CFLAGS includes ARCH_FLAG

author: Nobuyoshi Nakada <nobu@ruby-lang.org> 2021-01-26 22:01:07 +0900
committer: Nobuyoshi Nakada <nobu@ruby-lang.org> 2021-01-26 22:19:00 +0900
commit: ed6dc066b6247465c2bc55a39c2a837e53d2d4d0 (patch)
tree: 5f799585265f7d094187417350c618553d60b49a /spec/ruby/library/date/yday_spec.rb
parent: b091889ed67f278b1652ddde88596e2160d5aef0 (diff)
0 files changed, 0 insertions, 0 deletions
diff --git a/.cvsignore b/.cvsignore
deleted file mode 100644
index a72211d03f..0000000000
--- a/.cvsignore
+++ /dev/null
@@ -1,48 +0,0 @@
-*.bak
-*.orig
-*.rej
-*.sav
-*~
-.*.list
-.*.time
-.ccmalloc
-.ppack
-.ext
-.git
-.svn
-.pc
-COPYING.LIB
-ChangeLog.pre-alpha
-ChangeLog.pre1_1
-Makefile
-README.fat-patch
-README.v6
-README.atheos
-archive
-autom4te*.cache
-automake
-beos
-config.cache
-config.h
-config.h.in
-config.log
-config.status
-configure
-libruby.so.*
-miniruby
-newdate.rb
-newver.rb
-parse.c
-patches
-ppack
-preview
-rbconfig.rb
-repack
-riscos
-rubicon
-ruby
-ruby-man.rd.gz
-tmp
-web
-y.output
-y.tab.c
diff --git a/.document b/.document
index 230c50e387..fb27ba325d 100644
--- a/.document
+++ b/.document
@@ -6,11 +6,21 @@
 # Process all the C source files
 *.c
 
-# the lib/ directory (which has its own .document file)
+# prelude
+prelude.rb
 
+# the lib/ directory (which has its own .document file)
 lib
 
-
 # and some of the ext/ directory (which has its own .document file)
-
 ext
+
+# rdoc files
+ChangeLog
+
+NEWS
+
+README.md
+README.ja.md
+
+doc
diff --git a/.editorconfig b/.editorconfig
new file mode 100644
index 0000000000..67abf4b978
--- /dev/null
+++ b/.editorconfig
@@ -0,0 +1,16 @@
+root = true
+
+[*]
+end_of_line = lf
+insert_final_newline = true
+trim_trailing_whitespace = true
+tab_width = 8
+indent_style = tab
+indent_size = 4
+
+[**.bat]
+end_of_line = crlf
+
+[**.rb]
+indent_style = space
+indent_size = 2
diff --git a/.gdbinit b/.gdbinit
new file mode 100644
index 0000000000..03c2b653cb
--- /dev/null
+++ b/.gdbinit
@@ -0,0 +1,966 @@
+define hook-run
+  set $color_type = 0
+  set $color_highlite = 0
+  set $color_end = 0
+end
+
+define ruby_gdb_init
+  if !$color_type
+    set $color_type = "\033[31m"
+  end
+  if !$color_highlite
+    set $color_highlite = "\033[36m"
+  end
+  if !$color_end
+    set $color_end = "\033[m"
+  end
+  if ruby_dummy_gdb_enums.special_consts
+  end
+end
+
+# set prompt \033[36m(gdb)\033[m\040
+
+define rp
+  ruby_gdb_init
+  if (VALUE)($arg0) & RUBY_FIXNUM_FLAG
+    printf "FIXNUM: %ld\n", (long)($arg0) >> 1
+  else
+  if ((VALUE)($arg0) & ~(~(VALUE)0<<RUBY_SPECIAL_SHIFT)) == RUBY_SYMBOL_FLAG
+    set $id = (($arg0) >> RUBY_SPECIAL_SHIFT)
+    printf "%sSYMBOL%s: ", $color_type, $color_end
+    rp_id $id
+  else
+  if ($arg0) == RUBY_Qfalse
+    echo false\n
+  else
+  if ($arg0) == RUBY_Qtrue
+    echo true\n
+  else
+  if ($arg0) == RUBY_Qnil
+    echo nil\n
+  else
+  if ($arg0) == RUBY_Qundef
+    echo undef\n
+  else
+  if (VALUE)($arg0) & RUBY_IMMEDIATE_MASK
+    if ((VALUE)($arg0) & RUBY_FLONUM_MASK) == RUBY_FLONUM_FLAG
+      printf "%sFLONUM%s: %g\n", $color_type, $color_end, (double)rb_float_value($arg0)
+    else
+      echo immediate\n
+    end
+  else
+  set $flags = ((struct RBasic*)($arg0))->flags
+  if ($flags & RUBY_FL_PROMOTED) == RUBY_FL_PROMOTED
+    printf "[PROMOTED] "
+  end
+  if ($flags & RUBY_T_MASK) == RUBY_T_NONE
+    printf "%sT_NONE%s: ", $color_type, $color_end
+    print (struct RBasic *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_NIL
+    printf "%sT_NIL%s: ", $color_type, $color_end
+    print (struct RBasic *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_OBJECT
+    printf "%sT_OBJECT%s: ", $color_type, $color_end
+    print (struct RObject *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_CLASS
+    printf "%sT_CLASS%s%s: ", $color_type, ($flags & RUBY_FL_SINGLETON) ? "*" : "", $color_end
+    rp_class $arg0
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_ICLASS
+    printf "%sT_ICLASS%s: ", $color_type, $color_end
+    rp_class $arg0
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_MODULE
+    printf "%sT_MODULE%s: ", $color_type, $color_end
+    rp_class $arg0
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_FLOAT
+    printf "%sT_FLOAT%s: %.16g ", $color_type, $color_end, (((struct RFloat*)($arg0))->float_value)
+    print (struct RFloat *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_STRING
+    printf "%sT_STRING%s: ", $color_type, $color_end
+    rp_string $arg0 $flags
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_REGEXP
+    set $regsrc = ((struct RRegexp*)($arg0))->src
+    set $rsflags = ((struct RBasic*)$regsrc)->flags
+    printf "%sT_REGEXP%s: ", $color_type, $color_end
+    set print address off
+    output (char *)(($rsflags & RUBY_FL_USER1) ? \
+	    ((struct RString*)$regsrc)->as.heap.ptr : \
+	    ((struct RString*)$regsrc)->as.ary)
+    set print address on
+    printf " len:%ld ", ($rsflags & RUBY_FL_USER1) ? \
+            ((struct RString*)$regsrc)->as.heap.len : \
+            (($rsflags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
+    if $flags & RUBY_FL_USER6
+      printf "(none) "
+    end
+    if $flags & RUBY_FL_USER5
+      printf "(literal) "
+    end
+    if $flags & RUBY_FL_USER4
+      printf "(fixed) "
+    end
+    printf "encoding:%d ", ($flags & RUBY_ENCODING_MASK) >> RUBY_ENCODING_SHIFT
+    print (struct RRegexp *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_ARRAY
+    if ($flags & RUBY_FL_USER1)
+      set $len = (($flags & (RUBY_FL_USER3|RUBY_FL_USER4)) >> (RUBY_FL_USHIFT+3))
+      printf "%sT_ARRAY%s: len=%ld ", $color_type, $color_end, $len
+      printf "(embed) "
+      if ($len == 0)
+	printf "{(empty)} "
+      else
+	output/x *((VALUE*)((struct RArray*)($arg0))->as.ary) @ $len
+	printf " "
+      end
+    else
+      set $len = ((struct RArray*)($arg0))->as.heap.len
+      printf "%sT_ARRAY%s: len=%ld ", $color_type, $color_end, $len
+      if ($flags & RUBY_FL_USER2)
+	printf "(shared) shared="
+	output/x ((struct RArray*)($arg0))->as.heap.aux.shared
+	printf " "
+      else
+	printf "(ownership) capa=%ld ", ((struct RArray*)($arg0))->as.heap.aux.capa
+      end
+      if ($len == 0)
+	printf "{(empty)} "
+      else
+	output/x *((VALUE*)((struct RArray*)($arg0))->as.heap.ptr) @ $len
+	printf " "
+      end
+    end
+    print (struct RArray *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_FIXNUM
+    printf "%sT_FIXNUM%s: ", $color_type, $color_end
+    print (struct RBasic *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_HASH
+    printf "%sT_HASH%s: ", $color_type, $color_end,
+    if ((struct RHash *)($arg0))->ntbl
+      printf "len=%ld ", ((struct RHash *)($arg0))->ntbl->num_entries
+    end
+    print (struct RHash *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_STRUCT
+    printf "%sT_STRUCT%s: len=%ld ", $color_type, $color_end, \
+      (($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
+       ($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) >> (RUBY_FL_USHIFT+1) : \
+       ((struct RStruct *)($arg0))->as.heap.len)
+    print (struct RStruct *)($arg0)
+    x/xw (($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
+          ((struct RStruct *)($arg0))->as.ary : \
+          ((struct RStruct *)($arg0))->as.heap.ptr)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_BIGNUM
+    printf "%sT_BIGNUM%s: sign=%d len=%ld ", $color_type, $color_end, \
+      (($flags & RUBY_FL_USER1) != 0), \
+      (($flags & RUBY_FL_USER2) ? \
+       ($flags & (RUBY_FL_USER5|RUBY_FL_USER4|RUBY_FL_USER3)) >> (RUBY_FL_USHIFT+3) : \
+       ((struct RBignum*)($arg0))->as.heap.len)
+    if $flags & RUBY_FL_USER2
+      printf "(embed) "
+    end
+    print (struct RBignum *)($arg0)
+    x/xw (($flags & RUBY_FL_USER2) ? \
+          ((struct RBignum*)($arg0))->as.ary : \
+          ((struct RBignum*)($arg0))->as.heap.digits)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_RATIONAL
+    printf "%sT_RATIONAL%s: ", $color_type, $color_end
+    print (struct RRational *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_COMPLEX
+    printf "%sT_COMPLEX%s: ", $color_type, $color_end
+    print (struct RComplex *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_FILE
+    printf "%sT_FILE%s: ", $color_type, $color_end
+    print (struct RFile *)($arg0)
+    output *((struct RFile *)($arg0))->fptr
+    printf "\n"
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_TRUE
+    printf "%sT_TRUE%s: ", $color_type, $color_end
+    print (struct RBasic *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_FALSE
+    printf "%sT_FALSE%s: ", $color_type, $color_end
+    print (struct RBasic *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_DATA
+    if ((struct RTypedData *)($arg0))->typed_flag == 1
+      printf "%sT_DATA%s(%s): ", $color_type, $color_end, ((struct RTypedData *)($arg0))->type->wrap_struct_name
+      print (struct RTypedData *)($arg0)
+    else
+      printf "%sT_DATA%s: ", $color_type, $color_end
+      print (struct RData *)($arg0)
+    end
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_MATCH
+    printf "%sT_MATCH%s: ", $color_type, $color_end
+    print (struct RMatch *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_SYMBOL
+    printf "%sT_SYMBOL%s: ", $color_type, $color_end
+    print (struct RSymbol *)($arg0)
+    set $id_type = ((struct RSymbol *)($arg0))->id & RUBY_ID_SCOPE_MASK
+    if $id_type == RUBY_ID_LOCAL
+      printf "l"
+    else
+    if $id_type == RUBY_ID_INSTANCE
+      printf "i"
+    else
+    if $id_type == RUBY_ID_GLOBAL
+      printf "G"
+    else
+    if $id_type == RUBY_ID_ATTRSET
+      printf "a"
+    else
+    if $id_type == RUBY_ID_CONST
+      printf "C"
+    else
+    if $id_type == RUBY_ID_CLASS
+      printf "c"
+    else
+      printf "j"
+    end
+    end
+    end
+    end
+    end
+    end
+    set $id_fstr = ((struct RSymbol *)($arg0))->fstr
+    rp_string $id_fstr
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_UNDEF
+    printf "%sT_UNDEF%s: ", $color_type, $color_end
+    print (struct RBasic *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_IMEMO
+    printf "%sT_IMEMO%s(", $color_type, $color_end
+    output (enum imemo_type)(($flags>>RUBY_FL_USHIFT)&imemo_mask)
+    printf "): "
+    rp_imemo $arg0
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_NODE
+    printf "%sT_NODE%s(", $color_type, $color_end
+    output (enum node_type)(($flags&RUBY_NODE_TYPEMASK)>>RUBY_NODE_TYPESHIFT)
+    printf "): "
+    print *(NODE *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_ZOMBIE
+    printf "%sT_ZOMBIE%s: ", $color_type, $color_end
+    print (struct RData *)($arg0)
+  else
+    printf "%sunknown%s: ", $color_type, $color_end
+    print (struct RBasic *)($arg0)
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+end
+document rp
+  Print a Ruby's VALUE.
+end
+
+define rp_id
+  set $id = (ID)$arg0
+  if $id == '!' || $id == '+' || $id == '-' || $id == '*' || $id == '/' || $id == '%' || $id == '<' || $id == '>' || $id == '`'
+    printf "(:%c)\n", $id
+  else
+  if $id == idDot2
+    printf "(:..)\n"
+  else
+  if $id == idDot3
+    printf "(:...)\n"
+  else
+  if $id == idUPlus
+    printf "(:+@)\n"
+  else
+  if $id == idUMinus
+    printf "(:-@)\n"
+  else
+  if $id == idPow
+    printf "(:**)\n"
+  else
+  if $id == idCmp
+    printf "(:<=>)\n"
+  else
+  if $id == idLTLT
+    printf "(:<<)\n"
+  else
+  if $id == idLE
+    printf "(:<=)\n"
+  else
+  if $id == idGE
+    printf "(:>=)\n"
+  else
+  if $id == idEq
+    printf "(:==)\n"
+  else
+  if $id == idEqq
+    printf "(:===)\n"
+  else
+  if $id == idNeq
+    printf "(:!=)\n"
+  else
+  if $id == idEqTilde
+    printf "(:=~)\n"
+  else
+  if $id == idNeqTilde
+    printf "(:!~)\n"
+  else
+  if $id == idAREF
+    printf "(:[])\n"
+  else
+  if $id == idASET
+    printf "(:[]=)\n"
+  else
+    if $id <= tLAST_OP_ID
+      printf "O"
+    else
+      set $id_type = $id & RUBY_ID_SCOPE_MASK
+      if $id_type == RUBY_ID_LOCAL
+        printf "l"
+      else
+      if $id_type == RUBY_ID_INSTANCE
+        printf "i"
+      else
+      if $id_type == RUBY_ID_GLOBAL
+        printf "G"
+      else
+      if $id_type == RUBY_ID_ATTRSET
+        printf "a"
+      else
+      if $id_type == RUBY_ID_CONST
+        printf "C"
+      else
+      if $id_type == RUBY_ID_CLASS
+        printf "c"
+      else
+        printf "j"
+      end
+      end
+      end
+      end
+      end
+      end
+    end
+    printf "(%ld): ", $id
+    set $str = lookup_id_str($id)
+    if $str
+      rp_string $str
+    else
+      echo undef\n
+    end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+end
+document rp_id
+  Print an ID.
+end
+
+define rp_string
+  set $flags = ((struct RBasic*)($arg0))->flags
+  set print address off
+  output (char *)(($flags & RUBY_FL_USER1) ? \
+	    ((struct RString*)($arg0))->as.heap.ptr : \
+	    ((struct RString*)($arg0))->as.ary)
+  set print address on
+  printf " bytesize:%ld ", ($flags & RUBY_FL_USER1) ? \
+          ((struct RString*)($arg0))->as.heap.len : \
+          (($flags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
+  if !($flags & RUBY_FL_USER1)
+    printf "(embed) "
+  else
+    if ($flags & RUBY_FL_USER2)
+      printf "(shared) "
+    end
+    if ($flags & RUBY_FL_USER3)
+      printf "(assoc) "
+    end
+  end
+  printf "encoding:%d ", ($flags & RUBY_ENCODING_MASK) >> RUBY_ENCODING_SHIFT
+  if ($flags & RUBY_ENC_CODERANGE_MASK) == 0
+    printf "coderange:unknown "
+  else
+  if ($flags & RUBY_ENC_CODERANGE_MASK) == RUBY_ENC_CODERANGE_7BIT
+    printf "coderange:7bit "
+  else
+  if ($flags & RUBY_ENC_CODERANGE_MASK) == RUBY_ENC_CODERANGE_VALID
+    printf "coderange:valid "
+  else
+    printf "coderange:broken "
+  end
+  end
+  end
+  print (struct RString *)($arg0)
+end
+document rp_string
+  Print the content of a String.
+end
+
+define rp_class
+  printf "(struct RClass *) %p", (void*)$arg0
+  if ((struct RClass *)($arg0))->ptr.origin_ != $arg0
+    printf " -> %p", ((struct RClass *)($arg0))->ptr.origin_
+  end
+  printf "\n"
+  rb_classname $arg0
+  print *(struct RClass *)($arg0)
+  print *((struct RClass *)($arg0))->ptr
+end
+document rp_class
+  Print the content of a Class/Module.
+end
+
+define rp_imemo
+  set $flags = (((struct RBasic *)($arg0))->flags >> RUBY_FL_USHIFT) & imemo_mask
+  if $flags == imemo_cref
+    printf "(rb_cref_t *) %p\n", (void*)$arg0
+    print *(rb_cref_t *)$arg0
+  else
+  if $flags == imemo_svar
+    printf "(struct vm_svar *) %p\n", (void*)$arg0
+    print *(struct vm_svar *)$arg0
+  else
+  if $flags == imemo_throw_data
+    printf "(struct vm_throw_data *) %p\n", (void*)$arg0
+    print *(struct vm_throw_data *)$arg0
+  else
+  if $flags == imemo_ifunc
+    printf "(struct vm_ifunc *) %p\n", (void*)$arg0
+    print *(struct vm_ifunc *)$arg0
+  else
+  if $flags == imemo_memo
+    printf "(struct MEMO *) %p\n", (void*)$arg0
+    print *(struct MEMO *)$arg0
+  else
+    printf "(struct RIMemo *) %p\n", (void*)$arg0
+    print *(struct RIMemo *)$arg0
+  end
+  end
+  end
+  end
+  end
+end
+document rp_imemo
+  Print the content of a memo
+end
+
+define nd_type
+  print (enum node_type)((((NODE*)($arg0))->flags&RUBY_NODE_TYPEMASK)>>RUBY_NODE_TYPESHIFT)
+end
+document nd_type
+  Print a Ruby' node type.
+end
+
+define nd_file
+  print ((NODE*)($arg0))->nd_file
+end
+document nd_file
+  Print the source file name of a node.
+end
+
+define nd_line
+  print ((unsigned int)((((NODE*)($arg0))->flags>>RUBY_NODE_LSHIFT)&RUBY_NODE_LMASK))
+end
+document nd_line
+  Print the source line number of a node.
+end
+
+# Print members of ruby node.
+
+define nd_head
+  printf "%su1.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u1.node
+end
+
+define nd_alen
+  printf "%su2.argc%s: ", $color_highlite, $color_end
+  p ($arg0).u2.argc
+end
+
+define nd_next
+  printf "%su3.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u3.node
+end
+
+
+define nd_cond
+  printf "%su1.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u1.node
+end
+
+define nd_body
+  printf "%su2.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u2.node
+end
+
+define nd_else
+  printf "%su3.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u3.node
+end
+
+
+define nd_orig
+  printf "%su3.value%s: ", $color_highlite, $color_end
+  rp ($arg0).u3.value
+end
+
+
+define nd_resq
+  printf "%su2.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u2.node
+end
+
+define nd_ensr
+  printf "%su3.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u3.node
+end
+
+
+define nd_1st
+  printf "%su1.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u1.node
+end
+
+define nd_2nd
+  printf "%su2.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u2.node
+end
+
+
+define nd_stts
+  printf "%su1.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u1.node
+end
+
+
+define nd_entry
+  printf "%su3.entry%s: ", $color_highlite, $color_end
+  p ($arg0).u3.entry
+end
+
+define nd_vid
+  printf "%su1.id%s: ", $color_highlite, $color_end
+  p ($arg0).u1.id
+end
+
+define nd_cflag
+  printf "%su2.id%s: ", $color_highlite, $color_end
+  p ($arg0).u2.id
+end
+
+define nd_cval
+  printf "%su3.value%s: ", $color_highlite, $color_end
+  rp ($arg0).u3.value
+end
+
+
+define nd_cnt
+  printf "%su3.cnt%s: ", $color_highlite, $color_end
+  p ($arg0).u3.cnt
+end
+
+define nd_tbl
+  printf "%su1.tbl%s: ", $color_highlite, $color_end
+  p ($arg0).u1.tbl
+end
+
+
+define nd_var
+  printf "%su1.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u1.node
+end
+
+define nd_ibdy
+  printf "%su2.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u2.node
+end
+
+define nd_iter
+  printf "%su3.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u3.node
+end
+
+
+define nd_value
+  printf "%su2.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u2.node
+end
+
+define nd_aid
+  printf "%su3.id%s: ", $color_highlite, $color_end
+  p ($arg0).u3.id
+end
+
+
+define nd_lit
+  printf "%su1.value%s: ", $color_highlite, $color_end
+  rp ($arg0).u1.value
+end
+
+
+define nd_frml
+  printf "%su1.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u1.node
+end
+
+define nd_rest
+  printf "%su2.argc%s: ", $color_highlite, $color_end
+  p ($arg0).u2.argc
+end
+
+define nd_opt
+  printf "%su1.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u1.node
+end
+
+
+define nd_recv
+  printf "%su1.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u1.node
+end
+
+define nd_mid
+  printf "%su2.id%s: ", $color_highlite, $color_end
+  p ($arg0).u2.id
+end
+
+define nd_args
+  printf "%su3.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u3.node
+end
+
+
+define nd_noex
+  printf "%su1.id%s: ", $color_highlite, $color_end
+  p ($arg0).u1.id
+end
+
+define nd_defn
+  printf "%su3.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u3.node
+end
+
+
+define nd_old
+  printf "%su1.id%s: ", $color_highlite, $color_end
+  p ($arg0).u1.id
+end
+
+define nd_new
+  printf "%su2.id%s: ", $color_highlite, $color_end
+  p ($arg0).u2.id
+end
+
+
+define nd_cfnc
+  printf "%su1.cfunc%s: ", $color_highlite, $color_end
+  p ($arg0).u1.cfunc
+end
+
+define nd_argc
+  printf "%su2.argc%s: ", $color_highlite, $color_end
+  p ($arg0).u2.argc
+end
+
+
+define nd_cname
+  printf "%su1.id%s: ", $color_highlite, $color_end
+  p ($arg0).u1.id
+end
+
+define nd_super
+  printf "%su3.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u3.node
+end
+
+
+define nd_modl
+  printf "%su1.id%s: ", $color_highlite, $color_end
+  p ($arg0).u1.id
+end
+
+define nd_clss
+  printf "%su1.value%s: ", $color_highlite, $color_end
+  rp ($arg0).u1.value
+end
+
+
+define nd_beg
+  printf "%su1.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u1.node
+end
+
+define nd_end
+  printf "%su2.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u2.node
+end
+
+define nd_state
+  printf "%su3.state%s: ", $color_highlite, $color_end
+  p ($arg0).u3.state
+end
+
+define nd_rval
+  printf "%su2.value%s: ", $color_highlite, $color_end
+  rp ($arg0).u2.value
+end
+
+
+define nd_nth
+  printf "%su2.argc%s: ", $color_highlite, $color_end
+  p ($arg0).u2.argc
+end
+
+
+define nd_tag
+  printf "%su1.id%s: ", $color_highlite, $color_end
+  p ($arg0).u1.id
+end
+
+define nd_tval
+  printf "%su2.value%s: ", $color_highlite, $color_end
+  rp ($arg0).u2.value
+end
+
+define nd_tree
+  set $buf = (struct RString *)rb_str_buf_new(0)
+  call dump_node((VALUE)($buf), rb_str_new(0, 0), 0, ($arg0))
+  printf "%s\n", $buf->as.heap.ptr
+end
+
+define rb_p
+  call rb_p($arg0)
+end
+
+define rb_numtable_entry
+  set $rb_numtable_tbl = $arg0
+  set $rb_numtable_id = (st_data_t)$arg1
+  set $rb_numtable_key = 0
+  set $rb_numtable_rec = 0
+  if $rb_numtable_tbl->entries_packed
+    set $rb_numtable_p = $rb_numtable_tbl->as.packed.bins
+    while $rb_numtable_p && $rb_numtable_p < $rb_numtable_tbl->as.packed.bins+$rb_numtable_tbl->num_entries
+      if $rb_numtable_p.k == $rb_numtable_id
+	set $rb_numtable_key = $rb_numtable_p.k
+	set $rb_numtable_rec = $rb_numtable_p.v
+	set $rb_numtable_p = 0
+      else
+	set $rb_numtable_p = $rb_numtable_p + 1
+      end
+    end
+  else
+    set $rb_numtable_p = $rb_numtable_tbl->as.big.bins[st_numhash($rb_numtable_id) % $rb_numtable_tbl->num_bins]
+    while $rb_numtable_p
+      if $rb_numtable_p->key == $rb_numtable_id
+	set $rb_numtable_key = $rb_numtable_p->key
+	set $rb_numtable_rec = $rb_numtable_p->record
+	set $rb_numtable_p = 0
+      else
+	set $rb_numtable_p = $rb_numtable_p->next
+      end
+    end
+  end
+end
+
+define rb_id2name
+  ruby_gdb_init
+  printf "%sID%s: ", $color_type, $color_end
+  rp_id $arg0
+end
+document rb_id2name
+  Print the name of id
+end
+
+define rb_method_entry
+  set $rb_method_entry_klass = (struct RClass *)$arg0
+  set $rb_method_entry_id = (ID)$arg1
+  set $rb_method_entry_me = (rb_method_entry_t *)0
+  while !$rb_method_entry_me && $rb_method_entry_klass
+    rb_numtable_entry $rb_method_entry_klass->m_tbl_wrapper->tbl $rb_method_entry_id
+    set $rb_method_entry_me = (rb_method_entry_t *)$rb_numtable_rec
+    if !$rb_method_entry_me
+      set $rb_method_entry_klass = (struct RClass *)RCLASS_SUPER($rb_method_entry_klass)
+    end
+  end
+  if $rb_method_entry_me
+    print *$rb_method_entry_klass
+    print *$rb_method_entry_me
+  else
+    echo method not found\n
+  end
+end
+document rb_method_entry
+  Search method entry by class and id
+end
+
+define rb_classname
+  # up to 128bit int
+  set $rb_classname_permanent = "0123456789ABCDEF"
+  set $rb_classname = classname($arg0, $rb_classname_permanent)
+  if $rb_classname != RUBY_Qnil
+    rp $rb_classname
+  else
+    echo anonymous class/module\n
+  end
+end
+
+define rb_ancestors
+  set $rb_ancestors_module = $arg0
+  while $rb_ancestors_module
+    rp_class $rb_ancestors_module
+    set $rb_ancestors_module = RCLASS_SUPER($rb_ancestors_module)
+  end
+end
+document rb_ancestors
+  Print ancestors.
+end
+
+define rb_backtrace
+  call rb_backtrace()
+end
+
+define iseq
+  if ruby_dummy_gdb_enums.special_consts
+  end
+  if ($arg0)->type == ISEQ_ELEMENT_NONE
+    echo [none]\n
+  end
+  if ($arg0)->type == ISEQ_ELEMENT_LABEL
+    print *(LABEL*)($arg0)
+  end
+  if ($arg0)->type == ISEQ_ELEMENT_INSN
+    print *(INSN*)($arg0)
+    if ((INSN*)($arg0))->insn_id != YARVINSN_jump
+      set $i = 0
+      set $operand_size = ((INSN*)($arg0))->operand_size
+      set $operands = ((INSN*)($arg0))->operands
+      while $i < $operand_size
+	rp $operands[$i++]
+      end
+    end
+  end
+  if ($arg0)->type == ISEQ_ELEMENT_ADJUST
+    print *(ADJUST*)($arg0)
+  end
+end
+
+define rb_ps
+  rb_ps_vm ruby_current_vm
+end
+document rb_ps
+Dump all threads and their callstacks
+end
+
+define rb_ps_vm
+  print $ps_vm = (rb_vm_t*)$arg0
+  set $ps_thread_ln = $ps_vm->living_threads.n.next
+  set $ps_thread_ln_last = $ps_vm->living_threads.n.prev
+  while 1
+    set $ps_thread_th = (rb_thread_t *)$ps_thread_ln
+    set $ps_thread = (VALUE)($ps_thread_th->self)
+    rb_ps_thread $ps_thread
+    if $ps_thread_ln == $ps_thread_ln_last
+      loop_break
+    end
+    set $ps_thread_ln = $ps_thread_ln->next
+  end
+end
+document rb_ps_vm
+Dump all threads in a (rb_vm_t*) and their callstacks
+end
+
+define rb_ps_thread
+  set $ps_thread = (struct RTypedData*)$arg0
+  set $ps_thread_th = (rb_thread_t*)$ps_thread->data
+  printf "* #<Thread:%p rb_thread_t:%p native_thread:%p>\n", \
+    $ps_thread, $ps_thread_th, $ps_thread_th->thread_id
+end
+
+# Details: https://bugs.ruby-lang.org/projects/ruby-trunk/wiki/MachineInstructionsTraceWithGDB
+define trace_machine_instructions
+  set logging on
+  set height 0
+  set width 0
+  display/i $pc
+  while !$exit_code
+    info line *$pc
+    si
+  end
+end
+
+define SDR
+  call rb_vmdebug_stack_dump_raw_current()
+end
+
+define rbi
+  if ((LINK_ELEMENT*)$arg0)->type == ISEQ_ELEMENT_LABEL
+    p *(LABEL*)$arg0
+  else
+  if ((LINK_ELEMENT*)$arg0)->type == ISEQ_ELEMENT_INSN
+    p *(INSN*)$arg0
+  else
+  if ((LINK_ELEMENT*)$arg0)->type == ISEQ_ELEMENT_ADJUST
+    p *(ADJUST*)$arg0
+  else
+    print *$arg0
+  end
+  end
+  end
+end
diff --git a/.gitattributes b/.gitattributes
new file mode 100644
index 0000000000..d9785fad00
--- /dev/null
+++ b/.gitattributes
@@ -0,0 +1,5 @@
+*.gemspec diff=ruby
+*.rb diff=ruby
+bin/* diff=ruby
+tool/update-deps diff=ruby
+tool/make-snapshot diff=ruby
diff --git a/.gitignore b/.gitignore
new file mode 100644
index 0000000000..80c12594dd
--- /dev/null
+++ b/.gitignore
@@ -0,0 +1,183 @@
+*-*-*.def
+*-*-*.exp
+*-*-*.lib
+*.a
+*.bak
+*.dSYM
+*.dmyh
+*.dylib
+*.elc
+*.inc
+*.log
+*.o
+*.obj
+*.orig
+*.pdb
+*.rej
+*.sav
+*.swp
+*.yarb
+*~
+.*-*
+.*.list
+.*.time
+.DS_Store
+.ccmalloc
+.ext
+.pc
+.ppack
+.svn
+Makefile
+Makefile.old
+cygruby*.def
+extconf.h
+y.output
+y.tab.c
+
+# /
+/*-fake.rb
+/*.dll
+/*.exe
+/*.res
+/*.pc
+/*.rc
+/*_prelude.c
+/COPYING.LIB
+/ChangeLog-*
+/ChangeLog.pre-alpha
+/ChangeLog.pre1_1
+/Doxyfile
+/GNUmakefile
+/GNUmakefile.old
+/README.atheos
+/README.fat-patch
+/README.v6
+/TAGS
+/archive
+/autom4te*.cache
+/automake
+/beos
+/bmlog-*
+/breakpoints.gdb
+/config.cache
+/config.h
+/config.h.in
+/config.status
+/config.status.lineno
+/configure
+/coverage/simplecov
+/coverage/simplecov-html
+/coverage/doclie
+/coverage/.last_run.json
+/coverage/.resultset.json*
+/coverage/assets
+/coverage/index.html
+/doc/capi
+/enc.mk
+/encdb.h
+/exts.mk
+/goruby
+/id.[ch]
+/largefile.h
+/lex.c
+/libruby*.*
+/miniprelude.c
+/miniruby
+/newdate.rb
+/newline.c
+/newver.rb
+/parse.c
+/parse.h
+/patches
+/patches-master
+/pitest.rb
+/ppack
+/prelude.c
+/preview
+/probes.h
+/rbconfig.rb
+/rename2.h
+/repack
+/revision.h
+/riscos
+/rubicon
+/ruby
+/ruby-runner
+/ruby-runner.c
+/ruby-man.rd.gz
+/sizes.c
+/test.rb
+/tmp
+/transdb.h
+/uncommon.mk
+/verconf.h
+/verconf.mk
+/web
+/yasmdata.rb
+
+# /benchmark/
+/benchmark/bmx_*.rb
+/benchmark/fasta.output.*
+/benchmark/wc.input
+
+/enc/*.def
+/enc/*.exp
+/enc/*.lib
+/enc/unicode/data
+
+# /enc/trans/
+/enc/trans/*.c
+/enc/trans/*.def
+/enc/trans/*.exp
+/enc/trans/*.lib
+/enc/trans/.time
+
+# /ext/
+/ext/extinit.c
+
+# /ext/-test-/win32/dln/
+/ext/-test-/win32/dln/dlntest.exp
+/ext/-test-/win32/dln/dlntest.lib
+
+# /ext/dl/callback/
+/ext/dl/callback/callback-*.c
+/ext/dl/callback/callback.c
+
+# /ext/etc/
+/ext/etc/constdefs.h
+
+# /ext/fiddle/
+/ext/fiddle/libffi-*
+
+# /ext/rbconfig/
+/ext/rbconfig/sizeof/sizes.c
+
+# /ext/ripper/
+/ext/ripper/eventids1.c
+/ext/ripper/eventids2table.c
+/ext/ripper/ripper.*
+/ext/ripper/ids1
+/ext/ripper/ids2
+
+# /ext/socket/
+/ext/socket/constants.h
+/ext/socket/constdefs.h
+/ext/socket/constdefs.c
+
+# /ext/tk/
+/ext/tk/config_list
+
+# /gems
+/gems/*.gem
+
+# /spec/
+/spec/mspec
+/spec/rubyspec
+
+# /tool/
+/tool/config.guess
+/tool/config.sub
+
+# /win32/
+/win32/*.ico
+/win32/.time
diff --git a/.indent.pro b/.indent.pro
new file mode 100644
index 0000000000..6a207a0554
--- /dev/null
+++ b/.indent.pro
@@ -0,0 +1,21 @@
+-bap
+-nbbb
+-nbc
+-br
+-nbs
+-ncdb
+-ce
+-cli0.5
+-ndj
+-ei
+-nfc1
+-i4
+-l120
+-lp
+-npcs
+-psl
+-sc
+-sob
+
+-TID
+-TVALUE
diff --git a/.travis.yml b/.travis.yml
new file mode 100644
index 0000000000..f87ffd3483
--- /dev/null
+++ b/.travis.yml
@@ -0,0 +1,101 @@
+# Copyright (C) 2011 Urabe, Shyouhei.  All rights reserved.
+#
+# This file is  a part of the programming language  Ruby.  Permission is hereby
+# granted,  to either  redistribute  or  modify this  file,  provided that  the
+# conditions  mentioned in  the file  COPYING are  met.  Consult  the  file for
+# details.
+
+# This is  a Travis-CI  build configuration file.   The list  of configurations
+# available is located in
+#
+#     http://about.travis-ci.org/docs/user/build-configuration/
+#
+# and as Ruby itself is a project written in C language,
+#
+#     http://about.travis-ci.org/docs/user/languages/c/
+#
+# is also a good place to look at.
+
+# Language specification.
+language: c
+sudo: false
+
+# Compilers.  Several  compilers are  provided in Travis,  so we try  them all.
+# The value set here is visible via $CC environment variable.
+compiler:
+  - gcc
+
+os:
+  - linux
+
+# Dependencies.  Some  header files are missing  in a Travis' worker  VM, so we
+# have  to install  them.  The  "1.9.1" here  is OK.   It is  the  most adopted
+# version string  for Debian/Ubuntu, and  no dependencies have been  changed so
+# far since the 1.9.1 release.
+before_install:
+  - "CONFIG_FLAG="
+  - "JOBS='-j 4'"
+
+# Script is where the test runs.  Note  we just do "make test", not other tests
+# like  test-all, test-rubyspec.   This is  because  they take  too much  time,
+# enough for Travis to shut down the VM as being stalled.
+before_script:
+  - "uname -a"
+  - "uname -r"
+  - "rm -fr .ext autom4te.cache"
+  - "echo $TERM"
+  - "make -f common.mk BASERUBY=ruby MAKEDIRS='mkdir -p' srcdir=. update-config_files"
+  - "autoconf"
+  - "mkdir config_1st config_2nd"
+  - "./configure -C --disable-install-doc --with-gcc=$CC $CONFIG_FLAG"
+  - "cp -pr config.status .ext/include config_1st"
+  - "make reconfig"
+  - "cp -pr config.status .ext/include config_2nd"
+  - "diff -ru config_1st config_2nd"
+  - "make after-update BASERUBY=ruby"
+  - "make -s $JOBS"
+  - "make update-rubyspec"
+script:
+  - "make test TESTOPTS=--color=never"
+  - "make test-all TESTOPTS='-q -j3 --color=never --job-status=normal'"
+  - "make test-rubyspec MSPECOPT=-fm"
+
+# Branch matrix.  Not all branches are Travis-ready so we limit branches here.
+branches:
+  only:
+    - trunk
+    - ruby_2_0_0
+    - ruby_2_1
+    - ruby_2_2
+    - ruby_2_3
+
+# We want to be notified when something happens.
+notifications:
+  irc:
+    channels:
+      - "irc.freenode.org#ruby-core"
+      - "irc.freenode.org#ruby-ja"
+    on_success: change # [always|never|change] # default: always
+    on_failure: always # [always|never|change] # default: always
+    template:
+      - "%{message} by @%{author}: See %{build_url}"
+
+  # Update ruby-head installed on Travis CI so other projects can test against it.
+  webhooks:
+    urls:
+      - "https://rubies.travis-ci.org/rebuild/ruby-head"
+    on_success: always
+    on_failure: never
+
+  email:
+    - ko1c-failure@atdot.net
+    - shibata.hiroshi@gmail.com
+
+# Local Variables:
+# mode: YAML
+# coding: utf-8-unix
+# indent-tabs-mode: nil
+# tab-width: 4
+# fill-column: 79
+# default-justification: full
+# End:
diff --git a/BSDL b/BSDL
new file mode 100644
index 0000000000..a009caefea
--- /dev/null
+++ b/BSDL
@@ -0,0 +1,22 @@
+Copyright (C) 1993-2013 Yukihiro Matsumoto. All rights reserved.
+
+Redistribution and use in source and binary forms, with or without
+modification, are permitted provided that the following conditions
+are met:
+1. Redistributions of source code must retain the above copyright
+notice, this list of conditions and the following disclaimer.
+2. Redistributions in binary form must reproduce the above copyright
+notice, this list of conditions and the following disclaimer in the
+documentation and/or other materials provided with the distribution.
+
+THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+SUCH DAMAGE.
diff --git a/CONTRIBUTING.md b/CONTRIBUTING.md
new file mode 100644
index 0000000000..ffdf2dd4b8
--- /dev/null
+++ b/CONTRIBUTING.md
@@ -0,0 +1,4 @@
+Please see the [official issue tracker] and wiki [HowToContribute].
+
+[official issue tracker]: https://bugs.ruby-lang.org
+[HowToContribute]: https://bugs.ruby-lang.org/projects/ruby/wiki/HowToContribute
diff --git a/COPYING b/COPYING
index 9043404a83..a1f19ff99d 100644
--- a/COPYING
+++ b/COPYING
@@ -1,6 +1,6 @@
 Ruby is copyrighted free software by Yukihiro Matsumoto <matz@netlab.jp>.
-You can redistribute it and/or modify it under either the terms of the GPL
-version 2 (see the file GPL), or the conditions below:
+You can redistribute it and/or modify it under either the terms of the
+2-clause BSDL (see the file BSDL), or the conditions below:
 
   1. You may make and give away verbatim copies of the source form of the
      software without restriction, provided that you duplicate all of the
diff --git a/COPYING.ja b/COPYING.ja
index 933cc7cb9a..e50d01c8d1 100644
--- a/COPYING.ja
+++ b/COPYING.ja
@@ -1,51 +1,51 @@
-$BK\%W%m%0%i%`$O%U%j!<%=%U%H%&%'%"$G$9!%(BGPL(the GNU General
-Public License)$B$^$?$O0J2<$K<($9>r7o$GK\%W%m%0%i%`$r:FG[I[$G(B
-$B$-$^$9!%(BGPL$B$K$D$$$F$O(BGPL$B%U%!%$%k$r;2>H$7$F2<$5$$!%(B
+本プログラムはフリーソフトウェアです．2-clause BSDL
+または以下に示す条件で本プログラムを再配布できます
+2-clause BSDLについてはBSDLファイルを参照して下さい．
 
-  1. $BJ#@=$O@)8B$J$/<+M3$G$9!%(B
+  1. 複製は制限なく自由です．
 
-  2. $B0J2<$N>r7o$N$$$:$l$+$rK~$?$9;~$KK\%W%m%0%i%`$N%=!<%9$r(B
-     $B<+M3$KJQ99$G$-$^$9!%(B
+  2. 以下の条件のいずれかを満たす時に本プログラムのソースを
+     自由に変更できます．
 
-     (a) $B%M%C%H%K%e!<%:$K%]%9%H$7$?$j!$:n<T$KJQ99$rAwIU$9$k(B
-         $B$J$I$NJ}K!$G!$JQ99$r8x3+$9$k!%(B
+     (a) ネットニューズにポストしたり，作者に変更を送付する
+         などの方法で，変更を公開する．
 
-     (b) $BJQ99$7$?K\%W%m%0%i%`$r<+J,$N=jB0$9$kAH?%FbIt$@$1$G(B
-         $B;H$&!%(B
+     (b) 変更した本プログラムを自分の所属する組織内部だけで
+         使う．
 
-     (c) $BJQ99E@$rL@<($7$?$&$(!$%=%U%H%&%'%"$NL>A0$rJQ99$9$k!%(B
-         $B$=$N%=%U%H%&%'%"$rG[I[$9$k;~$K$OJQ99A0$NK\%W%m%0%i(B
-         $B%`$bF1;~$KG[I[$9$k!%$^$?$OJQ99A0$NK\%W%m%0%i%`$N%=!<(B
-         $B%9$NF~<jK!$rL@<($9$k!%(B
+     (c) 変更点を明示したうえ，ソフトウェアの名前を変更する．
+         そのソフトウェアを配布する時には変更前の本プログラ
+         ムも同時に配布する．または変更前の本プログラムのソー
+         スの入手法を明示する．
 
-     (d) $B$=$NB>$NJQ99>r7o$r:n<T$H9g0U$9$k!%(B
+     (d) その他の変更条件を作者と合意する．
 
-  3. $B0J2<$N>r7o$N$$$:$l$+$rK~$?$9;~$KK\%W%m%0%i%`$r%3%s%Q%$(B
-     $B%k$7$?%*%V%8%'%/%H%3!<%I$d<B9T7A<0$G$bG[I[$G$-$^$9!%(B
+  3. 以下の条件のいずれかを満たす時に本プログラムをコンパイ
+     ルしたオブジェクトコードや実行形式でも配布できます．
 
-     (a) $B%P%$%J%j$r<u$1<h$C$??M$,%=!<%9$rF~<j$G$-$k$h$&$K!$(B
-         $B%=!<%9$NF~<jK!$rL@<($9$k!%(B
+     (a) バイナリを受け取った人がソースを入手できるように，
+         ソースの入手法を明示する．
 
-     (b) $B5!3#2DFI$J%=!<%9%3!<%I$rE:IU$9$k!%(B
+     (b) 機械可読なソースコードを添付する．
 
-     (c) $BJQ99$r9T$C$?%P%$%J%j$OL>A0$rJQ99$7$?$&$(!$%*%j%8%J(B
-         $B%k$N%=!<%9%3!<%I$NF~<jK!$rL@<($9$k!%(B
+     (c) 変更を行ったバイナリは名前を変更したうえ，オリジナ
+         ルのソースコードの入手法を明示する．
 
-     (d) $B$=$NB>$NG[I[>r7o$r:n<T$H9g0U$9$k!%(B
+     (d) その他の配布条件を作者と合意する．
 
-  4. $BB>$N%W%m%0%i%`$X$N0zMQ$O$$$+$J$kL\E*$G$"$l<+M3$G$9!%$?(B
-     $B$@$7!$K\%W%m%0%i%`$K4^$^$l$kB>$N:n<T$K$h$k%3!<%I$O!$$=(B
-     $B$l$>$l$N:n<T$N0U8~$K$h$k@)8B$,2C$($i$l$k>l9g$,$"$j$^$9!%(B
+  4. 他のプログラムへの引用はいかなる目的であれ自由です．た
+     だし，本プログラムに含まれる他の作者によるコードは，そ
+     れぞれの作者の意向による制限が加えられる場合があります．
 
-     $B$=$l$i%U%!%$%k$N0lMw$H$=$l$>$l$NG[I[>r7o$J$I$KIU$$$F$O(B
-     LEGAL$B%U%!%$%k$r;2>H$7$F$/$@$5$$!%(B
+     それらファイルの一覧とそれぞれの配布条件などに付いては
+     LEGALファイルを参照してください．
 
-  5. $BK\%W%m%0%i%`$X$NF~NO$H$J$k%9%/%j%W%H$*$h$S!$K\%W%m%0%i(B
-     $B%`$+$i$N=PNO$N8"Mx$OK\%W%m%0%i%`$N:n<T$G$O$J$/!$$=$l$>(B
-     $B$l$NF~=PNO$r@8@.$7$??M$KB0$7$^$9!%$^$?!$K\%W%m%0%i%`$K(B
-     $BAH$_9~$^$l$k$?$a$N3HD%%i%$%V%i%j$K$D$$$F$bF1MM$G$9!%(B
+  5. 本プログラムへの入力となるスクリプトおよび，本プログラ
+     ムからの出力の権利は本プログラムの作者ではなく，それぞ
+     れの入出力を生成した人に属します．また，本プログラムに
+     組み込まれるための拡張ライブラリについても同様です．
 
-  6. $BK\%W%m%0%i%`$OL5J]>Z$G$9!%:n<T$OK\%W%m%0%i%`$r%5%]!<%H(B
-     $B$9$k0U;V$O$"$j$^$9$,!$%W%m%0%i%`<+?H$N%P%0$"$k$$$OK\%W(B
-     $B%m%0%i%`$N<B9T$J$I$+$iH/@8$9$k$$$+$J$kB;32$KBP$7$F$b@U(B
-     $BG$$r;}$A$^$;$s!%(B
+  6. 本プログラムは無保証です．作者は本プログラムをサポート
+     する意志はありますが，プログラム自身のバグあるいは本プ
+     ログラムの実行などから発生するいかなる損害に対しても責
+     任を持ちません．
diff --git a/ChangeLog b/ChangeLog
index d9b028fbc3..2d26904f0b 100644
--- a/ChangeLog
+++ b/ChangeLog
@@ -1,20434 +1,14558 @@
-Wed Jun 18 15:20:21 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Dec 14 23:53:41 2017  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* marshal.c (w_object, marshal_dump, r_object0, marshal_load): search
-	  public methods only.  [ruby-core:17283]
+	* test/net/ftp/test_ftp.rb (process_port_or_eprt): merge a part of
+	  r56973 to pass the test introduced at previous commit.
 
-	* object.c (convert_type): ditto.
+Thu Dec 14 22:55:05 2017  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* lib/singleton.rb (Singleton#_dump): conversion method should be
-	  public.
+	Fix a command injection vulnerability in Net::FTP.
 
-Wed Jun 18 13:19:55 2008  URABE Shyouhei  <shyouhei@ruby-lang.org>
+Thu Dec 14 22:35:19 2017  Eric Wong  <normalperson@yhbt.net>
 
-	* file.c: fixes to compile on mswin32.  Patch from U. Nakamura
-	  <usa at garbagecollect.jp>. [ruby-dev:35127]
+	webrick: compile RE correctly for beginning and end match
 
-Tue Jun 17 22:16:44 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	Using ^ and $ in regexps means we can accidentally get fooled
+	by "%0a" in HTTP request paths being decoded to newline
+	characters.  Use \A and \z to match beginning and end-of-string
+	respectively, instead.
 
-	* configure.in (LIBPATHFLAG, RPATHFLAG): no needs to be quoted,
-	  it is done by libpathflag in mkmf.rb.
+	Thanks to mame and hsbt for reporting.
 
-Mon Jun 16 15:43:07 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/webrick/httpserver.rb (MountTable#compile):
+	  use \A and \z instead of ^ and $
+	* lib/webrick/httpserver.rb (MountTable#normalize): use \z instead of $
+	* test/webrick/test_httpserver.rb (test_cntrl_in_path): new test
 
-	* proc.c (proc_dup): should copy safe_level from src proc
-	  properly.  a patch from Keita Yamaguchi
-	  <keita.yamaguchi at gmail.com>
+Thu Dec 14 22:29:04 2017  Eric Wong  <normalperson@yhbt.net>
 
-Sun Jun 15 23:31:10 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	webrick: do not hang acceptor on slow TLS connections
 
-	* ext/zlib/extconf.rb: search zlib1, and regard mswin32 later than VC6
-	  as WIN32.  [ruby-core:16984]
+	OpenSSL::SSL::SSLSocket#accept may block indefinitely on clients
+	which negotiate the TCP connection, but fail (or are slow) to
+	negotiate the subsequent TLS handshake.  This prevents the
+	multi-threaded WEBrick server from accepting other connections.
 
-Sun Jun 15 23:28:15 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	Since the TLS handshake (via OpenSSL::SSL::SSLSocket#accept)
+	consists of normal read/write traffic over TCP, handle it in the
+	per-client thread, instead.
 
-	* marshal.c (w_object, marshal_dump, r_object0, marshal_load): search
-	  private methods too.  [ruby-dev:34671]
+	Furthermore, using non-blocking accept() is useful for non-TLS
+	sockets anyways because spurious wakeups are possible from
+	select(2).
 
-	* object.c (convert_type): ditto.
+	* lib/webrick/server.rb (accept_client): use TCPServer#accept_nonblock
+	  and remove OpenSSL::SSL::SSLSocket#accept call
+	* lib/webrick/server.rb (start_thread): call OpenSSL::SSL::SSLSocket#acc
+ept
+	* test/webrick/test_ssl_server.rb (test_slow_connect): new test
+	  [ruby-core:83221] [Bug #14005]
 
-Sun Jun 15 23:26:50 2008  Akinori MUSHA  <knu@iDaemons.org>
+	webrick: fix up r60172
 
-	* numeric.c (flo_divmod): Revert the behavior change; do not
-	  suppress an exception when div is NaN or Inf. [ruby-dev:34857]
+	By making the socket non-blocking in r60172, TLS/SSL negotiation
+	via the SSL_accept function must handle non-blocking sockets
+	properly and retry on SSL_ERROR_WANT_READ/SSL_ERROR_WANT_WRITE.
+	OpenSSL::SSL::SSLSocket#accept cannot do that properly with a
+	non-blocking socket, so it must use non-blocking logic of
+	OpenSSL::SSL::SSLSocket#accept_nonblock.
 
-Sun Jun 15 23:24:32 2008  NAKAMURA Usaku  <usa@ruby-lang.org>
+	Thanks to MSP-Greg (Greg L) for finding this.
 
-	* file.c (BUFCHECK): wrong condition. [ruby-core:16921]
+	* lib/webrick/server.rb (start_thread): use SSL_accept properly
+	  with non-blocking socket.
+	  [Bug #14013] [Bug #14005]
 
-	* file.c (file_expand_buf): shouldn't use buflen for length of string.
+	webrick: fix up r60172 and revert r60189
 
-Sun Jun 15 23:21:22 2008  Akinori MUSHA  <knu@iDaemons.org>
+	Thanks to MSP-Greg (Greg L) for helping with this.
 
-	* marshal.c (r_object0, Init_marshal): Fix the garbled s_call
-	  definition; fixes [ruby-dev:34843].
+	* lib/webrick/server.rb (start_thread): ignore ECONNRESET, ECONNABORTED,
+	  EPROTO, and EINVAL on TLS negotiation errors the same way they
+	  were ignored before r60172 in the accept_client method of the
+	  main acceptor thread.
+	  [Bug #14013] [Bug #14005]
 
-Sun Jun 15 23:19:53 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	webrick: fix up r60172 and r60208
 
-	* object.c (rb_cstr_to_dbl): should clear errno before calling
-	  strtod(3).  [ruby-dev:34834]
+	Thanks to MSP-Greg (Greg L) for helping with this.
 
-Sun Jun 15 23:18:15 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/webrick/server.rb (start_thread): fix non-local return
+	  introduced in r60208
 
-	* marshal.c (marshal_load): should initialize arg.data used for
-	  reentrant check.  [ruby-dev:34837]
+	webrick: fix up r60172 and r60210
 
-Sun Jun 15 23:13:23 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	Thanks to MSP-Greg (Greg L) for helping with this.
 
-	* parse.y (top_local_setup): fixed memory leak bug based on a
-	  patch from Roger Pack <rogerpack2005 at gmail.com> in
-	  [ruby-core:16610].
-Sun Jun 15 23:16:26 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/webrick/server.rb (start_thread): properly fix non-local return
+	  introduced in r60208 and r60210
 
-	* marshal.c (reentrant_check): check reentrance via callcc.
-	  [ruby-dev:34802]
+Thu Nov 30 23:37:08 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
+	parse.y: fix line in rescue
 
-Sun Jun 15 23:09:00 2008  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* parse.y (set_line_body, primary): fix line number of bodystmt as the
+	  beginning of the block. [Bug #13181]
 
-	* sprintf.c (rb_f_sprintf): fixed SEGV on win32 with "% 0e" % 1.0/0.0.
+Thu Nov 30 23:29:00 2017  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Sun Jun 15 23:07:46 2008  NAKAMURA Usaku  <usa@ruby-lang.org>
+	Merge rubygems-2.6.14 changes.
 
-	* process.c (rb_f_system): set last_status when status == -1 because
-	  there is no path to set it on win32. this patch is derived from
-	  [ruby-core:16787], submitted by Luis Lavena <luislavena at gmail.com>
+	It fixed http://blog.rubygems.org/2017/10/09/unsafe-object-deserialization-vulnerability.html
 
-Sun Jun 15 23:02:12 2008  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Fri Sep 15 05:40:40 2017  URABE Shyouhei  <shyouhei@ruby-lang.org>
 
-	* lib/webrick/httpservlet/filehandler.rb: should normalize path
-	  name in path_info to prevent script disclosure vulnerability on
-	  DOSISH filesystems. (fix: CVE-2008-1891)
-	  Note: NTFS/FAT filesystem should not be published by the platforms
-	  other than Windows. Pathname interpretation (including short
-	  filename) is less than perfect.
+	fix --with-gmp (broken by r57490)
 
-	* lib/webrick/httpservlet/abstract.rb
-	  (WEBrick::HTTPServlet::AbstracServlet#redirect_to_directory_uri):
-	  should escape the value of Location: header.
+	Looking at the generated shell script (also the autoconf manual), it
+	seems AC_SEARCH_LIBS() m4 macro does not define HAVE_LIBsomething C
+	preprocessor macros, unlike AC_CHECK_LIB() which does define them.
+	This previous change effectively killed building with GMP because
+	building that mode depends on existence of HAVE_LIBGMP. [Bug #13402]
 
-	* lib/webrick/httpservlet/cgi_runner.rb: accept interpreter
-	  command line arguments.
+Thu Sep 14 20:25:55 2017  Yusuke Endoh  <mame@ruby-lang.org>
 
-Sun Jun 15 23:02:12 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	lib/webrick/log.rb: sanitize any type of logs
 
-	* file.c (file_expand_path): support for alternative data stream
-	  and ignored trailing garbages of NTFS.
+	It had failed to sanitize some type of exception messages.  Reported and
+	patched by Yusuke Endoh (mame) at https://hackerone.com/reports/223363
 
-	* file.c (rb_file_s_basename): ditto.
+Thu Sep 14 13:32:39 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* file.c (rb_file_s_extname): ditto.
+	parse.y: empty hash in defined
 
-Sun Jun 15 22:53:20 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* parse.y (command): NODE_ARRAY with NULL is invalid.  traversal
+	  in defined_expr0 is simplified than iseq_compile_each0.
+	  [ruby-core:82113] [Bug #13756]
 
-	* string.c (rb_str_cat): fixed buffer overrun reported by
-	  Christopher Thompson <cthompson at nexopia.com> in [ruby-core:16746]
+Thu Sep 14 13:26:31 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Jun 15 22:51:24 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	string.c: fix false coderange
 
-	* eval.c (is_defined): add NODE_OP_ASGN_{OR,AND}.  "defined?(a||=1)"
-	  should not operate assignment.  [ruby-dev:34645]
+	* string.c (rb_enc_str_scrub): enc can differ from the actual encoding
+	  of the string, the cached coderange is useless then. [Bug #13874]
 
-Sun Jun 15 22:49:45 2008  NAKAMURA Usaku  <usa@ruby-lang.org>
+Thu Sep 14 13:24:51 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* win32/win32.c (rb_w32_select): backport from trunk.
-	  [ruby-talk:300743]
+	parse.y: primary should not be 0
 
-Sun Jun 15 22:48:26 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* parse.y (primary): should not be 0, since it can be a receiver.
+	  [ruby-core:82447] [Bug #13836]
 
-	* lib/delegate.rb (SimpleDelegator::dup): removed needless argument.
-	  [ruby-list:44910]
+Thu Sep 14 13:19:30 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/delegate.rb (clone, dup): keep relationship with the target
-	  object.
-
-Sun Jun 15 22:46:34 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* util.c (ruby_strtod): backported from 1.9.  a patch from Satoshi
-	  Nakagawa <psychs at limechat.net> in [ruby-dev:34625]. 
-	  fixed: [ruby-dev:34623]
-
-Sun Jun 15 22:44:25 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* struct.c (rb_struct_s_def): to_str should be called only once.
-	  [ruby-core:16647]
-
-Sun Jun 15 22:42:54 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/zlib/zlib.c (gzreader_gets): may cause infinite loop.
-	  a patch from Kouya <kouyataifu4 at gmail.com> in
-	  [ruby-reference-manual:762].
-
-Sun Jun 15 22:34:09 2008  James Edward Gray II  <jeg2@ruby-lang.org>
-
-	Merged 16241 from trunk.
-
-	* lib/net/telnet.rb:  Fixing a bug where line endings would not be properly
-	  escaped when the two character ending was broken up into separate TCP
-	  packets.  Issue reported and patched by Brian Candler.
-
-Sun Jun 15 22:31:47 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* re.c (rb_reg_search): use local variable.  a patch from wanabe
-	  <s.wanabe AT gmail.com> in [ruby-dev:34537].  [ruby-dev:34492]
-
-Sun Jun 15 22:20:45 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* sprintf.c (rb_f_sprintf): should protect temporary string from
-	  GC.   [ruby-dev:34480]
-
-Sun Jun 15 22:18:30 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* regex.c (re_search): string might be NULL.  [ruby-core:16478]
-
-Sun Jun 15 22:16:21 2008  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* time.c (rb_strftime): check errno to detect strftime(3)'s error.
-	  this is workaround for recent version of MSVCRT.
-	  [ruby-dev:34456]
-
-Sun Jun 15 22:12:07 2008  Akinori MUSHA  <knu@iDaemons.org>
-
-	* lib/yaml/types.rb: Likewise, pass self to YAML::quick_emit;
-	  merged from 1.9.
-
-	* lib/yaml.rb (quick_emit): use combination of object_id and hash to
-	  identify repeated object references, since GC will reuse memory of
-	  objects during output of YAML. [ruby-Bugs-8548] [ruby-Bugs-3698];
-	  merged from 1.9.
-
-Sun Jun 15 22:09:02 2008  Akinori MUSHA  <knu@iDaemons.org>
-
-	* ext/syck/rubyext.c: Node#value defined twice.
-
-	* lib/yaml/: several method redefinitions causing warnings.
-
-Sun Jun 15 22:04:44 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* marshal.c (w_object): add volatile to avoid potential GC bug.  a
-	  patch from Tomoyuki Chikanaga <chikanag at nippon-control-system.co.jp>
-	  in [ruby-dev:34311].
-
-Sun Jun 15 21:59:22 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* re.c (rb_reg_quote): should always copy the quoting string.
-	  [ruby-core:16235]
-
-Sun Jun 15 21:27:46 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/net/pop.rb (Net::POP3::do_finish): clear @n_mails and
-	  @n_bytes as well.  [ruby-core:16144]
-
-Sun Jun 15 21:08:10 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/resolv.rb (Resolv::Config.default_config_hash): requires
-	  win32/resolv to use Win32::Resolv.  [ruby-dev:34138]
-
-Sun Jun 15 20:54:07 2008  Akinori MUSHA  <knu@iDaemons.org>
-
-	* parse.y (yycompile): Always prepare a new array for each file's
-	  SCRIPT_LINES__ storage, instead of appending source lines every
-	  time a file is re-loaded; submitted by Rocky Bernstein in
-	  #18517.
-
-Sun Jun 15 20:30:01 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/resolv.rb (Resolv::Hosts): should not use win32/resolv on cygwin.
-	  [ruby-dev:29945], [ruby-dev:34095]
-
-	* lib/win32/registry.rb (Win32::Registry.expand_environ): try upcased
-	  name too for cygwin.  [ruby-dev:29945]
-
-	* lib/win32/resolv.rb (Win32::Resolv.get_hosts_path): use expand_path.
-
-Sun Jun 15 20:27:59 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* misc/ruby-mode.el (ruby-mode): should use `run-mode-hooks' instead
-	  of calling `run-hooks' directly to run the mode hook.  patch from
-	  Chiyuan Zhang <pluskid AT gmail.com> in [ruby-core:15915]
-
-Sun Jun 15 20:20:59 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* numeric.c (fix_coerce): try conversion before type check.
-	  [ruby-core:15838]
-
-Sun Jun 15 19:56:53 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* bignum.c (BIGZEROP): fix for longer Bignum zeros.  [ruby-Bugs-17454]
-
-Sun Jun 15 19:54:21 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* bignum.c (big2str_find_n1): check integer overflow.
-
-Sun Jun 15 19:52:20 2008  Tanaka Akira  <akr@fsij.org>
-
-	* gc.c (STACK_LENGTH) [SPARC] : 0x80 offset removed.  [ruby-dev:33857]
-
-Sun Jun 15 19:50:20 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/readline/readline.c (readline_event): prevent polling.  based on
-	  a patch from error errorsson in [ruby-Bugs-17675].
-
-Sun Jun 15 19:44:52 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (yycompile): clear ruby_eval_tree_begin if parse failed.
-
-Sun Jun 15 19:44:52 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (yycompile): clear ruby_eval_tree_begin too before parse.
-
-Sun Jun 15 19:22:21 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/pty/lib/expect.rb (IO#expect): check if peer is closed.
-	  [ruby-Bugs-17940]
-
-Sun Jun 15 19:20:13 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/iconv/iconv.c (iconv_convert): check upper bound.  a patch from
-	  Daniel Luz at [ruby-Bugs-17910].
-
-Sun Jun 15 19:13:46 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in (ftruncate): check if available.
-
-	* file.c (rb_file_truncate): check if ftruncate instead of truncate.
-
-Sun Jun 15 19:02:46 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in (sigsetmask): check when signal semantics is not POSIX.
-
-	* signal.c (USE_TRAP_MASK): set true if sigprocmask or sigsetmask is
-	  available.
-
-Sat Jun 14 16:49:41 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/timeout.rb (Timeout::timeout): made sensitive to location on the
-	  stack.  [ruby-core:15458]
-
-Fri Jun 13 13:14:31 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/dl/ptr.c (dlmem_each_i): typo fixed.  a patch from IKOMA
-Sun Jun 15 21:06:12 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* class.c (clone_method): should copy cref as well.
-	  [ruby-core:15833]
-
-	  Yoshiki <ikoma@mb.i-chubu.ne.jp> in [ruby-dev:33776].
-
-Fri Jun 13 13:13:23 2008  URABE Shyouhei  <shyouhei@ice.uec.ac.jp>
-
-	* gc.c (rb_newobj): prohibit call of rb_newobj() during gc.
-	  Submitted by Sylvain Joyeux [ruby-core:12099].
-
-	* ext/dl/ptr.c: do not use LONG2NUM() inside dlptr_free().
-	  Slightly modified fix bassed on a patch by Sylvain Joyeux
-	  [ruby-core:12099] [ ruby-bugs-11859 ] [ ruby-bugs-11882 ]
-	  [ ruby-patches-13151 ].
-
-Fri Jun 13 12:10:13 2008  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* lib/benchmark.rb (Job::Benchmark#item): fix typo.
-
-Fri Jun 13 12:06:17 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/bigdecimal/bigdecimal.c (BigDecimal_to_f): use strtod() for more
-	  precision.  [ruby-talk:290296]
-
-	* ext/bigdecimal/bigdecimal.c (BASE_FIG): made constant.
-
-	* ext/bigdecimal/extconf.rb: ditto.  [ruby-dev:33658]
-
-Fri Jun 13 12:01:57 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/irb.rb (IRB::Irb::eval_input): rescues Interrupt and other than
-	  SystemExit and SignalException.  [ruby-core:15359]
-
-Fri Jun 13 11:57:46 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/benchmark.rb (Benchmark::realtime): make Benchmark#realtime
-	  a bit faster.  a patch from Alexander Dymo <dymo@ukrpost.ua> in
-	  [ruby-core:15337].
-
-Fri Jun 13 11:50:59 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	vm_method.c: alias warning at refined method
 
-	* io.c (rb_open_file): should check NUL in path.
-	  <http://www.rubyist.net/~matz/20080125.html#c01>.
+	* vm_method.c (rb_method_entry_make): suppress a warning at
+	  refined method which will not be redefined.
+	  [ruby-core:82385] [Bug #13817]
 
-	* io.c (rb_io_s_popen): ditto.
+Thu Sep 14 13:14:19 2017  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* io.c (rb_io_reopen): ditto.
+	* ext/bigdecimal/bigdecimal.c (BigDecimal_hash): st_index_t may not be
+	  fixable on 64bit mswin/mingw.
 
-	* io.c (next_argv): ditto.
+	* ext/date/date_core.c (d_lite_hash): ditto.
+	  [Backport #13877]
 
-	* io.c (rb_io_s_foreach): ditto.
+	* ext/openssl/ossl_bn.c (ossl_bn_hash): ditto.
 
-	* io.c (rb_io_s_readlines): ditto.
+Sat Sep  9 23:05:31 2017  Kazuki Yamaguchi <k@rhe.jp>
 
-	* io.c (rb_io_s_read): ditto.
+	asn1: fix out-of-bounds read in decoding constructed objects
 
-Wed Jun 11 15:23:13 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* OpenSSL::ASN1.{decode,decode_all,traverse}: have a bug of
+	  out-of-bounds read. int_ossl_asn1_decode0_cons() does not give the
+	  correct available length to ossl_asn1_decode() when decoding the
+	  inner components of a constructed object. This can cause
+	  out-of-bounds read if a crafted input given.
 
-	* lib/uri/generic.rb (URI::Generic::inspect): use Kernel#to_s instead
-	 object_id with printf.  [ruby-dev:33347]
+	Reference: https://hackerone.com/reports/170316
+	https://github.com/ruby/openssl/commit/1648afef33c1d97fb203c82291b8a61269e85d3b
 
-Wed Jun 11 15:00:55 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Sep  9 22:57:24 2017  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* configure.in: Remove wrong assumptions about Cygwin.  a patch from
-	  Corinna Vinschen in [ruby-Bugs-17018].
+	* ext/json: bump to version 1.8.3.1. [Backport #13853]
 
-Mon Jun  9 18:09:20 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Sep  9 22:50:10 2017  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* eval.c (eval): check if backtrace is empty.  [ruby-core:15040]
+	A HTTP Header value must not contain CR or LF.
+	to_str -> to_s
 
-Sun Jun  8 06:08:26 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/net/http/header.rb (set_field): `val` can not have `to_str`.
 
-	* eval.c (rb_define_alloc_func, rb_undef_alloc_func): should
-	  define/undef on a signleton class.  [ruby-core:09959]
+Sat Sep  9 22:42:22 2017  Kouhei Sutou  <kou@cozmixng.org>
 
-Sun Jun  8 06:04:41 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* REXML: Fix a bug that unexpected methods can be called as a XPath
+	  function. [HackerOne:249295] Reported by Andrea Jegher. Thanks!!!
 
-	* time.c (time_arg): use converted object.  [ruby-core:14759]
+Sat Sep  9 22:16:01 2017  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Sun Jun  8 06:02:11 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/rubygems: fix several vulnerabilities in RubyGems; bump to version
+	  2.5.2.1. [Backport #13842]
 
-	* io.c (fptr_finalize): clear errno first.  [ruby-talk:284492]
+Wed Aug  9 22:27:23 2017  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Sun Jun  8 05:59:36 2008  Tadayoshi Funaba  <tadf@dotrb.org>
+	* test/ruby/test_syntax.rb (test_invalid_{break,next}): use
+	  assert_in_out_err instead of assert_syntax_error because on ruby_2_3
+	  assert_syntax_error uses eval.
 
-	* lib/date.rb: don't freeze nil even if 1.8 will not be aware of
-	  the issue. [ruby-dev:32677]
+Wed Aug  9 22:27:23 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Jun  8 05:54:44 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* compile.c (iseq_compile_each0): turned dregx context in "once"
+	  into "guarded" type from "block" type, to disallow `next`,
+	  `break`, `redo` as well as outside "once".
+	  [Bug #13690]
 
-	* configure.in (TIMEZONE_VOID): check whether timezone requires zero
-	  arguments.  [ruby-dev:32631]
+Wed Aug  9 21:28:34 2017  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Sun Jun  8 05:37:10 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/ruby/test_process.rb (test_rlimit_{name,value}): test in UTF-8
+	  encoding.  fix test failures introduced at r59531 on some platforms.
 
-	* parse.y (f_rest_arg): check if duplicated.  [ruby-core:14140]
+Wed Aug  9 21:16:22 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Jun  8 05:32:45 2008  Tanaka Akira  <akr@fsij.org>
+	* marshal.c (rb_marshal_dump_limited): do not free dump_arg, which
+	  may be dereferenced in check_dump_arg due to continuation, and
+	  get rid of dangling pointers.
 
-	* gc.c (stack_end_address): use local variable address instead of
-	  __builtin_frame_address(0) to avoid SEGV on SunOS 5.11 on x86 with 
-	  gcc (GCC) 3.4.3 (csl-sol210-3_4-20050802).
+	* marshal.c (rb_marshal_load_with_proc): ditto for load_arg.
 
-Sun Jun  8 05:24:19 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Aug  9 21:13:24 2017  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* configure.in (RUBY_CHECK_VARTYPE): check if a variable is defined
-	  and its type.
+	* compile.c (iseq_compile_each): remove unused definition of unused
+	  variable derived from original patch.
 
-	* configure.in (timezone, altzone): check for recent cygwin.
+Wed Aug  9 19:45:16 2017  sorah (Shota Fukumori)  <her@sorah.jp>
 
-	* missing/strftime.c (strftime): fix for timezone.  [ruby-dev:32536]
+	Init_frozen_strings definition is removed in r51511.
+	https://bugs.ruby-lang.org/issues/11423
 
-	* lib/mkmf.rb (try_var): should fail for functions.
+	Patch by Kohei Suzuki <eagletmt@gmail.com>
 
-	* ext/readline/extconf.rb: should use have_func for functions instead
-	  of have_var.
+	* internal.h: Remove declaration of unexist function
+	  [Fix GH-1558]
 
-Sun Jun  8 05:08:35 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Aug  9 19:34:17 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/cgi.rb (read_multipart): exclude blanks from header values.
-	  [ruby-list:44327]
+	* internal.h (THROW_DATA_P): parenthesize the argument which is
+	  casted.
 
-Sun Jun  8 05:02:25 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Aug  9 19:34:17 2017  Koichi Sasada  <ko1@atdot.net>
 
-	* bignum.c (rb_cstr_to_inum): trailing spaces may exist at sqeezing
-	  preceeding 0s.  [ruby-core:13873]
+	* vm.c: get return_value from imemo_throw_data object (THROW_DATA_VAL()).
+	  imemo_throw_data (TAG_BREAK) contains returned value.
+	  However, imemo_throw_data (TAG_BREAK) can skip several frames so that
+	  we need to use it only once (at most internal frame). To record it,
+	  we introduced THROW_DATA_CONSUMED and check it.
 
-Sun Jun  8 04:58:05 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* internal.h: define THROW_DATA_CONSUMED flag.
 
-	* eval.c (error_print): put newline unless multiple line message ends
-	  with a newline.  [ruby-dev:32429]
+	* test/ruby/test_settracefunc.rb: add tests for [Bug #13369]
 
-Sun Jun  8 04:55:26 2008  James Edward Gray II  <jeg2@ruby-lang.org>
+	* vm_insnhelper.h: add THROW_DATA_CONSUMED_P() and
+	  THROW_DATA_CONSUMED_SET().
 
-	Merged 14070 from trunk.
-	
-	* lib/xmlrpc/server.rb (XMLRPC::Server#server): Improve signal handling so
-	  pressing control-c in the controlling terminal or sending SIGTERM stops
-	  the XML-RPC server.
+Wed Aug  9 19:32:17 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Jun  8 04:49:43 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* random.c (get_rnd, try_get_rnd): ensure initialized to get rid
+	  of crash in forked processes. [Bug #13753]
 
-	* parse.y (newline_node): set line from outermost node before removing
-	  NODE_BEGIN.  [ruby-dev:32406]
+Wed Aug  9 19:30:34 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Jun  8 04:37:34 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/strscan/strscan.c (strscan_aref): fix segfault after
+	  get_byte or getch which do not apply regexp.
+	  [Bug #13759]
 
-	* parse.y (stmt): remove unnecessary NODE_BEGIN.  [ruby-core:13814]
+Wed Aug  9 19:28:40 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Jun  8 04:16:35 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* configure.in: add rpath flags which is needed for OPTDIR as well
+	  as -L options, when it is given. [Bug #13411]
 
-	* eval.c (rb_alias): do not call hook functions until initialization
-	  finishes.  [ruby-talk:279538]
+Wed Aug  9 19:14:07 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Jun  8 04:14:16 2008  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
+	* vm_insnhelper.c (vm_throw_start): size of catch table has been
+	  included in iseq_catch_table struct, which could be NULL, since
+	  2.2. e.g., proc-closure in `once'. 
 
-	* ext/win32ole/win32ole.c (ole_invoke): bug fix. [ruby-talk:279100]
+Wed Aug  9 19:09:20 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Jun  8 03:59:31 2008  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* node.h (nd_line): should sign-extend.  shifting `VALUE` extends
+	  with zero bits if `sizeof(VALUE)` equals to `sizeof(int)`.  the
+	  zero bits are truncated if `sizeof(VALUE)` is bigger enough.
+	  [ruby-core:80920] [Bug #13523]
 
-	* ext/curses/extconf.rb: check macro if cannot find func.
-	  [ruby-list:44224]
+Wed Aug  9 17:53:09 2017  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Sun Jun  8 03:52:53 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* compile.c (iseq_compile_each): the lifetime of new_opt have to be
+	  until this case block is end.  this is a part of r57971.
+	  [Backport #13766]
 
-	* lib/cgi/session.rb (CGI::Session::FileStore::restore): use
-	  lockfile for exclusive locks.  a patch from <tommy AT tmtm.org>.
-	  [ruby-dev:32296]
+Wed Aug  9 17:35:47 2017  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Sun Jun  8 03:49:15 2008  Tanaka Akira  <akr@fsij.org>
+	this patch contains r54158, r57410, r57631 and r57954.
 
-	* missing/isinf.c (isinf): don't define if the macro is defined.
+	Prevent GC by volatile [Bug #13150]
 
-Sun Jun  8 03:42:10 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	test/ruby/test_marshal.rb test_context_switch (load) and test_gc (dump)
+	are failed on FreeBSD 10.3 and gcc7 (FreeBSD Ports Collection) 7.0.0
+	20170115 (experimental); RB_GC_GUARD looks not worked well.
 
-	* numeric.c (round): fallback definition.
+	* include/ruby/ruby.h (RB_GC_GUARD): prevent guarded pointer from
+	  optimization by using as an input to inline asm.
 
-	* numeric.c (flo_divmod, flo_round): use round() always.
-	  [ruby-dev:32269]
+	* ruby.h: remove comment
 
-Sun Jun  8 03:42:10 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* include/ruby/ruby.h (RB_GC_GUARD): remove comment unsupported by
+	  Solaris AS.
 
-	* numeric.c (flodivmod): work around for infinity.
+	Hidden objects (klass == 0) are not visible to Ruby code invoked
+	from other threads or signal handlers, so they can never be
+	accessed from other contexts.  This makes it safe to call
+	rb_gc_force_recycle on the object slot after releasing malloc
+	memory.
 
-	* numeric.c (flo_divmod): work around for platforms have no round().
-	  [ruby-dev:32247]
+	* marshal.c (rb_marshal_dump_limited): hide dump_arg and recycle when
+	  done (rb_marshal_load_with_proc): hide load_arg and recycle when done
+	  [ruby-core:79518]
 
-Sun Jun  8 03:42:10 2008  URABE Shyouhei  <shyouhei@ice.uec.ac.jp>
+	* marshal.c (rb_marshal_dump_limited): do not free dump_arg, which
+	  may be dereferenced in check_dump_arg due to continuation, and
+	  get rid of dangling pointers.
 
-	* numeric.c (flo_divmod): round to the nearest integer.
-	  [ ruby-Bugs-14540 ]
+	* marshal.c (rb_marshal_load_with_proc): ditto for load_arg.
 
-Sun Jun  8 03:28:53 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Wed Aug  9 17:28:35 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/rexml/encodings/SHIFT-JIS.rb (REXML::Encoding): place -x for
-	  nkf conversion.  a patch from <moonwolf AT moonwolf.com>.
-	  [ruby-dev:32183]
+	* eval.c (setup_exception): make unfrozen copy of special
+	  exception before setting up a cause.
 
-Sun Jun  8 03:07:19 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Aug  9 17:22:29 2017  TAKANO `takano32' Mitsuhiro  <tak@no32.tk>
 
-	* lib/optparse.rb (OptionParser::Switch::summarize): fix for long form
-	  option with very long argument.  a patch from Kobayashi Noritada
-	  <nori1 AT dolphin.c.u-tokyo.ac.jp> in [ruby-list:44179].
+	a64: fix crash on register stack mark/sweep pass
 
-Sun Jun  8 03:04:38 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* thread_pthread.c: move 'register_stack_start' earlier.
+	  [ruby-core:79928] [Bug #13284] [Fix GH-1625]
 
-	* numeric.c (fix_pow): returns infinity for 0**-1.  [ruby-dev:32084]
+	Author:    Sergei Trofimovich <slyfox@gentoo.org>
 
-Sun Jun  8 02:58:19 2008  James Edward Gray II  <jeg2@ruby-lang.org>
+Wed Aug  9 17:10:27 2017  Shugo Maeda  <shugo@ruby-lang.org>
 
-	Merged 13781 from trunk.
+	* test/net/smtp/test_smtp.rb (test_tls_connect, test_tls_connect):
+	  use Socket.tcp_server_sockets in case localhost is resolved to ::1.
 
-	* lib/net/telnet.rb (Net::Telnet#login): Allowing "passphrase" in
-	  addition to "password" for Telnet login prompts. [ruby-Bugs-10746]
+Wed Aug  9 17:10:27 2017  Shugo Maeda  <shugo@ruby-lang.org>
 
-Wed Oct 25 06:46:21 2007  James Edward Gray II  <jeg2@ruby-lang.org>
+	* lib/net/smtp.rb (tlsconnect): support timeout for TLS handshake.
+	  [ruby-core:76893] [Bug #12678]
 
-	Merged 13779 from trunk.
+	* lib/net/protocol.rb (ssl_socket_connect): new method to implement
+	  timeout for TLS handshake.
 
-	* lib/net/telnet.rb (Net::Telnet#login): Making the password prompt
-	  pattern case insensitive. [ruby-Bugs-10746]
+	* lib/net/http.rb (connect): use Net::Protocol#ssl_socket_connect.
 
-Sun Jun  8 02:55:19 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Aug  9 17:08:01 2017  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* io.c (rb_io_tell, rb_io_seek): check errno too.  [ruby-dev:32093]
+	Zlib::GzipReader#pos underflows after calling #ungetbyte or #ungetc at start of file [Bug #13616]
 
-Sun Jun  8 01:53:50 2008  James Edward Gray II  <jeg2@ruby-lang.org>
+	patched by Andrew Haines <andrew@haines.org.nz> [ruby-core:81488]
+	zlib.c: fix unnormalized Fixnum
 
-	Merged 13767, 13768, 13769, and 13770 from trunk.
+	* ext/zlib/zlib.c (rb_gzfile_total_out): cast to long not to
+	  result in an unsigned long to normalized to Fixnum on LLP64
+	  platforms.  [ruby-core:81488]
 
-	* lib/xmlrpc/parser.rb (XMLRPC::Convert::dateTime): Fixing a bug that
-	  caused time zone conversion to fail for some ISO 8601 date formats.
-	  [ruby-Bugs-12677]
+Wed Aug  9 17:03:00 2017  Eric Wong  <normalperson@yhbt.net>
 
-	* lib/xmlrpc/client.rb (XMLRPC::Client#do_rpc): Explicitly start
-	  the HTTP connection to support keepalive requests. [ruby-Bugs-9353]
+	process.c: handle dynamic :rlimit_* symbols in spawn execopts
 
-	* lib/xmlrpc/client.rb (XMLRPC::Client#do_rpc): Improving the error
-	  message for Content-Type check failures. [ruby-core:12163]
+	* process.c (rb_execarg_addopt_rlimit): hoist out of rb_execarg_addopt
+	  (rlimit_type_by_sym): new wrapper for dynamic symbol
+	  (rb_execarg_addopt): check for dsym via rlimit_type_by_sym
+	* test/ruby/test_process.rb (test_execopts_rlimit): check dsym w/o pindown
+	  Add extra check for bogus rlimit args, too.
+	  [ruby-core:82033] [Bug #13744]
+	process.c: null bytes
 
-	* lib/xmlrpc/utils.rb (XMLRPC::ParseContentType#parse_content_type):
-	  Making Content-Type checks case insensitive. [ruby-Bugs-3367]
+	* process.c (rlimit_type_by_sym): prohibit null bytes in key
+	  names.  [ruby-core:82033] [Bug #13744]
 
-Sun Jun  8 01:50:07 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Aug  9 16:56:52 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* marshal.c (r_bytes0): refined length check.  [ruby-dev:32059]
+	optparse.rb: get rid of eval
 
-Sun Jun  8 01:50:07 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/optparse.rb: try Float() and Integer() instead of eval,
+	  which does too much things.
 
-	* marshal.c (r_bytes0): check if source has enough data.
-	  [ruby-dev:32054]
 
-Sun Jun  8 01:41:19 2008  Tanaka Akira  <akr@fsij.org>
+Fri Jul  7 10:58:10 2017  Eric Wong  <e@80x24.org>
 
-	* ext/socket/socket.c (s_accept_nonblock): make accepted fd
-	  nonblocking.  [ruby-talk:274079]
+	This backport of r58812 is necessary to ease backporting r59028,
+	which fixes a real bug.
 
-Sun Jun  8 01:36:26 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* thread.c (struct waiting_fd): declare
+	  (rb_thread_io_blocking_region): use on-stack list waiter
+	  (rb_notify_fd_close): walk vm->waiting_fds instead
+	  (call_without_gvl): remove old field setting
+	  (th_init): ditto
+	  [Feature #9632]
 
-	* configure.in (AC_SYS_LARGEFILE): keep results also in command
-	  options, to vail out of mismatch.  [ruby-list:44114]
+	* vm_core.h (typedef struct rb_vm_struct): add waiting_fds list
 
-	* mkconfig.rb, lib/mkmf.rb (configuration): add DEFS.
+	* (typedef struct rb_thread_struct): remove waiting_fd field
+	  (rb_vm_living_threads_init): initialize waiting_fds list
 
-Sun Jun  8 01:31:17 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	This should fix bad interactions with test_race_gets_and_close
+	in test/ruby/test_io.rb since we ensure rb_notify_fd_close
+	continues returning the busy flag after enqueuing the interrupt.
 
-	* win32/mkexports.rb: deal with __fastcall name decorations.
-	  [ruby-list:44111]
+	* thread.c (rb_notify_fd_close): do not enqueue multiple interrupts
+	  [ruby-core:81581] [Bug #13632]
 
-Sun Jun  8 01:27:06 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/ruby/test_io.rb (test_single_exception_on_close):
+	  new test based on script from Nikolay
 
-	* {bcc,win}32/mkexports.rb: explicit data.  [ruby-list:44108]
+Wed Jul  5 15:55:35 2017  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Sun Jun  8 01:15:50 2008  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* ext/openssl/ossl_cipher.c: remove the encryption key initialization
+	  from Cipher#initialize. This is effectively a revert of r32723
+	  ("Avoid possible SEGV from AES encryption/decryption", 2011-07-28).
+	  the patch is derived from https://github.com/ruby/openssl/commit/8108e0a6db133f3375608303fdd2083eb5115062,
+	  written by Kazuki Yamaguchi.
+	  [Backport #8221]
 
-	* lib/net/http.rb, lib/open-uri.rb: remove
-	  Net::HTTP#enable_post_connection_check.  [ruby-dev:31960]
+Sat Jul  1 00:28:22 2017  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* lib/net/imap.rb: hostname should be verified against server's
-	  indentity as persented in the server's certificate. [ruby-dev:31960]
+	* ext/psych/yaml: update libyaml to 0.1.7.
 
-	* ext/openssl/lib/net/telnets.rb, ext/openssl/lib/net/ftptls.rb: ditto.
+	* ext/psych/psych.gemspec: bump version to 2.1.0.1.
 
-Thu Jun  5 16:21:16 2008  NAKAMURA Usaku  <usa@ruby-lang.org>
+Fri Jun 30 22:05:39 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* win32/win32.c (make_cmdvector): adjust escaped successive
-	  double-quote handling. (merge from trunk)
+	* parse.y (parser_precise_mbclen): check invalid multibyte char at
+	  skipping strings following ?x literal string, not to stuck in a
+	  infinite loop. [Bug #13672]
 
-Thu Jun  5 12:26:45 2008  NAKAMURA Usaku  <usa@ruby-lang.org>
+Fri Jun 30 22:00:56 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* win32/win32.c (init_env): initialize HOME and USER environment
-	  variables unless set. [ruby-core:12328] (merge from trunk)
+	* ext/pathname/lib/pathname.rb (Pathname#plus): UNC root pathname needs
+	  a separator. File.basename returns "/" on UNC root, as well as sole
+	  drive letter, even if it does not end with a separator. [Bug #13515]
 
-	* win32/win32.c (NtInitialize, getlogin): ditto.
+Fri Jun 30 21:57:27 2017  Kouhei Sutou  <kou@cozmixng.org>
 
-	* configure.in, win32/Makefile.sub (LIBS): need to link shell32
-	  library for SH* functions on mswin32 and mingw32.
+	* lib/rexml/parsers/streamparser.rb: add close tag check on end of
+	  document to StreamParser [Bug #13636]
+	  Reported by Anton Sivakov. Thanks!!!
 
-Thu Jun  5 12:22:28 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Jun 30 21:54:01 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* gc.c (id2ref): valid id should not refer T_VALUE nor T_ICLASS.
-	  [ruby-dev:31911]
+	* array.c (rb_ary_insert): check position to insert even if no elements
+	  to be inserted. [Bug #13558]
 
-Wed Jun  4 16:41:19 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Jun 30 21:51:40 2017  Marcus Stollsteimer  <sto.mar@web.de>
 
-	* Makefile.in (ext/extinit.o): use $(OUTFLAG) as well as other
-	  objects.  [ruby-Bugs-14228]
+	* ext/date/date_core.c: [DOC] fix documentation for %Z format of
+	  {Date,DateTime}.strftime.
+	  Reported by Damon Timm. Based on a patch by nano.
+	  [Bug #13231] [Fix GH-1565]
 
-Tue Jun  3 16:15:27 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Jun 30 21:46:50 2017  Kouhei Sutou  <kou@cozmixng.org>
 
-	* parse.y (yyerror): limit error message length.  [ruby-dev:31848]
+	* lib/rss/rss.rb: Accept empty text element as valid element
+	  Parser has been accepted it but XML serializer wasn't accepted.
+	  Reported by stefano frabetti. Thanks!!!
+	  [Bug #13531]
 
-	* regex.c (re_mbc_startpos): separated from re_adjust_startpos.
+Fri Jun 30 21:40:42 2017  Kazuki Yamaguchi <k@rhe.jp>
 
-Tue Jun  3 15:45:00 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/openssl/ossl_x509store.c: clear error queue after calling
+	  X509_LOOKUP_load_file()
 
-	* gc.c (os_obj_of, os_each_obj): hide objects to be finalized.
-	  [ruby-dev:31810]
+	  X509_LOOKUP_load_file(), which ends up calling
+	  X509_load_cert_crl_file()
+	  internally, may leave error entries in the queue even when it returns
+	  non-zero value (which indicates success).
 
-Wed Jun  4 19:16:40 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	  This will be fixed by OpenSSL 1.1.1, but can be worked around by
+	  clearing the error queue ourselves.
 
-	* eval.c (remove_method): should not remove undef place holder.
-	  [ruby-dev:31817]
+	  Fixes: [Backport #11033]
 
-Tue Jun  3 15:22:47 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Jun 30 21:35:16 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* process.c (struct rb_exec_arg): proc should be a VALUE.
+	* gc.c (heap_page_allocate): expand sorted pages before inserting
+	  allocated new page. [Bug #12670]
 
-	* process.c (rb_f_exec): suppress a warning.
+Fri Jun 30 21:33:39 2017  Koichi Sasada  <ko1@atdot.net>
 
-       * process.c (rb_detach_process): cast for the platforms where size of
-         pointer differs from size of int.
+	* gc.c (heap_page_resurrect): do not return tomb_pages when
+	  page->freelist == NULL.
+	  [Bug #12670]
 
-       * process.c (rb_f_exec, rb_f_system): should not exceptions after
-         fork.  [ruby-core:08262]
+Fri Jun 30 21:23:20 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed May 21 01:32:56 2008  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* vsnprintf.c (BSD_vfprintf): sign and hex-prefix should not be counted
+	  in precision. [Bug #8916]
 
-	* lib/webrick/httpservlet/filehandler.rb: should normalize path
-	  name in path_info to prevent script disclosure vulnerability on
-	  DOSISH filesystems. (fix: CVE-2008-1891)
-	  Note: NTFS/FAT filesystem should not be published by the platforms
-	  other than Windows. Pathname interpretation (including short
-	  filename) is less than perfect.
+Fri Jun 30 21:20:14 2017  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/webrick/httpservlet/abstract.rb
-	  (WEBrick::HTTPServlet::AbstracServlet#redirect_to_directory_uri):
-	  should escape the value of Location: header.
+	* thread.c (ruby_thread_stack_overflow): disable VM events when stack
+	  overflow occurred; it causes another stack overflow again in making
+	  backtrace object, and crashes. [Bug #13425]
 
-	* lib/webrick/httpservlet/cgi_runner.rb: accept interpreter
-	  command line arguments.
+	* vm.c (hook_before_rewind): skip rewind hooks if err is
+	  SystemStackError because rewind hooks can cause stack overflow again
+	  and again.
 
-Sun May 18 01:57:44 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* thread.c (ruby_thread_stack_overflow): do not disable all hooks.
+	  Additionally, clearing ruby_vm_event_flags is not suitable way
+	  to disable hooks.
 
-	* file.c (isdirsep): backslash is valid path separator on cygwin too.
-	  backported from 1.8 HEAD.
+Fri Jun 30 21:13:25 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat May 17 23:53:57 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* proc.c (method_super_method): skip prepended modules and continue from
+	  the super class of the original class. [Bug #13656]
 
-	* file.c (file_expand_path): fix for short file name on Cygwin.
+Fri Jun 30 21:10:48 2017  Shugo Maeda  <shugo@ruby-lang.org>
 
-Sat May 17 23:50:29 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/net/smtp.rb (getok, get_response): raise an ArgumentError when
+	  CR or LF is included in a line, because they are not allowed in
+	  RFC5321.  Thanks, Jeremy Daer.
 
-	* file.c (OpenFile): prevent conflict on Windows.
+Fri Jun 30 21:07:56 2017  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* file.c (USE_NTFS): fixed merge miss.
+	* eval.c (exc_setup_cause): need to unfreeze(=dup) the exception before
+	  setting cause if its frozen.
 
-Sat May 17 12:36:46 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Jun 30 21:07:14 2017  Eric Wong  <e@80x24.org>
 
-	* file.c (file_expand_path): rb_str_set_len is not backported.
+	thread.c: avoid busy looping on rb_thread_fd_close
 
-Sat May 17 12:15:48 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	We no longer use it this function, but extensions do, and
+	we need to ensure it continues to work for them.
 
-	* file.c (file_expand_path): support for alternative data stream
-	  and ignored trailing garbages of NTFS.
+	* thread.c (rb_thread_fd_close): schedule other threads in loop
 
-	* file.c (rb_file_s_basename): ditto.
+	* ext/-test-/thread_fd_close/thread_fd_close.c: new file
 
-	* file.c (rb_file_s_extname): ditto.
+	* ext/-test-/thread_fd_close/depend: ditto
 
-Mon Mar  3 23:34:13 2008  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* ext/-test-/thread_fd_close/extconf.rb: ditto
 
-	* lib/webrick/httpservlet/filehandler.rb: should normalize path
-	  separators in path_info to prevent directory traversal attacks
-	  on DOSISH platforms.
-	  reported by Digital Security Research Group [DSECRG-08-026].
+	* test/-ext-/thread_fd_close/test_thread_fd_close.rb: new test
 
-	* lib/webrick/httpservlet/filehandler.rb: pathnames which have
-	  not to be published should be checked case-insensitively.
+Fri Jun 30 20:34:49 2017  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-Mon Dec  3 08:13:52 2007  Kouhei Sutou  <kou@cozmixng.org>
+	* sample/pty/shl.rb: update sample
+	  * Specify frozen_string_literal: true.
+	  * Fix TypeError of raise.
+	  * Use a character literal instead of Integer.
 
-	* test/rss/test_taxonomy.rb, test/rss/test_parser_1.0.rb,
-	  test/rss/test_image.rb, test/rss/rss-testcase.rb: ensured
-	  declaring XML namespaces.
+Fri Jun 30 20:31:59 2017  Marcus Stollsteimer  <sto.mar@web.de>
 
-Sun Sep 23 21:57:25 2007  GOTOU Yuuzou  <gotoyuzo@notwork.org>  
+	* string.c: [DOC] clarify docs for String#split when called with limit
+	  and capture groups. Reported by Cichol Tsai. [Bug #13621]
 
-	* lib/net/http.rb: an SSL verification (the server hostname should
-	  be matched with its certificate's commonName) is added.
-	  this verification can be skipped by
-	  "Net::HTTP#enable_post_connection_check=(false)".
-	  suggested by Chris Clark <cclark at isecpartners.com>
+Fri Jun 30 20:23:31 2017  Takashi Kokubun  <takashikkbn@gmail.com>
 
-	* lib/net/open-uri.rb: use Net::HTTP#enable_post_connection_check to
-	  perform SSL post connection check.
+	* lib/erb.rb: Allow explicit trimming carriage return when trim_mode is
+	  "-", for Windows environments. [Bug #5339]
 
-	* ext/openssl/lib/openssl/ssl.c
-	  (OpenSSL::SSL::SSLSocket#post_connection_check): refine error message.
+	* lib/erb.rb: Allow trimming CR in all trim_modes to unify a behavior
+	  with r58823 and r58825.
 
-Sun Sep 23 07:49:49 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Jun 30 20:16:15 2017  Takashi Kokubun  <takashikkbn@gmail.com>
 
-	* eval.c, intern.h, ext/thread/thread.c: should not free queue while
-	  any live threads are waiting.  [ruby-dev:30653]
+	* lib/erb.rb: Allow trimming carriage return when trim_mode is "<>", for
+	  Windows environments. [Bug #11464]
 
-Sun Sep 23 06:05:35 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Jun 30 20:07:37 2017  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/stringio/stringio.c (strio_init): separate from strio_initialize
-	  to share with strio_reopen properly.  [ruby-Bugs-13919]
+	* util.c (ruby_strtod) Merge latest dtoa.c [Bug #13545]
+	  Apply some part of http://www.netlib.org/fp/dtoa.c with my eyes...
 
-Sun Sep 23 05:42:35 2007  URABE Shyouhei  <shyouhei@ruby-lang.org>
+Fri Jun 30 20:00:18 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/rdoc/options.rb (Options::check_diagram): dot -V output
-	  changed. [ ruby-Bugs-11978 ], Thanks Florian Frank.
+	* dir.c (is_case_sensitive): use getattrlist() if fgetattrlist() is
+	  unavailable, on OSX 10.5. [Bug #11054]
 
-Wed Sep 19 11:13:07 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Jun 30 19:58:16 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* bignum.c (bigtrunc): RBIGNUM(x)->len may be zero.  out of bound
-	  access.  [ruby-dev:31404]
+	* tool/mkconfig.rb (RbConfig): prefix SDKROOT to oldincludedir
+	  not includedir, the latter is outside the ruby installation.
+	  [ruby-core:72496] [Bug #11881]
 
-Mon Sep 17 05:24:13 2007  Sylvain Joyeux <sylvain.joyeux@m4x.org>
+Fri Jun 30 19:56:06 2017  Eric Wong  <e@80x24.org>
 
-	* ext/thread/thread.c (lock_mutex): should take care of threads
-	  not waiting any longer; there cases of a thread raising
-	  exceptions. [ ruby-Bugs-11901 ]
+	* variable.c (check_autoload_required): do not assume a provided feature
+	  means autoload is complete, always wait if autoload is being performed
+	  by another thread. [Bug #11384] Thanks to s.wanabe@gmail.com
 
-	* test/thread/test_thread.rb (test_mutex_exception_handling):
-	  test for above.
+Fri Jun 30 19:53:30 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Sep 17 05:01:55 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* process.c (obj2uid, obj2gid): use temporary string as the buffer
+	  instead of rb_alloc_tmp_buffer, which is NODE_ALLOCA since r51492.
+	  [Bug #13554]
 
-	* runruby.rb: fix incomplete backport r12339.
+Fri Jun 30 19:50:25 2017  Eric Wong  <e@80x24.org>
 
-Mon Sep 17 04:56:28 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* variable.c (autoload_reset): use idempotent list_del_init
 
-	* test/thread/test_thread.rb (test_local_barrier),
-	  test/thread/lbtest.rb: test for [ruby-dev:30653].
+	* variable.c (autoload_sleep): moved code from rb_autoload_load
 
-Mon Sep 17 04:52:21 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* variable.c (autoload_sleep_done): cleanup for use with rb_ensure
 
-	* ruby.c (proc_options): -W should be allowed in RUBYOPT
-	  environment variable.  [ruby-core:12118]
+	* variable.c (rb_autoload_load): ensure list delete happens in case the
+	  thread dies during sleep
 
-Mon Sep 17 04:37:10 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/ruby/bug-13526.rb: new script for separate execution
 
-	* range.c (range_step): fixed integer overflow.  [ruby-dev:31763]
+	* test/ruby/test_autoload.rb (test_bug_13526): new test [Bug #13526]
 
-Fri Sep  7 17:06:16 2007  Vincent Isambart <vincent.isambart@gmail.com>
+Fri Jun 30 19:46:46 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (rb_thread_start_0): should unset time_thread_alive_p.
-	  [ruby-talk:257219], [ruby-core:11542], [ruby-dev:31253]
+	* sprintf.c (rb_str_format): while "% 2f" and "% 4f" result in " Inf"
+	  and " Inf" respectively, "% 3f" results in "Inf" (no space).
 
-Fri Sep  7 16:39:23 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* sprintf.c (rb_str_format): as for non-finite float, calculate the
+	  exact needed size with the space flag.
 
-	* array.c (rb_ary_subseq): need integer overflow check.
-	  [ruby-dev:31736]
+Fri Jun 30 19:41:48 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* array.c (rb_ary_splice): ditto.  [ruby-dev:31737]
+	* thread_win32.c (w32_wait_events): do not acquire GVL, to fix deadlock
+	  at read/close race condition. instead, just ignore interrupt_event if
+	  it is closed.
 
-	* array.c (rb_ary_fill): ditto.  [ruby-dev:31738]
+	* thread_win32.c (w32_wait_events): fix wait object index in the case of
+	  interrupt_event is not usable.
 
-	* string.c (rb_str_splice): integer overflow for length.
-	  [ruby-dev:31739]
+Fri Jun 30 19:37:47 2017  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Fri Sep  7 16:33:23 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* io.c (nogvl_wait_for_single_fd): nogvl_wait_for_single_fd must wait
+	  as its name.
+	  poll(fds, n, 0) mean no timeout and immediately return. If you want to
+	  wait something, you need to use -1 instead.
 
-	* include/ruby/defines.h (flush_register_windows): call "ta 0x03"
-	  even on Linux/Sparc.  [ruby-dev:31674]
+Fri Jun 30 19:35:31 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Sep  7 16:09:39 2007  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
+	* class.c (Init_class_hierarchy): prevent rb_cObject which is the class
+	  tree root, from GC. [Bug #12492]
 
-	* ext/win32ole/win32ole.c (ole_type_progid, reg_enum_key, 
-	  reg_get_val, ole_wc2mb): fix the bug. Thanks, arton. 
-	  [ruby-dev:31576]
+Fri Jun 30 19:32:52 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Sep  7 15:50:50 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* class.c (Init_class_hierarchy): prevent rb_cObject which is the
+	  class tree root, from GC.  [ruby-dev:49666] [Bug #12492]
 
-	* eval.c (mnew): should preserve noex as safe_level.
+Fri Jun 30 19:29:45 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (rb_call0): tighten security check condition..
+	* ext/ripper/lib/ripper/lexer.rb (on_heredoc_dedent): fix for nested
+	  indedented here documents, where Elems are nested too. [Bug #13536]
 
-Fri Sep  7 15:43:43 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/ripper/lib/ripper/lexer.rb (on_heredoc_dedent): insert stripped
+	  leading spaces as on_ignored_sp elements, so that the original source
+	  can be reconsructed. [Bug #13536]
 
-	* ext/tk/tcltklib.c (Init_tcltklib): use rb_set_end_proc().
+Mon May  1 06:36:57 2017  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Fri Sep  7 15:42:07 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* parse.y (parser_parse_string): set the mark of term to `nd_func`
+	  because in this version `u2.id` is not used for this purpose.
+	  fixed failure of ruby/spec introduced at r58518.
+	  see also [Backport #13363]
 
-	* process.c (detach_process_watcher): should not pass the pointer
-	  to an auto variable to the thread to be created.  pointed and
-	  fix by KUBO Takehiro <kubo at jiubao.org>  [ruby-dev:30618]
+Sun Apr 30 23:01:00 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Sep  7 15:40:47 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	class.c: ensure_includable
 
-	* sample/test.rb, test/ruby/test_system.rb(valid_syntax?): keep
-	  comment lines first.
+	* class.c (ensure_includable): extract checks to include and
+	  prepend.
 
-Wed Aug 22 12:40:15 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	class.c: prohibit refinement module
 
-	* hash.c (rb_hash_delete_key): delete the entry without calling block.
+	* class.c (ensure_includable): cannot include refinement
+	  module, or the type and the class do not match.
+	  [ruby-core:79632] [Bug #13236]
 
-	* hash.c (rb_hash_shift): should consider iter_lev too.
+Sun Apr 30 22:55:41 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* hash.c (delete_if_i): use rb_hash_delete_key() so that the block
-	  isn't called twice.  [ruby-core:11556]
+	keep line number after unterminated string literal
 
-Sun Arg 12 03:56:30 2007  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+	* parse.y (parser_parse_string): keep line number even after an
+	  unterminated string literal.  it does not matter in the parser,
+	  ripper needs this value after this error.
 
-	* lib/rinda/tuplespace.rb: fix Rinda::TupleSpace keeper thread bug.
-	  the thread is started too early. [ruby-talk:264062] 
+	parse.y: unterminated content token
 
-	* test/rinda/test_rinda.rb: ditto.
+	* parse.y (parser_parse_string): defer the end token to next
+	  reading, to yield tSTRING_CONTENT with the unterminated content.
+	  [Bug #13363]
 
-Wed Aug 22 12:31:15 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sun Apr 30 22:52:38 2017  Marcus Stollsteimer  <sto.mar@web.de>
 
-	* configure.in (ac_cv_func_isinf): set yes also on OpenSolaris.
-	  [ruby-Bugs-12859]
+	* io.c: [DOC] expand docs for IO#puts
+	  [Bug #13306]
 
-Wed Aug 22 12:30:42 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sun Apr 30 22:38:44 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/rexml/encodings/{ISO-8859-15,CP-1252}.rb: fixed invalid syntax.
+	sample/pty/shl.rb: update [ci skip]
 
-Wed Aug 22 12:29:36 2007  Tadayoshi Funaba  <tadf@dotrb.org>
+	* sample/pty/shl.rb: stop writer loop when the child exited.
+	  PTY::ChildExited no longer raises asynchronously since r20298.
+	  [ruby-dev:49974] [Bug #13191]
 
-	* lib/README: fixed a typo.
+	* sample/pty/shl.rb: use io/console instead of stty.
+	  [ruby-dev:49974] [Bug #13191]
 
-Wed Aug 22 12:13:54 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* sample/pty/shl.rb: do not manage array length separately.
+	  [ruby-dev:49974] [Bug #13191]
 
-	* ext/extmk.rb (extmake): save all CONFIG values.
+	* sample/pty/shl.rb: leap exited child process.
+	  [ruby-dev:49974] [Bug #13191]
 
-	* ext/extmk.rb (extmake): remove mkmf.log at clean, and extconf.h at
-	  distclean, respectively.
+Sun Apr 30 22:35:10 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/extmk.rb: remove rdoc at clean, and installed list file at
-	  distclean, respectively.
+	configure.in: use AC_SEARCH_LIBS
 
-Wed Aug 22 11:49:00 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* configure.in (--with-gmp, --with-jemalloc): use AC_SEARCH_LIBS
+	  to check if no library is required, instead of AC_CHECK_LIB.
+	  [ruby-core:79368] [Bug #13175]
 
-	* sprintf.c (rb_f_sprintf): should not check positional number as
-	  width.  [ruby-core:11838]
+Sun Apr 30 22:24:25 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Aug 22 11:47:11 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* numeric.c (flo_round): [EXPERIMENTAL] adjust the case that the
+	  receiver is close to the exact but unrepresentable middle value
+	  of two values in the given precision.
+	  http://d.hatena.ne.jp/hnw/20160702
 
-	* bignum.c (rb_big_aref): check for Bignum index range.
-	 [ruby-dev:31271]
+Sun Apr  9 22:21:23 2017  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Wed Aug 22 11:41:44 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	thread.c: rb_thread_fd_close [ci skip]
 
-	* dln.c (conv_to_posix_path): removed.
+	* thread.c (rb_thread_fd_close): re-define because of a couple of
+	  external libraries used it.
 
-	* ruby.c (rubylib_mangled_path, rubylib_mangled_path2): return
-	  VALUE instead of a pointer to static buffer.
+Wed Mar 29 23:47:31 2017  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
 
-	* ruby.c (push_include_cygwin): fixed buffer overflow.
-	  [ruby-dev:31297]
+	* hash.c (any_hash): fix CI failure on L32LLP64 architecture.
+	  The patch was provided by usa. [ruby-core:80484] [Bug #13376]
 
-	* ruby.c (ruby_init_loadpath): not convert built-in paths.
+Wed Mar 29 06:22:27 2017  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
 
-Wed Aug 22 11:39:31 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* hash.c (any_hash): fix Symbol#hash to be nondeterministic.
+	  The patch was provided by Eric Wong. [ruby-core:80433] [Bug #13376]
 
-	* intern.h (is_ruby_native_thread): removed since declared as an int
-	  function in ruby.h already.
+	* test/ruby/test_symbol.rb: add test for above.
 
-Wed Aug 22 11:00:20 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Mar 28 00:38:39 2017  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/mkmf.rb (init_mkmf): should remove mkmf.log too.
+	* win32/win32.c (poll_child_status): rb_w32_wait_events_blocking() sets
+	  errno internally, then should not set it here.
 
-Wed Aug 22 10:57:50 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon Mar 27 20:15:17 2017  Kazuki Tsujimoto  <kazuki@callcc.net>
 
-	* ext/openssl/ossl_config.c (ossl_config_set_section): do not
-	  initialize aggregations with dynamic values.  [ruby-talk:259306]
+	* eval.c, method.h, proc.c, vm.c, vm_eval.c, vm_insnhelper.c, vm_method.c:
+	  TracePoint#method_id should return method_id, not callee_id.
+	  [ruby-core:77241] [Feature #12747]
 
-Wed Aug 22 10:55:00 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/ruby/test_settracefunc.rb: change accordingly.
 
-	* eval.c (get_backtrace): check the result more.
-	  [ruby-dev:31261] [ruby-bugs-12398]
+Mon Mar 27 20:12:23 2017  Anton Davydov  <mail@davydovanton.com>
 
-Wed Aug 22 10:36:15 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/uri/mailto.rb: Removed needless `return` and use `.`` instead of `::`
+	  with class method.
+	* test/uri/test_mailto.rb: Added tests for coverage.
 
-	* bignum.c (rb_big_lshift, rb_big_rshift): separated functions
-	  to get rid of infinite recursion.  fixed calculation in edge
-	  cases.  [ruby-dev:31244]
+Mon Mar 20 06:35:08 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* numeric.c (rb_fix_lshift, rb_fix_rshift): ditto.
+	* ruby.c (process_options): convert -e script to the encoding
+	  given by a command line option on Windows.  assume it is the
+	  expected encoding.  [ruby-dev:49461] [Bug #11900]
 
-Wed Aug 22 10:29:45 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon Mar 20 05:47:49 2017  Koichi Sasada  <ko1@atdot.net>
 
-	* bignum.c (rb_big_pow): refine overflow check.  [ruby-dev:31242]
+	* test/ruby/test_exception.rb: fix thread issues.
+	  * use Queue instead of a local variable for synchronization.
+	  * join created thread to soleve leaking threads warning.
 
-Wed Aug 22 10:26:59 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Mon Mar 20 05:47:49 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* time.c (time_succ): Time#succ should return a time object in the
-	  same timezone mode to the original.  [ruby-talk:260256]
+	* thread.c (rb_threadptr_raise): set cause from the called thread,
+	  but not from the thread to be interrupted.
+	  [ruby-core:77222] [Bug #12741]
 
-Wed Aug 22 10:24:00 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Wed Feb  8 02:17:02 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* numeric.c (fix_pow): integer power calculation: 0**n => 0, 
-	  1**n => 1, -1**n => 1 (n: even) / -1 (n: odd).
+	* lib/forwardable.rb (Forwardable._delegator_method): extract
+	  method generator and deal with non-module objects.
+	  [ruby-dev:49656] [Bug #12478]
 
-	* test/ruby/test_fixnum.rb (TestFixnum::test_pow): update test
-	  suite.  pow(-3, 2^64) gives NaN when pow(3, 2^64) gives Inf.
+Wed Feb  8 02:17:02 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Aug 22 10:23:01 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/forwardable.rb (def_instance_delegator): adjust backtrace of
+	  method body by tail call optimization.  adjusting the delegated
+	  target is still done by deleting backtrace.
 
-	* lib/base64.rb (Base64::b64encode): should not specify /o option
-	  for regular expression.  [ruby-dev:31221]
+	* lib/forwardable.rb (def_single_delegator): ditto.
 
-Wed Aug 22 10:20:32 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Jan 17 03:51:48 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* sprintf.c (rb_f_sprintf): more checks for format argument.
-	  [ruby-core:11569], [ruby-core:11570], [ruby-core:11571],
-	  [ruby-core:11573]
+	* compile.c (setup_args): duplicate splatting array if more
+	  arguments present to obey left-to-right execution order.
+	  [ruby-core:77701] [Bug# 12860]
 
-Wed Aug 22 10:13:45 2007  pegacorn  <subscriber.jp AT gmail.com>
+Thu Nov 24 05:47:18 2016  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
 
-	* ext/digest/digest.c (rb_digest_instance_update,
-	  rb_digest_instance_finish, rb_digest_instance_reset,
-	  rb_digest_instance_block_length): %s in rb_raise() expects char*.
-	  [ruby-dev:31222]
+	* test/fileutils/test_fileutils.rb (TestFileUtils#setup): Use primary
+	  group as well as supplementary groups.
+	  based on the patch by Vit Ondruch at [Bug #12910]
 
-	* ext/openssl/ossl.h: include ossl_pkcs5.h.  [ruby-dev:31231]
+Thu Nov 24 05:44:04 2016  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
 
-	* ext/openssl/ossl_pkcs5.h: new file for PKCS5.  [ruby-dev:31231]
+	* test/ruby/test_dir_m17n.rb: Don't encode to UTF-8 if it's unnecessary.
+	  If the file system encoding is ISO-8851-1 or if the encoding of the
+	  target string is invalid, don't encode to UTF-8. [Bug#12972]
 
-	* ext/openssl/ossl_x509name.c (ossl_x509name_to_s): use ossl_raise()
-	  instead of rb_raise().  [ruby-dev:31222]
+Mon Nov 21 16:55:15 2016  boshan  <boshan@subsplash.com>
 
-	* ext/sdbm/_sdbm.c: DOSISH platforms need io.h.  [ruby-dev:31232]
+	* lib/tempfile.rb (Tempfile#initialize): [DOC] the first parameter
+	  `basename` is optional and defaulted to an empty string since
+	  [GH-523].  [Fix GH-1225]
 
-	* ext/syck/syck.h: include stdlib.h for malloc() and free().
-	  [ruby-dev:31232]
+Sat Nov 19 14:06:07 2016  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
 
-	* ext/syck/syck.h (syck_parser_set_input_type): prototype added.
-	  [ruby-dev:31231]
+	* iseq.c (proc_dup): don't duplicate sym_procs.  [Fix GH-1479]
+	  [ruby-core:78100] [Bug #12927]
+	  Based on the patch provided by Emiliano Ritiro.
 
-	* win32/win32.c: include mbstring.h for _mbspbrk().  [ruby-dev:31232]
+Sat Nov 19 11:48:47 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* win32.h (rb_w32_getcwd): prototype added.  [ruby-dev:31232]
+	* iseq.c (iseqw_s_compile_file): deal with syntax error as well as
+	  compile, and should not abort when rescued.
 
-Wed Aug 22 10:11:59 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Nov 16 23:40:29 2016  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
 
-	* bignum.c (rb_cstr_to_inum): check leading non-digits.
-	  [ruby-core:11691]
+	* vm_eval.c (vm_call0_body): refined module should not be skipped as
+	  prepended. [Bug #12920]
 
-Wed Aug 22 10:07:48 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Nov 15 03:14:02 2016  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* bignum.c (rb_big_neg): SIGNED_VALUE isn't in 1.8.
+	* ext/-test/file/fs.c (get_atime_p): Updating of file access times
+	  is enabled or not.
 
-	* bignum.c (bigtrunc): do not empty Bignum.  [ruby-dev:31229]
+Tue Nov 15 03:14:02 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Aug 22 10:02:42 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/ruby/test_file.rb (TestFile#test_stat): fix noatime case.
+	  [ruby-core:77943] [Bug #12903]
 
-	* numeric.c (fix_pow): 0**2 should not raise floating point
-	  exception.  [ruby-dev:31216]
+Tue Nov 15 03:09:39 2016  Shugo Maeda  <shugo@ruby-lang.org>
 
-Wed Aug 22 10:01:08 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/rinda/test_rinda.rb (test_make_socket_ipv6_multicast,
+	  test_make_socket_ipv6_multicast_hops): skip if IPv6 multicast 
+	  address is not available.
 
-	* win32/win32.c (CreateChild): enclose command line except for
-	  command.com which can not handle quotes.  [ruby-talk:258939]
+Tue Nov 15 02:49:30 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Aug 22 09:58:30 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* vm_eval.c (vm_call0_body): follow the original class, not to
+	  loop the prepended module.  [ruby-core:77784] [Bug #12876]
 
-	* lib/mkmf.rb (link_command, cc_command, cpp_command): do not expand
-	  ::CONFIG which is an alias of MAKEFILE_CONFIG.
+Tue Nov 15 02:45:44 2016  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Wed Aug 22 09:55:08 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/net/http.rb (transport_request): other than HTTPContinue
+	  in 1xx (HTTPInformation) also needs to continue. [Bug #12890]
 
-	* struct.c (rb_struct_init_copy): disallow changing the size.
-	  [ruby-dev:31168]
+Sat Nov 12 01:05:45 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Wed Aug 22 09:54:28 2007  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* object.c: Improve documentation for Float conversion.
+	  [ruby-core:71661][Bug #11736][ci skip]
 
-	* random.c: documentation fix.  srand(0) initializes PRNG with '0',
-	  not with random_seed.
+Sat Nov 12 00:50:35 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Aug 22 09:53:14 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* proc.c (mnew_internal): follow the original class, not to loop
+	  the prepended module.  [ruby-core:77591] [Bug #12832]
 
-	* bcc32/{Makefile.sub,setup.mak}: remove surplus slash from srcdir.
+Sat Nov 12 00:46:50 2016  Shugo Maeda  <shugo@ruby-lang.org>
 
-Wed Aug 22 09:46:25 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* cont.c (cont_new): disable optimization if clang's version is
+	  3.8.0.  [ruby-core:77894] [Bug #12893]
 
-	* sprintf.c (rb_f_sprintf): sign bit extension should not be done
-	  if FPLUS flag is specified.  [ruby-list:39224]
+Sat Nov 12 00:27:24 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Aug 22 09:41:56 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* compile.c (iseq_peephole_optimize): enable tail call
+	  optimization inside a conditional block.
 
-	* array.c (rb_ary_initialize): should call rb_ary_modify() first.
-	  [ruby-core:11562]
+Sat Nov  5 11:53:17 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Aug 22 09:40:25 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* io.c (copy_stream_body): use IO to write to copy to duplex IO.
+	  http://twitter.com/knu/status/786505317974585344
 
-	* parse.y (yylex): return non-valid token for an invalid
-	  instance/class variable name.  a patch from from Yusuke ENDOH
-	  <mame AT tsg.ne.jp>.  [ruby-dev:31095]
+Sat Nov  5 11:49:41 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Aug 22 09:39:26 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* sprintf.c (rb_str_format): format exact number more exactly.
 
-	* parse.y (dsym): return non-null NODE even if yyerror().  based on a
-	  patch from from Yusuke ENDOH <mame AT tsg.ne.jp>.  [ruby-dev:31085]
+Sat Nov  5 11:45:32 2016  Kazuki Yamaguchi  <k@rhe.jp>
 
-Wed Aug 22 09:38:43 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/openssl/ossl.c (Init_openssl): register an ex_data index for
+	  X509_STORE and X509_STORE_CTX respectively. Since they don't share
+	  the ex_data index registry, we can't use the same index.
+	  (ossl_verify_cb): use the the correct index.
 
-	* process.c (proc_exec_v, rb_proc_exec): preserve errno.
+	* ext/openssl/ossl_ssl.c (ossl_ssl_verify_callback): ditto.
 
-Wed Aug 22 09:00:23 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/openssl/ossl_x509store.c (ossl_x509store_set_vfy_cb): ditto.
+	  (ossl_x509stctx_verify): ditto.
 
-	* eval.c (ruby_cleanup): return EXIT_FAILURE if any exceptions occured
-	  in at_exit blocks.  [ruby-core:11263]
+	* ext/openssl/ossl.h (void ossl_clear_error): add extern declarations
+	  of ossl_store_{ctx_,}ex_verify_cb_idx.
 
-Wed Aug 22 08:52:02 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/openssl/openssl_missing.c: remove X509_STORE_set_ex_data and
+	  X509_STORE_get_ex_data.
 
-	* variable.c (rb_path2class): get rid of dangling pointer caused by
-	  optimized out value.
+	* ext/openssl/openssl_missing.h: implement X509_STORE_get_ex_data,
+	  X509_STORE_set_ex_data and X509_STORE_get_ex_new_index as macros.
 
-Wed Aug 22 08:51:20 2007  NAKAMURA Usaku  <usa@ruby-lang.org>
+Sat Nov  5 11:35:58 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/dl/lib/dl/win32.rb: seems that dl doesn't accept void argument.
-	  fixed [ruby-bugs:PR#5489].
+	* thread.c (rb_thread_pending_interrupt_p): no pending interrupt
+	  before initialization.
 
-Wed Aug 22 08:49:47 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* thread.c (thread_raise_m, rb_thread_kill): uninitialized thread
+	  cannot interrupt.  [ruby-core:72732] [Bug #11959]
 
-	* configure.in (darwin): prohibit loading extension libraries to
-	  miniruby.
+Sat Nov  5 11:16:58 2016  Kenta Murata  <mrkn@mrkn.jp>
 
-Wed Aug 22 08:34:20 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/bigdecimal/bigdecimal.c: Import changes from ruby/bigdecimal
+	  repository.
 
-	* eval.c (rb_kill_thread): renamed in order to get rid of conflict
-	  with a BeOS system function.  [ruby-core:10830]
+Tue Oct 18 02:58:22 2016  Kazuki Yamaguchi  <k@rhe.jp>
 
-Wed Aug 22 08:32:32 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* eval_intern.h (TH_PUSH_TAG): Initialize struct rb_vm_tag::tag with
+	  Qundef rather than 0 which is equal to Qfalse. Since Kernel#throw(obj)
+	  searches a tag with rb_vm_tag::tag == obj, throw(false) can
+	  accidentally find an unrelated tag which is not created by
+	  Kernel#catch.  [ruby-core:77229] [Bug #12743]
 
-	* process.c (ruby_setreuid, ruby_setregid): rename to get rid of name
-	  clash.
-Wed Aug 22 08:27:53 2007  Shugo Maeda  <shugo@ruby-lang.org>
+	* test/ruby/test_exception.rb (test_throw_false): Add a test case for
+	  this.
 
-	* lib/net/imap.rb (ResponseParser#next_token): fixed
-	  error message. (backported from HEAD)
+Tue Oct 18 02:24:29 2016  Aurelien Jacobs  <aurel@gnuage.org>
 
-	* lib/net/imap.rb (ResponseParser#parse_error): fixed
-	  the condition not to refer @token.symbol unexpectedly.
-	  Thanks, Dick Monahan. (backported from HEAD)
+	* lib/logger.rb (Logger::Period#next_rotate_time): fix monthly log
+	  rotate when DST is applied during a month of 31 days.
+	  [Fix GH-1458]
 
-Wed Aug 22 08:26:33 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Wed Oct 12 22:31:09 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* marshal.c (w_extended): erroneous check condition when dump
-	  method is defined.  [ruby-core:10646]
+	* tool/downloader.rb: Removed verification of gem certification.
+	  Because signed gem is not working on rubygems ecosystem.
+	* tool/gem-unpack.rb: ditto.
 
-Mon Jun 18 11:29:49 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Oct  7 02:48:06 2016  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
 
-	* intern.h, ext/thread/thread.c: moved prototype of rb_thread_status()
-	  to get rid of error in C++.  [ruby-list:43615]
+	* lib/rubygems/ssl_certs/GlobalSignRootCA.pem: add for RugyGems.org.
 
-Sun Jun 10 13:47:36 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon Sep 26 23:51:31 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/ruby/test_beginendblock.rb (test_should_propagate_signaled):
-	  get rid of invoking shell.  [ruby-dev:30942]
+	* variable.c (rb_const_search): raise with the actual class/module
+	  name which defines the private constant.
 
-Sat Jun  9 10:40:00 2007  URABE Shyouhei  <shyouhei@ruby-lang.org>
+Mon Sep 26 23:34:09 2016  Kazuki Yamaguchi  <k@rhe.jp>
 
-	* stable version 1.8.6-p36 released.
+	* ext/openssl/ossl_pkcs12.c (ossl_pkcs12_initialize): pop errors
+	  leaked by PKCS12_parse(). This is a bug in OpenSSL, which exists
+	  in the versions before the version 1.0.0t, 1.0.1p, 1.0.2d.
 
-Fri Jun  8 17:50:17 2007  NAKAMURA Usaku  <usa@ruby-lang.org>
+Mon Sep 26 23:10:43 2016  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* eval.c (rb_thread_cancel_timer): fix undefined function
+	* vm_dump.c (backtrace): use rip in the saved context for the case
+	  the SIGSEGV is received when the process is in userland.
+	  Note that ip in the stack should be used if the signal is received
+	  when it is in kernel (when it is calling syscall) [Bug #12711]
 
-Wed May 30 05:17:55 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon Sep 26 20:23:32 2016  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
 
-	* eval.c (rb_eval): get rid of SEGV at ZSUPER in a block
-	  [ruby-dev:30836]
+	* gems/bundled_gems: update minitest to 5.8.5.
 
-Wed May 30 04:29:43 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* tool/downloader.rb: revert workarounds.
 
-	* eval.c (thread_timer): timer thread should not receive any
-	  signals.  submitted by Sylvain Joyeux.  [ruby-core:08546]
+	* tool/gem-unpack.rb: ditto.
 
-Wed May 30 04:18:37 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon Sep 26 07:26:44 2016  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
 
-	* eval.c (rb_eval_cmd): just return if no exceptions.
-	  [ruby-dev:30820]
+	* tool/gem-unpack.rb: don't set security policy.
+	  workaround for certificate expiration of minitest-5.8.3.gem.
 
-Tue May 29 11:01:06 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon Sep 26 06:33:16 2016  Aaron Patterson <tenderlove@ruby-lang.org>
 
-	* win32/win32.c (rb_w32_opendir): store attributes of the second
-	  entries or later too.
+	* lib/uri/generic.rb (def check_password): don't include bad password
+	  in URI exception output
 
-	* win32/win32.c (rb_w32_opendir, rb_w32_readdir): eliminate magic
-	  numbers.
+	* test/uri/test_generic.rb (def test_set_component): test for behavior
 
-Thu Jun  7 20:10:51 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon Sep 26 06:20:58 2016  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
 
-	* eval.c, intern.h, ext/thread/thread.c: should not free queue
-	  while any live threads are waiting.
-	  [ruby-dev:30653]
+	* tool/downloader.rb: comment out gem package verification.
+	  workaround for certificate expiration of minitest-5.8.3.gem.
 
-Thu Jun  7 14:53:46 2007  URABE Shyouhei  <shyouhei@ruby-lang.org>
+Sun Sep 25 16:37:22 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* eval.c (method_inspect): show proper class name.
-	  [ruby-talk:248647], Thanks Calamitas.
+	* io.c (nogvl_fsync, nogvl_fdatasync): on Windows, just ignore if the
+	  fd is associated to non-disk device.  if call fsync and/or fdatasync
+	  with such fds, it causes Errno::EBADF exception and the behavior is
+	  incompatible with ruby 2.1 and earlier unintentionally introduced.
 
-Sun May 27 05:24:56 2007  URABE Shyouhei  <shyouhei@ruby-lang.org>
+Sun Sep 25 15:09:04 2016  Kazuki Tsujimoto  <kazuki@callcc.net>
 
-	* runruby.rb: eliminate uninitialized variable.
-	  [ruby-core:11255]
+	* array.c (flatten): use rb_obj_class instead of rb_class_of
+	  because rb_class_of may return a singleton class.
+	  [ruby-dev:49781] [Bug #12738]
 
-Sun May 27 05:19:03 2007  URABE Shyouhei  <shyouhei@ruby-lang.org>
+Sun Sep 25 15:07:19 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (mnew): call of super via a method object should work again.
-	  [ruby-talk:248647], Thanks Calamitas.
+	* man/irb.1: remove useless -width option.
+	  [ruby-dev:49767] [Bug #12692]
 
-	* test/ruby/test_method.rb (TestMethod::test_method_super): test for
-	  above fix.
+Tue Aug 30 05:24:33 2016  Kazuki Yamaguchi  <k@rhe.jp>
 
-Wed May 23 07:29:53 2007  URABE Shyouhei  <shyouhei@ruby-lang.org>
+	* ext/openssl/ossl_x509ext.c: additional fix memory leak.
+	  [ruby-core:76922] [Bug #12680]
 
-	* process.c (proc_exec_v): terminate timer thread in advance.
-	  [ruby-dev:30581], Thanks H. Holon.
+	* text/openssl/test_x509ext.rb: test for above.
 
-Wed May 23 06:51:46 2007  URABE Shyouhei  <shyouhei@ruby-lang.org>
+Sun Aug 28 00:26:58 2016  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
 
-	* lib/cgi.rb (CGI#[]): get rid of exceptions being raised.
-	  [ruby-dev:30740], Thanks Kentaro KAWAMOTO.
+	* vm_method.c: revert r55869. it breaks Integer#days with
+	  ActiveSupport-4.1.x. [ruby-core:76949] [Bug #12353]
 
-Wed May 23 05:49:49 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/ruby/test_marshal.rb: ditto.
 
-	* ext/extmk.rb, ext/purelib.rb, lib/mkmf.rb, runruby.rb: clear default
-	  load path to get rid of load pre-installed extensions/libraries.
-	  [ruby-core:11017]
+Sat Aug 27 03:51:23 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed May 23 06:14:15 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* id_table.c (hash_table_extend): should not shrink the table than
+	  the previous capacity.  [ruby-core:76534] [Bug #12614]
 
-	* win32/win32.c (move_to_next_entry): loc also must move forward.
-	  [ruby-talk:251987]
+Sat Aug 27 03:37:49 2016  Kazuki Yamaguchi  <k@rhe.jp>
 
-Wed May 23 05:55:04 2007  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* ext/openssl/ossl_config.c: fix memory leak.
+	  [ruby-core:76922] [Bug #12680]
 
-	* win32/win32.c (init_stdhandle): stderr should be without buffering,
-	  but mswin32 use buffering when stderr is not connected to tty.
+	* ext/openssl/ossl_ocsp.c: ditto.
 
-Wed May 23 05:35:42 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/openssl/ossl_pkcs12.c: ditto.
 
-	* bignum.c (rb_big_pow): truncate all zero BDIGITs. [ruby-dev:30733]
+	* ext/openssl/ossl_pkcs7.c: ditto.
 
-Wed May 23 05:17:33 2007  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* ext/openssl/ossl_pkey_ec.c: ditto.
 
-	* ext/iconv/iconv.c (iconv_s_conv): rdoc fix.
+	* ext/openssl/ossl_x509.h: ditto.
 
-Wed May 23 05:10:02 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/openssl/ossl_x509attr.c: ditto.
 
-	* eval.c (rb_thread_priority): rdoc fix; the initial value is
-	  inherited from the creating thread.  [ruby-core:10607]
+	* ext/openssl/ossl_x509crl.c: ditto.
 
-Wed May 23 04:22:57 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/openssl/ossl_x509ext.c: ditto.
 
-	* dir.c (do_stat, do_lstat, do_opendir): should not warn ENOTDIR.
-	  [ruby-talk:248288]
+	* ext/openssl/ossl_x509req.c: ditto.
 
-Wed May 23 03:50:35 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/openssl/ossl_x509revoked.c: ditto.
 
-	* lib/mkmf.rb (libpathflag): not to append RPATHFLAG to current
-	  directory.
+Thu Aug 25 00:19:24 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* lib/mkmf.rb (init_mkmf): add current directory to default
-	  library path with highest priority.  [ruby-core:10960]
+	* lib/rubygems/specification.rb: `coding` is affect only first line except
+	  shebang.
+	* lib/rubygems/package.rb, lib/rubygems/package/*: ditto.
 
-	* lib/mkmf.rb (LINK_SO): LIBPATH to be placed before DLDFLAGS.
+Thu Aug 25 00:19:24 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Wed May 23 03:33:55 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/rubygems.rb, lib/rubygems/*, test/rubygems/*: Update rubygems-2.5.2.
+	  It supports to enable frozen string literal and add `--norc` option for
+	  disable to `.gemrc` configuration.
+	  See 2.5.2 release notes for other fixes and enhancements.
+	  https://github.com/rubygems/rubygems/blob/a8aa3bac723f045c52471c7b9328310a048561e0/History.txt#L3
 
-	* lib/monitor.rb (ConditionVariable#wait, mon_enter, mon_exit_for_cond):
-	  ensures Thread.critical to be false.  [ruby-talk:248300]
+Wed Aug 24 23:54:40 2016  Charles Oliver Nutter  <headius@headius.com>
 
-Wed May 23 03:25:13 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/ruby/test_array.rb: split out the test for no stack error
+	  on large input for test_permutation, test_repeated_permutation,
+	  and test_repeated_combination, and make them all timeout:30.
 
-	* util.c (ruby_strtod): exponent is radix 10.  [ruby-talk:248272]
+Tue Aug 23 03:22:34 2016  Naohisa Goto  <ngotogenome@gmail.com>
 
-Wed May 23 03:12:17 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/fiddle/test_pointer.rb (test_to_str, test_to_s, test_aref_aset):
+	  Attempt to use independent strings for destructive tests that
+	  directly modify values on memory by using Fiddle::Pointer.
+	  [Bug #12537] [ruby-dev:49700]
 
-	* configure.in (LDFLAGS): prepend -L. instead appending it to
-	  XLDFLAGS.  [ruby-core:10933]
+Tue Aug 23 03:14:22 2016  Naohisa Goto  <ngotogenome@gmail.com>
 
-	* configure.in (Makefile): remove $U for automake from MISSING.
-	  [ruby-talk:248171]
+	* string.c (str_buf_cat): Fix capa size for embed string.
+	  Fix bug in r55547. [Bug #12536]
 
-Wed May 23 02:09:32 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Tue Aug 23 03:14:22 2016  Naohisa Goto  <ngotogenome@gmail.com>
 
-	* eval.c (rb_yield_0): should not clear state on TAG_NEXT when
-	  it's invoked from within lambda body.  [ruby-talk:248136]
+	* string.c (rb_str_change_terminator_length): New function to change
+	  termlen and resize heap for the terminator. This is split from
+	  rb_str_fill_terminator (str_fill_term) because filling terminator
+	  and changing terminator length are different things. [Bug #12536]
 
-	* eval.c (proc_invoke): handle TAG_NEXT which would be caused by
-	  next in the lambda body as well.
+	* internal.h: declaration for rb_str_change_terminator_length.
 
-Wed May 23 01:55:49 2007  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* string.c (str_fill_term): Simplify only to zero-fill the terminator.
+	  For non-shared strings, it assumes that (capa + termlen) bytes of
+	  heap is allocated. This partially reverts r55557.
 
-	* win32/win32.c (rb_w32_fclose, rb_w32_close): need to save errno
-	  before calling original fclose()/close().
+	* encoding.c (rb_enc_associate_index): rb_str_change_terminator_length
+	  is used, and it should be called whenever the termlen is changed.
 
-Wed May 23 01:42:29 2007  Shugo Maeda  <shugo@ruby-lang.org>
+	* string.c (str_capacity): New static function to return capacity
+	  of a string with the given termlen, because the termlen may
+	  sometimes be different from TERM_LEN(str) especially during
+	  changing termlen or filling terminator with specific termlen.
 
-	* lib/net/imap.rb (disconnect): call shutdown for
-	  SSLSocket. Thanks, Technorama Ltd.
+	* string.c (rb_str_capacity): Use str_capacity.
 
-Wed May 23 01:28:14 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Aug 23 03:14:22 2016  Naohisa Goto  <ngotogenome@gmail.com>
 
-	* error.c (rb_notimplement), io.c (pipe_open): removed definite
-	  articles and UNIX manual section from messages.  [ruby-dev:30690]
+	* string.c: Partially reverts r55547 and r55555.
+	  ChangeLog about the reverted changes are also deleted in this file.
+	  [Bug #12536] [ruby-dev:49699] [ruby-dev:49702]
 
-	* io.c (pipe_open): raise NotImplementedError for command "-" on
-	  platforms where fork(2) is not available.  [ruby-dev:30681]
+Tue Aug 23 03:14:22 2016  Naohisa Goto  <ngotogenome@gmail.com>
 
-Wed May 23 00:03:42 2007  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* string.c (str_fill_term): When termlen increases, re-allocation
+	  of memory for termlen should always be needed.
+	  In this fix, if possible, decrease capa instead of realloc.
+	  [Bug #12536] [ruby-dev:49699]
 
-	* ext/socket/socket.c (s_recv, s_recvfrom): some systems (such as
-	  windows) doesn't set fromlen if the socket is connection-oriented.
-	  reported by Bram Whillock in [ruby-core:10512] [ruby-Bugs#9061]
+Tue Aug 23 03:14:22 2016  Naohisa Goto  <ngotogenome@gmail.com>
 
-Sat Mar 24 23:40:29 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* string.c: Specify termlen as far as possible.
+	  Additional fix for [Bug #12536] [ruby-dev:49699].
 
-	* node.h (struct rb_thread.locals): explicit as struct.
-	  [ruby-core:10585]
+	* string.c (str_new_static): Specify termlen from the given encoding
+	  when creating a new String object is needed.
 
-	* eval.c, node.h (enum rb_thread_status, struct rb_thread,
-	  rb_curr_thread, rb_main_thread): prefixed.  [ruby-core:10586]
+	* string.c (rb_tainted_str_new_with_enc): New function to create a
+	  tainted String object with the given encoding. This means that
+	  the termlen is correctly specified. Currently static function.
+	  The function name might be renamed to rb_tainted_enc_str_new
+	  or rb_enc_tainted_str_new.
 
-	* file.c (chompdirsep): made an unprefixed name static.
+	* string.c (rb_external_str_new_with_enc): Use encoding by using the
+	  above rb_tainted_str_new_with_enc().
 
-	* io.c (io_fread): ditto.
+Tue Aug 23 03:14:22 2016  Naohisa Goto  <ngotogenome@gmail.com>
 
-Tue May 22 23:27:16 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* string.c (rb_str_subseq, str_substr): When RSTRING_EMBED_LEN_MAX
+	  is used, TERM_LEN(str) should be considered with it because
+	  embedded strings are also processed by TERM_FILL.
+	  Additional fix for [Bug #12536] [ruby-dev:49699].
 
-	* eval.c (ruby_cleanup): exit by SystemExit and SignalException in END
-	  block.  [ruby-core:10609]
+Tue Aug 23 03:14:22 2016  Naohisa Goto  <ngotogenome@gmail.com>
 
-	* test/ruby/test_beginendblock.rb (test_should_propagate_exit_code):
-	  test for exit in END block.  [ruby-core:10760]
+	* string.c: Fix memory corruptions when using UTF-16/32 strings.
+	  [Bug #12536] [ruby-dev:49699]
 
-	* test/ruby/test_beginendblock.rb (test_should_propagate_signaled):
-	  test for signal in END block.
+	* string.c (rb_str_new_with_class): Use TERM_LEN of the "obj".
 
-Tue May 22 23:14:19 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* string.c (rb_str_plus, rb_str_justify): Use str_new0 which is aware
+	  of termlen.
 
-	* eval.c (rb_provided): check for extension library if SOEXT is
-	  explicitly given.  [ruby-dev:30657]
+	* string.c (str_shared_replace): Copy +termlen bytes instead of +1.
 
-Tue May 22 21:29:08 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* string.c (rb_str_times): termlen should not be included in capa.
 
-	* bignum.c (rb_big2str0): round up for the most significant digit.
-	  [ruby-core:10686]
+	* string.c (RESIZE_CAPA_TERM): When using RSTRING_EMBED_LEN_MAX,
+	  termlen should be counted with it because embedded strings are
+	  also processed by TERM_FILL.
 
-Tue May 22 20:53:02 2007  Akinori MUSHA  <knu@iDaemons.org>
+	* string.c (rb_str_capacity, str_shared_replace, str_buf_cat): ditto.
 
-	* ext/thread/thread.c (remove_one): Preserve List invariants;
-	  submitted by: MenTaLguY <mental AT rydia.net>
-	  in [ruby-core:10598] and [ruby-bugs:PR#9388].
+	* string.c (rb_str_drop_bytes, rb_str_setbyte, str_byte_substr): ditto.
 
-Tue Mar 20 15:37:24 2007  URABE Shyouhei  <shyouhei@ruby-lang.org>
+Thu Aug 18 23:43:33 2016  Eric Wong  <e@80x24.org>
 
-	* distruby.rb: Add zip generation.
+	* ext/openssl/ossl_ssl.c (ossl_ssl_write_internal):
+	  avoid undefined behavior
+	* test/openssl/test_pair.rb (test_write_zero): new test
+	  [ruby-core:76751] [Bug #12660]
 
-Fri Mar 16 21:48:11 2007  Akinori MUSHA  <knu@iDaemons.org>
+Thu Aug 18 23:18:17 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/dl/dl.c (rb_ary2cary): Fix a bug in type validation;
-	  submitted by sheepman <sheepman AT sheepman.sakura.ne.jp>
-	  in [ruby-dev:30554].
+	* ext/socket/option.c, ext/socket/rubysocket.h (inet_ntop): share
+	  the fallback definition.  [ruby-core:76646] [Bug #12645]
 
-Fri Mar 16 18:28:06 2007  Akinori MUSHA  <knu@iDaemons.org>
+Thu Aug 18 23:07:29 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/etc/etc.c (etc_getgrgid): Fix a bug in Etc::getgrgid()
-	  always returning the (real) group entry of the running process;
-	  reported by: UEDA Hiroyuki <ueda AT netforest.ad.jp>
-	  in [ruby-dev:30586].
+	* vm.c (vm_set_main_stack): remove unnecessary check.  toplevel
+	  binding must be initialized.  [Bug #12611] (N1)
 
-Fri Mar 16 16:33:58 2007  Akinori MUSHA  <knu@iDaemons.org>
+	* win32/win32.c (w32_symlink): fix return type.  [Bug #12611] (N3)
 
-	* ext/thread/thread.c (unlock_mutex_inner): Make sure that the
-	  given mutex is actually owned by the caller; submitted by:
-	  Sylvain Joyeux <sylvain.joyeux AT m4x.org> in [ruby-core:10598].
+	* string.c (rb_str_split_m): simplify the condition.
+	  [Bug #12611](N4)
 
-Fri Mar 16 16:21:35 2007  Akinori MUSHA  <knu@iDaemons.org>
+Thu Aug 18 23:06:20 2016  Kouhei Sutou  <kou@cozmixng.org>
 
-	* ext/thread/thread.c (wait_condvar, lock_mutex): Fix a problem in
-	  ConditionVariable#wait that occurs when two threads that are
-	  trying to access the condition variable are also in concurrence
-	  for the given mutex; submitted by: Sylvain Joyeux
-	  <sylvain.joyeux AT m4x.org> and MenTaLguY <mental AT rydia.net>
-	  in [ruby-core:10598].
+	* lib/rexml/attribute.rb (REXML::Attribute#to_string): Fix wrong
+	  entry reference name of double quote.
+	  [Bug #12609][ruby-core:76509]
+	  Patch by Joseph Marrero. Thanks!!!
 
-Fri Mar 16 16:17:27 2007  Akinori MUSHA  <knu@iDaemons.org>
+Thu Aug 18 23:04:59 2016  Naohisa Goto  <ngotogenome@gmail.com>
 
-	* test/thread/test_thread.rb: Add a test script for the `thread'
-	  library.  This should result in failure as of now with
-	  ext/thread; submitted by: Sylvain Joyeux <sylvain.joyeux AT
-	  m4x.org> in [ruby-core:10598].
+	* thread.c (rb_wait_for_single_fd): Clean up fds.revents every time
+	  before calling ppoll(2). [Bug #12575] [ruby-dev:49725]
 
-Wed Mar 14 12:30:00 2007  Shigeo Kobayashi  <shigeo@tinyforest.jp>
+Thu Aug 18 22:52:19 2016  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/bigdecimal/bigdecimal.c: BigDecimal("-.31") is now
-	  treated as ("-0.31") not as ("0.31").
+	* vm_args.c (setup_parameters_complex): don't raise ArgumentError
+	  if an array is given for instance_exec with optional argument.
+	  [ruby-core:76300] [Bug #12568]
+	  https://github.com/rails/rails/pull/25699
 
-Tue Mar 13 04:04:04 2007  Akinori MUSHA  <knu@iDaemons.org>
+Tue Aug 16 12:27:48 2016  Koichi Sasada  <ko1@atdot.net>
 
-	* stable version 1.8.6 released.
+	* gc.c (gc_mark_roots): should mark the VM object itself to mark
+	  singleton class of the VM object.
+	  Before this patch, we only set mark bit for the VM object and
+	  invoke mark function separately.
+	  [Bug #12583]
 
-Tue Mar 13 02:54:17 2007  Akinori MUSHA  <knu@iDaemons.org>
+	* test/ruby/test_gc.rb: add a test.
 
-	* lib/cgi.rb (CGI::header): IIS >= 5.0 does not need the nph
-	  assumption any more; submitted by MIYASAKA Masaru <alkaid AT
-	  coral.ocn.ne.jp> in [ruby-dev:30537].
+Tue Aug 16 12:01:35 2016  Naohisa Goto  <ngotogenome@gmail.com>
 
-Mon Mar 12 11:07:44 2007  Akinori MUSHA  <knu@iDaemons.org>
+	* ext/digest/md5/md5ossl.h: Remove excess semicolons.
+	  Suppress warning on Solaris with Oracle Solaris Studio 12.
+	  [ruby-dev:49692] [Bug #12524]
 
-	* ext/openssl/ossl_asn1.c (Init_ossl_asn1): Let rdoc know about
-	  externally defined modules; submitted by Technorama
-	  Ltd. <oss-ruby AT technorama.net> in [ruby-bugs:PR#4704].
+	* ext/digest/md5/md5cc.h: ditto.
+	* ext/digest/sha1/sha1cc.h: ditto.
+	* ext/digest/sha1/sha1ossl.h: ditto.
+	* ext/digest/sha2/sha2cc.h: ditto.
+	* ext/digest/sha2/sha2ossl.h: ditto.
 
-	* ext/openssl/ossl_bn.c (Init_ossl_bn): Ditto.
+Tue Aug 16 11:51:52 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/openssl/ossl_cipher.c (Init_ossl_cipher): Ditto.
+	* compile.c (ADD_TRACE): ignore trace instruction on non-positive
+	  line.
 
-	* ext/openssl/ossl_digest.c (Init_ossl_digest): Ditto.
+	* parse.y (coverage): get rid of ArgumentError when the starting
+	  line number is not positive.  [ruby-core:76141] [Bug #12517]
 
-	* ext/openssl/ossl_hmac.c (Init_ossl_hmac): Ditto.
+Tue Aug 16 11:51:52 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* ext/openssl/ossl_pkey.c (Init_ossl_pkey): Ditto.
+	* test/coverage/test_coverage.rb: ignored test when enabled to coverage.
+	  It lead to crash with `make test-all`.
 
-	* ext/openssl/ossl_pkey_dh.c (Init_ossl_dh): Ditto.
+Tue Aug 16 11:46:07 2016  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/openssl/ossl_pkey_dsa.c (Init_ossl_dsa): Ditto.
+	* lib/uri/mailto.rb (initialize): RFC3986_Parser#split sets opaque
+	  only if the URI has path-rootless, not path-empty.
+	  [ruby-core:76055] [Bug #12498]
+	  patched by Chris Heisterkamp <cheister@squareup.com>
 
-	* ext/openssl/ossl_pkey_rsa.c (Init_ossl_rsa): Ditto.
+Tue Aug 16 04:57:28 2016  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* ext/openssl/ossl_rand.c (Init_ossl_rand): Ditto.
+	* lib/net/http/generic_request.rb (write_header): A Request-Line must
+	  not contain CR or LF.
 
-	* ext/openssl/ossl_ssl.c (Init_ossl_ssl): Ditto.
+Tue Aug 16 04:54:12 2016  Shugo Maeda  <shugo@ruby-lang.org>
 
-Mon Mar 12 01:23:50 2007  Akinori MUSHA  <knu@iDaemons.org>
+	* lib/net/ftp.rb (putline): raise an ArgumentError when
+	  CR or LF is included in a line.
 
-	* ext/dl/sym.c (rb_dlsym_inspect): Use "0x%x" rather for pointers.
-	  This might not be very right but it is commonly used in other
-	  parts of the code; submitted by sheepman <sheepman AT
-	  sheepman.sakura.ne.jp> in [ruby-dev:30532].
+Tue Aug 16 04:38:48 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/dl/ptr.c (rb_dlptr_inspect): Ditto.
+	* ext/date/date_strftime.c (date_strftime_with_tmx): reject too
+	  large precision to get rid of buffer overflow.
+	  reported by Guido Vranken <guido AT guidovranken.nl>.
 
-	* ext/dl/lib/dl/import.rb (DL::Importable::Internal::import,
-	  DL::Importable::Internal::callback): Avoid race condition for an
-	  instance variable; submitted by sheepman <sheepman AT
-	  sheepman.sakura.ne.jp> in [ruby-dev:30530].
+Tue Aug 16 04:28:22 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Mar 11 19:04:29 2007  Akinori MUSHA  <knu@iDaemons.org>
+	* file.c (append_fspath): normalize directory name to be appended
+	  on OS X.  [ruby-core:75957] [Ruby trunk Bug#12483]
+	  https://github.com/rails/rails/issues/25303#issuecomment-224834804
 
-	* misc/README: Add a note about ruby-electric.el. 
+Tue Aug 16 04:16:14 2016  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* misc/ruby-mode.el (ruby-non-block-do-re): Fix
-	  ruby-non-block-do-re. [ruby-core:03719]
+	* regcomp.c (noname_disable_map): don't optimize out group 0
+	  Ruby's Regexp doesn't allow normal numbered groups if the regexp
+	  has named groups. On such case it optimizes out related NT_ENCLOSE.
+	  But even on the case it can use \g<0>.
+	  This fix not to remove NT_ENCLOSE whose regnum is 0.
+	  [ruby-core:75828] [Bug #12454]
 
-	* misc/inf-ruby.el: Synchronize the comment section with trunk.
+Tue Aug 16 04:06:52 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* misc/README, misc/rdebug.el: Add rdebug.el, Emacs ruby-debug
-	  interface based on rubydb3x.el; submitted by Martin Nordholts
-	  <enselic AT gmail.com> in [ruby-bugs:PR#9023].
+	* missing/crypt.c: fix size macros to use configured values
+	  for platforms long is larger than 32bit.
+	  [ruby-core:75792] [Bug #12446]
 
-Sun Mar 11 17:51:46 2007  Akinori MUSHA  <knu@iDaemons.org>
+Tue Aug 16 04:03:25 2016  Kazuki Yamaguchi  <k@rhe.jp>
 
-	* ext/dl/mkcallback.rb (mkfunc): Make sure that a callback
-	  function is found in the function table before trying to call
-	  it; submitted by sheepman <sheepman AT sheepman.sakura.ne.jp>
-	  in [ruby-dev:30524].
+	* ext/openssl/ossl_bn.c (try_convert_to_bnptr): Extracted from
+	  GetBNPtr(). This doesn't raise exception but returns NULL on error.
+	  (GetBNPtr): Raise TypeError if conversion fails.
+	  (ossl_bn_eq): Implement BN#==.
+	  (ossl_bn_eql): #eql? should not raise TypeError even if the argument
+	  is not compatible with BN.
+	  (ossl_bn_hash): Implement BN#hash.
 
-Sun Mar 11 17:30:53 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/openssl/ossl_bn.c (Init_ossl_bn): Define #== and #hash.
 
-	* eval.c (error_handle): no message when exiting by signal.
+	* test/openssl/test_bn.rb: Test BN#eql?, #== and #hash
 
-	* eval.c (ruby_cleanup): re-send signal.  [ruby-dev:30516]
+Tue Aug 16 03:51:59 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (rb_thread_interrupt): instantiate SignalException.
+	* transcode.c (str_transcode0): scrub in the given encoding when
+	  the source encoding is given, not in the encoding of the
+	  receiver.  [ruby-core:75732] [Bug #12431]
 
-	* eval.c (rb_thread_signal_raise): now takes signal number instead
-	  of signal name.
+Tue Aug 16 03:41:21 2016  Kazuki Yamaguchi  <k@rhe.jp>
 
-	* intern.h (rb_thread_signal_raise, ruby_default_signal): prototypes.
+	* ext/openssl/ossl_pkey_dh.c (ossl_dh_compute_key): Check that the DH
+	  has 'p' (the prime) before calling DH_size(). We can create a DH with
+	  no parameter but DH_size() does not check and dereferences NULL.
+	  [ruby-core:75720] [Bug #12428]
 
-	* signal.c (esignal_init): takes a signal number and an optional
-	  signal name.
+	* ext/openssl/ossl_pkey_dsa.c (ossl_dsa_sign): Ditto. DSA_size() does
+	  not check dsa->q.
 
-	* signal.c (interrupt_init): pass SIGINT always.
-
-	* signal.c (ruby_default_signal): invoke system default signal
-	  handler.
-
-	* signal.c (rb_signal_exec, trap): handle SIGTERM.  [ruby-dev:30505]
-
-Tue Mar  6 19:03:42 2007  Akinori MUSHA  <knu@iDaemons.org>
-
-	* ext/digest/lib/md5.rb (MD5::new, MD5::md5): Do not modify
-	  Digest::MD5.
-
-	* ext/digest/lib/sha1.rb (SHA1::new, SHA1::sha1): Ditto.
-
-	* lib/shell/process-controller.rb: fix thread synchronization
-	  problem for [ruby-dev:30477].
-
-	* ext/digest/lib/md5.rb (MD5::new, MD5::md5): Catch up with
-	  Digest's API changes; noted by: Kazuhiro Yoshida <moriq AT
-	  moriq.com> in [ruby-dev:30500].
-
-	* ext/digest/lib/sha1.rb (SHA1::new, SHA1::sha1): Ditto.
-
-	* time.c (time_to_s): Back out the format changes; discussed
-	  in [ruby-dev:30495].
-
-	* ext/tk/sample/irbtkw.rbw: fails to exit process.
-
-Mon Mar  5 20:26:10 2007  Akinori MUSHA  <knu@iDaemons.org>
-
-	* time.c (time_to_s): Correct the wrong format which did not
-	  really conform to RFC 2822; pointed out by: OHARA Shigeki <os at
-	  iij.ad.jp> in [ruby-dev:30487].
-
-Sun Mar  4 23:53:27 2007  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/fileutils.rb (mv): could not move a directory between
-	  different filesystems. [ruby-dev:30411]
-
-Sun Mar  4 23:46:40 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* file.c (rb_file_s_utime): allow nil to set the current time.
-
-	* lib/fileutils.rb (touch): ditto, and added :mtime and :nocreate
-	  options.  fixed: [ruby-talk:219037]
-
-Sun Mar  4 23:19:00 2007  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* ext/openssl/ossl_pkey_rsa.c (ossl_rsa_public_encrypt,
+	  ossl_rsa_public_decrypt, ossl_rsa_private_encrypt,
+	  ossl_rsa_private_decrypt): Ditto. RSA_size() does not check rsa->n.
 
-	* util.c (push_element): should return a int value.
+Tue Aug 16 03:10:42 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Mar  4 01:06:55 2007  Akinori MUSHA  <knu@iDaemons.org>
+	* transcode.c (enc_arg, str_transcode_enc_args, econv_args):
+	  remove volatile, and add GC guards in callers.
+	  [ruby-core:75664] [Bug #12411]
 
-	* lib/set.rb (Set#^, Set#&): Correct documentation.  Those methods
-	  return sets, not arrays; noted by Oliver Frank Wittich <nietz AT
-	  mangabrain.de>.
+Tue Aug 16 02:45:52 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Sat Mar  3 21:41:31 2007  Akinori MUSHA  <knu@iDaemons.org>
+	* ext/psych/*, test/psych/*: Update psych 2.1.0
+	  This version fixed [Bug #11988][ruby-core:72850]
 
-	* eval.c (stack_check): Unset inline to fix build with GCC 3.4.6;
-	  submitted by: NISHIMATSU Takeshi <t_nissie AT yahoo.co.jp> in
-	  [ruby-list:43218].
-	  cf. http://gcc.gnu.org/bugzilla/show_bug.cgi?id=24556
+Fri Aug 12 04:15:10 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Mar  3 19:07:05 2007  Akinori MUSHA  <knu@iDaemons.org>
+	* common.mk (build-ext), ext/extmk.rb: use variable EXTENCS
+	  different than ENCOBJS, to get rid of circular dependency.
+	  build libencs when linking encodings statically.
+	  [ruby-core:75618] [Bug #12401]
 
-	* ext/thread/thread.c (push_list): Use ALLOC().
+Fri Aug 12 04:04:23 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/thread/thread.c (rb_mutex_alloc): Ditto.
+	* process.c (rb_execarg_commandline): build command line string
+	  from argument vector in rb_execarg.
+	  [ruby-core:75611] [Bug #12398]
 
-	* ext/thread/thread.c (rb_condvar_alloc): Ditto.
+Fri Aug 12 03:30:59 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Mar  3 18:56:40 2007  Akinori MUSHA  <knu@iDaemons.org>
+	* variable.c (rb_local_constants_i): exclude private constants
+	  when excluding inherited constants too.  [Bug #12345]
 
-	* NEWS: Add a note for String#intern.
+Fri Aug 12 03:00:05 2016  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
 
-Sat Mar  3 18:36:35 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/drb/timeridconv.rb: don't use keeper thread. [Bug #12342]
 
-	* eval.c (rb_provided): return true only for features loaded from
-	  .rb files, and not search actual library type.  [ruby-dev:30414]
+	* test/drb/ut_timerholder.rb: ditto.
 
-	* eval.c (rb_feature_p): check loading_tbl if the given ext is
-	  empty.  [ruby-dev:30452]
+Fri Aug 12 02:46:37 2016  Kazuki Yamaguchi  <k@rhe.jp>
 
-	* eval.c (rb_feature_p): fix possible buffer overrun.
+	* ext/openssl/ossl_ssl.c (ossl_ssl_stop): Don't free the SSL struct
+	  here. Since some methods such as SSLSocket#connect releases GVL,
+	  there is a chance of use after free if we free the SSL from another
+	  thread. SSLSocket#stop was documented as "prepares it for another
+	  connection" so this is a slightly incompatible change. However when
+	  this sentence was added (r30090, Add toplevel documentation for
+	  OpenSSL, 2010-12-06), it didn't actually. The current behavior is
+	  from r40304 (Correct shutdown behavior w.r.t GC., 2013-04-15).
+	  [ruby-core:74978] [Bug #12292]
 
-Sat Mar  3 16:30:39 2007  Akinori MUSHA  <knu@iDaemons.org>
+	* ext/openssl/lib/openssl/ssl.rb (sysclose): Update doc.
 
-	* env.h (SCOPE_CLONE): Introduce a new scope flag to prevent a
-	  local_tbl region from getting freed many times; submitted by
-	  Chikanaga Tomoyuki <chikanag AT nippon-control-system.co.jp> in
-	  [ruby-dev:30460].
+	* test/openssl/test_ssl.rb: Test this.
 
-	* eval.c (proc_invoke): Ditto.
+Thu Aug 11 01:30:29 2016  Marcus Stollsteimer  <sto.mar@web.de>
 
-	* gc.c (obj_free): Ditto.
+	* ext/json/lib/*.rb: Removed some comments. Because these are unnecessary
+	  class description. [ci skip][Bug #12255][ruby-core:74835]
 
-	* parse.y (top_local_setup_gen): Ditto.
+Thu Aug 11 01:09:43 2016  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Sat Mar  3 16:09:27 2007  Akinori MUSHA  <knu@iDaemons.org>
+	* pack.c (pack_pack): use union instead of bare variable to ease
+	  optimizations and avoid assigning x87 floating point number.
+	  [ruby-core:74496] [Bug #12209]
 
-	* object.c (rb_obj_ivar_set): RDoc updated according to a
-	  suggestion from Brian Candler <B.Candler AT pobox.com>.
-	  [ruby-core:10469]
+	* pack.c (pack_unpack): ditto.
 
-Sat Mar  3 15:41:33 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Aug  2 01:34:12 2016  Eric Wong  <e@80x24.org>
 
-	* parse.y (stmt, arg): should not omit lhs of OP_ASGN1 even if
-	  empty.  [ruby-dev:30452]
+	* lib/webrick/httpservlet/cgihandler.rb (do_GET): delete HTTP_PROXY
+	* test/webrick/test_cgi.rb (test_cgi_env): new test
+	* test/webrick/webrick.cgi (do_GET): new endpoint to dump env
+	  [ruby-core:76511] [Bug #12610]
 
-Thu Mar  1 04:08:30 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Aug  2 01:33:11 2016  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* mkconfig.rb (patchlevel): read from version.h.
+	* test/ruby/test_refinement.rb: skip
+	  test_prepend_after_refine_wb_miss on ARM or MIPS.
+	  [ruby-core:76031] [Bug #12491]
 
-Thu Mar  1 03:42:09 2007  Akinori MUSHA  <knu@iDaemons.org>
+Sat Jul 30 12:23:29 2016  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* ext/digest/digest.c (get_digest_base_metadata): Allow inheriting
-	  Digest::Base subclasses, which was unintentionally made
-	  impossible while restructuring Digest classes.
+	* vm_args.c (vm_caller_setup_arg_block): disable symbol block
+	  argument optimization when tail call optimization is enabled,
+	  in order to avoid SEGV.  [ruby-core:76288] [Bug #12565]
 
-Wed Feb 28 22:10:55 2007  Akinori MUSHA  <knu@iDaemons.org>
+Sat Jul 30 12:10:51 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* doc/NEWS-1.8.0: Rename NEWS to NEWS-1.8.0.  This is way too old
-	  NEWS.
+	* proc.c (passed_block): convert passed block symbol to proc.
+	  based on the patch by Daisuke Sato in [ruby-dev:49695].
+	  [Bug #12531]
 
-	* NEWS: Add NEWS, a document file to keep user visible feature
-	  changes between releases.
+Sat Jul 30 10:58:49 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* configure.in (ac_cv_func_fcntl): fcntl support for MinGW.
+	* vm_insnhelper.c (vm_throw_start): check if the iseq is symbol
+	  proc, class definition should not be a symbol proc.
+	  [ruby-core:75856] [Bug #12462]
 
-	* missing/flock.c: workaround for MinGW.
+Mon Jul 11 22:35:00 2016  Kenta Murata  <mrkn@mrkn.jp>
 
-	* ext/openssl/extconf.rb: no need to check unistd.h and sys/time.h.
-	  they are already checked at configure.
-	  reported by KOBAYASHI Yasuhiro [ruby-list:43225]
+	* bignum.c (rb_big_hash): make it public function to be available in
+	  other source files, and remove documentation comment for Bignum#hash.
 
-	* lib/mkmf.rb ($DEFLIBPATH): default library paths ($(topdir), etc)
-	  should be the first elements of library paths list.
-	  reported by KOBAYASHI Yasuhiro [ruby-list:43225]
+	* bignum.c (Bignum#hash): remove its definition because it is unified
+	  with Object#hash.
 
-	* test/{dbm,gdbm}/test_{dbm,gdbm}.rb: shouldn't use host_os. use
-	  target_os instead. reported by KOBAYASHI Yasuhiro [ruby-list:43225]
+	* include/ruby/intern.h (rb_big_hash): add a prototype declaration.
 
-	* mkconfig.rb (RbConfig): add CONFIG['PATCHLEVEL']
+	* hash.c (any_hash): treat Bignum values directly.
 
-	* common.mk: new target dist
+Sat Jul  2 04:00:50 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* distruby.rb: new file
+	* string.c (tr_trans): consider terminator length and fix heap
+	  overflow.  reported by Guido Vranken <guido AT guidovranken.nl>.
 
-	* configure.in (--enable-auto-image-base): avoid the neccessity to
-	  rebase the shared libs as much as possible;
-	  submitted by Corinna Vinschen <spam at vinschen.de> in
-	  [ruby-talk:240964].
+Sat Jul  2 03:33:28 2016  Shugo Maeda  <shugo@ruby-lang.org>
 
-Wed Feb 28 20:51:32 2007  URABE Shyouhei  <shyouhei@ruby-lang.org>
+	* vm.c (invoke_bmethod, invoke_block_from_c_0): revert r52104
+	  partially to avoid "self has wrong type to call super in this
+	  context" errors.
+	  [ruby-core:72724] [Bug #11954]
 
-	* pack.c (pack_unpack): properly ignore non-base64 octets such as
-	  UTF-8 encoded BOMs; submitted by SOUMA Yutaka <holon@radastery.jp>
-	  to fix [ruby-core:10437]
+Mon Jun 20 02:38:29 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Feb 27 21:50:10 2007  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* lib/optparse.rb (OptionParser::Completion.candidate): get rid of
+	  nil as key names.  [ruby-core:75773] [Bug #12438]
 
-	* util.c (__crt0_glob_function): use ruby_glob() instead of rb_globi().
+	* lib/optparse.rb (OptionParser#make_switch): char class option
+	  cannot be NoArgument, default to RequiredArgument.
 
-	* configure.in (ac_cv_func_setrlimit): workaround for djgpp.
+Mon Jun 20 02:25:44 2016  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Tue Feb 27 20:49:19 2007  Akinori MUSHA  <knu@iDaemons.org>
+	* re.c (unescape_nonascii): scan hex up to only 3 characters.
+	  [Bug #12420] [Bug #12423]
 
-	* lib/base64.rb (Base64::b64encode): Fix documentation; submitted
-	  by David Symonds <dsymonds@gmail.com> in [ruby-core:10432].
+Mon Jun 20 02:25:44 2016  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* regex.c (calculate_must_string, slow_search, re_search): Silence
-	  warnings regarding char * vs. unsigned char * mismatch;
-	  submitted by Lyle Johnson <lyle.johnson@gmail.com>
-	  in [ruby-core:10416].
+	* regparse.c (fetch_token_in_cc): raise error if given octal escaped
+	  character is too big. [Bug #12420] [Bug #12423]
 
-	* ext/bigdecimal/bigdecimal.c (BigDecimal_load): Ditto.
+Sun Jun 19 04:29:13 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/digest/sha1/sha1ossl.c (SHA1_Finish): Ditto.
+	* include/ruby/missing.h (isfinite): move from numeric.c.
 
-	* ext/digest/rmd160/rmd160ossl.c (RMD160_Finish): Ditto.
+Sun Jun 19 04:29:13 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/digest/digest.c (rb_digest_base_finish,
-	  rb_digest_base_update): Ditto.
+	* ext/bigdecimal/bigdecimal.c (isfinite): get rid of a warning on
+	  cygwin. [Bug #12417][ruby-core:75691]
 
-	* ext/nkf/nkf.c (rb_str_resize, rb_nkf_kconv, rb_nkf_guess1,
-	  rb_nkf_guess2): Ditto.
+Sun Jun 19 04:29:13 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/thread/thread.c (wait_list_cleanup, rb_mutex_try_lock):
-	  Eliminate rb_thread_critical switching where unnecessary;
-	  implied by shugo in [ruby-dev:30412].
+	* ext/bigdecimal/bigdecimal.c (isfinite): isfinite does not always
+	  exist.  fixed build error on Windows introduced at r55123.
 
-	* ext/thread/thread.c (set_critical): Merge in
-	  thread_exclusive_ensure().
+Sun Jun 19 04:29:13 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/thread/thread.c: Consistently use 0 and 1 for
-	  rb_thread_critical values.
+	* ext/bigdecimal/bigdecimal.c (GetVpValueWithPrec): consider
+	  non-finite float values not to raise FloatDomainError.
+	  [ruby-core:75682] [Bug #12414]
 
-	* ext/thread/thread.c: Use xmalloc()/xfree() instead of
-	  malloc()/free(); pointed out by shugo in [ruby-dev:30412].
+Thu Jun 16 00:42:56 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/test/unit/autorunner.rb (Test::Unit::AutoRunner::initialize):
-	  Initialize @workdir properly to silence a warning under -w.
-	  Submitted by <tommy at tmtm.org> in [ruby-dev:30400].
+	* string.c (rb_str_modify_expand): check integer overflow.
+	  [ruby-core:75592] [Bug #12390]
 
-Sun Feb 25 02:50:51 2007  Akinori MUSHA  <knu@iDaemons.org>
+Thu Jun 16 00:29:29 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* defines.h: Pull the RUBY_MBCHAR_MAXSIZE definition from trunk,
-	  which is necessary for dir.c to compile on djgpp and emx.
+	* vm_insnhelper.c (vm_get_ev_const): warn deprecated constant even
+	  in the class context.  [ruby-core:75505] [Bug #12382]
 
-Sat Feb 24 17:04:01 2007   Tadayoshi Funaba  <tadf@dotrb.org>
+Tue Jun 14 03:49:28 2016  Eric Wong  <e@80x24.org>
 
-	* lib/date/format.rb: updated based on date2 4.0.3.
+	* dir.c (dir_close): update RDoc for 2.3 #close change
+	  [ruby-core:75679] [Bug #12413]
 
-Sat Feb 24 17:01:02 2007  Minero Aoki  <aamine@loveruby.net>
+Tue Jun 14 03:47:29 2016  Eric Wong  <e@80x24.org>
 
-	* ext/racc/cparse/cparse.c (cparse_params_mark): remove useless
-	  rb_gc_mark.  Thanks Tomoyuki Chikanaga. [ruby-dev:30405]
+	* proc.c: fix RDoc of Proc#===/call/yield/[]
+	  [Bug #12332]
 
-Sat Feb 24 16:53:09 2007  NAKAMURA Usaku  <usa@ruby-lang.org>
+Tue Jun 14 03:34:27 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* signal.c (sighandler): need to tell to be interrupted to main
-	  context when handler is installed.
+	* variable.c (rb_local_constants_i): exclude hidden constants.
+	  [ruby-core:75575] [Bug #12389]
 
-	* win32/win32.[ch] (rb_win32_interrupted): new function to listen
-	  interrupt.
+Tue Jun 14 03:25:14 2016  Benoit Daloze  <eregontp@gmail.com>
 
-	* win32/win32.c (set_pioinfo_extra): new function for VC++8 SP1
-	  workaround. [ruby-core:10259]
+	* insns.def (defineclass): Also raise an error when redeclaring the
+	  superclass of a class as Object and it has another superclass.
+	  [Bug #12367] [ruby-core:75446]
 
-	* win32/win32.c (NtInitialize): call above function.
+	* test/ruby/test_class.rb: test for above.
 
-Fri Feb 23 13:04:43 2007  Akinori MUSHA  <knu@iDaemons.org>
+Tue Jun 14 03:15:54 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* numeric.c (fix_cmp, fix_equal): Remove FIX2LONG() to optimize.
-	  suggested in
-	  http://t-a-w.blogspot.com/2007/02/making-ruby-faster.html.
-	  [ruby-talk:240223]
+	* process.c (rb_exec_getargs): honor the expected argument types
+	  over the conversion method.  the basic language functionality
+	  should be robust.  [ruby-core:75388] [Bug #12355]
 
-Fri Feb 23 12:47:13 2007  James Edward Gray II  <james@grayproductions.net>
+Tue Jun 14 03:02:38 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/xmlrpc/client.rb (XMLRPC::Client::do_rpc): Make the
-	  Content-Length parameter optional for responses in
-	  xmlrpc/client.rb; suggested by Daniel Berger
-	  <Daniel.Berger@qwest.com> and approved by the maintainer.
+	* win32/win32.c, include/ruby/win32.h (rb_w32_utruncate): implements new
+	  truncate alternative which accepts UTF-8 path.
 
-	* lib/xmlrpc/create.rb (XMLRPC::Create::conv2value): Add DateTime
-	  support to xmlrpc; approved by the maintainer.
+	* file.c (truncate): use above function.
+	  [Bug #12340]
 
-Mon Feb 19 18:33:30 2007  Akinori MUSHA  <knu@iDaemons.org>
+Tue Jun 14 02:58:41 2016  Marcus Stollsteimer  <sto.mar@web.de>
 
-	* ext/socket/socket.c (unix_peeraddr): wrong syscall name in error
-	  message for #peeraddr. a patch from Sam Roberts
-	  <sroberts at uniserve.com>.  [ruby-core:10366]
+	* ext/date/date_core.c (Init_date_core): [DOC] Convert DateTime
+	  documentation to RDoc from Markdown.
+	  [ruby-core:75136] [Bug #12311]
 
-Mon Feb 19 18:27:42 2007  Akinori MUSHA  <knu@iDaemons.org>
+Sun Jun 12 02:36:52 2016  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* configure.in, defines.h, eval.c (rb_feature_p, rb_provided,
-	  load_wait, search_required, rb_require_safe), ext/extmk.rb: Fix
-	  a bug where a statically linked extension cannot be autoloaded.
-	  [ruby-dev:30023] / [ruby-dev:30239]
+	* regcomp.c (compile_length_tree): return error code immediately
+	  if compile_length_tree raised error [Bug #12418]
 
-Thu Feb 15 20:31:07 2007  Akinori MUSHA  <knu@iDaemons.org>
+Sun Jun 12 02:27:07 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/uri/ftp.rb: Revert the previous change pending discussion.
+	* thread.c (recursive_list_access): a object id may be a Bignum.  so,
+	  the list must be a objhash, instead of a identhash.
+	  this fixes many test errors on mswin64 CI.
 
-Fri Feb 16 11:18:21 2007  Eric Hodel  <drbrain@segment7.net>
+Sun Jun 12 01:59:33 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/.document: Apply patch for irb, e2mmap and README by Hugh Sasse
-	  <hgs at dmu.ac.uk> from [ruby-core:10135]
+	* parse.y (new_if_gen): set newline flag to NODE_IF to trace all
+	  if/elsif statements.  [ruby-core:67720] [Bug #10763]
 
-	* lib/prettyprint.rb: Suppress RDoc for PrettyPrint test suite.
+Sun May 15 02:33:52 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Feb 15 18:10:09 2007  Akinori MUSHA  <knu@iDaemons.org>
+	* lib/mkmf.rb (pkg_config): use xsystem consistently to set up
+	  library path environment variable as well as latter pkg-config
+	  calls.  [ruby-dev:49619] [Bug #12379]
 
-	* dir.c (glob_helper): Fix the function declaration.
+Fri May  6 02:30:32 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Feb 15 16:55:33 2007  Akinori MUSHA  <knu@iDaemons.org>
+	* lib/optparse.rb: [DOC] fix example code.  base on the code by
+	  Semyon Gaivoronskiy in [ruby-core:75224].  [Bug #12323]
 
-	* version.h: Branch off ruby_1_8_6 from ruby_1_8 in preparation
-	  for the forthcoming 1.8.6 release.
+Fri May  6 02:28:31 2016  Masaki Suketa <masaki.suketa@nifty.ne.jp>
 
-Thu Feb 15 16:44:14 2007  Akinori MUSHA  <knu@iDaemons.org>
+	* ext/win32ole/win32ole.c (ole_vstr2wc, ole_variant2val): fix blank
+	  string conversion.
+	  [Bug #11880]
+	  Thanks Akio Tajima for the patch!
 
-	* lib/uri/generic.rb (URI::Generic::userinfo): Considering how
-	  `scheme://user:@...', `scheme://:password@...' and
-	  `scheme://:@...' are parsed, an empty user name or password
-	  should be allowed and represented as it is.
+Fri May  6 02:24:13 2016  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-Thu Feb 15 11:46:05 2007  KIMURA Koichi  <hogemuta@gmail.com>
+	* bignum.c: [DOC] Update result of 123456789 ** -2.
+	  [ruby-dev:49606] [Bug #12339]
 
-	* dir.c, win32/win32.c, win32/dir.h, ruby.h, intern.h: Bring
-	  encoding aware globbing support in from trunk.  Dir.[] and
-	  Dir.glob() can now take many patterns in an array.  Minor fixes
-	  will follow.
+Wed May  4 02:38:08 2016  Yuichiro Kaneko  <yui-knk@ruby-lang.org>
 
-Thu Feb 15 11:00:26 2007  Akinori MUSHA  <knu@iDaemons.org>
+	* internal.h (RCOMPLEX_SET_IMAG): undef RCOMPLEX_SET_IMAG
+	  instead of duplicated undef RCOMPLEX_SET_REAL.
 
-	* lib/uri/generic.rb (URI::Generic::userinfo): should support
-	  empty password.  [ruby-core:10290]
+Wed May  4 02:38:08 2016  Yuichiro Kaneko  <yui-knk@ruby-lang.org>
 
-	* lib/uri/generic.rb (URI::Generic::set_password): password can be
-	  cleared by nil.  [ruby-core:10290]
+	* complex.c (rb_complex_set_imag): Fix to properly set imag
+	  of complex.
 
-	* lib/uri/common.rb (escape): regard second string argument as a
-	  character set properly. [ruby-dev:27692]
+Tue Apr 26 23:34:45 2016  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
 
-	* lib/uri/ftp.rb: Attempt to conform to RFC 1738 with regard to
-	  relative/absolute paths.
+	* version.h: Bump versionto 2.3.2.
 
-	* lib/uri: Lovely RDOC patches from mathew (metaATpoboxDOTcom).
+Tue Apr 26 02:58:51 2016  Marcus Stollsteimer  <sto.mar@web.de>
 
-Thu Feb 15 10:57:38 2007  Tietew  <tietew@tietew.net>>
+	* doc/extension.rdoc: Improvements to english grammers.
+	  [Bug #12246][ruby-core:74792][ci skip]
 
-	* lib/cgi.rb (CGI::unescapeHTML): invalid decoding for single
-	  unescaped ampersand.  a patch from Tietew
-	  <tietew+ruby-dev at tietew.net> in [ruby-dev:30292].
-	  fixed: [ruby-dev:30289]
+Tue Apr 26 02:58:51 2016  craft4coder  <yooobuntu@163.com>
 
-Thu Feb 15 10:48:40 2007  MenTaLguY  <mental@rydia.net>
+	* doc/extension.rdoc: [DOC] `nul` should be uppercase.
+	  change 'nul' => 'NUL'.  [Fix GH-1172]
 
-	* ext/thread/thread.c: Handle interrupted waits correctly.
-	  [ruby-bugs:PR#8663]
+Tue Apr 26 02:54:57 2016  Marcus Stollsteimer  <sto.mar@web.de>
 
-Wed Feb 14 19:22:15 2007  Akinori MUSHA  <knu@iDaemons.org>
+	* encoding.c: Fix return value of `Encoding::ISO8859_1.name`
+	  [Bug #12313][ruby-core:75147][ci skip]
+	* ext/bigdecimal/bigdecimal.c: Fix code sample of `BigDecimal.new`
 
-	* ext/digest/lib/digest.rb (Digest::self.const_missing): Drop
-	  autoloads for sha2 classes in favor of handling in
-	  const_missing(), to work around a problem exposed on OS X.
+Mon Apr 25 02:29:07 2016  Rei Odaira  <Rei.Odaira@gmail.com>
 
-Tue Feb 13 02:21:12 2007  Sam Roberts  <sroberts@uniserve.com>
+	* configure.in: add missing -lm for AIX.
 
-	* io.c (rb_f_syscall): Fix buffer overflow with syscall
-	  arguments.  [ruby-bugs:PR#8541]
+Mon Apr 25 02:29:07 2016  Rei Odaira  <Rei.Odaira@gmail.com>
 
-Sun Feb 11 07:46:45 2007  Akinori MUSHA  <knu@iDaemons.org>
+	* configure.in: don't use the system-provided round(3) on AIX.
+	  In AIX, round(0.49999999999999994) returns 1.0.
+	  Use round() in numeric.c instead.
 
-	* lib/cgi.rb (CGI::QueryExtension::read_multipart): Properly parse
-	  a quoted-string in a Content-Disposition value.
+Sun Apr 24 03:05:47 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Feb 11 06:27:54 2007  Akinori MUSHA  <knu@iDaemons.org>
+	* ruby.c: cygwin does not use w32_cmdvector, command line can be
+	  other than UTF-8.  [ruby-dev:49519] [Bug #12184]
 
-	* configure.in, ext/thread/extconf.rb, lib/thread.rb: Add a
-	  configure option `--disable-fastthread', to choose the original,
-	  pure ruby version of the "thread" library instead of the new,
-	  much faster implementation in ext/thread.
+Sat Apr 23 01:01:13 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Feb 11 06:22:20 2007  Akinori MUSHA  <knu@iDaemons.org>
+	* eval_jump.c (exec_end_procs_chain): restore previous error info
+	  for each end procs.  [ruby-core:75038] [Bug #12302]
 
-	* ext/Setup: Add thread except for platforms without threads
-	  support.
+Sat Apr 23 00:51:51 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Feb 11 06:15:16 2007  Akinori MUSHA  <knu@iDaemons.org>
+	* compile.c (new_label_body): initialize bit fields, since
+	  compile_data_alloc does not clear the memory.  [Bug #12082]
 
-	* ext/thread/lib/thread.rb: Add a replacement of thread.rb that
-	  loads this extension.
+Sat Apr 23 00:51:51 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Feb 11 05:39:47 2007  Akinori MUSHA  <knu@iDaemons.org>
+	* compile.c (iseq_optimize): disable tail call optimization in
+	  rescued, rescue, and ensure blocks.
+	  [ruby-core:73871] [Bug #12082]
 
-	* lib/thread.rb: Remove an ineffective part of the code.
+Sat Apr 23 00:33:04 2016  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Sun Feb 11 05:32:54 2007  Akinori MUSHA  <knu@iDaemons.org>
+	* ext/nkf/nkf-utf8/nkf.c (mime_putc): fix typo.
+	  [Bug #12202] [ruby-core:74802]
 
-	* ext/thread/thread.c (rb_thread_exclusive): Implement
-	  Thread.exclusive.
+Sat Apr 23 00:33:04 2016  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Sun Feb 11 05:26:51 2007  Akinori MUSHA  <knu@iDaemons.org>
+	* ext/nkf/nkf-utf8/nkf.c: Merge upstream 4f3edf80a0.
+	  patched by Anton Sivakov [Bug #12201] [Bug #12202]
 
-	* ext/thread/thread.c: Get rid of use of a dummy function.
+Sat Apr 23 00:29:15 2016  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Sun Feb 11 01:45:31 2007  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* lib/securerandom.rb (gen_random): to avoid blocking on Windows.
+	  On Windows OpenSSL RAND_bytes (underlying implementation is
+	  RAND_poll in crypto/rand/rand_win.c) may be blocked at
+	  NetStatisticsGet.
+	  https://wiki.openssl.org/index.php/Random_Numbers#Windows_Issues
+	  Instead of this, use Random.raw_seed directly (whose implementation
+	  CryptGenRandom is one of the source of
+	  entropy of RAND_poll on Windows).
+	  https://wiki.openssl.org/index.php/Random_Numbers
+	  Note: CryptGenRandom function is PRNG and doesn't check its entropy,
+	  so it won't block. [Bug #12139]
+	  https://msdn.microsoft.com/ja-jp/library/windows/desktop/aa379942.aspx
+	  https://tools.ietf.org/html/rfc4086#section-7.1.3
+	  https://eprint.iacr.org/2007/419.pdf
+	  http://www.cs.huji.ac.il/~dolev/pubs/thesis/msc-thesis-leo.pdf
 
-	* ext/thread/thread.c (Init_thread): Define missing aliases:
-	  Queue#enq and SizedQueue#enq.
+Sat Apr 23 00:25:26 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Feb 10 09:27:35 2007  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
+	* miniinit.c (Init_enc): add some common aliases of built-in
+	  encodings.  [ruby-core:72481] [Bug #11872]
 
-	* ext/win32ole/win32ole.c (ole_variant2val): fix compile error
-	  on VC++.
+Sat Apr 23 00:13:50 2016  sorah (Shota Fukumori)  <her@sorah.jp>
 
-Sat Feb 10 07:41:52 2007  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
+	* lib/forwardable.rb: Convert given accessors to String.
 
-	* ext/win32ole/win32ole.c (ole_variant2val): fix the bug when
-	  SAFEARRAY pointer is NULL.
+	  r53381 changed to accept only Symbol or String for accessors, but
+	  there are several rubygems that pass classes (e.g. Array,
+	  Hash, ...) as accessors. Prior r53381, it was accepted because Class#to_s
+	  returns its class name. After r53381 given accessors are checked
+	  with define_method, but it accepts only Symbol or String, otherwise
+	  raises TypeError.
 
-Sat Feb 10 00:13:11 2007  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	      def_delegator Foo, :some_method
 
-	* ext/tk/lib/tk.rb: fix typo (TkConfigMethod::__confinfo_cmd,
-	  __conv_keyonly_opts).
+	  This change is to revert unexpected incompatibility. But this behavior
+	  may change in the future.
 
-Fri Feb  9 20:44:53 2007  Akinori MUSHA  <knu@iDaemons.org>
+Sat Apr 23 00:02:09 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/thread: Make style fixes (mostly de-K&R'ism) to match the
-	  rest of the source code.
+	* configure.in: check if succeeded in creating config.h.
 
-	* ext/thread: Make USE_MEM_POOLS an extconf option.
+	* tool/ifchange: ignore failures when TEST_COLORS unmatched. just
+	  use the default value if expected name is not contained in it.
+	  [ruby-core:75046] [Bug #12303]
 
-Fri Feb  9 20:43:01 2007  Akinori MUSHA  <knu@iDaemons.org>
+Fri Apr 22 23:47:05 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/thread: Import the "fastthread" implementation by MenTaLguY
-	  in the original form.  This module is not hooked into the build
-	  yet since it needs some style fixes and adjustments.
+	* doc/regexp.rdoc (comments): [DOC] terminators cannot appear in
+	  comments.  [ruby-core:74838] [Bug #12256]
 
-Fri Feb  9 15:46:09 2007  Akinori MUSHA  <knu@iDaemons.org>
+Fri Apr 22 23:44:07 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/bigdecimal: Synchronize with trunk.  Better function
-	  prototypes, removal of a useless method `!=', and document
-	  updates.
+	* extension.rdoc, extension.ja.rdoc: [DOC] Fix some errors.
+	  Renamed files, wrong method names or argument types; the example
+	  GetDBM macro is now updated to the current version of the actual
+	  code.  patch by Marcus Stollsteimer in [ruby-core:74690].
+	  [Bug #12228]
 
-Tue Feb 06 22:06:45 2007  NARUSE, Yui  <naruse@ruby-lang.org>
+Fri Apr 22 23:32:19 2016  Tanaka Akira  <akr@fsij.org>
 
-        * ext/nkf/nkf-utf8/{nkf.c,utf8tbl.c}:
-          imported nkf 2007-01-28.
-          * Fixed: can't decode MIME encode JIS string.
-          * Fixed: Fullwitdh-halfwidth conversion.
-          * Support DoCoMo's and Softbank's EMOJI
-          * Support CP932, CP5022x, eucJP-ms UDC
-          * Support UTF-32 encoding
-          * Support beyond BMP
-          [ruby-dev:29700] [ruby-dev:29922] [ruby-dev:30144]
+	* test/ruby/test_time_tz.rb: Tests depends on Europe/Moscow removed
+	  to avoid test failures due to the tzdata change.
+	  https://github.com/eggert/tz/commit/8ee11a301cf173afb0c76e0315b9f9ec8ebb9d95
+	  Found by naruse.
 
-Wed Jan 31 14:52:09 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Tue Apr 19 02:32:50 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (rb_iterate): need to PUSH_ITER in proper order.
-	  [ruby-core:10125]
+	* configure.in (rb_cv_lgamma_r_m0): fix the condition for
+	  lgamma_r(-0.0).  [Bug #12249]
 
-	* test/ruby/test_iterator.rb (TestIterator::test_block_given_within_iterator):
-	  add new test.  [ruby-core:10125]
+Tue Apr 19 02:32:50 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Jan 30 14:58:51 2007  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* configure.in (rb_cv_lgamma_r_m0): check if lgamma_r(-0.0)
+	  returns negative infinity.  [Bug #12249]
 
-	* string.c (rb_str_sub_bang): calling rb_str_modify() should be just
-	  before actually modifying the string.
-	  fixed: [ruby-dev:30211] (originally reported by zunda)
+	* math.c (ruby_lgamma_r): define by the configured result.
 
-Tue Jan 30 12:05:35 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Apr 19 02:32:50 2016  cremno phobia  <cremno@mail.ru>
 
-	* mkconfig.rb: autoconf 2.61 support.  [ruby-core:10016]
+	* math.c (ruby_lgamma_r): missing/lgamma_r.c is used on Windows,
+	  since msvcrt does not provide it.
 
-Sat Jan 27 15:20:11 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* missing/lgamma_r.c (lgamma_r): fix lgamma(-0.0).
+	  [ruby-core:74823] [Bug #12249]
 
-	* parse.y (dyna_var_lookup): should not alter dvar->val not to
-	  destroy living value.  [ruby-core:10076]
+Tue Apr 19 02:32:50 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* parse.y (dyna_init): ditto.
+	* math.c (ruby_lgamma_r): mswin's lgamma_r also seems to be wrong.
+	  cf. [Bug #12249]
 
-Fri Jan 26 12:03:39 2007  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Tue Apr 19 02:32:50 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/lib/tk.rb (TkConfigMethod#__confinfo_cmd,
-	  __conv_keyonly_optkeys): make them private [ruby-dev:30074].
+	* math.c (ruby_tgamma): fix tgamma(-0.0) on mingw.
+	  [ruby-core:74817] [Bug #12249]
 
-	* ext/tk/lib/tk/txtwin_abst.rb: fix typo [ruby-dev:30073].
+Tue Apr 19 01:53:32 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/lib/tk/canvas.rb (TkCanvas#scan_dragto): lack of an argument.
+	* defs/keywords (alias, undef): symbol literals are allowed.
 
-	* ext/tk/lib/tk/canvas.rb: clarify the including module name
-	  [ruby-dev:30080].
+	* parse.y (parse_percent): should parse symbol literals for alias
+	  and undef.  [ruby-dev:47681] [Bug #8851]
 
-	* ext/tk/lib/tk/scrollable.rb: change primary name of modules
-	  [ruby-dev:30080].
+Mon Apr 18 18:05:29 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Jan 24 18:05:39 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* struct.c (struct_make_members_list, rb_struct_s_def): member
+	  names should be unique. [ruby-core:74971] [Bug #12291]
 
-	* misc/ruby-mode.el (ruby-font-lock-syntactic-keywords): fix
-	  regexp font-lock bug.  [ruby-talk:235758]
+	* struct.c (struct_make_members_list): extract making member name
+	  list from char* va_list, with creating symbols without
+	  intermediate IDs.
 
-Tue Jan 23 11:02:33 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Mon Apr 18 17:54:40 2016  Joe Swatosh  <joe.swatosh@gmail.com>
 
- 	* lib/webrick/httprequest.rb (WEBrick::HTTPRequest::read_line):
+	* ext/win32/lib/win32/registry.rb (DeleteValue, DeleteKey): fix
+	  API names.  [ruby-core:74863] [Bug #12264]
 
-Tue Jan 23 18:26:12 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Mon Apr 18 17:27:30 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/cgi.rb (CGI::QueryExtension::read_multipart): use == instead
-	  of ===.  [ruby-dev:30176]
+	* compile.c (iseq_peephole_optimize): should not replace the
+	  current target INSN, not to follow the replaced dangling link in
+	  the caller.  [ruby-core:74993] [Bug #11816]
 
-Tue Jan 23 10:48:17 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Mon Apr 18 17:18:25 2016  cremno phobia  <cremno@mail.ru>
 
-	* hash.c: added documentation for Hash about how it uses eql? and
-	  hash methods for the keys.  [ruby-core:09995]
+	* cont.c (fiber_initialize_machine_stack_context): fix wrong
+	  _MSC_VER check, should be decimal but not hexadecimal.
+	  [ruby-core:74936] [Bug #12279]
 
-Mon Jan 22 14:57:25 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Mon Apr 18 17:18:25 2016  cremno phobia  <cremno@mail.ru>
 
-	* ext/socket/socket.c: fix errors in socket sample code.
-	  [ruby-core:09992]
+	* cont.c (fiber_initialize_machine_stack_context): fix wrong
+	  _MSC_VER check, should be decimal but not hexadecimal.
+	  [ruby-core:74936] [Bug #12279]
 
-Sat Jan 13 23:54:48 2007  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
+Mon Apr 18 17:08:10 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/win32ole/win32ole.c (ole_free, ole_type_free,
-	  olemethod_free, olevariable_free, oleparam_free,
-	  ole_event_free): fix memory leak.  [ruby-core:09846]
+	* vm_core.h (rb_vm_struct): make at_exit a single linked list but
+	  not RArray, not to mark the registered functions by the write
+	  barrier.  based on the patches by Evan Phoenix.
+	  [ruby-core:73908] [Bug #12095]
 
-Fri Jan 12 11:13:55 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon Apr 18 16:56:31 2016  Benoit Daloze  <eregontp@gmail.com>
 
-	* ext/etc/etc.c (etc_getpwuid, etc_getgrgid): fix to correctly
-	  convert uid/gid from VALUE. (backport of r11521)
+	* thread.c (update_coverage): Do not track coverage in loaded files
+	  after Coverage.result. Avoids out-of-bounds access. [Bug #12237]
 
-Wed Jan 10 18:57:57 2007  Minero Aoki  <aamine@loveruby.net>
+	* ext/coverage/coverage.c (coverage_clear_result_i): document.
 
-	* ext/strscan/strscan.c (strscan_do_scan): should set kcode option
-	  before match. [ruby-dev:29914]
+Mon Apr 18 16:33:50 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/strscan/test_stringscanner.rb: test it.
+	* ext/date/date_core.c (Init_date_core): [DOC] fix misplaced doc
+	  of DateTime.  [ruby-core:74729] [Bug #12233]
 
-	* re.c: export kcode_set_option and kcode_reset_option (with "rb_"
-	  prefix).
+Mon Apr 18 13:48:05 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* intern.h: ditto.
+	* cygwin/GNUmakefile.in (MSYS2_ARG_CONV_EXCL_PARAM):
+	  * add missing parentheses and remove double quotes.
+	  * rename to get rid of recursive references.
+	  * as --excludes-dir option is for a path name, its argument
+	    should be converted.
+	  [ruby-dev:49526] [Bug #12199]
 
-Tue Jan  9 17:45:17 2007  NAKAMURA Usaku  <usa@ruby-lang.org>
+Mon Apr 18 13:48:05 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* file.c (rb_find_file): should not call fpath_check() with NULL.
-	  fixed: [ruby-core:09867]
+	* common.mk (TEST_EXCLUDES, EXCLUDE_TESTFRAMEWORK): use full spell
+	  long option.
 
-Tue Jan  9 03:54:38 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* cygwin/GNUmakefile.in (MSYS2_ARG_CONV_EXCL): suppress path name
+	  conversions by msys2.  [ruby-dev:49525] [Bug #12199]
 
-	* string.c (rb_str_upto): String#upto from empty string makes
-	  inifinite loop.  [ruby-core:09864]
+Mon Apr 18 13:48:05 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Jan  7 12:13:26 2007  Eric Hodel  <drbrain@segment7.net>
+	* test/lib/test/unit.rb (Options#non_options): make regexp name
+	  options prefixed with "!" negative filters.
 
-	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser#find_class_comment):
-	  Look for class and module comments above rb_define_class and
-	  rb_define_module.  Patch by Daniel Berger <djberg96 at gmail.com>
+	* common.mk (TEST_EXCLUDES): use negative filter to exclude memory
+	  leak tests.  -x option excludes test files, not test methods.
 
-Sun Jan  7 10:32:12 2007  Eric Hodel  <drbrain@segment7.net>
+Sun Apr 17 04:30:13 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser#handle_constants):
-	  Properly handle escaping of : in comments.
-	* test/rdoc/parsers/test_parse_c.rb:
-	  Test RDoc::C_Parser#do_classes and Rdoc::C_Parser#find_class_comment.
+	* parse.y (parse_ident): allow keyword arguments just after a
+	  method where the same name local variable is defined.
+	  [ruby-core:73816] [Bug#12073]
 
-Sun Jan  7 09:33:02 2007  Tadayoshi Funaba  <tadf@dotrb.org>
+Sun Apr 17 04:20:40 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/date/format.rb: updated based on date2 4.0.1.
+	* eval.c (setup_exception): set the cause only if it is explicitly
+	  given or not set yet.  [Bug #12068]
 
-Wed Jan  3 11:36:51 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sat Apr 16 00:56:45 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* io.c (ruby_dup): start GC on ENOMEM as well.
+	* thread.c (rb_thread_setname): defer setting native thread name
+	  set in initialize until the native thread is created.
+	  [ruby-core:74963] [Bug #12290]
 
-Mon Jan  1 06:13:11 2007  Eric Hodel  <drbrain@segment7.net>
+Fri Apr 15 21:10:00 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* lib/rdoc/parsers/c_parser.rb: Make Rdoc accessible.  Update constant
-	  value information.
+	* lib/irb/ext/save-history.rb: Fix NoMethodError when method is not defined.
 
-Mon Jan  1 06:13:11 2007  Eric Hodel  <drbrain@segment7.net>
+Fri Apr 15 14:52:06 2016  Elliot Winkler  <elliot.winkler@gmail.com>
 
-	* ext/bigdecimal/bigdecimal.c: Update constant comments to provide
-	  values for RDoc.
+	* lib/forwardable.rb (def_instance_delegator) fix delegating to
+	  'args' and 'block', clashing with local variables in generated
+	  methods.  [ruby-core:72579] [Bug #11916]
 
-Mon Jan  1 06:05:55 2007  Eric Hodel  <drbrain@segment7.net>
+	* lib/forwardable.rb (def_single_delegator): ditto.
 
-	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser#handle_constansts):
-	  Allow RDoc comment to give friendly value for rb_define_const.  Patch
-	  by Daniel Berger <djberg96 at gmail.com>, [ruby-patches-7499].
-	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser#handle_constansts): Fix
-	  whitespace handling in constant comments.
+Fri Apr 15 14:27:48 2016  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Sun Dec 31 00:31:16 2006  Tadayoshi Funaba  <tadf@dotrb.org>
+	* lib/irb/ext/save-history.rb: suppress warning: method redefined;
+	  discarding old save_history=.
 
-	* lib/date.rb, lib/date/format.rb: updated based on date2 4.0.
+Tue Apr 12 16:15:39 2016  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Thu Dec 14 18:29:13 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* configure.in: improve ICC (Intel C Compiler) support.
 
-	* ext/readline/readline.c: NetBSD editline does not have
-	  rl_username_completion_function() and rl_completion_matches().
-	  a patch from Takahiro Kambe <taca at back-street.net>.
-	  [ruby-dev:30008]
+	* configure.in (CXX): The name of icc's c++ compiler is `icpc`.
 
-Thu Dec 14 18:20:43 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* configure.in (warnings): Add `-diag-disable=2259` to suppress
+	  noisy warnings: "non-pointer conversion from "..." to "..." may
+	  lose significant bits".
 
-	* lib/irb/locale.rb (IRB::Locale::puts): typo fixed.  a patch from
-	  NAKAMURA Usaku <usa@ruby-lang.org>.  [ruby-dev:30012]
+	* configure.in (optflags): Add `-fp-model precise` like -fno-fast-math.
 
-Mon Dec 11 11:58:36 2006  Akinori MUSHA  <knu@iDaemons.org>
+	* lib/mkmf.rb: icc supports -Werror=division-by-zero
+	  and -Werror=deprecated-declarations, but doesn't support
+	  -Wdivision-by-zero and -Wdeprecated-declarations.
 
-	* ext/digest/sha2/lib/sha2.rb: Moved one level up from under
-	  the superfluous subdirectory digest/.
+Tue Apr 12 14:29:01 2016  Kazuki Yamaguchi  <k@rhe.jp>
 
-Mon Dec 11 11:46:18 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/openssl/extconf.rb: check SSL_CTX_set_next_proto_select_cb
+	  function rather than OPENSSL_NPN_NEGOTIATED macro. it exists
+	  even if it is disabled by OpenSSL configuration.
+	  [ruby-core:74384] [Bug #12182]
 
-	* variable.c (rb_define_const): typo fixed.
+	* ext/openssl/ossl_ssl.c: update #ifdef(s) as above.
 
-Mon Dec 11 09:36:29 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/openssl/test_ssl.rb: skip NPN tests if NPN is disabled.
 
-	* string.c (rb_str_aset): index double decode problem.
-	  [ruby-core:09695]
+Tue Apr 12 14:27:04 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Dec  9 21:39:24 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/uri/http.rb (URI::HTTP#initialize): [DOC] fix example,
+	  missing mandatory arguments.  [ruby-core:74540] [Bug #12215]
 
-	* eval.c (ruby_cleanup): keep the exception till after END blocks.
-	  [ruby-core:09675]
+Thu Apr  7 01:07:02 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Dec  9 11:22:00 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* sprintf.c (rb_str_format): fix buffer overflow, length must be
+	  greater than precision.  reported by William Bowling <will AT
+	  wbowling.info>.
 
-	* lib/irb/locale.rb (IRB::Locale::search_file): ues File.exist?
-	  instead of File.exists?.  a patch from Yutaka Kanemoto
-	  <kinpoco at gmail.com> in [ruby-dev:30000].
+Wed Apr  6 00:33:45 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Dec  7 09:29:02 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/rubygems/security.rb (DIGEST_ALGORITHM, KEY_ALGORITHM):
+	  should check same name as the used constants.
+	  [ruby-core:72674] [Bug #11940]
 
-	* lib/weakref.rb (WeakRef::__setobj__): should support
-	  marshaling.  [ruby-talk:228508]
+Mon Apr  4 00:31:51 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/delegate.rb (Delegator::marshal_load): need to call
-	  __setobj__.
+	* compile.c (compile_massign_lhs): when index ends with splat,
+	  append rhs value to it like POSTARG, since VM_CALL_ARGS_SPLAT
+	  splats the last argument only.  [ruby-core:72777] [Bug #11970]
 
-Wed Dec  6 23:56:14 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Apr  2 02:07:29 2016  Seiei Miyagi  <hanachin@gmail.com>
 
-	* Makefile.in, common.mk (NULLCMD): moved for platforms that empty
-	  command does not run.  fixed: [ruby-dev:29994]
+	* ext/ripper/lib/ripper/lexer.rb (on_heredoc_dedent): Fix
+	  Ripper.lex error in dedenting squiggly heredoc.  heredoc tree is
+	  also an array of Elem in the outer tree.  [Fix GH-1234]
 
-Wed Dec  6 17:17:26 2006  WATANABE Hirofumi  <eban@ruby-lang.org>
+Wed Mar 30 02:28:13 2016  Eric Wong  <e@80x24.org>
 
-	* configure.in (SITE_DIR): fixed to emtpy RUBY_SITE_LIB in config.h on
-	  NetBSD.  fixed: [ruby-dev:29358]
+	* thread_pthread.c (setup_communication_pipe): delay setting owner
+	  (rb_thread_create_timer_thread): until thread creation succeeds
+	  [ruby-core:72590] [Bug #11922]
 
-Tue Dec  5 00:59:05 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Wed Mar 30 02:20:06 2016  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* misc/ruby-mode.el (ruby-parse-partial): need to parse "/=" as
-	  self assignment operator, not regex.  [ruby-talk:227324]
+	* localeinit.c (rb_locale_charmap_index): fix prototype.
+	  patched by Andreas Schwab [Bug #12218]
 
-Mon Dec  4 10:48:03 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Wed Mar 30 02:20:06 2016  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ruby.h (OFFT2NUM): use LONG2NUM() if sizeof(long) equals to
-	  sizeof(off_t).
+	* thread_pthread.c (reserve_stack): fix reserving position where
+	  the stack growing bottom to top. [Bug #12118]
 
-Mon Dec  4 10:43:46 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Wed Mar 30 02:17:33 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* parse.y (dyna_init_gen): dvar initialization only if dvar is
-	  assigned inner block.  [ruby-talk:227402]
+	* win32/file.c (rb_readlink): drop garbage after the substitute
+	  name, as rb_w32_read_reparse_point returns the expected buffer
+	  size but "\??\" prefix is dropped from the result.
 
-Mon Dec  4 08:32:49 2006  Shugo Maeda  <shugo@ruby-lang.org>
+	* win32/win32.c (w32_readlink): ditto, including NUL-terminator.
 
-	* lib/cgi.rb (CGI::QueryExtension::read_multipart): should quote
-	  boundary. JVN#84798830
+Wed Mar 30 02:17:33 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Sat Dec  2 07:09:04 2006  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* win32/win32.c (fileattr_to_unixmode, rb_w32_reparse_symlink_p): volume
+	  mount point should be treated as directory, not symlink.
+	  [ruby-core:72483] [Bug #11874]
 
-	* ext/openssl/ossl_ocsp.c: OpenSSL::OCSP::OSCPError should be
-	  subclass of OpenSSL::OpenSSLError. [ruby-dev:29980]
+	* win32/win32.c (rb_w32_read_reparse_point): check the reparse point is
+	  a volume mount point or not.
 
-Fri Dec  1 17:01:49 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* win32/file.c (rb_readlink): follow above change (but this pass won't
+	  be used).
 
-	* gc.c (ruby_init_stack): decrease "stack level too deep" in Windows.
-	  merge from trunk.
+Wed Mar 30 01:32:14 2016  Rei Odaira  <Rei.Odaira@gmail.com>
 
-Fri Dec  1 16:31:53 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* test/-ext-/time/test_new.rb (test_timespec_new): change a gmtoff
+	  test to a better one that does not depend on whether the current
+	  time is in summer time or not.
 
-	* ext/tk/tcltklib.c: shouldn't run the killed thread at callback.
-	  [ruby-talk: 227408]
+Wed Mar 30 01:32:14 2016  Rei Odaira  <Rei.Odaira@gmail.com>
 
-Mon Nov 27 17:18:27 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/-ext-/time/test_new.rb (test_timespec_new): Time#gmtoff values
+	  are the same only when both or neither of the Time objects are in
+	  summer time (daylight-saving time).
 
-	* sprintf.c (rb_f_sprintf): need not to truncate string if no
-	  width specifier given for %s.  [ruby-dev:29952]
+Wed Mar 30 01:30:54 2016  Hiroshi Shirosaki  <h.shirosaki@gmail.com>
 
-Sun Nov 26 16:36:46 2006  URABE Shyouhei  <shyouhei@ruby-lang.org>
+	* lib/rubygems/test_case.rb: Fix test on Windows for inconsistent temp path.
+	  https://github.com/rubygems/rubygems/pull/1554
+	  [Bug #12193][ruby-core:74431]
 
-	* version.h: addition of RUBY_PATCHLEVEL.
-	* version.c: ditto.
+Wed Mar 30 01:25:46 2016  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Fri Nov 24 10:17:51 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* string.c (str_new_frozen): if the given string is embeddedable
+	  but not embedded, embed a new copied string. [Bug #11946]
 
-	* bignum.c (bignorm): avoid segmentation.  a patch from Hiroyuki
-	  Ito <ZXB01226@nifty.com>.  [ruby-list:43012]
+Wed Mar 30 01:23:57 2016  Marcus Stollsteimer  <sto.mar@web.de>
 
-Thu Nov 23 10:38:40 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* doc/extension.ja.rdoc: Fix RDoc markup in doc/extension*.rdoc.
+	  [ci skip][Bug #12143][ruby-core:74143]
+	* doc/extension.rdoc: ditto.
 
-	* eval.c (rb_mod_define_method): set implicit visibility only when
-	  it's called for the target class (ruby_cbase).
+Wed Mar 30 01:00:30 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Nov 22 16:00:49 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* proc.c (proc_binding): proc from symbol can not make a binding.
+	  [ruby-core:74100] [Bug #12137]
 
-	* ext/tk/extconf.rb: support --with-X11/--without-X11 option.
+Wed Mar 30 00:54:38 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/README.tcltklib: add description about --with-X11-* option
-	  [ruby-talk:225166] and --with-X11/--without-X11 option.
+	* include/ruby/win32.h (O_SHARE_DELETE): change to fit Fixnum
+	  limit.  [ruby-core:74285] [Bug #12171]
 
-	* ext/tk/tkutil/extconf.rb: able to be called manually
-	  [ruby-talk:225950].
+Wed Mar 30 00:52:47 2016  Rei Odaira  <Rei.Odaira@gmail.com>
 
-Wed Nov 15 23:22:54 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/net/imap/test_imap.rb (test_idle_timeout): Because of the
+	  timeout specified in "imap.idle(0.2)", there is no gurantee that
+	  the server thread has done all the work before the client thread
+	  performs the assertions. It depends on the thread scheduling.
+	  Add checks to avoid false positives (on AIX, particularly).
 
-	* file.c (test_grpowned, rb_stat_grpowned): should honor
-	  supplementary group IDs.  [ruby-core:09546]
+Wed Mar 30 00:41:42 2016  Rei Odaira  <Rei.Odaira@gmail.com>
 
-Thu Nov  9 03:15:22 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/socket/test_socket.rb (test_udp_recvmsg_truncation):
+	  AIX does not set the MSG_TRUNC flag for a message partially read
+	  by recvmsg(2) with the MSG_PEEK flag set.
 
-	* eval.c (BEGIN_CALLARGS): ruby_block may be NULL even when
-	  ITER_PRE.
+Wed Mar 30 00:00:47 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Nov  7 18:34:34 2006  Akinori MUSHA  <knu@iDaemons.org>
+	* doc/extension.rdoc, doc/extension.ja.rdoc: add editor local
+	  variables, with commenting out by :enddoc: directives which are
+	  just ignored unless code object mode.  [Bug #12111]
 
-	* ext/digest/lib/digest/hmac.rb: Keep this out of the 1.8 tree
-	  until we reach a consensus that HMAC should be put under Digest.
+Wed Mar 30 00:00:47 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Tue Nov  7 18:05:01 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* doc/extension.ja.rdoc: removed rendering error caused by editor specific
+	  configuration on http://docs.ruby-lang.org/en/trunk/extension_rdoc.html .
+	  [Bug #12111][ruby-core:73990]
 
-	* ext/tk/lib/tk/itemconfig.rb: minor bug fix.
+Tue Mar 29 23:54:31 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Nov  6 20:11:20 2006  Kouhei Sutou  <kou@cozmixng.org>
+	* object.c (rb_mod_const_get): make error message at uninterned
+	  string consistent with symbols.  [ruby-dev:49498] [Bug #12089]
 
-	* lib/rss/0.9.rb (RSS::Rss): removed needless include.
+Tue Mar 29 23:45:24 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Nov  6 15:41:55 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* dir.c (push_pattern, push_glob): deal with read paths as UTF-8
+	  to stat later, on Windows as well as OS X.
+	  [ruby-core:73868] [Bug #12081]
 
-	* ext/tk/lib/tk/itemconfig.rb: ext/tk/lib/tk/itemconfig.rb: bug
-	  fix on 'itemconfiginfo' method, and modify to make it easy to
-	  override 'itemconfiginfo' method.
+Tue Mar 29 23:36:49 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/lib/tkextlib/tile/treeview.rb : support Tile 0.7.8.
+	* ext/extmk.rb: add cygwin case, nothing excluded.
+	  [ruby-core:73806] [Bug#12071]
 
-	* ext/tk/lib/tkextlib/version.rb : [new] add Tk::Tkextlib_RELEASE_DATE
-	  to get the information from scripts.
+Tue Mar 29 23:10:47 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/lib/tk.rb: load 'tkextlib/version.rb', and update RELEASE_DATE
+	* iseq.c (rb_iseq_mark): mark parent iseq to prevent dynamically
+	  generated iseq by eval from GC.  [ruby-core:72620] [Bug #11928]
 
-	* ext/tk/lib/tkextlib/SUPPORT_STATUS: update.
+Tue Mar 29 22:56:44 2016  Eric Wong  <e@80x24.org>
 
-	* ext/tk/sample/editable_listbox.rb: [new] the listbox with editable
-	  items. It's one of the example about usage of Place geometry manager.
+	* lib/resolv.rb (Resolv::IPv6.create): avoid modifying frozen
+	* test/resolv/test_dns.rb (test_ipv6_create): test for above
+	  [Bug #11910] [ruby-core:72559]
 
-	* ext/tk/sample/tktextio.rb: improve the functions of TkTextIO class.
-	  Those are required by 'irbtkw.rbw'.
+Tue Mar 29 22:31:48 2016  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* ext/tk/sample/irbtkw.rbw: [new] IRB on Ruby/Tk. It doesn't need any
-	  real console. IRB works on a text widget without I/O blocking. That
-	  is, thread switching on IRB will work properly, even if on Windows.
+	* range.c (range_eqq): revert r11113 because rb_call_super() is
+	  called in range_include() and thus r11113 doesn't work when the
+	  receiver Range object consists of non linear objects such as Date
+	  objects.
+	  [ruby-core:72908] [Bug #12003]
 
-Sun Nov  5 19:53:49 2006  Tadayoshi Funaba  <tadf@dotrb.org>
+Tue Mar 29 22:26:55 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/date.rb: updated based on date2 3.9.7.
+	* vm_eval.c (rb_check_funcall_with_hook): also should call the
+	  given hook before returning Qundef when overridden respond_to?
+	  method returned false.  [ruby-core:73556] [Bug #12030]
 
-Sat Nov  4 13:13:57 2006  Shugo Maeda  <shugo@ruby-lang.org>
+Tue Mar 29 22:08:36 2016  Kazuki Yamaguchi  <k@rhe.jp>
 
-	* lib/net/imap.rb: accept NOMODSEQ. [ruby-core:9002]
-	  (backported from HEAD)
+	* compile.c (iseq_peephole_optimize): don't apply tailcall
+	  optimization to send/invokesuper instructions with blockiseq.
+	  This is a follow-up to the changes in r51903; blockiseq is now
+	  the third operand of send/invokesuper instructions.
+	  [ruby-core:73413] [Bug #12018]
 
-Fri Nov  3 00:16:37 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Tue Mar 29 21:22:22 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/socket/socket.c (ruby_getnameinfo__aix): AF_INET6 workaround
-	  for AIX.  a patch from Yutaka Kanemoto <kinpoco AT gmail.com>.
-	  [ruby-dev:29744]
+	* parse.y (xstring): reset heredoc indent after dedenting,
+	  so that following string literal would not be dedented.
+	  [ruby-core:72857] [Bug #11990]
 
-Thu Nov  2 15:43:39 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+Tue Mar 29 21:22:22 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* parse.y (primary): should set NODE even when compstmt is NULL.
-	  merge from trunk. fixed: [ruby-dev:29732]
+	* parse.y (string1): reset heredoc indent fore each string leteral
+	  so that concatenated string would not be dedented.
+	  [ruby-core:72857] [Bug #11990]
 
-Thu Nov  2 14:48:30 2006  Akinori MUSHA  <knu@iDaemons.org>
+Tue Mar 29 21:18:09 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/set.rb (Set#^): Fix XOR operation against a container that
-	  holds duplicate values. [issue: #6444]
+	* parse.y (parser_here_document): update indent for each line in
+	  indented here document with single-quotes.
+	  [ruby-core:72479] [Bug #11871]
 
-Wed Nov  1 02:41:38 2006  Akinori MUSHA  <knu@iDaemons.org>
+Tue Mar 29 21:03:40 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/digest/lib/digest/hmac.rb (Digest::HMAC::update): Minor
-	  optimization.
+	* symbol.h (is_attrset_id): ASET is an attrset ID.  fix
+	  unexpected safe call instead of an ordinary ASET.
 
-	* ext/digest/digest.c (rb_digest_instance_equal): Allow comparing
-	  a digest instance with another of a different class.
+Tue Mar 29 21:01:07 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Wed Nov  1 01:05:13 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* doc/syntax/calling_methods.rdoc: fix old operator for safe navigation
+	  operator. [ci skip][fix GH-1182] Patch by @dougo
 
-	* eval.c (rb_call0): fixed bug of zsuper with both of opt and rest.
-	  fixed: [ruby-list:42928]
+Tue Mar 29 18:49:54 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/ruby/test_super.rb: add tests to check above bug.
+	* lib/ostruct.rb (freeze): define deferred accessors before
+	  freezing to get rid of an error when just reading frozen
+	  OpenStruct.
 
-Tue Oct 31 17:03:21 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Tue Mar 29 18:49:54 2016  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
 
-	* time.c (time_dup): duplicate the class of original time.
-	  [ruby-core:09357]
+	* lib/ostruct.rb: Fix new_ostruct_member to correctly avoid
+	  redefinition [#11901]
 
-	* lib/time.rb (Time::make_time, Time::rfc2822, Time::httpdate):
-	  should respect subclasses.  [ruby-core:09357]
+Tue Mar 29 17:54:17 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Oct 30 23:40:52 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/ostruct.rb (OpenStruct): make respond_to? working on
+	  just-allocated objects for workaround of Psych.
+	  [ruby-core:72501] [Bug #11884]
 
-	* Makefile.in (miniruby): add XLDFLAGS.
+Tue Mar 29 17:04:35 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* configure.in (aix): use -bE option for miniruby.  [ruby-dev:29698]
+	* vm_eval.c (rb_f_catch): [DOC] fix malformed RDoc syntax, "+...+"
+	  cannot enclose non-identifier characters.
+	  a patch by Sebastian S in [ruby-core:74278].  [Bug#12170]
 
-	* dir.c (glob_helper): get rid of possible memory leak.
+Tue Mar 29 17:03:28 2016  Rei Odaira  <Rei.Odaira@gmail.com>
 
-	* win32/win32.c (cmdglob, rb_w32_cmdvector, rb_w32_opendir,
-	  rb_w32_get_environ): not to use GC before initialization.
+	* test/-ext-/float/test_nextafter.rb: In AIX,
+	  nextafter(+0.0,-0.0)=+0.0, and nextafter(-0.0,+0.0)=-0.0,
+	  but they should return -0.0 and +0.0, respectively. This is
+	  a known bug in nextafter(3) on AIX, so skip related tests.
 
-Mon Oct 30 19:29:20 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+Tue Mar 29 16:54:14 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* bignum.c (rb_big2str0): use better approximation.
+	* string.c (enc_succ_alnum_char): try to skip an invalid character
+	  gap between GREEK CAPITAL RHO and SIGMA.
+	  [ruby-core:74478] [Bug #12204]
 
-Mon Oct 30 18:35:33 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Tue Mar 29 16:45:58 2016  Victor Nawothnig  <Victor.Nawothnig@gmail.com>
 
-	* bignum.c (rb_big2str0): wrong allocation length.  a patch from
-	  U.Nakamura <usa at garbagecollect.jp> [ruby-dev:29710]
+	* parse.y (parse_numvar): NTH_REF must be less than a half of
+	  INT_MAX, as it is left-shifted to be ORed with back-ref flag.
+	  [ruby-core:74444] [Bug#12192] [Fix GH-1296]
 
-Mon Oct 30 12:34:02 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Tue Mar 29 16:44:54 2016  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* eval.c (rb_eval): fix commit miss.  [ruby-dev:29707]
+	* enc/trans/JIS: update Unicode's notice. [Bug #11844]
 
-Mon Oct 30 12:20:58 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Tue Mar 29 16:41:27 2016  Eric Hodel  <drbrain@segment7.net>
 
-	* bignum.c (rb_big2str0): a bug in length adjustment.
+	* marshal.c (r_object0):  raise ArgumentError when linking to undefined
+	  object.
 
-Mon Oct 30 11:15:40 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Tue Mar 29 16:41:27 2016  Eric Hodel  <drbrain@segment7.net>
 
-	* sprintf.c (rb_str_format): should preserve leading zero
-	  information for negative %b and %x.  [ruby-talk:221347]
+	* marshal.c (r_object0): Fix Marshal crash for corrupt extended object.
 
-Thu Oct 26 21:05:58 2006  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Tue Mar 29 16:40:48 2016  Eric Wong  <e@80x24.org>
 
-	* ext/openssl/ossl_pkcs7.c (ossl_pkcs7_verify): should clear error.
-	  (fix http://bugs.debian.org/394336)
+	* ext/openssl/ossl_ssl.c (ossl_sslctx_setup): document as MT-unsafe
+	  [ruby-core:73803] [Bug #12069]
 
-	* ext/openssl/ossl_ns_spki.c (ossl_spki_initialize): ditto.
+Tue Mar 29 16:29:44 2016  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Thu Oct 26 15:21:10 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* insns.def (opt_mod): show its method name on ZeroDivisionError.
+	  [Bug #12158]
 
-	* ext/digest/digest.c (Init_digest): typo.
+Tue Mar 29 16:25:27 2016  Anthony Dmitriyev  <antstorm@gmail.com>
 
-Wed Oct 25 17:23:28 2006  Akinori MUSHA  <knu@iDaemons.org>
+	* net/ftp.rb: add NullSocket#closed? to fix closing not opened
+	  connection.  [Fix GH-1232]
 
-	* ext/digest, test/digest/test_digest.rb: Merge from trunk:
-	  - Introduce versioning in Digest::Base API, and prefix C
-	    constants with RUBY_ and C type names with rb_ to avoid name
-	    clash in writing extensions.
-	  - Introduce Digest::Class and Digest::Instance for ease of
-	    implementing subclasses and add-ons.
-	  - Digest::Instance module requires and assumes that any instance
-	    be resettable and clonable.  An instance method #new() is
-	    added so digest instances work just like digest classes.
-	  - The constructor does no longer take an initial string to feed;
-	    digest() and hexdigest() now do, instead.  This allows digest
-	    classes to take their own hashing parameters.
-	  - Make some changes to digest() and hexdigest() class methods,
-	    which now take extra arguments, which are passed through to
-	    the constructor in an internal call.
-	  - Add #digest_length/size/length() and #block_length(),
-	  - Add the Digest::SHA2 class to wrap up SHA2 variants: SHA256,
-	    SHA384 and SHA512, hoping this module would make a decent
-	    example of a digest subclass written in Ruby.
-	  - Rip BubbleBabble support out of the base class and have a
-	    separate module named digest/bubblebabble.
-	  - Remove RD documents in favor of newly written and embedded
-	    RDoc documentation.
+Tue Mar 29 16:12:08 2016  Koichi ITO  <koic.ito@gmail.com>
 
-Wed Oct 25 08:03:23 2006  Tadayoshi Funaba  <tadf@dotrb.org>
+	* variable.c: Added documentation about order of `Module#constants`
+	  [ci skip][Bug #12121][ruby-dev:49505][fix GH-1301]
 
-	* lib/date/format.rb: updated based on date2 3.9.6.
-	  [ruby-core:09323]
+Tue Mar 29 16:02:26 2016  Rei Odaira  <Rei.Odaira@gmail.com>
 
-Sun Oct 22 14:48:31 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/ruby/test_process.rb (test_execopts_gid): Skip a test
+	  that is known to fail on AIX. AIX allows setgid to
+	  a supplementary group, but Ruby does not allow the "-e"
+	  option when setgid'ed, so the test does not work as intended.
 
-	* signal.c (ruby_signal): don't set SA_RESTART.  a backport from
-	  the HEAD.  [ruby-talk:220937]  [ruby-talk:147220]
+Tue Mar 29 15:58:18 2016  Rei Odaira  <Rei.Odaira@gmail.com>
 
-	* signal.c (Init_signal): avoid duplicated installation of SIGCHLD
-	  handler.
+	* test/socket/test_addrinfo.rb (test_ipv6_address_predicates):
+	  IN6_IS_ADDR_V4COMPAT and IN6_IS_ADDR_V4MAPPED are broken
+	  on AIX, so skip related tests.
 
-Sun Oct 22 16:47:56 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Mar 29 15:31:06 2016  Rei Odaira  <Rei.Odaira@gmail.com>
 
-	* string.c (rb_str_substr): should be infected with only original
-	  string, but not the shared string.  fixed: [ruby-core:09152]
+	* test/rinda/test_rinda.rb (test_make_socket_ipv4_multicast):
+	  The fifth argument to getsockopt(2) should be modified to
+	  indicate the actual size of the value on return,
+	  but not in AIX. This is a know bug. Skip related tests.
+	* test/rinda/test_rinda.rb (test_ring_server_ipv4_multicast):
+	  ditto.
+	* test/rinda/test_rinda.rb (test_make_socket_unicast): ditto.
+	* test/socket/test_basicsocket.rb (test_getsockopt): ditto.
+	* test/socket/test_sockopt.rb (test_bool): ditto.
 
-	* string.c (rb_str_new4): keep shared string untainted when orignal
-	  string is tainted.  fixed: [ruby-dev:29672]
+Tue Mar 29 15:27:14 2016  Rei Odaira  <Rei.Odaira@gmail.com>
 
-Sun Oct 22 05:20:34 2006  URABE Shyouhei  <shyouhei@ice.uec.ac.jp>
+	* test/zlib/test_zlib.rb (test_adler32_combine, test_crc32_combine):
+	  Skip two tests on AIX because zconf.h in zlib does not correctly
+	  recognize _LARGE_FILES in AIX. The problem was already reported
+	  to zlib, and skip these tests until it is fixed.
 
-	* configure.in: alloca is broken; use C_ALLOCA instead.
-	  [ruby-dev:29416]
+Tue Mar 29 15:10:31 2016  Rei Odaira  <Rei.Odaira@gmail.com>
 
-Fri Oct 20 10:47:43 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* thread_pthread.c (getstack): __pi_stacksize returned by
+	  pthread_getthrds_np() is wrong on AIX. Use
+	  __pi_stackend - __pi_stackaddr instead.
 
-	* lib/mkmf.rb: fixed the bug of handling COMMON_MACROS.
+Tue Mar 29 15:10:05 2016  Alex Boyd  <alex@opengroove.org>
 
-Fri Oct 20 08:42:38 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/irb.rb: avoid to needless truncation when using back_trace_limit option.
+	  [fix GH-1205][ruby-core:72773][Bug #11969]
 
-	* common.mk (NULLCMD): dummy command.
+Tue Mar 29 15:05:16 2016  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
 
-	* bcc32/Makefile.sub (post-install-*): Borland make cannot ignore
-	  command-less double-colon rules.  [ruby-dev:29676]
+	* ext/tk/lib/tkextlib/tcllib/tablelist_tile.rb: fix method name typo.
+	  [ruby-core:72513] [Bug #11893] The patch provided by Akira Matsuda.
 
-Fri Oct 20 00:37:07 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* bcc32/Makefile.sub ($(LIBRUBY_SO)): execute pre-link hook.
+Tue Mar 29 15:05:02 2016  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
 
-	* ext/extmk.rb: workaround for Borland make.
+	* ext/tk/lib/tkextlib/tcllib/toolbar.rb: fix method name typo.
+	  [ruby-core:72511] [Bug #11891] The patch provided by Akira Matsuda.
 
-Wed Oct 18 23:02:40 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* array.c (rb_ary_shift): shorten copy size.  fixed: [ruby-list:42907]
+Tue Mar 29 15:04:42 2016  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
 
-	* signal.c (Init_signal): handle SIGTERM.  fixed: [ruby-list:42895]
+	* ext/tk/lib/tkextlib/blt/tree.rb: fix method name typo.
+	  [ruby-core:72510] [Bug #11890] The patch provided by Akira Matsuda.
 
-	* win32/win32.c (rb_w32_utime): allow NULL to set the current time.
-	  [ruby-talk:219248]
 
-Wed Oct 18 00:55:33 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Mar 29 15:04:19 2016  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
 
-	* parse.y (parser_yylex): use particular enums.  [ruby-core:09221]
+	* ext/tk/lib/tk/menubar.rb: fix a typo in font name. [ruby-core:72505]
+	  [Bug #11886] The patch provided by Akira Matsuda.
 
-Mon Oct 16 08:30:43 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/tk/sample/*.rb: ditto.
 
-	* mkconfig.rb: *OBJS are not needed for extension libraries.
+Tue Mar 29 15:03:03 2016  Kenta Murata  <mrkn@mrkn.jp>
 
-	* {bcc32,wince,win32}/Makefile.sub (config.status): fixed typo,
-	  missing comma.
+	* ruby.h: undef HAVE_BUILTIN___BUILTIN_CHOOSE_EXPR_CONSTANT_P
+	  and HAVE_BUILTIN___BUILTIN_TYPES_COMPATIBLE_P on C++.
+	  [ruby-core:72736] [Bug #11962]
 
-Sun Oct 15 01:03:08 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Mar 29 14:58:56 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/test/unit/collector/dir.rb (Collector::Dir#collect): append base
-	  directory but not prepend.
+	* ext/socket/option.c (inspect_tcpi_msec): more accurate condition
+	  for TCPI msec member inspection function.
+	  [ruby-core:74388] [Bug #12185]
 
-	* lib/test/unit/collector/dir.rb (Collector::Dir#collect_file): do not
-	  join with dot.  fixed: [ruby-core:09179]
+Tue Mar 29 14:53:58 2016  Naotoshi Seo  <sonots@gmail.com>
 
-Sat Oct 14 23:39:50 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/logger.rb: Remove block from Logger.add as it's not needed
+	  patch provided by Daniel Lobato Garcia [fix GH-1240] [Bug #12054]
 
-	* parse.y (singleton): no need to re-create NODE_SELF() again.
-	  [ruby-core:09177]
+Tue Mar 29 14:52:20 2016  Zachary Scott  <zzak@ruby-lang.org>
 
-Sat Oct 14 23:25:31 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* re.c: Remove deprecated kcode argument from Regexp.new and compile
+	  patch provided by Dylan Pulliam [Bug #11495]
 
-	* parse.y (parser_warning, parser_warn): some error message may
-	  contain format specifiers.  a patch from Akinori MUSHA <knu at
-	  iDaemons.org>.  [ruby-dev:29657]
+Tue Mar 29 14:44:02 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/bigdecimal/bigdecimal.c (VpException): ditto.
+	* ext/socket/socket.c (sock_gethostname): support unlimited size
+	  hostname.
 
-	* ext/dl/handle.c (rb_dlhandle_initialize): ditto.
+Tue Mar 29 14:35:06 2016  Kouhei Sutou  <kou@cozmixng.org>
 
-	* ext/gdbm/gdbm.c (rb_gdbm_fatal): ditto.
+	* lib/xmlrpc/client.rb: Support SSL options in async methods of
+	  XMLRPC::Client.
+	  [Bug #11489]
+	  Reported by Aleksandar Kostadinov. Thanks!!!
 
-Sat Oct 14 08:24:45 2006  Akinori MUSHA  <knu@iDaemons.org>
+Tue Mar 29 14:22:57 2016  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/digest/lib/digest/hmac: Back out the addition of digest/hmac
-	  for now because the API is too premature for a stable branch.
+	* marshal.c (r_object0): honor Marshal.load post proc
+	  value for TYPE_LINK.  by Hiroshi Nakamura <nahi@ruby-lang.org>
+	  https://github.com/ruby/ruby/pull/1204 fix GH-1204
 
-Sat Oct 14 00:55:08 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Mar 29 14:18:26 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* bcc32/Makefile.sub (post-install-ext): no longer needed.
+	* .travis.yml: removed commented-out code.
 
-	* bcc32/configure.bat: get rid of a quirk of Borland make, which
-	  sets empty macro in command line to "1".
+Tue Mar 29 14:18:26 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Fri Oct 13 22:50:43 2006  Tadayoshi Funaba  <tadf@dotrb.org>
+	* .travis.yml: removed osx code. follow up with r53517
 
-	* lib/date.rb: updated based on date2 3.9.5.
+Tue Mar 29 14:12:22 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Oct 13 22:33:28 2006  Minero Aoki  <aamine@loveruby.net>
+	* ext/socket/option.c (sockopt_bool): relax boolean size to be one
+	  too not only sizeof(int).  Winsock getsockopt() returns a single
+	  byte as a boolean socket option.  [ruby-core:72730] [Bug #11958]
 
-	* lib/fileutils.rb (FileUtils.cp_r): dereference_root=true is
-	  default in Ruby 1.8.  This line is wrongly removed in last commit.
+Tue Mar 29 14:12:22 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Oct 13 18:19:31 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/socket/option.c (check_size): extract a macro to check
+	  binary data size, with a consistent message.
 
-	* object.c: Class#inherited RDoc added.  a patch from Daniel
-	  Berger <djberg96 at gmail.com>  [ruby-core:08942]
+	* ext/socket/option.c (sockopt_byte): fix error message,
+	  sizeof(int) differs from sizeof(unsigned char) in general.
 
-Fri Oct 13 02:30:12 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Mar 29 14:01:14 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/test/unit/collector/dir.rb (Collector::Dir#collect): prepend
-	  base directory to load path.
+	* process.c (rb_execarg_parent_start1): need to convert the encoding to
+	  ospath's one.
 
-	* lib/test/unit/collector/dir.rb (Collector::Dir#collect_file): should
-	  use the given File-like interface, but not File directly.
+Tue Mar 29 14:01:14 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* test/testunit/collector/test_dir.rb (TestDir::FileSystem): implement
-	  File-like methods correctly.
+	* process.c: use rb_w32_uchdir() instead of plain chdir() on Windows.
+	  reported by naruse via twitter.
 
-Fri Oct 13 01:48:42 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* process.c (rb_execarg_addopt): need to convert the encoding to
+	  ospath's one.
 
-	* lib/date.rb (Date::self.complete_hash): need to check if g is
-	  nil before dereference.  [ruby-core:09116]
+Tue Mar 29 13:56:36 2016  Eric Wong  <e@80x24.org>
 
-Fri Oct 13 00:34:26 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/stringio/stringio.c (strio_binmode): implement to set encoding
+	* test/stringio/test_stringio.rb (test_binmode): new test
+	  [ruby-core:72699] [Bug #11945]
 
-	* object.c (rb_mod_cvar_defined): wrong id check.  a patch from
-	  Mauricio Fernandez <mfp at acm.org>.  [ruby-core:09158]
+Tue Mar 29 13:50:30 2016  Eric Wong  <e@80x24.org>
 
-	* object.c (rb_mod_cvar_get): typo fixed.  [ruby-core:09168]
+	* io.c (io_getpartial): remove unused kwarg from template
+	* test/ruby/test_io.rb (test_readpartial_bad_args): new
+	  [Bug #11885]
 
-	* object.c (rb_mod_cvar_set): ditto.
+Tue Mar 29 13:41:03 2016  Tadashi Saito  <tad.a.digger@gmail.com>
 
-Wed Oct 11 22:21:41 2006  Akinori MUSHA  <knu@iDaemons.org>
+	* compile.c, cont.c, doc, man: fix common misspelling.
+	  [ruby-core:72466] [Bug #11870]
 
-	* ext/digest: Merge from trunk; metadata location changed,
-	  Digest::Base#reset() added, Digest::Base#equal() changed, and
-	  digest/hmac added with some modifications made for ruby 1.8.
+Tue Mar 29 13:31:34 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Oct 10 17:24:12 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* parse.y (regexp): set_yylval_num sets u1, should use nd_tag
+	  instead of nd_state.  [ruby-core:72638] [Bug #11932]
 
-	* {bcc32,win32,wince}/Makefile.sub (config.status): shouldn't use
-	  copy command instead of install. use -run install.
+Tue Mar 29 13:31:34 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Oct 10 16:49:16 2006  Akinori MUSHA  <knu@iDaemons.org>
+	* parse.y (set_yylval_num): should be used as nd_state, set to u3.
+	  [ruby-core:72638] [Bug #11932]
 
-	* ext/digest/digest.c (hexdigest_str_new, bubblebabble_str_new):
-	  Perform StringValue() checks properly.
+Tue Mar 29 13:26:15 2016  Joseph Tibbertsma  <josephtibbertsma@gmail.com>
 
-	* ext/digest/digest.c: Use RSTRING_{PTR,LEN} macros.
+	* gc.c (RVALUE_PAGE_WB_UNPROTECTED): fix a typo of argument name.
+	  [Fix GH-1221]
 
-Tue Oct 10 13:49:53 2006  Akinori MUSHA  <knu@iDaemons.org>
+Thu Jan 21 16:39:55 2016  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/digest: Merge from trunk; apply all changes since the
-	  initial import, except for the removal of compatibility stub
-	  libraries (md5.rb and sha1.rb).
+	* Makefile.in (update-rubyspec): fix r53208 like r53451.
 
-Mon Oct  9 23:46:29 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Jan 15 00:05:57 2016  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/parsedate.rb: documentation patch from Konrad Meyer
-	  <konrad.meyer@gmail.com>.  [ruby-doc:1238]
+	* lib/uri/generic.rb (URI::Generic#to_s): change encoding to
+	  UTF-8 as Ruby 2.2/ by Koichi ITO <koic.ito@gmail.com>
+	  https://github.com/ruby/ruby/pull/1188 fix GH-1188
 
-	* lib/open3.rb, lib/ping.rb: ditto.
+Tue Jan 12 17:23:39 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Mon Oct  9 22:56:12 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* process.c (rb_execarg_parent_start1): need to convert the encoding to
+	  ospath's one.
 
-	* lib/rexml/encoding.rb (REXML::Encoding::check_encoding): spaces
-	  are allowed around equal sign.  [ruby-core:09032]
+Tue Jan 12 17:23:39 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/rexml/parsers/baseparser.rb (REXML::Parsers::BaseParser): ditto.
+	* process.c: use rb_w32_uchdir() instead of plain chdir() on Windows.
+	  reported by naruse via twitter.
 
-Sat Oct  7 23:53:08 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* process.c (rb_execarg_addopt): need to convert the encoding to
+	  ospath's one.
 
-	* string.c (rb_str_scan): small documentation fix.
-	  [ruby-core:09007]
+Tue Jan 12 15:21:00 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Oct  7 23:44:33 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* include/ruby/missing.h (explicit_bzero_by_memset_s): remove
+	  inline implementation by memset_s, which needs a macro before
+	  including headers and can cause problems in extension libraries
+	  by the order of the macro and headers.
 
-	* bignum.c (rb_big_rshift): a bug in right shift of negative
-	  bignums.  [ruby-core:09020]
+Thu Dec 24 23:01:57 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Sat Oct  7 00:27:58 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* NEWS: added entry for CGI.escapeHTML optimization.
 
-	* class.c (rb_include_module): remove unnecessary check.
-	  [ruby-talk:218402]
+Thu Dec 24 18:43:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Oct  6 04:30:30 2006  Akinori MUSHA  <knu@iDaemons.org>
+	* error.c (rb_compile_error_with_enc, rb_compile_error),
+	  (rb_compile_bug): deprecate internal functions.
 
-	* sample/openssl/c_rehash.rb: Use digest/md5 instead of obsolete md5.
+	* parse.y (parser_yyerror): construct exception message with
+	  source code and caret.
 
-Wed Oct  4 18:47:25 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Thu Dec 24 17:25:42 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/lib/tkextlib/*: bugfix and update
-	  (see ext/tk/ChangeLog.tkextlib).
+	* compile.c (append_compile_error), parse.y (compile_error):
+	  preserve encoding of source file name in exceptions.
 
-Wed Oct  4 17:25:14 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* error.c (rb_compile_error_str, rb_compile_bug_str): add.
 
-	* eval.c (rb_call): check protected visibility based on real self,
-	  not ruby_frame->self.  [ruby-talk:217822]
+Thu Dec 24 16:17:47 2015  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Wed Oct  4 08:52:30 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* common.mk (fake.rb): $(arch)-fake.rb must depend on miniruby because
+	  it may depend on miniruby.
 
-	* test/optparse/test_getopts.rb: changed the class name of test case
-	  to get rid of conflict with test_optparse.rb.
+Thu Dec 24 16:13:05 2015  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Tue Oct  3 23:32:27 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* common.mk (ripper.c): r50045 wrongly replace $(PWD) with ../..
+	  It is the top of build directory, not topsrcdir.
 
-	* lib/test/unit/testcase.rb (Test::Unit::TestCase.suite): test name
-	  must be string.  fixed: [ruby-core:08978]
+Thu Dec 24 15:02:42 2015  sorah (Shota Fukumori)  <her@sorah.jp>
 
-Mon Oct  2 23:47:55 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* tool/vcs.rb (IO.popen): Refactor. Avoid assigning in condition.
 
-	* lib/test/unit/autorunner.rb (Test::Unit::AutoRunner::COLLECTORS):
-	  base directory should be lower precedence.  fixed: [ruby-dev:29622]
+Thu Dec 24 15:01:38 2015  sorah (Shota Fukumori)  <her@sorah.jp>
 
-	* lib/test/unit/autorunner.rb (Test::Unit::AutoRunner#options): typo.
+	* tool/file2lastrev.rb: Fix ArgumentError to work on Ruby 1.8.7.
 
-	* lib/test/unit/collector/dir.rb (Test::Unit::Collector::Dir#collect_file):
-	  load expanded path.  fixed: [ruby-dev:29621]
+Thu Dec 24 14:44:08 2015  sorah (Shota Fukumori)  <her@sorah.jp>
 
-Mon Oct  2 15:49:19 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* tool/vcs.rb (IO.popen): Enable on Ruby 1.9 where chdir option is not
+	  supported on IO.popen
 
-	* instruby.rb: batfile should be CRLF'ed.
+	* tool/vcs.rb (IO.popen): Fix NoMethodError. I guess r49705 was not
+	  tested... :/
 
-Mon Oct  2 01:24:26 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Dec 24 14:57:03 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* common.mk (test-all): separate directory where running test cases
-	  from source tree.
+	* NEWS: rename
+	  "Implementation changes" section to
+	  "Supported platform changes" section.
 
-	* lib/test/unit/autorunner.rb (options): added --basedir, --workdir
-	  and --load-path options.
+	* NEWS: add "Implementation improvements" and add several entries.
 
-	* lib/test/unit/collector/dir.rb (recursive_collect, collect_file):
-	  base directory support.
+	* NEWS: add NEWS entries by Eric Wong. [ruby-core:72450]
 
-Sun Oct  1 23:56:52 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Dec 24 00:26:05 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* Makefile.in, common.mk, ext/extmk.rb, win{32,ce}/Makefile.in: keep
-	  LIBRUBY_SO unless need to be removed.
+	* ext/io/console/extconf.rb: fix gem build failure on Windows.
+	  only win32_vk.inc is included in the gem and no dependencies for
+	  the header, so that gperf will not be mandatory.
+	  [ruby-core:72453] [Bug #11866]
 
-Sun Oct  1 23:12:19 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/io/console/io-console.gemspec: include depend file and
+	  win32_vk header.
 
-	* lib/optparse.rb (OptionParser#make_switch): pass arguments directly.
+Wed Dec 23 23:58:44 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Sep 30 15:12:25 2006  Tadayoshi Funaba  <tadf@dotrb.org>
+	* io.c (rb_readwrite_syserr_fail): works with the given errno than
+	  thread local errno.
 
-	* lib/date.rb, lib/date/format.rb: updated based on date2 3.9.4.
+Wed Dec 23 17:57:45 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Sep 29 12:11:04 2006  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* file.c, io.c, util.c: prefer rb_syserr_fail with saved errno
+	  over setting errno then call rb_sys_fail, not to be clobbered
+	  potentially and to reduce thread local errno accesses.
 
-	* jcode.rb (succ!): call original succ! if $KCODE == 'n'.
-	  fixed: [ruby-talk:216845]
+Wed Dec 23 11:58:52 2015  Yuichiro Kaneko  <yui-knk@ruby-lang.org>
 
-Fri Sep 29 11:43:40 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* string.c: Fix document. Default value of the first
+	  argument of `String#split` is not `$;` but `nil`.
+	  When `nil` is passed as first argument, `$;` is used.
+	  [ci skip] [Bug #11729] [ruby-dev:49378]
 
-	* lib/mkmf.rb (try_func): revert fallback checking undeclared function.
-	  fixed: [ruby-core:08949]
+Wed Dec 23 07:15:17 2015  Eric Wong  <e@80x24.org>
 
-Fri Sep 29 09:56:56 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/socket/init.c (rsock_init_sock): reject reserved FDs
+	  [ruby-core:72445] [Bug #11862]
 
-	* ext/extmk.rb: extout is needed for also clean.
-	  fixed: [ruby-core:08944]
+Wed Dec 23 02:59:26 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/optparse.rb (OptionParser::Switch#conv_arg): unsplat by
-	  Proc#call if no conversion is given.
+	* configure.in (__STDC_WANT_LIB_EXT1__): necessary to use memset_s
+	  in strict C99 mode.
 
-Thu Sep 28 23:59:31 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Dec 23 02:34:36 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* node.h (struct thread): declare win32_exception_list on cygwin and
-	  win32 regardless if it is implemented.  Provisional fix for
-	  [ruby-core:08917].
+	* regexec.c (match_at): move direct threaded VM code to get rid of
+	  mixed declarations and code, and enable it only for gcc since it
+	  depends on a gcc extension.
 
-Thu Sep 28 20:53:16 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+Wed Dec 23 02:23:19 2015  Yuki Nishijima  <mail@yukinishijima.net>
 
-	* lib/tmpdir.rb: use return value of getdir.call for length.
+	* gems/bundled_gems: Upgrade the did_you_mean gem to 1.0.0
 
-Wed Sep 27 01:04:49 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* NEWS: Add news about the did_you_mean gem
 
-	* lib/mkmf.rb (try_func): check function pointer first and macro next.
+Wed Dec 23 02:18:57 2015  Jake Worth  <jakeworth82@gmail.com>
 
-	* lib/mkmf.rb (have_type): simplified with typedef and sizeof.
+	* doc/contributing.rdoc: [DOC] remove an extra word "here".
+	  [Fix GH-1169]
 
-Tue Sep 26 23:57:03 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Dec 23 01:58:20 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/optparse.rb (OptionParser#getopts): use strings as key.
-	  fixed: [ruby-dev:29614]
+	* regexec.c (USE_DIRECT_THREADED_VM): enable direct threaded VM by
+	  the default.
 
-Tue Sep 26 15:31:26 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+Tue Dec 22 22:15:53 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* {win32,wince}/Makefile.sub (CPP): check predefined value.
+	* gc.c (internal_object_p): should not expose singleton classes
+	  without a metaclass.  based on patches by ko1 and shugo.
+	  [Bug #11740]
 
-Tue Sep 26 07:55:16 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* class.c (rb_singleton_class_object_p): added.
 
-	* array.c (rb_ary_shift): should not move memory region if array
-	  body is shared.  a patch from Kent Sibilev <ksruby at gmail.com>.
-	  [ruby-core:08922]
+Tue Dec 22 22:15:08 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Sep 25 22:26:26 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/io/console/io-console.gemspec: bump up to 0.4.4.
 
-	* file.c (rb_path_end): skip root directory.  fixed: [ruby-core:08913]
+Tue Dec 22 22:11:06 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* lib/mkmf.rb (init_mkmf): set default $LDFLAGS.  Patch by Michal
-	  Suchanek <hramrach at centrum.cz>.  [ruby-talk:216256]
+	* NEWS: Added news entry of Psych 2.0.17
 
-Mon Sep 25 08:14:43 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Tue Dec 22 22:09:01 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* array.c (rb_ary_shift): should clear shifting top element.
-	  [ruby-talk:216055]
+	* NEWS: Added news entry of RDoc 4.2.1
 
-	* array.c (rb_ary_shift): avoid creating shared object if array
-	  size is small.
+Tue Dec 22 21:20:00 2015  Kenta Murata  <mrkn@mrkn.jp>
 
-Mon Sep 25 08:11:35 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/bigdecimal/bigdecimal.gemspec: bump version to 1.2.8.
 
-	* random.c (rb_f_rand): RDoc typo fix.  a patch from Frederick
-	  Cheung <fred at 82ask.com>.  [ruby-talk:216047]
+Tue Dec 22 21:08:05 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Sun Sep 24 22:28:20 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/rdoc.rb: bump version to 4.2.1. It contains following fixes.
+	  https://github.com/rdoc/rdoc/pull/340
+	  https://github.com/rdoc/rdoc/pull/341
+	  https://github.com/rdoc/rdoc/pull/367
+	  https://github.com/rdoc/rdoc/pull/368
+	* lib/rdoc/*: ditto.
+	* test/rdoc/*: ditto.
 
-	* runruby.rb: extension library scripts moved into common directory.
+Tue Dec 22 20:25:33 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Sun Sep 24 14:59:50 2006  Tanaka Akira  <akr@fsij.org>
+	* ext/psych/lib/psych.rb: bump version to 2.0.17
+	* ext/psych/psych.gemspec: ditto.
 
-	* node.h (struct thread): ia64 support is broken by sandbox patch.
+Tue Dec 22 20:14:47 2015  Koichi Sasada  <ko1@atdot.net>
 
-Sun Sep 24 12:11:16 2006  Tadayoshi Funaba  <tadf@dotrb.org>
+	* vm_insnhelper.c: move vm_callee_setup_block_arg() (and related
+	  functions) to the latter location.
+	  This moving recovers performance a little.
+	  [Bug #11829]
 
-	* lib/date.rb, lib/date/format.rb: updated based on date2 3.9.3.
+Tue Dec 22 15:21:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Sep 23 23:24:57 2006  why the lucky stiff  <why@ruby-lang.org>
+	* string.c (str_compat_and_valid): as scrub does nothing for dummy
+	  encoding string now, incompatible encoding is not a matter.
 
-	* eval.c (rb_thread_save_context, rb_thread_restore_context):
-	  sandbox hook to save and restore sandbox state.
+Tue Dec 22 14:31:28 2015  Toru Iwase  <tietew@tietew.net>
 
-	* eval.c (thread_no_ensure): added THREAD_NO_ENSURE thread flag.
+	* ext/cgi/escape/escape.c (optimized_escape_html): CGI.escapeHTML
+	  should return unfrozen new string.
+	  [ruby-core:72426] [Bug #11858]
 
-	* eval.c (rb_thread_kill_bang): Thread#kill! uses the above flag
-	  to circumvent ensure, in order to prevent endless loops.
-	  [ruby-core:08768]
+Tue Dec 22 05:39:58 2015  Takashi Kokubun  <takashikkbn@gmail.com>
 
-	* eval.c (rb_thread_kill): fix Thread#kill docs, which returns
-	  the thread object in all cases.
+	* ext/cgi/escape/escape.c (preserve_original_state): Preserve
+	  original state for tainted and frozen.  [Fix GH-1166]
+	  [ruby-dev:49451] [Bug #11855]
 
-	* node.h: expose the rb_jmpbuf_t and rb_thread_t structs, along
-	  with the thread flags.  used by the sandbox extension.
+Tue Dec 22 03:57:20 2015  Eric Wong  <e@80x24.org>
 
-	* ruby.h: extern rb_eThreadError, so sandbox can swap it.
+	* ext/socket/init.c (rsock_init_sock): check FD after validating
+	* test/socket/test_basicsocket.rb (test_for_fd): new
+	  [ruby-core:72418] [Bug #11854]
 
-Sat Sep 23 21:34:15 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Mon Dec 21 21:29:45 2015  Naohisa Goto  <ngotogenome@gmail.com>
 
-	* lib/cgi.rb (CGI::QueryExtension::read_multipart): CGI content
-	  may be empty.  a patch from Jamis Buck <jamis at 37signals.com>.
+	* variable.c (struct ivar_update): rename "extended" to "iv_extended"
+	  to avoid name conflict with /usr/include/floatingpoint.h on
+	  Solaris. [Bug #11853] [ruby-dev:49448]
 
-Sat Sep 23 08:35:53 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Mon Dec 21 12:15:32 2015  Kimura Wataru  <kimuraw@i.nifty.jp>
 
-	* lib/rdoc/ri/ri_options.rb: prevent NameError.  [ruby-dev:29597]
+	* test/ruby/test_io.rb: handled rlimit value same as r52277
+	  [Bug #11852][ruby-dev:49446]
 
-Sat Sep 23 01:04:20 2006  Tadayoshi Funaba  <tadf@dotrb.org>
+Mon Dec 21 10:21:22 2015  Ilya Vassilevsky <vassilevsky@gmail.com>
 
-	* lib/date.rb, lib/date/format.rb: updated based on date2 3.9.2.
+	* lib/net/http.rb (open_timeout): update default value in RDoc
+	  [ruby-core:72413]
 
-Fri Sep 22 02:06:26 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon Dec 21 10:18:46 2015  Kazuki Yamaguchi  <k@rhe.jp>
 
-	* .cvsignore: ignore timestamp files and installed list file.
+	* vm_backtrace.c (rb_profile_frames): ignore ifunc frames as it
+	  did before.  [ruby-core:72409] [Bug #11851]
 
-Fri Sep 22 01:36:34 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon Dec 21 09:33:17 2015  Karol Bucek  <kares@users.noreply.github.com>
 
-	* instruby.rb: include FileUtils unconditionally.
+	* ext/openssl/lib/openssl/ssl.rb (OpenSSL::SSL::SSLSocket): fix
+	  NotImplementedError typo.  [Fix GH-1165]
 
-Thu Sep 21 22:56:20 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sun Dec 20 20:54:51 2015  Takashi Kokubun  <takashikkbn@gmail.com>
 
-	* common.mk (no-install): not install rdoc actually.
+	* cgi/escape/escape.c: Optimize CGI.escapeHTML for
+	  ASCII-compatible encodings.  [Fix GH-1164]
 
-	* common.mk (install-doc, no-install-doc): use instruby.rb.
+Sun Dec 20 15:36:46 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* instruby.rb: rdoc installation.
+	* lib/erb.rb: revert r53123. It breaks compatibility like thor and
+	  rspec-rails.
+	  We should try with Ruby 2.4 or 3.0.
+	  [Bug #11842][ruby-core:72374]
+	* lib/rdoc/erb_partial.rb: ditto.
+	* template/verconf.h.tmpl: ditto.
 
-	* ext/extmk.rb: expand ruby executable names.
+Sun Dec 20 11:43:31 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Sep 21 13:55:07 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* parse.y (parser_yylex): allow here documents in labeled
+	  argument.  [ruby-core:72396] [Bug #11849]
 
-	* ext/etc/etc.c (etc_getpwuid): uid integer should be wraped in
-	  uid_t value.  [ruby-core:08897]
+Sun Dec 20 11:14:11 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/etc/etc.c (etc_getpwuid): uid_t may be bigger than plain
-	  'int' type.
+	* proc.c (rb_mod_define_method): should check Symbol or not.
+	  [Bug #11850]
 
-Wed Sep 20 23:17:41 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/ruby/test_method.rb: add a test.
 
-	* common.mk (pre-install-doc): create data directory before install.
+Sun Dec 20 11:01:57 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/mkmf.rb (dir_re): fixed typo.
+	* proc.c (rb_mod_define_method): fix notation.
 
-	* lib/mkmf.rb (install_dirs): remove extra slash.
+Sun Dec 20 10:54:15 2015  Koichi Sasada  <ko1@atdot.net>
 
-Wed Sep 20 09:53:38 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* proc.c (proc_new): fix notation.
 
-	* {bcc32,win32,wince}/Makefile.sub (INSTALLED_LIST): need to define
-	  this macro to install.
+Sun Dec 20 00:29:00 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Sep 20 09:43:10 2006  Shugo Maeda  <shugo@ruby-lang.org>
+	* proc.c (rb_proc_get_iseq): proc made from symbol does not have
+	  iseq.  fix infinite loop.  [ruby-core:72381] [Bug #11845]
 
-	* lib/net/imap.rb: allow extra spaces in responses.
-	  Thanks, Tom Soderlund. (backported from HEAD)
+Sat Dec 19 20:06:10 2015  Naohisa Goto  <ngotogenome@gmail.com>
 
-Wed Sep 20 09:25:39 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* enc/windows_1250.c: Should not use C++ style comments (C99 feature).
+	  [Bug #11843]
 
-	* ext/gdbm/gdbm.c: add RDoc documentation. a patch from Peter
-	  Adolphs <futzilogik at users dot sourceforge dot net>.
-	  [ruby-doc:1223]
+Sat Dec 19 17:17:04 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Sep 19 01:28:00 2006  Minero Aoki  <aamine@loveruby.net>
+	* lib/webrick/utils.rb (WEBrick::Utils::TimeoutHandler#initialize):
+	  use WEBrick::Utils::TimeoutHandler::Thread, which is ignored by
+	  LeakChecker#find_threads, instead of ::Thread to get rid of
+	  thread leak checker.  since this TimeoutHandler is resident
+	  during tests because of Singleton, it waits for the next timeout
+	  if it has any schedules.  in the case of nested timeouts, inner
+	  timeout does not cancel outer timeouts and then those schedules
+	  still remain.
 
-	* lib/fileutils.rb: backport from HEAD (rev 1.71).
+Sat Dec 19 14:28:01 2015  Jake Worth  <jakeworth82@gmail.com>
 
-	* lib/fileutils.rb (FileUtils.cp_r): new option
-	  :remove_destination.
+	* ext/zlib/zlib.c (Init_zlib): [DOC] Fix double-word typo and
+	  grammatical error.  [Fix GH-1162]
 
-Tue Sep 19 00:42:15 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Dec 19 14:23:59 2015  Jake Worth  <jakeworth82@gmail.com>
 
-	* object.c (rb_obj_ivar_defined, rb_mod_cvar_defined): new methods,
-	  Kernel#instance_variable_defined? and Module#class_variable_defined?.
-	  [ruby-dev:29587]
+	* lib/csv.rb (CSV#initialize): [DOC] Fix double-word typo.
+	  [Fix GH-1161]
 
-	* lib/date/format.rb (Date::Bag#method_missing): use new method,
-	  instance_variable_defined? to check if an instance variable is
-	  defined.  fixed: [ruby-dev:29554]
-	  -- This didn't fix anything.
+Sat Dec 19 10:33:33 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
 
-Sun Sep 17 23:44:58 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* enc/iso_8859_2.c, enc/windows_1250.c: separate Windows-1250
+	  from ISO-8859-2 to fix 0x80..0x9e range (from Kimihito Matsui)
 
-	* lib/rdoc/rdoc.rb (RDoc::RDoc#document): scan only files modified
-	  after the previous generation.
+Fri Dec 18 21:26:54 2015  Naohisa Goto  <ngotogenome@gmail.com>
 
-Sun Sep 17 17:42:13 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/webrick/utils.rb (WEBrick::Utils::TimeoutHandler): To prevent
+	  potential deadlocks, Queue is used to tell update of @timeout_info
+	  instead of sleep and wakeup. [Bug #11742] [ruby-dev:49387]
 
-	* common.mk (install-doc): reverted.
+Fri Dec 18 17:24:09 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* instruby.rb: stores file name list without destdir prefix.
+	* compile.c (ibf_load_object_string): use fstring if frozen string.
 
-	* lib/rdoc/generators/ri_generator.rb: do not chdir twice.
+Fri Dec 18 16:54:38 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Sep 16 23:14:29 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/stringio/stringio.c (strio_set_encoding): add StringIO's own
+	  encoding and separate it from the buffer string to override the
+	  encoding of string when reading.  [ruby-core:72189] [Bug #11827]
+	  note that setting the encoding of its buffer string directly
+	  without StringIO#set_encoding may cause unpredictable behavior.
 
-	* ext/pty/pty.c (establishShell): remove remaining unused line.
+Fri Dec 18 16:50:35 2015  Koichi Sasada  <ko1@atdot.net>
 
-Sat Sep 16 16:40:44 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* compile.c (ibf_load_setup): check tainted string argument.
 
-	* Makefile.in, common.in, instruby.rb, ext/extmk.rb, lib/mkmf.rb:
-	  use instruby.rb to install extensions instead of ext/extmk.rb.
+Fri Dec 18 16:12:13 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* instruby.rb: store installed list into the file.
+	* vm_core.h: define USE_LAZY_LOAD if it is not defined.
 
-	* ext/dbm/extconf.rb: allow multiple candidates for dbm-type.
+Fri Dec 18 15:40:06 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/io/wait/extconf.rb: suspicious checking_for.
+	* ext/stringio/stringio.c (strio_unget_bytes): extract from
+	  strio_ungetbyte to share with strio_ungetc.
 
-	* ext/pty/pty.c (establishShell): parent pid is not used.
+Fri Dec 18 12:39:42 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* ext/pty/pty.c (freeDevice): not used.
+	* doc/syntax/*.rdoc: separated modifier at sentence.
+	  [ci skip][fix GH-1121] Patch by @clandry94
 
-	* ext/pty/pty.c (get_device_once): removed garbage right brace.
+Fri Dec 18 12:09:21 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/mkmf.rb (checking_for): improved the messages.
+	* ext/stringio/stringio.c (strio_ungetbyte): pad with \000 when
+	  the current position is after the end.
 
-Thu Sep 14 16:11:15 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Dec 18 11:24:48 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* string.c (rb_str_intern): raise SecurityError only when $SAFE
-	  level is greater than zero.  [ruby-core:08862]
+	* vm_method.c (rb_method_entry_make, check_override_opt_method):
+	  should check whether a newly created method overrides an optimize
+	  method in case the method is defined in a prepended module of a
+	  built-in class.
+	  [ruby-core:72226] [Bug #11836]
 
-	* parse.y (rb_interned_p): new function to check if a string is
-	  already interned.
+Fri Dec 18 11:09:38 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* object.c (str_to_id): use rb_str_intern().
+	* vm.c (vm_exec): call RUBY_DTRACE_CMETHOD_RETURN_HOOK instead of
+	  RUBY_DTRACE_METHOD_RETURN_HOOK.
 
-Wed Sep 13 18:43:05 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Dec 18 10:24:44 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* README.EXT: English adjustment.  [ruby-core:08851] and
-	  [ruby-core:08852]
+	* lib/irb/ruby-lex.rb: fixed parse error for striped heredocument syntax.
+	  [fix GH-1127] Patch by @koic
 
-Wed Sep 13 18:25:18 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Dec 18 09:44:47 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* misc/ruby-mode.el (ruby-parse-partial): better here-doc support.
-	  a patch from Marshall T. Vandegrift <llasram at gmail.com>.
-	  [ruby-core:08804]
+	* ext/pty/pty.c: fix double words typo.
+	  [ci skip][fix GH-1157] Patch by @jwworth
 
-Wed Sep 13 16:43:36 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Dec 18 09:42:45 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* string.c (rb_str_intern): prohibit interning tainted string.
+	* ext/nkf/nkf-utf8/utf8tbl.c: fix a typo.
+	  [ci skip][fix GH-1159] Patch by @akshay-vishnoi
+	* ext/nkf/nkf-utf8/utf8tbl.h: ditto.
 
-Wed Sep 13 01:14:21 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Dec 18 07:39:01 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* lib/optparse.rb (OptionParser#getopts): works with pre-registered
-	  options.  [ruby-core:08826]
+	* vm.c (rb_vm_check_redefinition_opt_method): should check the real
+	  class instead of the origin iclass.
+	  [ruby-core:72188] [Bug #11826]
 
-Sun Sep 10 20:27:13 2006  Tadayoshi Funaba  <tadf@dotrb.org>
+Thu Dec 17 22:13:10 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* lib/date.rb, lib/date/format.rb: updated based on date2 3.9.1.
+	* vm_args.c (vm_caller_setup_arg_block): remove code for ifunc
+	  because it was made unnecessary by r52138.
 
-Tue Jan 10 09:18:03 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Dec 17 16:13:10 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* eval.c (stack_extend): fixed prototype.
+	* proc.c (rb_block_arity): should not call GetProcPtr() for symbols.
+	  [ruby-core:72205] [Bug #11830]
 
-	* eval.c (rb_require_safe): prevent extension from loading twice.
-	  fixed: [ruby-dev:29523]
+Thu Dec 17 14:16:29 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Sep  9 23:50:38 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* string.c (rb_str_scrub): the result should be infected by the
+	  original string.
 
-	* bignum.c (rb_big_mul0): bignum multiplication without
-	  normalization.
+Thu Dec 17 13:35:27 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* bignum.c (rb_big_pow): use rb_big_mul0().  [ruby-dev:29547]
+	* transcode.c (rb_econv_substr_append, econv_primitive_convert):
+	  the result should be infected by the original string.
 
-Sat Sep  9 14:08:38 2006  Eric Hodel  <drbrain@segment7.net>
+Thu Dec 17 09:46:08 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/test/unit/testcase.rb (Test::Unit::TestCase#run): Rescue
-	  Exception in Test::Unit::TestCase#run.  [ruby-core:08783]
+	* re.c (reg_names_iter): should consider encoding of regexp.
+	  [ruby-core:72185] [Bug #11825]
 
-Sat Sep  9 04:55:59 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Dec 17 03:52:10 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/pstore.rb: open all in binary mode, and get rid of the quirk of
-	  msvcrt.  fixed: [ruby-dev:29518]
+	* vm.c (vm_make_env_each): should not compare with Qfalse and FALSE.
+	  Pointed at http://d.hatena.ne.jp/nagachika/20151216/ruby_trunk_changes_53128_53163
 
-Sat Sep  9 04:54:42 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Dec 17 03:15:25 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* Makefile.in, win32/Makefile.sub (MINIRUBY): append MINIRUBYOPT.
+	* vm_insnhelper.c (vm_call_method_each_type): should not set fastpath
+	  with keyword arguments for VM_METHOD_TYPE_ATTRSET type methods.
 
-	* mkconfig.rb, ext/extmk.rb, lib/mkmf.rb, win32/mkexports.rb: suppress
-	  warnings with $VERBOSE.
+	  Normally, we can not use keyword arguments for this kind of methods,
+	  (obj.foo = 1), but we can set alias names for them.
+	  [Bug #11657]
 
-	* ext/extmk.rb: Proc#call does not pass the block in 1.8.
+	* test/ruby/test_keyword.rb: add a test for this fix.
 
-	* win32/resource.rb: add more info.
+Wed Dec 16 20:32:43 2015  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
 
-Fri Sep  8 10:03:59 2006  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* ext/fiddle/handle.c: check tainted string arguments.
+	  Patch provided by tenderlove and nobu.
 
-	* lib/webrick/cookie.rb (WEBrick::Cookie.parse_set_cookies): new
-	  method to parse multiple cookies per Set-Cookie header.
-	  Thanks to Aaron Patterson <aaron_patterson at speakeasy.net>.
-	  [ruby-core:08802]
+	* test/fiddle/test_handle.rb (class TestHandle): add test for above.
 
-Fri Sep  8 08:59:30 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* win32/Makefile.sub, win32/configure.bat win32/setup.mak: program
-	  name transform.
+Wed Dec 16 19:30:56 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-Fri Sep  8 01:33:08 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* vm.c (vm_make_proc_from_block): should convert a Symbol to a Proc.
+	  [ruby-core:72083] [Bug #11811]
 
-	* ruby.h (RSTRING_PTR): add migration macro.
+Wed Dec 16 16:17:34 2015  Eric Wong  <e@80x24.org>
 
-	* ruby.h (RARRAY_PTR): ditto.
+	* test/ruby/test_io.rb: fix spelling errors
 
-Thu Sep  7 23:27:05 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Dec 16 16:04:49 2015  Eric Wong  <e@80x24.org>
 
-	* file.c (path_check_0, fpath_check): disable path check on cygwin.
-	  [ruby-talk:213074]
+	* NEWS: note IO#advise change [ruby-core:72168]
 
-Wed Sep 06 12:05:19 2006  NARUSE, Yui  <naruse@ruby-lang.org>
+Wed Dec 16 15:35:13 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/nkf/lib/kconv.rb (Kconv::RegexpEucjp): fix regexp for euc-jp
-	  [ruby-dev:29344]
+	* vm.c: fix mark miss for proc given as passed block.
+	  [Bug #11750]
 
-	* ext/nkf/lib/kconv.rb (Kconv::toeuc): remove -m0 [ruby-dev:29505]
+	* vm.c (vm_make_proc_from_block): should return a Proc object
+	  if block is given. Previous implementation returns
+	  a Proc object only when corresponding Proc object is not
+	  available.
 
-Tue Sep  5 06:47:22 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* vm.c (vm_make_env_each): ditto.
 
-	* time.c (time_to_s): variable declaration after an execution
-	  statement.
+	* test/ruby/test_proc.rb: add a test for this bug.
 
-Tue Sep  5 05:56:51 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Dec 16 12:24:59 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
 
-	* numeric.c (flo_hash): improve collision.  fixed: [ruby-dev:29352]
+	* test_struct.rb: Test that initialize is overridable [#11708]
 
-Tue Sep  5 05:49:41 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Dec 16 10:49:51 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* file.c (path_check_0): check if sticky bit is set on parent
-	  directories for executable path.  fixed: [ruby-dev:29415]
+	* parse.y (block_command, block_call): fix `&.` calls after
+	  block_call.  [Feature #11537]
 
-Tue Sep  5 05:03:46 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Wed Dec 16 00:53:45 2015  Naohisa Goto  <ngotogenome@gmail.com>
 
-	* numeric.c (fix_plus): addition in Fixnum will never overflow
-	  long.  a patch from Ondrej Bilka <neleai at seznam.cz>.
-	  [ruby-core:08794]
+	* lib/webrick/utils.rb (WEBrick::Utils::TimeoutHandler): Acquire
+	  TimeoutMutex only when accessing @timeout_info for avoiding
+	  potential deadlock. [Bug #11742] [ruby-dev:49387]
 
-	* numeric.c (fix_minus): ditto.
+Wed Dec 16 00:39:27 2015  Jake Worth  <jakeworth82@gmail.com>
 
-	* bignum.c (rb_big_pow): eagerly truncate resulting bignum.
-	  [ruby-core:08794]
+	* doc/extension.rdoc: [DOC] fix double-word typo.  [Fix GH-1153]
 
-Mon Sep  4 23:15:34 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Wed Dec 16 00:25:41 2015  Naohisa Goto  <ngotogenome@gmail.com>
 
-	* time.c (time_to_s): make it conform to RFC2822 date format.
-	  [ruby-dev:29467]
+	* lib/webrick/utils.rb (WEBrick::Utils::TimeoutHandler#initialize):
+	  TimeoutMutex should be acquired when accessing @timeout_info.
+	  To avoid deadlock, interrupt() calls are delayed.
+	  Due to the mutex, it is safe to treat ary without ary.dup.
+	  [Bug #11742] [ruby-dev:49387]
 
-Mon Sep  4 21:43:57 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Dec 15 23:13:10 2015  Naohisa Goto  <ngotogenome@gmail.com>
 
-	* ext/dbm/extconf.rb: create makefile according to the result of check
-	  for dbm header.  fixed: [ruby-dev:29445]
+	* gc.c: Delete excess semicolon after RUBY_ALIAS_FUNCTION().
+	  Suppress "syntax error:  empty declaration" warnings by
+	  Oracle Solaris Studio 12.x on Solaris. [Bug #11821]
 
-Mon Sep  4 21:42:35 2006  Tadayoshi Funaba  <tadf@dotrb.org>
+	* hash.c: ditto, after NOINSERT_UPDATE_CALLBACK().
 
-	* lib/date.rb, lib/date/format.rb: updated based on date2 3.9.
+Tue Dec 15 18:04:04 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
 
-Mon Sep  4 21:14:20 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* NEWS: added news about EBCDIC encoding
 
-	* time.c (time_strftime): include nul character.  fixed: [ruby-dev:29422]
+Tue Dec 15 17:57:57 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
 
-Mon Sep  4 16:29:33 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* enc/ebcdic.h, enc/trans/ebcdic.trans,
+	  test/ruby/test_transcode.rb: Fixed encoding name
+	  to the correct one in the IANA registry (IBM037)
+	  and added an alias (ebcdic-cp-us)
 
-	* lib/cgi.rb (CGI::out): specify -m0 -x option for nkf.
-	  [ruby-dev:29284]
+Tue Dec 15 16:19:26 2015  Takashi Kokubun  <takashikkbn@gmail.com>
 
-Mon Sep  4 16:13:23 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/erb.rb: Render erb with array buffer for function call optimization.
+	  [fix GH-1143]
+	* lib/rdoc/erb_partial.rb: ditto.
+	* template/verconf.h.tmpl: ditto.
 
-	* io.c (pipe_open): command name should not contain null bytes.
-	  [ruby-dev:29421]
+Tue Dec 15 13:50:05 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* process.c (proc_spawn): ditto.
+	* string.c (rb_str_oct): [DOC] mention radix indicators.
+	  [ruby-core:71310] [Bug #11648]
 
-	* process.c (proc_spawn_n): ditto.
+Tue Dec 15 12:20:30 2015  Takashi Kokubun  <takashikkbn@gmail.com>
 
-	* process.c (rb_f_system): ditto.
+	* lib/erb.rb: Simplify regexp to optimize erb scanner.
+	  [fix GH-1144]
 
-Sun Sep  3 15:32:44 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Dec 15 11:56:24 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* lib/mkmf.rb: get rid of nil.to_s.
+	* lib/uri/common.rb: make code block for rdoc.
+	  [ci skip][fix GH-1152] Patch by @Tonkpils
 
-Sun Sep  3 06:24:38 2006  Tanaka Akira  <akr@fsij.org>
+Tue Dec 15 11:55:08 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* ext/socket/socket.c (ruby_connect): sockerrlen should be socklen_t.
+	* ext/zlib/zlib.c: fix a typo.
+	  [ci skip][fix GH-1149] Patch by @crismali
 
-Sun Sep  3 04:40:42 2006  Tanaka Akira  <akr@fsij.org>
+Tue Dec 15 09:14:14 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
 
-	* ext/socket/extconf.rb: check arpa/inet.h for ntohs.
+	* tool/transcode_tablegen.rb: detailed documentation
+	  for transcode_tblgen function [ci skip]
 
-	* ext/socket/socket.c: include arpa/inet.h if available.
+Mon Dec 14 22:11:11 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
 
-Sun Sep  3 02:34:55 2006  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+	* enc/ebcdic.h: new dummy encoding EBCDIC-US
+	* enc/trans/ebcdic.trans: transcodings between EBCDIC-US
+	  and iso-8859-1 [with code from Andrea Ribuoli]
+	* test/ruby/test_transcode.rb: tests for above
+	* tool/transcode_tablegen.rb: additional argument for
+	  method transcode_tblgen
 
-	* lib/drb/unix.rb (DRbUNIXSocket#close): don't get path if client mode.
-	  [ruby-dev:29417]
+Mon Dec 14 17:04:14 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Sun Sep  3 01:45:17 2006  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+	* ext/socket/lib/socket.rb: use safe navigation operator.
+	  [fix GH-1142] Patch by @mlarraz
+	* lib/drb/extservm.rb: ditto.
+	* lib/net/http.rb: ditto.
+	* lib/net/http/response.rb: ditto.
+	* lib/scanf.rb: ditto.
+	* lib/uri/generic.rb: ditto.
 
-	* lib/drb/acl.rb (ACLEntry#initialize): examine whether '*' is
-	  included before IPAddr.new. [ruby-dev:29406]
+Mon Dec 14 17:03:05 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Sat Sep  2 13:23:01 2006  Tanaka Akira  <akr@fsij.org>
+	* bootstraptest/runner.rb: use safe navigation operator.
+	  [fix GH-1142] Patch by @mlarraz
+	* test/openssl/test_pair.rb: ditto.
+	* test/ruby/test_econv.rb: ditto.
+	* test/ruby/test_settracefunc.rb: ditto.
+	* test/thread/test_queue.rb: ditto.
 
-	* common.mk (ia64.o): use the compiler driver to assemble ia64.s
-	  to use appropriate ABI.
+Mon Dec 14 14:33:35 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Sat Sep  2 03:36:22 2006  Tanaka Akira  <akr@fsij.org>
+	* lib/xmlrpc.rb: added documentation for parser details.
+	  [ci skip][fix GH-1124] Patch by @jrafanie
 
-	* common.mk, configure.in, defines.h, eval.c, gc.c, main.c,
-	  numeric.c, ruby.h, ia64.s: backport IA64 HP-UX support.
+Mon Dec 14 11:46:52 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Fri Sep  1 13:52:57 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* enum.c: fix a typo in documentation.
+	  [ci skip][fix GH-1140] Patch by @jutaz
+	* io.c: ditto.
+	* iseq.c: ditto.
+	* numeric.c: ditto.
+	* process.c: ditto.
+	* string.c: ditto.
+	* vm_trace.c: ditto.
 
-	* ext/tk/lib/tk/font.rb: TkFont#current_configinfo() doesn't work
-	  on Tcl/Tk8.x.
+Mon Dec 14 11:41:59 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Thu Aug 31 12:46:55 2006  why the lucky stiff  <why@ruby-lang.org>
+	* lib/cgi.rb: fix a typo in documentation.
+	  [ci skip][fix GH-1140] Patch by @jutaz
 
-	* eval.c (ruby_init): rename top_cref to ruby_top_cref and export,
-	  along with ruby_cref, for use by the sandbox. [ruby-core:08762]
+Mon Dec 14 11:31:00 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
+	* compile.c: fix typos.
+	  [ci skip][fix GH-1140] Patch by @jutaz
+	* dir.c: ditto.
+	* gc.c: ditto.
+	* io.c: ditto.
 	* node.h: ditto.
+	* thread_pthread.c: ditto.
+	* vm_insnhelper.c: ditto.
+	* vsnprintf.c: ditto.
 
-Tue Aug 29 19:10:10 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* hash.c (rb_hash_s_create): fixed memory leak, based on the patch
-	  by Kent Sibilev <ksruby at gmail.com>.  fixed: [ruby-talk:211233]
-
-Mon Aug 28 11:36:02 2006  Eric Hodel  <drbrain@segment7.net>
-
-	* lib/rdoc/parsers/parse_rb.rb: Fix typo.  Submitted by
-	  <calamitas at gmail.com>.  [ruby-core:08724]
-
-Mon Aug 28 07:53:44 2006  Eric Hodel  <drbrain@segment7.net>
-
-	* lib/rdoc/ri/ri_formatter.rb: Don't unescape HTML in HtmlFormatter.
-	  Submitted by Kent Sibilev <ksruby at gmail.com>.  [ruby-core:08392].
-
-Mon Aug 28 07:25:45 2006  Eric Hodel  <drbrain@segment7.net>
-
-	* file.c (File#size?): Fix documentation submitted by Rick Ohnemus.
-	  ruby-Bugs-5529.  [ruby-core:08725]
-
-Sat Aug 26 08:07:13 2006  Tadayoshi Funaba  <tadf@dotrb.org>
-
-	* lib/date.rb, lib/date/format.rb: updated based on date2 3.8.2.
-
-Fri Aug 25 22:32:04 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/rexml/source.rb (REXML::IOSource#initialize): encoding have to
-	  be set with the accessor.  fixed: [ruby-list:42737]
-
-Fri Aug 25 17:15:17 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* stable version 1.8.5 released.
-
-Fri Aug 25 17:02:06 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* gc.c (gc_sweep): typo fixed.
-
-Tue Aug 22 18:47:51 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::handle_method):
-	  rdoc documents C module methods as instance methods. a patch in
-	  [ruby-core:08536].
-
-Sat Aug 19 14:15:02 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/Makefile.sub (config.status): include winsock2.h instead of
-	  winsock.h when --with-winsock2 is specified.
-	  fixed: [ruby-dev:29296]
-
-Sat Aug 19 11:28:08 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* file.c (rb_file_s_rename): use errno if set properly.
-	  fixed: [ruby-dev:29293]
-
-Sat Aug 19 11:09:23 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* parse.y (then): remove semicolon warning.  [ruby-dev:29299]
-
-Thu Aug 17 19:15:16 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* file.c (rb_stat_[rRwWxX]): check for super user.
-	  fixed: [ruby-core:08616]
-
-Thu Aug 17 14:47:06 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/mkmf.rb: added rdoc by Daniel Berger.  [ruby-core:08177]
-
-Thu Aug 17 00:39:05 2006  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* lib/rinda/ring.rb (do_reply): Fix for RingServer fails to find a
-	  TupleSpace when TupleSpace resides in the same ruby process with
-	  RingServer. a patch from Kent Sibilev. [ruby-core:08453]
-
-Wed Aug 16 11:45:36 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* process.c (proc_setuid, proc_setgid, proc_seteuid, proc_setegid):
-	  get rid of bogus implementations on Mac OS X.
-
-Tue Aug 15 19:10:18 2006  Eric Hodel  <drbrain@segment7.net>
-
-	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser#find_class_comment): Fix
-	  broken class-level documentation.
-
-Wed Aug 16 11:09:26 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ruby.c (set_arg0): fill argv other than the first with an empty
-	  string instead of NULL.
-
-Wed Aug 16 11:08:00 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* win32/win32.h: removed an excess macro.  fixed: [ruby-dev:29258]
-
-Tue Aug  8 23:49:06 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/irb/extend-command.rb (IRB::ExtendCommandBundle): pacify
-	  RDoc.  a patch from Eric Hodel <drbrain at segment7.net>.
-	  [ruby-core:08522]
-
-Tue Aug  8 11:32:54 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* Makefile.in, common.mk, configure.in: fix for platforms without
-	  rm. patches from Yutaka kanemoto <kinpoco at gmail.com>.
-	  [ruby-dev:29215]
-
-Mon Aug  7 17:56:59 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/bigdecimal/bigdecimal.c, ext/digest/rmd160/rmd160ossl.c,
-	  ext/digest/sha1/sha1ossl.c, ext/readline/readline.c: move
-	  incluion of config.h to pacify AIX.  a patch from Yutaka
-	  Kanemoto <kinpoco at gmail.com>.  [ruby-dev:29197]
-
-Mon Aug  7 15:55:08 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/syck/syck.c (syck_move_tokens): should avoid negative
-	  memmove.  [ruby-list:42625]
-
-Mon Aug  7 14:37:48 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* configure.in, common.mk: AIX link issue.  a patch from Yutaka
-	  Kanemoto <kinpoco at gmail.com>.  [ruby-dev:29190]
-
-	* ext/socket/socket.c: AIX socket support.  [ruby-dev:29190]
-
-Mon Aug  7 12:05:28 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* dln.c, eval.c, gc.c, regex.c, ruby.h: shut up AIX alloca
-	  warning.  a patch from Yutaka Kanemoto <kinpoco at gmail.com>.
-	  [ruby-dev:29191]
-
-Sun Aug  6 20:40:41 2006  Tadayoshi Funaba  <tadf@dotrb.org>
-
-	* lib/date/format.rb (str[fp]time): %[EO]U didn't denote %U.
-
-Sat Aug  5 17:07:43 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* parse.y (top_local_setup): local_vars[-1] should point
-	  ruby_scope itself to protect local_tbl from garbage collection.
-	  [ruby-dev:29049]
-
-Sat Aug  5 13:54:03 2006  Tadayoshi Funaba  <tadf@dotrb.org>
-
-	* lib/date/format.rb (str[fp]time): "%\n" means "\n".
-
-Fri Aug  4 15:21:00 2006  Eric Hodel  <drbrain@segment7.net>
-
-	* lib: Merge RDoc and .document from HEAD.
-	* lib/drb/ssl.rb: Close socket on SSLError [ruby-core:7197]
-
-Fri Aug  4 19:13:41 2006  Keiju Ishitsuka  <keiju@ruby-lang.org>
-
-	* lib/irb/{init.rb,ruby-lex.rb,slex.rb}: can't input '\c' for
-	  [ruby-core: 7122].
+Mon Dec 14 11:27:01 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Fri Aug  4 14:02:14 2006  James Edward Gray II  <james@grayproductions.net>
+	* enc/iso_2022_jp.h: fix typos.
+	  [ci skip][fix GH-1140] Patch by @jutaz
+	* enc/utf_16_32.h: ditto.
+	* enc/utf_7.h: ditto.
 
-	* lib/date/format.rb (__strptime, strftime): allow multi-line patterns
-	  in Date#strftime the same as Time#strftime accepts.
-	  fixed: [ruby-core:08466]
+Mon Dec 14 11:25:57 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Fri Aug  4 13:56:51 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* benchmark/bm_app_aobench.rb: fix typos.
+	  [ci skip][fix GH-1140] Patch by @jutaz
+	* benchmark/bm_vm_thread_pipe.rb: ditto.
 
-	* pack.c (pack_pack): check argument overrun for 'P'.  based on a
-	  patch by rucila <rucila at yahoo.cojp>.  fixed: [ruby-dev:29182]
+Sun Dec 13 23:46:10 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Aug  1 17:44:03 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* parse.y (trace_lex_state): trace lex_state changes if yydebug is
+	  set, and send the messages to rb_stdout.
 
-	* win32/win32.c (init_stdhandle): assign standard file handles.
+	* parse.y (rb_parser_printf): store YYPRINTF messages per lines
+	  so that lex_state traces do not mix.
 
-Tue Aug  1 12:24:58 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* tool/ytab.sed: add parser argument to yy_stack_print too.
 
-	* eval.c (Init_Binding): fix old commit miss.
+Sun Dec 13 20:41:16 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Jul 31 17:08:20 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* parse.y (build_lex_state_name, trace_lex_state): lex_state is
+	  now bit flags and can be set 2 bits or more.
 
-	* win32/win32.c (exit_handler): new function; release winsock and
-	  environment work area.
+Sun Dec 13 20:26:30 2015  Yuki Yugui Sonoda  <yugui@yugui.jp>
 
-	* win32/win32.c (NTInitialize): setup exit_handler.
+	* test/ruby/test_syntax.rb: fix typo in test
 
-	* win32/win32.c (StartSockets): use exit_handler.
+Sun Dec 13 20:12:14 2015  Yuki Yugui Sonoda  <yugui@yugui.jp>
 
-	* win32/win32.c (rb_w32_getenv): use GetEnvironmentStrings() instead
-	  of GetEnvironmentVariable(), because the latter cannot distinguish
-	  wheather a null environment variable exists or not.
-	  fixed: [ruby-talk:205123]
+	* parse.y (parse_percent): Allow %-literals in labeled arg as
+	  r51624 did for parentheses.
+	  Fixes [ruby-core:72084] [Bug #11812].
 
-Mon Jul 31 16:15:13 2006  Tanaka Akira  <akr@fsij.org>
+Sun Dec 13 20:02:15 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* test/ruby/test_process.rb (TestProcess#test_rlimit_nofile):
-	  setrlimit may fail with EINVAL.
-	  reported by MIYAMUKO Katsuyuki.  [ruby-dev:29174]
+	* ChangeLog: fix a typo
 
-Mon Jul 31 13:38:22 2006  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Sun Dec 13 19:54:26 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* lib/webrick/httprequest.rb (WEBrick::HTTPReuqest#parse_uri): improve
-	  for the value of IPv6 address in the Host: header field.
+	* test/lib/envutil.rb: move envutil's assertions under Test::Unit::Assertion.
+	* test/lib/test/unit/assertions.rb: ditto.
 
-Mon Jul 31 09:22:12 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sun Dec 13 19:24:20 2015  Yuki Yugui Sonoda  <yugui@yugui.jp>
 
-	* ruby.h: use ifdef (or defined) for macro constants that may or
-	  may not be defined to shut up gcc's -Wundef warnings.
-	  [ruby-core:08447]
+	* parse.y (lex_state_name): Make it return the correct names.
+	  Add new names to follow r51617; Indices ffs(2) returns are 1-origin.
 
-Sun Jul 30 23:26:22 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sun Dec 13 18:40:45 2015  Yuki Yugui Sonoda  <yugui@yugui.jp>
 
-	* eval.c (rb_call0): trace call/return of method defined from block.
-	  fixed: [ruby-core:08329]
+	* parse.y: debug output of lex_state transition if PARSER_DEBUG
 
-	* eval.c (rb_trap_eval): make the current thread runnable to deal with
-	  exceptions which occurred within the trap.  fixed: [ruby-dev:27729]
+Sun Dec 13 18:49:25 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/cgi/session.rb, lib/cgi/session/pstore.rb: suppress warnings.
-	  fixed: [ruby-talk:204896]
+	* io.c (parse_mode_enc): preserve encoding of mode string in
+	  warnings.
 
-Sat Jul 29 06:12:06 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* io.c (io_encname_bom_p): check BOM prefix only, not including
+	  UTF prefix.
 
-	* ext/tk/lib/multi-tk.rb: freeze ip_name for security reason.
+	* io.c (parse_mode_enc): warn BOM with non-UTF encoding.
 
-Sat Jul 29 01:23:52 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* io.c (parse_mode_enc): fix buffer overflow.
 
-	* lib/logger.rb: improves the amount of documentation that Rdoc
-	  picks up when processing logger.rb by moving the require
-	  statement back before the comment block.  a patch from Hugh
-	  Sasse <hgs at dmu.ac.uk>.  [ruby-core:08422]
+Sun Dec 13 18:35:57 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Jul 27 22:21:52 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/fiddle/function.c (initialize): check all arguments first.
+	  reported by Marcin 'Icewall' Noga of Cisco Talos.
 
-	* time.c (time_to_s): fixed format mismatch.
+	* ext/fiddle/conversions.h (PTR2NUM): use signed integer to make
+	  Fixnum for negative values.
 
-Thu Jul 27 21:19:54 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sun Dec 13 18:33:41 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* math.c (domain_check): a new function to check domain error
-	  explicitly for systems that return NaN like FreeBSD.
-	  [ruby-core:07019]
+	* pack.c (pack_pack): always check index range against the
+	  receiver array length, which can be shortened by elements
+	  conversion.  reported by Marcin 'Icewall' Noga of Cisco Talos.
 
-	* math.c (math_acos, math_asin, math_acosh, math_atanh, math_log,
-	  math_log10, math_sqrt): use domain_check().
+Sun Dec 13 18:28:52 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* math.c (math_sqrt): fix documentation flaw.
+	* ext/psych/psych_emitter.c (start_document): should not exceed
+	  tags array range.
 
-Thu Jul 27 18:12:12 2006  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* ext/psych/psych_emitter.c (start_document): ensure string before
+	  encoding conversion.
 
-	* time.c: need to declare time_utc_offset.
+Sun Dec 13 18:26:31 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Jul 27 17:01:01 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/tk/tkutil/tkutil.c (tk_hash_kv): check types of array
+	  argument.  reported by Marcin 'Icewall' Noga of Cisco Talos.
 
-	* io.c (io_close): always calls "close" method of the receiver.
-	  [ruby-core:6911] [ruby-core:8112]
+	* ext/tk/tkutil/tkutil.c (cbsubst_table_setup): check length of
+	  argument arrays for each access, as callback methods can modify
+	  them.  reported by Marcin 'Icewall' Noga of Cisco Talos.
 
-Thu Jul 27 16:49:01 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/tk/tkutil/tkutil.c (cbsubst_table_setup): check types of
+	  argument elements.  reported by Marcin 'Icewall' Noga of Cisco
+	  Talos.
 
-	* time.c (time_to_s): use +0900 style timezone string for local time.
-	  [ruby-dev:29143]
+Sun Dec 13 18:19:20 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Jul 27 16:41:15 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/win32ole/win32ole.c (ole_vstr2wc): check argument type, vstr
+	  must be a String here.  reported by Marcin 'Icewall' Noga of
+	  Cisco Talos.
 
-	* ext/openssl/ossl.h: move <ruby.h> inclusion point to shut up
-	  Solaris compiler.  [ruby-core:08114]
+Sun Dec 13 16:41:01 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Jul 26 22:20:59 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* configure.in (BOOTSTRAPRUBY): make BASERUBY full path before
+	  building ruby to get rid of unexpectedly invoking built ruby.
+	  [ruby-core:72065] [Bug #11807]
 
-	* configure.in: add support for as and ASFLAGS.  [ruby-dev:29138]
+	* configure.in (BOOTSTRAPRUBY): use MINIRUBY but not BASERUBY
+	  unless cross compiling.  [ruby-core:72065] [Bug #11807]
 
-Wed Jul 26 22:13:45 2006  Minero Aoki  <aamine@loveruby.net>
+Sun Dec 13 14:17:19 2015  Akinori MUSHA  <knu@iDaemons.org>
 
-	* lib/net/http.rb: sync with HEAD (rev 1.132).
+	* test/test_shellwords.rb (TestShellwords): Add many more tests
+	  for handling whitespace characters and frozenness.
 
-	* lib/net/http.rb (Net::HTTP#post, request_post, request): should
-	  set Content-Type: x-www-form-urlencoded by default.
+Sun Dec 13 14:16:09 2015  Akinori MUSHA  <knu@iDaemons.org>
 
-	* lib/net/http.rb (Net::HTTPHeader#content_type): should return
-	  nil when there's no Content-Type.
+	* lib/shellwords.rb (Shellwords#shellsplit): Document that this
+	  method does not treat shell metacharacters as such.
 
-	* lib/net/http.rb (Net::HTTPHeader#sub_type): should return nil
-	  when there's no sub Content-Type (e.g. "Content-Type: text").
+Sun Dec 13 12:17:43 2015  Eric Wong  <e@80x24.org>
 
-	* lib/net/http.rb (Net::HTTPHeader#type_params): wrongly failed
-	  when there's no Content-Type.
+	* lib/shellwords.rb (shellescape): duplicate frozen literal
+	* test/test_shellwords.rb (test_stringification): new test
 
-Wed Jul 26 18:35:38 2006  Minero Aoki  <aamine@loveruby.net>
+Sun Dec 13 11:47:35 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* ext/strscan/strscan.c: sync with HEAD (rev 1.25).
+	* object.c (rb_inspect): check the default internal encoding as
+	  String#inspect do.
+	  [ruby-dev:49415] [Bug #11787]
 
-	* ext/strscan/strscan.c (strscan_do_scan):
-	  StringScanner.new("").scan(//) should return "". [ruby-Bugs:4361]
+Sun Dec 13 11:38:12 2015  Akinori MUSHA  <knu@iDaemons.org>
 
-Wed Jul 26 18:14:19 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/shellwords.rb: Turn on frozen-string-literal after fixing
+	  shellsplit.
 
-	* ext/pty/pty.c (getDevice): retry once after GC on failure.
-	  [ruby-core:08282]
+Sun Dec 13 10:44:44 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
 
-Wed Jul 26 17:28:16 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* KNOWNBUGS.rb: Fixed typo, made more explicit [ci skip]
 
-	* sprintf.c (rb_f_sprintf): prepend ".." to %u for negative bignum,
-	  but not "-".  fixed: [ruby-core:08167]
+Sun Dec 13 10:26:47 2015  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Wed Jul 26 16:39:07 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/openssl/ossl_ssl.c (ssl_npn_select_cb_common): fix parsing
+	  protocol list.
+	  The protocol list from OpenSSL is not null-terminated.
+	  patched by Kazuki Yamaguchi [Bug #11810] [ruby-core:72082]
 
-	* string.c (rb_str_scan): add string modification check.
-	  [ruby-core:7216]
+Sun Dec 13 06:40:30 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
 
-Wed Jul 26 16:06:03 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/ostruct.rb: Have OpenStruct#dig raise if argument is not a
+	  symbol
+	  nor a string. See [#11762]
 
-	* lib/cgi.rb (CGI::QueryExtension::read_multipart): check
-	  multipart boundary end.  a patch from Fujioka <fuj at rabbix.jp>
-	  [ruby-dev:28470]
+Sun Dec 13 00:05:42 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-Wed Jul 26 01:02:59 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* vm_insnhelper.c (vm_call_method_missing): method_missing should
+	  not be refined.
+	  [ruby-core:72080] [Bug #11809]
 
-	* configure.in: suppress warnings by automake 1.8 or later.
+Sat Dec 12 23:00:17 2015  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Tue Jul 25 00:30:06 2006  Eric Hodel  <drbrain@segment7.net>
+	* ext/nkf/nkf-utf8/nkf.c: Merge nkf 2.1.4.
 
-	* lib/prettyprint.rb: RD to RDoc conversion by Hugh Sasse.
+Sat Dec 12 18:52:26 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Jul 25 14:49:51 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* object.c (rb_obj_dig): raise TypeError if an element does not
+	  have #dig method.  [ruby-core:71798] [Bug #11762]
 
-	* lib/mkmf.rb (configuration): typo.
+Sat Dec 12 17:59:07 2015  Yuichiro Kaneko  <yui-knk@ruby-lang.org>
 
-Tue Jul 25 13:14:32 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/ruby/test_regexp.rb: Add test cases for `$KCODE` and `$=` warning
+	  [Misc #11770][ruby-dev:49398]
 
-	* process.c (rb_proc_times): rename hz to hertz to avoid name
-	  crash on AIX.  [ruby-dev:29126]
+Sat Dec 12 17:11:57 2015  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
 
-Mon Jul 24 22:03:40 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* doc/NEWS-0.2.2: add description about incompatible change in Hash
+	  duplicated key overriding policy. [Bug #10315] [Bug #11501]
 
-	* eval.c (backtrace): skip frames successive on node and method name.
+Sat Dec 12 07:44:38 2015  Eric Wong  <e@80x24.org>
 
-Mon Jul 24 17:55:55 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* io.c (do_io_advise): do not raise on ENOSYS
+	* test/ruby/test_io.rb (test_advise): do not skip on Errno::ENOSYS
+	  (test_advise_pipe): ditto
+	  [ruby-core:72066] [Feature #11806]
 
-	* process.c (rb_f_system): add security check.  [ruby-talk:202947]
+Sat Dec 12 07:05:29 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* process.c (rb_f_system): move signal right before fork to avoid
-	  signal handler intervention.
+	* enc/windows_1252.c: separate from ISO-8859-1 to fix 0x80..0x9e
+	  range.  [ruby-core:64049] [Bug #10097]
 
-Mon Jul 24 15:51:52 2006  Tanaka Akira  <akr@fsij.org>
+Fri Dec 11 23:33:40 2015  Yusuke Endoh  <mame@ruby-lang.org>
 
-	* ext/readline/readline.c (readline_readline): rl_deprep_term_function
-	  may be NULL with libedit.  reported by Ryan Davis.  [ruby-dev:29070]
+	* sample/trick2015/: added the award-winning entries of TRICK 2015.
+	  See https://github.com/tric/trick2015 for the contest outline.
 
-Mon Jul 24 15:19:55 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Dec 11 17:59:05 2015  Eric Wong  <e@80x24.org>
 
-	* eval.c (rb_call0): revert last change.  [ruby-dev:29112]
-	  [ruby-core:08374]
+	* insns.def (opt_case_dispatch): avoid converting Infinity
+	* test/ruby/test_optimization.rb (test_opt_case_dispatch_inf): new
+	  [ruby-dev:49423] [Bug #11804]'
 
-Sun Jul 23 22:59:49 2006  Tanaka Akira  <akr@fsij.org>
+Fri Dec 11 16:48:57 2015  Eric Wong  <e@80x24.org>
 
-	* test/socket/test_unix.rb: disabled on cygwin.
-	  reported by Kouhei Yanagita.  [ruby-dev:29080]
+	* hash.c (rb_num_hash_start): avoid pathological behavior
+	  [ruby-core:72028] [Feature #11405]
 
-Fri Jul 21 21:21:08 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Dec 11 11:58:46 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* eval.c (rb_call0): include funcalled methods in caller list.
-	  fixed: [ruby-core:08290]
+	* NEWS: Mentioned rubygems-2.5.1
 
-Fri Jul 21 12:11:00 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Dec 11 11:52:39 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* ext/extmk.rb, lib/mkmf.rb (with_destdir): remove drive letter before
-	  prepending destdir on DOSISH.
+	* lib/rubygems: Update to RubyGems 2.5.1
+	* test/rubygems: ditto.
 
-Thu Jul 20 15:07:14 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Dec 11 11:38:14 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ruby.h: export classes/modules to implement sandbox.
-	  [ruby-core:08283]
+	* compile.c (iseq_compile_each, ibf_load_object_hash): rehash
+	  case-dispatch hash to reduce collisions.
+	  http://d.hatena.ne.jp/ku-ma-me/20151210
 
-Thu Jul 20 00:06:29 2006  Keiju Ishitsuka  <keiju@ishitsuka.com>
+Fri Dec 11 03:44:43 2015  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/irb/completion.rb: support for completion of numeric
-    	  number. [ruby-dev: 29038]
+	* object.c (rb_inspect): dump inspected result with rb_str_escape()
+	  instead of raising Encoding::CompatibilityError. [Feature #11801]
 
-Wed Jul 19 23:53:05 2006  Kouhei Sutou  <kou@cozmixng.org>
+	* string.c (rb_str_escape): added to dump given string like
+	  rb_str_inspect without quotes and always dump in US-ASCII
+	  like rb_str_dump.
 
-	* lib/rss/parser.rb, lib/rss/utils.rb: added documents.
+Thu Dec 10 14:59:59 2015  Koichi Sasada  <ko1@atdot.net>
 
-Tue Jul 18 22:10:13 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/ruby/test_gc.rb (test_expand_heap): relax condition (1->2).
 
-	* process.c (rb_f_system): block SIGCHLD during the process
-	  execution, like glibc system(3) does.  [ruby-talk:202361]
+Thu Dec 10 14:15:59 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Tue Jul 18 23:12:14 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* cont.c: fix a double word typo.
+	  [Bug #11313][ruby-core:69749]
 
-	* win32/win32.c (open_ifs_socket): should not use plain malloc.
+Thu Dec 10 14:13:34 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* win32/win32.c (rb_w32_opendir): should not use plain realloc.
+	* ext/tk/lib/multi-tk.rb: fix typos.
+	  [Bug #11764][ruby-core:71800]
 
-Tue Jul 18 18:05:49 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Thu Dec 10 11:33:34 2015  Eric Wong  <e@80x24.org>
 
-	* test/ruby/test_float.rb (TestFloat::test_strtod): update test to
-	  conform strtod change.
+	* compile.c (iseq_compile_each): reduce needless rb_str_dup
+	  [ruby-core:72018] <5668DB6E.8000101@ruby-lang.org>
 
-Tue Jul 18 15:49:42 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Thu Dec 10 09:32:51 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* pack.c (pack_unpack): propagate association array to copied
-	  string.  [ruby-core:08223]
+	* lib/mkmf.rb, lib/shellwords.rb: disable frozen-string-literal.
+	  [ruby-core:72011] [Bug #11800]
 
-	* pack.c (pack_unpack): return referenced string itself if it has
-	  same length as specified.  a patch from <nobu at ruby-lang.org>
-	  in [ruby-core:08225].
+Thu Dec 10 06:33:39 2015  Eric Wong  <e@80x24.org>
 
-	* pack.c (pack_pack): taint 'p' packed strings.
+	* marshal.c (memsize_dump_arg): remove NULL check
+	  (memsize_load_arg): ditto
 
-Tue Jul 18 14:03:02 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Thu Dec 10 05:53:18 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/webrick/httpserver.rb (WEBrick::HTTPServer::unmount): remove
-	  inpect argument from sprintf.  [ruby-dev:29039]
+	* tool/mkconfig.rb: rbconfig must not be frozen-string-literal to
+	  expand CONFIG hash.  [ruby-core:72006] [Bug #11798]
 
-Tue Jul 18 10:53:37 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Dec 10 05:03:51 2015  Eric Wong  <e@80x24.org>
 
-	* object.c (rb_cstr_to_dbl): limit out-of-range message.
+	* ext/socket/ifaddr.c (ifaddr_mark): remove empty function
+	  (ifaddr_type): pass zero to rb_data_type_t.function.dmark
 
-	* util.c (ruby_strtod): return end pointer even if ERANGE occurred.
-	  fixed: [ruby-dev:29041]
+Thu Dec 10 04:49:16 2015  Eric Wong  <e@80x24.org>
 
-Mon Jul 18 00:43:05 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* proc.c (bm_free): remove, use default free
+	  (method_data_type): use RUBY_TYPED_DEFAULT_FREE
 
-	* util.c (ruby_strtod): stop at dot not followed by digits.
-	  fixed: [ruby-dev:29035]
+Thu Dec 10 02:01:41 2015  Koichi Sasada  <ko1@atdot.net>
 
-Tue Jul 18 00:01:27 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* compile.c (iseq_compile_each): do not add debug information
+	  without --debug or --debug=frozen-string-literal option
+	  because String#dup slows down with debug information.
+	  [Feature #11725]
 
-	* ext/extmk.rb: remove LIBRUBY_SO if static linked extensions exist.
+	* NEWS: apply about it.
 
-Mon Jul 17 23:30:46 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/ruby/test_rubyoptions.rb: catch up this fix with refactoring.
 
-	* configure.in (rb_cv_msvcrt): defaulted to msvcrt.  Workaround for a
-	  bug of cygwin 1.5.20.
+Thu Dec 10 00:06:56 2015  Koichi Sasada  <ko1@atdot.net>
 
-Mon Jul 17 13:43:05 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* iseq.c: rename methods
+	  RubyVM::InstructionSequence#to_binary_format -> #to_binary
+	  RubyVM::InstructionSequence.from_binary_format -> .load_from_binary
+	  RubyVM::InstructionSequence.from_binary_format_extra_data ->
+	                             .load_from_binary_extra_data
 
-	* pack.c (define_swapx): should not use plain malloc.
+	* iseq.c: fix document of iseq.to_binary.
+	  [Fix GH-1134]
 
-Mon Jul 17 12:58:41 2006  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* sample/iseq_loader.rb: catch up this change.
 
-	* configure.in: should use ac_cv_lib_dl_dlopen=no on MinGW.
+	* test/lib/iseq_loader_checker.rb: ditto.
 
-Sat Jul 15 23:50:12 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Dec  9 17:02:03 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (rb_require_safe): wait for another thread requiring the same
-	  feature.  fixed: [ruby-core:08229]
+	* regparse.h (SET_NTYPE): get rid of breaking strict aliasing.
+	  patch by Zarko Todorovski in [ruby-core:71953].  [Bug #11790]
 
-Sat Jul 15 01:27:13 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Dec  9 16:10:37 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* dir.c (has_magic): glob names contain alphabets to enable case fold
-	  search also for directories.  fixed: [ruby-talk:201917]
+	* vm.c (rb_vm_cref_in_context): Module#define_method in non-class
+	  expression should be public.
+	  [Bug #11754]
 
-Sat Jul 15 01:09:22 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/ruby/test_method.rb: add a test.
 
-	* st.c (malloc): use xmalloc/xcalloc instead of plain
-	  malloc/calloc, to detect memory allocation failure.  see
-	  <http://www.nongnu.org/failmalloc/>.
+Wed Dec  9 14:45:27 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* gc.c (rb_memerror): should not raise empty nomem_error.
+	* gc.c (gc_mark_stacked_objects): fix typo.
+	  reported by XIE Zhibang. [Bug #11763]
 
-Fri Jul 14 13:08:13 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Wed Dec  9 14:37:51 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* ext/tk/lib/tk.rb: add methods for new features of latest Tcl/Tk8.5.
+	* doc/syntax/refinements.rdoc: remove outdated description.
 
-	* ext/tk/lib/tk/namespace.rb: ditto.
+Wed Dec  9 09:58:09 2015  Koichi Sasada  <ko1@atdot.net>
 
-Fri Jul 14 02:30:12 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/**/*.c (*_memsize): same as r52986 for extensions.
 
-	* lib/monitor.rb: document patch from Hugh Sasse <hgs at dmu.ac.uk>.
-	  [ruby-core:08205]
+Wed Dec  9 09:46:19 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Fri Jul 14 01:09:46 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* .gitignore: ignored ISeq binary format.
 
-	* parse.y (then): error in warning action.
+Wed Dec  9 09:34:41 2015  Koichi Sasada  <ko1@atdot.net>
 
-Fri Jul 14 00:10:15 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* *.c (*_memsize): do not check ptr.
+	  NULL checking is finished Before call of memsize functions.
+	  See r52979.
 
-	* array.c (rb_ary_pop): may cause realloc oscillation.  a patch
-	  from MORITA Naoyuki <mlgetter at kidou.sakura.ne.jp>.
-	  [ruby-dev:29028]
+Wed Dec  9 09:25:29 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Thu Jul 13 22:23:56 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* test/net/smtp/test_response.rb: use Test::Unit. We should use Test::Unit
+	  without rubygems and rdoc.
 
-	* ext/tk/lib/tk/composite.rb: improve handling of the classname on the
-	  option database for the widget class which includes TkComposite.
+Wed Dec  9 06:26:23 2015  Colin Kelley <colindkelley@gmail.com>
 
-Thu Jul 13 20:32:19 2006  Kouhei Sutou  <kou@cozmixng.org>
+	* lib/uri/generic.rb: enable frozen_string_literal
+	  (split_userinfo): remove explicit .freeze for string literals
+	  (check_path): ditto
+	  (query): ditto
+	  (fragment): ditto
+	  (to_s): ditto
+	  [ruby-core:71910] [Bug #11759]
 
-	* lib/rss/parser.rb: updated documents by a patch from
-	  Hugh Sasse <hgs at dmu.ac.uk>. [ruby-core:8194]
+Wed Dec  9 06:25:47 2015  Eric Wong  <e@80x24.org>
 
-Wed Jul 12 13:54:09 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/uri/test_generic.rb (to_s): new test
+	  [ruby-core:71820]
 
-	* parse.y (then): we'd like to reserve colon here for the future.
-	  warning added.
+Wed Dec  9 02:18:52 2015  Koichi Sasada  <ko1@atdot.net>
 
-Tue Jul 11 20:58:18 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* compile.c (ibf_dump_memsize): should check NULL.
 
-	* ruby.h: export rb_cMethod.  [ruby-talk:201259]
+Wed Dec  9 01:46:35 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Tue Jul 11 19:13:33 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* string.c (rb_str_init): now accepts new option parameter `encoding'.
+	  [Feature #11785]
 
-	* ext/tk/lib/multi-tk.rb: remove restriction on the class of
-	  pseudo-toplevel.
+Wed Dec  9 00:52:37 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Jul 11 18:00:57 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* file.c (rb_stat_wr, rb_stat_ww): call get_stat only once and
+	  reduce checking struct.  patch by Yuki Kurihara in
+	  [ruby-core:71949].  [Misc #11789]
 
-	* ext/tk/lib/multi-tk.rb: security fix.
+Wed Dec  9 00:24:33 2015  Koichi Sasada  <ko1@atdot.net>
 
-Tue Jul 11 17:33:39 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* compile.c (iseq_ibf_dump): dump extra data just string length.
 
-	* string.c (rb_str_dump): need to extend len for \b.
+	* sample/iseq_loader.rb: add using
+	  RubyVM::InstructionSequence.from_binary_format_extra_data method
+	  (commented out).
 
-Mon Jul 10 22:00:00 2006  Shigeo Kobayashi  <shigek@ruby-lang.org>
+Mon Dec  9 00:21:19 2015  Yuki Nishijima  <mail@yukinishijima.net>
 
-	* ext/bigdecimal/bigdecimal.c: Allows '_' to appear within
-	  digits.  [ruby-dev:28872]
+	* gems/bundled_gems: Upgrade the did_you_mean gem to 1.0.0.rc1
 
-	* ext/bigdecimal/lib/bigdecimal/util.rb: Bug in to_r reported by
-	  [ruby-list:42533] fixed.
+Wed Dec  9 00:17:49 2015  Koichi Sasada  <ko1@atdot.net>
 
-Mon Jul 10 19:22:19 2006  Tanaka Akira  <akr@fsij.org>
+	* compile.c (ibf_load_setup): cast to int.
 
-	* gc.c (gc_sweep): expand heap earlier.
-	  reported by MORITA Naoyuki.  [ruby-dev:28960]
+Wed Dec  9 00:13:09 2015  Koichi Sasada  <ko1@atdot.net>
 
-Mon Jul 10 18:59:34 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* compile.c (ibf_setup_load): rename to ibf_load_setup().
 
-	* ext/tk/lib/tk/font.rb: sorry. mistaken to patch.
+	* compile.c (iseq_load_setup): check binary format.
 
-Mon Jul 10 18:46:52 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Tue Dec  8 23:30:07 2015  Naohisa Goto  <ngotogenome@gmail.com>
 
-	* ext/tk/tcltklib.c: make SEGV risk lower at exit.
+	* test/io/console/test_io_console.rb (run_pty): Avoid waiting twice
+	  for a process. Fix Errno::ECHILD in TestIO_Console#test_close and
+	  TestIO_Console#test_sync.
 
-	* ext/tk/lib/tk.rb: ditto.
+Tue Dec  8 23:05:47 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/tk/lib/multi-tk.rb: fail to call function-style methods on slave
-	  interpreters. The strategy (MultiTkIp_PseudoToplevel_Evaluable) to
-	  fix the problem is a little tricky. You may have to take care of
-	  conflicting with it.
+	* compile.c (iseq_ibf_dump): fix for clang type checker.
 
-	* ext/tk/lib/tk.rb: a little change for the pseudo-toplevel strategy.
+Tue Dec  8 23:04:02 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/tk/lib/tk/font.rb: ditto.
+	* iseq.c (iseq_s_load): fix mysterious bug.
 
-	* ext/tk/lib/tk/msgcat.rb: ditto.
+Tue Dec  8 22:31:58 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/tk/lib/tkextlib/itk/incr_tk.rb: ditto.
+	* introduce new ISeq binary format serializer/de-serializer
+	  and a pre-compilation/runtime loader sample.
+	  [Feature #11788]
 
-	* ext/tk/sample/demos-en/widget: fail to call function-style methods
-	  on sample scripts. To fix it, a strategy which similar to the way
-	  on MultiTiIp is used. Please take care when re-write and re-run a
-	  demo script on the Widget-Demo code viewer.
+	* iseq.c: add new methods:
+	  * RubyVM::InstructionSequence#to_binary_format(extra_data = nil)
+	  * RubyVM::InstructionSequence.from_binary_format(binary)
+	  * RubyVM::InstructionSequence.from_binary_format_extra_data(binary)
 
-	* ext/tk/sample/demos-jp/widget: ditto.
+	* compile.c: implement body of this new feature.
 
-Mon Jul 10 13:58:40 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* load.c (rb_load_internal0), iseq.c (rb_iseq_load_iseq):
+	  call RubyVM::InstructionSequence.load_iseq(fname) with
+	  loading script name if this method is defined.
 
-	* signal.c (ruby_nativethread_signal, posix_nativethread_signal,
-	  sigsend_to_ruby_thread, install_nativethread_sighandler):
-	  nativethread-support on signal handler. RE-backport from 1.9.
+	  We can return any ISeq object as a result value.
+	  Otherwise loading will be continue as usual.
 
-	* ruby.h (HAVE_NATIVETHREAD_KILL): ditto.
+	  This interface is not matured and is not extensible.
+	  So that we don't guarantee the future compatibility of this method.
+	  Basically, you shouldn't use this method.
 
-	* eval.c (ruby_native_thread_kill): ditto.
+	* iseq.h: move ISEQ_MAJOR/MINOR_VERSION (and some definitions)
+	  from iseq.c.
 
-Mon Jul 10 10:54:14 2006  Ryan Davis  <ryand@zenspider.com>
+	* encoding.c (rb_data_is_encoding), internal.h: added.
 
-	* lib/rdoc/parsers/parse_f95.rb: massive overhaul from Yasuhiro
-	  Morikawa including new file suffixes, function support, public
-	  variables and constants, derived-types, defined operators and
-	  assignments, namelists, and subroutine and function
-	  arguments. Truly massive.
+	* vm_core.h: add several supports for lazy load.
+	  * add USE_LAZY_LOAD macro to specify enable or disable of
+	    this feature.
+	  * add several fields to rb_iseq_t.
+	  * introduce new macro rb_iseq_check().
 
-	* lib/rdoc/diagram.rb: diagrams are now cached.
+	* insns.def: some check for lazy loading feature.
 
-	* lib/irb/completion.rb: fixed a crasher when completing against
-	  an unnamed class/module.
+	* vm_insnhelper.c: ditto.
 
-	* lib/rdoc/parsers/parse_c.rb: private comment (--/++) support in
-	  C-file rdoc.
+	* proc.c: ditto.
 
-	* lib/debug.rb: minor clarification in help.
+	* vm.c: ditto.
 
-	* lib/pp.rb: minor clarification on exception.
+	* test/lib/iseq_loader_checker.rb: enabled iff suitable
+	  environment variables are provided.
 
-Mon Jul 10 09:29:12 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/runner.rb: enable lib/iseq_loader_checker.rb.
 
-	* eval.c (rb_clear_cache_for_undef): clear entries for included
-	  module.  fixed: [ruby-core:08180]
+	* sample/iseq_loader.rb: add sample compiler and loader.
 
-Mon Jul 10 01:48:38 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	    $ ruby sample/iseq_loader.rb [dir]
 
-	* st.h (st_data_t): use pointer sized integer for st_data_t.
-	  [ruby-dev:28988]
+	  will compile all ruby scripts in [dir].
+	  With default setting, this compile creates *.rb.yarb files
+	  in same directory of target .rb scripts.
 
-Sun Jul  9 18:06:47 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	    $ ruby -r sample/iseq_loader.rb [app]
 
-	* lib/mkmf.rb (try_constant): fix for value 1 at cross compiling.
+	  will run with enable to load compiled binary data.
 
-	* lib/mkmf.rb (create_makefile): prevent substitution of macro
-	  definition.  fixed: http://www.yotabanana.com/lab/20060624.html#p02
+Tue Dec  8 21:21:16 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-Sun Jul  9 00:54:34 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* NEWS: mention about Enumerator::Lazy#grep_v.
+	  [ruby-core:71845] [Feature #11773]
 
-	* eval.c (next_jump): deal with destination of next.
-	  fixed: [ruby-core:08169]
+Tue Dec  8 17:36:36 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
 
-Fri Jul  7 00:38:49 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* string.c: removed unused variable
 
-	* hash.c (rb_hash_default): should not call default procedure if
-	  no key is given.  [ruby-list:42541]
+Tue Dec  8 16:23:40 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Jul  7 00:29:10 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* enumerator.c (lazy_grep_v): add Enumerator::Lazy#grep_v as well
+	  as Enumerable, to enumerate lazily.
+	  [ruby-core:71845] [Feature #11773]
 
-	* time.c (time_mload): a patch from Daniel Berger
-	  <Daniel.Berger at qwest.com>.  [ruby-core:08128]
+Tue Dec  8 14:27:07 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Jul  6 22:21:57 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* error.c (name_err_local_variables): new method
+	  NameError#local_variables for internal use only.
+	  [Feature #11777]
 
-	* process.c (rb_proc_times): use sysconf(_SC_CLK_TCK) value prior to
-	  HZ and CLK_TCK.  fixed: [ruby-talk:200293]
+Tue Dec  8 14:20:38 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Jul  6 22:17:21 2006  Minero Aoki  <aamine@loveruby.net>
+	* marshal.c (w_objivar): skip internal instance variables in
+	  T_OBJECT too.
 
-	* ext/racc/cparse/cparse.c: sync with original code, rev 1.8.
+Tue Dec  8 12:58:04 2015  Naohisa Goto  <ngotogenome@gmail.com>
 
-	* ext/racc/cparse/cparse.c: should mark CparseParams objects.
+	* test/io/console/test_io_console.rb (test_getpass): s.getpass
+	  should be tested. Narrow ensure block. This reverts r52911.
+	  [Bug #11780] [ruby-dev:49412]
 
-	* lib/racc/parser.rb: sync with original code, rev 1.8.
+Tue Dec  8 10:40:21 2015  Eric Wong  <e@80x24.org>
 
-	* lib/racc/parser.rb: update coding style.
+	* benchmark/bm_vm2_case_lit.rb: new benchmark
+	* compile.c (case_when_optimizable_literal): add nil/true/false
+	* insns.def (opt_case_dispatch): ditto
+	* vm.c (vm_redefinition_check_flag): ditto
+	* vm.c (vm_init_redefined_flag): ditto
+	* vm_core.h: ditto
+	* object.c (InitVM_Object): define === explicitly for nil/true/false
+	* test/ruby/test_case.rb (test_deoptimize_nil): new test
+	* test/ruby/test_optimization.rb (test_opt_case_dispatch): update
+	  (test_eqq): new test
+	  [ruby-core:71923] [Feature #11769]
+	  Original patch by Aaron Patterson <tenderlove@ruby-lang.org>
 
-Mon Jul  3 19:04:38 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Tue Dec  8 10:19:02 2015  Jake Worth  <jakeworth82@gmail.com>
 
-	* ext/tk/tcltklib.c (ip_make_menu_embeddable): help to make a menu
-	  widget embeddable (pack, grid, and so on) like as a general widget.
-	  However, an embeddable menu may require to be definied some event
-	  bindings for general use.
+	* lib/optparse.rb: fix double word typo in the document.
+	  [Misc #10608] [Fix GH-1126]
 
-	* ext/tk/lib/tk/event.rb: [bug fix] Tk.callback_break and
-	  Tk.callback_continue don't work on MultiTkIp.
+Tue Dec  8 09:03:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/lib/multi-tk.rb: ditto.
+	* ext/date/date_core.c (d_lite_lshift): should check the argument
+	  before negation.
 
-	* ext/tk/lib/tk.rb: lack of Tk.callback_return.
+Tue Dec  8 08:56:16 2015  Eric Wong  <e@80x24.org>
 
-	* ext/tk/lib/tk/menu.rb: improve creating clone menus.
+	* insns.def (opt_case_dispatch): check Float#=== redefinition
+	* test/ruby/test_optimization.rb (test_opt_case_dispatch): new
+	  [ruby-core:71920] [Bug #11784]
 
-Mon Jul  3 14:42:06 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Dec  8 03:56:05 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/etc/extconf.rb (PW_UID2VAL, PW_GID2VAL): defaulted to conversion
-	  from int, and sys/types.h needs to be included before grp.h.
-	  fixed: [ruby-dev:28938]
+	* test/lib/iseq_loader_checker.rb: add iseq dumper/loader checker.
+	  If you enable this checker (remove `#' in test/runner.rb),
+	  you can see comparison results between an original iseq disassembed
+	  result and dumped and loaded iseq disassembed result.
 
-Mon Jul  3 01:14:15 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	  There are several bugs around there, because of inexact stack depth
+	  calculation. Now, I leave these bugs because they are not critical
+	  and difficult to solve completely.
 
-	* string.c (rb_str_inspect): encode \b (\010) for escape.
-	  [ruby-dev:28927]
+	* test/runner.rb: require test/lib/iseq_loader_checker.rb but
+	  disabled at default (commented out).
 
-	* string.c (rb_str_dump): ditto.
+Tue Dec  8 03:45:47 2015  Eric Wong  <e@80x24.org>
 
-Sun Jul  2 19:17:56 2006  Minero Aoki  <aamine@loveruby.net>
+	* doc/extension.rdoc: warn about kwargs performance in C
+	  [Feature #11339] [ci skip]
 
-	* ext/racc/cparse/cparse.c: sync with original code (rev 1.7).
+Tue Dec  8 03:44:51 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/racc/cparse/cparse.c: use rb_catch instead of rb_iterate.
-	  Giving a block to a Ruby-level method by rb_iterate is obsolete on
-	  Ruby 1.9.  Note that current cparse.c still includes one
-	  rb_iterate call on Ruby 1.8, but it is not a problem (at least
-	  just now).
+	* iseq.c (iseq_load): disable peephole optimization option
+	  because apply it multiple times change the sequence.
+	  (iseq != peephole_optimize(load(iseq.to_a)))
 
-Sat Jul  1 15:15:49 2006  Tanaka Akira  <akr@m17n.org>
+Tue Dec  8 03:43:21 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* test/socket/test_nonblock.rb: add timeout to send/receive
-	  an empty UDP packet.
-	  [ruby-dev:28820]
+	* compile.c (rb_iseq_build_from_ary): do not allocate table
+	  if table_size is 0.
 
-Fri Jun 30 23:46:23 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Tue Dec  8 03:30:34 2015  Eric Wong  <e@80x24.org>
 
-	* configure.in: should test isinf for Solaris with GCC compiler.
-	  a patch from <ville.mattila at stonesoft.com>.  [ruby-core:07791]
+	* ext/socket/unixsocket.c (unix_send_io): document args
+	  (unix_recv_io): ditto
+	* test/socket/test_unix.rb (test_fd_passing_class_mode): added
 
-	* configure.in: -shared patch from Andrew Morrow
-	  <andrew.c.morrow at gmail.com>.  [ruby-core:08100]
+Tue Dec 08 02:21:35 2015  Koichi Sasada  <ko1@atdot.net>
 
-Thu Jun 29 18:58:51 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* iseq.c (iseq_translate): at the end of constructing an iseq,
+	  call RubyVM::InstructionSequence.translate(iseq) if this method
+	  is defined. If the return value is also an object of
+	  RubyVM::InstructionSequence, then use it instead of created one.
 
-	* ext/bigdecimal/bigdecimal.c (BigDecimal_version): fix patch
-	  failure.
+	  For example, this method is useful to test iseq dumper/loader
+	  such as RubyVM::InstructionSequence#to_a and rb_iseq_load().
 
-Thu Jun 29 18:00:51 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	  Because this method is for such internal experimental usage,
+	  the interface is not matured. For example, this interface has
+	  no extensibility. Two or more translators can not run
+	  simultaneously.
 
-	* ext/bigdecimal/bigdecimal.c: add RDoc document.  a patch from
-	  mathew <meta at pobox.com>.   [ruby-core:07050]
+	  So that we don't guarantee future compatibility of this method.
+	  Basically, do not use this method.
 
-Wed Jun 28 15:47:14 2006  Eric Hodel  <drbrain@segment7.net>
+Tue Dec  8 01:57:13 2015  Aaron Patterson <tenderlove@ruby-lang.org>
 
-	* lib/optparse.rb: RDoc patch from Robin Stocker <robin@nibor.org>
-	  [ruby-core:08087]
+	* ext/psych/*: update psych to 2.0.16
+	* test/psych/*: ditto
 
-Wed Jun 28 19:04:34 2006  Tanaka Akira  <akr@m17n.org>
+Mon Dec  7 23:45:20 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* test/socket/test_unix.rb: test_seqpacket_pair removed.
-	  [ruby-dev:28846]
+	* string.c: introduce String#+@ and String#-@ to control
+	  String mutability.
+	  [Feature #11782]
 
-Tue Jun 27 23:03:49 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Mon Dec  7 23:39:49 2015  Ben Miller  <bjmllr@gmail.com>
 
-	* string.c: RDoc update for =~ method.  a patch from Alex Young
-	  <alex at blackkettle.org>.  [ruby-core:08068]
+	* parse.y: add heredoc <<~ syntax.  [Feature #9098]
 
-Tue Jun 27 22:47:18 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Mon Dec  7 23:06:16 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-	* ext/tk/tcltklib.c: forgot to update TCLTKLIB_RELEASE_DATE.
+	* prelude.rb (IO#read_nonblock): [DOC] add missing options to
+	  call-seq.  [ruby-core:71627] [Bug #11730]
 
-	* ext/tk/lib/tk.rb (tk_tcl2ruby): [bug fix] sometimes fail to convert
-	  a tcl string to a ruby object if the tcl string includes "\n".
+Mon Dec  7 15:50:50 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
 
-Tue Jun 27 16:04:05 2006  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* .gitignore: added cygruby*.def for Cygwin
 
-	* win32/win32.h: define isascii on MinGW for msvcrt compatibility.
+Sun Dec  6 19:52:31 2015  Eric Wong  <e@80x24.org>
 
-	* configure.in: set ac_cv_header_sys_time_h=no on MinGW
-	  for msvcrt compatibility.
+	* include/ruby/intern.h (rb_autoload): deprecate
+	* internal.h (rb_autoload_str): declare
+	* load.c (rb_mod_autoload): use rb_autoload_str
+	* variable.c (rb_autoload): become compatibility wrapper
+	  (rb_autoload_str): hoisted out from old rb_autoload
+	  [ruby-core:71369] [Feature #11664]
 
-Tue Jun 27 11:36:02 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sun Dec  6 18:25:22 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/etc/etc.c (setup_passwd, setup_group): allow bignum uid, gid and
-	  so on.  [ruby-talk:199102]
+	* test/webrick/test_cgi.rb (TestWEBrickCGI#test_cgi): gave up the test
+	  of binary path info test on Windows because the test had passed
+	  occasionally as the comment said.
 
-Mon Jun 26 13:37:27 2006  Eric Hodel  <drbrain@segment7.net>
+Sun Dec  6 15:25:06 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/rdoc: Merge from HEAD.
-	  Add options to limit the ri search path.
+	* ext/io/console/console.c (console_getpass): add IO#getpass
+	  method.
 
-Tue Jun 27 00:54:08 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sun Dec  6 08:39:05 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* util.c (powersOf10): constified.
+	* ext/json/json.gemspec: bump version to json 1.8.3. CRuby already contained
+	  upstream changes.
 
-Mon Jun 26 18:37:44 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	  https://github.com/ruby/ruby/commit/4d059bf9f5f10f3d3088de49fc87e5555db7770d
+	  https://github.com/flori/json/commit/d4c99de78905d96c3f301f48b2c789943bb3f098
 
-	* ext/tk/tcltklib.c (ip_delete): fix SEGV when a slave-ip is
-	  deleted on callback.
+	* ext/json/lib/json/version.rb: ditto.
 
-Mon Jun 26 10:47:42 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sat Dec  5 17:48:25 2015  Lars Kanis  <lars@greiz-reinsdorf.de>
 
-	* io.c (pipe_open): avoid closing uninitialized file descriptors.
-	  a patch from <tommy at tmtm.org> [ruby-dev:28600]
+	* tool/fake.rb: Fix cross build when srcdir is an absolute path.
 
-Mon Jun 26 09:56:22 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* Makefile.in: PREP dependency is needed when cross build too, not
+	  "-r$(arch)-fake" to be  used before created.  [Fix GH-1125]
 
-	* win32/win32.[ch] (rb_w32_send, rb_w32_sendto): constified.
+Sat Dec  5 17:26:24 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Jun 25 23:02:12 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* hash.c (env_str_new, env_path_str_new): make default string
+	  UTF-8 for the case conversion is not possible.  [Bug #8822]
 
-	* Makefile.in, mkconfig.rb: catch-up for latest autoconf.
+	* hash.c (get_env_cstr): convert non-ASCII string to UTF-8 string.
 
-Sat Jun 24 06:35:00 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* hash.c (ruby_setenv): use wide char version to put environment
+	  variable to deal with non-ASCII value.
 
-	* signal.c: revert last change.
+Sat Dec  5 09:56:50 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ruby.h: ditto.
+	* ruby_atomic.h (ATOMIC_CAS): old value to be swapped should be
+	  same as the destination.  immediate value may need type
+	  promotion.
 
-	* eval.c: ditto.
+	* ruby_atomic.h (ATOMIC_SIZE_CAS): fix the argument order of
+	  InterlockedCompareExchange64.  new value and then old value is
+	  the last.
 
-Thu Jun 22 11:52:02 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sat Dec  5 09:23:34 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/net/http.rb (Net::HTTPResponse): duplicated error 501;
-	  HTTPInternalServerError should be error 500.  [ruby-core:08037]
+	* random.c (fill_random_seed): fix the size to be filled, not the
+	  size of element, but the whole size of array.
 
-Thu Jun 22 05:15:58 2006  Tanaka Akira  <akr@m17n.org>
+Sat Dec  5 06:03:54 2015  Eric Wong  <e@80x24.org>
 
-	* ext/socket/socket.c (sock_s_socketpair): try GC only once.
-	  [ruby-dev:28778]
+	* vm.c (ruby_vm_verbose_ptr): make static
+	  (ruby_vm_debug_ptr): ditto
 
-Wed Jun 21 21:28:32 2006  Tadayoshi Funaba  <tadf@dotrb.org>
+Sat Dec  5 00:56:29 2015  Naohisa Goto  <ngotogenome@gmail.com>
 
-	* lib/date.rb (jd_to_commercial): now works fine even if in
-	  mathn-ized context.
+	* include/ruby/ruby.h (RB_OBJ_TAINT): follow-up of r52881.
+	  Turn into void expression not to use unexpected result.
+	  Fix "operands have incompatible types" error with
+	  Oracle Solaris Studio 12.x on Solaris.
 
-Wed Jun 21 17:32:31 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Fri Dec  4 19:52:52 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
 
-	* signal.c (ruby_nativethread_signal, posix_nativethread_signal,
-	  sigsend_to_ruby_thread, install_nativethread_sighandler):
-	  nativethread-support on signal handler (backport from 1.9).
+	* enc/iso_8859_13.c: Added three missing lower/upper-case
+	  character pairs (from Kimihito Matsui)
 
-	* ruby.h (HAVE_NATIVETHREAD_KILL): ditto.
+Fri Dec  4 18:57:57 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
 
-	* eval.c (ruby_native_thread_kill): ditto.
+	* enc/iso_8859_4.c: Added missing lower/upper-case character
+	  pair (U+014A and U+014B, LATIN CAPITAL/SMALL LETTER ENG)
+	  (from Kimihito Matsui)
 
-Wed Jun 21 08:39:54 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Dec  4 16:48:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/xmlrpc/create.rb (XMLRPC::Create::conv2value): merge Date
-	  and Time processing.  [ruby-core:08033]
+	* string.c (rb_obj_as_string): fstring should not be infected.
+	  re-apply r52872 and fix a typo.
+	  TODO: other frozen strings also may not be.
 
-Wed Jun 21 01:40:25 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Dec  4 15:21:45 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* parse.y (yylex, reswords): modifier token is no longer returned in
-	  fname state.  [ruby-dev:28775]
+	* lib/rubygems: Update to RubyGems 2.5.0+ HEAD(fdab4c4).
+	  this version includes #1396, #1397, #1398, #1399
+	* test/rubygems: ditto.
 
-Wed Jun 21 01:12:46 2006  Kouhei Sutou  <kou@cozmixng.org>
+Fri Dec  4 11:22:40 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/rss/rss.rb: RSS::Element.def_corresponded_attr_writer
-	  supported date type.
+	* thread.c (rb_thread_setname): name must be ascii-compatible, as
+	  pthread APIs do not accept legacy wide char strings.
 
-Tue Jun 20 22:08:36 2006  Kouhei Sutou  <kou@cozmixng.org>
+Thu Dec  3 15:39:21 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* test/rss/test_parser.rb: split parser tests into ...
-	* test/rss/test_parser_1.0.rb: ... RSS 1.0 parsing tests and ...
-	* test/rss/test_parser_2.0.rb: ... RSS 2.0 parsing tests.
+	* lib/scanf.rb: fixed double words typo.
+	  [ci skip][fix GH-1123] Patch by @jwworth
 
-Tue Jun 20 21:19:06 2006  Kouhei Sutou  <kou@cozmixng.org>
+Thu Dec  3 15:37:56 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* lib/rss/rss.rb: provided default RSS::Element#children.
+	* test/ruby/test_mixed_unicode_escapes.rb: fixed typo.
+	  [fix GH-1122] Patch by @davydovanton
+	* test/ruby/test_object.rb: ditto.
+	* test/socket/test_tcp.rb: ditto.
 
-	* lib/rss/0.9.rb: used default RSS::Element#children.
-	* lib/rss/1.0.rb: ditto.
-	* lib/rss/2.0.rb: ditto.
-	* lib/rss/taxonomy.rb: ditto.
+Thu Dec  3 15:33:08 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Jun 20 21:04:33 2006  Kouhei Sutou  <kou@cozmixng.org>
+	* sprintf.c (rb_str_format): fix wrong shifting position in
+	  Rational conversion when not at the beginning of the result.
+	  [ruby-core:71806] [Bug #11766]
 
-	* lib/rss/rss.rb: provided default RSS::Element#_tags.
+Thu Dec  3 14:22:16 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/rss/0.9.rb: used default RSS::Element#_tags.
-	* lib/rss/1.0.rb: ditto.
-	* lib/rss/2.0.rb: ditto.
-	* lib/rss/image.rb: ditto.
-	* lib/rss/taxonomy.rb: ditto.
+	* range.c (range_to_s): should be infected by the receiver.
+	  str2 infects by appending.  [ruby-core:71811] [Bug #11767]
 
-Tue Jun 20 20:47:07 2006  Kouhei Sutou  <kou@cozmixng.org>
+Thu Dec  3 11:57:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/rss/rss.rb: hide RSS::Element.install_model.
-	  (RSS::Element.install_have_child_element,
-	   RSS::Element.install_have_children_element,
-	   RSS::Element.install_text_element,
-	   RSS::Element.install_date_element): call
-	  RSS::Element.install_model internally.
+	* configure.in: separate SET_CURRENT_THREAD_NAME, which can set
+	  the name of current thread only, and SET_ANOTHER_THREAD_NAME,
+	  which can set the name of other threads.
 
-	* lib/rss/0.9.rb: followed new API.
-	* lib/rss/1.0.rb: ditto.
-	* lib/rss/2.0.rb: ditto.
-	* lib/rss/content.rb: ditto.
-	* lib/rss/dublincore.rb: ditto.
-	* lib/rss/image.rb: ditto.
-	* lib/rss/syndication.rb: ditto.
-	* lib/rss/taxonomy.rb: ditto.
-	* lib/rss/trackback.rb: ditto.
+	* thread.c (rb_thread_setname): use SET_ANOTHER_THREAD_NAME.  OS X
+	  is not possible to set another thread name.
 
-Tue Jun 20 20:18:05 2006  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* thread_pthread.c (native_set_thread_name, thread_timer): use
+	  SET_CURRENT_THREAD_NAME.
 
-	* ext/openssl/extconf.rb: add check for OBJ_NAME_do_all_sorted.
+Wed Dec 02 22:57:46 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/openssl/ossl_cipher.c (ossl_s_ciphers): new method
-	  OpenSSL::Cipher.ciphers. it returns all the cipher names.
+	* vm_core.h, iseq.h: remove rb_iseq_t::variable_body.
+	  Fields in rb_iseq_t::variable_body are contained by
+	  rb_iseq_t::body::mark_ary (hidden Array object).
 
-	* ext/openssl/lib/openssl/cipher.rb:
-	  - add constants AES128, AES192, AES256. [ruby-dev:28610]
-	  - reimplement without eval()
+	  Index 0 to 2 of mark_ary are reserved by these objects.
 
-	* ext/openssl/lib/openssl/digest.rb: reimplement without eval().
+	* iseq.c: catch up this fix.
 
-	* test/openssl/test_cipher.rb, test_digest: fix about reimplemented
-	  features.
+	* compile.c (rb_iseq_original_iseq): trivial rewrite.
 
-	* sample/openssl/cipher.rb: rewrite all.
+Wed Dec  2 17:19:02 2015  Koichi Sasada  <ko1@atdot.net>
 
-Sat Jun 19 11:21:46 2006  Eric Hodel  <drbrain@segment7.net>
+	* iseq.h: introduce ISEQ_ORIGINAL_ISEQ() and
+	  ISEQ_ORIGINAL_ISEQ_ALLOC() macro.
 
-	* lib/test/unit/assertions.rb: Merge RDoc from HEAD.
+	* compile.c: use them to access original iseq buffer.
 
-Tue Jun 20 01:06:57 2006  Kouhei Sutou  <kou@cozmixng.org>
+	* iseq.c: ditto.
 
-	* lib/rss/rss.rb:
-	  - cleanup validation mechanism. Now, #XXX_validation is
-	    needless.
-	  - changed internal variable name RSS::Element::MODEL to
-	    RSS::Element::MODELS.
-	  - RSS::Element.install_model requires uri.
+	* vm_core.h: rename iseq field to support this fix.
 
-	* lib/rss/0.9.rb: followed new validation API.
-	* lib/rss/1.0.rb: ditto.
-	* lib/rss/2.0.rb: ditto.
-	* lib/rss/content.rb: ditto.
-	* lib/rss/dublincore.rb: ditto.
-	* lib/rss/image.rb: ditto.
-	* lib/rss/syndication.rb: ditto.
-	* lib/rss/taxonomy.rb: ditto.
-	* lib/rss/trackback.rb: ditto.
+Wed Dec  2 17:10:32 2015  Koichi Sasada  <ko1@atdot.net>
 
-Mon Jun 19 23:40:59 2006  NARUSE, Yui  <naruse@ruby-lang.org>
+	* iseq.h: introduce ISEQ_FLIP_CNT_INCREMENT() macro.
 
-	* ext/nkf/lib/kconv.rb: remove default -m0 and fix document.
+	* compile.c (iseq_compile_each): use it.
 
-	* ext/nkf/nkf-8/{nkf.c, config.h, utf8tbl.c, utf8tbl.h}:
-	  imported nkf 2.0.7.
+	* vm_core.h: rename flip_cnt field to support this fix.
 
-Mon Jun 19 22:31:59 2006  Kouhei Sutou  <kou@cozmixng.org>
+Wed Dec  2 17:05:15 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/rss/rss.rb:
-	  - provided default #to_s as RSS::Element#to_s.
-	  - removed RSS::Element#other_element.
-	  - RSS::Element#tag requires attributes as Hash instead of Array.
+	* iseq.h: introduce ISEQ_COVERAGE() and ISEQ_COVERAGE_SET() macro.
 
-	* lib/rss/0.9.rb: removed #to_s to use RSS::Element#to_s.
-	* lib/rss/1.0.rb: ditto.
-	* lib/rss/image.rb: ditto.
-	* lib/rss/taxonomy.rb: ditto.
-	* lib/rss/trackback.rb: ditto.
+	* compile.c: use them.
 
-	* lib/rss/2.0.rb: removed #other_element.
+	* iseq.c: ditto.
 
-Mon Jun 19 22:09:16 2006  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
+	* iseq.c (rb_iseq_coverage): added.
 
-	* ext/win32ole/win32ole.c(ole_invoke): support some kind of
-	  method of word. [ruby-Bugs#3237]
+	* thread.c (update_coverage): use rb_iseq_coverage().
 
-	* ext/win32ole/tests/test_word.rb: ditto.
+	* vm_core.h: rename coverage field name to support this fix.
 
-	* ext/win32ole/tests/testall.rb: ditto.
+Wed Dec  2 17:00:54 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Jun 19 00:02:17 2006  Kouhei Sutou  <kou@cozmixng.org>
+	* encoding.c (enc_name, rb_enc_name_list_i, rb_enc_aliases_enc_i):
+	  make fstring instead of making each copies.
 
-	* lib/rss/rss.rb: automatically detected attributes.
+Wed Dec  2 16:32:08 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/rss/0.9.rb: removed #_attrs.
-	* lib/rss/1.0.rb: ditto.
-	* lib/rss/2.0.rb: ditto.
-	* lib/rss/image.rb: ditto.
-	* lib/rss/taxonomy.rb: ditto.
-	* lib/rss/trackback.rb: ditto.
+	* iseq.h: introduce ISEQ_COMPILE_DATA() macro.
 
-	* lib/rss/parser.rb: followed new internal API.
+	* compile.c, iseq.c: use ISEQ_COMPILE_DATA().
 
-Mon Jun 19 00:00:17 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* vm_core.h: rename compile_data field to support this fix.
 
-	* ext/tk/lib/multi-tk.rb: fix bug: initialize improper tables.
+Wed Dec  2 16:27:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Jun 18 22:36:13 2006  Kouhei Sutou  <kou@cozmixng.org>
+	* encoding.c (enc_m_loader): defer finding encoding object not to
+	  be infected by marshal source.  [ruby-core:71793] [Bug #11760]
 
-	* lib/rss/rss.rb: RSS::Element#initialize accepts initial
-	  attributes.
-	* lib/rss/0.9.rb: ditto.
-	* lib/rss/1.0.rb: ditto.
-	* lib/rss/2.0.rb: ditto.
-	* lib/rss/dublincore.rb: ditto.
-	* lib/rss/image.rb: ditto.
-	* lib/rss/taxonomy.rb: ditto.
-	* lib/rss/trackback.rb: ditto.
+	* marshal.c (r_object0): enable compatible loader on USERDEF
+	  class.  the loader function is called with the class itself,
+	  instead of an allocated object, and the loaded data.
 
-	* lib/rss/utils.rb: added Utils.element_initialize_arguments? to
-	  detect backward compatibility initial arguments.
+	* marshal.c (compat_allocator_table): initialize
+	  compat_allocator_tbl on demand.
 
-	* lib/rss/parser.rb: user initial attributes to initialize
-	  RSS::Element.
+	* object.c (rb_undefined_alloc): extract from rb_obj_alloc.
 
-Sun Jun 18 18:24:42 2006  Kouhei Sutou  <kou@cozmixng.org>
+Wed Dec  2 15:12:43 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* lib/rss/converter.rb: use NKF for Uconv fallback.
+	* configure.in: Fixed double negative comments.
+	  [Bug #11698][ruby-core:71506]
 
-Sun Jun 18 18:22:04 2006  Kouhei Sutou  <kou@cozmixng.org>
+Wed Dec  2 14:55:01 2015  yui-knk  <spiketeika@gmail.com>
 
-	* test/rss/test_image.rb: shared name space configuration.
+	* test/ruby/test_string.rb: removed non executing tests.
+	  [Misc #11757][ruby-dev:49397]
 
-Sun Jun 18 18:13:25 2006  Kouhei Sutou  <kou@cozmixng.org>
+Wed Dec  2 11:23:06 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* lib/rss/rss.rb: improved ignore_unknown_element
-	  handling. RSS::NotExpectedTagError provides tag URI.
-	* lib/rss/parser.rb: ditto.
-	* lib/rss/0.9.rb: ditto.
-	* lib/rss/1.0.rb: ditto.
-	* lib/rss/content.rb: ditto.
-	* lib/rss/dublincore.rb: ditto.
-	* lib/rss/image.rb: ditto.
-	* lib/rss/syndication.rb: ditto.
-	* lib/rss/taxonomy.rb: ditto.
-	* lib/rss/trackback.rb: ditto.
+	* lib/csv.rb: enable frozen_string_literal.
+	  [fix GH-1116] Patch by @marshall-lee
 
-	* test/rss/rss-assertions.rb: checked URI of not expected tag too.
-	* test/rss/test_parser.rb: ditto.
+Wed Dec  2 10:36:25 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Sun Jun 18 18:08:36 2006  Kouhei Sutou  <kou@cozmixng.org>
+	* ext/bigdecimal/bigdecimal.c: Fix double word typo.
+	  [ci skip][fix GH-1120] Patch by @jwworth
 
-	* lib/rss/rss.rb: changed empty namespace URI representation to ""
-	  from nil.
-	* lib/rss/parser.rb: ditto.
-	* lib/rss/0.9.rb: ditto.
-	* lib/rss/1.0.rb: ditto.
-	* lib/rss/2.0.rb: ditto.
+Wed Dec  2 07:43:51 2015  Eric Wong  <e@80x24.org>
 
-Sun Jun 18 18:03:50 2006  Kouhei Sutou  <kou@cozmixng.org>
+	* ext/openssl/ossl_ssl.c (mSSLExtConfig): make static
+	  (eSSLError): ditto
+	  (ID_callback_state): ditto
+	  (ossl_ssl_ex_vcb_idx): ditto
+	  (ossl_ssl_ex_store_p): ditto
+	  (ossl_ssl_ex_ptr_idx): ditto
+	* ext/openssl/ossl_ssl.h: remove extern declarations for
+	  mSSLExtConfig and eSSLError
 
-	* lib/rss/parser.rb: removed a guard for requiring open-uri.
+Wed Dec  2 07:41:08 2015  Eric Wong  <e@80x24.org>
 
-Sun Jun 18 18:01:26 2006  Kouhei Sutou  <kou@cozmixng.org>
+	* missing/explicit_bzero.c (explicit_bzero): fixup r52839
+	  for compilers with "weak" attribute
 
-	* lib/rss/rss.rb: fixed typo: except -> expect
-	* lib/rss/parser.rb: ditto.
-	* test/rss/rss-assertions.rb: ditto.
-	* test/rss/test_parser.rb: ditto.
+Wed Dec  2 06:47:25 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Sun Jun 18 17:52:39 2006  Kouhei Sutou  <kou@cozmixng.org>
+	* missing/explicit_bzero.c: add ruby_explicit_bzero_hook_unused
+	  for preventing optimization. Inspired from OpenBSD.
 
-	* lib/rss/rss.rb: RSS::Element#calc_indent became to be deprecated.
-	* lib/rss/0.9.rb: ditto.
-	* lib/rss/1.0.rb: ditto.
-	* lib/rss/image.rb: ditto.
-	* lib/rss/taxonomy.rb: ditto.
-	* lib/rss/trackback.rb: ditto.
+Tue Dec  1 23:36:39 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/rss/test_1.0.rb: removed RSS::Element.indent_size tests.
-	* test/rss/test_2.0.rb: ditto.
+	* thread.c (rb_thread_setname): allow to reset thread name.
 
-Sun Jun 18 00:49:11 2006  Tanaka Akira  <akr@m17n.org>
+Tue Dec  1 23:14:04 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/socket/socket.c (bsock_recv_nonblock): new method
-	  BasicSocket#recv_nonblock.
-	  (udp_recvfrom_nonblock): renamed from ip_recvfrom_nonblock.
-	  IPSocket#recvfrom_nonblock is moved to UDPSocket#recvfrom_nonblock.
-	  (unix_recvfrom_nonblock): removed.
-	  UNIXSocket#recvfrom_nonblock is removed.
+	* thread.c (rb_thread_setname): check the argument if valid
+	  string.  [ruby-core:71774] [Bug #11756]
 
-Sat Jun 17 22:17:17 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Tue Dec  1 17:13:41 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/mathn.rb (Integer::prime_division): raise ZeroDivisionError
-	  on zeros.  [ruby-dev:28739]
-
-Sat Jun 17 14:53:32 2006  Tanaka Akira  <akr@m17n.org>
-
-	* lib/pathname.rb: backport from 1.9.
-	  (Kernel#Pathname): new method.
-
-Sat Jun 17 10:30:41 2006  Kouhei Sutou  <kou@cozmixng.org>
-
-	* lib/rss/rss.rb (Hash#merge, Enumerable#sort_by): removed.
-
-	* lib/rss/rss.rb (RSS::RootElementMixin#to_xml): added.
-	  [ruby-talk:197284]
-
-	  We can convert RSS version easily like the following:
-	    rss10 = RSS::Parser.parse(File.read("1.0.rdf"))
-	    File.open("2.0.rss", "w") {|f| f.print(rss10.to_xml("2.0"))}
-
-	* test/rss/test_1.0.rb: added #to_xml test.
-	* test/rss/test_2.0.rb: ditto.
-
-	* test/rss/rss-testcase.rb: added some helper methods that
-	  generates sample RSS 2.0.
-
-	* sample/rss/convert.rb: added a sample script to convert RSS format.
-
-Sat Jun 17 10:23:22 2006  Kouhei Sutou  <kou@cozmixng.org>
-
-	* lib/rss/rss.rb (Kernel#funcall): removed.
-	* lib/rss/parser.rb (Kernel.URI): removed.
-
-	* lib/rss/maker/: supported
-	    xxx.new_yyy do |yyy|
-	      yyy.zzz = zzz
-	      ...
-	    end
-	  style and this style became the style of the recommendation.
-
-	  Old style
-	    yyy = xxx.new_yyy
-	    yyy.zzz = zzz
-	    ...
-	  is supported too but this style isn't recommended.
-	  [ruby-talk:197284]
-
-	* test/rss/test_*maker*.rb: used new recommended style.
-
-Sat Jun 17 09:03:47 2006  Kouhei Sutou  <kou@cozmixng.org>
-
-	* lib/rss, test/rss: backported from trunk. (2005-11-16 - now)
-
-	* lib/rss/rss.rb (RSS::VERSION): 0.1.5 -> 0.1.6.
-	* test/rss/test_version.rb (RSS::TestVersion#test_version): ditto.
-
-	* lib/rss/trackback.rb: added TrackBack prefix.
-	* lib/rss/maker/trackback.rb: ditto.
-
-	* lib/rss/rss.rb : removed needless argument 'prefix'.
-	* lib/rss/parser.rb: ditto.
-
-	* lib/rss/1.0.rb: added rdf:Bag.
-
-	* lib/rss/taxonomy.rb: implemented taxonomy module.
-	* test/rss/test_taxonomy.rb: added tests for taxonomy support.
-
-	* lib/rss/1.0.rb: added convenience method 'resources'.
-	* lib/rss/taxonomy.rb: ditto.
-	* test/rss/rss-assertions.rb: added test for 'resources'.
-	* test/rss/test_taxonomy.rb: ditto.
-
-	* lib/rss/rss.rb: fixed a indentation bug.
-	* lib/rss/taxonomy.rb: fixed <taxo:topic> #to_s bug.
-	* test/rss/test_taxonomy.rb: added a #to_s test.
-
-	* lib/rss/maker/taxonomy.rb: implemented taxonomy module for RSS
-	  Maker.
-	* lib/rss/taxonomy.rb: supported RSS Maker.
-	* lib/rss/maker.rb: added taxonomy module support.
-
-	* lib/rss/rss.rb: adjusted to other element API.
-	* lib/rss/1.0.rb: adjusted to other element API but backward
-	  compatibility is reserved.
-	* lib/rss/0.9.rb: ditto.
-
-	* test/rss/test_maker_taxo.rb: added test case for taxonomy module
-	  for RSS Maker.
-	* test/rss/test_setup_maker_1.0.rb: added tests for taxo:topic.
-
-	* test/rss/test_setup_maker_1.0.rb: added backward compatibility
-	  test.
-	* test/rss/test_setup_maker_0.9.rb: ditto.
-	* test/rss/test_setup_maker_2.0.rb: ditto.
-
-	* test/rss/rss-testcase.rb: added convenience method for setting
-	  up taxo:topic.
-	* test/rss/rss-assertions.rb: added assertion for taxo:topic.
-
-	* sample/rss/blend.rb: followed new API.
-
-	* lib/rss/taxonomy.rb: changed class or module prefix to
-	  Taxonomy from Taxo.
-	* lib/rss/maker/taxonomy.rb: ditto.
-
-	* test/rss/test_taxonomy.rb: use #reject directory.
-
-	* lib/rss/: use #__send__ instead of #send.
-	* test/rss/: ditto.
-
-	* lib/rss/parser.rb: added entity handling type predicate.
-	* lib/rss/rexmlparser.rb: ditto.
-	* lib/rss/xmlparser.rb: ditto.
-	* lib/rss/xmlscanner.rb: ditto.
-
-	* lib/rss/xmlscanner.rb: more robust entity handling.
-
-	* test/rss/test_parser.rb: added an entity handling test.
-
-	* test/rss/test_2.0.rb: added RSS 2.0 tests.
-	* test/rss/rss-assertions.rb: extended XML stylesheet assertion.
-	* lib/rss/0.9.rb: added initialize method.
-	* test/rss/test_1.0.rb: cleanup.
-
-	* lib/rss/image.rb: added Image prefix.
-	* lib/rss/maker/image.rb: ditto.
-
-	* lib/rss/rss.rb: improved type conversion.
-	* lib/rss/1.0.rb: ditto.
-	* lib/rss/0.9.rb: ditto.
-	* lib/rss/2.0.rb: ditto.
-	* lib/rss/image.rb: ditto.
-	* lib/rss/syndication.rb: ditto.
-
-	* test/rss/test_2.0.rb: added type conversion tests.
-	* test/rss/test_accessor.rb: ditto.
-	* test/rss/test_to_s.rb: ditto.
-	* test/rss/test_syndication.rb: ditto.
-	* test/rss/test_setup_maker_2.0.rb: ditto.
-	* test/rss/test_setup_maker_1.0.rb: ditto.
-	* test/rss/test_setup_maker_0.9.rb: ditto.
-	* test/rss/test_maker_sy.rb: ditto.
-	* test/rss/test_maker_image.rb: ditto.
-	* test/rss/test_maker_2.0.rb: ditto.
-	* test/rss/test_maker_0.9.rb: ditto.
-	* test/rss/test_image.rb: ditto.
-
-	* test/rss/test_maker_1.0.rb: use assert instead of assert_equal.
-
-	* test/rss/rss-assertions.rb: improved type conversion assertions.
-
-	* lib/rss/rss.rb: added backward compatibility codes.
-	* lib/rss/parser.rb: ditto.
-	* test/rss/test_parser.rb: ditto.
-	* test/rss/test_2.0.rb: ditto.
-
-Sat Jun 17 02:01:00 2006  Tanaka Akira  <akr@m17n.org>
-
-	* lib/pp.rb (Kernel#pretty_inspect): defined for pretty printed
+	* string.c (rb_string_value_cstr): should not raise on frozen
 	  string.
 
-Sat Jun 17 00:23:58 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (reswords): kDO_BLOCK was missing.  fixed: [ruby-core:7995]
-
-Sat Jun 17 00:02:15 2006  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
-
-	* ext/win32ole/win32ole.c (ole_propertyput): support
-	  PROPERTYPUTREF. [ruby-talk:183042]
-
-	* ext/win32ole/tests/test_propertyputref.rb: ditto.
-
-Thu Jun 15 23:02:47 2006  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
-
-	* ext/win32ole/win32ole.c (fole_methods): The return value
-	  of WIN32OLE#ole_methods should include PROPERTYPUTREF methods.
-
-	* ext/win32ole/win32ole.c (fole_put_methods): The return value
-	  of WIN32OLE#ole_put_methods should include PROPERTYPUTREF methods.
-
-	* ext/win32ole/tests/test_ole_methods.rb: ditto.
-
-	* ext/win32ole/tests/testall.rb : ditto.
-
-Wed Jun 14 18:23:28 2006  Eric Hodel  <drbrain@segment7.net>
-
-	* enum.c (enum_any): Documentation typo.
-
-Wed Jun 14 15:01:09 2006  Eric Hodel  <drbrain@segment7.net>
-
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser#warn): Don't print
-	  warnings when -q is set.
-
-Wed Jun 14 23:03:53 2006  Tanaka Akira  <akr@m17n.org>
-
-	* configure.in: check sizeof(rlim_t).
-	  check setrlimit.
-
-	* process.c (proc_getrlimit): new method Process.getrlimit.
-	  (proc_setrlimit): new method Process.setrlimit.
-
-	* ruby.h (NUM2ULL): new macro.
-
-Mon Jun 12 22:25:09 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* sprintf.c (rb_f_sprintf): adjust precision length to prevent
-	  splitting multi-byte characters.  [ruby-list:42389]
-
-Sun Jun 11 23:20:07 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/optparse.rb (OptionParser::Arguable#getopts): pass self to the
-	  parser.
-
-Sun Jun 11 10:00:57 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/win32.h (write): not need to define on bcc.
-
-Sun Jun 11 08:30:33 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/optparse.rb (OptionParser#getopts): new methods.
-
-Sat Jun 10 18:02:40 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/bigdecimal/lib/bigdecimal/newton.rb (Newton::nlsolve): typo
-	  fixed: raize -> raise.  [ruby-talk:196608]
-
-Thu Jun  8 14:19:17 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/win32.[ch] (rb_w32_read, rb_w32_write): new functions.
-	  use recv() and send() when fd is socket. fixed: [ruby-dev:28694]
-
-Wed Jun  7 16:22:51 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/tempfile.rb (Tempfile::make_tmpname): put dot between
-	  basename and pid.  [ruby-talk:196272]
-
-Wed Jun  7 14:53:04 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/win32.c (errmap): add some winsock errors.
-
-Wed Jun  7 11:34:38 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* configure.in: add new configure option `--with-winsock2' for mingw.
-
-	* win32/Makefile.sub (config.h): define USE_WINSOCK2 in config.h
-	  instead of in CPPFLAGS.
-
-	* ext/socket/extconf.rb: determine whether to use winsock2 or not
-	  by using with_config.
-
-Wed Jun  7 10:45:10 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/{configure.bat, setup.mak, Makefile.sub, win32.h}: add
-	  new configure option `--with-winsock2'.
-
-	* win32/win32.c (StartSockets): ditto.
-
-	* ext/socket/extconf.rb: ditto.
-
-	* win32/win32.c (open_ifs_socket): new function.
-
-	* win32/win32.c (StartSockets, rb_w32_socket): use open_ifs_socket()
-	  instead of socket().
-	  ifs socket support is backported from trunk.
-
-Wed Jun  7 09:14:44 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_call0): binding for the return event hook should have
-	  consistent scope.  [ruby-core:07928]
-
-	* eval.c (EXEC_EVENT_HOOK): trace_func may remove itself from
-	  event_hooks.	no guarantee for arbitrary hook deletion.
-	  [ruby-dev:28632]
-
-Mon Jun  5 18:12:12 2006  Tanaka Akira  <akr@m17n.org>
-
-	* ext/socket/socket.c (sock_s_unpack_sockaddr_in): reject
-	  non-AF_INET/AF_INET6 sockaddr.
-	  (sock_s_unpack_sockaddr_un): reject non-AF_UNIX sockaddr.
-	  [ruby-dev:28691]
-
-Sun Jun  4 20:40:19 2006  Tanaka Akira  <akr@m17n.org>
-
-	* ext/socket/socket.c: fix sockaddr_un handling.
-	  [ruby-dev:28677]
-
-Fri Jun  2 22:08:17 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/forwardable.rb: RDoc typo fix from Jan Svitok
-	  <jan.svitok at gmail.com>.  [ruby-core:07943]
-
-Fri Jun  2 19:02:09 2006  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/extconf.rb: use create_header.
-
-	* ext/openssl/ossl.h, ext/openssl/openssl_missing.h:
-	  include RUBY_EXTCONF_H.
-
-Fri Jun  2 17:16:52 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/mkmf.rb (CLEANINGS): remove extconf.h by distclean if created.
-
-Fri Jun  2 00:11:19 2006  Tanaka Akira  <akr@m17n.org>
-
-	* ext/socket/socket.c (s_recvfrom): alen may be zero with UNIXSocket
-	  too.  (tested on NetBSD 3.0)
-	  (s_recvfrom_nonblock): extracted from sock_recvfrom_nonblock.
-	  (sock_recvfrom_nonblock): use s_recvfrom_nonblock.
-	  (ip_recvfrom_nonblock): new method: IPSocket#recvfrom_nonblock
-	  (unix_recvfrom_nonblock): new method: UNIXSocket#recvfrom_nonblock
-	  (s_accept_nonblock): extracted from sock_accept_nonblock.
-	  (sock_accept_nonblock): use s_accept_nonblock.
-	  (tcp_accept_nonblock): new method: TCPServer#accept_nonblock
-	  (unix_accept_nonblock): new method: UNIXServer#accept_nonblock
-
-Thu Jun  1 19:12:37 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* win32/win32.c (rb_w32_cmdvector): backslashes inside single-quotes
-	  no longer has special meanings.  fixed: [ruby-list:42311]
-
-Thu Jun  1 16:14:41 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/win32.c (rb_w32_getcwd): runtime's getcwd() will not success
-	  if the length of the cwd is longer than MAX_PATH.
-	  fixed [ruby-list:42335]
-
-Thu Jun  1 11:29:14 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/win32.c (rb_w32_getcwd): set errno if not set.
-	  fixed [ruby-list:42346]
-
-Sat May 27 11:29:46 2006  nobuyoshi nakada  <nobu@ruby-lang.org>
-
-	* ext/extmk.rb (extmake): remove extinit files if no statically linked
-	  extensions.
-
-Fri May 26 09:05:11 2006  nobuyoshi nakada  <nobu@ruby-lang.org>
-
-	* ruby.h, lib/mkmf.rb (create_header): clear command line options for
-	  macros moved to extconf.h.
-
-	* ext/extmk.rb (extract_makefile, extmk): made RUBY_EXTCONF_H and
-	  EXTSTATIC permanent.
-
-	* ext/{dbm,digest/*,socket,zlib}/extconf.rb: used $defs and $INCFLAGS.
-
-	* {bcc32,win32,wince}/Makefile.sub (COMPILE_C, COMPILE_CXX): added
-	  $(INCFLAGS).
-
-	* lib/mkmf.rb (configuration): add $defs unless extconf.h was created.
-
-Thu May 25 01:52:07 2006  nobuyoshi nakada  <nobu@ruby-lang.org>
-
-	* lib/mkmf.rb (pkg_config): particular config commands support.
-
-	* ext/extmk.rb: deal with $static set in extconf.rb.
-
-	* mkconfig.rb: merge multiple entries to an entry with multiple lines.
-
-	* lib/mkmf.rb: allow a series of commands to link.
-
-	* win32/Makefile.sub: embed manifests.
-
-	* win32/setup.mak: suffix OS name by runtime version.
-
-Wed May 24 23:52:11 2006  nobuyoshi nakada  <nobu@ruby-lang.org>
-
-	* configure.in (ac_install_sh): ignore dummy install-sh.
-	  [ruby-talk:193876]
-
-Wed May 24 03:10:48 2006  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/lib/openssl/ssl.rb
-	  (OpenSSL::SSL::SocketForwarder#setsockopt,getsockopt): typo fixed.
-
-Mon May 22 17:54:12 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* ext/socket/socket.c (sock_recvfrom_nonblock): use rb_read_pending
-	  instead of rb_io_read_pending.
-	  [ruby-dev:28663]
-
-Mon May 22 17:30:04 2006  Tanaka Akira  <akr@m17n.org>
-
-	* rubyio.h (rb_io_set_nonblock): declared.
-
-	* io.c (rb_io_set_nonblock): new function.
-	  (io_getpartial): nonblocking read support.
-	  (io_read_nonblock): new method: IO#read_nonblock.
-	  (io_write_nonblock): new method: IO#write_nonblock.
-
-	* ext/socket/socket.c
-	  (sock_connect_nonblock): new method: Socket#connect_nonblock.
-	  (sock_accept_nonblock): new method: Socket#accept_nonblock.
-	  (sock_recvfrom_nonblock): new method: Socket#recvfrom_nonblock.
-
-	  [ruby-core:7917]
-
-Mon May 22 15:57:39 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (umethod_bind): should not update original class.
-	  [ruby-dev:28636]
-
-Mon May 22 13:38:57 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (ev_const_get): should support constant access from
-	  within instance_eval().  [ruby-dev:28327]
-
-Thu May 18 17:51:32 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* time.c (time_timeval): should round for usec floating
-	  number.  [ruby-core:07896]
-
-	* time.c (time_add): ditto.
-
-Thu May 18 17:11:45 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/cgi.rb (CGI::out): support utf-8.  a patch from Fujioka
-	  <fuj at rabbix.jp>.  [ruby-dev:28649]
-
-Thu May 18 00:42:12 2006  nobuyoshi nakada  <nobu@ruby-lang.org>
-
-	* ext/extmk.rb, lib/mkmf.rb: use BUILD_FILE_SEPARATOR in Makefiles.
-
-Wed May 17 17:55:26 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* dir.c (sys_warning): should not call a vararg function
-	  rb_sys_warning() indirectly.  [ruby-core:07886]
-
-Wed May 17 08:17:15 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* util.c (ruby_strtod): try to reduce errors using powersOf10
-	  table.  [ruby-dev:28644]
-
-Tue May 16 15:34:18 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* re.c (rb_reg_initialize): should not allow modifying literal
-	  regexps.  frozen check moved from rb_reg_initialize_m as well.
-
-Tue May 16 09:20:16 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* re.c (rb_reg_initialize): should not modify untainted objects in
-	  safe levels higher than 3.
-
-	* re.c (rb_memcmp): type change from char* to const void*.
-
-	* dir.c (dir_close): should not close untainted dir stream.
-
-	* dir.c (GetDIR): add tainted/frozen check for each dir operation.
-
-Mon May 15 17:42:39 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_symbol_arg):
-	  typo fixed.  a patch from Florian Gross <florg at florg.net>.
-
-Sat May 13 16:14:05 2006  Tanaka Akira  <akr@m17n.org>
-
-	* lib/pp.rb (PP.mcall): new method.
-	  (Struct#pretty_print): call Kernel#class and Struct#members even if
-	  overridden.
-	  (Struct#pretty_print_cycle): ditto.
-	  [ruby-core:7865]
-
-Thu May 11 19:57:00 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* util.c (ruby_strtod): differ addition to minimize error.
-	  [ruby-dev:28619]
-
-Fri Aug 11 15:39:25 2006  Eric Hodel  <drbrain@segment7.net>
-
-	* lib/yaml/tag.rb: Replace nodoc with stopdoc so Module methods get
-	  documented.
-
-Thu May 11 18:10:43 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* util.c (ruby_strtod): should not raise ERANGE when the input
-	  string does not have any digits.  [ruby-dev:28629]
-
-Sun May  7 03:09:51 2006  Stephan Maka  <stephan@spaceboyz.net>
-
-	* lib/resolv.rb (Resolv::DNS::Requester::ConnectedUDP#initialize):
-	  Use AF_INET6 for nameservers containing colons.
-
-Sat May  6 00:38:42 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* signal.c (trap): sig should be less then NSIG.  Coverity found
-	  this bug.  a patch from Kevin Tew <tewk at tewk.com>.
-	  [ruby-core:07823]
-
-Thu May  4 02:24:16 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/syck/emitter.c (syck_scan_scalar): avoid accessing
-	  uninitialized array element.  a patch from Pat Eyler
-	  <rubypate at gmail.com>.  [ruby-core:07809]
-
-	* array.c (rb_ary_fill): initialize local variables first.  a
-	  patch from Pat Eyler <rubypate at gmail.com>.  [ruby-core:07810]
-
-	* ext/syck/yaml2byte.c (syck_yaml2byte_handler): need to free
-	  type_tag.  a patch from Pat Eyler <rubypate at gmail.com>.
-	  [ruby-core:07808]
-
-Wed May  3 02:12:07 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/socket/socket.c (make_hostent_internal): accept ai_family
-	  check from Sam Roberts <sroberts at uniserve.com>.
-	  [ruby-core:07691]
-
-Mon May  1 12:23:19 2006    <sinara@blade.nagaokaut.ac.jp>
-
-	* numeric.c (num_div): use floor rather than rb_Integer().
-	  [ruby-dev:28589]
-
-	* numeric.c (flo_divmod): the first element of Float#divmod should
-	  be an integer. [ruby-dev:28589]
-
-	* test/ruby/test_float.rb: add tests for divmod, div, modulo and remainder.
-
-Sat Apr 29 22:42:08 2006  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_asn1.c (ossl_asn1_decode0): should initialize
-	  flag. [ruby-core:07785]
-
-Fri Apr 28 10:53:16 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* util.c (ruby_strtod): should not cut off 18 digits for no
-	  reason.  [ruby-core:07796]
-
-	* util.c (ruby_strtod): fixed wrong conversion.
-
-Thu Apr 27 01:38:10 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* array.c (rb_ary_fill): internalize local variable "beg" to
-	  pacify Coverity.  [ruby-core:07770]
-
-Wed Apr 26 16:59:24 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* pack.c (pack_unpack): now supports CRLF newlines.  a patch from
-	  <tommy at tmtm.org>.  [ruby-dev:28601]
-
-Tue Apr 25 18:00:05 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/tcltklib.c (delete_slaves): maybe increment the reference
-	  count of a NULL Tcl_Obj [ruby-core:07759].
-
-Tue Apr 25 07:55:31 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/jcode.rb (String::tr_s): should have translated non
-	  squeezing character sequence (i.e. a character) as well.  thanks
-	  to Hiroshi Ichikawa <gimite at gimite.ddo.jp> [ruby-list:42090]
-
-Tue Apr 25 00:08:24 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* regex.c (re_compile_pattern): should check if c is not a
-	  multibyte character.  a patch from KIMURA Koichi
-	  <kimura.koichi at canon.co.jp>.  [ruby-dev:28598]
-
-Fri Apr 21 15:19:13 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/tcltklib.c (lib_eventloop_ensure): refer freed pointer
-	  [ruby-core:07744] and memory leak.
-
-Fri Apr 21 12:14:52 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/socket/socket.c: document update patch from Sam Roberts
-	  <sroberts at uniserve.com>.  [ruby-core:07701]
-
-Wed Apr 19 13:55:27 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* parse.y (arg): too much NEW_LIST()
-
-	* eval.c (SETUP_ARGS0): remove unnecessary access to nd_alen.
-
-Wed Apr 19 11:57:04 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_eval): use ARGSCAT for NODE_OP_ASGN1.
-	  [ruby-dev:28585]
-
-	* parse.y (list_concat): revert last change.
-
-	* parse.y (arg): use NODE_ARGSCAT for placeholder.
-
-Wed Apr 19 11:13:17 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/getoptlong.rb (GetoptLong::get): RDoc update patch from
-	  mathew <meta at pobox.com>.  [ruby-core:07738]
-
-Wed Apr 19 10:13:27 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* variable.c (rb_const_set): raise error when no target klass is
-	  supplied.  [ruby-dev:28582]
-
-Wed Apr 19 09:49:36 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* parse.y (list_concat): should not modify nodes other than
-	  NODE_ARRAY.  [ruby-dev:28583]
-
-Tue Apr 18 17:40:37 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/multi-tk.rb: add a binding to a container for a slave IP.
-
-	* ext/tk/lib/tk.rb: update RELEASE_DATE.
-
-	* ext/tk/tcltklib.c: forget to reset a Tcl interpreter.
-
-	* ext/tk/stubs.c: fix potential bugs about handling rb_argv0.
-
-Tue Apr 18 00:11:21 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c: block_unique should be 1, not frame_unique.
-	  [ruby-dev:28577]
-
-Fri Aug 11 15:39:25 2006  Eric Hodel  <drbrain@segment7.net>
-
-	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser#find_body): Make RDoc
-	  ignore C function prototypes.  Patch by Tilman Sauerbeck
-	  <tilman at code-monkey.de>.  [ruby-core:8574]
-	* lib/yaml/tag.rb: Replace nodoc with stopdoc so Module methods get
-	  documented.
-
-Mon Apr 10 01:03:10 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* prec.c (prec_prec_f): documentation patch from
-	  <gerardo.santana at gmail.com>.  [ruby-core:07689]
-
-Sat Apr  8 02:34:34 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* bignum.c (rb_big_pow): second operand may be too big even if
-	  it's a Fixnum.  [ruby-talk:187984]
-
-Sat Apr  8 02:12:38 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* README.EXT: update symbol description.  [ruby-talk:188104]
-
-Thu Apr  6 23:28:47 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* COPYING: explicitly note GPLv2.  [ruby-talk:187922]
-
-Thu Apr  6 11:18:37 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk/panedwindow.rb: lack of arguments. [ruby-core:7681]
-
-Thu Apr  6 01:04:47 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/tcltklib.c: fix SEGV when embedding to an application.
-	  [ruby-core:7600]
-
-	* ext/tk/tcltklib.c: fix SEGV at exit. [ruby-talk:186489]
-
-	* ext/tk/tkutil/tkutil.c: follow to changing specification of
-	  instance_eval on ruby-1.9.x.
-
-	* ext/tk/lib/tk.rb: ditto.
-
-	* ext/tk/lib/multi-tk.rb: ditto.
-
-	* ext/tk/lib/tk.rb: remove warning about redefinition of methods.
-
-	* ext/tk/lib/tk/variable.rb: remove warning about unseting Tcl
-	  variables.
-
-Wed Mar 29 20:54:44 2006  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
-
-	* ext/win32ole/win32ole.c (fole_getproperty): WIN32OLE#[] should accept
-	  multi arguments.
-
-	* ext/win32ole/tests/testWIN32OLE.rb (test_setproperty_bracket): ditto.
-
-Wed Mar 29 10:07:44 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* ext/nkf/nkf-utf8/nkf.c (nkf_each_char_to_hex, encode_fallback_subchar,
-	  e2w_conv): support C90 compiler.
-
-Wed Mar 29 06:48:40 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (backtrace): reports aliased method names in a generated
-	  backtrace.  a patch from "U.Nakamura" <usa at garbagecollect.jp>.
-	  [ruby-dev:28471]
-
-Mon Mar 27 22:19:09 2006  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* ext/nkf/nkf-utf8/{nkf.c, utf8tbl.c, config.h}: imported nkf 2.0.6.
-	  * Add --ic / --oc option and mapping tables.
-	  * Add fallback option.
-	  * Add --no-best-fit-chars option.
-	  * Fix some bugs.
-
-	* ext/nkf/nkf.c (nkf_split_options): added for parse option string.
-
-	* ext/nkf/lib/kconv.rb (Kconv.to*): add -m0.
-	  Note that Kconv.to* still imply -X.
-
-Mon Mar 27 03:17:21 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_call0): insecure calling should be checked for non
-	  NODE_SCOPE method invocations too.
-
-	* eval.c (rb_alias): should preserve the current safe level as
-	  well as method definition.
-
-Fri Mar 24 23:14:30 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (yield_under_i): pass self again for instance_eval().
-	  [ruby-dev:28466]
-
-Fri Mar 24 17:20:03 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* process.c (rb_f_sleep): remove description about SIGALRM which
-	  is not valid on the current implementation.  [ruby-dev:28464]
-
-Thu Mar 23 10:47:03 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (method_missing): should support argument splat in
-	  super.  [ruby-talk:185438]
-
-Mon Mar 20 12:05:18 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* configure.in: Solaris SunPro compiler -rapth patch from
-	  <kuwa at labs.fujitsu.com>.  [ruby-dev:28443]
-
-Mon Mar 20 09:40:23 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* configure.in: remove enable_rpath=no for Solaris.
-	  [ruby-dev:28440]
-
-Fri Mar 17 19:08:49 2006  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_ssl.c, ext/openssl/ossl_nsspki.c: fix typo.
-	  [ruby-core:07571]
-
-Wed Mar 15 16:54:21 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* lib/mkmf.rb (create_makefile): support libraries without *.so.
-
-Wed Mar 15 16:35:43 2006  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_ssl.c, ext/openssl/ossl_nsspki.c: should use
-	  "rb_str_new(0, 0)" to make empty string.
-
-Sat Mar 11 14:24:06 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/rdoc/ri/ri_formatter.rb (RI::TextFormatter::wrap): removed
-	  space before argument parenthesis.  [ruby-talk:183630]
-
-	* ruby.1: a clarification patch from David Lutterkort
-	  <dlutter at redhat.com>.  [ruby-core:7508]
-
-Sat Mar  4 15:26:40 2006  Tanaka Akira  <akr@m17n.org>
-
-	* gc.c (id2ref): fix symbol test.
-
-Sat Mar  4 01:08:07 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/rdoc/ri/ri_paths.rb (RI::Paths): adding paths from rubygems
-	  directories.  a patch from Eric Hodel <drbrain at segment7.net>.
-	  [ruby-core:07423]
-
-Thu Mar  2 19:44:18 2006  Tanaka Akira  <akr@m17n.org>
-
-	* gc.c: align VALUE with sizeof(RVALUE) globally.
-	  (is_pointer_to_heap): check alignment out of loop.
-	  (id2ref): avoid collision between symbols and objects.
-	  (rb_obj_id): ditto.  moved from object.c.
-	  [ruby-talk:178364] [ruby-core:7305]
-
-Thu Mar  2 18:58:18 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_thread_fd_writable): should not re-schedule output
-	  from KILLED thread (must be error printing).
-
-Thu Mar  2 17:57:49 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* gc.c: commited magic for reducing RVALUE size on windows. (24->20byte)
-	  [ruby-core:7474]
-
-Thu Mar  2 12:59:14 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* win32/win32.c (filetime_to_unixtime): should set tm_isdst to -1.
-	  stat() didn't treat daylight saving time property on WinNT.
-	  [ruby-talk:182100]
-
-Thu Mar  2 08:02:42 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* gc.c (add_heap): heap_slots may overflow.  a patch from Stefan
-	  Weil <weil at mail.berlios.de>.
-
-Wed Mar  1 00:24:31 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* lib/rdoc/parsers/parse_rb.rb (read_escape): could not handle /\^/.
-	  merged Mr. Ishizuka's lib/irb/ruby-lex.rb 's patch rev 1.29.
-	  [ruby-talk:181631] [ruby-dev:28404]
-
-Tue Feb 28 09:32:17 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* lib/drb/extservm.rb (invoke_service_command): cannot invoke command
-	  if command name is quoted on mswin32. [ruby-dev:28400]
-
-Mon Feb 27 00:19:16 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ruby.h (SYM2ID): should not cast to signed long.
-	  [ruby-core:07414]
-
-Fri Feb 24 20:07:23 2006  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* test/drb/drbtest.rb (add_service_command): quote pathnames in the
-	  server's command line for space contained directory names.
-	  Thanks, arton. [ruby-dev:28386]
-
-Fri Feb 24 12:11:08 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* instruby.rb: install *.exe.manifest and *.dll.manifest if exist.
-	  It's for VC++8.
-
-Fri Feb 24 11:33:52 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* bcc32/Makefile.sub (HAVE_HYPOT): bcc32 has hypot().
-
-Fri Feb 24 11:19:58 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* time.c (time_new_internal): add prototype to tell the compiler
-	  arugments types.
-
-	* win32/win32.c (NtInitialize): need to set a handler for VC++8.
-
-Fri Feb 24 08:19:16 2006  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* test.rb: Removed.  Obsolete by test/nkf.
-
-	* ext/.document: enabled documents in nkf and kconv
-
-	* ext/nkf/nkf.c ext/nkf/lib/kconv.rb: Add rdoc.
-
-Thu Feb 23 22:39:59 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* bcc32/Makefile.sub: use borlndmm.dll if possible. bcc32's RTL internal
-	  memory manager cannot handle large memory block properly.
-	  ex: 10000.times { "" << "." * 529671; GC.start } # crash
-	  [ruby-dev:28230]
-
-Thu Feb 23 13:20:28 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* eval.c (SETUP_ARGS0): fixed memory corruption. [ruby-dev:28360]
-
-Tue Feb 21 02:18:46 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* configure.in (mingw): have link.  [ruby-list:41838]
-
-	* win32/Makefile.sub (config.h): ditto.
-
-Tue Feb 21 02:07:39 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* parse.y (f_arglist): should set command_start = Qtrue for
-	  command body.  [ruby-talk:180648]
-
-Mon Feb 20 17:37:26 2006  Tanaka Akira  <akr@m17n.org>
-
-	* mkconfig.rb: alias RbConfig for Config.
-
-Mon Feb 20 12:27:53 2006  Kent Sibilev  <ksruby@gmail.com>
-
-	* lib/rational.rb (Integer::gcd): small typo fix.
-	  [ruby-core:07395]
-
-Mon Feb 20 01:05:27 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/rational.rb (Integer::gcd): replaced by gcd4 in
-	  [ruby-core:07390].  [ruby-core:07377]
-
-Mon Feb 20 00:57:02 2006  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl.h (OSSL_Debug): should not use __func__.
-	  [ruby-dev:28339]
-
-Sun Feb 19 04:46:29 2006  Guy Decoux  <ts@moulon.inra.fr>
-
-	* eval.c: initial value for block_unique must be 1.
-	  [ruby-talk:180420]
-
-Sat Feb 18 23:58:26 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/tracer.rb (Tracer::Tracer.add_filter): turn on tracer mode
-	  only when caller() level size is one.  [ruby-core:07389]
-
-	* lib/rdoc/parsers/parse_rb.rb: need not to require "tracer".
-	  [ruby-core:07389]
-
-	* sample/rtags.rb: ditto.
-
-Sat Feb 18 12:18:26 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/fileutils.rb (FileUtils::fu_world_writable): make it
-	  private.  [ruby-core:07383]
-
-Sat Feb 18 00:22:39 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/tracer.rb: merged a minor clarification patch from Daniel
-	  Berger <Daniel.Berger at qwest.com>.  [ruby-core:07376]
-
-Fri Feb 17 11:18:42 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* util.c (ruby_strtod): Float("1e") should fail. [ruby-core:7330]
-
-	* pack.c (EXTEND32): unpack("l") did not work where sizeof(long) != 4.
-	  [ruby-talk:180024]
-
-	* pack.c (pack_unpack): fixed integer overflow on template "w".
-	  [ruby-talk:180126]
-
-Fri Feb 17 09:39:29 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_thread_wait_for): sleep should always sleep for
-	  specified amount of time.  [ruby-talk:180067]
-
-Thu Feb 16 01:10:48 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (backtrace): frame->orig_func may not be initialized.
-	  [ruby-core:07367]
-
-Wed Feb 15 16:52:52 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_eval): NODE_OP_ASGN1 should allow splat in its
-	  argument list.  [ruby-core:07366]
-
-	* parse.y (arg): avoid unnecessary extra argument.
-	  [ruby-core:07366]
-
-	* eval.c (rb_eval): honor visibility on OP_ASGN1 and
-	  OP_ASGN2. [ruby-core:07366]
-
-Wed Feb 15 10:09:51 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (yield_under_i): should not pass self as an argument to
-	  the block for instance_eval.  [ruby-core:07364]
-
-Wed Feb 15 09:20:35 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_obj_instance_eval): should be no singleton classes for
-	  true, false, and nil.  [ruby-dev:28186]
-
-Tue Feb 14 18:48:33 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (DMETHOD_P): accessing wrong frame.  [ruby-dev:28181]
-
-	* eval.c (proc_invoke): preserve FRAME_DMETH flag.
-
-Tue Feb 14 15:13:51 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* ext/zlib/zlib.c: supress warning on test/zlib. [ruby-dev:28323]
-
-Tue Feb 14 14:01:17 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* time.c (search_time_t): support non 32bit time_t environments.
-
-	* win32/Makefile.sub (config.h): VC++8 has ``long long'' type.
-
-	* win32/Makefile.sub (config.h): VC++8's time_t is 64bit value.
-
-	* win32/win32.c (rb_w32_utime): drop read-only attribute before
-	  changing file time.
-
-	  all changes are backported from CVS HEAD.
-
-Tue Feb 14 11:21:38 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (argf_forward): should not use frame->argv.
-	  [ruby-core:07358]
-
-Mon Feb 13 18:08:12 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_call0): argument update propagation.  [ruby-dev:28044]
-
-	* env.h: remove argv member from struct FRAME.
-
-Mon Feb 13 13:27:00 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (eval): should push class from binding if supplied.
-	  [ruby-core:07347]
-
-Mon Feb 13 00:04:00 2006  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* lib/erb.rb (ERB::Compiler): add instance variable @insert_cmd to
-	  change <%='s behavior. (backported 1.15 - 1.16)
-
-Sat Feb 11 02:04:11 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (eval): no need to push ruby_class.  [ruby-dev:28176]
-
-Sat Feb 11 01:57:44 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_f_autoload): check if ruby_cbase is nil (during
-	  instance_eval for objects cannot have singleton classes,
-	  e.g. fixnums and symbols).  [ruby-dev:28178]
-
-Tue Feb  7 23:03:24 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* ext/zlib/zlib.c: should not access ruby objects in finalizer.
-	  [ruby-dev:28286]
-
-Mon Feb  6 16:02:51 2006  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* file.c (rb_thread_flock): ERROR_NOT_LOCKED is not an error on Cygwin.
-	  In such situation, flock() should return 0.
-
-Mon Feb  6 00:41:08 2006  Tanaka Akira  <akr@m17n.org>
-
-	* ruby.h (RSTRUCT_LEN, RSTRUCT_PTR): defined for source level
-	  compatibility with ruby 1.9.
-
-Sun Feb  5 21:05:34 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* numeric.c (fix_to_s): removed workaround for radix 2. Historically,
-	  rb_fix2str could only handle radix 8, 10, 16. (Rev1.37) But for now,
-	  it can handle radix 2..36. [ruby-Bugs#3438] [ruby-core:7300]
-
-Sun Feb  5 18:55:08 2006  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/net/http.rb: imported from trunk, rev 1.129
-
-	* lib/net/http.rb (add_field, get_fields): keep 1.8.2 backward
-	  compatibility.
-
-	* lib/net/https.rb: imported from trunk, rev 1.3.
-
-	* lib/net/https.rb: #use_ssl? definition moved from net/http.rb.
-
-Sun Feb  5 14:22:15 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* lib/pstore.rb: should return default value if name is not found.
-	  [ruby-core:7304]
-
-	* lib/pstore.rb: should raise PStore::Error if not in transaction.
-
-Sat Feb  4 22:51:43 2006  Tanaka Akira  <akr@m17n.org>
-
-	* eval.c: apply the FreeBSD getcontext/setcontext workaround
-	  only before FreeBSD 7-CURRENT.
-
-Sat Feb  4 21:19:23 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/win32.c (LK_ERR): ERROR_NOT_LOCKED is not an error.
-	  In such situation, flock() should return 0.
-
-Sat Feb  4 15:56:37 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* numeric.c (fix_to_s): (2**32).to_s(2) fails with exception where
-	  sizeof(int) == 4 < sizeof(long). [ruby-core:7300]
-
-Fri Feb  3 15:06:50 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* ext/syck/syck.c (syck_move_tokens): should reset p->cursor or etc
-	  even if skip == 0. This causes buffer overrun.
-	  (ex: YAML.load('--- "..' + '\x82\xA0' * 511 + '"'))
-
-Thu Feb  2 23:51:18 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* ext/syck/emitter.c (syck_emitter_write): should not set '\0' on
-	  emitter's marker. if marker points to the end of buffer, this causes
-	  buffer overrun. (ex: YAML.dump("." * 12288))
-
-Thu Feb  2 16:01:24 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (eval): need not to protect $SAFE value.
-	  [ruby-core:07177]
-
-Thu Feb  2 14:45:53 2006  Ville Mattila  <ville.mattila@stonesoft.com>
-
-	* configure.in: The isinf is not regognized by autoconf
-	  library guesser on solaris 10. [ruby-core:7138]
-
-Wed Feb  1 22:01:47 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* configure.in, hash.c (ruby_setenv): use setenv(3) and unsetenv(3)
-	  where they are supported. modifing environ variable seems to
-	  segfault solaris 10. [ruby-core:7276] [ruby-dev:28270]
-
-	* ruby.c (set_arg0): if use setenv(3), environ space cannot be used
-	  for altering argv[0].
-
-Tue Jan 31 14:46:28 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* struct.c (rb_struct_select): update RDoc description.
-	  [ruby-core:7254]
-
-Tue Jan 31 11:58:51 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/multi-tk.rb: add MultiTkIp#eval and bg_eval.
-
-	* ext/tk/lib/tk/namespace.rb: TkNamespace#eval was enbugged at the
-	  last commit. Now it will return a proper object.
-
-Tue Jan 31 00:10:26 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* ext/syck/rubyext.c (syck_resolver_transfer): workaround for SEGV.
-	  ex: ruby -ryaml -e 'YAML.load("!map:B {}")' [ruby-core:7217]
-
-Sat Jan 28 07:56:57 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* lib/rdoc/usage.rb: support "a:0:33" style caller[-1]. In this case
-	  file name is "a:0". I don't know this really happens though...
-	  [ruby-Bugs:3344]
-
-Wed Jan 25 22:29:04 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in, dln.c, file.c, intern.h, missing.h (eaccess): use
-	  system routine if provided.  fixed: [ruby-core:07195]
-
-Sun Jan 22 23:27:13 2006  Go Noguchi  <gonoguti@yahoo.co.jp>
-
-	* lib/test/unit/autorunner.rb (process_args): ignore arguments after
-	  '--' so that test scripts can handle them.  fixed: [ruby-dev:28258]
-
-Sun Jan 22 22:09:52 2006  Tanaka Akira  <akr@m17n.org>
-
-	* eval.c (POST_GETCONTEXT): define separately from PRE_GETCONTEXT on
-	  IA64 to avoid reusing variable address.
-
-Sun Jan 22 20:03:35 2006  Tanaka Akira  <akr@m17n.org>
-
-	* eval.c (ruby_setjmp): define PRE_GETCONTEXT and POST_GETCONTEXT
-	  instead of FUNCTION_CALL_MAY_RETURN_TWICE.
-	  define PRE_GETCONTEXT to clear carry flag for workaround of
-	  FreeBSD/i386 getcontext/setcontext bug.
-	  [ruby-dev:28263]
-
-Sat Jan 21 00:36:47 2006  Tanaka Akira  <akr@m17n.org>
-
-	* eval.c (FUNCTION_CALL_MAY_RETURN_TWICE): use only on SPARC and IA64
-	  before gcc 4.0.3.
-	  [ruby-dev:28247]
-
-Thu Jan 19 22:21:23 2006  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/fileutils.rb (mv): should remove file after copying.
-	  [ruby-dev:28223]
-
-Wed Jan 18 23:37:06 2006  Tanaka Akira  <akr@m17n.org>
-
-	* eval.c (FUNCTION_CALL_MAY_RETURN_TWICE): don't clobber %l7 of SPARC
-	  if enable-shared.
-	  (ruby_setjmp): call FUNCTION_CALL_MAY_RETURN_TWICE after getcontext
-	  too.
-	  reported by Pav Lucistnik and Marius Strobl.
-	  http://lists.freebsd.org/pipermail/freebsd-sparc64/2006-January/003739.html
-
-Tue Jan 17 11:32:46 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/setup.mak (MAKE): workaround for nmake 8.
-
-Tue Jan 17 11:10:21 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/{Makefile.sub,setup.mak}: invoke .bat via shell. workaround
-	  for nmake 8.
-
-Mon Jan 16 10:26:23 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* ext/syck/emitter.c (syck_emit_seq, syck_emit_map, syck_emit_item):
-	  should output complex key mark even if map's key is empty seq/map.
-	  [ruby-core:7129]
-
-Sat Jan 14 05:37:06 2006  Tanaka Akira  <akr@m17n.org>
-
-	* io.c (READ_DATA_PENDING, READ_DATA_PENDING_COUNT): defined
-	  for DragonFly BSD 1.4.0.
-
-Sat Jan 14 03:43:24 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* file.c (rb_file_s_chmod): avoid warning where sizeof(int) !=
-	  sizeof(void*).
-
-Fri Jan 13 19:14:56 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* lib/rdoc/diagram.rb:
-	    - properly quote bare element attributes
-	    - terminates dangling elements (e.g. <img>, <br>, <link>, etc)
-	    - converts "CVS" to the more HTML-friendly acronym element
-	    - adds missing type attributes to style elements
-
-	  based on Paul Duncan's patch <pabs@pablotron.org> [ruby-core:7028]
-
-	* lib/rdoc/generators/html_generator.rb: ditto.
-	* lib/rdoc/generators/template/html/hefss.rb: ditto.
-	* lib/rdoc/generators/template/html/html.rb: ditto.
-	* lib/rdoc/generators/template/html/kilmer.rb: ditto.
-
-Thu Jan 12 11:53:08 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/sample/tkballoonhelp.rb: [bug fix] couldn't add to a widget
-	  which is constructed with TkComposite module.
-	  [new feature] support 'command' option which is called just before
-	  popping up the balloon help.
-
-Wed Jan 11 15:00:00 2006  Ville Mattila  <mulperi@iki.fi>
-
-	* io.c (READ_PENDING*): Support solaris 64-bit environments.
-	  Solaris defines a opaque FILE struct when compiling 64 bit
-	  binaries. This means that we dont have access to _ptr etc.
-	  members anymore. The solution by Steven Lumos is to define
-	  FILE64 that has needed members available. I've modified
-	  the origanal patch a bit so that it compiles both with gcc
-	  and now free sun studio 11 compiler and both amd64 and sparc.
-	  NOTE! We have to 64 bit solaris FILE structure time to time
-	  otherwise we'll get breakage.
-	  [ruby-core:7106]
-
-Tue Jan 10 19:42:33 2006  Tanaka Akira  <akr@m17n.org>
-
-	* gc.c (garbage_collect): mark ruby_current_node.
-	  if an exception is raised in a finalizer called written in C by
-	  rb_gc_call_finalizer_at_exit, ruby_set_current_source may use
-	  collected ruby_current_node and mark_source_filename may corrupt
-	  memory.
-
-Tue Jan 10 13:30:34 2006  akira yamada  <akira@ruby-lang.org>
-
-	* ext/syck/rubyext.c (syck_resolver_transfer): should be able to load
-	  !ruby/object:Bignum syntax 1.8.3 dumped. [ruby-core:6159]
-
-Tue Jan 10 12:47:41 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* lib/yaml/rubytypes.rb (Fixnum): Bignum could not be loaded in
-	  ruby 1.8.3/1.8.4. [ruby-core:6115]
-
-	* lib/yaml/rubytypes.rb (Numeric): Subclass of Numeric could not
-	  be dumped properly. [ruby-core:7047]
-
-Tue Jan 10 12:00:48 2006  Aaron Schrab  <aaron @nospam@ schrab.com>
-
-	* lib/yaml/rubytypes.rb (Symbol#yaml_new): YAML loading of quoted
-	  Symbols broken. [ruby-Bugs:2535]
-
-Mon Jan  9 19:54:35 2006  arton  <artonx@yahoo.co.jp>
-
-	* ext/zlib/extconf.rb: zlib compiled DLL version 1.2.3 distributed by
-	  http://www.zlib.net/ has zdll.lib. [ruby-dev:28209]
-
-Mon Jan  9 14:17:12 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* win32/Makefile.sub (OPTFLAGS): I have experienced trouble on y- flag,
-	  (VisualC++6) so use -O2b2xg- if  $(MSC_VER) < 1400. [ruby-core:7040]
-
-Mon Jan  9 14:17:12 2006  Kero van Gelder  <rubyforge @nospam@ kero.tmfweb.nl>
-
-	* lib/webrick/httpservlet/filehandler.rb: fixed typo. [ruby-core:7075]
-
-Sat Jan  7 15:40:07 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (singleton): get rid of segfault on syntax error.
-	  fixed: [ruby-core:07070]
-
-Fri Jan  6 10:16:20 2006  Steven Lumos  <steven@lumos.us>
-
-	* io.c (READ_DATA_PENDING): defined for 64bit Solaris on SPARC.
-	  [ruby-core:7057]
-	  (READ_DATA_PENDING_COUNT): ditto.
-	  (READ_DATA_PENDING_PTR): ditto.
-
-Sun Jan  1 17:07:59 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* win32/win32.c (rb_w32_seekdir): should not segfault even if passed
-	  the location which rb_w32_telldir didn't return. [ruby-core:7035]
-	  (I think HEAD implementation is better. but binary compatibility)
-
-	* test/ruby/test_dir.rb: added.
-
-Sat Dec 31 22:57:00 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_thread_save_context): should not recycle scope object used
-	  in a thread.  fixed: [ruby-dev:28177]
-
-Fri Dec 30 18:22:42 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* gc.c (garbage_collect): mark objects refered from aborting threads.
-	  [ruby-dev:28190]
-
-	* win32/Makefile.sub: VC++8 support.
-
-Fri Dec 30 14:24:53 2005  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* dir.c (glob_helper): do not use TRUE for djgpp.
-
-Fri Dec 30 04:54:40 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* file.c (eaccess): workaround for VC++8 runtime.
-
-	* win32/win32.c (ioinfo): VC++8 support.
-
-Thu Dec 29 23:59:37 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_gc_mark_threads): leave unmarked threads which won't wake
-	  up alone, and mark threads in the loading table.  [ruby-dev:28154]
-
-	* eval.c (rb_gc_abort_threads), gc.c (gc_sweep): kill unmarked
-	  threads.  [ruby-dev:28172]
-
-Thu Dec 29 17:02:07 2005  Tanaka Akira  <akr@m17n.org>
-
-	* test/ruby/envutil.rb (EnvUtil.rubybin): search "ruby" instead of
-	  "miniruby".  [ruby-dev:28140]
-
-Tue Dec 27 16:59:52 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* test/drb/drbtest.rb (DRbService::self.ext_service): increase
-	  timeout limit.  a patch from Kazuhiro NISHIYAMA
-	  <zn at mbf.nifty.com>. [ruby-dev:28132]
-
-Tue Dec 27 08:29:18 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/lib/openssl/ssl.rb (OpenSSL::SSL::SSLSocket#post_connection_chech):
-	  treat wildcard character in commonName. [ruby-dev:28121]
-
-Mon Dec 26 22:32:47 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_eval), gc.c (gc_mark_children), node.h (NEW_ALIAS,
-	  NEW_VALIAS), parse.y (fitem): allow dynamic symbols to
-	  NODE_UNDEF and NODE_ALIAS.
-	  backported from trunk.  fixed: [ruby-dev:28105]
-
-Mon Dec 26 08:50:36 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (ev_const_get): fixed a bug in constant reference during
-	  instance_eval.  [yarv-dev:707]
-
-	* eval.c (ev_const_defined): ditto.
-
-	* lib/yaml.rb (YAML::add_domain_type): typo fixed.  a patch from
-	  Joel VanderWerf <vjoel at path.berkeley.edu>.
-	  [ruby-talk:165285] [ruby-core:6995]
-
-Sat Dec 24 18:58:14 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* stable version 1.8.4 released.
-
-Fri Dec 23 10:30:23 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/digest/sha2/sha2.c (ULL): support AIX C.  a patch from
-	  Kailden <kailden at gmail.com>.  [ruby-core:06984]
-
-Wed Dec 21 16:53:06 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* file.c (w32_io_info): should return handle because FileIndex is
-	  valid only while file is open. [ruby-dev:28088]
-
-Wed Dec 21 14:53:26 2005  Tanaka Akira  <akr@m17n.org>
-
-	* lib/pathname.rb (test_kernel_open): use File.identical?.
-	  [ruby-talk:171804]
-
-Tue Dec 20 22:41:17 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (eval_under_i): evaluate source in caller's frame.
-	  [ruby-dev:28076]
-
-	* eval.c (rb_call_super): use original method name on exception.
-	  [ruby-dev:28078]
-
-Tue Dec 20 13:11:59 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* ext/syck/rubyext.c: fixed GC problem (backported HEAD 1.55 - 1.62)
-	  [ruby-dev:27839]
-
-	* ext/syck/syck.h (S_FREE): small hack. no need to check if pointer is
-	  NULL or not before S_FREE.
-
-	* st.c: uses malloc instead of xmalloc to avoid GC. syck uses st_insert
-	  in gram.c to insert node from rb_syck_bad_anchor_handler into
-	  SyckParser's hash table. if GC occurs in st_insert, it's not under
-	  SyckParser's mark system yet. so RString can be released wrongly.
-	  [ruby-dev:28057]
-
-Tue Dec 20 12:53:23 2005  why the lucky stiff  <why@ruby-lang.org>
-
-	* ext/syck/rubyext.c (syck_emitter_reset): to ensure compatibility
-	  with previous Ruby versions, documents are no longer headless.
-
-Tue Dec 20 01:46:48 2005  Tanaka Akira  <akr@m17n.org>
-
-	* io.c (rb_f_backquote): fix a GC problem on
-	  IA64 with gcc 4.0.3 20051216 (prerelease) -O3.
-
-Mon Dec 19 23:32:39 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (rb_symname_p): fixed wrong validation.  [ruby-dev:28047]
-
-Sat Dec 17 03:57:01 2005  Tanaka Akira  <akr@m17n.org>
-
-	* bignum.c (rb_big_rshift): fix a GC problem on
-	  IA64 with gcc 4.0.3 20051216 (prerelease).
-
-Sat Dec 17 03:30:23 2005  Tanaka Akira  <akr@m17n.org>
-
-	* eval.c (bmcall): fix a GC problem by tail call on
-	  IA64 with gcc 4.0.3 20051216 (prerelease).
-
-Fri Dec 16 00:54:06 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* signal.c (Init_signal): revert C++ style comment.
-	  [ruby-dev:28041]
-
-Thu Dec 15 12:35:14 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/tmpdir.rb: merged RDoc patch from Eric Hodel <drbrain at
-	  segment7.net>.  [ruby-core:06894]
-
-Thu Dec 15 01:33:31 2005  Tanaka Akira  <akr@m17n.org>
-
-	* ext/zlib/zlib.c (zstream_run): fix a GC problem by tail call on
-	  x86_64 with gcc 4.0.3 20051111 (prerelease) (Debian 4.0.2-4)
-
-Wed Dec 14 12:11:46 2005  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* test/gdbm/test_gdbm.rb: specify pid for the argument of
-	  Process.wait.  workaround for Cygwin.
-
-Wed Dec 14 12:01:26 2005  Tanaka Akira  <akr@m17n.org>
-
-	* marshal.c (r_object0): fix a GC problem for reading a bignum on
-	  IA64 with gcc 3.3.5 (Debian 1:3.3.5-13).
-
-Tue Dec 13 12:23:47 2005  Tanaka Akira  <akr@m17n.org>
-
-	* re.c (rb_reg_regcomp): fix a GC problem on x86_64 with
-	  gcc 3.3.5 (Debian 1:3.3.5-13).
-
-Tue Dec 13 01:44:16 2005  Tanaka Akira  <akr@m17n.org>
-
-	* array.c (rb_ary_diff): fix a GC problem on IA64 with
-	  gcc 3.3.5 (Debian 1:3.3.5-13).
-	  When rb_ary_push is called, there was no register which contains
-	  `hash' but `&RHASH(hash)->tbl' instead.
-
-Tue Dec 13 00:08:09 2005  Tanaka Akira  <akr@m17n.org>
-
-	* sprintf.c (rb_str_format): fix a GC problem.
-	  [ruby-dev:28001]
-
-Mon Dec 12 15:54:56 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* test/openssl/test_ssl.rb (test_parallel): call GC.start to close
-	  unused files. [ruby-dev:27981]
-
-Mon Dec 12 00:33:56 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/digest/digest.c (rb_digest_base_s_digest): add volatile to
-	  protect temporary context object.  [ruby-dev:27979]
-
-	* ext/iconv/iconv.c (Init_iconv): rb_gc_register_address() should
-	  be called before actual variable initialization.
-	  [ruby-dev:27986]
-
-Fri Dec  9 23:31:02 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/rexml/encoding.rb (encoding=): give priority to particular
-	  conversion to iconv.  [ruby-core:06520]
-
-Thu Dec  8 02:07:19 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (umethod_bind): adjust invoking class for module method.
-	  [ruby-dev:27964]
-
-Thu Dec  8 00:40:52 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (call_trace_func): klass parameter should be a
-	  class/module that defines calling method.  [ruby-talk:169307]
-
-Wed Dec  7 17:10:27 2005  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
-
-	* sprintf.c (rb_f_sprintf): [ruby-dev:27967]
-
-Wed Dec  7 15:31:35 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* sprintf.c (rb_str_format): integer overflow check added.
-
-	* sprintf.c (GETASTER): ditto.
-
-Wed Dec  7 01:02:04 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/README.macosx-aqua: [new document] tips to avoid the known
-	  bug on platform specific dialogs of Tcl/Tk Aqua on MacOS X.
-
-	* ext/tk/tcltklib.c: fix bug on switching threads and waiting on the
-	  deleted interpreter on vwait and tkwait command.
-
-	* ext/tk/lib/multi-tk.rb: kill the meaningless loop for the deleted Tk
-	  interpreter.
-
-	* ext/tk/sample/demos-jp/image3.rb: [bug fix] wrong argument.
-
-	* ext/tk/sample/demos-en/image3.rb: ditto.
-
-	* ext/tk/sample/demos-jp/menu.rb: fix message for MacOS X.
-
-	* ext/tk/sample/demos-jp/menu8x.rb: ditto.
-
-	* ext/tk/sample/demos-en/menu.rb: ditto.
-
-Tue Dec  6 16:37:57 2005  Yuya Nishida  <yuya@j96.org>
-
-	* eval.c (exec_under): avoid accessing ruby_frame->prev.
-	  [ruby-dev:27948]
-
-Thu Dec  1 00:50:33 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_funcall2): allow to call protected methods.
-	  fixed: [ruby-dev:27890]
-
-Wed Nov 30 23:52:17 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (NEWHEAP, ADD2HEAP): set count after pointer was set.
-	  fixed: [ruby-dev:27896]
-
-Wed Nov 30 13:43:07 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* misc/ruby-mode.el (ruby-expr-beg): support $! at the end of
-	  expression.   [ruby-dev:27868]
-
-Mon Nov 28 18:55:43 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* ext/socket/socket.c (init_inetsock_internal): remove setting
-	  SO_REUSEADDR option on server socket on Cygwin.
-	  fixed: [ruby-core:6765] ([ ruby-Bugs-2872 ])
-
-Mon Nov 28 13:08:54 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* win32/win32.c (rb_w32_strerror): remove all CR and LF. (avoid broken
-	  error message on bccwin32 + winsock)
-
-Mon Nov 28 09:21:49 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* lib/mkmf.rb (create_makefile): should not change sodir with
-	  dir.gsub!. (bccwin32 failed to install third party exntesions)
-	  [ruby-dev:27834]
-
-Sun Nov 27 00:56:13 2005  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/wsdl/xmlSchema/complexContent.rb: missing
-	  ComplexContent#elementformdefault method.
-
-Sat Nov 26 19:57:45 2005  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* dln.c (conv_to_posix_path): should initialize posix.
-
-Thu Nov 24 21:05:58 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* configure.in (AC_CHECK_FUNCS): need to check link().
-	  fixed: [ruby-dev:27814]
-
-Thu Nov 24 01:22:25 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* file.c (w32_io_info): CreateFile failed on Win9x if file was already
-	  opened. (FILE_SHARE_READ was needed, but actually I don't understand
-	  the flags of CreateFile well...)
-
-Wed Nov 23 20:59:01 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb: add Tk.pkgconfig_list and Tk.pkgconfig_get
-	  [Tk8.5 feature].
-
-	* ext/tk/lib/tk/text.rb: supports new indices modifires on a Text
-	  widget [Tk8.5 feature].
-
-	* ext/tk/lib/tk/virtevent.rb: add TkNamedVirtualEvent.
-
-	* ext/tk/lib/tk/autoload.rb: ditto.
-
-	* ext/tk/lib/tk/event.rb: add :data key for virtual events [Tk8.5
-	  feature].
-
-Wed Nov 23 18:55:31 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* file.c (w32_io_info): should not call GetFileInformationByHandle
-	  for pipe.
-
-	* file.c (w32_io_info): checks return value from rb_w32_get_osfhandle.
-
-	* file.c (w32_io_info): now can identify directory on WinNT.
-
-Wed Nov 23 03:40:49 2005  Guy Decoux  <ts@moulon.inra.fr>
-
-	* re.c (KR_REHASH): should cast to unsigned for 64bit CPU.
-	  [ruby-core:06721]
-
-Wed Nov 23 11:01:33 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* intern.h, file.c: failed to compile on windows.
-
-Wed Nov 23 07:26:44 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/extconf.rb: check for X509V3_EXT_nconf_nid.
-
-	* ext/openssl/ossl_x509ext.c (MakeX509ExtFactory): should use
-	  OPENSSL_malloc to allocate X509V3_CTX.
-
-	* ext/openssl/ossl_x509ext.c (ossl_x509extfactory_create_ext): use
-	  X509V3_EXT_nconf_nid to avoid SEGV (and to build extensions which
-	  values are placed in separate section).
-
-	* test/openssl/test_x509ext.rb: new file.
-
-Wed Nov 23 01:22:57 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* file.c (test_identical): test if two files are identical.
-
-	* file.c (rb_f_test): support DOSISH systems where st_ino is not
-	  reliable.  fixed: [ruby-core:06672]
-
-	* win32.h, win32.c (rb_w32_osid): check the running platform.
-
-Tue Nov 22 23:52:06 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/optparse.rb: match incomplete (in current enconding) multibyte
-	  string.  http://inamode6.tokuhirom.dnsalias.org/show/1551
-
-Tue Nov 22 18:36:11 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* win32/win32.c (winnt_stat): set mapped errno instead of ENOENT.
-
-Tue Nov 22 14:46:57 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* file.c (rb_file_s_basename): skip slashes just after UNC top slashes.
-
-	* test/ruby/test_path.rb (test_dirname, test_basename): follow new
-	  spec. and add new tests.
-
-Tue Nov 22 13:18:32 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* win32/win32.c (rb_w32_stat): Dir.chdir('//server/shared');
-	  p Dir.glob('*') should work on WinNT. (implemented our own
-	  stat(2) on WinNT) [ruby-list:41552] [ruby-dev:27711]
-
-Tue Nov 22 02:31:53 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tkextlib/tile.rb: bug fix (Tk::Tile::USE_TTK_NAMESPACE
-	  is not defined).
-
-Tue Nov 22 01:45:21 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* file.c (rb_file_s_basename): DOSISH_UNC is defined on cygwin but
-	  DOSISH is not.  fixed: [ruby-dev:27797]
-
-Mon Nov 21 22:50:48 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* file.c (rb_path_skip_prefix, rb_file_s_basename): UNC without path
-	  should not be splitted.  fixed: [ruby-dev:27776] [ruby-dev:27786]
-
-	* parse.y (dsym): prohibit empty symbol literal by interpolation.
-	  fixed: [ruby-talk:166529]
-
-Mon Nov 21 16:03:48 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* win32/setup.mk: findstr doesn't exist on win9x.
-	  fixed: [ruby-dev:27756]
-
-Sun Nov 20 22:34:06 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (rb_symname_p): [ not followed by ] is not valid symbol.
-	  fixed: [ruby-talk:166520]
-
-Sat Nov 19 19:57:54 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/fileutils.rb (FileUtils::ln): ln documentation fix.
-	  [ruby-core:06661]
-
-Sat Nov 19 07:34:32 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk/font.rb: remove dependency on Ruby's version (1.8
-	  or 1.9).
-
-	* ext/tk/lib/tkextlib/ICONS/icons.rb: ditto.
-
-	* ext/tk/sample/tkextlib/treectrl/demo.rb: ditto.
-
-Fri Nov 18 17:57:08 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* file.c (rb_file_s_dirname): should use skipprefix for UNC path.
-	  pointed out by nobu ([ruby-dev:27744]). fixed: [ruby-core:5076]
-
-Fri Nov 18 17:35:09 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/multi-tk.rb: add restriction to access the entried
-	  command table and manipulate other IPs (for reason of security).
-	  Now, a IP object can be controlled by only its master IP or the
-	  default IP.
-
-	* ext/tk/lib/remote-tk.rb: add restriction to manipulate.
-
-	* ext/tk/tcltklib.c (ip_is_slave_of_p): add TclTkIp#slave_of?(ip)
-	  to check manipulability.
-
-	* ext/tk/lib/tk.rb: bug fix on handling of Tcl's namespaces.
-
-	* ext/tk/lib/tk/namespace.rb: ditto.
-
-Fri Nov 18 17:26:06 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* file.c (rb_file_s_dirname): added checks for some patterns with drive
-	  letter. fixed: [ruby-dev:27738]
-
-	* test/ruby/test_path.rb (test_dirname): added tests for above
-	  patterns.
-
-Fri Nov 18 12:18:02 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* win32/win32.h (S_IFIFO): r,w = IO.pipe; r.stat.pipe? now
-	  returns true on VisualC++6.
-
-Wed Nov 16 23:24:17 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* common.mk (static-ruby): overridable.
-
-	* ext/extmk.rb (parse_args): force to link extensions statically only
-	  if static is given for extstatic.
-
-	* ext/extmk.rb (RUBY, RUBYW): overridable.
-
-Tue Nov 15 23:46:35 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/find.rb (Find::find): should not ignore symbolic links to
-	  non-existing files.  [ruby-talk:165866]
-
-Tue Nov 15 16:23:26 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* array.c (rb_ary_fill): previous commit disabled this usage:
-
-	    a = [0,1,2,3,4,5,6,7,8,9]
-	    a.fill {|i| a[i] * 10} #=> [nil, nil, ...., nil]
-
-	  previous commit has the advantage of early garbage collection, but
-	  potensially this would break some script. so I reverted behavior.
-
-Tue Nov 15 16:04:10 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* array.c (rb_ary_fill): tail elements were vanished when the middle
-	  part of array was filled. (ie: [0,1,2,3,4].fill(-1,2,1) => [0,1,-1])
-
-	* test/ruby/test_array.rb (test_fill): added.
-
-Tue Nov 15 14:39:16 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* array.c (rb_ary_fill): should adjust array length correctly when
-	  an array is expanded in the fill process.  [ruby-core:06625]
-
-Mon Nov 14 23:49:57 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* file.c (rb_file_s_readlink): ERANGE will occur only on GPFS.
-	  [ruby-dev:27699]
-
-Mon Nov 14 17:36:22 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* array.c (rb_ary_first): RDoc update from Daniel Berger
-	  <djberg96@yahoo.com>.  [ruby-core:06577].
-
-Fri Nov 11 10:31:44 2005  Zach Dennis  <zdennis@mktec.com>
-
-	* ext/socket/socket.c: Socket Documentation. [ruby-core:6552]
-
-Fri Nov 11 08:20:56 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* Makefile.in (OUTFLAG): keep trailing spaces.  [ruby-dev:27666]
-
-	* mkconfig.rb: substitution refereces added.
-
-Fri Nov 11 07:44:18 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* configure.in: undef HAVE_LINK on BeOS. (link(2) always returns
-	  EINVAL, and this causes error in test/fileutils.)
-
-	* file.c: overwride chown(2) and fchown(2) on BeOS. (these functions
-	  should not change user/group id if -1 is passed as corresponding
-	  argument, and this causes error in test/fileutils too)
-	  [ruby-dev:27672]
-
-	* file.c (rb_file_s_link): checks HAVE_LINK.
-
-Tue Nov  8 15:32:27 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/drb/ssl.rb (DRb::SSLConfig#accept): fixed typo.
-	  [ruby-dev:27560] [ruby-core:4627]
-
-Mon Nov  7 13:43:51 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/stubs.c (_nativethread_consistency_check): use simpler
-	  (low cost) way to check whether the Tcl interpreter was compiled
-	  with threads enabled of not.
-
-	* ext/tk/tcltklib.c: reduce warnings.
-
-	* ext/tk/tkutil/tkutil.c: ditto.
-
-Mon Nov  7 00:06:58 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* lib/yaml.rb: removed :nodoc: to generate Kernel doc. [ruby-core:6324]
-
-Sun Nov  6 23:39:13 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/iconv/iconv.c (Iconv::BrokenLibrary): exception when detected a
-	  bug of underlying library.
-
-Sun Nov  6 21:46:59 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* ext/tk/stubs.c (ruby_tcl_create_ip_and_stubs_init): should touch
-	  interpreter after initialization is done. [ruby-dev:27638]
-
-Sun Nov  6 20:13:27 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* file.c (rb_file_s_readlink): readlink(2) on AIX fails with ERANGE if
-	  buffer size is less than required.  fixed: [ruby-dev:27634]
-
-Wed Nov  2 20:25:28 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/extconf.rb: ext/tk/extconf.rb: change the check parameter
-	  for Win32.
-
-Wed Nov  2 20:14:53 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tcltklib: merge into ext/tk and remove.
-
-Wed Nov  2 19:03:06 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tcltklib/tcltklib.c (ip_rbUpdateObjCmd,
-	  ip_rb_threadUpdateObjCmd): passed improper flags to DoOneEvent().
-
-	* ext/tk/tkutil.c: use rb_obj_respond_to() instead of rb_respond_to().
-
-Tue Nov  1 14:20:11 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_call_super): should call method_missing if super is
-	  called from Kernel method.
-
-	* eval.c (exec_under): frame during eval should preserve external
-	  information.
-
-Tue Nov  1 10:50:17 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/extconf.rb: should check ERR_peek_last_error().
-	  [ruby-dev:27597]
-
-	* ext/openssl/ossl.c (ossl_raise): ditto.
-
-Mon Oct 31 17:34:46 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* configure.in: use proper option for Sun linker. A patch from
-	  Shinya Kuwamura <kuwa at labs.fujitsu.com>.  [ruby-dev:27603]
-
-Mon Oct 31 11:27:22 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* test/gdbm/test_gdbm.rb, test/sdbm/test_sdbm.rb (test_s_open_error):
-	  skip on Win32/DOS platforms.
-
-Mon Oct 31 05:49:23 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_cipher.c (ossl_cipher_update): input data must
-	  not be empty. [ruby-talk:161220]
-
-	* test/openssl/test_cipher.rb: add test for Cipher#update("").
-
-Mon Oct 31 05:37:20 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/httpservlet/cgihandler.rb
-	  (WEBrick::HTTPServlet::CGIHandler#do_GET): the value of Set-Cookie:
-	  header field should be splited into each cookie.  [ruby-Bugs:2199]
-
-	* lib/webrick/cookie.rb (WEBrick::Cookie.parse_set_cookie): new method
-	  to parse the value of Set-Cookie: header field.
-
-	* test/webrick/test_cookie.rb, test/webrick/test_cgi.rb,
-	  test/webrick/webrick.cgi: add some test for cookie.
-
-Mon Oct 31 03:19:36 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/readline/readline.c (readline_readline): type check.
-	  [ruby-core:6089]
-
-	* numeric.c (fix_rshift): RDoc fix.  [ruby-core:6351]
-
-	* util.h (strtod): add #undef for platforms defines strtod()
-	  macro.   [ruby-dev:27563]
-
-Mon Oct 31 02:35:59 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* test/ruby/test_float.rb (test_precision): test by assert_in_delta.
-	  [ruby-dev:27575]
-
-Sat Oct 29 01:58:25 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/etc/etc.c: document update from mathew <meta@pobox.com>.
-	  [ruby-core:06473]
-
-	* ext/fcntl/fcntl.c: ditto.
-
-Thu Oct 27 16:45:31 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* string.c (scan_once): wrong condition to use mbclen2().
-	  [ruby-dev:27535]
-
-Wed Oct 26 09:27:27 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* ext/syck/implicit.c (syck_type_id_to_uri): should return
-	  newly allocated memory. otherwise, type_id will be freed
-	  twice. [ruby-dev:27384] [ruby-core:6385]
-
-Wed Oct 26 09:04:51 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* ruby.h (Qfalse, Qtrue, Qnil, Qundef): make sure these immediate
-	  values have VALUE type. there is an environment where sizeof(VALUE)
-	  != sizeof(int) like IA64. if 32bit integer (Qtrue) is passed to ANYARGS
-	  and received by 64bit integer (VALUE), upper bits may have garbage value.
-	  [ruby-dev:27513]
-
-Wed Oct 26 01:58:19 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in (RUBY_EXTERN): macro to export symbols in shared
-	  library.  [ruby-core:05528]
-
-	* defines.h, {bcc32,win32,wince}/Makefile.sub (RUBY_EXTERN): moved to
-	  configuration pass.
-
-	* ext/extmk.rb (extmake): RUBY_EXTERN for static linked extensions.
-
-Tue Oct 25 15:32:00 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/rational.rb: applied documentation patch from Gavin Sinclair
-	  <gsinclair@gmail.com>.  [ruby-core:06364]
-
-	* lib/irb.rb (IRB::Irb::eval_input): handle prompts with newlines
-	  in irb auto-indentation mode.  [ruby-core:06358]
-
-Tue Oct 25 02:12:08 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/rdoc/markup/simple_markup.rb (SM::SimpleMarkup::LABEL_LIST_RE):
-	  reduce redundant backtrack.  [ruby-talk:161771]
-
-Tue Oct 25 00:27:35 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* lib/rinda/*: RDoc documentation from Eric Hodel
-	  <drbrain@segment7.net> added.
-
-Mon Oct 24 21:14:29 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in, io.c: use sys/syscall.h if syscall.h is not available.
-	  [ruby-core:06247]
-
-Mon Oct 24 20:49:45 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* ext/Win32API/lib/win32/resolv.rb (get_info): support multiple DNS.
-	  fixed: [ruby-list:40058], [ruby-dev:27479]
-
-Mon Oct 24 07:57:56 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/tk/lib/tk/canvas.rb (TkCanvasItemConfig::__item_val2ruby_optkeys):
-	  typo fixed.  [ruby-talk:162187]
-
-	* ext/tk/lib/tk/menu.rb (TkMenuEntryConfig::__item_val2ruby_optkeys):
-	  ditto.  [ruby-core:06359]
-
-Sun Oct 23 21:50:15 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/enumerator/enumerator.c: applied documentation patch from
-	  James Edward Gray II <james@grayproductions.net>.
-	  [ruby-core:06348]
-
-Sun Oct 23 07:11:11 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tcltklib/extconf.rb: improve messages [ruby-core:06325].
-
-	* ext/tk/lib/tk.rb, ext/tk/lib/tk/canvas.rb, ext/tk/lib/tk/entry.rb,
-	  ext/tk/lib/tk/frame.rb, ext/tk/lib/tk/image.rb,
-	  ext/tk/lib/tk/itemconfig.rb, ext/tk/lib/tk/labelframe.rb,
-	  ext/tk/lib/tk/listbox.rb, ext/tk/lib/tk/menu.rb,
-	  ext/tk/lib/tk/radiobutton.rb, ext/tk/lib/tk/scale.rb,
-	  ext/tk/lib/tk/spinbox.rb, ext/tk/lib/tk/text.rb,
-	  ext/tk/lib/tk/toplevel.rb: improve conversion of option values.
-
-	* ext/tk/lib/tkextlib/*: ditto.
-
-	* ext/tk/lib/tkextlib/*: update to support ActiveTcl8.4.11.2.
-
-	* ext/tk/lib/tkextlib/trofs/*: support Trofs 0.4.3.
-
-	* ext/tk/lib/tkextlib/tile/*: support Tile 0.7.2.
-
-	* ext/tk/lib/tkextlib/vu/*: support vu 2.3.0.
-
-	* ext/tk/lib/tkextlib/tcllib/*: support Tcllib 1.8 (Tklib 0.3).
-
-Sat Oct 22 23:54:07 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/extmk.rb, lib/mkmf.rb (with_config): support --with-extension
-	  options.  [ruby-dev:27449]
-
-Sat Oct 22 13:26:57 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* object.c (sym_inspect), parse.y (parser_yylex, rb_symname_p): check
-	  if valid as a symbol name more strictly.  [ruby-dev:27478]
-
-	* test/ruby/test_symbol.rb: tests for [ruby-core:03573].
-
-	* time.c (rb_strftime): removed meaningless volatile modifiers, and
-	  concatenate successive nul characters at once.  [ruby-dev:27472]
-
-Fri Oct 21 19:21:56 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* rubysig.h (CHECK_INTS): fixed typo. (I believe bit-or is improper)
-
-Fri Oct 21 17:49:32 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* bin/erb (ERB::Main::run): typo fixed.  [ruby-core:06337]
-
-Fri Oct 21 15:27:17 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* bignum.c (bignew_1): convertion from `int' to `char' discards
-	  upper bits, (ie. (char)0xff00 -> 0) so it's better to test if
-	  nonzero and set 0 or 1 instead of simply casting ... as a flag usage.
-	  (but I believe this won't cause actual bug in current implementation)
-	  [ruby-dev:27055]
-
-	* time.c: should use LONG_LONG instead of `long long'.
-
-Thu Oct 20 09:37:15 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* lib/mkmf.rb (create_makefile): Borland make seems not to allow
-	  empty dependency list. If this change is not good, please correct
-	  it.
-
-Thu Oct 20 07:55:09 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/mkmf.rb (create_makefile): get rid of a restriction
-	  of Borland make.  fixed: [ruby-dev:27460]
-
-Thu Oct 20 00:13:18 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* rubysig.h (CHECK_INTS): fix typo.
-
-Wed Oct 19 23:58:03 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/mkmf.rb (create_makefile): do not create unnecessary empty
-	  directories.  fixed: [ruby-dev:27451]
-
-Wed Oct 19 19:26:15 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (rb_gc_mark_parser): get rid of segfault with old yacc.
-	  fixed: [ruby-dev:27439]
-
-Wed Oct 19 08:28:32 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* file.c (rb_file_join): elements may contain null pointer strings.
-	  report and fixed by Lloyd Zusman (hippoman): [ruby-core:06326]
-
-Wed Oct 19 02:34:33 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c, gc.c, time.c: made internal symbols static.  [ruby-dev:27435]
-
-Wed Oct 19 01:27:07 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* regex.c (re_compile_pattern): numeric literal inside character class
-	  disabled succeeding backtrack.  fixed: [ruby-list:41328]
-
-Mon Oct 17 21:18:50 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (parser_heap): byacc never free parser stack.
-	  fixed: [ruby-dev:27428]
-
-Mon Oct 17 16:04:47 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* file.c (chmod_internal, lchmod_internal): fixed type of 2nd argument.
-
-Sun Oct 16 22:16:51 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/extmk.rb: omit non-existing directories.
-
-Sun Oct 16 14:30:05 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* lib/rinda/rinda.rb (Rinda::Tuple#initialize): check remote hash
-	  tuple. fixed: [ruby-list:41227]
-
-	* test/rinda/test_rinda.rb: test it.
-
-Sun Oct 16 03:38:07 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* rubysig.h (CHECK_INTS): prevent signal handler to run during
-	  critical section.  [ruby-core:04039]
-
-	* eval.c (load_wait): need not to call rb_thread_schedule()
-	  explicitly.  [ruby-core:04039]
-
-	* eval.c (rb_thread_schedule): clear rb_thread_critical.
-	  [ruby-core:04039]
-
-Sat Oct 15 19:56:38 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* bin/erb: typo fixed, again. thanks, Doug Kearns.
-
-Fri Oct 14 22:08:26 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/win32.c (ioctl): should set errno.
-
-Fri Oct 14 16:57:32 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/config.rb (Config::FileHandler): :UserDir should be nil.
-	  It is harmful to permit the access to ~/public_html by default.
-	  suggested by Hiroyuki Iwatsuki.
-
-Thu Oct 13 23:29:51 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (HEAPCNT): bison allocates indivisible size.
-	  fixed: [ruby-core:06261]
-
-	* io.c, pack.c, ext/syck/rubyext.c, ext/syck/syck.h, missing/isinf.c:
-	  get rid of warnings.  fixed: [ruby-core:06247]
-
-Wed Oct 12 12:52:57 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl.c (Init_openssl): should call
-	  OpenSSL_add_ssl_algorithms().
-
-Wed Oct 12 11:08:54 2005  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* file.c (rb_f_test): typo in RDoc comments.
-
-Tue Oct 11 21:41:58 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_obj_respond_to): check if obj responds to the given
-	  method with the given visibility.  [ruby-dev:27408]
-
-	* eval.c (rb_respond_to): conform to Object#respond_to?.  [ruby-dev:27411]
-
-Tue Oct 11 00:01:21 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* st.c (st_free_table): do not call free() but xfree().
-	  [ruby-core:06205]
-
-Sat Oct  8 20:04:40 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (Init_Binding): add Binding#dup method.  [yarv-dev:666]
-
-	* parse.y (rb_parser_malloc, rb_parser_free): manage parser stack on
-	  heap.  [ruby-list:41199]
-
-	* ext/iconv/charset_alias.rb: parse config.charset_alias file directly.
-
-Fri Oct  7 09:54:00 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/cgi.rb (CGI::Cookie::parse): Cookies from Nokia devices may
-	  not be parsed correctly.  A patch from August Z. Flatby
-	  (augustzf) in [ruby-Patches-2595].  [ruby-core:06183]
-
-Thu Oct  6 20:12:16 2005  Minero Aoki  <aamine@loveruby.net>
-
-	* ext/strscan/strscan.c (strscan_free): remove useless code.
-	  [ruby-dev:26368] [ruby-dev:27389]
-	  (backported from trunk, rev 1.22)
-
-Wed Oct  5 04:42:38 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/xmlrpc/server.rb (XMLRPC::Server#initialize): should mount the
-	  servlet on "/".
-
-Wed Oct  5 03:59:09 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/xmlrpc/server.rb (XMLRPC::Server#serve): delete wrong call
-	  of "join".
-
-Mon Oct  3 00:04:00 2005  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
-
-	* pack.c (EXTEND16): [ruby-dev:27383]
-
-Thu Sep 29 10:26:18 2005  Tanaka Akira  <akr@m17n.org>
-
-	* ext/dl/dl.c (rb_io_to_ptr): abolish sizeof(FILE).
-	  [ruby-dev:27317]
-
-Thu Sep 29 07:22:05 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* evalc. (rb_f_send): underscores need to be escaped.
-	  fixed by Doug Kearns.  [ruby-core:06053]
-
-Thu Sep 29 00:57:35 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (ev_const_get), variable.c (rb_const_get_0): retry only when
-	  autoload succeeded.
-
-	* variable.c (rb_autoload_load): now return true if autoload
-	  succeeded.  fixed: [ruby-dev:27331]
-
-Wed Sep 28 23:42:15 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* file.c (apply2files): add prototype.
-
-	* file.c (rb_stat_inspect): constified.
-
-	* class.c (rb_mod_init_copy, rb_class_init_copy), file.c (rb_stat_init_copy),
-	  numeric.c (num_init_copy), object.c (rb_obj_init_copy, Init_Object),
-	  re.c (match_init_copy, rb_reg_init_copy), time.c (time_init_copy):
-	  undocumented.
-
-Wed Sep 28 23:09:23 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/delegate.rb: document update from James Edward Gray II
-	  <james@grayproductions.net>.  [ruby-core:06027]
-
-Wed Sep 28 15:14:19 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/cgi.rb (WEBrick::CGI#start): req.query_string should
-	  refer the value of QUERY_STRING. [ruby-list:41186]
-
-	* lib/webrick/httprequest.rb (WEBrick::HTTPRequest#query_string=):
-	  add new method.
-
-Wed Sep 28 10:45:44 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tcltklib/tcltklib.c: cannot compile with Tcl/Tk8.0.x
-	  [ruby-dev:27335].
-
-Wed Sep 28 08:12:18 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* io.c (read_buffered_data): check if reached EOF.  fixed: [ruby-dev:27334]
-
-Wed Sep 28 07:56:52 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/yaml/basenode.rb (YAML::BaseNode::match_segment): fix typo.
-	  [ruby-dev:27237], [ruby-core:05854]
-
-	* lib/yaml/tag.rb (Module#yaml_as): suppress warnings.
-
-	* lib/yaml/types.rb (YAML::PrivateType, YAML::DomainType): ditto.
-
-Wed Sep 28 03:23:35 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* rubysig.h: fixed build problem with --enable-pthread on platforms
-	  which don't have setitimer().
-
-Mon Sep 26 22:32:13 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (set_trace_func): add rb_secure(4) to prevent adding
-	  tracing function.
-
-Sun Sep 25 12:05:10 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* bin/erb: typo fixed.
-
-Sun Sep 25 01:46:43 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* misc/ruby-mode.el (ruby-calculate-indent): arrange deep-indent
-	  closing parenthesis at same column as the opening.
-
-Sun Sep 25 00:42:11 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* misc/ruby-mode.el (ruby-expr-beg): deal with heredoc separately.
-	  fixed: [ruby-list:41168]
-
-	* misc/ruby-mode.el (ruby-calculate-indent): not to deepen indent
-	  level for continuous line inside parentheses.
-	  http://nabeken.tdiary.net/20050915.html#p02
-
-Sun Sep 25 00:18:11 2005  Tanaka Akira  <akr@m17n.org>
-
-	* eval.c (unknown_node): show more information.  [ruby-dev:26196]
-
-Sat Sep 24 08:56:01 2005  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/fileutils.rb (cd): no longer accept :noop option, related
-	  code is useless (backported from trunk, rev 1.67).
-	  [ruby-core:05858] [ruby-Bugs:2494]
-
-Sat Sep 24 08:38:07 2005  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/fileutils.rb: fix visibility of FileUtils::NoWrite, Verbose,
-	  DryRun (backported from trunk, rev 1.66). [ruby-core:05954]
-
-	* test/fileutils/test_nowrite.rb: test it.
-
-	* test/fileutils/test_dryrun.rb: new file.
-
-	* test/fileutils/test_verbose.rb: new file.
-
-Sat Sep 24 02:40:20 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/delegate.rb: document update from James Edward Gray II
-	  <james@grayproductions.net>.  [ruby-core:05942]
-
-Thu Sep 22 23:36:24 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/mkmf.rb (find_executable0): default path if environment is not
-	  set.  [ruby-dev:27281]
-
-Thu Sep 22 16:33:12 2005  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* test/readline/test_readline.rb (TestReadline::replace_stdio):
-	  merged the patch of [ruby-dev:25232] instead of [ruby-dev:25223].
-
-Wed Sep 21 23:30:44 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/mkmf.rb (configuration): generalized nmake dependent code.
-
-Wed Sep 21 09:07:55 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* stable version 1.8.3 released.
-
-Wed Sep 21 08:52:25 2005  why the lucky stiff  <why@ruby-lang.org>
-
-	* ext/syck/token.c: correctly compute identation of a block
-	  scalar's parent node. [ruby-talk:150620]
-
-Wed Sep 21 08:20:24 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* README.EXT, README.EXT.ja: add new features.
-
-Wed Sep 21 07:43:58 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/optparse.rb (default_argv, Arguable#options): defaults strings
-	  to be parsed to Arguable instance.
-
-Wed Sep 21 02:44:09 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* file.c (path_check_0): disallow sticky world writable directory
-	  in PATH (and $LOAD_PATH).  [ruby-dev:27226]
-
-	* file.c (fpath_check): typo fixed.
-
-Tue Sep 20 22:29:49 2005  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* test/wsdl/simpletype/rpc/test_rpc.rb, test/wsdl/ref/test_ref.rb,
-	  test/wsdl/any/test_any.rb test/soap/wsdlDriver/test_calc.rb:
-	  suppress deliberate warnings with $VERBOSE = nil.
-
-Tue Sep 20 21:26:23 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/io/wait/lib/nonblock.rb: disable on platforms non-blocking flag
-	  is not available.  fixed: [ruby-dev:27187]
-
-Tue Sep 20 18:23:04 2005  Tanaka Akira  <akr@m17n.org>
-
-	* eval.c (thread_mark): mark th->last_status.  [ruby-dev:27179]
-
-Tue Sep 20 18:20:33 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/yaml.rb: require 'yaml/constants'.  [ruby-core:5776]
-
-Tue Sep 20 17:48:34 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/xmlrpc/client.rb (XMLRPC::Client::do_rpc): add charset
-	  information to content-type header.[ruby-core:5127]
-
-	* lib/xmlrpc/server.rb (CGIServer::serve): ditto.
-
-	* lib/xmlrpc/server.rb (ModRubyServer::serve): ditto.
-
-	* lib/xmlrpc/server.rb (WEBrickServlet::service): ditto.
-
-Tue Sep 20 17:34:46 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* test/webrick/test_cgi.rb: set ENV["PATH"] to CGIEnvPath on
-	  windows. bcc32's runtime is not installed into system directory,
-	  so it cannot be found without this setting. [ruby-dev:27166]
-
-Tue Sep 20 17:10:38 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* test/dbm/test_dbm.rb (TestDBM::test_s_open_error): remove
-	  test_s_open_error test to detect duplicate open.
-	  [ruby-dev:27202]
-
-Tue Sep 20 17:08:31 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* io.c: PIPE_BUF is not defined on BeOS. use _POSIX_PIPE_BUF instead.
-	  [ruby-dev:27185]
-
-Tue Sep 20 16:53:53 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* test/readline/test_readline.rb (TestReadline::replace_stdio):
-	  BSD seek support from [ruby-dev:25223].  fixed: [ruby-dev:27150]
-
-Tue Sep 20 15:39:40 2005  why the lucky stiff  <why@ruby-lang.org>
-
-	* ext/syck/emitter.c (syck_scan_scalar): prevent indicators from
-	  appearing alone or at the end of plain scalars. [ruby-core:5826]
-
-	* ext/syck/emitter.c (syck_emit_scalar): treat typed scalar nodes
-	  as complex keys.
-
-	* lib/syck.h: version 0.60.
-
-	* lib/yaml/basenode.rb (YAML::BaseNode#at): transform keys during
-	  key searches.
-
-	* ext/syck/rubyext.c: loading of binary-typed nodes.  prevent
-	  emission of plain strings that look like symbols, but which aren't.
-
-Tue Sep 20 05:50:22 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* test/xmlrpc/test_webrick_server.rb (setup_http_server):
-	  should not include 'webrick/https' unless 'use_ssl' because
-	  it fails where openssl is not installed.
-
-Tue Sep 20 00:34:07 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (io_close): call rb_io_close() directly if io is a T_FILE
-	  object.  [ruby-dev:27156]
-
-Mon Sep 19 19:09:08 2005  Minero Aoki  <aamine@loveruby.net>
-
-	* file.c (rb_file_chown): should accept nil. [ruby-dev:27171]
-	  (backport from trunk, rev 1.208)
-
-Mon Sep 19 18:35:13 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/dl/dl.c (rb_io_to_ptr): fix DragonFlyBSD support.
-	  [ruby-dev:27151]
-
-Mon Sep 19 14:17:04 2005  Minero Aoki  <aamine@loveruby.net>
-
-	* ext/syck/emitter.c (syck_emit): passing an int* value to the
-	  long* parameter causes unaligned access on LP64 systems.
-	  [ruby-dev:27161]
-
-Mon Sep 19 13:44:03 2005  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
-
-	* ext/win32ole/win32ole.c: avoid core dump with WIN32OLE_EVENT.
-	  [ruby-dev:27133]
-
-Mon Sep 19 10:36:06 2005  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/fileutils.rb (cp_r): default is :dereference_root=>true for
-	  backward compatibility. [ruby-dev:27145]
-
-	* test/fileutils/test_fileutils.rb (test_cp_r): test it.
-
-Mon Sep 19 09:57:39 2005  Minero Aoki  <aamine@loveruby.net>
-
-	* test/fileutils/test_fileutils.rb: backported from trunk (1.36).
-	  (again) [ruby-dev:27145]
-
-Mon Sep 19 07:45:37 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_pkey.h, ossl_pkey_rsa.c, ossl_pkey_dsa.c:
-	  an instance variable "private" is added to OpenSSL::PKey class.
-	  this ivar is a flag that shows whether there is a private key
-	  in the instance.
-
-	* ext/openssl/ossl_engine.c: (ossl_engine_load_privkey): set private
-	  key flag.
-
-Mon Sep 19 06:41:32 2005  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/fileutils.rb: backported from trunk (rev 1.65):
-
-	* lib/fileutils.rb (rm_r): new option :secure.
-
-	* lib/fileutils.rb (rm_rf): new option :secure.
-
-	* lib/fileutils.rb: new method #remove_entry_secure.
-
-	* lib/fileutils.rb (cd): remove option :noop.
-
-	* lib/fileutils.rb (cp_r): new option :dereference_root.
-
-	* lib/fileutils.rb (cp_r): new option :dereference_root.
-
-	* lib/fileutils.rb: new method #remove_entry.
-
-	* lib/fileutils.rb: new method #chmod_R.
-
-	* lib/fileutils.rb: new method #chown.
-
-	* lib/fileutils.rb: new method #chown_R.
-
-	* lib/fileutils.rb: new method .commands.
-
-	* lib/fileutils.rb: new method .options.
-
-	* lib/fileutils.rb: new method .have_option?.
-
-	* lib/fileutils.rb: new method .options_of.
-
-	* lib/fileutils.rb: new method .collect_method.
-
-	* lib/fileutils.rb: use module_function instead of single extend.
-
-	* test/fileutils/test_fileutils.rb: backported from trunk (1.36).
-
-Mon Sep 19 03:17:48 2005  Tanaka Akira  <akr@m17n.org>
-
-	* file.c (rb_thread_flock): wrap the flock system call by
-	  TRAP_BEG/TRAP_END to enable signals.  [ruby-dev:27122]
-
-	* ext/socket/socket.c (bsock_send): wrap the sendto and send system
-	  call by TRAP_BEG/TRAP_END to enable signals when writing to a socket
-	  which is full.  [ruby-dev:27132]
-
-	* io.c (rb_io_syswrite): wrap the write system call by
-	  TRAP_BEG/TRAP_END to enable signals when writing to a pipe which is
-	  full.  [ruby-dev:27134]
-
-Mon Sep 19 03:02:08 2005  Tanaka Akira  <akr@m17n.org>
-
-	* io.c (io_fwrite): wrap the write system call by TRAP_BEG/TRAP_END to
-	  enable signals when writing to a pipe which is full.
-
-Sun Sep 18 02:10:47 2005  why the lucky stiff  <why@ruby-lang.org>
-
-	* lib/yaml/rubytypes.rb: remove comments that are bungling up
-	  the rdoc and ri output.  output symbols as plain scalars.
-
-	* ext/syck/rubyext.c (syck_emitter_reset): emit headless
-	  documents always.
-
-	* ext/syck/emitter.c (syck_scan_scalar): quote scalars with any
-	  kind of surrounding line space, tabs or spaces alike.
-
-	* ext/syck/token.c: accept tabs as whitespace, not for indentation,
-	  but strip from plain scalars.
-
-	* test/yaml/test_yaml.rb: remove outdated tests.
-
-Sat Sep 17 23:25:04 2005  sheepman  <sheepman@sheepman.sakura.ne.jp>
-
-	* lib/mathn.rb (Rational::inspect): should preserve original
-	  operand.  [ruby-core:05806]
-
-Sat Sep 17 23:20:27 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/cgi.rb (CGI::Cookie): should handle multiple values for a
-	  cookie name.  [ruby-talk:156140]
-
-Sat Sep 17 10:42:13 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/multi-tk.rb: MultiTkIp#eval_string and bg_eval_string
-	  should call Kernel.eval on caller's safe-level instead of slave's
-	  safe-level (Of course, the given script should be evaluated on
-	  slave's safe-level).
-
-Sat Sep 17 09:45:26 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* string.c (rb_str_substr): should propagate taintness even for
-	  empty strings.  [ruby-dev:27121]
-
-	* string.c (rb_str_aref): should infect result if range argument
-	  is tainted.  [ruby-dev:27121]
-
-Sat Sep 17 08:35:39 2005  Kouhei Sutou  <kou@cozmixng.org>
-
-	* lib/rss/maker/base.rb (RSS::Maker::ItemsBase#normalize): fixed
-	  strange RSS::Maker::Item#max_size behavior.
-	  Thanks to Kazuhiko <kazuhiko@fdiary.net>.
-
-	* test/rss/test_maker_1.0.rb (RSS::TestMaker10#test_items): ditto.
-
-Fri Sep 16 23:09:20 2005  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
-
-	* ext/win32ole/win32ole.c (ole_search_event_at): bug fix
-	  in ext/win32ole/sample/ienavi.rb.
-
-	* ext/win32ole/win32ole/tests/testOLEEVENT.rb: ditto.
-
-Fri Sep 16 22:41:18 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* file.c (rb_file_s_extname): empty string for path name ending with a
-	  period.  fixed: [ruby-core:05651]
-
-	* file.c (rb_file_join): smarter behavior at edge cases.
-	  fixed: [ruby-core:05706]
-
-Fri Sep 16 18:34:01 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/syck/node.c (syck_replace_str): was using return from the
-	  void function.  a patch from MIYAMUKO Katsuyuki
-	  <miyamuko at mtb.biglobe.ne.jp>.  [ruby-dev:27111]
-
-Fri Sep 16 14:48:48 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/multi-tk.rb: fix typo on MultiTkIp#bg_eval_string
-
-Fri Sep 16 12:02:12 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/syck/rubyext.c (syck_resolver_transfer): remove C++ style
-	  comment (//).  [ruby-core:05793]
-
-Fri Sep 16 00:14:14 2005  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* test/logger/test_logger.rb: unintentionally overwritten changes by
-	  Usa.  reverted.
-
-Fri Sep 16 00:06:18 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/cgi.rb (WEBrick::CGI::Socket#initialize): should set
-	  $stdout.binmode.
-
-Thu Sep 15 23:25:21 2005  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/{soap,wsdl,xsd}, test/{soap,wsdl,xsd}: imported soap4r/1.5.5.
-
-	  #nnn is a ticket number at http://dev.ctor.org/soap4r
-
-	  * SOAP
-
-	    * allow to configure an envelope namespace of SOAP request. (#124)
-	   	TemporaryNamespace = 'http://www.w3.org/2003/05/soap-envelope'
-	  	@client.options["soap.envelope.requestnamespace"] =
-		  TemporaryNamespace
-	 	@client.options["soap.envelope.responsenamespace"] =
-		  TemporaryNamespace
-		@client.do_proc(...)
-
-	    * let SOAP request XML indent space configuable.  see
-	      "soap.envelope.no_indent" option. (#130)
-
-	    * let external CES configuable.
-	      ex. client["soap.mapping.external_ces"] = 'SJIS'.  $KCODE is used
-	      by default. (#133)
-		external CES ::= CES used in Ruby object of client and server
-		internal CES ::= CES used in SOAP/OM
-
-	    * add iso-8859-1 external CES support. (#106)
-
-	    * fixed illegal 'qualified' handling of elements.  it caused
-	      ASP.NET inteoperability problem. (#144)
-
-	    * added 'soap.envelope.use_numeric_character_reference' (boolean)
-	      option to let query XML use numeric character reference in XML,
-	      not plain UTF-8 character.  !GoogleSearch server seems to not
-	      allow plain UTF-8 character since 2005-08-15 update. (#147)
-
-	    * SOAP::Header::SimpleHeader (de)serialization throws an exception
-	      on !SimpleHeader.on_(in|out)bound when header is a String.  so we
-	      could not use a simple single element headerItem.  fixed.  thanks
-	      to emil. (#129)
-
-	    * out parameter of rpc operation did not work.  (#132)
-
-	    * follow HTTP redirect only if using http-access2.  (#125) (#145)
-
-	    * add a workaround for importing an WSDL whose path begins with
-	      drive letter.  (#115)
-
-	  * WSDL
-
-	    * SOAP Data which is defined as a simpletype was not mapped
-	      correctly to Ruby obj when using wsdl2ruby.rb generated classdef
-	      file. (#123)
-
-	    * rpc/literal support. (#118)
-
-	    * re-implemented local element qualify/unqualify control.  handles
-	      elementFormDefault and form in WSDL.  (#119)
-
-	    * Array of an element which has simpleType causes a crash. (#128)
-
-	    * prarmeterOrder may not contain return part so it can be shorter
-	      than parts size.  Thanks to Hugh.  (#139)
-
-	  * Samples
-
-	    * added !BasicAuth client sample. (#117)
-
-	    * added Base64 client/server sample.
-
-	    * added Flickr SOAP interface client sample. (#122)
-
-	    * added !SalesForce client sample. (#135)
-
-	    * updated Thawte CA certificate for !GoogleAdWords sample.
-
-	    * updated a client script with the newer version made by Johan.
-	      thanks!
-
-	    * shortened long file names. (#120)
-
-	    * fixed typo in authheader sample. (#129)
-
-	    * updated deprecated method usage.  (#138)
-
-Thu Sep 15 23:02:57 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* win32/win32.h (rb_w32_stat): added prototype.
-
-Thu Sep 15 22:35:55 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* test/ruby/test_signal.rb (test_exit_action): skip the test using
-	  fork on fork-less platforms.
-
-Thu Sep 15 11:39:18 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk/dialog.rb: If a dialog does not show up yet,
-	  TkDialogObj#name raises an exception. [ruby-talk:156109]
-
-Thu Sep 15 01:39:19 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* lib/rinda/tuplespace.rb (Rinda::TemplateEntry::initialize): pull
-	  up method. Tabs converted to spaces.
-
-Thu Sep 15 00:18:24 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/net/telnet.rb (Net::Telnet::waitfor): replace sysread with
-	  readpartial.  [ruby-talk:127641]
-
-Wed Sep 14 22:40:26 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (ruby_glob): glob function not using ruby exception system.
-
-Wed Sep 14 01:26:03 2005  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/net/https.rb: backported from trunk, rev 1.3.
-	  [ruby-dev:25673] (again), [ruby-dev:26617] (again),
-	  [ruby-dev:27062]
-
-	* ext/openssl/lib/net/https.rb: removed.
-
-	* ext/openssl/lib/net/protocols.rb: removed.
-
-	* lib/net/http.rb: #use_ssl?, #use_ssl are moved from net/https.
-
-Tue Sep 13 22:09:40 2005  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/logger.rb (Logger): added formatter accessor to logger for
-	  dictating the way in which the logger should format the messages it
-	  displays.  Thanks to Nicholas Seckar (cf. [ruby-talk:153391]) and
-	  Daniel Berger.
-
-	* lib/logger.rb (Logger): added VERSION constant.
-
-	* lib/logger.rb: removed document for LogDevice. It is an
-	  implementation detail and is not a public interface.
-
-	* test/logger/test_logger.rb: added tests.
-
-Tue Sep 13 21:47:17 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (BEGIN_CALLARGS): pop halfly pushed status.
-	  fixed: [ruby-dev:26881]
-
-Tue Sep 13 16:26:45 2005  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/net/http.rb: backported from trunk, rev 1.128.
-	  [ruby-dev:25673] [ruby-dev:26617]
-
-	* lib/net/protocol.rb: backported from trunk, rev 1.78.
-
-	* lib/net/protocol.rb: new method #old_open to support net/smtp
-	  and net/pop.
-
-	* lib/net/smtp.rb: use #old_open.
-
-	* lib/net/pop.rb: ditto.
-
-Tue Sep 13 12:33:05 2005  why the lucky stiff  <why@ruby-lang.org>
-
-	* lib/yaml.rb: reworking YAML::Stream to use the new
-	  emitter.
-
-	* lib/yaml/stream.rb: ditto.
-
-	* lib/yaml/rubytypes.rb: added Object#yaml_new.
-
-	* lib/yaml/tag.rb: the tag_subclasses? method now
-	  shows up in the class.  allow taguri to be set using an accessor.
-	  continue support of Object#to_yaml_type.
-
-	* ext/syck/rubyext.c: new emitter code.  yaml_new and yaml_initialize
-	  get called, should they be present.  consolidated all the diaspora of internal
-	  node types into the family below YAML::Syck::Node -- Map,
-	  Seq, Scalar -- all of whom are SyckNode structs pointing to
-	  Ruby data.  moved Object#yaml_new into the node_import and made it the
-	  default behavior.  the target_class is always called wih yaml_new, prepended
-	  a parameter, which is the klass.  loaded nodes through GenericResolver show their style.
-	  new Resolver#tagurize converts type ids to taguris.
-
-	* ext/syck/implicit.re: were 'y' and 'n' seriously omitted??
-
-	* ext/syck/emitter.c: renovated emitter, walks the tree in advance.
-	  consolidated redundant block_styles struct into
-	  the scalar_style struct.  (this means loaded nodes can now
-	  be sent back to emitter and preserve at least its very basic
-	  formatting.)
-
-	* ext/syck/gram.c: headless documents of any kind allowed.
-
-	* ext/syck/node.c: new syck_replace_str methods and syck_empty_*
-	  methods for rewriting node contents, while keeping the ID
-	  and other setup info.  added syck_seq_assign.
-
-	* ext/syck/syck.h: reflect block_styles and new node functions.
-
-Mon Sep 12 20:53:06 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* test/openssl/test_pkcs7.rb (test_enveloped): skip this test
-	  to avoid a bug of PKCS7_enctypt() (only if ext/openssl is
-	  compiled with OpenSSL-0.9.7d or earlier versions).
-	  http://www.mail-archive.com/openssl-dev@openssl.org/msg17376.html
-
-Mon Sep 12 14:03:33 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* test/dbm/test_dbm.rb: remove locking test, which may not be
-	  supported on some platforms.  [ruby-dev:27030]
-
-Mon Sep 12 10:45:58 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/dl/dl.c (rb_io_to_ptr): merged a patch for DragonFly BSD
-	  from Takahiro Kambe <taca at back-street.net>.  [ruby-dev:27023]
-
-Sun Sep 11 22:05:51 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* bin/erb (ERB::Main#run): set ERB#filename so that it is used
-	  when reporting syntax/runtime errors. Tabs converted to spaces.
-
-Sat Sep 10 10:17:03 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_engine.c (ossl_engine_s_by_id):
-	  OpenSSL::Engine.by_id calls given block before calling
-	  ENGINE_init (block parameter is the return value of this method
-	  itself).  this functionality is useful to load dynamic shared
-	  engines. the following code is a sample of loading a key using
-	  OpenSC PKCS #11 module.
-
-		require "openssl"
-		pkcs11 = OpenSSL::Engine.by_id("dynamic"){|e|
-		  e.ctrl_cmd("SO_PATH", "/usr/lib/opensc/engine_pkcs11.so")
-		  e.ctrl_cmd("LIST_ADD", "1")
-		  e.ctrl_cmd("LOAD")
-		}
-		pkcs11.ctrl_cmd("PIN", "secret")
-		key = pkcs11.load_private_key
-
-	* ext/openssl/ossl_engine.c (ossl_engine_ctrl_cmd): new method
-	  OpenSSL::Engine#ctrl_cmd. it wraps ENGINE_ctrl_cmd_string.
-
-	* ext/openssl/ossl_engine.c (ossl_engine_get_cmds): new method
-	  OpenSSL::Engine#cmds. it returms engine command definitions.
-
-Sat Sep 10 10:09:47 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_asn1.c (asn1str_to_str): new function.
-
-	* ext/openssl/ossl_pkcs7.c: new class OpenSSL::PKCS7::RecipientInfo.
-	  this class wraps PKCS7_RECIP_INFO struct.
-
-	* ext/openssl/ossl_pkcs7.c: OpenSSL::PKCS7::Signer is renamed to
-	  OpenSSL::PKCS7::SignerInfo. ("Signer" remains as an alias of
-	  SignerInfo.)
-
-	* test/openssl/test_pkcs7.rb: new file.
-
-Sat Sep 10 10:05:51 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_ns_spki.c (ossl_spki_initialize): assume that
-	  the argument is a DER string if Base64 decoding failed.
-
-	* ext/openssl/ossl_ns_pki.c (ossl_spki_to_der): new method.
-
-	* test/openssl/test_ns_spki.rb: add new file.
-
-Sat Sep 10 09:56:24 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/lib/digest.rb: added SHA224, SHA256, SHA384 and SHA512.
-	  these features are enabled if this library is compiled with
-	  OpenSSL 0.9.8 or later.
-
-	* test/openssl/test_digest.rb: add test for new digests.
-
-Sat Sep 10 09:51:30 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl.c (ossl_raise): should use ERR_peek_last_error
-	  to get last error on the current thread. And should report
-	  errors on the stack while OpenSSL.debug is true.
-
-	* ext/openssl/ossl.c (ossl_get_errors): new method for debugging
-	  this library.
-
-	* ext/openssl/ossl_ssl.c (ossl_sslctx_set_ciphers): fix error message.
-
-	* ext/openssl/ossl_x509req.c (ossl_x509req_set_attributes): get rid
-	  of unused variable.
-
-	* ext/openssl/ossl_x509store.c (ossl_x509store_initialize): should
-	  set @time to avoid warning.
-
-	* ext/openssl/ossl_x509store.c (ossl_x509store_set_default_paths,
-	  X509_STORE_add_cert, X509_STORE_add_crl): should raise error if
-	  wrapped functions failed.
-
-	* test/openssl/test_x509store.rb: add test for errors.
-
-Fri Sep  9 22:13:19 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_call0): prohibit calling tainted method (>2) when
-	  $SAFE == 0.
-
-Fri Sep  9 16:45:25 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* string.c (rb_str_times): make empty strings to keep taintness,
-	  and a little improvement.  [ruby-dev:26900]
-
-	* ext/iconv/iconv.c (iconv_try), ext/iconv/extconf.rb: get rid of meta
-	  characters in command line option.  fixed: [ruby-talk:155369]
-
-Thu Sep  8 14:58:11 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* merged a patch from Takahiro Kambe <taca at back-street.net> to
-	  support DragonFly BSD.  [ruby-dev:26984]
-
-Wed Sep  7 12:55:08 2005  Tanaka Akira  <akr@m17n.org>
-
-	* lib/open-uri.rb: abolish mod === tempfile to avoid a problem
-	  [ruby-dev:26967].
-
-Wed Sep  7 10:45:15 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_thread_switch): convert all exceptions to
-	  SystemExit.  fixed: [ruby-core:05724]
-
-	* eval.c (rb_thread_terminated): show backtrace before propagate
-	  exceptions to main thread.
-
-Wed Sep  7 08:35:04 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* Makefile.in, configure.in (MINIOBJS): miniruby on HP-UX can not load
-	  extension libraries.
-
-	* bignum.c (bignew_1, bigadd): K&R style argument actually can't be
-	  defined as char.
-
-	* missing/vsnprintf.c: ANSI compiler supports const keyword.
-
-	* ext/digest/sha2/extconf.rb: reject platforms which has inttypes.h
-	  but no 64bit integer.
-
-	* lib/mkmf.rb (what_type?): guesstimate type.
-
-	* ext/etc/etc.c (setup_passwd), ext/etc/extconf.rb: pw_age might be
-	  char*.  fixed: [ruby-core:05470]
-
-Wed Sep  7 08:32:47 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* object.c (rb_mod_cvar_get, rb_mod_cvar_set): document fix from
-	  sheepman <sheepman@sheepman.sakura.ne.jp>; a bug in visibility
-	  description.  [ruby-dev:26965]
-
-	* sprintf.c (rb_f_sprintf): warn "too many argument" on verbose
-	  mode (-v/-w); backported from 1.9.  [ruby-dev:26963]
-
-Mon Sep  5 17:03:07 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/ostruct.rb: a patch from Florian Gross <florgro at gmail.com>
-	  merged to allow recursive inspect (and to_s) for OpenStruct.
-	  [ruby-core:05532]
-
-Mon Sep  5 07:01:12 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/openssl/lib/openssl/buffering.rb (Buffering#do_write):
-	  should clear data from the buffer which already been output.
-
-Fri Sep  2 23:51:54 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib: do not use __send__ to access private methods.  [ruby-dev:26935]
-
-Fri Sep  2 03:29:00 2005  Keiju Ishitsuka  <keiju@ruby-lang.org>
-
-	* lib/irb/init.rb: make IRB -I option that is same befavior for ruby.
-	  [ruby-dev:26872], [ruby-dev: 26920]
-
-	* lib/irb/locale.rb: support to print help message when OS locale is
-	  ja_JP.utf-8. [ruby-dev:26872]
-
-Thu Sep  1 17:11:25 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_call0): wrong condition for $SAFE restoration.
-
-Thu Sep  1 14:12:45 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/multi-tk.rb: On Tcl8.5, MultiTkIp#invoke_hidden doesn't
-	  work (gives wrong order of arguments).
-
-	* ext/tk/lib/multi-tk.rb: add MultiTkIp#invoke_hidden_on_namespace
-	  to support '-namespace' option of 'interp invokehidden' command
-	  on Tcl8.5.
-
-Wed Aug 31 14:43:15 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/Makefile.sub (OPTFLAGS): default global optimization to
-	  disabled for all VC++ versions.  fixed: [ruby-dev:26897]
-
-Wed Aug 31 11:35:43 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* test/gdbm/test_gdbm.rb (teardown): should remove GDBM temporary
-	  file.
-
-Wed Aug 31 10:30:56 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* process.c (proc_detach, proc_setmaxgroups): missing argument type
-	  declaration. (I recommend ANSI-style function)
-
-Tue Aug 30 23:20:19 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_rescue2): initialization miss.  fixed: [ruby-dev:26917]
-
-	* lib/mkmf.rb (xsystem, xpopen): no longer expand by Config.
-
-	* lib/mkmf.rb (link_command, cc_command, cpp_command): expand
-	  variables at once, and quote hdrdir.  fixed: [ruby-core:05680]
-
-	* lib/mkmf.rb (libpathflag): quote paths.
-
-Tue Aug 30 19:34:27 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/digest/md5/md5ossl.h, ext/digest/rmd160/rmd160ossl.h,
-	  ext/digest/sha1/sha1ossl.h: include <stddef.h> to avoid
-	  error in compilation with OpenSSL-0.9.8. [ruby-list:41068]
-
-Mon Aug 29 19:54:21 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* lib/rdoc/usage.rb: improper exceptions. [ruby-dev:26870]
-
-	* lib/rdoc/usage.rb: support the case when non-ruby code exists before
-	  shebang. (this is needed when ri.bat is executed on windows)
-
-Mon Aug 29 17:48:17 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (method_arity): should return proper arity value.
-	  [ruby-dev:26390]
-
-Mon Aug 29 01:19:57 2005  Tanaka Akira  <akr@m17n.org>
-
-	* lib/time.rb (Time.parse): extract fractional seconds using
-	  Date._parse.  [ruby-talk:153859]
-
-Sat Aug 27 20:20:01 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* ext/curses/curses.c ({curses,window}_clrtoeol): added. suggested
-	  by Reyn Vlietstra.
-
-	* ext/curses/curses.c: chtype in curses is not `char', rahter `long'.
-	  [ruby-Bugs:2298]
-
-	* ext/curses/view.rb: String =~ String is deprecated.
-
-Wed Aug 24 10:53:28 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* test/logger/test_logger.rb (test_shifting_size): should close log
-	  device before unlink, since some platform cannot unlink opened
-	  file.
-
-Sun Aug 21 00:13:27 2005  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/wsdl/xmlSchema/importer.rb (WSDL::XMLSchema::Importer#fetch): add
-	  a workaround for importing an WSDL whose path begins with drive
-	  letter.  [ruby-dev:26242]
-
-Sat Aug 20 22:37:13 2005  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/logger.rb (write, shift_log?, shift_log): file shifting race
-	  condition bug fixed.  [ruby-dev:26764]
-
-	* test/logger/test_logger.rb: tests.
-
-Fri Aug 19 18:13:39 2005  Tanaka Akira  <akr@m17n.org>
-
-	* lib/time.rb (Time.apply_offset): fix a problem with last day of
-	  month.  reported by Lucas Nussbaum.  [ruby-talk:152866]
-
-Thu Aug 18 12:46:28 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* bcc32/Makefile.sub (COMMON_HEADERS): reverted 1.42.2.24.
-	  I misunderstood, bccwin32 on ruby_1_8 uses winsock2 originally.
-	  [ruby-dev:26806]
-
-	* win32/win32.h: include winsock2.h instead of winsock.h. (bcc32)
-
-Wed Aug 17 23:58:05 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* object.c (rb_to_integer): argument constified.
-
-	* eval.c (terminate_process): take String message.
-
-	* eval.c (rb_thread_switch): propagate the exception caused thread
-	  termination directly.  fixed: [ruby-core:05552]
-
-Wed Aug 17 00:05:46 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_add_method): preserve safe level in the environment
-	  where a method is defined .
-
-	* eval.c (rb_call0): restore preserved safe level in the method
-	  execution.
-
-Mon Aug 15 00:38:51 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_rescue2): reduce PUSH_TAG() as well as NODE_RESCUE.
-	  [ruby-dev:26800]
-
-	* range.c (range_check, range_init): reduce useless exceptions.
-
-Sat Aug 13 18:51:26 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_block_pass): distinguish current block from others.
-	  fixed: [ruby-dev:26274]
-
-	* ext/stringio/stringio.c (strio_set_string): disallow nil.
-	  http://www.rubyist.net/~nobu/t/20050811.html#c05
-
-Thu Aug 11 23:29:03 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Dec  1 09:35:29 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/stringio/stringio.c: keep holding string after closed.
+	* missing/explicit_bzero.c: add a few comment.
 
-Thu Aug 11 13:01:48 2005  Kouhei Sutou  <kou@cozmixng.org>
+Tue Dec  1 09:31:19 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/rss: fixed sort bug. [ruby-list:41018]
+	* missing/explicit_bzero.c: add disabling optimization on gcc.
 
-	* lib/rss/1.0.rb (RSS::RDF::Channel#setup_maker_attributes):
-	  removed self.
+Tue Dec  1 07:50:33 2015  Eric Wong  <e@80x24.org>
 
-	* lib/rss/maker/base.rb (RSS::Maker::ItemsBase#<=>): use #date
-	  instead of @date.
-	  (RSS::Maker::Base::self.def_array_element): added #size.
+	* missing/explicit_bzero.c: new file. define explicit_bzero.
+	  Fixup r52806
 
-	* lib/rss/maker/1.0.rb
-	  (RSS::Maker::RSS10::Channel#to_rss,
-	   RSS::Maker::RSS10::Items::Item#to_rss): cleared dc_dates set
-	  upped by using #date.
+Thu Oct 22 12:54:43 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/rss/maker/dublincore.rb
-	  (RSS::Maker::ChannelBase, RSS::Maker::ItemsBase::ItemBase):
-	  fixed opposite alias.
+	* thread_pthread.c (register_ubf_list): renamed from
+	  add_signal_thread_list.
+	* thread_pthread.c (unregister_ubf_list): renamed
+	  from remove_signal_thread_list.
+	* thread_pthread.c (ubf_wakeup_all_threads): renamed from
+	  ping_signal_thread_list.
+	* thread_pthread.c (ubf_wakeup_thread): renamed from
+	  ubf_select_each.
+	* thread_pthread.c (ubf_threads_empty): renamed from
+	  check_signal_thread_list().
+	* thread_pthread.c (ubf_list_lock): renamed from
+	  signal_thread_list_lock.
 
-	* test/rss/test_setup_maker_1.0.rb
-	  (RSS::TestSetupMaker10::test_setup_maker_items_sort): added some
-	  tests for RSS::Maker::ItemsBase#do_sort.
+	* thread_pthread.c (register_ubf_list): large simplification
+	  by using ccan/list.h.
+	  bonus: removed malloc() and exit(EXIT_FAILURE).
+	* thread_pthread.c (unregister_ubf_list): ditto.
+	* thread_pthread.c (ubf_threads_empty): ditto.
+	* thread_pthread.c (ubf_wakeup_all_threads): ditto.
 
-Wed Aug 10 10:29:40 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* thread_pthread.c (print_signal_list): removed.
 
-	* ext/tk/lib/tk.rb: fix bug on handling __ruby2val_optkeys().
+Thu Oct 22 08:03:49 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tk/lib/tk/itemconfig.rb: fix bug on handling
-	  __item_ruby2val_optkeys().
+	* test/ruby/test_rand.rb (TestRand#test_default_seed): add
+	  srand case.
 
-	* ext/tk/lib/tk/canvas.rb: didn't check __item_ruby2val_optkeys().
+Thu Oct 22 06:33:38 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tk/lib/tkextlib/blt/component.rb: ditto.
+	* random.c (InitVM_Random): move Random::DEFAULT initialization
+	  bits to Init_Random_default.
+	* random.c (Init_Random_default): renamed from Init_RandomSeed2.
+	* random.c (Init_RandomSeedCore): renamed from Init_RandomSeed.
 
-Tue Aug  9 15:12:04 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Thu Oct 22 06:20:48 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tcltklib/tcltklib.c: remove dangerous 'rb_jump_tag's.
+	* random.c (Init_RandomSeed): move all Random::DEFAULT
+	  construction bits to Init_RandomSeed2. Random::DEFAULT
+	  and Ruby internal hashes are no longer shared their seed.
+	* random.c (Init_RandomSeed2): ditto. And, kill evil
+	  rb_obj_reveal() stuff.
 
-	* ext/tk/lib/tk.rb: add __val2ruby_optkeys and __ruby2val_optkeys to
-	  help to convert option values between ruby and tcl.
+	* random.c (init_hashseed): add MT argument.
+	* random.c: (init_siphash): ditto.
 
-	* ext/tk/lib/tk/itemconfig.rb: add __item_val2ruby_optkeys and
-	  __item_ruby2val_optkeys to help to convert option values between
-	    ruby and tcl.
+	* test/ruby/test_rand.rb (TestRand#test_default_seed): new
+	  test for Random::DEFAULT::seed.
 
-	* ext/tk/lib/tk/radiobutton.rb: use __ruby2val_optkeys for 'variable'
-	  option (for the reason of backward compatibility).
+Thu Oct 22 05:23:48 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tk/lib/tk/composite.rb: clarify the arguments of super().
+	* random.c (init_hashseed, init_siphash): extract initialize
+	  functions.
 
-	* ext/tk/lib/tk/spinbox.rb: ditto.
+Thu Oct 22 01:01:34 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tk/lib/tk/text.rb: ditto.
+	* configure.in: sort AC_CHECK_HEADERS() by alphabetical order.
 
-	* ext/tk/lib/tk/validation.rb: ditto.
+Thu Oct 22 00:19:07 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tk/lib/tkextlib/*: support to treat tkvariable-type
-	  configure options.
+	* random.c (init_randomseed): remove "initial" argument. It never
+	  be used from outside of this function.
 
-Tue Aug  9 20:30:19 2005  Tadashi Saito  <shiba@mail2.accsnet.ne.jp>
+Thu Oct 22 00:12:33 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* bignum.c (rb_big_coerce): allow bignum x bignum coercing.
-	  [ruby-dev:26778]
+	* lib/securerandom.rb (SecureRandom::gen_random): use /dev/urandom
+	  for initialize OpenSSL's rand.
 
-Mon Aug  8 20:43:02 2005  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Wed Oct 21 12:10:04 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* test/ruby/test_method.rb: added.  [ruby-dev:26761]
+	* ext/openssl/ossl_rand.c (ossl_rand_bytes): RAND_bytes could
+	  be return -1 as an error. Therefore, added error handling.
+	* ext/openssl/ossl_pkey_dsa.c (dsa_generate): ditto.
 
-Sun Aug  7 23:50:14 2005  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Wed Oct 21 09:04:09 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* test/ruby/test_super.rb: added from HEAD. [ruby-dev:26743]
+	* include/ruby/util.h: remove a warning suppression C4723
+	  (potential divide by zero) for VisualC++. It's meaningless.
+	  Before r26197, there is ruby_div0() in this place and it
+	  actually made divide by zero. But now it's just garbage.
 
-Sun Aug  7 01:31:15 2005  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
+Wed Oct 21 08:23:36 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/win32ole/win32ole.c (WIN32OLE_EVENT#on_event): should set
-	  only one event handler.
+	* random.c: random_raw_seed don't use GRND_NONBLOCK. GRND_NONBLOCK
+	  mean the result might not have an enough cryptic strength and
+	  easy predictable. That's no good for SecureRandom.
 
-	* ext/win32ole/tests/testOLEEVENT.rb: ditto.
+Sun Oct 18 17:26:53 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/win32ole/tests/testOLEPARAM.rb: remove re-defined
-	  test_ole_type_detail method.
+	* common.mk: add a rule for explicit_bzero.o.
+	* configure.in: detect explicit_bzero and memset_s.
+	* include/ruby/missing.h: add explicit_bzero.
+	* random.c (init_randomseed): use explicit_bzero() instead of
+	  memset(). memset could be eliminated by compiler optimization.
 
-Sat Aug  6 12:35:24 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Mon Nov 30 18:46:44 2015  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/tk/lib/{tk.rb,tk/itemconfig.rb}: configure creates
-	  TkVariable if key name is 'variable' or 'textvariable'
-	  by default. [ruby-dev:26749]
+	* ext/readline/extconf.rb: call dir_config("libedit")
+	  if --enable-libedit is specified. [Bug #11751]
+	  patched by John Hein
 
-	* ext/tk/lib/tk/{label,radiobutton}.rb: removed its own
-	  {variable,textvariable} function.
+Mon Nov 30 08:44:29 2015  Eric Wong  <e@80x24.org>
 
-	* ext/tk/lib/tk/variable.rb: retains backward conpatibility.
+	* variable.c: remove spurious #define for globals
+	  [ruby-core:71735] [Feature #11749]
 
-Fri Aug  5 12:50:32 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Sun Nov 29 09:13:03 2015  Conor Landry  <clandry94@gmail.com>
 
-	* ext/tcltklib/tcltklib.c: fixed memory leak when tk_funcall raised
-	  exception. (copies argv into heap in tk_funcall instead of
-	  caller)
+	* NEWS: [DOC] Various grammar corrections and clarifications to
+	  increase readability.  [Fix GH-1115]
 
-Fri Aug  5 12:42:57 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+Sat Nov 28 19:33:55 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/mkmf.rb (create_makefile): need to convert path separetor
-	  before invoking install command.
+	* parse.y (parser_here_document): store dispatched result of
+	  on_tstring_content at the last fragment of a here document.
 
-Fri Aug  5 00:27:04 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Fri Nov 27 19:19:44 2015  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/tcltklib/tcltklib.c: refactoring - extract ruby string <->
-	  tcl object conversion as get_str_from_obj and get_obj_from_str.
+	* lib/net/http.rb (connect): detect closed connection and reconnect
+	  If the server closes a keep-alive http connection, the client socket
+	  reaches EOF. To avoid an EOFError, detect the closed connection and
+	  reconnect.
+	  Added test to ensure HTTP#post succeeds even if the
+	  keep-alive-connection has been closed by the server.
+	  by Kristian Hanekamp <kris.hanekamp@gmail.com>
+	  https://github.com/ruby/ruby/pull/1089 fix GH-1089
 
-Fri Aug  5 00:19:33 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Nov 26 21:36:40 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* extmk.rb (extmake): needs to be wrapped in an Array.
+	* compile.c (iseq_peephole_optimize): enable tail call
+	  optimization for specialized indexers.
 
-Thu Aug  4 18:38:36 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* compile.c (iseq_compile_each): blockiseq should be NULL, but not
+	  Qnil.
 
-	* ext/tcltklib/tcltklib.c: cannot compile for Tcl7.6/Tk4.2.
+Thu Nov 26 17:22:53 2015  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/tcltklib/tcltklib.c: add nativethread consistency check.
+	* regcomp.c, regenc.c, regexec.c, regint.h, enc/unicode.c:
+	  Merge Onigmo 58fa099ed1a34367de67fb3d06dd48d076839692
+	  + https://github.com/k-takata/Onigmo/pull/52
 
-	* ext/tcltklib/stubs.c: ditto.
+Thu Nov 26 09:50:02 2015  yui-knk  <spiketeika@gmail.com>
 
-	* ext/tk/lib/tk.rb: forgot to define TclTkIp.encoding and encoding=
-	  when Tcl is 7.6 or 8.0.
+	* test/coverage/test_coverage.rb: Added test-case for Coverage.restart.
+	  [Misc #11732][ruby-dev:49379]
 
-	* ext/tk/lib/tk/wm.rb: support to make some methods as options of
-	  root or toplevel widget. [ruby-talk:150336]
+Thu Nov 26 09:46:36 2015  yui-knk  <spiketeika@gmail.com>
 
-	* ext/tk/lib/tk/root.rb: ditto.
+	* test/coverage/test_coverage.rb: Added test-case for Coverage.peek_result
+	  without Coverage.start. [Misc #11726][ruby-core:71622]
 
-	* ext/tk/lib/tk/toplevel.rb: ditto.
+Thu Nov 26 07:22:55 2015  Eric Wong  <e@80x24.org>
 
-	* ext/tk/lib/tkextlib/SUPPRT_STATUS: update RELEASE_DATE
+	* test/openssl/test_ssl.rb (test_copy_stream): new test
 
-Thu Aug  4 08:03:39 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Nov 25 21:23:39 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/extmk.rb (extmake): should not modify $mflags for each
-	  extentions.
+	* io.c (copy_stream_body): try to_io conversion before read,
+	  readpartial, and write methods.  [ruby-dev:49008] [Bug #11199]
 
-Thu Aug  4 00:25:48 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Nov 25 10:55:21 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* common.mk, Makefile.in, {bcc32,win32,wince}/Makefile.sub: integrated
-	  macro definitions.
+	* io.c (argf_getpartial): should not resize str if the second
+	  argument is not given.
+	  [ruby-core:71668] [Bug #11738]
 
-	* bcc32/Makefile.sub: LIBRUBY_SO should use DLDOBJS, not EXTOBJS.
+Tue Nov 24 23:56:25 2015  Naohisa Goto  <ngotogenome@gmail.com>
 
-	* {win32,wince}/Makefile.sub: separate config.h for compiler versions.
+	* configure.in: On Solaris, it is safe to define _LARGEFILE_SOURCE
+	  when _FILE_OFFSET_BITS=64 is defined (= when 32-bit compile).
 
-Wed Aug  3 21:59:16 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Tue Nov 24 10:00:10 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* ext/tk/lib/tk/variable.rb: TkVariable#trace didn't work on
-	  TkVariable retrived from TkVariable.new_hash.ref. [ruby-dev:26721]
+	* lib/rubygems/installer.rb: Fix two double-word typos.
+	  [ci skip][fix GH-1108] Patch by @jwworth
 
-Wed Aug  3 08:22:13 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Tue Nov 24 09:17:02 2015  Alexander von Gluck IV  <kallisti5@unixzen.com>
 
-	* ext/socket/socket.c (ruby_connect): revert [ruby-talk:111654]
-	  changes at 2004-09-07.  [ruby-dev:26656]
+	* beos: Drop support for BeOS now that Haiku is stable.
+	  [Fix GH-1112]
 
-Tue Aug  2 10:20:54 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Tue Nov 24 09:16:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tcltklib/tcltklib.c: use Tcl_[GS]etVar2Ex instead of
-	  Tcl_Obj[GS]etVar2. (avoid Tcl_NewStringObj on supported platforms)
+	* internal.h (rb_gc_for_fd): move to export, as referred by
+	  ext/socket.
 
-	* ext/tcltklib/tcltklib.c: use ip_{get,set,unset}_variable2_core from
-	  ip_{get,set,unset}_variable.
+Tue Nov 24 09:04:29 2015  David Rodriguez  <deivid.rodriguez@gmail.com>
 
-	* ext/tcltklib/tcltklib.c: replaced Tcl_Panic with rb_bug.
+	* file.c: [DOC] add a missing period to File docs, to terminate
+	  the sentence and separate from the next sentence.  [Fix GH-1111]
 
-Tue Aug  2 01:41:28 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Tue Nov 24 08:30:06 2015  JuanitoFatas  <katehuang0320@gmail.com>
 
-	* lib/ping.rb (Ping.pingecho): should rescue StandardError.
-	  [ruby-dev:26677]
+	* NEWS: Fix the issue number of `Struct#dig`, which should be
+	  [Feature #11688].  [Fix GH-1110]
 
-Mon Aug  1 19:09:41 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Tue Nov 24 07:56:54 2015  Eric Wong  <e@80x24.org>
 
-	* ext/tcltklib/tcltklib.c: refactoring - replaced rb_ivar_defined &
-	  rb_ivar_get with single rb_attr_get call.
+	* ext/socket/init.c (rsock_s_accept): handle ENOMEM
 
-Mon Aug  1 18:45:07 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Tue Nov 24 07:50:15 2015  Eric Wong  <e@80x24.org>
 
-	* ext/tcltklib/tcltklib.c (Tcl_GetStringResult): refactoring - define
-	  alternative macro on Tcl7.x or earlier.
+	* dir.c (dir_initialize): use rb_gc_for_fd for ENOMEM
+	* ext/socket/init.c (rsock_socket): ditto
+	* ext/socket/socket.c (rsock_socketpair): ditto
+	* internal.h (rb_gc_for_fd): prototype
+	* io.c (rb_gc_for_fd): remove static
+	  [ruby-core:71623] [Feature #11727]
 
-Mon Aug  1 13:57:35 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Tue Nov 24 06:46:27 2015  Eric Wong  <e@80x24.org>
 
-	* ext/tcltklib/tcltklib.c (deleted_ip): refactoring - interpreter
-	  deletion check. [ruby-dev:26664]
+	* io.c (rb_gc_for_fd): new helper function
+	  (ruby_dup): use rb_gc_for_fd
+	  (rb_sysopen): ditto
+	  (rb_fdopen): ditto
+	  (rb_pipe): ditto
+	  [ruby-core:71623] [Feature #11727]
 
-Mon Aug  1 01:17:40 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+Tue Nov 24 05:13:35 2015  Eric Wong  <e@80x24.org>
 
-	* lib/drb/drb.rb (check_insecure_method): use private_methods and
-	  protected_methods instead of respond_to? to check method visibility.
-	  [ruby-dev:26616]
+	* ext/fiddle/function.c (struct nogvl_ffi_call_args):
+	  new struct for GVL release
+	  (nogvl_ffi_call): new function
+	  (function_call): adjust for GVL release
+	  [ruby-core:71642] [Feature #11607]
+	* ext/fiddle/closure.c (struct callback_args):
+	  new struct for GVL acquire
+	  (with_gvl_callback): adjusted original callback function
+	  (callback): wrapper for conditional GVL acquire
+	* ext/fiddle/depend: add dependencies
+	* ext/fiddle/extconf.rb: include top_srcdir for internal.h
+	* internal.h (ruby_thread_has_gvl_p): expose for fiddle
+	* vm_core.h (ruby_thread_has_gvl_p): moved to internal.h
+	* test/fiddle/test_function.rb (test_nogvl_poll): new test
 
-	* test/drb/drbtest.rb: ditto.
+Mon Nov 23 19:53:12 2015  Naohisa Goto  <ngotogenome@gmail.com>
 
-	* test/drb/ut_drb.rb: ditto.
+	* configure.in: On Solaris, with gcc, "-std=iso9899:1999"
+	  in $ansi_options is often also needed in CPPFLAGS,
+	  because some feature definitions vary depending on such
+	  standards options.
 
-Mon Aug  1 00:07:32 2005  Keiju Ishitsuka  <keiju@ruby-lang.org>
-	* lib/irb/context.rb: fix `irb --readline` option. [ruby-list:40955]
+Mon Nov 23 12:54:39 2015  Hamish Morrison  <hamishm53@gmail.com>
 
-Fri Jul 29 09:59:38 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* configure.in: remove obsolete workarounds for Haiku.
 
-	* eval.c (rb_yield_0): push yielded node instead of yielding.
-	  fixed: [yarv-dev:549]
+	* dln.c, file.c, io.c: remove obsolete Haiku workarounds.
 
-Thu Jul 28 18:09:55 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* thread_pthread.c: add stack bounds detection for Haiku.
 
-	* ext/tcltklib/stubs.c: When --enable-tcltk-stubs, the initialize
-	  routine creates a Tcl/Tk interpreter and deletes it. However,
-	  init cost of Tk's MainWindow is not so small. And that makes it
-	  impossible to use libraries written with Tcl functions only on
-	  an environment without a graphical display. This changes support
-	  delaying initalization of Tk_Stubs until the script needs Tk.
+	* signal.c: get stack pointer from signal context on Haiku.
+	  [ruby-core:67923] [Bug #10811] [Fix GH-1109]
 
-	* ext/tcltklib/stubs.h: New file. Define prototypes and return
-	  codes of functions on stubs.c.
+Mon Nov 23 11:44:11 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* ext/tcltklib/tcltklib.c: Support delaying initalization of
-	  Tk_Stubs until the script needs Tk.
+	* gems/bundled_gems: bump version to minitest-5.8.3
 
-	* ext/tcltklib/tcltklib.c: Show friendly error messages for errors
-	  on initialization.
+Mon Nov 23 08:55:00 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* ext/tcltklib/tcltklib.c: Avoid SEGV on ip_finalize() when ruby is
-	  exiting and $DEBUG is true. (Not fix. If you know the reason of
-	  why, please fix it.)
+	* ChangeLog: fix wrong reference for r52714
 
-	* ext/tk/tkutil.c (ary2list, ary2list2): bug fix on handling of
-	  encoding.
+Sun Nov 22 22:23:37 2015  Rei Odaira  <Rei.Odaira@gmail.com>
 
-	* ext/tk/lib/multi-tk.rb: MultiTkIp#eval_string and bg_eval_string
-	  don't work propery.
+	* gc.c (rb_raw_obj_info): fix compile errors when USE_RGENGC
+	  is 0.
 
-	* ext/tk/lib/tk.rb: Forget extending Tk::Encoding module to Tk.
-	* ext/tk/lib/tk/variable.rb: TkVarAccess fails to initialize the
-	  object for an element of a Tcl's array variable.
+Sun Nov 22 21:58:09 2015  Naohisa Goto  <ngotogenome@gmail.com>
 
-Wed Jul 27 23:23:54 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/cmath.rb: methods which has suffix '!' are now deprecated.
+	  Re-apply r52469 made by Kazuki Tanaka, with fixing bug about
+	  mathn.rb compatibility. [ruby-core:68528] [Feature #10974]
 
-	* gc.c (obj_free): make message format consistent with one from
-	  gc_mark().  [ruby-talk:149668]
+Sun Nov 22 19:36:51 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Wed Jul 27 22:11:37 2005  Kouhei Sutou  <kou@cozmixng.org>
+	* ext/openssl/ossl.c: fix brew command for installation of openssl.
+	  [ci skip][fix GH-1107] Patch by @arthurnn
 
-	* sample/rss/tdiary_plugin: removed. because the plugin
-	  is imported in the tDiary plugin packages.
+Sun Nov 22 17:59:50 2015  Naohisa Goto  <ngotogenome@gmail.com>
 
-Wed Jul 27 10:59:02 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* configure.in: On Solaris, add -D_XOPEN_SOURCE=n only when both
+	  AC_TRY_CPP and AC_TRY_COMPILE pass, because some options
+	  (e.g. -std=iso9899:1999) are not set when running C preprocessor
+	  or building ext.
 
-	* dir.c (dir_each): rewinddir(3) before iteration.
-	  [ruby-talk:149628]
+Sun Nov 22 16:53:34 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Jul 26 12:57:49 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* compile.c (iseq_peephole_optimize): remove unreachable code
+	  chunk after jump/leave.
 
-	* ext/openssl/openssl_missin.c: include <openssl/engine.h> before
-	  <openssl/x509_vfy.h> to avoid compilation error of mswin32.
-	  suggested by NAKAMURA Usaku.
+	* parse.y: move dead code elimination of logical operation to
+	  compile.c.  not to warn logical operation of literal constants.
 
-Mon Jul 25 21:30:46 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sun Nov 22 16:37:10 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* {bcc32,win32,wince}/Makefile.sub: moved CPPFLAGS only for ruby
-	  source to XCFLAGS.
+	* compile.c (iseq_peephole_optimize): eliminate always/never
+	  branches after a literal object and when the value is used after
+	  the branch.
 
-Mon Jul 25 13:45:18 2005  NAJIMA Hiroki  <najima@mickey.ai.kyutech.ac.jp>
+Sun Nov 22 01:23:43 2015  Naohisa Goto  <ngotogenome@gmail.com>
 
-	* io.c: check HAVE_SYS_IOCTL_H before including the header.
-	  [ruby-dev:26610]
+	* configure.in: Add -D_XOPEN_SOURCE=500 (or 600 or 700) on Solaris
+	  if available, mainly for enabling some features in sockets.
 
-Mon Jul 25 14:10:02 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Sun Nov 22 00:17:22 2015  Naohisa Goto  <ngotogenome@gmail.com>
 
-	* ext/tk/lib/multi-tk.rb: fix en-bugged part in the last commit.
+	* test/socket/test_socket.rb (test/socket/test_socket.rb): skip
+	  the test when Socket::SO_TIMESTAMP is not defined. Fix error
+	  on Solaris 10. [Bug #11728] [ruby-dev:49377]
 
-Sat Jul 23 16:49:04 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Sat Nov 21 18:57:28 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/openssl/ossl_engine.c (ossl_engine_s_load): should check
-	  OPENSSL_NO_STATIC_ENGINE.
+	* ruby.c (need_argument): move frozen-string-literal-debug option
+	  from --enable to --debug.  [Feature #11725]
 
-Fri Jul 22 21:06:08 2005  Tadashi Saito  <shiba@mail2.accsnet.ne.jp>
+	* ruby.c (proc_options): fix pointer overrun. do not advance argv
+	  until it is valid.
 
-	* bignum.c (rb_big_eq): reduce isnan().  [ruby-dev:26600]
+Sat Nov 21 13:59:09 2015  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* numeric.c (flo_eq, flo_gt, flo_ge, flo_lt, flo_le): ditto.
+	* ext/digest/sha1/extconf.rb: OpenSSL's struct name for SHA1 is
+	  SHA_CTX. http://openssl.org/docs/man0.9.8/crypto/SHA1.html
 
-Fri Jul 22 15:02:39 2005  Kouhei Sutou  <kou@cozmixng.org>
+Sat Nov 21 13:31:52 2015  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/rss/rss.rb: moved copyright description to lib/rss.rb.
+	* ext/digest/*/*.[ch]: include ruby.h before digest.h to avoid
+	  including ext/digest/extconf.h. [Bug #3231]
+	  https://msdn.microsoft.com/library/36k2cdd4.aspx
 
-	* lib/rss.rb: added for convenience.
+	* ext/digest/*/extconf.rb: remove ext/digest from include search path
+	  to avoid confusion of cl.exe.
 
-	* sample/rss/re_read.rb: added #to_s sample.
+	* ext/digest/*/*.[ch]: explicitly specify def.h's path.
 
-	* sample/rss/blend.rb: use 'require "rss"' instead of
-	  'require "rss/*"'.
-	* sample/rss/list_description.rb: ditto.
-	* sample/rss/rss_recent.rb: ditto.
-	* sample/rss/tdiary-plugin/rss-recent.rb: ditto.
+Sat Nov 21 13:05:16 2015  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* sample/rss/tdiary-plugin/rss-recent.rb: 0.0.6 -> 0.0.7.
+	* ext/openssl/ossl.h: LibreSSL doesn't have and need e_os2.h.
 
-Fri Jul 22 14:37:43 2005  Kouhei Sutou  <kou@cozmixng.org>
+Sat Nov 21 09:18:10 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/rss/parser.rb (RSS::Parser#initialize): accept HTTP/FTP
-	  URI and local file path too.
+	* thread_sync.c: reduce the specification of Queue#close.
+	  * Queue#close accepts no arguments.
+	  * deq'ing on closed queue returns nil, always.
+	  [Feature #10600]
 
-	* test/rss/test_parser.rb (RSS::TestParser#test_parse): test
-	  for the above.
+	* test/thread/test_queue.rb: catch up this fix.
 
-Fri Jul 22 07:01:42 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Sat Nov 21 08:44:21 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/tk/tkutil.c (tk_conv_args): forget to revert thread_critical
-	  and gc_disable when raise ArgumentError.
+	* compile.c (iseq_compile_each): add debug information to NODE_STR
+	  strings as default.
+	  [Feature #11725]
 
-	* ext/tk/lib/remote-tk.rb: RemoteTkIp doesn't need to include TkUtil.
+	* insns.def (freezestring): add new instruction to support adding
+	  debug information for dynamically constructed strings.
 
-	* ext/tcltklib/tcltklib.c: add TclTkIp#has_mainwindow? method.
+	* compile.c (iseq_compile_each): support adding debug information
+	  for NODE_DSTR with freezestring instruction.
 
-	* ext/tk/lib/tk.rb: add Tk.has_mainwindow? method.
+	* error.c (rb_error_frozen): change the debug information ID name
+	  id_debug_created_info and this field should have a 2 element array
+	  containing path and line information.
 
-	* ext/tk/lib/multi-tk.rb: add MultiTkIp#has_mainwindow? method.
+	* defs/id.def: ditto.
 
-	* ext/tk/lib/remote-tk.rb: add RemoteTkIp#has_mainwindow? method.
+	* test/ruby/test_rubyoptions.rb: catch up this fix.
 
-	* ext/tk/lib/multi-tk.rb: slave IP fail to exit itself when $SAFE==4.
+	* test/ruby/test_iseq.rb: now frozen strings are not same.
 
-	* ext/tk/lib/multi-tk.rb: remove constants from MultiTkIp module to
-	  avoid access from external.
+Sat Nov 21 04:34:16 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/lib/multi-tk.rb: check_root flag is ignored on slave IPs'
-	  mainloop.
+	* symbol.c (rb_str_intern): should not freeze the receiver itself
+	  unexpectedly.  [ruby-core:71611] [Bug #11721]
 
-	* ext/tk/lib/multi-tk.rb: hang-up Tk.mainloop called on a slave IP
-	  with $SAFE==4.
+Fri Nov 20 23:15:18 2015  Naotoshi Seo  <sonots@gmail.com>
 
-	* ext/tk/lib/multi-tk.rb: MultiTkIp#bg_eval_proc doesn't work
-	  properly.
+	* lib/logger.rb: expose logger mutex
+	  [fix GH-541] Patch by @arthurnn
 
-	* ext/tk/lib/multi-tk.rb: add MultiTkIp#set_cb_error(proc) and
-	  cb_error(exc) to log errors at callbacks on safe slave IPs.
+Fri Nov 20 15:05:28 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* ext/tk/lib/multi-tk.rb: fail to get an available slave IP object
-	  when call Tk.mainloop in the block which is given to new_* method,
-	    because cannot finish initialize while the root widget is alive.
+	* Added missing reference of GitHub
 
-	* ext/tk/lib/multi-tk.rb: fail to control a slave IP when Tk.mainloop
-	  runs on the IP.
+Fri Nov 20 14:57:01 2015  Trevor Rowe  <trevorrowe@gmail.com>
 
-Wed Jul 20 19:20:37 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* lib/net/http.rb: Fixed regression for Net::HTTP::PUT with "Expect-100"
+	  header. [fix GH-949]
+	* test/net/http/test_http.rb: added test.
 
-	* io.c (S_ISREG): need to define S_ISREG before it is used first.
+Fri Nov 20 14:39:56 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Wed Jul 20 18:40:50 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* lib/net/http.rb: set hostname before call ossl_ssl_set_session.
+	  [Bug #11401][ruby-core:70152][fix GH-964] Patch by @mkarnebeek
 
-	* io.c (wsplit_p): patch for the environment where
-	  fcntl(F_GETFL, O_NONBLOCK) is not supported. in that case,
-	  set FMODE_WSPLIT without fcntl check. [ruby-dev:26566]
+Fri Nov 20 12:53:19 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Wed Jul 20 18:07:11 2005  Tanaka Akira  <akr@m17n.org>
+	* array.c: clarify docs for take_while/drop_while samples.
+	  [ci skip][fix GH-1028] Patch by @leriksen
 
-	* io.c (rb_io_ctl): update FMODE_WSPLIT_INITIALIZED and FMODE_WSPLIT
-	  by F_SETFL.
+Fri Nov 20 12:48:04 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Wed Jul 20 10:04:51 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/socket/socket.c: remove mention of :UNIX in getaddrinfo().
+	  It's typically not a support option.
+	  [ci skip][fix GH-990] Patch by @eam
 
-	* variable.c (rb_class_path): need to adjust snprintf() len for
-	  teminating NUL.  [ruby-dev:26581]
+Fri Nov 20 12:44:06 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Wed Jul 20 04:01:55 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* lib/rss/syndication.rb: Add nodoc marker for #validate_sy_updatePeriod.
+	  [ci skip][fix GH-1105] Patch by @davydovanton
 
-	* ext/socket/socket.c: sorry, BeOS also uses HAVE_CLOSESOCKET,
-	  so reverted.
+Fri Nov 20 09:05:21 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/socket/extconf.rb: should not define HAVE_CLOSESOCKET
-	  on windows.
+	* vm.c (rb_vm_cref_replace_with_duplicated_cref): added.
 
-Wed Jul 20 03:16:43 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	  CREFs should not be shared by methods between `using'.
+	  [Bug #11247]
 
-	* ext/socket/socket.c: should not undef close() on win32.
-	  it's defined to rb_w32_close(), otherwise handle leaks.
-	  [ruby-Bugs-2131]
+	* vm_insnhelper.c (vm_cref_replace_with_duplicated_cref): ditto.
 
-Wed Jul 20 00:48:16 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* vm.c (vm_cref_dup): should copy refinements correctly.
 
-	* error.c (syserr_initialize): don't use str before StringValue()
-	  check.  [ruby-dev:26579]
+	* eval.c: use rb_vm_cref_replace_with_duplicated_cref().
 
-Tue Jul 19 22:47:29 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* eval_intern.h: add a decl. of
+	  rb_vm_cref_replace_with_duplicated_cref().
 
-	* error.c (syserr_initialize): add 1 byte for snprintf() size for
-	  NUL at the end.  [ruby-dev:26574]
+	* vm_eval.c (eval_string_with_cref): do not need to pass
+	  scope's CREF because VM can find out CREF from stack frames.
 
-Tue Jul 19 16:39:46 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/ruby/test_refinement.rb: add a test.
 
-	* io.c (rb_io_inspect): replace sprintf() with "%s" format all
-	  over the place by snprintf() to avoid integer overflow.
+Fri Nov 20 06:52:53 2015  Eric Wong  <e@80x24.org>
 
-Tue Jul 19 14:08:22 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* .gitattributes: new file for git users
+	  [ruby-core:71578] [Feature #11713]
 
-	* ext/tcltklib/tcltklib.c: rbtk_eventloop_depth is used as int.
+Thu Nov 19 22:35:31 2015  Tanaka Akira  <akr@fsij.org>
 
-	* ext/tcltklib/tcltklib.c: rbtk_pending_exception is tested with
-	  NIL_P, so should assign Qnil instead of 0 (Qfalse).
+	* ext/socket/ancdata.c: Check buffer full and ignore MSG_TRUNC flag.
+	  buffer fullness is more robust to detect the message is too big for
+	  the buffer.
+	  AIX 7.1 recvmsg doesn't set MSG_TRUNC for rflags when MSG_PEEK is
+	  given.
 
-	* ext/tcltklib/tcltklib.c (ip_invoke_real): fixed memory leak when
-	  ip is deleted.
+Thu Nov 19 21:55:11 2015  Koichi Sasada  <ko1@atdot.net>
 
-Tue Jul 19 13:19:46 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* gc.c (gc_start): force to invoke GC by GC.start
+	  even if it is GC.disable'd.
 
-	* ext/tk/lib/tk/variable.rb: For symmetry, add TkVariable#string. It
-	  returns a string even if the default value type of the TkVariable
-	  object is not "string".
+	* test/ruby/test_gc.rb: add a test.
 
-Mon Jul 18 21:40:20 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Thu Nov 19 20:08:59 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* eval.c (rb_call0): make the pointer to NODE volatile
-	  instead of NODE itself.
+	* gc.c: trivial performance improvements.
 
-Mon Jul 18 14:32:21 2005  Tanaka Akira  <akr@m17n.org>
+	    name    modified
+	    vm1_gc_short_lived*                1.015
+	    vm1_gc_short_with_complex_long*    1.014
+	    vm1_gc_short_with_long*            1.000
+	    vm1_gc_short_with_symbol*          1.016
+	    vm1_gc_wb_ary*                     1.002
+	    vm1_gc_wb_ary_promoted*            0.996
+	    vm1_gc_wb_obj*                     1.045
+	    vm1_gc_wb_obj_promoted*            1.014
+	    vm3_gc                             1.021
 
-	* eval.c (rb_call0): make body volatile to avoid optimization problem.
-	  [ruby-dev:26195]
+	* gc.c (gc_writebarrier_generational): reorder parameters to optimize
+	  register passing function call.
 
-Mon Jul 18 12:23:27 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* gc.c (gc_writebarrier_incremental): ditto.
 
-	* ext/io/wait/wait.c: wrong backport from trunk.  fixed: [ruby-dev:26562]
+	* gc.c (rb_gc_writebarrier): remove LIKELY().
+	  LIKELY() seems to move related functions not better places.
 
-Mon Jul 18 09:36:25 2005  Tanaka Akira  <akr@m17n.org>
+Thu Nov 19 19:45:05 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* rubyio.h (FMODE_WSPLIT, FMODE_WSPLIT_INITIALIZED): new constant.
+	* ruby.c (ruby_prog_init): [DOC] ARGV does not contain the name of
+	  the executable.  [ruby-core:71561] [Bug #11711]
 
-	* io.c (wsplit_p): new function.
-	  (io_fwrite): split writing data by PIPE_BUF if wsplit_p is true in
-	  multi-threaded mode.
-	  [ruby-dev:26540]
+Thu Nov 19 15:53:21 2015  Koichi Sasada  <ko1@atdot.net>
 
-Sun Jul 17 13:46:54 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* signal.c: should also clear ruby_disable_gc.
+	  [Bug #11692]
 
-	* ext/io/wait/extconf.rb, ext/io/wait/wait.c: Win32 platforms support.
+Thu Nov 19 15:31:45 2015  Koichi Sasada  <ko1@atdot.net>
 
-Fri Jul 15 23:59:03 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* compile.c (iseq_compile_each): T_IMEMO/iseq objects should be
+	  wrap with ISeq wrappers. [Bug #11676]
 
-	* lib/rdoc/parsers/parse_c.rb (handle_class_module): handle a
-	  module enclosed in a built-in module.  fixed: [ruby-talk:148239]
+Thu Nov 19 15:16:12 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* lib/rdoc/parsers/parse_c.rb (find_body): allow macros as methods.
+	* lib/rubygems: Update to RubyGems 2.5.0+ HEAD(c6b4946).
+	  this version includes #1114, #1314, #1322, #1375, #1383, #1387
+	* test/rubygems: ditto.
 
-	* lib/rdoc/parsers/parse_c.rb (find_call_seq): allow :nodoc: modifier
-	  in C.  [ruby-core:04572]
+Thu Nov 19 14:14:37 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Fri Jul 15 18:00:01 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* win32/win32.c (finish_overlapped_socket): return value of this
+	  function should be only 0 or SOCKET_ERROR.
 
-	* bcc32/Makefile.sub (COMMON_HEADERS): ruby_1_8 is using winsock.h.
-	  failed to compile ext/socket on bcc5.6.4. [ruby-dev:26193]
+Thu Nov 19 14:12:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Jul 15 07:58:56 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* compile.c (iseq_tailcall_optimize): apply tail call optimization
+	  before conversion to specialized instructions.  when looking
+	  back from `leave` instruction, `send` instructions have been
+	  translated already.
 
-	* lib/webrick/server.rb (WEBrick::GenericServer#accept_client):
-	  sockets should be non-blocking mode. [ruby-dev:26405]
+Thu Nov 19 13:57:58 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/webrick/utils.rb (WEBrick::Utils.set_non_blocking): new method.
+	* win32/win32.c (finish_overlapped_socket): ignore EMSGSIZE when input,
+	  because POSIX platforms just do so.  fixes test errors revealed by
+	  r52647.
 
-	* lib/webrick/httprequest.rb (WEBrick::HTTPRequest#read_chunked):
-	  should call sock.read repeatedly until the preferred size data
-	  is obtained.
+Thu Nov 19 02:52:30 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Thu Jul 14 18:27:16 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* ext/socket/ancdata.c (bsock_recvmsg_internal): stretch the buffer size
+	  only when vmaxdatlen is nil.
 
-	* win32/win32.c (rb_w32_strerror): should return correct message
-	  for ENAMETOOLONG and ENOTEMPTY. (bcc32) [ruby-dev:26533]
+Thu Nov 19 02:20:11 2015  Tanaka Akira  <akr@fsij.org>
 
-	* win32/win32.c (rb_w32_strerror): stripped CR LF on the tail.
-	  (bcc32) [ruby-dev:26533]
+	* test/socket/test_socket.rb (test_udp_recvmsg_truncation): rflags is
+	  nil on Solaris 10 which have no HAVE_STRUCT_MSGHDR_MSG_CONTROL.
+	  Reported by Naohisa Goto. [ruby-core:71557] [Bug #11709]
 
-Thu Jul 14 00:45:42 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Nov 19 01:48:05 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* LEGAL (ext/nkf/nkf-utf8): updated from nkf1.7 to nkf-utf8.
+	* configure.in: add -static-libgcc for mingw automatically if available.
 
-Wed Jul 13 19:37:47 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Thu Nov 19 00:53:26 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* win32/win32.c (rb_w32_mkdir): should set EEXIST (not EACCES)
-	  if file or directory already exists. (bcc32) [ruby-dev:26508]
+	* ext/extmk.rb (--extflags): new option to pass EXTLDFLAGS to children,
+	  especially exts.mk.
 
-	* win32/win32.c (rb_w32_rmdir): should set ENOTDIR (not EINVAL)
-	  if it is not directory. (bcc32, win32)
+	* common.mk (EXTMK_ARGS): use above option.
 
-	* win32/win32.c (rb_w32_rmdir, rb_w32_unlink): restore
-	  FILE_ATTRIBUTE_READONLY flag on function failure.
+Wed Nov 18 22:50:43 2015  Koichi Sasada  <ko1@atdot.net>
 
-Wed Jul 13 12:40:00 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* vm_method.c (rb_class_clear_method_cache): should clear all
+	  RCLASS_CALLABLE_M_TBLs of all sub-classes (T_ICLASS).
 
-	* ext/tcltklib/tcltklib.c: TclTkLib.do_one_event doesn't work.
+	  RCLASS_CALLABLE_M_TBL() caches complemented method entries.
+	  It should be cleared when the modules are cleared.
+	  On previous version clears only for direct children.
+	  It is enough for normal modules because corresponding T_ICLASSes
+	  are direct children.
 
-	* ext/tk/lib/tk.rb: Tk.thread_update is available.
+	  However, refinements create complex data structure. So that
+	  we need to clear all children (and descendants).
+	  [ruby-core:71423] [Bug #11672]
 
-Tue Jul 12 23:32:11 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* vm_method.c (rb_clear_method_cache_by_class): rb_mKernel
+	  doesn't call rb_class_clear_method_cache, so that
+	  clear child T_ICLASSes.
 
-	* lib/mkmf.rb: keep curdir unexpanded.
+	* test/ruby/test_refinement.rb: enable disabled test.
 
-Mon Jul 11 08:31:29 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Nov 18 21:09:08 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* regex.c (read_special): fix parsing backslashes following \c in
-	  regexp.  fixed: [ruby-dev:26500]
+	* vm_method.c (prepare_callable_method_entry): use
+	  RCLASS_CALLABLE_M_TBL() instead of accessing a filed directly.
 
-Mon Jul 11 02:53:00 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Wed Nov 18 17:08:18 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/webrick/cgi.rb (WEBrick::CGI::Socket#request_line):
-	  mistook in merging the patch of [ruby-dev:26235] at
-	  revision 1.4.2.6.
+	* method.h: introduce the following field and macros.
 
-Sun Jul 10 23:58:04 2005  Tanaka Akira  <akr@m17n.org>
+	  * rb_method_definition_t::complemented_count to count shared method
+	    entries because of complemented method entries and separate from
+	    alias_count.
 
-	* lib/pathname.rb (Pathname#unlink): try Dir.unlink first to
-	  avoid unlink a directory by root.
-	  cf. [ruby-dev:26237]
+	    Shared `def' only by complemented method entries should not prevent
+	    method re-definition warning.
 
-Sun Jul 11 05:18:17 2005  Michael Neumann  <mneumann@ruby-lang.org>
+	  * METHOD_ENTRY_COMPLEMENTED(me) to represent complemented method entry.
+	  * METHOD_ENTRY_COMPLEMENTED_SET(me) to check it as  complemented me.
 
-	* lib/xmlrpc/server.rb (XMLRPC::Server): Switch from GServer over to
-	  WEBrick. This makes file lib/xmlrpc/httpserver.rb obsolete (at least it is
-		no further used by the XML-RPC library).
+	* vm_insnhelper.c (aliased_callable_method_entry): should also
+	  check me->def->complemented_count.
 
-Sun Jul 10 12:47:01 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* vm_method.c (method_definition_addref_complement): add to count
+	  complemented method entries number.
 
-	* lib/debug.rb (debug_command): added a deficient format specifier.
-	  fixed: [ruby-core:05419]
+	* vm_method.c (rb_method_definition_release): release `def' iff
+	  alias_count == 0 and complemented_count == 0.
 
-Sat Jul  9 21:28:46 2005  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
+	* test/ruby/test_module.rb: add a test.
 
-	* ext/win32ole/win32ole.c (ole_method_dispid): convert dispid
-	  in Ruby and C by INT2NUM and NUM2INT.
+Wed Nov 18 17:06:19 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/win32ole/win32ole.c (ole_invoke2): ditto.
+	* gc.c (rb_raw_obj_info): fix trivial issues.
 
-	* ext/win32ole/test/testWIN32OLE.rb: ditto.
+	  * support SPECIAL_CONSTs.
+	  * fix IMEMO/ment outputs.
 
-	* ext/win32ole/test/testOLEMETHOD.rb: ditto.
+Wed Nov 18 11:32:15 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Jul  8 15:45:04 2005  Kouhei Sutou  <kou@cozmixng.org>
-
-	* lib/rss/rss.rb (RSS::VERSION): 0.1.4 -> 0.1.5.
-
-	* test/rss/test_version.rb (RSS::TestVersion#test_version):
-	  ditto.
-
-	* lib/rss/0.9.rb (RSS::Rss::Channel::Item::Category):
-	  domain attribute of <category> is optional. Thanks to
-	  Chris Lee <clee@kde.org>.
-
-	* test/rss/test_parser.rb (RSS::TestParser#test_category20):
-	  adjusted test case.
-
-Tue Jul  5 23:44:06 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* instruby.rb: expand source library path.
-
-Tue Jul  5 23:27:14 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* array.c (sort_2): get rid of yet another bcc's bug.
-	  fixed: [ruby-core:05152]
-
-	* eval.c (rb_thread_save_context): must not switch contexts during
-	  re-allocating stack.  fixed: [ruby-core:05219]
-
-Tue Jul  5 15:15:10 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/tkutil.c: fix typo.
-
-Tue Jul  5 14:51:35 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tcltklib/tcltklib.c: bug fix on treating Unicode strings.
-
-	* ext/tcltklib/tcltklib.c: add methods to treat encoding mode.
-
-	* ext/tcltklib/MANUAL.eng: add description of TclTkLib#encoding,
-	  encoding_system, and so on.
-
-	* ext/tcltklib/MANUAL.euc: ditto.
-
-	* ext/tk/tkutil.c: fail to create a Tcl's list string from an
-	  array including multiple kind of encoded strings.
-
-	* ext/tk/lib/tk.rb: ditto.
-
-	* ext/tk/lib/multi-tk.rb: 2nd arg of _{to|from}UTF8 is omissible.
-
-	* ext/tk/lib/remote-tk.rb: ditto.
-
-	* ext/tk/lib/tk.rb: override TclTkLib#encoding and encoding= to
-	  use TkCore::INTERP.encoding and encoding=.
-
-	* ext/tk/lib/tk.rb: when "require 'tk'" and $KCODE=='NONE', check
-	  DEFAULT_TK_ENCODING to decide Ruby/Tk's system encoding mode.
-
-	* ext/tk/lib/tk/encodedstr.rb: check both of Tk.encoding and
-	  Tk.encoding_system. Tk.encoding has higher priority.
-
-	* ext/tk/lib/tk/optiondb.rb: ditto.
-
-	* ext/tk/lib/tk/spinbox.rb: ditto.
-
-	* ext/tk/lib/tk/validation.rb: ditto.
-
-	* ext/tk/lib/tk/namespace.rb: arguemnts for TclTkIp#_merge_tklist
-	  should be UTF-8 strings.
-
-Mon Jul  4 14:35:52 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* sample/svr.rb: service can be stopped by ill-behaved client; use
-	  tsvr.rb instead.
-
-Mon Jul  4 13:25:21 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* missing/erf.c: original erf.c by prof. Okumura is confirmed to
-	  be public domain.  reverted BSD implementation.
-
-Mon Jul  4 11:15:37 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* test/{dbm,gdbm,sdbm}/test_{dbm,gdbm,sdbm}.rb: skip some tests
-	  which using fork on fork-less platforms.
-
-Sun Jul  3 23:26:30 2005  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* test/wsdl/document/test_rpc.rb: compare formatted time string of
-	  Time objects instead of comparing Time objects itself to avoid
-	  unintended conflict of usec part.  [ruby-dev:26220]
-
-Sat Jul  2 22:41:04 2005  Tanaka Akira  <akr@m17n.org>
-
-	* ext/socket/socket.c (unix_send_io, unix_recv_io): support x86-64 and
-	  IA64.
-
-Sat Jul  2 17:06:23 2005  Tanaka Akira  <akr@m17n.org>
-
-	* defines.h (FLUSH_REGISTER_WINDOWS): defined for IA64.
-	  (flush_register_windows): declare flush_register_windows.
-
-	* eval.c (flush_register_windows): new function.
-
-Fri Jul  1 17:48:52 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* bignum.c (get2comp): revert all prior changes, and calculate
-	  proper 2's complement for negative numbers.  backported from
-	  HEAD.
-
-Fri Jul  1 15:50:12 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* missing/erf.c: need to include some headers for some platforms.
-
-	* win32/win32.h (copysign, scalb): define for compatibility with
-	  other platforms. [ruby-dev:26430]
-
-Fri Jul  1 15:37:42 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* missing/crypt.c: modified to make it compilable on platforms
-	  other than BSD.  [ruby-dev:26430]
-
-	* missing/erf.c: ditto.  code from <exp.c> merged.
-
-Fri Jul  1 12:44:56 2005  Tanaka Akira  <akr@m17n.org>
-
-	* lib/open-uri.rb (OpenURI.open_http): refine post_connection_check
-	  call.
-
-Fri Jul  1 11:34:08 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* missing/crypt.c: replaced with 4.4BSD version.
-
-	* missing/erf.c: ditto.
-
-	* missing/vsnprintf.c: removed the third provision from the old
-	  BSD license.  [ruby-core:05177]
-
-Fri Jul  1 01:45:21 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* enum.c (enum_min, enum_max): must not return Qundef.
-	  fixed: [ruby-core:05299]
-
-Fri Jul  1 00:18:40 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/delegate.rb (Delegator::respond_to): respond_to? must check
-	  destination object.  [ruby-talk:146894]
-
-Thu Jun 30 19:00:21 2005  Keiju Ishitsuka  <keiju@ruby-lang.org>
-	* lib/irb/ruby-lex.rb (RubyLex::identify_number): alternative implements
-	  for [ruby-dev:26410]. And support a numeric form of 0d99999.
-
-Thu Jun 30 17:28:10 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/irb/ruby-lex.rb (RubyLex::identify_number): should not treat
-	  plain zero as an octal number.  [ruby-dev:26410]
-
-Thu Jun 30 15:13:16 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_eval): pre-evaluate argument for unambiguous
-	  evaluation order.  [ruby-dev:26383]
-
-Thu Jun 30 09:53:56 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/delegate.rb (Delegator::method_missing): forward unknown
-	  method to the destination.  suggested by
-	  <christophe.poucet@gmail.com>.  [ruby-talk:146776]
-
-Tue Jun 28 21:59:29 2005  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
-
-	* dir.c, eval.c, hash.c, process.c, ruby.c: avoid warning "unused
-	  variable" [ruby-dev:26387]
-
-Sat Jun 25 17:15:23 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/httputils.rb (WEBrick::HTTPUtils.parse_query): should
-	  discard if key=val pair is empty. patch from Gary Wright.
-
-Sat Jun 25 23:30:51 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* process.c (detach_process_watcher): terminate process watcher
-	  thread right after rb_waitpid() succeed.  [ruby-talk:146430]
-
-Sat Jun 25 15:49:18 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* enum.c (enum_min, enum_max): do not ignore nil as the first element.
-
-Sat Jun 25 14:40:17 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* ext/sdbm/init.c (fsdbm_select): SDBM#select had returned the array
-	  which contained each elements twice. [ruby-dev:26358]
-
-Fri Jun 25 05:06:47 2005  Michael Neumann  <mneumann@ruby-lang.org>
-
-	* lib/xmlrpc/*, test/xmlrpc/*: backported changes from HEAD into 1.8
-
-Fri Jun 24 17:00:00 2005  Shigeo Kobayashi  <shigeo@tinyforest.jp>
-
-	* ext/bigdecimal/bigdecimal.c: patch from "NATORI Shin"
-	  (u-tokyo.ac.jp) applied to fix rounding bug.
-
-Fri Jun 24 13:06:45 2005  akira yamada  <akira@ruby-lang.org>
-
-	* lib/uri/common.rb, lib/uri/generic.rb: fixed typo in documents and
-	  replaced some existent domain name with "example.com".
-
-Fri Jun 24 12:23:19 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb: fix typo on Tk.grid_propagate.
-
-	* ext/tk/lib/tk.rb: Tk.event_generate and TkWindow#event_generate
-	  accept TkEvent::Event object as context argument.
-
-	* ext/tk/lib/tk/event.rb: add TkEvent::Event#valid_fields and
-	  valid_for_generate to get field parameters of event_generate.
-
-Thu Jun 23 23:55:59 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* runruby.rb: should load built rbconfig.rb.
-
-Thu Jun 23 16:53:15 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk/canvastag.rb: TkcGroup.new cannot include given items.
-	  TkcGroup#exclude calls wrong method.
-	  Add alias TkcGroup#add [ruby-talk:146049].
-
-	* ext/tk/lib/tk/canvas.rb: TkCanvas#dtag and some subcommands of
-	  TkCanvas#addtag fail to treat a TkcTag argument.
-
-	* ext/tk/lib/tk/event.rb: add TkEvent::Event#generate to help to send
-	  current event to other widgets.
-
-Mon Jun 20 18:44:04 2005  Tanaka Akira  <akr@m17n.org>
-
-	* eval.c (FUNCTION_CALL_MAY_RETURN_TWICE): DUMMY_SETJMP is replaced
-	  because setjmp is not enough to fix getcontext and SPARC register
-	  window problem.
-
-Mon Jun 20 16:48:36 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* ext/dbm/dbm.c (fdbm_closed): new method DBM#closed?
-
-	* ext/gdbm/gdbm.c (fgdbm_closed): new method GDBM#closed?
-
-	* ext/sdbm/init.c (fsdbm_closed): new method SDBM#closed?
-
-	* test/dbm/test_dbm.rb, test/gdbm/test_gdbm.rb, test/sdbm/test_sdbm.rb
-	  (teardown): close all db objects before deleting data files.
-
-	* win32/win32.{ch} (unlink): hook runtime function to change
-	  file attribute before unlinking.
-	  fixed: [ruby-dev:26360]
-
-Mon Jun 20 02:15:35 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* gc.c (define_final): document fix: finalizers never get called
-	  before target object is destroyed.
-
-Mon Jun 20 01:26:49 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/openssl_missing.c, ext/openssl/ossl.h,
-	  ext/openssl/ossl_asn1.c, ext/openssl/ossl_bio.c,
-	  ext/openssl/ossl_pkcs12.h, ext/openssl/ossl_x509req.c: avoid
-	  compiler warnings. suggested by Michal Rokos.
-
-Sun Jun 19 14:09:07 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* gc.c (run_final): reduce unnecessary object allocation during
-	  finalization.
-
-	* gc.c (rb_gc_call_finalizer_at_exit): deferred finalizers list should
-	  be cleared before calling them.  fixed: [ruby-talk:145790]
-
-Fri Jun 17 13:01:40 2005  Tanaka Akira  <akr@m17n.org>
-
-	* lib/time.rb (Time.parse): fix previous leap seconds support.
-	  (Time.rfc2822): ditto.
-	  (Time.xmlschema): ditto.
-
-Thu Jun 16 15:06:55 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* ext/tcltklib/tcltklib.c (ip_rb_threadVwaitCommand): Tcl_Release
-	  was missing.
-
-Thu Jun 16 13:34:48 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb: add Tk.getMultiple{Open|Save}File() which return
-	  an Array of selected files.
-
-Thu Jun 16 12:53:24 2005  Tanaka Akira  <akr@m17n.org>
-
-	* lib/time.rb (Time.parse): "Fri Jan  1 08:59:60 +0900 1999" was
-	  parsed as "Fri Jan 01 09:00:00 JST 1999" even on an environment
-	  which supports leap seconds.
-	  (Time.rfc2822): ditto.
-	  (Time.xmlschema): ditto.
-
-Thu Jun 16 08:29:22 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* ext/dl/sym.c (rb_dlsym_call): needs FREE_ARGS before return.
-	  fixed memory leak. [ruby-Bugs-2034]
-
-Wed Jun 15 18:26:39 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb: support "tk inactive" sub-command [for Tcl/Tk8.5a3]
-
-	* ext/tk/lib/tk/namespace.rb: support "namespace path" sub-command and
-	  'namespace ensemble' sub-command [for Tcl/Tk8.5a3]
-
-Tue Jun 14 02:02:43 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/tkutil.c: add TkUtil::CallbackSubst.subst_arg(m, ...) &
-	  _define_attribute_aliases(hash) to get substitution-argument from
-	  attributes (e.g. subst_arg(:x,:y,:num,:button) --> "%x %y %b %b ").
-
-	* ext/tk/lib/tk/event.rb: use _define_attribute_aliases().
-
-Mon Jun 13 13:01:05 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* hash.c (ruby_setenv): fixed SEGV. [ruby-dev:26186]
-
-Mon Jun 13 01:54:20 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* signal.c (sigexit): call rb_thread_signal_exit() instead of
-	  rb_exit().  [ruby-dev:26347]
-
-	* eval.c (rb_thread_signal_exit): a new function to exit on main
-	  thread.
-
-	* eval.c (rb_thread_switch): exit status should be retrieved from
-	  ruby_errinfo.
-
-	* eval.c (rb_f_exit): ensure exit(0) should call
-	  exit(EXIT_SUCCESS).
-
-Mon Jun 13 01:20:02 2005  Tanaka Akira  <akr@m17n.org>
-
-	* eval.c (rb_gc_mark_threads): curr_thread may not be part of the
-	  thread list.  [ruby-dev:26312]
-
-Fri Jun 10 23:35:34 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* missing/mkdir.c: remove. [ruby-core:05177]
-
-Fri Jun 10 22:54:26 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* missing.h: fd_set stuffs need sys/types.h.  fixed: [ruby-core:05179]
-
-Thu Jun  9 23:58:12 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/Win32API/Win32API.c (Win32API_Call): disable global
-	  optimization. fixed: [ruby-core:05143]
-
-Thu Jun  9 23:35:22 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* enum.c (enum_inject): default the result value to Qundef to use
-	  first element as initial value if not given.
-
-Thu Jun  9 19:55:41 2005  Tanaka Akira  <akr@m17n.org>
-
-	* eval.c (ruby_longjmp): new macro to call longjmp, setcontext, etc.
-	  (ruby_setjmp): new macro to call setjmp, getcontext, etc.
-	  (ruby_setjmp): call setjmp before getcontext to avoid IA64 register
-	  stack problem.
-	  [ruby-talk:144939]
-
-	* gc.c (Init_stack): remove IA64_MAGIC_STACK_LIMIT.
-
-Thu Jun  9 11:55:34 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/delegate.rb (SimpleDelegator::__setobj__): need check for
-	  recursive delegation.  [ruby-core:04940]
-
-Wed Jun  8 18:47:10 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* misc/ruby-mode.el (ruby-expr-beg): fix looking point drift.
-
-Wed Jun  8 11:11:34 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* bignum.c (get2comp): calculate proper 2's complement for
-	  negative numbers.  a bug in normalizing negative numbers
-	  reported from Honda Hiroki <hhonda@ipflex.com>.
-
-Wed Jun  8 08:33:10 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* enum.c (enum_min_by, enum_max_by): return nil if no iteration.
-	  fixed: [ruby-dev:26245]
-
-	* eval.c (rb_need_block): ensure a block is given.
-
-	* eval.c (backtrace): skip successive frames sharing same node.
-
-Wed Jun  8 00:15:08 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/socket/socket.c (ruby_getaddrinfo__aix): merged a patch from
-	  KUBO Takehiro <kubo at jiubao.org> to support AIX.  [ruby-list:40832]
-
-Wed Jun  8 00:09:01 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/yaml/rubytypes.rb (Array::to_yaml): merged a patch from
-	  Tilman Sauerbeck <tilman at code-monkey.de>.  [ruby-core:05055]
-
-	* lib/yaml/rubytypes.rb (Hash::to_yaml): ditto.
-
-Wed Jun  8 00:00:01 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/curses/curses.c (curses_insertln): merged a patch from
-	  TAKAHASHI Tamotsu <ttakah at lapis.plala.or.jp>.  [ruby-ext:02305]
-
-Tue Jun  7 19:34:15 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/irb/init.rb (IRB::IRB.rc_file_generators): more flexible
-	  IRB.rc_file_generators.  [ruby-core:05163]
-
-Tue Jun  7 18:39:31 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/thread.rb: RDoc documentation from Eric Hodel
-	  <drbrain at segment7.net> added.  [ruby-core:05148]
-
-Tue Jun  7 18:30:04 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/mkmf.rb (create_makefile): add .SUFFIXES from depend file.
-	  fixed: [ruby-dev:26294]
-
-Tue Jun  7 17:39:54 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* object.c (rb_mod_cvar_get): Module#class_variable_get(): back
-	  ported from CVS HEAD.  [ruby-talk:144741]
-
-	* object.c (rb_mod_cvar_set): Module#class_variable_set().
-	  [ruby-talk:144741]
-
-Tue Jun  7 16:32:53 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* sprintf.c (rb_f_sprintf): raise exception on debug mode (-d),
-	  not verbose mode (-v/-w).  [ruby-core:05123]
-
-Tue Jun  7 10:30:49 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/multi-tk.rb: slave-ip fails to call procedures
-	  delegated by master-ip.
-
-Sun Jun  5 23:00:35 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk/console.rb: create console when required
-
-	* ext/tk/sample/tkextlib/tile/demo.rb: fix TypeError & create Console
-
-Sat Jun  4 14:55:18 2005  Tanaka Akira  <akr@m17n.org>
-
-	* test/dbm/test_dbm.rb: merged from ext/dbm/testdbm.rb.
-
-	* test/gdbm/test_gdbm.rb: merged from ext/gdbm/testgdbm.rb.
-
-	* test/sdbm/test_sdbm.rb: renamed from ext/sdbm/testsdbm.rb with
-	  modification to use test/unit.
-
-Fri Jun  3 14:06:12 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/multi-tk.rb: fix typo.
-
-Wed Jun  1 11:32:42 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* bcc32/Makefile.sub: can use single quote character in DESTDIR.
-	  [ruby-dev:26205]
-
-Mon May 30 23:48:29 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk/macpkg.rb: add PACKAGE_NAME information of Tcl/Tk
-	  Extension.
-
-	* ext/tk/lib/tk/msgcat.rb: ditto.
-
-	* ext/tk/lib/tk/winpkg.rb: ditto.
-
-	* ext/tk/lib/tkextlib/*: ditto.
-
-Sat May 28 16:40:15 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* test/openssl/test_x509store.rb: add test for expired CRL
-	  and refine some assertions.
-
-Sat May 28 05:15:51 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_x509store.c (ossl_x509stctx_set_time): should
-	  not set internal flag directry.
-
-Sat May 28 02:00:11 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/cgi.rb (WEBrick::CGI::Socket#request_line):
-	  ENV["REQUEST_URI"] is better to get correct Request-URI
-	  than ENV["SCRIPT_NAME"] + ENV["PATH_INFO"].  [ruby-dev:26235]
-
-Fri May 27 16:32:04 2005  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* lib/mkmf.rb: use the semicolon as the path separator
-	  in the environment of MSYS.  fixed: [ruby-dev:26232]
-
-Thu May 26 06:08:11 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb: add shortcut-methods of tk_call + tk_split_list
-
-Wed May 25 22:52:42 2005  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/irb/input-method.rb: do not use Readline::HISTORY.pop.
-	  (backported from HEAD)
-
-Wed May 25 21:55:40 2005  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* ext/readline/readline.c: supported libedit. (backported from HEAD)
-
-	* ext/readline/extconf.rb: ditto.
-
-	* test/readline/test_readline.rb: ditto.
-
-Wed May 25 20:06:27 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb: TkComm#tk_split_*list fail to split a kind of SJIS
-	  strings. To avoid the trouble, add arguments to control converting
-	  encoding, and do split on a UTF8 string.
-
-	* ext/tk/lib/multi-tk.rb: modify to attend encoding.
-
-	* ext/tk/lib/remote-tk.rb: ditto.
-
-	* ext/tk/lib/tk/itemconfig.rb: ditto.
-
-	* ext/tk/lib/tk/listbox.rb: ditto.
-
-	* ext/tk/lib/tk/namespace.rb: ditto.
-
-	* ext/tk/lib/tk/panedwindow.rb: ditto.
-
-	* ext/tk/lib/tk/text.rb: ditto.
-
-	* ext/tk/lib/tk/textmark.rb: ditto.
-
-	* ext/tk/lib/tk/texttag.rb: ditto.
-
-	* ext/tk/lib/tk/variable.rb: ditto.
-
-	* ext/tk/lib/tk/winfo.rb: ditto.
-
-	* ext/tk/lib/tkextlib/iwidgets/scrolledlistbox.rb: ditto.
-
-	* ext/tk/lib/tkextlib/iwidgets/scrolledtext.rb: ditto.
-
-	* ext/tk/lib/tk.rb: add TkWindow#lower_window/raise_window and
-	  Tk#lower_window/raise_window by reason of method-name conflict
-
-	* ext/tk/lib/tk/canvas.rb: bug fix on TkCanvas#delete when given
-	  non-TkcItem arguments.
-
-	* ext/tk/lib/tkextlib/iwidgets/scrolledcanvas.rb: ditto.
-
-Wed May 25 12:59:48 2005  Tanaka Akira  <akr@m17n.org>
-
-	* lib/open-uri.rb (OpenURI::Meta::RE_QUOTED_STRING): a content of
-	  quoted-string should be zero or more characters.
-
-Tue May 24 23:42:16 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* numeric.c (fix_pow): support Fixnum ** Float case directly
-	  without coercing.  [ruby-talk:142697] [ruby-talk:143054]
-
-Tue May 24 16:57:24 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ruby.c (require_libraries): caused SEGV when continuation jumped
-	  in to the required library code.
-
-Tue May 24 11:56:25 2005  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* lib/getopts.rb: should warn only if verbose mode.
-	  fixed: [ruby-dev:26201]
-
-Tue May 24 06:45:31 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* misc/ruby-mode.el (ruby-font-lock-syntactic-keywords): string
-	  literals to be matched non-greedy.
-
-Tue May 24 00:34:32 2005  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* test/soap/calc: method name 'set' was able to crash with a class Set.
-	  [ruby-dev:26210]
-
-	* test/wsdl/document/test_rpc.rb: dateTime comparison failed under
-	  TZ=right/Asia/Tokyo (with leap second.) [ruby-dev:26208]
-
-Mon May 23 16:24:05 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tcltklib/extconf.rb: Framework support on MacOS X Tiger.
-
-	* ext/tcltklib/README.1st: add description of Framework support options.
-
-Mon May 23 12:21:37 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* re.c (make_regexp): should not return junk address during
-	  compile time.  [ruby-dev:26206]
-
-Sun May 22 21:54:06 2005  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/{soap,wsdl,xsd}, test/{soap,wsdl,xsd}: imported soap4r/1.5.4.
-
-	  == SOAP client and server ==
-
-	  === for both client side and server side ===
-
-	  * improved document/literal service support.
-	    style(rpc,document)/use(encoding, literal) combination are all
-	    supported.  for the detail about combination, see
-	    test/soap/test_style.rb.
-
-	  * let WSDLEncodedRegistry#soap2obj map SOAP/OM to Ruby according to
-	    WSDL as well as obj2soap.  closes #70.
-
-	  * let SOAP::Mapping::Object handle XML attribute for doc/lit service.
-	    you can set/get XML attribute via accessor methods which as a name
-	    'xmlattr_' prefixed (<foo name="bar"/> -> Foo#xmlattr_name).
-
-	  === client side ===
-
-	  * WSDLDriver capitalized name operation bug fixed.  from
-	    1.5.3-ruby1.8.2, operation which has capitalized name (such as
-	    KeywordSearchRequest in AWS) is defined as a method having
-	    uncapitalized name. (converted with GenSupport.safemethodname
-	    to handle operation name 'foo-bar').  it introduced serious
-	    incompatibility; in the past, it was defined as a capitalized.
-	    define capitalized method as well under that circumstance.
-
-	  * added new factory interface 'WSDLDriverFactory#create_rpc_driver'
-	    to create RPC::Driver, not WSDLDriver (RPC::Driver and WSDLDriver
-	    are merged).  'WSDLDriverFactory#create_driver' still creates
-	    WSDLDriver for compatibility but it warns that the method is
-	    deprecated.  please use create_rpc_driver instead of create_driver.
-
-	  * allow to use an URI object as an endpoint_url even with net/http,
-	    not http-access2.
-
-	  === server side ===
-
-	  * added mod_ruby support to SOAP::CGIStub.  rename a CGI script
-	    server.cgi to server.rb and let mod_ruby's RubyHandler handles the
-	    script.  CGIStub detects if it's running under mod_ruby environment
-	    or not.
-
-	  * added fcgi support to SOAP::CGIStub.  see the sample at
-	    sample/soap/calc/server.fcgi.  (almost same as server.cgi but has
-	    fcgi handler at the bottom.)
-
-	  * allow to return a SOAPFault object to respond customized SOAP fault.
-
-	  * added the interface 'generate_explicit_type' for server side
-	    (CGIStub, HTTPServer).  call 'self.generate_explicit_type = true'
-	    if you want to return simplified XML even if it's rpc/encoded
-	    service.
-
-	  == WSDL ==
-
-	  === WSDL definition ===
-
-	  * improved XML Schema support such as extension, restriction,
-	    simpleType, complexType + simpleContent, ref, length, import,
-	    include.
-
-	  * reduced "unknown element/attribute" warnings (warn only 1 time for
-	    each QName).
-
-	  * importing XSD file at schemaLocation with xsd:import.
-
-	  === code generation from WSDL ===
-
-	  * generator crashed when there's '-' in defined element/attribute
-	    name.
-
-	  * added ApacheMap WSDL definition.
-
-	* sample/{soap,wsdl}: removed.
-
-Sun May 22 19:11:35 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/lib/openssl/ssl.rb (OpenSSL::SSL::SSLServer#intialize):
-	  should initialize session id context. [ruby-core:4663]
-
-	* ext/openssl/ossl_ssl.c (ossl_sslctx_setup): add session id support.
-
-Sat May 21 10:24:21 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* bcc32/Makefile.sub: tds files were not deleted when DESTDIR
-	  included '\' path delimiter. [ruby-dev:26193]
-
-Thu May 19 19:04:29 2005  speakillof  <speakillof@yahoo.co.jp>
-
-	* lib/rexml/encodings/SHIFT-JIS.rb: encoding and decoding were
-	  swapped. [ruby-core:4772]
-
-Wed May 18 23:42:25 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* error.c (exc_exception): reverted to call Exception#initialize
-	  directly.  fixed: [ruby-dev:26177]
-
-Wed May 18 23:39:09 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (glob_helper): get rid of using String.  [ruby-dev:26180]
-
-	* dir.c (push_braces): should skip balanced braces.
-
-	* eval.c (ruby_options), win32/win32.c (NtInitialize): move argument
-	  intialization back.  [ruby-dev:26180]
-
-Tue May 17 15:31:31 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/httpserver.rb (WEBrick::HTTPServer#run): should
-	  break the loop if the socket reached to EOF. [ruby-talk:142285]
-
-Tue May 17 11:52:18 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/win32.c (unixtime_to_filetime): use localtime() instead of
-	  gmtime() when using FileLocalTimeToFileTime().
-
-Mon May 16 22:28:43 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* win32/win32.h, {bcc32,win32,wince}/Makefile.sub: moved rb_[ugp]id_t
-	  to get rid of redefinition warnings on mingw.
-
-	* class.c (rb_class_init_copy): singleton class is disallowed to copy,
-	  from its definition.  fixed: [ruby-talk:142749]
-
-Mon May 16 08:52:29 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* win32/win32.{h,c}: define rb_[pgu]id_t.
-
-Mon May 16 00:21:02 2005  Tanaka Akira  <akr@m17n.org>
-
-	* lib/pathname.rb (Pathname#unlink): use SystemCallError instead of
-	  Errno::EISDIR because EISDIR is not portable.
-	  [ruby-core:5001]
-
-Sun May 15 22:11:33 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* lib/drb/drb.rb (DRbObject#method_missing): use raise(exception).
-	  [ruby-dev:26164]
-
-Sun May 15 18:56:35 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in, ruby.h: define rb_[pgu]id_t macros instead of typedefs
-	  to get rid of types which might not be defined yet.  [ruby-dev:26165]
-
-Sun May 15 14:35:46 2005  Tanaka Akira  <akr@m17n.org>
-
-	* lib/pathname.rb (Pathname#unlink): unlink a symlink to a directory
-	  was failed.  [ruby-core:4992]
-
-Sun May 15 09:57:30 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* win32/win32.c (unixtime_to_filetime): deal with DST.
-	  [ruby-talk:141817]
-
-Sat May 14 23:59:11 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* error.c (exc_exception, {exit,name_err,syserr}_initialize): call
-	  Execption#initialize.  fixed: [ruby-talk:142593]
-
-Sat May 14 23:57:26 2005  Erik Huelsmann  <ehuels@gmail.com>
-
-	* configure.in: Check for the availability of pid_t, gid_t and uid_t and
-	  remove AC_TYPE_UID_T.  fixed: [ruby-core:04745]
-
-	* defines.h: Remove pid_t typedef.
-
-	* ruby.h: Define rb_pid_t, rb_gid_t and rb_uid_t in accordance with
-	 the available system types.
-
-	* process.c: Change instances of pid_t and gid_t to their rb_*
-	 counterparts.
-
-	* ext/pty/pty.c: Change pid_t to rb_pid_t.
-
-	* vms/config.h: Define HAVE_{P,G,U}ID_T to 1.
-
-	* win32/Makefile.sub: Remove #define for {g,u}id_t.
-
-	* win32/win32.c: Change pid_t to rb_pid_t.
-
-	* wince/Makefile.sub: Remove #define for {g,u}id_t.
-
-	* wince/sys/types.h: Remove definitions of {p,g,u}id_t.
-
-Fri May 13 23:44:22 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/extmk.rb: keep srcdir unexpanded.
-
-	* lib/mkmf.rb (create_makefile): quote topdir and hdrdir if necessary.
-	  fixed: [ruby-core:04932]
-
-	* lib/mkmf.rb (configuration), {bcc32,win32,wince}/Makefile.sub: make
-	  also INSTALL_PROG and INSTALL_DATA system dependent.
-	  fixed: [ruby-core:04931]
-
-Fri May 13 17:54:39 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* variable.c (generic_ivar_get): rb_attr_get should not warn.
-	  [ruby-dev:26010]
-
-Fri May 13 12:28:43 2005  Daniel Berger  <djberge@qwest.com>
-
-	* array.c (rb_ary_select): can remove argc check. [ruby-core:4911]
-
-	* test/ruby/test_array.rb: add test for find_all.
-
-Fri May 13 11:29:00 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* eval.c (unknown_node): add volatile directive to prototype.
-
-Thu May 12 17:08:48 2005  Tanaka Akira  <akr@m17n.org>
-
-	* io.c (rb_io_eof, remain_size, read_all, io_read, appendline)
-	  (swallow, rb_io_each_byte, rb_io_getc): revert previous change.
-
-	* io.c (rb_io_eof, io_fread, appendline, swallow, rb_io_each_byte)
-	  (rb_io_getc, rb_getc): call clearerr before getc to avoid
-	  stdio incompatibility.
-
-Thu May 12 16:52:20 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* lib/rdoc/parsers/parse_c.rb: more readability for mixing
-	  progress "c..." and warning message.
-
-Thu May 12 16:31:00 2005  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* ext/nkf/nkf-utf8/nkf.c: follow nkf 2.0.5
-
-Thu May 12 16:15:01 2005  Tanaka Akira  <akr@m17n.org>
-
-	* io.c (rb_io_eof, remain_size, read_all, io_read, appendline)
-	  (swallow, rb_io_each_byte, rb_io_getc): don't rely EOF flag.
-	  [ruby-talk:141527]
-
-Thu May 12 15:56:20 2005  Tilman Sauerbeck  <tilman@code-monkey.de>
-
-	* lib/rdoc/parsers/parse_c.rb: show parsing progress for C files.
-	  [ruby-core:4341]
-
-Thu May 12 13:47:56 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* test/drb/test_drb{ssl,unix}.rb: can test drb
-	  before install. (backported from HEAD) [ruby-dev:26146]
-
-Thu May 12 09:53:57 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* version.c (ruby_show_version): flush for non-tty stdout.
-
-Thu May 12 09:07:07 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* test/ruby/envutil.rb, test/drb/drbtest.rb: can test drb
-	  before install. (backported from HEAD) [ruby-Bugs-1672]
-
-Thu May 12 01:23:55 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_eval), parse.y (arg): reduce fixnum range literal at
-	  parser.  fixed: [ruby-dev:26113]
-
-	* eval.c (unknown_node): ignore broken NODE to get rid of accessing
-	  possibly inaccessible address.  fixed: [ruby-dev:26122]
-	  should emit more useful information like [ruby-dev:26126], though.
-
-Wed May 11 16:20:01 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/cgi.rb: new methods WEBrick::CGI#[], WEBrick::CGI#logger
-	  and WEBrick::CGI#config. (backported from HEAD)
-
-	* lib/webrick/httputils.rb (WEBrick::HTTPUtils.escape_path): should
-	  not use String#split("/"). (backported from HEAD)
-
-Wed May 11 15:58:39 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (break_jump): break should not cross functions.
-	  [ruby-list:40818]
-
-Wed May 11 10:39:37 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* lib/tempfile.rb (Tempfile#unlink): fixed typo.
-
-Wed May 11 01:03:36 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (TMP_ALLOC): use macro NEW_NODE() to get rid of warnings on
-	  platforms which have no alloca().  fixed: [ruby-talk:141301]
-
-Sun May  8 23:17:47 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk/timer.rb: fix typo.
-
-Sun May  8 16:52:56 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* lib/profiler.rb: fixed "undefined method `[]' for nil:NilClass"
-	  [ruby-core:4775] [ruby-talk:140401] [ruby-dev:26118]
-
-Sat May  7 22:58:00 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/mkmf.rb (have_var): no libs argument is given.
-
-Sun May  1 09:58:11 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ruby.c (process_sflag): replace '-' in variable names with '_'.
-	  [ruby-dev:26107]
-
-	* ruby.c (set_arg0): use also environment variable space for setting
-	  $0.  [ruby-core:04774]
-
-Wed Apr 27 23:42:22 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* win32/Makefile.sub (OPTFLAGS): default global optimization to
-	  disabled only for VC++6.
-
-Tue Apr 26 22:58:00 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tcltklib/tcltklib.c (ip_invoke_core): call Tcl's "::unknown"
-	  command when can't get information of target command.
-
-Mon Apr 25 01:18:43 2005  Tanaka Akira  <akr@m17n.org>
-
-	* regex.c: declare rb_warn to have variadic argument.  [ruby-core:4751]
-
-Sat Apr 23 19:45:59 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* ext/tcltklib/tcltklib.c (ip_RubyExitCommand): exit with status code
-	  via TclTkIp#_eval didn't work. [ruby-talk:139390]
-
-Fri Apr 22 16:41:50 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* ext/tcltklib/tcltklib.c (ip_set_exc_message): fixed memory leak.
-
-	* ext/tcltklib/tcltklib.c: eTkCallbackReturn was not initialized.
-
-Thu Apr 21 00:07:50 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/mkmf.rb (create_makefile): support platforms have file separator
-	  other than /.
-
-	* {bcc32,win32,wince}/Makefile.sub (BUILD_FILE_SEPARATOR): separator
-	  of building platform.
-
-	* {bcc32,win32,wince}/Makefile.sub (CP, INSTALL): use COPY command.
-
-Wed Apr 20 23:22:39 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* Makefile.in, common.mk: miniruby depens on MINIOBJS.
-
-	* dmydln.c (dln_load): dummy function to raise LoadError.
-
-	* cygwin/GNUmakefile.in, {bcc32,win32,wince}/Makefile.sub: miniruby
-	  can't load extensions on Windows.
-
-Wed Apr 20 23:01:35 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* win32/ifchange.bat: delete testing files.
-
-Wed Apr 20 07:27:18 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* {bcc32,win32,wince}/configure.bat, {bcc32,win32,wince}/setup.mak:
-	  add extout option.
-
-	* bcc32/setup.mak: make configuration variables overridable.
-
-Wed Apr 20 04:15:27 2005  Keiju Ishitsuka  <keiju@ruby-lang.org>
-
-	* lib/irb.rb lib/irb/* doc/irb: IRB 0.9.5
-
-Tue Apr 19 23:37:09 2005  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* lib/ftools.rb (File.safe_unlink): do not modify a symlinked file.
-
-Tue Apr 19 00:06:20 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/extmk.rb: expand path for ext/**/extconf.rb.
-
-Mon Apr 18 11:25:14 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* ext/zlib/zlib.c (zstream_run): fixed SEGV. [ruby-core:4712]
-
-Sun Apr 17 23:57:49 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/extmk.rb (extmake, parse_args): do not expand destdir.
-
-	* ext/extmk.rb (relative_from): treat mere drive letter as an absolute
-	  path.
-
-Sat Apr 16 17:01:16 2005  Kouhei Sutou  <kou@cozmixng.org>
-
-	* sample/rss/tdiary_plugin/rss-recent.rb (rss_recent_cache_rss):
-	  use the first date information of items as site date information
-	  if channel doesn't have date information.
-
-Sat Apr 16 15:27:03 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in (RUBY_PROG_INSTALL): not add -p option to INSTALL.
-	  files need timestamps to be kept are only ar-archive on a few
-	  platforms, and be installed by instruby.rb but not INSTALL.
-	  fixed: [ruby-core:04721]
-
-	* mkconfig.rb: purge autoconf value variables.
-
-Sat Apr 16 10:36:01 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* bcc32/Makefile.sub: quick hack... prepend DESTDIR.
-	  still have restriction on DESTDIR ("", "/", "e:")
-
-Sat Apr 16 03:59:42 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/extconf.rb: check for OPENSSL_cleanse.
-
-	* ext/openssl/openssl_missing.h: ditto.
-
-Thu Apr 14 19:18:30 2005  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/fileutils.rb (remove_file): ignore exceptions caused by
-	  chmod.
-
-	* lib/fileutils.rb (remove_dir): try to get rights to rmdir.
-	  [ruby-Bugs:1502] (2 items backportted from HEAD, rev 1.53-54)
-
-Thu Apr 14 16:57:40 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* bcc32/Makefile.sub: failed to remove debug information files.
-	  fixed: [ruby-dev:26034]
-
-Wed Apr 13 23:40:21 2005  Kouhei Sutou  <kou@cozmixng.org>
-
-	* lib/rss/rss.rb (RSS::VERSION): 0.1.3 -> 0.1.4.
-
-	* lib/rss/rss.rb (RSS::Element#converter): fixed converter
-	  transmission bug.
-
-Wed Apr 13 21:20:35 2005  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* configure.in (mingw32): extract msvcr*.dll from objdump result.
-
-Wed Apr 13 20:24:30 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in (mingw32): use actual runtime DLL name as ruby DLL
-	  name and default load path.
-
-	* win32/Makefile.sub, win32/setup.mak: ditto.
-
-Tue Apr 12 15:33:09 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tcltklib/tcltklib.c (ip_finalize): better modification than the
-	  previous commit [ruby-dev:26029].
-
-Tue Apr 12 12:38:06 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tcltklib/tcltklib.c (ip_finalize): fix SEGV when Tcl_GlobalEval()
-	  modifies the argument string to eval.
-
-Tue Apr 12 02:21:55 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tcltklib/tcltklib.c (ip_finalize): add existence check of
-	  Tcl commands before calling Tcl_GlobalEval().
-
-Mon Apr 11 23:47:21 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* lib/drb/drb.rb: [druby-ja:123] fix: When reference of my object is
-	  loaded, the object is tainted.
-
-	* test/drb/test_drb.rb: ditto.
-
-Mon Apr 11 22:18:23 2005  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* dir.c, file.c (lstat): avoid warnings for mingw.
-
-Mon Apr 11 20:11:06 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tcltklib/tcltklib.c (ip_finalize): adhoc patch to avoid SEGV
-	  when exit on Tcl/Tk8.3.x.
-
-Mon Apr 11 15:26:25 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* lib/mkmf.rb (configuration): shouldn't output hdrdir twice.
-
-Mon Apr 11 12:09:05 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* {bcc32,win32,wince}/Makefile.sub: ri data was not installed
-	  into correct path. [ruby-dev:26011]
-
-	* bcc32/Makefile.sub: defaulted install-nodoc. [ruby-dev:26011]
-
-Sun Apr 10 10:12:42 2005  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
-
-	* ext/win32ole/win32ole.c(ole_invoke): retry after converting Qnil
-	  to VT_EMPTY.
-
-	* ext/win32ole/win32ole/tests/testWIN32OLE.rb: correct error
-	  message string "Unknown" => "unknown".
-
-Sat Apr  9 18:20:31 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk/image.rb: support to create TkImage object without
-	  creating a new image object on Tk.
-
-	* ext/tk/lib/tk/menu.rb: use TkCommandNames on create_self()
-
-	* ext/tk/lib/tk/root.rb: TkRoot.to_eval() returns '.'.
-
-	* ext/tk/lib/tk/text.rb: add methods to create a TkText::IndexString
-	  from (x, y) coords.
-
-	* ext/tk/lib/tkextlib/tile/: add demo and update support status.
-
-Sat Apr  9 14:42:29 2005  Kouhei Sutou  <kou@cozmixng.org>
-
-	* sample/rss/tdiary_plugin/rss-recent.rb: supported configuration
-	  via Web browser.
-
-Sat Apr  9 11:59:57 2005  Kouhei Sutou  <kou@cozmixng.org>
-
-	* lib/rss: backoported from HEAD.
-
-	* lib/rss: refactored.
-	  - gave a name to 'x'.
-	  - undef_method -> remove_method for avoiding a warning in ruby 1.6.
-
-
-	* lib/rss/parser.rb: @@setter -> @@setters.
-
-	* lib/rss/parser.rb
-	  (RSS::BaseListener.register_uri)
-	  (RSS::BaseListener.uri_registered?)
-	  (RSS::BaseListener.install_get_text_element):
-	  swapped the first argument and the second argument.
-
-	* lib/rss/taxonomy.rb: swapped the first argument and the second
-	  argument for RSS::BaseListener.install_get_text_element.
-	* lib/rss/image.rb: ditto.
-	* lib/rss/syndication.rb: ditto.
-	* lib/rss/dublincore.rb: ditto.
-	* lib/rss/parser.rb: ditto.
-	* lib/rss/1.0.rb: ditto.
-	* lib/rss/2.0.rb: ditto.
-	* lib/rss/0.9.rb: ditto.
-	* lib/rss/content.rb: ditto.
-
-	* lib/rss/parser.rb
-	  (RSS::BaseListener.install_setter)
-	  (RSS::BaseListener.register_uri): changed fallback way.
-
-	* lib/rss/parser.rb: added class name registry for complex model
-	  elements. (ex. have childlen elements, have some attributes and
-	  a child element and so on.)
-
-
-	* lib/rss/dublincore.rb: supported multiple Dublin Core items.
-	* lib/rss/maker/dublincore.rb: ditto.
-
-	* lib/rss/maker/image.rb: supproted new Dublin Core API.
-
-
-	* lib/rss/maker/base.rb: added default current_element implementation.
-
-
-	* lib/rss/trackback.rb (RSS::TrackBackUtils.new_with_value_if_need):
-	  moved to RSS::Utils.
-
-	* lib/rss/utils.rb (RSS::Utils.new_with_value_if_need):
-	  moved from RSS::TrackBackUtils.
-
-
-	* lib/rss/maker/image.rb: fixed invalid argument of
-	  add_need_initialize_variable bug.
-	* lib/rss/maker/trackback.rb: ditto.
-
-
-	* lib/rss/rss.rb (Hash#merge): added for ruby 1.6.
-
-	* lib/rss/rss.rb (RSS::BaseModel.date_writer): changed to accept nil
-	  for date value.
-
-
-	* test/test_dublincore.rb: added tests for plural accessor and
-	  multiple Dublin Core items.
-
-	* test/test_setup_maker_1.0.rb: fixed swapped actual and expected
-	  values.
-
-	* test/rss/rss-assertions.rb (assert_multiple_dublin_core): added
-	  an assertion for testing multiple Dublin Core items.
-
-	* test/rss/test_maker_dc.rb (test_rss10_multiple): added a test
-	  for making multiple Dublin Core items.
-
-	* test/rss/test_maker_dc.rb (test_date): added a test for #date=
-	  and #dc_date=.
-
-
-	* sample/rss/tdiary_plugin/rss-recent.rb:
-	  new option: @options['rss-recent.use-image-link']:
-	  use image as link instread of text if available.
-
-	* sample/rss/tdiary_plugin/rss-recent.rb (RSS_RECENT_VERSION):
-	  0.0.5 -> 0.0.6.
-
-Fri Apr  8 20:17:48 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/extmk.rb (extmake): hdrdir needs to be defined also in
-	  Config::CONFIG.
-
-	* lib/mkmf.rb (configuration, create_makefile): get rid of recursive
-	  macro reference.
-
-Fri Apr  8 18:26:56 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_ssl.c: add callbacks to OpenSSL::SSL::SSLContexts.
-	  - SSLContext#client_cert_cb=(aProc). it is called when a client
-	    certificate is requested by a server and no certificate was not
-	    set for the SSLContext. it must return an Array which includes
-	    OpenSSL::X509::Certificate and OpenSSL::PKey::RSA/DSA objects.
-	  - SSLContext#tmp_dh_callback=(aProc). it is called in key
-	    exchange with DH algorithm. it must return an OpenSSL::PKey::DH
-	    object.
-
-	* ext/openssl/ossl_ssl.c (ossl_sslctx_set_ciphers): ignore the
-	  argument if it's nil.
-
-	* ext/openssl/ossl_pkey.c
-	  (GetPrivPKeyPtr, ossl_pkey_sign): should call rb_funcall first.
-	  (DupPrivPKeyPtr): new function.
-
-	* ext/openssl/ossl_pkey_dh.c: add default DH parameters.
-
-	* ext/openssl/ossl_pkey.h: ditto.
-
-Fri Apr  8 01:55:20 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/sample/demos-{en,jp}/goldberg.rb: reduced window size.
-	  [ruby-dev:25992]
-
-Thu Apr  7 23:58:40 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/extmk.rb (extmake): keep directory names in Makefile as macros.
-
-	* lib/mkmf.rb (configuration, create_makefile): ditto.
-
-	* lib/mkmf.rb (CXX_EXT): separate C++ extensions.
-
-Thu Apr  7 17:43:25 2005  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* eval.c (rb_call0): "return" event hook should be always executed
-	  if event_hooks is set.  fixed: [ruby-core:04662]
-	  (backported from HEAD)
-
-Mon Apr  4 23:17:52 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb (TkComm#array2tk_list): accept enc-mode argument to
-	  decide whether convert encoding of each element or not.
-
-	* ext/tk/lib/tk/variable.rb (TkVariable#value=): fail to convert the
-	  encoding of array elements when assign an array to an TkVariable
-	  object.
-
-Mon Apr  4 10:26:48 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* ext/tk/lib/tk/dialog.rb: fixed typo.
-
-Sun Apr  3 17:16:33 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* win32/win32.{h,c} (rb_w32_fdopen): avoid warning on bcc32.
-	  (backported from HEAD)
-
-Sat Apr  2 23:38:54 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in (CP, INSTALL): get rid of less portable options.
-
-	* lib/mkmf.rb (configuration, create_makefile): correct configuration
+	* compile.c (iseq_peephole_optimize): eliminate always/never
+	  branches after a literal object.  this sequence typically
+	  appears by defined? operator for a method call on a local
 	  variable.
 
-	* {bcc32,win32,wince}/{Makefile.sub,setup.mak}: leave prefix empty in
-	  config.status for backward compatibility.  fixed: [ruby-core:04649]
-
-	* lib/mkmf.rb (create_makefile): ensure library directories get made
-	  before copying libraries there.
-
-Sat Apr  2 16:59:46 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb: forgot to update RELEASE_DATE
-
-	* ext/tk/lib/tk/variable.rb: fix namespace trouble when autoloading
-
-	* ext/tk/lib/tk/palette.rb: define Tcl variable 'tkPalette' as global
-
-	* ext/tk/lib/tk/dialog.rb: use array2tk_list method when calling
-	  Tk.ip_eval.
-
-	* ext/tk/lib/tk/autoload.rb: add autoload entry 'TkDialogObj' and
-	  'TkWarningObj'
-
-Sat Apr  2 02:19:11 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb (TkWindow.initialize): accept 'without_creating'
-	  option without 'widgetname' option to allow creating a widget object
-	  which is used as an argument of Tcl/Tk's widget allocation commands.
-
-	* ext/tk/lib/tk/image.rb (TkImage.initialize): accept 'imagename'
-	  option to create a image object by the given name.
-
-Thu Mar 31 22:23:51 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/mkmf.rb (SRC_EXT): exclude just case different suffixes on case
-	  insensitive file system platforms.
-
-	* README.EXT, README.EXT.ja (Appendix C): utility functions.
-
-Thu Mar 31 14:15:44 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_engine.c (ossl_engine_s_load): should return
-	  value. [ruby-dev:25971]
-
-Thu Mar 31 08:25:50 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* common.mk (RUBYOPT): clear for the environment RubyGems installed.
-
-	* common.mk (clean-local): keep $(PREP) files till distclean.
-
-	* common.mk (check): do all tests.
-
-Thu Mar 31 06:00:20 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_engine.c (ossl_engine_s_load): should not raise
-	  error even if the specified engine could not be loaded. (Dynamic
-	  engines don't have fixed name to load.)
-
-Thu Mar 31 00:18:27 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* win32/ifchange.bat, win32/rm.bat: backported from HEAD.
-
-Wed Mar 30 23:44:50 2005  Nobuyoshi Nakada  <nobu.nokada@softhome.net>
-
-	* Makefile.in, */Makefile.sub, */configure.bat,
-	  cygwin/GNUmakefile.in, common.mk, configure.in, ext/extmk.rb,
-	  lib/mkmf.rb, instruby.rb, runruby.rb: backport extout.
-	  [ruby-dev:25963]
-
-Wed Mar 30 17:41:48 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tcltklib/tcltklib.c: add TclTkIp#_create_console() method to
-	  create a Tcl/Tk's console window.
-
-	* ext/tk/lib/multi-tk.rb: support TclTkIp#_create_console() method.
-
-	* ext/tk/lib/remote-tk.rb: ditto.
-
-	* ext/tk/lib/tk/console.rb: ditto.
-
-	* ext/tk/lib/tk.rb: update RELEASE_DATE
-
-	* ext/tk/sample/demo-*/check2.rb: use 'return' in the Proc object.
-
-	* ext/tk/sample/tkextlib/**: ditto.
-
-Tue Mar 29 22:11:56 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* test/rinda/test_rinda.rb: use DRbObject.new_with instead of reinit.
-	  [ruby-dev:25961]
-
-Mon Mar 28 23:40:40 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* lib/drb/drb.rb: move method DRbObject#reinit to DRbObject.new_with.
-	  extract method DRbObject.prepare_backtrace. add DRb.regist_server,
-	  remove_server, fetch_server. change server in thread variable if
-	  in-proc server. [druby-ja:113]
-
-	* lib/drb/gw.rb: ditto.
-
-Mon Mar 28 20:43:34 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/syck/rubyext.c: get rid of warnings caused by a bug of VC.
-
-Mon Mar 28 08:39:49 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/iconv/iconv.c (iconv_create): Iconv::Failure requires 3
-	  arguments.  (pointed out by NaHi)
-
-Sat Mar 26 22:51:33 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb (_callback_entry_class?): add for checking whether
-	  a class is available for a callback entry.
-
-	* ext/tk/lib/tk.rb (after_cancel): add Tk.after_cancel(afterID) method.
-
-	* ext/tk/lib/tk.rb (array2tk_list): change from private module method
-	  of TkComm to public module method.
-
-	* ext/tk/lib/tk.rb (cget): add check that slot argument is not
-	  empty string.
-
-	* ext/tk/lib/tk.rb (configinfo): ditto.
-
-	* ext/tk/lib/tk/itemconfig.rb (itemcget): add check that slot argument
-	  is not empty string.
-
-	* ext/tk/lib/tk/itemconfig.rb (itemconfiginfo): ditto.
-
-	* ext/tk/lib/tk/entry.rb: add TkEntry#icursor and icursor= (alias of
-	  cursor and cursor= method).
-
-	* ext/tk/lib/tk/font.rb: improve font treatment when the font name is
-	  empty string.
-
-	* ext/tk/lib/tk/variable.rb: add :variable, :window and :procedure
-	  type.
-
-	* ext/tk/lib/tk/variable.rb: improve treatment of array-type
-	  tkvariable.
-
-	* ext/tk/lib/tkextlib/blt.rb: add commands for zooming.
-
-	* ext/tk/lib/tkextlib/blt/*: bug fix.
-
-	* ext/tk/lib/tkextlib/treectrl/tktreectrl.rb: bug fix and add methods
-	  to call TreeCtrl commands for bindings.
-
-	* ext/tk/sample/tkextlib/blt/*: new sample scripts.
-
-	* ext/tk/sample/tkextlib/treectrl/*: ditto.
-
-Fri Mar 25 10:53:16 2005  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* configure.in (WIN32_LEAN_AND_MEAN): removed because a lot of
-	  troubles.  [ruby-list:40721]
-
-Thu Mar 24 23:10:44 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/mkmf.rb (macro_defined?): try to compile for an old compiler
-	  which doesn't bail out at #error directive.  [ruby-dev:25818]
-
-	* lib/mkmf.rb (check_sizeof): refine logging messages.
-
-Thu Mar 24 03:57:48 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/utils.rb (WEBrick::Utils.create_listeners):
-	  - should raise ArgumentError if no port is specified.
-	  - even if the specified port is 0, all TCPServers should be
-	  initialized with the port given to the first one.
-
-	* lib/webrick/server.rb (WEBrick::GenericServer#initialize): if :Port
-	  parameter is 0, it should be updated with the port number which
-	  actually listened.
-
-Wed Mar 23 00:35:10 2005  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* test/ruby/test_settracefunc.rb (test_event): added tests for
-	  "class" and "end" and "raise".
-
-Tue Mar 22 22:40:18 2005  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* eval.c (rb_call0): check event_hooks instead of trace_func.
-
-Tue Mar 22 17:30:44 2005  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* eval.c (rb_add_event_hook): new function to add a hook function for
-	  interpreter events. (backported form HEAD)
-
-Sun Mar 20 22:51:19 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/mkmf.rb (mkmf_failed): check if Makefile is created without
-	  create_makefile.
-
-Sat Mar 19 23:48:10 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* misc/ruby-mode.el (ruby-expr-beg): returned true always.
-	  fixed: [ruby-list:40683]
-
-Sat Mar 19 00:41:02 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk/font.rb: add some TkFont class methods to get font
-	  information without creating a TkFont object.
-
-	* ext/tk/lib/tkextlib/treectrl/tktreectrl.rb: bug fix and define some
-	  classes for components of Tk::TreeCtrl
-
-Thu Mar 17 17:42:13 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* struct.c (make_struct): allow non local-id field
-	  names. [ruby-core:04575]
-
-	* struct.c (inspect_struct): ditto.
-
-Wed Mar 16 23:36:02 2005  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* eval.c (rb_call0): call_cfunc() should be protected.
-
-	* test/ruby/test_settracefunc.rb: added test for c-return.
-
-Wed Mar 16 22:20:25 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* object.c (str_to_id): fixed typo.
-
-Wed Mar 16 18:08:32 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_call0): reorganize "return" event post.
-
-Tue Mar 15 23:49:19 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/iconv/iconv.c (Init_iconv): InvalidEncoding also should include
-	  Iconv::Failure.
-
-Tue Mar 15 16:38:11 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/tkutil.c (ary2list): give wrong arguments to hash2kv()
-
-Mon Mar 14 19:39:33 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk/timer.rb (TkTimer): forgot to clear @return_value
-	  when restarting
-
-	* ext/tk/lib/tk/sample/cd_timer.rb: new sample of TkRTTimer
-
-Mon Mar 14 12:21:03 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk/timer.rb (TkRTTimer): forgot to reset the callback
-	  time. So, 'continue' do all callbacks between 'stop' and 'continue'.
-
-Mon Mar 14 08:14:56 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* object.c (str_to_id): warn for NUL containing strings.
-
-Mon Mar 14 00:13:49 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk/timer.rb (TkRTTimer): correct calculation of offset
-	  value. get a little better accuracy.
-
-	* ext/tk/sample/demos-en/widget: use a binding with no local variables
-	  when eval a sample script.
-
-	* ext/tk/sample/demos-en/bind.rb: ditto.
-
-	* ext/tk/sample/demos-en/tcolor: ditto.
-
-	* ext/tk/sample/demos-jp/widget: ditto.
-
-	* ext/tk/sample/demos-jp/bind.rb: ditto.
-
-	* ext/tk/sample/demos-jp/tcolor: ditto.
-
-Sun Mar 13 10:04:17 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* test/rinda/test_rinda.rb: remove test_gc. [ruby-dev:25871]
-
-Thu Mar 10 19:12:06 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tcltklib/tcltklib.c (lib_eventloop_ensure): mis-delete a timer
-	  handler when exit from a recursive called eventloop
-
-	* ext/tk/lib/tk/timer.rb: new TkRTTimer class, which can works for a
-	  realtime operation
-
-	* ext/tk/sample/tkrttimer.rb: sample of TkRTTimer class
-
-	* ext/tk/lib/tk/textmark.rb: move  TkTextMark#+ and TkTextMark#- to
-	  TkText::IndexModMethods
-
-	* ext/tk/lib/tk/text.rb: improve TkTextMark#+ and TkTextMark#-, and
-	  add them to TkText::IndexModMethods module
-
-	* ext/tk/sample/tktextio.rb: add test part of "seek by text index
-	  modifiers"
-
-Thu Mar 10 08:10:11 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* re.c (make_regexp): need to free internal regexp structure when
-	  compilation fails.  [ruby-talk:133228]
-
-Wed Mar  9 20:25:58 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_ssl.c (ossl_start_ssl, ossl_ssl_write): call
-	  rb_sys_fail if errno isn't 0. [ruby-dev:25831]
-
-	* ext/openssl/lib/openssl/cipher.rb: fix typo. [ruby-dev:24285]
-
-Wed Mar  9 15:46:35 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/server.rb (WEBrick::GenericServer#start): should
-	  restore @token if accept failure. suggested by Dominique Brezinski.
-	  [ruby-core:04518]
-
-Wed Mar  9 13:37:57 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/sample/tktextio.rb: fix bug of handling 'end' position.
-	  support initial text, overwrite setting and pos_gravity control.
-
-Tue Mar  8 18:16:55 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/sample/tktextio.rb: New sample script. TkTextIO class in this
-	  sample supports to use a text widget as if it is a I/O stream (such
-	  like as StringIO class).
-
-Tue Mar  8 13:54:40 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* ext/socket/socket.c: workaround for some of 4.4BSD-Lite derived OSs.
-
-Tue Mar  8 12:36:17 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/socket/socket.c: document from Sam Roberts
-	  <sroberts@uniserve.com> for getsockopt and setsockopt is merged.
-	  [ruby-doc:824]
-
-Tue Mar  8 01:27:00 2005  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* ext/nkf/nkf-utf8/nkf.c: follow nkf 1.66
-	  fixed: [ruby-dev:25828]
-
-Mon Mar  7 21:35:02 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* sample/webrick/httpsd.rb: fix typo in comment. suggested by
-	  Kazuhiko Shiozaki.
-
-Mon Mar  7 14:55:43 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (block_pass): should not push unique number if a block is
-	  not an orphan.  [ruby-dev:25808]
-
-Wed Feb 16 02:55:21 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_ssl.c (ossl_start_ssl, ossl_ssl_read,
-	  ossl_ssl_write):
-	  - need to set errno on Win32 platform.
-	  - should call rb_sys_fail instead of rasing SSLError if
-	    SSL_ERROR_SYSCALL occured.
-	  - should wait for that the underlying IO become readable or
-	    writable if the error was SSL_ERROR_WANT_READ or
-	    SSL_ERROR_WANT_WRITE. [ruby-dev:25795]
-
-	* ext/openssl/lib/openssl/buffering.rb
-	  (Buffering#initialize): should set @eof and @rbuffer.
-	  (Buffering#fill_rbuff): should rescue Errno::EAGAIN.
-	  (Buffering#consume_rbuf): pointless eof flag resetting is deleted.
-	  (Buffering#read): should return an empty string if the specified
-	  size is zero.
-	  (Buffering#readpartial): new method.
-	  (Buffering#readline): fix typo.
-	  (Buffering#getc): return the first character of string correctly.
-	  (Buffering#each): fix typo.  suggested by Brian Ollenberger.
-	  (Buffering#readchar): fix typo.
-	  (Buffering#eof?): should read again it the input buffer is empty.
-	  (Buffering#do_write): should rescue Errno::EAGAIN.
-	  (Buffering#puts): use "\n" as the output field separator.
-
-	* ext/openssl/lib/openssl/ssl.rb: set non-blocking flag to the
-	  underlying IO.
-
-	* ext/openssl/extconf.rb: get rid of GNUmakefile generation.
-
-	* text/openssl/test_pair.rb: test for IO like methods.
-
-	* test/ruby/ut_eof.rb: test about empty file.
-
-Mon Mar  7 10:22:06 2005  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* lib/un.rb: should use OptionParser. (backported form HEAD)
-
-Mon Mar  7 09:18:42 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* string.c (rb_str_cmp_m): should not return false but nil.
-	  fixed: [ruby-dev:25811]
-
-Mon Mar  7 01:22:14 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/tkutil.c: remove the some codes which depend on the
-	  difference between Ruby1.8 and 1.9, because st.c on Ruby1.9
-	  was changed.
-
-Mon Mar  7 00:01:04 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tcltklib/tcltklib.c: fail to call TclTkLib.mainloop when $SAFE==4
-
-Sun Mar  6 16:41:33 2005  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/net/http.rb: HTTPHeader holds its header fields as an array
-	  (backport from CVS HEAD rev 1.112-1.123). [ruby-list:40629]
-
-	* test/net/http/test_httpheader.rb: new file.
-
-Sun Mar  6 11:47:10 2005  Sam Roberts  <sroberts@uniserve.com>
-
-	* lib/pp.rb: rdoced.  [ruby-core:4490]
-
-Sun Mar  6 11:36:37 2005  Tanaka Akira  <akr@m17n.org>
-
-	* lib/pp.rb (File::Stat#pretty_print): Etc.getpwuid and Etc.getgrgid
-	  may return nil.  [ruby-talk:129826]
-	  reported by Daniel Berger.
-
-Sat Mar  5 18:06:21 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* dir.c (fnmatch): removed unnecessary code. (ruby_1_8 didn't have
-	  String#clear, so [ruby-dev:24749] didn't affect it)
-
-	* win32/win32.c (NtInitialize): ditto. (by numeric.c 1.101.2.14)
-
-Sat Mar  5 16:29:26 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/multi-tk.rb: freeze callback-entry objects
-
-	* ext/tk/lib/tkextlib/tile.rb: support tile-0.6
-
-Fri Mar  4 19:39:28 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser#do_includes): replace
-	  also locally defined modules.
-
-	* ext/iconv/iconv.c: backport Iconv::InvalidEncoding from CVS HEAD.
-
-	* ext/strscan/strscan.c: moved misplaced rdoc.
-
-Fri Mar  4 15:58:12 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/cgi-lib.rb: add deprecation warning. [ruby-dev:25499]
-	  getopts.rb, parsearg.rb, importenv.rb as well.
-
-Fri Mar  4 11:17:06 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Wed Nov 18 10:33:06 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/tcltklib/tcltklib.c (ip_rbUpdateCommand): get rid of
-	  warnings with Tcl/Tk 8.3 or former (backport from CVS_HEAD).
+	* ext/socket/ancdata.c (bsock_recvmsg_internal): stretch the buffer size
+	  when EMSGSIZE occurs on non HAVE_STRUCT_MSGHDR_MSG_CONTROL platforms
+	  (such as, Windows).  fixes a test error revealed by r52625.
 
-	* ext/tcltklib/tcltklib.c (ip_rb_threadUpdateCommand): ditto.
+Wed Nov 18 10:12:36 2015  Eric Wong  <e@80x24.org>
 
-Fri Mar  4 10:15:30 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/socket/ancdata.c (bsock_recvmsg_internal): use 4096 as
+	  default size to match pre-r52610, which also maps to a common
+	  page size.
 
-	* lib/set.rb (SortedSet::setup): a hack to shut up warning.
-	  [ruby-talk:132866]
+Wed Nov 18 10:05:25 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-Fri Mar  4 07:07:00 2005  NARUSE, Yui  <naruse@ruby-lang.org>
+	* doc/syntax/refinements.rdoc: update documentation to reflect
+	  recent changes.
+	  [ci skip] [ruby-core:71466] [Misc #11681] Patch by James Adam
 
-	* ext/nkf/nkf-utf8/nkf.c: follow nkf 1.63
+Wed Nov 18 09:50:21 2015  Naotoshi Seo  <sonots@gmail.com>
 
-Thu Mar  3 23:49:00 2005  NARUSE, Yui  <naruse@ruby-lang.org>
+	* test/logger/test_logdevice.rb: Fix tests of logger to make it work on
+	  windows (windows can not remove opened file) [Bug #11702]
 
-	* ext/nkf/nkf-utf8/nkf.c: follow nkf 1.62
+Wed Nov 18 06:59:52 2015  Eric Wong  <e@80x24.org>
 
-Thu Mar  3 11:49:51 2005  Kouhei Sutou  <kou@cozmixng.org>
+	* ext/socket/ancdata.c (bsock_recvmsg_internal): grow buffer
+	  on unspecified maxdatlen
+	  [ruby-core:71517] [Bug #11701]
+	* ext/socket/lib/socket.rb (Socket#recvmsg): nil default for dlen
+	  (Socket#recvmsg_nonblock): ditto
+	* test/socket/test_socket.rb (test_recvmsg_udp_no_arg): new test
 
-	* sample/rss/tdiary_plugin/rss-recent.rb: added site information.
+Tue Nov 17 19:50:06 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Wed Mar  2 19:53:07 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* win32/win32.c (fstat): declare for mingw.
 
-	* ext/extmk.rb (parse_args): add DESTDIR only when not directed
-	  already.  fixed: [ruby-dev:25781]
+Tue Nov 17 19:02:59 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Wed Mar  2 17:14:18 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* configure.in (BASERUBY): use Kernel#print instead of Kernel#p because
+	  the baseruby may output CRLF as end of line.
 
-	* ext/tcltklib/tcltklib.c (lib_eventloop_core): fix typo
+Tue Nov 17 15:34:34 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* NEWS: Added update from Unicode 7.0.0 to 8.0.0 [ci skip]
 
-Wed Mar  2 16:00:02 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Tue Nov 17 15:30:30 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* enc/unicode/casefold.h, name2ctype.h: Change Unicode
+	  Version for regular expressions from 7.0.0 to
+	  8.0.0 (with help from Kimihito Matsui) [Feature #11563]
 
-	* ext/tcltklib/tcltklib.c: enforce thread-check and exception-handling
-	  to avoid SEGV trouble.
-	  [KNOWN BUG] When supports pthread and running multiple Tk
-	  interpreters, an interrupt signal causes SEGV frequently. That
-	  may be a trouble of Ruby's signal handler.
+Tue Nov 17 14:36:00 2015  Kenichi Kamiya  <kachick1@gmail.com>
 
-	* ext/tk/tkutil/tkutil.c; fix a bug on converting a SJIS string array
-	  to a Tcl's list string.
+	* lib/ostruct.rb (dig): Implement OpenStruct#dig
+	  [Feature #11688]
 
-	* ext/tk/tcltklib.c: wrap Tcl's original "namespace" command to
-	  protect from namespace crash.
+Tue Nov 17 14:04:14 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/tk/lib/multi-tk.rb: enforce exception-handling.
+	* ext/socket/lib/socket.rb (Socket#recvmsg{,_nonblock}): default values
+	  of clen must be nil.
 
-	* ext/tk/lib/multi-tk.rb: catch IRB_EXIT to work on irb.
+	* ext/socket/ancdata.c (bsock_sendmsg_internal): handle nil of clen.
+	  fixes test errors introduced at r52602.
 
-	* ext/tk/lib/tk.rb: ditto.
+Tue Nov 17 13:43:46 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/tk/tcltklib.c: add TclTkLib.mainloop_thread?
+	* ext/socket/lib/socket.rb: UNIXSocket is not always exists.  fixes
+	  install error on Windows, introduced at r52601.
 
-	* ext/tk/lib/multi-tk.rb: (bug fix) callback returns a value.
+Tue Nov 17 11:27:23 2015  Eric Wong  <e@80x24.org>
 
-	* ext/tk/lib/tk/canvas.rb (delete): bug fix when multiple arguments.
+	* ext/socket/lib/socket.rb (Socket#recvfrom_nonblock):
+	  UDPSocket#recvfrom_nonblock):
+	  update doc for `exception: false` and destination buffer
+	  [ruby-core:69542] [Feature #11229]
+	  [ruby-core:69543] [Feature #11242]
 
-	* ext/tk/lib/clock.rb: fix 'no method error'.
+Tue Nov 17 11:25:05 2015  Eric Turner  <ericturnerdev@gmail.com>
 
-	* ext/tk/lib/clock.rb (self.clicks): accept a Symbol argument.
+	* array.c (rb_ary_dig), hash.c (rb_hash_dig): [DOC] Update
+	  comments describing dig methods.  [Fix GH-1103]
 
-	* ext/tk/lib/variable.rb: be able to set default_value_type; :numeric,
-	  :bool, :string, :symbol, :list, :numlist or nil (default; same to
-	  :string). If set a type, TkVariable#value returns a value of the
-	  type.
+	* struct.c (rb_struct_dig): [DOC] add rdoc.
 
-	* ext/tk/lib/tkextlib/tclx/tclx.rb: add Tk::TclX.signal to warn the
-	  risk of using TclX extension's 'signal' command.
+Tue Nov 17 11:22:22 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* NEWS: Small grammatical fix [ci skip]
 
-	* ext/tk/sample/irbtk.rb: irb with Ruby/Tk.
+Tue Nov 17 10:12:30 2015  Eric Wong  <e@80x24.org>
 
-	* ext/tk/sample/demos-*/anilabel.rb: bug fix on 'show code'
+	* ext/socket/lib/socket.rb (Socket.accept_loop): avoid exceptions
+	  (Socket.udp_server_recv): ditto
 
-	* ext/tk/sample/demos-*/aniwave.rb: new Ruby/Tk animation demo.
+Tue Nov 17 09:59:00 2015  Eric Wong  <e@80x24.org>
 
-	* ext/tk/sample/demos-*/pendulum.rb: ditto.
+	* ext/socket/ancdata.c (bsock_sendmsg_internal): avoid arg parsing
+	  [ruby-core:71439] [Feature #11339]
+	  (rsock_bsock_sendmsg): make private, adjust for above
+	  (rsock_bsock_sendmsg_nonblock): ditto
+	* ext/socket/rubysocket.h: adjust prototypes
+	  (rsock_opt_false_p): remove
+	* ext/socket/basicsocket.c (rsock_init_basicsocket):
+	  define private methods
+	* ext/socket/lib/socket.rb (BasicSocket#sendmsg): new wrapper
+	  (BasicSocket#sendmsg_nonblock): ditto
 
-	* ext/tk/sample/demos-*/goldberg.rb: ditto.
+Tue Nov 17 09:45:18 2015  Eric Wong  <e@80x24.org>
 
-	* ext/tk/sample/demos-*/widget: add entries of animation demos.
+	* ext/socket/ancdata.c (bsock_recvmsg_internal): avoid arg parsing
+	  (rsock_bsock_recvmsg): adjust for above change
+	  (rsock_bsock_recvmsg_nonblock): ditto
+	  [ruby-core:71439] [Feature #11339]
+	* ext/socket/rubysocket.h: adjust prototypes for above
+	* ext/socket/basicsocket.c (rsock_init_basicsocket):
+	  adjust private methods
+	* ext/socket/lib/socket.rb (BasicSocket#recvmsg): wrapper method
+	  (BasicSocket#recvmsg_nonblock): ditto
 
-Tue Mar  1 00:47:43 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+Tue Nov 17 08:36:34 2015  Eric Wong  <e@80x24.org>
 
-	* test/rinda/test_rinda.rb: backport from CVS_HEAD. use
-	  MockClock.sleep instead of Kernel.sleep [ruby-dev:25387]
+	* ext/socket/init.c (rsock_s_accept_nonblock): avoid parsing args
+	  [ruby-core:71439] [Feature #11339]
+	* ext/socket/rubysocket.h: adjust prototype
+	* ext/socket/socket.c (sock_accept_nonblock): make private
+	* ext/socket/tcpserver.c (tcp_accept_nonblock): ditto
+	* ext/socket/unixserver.c (unix_accept_nonblock): ditto
+	* ext/socket/lib/socket.rb (Socket#accept_nonblock):
+	  implement as wrapper, move RDoc
+	  (TCPServer#accept_nonblock): ditto
+	  (UNIXServer#accept_nonblock): ditto
 
-Tue Mar  1 00:34:24 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+Tue Nov 17 08:25:57 2015  Eric Wong  <e@80x24.org>
 
-	* lib/rinda/tuplespace.rb (Rinda::TupleSpace): improved keeper thread.
+	* ext/socket/socket.c (sock_connect_nonblock):
+	  avoid argument parsing in C.
+	  [ruby-core:71439] [Feature #11339]
+	* ext/socket/lib/socket.rb (Socket#connect_nonblock):
+	  new wrapper for private method, move RDoc
 
-	* test/rinda/test_rinda.rb: ditto.
+Tue Nov 17 08:16:09 2015  Eric Wong  <e@80x24.org>
 
-Mon Feb 28 11:42:23 2005  Ian Macdonald  <ian@caliban.org>
+	* ext/socket/init.c (rsock_s_recvfrom_nonblock):
+	  avoid arg parsing with C API
+	  [ruby-core:71439] [Feature #11339]
+	* ext/socket/basicsocket.c (bsock_recv_nonblock):
+	  adjust for above change, make private
+	* ext/socket/socket.c (sock_recvfrom_nonblock): ditto
+	* ext/socket/udpsocket.c (udp_recvfrom_nonblock): ditto
+	* ext/socket/lib/socket.rb (BasicSocket#recv_nonblock):
+	  new wrapper for private method, move RDoc
+	  (Socket#recvfrom_nonblock): ditto
+	  (UDPSocket#recvfrom_nonblock): ditto
 
-	* exception error messages updated.  [ruby-core:04497]
+Mon Nov 16 21:27:54 2015  Naohisa Goto  <ngotogenome@gmail.com>
 
-Mon Feb 28 09:03:09 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/dtrace/helper.rb (Dtrace::TestCase#trap_probe): dtrace buffer
+	  size is set as 8m on Solaris (default 4m). [Bug #11697]
 
-	* ext/socket/socket.c (Init_socket): add bunch of Socket
-	  constants.  Patch from Sam Roberts <sroberts@uniserve.com>.
-	  [ruby-core:04409]
+Mon Nov 16 20:03:14 2015  Naotoshi Seo  <sonots@gmail.com>
 
-Wed Feb 23 15:04:32 2005  akira yamada  <akira@ruby-lang.org>
+	* lib/logger.rb: Add Logger#reopen
 
-	* lib/uri/generic.rb (split_userinfo): should split ":pass" into ""
-	  and "pass".  [ruby-dev:25667]
+Mon Nov 16 18:21:52 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Feb 23 08:00:18 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* object.c (rb_obj_dig): dig in nested structs too.
 
-	* array.c (rb_ary_s_create): no need for negative argc check.
-	  [ruby-core:04463]
+	* struct.c (rb_struct_dig): new method Struct#dig.
+	  [Feature #11688]
 
-	* array.c (rb_ary_unshift_m): ditto.
+Mon Nov 16 17:41:33 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Feb 23 01:57:46 2005  Shugo Maeda  <shugo@ruby-lang.org>
+	* compile.c (iseq_peephole_optimize): optimize tail calls on aref
+	  and aset specialized instructions.
 
-	* lib/net/imap.rb (initialize): handle certs correctly. Thanks,
-	  NABEYA Kenichi. (backported from CVS HEAD)
+	* compile.c (iseq_peephole_optimize): optimize replaced leave
+	  instruction copied to jump instruction too.
 
-Tue Feb 22 07:25:18 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon Nov 16 16:39:38 2015  Akinori MUSHA  <knu@iDaemons.org>
 
-	* parse.y (parser_yylex): identfier after dot must not be a variable.
+	* lib/set.rb: Enable frozen_string_literal.
 
-Mon Feb 21 10:04:49 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* lib/set.rb: Move << out of the begin block that ensures pop.
 
-	* {bcc32,win32,wince}/Makefile.sub (config.h): add fcntl.
+Mon Nov 16 16:28:30 2015  Akinori MUSHA  <knu@iDaemons.org>
 
-	* win32/win32.[ch] (fcntl): ditto.
+	* lib/set.rb (Hash#flatten!, #add?, #delete?, #collect!, #reject!,
+	  #select!, #^, #classify): Micro-optimize some methods for
+	  performance and readability.
 
-	* win32/win32.c (rb_w32_connect): support nonblocking mode.
+Mon Nov 16 16:17:58 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* ext/socket/socket.c (wait_connectable, ruby_connect): support
-	  nonblocking connect on various platforms.
-	  all changes are backported from CVS HEAD. [ruby-core:3154],
-	  [ruby-core:4364].
+	* ChangeLog: fixed accidentally commit.
 
-Sun Feb 20 00:48:48 2005  Tanaka Akira  <akr@m17n.org>
+Mon Nov 16 16:10:51 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* lib/open-uri.rb (URI::FTP#buffer_open): access mechanism
-	  re-implemented according to RFC 1738.
-	  reported by Guillaume Marcais.  [ruby-talk:131650]
+	* mkconfig.rb: Add some high-level documentation.
+	  [ci skip][fix GH-1081] Patch by @ulfalizer
 
-Sat Feb 19 18:11:47 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+Mon Nov 16 15:59:14 2015  yui-knk  <spiketeika@gmail.com>
 
-	* lib/drb/drb.rb (DRbObject#respond_to?): take two arguments.
-	  [ruby-dev:25722]
+	* proc.c: Add call-seq of `Method#super_method`
+	  [ci skip][fix GH-1094]
 
-	* test/drb/drbtest.rb: ditto.
+Mon Nov 16 15:58:39 2015  Kenichi Kamiya  <kachick1@gmail.com>
 
-Sat Feb 19 13:52:02 2005  Tanaka Akira  <akr@m17n.org>
+	* struct.c: Standardize a method signature of Struct#[]=.
+	  [ci skip][fix GH-1095]
 
-	* lib/open-uri.rb: call OpenSSL::SSL::SSLSocket#post_connection_check
-	  after connection is made.
+Mon Nov 16 15:42:36 2015  Akinori MUSHA  <knu@iDaemons.org>
 
-Sat Feb 19 01:32:03 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* lib/set.rb (#>=, #>, #<=, #<): Make use of Hash#>=, #>, #<, and
+	  #<= when comparing against an instance of the same kind.
 
-	* ext/bigdecimal/lib/bigdecimal/newton.rb: resolved LoadError.
-	  [ruby-dev:25685]
+Mon Nov 16 15:37:11 2015  Naotoshi Seo  <sonots@gmail.com>
 
-	* ext/bigdecimal/sample/linear.rb: ditto.
+	* lib/logger.rb: Support symbol and string log level setting
 
-	* ext/bigdecimal/sample/nlsolve.rb: ditto.
+Mon Nov 16 15:33:11 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* ext/bigdecimal/lib/bigdecimal/nlsolve.rb: removed because this file
-	  is sample script and same file exists in ext/bigdecimal/sample.
+	* tool/rbinstall.rb: fix wrong permission for gem specification without
+	  zlib runtime. [Bug #11685][ruby-dev:49343]
 
-Fri Feb 18 17:14:00 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Mon Nov 16 12:11:11 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* lib/xmlrpc/parser.rb (XMLRPC::FaultException): make it subclass
-	  of StandardError class, not Exception class.  [ruby-core:04429]
+	* lib/webrick/httpauth/basicauth.rb: fix a typo.
+	  [ci skip][fix GH-1099] Patch by @jwworth
+	* lib/webrick/httpauth/digestauth.rb: ditto.
 
-Thu Feb 17 20:11:18 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Sun Nov 15 18:28:43 2015  Kenichi Kamiya  <kachick1@gmail.com>
 
-	* lib/drb/drb.rb (DRbServer.default_safe_level): fix typo.
+	* vm_method.c (set_method_visibility): should fail if the receiver
+	  is frozen.  [ruby-core:71489] [Bug #11687]
 
-Thu Feb 17 20:11:18 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Nov 14 22:15:07 2015  Tanaka Akira  <akr@fsij.org>
 
-	* test/digest/test_digest.rb: separate test case for each algorithms.
-	  [ruby-dev:25412]
+	* ext/socket/lib/socket.rb: Specify frozen_string_literal: true.
 
-Thu Feb 17 11:54:00 2005  Nathaniel Talbott  <ntalbott@ruby-lang.org>
+Sat Nov 14 21:44:56 2015  Tanaka Akira  <akr@fsij.org>
 
-	* lib/test/unit/collector.rb (collect_file): now deletes paths added
-	  to $LOAD_PATH instead of restoring it verbatim.
+	* lib/time.rb: Use "<<" to reduce string allocation.
 
-	* lib/test/unit/autorunner.rb (AutoRunner.run): fixed so that
-	  'ruby -rtest/unit -rtest1 -rtest2 -e0' will use the objectspace
-	  collector again. Also tried to simplify the calling convention.
+Sat Nov 14 17:45:49 2015  Tanaka Akira  <akr@fsij.org>
 
-	* test/runner.rb: adjusted for new AutoRunner semantics.
+	* lib/tsort.rb: Specify frozen_string_literal: true.
 
-	* lib/test/unit.rb: ditto.
+Sat Nov 14 17:25:15 2015  Tanaka Akira  <akr@fsij.org>
 
-Thu Feb 17 04:21:47 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/resolv-replace.rb: Specify frozen_string_literal: true.
 
-	* lib/open3.rb (Open3::popen3): $? should not be EXIT_FAILURE.
-	  fixed: [ruby-core:04444]
+Sat Nov 14 17:00:13 2015  Tanaka Akira  <akr@fsij.org>
 
-Thu Feb 17 00:09:45 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+	* lib/time.rb: Specify frozen_string_literal: true.
 
-	* test/drb/ignore_test_drb.rb: move TestDRbReusePort to new file
-	  [ruby-dev:25238]
+Sat Nov 14 16:43:02 2015  Tanaka Akira  <akr@fsij.org>
 
-	* test/drb/test_drb.rb: add method DRbService.ext_service, move
-	  TestDRbReusePort to new file [ruby-dev:25238]
+	* lib/open3.rb: Specify frozen_string_literal: true.
 
-	* test/drb/test_drb.rb: ditto.
+Sat Nov 14 05:04:09 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* test/drb/test_drbssl.rb: ditto.
+	* node.h: remove old comments.
 
-	* test/drb/test_drbunix.rb: ditto.
+Sat Nov 14 04:55:36 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* test/drb/ut_drb.rb: reduce sleep.
+	* refactoring CREF related code.
 
-Thu Feb 17 00:02:27 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* eval_intern.h: remove unused setter functions.
+	  CREF_CLASS_SET()
+	  CREF_NEXT_SET()
+	  CREF_SCOPE_VISI_COPY()
 
-	* eval.c (is_defined): NODE_IASGN is an assignment.
+	* eval_intern.h: rename flags:
+	  * NODE_FL_CREF_PUSHED_BY_EVAL_ -> CREF_FL_PUSHED_BY_EVAL
+	  * NODE_FL_CREF_OMOD_SHARED_ -> CREF_FL_OMOD_SHARED
+	  and use IMEMO_FL_USER1/2.
 
-Wed Feb 16 23:34:30 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+	* vm.c (vm_cref_new): accept push_by_eval parameter.
 
-	* lib/drb/drb.rb: add lazy stop_service. ([druby-ja:109])
+	* vm.c (vm_cref_new_use_prev): added for rb_vm_rewrite_cref().
 
-	* lib/drb/extserv.rb: ditto.
+	* vm_insnhelper.c (vm_cref_push): accept pushed_by_eval parameter.
 
-Wed Feb 16 17:07:57 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* vm_insnhelper.h: remove unused macros:
+	  COPY_CREF_OMOD() and COPY_CREF().
 
-	* ext/tk/tkutil.c: Follow the change of st.c (st_foreach)
-	  [ruby-list:40623].
-	  Sometimes mis-convert from a Ruby's Array of SJIS Strings, which
-	  includes some kind of SJIS characters, to a Tcl's UTF8 list string.
+	* vm_eval.c, insns.def: catch up this fix.
 
-Mon Feb 14 23:58:17 2005  Kouhei Sutou  <kou@cozmixng.org>
+Sat Nov 14 02:58:03 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/rss/parser.rb (RSS::ListenerMixin::tag_end):
-	  fixed invalid namespace handling bug.
+	* vm.c (vm_define_method): refactoring.
+	  * get CREF in this function.
+	  * cbase is no longer needed (CREF_CLASS(cref) is enough).
 
-Mon Feb 14 13:12:38 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* compile.c: RubyVM::FrozenCore.define_method only accept 2 args.
 
-	* ext/openssl/lib/openssl/ssl.rb
-	 (OpenSSL::SSL::SSLSocket#post_connection_check): new method.
+Sat Nov 14 02:34:43 2015  Koichi Sasada  <ko1@atdot.net>
 
-Mon Feb 14 00:40:49 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+	* vm.c (vm_define_method): do not use current CREF immediately,
+	  but check CREF in environment or methods. Methods defined in methods
+	  should be public.
+	  [Bug #11571]
 
-	* lib/drb/drb.rb (InvokeMethod.perform): pass DRb info to sub thread.
+	* vm_method.c (rb_scope_module_func_check): check CREF in env or me.
+	  if CREF is contained by `me', then return FALSE.
 
-	* test/drb/test_drb.rb (test_01_safe1_safe4_eval): fix test case.
+	* test/ruby/test_method.rb: add a test.
 
-Sun Feb 13 23:13:46 2005  Kouhei Sutou  <kou@cozmixng.org>
+Sat Nov 14 02:19:16 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/rss/dublincore.rb (RSS::DublicCoreModel#date{,=}): added
-	  convenient methods.
+	* method.h: constify rb_cref_t::scope_visi;
 
-	* lib/rss/0.9.rb (RSS::Rss::Channel#date{,=}): ditto.
+	* eval_intern.h (CREF_SCOPE_VISI_COPY): catch up this fix.
 
-	* lib/rss/2.0.rb (RSS::Rss::Channel::Item#date{,=}): ditto.
+	* vm_method.c: ditto.
 
-	* test/rss/: added tests for the convenient methods.
+Sat Nov 14 01:53:52 2015  Naohisa Goto  <ngotogenome@gmail.com>
 
-Sun Feb 13 22:43:03 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+	* pack.c (pack_unpack, AVOID_CC_BUG): Very ugly workaround for
+	  optimization bug of Oracle Solaris Studio 12.4 on Solaris
+	  with -xO4 optimization option. [Bug #11684]
 
-	* lib/drb/drb.rb (DRbServer): add default_safe_level, safe_level,
-	  config[:safe_level] ([druby-ja:120])
+Fri Nov 13 23:00:23 2015  Hiroshi Shirosaki  <h.shirosaki@gmail.com>
 
-	* test/drb/test_drb.rb, ut_eval.rb, ut_safe1.rb: ditto.
+	* configure.in: unset LD_PRELOAD on mingw. msys2 child processes
+	  crash at make test-all with LD_PRELOAD.
+	  [ruby-core:71461] [Bug #11680]
 
-Sun Feb 13 16:56:52 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Fri Nov 13 14:00:43 2015  Zachary Scott  <zzak@ruby-lang.org>
 
-	* lib/webrick/cgi.rb (WEBrick::CGI.start): should set reason-phrase
-	  to the value of status header field. ([ruby-dev:40617])
+	* ext/openssl/ossl_pkey.c: Merge ruby/openssl@b9ea8ef [Bug #10735]
 
-Sun Feb 13 00:52:33 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+Fri Nov 13 13:09:16 2015  Zachary Scott  <zzak@ruby-lang.org>
 
-	* lib/erb.rb (ERB::Util.h, u): make it module_function.
+	* ext/openssl/ossl_ssl.c: Merge ruby/openssl@81e1a30
 
-Sat Feb 12 17:29:19 2005  Tanaka Akira  <akr@m17n.org>
+	* test/openssl/test_ssl.rb: ditto
 
-	* lib/open-uri.rb (OpenURI.open_loop): send authentication only for
-	  the URI directly specified.
+Fri Nov 13 13:05:37 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Feb 12 15:07:23 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* prelude.rb (Thread.exclusive): warn as deprecated.
 
-	* random.c (rand_init): suppress warning.
+Fri Nov 13 10:36:39 2015  Victor Nawothnig  <Victor.Nawothnig@gmail.com>
 
-Sat Feb 12 13:54:03 2005  Tanaka Akira  <akr@m17n.org>
+	* parse.y (new_unless): optimize constant condition for `unless`
+	  as well as `if`.  [Fix GH-1092]
 
-	* lib/open-uri.rb: support https if the platform provides CA
-	  certificates.
+Fri Nov 13 10:08:41 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Sat Feb 12 06:18:28 2005  URABE Shyouhei  <shyouhei@ice.uec.ac.jp>
+	* ext/psych/psych.gemspec: bump version to 2.0.15
 
-	* ext/etc/etc.c (Init_etc): sGroup needs HAVE_ST_GR_PASSWD check.
-	  [ruby-dev:25675]
+Thu Nov 12 18:44:26 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Feb 11 17:40:42 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* parse.y (parser_magic_comment): should match exactly.
+	  [ruby-core:71460] [Bug #11679]
 
-	* ext/openssl/ossl_x509store.c (ossl_x509store_set_default_paths):
-	  new method OpenSSL::X509::Store#set_default_paths.
+Thu Nov 12 16:16:20 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Feb 11 11:33:53 2005  Tanaka Akira  <akr@m17n.org>
+	* template/prelude.c.tmpl: enable tail call optimization.
 
-	* lib/open-uri.rb (URI::HTTP#proxy_open): new option supported:
-	  :http_basic_authentication.
-	  suggested by Kent Sibilev.  [ruby-core:4392]
+Thu Nov 12 14:17:01 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Feb 11 06:30:07 2005  George Ogata  <g_ogata@optushome.com.au>
+	* parse.y (parser_yylex): ANDDOT at the head of the line denote
+	  line continuation from previous one to support fluent interface,
+	  as well as single dot.
 
-	* misc/ruby-mode.el: ignore parenthesis inside heredoc.
-	  [ruby-core:04415]
+Thu Nov 12 13:49:50 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Fri Feb 11 04:54:13 2005  Tilman Sauerbeck  <tilman@code-monkey.de>
+	* lib/rubygems: Update to RubyGems 2.5.0+ HEAD(db78980).
+	  this version includes #1367 , #1373 , #1375
+	* test/rubygems: ditto.
 
-	* lib/rdoc/generators/html_generator.rb: [ruby-core:04412]
+Thu Nov 12 10:53:41 2015  Eric Wong  <e@80x24.org>
 
-	* lib/rdoc/generators/ri_generator.rb: ditto.
+	* benchmark/bm_io_nonblock_noex2.rb: new benchmark based
+	  on bm_io_nonblock_noex.rb
+	* io.c (io_read_nonblock): move documentation to prelude.rb
+	  (io_write_nonblock): ditto
+	  (Init_io): private, internal methods for prelude.rb use only
+	* prelude.rb (IO#read_nonblock): wrapper + documentation
+	  (IO#write_nonblock): ditto
+	  [ruby-core:71439] [Feature #11339]
 
-Thu Feb 10 11:14:17 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+Wed Nov 11 18:30:28 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* win32/Makefile.sub (COMMON_HEADERS): shouldn't include winsock2.h.
+	* sprintf.c (rb_str_format): look up the key, then get default
+	  value and raise KeyError if the returned value is nil.
+	  [ruby-dev:49338] [Ruby trunk - Bug #11677]
 
-	* ext/socket/extconf.rb (sockaddr_storage): remove workaround for
-	  mswin32.
+Wed Nov 11 17:38:24 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Feb 10 10:29:16 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* vm_eval.c (local_var_list_add): skip internal local variable
+	  name by its type but not if it has a name.  internal local
+	  variable names are just unique per frame, not globally.
+	  [ruby-core:71437] [Bug #11674]
 
-	* ext/curses/curses.c: don't need to check HAVE_WCOLOR_SET excluding
-	  window_color_set().
+Wed Nov 11 14:14:33 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Thu Feb 10 00:47:25 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* transcode.c: fix a typo
+	[ci skip][fix GH-1091] Patch by @jwworth
 
-	* struct.c (make_struct): fixed: [ruby-core:04402]
+Wed Nov 11 11:58:38 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-Wed Feb  9 08:07:08 2005  Paul Duncan  <pabs@pablotron.org>
+	* lib/net/ftp.rb (initialize): Connections are in passive mode per
+	  default now.  The default mode can be changed by
+	  Net::FTP.default_passive=.
+	  [ruby-core:71146] [Feature #11612]
 
-	* ext/curses/curses.c (window_color_set): [ruby-core:04393]
+	* lib/net/ftp.rb (default_passive=, default_passive): new methods.
 
-Tue Feb  8 23:51:47 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+Wed Nov 11 09:03:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/drb/drb.rb: reject :instance_eval, :class_eval, :module_eval
-	  [druby-ja:117]
+	* sprintf.c (rb_str_format): respect default value of a hash.  no
+	  longer raises KeyError unless the default value of the hash is
+	  nil.  [ruby-core:71354] [Bug #11661]
 
-Tue Feb  8 13:06:12 2005  Sam Roberts  <sroberts@uniserve.com>
+Tue Nov 10 20:35:12 2015  Tanaka Akira  <akr@fsij.org>
 
-	* ext/socket/socket.c (Init_socket): SO_REUSEPORT added.
-	  [ruby-talk:130092]
+	* lib/open-uri.rb: Remove indicator for "frozen_string_literal: true".
 
-Tue Feb  8 09:30:01 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/pp.rb: Ditto.
 
-	* lib/cgi.rb (CGI::Cookie): [ruby-talk:130040]
+	* lib/prettyprint.rb: Ditto.
 
-Tue Feb  8 00:19:02 2005  Tanaka Akira  <akr@m17n.org>
+	* lib/resolv.rb: Ditto.
 
-	* lib/resolv.rb (Resolv::DNS::Name#subdomain_of?): new method.
-	  (Resolv::DNS::Name#inspect): ditto.
-	  Suggested by Sam Roberts.  [ruby-talk:129086]
+	* lib/securerandom.rb: Ditto.
 
-Mon Feb  7 10:06:30 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/tmpdir.rb: Ditto.
 
-	* object.c: [ruby-doc:818]
+	* lib/unicode_normalize/tables.rb: Ditto.
 
-Mon Feb  7 01:56:20 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* test/net/ftp/test_buffered_socket.rb: Ditto.
 
-	* instruby.rb, rubytest.rb (srcdir): no longer embed srcdir into
-	  rbconfig.rb. (backported from CVS HEAD)
+	* test/net/ftp/test_mlsx_entry.rb: Ditto.
 
-	* ext/socket/extconf.rb (sockaddr_storage): winsock2.h have the
-	  definition of struct sockaddr_storage, but socket.c doesn't
-	  include it because this version of ruby still has binary level
-	  compatibility with winsock1.
+	* test/open-uri/test_open-uri.rb: Ditto.
 
-	* lib/mkmf.rb (create_makefile): should support header files in
-	  depend file.
+	* test/open-uri/test_ssl.rb: Ditto.
 
-Mon Feb  7 01:21:50 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/pathname/test_pathname.rb: Ditto.
 
-	* ext/socket/extconf.rb: check if getaddrinfo() works fine only when
-	  wide-getaddrinfo option is not given.  fixed: [ruby-dev:25422]
+	* test/test_pp.rb: Ditto.
 
-	* lib/mkmf.rb ($extmk): check if under ext directory.
+	* test/test_prettyprint.rb: Ditto.
 
-	* lib/mkmf.rb (Logging.postpone): allow recursive operation.
+	* tool/transcode-tblgen.rb: Ditto.
 
-	* lib/mkmf.rb (try_constant): make sure if really a constant, reduce
-	  the number of times of compile.
+	* ext/pathname/lib/pathname.rb: Ditto.
 
-	* lib/mkmf.rb (have_macro, have_var, byte_order): new functions.
+Tue Nov 10 18:42:24 2015  Aleksandrs Ledovskis  <aleksandrs@ledovskis.lv>
 
-	* lib/mkmf.rb (find_library): allow directory list with separators.
+	* defs/id.def, parse.y: Switch internal token name to reflect
+	  current form of safe-call operator.  [Fix GH-1090]
 
-	* lib/mkmf.rb (arg_config): manage provided configuration options.
+Tue Nov 10 18:25:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/mkmf.rb (dir_config): accept arrays of directory names as
-	  default values.
+	* hash.c (rb_hash_to_proc): use rb_func_proc_new to make light
+	  weight proc.  [Feature #11653]
 
-	* mkconfig.rb: no longer embed srcdir and compile_dir into
-	  rbconfig.rb.
+Tue Nov 10 18:23:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/mkmf.rb (create_makefile): fix unbalanced parens.
+	* proc.c (cfunc_proc_t): add room for me.
 
-Sun Feb  6 19:23:01 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* proc.c (cfunc_proc_new): generalise for cfunc proc without env.
 
-	* eval.c (stack_extend): add prototype because VC++8 doesn't
-	  accept __declspec(noinline) with K&R style function definitions.
-	  (backported from CVS HEAD)
+	* proc.c (rb_func_proc_new, rb_func_lambda_new): new functions to
+	  make proc/lambda without env from cfunc.
 
-Sun Feb  6 14:14:26 2005  Tadayoshi Funaba  <tadf@dotrb.org>
+Tue Nov 10 17:32:35 2015  Naohisa Goto  <ngotogenome@gmail.com>
 
-	* lib/date.rb (new_with_hash): changed messages of exception.
+	* bootstraptest/test_fork.rb ([ruby-dev:37934]): :NPROC (RLIMIT_NPROC)
+	  is not supported on some platforms (e.g. Solaris 10).
 
-	* lib/date/format.rb (str[fp]time): undocumented conversion
-	  specifications %[1-3] are now deprecated.
+Tue Nov 10 16:57:14 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Feb  6 12:20:11 2005  Akinori MUSHA  <knu@iDaemons.org>
+	* hash.c (rb_hash_to_proc): new method Hash#to_proc.
+	  [Feature #11653]
 
-	* bignum.c (rb_big2ulong_pack): One too many arguments are passed
-	  to big2ulong().
+Tue Nov 10 14:34:09 2015  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* re.c (rb_reg_init_copy, rb_reg_initialize_m): One too many
-	  arguments are passed to rb_reg_initialize().
+	* time.c (rb_time_timespec_new): swap utc and localtime
+	  to generate gmt flag by INT_MAX - gmtoff.
 
-Sun Feb  6 03:24:20 2005  Tanaka Akira  <akr@m17n.org>
+Tue Nov 10 14:01:59 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/resolv.rb (Resolv::DNS::Resource::TXT): multiple strings was not
-	  handled.
-	  (Resolv::DNS::Resource::TXT#strings): new method to return all
-	  strings.
-	  (Resolv::DNS::Message::MessageEncoder#put_string_list): new method.
-	  (Resolv::DNS::Message::MessageDecoder#get_string_list): ditto.
-	  based on [ruby-talk:129732] by Sam Roberts.
+	* hash.c (rb_hash_{le,lt,ge,gt}): new methods, Hash#<=, Hash#<,
+	  Hash#>=, Hash#>, to test if all elements of a hash are also
+	  included in another hash, and vice versa.
+	  [ruby-core:68561] [Feature #10984]
 
-Fri Feb  4 00:30:45 2005  Kouhei Sutou  <kou@cozmixng.org>
+Tue Nov 10 11:25:29 2015  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/rss: supported Image module.
-	  http://web.resource.org/rss/1.0/modules/image/
+	* time.c (rb_timespec_now): added.  [Feature #11558]
 
-Thu Feb  3 23:42:36 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* time.c (rb_time_timespec_new): added.  [Feature #11558]
 
-	* ext/stringio/stringio.c (strio_close, strio_close_read, strio_close_write):
-	  should return nil instead of self as well as IO.  [ruby-dev:25623]
+Tue Nov 10 06:17:17 2015  Eric Wong  <e@80x24.org>
 
-	* ext/stringio/stringio.c (strio_extend, strio_putc): fill with zero
-	  extended portion.  [ruby-dev:25626]
+	* variable.c (rb_autoload_load): allow recursive calls
+	  [ruby-core:71345] [Bug #11658]
+	* test/ruby/test_autoload.rb (test_autoload_while_autoloading):
+	  new test by: Hiroshi Shirosaki <h.shirosaki@gmail.com>
+	  [ruby-core:71390]
 
-Wed Feb  2 23:52:53 2005  sheepman  <sheepman@tcn.zaq.ne.jp>
+Tue Nov 10 00:36:46 2015  Tanaka Akira  <akr@fsij.org>
 
-	* ext/stringio/stringio.c (strio_truncate): should MEMZERO an extended
-	  part.  [ruby-dev:25618]
+	* lib/resolv.rb (Resolv::DNS::Message::MessageEncoder#put_labels):
+	  Prevent overflow of pointer to labels.
+	  Patch by Hannes Georg.  [ruby-core:71248] [Bug #11632]
 
-Wed Feb  2 21:56:01 2005  Kouhei Sutou  <kou@cozmixng.org>
+Tue Nov 10 00:25:41 2015  Kazuki Tsujimoto  <kazuki@callcc.net>
 
-	* lib/rss/rss.rb (RSS::Element#convert): added.
+	* gems/bundled_gems: update to power_assert 0.2.6.
 
-	* lib/rss/rss.rb: convert -> need_convert.
+Mon Nov  9 21:48:17 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/rss/1.0.rb: ditto.
+	* vm_eval.c (rb_check_funcall_default): split from
+	  rb_check_funcall to return the given fallback value.
 
-	* lib/rss/0.9.rb: ditto.
+	* object.c (rb_obj_dig): use rb_check_funcall_default so that tail
+	  call optimization will be possible.  [Feature #11643]
 
-	* lib/rss/2.0.rb: ditto.
+Mon Nov  9 21:27:23 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/rss/trackback.rb: ditto.
+	* array.c (rb_ary_dig): new method Array#dig.
 
-Tue Feb  1 22:48:48 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+	* hash.c (rb_hash_dig): new method Hash#dig.
 
-	* lib/drb/drb.rb (DRb::DRbObject#respond_to?): check marshal_dump and
-	  _dump.
+	* object.c (rb_obj_dig): dig in nested arrays/hashes.
+	  [Feature #11643]
 
-Tue Feb  1 00:20:23 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon Nov  9 18:00:47 2015  Yuki Nishijima  <mail@yukinishijima.net>
 
-	* configure.in (aix): fix linker flags on AIX.  [ruby-talk:125460]
+	* gems/bundled_gems: Upgrade the did_you_mean gem to 1.0.0.beta3
 
-Mon Jan 31 13:33:21 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Mon Nov  9 17:38:14 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* ext/tcltklib/tcltklib.c: add invalid namespace check
+	* test/runner.rb: use official repository for coverage tool.
+	* Makefile.in: ditto.
+	* common.mk: ditto.
+	* .gitignore: ignored third party repositories.
 
-	* ext/tk/lib/multi-tk.rb: add invalid_namespace? method
+Mon Nov  9 17:29:09 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* ext/tk/lib/remote-tk.rb: ditto
+	* compile.c (iseq_compile_each): Dynamic string literals should be
+	  frozen.
+	  [ruby-core:57574] [Feature #8976]
 
-Mon Jan 31 10:29:18 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Mon Nov  9 15:56:07 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* lib/irb/context.rb (IRB::Context::initialize): [ruby-core:04330]
+	* common.mk: Use ruby organization url for simplecov repository.
 
-Sat Jan 29 09:42:12 2005  Sam Roberts  <sroberts@uniserve.com>
+Sun Nov  8 16:24:09 2015  Masaki Matsushita <glass.saga@gmail.com>
 
-	* lib/resolv.rb (Resolv::DNS::Resource::IN::SRV): Added RFC2782 SRV
-	  resource record for specifying location of services.
+	* NEWS: describe addition of File::TMPFILE
 
-Fri Jan 28 17:16:55 2005  Tanaka Akira  <akr@m17n.org>
+Sun Nov  8 15:19:17 2015  Masaki Matsushita <glass.saga@gmail.com>
 
-	* lib/resolv.rb (Resolv::DNS::Config.parse_resolv_conf):
-	  parse options line for ndots option.
-	  (Resolv::Hosts#lazy_initialize): return self.
-	  (Resolv::DNS#lazy_initialize): ditto.
-	  (Resolv::DNS::Config#lazy_initialize): ditto.
-	  Suggested by Sam Roberts.
+	* file.c: Add O_TMPFILE.
 
-Thu Jan 27 13:18:03 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sun Nov  8 14:24:43 2015  windwiny  <windwiny.ubt@gmail.com>
 
-	* st.c (st_foreach): report success/failure by return value.
-	  [ruby-Bugs-1396]
+	* method.h (METHOD_ENTRY_{VISI,BASIC,FLAGS}_SET): suppress
+	  shift-op-parentheses warnings.  [Fix GH-1082]
 
-Thu Jan 27 00:15:29 2005  Minero Aoki  <aamine@loveruby.net>
+Sun Nov  8 14:01:22 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* test/fileutils/test_fileutils.rb (setup): support BSD-style
-	  directory group inheritance. (backport from HEAD, rev 1.32)
+	* ext/psych/psych_emitter.c: backport 5bd7744 from tenderlove/psych.
+	  support backward compatibility of Ruby 2.0
 
-	* test/fileutils/fileasserts.rb (assert_same_entry): show entry
-	  difference. (backport from HEAD, rev 1.4)
+Sun Nov  8 10:55:10 2015  Anton Davydov  <antondavydov.o@gmail.com>
 
-Wed Jan 26 23:09:11 2005  Minero Aoki  <aamine@loveruby.net>
+	* io.c (rb_io_gets_m): Update IO#gets doc for characters more than
+	  1 byte.  [Fix GH-1085]
 
-	* lib/net/protocol.rb (WriteAdapter#puts): should append \n, not
-	  prepend. [ruby-talk:128302] (backport from HEAD, rev 1.75)
+Sun Nov  8 10:37:58 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Wed Jan 26 10:51:50 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* lib/uri/ftp.rb: fix a typo.
+	  [fix GH-1084][ci skip] Patch by @windwiny
 
-	* win32/win32.c (flock_winnt, flock_win95): unlock file even if
-	  LOCK_NB is specified. (backported from CVS HEAD)
+Sun Nov  8 08:10:31 2015  Koichi Sasada  <ko1@atdot.net>
 
-Tue Jan 25 17:11:51 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* vm_trace.c (exec_hooks_precheck): check need_clean everytime
+	  to clean-up unused hooks.
 
-	* ruby.c (proc_options): correct -T option in RUBYOPT. (backported
-	  from CVS HEAD)
+	* vm_trace.c (list->need_clean): use as boolean value.
 
-Tue Jan 25 14:05:52 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Sun Nov  8 01:31:27 2015  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/tcltklib/tcltklib.c: fix SEGV bug; trouble on canceling remained
-	  after scripts [ruby-dev:25479]: NULL current namespace when deleting
-	    Tk interpreter [ruby-talk:126225]
+	* lib/net/http.rb (Net::HTTP#initialize):
+	  default value of Net::HTTP#open_timeout is now 60 (was nil).
 
-	* ext/tcltklib/extconf.rb: bug fix; TCL_ENABLE_THREAD flag is inverted
-	  [ruby-talk:126360]
+Sat Nov  7 12:18:05 2015  Eric Wong  <e@80x24.org>
 
-	* ext/tcltklib/extconf.rb: add yet another native-thread check
+	* string.c (id_to_s): remove redundant variable
+	  (rb_obj_as_string): trade id_to_s for idTo_s
+	  (rb_str_equal): replace rb_intern(...) with pre-defined ID
+	  (rb_str_cmp_m): ditto
+	  (rb_str_match): ditto
+	  (str_upto_each): ditto
+	  (rb_str_sum): ditto
+	  (Init_String): remove id_to_s initialization
 
-	* ext/tk/tkutil.c: fix SEGV bug; NULL string pointer when finalize
-	  Ruby interpreter
+Sat Nov  7 11:40:05 2015  Eric Wong  <e@80x24.org>
 
-	* ext/tk/lib/multi-tk.rb: avoid warning for deleted safeTk ip frame
+	* thread.c (rb_cThreadShield): make static
 
-	* ext/tk/lib/tk/bindtag.rb: bug fix; new method of named bindtag
-	  doesn't return the created object [ruby-dev:25479]
+Sat Nov  7 09:51:38 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/tk/lib/tk/menu.rb: bug on treating arguments [ruby-dev:25479]
+	* vm_trace.c (rb_threadptr_exec_event_hooks_orig):
+	  maintain trace_running counter on internal events.
 
-	* ext/tk/lib/tk.rb: bug fix; cannot accept a callback ID string for
-	  a command argument [ruby-dev:25479]
+	  This patch is made by Takashi Kokubun <takashikkbn@gmail.com>.
+	  [Bug #11603] https://github.com/ruby/ruby/pull/1059
 
-	* ext/tk/lib/multi-tk.rb: ditto
+Sat Nov  7 03:32:27 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/tk/lib/tk/*.rb: ditto
+	* include/ruby/ruby.h (RSTRUCT_PTR): need a close parenthesis.
 
-	* ext/tk/lib/tkextlib/*.rb: ditto
+Sat Nov  7 01:32:06 2015  Naohisa Goto  <ngotogenome@gmail.com>
 
-	* ext/tk/sample/demos-jp/anilabel.rb: new demo script
+	* dir.c (dir_fileno, dirfd): support of Dir#fileno on Solaris 10.
+	  Solaris 10 does not have dirfd, but the file descriptor of a
+	  directory is stored in the d_fd or dd_fd member in the DIR struct.
+	  Note that Solaris 11 has dirfd(3C).
 
-	* ext/tk/sample/demos-en/anilabel.rb: ditto
+	* configure.in: checks for DIR.d_fd and DIR.dd_fd on Solaris 10.
 
-	* ext/tk/sample/tkHTML/ss.rb: local variable scope bug fix
-	  [ruby-dev:25479]
+Fri Nov  6 23:13:53 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
 
-Mon Jan 24 15:44:25 2005  Tilman Sauerbeck  <tilman@code-monkey.de>
+	* array.c: clarifies Array#reject! documentation.
+	  [fix GH-894][ci skip] Patch by @GxSplinter
 
-	* lib/rdoc/parsers/parse_c.rb: allow whitespace after function names.
-	  [ruby-core:4296]
+Fri Nov  6 20:18:25 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* lib/rdoc/parsers/parse_simple.rb: adds support for private comments
-	  in the "simple" parser. [ruby-core:4301]
+	* test/runner.rb: extracted test helper.
+	* test/lib/zombie_hunter.rb: ditto.
 
-Mon Jan 24 15:44:25 2005  Charles Mills  <cmills@freeshell.org>
+Fri Nov  6 18:07:47 2015  Naohisa Goto  <ngotogenome@gmail.com>
 
-	* lib/rdoc/parsers/parse_c.rb: adds support for constants
-	  (rb_define_const), accessors (rb_define_attr), and makes a
-	  couple fixes. [ruby-core:4307]
+	* include/ruby/ruby.h (rb_array_const_ptr, rb_struct_const_ptr):
+	  Suppress pointer type mismatch warnings occurred with old version
+	  of Fujitsu C Compiler (fcc) on Solaris 10. The warnings cause
+	  failure of TestMkmf::TestConvertible. [Bug #11644] [ruby-dev:49326]
+	* include/ruby/ruby.h (FIX_CONST_VALUE_PTR): macro for the above,
+	  only effective with fcc.
 
-Mon Jan 24 15:44:25 2005  Florian Gro  <florgro@gmail.com>
+Fri Nov  6 12:39:21 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/rdoc/parsers/parse_rb.rb: Logic for def Builtin.method() end
-	  [ruby-core:4302]
+	* defs/id.def (token_ops), parse.y (parser_yylex): change DOTQ
+	  from ".?" to "&.".  [ruby-core:71363] [Feature #11537]
 
-Mon Jan 24 15:44:25 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Nov  6 09:01:26 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* document updates - [ruby-core:04296], [ruby-core:04301],
-	  [ruby-core:04302], [ruby-core:04307]
+	* parse.y (kwd_append): fix segv after invalid keyword argument,
+	  preceding keyword list is NULL when syntax error is there.
+	  [ruby-core:71356] [Bug #11663]
 
-Sun Jan 23 12:41:16 2005  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Fri Nov  6 06:59:37 2015  Eric Wong  <e@80x24.org>
 
-	* lib/soap/wsdlDriver.rb: from 1.5.3-ruby1.8.2, operation which has
-	  capitalized name (such as KeywordSearchRequest in AWS) is defined as
-	  a method having uncapitalized name. (converted with
-	  GenSupport.safemethodname to handle operation name 'foo-bar').  it
-	  introduced serious incompatibility; in the past, it was defined as a
-	  capitalized.
+	* test/ruby/test_autoload: hoist out ruby_impl_require
 
-	  define capitalized method as well under that circumstance.
+Thu Nov  5 13:03:58 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Jan 23 05:24:42 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* defs/id.def (token_ops): gather associations between IDs,
+	  operators, and parser tokens.
 
-	* ext/openssl/ossl_ocsp.c (ossl_ocspreq_to_der): should call
-	  GetOCSPReq at first.
+Thu Nov  5 10:17:17 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Jan 22 23:09:47 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+	* ext/socket/socket.c (make_addrinfo): use RARRAY_ASET for
+	  write-barrier.
 
-	* lib/drb/ssl.rb (accept): rescue SSLError. [druby-ja:110]
+	* ext/tk/tcltklib.c ({call,eval,invoke}_queue_handler): ditto.
 
-Sat Jan 22 22:35:03 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+	* ext/tk/tkutil/tkutil.c (ary2list, ary2list2): ditto.
 
-	* lib/drb/unix.rb: fail if UNIXFileOwner is set. [druby-ja:111]
+Thu Nov  5 10:09:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Jan 21 23:58:42 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/**/*.c: prefer RARRAY_AREF to indexing RARRAY_CONST_PTR.
+	  pointed out by hanmac.
+	  https://github.com/ruby/ruby/commit/3553a86#commitcomment-14187670
 
-	* ext/stringio/stringio.c (strio_set_pos): clear EOF flag.
-	  [ruby-talk:127511]
+Wed Nov  4 17:33:24 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Fri Jan 21 20:07:02 2005  Tanaka Akira  <akr@m17n.org>
+	* lib/debug.rb: Add documentation for #thread_list_all.
+	  [Misc #11580][ci skip]
 
-	* lib/resolv.rb (Resolv::DNS::Config.resolv): don't raise ResolvError.
-	  reported by Sam Roberts.  [ruby-talk:127133]
+Wed Nov  4 15:45:59 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Fri Jan 21 16:58:10 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* class.c: fix documentation for rb_define_class{_id}_under.
+	  [fix GH-991][ci skip] Patch by @kachick
 
-	* dir.c (rb_push_glob): should work for NUL delimited patterns.
+Wed Nov  4 15:40:45 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Fri Jan 21 13:58:37 2005  Shugo Maeda  <shugo@ruby-lang.org>
+	* method.h: fix typo. Patch by @davydovanton
+	  [fix GH-1076][ci skip]
 
-	* lib/net/imap.rb (u8tou16): fixed typo. fixed: [ruby-list:40546]
-	  (backported from CVS HEAD)
+Wed Nov  4 15:39:32 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Fri Jan 21 09:30:16 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* hash.c: use correct grammar. Patch by @tveastman
+	  [fix GH-1079][ci skip]
 
-	* rubyio.h (rb_eof_error): should mark as NORETURN. (backported
-	  from CVS HEAD)
+Wed Nov  4 11:38:23 2015  Jake Worth  <jakeworth82@gmail.com>
 
-Fri Jan 21 00:31:36 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* process.c (proc_getsid): [DOC] Fix double word 'for' and typo.
+	  [Fix GH-1080]
 
-	* ext/syck/rubyext.c (syck_parser_bufsize_set): avoid VC++ warning
-	  "local variable 'size' used without having been initialized".
+Wed Nov  4 06:01:52 2015  Eric Wong  <e@80x24.org>
 
-Thu Jan 20 19:03:24 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* include/ruby/ruby.h (struct RObject): hide iv_index_tbl type
+	  [ruby-core:71306] [Feature #11647]
 
-	* ext/extmk.rb (extmake): shouldn't set $extflags on mswin32.
+Tue Nov  3 06:48:58 2015  Eric Wong  <e@80x24.org>
 
-	* win32/Makefile.sub (LIBRUBY_SO): should use $DLDOBJS instead of
-	  $EXTOBJS.
-	  fixed: [ruby-core:04290] (backported from CVS HEAD)
+	* variable.c (find_class_path): remove cast for rb_class_ivar_set
+	  (rb_ivar_set): ditto
+	  (rb_cvar_set): ditto
 
-Thu Jan 20 11:42:02 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Tue Nov  3 06:18:21 2015  Eric Wong  <e@80x24.org>
 
-	* string.c (rb_str_new4): should propagate taintedness.
+	* variable.c (rb_global_tbl): convert to id_table
 
-	* struct.c (rb_struct_set): use original method name, not callee
-	  name, to retrieve member slot.  [ruby-core:04268]
+Tue Nov  3 01:58:46 2015  Naohisa Goto  <ngotogenome@gmail.com>
 
-	* time.c (time_strftime): protect from format modification from GC
-	  finalizers.
+	* parse.y (NO_QCALL): fix type mismatch of operands that causes
+	  compile error with Oracle Solaris Studio on Solaris.
+	  [Bug #11645] [ruby-dev:49327]
 
-Wed Jan 19 18:06:40 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+Sun Nov  1 17:14:36 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/ipaddr.rb (to_s, test_to_s): too many colons with some cases.
-	  (backported from CVS HEAD)
+	* id_table.c (mix_id_table_insert): do not touch list during
+	  list->hash transition because GC can run during transition.
 
-Wed Jan 19 01:16:30 2005  Tanaka Akira  <akr@m17n.org>
+Sun Nov  1 11:07:31 2015  Eric Wong  <e@80x24.org>
 
-	* lib/resolv.rb (Resolv::DNS::Config.parse_resolv_conf): ignore
-	  domain and search directive without an argument.
-	  reported by Sam Roberts.  [ruby-talk:126781]
+	* iseq.c (iseq_memsize): account for rb_call_cache entries
 
-Tue Jan 18 15:03:05 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Sun Nov  1 09:12:10 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/webrick/ssl.rb (WEBrick::Config::SSL): the default value
-	  of :SSLEnable is false.
+	* parse.y (parser_yylex): ':' separated by a comment and a newline
+	  is not valid as symbol.
 
-	* lib/webrick/server.rb (WEBrick::Daemon.start): prepared stdio
-	  don't allow changing its mode.
+Sat Oct 31 20:15:48 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* lib/webrick/httpproxy.rb (WEBrick::HTTPProxyServer#proxy_service):
-	  should delete trailing LF from the result of pack("m*").
+	* test/openssl/test_pair.rb: skipped tests if openssl doesn't support
+	  ECDH cipher.
 
-	* lib/webrick/httpproxy.rb (WEBrick::HTTPProxyServer#proxy_connect):
-	  - should delete trailing LF from the result of pack("m*").
-	  - clear Request-Line not to send the response by HTTPServer#run.
+Sat Oct 31 14:58:10 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/webrick/httputils (WEBrick::HTTPUtils.parse_qvalues):
-	  refine regexp (and change the name of a local variable).
+	* man/ruby.1 (SYNOPSIS): remove extraneous space for -F option as
+	  it does not allow spaces before its argument.
+	  [ruby-core:71283] [Bug #11641]
 
-	* lib/webrick/httputils.rb (WEBrick::HTTPUtils#escape_path): add
-	  new method to escape URI path component.
+Sat Oct 31 14:58:01 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/webrick/cgi.rb (WEBrick::CGI::Socket#request_line): should
-	  escape SCRIPT_NAME and PATH_INFO before being parsed as a URI.
+	* man/ruby.1 (SYNOPSIS): remove extraneous space for -F option as
+	  it does not allow spaces before its argument.
+	  [ruby-core:71283] [Bug #11641]
 
-	* test/webrick/*, sample/webrick/httpproxy.rb: add new file.
+Sat Oct 31 10:22:49 2015  yui-knk  <spiketeika@gmail.com>
 
-Mon Jan 17 23:33:46 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* eval_error.c (undef_mesg_for): fix typo.  Before this commit
+	  `ArgumentError: malformed format string - %$` was raised when
+	  `NameError#message` is called.  [ruby-core:71282] [Bug #11640]
+	  [Fix GH-1077]
 
-	* configure.in (aix): fix typo.  [ruby-talk:126401]
+Fri Oct 30 21:12:45 2015  Kazuki Tsujimoto  <kazuki@callcc.net>
 
-Mon Jan 17 07:08:51 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* gems/bundled_gems: update to power_assert 0.2.5.
 
-	* ext/readline/readline.c: suppress warnings.
+Fri Oct 30 19:29:52 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/irb/extend-command.rb (IRB::ContextExtender.def_extend_command):
-	  ditto.
-
-	* lib/irb/ext/history.rb (IRB::Context::set_last_value): ditto.
-
-	* lib/irb/ext/history.rb (IRB::Context::eval_history): ditto.
-
-	* lib/irb/locale.rb (IRB::Locale::real_load): ditto.
-
-	* lib/irb/slex.rb (SLex::Node::create_subnode): remove garbage.
-
-Mon Jan 17 00:09:42 2005  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* gc.c (newobj_slowpath): do not need to use flags hack (commit miss).
 
-	* lib/uri/common.rb (PORT): typo fix. fixed: [ruby-core:04256]
+Fri Oct 30 19:08:48 2015  Koichi Sasada  <ko1@atdot.net>
 
-Sat Jan 15 14:57:22 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* gc.c (heap_get_freeobj_from_next_freepage): not so UNLIKELY.
 
-	* ruby.c (proc_options): ignore trailing CRs at the end of short
-	  options as well as long options.  fixed: [ruby-core:04232]
+Fri Oct 30 18:09:51 2015  Koichi Sasada  <ko1@atdot.net>
 
-Sat Jan 15 13:35:16 2005  Kouhei Sutou  <kou@cozmixng.org>
+	* gc.c (newobj_slowpath): reduce 1 parameter to use only registers
+	  for performance.
 
-	* lib/rss/rss.rb (RSS::VERSION): 0.1.2 -> 0.1.3.
+	  On my laptop, 'N.times{x = []}' (where N = 29_000_000) is
+	  1.86 sec -> 1.74 sec.
 
-	* lib/rss/rss.rb: accept inheritance. [ruby-talk:126104]
+Fri Oct 30 12:53:21 2015  yui-knk  <spiketeika@gmail.com>
 
-Thu Jan 13 04:48:53 2005  Tanaka Akira  <akr@m17n.org>
+	* test/ruby/test_call.rb: added test for safe navigation operator.
+	  [fix GH-1066]
 
-	* io.c (io_fread): don't warn nonblocking behavior by default.
+Fri Oct 30 12:47:34 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Wed Jan 12 00:36:29 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ChangeLog: fix wrong commit name.
 
-	* object.c (rb_class_superclass): superclass of singleton class also
-	  should be a singleton class.  fixed: [ruby-list:40519]
+Fri Oct 30 12:36:16 2015  yui-knk  <spiketeika@gmail.com>
 
-Tue Jan 11 09:44:40 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* vm_method.c: added documentation of protected/private methods.
+	  [fix GH-1072]
+	* test/ruby/test_module.rb: added testcase for method_defined?
+	  [fix GH-1071]
 
-	* numeric.c (Init_Numeric): turn off floating point exceptions
-	  on bcc32. "1e300".to_f had crashed by overflow.
+Fri Oct 30 12:06:59 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Jan 11 03:10:10 2005  Minero Aoki  <aamine@loveruby.net>
+	* variable.c (rb_class_ivar_set): rename as class specific ivar
+	  setter, and st_table is no longer involved.
 
-	* lib/fileutils.rb (copy_entry): could not copy symbolic link.
-	  [ruby-talk:125733]
+Fri Oct 30 11:36:33 2015  Eric Wong  <e@80x24.org>
 
-	* lib/fileutils.rb (copy_stream): use read/write instead of
-	  sysread/syswrite.
+	* variable.c (generic_ivar_remove): adjust type, set valp
+	  (rb_obj_remove_instance_variable): simplify call
+	* test/ruby/test_object.rb (test_remove_instance_variable):
+	  expand for implementation details
 
-Mon Jan 10 23:08:15 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Oct 30 10:37:56 2015  Eric Wong  <e@80x24.org>
 
-	* variable.c (rb_autoload): hide internal data from ruby level.
-	  fixed: [ruby-dev:25435], [ruby-list:40498]
+	* internal.h (rb_st_insert_id_and_value): update prototype
+	* variable.c (rb_st_insert_id_and_value): reduce args
+	  (find_class_path): adjust call for less args
+	  (rb_ivar_set): ditto
+	  (rb_cvar_set): ditto
+	* class.c (rb_singleton_class_attached): ditto
 
-Mon Jan 10 01:22:55 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Oct 30 09:57:22 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* gc.c (rb_data_object_alloc): klass may be NULL.
-	  [ruby-list:40498]
+	* gems/bundled_gems: update latest gems.
+	  test-unit-3.1.5 and minitest-5.8.2
 
-Sun Jan  9 03:12:58 2005  Tanaka Akira  <akr@m17n.org>
+Fri Oct 30 09:54:05 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* io.c (io_fread): warn nonblocking behavior.
-	  (io_readpartial): new method IO#readpartial.
+	* lib/rubygems: Update to RubyGems HEAD(60d7972).
+	  this version contains pull requests number of #1343, #1356, #1357, #1363
+	  at https://github.com/rubygems/rubygems/pulls
+	* test/rubygems: ditto.
 
-Sat Jan  8 04:38:47 2005  why the lucky stiff  <why@ruby-lang.org>
+Fri Oct 30 07:38:29 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/yaml.rb: Kernel#y requires an argument.
+	* insns.def (getinlinecache/setinlinecache): compare ic->ic_cref and
+	  current cref only when cached CREF list includes singleton class.
 
-Fri Jan  7 21:12:29 2005  TAMURA Takashi  <sheepman@tcn.zaq.ne.jp>
+	  Singleton classes have own namespaces, so that we need to check
+	  cref as a key (#10943).
 
-	* random.c (rand_init): use ALLOC_N instead of ALLOCA_N
-	  [ruby-dev:25426]
+	  However, if current CREF list does not include singleton class,
+	  no need to check CREF because it should be same name space.
 
-Fri Jan  7 18:03:35 2005  Tanaka Akira  <akr@m17n.org>
+	* vm_insnhelper.c (vm_get_const_key_cref): add a function returns
+	  CREF only when it includes singleton class.
 
-	* gc.c (mark_locations_array): avoid core dump with -O3.
-	  [ruby-dev:25424]
+	* vm_core.h: constify iseq_inline_cache_entry::ic_cref.
 
-Thu Jan  6 20:31:07 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+Fri Oct 30 06:43:50 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/zlib/zlib.c (zstream_end): should return value. (backported
-	  from CVS HEAD)
+	* vm_insnhelper.c (vm_env_cref): make it inline for performance.
 
-Thu Jan  6 19:55:13 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* vm_insnhelper.c (rb_vm_get_cref): use NULL instead of 0.
 
-	* win32/win32.c (rb_w32_close): didn't close socket handle.
-	  [ruby-dev:25414]
+Fri Oct 30 06:20:40 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* win32/win32.c (rb_w32_open_osfhandle): bcc32's _open_osfhandle
-	  never set EMFILE.
+	* insns.def: nobody set ic->ic_value.value to Qundef.
 
-Thu Jan  6 17:14:31 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Fri Oct 30 06:15:50 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* random.c (random_seed): O_NONBLOCK isn't defined on some
-	  platforms. [ruby-dev:25417]
+	* vm.c: add ifndef guard for VM_CHECK_MODE.
 
-Thu Jan  6 13:45:35 2005  Tanaka Akira  <akr@m17n.org>
+Fri Oct 30 06:13:10 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/time.rb: recognize +00:00 and GMT as a localtime.
+	* vm_insnhelper.c (vm_check_frame_detail): should require me for
+	  VM_FRAME_FLAG_BMETHOD type frame.
 
-Thu Jan  6 07:58:28 2005  Dave Thomas  <dave@pragprog.com>
+Thu Oct 29 18:42:30 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/rdoc/usage.rb (RDoc::RDoc.usage_no_exit): Allow for colons
-	  in path names on DOS machines. (thanks to Johan Nilsson)
+	* gc.c (gc_mark_ptr): specify NOINLINE so that gc_mark() can return
+	  immediately when obj is not a markable object.
 
-Wed Jan  5 20:16:32 2005  Tanaka Akira  <akr@m17n.org>
+Thu Oct 29 18:05:22 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* random.c (limited_big_rand): didn't work if SIZEOF_BDIGITS == 2.
-	  [ruby-dev:25408]
+	* encoding.c (rb_enc_check_str): add for performance.
+	  This function only accepts T_STRING (and T_REGEXP).
 
-	* random.c (random_seed): refined.
+	  This patch improves performance of a tiny_segmenter benchmark
+	  (num=2) 2.54sec -> 2.42sec on my machine.
+	  https://github.com/chezou/TinySegmenter.jl/blob/master/benchmark/benchmark.rb
 
-Wed Jan  5 12:49:39 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* encoding.c: add ENC_DEBUG and ENC_ASSERT() macros.
 
-	* eval.c (rb_thread_initialize): Thread objects cannot be initialized
-	  again.  fixed: [ruby-core:04067]
+	* internal.h: add a decl. of rb_enc_check_str().
 
-Wed Jan  5 10:48:16 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* string.c (rb_str_plus): use rb_enc_check_str().
 
-	* dir.c (dir_s_mkdir): win32 special processing doesn't need any
-	  longer. (backported from CVS HEAD)
+	* string.c (rb_str_subpat_set): ditto.
 
-	* win32/win32.[ch] (rb_w32_mkdir): new function. POSIX.1 compatible
-	  interface. (backported from CVS HEAD)
+Thu Oct 29 17:16:40 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* win32/win32.[ch] (rb_w32_rmdir): new function. (backported from CVS
-	  HEAD)
+	* internal.h: export rb_wb_(un)protected_newobj_of()
+	  because some extensions include internal.h.
 
-Wed Jan  5 02:30:11 2005  Tanaka Akira  <akr@m17n.org>
+Thu Oct 29 16:42:19 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* random.c (init_by_array): imported from mt19937ar-cok.tgz.
-	  (genrand_int32): ditto.
-	  (genrand_real): replaced with genrand_res53 in mt19937ar-cok.
-	  (rand_init): support bignum for longer seed.
-	  (random_seed): generate longer seed.
-	  (make_mask): new function.
-	  (limited_rand): ditto.
-	  (limited_big_rand): ditto.
-	  (rb_f_rand): call limited_rand and limited_big_rand.
-	  [ruby-dev:25403]
+	* gc.c (rb_imemo_new): should not pass FL_WB_PROTECTED flag.
 
-Tue Jan  4 23:25:29 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* gc.c (rb_wb_protected_newobj_of): add more assertions.
 
-	* bignum.c (rb_big_rand): should return positive random number.
-	  [ruby-dev:25401]
+	* gc.c (rb_wb_unprotected_newobj_of): ditto.
 
-Tue Jan  4 11:15:29 2005  TAMURA Takashi  <sheepman@tcn.zaq.ne.jp>
+Thu Oct 29 16:20:26 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* bignum.c (rb_big_rand): do not use rb_big_modulo to generate
-	  random bignums.  [ruby-dev:25396]
+	* gc.c: introduce rb_wb_unprotected_newobj_of() and
+	  rb_wb_protected_newobj_of(), pass the WB_PROTECTED
+	  information explicitly.
 
-Mon Jan  3 14:01:54 2005  Tanaka Akira  <akr@m17n.org>
+	* internal.h: use introduced functions by NEWOBJ_OF().
+	  `flag' is immediate value, so that C compilers can
+	  solve them at compile time.
 
-	* random.c (random_seed): don't use /dev/urandom if it is not
-	  character device.
+	* include/ruby/ruby.h: add a comment about that.
 
-Mon Jan  3 11:37:42 2005  Tanaka Akira  <akr@m17n.org>
+Thu Oct 29 14:52:03 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* random.c (random_seed): use /dev/urandom if available.
-	  [ruby-dev:25392]
+	* gc.c: add rb_objspace::flags::has_hook to represent hook availability.
 
-Mon Jan  3 07:46:42 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* gc.c: add gc_event_hook_available_p(objspace) to check that flag.
 
-	* lib/webrick/httpauth/htpasswd.rb (WEBrick::Htpasswd#reload):
-	  raise NotImplementedError if password is encrypted by digest
-	  algorithms. This patch is contributed by sheepman. [ruby-list:40467]
+	* gc.c (newobj_of): use gc_event_hook_available_p() instead of
+	  checking gc_event_hook_needed_p(objspace, RUBY_INTERNAL_EVENT_NEWOBJ).
+	  for performance.
 
-	* lib/webrick/httpauth/digestauth.rb
-	  (WEBrick::HTTPAuth::DigestAuth#_authenticate): fix digest calculation.
-	  This patch is contributed by sheepman. [ruby-list:40482]
+	* gc.c (newobj_init): add UNLIKELY() for FL_WB_PROTECTED flag.
 
-	* lib/webrick/{httpauth.rb,httpauth/basicauth.rb,httpproxy.rb}: use
-	  pack/unpack-template char "m" instead of lib/base64.rb to do base64
-	  encoding/decoding. fixed: [ruby-dev:25336]
+	* gc.c (newobj_init): change parameters order (trivial change).
 
-	* test/webrick/test_httpauth.rb: new file.
+Thu Oct 29 14:45:15 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Jan  1 04:20:23 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* vm_core.h (rb_thread_struct): move forward declarations before
+	  used.
 
-	* ext/openssl/ossl_ns_spki.c (ossl_spki_set_challenge): should call
-	  StringValue before GetSPKI. fixed: [ruby-dev:25359].
+Thu Oct 29 14:07:54 2015  Koichi Sasada  <ko1@atdot.net>
 
-Sat Jan  1 01:13:28 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* gc.c (gc_mark_ptr): remove debug code for #11244.
 
-	* variable.c (rb_autoload): [ruby-dev:25373]
+Thu Oct 29 10:08:33 2015  Eric Wong  <e@80x24.org>
 
-Fri Dec 31 14:10:43 2004  Dave Thomas  <dave@pragprog.com>
+	* variable.c (struct autoload_state): usable as wait-queue head
+	  (struct autoload_data_i): remove 2 words of overhead
+	  (autoload_i_mark): remove marking for thread
+	  (autoload_reset): adjust for struct changes
+	  (rb_autoload): ditto
+	  (rb_autoloading_value): ditto
+	  (rb_autoload_load): ditto
+	  (const_update): ditto
 
-	* lib/rdoc/ri/ri_formatter.rb (RI::TextFormatter::display_flow_item): Fix problem
-	  if heading contains formatting.
+Thu Oct 29 08:48:05 2015  Eric Wong  <e@80x24.org>
 
-Thu Dec 30 00:41:42 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* variable.c (struct autoload_data_i): add waitq_head
+	  (struct autoload_state): new struct
+	  (autoload_require): save result in autoload_state for use
+	    in autoload_reset
+	  (autoload_reset): wake up other waiters with open-coded
+	    wait-queues
+	  (rb_autoload_load): add ensure autoload_const_set happens
+	    atomically w.r.t. autoload-triggered "require"
+	  [ruby-core:70075] [ruby-core:71239] [Bug #11384]
 
-	* eval.c (svalue_to_avalue): [ruby-dev:25366]
+Wed Oct 29 00:39:50 2015  Naohisa Goto  <ngotogenome@gmail.com>
 
-	* string.c (rb_str_justify): [ruby-dev:25367]
+	* test/rubygems/test_gem_commands_server_command.rb
+	  (test_handle_options_port): change port from http to discard.
+	  Solaris does not include "http 80/tcp" in its default
+	  /etc/inet/services. AFAIK, discard (9/tcp) is older than http
+	  and it is expected that all OS can resolve the service name.
+	  [Bug #10004] [ruby-core:63518]
 
-Wed Dec 29 11:07:07 2004  Dave Thomas  <dave@pragprog.com>
+Wed Oct 28 23:52:48 2015  Naohisa Goto  <ngotogenome@gmail.com>
 
-	* lib/rdoc/generators/template/html/kilmer.rb: Update to use new
-	  sections.
+	* probes_helper.h (RUBY_DTRACE_HOOK): add RB_GC_GUARD, though paranoic.
 
-Tue Dec 28 22:31:46 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Oct 28 15:36:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* string.c (rb_str_justify): create buffer string after argument type
-	  conversion.  fixed: [ruby-dev:25341]
+	* error.c (rb_name_err_new): store the receiver directly.
 
-Tue Dec 28 15:41:48 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* error.c (name_err_receiver): return directly stored receiver.
+	  [Feature #10881]
 
-	* ext/nkf/nkf-utf8/nkf.c (reinit): should initialize all static
-	  variables.  fixed: [ruby-list:40445]
+	* error.c (name_err_mesg_to_str): quote the name if unprintable.
 
-Tue Dec 28 15:25:20 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* object.c (check_setter_id): use rb_check_id to convert names.
 
-	* ext/nkf/lib/kconv.rb (Kconv::RegexpEucjp): second byte is up to
-	  0xfe.
+	* variable.c (uninitialized_constant): use NameError::message to
+	  keep the receiver of uninitialized constant.  [Feature #10881]
 
-	* ext/nkf/lib/kconv.rb (Kconv#kconv): should handle UTF8 and UTF16
-	  properly.
+	* error.c (rb_name_err_new): new function to create NameError
+	  exception instance.  [Feature #10881]
 
-Tue Dec 28 13:35:20 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Oct 28 13:29:39 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/zlib/zlib.c (rb_deflate_s_deflate, rb_inflate_s_inflate): ensure
-	  freeing internal zstreams.  fixed: [ruby-dev:25309]
-
-	* ext/zlib/zlib.c (rb_deflate_init_copy): replace rb_deflate_clone.
-
-Tue Dec 28 12:26:45 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/Makefile.sub, win32/setup.mak (RDOCTARGET, install,
-	  install-nodoc, install-doc): rdoc support for mswin32.
-
-	* win32/configure.bat (--enable-install-doc, --disable-install-doc):
-	  ditto.
+	* parse.y (new_attr_op_assign): fix op_assign type, which is
+	  already an ID since r52284.  [Feature #11537]
 
-Mon Dec 27 20:02:14 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Tue Oct 27 23:14:14 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tcltklib/tcltklib.c: fix SEGV bug when deleting Tk interp
+	* defs/id.def: enable anonymous IDs not to expose internal IDs for
+	  frozen-string-literal-debug by Marshal.dump.
 
-	* ext/tk/lib/multi-tk.rb: ditto
+Tue Oct 27 17:06:55 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Dec 27 16:55:17 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* defs/id.def: move internal IDs for frozen-string-literal-debug.
 
-	* ext/openssl/ossl_x509name.c (Init_ossl_x509name): should use
-	  rb_hash_new to get exactly a Hash. fix [ruby-dev:25325].
+Tue Oct 27 16:41:05 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Dec 27 16:29:56 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* error.c (rb_error_frozen_object): use rb_attr_get instead of
+	  rb_ivar_get to get rid of warnings for string objects created
+	  when frozen-string-literal-debug is disabled.
 
-	* string.c (rb_str_justify): [ruby-dev:25341]
+Tue Oct 27 16:18:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Dec 27 15:47:48 2004  Minero Aoki  <aamine@loveruby.net>
+	* lib/logger.rb (Logger::Period#previous_period_end): as weekly
+	  rotation shifts the log file on Sundays, the end date of the
+	  previous period should be Saturdays.  fix r45072.
+	  [ruby-dev:49314] [Bug #11622]
 
-	* test/fileutils/fileasserts.rb: sync with HEAD.
+Tue Oct 27 16:12:37 2015  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* test/fileutils/test_fileutils.rb: ditto.
+	* vm_dump.c (rb_print_backtrace): our addr2line doesn't work on sparc.
+	  http://rubyci.s3.amazonaws.com/unstable11s/ruby-trunk/log/20151027T043311Z.log.html.gz
 
-	* test/fileutils/test_nowrite.rb: ditto.
+Tue Oct 27 12:00:33 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Dec 27 15:21:07 2004  Minero Aoki  <aamine@loveruby.net>
+	* lib/logger.rb (Logger::Period#next_rotate_time): get rid of
+	  adding to mday not to exceed the days of the month.
+	  [ruby-core:71185] [Bug #11620]
 
-	* lib/fileutils.rb (mv): should raise error when moving a
-	  directory to the (empty) directory. [ruby-talk:124368]
-	  (backport from HEAD 1.48)
+Mon Oct 26 22:43:03 2015  yui-knk  <spiketeika@gmail.com>
 
-	* lib/fileutils.rb (mv): wrongly did not overwrite file on Win32
-	  platforms. (backport from HEAD 1.48)
+	* test/ruby/test_module.rb (test_method_defined): Add test cases
+	  for `public/protected/private _method_defined?`
+	  These methods accept string as argument, so add string argument
+	  cases.  [Fix GH-1067]
 
-Sat Dec 25 11:11:48 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Mon Oct 26 22:23:30 2015  SimonDKnight  <simondknight@hotmail.com>
 
-	* stable version 1.8.2 released.
+	* lib/racc/rdoc/grammar.en.rdoc: Grammatical errors fixed.
+	  [Fix GH-1070]
 
-Sat Dec 25 04:23:49 2004  Minero Aoki  <aamine@loveruby.net>
+Mon Oct 26 18:36:43 2015  Shota Fukumori (sora_h) <her@sorah.jp>
 
-	* lib/fileutils.rb (mkdir, mkdir_p): should ensure directory
-	  permission. (backportted from HEAD, 1.47)
+	* vm_method.c(rb_method_entry_make):
+	  [DOC] [ci skip] Remove a needless space from comment
+	  [Fixes GH-1069] Patch by @yui-knk
 
-	* lib/fileutils.rb (traverse, remove_dir): untaint trasted
-	  objects. (backportted from HEAD, 1.46)
+Mon Oct 26 17:30:13 2015  Ryan Hosford  <tad.hosford@gmail.com>
 
-Sat Dec 25 01:28:23 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/fileutils.rb: rename tailing to trailing.
+	  [Misc #11548]
 
-	* io.c: cancel io_reopen() change on Dec. 24th.
+Mon Oct 26 17:11:53 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* dln.c: use <dlfcn.h> for NetBSD.  [ruby-dev:25313]
+	* parse.y (call_op, call_op2): fix values on ripper.  [Feature #11537]
 
-	* io.c (rb_f_select): IO list could be altered.  [ruby-dev:25312]
+Mon Oct 26 12:55:06 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Dec 24 23:51:48 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* parse.y (call_op2): separate from call_op and also allow "::",
+	  while dot_or_colon should not allow ".?".  [Feature #11537]
 
-	* bcc32/Makefile.sub: bcc32 should use RTL dll (backport from HEAD)
-	  [ruby-dev:25306]
+Mon Oct 26 01:03:23 2015  Rei Odaira  <Rei.Odaira@gmail.com>
 
-	* win32/win32.[ch]: ditto.
+	* thread_pthread.c: fix compile errors when
+	  USE_SLEEPY_TIMER_THREAD is disabled.
 
-Fri Dec 24 23:27:18 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Sun Oct 25 10:12:05 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/lib/tk/image.rb: TkPhotoImage#cget bug fix
+	* symbol.c (op_tbl): add DOTQ for ripper.  [Feature #11537]
 
-Fri Dec 24 18:39:25 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Sat Oct 24 22:51:18 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* win32/win32.[ch]: failed to compile on bcc32 (and probably wince)
-	  [ruby-dev:25306]
+	* configure.in: fixed build failure of Haiku.
+	  [fix GH-984] Patch by @kallisti5
+	* ext/socket/getaddrinfo.c: ditto.
+	* ext/socket/getnameinfo.c: ditto.
+	* ext/socket/rubysocket.h: ditto.
 
-Fri Dec 24 02:52:52 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Oct 24 21:16:53 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* io.c (io_reopen, rb_io_reopen): prohibit to change access mode for
-	  special IO ports.  [ruby-dev:25225]
+	* test/fileutils/test_fileutils.rb (test_uptodate): relax error
+	  message format.  [Feature #9025], [ruby-core:71178] [Bug #11617]
 
-Fri Dec 24 02:22:53 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Oct 24 21:06:43 2015  Shota Fukumori (sora_h)  <her@sorah.jp>
 
-	* ext/syck/rubyext.c (rb_syck_io_str_read): [ruby-core:03973]
+	* lib/mkmf.rb: Revert r45640 because it may lead to link
+	  with different libruby. [Bug #9760]
 
-	* ext/syck/rubyext.c (syck_loader_transfer): check type conversion.
+Sat Oct 24 15:42:20 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/syck/rubyext.c (syck_parser_assign_io, rb_new_syck_node): duck
-	  typing.
+	* bootstraptest/test_method.rb: relax error message format.
 
-	* ext/syck/rubyext.c (syck_parser_s_alloc, syck_parser_initialize):
-	  allocation framework.
+	* test/ruby/test_arity.rb (err_mess): ditto.
+	  [Feature #9025], [ruby-core:71178] [Bug #11617]
 
-	* ext/syck/rubyext.c (syck_emitter_s_alloc, syck_emitter_initialize):
-	  ditto.
+Sat Oct 24 12:47:47 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
 
-Fri Dec 24 01:21:00 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* vm_insnhelper.c: improved error message for "wrong number
+	  of arguments", distinguishing given and expected argument
+	  numbers clearly. [Feature #9025]
 
-	* ext/tk/lib/tkextlib/blt.rb: add BLT extension support
+Sat Oct 24 11:57:59 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* ext/tk/lib/tkextlib/blt/*.rb: ditto
+	* vm_insnhelper.c: remove the typedef redeclaration of
+	  vm_call_handler.
 
-	* ext/tk/lib/tkextlib/blt/tile/*.rb: ditto
+Sat Oct 24 07:29:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Dec 23 23:36:28 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/forwardable.rb (def_instance_delegator, def_single_delegator):
+	  match backtraces against ::Forwardable in case the target class
+	  is a subclass of BasicObject and does not include Kernel.
+	  [ruby-core:71176] [Bug #11616]
 
-	* process.c (proc_setgroups): check if the argument lenght is
-	  modified.  fixed: [ruby-dev:25285]
+Sat Oct 24 04:10:13 2015  Koichi Sasada  <ko1@atdot.net>
 
-Thu Dec 23 13:13:33 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* iseq.c (make_compile_option_value): include frozen_string_literal*
+	  in a made option value.
 
-	* ext/tcltklib/tcltklib.c: define TclTkLib::COMPILE_INFO and
-	  RELEASE_DATE
+	* vm_opts.h: forgot to add OPT_FROZEN_STRING_LITERAL_DEBUG
+	  at last commit.
 
-	* ext/tcltklib/extconf.rb: ditto
+Sat Oct 24 03:58:02 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/tk/tkutil.c: define TkUtil::RELEASE_DATE
+	* ruby.c: introduce --enable-frozen-string-literal-debug option.
+	  If this option is enabled, the modify error will be:
+	    can't modify frozen String (RuntimeError) =>
+	    can't modify frozen String, created at test.rb:3 (RuntimeError)
 
-	* ext/tk/lib/tk.rb: define Tk::RELEASE_DATE
+	* iseq.h: add compile option frozen_string_literal_debug.
 
-Thu Dec 23 09:38:31 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* compile.c: catch up this fix.
 
-	* io.c (io_reopen): restore exact mode.  fixed: [ruby-core:04003]
+	* error.c (rb_error_frozen): ditto.
 
-Thu Dec 23 00:16:32 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* iseq.c (set_compile_option_from_hash): ditto.
 
-	* configure.in (bsdi): use $(CC) for LDSHARED.  fixed [ruby-dev:25270]
+	* test/ruby/test_rubyoptions.rb: add a test for this fix.
 
-Wed Dec 22 11:14:55 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Oct 24 02:02:24 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* io.c (rb_io_mode_modenum): replace O_ACCMODE with O_RDWR.
-	  fixed: [ruby-dev:25273]
+	* vm_insnhelper.c: introduce new call handler for simple ISeqs.
 
-Wed Dec 22 08:34:32 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	  vm_call_iseq_setup_normal_0start() is simple, however it has
+	  some loops/conditions depends on ISeq::param.size and
+	  ISeq::local_size (in vm_push_frame(), inlined into this function).
 
-	* ext/dl/sym.c (rb_dlsym_initialize): extract internal pointers after
-	  all argument conversion.  fixed: [ruby-dev:25271]
+	  There are many simple methods which has a few parameters and local
+	  variables. So that this patch introduces several special functions
+	  generated in vm_call_iseq_optimized.inc by
+	  tool/mk_call_iseq_optimized.rb.
 
-Wed Dec 22 00:08:01 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	  This script makes
+	    vm_call_iseq_setup_normal_0start_Xparams_Ylocals()
+	  where X is 0 to 3 and Y is 1 to 6 (as current setting).
+	  In this case, X * Y = 24 functions are created.
 
-	* lib/soap/*, test/soap/*, sample/soap/authheader/*: eval cleanup.
+	  These functions creates fast method dispatch by inlining
+	  vm_push_frame() with immediate params/locals sizes.
 
-Tue Dec 21 22:07:33 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	  On my laptop, we can have the following results.
 
-	* ext/openssl/ossl_asn1.c (ossl_asn1_traverse, ossl_asn1_decode,
-	  ossl_asn1_decode_all): temporary value should be marked volatile.
+	  vm2_method*       1.083 (8.3% faster)
+	  vm2_poly_method*  0.961 (3.4% slower)
 
-Tue Dec 21 14:40:02 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	  It shows 8.3% faster for inner loop method dispatch (hit inline
+	  cache), but 3.4% slower when inline cache miss because we need
+	  to find a suitable call handler.
 
-	* ext/openssl/ossl_asn1.c (ossl_asn1_traverse, ossl_asn1_decode,
-	  ossl_asn1_decode_all): use rb_str_new4 to avoid SEGV.
-	  fix [ruby-dev:25261]
+	* common.mk: add a rule for vm_call_iseq_optimized.inc.
 
-	* test/openssl/test_asn1.rb: add tests for OpenSSL::ASN1.
+	* tool/mk_call_iseq_optimized.rb: added.
 
-Tue Dec 21 12:22:40 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* vm.c: include vm_call_iseq_optimized.inc.
 
-	* io.c (io_reopen): keep duplex pipe in correct mode for exception
-	  safeness.  fixed: [ruby-dev:25152]
+Sat Oct 24 01:58:50 2015  Koichi Sasada  <ko1@atdot.net>
 
-Tue Dec 21 12:10:04 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* vm_core.h: define vm_call_handler.
 
-	* ext/tk/lib/tk/grid.rb: rescue bug of 'grid configure' on Tcl/Tk8.3-
+Sat Oct 24 01:56:01 2015  Koichi Sasada  <ko1@atdot.net>
 
-Tue Dec 21 00:53:01 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* vm_core.h, vm_insnhelper.h: move definition of VMDEBUG
+	  from vm_insnhelper.h to vm_core.h.
 
-	* ext/openssl/ossl_asn1.c (ossl_asn1_traverse): [ruby-dev:25261]
+Sat Oct 24 01:51:01 2015  Akinori MUSHA  <knu@iDaemons.org>
 
-	* ext/openssl/ossl_asn1.c (ossl_asn1_decode): ditto.
+	* NEWS: [DOC] In the new safe call syntax, arguments are evaluated
+	  only if a call is made.
 
-	* ext/openssl/ossl_asn1.c (ossl_asn1_decode_all): ditto.
+	* doc/syntax/calling_methods.rdoc: Fix a typo.
 
-Mon Dec 20 23:22:26 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Sat Oct 24 00:38:34 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* added files:
-	  * lib/soap/mapping/wsdl*.rb
-	  * lib/wsdl/soap/element.rb
-	  * lib/wsdl/xmlSchema/simpleContent.rb
+	* lib/forwardable (def_instance_delegator, def_single_delegator):
+	  rescue ::Exception instead of Exception in case Exception is
+	  defined under the target class.
+	  [ruby-core:71175] [Ruby trunk - Bug #11615]
 
-	* modified files:
-	  * lib/soap/*
-	  * lib/wsdl/*
-	  * lib/xsd/*
-	  * test/soap/*
-	  * test/wsdl/*
-	  * test/xsd/*
-	  * sample/soap/*
-	  * sample/sdl/*
+Fri Oct 23 21:10:37 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* summary
-	  * imported from the soap4r repository.  Version: 1.5.3-ruby1.8.2
+	* error.c (name_err_mesg_to_str): separate class names from the
+	  receiver description.
 
-	  * added several XSD basetype support: nonPositiveInteger,
-	    negativeInteger, nonNegativeInteger, unsignedLong, unsignedInt,
-	    unsignedShort, unsignedByte, positiveInteger
+	* vm_eval.c (make_no_method_exception, raise_method_missing): add
+	  format specifiers for class names.
 
-	  * HTTP client connection/send/receive timeout support.
+Fri Oct 23 18:10:32 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	  * HTTP client/server gzipped content encoding support.
+	* .gitignore: ignored environmental wrapper files.
 
-	  * improved WSDL schema definition support; still is far from
-	    complete, but is making step by step improovement.
+Fri Oct 23 17:55:29 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Mon Dec 20 22:56:39 2004  Tanaka Akira  <akr@m17n.org>
+	* lib/irb.rb: Ignored assignment of STDOUT.sync = true
+	  when irb.rb loaded. It's affected to IDE such as Jetbrain.
+	  [fix GH-864] Patch by @os97673
 
-	* gc.c (stack_end_address): gcc noinline attribute is available since
-	  gcc-3.1.
+Fri Oct 23 16:35:08 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Mon Dec 20 14:07:02 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* lib/ipaddr.rb, test/test_ipaddr.rb: Reject invalid address contained
+	  EOL string. Patch by @kachick [fix GH-942][Bug #11513]
 
-	* ext/tk/lib/multi-tk.rb: supports new features of Tcl/Tk8.5a2
+Fri Oct 23 16:03:26 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* ext/tk/lib/tk/clock.rb: ditto
+	* file.c: fix indent style. [fix GH-977]
+	* test/ruby/test_string.rb: indent. [fix GH-975]
+	  [ci skip] These patches are contributed from @yui-knk
 
-	* ext/tk/lib/tk/text.rb: ditto
+Fri Oct 23 15:46:09 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* ext/tk/lib/tk/panedwindow.rb: ditto
+	* string.c: Added method signature to include hash. It's inconsistency
+	  with `gsub` method signature.
+	  [ci skip][fix GH-1023] Patch by @danielevans
 
-Mon Dec 20 12:47:13 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Fri Oct 23 15:25:51 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* ext/openssl/lib/net/https.rb,protocols.rb,telnets.rb: delete
-	  doc and code about SSLContext#{key_file,cert_file}.
-	  fixed: [ruby-dev:25243]
+	* lib/net/imap.rb: remove an empty comment line and -*-.
 
-Mon Dec 20 12:42:17 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+Fri Oct 23 15:20:02 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* io.c (io_fwrite): workaround for MSVCRT's bug.
-	  fixed: [ruby-core:03982]
+	* lib/net/ftp.rb (gettextfile, getbinaryfile): use the safe
+	  navigation operator.
 
-Mon Dec 20 11:21:04 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Oct 23 13:51:33 2015  yui-knk  <spiketeika@gmail.com>
 
-	* io.c (rb_io_eof): check if closed before clearerr().
-	  fixed: [ruby-dev:25251]
+	* test_call.rb (test_safe_call): Add test cases for safe
+	  navigation operator assignment.  [Fix GH-1064]
+	  Validate:
+	  * can assign an attribute which is `nil`
+	  * can "or assign" an attribute which is `nil`
 
-Mon Dec 20 03:30:40 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Oct 23 11:58:21 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/cgi/session.rb (CGI::Session#initialize): empty session id was
-	  used if request had no session key.  fixed: [ruby-core:03981]
+	* compile.c (iseq_peephole_optimize): optimize lengthy safe
+	  navigation method chain.  [Feature #11537]
 
-Mon Dec 20 01:51:01 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Oct 23 10:58:41 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* struct.c (make_struct): [ruby-dev:25249]
+	* lib/matrix/eigenvalue_decomposition.rb (tridiagonalize): fix
+	  indentation to avoid a warning when the command line option -w of
+	  ruby is specified.
 
-Mon Dec 20 00:28:20 2004  Kouhei Sutou  <kou@cozmixng.org>
+	* lib/matrix/eigenvalue_decomposition.rb (hessenberg_to_real_schur):
+	  change the name of a block parameter to avoid a warning when the
+	  command line option -w of ruby is specified.
 
-	* lib/rexml/encodings/SHIFT-JIS.rb: backported from CVS HEAD.
+Fri Oct 23 10:49:36 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/rexml/encodings/SHIFT_JIS.rb: ditto.
+	* compile.c (iseq_compile_each): support safe navigation of simple
+	  attribute assignment.  [Feature #11537]
 
-Sun Dec 19 17:19:48 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* parse.y (mlhs_node, lhs, attrset_gen): ditto.  keep mid
+	  non-attrset as the sign of safe navigation.
 
-	* ext/openssl/ossl_x509store.c
-	  (ossl_x509store_set_time): add OpenSSL::X509::Store#time=.
-	  (ossl_x509stctx_set_time): add OpenSSL::X509::StoreContext#time=.
+Fri Oct 23 07:17:11 2015  Eric Wong  <e@80x24.org>
 
-	* test/openssl/ossl_x509store.rb: test certificate validity times.
+	* test/io/wait/test_io_wait.rb (test_wait_eof): test return value
 
-	* ext/openssl/ossl_x509name.c (ossl_x509name_to_s): add optional
-	  second argument to specify the output format (see also
-	  X509_NAME_print_ex).
+Fri Oct 23 00:32:02 2015  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/openssl/ossl_x509name.c (ossl_x509name_init): new constants:
-	  OpenSSL::X509::Name::COMPAT, OpenSSL::X509::Name::RFC2253,
-	  OpenSSL::X509::ONELINE, OpenSSL::X509::MULTILINE.
+	* ext/openssl/ossl_ssl.c (ssl_npn_select_cb): explicitly raise error
+	  in ext/openssl instead of OpenSSL itself because LibreSSL
+	  silently truncate the selected protocol name by casting the length
+	  from int to unsigned char. [Bug #11369]
+	  Patch by Jeremy Evans <merch-redmine@jeremyevans.net>
 
-	* ext/openssl/lib/openssl/x509.rb (OpenSSL::X509::Name::RFC2253DN):
-	  new module to provide the parse for RFC2253 DN format.
+Fri Oct 23 00:49:45 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* ext/openssl/lib/openssl/x509.rb (OpenSSL::X509::Name.parse_rfc2253):
-	  new method to parse RFC2253 DN format.
+	* lib/un.rb (help): change the name of a block parameter to avoid
+	  a warning when the command line option -w of ruby is specified.
 
-	* test/openssl/ossl_x509name.rb: add tests about RFC2253 DN.
+Fri Oct 23 00:22:20 2015  Josef Simanek  <josef.simanek@gmail.com>
 
-	* text/openssl/ssl_server.rb: try to listen ports from 20443 to 20542
-	  while EADDRINUSE is raised.
+	* string.c (rb_str_tr): [DOC] Escape backslash in String#tr
+	  documentation.  [Fix GH-1063]
 
-	* all changes in this entry are backport from 1.9.
+Fri Oct 23 00:19:04 2015  yui-knk  <spiketeika@gmail.com>
 
-Sun Dec 19 17:24:59 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* array.c (rb_ary_collect): [DOC] Fix space of code example of
+	  Array#map.  [Fix GH-1062]
 
-	* configure.in (enable_rpath): use rpath flag to embed the library
-	  path into extensions on ELF environment.  [ruby-dev:25035]
+Thu Oct 22 18:52:53 2015  Akinori MUSHA  <knu@iDaemons.org>
 
-Sun Dec 19 11:01:25 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* vm_eval.c (rb_f_loop): When a loop is stopped by a StopIteration
+	  exception, return what the enumerator has returned instead of
+	  nil. [ruby-core:71133] [Feature #11498]
 
-	* lib/test/unit.rb: use standalone runner for -e.
+Thu Oct 22 18:25:10 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* lib/test/unit/autorunner.rb (Test::Unit::AutoRunner#options): accept
-	  multiple -p and -x options.
+	* lib/net/imap.rb (idle): add a new argument timeout for keep-alive.
+	  [ruby-core:63693] [Bug #10031]
 
-	* lib/test/unit/collector/dir.rb (Test::Unit::Collector::Dir#recursive_collect):
-	  ditto.
+Thu Oct 22 15:30:08 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Dec 18 16:36:23 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* compile.c (iseq_peephole_optimize): peephole optimization for
+	  branchnil jumps.
 
-	* ext/zlib/zlib.c (rb_deflate_s_deflate, rb_inflate_s_inflate):
-	  disallow interrupt by type conversion.  fixed: [ruby-dev:25226]
+	* compile.c (iseq_compile_each): generate save navigation operator
+	  code.
 
-Sat Dec 18 15:16:41 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* insns.def (branchnil): new opcode to pop the tos and branch if
+	  it is nil.
 
-	* lib/webrick/httpauth.rb,
-	  lib/webrick/httpauth/{basicauth.rb,digestauth.rb}: use
-	  pack/unpack-template char "m" instead of lib/base64.rb to do base64
-	  encoding/decoding.
+	* parse.y (NEW_QCALL, call_op, parser_yylex): parse token '.?'.
+	  [Feature #11537]
 
-Sat Dec 18 10:51:01 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Thu Oct 22 13:16:19 2015  Guilherme Reis Campos  <guilhermekbsa@gmail.com>
 
-	* dir.c (dir_open_dir): new function.  [ruby-dev:25242]
+	* dir.c (ruby_brace_expand): glob brace expansion edge case fix.
+	  When there are closing braces '}' before a open brace '{' it
+	  must be ignored and considered as literal.
+	  [ruby-core:71138] [Bug #11609]
 
-Fri Dec 17 18:07:01 2004  Shugo Maeda  <shugo@ruby-lang.org>
+Thu Oct 22 13:13:49 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/readline/test_readline.rb: fix for BSD. Thanks, GOTOU Yuuzou.
-	  fixed: [ruby-dev:25218]
+	* io.c (argf_next_argv): check ARGV element type, and try
+	  conversion if necessary.  [ruby-core:71140] [Bug #11610]
 
-Fri Dec 17 16:28:12 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Thu Oct 22 11:11:16 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* ext/tk/lib/tk.rb: fix bug on setting up system encoding
+	* test/net/ftp/test_ftp.rb: add tests for getbinaryfile and
+	  gettextfile.
 
-	* ext/tk/lib/tk/event.rb: fix error on require process
+Wed Oct 21 18:34:06 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/lib/tk/font.rb: fix abnormal termination error on Windows
+	* parse.y (parser_magic_comment): allow a sole magic comment without
+	  indicators, neither other non-space comments.  [Feature #8976]
 
-	* ext/tk/lib/tk/virtevent.rb: TkVirtualEvent::PreDefVirtEvent.new()
-	  accepts event-sequence arguments
+Tue Oct 20 12:17:56 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
 
-	* ext/tk/lib/tk/text.rb: fail to dump embedded images
+	* lib/prime.rb: Add basic argument checking to Prime.prime?
+	  [Bug #11606]
 
-	* ext/tk/lib/tk/text.rb: tag_nextrange and tag_prevrange returns wrong
-	  types of values
+Tue Oct 20 12:17:50 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
 
-	* ext/tk/lib/tk/texttag.rb: nextrange and prevrange returns wrong
-	  types of values
+	* lib/prime.rb: Optimize Integer#prime?
+	  Patch by Nick Slocum [Bug #10354]
 
-	* ext/tk/lib/tk/text.rb: add TkText::IndexModMethods module and
-	  TkText::IndexString class to treat text index modifiers
+Tue Oct 20 08:12:47 2015  Rei Odaira  <Rei.Odaira@gmail.com>
 
-	* ext/tk/lib/tk/texttag.rb: use TkText::IndexModMethods module
+	* configure.in: pthread_getattr_np is broken on AIX.
+	  More specifically, the stack address and size returned are
+	  not correct.
 
-	* ext/tk/lib/tk/textmark.rb: ditto
+Tue Oct 20 05:54:46 2015  Eric Wong  <e@80x24.org>
 
-	* ext/tk/lib/tk/textimage.rb: ditto
+	* ext/fiddle/closure.c (callback): static function
 
-	* ext/tk/lib/tk/textwindow.rb: ditto
+Mon Oct 19 10:33:46 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/lib/tk/textimage.rb: wrong gravity of text mark for embedded
-	  image
+	* ext/socket/init.c (rsock_raise_socket_error): get rid of a glibc
+	  bug.  [ruby-core:71100] [Bug #11600]
 
-	* ext/tk/lib/tk/textwindow.rb: wrong gravity of text mark for
-	  embedded window
+Mon Oct 19 01:26:26 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Fri Dec 17 13:50:00 2004  Akiyoshi, Masamichi  <akiyoshi@hp.com>
+	* file.c (rb_file_identical_p): not necessary to compare the paths after
+	  comparing the file indexes on Windows.  designate by kosaki.
 
-	* vms/vmsruby_private.c, vms/vmsruby_private.h: private routines
-	  for VMS port are added.
+Sun Oct 18 21:17:27 2015  Tanaka Akira  <akr@fsij.org>
 
-	* eval.c (ruby_init): change to call VMS private intialization routine.
+	* lib/open-uri.rb: Specify frozen_string_literal: true.
 
-Fri Dec 17 13:33:58 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sun Oct 18 14:37:56 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/cgi/session.rb (CGI::Session#initialize): control adding
-	  session_id hidden fields.  fixed: [ruby-talk:123850]
+	* random.c (fill_random_bytes_urandom): add a comment why using
+	  O_NONBLOCK and O_NOCTTY.
 
-Thu Dec 16 23:25:25 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+Sun Oct 18 13:24:17 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/drb/drb.rb, lib/drb/ssl.rb: backported from CVS HEAD.
-	  [druby-ja:101]
+	* random.c (fill_random_bytes_syscall): use ATOMIC_SET() for
+	  updating try_syscall.
 
-	* test/drb/test_drb.rb: adjust and reduce sleep (backported from
-	  CVS HEAD.)
+Sun Oct 18 13:03:52 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Thu Dec 16 18:44:58 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* include/ruby/backward/util.h: Good-by Borland-C.
 
-	* lib/webrick/httpserver.rb (WEBrick::HTTPServer#run): should wait
-	  for reading request till data arrive. [ruby-talk:121068]
+Sun Oct 18 13:03:09 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/webrick/server.rb (WEBrick::GenericServer#start_thread):
-	  should log about all accepted socket. [ruby-core:03962]
+	* common.mk: add a comment how to use "make test-all"
 
-	* lib/webrick/accesslog.rb (WEBrick::AccessLog#setup_params):
-	  "%%" and "%u" are supported. [webricken:135]
+Sun Oct 18 12:59:22 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/webrick/httpservlet/filehandler.rb
-	  (WEBrick::HTTPServlet::FileHandler#check_filename):
-	  :NondisclosureName is acceptable if it is Enumerable.
+	* common.mk: add comments how to use "make benchmark"
 
-	* lib/webrick/config.rb (WEBrick::Config::FileHandler):
-	  default value of :NondisclosureName is [".ht*", "*~"].
+Sun Oct 18 12:58:15 2015  Tanaka Akira  <akr@fsij.org>
 
-Thu Dec 16 18:36:52 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* lib/securerandom.rb: Specify frozen_string_literal: true.
 
-	* ext/openssl/ossl.c (ossl_raise): refine message format.
+Sun Oct 18 11:22:52 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Thu Dec 16 16:29:44 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* dln.c: remove defined(__WATCOMC__).
 
-	* ext/tk/sample/demos-en/widget: modify version check for
-	  supporting features
+Sun Oct 18 11:16:33 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Thu Dec 16 16:03:50 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* lib/mkmf.rb: Good-by Borland-C.
 
-	* ext/tk/lib/tk/bindtag.rb: bug fix [ruby-talk: 123667]
+Sun Oct 18 11:04:36 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tk/lib/tk/timer.rb: accept :idle for the interval argument
+	* numeric.c: Good-by Borland-C.
+	* include/ruby/backward/rubyio.h: ditto.
+	* include/ruby/backward/st.h: ditto.
+	* include/ruby/backward/util.h: ditto.
+	* include/ruby/backward/rubysig.h: ditto.
+	* include/ruby/backward/classext.h: ditto.
+	* dln.c: ditto.
+	* gc.c: ditto.
+	* win32/resource.rb: ditto.
+	* win32/dir.h: ditto.
+	* ext/tk/tcltklib.c: ditto.
+	* NEWS: announce that Borland-C is no longer supported.
 
-	* ext/tk/lib/tk.rb: add TkComm._callback_entry?()
+Sun Oct 18 10:54:52 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tk/lib/multi-tk.rb: add MultiTkIp.cb_entry_class
+	* dln.c: simplify #ifdef. _WIN32 and __CYGWIN__ are exclusive.
+	  see include/ruby/defines.h
+	* gc.c: ditto.
+	* ext/sdbm/_sdbm.c: ditto.
 
-	* ext/tk/lib/tk/canvas.rb: use TkComm._callback_entry?()
+Sun Oct 18 10:42:19 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tk/lib/tk/canvastag.rb: ditto
+	* ruby.c (open_load_file): add a comment.
 
-	* ext/tk/lib/tk/dialog.rb: ditto
+Sun Oct 18 10:12:46 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tk/lib/tk/optiondb.rb: ditto
+	* file.c (rb_file_identical_p): simplify ifdefs
 
-	* ext/tk/lib/tk/text.rb: ditto
+Sun Oct 18 10:01:40 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tk/lib/tk/texttag.rb: ditto
+	* ChangeLog: Good-bye OS/2.
+	* common.mk: ditto.
+	* configure.in: ditto.
+	* dln_find.c: ditto.
+	* ext/Setup.emx: ditto.
+	* ext/extmk.rb: ditto.
+	* ext/socket/extconf.rb: ditto.
+	* ext/zlib/extconf.rb: ditto.
+	* file.c: ditto.
+	* include/ruby/defines.h: ditto.
+	* io.c: ditto.
+	* lib/mkmf.rb: ditto.
+	* missing/os2.c: ditto.
+	* process.c: ditto.
+	* ruby.c: ditto.
+	* NEWS: announce OS/2 is no longer supported.
 
-	* ext/tk/lib/tk/textwindow.rb: ditto
+Sun Oct 18 08:50:15 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tk/lib/tk/timer.rb: ditto
+	* include/ruby/defines.h (DOSISH): add comments.
 
-	* ext/tk/lib/tk/validation.rb: ditto
+Sun Oct 18 08:26:51 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* ext/tk/lib/tkextlib/*: ditto
+	* io.c (fptr_finalize): don't release gvl if fptr is not writable.
+	  writable fd may block on close(2) when it's on NFS. But readonly
+	  fd doesn't. [Bug #11559]
+	  result: make benchmark OPTS="-p bm_require_t -e ruby-trunk -e ruby-2.2.2"
+	    build-ruby:             0.171
+	    ruby 2.3.0dev(r52151):  0.659
+	    ruby 2.2.0p95 (r50295): 0.834
 
-Thu Dec 16 03:14:28 2004  Minero Aoki  <aamine@loveruby.net>
+Sun Oct 18 09:32:58 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/net/http.rb (basic_encode): return value of pack('m') may
-	  include multiple CR/LFs.  Backported from main trunk (rev 1.112).
-	  [ruby-dev:25212]
+	* file.c (ruby_is_fd_loadable): this should be fail if st_mode is
+	  not regular file nor FIFO.
 
-Thu Dec 16 00:33:37 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sun Oct 18 09:20:17 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* hash.c (Init_Hash): remove custom "hash" and "eql?".
+	* ruby.c (open_load_file): use rb_thread_wait_fd() instead of reopen.
 
-Wed Dec 15 18:57:01 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sun Oct 18 05:11:22 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* lib/set.rb (Set::eql): wrong definition.  [ruby-dev:25207]
+	* ruby.c (open_load_file): reset O_NONBLOCK after open.
+	  Even if S_ISREG() is true, the file may be file on FUSE filesystem
+	  or something. We can't assume O_NONBLOCK is safe.
+	  Moreover, we should wait if the path is point to FIFO. That's
+	  FIFO semantics. GVL should be transparent from ruby script.
+	  Thus, just reopen without O_NONBLOCK for filling the requirements.
+	  [Bug #11060][Bug #11559]
 
-Wed Dec 15 18:48:42 2004  Shugo Maeda  <shugo@ruby-lang.org>
+	* ruby.c (loadopen_func): new for the above.
 
-	* ext/curses/curses.c (window_subwin): call NUM2INT() before
-	  GetWINDOW(). (backported from CVS HEAD)
+	* file.c (ruby_is_fd_loadable): new. for checks loadable file type
+	  of not.
+	* file.c (rb_file_load_ok): use ruby_is_fd_loadble()
+	* internal.h: add ruby_is_fd_loadble()
 
-Wed Dec 15 17:03:50 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* common.mk: now, ruby.o depend on thread.h.
 
-	* win32/win32.[ch] (rb_w32_isatty): new function to replace MSVCRT's
-	  isatty because it never sets errno. (backported from CVS HEAD)
+	* test/ruby/test_require.rb
+	(TestRequire#test_loading_fifo_threading_success): new test.
+	  This test successful case that loading from FIFO.
 
-Wed Dec 15 15:39:32 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* test/ruby/test_require.rb
+	(TestRequire#test_loading_fifo_threading_raise): rename from
+	  test_loading_fifo_threading. You shouldn't rescue an exception
+	  if you test raise or not.
+	  Moreover, this case should be caught IOError because load(FIFO)
+	  should be blocked until given any input.
 
-	* ext/openssl/ossl_x509name.c (ossl_x509name_to_a): avoid SEGV
-	  (rollback the previous commit).
+Sat Oct 17 13:55:32 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Dec 15 16:10:23 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* file.c (rb_file_expand_path_internal): concatenate converted
+	  string to the result instead of making converted string and
+	  append it.
 
-	* object.c (rb_obj_id_obsolete): warn always.
+	* string.c (rb_str_cat_conv_enc_opts): from rb_str_conv_enc_opts,
+	  separate function to concatenate with transcoding.
 
-	* eval.c (rb_enable_super): ditto.
+Sat Oct 17 13:19:10 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Dec 15 15:31:02 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ruby.c (load_file): unify each preparations and clean-ups by
+	  merging load_file_internal and load_file_internal2, and remove
+	  nested rb_protect and rb_ensure.
 
-	* lib/set.rb (Set#==): [ruby-dev:25206]
+Sat Oct 17 05:28:32 2015  Rei Odaira  <Rei.Odaira@gmail.com>
 
-Wed Dec 15 14:22:10 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* test/ruby/test_symbol.rb (test_symbol_fstr_leak): add a warm-up
+	  code and check RSS to avoid false positive on AIX and false
+	  negative on Mac OS X. [Bug #10686]
 
-	* win32/win32.c (rb_w32_fdisset): check whether the handle is valid.
-	  fixed: [ruby-core:03959]
+Fri Oct 16 15:54:37 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Dec 15 10:30:37 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* file.c (rb_file_load_ok): open in non-blocking mode withoout
+	  releasing GVL.  don't care about others than regular files and
+	  directories.  [ruby-dev:49272] [Bug #11559]
 
-	* ext/openssl/ossl_digest.c (ossl_digest_initialize): [ruby-dev:25198]
+	* ruby.c (load_file_internal): ditto.
 
-Tue Dec 14 17:10:09 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+Thu Oct 15 23:56:03 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* win32/win32.c (rb_w32_close): need to reset osfhnd().
+	* proc.c (rb_sym_to_proc): make void env.
 
-Tue Dec 14 14:03:57 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Thu Oct 15 13:37:23 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/openssl/ossl.c (ossl_raise): avoid buffer overrun.
-	  [ruby-dev:25187]
+	* proc.c (rb_sym_to_proc): move from string.c and create a Proc
+	  with no environments.  [ruby-core:71088] [Bug #11594]
 
-Tue Dec 14 12:36:04 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Thu Oct 15 01:57:03 2015  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
 
-	* lib/cgi/session.rb (CGI::Session::initialize): generate new
-	  session if given session_id does not exist.  [ruby-list:40368]
+	* test/objspace/test_objspace.rb
+	  (test_trace_object_allocations_start_stop_clear): clear object
+	  allocation table first to get rid of erroneous detection for obj3.
+	  [ruby-dev:49095] [Bug #11271]
 
-Mon Dec 13 18:13:52 2004  Tanaka Akira  <akr@m17n.org>
+Thu Oct 15 01:53:38 2015  Benoit Daloze  <eregontp@gmail.com>
 
-	* gc.c (stack_end_address): new function to obtain stack end address.
-	  stack_end_address calls __builtin_frame_address(0) to obtain the
-	  frame pointer of a stack frame of stack_end_address.  The address
-	  is the stack pointer of the caller's stack frame.
-	  (SET_STACK_END): use stack_end_address.
-	  This makes the conservative garbage collector to scan a stack frame
-	  of the garbage_collect function itself.  This is required because
-	  callee-save registers may be stored in the frame.
-	  [ruby-dev:25158]
+	* test/ostruct/test_ostruct.rb: Add tests for OpenStruct#respond_to.
+	  Patch by @jeremy in [GH-1041]: https://github.com/ruby/ruby/pull/1041
 
-Mon Dec 13 00:58:02 2004  Tanaka Akira  <akr@m17n.org>
+Thu Oct 15 01:49:25 2015  Benoit Daloze  <eregontp@gmail.com>
 
-	* lib/pathname.rb (cleanpath_aggressive): make it private.
-	  (cleanpath_conservative): ditto.
-	  Suggested by Daniel Berger.  [ruby-core:3914]
+	* lib/ostruct.rb: Finish defining OpenStruct attributes lazily.
+	  Patch by @sferik in [GH-1037]: https://github.com/ruby/ruby/pull/1037
+	  This commit is an addendum to https://github.com/ruby/ruby/pull/1033.
+	  It:
+	  1. lazily defines attribute accessors for copied and marshaled objects,
+	  2. returns nil when an attribute reader is not defined, and
+	  3. defines respond_to_missing? to maintain the same respond_to? behavior
 
-Sun Dec 12 20:06:38 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+Wed Oct 14 16:56:50 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/drb/drb.rb: backported from CVS HEAD.
+	* configure.in: check for libunwind.h, which is not available in
+	  very old OS X SDK.  [ruby-core:71080] [Bug #11591]
 
-Sun Dec 12 10:35:10 2004  Dave Thomas  <dave@pragprog.com>
+Wed Oct 14 14:11:42 2015  Brian Black  <bblack@veracode.com>
 
-	* lib/rdoc/generators/template/html/html.rb (RDoc::Page): Don't
-	  show an accessor's r/w flag if none was specified
+	* iseq.c (rb_insn_operand_intern): change kw in callinfo disasm from the
+	  number of keyword arguments to an ordered list of the keywords used.
+	  [Feature #11589]
 
-Sun Dec 12 10:14:03 2004  Dave Thomas  <dave@pragprog.com>
+Wed Oct 14 13:58:44 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/rdoc/rdoc.rb (RDoc::RDoc::parse_files): Never exclude files
-	  explicitly given on the command line.
+	* parse.y (parser_nextc): send a warning to ripper, not to STDERR
+	  always.
 
-Sun Dec 11 23:54:07 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* parse.y (rb_warn1, rb_warning1): move argument conversions to
+	  callers.  PRIsVALUE is not valid in String#%.
 
-	* ext/tk/*: update to support libraries in ActiveTcl8.4.12.0
-	  (see ext/tk/ChangeLog.tkextlib).
+Wed Oct 14 13:37:23 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* ext/tk/sample/scrollframe.rb: add a new sample.
+	* lib/racc/rdoc/grammar.en.rdoc: fix spell error.
+	  [fix GH-1053][ci skip] Patch by @Matrixbirds
 
-Sat Dec 11 20:12:21 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+Tue Oct 13 22:06:50 2015  Tanaka Akira  <akr@fsij.org>
 
-	* lib/drb/drb.rb: add DRbRemoteError. [ruby-list:40348],
-	  [ruby-list:40390]
+	* ext/socket/raddrinfo.c (rsock_fd_family): Check sa_len.
 
-	* test/drb/drbtest.rb: ditto.
+Tue Oct 13 12:14:10 2015  Craig Davison  <craig65535@gmail.com>
 
-	* test/drb/ut_drb.rb: ditto.
+	* ext/socket/rsock_addrinfo (rsock_addrinfo): specify address
+	  family.  [Fix GH-1052]
 
-Sat Dec 11 15:38:14 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/socket/udpsocket.c (udp_connect, udp_bind, udp_send):
+	  address family by the receiver.
 
-	* lib/jcode.rb (String::succ): [ruby-dev:25156]
+Sun Oct 11 07:09:19 2015  Koichi Sasada  <ko1@atdot.net>
 
-Sat Dec 11 12:41:55 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* vm_insnhelper.c (vm_push_frame): initialize other than sp (and ep)
+	  first for performance.
 
-	* eval.c (run_trap_eval): prototype; avoid VC++ warnings.
+Sun Oct 11 06:21:50 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/socket/getaddrinfo.c: fix typo. fixed: [ruby-core:03947]
+	* vm_eval.c, internal.h (rb_yield_1): added for performance which
+	  doesn't check Qundef.
 
-	* win32/win32.c: need to include dln.h.
+	* numeric.c (int_dotimes): use rb_yield_1.
 
-Sat Dec 11 00:10:18 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sun Oct 11 06:19:49 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* io.c (io_reopen): [ruby-dev:25150]
+	* vm_insnhelper.c (vm_call_iseq_setup_normal): setup sp first
+	  for performance.
 
-Fri Dec 10 08:39:27 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sun Oct 11 05:29:51 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/socket/socket.c (sock_listen): get OpenFile just before calling
-	  listen(2).  fixed: [ruby-dev:25149]
+	* vm.c (invoke_block_from_c): split this function into several
+	  functions.
 
-Thu Dec  9 17:00:00 2004  Akiyoshi, Masamichi  <akiyoshi@hp.com>
+	* vm_insnhelper.c (vm_yield_callee_setup_arg): remove this function
+	  because it is only delegation function.
 
-	* ext/socket/socket.c, ext/socket/getaddrinfo.c: port to VMS
+Sun Oct 11 03:48:46 2015  Koichi Sasada  <ko1@atdot.net>
 
-Thu Dec  9 16:31:02 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* gc.c (newobj_of_slowpass): fix typo (pass -> path).
+	  Pointed out by Yukihiro Matsumoto  <matz@ruby-lang.org>.
 
-	* ext/sdbm/init.c (GetDBM): typo.
+	* gc.c (newobj_of_...): `of' is unnecessary.
 
-Thu Dec  9 16:05:00 2004  Akiyoshi, Masamichi  <akiyoshi@hp.com>
+Sat Oct 10 19:04:42 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* defines.h: change path of vms.h
-	* vms/vms.h: delete reference for snprintf()
-	* vms/config.h: new file
-	* vms/config.h_in: deleted
+	* ext/socket/udpsocket.c (udp_connect, udp_bind): get open files
+	  inside ensure functions.
 
-Thu Dec  9 14:38:35 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Oct 10 18:35:12 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* string.c (rb_str_inspect): escape # which starts an expression
-	  substitution.  fixed: [ruby-core:03922]
+	* vm_insnhelper.c (vm_call_method0): do not propagate enable_fastpath,
+	  but pass dummy CC to prevent wrong caching.
 
-	* string.c (rb_str_dump): not escape # which isn't a substitution.
+Sat Oct 10 15:28:45 2015  Koichi Sasada  <ko1@atdot.net>
 
-Thu Dec  9 10:54:36 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* import a github pull request
+	  https://github.com/ruby/ruby/pull/1050
+	  by Kazuho Oku <kazuho@natadeco.co>.
 
-	* ext/dbm/dbm.c (fdbm_select): [ruby-dev:25132]
+	  This pull request has the following commits.
 
-	* ext/sdbm/init.c: ditto.
+	* gc.c: reduce # of args to 6 (max. of register args on x86-64) so
+	  that the `newobj_of_slowpass` can be called via TCO.
 
-	* ext/gdbm/gdbm.c: ditto.
+	* gc.c (newobj_of), string.c (str_duplicate): for performance,
+	  the hot functions must be inlined.
 
-Thu Dec  9 03:08:36 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* gc.c: for performance, preceding arguments of `.*newobj_of.*`
+	  must be same, so that the arg registers can be reused in case of
+	  TCO.
 
-	* ext/tcltklib/tcltklib.c (ip_init): set root-win title to "ruby" when
-	  the running script is '-e one-liner' or '-' (stdin).
+Sat Oct 10 08:52:21 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tcltklib/extconf.rb: add find_library("#{lib}#{ver}",..) for
-	  stub libs
+	* ext/socket/udpsocket.c (udp_connect, udp_bind, udp_send): fix
+	  memory leaks at closed socket.
 
-	* ext/tk/lib/tk/textmark.rb: TkTextMarkCurrent and TkTextMarkAnchor
-	  have a wrong parent class.
+Fri Oct  9 17:29:07 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* ext/tk/lib/tk/dialog.rb: rename TkDialog2 --> TkDialogObj and
-	  TkWarning2 --> TkWarningObj (old names are changed to alias names)
+	* lib/net/ftp.rb (parse257): refactor.
 
-	* ext/tk/lib/tk/dialog.rb: bug fix of treatment of 'prev_command'
-	  option and hashes for configuration
+Fri Oct  9 16:42:26 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* ext/tk/lib/tk/dialog.rb: add TkDialogObj#name to return the
-	  button name
+	* lib/net/imap.rb: use frozen_string_literal: true.
 
-	* ext/tk/lib/tk/radiobutton.rb: rename enbugged method value() ==>
-	  get_value() and value=(val) ==> set_value(val).
+	* test/net/imap/test_imap.rb: ditto.
 
-	* ext/tk/lib/tk/menu.rb: add TkMenu.new_menuspec
+	* test/net/imap/test_imap_response_parser.rb: ditto.
 
-	* ext/tk/lib/tk/menu.rb: add alias (TkMenuButton = TkMenubutton,
-	  TkOptionMenuButton = TkOptionMenubutton)
+Fri Oct  9 15:52:28 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* ext/tk/lib/tk/event.rb: new method aliases (same as option keys of
-	  event_generate) for Event object
+	* lib/net/ftp.rb: use frozen_string_literal: true.
 
-	* ext/tk/lib/tk/font.rb: configinfo returns proper types of values
+	* test/net/ftp/test_buffered_socket.rb: ditto.
 
-	* ext/tk/lib/tk.rb: bind methods accept subst_args + block
+	* test/net/ftp/test_ftp.rb: ditto.
 
-	* ext/tk/lib/tk/canvas.rb: ditto
+	* test/net/ftp/test_mlsx_entry.rb: ditto.
 
-	* ext/tk/lib/tk/canvastag.rb: ditto
+Fri Oct  9 14:12:35 2015  Shota Fukumori (sora_h)  <her@sorah.jp>
 
-	* ext/tk/lib/tk/frame.rb: ditto
+	* ext/openssl/lib/openssl/ssl.rb: Revert r52082 because it was
+	  dropping TLS v1.1 support too. Supporting only TLS v1.2 is too
+	  early, because many popular websites still don't support it.
 
-	* ext/tk/lib/tk/text.rb: ditto
+	  For instance, Servers where aws-sdk connects to still don't support
+	  TLS v1.2 and it became broken.
 
-	* ext/tk/lib/tk/texttag.rb: ditto
+	  We should consider more carefully about this.
 
-	* ext/tk/lib/tk/toplevel.rb: ditto
+	  [Fix GH-873] [Feature #11524]
 
-	* ext/tk/lib/tkextlib/*: ditto and bug fix
+Fri Oct  9 12:52:08 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-Wed Dec  8 23:54:29 2004  Dave Thomas  <dave@pragprog.com>
+	* compile.c (iseq_compile_each): Dynamic string literals (e.g.,
+	  "#{x}") should not be frozen because they don't literally
+	  represent strings.
+	  https://twitter.com/shugomaeda/status/651937650027401216
+	  https://twitter.com/yukihiro_matz/status/651942882312482817
+	  https://twitter.com/yukihiro_matz/status/651980835181096960
 
-	* lib/rdoc/generators/template/html/html.rb (RDoc::Page): Typo
-	  meant that h2 tag was invisible.
+Fri Oct  9 06:52:49 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Wed Dec  8 21:56:31 2004  Kouhei Sutou  <kou@cozmixng.org>
+	* benchmark/prepare_require.rb: skip file creation if it already
+	  exist. Suggested by ko1.
 
-	* lib/rss, test/rss, sample/rss: backported from CVS HEAD.
+Fri Oct  9 06:18:04 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+	* benchmark/bm_require.rb: new benchmark for require.
+	* benchmark/bm_require_thread.rb: new benchmark for conflicting
+	  require vs thread. like [Bug #11559]
+	* prepare_require.rb: new file for preparing above tests.
+	* prepare_require.rb: ditto.
 
-Wed Dec  8 14:31:36 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Thu Oct  8 14:10:45 2015  Zachary Scott  <zzak@ruby-lang.org>
 
-	* io.c (io_fwrite): change dereference for cosmetic reason.
+	* ext/openssl/lib/openssl/ssl.rb: Default to TLSv1.2 and drop TLS v1
+	  Patch provided by @claudijd [Fixes GH-873] [Feature #11524]:
+	  https://github.com/ruby/ruby/pull/873
 
-	* sprintf.c (rb_f_sprintf): [ruby-dev:25104]
+Wed Oct  7 22:55:02 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Dec  7 19:08:00 2004  Akiyoshi, Masamichi  <akiyoshi@hp.com>
+	* test/minitest/metametameta.rb (with_output): restore output to
+	  fix mixing test result output in worker responses.
 
-	* io.c (io_fwrite): fix offset incrementation (for VMS and Human68k)
+Wed Oct  7 21:32:51 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Dec  7 00:27:37 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* string.c (str_duplicate): move from rb_str_resurrect to short
+	  circuit initialization.
 
-	* process.c (proc_setgroups): [ruby-dev:25081]
+Wed Oct  7 20:43:14 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Dec  6 18:08:10 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* string.c (rb_str_resurrect): fix resurrection of short enough to
+	  be embedded but not embedded string.
 
-	* re.c (rb_reg_eqq): document fix.  [ruby-talk:122541]
+Wed Oct  7 20:17:29 2015  Koichi Sasada  <ko1@atdot.net>
 
-Mon Dec  6 17:19:13 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* gc.c (newobj_of): divide fast path and slow path
+	  to avoid register savings for fast path.
 
-	* rubysig.h (TRAP_BEG, TRAP_END): safe errno around CHECK_INTS.
-	  (backported from CVS HEAD)  [ruby-dev:24993]
+	  This idea is given by Kazuho Oku <kazuho@natadeco.co>.
 
-Mon Dec  6 10:18:17 2004  Dave Thomas  <dave@pragprog.com>
+Wed Oct  7 17:30:50 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::look_for_directives_in):
-	  Oops - 1.8 doesn't have String#clear
+	* string.c (rb_str_times): optimize for the argument 0 and 1.
 
-Mon Dec  6 09:59:23 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Wed Oct  7 01:20:46 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/socket/socket.c (sock_connect): use rb_str_new4().
-	  [ruby-dev:25052]
+	* gc.h, gc.c: introduce new debug function rb_obj_info_dump(VALUE obj)
+	  which prints the result of rb_raw_obj_info(..., obj).
 
-Mon Dec  6 01:42:08 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Wed Oct  7 01:16:11 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/openssl/ossl_pkey_rsa.c (ossl_rsa_public_encrypt,
-	  ossl_rsa_public_decrypt, ossl_rsa_private_encrypt,
-	  ossl_rsa_private_decrypt): should take an optional argument
-	  to specify padding mode. [ruby-talk:122539]
+	* vm_args.c: remove an unused field args_info::calling.
 
-	* ext/openssl/ossl_pkey_rsa.c (Init_ossl_rsa): add new constants
-	  PKCS1_PADDING, SSLV23_PADDING, NO_PADDING and PKCS1_OAEP_PADDING
-	  under OpenSSL::PKey::RSA.
+Tue Oct  6 23:43:10 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* test/openssl/test_pkey_rsa.rb: new file.
+	* proc.c (rb_method_entry_min_max_arity): should support
+	  OPTIMIZED_METHOD_TYPE_CALL.
 
-Sun Dec  5 19:39:17 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Oct  6 21:29:08 2015  Tanaka Akira  <akr@fsij.org>
 
-	* lib/optparse.rb (OptionParser::Completion#complete): new parameter
-	  to direct case insensitiveness.
+	* lib/tmpdir.rb (Dir.tmpdir): return duplicated string to be
+	  modify safely even when $SAFE > 0.
 
-	* lib/optparse.rb (OptionParser#order!): ignore case only for long
-	  option.  [ruby-dev:25048]
+Tue Oct  6 19:24:38 2015  Koichi Sasada  <ko1@atdot.net>
 
-Sat Dec  4 22:54:15 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* vm_insnhelper.c (vm_call_method0): use switch() for visibilities
+	  (for readability).
 
-	* io.c (io_write): remove rb_str_locktmp().  [ruby-dev:25050]
+Tue Oct  6 19:23:58 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* io.c (io_fwrite): takes VALUE string as an argument.
-	  [ruby-dev:25050]
+	* proc.c (Init_Proc): Proc#call and others should be public.
 
-	* ext/socket/socket.c (sock_connect): remove rb_str_locktmp().
-	  [ruby-dev:25050]
+Tue Oct  6 18:51:51 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/socket/socket.c (udp_connect): [ruby-dev:25045]
+	* method.h: IMEMO_FL_USER3 and IMEMO_FL_USER4 is not needed any more.
 
-	* ext/socket/socket.c (udp_bind): ditto.
+Tue Oct  6 18:47:45 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/socket/socket.c (udp_send): ditto.
+	* method.h: remove METHOD_ENTRY_SAFE(me) and related code
+	  because $SAFE = 3 and 4 is not available.
+	  Now, $SAFE is not checked on method dispatch at all.
 
-	* ext/socket/socket.c (bsock_send): ditto.
+	* vm_eval.c, vm_insnhelper.c, vm_method.c: ditto.
 
-	* ext/socket/socket.c (s_recvfrom): ditto.
+Tue Oct  6 13:56:14 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* hash.c (rb_hash_hash): should provide "hash" method where "eql?"
-	  is redefined.  [ruby-talk:122482]
+	* include/ruby/ruby.h: turn function macros into inline functions,
+	  for debuggers.
 
-Sat Dec  4 14:54:52 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* include/ruby/ruby.h: turn constant macros into enums, for
+	  debuggers.
 
-	* eval.c (proc_invoke): use volatile `tmp' rather than `args'.
-	  [ruby-core:03882]
+Tue Oct  6 13:48:05 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Sat Dec  4 14:28:56 2004  Dave Thomas  <dave@pragprog.com>
+	* method.h: typo fix. Patch by @davydovanton [fix GH-1032][ci skip]
 
-	* lib/rdoc/code_objects.rb (RDoc::Context::Section::set_comment):
-	  Section comments may now be bracketed by lines which are
-	  ignored. You can now write
-	      # -----------
-	      # :section: Dave's Section
-	      # comment material
-	      # -----------
-	   The lines before :section: are removed, and identical lines at the end are
-	   also removed if present.
+Tue Oct  6 06:54:34 2015  Koichi Sasada  <ko1@atdot.net>
 
-Sat Dec  4 03:33:45 2004  Shugo Maeda  <shugo@ruby-lang.org>
+	* iseq.c (rb_iseq_free): free iseq::variable_body to avoid memory
+	  leak.
 
-	* ext/readline/readline.c: check $SAFE. (backported from CVS HEAD)
+Tue Oct  6 06:32:52 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* test/readline/test_readline.rb: added tests for readline.
-	  (backported from CVS HEAD)
+	* proc.c: enable optimization of Proc#call.
+	  [Feature #11569]
 
-Sat Dec  4 02:24:00 2004  NARUSE, Yui  <naruse@ruby-lang.org>
+	* NEWS: write about this optimization and incompatibilities.
 
-	* ext/nkf/nkf.c: add constant NKF::VERSION
+	* test/ruby/test_backtrace.rb: catch up this fix.
 
-	* ext/nkf/nkf.c(guess): this becomes an alias of guess2
+Tue Oct  6 04:41:03 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/nkf/test.rb(mime_out2): add --no-cp932
+	* vm_insnhelper.c: solve goto spaghetti.
 
-	* ext/nkf/nkf-utf8/nkf.c: original nkf2 revision 1.47
+	  Change all goto statement across blocks to tail call functions.
 
-Sat Dec  4 00:35:08 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Tue Oct  6 02:29:38 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/socket/socket.c (bsock_setsockopt): [ruby-dev:25039]
+	* string.c (rb_str_resurrect): optimize by short circuit to copy
+	  hidden string without checking length, encoding and so on.
 
-Fri Dec  3 18:57:03 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Mon Oct  5 23:08:17 2015  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
 
-	* lib/ostruct.rb: 1.9 marshaling support back-ported.
-	  [ruby-core:03871]
+	* test/ruby/test_thread.rb (test_handle_interrupt_blocking): check if
+	  exception handling was postponed until sleep.
 
-Fri Dec  3 13:45:20 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Mon Oct  5 22:25:49 2015  Tanaka Akira  <akr@fsij.org>
 
-	* eval.c (proc_invoke): copy arguments to frame.argv.
-	  [ruby-core:03861]
+	* lib/pp.rb: Use frozen_string_literal: true.
 
-Fri Dec  3 12:25:41 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/prettyprint.rb: Ditto.
 
-	* st.h: fix prototypes.
+	* lib/resolv.rb: Ditto.
 
-Fri Dec  3 00:21:05 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/tmpdir.rb: Ditto.
 
-	* object.c (convert_type): use rb_respond_to() again.
-	  [ruby-dev:25021]
+	* test/test_pp.rb: Ditto.
 
-	* eval.c (rb_respond_to): funcall respond_to? if it's redefined.
-	  [ruby-dev:25021]
+	* test/test_prettyprint.rb: Ditto.
 
-Fri Dec  3 01:55:24 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* tool/transcode-tblgen.rb: Ditto.
 
-	* ext/tk/lib/tk.rb: widget configuration by TkWindow#method_missing
-	  returns proper object. "widget.option = val" returns val, and
-	  "widget.option(val)" returns self.
+Mon Oct  5 20:39:32 2015  Benoit Daloze  <eregontp@gmail.com>
 
-	* ext/tk/lib/tk/font.rb: TkFont#replace accepts only one font argument.
+	* test/ruby/test_thread.rb: fix potential race condition.
+	  The thread could have a "sleep" status because it tries
+	  to acquire the mutex, but does not have it yet.
 
-	* ext/tk/lib/tk/radiobutton.rb: add TkRadiobutton#value and
-	  TkRadiobutton#value=(val).
+Mon Oct  5 15:39:30 2015  Zachary Scott  <zzak@ruby-lang.org>
 
-	* ext/tk/lib/tk/spinbox.rb: callback substitution support on
-	  command option.
+	* numeric.c: [DOC] Overview for Numeric class by Joe Corcoran
+	  This patch was created at ROSSConf Berlin 2015 [Bug #11555]
 
-	* ext/tk/sample/demos-en/widget: bug fix (wrong image height)
+Mon Oct  5 15:34:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/sample/demos-jp/widget: ditto.
+	* proc.c (proc_new): link ep to calling block.
+	  [ruby-core:70980] [Bug #11566]
 
-Fri Dec  3 00:11:48 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Mon Oct  5 00:53:51 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* io.c (rb_file_initialize): [ruby-dev:25032]
+	* dir.c (rb_dir_getwd): make ASCII-8BIT if filesystem encoding is
+	  US-ASCII, like as Dir.glob.
 
-Thu Dec  2 16:41:03 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sun Oct  4 23:39:09 2015  Tanaka Akira  <akr@fsij.org>
 
-	* eval.c (rb_protect): prevent continuations created inside from being
-	  called from the outside.  [ruby-dev:25003]
+	* enum.c (nmin_filter): Fix limit value.
+	  patch by Helder Pereira.
+	  [Bug #11471] [ruby-core:70477]
 
-	* eval.c (rb_callcc, rb_cont_call): prohibit calling from different
-	  signal contexts.  [ruby-dev:25022]
+Sun Oct  4 15:11:48 2015  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Thu Dec  2 09:57:24 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* enc/euc_jp.c (mbc_case_fold): check given string is valid or not,
+	  and if invalid, return 1. [Bug #11486]
 
-	* lib/ostruct.rb (OpenStruct::Marshaler): OpenStruct can be
-	  marshaled again.  [ruby-core:03862]
+Sun Oct  4 10:09:57 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Dec  2 09:30:06 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* dir.c (rb_dir_getwd): normalize OS path to UTF-8 on OS X.
 
-	* eval.c (thread_mark): mark thread group.  [ruby-dev:25020]
+Sun Oct  4 00:09:45 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (thgroup_add): check whether the argument is really a Thread.
+	* template/ruby-runner.c.in: wrapper to set dynamic loading path
+	  environment variable.  /bin/sh on Mac OS X 10.11 (El Capitan)
+	  clears DYLD_LIBRARY_PATH.
 
-Thu Dec  2 07:57:16 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	  it must:
+	  - do nothing even if current directory is not present
+	  - do not set other environment variables, e.g. PWD, SHLVL, etc
+	  - do not open other FDs, e.g. pipes for timer thread
 
-	* io.c (rb_io_ctl): [ruby-dev:25019]
+Sun Oct 2 10:59:00 2015  schneems  <richard.schneeman@gmail.com>
 
-Wed Dec  1 02:21:02 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/pathname/lib/pathname.rb: freeze string literals for
+	  reduced object allocation.
+	  [Feature #11375] [ruby-core:70043]
 
-	* signal.c (sighandler): call handler immediately only for default
-	  handlers.  [ruby-dev:25003]
+Fri Oct  2 09:20:20 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
 
-Tue Nov 30 23:38:18 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* common.mk, lib/unicode_normalize/tables.rb: Change Unicode
+	  Version for character normalization data from 7.0.0 to
+	  8.0.0.
 
-	* io.c (io_fread): need not to null terminate.  [ruby-dev:24998]
+Fri Oct  2 00:18:39 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* io.c (read_all): remove unnecessary rb_str_resize().
-	  [ruby-dev:24996]  (backported from CVS HEAD)
+	* proc.c (proc_mark): block.ep of Proc from Symbol is now NULL.
+	  [ruby-core:70961] [Bug #11560]
 
-	* io.c (io_readpartial): ditto.
+Wed Sep 30 15:47:13 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* io.c (io_read): ditto.
+	* vm_args.c (vm_caller_setup_arg_block): bypass Symbol#to_proc
+	  call to optimize symbol block passing.
 
-Tue Nov 30 16:18:50 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Wed Sep 30 01:34:34 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* io.c (io_fread): need not to null terminate.  [ruby-dev:24998]
+	* parse.y (parser_free): fix memory leak at syntax error when
+	  warn-indent is enabled.
 
-	* io.c (read_all): remove unnecessary rb_str_resize().
-	  [ruby-dev:24996]
+Tue Sep 29 22:27:50 2015  Benoit Daloze  <eregontp@gmail.com>
 
-	* io.c (io_read): ditto.
+	* parse.y: fix minor typo. [ci skip][fix GH-1038].
+	  Patch by @ltratt.
 
-Tue Nov 30 00:49:08 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Tue Sep 29 16:53:53 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
 
-	* io.c (rb_io_sysread): use temporary lock.  [ruby-dev:24992]
+	* tool/unicode_norm_gen.tmpl, lib/unicode_normalize/tables.rb:
+	  get rid of many .freeze commands by using frozen_string_literal
+	  pragma.
 
-Mon Nov 29 16:06:04 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Sep 29 16:37:29 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/stringio/stringio.c (strio_write): insufficiently filled string
-	  being extended when overwriting.  [ruby-core:03836]
+	* compile.c (compile_dstr_fragments): fix performance by omitting
+	  the first empty string only for keeping literal encoding if
+	  other literals are too.  [ruby-core:70930] [Bug #11556]
 
-Mon Nov 29 15:59:05 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* string.c (rb_str_append_literal): append but keep encoding non
+	  US-ASCII.
 
-	* lib/ostruct.rb (OpenStruct::method_missing): check method
-	  duplication for -d.
+Mon Sep 28 17:40:17 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* lib/ostruct.rb (OpenStruct::initialize): ditto.
+	* lib/net/ftp.rb (mtime): use usec instead of fractions to parse
+	  decimal fractions of a second correctly when the number of digits
+	  is not 6.
 
-Mon Nov 29 15:22:28 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon Sep 28 16:07:08 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* test/io/nonblock/test_flush.rb: abandon tests when io/nonblock is
-	  not supported.
+	* lib/net/ftp.rb (mtime): parse decimal fractions of a second as
+	  specified in RFC 3659.
 
-Mon Nov 29 03:08:30 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Mon Sep 28 10:31:12 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* object.c (convert_type): direct call conversion methods for the
-	  performance.  [ruby-core:03845]
+	* test/test_forwardable.rb: Write basic tests for lib/forwardable.
+	  [fix GH-1035] Patch by @kachick
 
-	* eval.c (rb_funcall_rescue): new function.
+Sun Sep 27 23:32:46 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* object.c (rb_Array): avoid using rb_respond_to().
+	* class.c (rb_define_class, rb_define_class_id_under): refine
+	  error messages.
 
-	* object.c (rb_Integer): ditto.
+	* class.c (rb_define_module, rb_define_module_id_under): ditto,
+	  and make consistent with class.
 
-	* parse.y (reduce_nodes): empty body should return nil.
+Sun Sep 27 18:44:43 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* string.c (rb_str_aset): the original string should not be
-	  affected by modifying duplicated string.  [ruby-dev:24981]
+	* ChangeLog: removed duplicated message.
 
-Mon Nov 29 13:57:38 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+Sun Sep 27 15:46:58 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* win32/win32.c (CreateChild): search executable file if no program
-	  name given. (backported from CVS HEAD)
+	* ruby.c (process_options): add an option to enable/disable
+	  frozen-string-literal.  [Feature #8976]
 
-Mon Nov 29 13:37:54 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* compile.c (iseq_compile_each): override compile option by option
+	  given by pragma.
 
-	* io.c (fptr_finalize): must not use FILE after fclose().
-	  [ruby-dev:24985]
+	* iseq.c (rb_iseq_make_compile_option): extract a function to
+	  overwrite rb_compile_option_t.
 
-Mon Nov 29 13:16:31 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* parse.y (parser_set_compile_option_flag): introduce pragma to
+	  override compile options.
 
-	* win32/win32.c (CreateChild): push back the last space before next
-	  loop because CharNext() eats it.
+	* parse.y (magic_comments): new pragma "frozen-string-literal".
+	  [Feature #8976]
 
-Mon Nov 29 01:18:18 2004  Tanaka Akira  <akr@m17n.org>
+Sun Sep 27 08:16:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* io.c (rb_io_check_writable): call io_seek regardless of
-	  NEED_IO_SEEK_BETWEEN_RW.  [ruby-dev:24986]
+	* lib/ostruct.rb (delete_field): do not raise NameError for
+	  existing keys.  [Fix GH-1033]
 
-Sat Nov 27 21:43:39 2004  Tanaka Akira  <akr@m17n.org>
+Sun Sep 27 00:34:31 2015  Zachary Scott  <zzak@ruby-lang.org>
 
-	* io.c: avoid data lost with nonblocking fd and
-	  stdio buffering in sync mode.  [ruby-dev:24966]
-	  based on matz's patch [ruby-dev:24967]
-	  (io_fwrite): new primitive writing function which writes
-	  directly if sync mode.
-	  (rb_io_fwrite): wrapper for io_fwrite now.
-	  (io_write): call io_fwrite instead of rb_io_fwrite.
+	* lib/ostruct.rb: Move method definitions for getter/setter to be lazy
+	  Patch by @sferik in [GH-1033]: https://github.com/ruby/ruby/pull/1033
 
-Sat Nov 27 14:44:15 2004  Kent Sibilev  <ksibilev@bellsouth.net>
+Fri Sep 25 10:07:25 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* lib/cgi/session.rb (CGI::Session::initialize): create_new_id is
-	  now a instance method.  [ruby-core:03832]
+	* lib/net/http.rb: removed unused variable. It's removed at r13648.
+	  [fix GH-1022] Patch by @nkondratyev
 
-Sat Nov 27 09:41:21 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Sep 25 09:48:27 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* io.c (io_fread): old rb_io_fread with file closing checking.
-	  (rb_io_fread): wrapper for io_fread now.
-	  [ruby-dev:24964]
+	* gems/bundled_gems: upgrade to minitest-5.8.1
 
-Fri Nov 26 18:02:44 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Fri Sep 25 09:47:12 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* ext/tk/lib/tk.rb: Tk.destroy uses TkWindow#epath
+	* id_table.c: fix typo. [ci skip][fix GH-1031] Patch @davydovanton
 
-	* ext/tk/lib/tk/image.rb: bug fix
+Fri Sep 25 07:54:05 2015  Rei Odaira  <Rei.Odaira@gmail.com>
 
-	* ext/tk/lib/tk/wm.rb: add 'iconphoto' method(Windows only)
+	* test/gdbm/test_gdbm.rb (TestGDBM#test_s_open_lock): skip
+	  this test on AIX. The issue is the same as on Solaris.
+	  [ruby-dev:47631]
 
-	* ext/tk/lib/tkextlib/*: some methods uses TkWindow#epath
+Thu Sep 24 17:25:09 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Nov 26 13:49:06 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* parse.y (paren_args): fix separator token at `foo::bar()` in
+	  ripper.
 
-	* eval.c (method_missing): raise TypeError for classes do not
-	  have allocators.  [ruby-core:03752]
+Thu Sep 24 00:00:17 2015  Rei Odaira  <Rei.Odaira@gmail.com>
 
-	* lib/erb.rb: add RDoc by James Edward Gray II.  [ruby-core:03786]
+	* complex.c: ruby/config.h must be included before math.h
+	  because it defines _LARGE_FILES on AIX and _LARGE_FILES
+	  must be defined before sys/types.h is included from math.h.
+	  [Bug #11483]
 
-Fri Nov 26 13:29:02 2004  Dave Thomas  <dave@pragprog.com>
+Wed Sep 23 22:22:38 2015  Zachary Scott  <zzak@ruby-lang.org>
 
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::look_for_directives_in): Break
-	  out of preprocessing when we find a :section: directive (previously cleared out the
-	  comment, but this apparently now generates an error in gsub!)
+	* ext/openssl/ossl_pkcs12*: Remove svn commit id macro
 
-Fri Nov 26 00:17:40 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Wed Sep 23 01:11:28 2015  Zachary Scott  <zzak@ruby-lang.org>
 
-	* io.c (io_read): move StringValue() check before GetOpenFile().
-	  [ruby-dev:24959]
+	* ext/openssl/*: Remove svn commit id macros to make sync easier
 
-Thu Nov 25 20:14:57 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Sep 22 04:20:01 2015  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
 
-	* lib/thwait.rb (ThreadsWait#join_nowait): abnormally terminated
-	  threads should be also processed.  [ruby-talk:121320]
+	* test/drb/test_drb.rb: Run Rinda/DRb tests on localhost. [Fix GH-1027]
+	  patch by voxik.
 
-Thu Nov 25 10:14:26 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/rinda/test_rinda.rb: ditto
 
-	* dir.c (push_braces): do not reuse buffer strings.  [ruby-core:03806]
+Mon Sep 21 20:53:39 2015  tbpgr  <tbpgr@tbpgr.jp>
 
-Thu Nov 25 07:59:41 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/win32ole/test_win32ole_event.rb: fix typo.
+	  swbemsink_avairable? => swbemsink_available?  [Fix GH-1025]
 
-	* io.c (read_all): stringify non-nil buffer argument, and always
-	  taint the result.  [ruby-dev:24955]
+Sun Sep 20 10:07:35 2015  Anton Davydov  <antondavydov.o@gmail.com>
 
-Wed Nov 24 01:01:31 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* cont.c (rb_callcc): [DOC] append continuations example accros
+	  methods.  [Fix GH-1026]
 
-	* io.c (io_read): integer conversion should be prior to
-	  GetOpenFile().  [ruby-dev:24952]
+Sun Sep 20 03:20:21 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* configure.in, io.c: cancel [ ruby-Patches-1074 ].
+	* iseq.c (rb_iseq_free): free rb_iseq_t::body::cc_entries.
 
-Tue Nov 23 08:09:50 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Sun Sep 20 02:46:34 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/tk/lib/tk/menu.rb: improve usability of TkOptionMenubutton
+	* vm_core.h: split rb_call_info_t into several structs.
+	  * rb_call_info (ci) has compiled fixed information.
+	  * if ci->flag & VM_CALL_KWARG, then rb_call_info is
+	    also rb_call_info_with_kwarg. This technique reduce one word
+	    for major rb_call_info data.
+	  * rb_calling_info has temporary data (argc, blockptr, recv).
+	    for each method dispatch. This data is allocated only on
+	    machine stack.
+	  * rb_call_cache is for inline method cache.
 
-Tue Nov 23 02:00:21 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	  Before this patch, only rb_call_info_t data is passed.
+	  After this patch, above three structs are passed.
 
-	* file.c (rb_file_chown): integer conversion should be prior to
-	  GetOpenFile().  [ruby-dev:24949]
+	  This patch improves:
+	  * data locality (rb_call_info is now read-only data).
+	  * reduce memory consumption (rb_call_info_with_kwarg,
+	    rb_calling_info).
 
-Tue Nov 23 00:10:48 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* compile.c: use above data.
 
-	* file.c (rb_file_chown): integer conversion should be prior to
-	  GetOpenFile().  [ruby-dev:24947]
+	* insns.def: ditto.
 
-	* file.c (rb_file_truncate): ditto.
+	* iseq.c: ditto.
 
-	* file.c (rb_file_s_truncate): ditto.
+	* vm_args.c: ditto.
 
-	* dir.c (dir_seek): use NUM2OFFT().
+	* vm_eval.c: ditto.
 
-	* misc/ruby-mode.el (ruby-non-block-do-re): should not match words
-	  start with block keyword and underscore.  [ruby-core:03719]
+	* vm_insnhelper.c: ditto.
 
-Mon Nov 22 22:33:02 2004  Dave Thomas  <dave@pragprog.com>
+	* vm_insnhelper.h: ditto.
 
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::parse_require): Don't use names
-	  of variables or constants when oarsing 'require'
+	* iseq.h: add iseq_compile_data::ci_index and
+	  iseq_compile_data::ci_kw_index.
 
-Mon Nov 22 00:13:35 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* tool/instruction.rb: introduce TS_CALLCACHE operand type.
 
-	* dir.c (dir_seek): should retrieve dir_data after NUM2INT().
-	  [ruby-dev:24941]
+Sun Sep 20 02:18:10 2015  Tanaka Akira  <akr@fsij.org>
 
-Sat Nov 20 23:57:33 2004  Dave Thomas  <dave@pragprog.com>
+	* test/lib/envutil.rb: mkfifo command based File.mkfifo method
+	  definition removed.
 
-	* lib/rdoc/README (et al): Add a new directive, :section:, and
-	  change the output format to accomodate. :section: allows to to
-	  group together methods, attributes, constants, etc under
-	  headings in the output. If used, a table of contents is
-	  generated.
+Fri Sep 18 20:11:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Nov 20 23:56:54 2004  Dave Thomas  <dave@pragprog.com>
+	* file.c (rb_file_s_mkfifo): implement File.mkfifo.
+	  [Feature #11536]
 
-	* lib/rdoc/options.rb (Options::parse): Force --inline-source if
-	  --one-file option given
+Fri Sep 18 16:56:19 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-Sat Nov 20 23:55:19 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* NEWS: add Net::FTP#mlst and Net::FTP#mlsd.
 
-	* string.c (rb_str_splice): should place index wrapping after
-	  possible modification.  [ruby-dev:24940]
+Fri Sep 18 07:39:22 2015  Aaron Patterson <tenderlove@ruby-lang.org>
 
-Sat Nov 20 13:26:03 2004  NARUSE, Yui  <naruse@ruby-lang.org>
+	* ext/objspace/objspace_dump.c (obj_type): add IMEMO types to the heap
+	  dump information.
 
-	* ext/nkf/nkf-utf8/utf8tbl.c: original revision 1.7
+Thu Sep 17 22:33:07 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Sat Nov 20 05:34:24 2004  NARUSE, Yui  <naruse@ruby-lang.org>
+	* common.mk: fix command error with outside builddir.
 
-	* ext/nkf/nkf-utf8/nkf.c: original nkf.c rev:1.40
+Thu Sep 17 17:42:09 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* ext/nkf/test.rb: add test for mime encode/decode
+	* common.mk: separated test for test-framework from test-all task.
+	  They should be invoke at first before tests of test-all.
 
-Sat Nov 20 01:37:34 2004  Johan Holmberg  <holmberg@iar.se>
+Thu Sep 17 12:05:54 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* eval.c (error_print): nicer traceback at interrupt.
-	  [ruby-core:03774]
+	* test/ruby/test_dir.rb (TestDir#test_fileno): s/?x/"x"/. Don't
+	  use tricky code, please.
 
-Sat Nov 20 00:07:16 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Wed Sep 16 20:49:56 2015  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
 
-	* string.c (str_gsub): internal buffer should not be listed by
-	  ObjectSpace.each_object() by String#gsub.  [ruby-dev:24931]
+	* encindex.h: fix typo of last #endif comment. [ci skip]
 
-Fri Nov 19 01:20:22 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Wed Sep 16 20:39:26 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/cgi/session.rb (CGI::Session::FileStore::initialize): raise
-	  exception if data corresponding to session specified from the
-	  client does not exist.
+	* variable.c (set_const_visibility): fail if the class/module is
+	  frozen.  [ruby-core:70828] [Bug #11532]
 
-Fri Nov 19 00:59:31 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Wed Sep 16 17:16:43 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* string.c (str_gsub): internal buffer should not be listed by
-	  ObjectSpace.each_object().  [ruby-dev:24919]
+	* vm_core.h (ENABLE_VM_OBJSPACE): enable per-VM object space on
+	  Windows by default, as rb_w32_sysinit() no longer depends on
+	  ruby_xmalloc.
 
-Thu Nov 18 18:41:08 2004  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+Wed Sep 16 15:08:17 2015  Akinori MUSHA  <knu@iDaemons.org>
 
-	* test/ruby/test_stringchar.rb (test_bang): added.
+	* doc/syntax/literals.rdoc (Strings): [DOC] Revise the character
+	  literal part.
 
-	* string.c (rb_str_upcase_bang, rb_str_capitalize_bang)
-	  (rb_str_swapcase_bang): missing rb_str_modify().  [ruby-dev:24915]
+Wed Sep 16 14:55:33 2015  Akinori MUSHA  <knu@iDaemons.org>
 
-Thu Nov 18 00:21:15 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* doc/syntax/literals.rdoc (Strings): [DOC] Document the full list
+	  of supported escape sequences in string literals.
 
-	* process.c (proc_getpgrp): prohibit for $SAFE=2.
-	  [ruby-dev:24899]
+Wed Sep 16 14:49:58 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* process.c (get_pid): ditto.  [ruby-dev:24904]
+	* string.c (rb_str_setbyte): keep the code range as possible.
 
-	* process.c (get_ppid): ditto.
+Wed Sep 16 13:23:48 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* array.c (rb_ary_delete): defer rb_ary_modify() until actual
-	  modification.  [ruby-dev:24901]
+	* doc/syntax/literals.rdoc (Strings): mention about ?a literal.
 
-Thu Nov 18 10:10:14 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Sep 16 12:06:53 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* io.c, rubyio.h (rb_io_modenum_flags): exported.
+	* dir.c (glob_helper): check pathtype once again by lstat(2) if
+	  dp->d_type is DT_UNKNOWN. XFS may return DT_UNKNOWN.
 
-	* ext/stringio/stringio.c (strio_initialize): allow Fixnum as mode as
-	  well as IO.new does.  [ruby-dev:24896]
+Wed Sep 16 03:49:19 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-Wed Nov 17 23:42:40 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* test/ruby/test_thread.rb (TestThread#test_mutex_synchronize):
+	  insert waste loop for invoking preemptive thread context switch.
+	  [Bug #11496]
 
-	* test/ruby/test_settracefunc.rb: added.  [ruby-dev:24884]
+Tue Sep 15 19:38:55 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Nov 17 13:56:57 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* gc.c (rb_objspace_alloc, rb_objspace_free): define always
+	  regardless ENABLE_VM_OBJSPACE, and free heap pages.
 
-	* parse.y (newline_node): should not use FL_SET. [ruby-dev:24874]
+Tue Sep 15 15:15:41 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* parse.y (string_content): should not use FL_UNSET.
+	* win32/win32.c (rb_w32_sysinit, rb_w32_readdir): compare by
+	  encoding index to get rid of encoding initialization before VM
+	  object space allocation.
 
-	* node.h (NODE_NEWLINE): remove unused bit to utilize flag field
-	  in nodes.
+	* dir.c (fundamental_encoding_p, push_glob): compare by encoding
+	  index immediately.
 
-Wed Nov 17 13:09:40 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* enc/{ascii,us_ascii,utf_8}.c: set encoding indexes of
+	  fundamental built-in encodings so that usable as well as
+	  allocated rb_encoding before rb_enc_init().
 
-	* {bcc32,win32,wince}/Makefile.sub (test): should build ruby.exe
-	  before running test. [ruby-core:03756]
+	* encindex.h: separate encoding index constants from internal.h.
 
-Wed Nov 17 04:33:01 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Tue Sep 15 13:13:13 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* pack.c: all features are backport from 1.9. [ruby-dev:24826]
+	* array.c (rb_ary_sort_bang, rb_ary_sort): [DOC] correct block
+	  return values, which may be a negative or positive integer, not
+	  only -1 or +1.
 
-	* bignum.c (rb_big2ulong_pack): new function to pack Bignums.
+Tue Sep 15 12:49:10 2015  Jason Barnabe  <jason.barnabe@gmail.com>
 
-Wed Nov 17 03:42:45 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* array.c (rb_ary_sort_bang, rb_ary_sort): [DOC] Correct
+	  description of array sort block return values.  And also fix up
+	  the grammar a bit.  [Fix GH-1020]
 
-	* string.c (rb_str_splice): move rb_str_modify() after
-	  StringValue(), which may alter the receiver.  [ruby-dev:24878]
+Tue Sep 15 12:44:32 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Nov 16 23:45:07 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* util.c (ruby_qsort): use BSD-style qsort_r if available.
 
-	* numeric.c (flo_divmod): protect float values from GC by
-	  assignment to local variables.  [ruby-dev:24873]
+Mon Sep 14 19:26:34 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-Tue Nov 16 16:30:21 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* lib/net/ftp.rb (parse_mlsx_entry): parse pathnames including
+	  space correctly.
 
-	* {bcc32,win32,wince}/setup.mak (-epilogue-): remove config.h and
-	  config.status to force updating them.
+Mon Sep 14 11:12:10 2015  Anton Davydov  <antondavydov.o@gmail.com>
 
-Tue Nov 16 16:20:45 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/racc/rdoc/grammar.en.rdoc: [DOC] fix typo, "convertion" to
+	  "conversion".  [Fix GH-1016]
 
-	* ext/stringio/stringio.c (strio_read): position was ignored when a
-	  buffer was passed.  http://www.yo.rim.or.jp/~nov/d/?date=20041116#p03
+Sun Sep 13 11:03:13 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Nov 16 11:19:07 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* include/ruby/ruby.h: prefix RUBY or RB to global symbols to get
+	  rid of name conflicts with other headers.
 
-	* lib/test/unit/autorunner.rb (Test::Unit::AutoRunner::options): use
-	  Regexp conversion.
+	* include/ruby/encoding.h, include/ruby/intern.h: ditto.
 
-Tue Nov 16 01:41:31 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sun Sep 13 09:38:51 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* string.c (str_mod_check): frozen check should be separated.
-	  [ruby-core:3742]
+	* lib/net/ftp.rb (size, modify, create, type, unique, perm, lang,
+	  media_type, charset): new methods to return standard facts.
 
-	* array.c (rb_ary_update): pedantic check to detect
-	  rb_ary_to_ary() to modify the receiver.  [ruby-dev:24861]
+Sat Sep 12 19:43:49 2015  Koichi Sasada  <ko1@atdot.net>
 
-Mon Nov 15 13:50:52 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* vm_insnhelper.c (vm_call_iseq_setup_normal): do not clear local
+	  variables here. vm_push_frame() clears.
 
-	* string.c (rb_str_justify): typo fixed.  [ruby-dev:24851]
+	* vm_insnhelper.c (vm_call_iseq_setup_tailcall): ditto.
 
-Mon Nov 15 11:50:32 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* vm_insnhelper.c (vm_push_frame): move check code to
+	  vm_check_frame().
 
-	* misc/ruby-mode.el (ruby-special-char-p, ruby-parse-partial): handle
-	  operator symbols.  [ruby-talk:120177]
+	  Reorder initialization timing to reuse same values (sp).
 
-Sun Nov 14 13:27:03 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* compile.c (rb_iseq_compile_node): use
+	  iseq_set_exception_local_table() for ISEQ_TYPE_DEFINED_GUARD.
 
-	* lib/pp.rb (PP#object_address_group): remove odd number of 'f'
-	  prefixed to negative address.
+Sat Sep 12 23:06:51 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-Sun Nov 14 08:51:04 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* lib/net/ftp.rb (file?, directory?, appendable?, creatable?,
+	  deletable?, enterable?, renamable?, listable?, directory_makable?,
+	  purgeable?, readable?, writable?): new methods.
 
-	* test/logger/test_logger.rb: Logger just expects
-	  Logger#datetime_format to be used for Time#strftime independently of
-	  locale. [ruby-dev:24828]
+Sat Sep 12 21:27:22 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-Fri Nov 12 15:03:26 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* lib/net/ftp.rb (FACT_PARSERS): support system dependent facts
+	  UNIX.mode, UNIX.owner, UNIX.group, UNIX.ctime, and UNIX.atime.
 
-	* eval.c (ruby_options): now we cannot call rb_glob() before
-	  ruby_init(), so call rb_w32_cmdvector() at ruby_options().
+Sat Sep 12 19:08:58 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* win32.{c,h} (rb_w32_cmdvector): rename make_cmdvector() and
-	  export it.
+	* win32/win32.c (rb_w32_dup2): should return the new fd on
+	  success, while msvcrt returns 0 wrongly.
 
-Fri Nov 12 14:08:01 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Sat Sep 12 18:14:11 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* ext/tk/lib/tk/event.rb: remove $LOADED_FEATURES trick
+	* lib/net/ftp.rb (parse_mlsx_entry, mlst) raise an FTPProtoError
+	  when parsing failed.
 
-	* ext/tk/lib/tk.rb: ditto
+Sat Sep 12 18:00:35 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-Fri Nov 12 00:31:05 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/net/ftp.rb (TIME_PARSER): use "Z" instead of "+00:00" to
+	  get UTC time.  Thanks, Wilson Bilkovich.
 
-	* ext/gdbm/gdbm.c (fgdbm_store): StringValue() may alter string
-	  pointer.  [ruby-dev:24783]
+Sat Sep 12 17:55:24 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-Thu Nov 11 17:36:12 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/net/ftp.rb (mlst, mlsd): support new commands MLST and MLSD
+	  specified in RFC 3659.
 
-	* dir.c (rb_globi): also should call back via rb_glob_caller().
-	  [ruby-dev:24775]
+Sat Sep 12 16:14:31 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Thu Nov 11 16:47:21 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* file.c: access()/eaccess() wrapping methods check more than just uid.
+	  [fix GH-1007][ci skip] Patch by @eam
 
-	* test/ruby/test_file.rb (test_truncate_wbuf): we want to test
-	  only File#truncate, not behaviour of seek(2).
+Sat Sep 12 16:07:01 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Thu Nov 11 09:41:01 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* README.md: improve markdown rendering for readability.
+	  [fix GH-1015][ci skip] Patch by @Matrixbirds
 
-	* dir.c (push_braces): was confusing VALUE and char*.
+Sat Sep 12 14:30:03 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* dir.c (rb_push_glob): Dir.glob should have called its block.
+	* process.c (save_redirect_fd): make saved FDs close-on-exec not
+	  to be inherited.
 
-Thu Nov 11 01:52:52 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* process.c (run_exec_dup2): restore close-on-exec flags too.
 
-	* error.c (syserr_initialize): use stringified object.
-	  [ruby-dev:24768]
+	* win32/win32.c (fcntl): implement F_GETFD, F_SETFD, and
+	  F_DUPFD_CLOEXEC.
 
-Wed Nov 10 22:49:01 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sat Sep 12 05:35:24 2015  Eric Wong  <e@80x24.org>
 
-	* lib/delegate.rb (SimpleDelegator::dup): wrong number of
-	  arguments.
+	* rational.c (string_to_r_strict): preserve encoding in exception
 
-	* lib/delegate.rb (DelegateClass::dup): ditto.
+Fri Sep 11 20:23:35 2015  Koichi Sasada  <ko1@atdot.net>
 
-Wed Nov 10 12:31:21 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* vm_core.h: remove rb_call_info_t::aux.opt_pc.
 
-	* README.EXT (Example): extconf.rb is indispensable now.
+	* vm_insnhelper.c: introduce shortcut functions for opt_pc == 0
+	  because opt_pc is always 0 on shortcut function.
 
-Wed Nov 10 03:33:36 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Fri Sep 11 17:49:36 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/tcltklib/tcltklib.c: fix SEGV when compiled with Tcl/Tk8.3.x
-	  or older
+	* iseq.c: disable ISeq.load. It enabled accidentally at r51794.
 
-	* ext/tk/lib/tkextlib/tile/style.rb: bug fix
+Fri Sep 11 11:15:12 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-Tue Nov  9 14:27:18 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/net/ftp.rb (size, mdtm, system): parse responses according to
+	  RFC 959 and 3659, where reply codes must be followed by SP.
 
-	* lib/optparse.rb (OptionParser::Officious): moved from DefaultList.
+	* lib/net/ftp.rb (system): remove LF from the return value.
 
-Tue Nov  9 01:05:04 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Thu Sep 10 22:48:49 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* dir.c (rb_glob2): do not allocate buffer from heap to avoid
-	  memory leaks.  use string object for buffering instead.
-	  [ruby-dev:24738]
+	* parse.y (literal_concat_gen, evstr2dstr_gen): keep literal
+	  encoding beginning with an interpolation same as the source file
+	  encoding.  [ruby-core:70703] [Bug #11519]
 
-	* dir.c (join_path): ditto.
+Thu Sep 10 22:15:51 2015  Joe Rafaniello  <jrafanie@redhat.com>
 
-	* io.c (io_read): external input buffer may be modified even after
-	  rb_str_locktmp().  [ruby-dev:24735]
+	* process.c (rb_f_spawn): Be more specific regarding "other
+	  values" by having "non-zero positive integers" Add nil, the
+	  default value, as a possible value and what it means.
 
-	* dir.c (fnmatch): p or s may be NULL.  [ruby-dev:24749]
+	  Try to use more consistent language.
+	  [Fix GH-1008]
 
-Tue Nov  9 00:53:53 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+Thu Sep 10 15:16:02 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* regex.c (slow_match): avoid GCC 3.4.x warnings.
+	* lib/net/ftp.rb (getmultiline): refactor.
 
-Tue Nov  9 00:50:06 2004  Dave Thomas  <dave@pragprog.com>
+Thu Sep 10 12:17:28 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/rdoc/rdoc.rb: Change version numbering of RDoc and ri
+	* compile.c (iseq_build_from_ary_body): register cdhash to the
+	  iseq constant body instead of compile time mark array, not to
+	  get GCed.  [ruby-core:70708] [Feature #8543]
 
-Mon Nov  8 23:38:35 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+Wed Sep  9 18:16:14 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/drb/extservm.rb: add DRb::ExtServManager#uri=.
-	  [ruby-dev:24743]
+	* lib/rubygems/stub_specification.rb (Gem::StubSpecification#data):
+	  should not change the value of $. when `require`ing gems.
+	  this fixed test failures introduced by r51813.
 
-Mon Nov  8 22:20:19 2004  Dave Thomas  <dave@pragprog.com>
+Wed Sep  9 16:55:45 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_class):
-	  Fix bug where parent class wasn't being detected if the
-	  child class was defined using the A::B notation.
+	* ruby.c (usage, enable_option, disable_option, process_options): new
+	  option `--disable-did_you_mean`.
 
-Mon Nov  8 00:14:13 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* gem_prelude.rb: now requires did_you_mean gem by default if available.
 
-	* configure.in: add setup for mignw32 cross compiling.
-	  [ruby-talk:119413]
+Wed Sep  9 13:38:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Nov  7 23:49:26 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* tool/extlibs.rb (do_patch): let "patch" command change the
+	  working directory and open the patch file there, instead of
+	  spawn options, so that proper error message will be shown by the
+	  command not just "chdir" or "open".
 
-	* ext/tk/lib/tk.rb: bind-event methods accept multi substitution
-	  arguments.
+Wed Sep  9 11:33:05 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/tk/lib/tk/canvas.rb: ditto.
+	* common.mk (update-gems): use BASERUBY instead of RUNRUBY.
 
-	* ext/tk/lib/tk/canvastag.rb: ditto.
+Wed Sep  9 11:08:59 2015  Zachary Scott  <zzak@ruby-lang.org>
 
-	* ext/tk/lib/tk/text.rb: ditto.
+	* lib/delegate.rb: Remove backtrace cleaning for delegated methods
+	  This patch was provided by Rafael Franca and greatly improves
+	  performance when an exception is raised. [Bug #11461]
 
-	* ext/tk/lib/tk/texttag.rb: ditto.
+Wed Sep  9 10:05:41 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* ext/tk/lib/tkextlib: ditto.
+	* test/rubygems/test_config.rb: fix broken tests for Windows platform.
 
-Sat Nov  6 14:58:44 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Wed Sep  9 07:46:32 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* lib/webrick/server.rb (WEBrick::HTTPServer#start): remove
-	  :DoNotReverseLookup option. (Socket#do_not_reverse_lookup is a
-	  ruby 1.9 feature)
+	* lib/rubygems: Update to RubyGems HEAD(fe61e4c112).
+	  this version contains new feature that warn invalid SPDX license
+	  identifiers. https://github.com/rubygems/rubygems/pull/1249
+	  and #1032, #1023, #1332, #1328, #1306, #1321, #1324
+	* test/rubygems: ditto.
 
-Sat Nov  6 11:31:04 2004  Tadayoshi Funaba  <tadf@dotrb.org>
+Tue Sep  8 23:17:36 2015  Yuki Nishijima  <mail@yukinishijima.net>
 
-	* lib/date.rb (_parse): checks whether zone was given.
+	* gems/bundled_gems: Upgrade the did_you_mean gem to 1.0.0.beta2.
 
-Sat Nov  6 00:46:27 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Tue Sep  8 23:09:28 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* string.c (rb_str_locktmp): check STR_TMPLOCK flag before
-	  locking.  [ruby-dev:24727]
+	* io.c (rb_io_s_popen): do not wait the child process during being
+	  killed.  [ruby-core:70671] [Bug #11510]
 
-Fri Nov  5 18:12:42 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Tue Sep  8 22:18:04 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/tk/lib/tk/scrollable.rb: divide Scrollable module into
-	  X_Scrollable and Y_Scrollable
+	* gems/bundled_gems: revert because ruby trunk never be able to install
+	  the did_you_mean gem.  retry after enough test.
 
-	* ext/tk/lib/tk/entry.rb: include X_Scrollable instead of Scrollable
+Tue Sep  8 21:48:22 2015  Yuki Nishijima  <mail@yukinishijima.net>
 
-	* ext/tk/lib/tk/autoload.rb: define autoload for X_Scrollable and
-	  Y_Scrollable
+	* gems/bundled_gems: Automatically install the did_you_mean gem
+	  as a bundled gem.  [Feature #11252]
 
-Fri Nov  5 16:05:32 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Tue Sep  8 17:17:48 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/tk/lib/tk.rb: TkComm._at() supprts both of "@x,y" and "@x"
+	* vm_core.h: remove rb_call_info_t::blockiseq.
 
-Fri Nov  5 13:22:58 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* insns.def (send, invokesuper): pass blockiseq explicitly.
 
-	* ext/tk/lib/tk/text.rb: sorry. bug fix again.
+	* compile.c: catch up this fix.
 
-Fri Nov  5 13:17:54 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* iseq.c: ditto.
 
-	* ext/tk/lib/tk/text.rb: bug fix
+	* vm_args.c: ditto.
 
-Fri Nov  5 08:52:48 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* iseq.c (ISEQ_MINOR_VERSION): 2->3 because instruction spec was
+	  changed.
 
-	* gc.c (gc_mark): stricter GC stack check.
+Tue Sep  8 15:01:19 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-Fri Nov  5 08:52:48 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/net/ftp.rb (list): fetch all the lines before yielding a block
+	  to allow other commands in the block.  [Feature #11454]
+	  Patched by Srikanth Shreenivas.
 
-	* gc.c (gc_mark): stricter GC stack check.
+Tue Sep  8 12:05:00 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Fri Nov  5 08:34:43 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* win32/win32.c (rb_w32_read_reparse_point): return correct required
+	  buffer size for IO_REPARSE_TAG_MOUNT_POINT.
 
-	* string.c (str_gsub): should have removed rb_str_unlocktmp(str).
-	  [ruby-dev:24708]
+Tue Sep  8 00:14:43 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Nov  4 21:25:38 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* process.c (rb_execarg_parent_start1): raise with the target path
+	  name when open() failed.
 
-	* string.c (str_gsub): string modify check no longer based on
-	  tmplock.  [ruby-dev:24706]
+Mon Sep  7 23:45:28 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Nov  4 19:27:46 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* process.c (rb_exec_fail): raise with the target directory name
+	  when chdir() failed.  pointed out by sorah.
 
-	* io.c (rb_f_open): fix typo.
+Mon Sep  7 22:05:28 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Nov  4 15:02:14 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* win32/win32.c (insert): should use plain strdup() instead of
+	  ruby_strdup() at startup time, and plain free()ed in cmdglob().
 
-	* ext/tk/lib/tk/variable.rb: forget to initialize instance_variables
-	  of TkVarAccess objects
+Mon Sep  7 16:49:30 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Nov  4 09:11:35 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* vm_core.h (rb_vm_struct): define objspace always regardless
+	  ENABLE_VM_OBJSPACE.
 
-	* gc.c (gc_mark): enable GC stack checking.
+Mon Sep  7 15:54:58 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Nov  4 03:11:33 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ruby_atomic.h (ATOMIC_VALUE_CAS): fix typo.
+	  TODO: make arguments of all CAS macros consistent.
 
-	* string.c (str_gsub): lock strings temporarily.  [ruby-dev:24687]
+Sun Sep  6 16:07:22 2015  Eric Wong  <e@80x24.org>
 
-	* ext/socket/socket.c (s_recvfrom): tmplock input buffer.
-	  [ruby-dev:24705]
+	* ccan/list/list.h: suppress unused argument warnings
+	  [ccan commit 6aaca17e07588997417a73fac19dcf0ff17ed81b]
 
-Wed Nov  3 22:32:12 2004  NARUSE, Yui  <naruse@ruby-lang.org>
+Sat Sep  5 11:39:52 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* process.c: On NetBSD don't use setruid() and setrgid().
+	* lib/rss/rss.rb (Time#w3cdtf): fix zero-trimmed width of fraction
+	  digits.  [ruby-core:70667] [Bug #11509]
 
-Wed Nov  3 22:24:17 2004  Daigo Moriwaki  <techml@sgtpepper.net>
+Sat Sep  5 08:28:58 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/webrick/httpauth/digestauth.rb: use Base64.encode64 to
-	  avoid warnings.
+	* hash.c (rb_hash_equal, rb_hash_eql): [DOC] the orders of each
+	  hashes are not compared.  [Bug #11508]
 
-Wed Nov  3 17:19:59 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Sep  4 23:26:22 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* array.c (rb_ary_uniq_bang): do not push frozen string from hash
-	  table.  [ruby-dev:24695]
+	* include/ruby/win32.h: fix macro name for VC runtime version,
+	  RT_VER is only in Makefile.
 
-	* array.c (rb_ary_and): ditto.
+Fri Sep  4 17:46:17 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* array.c (rb_ary_or): ditto.
+	* doc/contributing.rdoc: fix configuration option.
+	  [ci skip] [fix GH-1009]
 
-Wed Nov  3 17:13:02 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Fri Sep  4 04:46:54 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* io.c (pipe_open): fix compile error
+	* iseq.c (iseq_memsize): functions for wrapper object should have
+	  iseqw_ prefix.
 
-Wed Nov  3 16:58:07 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Thu Sep  3 21:12:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/lib/tk.rb: support to use different Tcl commands between
-	  configure and configinfo
+	* lib/cgi/session.rb (create_new_id): use SHA512 instead of MD5.
+	  pointed out by SARWAR JAHAN.
 
-	* ext/tk/lib/font.rb: ditto.
+Thu Sep  3 20:29:18 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/tk/lib/itemconfig.rb: support to use different Tcl commands
-	  between item_configure and item_configinfo
+	* gc.c (rb_raw_obj_info): iseq->body->location.first_lineno is Fixnum.
 
-	* ext/tk/lib/itemfont.rb: ditto.
+Thu Sep  3 17:54:26 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/extconf.rb: install SUPPORT_STATUS
+	* vm_eval.c (raise_method_missing): "names" should be singular.
+	  pointed out by Filip Bartuzi.
 
-	* ext/tk/lib/tkextlib: some bug fixes (see ext/tk/ChangeLog.tkextlib)
+Thu Sep  3 17:50:09 2015  Koichi Sasada  <ko1@atdot.net>
 
-Wed Nov  3 16:30:41 2004  NARUSE, Yui  <naruse@ruby-lang.org>
+	* gc.c (rb_raw_obj_info): should support IMEMO/iseq.
 
-	* ext/nkf: follow nkf 2.0.4
+Thu Sep  3 10:07:49 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Nov  3 15:53:34 2004  Kouhei Sutou  <kou@cozmixng.org>
+	* vm_eval.c (raise_method_missing): refine error messages when a
+	  symbol is not given.  [Fix GH-1013]
 
-	* test/rss/test_maker_*.rb: added tests for RSS Maker.
+Wed Sep  2 18:49:55 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* lib/rss/maker.rb: added RSS Maker.
+	* ext/psych/*: merge psych master(8737e5b). It contains following fixes.
+	  https://github.com/tenderlove/psych/pull/242
+	  https://github.com/tenderlove/psych/pull/246 [ruby-list:50219]
+	* test/psych/*: ditto.
 
-	* lib/rss/maker/*.rb: ditto.
+Wed Sep  2 18:04:13 2015  Koichi Sasada  <ko1@atdot.net>
 
-Tue Nov  2 16:35:57 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* vm_insnhelper.h (GET_PC_COUNT): remove unused macro.
 
-	* ext/enumerator/enumerator.c (each_cons_i): pass copy of an
-	  internal consequent array.  [ruby-talk:118691]
+Wed Sep  2 17:18:37 2015  Chris Schneider  <chris@christopher-schneider.com>
 
-Tue Nov  2 16:05:21 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* process.c (proc_detach): [DOC] fix typo "intent" as "intend" in
+	  rdoc.  [Fix GH-1011]
 
-	* process.c (rb_f_fork): need to flush stdout and stderr before
-	  fork(2).  [ruby-talk:117715]
+Wed Sep  2 16:58:21 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Nov  2 01:20:09 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* file.c (rb_realpath_internal): use filesystem encoding if the
+	  argument is in ASCII encodings.
 
-	* eval.c (proc_invoke): nail down dyna_var node when Proc object
-	  or continuation is created.  [ruby-dev:24671]
+	* win32/file.c (rb_readlink): needs the result encoding.
 
-Mon Nov  1 13:59:28 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+Tue Sep  1 18:37:15 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/extmk.rb (MANIFEST): do not use anymore, use extconf.rb instead.
+	* test/thread/test_queue.rb: catch up last commit.
 
-	* ext/enumerator/extconf.rb, ext/fcntl/extconf.rb,
-	  ext/stringio/extconf.rb: added.
+Tue Sep  1 18:16:32 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* MANIFEST, ext/**/MANIFEST: removed.
+	* thread_sync.c (queue_do_close): ignore multiple close to allow
+	  multiple producers.
+	  https://bugs.ruby-lang.org/issues/10600#note-14
 
-	* README.EXT, README.EXT.ja: remove MANIFEST stuff.
+Tue Sep  1 18:06:26 2015  Koichi Sasada  <ko1@atdot.net>
 
-Mon Nov  1 01:14:52 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* thread_tools.c: rename thread_tools.c to thread_sync.c.
 
-	* io.c (rb_f_open): create copy of popen specifier.  [ruby-dev:24656]
+Mon Aug 31 17:04:45 2015  Koichi Sasada  <ko1@atdot.net>
 
-Mon Nov  1 00:36:48 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* class.c (move_refined_method): should insert a write barrier
+	  from an original class to a created (cloned) method entry.
 
-	* main.c (_stklen): move to gc.c.
+	* test/ruby/test_refinement.rb: add a test.
 
-Sun Oct 31 00:22:28 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sun Aug 30 02:42:22 2015  Aaron Patterson <tenderlove@ruby-lang.org>
 
-	* string.c (rb_str_locktmp): lock string temporarily.
+	* ext/openssl/ossl_ssl.c (ossl_ssl_method_tab): Only add SSLv3 support
+	  if the SSL library supports it.  Thanks Kurt Roeckx <kurt@roeckx.be>
+	  [Bug #11376]
 
-	* string.c (str_independent): add tmplock check.
+	* ext/openssl/extconf.rb: check for SSLv3 support in the SSL
+	  implementation.
 
-	* io.c (io_write): lock output string temporarily.
-	  [ruby-dev:24649]
+	* test/openssl/test_ssl.rb (class OpenSSL): Skip tests that need SSLv3
+	  if there is no support.
 
-	* io.c (io_write): use rb_str_locktmp().
+Fri Aug 28 16:05:09 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* io.c (read_all): ditto.
+	* lib/rdoc/*: Update rdoc master(cfffed5)
+	  https://github.com/rdoc/rdoc/pull/337
+	  https://github.com/rdoc/rdoc/pull/367
 
-Sat Oct 30 06:53:24 2004  Peter Vanbroekhoven  <peter.vanbroekhoven@cs.kuleuven.ac.be>
+Fri Aug 28 10:16:20 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* eval.c (rb_eval): NODE_XSTR should pass copy of literal string.
+	* vm.c (hook_before_rewind): prevent kicking :return event while
+	  finishing vm_exec func because invoke_block_from_c() kick a :return
+	  event for bmethods.
+	  [Bug #11492]
 
-Sat Oct 30 00:19:40 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/ruby/test_settracefunc.rb: add a test.
 
-	* enum.c (enum_sort_by): protect continuation jump in.
-	  [ruby-dev:24642]
+Thu Aug 27 18:05:42 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Fri Oct 29 21:27:51 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/webrick/server.rb: use IO::NULL instead of '/dev/null'
+	* test/ruby/test_string.rb: ditto.
 
-	* io.c (rb_io_check_initialized): new function to check uninitialized
-	  object.  [ruby-talk:118234]
+Thu Aug 27 15:24:57 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* file.c (rb_file_path), io.c (rb_io_closed): check if initialized.
+	* compile.c (iseq_set_sequence): rename variable names
+	  to make it readable.
 
-Fri Oct 29 10:00:30 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Thu Aug 27 07:45:34 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* eval.c (rb_thread_start_0): forget to free some memory chunks.
-	  [ruby-core:03611]
+	* thread_tools.c: add Queue#close(exception=false) and
+	  SizedQueue#close(exception=false).
+	  [Feature #10600]
 
-	* eval.c (ruby_cleanup): ruby_finalize_1 may cause exception,
-	  should be wrapped by PUSH_TAG/POP_TAG().  [ruby-dev:24627]
+	  Trying to deq from a closed empty queue return nil
+	  if exception parameter equals to false (default).
 
-Thu Oct 28 08:42:02 2004  Tanaka Akira  <akr@m17n.org>
+	  If exception parameter is truthy, it raises
+	  ClosedQueueError (< StopIteration).
+	  ClosedQueueError inherits StopIteration so that you can write:
 
-	* io.c (argf_forward): use ANSI style.
-	  (argf_read): call argf_forward with argv argument.
-	  [ruby-dev:24624]
+	    loop{ e = q.deq; (using e) }
 
-Thu Oct 28 23:32:54 2004  akira yamada  <akira@ruby-lang.org>
+	  Trying to close a closed queue raises ClosedQueueError.
 
-	* ext/zlib/zlib.c (zstream_detach_input): resets klass of z->input if
-	  z->input isn't nil.
+	  Blocking threads to wait deq for Queue and SizedQueue will be
+	  restarted immediately by returning nil (exception=false) or
+	  raising a ClosedQueueError (exception=true).
 
-Thu Oct 28 23:19:31 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	  Blocking threads to wait enq for SizedQueue will be
+	  restarted by raising a ClosedQueueError immediately.
 
-	* ext/extmk.rb: prefer relative path.  [ruby-talk:93037]
+	  The above specification is not proposed specification, so that
+	  we need to continue discussion to conclude specification this
+	  method.
 
-Wed Oct 27 18:49:11 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* test/thread/test_queue.rb: add tests originally written by
+	  John Anderson and modify detailed behavior.
 
-	* gc.c: prototype; rb_io_fptr_finalize() doesn't return any value
-	  at this version.
+Wed Aug 26 10:52:02 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Oct 27 17:27:45 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* re.c (rb_memsearch_wchar, rb_memsearch_qchar): test matching
+	  till the end of string.  [ruby-core:70592] [Bug #11488]
 
-	* gc.c (gc_sweep): recover ruby_in_compile variable.
+	* test/ruby/test_m17n.rb (test_include?, test_index): add tests by
+	  Tom Stuart.
 
-Wed Oct 27 09:17:30 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Aug 26 09:26:00 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* string.c (str_gsub): use a string object for exception safeness.
-	  [ruby-dev:24601]
+	* id_table.c (list_table_extend, hash_table_extend): remove C99
+	  features.  [ruby-dev:49239] [Bug #11487]
 
-Tue Oct 26 23:52:32 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Aug 25 06:34:43 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* io.c (rb_io_getline): rs modification check should not interfere in the loop.
+	* win32/win32.c (w32_symlink): implement symlink().
 
-Tue Oct 26 23:30:39 2004  Dave Thomas  <dave@pragprog.com>
+Mon Aug 24 16:01:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/rdoc/code_objects.rb (RDoc::Context::add_class_or_module):
-	  Restore correct :nopdoc: behavior with nested classes and modules.
+	* encoding.c (rb_locale_encindex): find encoding index without
+	  making a string object every time.  [ruby-core:58160] [Bug #9080]
 
-Tue Oct 26 18:21:29 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sat Aug 22 15:43:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* string.c (RESIZE_CAPA): check string attribute before modifying
-	  capacity member of string structure.  [ruby-dev:24594]
+	* vm_eval.c (check_funcall_failed, check_funcall_missing): cache
+	  results of respond_to? and respond_to_missing?, and search a
+	  public method only for compatibility with rb_respond_to.
 
-Tue Oct 26 11:33:26 2004  David G. Andersen  <dga@lcs.mit.edu>
+Sat Aug 22 08:23:32 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/zlib/zlib.c (gzreader_gets): use memchr() to to gain
-	  performance.  [ruby-talk:117701]
+	* ext/thread/thread.c: move definitions of Queue, SizedQueue
+	  and ConditionalVariables to thread_tools.c. In other words,
+	  such classes are built-in.
+	  [Feature #8919]
 
-Tue Oct 26 10:56:55 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	  At first, I planned to embed only a Queue class.
+	  However, rubygems requires 'thread.rb' (rubygems are
+	  required at first, when launch MRI without --disable-gems).
+	  So most of people require 'thread.rb' as an embedded library.
 
-	* sprintf.c (rb_f_sprintf): raise ArgumentError for extra
-	  arguments, unless (digit)$ style used.
+	  Now, ext/thread/thread.c is empty, only for a dummy for
+	  compatibility.
 
-Tue Oct 26 11:33:26 2004  David G. Andersen  <dga@lcs.mit.edu>
+	* thread.c: move a definition of Mutex class to thread_tools.c.
 
-	* ext/zlib/zlib.c (gzreader_gets): use memchr() to to gain
-	  performance.  [ruby-talk:117701]
+	  And define Mutex class under Thread (so now Mutex is Thread::Mutex).
+	  Because other thread related classes are also defined under Thread.
+	  We remain ::Mutex as Thread::Mutex. Only an inspect result is changed.
 
-Tue Oct 26 10:56:55 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* common.mk: add dependency from thread.o to thread_tools.c.
 
-	* sprintf.c (rb_f_sprintf): raise ArgumentError for extra
-	  arguments, unless (digit)$ style used.
+Sat Aug 22 05:31:37 2015  Koichi Sasada  <ko1@atdot.net>
 
-Mon Oct 25 18:35:39 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* vm_opts.h, iseq.c, iseq.h: add compile option to force frozen
+	  string literals.
+	  [Feature #11473]
 
-	* win32/win32.c (isUNCRoot): should check NUL after '.'.
-	  [ruby-dev:24590]
+	  This addition is not specification change, but to try frozen
+	  string literal world discussed on [Feature #11473].
 
-	* win32/win32.c (isUNCRoot): fixed buffer overrun.
+	  You can try frozen string literal world using this magical line:
 
-Mon Oct 25 08:03:26 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	    RubyVM::InstructionSequence.compile_option =
+	      {frozen_string_literal: true}
 
-	* eval.c (get_backtrace): ignore illegal backtrace.  [ruby-dev:24587]
+	  Note that this is a global compilation option, so that you need to
+	  compile another script like that:
 
-Sun Oct 24 00:41:09 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	    p 'foo'.frozen? #=> false
+	    RubyVM::InstructionSequence.compile_option =
+	      {frozen_string_literal: true}
+	    p 'foo'.frozen? #=> false, because this line is already compiled.
+	    p eval("'foo'.frozen?") #=> true
 
-	* eval.c (rb_load, search_required, rb_require_safe, rb_require): use
-	  frozen shared string to avoid outside modification.  [ruby-dev:24580]
+	  Details:
+	    * String literals are deduped by rb_fstring().
+	    * Dynamic string literals ("...#{xyz}...") is now only frozen,
+	      not deduped. Maybe you have other ideas.
 
-Sat Oct 23 22:18:32 2004  Guy Decoux  <ts@moulon.inra.fr>
+	  Now, please do not use this option on your productions :)
+	  Of course, current specification can be changed.
 
-	* eval.c (frame_free): Guy Decoux solved the leak problem.
-	  Thanks.  [ruby-core:03549]
+	* compile.c: ditto.
 
-Sat Oct 23 00:20:55 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/ruby/test_iseq.rb: add a test.
 
-	* ext/zlib/zlib.c (zstream_append_input): clear klass for z->input
-	  to avoid potential vulnerability.
+Sat Aug 22 02:53:12 2015  Aaron Patterson <tenderlove@ruby-lang.org>
 
-	* ext/zlib/zlib.c (zstream_run): always use zstream_append_input()
-	  to avoid SEGV.  [ruby-dev:24568]
+	* ext/psych/*: update to Psych 2.0.14
 
-Fri Oct 22 12:02:28 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/psych/*: ditto
 
-	* eval.c (rb_alias): was warning for wrong condition.
-	  [ruby-dev:24565]
+Fri Aug 21 19:58:48 2015  Koichi Sasada  <ko1@atdot.net>
 
-Fri Oct 22 10:36:37 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* ext/objspace/objspace.c: add a new method ObjectSpace.count_symbols.
+	  [Feature #11158]
 
-	* lib/webrick/httprequest.rb (WEBrick::HTTPRequest#meta_vars):
-	  should check if path_info is not nil.
+	* symbol.c (rb_sym_immortal_count): added to count immortal symbols.
 
-Fri Oct 22 00:22:31 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* symbol.h: ditto.
 
-	* ext/zlib/zlib.c (zstream_shift_buffer): should restore class
-	  field of a buffer.  [ruby-dev:24562]
+	* test/objspace/test_objspace.rb: add a test for this method.
 
-Fri Oct 22 00:20:33 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* NEWS: describe about this method.
 
-	* string.c (rb_str_include): should not treat char as negative value.
-	  [ruby-dev:24558]
+Fri Aug 21 19:48:17 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Oct 21 21:32:30 2004  IWATSUKI Hiroyuki  <don@na.rim.or.jp>
+	* win32/Makefile.sub ($(LIBRUBY_SO)): needs additional libraries
+	  for extension libraries to link statically.
+	  [ruby-core:70499] [Feature #9018]
 
-	* lib/pstore.rb (PStore#transaction): Use the empty content when a
-	  file is not found.  [ruby-dev:24561]
+Fri Aug 21 18:49:22 2015  Koichi Sasada  <ko1@atdot.net>
 
-Thu Oct 21 19:06:15 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* include/ruby/ruby.h, cont.c, vm_trace.c: add a new event
+	  fiber_switch. We need more discussion about this feature
+	  so that I don't write it on NEWS.
+	  [Feature #11348]
 
-	* lib/webrick/httpresponse.rb (WEBrick::HTTPResponse#send_body_io):
-	  ensure to close @body. (http://bugs.debian.org/277520)
+	* test/ruby/test_settracefunc.rb: add tests.
 
-Thu Oct 21 00:36:41 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Aug 21 17:32:42 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* eval.c (rb_alias): should warn on method discarding.
-	  [ruby-dev:24546]
+	* vm_insnhelper.c (vm_invoke_block): we should not expect ci->argc is
+	  stable after invoking a block. [Bug #11451]
 
-	* ext/zlib/zlib.c (zstream_expand_buffer_into): hide internal
-	  string buffer by clearing klass.  [ruby-dev:24548]
+	* test/ruby/test_yield.rb: add a test. This test script is given by
+	  Alex Dowad.
 
-Wed Oct 20 19:45:13 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Aug 21 06:35:50 2015  Aaron Patterson <tenderlove@ruby-lang.org>
 
-	* string.c (str_gsub): 	reentrant check.  [ruby-dev:24432]
+	* test/openssl/test_ssl_session.rb: Fix tests so that they take in to
+	  account OpenSSL installations that have SSLv3 disabled by default.
+	  Thanks Jeremy Evans <code@jeremyevans.net> for the patches.
+	  [Bug #11366] [Bug #11367]
 
-	* backport all SEGV bug fixes from CVS HEAD.  [ruby-dev:24536]
+Thu Aug 20 22:19:17 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Oct 20 04:17:55 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* vm_method.c (basic_obj_respond_to): call respond_to_missing?
+	  only when redefined.  [ruby-core:70460] [Bug #11465]
 
-	* ext/dbm/dbm.c (fdbm_delete_if): should check if deleting element
-	  is a string.  [ruby-dev:24490]
+Thu Aug 20 14:13:27 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/sdbm/init.c (fsdbm_delete_if): ditto.
+	* vm_eval.c (check_funcall_respond_to): share the behavior with
+	  rb_obj_respond_to.  [ruby-core:70460] [Bug #11465]
 
-Wed Oct 20 01:37:18 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* vm_method.c (vm_respond_to): extract from rb_obj_respond_to and
+	  merge r39881.
 
-	* array.c (rb_ary_times): Array#* should return an instance of
-	  the class of right operand.  [ruby-dev:24526]
+Thu Aug 20 08:53:09 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/zlib/zlib.c (zstream_detach_buffer): should not expose
-	  class-less object to Ruby world. [ruby-dev:24530]
+	* vm_method.c (rb_obj_respond_to): reuse found method entry
+	  instead of searching same entry repeatedly.
 
-	* eval.c (proc_dup): provide Proc#dup as well.  [ruby-talk:116915]
+Thu Aug 20 08:31:17 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (ruby_exec): stack marking position may be higher than
-	  expected.  thanks to Guy Decoux.  [ruby-core:03527]
+	* dir.c (replace_real_basename), win32/win32.c (opendir_internal):
+	  check reparse point tags and treat supported tags only as
+	  symbolic links.  [ruby-core:70454] [Bug #11462]
 
-Tue Oct 19 22:43:12 2004  Dave Thomas  <dave@pragprog.com>
+Wed Aug 19 23:59:28 2015  Aaron Patterson <tenderlove@ruby-lang.org>
 
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_attr): If
-	  we come across 'attr' in a context where it isn't
-	  followed by a symbol, just issue a warning.
+	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): add OP_ALL to
+	  existing options rather than just setting it.  Some vendors apply
+	  custom patches to their versions of OpenSSL that set default values
+	  for options.  This commit respects the custom patches they've
+	  applied.
 
-Tue Oct 19 20:41:37 2004  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
+	* test/openssl/test_ssl.rb (class OpenSSL): check that OP_ALL has been
+	  added to the options.
 
-	* ext/win32ole.c(ole_invoke): retrieve the result value when
-	  retrying the IDispatch::invoke.
+Wed Aug 19 23:55:29 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Oct 19 17:24:11 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* process.c (rb_f_spawn): [DOC] elaborate environment variable
+	  values.  [ruby-core:70456] [Bug #11463]
 
-	* io.c (read_all): block string buffer modification during
-	  rb_io_fread() by freezing it temporarily. [ruby-dev:24479]
+Wed Aug 19 23:48:06 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* dir.c (rb_push_glob): block call at once the end of method.
-	  [ruby-dev:24487]
+	* win32/win32.c (winnt_lstat): check reparse point tags and treat
+	  supported tags only as symbolic links.
+	  [ruby-core:70454] [Bug #11462]
 
-	* ext/enumerator/enumerator.c (enum_each_slice): remove
-	  rb_gc_force_recycle() to prevent potential SEGV.
-	  [ruby-dev:24499]
+Tue Aug 18 20:05:49 2015  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/zlib/zlib.c (zstream_expand_buffer): hide internal string
-	  buffer by clearing klass.  [ruby-dev:24510]
+	* thread_pthread.c (reserve_stack): ensure the memory is really
+	  allocated. [Bug #11457]
 
-Tue Oct 19 16:12:18 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Tue Aug 18 17:19:21 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/tkutil.c: backport from CVS HEAD
+	* parse.y (IS_BEG): include labeled argument state, which was
+	  EXPR_LABELARG.  [ruby-dev:49221] [Bug #11456]
 
-Tue Oct 19 08:54:26 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Aug 18 16:16:21 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* intern.h, object.c (rb_class_inherited_p): export.
+	* include/ruby/ruby.h (RClass): define only in C, `__attribute__`
+	  between `struct` and the name can't compile with g++.
+	  [ruby-core:70297] [Bug #11426]
 
-Tue Oct 19 08:46:57 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon Aug 17 20:56:36 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* string.c (rb_str_upto): method result must be checked.  [ruby-dev:24504]
+	* parse.y: fix syntax error at do-block after a conditional
+	  operator.  separate label-allowed and after-a-label states from
+	  others as bit flags.  [ruby-dev:48790] [Bug #10653]
 
-	* eval.c (error_print): ditto.  [ruby-dev:24519]
+Mon Aug 17 11:57:36 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Oct 18 23:37:05 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* io.c (rb_io_each_codepoint): raise an exception at incomplete
+	  character before EOF when conversion takes place.  [Bug #11444]
 
-	* marshal.c (r_object0): check inheritance by the internal function.
-	  [ruby-dev:24515]
+Sun Aug 16 17:33:45 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Mon Oct 18 15:58:01 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* gems/bundled_gems: update latest version of bundled gems.
+	  It includes minitest-5.8.0 and test-unit 3.1.3.
 
-	* range.c (range_step, range_each): need cast.
+Sun Aug 16 17:24:10 2015  Kazuki Tsujimoto  <kazuki@callcc.net>
 
-Fri Oct 29 16:34:19 2004  Daiki Ueno  <ueno@unixuser.org>
+	* gc.c (gc_mark_children): check if RCLASS_EXT is valid
+	  before marking. This fixes the following test failure
+	  introduced in r51126:
 
-	* misc/ruby-mode.el (ruby-parse-partial): Parse the rest of the
-	  line after opening heredoc identifier.  [ruby-dev:24635]
+	    make test-all TESTOPTS='--gc-stress ruby/test_refinement.rb'
 
-Mon Oct 18 07:26:21 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Aug 15 10:51:08 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* file.c (rb_file_truncate): discard read buffer before truncation.
-	  [ruby-dev:24197]
+	* ext/win32/lib/win32/registry.rb (API#SetValue): data size should
+	  be in bytes, not in chars.  [ruby-core:70365] [Bug #11439]
 
-Mon Oct 18 02:11:21 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Sat Aug 15 10:15:20 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/webrick/config.rb (WEBrick::Config::General): add default values:
-	  - WEBrick::Config[:DoNotReverseLookup]
-	  - WEBrick::Config[:RequestCallback] (it used as an alias of
-	    :RequestHandler in WEBrick::HTTPServer#run)
-	  - WEBrick::Config::FileHandler[:AcceptableLanguages]
+	* io.c (rb_io_each_codepoint): read more data when read partially.
+	  [ruby-core:70379] [Bug #11444]
 
-	* lib/webrick/httpservlet/filehandler.rb
-	  (WEBrick::HTTPServlet::FileHandler#set_filename): search files
-	  having suffix of language-name which Accept-Language header field
-	  includes if :AcceptableLanguages options is present.
+Sat Aug 15 04:33:39 2015  Eric Wong  <e@80x24.org>
 
-	* lib/webrick/httpservlet/filehandler.rb
-	  (WEBrick::HTTPServlet::FileHandler#get_servlet): new method to
-	  search servlet correspond to the suffix of filename.
+	* hash.c (any_hash): skip rb_objid_hash for static syms
+	  (rb_num_hash_start): extract from rb_ident_hash
+	  (rb_objid_hash): call rb_num_hash_start
+	  (rb_ident_hash): ditto
+	  [ruby-core:70181] [Feature #11405]
 
-	* lib/webrick/httprequest.rb: add attributes access methods: accept,
-	  accept_charset, accept_encoding, accept_language, content_length
-	  and content_type.
+Sat Aug 15 04:16:13 2015  Eric Wong  <e@80x24.org>
 
-	* lib/webrick/httpresponse.rb: add attribute access methods:
-	  content_length, content_length=, content_type and content_type=.
+	* iseq.c (rb_iseq_mark): reduce NULL checks
 
-	* lib/webrick/httputils.rb (WEBrick::HTTPUtils.mime_types):
-	  use the second suffix to detect media type. (the first suffix
-	  may be a language name.)
+Fri Aug 14 18:50:57 2015  Eric Wong  <e@80x24.org>
 
-	* lib/webrick/httputils.rb (WEBrick::HTTPUtils.parse_qvalues):
-	  add method to parse Accept header field. it returns an Array of
-	  values sorted by the qvalues.
+	* method.h (METHOD_ENTRY_VISI_SET): cast visi to int
+	  (METHOD_ENTRY_FLAGS_SET): ditto
 
-Mon Oct 18 02:04:11 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Fri Aug 14 18:43:11 2015  Eric Wong  <e@80x24.org>
 
-	* lib/webrick/httpserver.rb (WEBrick::HTTPServer#virtual_host): new
-	  method to register virtual hosting servers.
+	* process.c (close_unless_reserved): add extra check
+	  (dup2_with_divert): remove
+	  (redirect_dup2): use dup2 without divert
+	  (before_exec_non_async_signal_safe): adjust call + comment
+	  (rb_f_exec): stop timer thread for all OSes
+	  (rb_exec_without_timer_thread): remove
+	* eval.c (ruby_cleanup): adjust call
+	* thread.c (rb_thread_stop_timer_thread): always close pipes
+	* thread_pthread.c (struct timer_thread_pipe): add writing field,
+	  mark owner_process volatile for signal handlers
+	  (rb_thread_wakeup_timer_thread_fd): check valid FD
+	  (rb_thread_wakeup_timer_thread): set writing flag to prevent close
+	  (rb_thread_wakeup_timer_thread_low): ditto
+	  (CLOSE_INVALIDATE): new macro
+	  (close_invalidate): new function
+	  (close_communication_pipe): removed
+	  (setup_communication_pipe_internal): make errors non-fatal
+	  (setup_communication_pipe): ditto
+	  (thread_timer): close reading ends inside timer thread
+	  (rb_thread_create_timer_thread): make errors non-fatal
+	  (native_stop_timer_thread): close write ends only, always,
+	   wait for signal handlers to finish
+	  (rb_divert_reserved_fd): remove
+	* thread_win32.c (native_stop_timer_thread): adjust (untested)
+	  (rb_divert_reserved_fd): remove
+	* vm_core.h: adjust prototype
+	  [ruby-core:70386] [Bug #11336]
 
-	* lib/webrick/server.rb (WEBrick::GenericServer#accept): call
-	  do_not_reverse_lookup for each socket if :DoNotReverseLookup
-	  is set.  [ruby-core:02357]
+Fri Aug 14 18:40:43 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Oct 18 00:42:45 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/win32/lib/win32/registry.rb (API#SetValue): add terminator
+	  size, not 1 byte.  [ruby-core:70365] [Bug #11439]
 
-	* ext/socket/socket.c (sock_s_getservbyaname): protocol string
-	  might be altered.  [ruby-dev:24503]
+Thu Aug 13 22:49:42 2015  Juanito Fatas  <katehuang0320@gmail.com>
 
-	* string.c (rb_str_upto): check if return value from succ is a
-	  string.  [ruby-dev:24504]
+	* lib/timeout.rb (Timeout#timeout): freeze a string message to
+	  reduce string allocations.  [Fix GH-996]
 
-Sun Oct 17 23:03:48 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Thu Aug 13 17:42:34 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/tk/lib/tk/timer.rb: TkTimer#start and restart accept a block
+	* vm_core.h (rb_call_info_kw_arg_bytes): move the definition
+	  to iseq.h because this function is shared with iseq.c and compile.c.
 
-Sun Oct 17 13:05:04 2004  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
+Thu Aug 13 14:36:31 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/win32ole/win32ole.c (fole_func_methods): correct argument mismatch.
-	* ext/win32ole/win32ole.c (fole_get_methods): ditto.
-	* ext/win32ole/win32ole.c (fole_put_methods): ditto.
-	* ext/win32ole/tests/testWIN32OLE.rb: add test for WIN32OLE#ole_func_methods
-	  WIN32OLE#ole_get_methods, WIN32OLE#ole_put_methods
+	* object.c (rb_num_to_dbl): move from num2dbl_with_to_f in math.c.
 
-Sat Oct 16 14:45:28 2004  Kouhei Sutou  <kou@cozmixng.org>
+Thu Aug 13 09:01:25 2015  Eric Wong  <e@80x24.org>
 
-	* lib/rss/0.9.rb (RSS::Rss#to_s): removed garbage.
+	* load.c (features_index_add): avoid repeat calculation
 
-Sat Oct 16 13:42:49 2004  Kouhei Sutou  <kou@cozmixng.org>
+Wed Aug 12 21:57:31 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/rss/: untabified.
-	* test/rss/: untabified.
-	* lib/rss/0.9.rb (RSS::Rss#to_s): inent -> indent.
+	* id_table.c: IMPL() macro accept op as _opname instead of opname
+	  because jemalloc seems to replace the word `free' to `je_free'.
 
-Sat Oct 16 13:34:56 2004  Kouhei Sutou  <kou@cozmixng.org>
+Wed Aug 12 21:51:11 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/rss: supported prety print.
-	* test/rss/test_1.0.rb: added test for calculating default indent size.
+	* id_table.c (mix_id_table_insert): fix memory leak.
 
-Fri Oct 15 18:04:35 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Wed Aug 12 21:17:38 2015  Eric Wong  <e@80x24.org>
 
-	* ext/tk/lib/tk/timer.rb: TkTimer.new(interval, loop){ ... } is
-	  acceptable. Add TkTimer.start ( == new + start ).
+	* iseq.c (iseq_memsize): reimplement for wrapper
+	  (param_keyword_size): extracted from iseq_memsize
+	  (iseqw_mark): new mark function
+	  (iseqw_data_type): new data type
+	  (iseqw_new): wrap as iseqw_data_type
+	  (iseqw_check): adjust for wrapper
+	  (Init_ISeq): remove iseqw_iseq_key initialization
+	* test/objspace/test_objspace.rb: new test
+	  [ruby-core:70344] [Feature #11435]
 
-Fri Oct 15 12:43:09 2004  Tanaka Akira  <akr@m17n.org>
+Wed Aug 12 21:15:27 2015  Eric Wong  <e@80x24.org>
 
-	* eval.c (Init_stack): make prototype declaration consistent with
-	  the definition in gc.c.
+	* vm_core.h (rb_call_info_kw_arg_bytes): extract from compile.c
+	* compile.c (iseq_build_callinfo_from_hash): use above function
 
-Thu Oct 14 14:34:01 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+Wed Aug 12 18:00:17 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* io.c (MODE_BINMODE, MODE_BINARY): fixed reversed condition.
+	* class.c (move_refined_method): same as the last commit.
 
-Thu Oct 14 13:33:59 2004  Kouhei Sutou  <kou@cozmixng.org>
+Wed Aug 12 17:57:53 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/rss/rss.rb: added link to Tutorial.
+	* class.c, gc.c vm.c: use ID_TABLE_* instead of ST_*
+	  (such as ST_CONTINUE) for enum rb_id_table_iterator_result.
 
-Mon Oct 11 13:48:20 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Wed Aug 12 17:05:36 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/tk/lib/tk/*: untabify
+	* id_table.h: introduce ID key table.
+	  [Feature #11420]
 
-Sun Oct 10 12:32:08 2004  Dave Thomas  <dave@pragprog.com>
+	  This table only manage ID->VALUE table to reduce overhead of st.
 
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::parse_require): Allow 'require'
-	  to be used as a variable name
+	  Some functions prefixed rb_id_table_* are provided.
 
-Sat Oct  9 21:23:37 2004  Kouhei Sutou  <kou@cozmixng.org>
+	* id_table.c: implement rb_id_table_*.
 
-	* lib/rss/converter.rb: changed to try to use Iconv for default
-	  conversion.
+	  There are several algorithms to implement it.
 
-	* lib/rss/rss.rb: 0.0.9 -> 0.1.0.
+	  Now, there are roughly 4 types:
 
-Sat Oct  9 19:50:36 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	    * st
+	    * array
+	    * hash (implemented by  Yura Sokolov)
+	    * mix of array and hash
 
-	* io.c (rb_io_getline): should not treat char as negative value.
-	  [ruby-dev:24460]
+	  The macro ID_TABLE_IMPL can choose implementation.
+	  You can see detailes about them at the head of id_table.c.
 
-Fri Oct  8 09:49:32 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	  At the default, I choose 34 (mix of list and hash).
+	  This is not final decision.
+	  Please report your suitable parameters or
+	  your data structure.
 
-	* pack.c (pack_pack): pointer modification check before each
-	  iteration.  [ruby-dev:24445]
+	  * symbol.c: introduce rb_id_serial_t and rb_id_to_serial()
+	    to represent ID by serial number.
 
-Fri Oct  8 01:13:05 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	  * internal.h: use id_table for method tables.
 
-	* ext/tk/lib/tk/optiondb.rb: make it more secure
+	  * class.c, gc.c, marshal.c, vm.c, vm_method.c: ditto.
 
-Thu Oct  7 23:47:57 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Wed Aug 12 05:19:11 2015  Eric Wong  <e@80x24.org>
 
-	* ext/tk/lib/tk/scrollbar.rb: When 'set' operation, a scrollbar
-	  cannot propagate view port information from the source widget
-	  (that calls 'set') to other assigned widgets.
+	* parse.y (rb_parser_compile_cstr): remove volatile arg
+	  (rb_parser_compile_string): ditto
+	  (rb_parser_compile_file): ditto
+	  (rb_parser_compile_string_path): ditto
+	  (rb_parser_compile_file_path): ditto
+	  [ruby-core:70323] [Misc #11431]
 
-Thu Oct  7 17:36:25 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Tue Aug 11 22:59:57 2015  Tanaka Akira  <akr@fsij.org>
 
-	* ext/tk/lib/tk.rb: When CHILDKILLED and so on, Tk.errorCode returns
-	  a Fixnum for 2nd element (it's pid) of the return value.
+	* numeric.c (Init_Numeric): Fix document for Float::MIN and
+	  Float::EPSILON.
 
-Thu Oct  7 12:55:04 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Tue Aug 11 15:22:31 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* io.c (io_read): should freeze buffer before thread context
-	  switch. [ruby-dev:24442]
+	* include/ruby/ruby.h (ALLOCV_N): check integer overflow, as well
+	  as ruby_xmalloc2.  pointed out by Paul <pawlkt AT gmail.com>.
 
-	* pack.c (pack_unpack): string conversion should at the top of the
-	  method.  [ruby-dev:24439]
+Tue Aug 11 14:57:09 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* io.c (io_read): buffer should be frozen only after the length
-	  check.  [ruby-dev:24440]
+	* array.c (rb_ary_repeated_permutation): fix buffer size, ALLOCV_N
+	  already multiplies element size.
 
-Thu Oct  7 02:56:43 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Aug 11 12:13:20 2015  Jeremy Evans  <merch-redmine@jeremyevans.net>
 
-	* ext/stringio/stringio.c: use FMODE_APPEND.
+	* test/openssl/test_ssl.rb: Fix LocalJumpErrors being raised
+	  in OpenSSL tests. [ruby-core:70020][Bug #11368]
 
-Thu Oct  7 01:05:33 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Tue Aug 11 11:54:13 2015  Alexey Lipnyagov  <liptonshmidt@gmail.com>
 
-	* ext/tk/lib/tk.rb: add Tk.errorInfo and Tk.errorCode
+	* string.c: Fix documentation for String#slice
+	  [ruby-core:70298][Bug #11427]
 
-Thu Oct  7 00:08:37 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Tue Aug 11 11:53:28 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* io.c (rb_io_s_sysopen): preserve path in the buffer allocated by
-	  ALLOCA_N() to prevent modification.  [ruby-dev:24438]
+	* parse.y (superclass): make superclass rule optional and allow
+	  any contents without a terminator.  [EXPERIMENTAL]
 
-Wed Oct  6 09:21:00 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Tue Aug 11 10:58:42 2015  Juanito Fatas  <juanitofatas@gmail.com>
 
-	* io.c (rb_io_mode_flags): preserve append mode flag.
-	  [ruby-dev:24436]
+	* string.c: [DOC] Make #end_with? example doc symmetry
+	  with #start_with? [fix GH-992][ci skip]
 
-	* io.c (rb_io_modenum_mode): do not use external output buffer.
+Tue Aug 11 10:51:19 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* string.c (rb_str_justify): differ pointer retrieval to prevent
-	  padding string modification.  [ruby-dev:24434]
+	* test/ruby/test_array.rb: Add test for `Array#flatten` with level 1
+	  [fix GH-986] Patch @yui-knk
 
-	* range.c (range_each_func): allow func to terminate loop by
-	  returning RANGE_EACH_BREAK.
+Tue Aug 11 10:48:16 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* range.c (member_i): use RANGE_EACH_BREAK. [ruby-talk:114959]
+	* enum.c: added doc for Enumerable#zip
+	  [fix GH-985] Patch by @yui-knk
+	* test/ruby/test_enum.rb: added tests for Enumerable#zip
+	  [fix GH-985] Patch @yui-knk
 
-Mon Oct  4 14:04:14 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Aug 11 10:33:26 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* io.c (rb_file_open_internal, rb_io_reopen): fname might be altered
-	  while GC.  [ruby-dev:24408]
+	* vm_method.c: typo fix [fix GH-993][ci skip] Patch by @0x0dea
+	* test/ruby/test_refinement.rb: ditto.
 
-Mon Oct  4 12:53:45 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Sun Aug  9 14:15:54 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/lib/tk/optiondb.rb: support definition of command
-	  resources on widgets
+	* vm.c (Init_vm_objects, rb_vm_fstring_table): use frozen_strings
+	  table in rb_vm_t.  [ruby-core:70274] [Bug #11423]
 
-	* ext/tk/lib/tk/image.rb: bug fix
+Sat Aug  8 03:59:51 2015  Zachary Scott  <zzak@ruby-lang.org>
 
-Sun Oct  3 21:20:03 2004  Shugo Maeda  <shugo@ruby-lang.org>
+	* object.c: [DOC] Improve grammar for Module#===
+	  Patch by @SkyBirdSoar in documenting-ruby/ruby#52:
+	  https://github.com/documenting-ruby/ruby/pull/52
 
-	* lib/net/imap.rb (TEXT_REGEXP): allow 8-bit characters for the german
-	  version of Microsoft Exchange Server. (backported from HEAD)
+Sat Aug  8 03:39:33 2015  Zachary Scott  <zzak@ruby-lang.org>
 
-	* lib/net/imap.rb (RTEXT_REGEXP): ditto.
+	* hash.c: [DOC] Improve description of symbol key syntax
+	  Patch by Raphael Das Gupta in documenting-ruby/ruby#51:
+	  https://github.com/documenting-ruby/ruby/pull/51
 
-	* lib/net/imap.rb (CTEXT_REGEXP): ditto.
+Fri Aug  7 21:04:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Oct  2 20:34:22 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* parse.y (parser_params): turn in_def and in_single into bit
+	  flags and reduce the size by 2-words.
 
-	* node.h (NEW_DVAR): extra semicolon.
+	* parse.y (parser_params): remove redundant prefixes.
 
-Sat Oct  2 00:42:20 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* parse.y (yylex): non-pure parser has not been supported since
+	  merger of ripper.  change argument types from void pointers.
 
-	* marshal.c (r_byte): retrieve pointer from string value for each
-	  time.  [ruby-dev:24404]
+Fri Aug  7 17:07:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* marshal.c (r_bytes0): ditto.
+	* proc.c (method_super_method): uncallable method entry does not
+	  have the defined class, use the owner instead.
+	  [ruby-core:70254] [Bug #11419]
 
-	* enum.c (sort_by_i): re-entrance check added.  [ruby-dev:24399]
+	* test/ruby/test_method.rb (test_super_method_unbound): add test
+	  by Akira Matsuda.
 
-	* io.c (io_read): should freeze all reading buffer.
-	  [ruby-dev:24400]
+Thu Aug  6 10:49:57 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* string.c (rb_str_sum): should use bignums when bits is greater
-	  than or equals to sizeof(long)*CHAR_BITS. [ruby-dev:24395]
+	* node.c (rb_alloc_tmp_buffer): round up the size and check the
+	  range.
 
-	* eval.c (specific_eval): defer pointer retrieval to prevent
-	  unsafe sourcefile string modification.  [ruby-dev:24382]
+	* ruby_atomic.h (ATOMIC_VALUE_EXCHANGE, ATOMIC_VALUE_CAS): add
+	  atomic operations for VALUE.
 
-	* eval.c (specific_eval): defer pointer retrieval to prevent
-	  unsafe sourcefile string modification.  [ruby-dev:24382]
+Thu Aug  6 08:15:49 2015  Aaron Patterson <tenderlove@ruby-lang.org>
 
-	* string.c (rb_str_sum): wrong cast caused wrong result.
-	  [ruby-dev:24385]
+	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): move
+	  SSLSocket#sysclose to Ruby.
 
-	* enum.c (enum_sort_by): hide temporary array from
-	  ObjectSpace.each_object.  [ruby-dev:24386]
+	* ext/openssl/ossl_ssl.c (ossl_ssl_close): ditto
 
-	* string.c (rb_str_sum): check was done with false pointer.
-	  [ruby-dev:24383]
+Thu Aug  6 07:57:21 2015  Aaron Patterson <tenderlove@ruby-lang.org>
 
-	* string.c (rb_str_sum): string may be altered.  [ruby-dev:24381]
+	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): move nonblock
+	  enable to SSLSocket#initialize and remove Nonblock module.
 
-Mon Oct 11 17:51:34 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Thu Aug  6 07:53:47 2015  Aaron Patterson <tenderlove@ruby-lang.org>
 
-	* io.c (rb_io_popen): get mode string via rb_io_flags_mode() to
-	  avoid mode string modification.  [ruby-dev:24454]
+	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): move
+	  OpenSSL::SSL::SSLSocket#initialize to Ruby.
 
-	* io.c (rb_io_getline_fast): should take delim as unsigned char to
-	  distinguish EOF and '\377'.  [ruby-dev:24460]
+	* ext/openssl/ossl_ssl.c: ditto
 
-	* io.c (rb_io_getline): add check for RS modification.
-	  [ruby-dev:24461]
+Thu Aug  6 02:25:31 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* enum.c (enum_sort_by): use qsort() directly instead using
-	  rb_iterate().  [ruby-dev:24462]
+	* node.c (rb_alloc_tmp_buffer): use NODE_ALLOCA to mark locations
+	  like as builtin alloca.  [ruby-core:70251] [Bug #11418]
 
-	* enum.c (enum_each_with_index): remove rb_gc_force_recycle() to
-	  prevent access to recycled object (via continuation for
-	  example).  [ruby-dev:24463]
+Wed Aug  5 14:37:55 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Oct  1 11:40:14 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* transcode.c (rb_econv_open0): rb_econv_t::source_encoding_name
+	  and rb_econv_t::destination_encoding_name should refer static
+	  strings always or NULL.  [ruby-core:70247] [Bug #11416]
 
-	* eval.c (rb_f_eval): defer pointer retrieval to prevent unsafe
-	  sourcefile string modification.  [ruby-dev:24373]
+Tue Aug  4 16:53:43 2015  Aaron Patterson <tenderlove@ruby-lang.org>
 
-	* io.c (io_read): block string buffer modification during
-	  rb_io_fread() by freezing it temporarily. [ruby-dev:24366]
+	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): extract callback
+	  lookup to private Ruby methods. This means we can keep the default
+	  DH callback logic hidden from consumers.  Also, since the SSLSocket
+	  always has a context, we can remove conditionals about that
+	  instance.
 
-	* io.c (rb_io_s_popen): mode argument may be altered.
-	  [ruby-dev:24375]
+	* ext/openssl/ossl_ssl.c: move callback lookup methods to private Ruby
+	  methods.
 
-	* file.c (rb_file_s_basename): ext argument may be altered.
-	  [ruby-dev:24377]
+Tue Aug  4 16:40:26 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* enum.c (enum_sort_by): use NODE instead of 2 element arrays.
-	  [ruby-dev:24378]
+	* test/ruby/test_module.rb: should not expect a method table ordering.
+	  [Feature #11414]
 
-	* string.c (rb_str_chomp_bang): StringValue() may change the
-	  receiver.  [ruby-dev:24371]
+Tue Aug 04 15:30:04 2015  Koichi Sasada  <ko1@atdot.net>
 
-Fri Oct  1 11:25:20 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* proc.c (rb_block_clear_env_self): clear by Qfalse instead of Qnil.
+	  [Bug #11409]
 
-	* ext/tk/lib/tk/grid.rb: revive TkGrid.grid
+	* test/ruby/test_eval.rb: add tests for this issue,
+	  written by @0x0dea.
+	  https://github.com/ruby/ruby/pull/988
 
-	* ext/tk/lib/tk/pack.rb: revive TkPack.pack
+Tue Aug  4 12:12:14 2015  Eric Wong  <e@80x24.org>
 
-	* ext/tk/lib/tk/place.rb: revive TkPlace.place
+	* variable.c: wrap long lines
 
-Thu Sep 30 00:50:44 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Tue Aug  4 09:32:30 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* ext/tcltklib/tcltklib.c (ip_init): bug fix
+	* proc.c: Removing duplicate doc [fix GH-987][ci skip]
+	  Patch by @ronakjangir47
 
-	* ext/tk/tkutil.c (get_eval_string_core): accept a Regexp object
+Tue Aug  4 09:21:58 2015  Richard Schneeman  <richard.schneeman+foo@gmail.com>
 
-	* ext/tk/lib/multi-tk.rb: fix bug on 'exit' operation
+	* doc/contributing.rdoc: fixed wrong instructions with OS X
+	  [fix GH-989][ci skip] Patch by @schneems
 
-	* ext/tk/lib/tk/text.rb: 'tksearch' accepts a Regexp object as a
-	  matting pattern argument
+Mon Aug  3 10:08:33 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Sep 29 10:58:07 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* re.c (rb_memsearch): should match only char boundaries in wide
+	  character encodings.  [ruby-core:70220] [Bug #11413]
 
-	* enum.c (sort_by_i): internally used object must not be changed
-	  outside.  [ruby-dev:24368]
+Sun Aug  2 07:01:17 2015  Eric Wong  <e@80x24.org>
 
-Mon Sep 27 13:46:45 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/openssl/lib/openssl/buffering.rb (gets):
+	  avoid comparing fixnum with nil
+	* test/openssl/test_pair.rb: test gets with limit when EOF is hit
+	  Thanks to Bar Hofesh <bar.hofesh@safe-t.com> for the bug report
+	  and testing.
+	  [ruby-core:70149] [Bug #11400]
 
-	* intern.h, struct.c (rb_struct_s_members, rb_struct_members): public
-	  accessors.  [ruby-dev:24342]
+Sat Aug  1 17:13:15 2015  Kazuki Tsujimoto  <kazuki@callcc.net>
 
-	* marshal.c (w_object, r_object0): use accessors.
+	* lib/net/http/response.rb (Net::HTTPResponse::Inflater#finish):
+	  fix a bug that empty gzipped response body causes Zlib::BufError.
+	  [ruby-core:68846] [Bug #11058]
 
-Mon Sep 27 09:14:03 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/net/http/test_httpresponse.rb: tests for the above.
 
-	* ext/socket/socket.c (s_accept): don't retry for EWOULDBLOCK.
-	  [ruby-talk:113807]
+Sat Aug  1 17:05:18 2015  Kazuki Tsujimoto  <kazuki@callcc.net>
 
-Fri Sep 24 16:09:42 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/net/http/response.rb (Net::HTTPResponse#inflater):
+	  fix TypeError. An exception object might be nil.
+	  [ruby-core:68846] [Bug #11058]
 
-	* eval.c (proc_invoke): propagate DVAR_DONT_RECYCLE on termination
-	  to avoid double call to rb_gc_force_recycle(). [ruby-dev:24311]
+Sat Aug  1 09:09:46 2015  Aaron Patterson <tenderlove@ruby-lang.org>
 
-Fri Sep 24 08:29:45 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/openssl/ossl_ssl.c (ossl_sslctx_setup): Implement
+	  SSLContext#options and options= using SSL_CTX_set_options and
+	  SSL_CTX_get_options. This reduces the number of ivars we need and
+	  simplifies `ossl_sslctx_setup`.
 
-	* array.c (rb_ary_subseq): original object might be modified after
-	  sharing data creation.  [ruby-dev:24327]
+	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): Default `options`
+	  to SSL_OP_ALL
 
-	* array.c (rb_ary_replace): ditto.
+Sat Aug  1 06:54:36 2015  Aaron Patterson <tenderlove@ruby-lang.org>
 
-	* array.c (ary_make_shared): freeze shared array. [ruby-dev:24325]
+	* ext/openssl/ossl_ssl.c (Init_ossl_ssl): OpenSSL declares these
+	  constants as longs, so we should follow that and use LONG2NUM.
+	  http://git.io/vOqxD
 
-	* struct.c (struct_members): always check struct size and size of
-	  members list in the class.  [ruby-dev:24320]
+Sat Aug  1 04:06:29 2015  Aaron Patterson <tenderlove@ruby-lang.org>
 
-Thu Sep 23 09:29:14 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/openssl/ossl_ssl.c (ossl_call_tmp_dh_callback): change callback
+	  to return the Ruby dh (or ecdh) object that the caller cares about
+	  instead of doing rb_iv_get / set to communicate.  This means we can
+	  remove an rb_iv_get call, and only use the set calls for their
+	  intended purpose (to prevent the object from being GC'd).
 
-	* string.c (rb_str_sub_bang): check if string is not modified
-	  during iteration.  [ruby-dev:24315]
+	* ext/openssl/ossl_ssl.c (ossl_tmp_dh_callback): ditto
+	* ext/openssl/ossl_ssl.c (ossl_call_tmp_ecdh_callback): ditto
+	* ext/openssl/ossl_ssl.c (ossl_tmp_ecdh_callback): ditto
 
-	* hash.c (rb_hash_rehash): replace st_foreach() by its deep
-	  checking counterpart.  [ruby-dev:24310]
+Sat Aug  1 03:49:31 2015  Aaron Patterson <tenderlove@ruby-lang.org>
 
-Wed Sep 22 13:38:12 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/openssl/ossl_ssl.c (ossl_call_tmp_dh_callback): Similarly to the
+	  tmp_ecdh_callback, the SSLSocket instance always holds a reference
+	  to the SSLContext object (it's always set in `initialize`).  The
+	  SSLContext holds a reference to the tmp_dh_callback.  Ask the
+	  context for the callback instead of storing the callback in two
+	  places.
 
-	* hash.c (rb_hash_rehash): add iteration check.  [ruby-dev:24301]
+Sat Aug  1 03:43:10 2015  Aaron Patterson <tenderlove@ruby-lang.org>
 
-	* st.c (st_foreach): add deep check.
+	* ext/openssl/ossl_ssl.c (ossl_call_tmp_dh_callback): create an array
+	  and use `rb_apply` to clean up calls to `rb_protect`.
 
-Wed Sep 22 13:06:14 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* ext/openssl/ossl_ssl.c (ossl_tmp_dh_callback): ditto
 
-	* win32/win32.c (rb_w32_call_handler): workaround for Ctrl-C.
-	  merge from HEAD.
+Sat Aug  1 03:27:12 2015  Aaron Patterson <tenderlove@ruby-lang.org>
 
-Wed Sep 22 00:11:12 2004  Dave Thomas  <dave@pragprog.com>
+	* ext/openssl/ossl_ssl.c (ossl_call_tmp_ecdh_callback): The SSL socket
+	  always holds a reference to the SSLContext object, which will have
+	  the callback object.  Ask the context for the callback instead of
+	  storing the callback in two places.
 
-	* process.c: Add documentation for fork()
+Sat Aug  1 03:14:07 2015  Aaron Patterson <tenderlove@ruby-lang.org>
 
-Wed Sep 22 09:04:41 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): convert
+	  `tmp_dh_callback` to Ruby, and call it when setting up an SSL
+	  connection.  This allows us to move the "default" behavior to the
+	  reader method.
 
-	* array.c (rb_ary_collect_bang): element size might change during
-	  comparison.  [ruby-dev:24300]
+	* ext/openssl/ossl_ssl.c: call the tmp_dh_callback instead of
+	  accessing the SSLContext's internals.
 
-	* array.c (rb_ary_reject_bang): ditto. [ruby-dev:24300]
+Fri Jul 31 23:34:27 2015  Aaron Patterson <tenderlove@ruby-lang.org>
 
-	* array.c (rb_ary_eql): ditto. [ruby-dev:24300]
+	* .travis.yml: update libssl before running tests.
+	  Thanks to Chris Sinjakli <chris@sinjakli.co.uk> for figuring out the
+	  travis settings!
 
-Tue Sep 21 18:29:49 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Jul 31 21:34:49 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* array.c (rb_ary_equal): merge miss.
+	* load.c (rb_require_internal): use rb_load_internal0 not to raise
+	  a exception to be caught.
 
-	* array.c (rb_ary_uniq_bang): element size might change during
-	  comparison.  [ruby-dev:24298]
+Thu Jul 30 13:19:54 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Sep 20 00:24:19 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* variable.c (rb_const_get_0): warn deprecated constant reference.
 
-	* enum.c (enum_sort_by): do not use qsort directly.  use
-	  rb_ary_sort_bang() instead.  [ruby-dev:24291]
+	* variable.c (rb_mod_deprecate_constant): mark constants to be
+	  warned as deprecated.  [Feature #11398]
 
-	* enum.c (enum_sort_by): pedantic type check added.
-	  [ruby-dev:24291]
+Thu Jul 30 11:53:54 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* hash.c (rb_hash_foreach_iter): check iter_lev after each
-	  iteration.  [ruby-dev:24289]
+	* thread.c (rb_thread_s_handle_interrupt): make identity hash, to
+	  compare masking classes just by their IDs.
 
-	* array.c (rb_ary_and): element size might change during
-	  comparison.  [ruby-dev:24290]
+Thu Jul 30 11:52:55 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* array.c (rb_ary_or): ditto. [ruby-dev:24292]
+	* load.c (rb_load_internal0): stop separating exits at loading
+	  from exits from execution.  TAG_FATAL is the only case that
+	  `errinfo` is a Fixnum, and should continue to exit by JUMP_TAG
+	  but not raising as an ordinary exception.
+	  [ruby-core:70169] [Bug #11404]
 
-	* array.c (rb_ary_equal): wrong fix. [ruby-dev:24286]
+Thu Jul 30 10:42:27 2015  Alex Dowad  <alexinbeijing@gmail.com>
 
-Sat Sep 18 15:02:22 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* load.c (rb_load_internal0): extra check before returning
+	  TAG_RAISE when a non-local transfer of control happens while
+	  loading and parsing a Ruby source file.
+	  [ruby-core:70169] [Bug #11404]
 
-	* array.c (rb_ary_equal): element size might change during
-	  comparison.  [ruby-dev:24254]
+Thu Jul 30 08:48:42 2015  Eric Wong  <e@80x24.org>
 
-	* array.c (rb_ary_diff): ditto. [ruby-dev:24274]
+	* st.c (find_entry): constify st_table*
+	  (find_packed_index_from): ditto
+	  (find_packed_index): ditto
+	  (get_keys): ditto
+	  (get_values): ditto
 
-	* array.c (rb_ary_select): ditto. [ruby-dev:24278]
+Thu Jul 30 04:29:25 2015  Eric Wong  <e@80x24.org>
 
-	* array.c (rb_ary_delete): ditto. [ruby-dev:24283]
+	* benchmark/bm_hash_aref_dsym.rb: new benchmark
+	* benchmark/bm_hash_aref_dsym_long.rb: ditto
+	* benchmark/bm_hash_aref_fix.rb: ditto
 
-	* array.c (rb_ary_rindex): ditto. [ruby-dev:24275]
+Wed Jul 29 21:38:41 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* array.c (rb_ary_initialize): element size might change during
-	  initializing block.  [ruby-dev:24284]
+	* hash.c (any_hash), symbol.c (dsymbol_alloc): fix dynamic symbol
+	  hash value by restricting in Fixnum range, that is `long`.
 
-Sat Sep 18 14:10:23 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Wed Jul 29 17:25:46 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* dir.c (dir_s_chdir): avoid memory leak and unnecessary chdir to
-	  the original directory when exception has caused in changing
-	  direcotry or within block.  thanks to Johan Holmberg
-	  <holmberg@iar.se> [ruby-core:03446]
+	* hash.c (rb_obj_hash): move in order to share with rb_any_hash.
 
-Fri Sep 17 20:20:27 2004  Minero Aoki  <aamine@loveruby.net>
+Wed Jul 29 16:00:22 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/fileutils.rb (mkdir_p): backport from CVS HEAD 1.45. [ruby-core:03420]
+	* string.c (str_buf_cat): consider empty non-embed string case,
+	  not to loop infinitely.  [ruby-core:70074] [Bug #11383]
 
-Fri Sep 17 17:11:08 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Wed Jul 29 15:25:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* array.c (rb_ary_delete): element comparison might change array
-	  size. [ruby-dev:24273]
+	* vm_eval.c (send_internal): set method_missing_reason before
+	  invoking overriding method_missing method so that the default
+	  method_missing can achieve it properly.
+	  [ruby-core:68515] [Bug #10969]
 
-	* file.c (rb_file_truncate): clear stdio buffer before truncating
-	  the file.  [ruby-dev:24191]
+Wed Jul 29 14:54:16 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/digest/digest.c: use rb_obj_class() instead of CLASS_OF
-	  which might return singleton class.  [ruby-dev:24202]
+	* hash.c (rb_sym_hash): return same value as rb_any_hash() of
+	  Symbol.  [Bug #9381]
 
-Fri Sep 17 16:07:09 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* hash.c (rb_any_hash): fix Float hash.  rb_dbl_hash() returns a
+	  Fixnum, but not a long.  [Bug #9381]
 
-	* ext/tk/lib/multi-tk.rb: improve exit operation
+Wed Jul 29 11:07:10 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Sep 17 15:01:57 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* internal.h (LIKELY, UNLIKELY): make a boolean to enforce 1 or 0.
 
-	* ext/tcltklib/tcltklib.c: fix SEGV when (thread_)vwait or
-	  (thread_)tkwait
+Wed Jul 29 10:44:43 2015  Alex Dowad  <alexinbeijing@gmail.com>
 
-	* ext/tk/lib/tk.rb: add alias wait_window to wait_destroy
+	* gc.c: document argument passed to finalizer proc.
+	  [fix GH-976][ci skip] Patch by @alexdowad
 
-	* ext/tk/lib/multi-tk.rb: support calling 'mainloop' on slave
-	  interpreters (however, the 'real' eventloop must be run on the
-	  Default Master IP)
+Wed Jul 29 10:36:58 2015  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/tk/lib/remote-tk.rb: follow the changes of ext/tk/lib/multi-tk.rb
+	* io.c (rb_io_extract_modeenc): add option parameter `flags'
+	  to append extra oflags to normal mode.
+	  [Feature #11253] [ruby-core:69539]
 
-	* ext/tk/sample/remote-ip_sample2.rb: ditto
+Wed Jul 29 04:54:47 2015  Eric Wong  <e@80x24.org>
 
-	* ext/tk/sample/tkoptdb-safeTk.rb: ditto
+	* test/rubygems/test_gem_remote_fetcher.rb: pre-generate test key
+	  [ruby-core:70151] [Bug #11397]
 
-Thu Sep 16 18:12:32 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Tue Jul 28 10:32:09 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/webrick/cgi.rb (WEBrick::CGI#start): should set REMOTE_USER
-	  to request.user attribute.
+	* internal.h (struct RClass): moved from ruby/ruby.h to hide the
+	  internals.
 
-	* lib/webrick/httpservlet/filehandler.rb
-	  (WEBrick::HTTPServlet::FileHandler#initialize): should expand
-	  the pathname of document root directory.
+Tue Jul 28 08:48:29 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Sep 16 15:49:28 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* configure.in (RUBY_TYPE_ATTRIBUTE): attribute declaration for
+	  types.
 
-	* string.c (rb_str_intern): protect string argument from GC.
-	  [ruby-core:03411]
+Tue Jul 28 07:23:03 2015  Eric Wong  <e@80x24.org>
 
-Wed Sep 15 20:22:23 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* symbol.h (struct RSymbol): add hashval field
+	* symbol.c (dsymbol_alloc): setup hashval field once
+	* hash.c (rb_any_hash): return RSymbol->hashval directly
+	* common.mk: hash.o depends on symbol.h
+	  Thanks to Bruno Escherl <bruno@escherl.net> for the bug report
+	  [ruby-core:70129] [Bug #11396]
 
-	* ext/tk/sample/tkoptdb-safeTk.rb: fix a bug depend on the changes
-	  of MultiTkIp
+Tue Jul 28 03:26:15 2015  Aaron Patterson <tenderlove@ruby-lang.org>
 
-Tue Sep 14 23:54:11 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): raise a more
+	  helpful exception when verifying the peer connection and an
+	  anonymous cipher has been selected. [ruby-core:68330] [Bug #10910]
+	  Thanks to Chris Sinjakli <chris@sinjakli.co.uk> for the patch.
 
-	* ext/tk/lib/multi-tk.rb: MultiTkIp#eval_string was en-bugged by
-	  the previous changes.
+	* test/openssl/test_ssl.rb (class OpenSSL): test for change
 
-Tue Sep 14 23:45:44 2004  Dave Thomas  <dave@pragprog.com>
+Mon Jul 27 13:24:11 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/rdoc/ri/ri_formatter.rb (RI::TextFormatter::TextFormatter.for):
-	  Add Eric Hodel's simpleformatter.
+	* template/id.h.tmpl (ID2ATTRSET): remove an unused macro.
 
-Tue Sep 14 16:59:37 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Mon Jul 27 12:21:15 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/tcltklib/tcltklib.c: fix SEGV
+	* test/openssl/test_ssl.rb: run tests on non-Unix platforms.
 
-	* ext/tk/lib/multi-tk.rb: improve safe-level handling of argument proc
+Sun Jul 26 19:21:31 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/sample/multi-ip_sample.rb: rename of old 'safe-tk.rb'
+	* ext/openssl/ossl_ssl.c (ossl_ssl_alpn_protocol): fix condition
+	  to compile, needs ALPN to be available.  [Feature #9390]
 
-	* ext/tk/sample/safe-tk.rb: new sample script
+Sun Jul 26 11:29:01 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Sep 14 00:15:15 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* signal.c (default_handler, Init_signal): discard SIGSYS, ENOSYS
+	  should raise a SystemCallError always instead.
 
-	* ext/zlib/zlib.c: backported from HEAD.
+Sun Jul 26 10:26:35 2015  Aaron Patterson <tenderlove@ruby-lang.org>
 
-Mon Sep 13 19:16:33 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* ext/openssl/ossl_ssl.c (ossl_call_servername_cb): set the ssl context
+	  object returned by the servername callback on to the socket as an
+	  instance variable.  If the callback allocated a new context object
+	  and didn't keep a reference to it, it could be GC'd out from under
+	  the socket object.
 
-	* eval.c (blk_copy_prev): need frame_dup().  [ruby-dev:24103]
+	* test/openssl/test_ssl.rb (class OpenSSL): test for change.
 
-Mon Sep 13 16:23:27 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Sun Jul 26 10:07:26 2015  Aaron Patterson <tenderlove@ruby-lang.org>
 
-	* ext/tk/lib/multi-tk.rb: MultiTkIp.new_master and new_slave accept
-	  safe-level value argument
+	* test/openssl/test_ssl.rb (class OpenSSL): add test coverage around
+	  OpenSSL::SSL::SSLContext#servername_cb
 
-Mon Sep 13 10:20:45 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+Sun Jul 26 09:10:32 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* object.c (nil_inspect): fix typo.
+	* gems/bundled_gems: update latest version of bundled power_assert.
 
-Mon Sep 13 01:03:02 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Sun Jul 26 08:49:28 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* ext/tcltklib/tcltklib.c: improve control of preserv/release tcltkip
+	* test/rubygems/test_gem_remote_fetcher.rb: backport rubygems upstream
+	  change for OpenSSL key length. see detail to
+	  https://github.com/rubygems/rubygems/pull/1290
 
-	* ext/tcltklib/tcltklib.c: store original 'exit' command
+Sun Jul 26 08:33:03 2015  Aaron Patterson <tenderlove@ruby-lang.org>
 
-	* ext/tk/tkutil.c: fix(?) SEGV
+	* ext/openssl/lib/openssl/pkey.rb: implement DEFAULT_512 and
+	  DEFAULT_1024 constants in Ruby.
 
-Sun Sep 12 23:46:23 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): Ask PKey for the
+	  default DH callback since it already must check whether openssl has
+	  been compiled with DH support.
 
-	* util.c (ruby_strdup): remove unnecessary code. (xmalloc never
-	  returns NULL.)
+	* ext/openssl/ossl_pkey_dh.c (OSSL_PKEY_BN): Remove C definitions of
+	  DEFAULT_512 and DEFAULT_1024
 
-	* util.c (ruby_getcwd): fix memory leak on failure.
+	* ext/openssl/ossl_pkey_dh.c (Init_ossl_dh): ditto
 
-Sun Sep 12 02:41:58 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* test/openssl/test_pkey_dh.rb (class OpenSSL): add test to ensure the
+	  Ruby definitions are the same as the C definitions were.
 
-	* ext/tcltklib/tcltklib.c: add TclTkIp#allow_ruby_exit? and
-	  allow_ruby_exit=
+Sun Jul 26 08:14:59 2015  Aaron Patterson <tenderlove@ruby-lang.org>
 
+	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): support
+	  specifically setting the tmp_dh_callback to nil.
 
-	* ext/tk/lib/multi-tk.rb: ditto.
+	* ext/openssl/ossl_ssl.c (Init_ossl_ssl): ditto
 
-	* ext/tk/lib/remote-tk.rb: ditto.
+	* test/openssl/test_pair.rb (module OpenSSL): add a test
 
-	* ext/tcltklib/MANUAL.euc: ditto.
+Sun Jul 26 07:47:14 2015  Aaron Patterson <tenderlove@ruby-lang.org>
 
-	* ext/tcltklib/MANUAL.eng: ditto.
+	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): move the default
+	  tmp_dh_callback Ruby code and set it as a default in `initialize`.
 
-	* ext/tcltklib/tcltklib.c: fix some reasons of SEGV
+	* ext/openssl/ossl_pkey_dh.c (static unsigned char DEFAULT_DH_512_GEN):
+	  move this constant to Ruby.
 
-	* ext/tk/tkutil.c: ditto.
+	* ext/openssl/ossl_pkey_dh.c (static unsigned char DEFAULT_DH_1024_GEN):
+	  ditto
 
-	* ext/tk/lib/multi-tk.rb: ditto.
+	* ext/openssl/ossl_pkey_dh.c (Init_ossl_dh): ditto
 
-	* ext/tk/lib/tk/timer.rb: ditto.
+	* ext/openssl/ossl_ssl.c (ossl_tmp_dh_callback): ditto
 
-Sat Sep 11 16:09:46 2004  Dave Thomas  <dave@pragprog.com>
+	* ext/openssl/ossl_ssl.c (ossl_sslctx_setup): tmp_dh_callback should
+	  always be set, so we can remove this conditional
 
-	* lib/rdoc/parsers/parse_rb.rb: Fix up cross-file class merging.
+Sun Jul 26 06:22:24 2015  Aaron Patterson <tenderlove@ruby-lang.org>
 
-Fri Sep 10 20:20:53 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* test/openssl/test_pair.rb: add a test ensuring that the default DH
+	  callback is used when no DH callback is specified.
 
-	* ext/tcltklib/tcltklib.c (lib_merge_tklist): fix suspicious
-	  pointer conversion.
+Sun Jul 26 04:08:27 2015  Aaron Patterson <tenderlove@ruby-lang.org>
 
-Fri Sep 10 02:43:54 2004  Dave Thomas  <dave@pragprog.com>
+	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): add missing
+	  instance variables to squash warnings with alpn.
 
-	* lib/rdoc/generators/template/kilmer.rb: James Buck's
-	  patch for call-seq.
+Sun Jul 26 03:42:19 2015  Aaron Patterson <tenderlove@ruby-lang.org>
 
-Thu Sep  9 13:58:56 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): move
+	  OpenSSL::SSL::SSLContext#initialize implementation to pure Ruby.
 
-	* ext/tcltklib/tcltklib.c (ip_init): change flag value for setting
-	  'argv' and 'argv0' variable
+	* ext/openssl/ossl_ssl.c (ossl_sslctx_initialize): ditto
 
-	* ext/tk/lib/remote-tk.rb: follow changes of multi-tk.rb
+	* ext/openssl/ossl_ssl.c (Init_ossl_ssl): ditto
 
-Thu Sep  9 11:46:18 2004  Dave Thomas  <dave@pragprog.com>
+Sat Jul 25 21:03:45 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::do_classes): Allow
-	  spaces aroun parameter to define_method_under (James Buck)
+	* random.c (fill_random_bytes_syscall): get rid of blocking when
+	  no entropy is available.  based on the patch by mame in
+	  [ruby-core:70114].  [Bug #11395]
 
-Wed Sep  8 18:44:03 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Jul 25 11:05:31 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/stringio/stringio.c (strio_write): zero fill a gap if exsts.
-	  [ruby-dev:24190]
+	* string.c (str_replace_shared_without_enc): fill the terminator
+	  of embedded strings in wide char encodings.
 
-Wed Sep  8 15:19:49 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Sat Jul 25 06:38:36 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/tcltklib/tcltklib.c (ip_init): cannot create a IP at level 4
+	* vm_core.h: size should be unsigned.
+	  * rb_call_info_t::index
+	  * rb_iseq_constant_body::stack_max
+	  * rb_iseq_constant_body::local_size
+	  * rb_iseq_constant_body::param::size
+	  * rb_iseq_constant_body::local_table_size
+	  * rb_iseq_constant_body::is_size
+	  * rb_iseq_constant_body::callinfo_size
 
-	* ext/tk/lib/multi-tk.rb: improve 'exit' operation, security check,
-	  and error treatment
+	* iseq.h: same for iseq_catch_table::size.
 
-	* ext/tk/lib/multi-tk.rb: allow a trusted slave IP to create slave IPs
+	* compile.c: catch up these fix.
 
-	* ext/tk/lib/tk/listbox.rb: add TkListbox#value, value=, clear,	and
-	  erase
+	* iseq.c: ditto.
 
-	* ext/tk/lib/tk/text.rb: add TkText#clear and erase
+	* proc.c: ditto.
 
-Tue Sep  7 15:17:49 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* vm.c: ditto.
 
-	* ext/socket/socket.c (ruby_connect): break immediately if a
-	  socket is non-blocking.  [ruby-talk:111654]
+	* vm_args.c: ditto.
 
-Mon Sep  6 11:08:50 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* vm_eval.c: ditto.
 
-	* ext/tk/lib/tk/menu.rb(TkOptionMenubutton#insert): call correct method
+	* vm_insnhelper.c: ditto.
 
-Mon Sep  6 11:00:47 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sat Jul 25 06:00:09 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* dir.c (dir_s_chdir): the patch to shut up false warning when
-	  exception occurred within a block.  a patch was given from Johan
-	  Holmberg <holmberg at iar.se>.  [ruby-core:03292]
+	* vm_core.h: constify rb_iseq_constant_body::line_info_table.
 
-Mon Sep  6 07:51:42 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* iseq.c: catch up this fix.
 
-	* eval.c (cvar_cbase): singletons should refer outer cvar scope.
-	  [ruby-dev:24223]
+Sat Jul 25 05:56:43 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* eval.c (rb_load): should preserve previous ruby_wrapper value.
-	  [ruby-dev:24226]
+	* vm_core.h: constify rb_iseq_constant_body::param::opt_table and
+	  rb_iseq_constant_body::param::keyword.
 
-Sat Sep  4 01:14:57 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* compile.c: catch up this fix.
 
-	* eval.c (cvar_cbase): class variables cause SEGV in
-	  instance_eval() for fixnums and symbols. [ruby-dev:24213]
+Sat Jul 25 04:47:01 2015  Koichi Sasada  <ko1@atdot.net>
 
-Fri Sep  3 17:47:58 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* vm_core.h: constify rb_iseq_constant_body::catch_table.
 
-	* struct.c (make_struct): remove redefining constant when
-	  conflict.  [ruby-dev:24210]
+	* compile.c (iseq_set_exception_table): catch up this fix.
 
-Fri Sep  3 11:31:44 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* iseq.c: ditto.
 
-	* ext/tk/lib/tk.rb: Tk.after makes TkCore::INTERP.tk_cmd_tbl grow
-	  [ruby-dev:24207]
+	* vm.c (vm_exec): ditto.
 
-Fri Sep  3 02:12:48 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Fri Jul 24 21:29:54 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tcltklib/tcltklib.c: fix typo [ruby-talk:111266]
+	* st.c (EQUAL, st_delete_safe): fix arguments order to compare
+	  function, searching key is the first and stored key is the
+	  second always.
 
-	* ext/tk/lib/tk/text.rb: fix typo
+Fri Jul 24 21:27:29 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/lib/multi-tk.rb: improve safe-level treatment on slave IPs
+	* string.c (fstr_update_callback): fstring must not be a shared
+	  string, or the content without RSTRING_FSTR may be freed.
+	  [ruby-dev:49188] [Bug #11386]
 
-Fri Sep  3 01:54:20 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Jul 24 20:09:43 2015  Naohisa Goto  <ngotogenome@gmail.com>
 
-	* ext/extmk.rb: already built-in libraries satisfy dependencies.
-	  [ruby-dev:24028]
+	* test/rinda/test_rinda.rb (RingIPv6#prepare_ipv6): prevent to use
+	  IPv6 loopback interface for
+	  Rinda::TestRingFinger#test_make_socket_ipv6_multicast and
+	  Rinda::TestRingFinger#test_make_socket_ipv6_multicast_hops.
+	  The tests are skipped if there are no IPv6 devices other than the
+	  loopback device. [Bug #11394] [ruby-dev:49199]
 
-Thu Sep  2 11:36:20 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* test/rinda/test_rinda.rb (test_make_socket_ipv6_multicast): ditto
+	  for Rinda::TestRingServer#test_make_socket_ipv6_multicast.
 
-	* eval.c (rb_obj_instance_eval): backported from HEAD.
+	* test/rinda/test_rinda.rb (test_ring_server_ipv6_multicast): ditto
+	  for Rinda::TestRingServer#test_ring_server_ipv6_multicast.
 
-Wed Sep  1 21:18:25 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Fri Jul 24 16:35:55 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/lib/tk/spinbox.rb: fix typo
+	* string.c (fstr_update_callback): pool bare strings only.
 
-Tue Aug 31 18:24:04 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* string.c (rb_fstring): return the original string with sharing a
+	  fstring if it has extra attributes, not the fstring itself.
+	  [ruby-dev:49188] [Bug #11386]
 
-	* ext/tk/tkutil.c (cbsubst_init): fix memory leak
+Fri Jul 24 16:35:34 2015  yui-knk  <spiketeika@gmail.com>
 
-	* ext/tk/tkutil.c (cbsubst_get_all_subst_keys): fix SEGV
+	* file.c (rb_file_s_extname): [DOC] add an example.
 
-Tue Aug 31 16:04:22 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* test/ruby/test_path.rb (test_extname): add tests.  [Fix GH-978]
+	  * path starts with dot ('.a.rb')
+	  * path includes dir name ('a/b/d/test.rb')
+	  * path includes dir name and dir name starts with dot
+	    ('.a/b/d/test.rb')
 
-	* ext/tcltklib/tcltklib.c (ip_delete): when a tcltkip is deleted,
-	  destroy its root widget
+Thu Jul 23 18:50:43 2015  Koichi Sasada  <ko1@atdot.net>
 
-Tue Aug 31 12:30:36 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* vm_core.h: constify rb_iseq_constant_body::local_table and
+	  rb_iseq_param_keyword::table and
+	  rb_iseq_param_keyword::default_values.
 
-	* ext/tcltklib/tcltklib.c (del_root): fix SEGV
+	* compile.c: catch up this fix.
 
-Mon Aug 30 23:11:06 2004  Dave Thomas  <dave@pragprog.com>
+	* iseq.c: ditto.
 
-	* lib/rdoc/ri/ri_driver.rb (and others): ri now merges documentation
-	  if it finds the same class in multiple places.
+Thu Jul 23 17:30:43 2015  Koichi Sasada  <ko1@atdot.net>
 
-Mon Aug 30 22:40:30 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* vm_core.h: constify rb_iseq_constant_body::iseq_encoded and
+	  rb_control_frame_t::pc.
 
-	* ext/tk/lib/multi-tk.rb: 'restart' method accepts arguments
+	* compile.c (rb_iseq_translate_threaded_code): catch up this fix.
 
-Mon Aug 30 21:50:14 2004  Dave Thomas  <dave@pragprog.com>
+	* iseq.c: ditto.
 
-	* object.c: Add RDoc for Module.included.
+	* vm_exec.c (vm_exec_core): ditto.
 
-Mon Aug 30 15:10:46 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+Thu Jul 23 10:25:46 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* configure.in (GNU/k*BSD): fixed FTBFS on GNU/k*BSD. [ruby-dev:24051]
+	* include/ruby/ruby.h: add raw FL macros, which assume always the
+	  argument object is not a special constant.
 
-Mon Aug 30 11:29:35 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* internal.h (STR_EMBED_P, STR_SHARED_P): valid only for T_STRING.
 
-	* win32/win32.c (CreateChild): strip trailing spaces. [ruby-dev:24143]
-	  merge from HEAD.
+	* string.c: deal with taint flags directly across String instances.
 
-Sun Aug 29 14:08:56 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Thu Jul 23 09:05:28 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tcltklib/tcltklib.c: compile error on bcc32 [ruby-dev:24081]
+	* parse.y (lambda_body): pop cmdarg stack for lookahead
+	  token.  [ruby-core:70067] [Bug #11380]
 
-	* ext/tk/lib/multi-tk.rb: MultiTkIp#eval_string does not work
+Thu Jul 23 04:03:03 2015  Aaron Patterson <tenderlove@ruby-lang.org>
 
-Sat Aug 28 23:04:41 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/openssl/ossl_ssl.c: fix tests by not setting the instance
+	  variable on the frozen ssl instance.
 
-	* bignum.c (rb_big_and): protect parameters from GC.
-	  [ruby-talk:110664]
+Thu Jul 23 03:32:26 2015  Aaron Patterson <tenderlove@ruby-lang.org>
 
-Thu Aug 26 04:38:29 2004  Dave Thomas  <dave@pragprog.com>
+	* ext/openssl/ossl_ssl.c: add ECDH callback support. [Feature #11356]
 
-	* eval.c (return_jump): Minor typo in error message. Now reads
-	  "return can't jump across threads".
+	* test/openssl/test_pair.rb: test for ECDH callback support
 
-Tue Aug 24 17:30:00 2004  Shugo Maeda  <shugo@ruby-lang.org>
+Thu Jul 23 03:29:49 2015  Aaron Patterson <tenderlove@ruby-lang.org>
 
-	* lib/cgi/session.rb (CGI::Session::FileStore#initialize): do not
-	  use a session id as a filename. (backported from HEAD)
+	* ext/openssl/ossl_ssl.c: add ALPN support. [Feature #9390]
 
-	* lib/cgi/session/pstore.rb (CGI::Session::PStore#initialize): ditto.
+	* ext/openssl/extconf.rb: detect ALPN support in OpenSSL
 
-	* lib/cgi/session/pstore.rb (CGI::Session::PStore#initialize): use
-	  Dir::tmpdir. (backported from HEAD)
+	* test/openssl/test_ssl.rb: test for ALPN
 
-Tue Aug 24 14:40:16 2004  Shugo Maeda  <shugo@ruby-lang.org>
+Wed Jul 22 23:44:17 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/cgi/session.rb (CGI::Session::FileStore#initialize): untaint
-	  session id after check. (backported from HEAD)
+	* string.c (rb_str_reverse): reversed string is not a substring,
+	  and should not set coderange of the original string.
+	  [ruby-dev:49189] [Bug #11387]
 
-Tue Aug 24 09:09:01 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Wed Jul 22 20:17:51 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/openssl/ossl_x509attr.c (ossl_x509attr_initialize): d2i
-	  functions may replace the pointer indicated by the first argument.
+	* vm_core.h: modify layout of rb_iseq_constant_body.
 
-	* ext/openssl/ossl_x509ext.c (ossl_x509ext_initialize): ditto.
+	  Move frequent accessing fields to upper part.
 
-	* ext/openssl/ossl_x509name.c (ossl_x509name_initialize): ditto.
+Wed Jul 22 19:57:47 2015  Koichi Sasada  <ko1@atdot.net>
 
-Mon Aug 23 14:04:51 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* vm_core.h: remove unused declaration of
+	  iseq_compile_data_ensure_node_stack.
 
-	* ext/openssl/ossl_ssl.c (ossl_ssl_read):
-	  - should return an empty string if specified length to read is 0.
-	  - should check for pending data and wait for fd before reading.
-	  - call underlying IO's sysread if SSL session is not started.
-	  [ruby-dev:24072], [ruby-dev:24075]
+Wed Jul 22 19:52:45 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/openssl/ossl_ssl.c (ossl_ssl_write):
-	  - call underlying IO's syswrite if SSL session is not started.
+	* vm_core.h: separate rb_iseq_body into rb_iseq_constant_body and
+	  rb_iseq_variable_body (rb_iseq_t::variable_body).
 
-	* ext/openssl/ossl_ssl.c (ossl_ssl_pending): new method
-	  OpenSSL::SSL#pending.
+	  rb_iseq_variable_body can be modified after compilation.
 
-	* ext/openssl/lib/openssl/buffering.rb: should not use select.
+	* compile.c: use rb_iseq_t::variable_body.
 
-Mon Aug 23 12:40:56 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* iseq.c: ditto.
 
-	* lib/resolv.rb (Config.default_config_hash): when multiple domains
-	  are set, Win32::Resolv.get_resolv_info returns Array.
+	* thread.c: ditto.
 
-Sun Aug 22 01:15:31 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Wed Jul 22 17:50:35 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* lib/webrick/httpproxy.rb (WEBrick::HTTPProxyServer#proxy_connect):
-	  should call :ProxyContentHandler before finishing CONNECT.
+	* lib/matrix/eigenvalue_decomposition.rb: refine code style.
+	  [fix GH-959][ci skip] Patch by @bogdanvlviv
 
-Sat Aug 21 06:41:16 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Jul 22 15:48:47 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* ext/tcltklib/extconf.rb (find_tcl, find_tk): find stub library.
+	* test/ruby/test_range.rb: Add test case for Range#end with
+	  exclude_end true case. [fix GH-968] Patch by @yui-knk
 
-	* lib/mkmf.rb (arg_config, with_config): deal with '-' and '_'
-	  uniformly.  [ruby-dev:24118]
+Wed Jul 22 09:45:31 2015  Maksim Sitnikov  <sitnikovme@undev.ru>
 
-Thu Aug 19 16:29:45 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* numeric.c (num_coerce): [DOC] fix doc for Numeric#coerce,
+	  missing '+'.  [Fix GH-974]
 
-	* ext/tk/lib/tk.rb: Fail to treat a hash value of 'font' option.
+Wed Jul 22 07:24:18 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/tk/lib/tk.rb: bindinfo cannot return '%' substiturion infomation.
+	* make rb_iseq_t T_IMEMO object (type is imemo_iseq).
 
-	* ext/tk/lib/menu.rb: typo bug.
+	  All contents of previous rb_iseq_t is in rb_iseq_t::body.
+	  Remove rb_iseq_t::self because rb_iseq_t is an object.
 
-Thu Aug 19 15:15:24 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	  RubyVM::InstructionSequence is wrapper object points T_IMEMO/iseq.
+	  So RubyVM::ISeq.of(something) method returns different wrapper
+	  objects but they point the same T_IMEMO/iseq object.
 
-	* dir.c (free_dir): fix memory leak.  reported by yamamoto
-	  madoka.
+	  This patch is big, but most of difference is replacement of
+	  iseq->xxx to iseq->body->xxx.
 
-Thu Aug 19 11:00:00 2004  Akiyoshi, Masamichi  <masamichi.akiyoshi@hp.com>
+	  (previous) rb_iseq_t::compile_data is also located to
+	  rb_iseq_t::compile_data.
+	  It was moved from rb_iseq_body::compile_data.
 
-	* dln.c (dln_load): Modify to call lib$find_image_symbol for VMS.
-	* io.c (rb_io_fwrite): Use fputc() for VMS non-stream file.
+	  Now rb_iseq_t has empty two pointers.
+	  I will split rb_iseq_body data into static data and dynamic data.
 
-Thu Aug 19 06:07:45 2004  why the lucky stiff  <why@ruby-lang.org>
+	* compile.c: rename some functions/macros.
+	  Now, we don't need to separate iseq and iseqval (only VALUE).
 
-	* ext/syck/token.c: re2c no longer compiled with bit vectors.  caused
-	  problems for non-ascii characters. [ruby-core:03280]
-	* ext/syck/implicit.c: ditto.
-	* ext/syck/bytecode.c: ditto.
+	* eval.c (ruby_exec_internal): `n' is rb_iseq_t (T_IMEMO/iseq).
 
-	* lib/yaml/baseemitter.rb: folding now handles double-quoted strings,
-	  fixed problem with extra line feeds at end of folding, whitespace
-	  opening scalar blocks.
+	* ext/objspace/objspace.c (count_imemo_objects): count T_IMEMO/iseq.
 
-	* lib/yaml/rubytypes.rb: subtelties in handling strings with
-	  non-printable characters and odd whitespace patterns.
+	* gc.c: check T_IMEMO/iseq.
 
-Wed Aug 18 23:41:33 2004  Minero Aoki  <aamine@loveruby.net>
+	* internal.h: add imemo_type::imemo_iseq.
 
-	* lib/net/protocol.rb (rbuf_fill): OpenSSL::SSL::SSLSocket has its own
-	  buffer, select(2) might not work. [ruby-dev:24072]
+	* iseq.c: define RubyVM::InstructionSequence as T_OBJECT.
+	  Methods are implemented by functions named iseqw_....
 
-Wed Aug 18 17:10:12 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* load.c (rb_load_internal0): rb_iseq_new_top() returns
+	  rb_iseq_t (T_IMEMO/iesq).
 
-	* ext/tcltklib/stubs.c (ruby_tcltk_stubs): need to call
-	  Tcl_FindExecutable() for Tcl/Tk 8.4.
+	* method.h (rb_add_method_iseq): accept rb_iseq_t (T_IMEMO/iseq).
 
-Wed Aug 18 12:52:55 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* vm_core.h (GetISeqPtr): removed because it is not T_DATA now.
 
-	* eval.c (rb_obj_instance_eval): evaluates under special singleton
-	  classes as for special constants.
+	* vm_core.h (struct rb_iseq_body): remove padding for
+	  [Bug #10037][ruby-core:63721].
 
-Tue Aug 17 17:20:59 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Wed Jul 22 07:15:33 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* io.c (rb_io_reopen): should clear allocated OpenFile.  pointed
-	  out by Guy Decoux. [ruby-core:03288]
+	* ext/objspace/objspace.c (total_i): no need to skip singleton classes.
 
-Tue Aug 17 01:36:32 2004  Dave Thomas  <dave@pragprog.com>
+Wed Jul 22 06:37:54 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/rdoc/usage.rb: Remove extra indent. Tidy 'ri' option
-	  parsing so RDoc::usage plays better with OptionParser.
+	* vm_core.h: constify rb_call_info_t::kw_arg,
+	  rb_control_frame_t::iseq and rb_control_frame_t::block_iseq.
 
-Sat Aug 14 13:09:10 2004  Minero Aoki  <aamine@loveruby.net>
+	* iseq.c (iseq_free): catch up this fix.
 
-	* lib/fileutils.rb: backport from CVS HEAD (rev1.44).
+	* vm.c: ditto.
 
-	* lib/fileutils.rb: cp_r should copy symlink itself, except cp_r
-	  root.
+	* vm_dump.c: ditto.
 
-	* lib/fileutils.rb: new option mv :force.
+Wed Jul 22 06:25:45 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/fileutils.rb: new module FileUtils::DryRun.
+	* vm_core.h: constify rb_call_info_t::blockiseq and rb_block_t::iseq.
 
-Sat Aug 14 02:48:16 2004  Dave Thomas  <dave@pragprog.com>
+	* vm.c, vm_insnhelper.c: catch up this fix.
 
-	* lib/rdoc/usage.rb: Added. Allows command line programs
-	  to report usage using their initial RDoc comment.
+	* iseq.c (iseq_data_to_ary): constify the first iseq parameter.
 
-Fri Aug 13 13:23:17 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* vm_insnhelper.c (vm_make_proc_with_iseq): ditto.
 
-	* lib/webrick/httputils.rb (WEBrick::HTTPUtils.parse_range_header):
-	  fix regex for range-spec.
+Wed Jul 22 06:17:35 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/webrick/httpservlet/filehandler.rb
-	  (WEBrick::HTTPServlet::DefaultFileHandler#make_partial_content):
-	  multipart/byteranges response was broken.
+	* method.h: constify rb_method_iseq_t::iseqptr.
 
-	* lib/webrick/httpservlet/erbhandler.rb
-	  (WEBrick::HTTPServlet::ERBHandler#do_GET): should select media type
-	  by suffix of script filename.
+	* proc.c (rb_method_entry_min_max_arity): catch up this fix.
 
-	* lib/xmlrpc/server.rb: refine example code.
+	* vm_insnhelper.c (def_iseq_ptr): constify.
 
-Wed Aug 11 17:17:50 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+Wed Jul 22 03:37:39 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* configure.in (RPATHFLAG): stop setting RPATHFLAG on Interix.
+	* gc.c (internal_object_p): Now a singleton classes appear by
+	  ObjectSpace.each_object. [Bug #11360]
 
-Sun Aug  8 00:43:31 2004  why the lucky stiff  <why@ruby-lang.org>
+	* test/ruby/test_objectspace.rb: add a test about it.
 
-	* lib/implicit.c: added sexagecimal float#base60.
+Tue Jul 21 21:21:33 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/syck/rubyext.c (yaml_org_handler): ditto.
+	* thread.c (do_select): replace switch and goto with a loop to
+	  suppress maybe-uninitialized warnings by gcc6.
 
-	* lib/token.c: indentation absolutely ignored when processing flow
-	  collections.  plain scalars are trimmed if indentation follows in
-	  an ambiguous flow collection.
+	* thread.c (set_unblock_function, rb_wait_for_single_fd): ditto.
 
-Sat Aug  7 00:50:01 2004  Tanaka Akira  <akr@m17n.org>
+Tue Jul 21 20:32:33 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* ext/zlib/zlib.c: Zlib::GzipReader#read(0) returns "" instead of nil.
+	* test/ruby/test_range.rb: Add test for Range#hash
+	  [fix GH-969] Patch by @yui-knk
 
-Tue Aug  3 13:49:20 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Tue Jul 21 19:43:20 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/tk/lib/tk/namespace.rb: bug fix
+	* compile.c: constify the first parameter (iseq).
+	  * iseq_add_mark_object()
+	  * iseq_add_mark_object_compile_time()
 
-	* ext/tk/lib/tkextlib/treectrl/tktreectrl.rb: add Tk::TreeCtrl.loupe
+	* iseq.c, iseq.h (rb_iseq_add_mark_object): ditto.
 
-Mon Aug  2 18:04:21 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Tue Jul 21 16:18:48 2015  Eric Wong  <e@80x24.org>
 
-	* ext/tk/lib/tk/msgcat.rb (set_translation): bug fix (fail to set
-	  trans_str to the same as src_str when trans_str is not given.)
+	* test/socket/test_nonblock.rb: increase buffer sizes
+	  to OpenBSD limits. Thanks to Jeremy Evans <code@jeremyevans.net>
+	  [ruby-core:70058]
 
-Mon Aug  2 11:53:06 2004  Dave Thomas  <dave@pragprog.com>
+Tue Jul 21 16:08:53 2015  Eric Wong  <e@80x24.org>
 
-	* lib/rdoc/code_objects.rb (RDoc::Context::find_symbol): Fix infinite recursion
-	  looking up some top level symbols (batsman)
+	* load.c (ruby_dln_librefs): make static
 
-Mon Aug  2 11:48:29 2004  Dave Thomas  <dave@pragprog.com>
+Tue Jul 21 13:36:54 2015  yuuji.yaginuma  <yuuji.yaginuma@gmail.com>
 
-	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::do_methods): Allow '.'s in
-	  variable names to support SWIG generated files (Hans Fugal)
+	* lib/optparse.rb (complete): [DOC] fix typo.  [Fix GH-973]
 
-Sat Jul 31 17:40:16 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Jul 21 05:20:21 2015  Eric Wong  <e@80x24.org>
 
-	* misc/ruby-mode.el (ruby-expr-beg, ruby-parse-partial,
-	  ruby-calculate-indent, ruby-move-to-block, ruby-forward-sexp,
-	  ruby-backward-sexp): keywords must match word-wise.
+	* io.c (nogvl_wait_for_single_fd): new function for Linux
+	  (maygvl_copy_stream_wait_read): Linux-specific version
+	  (nogvl_copy_stream_wait_write): use nogvl_wait_for_single_fd
+	  [ruby-core:70051] [Feature #11377]
 
-Sat Jul 31 05:47:37 2004  why the lucky stiff  <why@ruby-lang.org>
+Mon Jul 20 15:04:30 2015  Eric Wong  <e@80x24.org>
 
-	* lib/yaml.rb (YAML::load_file, YAML::parse_file): added.
+	* parse.y (parser_initialize): avoid redundant zero-ing
 
-	* lib/yaml/rubytypes.rb: exceptions were using an older
-	  YAML.object_maker. [ruby-core:03080]
+Mon Jul 20 12:12:05 2015  Eric Wong  <e@80x24.org>
 
-	* ext/syck/token.c (sycklex_yaml_utf8): using newline_len to
-	  handline CR-LFs.  "\000" was showing up on folded blocks which
-	  stopped at EOF.
+	* parse.y (struct parser_params): pack: 88 => 256 bytes on 64-bit
+	  [ruby-core:70034] [Feature #11371]
 
-	* ext/syck/token.c: re2c compiled with bit vectors now.
-	* ext/syck/implicit.c: ditto.
-	* ext/syck/bytecode.c: ditto.
+Sun Jul 19 14:29:18 2015  windwiny  <windwiny.ubt@gmail.com>
 
-Fri Jul 30 16:10:54 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* ext/pty/pty.c: [DOC] fix example typo, an old name at move from
+	  PTY.open.  [Fix GH-972]
 
-	* ext/tcltklib/tcltklib.c (lib_fromUTF8_core): raise ArgumentError when
-	  the unknown encoding name is given.
+Sat Jul 18 21:29:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tcltklib/tcltklib.c (lib_toUTF8_core): ditto.
+	* thread.c (vm_check_ints_blocking): gather common statements at
+	  the end, and prefer LIKELY for Visual C optimization.
 
-	* ext/tk/lib/tk.rb (Tk::Encoding.encoding_convertfrom): bug fix.
+Sat Jul 18 20:44:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/lib/tk.rb (Tk::Encoding.encoding_convertto): ditto.
+	* load.c (rb_load_internal0): do not raise any exceptions but
+	  return the result tag state.
 
-Wed Jul 28 18:59:17 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* load.c (rb_load_protect): reduce nested EXEC_TAGs.
 
-	* lib/cgi.rb (CGI::initialize): remove at_exit code for CGI_PARAMS
-	  and CGI_COOKIES.  they will no longer be used.
+Sat Jul 18 19:52:17 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Jul 28 01:04:44 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* gc.c (run_finalizer): set and restore safe level here to reduce
+	  nested EXEC_TAGs.
 
-	* gc.c (run_final): wrong order of data. [ruby-dev:23984]
+Sat Jul 18 18:45:22 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Jul 27 07:05:04 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* eval.c (ruby_cleanup): error_handle() returns exit status to the
+	  system, not internal error state, do not convert the exit status
+	  again.
 
-	* eval.c (rb_eval): copy on write for argument local variable
-	  assignment.
+Sat Jul 18 10:29:03 2015  Eric Wong  <e@80x24.org>
 
-	* eval.c (assign): ditto.
+	* test/ruby/test_process.rb: test thread+sigs work after failed exec
 
-	* eval.c (rb_call0): update ruby_frame->argv with the default
-	  value used for the optional arguments.
+Sat Jul 18 07:20:18 2015  Jeremy Evans  <code@jeremyevans.net>
 
-	* object.c (Init_Object): "===" calls rb_obj_equal() directly.
-	  [ruby-list:39937]
+	* test/socket/test_nonblock: use smaller buffer for sendmsg
+	  [ruby-core:70016] [Bug #11364]
 
-Mon Jul 26 11:22:55 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Sat Jul 18 07:04:24 2015  Eric Wong  <e@80x24.org>
 
-	* lib/webrick/httputils.rb (WEBrick::HTTPUtils.escape): should
-	  escape space.
+	* signal.c (trap_handler): cleanup to use RSTRING_GETMEM + memcmp
 
-Sun Jul 25 11:05:21 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Sat Jul 18 02:53:06 2015  Eric Wong  <e@80x24.org>
 
-	* win32/win32.{h,c} (rb_w32_{f,fd,fs}open): workaround for bcc32's
-	  {f,fd,fs}open bug. set errno EMFILE and EBADF. [ruby-dev:23963]
+	* io.c (argf_read_nonblock): support `exception: false'
+	  (io_nonblock_eof): new function
+	  (io_read_nonblock): use io_nonblock_eof
+	  (argf_getpartial): accept kwargs hash for `exception: false'
+	* test/ruby/test_argf.rb (test_read_nonblock): new test
+	* NEWS: add item for ARGF.read_nonblock
+	  [ruby-core:70000] [Feature #11358]
 
-Sat Jul 24 13:32:47 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Jul 17 23:51:31 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* range.c (rb_range_beg_len): returns Qnil only when "beg" points
-	  outside of a range.  No boundary check for "end".
+	* vm_eval.c (rb_eval_cmd): $SAFE=4 has been deprecated.
 
-Fri Jul 23 16:40:25 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Jul 17 22:18:09 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* gc.c (define_final): should not disclose NODE* to Ruby world.
-	  [ruby-dev:23957]
+	* compile.c (iseq_compile_each): use enum ruby_tag_type names.
 
-Fri Jul 23 09:03:16 2004  Shugo Maeda  <shugo@ruby-lang.org>
+	* vm_core.h (ruby_tag_type): move from eval_intern.h for compiling
+	  break/next/redo/return.
 
-	* lib/net/imap.rb (disconnected?): new method. (backported from HEAD)
+Fri Jul 17 15:39:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Jul 22 16:41:54 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* include/ruby/encoding.h (ENC_CODERANGE_CLEAN_P): predicate that
+	  tells if the coderange is clean, that is 7bit or valid, and no
+	  needs to scrub.
 
-	* lib/cgi/session.rb (CGI::Session::FileStore#update): sets the
-	 permission of the session data file to 0600.
+	* re.c (rb_reg_expr_str): use ENC_CODERANGE_CLEAN_P.
 
-	* lib/cgi/session/pstore.rb (CGI::Session::Pstore#initialize):
+	* string.c (enc_strlen, rb_enc_cr_str_buf_cat, rb_str_scrub):
 	  ditto.
 
-Thu Jul 22 00:02:21 2004  Masahiro Kitajima  <katonbo@katontech.com>
-
-	* process.c (rb_f_system): not need to call last_status_set() any
-	  longer on _WIN32.
-
-Tue Jul 20 09:15:17 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* test/fileutils/test_fileutils.rb: File.link raises EINVAL on BeOS.
-
-Mon Jul 19 01:15:07 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/httpservlet/cgihandler.rb
-	  (WEBrick::HTTPServlet::CGIhandler#do_GET): set SystemRoot environment
-	  variable to CGI process on Windows native platforms. [ruby-dev:23936]
-
-	* lib/webrick/httpservlet/cgihandler.rb
-	  (WEBrick::HTTPServlet::CGIhandler#do_GET): use $?.exitstatus and
-	  refine log message.
-
-Sun Jul 18 16:14:29 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk/msgcat.rb (TkMsgCatalog.callback): bug fix
-	  ( wrong number of argument )
-
-Sun Jul 18 08:13:58 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* sprintf.c (rb_f_sprintf): remove extra sign digit.
-
-Sun Jul 18 03:21:42 2004  Akinori MUSHA  <knu@iDaemons.org>
-
-	* dir.c (range): use NULL instead of 0.
-
-	* dir.c (range): get rid of a gcc 3.4 warning.
-
-Sun Jul 18 03:12:11 2004  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/net/imap.rb (receive_responses): return if a LOGOUT response
-	  received. (backported from HEAD)
-	* lib/net/imap.rb (send_string_data): wait command continuation
-	  requests before sending octet data of literals. (backported from HEAD)
-
-Sat Jul 17 23:54:59 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk/variable.rb: TkVariable#ref returns a TkVariable object
-
-Sat Jul 17 22:04:44 2004  akira yamada  <akira@ruby-lang.org>
-
-	* lib/uri/ldap.rb: method hierarchical? should be in URI::LDAP.
-
-Sat Jul 17 18:29:07 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (stmt): not to show same error messages twice.
-
-Sat Jul 17 13:13:32 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* lib/irb/ruby-lex.rb (RubyLex::identify_string): %s string do not
-	  process expression interpolation.  [ruby-talk:106691]
-
-Sat Jul 17 05:26:27 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/diagram.rb: Incorporate Micheal Neuman's
-	  client-side imagemao patch
-
-Sat Jul 17 01:57:03 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (THREAD_ALLOC): th->thread should be initialized to NULL.
-	  [ruby-talk:106657]  The solution was found by Guy Decoux.
-
-Fri Jul 16 22:30:28 2004  Michael Neumann  <mneumann@ntecs.de>
-
-	* file.c (rb_stat_dev_major): new methods File::Stat#dev_major and
-	  #dev_minor. [ruby-core:03195]
-
-Fri Jul 16 15:23:53 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (return_jump, break_jump): raise unexpceted local jump
-	  exception directly.  [ruby-dev:23740]
-
-	* lib/base64.rb (Deprecated): super in bound method calls original
-	  name method in stable version.  [ruby-dev:23916]
-
-Fri Jul 16 11:31:49 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* lib/test/unit/ui/{fox,gtk,gtk2}/testrunner.rb: remove
-	  garbage (patch from akira yamada) [ruby-dev:23911]
-
-Fri Jul 16 11:20:00 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* sprintf.c (rb_f_sprintf): fix output of NaN, Inf and -Inf with
-	  "%f" or etc on MSVCRT platforms. (backported from HEAD)
-
-Fri Jul 16 11:17:38 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* error.c (exit_initialize): use EXIT_SUCCESS instead of 0.
-	  [ruby-dev:23913]
-
-	* error.c (exit_success_p): new method SystemExit#success?.
-	  [ruby-dev:23912]
-
-	* error.c (syserr_initialize): initialization for subclasses.
-	  [ruby-dev:23912]
-
-Thu Jul 15 23:53:38 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/optparse.rb (OptionParser#warn, OptionParser#abort): Exception
-	  no longer has to_str method.
-
-Thu Jul 15 22:59:48 2004  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* ext/readline/extconf.rb: added dir_config for curses, ncurses,
-	  termcap. (backported from HEAD)
-
-Thu Jul 15 20:29:15 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* class.c, error.c, eval.c, intern.h, object.c, variable.c:
-	  do not set path if it is a singleton class.  [ruby-dev:22588]
-	  (backport from 1.9)
-
-Thu Jul 15 10:15:04 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/, ext/tcltklib/: bug fix
-
-	* ext/tk/lib/tk.rb: better operation for SIGINT when processing
-	  callbacks.
-	* ext/tk/lib/tk/msgcat.rb: ditto.
-	* ext/tk/lib/tk/variable.rb: ditto.
-	* ext/tk/lib/tk/timer.rb: ditto.
-
-	* ext/tk/lib/tk/validation.rb: add Tk::ValidateConfigure.__def_validcmd
-	  to define validatecommand methods easier
-
-	* ext/tk/lib/tk.rb (_genobj_for_tkwidget): support autoload Tk ext
-	  classes
-
-	* ext/tk/lib/tk/canvas.rb and so on: remove the parent widget type
-	  check for items (e.g. canvas items; depends on the class) to
-	  avoid some troubles on Tk extension widget class definition.
-
-	* ext/tk/lib/tkextlib/: add Iwidget and TkTable extension support
-
-	* ext/tk/sample/tkextlib/: add samples of Iwidget and TkTable
-
-
-Wed Jul 14 18:08:37 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_asn1.c (ossl_asn1cons_to_der): fix type of
-	  argument. [ruby-dev:23891]
-
-	* test/openssl/test_x509store.rb: prune tests for CRL checking
-	  unless X509::V_FLAG_CRL_CHECK is defined.
-
-Wed Jul 14 12:29:07 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* util.c (ruby_strtod): should not convert string in the form of
-	  "-I.FE-X" which both "I" and "F" are ommitted. [ruby-dev:23883]
-
-	* test/ruby/test_float.rb (test_strtod): add test for bug fix.
-
-Wed Jul 14 00:31:15 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* array.c: rdoc patch. merged patch from Johan Holmberg
-	  <holmberg@iar.se> [ruby-core:3170]
-
-Tue Jul 13 19:39:12 2004  akira yamada  <akira@ruby-lang.org>
-
-	* lib/uri/generic.rb (URI::Generic#merge_path):
-	  "URI('http://www.example.com/foo/..') + './'" should return
-	  "URI('http://www.example.com/')".  [ruby-list:39838]
-	  "URI('http://www.example.com/') + './foo/bar/..'" should return
-	  "URI('http://www.example.com/foo/')".  [ruby-list:39844]
-
-	* test/uri/test_generic.rb (TestGeneric#test_merge): added tests.
-
-Tue Jul 13 15:51:45 2004  Akinori MUSHA  <knu@iDaemons.org>
-
-	* lib/mkmf.rb (init_mkmf): Do not add $(libdir) to $LIBPATH in
-	   extmk mode.
-
-	* lib/mkmf.rb (dir_config): Prepend a new library path instead of
-	  appending so it is tried first.
-
-Tue Jul 13 00:50:48 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_rb.rb: Support call-seq: for Ruby files.
-
-Mon Jul 12 21:20:36 2004  Dave Thomas  <dave@pragprog.com>
-
-	* html_generator.rb: Support hyperlinks of the form {any text}[xxx]
-	  as well as stuff[xxx]
-
-Sat Jul 10 09:30:24 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* test/soap/marshal/test_struct.rb: use qualified build-tin class name
-	  (::Struct) to avoid name crash.
-
-Sat Jul 10 04:21:56 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb: better operation for SIGINT when processing
-	  callbacks.
-	* ext/tk/lib/tk/msgcat.rb: ditto.
-	* ext/tk/lib/tk/variable.rb: ditto.
-	* ext/tk/lib/tk/timer.rb: ditto.
-
-	* ext/tk/lib/tk/validation.rb (__def_validcmd):  add a module
-	  function of Tk::ValidateConfigure to define validatecommand
-	  methods easier
-
-Fri Jul  9 22:36:36 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* array.c, enum.c, pack.c: rdoc patch from Johan Holmberg
-	  <holmberg@iar.se> [ruby-core:3132] [ruby-core:3136]
-
-	* numeric.c: rdoc patch.
-
-Fri Jul  9 19:26:39 2004  Tanaka Akira  <akr@m17n.org>
-
-	* lib/open-uri.rb (URI::HTTPS#proxy_open): raise ArgumentError to
-	  notice https is not supported.
-
-Fri Jul  9 14:28:54 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_thread_raise): accept third argument as well as
-	  Kernel#raise, and evaluate the arguments to create an exception in
-	  the caller's context.  [ruby-talk:105507]
-
-Fri Jul  9 01:47:08 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib : bug fix
-	* ext/tk/lib/tkextlib/itcl : add [incr Tcl] support
-	* ext/tk/lib/tkextlib/itk  : add [incr Tk] support
-	* ext/tk/lib/tkextlib/iwidgets : midway point of [incr Widgets] support
-	* ext/tk/sample/tkextlib/iwidgets : very simple examples of
-	  [incr Widgets]
-
-Thu Jul  8 22:52:19 2004  Kouhei Sutou  <kou@cozmixng.org>
-
-	* lib/rss/{rss,parser,0.9,1.0,2.0}.rb: supported RSS 0.9x/2.0
-	  validation and validation which disregard order of elements.
-	* test/rss/test_parser.rb: added tests for RSS 0.9x/2.0
-	  validation.
-	* test/rss/{test_trackback,rss-testcase}.rb: fixed no good method
-	  name.
-
-Thu Jul  8 00:05:23 2004  akira yamada  <akira@ruby-lang.org>
-
-	* lib/tempfile.rb (Tempfile::initialize): got out code of
-	  generating tmpname.  [ruby-dev:23832][ruby-dev:23837]
-
-Wed Jul  7 15:53:14 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* string.c (rb_str_match): raise TypeError when both arguments are
-	  strings. [ruby-dev:22869] (backported from HEAD)
-
-	* string.c (rb_str_match2): removed.
-
-	* Makefile.in, bcc32/Makefile.sub, win32/Makefile.sub,
-	  wince/Makefile.sub (string.c): now not depend on version.h.
-
-Wed Jul  7 00:48:34 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* ext/tk/lib/tkextlib/tktrans.rb,
-	  ext/tk/lib/tkextlib/treectrl.rb: fix syntax errors.
-
-Tue Jul  6 18:38:45 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib : improve framework of developping Tcl/Tk extension
-	  wrappers
-
-Mon Jul  5 23:56:42 2004  Kouhei Sutou  <kou@cozmixng.org>
-
-	* lib/rss/{trackback,syndication,dublincore,content}.rb: worked
-	  with ruby 1.6 again.
-
-	* test/rss/rss-assertions.rb: ditto.
-
-Mon Jul  5 22:54:39 2004  Tanaka Akira  <akr@m17n.org>
-
-	* lib/uri/common.rb (Kernel#URI): new global method for parsing URIs.
-
-Mon Jul  5 09:02:52 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_thread_yield, rb_f_catch): 4th argument to rb_yield_0()
-	  is a set of bit flags.  [ruby-dev:23859]
-
-Mon Jul  5 01:27:32 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* lib/drb/drb.rb(DRbConn self.open): If socket pool is full, close
-	  the socket whose last-access-time is oldest. (and add new one)
-	  [ruby-dev:23860]
-
-Sun Jul  4 12:24:50 2004  Kouhei Sutou  <kou@cozmixng.org>
-
-	* lib/rss/rss.rb: added copyright header.
-
-Sun Jul  4 00:24:40 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* added files
-	  * lib/soap/attachment.rb
-	  * lib/soap/header
-	  * lib/soap/mimemessage.rb
-	  * lib/soap/rpc/httpserver.rb
-	  * lib/wsdl/soap/cgiStubCreator.rb
-	  * lib/wsdl/soap/classDefCreator.rb
-	  * lib/wsdl/soap/classDefCreatorSupport.rb
-	  * lib/wsdl/soap/clientSkeltonCreator.rb
-	  * lib/wsdl/soap/driverCreator.rb
-	  * lib/wsdl/soap/mappingRegistryCreator.rb
-	  * lib/wsdl/soap/methodDefCreator.rb
-	  * lib/wsdl/soap/servantSkeltonCreator.rb
-	  * lib/wsdl/soap/standaloneServerStubCreator.rb
-	  * lib/wsdl/xmlSchema/enumeration.rb
-	  * lib/wsdl/xmlSchema/simpleRestriction.rb
-	  * lib/wsdl/xmlSchema/simpleType.rb
-	  * lib/xsd/codegen
-	  * lib/xsd/codegen.rb
-	  * sample/soap/authheader
-	  * sample/soap/raa2.4
-	  * sample/soap/ssl
-	  * sample/soap/swa
-	  * sample/soap/whois.rb
-	  * sample/soap/calc/samplehttpd.conf
-	  * sample/soap/exchange/samplehttpd.conf
-	  * sample/soap/sampleStruct/samplehttpd.conf
-	  * sample/wsdl/raa2.4
-	  * sample/wsdl/googleSearch/samplehttpd.conf
-	  * test/openssl/_test_ssl.rb
-	  * test/soap/header
-	  * test/soap/ssl
-	  * test/soap/struct
-	  * test/soap/swa
-	  * test/soap/wsdlDriver
-	  * test/wsdl/multiplefault.wsdl
-	  * test/wsdl/simpletype
-	  * test/wsdl/test_multiplefault.rb
-
-	* modified files
-	  * lib/soap/baseData.rb
-	  * lib/soap/element.rb
-	  * lib/soap/generator.rb
-	  * lib/soap/marshal.rb
-	  * lib/soap/netHttpClient.rb
-	  * lib/soap/parser.rb
-	  * lib/soap/processor.rb
-	  * lib/soap/property.rb
-	  * lib/soap/soap.rb
-	  * lib/soap/streamHandler.rb
-	  * lib/soap/wsdlDriver.rb
-	  * lib/soap/encodingstyle/handler.rb
-	  * lib/soap/encodingstyle/literalHandler.rb
-	  * lib/soap/encodingstyle/soapHandler.rb
-	  * lib/soap/mapping/factory.rb
-	  * lib/soap/mapping/mapping.rb
-	  * lib/soap/mapping/registry.rb
-	  * lib/soap/mapping/rubytypeFactory.rb
-	  * lib/soap/mapping/wsdlRegistry.rb
-	  * lib/soap/rpc/cgistub.rb
-	  * lib/soap/rpc/driver.rb
-	  * lib/soap/rpc/element.rb
-	  * lib/soap/rpc/proxy.rb
-	  * lib/soap/rpc/router.rb
-	  * lib/soap/rpc/soaplet.rb
-	  * lib/soap/rpc/standaloneServer.rb
-	  * lib/wsdl/data.rb
-	  * lib/wsdl/definitions.rb
-	  * lib/wsdl/operation.rb
-	  * lib/wsdl/parser.rb
-	  * lib/wsdl/soap/definitions.rb
-	  * lib/wsdl/xmlSchema/complexContent.rb
-	  * lib/wsdl/xmlSchema/complexType.rb
-	  * lib/wsdl/xmlSchema/data.rb
-	  * lib/wsdl/xmlSchema/parser.rb
-	  * lib/wsdl/xmlSchema/schema.rb
-	  * lib/xsd/datatypes.rb
-	  * lib/xsd/qname.rb
-	  * sample/soap/calc/httpd.rb
-	  * sample/soap/exchange/httpd.rb
-	  * sample/soap/sampleStruct/httpd.rb
-	  * sample/soap/sampleStruct/server.rb
-	  * sample/wsdl/amazon/AmazonSearch.rb
-	  * sample/wsdl/amazon/AmazonSearchDriver.rb
-	  * sample/wsdl/googleSearch/httpd.rb
-	  * test/soap/test_basetype.rb
-	  * test/soap/test_property.rb
-	  * test/soap/test_streamhandler.rb
-	  * test/soap/calc/test_calc.rb
-	  * test/soap/calc/test_calc2.rb
-	  * test/soap/calc/test_calc_cgi.rb
-	  * test/soap/helloworld/test_helloworld.rb
-	  * test/wsdl/test_emptycomplextype.rb
-	  * test/wsdl/axisArray/test_axisarray.rb
-	  * test/wsdl/datetime/test_datetime.rb
-	  * test/wsdl/raa/test_raa.rb
-	  * test/xsd/test_xmlschemaparser.rb
-	  * test/xsd/test_xsd.rb
-
-	* summary
-	  * add SOAP Header mustUnderstand support.
-
-	  * add HTTP client SSL configuration and Cookies support (works
-	    completely with http-access2).
-
-	  * add header handler for handling sending/receiving SOAP Header.
-
-	  * map Ruby's anonymous Struct to common SOAP Struct in SOAP Object
-	    Model.  it caused error.
-
-	  * add WSDL simpleType support to restrict lexical value space.
-
-	  * add SOAP with Attachment support.
-
-Sat Jul  3 17:19:44 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* ext/tk/lib/tkextlib/tkDND.rb: fix syntax error.
-
-Thu Jul  1 23:15:29 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/pstore.rb (transaction): safer backup scheme.  [ruby-list:39102]
-
-	* lib/pstore.rb (commit_new): use FileUtils.copy_stream for Cygwin.
-	  [ruby-dev:23157]
-
-	* lib/pstore.rb (transaction): allow overriding dump and load.
-	  [ruby-dev:23567]
-
-	* lib/pstore.rb (PStore#transaction): get rid of opening in write mode
-	  when read only transaction.  [ruby-dev:23842]
-
-	* lib/yaml/store.rb: follow lib/pstore.rb's change.
-
-Thu Jul  1 18:36:08 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tcltklib : bug fix
-
-	* ext/tk/lib/tk : bug fix and add Tcl/Tk extension support libraries
-
-Thu Jul  1 11:59:45 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/extconf.rb: check for EVP_CIPHER_CTX_copy, ENGINE_add,
-	  EVP_CIPHER_CTX_set_padding, EVP_CipherFinal_ex, EVP_CipherInit_ex,
-	  EVP_DigestFinal_ex and EVP_DigestInit_ex.
-
-	* ext/openssl/openssl_missing.c (EVP_CIPHER_CTX_copy): new function.
-
-	* ext/openssl/openssl_missing.h (EVP_DigestInit_ex, EVP_DigestFinal_ex,
-	  EVP_CipherInit_ex, EVP_CipherFinal_ex, HMAC_Init_ex): new macro for
-	  OpenSSL 0.9.6.
-
-	* ext/openssl/ossl_cipher.c (ossl_cipher_encrypt, ossl_cipher_decrypt):
-	  re-implemnt (the arguments for this method is ).
-
-	* ext/openssl/ossl_cipher.c (ossl_cipher_pkcs5_keyivgen): new method
-	  OpenSSL::Cipher::Cipher#pkcs5_keyivgen. it calls EVP_BytesToKey().
-
-	* ext/openssl/ossl_cipher.c (ossl_cipher_alloc, ossl_cipher_initialize,
-	  ossl_cipher_copy, ossl_cipher_reset ossl_cipher_final,
-	  ossl_cipher_set_key, ossl_cipher_set_iv): replace all EVP_CipherInit
-	  and EVP_CipherFinal into EVP_CipherInit_ex and EVP_CipherFinal_ex.
-	  and EVP_CIPHER_CTX_init should only be called once.
-
-	* ext/openssl/ossl_cipher.c (ossl_cipher_set_key_length): new method
-	  OpenSSL::Cipher::Cipher#key_len=.
-
-	* ext/openssl/ossl_cipher.c (ossl_cipher_init_deprecated): new
-	  finction; print warning for Cipher#<<.
-
-	* ext/openssl/ossl_digest.c: replace all EVP_DigestInit and
-	  EVP_DigestFinal into EVP_DigestInit_ex and EVP_DigestFinal_ex.
-	  and EVP_MD_CTX_init should only be called once.
-
-	* ext/openssl/ossl_digest.c (digest_final): should call
-	  EVP_MD_CTX_cleanup to avoid memory leak.
-
-	* ext/openssl/ossl_hmac.c (ossl_hmac_initialize): repalce HMAC_init
-	  into HMAC_init_ex. and HMAC_CTX_init is moved to ossl_hmac_alloc.
-
-	* ext/openssl/ossl_hmac.c (hmac_final): should call
-	  HMAC_CTX_cleanup to avoid memory leak.
-
-	* test/openssl/test_cipher.rb, test/openssl/test_digest.rb,
-	  test/openssl/test_hmac.rb: new file.
-
-Thu Jul  1 04:08:30 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_asn1.c (ossl_i2d_ASN1_TYPE, ossl_ASN1_TYPE_free):
-	  workaround for the versions earlier than OpenSSL-0.9.7.
-
-Thu Jul  1 03:33:55 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_pkey_dh.c (ossl_dh_initialize): should create
-	  empty pkey object if no argument is passed. [ruby-talk:103328]
-
-	* ext/openssl/ossl_pkey_dsa.c (ossl_dsa_initialize): ditto.
-
-	* ext/openssl/ossl_pkey_rsa.c (ossl_rsa_initialize): ditto.
-
-	* ext/openssl/ossl_pkey_dh.c: add new methods: OpenSSL::PKey::DH#p,
-	  OpenSSL::PKey::DH#p=, OpenSSL::PKey::DH#g, OpenSSL::PKey::DH#g=,
-	  OpenSSL::PKey::DH#pub_key, OpenSSL::PKey::DH#pub_key=,
-	  OpenSSL::PKey::DH#priv_key and OpenSSL::PKey::DH#priv_key=.
-
-	* ext/openssl/ossl_pkey_dsa.c: add new methods: OpenSSL::PKey::DSA#p,
-	  OpenSSL::PKey::DSA#p=, OpenSSL::PKey::DSA#q, OpenSSL::PKey::DSA#q=,
-	  OpenSSL::PKey::DSA#g, OpenSSL::PKey::DSA#g=,
-	  OpenSSL::PKey::DSA#pub_key, OpenSSL::PKey::DSA#pub_key=,
-	  OpenSSL::PKey::DSA#priv_key and OpenSSL::PKey::DSA#priv_key=.
-
-Thu Jul  1 03:16:09 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_ssl.c (ossl_ssl_read): take optional second argument
-	  to specify a string to be written.
-
-	* ext/openssl/lib/openssl/buffering.rb (OpenSSL::Buffering#read):
-	  take optional second argument to specify a string to be written.
-
-	* ext/openssl/lib/openssl/buffering.rb (OpenSSL::Buffering#gets):
-	  refine regexp for end-of-line.
-
-	* ext/opnessl/lib/openssl/ssl.rb
-	  (OpenSSL::SSL::SocketForwarder#listen): fix typo.
-
-Wed Jun 30 11:38:51 2004  Mikael Brockman  <phubuh@phubuh.org>
-
-	* parse.y (primary): should not be NULL.  [ruby-core:03098]
-
-Wed Jun 30 02:53:24 2004  why the lucky stiff  <why@ruby-lang.org>
-
-	* ext/syck/rubyext.c (syck_emitter_new): set buffer after
-	  Data_Wrap_Struct to avoid possible GC. [ruby-talk:104835]
-
-Tue Jun 29 10:31:19 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_eval_cmd, rb_thread_trap_eval): restore safe level.
-
-	* gc.c (define_final, run_final): preserve and restore safe level for
-	  finalizers.  [ruby-core:03058]
-
-	* signal.c (signal_exec, rb_trap_exit, trap): preserve and restore
-	  safe level for signal handlers.  [ruby-dev:23829]
-
-Mon Jun 28 14:57:56 2004  Jeff Mitchell  <quixoticsycophant@yahoo.com>
-
-	* configure.in, lib/mkmf.rb (LIBPATHFLAG): use double quotes due to
-	  DOSISH compilers.  [ruby-core:03107]
-
-Mon Jun 28 00:30:19 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* sample/drb/*.rb: using 'DRb.thread.join' instead of 'gets'
-
-Sun Jun 27 22:39:51 2004  Kouhei Sutou  <kou@cozmixng.org>
-
-	* sample/rss/tdiary_plugin/rss-recent.rb: supported Hiki.
-
-Sun Jun 27 12:19:46 2004  Kouhei Sutou  <kou@cozmixng.org>
-
-	* {lib,sample,test}/rss: added RSS Parser. [ruby-dev:23780]
-
-Sat Jun 26 11:07:30 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in (aix): -b must come at the start of the command line,
-	  and -e must not appear while testing libraries.  [ruby-talk:104501]
-
-	* lib/mkmf.rb (dir_config): quote directory names if necessary.
-	  [ruby-talk:104505]
-
-Fri Jun 25 15:33:19 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/iconv/extconf.rb: check stricter.  [ruby-talk:104501]
-
-	* ext/iconv/extconf.rb: include iconv.h for libiconv.  [ruby-dev:22715]
-
-Fri Jun 25 08:31:29 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_thread_atfork): remove "fork terminates thread"
-	  warning.  [ruby-dev:23768]
-
-	* object.c (rb_obj_clone): backport FL_FINALIZE patch from 1.9.
-	  [ruby-core:02786][ruby-core:03067]
-
-	* ext/socket/socket.c (sock_sockaddr): Socket#gethostbyname()
-	  should give us packed address, not struct sockaddr.
-	  [ruby-core:03053]
-
-Fri Jun 25 02:04:23 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* {bcc32,win32,wince}/setup.mak: remove RUBY_EXTERN lines when
-	  including version.h. [ruby-talk:104456] (backported from HEAD)
-
-Thu Jun 24 14:23:29 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* io.c (rb_io_fread): return already read data when system call is
-	  interrupted.  [ruby-talk:97206]
-
-Thu Jun 24 01:32:43 2004  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* version.h: added declarations of ruby_version,
-	  ruby_release_date, ruby_platform.
-	  (backported from HEAD)
-
-Wed Jun 23 22:23:37 2004  Dave Thomas  <dave@pragprog.com>
-
-	* ext/socket/socket.c (sock_s_gethostbyaddr): Work around problem
-	  with OS X not returning 'from' parameter to recvfrom for
-	  connection-oriented sockets.
-
-Wed Jun 23 01:45:27 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_rb.rb (RubyLex::identify_quotation):
-	  Fix problem with the 'r' being dropped from %r{xxx}
-
-Wed Jun 23 00:20:20 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* ext/win32ole/win32ole.c (ole_hresult2msg): remove trailing
-	  CRs and LFs. (doesn't depend on CR+LF) [ruby-dev:23749]
-
-Wed Jun 23 00:00:25 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* io.c (rb_io_initialize): should check fcntl result.  [ruby-dev:23742]
-
-Tue Jun 22 21:11:36 2004  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
-
-	* ext/win32ole/win32ole.c (OLE_FREE): should not call CoFreeUnuse-
-	  dLibraries().
-
-	* ext/win32ole/win32ole.c (ole_event_free): ditto.
-
-	* ext/win32ole/win32ole.c (ole_hresult2msg): truncate error message
-	  before CR.
-
-Tue Jun 22 16:47:42 2004  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/net/ftp.rb (MDTM_REGEXP): fix for demon's ftp server.
-	  Thanks, Rutger Nijlunsing.
-
-Mon Jun 21 10:19:23 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/win32.c (rb_w32_opendir): use FindFirstFile()/FindNextFile()/
-	  FindClose() instead of _findfirst()/_findnext()/_findclose().
-	  merge from HEAD.
-
-Sat Jun 19 13:24:15 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (method_call): allow changing $SAFE.  [ruby-dev:23713]
-
-Fri Jun 18 23:12:22 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (proc_save_safe_level, rb_set_safe_level, safe_setter): limit
-	  safe level.
-
-Wed Jun 16 23:05:57 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* object.c (rb_mod_freeze): prepare string representation before
-	  freezing. [ruby-talk:103646]
-
-Wed Jun 16 16:04:40 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* object.c (rb_mod_le): singleton class inherits Class rather than its
-	  object's class.  [ruby-dev:23690]
-
-Wed Jun 16 16:01:17 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* gc.c (stack_grow_direction): memoize the direction.
-
-	* gc.c (Init_stack): should always move to end of VALUE.
-
-Tue Jun 15 12:10:04 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb: bug fix (TkWindow#grab)
-
-Mon Jun 14 18:23:27 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/remote-tk.rb: bug fix
-
-Sun Jun 13 00:23:04 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tcltklib/extconf.rb: [EXPERIMENTAL] MacOS X (darwin) support
-
-	* ext/tcltklib/tcltklib.c: fix thread trouble on callback proc, and
-	  eliminate warning about instance variable access
-
-	* ext/tk/lib/tk/menubar.rb: improve supported menu_spec
-
-	* ext/tk/lib/tk/menuspec.rb: [add] menu_spec support library
-
-	* ext/tk/lib/tk/root.rb: add menu_spec support
-
-	* ext/tk/lib/tk/text.rb: bug fix
-
-	* ext/tk/lib/tk/toplevel.rb: add menu_spec support
-
-	* ext/tk/sample/menubar?.rb: [add] sample of menu_spec usage
-
-Sat Jun 12 11:15:53 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* configure.in (target_os): strip -gnu suffix on Linux.
-
-Fri Jun 11 17:08:21 2004  Akinori MUSHA  <knu@iDaemons.org>
-
-	* config.guess: Restore a wrongly removed hyphen.
-
-Fri Jun 11 14:30:08 2004  Akinori MUSHA  <knu@iDaemons.org>
-
-	* config.guess: Attempt to avoid system name change on
-	  Darwin platforms also.
-
-Fri Jun 11 14:22:45 2004  Akinori MUSHA  <knu@iDaemons.org>
-
-	* config.guess, config.sub: Attempt to avoid system name change on
-	  Linux platforms.  We have been using "linux" instead of
-	  "linux-gnu" on this branch.
-
-Thu Jun 10 19:19:41 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/sdbm/init.c (fsdbm_store): sdbm should use StringValue().
-	  [ruby-talk:103062]
-
-Wed Jun  9 18:04:14 2004  akira yamada  <akira@ruby-lang.org>
-
-	* lib/uri/generic.rb (URI::Generic::merge,
-	  URI::Generic::route_from): accepts non-hierarchical URI.
-	  [ruby-dev:23631]
-
-	* test/uri/test_generic.rb (TestGeneric::test_route,
-	  TestGeneric::test_merge): added tests for above changes.
-
-Wed Jun  9 17:39:37 2004  Akinori MUSHA  <knu@iDaemons.org>
-
-	* config.guess, config.sub: Update to a more recent version as of
-	  2004-01-20.
-
-	* configure.in: Add support for DragonFly BSD.
-
-Wed Jun  2 20:16:03 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* string.c (str_new4): should share shared instance if it already
-	  exists.  [ruby-dev:23665]
-
-Wed Jun  2 12:41:53 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (rb_io_gets_m): set lastline ($_) even when read line is
-	  nil.  [ruby-dev:23663]
-
-Fri May 28 11:20:31 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_eval): bad influence on frame node.
-
-	* eval.c (eval): reverted wrongly removed condition.  [ruby-dev:23638]
-
-Thu May 27 23:15:18 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/logger.rb: leading 0 padding of timestamp usec part.
-
-	* lib/csv.rb (CSV.parse): [CAUTION] behavior changed.  in the past,
-	  CSV.parse accepts a filename to be read-opened (it was just a
-	  shortcut of CSV.open(filename, 'r')).  now CSV.parse accepts a
-	  string or a stream to be parsed e.g.
-	  CSV.parse("1,2\n3,r") #=> [['1', '2'], ['3', '4']]
-
-	* lib/csv.rb: CSV::Row and CSV::Cell are deprecated.  these classes
-	  are removed in the future.  in the new csv.rb, row is represented
-	  as just an Array.  since CSV::Row was a subclass of Array, it won't
-	  hurt almost all programs except one which depended CSV::Row#match.
-	  and a cell is represented as just a String or nil(NULL).  this
-	  change will cause widespread destruction.
-
-	      CSV.open("foo.csv", "r") do |row|
-		row.each do |cell|
-		  if cell.is_null       # using Cell#is_null
-		    p "(NULL)"
-		  else
-		    p cell.data         # using Cell#data
-		  end
-		end
-	      end
-
-	    must be just;
-
-	      CSV.open("foo.csv", "r") do |row|
-		row.each do |cell|
-		  if cell.nil?
-		    p "(NULL)"
-		  else
-		    p cell
-		  end
-		end
-	      end
-
-	* lib/csv.rb: [CAUTION] record separator(CR, LF, CR+LF) behavior
-	  change.  CSV.open, CSV.parse, and CSV,generate now do not force
-	  opened file binmode.  formerly it set binmode explicitly.
-
-	  with CSV.open, binmode of opened file depends the given mode
-	  parameter "r", "w", "rb", and "wb".  CSV.parse and CSV.generate open
-	  file with "r" and "w".
-
-	  setting mode properly is user's responsibility now.
-
-	* lib/csv.rb: accepts String as a fs (field separator/column separator)
-	  and rs (record separator/row separator)
-
-	* lib/csv.rb (CSV.read, CSV.readlines): added.  works as IO.read and
-	  IO.readlines in CSV format.
-
-	* lib/csv.rb: added CSV.foreach(path, rs = nil, &block).  CSV.foreach
-	  now does not handle "| cmd" as a path different from IO.foreach.
-	  needed?
-
-	* test/csv/test_csv.rb: updated.
-
-	* test/ruby/test_float.rb: added test_strtod to test Float("0").
-
-Thu May 27 21:37:50 2004  Tanaka Akira  <akr@m17n.org>
-
-	* lib/pathname.rb (Pathname#initialize): refine pathname initialization
-	  by pathname.
-
-Thu May 27 20:22:05 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* io.c (rb_io_fwrite): check all case errno != 0 [ruby-dev:23648]
-
-Thu May 27 14:53:13 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* io.c (rb_io_fwrite): workaround for bcc32's fwrite bug.
-	  add errno checking.  [ruby-dev:23627]
-
-Wed May 26 14:19:42 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_eval, eval): make line number consistent on eval with
-	  Proc.  [ruby-talk:101253]
-
-Wed May 26 13:59:17 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::skip_for_variable): Allow for
-	  'do' after for statement
-
-Wed May 26 13:56:03 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/generators/html_generator.rb (Generators::MarkUp::style_url): Fix
-	  relative path to code CSS file
-
-Wed May 26 13:14:52 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* io.c (rb_io_init_copy): copy also positions.  [ruby-talk:100910]
-
-Wed May 26 00:00:00 2004  why the lucky stiff  <why@ruby-lang.org>
-
-	* ext/syck/syck.c (syck_new_parser): clear parser on init.
-	  thanks, ts. [ruby-core:02931]
-
-	* ext/syck/token.c (sycklex_yaml_utf8): buffer underflow.
-	  thanks, ts. [ruby-core:02929]
-
-	* lib/yaml/baseemitter.rb (indent_text): simpler flow block code.
-
-	* lib/yaml.rb: added rdoc to beginning of lib.
-
-Mon May 24 10:46:26 2004  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
-
-	* lib/rdoc/generators/template/html/html.rb: SYSTEM identifiers
-	  must be absolute URIs
-
-Sat May 22 12:00:04 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* MANIFEST: add new encodings in rexml.
-
-	* ext/tk/MANIFEST: add recent files.
-
-Sat May 22 05:37:11 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/remote-tk.rb: (NEW library) controll Tk interpreters
-	  on the other processes by Tcl/Tk's 'send' command
-
-Fri May 21 09:22:05 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_method_parameters):
-	  Add ()'s around parameters that don't have them
-
-Thu May 20 17:02:03 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/mkmf.rb (check_sizeof): define result size.  [ruby-core:02911]
-
-	* lib/mkmf.rb (create_header): macro name should not include equal
-	  sign.
-
-Thu May 20 15:59:50 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* ext/socket/socket.c: fix SEGV. [ruby-dev:23550]
-
-Thu May 20 14:35:52 2004  Tanaka Akira  <akr@m17n.org>
-
-	* ext/socket/socket.c: check SCM_RIGHTS macro addition to
-	  the msg_control field to test existence of file descriptor passing
-	  by msg_control.
-
-Thu May 20 12:38:06 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* numeric.c (flo_eq): always check if operands are NaN.
-	  [ruby-list:39685]
-
-Thu May 20 12:34:39 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_visibility):
-	  At Ryan Davis' suggestion, honor visibility modifers if guarded by a
-	  statement modifier
-
-Thu May 20 12:22:13 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/mkmf.rb (have_type): do not check pointer to incomplete type,
-	  which always get compiled.  [ruby-list:39683]
-
-Wed May 19 11:09:00 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tk/lib/tk.rb: change permition of TkObject#tk_send from
-	  private to public
-
-Tue May 18 14:00:46 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* node.h (NEW_DSTR): adjust list length.
-
-	* parse.y (literal_concat): ditto.
-
-Mon May 17 16:14:25 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* numeric.c (flo_to_s): it's preferable that "p 0.0" outputs "0.0"
-	  instead of "0.0e+00". [ruby-dev:23480]
-
-	* numeric.c (flo_to_s): it's preferable that "p 0.00000000000000000001"
-	  outputs "1.0e-20" instead of "9.999999999999999e-21". (the precision
-	  is considered, but there is assumption DBL_DIG == 15 in current
-	  implementation)
-
-Mon May 17 10:13:33 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/socket/socket.c (setup_domain_and_type): honor duck typing.
-	  [ruby-dev:23522]
-
-	* ext/socket/socket.c (sock_s_getnameinfo): ditto.
-
-Mon May 17 01:15:23 2004  why the lucky stiff  <why@ruby-lang.org>
-
-	* lib/yaml.rb: removed fallback to pure Ruby parser.
-
-	* lib/yaml/baseemitter.rb (indent_text): was forcing a mod value
-	  of zero at times, which kept some blocks from getting indentation.
-
-	* lib/yaml/baseemitter.rb (node_text): rewriting folded scalars.
-
-	* ext/syck/syck.h: reports style of scalars now, be they plain, block
-	  single-, or double-quoted.
-
-	* ext/syck/syck.c: ditto.
-
-	* ext/syck/gram.c: ditto.
-
-	* ext/syck/node.c: ditto.
-
-	* ext/syck/token.c: ditto.
-
-	* ext/syck/rubyext.c (yaml_org_handler): symbols loaded only
-	  if scalar style is plain.
-
-	* ext/syck/rubyext.c (yaml_org_handler): some empty strings were
-	  loaded as symbols.
-
-	* test/yaml/test_yaml.rb (test_perl_regexp): updated test to
-	  match new regexp serialization.
-
-Mon May 17 00:03:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
-
-	* lib/drb/drb.rb: Cosmetic documentation changes.
-
-Sun May 16 22:36:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
-
-	* lib/test/unit.rb: Removed :nodoc: directive (it prevented effective
-	  RDoc operation), and added file-level comment.
-
-Sun May 16 20:55:49 2004  Tanaka Akira  <akr@m17n.org>
-
-	* ext/dbm/dbm.c (fdbm_initialize): accept optional 3rd argument to
-	  specify an open flag.
-	  (Init_dbm): define open flags: DBM::READER, DBM::WRITER, DBM::WRCREAT
-	  and DBM::NEWDB.
-
-Sun May 16 13:10:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
-
-	* lib/test/unit/**/*.rb: Removed :nodoc: directives (many were
-	  generating warnings, many were on private methods).
-
-Sat May 15 01:41:34 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (eval): forgot to restore $SAFE value before evaluating
-	  compiled node.  [ruby-core:02872]
-
-Sat May 15 01:33:12 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* range.c (range_each_func): terminates loop if generating value
-	  is same to @end.  [ruby-talk:100269]
-
-Fri May 14 22:08:38 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* string.c (rb_str_new4): should not reuse frozen shared string if
-	  the original is not an instance of String. [ruby-talk:100193]
-
-Fri May 14 18:39:25 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* string.c (rb_str_enumerate_chars): ditto, and suppress a warning
+	  by gcc6.
 
-	* ext/tk/lib/tk/canvas.rb: improve coords support for canvas items.
-	  Now, supports all of the followings.
-	    TkcLine.new(c, 0, 0, 100, 100, :fill=>'red')
-	    TkcLine.new(c, [0, 0, 100, 100], :fill=>'red')
-	    TkcLine.new(c, [0, 0], [100, 100], :fill=>'red')
-	    TkcLine.new(c, [[0, 0], [100, 100]], :fill=>'red')
-	    TkcLine.new(c, :coords=>[0, 0, 100, 100], :fill=>'red')
-	    TkcLine.new(c, :coords=>[[0, 0], [100, 100]], :fill=>'red')
+Fri Jul 17 15:36:52 2015  yui-knk  <spiketeika@gmail.com>
 
-Fri May 14 12:11:43 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* test/ruby/test_range.rb (test_first_last): Add test for
+	  `Range.new`.  [Fix GH-971]
 
-	* util.c (ruby_strtod): strtod("0", &end); => end should point '\0'.
-	 [ruby-dev:23498]
+Fri Jul 17 15:36:40 2015  yui-knk  <spiketeika@gmail.com>
 
-Thu May 13 15:47:30 2004  akira yamada  <akira@ruby-lang.org>
+	* test/ruby/test_range.rb (test_first_last): Add assertions to
+	  test of `Range#last` with exclude_end true case.  [Fix GH-970]
 
-	* lib/net/telnet.rb (Net::Telnet::login): "options" can specify
-	  regexps for login prompt and/or password prompt.
+Fri Jul 17 09:59:14 2015  Eric Wong  <e@80x24.org>
 
-Thu May 13 14:23:45 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* thread.c (rb_thread_alone): simplify
 
-	* hash.c (delete_if_i): use st_delete_safe() (via
-	  rb_hash_delete()) instead of returning ST_DELETE.
-	  backport from HEAD.  [ruby-dev:23487]
+Fri Jul 17 09:58:32 2015  Eric Wong  <e@80x24.org>
 
-Thu May 13 13:01:30 2004  akira yamada  <akira@ruby-lang.org>
+	* lib/rinda/tuplespace.rb: remove enumerator require
+	* test/pathname/test_pathname.rb: ditto
 
-	* lib/uri/mailto.rb (URI::MailTo::to_s): should include fragment.
+Fri Jul 17 05:33:58 2015  Eric Wong  <e@80x24.org>
 
-Thu May 13 11:04:08 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* iseq.c (rb_iseq_compile_with_option): reuse result of previous
+	  GET_THREAD() call
+	* thread.c (thread_create_core): ditto
+	  (rb_mutex_trylock): ditto
+	  (rb_mutex_lock): ditto
+	* process.c (rb_waitpid): avoid multiple eval from RUBY_VM_CHECK_INTS
+	* thread.c (rb_thread_check_ints): ditto
 
-	* pack.c (pack_pack): always add with null for 'Z'.
+Thu Jul 16 19:12:30 2015  Eric Wong  <e@80x24.org>
 
-	* pack.c (pack_unpack): terminated by null for 'Z'.  [ruby-talk:98281]
+	* thread.c (mutex_alloc): remove needless volatile
 
-Wed May 12 19:59:43 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Jul 16 22:05:29 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/mkmf.rb (have_type, check_sizeof): replace unusable characters.
-	  [ruby-talk:99788]
+	* vm_core.h: constify rb_iseq_t::parent_iseq.
 
-Wed May 12 17:41:42 2004  Tanaka Akira  <akr@m17n.org>
+	  rb_iseq_t::local_iseq is not constant data because
+	  local_iseq::flip_cnt can be modified (commented).
 
-	* lib/resolv.rb (Resolv::DNS::Config): make it configurable without
-	  external file such as /etc/resolv.conf.
+	* compile.c: catch up this fix.
 
-Wed May 12 14:37:27 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* iseq.c: ditto.
 
-	* ext/openssl/ossl_x509name.c: attribute value of DC (short name of
-	  domainComponent) should be IA5String.
+	* vm_insnhelper.c: ditto.
 
-Wed May 12 13:20:19 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Thu Jul 16 21:47:47 2015  Naohisa Goto  <ngotogenome@gmail.com>
 
-	* ext/tk/lib/tk/composite.rb: improve configure methods (based on
-	  the proposal of [ruby-talk:99671]).
+	* process.c (redirect_dup2): when the new FD of dup2() conflicts
+	  with one of the timer thread FDs, the internal FD is diverted.
+	  [Bug #11336] [ruby-core:69886] [Bug #11350] [ruby-core:69961]
 
-Wed May 12 11:51:08 2004  Dave Thomas  <dave@pragprog.com>
+	* process.c (dup2_with_divert): new function for the above purpose.
 
-	* class.c (rb_obj_singleton_methods): fix rdoc
+	* thread_pthread.c (rb_divert_reserved_fd): new function for
+	  diverting reserved FD. If the given FD is the same as one of the
+	  reserved FDs, the reserved FD number is internally changed.
+	  It returns -1 when error. Otherwise, returns 0. It also returns
+	  0 if there is no need to change reserved FD number.
 
-Mon May 10 21:44:42 2004  Dave Thomas  <dave@pragprog.com>
+	* thread_win32.c (rb_divert_reserved_fd): always returns 0 because
+	  of no reserved FDs.
 
-	* lib/rdoc/generators/html_generator.rb: Change scheme for
-	  looking up symbols in  HTML generator.
+	* internal.h (rb_divert_reserved_fd): prototype declaration.
+	  It is Ruby internal use only.
 
-Mon May 10 16:45:21 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Thu Jul 16 21:47:46 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* eval.c (eval): warning during eval should not cause deadlock.
-	  [ruby-talk:98651]
+	* iseq.c (rb_iseq_disasm): rename rb_iseq_t *iseqdat to iseq
+	  and VALUE *iseq to code.
 
-	* eval.c (rb_eval): raise TypeError exception for superclass
-	  mismatch.  [ruby-list:39567]
+	* iseq.c (rb_iseq_disasm_insn): ditto.
 
-Mon May 10 12:11:37 2004  Dave Thomas  <dave@pragprog.com>
+Thu Jul 16 14:34:24 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/rdoc/generators/html_generator.rb: Hack to search parents
-	  for unqualified constant names.
+	* vm.c (REWIND_CFP): keep the arguments region inside the valid
+	  value stack.  [ruby-core:69969] [Bug #11352]
 
-Mon May 10 12:11:37 2004  Dave Thomas  <dave@pragprog.com>
+Thu Jul 16 11:38:21 2015  Eric Wong  <e@80x24.org>
 
-	* lib/rdoc/generators/html_generator.rb: Hack to search parents
-	  for unqualified constant names.
+	* process.c (close_unless_reserved): declare type of `fd' arg
 
-Sun May  9 22:37:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
+Thu Jul 16 08:47:29 2015  Eric Wong  <e@80x24.org>
 
-	* lib/net/ftp.rb: improved documentation
-	* lib/net/imap.rb: ditto
-	* lib/net/pop.rb: ditto
-	* lib/net/smtp.rb: ditto
-	* lib/net/telnet.rb: ditto
+	* load.c (rb_construct_expanded_load_path): fstring expanded path
+	  (get_loaded_features_index): fstring feature path
+	  (rb_provide_feature): ditto
+	  [ruby-core:69871] [Feature #11331]
 
-Fri May  7 21:50:21 2004  Dave Thomas  <dave@pragprog.com>
+Thu Jul 16 02:56:14 2015  Eric Wong  <e@80x24.org>
 
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::parse_include): Allow
-	  multiple arguments to 'include'
+	* thread.c (thread_initialize): avoid RSTRING_PTR and NUMT2INT
 
-Fri May  7 21:31:56 2004  Minero Aoki  <aamine@loveruby.net>
+Thu Jul 16 01:00:46 2015  Naohisa Goto  <ngotogenome@gmail.com>
 
-	* lib/fileutils.rb (fu_list): Array() breaks pathes including "\n".
-	  [ruby-core:02843]
+	* test/ruby/test_process.rb (test_exec_close_reserved_fd): test for
+	  [Bug #11353]
 
-Fri May  7 11:25:53 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Thu Jul 16 00:35:42 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-	* util.c (ruby_strtod): "0.0000000000000000001" should be converted
-	  to 1.0e-19 instead of 0.0. (leading zeros aren't significant digits)
-	  [ruby-talk:99318] [ruby-dev:23465]
+	* .gitignore: ignore version.i.
 
-Fri May  7 10:00:05 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Wed Jul 15 23:40:32 2015  Naohisa Goto  <ngotogenome@gmail.com>
 
-	* ext/tk/tkutil.c (get_eval_string_core): bug fix. [ruby-dev:23466]
+	* test/ruby/test_process.rb (test_deadlock_by_signal_at_forking):
+	  use RUBY (= EnvUtil.rubybin)
 
-Thu May  6 22:13:17 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+Wed Jul 15 23:01:22 2015  Naohisa Goto  <ngotogenome@gmail.com>
 
-	* ext/socket/socket.c (ippaddr): use NUMERICHOST if can not resolve
-	  hostname.
-
-Thu May  6 14:22:29 2004  why the lucky stiff  <why@ruby-lang.org>
-
-	* lib/yaml/rubytypes.rb (to_yaml): added instance variable handling
-	  for Ranges, Strings, Structs, Regexps.
-
-	* lib/yaml/rubytypes.rb (to_yaml_fold): new method for setting a
-	  String's flow style.
-
-	* lib/yaml.rb (YAML::object_maker): now uses Object.allocate.
-
-	* ext/syck/gram.c: fixed transfer methods on structs, broke it
-	  last commit.
-
-Thu May  6 11:40:28 2004  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/net/imap.rb (string): accept NIL.
-
-	* lib/net/imap.rb (body_type_basic): allow body-fields omissions.
-
-Thu May  6 01:59:04 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/generators/html_generator.rb (Generators::HtmlMethod::params):
-	  Don't include the &block parameter if we have explicit
-	  yield parameters.
-
-Wed May  5 03:40:29 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* lib/rinda/ring.rb: use recv instead of recvfrom.
-
-Tue May  4 23:52:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
-
-	* lib/gserver.rb: documented
-
-Tue May  4 23:46:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
-
-	* lib/xmlrpc/README.txt: introduced for documentation purposes
-
-Mon May  3 09:47:24 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_method_or_yield_parameters):
-	  Fix parsing bug if yield called within 1 line block
-
-Sun May  2 01:04:38 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tcltklib, ext/tk: renewal Ruby/Tk
-
-Fri Apr 30 20:08:41 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* time.c (SIZEOF_TIME_T): support SIZEOF_TIME_T == SIZEOF_INT.
-
-Tue Apr 27 13:12:42 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_eval): too many line trace call. (ruby-bugs PR#1320)
-
-Tue Apr 27 08:41:28 2004  why the lucky stiff  <why@ruby-lang.org>
-
-	* lib/yaml/rubytypes.rb: passing Range tests.
-
-	* ext/syck/syck.h: version 0.44.
-
-	* ext/syck/gram.c: transfers no longer open an indentation.
-	  fixed transfers which precede blocks.
-
-	* ext/syck/token.c: ditto.
-
-	* ext/syck/syck.c: fixed segfault if an anchor has been released already.
-
-	* ext/syck/node.c (syck_free_members): organized order of free'd nodes.
-
-	* ext/syck/rubyext.c (syck_emitter_write_m): test for proper string with
-	  StringValue.
-
-Mon Apr 26 23:56:54 2004  Daniel Kelley  <news-1082945587@dkelley.gmp.san-jose.ca.us>
-
-	* README.EXT, README.EXT.ja: fixed wrong function signature.
-	  [ruby-talk:98349]
-
-Mon Apr 26 21:40:09 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/code_objects.rb (RDoc::Context::add_alias): Only alias
-	  to instance methods.
-
-Sat Apr 24 10:38:31 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/markup/simple_markup.rb (SM::SimpleMarkup::group_lines):
-	  Fix bug where consecutive headings are merged.
-
-Fri Apr 23 23:26:13 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/mkmf.rb: $hdrdir should not contain macros for backward
-	  compatibility.  [bruby-dev:28]
-
-	* version.c (ruby_show_copyright): obtain copyright year from
-	  RUBY_RELEASE_YEAR.
-
-	* win32/resource.rb: ditto.
-
-	* win32/resource.rb: default rubyw icon to ruby.ico, and let DLL also
-	  include them.
-
-	* win32/resource.rb: include winver.h for older WindowsCE.
-
-Fri Apr 23 16:38:46 2004  Tanaka Akira  <akr@m17n.org>
-
-	* lib/pathname.rb: sync taint/freeze flag between
-	  a pathname object and its internal string object.
-
-Fri Apr 23 14:52:08 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (stmt, arg, aref_args): should not make sole splat into
-	  array, in aref_args other than aref with op_asgn.
-
-Fri Apr 23 14:14:38 2004  Tanaka Akira  <akr@m17n.org>
-
-	* lib/resolv.rb: don't use Regexp#source to embed regexps.
-	  [ruby-dev:23432]
-
-Thu Apr 22 04:15:36 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (aref_args): should pass expanded list.  [ruby-core:02793]
-
-Thu Apr 22 01:12:57 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* numeric.c (flo_to_s): tweak output string based to preserve
-	  decimal point and to remove trailing zeros.  [ruby-talk:97891]
-
-	* string.c (rb_str_index_m): use unsigned comparison for T_FIXNUM
-	  search.  [ruby-talk:97342]
-
-Wed Apr 21 22:57:27 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* lib/rinda/rinda.rb, test/rinda/test_rinda.rb: check Hash tuple size.
-
-Wed Apr 21 20:05:00 2004  Tanaka Akira  <akr@m17n.org>
-
-	* lib/open-uri.rb (URI::HTTP#proxy_open): set Host: field explicitly.
-	  [ruby-list:39542]
-
-Mon Apr 19 18:11:15 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* hash.c (rb_hash_equal): returns true if two hashes have same set
-	  of key-value set.  [ruby-talk:97559]
-
-	* hash.c (rb_hash_eql): returns true if two hashes are equal and
-	  have same default values.
-
-Mon Apr 19 08:19:58 2004  Doug Kearns  <djkea2@mugca.its.monash.edu.au>
-
-	* dln.c, io.c, lib/benchmark.rb, lib/cgi.rb, lib/csv.rb, lib/date.rb,
-	  lib/ftools.rb, lib/getoptlong.rb, lib/logger.rb, lib/matrix.rb,
-	  lib/monitor.rb, lib/set.rb, lib/thwait.rb, lib/timeout.rb,
-	  lib/yaml.rb, lib/drb/drb.rb, lib/irb/workspace.rb, lib/net/ftp.rb,
-	  lib/net/http.rb, lib/net/imap.rb, lib/net/telnet.rb,
-	  lib/racc/parser.rb, lib/rinda/rinda.rb, lib/rinda/tuplespace.rb,
-	  lib/shell/command-processor.rb, lib/soap/rpc/soaplet.rb,
-	  lib/test/unit/testcase.rb, lib/test/unit/testsuite.rb: typo fix.
-
-Mon Apr 19 08:14:18 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::find_body): Allow for
-	  #ifdef HAVE_PROTOTYPES
-
-Fri Apr 16 22:33:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
-
-	* ext/iconv/iconv.c: nearly finished RDoc comments.
-
-Fri Apr 16 17:04:07 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* string.c (rb_str_equal): always returns true or false, never
-	  returns nil. [ruby-dev:23404]
-
-Fri Apr 16 08:27:02 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/extmk.rb: skip linking when libraries to be preloaded not
-	  compiled.  [ruby-list:39561]
-
-Thu Apr 15 23:21:52 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* process.c (pst_success_p): new method Process::Status#success?.
-	  [ruby-dev:23385]
-
-Thu Apr 15 17:12:13 2004  Tanaka Akira  <akr@m17n.org>
-
-	* ext/gdbm/gdbm.c (Init_gdbm): define GDBM::READER, GDBM::WRITER,
-	  GDBM::WRCREAT and GDBM::NEWDB.
-	  (fgdbm_initialize): use specified read/write flag.
-
-Wed Apr 14 11:29:56 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* numeric.c (flo_eq): workaround for bcc32's bug.
-	  (ruby-bugs-ja:PR#594)
-
-Wed Apr 14 13:06:35 2004  Doug Kearns  <djkea2@mugca.its.monash.edu.au>
-
-	* array.c, enum.c, eval.c, file.c, io.c, numeric.c, object.c, prec.c,
-	  process.c, re.c, string.c: typos in RDoc comments.  [ruby-core:02783]
-
-Wed Apr 14 11:06:38 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::scan): Changed
-	  behavior of :enddoc: -- it now unconditionally terminates
-	  processing of the current file.
-
-Wed Apr 14 11:03:22 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* defines.h: include <net/socket.h> to get fd_set definition in BeOS.
-
-Tue Apr 13 23:06:30 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* lib/rinda/rinda.rb: change pattern matching.
-	  a === b -> a == b || a === b. [druby-ja:98]
-
-	* test/rinda/test_rinda.rb: ditto.
-
-Tue Apr 13 19:54:29 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/net/http.rb: should not overwrite HTTP request header.
-	  [ruby-list:39543]
-
-Tue Apr 13 01:30:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
-
-	* ext/iconv/iconv.c: RDoc documentation (from RD; nearly finished).
-	* ext/iconv/charset_alias.rb: Prevent from RDoc'ing.
-
-Mon Apr 12 19:11:29 2004  Eric Hodel  <drbrain@segment7.net>
-
-	* gc.c (rb_gc_copy_finalizer): typo.  [ruby-core:02774]
-
-Mon Apr 12 18:52:32 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_x509name.c (ossl_x509name_init_i): should return
-	  a value.
-
-Mon Apr 12 10:43:47 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* dir.c (rb_glob2, rb_glob, rb_globi, push_globs, push_braces,
-	  rb_push_glob): fix memory leak. (leaked when block was interrupted)
-
-Mon Apr 12 10:27:37 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* bcc32/Makefile.sub: backport SIZEOF_TIME_T definition from 1.9.
-
-	* win32/Makefile.sub: ditto.
-
-	* wince/Makefile.sub: ditto.
-
-Sun Apr 11 19:12:35 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ruby.c (require_libraries): restore source file/line after
-	  statically linked extensions initialized.  [ruby-dev:23357]
-
-Sun Apr 11 10:47:04 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/code_objects.rb (RDoc::TopLevel::add_class_or_module): Toplevel
-	  classes and modules are a special case too... (handle extending existing
-	  classes with or without :enddoc:)
-
-Sat Apr 10 23:51:13 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/code_objects.rb (RDoc::Context::add_to): Implementation of :enddoc:
-	  made one too many assumptions...
-
-Sat Apr 10 00:00:19 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/markup/simple_markup/inline.rb: Fix problem
-	  with \_cat_<b>dog</b>
-
-Wed Apr  7 00:19:50 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* lib/rinda/rinda.rb: fix hash tuple bug.
-
-	* lib/rinda/tuplespace.rb: ditto.
-
-	* test/rinda/test_rinda.rb
-
-Tue Apr  6 18:24:18 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* io.c (rb_io_reopen): should use rb_io_check_io().
-
-Tue Apr  6 16:46:09 2004  Tanaka Akira  <akr@m17n.org>
-
-	* configure.in: check the size of time_t.
-
-	* time.c (time_add): new function.
-	  (time_plus): use time_add.
-	  (time_minus): use time_add.
-
-Tue Apr  6 13:21:30 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* ext/socket/socket.c (make_hostent): must return value.
-
-Tue Apr  6 00:05:30 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* lib/rinda/rinda.rb: add require 'drb/drb'
-
-Mon Apr  5 08:18:23 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/rdoc.rb: Remove leading ./ from file names so that cross
-	  references work properly.
-
-Sun Apr  4 20:33:42 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* eval.c (Init_load): make $LOADED_FEATURES built-in.
-	  [ruby-dev:23299]
-
-	* ruby.c (ruby_prog_init): make $PROGRAM_NAME built-in.
-
-	* lib/English.rb: remove $LOADED_FEATURES and $PROGRAM_NAME.
-
-Sun Apr  4 14:01:20 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/options.rb (Options::parse): Allow multiple -x options to RDoc.
-	  Fix bug where files weren't being excluded properly
-
-Sat Apr  3 17:11:05 2004  why the lucky stiff  <why@ruby-lang.org>
-
-	* ext/syck/syck.h: version 0.43.
-
-	* ext/syck/lib/gram.c: allow root-level inline collections.
-	 [ruby-talk:94922]
-
-	* lib/yaml/rubytypes.rb (Symbol#to_yaml): emit symbols as implicits.
-	 [ruby-talk:94930]
-
-	* ext/syck/bytecode.c: turn off default implicit typing.
-
-	* ext/syck/implicit.c: detect base60 integers.
-
-	* ext/syck/rubyext.c: handle base60, as well as hex and octal
-	  with commas.  implicit typing of ruby symbols.
-
-Fri Apr  2 17:27:17 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (top_include): include in the wrapped load is done for
-	  the wrapper, not for a singleton class for wrapped main.
-	  [ruby-dev:23305]
-
-Fri Apr  2 15:13:44 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* bignum.c (rb_big_eq): use temporary double variable to save the
-	  result (internal float register may be bigger than 64 bits, for
-	  example, 80 bits on x86).  [ruby-dev:23311]
-
-Fri Apr  2 14:35:26 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (block_pass): should generate unique identifier of the
-	  pushing block.  [ruby-talk:96363]
-
-Fri Apr  2 07:31:38 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* ext/socket/socket.c (make_hostent): fix memory leak, based on
-	  the patch from HORIKAWA Hisashi <vzw00011@nifty.ne.jp>.
-
-Thu Apr  1 22:55:33 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/parsers/parse_rb.rb: Allow rdoc comments in
-	  =begin rdoc/=end
-
-	* lib/rdoc/parsers/parse_rb.rb: Fix problem with comment in
-	  top-level method being taken as file comment.
-
-Thu Apr  1 22:55:04 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/ri/ri_options.rb: Fix undefined variable warning.
-
-Thu Apr  1 19:58:37 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/soap/mapping/{factory.rb,registry.rb}: fixed illegal mapped URI
-	  object with soap/marshal.
-	  added URIFactory class for URI mapping.  BasetypeFactory checks
-	  instance_variables when original mapping is not allowed (ivar must
-	  be empty).  Instance of URI have instance_variables but it must be
-	  llowed whenever original mapping is allowed or not.
-
-	* lib/xsd/datatypes.rb: check the smallest positive non-zero
-	  single-precision float exactly instead of packing with "f".
-	  [ruby-talk:88822]
-
-	* lib/soap/mapping/rubytypeFactory.rb: should not dump singleton class.
-	  [ruby-dev:22588]
-	  c = class << Object.new; class C; self; end; end; SOAPMarshal.dump(c)
-
-Wed Mar 31 19:06:23 2004  Tanaka Akira  <akr@m17n.org>
-
-	* time.c (year_leap_p): new function.
-	  (timegm_noleapsecond): ditto.
-	  (search_time_t): use timegm_noleapsecond instead of
-	  mktime for first guess.
-
-Wed Mar 31 12:04:04 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/delegate.rb (DelegateClass): define internal methods of the
-	  result class, but not metaclass of the caller.  [ruby-talk:96156]
-
-	* intern.h: provide proper prototypes.  [ruby-core:02724]
-
-	* ruby.h: missing.h is now prerequisite to intern.h.
-
-Tue Mar 30 20:25:34 2004  Tanaka Akira  <akr@m17n.org>
-
-	* time.c (search_time_t): limit guess range by mktime if it is
-	  available.  [ruby-dev:23274]
-
-Sun Mar 28 14:16:59 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/net/pop.rb (auth): failed when account/password include "%".
-	  [ruby-talk:95933]
-
-Sat Mar 27 21:40:41 2004  Tanaka Akira  <akr@m17n.org>
-
-	* lib/open-uri.rb: permit extra semicolon in content-type field.
-
-Sat Mar 27 10:40:48 2004  Tanaka Akira  <akr@m17n.org>
-
-	* (lib/pp.rb, lib/prettyprint.rb): define seplist in PP::PPMethods
-	  instead of PrettyPrint.
+	* process.c (redirect_close, parent_redirect_close): should not close
+	  reserved FD. It should be closed in the exec system call due to the
+	  O_CLOEXEC or FD_CLOEXEC flag. [Bug #11353] [ruby-core:69977]
 
-Thu Mar 25 23:28:52 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* process.c (close_unless_reserved): new function to close FD unless
+	  it is reserved for internal communication.
 
-	* time.c (time_overflow_p): backport 1.9 usec overflow function.
-	  (ruby-bugs PR#1307)
+	* thread_pthread.c (rb_reserved_fd_p): should check owner_process pid
+	  to avoid false positive in forked child process.
 
-Thu Mar 25 23:15:24 2004  Dave Thomas  <dave@pragprog.com>
+Wed Jul 15 18:31:18 2015  Eric Wong  <e@80x24.org>
 
-	* lib/rdoc/ri/ri_options.rb (RI::Options::show_version):
-	  Add --version option
+	* proc.c (proc_mark): remove redundant check
+	* vm.c (env_mark): ditto
 
-Thu Mar 25 04:16:18 2004  Dave Thomas  <dave@pragprog.com>
+Wed Jul 15 17:27:40 2015  Eric Wong  <e@80x24.org>
 
-	* lib/rdoc/ri/ri_options.rb (RI::Options): Add the --list-names option,
-	  which dumps our all known names
+	* iseq.c (iseq_mark): remove check for data pointer
+	* proc.c (binding_mark): ditto
+	* vm.c (rb_thread_mark): ditto
+	* vm_trace.c (tp_mark): ditto
 
-Thu Mar 25 03:57:47 2004  Dave Thomas  <dave@pragprog.com>
+Wed Jul 15 16:55:04 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/rdoc/ri/ri_util.rb (NameDescriptor::initialize): No longer
-	  allow nested classes to be designated using "."--you must
-	  now use "::"
+	* encoding.c (enc_autoload): drop dummy encoding flag from
+	  the loaded encoding index.  this flag is used only in this
+	  source.
 
-Thu Mar 25 02:00:18 2004  Dave Thomas  <dave@pragprog.com>
+Wed Jul 15 14:39:29 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/rdoc/generators/template/html/one_page_html.rb (Page):
-	  Fix to work with C modules.
+	* vm.c (vm_make_env_each): add comments about env layout.
+	  Do not use `i' to specify `new_ep'.
 
-Wed Mar 24 21:17:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
+	* vm.c (rb_proc_create, rb_vm_make_proc_lambda): envval is not used.
 
-	* lib/uri.rb: Documented (thanks Dmitry V. Sabanin).
-	* lib/uri/common.rb: Ditto.
-	* lib/uri/ftp.rb: Ditto.
-	* lib/uri/generic.rb: Ditto.
-	* lib/uri/http.rb: Ditto.
-	* lib/uri/https.rb: Ditto.
-	* lib/uri/ldap.rb: Ditto.
-	* lib/uri/mailto.rb: Ditto.
-	  (All backported from 1.9)
+Wed Jul 15 08:59:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Mar 24 18:48:26 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* gc.h (RUBY_MARK_UNLESS_NULL): evaluate the argument only once
+	  to get rid of inadvertent side effects.
 
-	* lib/mkmf.rb ($ruby, $topdir, $hdrdir): should not be affected by
-	  DESTDIR after installed.
+Wed Jul 15 02:53:11 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/mkmf.rb (RUBY): / is not recognized as path separator on
-	  nmake/bmake. [ruby-list:39388]
+	* vm_core.h, vm.c: remove rb_proc_t::envval because we can know it via
+	  rb_proc_t::block::ep.
 
-	* lib/mkmf.rb (init_mkmf): $INCFLAGS also should be lazy-evaluated.
+	  rb_vm_proc_envval(const rb_proc_t *proc) returns an Env object which
+	  the Proc object use.
 
-Wed Mar 24 12:32:56 2004  Dave Thomas  <dave@pragprog.com>
+	* proc.c: catch up this fix.
 
-	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::handle_class_module):
-	  Don't document methods if we don't know for sure the
-	  class or module.
+	* vm_dump.c (rb_vmdebug_proc_dump_raw): ditto.
 
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_class):
-	  Don't store documentation for singleton classes if we
-	  don't know the real class.
+Wed Jul 15 02:27:22 2015  Koichi Sasada  <ko1@atdot.net>
 
-Wed Mar 24 11:11:26 2004  Dave Thomas  <dave@pragprog.com>
+	* vm_core.h, vm.c: remove rb_env_t::prev_envval because we can know it
+	  via env->ep.
 
-	* lib/rdoc/generators/html_generator.rb (Generators::HTMLGenerator::load_html_template):
-	  Allow non-RDoc templates by putting a slash in the template name
+	  rb_vm_env_prev_envval(env) returns prev_envval via env->ep.
 
-Mon Mar 22 16:19:57 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* vm_core.h (rb_vm_env_local_variables): change parameter type
+	  from VALUE (T_DATA/env) to `const rb_env_t *' to make same as
+	  rb_vm_env_prev_envval().
 
-	* ruby.1: add -width option to .Bl for old groff.
+	* proc.c: catch up these changes.
 
-Sun Mar 21 21:11:16 2004  Keiju Ishitsuka  <keiju@ishitsuka.com>
+	* vm_dump.c: ditto.
 
-	* lib/shell/*: bug fix for Shell#system(command_line_string).
+	* vm.c: rename macros.
 
-Sat Mar 20 20:57:10 2004  David Black  <dblack@wobblini.net>
+	  * ENV_IN_HEAP_P() to VM_EP_IN_HEAP_P() because it uses ep.
+	  * ENV_VAL() to VM_ENV_EP_ENVVAL() because it is too short.
 
-	* lib/scanf.rb: Backported 1.9 branch
-	  modifications/corrections to 1.8 branch
+Wed Jul 15 01:09:09 2015  Koichi Sasada  <ko1@atdot.net>
 
-Sat Mar 20 23:51:03 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* vm.c: refactoring Proc/Env related code.
 
-	* eval.c (rb_require_safe): preserve old ruby_errinfo.
-	  [ruby-talk:95409]
+	* vm_core.h: remove blockprocval field from rb_proc_t and rb_binding_t.
+	  Instead of this field, mark given block in Proc at rb_env_t::env.
 
-	* eval.c (rb_f_raise): should not clear backtrace information if
-	  exception object already have one.
+	* vm.c (vm_make_env_each): make an Env object with this layout.
+	  And also simplify parameters.
 
-Sat Mar 20 15:25:36 2004  Dave Thomas  <dave@pragprog.com>
+	* proc.c: catch up this fix.
 
-	* lib/rdoc/generators/template/html/html.rb (RDoc::Page): Force
-	  page background to white.
+	* vm_core.h: remove rb_env_t::local_size because it is not used.
 
-Sat Mar 20 09:52:33 2004  Tadayoshi Funaba  <tadf@dotrb.org>
+	* vm_dump.c (rb_vmdebug_env_dump_raw): catch up this fix.
 
-	* lib/date.rb, lib/date/format.rb: _parse() now accepts fractional
-	  part of second minute that follows a comma or a full stop.
+	* vm_core.h (rb_vm_make_env_object): remove rb_vm_make_env_object()
+	  because it is only referred from vm.c.
 
-Fri Mar 19 01:55:57 2004  Mauricio Fernandez  <batsman.geo@yahoo.com>
+	* vm_eval.c (eval_string_with_cref): catch up this fix.
 
-	* io.c (rb_io_sync): need not to check writable. [ruby-core:02674]
+Wed Jul 15 00:03:36 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-Thu Mar 18 21:44:38 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+	* gc.c (__has_feature): move into internal.h.
 
-	* lib/drb/drb.rb: backport drb.rb 1.16.
+	* internal.h (__has_feature): ditto.
 
-Fri Mar 18 17:49:51 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* internal.h (__has_extension): new macro.
 
-	* struct.c (make_struct): allow const_id for accessor names.
-	  [ruby-core:04585]
+	* internal.h (STATIC_ASSERT): use _Static_assert with
+	  clang. [ruby-core:69931] [Bug #11343]
 
-	* eval.c (rb_attr): check if attribute name is local_id or
-	  const_id.
+Wed Jul 15 00:00:00 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-Thu Mar 18 16:22:38 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* random.c (fill_random_bytes_syscall): fix compile error with
+	  clang. [ruby-core:69931] [Bug #11343]
 
-	* eval.c (proc_eq): avoid false positive by using scope and
-	  dyna_vars.  no longer use frame.uniq.
+Tue Jul 14 11:22:42 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Mar 17 14:44:43 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* lib/webrick/utils.rb (WEBrick::Utils::TimeoutHandler#register):
+	  notify the handler thread of new timeout registration.
 
-	* dir.c (range): fix possible "\0" overrun. (in case of "\0-")
+	* lib/webrick/utils.rb (WEBrick::Utils::TimeoutHandler#initialize):
+	  make sleep intervals adaptive than fixed period intervals.
 
-Mon Mar 15 07:39:13 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/webrick/server.rb (WEBrick::GenericServer#start): flush
+	  shutdown pipe.
 
-	* eval.c (rb_yield_0): should not re-submit TAG_BREAK if this
-	  yield is not break destination. [ruby-dev:23197]
+	* lib/webrick/server.rb (WEBrick::GenericServer#stop): request the
+	  server to stop immediately by sending data via shutdown pipe.
 
-Sat Mar 13 14:28:16 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+Mon Jul 13 23:58:08 2015  Stefano Tortarolo  <stefano.tortarolo@gmail.com>
 
-	* test/drb/test_drbssl.rb: rescue LoadError. (Barkport from main
-	  trunk)
+	* lib/webrick/httpproxy.rb (WEBrick::HTTPProxyServer#do_CONNECT):
+	  fix typos in debugger statements.  [Fix GH-967]
 
-	* test/drb/test_drbunix.rb: ditto.
+Mon Jul 13 19:11:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Mar 10 22:28:09 2004  Minero Aoki  <aamine@loveruby.net>
+	* lib/timeout.rb (timeout): warn as deprecated for a long time.
 
-	* lib/fileutils.rb (remove_dir): should handle symlink correctly.
-	  This patch is contributed by Christian Loew.  [ruby-talk:94635]
-	  (Backport from main trunk)
+Mon Jul 13 01:37:27 2015  Zachary Scott  <zzak@ruby-lang.org>
 
-Wed Mar 10 16:28:42 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/openssl/ossl.c: [DOC] Backport ruby/openssl@dbb3fdb [Bug #11345]
+	  Thanks to Tomoya Chiba for the report and help with patch.
 
-	* eval.c (return_jump): set return value to the return
-	  destination.  separated from localjump_destination().
+Sun Jul 12 09:20:02 2015  Shota Fukumori  <her@sorah.jp>
 
-	* eval.c (break_jump): break innermost loop (or thread or proc).
+	* ext/socket/basicsocket.c: [DOC] typo (Errno::AGAIN -> Errno::EAGAIN)
 
-	* eval.c (rb_yield_0): set exit_value for block break.
+	* ext/socket/socket.c: ditto
 
-Wed Mar 10 15:58:43 2004  Ryan Davis  <ryand@zenspider.com>
+	* ext/socket/tcpserver.c: ditto
 
-	* eval.c (eval): Only print backtrace if generating the backtrace
-	  doesn't generate an exception.  [ruby-core:02621]
+	* ext/socket/udpsocket.c: ditto
 
-Tue Mar  9 13:04:26 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/socket/unixserver.c: ditto
 
-	* io.c (rb_io_ungetc): raise IOError instead of calling
-	  rb_sys_fail().  [ruby-talk:23181]
+	* io.c: ditto
 
-Mon Mar  8 19:32:28 2004  akira yamada  <akira@ruby-lang.org>
+Sun Jul 12 06:42:23 2015  ksss  <co000ri@gmail.com>
 
-	* lib/uri/common.rb (URI::REGEXP::PATTERN::HOSTPORT): (?:#{PORT})
-	  -> (?::#{PORT}).  [ruby-dev:23170]
+	* test/stringio/test_stringio.rb (test_sysread): add a test for
+	  StringIO#sysread.  [Fix GH-966]
 
-Mon Mar  8 15:31:41 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Sat Jul 11 21:16:34 2015  ksss  <co000ri@gmail.com>
 
-	* dir.c (range): treat incomplete '[' as ordinary character (like
-	  has_magic does).
+	* ext/stringio/stringio.c (Init_stringio): [DOC] Fix an example,
+	  StringIO#puts should be set "\n" at last.  [Fix GH-965]
 
-	* dir.c (range):  Cancel above change. More discussion is needed.
+Sat Jul 11 12:45:51 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Mar  7 22:37:46 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+	* lib/timeout.rb (Timeout#timeout): remove regexp with wrong line
+	  number and fix caller depth.
 
-	* test/drb/ut_drb.rb: use 'druby://localhost:0'. [ruby-dev:23078]
+Fri Jul 10 22:05:50 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/drb/ut_eval.rb: ditto.
+	* lib/timeout.rb (ExitException): removed internal exception class
+	  and use Timeout::Error instead, as using throw/catch to isolate
+	  each timeouts now.  [ruby-dev:49179] [Bug #11344]
 
-	* test/drb/ut_large.rb: ditto.
+Fri Jul 10 17:41:54 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/drb/ut_safe1.rb: ditto.
+	* dir.c (is_case_sensitive): get attributes by the file descriptor
+	  of open directory, instead of using mount point name.
 
-	* test/drb/ut_drb_drbssl.rb: use 'drbssl://localhost:0'.
+Fri Jul 10 10:46:02 2015  ksss  <co000ri@gmail.com>
 
-Sun Mar  7 16:22:26 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* ext/stringio/stringio.c (writable): remove unnecessary check for
+	  deprecated safe level 4.  [Fix GH-963]
 
-	* Makefile.in (lex.c): use $? instead of $<.
+Thu Jul  9 15:07:12 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Fri Mar  5 00:54:14 2004  Dave Thomas  <dave@pragprog.com>
+	* win32/win32.c (waitpid): return immediately if interrupted.
+	  reported by <takkanm AT gmail.com> [ruby-dev:49176] [Bug #11340]
 
-	* lib/test/unit.rb: MOve RDoc documentation so that you can
-	  now say 'ri Test::Unit'
+Thu Jul  9 13:03:46 2015  Koichi Sasada  <ko1@atdot.net>
 
-Tue Mar  2 12:32:59 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* vm_insnhelper.c (vm_search_super_method): use CI_SET_FASTPATH().
 
-	* win32/Makefile.sub, wince/Makefile.sub (config.h): shouldn't check
-	  defined? NORETURN. [ruby-dev:23100]
+Thu Jul  9 11:07:06 2015  Koichi Sasada  <ko1@atdot.net>
 
-Mon Mar  1 12:24:10 2004  Dave Thomas  <dave@pragprog.com>
+	* vm_core.h: remove rb_call_info_t::klass because
+	  rb_callable_method_entry_t has information about defined class.
 
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_alias):
-	  Allow aliases to have parentheses
+	* vm_insnhelper.c (vm_search_method): don't set ci->klass because
+	  it is removed.
 
-Sun Feb 29 23:14:53 2004  Dave Thomas  <dave@pragprog.com>
+	* vm_insnhelper.c (rb_equal_opt): ditto.
 
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_class):
-	  Handle :nodoc: on singleton classes.
+	* vm_insnhelper.c (vm_search_superclass): removed because it is too
+	  simple to write code directly.
 
-Sat Feb 28 10:58:49 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+	* vm_insnhelper.c (vm_defined): don't use vm_search_superclass().
+	  This fix avoid searching current callable `me' twice.
 
-	* MANIFEST: add test_erb.rb
+	* vm_insnhelper.c (vm_search_super_method): ditto.
 
-	* lib/erb.rb, test/erb/test_erb.rb: don't forget filename,
-	  if both filename and safe_level given. [ruby-dev:23050]
+Thu Jul  9 10:03:10 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Fri Feb 27 01:00:09 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+	* lib/net/http/responses.rb: Added 308 status to CODE_TO_OBJ list.
+	  [fix GH-961] Patch by @billinghamj
 
-	* lib/drb/drb.rb, test/drb/drbtest.rb: require drb/eq.rb by default
+Thu Jul  9 09:34:14 2015  Koichi Sasada  <ko1@atdot.net>
 
-Wed Feb 25 21:16:25 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* vm_core.h (rb_control_frame_t): fix comments (layout index).
 
-	* instruby.rb (with_destdir): should return the given argument if no
-	  DESTDIR is given.
+Thu Jul  9 09:25:50 2015  Zachary Scott  <e@zzak.io>
 
-	* instruby.rb: use path name expansion of cmd.exe.
+	* parse.y: Improve duplicate key warning with patch by @andremedeiros
+	  [Fix GH-938] https://github.com/ruby/ruby/pull/938 [Bug #11327]
 
-Wed Feb 25 09:35:22 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+Wed Jul  8 07:43:01 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* error.c (NameError::Message): new class for lazy evaluation of
-	  message to ensure replaced before marshalling. merge from HEAD.
-	  (ruby-bugs-ja:PR#588)
+	* lib/csv.rb: typo fix [ci skip][fix GH-958] Patch by @henrik
 
-	* eval.c (rb_method_missing): use NameError::Message. merge from
-	  HEAD. (ruby-bugs-ja:PR#588)
+Wed Jul  8 04:42:27 2015  Eric Wong  <e@80x24.org>
 
-Tue Feb 24 18:59:37 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+	* iseq.c (iseq_data_to_ary): dump kw_arg as symbol
+	* test/-ext-/iseq_load/test_iseq_load.rb: test kw_arg roundtrip
+	  [ruby-core:69891] [Bug #11338]
 
-	* dir.c (glob_helper): '**/' should not match leading period
-	  unless File::FNM_DOTMATCH is set. (like '*/') [ruby-dev:23014]
+Tue Jul  7 18:18:41 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-Tue Feb 24 13:22:21 2004  Dave Thomas  <dave@pragprog.com>
+	* random.c (fill_random_bytes_syscall): fix compile error.
 
-	* lib/rdoc/rdoc.rb (RDoc::RDoc::normalized_file_list): Attempt to get better
-	  heuristics on which files to include and exclude. Now only include
-	  non-standard files if they are explicitly named in ARGV.
+Tue Jul  7 16:47:30 2015  Eric Wong  <e@80x24.org>
 
-Tue Feb 24 07:23:30 2004  Dave Thomas  <dave@pragprog.com>
+	* compile.c (COMPILE_ERROR): reduce GET_THREAD() calls
 
-	* lib/rdoc/generators/html_generator.rb: Deal with :stopdoc: when
-	  choosing a default main page to display (ie. don't select a page
-	  if we don't have documentation for it).
+Tue Jul  7 16:39:04 2015  Eric Wong  <e@80x24.org>
 
-Tue Feb 24 06:40:14 2004  Dave Thomas  <dave@pragprog.com>
+	* random.c (fill_random_bytes_syscall): return -1 for error
+	* random.c (fill_random_bytes): try urandom on syscall failure
 
-	* lib/rdoc/parsers/parse_rb.rb (RubyLex::identify_identifier): Handle
-	  class variables in code listings
+Tue Jul  7 15:02:18 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Feb 24 06:40:14 2004  Dave Thomas  <dave@pragprog.com>
+	* file.c (rb_str_normalize_ospath): skip invalid byte sequence not
+	  to loop infinitely.  this case usually does not happen as the
+	  input name should come from real file systems.
 
-	* lib/rdoc/parsers/parse_rb.rb (RubyLex::identify_identifier): Handle
-	  class variables in code listings
+Tue Jul  7 14:40:08 2015  Koichi Sasada  <ko1@atdot.net>
 
-Tue Feb 24 06:32:27 2004  Dave Thomas  <dave@pragprog.com>
+	* vm_backtrace.c: remove debug flag introduced accidentally.
 
-	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::do_aliases): Handle
-	  aliases in C files.
+Tue Jul  7 12:05:37 2015  Koichi Sasada  <ko1@atdot.net>
 
-Tue Feb 24 06:16:22 2004  Dave Thomas  <dave@pragprog.com>
+	* cont.c (cont_free): remove mysterious fflush()
+	  introduced at r19890, maybe accidentally.
 
-	* lib/rdoc/rdoc.rb (RDoc::RDoc::document): Now create op dir _before_
-	  parsing files.
+Tue Jul  7 11:45:14 2015  Koichi Sasada  <ko1@atdot.net>
 
-Tue Feb 24 06:08:47 2004  Dave Thomas  <dave@pragprog.com>
+	* proc.c (rb_method_call): because data->me should be non-NULL,
+	  do not check data->me
 
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_constant):
-	  Start collecting text of constant values earlier: was missing
-	  values in output if there was no space after '='
+	* proc.c (method_inspect): ditto.
 
-Tue Feb 24 06:08:25 2004  Dave Thomas  <dave@pragprog.com>
+Tue Jul  7 11:37:25 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/rdoc/generators/html_generator.rb: Escape contant values.
+	* vm_core.h: remove rb_iseq_t::orig because rb_iseq_clone()
+	  no longer exists.
 
-Tue Feb 24 03:45:06 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* iseq.c: don't use rb_iseq_t::orig.
 
-	* ext/openssl/ossl_config.c (ossl_config_each): add new method
-	  OpenSSL::Config#each. it iterates with section name, field name
-	  and value.
+Tue Jul 07 11:25:57 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/openssl/ossl_config.c (Init_ossl_config): include Enumerable.
+	* iseq.c, internal.h (rb_iseq_clone): removed because we don't need to
+	  clone iseq any more.
 
-Mon Feb 23 09:16:35 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* class.c (clone_method): share iseq between cloned methods. All of
+	  method dependent information are able to refer from method entry.
 
-	* instruby.rb (DOSISH): embedded path in batch files should not be
-	  prefixed by DESTDIR.  [ruby-core:02186]
+Tue Jul  7 04:42:25 2015  Eric Wong  <e@80x24.org>
 
-Sun Feb 22 09:54:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
+	* string.c (Init_String): use rb_str_freeze for String#freeze
+	  to resize internal buffer
+	  [ruby-core:69870] [Feature #11330]
 
-	* re.c: corrected documentation format (again)
+Tue Jul  7 04:12:32 2015  Koichi Sasada  <ko1@atdot.net>
 
-Sun Feb 22 09:43:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
+	* vm.c (vm_define_method): remove an unused local variable.
 
-	* re.c: corrected documentation format (rb_reg_initialize_m)
+Tue Jul  7 03:57:28 2015  Koichi Sasada  <ko1@atdot.net>
 
-Sat Feb 21 22:36:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
+	* vm_core.h: remove rb_iseq_t::defined_method_id because it is not
+	  needed.
 
-	* ext/zlib/zlib.c: documented, but needs more effort.
+	* eval.c (frame_func_id): simplify. rb_callable_method_entry_t
+	  has enough information.
 
-Sat Feb 21 11:12:15 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* eval.c (frame_called_id): ditto.
 
-	* missing/os2.c, missing/x68.c: typo fix.  pointed out by greentea.
+	* iseq.c (prepare_iseq_build): catch up this fix.
 
-Fri Feb 20 18:59:47 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* proc.c (rb_mod_define_method): ditto.
 
-	* lib/irb/init.rb (IRB::IRB.parse_opts): add -I option to
-	  irb. [ruby-dev:39243]
+	* vm.c (vm_define_method): ditto.
 
-Thu Feb 19 23:24:16 2004  Dave Thomas  <dave@pragprog.com>
+Tue Jul  7 03:47:26 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/rdoc/generators/html_generator.rb (Generators::HtmlClass::build_attribute_list):
-	  Support visibility modifiers for attributes
+	* vm_core.h: remove a useless declaration.
 
-Thu Feb 19 23:24:16 2004  Dave Thomas  <dave@pragprog.com>
+Tue Jul  7 03:33:20 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/rdoc/generators/html_generator.rb (Generators::HtmlClass::build_attribute_list):
-	  Support visibility modifiers for attributes
+	* vm_core.h: remove rb_iseq_t::klass to reduce dynamic data.
 
-Thu Feb 19 22:39:04 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* internal.h, iseq.c (rb_iseq_klass): remove it because
+	  rb_iseq_t::klass is removed.
 
-	* test/rinda/test_rinda.rb: DRb.start_service only once in testsuites.
-	  DRb.start_service could handle this.
+	* vm_insnhelper.c (vm_super_outside): do not see cfp->iseq, but
+	  check callable method entry on a frame.
+	  This fix simplify the logic to search super class.
 
-Thu Feb 19 22:19:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
+	* test/ruby/test_method.rb: support super() from Proc.
+	  Now, [Bug #4881] and [Bug #3136] was solved.
 
-	* lib/ostruct.rb: documented
+	* proc.c (rb_mod_define_method): catch up this change.
 
-Thu Feb 19 21:28:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
+	* vm.c (vm_define_method): ditto.
 
-	* ext/strscan/strscan.c: improved documentation
+	* vm_backtrace.c (rb_profile_frames): now, each `frame' objects
+	  are rb_callable_method_entry_t data or iseq VALUEs.
 
-Thu Feb 19 03:10:52 2004  Minero Aoki  <aamine@loveruby.net>
+	  This fix introduce minor compatibility issue that
+	  rb_profile_frame_label() always returns
+	  rb_profile_frame_base_label().
 
-	* ext/strscan/strscan.c: synchronized with main trunk (rev 1.11).
+	* test/-ext-/debug/test_profile_frames.rb: catch up this change.
 
-Thu Feb 19 02:30:34 2004  Minero Aoki  <aamine@loveruby.net>
+Tue Jul  7 01:52:14 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/strscan/strscan.c: documentation checked.
+	* cont.c (fiber_init): initialize control frame correctly.
+	  This fix does not affect any ordinal execution, but
+	  affects debug prints.
 
-Thu Feb 19 00:11:05 2004  Dave Thomas  <dave@pragprog.com>
+Mon Jul  6 17:59:05 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/rdoc/markup/simple_markup/preprocess.rb (SM::PreProcess::handle):
-	  Strip extraneous space from filenames in :include:
+	* vm_insnhelper.c (vm_search_super_method): do not skip calling
+	  same methods in super.
+	  [Bug #3351]
 
-Wed Feb 18 22:52:00 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+	* test/ruby/test_super.rb: fix a test.
 
-	* lib/drb/unix.rb: remove O_NONBLOCK, thanks \ay
+Mon Jul  6 17:59:11 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Wed Feb 18 22:47:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
+	* ext/tk/tcltklib.c: removed deprecated safe level.
 
-	* ext/strscan/strscan.c: documented
+Mon Jul  6 17:16:37 2015  Koichi Sasada  <ko1@atdot.net>
 
-Wed Feb 18 22:03:11 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* method.h, proc.c (rb_method_entry_location): make it static
+	  and remove prefix `rb_' because it is used only in proc.c.
 
-	* test/*: should not depend on $KCODE.
+Mon Jul  6 16:42:10 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Wed Feb 18 17:18:01 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* test/lib/memory_status.rb: removed redundant path.
 
-	* ext/win32ole/win32ole.c: need to include <olectl.h> on Cygwin.
+Mon Jul  6 01:18:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Feb 18 10:40:38 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/lib/test/unit/parallel.rb: make @@project_dir one level
+	  upper as this file had moved one level deeper.
 
-	* sprintf.c (rb_f_sprintf): do not prepend dots for negative
-	  numbers if FZERO is specified.  [ruby-list:39218]
+Sun Jul  5 23:54:10 2015  mizokami  <suzunatsu@yahoo.com>
 
-Tue Feb 17 23:40:34 2004  Guy Decoux  <ts@moulon.inra.fr>
+	* lib/optparse.rb: [DOC] Fix typo.
 
-	* sprintf.c (rb_f_sprintf): preserve original val for
-	  format_integer. [ruby-talk:92975]
+Sun Jul  5 18:25:37 2015  Eric Wong  <e@80x24.org>
 
-Tue Feb 17 23:28:45 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* gc.c (gc_profile_record_get): fix spelling error in keys
 
-	* test/ruby/marshaltestlib.rb: common marshal testcase added.
+Sun Jul  5 14:49:01 2015  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
 
-	* test/ruby/test_marshal.rb: use above testsuite.
+	* README.md: fix a typo pointed out by raoulvdberge.
+	  https://github.com/ruby/ruby/pull/953#commitcomment-11998186
 
-	* test/soap/marshal/test_marshal.rb: ditto.
+Sun Jul  5 12:56:20 2015  Irvi Firqotul Aini  <viarc7@gmail.com>
 
-	* test/soap/marshal/cmarshal.rb: removed (not used).
+	* README.md: Added link HowToReport bugs.
 
-Tue Feb 17 10:51:23 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+Sun Jul  5 10:51:48 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/syck/rubyext.c (syck_emitter_end_object): takes only one arg.
+	* array.c (rb_ary_sort_bang): the original array may not be
+	  embedded even if a substitution array is embedded, as it is
+	  embedded when the original array is short enough but not
+	  embedded.  [ruby-dev:49166] [Bug #11332]
 
-Tue Feb 17 01:35:28 2004  Tanaka Akira  <akr@m17n.org>
+Sun Jul  5 09:31:40 2015  Eric Wong  <e@80x24.org>
 
-	* eval.c (rb_eval): care that another thread replace NODE_DREGX_ONCE
-	  to NODE_LIT.  [ruby-dev:22920]
+	* test/ruby/test_process.rb: test for fd=3 usability in child
 
-Tue Feb 17 01:24:35 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Jul  4 19:43:31 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* bcc32/Makefile.sub, win32/Makefile.sub (config.h): define
-	  STACK_GROW_DIRECTION. [ruby-dev:22910]
+	* Add test case for empty array and first method with args.
+	  Patch by @yui-knk [fix GH-955]
 
-	* bcc32/Makefile.sub (config.h): add newer checks.
+Sat Jul  4 19:39:08 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* wince/Makefile.sub (config.h): define NEED_IO_SEEK_BETWEEN_RW.
+	* Add test for `Enumerable#sort` with block. Patch by @yui-knk
+	  [fix GH-954]
 
-Tue Feb 17 00:38:10 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+Sat Jul  4 14:38:43 2015  Eric Wong  <e@80x24.org>
 
-	* lib/rinda/tuplespace.rb: TupleSpace#initialize, stop doubling timeout
+	* enum.c (zip_ary): remove volatile, use RB_GC_GUARD
+	  (zip_i): ditto
 
-Tue Feb 17 00:18:03 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+Sat Jul  4 10:42:57 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/rinda/test_rinda.rb: import test_rinda.rb
+	* lib/rubygems/test_case.rb (teardown): do not delete features
+	  loaded from the original load paths, the same libraries should
+	  be loaded again when the same features are required.
+	  [ruby-dev:49031] [Bug #11222]
 
-Tue Feb 17 00:14:30 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+Sat Jul  4 09:38:52 2015  Eric Wong  <e@80x24.org>
 
-	* bcc32/Makefile.sub: avoid warning "Redefinition of macro
-	  'HAVE_GETLOGIN'".
+	* vm.c (rb_vm_mark): reduce branches for always-set VM fields
+	  (rb_vm_add_root_module): ditto
 
-	* vms/config.h_in: ditto.
+Fri Jul 03 20:05:10 2015  Koichi Sasada  <ko1@atdot.net>
 
-Mon Feb 16 23:28:14 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* method.h: introduce rb_callable_method_entry_t to remove
+	  rb_control_frame_t::klass.
+	  [Bug #11278], [Bug #11279]
 
-	* lib/csv.rb: document reduction.  [ruby-core:02429]
+	  rb_method_entry_t data belong to modules/classes.
+	  rb_method_entry_t::owner points defined module or class.
 
-Mon Feb 16 22:08:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
-
-	* lib/generator.rb: corrected doc format
-	* lib/rinda/rinda.rb: added documentation (from Hugh Sasse)
-	* lib/rinda/tuplespace.rb: ditto
-
-Mon Feb 16 20:41:32 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* bcc32/Makefile.sub: show more warnings. (refering to mingw)
-
-	* bcc32/setup.mak: ditto.
-
-Mon Feb 16 13:39:44 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* dir.c (rb_glob, rb_globi): add const.
-
-	* ruby.h: ditto.
-
-Mon Feb 16 02:16:33 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* bcc32/Makefile.sub: should warn suspicious pointer conversion.
-
-	* bcc32/setup.mak: ditto.
-
-Sun Feb 15 19:06:42 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* lib/rinda/tuplespace.rb: TupleSpace#read(tpl, 0), raise
-	  RequestExpiredError if not found.
-
-Sun Feb 15 15:56:46 2004  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
-
-	* ext/win32ole/win32ole.c: add IDispatch wrapper in val2variant.
-	  Thanks, arton.
-
-Sun Feb 15 01:46:05 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/mkmf.rb: absolute path of ruby is assigned to $(RUBY).
-	  [ruby-dev:22870]
-
-Sat Feb 14 11:29:41 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* sample/drb/*: import lib/drb/sample
-
-Sat Feb 14 11:08:23 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* lib/drb/drb.rb: add pretty_print, thanks gotoken.
-
-Fri Feb 13 12:35:08 2004  Minero Aoki  <aamine@loveruby.net>
-
-	* test/fileutils/test_fileutils.rb: File.link may raise EINVAL and
-	  EACCES on Windows.
-
-Thu Feb 12 21:45:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
-
-	* lib/ftools.rb: documented
-
-Thu Feb 12 21:25:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
-
-	* lib/base64.rb: backported from HEAD (modularised and documented)
-
-Thu Feb 12 20:31:48 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/mkmf.rb (create_tmpsrc): cpp32 of Borland C++ ignores #error
-	  directives in DOS line-ending files at all.
-
-Thu Feb 12 02:23:56 2004  Tanaka Akira  <akr@m17n.org>
-
-	* lib/pathname.rb: use assert_raise instead of assert_raises.
-
-	* lib/pp.rb: ditto.
-
-	* lib/time.rb: ditto.
-
-	* lib/tsort.rb: ditto.
-	  use TSortHash and TSortArray instead of Hash and Array in test.
-
-Wed Feb 11 20:01:12 2004  akira yamada  <akira@ruby-lang.org>
-
-	* test/ruby/test_file.rb (TestFile::test_fnmatch): added tests for
-	  File.fnmatch. [ruby-dev:22815][ruby-dev:22819]
-
-	* test/ruby/test_proc.rb (TestProc::test_eq): added a
-	  test.  [ruby-dev:22599]
-
-	* test/ruby/test_proc.rb (TestProc::test_eq): added tests for
-	   Proc#==.  [ruby-dev:22592], [ruby-dev:22601]
-
-Tue Feb 10 16:43:56 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (umethod_bind): purge unused check.  [ruby-dev:22850]
-
-Mon Feb  9 17:16:00 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* lib/rdoc/parsers/parse_c.rb: escape '{' and '}' to avoid warnings.
-
-Mon Feb  9 13:00:55 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
-
-	* dir.c (fnmatch): File.fnmatch('*?', 'a') should return true.
-	  [ruby-dev:22815]
-
-	* dir.c (fnmatch): File.fnmatch('\[1\]' , '[1]') should return true.
-	  [ruby-dev:22819]
-
-Sun Feb  8 16:46:13 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/pp.rb (PP::PPMethods::object_address_group): suppress negative
-	  sign for higher heap areas.
-
-Fri Feb  6 22:48:16 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/generators/html_generator.rb (gen_url): Support
-	  https in RDoc hyperlinks
-
-Fri Feb  6 22:41:22 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/pp.rb (PPInspectTest#test_to_s_with_iv): rollback the previous
-	  commit.  [ruby-dev:22813]
-
-Fri Feb  6 22:22:50 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/pp.rb (PPInspectTest#test_to_s_with_iv): remove instance
-	  variable which is defined in the test.
-
-Fri Feb  6 00:48:37 2004  Tanaka Akira  <akr@m17n.org>
-
-	* lib/prettyprint.rb (PrettyPrint#first?): obsoleted.
-
-Thu Feb  5 23:56:55 2004  Tanaka Akira  <akr@m17n.org>
-
-	* lib/prettyprint.rb (PrettyPrint#seplist): added.
-
-	* lib/pp.rb (PPMethods#pp_object): use seplist.
-	  (PPMethods#pp_hash): ditto.
-	  (Array#pretty_print): ditto.
-	  (Struct#pretty_print): ditto.
-	  (MatchData#pretty_print): ditto.
-
-	* lib/set.rb (Set#pretty_print): use seplist.
-
-Wed Feb  4 02:12:06 2004  Tanaka Akira  <akr@m17n.org>
-
-	* file.c (test_l): fix wrong method name in document.
-	  (test_S): ditto.
-	  (test_b): ditto.
-	  (test_c): ditto.
-	  (test_suid): ditto.
-	  (test_sgid): ditto.
-	  (test_sticky): ditto.
-
-Tue Feb  3 08:04:57 2004  Tanaka Akira  <akr@m17n.org>
-
-	* lib/pp.rb (Struct#pretty_print_cycle): follow 1.8 style.
-
-Mon Feb  2 19:33:49 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* configure.in: backport from 1.9 for Interix.
-
-	* dln.c (dln_load): ditto.
-
-Mon Feb  2 13:31:51 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* lib/net/http.rb (canonical_each): fix merge miss.
-
-Mon Feb  2 01:54:00 2004  Tanaka Akira  <akr@m17n.org>
-
-	* lib/pp.rb (Struct#pretty_print): make it 1.8 style.
-	  (Numeric#pretty_print, FalseClass#pretty_print)
-	  (TrueClass#pretty_print, Module#pretty_print): fix pp for objects
-	  with instance variables.  [ruby-talk:91157]
-
-	* lib/open-uri.rb (URI::Generic#find_proxy): return nil on loopback
-	  address.
-
-	* lib/resolv-replace.rb (BasicSocket#send): don't replace because
-	  it has no hostname argument.
-	  (IPSocket.getaddress): raise SocketError instead of
-	  Resolv::ResolvError for errors.
-	  (TCPSocket#initialize, UDPSocket#bind, UDPSocket#connect)
-	  (SOCKSSocket#initialize): use IPSocket.getaddress instead of
-	  Resolv.getaddress.
-	  (UDPSocket#send): recognize 3 arguments form.  try all addresses on
-	  4 arguments form.
-
-Sun Feb  1 18:17:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
-
-	* lib/net/http.rb: merged coding style changes from HEAD.
-
-Sun Feb  1 16:15:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
-
-	* lib/test/unit.rb: rearranged documentation for RDoc's sake.
-	* lib/matrix.rb: improved documentation.
-	* lib/net/http.rb: slight documentation formatting improvement.
-
-Sun Feb  1 05:30:06 2004  Tanaka Akira  <akr@m17n.org>
-
-	* lib/open-uri.rb (URI::Generic#find_proxy): warn HTTP_PROXY.
-	 raise an errror on non-http proxy URI.
-	 (OpenURI::Buffer#<<): make a tempfile binmode.  [ruby-talk:90793]
-
-Sat Jan 31 09:20:32 2004  NAKAMURA, Hiroshi  <nakahiro@sairon.co.jp>
-
-	* sample/openssl/gen_csr.rb: wrong usage string.
-
-Sat Jan 31 01:00:32 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/soap/wsdlDriver.rb, lib/wsdl/soap/operation.rb: add support of
-	  "parts" attribute of soap:body element in WSDL.
-
-	* lib/wsdl/xmlSchema/schema.rb: friendly warning message for
-	  simpleType element which is not supported for now.
-
-	* lib/soap/mapping/factory.rb: deleted unused methods.
-
-	* lib/soap/mapping/rubytypeFactory.rb: do no ignore case while xsi:type
-	  string <-> Ruby class name matching.
-
-	* test/wsdl/soap/{soapbodyparts.wsdl,test_soapbodyparts.wsdl}: new
-	  files.
-
-Thu Jan 29 23:56:00 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* util.c (mblen): fix overrun.  [ruby-dev:22672]
-
-Thu Jan 29 22:41:53 2004  Dave Thomas  <dave@pragprog.com>
-
-	* lib/rdoc/generators/html_generator.rb: Allow 'link:' in Tidylinks.
-	  THis means you can write "see f1[link:files/f1_rb.html]".
-
-Thu Jan 29 15:33:23 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_x509hame.c (ossl_x509name_initialize): change
-	  second argument. it expected to be a Hash not an Integer.
-
-	* ext/openssl/ossl_x509name.c (ossl_x509name_add_entry): add new
-	  function for OpenSSL::X509::Name#add_entry.
-
-	* ext/openssl/ossl_x509name.c (ossl_x509name_to_a): append ASN.1
-	  tag number to each element of return value.
-
-	* ext/openssl/ossl_x509name.c (Init_ossl_x509name): add constants
-	  OpenSSL::X509::Name::DEFAULT_OBJECT_TYPE and OBJECT_TYPE_TEMPLATE.
-
-	* ext/openssl/lib/openssl/x509.rb (OpenSSL::X509::Name#initialize):
-	  second argument takes OBJECT_TYPE_TEMPLATE by default.
-
-	* sample/openssl/gen_csr.rb: use OpenSSL::X509::Name.parse.
-
-Wed Jan 28 04:29:41 2004  Eric Schwartz  <emschwar@fc.hp.com>
+	    module M
+	      def foo; end
+	    end
 
-	* lib/cgi/session.rb: use LOCK_SH to read, and a few other
-	  improvements.  [ruby-core:02328]
+	  In this case, owner is M.
 
-Tue Jan 27 11:09:29 2004  FUKUMOTO Atsushi  <fukumoto@nospam.imasy.or.jp>
+	  rb_callable_method_entry_t data belong to only classes.
+	  For modules, MRI creates corresponding T_ICLASS internally.
+	  rb_callable_method_entry_t can also belong to T_ICLASS.
 
-	* ext/socket/socket.c (s_recvfrom): sending length should be an
-	  invariant while retrying on EAGAIN.  [ruby-talk:89962]
+	  rb_callable_method_entry_t::defined_class points T_CLASS or
+	  T_ICLASS.
+	  rb_method_entry_t data for classes (not for modules) are also
+	  rb_callable_method_entry_t data because it is completely same data.
+	  In this case, rb_method_entry_t::owner == rb_method_entry_t::defined_class.
 
-Tue Jan 27 10:35:18 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+	  For example, there are classes C and D, and includes M,
 
-	* ext/win32ole/win32ole.c (set_argv): fix condition.
+	    class C; include M; end
+	    class D; include M; end
 
-Tue Jan 27 02:26:31 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	  then, two T_ICLASS objects for C's super class and D's super class
+	  will be created.
 
-	* lib/webrick/httputils.rb (WEBrick:HTTPUtils::parse_header):
-	  refine regex for header-name.
+	  When C.new.foo is called, then M#foo is searched and
+	  rb_callable_method_t data is used by VM to invoke M#foo.
 
-Tue Jan 27 00:30:11 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+	  rb_method_entry_t data is only one for M#foo.
+	  However, rb_callable_method_entry_t data are two (and can be more).
+	  It is proportional to the number of including (and prepending)
+	  classes (the number of T_ICLASS which point to the module).
 
-	* win32/Makefile.sub: rollback.
+	  Now, created rb_callable_method_entry_t are collected when
+	  the original module M was modified. We can think it is a cache.
 
-Mon Jan 26 22:53:04 2004  Dave Thomas  <dave@pragprog.com>
+	  We need to select what kind of method entry data is needed.
+	  To operate definition, then you need to use rb_method_entry_t.
 
-	* io.c: Remove documentation references to $defout.
+	  You can access them by the following functions.
 
-Mon Jan 26 15:11:47 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+	  * rb_method_entry(VALUE klass, ID id);
+	  * rb_method_entry_with_refinements(VALUE klass, ID id);
+	  * rb_method_entry_without_refinements(VALUE klass, ID id);
+	  * rb_resolve_refined_method(VALUE refinements, const rb_method_entry_t *me);
 
-	* sample/exyacc.rb: escape '}' to avoid warning.
+	  To invoke methods, then you need to use rb_callable_method_entry_t
+	  which you can get by the following APIs corresponding to the
+	  above listed functions.
 
-Mon Jan 26 14:41:46 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	  * rb_callable_method_entry(VALUE klass, ID id);
+	  * rb_callable_method_entry_with_refinements(VALUE klass, ID id);
+	  * rb_callable_method_entry_without_refinements(VALUE klass, ID id);
+	  * rb_resolve_refined_method_callable(VALUE refinements, const rb_callable_method_entry_t *me);
 
-	* lib/delegate.rb (Delegator::initialize): preserve
-	  singleton_method_added method [ruby-dev:22685]
+	  VM pushes rb_callable_method_entry_t, so that rb_vm_frame_method_entry()
+	  returns rb_callable_method_entry_t.
+	  You can check a super class of current method by
+	  rb_callable_method_entry_t::defined_class.
 
-	* lib/delegate.rb (Delegator::initialize): use Kernel::raise
-	  instead of mere raise.  [ruby-dev:22681]
+	* method.h: renamed from rb_method_entry_t::klass to
+	  rb_method_entry_t::owner.
 
-Mon Jan 26 12:47:17 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* internal.h: add rb_classext_struct::callable_m_tbl to cache
+	  rb_callable_method_entry_t data.
 
-	* ext/tcltklib/tcltklib.c: define CONST84 when TCL_MAJOR_VERSION == 7
+	  We need to consider about this field again because it is only
+	  active for T_ICLASS.
 
-Mon Jan 26 11:35:23 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* class.c (method_entry_i): ditto.
 
-	* ext/extmk.rb: Makefiles should depend on also rbconfig.rb.
-	  (ruby-bugs:PR#1256)
+	* class.c (rb_define_attr): rb_method_entry() does not takes
+	  defined_class_ptr.
 
-	* ext/win32ole/win32ole.c (set_argv): set real arguments to
-	  WIN32OLE::ARGV.  [ruby-list:39073]
+	* gc.c (mark_method_entry): mark RCLASS_CALLABLE_M_TBL() for T_ICLASS.
 
-Thu Jan 22 22:54:53 2004  Shugo Maeda  <shugo@ruby-lang.org>
+	* cont.c (fiber_init): rb_control_frame_t::klass is removed.
 
-	* lib/net/imap.rb (BEG_REGEXP): allow 8-bit characters in quoted
-	  strings for Novell GroupWise Internet Agent.
-	* lib/net/imap.rb (DATA_REGEXP): ditto.
+	* proc.c: fix `struct METHOD' data structure because
+	  rb_callable_method_t has all information.
 
-Thu Jan 22 16:21:33 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* vm_core.h: remove several fields.
+	  * rb_control_frame_t::klass.
+	  * rb_block_t::klass.
 
-	* parse.y (string_content): reset lexical states at the beginning of
-	  string contents.  [ruby-list:39061]
+	  And catch up changes.
 
-Wed Jan 21 21:55:51 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+	* eval.c: catch up changes.
 
-	* lib/drb/drb.rb: remove O_NONBLOCK, thanks \ay
-	* lib/drb/extserv.rb: typo
+	* gc.c: ditto.
 
-Wed Jan 21 17:57:56 2004  Shugo Maeda  <shugo@ruby-lang.org>
+	* insns.def: ditto.
 
-	* lib/net/imap.rb (envelope): allow NIL.
-	* lib/net/imap.rb (body): ditto.
-	* lib/net/imap.rb (number): ditto.
-	* lib/net/imap.rb (ensure_nz_number): show a detailed error
-	  message.
+	* vm.c: ditto.
 
-Wed Jan 21 16:44:20 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* vm_args.c: ditto.
 
-	* lib/mkmf.rb (merge_libs): squeeze successive same libraries.
-	  [ruby-dev:22652]
+	* vm_backtrace.c: ditto.
 
-Wed Jan 21 16:01:37 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* vm_dump.c: ditto.
 
-	* ext/digest/rmd160/extconf.rb: have_library appends found library.
+	* vm_eval.c: ditto.
 
-Wed Jan 21 11:36:00 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* vm_insnhelper.c: ditto.
 
-	* parse.y (block_append): update nd_end for "real" head node.
-	  [ruby-list:39058]
+	* vm_method.c: ditto.
 
-Tue Jan 20 14:48:13 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Fri Jul  3 14:30:18 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/openssl/extconf.rb: should check <openssl/conf_api.h> instead
-	  of OPENSSL_VERSION_NUMBER. [ruby-list:39056]
+	* win32/file.c: some mingw compilers need a tweek for the
+	  declarations of _wfreopen_s.  [Bug #11320]
 
-Tue Jan 20 14:43:17 2004  Dave Thomas  <dave@pragprog.com>
+Fri Jul  3 12:25:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/base64.rb: Add RDoc
+	* transcode.c (rb_econv_set_replacement): target encoding name can
+	  be empty now.  [ruby-core:69841] [Bug #11324]
 
-Tue Jan 20 14:25:51 2004  Dave Thomas  <dave@pragprog.com>
+Fri Jul  3 07:21:06 2015  Eric Wong  <e@80x24.org>
 
-	* lib/abbrev.rb: Add RDoc
+	* benchmark/bm_io_nonblock_noex.rb: new benchmark
+	* ext/openssl/ossl_ssl.c (no_exception_p): new function
+	  (ossl_start_ssl): adjust for no_exception_p
+	  (ossl_ssl_connect): adjust ossl_start_ssl call
+	  (ossl_ssl_connect_nonblock): ditto
+	  (ossl_ssl_accept): ditto
+	  (ossl_ssl_accept_nonblock): ditto
+	  (ossl_ssl_read_internal): adjust for no_exception_p
+	  (ossl_ssl_write_internal): ditto
+	  (ossl_ssl_write): adjust ossl_write_internal call
+	  (ossl_ssl_write_nonblock): ditto
+	* ext/stringio/stringio.c (strio_read_nonblock):
+	  delay exception check
+	* io.c (no_exception_p): new function
+	  (io_getpartial): call no_exception_p
+	  (io_readpartial): adjust for io_getpartial
+	  (get_kwargs_exception): remove
+	  (io_read_nonblock): adjust for io_getpartial,
+	  check no_exception_p on EOF
+	  (io_write_nonblock): call no_exception_p
+	  (rb_io_write_nonblock): do not check `exception: false'
+	  (argf_getpartial): adjust for io_getpartial
+	  [ruby-core:69778] [Feature #11318]
 
-Tue Jan 20 13:22:39 2004  Dave Thomas  <dave@pragprog.com>
+Fri Jul  3 07:13:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/rdoc/generators/html_generator.rb: Document aliases at
-	  top-most level.
+	* dir.c (replace_real_basename): Win32 API does not set errno, get
+	  the last error by GetLastError() and map to errno.  [Bug #10015]
 
-	* lib/English.rb: Document English.rb.
+Thu Jul  2 21:32:06 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Jan 20 02:49:22 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* dir.c (replace_real_basename): show warnings at errors.
+	  [Bug #10015]
 
-	* ext/openssl/extconf.rb: add check for OpenSSL version.
-	  [ruby-list:39054]
+Thu Jul  2 18:39:20 2015  Koichi Sasada  <ko1@atdot.net>
 
-Tue Jan 20 02:38:13 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* gc.c: remove `#define RGENGC_OBJ_INFO 1' line introduced to
+	  debug Bug #11244.
 
-	* marshal.c (w_class): should not dump singleton class.
-	  [ruby-dev:22631]
+Thu Jul  2 18:34:26 2015  Koichi Sasada  <ko1@atdot.net>
 
-Tue Jan 20 01:31:36 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* gc.c (rb_raw_obj_info): separated from rb_obj_info().
+	  Fill internal object information into passed buffer.
 
-	* io.c (lineno): typo fix(FIX2INT -> INT2FIX).
+	* gc.h: declare rb_raw_obj_info().
 
-Mon Jan 19 21:53:38 2004  akira yamada  <akira@ruby-lang.org>
+Thu Jul  2 16:15:04 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* io.c, re.c, string.c, time.c: fixed up positions of RDocs.
+	* dir.c (replace_real_basename): update path type by the target
+	  attributes if possible, to improve the performance.  [Bug #10015]
 
-Mon Jan 19 07:09:20 2004  Tadayoshi Funaba  <tadf@dotrb.org>
+Thu Jul  2 14:45:53 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/date.rb: zone was wrong when it was behind UTC.
-	  Thanks Mark J. Reed.
+	* st.c: get rid of VC++'s warnings of C4700 (uninitialized local
+	  variable used).  I think that these are wrong, but should shut them
+	  up.
 
-	* lib/date/format.rb: %z is now always replaced by four digits
-	  with a leading plus or minus sign.
+Thu Jul  2 14:15:50 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* sample/cal.rb: added a class, anyway.
+	* lib/rubygems.rb (Gem.load_path_insert_index): search
+	  @gem_prelude_index first.
 
-Sun Jan 18 20:47:35 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* lib/rubygems/test_case.rb (Gem::TestCase#setup): keep already
+	  expanded paths to preserve instance variables.
 
-	* ruby.c: use translate_char() on Cygwin.
+Thu Jul  2 14:12:01 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Jan 18 02:33:26 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* ruby.c (process_options): also copy initial load path marks at
+	  setting load paths encoding.
 
-	* defines.h (_WIN32): undef _WIN32 on Cygwin before defining DOSISH.
+Thu Jul  2 12:26:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Jan 18 00:23:55 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/rubygems/test_gem_server.rb (process_based_port): use
+	  dynamically chosen port numbers to get rid of conflicts.
 
-	* marshal.c (class2path): check anonymous class/module before
-	  checking referable, and allow singleton classes.
+Thu Jul  2 11:58:59 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Fri Jan 16 14:33:35 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/rubygems/test_gem_specification.rb: skip tests which the
+	  platform does not permit the filename of its test file.
 
-	* marshal.c (class2path): get class path and check referable.
-	  [ruby-dev:22588]
+Thu Jul  2 11:36:20 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Jan 16 09:52:23 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/rubygems/test_gem_resolver_git_specification.rb: require
+	  rubygems/installer.rb before Gem::TestCase#setup runs, otherwise
+	  as Gem::TestCase#teardown restores $LOADED_FEATURES to the state
+	  at that time, the requiring the file in GitSpecification#install
+	  method causes a lot of constant redefinitions.
 
-	* eval.c (proc_eq): Proc with empty body may not be equal.
-	  [ruby-dev:22590]
+Thu Jul  2 10:43:36 2015  Eric Wong  <e@80x24.org>
 
-Thu Jan 15 13:03:10 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/socket/rubysocket.h: flags for common socket families
+	  (rsock_getfamily): update signature
+	* include/ruby/io.h: comment socket FMODE flags
+	* ext/socket/init.c (rsock_getfamily): memoize family
+	* ext/socket/basicsocket.c: adjust rsock_getfamily calls
+	* ext/socket/ancdata.c: ditto
+	  [ruby-core:69713] [Feature #11298]
 
-	* io.c (argf_read): do not append EOF.  (ruby-bugs-ja:PR#585)
+Thu Jul  2 10:30:01 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* io.c (rb_io_fwrite): ad-hockery hack to get rid of HP-UX stdio
-	  weird behavior.  [ruby-dev:22424]
+	* lib/rubygems/resolver.rb: fixed NameError of Gem::Util::NULL_DEVICE.
 
-Wed Jan 14 13:31:06 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Jul  2 09:51:44 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* ext/iconv/extconf.rb: wrapper iconv.rb is dependent on platform.
+	* lib/rubygems/resolver.rb: fix error of null device reference with DOSISH
+	  platform.
 
-Tue Jan 13 18:54:28 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Thu Jul  2 06:49:44 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* lib/logger.rb(Logger#msg2str): no special treatment for the object
-	  which responds to :to_str.  commited at 2004-01-11T21:46:27 by
-	  gsinclair.
+	* lib/rubygems: Update to RubyGems HEAD(c202db2).
+	  this version contains many enhancements see http://git.io/vtNwF
+	* test/rubygems: ditto.
 
-	* lib/logger.rb(LogDevice#initialize): remove type checking if the
-	  given object is a String.  Kernel.open handles it correctly.
-	  commited at 2004-01-11T21:46:27 by gsinclair.
+Wed Jul  1 23:50:34 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-	* test/logger/test_logger.rb: follow above change (ArgumentError ->
-	  TypeError.)  follow above commit.
+	* test/net/http/test_httpresponse.rb
+	(HTTPResponseTest#test_read_body_content_encoding_deflate_uppercase):
+	fix a failure without zlib.
 
-Tue Jan 13 14:27:13 2004  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+Wed Jul  1 10:54:56 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* lib/test/unit/ui/testrunnerutilities.rb (TestRunnerUtilities):
-	  moved run method which allows output level.  [ruby-dev:22554]
+	* Add test for Enumerable#none? [fix GH-950] Patch by @yui-knk
 
-Tue Jan 13 04:29:52 2004  Dave Thomas  <dave@pragprog.com>
+Wed Jul  1 09:30:36 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/rdoc/ri/ri_driver.rb (RiDriver::report_method_stuff):
-	  Show fully-qualified class names in class list.
+	* struct.c (struct_set_members): hide internal back_members
+	  object, and members object does not need to be duped as it
+	  should be frozen and hidden.
 
-Tue Jan 13 01:04:37 2004  Dave Thomas  <dave@pragprog.com>
+Wed Jul  1 09:28:47 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/rdoc/ri/ri_paths.rb (RI::Paths): First attempt at
-	  incorporating DESTDIR in the rdoc installation.
+	* struct.c (struct_member_pos): revert r51080 to fix other
+	  implicit conversions but cast the return value to fix the
+	  previous implicit conversion.
 
-Mon Jan 12 23:27:19 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Jul  1 08:47:24 2015  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* parse.y (primary): fix position after FCALL.  [ruby-dev:22574]
+	* struct.c (struct_member_pos): avoid implicit conversion loses
+	  integer precision: 'long' to 'int'.
 
-Mon Jan 12 12:07:22 2004  Dave Thomas  <dave@pragprog.com>
+Wed Jul  1 05:57:03 2015  Eric Wong  <e@80x24.org>
 
-	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::do_methods):
-	  Someone changed the "// in eval.c" comments to "/*...*/" style,
-	  so the parsing of the source file name broke.
+	* vm_method.c (rb_add_method_iseq): add RB_GC_GUARD
+	* class.c (clone_method): remove RB_GC_GUARD
+	* struct.c (define_aref_method): ditto
+	  (define_aset_method): ditto
+	* vm.c (vm_define_method):
+	* iseq.c (rb_iseq_clone): add RB_GC_GUARD
 
-	* object.c: Remove spurious space in TrueClass documentation.
+Wed Jul  1 05:43:58 2015  Eric Wong  <e@80x24.org>
 
-	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::find_body): Fix
-	  bad regexp: if the code before a documented method contained
-	  a comment that wasn't terminated by whitespace, that comment
-	  and all intervening code was included in the following
-	  method's documentation.
+	* struct.c (AREF_HASH_THRESHOLD): new macro
+	  (id_back_members): new ID
+	  (struct_member_pos_ideal): new function
+	  (struct_member_pos_probe): ditto
+	  (struct_set_members): ditto
+	  (struct_member_pos): ditto
+	  (rb_struct_getmember): use struct_member_pos for O(1) access
+	  (rb_struct_aref_sym): ditto
+	  (rb_struct_aset_sym): ditto
+	  (setup_struct): call struct_set_members
+	  (struct_define_without_accessor): ditto
+	  (Init_Struct): initialize __members_back__
+	  [ruby-core:66851] [ruby-core:69705] [ruby-core:69821]
 
-	* lib/rdoc/ri/ri_formatter.rb (RI::HtmlFormatter::break_to_newline):
-	  HTML formats need explicit line breaks.
+Tue Jun 30 23:12:08 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Jan 12 11:46:30 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* io.c (rb_io_reopen): FilePathValue() ensures the path
+	  NUL-terminated and frozen, so it is unnecessary to make it shared.
 
-	* configure.in (LIBPATHFLAG, RPATHFLAG): enclose paths with single
-	  quotes.  [ruby-dev:22564]
+Tue Jun 30 23:11:53 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/mkmf.rb (libpathflag): do not enclose with quotes always.
+	* dir.c (check_dirname): ensure path name NUL-terminated for
+	  SHARABLE_MIDDLE_SUBSTRING.
 
-	* {bcc32,win32,wince}/Makefile.sub (LIBPATHFLAG): quoted.
+	* io.c (rb_sysopen): ditto.
 
-Mon Jan 12 02:24:07 2004  Dave Thomas  <dave@pragprog.com>
+Tue Jun 30 18:38:16 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/rdoc/ri/ri_formatter.rb (RI::HtmlFormatter): Add HTML
-	  generation support to ri (Elliot Hughes)
+	* win32/file.c (rb_freopen): need to terminate by NUL.
 
-Mon Jan 12 02:24:07 2004  Dave Thomas  <dave@pragprog.com>
+Tue Jun 30 17:28:25 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/rdoc/ri/ri_formatter.rb (RI::HtmlFormatter): Add HTML
-	  generation support to ri (Elliot Hughes)
+	* io.c (rb_io_reopen): freopen(3) with OS encoding path.
+	  [ruby-core:69780] [Bug #11320]
 
-Sun Jan 11 02:07:47 2004  Dave Thomas  <dave@pragprog.com>
+	* win32/file.c (rb_freopen): wrapper of wchar version freopen(3).
+	  use _wfreopen_s() if available.
 
-	* lib/rdoc/ri/ri_options.rb (RI::Options::OptionList::OptionList):
-	  Also accept command line options via the 'RI' environment variable.
+Tue Jun 30 08:24:08 2015  Eric Wong  <e@80x24.org>
 
-Sun Jan 11 02:07:47 2004  Dave Thomas  <dave@pragprog.com>
+	* io.c (rb_io_oflags_modestr): handle O_TRUNC correctly
+	* test/ruby/test_io.rb (test_reopen_stdio): new test
+	  Patch-by: cremno phobia <cremno@mail.ru>
+	  [ruby-core:69779] [Bug #11319]
 
-	* lib/rdoc/ri/ri_options.rb (RI::Options::OptionList::OptionList):
-	  Also accept command line options via the 'RI' environment variable.
+Tue Jun 30 02:47:02 2015  Eric Wong  <e@80x24.org>
 
-Sat Jan 10 21:27:41 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* include/ruby/st.h (struct st_table): hide struct list_head
+	* st.c (struct st_table_entry): adjust struct
+	  (head, tail): remove shortcut macros
+	  (st_head): new wrapper function
+	  (st_init_table_with_size): adjust to new struct and API
+	  (st_clear): ditto
+	  (add_direct): ditto
+	  (unpack_entries): ditto
+	  (rehash): ditto
+	  (st_copy): ditto
+	  (remove_entry): ditto
+	  (st_shift): ditto
+	  (st_foreach_check): ditto
+	  (st_foreach): ditto
+	  (get_keys): ditto
+	  (get_values): ditto
+	  (st_values_check): ditto
+	  (st_reverse_foreach_check): ditto (unused)
+	  (st_reverse_foreach): ditto (unused)
+	  [ruby-core:69726] [Misc #10278]
 
-	* eval.c (eval): need to add message delimiter. [ruby-dev:22561]
+Mon Jun 29 17:38:01 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Jan 10 01:54:50 2004  Eric Sunshine  <sunshine@sunshineco.com>
+	* insns.def (defineclass): do not quote unprintable characters at
+	  raising an exception.
 
-	* defines.h (__NeXT__): Ensure that all standard S_IRUSR, S_IWGRP,
-	  S_IRWXO, etc. macros are defined since future code might require
-	  them (even though present code only requires a subset).
+Mon Jun 29 16:01:24 2015  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* defines.h (__NeXT__): Bug fix: WORDS_BIGENDIAN was not being set
-	  correctly on Rhapsody when -arch compiler flag was used (via
-	  configure's --enable-fat-binary option).
+	* lib/net/http/response.rb (inflater): CONTENT_ENCODING can be upper
+	  case. [ruby-core:69670] [Bug #11285] patched by Andy Chu
 
-Fri Jan  9 10:05:14 2004  Siena.  <siena@faculty.chiba-u.jp>
+Mon Jun 29 14:50:08 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* lib/mkmf.rb (libpathflag): use single quotes.  [ruby-dev:22440]
+	* eval.c (add_activated_refinement): should not include the original
+	  class.
 
-Thu Jan  8 23:49:21 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+Mon Jun 29 12:09:10 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* configure.in (RDOCTARGET): new macro.  if you want to install
-	  rdoc documentation, you need to run configure with
-	  --enable-install-doc.
+	* README.md: tweak styles. [fix GH-945][ci skip] Patch by @bryndyment
 
-Thu Jan  8 21:29:43 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Mon Jun 29 07:23:55 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/openssl/ossl_pkey.c (ossl_pkey_to_der): removed; it returns
-	  public key only.
+	* template/sizes.c.tmpl: extract RUBY_DEFINT to define sizes of
+	  types checked by configure.in, and fix size of intptr_t in
+	  universal binary.
 
-	* ext/openssl/ossl_pkey_dh.c (ossl_dh_to_der): new function for
-	  OpenSSL::PKey::DH#to_der.
+Mon Jun 29 02:10:10 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/openssl/ossl_pkey_dsa.c (ossl_dsa_to_der): new function for
-	  OpenSSL::PKey::DSA#to_der.
+	* insns.def (defineclass): preserve encoding of name in error
+	  messages for super class mismatch.
 
-	* ext/openssl/ossl_pkey_rsa.c (ossl_rsa_to_der): new function for
-	  OpenSSL::PKey::RSA#to_der.
+	* insns.def (defineclass): preserve encoding of name in error
+	  messages for non-class super.
 
-Thu Jan  8 16:51:04 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* insns.def (defineclass): preserve encoding of name in error
+	  messages when already defined but type mismatch.
 
-	* test/wsdl/datetime/test_datetime.rb: fixed a stupid testcase which
-	  dumps "E" at month-end.
+Sun Jun 28 12:07:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Jan  8 11:20:01 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* class.c (rb_define_class_id_under): raise TypeError exception
+	  same as ruby level class definition when superclass mismatch.
 
-	* eval.c, object.c, process.c, re.c: don't use C++ style comments.
+Sun Jun 14 19:02:03 2015  Benoit Daloze  <eregontp@gmail.com>
 
-Thu Jan  8 04:36:21 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* lib/net/ftp.rb (makeport): close the TCPServer
+	  when sending the port fails.
 
-	* lib/webrick/cgi.rb (WEBrick::CGI#initialize): should create
-	  @config[:Logger] if it was not given.
+	* test/net/ftp/test_ftp.rb: test for above.
 
-	* sample/webrick/*: new files.
+Fri Jun 26 12:48:37 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* MANIFEST: add sample/webrick/*
+	* transcode.c (load_transcoder_entry): fix transcoder loading race
+	  condition, by waiting in require.  [ruby-dev:49106] [Bug #11277]
 
-Wed Jan  7 13:00:18 2004  Dave Thomas  <dave@pragprog.com>
+Fri Jun 26 07:53:56 2015  Eric Wong  <e@80x24.org>
 
-	* lib/rdoc/ri/ri_driver.rb: Fix problem where ri was
-	  being too eager to find matches of ambiguous method
-	  names (such as "ri Thread.join" would return both
-	  Thread.join and ThreadsWait.join)
+	* enum.c (enum_minmax): simplify return value creation
+	* test/ruby/test_enum.rb: test behavior on empty
+	* hash.c (rb_hash_fetch_m): remove unnecessary volatile since r41597
+	  (env_reject_bang): trade volatile for GC guard
+	  (env_select): ditto
+	  (env_select_bang): ditto
+	  (env_keep_if): ditto
+	  (rb_env_clear): ditto
 
-Wed Jan  7 12:35:41 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Thu Jun 25 21:24:28 2015  Naohisa Goto  <ngotogenome@gmail.com>
 
-	* lib/debug.rb: revert command parse regexps.  [ruby-list:39014] by
-	  Shirai,Kaoru.
+	* test/-ext-/popen_deadlock/test_popen_deadlock.rb: test [Bug #11265]
 
-Wed Jan  7 08:21:04 2004  Dave Thomas  <dave@pragprog.com>
+	* ext/-test-/popen_deadlock/infinite_loop_dlsym.c: new ext to call
+	  dlsym(3) infinitely without GVL, used in the above test.
 
-	* lib/rdoc/parsers/parserfactory.rb: Check for shebang
-	  line in files that would otherwise be treated as
-	  plain text.
+	* ext/-test-/popen_deadlock/extconf.rb: extconf.rb for the above
+	  ext. Currently, only enabled on Solaris (main target) and Linux
+	  (as a reference platform and for debugging the ext).
 
-Tue Jan  6 22:13:34 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Thu Jun 25 19:24:25 2015  Naohisa Goto  <ngotogenome@gmail.com>
 
-	* eval.c (rb_mod_modfunc): should break if m has no super class.
-	  [ruby-dev:22498]
+	* configure.in: not to use vfork on Solaris to avoid deadlock
+	  occurred in vfork(2) with multi-threading and dynamic linker
+	  on Solaris. [Bug #11265] [ruby-dev:49089]
 
-Tue Jan  6 21:55:02 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Jun 25 18:25:41 2015  Naohisa Goto  <ngotogenome@gmail.com>
 
-	* io.c (fptr_finalize): should save errno just after failure.
-	  [ruby-dev:22492]
+	* test/lib/envutil.rb (Test::Unit::Assertions#assert_no_memory_leak):
+	  NO_MEMORY_LEAK_ENVS is moved to Memory::NO_MEMORY_LEAK_ENVS
+	  to reduce child executions during test-all on Solaris.
 
-Tue Jan  6 14:53:14 2004  Dave Thomas  <dave@pragprog.com>
+	* test/lib/memory_status.rb (Memory::NO_MEMORY_LEAK_ENVS): ditto.
 
-	* bin/ri: split out the display side, making it pluggable. Added
-	  new ri_driver and ri_display files in lib/rdoc/ri.
+Thu Jun 25 17:32:33 2015  Koichi Sasada  <ko1@atdot.net>
 
-Tue Jan  6 06:37:53 2004  Dave Thomas  <dave@pragprog.com>
+	* vm_method.c (rb_method_entry_create): need to call
+	  method_definition_reset() if def is given.
 
-	* bin/rdoc: Add --ri-system switch
+	  Actually, `me' is a new object, so we don't need to call it.
+	  It is just to make sure.
 
-	* lib/.document: Update with list of files that seem to have
-	  documentation
+	* vm_method.c (method_definition_reset): remove duplicated insertion.
 
-	* lib/test/unit.rb: Reorder comment to make it RDoc friendly.
+	* vm_method.c (rb_method_entry_clone): assign dst->def here,
+	  not in method_definition_reset().
 
-	* Makefile.in: add install-nodoc target, and make it
-	  generate RDoc on default install.
+Thu Jun 25 16:44:54 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/rdoc/ri/ri_options.rb (RI::Options::parse): Add
-	  --doc-dir option to ri.
+	* vm_method.c: make a rb_method_definition_t data (def) *after* making
+	  a rb_method_entry_t data (me).
 
-Tue Jan  6 00:04:40 2004  Dave Thomas  <dave@pragprog.com>
+	  Normally, `me' points `def'. Some Ruby objects pointed from `def'
+	  and objects are marked by `me' (mark_method_entry() in gc.c).
+	  However, `def' is built before making a `me', then nobody can mark
+	  objects pointed from `def' before making (and pointing from) `me'.
 
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_method_or_yield_parameters):
-	  fix parsing if there are braces in a method parameter list
+	  I hope this patch solve #11244.
 
-Fri Jan  2 14:54:11 2004  Dave Thomas  <dave@pragprog.com>
+	* vm_method.c: remove `rb_' prefix from some static functions.
 
-	* bin/ri: Add new --classes option, and arrange for
-	  help messages to be paged too.
+	* method.h (rb_method_entry_create): constify
 
-	* bin/rdoc: Add statistics.
+	* gc.c (mark_method_entry): add checking `def' and
+	  `def->body.iseq.iseqptr' availability because they can be NULL.
 
-	* process.c: (MG) Added Process documentation
+Thu Jun 25 14:14:16 2015  takiy33  <takiy33@gmail.com>
 
-	* lib/rdoc/ri/ri_formatter.rb (RI::AttributeFormatter::wrap):
-	  Fix problem with labels not displaying in RI labeled
-	  lists using BS and ANSI modes.
+	* test/test_prime.rb (test_eratosthenes_works_fine_after_timeout):
+	  use spaces instead of TABs in ruby codes.  [Fix GH-944]
 
-Fri Jan  2 01:50:13 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Thu Jun 25 07:08:35 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* io.c (argf_eof): ARGF.eof? should not have any side effect.
-	  [ruby-dev:22469]
+	* gc.c (obj_info, method_type_name): show method type name in a string
+	  instead of a number.
 
-Wed Dec 31 17:25:17 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Thu Jun 25 06:49:25 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* io.c (argf_each_byte): should return self.  [ruby-dev:22465]
+	* gc.c (obj_info): show more details for T_IMEMO/imemo_ment.
 
-Wed Dec 31 11:20:34 2003  Dave Thomas  <dave@pragprog.com>
+Thu Jun 25 06:40:46 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::do_methods): Make
-	  file referenced in "// in sss.c" relative to current file.
+	* vm_method.c (rb_method_definition_reset): need a WB for
+	  VM_METHOD_TYPE_ATTRSET.
 
-Wed Dec 31 11:17:37 2003  Dave Thomas  <dave@pragprog.com>
+Thu Jun 25 03:33:21 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/rdoc/generators/html_generator.rb: Fix problem when
-	  a public method was aliased, but the alias is then
-	  made private, and hence doesn't appear in RDoc output.
+	* gc.c (RGENGC_OBJ_INFO, obj_info): add a macro to enable/disable
+	  rich obj_info() output.
 
-Wed Dec 31 01:33:05 2003  Dave Thomas  <dave@pragprog.com>
+	  At the default, the value of RGENGC_OBJ_INFO is
+	  (RGENGC_DEBUG | RGENGC_CHECK_MODE).
 
-	* array.c, error.c, eval.c, io.c, prec.c, range.c, re.c,
-	  string.c, time.c: Add RDoc for Kernel functions, and tidy.
+	* gc.c (RGENGC_OBJ_INFO): force enable it to debug #11244.
 
-Tue Dec 30 19:39:14 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* gc.c (gc_mark_ptr): print more details with obj_info().
 
-	* io.c (rb_f_readline): should raise EOFError at the end of
-	  files.  [ruby-dev:22458]
+	* gc.c (gc_mark_children): remove useless debug prints.
 
-	* io.c (argf_read): should concatenate input files when length
-	  argument is nil. [ruby-dev:22450]
+Thu Jun 25 02:40:33 2015  Eric Wong  <e@80x24.org>
 
-	* io.c (argf_read): should update supplied string buffer (2nd
-	  argument) even when IO#read is called multiple times.
+	* ext/openssl/ossl_ssl.c (ossl_ssl_read_internal):
+	  do not process kwargs in blocking mode
+	* test/openssl/test_ssl.rb: test sysread
 
-	* io.c: should initialize lineno by zero. [ruby-dev:22460]
+Wed Jun 24 16:54:11 2015  Koichi Sasada  <ko1@atdot.net>
 
-Tue Dec 30 12:30:30 2003  Dave Thomas  <dave@pragprog.com>
+	* gc.c (gc_mark_children): add additional debug code for #11244.
 
-	* lib/rdoc/code_objects.rb (RDoc::Context::find_symbol): If a
-	  class and a method have the same name, finding Xxx.abc was trying
-	  to find 'abc' in method 'Xxx', not class 'Xxx'.
+Wed Jun 24 16:05:42 2015  Eric Wong  <e@80x24.org>
 
+	* string.c (rb_str_justify): use RB_GC_GUARD
 
-Tue Dec 30 08:32:32 2003  Dave Thomas  <dave@pragprog.com>
+Wed Jun 24 14:25:17 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_method):
-	  Handle undoing nesting of yield parameters correctly for:
+	* gc.c (gc_mark_ptr): add a check code for #11244.
 
-	  def each_entry(&b) Dir.foreach(@path) {|f| yield P.new(f) } end
+	  It should be removed later. But we can remain this check
+	  because it is only a branch.
 
+Wed Jun 24 12:49:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Dec 30 08:32:32 2003  Dave Thomas  <dave@pragprog.com>
+	* string.c (rb_fstring_cstr): new function to make a fstring from
+	  a string literal.
 
-	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_method):
-	  Handle undoing nesting of yield parameters correctly for:
+	* internal.h (rb_fstring_lit): new macro to make a fstring from a
+	  string literal.
 
-	    def each_entry(&block) Dir.foreach(@path) {|f| yield Pathname.new(f) } end
+	* include/ruby/intern.h (rb_strlen_lit): new macro to get the
+	  length of a string literal, borrowed from mruby/mruby@e4afd53.
 
-Mon Dec 29 12:51:02 2003  Dave Thomas  <dave@pragprog.com>
+Wed Jun 24 12:21:16 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* eval.c: Add RDoc for Kernel global functions.
+	* re.c: Update documentation for Regexp class.
+	  [fix GH-937][ci skip] Patch by @davydovanton
 
-Mon Dec 29 11:00:16 2003  Dave Thomas  <dave@pragprog.com>
+Wed Jun 24 09:23:03 2015  Eric Wong  <e@80x24.org>
 
-	* array.c: Tidy up RDoc loose ends.
+	* variable.c (generic_ivar_set): remove FL_ABLE check
+	  (gen_ivar_copy): ditto
+	  [ruby-core:69715]
 
-Mon Dec 29 05:05:51 2003  Dave Thomas  <dave@pragprog.com>
+Wed Jun 24 08:28:15 2015  Eric Wong  <e@80x24.org>
 
-	* struct.c, random: Add RDoc comments
+	* ext/socket/ancdata.c (bsock_recvmsg_internal): reduce stack use
+	  [ruby-core:69595] [Feature #11263]
 
-Mon Dec 29 02:20:54 2003  Dave Thomas  <dave@pragprog.com>
+Tue Jun 23 14:32:42 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c: Add RDoc for class Proc, Method, UnboundMethod
+	* error.c (name_err_receiver): raise ArgumentError if no receiver
+	  is available on this exception object.  [Feature #10881]
 
-Mon Dec 29 00:41:44 2003  Dave Thomas  <dave@pragprog.com>
+Tue Jun 23 09:48:34 2015  Eric Wong  <e@80x24.org>
 
-	* math.c: Add RDoc comments
+	* dir.c (check_dirname): avoid volatile, use return value
+	  (dir_s_chroot, dir_s_mkdir, dir_s_rmdir): adjust callers
 
-Sun Dec 28 20:19:11 2003  Tanaka Akira  <akr@m17n.org>
+Tue Jun 23 06:37:10 2015  Eric Wong  <e@80x24.org>
 
-	* ext/stringio/stringio.c (strio_sysread): StringIO.new.sysread didn't
-	  raise EOFError.
+	* struct.c (struct_ivar_get): cache member definition in a subclass
+	  Thanks to Sokolov Yura aka funny_falcon <funny.falcon@gmail.com>
+	  in https://bugs.ruby-lang.org/issues/10585
 
-	* ext/zlib/zlib.c (gzreader_gets): don't increment lineno when
-	  gzfile_read_all returns "".
+Tue Jun 23 04:58:06 2015  Eric Wong  <e@80x24.org>
 
-Sun Dec 28 15:25:08 2003  Dave Thomas  <dave@pragprog.com>
+	* benchmark/bm_vm2_struct_big_href_hi.rb: new benchmark
+	* benchmark/bm_vm2_struct_big_href_lo.rb: ditto
+	* benchmark/bm_vm2_struct_big_hset.rb: ditto
+	* benchmark/bm_vm2_struct_small_href.rb: ditto
+	* benchmark/bm_vm2_struct_small_hset.rb: ditto
+	  Thanks to Sokolov Yura aka funny_falcon <funny.falcon@gmail.com>
+	  in https://bugs.ruby-lang.org/issues/10585
 
-	* class.c,object.c,parse.y,sprintf.c,variable.c: Document classes
-	  Object, Module, etc...
+Mon Jun 22 18:08:48 2015  Naohisa Goto  <ngotogenome@gmail.com>
 
-Sun Dec 28 11:55:29 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* test/lib/test/unit.rb (Test::Unit::Parallel#start_watchdog): removed
+	  because it has been meaningless since r36385. [Bug #11288]
 
-	* test/csv/test_csv.rb: generate bom.csv and mac.csv files on the fly.
-	  [ruby-talk:88852]
+	* test/lib/test/unit.rb (Test::Unit::Parallel#_run_parallel): delete
+	  lines related to the removed start_watchdog method
 
-	* test/csv/{bom.csv,mac.csv}: removed.
+Sun Jun 21 23:52:46 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-Sun Dec 28 08:56:51 2003  Dave Thomas  <dave@pragprog.com>
+	* NEWS: mention about Array#bsearch_index and Hash#fetch_values.
 
-	* eval.c: Thead[Group] RDoc (thanks to MG)
+Sun Jun 21 23:46:27 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-Sun Dec 28 03:50:05 2003  Dave Thomas  <dave@pragprog.com>
+	* NEWS: add a reference to a ticket.
 
-	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::find_override_comment):
-	  Escape method names used in regexp
+Sun Jun 21 20:28:09 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Dec 28 01:46:02 2003  Dave Thomas  <dave@pragprog.com>
+	* internal.h (roomof): extract from type_roomof, and move from
+	  bignum.c.
 
-	* lib/rdoc/ri/ri_formatter.rb (RI::TextFormatter::display_flow_item):
-	  Add support for rules in 'ri' output.
+Sun Jun 21 18:32:37 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Dec 28 01:35:35 2003  Dave Thomas  <dave@pragprog.com>
+	* ruby_atomic.h (ATOMIC_PTR_CAS): define by generic CAS macro, not
+	  via size_t, to suppress a warning by mingw gcc.
 
-	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::find_body):
-	  Sometimes the Ruby source aliases two otherwise
-	  unrelated methods (for example Kernel#object_id and
-	  Kernel#hash are both the same C function). Provide a
-	  facility to allow the methods to be documented
-	  separately.
+Sun Jun 21 05:31:41 2015  Shota Fukumori  <her@sorah.jp>
 
-Sun Dec 28 01:05:31 2003  Dave Thomas  <dave@pragprog.com>
+	* ext/objspace/objspace_dump.c(dump_object): Return empty JSON object when
+	  passed object is a special const, instead of SEGV.
+	  Based patch by Kohei Suzuki (eagletmt). [ruby-core:69692] [Bug #11291]
 
-	* marshal.c, signal.c: RDoc collemts added by Elliott Hughes
+	* test/objspace/test_objspace.rb(test_dump_special_consts): Test for above fix.
 
-Sun Dec 28 00:48:47 2003  Dave Thomas  <dave@pragprog.com>
 
-	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::find_class_comment):
-	  Some source files use lower case class or module names
-	  when naming the Init_XXX function in C.
+Sat Jun 20 03:56:58 2015  Yusuke Endoh  <mame@ruby-lang.org>
 
-Sat Dec 27 23:41:46 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* enc/make_encmake.rb: the list of encoding extension libraries must
+	  not include encinit.c itself.  It caused "undefined reference to
+	  Init_encinit".
 
-	* configure.in: fix "test: too many arguments" error.
+Sat Jun 20 02:03:53 2015  Naohisa Goto  <ngotogenome@gmail.com>
 
-Sat Dec 27 15:32:19 2003  Dave Thomas  <dave@wireless_3.local.thomases.com>
+	* process.c (rb_execarg_parent_start1): new macro ALWAYS_NEED_ENVP
+	  to generate envp_str anytime on Solaris 10 (or earlier version
+	  of Solaris) to avoid calling execv() which is async-signal unsafe
+	  on Solaris 10. [Bug #11265] [ruby-dev:49089]
 
-	* time.c: RDoc comments added
+	* process.c (exec_with_sh, proc_exec_cmd): On Solaris 10,
+	  because ALWAYS_NEED_ENVP is 1 and envp_str is always generated,
+	  execv() in exec_with_sh() and proc_exec_cmd() are never called.
+	  To guarantee this, execv() is replaced by a macro to print
+	  out error message on Solaris 10.
 
-Sat Dec 27 15:07:57 2003  Dave Thomas  <dave@pragprog.com>
+	* process.c (proc_exec_sh): Because proc_exec_sh() may be called
+	  by rb_proc_exec() with envp_str = Qfalse, execl() is replaced
+	  by a macro that calls execle() with "extern char **environ"
+	  traditional global variable on Solaris 10.
+	  TODO: This may be unsafe and should be changed in the future.
+	  Although rb_proc_exec() is not used from inside current version
+	  of ruby, it may be called by third-party extensions.
 
-	* object.c: Add RDoc comments for Symbol class.
+Sat Jun 20 01:10:13 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-Sat Dec 27 14:42:30 2003  Dave Thomas  <dave@pragprog.com>
+	* NEWS: mention about $SAFE.
 
-	* numeric.c: Add RDoc comments.
+Fri Jun 19 14:53:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Dec 27 00:44:00 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* proc.c (rb_mod_define_method): now requires a block direct to
+	  this method call.  [ruby-core:69655] [Bug #11283]
 
-	* io.c (next_argv): warn always for stdin on inplace edit mode.
+Fri Jun 19 13:54:43 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* io.c (read_all): need to check string value.
+	* proc.c (rb_mod_define_method): get rid of inadvertent ID
+	  creations at error.
 
-	* io.c (argf_read): allow ARGF.read(nil).  [ruby-dev:22433]
+Fri Jun 19 07:58:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Dec 26 23:02:09 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/extmk.rb: if no with-ext option is given, default to
+	  enable everything.  [ruby-dev:49108] [Bug #11280]
 
-	* io.c (rb_f_backquote): need not to check nil result.
-	  [ruby-core:02078]
+Fri Jun 19 06:30:07 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* io.c (rb_io_getline): should return nil when read_all gives
-	  empty string, even when nil rs is specified. [ruby-core:02077]
+	* bootstraptest/test_method.rb: remove a test because $SAFE=2 was
+	  obsolete.
 
-Fri Dec 26 18:50:59 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	  Please check btest, too.
 
-	* configure.in: check if getcontext and setcontext are available.
+Thu Jun 18 23:51:51 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-	* eval.c: use presence of getcontext/setcontext.
+	* bin/erb: $SAFE=3 is obsolete.
 
-Fri Dec 26 16:40:53 2003  Tanaka Akira  <akr@m17n.org>
+Thu Jun 18 23:45:11 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-	* lib/pathname.rb (PathnameTest#test_plus): add 2 assertions.
+	* safe.c: removed needless doc related $SAFE=2
 
-Fri Dec 26 09:26:58 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Thu Jun 18 23:38:07 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* pack.c (pack_pack): add sign check for 'i', and 'l'.
-	  [ruby-dev:22427]
+	* thread.c (rb_thread_safe_level): fix document.  $SAFE=3 is obsolete.
+	  [ci skip]
 
-	* bignum.c (rb_quad_pack): add range check for 'quad int'.
+Thu Jun 18 23:25:51 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Dec 25 22:39:59 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* ext/extmk.rb: configure intersection of with-ext and not
+	  without-ext, as withouts is no longer true by default if
+	  with-ext option is given.  [ruby-dev:49108] [Bug #11280]
 
-	* string.c (rb_str_update): don't return any value.
+Thu Jun 18 23:20:46 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Thu Dec 25 15:30:17 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* include/ruby/ruby.h: $SAFE=2 is now obsolete.
 
-	* string.c (rb_str_update): call rb_str_modify().
+	* dir.c, ext/fiddle/handle.c, ext/socket/basicsocket.c, file.c
+	  gc.c, io.c, process.c, safe.c, signal.c, win32/file.c:
+	  removed code for $SAFE=2
 
-Thu Dec 25 05:08:09 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/erb/test_erb.rb, test/fiddle/test_handle.rb
+	  test/ruby/test_env.rb: removed tests for $SAFE=2.
 
-	* eval.c (search_required): search actual file name once when no
-	  extension specified.
+Thu Jun 18 22:50:07 2015  Yusuke Endoh  <mame@ruby-lang.org>
 
-Thu Dec 25 04:00:44 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* enc/make_encmake.rb: added --transes and --no-transes options.
 
-	* stable version 1.8.1 released.
+Thu Jun 18 18:24:12 2015  Eric Wong  <e@80x24.org>
 
-Thu Dec 25 00:17:53 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/socket/test_unix.rb: replace sleep with select
 
-	* configure.in: check for nanosleep, -lrt if required.
-	  [ruby-core:02059]
+Thu Jun 18 17:59:06 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* eval.c (thread_timer): use select(2) if nanosleep(2) is not
-	  available.
+	* vm.c (rb_vm_control_frame_id_and_class): remove useless codes.
+	  `me' knows ID and owner class.
 
-	* eval.c: check __stub_getcontext for glibc on some platforms.
-	  [ruby-list:38984]
+Thu Jun 18 16:58:35 2015  Koichi Sasada  <ko1@atdot.net>
 
-Wed Dec 24 23:48:04 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* method.h: constify rb_method_alias_struct::original_me and
+	  rb_method_refined_struct::orig_me.
 
-	* test/soap/test_basetype.rb, test/soap/marshal/test_marshal.rb
-	  test/xsd/test_xsd.rb: use "(-1.0 / (1.0 / 0.0))" instead of "-0.0"
-	  to express -0.0.  [ruby-talk:88786]
+	* class.c (move_refined_method): use RB_OBJ_WRITE() for
+	  me->def->body.refined.orig_me.
 
-Wed Dec 24 23:29:30 2003  Tanaka Akira  <akr@m17n.org>
+Thu Jun 18 14:35:28 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/tsort.rb (test_orphaned_break): removed.
+	* ext/objspace/objspace.c (count_imemo_objects): support imemo_ment.
 
-Wed Dec 24 20:53:06 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Thu Jun 18 13:32:46 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/sample/tkmulticolumnlist.rb: new sample
+	* error.c (name_err_receiver): add NameError#receiver method.
+	  [Feature #10881]
 
-	* ext/tk/sample/tkmultilistframe.rb: bug fix
+Thu Jun 18 10:00:06 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Wed Dec 24 20:37:37 2003  Eric Sunshine  <sunshine@sunshineco.com>
+	* safe.c: removed needless doc related $SAFE=3
 
-	* configure.in (LDSHARED): Fixed typographical error in assignment of
-	  LDSHARED for Rhapsody which caused linking of extension modules to
-	  fail.
+Thu Jun 18 09:59:23 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Wed Dec 24 17:51:18 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* safe.c: rename old method name for $SAFE=3
 
-	* file.c (rb_thread_flock): enable thread support again.
+Thu Jun 18 06:02:42 2015  Eric Wong  <e@80x24.org>
 
-Wed Dec 24 16:46:08 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* compile.c (get_exception_sym2type, iseq_build_from_ary_body):
+	  rely on %+PRIsVALUE instead of calling rb_inspect directly
 
-	* eval.c (catch_timer): do not call rb_thread_schedule() inside to
-	  avoid pthread_mutex_lock() deadlock.  interrupts to system calls
-	  are detected by TRAP_END via EINTR error.
+Wed Jun 17 20:59:25 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (thread_timer): do not post signal unless it is
-	  absolutely necessary.
+	* common.mk (ENC_MK): needs fake.rb if cross compilation.
+	  [ruby-dev:49098] [Bug #11272]
 
-	* rubysig.h (TRAP_END): add CHECK_INTS to switch thread.
+Wed Jun 17 20:23:29 2015  Tanaka Akira  <akr@fsij.org>
 
-	* regex.c (re_compile_pattern): check if nextp is smaller than
-	  pend.  [ruby-dev:22372]
+	* ext/rbconfig/sizeof/extconf.rb: Check __float80.
 
-	* eval.c (umethod_bind): remove method overridden check.
-	  [ruby-dev:22366]
+Wed Jun 17 15:15:53 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Wed Dec 24 16:13:05 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* safe.c (safe_setter): of course, don't have to warn the limitation of
+	  $SAFE=3 after it's removed.
 
-	* ext/openssl/ossl_ssl.c (ossl_ssl_read): should check for error
-	  status by SSL_get_error().
+Wed Jun 17 14:29:43 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* ext/openssl/ossl_ssl.c (ossl_ssl_write): ditto.
+	* include/ruby/ruby.h: $SAFE=3 is now obsolete.
 
-Wed Dec 24 14:23:27 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/socket/init.c, ext/socket/socket.c, ext/socket/tcpsocket.c
+	  ext/socket/udpsocket.c, gc.c, object.c, re.c, safe.c: removed code
+	  for $SAFE=3
 
-	* ext/stringio/stringio.c (strio_read): clear the buffer argument
-	  when returning nil.  [ruby-dev:22363]
+	* bootstraptest/test_method.rb, test/erb/test_erb.rb, test/ruby/test_dir.rb
+	  test/ruby/test_file.rb, test/ruby/test_method.rb, test/ruby/test_regexp.rb
+	  test/ruby/test_thread.rb: remove tests for $SAFE=3
 
-	* test/ruby/ut_eof.rb (TestEOF::test_eof_0, TestEOF::test_eof_1):
-	  add buffer argument tests.
+Wed Jun 17 12:13:33 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Wed Dec 24 14:07:55 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ChangeLog: added contributor name.
 
-	* lib/test/unit/assertions.rb: Modules are allowed to rescue.
+Wed Jun 17 10:57:28 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* lib/test/unit/autorunner.rb: show output_level in order.
+	* lib/csv.rb: accept to use Range object for row selection.
+	  contributed by Mitsutaka Mimura.
+	  [Feature #11267][ruby-dev:49091]
 
-	* lib/test/unit/collector/dir.rb: get rid of successive same
-	  directories in load path.
+Wed Jun 17 09:50:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/testunit/test_assertions.rb (test_assert_nothing_raised,
-	  test_assert_raise): test for modules.
+	* lib/rdoc/servlet.rb (documentation_search, root_search):
+	  requires json for JSON.dump and fix sporadic failures due to
+	  the loading order.
 
-Wed Dec 24 13:43:34 2003  Shugo Maeda  <shugo@ruby-lang.org>
+Tue Jun 16 19:19:53 2015  Tanaka Akira  <akr@fsij.org>
 
-	* lib/net/imap.rb (authenticate): remove "\n" from base64 encoded
-	  strings.
+	* ext/rbconfig/sizeof/extconf.rb: Check several types defined in C99
+	  and x86_64 ABI.
 
-Wed Dec 24 11:26:41 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* template/sizes.c.tmpl: Relax a pattern for types.
 
-	* test/fileutils/test_fileutils.rb: should not create any
-	  files or directories in current directory.  [ruby-talk:88724]
+Tue Jun 16 17:37:01 2015  Koichi Sasada  <ko1@atdot.net>
 
-Wed Dec 24 10:29:53 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/objspace/test_objspace.rb: relax pattern because uncollectible
+	  flag and marked flag can be false at major GC.
+	  [Bug #10852]
 
-	* ext/stringio/stringio.c (strio_read): never return nil at
-	  unlimited read.  [ruby-dev:22334]
+Tue Jun 16 04:50:44 2015  Eric Wong  <e@80x24.org>
 
-	* ext/stringio/stringio.c (strio_read): support second
-	  argument.  [ruby-dev:22350]
+	* ext/socket/basicsocket.c (bsock_recv): document outbuf
+	* ext/socket/unixsocket.c (unix_recvfrom): ditto
+	* ext/socket/init.c (rsock_strbuf, recvfrom_locktmp): new functions
+	  (rsock_s_recvfrom): support destination buffer as 3rd arg
+	  (rsock_s_recvfrom_nonblock): ditto
+	* string.c (rb_str_locktmp_ensure): export for internal ext
+	* test/socket/test_nonblock.rb: test recv_nonblock
+	* test/socket/test_unix.rb: test recv
+	  [ruby-core:69543] [Feature #11242]
 
-Wed Dec 24 09:38:49 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Jun 16 04:38:02 2015  Eric Wong  <e@80x24.org>
 
-	* parse.y (arg): should return 0 after error.  [ruby-dev:22360]
+	* ext/socket/ancdata.c (bsock_sendmsg_internal,
+	  bsock_recvmsg_internal):
+	  support "exception: false" kwarg
+	* ext/socket/init.c (rsock_s_recvfrom_nonblock):
+	  ditto
+	* ext/socket/init.c (rsock_s_recvfrom_nonblock): use rsock_opt_false_p
+	* ext/socket/socket.c (sock_connect_nonblock): ditto
+	* ext/socket/rubysocket.h (rsock_opt_false_p): new function
+	* ext/socket/basicsocket.c (bsock_recv_nonblock): update rdoc
+	* ext/socket/udpsocket.c (udp_recvfrom_nonblock): ditto
+	* test/socket/test_nonblock.rb: new tests
+	  [ruby-core:69542] [Feature #11229]
 
-Wed Dec 24 00:56:54 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Mon Jun 15 14:33:02 2015  Akinori MUSHA  <knu@iDaemons.org>
 
-	* io.c (read_all): do not return nil at the end of file.
-	  [ruby-dev:22334]
+	* lib/set.rb: Make Set#each and SortedSet#each generate a sized
+	  enumerator. [GH-931] by kachick (Kenichi Kamiya)
 
-	* io.c (argf_read): do not depend on nil at eof behavior of
-	  IO#read().
+	* test/test_set.rb: Import tests from Set into SortedSet. [GH-931]
+	  by kachick (Kenichi Kamiya)
 
-	* eval.c (rb_thread_join): dup exception before re-raising it.
+Mon Jun 15 02:26:34 2015  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* io.c (rb_io_eof): call clearerr() to prevent side effect.  this
-	  patch is supplied by Masahiro Sakai <sakai@tom.sfc.keio.ac.jp>.
-	  [ruby-dev:22234]
+	* lib/net/http.rb (Net::HTTP#connect): use connect_nonblock and
+	  io/wait to eliminate timeout use. fix GH-899
 
-	* pack.c (OFF16): get offset for big endian machines.
+Sat Jun 13 07:21:18 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* pack.c (pack_pack): use OFF16 instead of OFF16B.
-	  [ruby-dev:22344]
+	* thread.c (thread_start_func_2): don't interrupt when last thread
+	  exit unless main thread is already exited. Otherwise main thread
+	  could be wrongly interrupted when it uses rb_thread_call_without_gvl().
+	  Patch by Takehiro Kubo. [Bug #11237][ruby-dev:49044][GH-898]
 
-	* pack.c (pack_unpack): ditto.
+	* test/-ext-/gvl/test_last_thread.rb: new test for the above fix.
 
-Tue Dec 23 22:47:14 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/-test-/gvl/call_without_gvl/call_without_gvl.c: new ext for
+	  the above test.
+	* ext/-test-/gvl/call_without_gvl/extconf.rb: ditto.
 
-	* io.c (rb_io_check_readable): set FMODE_RBUF always, even if
-	  NEED_IO_SEEK_BETWEEN_RW is not defined. [ruby-dev:22340]
+Mon Jun 15 00:14:33 2015  Tanaka Akira  <akr@fsij.org>
 
-	* io.c (rb_io_check_writable): clear FMODE_RBUF before writing
-	  something.
+	* ext/pathname/lib/pathname.rb (descend): Blockless form supported.
+	  (ascend): Ditto.
+	  [ruby-core:68820] [Feature #11052] Patch by Piotr Szotkowski.
 
-Tue Dec 23 22:25:00 2003  Gavin Sinclair  <gsinclair@soyabean.com.au>
+Sun Jun 14 20:09:25 2015  Tanaka Akira  <akr@fsij.org>
 
-	* lib/optparse.rb: incomplete RDoc documentation added in place of
-	  existing RD comments.  Tabs converted to spaces.
+	* time.c (time_getlocaltime): [DOC] Add examples of valid utc_offset
+	  formats.
+	  [ruby-core:68306] [Misc #10905] Patch by Charles Korn.
 
-Tue Dec 23 19:44:47 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Sun Jun 14 18:49:56 2015  Tanaka Akira  <akr@fsij.org>
 
-	* test/soap/test_streamhandler.rb (test_basic_auth): removed.
-	  soap4r + basic_auth is not officially supported in ruby/1.8.1 even
-	  though soap4r + basic_auth + http-access2 should run fine.
+	* ext/socket/raddrinfo.c (parse_numeric_port): Detect
+	  port overflow.
+	  (numeric_getaddrinfo): Use parse_numeric_port.
+	  numeric_getaddrinfo fails if port is too big now.
+	  This makes rb_getaddrinfo invokes the real getaddrinfo()
+	  on such condition.
+	  This change is related to [ruby-core:69355] [Bug #11179].
 
-Tue Dec 23 19:42:59 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sun Jun 14 17:26:03 2015  Tanaka Akira  <akr@fsij.org>
 
-	* io.c (rb_io_ungetc): raise an exception at unread stream to
-	  avoid unspecified behavior.  [ruby-dev:22330]
+	* enum.c (enum_chunk_while): New method Enumerable#chunk_while.
+	  [ruby-core:67738] [Feature #10769] proposed by Tsuyoshi Sawada.
 
-	* test/ruby/test_system.rb (test_syntax): glob relatively from
-	  __FILE__.
+Sun Jun 14 17:20:40 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Dec 23 18:09:40 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* file.c (rb_file_load_ok): try opening file without gvl not to
+	  lock entire process.  [Bug #11060]
 
-	* pack.c (pack_pack): remove unnecessary negative value check.
-	  [ruby-dev:22329]
+Sun Jun 14 10:43:50 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Tue Dec 23 17:26:55 2003  KONISHI Hiromasa  <konishih@fd6.so-net.ne.jp>
+	* tool/runruby.rb: just remove the lines of RUBY_VERSION check and raise
+	  instead of replacing the check to `true`, for getting rid of a
+	  warning `possibly useless use of true in void context`.
 
-	* bcc32/Makefile.sub (config.h): bcc has finite(). [ruby-list:38940]
+Sun Jun 14 10:13:55 2015  Kouhei Sutou  <kou@cozmixng.org>
 
-Tue Dec 23 16:08:16 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* lib/rexml/source.rb (REXML::IOSource#scan): Fix a typo in
+	  document. [fix GH-934]
+	  Patch by Anton Davydov. Thanks!!!
 
-	* lib/rexml/encodings/US-ASCII.rb: typo.  [ruby-talk:88650]
+Sun Jun 14 10:09:48 2015  Kouhei Sutou  <kou@cozmixng.org>
 
-	* test/ruby/test_system.rb: num of asserts depended on running dir.
+	* lib/rexml/attlistdecl.rb (REXML::AttlistDecl): Fix a typo in
+	  document. [fix GH-934]
+	  Patch by Anton Davydov. Thanks!!!
 
-	* test/xsd/test_noencoding.rb: rexml + without iconv/uconv cannot
-	  handle euc-jp.  install iconv, uconv or xmlscan.
+Sun Jun 14 06:24:57 2015  Benoit Daloze  <eregontp@gmail.com>
 
-Tue Dec 23 14:13:51 2003  akira yamada  <akira@ruby-lang.org>
+	* test/ruby/test_io.rb: add test for IO.binread fd leak.
+	  See r50881.
 
-	* lib/uri/generic.rb (URI::Generic::check_userinfo,
-	  URI::Generic::check_user, URI::Generic::check_password): tests
-	  conflicts/depends with other components closely.
+Sun Jun 14 05:23:51 2015  Benoit Daloze  <eregontp@gmail.com>
 
-	* test/uri/test_generic.rb (TestGeneric::test_set_component):
-	  added tets.
+	* io.c (rb_io_s_binread): close fd if seek offset is invalid.
 
-Tue Dec 23 11:08:34 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Sun Jun 14 04:40:32 2015  Benoit Daloze  <eregontp@gmail.com>
 
-	* test/xsd/test_noencoding.rb: rescue Errno::EINVAL and do not test.
-	  "euc-jp" might not be in supported encoding name list.
-	  [ruby-talk:88650]
+	* test/lib/leakchecker.rb (check): refactor.
 
-Tue Dec 23 06:10:31 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Sun Jun 14 04:34:14 2015  Benoit Daloze  <eregontp@gmail.com>
 
-	* lib/webrick/cgi.rb (CGI): add support for mod_ruby.
+	* test/lib/leakchecker.rb: Return false for no leaks.
+	  Otherwise the GC could run for nothing.
 
-	* lib/webrick/cgi.rb (CGI::Socket): add check for existence of
-	  OpenSSL module in all HTTPS related methods.
+Sun Jun 14 04:15:40 2015  Benoit Daloze  <eregontp@gmail.com>
 
-	* lib/webrick/cgi.rb (CGI::Socket#cipher): should create similar
-	  value to OpenSSL::SSLSocket#cipher.
+	* lib/delegate.rb: [DOC] Update SimpleDelegator example. [ci skip]
 
-	* lib/webrick/httpresponse.rb (HTTPResponse#setup_header): should
-	  set "connection: close" if @keep_alive is false.
+Sat Jun 13 20:28:14 2015  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/webrick/https.rb (HTTPrequest#meta_vars): add supprt for
-	  SSL_PROTOCOL, SSL_CIPHER_USEKEYSIZE and SSL_CIPHER_ALGKEYSIZE.
+	* file.c (rb_stat_ino): get inode from the interval of struct st.
 
-Mon Dec 22 23:00:05 2003  akira yamada  <akira@ruby-lang.org>
+	* win32/win32.c (stati64_set_inode): get nFileIndexHigh/Low, and set it
+	  to the interval of struct st as inode.
+	  [Feature #11216]
 
-	* lib/uri/generic.rb (URI::Generic::check_opaque): fixed typo.
+	* win32/win32.c (stati64_set_inode_handle): call stati64_set_inode.
 
-Mon Dec 22 21:59:24 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* win32/win32.c (rb_w32_fstati64): call stati64_set_inode_handle.
 
-	* ext/iconv/iconv.c (map_charset): always ensure code is a String.
+	* win32/win32.c (stati64_handle): call stati64_set_inode.
 
-Mon Dec 22 21:15:29 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Jun 13 19:44:53 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* class.c (rb_mod_init_copy): always copy singleton class.
-	  [ruby-dev:22325]
+	* ext/io/console/depend (.list.chksum): revert a part of r50859, because
+	  it was not mentioned at its commit log and it caused a build error on
+	  Windows ($(MAKE) is already quoted).
 
-Mon Dec 22 20:44:36 2003  akira yamada  <akira@ruby-lang.org>
+Sat Jun 13 17:35:11 2015  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/uri/generic.rb (URI::Generic#route_from): accepts urls which
-	  has no host-part.
+	* vm_core.h (rb_thread_t): add th->name.
 
-	* test/uri/test_generic.rb (TestGeneric::test_route): added a test.
+	* vm.c (th_init): initialize th->name.
 
-Mon Dec 22 20:38:44 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* thread.c (Init_Thread): add Thread.name and name=. [Feature #11251]
 
-	* lib/cgi.rb: reduce eval.
+	* thread.c (rb_thread_inspect): show thread's name if set.
 
-	* lib/cgi.rb (CGI::QueryExtension::read_multipart): alias path to
-	  local_path.  [ruby-list:38883]
+	* thread.c (rb_thread_getname): defined.
 
-Mon Dec 22 20:09:31 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* thread.c (rb_thread_setname): ditto.
 
-	* test/soap/test_property.rb: remove duplicated test method.
+Sat Jun 13 11:39:43 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Mon Dec 22 18:22:04 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* lib/tempfile.rb: Fix typo. [fix GH-933] Patch by @Zorbash
 
-	* bcc32/Makefile.sub, win32/Makefile.sub (config.h): remove
-	  HAVE_ISINF definition to follow previous commits of missing.h
-	  and win32/win32.h.
+Sat Jun 13 11:38:00 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Mon Dec 22 17:23:42 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/openssl/ossl_ocsp.c: fix documentation on ocsp response cert status.
+	  [fix GH-932] Patch by @chrisholmes
 
-	* configure.in (ac_cv_func_setitimer): moved from defines.h
+Sat Jun 13 11:35:19 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* defines.h, rubysig.h, signal.c: removed macro handling which
-	  should be done in configure.
+	* ext/bigdecimal/bigdecimal.gemspec: Fix require paths for released gem.
+	  [fix GH-929] Patch by @voxik
+	* ext/io/console/io-console.gemspec: ditto.
 
-	* configure.in (intrinsics.h): check if present.
+Sat Jun 13 00:45:08 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
 
-	* ruby.h: include intrinsics.h if available.
+	* lib/prime.rb: Return sized enumerators.
+	  Patch by Kenichi Kamiya [GH-931]
 
-	* bignum.c, marshal.c: include ieeefp.h if available.
+Sat Jun 13 00:45:06 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
 
-	* missing.h (isinf): define as a macro if finite() and isnan()
-	  are available.  [ruby-core:02032]
+	* lib/prime.rb: Fix with_object with no block given
 
-Mon Dec 22 17:07:31 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+Sat Jun 13 00:44:59 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
 
-	* configure.in (mingw): set isnan, finite and isinf to yes.
+	* lib/prime.rb: Have with_index accept an offset parameter.
+	  Based on patch by T Yamada. [#11007]
 
-Mon Dec 22 13:40:19 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Fri Jun 12 22:21:12 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-	* lib/soap/property.rb: passing block by reference.
+	* test/ruby/test_extlibs.rb (TestExtLibs::check_existence): fix
+	  error. [Bug #11255] [ruby-dev:49079]
 
-Mon Dec 22 00:32:43 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Jun 12 21:17:46 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* eval.c (rb_with_disable_interrupt): use ENABLE_INTS instead of
-	  ALLOW_INTS which may switch context.  [ruby-dev:22319]
+	* pack.c (pack_{un,}pack): new template character `j` and `J`, pointer
+	  with signed and unsigned integers.
 
-	* ext/syck/emitter.c (syck_emitter_write): str bigger than
-	  e->bufsize causes buffer overflow.  [ruby-dev:22307]
+	* NEWS: mention about this feature.
+	  [Feature #11215] [ruby-dev:49015]
 
-Sun Dec 21 17:29:00 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Jun 12 21:01:44 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* class.c (rb_check_inheritable): new function.  [ruby-dev:22316]
+	* file.c (File::SHARE_DELETE): new flag to be able to delete opened file
+	  on Windows.
 
-	* intern.h: add prototype.
+	* include/win32/win32.c (O_SHARE_DELETE): new pseudo file mode flag.
 
-	* eval.c (superclass): use rb_check_inheritable().
+	* win32/win32.c (rb_w32_{w,}open): support above flag.  [EXPERIMENTAL]
 
-	* object.c (rb_class_initialize): check argument validity.
+	* NEWS: mention about this feature.
+	  [Feature #11218] [ruby-dev:49022]
 
-Sun Dec 21 16:25:10 2003  Tanaka Akira  <akr@m17n.org>
+Fri Jun 12 18:21:45 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* lib/pathname.rb (Pathname#+): re-implemented to resolve ".." in
-	  beginning of the argument.
-	  (Pathname#join): concatenate from the last argument.
-	  (Pathname#parent): just use Pathname#+.
+	* ChangeLog: added missing commit message.
 
-Sun Dec 21 00:12:37 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Fri Jun 12 18:20:37 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* ext/tk/lib/tk.rb: add new methods (TkScrollbar#assign, assign_list)
+	* sample/exyacc.rb: Fix some typos. [fix GH-927] Patch by @davydovanton
+	* sample/list.rb: ditto.
+	* sample/trick2013/kinaba/remarks.markdown: ditto.
 
-	* ext/tk/sample/tkmultilistframe.rb: use TkScrollbar#assign method
+Fri Jun 12 17:34:14 2015  Wojciech Mach  <wojtek@wojtekmach.pl>
 
-Sat Dec 20 21:59:03 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* hash.c (rb_hash_fetch_values): add `Hash#fetch_values`.
+	  [Feature #10017] [Fix GH-776]
 
-	* lib/webrick/httprequest.rb (HTTPRequest#meta_vars): refine regexp.
+Fri Jun 12 16:28:17 2015  Radan Skoric  <radan.skoric@gmail.com>
 
-	* lib/webrick/cgi.rb (CGI#start): NPH scripts return status line
-	  instead of Status: header field.
+	* array.c (rb_ary_bsearch_index): Implement Array#bsearch_index
+	  method, which is similar to bsearch and returns the index or
+	  nil.  [Feature #10730]
 
-	* lib/webrick/cgi.rb (CGI::Socket): refine some coditions.
+Thu Jun 11 19:11:22 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Sat Dec 20 16:07:14 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/zlib/zlib.c: Fix indentation for rdoc.
+	  [Bug #11221][ruby-core:69465]
 
-	* lib/optparse.rb (OptionParser::Completion::complete): wrong
-	  Regexp for word boundary.  pointed out by Gavin Sinclair.
+Thu Jun 11 16:23:37 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/optparse.rb (OptionParser::make_switch): [no-] prefix was
-	  missing.
+	* method.h (METHOD_ENTRY_BASIC_SET): fix last commit (unbalanced parens).
 
-Sat Dec 20 11:40:10 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Jun 11 15:14:16 2015  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/yaml.rb (YAML::YAML): adjust Marshal version.
+	* configure.in: define SET_THREAD_NAME if it has pthread_set_name_np
+	  for FreeBSD, and don't define it if both pthread_setname_np
+	  and pthread_set_name_np don't exist.
 
-Sat Dec 20 03:56:02 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* thread_pthread.c (SET_THREAD_NAME): don't define if they don't exist.
 
-	* eval.c (rb_with_disable_interrupt): prohibit thread context
-	  switch during proc execution.  [ruby-dev:21899]
+	* thread_pthread.c (native_set_thread_name): run if SET_THREAD_NAME
+	  is defined.
 
-Sat Dec 20 02:41:02 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Thu Jun 11 15:53:31 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/webrick/cgi.rb: add file. (yet another CGI library)
+	* method.h (METHOD_ENTRY_BASIC_SET): should clear last bit.
 
-	* MANIFEST: add lib/webrick/cgi.rb.
+Thu Jun 11 14:34:45 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Sat Dec 20 02:18:31 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/rubygems.rb: bump version to 2.4.7 and 2.4.8. these versions fixed
+	  CVE-2015-3900.
+	* lib/rubygems/remote_fetcher.rb: ditto.
+	* test/rubygems/test_gem_remote_fetcher.rb: added testcase for CVE-2015-3900
 
-	* misc/ruby-mode.el (ruby-calculate-indent): proper indentation
-	  inside of parentheses.  [ruby-dev:22308]
+Thu Jun 11 14:18:51 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Fri Dec 19 21:24:22 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* lib/rubygems.rb: bump version to 2.4.6. It's missing change at r49774.
 
-	* lib/webrick/httprequest.rb (HTTPRequest#meta_vars): should not set
-	  HTTP_CONTENT_TYPE and HTTP_CONTENT_LENGTH.
+Thu Jun 11 13:50:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/webrick/https.rb (HTTPRequest#parse): should check presence
-	  of cert() method to detect SSLSocket.
+	* array.c (ary_ensure_room_for_push): check if array size will
+	  exceed maximum size to get rid of buffer overflow.
+	  [ruby-dev:49043] [Bug #11235]
 
-Fri Dec 19 22:56:46 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* array.c (ary_ensure_room_for_unshift, rb_ary_splice): ditto.
 
-	* lib/soap/property.rb (SOAP::Property#load): new method for loading
-	  property value into existing property tree.
+Thu Jun 11 13:17:34 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* test/soap/test_property.rb: add test.
+	* test/test_cmath.rb (TestCMath#test_trigonometric_functions): should
+	  not compare float values (in complex values) by `==`.
 
-Fri Dec 19 19:21:49 2003  akira yamada  <akira@ruby-lang.org>
+Thu Jun 11 08:52:01 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/runit/cui/testrunner.rb (RUNIT::CUI::TestRunner::run):
-	  should use Test::Unit::UI::{PROGRESS_ONLY,VERBOSE}.
+	* method.h: embed rb_method_entry_t::attr::flags (5 bits) into
+	  rb_method_entry_t::flags to make one word spare space.
 
-Fri Dec 19 17:36:49 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	  Add some macros to access these flags.
 
-	* ext/tk/sample/tkmultilistbox.rb: bug fix
+	* vm_method.c: use these macros.
 
-	* ext/tk/sample/tkmultilistframe.rb: new sample script
+	* internal.h: define IMEMO_FL_USHIFT and IMEMO_FL_USER[0-4]
+	  for T_IMEMO local flags.
 
-Fri Dec 19 03:44:27 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Thu Jun 11 08:27:06 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/webrick/httputils.rb (parse_form_data): should return an
-	  empty Hash if the body is empty.
+	* vm.c: use VM_ASSERT instead of assert().
 
-Thu Dec 18 21:47:35 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* vm_args.c: ditto.
 
-	* lib/mkmf.rb (create_makefile): should remove deffile if it's
-	  made by miniruby. based on nobu's patch.
+	* vm_insnhelper.c: ditto.
 
-Thu Dec 18 21:44:21 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* vm_method.c: ditto.
 
-	* eval.c (stack_extend): ignore inline optimization on VC7.
+Thu Jun 11 08:16:48 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* win32/Makefile.sub (OS, RT): can override.
+	* vm_core.h: define VM_ASSERT() for assertion
+	  enabled only when (VM_CHECK_MODE > 0).
 
-	* win32/Makefile.sub (LDFLAGS): ditto. shouldn't use pdb:none
-	  option. based on Tietew's patch [ruby-dev:22289]
+	* vm_insnhelper.c: move definition VM_CHECK_MODE
+	  from vm_insnhelper.c to vm_core.h.
 
-Thu Dec 18 16:38:44 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* vm.c: remove <assert.h>
 
-	* dir.c (fnmatch): unlike find_dirsep(), rb_path_next() never
-	  return NULL.
+Thu Jun 11 06:46:07 2015  Koichi Sasada  <ko1@atdot.net>
 
-Thu Dec 18 15:27:59 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* vm_insnhelper.c (check_frame): check type of cref_or_me first.
 
-	* lib/ipaddr.rb (IPSocket::getaddress): merge usa's patch.
-	  [ruby-dev:21678]
+Thu Jun 11 04:34:39 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
 
-Wed Dec 17 15:15:30 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/test_cmath.rb: Add some assertions.
 
-	* lib/cgi.rb (CGI::QueryExtension::Value::[]): should work like
-	  String#[] if more than one arguments are specified.
+Thu Jun 11 00:34:39 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/delegate.rb: avoid using common instance name as "@obj".
+	* template/fake.rb.in: expanded macro result may have spaces
+	  between tokens.  [ruby-dev:49047] [Bug #11243]
 
-	* lib/cgi.rb (CGI::QueryExtension::Value): Value is no longer
-	  subclass of String, but DelegateClass(String).
+Wed Jun 10 22:27:32 2015  Naohisa Goto  <ngotogenome@gmail.com>
 
-	* ext/curses/extconf.rb: restore function check for init_color.
-	  [ruby-list:38905]
+	* lib/mkmf.rb: revert r50804 because of build failure when specifying
+	  LDFLAGS during configure, observed on Solaris with GCC 4.6.
+	  [Bug #11245]
 
-	* Makefile.in: need to specify $(MAINLIBS) for the miniruby
-	  generation rule.
+Wed Jun 10 21:59:51 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-	* configure.in: better FreeBSD -lc_r support.
+	* README.ja.md: fix markup miss.
 
-Wed Dec 17 00:16:14 2003  Minero Aoki  <aamine@loveruby.net>
+Wed Jun 10 11:06:25 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/strscan/strscan.c: new method
-	  StringScanner#beginning_of_line? (alias #bol?)
+	* template/fake.rb.in: turn into erb template from autoconf
+	  template to fake more accurately.
 
-	* ext/strscan/strscan.c: new method StringScanner#concat and #<<.
+	* common.mk (fake.rb): needs preprocessed file now.
 
-	* ext/strscan/strscan.c: StringScanner#new(str) does not duplicate
-	  nor freeze STR (allow destructive modification).
+	* version.c (Init_version): add dummy expression to
+	  RUBY_ENGINE_VERSION.
 
-	* test/strscan/test_stringscanner.rb: test new methods above.
+Tue Jun  9 12:31:25 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
 
-	* test/strscan/test_stringscanner.rb: test destructive string
-	  modification.
+	* lib/prime.rb: Simplify and optimize EratosthenesSieve
 
-Tue Dec 16 21:20:47 2003  Tanaka Akira  <akr@m17n.org>
+Tue Jun  9 11:45:00 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
 
-	* lib/pp.rb: don't use local variable `pp'.
+	* lib/prime.rb: Simplify and optimize EratosthenesSieve
+	  based on patch by Ajay Kumar. [Fixes GH-921]
 
-	* lib/prettyprint.rb: ditto.
+Mon Jun  8 05:09:58 2015  Koichi Sasada  <ko1@atdot.net>
 
-Tue Dec 16 13:20:43 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* gc.c (obj_info): print method id for T_IMEMO/ment.
 
-	* ext/tk/lib/tk.rb: condition bug of if statement on
-	  {pack,grid}_propagate methods
+Sun Jun  7 07:05:43 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
 
-Tue Dec 16 03:17:29 2003  why the lucky stiff  <why@ruby-lang.org>
+	* Move test cases from test/ruby/test_complex.rb to test/test_cmath.rb
 
-	* lib/yaml/rubytypes.rb: comments in strings. [ruby-talk:88012]
+Sat Jun  6 18:23:41 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* test/yaml/test_yaml.rb: add test.
+	* method.h: back to share rb_method_definition_t by
+	  rb_method_entry_t.
 
-Tue Dec 16 01:14:44 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	  r50728 changed sharing `def's to isolating `def's
+	  on alias and so on. However, this change conflicts
+	  future improvement plan. So I change back to sharing approach.
 
-	* eval.c (catch_timer): check rb_thread_crtical in main native
-	  thread.
+	* method.h: move rb_method_definition_t::flags to
+	  rb_method_entry_t::attr::flags.
 
-	* eval.c (thread_timer): just sends signals periodically, to
-	  prevent main native thread from receiving them in critical
-	  section.  [ruby-core:01959]
+	  rb_method_entry_t::attr is union with VALUE because this field
+	  should have same size of VALUE. rb_method_entry_t is T_IMEMO).
 
-Mon Dec 15 13:32:22 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	  And also add the following access macros to it's fields.
 
-	* dir.c (check_dirname): check string safety and remove extraneous
-	  trailing directory separators.  [ruby-dev:22279]
+	  * METHOD_ENTRY_VISI(me)
+	  * METHOD_ENTRY_BASIC(me)
+	  * METHOD_ENTRY_SAFE(me)
 
-	* file.c: renamed and externalized rb_path_next,
-	  rb_path_skip_prefix, rb_path_last_separator, rb_path_end.
+	* vm_method.c (rb_method_definition_addref): added instead of
+	  rb_method_definition_clone().
 
-	* intern.h: prototypes for rb_path_next, rb_path_skip_prefix,
-	  rb_path_last_separator, rb_path_end.
+	  Do not create new definition, but increment alias_count.
 
-Mon Dec 15 09:27:46 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* class.c (clone_method): catch up this fix.
 
-	* ext/openssl/ossl_pkcs12.c (ossl_pkcs12_initialize): first argument
-	  of rb_protect should take an argument of VALUE.
+	* class.c (method_entry_i): ditto.
 
-Sun Dec 14 18:46:48 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* proc.c (mnew_internal): ditto.
 
-	* ext/socket/socket.c (Init_socket): IPv6 is not supported although
-	  AF_INET6 is defined on MinGW.
+	* proc.c (mnew_missing): ditto.
 
-	* lib/ipaddr.rb (AF_INET6): workaround in the environment which does
-	  not support IPv6.
+	* vm_eval.c: ditto.
 
-Sat Dec 13 18:55:16 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* vm_insnhelper.c: ditto.
 
-	* ext/iconv/charset_alias.rb: preserve original order.
+	* vm_method.c: ditto.
 
-	* ext/iconv/extconf.rb: remove wrapper file at clean.
+Sat Jun  6 15:59:38 2015  Koichi Sasada  <ko1@atdot.net>
 
-Sat Dec 13 18:09:42 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* class.c: ins_methods_push() needs rb_method_visibility_t type on
+	  2nd arg.
 
-	* eval.c (thread_timer): use timer by sub-thread and nanosleep.
-	  [ruby-talk:87519]
+Sat Jun  6 15:05:47 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* gc.c (Init_stack): no stack adjustment for THREAD_SAFE.
+	* class.c (ins_methods_push): Change type and name of parameters
+	  to make more clear.
 
-Sat Dec 13 17:17:59 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Jun  6 08:52:13 2015  Eric Wong  <e@80x24.org>
 
-	* eval.c (proc_alloc): cache the created object at first time.
-	  [ruby-talk:61288], [ruby-dev:22240]
+	* test/socket/test_nonblock.rb: try to avoid EMSGSIZE
+	  [ruby-core:69466]
 
-Sat Dec 13 09:01:23 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Jun  6 07:58:30 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* configure.in: check ucontext.h.
+	* gc.c: remove struct mark_tbl_arg and pass objspace directly
+	  to avoid indirect access overhead.
 
-	* eval.c: use getcontext/setcontext() instead of setjmp/longjmp()
-	  on ia64 or with native thread enabled.  [ruby-core:01932]
+Sat Jun  6 07:08:45 2015  Eric Wong  <e@80x24.org>
 
-Sat Dec 13 03:09:14 2003  why the lucky stiff  <why@ruby-lang.org>
+	* ext/socket/ancdata.c (bsock_sendmsg_internal): drop redundant assignment
 
-	* lib/yaml/rubytypes.rb: anonymous struct fix. [ruby-core:01946]
+Sat Jun  6 01:00:06 2015  Naohisa Goto  <ngotogenome@gmail.com>
 
-	* test/yaml/test_yaml.rb: add test.
+	* ext/socket/ancdata.c (bsock_sendmsg_internal): all arguments are
+	  parsed even on systems without HAVE_STRUCT_MSGHDR_MSG_CONTROL
+	  to prevent SEGV caused by passing Qnil to RARRAY_LENINT and
+	  to preserve behavior before r50776.
+	  [Bug #11224] [ruby-core:69468] [Bug #11225] [ruby-core:69469]
 
-Fri Dec 12 22:36:44 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Fri Jun  5 22:37:42 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/csv.rb: add Cell#to_str and Cell#to_s for /.../ =~ aCell,
-	  "#{aCell}" and so on.
+	* class.c (ins_methods_push): change 3rd parameter's type
+	  from long to rb_method_visibility_t.
 
-	* test/csv/test_csv.rb: add tests.
+	* class.c (ins_methods_i): catch up this fix.
 
-Fri Dec 12 19:33:06 2003  Minero Aoki  <aamine@loveruby.net>
+	* class.c (method_entry_i): cast to st_data_t instead of `long'.
 
-	* lib/fileutils.rb (mkdir): remove trailing `/' from pathes.
+Fri Jun  5 20:37:10 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/fileutils.rb (rmdir): ditto. [ruby-dev:22238]
+	* internal.h: move definition of rb_cref_t to method.h.
 
-	* lib/fileutils.rb (rmdir_r): ditto.
+	* eval_intern.h: move definition of rb_scope_visibility_t
+	  to method.h.
 
-	* lib/fileutils.rb (fu_copy_dir): check if it is a directory after
-	  mkdir(2).
+	* method.h: change rb_cref_t::scope_visi from VALUE to
+	  rb_scope_visibility_t.
+	  [Bug #11219]
 
-Fri Dec 12 06:06:09 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* vm.c (vm_cref_new): accept rb_method_visibility_t directly.
 
-	* eval.c (proc_invoke): fix class name in warning message for
-	  define_method.  [ruby-dev:22235]
+	* vm_insnhelper.c (rb_vm_rewrite_cref): don't use 0,
+	  but METHOD_VISI_UNDEF.
 
-Thu Dec 11 21:24:43 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* vm_method.c (rb_scope_visibility_set): don't need to use cast.
 
-	* ext/openssl/ossl_pkcs12.[ch]: new files. add OpenSSL::PKCS12.
+	* vm_method.c (rb_scope_module_func_set): ditto.
 
-	* ext/openssl/ossl.[ch]: ditto.
+Fri Jun  5 17:27:30 2015  Eric Wong  <e@80x24.org>
 
-	* ext/openssl/MANIFEST: add ossl_pkcs12.[ch].
+	* ext/socket/ancdata.c (bsock_sendmsg_internal): avoid msg_control
+	  ptr if msg_controllen is zero to fix portability problems.
 
-Thu Dec 11 20:54:28 2003  Minero Aoki  <aamine@loveruby.net>
+Fri Jun  5 09:17:45 2015  Eric Wong  <e@80x24.org>
 
-	* lib/fileutils.rb (mkdir_p): remove trailing `/' befere mkdir(2).
-	  mkdir("nonexistdir/") does not work on NetBSD/Alpha 1.6.1.
+	* ext/socket/ancdata.c (bsock_sendmsg_internal): fix build error
+	  from r50776
 
-	* lib/fileutils.rb (fu_list): call to_str for all arguments.
+Fri Jun  5 07:05:58 2015  Eric Wong  <e@80x24.org>
 
-Thu Dec 11 20:07:01 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* io.c (sym_wait_readable, sym_wait_writable): declare
+	  (io_getpartial): use sym_wait_readable
+	  (io_write_nonblock): use sym_wait_writable
+	  (Init_IO): initialize sym_wait_*able
 
-	* lib/ftools.rb (makedirs): sync with fileutils.
+Fri Jun  5 06:43:00 2015  Eric Wong  <e@80x24.org>
 
-Thu Dec 11 19:53:03 2003  Minero Aoki  <aamine@loveruby.net>
+	* doc/extension.rdoc: note rb_get_kwargs changes keywords_hash
+	  [ruby-core:68507]
 
-	* lib/fileutils.rb (mkdir_p): catch all SystemCallErrors.
-	  (mkdir("C:\") causes EACCESS on Windows 2000/NTFS)
+Fri Jun  5 05:50:29 2015  Eric Wong  <e@80x24.org>
 
-Thu Dec 11 19:08:02 2003  Minero Aoki  <aamine@loveruby.net>
+	* ext/socket/ancdata.c (bsock_sendmsg_internal): use rb_scan_args
+	  [ruby-core:69439] [Feature #11207]
 
-	* lib/fileutils.rb (mkdir_p): check if it is a directory after
-	  mkdir(2) instead of before mkdir(2), to avoid race condition.
-	  [ruby-talk:87730]
-	  Refer: mkinstalldirs sh script, GNU mkdir(1) (coreutils 5.0)
+Fri Jun  5 02:20:06 2015  Koichi Sasada  <ko1@atdot.net>
 
-Thu Dec 11 18:49:30 2003  Minero Aoki  <aamine@loveruby.net>
+	* test/lib/envutil.rb (assert_no_memory_leak): change default value
+	  of limit from 1.5 to 2.0. It is ad-hoc fix to solve test failure
+	  in travis-ci.
 
-	* lib/fileutils.rb: def m( arg ) -> def m(arg).
+Fri Jun  5 01:17:21 2015  Koichi Sasada  <ko1@atdot.net>
 
-Thu Dec 11 11:39:43 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* vm_insnhelper.c (vm_defined): no need to use cast.
 
-	* configure.in (ieeefp.h), numeric.c: needed for finite() on
-	  Solaris.  [ruby-core:01921]
+Fri Jun  5 01:14:02 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* file.c (rb_stat_inspect): adjust format specifier.
+	* vm_insnhelper.c (vm_defined): show additional messages on rb_bug().
 
-	* parse.c (arg_prepend): nodetype() is for debug use.
+Fri Jun  5 01:06:02 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ruby.h (ISASCII, etc): cast to int to get rid of warning.
+	* vm_method.c (rb_add_method_iseq): use intermediate struct to
+	  avoid initializing struct with variables.
+	  [Bug #11217]
 
-	* ruby.h (alloca.h): include even in GCC.  [ruby-core:01925]
+	* method.h: add a comment about it.
 
-	* ext/bigdecimal/bigdecimal.c (GetVpValue): adjust format
-	  specifier.
+Fri Jun  5 00:55:21 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/bigdecimal/bigdecimal.c (BigDecimal_prec, BigDecimal_coerce,
-	  BigDecimal_divmod): use rb_assoc_new() to suppress memory usage.
+	* method.h: constify rb_method_refined_t::orig_me.
 
-	* ext/bigdecimal/bigdecimal.c (BigDecimal_split): ditto.
+	  Also constify the following functions.
 
-	* ext/dl/sym.c (rb_dlsym_guardcall): guard itself should be
-	  volatile.
+	  * rb_resolve_refined_method()
+	  * rb_method_entry_with_refinements()
+	  * rb_method_entry_without_refinements()
+	  * rb_method_entry_copy()'s parameter.
 
-	* ext/iconv/iconv.c (iconv_convert): ensure actual parameter with
-	  format specifier.
+	* class.c: catch up this fix.
 
-	* ext/pty/pty.c (MasterDevice, SlaveDevice, deviceNo): do not
-	  define unless used.
+	* vm_insnhelper.c: ditto.
 
-	* ext/pty/pty.c (getDevice): get rid of warning.
+	* vm_method.c: ditto.
 
-	* ext/socket/socket.c (port_str, sock_s_getaddrinfo,
-	  sock_s_getnameinfo): FIX2INT() now returns long.
+Thu Jun  4 12:47:54 SGT 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* ext/socket/socket.c (init_inetsock_internal): uninitialized
-	  variable.
+	* array.c: Revert r50763. because "reentered" is not typo.
 
-	* ext/syck/rubyext.c (syck_parser_assign_io): add prototype.
+Thu Jun  4 11:12:29 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* ext/syck/rubyext.c (rb_syck_mktime, yaml_org_handler): use
-	  ISDIGIT() instead of isdigit() to avoid warnings and for
-	  platforms which don't support non-ascii charater.
+	* ext/win32ole/win32ole.c: fix a typo. Patch by @davydovanton
+	  [fix GH-923]
+	* include/ruby/st.h: ditto.
+	* include/ruby/util.h: ditto.
 
-Wed Dec 10 19:28:56 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Jun  4 10:54:30 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* ext/stringio/stringio.c (strio_read): set EOF flag at short read.
-	  [ruby-dev:22223], [ruby-dev:22224]
+	* array.c: fix a typo. Patch by @manish-shrivastava
+	  [fix GH-922]
 
-Wed Dec 10 18:07:25 2003  Minero Aoki  <aamine@loveruby.net>
+Thu Jun  4 09:52:02 2015  Eric Wong  <e@80x24.org>
 
-	* lib/erb.rb: new method ERB#filename(=). [ruby-dev:22208]
+	* ext/openssl/lib/openssl/ssl.rb: use io/nonblock instead of fcntl
+	  [ruby-core:69382] [Feature #11190]
 
-Wed Dec 10 17:54:51 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Jun  4 07:22:45 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/stringio/stringio.c (strio_read): do not set EOF flag when
-	  requested length is zero.  [ruby-dev:22214]
+	* method.h: introduce rb_method_refined_t for refined method entry.
 
-Wed Dec 10 17:17:18 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* class.c (move_refined_method): catch up this fix.
 
-	* io.c (read_all): should return given string even if data read is
-	  empty.  [ruby-dev:22207]
+	* gc.c (mark_method_entry): ditto.
 
-Wed Dec 10 17:16:06 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* vm_eval.c (vm_call0_body): ditto.
 
-	* ext/stringio/stringio.c (strio_read): adjust behavior at reading
-	  beyond EOF to IO.  [ruby-dev:22205]
+	* vm_insnhelper.c (vm_call_method): ditto.
 
-	* test/ruby/ut_eof.rb (TestEOF::Seek): test behaviors at reading
-	  beyond EOF.
+	* vm_method.c: ditto.
 
-	* test/ruby/test_file.rb, test/stringio/test_stringio.rb: include
-	  TestEOF::Seek test case.
+Thu Jun  4 07:12:20 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Dec 10 15:01:19 2003  Shugo Maeda  <shugo@ruby-lang.org>
+	* dir.c (dirent_match): match short names only when FNM_SHORTNAME
+	  flag is given, for the backward compatibility, and the new
+	  behavior is often dangerous.  [ruby-core:69435] [Bug #11206]
 
-	* test/monitor/test_monitor.rb (test_cond): use Queue#deq
-	  instead of sleep.
+Thu Jun  4 05:44:01 2015  Eric Wong  <e@80x24.org>
 
-Wed Dec 10 14:45:39 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* variable.c (special_generic_ivar): remove flag
+	  (givar_i, rb_mark_generic_ivar_tbl): remove functions
+	  (rb_free_generic_ivar, rb_ivar_lookup, rb_ivar_delete,
+	   generic_ivar_set, rb_ivar_set, rb_ivar_defined,
+	   rb_copy_generic_ivar, rb_ivar_foreach, rb_ivar_count,
+	   rb_obj_remove_instance_variable):
+	   adjust for lack of ivar support in special constants
+	* test/ruby/test_variable.rb: test ivars for special consts
+	* internal.h: remove rb_mark_generic_ivar_tbl decl
+	* gc.c (gc_mark_roots): remove rb_mark_generic_ivar_tbl call
+	  [ruby-core:69441] [Feature #11208]
 
-	* ext/pty/pty.c (HAVE_SYS_IOCTL_H): need to include <sys/ioctl.h>
-	  for TIOCSCTTY on *BSD.  based on gotoyuzo's patch.
-	  (ruby-bugs:PR#1211)
+Thu Jun  4 05:13:34 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/pty/pty.c (establishShell): should close descriptors if fork
-	  failed.
+	* vm_insnhelper.c (def_iseq_ptr): `iseqval' is not available any more.
 
-Wed Dec 10 12:53:05 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+Thu Jun  4 04:50:12 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* win32/win32.h: define execv() using do_aspawn().
+	* class.c (method_entry_i): mtbl should not have `me' as NULL.
 
-	* process.c (proc_exec_v): remove #ifdef's which stopped needing.
+Thu Jun  4 04:28:45 2015  Koichi Sasada  <ko1@atdot.net>
 
-Tue Dec  9 23:32:23 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* class.c (clone_method): do not use me->klass, but use explicitly
+	  passed argument.
 
-	* ext/tk/lib/tk.rb, ext/tk/lib/tkcanvas.rb, ext/tk/lib/tkdialog.rb,
-	  ext/tk/lib/tkentry.rb, ext/tk/lib/tkscrollbox.rb, ext/tk/lib/tktext.rb,
-	  ext/tk/sample/tkalignbox.rb, ext/tk/sample/tkcombobox.rb,
-	  ext/tk/sample/tkmultilistbox.rb, ext/tk/sample/tkoptdb.rb, ext/tk/sample/tktextframe.rb,
-	  ext/tk/sample/demos-en/dialog1.rb, ext/tk/sample/demos-en/dialog2.rb,
-	  ext/tk/sample/demos-jp/dialog1.rb, ext/tk/sample/demos-jp/dialog2.rb:
-	  overrided instance methods, which are private methods on the super
-	  class, are changed to 'private'
+Thu Jun  4 04:10:43 2015  Koichi Sasada  <ko1@atdot.net>
 
-Tue Dec  9 19:53:02 2003  akira yamada  <akira@ruby-lang.org>
+	* vm_core.h (rb_vm_rewrite_cref_stack): rename to rb_vm_rewrite_cref().
 
-	* lib/uri/generic.rb (URI::Generic#route_from0): make case insensitive
-	  for host-part.
+	* class.c (clone_method): use renamed name.
 
-	* test/uri/test_generic.rb (test_route): added tests for the above
-	  change.
+	* vm_insnhelper.c (rb_vm_rewrite_cref): do not use `node' in variable
+	  names.
 
-Tue Dec  9 14:10:48 2003  Tanaka Akira  <akr@m17n.org>
+Wed Jun  3 23:03:50 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* io.c (rb_io_check_readable): don't call io_seek if EOF flag is set,
-	  to avoid clearing EOF flag.
-	  (rb_io_check_writable): ditto.
+	* vm_method.c: rename `rb_frame_...' to `rb_scope_...'.
 
-Tue Dec  9 02:53:55 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* eval_intern.h: move decl. of rb_scope_visibility_set() to method.h.
 
-	* ext/tk/sample/tkalignbox.rb: new sample script
+	* load.c: catch up this fix.
 
-Tue Dec  9 00:45:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
+Wed Jun  3 21:14:20 2015  Tanaka Akira  <akr@fsij.org>
 
-	* lib/test/unit/assertions.rb: renamed #assert_raises to #assert_raise
-	  and made the former call the latter. [ruby-core:01890]
+	* ext/rbconfig/sizeof/extconf.rb: Check C99 standard integer types.
 
-	* test/testunit/test_assertions.rb: ditto.
+Wed Jun  3 21:00:47 2015  Tanaka Akira  <akr@fsij.org>
 
-Tue Dec  9 00:07:35 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* configure.in: Don't check __int128.
 
-	* lib/soap/rpc/standaloneServer.rb: add 'shutdown' and 'status'
-	  methods as delegates to WEBrick.
+	* ext/rbconfig/sizeof/extconf.rb: Check __int128.
 
-	* test/soap/calc/{test_calc.rb,test_calc2.rb},
-	  test/soap/helloworld/test_helloworld.rb,
-	  test/wsdl/datetime/test_datetime.rb, test/wsdl/raa/test_raa.rb:
-	  follow the change.
+	* ext/rbconfig/sizeof/depend: sizes.c depends on
+	  ext/rbconfig/sizeof/extconf.rb.
 
-Mon Dec  8 22:48:03 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* template/sizes.c.tmpl: Detect check_sizeof.
 
-	* lib/test/unit/autorunner.rb: remove dependency to a particular
-	  runner.  [ruby-core:01901], [ruby-list:38869]
+Wed Jun  3 20:07:07 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/test/unit/ui/testrunnerutilities.rb: moved output level
-	  constants from Console.
+	* class.c (clone_method): remove redundant check for me->def != NULL.
+	  Now, all `me` have `me->def`.
 
-	* lib/test/unit/ui/console/testrunner.rb: ditto.
+	* proc.c (rb_method_entry_location): ditto.
 
-	* lib/test/unit/ui/{fox,gtk,gtk2,tk}/testrunner.rb (initialize):
-	  accept output_level.
+	* vm.c (rb_vm_check_redefinition_opt_method): ditto.
 
-Mon Dec  8 15:03:30 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* vm.c (add_opt_method): ditto.
 
-	* ext/syck/syck.c (syck_io_str_read): get rid of buffer overflow.
+	* vm_eval.c (vm_call0_body): ditto.
 
-Mon Dec  8 13:02:11 2003  Minero Aoki  <aamine@loveruby.net>
+Wed Jun  3 19:24:12 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/uri/common.rb: new method URI.regexp. [ruby-dev:22121]
+	* vm_core.h: rename enum missing_reason to enum method_missing_reason.
 
-	* test/uri/test_common.rb: add test for URI.regexp.
+	* vm_core.h: use enum method_missing_reason for
+	  rb_thread_t::method_missing_reason.
 
-Mon Dec  8 12:44:14 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* vm_eval.c: catch up this fix.
 
-	* pack.c: define swap16 and swap32 only if they are not
-	  defined. OpenBSD defines these macros. [ruby-dev:22181]
+	* vm_insnhelper.c: ditto.
 
-Sun Dec  7 20:54:17 2003  Tanaka Akira  <akr@m17n.org>
+Wed Jun  3 16:17:21 2015  Aaron Patterson <tenderlove@ruby-lang.org>
 
-	* ext/iconv/iconv.c (map_charset): make case sensitive.
-	  ext/iconv/charset_alias.rb (charset_alias): don't ignore
-	  config.charset's information.  sort aliases.
+	* vm.c: eagerly allocate `loading_table`.  This eliminates the need to
+	  do NULL checks when looking up the `loading_table` hash.
+	  https://github.com/ruby/ruby/pull/918
 
-Sat Dec  6 22:58:03 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* load.c: remove various NULL checks
 
-	* ext/openssl/ossl_ssl.c (ossl_start_ssl): new function to wrap
-	  SSL_connect and SSL_accept; if SSL_connect (or SSL_accept) returned
-	  but not finished the handshake process, we should retry it.
+Wed Jun  3 11:47:15 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/openssl/ossl_ssl.c (ossl_ssl_connect): call ossl_start_ssl.
+	* method.h: change fields order to gather frequent access fields.
 
-	* ext/openssl/ossl_ssl.c (ossl_ssl_accept): ditto.
+	* vm_insnhelper.c (vm_call_method): add LIKELY().
 
-	* ext/openssl/ossl_ssl.c (ossl_ssl_read): allow signal traps.
+Wed Jun 03 10:35:45 2015  Koichi Sasada  <ko1@atdot.net>
 
-Sat Dec  6 21:45:10 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* method.h: split rb_method_definition_t::flag to several flags.
 
-	* io.c (flush_before_seek): flush before seek on any platform.
+	  `flag' contains several categories of attributes and it makes us
+	  confusion (at least, I had confused).
 
-	* configure.in: ditto.
+	  * rb_method_visibility_t (flags::visi)
+	    * NOEX_UNDEF     -> METHOD_VISI_UNDEF     = 0
+	    * NOEX_PUBLIC    -> METHOD_VISI_PUBLIC    = 1
+	    * NOEX_PRIVATE   -> METHOD_VISI_PRIVATE   = 2
+	    * NOEX_PROTECTED -> METHOD_VISI_PROTECTED = 3
+	  * NOEX_SAFE(flag)  -> safe (flags::safe, 3 bits)
+	  * NOEX_BASIC       -> basic (flags::basic, 1 bit)
+	  * NOEX_MODFUNC     -> rb_scope_visibility_t in CREF
+	  * NOEX_SUPER       -> MISSING_SUPER (enum missing_reason)
+	  * NOEX_VCALL       -> MISSING_VCALL (enum missing_reason)
+	  * NOEX_RESPONDS    -> BOUND_RESPONDS (macro)
 
-Sat Dec  6 17:23:00 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	  Now, NOEX_NOREDEF is not supported (I'm not sure it is needed).
 
-	* lib/soap/soap.rb(SOAP::Env.getenv): allow upcase environment variable
-	  as well as downcase one.
+	  Background:
+	    I did not know what "NOEX" stands for.
+	    I asked Matz (who made this name) and his answer was "Nothing".
+	    "At first, it meant NO EXport (private), but the original
+	    meaning was gone."
+	    This is why I remove the mysterious word "NOEX" from MRI.
 
-	* lib/soap/netHttpClient.rb(SOAP::NetHttpClient#proxy=): check URI.
+	* vm_core.h: introduce `enum missing_reason' to represent
+	  method_missing (NoMethodError) reason.
 
-Fri Dec  5 23:22:30 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* eval_intern.h: introduce rb_scope_visibility_t to represent
+	  scope visibility.
+	  It has 3 method visibilities (public/private/protected)
+	  and `module_function`.
 
-	* lib/test/unit/assertions.rb (Test::Unit::Assertions::assert_raises,
-	  Test::Unit::Assertions::assert_nothing_raised): use the last
-	  argument as message unless class object.
+Wed Jun  3 08:06:30 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* test/testunit/test_assertions.rb (test_assert_raises): test for
-	  multiple exception list.  [ruby-core:01891]
+	* gem/bundled_gems: updated to test-unit 3.1.1 and minitest 5.7.0.
 
-	* test/testunit/test_assertions.rb (test_assert_nothing_raised): test
-	  for non-exception classes.
+Wed Jun  3 04:48:05 2015  Koichi Sasada  <ko1@atdot.net>
 
-Fri Dec  5 22:23:04 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* vm_insnhelper.c (vm_defined): check respond_to_missing?
+	  at defined?(func()).
+	  [Bug #11212]
 
-	* lib/soap/netHttpClient.rb: proxy support did not work.  fixed.
+	* test/ruby/test_defined.rb: add a test for this fix.
 
-	* lib/soap/property.rb: add class methods for loading property from
-	  stream/file/propertyfile.  propertyfile is a file which is located at
-	  somedir in $:.
+Wed Jun  3 04:34:39 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/soap/soap.rb, lib/soap/wsdlDriver.rb, lib/soap/rpc/driver.rb,
-	  lib/wsdl/importer.rb: load property from propertyfile 'soap/property'
-	  e.g. /usr/local/lib/ruby/site_ruby/1.8/soap/property.
+	* vm_insnhelper.c (vm_defined): skip respond_to_missing? when
+	  a method is available.
+	  [Bug #11211]
 
-	* test/soap/test_property.rb, test/soap/test_streamhandler.rb: new file.
+	* test/ruby/test_defined.rb: add a test for this fix.
 
-Fri Dec  5 17:26:23 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Jun  3 04:14:13 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* eval.c (rb_exec_end_proc): maintain tmp_end_procs.
-	  [ruby-dev:22154]
+	* insns.def (defined), vm_insnhelper.c (vm_defined):
+	  move instruction body to the vm_defined() function.
 
-Fri Dec  5 13:36:59 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Wed Jun  3 02:29:25 2015  Benoit Daloze  <eregontp@gmail.com>
 
-	* eval.c (rb_exec_end_proc): should not clear end_procs and
-	  ephemeral_end_procs before execution. [ruby-dev:22144]
+	* test/ruby/test_module.rb: Do not assume class variable order.
+	  Patch by @enebo.
 
-	* eval.c (rb_obj_extend): call Module#extended hook after
-	  extended_object.  [ruby-list:38866]
+Wed Jun  3 01:10:38 2015  Yusuke Endoh  <mame@tsg.ne.jp>
 
-	* object.c (Init_Object): Module#extended defined.
+	* vm_method.c (rb_method_definition_set): remove a double assignment.
+	  Coverity Scan found this bug.
 
-Fri Dec  5 13:17:30 2003  Tanaka Akira  <akr@m17n.org>
+Wed Jun  3 00:04:51 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* test/ruby/test_pipe.rb: use IO.pipe instead of IO.popen.
+	* vm_method.c (rb_alias): rename parameter names.
 
-Fri Dec  5 11:54:45 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Jun  2 23:27:18 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/stringio/stringio.c (strio_read): follow IO#read.
+	* method.h: remove rb_method_iseq_t::iseqval.
+	  While making a r50728, iseqval is needed (to mark correctly),
+	  but now just iseqptr is enough.
 
-	* test/ruby/ut_eof.rb, test/ruby/test_file.rb, test/ruby/test_pipe.rb,
-	  test/stringio/test_stringio.rb: add EOF test.
+	* class.c: catch up this fix.
 
-Fri Dec  5 02:49:35 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* gc.c: ditto.
 
-	* lib/test/unit/assertions.rb (Test::Unit::Assertions::assert_raises):
-	  allow multiple exception list.  [ruby-core:01884]
+	* proc.c: ditto.
 
-	* lib/test/unit/assertions.rb (Test::Unit::Assertions::assert_nothing_raised):
-	  check whether arguments are subclass of Exception.
+	* vm_method.c: ditto.
 
-Thu Dec  4 23:54:00 2003  Rick Ohnemus  <rick.ohnemus@systemware.com>
+Tue Jun  2 21:29:28 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* dln.c (aix_loaderror): should not use member named 'errno' which
-	  might be a macro (e.g. on AIX).
+	* proc.c (proc_curry): remove a debug line.
 
-Thu Dec  4 23:32:26 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Tue Jun  2 12:43:46 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* io.c (read_all): do not depend on lseek position.
-	  [ruby-dev:22026]
+	* method.h: make rb_method_entry_t a VALUE.
+	  Motivation and new data structure are described in [Bug #11203].
 
-Thu Dec  4 22:37:26 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	  This patch also solve the following issues.
 
-	* eval.c (rb_eval): preserve $! value when retry happens in the
-	  rescue clause.  [ruby-talk:86697]
+	  * [Bug #11200] Memory leak of method entries
+	  * [Bug #11046] __callee__ returns incorrect method name in orphan
+	                 proc
 
-Thu Dec  4 21:50:07 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/ruby/test_method.rb: add a test for [Bug #11046].
 
-	* lib/drb/drb.rb (DRb::DRbMessage::send_request, send_reply):
-	  should rescue errors and re-raise DRbConnError on write too.
-	  [ruby-dev:22132]
+	* vm_core.h: remove rb_control_frame_t::me. me is located at value
+	  stack.
 
-Thu Dec  4 16:41:17 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* vm_core.h, gc.c, vm_method.c: remove unlinked_method... codes
+	  because method entries are simple VALUEs.
 
-	* parse.y (exc_list): allow expanding list.  [ruby-dev:22134]
+	* method.h: Now, all method entries has own independent method
+	  definitions. Strictly speaking, this change is not essential,
+	  but for future changes.
 
-Thu Dec  4 14:09:24 2003  Minero Aoki  <aamine@loveruby.net>
+	  * rb_method_entry_t::flag is move to rb_method_definition_t::flag.
+	  * rb_method_definition_t::alias_count is now
+	    rb_method_definition_t::alias_count_ptr, a pointer to the counter.
 
-	* test/fileutils/test_fileutils.rb (test_cp): test if the error is
-	  kind of SystemCallError.  It is needless details that which errno
-	  is set on each systems.
+	* vm_core.h, vm_insnhelper.c (rb_vm_frame_method_entry) added to
+	  search the current method entry from value stack.
 
-Thu Dec  4 13:24:13 2003  Shugo Maeda  <shugo@ruby-lang.org>
+	* vm_insnhelper.c (VM_CHECK_MODE): introduced to enable/disable
+	  assertions.
 
-	* lib/monitor.rb: use Object#__send__ instead of Object#send.
+Tue Jun  2 10:46:36 2015  Eric Wong  <e@80x24.org>
 
-Thu Dec  4 13:17:45 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* test/socket/test_nonblock.rb: new test for sendmsg_nonblock
 
-	* lib/soap/streamHandler.rb: support latest released version of
-	  http-access2.
+Tue Jun  2 09:04:14 2015  Eric Wong  <e@80x24.org>
 
-Thu Dec  4 13:04:44 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* lib/benchmark.rb: just use Process::CLOCK_MONOTONIC
+	  [ruby-core:69390]
 
-	* lib/soap/soap.rb: add SOAP::Env module for environment repository
-	  such as HTTP_PROXY.
+Mon Jun  1 22:01:27 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/soap/property.rb: property implementation.
+	* lib/mkmf.rb (pkg_config): split --libs if --libs-only-l option
+	  is not available.  patch in [ruby-core:69428] by Hans Mackowiak.
+	  [ruby-core:69421] [Bug #11201]
 
-	* lib/soap/streamHandler.rb, lib/soap/wsdlDriver.rb,
-	  lib/soap/rpc/driver.rb: use soap/property.rb.
+Mon Jun  1 21:18:24 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/wsdl/importer.rb, lib/soap/wsdlDriver.rb, lib/soap/rpc/driver.rb:
-	  use SOAP::Env.
+	* gc.c (gc_mark_children): remove a garbage character
+	  introduced at the last commit.
 
-	* lib/soap/netHttpClient.rb: add basic_auth, ssl_config, and cookie
-	  management interface, but ignored for now.
+Mon Jun  1 19:24:42 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/xsd/charset.rb: add XSD::Charset.encoding= interface to set
-	  wiredump charset explicitly.  it was fixed to 'utf-8' when iconv or
-	  uconv module was found.
+	* vm_method.c (rb_method_entry_make): do not show warning message
+	  when method_entry is an alias.
 
-Thu Dec  4 10:43:58 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+Mon Jun  1 15:47:16 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/dl/sym.c (rb_dlsym_guardcall): __declspec(noinline) is VC7
-	  feature.
+	* internal.h: move class related definitions.
 
-Thu Dec  4 10:27:12 2003  Minero Aoki  <aamine@loveruby.net>
+Mon Jun  1 15:43:03 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/net/http.rb: update hyperlink to the Japanese document.
+	* class.c: remove needless include pragma for method.h.
 
-Thu Dec  4 09:12:43 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* struct.c: ditto.
 
-	* ext/openssl/ossl_asn1.c (asn1time_to_time): should check that
-	  the underlying value of ASN1_TIME isn't NULL. [ruby-core:01881]
+	* vm_method.c: ditto.
 
-Thu Dec  4 08:29:43 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Mon Jun  1 05:42:00 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/webrick/server.rb (GenericServer#start): should rescue
-	  Exception to avoid unexpected aborting. [ruby-core:01853]
+	* eval_intern.h, vm_method.c: move macros to functions.
+	  * SCOPE_TEST(f)  -> rb_frame_visibility_test(flag).
+	  * SCOPE_CHECK(f) -> rb_frame_visibility_check(flag).
+	  * SCOPE_SET(f)   -> rb_frame_visibility_set(flag).
 
-	* lib/webrick/server.rb (GenericServer#start_thread): should check
-	  that peeraddr isn't nil before printing.
+	* load.c (load_ext): use it.
 
-	* lib/webrick/httpresponse.rb (HTTPResponse#start_thread): should
-	  rescue Exception to avoid unexpected aborting of thread.
+Mon Jun  1 04:47:37 2015  Zachary Scott  <e@zzak.io>
 
-Thu Dec  4 03:48:59 2003  Tanaka Akira  <akr@m17n.org>
+	* ext/date/date_core.c: [DOC] Add comparison of Time and DateTime
+	  Patch provided by @pixeltrix
 
-	* lib/pathname.rb (Pathname#link, Pathname#symlink): obsoleted.
-	  (Pathname#make_link, Pathname#make_symlink): new method.
+Mon Jun  1 04:22:09 2015  Koichi Sasada  <ko1@atdot.net>
 
-Thu Dec  4 01:45:24 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* vm_core.h (VM_FRAME_MAGIC_DUMMY): introduce new frame type to
+	  recognize dummy frame.
 
-	* io.c (argf_read): should not terminate on empty string; wait
-	  until real EOF.  [ruby-dev:21969]
+	* vm.c (th_init): use new frame type.
 
-	* io.c (argf_read): should adjust length to read, when length is
-	  specified and read spans command line argument files.
+	* vm_args.c (raise_argument_error): ditto.
 
-Wed Dec  3 19:38:36 2003  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+Mon Jun  1 04:15:42 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/drb/drb.rb: correct fcntl parameter. [ruby-dev:22120]
+	* class.c (rb_class_has_methods): added to reduce dependency
+	  to internal class data structure.
 
-Wed Dec  3 13:49:07 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* internal.h: ditto.
 
-	* ext/tk/lib/tk.rb: 'format'==>'Kernel.format' (avoid override trouble)
+	* hash.c (has_extra_methods): use added function.
 
-	* ext/tk/lib/tkafter.rb: ditto.
+Mon Jun  1 04:11:48 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/tk/lib/tkcanvas.rb: ditto.
+	* gc.c , gc.h (rb_obj_info): export obj_info(VALUE) for debugging.
 
-	* ext/tk/lib/tkdialog.rb: ditto.
+Mon Jun  1 03:52:55 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/tk/lib/tktext.rb: ditto.
+	* test/ruby/test_gc.rb: increase timeout seconds for GC stressful
+	  debugging.
 
-Wed Dec  3 13:28:13 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sun May 31 04:18:06 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* Makefile.in (lex.c): try gperf first, and copy from the source
-	  directory if failed.  [ruby-dev:22123]
-
-	* ext/extmk.rb (MTIMES): let makefiles depend to mkmf.rb.
-
-	* lib/mkmf.rb (configuration): DLDFLAGS was duplicated.
-
-Tue Dec  2 23:18:12 2003  Minero Aoki  <aamine@loveruby.net>
-
-	* lib/net/http.rb: wrote the warning about HTTP_PROXY environment
-	  variable.
+	* method.h: fix typo of comments.
 
-Tue Dec  2 21:31:42 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sun May 31 03:36:42 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* bin/testrb: new test runner.  [ruby-core:01845]
+	* method.h: add VM_METHOD_TYPE_ALIAS rb_method_definition_t::type
+	  to fix [Bug #11173].
 
-	* lib/test/unit/autorunner.rb (Test::Unit::AutoRunner.run,
-	  Test::Unit::AutoRunner#process_args): take test list to run and
-	  options.
+	  Now, inter class/method alias creates new method entry
+	  VM_METHOD_TYPE_ALIAS, which has an original method entry.
 
-	* lib/test/unit/autorunner.rb (Test::Unit::AutoRunner::RUNNERS,
-	  Test::Unit::AutoRunner#run): should not exit inside a library,
-	  just return the result instead.
+	* vm_insnhelper.c (find_defined_class_by_owner): added.
+	  Search corresponding defined_class from owner class/module.
 
-	* lib/test/unit.rb: ditto.
+	* vm_method.c (rb_method_entry_get_without_cache): return me->klass
+	  directly for defined_class.
 
-	* test/runner.rb: exit with the test result.
+	  Now, no need to check me->klass any more.
 
-Tue Dec  2 20:18:48 2003  Eric Sunshine  <sunshine@sunshineco.com>
+	* vm_method.c (method_entry_set0): separated from method_entry_set().
 
-	* configure.in (AC_PROG_YACC): AC_DEFINE(OLD_YACC) if Yacc is found
-	  instead of Bison or byacc.
+	* vm_method.c (rb_alias): make method entry has VM_METHOD_TYPE_ALIAS.
 
-	* parse.y: If OLD_YACC is defined, ensure that YYMAXDEPTH is at least
-	  10000 (Bison's default) since some old versions of Yacc define it as
-	  low as 150 by default, which is too low for Ruby to parse some files,
-	  such as date/format.rb.  Among other issues, the parse problem causes
-	  "make test" to fail.
+	* vm_method.c (release_method_definition): support VM_METHOD_TYPE_ALIAS.
 
-Tue Dec  2 20:03:20 2003  Minero Aoki  <aamine@loveruby.net>
+	* vm_method.c (rb_hash_method_definition): ditto.
 
-	* test/fileutils/test_fileutils.rb: check if Pathnames are usable
-	  for arguments.
+	* vm_method.c (rb_method_definition_eq): ditto.
 
-Tue Dec  2 04:22:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
+	* vm_method.c (release_method_definition): ditto.
 
-	* lib/test/unit/assertions.rb: fixed #assert_no_match message.
+	* vm_insnhelper.c (vm_call_method): ditto.
 
-	* test/testunit/test_assertions.rb: ditto.
+	* vm_insnhelper.c (vm_method_cfunc_entry): ditto.
 
-Tue Dec  2 00:43:00 2003  why the lucky stiff  <why@ruby-lang.org>
+	* vm_eval.c (vm_call0_body): ditto.
 
-	* ext/syck/syck.c: string buffering bug.  decrementing by full
-	  max_size now. [ruby-core:01834]
+	* gc.c (mark_method_entry): ditto.
 
-Mon Dec  1 21:33:08 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* proc.c (method_def_iseq): ditto.
 
-	* numeric.c (num_sadded): prohibit singleton method definition for
-	  Numerics.  fill yet another gap between Fixnum and Bignum.
+	* proc.c (method_cref): ditto.
 
-Mon Dec  1 17:33:47 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* proc.c (rb_method_entry_min_max_arity): ditto.
 
-	* pack.c (htov16): converts endian using swap16. htov32(), hton16,
-	  hton32 as well. [ruby-talk:85377]
+	* test/ruby/test_alias.rb: add tests.
 
-	* pack.c (swap16): swap 2 bytes no matter how big short is on the
-	  platform.  swap32() is also prepared.
+	* test/ruby/test_module.rb: fix a test to catch up current behavior.
 
-	* numeric.c (rb_num2int): returns long to preserve information.
-	  rb_fix2int(), rb_num2uint(), rb_fix2uint() as well.
-	  [ruby-talk:85377]
+Sun May 31 03:34:25 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* numeric.c (rb_num2uint): should not check for value range if the
-	  source value is negative.
+	* vm_method.c (rb_unlink_method_entry): make it static.
 
-Mon Dec  1 17:14:34 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sun May 31 03:26:58 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* sample/optparse/opttest.rb: added.
+	* method.h, vm_method.c (rb_free_method_entry): constify a parameter.
 
-Mon Dec  1 16:10:52 2003  Dave Thomas  <dave@pragprog.com>
+	* vm_core.h: remove useless declaration about rb_unlink_method_entry().
 
-	* lib/rdoc/rdoc.rb: (etc) initial merge into main tree.
+Sat May 30 18:05:02 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Mon Dec  1 14:17:49 2003  Minero Aoki  <aamine@loveruby.net>
+	* lib/tempfile.rb (Remover#call): fixed wrong condition.  introduced at
+	  r50682.
 
-	* lib/fileutils.rb (fu_each_src_dest0): call #to_str to allow
-	  Pathname for arguments. [ruby-core:01795]
+Sat May 30 16:12:35 2015  Eric Wong  <e@80x24.org>
 
-	* test/fileutils/test_fileutils.rb: does much strict test on
-	  "same" files detecting.
+	* ext/socket/ancdata.c: use RB_GC_GUARD instead of volatile
+	  [ruby-core:69419] [Feature #11198]
 
-Mon Dec  1 09:28:14 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+Sat May 30 15:59:10 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub
-	  (XCFLAGS): re-export $(XCFLAGS).
+	* lib/tempfile.rb (Tempfile#initialize): initialize @unlinked to fix
+	  test failures introduced at r50682.  I hope that check the results of
+	  tests before committing, at least the tests about the changed feature.
 
-	* bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub
-	  (ARCH_FLAG): export $(ARCH_FLAG) (perhaps empty value).
+Sat May 30 11:02:55 2015  Martin Englund <martin@englund.nu>
 
-Mon Dec  1 01:03:27 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* doc/dtrace_probes.rdoc: change lingering dtrace probe documentation
+	  from function- to method-
 
-	* lib/mkmf.rb (TRY_LINK, link_command): added support for DLDFLAGS
-	  and ARCH_FLAG.  [ruby-dev:22085]
+Sat May 30 10:26:09 2015  Masaki Matsushita <glass.saga@gmail.com>
 
-Sun Nov 30 20:18:07 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* lib/tempfile.rb: refactoring.
+	  * use warn instead of STDERR.print
+	  * remove @tmpname and use @tmpfile.path
+	  * introduce @unlinked flag
+	  * Remover takes only @tmpfile
+	  * mode will be modified just before file reopen
 
-	* configure.in: keep ARCH_FLAG separate. export ARCH_FLAG.
-	  [ruby-core:01819]
+Sat May 30 09:02:51 2015  Eric Wong  <e@80x24.org>
 
-	* Makefile.in: add ARCH_FLAG to CFLAGS.
+	* include/ruby/intern.h (rb_generic_ivar_table): deprecate
+	* internal.h (rb_attr_delete): declare
+	* marshal.c (has_ivars): use rb_ivar_foreach
+	  (w_ivar): ditto
+	  (w_object): update for new interface
+	* time.c (time_mload): use rb_attr_delete
+	* variable.c (generic_ivar_delete): implement
+	  (rb_ivar_delete): ditto
+	  (rb_attr_delete): ditto
+	  [ruby-core:69323] [Feature #11170]
 
-	* Makefile.in: add @CPPFLAGS@ to CPPFLAGS.
+Sat May 30 09:14:28 2015  Scott Francis  <scott.francis@shopify.com>
 
-	* lib/mkmf.rb (link_command, cc_command): use ARCH_FLAG.
+	* cont.c (cont_free): check if ruby_current_thread is still valid.
+	  [Fix GH-914]
 
-	* lib/mkmf.rb (configuration): add ARCH_FLAG to DLDFLAGS.
+Sat May 30 08:36:04 2015  Eric Wong  <e@80x24.org>
 
-	* Makefile.in: add ARCH_FLAG to DLDFLAGS.
+	* variable.c (static int special_generic_ivar): move
+	  (rb_generic_ivar_table): rewrite for compatibility
+	  (gen_ivtbl_bytes): new function
+	  (generic_ivar_get): update to use ivar index
+	  (generic_ivar_update): ditto
+	  (generic_ivar_set): ditto
+	  (generic_ivar_defined): ditto
+	  (generic_ivar_remove): ditto
+	  (rb_mark_generic_ivar): ditto
+	  (givar_i): ditto
+	  (rb_free_generic_ivar): ditto
+	  (rb_mark_generic_ivar_tbl): ditto
+	  (rb_generic_ivar_memsize): ditto
+	  (rb_copy_generic_ivar): ditto
+	  (rb_ivar_set): ditto
+	  (rb_ivar_foreach): ditto
+	  (rb_ivar_count): ditto
+	  (givar_mark_i): remove
+	  (gen_ivtbl_mark): new function
+	  (gen_ivar_each): ditto
+	  (iv_index_tbl_extend): update for struct ivar_update
+	  (iv_index_tbl_newsize): ditto
+	  [ruby-core:69323] [Feature #11170]
 
-	* configure.in: should put getcwd in AC_CHECK_FUNCS, not
-	  AC_REPLACE_FUNCS.  [ruby-core:01826]
+Sat May 30 08:10:46 2015  Eric Wong  <e@80x24.org>
 
-Sun Nov 30 18:22:48 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* variable.c (iv_index_tbl_make): extract from rb_ivar_set
+	  (iv_index_tbl_extend): ditto
+	  (iv_index_tbl_newsize): ditto
+	  (rb_ivar_set): use extracted functions
+	  [ruby-core:69323] (Part 1)
 
-	* configure.in: do not override CCDLDFLAGS, LDFLAGS, XLDFLAGS,
-	  DLDFLAGS and LDSHARED.
+Fri May 29 17:39:14 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* configure.in: XCFLAGS for compiling ruby itself.  ARCH_FLAG is
-	  reflected in CFLAGS.
+	* tool/make_hgraph.rb: added.
 
-	* lib/mkmf.rb: ditto.  do not import XCFLAGS from config.status.
+Fri May 29 14:39:00 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Nov 30 17:37:36 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* compile.c (iseq_compile_each): out of range NTH_REF is always
+	  nil.
 
-	* ext/tk/lib/tk.rb: bug fix [ruby-talk:86746]
+	* parse.y (parse_numvar): check overflow of NTH_REF and range.
+	  [ruby-core:69393] [Bug #11192]
 
-Sun Nov 30 13:02:00 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* util.c (ruby_scan_digits): make public and add length parameter.
 
-	* lib/soap/encodingstyle/soapHandler.rb: refactoring - Simplifying
-	  Conditional Expressions.
+Fri May 29 11:18:58 2015  Eric Wong  <e@80x24.org>
 
-	* lib/wsdl/soap/definitions.rb: refactoring - Move Method.
+	* ext/socket/ancdata.c (bsock_sendmsg_internal,
+	  bsock_recvmsg_internal):
+	  avoid redundant fcntl on Linux
+	  [ruby-core:69154] [Feature #11145]
+	* ext/socket/init.c (rsock_s_recvfrom_nonblock): ditto
+	* ext/socket/rubysocket.h (MSG_DONTWAIT_RELIABLE): new macro
 
-	* test/xsd/{test_noencoding.rb,noencoding.xml}: new files.  test for
-	  encoding unspecified XML file parsing.
+Fri May 29 10:30:34 2015  Eric Wong  <e@80x24.org>
 
-	* test/wsdl/{test_fault.rb,map,datetime}: new files.  test of
-	  SOAPFault, dateTime and Apache's Map.
+	* lib/net/resolv.rb (request): use monotonic clock
+	* lib/net/http.rb (begin_transport, end_transport): ditto
+	  [ruby-core:69384] [Feature #11124]
 
-Sun Nov 30 09:35:14 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri May 29 04:37:38 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* string.c (rb_str_update): get rid of SEGV at just allocated String.
-	  [ruby-core:01812]
+	* ext/objspace/objspace.c: add two methods to debug internals.
 
-Fri Nov 28 23:19:34 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	  * ObjectSpace.internal_class_of: return RBASIC_CLASS(obj).
+	  * ObjectSpace.internal_super_of: return RCLASS_SUPER(cls).
 
-	* gc.c (gc_mark): explicitly check mark recursion levels, instead
-	  of unreliable stack length.
+	* NEWS: add information about both methods.
 
-Fri Nov 28 22:49:56 2003  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+	* test/objspace/test_objspace.rb: add tests for both methods.
 
-	* lib/rinda/rinda.rb: fix TupleSpaceProxy#read, read_all.
+Thu May 28 06:55:53 2015  Anton Davydov  <antondavydov.o@gmail.com>
 
-Fri Nov 28 21:44:40 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* ext/tk/sample/figmemo_sample.rb (open_file),
+	  ext/tk/sample/tktextio.rb (TkTextIO): fix typo in messages.
+	  [Fix GH-916]
 
-	* test/fileutils/test_fileutils.rb (test_ln_s): should be a file, not
-	  a directory for FreeBSD.
+Wed May 27 09:50:51 2015  Eric Wong  <e@80x24.org>
 
-Fri Nov 28 19:37:56 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/openssl/ossl_asn1.c (ossl_asn1_traverse, ossl_asn1_decode,
+	  ossl_asn1_decode_all): use RB_GC_GUARD instead of volatile
+	  [ruby-core:69371] [Bug #11185]
 
-	* hash.c (env_has_value, env_index): must match exactly.
+Wed May 27 09:27:30 2015  Eric Wong  <e@80x24.org>
 
-	* test/ruby/test_env.rb (test_has_value, test_index): condition for
-	  aboves.
+	* lib/drb/drb.rb (set_sockopt): remove redundant fcntl call
+	* lib/drb/unix.rb (set_sockopt): ditto
+	  [ruby-core:69128] [Feature #11137]
 
-Fri Nov 28 17:59:20 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+Tue May 26 22:10:43 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* test/ruby/test_env.rb: add tests for ENV.
+	* vm_method.c (rb_alias): should resolve refined methods.
+	  [ruby-core:69360] [Bug #11182]
 
-Fri Nov 28 17:47:46 2003  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+Tue May 26 21:35:13 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-	* lib/drb/drb.rb (DRbMessage#load): rescue Errno::* and raise
-	  DRbConnError.
+	* include/ruby/defines.h (RUBY_ATTR_ALLOC_SIZE): fix condition.
 
-Fri Nov 28 15:41:15 2003  Tanaka Akira  <akr@m17n.org>
+Mon May 25 22:35:58 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/pathname.rb (Pathname#realpath): obsolete the force_absolute
-	  argument.
+	* tool/redmine-backporter.rb (rel): after the relations is changed,
+	  @changesets is no longer right.
 
-Fri Nov 28 14:41:52 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Mon May 25 11:27:14 2015  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/soap/streamHandler.rb: drop unused http parameters.
+	* win32/win32.c (setup_overlapped): seek to the file end only when
+	  writing (mode:a), not reading (mode:a+, read).
 
-	* lib/soap/encodingstyle/soapHandler.rb, lib/soap/mapping/factory.rb,
-	  lib/soap/mapping/mapping.rb, lib/soap/mapping/registry.rb,
-	  lib/wsdl/soap/complexType.rb: ApacheSOAP's map support was broken
-	  under WSDL dynanic client environment.  fixed.
+Mon May 25 00:27:37 2015  Benoit Daloze  <eregontp@gmail.com>
 
-	* test/wsdl/raa/*: add tests.
+	* numeric.c (Numeric#negative?): [DOC] Fix call-seq.
+	  Patch by @yui-knk. [Fixes GH-908]
 
-	* lib/xsd/datatypes.rb: dateTime precision bug fix (at least, I hope.)
-	  bug of soap4r.  XSDDateTimeImple.to_time passed a Float to
-	  Time.local/Time.gm as an usec, and NUM2LONG(rb_num2long for Float)
-	  causes rounding error.
+Sun May 24 01:35:22 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* test/soap/test_basetype.rb, test/xsd/test_xsd.rb: add tests.
+	* debug.c (ruby_debug_print_id): use rb_id2name() for fprintf().
 
-Fri Nov 28 04:15:24 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat May 23 18:38:46 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (method_arity): used wrong Proc object.  [ruby-talk:86504]
+	* man/*.1: updated dates in man pages.
+	  [ruby-dev:48988] [Bug #11171]
 
-Fri Nov 28 00:47:29 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat May 23 03:10:58 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* eval.c (rb_f_exit), process.c (rb_f_exit_bang): treat true as
-	  success, false as failure.  [ruby-dev:22067]
+	* win32/win32.c (rb_w32_write_console): should return the count of
+	  actually eaten characters, include escape sequences.
 
-	* eval.c (rb_f_abort, rb_thread_switch), process.c (rb_f_system): use
-	  ANSI macro instead of hard coded value.
+Fri May 22 22:36:14 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
 
-	* eval.c (rb_f_exit), process.c (rb_f_exit_bang): use VALUEs not but
-	  TYPEs.
+	* lib/prime.rb: Remove obsolete Prime.new
+	  patch by Ajay Kumar. [Fixes GH-891]
 
-Thu Nov 27 22:05:48 2003  Akinori MUSHA  <knu@iDaemons.org>
+Fri May 22 21:13:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c, gc.c: FreeBSD/ia64 currently does not have a way for a
-	  process to get the base address for the RSE backing store, so
-	  hardcode it for the moment.
-	  [submitted by: Marcel Moolenaar <marcel@FreeBSD.org>]
+	* include/ruby/intern.h (rb_sym_count): move `rb_sym_all_symbols`
+	  to a symbol.c specific section.  a part of patch by Lourens
+	  Naude.
 
-Thu Nov 27 17:36:42 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Fri May 22 20:56:33 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/tk/lib/tkafter.rb: bug fix on TkTimer#cancel_on_exception=(mode).
-	  TkTimer#wait recieves the exception of the callback.
-	  The exception is kept on @return_value.
+	* complex.c (f_complex_polar): simple bug reproduced only when y is
+	  a float but x is not a float.
 
-Thu Nov 27 16:58:48 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+Fri May 22 19:42:06 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* win32/win32.c (rb_w32_stat): remove _fullpath() for NUL: device.
+	* process.c (rb_spawn_process): do not discard global escape
+	  status.  [ruby-core:69304] [Bug #11166]
 
-Wed Nov 26 15:38:47 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* process.c (rb_execarg_spawn): extract the start procedure in a
+	  parent process with ensuring the end procedure.
 
-	* test/fileutils/test_fileutils.rb (test_ln_s): should take the
-	  existing symbolic link for OpenBSD.
+Fri May 22 16:48:32 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Wed Nov 26 04:48:42 2003  why the lucky stiff  <why@ruby-lang.org>
+	* NEWS: added news for net-telnet and rake
 
-	* ext/syck/token.c: removed YYTOKTMP references which
-	  were causing buffer overflows on large block scalars,
-	  comments, quoted scalars and plain scalars.
+Thu May 21 20:27:07 2015  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/syck/rubyext.c: dynamic changing of buffer size.
+	* configure.in (RUBY_DTRACE_POSTPROCESS): cmp -b is GNU extension.
+	  darwin uses GNU cmp, and FreeBSD and Solaris are not.
+	  Note that accidentally equals to expected result.
 
-	* ext/syck/syck.h: default buffer size of 4k.
+Thu May 21 18:00:19 2015  Koichi Sasada  <ko1@atdot.net>
 
-Wed Nov 26 00:55:30 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* iseq.c: constify.
 
-	* lib/webrick/httpresponse.rb: add HTTPResponse#keep_alive=.
+	* iseq.h: ditto.
 
-	* lib/webrick/httpserver.rb (HTTPServer#run): should pass the
-	  request's keep_alive flag to the response.
+	* method.h: ditto.
 
-Tue Nov 25 21:41:35 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* proc.c: ditto.
 
-	* defines.h (ENV_IGNORECASE): should define when DOSISH without
-	  human68k. [ruby-dev:22047]
+	* vm_method.c: ditto.
 
-	* hash.c (env_has_value, env_index): don't ignore case of value.
-	  [ruby-dev:22048]
+Thu May 21 17:44:53 2015  Koichi Sasada  <ko1@atdot.net>
 
-Tue Nov 25 21:39:37 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* proc.c: fix issues caused by binding created from Method#to_proc.
+	  [Bug #11163]
 
-	* file.c (path_check_1): honor sticky bits always.
-	  [ruby-talk:86273]
+	* vm.c (vm_cref_new_toplevel): export as rb_vm_cref_new_toplevel().
 
-Tue Nov 25 20:02:14 2003  Minero Aoki  <aamine@loveruby.net>
+	* test/ruby/test_method.rb: add some assertions.
 
-	* test/fileutils/test_fileutils.rb: do test in more deep
-	  directory.
+Thu May 21 17:29:26 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* test/fileutils/test_nowrite.rb: ditto.
+	* lib/matrix.rb: added documentation for Matrix#empty and Matrix#/
+	  [Feature #10070][ruby-dev:48433] Patch by @gogotanaka
 
-Tue Nov 25 19:04:23 2003  Tanaka Akira  <akr@m17n.org>
+Thu May 21 17:02:43 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/open-uri.rb (URI::Generic#find_proxy): ENV case sensitivity test
-	  refined.
+	* proc.c: rename functions.
+	  * method_get_def() -> method_def()
+	  * method_get_iseq() -> method_def_iseq()
+	  * method_get_cref() -> method_cref()
 
-Tue Nov 25 18:13:30 2003  Minero Aoki  <aamine@loveruby.net>
+Thu May 21 16:52:44 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* test/fileutils/test_fileutils.rb: chdir Dir.tmpdir before each
-	  test. [ruby-dev:22045]
+	* proc.c (rb_method_get_iseq): rename to rb_method_iseq.
 
-	* test/fileutils/test_nowrite.rb: ditto.
+	* iseq.c: catch up this fix.
 
-Tue Nov 25 17:52:11 2003  Tanaka Akira  <akr@m17n.org>
+	* iseq.h: commit ditto.
 
-	* lib/open-uri.rb (URI::Generic#find_proxy): use http_proxy under CGI
-	  if the environment variable is case sensitive.
+Thu May 21 15:41:45 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Tue Nov 25 16:41:33 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* lib/net/telnet.rb: gemify net-telnet.
+	  [Feature #11083]
+	* gems/bundled_gems: added net-telnet to bundled gems.
 
-	* test/wsdl/multiplefault.wsdl, test/wsdl/test_multiplefault.rb:
-	  removed.  this test requires extra libraries in soap4r/1.5.*.
+Thu May 21 15:37:32 2015  Zachary Scott  <e@zzak.io>
 
-Tue Nov 25 16:24:42 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* vm_method.c: Remove private attribute warning [Bug #10967]
+	  Patch by @spastorino [Fixes GH-849]
+	  https://github.com/ruby/ruby/pull/849
 
-	* lib/soap/**/*.rb, lib/wsdl/**/*.rb, lib/xsd/**/*.rb: changed license;
-	  GPL2 -> Ruby's.
+	* test/ruby/test_module.rb: Update test for changes
 
-	* lib/soap/rpc/driver.rb, lib/soap/wsdlDriver.rb,
-	  lib/soap/streamHandler.rb: add interface to streamhandler.
+Thu May 21 10:59:43 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/soap/marshal.rb: raise error if parse fails.
+	* proc.c (method_proc): rename to method_to_proc.
 
-	* lib/soap/netHttpClient.rb: add https support.  Patched by
-	  Oliver M. Bolzer.
+Thu May 21 10:51:54 2015  Jake Worth  <jakeworth82@gmail.com>
 
-	* lib/soap/netHttpClient.rb: dump HTTP response message body by itself.
+	* io.c (rb_f_select): [DOC] Fixes for grammar and style.
+	  [Fix GH-906]
 
-	* lib/soap/rpc/driver.rb, lib/soap/rpc/proxy.rb,
-	  lib/soap/wsdlDriver.rb: add driver#mandatorycharset interface to foce
-	  using charset for parsing response from buggy server.
+Thu May 21 08:25:19 2015  Eric Wong  <e@80x24.org>
 
-	* lib/soap/encodingstyle/soapHandler.rb: support Apache Axis's half
-	  typed multi-ref array.
+	* variable.c (Init_var_tables): init generic_iv_tbl
+	  (rb_generic_ivar_table, generic_ivar_get, generic_ivar_set,
+	   generic_ivar_defined, generic_ivar_remove,
+	   rb_mark_generic_ivar, givar_i, rb_mark_generic_ivar_tbl,
+	   rb_free_generic_ivar, rb_copy_generic_ivar, rb_ivar_foreach,
+	   rb_ivar_count): remove checks for uninitialize generic_iv_tbl
+	[ruby-core:69155] [Feature #11146]
 
-	* lib/soap/mapping/factory.rb, lib/soap/mapping/registry.rb: map
-	  SOAPStruct which has multi-accessors which name are the same, to an
-	  array.
+Thu May 21 04:11:03 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/soap/rpc/element.rb: fixed illegal parameter order.
+	* iseq.c (exception_type2symbol): show correct bug message.
 
-	* lib/soap/rpc/element.rb: element name of response message could have
-	  the name other than 'return'.
+Wed May 20 23:19:05 2015  Yusuke Endoh  <mame@ruby-lang.org>
 
-	* lib/wsdl/operation.rb, lib/wsdl/operationBinding.rb,
-	  lib/wsdl/soap/classDefCreator.rb, lib/wsdl/soap/methodDefCreator.rb,
-	  lib/wsdl/soap/methodDefCreatorSupport.rb: WSDL/1.1 allows plural
-	  fault definition in a operation. [ruby-talk:84948]
+	* lib/base64.rb: Fix rdoc-formatting for padding argument.
+	  [fix GH-905][ci skip] Patch by @davydovanton
 
-	* test/wsdl/multiplefault.wsdl, test/wsdl/test_multiplefault.rb: add
-	  test for above fix.
+Wed May 20 13:16:23 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/wsdl/soap/complexType.rb: support WSDL array definition with
-	  maxOccures="unbound".
+	* configure.in (DEPRECATED_BY): deprecate warning with preferable
+	  alternative.
 
-	* lib/xsd/charset.rb: use cp932 under emx.  Patched by
-	  Siena. / SHINAGAWA, Norihide in [ruby-dev:21972]
+	* configure.in (RUBY_FUNC_ATTRIBUTE): allow attribute arguments in
+	  the macro.
 
-	* lib/xsd/xmlparser/parser.rb: set @charset nil by default.  Nil means
-	  'follow encoding declaration in XML'.
+Wed May 20 11:23:24 2015  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* sample/soap/digraph.rb, sample/wsdl/amazon/wsdlDriver.rb,
-	  sample/wsdl/googleSearch/sampleClient.rb,
-	  sample/wsdl/googleSearch/wsdlDriver.rb,
-	  test/wsdl/test_emptycomplextype.rb,
-	  test/wsdl/marshal/test_wsdlmarshal.rb,
-	  test/xsd/test_xmlschemaparser.rb: use File.open(...) { |f| f.read }
-	  instead of File.open(...).read. [ruby-dev:21964]
+	* vm_dump.c (rb_print_backtrace): return value of libexec's backtrace
+	  is size_t, so simply cast as int.
 
-	* test/wsdl/emptycomplextype.wsdl, test/wsdl/test_emptycomplextype.rb:
-	  simplify the test case.
+Tue May 19 18:54:41 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/wsdl/axisArray/*: add tests for axis's array encoding.
+	* iseq.c (rb_iseq_compile_with_option): check source type, must be
+	  an IO or a String.  [ruby-core:69219] [Bug #11159]
 
-Tue Nov 25 16:15:29 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+Tue May 19 17:15:03 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* ruby.h: don't treat Cygwin as Windows.
+	* lib/benchmark.rb: Update Benchmark documentation and formatting.
+	  [fix GH-903][ci skip] Patch by @davydovanton
 
-Tue Nov 25 15:18:28 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Tue May 19 13:10:08 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* configure.in: change default value of --enable-pthread (default: no)
+	* numeric.c (num_positive_p): should false on Bignum 0.
+	  http://twitter.com/rafaelfranca/status/600509783427391488
+	  [ruby-core:69173] [Feature #11151]
 
-Tue Nov 25 07:31:16 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue May 19 11:22:28 2015  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* parse.y (primary): allow newlines just before right argument
-	  parenthesis.  (ruby-bugs:PR#1221)
+	* lib/uri/rfc2396_parser.rb (initialize_pattern):
+	  URI::Generic.build should accept port as a string.
+	  pattern[:PORT] is not defined for long.
+	  by Dave Slutzkin <daveslutzkin@fastmail.fm>
+	  https://github.com/ruby/ruby/pull/804 fix GH-804
 
-Mon Nov 24 23:32:06 2003  Tanaka Akira  <akr@m17n.org>
+Tue May 19 11:18:46 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/open-uri.rb (OpenURI.open_loop, URI::HTTP#proxy_open): use
-	  catch/throw for redirection instead of exception.
-	  (OpenURI.open_loop, OpenURI.redirectable?): restrict redirection.
+	* include/ruby/ruby.h (rb_data_typed_object_alloc),
+	  (rb_data_object_alloc): add old names for source level backward
+	  compatibilities.
 
-Mon Nov 24 19:59:48 2003  Tanaka Akira  <akr@m17n.org>
+	* gc.c (rb_data_object_alloc, rb_data_typed_object_alloc): add
+	  aliases for binary level backward compatibilities.
 
-	* lib/open-uri.rb (URI::Generic#find_proxy): use CGI_HTTP_PROXY
-	  instead of HTTP_PROXY in the CGI environment.
+Tue May 19 09:54:44 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Nov 24 19:32:55 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* include/ruby/ruby.h (Data_Make_Struct0): needs function pointer
+	  casts to fix function overloading in C++.
 
-	* ext/etc/extconf.rb: check for pw_passwd in struct passwd and
-	  gr_passwd in struct group for DJGPP.
+Tue May 19 09:43:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/etc/etc.c: ditto.
+	* include/ruby/ruby.h (Data_Make_Struct0, TypedData_Make_Struct0):
+	  explicit cast from void* is necessary as implicit cast is
+	  disallowed in C++.
 
-	* ext/Setup.dj: support for curses, etc, zlib.
+Mon May 18 15:31:31 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Nov 24 17:00:00 2003  Tanaka Akira  <akr@m17n.org>
+	* include/ruby/intern.h (rb_f_notimplement): should not respond to
+	  not-implemented methods.  as the address inside a DLL and the
+	  imported address are different on Windows, use an exported
+	  variable to share the same address.
 
-	* lib/open-uri.rb: validate option names.
-	  :content_length_proc and :progress_proc option implemented.
+Mon May 18 13:55:01 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-Mon Nov 24 14:53:10 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* lib/monitor.rb (mon_try_enter, mon_enter): should reset @mon_count
+	  just in case the previous owner thread dies without mon_exit.
+	  [fix GH-874] Patch by @chrisberkhout
 
-	* bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub
-	  (XCFLAGS): output empty value instead of `-DRUBY_EXPORT'.
+Sun May 17 17:21:29 2015  Eric Wong  <e@80x24.org>
 
-Sat Nov 22 23:09:45 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* lib/webrick/utils.rb (set_non_blocking): use IO#nonblock=
+	* (set_close_on_exec): use IO#close_on_exec=
+	  [Feature #11136]
 
-	* configure.in: set enable_pthread to no on MinGW.
+Sun May 17 15:01:26 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Nov 22 22:56:20 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* numeric.c (num_positive_p, num_negative_p): add methods
+	  Numeric#positive? and Numeric#negative?.
+	  [ruby-core:69173] [Feature #11151]
 
-	* configure.in: add --enable-pthread option (default: yes)
+	* numeric.c (flo_positive_p, flo_negative_p): specialized
+	  functions for Float.
 
-Sat Nov 22 22:48:46 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* complex.c (Init_Complex): Complex do not have positive? and
+	  negative? methods
 
-	* ext/tk/lib/tk.rb: add Tk.grab_release and fix bug of TkComposite
+Sun May 17 14:57:42 2015  Eric Wong  <e@80x24.org>
 
-	* ext/tk/lib/tkafter.rb: bug fix of TkAfter#start
+	* lib/webrick/server.rb (accept_client): avoid redundant fcntl call
+	  [Feature #11137]
 
-	* ext/tk/sample/tkcombobox.rb: new sample script
+Sun May 17 12:13:33 2015  Eric Wong  <e@80x24.org>
 
-	* ext/tcltklib/tcltklib.c: add native thread check
+	* ext/socket/init.c (cloexec_accept): support nonblock flag and
+	  use SOCK_NONBLOCK if possible
+	* ext/socket/init.c (rsock_s_accept_nonblock):
+	  update cloexec_accept call
+	* ext/socket/init.c (accept_blocking): ditto for blocking
+	* test/socket/test_nonblock.rb: check nonblock? on accepted socket
+	  [Feature #11138]
 
-Sat Nov 22 18:49:47 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+Sun May 17 03:58:59 2015  Aaron Patterson <tenderlove@ruby-lang.org>
 
-	* ext/curses/curses.c (window_nodelay): nodelay() of NetBSD's
-	  libcruses returns no value, just like keypad().
+	* load.c (loaded_feature_path): stop returning false negatives for
+	  filenames which are trailing substrings of file extensions.  For
+	  example, 'b', which a trailing substring of ".rb" should not return
+	  false. [Bug #11155][ruby-core:69206]
 
-Sat Nov 22 17:36:36 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* test/ruby/test_autoload.rb: test for fix
 
-	* bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub
-	  (HAVE_GETCWD): output to config.h.
+Sat May 16 21:41:24 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub
-	  (XCFLAGS): output to config.status.
+	* string.c: added documentation for character sequence \' with String#sub
+	  [Bug #11132][ruby-core:69121][fix GH-900][ci skip] Patch by @shishir127
 
-Sat Nov 22 13:10:10 2003  Minero Aoki  <aamine@loveruby.net>
+Sat May 16 21:38:05 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* lib/fileutils.rb (have_st_ino?): djgpp has valid st_ino.
+	* enum.c: fix a sample code. Patch by @eagletmt
+	  [fix GH-901][ci skip]
 
-Sat Nov 22 11:28:48 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sat May 16 21:17:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* gc.c (Init_stack): stack region is far smaller than usual if
-	  pthread is used.
+	* gc.c (rb_data_object_wrap, rb_data_typed_object_wrap): rename
+	  alloc as wrap.  these functions do not allocate data pointers
+	  but just wrap the given pointers.
 
-Sat Nov 22 07:30:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
+Sat May 16 19:59:24 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/test/unit/util/backtracefilter.rb: fixed a bug that occurred
-	  when an exception had no backtrace.
+	* win32/win32.c (rb_w32_accept): simplified.
 
-	* test/testunit/util/test_backtracefilter.rb: ditto.
+Fri May 15 18:28:20 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Nov 21 16:44:18 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* array.c (rb_ary_assoc, rb_ary_rassoc): [DOC] the result when key
+	  was found is the existing element, not a new array.  reported by
+	  Giau Nguyen <giaunv AT nustechnology.com>.
 
-	* ext/tk/lib/tkentry.rb: fix the encoding trouble of percent
-	  substitutions on validatecommand option of TkEntry widget
+Fri May 15 08:24:28 2015  Takeyuki FUJIOKA  <xibbar@ruby-lang.org>
 
-	* ext/tk/lib/tk.rb: fix bug on {pack|grid}_propagate() method
+	* lib/cgi/cookie.rb: Implement HttpOnly flag for cookies.
+	  [fix GH-887] Patch by @martinpovolny
 
-Fri Nov 21 16:12:11 2003  Akinori MUSHA  <knu@iDaemons.org>
+Fri May 15 06:54:19 2015  Aaron Patterson <tenderlove@ruby-lang.org>
 
-	* ruby.1: Fix markups and grammar.
+	* variable.c: Change autoload to call `require` through Ruby rather
+	  than directly calling `rb_require_safe`.  This allows things like
+	  RubyGems to intercept file loading done though `autoload`.
+	  [Feature #11140]
 
-Fri Nov 21 14:49:42 2003  Minero Aoki  <aamine@loveruby.net>
+	* test/ruby/test_autoload.rb: Test for change.
 
-	* ruby.1: wrote about ruby related environment variables.
+Wed Apr  8 19:18:02 2015  Shota Fukumori (sora_h)  <her@sorah.jp>
 
-Fri Nov 21 12:28:03 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* enum.c (enum_grep_v, grep_i, grep_iter_i, Init_enum):
+	  Implement Enumerable#grep_v. [Feature #11049]
 
-	* marshal.c (w_extended): singleton methods should not be checked
-	  when dumping via marshal_dump() or _dump(). [ruby-talk:85909]
+Thu May 14 15:54:13 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Fri Nov 21 01:40:00 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* ext/pathname/lib/pathname.rb: Remove condition of RUBY_VERSION <= 1.9.
+	  [Feature #11082]
 
-	* configure.in: check <pthread.h>
+Wed May 13 17:10:37 2015  Masaki Matsushita <glass.saga@gmail.com>
 
-	* ruby.h: include pthread.h if existence.
-	  define is_ruby_native() macro when not HAVE_NATIVETHREAD
+	* enum.c (enum_to_a): revert r50457.
+	  it requires recursion check.
+	  then, it doesn't make performance improvement.
+	  [Bug #11130] [Feature #9118]
 
-	* eval.c: undef is_ruby_native() function when not HAVE_NATIVETHREAD
+Wed May 13 11:13:40 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Nov 21 00:43:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
+	* parse.y (parse_gvar): separate message for gvar without
+	  non-space characters from message for invalid identifiers.
 
-	* lib/test/unit/assertions.rb: use #__send__ instead of #send.
+Tue May 12 22:18:27 2015  Masaki Matsushita <glass.saga@gmail.com>
 
-	* lib/test/unit/testcase.rb: ditto.
+	* enum.c (enum_to_a): fix incompatibility introduced in r50457.
+	  [Bug #11130]
 
-Thu Nov 20 19:19:22 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* test/ruby/test_enum.rb: test for above.
 
-	* configure.in: don't find the Cygwin's pthread library on MinGW.
+Tue May 12 17:08:03 2015  Koichi Sasada  <ko1@atdot.net>
 
-Thu Nov 20 19:15:50 2003  Minero Aoki  <aamine@loveruby.net>
+	* method.h: remove unused declaration.
 
-	* lib/fileutils.rb (have_st_ino?): emx (OS/2 with EMX) does not
-	  have st_ino (always 0). [ruby-dev:21972]
+Mon May 11 10:58:45 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* lib/fileutils.rb (rename_cannot_overwrite_file?): emx does not
-	  allow overwriting files by rename(2).
+	* gems/bundled_gems: Update minitest-5.6.1 and power_assert-0.2.3.
 
-	* test/fileutils/test_fileutils.rb: windows? ->
-	  have_drive_letter?, have_file_perm?
+Mon May 11 00:20:31 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Nov 20 17:50:58 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* include/ruby/ruby.h (Data_Make_Struct, TypedData_Make_Struct):
+	  allocate wrapper data object before allocating DATA_PTR to get
+	  rid of possible memory leak when the former failed.
 
-	* ext/tk/sample/tkballoonhelp.rb: new sample script
+Sun May 10 21:32:45 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/sample/tkmultilistbox.rb: ditto
+	* gc.c (gc_mark_children): call dmark function for non-NULL
+	  pointers only, so that DATA_PTR can be NULL safely now.
 
-	* ext/tk/sample/tktextframe.rb: ditto
+Sun May 10 16:23:58 2015  Kazuki Tsujimoto  <kazuki@callcc.net>
 
-Thu Nov 20 13:37:34 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* proc.c (proc_binding): fix segmentation fault on marking phase.
+	  envptr of newenvval should not be NULL.
 
-	* ruby.h: define is_ruby_native_thread() for no native thread
-	  environment
+	  You can reproduce by
+	   make test-all TESTS='--gc-stress -n test_to_proc_binding ruby/test_method.rb'
 
-	* eval.c: ditto
+Sun May 10 12:41:18 2015  Masaki Matsushita <glass.saga@gmail.com>
 
-Thu Nov 20 12:42:47 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* ext/zlib/zlib.c (rb_gzreader_external_encoding):
+	  define GzipReader#external_encoding.
+	  [Bug #10900]
 
-	* configure.in: always check existence of the pthread library
+	* test/zlib/test_zlib.rb: test for above.
 
-	* ruby.h: define macros for ruby's native thread check
+Sun May 10 11:57:48 2015  Masaki Matsushita <glass.saga@gmail.com>
 
-	* eval.c: add ruby's native thread check
+	* ext/win32ole/win32ole_variant.c: fix typo "indicies".
+	  the patch is from davydovanton <antondavydov.o at gmail.com>.
+	  [fix GH-892]
 
-	* gc.c: ditto
+	* lib/rubygems/indexer.rb: ditto.
 
-Wed Nov 19 14:45:18 2003  Minero Aoki  <aamine@loveruby.net>
+	* test/rubygems/test_gem_indexer.rb: ditto.
 
-	* lib/net/http.rb (to_ary): print more friendly warning message.
+Sun May 10 11:44:37 2015  Masaki Matsushita <glass.saga@gmail.com>
 
-Wed Nov 19 14:32:08 2003  Minero Aoki  <aamine@loveruby.net>
+	* string.c (rb_str_crypt): Raise ArgumentError when
+	  string passed to String#crypt contains null.
+	  the patch is from jrusnack <jrusnack at redhat.com>.
+	  [Bug #10988] [fix GH-853]
 
-	* lib/fileutils.rb (fu_same?): add djgpp and wince.
+	* test/ruby/test_string.rb: test for above.
 
-	* lib/fileutils.rb (cannot_overwrite_file?): add wince.
+Sun May 10 11:23:03 2015  Masaki Matsushita <glass.saga@gmail.com>
 
-Wed Nov 19 11:04:47 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* enum.c (enum_to_a): Use size to set array capa when possible.
+	  the patch is from HonoreDB <aweiner at mdsol.com>.
+	  [fix GH-444]
 
-	* lib/fileutils.rb (cannot_overwrite_file?, have_st_ino?): bccwin32
-	  is same as mswin32.
+Sat May  9 06:48:36 2015  Eric Wong  <e@80x24.org>
 
-Wed Nov 19 07:54:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
+	* ext/socket/ancdata.c (bsock_recvmsg_internal): GC guard
+	  [Bug #11123]
 
-	* lib/test/unit.rb: do not run tests if $! is set.
+Fri May  8 22:57:24 2015  takiy33  <takiy33@gmail.com>
 
-	* lib/test/unit/assertionfailederror.rb: extend StandardError instead
-	  Exception (irb catches the former but not the latter).
+	* test/matrix/test_matrix.rb (test_determinant): refactor test on
+	  Matrix#determinant, by merging with test_det for an alias method
+	  det.  [Fix GH-897]
 
-Tue Nov 18 23:31:36 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+Fri May  8 15:43:11 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* missing/memmove.c (memmove): take void *, not char *.
+	* lib/net/imap.rb (body_ext_mpart): should work even if body-fld-dsp
+	  is omitted.  [ruby-core:69093] [Bug #11128]
 
-	* missing.h (memmove): ditto.
+Fri May  8 15:05:57 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* missing.h (strchr, strrchr): return char *, not int.
+	* doc/syntax/control_expressions.rdoc: fix a missing "a"
+	  [fix GH-888][ci skip] Patch by @riffraff
 
-Tue Nov 18 22:20:10 2003  Minero Aoki  <aamine@loveruby.net>
+Fri May  8 12:11:33 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/fileutils.rb (fu_same?): temporal fix for windows.
+	* vm_eval.c (rb_method_call_status): resolve refined method entry
+	  to check if undefined.  [ruby-core:69064] [Bug #11117]
 
-Tue Nov 18 19:05:04 2003  Minero Aoki  <aamine@loveruby.net>
+Thu May  7 22:22:59 2015  Sho Hashimoto  <sho-h@ruby-lang.org>
 
-	* lib/fileutils.rb (fu_same?): check by inode instead of path
-	  name, to detect two hard links pointing to the same content.
+	* proc.c: [DOC] fix Binding#local_variable_set example. [ci skip]
 
-	* test/fileutils.rb: did not create correctly looped symlinks.
+Thu May  7 11:32:57 2015  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Tue Nov 18 18:23:05 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* Makefile.in (rbconfig.rb): add rule to make.
 
-	* ext/stringio/stringio.c (strio_read): behave as IO at empty string.
-	  [ruby-dev:21939], [ruby-dev:21941]
+Thu May  7 05:14:39 2015  Eric Wong  <e@80x24.org>
 
-	* ext/stringio/stringio.c (strio_getc, strio_getline): set EOF flag.
+	* ext/socket/lib/socket.rb (connect_nonblock): use IO#wait_writable
+	* lib/drb/drb.rb (DRB::DRbTCPSocket#alive?): use IO#wait_readable
+	* lib/webrick/httpserver.rb (run): ditto
+	* lib/resolv.rb (request): ditto for single socket case
+	  [ruby-core:68943] [Feature #11081]
 
-	* ext/stringio/stringio.c (strio_rewind, strio_seek, strio_ungetc):
-	  clear EOF flag.
+Wed May  6 22:49:54 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/stringio/test_stringio.rb: imported from [ruby-dev:21941].
+	* vm_eval.c (rb_method_call_status): undefined refined method is
+	  not callable unless using.  [ruby-core:69064] [Bug #11117]
 
-Tue Nov 18 14:06:35 2003  Minero Aoki  <aamine@loveruby.net>
+Sun May  3 22:40:06 2015  Rei Odaira  <Rei.Odaira@gmail.com>
 
-	* lib/fileutils.rb (fu_each_src_dest): raise if src==dest.
-	  [ruby-talk:85344] [ruby-core:01699]
+	* ext/-test-/file/fs.c: need to include sys/statvfs.h
+	  to use statvfs().
 
-	* lib/fileutils.rb: use Object#is_a? instead of Class#=== to allow
-	  e.g. remote objects for receivers.
+	* ext/-test-/file/extconf.rb: check the existence of
+	  sys/statvfs.h
 
-	* lib/fileutils.rb: FileTest -> File.
+Sun May  3 21:59:48 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* lib/fileutils.rb: put parentheses for arguments of File.xxxx?
+	* lib/yaml.rb: fix typo. [ci skip][fix GH-890]
+	  Patch by @miketheman
 
-	* test/fileutils/test_fileutils.rb (test_cp): test "cp a a".
+Sun May  3 10:02:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/fileutils/test_fileutils.rb (test_mv): test "mv a a".
+	* range.c (linear_object_p, range_include): test if covered for
+	  linear objects.  [ruby-core:69052] [Bug #11113]
 
-	* test/fileutils/test_fileutils.rb (test_ln): test "ln a a".
+Fri May  1 13:30:24 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/fileutils/test_fileutils.rb (test_ln_s): test "ln_s a a".
+	* dln.c (dln_load): check if a different libruby is loaded by the
+	  extension library, and then bail out to get rid of very
+	  frequently reported stale bug reports.
 
-	* test/fileutils/test_fileutils.rb (test_install): test "install a a".
+Thu Apr 30 19:51:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/fileutils/fileasserts.rb: new method assert_symlink.
+	* compile.c (iseq_compile_each): revert r46873 and r46875, not to
+	  allow to execute private readers by pretending op assign.
+	  [ruby-core:68984] [Bug #11096]
 
-	* test/fileutils/fileasserts.rb: assert_is_directory -> assert_directory.
+Thu Apr 30 17:02:33 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Mon Nov 17 19:38:49 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* rational.c: Added documentation for rational literal.
+	  [Bug #11075][fix GH-885][ci skip] Patch by @shishir127
 
-	* file.c (getcwdofdrv): avoid using getcwd() directly, use
-	  my_getcwd() instead.
+Thu Apr 30 16:39:44 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* merged NeXT, OpenStep, Rhapsody ports patch from Eric Sunshine
-	  <sunshine@sunshineco.com>.  [ruby-core:01596]
+	* ext/socket/ipsocket.c (init_inetsock_internal): preserve errno
+	  before other library calls and use rb_syserr_fail.
+	  [ruby-core:68531] [Bug #10975]
 
-Mon Nov 17 10:50:27 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Apr 30 16:22:16 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/optparse.rb (OptionParser::Completion::complete): allow least
-	  common completion for three or more candidates.
+	* parse.y (lambda): push and reset cmdarg_stack in lambda body.
+	  [ruby-core:69017] [Bug #11107]
 
-Mon Nov 17 09:41:38 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sun Apr 26 07:36:48 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/test/unit/ui/tk/testrunner.rb,
-	  lib/test/unit/ui/gtk/testrunner.rb:
-	  run GUI main loop in sub thread.
+	* enc/utf_8.c (code_to_mbclen, code_to_mbc): reject values larger
+	  than UTF-8 max codepoints.  [Feature #11094]
 
-	* lib/test/unit/ui/gtk2/testrunner.rb: imported from rough.
+Sat Apr 25 14:26:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/test/unit/autorunner.rb (keyword_display): sort keywords.
+	* string.c (str_buf_cat): expand later so that the buffer can be
+	  larger for further use.  [Bug #11080] [Bug #11095]
 
-Sun Nov 16 18:10:57 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Apr 24 23:48:45 2015  Akinori MUSHA  <knu@iDaemons.org>
 
-	* eval.c (rb_eval): iterator should return value from next inside
-	  begin/rescue/end.  (ruby-bugs:PR#1218)
+	* misc/ruby-electric.el: Import version 2.2.3 from
+	  https://github.com/knu/ruby-electric.el.
 
-Sun Nov 16 13:26:07 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Apr 24 10:40:02 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* marshal.c (w_object): LINK check earlier than anything else,
-	  i.e. do not dump TYPE_IVAR for already dumped objects.
-	  (ruby-bugs:PR#1220)
+	* win32/win32.c (rb_w32_{getc,putc}): removed.  they are needed for old
+	  ruby (before 1.8), but not now.
 
-	* eval.c (rb_eval): call "inherited" only when a new class is
-	  generated; not on reopening.
+Fri Apr 24 08:40:13 2015  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* eval.c (eval): prepend error position in evaluating string to
-	  "mesg" attribute string only when it's available and is a
-	  string.
+	* win32/win32.c: remove bcc related code.
 
-Sun Nov 16 12:16:10 2003  Minero Aoki  <aamine@loveruby.net>
+	* include/ruby/win32.h: ditto.
 
-	* lib/net/protocol.rb: logging response body. [experimental]
-	  [ruby-list:38800]
+Fri Apr 24 08:21:07 2015  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Sun Nov 16 10:49:38 2003  Gavin Sinclair  <gsinclair@soyabean.com.au>
+	* win32/win32.c (rb_acrt_lowio_lock_fh): wrap _pioinfo(i)->lock.
 
-	* lib/thread.rb (Thread.exclusive): wrap method definition in
-	  class Thread to enable rdoc to process.
+	* win32/win32.c (rb_acrt_lowio_unlock_fh): ditto.
 
-Sun Nov 16 09:45:23 2003  Minero Aoki  <aamine@loveruby.net>
+Fri Apr 24 06:47:19 2015  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/net/http.rb (set_debug_output): warn if method is called
-	  after #start.  [ruby-dev:38798]
+	* win32/win32.c (_filbuf): msvc14 doesn't have it, use _fgetc_nolock.
 
-Sun Nov 16 04:41:33 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* win32/win32.c (_flsbuf): msvc14 doesn't have it, use _fputc_nolock.
 
-	* eval.c (eval): do not re-raise exception to avoid unnecessary
-	  exception copying, instead modify exception and internal
-	  information to adjust eval().
+	* win32/win32.c (vcruntime_file): define vcruntime_file on msvc14
+	  because it doesn't export FILE's internal structure.
 
-	* eval.c (backtrace): can return the current frame information
-	  only if lev < -1.
+	* win32/win32.c (FILE_COUNT): added to abstract FILE->_cnt.
 
-Sat Nov 15 22:16:42 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* win32/win32.c (FILE_READPTR): added to abstract FILE->_ptr.
 
-	* /ext/openssl/ossl_x509ext.c (ossl_x509extfactory_create_ext):
-	  refine error message.
+	* win32/win32.c (FILE_FILENO): added to abstract FILE->_file.
 
-Sat Nov 15 10:05:40 2003  Tanaka Akira  <akr@m17n.org>
+	* win32/win32.c (init_stdhandle): use FILE_FILENO.
 
-	* lib/open-uri.rb (OpenURI.open_loop, OpenURI::HTTP#proxy_open):
-	  refactored to support options.
-	  (Buffer): maintain size by this class.
+	* win32/win32.c (rb_w32_getc): use FILE_COUNT and FILE_READPTR.
 
-Sat Nov 15 07:40:14 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* win32/win32.c (rb_w32_putc): ditto.
 
-	* eval.c (rb_method_node): new API to retrieve method body.
+Fri Apr 24 06:37:07 2015  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Fri Nov 14 13:21:30 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* win32/win32.c (dupfd): use _set_osfhnd.
 
-	* ext/tcltklib/tcltklib.c: fix (en-bugged at 2003/11/07)
+	* win32/win32.c (rb_w32_wopen): use _set_osflags.
 
-	* ext/tk/lib/tkdialog.rb: TkDialog.new accepts a parent widget
-	  argument [ruby-talk:85066]
+Thu Apr 24 05:38:01 2015  Koichi Sasada  <ko1@atdot.net>
 
-Thu Nov 13 20:53:35 2003  Tanaka Akira  <akr@m17n.org>
+	* gc.c (gc_mark_roots): fox to work PRINT_ROOT_TICKS.
 
-	* lib/open-uri.rb (Kernel[#.]open): hard coded URI schemes removed.
-	  [ruby-ext:02251]
+Fri Apr 24 04:49:05 2015  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Thu Nov 13 19:17:00 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* win32/Makefile.sub: MSVC14 have struct timespec.
 
-	* lib/test/unit/ui/tk/testrunner.rb: use grid and panedwindow
-	  (if available)
+	* win32/rtname.cmd: support vcruntime140.dll.
 
-Thu Nov 13 17:56:41 2003  Tanaka Akira  <akr@m17n.org>
+	* time.c (localtime_with_gmtoff_zone): MSVC14 doesn't have tzname and
+	  daylight but have _tzname and _daylight.
 
-	* lib/open-uri.rb (OpenURI.open_uri): use File::RDONLY.
-	  reported by Take_tk <ggb03124@nifty.ne.jp>.
-	  [ruby-ext:02245]
+Thu Apr 23 11:35:55 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Nov 13 16:45:53 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* vm_eval.c (rb_obj_instance_eval, rb_obj_instance_exec): allow
+	  symbols to just instance_eval/exec, except for definition of
+	  singletons.  [ruby-core:68961] [Bug #11086]
 
-	* ext/openssl/ossl_x509req.c (ossl_x509req_to_der): add function for
-	  X509::Request#to_der.
+Thu Apr 23 10:01:36 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Thu Nov 13 11:31:14 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/delegate.rb: fix a typo.
+	  [fix GH-881][ci skip] Patch by @Zorbash
 
-	* lib/optparse.rb (OptionParser::Completion#complete): prior shorter
-	  name to containing longer name.
+Wed Apr 22 18:36:50 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-Thu Nov 13 06:08:54 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* lib/net/imap.rb (move, uid_move): support the MOVE command defined
+	  in RFC6851.  Patch by ojab ojab.
+	  [ruby-core:68960] [Feature #11077]
 
-	* ext/tk/lib/tk.rb: stop freezing some classes
+Tue Apr 22 12:42:12 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
 
-	* ext/tk/lib/multi-tk.rb: ditto.
+	* test/ruby/test_object.rb: add tests for Kernel#String and Kernel#Array.
+	  [fix GH-879][fix GH-880] Patch by @yui-knk
 
-Wed Nov 12 17:32:49 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Apr 21 20:46:02 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* lib/test/unit/assertions.rb (assert_throws, assert_nothing_thrown):
-	  uncaught throw in sub thread raises ThreadError.
+	* test/ruby/test_object.rb: renamed tests to explicitly class name.
+	  [fix GH-877] Patch by @yui-knk
 
-	* lib/test/unit/ui/tk/testrunner.rb (setup_ui): "expand" is not
-	  necessary.
+Tue Apr 21 05:31:00 2015  Eric Wong  <e@80x24.org>
 
-Wed Nov 12 14:09:43 2003  Shugo Maeda  <shugo@ruby-lang.org>
+	* ext/socket/lib/socket.rb (connect_internal): avoid common exceptions
+	  from connect_nonblock. [ruby-core:68909]
 
-	* test/monitor/test_monitor.rb: fix the timing problem by Queue.
+Mon Apr 20 23:46:53 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Wed Nov 12 12:59:44 2003  Shugo Maeda  <shugo@ruby-lang.org>
+	* win32/win32.c (rb_w32_wreadlink): follow the official format of
+	  REPARSE_DATA_BUFFER structure.
 
-	* test/monitor/test_monitor.rb: added.
+Mon Apr 20 20:23:04 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Wed Nov 12 10:14:28 2003  Shugo Maeda  <shugo@ruby-lang.org>
+	* common.mk ($(arch)-fake.rb): revert r50354 because bsdmake seems not
+	  to handle such substitution.
 
-	* lib/monitor.rb: refactored. Thanks, Gennady Bystritsky.
+	* tool/expand-config.rb: convert path separators here.
 
-Wed Nov 12 06:11:39 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Mon Apr 20 16:52:20 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/openssl/ossl.c (ossl_x509_sk2ary, ossl_x509crl_sk2ary):
-	  add functions to convert STACK into Array.
+	* tool/fake.rb: don't fake libdir.  use libdirname instead.
 
-	* ext/openssl/ossl.h: add prototypes.
+Mon Apr 20 16:49:52 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/openssl/ossl_pkcs7.c (ossl_pkcs7_set_certificates,
-	  ossl_pkcs7_get_certificates, ossl_pkcs7_get_crls,
-	  ossl_pkcs7_set_crls): add functions for PKCS7#certificates=
-	  PKCS7#certificates, PKCS7#crls= and PKCS7#crls.
+	* lib/mkmf.rb (MakeMakefile#configuration): DESTDIR should never affect
+	  top_srcdir and builddir.
 
-Wed Nov 12 00:47:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
+Mon Apr 20 16:18:17 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/test/unit/ui/testrunnermediator.rb: should require 'test/unit'.
+	* common.mk ($(arch)-fake.rb): fix the path separator up for Windows.
 
-Tue Nov 11 23:54:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
+Mon Apr 20 15:02:47 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/test/unit/ui/gtk/testrunner.rb: added a rescue clause to handle
-	  the case when the requested font is not available.
+	* win32/win32.c (rb_w32_wreadlink): fixed a bug that a junction misses
+	  its drive letter.
 
-Tue Nov 11 22:44:08 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Mon Apr 20 12:54:56 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* io.c (appendline): file may not end with newline.  a bug if
-	  READ_DATA_PENDING_PTR is defined. [ruby-talk:84925]
+	* ext/openssl/*: use license instead of licence.
+	  [fix GH-876][ci skip] Patch by @davydovanton
+	* lib/net/https.rb: ditto.
 
-Tue Nov 11 10:42:41 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Mon Apr 20 12:42:40 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* ext/tk/lib/tk.rb: raise an exception when creating TkWindow
-	  object, because TkWindow class is an abstract class.
+	* benchmark/bm_so_meteor_contest.rb: fix a typo.
+	  [fix GH-876][ci skip] Patch by @davydovanton
+	* tool/bisect.sh: ditto.
+	* tool/update-deps: ditto.
 
-Tue Nov 11 03:30:43 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Mon Apr 20 11:10:46 2015  Eric Wong  <e@80x24.org>
 
-	* lib/ext/openssl/ossl_conf.c (ossl_config_get_value): return nil
-	  if the specified value doesn't exist.
+	* ext/socket/socket.c (sock_connect_nonblock): do not raise EISCONN
+	  [ruby-core:68926] [Feature #11072]
+	* test/socket/test_nonblock.rb: check non-EISCONN on 2nd connect
 
-	* lib/ext/openssl/ossl_conf.c (ossl_config_get_section): return
-	  a empty hash if the specified section doesn't exist.
+Sun Apr 19 12:19:17 2015  Chad Brewbaker  <crb002@gmail.com>
 
-Mon Nov 10 11:40:29 2003  Shugo Maeda  <shugo@ruby-lang.org>
+	* ext/{etc,openssl,tk}: Adding parens and comparisons around
+	  assignments to get rid of Wparentheses warnings.  [Fix GH-875]
 
-	* lib/monitor.rb (wait): return true on signal/broadcastfalse and
-	  false on timeout. Thanks Gennady Bystritsky.
+Sun Apr 19 10:42:54 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Nov 10 00:07:10 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* hash.c (get_env_cstr): environment variables must be ASCII
+	  compatible, as dummy encodings and wide char encodings are
+	  unsupported now.
 
-	* parse.y (primary): primary_value may be 0 when syntax error.
-	  [ruby-talk:84893]
+Sat Apr 18 15:18:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Nov  9 02:05:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
+	* ext/json/parser/parser.rl: raise with messages in UTF-8
+	  encoding.  [ruby-core:67386] [Bug #10705]
 
-	* lib/test/unit/assertions.rb: un-deprecated #assert_not_nil to
-	  maintain symmetry with #assert_nil. Also added better output for
-	  #assert_kind_of.
+Fri Apr 17 11:58:34 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/testunit/tc_assertions.rb: ditto.
+	* string.c (STR_SET_EMBED): clear NOFREE flag at embedding as
+	  embedded strings no longer refer static strings.
+	  [ruby-core:68436] [Bug #10942]
 
-Sat Nov  8 18:50:20 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Thu Apr 16 05:15:50 2015  Eric Wong  <e@80x24.org>
 
-	* test/wsdl/raa/*: add new testcase for WSDL loading, parsing and
-	  reading.
+	* NEWS: note IO#wait_readable change in r50263
 
-	* test/soap/marshal/*: backport from soap4r/1.5.1.  all differences are
-	  for ruby/1.6.
+Thu Apr 16 05:09:36 2015  Eric Wong  <e@80x24.org>
 
-	* lib/soap/*: backport from soap4r/1.5.1.  all differences are for
-	  ruby/1.6.
+	* lib/net/protocol.rb (rbuf_fill): use IO#wait_*able
+	* lib/net/http/generic_request.rb (wait_for_continue): ditto
+	  [ruby-core:68891] [Feature #11056]
 
-	* lib/wsdl/data.rb, lib/wsdl/xmlSchema/data.rb: move definition of
-	  ArrayTypeAttrName from ::WSDL::XMLSchema::* to ::WSDL::*.
-	  [ruby-talk:84813]
+Wed Apr 15 18:43:43 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/wsdl/soap/definitions.rb: element name typo in custom exception
-	  struct definition which is needed for wsdlDriver; camelCase ->
-	  underscore_name.
+	* vm_trace.c (rb_tracepoint_new): fix documentation.
+	  Commented by @emilsoman.
 
-Sat Nov  8 13:49:50 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Wed Apr 15 17:36:51 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* configure.in: improvement of pthread check
+	* vm_trace.c (rb_tracepoint_new): Add documentation for
+	  rb_tracepoint_new C level API [ci skip]
+	  Provided by @emilsoman. [fix GH-869]
 
-Sat Nov  8 13:28:46 2003  Takaaki Tateishi  <ttate@ttsky.net>
-	* ext/dl/sym.c: Add DL.win32_last_error and DL.last_error.
-	  Thanks, Kaoru Shirai.
+Wed Apr 15 10:37:40 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-Sat Nov  8 06:19:38 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* doc/contributors.rdoc: fix a typo. Patch by @davydovanton
+	  [fix GH-872][ci skip]
+	* doc/syntax/methods.rdoc: ditto.
+	* ext/digest/sha2/sha2.c: ditto.
+	* ext/socket/ipsocket.c: ditto.
+	* ext/tk/*: ditto.
 
-	* ext/tcltklib/tcltklib.c: To fix 'pthread-enabled Tcl/Tk' problem,
-	  TclTkIp#_eval calls Tcl_Eval() on the mainloop thread only
-	  (queueing a handler to the EventQueue).
+Wed Apr 15 07:51:23 2015  Yuki Yugui Sonoda  <yugui@yugui.jp>
 
-	* ext/tcltklib/README.1st: edit the description of '--with-pthread-ext'
+	* doc/extension.ja.rdoc: Added description of TypedData_XXX.
+	  Deprecated the old DATA_XXX.
+	  Reviewed by ko1 and nobu.
+	  Fixes [ruby-dev:40881] #3064
 
-Fri Nov  7 23:23:04 2003  Tanaka Akira  <akr@m17n.org>
+	* doc/extension.rdoc: ditto.
 
-	* lib/pathname.rb (Pathname#+): if self or the argument is `.', return
-	  another.
-	  (Pathname#parent): if self is `.', return `..'.
-	  (Pathname#children): if self is `.', don't prepend self for a
-	  pathname in a result.
-	  (Pathname#join): re-implemented using Pathname#+.
-	  (Pathname#find): if self is `.', remove `./' prefix of yielding
-	  pathname.
+Wed Apr 15 07:34:49 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Nov  7 10:23:24 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* thread_pthread.c (reserve_stack): keep sp safe zone to get rid
+	  of crash by -fstack-check.  [ruby-core:68740] [Bug #11030]
 
-	* ext/socket/socket.c (make_hostent): get rid of SEGV on aliases
-	  lookup failure.  (ruby-bugs:PR#1215)
+Tue Apr 14 16:03:49 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Fri Nov  7 04:08:05 2003  UENO Katsuhiro  <katsu@blue.sky.or.jp>
+	* tool/merger.rb (versionup): should also increment revision when
+	  changing teeny.
 
-	* ext/zlib/zlib.c (Init_zlib): define Zlib::GzipReader#each_line as
-	  an alias of Zlib::GzipReader#each.
+Tue Apr 14 11:24:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Nov  7 01:03:16 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/-test-/printf/printf.c (uint_to_str): renamed to get rid of
+	  conflict on cygwin.  [ruby-core:68877] [Bug #11065]
 
-	* eval.c (rb_load): save and restore rb_prohibit_interrupt.
-	  [ruby-dev:21857]
+Tue Apr 14 08:59:04 2015  Zachary Scott  <e@zzak.io>
 
-Thu Nov  6 18:05:07 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* gc.c: [DOC] Improve documentation for ObjectSpace.count_objects
+	  with regards to `:TOTAL` key, with patch by @schneems [Fixes GH-871]
+	  https://github.com/ruby/ruby/pull/871 [Bug #11067]
 
-	* io.c (rb_io_inspect): show the path also at a closed file.
-	  [ruby-dev:21851]
+Mon Apr 13 22:44:07 2015  Tanaka Akira  <akr@fsij.org>
 
-Thu Nov  6 11:42:07 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/lib/envutil.rb (File.mkfifo): Defined using mkfifo command.
 
-	* ext/stringio/stringio.c (strio_set_string, strio_reopen): check
-	  tainted.
+	* test/ruby/test_io.rb: Use File.mkfifo.
 
-	* ext/stringio/stringio.c (strio_copy, strio_ungetc, strio_write,
-	  strio_putc): add infection.
+	* test/ruby/test_file_exhaustive.rb: Ditto.
 
-	* ext/stringio/stringio.c (strio_path): just nil.  [ruby-dev:21846]
+	* test/ruby/test_process.rb: Ditto.
 
-	* ruby.c (proc_options): reserve searched script path in the
-	  source file name table.  [ruby-list:38765]
+Mon Apr 13 21:20:20 2015  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
 
-	* lib/optparse.rb (OptionParser::Completion#complete): default not to
-	  ignore case on completion.  [ruby-talk:84726]
+	* ext/openssl/lib/openssl/ssl.rb: stricter hostname verification
+	  following RFC 6125. with the patch provided by Tony Arcieri and
+	  Hiroshi Nakamura [ruby-core:61545] [Bug #9644]
+	* test/openssl/test_ssl.rb: add tests for above.
 
-	* win32/win32.c (make_cmdvector): process backslashes even if a quote
-	  is not enclosed.
+Sun Apr 12 18:40:04 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-Wed Nov  5 23:49:45 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* ext/json/json.gemspec: bump version to 1.8.2.
+	* ext/json/lib/json/version.rb: ditto.
 
-	* sample/openssl/gen_csr.rb: there (at least) is a CA which does not
-	  accept DN in UTF8STRING format.  it's a sample.
+Sun Apr 12 18:12:07 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-Wed Nov  5 22:55:16 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* ext/json/json.gemspec, lib/rdoc/rdoc.gemspec: added gemspec directly.
+	* defs/default_gems, tool/rbinstall.rb: removed default_gems definition.
+	  it make simple installation for default gems.
 
-	* configure.in, eval.c, signal.c: : add '--with-pthread-ext'
-	  option to fix the pthread trouble on 'tcltklib'
+Sun Apr 12 17:35:17 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-	* ext/tcltklib/README.1st: add the description of '--with-pthread-ext'
+	* ext/json/*, test/json/*: Reverted r50231.  Because it's not
+	  working with cross-compile environment.
 
-	* ext/tk/lib/tktext.rb : add TkText#text_copy, text_cut, text_paste
-	  to support Tcl/Tk8.4's tk_textCopy, tk_textCut, tk_textPaste
+Sun Apr 12 15:34:59 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/lib/tk.rb : add TkMenu#set_focus support Tcl/Tk's
-	  tk_menuSetFocus
+	* parse.y (arg): fix segfault by null caused by syntax error.
+	  [ruby-core:68851] [Bug #10957]
 
-Wed Nov  5 17:33:45 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sun Apr 12 15:11:16 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-	* eval.c (rb_load): allow interrupt during loaded program
-	  evaluation.  [ruby-dev:21834]
+	* lib/rubygems/test_case.rb: use explicitly exception class and reverted
+	  to require JSON library for rubygems tests with Ruby 2.2.0 or earlier.
 
-	* hash.c (rb_hash_fetch): always warn if default argument and a
-	  block are supplied at the same time. [ruby-dev:21842]
+Sun Apr 12 15:10:18 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* hash.c (env_fetch): ditto.
+	* ext/io/wait/wait.c (io_wait_readable): simply returns that IO is
+	  readable without blocking, but no longer returns EOF.
 
-	* array.c (rb_ary_fetch): ditto.
+	* ext/io/wait/wait.c (io_ready_p, io_wait_readable): try polling
+	  first and check FIONREAD optionally to see if EOF.
+	  [ruby-core:36805] [Feature #4849]
 
-Wed Nov  5 19:08:47 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sun Apr 12 14:53:23 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-	* lib/optparse.rb (OptionParser::Switch::PlacedArgument::parse):
-	  do not remove next argument if empty value is placed.
+	* lib/rubygems/test_case.rb: fixed json load error for rubygems tests.
 
-	* test/optparse: added.
+Sun Apr 12 14:13:28 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-Wed Nov  5 17:05:18 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* gc.c: Document require name for ObjectSpace methods.
+	  [ci skip][fix GH-860] Patch by @schneems
 
-	* lib/test/unit/ui/gtk/testrunner.rb: typo.
+Sun Apr 12 13:54:05 2015  Tanaka Akira  <akr@fsij.org>
 
-Wed Nov  5 11:13:32 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* test/ruby/test_io.rb: New test that open(fifo) doesn't block other
+	  threads.
 
-	* string.c: add #include "version.h". this file still depends on it.
+Sun Apr 12 13:52:18 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-	* Makefile.in, bcc32/Makefile.sub, win32/Makefile.sub,
-	  wince/Makefile.sub: add version.h dependency to string.c.
+	* ext/coverage/coverage.c: Remove extension from require argument.
+	  [ci skip][fix GH-870] Patch by @yui-knk
 
-Wed Nov  5 09:14:23 2003  Shugo Maeda  <shugo@ruby-lang.org>
+Sun Apr 12 10:29:14 2015  Eric Wong  <e@80x24.org>
 
-	* lib/monitor.rb: revert to the previous revision.
+	* ext/openssl/ossl_ssl.c (ossl_ssl_connect_nonblock):
+	  support `exception: false'
+	* (get_no_exception): move function location
+	* ext/socket/socket.c (sock_connect_nonblock):
+	  support `exception: false'
+	* test/openssl/test_pair.rb (test_connect_accept_nonblock_no_exception):
+	  test `exception: false' on connect,
+	  rename from `test_accept_nonblock_no_exception'
+	* test/socket/test_nonblock.rb (test_connect_nonblock_no_exception):
+	  new test
 
-Wed Nov  5 08:39:51 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Sun Apr 12 09:57:16 2015  Tanaka Akira  <akr@fsij.org>
 
-	* lib/webrick/https.rb (HTTPRequest#parse): set @client_cert_chain.
+	* test/ruby/test_file_exhaustive.rb: Test a block device on GNU/Linux.
 
-	* lib/webrick/https.rb (HTTPRequest#meta_vars): create
-	  SSL_CLIENT_CERT_CHAIN_n from @client_cert_chain.
+Sun Apr 12 09:24:03 2015  Tanaka Akira  <akr@fsij.org>
 
-	* ext/openssl/ossl_ssl.c (ossl_ssl_get_peer_cert_chain): return nil
-	  if no cert-chain was given.
+	* test/ruby/test_file_exhaustive.rb: Test a file not owned.
 
-Tue Nov  4 23:44:48 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+Sun Apr 12 09:05:44 2015  Tanaka Akira  <akr@fsij.org>
 
-	* bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub:
-	  remove needless version.h dependency.
+	* ext/fiddle/depend: Fix "Wrong mix of special targets" error with
+	  OpenBSD make.
 
-Tue Nov  4 23:38:43 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+Sun Apr 12 09:04:37 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* class.c, hash.c, string.c: remove #include "version.h".
+	* test/ruby/test_file_exhaustive.rb: Windows doesn't support Unix file
+	  modes.
 
-	* Makefile.in: remove needless version.h dependency.
+Sun Apr 12 08:56:44 2015  Tanaka Akira  <akr@fsij.org>
 
-Tue Nov  4 06:54:52 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/-test-/file/fs.c: OpenBSD needs sys/param.h before sys/mount.h.
 
-	* io.c (read_all): fptr->f may be NULL, if IO is closed in the
-	  signal handler.
+Sun Apr 12 08:52:01 2015  Tanaka Akira  <akr@fsij.org>
 
-	* io.c (io_read): ditto.
+	* test/ruby/test_file_exhaustive.rb: Test suid, sgid and sticky file.
 
-	* string.c (get_pat): remove 1.8.0 warning code.
+Sat Apr 11 23:48:30 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-	* string.c (rb_str_match): extend warning until 1.8.2.
+	* template/fake.rb.in: Don't assign baseruby, Because it's affect to
+	  Makefile of native gem like json on bundled gems.
 
-	* string.c (rb_str_match2): ditto.
+Sat Apr 11 23:33:22 2015  Tanaka Akira  <akr@fsij.org>
 
-	* class.c (class_instance_method_list): remove 1.8.0 warnings.
-	  method_list now recurs.  [ruby-dev:21816]
+	* file.c (rb_f_test): Consider nsec for "=", "<" and ">" for "test"
+	  method.
 
-	* class.c (rb_obj_singleton_methods): ditto.
+Sat Apr 11 23:26:05 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-	* array.c (rb_ary_select): remove select with block.
-	  [ruby-dev:21824]
+	* tool/rbinstall.rb: support destdir for native extension gem.
 
-	* hash.c (rb_hash_select): ditto.
+Sat Apr 11 21:02:06 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* hash.c (env_select): ditto.
+	* test/ruby/test_file_exhaustive.rb
+	  (TestFileExhaustive#test_stat_socket_p): r50226 accidentally missed
+	  the guard for non-unix environments.
 
-	* re.c (match_select): ditto.
+Sat Apr 11 20:14:21 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-	* struct.c (rb_struct_select): ditto.
+	* ext/json/*, test/json/*, defs/default_gems: Gemify JSON library.
+	  [fix GH-867][Feature #11057]
+	* test/ruby/test_extlibs.rb: removed json gem from existence extensions.
+	* gems/bundled_gems: added json gem into bundled gem.
+	* lib/rdoc/rubygems_hook.rb: ignored no json environment.
+	* lib/rubygems/test_case.rb, test/rubygems/*: ditto.
+	* lib/rdoc/test_case.rb, test/rdoc/*: ditto.
 
-Mon Nov  3 22:53:21 2003  Minero Aoki  <aamine@loveruby.net>
+Sat Apr 11 15:56:58 2015  Tanaka Akira  <akr@fsij.org>
 
-	* lib/racc/parser.rb: synchronize with Racc 1.4.4.
+	* test/ruby/test_file_exhaustive.rb: Create sample files lazily.
 
-	* ext/racc/cparse/cparse.c: ditto.
+Sat Apr 11 14:03:47 2015  Tanaka Akira  <akr@fsij.org>
 
-	* ext/racc/cparse/cparse.c (parse_main): should abort when
-	  the length of LR state stack <=1, not ==0.
+	* test/ruby/test_file_exhaustive.rb: Test character device using
+	  /dev/null.
 
-Mon Nov  3 08:50:47 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sat Apr 11 10:59:58 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* process.c (check_uid_switch): remove duplicated error messages.
+	* lib/mkmf.rb (append_cppflags, append_cflags, append_ldflags):
+	  utility methods to append compiler options.
 
-	* process.c (check_gid_switch): ditto.
+Sat Apr 11 08:22:24 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-Sun Nov  2 02:28:33 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* lib/rdoc/text.rb: removed duplicated code.
 
-	* lib/webrick/ssl.rb: new option :SSLExtraChainCert.
+Sat Apr 11 04:46:42 2015  Eric Wong  <e@80x24.org>
 
-Sun Nov  2 01:02:04 2003  Akinori MUSHA  <knu@iDaemons.org>
+	* lib/net/protocol.rb (rbuf_fill): avoid exception with read_nonblock
+	  [ruby-core:68787] [Feature #11044]
 
-	* string.c (rb_str_hash): Update the HASH_PERL alternative hash
-	  algorithm in sync with Perl 5.8.
+Fri Apr 10 23:57:44 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* st.c (strhash): Ditto.
+	* dir.c (need_normalization): use getattrlist() if fgetattrlist()
+	  is unavailable, on OSX 10.5.  [ruby-core:68829] [Bug #11054]
 
-Sat Nov  1 18:21:09 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Fri Apr 10 22:29:21 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/openssl/ossl_ssl.c (ossl_ssl_peer_cert_chain): add new method
-	  SSLSocket#peer_cert_chain.
+	* lib/mkmf.rb (try_compile): pass the given werror flag to try_do
+	  to check if stderr is empty.
 
-	* ext/openssl/ossl_x509req.c (GetX509ReqPtr): new function
-	  which returns underlying X509_REQ.
+	* lib/mkmf.rb (try_cflags, try_ldflags): default werror to true.
 
-	* ext/openssl/ossl_x509ext.c (ossl_x509extfactory_set_issuer_cert,
-	  ossl_x509extfactory_set_subject_cert, ossl_x509extfactory_set_crl,
-	  ossl_x509extfactory_set_subject_req, ossl_x509extfactory_set_config):
-	  use underlying C struct without duplication not to leak momory.
+	* win32/Makefile.sub (WERRORFLAG): remove useless option.  VC does
+	  not make warnings of unknown command option an error.
 
-Sat Nov  1 01:49:03 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Fri Apr 10 19:34:24 2015  Tanaka Akira  <akr@fsij.org>
 
-	* lib/soap/mapping/factory.rb: mark marshalled basetype objects when
-	  @allow_original_mapping is true.  multi-referencing basetype node is
-	  prohibited in SOAP/1.1 encoding but soap4r's original ruby object
-	  mapping requires basetype to be marked to detect self referencing
-	  loop.  e.g. o = 1; o.instance_eval { @iv = o }  soap4r's original
-	  mapping is only used through soap/marshal API.
+	* test/ruby/test_file_exhaustive.rb: Test socket.
 
-	* test/soap/marshal/test_marshal.rb: add tests for self referencing
-	  immutable objects.
+Fri Apr 10 19:38:46 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* test/soap/calc/test_calc_cgi.rb: fix test name.
+	* test/objspace/test_objspace.rb: remove debug prints.
 
-Fri Oct 31 22:26:29 2003  Takaaki Uematsu  <uema2x@jcom.home.ne.jp>
+Fri Apr 10 19:35:51 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* wince/string_wce.c (strrchr): should decrement pointer.
+	* ext/objspace/objspace.c: add ObjectSpace.count_imemo_objects method
+	  to count imemo objects for each type.
 
-	* wince/Makefile.sub: correct a range of isdigit().
+	* test/objspace/test_objspace.rb: add a test.
 
-Fri Oct 31 12:55:24 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* NEWS: describe about this addition.
 
-	* configure.in, lib/mkmf.rb: add RPATHFLAG for NetBSD.
-	  [ruby-dev:21791]
+Fri Apr 10 19:34:24 2015  Tanaka Akira  <akr@fsij.org>
 
-	* bcc32/Makefile.sub, win32/Makefile.sub, win32/Makefile.sub: ditto.
+	* test/ruby/test_file_exhaustive.rb: Test anonymous pipe.
 
-Fri Oct 31 01:38:14 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+Fri Apr 10 19:31:56 2015  Tanaka Akira  <akr@fsij.org>
 
-	* wince/Makefile.sub, win32/Makefile.sub (.y.c): allow white spaces
-	  at the beginning of line to remove by sed. (ruby-bugs-ja:PR#580)
+	* test/ruby/test_file_exhaustive.rb: Test named pipe.
 
-Fri Oct 31 01:02:24 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Apr 10 19:10:34 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* compar.c (cmp_equal): protect exceptions from <=> comparison
-	  again.  returns nil if any exception or error happened during
-	  comparison.
+	* ext/objspace/objspace.c (setup_hash): unify common routine.
 
-	* eval.c (search_required): should update *featurep when DLEXT2 is
-	  defined. (ruby-bugs-ja:PR#581)
+Fri Apr 10 18:29:49 2015  Tanaka Akira  <akr@fsij.org>
 
-Thu Oct 30 23:41:04 2003  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+	* process.c (rb_execarg_parent_start1): Handle EINTR.
 
-	* lib/drb/drb.rb: add DRbArray
+Fri Apr 10 17:27:58 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/drb/invokemethod.rb: fix Hash#each problem. [ruby-dev:21773]
+	* vm.c (vm_exec): check other events when RETURN is thrown.
+	  [Bug #10724]
 
-	* lib/drb/unix.rb: add LoadError. [ruby-dev:21743]
+	* test/ruby/test_settracefunc.rb: add a test.
 
-Thu Oct 30 23:19:11 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Fri Apr 10 11:44:09 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/soap/generator.rb: better XML pretty printing.
+	* ext/date/extconf.rb: check warnings.
 
-	* lib/soap/encodingstyle/soapHandler.rb: remove unnecessary namespace
-	  assignment in the element which has "encodingStyle" attribute, and
-	  add necessary namespace assignment for "arrayType" attribute.
+	* lib/mkmf.rb (try_cflags): pass options to try_compile.
 
-	* test/soap/calc/test_calc_cgi.rb: take over $DEBUG to ruby process
-	  through CGI.
+	* win32/Makefile.sub (WERRORFLAG): make unknown command line
+	  options an error.
 
-Thu Oct 30 22:59:39 2003  why the lucky stiff  <why@ruby-lang.org>
+Fri Apr 10 08:00:17 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/syck/yaml2byte.c: HASH const too long.  Thanks, matz.
+	* test/ruby/test_process.rb: unfortunately, windows is not POSIX...
+	  cygwin has mkfifo command, but it does not affect system-wide.
 
-Thu Oct 30 19:13:53 2003  Akinori MUSHA  <knu@iDaemons.org>
+Fri Apr 10 02:18:53 2015  Tanaka Akira  <akr@fsij.org>
 
-	* ext/syck/MANIFEST: Add yamlbyte.h.
+	* test/ruby/test_process.rb: Use mkfifo command instead of mknod
+	  command to create a named pipe.  mkfifo command is defined by POSIX.
 
-Thu Oct 30 14:25:31 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Apr 10 01:29:05 2015  Tanaka Akira  <akr@fsij.org>
 
-	* io.c (READ_DATA_BUFFERED): new macro to detect whether stdio
-	  buffer filled.
+	* process.c: Release GVL when opening a file in spawn() to avoid whole
+	  process blocking when opening a named pipe.
+	  (open_func): New function.
+	  (rb_execarg_parent_start1): Extracted from rb_execarg_parent_start and
+	  use rb_thread_call_without_gvl2 to release GVL when opening a file.
+	  (rb_execarg_parent_start): Invoke rb_execarg_parent_start1 via
+	  rb_protect and invoke rb_execarg_parent_end when error.
 
-	* io.c (rb_io_fptr_cleanup): move path deallocation to
-	  rb_io_fptr_finalize (finalizer called by GC).
+Thu Apr  9 22:19:19 2015  Tanaka Akira  <akr@fsij.org>
 
-Thu Oct 30 13:23:39 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* process.c (redirect_open): Removed.
 
-	* parse.y (logop): left may be NULL. [ruby-talk:84539]
+Thu Apr  9 21:38:20 2015  Tanaka Akira  <akr@fsij.org>
 
-	* eval.c (rb_eval): NODE_CASE nd_head may be NULL.
+	* internal.h (rb_execarg_parent_end): Declared.
 
-Thu Oct 30 10:14:51 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* process.c: "spawn" opens files in the parent process.
+	  (check_exec_redirect): Add an placeholder for fd in parameters
+	  for fd_open.
+	  (check_exec_fds_1): Delete fd_open condition.
+	  (check_exec_fds): Don't call check_exec_fds_1 with fd_open.
+	  (rb_execarg_parent_start): Open files specified as "spawn" options
+	  and add "dup2" options.
+	  (rb_execarg_parent_end): New function to close opened fds.
+	  (run_exec_open): Removed.
+	  (rb_execarg_run_options): Don't call run_exec_open.
+	  (rb_spawn_internal): Call rb_execarg_parent_end.
 
-	* lib/test/unit/autorunner.rb: make fox runner work.
+	* io.c (pipe_open): Call rb_execarg_parent_end.
 
-Thu Oct 30 09:32:26 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* ext/pty/pty.c (establishShell): Call rb_execarg_parent_end.
 
-	* process.c (rb_f_system): fixed lack of security check before
-	  calling do_spawn() on win32. [ruby-talk:84555]
+Thu Apr  9 20:52:31 2015  Tanaka Akira  <akr@fsij.org>
 
-Thu Oct 30 02:46:35 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* internal.h (rb_execarg_parent_start): Renamed from rb_execarg_fixup.
 
-	* eval.c (proc_invoke): single array value to normal Proc#call
-	  (i.e. not via lambda call), should be treated just like yield.
-	  [ruby-dev:21726]
+	* process.c: Follows the above change.
 
-Thu Oct 30 02:25:48 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* io.c: Ditto.
 
-	* ext/openssl/lib/openssl/buffering.rb (Buffering#initialize):
-	  add new method to inherit @sync from @io.sync.
+	* ext/pty/pty.c: Ditto.
 
-	* ext/openssl/lib/net/protocols.rb (SSLIO#ssl_connect): no need to
-	  set sync flag explicitly.
+Thu Apr  9 20:35:12 2015  Tanaka Akira  <akr@fsij.org>
 
-	* ext/openssl/ossl_ssl.c (ossl_sslctx_initialize): call super.
+	* process.c (fd_clear_cloexec): Extracted from run_exec_dup2.
 
-	* ext/openssl/ossl_ssl.c (ossl_sslctx_setup): set extra chain
-	  certificates in @extra_chain_cert.
+Thu Apr  9 09:26:47 2015  Eric Wong  <e@80x24.org>
 
-Wed Oct 29 22:02:04 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* ccan/list/list.h: sync with ccan upstream
+	  [ccan commit c2fbfe5282ba264f3485586e7efa8a5967f2d386]
 
-	* test/drb/drbtest.rb: use rbconfig.rb to make the path of ruby
-	  interpreter to exec, instead of test/ruby/envutil.rb,
+Thu Apr  9 08:24:03 2015  Masahiro Tomita  <tommy@tmtm.org>
 
-Wed Oct 29 19:58:59 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* ext/socket/raddrinfo.c (addrinfo_mload): fix memory leak of
+	  addrinfo.  [ruby-dev:48923] [Bug #11051]
 
-	* ext/tcltklib/tcltklib.c (CONST84): define CONST84 when it is not
-	  defined and TCL_MAJOR_VERSION >= 8.
+Wed Apr  8 17:45:02 2015  Shannon Skipper  <shannonskipper@gmail.com>
 
-	* ext/tcltklib/tcltklib.c (VwaitVarProc, WaitVariableProc,
-	  rb_threadVwaitProc): use CONST84 instead of CONST.
+	* version.c (Init_version): the version of the engine or
+	  interpreter.  [Fix GH-858]
 
-	* ext/tcltklib/tcltklib.c (ip_rbTkWaitCommand,
-	  ip_rb_threadTkWaitCommand): use CONST84 always.
+Wed Apr  8 16:15:30 2015  Kenta Murata  <mrkn@cookpad.com>
 
-Wed Oct 29 17:27:05 2003  Tanaka Akira  <akr@m17n.org>
+	* bigdecimal: conform to ruby's license.  [ruby-core:68466] [Bug #10952]
 
-	* re.c (rb_reg_s_union, Init_Regexp): new method `Regexp.union'.
+Wed Apr  8 14:57:06 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/pathname.rb (realpath): examine Dir.pwd because it may have
+	* win32/win32.c (rb_w32_wreadlink): should treat junctions like as
 	  symlinks.
 
-Wed Oct 29 17:16:31 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_longjmp): must not disturb original jump.
-	  [ruby-dev:21733]
-
-Wed Oct 29 15:28:34 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (Init_Proc): taint preallocated exception object
-	  sysstack_error. [ruby-talk:84534]
-
-Wed Oct 29 11:27:39 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* parse.y (ret_args): node may be NULL. [ruby-talk:84530]
-
-Tue Oct 28 15:20:12 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* ext/tcltklib/tcltklib.c (VwaitVarProc, ip_rbVwaitObjCmd,
-	  WaitVariableProc, WaitVisibilityProc, WaitWindowProc,
-	  ip_rbTkWaitObjCmd, ip_rbTkWaitCommand, rb_threadVwaitProc,
-	  rb_threadWaitVisibilityProc, rb_threadWaitWindowProc,
-	  ip_rb_threadVwaitObjCmd, ip_rb_threadTkWaitObjCmd): prototype;
-	  avoid VC++ warnings.
-
-Mon Oct 27 19:19:55 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (rb_longjmp): ignore reentering error while warning.
-	  [ruby-dev:21730]
-
-Mon Oct 27 00:23:50 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
-
-	* ext/tcltklib/tcltklib.c (ip_ruby): bug fix on Win : hang-up when
-	  calling 'exit' in the Tk callback procedure. [ruby-list:38656]
-
-Sat Oct 25 09:18:04 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* eval.c (rb_method_missing): protect exception from within
-	  "inspect".  (ruby-bugs:PR#1204)
-
-Fri Oct 24 23:26:34 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* hash.c (rb_hash_each): Hash#each should yield single value.
-	  [ruby-talk:84420]
-
-	* hash.c (env_each): ditto for ENV.each.
-
-Thu Oct 23 20:25:32 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* lib/webrick/server.rb (GenericServer#start): should rescue
-	  IOError from IO::accept. [ruby-dev:21692]
-
-Thu Oct 23 17:59:36 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Apr  8 14:03:47 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* eval.c (ruby_cleanup): initialize stack bottom for embedding.
-	  [ruby-dev:21686]
+	* test/ruby/test_symbol.rb: fix syntax error.
 
-	* ext/dl/extconf.rb: move list of files to clean from DEPEND file,
-	  to get rid of macro redefinitions.
+Wed Apr  8 13:01:06 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Oct 23 13:44:00 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* hash.c (rb_any_hash): Symbols are compared by the identities
+	  always.  [ruby-core:68767] [Bug #11035]
 
-	* parse.y: integrate operations for stack_type.  [ruby-dev:21681]
+Tue Apr  7 10:22:51 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-Thu Oct 23 00:41:45 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* internal.h: fix typo. Patch by @sferik [fix GH-865]
 
-	* test/soap/calc/*, test/soap/helloworld/*: set logging threshold
-	  to ERROR.
+Mon Apr  6 22:52:35 2015  Tanaka Akira  <akr@fsij.org>
 
-Wed Oct 22 12:53:31 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* enum.c: Enumerable#chunk and Enumerable#slice_before no longer takes
+	  the initial_state argument.  [Feature #10958]
 
-	* lib/test/unit/collector/dir.rb (Test::Unit::Collector::Dir#collect_file):
-	  ignore tests which raised LoadError.
+Mon Apr  6 16:09:58 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* test/drb/drbtest.rb, test/ruby/test_beginendblock.rb,
-	  test/ruby/test_system.rb: avoid requiring same file twice.
+	* vm_args.c: protect value stack from calling other methods
+	  during complex parameter setting process (splat, kw, and so on).
+	  [Bug #11027]
 
-	* test/drb/test_drbssl.rb, test/drb/test_drbunix.rb: should not use
-	  ARGV unless invoked directly.  do not create test cases unless
-	  required libraries are available.
+	* vm_core.h: remove rb_thread_t::mark_stack_len.
+	  With this modification, we don't need to use th->mark_stack_len.
 
-Wed Oct 22 02:31:34 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/ruby/test_keyword.rb: add a test.
 
-	* eval.c (ruby_cleanup): should not ignore exit_value in END
-	  execution. [ruby-dev:21670]
+	* cont.c (cont_capture): catch up this fix.
 
-Tue Oct 21 23:16:26 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* vm.c (rb_thread_mark): ditto.
 
-	* eval.c (ruby_cleanup): call finalizers and exit procs before
-	  terminating threads.
+Mon Apr  6 11:26:42 2015  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* eval.c (ruby_cleanup): preserve ruby_errinfo before ruby_finalize_0().
+	* tool/downloader.rb (http_options): prevent content auto decoding
+	  because this is a downloader.
 
-Tue Oct 21 15:57:11 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sun Apr  5 09:55:18 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/test/unit/collector/dir.rb (Test::Unit::Collector::Dir#collect_file):
-	  prepend the directory of target file to the load path.
+	* doc/contributing.rdoc: update Maintainers list.
 
-Tue Oct 21 15:08:53 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+Sun Apr  5 09:11:00 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-	* win32/win32.c (do_spawn, do_aspawn): should wait child process even
-	  if callded with P_OVERLAY.
+	* tool/rbinstall.rb: fix bin script permission of bundled gems.
 
-	* win32/win32.c (do_spawn, do_aspawn): should return child's exit
-	  status to parent.
+Sun Apr  5 08:46:08 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-Tue Oct 21 00:35:02 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* tool/rbinstall.rb: support --program-suffix option.
 
-	* test/soap/calc/*, test/soap/helloworld/*: catch the exception from
-	  test server thread and recover.
+Sat Apr  4 21:31:18 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-Tue Oct 21 00:22:57 2003  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+	* lib/rake/*: Gemify rake [fix GH-862][Feature #11025]
+	* test/rake/*: ditto.
+	* tool/rbinstall.rb: ditto.
 
-	* test/drb/*: import drb/runit.
+Sat Apr  4 11:30:24 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Oct 20 23:55:47 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* string.c (rb_str_setbyte): check the argument first not to
+	  discard shared string and code range unnecessarily until
+	  actually changing the contents.  pointed out by headius.
 
-	* eval.c (rb_eval): set current node after arguments evaluation.
-	  [ruby-dev:21632]
+Sat Apr  4 08:16:43 2015  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* eval.c (rb_yield_0): set current node and keep it at local jump.
+	* lib/net/http.rb (edit_path): use path which is absolute ftp url
+	  on using ftp_proxy.
 
-Mon Oct 20 22:01:18 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Apr  3 11:43:17 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (rb_thread_cleanup): keep thread group for main thread.
-	  [ruby-dev:21644]
+	* vm_eval.c (vm_call0_cfunc): update invoker arguments.
 
-Mon Oct 20 18:28:10 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* vm_insnhelper.c (vm_call_cfunc_latter): ditto.
 
-	* eval.c (rb_catch): backout.
+	* vm_insnhelper.c (rb_vm_call_cfunc_push_frame): ditto, and prefix
+	  with rb_.
 
-Mon Oct 20 17:31:46 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Thu Apr  2 16:26:59 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (PUSH_FRAME): generate unique number to be TAG_JUMP()
-	  destination.
+	* common.mk, tool/mkconfig.rb: check the running ruby version in
+	  rbconfig.rb with the program version, as RUBY_VERSION has never
+	  been affected by --with-ruby-version option.
+	  [ruby-core:68639] [Bug #11002]
 
-	* eval.c (localjump_destination): use unique number in ruby_frame
-	  for localjump destination.
+	* configure.in (LIBRUBY_DLDFLAGS): compatibility_version must be
+	  valid version numbers, not an arbitrary string.
 
-Mon Oct 20 11:31:44 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Apr  1 11:09:15 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/ruby/test_signal.rb (test_signal): restore old trap.
+	* dir.c (push_glob): remove indirect links of arguments for
+	  trampoline.
 
-Mon Oct 20 11:00:46 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Wed Apr  1 09:59:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* gc.c (gc_sweep): loosen page free condition to avoid add_heap()
-	  race condition. [ruby-dev:21633]
+	* lib/fileutils.rb (FileUtils#mv): show the exact target path in
+	  the error message instead of the destination parent directory
+	  name.  patched by Joao Britto <jabcalves AT gmail.com> at
+	  [ruby-core:68706].  [Bug #11021]
 
-	* gc.c (gc_sweep): do not update malloc_limit when malloc_increase
-	  is smaller than malloc_limit.
+Tue Mar 31 15:25:07 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-Mon Oct 20 09:45:12 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* doc/ChangeLog-0.06_to_0.52: added archived Changelog.
+	  [ruby-list:50105]
+	* doc/ChangeLog-0.50_to_0.60: ditto.
+	* doc/ChangeLog-0.60_to_1.1: ditto.
 
-	* lib/debug.rb (debug_command): remove debug print.
+Mon Mar 30 22:02:55 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-Wed Oct 20 00:25:41 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* README.EXT.ja: add redirect [ruby-core:68631]
 
-	* eval.c (search_required): required name must not be changed before
-	  loading.  [ruby-dev:24492]
+Mon Mar 30 14:42:41 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Oct 19 13:12:30 2003  Tanaka Akira  <akr@m17n.org>
+	* win32/win32.c (fileattr_to_unixmode, winnt_lstat): deal with
+	  symbolic link than directory, and set executable bits.
 
-	* lib/pathname.rb (foreachline, dir_foreach): add obsolete warning.
+Mon Mar 30 11:27:54 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Oct 19 00:14:22 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* io.c (copy_stream_body): use the arguments without conversion if
+	  having read, readpartial, and write methods, than conversion by
+	  to_path method.  [ruby-core:68676] [Bug #11015]
 
-	* test/soap/calc/*, test/soap/helloworkd/*: changed port# of test
-	  server. (17171)
+Sun Mar 29 21:08:37 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-Sat Oct 18 23:01:32 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* gc.c (objspace_allrefs_destruct_i): fix a typo.
+	  [Bug #11013]
 
-	* missing/acosh.c (DBL_MANT_DIG): typo fix(ifdef -> ifndef).
+Sun Mar 29 11:51:32 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Oct 18 05:48:59 2003  why the lucky stiff  <why@ruby-lang.org>
+	* proc.c (proc_binding): replicate env from method object, and
+	  allocate the local variable area for the iseq local table.
+	  [ruby-core:68673] [Bug #11012]
 
-	* ext/syck/rubyext.c: YAML::Syck::compile method.
+Sat Mar 28 09:19:41 2015  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* ext/syck/syck.c: Buffer edge bug.
+	* ext/date/extconf.rb: try_cflags("-std=iso9899:1999") [Bug #10906]
+	  ruby itself (including numeric.c) is built with strict compile
+	  options including -std=iso9899:1999, but ext/date is not.
+	  By the way -std=iso9899:1999 is not only a warning option but also
+	  changes behavior like MACRO definitions for example INFINITY.
+	  gcc on Solaris affect this.
 
-	* ext/syck/yaml2byte.c: YAML to bytecode converter.
+Fri Mar 27 16:34:16 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/syck/yamlbyte.h: Ditto.
+	* common.mk: revert using BOOTSTRAPRUBY for enc.mk, as
+	  enc/depend uses CONFIG.  [ruby-core:68647] [Bug #11004]
 
-	* ext/syck/bytecode.c: Bytecode parser fixes to empty collections
-	  and empty strings.
+Thu Mar 26 10:05:13 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-	* ext/syck/token.c: Ditto.
+	* test/test_observer.rb: add tests for Observable module.
+	  [fix GH-859] Patch by @brightbits
 
-Fri Oct 17 23:07:38 2003  Akinori MUSHA  <knu@iDaemons.org>
+Thu Mar 26 06:35:10 2015  Eric Wong  <e@80x24.org>
 
-	* ext/enumerator/enumerator.c, ext/enumerator/enumerator.txt:
-	  Provide Kernel#to_enum as an alias for Kernel#enum_for.  Maybe
-	  this is a better name.
+	* README.EXT: add redirect [ruby-core:68631]
 
-Fri Oct 17 23:00:30 2003  Akinori MUSHA  <knu@iDaemons.org>
+Wed Mar 25 16:46:49 2015  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/generator.rb: Add rdoc documentation.
+	* ext/socket/extconf.rb: Solaris 11 has struct tcp_info.tcpi_ca_state,
+	  but it is a dummy.
 
-Fri Oct 17 22:16:42 2003  Akinori MUSHA  <knu@iDaemons.org>
+	* ext/socket/option.c: Solaris 11 doesn't have u_intN_t.
 
-	* lib/set.rb: Reword and fix Overview.
+	* ext/socket/option.c: Solaris 11 needs inspect_tcpi_msec.
 
-	* lib/set.rb: It is not necessary to require
-	  'test/unit/ui/console/testrunner'.
+	* ext/socket/raddrinfo.c: Solaris 11 has AF_PACKET but doesn't have
+	  related macros.
 
-Fri Oct 17 11:15:22 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+Wed Mar 25 17:03:08 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/ruby/test_range.rb: added.
+	* ext/-test-/file/fs.c (get_fsname): try magic number only if
+	  f_type is included.  [ruby-dev:48913] [Bug #11000]
 
-	* MANIFEST: add test/ruby/test_range.rb.
+Wed Mar 25 11:20:40 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Oct 17 03:21:23 2003  William Sobel  <will.sobel@barra.com>
+	* benchmark/bm_hash_aref_flo.rb: make more realistic data.
+	  [ruby-core:68632] [[Bug #10999]
 
-	* ext/socket/socket.c (make_hostent): h_aliases may be NULL.
-	  (ruby-bugs:PR#1195)
+Wed Mar 25 10:39:06 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-	* ext/socket/socket.c (sock_s_gethostbyaddr): ditto.
+	* .document: removed needless entries.
 
-Fri Oct 17 00:12:41 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Wed Mar 25 08:07:28 2015  Eric Wong  <e@80x24.org>
 
-	* ext/tk/lib/tk.rb: (bug fix) instance variable @frame was used
-	  without initializing on TkComposite module.
+	* doc/extension.rdoc: fix spelling of filename
+	* doc/extension.ja.rdoc: ditto.
 
-Thu Oct 16 23:51:04 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Tue Mar 25 06:55:43 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
 
-	* ext/tk/lib/tk.rb: If $DEBUG == true and some exception is caused
-	  in a callback operation, Ruby/Tk shows a (verbose) backtrace
-	  information on the callback process.
+	* complex.c (k_inexact_p, k_exact_zero_p): use k_exact_zero_p macro
+	  to remove k_inexact_p macro.
 
-Thu Oct 16 17:09:19 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* complex.c (k_exact_one_p): remove unused macro k_exact_one_p.
 
-	* lib/debug.rb (DEBUGGER__::Context::debug_command): do not call
-	  debug_silent_eval() when $1 is not set. (ruby-bugs:PR#1194)
+Tue Mar 24 22:23:33 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-Thu Oct 16 16:54:57 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* doc/extension.rdoc: move from toplevel document and added extname.
+	* doc/extension.ja.rdoc: ditto.
 
-	* string.c (rb_str_upto): ("a"..."a").to_a should return [].
-	  [ruby-core:01634]
+Tue Mar 24 22:06:58 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-Thu Oct 16 16:40:51 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* doc/standard_library.rdoc: strip.
 
-	* ext/tk/lib/tk.rb:
-	  Add Tk::EncodedString and Tk::UTF8_String class to support
-	  characters using the \uXXXX escape to the UNICODE string.
+Tue Mar 24 22:06:27 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-	* ext/tk/sample/{demos-en,demos-jp}/unicodeout.rb
-	  new demo-scripts (samples of Tk::UTF8_String)
+	* doc/standard_library.rdoc: move Thread to Extensions.
 
-	* ext/tk/sample/{demos-en,demos-jp}/widget
-	  add entries for 'unicodeout.rb'
+Tue Mar 24 21:59:10 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-Thu Oct 16 08:38:06 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* doc/contributing.rdoc: update Maintainers list.
 
-	* test/digest/test_digest.rb (test_eq): show failed class.
+Tue Mar 24 19:10:24 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* test/ruby/test_iterator.rb (test_break, test_return_trace_func):
-	  test localjump destination.
+	* gc.c (gc_writebarrier_generational): fix messages for rb_bug().
+	  Remove `rb_' prefix.
 
-Wed Oct 15 20:22:31 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* gc.c (gc_writebarrier_incremental): ditto.
 
-	* lib/soap/netHttpClient.rb: use URI::HTTP#request_uri instead of
-	  instance_eval('path_query').  [ruby-list:38575]
+Tue Mar 24 17:34:01 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-Wed Oct 15 17:24:45 2003  URABE Shyouhei  <root@mput.dip.jp>
+	* README.ja.md: should be chunibyo.
 
-	* lib/cgi.rb (CGI::Cookie): tiny typo fix.
+Tue Mar 24 17:30:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Oct 15 15:00:54 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/-test-/file/fs.c (get_fsname): return filesystem name by
+	  statfs/statvfs.  [ruby-core:68624] [Bug #10998]
 
-	* eval.c (ruby_run): just return FAILURE instead of parse error
-	  count.  [ruby-list:38569]
+Tue Mar 24 16:46:02 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Wed Oct 15 13:17:02 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* tool/redmine-backporter.rb: now doesn't required spaces just after
+	  `!`.
 
-	* ext/digest/digest.c (rb_digest_base_alloc): need to initialize
-	  buffer. [ruby-dev:21622]
+Mon Mar 23 23:18:27 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Oct 15 11:23:05 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* dir.c (dir_close): don't raise on double close for consistent to
+	  IO#close.  [Feature #10950]
 
-	* marshal.c (w_object): dump extended modules as well.
+Mon Mar 23 21:22:07 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* marshal.c (r_object0): TYPE_USRMARSHAL should restore extended
-	  modules before invoking marshal_load.  these two fixes are done
-	  by Masatoshi Seki <m_seki@mva.biglobe.ne.jp>.
+	* win32/file.c (rb_readlink): move from file.c for better buffer
+	  allocation and the result encoding.
 
-Wed Oct 15 09:30:34 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* win32/win32.c (wreadlink, rb_w32_ureadlink): implement readlink().
 
-	* ext/enumerator/enumerator.c (enumerator_each): avoid VC++ warning.
+Mon Mar 23 14:40:45 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/syck/syck.h: include stdio.h for definition of FILE.
+	* win32/win32.c (winnt_stat): stat with following symbolic links.
 
-Wed Oct 15 08:09:07 2003  why the lucky stiff  <why@ruby-lang.org>
+	* win32/win32.c (winnt_lstat): rename old winnt_stat, which does
+	  not follow symbolic links.
 
-	* ext/syck/bytecode.c: Checkin of YAML bytecode support.
+Mon Mar 23 01:44:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/syck/gram.c: Ditto.
+	* marshal.c (r_symreal): register symbol names as strings first so
+	  that r_symlink always returns valid names.
+	  [ruby-core:68587] [Bug #10991]
 
-	* ext/syck/syck.c: Ditto.
+	* marshal.c (r_ivar, r_object0): now need to intern symbol names.
 
-	* ext/syck/token.c: Ditto.
+	* marshal.c (r_object0): compare with symbol names.
 
-	* ext/syck/handler.c: Ditto.
+Sun Mar 22 22:07:40 2015  Kouhei Sutou  <kou@cozmixng.org>
 
-	* ext/syck/handler.c: Now using 'tag' rather than 'taguri' in type URIs.
+	* doc/etc.rd.ja: Fix wrong coding for Emacs.
 
-	* ext/syck/rubyext.c: Ditto (on both counts).
+Sun Mar 22 09:53:15 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Oct 15 05:05:53 2003  Akinori MUSHA  <knu@iDaemons.org>
+	* tool/make-snapshot (package): add default CONFIGURE name to
+	  follow r50039.
 
-	* lib/generator.rb: A new library which converts an internal
-	  iterator to an external iterator.
+	* tool/make-snapshot (package): substitute configuration variables
+	  in Makefile.in instead of passing by the command line, and make
+	  temporary Makefile instead of a pipe.
 
-	* lib/abbrev.rb: A new library which creates an abbreviation table
-	  from a list.
+Sun Mar 22 08:09:47 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Oct 15 04:31:51 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* common.mk (ext/ripper/ripper.c, ext/rbconfig/sizeof/sizes.c):
+	  strip autogenerated dependencies which have invalid syntax in
+	  other than nmake.
 
-	* ext/tk/sample/demos-en/entry3.rb, ext/tk/sample/demos-jp/entry3.rb :
-	  new demo-scripts
+Sat Mar 21 15:01:26 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/sample/demos-en/widget, ext/tk/sample/demos-jp/widget :
-	  add entries for 'entry3.rb'
+	* ext/io/console/console.c (console_set_winsize): use handle for
+	  writing.  GetConsoleScreenBufferInfo seems failing on a handle
+	  for reading.
 
-Wed Oct 15 04:31:47 2003  Akinori MUSHA  <knu@iDaemons.org>
+	* io.c: [DOC] update the example of IO#winsize to use $stdout
+	  instead of $stdin, which does not work on Windows.  a patch by
+	  Jan Lelis <mail AT janlelis.de> at [ruby-core:68574].
+	  [Bug #10986]
 
-	* test/digest/test_digest.rb: Moved from ext/digest/test.rb.
+Fri Mar 20 18:41:03 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Oct 15 03:53:20 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* proc.c (respond_to_missing_p): check if the receiver responds to
+	  the given method by respond_to_missing?.
 
-	* ext/tk/lib/tk.rb: fixed trouble on auto-load Tcl commands (enbug
-	  on the last commit).
+	* proc.c (mnew_missing): create Method object for method_missing.
+	  [ruby-core:68564] [Bug #10985]
 
-Wed Oct 15 00:25:00 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Mar 20 17:43:18 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-	* parse.y (yylex): argument parentheses preceded by spaces should
-	  be warned; not error.  [ruby-talk:84103]
+	* .travis.yml: enabled email notification.
 
-Wed Oct 15 00:20:15 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Fri Mar 20 17:39:52 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-	* ext/tcltklib/tcltklib.c: replace Tcl/Tk's vwait and tkwait to
-	  switch on threads smoothly and avoid seg-fault.
+	* .travis.yml: removed Ruby 1.9.3 build on Travis CI
 
-	* ext/tcltklib/tcltklib.c: add TclTkIp._thread_vwait and
-	  _thread_tkwait for waiting on a thread. (Because Tcl/Tk's vwait
-	  and tkwait command wait on an eventloop.)
+Fri Mar 20 12:38:36 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/tk/lib/multi-tk.rb: support TclTkIp._thread_vwait and
-	  _thread_tkwait.
+	* gc.c (obj_info): obj_info() can receive internal objects.
 
-	* ext/tk/lib/tk.rb: now, TkVariable#wait has 2 arguments.
-	  If 1st argument is true, waits on a thread. If false, waits on
-	  an eventloop. If 2nd argument is true, checks existence of
-	  rootwidgets. If false, doesn't. Default is wait(true, false).
+	* gc.c (check_rvalue_consistency): obj_info() returns const char *.
 
-	* ext/tk/lib/tk.rb: add TkVariable#tkwait(arg) which is equal to
-	  TkVariable#wait(arg, true). wait_visibility and wait_destroy
-	  have an argument for waiting on a thread or an eventloop.
+Fri Mar 20 12:14:37 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/tk/lib/tk.rb: improve of accessing Tcl/Tk's special variables.
+	* gc.c (obj_info): show class name and T_DATA type_name.
 
-	* ext/tk/lib/tkafter.rb: support 'wait on a thread' and 'wait on
-	  an eventloop'.
+Thu Mar 19 22:12:46 2015  Koichi Sasada  <ko1@atdot.net>
 
-Wed Oct 15 00:10:24 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* gc.c (rb_copy_wb_protected_attribute): `dest' can be WB unprotected.
 
-	* lib/soap/baseData.rb: Introduce SOAPType as the common ancestor of
-	  SOAPBasetype and SOAPCompoundtype.
+Thu Mar 19 21:25:25 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/soap/generator.rb, lib/soap/element.rb, lib/soap/encodingstyle/*:
-	  Encoding methods signature change.  Pass SOAPGenerator as a parameter.
+	* gc.c (rb_copy_wb_protected_attribute): demote `dest' object.
 
-	* lib/soap/mapping/*, test/soap/marshal/test_marshal.rb: Refactoring
-	  for better marshalling/unmarshalling support.  Now I think SOAP
-	  marshaller supports all kind of object graph which is supported by
-	  Ruby's original marshaller.  Of course there could be bugs as always.
-	  Find it.  :-)
+Thu Mar 19 16:18:00 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/soap/rpc/standaloneServer.rb: Set severity threshould to INFO.
-	  DEBUG is too noisy.
+	* gc.c, internal.h: export rb_gc_verify_internal_consistency().
 
-	* lib/xsd/datatypes.rb: DateTime#of is obsoleted.  Use DateTime#offset.
+Thu Mar 19 16:15:24 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* test/wsdl/emptycomplextype.wsdl, test/xsd/xmlschema.xml: Avoid
-	  useless warning.
+	* gc.c (obj_info): show allocation site if GC_DEBUG is not 0.
 
-Tue Oct 14 19:09:35 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Mar 19 16:12:01 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* eval.c (ruby_finalize_0): return the given exit status unless
-	  SystemExit got raised.
+	* gc.c (newobj_of): fix RGENGC_OLD_NEWOBJ_CHECK logics.
+	  * skip on incremental marking because not sure what happen :p
+	  * rb_gc_writebarrier_remember() is enough to mark children.
 
-Tue Oct 14 11:53:49 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Mar 19 16:08:42 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* intern.h (ruby_stop): never return.
+	* gc.c (rb_copy_wb_protected_attribute): need demote for old objects.
 
-	* ruby.h (ruby_run): ditto.
+Thu Mar 19 10:31:00 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Oct 14 04:43:55 2003  Tanaka Akira  <akr@m17n.org>
+	* random.c (fill_random_bytes): release the handle in the static
+	  variable, not a local variable.
 
-	* lib/pathname.rb (realpath): make ELOOP check bit more robust.
-	  (children): prepend self by default.
-	  (chroot): obsoleted.
+Thu Mar 19 06:30:35 2015  Koichi Sasada  <ko1@atdot.net>
 
-Tue Oct 14 02:29:31 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* object.c (rb_obj_clone): do not touch age (FL_PROMOTED[01]) because
+	  rb_obj_alloc() can return old object in debug.
 
-	* eval.c (rb_require_safe): segfault after loading .so.
+Thu Mar 19 06:29:28 2015  Koichi Sasada  <ko1@atdot.net>
 
-Tue Oct 14 02:05:23 2003  Akinori MUSHA  <knu@iDaemons.org>
+	* test/objspace/test_objspace.rb: flag name was changed
+	  (long_lived -> uncollectible).
 
-	* ext/Setup*, ext/enumerator/*: Add ext/enumerator, a helper
-	  module for the Enumerable interface.
+Thu Mar 19 05:30:13 2015  Koichi Sasada  <ko1@atdot.net>
 
-Mon Oct 13 23:55:59 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* iseq.c (iseq_mark): skip some marking if iseq->orig is available.
 
-	* test/ruby/envutil.rb: use Config::CONFIG["ruby_install_name"],
-	  not "ruby".
+	* iseq.c (rb_iseq_clone): need WB for iseq1->klass = iseq0->klass
+	  (done in MEMCPY).
 
-Mon Oct 13 23:57:29 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Mar 19 04:55:53 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* eval.c (rb_feature_p): match by classified suffix.
+	* internal.h (IMEMO_DEBUG): added.
 
-	* eval.c (rb_require_safe): require library in the specified safe
-	  level.
+	* internal.h: remove unused FL_IMEMO_MARK_V[0-3].
 
-	* variable.c (rb_autoload, rb_autoload_load): restore safe level
-	  when autoload was called.  [ruby-dev:21338]
+	* gc.c (rb_imemo_new_debug): added.
 
-	* intern.h: prototypes; rb_require_safe.
+	* gc.c (obj_info): show imemo type name.
 
-	* test/runner.rb: accept non-option arguments.
+Thu Mar 19 04:52:26 2015  Koichi Sasada  <ko1@atdot.net>
 
-Mon Oct 13 20:49:51 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* gc.c (RGENGC_OLD_NEWOBJ_CHECK): add check mechanism.
 
-	* string.c (str_new4): should not preserve FL_TAINT status in the
-	  internal shared string. [ruby-dev:21601]
+	  If RGENGC_OLD_NEWOBJ_CHECK > 0, then create old objects
+	  (not new objects) periodically.
 
-	* string.c (rb_str_new4): ditto.
+	  Create one old objects per RGENGC_OLD_NEWOBJ_CHECK objects are
+	  created.
 
-	* eval.c: use EXIT_SUCCESS and EXIT_FAILURE for exit values.
+Thu Mar 19 04:46:36 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* process.c: ditto. [ruby-list:38521]
+	* enum.c (enum_sort_by): add WBs.
 
-Mon Oct 13 19:51:02 2003  Koji Arai  <jca02266@nifty.ne.jp>
+Thu Mar 19 03:37:52 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/debug.rb (debug_command): should enter emacs mode when
-	  assigned any value to the environment variable "EMACS".
-	  On Meadow, (getenv "EMACS") is "meadow".
+	* gc.c (check_rvalue_consistency): refactoring.
+	  * not inline on RGENGC_CHECK_MODE > 0.
+	  * check SPECIAL_CONST_P(obj) first.
+	  * add a check that remembered_bit is only TRUE when old (age == 3).
 
-Sun Oct 12 14:45:03 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* gc.c (RVALUE_DEMOTE): should clear RVALUE_REMEMBERED bit.
 
-	* ext/win32ole/extconf.rb: check "windows.h", not "windows".
-	  [ruby-talk:84051]
+	  remembered_bit should be TRUE only for old (age == 3) objects.
 
-Sat Oct 11 20:41:03 2003  Corinna Vinschen  <corinna@vinschen.de>
+	  Actually there are no effect because demoted objects will be
+	  uncollectible WB unprotected objects (marked at the beginning of
+	  every minor GC).
 
-	* file.c (eaccess): Use access(2) on Cygwin.
+Thu Mar 19 02:52:48 2015  Koichi Sasada  <ko1@atdot.net>
 
-Sat Oct 11 17:09:21 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* gc.c: rename terminologies.
+	  * long_lived -> uncollectible:
+	    because this bitmap does not mean "long lived objects in past",
+	    but means "prohibit collection these objects until next major GC".
 
-	* lib/rexml/quickpath.rb (REXML::QuickPath::match):
-	  escape '[' to avoid warning.
+	    Uncollectible objects consist of two types objects, one is old
+	    objects (WB protected objects which age == 3) and another is
+	    uncollectible WB unprotected objects which are referred from old
+	    objects
 
-Sat Oct 11 16:08:41 2003  Tanaka Akira  <akr@m17n.org>
+	  * remembered_wb_unprotected_objects ->
+	    uncollectible_wb_unprotected_objects:
+	    because uncollectible objects does not mean remembered objects.
 
-	* lib/pathname.rb (realpath): check existence of the file.
+Wed Mar 18 17:21:12 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/pathname.rb (realpath): re-implemented.
-	  (realpath_root?, realpath_rec): removed
+	* gc.c (gc_writebarrier_generational): add an alternative write
+	  barrier (WB) implementation.
+	  When finding reference from [Old obj] to [New obj] by WB, current
+	  implementation marks [Old obj] as remembered old objects and marks
+	  children of [Old obj] at the beginning of marking.
 
-Sat Oct 11 10:19:39 2003  Shugo Maeda  <shugo@ruby-lang.org>
+	  Added (but disabled) code changes current behaviour. This fix promote
+	  [New obj] to old and marks as a remembered old object. We can assume
+	  "new objects referred from old objects are maybe long-lived old
+	  objects".
 
-	* lib/monitor.rb: handle exceptions correctly. Thanks, Gennady
-	  Bystritsky.
+	  Disadvantage of added algorithm is we may promote unwilling
+	  short-lived objects. For example, consider many new objects push and
+	  pop to an old stack object. All of new objects (short-lived objects)
+	  promote to old objects unexpectedly.
 
-Fri Oct 10 07:50:54 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	  To compare these behaviour, I add this new code (but disabled it).
 
-	* eval.c (is_defined): inheritance line adjustment as like as
-	  rb_call_super().
+Wed Mar 18 17:14:39 2015  Koichi Sasada  <ko1@atdot.net>
 
-Fri Oct 10 01:19:00 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* gc.c (RVALUE_PROMOTE_RAW): rename to RVALUE_OLD_LONG_LIVED_SET()
+	  to make clear.
 
-	* ext/openssl/ossl_x509name.c (ossl_x509name_initialize): add
-	  optional argument to specify the DirectoryString type
-	  (ASN1::UTF8STRING by default). RFC3280 deprecates PrintableString
-	  for DirectoryString, and strongly requires to use UTF8String for
-	  all certificates issued after December, 31 2003.
+Wed Mar 18 17:10:01 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/openssl/lib/openssl/x509.rb (X509::Name::parse): ditto.
+	* gc.c (check_rvalue_consistency): do not need to check is_sweeping().
 
-Thu Oct  9 23:50:21 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Mar 18 14:13:22 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* eval.c (rb_thread_start_0): prevent thread from GC.
-	  [ruby-dev:21572]
+	* benchmark/bm_vm1_gc_wb_ary.rb: run GC to finish "marking" phase.
 
-Thu Oct  9 19:11:44 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* benchmark/bm_vm1_gc_wb_obj.rb: ditto.
 
-	* eval.c (rb_thread_start_0): non-volatile should be restored from
-	  volatile.
+	* benchmark/bm_vm1_gc_wb_ary_promoted.rb: add parameter
+	  full_mark: false to invoke only minor GC.
 
-Thu Oct  9 17:43:36 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* benchmark/bm_vm1_gc_wb_obj_promoted.rb: ditto.
 
-	* eval.c (proc_save_safe_level, proc_get_safe_level,
-	  proc_set_safe_level): save/restore safe level 1..4.
+Wed Mar 18 12:07:36 2015  Koichi Sasada  <ko1@atdot.net>
 
-Thu Oct  9 16:33:23 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* string.c: add a comment about RSTRING_FSTR.
 
-	* marshal.c (r_object0): remove unnecessary iv restoration for
-	  USRMARSHAL. [ruby-dev:21582]
+Wed Mar 18 12:01:53 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* marshal.c (w_object): dump generic instance variables from
-	  a string from '_dump'.
+	* hash.c (rb_any_hash): use same hash values with Float#hash so
+	  that -0.0 and +0.0 will be identical.
+	  [ruby-core:68541] [Bug #10979]
 
-	* variable.c (rb_generic_ivar_table): return 0 if obj's FL_EXIVAR
-	  is not set.
+Wed Mar 18 05:34:32 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* time.c (time_dump): copy instance variables to dumped string, to
-	  be included in the marshaled data.
+	* string.c: introduce STR_FAKESTR to show string is FAKESTR or not.
 
-	* bignum.c (rb_big2ulong): add range check to ensure round trip.
+	* string.c (STR_SET_SHARED): ignore FAKESTR because only Ruby objects
+	  can use write barrier.
 
-Thu Oct  9 15:45:27 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Tue Mar 17 18:59:16 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* pack.c (uv_to_utf8): change message to "out of range", since
-	  negative values are not "too big". [ruby-dev:21567]
+	* include/ruby/ruby.h: use rb_gc_writebrrier() simply.
+	  For incremental GC, we need to get a pointer to the objspace.
+	  We can share this pointer for the following WB process.
+	  And considering icache hit ratio, process in the GC.
 
-Thu Oct  9 14:05:38 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* gc.c (rb_gc_writebarrier): added.
 
-	* eval.c (rb_set_end_proc, rb_exec_end_proc): restore safe level.
-	  [ruby-dev:21557]
+	* gc.c (gc_writebarrier_generational, gc_writebarrier_incremental):
+	  make them NOINLINE because inlining them into rb_gc_writebarrier()
+	  makes a prologue code of rb_gc_writebarrier() longer (storing callee
+	  save registers).
 
-Thu Oct  9 10:51:04 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	  This patch improve the performance of WB on micro-benchmarks.
 
-	* eval.c (rb_yield_0): no error if block is empty.
+	  name                   ruby 2.1   trunk   modified
+	  vm1_gc_wb_ary*            0.511   0.632      0.532
+	  vm1_gc_wb_ary_promoted*   0.578   0.701      0.674
+	  vm1_gc_wb_obj*            0.419   0.575      0.492
+	  vm1_gc_wb_obj_promoted*   0.537   0.664      0.618
+	                                                 (sec)
 
-Thu Oct  9 06:43:33 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Mar 17 18:51:43 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* eval.c (localjump_error): id should be ID.
+	* benchmark/bm_vm1_gc_wb_ary(_promoted).rb: separate fastpath and
+	  slowpath for WB.
 
-	* eval.c (rb_eval): nd_rval is set in copy_node_scope().
+	  Before this change bm_vm1_gc_wb_ary.rb tried to check the performance
+	  for WB slowpath (making a reference from oldobj to newobj). However,
+	  from Ruby 2.2, 3 GCs are needed to promote new objects because
+	  only 3 age objects are promoted objects.
 
-	* eval.c (rb_yield_0): unused variable.
+	  To compare fastpath and slowpath, introduce new "promoted" version
+	  benchmark.
 
-	* eval.c (rb_yield_0): nothing to do for empty node.
+	  bm_vm1_gc_wb_ary.rb is for fastpath and
+	  bm_vm1_gc_wb_ary_promoted.rb is for slowpath.
 
-	* eval.c (call_end_proc, proc_invoke): adjust backtrace in END.
-	  [ruby-dev:21551]
+	* benchmark/bm_vm1_gc_wb_obj(_promoted).rb: ditto.
 
-	* eval.c (rb_thread_start_0): set the value by break as the result.
-	  [ruby-dev:21552]
+Tue Mar 17 17:23:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (rb_thread_start_0, rb_thread_raise, rb_callcc): save
-	  variables across THREAD_SAVE_CONTEXT.
+	* dir.c (glob_helper): distinguish not-yet-stated and DT_UNKNOWN
+	  by readdir, and traverse recursively for the former.  Linux
+	  readdir returns DT_UNKNOWN on some filesystems, e.g., smbfs,
+	  iso9660.
 
-Thu Oct  9 12:05:46 2003  Eric Sunshine  <sunshine@sunshineco.com>
+Mon Mar 16 17:43:21 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-	* configure.in: revived NextStep, OpenStep, and Rhapsody ports which
-	  had become unbuildable; enhanced --enable-fat-binary option so that
-	  it accepts a list of desired architectures (rather than assuming a
-	  fixed list), or defaults to a platform-appropriate list if user does
-	  not provide an explicit list; made the default list of architectures
-	  for MAB (fat binary) more comprehensive; now uses -fno-common even
-	  when building the interpreter (in addition to using it for
-	  extensions), thus allowing the interpreter to be embedded into a
-	  plugin module of an external project (in addition to allowing
-	  embedding directly into an application); added checks for
-	  <netinet/in_systm.h> (needed by `socket' extension) and getcwd(); now
-	  ensures that -I/usr/local/include is employed when extensions'
-	  extconf.rb scripts invoke have_header() since extension checks on
-	  NextStep and OpenStep will fail without it if the desired resource
-	  resides in the /usr/local tree; fixed formatting of --help message.
+	* lib/webrick/server.rb: Fix regression bug in WEBrick's
+	  :DoNotReverseLookup config option implementation.
+	  [fix GH-731] Patch by @vais
+	* test/webrick/test_do_not_reverse_lookup.rb: ditto.
 
-	* Makefile.in: $(LIBRUBY_A) rule now deletes the archive before
-	  invoking $(AR) since `ar' on Apple/NeXT can not "update" MAB archives
-	  (see configure's --enable-fat-binary option); added rule for new
-	  missing/getcwd.c.
+Sat Mar 14 20:05:23 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
 
-	* defines.h: fixed endian handling during MAB build (see configure's
-	  --enable-fat-binary option) to ensure that all portions of the
-	  project see the correct WORDS_BIGENDIAN value (some extension modules
-	  were getting the wrong endian setting); added missing constants
-	  GETPGRP_VOID, WNOHANG, WUNTRACED, X_OK, and type pid_t for NextStep
-	  and OpenStep; removed unnecessary and problematic HAVE_SYS_WAIT_H
-	  define in NeXT section.
+	* math.c (math_gamma): optimization for passed small integer.
 
-	* dir.c: do not allow NAMLEN() macro to trust dirent::d_namlen on
-	  NextStep since, on some installations, this value always resolves
-	  uselessly to zero.
+Sat Mar 14 18:07:23 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
 
-	* dln.c: added error reporting to NextStep extension loader since the
-	  previous behavior of failing silently was not useful; now ensures
-	  that NSLINKMODULE_OPTION_BINDNOW compatibility constant is defined
-	  for OpenStep and Rhapsody; no longer includes <mach-o/dyld.h> twice
-	  on Rhapsody since this header lacks multiple-include protection,
-	  which resulted in "redefinition" compilation errors.
+	* enum.c: [DOC] Fixes Enumerable#member? documentation
+	  [fix GH-756][ci skip] Patch by @shamanime
 
-	* main.c: also create hard reference to objc_msgSend() on NeXT
-	  platforms (in addition to Apple platforms).
+Sat Mar 14 12:23:53 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/mkmf.rb: now exports XCFLAGS from configure script to extension
-	  makefiles so that extensions can be built MAB (see configure's
-	  --enable-fat-binary option); also utilize XCFLAGS in cc_command()
-	  (but not cpp_command() because MAB flags are incompatible with
-	  direct invocation of `cpp').
+	* dir.c (glob_helper): use d_type to reduce lstat system calls.
 
-	* ext/curses/extconf.rb: now additionally checks for presence of these
-	  curses functions which are not present on NextStep or Openstep:
-	  bkgd(), bkgdset(), color(), curs(), getbkgd(), init(), scrl(), set(),
-	  setscrreg(), wattroff(), wattron(), wattrset(), wbkgd(), wbkgdset(),
-	  wscrl(), wsetscrreg()
+	* win32/dir.h (struct direct): add d_type instead of d_isdir and
+	  d_isrep.  SYMLINKD is unreliable, since the target can be
+	  replaced after a link was created.
 
-	* ext/curses/curses.c: added appropriate #ifdef's for additional set of
-	  curses functions now checked by extconf.rb; fixed curses_bkgd() and
-	  window_bkgd() to correctly return boolean result rather than numeric
-	  result; fixed window_getbkgd() to correctly signal an error by
-	  returning nil rather than -1.
+	* win32/win32.c (readdir_internal): set d_type.
 
-	* ext/etc/etc.c: setup_passwd() and setup_group() now check for null
-	  pointers before invoking rb_tainted_str_new2() upon fields extracted
-	  from `struct passwd' and `struct group' since null pointers in some
-	  fields are common on NextStep/OpenStep (especially so for the
-	  `pw_comment' field) and rb_tainted_str_new2() throws an exception
-	  when it receives a null pointer.
+Sat Mar 14 02:14:50 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/pty/pty.c: include "util.h" for strdup()/ruby_strdup() for
-	  platforms such as NextStep and OpenStep which lack strdup().
+	* parse.y (primary): empty parentheses at cmdarg can be null.
+	  [ruby-core:68477] [Bug #10957]
 
-	* ext/socket/getaddrinfo.c: cast first argument of getservbyname(),
-	  gethostbyaddr(), and gethostbyname() from (const char*) to non-const
-	  (char*) for older platforms such as NextStep and OpenStep.
+Fri Mar 13 15:04:36 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/socket/socket.c: include "util.h" for strdup()/ruby_strdup() for
-	  platforms such as NextStep and OpenStep which lack strdup(); include
-	  <netinet/in_systm.h> if present for NextStep and OpenStep; cast first
-	  argument of gethostbyaddr() and getservbyname() from (const char*) to
-	  non-const (char*) for older platforms.
+	* ext/stringio/stringio.c (strio_close): don't raise on double
+	  close for consistent to IO#close.
 
-	* ext/syslog/syslog.c: include "util.h" for strdup()/ruby_strdup() for
-	  platforms such as NextStep and OpenStep which lack strdup().
+Fri Mar 13 15:03:20 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Oct  8 22:19:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
+	* io.c (rb_io_close_read, rb_io_close_write): don't raise after
+	  close same as IO#close.
 
-	* lib/test/unit.rb: removed installation instructions.
+Fri Mar 13 12:29:07 2015  Tanaka Akira  <akr@fsij.org>
 
-	* lib/test/unit/ui/testrunnermediator.rb: moved the run flag to a more
-	  central location.
+	* test/readline/test_readline.rb: Restore environment variables:
+	  COLUMNS LINES
 
-	* lib/test/unit.rb: ditto.
+Fri Mar 13 11:37:46 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/test/unit.rb: extracted the running code in to AutoRunner.
+	* ext/fiddle/extconf.rb: needs --enable-shared when linked to
+	  libruby or fiddle.so.  since --with-static-linked-ext does no
+	  longer link extensions to ruby program with --enable-shared, the
+	  only combination needs --enable-static is --disable-shared and
+	  --with-static-linked-ext.  [ruby-dev:48901] [Bug #10960]
 
-	* lib/test/unit/autorunner.rb: added.
+Fri Mar 13 07:02:20 2015  Eric Wong  <e@80x24.org>
 
-	* lib/test/unit/collector/objectspace.rb: extracted common test
-	  collection functionality in to a module.
+	* ext/socket/init.c (rsock_s_accept_nonblock): use rb_hash_lookup2
+	* ext/openssl/ossl_ssl.c (get_no_exception): new function
+	  (ossl_ssl_accept_nonblock): use get_no_exception
+	  (ossl_ssl_read_internal): ditto
+	  (ossl_ssl_write_nonblock): ditto
+	  [ruby-core:68511]
 
-	* lib/test/unit/collector.rb: ditto; added.
+Fri Mar 13 07:01:38 2015  Eric Wong  <e@80x24.org>
 
-	* test/testunit/collector/test_objectspace.rb: ditto.
+	* ext/openssl/ossl_ssl.c: predefine wait_*able symbols
 
-	* lib/test/unit/collector/dir.rb: added. Supports collecting tests out
-	  of a directory structure.
+Thu Mar 12 22:59:53 2015  Tanaka Akira  <akr@fsij.org>
 
-	* test/testunit/collector/test_dir.rb: added.
+	* test/lib/leakchecker.rb: Check environment variables.
 
-	* test/runner.rb: simplified to use the new capabilities.
+Thu Mar 12 05:54:27 2015  Eric Wong  <e@80x24.org>
 
-Tue Oct  7 15:23:09 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* ext/socket/init.c (rsock_s_accept_nonblock):
+	  support exception: false
+	  [ruby-core:66385] [Feature #10532]
+	* ext/socket/init.c (rsock_init_socket_init): define new symbols
+	* ext/socket/rubysocket.h: adjust prototype
+	* ext/socket/socket.c (sock_accept_nonblock): support exception: false
+	* ext/openssl/ossl_ssl.c (ossl_ssl_accept_nonblock): ditto
+	* ext/socket/socket.c (Init_socket): adjust accept_nonblock definition
+	* ext/openssl/ossl_ssl.c (Init_ossl_ssl): ditto
+	* ext/socket/tcpserver.c (rsock_init_tcpserver): ditto
+	* ext/socket/unixserver.c (rsock_init_unixserver): ditto
+	* ext/socket/tcpserver.c (tcp_accept_nonblock): adjust
+	  rsock_s_accept_nonblock call
+	* ext/socket/unixserver.c (unix_accept_nonblock): ditto
+	* ext/openssl/ossl_ssl.c (ossl_start_ssl): support no_exception
+	* ext/openssl/ossl_ssl.c (ossl_ssl_connect): adjust ossl_start_ssl call
+	* ext/openssl/ossl_ssl.c (ossl_ssl_connect_nonblock): ditto
+	* ext/openssl/ossl_ssl.c (ossl_ssl_accept): ditto
+	* test/socket/test_nonblock.rb (test_accept_nonblock): test for
+	  "exception :false"
+	* test/socket/test_tcp.rb (test_accept_nonblock): new test
+	* test/socket/test_unix.rb (test_accept_nonblock): ditto
+	* test/openssl/test_pair.rb (test_accept_nonblock_no_exception): ditto
 
-	* test/ruby/test_beginendblock.rb: add tests for nested BEGIN/END.
+Thu Mar 12 10:53:06 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* test/ruby/beginmainend.rb: add tests for nested BEGIN/END.
+	* internal.h, node.h: move a definition of `struct rb_global_entry'
+	  and related functions from node.h to internal.h.
 
-	* test/ruby/endblockwarn.rb: new file added to test of END-in-method
-	  warning.
+	* variable.c: remove unused include pragma.
 
-Tue Oct  7 12:23:47 2003  Tanaka Akira  <akr@m17n.org>
+	* common.mk: remove unused dependency.
 
-	* ext/fcntl/fcntl.c (Init_fcntl): define Fcntl::O_ACCMODE.
+Thu Mar 12 10:32:39 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/socket/extconf.rb: useless assignment removed.
+	* common.mk: remove unused dependency.
 
-Tue Oct  7 09:13:24 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Mar 12 08:20:14 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* test/ruby/test_beginendblock.rb (test_endinmethod): END{} is now
-	  allowed in eval.
+	* load.c: removed unused header file "node.h".
 
-Tue Oct  7 04:15:25 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* method.h: ditto.
 
-	* parse.y (stmt): should not expand mrhs if lhs is solely starred.
+	* symbol.c: ditto.
 
-Tue Oct  7 02:57:53 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Thu Mar 12 08:14:48 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* parse.y (stmt): rhs of multiple assignment should not be
-	  expanded using "to_a". [ruby-dev:21527]
+	* gc.c: RGENGC_CHECK_MODE should be 0.
 
-Tue Oct  7 01:42:34 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Thu Mar 12 07:44:17 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/openssl/ossl_asn1.c (ossl_asn1_get_asn1type): use appropriate
-	  free function for ASN1_OBJECT.
+	* internal.h: use T_IMEMO to represent `struct MEMO' value.
+	  memo->v1 and memo->v2 is WB protected values.
+	  So use MEMO_V1/V2_SET() macros to set these values.
+	  memo->u3 is ambiguous (sometimes a VALUE, sometimes an integer
+	  value), so use gc_mark_maybe() in gc.c to mark it.
 
-	* ext/openssl/ossl_asn1.c (ossl_asn1obj_get_sn): add new function for
-	  ASN1::ObjectId#sn; it returns short name text representation of OID.
+	  Rename NEW_MEMO() to MEMO_NEW().
 
-	* ext/openssl/ossl_asn1.c (ossl_asn1obj_get_ln): add new function for
-	  ASN1::ObjectId#ln; it returns long name text representation of OID.
+	  Move MEMO_FOR and NEW_MEMO_FOR macros from node.h.
 
-	* ext/openssl/ossl_asn1.c (ossl_asn1obj_get_oid): add new function for
-	  ASN1::ObjectId#oid; it returns numerical representation of OID.
+	  Export a rb_imemo_new() function for ext/ripper.
 
-Mon Oct  6 22:59:46 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* node.h: remove NODE_MEMO.
 
-	* lib/csv.rb (IOReader, BasicWriter): call binmode when a given IO
-	  respond_to?(:binmode).  record separator was wrong when you gave
-	  text mode IO to Reader.parse and Writer.generate.
+	* enum.c: catch up these change.
 
-	* test/csv/test_csv.rb: add tests for above change.
+	* enumerator.c: ditto.
 
-Sun Oct  5 23:27:09 2003  Tanaka Akira  <akr@m17n.org>
+	* load.c: ditto.
 
-	* ext/socket/extconf.rb: check recvmsg even if sendmsg is exists.
+	* ext/objspace/objspace.c (count_nodes): ditto.
 
-	* ext/socket/socket.c (thread_read_select): restored.
+	* gc.c (gc_mark_children): mark imemo_memo type.
 
-Mon Oct  6 16:23:38 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* parse.y (new_args_gen): use T_IMEMO.
+	  (I'm not sure it is working correctly...)
 
-	* marshal.c (w_object): wrong method name in the message.
+Wed Mar 11 22:36:34 2015  Koichi Sasada  <ko1@atdot.net>
 
-Mon Oct  6 16:02:05 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* eval.c (frame_called_id): it should use vm_ifunc type.
 
-	* parse.y (stmt): END in method should cause warning.
-	  [ruby-dev:21519]
+	* eval.c (frame_func_id): ditto.
 
-Mon Oct  6 15:17:23 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Wed Mar 11 22:27:05 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* test/ruby/test_iterator.rb (test_block_argument_without_paren):
-	  added. (follows sample/test.rb)
+	* node.h: remove NODE_IFUNC, NEW_IFUNC.
 
-Mon Oct  6 11:57:06 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* internal.h: use T_IMEMO for IFUNC.
 
-	* test/ruby/test_beginendblock.rb, test/ruby/beginmainend.rb: added
-	  test for eval-ed BEGIN END order.
+	  rename `struct IFUNC' to `struct vm_ifunc' and move the definition
+	  from vm_insnhelper.h. Add imemo_ifunc.
 
-Mon Oct  6 09:19:54 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* gc.c (gc_mark_children): mark imemo_ifunc type T_IMEMO object.
 
-	* marshal.c (w_object): should pass "weak" value to next level.
-	  [ruby-dev:21496]
+	* compile.c: catch up these changes.
 
-	* eval.c (proc_alloc): should not use cached object if klass is
-	  different. [ruby-talk:83685]
+	* proc.c: ditto.
 
-Sun Oct  5 23:27:09 2003  Tanaka Akira  <akr@m17n.org>
+	* vm_core.h (RUBY_VM_IFUNC_P): ditto.
 
-	* lib/pathname.rb: version information is added in document.
+	* vm_eval.c (rb_iterate): ditto.
 
-Sun Oct  5 23:07:03 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* vm_insnhelper.c: ditto.
 
-	* eval.c (rb_f_END): block should be given.  [ruby-dev:21497]
+	* ext/objspace/objspace.c: ditto.
 
-Sun Oct  5 22:51:23 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Wed Mar 11 21:53:43 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/ext/openssl/extconf.rb: add check for some engine functions
-	  unavailable in OpenSSL-0.9.6.
+	* internal.h, eval_intern.h: move CREF accessors.
 
-	* lib/ext/openssl/ossl_engine.c: ditto.
+	  List IMEMO supported types in internal.h.
 
-Sun Oct  5 17:56:30 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Mar 11 21:45:36 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* eval.c (rb_eval): fix evaluation order.  [ruby-list:38431]
+	* vm_insnhelper.h: use T_IMEMO to create THROW_DATA.
 
-Sun Oct  5 15:05:06 2003  akira yamada  <akira@ruby-lang.org>
+	  Add THROW_DATA_NEW().
 
-	* test/uri/*: translated RUNIT to Test::Unit.
+	* internal.h: move definition of `struct THROW_DATA'
+	  from vm_insnhelper.h to internal.h.
 
-Sun Oct  5 14:37:39 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	  Rename `THROW_DATA' to `vm_throw_data'.
 
-	* lib/xsd/datatypes.rb: Rational -> Decimal string bug fix.
+	* eval_intern.h (THROW_DATA_P): move to internal.h.
+	  THROW_DATA is no longer T_NODE, so check T_IMEMO.
 
-	* test/soap/marshal/test_marshal.rb: ditto.
+	* gc.c (gc_mark_children): mark THROW_DATA.
 
-	* test/soap/calc/test_calc_cgi.rb: add Config::CONFIG["EXEEXT"] to
-	  RUBYBIN.
+	* vm.c: catch up these changes.
 
-Sun Oct  5 13:47:22 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* vm_eval.c: ditto.
 
-	* test/ruby/test_beginendblock.rb, test/ruby/beginmainend.rb: add tests
-	  about scope, order and allowed syntax.
+	* vm_insnhelper.c: ditto.
 
-Sun Oct  5 11:54:29 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Wed Mar 11 21:21:56 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* test/ruby/envutil.rb: added.  split "rubybin" from test_system.rb.
+	* vm_insnhelper.c: use T_IMEMO to create SVAR.
 
-	* test/ruby/test_system.rb: use envutil.rb
+	* internal.h, vm_insnhelper.h: move definition `struct SVAR'
+	  from vm_insnhelper.h to internal.h. And rename it to struct vm_svar.
 
-	* test/ruby/test_beginendblock.rb: added.
+	  new imemo_type imemo_svar is added.
 
-	* test/ruby/beginmainend.rb: added.  used in test_beginendblock.rb.
+	* gc.c (gc_mark_children): mark imemo_svar.
 
-Sun Oct  5 11:23:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
+	* node.c (rb_gc_mark_node): remove useless marking.
 
-	* test/testunit/runit/test_testresult.rb: removed some unnecessary
-	  cruft.
+Wed Mar 11 19:35:46 2015  Koichi Sasada  <ko1@atdot.net>
 
-Sun Oct  5 11:14:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
+	* include/ruby/ruby.h: introduce new type T_IMEMO.
+	  T_IMEMO is Internal Memo type, internal use only.
+	  T_IMEMO has same purpose of NODE_MEMO.
 
-	* lib/rubyunit.rb: aliasing TestCase into the top level is
-	  problematic.
+	  To insert T_IMEMO, type numbers are modified a little.
 
-	* lib/runit/assert.rb: fixed a couple of bugs caused by recent
-	  refactoring in Test::Unit.
+	* internal.h: define struct RIMemo. Each RIMemo objects
+	  has imemo_type. We can observe it by the imemo_type() function.
 
-	* test/testunit/runit/*: added.
+	* gc.c (rb_imemo_new): added.
 
-Sun Oct  5 10:55:29 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* node.h: remove NODE_CREF and NEW_CREF().
 
-	* lib/open-uri.rb (URI::Generic#find_proxy): no_proxy support did not
-	  work.  [ruby-dev:21484]
+	* node.c (rb_gc_mark_node): ditto.
 
-Sun Oct  5 09:52:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
+	* vm.c (vm_cref_new): use rb_imem_new().
 
-	* lib/test/unit/assertions.rb: will use pp for output if available.
-	  Can be disabled by setting Assertions.use_pp = false.
+	* vm_eval.c: ditto.
 
-	* test/testunit/test_assertions.rb: made a small change to exception
-	  formatting.
+	* vm_insnhelper.c: use RIMemo objects for CREF.
 
-Sun Oct  5 07:42:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
+	* ext/objspace/objspace.c: support T_IMEMO.
 
-	* lib/test/unit/assertions.rb: made small improvements to assertion
-	  messages. Deprecated Assertions#assert_not_nil; use #assert instead.
+Wed Mar 11 17:03:20 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* test/testunit/test_assertions.rb: ditto.
+	* gc.c: fix memory leak by prepend method.
 
-	* test/testunit/util/test_procwrapper.rb: use #assert instead of
-	  #assert_not_nil.
+	  It is easy to reproduce with such script:
 
-Sun Oct  5 04:10:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
-
-	* lib/test/unit/assertions.rb: refactored message building.
-
-Sun Oct  5 03:40:22 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
-
-	* ext/openssl/ossl_asn1.h: global symbols should be declared
-	  as external.
-
-Sun Oct  5 03:03:20 2003  akira yamada  <akira@ruby-lang.org>
-
-	* test/ruby/test_exception.rb (test_else): added.
-
-Sun Oct  5 02:12:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
-
-	* lib/test/unit/assertions.rb: changed assertion messages to rely more
-	  heavily on #inspect. Added backtrace filtering for exceptions in
-	  assertion messages.
-
-	* test/testunit/test_assertions.rb: ditto.
-
-Sun Oct  5 02:12:00 2003  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* lib/drb/acl.rb, lib/drb/ssl.rb: added.
-
-	* lib/drb/drb.rb: exit from a thread using 'break'.
-
-Sat Oct  4 21:49:14 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
-
-	* gc.c (Init_stack): the type of space is changed to unsigned int
-	  from double.  [ruby-dev:21483]
-
-Sat Oct  4 17:52:59 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-
-	* lib/soap/netHttpClient.rb: follow http-access2.  hosts which matches
-	  ENV['no_proxy'] or ENV['NO_PROXY'] are not proxyed.
-	  - [,:] separated. ("ruby-lang.org:rubyist.net")
-	  - no regexp. (give "ruby-lang.org", not "*.ruby-lang.org")
-	  - if you want specify host by IP address, give full address.
-	    ("192.168.1.1, 192.168.1.2")
-
-	* lib/soap/rpc/cgistub.rb: return "Status: XXX MMM" line.
-
-	* test/runner.rb: give testsuite name.
-
-Sat Oct  4 15:16:02 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
-
-	* marshal.c (w_object): instance variable dump do not cause error
-	  for objects that cannot be dumped, if they traversed from
-	  marshal_dump.  they are just ignored.
-
-	* gc.c (Init_stack): cast "space" (doble value) into unsigned
-	  int.  should run on PowerPC.
-
-	* eval.c (rb_eval): should not execute else part if any exception
-	  is caught. [ruby-dev:21482]
-
-	* parse.y (f_args): should allow unparenthesized block argument.
-
-	* parse.y (f_rest_arg): should allow unparenthesized rest
-	  argument.
-
-Sat Oct  4 14:59:51 2003  Tanaka Akira  <akr@m17n.org>
-
-	* lib/pathname.rb (initialize): raise ArgumentError if argument has
-	  '\0' character.
-	  (relative_path_from): new method.
-	  (each_entry): new method for replacement of dir_foreach.
-	  (foreach, foreachline, dir_foreach, chdir): obsoleted.
-
-Sat Oct  4 12:58:48 2003  akira yamada  <akira@ruby-lang.org>
-
-	* test/uri/* (6 files): added.
-
-Sat Oct  4 12:44:45 2003  akira yamada  <akira@ruby-lang.org>
-
-	* lib/uri/ftp.rb, lib/uri/mailto.rb: renamed to #to_s from #to_str.
-
-Sat Oct  4 07:33:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
-
-	* lib/test/unit/testsuite.rb: changed #<< to return self, and added
-	  #delete.
-
-	* test/testunit/test_testsuite.rb: ditto. Also slightly refactored
-	  #test_size.
-
-	* lib/test/unit/collector/objectspace.rb: collector now preserves the
-	  hierarchy of suites.
-
-	* test/testunit/collector/test_objectspace.rb: ditto.
-
-Sat Oct  4 04:48:49 2003  why the lucky stiff  <why@ruby-lang.org>
-
-	* ext/syck/rubyext.c: default keys handled.
-
-	* ext/syck/syck.h: lowered default buffer size to 16k for increased
-	  performance.
-
-	* test/yaml: checkin of basic unit tests.
-
-Sat Oct  4 04:24:19 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	    module M; def bar; end; end
+	    loop{
+	      Class.new do
+	        def foo; end
+	        prepend M
+	      end
+	    }
 
-	* ext/openssl/extconf.rb: add check for X509V3_set_nconf.
+	* gc.c (obj_free): free T_ICLASS::m_tbl if it is created by prepend.
+	  To recognize it, check RICLASS_IS_ORIGIN flag.
 
-	* ext/openssl/ossl_x509ext.c (ossl_x509extfactory_set_config):
-	  cannot implement if X509V3_set_nconf doesn't exist.
+	* gc.c (gc_mark_children): T_ICLASS objects only need to mark
+	  T_ICLASS::m_tbl if RICLASS_IS_ORIGIN is set.
 
-Sat Oct  4 02:12:44 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* gc.c (obj_memsize_of): count T_ICLASS if RICLASS_IS_ORIGIN is set.
 
-	* lib/xsd/datatypes.rb: dump sign by itself.  under the problematic
-	  platform, sprintf("%+.10g", -0.0) => +0.  sigh.
+	* internal.h (RCLASS_SET_ORIGIN): add to set RCLASS_SET_ORIGIN.
 
-	* sample/wsdl/amazon/*: update schema ver2 to ver3.
+	  TODO: The word `origin' seems not good name. We need to invent
+	  another good name.
 
-Sat Oct  4 01:33:46 2003  Tanaka Akira  <akr@m17n.org>
+	* class.c: use RCLASS_SET_ORIGIN().
 
-	* lib/pathname.rb (initialize): duplicate and freeze argument.
-	  (to_s): return duplicated string.
-	  (children): new method.
-	  (each_line): new alias to foreachline.
+	* class.c (class_alloc): zero clear rb_classext_t.
 
-Fri Oct  3 16:13:19 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Wed Mar 11 13:28:49 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/openssl/ossl_asn1.c: add DER encoder and decoder.
+	* configure.in: check also procstat_getvmmap, which is not
+	  available on FreeBSD 9.  [ruby-core:68468] [Bug #10954]
 
-	* ext/openssl/ossl_asn1.h: add OpenSSL::ASN1 module.
+	* vm_dump.c (procstat_vm): use kinfo_getvmmap instead if
+	  procstat_getvmmap is not available.
 
-	* ext/openssl/ossl.c (Init_openssl): call Init_ossl_asn1.
+Wed Mar 11 09:15:21 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/openssl/extconf.rb: check if X509_ATTRIBUTE has field "single".
+	* internal.h: define struct MEMO.
 
-	* ext/openssl/ossl_x509attr.c (ossl_x509attr_set_value): accept
-	  DER encoded data argument.
+	* enum.c: use MEMO.
 
-	* ext/openssl/ossl_x509attr.c (ossl_x509attr_get_value): return
-	  DER encoded data in OpenSSL::ASN1 types.
+	* enumerator.c: ditto.
 
-Fri Oct  3 13:02:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
+	* load.c: ditto.
 
-	* lib/test/unit.rb: refactored to use optparse.
+	* node.h: return (struct MEMO *) pointer.
 
-	* lib/test/unit.rb: added support for selecting the output
-	  level from the command-line.
+Wed Mar 11 06:26:21 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/test/unit.rb: added a command-line switch to stop processing
-	  the command-line, allowing arguments to be passed to tests.
+	* vm_insnhelper.h (THROW_DATA_STATE): return int, not VALUE.
 
-	* lib/test/unit.rb: changed the method for specifying a runner or a
-	  filter from the command-line.
+	* vm_insnhelper.h (THROW_DATA_STATE_SET): accept int value.
 
-	* lib/test/unit/collector/objectspace.rb: fixed a bug causing all
-	  tests to be excluded when the filter was set to an empty array.
+Wed Mar 11 05:06:46 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* test/testunit/collector/test_objectspace.rb: ditto.
+	* vm_eval.c (rb_catch_protect): use THROW_DATA_VAL().
 
-Fri Oct  3 08:14:32 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Wed Mar 11 04:56:04 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/irb/ruby-lex.rb (RubyLex::identify_identifier): support
-	  'class ::Foo' syntax. [ruby-talk:83514]
+	* vm_insnhelper.h: define struct IFUNC.
 
-Fri Oct  3 08:01:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
+	* vm_eval.c (rb_iterate): use it.
 
-	* lib/test/unit/assertions.rb: added a default message for #assert,
-	  #assert_block, and #flunk.
+	* vm_insnhelper.c (vm_yield_with_cfunc): ditto.
 
-	* test/testunit/test_assertions.rb: ditto.
+Wed Mar 11 03:52:12 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/test/unit/failure.rb: failures now show a better trace of where
-	  they occurred.
+	* eval_intern.h (THROW_DATA_P): use RB_TYPE_P() instead of
+	  BUILTIN_TYPE().
 
-	* test/testunit/test_failure.rb: ditto (added).
+	* thread.c (thread_join): use THROW_DATA_P().
 
-	* lib/test/unit/testcase.rb: ditto.
+Wed Mar 11 03:48:01 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* test/testunit/test_testcase.rb: ditto.
+	* proc.c: use RUBY_VM_IFUNC_P() to recognize IFUNC or not.
 
-	* lib/test/unit/util/backtracefilter.rb: added.
+	* vm.c: ditto.
 
-	* test/testunit/util/test_backtracefilter.rb: added.
+	* vm_dump.c: ditto.
 
-	* lib/test/unit/error.rb: changed to use BacktraceFilter and improved
-	  output.
+	* vm_insnhelper.c: ditto.
 
-	* test/testunit/test_error.rb: ditto.
+	* vm_core.h (RUBY_VM_IFUNC_P): use RB_TYPE_P() instead of
+	  BUILTIN_TYPE().
 
-Thu Oct  2 20:33:49 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Mar 11 03:21:37 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/iconv/iconv.c (iconv_failure_initialize): conform with
-	  orthodox initialization method.
+	* vm_insnhelper.h: define struct THROW_DATA to represent
+	  throwing data. Also define accessor functions.
 
-	* ext/iconv/iconv.c (iconv_fail): initialize exception instance
-	  from the class, and do not share instance variables with the
-	  others.  [ruby-dev:21470]
+	* eval_intern.h: move related changes into vm_insnhelper.h.
+	  Now these MACROs (functions) are only used in vm*.c.
 
-Thu Oct  2 18:20:27 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	  There is only THROW_DATA_P(err) to check this data type or not.
 
-	* time.c (Init_Time): define initialize.  [ruby-dev:21469]
+	* vm.c: catch up these changes.
 
-Thu Oct  2 17:39:38 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* vm_eval.c: ditto.
 
-	* ext/openssl/ossl_engine.c: add a new module OpenSSL::Engine.
-	  it supports OpenSSL hardware cryptographic engine interface.
+	* vm_insnhelper.c: ditto.
 
-	* ext/openssl/ossl_engine.h: ditto.
+Wed Mar 11 00:57:00 2015  Rei Odaira  <Rei.Odaira@gmail.com>
 
-	* ext/openssl/MANIFEST: add ossl_engine.c and ossl_engine.h.
+	* test/rubygems/test_gem_security_trust_dir.rb: The return value of
+	  File::Stat#mode is OS dependent. In AIX, 0200000 is set.
 
-	* ext/openssl/extconf.rb: add check for openssl/engine.h.
+Tue Mar 10 20:03:41 2015  Tanaka Akira  <akr@fsij.org>
 
-	* ext/openssl/ossl.c: call Init_ossl_engine().
+	* lib/webrick/server.rb: Invoke setup_shutdown_pipe in start method
+	  instead of listen method.
+	  [ruby-core:68476] [Bug #10956] Reported by Shintaro Kojima.
 
-	* ext/openssl/ossl.h: include openssl/engine.h.
+Tue Mar 10 17:27:27 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* ext/openssl/ossl_pkey_{rsa,dsa,dh}.c: check if underlying
-	  EVP_PKEY referes engine.
+	* thread.c (thread_join): Fixnum (except TAG_FATAL) and
+	  NODE should not be reached here.
 
-Thu Oct  2 17:22:37 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Mon Mar  9 21:42:10 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* time.c (time_load): restore instance variables (if any) before
-	  loading from marshaled data.
+	* vm_insnhelper.c (ep_cref): rename to lep_cref() because it should be
+	  local ep.
 
-Thu Oct  2 14:19:15 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon Mar  9 16:34:36 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/iconv/iconv.c (iconv_fail): now yield erred substring, and
-	  set error object to $!.
+	* ext/stringio/stringio.c (strio_close): don't raise on double
+	  close for consistent to IO#close.
 
-	* ext/iconv/iconv.c (iconv_convert): error handler block should
-	  return appended part and the rest.  if rest is nil, the
-	  conversion stops.
+Mon Mar 09 06:44:48 2015  Koichi Sasada  <ko1@atdot.net>
 
-Thu Oct  2 12:00:18 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* vm_insnhelper.h: define struct SVAR for SVAR.
+	  This data type is also same layout of NODE (NODE_IF).
 
-	* variable.c (rb_const_defined_0): look up constants in Object as
-	  well.  [ruby-dev:21458]
+	* vm_insnhelper.c: catch up this change.
 
-	* test/ruby/test_defined.rb (TestDefined::test_defined): test for
-	  constants.
+Mon Mar  9 06:43:21 2015  Koichi Sasada  <ko1@atdot.net>
 
-Thu Oct  2 11:17:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
+	* vm_insnhelper.c (lep_svar_set): add WBs.
 
-	* lib/test/unit/assertions.rb: should not capture an
-	  AssertionFailedError unless explicitly requested.
+Mon Mar  9 06:19:06 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* test/testunit/test_assertions.rb: ditto.
+	* internal.h: define rb_cref_t and change to use it.
 
-	* test/testunit/collector/test_objectspace.rb: fixed a test failure
-	  caused by methods being returned in different orders on different
-	  platforms by moving test sorting from TestSuite into the locations
-	  where suites are constructed. [ruby-talk:83156]
+	  rb_cref_t is data type of CREF. Now, the body is still NODE.
+	  It is easy to understand what is CREF and what is pure NODE.
 
-	* lib/test/unit/testcase.rb: ditto.
+Mon Mar  9 06:00:37 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/test/unit/testsuite.rb: ditto.
+	* vm_insnhelper.h (COPY_CREF_OMOD): fix translation miss.
 
-	* lib/test/unit/collector/objectspace.rb: ditto.
+Mon Mar  9 04:47:58 2015  Koichi Sasada  <ko1@atdot.net>
 
-Thu Oct  2 03:25:01 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* internal.h: define CREF accessor macros.
+	  * CREF_CLASS(cref)
+	  * CREF_NEXT(cref)
+	  * CREF_VISI(cref)
+	  * CREF_VISI_SET(cref, v)
+	  * CREF_REFINEMENTS(cref)
+	  * CREF_PUSHED_BY_EVAL(cref)
+	  * CREF_PUSHED_BY_EVAL_SET(cref)
+	  * CREF_OMOD_SHARED(cref)
+	  * CREF_OMOD_SHARED_SET(cref)
+	  * CREF_OMOD_SHARED_UNSET(cref)
 
-	* eval.c (rb_thread_raise): prototype; avoid VC++ warning.
+	  This is process to change CREF data type from NODE.
 
-Thu Oct  2 01:37:34 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sun Mar  8 22:50:57 2015  Tanaka Akira  <akr@fsij.org>
 
-	* time.c (time_mdump): new marshal dumper. _dump is still
-	  available for compatibility.
+	* ext/zlib/zlib.c (rb_gzfile_close): Don't raise on double
+	  close for consistent to IO#close.
 
-	* time.c (time_mload): new marshal loader.
+Sun Mar  8 16:57:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* marshal.c (w_object): preserve instance variables for objects
-	  with marshal_dump.
+	* dir.c (glob_helper): match patterns against legacy short names
+	  too, not only ordinary names.  [ruby-core:67954] [Bug #10819]
 
-	* marshal.c (r_object0): restore instance variables before calling
-	  marshal_load.
+	* win32/dir.h (struct direct): add short name members.
 
-	* error.c (rb_warn_m): always return nil.
+	* win32/win32.c (opendir_internal, readdir_internal): ditto.
 
-Thu Oct  2 01:32:46 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sat Mar  7 09:36:05 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-	* eval.c (rb_f_block_given_p): real required condition is
-	  ruby_frame->prev->iter == ITER_CUR.
+	* array.c: document that first element is kept when using
+	  Array#uniq and #uniq! [fix GH-845][ci skip]
+	  Patch by @riffraff
 
-	* eval.c (rb_block_given_p): ditto.
+Sat Mar  7 09:28:02 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-	* eval.c (block_pass): update ruby_frame->iter only when previous
-	  value is ITER_NOT.
+	* thread.c: Mutex#owned? is no longer experimental since 2.1.0
+	  [fix GH-839][ci skip] Patch by @takiy33
 
-Thu Oct  2 01:02:35 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sat Mar  7 09:18:42 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-	* variable.c (rb_const_defined_at): should exclude constants from
-	  Object when TYPE(klass) == T_MODULE *and* exclude is on.
-	  [ruby-dev:21458]
+	* tool/merger.rb: Added documentation to version method.
+	  [fix GH-847][ci skip] Patch by @magikid
 
-	* variable.c (rb_const_get_0): do not lookup constants from Object
-	  when TYPE(klass) == T_MODULE *and* exclude is on.
+Fri Mar  6 22:50:36 2015  Koichi Sasada  <ko1@atdot.net>
 
-Thu Oct  2 00:21:11 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* class.c (rb_prepend_module): need a WB for klass -> origin.
 
-	* test/logger/test_logger.rb: unlinking file before close causes
-	  problem under win32 box.
+Fri Mar  6 20:18:38 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* lib/xsd/datatypes.rb(XSDFloat, XSDDouble): add +/- sign explicitly
-	  when stringified and embedded into XML instance.  Ruby's sprintf may
-	  format -0.0 as "0.0" (no minus sign) depending on underlying C
-	  sprintf implementation.
+	* fix namespace issue on singleton class expressions. [Bug #10943]
 
-	* test/xsd/test_xsd.rb, test/soap/test_basetype.rb: follow above change.
+	* vm_core.h, method.h: remove rb_iseq_t::cref_stack. CREF is stored
+	  to rb_method_definition_t::body.iseq_body.cref.
 
-	* test/soap/calc/*: give httpd config param "CGIInterpreter".
-	  "/usr/bin/env ruby" thing does not work under non-Unix boxes.
+	* vm_insnhelper.c: modify SVAR usage.
+	  When calling ISEQ type method, push CREF information onto method
+	  frame, SVAR located place. Before this fix, SVAR is simply nil.
+	  After this patch, CREF (or NULL == Qfalse for not iseq methods)
+	  is stored at the method invocation.
 
-Sat Oct  2 00:42:20 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	  When SVAR is required, then put NODE_IF onto SVAR location,
+	  and NDOE_IF::nd_reserved points CREF itself.
 
-	* marshal.c (r_byte): retrieve pointer from string value for each
-	  time.  [ruby-dev:24404]
+	* vm.c (vm_cref_new, vm_cref_dump, vm_cref_new_toplevel): added.
 
-	* marshal.c (r_bytes0): ditto.
+	* vm_insnhelper.c (vm_push_frame): accept CREF.
 
-	* enum.c (sort_by_i): re-entrance check added.  [ruby-dev:24399]
+	* method.h, vm_method.c (rb_add_method_iseq): added. This function
+	  accepts iseq and CREF.
 
-	* io.c (io_read): should freeze all reading buffer.
-	  [ruby-dev:24400]
+	* class.c (clone_method): use rb_add_method_iseq().
 
-	* string.c (rb_str_sum): should use bignums when bits is greater
-	  than or equals to sizeof(long)*CHAR_BITS. [ruby-dev:24395]
+	* gc.c (mark_method_entry): mark method_entry::body.iseq_body.cref.
 
-	* eval.c (specific_eval): defer pointer retrieval to prevent
-	  unsafe sourcefile string modification.  [ruby-dev:24382]
+	* iseq.c: remove CREF related codes.
 
-	* string.c (rb_str_sum): wrong cast caused wrong result.
-	  [ruby-dev:24385]
+	* insns.def (getinlinecache/setinlinecache): CREF should be cache key
+	  because a different CREF has a different namespace.
 
-	* enum.c (enum_sort_by): hide temporary array from
-	  ObjectSpace.each_object.  [ruby-dev:24386]
+	* node.c (rb_gc_mark_node): mark NODE_IF::nd_reserved for SVAR.
 
-	* string.c (rb_str_sum): check was done with false pointer.
-	  [ruby-dev:24383]
+	* proc.c: catch up changes.
 
-	* string.c (rb_str_sum): string may be altered.  [ruby-dev:24381]
+	* struct.c: ditto.
 
-Thu Oct  2 00:25:21 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* insns.def: ditto.
 
-	* signal.c (ruby_signal_name): adjust to the prototype.
+	* vm_args.c (raise_argument_error): ditto.
 
-	* process.c (pst_inspect): ditto.
+	* vm_eval.c: ditto.
 
-	* ext/etc/etc.c (etc_getgrent, Init_etc): typo.
+	* test/ruby/test_class.rb: add a test.
 
-Wed Oct  1 20:49:41 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Mar  6 18:19:13 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* gc.c (heaps): manage slots and limits together.  [ruby-dev:21453]
+	* test/webrick/test_filehandler.rb: on vboxsf (on VirtualBox
+	  on Windows 7), file name and permissions are strange (can access
+	  by short file name and so on).
 
-	* gc.c (add_heap): should not clear heaps slot even if realloc()
-	  failed.
+	  Simply skip on such tests on such FS. To detect strange FS, this
+	  patch use a part of code `File.executable?(__FILE__)`.
+	  Please correct them if there are better ways.
 
-Wed Oct  1 20:36:49 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+Fri Mar  6 17:31:29 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* MANIFEST: add wince/mkconfig_wce.rb.
+	* test/ruby/test_beginendblock.rb: do not change directory.
 
-Wed Oct  1 17:22:33 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	  Run system command in the directory mounted by vboxsf on Windows 7
+	  and get warning like that "warning: Insecure world writable dir...".
 
-	* ext/etc/etc.c: add new functions: setpwent, getpwent, endpwent,
-	  setgrent, getgrent, endgrent.
+Fri Mar  6 10:31:00 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/socket/socket.c (sock_s_gethostbyname): do not reverse lookup.
+	* vm_eval.c (vm_call_super): search next super class from the
+	  original class, to get rid of infinite recursion with
+	  prepending.  a patch by Seiei Higa <hanachin AT gmail.com> at
+	  [ruby-core:68434].  [ruby-core:68093] [Bug #10847]
 
-Wed Oct  1 17:01:30 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Mar  6 08:45:26 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
 
-	* eval.c (rb_load): Object scope had priority over required file
-	  scope.  [ruby-dev:21415]
+	* lib/matrix.rb: Add Vector#round. Patch by Jordan Stephens.
+	  [Fixes GH-802]
 
-Wed Oct  1 14:09:53 2003  Takaaki Uematsu  <uema2x@jcom.home.ne.jp>
+Fri Mar  6 07:33:03 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* wince/mkconfig_wce.rb: sorry, forget to commit.
+	* gc.c (obj_info): show node name too.
 
-Wed Oct  1 10:08:42 2003  Takaaki Uematsu  <uema2x@jcom.home.ne.jp>
+Fri Mar  6 07:00:44 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* wince/setup.mak: add sigmarionIII SDK support.
+	* internal.h: remove struct method_table_wrapper.
+	  struct method_table_wrapper was introduced to avoid duplicate marking
+	  for method tables.
 
-	* wince/Makefile.sub: ditto.
+	  For example, `module M1; def foo; end; end` make one method table
+	  (mtbl) contains a method `foo`. M1 (T_MODULE) points mtbl.
+	  Classes C1 and C2 includes M1, then two T_ICLASS objects are created
+	  and they points mtbl too. In this case, three objects (one T_MODULE
+	  and two T_ICLASS objects) points same mtbl. On marking phase, these
+	  three objects mark same mtbl. To avoid such duplication, struct
+	  method_table_wrapper was introduced.
 
-	* wince/mkexports.rb: fix linker error in SH4.
+	  However, created two T_ICLASS objects have same or shorter lifetime
+	  than M1 (T_MODULE) object. So that we only need to mark mtbl from M1,
+	  not from T_ICLASS objects. This patch tries marking only from M1.
+	  In other words, original module (M1) has responsibility to mark mtbl.
+	  Because of no duplicate marking, we don't need method_table_wrapper
+	  any more.
 
-	* wince/mkconfig_wce.rb: camouflage RUBY_PLATFORM for compiling ext.
+	  Note that one `Module#prepend` call creates two T_ICLASS objects.
+	  One for referring to a prepending Module object, same as
+	  `Module#include`. We don't need to care this T_ICLASS.
+	  One for moving original mtbl from a prepending class. We need to
+	  mark such mtbl from this T_ICLASS object. To mark the mtbl,
+	  we need to use `RCLASS_ORIGIN(klass)` on marking from a prepended
+	  class `klass`.
 
-Wed Oct  1 08:02:52 2003  Takaaki Uematsu  <uema2x@jcom.home.ne.jp>
+	* class.c: ditto.
 
-	* wince/time_wce.c (time): add zero check.
+	* eval.c (rb_using_refinement): ditto.
 
-Tue Sep 30 16:11:05 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* gc.c: ditto.
 
-	* Makefile.in: copy lex.c from $(srcdir) if it's not the current
-	  directory.  [ruby-dev:21437]
+	* include/ruby/ruby.h: define m_tbl directly. The definition of
+	  struct RClass should be moved to (srcdir)/internal.h.
 
-Tue Sep 30 11:29:23 2003  Tanaka Akira  <akr@m17n.org>
+	* method.h: remove decl of rb_free_m_tbl_wrapper().
 
-	* process.c (pst_inspect): describe stopped process "stopped".
+	* object.c: use RCLASS_M_TBL() directly.
 
-Tue Sep 30 09:31:56 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Mar  6 02:50:12 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* test/runner.rb: glob for directories.
+	* dir.c (replace_real_basename): need to check the return value of
+	  GLOB_REALLOC().
 
-Tue Sep 30 09:11:43 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Mar  6 02:26:03 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* eval.c (rb_eval): while/until should not capture break unless
-	  they are destination of the break.
+	* dir.c (replace_real_basename): shouldn't create Ruby object before
+	  the object system is loaded.
+	  [ruby-core:68430] [Bug #10941]
 
-Tue Sep 30 03:12:02 2003  Minero Aoki  <aamine@loveruby.net>
+Wed Mar  5 16:58:43 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
 
-	* lib/net/http.rb (finish): revert to 1.93.
+	* hash.c: [DOC] #delete method actually returns nil, if the key
+	  is not found. [fix GH-844][ci skip] Patch by @ivdma
 
-	* lib/net/pop.rb (finish): revert to 1.60.
+Wed Mar  5 12:22:23 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
 
-	* lib/net/smtp.rb (finish): revert to 1.67.
+	* math.c: refactoring: remove unnecessary variable d0 to unify code
+	  appearance.
 
-	* lib/net/http.rb (do_start): ensure to close socket if failed to
-	  start session.
+Thu Mar  5 11:50:54 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* lib/net/pop.rb (do_start): ditto.
+	* vm_eval.c (eval_string_with_cref): A binding should keep
+	  refinements activation information and the refinements should be
+	  activated in subsequent eval calls with the binding.
+	  [ruby-core:67945] [Bug #10818]
 
-	* lib/net/smtp.rb (do_start): ditto.
+Thu Mar  5 11:16:55 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* lib/net/smtp.rb: SMTP#started? wrongly returned false always.
+	* test/ruby/test_refinement.rb: There is no need anymore to suppress
+	  warnings.
 
-Tue Sep 30 02:54:49 2003  Minero Aoki  <aamine@loveruby.net>
+Thu Mar  5 08:31:02 2015  Rei Odaira  <Rei.Odaira@gmail.com>
 
-	* test/ruby/test_iterator.rb: new test
-	  test_break__nested_loop[123].
+	* random.c (random_raw_seed): Avoid calling fill_random_bytes()
+	  if the requested size is 0. AIX returns -1 for 0-byte read from
+	  /dev/urandom, while other UNIX returns 0. With this change,
+	  Random.raw_seed(0) consistently returns "" in any UNIX.
 
-Mon Sep 29 23:39:13 2003  Minero Aoki  <aamine@loveruby.net>
+Wed Mar  4 12:43:32 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
 
-	* lib/net/http.rb (finish): does not raise IOError even if
-	  !started?, to allow closing socket which was opened before
-	  session started.
+	* test/ruby/test_math.rb (assert_float_and_int): Refactor test cases
+	  by introducing assert_float_and_int. [misc #10810]
 
-	* lib/net/pop.rb (finish): ditto.
+Wed Mar  4 11:52:30 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/net/smtp.rb (finish): ditto.
+	* symbol.c (Init_sym): make dsym_fstrs a hash compared by identity
+	  as the keys are unique fstrings, to get rid of running hash and
+	  compare methods and causing new object allocation during garbage
+	  collection phase.  [ruby-dev:48891] [Bug #10933]
 
-Mon Sep 29 19:06:51 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+Wed Mar  4 10:16:57 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-	* ext/win32ole/extconf.rb: add windows.h checking.
-	  (ruby-bugs:PR#1185)
+	* enum.c: Fix typo in slice_after's exception message.
+	  [fix GH-842][ci skip] Patch by @jsyeo
 
-Mon Sep 29 16:18:30 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Wed Mar  4 10:15:37 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-	* lib/logger.rb: check if the given logdevice object respond_to :write
-	  and :close, not is_a? IO.  duck duck.
+	* doc/syntax/methods.rdoc: add some missing spaces and
+	  fix a grammatical error in method docs.
+	  [fix GH-843][ci skip] Patch by @nikolas
 
-	* test/logger/test_logger.rb: self IO.pipe reading/writing may be
-	  locked by the flood.  use tempfile.
+Wed Mar  4 02:13:06 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/wsdl/xmlSchema/data.rb: wrong constant reference.
+	* tool/redmine-backporter.rb (backport_command_string): pick up only
+	  when the revision exists in trunk.
 
-Mon Sep 29 16:11:23 2003  Minero Aoki  <aamine@loveruby.net>
+Wed Mar  4 00:44:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/fileutils/test_fileutils.rb: clean up temporary symlink.
-	  Patched by NaHi.  [ruby-dev:21420]
+	* thread.c (rb_thread_io_blocking_region): assigned variables
+	  inside EXEC_TAG() should be volatile.
 
-Mon Sep 29 11:16:55 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* thread.c (rb_thread_s_handle_interrupt): ditto.
 
-	* eval.c (rb_thread_atfork): wrong format specifier.
-	  [ruby-dev:21428]
+	* thread.c (exec_recursive): ditto.
 
-	* process.c (pst_inspect): better description.
+Wed Mar  4 00:29:18 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Mon Sep 29 02:31:44 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* tool/redmine-backporter.rb: now can specify shorten form of commands.
 
-	* lib/webrick/utils.rb (Utils::su): use setgid and setuid to
-	  set real and effective IDs. and setup group access list by
-	  initgroups.
+Tue Mar  3 23:41:42 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Sun Sep 28 11:14:19 2003  Koji Arai  <jca02266@nifty.ne.jp>
+	* tool/redmine-backporter.rb (Readline.readline): drop untreated control
+	  characters.
 
-	* ext/digest/digest.c (Init_digest): `copy_object' was deprecated.
-	  `initialize_copy' should be defined.
+Tue Mar  3 22:25:24 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/stringio/stringio.c (Init_stringio): ditto.
+	* test/lib/envutil.rb (EnvUtil.invoke_ruby): need to rescue because
+	  Signal.signame may raise exception.
 
-Sat Sep 27 18:25:13 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Tue Mar  3 16:57:39 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/xsd/charset.rb: XSD::Charset.is_ces did return always true under
-	  $KCODE = "NONE" environment.  check added.
+	* tool/redmine-backporter.rb: use 'b' instead of 's' for showing
+	  Backport options for merger.rb.
 
-	* test/xsd/test_xsd.rb: add tests for above fix.
+Tue Mar  3 16:55:23 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Sat Sep 27 15:58:50 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* tool/redmine-backporter.rb: show selected ticket number at prompt.
 
-	* lib/soap/rpc/cgistub.rb: make logging severity threshold higher.
+Tue Mar  3 14:47:30 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
 
-	* lib/soap/rpc/standaloneServer.rb: defer WEBrick server start to give
-	  a chance to reset logging severity threshold.
+	* math.c (num2dbl_with_to_f): direct casting from Rational to double.
+	  [Feature #10909]
 
-	* test/soap/calc/test_*, test/soap/helloworld/test_helloworld.rb: run
-	  silent.
+	* test/ruby/test_math.rb: add tests for the above change.
 
-Sat Sep 27 09:44:18 2003  Minero Aoki  <aamine@loveruby.net>
+Tue Mar  3 07:52:20 2015  Rei Odaira  <Rei.Odaira@gmail.com>
 
-	* test/fileutils/test_fileutils.rb: clear all errors on Windows.
-	  [ruby-dev:21417]
+	* test/ruby/test_symbol.rb: avoid a false positive in AIX.
 
-	* test/fileutils/test_nowrite.rb: ditto.
+Tue Mar  3 00:59:39 2015  Naohisa Goto  <ngotogenome@gmail.com>
 
-Mon Sep 27 09:14:03 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* configure.in: set PRELOADENV in Solaris to avoid "wrong ELF class"
+	  error. [Bug #10926] [ruby-dev:48888]
+	* configure.in: set LIBPATHENV for 32-bit compile in Solaris
+	  in addition to 64-bit.
 
-	* array.c (rb_ary_delete): comparison may change the capacity.
-	  [ruby-dev:24348]
+Mon Mar  2 15:36:10 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* array.c (rb_ary_fill): fill should honor length argument.
-	  [ruby-dev:24346]
+	* configure.in: do not check _setjmp unless _longjmp is available,
+	  so that configure results will not be changed by cache.
 
-	* array.c (rb_ary_replace): should not use ptr from shared array.
-	  [ruby-dev:24345]
+Mon Mar  2 14:44:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/socket/socket.c (s_accept): don't retry for EWOULDBLOCK.
-	  [ruby-talk:113807]
+	* configure.in (RUBY_REPLACE_TYPE): restore unsigned type from
+	  cached variable only if the target type is not available.
 
-Sat Sep 27 04:57:07 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Mon Mar  2 13:04:27 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/ruby/test_file.rb: new file.  only asserts unlink-before-close
-	  behaviour now.
+	* signal.c (sig_signame): return nil if the argument is a valid
+	  signal number.
 
-	* test/soap/marshal/test_digraph.rb: should close before unlink.
-	  unlink-before-close pattern is not needed here.
+Mon Mar  2 12:05:04 2015  Naohisa Goto  <ngotogenome@gmail.com>
 
-Sat Sep 27 03:32:37 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* test/net/ftp/test_ftp.rb (create_ftp_server): set SO_OOBINLINE
+	  for receiving OOB data which is sent with MSG_OOB flag in
+	  portable way. [Bug #10915] [ruby-dev:48885]
+	* test/net/ftp/test_ftp.rb (test_abort, test_status): use gets
+	  for receiving OOB data in portable way.
 
-	* test/soap/*, test/wsdl/*, test/xsd/*: move TestCase classes into
-	  each module namespace.  TestMarshal in
-	  test/soap/marshal/test_marshal.rb crashed with
-	  test/ruby/test_marshal.rb.
+Mon Mar  2 11:43:07 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Sep 27 01:30:59 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* configure.in (RUBY_REPLACE_TYPE): restore unsigned type from
+	  cached variable.
 
-	* ext/socket/socket.c (ruby_connect): on win32, type of the 4th
-	  argument of getsockopt is char *.
+Mon Mar  2 06:01:41 2015  Eric Wong  <e@80x24.org>
 
-Fri Sep 26 18:35:40 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/io/wait/wait.c (io_nread): wrap return value with INT2FIX
+	  Thanks to Yura Sokolov <funny.falcon@gmail.com>
+	  [ruby-core:68369] [Bug#10923]
+	* test/io/wait/test_io_wait.rb (test_nread_buffered):
+	  fix broken test
 
-	* lib/resolv-replace.rb: 1.8 compliance.  [ruby-talk:82946]
+Sun Mar  1 20:21:16 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Sep 26 17:39:27 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* configure.in (RUBY_REPLACE_TYPE): restore convertible type from
+	  cached variable, so that configured results will be stable.
 
-	* test/ruby/test_marshal.rb: add test for ruby's objects.
+Sun Mar  1 18:10:34 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Sep 26 09:52:44 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* configure.in (rb_cv_broken_memmem): check before adding the
+	  result HAVE_MEMMEM macro to confdefs.h, so that configured
+	  results will be stable.
 
-	* defines.h (flush_register_windows): use volatile only for gcc on
-	  Solaris.  [ruby-dev:21403]
+Sun Mar  1 11:17:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/mkmf.rb (xsystem): use system directly to honor shell meta
-	  charaters.
+	* gc.c (id2ref): prohibit from accessing internal objects.
+	  [ruby-core:68348] [Bug #10918]
 
-Fri Sep 26 00:10:13 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Sun Mar  1 09:06:11 2015  Tanaka Akira  <akr@fsij.org>
 
-	* lib/README: updated.
+	* lib/time.rb (strptime): Support %s.%N.
+	  [ruby-core:68301] [Bug #10904] Patch by Sadayuki Furuhashi.
 
-Thu Sep 25 17:48:10 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+Sat Feb 28 17:18:39 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/openssl/ossl.c (ossl_buf2str): fix type of 1st argument for
-	  rb_protect.
+	* enum.c (enum_each_slice, enum_each_cons): limit elements size by
+	  the enumerator size.  suggested by Hans Mackowiak <hanmac AT
+	  gmx.de> at [ruby-core:68335]
 
-	* ext/openssl/ossl_hmac.c (ossl_hmac_digest): should return meaningful
-	  value.
+Sat Feb 28 15:44:20 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Sep 25 09:00:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
+	* vm_dump.c (rb_vm_bugreport): get rid of making new strings
+	  inside signal context.
 
-	* lib/ostruct.rb: Added OpenStruct#==.
+	* variable.c (rb_tmp_class_path): defer making temporary class
+	  path string.
 
-	* test/ostruct/test_ostruct.rb: Added.
+	* variable.c (rb_search_class_path): search class path or return
+	  Qnil or Qfalse if unnamed, not creating a temporary path.
 
-Thu Sep 25 07:55:26 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Feb 28 15:02:02 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/win32ole/win32ole.c, ext/openssl/ossl_pkey_dsa.c,
-	  ext/openssl/ossl_pkey_rsa.c, ext/bigdecimal/bigdecimal.h: must
-	  not use C++ or C99 style comment yet.  (ruby-bugs:PR#1184)
+	* variable.c (rb_tmp_class_path): preserve name encoding of an
+	  anonymous instance of module/class subclass.
 
-Thu Sep 25 00:23:22 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+Sat Feb 28 08:24:30 2015  Rei Odaira  <Rei.Odaira@gmail.com>
 
-	* MANIFEST: add SOAP4R.
+	* ext/pty/pty.c: AIX supports autopush.
+	  Patch by Perry Smith [ruby-core:58539] [Bug #9144]
 
-Thu Sep 25 00:13:15 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Fri Feb 27 22:00:05 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-	* lib/soap/* (29 files): SOAP4R added.
+	* lib/rubygems: Update to RubyGems 2.4.6 and HEAD(800f2e6).
+	  Fixed #1159, #1171, #1173 on rubygems/rubygems
+	* test/rubygems: ditto.
 
-	* lib/wsdl/* (42 files): WSDL4R added.
+Fri Feb 27 20:55:42 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-	* lib/xsd/* (12 files): XSD4R added.
+	* lib/rake: Update to rake (9237e74), typo fix and remove needless
+	  private syntax.
+	* test/rake: ditto.
 
-	* test/soap/* (16 files): added.
+Fri Feb 27 17:06:44 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* test/wsdl/* (2 files): added.
+	* vm_core.h: define vm_svar_index.
 
-	* test/xsd/* (3 files): added.
+	* vm_insnhelper.c, vm.c, compile.c: use vm_svar_index names.
 
-	* sample/soap/* (27 files): added.
+	* iseq.h: remove DEFAULT_SPECIAL_VAR_COUNT.
+	  use VM_SVAR_FLIPFLOP_START instead.
 
-	* sample/wsdl/* (13 files): added.
+Fri Feb 27 13:57:48 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Sep 24 02:08:11 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* io.c (setup_narg): wipe away expanded part of buffer to get rid
+	  of revealing uncleaned data.  reported by Dongkwan Kim <dkay AT
+	  kaist.ac.kr>.
 
-	* lib/webrick/httpservlet/cgihandler.rb: conform to mswin32.
-	  [ruby-talk:82735], [ruby-talk:82748], [ruby-talk:82818]
+Wed Feb 25 22:25:07 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-Tue Sep 23 23:10:16 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* spec/default.mspec: use default configuration file name.
+	  https://github.com/ruby/rubyspec/commit/cc69f337b06362e5607ffa3e3ad40ef7494960cf
 
-	* lib/logger.rb: add Logger#<<(msg) for writing msg without any
-	  formatting.
+Wed Feb 25 22:21:56 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-	* test/logger/test_logger.rb: ditto.
+	* spec/default.mspec: remove specific version number.
+	  https://github.com/ruby/rubyspec/commit/7a909e925c1baa9c700bd44af9241aef6e596714
 
-Tue Sep 23 20:47:51 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Wed Feb 25 22:04:04 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* error.c (rb_warn_m): should not warn if -W0 is specified.
-	  [ruby-talk:82675]
+	* ext/win32/Win32API.rb (initialize): accept both a string and an array
+	  for the arguments of the imported function.
+	  reported by Aaron Stone [ruby-core:68208] [Bug #10876] [Fixes GH-835]
 
-Mon Sep 22 21:28:57 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+Wed Feb 25 18:12:11 2015  Eric Wong  <e@80x24.org>
 
-	* MANIFEST: updated.
+	* signal.c (sighandler): preserve errno
+	  Patch by Steven Stewart-Gallus <sstewartgallus00@mylangara.bc.ca>
+	  [ruby-core:68172] [Bug #10866]
 
-Mon Sep 22 19:22:26 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Wed Feb 25 15:59:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* configure.in (AC_CHECK_FUNCS): add setuid and setgid.
+	* dir.c (push_pattern, push_glob): make globbed file names same
+	  encoding to the given pattern.
 
-Mon Sep 22 12:34:55 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Wed Feb 25 15:27:16 2015  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* util.c (ruby_strtod): skip preceding zeros before counting
-	  digits in the mantissa. (ruby-bugs:PR#1181)
+	* tool/merger.rb: support 2.1+ versioning scheme.
 
-Sun Sep 21 04:12:36 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Tue Feb 25 08:49:12 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
 
-	* ext/openssl/ossl_ocsp.c (ossl_ocspreq_initialize): the argument
-	  should be a String.
+	* lib/cmath.rb (log): raise ArgumentError when more than 2 arguments
+	  are passed. [ruby-core:66143] [Bug #10487]
 
-	* ext/openssl/ossl_ocsp.c (ossl_ocspres_initialize): ditt.
+Tue Feb 25 02:15:17 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
 
-	* ext/openssl/ossl_x509attr.c (ossl_x509attr_initialize): ditto.
+	* test/ruby/test_math.rb: Use assert_infinity instead of assert_equal(1.0/0, ...).
 
-	* ext/openssl/ossl_x509ext.c (ossl_x509ext_initialize): ditto.
+	* test/ruby/test_math.rb: Add tests for overriding Integer#to_f.
+	  [ruby-core:67919] [Misc #10809]
 
-	* ext/openssl/ossl_x509ext.c (ossl_x509ext_set_value): ditto.
+Tue Feb 24 22:58:48 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Sep 20 11:49:05 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* complex.c (nucomp_mul): calculate as rotation in complex plane
+	  if matrix calculation resulted in NaN.
 
-	* lib/logger.rb: typo fixed.
+Tue Feb 24 21:45:39 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
 
-	* test/logger/test_logger.rb: new file.
+	* test/ruby/test_math.rb(test_cbrt): Add an assertion for Math.cbrt(1.0/0)
+	  and move #test_cbrt to more proper place.
 
-Fri Sep 19 11:39:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
+Tue Feb 24 19:09:25 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* test/testunit/*: Added.
+	* vm_insnhelper.c (lep_svar_place, lep_svar_get): do not create
+	  additional T_NODE object (svars holder) when only getting
+	  svars.
 
-	* lib/test/unit.rb: Documentation update.
+Tue Feb 24 11:49:48 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/test/unit/ui/console/testrunner.rb (TestRunner#initialize):
-	  Ditto.
+	* time.c (time_zone_name): should be US-ASCII only if all 7-bits,
+	  otherwise locale encoding.  [ruby-core:68230] [Bug #10887]
 
-	* lib/test/unit.rb: Factored out an ObjectSpace collector.
+Tue Feb 24 09:47:07 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/test/unit/collector/objectspace.rb: Ditto.
+	* string.c (chompped_length): enable smart chomp for all non-dummy
+	  encoding strings, not only default_rs.
+	  [ruby-core:68258] [Bug #10893]
 
-	* sample/testunit/*: Added.
+Mon Feb 23 23:19:42 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Sep 19 01:00:48 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* tool/vcs.rb (IO.popen): support :chdir option.
 
-	* lib/webrick/log.rb (BasicLog#log): get rid of as ineffectual
-	  condition.
+	* tool/vcs.rb (VCS::GIT.get_revisions): use :chdir option instead
+	  of -C option which is not supported by older git.
+	  [ruby-dev:48880] [Bug #10890]
 
-	* lib/webrick/log.rb (BasicLog#format): add "\n" to message.
+Mon Feb 23 15:26:39 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Sep 18 22:43:20 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* string.c (rb_str_split_m): raise ArgumentError at broken string
+	  not RegexpError, as Regexp is not involved in.
+	  [ruby-core:68229] [Bug #10886]
 
-	* eval.c (proc_invoke): should push PROT_PCALL tag for orphans.
+Mon Feb 23 07:25:29 2015  Benoit Daloze  <eregontp@gmail.com>
 
-	* eval.c (proc_invoke): should update "result" for orphans.
+	* time.c: Zone encoding should be US-ASCII if all 7-bits. Fix r46907.
 
-Thu Sep 18 20:33:03 2003  Tietew  <tietew-ml-ruby-list@tietew.net>
+	* test/ruby/test_time.rb, test/ruby/test_time_tz.rb: Update tests.
 
-	* parse.y (str_xquote): do not prepend escapes in
-	  backqoute literals.  [ruby-list:38409]
+Sun Feb 22 18:33:42 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-Thu Sep 18 20:30:17 2003  Tanaka Akira  <akr@m17n.org>
+	* common.mk: use ruby organization for rubyspec.
 
-	* lib/pathname.rb: update document.
+Sun Feb 22 15:56:06 2015  Kazuki Tsujimoto  <kazuki@callcc.net>
 
-Thu Sep 18 15:27:05 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* vm_insnhelper.c (rb_vm_rewrite_cref_stack): copy nd_refinements
+	  of original crefs. It fixes segmentation fault when calling
+	  refined method in duplicate module. [ruby-dev:48878] [Bug #10885]
 
-	* lib/logger.rb: new file.  Logger, formerly called devel-logger or
-	  Devel::Logger.
+	* vm_core.h, class.c: change accordingly.
 
-	* sample/logger/*: new file.  samples of logger.rb.
+	* test/ruby/test_refinement.rb: add a test for above.
 
-Wed Sep 17 23:41:45 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sun Feb 22 10:43:37 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* eval.c (localjump_destination): should not raise ThreadError
-	  exception for "break". [ruby-dev:21348]
+	* gc.c (rb_objspace_call_finalizer): control GC execution during
+	  force firnalizations at the end of interpreter process.
+	  [Bug #10768]
 
-	* eval.c (proc_invoke): use result instead of prot_tag->retval.
-	  retval is no longer propagated to the ancestors.
+	  1) Prohibit incremental GC while running Ruby-level finalizers
+	     to avoid any danger.
+	  2) Prohibit GC while invoking T_DATA/T_FILE data structure
+	     because these operations break object relations consistency.
 
-Wed Sep 17 20:34:00 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	  This patch can introduce another memory consuming issue because
+	  Ruby-level finalizers can run after (2), GC is disabled.
+	  However, basically object consistency was broken at (2) as I
+	  described above. So that running Ruby-level finalizers contains
+	  danger originally. Because of this point, I need to suggest to
+	  remove these 3 lines (invoking remaining finalizers). And add a
+	  rule to add that finalizers should not add new finalizers, or
+	  say there is no guarantee to invoke finalizers that added by
+	  another finalizer.
 
-	* parse.y (tokadd_string, parse_string, yylex): escaped terminator
-	  is now interpreted as is.  [ruby-talk:82206]
+Sun Feb 22 04:07:05 2015  Zachary Scott  <e@zzak.io>
 
-Wed Sep 17 18:52:36 2003  Minero Aoki  <aamine@loveruby.net>
+	* ext/openssl/ossl_asn1.c: [DOC] RDoc formatting fixes for
+	  ASN1::ObjectId with patch from @vbatts [Fixes GH-834]
 
-	* test/fileutils/fileassertions.rb: new file.
+	* ext/openssl/ossl_bn.c: ditto.
 
-	* test/fileutils/test_fileutils.rb: new file.
+Sat Feb 21 19:51:49 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/fileutils/test_nowrite.rb: new file.
+	* re.c (match_aref): RMatch::regexp is Qnil after matching by a
+	  string since r45451.  [ruby-core:68209] [Bug #10877]
 
-Wed Sep 17 18:51:02 2003  Minero Aoki  <aamine@loveruby.net>
+Sat Feb 21 16:18:42 2015  Stefan Schuler  <mail@stefanschuessler.de>
 
-	* test/strscan/test_stringscanner.rb: require test/unit.
+	* compar.c (Init_Comparable): [DOC] Replace camelcase variable name.
+	  [Fix GH-833]
 
-Wed Sep 17 18:35:34 2003  Minero Aoki  <aamine@loveruby.net>
+Fri Feb 20 17:27:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/strscan/test_stringscanner.rb: new file.
+	* file.c (rb_file_identical_p): fix handle leak, ensure to close
+	  the handle of the first argument.
 
-Wed Sep 17 18:03:30 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Fri Feb 20 17:19:23 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/openssl: all files are reviewed to simplify and avoid memory leak.
+	* win32/win32.c (different_device_p): compare by volume serial
+	  numbers, not by path names.  [ruby-core:68162] [Bug #10865]
 
-	* ext/openssl/extconf.rb: add check for assert.h.
+Thu Feb 19 01:58:10 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/openssl/ossl.c (ossl_buf2str): new function to convert
-	  C buffer to String and free buffer.
+	* win32/file.c (rb_file_expand_path_internal): neither the drive
+	  of base directory nor the current drive are involved in the
+	  result if different than the drive of path.
+	  [ruby-core:68130] [Bug #10858]
 
-	* ext/openssl/ossl.c (ossl_x509_ary2sk): new function to convert
-	  Array of OpenSSL::X509 to STACK_OF(X509) with exception safe.
+Wed Feb 18 10:48:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/openssl/ossl.c (ossl_to_der, ossl_to_der_if_possible): new
-	  functions to convert object to DER string.
+	* win32/win32.c (wrename): return EXDEV if moving a directory to
+	  another drive, since MoveFileExW does not set proper error code.
+	  [ruby-core:68162] [Bug #10865]
 
-	* ext/openssl/ossl.h: ditto.
+Wed Feb 18 03:13:52 2015  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* ext/openssl/ossl_bio.c (ossl_membio2str): new function to convert
-	  BIO to String object and free BIO.
+	* ext/psych/lib/psych.rb: bump psych version.
+	* ext/psych/psych.gemspec: ditto
+	* ext/psych/yaml/scanner.c: add latest libyaml change.
+	* test/psych/helper.rb: support newer minitest
+	* test/psych/test_to_yaml_properties.rb: ditto
 
-	* ext/openssl/ossl_bio.h: ditto.
+Tue Feb 17 11:47:17 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/openssl/ossl_pkcs7.c (ossl_pkcs7_to_der): add for "to_der".
+	* lib/resolv.rb (Resolv::DNS::Resource#==, #hash): elements
+	  returned by Kernel#instance_variables are Symbols now.
+	  [ruby-core:68128] [Bug #10857]
 
-	* ext/openssl/ossl_x509name.c (ossl_x509name_to_der): ditto.
+Tue Feb 17 10:59:10 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-	* ext/openssl/ossl_x509ext.c (ossl_x509ext_to_der): ditto.
+	* doc/syntax/calling_methods.rdoc: Fix documentation for "calling_methods"
+	  Patch by @sos4nt [fix GH-830][ci skip]
 
-	* ext/openssl/ossl_x509ext.c (create_ext_from_array): removed
-	  and reimplement in openssl/x509.rb.
+Tue Feb 17 10:53:29 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/openssl/ossl_x509attr.c: reimplemented and disable some
-	  method temporarily. this class doesn't work fine without ASN.1
-	  data support;-) I'll rewrite in near future.
+	* win32/file.c (rb_file_expand_path_internal): do not make invalid
+	  (or ADS) path if the path has a drive letter, the result also
+	  should have be under it.  [ruby-core:68130] [Bug #10858]
 
-	* ext/openssl/lib/openssl/x509.c (X509::Attribute): get rid off
-	  unused code.
+Tue Feb 17 10:47:20 2015  Iain Beeston  <iain.beeston@gmail.com>
 
-	* ext/openssl/lib/openssl/x509.c (X509::ExtensionFactory): refine all.
+	* hash.c: Added docs to explain that #include? and #member? do not
+	  check member equality
+	* lib/set.rb: ditto
 
-Tue Sep 16 22:25:06 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Mon Feb 16 20:58:49 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/csv/test_csv.rb: add negative tests of row_sep.
+	* compile.c (compile_massign): optimization for special case,
+	  assignments by aset or attrset.
+	  http://kokizzu.blogspot.jp/2015/02/c-java-hhvm-ruby-nodejsrhinojscspidermo.html
+	  http://www.atdot.net/~ko1/diary/201502.html#d16
 
-Tue Sep 16 18:02:36 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sun Feb 15 10:41:23 2015  Sho Hashimoto  <sho-h@ruby-lang.org>
 
-	* regex.c (re_compile_pattern): should not translate character
-	  class range edge. [ruby-list:38393]
+	* doc/standard_library.rdoc: [DOC] delete removed libraries.
+	  [misc #10843] [ci skip]
 
-Tue Sep 16 16:47:56 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+Sat Feb 14 12:20:01 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* MANIFEST: add test/csv/mac.csv.
+	* random.c (rand_random_number): add a method to return a random
+	  number like SecureRandom to Random::Formatter.
 
-	* win32/Makefile.sub, bcc32/Makefile.sub (test): add phony NUL target.
+	* lib/securerandom.rb (random_bytes): move to Random::Formatter,
+	  the base method of the module.
 
-Mon Sep 15 19:02:52 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Sat Feb 14 12:01:32 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/csv.rb: add extra pamameter to specify row(record) separater
-	  character.  To parse Mac's CR separated CSV, do like this.
-	    CSV.open("mac.csv", "r", ?,, ?\r) { |row| p row.to_a }
-	  The 3rd parameter in this example ?, is for column separater and the
-	  4th ?\r is for row separater.  Row separater is nil by default.  Nil
-	  separater means "\r\n" or "\n".
+	* random.c (random_raw_seed): extract platform dependent random
+	  seed initialization function as a new method Random.raw_seed.
 
-	* test/csv/test_csv.rb: add tests for above feature.
+	* lib/securerandom.rb (SecureRandom): use Random.raw_seed.
 
-	* test/csv/mac.csv: added.  Sample CR separated CSV file.
+Sat Feb 14 00:49:37 2015  Aaron Patterson <aaron@tenderlovemaking.com>
 
-Fri Sep 12 22:41:48 2003  Michal Rokos  <m.rokos@sh.cvut.cz>
+	* ext/coverage/coverage.c: Add Coverage.peek_result.  Allows you to
+	  capture coverage information without stopping the coverage tool.
+	  [ruby-core:67940] [Feature #10816]
 
-	* ext/openssl/ossl.c: move ASN.1 stuff to ossl_asn1.[ch]
+	* test/coverage/test_coverage.rb: test for change.
 
-	* ext/openssl/ossl.c: move BIO stuff to ossl_bio.[ch]
+Fri Feb 13 21:52:05 2015  Yusuke Endoh  <mame@tsg.ne.jp>
 
-	* ext/openssl/ossl_asn1.[ch]: new files
+	* string.c (str_discard): does not free for STR_NOFREE string.
+	  [Bug #10853][ruby-core:68110]
 
-	* ext/openssl/ossl_bio.[ch]: new files
+	* bootstraptest/test_string.rb: test for above.
 
-Fri Sep 12 12:30:41 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Feb 13 21:16:00 2015  Yusuke Endoh  <mame@tsg.ne.jp>
 
-	* intern.h (rb_disable_super, rb_enable_super): replace with dummy
-	  expressions instead of prototypes.  the functions remain yet for
-	  binary compatibility.  [ruby-talk:81758]
+	* lib/base64.rb: make urlsafe mode user-friendly.
 
-Fri Sep 12 12:09:54 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/base64.rb (Base64.urlsafe_encode64): a new option "padding" to
+	  suppress the padding character ("=").
 
-	* bignum.c (rb_big_and): convert argument using 'to_int'.
+	* lib/base64.rb (Base64.urlsafe_decode64): now it accepts not only
+	  correctly-padded input but also unpadded input.
+	  [Feature #10740][ruby-core:67570]
 
-	* bignum.c (rb_big_or): ditto.
+	* test/base64/test_base64.rb: Test for above
 
-	* bignum.c (rb_big_xor): ditto.
+Fri Feb 13 14:19:06 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-Fri Sep 12 07:06:14 2003  David Black  <dblack@superlink.net>
+	* ext/json: merge upstream from flori/json
+	  change usage of TypedData. [Feature #10739][ruby-core:67564]
 
-	* lib/scanf.rb: Took out useless @matched_item variable; some small
-	  refactoring.
+Thu Feb 12 18:34:01 2015  multisnow  <infinity.blick.winkel@gmail.com>
 
-Thu Sep 11 08:43:44 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/openssl/extconf.rb: check RAND_edg to support libressl.
 
-	* eval.c (rb_f_require): allow "require" on $SAFE>0, if feature
-	  name is not tainted.
+	* ext/openssl/ossl_rand.c (ossl_rand_egd): define only if RAND_edg
+	  is available.  [Fix GH-829]
 
-	* lib/rexml/parsers/baseparser.rb (REXML::Parsers::BaseParser::stream):
-	  Supports StringIO.
+Thu Feb 12 10:46:14 2015  Eric Hodel  <drbrain@segment7.net>
 
-Wed Sep 10 22:47:30 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* proc.c (proc_call):  Improve Proc#call documentation.  Patch by
+	  Hsing-Hui Hsu.  [fix GH-761]
 
-	* ext/openssl/ossl.h: add a workaround for win32 platform.
-	  libeay32.dll doesn't export functions defined in conf_api.h.
+Thu Feb 12 04:33:02 2015  Benoit Daloze  <eregontp@gmail.com>
 
-	* ext/openssl/ossl_config.c (ossl_config_initialize): ditto.
+	* compar.c (cmp_equal): no more error hiding for Comparable#==.
+	  It now behaves as other Comparable methods. See #7688.
 
-	* ext/openssl/ossl_config.c (ossl_config_add_value): ditto.
+	* test/ruby/test_comparable.rb: update related test.
 
-	* ext/openssl/ossl_config.c (set_conf_section_i): should check
-	  if the argument is Array.
+Thu Feb 12 03:28:05 2015  Eric Wong  <e@80x24.org>
 
-Wed Sep 10 22:41:54 2003  Tietew  <tietew@tietew.net>
+	* lib/set.rb (initialize): internal hash defaults to false
 
-	* eval.c (win32_get_exception_list): avoid VC7 warning.
-	  [ruby-win32:577]
+	* lib/set.rb (include?): use Hash#[] for optimized dispatch.
+	  Patch by Ismael Abreu <ismaelga@gmail.com>
+	  [ruby-core:67664] [Misc #10754]
 
-Tue Sep  9 10:39:51 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Feb 11 11:09:52 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (struct tag): dst should be VALUE.
+	* ext/digest/digest_conf.rb (digest_conf): check for CommonDigest.
 
-Tue Sep  9 10:39:51 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/digest/*/*cc.h: for Apple CommonCrypto/CommonDigest.h.
 
-	* eval.c (localjump_destination): stop at the scope where the current
-	  block was created.  [ruby-dev:21353]
+	* ext/digest/digest.h (DEFINE_FINISH_FUNC_FROM_FINAL): macro for
+	  finish functions, by inverting arguments order.
 
-Tue Sep  9 05:17:04 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* ext/digest/digest_conf.rb (digest_conf): extract common
+	  configurations.
 
-	* ext/openssl/ossl_config.rb: avoid compile error in OpenSSL-0.9.6.
+Wed Feb 11 11:01:33 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Sep  9 02:41:35 2003  Michal Rokos  <m.rokos@sh.cvut.cz>
+	* ext/json/generator/generator.c (generate_json): get rid of
+	  unnecessary recursive calls which can cause infinite recursion.
+	  T_STRING may not have rb_cString.
 
-	* ext/openssl/ossl_config.c: Refine compatibility.
+Wed Feb 11 07:53:35 2015  Masaki Suketa <masaki.suketa@nifty.ne.jp>
 
-Tue Sep  9 01:50:45 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* test/win32ole/test_word.rb: use skip method to skip test.
 
-	* lib/webrick/httpserver.rb (HTTPServer#access_log): add "\n" to
-	  the message.
+Tue Feb 10 11:38:28 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* lib/webrick/log.rb (BasicLog#log): add "\n" only if needed.
+	* vm_insnhelper.c (vm_call_method): stop method search when a method
+	  is not found in a refinement, to support undef in refinements.
+	  [ruby-core:66741] [Bug #10578]
 
-Mon Sep  8 22:15:33 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Tue Feb 10 11:19:11 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* ext/tk/lib/multi-tk.rb: modify security check at creating
-	  a new interpreter
+	* lib/net/ftp.rb (chdir, delete, gettextfile, mdtm, mkdir, nlst,
+	  putbinaryfile, puttextfile, rename, rmdir, size): support
+	  Pathname. Patch by Joe Rafaniello. [fix GH-828]
 
-Mon Sep  8 20:00:12 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon Feb  9 16:36:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/optparse.rb, lib/optparse/version.rb: search also all
-	  capital versions.
+	* tool/make-snapshot (package): get rid of loading unbundled and
+	  unexpected libraries.  [ruby-core:67977] [Bug #10822]
 
-Mon Sep  8 19:26:33 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Sun Feb  8 20:09:37 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-	* ext/openssl/ossl.h: include openssl/conf.h and openssl/conf_api.h.
+	* lib/net/http/header.rb: pass header names as symbols.
+	  Patch by @DamirSvrtan [fix GH-805]
+	* test/net/http/test_httpheader.rb: added test.
 
-	* ext/openssl/ossl_config.c: refine all with backward compatibility.
+Sun Feb  8 13:04:25 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/openssl/ossl_config.h: export GetConfigPtr() and DupConfigPtr().
+	* ext/socket/getaddrinfo.c (get_addr): reject too long hostname to
+	  get rid of GHOST vulnerability on very old platforms.
 
-	* ext/openssl/ossl_x509.c: added new constants under X509 module.
-	  DEFAULT_CERT_AREA, DEFAULT_CERT_DIR, DEFAULT_CERT_FILE,
-	  DEFAULT_CERT_DIR_ENV, DEFAULT_CERT_FILE_ENV and DEFAULT_PRIVATE_DIR.
+	* ext/socket/raddrinfo.c (make_hostent_internal): ditto, paranoic
+	  check for the canonical name.
 
-	* ext/openssl/ossl_x509ext.c (ossl_x509extfactory_free): don't free
-	  the members of the struct. it's left to GC.
+Sun Feb  8 12:48:38 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/openssl/ossl_x509ext.c (ossl_x509_set_config): add for config=.
+	* ext/win32/lib/win32/registry.rb (Win32::Registry::API): use wide
+	  versions of RegDeleteValue and RegDeleteKey.
+	  [ruby-core:67958] [Bug #10820]
 
-	* ext/openssl/ossl_x509ext.c (Xossl_x509extfactory_initialize):
-	  add attr readers: issuer_certificate, subject_certificate,
-	  subject_request, crl and config.
+Sat Feb  7 22:13:08 2015  Masaki Suketa <masaki.suketa@nifty.ne.jp>
 
-Mon Sep  8 18:26:41 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* test/win32ole/test_win32ole_record.rb: remove test using .NET
+	  Framework 3.5 because it is not included in Windows 8/8.1.
 
-	* lib/webrick/accesslog.rb (AccessLog::setup_params): use req.port
-	  instead of config[:Port] or req.request_uri.port.
+Sat Feb  7 19:25:25 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/webrick/httprequest.rb (HTTPRequest#meta_vars): ditto.
+	* dir.c (has_magic): always get long path name on Windows even if
+	  no tilde is there.  [ruby-core:68011] [Bug #10819]
 
-	* lib/webrick/httpservlet/filehandler.rb (FileHandler#dir_list): ditto.
+	* dir.c (replace_real_basename): FindFirstFile ignore redirection
+	  character, check if exists before call it.  cf. [Bug #8597]
 
-	* lib/webrick/config.rb: :Listen option never be used.
+Sat Feb  7 13:30:11 2015  Masaki Suketa <masaki.suketa@nifty.ne.jp>
 
-	* lib/webrick/server.rb (GenericServer#initialize): don't use :Listen
-	  option and add warning message.
+	* test/win32ole/test_win32ole_record.rb
+	  (test_ole_instance_variable_get): correct VT_RECORD type and
+	  instance variables.
 
-	* lib/webrick/log.rb (BasicLog#<<): shortcut of log(INFO, ...).
+Fri Feb  6 17:47:05 2015  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* lib/webrick/httpserver.rb (HTTPServer#accesslog): use << for logging.
+	* ext/psych/lib/psych/visitors/yaml_tree.rb: register nodes when
+	  dumping objects with custom coders. [ruby-core:66215] [Bug #10496]
 
-Sun Sep  7 16:08:28 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* test/psych/test_coder.rb: test for fix
 
-	* ext/tcltklib/tcltklib.c (lib_mainloop_core): fixed signal-trap bug
+Fri Feb  6 16:58:31 2015  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* ext/tk/lib/*.rb : Ruby/Tk works at $SAFE == 4
+	* ext/psych/lib/psych/visitors/to_ruby.rb: fix support for regular
+	  expressions with newlines. tenderlove/psych#222
 
-Sat Sep  6 02:26:34 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* test/psych/test_yaml.rb: test for change.
 
-	* test/ruby/test_*.rb: assert_same, assert_match, and so on.
+Fri Feb  6 10:31:50 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Sep  6 18:45:46 2003  Mauricio Fernandez  <batsman.geo@yahoo.com>
+	* vm_core.h (rb_call_info_kw_arg_struct): make keywords a symbols
+	  list to get rid of inadvertent creation by variable keyword
+	  arguments.  [ruby-core:68031] [Bug #10831]
 
-	* parse.y (assignable): call rb_compile_error(), not rb_bug().
-	  [ruby-core:01523]
+Thu Feb  5 22:42:34 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-Sat Sep  6 17:40:41 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* lib/rubygems:  Update to RubyGems HEAD(5c3b6f3).
+	  Fixed #1156, #1142, #1115, #1142, #1139 on rubygems/rubygems
+	* test/rubygems:  ditto.
 
-	* ext/openssl/ruby_missing.c: rid of unnecessary backward
-	  compatibility stuff. and remove DEFINE_ALLOC_WRAPPER from
-	  all sources.
+Thu Feb  5 13:41:01 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/openssl/ossl_x509ext.c (X509::Extension.new): new method.
+	* vm_eval.c (send_internal), vm_insnhelper.c (vm_call_opt_send):
+	  convert String method name into a Symbol, as method_missing
+	  method expects its first argument to be a Symbol.  [Bug #10828]
 
-	* ext/openssl/ossl_x509ext.c (X509::Extension#oid=): new method.
+	* vm_insnhelper.c (ci_missing_reason): return the reason of method
+	  missing in call info.
 
-	* ext/openssl/ossl_x509ext.c (X509::Extension#value=): new method.
+	* vm_insnhelper.c (vm_call_opt_send): re-apply r49500 with the
+	  proper missing reason.  [Bug #10828]
 
-	* ext/openssl/ossl_x509ext.c (X509::Extension#critical=): new method.
+Thu Feb  5 10:31:46 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-Sat Sep  6 01:23:22 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* class.c (rb_obj_singleton_methods): should use RTEST() to convert
+	  VALUE to int.
 
-	* win32/win32.c (CreateChild): need to quote cmd if RUBYSHELL is set.
+Thu Feb  5 03:59:33 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
 
-	* win32/win32.c (CreateChild): fix condition about whether to call
-	  shell or not.
+	* vm_insnhelper.c: Fix symbol leak with +send+ [Bug #10828]
 
-Sat Sep  6 00:36:20 2003  Nobuyoshi Nakada  <nobu.nokada@softhome.net>
+Wed Feb  4 20:26:54 2015  Masaki Suketa <masaki.suketa@nifty.ne.jp>
 
-	* Makefile.in (test): phony target.
+	* ext/win32ole/win32ole.c (Init_win32ole): should not use atexit to
+	  free allocated hash table to avoid error on Cygwin.
 
-	* lib/mkmf.rb (have_library, find_library): configure by library
-	  name.
+Wed Feb  4 15:34:25 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* lib/optparse.rb (OptionParser#order, #permute, #parse): allow an
-	  array as argument.
+	* class.c (method_entry_i, class_instance_method_list,
+	  rb_obj_singleton_methods): should not include methods of
+	  superclasses if recur is false. [ruby-dev:48854] [Bug #10826]
 
-	* test/ruby/test_*.rb: moved invariants to left side in
-	  assert_equal, and use assert_nil, assert_raises and so on.
+Wed Feb  4 16:32:40 2015  Matt Hoyle  <matt@deployable.co>
 
-	* win32/win32.c (isInternalCmd): distinguish command.com and
-	  cmd.exe.
+	* ext/bigdecimal/bigdecimal.c (VpSetPTR): fix a typo, 'expoennt'
+	  to 'exponent'.  [ruby-core:67980] [Bug #10823] [Fix GH-825]
 
-	* win32/win32.c (make_cmdvector): a character just after wildcard
-	  was ignored.  [ruby-core:01518]
+Wed Feb  4 15:55:38 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Sep  5 20:27:08 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* ext/sdbm/_sdbm.c: include ruby/ruby.h for PRIdPTRDIFF when a
+	  macro `DEBUG` is defined.  based on the patch by Owen Rodley in
+	  [ruby-core:67987]. [Bug #10825]
 
-	* test/ruby/test_*.rb: replace 'assert(a == b)' with assert_equal(a, b)'
+Wed Feb  4 11:12:43 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Sep  5 18:00:51 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* Makefile.in (probes.stamp): rebuild dtrace dependent objects
+	  only when `dtrace -G` modifies its input files.
 
-	* ext/openssl/lib/openssl/x509.rb: new method X509::Name::parse.
+Tue Feb  3 19:27:16 2015  Naohisa Goto  <ngotogenome@gmail.com>
 
-	* ext/openssl/ossl_digest.c: add ossl_digest_new().
+	* common.mk (ruby-glommed.o): dependency on $(OBJ) should be written
+	  in common.mk (in which OBJ is defined) because of Makefile include
+	  and parse order. This partly reverts r49419.
+	  [ruby-dev:48849] [Bug #10808]
 
-	* ext/openssl/ossl_digest.h: ditto.
+	* Makefile.in (ruby-glommed.o): ditto.
 
-	* ext/openssl/ossl_cipher.c: add ossl_cipher_new().
+	* Makefile.in (ruby-glommed.o): remove excess $(DTRACE_OBJ) because
+	  it is included in $(OBJS) since r49451.
 
-	* ext/openssl/ossl_cipher.h: ditto.
+	* Makefile.in (probes.o): should depend on $(DTRACE_DEPENDENT_OBJS)
 
-Fri Sep  5 15:32:04 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Feb  3 17:15:45 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* misc/ruby-mode.el (ruby-font-lock-maybe-here-docs): should not
-	  search delimiter forward if found in backward.
+	* lib/mkmf.rb (try_cppflags, try_cflags, try_ldflags): get rid of
+	  interference by modifying global variables in have_devel? method.
+	  [ruby-core:67962] [Bug #10821]
 
-Fri Sep  5 13:32:48 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Feb  3 15:23:58 2015  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* test/runner.rb: arguments should be keys.
+	* vm_method.c (remove_method): When remove refined
+	  method, raise a NameError if the method is not
+	  defined in refined class.
 
-Fri Sep  5 12:09:55 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+	  But if the method is defined in refined class,
+	  it should keep refined method and remove original
+	  method.
 
-	* test/ruby/test_system.rb (test_system): check existence of ruby
-	  interpreter.
+	  Patch by Seiei Higa. [ruby-core:67722] [Bug #10765]
 
-Fri Sep  5 11:32:17 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Feb  3 14:04:47 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/optparse.rb (--version): fix assignment/reference order.
+	* dir.c (glob_helper): obtain real name with FindFirstFile API
+	  instead of matching all entries, on Windows.
+	  [ruby-core:67954] [Bug #10819]
 
-	* lib/optparse.rb (OptionParser#help): new; OptionParser#to_s may
-	  be deprecated in future.
+Tue Feb  3 12:26:35 2015  Katsuhiko Nishimra  <ktns.87@gmail.com>
 
-	* lib/optparse/version.rb (OptionParser#show_version): hide Object.
+	* lib/mkmf.rb (configuration): set the default cxxflags, which is
+	  referred from the default CXXFLAGS, for extension libraries.
+	  [Fix GH-823]
 
-	* test/runner.rb: fix optparse usage.
+Tue Feb  3 05:52:00 2015  Aman Gupta <ruby@tmm1.net>
 
-	* test/runner.rb: glob all testsuits if no tests given.
+	* gc.c (rb_objspace_free): cause rb_bug if lazy sweep is in progress
+	  during rb_objspace_free. Adds extra protection for r46340.
+	  Patch by Vicent Marti. [Bug #10768] [ruby-core:67734]
+	* gc.c (rb_objspace_call_finalizer): Ensure GC is completed after
+	  finalizers have run. We already call gc_rest() before invoking
+	  finalizers, but finalizer can allocate new objects and start new GC
+	  cycle, so we call gc_rest() again after finalizers are complete.
 
-Fri Sep  5 10:42:58 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Mon Feb  2 10:51:34 2015  Ari Pollak  <ajp@aripollak.com>
 
-	* test/runner.rb: added.  gets testcases from command line and runs it.
+	* doc/security.rdoc (Symbols): update about Symbol GC.  Symbols
+	  explicitly converted from Strings now can be collected, but
+	  reflection/metaprogramming still can cause memory flooding.
+	  [Fix GH-725]
 
-	* test/ruby/test_gc.rb: remove useless part which was for dumping test
-	  result.
+Sun Feb  1 13:46:52 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Sep  5 09:28:59 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* tool/rbinstall.rb (bin-comm): drop batch file installation.
+	  Windows 95 support has not been supported already.
+	  [Feature #10806]
 
-	* test/ruby/test_gc.rb: added.  splitter.rb which I made to split
-	  sample/test.rb into test/ruby/test_* kindly removed GC test (the
-	  last section in the original test) to reduce things to be worried.
+Sat Jan 31 12:06:23 2015  Scott Francis  <scott.francis@shopify.com>
 
-Fri Sep  5 03:00:04 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* thread_pthread.c (reserve_stack): fix intermittent SIGBUS on
+	  Linux, by reserving the stack virtual address space at process
+	  start up so that it will not clash with the heap space.
+	  [Fix GH-822]
 
-	* test/ruby/test_iterator.rb (test_block_in_arg): add no block
-	  given tests.
+Fri Jan 30 17:28:29 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
 
-	* test/ruby/test_iterator.rb (test_ljump): uncomment LocalJumpError
-	  test.
+	* math.c (num2dbl_with_to_f): make faster when Bignum passed by
+	  direct conversion using rb_big2dbl().  [Feature #10800]
 
-Fri Sep  5 01:10:11 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Thu Jan 29 23:30:00 2015  Kenta Murata  <mrkn@mrkn.jp>
 
-	* test/ruby: tests for ruby itself.
+	* ext/bigdecimal/bigdecimal.c (rb_rational_num): add fallback function
+	  for rubies lower than 2.2.0.
 
-	* test/ruby/test_*.rb: split sample/test.rb into 28 test/unit testcases.
-	  some tests could not be translates...  search '!!' mark to see it.
+	* ext/bigdecimal/bigdecimal.c (rb_rational_den): ditto.
 
-	* test/csv/test_csv.rb: should require 'csv', not '../lib/csv'.  test
-	  runner should set load path correctly.
+	* ext/bigdecimal/extconf.rb: check the existences of struct RRational,
+	  rb_rational_num, and rb_rational_den.
 
-Fri Sep  5 01:03:59 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* ext/bigdecimal/bigdecimal.bundle: bump version.
 
-	* test/csv/test_csv.rb: close opened files for CSV::IOBuf explicitly.
-	  opened file cannot be removed under win32 box.
+Thu Jan 29 20:28:25 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-Thu Sep  4 23:59:40 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* tool/make-snapshot: removed md5 digest with package information
 
-	* parse.y (tokadd_string): newlines have no special meanings in
-	  %w/%W, otherwise they are ignored only when interpolation is
-	  enabled.  [ruby-dev:21325]
+Thu Jan 29 10:41:52 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
 
-Thu Sep  4 19:38:25 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* math.c (Get_Double): direct casting from Fixnum to double.
+	  [Feature #10785]
 
-	* ext/io/wait/.cvsignore: added.
+Thu Jan 29 02:34:27 2015  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* ext/openssl/.cvsignore: added.
+	* ext/psych/lib/psych/visitors/to_ruby.rb: fix parsing hashes with
+	  instance variables when it is referenced multiple times.
+	* ext/psych/lib/psych.rb: bump version
+	* ext/psych/psych.gemspec: bump version
+	* test/psych/test_hash.rb: test for fix
 
-Thu Sep  4 19:28:24 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+Thu Jan 29 02:06:09 2015  Eric Wong  <e@80x24.org>
 
-	* sample/openssl: added.  Sample of standard distribution library
-	  should be locate in sample/{module_name}/*.
+	* thread.c (struct join_arg): restructure and make smaller
+	  (thread_join_sleep): avoid timeofday() call if forever
+	  (thread_join): pass join_arg.delay directly
+	  (rb_thread_inspect_msg): remove, inline into rb_thread_inspect
+	  (rb_thread_inspect): reduce branching and string creation
+	* thread_pthread.c (native_set_thread_name): create string directly
+	  to avoid reparsing. [Misc #10723]
 
-	* ext/openssl/sample/*: removed.  move to sample/openssl/*.
+Wed Jan 28 21:32:24 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-Thu Sep  4 18:02:15 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* thread.c: Improve documentation for Thread#value
+	  [Bug #10694][ruby-core:67324][ci skip]
 
-	* test/csv/test_csv.rb: use remove_const to reduce warnings.  use
-	  Dir.tmpdir to locate working files.
+Tue Jan 27 16:04:19 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Thu Sep  4 17:41:31 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* tool/redmine-backporter.rb: added `!` command.
 
-	* misc/ruby-mode.el (ruby-here-doc-beg-re): underscore also is
-	  valid delimiter.
+Tue Jan 27 15:58:23 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* misc/ruby-mode.el (ruby-here-doc-end-match): must quote
-	  arbitrary string to use as regexp.
+	* tool/redmine-backporter.rb: added history feature for platforms which
+	  lack readline.
 
-	* misc/ruby-mode.el (ruby-font-lock-maybe-here-docs): must not
-	  call `ruby-here-doc-end-match' unless `ruby-here-doc-beg-re'
-	  matched.
+Mon Jan 26 22:09:35 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-Thu Sep  4 15:40:07 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* .gitignore: ignored temporary file with git.
 
-	* test/csv/test_csv.rb: run on test/unit original layer.
+Mon Jan 26 18:06:03 2015  Akinori MUSHA  <knu@iDaemons.org>
 
-Thu Sep  4 12:54:50 2003  why the lucky stiff  <why@ruby-lang.org>
+	* misc/ruby-electric.el: Import version 2.2.2 from
+	  https://github.com/knu/ruby-electric.el.
 
-	* ext/syck/token.c: headerless documents with root-level spacing now
-	  honored.
+Mon Jan 26 11:37:49 2015  Dave Stevens  <dave@crowdlab.com>
 
-Thu Sep  4 00:06:14 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* string.c (str_make_independent_expand): terminate String when
+	  moved from heap to embedded.  [Fix GH-821].
 
-	* eval.c (mark_frame_adj): need to adjust argv pointer if using
-	  system's alloca. [ruby-core:01503]
+Sun Jan 25 12:04:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Sep  3 21:33:20 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* array.c (flatten): no need to call to_ary method on elements
+	  beyond the given level.  [ruby-core:67637] [Bug #10748]
 
-	* test: add test directory.  Test::Unit aware testcases and needed
-	  files should be located in this directory.  dir/file name convention;
-	    test/{module_name}/test_{testcase_name}.rb
-	    test/{module_name}/{needed_files}
-	  someday, someone will write testrunner which searches test_*.rb and
-	  run testcases automatically.
+Sun Jan 25 00:42:24 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/csv/*: add testcase for lib/csv.rb.
+	* ext/fiddle/win32/libffi.mk.tmpl: assemble without directory prefix.
+	  workaround of a bug of VC12 ml, by unak at [ruby-core:67792].
+	  [ruby-core:67789] [Bug #10780]
 
-Wed Sep  3 01:37:09 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sat Jan 24 19:56:25 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* io.c (rb_f_gets): should call next_argv() before type check
-	  current_file. [ruby-list:38336]
+	* dln_find.c (dln_find_1): search regular files only.  based on
+	  the patch by Alex Coomans in [ruby-core:67766].  [Bug #10776]
 
-Tue Sep  2 20:37:15 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Fri Jan 23 23:57:05 2015  Misumi Rize  <r@ayase-e.li>
 
-	* ext/openssl/lib/net/protocols.rb (SSLIO#ssl_connect): warning
-	  for skipping server verification.
+	* vm_insnhelper.c (vm_throw_start): search the target to break
+	  from a block with nested rescue, from the nested blocks.
+	  [ruby-core:67765] [Bug #10775] [Fix GH-820]
 
-Tue Sep  2 23:36:57 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Jan 23 20:00:59 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (proc_invoke): should retrieve retval when pcall is true.
+	* marshal.c (w_object, marshal_dump): use identity tables for
+	  arbitrary VALUE keys, because of performance of FLONUM.
+	  [Bug #10761]
 
-Tue Sep  2 14:09:20 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* marshal.c (obj_alloc_by_klass, marshal_load): ditto.
 
-	* ext/socket/extconf.rb: check s6_addr8 in in6_addr (Tru64 UNIX).
-	  the patch is submitted by nmu <nmu@users.sourceforge.jp>.
+Fri Jan 23 17:12:33 2015  Eric Wong  <e@80x24.org>
 
-	* ext/socket/getaddrinfo.c (getaddrinfo): should use in6_addr8 on
-	  some platforms.
+	* benchmark/bm_marshal_dump_flo.rb: new benchmark for [Bug #10761]
 
-	* ext/socket/getnameinfo.c (getnameinfo): ditto.
+Thu Jan 22 18:03:19 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Tue Sep  2 14:02:19 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+	* tool/redmine-backporter.rb (find_svn_log): use double quotes instead
+	  of single quotes because cmd.exe doesn't handle them.
 
-	* ext/tcltklib/tcltklib.c (ip_invoke): fixed bug on passing a exception
+	* tool/redmine-backporter.rb (done): the 2nd element of matched data
+	  is the offset of the end of matched string, not length.
 
-	* ext/tk/lib/{tk.rb, tkcanvas.rb, tkfont.rb, tktext.rb} :
-	  bug fix and improvement of font control
+Thu Jan 22 16:45:24 2015  Eric Wong  <e@80x24.org>
 
-Tue Sep  2 09:51:36 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* st.c (st_numhash): mix float value for flonum
+	* hash.c (rb_any_hash): ditto
+	* benchmark/bm_hash_aref_flo.rb: new benchmark
+	* benchmark/bm_hash_ident_flo.rb: ditto
+	  [Bug #10761]
 
-	* eval.c (rb_eval): should not handle exceptions within rescue
-	  argument.  [ruby-talk:80804]
+Wed Jan 21 22:33:51 2015  Akinori MUSHA  <knu@iDaemons.org>
 
-Tue Sep  2 00:44:37 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* misc/ruby-electric.el: Import version 2.2.1 from
+	  https://github.com/knu/ruby-electric.el.  Improve compatibility
+	  with and optimize for Emacs 24.4.
 
-	* re.c (rb_memsearch): fix overrun.  [ruby-talk:80759]
+Wed Jan 21 09:40:52 2015  Zachary Scott  <e@zzak.io>
 
-Tue Sep  2 00:41:27 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* file.c: Document other cases of missing birthtime on OS with patch
+	  provided by @sho-h similar to GH-817. [ci skip] [DOC]
 
-	* ext/iconv/iconv.c (map_charset): use lower case keys.
+Wed Jan 21 09:09:19 2015  Tanaka Akira  <akr@fsij.org>
 
-	* ext/iconv/iconv.c (iconv_fail): just yield error and return the
-	  result if a block is given.
+	* NEWS: References to tickets added.
+	  [ruby-core:67701] [Bug #10760] Suggested by Zachary Scott.
 
-	* ext/iconv/iconv.c (iconv_convert): yield error and append the
-	  result if a block is given.
+Tue Jan 20 22:59:54 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-	* ext/iconv/charset_alias.rb (charset_alias): optional third
-	  argument.
+	* tool/vcs.rb: fix the exception given remote-url of svn.
 
-	* ext/iconv/charset_alias.rb (charset_alias): use CP932 instead of
-	  SHIFT_JIS on cygwin.
+Tue Jan 20 12:58:33 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Mon Sep  1 18:34:25 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* tool/redmine-backporter.rb: now can change the page of `ls`.
 
-	* eval.c (rb_eval): make tail recursion in ELSE clause of
-	  RESCUE a jump.
+Tue Jan 20 12:28:37 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Mon Sep  1 18:00:02 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* tool/redmine-backporter.rb (readline): fallback to normal gets on
+	  Windows because IO.console.getch is not always do as expected.
 
-	* parse.y (aref_args): forgot to call NEW_SPLAT(). reported by
-	  Dave Butcher.
+Tue Jan 20 11:31:07 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* eval.c (Init_Thread): protect thgroup_default.  suggested by Guy
-	  Decoux in [ruby-talk:80623]
+	* tool/redmine-backporter.rb: update usage.
 
-Mon Sep  1 16:59:10 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Jan 20 11:23:47 2015  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* eval.c (rb_thread_switch): add RESTORE_EXIT; exit by another
-	  thread termination.
+	* tool/redmine-backporter.rb (mygets): to support Backspace
+	  implement gets by itself.
 
-	* eval.c (rb_thread_start_0): should not error_print() within
-	  terminated thread, because $stderr used by it might be
-	  overriden now.  [ruby-dev:21280]
+Tue Jan 20 02:54:11 2015  Zachary Scott  <e@zzak.io>
 
-Sun Aug 31 22:46:55 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* file.c: NotImplementedError is raised if birthtime is unavailable.
+	  Patch by @y-yagi san and [Fixes GH-817] [ci skip] [DOC]
 
-	* eval.c (TAG_DST()): take no argument.
+	* ext/pathname/pathname.c: ditto.
 
-	* process.c (p_gid_sw_ensure): return VALUE.
+Mon Jan 19 22:08:26 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Aug 31 22:27:10 2003  Hidetoshi NAGAI  <nagai@dumbo.ai.kyutech.ac.jp>
+	* class.c (include_modules_at): allow to prepend each module up to
+	  once for each classe.  [EXPERIMENTAL]
 
-	* process.c (p_gid_sw_ensure): lack of function type
+Sun Jan 18 18:32:20 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-Sun Aug 31 12:25:06 2003  Nobuyoshi Nakada  <nobu.nokada@softhome.net>
+	* math.c (math_atan2): revive documentation before r49220.
+	  http://d.hatena.ne.jp/nagachika/20150112/ruby_trunk_changes_49213_49226
 
-	* lib/optparse.rb: --version takes an optional argument; "all" or
-	  a list of package names.
+Sun Jan 18 15:57:32 2015  Seiei Higa  <hanachin@gmail.com>
 
-Sun Aug 31 10:17:02 2003  Tadayoshi Funaba  <tadf@dotrb.org>
+	* vm_method.c (check_definition): Module#public_method_defined?,
+	  Module#private_method_defined?, Module#protected_method_defined?
+	  should not use refinements. [ruby-core:67656] [Bug #10753]
 
-	* lib/date/format.rb: yyyy/mm is not an acceptable format.
+Sun Jan 18 15:50:39 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/time.rb: follow above.
+	* vm_dump.c (rb_vm_bugreport): check by configured result instead
+	  of system name for old FreeBSD.  based on a patch by Steve Wills
+	  at [ruby-core:67655].  [Bug #10752]
 
-Sat Aug 30 14:25:43 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sun Jan 18 12:56:49 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (rb_iter_break): should not call TAG_JUMP directly.
+	* Makefile.in (VPATH, NEWLINE_C), common.mk (common-srcs): make
+	  and use newline.c under enc/trans directory, not toplevel.  no
+	  longer search enc directory implicitly.
 
-Sat Aug 30 03:58:21 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* configure.in, enc/Makefile.in (BUILTIN_ENCS, BUILTIN_TRANSES):
+	  prefix respective directory names to builtin encodings and
+	  transcoder source names.
 
-	* eval.c (struct BLOCK): remove BLOCKTAG, use scope instead.
+Sun Jan 18 11:49:46 2015  Masaki Suketa <masaki.suketa@nifty.ne.jp>
 
-	* eval.c (POP_TAG): no longer propagate retval.  retval is now set
-	  directly by localjump_destination().
+	* ext/win32ole/win32ole.c (ole_invoke): avoid SEGV when VT_RECORD
+	  variable is passed by reference. [ruby-dev:48803] [Bug #10697]
 
-	* eval.c (localjump_destination): new function to cast
-	  return/break local jump.
+Sat Jan 17 23:59:15 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (rb_yield_0): stop TAG_RETURN/TAG_BREAK escaping.
+	* ext/psych/lib/psych/visitors/yaml_tree.rb (visit_String):
+	  anchors like `\Z` are not valid inside character class.  use
+	  negative-lookahead instead.
+	  Fixes: https://github.com/tenderlove/psych/issues/221
 
-Fri Aug 29 22:35:00 2003  Shigeo Kobayashi  <shigek@ruby-lang.org>
+Sat Jan 17 23:42:27 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* bigdecimal.c *.html: The 2nd arg. for add,sub,mult, and div is 0,
-	  then result will be the same as +,-,*,/ respectively.
+	* configure.in: get rid of pattern substitution, which is not
+	  supported by ash, and ash on NetBSD parses whole source first
+	  and fails to start.  [ruby-dev:48823] [Bug #10750]
 
-Fri Aug 29 17:30:15 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+Fri Jan 16 18:42:58 2015  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* process.c: bug fix
+	* tool/redmine-backporter.rb: support adding related revisions
+	  to issues.
 
-	* process.c: add rb_secure(2) to methods of Process::{UID,GID,Sys}
+Fri Jan 16 17:20:33 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* process.c: deny handling IDs during evaluating the block given to
-	  the Process::{UID,GID}.switch method
+	vm.c, vm_core.h: constify VM_CF_LEP, VM_CF_PREV_EP, VM_CF_BLOCK_PTR
+	and rb_vm_control_frame_block_ptr.
 
-	* ext/tcltklib/tcltklib.c : some methods have no effect if on slave-IP
+Fri Jan 16 15:41:21 2015  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* ext/tcltklib/tcltklib.c : can create a interpreter without Tk
+	* ext/psych/lib/psych.rb: bump version
 
-	* ext/tcltklib/tcltklib.c : bug fix on handling exceptions
+	* ext/psych/psych.gemspec: ditto
 
-	* ext/tcltklib/MANUAL.euc : modify
+Fri Jan 16 15:37:49 2015  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* ext/tk/lib/tk.rb : freeze some core modules
+	* ext/psych/lib/psych/visitors/yaml_tree.rb: only dump hash
+	  subclasses. Thanks Joe Eli McIlvain <joe.eli.mac@gmail.com>
 
-	* ext/tk/lib/multi-tk.rb : more secure
+	* test/psych/test_hash.rb: test for change
 
-	* ext/tk/lib/tk.rb: TkVariable.new(array) --> treat the array as the
-	  Tk's list
+Fri Jan 16 15:35:21 2015  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* ext/tk/lib/tk.rb: improve accessibility of TkVariable object
+	* ext/psych/lib/psych.rb: bump version
 
-	* ext/tk/lib/tk.rb, ext/tk/lib/tkfont.rb, ext/tk/lib/tkcanvas.rb,
-	  ext/tk/lib/tktext.rb : fix bug of font handling
+	* ext/psych/lib/psych/visitors/yaml_tree.rb: fix line width wrapping
+	  for long strings.  Thanks Jakub Jirutka <jakub@jirutka.cz>
 
-	* ext/tk/lib/tkfont.rb TkFont.new() accepts compound fonts
+	* test/psych/test_string.rb: test for change
 
-Thu Aug 28 22:07:12 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Jan 16 11:44:44 2015  Kazuki Tsujimoto  <kazuki@callcc.net>
 
-	* variable.c (rb_autoload_load): call const_missing if autoloading
-	  constant is not defined to allow hook.
+	* eval_intern.h, vm.c, vm_eval.c, vm_insnhelper.c:
+	  change throw mechanism (not save target ep, but save target cfp).
+	  It fixes `unexpected break' bug that occurs when
+	  TracePoint#binding is called.
+	  [ruby-dev:48797] [Bug #10689]
 
-	* eval.c (rb_eval): use rb_const_get_from() instead of
-	  rb_const_get_at().
+	* test/ruby/test_settracefunc.rb: add a test.
 
-	* eval.c (is_defined): forgot to check NODE_COLON3.
+Thu Jan 15 23:55:15 2015  Tanaka Akira  <akr@fsij.org>
 
-Thu Aug 28 17:30:24 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* io.c (rb_io_close_m): Don't raise when the IO object is closed.
+	  [ruby-core:67444] [Feature #10718]
 
-	* variable.c (rb_const_get_0): should check constants defined in
-	  included modules, if klass is Object. [ruby-talk:79302]
+Thu Jan 15 21:34:57 2015  Seiei Higa  <hanachin@gmail.com>
 
-	* numeric.c (check_uint): check should be done using UINT_MAX, not
-	  INT_MAX. this fix is submitted by Lyle Johnson
-	  <lyle@knology.net> in [ruby-core:01486]
+	* proc.c (rb_obj_singleton_method): Kernel#singleton_method should
+	  not use refinements, as well as Kernel#method.
+	  [ruby-core:67603] [Bug #10744]
 
-Thu Aug 28 05:02:52 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Thu Jan 15 10:45:04 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* parse.y (singleton): typo fixed (ruby-bugs-ja:PR#562)
+	* array.c (rb_ary_select_bang, ary_reject_bang): linear
+	  performance.  [ruby-core:67418] [Feature #10714]
 
-Thu Aug 28 02:37:45 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Wed Jan 14 18:06:06 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
 
-	* eval.c (rb_eval): *a = [1,2] now assigns [[1,2]] to a.
-	  consistent with *a = [1], which set [[1]] to a.
+	* lib/uri/mailto.rb: raising URI::InvalidComponentError instead
+	  of failing with undefined method `split' for nil:NilClass for
+	  mailto: URIs without opaque part. [Bug #10738]
+	* test/uri/testuri.rb: Test for above
 
-	* node.h: merge NODE_RESTARY to NODE_SPLAT.
+Wed Jan 14 16:45:24 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* parse.y: rules simplified a bit by removing NODE_RESTARY.
+	* tool/downloader.rb (RubyGems.download): verify downloaded gem
+	  packages.  LowSecurity to allow untrusted certificates now.
 
-	* sample/test.rb: updated for new assignment behavior.
+Wed Jan 14 15:43:48 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Aug 27 22:33:24 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/readline/readline.c (readline_s_refresh_line): initialize
+	  before rl_refresh_line(), as some function make the internal
+	  state non-clean but rl_refresh_line() does not re-initialize it.
+	  [ruby-core:43957] [Bug #6232]
 
-	* error.c (rb_bug): should not use other methods; this function is
-	  not for ordinary use.  [ruby-dev:21259]
+Tue Jan 13 21:59:24 2015  Michal Papis  <mpapis@gmail.com>
 
-Wed Aug 27 15:07:57 2003  Minero Aoki  <aamine@loveruby.net>
+	* tool/rbinstall.rb (gem): fix changing permissions of installed
+	  bundled gems.  [Fix GH-812]
 
-	* lib/net/smtp.rb (check_response): AUTH CRAM-MD5 returns 334
-	  response. [ruby-list:38279]
+Tue Jan 13 21:57:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Aug 27 05:10:15 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* common.mk (distclean-local): remove autom4te.cache generated by
+	  autoconf.
 
-	* win32/win32.c (map_errno): support winsock error.
+	* common.mk (realclean-local): remove id sources and dummy header
+	  for dtrace.  [ruby-core:67562] [Bug #10737]
 
-	* win32/win32.c (pipe_exec, CreateChild, poll_child_status, waitpid,
-	  kill, link, rb_w32_rename, unixtime_to_filetime, rb_w32_utime):
-	  pass errno to map_errno().
+Tue Jan 13 21:08:22 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-	* win32/win32.c (rb_w32_select, rb_w32_accept, rb_w32_bind,
-	  rb_w32_connect, rb_w32_getpeername, rb_w32_getsockname,
-	  rb_w32_getsockopt, rb_w32_ioctlsocket, rb_w32_listen, rb_w32_recv,
-	  rb_w32_recvfrom, rb_w32_send, rb_w32_sendto, rb_w32_setsockopt,
-	  rb_w32_shutdown, rb_w32_socket, rb_w32_gethostbyaddr,
-	  rb_w32_gethostbyname, rb_w32_gethostname, rb_w32_getprotobyname,
-	  rb_w32_getprotobynumber, rb_w32_getservbyname, rb_w32_getservbyport,
-	  rb_w32_fclose, rb_w32_close): use map_errno().
+	* ext/json, test/json: merge JSON HEAD(259dee6)
+	  separate implementation of Typed_Data macro.
+	  https://github.com/flori/json/compare/v1.8.1...v1.8.2
 
-	* win32/win32.h: add winsock errors.
+Tue Jan 13 14:16:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Aug 26 23:53:23 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* test/net/http/test_http.rb: get rid of accessing DNS actually
+	  for some servers returning wrong results.
+	  [ruby-core:67454] [Bug #10721]
 
-	* lib/ostruct.rb (OpenStruct::method_missing): prohibit modifying
-	  frozen OpenStruct. [ruby-talk:80214]
+Mon Jan 12 23:21:57 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Tue Aug 26 20:03:50 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* gems/bundled_gems: update test-unit to 3.0.9.
 
-	* lib/mkmf.rb (create_tmpsrc): add the hook for source.
-	  [ruby-list:38122]
+Mon Jan 12 18:35:44 2015  Eric Wong  <e@80x24.org>
 
-Tue Aug 26 15:59:53 2003  why the lucky stiff  <why@ruby-lang.org>
+	* numeric.c (bit_coerce): use original value for error message
+	  [ruby-core:67405] [Bug #10711]
+	* test/ruby/test_numeric.rb (test_coerce): check error message
 
-	* implicit.c (syck_type_id_to_taguri): corrected detection of
-	  x-private types.
+Mon Jan 12 18:01:24 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Aug 24 01:02:48 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/rdoc/text.rb (expand_tabs): get rid of infinite loop with
+	  CR.  should check if substitution occurred too.
+	  [ruby-dev:48813] [Bug #10732]
 
-	* file.c (file_expand_path): performance improvement.
-	  [ruby-talk:79748]
+Mon Jan 12 16:45:46 2015  Seiei Higa  <hanachin@gmail.com>
 
-Sat Aug 23 23:41:16 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* vm_method.c (rb_alias): raise a NameError when creating alias to
+	  a refined method if the original method of the refined method is
+	  not defined.  [ruby-core:67523] [Bug #10731]
 
-	* file.c (rb_file_s_expand_path): avoid calling rb_scan_args() for
-	  apparent cases. [ruby-talk:79748]
+Mon Jan 12 13:53:17 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-Sat Aug 23 18:56:53 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* math.c (math_atan2): improve documentation.
+	  [Feature #10323][ruby-core:65400][ci skip]
 
-	* ext/nkf/nkf.c (rb_nkf_putchar): should use rb_str_resize() to just
-	  resize a string, rb_str_cat() disallows NULL.  [ruby-dev:21237]
+Mon Jan 12 13:50:49 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-Sat Aug 23 16:48:41 2003  Keiju Ishitsuka  <keiju@ishitsuka.com>
+	* ext/bigdecimal/bigdecimal.c: fixes documentation like labeled lists,
+	  code examples etc. [ruby-core:66730][Bug #10576][ci skip]
 
-	* lib/irb/ruby-lex.rb: bug fix for "foo" !~ /bar/. [ruby-talk:79942]
+Mon Jan 12 13:36:44 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-Sat Aug 23 15:59:58 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/optparse.rb: improvements for OptionParser documentation.
+	  [misc #10608][ruby-core:66901][ci skip]
 
-	* eval.c (rb_eval, rb_iterate, block_pass): reduce PUSH/POP_TAG and
-	  EXEC_TAG() for retry.  [ruby-dev:21216]
+Mon Jan 12 13:33:52 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-Sat Aug 23 02:32:33 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* array.c (rb_ary_each): documented return value.
+	  [misc #10469][ruby-core:66063]
 
-	* eval.c (rb_yield_splat): should check if "values" is array.
+Sun Jan 11 15:11:38 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* enum.c (each_with_index_i): typo.
+	* test/webrick/test_utils.rb (test_create_listeners): use
+	  dynamically chosen port number, not hardcoded port number.
+	  [ruby-core:67508]
 
-Fri Aug 22 17:07:05 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sat Jan 10 12:57:12 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-	* enum.c (inject_i): use rb_yield_values.
+	* ext/zlib/zlib.c: fix document of method signatures.
+	  [Bug #10668][ruby-core:67186][ci skip]
 
-	* enum.c (each_with_index_i): ditto.
+Sat Jan 10 12:32:44 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* eval.c (rb_yield_splat): new function to call "yield *values".
+	* eval_error.c (error_print): pos and len parameters of rb_str_substr()
+	  are counted by characters, not bytes.  use rb_str_subseq() instead.
+	  [Bug #10727] [ruby-core:67473]
 
-	* string.c (rb_str_scan): use rb_yield_splat().
+Sat Jan 10 10:58:55 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-Fri Aug 22 06:13:22 2003  why the lucky stiff  <why@ruby-lang.org>
+	* complex.c: removed commented-out code.
 
-	* ext/syck/rubyext.c: refactoring of the transfer method
-	  dispatch.  added yaml_org_handler for faster dispatch of
-	  transfers to base types.
+Sat Jan 10 10:57:19 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-	* lib/yaml/rubytypes.rb: removed handling of builtins from
-	  Ruby library.
+	* rational.c: removed commented-out code.
+	  [Feature #10376][ruby-core:65643]
 
-	* ext/syck/token.c: quoted and block scalars are now implicit !str
+Sat Jan 10 10:12:15 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/syck/implicit.c: empty string detected as !null.
+	* array.c (rb_ary_select_bang): keep the array consistent by
+	  removing unselected values soon.  [ruby-dev:48805] [Bug #10722]
 
-Fri Aug 22 01:00:31 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Jan  9 23:20:04 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-	* eval.c (block_pass): improve passing current block.
+	* lib/rubygems:  Update to RubyGems HEAD(e53c54a).
+	* test/rubygems:  ditto.
 
-Fri Aug 22 00:13:00 2003  Shigeo Kobayashi  <shigek@ruby-lang.org>
+Fri Jan  9 11:13:01 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/bigdecimal/bigdecimal.c: Int. overflow bug in multiplication
-	  fixed, and VpNmlz() speed up.
+	* parse.y (assocs, assoc): eliminate splatting empty literal
+	  hashes.  [ruby-core:67446] [Bug #10719]
 
-Wed Aug 20 16:44:49 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* compile.c (compile_array_): support splatted hash in hash type.
 
-	* ext/socket/socket.c (ruby_connect): many systems seem to have
-	  a problem in select() after EINPROGRESS.  [ruby-list:38080]
+Fri Jan  9 10:57:09 2015  Vit Ondruch  <vondruch@redhat.com>
 
-Wed Aug 20 01:31:17 2003  why the lucky stiff  <why@ruby-lang.org>
+	* configure.in (RUBY_SETJMP_TYPE): Remove superfluous semicolon
+	  which causes a syntax error with autoconf 2.63.
+	  [ruby-core:67429] [Bug #10716]
 
-	* ext/syck/syck.h: Parser definition problems on HP-UX.
-	  [ruby-talk:79389]
+Fri Jan  9 07:23:32 2015  Aaron Patterson <aaron@tenderlovemaking.com>
 
-	* ext/syck/handler.c (syck_hdlr_get_anchor): Memory leak.
+	* ext/psych/lib/psych/visitors/yaml_tree.rb: correctly quote non-ascii
+	  letters. Thanks @jirutka for the patch.
 
-	* ext/syck/syck.s (syck_io_file_read): Bad arguments to fread.
+	* test/psych/test_string.rb: test for change
 
-	* ext/syck/rubyext.c: Tainting issues.
+Fri Jan  9 07:13:55 2015  Aaron Patterson <aaron@tenderlovemaking.com>
 
-Tue Aug 19 23:20:00 2003  Shigeo Kobayashi  <shigek@ruby-lang.org>
+	* ext/psych/lib/psych/visitors/to_ruby.rb: call `allocate` on hash
+	  subclasses.  Fixes github.com/tenderlove/psych/issues/196
 
-	* ext/bigdecimal/bigdecimal.c .h .html: to_s("+") implemented.
+	* test/psych/test_hash.rb: test for change
 
-	* ext/bigdecimal/lib/bigdecimal/math.rb: E implemented.
+Fri Jan  9 06:58:43 2015  Aaron Patterson <aaron@tenderlovemaking.com>
 
-Tue Aug 19 07:47:09 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+	* ext/psych/lib/psych/visitors/to_ruby.rb: revive hashes with ivars
 
-	* lib/webrick/ssl.rb: new file; SSL/TLS enhancement for GenericServer.
+	* ext/psych/lib/psych/visitors/yaml_tree.rb: dump hashes with ivars.
+	  Fixes github.com/psych/issues/43
 
-	* lib/webrick/https.rb: SSLSocket handling is moved to webrick/ssl.rb.
+	* test/psych/test_hash.rb: test for change
 
-	* lib/webrick/compat.rb (File::fnmatch): remove old migration code.
+Thu Jan  8 17:05:00 2015  Seiei Higa  <hanachin@gmail.com>
 
-	* lib/webrick/httpserver.rb (HTTPServer#run): ditto.
+	* vm_method.c (rb_method_entry): if no super class, no original
+	  method entry.  [ruby-core:67389] [Bug #10707]
 
-	* lib/webrick/server.rb (GenericServer#listen): the body of this
-	  method is pull out as Utils::create_lisnteners.
+Thu Jan  8 16:31:43 2015  Seiei Higa  <hanachin@gmail.com>
 
-	* lib/webrick/utils.rb (Utils::create_lisnteners): new method.
+	* vm_method.c (rb_export_method): bail out if the original method
+	  is undefined when the method is refined.
+	  [ruby-core:67387] [Bug #10706]
 
-	* lib/webrick/server.rb (GenericServer#start): should rescue
-	  unknown errors. and refine comments.
+Thu Jan  8 12:53:44 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/openssl/lib/openssl/ssl.rb (SSLServer#accept): should close
-	  socket if SSLSocket raises error.
+	* dir.c (glob_helper): match in case-folding only if the directory
+	  resides on a case-insensitive file system, on OSX.
+	  [ruby-core:67364] [Bug #10700]
 
-Tue Aug 19 11:19:33 2003  Shugo Maeda  <shugo@ruby-lang.org>
+Thu Jan  8 11:39:18 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-	* io.c (next_argv): should not call GetOpenFile() if rb_stdout is
-	  not a IO (T_FILE).
+	* .travis.yml: Remove redundant configuration option.
+	  [fix GH-809] Patch by @gxworld
 
-Tue Aug 19 07:47:09 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Thu Jan  8 07:17:14 2015  Eric Wong  <e@80x24.org>
 
-	* ext/openssl/ossl_ssl.c: sync_close is moved to SSLSocket as
-	  a builtin.
+	* lib/resolv.rb: consider ENETUNREACH as ResolvTimeout
+	  [ruby-core:67411] [Bug #10712]
 
-	* ext/openssl/lib/openssl/buffering.rb (Buffering#close): ditto.
+Thu Jan  8 00:13:52 2015  Tanaka Akira  <akr@fsij.org>
 
-	* ext/openssl/lib/openssl/buffering.rb (Buffering#puts): should
-	  add a return to the tails of each line.
+	* lib/open3.rb: Open3 properly passes non-keyword hash args to spawn.
+	  Fixed by Josh Cheek.  [Fix GH-808]
+	  Related to [ruby-core:67347] [Bug #10699]
 
-	* ext/openssl/lib/openssl/ssl.rb: new class OpenSSL::SSL::SSLServer.
+Wed Jan  7 19:19:26 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/openssl/lib/net/protocols.rb (SSLIO#ssl_connect): use sync_close.
+	* dir.c (dir_initialize): workaround of opendir failure at symlink
+	  directories on Windows via CIFS.
 
-	* ext/openssl/sample/echo_svr.rb: use SSLServer.
+Wed Jan  7 18:52:50 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/openssl/sample/echo_cli.rb: add example of SSLSocket#sync_close.
+	* dir.c (need_normalization): not only HFS+, CIFS (SMB) is also
+	  decomposed.  [Bug #10704]
 
-Tue Aug 19 01:24:34 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* dir.c (NORMALIZE_UTF8PATH): Unicode decomposition seems to
+	  perform in an upper layer than file systems on OSX, as all path
+	  names are always decomposed regardless of file system types.
 
-	* ext/curses/curses.c (_XOPEN_SOURCE_EXTENDED): Mac OS X standard
-	  headers are inconsistent at this macro.  [ruby-core:01432]
+Tue Jan  6 21:41:04 2015  Tanaka Akira  <akr@fsij.org>
 
-	* ext/curses/extconf.rb: check if _XOPEN_SOURCE_EXTENDED breaks.
+	* time.c (timelocalw): Set tm_isdst field -1 if vtm->isdst is
+	  VTM_ISDST_INITVAL.  This bug is introduced at packing struct
+	  vtm (r45155).
+	  [ruby-core:67345] [Bug #10698] Reported by Boris Ruf.
 
-	* ext/tcltklib/stubs.c: Status macro in X11/Xthreads.h bothers
-	  winspool.h
+Tue Jan  6 03:10:54 2015  Koichi Sasada  <ko1@atdot.net>
 
-	* instruby.rb: make list at first instead of iterator.
-	  [ruby-talk:79347]
+	* test/fiddle/test_handle.rb: fix syntax.
 
-Mon Aug 18 11:23:11 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Jan  6 00:16:10 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* dir.c (glob_helper): preserve raw order for **.
+	* test/fiddle/test_handle.rb (test_NEXT): use -test-/dln/empty
+	  which is always a shared object and is not used by others.
+	  [ruby-dev:48629] [Bug #10384]
 
-Sun Aug 17 23:39:55 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon Jan  5 14:58:01 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-	* ext/openssl/extconf.rb (HAVE_VA_ARGS_MACRO): need to compile.
+	* test/ruby/test_io.rb: added timeout for AIX environment.
+	  [ruby-core:62983][Bug #9917]
 
-Sun Aug 17 17:10:03 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Sun Jan  4 22:33:33 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/openssl/lib/openssl/ssl.rb (SSLSocket#sync_close=): add a
-	  method to specify if the underlying IO will be closed in
-	  SSLSocket#close.
+	* test/lib/test/unit.rb (ExcludesOption): add "excludes" support
+	  to test suite, for alternative implementations and platforms.
+	  [Feature #10682]
 
-	* ext/openssl/lib/openssl/buffering.rb: add forwarders to
-	  setsockopt, getsockopt and fcntl.
+Sun Jan  4 22:32:42 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/openssl/lib/net/protocols.rb: enable sync for SSLSocket.
+	* test/lib/test/unit.rb (Test::Unit): reorder modules and merge
+	  each modules.
 
-Sun Aug 17 11:32:04 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/lib/test/unit.rb (Test::Unit): split the large class into
+	  each modules.
 
-	* ext/extmk.rb (extmake): should not force to remake Makefile when
-	  installation and so on.
+Sun Jan  4 21:32:52 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Aug 16 23:58:18 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* parse.y (f_label): return tLABEL value as it is.
+	  [ruby-core:67315] [Bug #10693]
 
-	* marshal.c (w_symbol, w_object): get rid of warnings.
+Sun Jan  4 14:02:37 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* re.c (rb_memsearch): ditto.
+	* test/lib/test/unit/parallel.rb (run): expand the file name to be
+	  loaded, so that relative paths work in parallel mode.
 
-	* time.c (time_dump): ditto.
+Sun Jan  4 13:36:56 2015  Ayumu AIZAWA  <ayumu.aizawa@gmail.com>
 
-	* ext/extmk.rb (extmake): not continue making when extconf.rb
-	  failed.
+	* test/test_tempfile.rb: use assert_file for more descriptive message.
+	  following r49131.
 
-	* ext/openssl/extconf.rb: check __VA_ARGS__ macro more precisely.
+Sun Jan  4 13:05:09 2015  Ayumu AIZAWA  <ayumu.aizawa@gmail.com>
 
-	* ext/openssl/ossl.h: remove version.h dependency.
+	* string.c: improve docs for String#<=>. [ruby-core:65399][Feature #10322]
+	  Patch by gogo tanaka.
 
-	* ext/openssl/ruby_missing.h: ditto.
+Sun Jan  4 12:42:24 2015  Ayumu AIZAWA  <ayumu.aizawa@gmail.com>
 
-	* lib/mkmf.rb (pkg_config): use --libs output except with
-	  only-L for other options.  [ruby-list:38099]
+	* array.c: improve docs for Array#reject. [ruby-core:65324][misc #10307]
+	  Patched by Nebu Pookins.
 
-	* lib/mkmf.rb (create_makefile): separate rule for static
-	  library from shared object.
+Sun Jan  4 12:24:11 2015  Ayumu AIZAWA  <ayumu.aizawa@gmail.com>
 
-	* win32/Makefile.sub, bcc32/Makefile.sub, wince/Makefile.sub:
-	  define exec_prefix and libdir.
+	* string.c: improve docs for String#strip and variations.
+	  [ruby-core:66081][Bug #10476]
 
-Fri Aug 15 23:15:00 2003  Shigeo Kobayashi  <shigek@ruby-lang.org>
+Sun Jan  4 09:21:04 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-	* ext/bigdecimal/bigdecimal.c .h: Bug in combination of limit & div
-	  method fixed.
+	* lib/drb/drb.rb: removed unused argument. Patch by @vipulnsward
+	  [fix GH-515]
 
-	* ext/bigdecimal/lib/bigdecimal/math.rb: atan() & sqrt() added.
+Sun Jan  4 09:18:31 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-Fri Aug 15 12:01:43 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/tempfile.rb: provide default basename parameter.
+	  [fix GH-523] Patch by @dissolved
+	* test/test_tempfile.rb: ditto.
 
-	* configure.in (HUGE_ST_INO): check whether struct stat.st_ino
-	  is larger than long.  [ruby-dev:21194]
-	  http://www.geocities.co.jp/SiliconValley-PaloAlto/1409/ruby/beos.html
+Sun Jan  4 00:43:41 2015  Ayumu AIZAWA  <ayumu.aizawa@gmail.com>
 
-	* error.c (syserr_eqq): errno might exceed Fixnum limit.
+	* README.ja.md: add guidance of mailing list and bugs.r-l.o.
 
-	* error.c (Init_Exception): moved base initialization from
-	  init_syserr().
+Sat Jan  3 23:56:28 2015  Ayumu AIZAWA  <ayumu.aizawa@gmail.com>
 
-	* inits.c (rb_call_inits): postpone initializing errnos until
-	  Bignum is available.
+	* hash.c: fix docs for Hash#invert. [ruby-core:66917] [Bug #10612]
 
-Fri Aug 15 12:01:43 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Jan  3 19:52:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/curses/curses.c (_XOPEN_SOURCE_EXTENDED): needed to let
-	  keyname() and so on be declared.
+	* include/ruby/intern.h (rb_str_new_literal): define on all
+	  platforms, not only gcc.
 
-	* ext/curses/curses.c (curses_resizeterm, window_resize):
-	  arguments conflicted with macros in term.h.
+Sat Jan  3 18:53:28 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/curses/curses.c (Curses module methods): ensure
-	  initialized.  [ruby-dev:21191]
+	* ext/fiddle/lib/fiddle/cparser.rb (parse_ctype): limit split word
+	  number as the rest are not used.
 
-Fri Aug 15 02:08:53 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Sat Jan  3 18:19:50 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-	* gc.c (id2ref): recycle check should be done by klass == 0.
-	  [ruby-core:01408]
+	* ext/fiddle/lib/fiddle/cparser.rb: r49110 broke Fiddle::Import with
+	  type_alias.
+	* test/fiddle/test_cparser.rb: added type_alias test for parse_ctype
+	  and parse_struct_signature.
 
-Fri Aug 15 01:34:23 2003  Michal Rokos  <m.rokos@sh.cvut.cz>
+Sat Jan  3 11:50:16 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-	* ext/openssl/ossl_pkey.c: move generate_cb here
+	* ext/openssl/ossl.h: avoid to build failure of Windows environment.
+	* ext/openssl/ossl_ssl_session.c: ditto.
 
-	* ext/openssl/ossl_pkey_{dh|dsa|rsa}.c: adapt to this cb
+Sat Jan  3 11:27:46 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-	* ext/openssl/openssl_missing.[ch]: add (0.9.6x, x<j) missing BN funcs
+	* array.c: Improve performance of Array#shift. use shared instead of
+	  MEMMOVE if with arguments. Patch by @ksss [fix GH-537]
+	* test/ruby/test_array.rb: ditto.
+	* benchmark/bm_array_shift.rb: Added benchmark of GH-537 issue.
 
-	* ext/openssl/ossl_bn.c: use supplied funcs from openssl_missing.c
+Sat Jan  3 10:38:52 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-Fri Aug 15 00:38:00 2003  Shigeo Kobayashi  <shigek@ruby-lang.org>
+	* lib/net/http.rb: More descriptive error message when net/http fails
+	  to connect to a server. Patch by @xaviershay [fix GH-700]
+	* test/net/http/test_http.rb: ditto.
 
-	* ext/bigdecimal/bigdecimal.c: Bug in div method fixed.
+Sat Jan  3 10:14:51 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-	* ext/bigdecimal/lib/bigdecimal/math.rb: Newly added.
+	* ext/openssl/ossl.h: Make `SSL_SESSION_cmp` use `CRYPTO_memcmp`
+	  [fix GH-591] Patch by @PiPeep
+	* ext/openssl/ossl_ssl_session.c: ditto.
 
-	* ext/bigdecimal/sample/pi.rb: Changed so as to use math.rb.
+Sat Jan  3 09:54:32 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-Thu Aug 14 21:19:14 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/fiddle/lib/fiddle/cparser.rb: Support for Fiddle::CParser
+	  to handle rich signatures including parameter names and function
+	  pointer types. Patch by @theryan [fix GH-590]
+	* test/fiddle/test_cparser.rb: ditto.
 
-	* eval.c (Init_Thread): Continuation#[] added.  [ruby-talk:79028]
+Sat Jan  3 09:01:43 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-Thu Aug 14 20:03:34 2003  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
+	* NEWS: added compatibility entry of r49101.
 
-	* ext/win32ole/win32ole.c (OLE_FREE): should not call
-	  ole_message_loop.
+Fri Jan  2 21:06:59 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-	* ext/win32ole/win32ole.c (ole_event_free): ditto.
+	* lib/net/http.rb (Net::HTTP#send_request): there is no response body
+	  with HEAD request. Patch by @rodrigosaito [fix GH-520]
 
-	* ext/win32ole/win32ole.c (ole_initialize): stop calling
-	  OleUninitialize at exit.
+Fri Jan  2 21:04:36 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-Thu Aug 14 11:27:37 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* test/net/http/test_http.rb (_test_send_request__HEAD): Added
+	  failing test for send_request with HEAD method.
 
-	* gc.c (rb_data_object_alloc): check type of 1st argument.
-	  [ruby-dev:21192]
+Fri Jan  2 18:41:20 2015  Tanaka Akira  <akr@fsij.org>
 
-Thu Aug 14 00:21:14 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* eval.c (ruby_init): Print ruby_setup() error only in debug mode.
+	  Unsuppressable error message is not a good idea.
+	  Note that the message is printed sometimes with following
+	  code (highly timing dependent, though):
+	  pid = spawn("ruby -e ''"); Process.kill(:TERM, pid)
 
-	* parse.y (mlhs_node): should allow "::Foo" (colon3) as lhs.
+Fri Jan  2 16:18:44 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-	* parse.y (lhs): ditto.
+	* test/ruby/test_module.rb: Refactor invalid testcase.
+	  [fix GH-472][ruby-core:59035][Bug #9240]
 
-	* parse.y (yylex): should return tCOLON3 right after kCLASS.
-	  [ruby-talk:78918]
+Fri Jan  2 15:53:00 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-	* error.c (exc_initialize): was converting argument to string too
-	  eagerly.  Only check was needed. [ruby-talk:78958]
+	* lib/webrick/utils.rb: removed unused argument variable.
+	  [fix GH-356] Patch by @vipulnsward
+	* lib/webrick/server.rb: ditto.
+	* lib/webrick/ssl.rb: ditto.
+	* test/webrick/test_utils.rb: added test for WEBrick::Utils#create_listeners.
 
-Wed Aug 13 23:31:00 2003  Shigeo Kobayashi  <shigek@ruby-lang.org>
+Fri Jan  2 15:35:53 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-	* ext/bigdecimal/bigdecimal.c .h .html: Ambiguity of
-	  BigDecimal::limit removed.
+	* lib/securerandom.rb: improve syntax and grammar of documentation.
+	  [fix GH-796][ci skip] Patch by @Erol
 
-Wed Aug 13 19:21:34 2003  Christian Neukirchen  <chneukirchen@yahoo.de>
+Fri Jan  2 15:10:01 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-	* lib/webrick/https.rb (HTTPServer#run): should set syncing-mode
-	  to SSLSocket. [ruby-talk:78919]
+	* test/openssl/test_ssl_session.rb (OpenSSL#test_ctx_client_session_cb):
+	  fix test failure with OpenSSL disabled SSLv3 protocol.
+	  [ruby-core:63772] [Bug #10046]
 
-Wed Aug 13 18:13:49 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Jan  2 09:08:31 2015  Tanaka Akira  <akr@fsij.org>
 
-	* eval.c (POP_BLOCK): turn on BLOCK_LEFT flag when leaving block.
+	* lib/resolv.rb (Resolv::DNS::Label::Str#==): Check class equality.
+	  (Resolv::DNS::Name#initialize): Normalize labels as
+	  Resolv::DNS::Label::Str objects.
 
-	* eval.c (proc_invoke): unpack return/break destination when block
-	  is already left.
+Thu Jan  1 21:41:49 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-Wed Aug 13 15:58:31 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* doc/regexp.rdoc: fix regexp docs for whitespace character.
+	  [ruby-dev:48765] [Bug #10624]
 
-	* object.c (rb_class_s_alloc): add function prototype to avoid VC++
-	  warning.
+Thu Jan  1 17:50:52 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Aug 13 13:50:59 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* test/ruby/test_rubyoptions.rb: try locale encoding name.
+	  [ruby-core:67109] [Bug #10643]
 
-	* ext/Win32API/Win32API.c (Win32API_initialize): should pass some
-	  class to first argument of Data_Wrap_Struct(). (ruby-bugs:PR#1109)
+Thu Jan  1 11:07:12 2015  Eric Wong  <e@80x24.org>
 
-Tue Aug 12 16:55:11 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* symbol.c (rb_gc_free_dsymbol): delete from global fstr hash
+	* test/ruby/test_symbol.rb (test_symbol_fstr_leak): test for bug
+	  [ruby-core:67268] [Bug #10686]
 
-	* Makefile.in: static link libraries to LIBRUBY_SO with static linked
-	  ext.  [ruby-dev:21157]
+Thu Jan  1 09:14:21 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/extmk.rb (extmake): sort extension library initialization order.
+	* vm_args.c (keyword_hash_p): fix non-symbol keys hash.
+	  rb_extract_keywords() returns 0 not Qnil when no symbol keys is
+	  included.  [ruby-core:67264] [Bug #10685]
 
-	* ext/extmk.rb (extmake): compact $extlibs.
+Wed Dec 31 17:48:43 2014  Tanaka Akira  <akr@fsij.org>
 
-Tue Aug 12 02:48:56 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/resolv.rb (Resolv::DNS::Label::Str#initialize): Set encoding
+	  ASCII-8BIT before downcase.  case insensitivity of DNS labels doesn't
+	  apply non-ASCII characters.  [RFC 4343]
 
-	* eval.c (THREAD_SAVE_CONTEXT): should explicitly turn off the
-	  flag before calling getcontext(2).
+Wed Dec 31 16:48:44 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (struct thread): add member to save backing store on
-	  IA64. (ruby-bugs PR1086)
+	* parse.y (gettable_gen): disable warnings of possible reference
+	  to a local variable defined in a past scope.
+	  [ruby-core:67162] [Bug #10661]
 
-	* eval.c (thread_mark): mark IA64 backing store region.
+Wed Dec 31 13:43:48 2014  Tanaka Akira  <akr@fsij.org>
 
-	* eval.c (thread_free): free saved IA64 backing store.
+	* lib/resolv.rb (Resolv::DNS::Name#==): Compare an array of Label:Str
+	  objects.  Label#Str#== is case-insensitive.
 
-	* eval.c (rb_thread_save_context): save IA64 backing store as well.
+Tue Dec 30 16:16:12 2014  Ben Miller  <bmiller@rackspace.com>
 
-	* eval.c (rb_thread_restore_context): restore IA64 backing store.
+	* lib/resolv.rb (Resolv::DNS::Name#==): DNS is case-insensitive, so the
+	  comparison should be case-insensitive as well.
+	  [ruby-core:66498] [Bug #10550]
 
-	* eval.c (THREAD_ALLOC): initialize IA64 members.
+Tue Dec 30 16:03:45 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Aug 11 22:31:50 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
-	* lib/debug.rb(debug_command): inspection command should inspect
-	  resulting value even if it's nil.  [ruby-dev:21180] by OMAE, jun
-	  <jun66j5@ybb.ne.jp>.
+	* lib/resolv.rb (Resolv::DNS::Name): names with different dots
+	  should be different.
 
-	* lib/debug.rb(debug_command): incomplete regexp.
+Tue Dec 30 13:16:56 2014  Martin Duerst  <bernhard+git@lsmod.de>
 
-Mon Aug 11 17:33:07 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/uri/common.rb: Initialize HTML5ASCIIINCOMPAT to empty Array
+	  to avoid error during bootstrap when encodings are not yet defined.
+	  [Bug #10678]
 
-	* eval.c (rb_call_super): do not use rb_block_given_p() for
-	  check. [ruby-talk:78656]
+Tue Dec 30 09:29:26 2014  Bernhard M. Wiedemann  <bernhard+git@lsmod.de>
 
-	* eval.c (BEGIN_CALLARGS): push ITER_NOT only when ITER_PRE.
+	* ext/dbm/dbm.c (Init_dbm): [DOC] as UNIX permissions are octal
+	  numbers, needs to be prefixed by 0.  [Fix GH-800]
 
-Sun Aug 10 10:43:05 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Tue Dec 30 08:57:39 2014  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-	* ext/openssl/lib/openssl/buffering.rb: increase BLOCK_SIZE
-	  from 1k to 16k bytes. [ruby-talk:78603]
+	* lib/unicode_normalize.rb: typo fix. [ci skip]
+	  [ruby-dev:48794][misc #10675]
 
-	* ext/openssl/ossl_ssl.c (ossl_sslctx_s_alloc): enable
-	  partial write to allow interruption in SSLSocket#write.
+Mon Dec 29 19:38:01 2014  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Sun Aug 10 00:34:16 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* version.h (RUBY_VERSION): 2.3.0 development has started.
 
-	* cygwin/GNUmakefile: remove unnecessary '--drive-name=$(CC)'
-	  for ccache.
+Mon Dec 29 18:58:46 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Aug  9 10:36:21 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* re.c (unescape_nonascii): append escape sequence as-is not
+	  unescaped character, to get rid of unexpected meta-character.
+	  [ruby-core:67193] [Bug #10670]
 
-	* marshal.c (w_object): do not dump generic instance variable when
-	  marshal_dump is defined.
+Mon Dec 29 14:27:33 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Aug  9 00:35:00 2003  Shigeo Kobayashi  <shigek@ruby-lang.org>
+	* doc/syntax/literals.rdoc (Symbols): now Symbols created by
+	  interpolation can be garbage collected.  patch by Yihang Ho in
+	  [ruby-core:67194].  [Bug #10671]
 
-	* ext/bigdecimal.c: F style output(like 1234.56789) implemented
-	  to to_s method.
-	* ext/bigdecimal_??.html: F style output(like 1234.56789)
-	  implemented to to_s method.
+Mon Dec 29 11:18:17 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Aug  8 12:33:17 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* thread.c (rb_thread_variable_get): fix dynamic symbol keys.
+	  rb_check_id() returns non-zero only for static symbols, whereas
+	  thread local variable keys can be dynamic symbols.
+	  [ruby-core:67185] [Bug #10667]
 
-	* bcc32/Makefile.sub: rubyw.exe should be a Windows GUI program.
-	  add the -aa option to WLDFLAGS.
+Mon Dec 29 10:37:27 2014  Thiago Lewin  <thiago_lewin@yahoo.com.br>
 
-Fri Aug  8 11:29:26 2003  Koji Arai  <jca02266@nifty.ne.jp>
+	* io.c (rb_f_select): [DOC] workaround for YARD doc.  [Fix GH-799]
 
-	* marshal.c (w_object): should set `c_arg' at first.
+	* process.c (proc_detach): [DOC] fix missing closing parenthesis.
+	  [Fix GH-799]
 
-Fri Aug  8 03:22:28 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+Mon Dec 29 07:27:23 2014  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-	* lib/webrick/httputils.rb (FormData#list): should not take
-	  a side effect for the receiver.
+	* ext/json, test/json: merge JSON HEAD(17fe8e7)
+	  https://github.com/flori/json/compare/v1.8.1...17fe8e7
 
-Thu Aug  7 14:40:37 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+Sun Dec 28 23:49:37 2014  Michal Papis  <mpapis@gmail.com>
 
-	* cygwin/GNUmakefile: better --disbale-shared option support.
+	* rbinstall.rb: fix target location for installing bundled gems.
+	  install to the prepared directory instead of default Gem.dir,
+	  not to be affected GEM_HOME environment variable.  [Fix GH-798]
 
-	* cygwin/GNUmakefile: add forwarding DLL target for cygwin.
+Sun Dec 28 18:19:28 2014  Eric Wong  <e@80x24.org>
 
-Thu Aug  7 14:21:05 2003  Corinna Vinschen  <vinschen@redhat.com>
+	* test/-ext-/iseq_load/test_iseq_load.rb
+	  (test_next_in_block_in_block): test using ISeq#eval
+	  (test_break_ensure): ditto
+	  [ruby-core:66988]
 
-	* configure.in: Fix Cygwin specific naming of libraries to
-	  be net distribution compliant. (ruby-bugs:PR#1077)
-	  cygwin-ruby18.dll -> cygruby18.dll
+Sun Dec 28 16:25:12 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Aug  7 12:51:38 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* cygwin/GNUmakefile.in (EXTOBJS): override to add resource files
+	  always.  [ruby-core:67153] [Bug #10657]
 
-	* eval.c (rb_f_at_exit): should not be called without a block.
-	  block_given check added.
+Sun Dec 28 13:54:26 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Aug  7 06:46:06 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* parse.y (f_kwrest, new_args_tail_gen): unnamed rest keyword and
+	  keywords bits arguments should be unique.  since internal IDs
+	  depend on the local variable index in the current scope, new ID
+	  should be made before popping those vtables.
+	  [ruby-core:67157] [Bug #10659]
 
-	* eval.c (rb_call0): forgot to pop ruby_class.
+Sat Dec 27 20:12:55 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c (rb_call0): update ruby_class as well as ruby_cref.
-	  (ruby-bugs-ja:PR#540)
+	* ext/json/generator/generator.c (JSON_Generator_State_type): add
+	  #ifdef for backward compatibility.
 
-Thu Aug  7 04:52:50 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/json/parser/parser.rl (JSON_Parser_type): ditto.
 
-	* eval.c (rb_yield_0): remove ruby_frame->cbase and unify to
-	  ruby_cref.  [ruby-talk:78141]
+	* ext/json/generator/generator.h (ZALLOC): add fallback definition.
 
-Thu Aug  7 04:19:15 2003  Akinori MUSHA  <knu@iDaemons.org>
+	* ext/json/parser/parser.h (ZALLOC): ditto.
 
-	* gc.c: FreeBSD/ia64's mcontext_t is a bit different from that of
-	  Linux/ia64.  This makes gc.c compile but miniruby coredumps for
-	  the moment.
+Sat Dec 27 16:54:05 2014  Tanaka Akira  <akr@fsij.org>
 
-Thu Aug  7 00:15:00 2003  Shigeo Kobayashi  <shigek@ruby-lang.org>
+	* process.c: Unused code removed.
+	  It seems waitpid() is universally available on POSIX platforms.
 
-	* ext/bigdecimal.c: Comparison results adjusted to Float's.
-	* ext/bigdecimal.c: Use rb_num_coerce_????(x,y) instead of own.
+Sat Dec 27 15:08:27 2014  Eric Wong  <e@80x24.org>
 
-Wed Aug  6 22:58:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
+	* vm_core.h (rb_vm_living_threads_insert): preserve order
+	  [Bug #10660] [ruby-core:67154] [ruby-core:67159]
 
-	* lib/test/unit/testcase.rb: Added equality checking.
-	* lib/test/unit/testsuite.rb: Added equality checking.
-	* lib/test/unit/assertions.rb: Fixed a warning.
+Sat Dec 27 13:08:20 2014  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-Wed Aug  6 17:28:10 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/socket/socket.c: improved document for YARD doc.
+	  [fix GH-795][ci skip] Patch by @tlewin
 
-	* ext/extmk.rb (extmake): pass LIBPATH to make ruby.  [ruby-dev:21137]
+Sat Dec 27 10:11:21 2014  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-	* ext/extmk.rb (extmake): set library name as source file name in
-	  Init_ext().  [ruby-dev:21137]
+	* ext/tk/lib/tkextlib/tcllib/plotchart.rb: fix to invoke correct function
+	  of tcllib. Patch by @zalt50 [fix GH-787]
 
-	* lib/mkmf.rb (Logging::postpone): postpone logging messages after
-	  heading message as the result of the block.
+Sat Dec 27 10:03:41 2014  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
 
-	* lib/mkmf.rb (macro_defined?): append newline to src unless ended
-	  with it.
+	* tool/make-snapshot: show sha1 digest when making packages.
+	  it's request from https://github.com/ruby/www.ruby-lang.org/issues/921
+	  [fix GH-794]
 
-	* lib/mkmf.rb (have_library): treat nil function name as "main".
-	  (ruby-bugs:PR#1083)
+Fri Dec 26 15:32:16 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/mkmf.rb (pkg_config): should append additional libraries to
-	  $libs but not $LIBS.  [ruby-dev:21137]
+	* ext/tk/tcltklib.c (ip_invoke_core): remove probably duplicate
+	  dead code.
 
-	* ext/io/wait/extconf.rb: check DOSISH macro instead of platform.
+Fri Dec 26 15:28:27 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/digest/sha1/extconf.rb: have_library already appends library
-	  name.
+	* ext/tk/tcltklib.c (ip_ruby_cmd_receiver_const_get): simply use
+	  rb_path2class() to get a class/module from its name.
 
-Wed Aug  6 17:23:57 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+Fri Dec 26 15:20:54 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c: initialize /* OK */ variables by Qnil to stop warnings.
+	* marshal.c (w_long): append at once by w_nbyte() instead of
+	  appending byte by byte.
 
-Wed Aug  6 04:58:32 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+Fri Dec 26 15:13:13 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/Setup*: add io/wait and openssl.
+	* ext/json/parser/parser.rl (unescape_unicode): check if valid
+	  before bit-or assignments.
+	  reported by Denis Denisov <denji0k AT gmail.com>.
 
-Wed Aug  6 01:13:38 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/nkf/nkf-utf8/nkf.c (nkf_iconv_t): fix a missing semicolon.
+	  reported by Denis Denisov <denji0k AT gmail.com>.
 
-	* eval.c (rb_f_autoload): use ruby_cbase instead of ruby_class.
+	* process.c (rb_spawn_process): get rid of usage of uninitialized
+	  variable.
+	  reported by Denis Denisov <denji0k AT gmail.com>.
 
-	* eval.c (rb_f_autoload_p): ditto.
+	* regexec.c (match_at): ditto.
 
-	* class.c (rb_mod_init_copy): no longer implements independent
-	  clone and dup methods.  override "initialize_copy" instead.
-	  [ruby-core:01352]
+	* ext/win32ole/win32ole.c (ole_wc2mb_alloc, ole_vstr2wc, ole_mb2wc):
+	  ditto.
 
-	* object.c (rb_class_s_alloc): define Class allocation function.
-	  this makes Classes to follow clone framework that uses
-	  initialize_copy.
+	* dir.c (ruby_glob0): no need to check never-NULL pointer.
+	  reported by Denis Denisov <denji0k AT gmail.com>.
 
-	* object.c (rb_class_initialize): separate instantiation and
-	  initialization.
+	* win32/file.c (rb_file_expand_path_internal): ditto.
 
-	* object.c (rb_obj_alloc): prohibit instantiation from
-	  uninitialized class.
+	* win32/file.c (code_page_i): handle realloc failure.
+	  reported by Denis Denisov <denji0k AT gmail.com>.
 
-	* object.c (rb_class_superclass): check uninitialized class.
+	* win32/stub.c (stub_sysinit): ditto.
 
-	* array.c (rb_ary_fill): wrong index processing with block.  this
-	  fix was done by Koji Arai <JCA02266@nifty.ne.jp> [ruby-list:38029]
+	* fix printf format conversion specifiers.
+	  reported by Denis Denisov <denji0k AT gmail.com>.
 
-	* marshal.c (w_object): should preserve generic ivar for nil,
-	  true, false, symbols, and fixnums.
+Fri Dec 26 01:41:40 2014  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* marshal.c (w_uclass): base_klass check should be done after
-	  rb_class_real().
+	* tool/rbinstall.rb: skip installing bundle gems if zlib is unavailable.
+	  [Bug #10647] [ruby-dev:48787]
 
-Wed Aug  6 01:18:50 2003  Minero Aoki  <aamine@loveruby.net>
+Fri Dec 26 01:24:42 2014  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/net/http.rb: update document.
+	* tool/downloader.rb: support old versions of ruby.
 
-	* lib/net/pop.rb: ditto.
+	* tool/downloader.rb: now can download gems by http if openssl is not
+	  available (this may be danger!)
 
-	* lib/net/protocol.rb: ditto.
+Fri Dec 26 00:13:48 2014  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Wed Aug  6 00:48:37 2003  Koji Arai  <jca02266@nifty.ne.jp>
+	* test/ruby/test_extlibs.rb: check existence of extension libraries
+	  which not depend on outer libraries. (experimental)
 
-	* marshal.c (w_object): should recommend marshal_dump rather than
-	  _dump_data.
+Thu Dec 25 21:58:15 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Aug  5 17:58:57 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+	* ext/fiddle/extconf.rb: make PIC objects if it will be linked as
+	  a shared object eventually.  [ruby-core:67128]
 
-	* lib/fileutils.rb (install): should preserve timestamp only.
+Thu Dec 25 19:01:13 2014  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Tue Aug  5 17:31:59 2003  Ian Macdonald  <ian@caliban.org>
+	* ext/fiddle/win32/libffi-3.2.1-mswin.patch: support mswin32.
 
-	* lib/shell/command-processor.rb (Shell::CommandProcessor::rmdir):
-	  simple typo.
+Thu Dec 25 17:30:40 2014  Naohisa Goto  <ngotogenome@gmail.com>
 
-Tue Aug  5 15:47:34 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* gc.c (wmap_final_func): fix memory size shortage when realloc wmap.
+	  Fix SEGV during finalize of WeakRef on Solaris (though the SEGV
+	  could occur on all OS/platforms). [ruby-dev:48779] [Bug #10646]
 
-	* eval.c (rb_load): should preserve current source file/line.
+Thu Dec 25 17:27:06 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Aug  5 10:04:42 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* configure.in (NET_LUID): include winsock2.h instead of windows.h.
+	  patch by Jon Forums in [ruby-core:67125].  [Bug #10640]
 
-	* string.c (str_new4): ptr may refer null_str.
+Thu Dec 25 16:14:10 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Aug  4 17:25:18 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* ext/io/console/console.c (console_dev): send the given arguments
+	  to the opened console.  as a special case, do nothing if :close
+	  is given.
 
-	* stable version 1.8.0 released.
+	* test/lib/leakchecker.rb (LeakChecker#check_fd_leak): close if
+	  console.
 
+For the changes before 2.2.0, see doc/ChangeLog-2.2.0
+For the changes before 2.1.0, see doc/ChangeLog-2.1.0
+For the changes before 2.0.0, see doc/ChangeLog-2.0.0
+For the changes before 1.9.3, see doc/ChangeLog-1.9.3
 For the changes before 1.8.0, see doc/ChangeLog-1.8.0
 
 Local variables:
+coding: us-ascii
 add-log-time-format: (lambda ()
   (let* ((time (current-time))
+	 (system-time-locale "C")
 	 (diff (+ (cadr time) 32400))
 	 (lo (% diff 65536))
-	 (hi  (+ (car time) (/ diff 65536))))
+	 (hi (+ (car time) (/ diff 65536))))
   (format-time-string "%a %b %e %H:%M:%S %Y" (list hi lo) t)))
 indent-tabs-mode: t
 tab-width: 8
+change-log-indent-text: 2
 end:
+vim: tabstop=8 shiftwidth=2
diff --git a/GPL b/GPL
index 5b6e7c66c2..d159169d10 100644
--- a/GPL
+++ b/GPL
@@ -1,12 +1,12 @@
-		    GNU GENERAL PUBLIC LICENSE
-		       Version 2, June 1991
+                    GNU GENERAL PUBLIC LICENSE
+                       Version 2, June 1991
 
- Copyright (C) 1989, 1991 Free Software Foundation, Inc.
-                       59 Temple Place, Suite 330, Boston, MA  02111-1307  USA
+ Copyright (C) 1989, 1991 Free Software Foundation, Inc.,
+ 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA
  Everyone is permitted to copy and distribute verbatim copies
  of this license document, but changing it is not allowed.
 
-			    Preamble
+                            Preamble
 
   The licenses for most software are designed to take away your
 freedom to share and change it.  By contrast, the GNU General Public
@@ -15,7 +15,7 @@ software--to make sure the software is free for all its users.  This
 General Public License applies to most of the Free Software
 Foundation's software and to any other program whose authors commit to
 using it.  (Some other Free Software Foundation software is covered by
-the GNU Library General Public License instead.)  You can apply it to
+the GNU Lesser General Public License instead.)  You can apply it to
 your programs, too.
 
   When we speak of free software, we are referring to freedom, not
@@ -55,8 +55,8 @@ patent must be licensed for everyone's free use or not licensed at all.
 
   The precise terms and conditions for copying, distribution and
 modification follow.
-
-		    GNU GENERAL PUBLIC LICENSE
+
+                    GNU GENERAL PUBLIC LICENSE
    TERMS AND CONDITIONS FOR COPYING, DISTRIBUTION AND MODIFICATION
 
   0. This License applies to any program or other work which contains
@@ -110,7 +110,7 @@ above, provided that you also meet all of these conditions:
     License.  (Exception: if the Program itself is interactive but
     does not normally print such an announcement, your work based on
     the Program is not required to print an announcement.)
-
+
 These requirements apply to the modified work as a whole.  If
 identifiable sections of that work are not derived from the Program,
 and can be reasonably considered independent and separate works in
@@ -168,7 +168,7 @@ access to copy from a designated place, then offering equivalent
 access to copy the source code from the same place counts as
 distribution of the source code, even though third parties are not
 compelled to copy the source along with the object code.
-
+
   4. You may not copy, modify, sublicense, or distribute the Program
 except as expressly provided under this License.  Any attempt
 otherwise to copy, modify, sublicense or distribute the Program is
@@ -225,7 +225,7 @@ impose that choice.
 
 This section is intended to make thoroughly clear what is believed to
 be a consequence of the rest of this License.
-
+
   8. If the distribution and/or use of the Program is restricted in
 certain countries either by patents or by copyrighted interfaces, the
 original copyright holder who places the Program under this License
@@ -255,7 +255,7 @@ make exceptions for this.  Our decision will be guided by the two goals
 of preserving the free status of all derivatives of our free software and
 of promoting the sharing and reuse of software generally.
 
-			    NO WARRANTY
+                            NO WARRANTY
 
   11. BECAUSE THE PROGRAM IS LICENSED FREE OF CHARGE, THERE IS NO WARRANTY
 FOR THE PROGRAM, TO THE EXTENT PERMITTED BY APPLICABLE LAW.  EXCEPT WHEN
@@ -277,9 +277,9 @@ YOU OR THIRD PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER
 PROGRAMS), EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE
 POSSIBILITY OF SUCH DAMAGES.
 
-		     END OF TERMS AND CONDITIONS
-
-	    How to Apply These Terms to Your New Programs
+                     END OF TERMS AND CONDITIONS
+
+            How to Apply These Terms to Your New Programs
 
   If you develop a new program, and you want it to be of the greatest
 possible use to the public, the best way to achieve this is to make it
@@ -303,10 +303,9 @@ the "copyright" line and a pointer to where the full notice is found.
     MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
     GNU General Public License for more details.
 
-    You should have received a copy of the GNU General Public License
-    along with this program; if not, write to the Free Software
-    Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA  02111-1307  USA
-
+    You should have received a copy of the GNU General Public License along
+    with this program; if not, write to the Free Software Foundation, Inc.,
+    51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA.
 
 Also add information on how to contact you by electronic and paper mail.
 
@@ -336,5 +335,5 @@ necessary.  Here is a sample; alter the names:
 This General Public License does not permit incorporating your program into
 proprietary programs.  If your program is a subroutine library, you may
 consider it more useful to permit linking proprietary applications with the
-library.  If this is what you want to do, use the GNU Library General
+library.  If this is what you want to do, use the GNU Lesser General
 Public License instead of this License.
diff --git a/KNOWNBUGS.rb b/KNOWNBUGS.rb
new file mode 100644
index 0000000000..35a8e75876
--- /dev/null
+++ b/KNOWNBUGS.rb
@@ -0,0 +1,7 @@
+#
+# IMPORTANT: Always keep the first 7 lines (comments),
+# even if this file is otherwise empty.
+#
+# This test file includes tests which point out known bugs.
+# So all tests will cause failure.
+#
diff --git a/LEGAL b/LEGAL
index 908eb270f5..2607f0082a 100644
--- a/LEGAL
+++ b/LEGAL
@@ -5,34 +5,90 @@ All the files in this distribution are covered under either the Ruby's
 license (see the file COPYING) or public-domain except some files
 mentioned below.
 
-regex.[ch]:
-
-  These files are under LGPL.  Treat them as LGPL says. (See the file
-  LGPL for details)
-
-    Extended regular expression matching and search library.
-    Copyright (C) 1993, 94, 95, 96, 97, 98 Free Software Foundation, Inc.
-
-    The GNU C Library is free software; you can redistribute it and/or
-    modify it under the terms of the GNU Library General Public License as
-    published by the Free Software Foundation; either version 2 of the
-    License, or (at your option) any later version.
-
-    The GNU C Library is distributed in the hope that it will be useful,
-    but WITHOUT ANY WARRANTY; without even the implied warranty of
-    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the GNU
-    Library General Public License for more details.
-
-    You should have received a copy of the GNU Library General Public
-    License along with the GNU C Library; see the file LGPL.  If not,
-    write to the Free Software Foundation, Inc., 59 Temple Place - Suite 330,
-    Boston, MA 02111-1307, USA.  */
-
-    Multi-byte extension added May, 1993 by t^2 (Takahiro Tanimoto)
-    Last change: May 21, 1993 by t^2
-    removed gapped buffer support, multiple syntax support by matz <matz@nts.co.jp>
-    Perl5 extension added by matz <matz@caelum.co.jp>
-    UTF-8 extension added Jan 16 1999 by Yoshida Masato  <yoshidam@tau.bekkoame.ne.jp>
+ccan/build_assert/build_assert.h
+ccan/check_type/check_type.h
+ccan/container_of/container_of.h
+ccan/str/str.h
+
+  These files are licensed under the CC0.
+
+    http://creativecommons.org/choose/zero/
+
+ccan/list/list.h
+
+  This file is licensed under the MIT License.
+
+    Permission is hereby granted, free of charge, to any person obtaining a copy
+    of this software and associated documentation files (the "Software"), to deal
+    in the Software without restriction, including without limitation the rights
+    to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
+    copies of the Software, and to permit persons to whom the Software is
+    furnished to do so, subject to the following conditions:
+
+    The above copyright notice and this permission notice shall be included in
+    all copies or substantial portions of the Software.
+
+    THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
+    IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
+    FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
+    AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
+    LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
+    OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN
+    THE SOFTWARE.
+
+include/ruby/oniguruma.h:
+regcomp.c:
+regenc.[ch]:
+regerror.c:
+regexec.c:
+regint.h:
+regparse.[ch]:
+enc/ascii.c
+enc/big5.c
+enc/cp949.c
+enc/emacs_mule.c
+enc/encdb.c
+enc/euc_jp.c
+enc/euc_kr.c
+enc/euc_tw.c
+enc/gb18030.c
+enc/gb2312.c
+enc/gbk.c
+enc/iso_8859_1.c
+enc/iso_8859_10.c
+enc/iso_8859_11.c
+enc/iso_8859_13.c
+enc/iso_8859_14.c
+enc/iso_8859_15.c
+enc/iso_8859_16.c
+enc/iso_8859_2.c
+enc/iso_8859_3.c
+enc/iso_8859_4.c
+enc/iso_8859_5.c
+enc/iso_8859_6.c
+enc/iso_8859_7.c
+enc/iso_8859_8.c
+enc/iso_8859_9.c
+enc/koi8_r.c
+enc/koi8_u.c
+enc/shift_jis.c
+enc/unicode.c
+enc/us_ascii.c
+enc/utf_16be.c
+enc/utf_16le.c
+enc/utf_32be.c
+enc/utf_32le.c
+enc/utf_8.c
+enc/windows_1251.c
+
+Oniguruma  ----   (C) K.Kosako <sndgk393 AT ybb DOT ne DOT jp>
+
+http://www.geocities.jp/kosako3/oniguruma/
+http://www.ruby-lang.org/cgi-bin/cvsweb.cgi/oniguruma/
+http://www.freebsd.org/cgi/cvsweb.cgi/ports/devel/oniguruma/
+
+   When this software is partly used or it is distributed with Ruby,
+   this of Ruby follows the license of Ruby.
 
 configure:
 
@@ -43,9 +99,8 @@ configure:
     This configure script is free software; the Free Software Foundation
     gives unlimited permission to copy, distribute and modify it.
 
-config.guess:
-config.sub:
-parse.c:
+tool/config.guess:
+tool/config.sub:
 
   As long as you distribute these files with the file configure, they
   are covered under the Ruby's license.
@@ -72,7 +127,58 @@ parse.c:
     configuration script generated by Autoconf, you may include it under
     the same distribution terms that you use for the rest of that program.
 
+parse.c:
+
+  This file is licensed under the GPL, but is incorporated into Ruby and
+  redistributed under the terms of the Ruby license, as permitted by the
+  exception to the GPL below.
+
+     Copyright (C) 1984, 1989, 1990, 2000, 2001, 2002, 2003, 2004, 2005, 2006
+     Free Software Foundation, Inc.
+
+     This program is free software; you can redistribute it and/or modify
+     it under the terms of the GNU General Public License as published by
+     the Free Software Foundation; either version 2, or (at your option)
+     any later version.
+
+     This program is distributed in the hope that it will be useful,
+     but WITHOUT ANY WARRANTY; without even the implied warranty of
+     MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+     GNU General Public License for more details.
+
+     You should have received a copy of the GNU General Public License
+     along with this program; if not, write to the Free Software
+     Foundation, Inc., 51 Franklin Street, Fifth Floor,
+     Boston, MA 02110-1301, USA.  */
+
+  /* As a special exception, you may create a larger work that contains
+     part or all of the Bison parser skeleton and distribute that work
+     under terms of your choice, so long as that work isn't itself a
+     parser generator using the skeleton or a modified version thereof
+     as a parser skeleton.  Alternatively, if you modify or redistribute
+     the parser skeleton itself, you may (at your option) remove this
+     special exception, which will cause the skeleton and the resulting
+     Bison output files to be licensed under the GNU General Public
+     License without this special exception.
+
+     This special exception was added by the Free Software Foundation in
+     version 2.2 of Bison.  */
+
 util.c (partly):
+
+    Copyright (c) 1991, 2000, 2001 by Lucent Technologies.
+
+    Permission to use, copy, modify, and distribute this software for any
+    purpose without fee is hereby granted, provided that this entire notice
+    is included in all copies of any software which is or includes a copy
+    or modification of this software and in all copies of the supporting
+    documentation for such software.
+
+    THIS SOFTWARE IS BEING PROVIDED "AS IS", WITHOUT ANY EXPRESS OR IMPLIED
+    WARRANTY.  IN PARTICULAR, NEITHER THE AUTHOR NOR LUCENT MAKES ANY
+    REPRESENTATION OR WARRANTY OF ANY KIND CONCERNING THE MERCHANTABILITY
+    OF THIS SOFTWARE OR ITS FITNESS FOR ANY PARTICULAR PURPOSE.
+
 win32/win32.[ch]:
 
   You can apply the Artistic License to these files. (or GPL,
@@ -83,6 +189,32 @@ win32/win32.[ch]:
     You may distribute under the terms of either the GNU General Public
     License or the Artistic License, as specified in the perl README file.
 
+util.c (partly):
+
+   Copyright (c) 2004-2008 David Schultz <das@FreeBSD.ORG>
+   All rights reserved.
+
+   Redistribution and use in source and binary forms, with or without
+   modification, are permitted provided that the following conditions
+   are met:
+   1. Redistributions of source code must retain the above copyright
+      notice, this list of conditions and the following disclaimer.
+   2. Redistributions in binary form must reproduce the above copyright
+      notice, this list of conditions and the following disclaimer in the
+      documentation and/or other materials provided with the distribution.
+
+   THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+   ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+   IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+   ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+   FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+   DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+   OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+   HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+   LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+   OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+   SUCH DAMAGE.
+
 random.c
 
   This file is under the new-style BSD license.
@@ -92,11 +224,11 @@ random.c
     This is a faster version by taking Shawn Cokus's optimization,
     Matthe Bellew's simplification, Isaku Wada's real version.
 
-    Before using, initialize the state by using init_genrand(seed) 
+    Before using, initialize the state by using init_genrand(seed)
     or init_by_array(init_key, key_length).
 
     Copyright (C) 1997 - 2002, Makoto Matsumoto and Takuji Nishimura,
-    All rights reserved.                          
+    All rights reserved.
 
     Redistribution and use in source and binary forms, with or without
     modification, are permitted provided that the following conditions
@@ -109,8 +241,8 @@ random.c
 	 notice, this list of conditions and the following disclaimer in the
 	 documentation and/or other materials provided with the distribution.
 
-      3. The names of its contributors may not be used to endorse or promote 
-	 products derived from this software without specific prior written 
+      3. The names of its contributors may not be used to endorse or promote
+	 products derived from this software without specific prior written
 	 permission.
 
     THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS
@@ -130,72 +262,139 @@ random.c
     http://www.math.keio.ac.jp/matumoto/emt.html
     email: matumoto@math.keio.ac.jp
 
+vm_dump.c:procstat_vm
+
+  This file is under the new-style BSD license.
+
+    Copyright (c) 2007 Robert N. M. Watson
+    All rights reserved.
+
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+
+    THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
+
+    $FreeBSD: head/usr.bin/procstat/procstat_vm.c 261780 2014-02-11 21:57:37Z jhb $
+
+vsnprintf.c:
+
+  This file is under the old-style BSD license.  Note that the
+  paragraph 3 below is now null and void.
+
+    Copyright (c) 1990, 1993
+         The Regents of the University of California.  All rights reserved.
+
+    This code is derived from software contributed to Berkeley by
+    Chris Torek.
+
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+    3. Neither the name of the University nor the names of its contributors
+       may be used to endorse or promote products derived from this software
+       without specific prior written permission.
+
+    THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
+
+    IMPORTANT NOTE:
+    --------------
+    From ftp://ftp.cs.berkeley.edu/pub/4bsd/README.Impt.License.Change
+    paragraph 3 above is now null and void.
+
 st.[ch]:
-x68/*:
 missing/alloca.c:
 missing/dup2.c:
+missing/erf.c:
 missing/finite.c:
 missing/hypot.c:
 missing/isinf.c:
 missing/isnan.c:
+missing/lgamma_r.c:
 missing/memcmp.c:
 missing/memmove.c:
-missing/strcasecmp.c:
 missing/strchr.c:
-missing/streror.c:
-missing/strftime.c:
-missing/strncasecmp.c:
 missing/strstr.c:
 missing/strtol.c:
+missing/tgamma.c:
 ext/digest/sha1/sha1.[ch]:
 
   These files are all under public domain.
 
-missing/strtod.c:
-
-  This file will not be used on most platforms depending on how the
-  configure script results.  In any case you must not receive any fee
-  with the file itself.
-
-    Copyright (c) 1988-1993 The Regents of the University of California.
-    Copyright (c) 1994 Sun Microsystems, Inc.
+missing/crypt.c:
 
-    Permission to use, copy, modify, and distribute this
-    software and its documentation for any purpose and without
-    fee is hereby granted, provided that the above copyright
-    notice appear in all copies.  The University of California
-    makes no representations about the suitability of this
-    software for any purpose.  It is provided "as is" without
-    express or implied warranty.
+  This file is under the old-style BSD license.  Note that the
+  paragraph 3 below is now null and void.
 
-missing/strtoul.c:
+    Copyright (c) 1989, 1993
+    	The Regents of the University of California.  All rights reserved.
 
-  This file will not be used on most platforms depending on how the
-  configure script results.  In any case you must not receive any fee
-  with the file itself.
+    This code is derived from software contributed to Berkeley by
+    Tom Truscott.
 
-    Copyright 1988 Regents of the University of California
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+    3. Neither the name of the University nor the names of its contributors
+       may be used to endorse or promote products derived from this software
+       without specific prior written permission.
 
-    Permission to use, copy, modify, and distribute this
-    software and its documentation for any purpose and without
-    fee is hereby granted, provided that the above copyright
-    notice appear in all copies.  The University of California
-    makes no representations about the suitability of this
-    software for any purpose.  It is provided "as is" without
-    express or implied warranty.
+    THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
 
-missing/erf.c:
-missing/crypt.c:
-missing/vsnprintf.c:
+missing/setproctitle.c
 
   This file is under the old-style BSD license.  Note that the
   paragraph 3 below is now null and void.
 
-    Copyright (c) 1990, 1993
-         The Regents of the University of California.  All rights reserved.
-
-    This code is derived from software contributed to Berkeley by
-    Chris Torek.
+    Copyright 2003 Damien Miller
+    Copyright (c) 1983, 1995-1997 Eric P. Allman
+    Copyright (c) 1988, 1993
+    	The Regents of the University of California.  All rights reserved.
 
     Redistribution and use in source and binary forms, with or without
     modification, are permitted provided that the following conditions
@@ -221,10 +420,46 @@ missing/vsnprintf.c:
     OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
     SUCH DAMAGE.
 
-    IMPORTANT NOTE:
-    --------------
-    From ftp://ftp.cs.berkeley.edu/pub/4bsd/README.Impt.License.Change
-    paragraph 3 above is now null and void.
+missing/strlcat.c
+missing/strlcpy.c
+
+  These files are under the new-style BSD license.
+
+    Copyright (c) 1998 Todd C. Miller <Todd.Miller@courtesan.com>
+    All rights reserved.
+
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+    3. The name of the author may not be used to endorse or promote products
+       derived from this software without specific prior written permission.
+
+    THIS SOFTWARE IS PROVIDED ``AS IS'' AND ANY EXPRESS OR IMPLIED WARRANTIES,
+    INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY
+    AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED.  IN NO EVENT SHALL
+    THE AUTHOR BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
+    EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
+    PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS;
+    OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY,
+    WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR
+    OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF
+    ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.
+
+missing/langinfo.c
+
+  This file is from http://www.cl.cam.ac.uk/~mgk25/ucs/langinfo.c.
+  Ruby uses a modified version. The file contains the following
+  author/copyright notice:
+
+  Markus.Kuhn@cl.cam.ac.uk -- 2002-03-11
+  Permission to use, copy, modify, and distribute this software
+  for any purpose and without fee is hereby granted. The author
+  disclaims all warranties with regard to this software.
 
 ext/digest/md5/md5.[ch]:
 
@@ -264,18 +499,7 @@ ext/digest/rmd160/rmd160.[ch]:
     Copyright (c) Katholieke Universiteit Leuven
     1996, All Rights Reserved
 
-ext/digest/rmd160/rmd160hl.c:
-ext/digest/sha1/sha1hl.c:
-
-  These files are under the beer-ware license.
-
-    "THE BEER-WARE LICENSE" (Revision 42):
-    <phk@login.dkuug.dk> wrote this file.  As long as you retain this notice you
-    can do whatever you want with this stuff. If we meet some day, and you think
-    this stuff is worth it, you can buy me a beer in return.   Poul-Henning Kamp
-
 ext/digest/sha2/sha2.[ch]:
-ext/digest/sha2/sha2hl.c:
 
   These files are under the new-style BSD license.
 
@@ -313,7 +537,7 @@ ext/nkf/nkf-utf8/utf8tbl.c:
   copyrighted semi-public-domain software.
 
     Copyright (C) 1987, Fujitsu LTD. (Itaru ICHIKAWA)
-       Everyone is permitted to do anything on this program 
+       Everyone is permitted to do anything on this program
        including copying, modifying, improving,
        as long as you don't try to pretend that you wrote it.
        i.e., the above copyright notice has to appear in all copies.
@@ -364,7 +588,7 @@ ext/win32ole/win32ole.c:
 
     Other modifications Copyright (c) 1997, 1998 by Gurusamy Sarathy
     <gsar@umich.edu> and Jan Dubois <jan.dubois@ibm.net>
- 
+
     You may distribute under the terms of either the GNU General Public
     License or the Artistic License, as specified in the README file
     of the Perl distribution.
diff --git a/LGPL b/LGPL
deleted file mode 100644
index b1e3f5a263..0000000000
--- a/LGPL
+++ /dev/null
@@ -1,504 +0,0 @@
-		  GNU LESSER GENERAL PUBLIC LICENSE
-		       Version 2.1, February 1999
-
- Copyright (C) 1991, 1999 Free Software Foundation, Inc.
-     59 Temple Place, Suite 330, Boston, MA  02111-1307  USA
- Everyone is permitted to copy and distribute verbatim copies
- of this license document, but changing it is not allowed.
-
-[This is the first released version of the Lesser GPL.  It also counts
- as the successor of the GNU Library Public License, version 2, hence
- the version number 2.1.]
-
-			    Preamble
-
-  The licenses for most software are designed to take away your
-freedom to share and change it.  By contrast, the GNU General Public
-Licenses are intended to guarantee your freedom to share and change
-free software--to make sure the software is free for all its users.
-
-  This license, the Lesser General Public License, applies to some
-specially designated software packages--typically libraries--of the
-Free Software Foundation and other authors who decide to use it.  You
-can use it too, but we suggest you first think carefully about whether
-this license or the ordinary General Public License is the better
-strategy to use in any particular case, based on the explanations below.
-
-  When we speak of free software, we are referring to freedom of use,
-not price.  Our General Public Licenses are designed to make sure that
-you have the freedom to distribute copies of free software (and charge
-for this service if you wish); that you receive source code or can get
-it if you want it; that you can change the software and use pieces of
-it in new free programs; and that you are informed that you can do
-these things.
-
-  To protect your rights, we need to make restrictions that forbid
-distributors to deny you these rights or to ask you to surrender these
-rights.  These restrictions translate to certain responsibilities for
-you if you distribute copies of the library or if you modify it.
-
-  For example, if you distribute copies of the library, whether gratis
-or for a fee, you must give the recipients all the rights that we gave
-you.  You must make sure that they, too, receive or can get the source
-code.  If you link other code with the library, you must provide
-complete object files to the recipients, so that they can relink them
-with the library after making changes to the library and recompiling
-it.  And you must show them these terms so they know their rights.
-
-  We protect your rights with a two-step method: (1) we copyright the
-library, and (2) we offer you this license, which gives you legal
-permission to copy, distribute and/or modify the library.
-
-  To protect each distributor, we want to make it very clear that
-there is no warranty for the free library.  Also, if the library is
-modified by someone else and passed on, the recipients should know
-that what they have is not the original version, so that the original
-author's reputation will not be affected by problems that might be
-introduced by others.
-
-  Finally, software patents pose a constant threat to the existence of
-any free program.  We wish to make sure that a company cannot
-effectively restrict the users of a free program by obtaining a
-restrictive license from a patent holder.  Therefore, we insist that
-any patent license obtained for a version of the library must be
-consistent with the full freedom of use specified in this license.
-
-  Most GNU software, including some libraries, is covered by the
-ordinary GNU General Public License.  This license, the GNU Lesser
-General Public License, applies to certain designated libraries, and
-is quite different from the ordinary General Public License.  We use
-this license for certain libraries in order to permit linking those
-libraries into non-free programs.
-
-  When a program is linked with a library, whether statically or using
-a shared library, the combination of the two is legally speaking a
-combined work, a derivative of the original library.  The ordinary
-General Public License therefore permits such linking only if the
-entire combination fits its criteria of freedom.  The Lesser General
-Public License permits more lax criteria for linking other code with
-the library.
-
-  We call this license the "Lesser" General Public License because it
-does Less to protect the user's freedom than the ordinary General
-Public License.  It also provides other free software developers Less
-of an advantage over competing non-free programs.  These disadvantages
-are the reason we use the ordinary General Public License for many
-libraries.  However, the Lesser license provides advantages in certain
-special circumstances.
-
-  For example, on rare occasions, there may be a special need to
-encourage the widest possible use of a certain library, so that it becomes
-a de-facto standard.  To achieve this, non-free programs must be
-allowed to use the library.  A more frequent case is that a free
-library does the same job as widely used non-free libraries.  In this
-case, there is little to gain by limiting the free library to free
-software only, so we use the Lesser General Public License.
-
-  In other cases, permission to use a particular library in non-free
-programs enables a greater number of people to use a large body of
-free software.  For example, permission to use the GNU C Library in
-non-free programs enables many more people to use the whole GNU
-operating system, as well as its variant, the GNU/Linux operating
-system.
-
-  Although the Lesser General Public License is Less protective of the
-users' freedom, it does ensure that the user of a program that is
-linked with the Library has the freedom and the wherewithal to run
-that program using a modified version of the Library.
-
-  The precise terms and conditions for copying, distribution and
-modification follow.  Pay close attention to the difference between a
-"work based on the library" and a "work that uses the library".  The
-former contains code derived from the library, whereas the latter must
-be combined with the library in order to run.
-
-		  GNU LESSER GENERAL PUBLIC LICENSE
-   TERMS AND CONDITIONS FOR COPYING, DISTRIBUTION AND MODIFICATION
-
-  0. This License Agreement applies to any software library or other
-program which contains a notice placed by the copyright holder or
-other authorized party saying it may be distributed under the terms of
-this Lesser General Public License (also called "this License").
-Each licensee is addressed as "you".
-
-  A "library" means a collection of software functions and/or data
-prepared so as to be conveniently linked with application programs
-(which use some of those functions and data) to form executables.
-
-  The "Library", below, refers to any such software library or work
-which has been distributed under these terms.  A "work based on the
-Library" means either the Library or any derivative work under
-copyright law: that is to say, a work containing the Library or a
-portion of it, either verbatim or with modifications and/or translated
-straightforwardly into another language.  (Hereinafter, translation is
-included without limitation in the term "modification".)
-
-  "Source code" for a work means the preferred form of the work for
-making modifications to it.  For a library, complete source code means
-all the source code for all modules it contains, plus any associated
-interface definition files, plus the scripts used to control compilation
-and installation of the library.
-
-  Activities other than copying, distribution and modification are not
-covered by this License; they are outside its scope.  The act of
-running a program using the Library is not restricted, and output from
-such a program is covered only if its contents constitute a work based
-on the Library (independent of the use of the Library in a tool for
-writing it).  Whether that is true depends on what the Library does
-and what the program that uses the Library does.
-  
-  1. You may copy and distribute verbatim copies of the Library's
-complete source code as you receive it, in any medium, provided that
-you conspicuously and appropriately publish on each copy an
-appropriate copyright notice and disclaimer of warranty; keep intact
-all the notices that refer to this License and to the absence of any
-warranty; and distribute a copy of this License along with the
-Library.
-
-  You may charge a fee for the physical act of transferring a copy,
-and you may at your option offer warranty protection in exchange for a
-fee.
-
-  2. You may modify your copy or copies of the Library or any portion
-of it, thus forming a work based on the Library, and copy and
-distribute such modifications or work under the terms of Section 1
-above, provided that you also meet all of these conditions:
-
-    a) The modified work must itself be a software library.
-
-    b) You must cause the files modified to carry prominent notices
-    stating that you changed the files and the date of any change.
-
-    c) You must cause the whole of the work to be licensed at no
-    charge to all third parties under the terms of this License.
-
-    d) If a facility in the modified Library refers to a function or a
-    table of data to be supplied by an application program that uses
-    the facility, other than as an argument passed when the facility
-    is invoked, then you must make a good faith effort to ensure that,
-    in the event an application does not supply such function or
-    table, the facility still operates, and performs whatever part of
-    its purpose remains meaningful.
-
-    (For example, a function in a library to compute square roots has
-    a purpose that is entirely well-defined independent of the
-    application.  Therefore, Subsection 2d requires that any
-    application-supplied function or table used by this function must
-    be optional: if the application does not supply it, the square
-    root function must still compute square roots.)
-
-These requirements apply to the modified work as a whole.  If
-identifiable sections of that work are not derived from the Library,
-and can be reasonably considered independent and separate works in
-themselves, then this License, and its terms, do not apply to those
-sections when you distribute them as separate works.  But when you
-distribute the same sections as part of a whole which is a work based
-on the Library, the distribution of the whole must be on the terms of
-this License, whose permissions for other licensees extend to the
-entire whole, and thus to each and every part regardless of who wrote
-it.
-
-Thus, it is not the intent of this section to claim rights or contest
-your rights to work written entirely by you; rather, the intent is to
-exercise the right to control the distribution of derivative or
-collective works based on the Library.
-
-In addition, mere aggregation of another work not based on the Library
-with the Library (or with a work based on the Library) on a volume of
-a storage or distribution medium does not bring the other work under
-the scope of this License.
-
-  3. You may opt to apply the terms of the ordinary GNU General Public
-License instead of this License to a given copy of the Library.  To do
-this, you must alter all the notices that refer to this License, so
-that they refer to the ordinary GNU General Public License, version 2,
-instead of to this License.  (If a newer version than version 2 of the
-ordinary GNU General Public License has appeared, then you can specify
-that version instead if you wish.)  Do not make any other change in
-these notices.
-
-  Once this change is made in a given copy, it is irreversible for
-that copy, so the ordinary GNU General Public License applies to all
-subsequent copies and derivative works made from that copy.
-
-  This option is useful when you wish to copy part of the code of
-the Library into a program that is not a library.
-
-  4. You may copy and distribute the Library (or a portion or
-derivative of it, under Section 2) in object code or executable form
-under the terms of Sections 1 and 2 above provided that you accompany
-it with the complete corresponding machine-readable source code, which
-must be distributed under the terms of Sections 1 and 2 above on a
-medium customarily used for software interchange.
-
-  If distribution of object code is made by offering access to copy
-from a designated place, then offering equivalent access to copy the
-source code from the same place satisfies the requirement to
-distribute the source code, even though third parties are not
-compelled to copy the source along with the object code.
-
-  5. A program that contains no derivative of any portion of the
-Library, but is designed to work with the Library by being compiled or
-linked with it, is called a "work that uses the Library".  Such a
-work, in isolation, is not a derivative work of the Library, and
-therefore falls outside the scope of this License.
-
-  However, linking a "work that uses the Library" with the Library
-creates an executable that is a derivative of the Library (because it
-contains portions of the Library), rather than a "work that uses the
-library".  The executable is therefore covered by this License.
-Section 6 states terms for distribution of such executables.
-
-  When a "work that uses the Library" uses material from a header file
-that is part of the Library, the object code for the work may be a
-derivative work of the Library even though the source code is not.
-Whether this is true is especially significant if the work can be
-linked without the Library, or if the work is itself a library.  The
-threshold for this to be true is not precisely defined by law.
-
-  If such an object file uses only numerical parameters, data
-structure layouts and accessors, and small macros and small inline
-functions (ten lines or less in length), then the use of the object
-file is unrestricted, regardless of whether it is legally a derivative
-work.  (Executables containing this object code plus portions of the
-Library will still fall under Section 6.)
-
-  Otherwise, if the work is a derivative of the Library, you may
-distribute the object code for the work under the terms of Section 6.
-Any executables containing that work also fall under Section 6,
-whether or not they are linked directly with the Library itself.
-
-  6. As an exception to the Sections above, you may also combine or
-link a "work that uses the Library" with the Library to produce a
-work containing portions of the Library, and distribute that work
-under terms of your choice, provided that the terms permit
-modification of the work for the customer's own use and reverse
-engineering for debugging such modifications.
-
-  You must give prominent notice with each copy of the work that the
-Library is used in it and that the Library and its use are covered by
-this License.  You must supply a copy of this License.  If the work
-during execution displays copyright notices, you must include the
-copyright notice for the Library among them, as well as a reference
-directing the user to the copy of this License.  Also, you must do one
-of these things:
-
-    a) Accompany the work with the complete corresponding
-    machine-readable source code for the Library including whatever
-    changes were used in the work (which must be distributed under
-    Sections 1 and 2 above); and, if the work is an executable linked
-    with the Library, with the complete machine-readable "work that
-    uses the Library", as object code and/or source code, so that the
-    user can modify the Library and then relink to produce a modified
-    executable containing the modified Library.  (It is understood
-    that the user who changes the contents of definitions files in the
-    Library will not necessarily be able to recompile the application
-    to use the modified definitions.)
-
-    b) Use a suitable shared library mechanism for linking with the
-    Library.  A suitable mechanism is one that (1) uses at run time a
-    copy of the library already present on the user's computer system,
-    rather than copying library functions into the executable, and (2)
-    will operate properly with a modified version of the library, if
-    the user installs one, as long as the modified version is
-    interface-compatible with the version that the work was made with.
-
-    c) Accompany the work with a written offer, valid for at
-    least three years, to give the same user the materials
-    specified in Subsection 6a, above, for a charge no more
-    than the cost of performing this distribution.
-
-    d) If distribution of the work is made by offering access to copy
-    from a designated place, offer equivalent access to copy the above
-    specified materials from the same place.
-
-    e) Verify that the user has already received a copy of these
-    materials or that you have already sent this user a copy.
-
-  For an executable, the required form of the "work that uses the
-Library" must include any data and utility programs needed for
-reproducing the executable from it.  However, as a special exception,
-the materials to be distributed need not include anything that is
-normally distributed (in either source or binary form) with the major
-components (compiler, kernel, and so on) of the operating system on
-which the executable runs, unless that component itself accompanies
-the executable.
-
-  It may happen that this requirement contradicts the license
-restrictions of other proprietary libraries that do not normally
-accompany the operating system.  Such a contradiction means you cannot
-use both them and the Library together in an executable that you
-distribute.
-
-  7. You may place library facilities that are a work based on the
-Library side-by-side in a single library together with other library
-facilities not covered by this License, and distribute such a combined
-library, provided that the separate distribution of the work based on
-the Library and of the other library facilities is otherwise
-permitted, and provided that you do these two things:
-
-    a) Accompany the combined library with a copy of the same work
-    based on the Library, uncombined with any other library
-    facilities.  This must be distributed under the terms of the
-    Sections above.
-
-    b) Give prominent notice with the combined library of the fact
-    that part of it is a work based on the Library, and explaining
-    where to find the accompanying uncombined form of the same work.
-
-  8. You may not copy, modify, sublicense, link with, or distribute
-the Library except as expressly provided under this License.  Any
-attempt otherwise to copy, modify, sublicense, link with, or
-distribute the Library is void, and will automatically terminate your
-rights under this License.  However, parties who have received copies,
-or rights, from you under this License will not have their licenses
-terminated so long as such parties remain in full compliance.
-
-  9. You are not required to accept this License, since you have not
-signed it.  However, nothing else grants you permission to modify or
-distribute the Library or its derivative works.  These actions are
-prohibited by law if you do not accept this License.  Therefore, by
-modifying or distributing the Library (or any work based on the
-Library), you indicate your acceptance of this License to do so, and
-all its terms and conditions for copying, distributing or modifying
-the Library or works based on it.
-
-  10. Each time you redistribute the Library (or any work based on the
-Library), the recipient automatically receives a license from the
-original licensor to copy, distribute, link with or modify the Library
-subject to these terms and conditions.  You may not impose any further
-restrictions on the recipients' exercise of the rights granted herein.
-You are not responsible for enforcing compliance by third parties with
-this License.
-
-  11. If, as a consequence of a court judgment or allegation of patent
-infringement or for any other reason (not limited to patent issues),
-conditions are imposed on you (whether by court order, agreement or
-otherwise) that contradict the conditions of this License, they do not
-excuse you from the conditions of this License.  If you cannot
-distribute so as to satisfy simultaneously your obligations under this
-License and any other pertinent obligations, then as a consequence you
-may not distribute the Library at all.  For example, if a patent
-license would not permit royalty-free redistribution of the Library by
-all those who receive copies directly or indirectly through you, then
-the only way you could satisfy both it and this License would be to
-refrain entirely from distribution of the Library.
-
-If any portion of this section is held invalid or unenforceable under any
-particular circumstance, the balance of the section is intended to apply,
-and the section as a whole is intended to apply in other circumstances.
-
-It is not the purpose of this section to induce you to infringe any
-patents or other property right claims or to contest validity of any
-such claims; this section has the sole purpose of protecting the
-integrity of the free software distribution system which is
-implemented by public license practices.  Many people have made
-generous contributions to the wide range of software distributed
-through that system in reliance on consistent application of that
-system; it is up to the author/donor to decide if he or she is willing
-to distribute software through any other system and a licensee cannot
-impose that choice.
-
-This section is intended to make thoroughly clear what is believed to
-be a consequence of the rest of this License.
-
-  12. If the distribution and/or use of the Library is restricted in
-certain countries either by patents or by copyrighted interfaces, the
-original copyright holder who places the Library under this License may add
-an explicit geographical distribution limitation excluding those countries,
-so that distribution is permitted only in or among countries not thus
-excluded.  In such case, this License incorporates the limitation as if
-written in the body of this License.
-
-  13. The Free Software Foundation may publish revised and/or new
-versions of the Lesser General Public License from time to time.
-Such new versions will be similar in spirit to the present version,
-but may differ in detail to address new problems or concerns.
-
-Each version is given a distinguishing version number.  If the Library
-specifies a version number of this License which applies to it and
-"any later version", you have the option of following the terms and
-conditions either of that version or of any later version published by
-the Free Software Foundation.  If the Library does not specify a
-license version number, you may choose any version ever published by
-the Free Software Foundation.
-
-  14. If you wish to incorporate parts of the Library into other free
-programs whose distribution conditions are incompatible with these,
-write to the author to ask for permission.  For software which is
-copyrighted by the Free Software Foundation, write to the Free
-Software Foundation; we sometimes make exceptions for this.  Our
-decision will be guided by the two goals of preserving the free status
-of all derivatives of our free software and of promoting the sharing
-and reuse of software generally.
-
-			    NO WARRANTY
-
-  15. BECAUSE THE LIBRARY IS LICENSED FREE OF CHARGE, THERE IS NO
-WARRANTY FOR THE LIBRARY, TO THE EXTENT PERMITTED BY APPLICABLE LAW.
-EXCEPT WHEN OTHERWISE STATED IN WRITING THE COPYRIGHT HOLDERS AND/OR
-OTHER PARTIES PROVIDE THE LIBRARY "AS IS" WITHOUT WARRANTY OF ANY
-KIND, EITHER EXPRESSED OR IMPLIED, INCLUDING, BUT NOT LIMITED TO, THE
-IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
-PURPOSE.  THE ENTIRE RISK AS TO THE QUALITY AND PERFORMANCE OF THE
-LIBRARY IS WITH YOU.  SHOULD THE LIBRARY PROVE DEFECTIVE, YOU ASSUME
-THE COST OF ALL NECESSARY SERVICING, REPAIR OR CORRECTION.
-
-  16. IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN
-WRITING WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MAY MODIFY
-AND/OR REDISTRIBUTE THE LIBRARY AS PERMITTED ABOVE, BE LIABLE TO YOU
-FOR DAMAGES, INCLUDING ANY GENERAL, SPECIAL, INCIDENTAL OR
-CONSEQUENTIAL DAMAGES ARISING OUT OF THE USE OR INABILITY TO USE THE
-LIBRARY (INCLUDING BUT NOT LIMITED TO LOSS OF DATA OR DATA BEING
-RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU OR THIRD PARTIES OR A
-FAILURE OF THE LIBRARY TO OPERATE WITH ANY OTHER SOFTWARE), EVEN IF
-SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE POSSIBILITY OF SUCH
-DAMAGES.
-
-		     END OF TERMS AND CONDITIONS
-
-           How to Apply These Terms to Your New Libraries
-
-  If you develop a new library, and you want it to be of the greatest
-possible use to the public, we recommend making it free software that
-everyone can redistribute and change.  You can do so by permitting
-redistribution under these terms (or, alternatively, under the terms of the
-ordinary General Public License).
-
-  To apply these terms, attach the following notices to the library.  It is
-safest to attach them to the start of each source file to most effectively
-convey the exclusion of warranty; and each file should have at least the
-"copyright" line and a pointer to where the full notice is found.
-
-    <one line to give the library's name and a brief idea of what it does.>
-    Copyright (C) <year>  <name of author>
-
-    This library is free software; you can redistribute it and/or
-    modify it under the terms of the GNU Lesser General Public
-    License as published by the Free Software Foundation; either
-    version 2.1 of the License, or (at your option) any later version.
-
-    This library is distributed in the hope that it will be useful,
-    but WITHOUT ANY WARRANTY; without even the implied warranty of
-    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the GNU
-    Lesser General Public License for more details.
-
-    You should have received a copy of the GNU Lesser General Public
-    License along with this library; if not, write to the Free Software
-    Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA  02111-1307  USA
-
-Also add information on how to contact you by electronic and paper mail.
-
-You should also get your employer (if you work as a programmer) or your
-school, if any, to sign a "copyright disclaimer" for the library, if
-necessary.  Here is a sample; alter the names:
-
-  Yoyodyne, Inc., hereby disclaims all copyright interest in the
-  library `Frob' (a library for tweaking knobs) written by James Random Hacker.
-
-  <signature of Ty Coon>, 1 April 1990
-  Ty Coon, President of Vice
-
-That's all there is to it!
-
-
diff --git a/Makefile.in b/Makefile.in
index 314e1ed256..ff475091ab 100644
--- a/Makefile.in
+++ b/Makefile.in
@@ -1,17 +1,35 @@
 SHELL = /bin/sh
-NULLCMD = :
+NULLCMD = @NULLCMD@
+n=$(NULLCMD)
+ECHO1 = $(V:1=$n)
+RUNCMD = $(SHELL)
+CDPATH = .
+CHDIR = @CHDIR@
+exec = exec
+NULL = /dev/null
+PATH_SEPARATOR = @PATH_SEPARATOR@
 
 #### Start of system configuration section. ####
 
 srcdir = @srcdir@
-VPATH = $(srcdir):$(srcdir)/missing
+top_srcdir = $(srcdir)
+hdrdir = $(srcdir)/include
+PLATFORM_DIR = @PLATFORM_DIR@
 
 CC = @CC@
-YACC = @YACC@
+CPP = @CPP@
+LD = @LD@
+YACC = bison
 PURIFY =
 AUTOCONF = autoconf
+CONFIGURE = @CONFIGURE@
 @SET_MAKE@
 MKFILES = @MAKEFILES@
+BASERUBY = @BASERUBY@
+HAVE_BASERUBY = @HAVE_BASERUBY@
+TEST_RUNNABLE = @TEST_RUNNABLE@
+CROSS_COMPILING = @CROSS_COMPILING@
+DOXYGEN = @DOXYGEN@
 
 prefix = @prefix@
 exec_prefix = @exec_prefix@
@@ -24,37 +42,79 @@ datadir = @datadir@
 arch = @arch@
 sitearch = @sitearch@
 sitedir = @sitedir@
+archlibdir = @archlibdir@
+ruby_version = @ruby_version@
 
 TESTUI = console
 TESTS =
-RDOCTARGET = @RDOCTARGET@
+INSTALLDOC = @INSTALLDOC@
+DOCTARGETS = @RDOCTARGET@ @CAPITARGET@
 
 EXTOUT = @EXTOUT@
-RIDATADIR = $(DESTDIR)$(datadir)/ri/$(MAJOR).$(MINOR)/system
+arch_hdrdir = $(EXTOUT)/include/$(arch)
+VPATH = $(arch_hdrdir)/ruby:$(hdrdir)/ruby:$(srcdir):$(srcdir)/missing
 
 empty =
+CC_VERSION = @CC_VERSION@
 OUTFLAG = @OUTFLAG@$(empty)
-CFLAGS = @CFLAGS@ @XCFLAGS@ @ARCH_FLAG@
-CPPFLAGS = -I. -I$(srcdir) @CPPFLAGS@
+COUTFLAG = @COUTFLAG@$(empty)
+ARCH_FLAG = @ARCH_FLAG@
+CFLAGS_NO_ARCH = @CFLAGS@
+CFLAGS = $(CFLAGS_NO_ARCH) $(ARCH_FLAG)
+cflags = @cflags@
+optflags = @optflags@
+debugflags = @debugflags@
+warnflags = @warnflags@ @strict_warnflags@
+cppflags = @cppflags@
+INCFLAGS = -I. -I$(arch_hdrdir) -I$(hdrdir) -I$(srcdir)
+XCFLAGS = @XCFLAGS@
+CPPFLAGS = @CPPFLAGS@ $(INCFLAGS)
 LDFLAGS = @STATIC@ $(CFLAGS) @LDFLAGS@
-EXTLDFLAGS = 
+EXTLDFLAGS = @EXTLDFLAGS@
 XLDFLAGS = @XLDFLAGS@ $(EXTLDFLAGS)
-EXTLIBS = 
+EXTLIBS =
 LIBS = @LIBS@ $(EXTLIBS)
 MISSING = @LIBOBJS@ @ALLOCA@
 LDSHARED = @LIBRUBY_LDSHARED@
-DLDFLAGS = @LIBRUBY_DLDFLAGS@ $(EXTLDFLAGS) @ARCH_FLAG@
+DLDFLAGS = @LIBRUBY_DLDFLAGS@ $(XLDFLAGS) $(ARCH_FLAG)
 SOLIBS = @SOLIBS@
 MAINLIBS = @MAINLIBS@
-MINIOBJS = @MINIOBJS@
-
+ARCHMINIOBJS = @MINIOBJS@
+DLNOBJ = @DLNOBJ@
+ENCOBJS = @ENCOBJS@
+EXTOBJS = @EXTOBJS@
+BUILTIN_ENCOBJS = @BUILTIN_ENCOBJS@
+BUILTIN_TRANSSRCS = @BUILTIN_TRANSSRCS@
+BUILTIN_TRANSOBJS = @BUILTIN_TRANSOBJS@
+POSTLINK = @POSTLINK@
+
+RUBY_BASE_NAME=@RUBY_BASE_NAME@
+RUBY_PROGRAM_VERSION=@RUBY_PROGRAM_VERSION@
 RUBY_INSTALL_NAME=@RUBY_INSTALL_NAME@
 RUBY_SO_NAME=@RUBY_SO_NAME@
 EXEEXT = @EXEEXT@
+LIBEXT = @LIBEXT@
 PROGRAM=$(RUBY_INSTALL_NAME)$(EXEEXT)
 RUBY = $(RUBY_INSTALL_NAME)
-MINIRUBY = @MINIRUBY@ $(MINIRUBYOPT)
-RUNRUBY = @RUNRUBY@
+MINIRUBY = @MINIRUBY@\
+	$(MINIRUBYOPT)
+# RUNRUBY_COMMAND:: runruby.rb or baseruby. do not append options directly
+RUNRUBY_COMMAND = @RUNRUBY_COMMAND@
+# RUNRUBY:: run ruby with RUN_OPTS which is passed to ruby
+RUNRUBY = @RUNRUBY@ $(RUN_OPTS)
+# RUNRUBY_DEBUGGER:: debugging option for runruby.rb
+RUNRUBY_DEBUGGER = --debugger='gdb -x run.gdb --quiet --args'
+XRUBY = @XRUBY@
+BTESTRUBY = @BTESTRUBY@\
+	$(MINIRUBYOPT)
+INSTALL = @INSTALL@
+INSTALL_DATA = @INSTALL_DATA@
+INSTALL_SCRIPT = @INSTALL_SCRIPT@
+INSTALL_PROGRAM = @INSTALL_PROGRAM@
+XRUBY_LIBDIR = @XRUBY_LIBDIR@
+XRUBY_RUBYLIBDIR = @XRUBY_RUBYLIBDIR@
+XRUBY_RUBYHDRDIR = @XRUBY_RUBYHDRDIR@
+BOOTSTRAPRUBY = @BOOTSTRAPRUBY@
 
 #### End of system configuration section. ####
 
@@ -69,112 +129,426 @@ LIBRUBY	      = @LIBRUBY@
 LIBRUBYARG    = @LIBRUBYARG@
 LIBRUBYARG_STATIC = @LIBRUBYARG_STATIC@
 LIBRUBYARG_SHARED = @LIBRUBYARG_SHARED@
+LIBRUBY_RELATIVE = @LIBRUBY_RELATIVE@
+LIBRUBY_A_OBJS = @LIBRUBY_A_OBJS@
+
+DTRACE_REBUILD_OBJS = $(DTRACE_REBUILD:yes=$(DTRACE_DEPENDENT_OBJS))
+
+DTRACE_DEPENDENT_OBJS = array.$(OBJEXT) \
+			eval.$(OBJEXT) \
+			gc.$(OBJEXT) \
+			hash.$(OBJEXT) \
+			load.$(OBJEXT) \
+			object.$(OBJEXT) \
+			parse.$(OBJEXT) \
+			string.$(OBJEXT) \
+			symbol.$(OBJEXT) \
+			vm.$(OBJEXT)
+
+THREAD_MODEL  = @THREAD_MODEL@
 
 PREP          = @PREP@
 ARCHFILE      = @ARCHFILE@
 SETUP         =
 EXTSTATIC     = @EXTSTATIC@
+ENCSTATIC     = @ENCSTATIC@
+SET_LC_MESSAGES = env LC_MESSAGES=C
 
+MAKEDIRS      = @MKDIR_P@
+CP            = cp
+MV            = mv
 RM            = rm -f
+RMDIR         = @RMDIR@
+RMDIRS        = @RMDIRS@
+RMALL         = @RMALL@
 NM            = @NM@
 AR            = @AR@
 ARFLAGS       = rcu
 RANLIB        = @RANLIB@
 AS            = @AS@
-ASFLAGS       = @ASFLAGS@
+ASFLAGS       = @ASFLAGS@ $(INCFLAGS)
+IFCHANGE      = $(srcdir)/tool/ifchange
+SET_LC_MESSAGES = env LC_MESSAGES=C
+OBJDUMP       = @OBJDUMP@
+OBJCOPY       = @OBJCOPY@
+VCS           = @VCS@
+VCSUP         = @VCSUP@
+DTRACE        = @DTRACE@
+DTRACE_EXT    = @DTRACE_EXT@
+DTRACE_OBJ    = @DTRACE_OBJ@
+DTRACE_REBUILD= @DTRACE_REBUILD@
+DTRACE_GLOMMED_OBJ = $(DTRACE_REBUILD:yes=ruby-glommed.$(OBJEXT))
 
 OBJEXT        = @OBJEXT@
+ASMEXT        = S
+DLEXT         = @DLEXT@
 MANTYPE	      = @MANTYPE@
+SYMBOL_PREFIX = @SYMBOL_PREFIX@
 
 INSTALLED_LIST= .installed.list
+
+NEWLINE_C     = enc/trans/newline.c
+MINIPRELUDE_C = miniprelude.c
+PRELUDE_C     = prelude.c
+RBCONFIG      = .rbconfig.time
+
+SRC_FILE      = $<
+OS_SRC_FILE   = $<
+DEST_FILE     = $@
+OS_DEST_FILE  = $@
+
+MESSAGE_BEGIN = @for line in
+MESSAGE_END = ; do echo "$$line"; done
+ECHO_BEGIN = @sep=''; for word in
+ECHO_END = ; do echo @ECHO_N@ "$$sep'$$word'@ECHO_C@"; sep=' '; done; echo
+
+DESTDIR       = @DESTDIR@
+
+configure_args = @configure_args@
 #### End of variables
 
-all:
+.SUFFIXES: .inc .h .c .y .i .$(DTRACE_EXT)
 
-.DEFAULT: all
+all:
 
 # Prevent GNU make v3 from overflowing arg limit on SysV.
 .NOEXPORT:
 
 miniruby$(EXEEXT):
-		@$(RM) $@
-		$(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(MAINLIBS) $(MAINOBJ) $(MINIOBJS) $(LIBRUBY_A) $(LIBS) $(OUTFLAG)$@
+		@-if test -f $@; then $(MV) -f $@ $@.old; $(RM) $@.old; fi
+		$(ECHO) linking $@
+		$(Q) $(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(NORMALMAINOBJ) $(MINIOBJS) $(COMMONOBJS) $(MAINLIBS) $(LIBS) $(OUTFLAG)$@
 
 $(PROGRAM):
 		@$(RM) $@
-		$(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(MAINLIBS) $(MAINOBJ) $(EXTOBJS) $(LIBRUBYARG) $(LIBS) $(OUTFLAG)$@
+		$(ECHO) linking $@
+		$(Q) $(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ) $(EXTOBJS) $(LIBRUBYARG) $(MAINLIBS) $(LIBS) $(EXTLIBS) $(OUTFLAG)$@
+		$(Q) $(POSTLINK)
 
 # We must `rm' the library each time this rule is invoked because "updating" a
 # MAB library on Apple/NeXT (see --enable-fat-binary in configure) is not
 # supported.
 $(LIBRUBY_A):
 		@$(RM) $@
-		$(AR) $(ARFLAGS) $@ $(OBJS) $(DMYEXT)
+		$(ECHO) linking static-library $@
+		$(Q) $(AR) $(ARFLAGS) $@ $(LIBRUBY_A_OBJS) $(INITOBJS)
 		@-$(RANLIB) $@ 2> /dev/null || true
+		$(ECHO) verifying static-library $@
+		@$(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ) $(LIBRUBY_A) $(MAINLIBS) $(EXTLIBS) $(LIBS) $(OUTFLAG)conftest$(EXEEXT)
+		@$(RM) conftest$(EXEEXT) conftest.c
 
 $(LIBRUBY_SO):
 		@-$(PRE_LIBRUBY_UPDATE)
-		$(LDSHARED) $(DLDFLAGS) $(OBJS) $(DLDOBJS) $(SOLIBS) $(OUTFLAG)$@
-		@-$(MINIRUBY) -e 'ARGV.each{|link| File.delete link if File.exist? link; \
+		$(ECHO) linking shared-library $@
+		$(Q) $(LDSHARED) $(DLDFLAGS) $(OBJS) $(DLDOBJS) $(SOLIBS) $(EXTSOLIBS) $(OUTFLAG)$@
+		-$(Q) $(OBJCOPY) -w -L '$(SYMBOL_PREFIX)Init_*' -L '$(SYMBOL_PREFIX)ruby_static_id_*' \
+			-L '$(SYMBOL_PREFIX)*_threadptr_*' $@
+		$(Q) $(POSTLINK)
+		@-$(MINIRUBY) -e 'ARGV.each{|link| File.delete link rescue nil; \
 						  File.symlink "$(LIBRUBY_SO)", link}' \
 				$(LIBRUBY_ALIASES) || true
 
-fake.rb:	Makefile
-		@echo ' \
-		class Object; \
-		  CROSS_COMPILING = RUBY_PLATFORM; \
-		  remove_const :RUBY_PLATFORM; \
-		  remove_const :RUBY_VERSION; \
-		  RUBY_PLATFORM = "@arch@"; \
-		  RUBY_VERSION = "@MAJOR@.@MINOR@.@TEENY@"; \
-		end; \
-		if RUBY_PLATFORM =~ /mswin|bccwin|mingw/; \
-		  class File; \
-		    remove_const :ALT_SEPARATOR; \
-		    ALT_SEPARATOR = "\\"; \
-		  end; \
-		end; \
-		' > $@
-
-Makefile:	$(srcdir)/Makefile.in
-
-$(MKFILES): config.status $(srcdir)/common.mk
-		MAKE=$(MAKE) $(SHELL) ./config.status
-		@{ \
+ruby_pc = @ruby_pc@
+$(ruby_pc):
+		@./config.status --file=$@:$(srcdir)/template/ruby.pc.in
+
+ruby-runner.c: template/ruby-runner.c.in
+		@./config.status --file=$@:$(srcdir)/template/$(@F).in
+
+ruby-runner$(EXEEXT): ruby-runner.c
+	$(Q) $(PURIFY) $(CC) $(CFLAGS) $(CPPFLAGS) -DRUBY_INSTALL_NAME=$(RUBY_INSTALL_NAME) $(LDFLAGS) $(LIBS) $(OUTFLAG)$@ ruby-runner.c
+
+$(RBCONFIG): $(PREP)
+
+rbconfig.rb: $(RBCONFIG)
+
+install-cross: $(arch)-fake.rb $(RBCONFIG) rbconfig.rb $(arch_hdrdir)/ruby/config.h \
+	$(LIBRUBY_A) $(LIBRUBY_SO) $(ARCHFILE)
+	$(ECHO) installing cross-compiling stuff
+	$(Q) $(MAKEDIRS) $(XRUBY_RUBYLIBDIR)/$(arch) $(XRUBY_RUBYHDRDIR)/$(arch)/ruby
+	$(Q) sed '/^\$$:\.unshift/q' $(arch)-fake.rb > fake.rb
+	$(Q) $(BASERUBY) -p \
+	-e '~/^\s*CONFIG\["LDFLAGS"\]/ and' \
+	-e '$$_[/(?=\s*"$$)/] = %q[ #{(CONFIG["LIBPATHFLAG"]%File.dirname(__FILE__)).strip}]' \
+	rbconfig.rb > fake-rbconfig.rb
+	$(INSTALL_SCRIPT) fake.rb $(XRUBY_RUBYLIBDIR)/$(arch)/fake.rb
+	$(INSTALL_SCRIPT) fake-rbconfig.rb $(XRUBY_RUBYLIBDIR)/$(arch)/rbconfig.rb
+	@$(RM) fake.rb fake-rbconfig.rb
+	$(INSTALL_DATA) $(arch_hdrdir)/ruby/config.h $(XRUBY_RUBYHDRDIR)/$(arch)/ruby
+	$(INSTALL_DATA) $(top_srcdir)/include/ruby/win32.h $(XRUBY_RUBYHDRDIR)/ruby
+	$(INSTALL_DATA) $(LIBRUBY) $(LIBRUBY_A) $(XRUBY_RUBYLIBDIR)/$(arch)
+	$(INSTALL_PROGRAM) $(LIBRUBY_SO) $(XRUBY_RUBYLIBDIR)/$(arch)
+
+Makefile:	$(srcdir)/Makefile.in $(srcdir)/enc/Makefile.in
+
+$(MKFILES): config.status $(srcdir)/version.h
+		@[ -f $@ ] && mv $@ $@.old
+		MAKE=$(MAKE) $(SHELL) ./config.status $@
+		@cmp $@ $@.old > /dev/null 2>&1 && echo $@ unchanged && exit 0; \
+		{ \
 		    echo "all:; -@rm -f conftest.mk"; \
 		    echo "conftest.mk: .force; @echo AUTO_REMAKE"; \
 		    echo ".force:"; \
 		} > conftest.mk || exit 1; \
 		$(MAKE) -f conftest.mk | grep '^AUTO_REMAKE$$' >/dev/null 2>&1 || \
-		{ echo "Makefile updated, restart."; exit 1; }
-
-config.status:	$(srcdir)/configure
-		MINIRUBY="$(MINIRUBY)" $(SHELL) ./config.status --recheck
-
-$(srcdir)/configure: $(srcdir)/configure.in
-		cd $(srcdir) && $(AUTOCONF)
-
-lex.c: keywords
-	@-$(RM) $@
-	gperf -p -j1 -i 1 -g -o -t -N rb_reserved_word -k1,3,$$ $? > $@ || \
-	cp "$(srcdir)/$@" .
-
-.y.c:
-	$(YACC) $<
-	sed '/^#/s|y\.tab\.c|$@|' y.tab.c > $@
-	rm -f y.tab.c
+		{ echo "$@ updated, restart."; exit 1; }
+
+uncommon.mk: $(srcdir)/common.mk
+		sed 's/{\$$([^(){}]*)[^{}]*}//g' $< > $@
+
+.PHONY: reconfig
+reconfig-args = $(srcdir)/$(CONFIGURE) $(configure_args)
+config.status-args = ./config.status --recheck
+reconfig-exec-0 = test -t 1 && { CONFIGURE_TTY=yes; export CONFIGURE_TTY; }; exec 3>&1; exit `exec 4>&1; { "$$@" 3>&- 4>&-; echo $$? 1>&4; } | fgrep -v '(cached)' 1>&3 3>&- 4>&-`
+reconfig-exec-1 = set -x; "$$@"
+
+reconfig config.status:	$(srcdir)/$(CONFIGURE) $(srcdir)/enc/Makefile.in \
+			$(srcdir)/include/ruby/version.h
+	@PWD= MINIRUBY="$(MINIRUBY)"; export MINIRUBY; \
+	set $(SHELL) $($@-args); $(reconfig-exec-$(V))
+
+$(srcdir)/$(CONFIGURE): $(srcdir)/configure.in $(srcdir)/aclocal.m4
+	$(CHDIR) $(srcdir) && exec $(AUTOCONF) -o $(@F)
+
+incs: id.h
+all-incs: probes.h
+
+# Things which should be considered:
+# * with gperf v.s. without gperf
+# * committers may have various versions of gperf
+# * ./configure v.s. ../ruby/configure
+# * GNU make v.s. HP-UX make	# HP-UX make invokes the action if lex.c and keywords has same mtime.
+# * svn checkout generate a file with mtime as current time
+# * ext4 and XFS has a mtime with fractional part
+lex.c: defs/keywords
+	@\
+	if cmp -s $(srcdir)/defs/lex.c.src $?; then \
+	  [ $(Q) ] && echo copying $@ || set -x; \
+	  $(CP) $(srcdir)/lex.c.blt $@; \
+	else \
+	  [ $(Q) ] && echo generating $@ || set -x; \
+	  gperf -C -P -p -j1 -i 1 -g -o -t -N rb_reserved_word -k1,3,$$ $? \
+	  | sed 's/(long)&((\(struct stringpool_t\) *\*)0)->\(stringpool_[a-z0-9]*\)/offsetof(\1, \2)/g' \
+	  > $@.tmp && \
+	  $(MV) $@.tmp $@ && \
+	  $(CP) $? $(srcdir)/defs/lex.c.src && \
+	  $(CP) $@ $(srcdir)/lex.c.blt; \
+	fi
+
+NAME2CTYPE_OPTIONS = -7 -c -j1 -i1 -t -C -P -T -H uniname2ctype_hash -Q uniname2ctype_pool -N uniname2ctype_p
+
+enc/unicode/name2ctype.h: enc/unicode/name2ctype.kwd
+	$(MAKEDIRS) $(@D)
+	@set +e; \
+	if cmp -s $(?:.kwd=.src) $?; then \
+	  set -x; \
+	  $(CP) $(?:.kwd=.h.blt) $@; \
+	else \
+	  trap '$(RM) $@-1.h $@-2.h' 0 && \
+	  set -x; \
+	  sed '/^#ifdef USE_UNICODE_PROPERTIES/,/^#endif/d' $? | gperf $(NAME2CTYPE_OPTIONS) > $@-1.h && \
+	  sed '/^#ifdef USE_UNICODE_PROPERTIES/d;/^#endif/d' $? | gperf $(NAME2CTYPE_OPTIONS) > $@-2.h && \
+	  diff -DUSE_UNICODE_PROPERTIES $@-1.h $@-2.h > $@.tmp || :; \
+	  $(MV) $@.tmp $@ && \
+	  $(CP) $? $(?:.kwd=.src) && \
+	  $(CP) $@ $(?:.kwd=.h.blt); \
+	fi
+
+JIS_PROPS_OPTIONS = -k1,3 -7 -c -j1 -i1 -t -C -P -t --ignore-case -H onig_jis_property_hash -Q onig_jis_property_pool -N onig_jis_property
+
+enc/jis/props.h: enc/jis/props.kwd
+	$(MAKEDIRS) $(@D)
+	@set +e; \
+	if cmp -s $(?:.kwd=.src) $?; then \
+	  set -x; \
+	  $(CP) $(?:.kwd=.h.blt) $@; \
+	else \
+	  set -x; \
+	  gperf $(JIS_PROPS_OPTIONS) $? | \
+	  sed 's/(int)(long)&((\([a-zA-Z_0-9 ]*[a-zA-Z_0-9]\) *\*)0)->\([a-zA-Z0-9_]*\),/(char)offsetof(\1, \2),/g' > $@ && \
+	  $(CP) $? $(?:.kwd=.src) && \
+	  $(CP) $@ $(?:.kwd=.h.blt); \
+	fi
 
 .c.@OBJEXT@:
-	$(CC) $(CFLAGS) $(CPPFLAGS) -c $<
+	@$(ECHO) compiling $<
+	$(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -c $<
 
 .s.@OBJEXT@:
-	$(AS) $(ASFLAGS) -o $@ $<
+	@$(ECHO) assembling $<
+	$(Q) $(AS) $(ASFLAGS) -o $@ $<
+
+.c.S:
+	@$(ECHO) translating $<
+	$(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -S $<
+
+.c.i:
+	@$(ECHO) preprocessing $<
+	$(Q) $(CPP) $(warnflags) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -E $< > $@
+
+.d.h:
+	@$(ECHO) translating probes $<
+	$(Q) $(DTRACE) -o $@.tmp -h -C $(INCFLAGS) -s $<
+	$(Q) sed -e 's/RUBY_/RUBY_DTRACE_/g' -e 's/PROBES_H_TMP/RUBY_PROBES_H/' -e 's/(char \*/(const char */g' -e 's/, char \*/, const char */g' $@.tmp > $@
+	$(Q) $(RM) $@.tmp
+
+.dmyh.h:
+	@$(ECHO) copying dummy $(DEST_FILE)
+	$(Q) $(CP) $(OS_SRC_FILE) $(OS_DEST_FILE)
+
+probes.stamp: $(DTRACE_REBUILD_OBJS)
+	$(Q) if test -f $@ -o -f probes.$(OBJEXT); then \
+	  $(RM) $(DTRACE_REBUILD_OBJS) $@; \
+	  $(ECHO0) "rebuilding objects which were modified by \"dtrace -G\""; \
+	  $(MAKE) $(DTRACE_REBUILD_OBJS); \
+	fi
+	$(Q) touch $@
+
+probes.@OBJEXT@: $(srcdir)/probes.d $(DTRACE_REBUILD:yes=probes.stamp)
+	@$(ECHO) processing probes in object files
+	$(Q) $(RM) $@
+	$(Q) $(DTRACE) -G -C $(INCFLAGS) -s $(srcdir)/probes.d -o $@ $(DTRACE_REBUILD_OBJS)
+
+# DTrace static library hacks described here:
+# http://mail.opensolaris.org/pipermail/dtrace-discuss/2005-August/000207.html
+ruby-glommed.$(OBJEXT):
+	@$(ECHO) generating a glommed object with DTrace probes for static library
+	$(Q) $(LD) -r -o $@ $(OBJS)
 
 clean-local::
-	@$(RM) ext/extinit.c ext/extinit.$(OBJEXT)
+	$(Q)$(RM) ext/extinit.c ext/extinit.$(OBJEXT) ext/ripper/y.output \
+		enc/encinit.c enc/encinit.$(OBJEXT)
+	-$(Q)$(RM) $(pkgconfig_DATA)
 
 distclean-local::
-	@$(RM) ext/config.cache $(RBCONFIG)
+	$(Q)$(RM) ext/config.cache $(RBCONFIG) Doxyfile
+	-$(Q)$(RM) run.gdb
+	-$(Q)$(RM) $(INSTALLED_LIST) $(arch_hdrdir)/ruby/config.h verconf.h
+	-$(Q)$(RMDIRS) $(arch_hdrdir)/ruby 2> /dev/null || true
+
+clean-ext distclean-ext realclean-ext::
+	@cd ext 2>/dev/null || exit 0; set dummy `echo "${EXTS}" | tr , ' '`; shift; \
+	test "$$#" = 0 && set .; \
+	set dummy `\
+	    find "$$@" -name Makefile -print | sed 's:^\./::;s:/Makefile$$::' | sort; \
+	`; shift; \
+	cd ..; \
+	for dir do \
+	    echo $(@:-ext=)ing "$$dir"; \
+	    (cd "ext/$$dir" && exec $(MAKE) $(MFLAGS) $(@:-ext=)) && \
+	    case "$@" in \
+	    *distclean-ext*|*realclean-ext*) \
+		$(RMDIRS) "ext/$$dir" 2> /dev/null || true;; \
+	    esac; \
+	done
+	-$(Q)$(RM) ext/extinit.$(OBJEXT)
+
+distclean-ext realclean-ext::
+	-$(Q)$(RM) ext/extinit.c
+	-$(Q)$(RMDIR) ext 2> /dev/null || true
+
+clean-extout:
+
+clean-enc distclean-enc realclean-enc:
+	@test -f "$(ENC_MK)" || exit 0; \
+	echo $(@:-enc=ing) encodings; \
+	exec $(MAKE) -f $(ENC_MK) $(MFLAGS) $(@:-enc=)
 
 ext/extinit.$(OBJEXT): ext/extinit.c $(SETUP)
-	$(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(OUTFLAG)$@ -c ext/extinit.c
+	$(ECHO) compiling $@
+	$(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -c ext/extinit.c
+
+enc/encinit.$(OBJEXT): enc/encinit.c $(SETUP)
+
+up::
+	@$(CHDIR) "$(srcdir)" && LC_TIME=C exec $(VCSUP)
+
+after-update:: update-config_files common-srcs
+
+update-mspec:
+	@$(CHDIR) $(srcdir); \
+	if [ -d spec/mspec ]; then \
+	  echo updating mspec ...; \
+	  $(Q1:0=:) set -x; \
+	  cd spec/mspec && \
+	  exec git pull; \
+	else \
+	  echo retrieving mspec ...; \
+	  $(Q1:0=:) set -x; \
+	  exec git clone $(MSPEC_GIT_URL) spec/mspec; \
+	fi
+
+update-rubyspec: update-mspec
+	@$(CHDIR) $(srcdir); \
+	if [ -d spec/rubyspec ]; then \
+	  echo updating rubyspec ...; \
+	  $(Q1:0=:) set -x; \
+	  cd spec/rubyspec && \
+	  exec git pull; \
+	else \
+	  echo retrieving rubyspec ...; \
+	  $(Q1:0=:) set -x; \
+	  exec git clone $(RUBYSPEC_GIT_URL) spec/rubyspec; \
+	fi
+
+test-rubyspec-precheck:
+	@if [ ! -d $(srcdir)/spec/rubyspec ]; then echo No rubyspec here.  make update-rubyspec first.; exit 1; fi
+
+update-doclie:
+	@$(CHDIR) $(srcdir); \
+	if [ -d coverage/doclie ]; then \
+	  echo updating doclie ...; \
+	  $(Q1:0=:) set -x; \
+	  cd coverage/doclie && \
+	  git fetch && \
+	  exec git checkout $(DOCLIE_GIT_REF); \
+	else \
+	  echo retrieving doclie ...; \
+	  $(Q1:0=:) set -x; \
+	  exec git clone --branch $(DOCLIE_GIT_REF) $(DOCLIE_GIT_URL) coverage/doclie; \
+	fi
+
+update-simplecov-html:
+	@$(CHDIR) $(srcdir); \
+	if [ -d coverage/simplecov-html ]; then \
+	  echo updating simplecov-html ...; \
+	  $(Q1:0=:) set -x; \
+	  cd coverage/simplecov-html && \
+	  git fetch && \
+	  exec git checkout $(SIMPLECOV_HTML_GIT_REF); \
+	else \
+	  echo retrieving simplecov-html ...; \
+	  exec git clone --branch $(SIMPLECOV_HTML_GIT_REF) $(SIMPLECOV_HTML_GIT_URL) coverage/simplecov-html; \
+	fi
+
+update-simplecov:
+	@$(CHDIR) $(srcdir); \
+	if [ -d coverage/simplecov ]; then \
+	  echo updating simplecov ...; \
+	  $(Q1:0=:) set -x; \
+	  cd coverage/simplecov && \
+	  git fetch && \
+	  exec git checkout $(SIMPLECOV_GIT_REF); \
+	else \
+	  echo retrieving simplecov ...; \
+	  $(Q1:0=:) set -x; \
+	  exec git clone --branch $(SIMPLECOV_GIT_REF) $(SIMPLECOV_GIT_URL) coverage/simplecov; \
+	fi
+
+update-coverage: update-simplecov update-simplecov-html update-doclie
+
+INSNS	= opt_sc.inc optinsn.inc optunifs.inc insns.inc insns_info.inc \
+	  vmtc.inc vm.inc
+
+$(INSNS): $(srcdir)/insns.def vm_opts.h \
+	  $(srcdir)/defs/opt_operand.def $(srcdir)/defs/opt_insn_unif.def \
+	  $(srcdir)/tool/instruction.rb $(srcdir)/tool/insns2vm.rb
+	$(ECHO) generating $@
+	$(Q) $(BASERUBY) -Ku $(srcdir)/tool/insns2vm.rb $(INSNS2VMOPT) $@
+
+verconf.h: $(RBCONFIG)
+
+loadpath: verconf.h
+	@$(CPP) $(XCFLAGS) $(CPPFLAGS) $(srcdir)/loadpath.c | \
+	sed -e '1,/^const char ruby_initial_load_paths/d;/;/,$$d' \
+	    -e '/^ /!d;s/ *"\\0"$$//;s/" *"//g'
diff --git a/NEWS b/NEWS
index de1dafb533..be722bc9de 100644
--- a/NEWS
+++ b/NEWS
@@ -1,115 +1,404 @@
-= NEWS
+# -*- rdoc -*-
+
+= NEWS for Ruby 2.3.0
 
 This document is a list of user visible feature changes made between
-releases excluding bug fixes.
+releases except for bug fixes.
 
 Note that each entry is kept so brief that no reason behind or
 reference information is supplied with.  For a full list of changes
-with all sufficient information, see the ChangeLog file.
+with all sufficient information, see the ChangeLog file or Redmine
+(e.g. <tt>https://bugs.ruby-lang.org/issues/$FEATURE_OR_BUG_NUMBER</tt>)
+
+== Changes since the 2.2.0 release
+
+=== Language changes
+
+* frozen-string-literal pragma:
+
+  * new pragma, frozen-string-literal has been experimentally introduced.
+    [Feature #8976]
+  * besides, --enable/--disable=frozen-string-literal options also have
+    been introduced. [Feature #8976]
+  * command line options --debug or --debug=frozen-string-literal enable
+    additional debugging mode which shows created location with at frozen
+    object error (RuntimeError).
+    [Feature #11725]
+
+* safe navigation operator:
+
+  * new method call syntax, `object&.foo', method #foo is called on
+    `object' if it is not nil.
+    this is similar to `try!' in Active Support, except:
+    * method name is syntactically required
+          obj.try! {} # valid
+          obj&. {}    # syntax error
+    * arguments are evaluated only if a call is made:
+          obj.try!(:foo, bar())  # bar() is always evaluated
+          obj&.foo(bar())        # bar() is conditionally evaluated
+    * attribute assignment is valid
+          obj&.attr += 1
+    [Feature #11537]
+
+* the did_you_mean gem:
+
+  * When a NameError or NoMethodError occurs because of a typo in the name,
+    the did_you_mean gem automatically suggests other names similar to the
+    method name.
+
+      "Yuki".starts_with?("Y")
+      # => NoMethodError: undefined method `starts_with?' for "Yuki":String
+      #    Did you mean?  start_with?
+
+* indented here document:
+
+  * new string literal, here document starts with `<<~`.
+    refer doc/syntax/literals.rdoc for more details.
+    [Feature #9098]
+
+=== Core classes updates (outstanding ones only)
+
+* ARGF
+
+  * ARGF.read_nonblock supports `exception: false' like IO#read_nonblock.
+    [Feature #11358]
+
+* Array
+
+  * Array#bsearch_index [Feature #10730]
+  * Array#dig [Feature #11643]
+
+* Comparable
+
+  * Comparable#== no longer rescues exceptions [Feature #7688]
+
+* Encoding
+
+  * new Encoding::IBM037 (alias ebcdic-cp-us; dummy)
+
+* Enumerable
+
+  * Enumerable#grep_v is added as inverse version of Enumerable#grep.
+    [Feature #11049]
+  * Enumerable#chunk_while [Feature #10769]
+
+* Enumerator::Lazy
+
+  * Enumerator::Lazy#grep_v [Feature #11773]
+
+* File
+
+  * File.mkfifo [Feature #11536]
+  * Add File::TMPFILE corresponding to O_TMPFILE
+
+* Hash
+
+  * Hash#fetch_values [Feature #10017]
+  * Hash#dig [Feature #11643]
+  * Hash#<=, Hash#<, Hash#>=, Hash#> [Feature #10984]
+  * Hash#to_proc [Feature #11653]
+
+* IO
+
+  * new mode flag File::SHARE_DELETE is available.
+    this flag means to permit deleting opened file on Windows, but currently
+    this affect only files opened as binary.  [Feature #11218]
+
+  * new option parameter `flags' is added.
+    this parameter is bitwise-ORed to oflags generated by normal mode argument.
+    [Feature #11253]
+
+  * IO#advise no longer raises Errno::ENOSYS in cases where it was
+    detected at build time but not available at runtime.  [Feature #11806]
+
+* Kernel
+
+  * Kernel#loop, when stopped by a StopIteration exception, returns
+    what the enumerator has returned instead of nil. [Feature #11498]
+
+* Module
+  * Module#deprecate_constant [Feature #11398]
+
+* NameError
+  * NameError#receiver is added to take the receiver object. [Feature #10881]
+
+* Numeric
 
-== Changes with Ruby 1.8.5
+  * Numeric#positive? and Numeric#negative? are added, which return
+    true when the receiver is positive and negative respectively.
+    [Feature #11151]
 
-=== New platforms/build tools support
+* Proc
 
-* IA64 HP-UX
+  * Proc#call (and also #[], #===, #yield) are optimized.
+    Backtrace doesn't show each method (show block lines directly).
+    TracePoint also ignores these calls. [Feature #11569]
 
-* Visual C++ 8 SP1
+* Queue (Thread::Queue)
 
-* autoconf 2.6x
+  * Queue#close is added to notice a termination. [Feature #10600]
 
-=== Library updates (outstanding ones only)
+* Regexp/String: Updated Unicode version from 7.0.0 to 8.0.0
 
-* date
+* RubyVM::InstructionSequence
+  * add the following methods as a primitive tool of iseq loader.
+    See sample/iseq_loader.rb for usage.
+    Note that loader does not have verifier so it is easy to cause
+    critical problem by loading modified/broken binary data.
+    See [Feature #11788] for more details. (experimental feature)
+    * RubyVM::InstructionSequence#to_binary(extra_data = nil)
+    * RubyVM::InstructionSequence.load_from_binary(binary)
+    * RubyVM::InstructionSequence.load_from_binary_extra_data(binary)
 
-  * Updated based on date2 4.0.3.
+* String
 
-* digest
+  * String#+@ and String#-@ are added to get mutable/frozen strings.
+    [Feature #11782]
 
-  * New internal APIs for C and Ruby.
+  * String.new now accepts new option parameter `encoding'.
+    [Feature #11785]
 
-  * Support for autoloading.
+* Struct
+  * Struct#dig [Feature #11688]
 
-  * See below for new features and compatibility issues.
+* Thread
+  * Thread#name, Thread#name= are added to handle thread names [Feature #11251]
+
+=== Core classes compatibility issues (excluding feature bug fixes)
+
+* Array
+  * Array#select!, Array#keep_if, Array#reject!, and Array#delete_if
+    no longer changes the receiver array instantly every time the
+    block is called.  [Feature #10714]
+
+  * Array#flatten and Array#flatten! no longer try to call #to_ary
+    method on elements beyond the given level.  [Bug #10748]
+
+  * Array#inspect doesn't raise error even if its content returns
+    a string which is not compatible with Encoding.default_external
+    as inspected result. [Feature #11801]
+
+* Enumerable
+  * Enumerable#chunk and Enumerable#slice_before no longer takes the
+    initial_state argument.  [Feature #10958]
+    Use a local variable instead to maintain a state.
+
+* File::Stat
+  * On Windows File::Stat#ino always returned 0, but now returns
+    BY_HANDLE_FILE_INFORMATION.nFileIndexHigh/Low.  [Feature #11216]
+
+* Hash
+  * Hash#inspect doesn't raise error even if its content returns
+    a string which is not compatible with Encoding.default_external
+    as inspected result. [Feature #11801]
+
+* IO
+  * IO#close doesn't raise when the IO object is closed.  [Feature #10718]
+  * IO#each_codepoint raises an exception at incomplete character
+    before EOF when conversion takes place.  [Bug #11444]
+
+* Module
+  * Module#define_method and Object.define_singleton_method now
+    require method body, Proc, Method, or a block, and raise
+    ArgumentError if no block is given directly.  [Bug #11283]
+
+* pack/unpack (Array/String)
+  * j and J directives for pointer width integer type.  [Feature #11215]
+
+
+=== Stdlib updates (outstanding ones only)
+
+* Logger
+
+  * Logger#level= now supports symbol and string levels such as :debug, :info,
+    :warn, :error, :fatal (case insensitive) [Feature #11695]
+  * Logger#reopen is added to reopen a log device. [Feature #11696]
+
+* io/wait
+  * IO#wait_readable no longer checks FIONREAD, it may be used for
+    non-bytestream IO such as listen sockets.
+
+* Net::FTP
+  * Net::FTP#mlst is added.
+  * Net::FTP#mlsd is added.
 
 * nkf
+  * Merge nkf 2.1.4.
+
+* ObjectSpace (objspace)
+  * ObjectSpace.count_symbols is added.
+  * ObjectSpace.count_imemo_objects is added.
+  * ObjectSpace.internal_class_of is added.
+  * ObjectSpace.internal_super_of is added.
+
+* OpenSSL
+  * OpenSSL::SSL::SSLSocket#accept_nonblock and
+    OpenSSL::SSL::SSLSocket#connect_nonblock supports `exception: false`.
+    [Feature #10532]
+
+* Pathname
+  * Pathname#descend and Pathname#ascend supported blockless form.
+    [Feature #11052]
+
+* Socket
+  * Socket#connect_nonblock, Socket#accept_nonblock,
+    TCPServer#accept_nonblock, UNIXServer#accept_nonblock,
+    BasicSocket#recv_nonblock, BasicSocket#recvmsg_nonblock,
+    BasicSocket#sendmsg_nonblock all support `exception: false` to return
+    :wait_readable or :wait_writable symbols instead of raising
+    IO::WaitReadable or IO::WaitWritable exceptions
+    [Feature #10532] [Feature #11229]
+  * BasicSocket#recv and BasicSocket#recv_nonblock allow an output
+    String buffer argument like IO#read and IO#read_nonblock to reduce
+    GC overhead [Feature #11242]
+
+* StringIO
+  * In read-only mode, StringIO#set_encoding no longer sets the encoding
+    of its buffer string.  Setting the encoding of the string directly
+    without StringIO#set_encoding may cause unpredictable behavior now.
+    [Bug #11827]
+
+* timeout
+  * Object#timeout is now warned as deprecated when called.
+
+=== Stdlib compatibility issues (excluding feature bug fixes)
+
+* ext/coverage/coverage.c
+  * Coverage.peek_result: new method to allow coverage to be captured without
+    stopping the coverage tool.  [Feature #10816]
+
+* Fiddle
+  * Fiddle::Function#call releases the GVL.  [Feature #11607]
+
+* io-console
+  * Update to io-console 0.4.5, and change the license to BSD 2-clause
+    "Simplified" License.
+
+* lib/base64.rb
+  * Base64.urlsafe_encode64: added a "padding" option to suppress
+    the padding character ("=").  [Feature #10740]
+  * Base64.urlsafe_decode64: now it accepts not only correctly-padded
+    input but also unpadded input.  [Feature #10740]
+
+* lib/drb/drb.rb
+  * removed unused argument. https://github.com/ruby/ruby/pull/515
+
+* lib/matrix.rb
+  * Add Vector#round. https://github.com/ruby/ruby/pull/802
+
+* lib/webrick/utils.rb
+  * removed unused argument. https://github.com/ruby/ruby/pull/356
+
+* Net::FTP
+  * Connections are in passive mode per default now.  The default mode can
+    be changed by Net::FTP.default_passive=.  [Feature #11612]
+
+* Net::HTTP
+  * default value of Net::HTTP#open_timeout is now 60 (was nil).
+
+* Net::Telnet
+  * Net::Telnet is extracted to net-telnet gem. It's unmaintain code.
+    [Feature #11083]
+
+* Psych
+  * Updated to Psych 2.0.17
+
+* Rake
+  * Rake is removed from stdlib.  [Feature #11025]
+
+* RDoc
+  * Updated to RDoc 4.2.1.  For full release notes see:
+
+    https://github.com/rdoc/rdoc/blob/master/History.rdoc#421--2015-12-22
 
-  * Updated based on nkf as of 2007-01-28.
+* RubyGems
+  * Updated to RubyGems 2.5.1.  For full release notes see:
 
-* tk
+    http://docs.seattlerb.org/rubygems/History_txt.html#label-2.5.0+-2F+2015-11-03
+    and
+    http://docs.seattlerb.org/rubygems/History_txt.html#label-2.5.1+-2F+2015-12-10
 
-  * Tk::X_Scrollable (Y_Scrollable) is renamed to Tk::XScrollable
-    (YScrollable). Tk::X_Scrollable (Y_Scrollable) is still available,
-    but it is an alias name.
+=== Built-in global variables compatibility issues
 
-  * Updated Tile extension support based on Tile 0.7.8.
+* $SAFE
+  * $SAFE=2 and $SAFE=3 are obsolete.  If $SAFE is set to 2 or larger,
+    an ArgumentError is raised.  [Feature #5455]
 
-  * Support --without-X11 configure option for non-X11 versions of
-    Tcl/Tk (e.g. Tcl/Tk Aqua).
+=== C API updates
 
-  * New sample script: irbtkw.rbw -- IRB on Ruby/Tk. It has no trouble
-    about STDIN blocking on Windows.
+* rb_define_class_id_under() now raises a TypeError exception when the
+  class is already defined but its superclass does not match the given
+  superclass, as well as definitions in ruby level.
 
-=== New methods and features
+* rb_timespec_now() is added to fetch current datetime as struct timespec.
+  [Feature #11558]
 
-* builtin classes
+* rb_time_timespec_new() is added to create a time object with epoch,
+  nanosecond, and UTC/localtime/time offset arguments.  [Feature #11558]
 
-  * New method: Kernel#instance_variable_defined?
+* rb_autoload() deprecated, use rb_funcall() instead.  [Feature #11664]
 
-  * New method: Module#class_variable_defined?
+* rb_compile_error_with_enc(), rb_compile_error(), and rb_compile_bug()
+  deprecated.  these functions are exposed but only for internal use.
+  external libraries should not use them.
 
-  * New feature: Dir::glob() can now take an array of glob patterns.
+=== Supported platform changes
 
-* digest
+* OS/2 is no longer supported
 
-  * New digest class methods: file
+* BeOS is no longer supported
 
-  * New digest instance methods: clone, reset, new,
-    inspect, digest_length (alias size or length),
-    block_length()
+* Borland-C is no longer supported
 
-  * New library: digest/bubblebabble
+* Haiku now stable and best effort
 
-  * New function: Digest(name)
+=== Implementation improvements
 
-* fileutils
+* Optimize Proc#call to eliminate method frame construction.
+  [Feature #11569]
 
-  * New option for FileUtils.cp_r(): :remove_destination
+* Reconsidering method entry data structure.
+  [Bug #11278]
 
-* thread
+* Introducing new table data structure for ID keys tables used by
+  method table and so on. New table structure is simple and fast
+  than st_table. [Feature #11420]
 
-  * Replaced with much faster mutex implementation in C.
-    The former implementation is available with a
-    configure option `--disable-fastthread'.
+* Machine code level tuning for object allocation and method calling
+  code. r52099, r52254
 
-* webrick
+* RubyVM::InstructionSequence is extended for future improvement.
+  [Feature #11788]
 
-  * New method: WEBrick::Cookie.parse_set_cookies()
+* Case dispatch is now optimized for all special constant literals
+  including nil, true, and false.  Previously, only literal strings,
+  symbols, integers and floats compiled to optimized case dispatch.
+  [Feature #11769]
 
-=== Compatibility issues (excluding feature bug fixes)
+* Instance variables on non-pure Ruby classes (T_DATA, T_FILE,
+  etc..) is less expensive to store than before. [Feature #11170]
 
-* builtin classes
+* All accesses to members of big Struct objects are performed in
+  constant-time.  Previously, Struct elements beyond the first 10
+  10 elements used a linear scan. [Feature #10585]
 
-  * String#intern now raises SecurityError when $SAFE level is greater
-    than zero.
+* The Set class got several speed up.
+  [Misc #10754], [r52591]
 
-* fileutils
+* Socket and I/O-related improvements
 
-  * A minor implementation change breaks Rake <=0.7.1.
-    Updating Rake to 0.7.2 fixes the problem.
+  * Calling overhead of most of new keyword-using I/O methods in
+    [Feature #11229] is reduced by avoiding the inefficient C API
+    to parse keywords.  [Feature #11339]
 
-* digest
+  * The standard library is updated to use the improved
+    exception-free non-blocking I/O from [Feature #11229].
+    This has the additional benefit of quieter $DEBUG output in
+    addition to reducing expensive exceptions. [Feature #11044]
 
-  * The constructor does no longer take an initial
-    string to feed; digest() and hexdigest() now do,
-    instead.  The following examples show how to
-    migrate:
+  * (Linux-only) waiting on a single FD anywhere in the stdlib no longer
+    uses select(2), making it immune to slowdowns with high-numbered FDs.
+    [Feature #11081] [Feature #11377]
 
-      # Before
-      md = Digest::MD5.new("string")
-      # After (works with any version)
-      md = Digest::MD5.new.update("string")
-        
-      # Before
-      hd = Digest::MD5.new("string").hexdigest
-      # After (works with any version)
-      hd = Digest::MD5.hexdigest("string")
+* CGI.escapeHTML is optimized with C extention.
+  https://github.com/ruby/ruby/pull/1164
diff --git a/README b/README
deleted file mode 100644
index cf836415ad..0000000000
--- a/README
+++ /dev/null
@@ -1,114 +0,0 @@
-* What's Ruby
-
-Ruby is the interpreted scripting language for quick and
-easy object-oriented programming.  It has many features to
-process text files and to do system management tasks (as in
-Perl).  It is simple, straight-forward, and extensible.
-
-
-* Features of Ruby
-
-  + Simple Syntax
-  + *Normal* Object-Oriented features(ex. class, method calls)
-  + *Advanced* Object-Oriented features(ex. Mix-in, Singleton-method)
-  + Operator Overloading
-  + Exception Handling
-  + Iterators and Closures
-  + Garbage Collection
-  + Dynamic Loading of Object files(on some architecture)
-  + Highly Portable(works on many UNIX machines, and on DOS,
-    Windows, Mac, BeOS etc.)
-
-
-* How to get Ruby
-
-The Ruby distribution files can be found in the following FTP site:
-
-  ftp://ftp.ruby-lang.org/pub/ruby/
-
-The latest source code of this version series can be checked out
-through SVN with the following command:
-
-  $ svn co http://svn.ruby-lang.org/repos/ruby/branches/ruby_1_8_6/
-
-The trunk of the Ruby source tree can be checked out with the
-following command:
-
-  $ svn co http://svn.ruby-lang.org/repos/ruby/trunk/ ruby
-
-There are some other branches under development.  Try the following
-command and see the list of branches:
-
-  $ svn ls http://svn.ruby-lang.org/repos/ruby/branches/
-
-
-* Ruby home-page
-
-The URL of the Ruby home-page is:
-
-   http://www.ruby-lang.org/
-
-
-* Mailing list
-
-There is a mailing list to talk about Ruby.
-To subscribe this list, please send the following phrase
-
-	subscribe YourFirstName YourFamilyName
-e.g.
-        subscribe Joseph Smith
-
-in the mail body (not subject) to the address <ruby-talk-ctl@ruby-lang.org>.
-
-
-* How to compile and install
-
-This is what you need to do to compile and install Ruby:
-
-  1. If ./configure does not exist or is older than configure.in,
-     run autoconf to (re)generate configure.
-
-  2. Run ./configure, which will generate config.h and Makefile.
-
-  3. Edit defines.h if you need.  Usually this step will not be needed.
-
-  4. Remove comment mark(#) before the module names from ext/Setup (or
-     add module names if not present), if you want to link modules
-     statically.
-
-     If you don't want to compile non static extension modules
-     (probably on architectures which does not allow dynamic loading),
-     remove comment mark from the line "#option nodynamic" in
-     ext/Setup.
-
-  5. Run make.
-
-  6. Optionally, run 'make test' to check whether the compiled Ruby
-     interpreter works well.  If you see the message "test succeeded",
-     your ruby works as it should (hopefully).
-
-  7. Run 'make install'
-
-     You may have to be a super user to install ruby.
-
-If you fail to compile ruby, please send the detailed error report with
-the error log and machine/OS type, to help others.
-
-
-* Copying
-
-See the file COPYING.
-
-
-* The Author
-
-Feel free to send comments and bug reports to the author.  Here is the 
-author's latest mail address:
-
-  matz@netlab.jp
-
--------------------------------------------------------
-created at: Thu Aug  3 11:57:36 JST 1995
-Local variables:
-mode: indented-text
-end:
diff --git a/README.EXT b/README.EXT
index 2fc2fd606a..48b8d964c4 100644
--- a/README.EXT
+++ b/README.EXT
@@ -1,1159 +1 @@
-.\" README.EXT -  -*- Text -*- created at: Mon Aug  7 16:45:54 JST 1995
-
-This document explains how to make extension libraries for Ruby.
-
-1. Basic knowledge
-
-In C, variables have types and data do not have types.  In contrast,
-Ruby variables do not have a static type, and data themselves have
-types, so data will need to be converted between the languages.
-
-Data in Ruby are represented by the C type `VALUE'.  Each VALUE data
-has its data-type.
-
-To retrieve C data from a VALUE, you need to:
-
- (1) Identify the VALUE's data type
- (2) Convert the VALUE into C data
-
-Converting to the wrong data type may cause serious problems.
-
-
-1.1 Data-types
-
-The Ruby interpreter has the following data types:
-
-	T_NIL		nil
-	T_OBJECT	ordinary object
-	T_CLASS		class
-	T_MODULE	module
-	T_FLOAT		floating point number
-	T_STRING	string
-	T_REGEXP	regular expression
-	T_ARRAY		array
-	T_FIXNUM	Fixnum(31bit integer)
-	T_HASH		associative array
-	T_STRUCT	(Ruby) structure
-	T_BIGNUM	multi precision integer
-	T_FILE		IO
-	T_TRUE		true
-	T_FALSE		false
-	T_DATA		data
-	T_SYMBOL        symbol
-
-In addition, there are several other types used internally:
-
-	T_ICLASS
-	T_MATCH
-	T_UNDEF
-	T_VARMAP
-	T_SCOPE
-	T_NODE
-
-Most of the types are represented by C structures.
-
-1.2 Check Data Type of the VALUE
-
-The macro TYPE() defined in ruby.h shows the data type of the VALUE.
-TYPE() returns the constant number T_XXXX described above.  To handle
-data types, your code will look something like this:
-
-  switch (TYPE(obj)) {
-    case T_FIXNUM:
-      /* process Fixnum */
-      break;
-    case T_STRING:
-      /* process String */
-      break;
-    case T_ARRAY:
-      /* process Array */
-      break;
-    default:
-      /* raise exception */
-      rb_raise(rb_eTypeError, "not valid value");
-      break;
-  }
-
-There is the data-type check function
-
-  void Check_Type(VALUE value, int type)
-
-which raises an exception if the VALUE does not have the type specified.
-
-There are also faster check macros for fixnums and nil.
-
-  FIXNUM_P(obj)
-  NIL_P(obj)
-
-1.3 Convert VALUE into C data
-
-The data for type T_NIL, T_FALSE, T_TRUE are nil, true, false
-respectively.  They are singletons for the data type.
-
-The T_FIXNUM data is a 31bit length fixed integer (63bit length on
-some machines), which can be converted to a C integer by using the
-FIX2INT() macro.  There is also NUM2INT() which converts any Ruby
-numbers into C integers.  The NUM2INT() macro includes a type check, so
-an exception will be raised if the conversion failed.  NUM2DBL() can
-be used to retrieve the double float value in the same way.
-
-In version 1.7 or later it is recommended that you use the new macros
-StringValue() and StringValuePtr() to get a char* from a VALUE.
-StringValue(var) replaces var's value with the result of "var.to_str()".
-StringValuePtr(var) does same replacement and returns char*
-representation of var.  These macros will skip the replacement if var is
-a String.  Notice that the macros take only the lvalue as their
-argument, to change the value of var in place.
-
-In version 1.6 or earlier, STR2CSTR() was used to do the same thing
-but now it is deprecated in version 1.7, because STR2CSTR() has a risk
-of a dangling pointer problem in the to_str() impliclit conversion.
-
-Other data types have corresponding C structures, e.g. struct RArray
-for T_ARRAY etc. The VALUE of the type which has the corresponding structure
-can be cast to retrieve the pointer to the struct.  The casting macro
-will be of the form RXXXX for each data type; for instance, RARRAY(obj). 
-See "ruby.h".
-
-For example, `RSTRING(str)->len' is the way to get the size of the
-Ruby String object.  The allocated region can be accessed by
-`RSTRING(str)->ptr'.  For arrays, use `RARRAY(ary)->len' and
-`RARRAY(ary)->ptr' respectively.
-
-Notice: Do not change the value of the structure directly, unless you
-are responsible for the result.  This ends up being the cause of interesting
-bugs.
-
-1.4 Convert C data into VALUE
-
-To convert C data to Ruby values:
-
-  * FIXNUM
-
-    left shift 1 bit, and turn on LSB.
-
-  * Other pointer values
-
-    cast to VALUE.
-
-You can determine whether a VALUE is pointer or not by checking its LSB.  
-
-Notice Ruby does not allow arbitrary pointer values to be a VALUE.  They
-should be pointers to the structures which Ruby knows about.  The known
-structures are defined in <ruby.h>.
-
-To convert C numbers to Ruby values, use these macros.
-
-  INT2FIX()	for integers within 31bits.
-  INT2NUM()	for arbitrary sized integer.
-
-INT2NUM() converts an integer into a Bignum if it is out of the FIXNUM
-range, but is a bit slower.
-
-1.5 Manipulating Ruby data
-
-As I already mentioned, it is not recommended to modify an object's internal
-structure.  To manipulate objects, use the functions supplied by the Ruby
-interpreter. Some (not all) of the useful functions are listed below:
-
- String functions
-
-  rb_str_new(const char *ptr, long len)
-
-    Creates a new Ruby string.
-
-  rb_str_new2(const char *ptr)
-
-    Creates a new Ruby string from a C string.  This is equivalent to
-    rb_str_new(ptr, strlen(ptr)).
-
-  rb_tainted_str_new(const char *ptr, long len)
-
-    Creates a new tainted Ruby string.  Strings from external data
-    sources should be tainted.
-
-  rb_tainted_str_new2(const char *ptr)
-
-    Creates a new tainted Ruby string from a C string.
-
-  rb_str_cat(VALUE str, const char *ptr, long len)
-
-    Appends len bytes of data from ptr to the Ruby string.
-
- Array functions
-
-  rb_ary_new()
-
-    Creates an array with no elements.
-
-  rb_ary_new2(long len)
-
-    Creates an array with no elements, allocating internal buffer
-    for len elements.
-
-  rb_ary_new3(long n, ...)
-
-    Creates an n-element array from the arguments.
-
-  rb_ary_new4(long n, VALUE *elts)
-
-    Creates an n-element array from a C array.
-
-  rb_ary_push(VALUE ary, VALUE val)
-  rb_ary_pop(VALUE ary)
-  rb_ary_shift(VALUE ary)
-  rb_ary_unshift(VALUE ary, VALUE val)
-
-    Array operations.  The first argument to each functions must be an 
-    array.  They may dump core if other types are given.
-
-2. Extending Ruby with C
-
-2.1 Addding new features to Ruby
-
-You can add new features (classes, methods, etc.) to the Ruby
-interpreter.  Ruby provides APIs for defining the following things:
-
- * Classes, Modules
- * Methods, Singleton Methods
- * Constants
-
-2.1.1 Class/module definition
-
-To define a class or module, use the functions below:
-
-  VALUE rb_define_class(const char *name, VALUE super)
-  VALUE rb_define_module(const char *name)
-
-These functions return the newly created class or module.  You may
-want to save this reference into a variable to use later.
-
-To define nested classes or modules, use the functions below:
-
-  VALUE rb_define_class_under(VALUE outer, const char *name, VALUE super)
-  VALUE rb_define_module_under(VALUE outer, const char *name)
-
-2.1.2 Method/singleton method definition
-
-To define methods or singleton methods, use these functions:
-
-  void rb_define_method(VALUE klass, const char *name, 
-		        VALUE (*func)(), int argc)
-
-  void rb_define_singleton_method(VALUE object, const char *name, 
-			          VALUE (*func)(), int argc)
-
-The `argc' represents the number of the arguments to the C function,
-which must be less than 17.  But I doubt you'll need that many.
-
-If `argc' is negative, it specifies the calling sequence, not number of
-the arguments.  
-
-If argc is -1, the function will be called as:
-
-  VALUE func(int argc, VALUE *argv, VALUE obj)
-
-where argc is the actual number of arguments, argv is the C array of
-the arguments, and obj is the receiver.
-
-If argc is -2, the arguments are passed in a Ruby array. The function
-will be called like:
-
-  VALUE func(VALUE obj, VALUE args)
-
-where obj is the receiver, and args is the Ruby array containing
-actual arguments.
-
-There are two more functions to define methods.  One is to define
-private methods:
-
-  void rb_define_private_method(VALUE klass, const char *name, 
-			        VALUE (*func)(), int argc)
-
-The other is to define module functions, which are private AND singleton
-methods of the module.  For example, sqrt is the module function
-defined in Math module.  It can be called in the following way:
-
-  Math.sqrt(4)
-
-or
-
-  include Math
-  sqrt(4)
-
-To define module functions, use:
-
-  void rb_define_module_function(VALUE module, const char *name, 
-				 VALUE (*func)(), int argc)
-
-Oh, in addition, function-like methods, which are private methods defined
-in the Kernel module, can be defined using:
-
-  void rb_define_global_function(const char *name, VALUE (*func)(), int argc)
-
-To define an alias for the method,
-
-  void rb_define_alias(VALUE module, const char* new, const char* old);
-
-To define and undefine the `allocate' class method,
-
-  void rb_define_alloc_func(VALUE klass, VALUE (*func)(VALUE klass));
-  void rb_undef_alloc_func(VALUE klass);
-
-func have to take the klass as the argument and return a newly
-allocated instance.  This instance should be empty as possible,
-without any expensive (including external) resources.
-
-2.1.3 Constant definition
-
-We have 2 functions to define constants:
-
-  void rb_define_const(VALUE klass, const char *name, VALUE val)
-  void rb_define_global_const(const char *name, VALUE val)
-
-The former is to define a constant under specified class/module.  The
-latter is to define a global constant.
-
-2.2 Use Ruby features from C
-
-There are several ways to invoke Ruby's features from C code.
-
-2.2.1 Evaluate Ruby Programs in a String
-
-The easiest way to use Ruby's functionality from a C program is to
-evaluate the string as Ruby program.  This function will do the job:
-
-  VALUE rb_eval_string(const char *str)
-
-Evaluation is done under the current context, thus current local variables
-of the innermost method (which is defined by Ruby) can be accessed.
-
-2.2.2 ID or Symbol
-
-You can invoke methods directly, without parsing the string.  First I need
-to explain about ID.  ID is the integer number to represent Ruby's
-identifiers such as variable names.  The Ruby data type corresponding to ID
-is Symbol.  It can be accessed from Ruby in the form:
-
- :Identifier
-
-You can get the ID value from a string within C code by using
-
-  rb_intern(const char *name)
-
-You can retrieve ID from Ruby object (Symbol or String) given as an
-argument by using
-
-  rb_to_id(VALUE symbol)
-
-You can convert C ID to Ruby Symbol by using
-
-  VALUE ID2SYM(ID id)
-
-and to convert Ruby Symbol object to ID, use
-
-  ID SYM2ID(VALUE symbol)
-
-2.2.3 Invoke Ruby method from C
-
-To invoke methods directly, you can use the function below
-
-  VALUE rb_funcall(VALUE recv, ID mid, int argc, ...)
-
-This function invokes a method on the recv, with the method name
-specified by the symbol mid.
-
-2.2.4 Accessing the variables and constants
-
-You can access class variables and instance variables using access
-functions.  Also, global variables can be shared between both environments.
-There's no way to access Ruby's local variables.
-
-The functions to access/modify instance variables are below:
-
-  VALUE rb_ivar_get(VALUE obj, ID id)
-  VALUE rb_ivar_set(VALUE obj, ID id, VALUE val)
-
-id must be the symbol, which can be retrieved by rb_intern().
-
-To access the constants of the class/module:
-
-  VALUE rb_const_get(VALUE obj, ID id)
-
-See 2.1.3 for defining new constant.
-
-3. Information sharing between Ruby and C
-
-3.1 Ruby constants that C can be accessed from C
-
-The following Ruby constants can be referred from C.
-
-  Qtrue
-  Qfalse
-
-Boolean values.  Qfalse is false in C also (i.e. 0).
-
-  Qnil
-
-Ruby nil in C scope.
-
-3.2 Global variables shared between C and Ruby
-
-Information can be shared between the two environments using shared global
-variables.  To define them, you can use functions listed below:
-
-  void rb_define_variable(const char *name, VALUE *var)
-
-This function defines the variable which is shared by both environments.
-The value of the global variable pointed to by `var' can be accessed
-through Ruby's global variable named `name'.
-
-You can define read-only (from Ruby, of course) variables using the
-function below.
-
-  void rb_define_readonly_variable(const char *name, VALUE *var)
-
-You can defined hooked variables.  The accessor functions (getter and
-setter) are called on access to the hooked variables.
-
-  void rb_define_hooked_variable(constchar *name, VALUE *var,
-				 VALUE (*getter)(), void (*setter)())
-
-If you need to supply either setter or getter, just supply 0 for the
-hook you don't need.  If both hooks are 0, rb_define_hooked_variable()
-works just like rb_define_variable().
-
-  void rb_define_virtual_variable(const char *name,
-				  VALUE (*getter)(), void (*setter)())
-
-This function defines a Ruby global variable without a corresponding C
-variable.  The value of the variable will be set/get only by hooks.
-
-The prototypes of the getter and setter functions are as follows:
-
-  (*getter)(ID id, void *data, struct global_entry* entry);
-  (*setter)(VALUE val, ID id, void *data, struct global_entry* entry);
-
-3.3 Encapsulate C data into a Ruby object
-
-To wrap and objectify a C pointer as a Ruby object (so called
-DATA), use Data_Wrap_Struct().
-
-  Data_Wrap_Struct(klass, mark, free, ptr)
-
-Data_Wrap_Struct() returns a created DATA object.  The klass argument
-is the class for the DATA object.  The mark argument is the function
-to mark Ruby objects pointed by this data.  The free argument is the
-function to free the pointer allocation.  If this is -1, the pointer
-will be just freed.  The functions mark and free will be called from
-garbage collector.
-
-You can allocate and wrap the structure in one step.
-
-  Data_Make_Struct(klass, type, mark, free, sval)
-
-This macro returns an allocated Data object, wrapping the pointer to
-the structure, which is also allocated.  This macro works like:
-
-  (sval = ALLOC(type), Data_Wrap_Struct(klass, mark, free, sval))
-
-Arguments klass, mark, and free work like their counterparts in
-Data_Wrap_Struct().  A pointer to the allocated structure will be
-assigned to sval, which should be a pointer of the type specified.
-
-To retrieve the C pointer from the Data object, use the macro
-Data_Get_Struct().
-
-  Data_Get_Struct(obj, type, sval)
-
-A pointer to the structure will be assigned to the variable sval.
-
-See the example below for details. 
-
-4. Example - Creating dbm extension
-
-OK, here's the example of making an extension library.  This is the
-extension to access DBMs.  The full source is included in the ext/
-directory in the Ruby's source tree.
-
-(1) make the directory
-
-  % mkdir ext/dbm
-
-Make a directory for the extension library under ext directory.
-
-(2) design the library
-
-You need to design the library features, before making it.
-
-(3) write C code.
-
-You need to write C code for your extension library.  If your library
-has only one source file, choosing ``LIBRARY.c'' as a file name is
-preferred.  On the other hand, in case your library has multiple source
-files, avoid choosing ``LIBRARY.c'' for a file name.  It may conflict
-with an intermediate file ``LIBRARY.o'' on some platforms.
-
-Ruby will execute the initializing function named ``Init_LIBRARY'' in
-the library.  For example, ``Init_dbm()'' will be executed when loading
-the library.
-
-Here's the example of an initializing function.
-
---
-Init_dbm()
-{
-    /* define DBM class */
-    cDBM = rb_define_class("DBM", rb_cObject);
-    /* DBM includes Enumerate module */
-    rb_include_module(cDBM, rb_mEnumerable);
-
-    /* DBM has class method open(): arguments are received as C array */
-    rb_define_singleton_method(cDBM, "open", fdbm_s_open, -1);
-
-    /* DBM instance method close(): no args */
-    rb_define_method(cDBM, "close", fdbm_close, 0);
-    /* DBM instance method []: 1 argument */
-    rb_define_method(cDBM, "[]", fdbm_fetch, 1);
-		:
-
-    /* ID for a instance variable to store DBM data */
-    id_dbm = rb_intern("dbm");
-}
---
-
-The dbm extension wraps the dbm struct in the C environment using 
-Data_Make_Struct.
-
---
-struct dbmdata {
-    int  di_size;
-    DBM *di_dbm;
-};
-
-
-obj = Data_Make_Struct(klass, struct dbmdata, 0, free_dbm, dbmp);
---
-
-This code wraps the dbmdata structure into a Ruby object.  We avoid wrapping
-DBM* directly, because we want to cache size information.
-
-To retrieve the dbmdata structure from a Ruby object, we define the
-following macro:
-
---
-#define GetDBM(obj, dbmp) {\
-    Data_Get_Struct(obj, struct dbmdata, dbmp);\
-    if (dbmp->di_dbm == 0) closed_dbm();\
-}
---
-
-This sort of complicated macro does the retrieving and close checking for
-the DBM.
-
-There are three kinds of way to receive method arguments.  First,
-methods with a fixed number of arguments receive arguments like this:
-
---
-static VALUE
-fdbm_delete(obj, keystr)
-    VALUE obj, keystr;
-{
-	:
-}
---
-
-The first argument of the C function is the self, the rest are the
-arguments to the method.
-
-Second, methods with an arbitrary number of arguments receive
-arguments like this:
-
---
-static VALUE
-fdbm_s_open(argc, argv, klass)
-    int argc;
-    VALUE *argv;
-    VALUE klass;
-{
-	:
-    if (rb_scan_args(argc, argv, "11", &file, &vmode) == 1) {
-	mode = 0666;		/* default value */
-    }
-	:
-}
---
-
-The first argument is the number of method arguments, the second
-argument is the C array of the method arguments, and the third
-argument is the receiver of the method.
-
-You can use the function rb_scan_args() to check and retrieve the
-arguments.  For example, "11" means that the method requires at least one
-argument, and at most receives two arguments.
-
-Methods with an arbitrary number of arguments can receive arguments
-by Ruby's array, like this:
-
---
-static VALUE
-fdbm_indexes(obj, args)
-    VALUE obj, args;
-{
-	:
-}
---
-
-The first argument is the receiver, the second one is the Ruby array
-which contains the arguments to the method.
-
-** Notice
-
-GC should know about global variables which refer to Ruby's objects, but
-are not exported to the Ruby world.  You need to protect them by
-
-  void rb_global_variable(VALUE *var)
-
-(4) prepare extconf.rb
-
-If the file named extconf.rb exists, it will be executed to generate
-Makefile.
-
-extconf.rb is the file for checking compilation conditions etc.  You
-need to put
-
-  require 'mkmf'
-
-at the top of the file.  You can use the functions below to check
-various conditions.
-
-  have_library(lib, func): check whether library containing function exists.
-  have_func(func, header): check whether function exists
-  have_header(header): check whether header file exists
-  create_makefile(target): generate Makefile
-
-The value of the variables below will affect the Makefile.
-
-  $CFLAGS: included in CFLAGS make variable (such as -O)
-  $CPPFLAGS: included in CPPFLAGS make variable (such as -I, -D)
-  $LDFLAGS: included in LDFLAGS make variable (such as -L)
-  $objs: list of object file names
-
-Normally, the object files list is automatically generated by searching
-source files, but you must define them explicitly if any sources will
-be generated while building.
-
-If a compilation condition is not fulfilled, you should not call
-``create_makefile''.  The Makefile will not be generated, compilation will
-not be done.
-
-(5) prepare depend (optional)
-
-If the file named depend exists, Makefile will include that file to
-check dependencies.  You can make this file by invoking
-
-  % gcc -MM *.c > depend
-
-It's harmless.  Prepare it.
-
-(6) generate Makefile
-
-Try generating the Makefile by:
-
-  ruby extconf.rb
-
-You don't need this step if you put the extension library under the ext
-directory of the ruby source tree.  In that case, compilation of the
-interpreter will do this step for you.
-
-(7) make
-
-Type
-
-  make
-
-to compile your extension.  You don't need this step either if you have
-put the extension library under the ext directory of the ruby source tree.
-
-(8) debug
-
-You may need to rb_debug the extension.  Extensions can be linked
-statically by adding the directory name in the ext/Setup file so that
-you can inspect the extension with the debugger.
-
-(9) done, now you have the extension library
-
-You can do anything you want with your library.  The author of Ruby
-will not claim any restrictions on your code depending on the Ruby API.
-Feel free to use, modify, distribute or sell your program.
-
-Appendix A. Ruby source files overview
-
-ruby language core
-
-  class.c
-  error.c
-  eval.c
-  gc.c
-  object.c
-  parse.y
-  variable.c
-
-utility functions
-
-  dln.c
-  regex.c
-  st.c
-  util.c
-
-ruby interpreter implementation
-
-  dmyext.c
-  inits.c
-  main.c
-  ruby.c
-  version.c
-
-class library
-
-  array.c
-  bignum.c
-  compar.c
-  dir.c
-  enum.c
-  file.c
-  hash.c
-  io.c
-  marshal.c
-  math.c
-  numeric.c
-  pack.c
-  prec.c
-  process.c
-  random.c
-  range.c
-  re.c
-  signal.c
-  sprintf.c
-  string.c
-  struct.c
-  time.c
-
-Appendix B. Ruby extension API reference
-
-** Types
-
- VALUE
-
-The type for the Ruby object.  Actual structures are defined in ruby.h,
-such as struct RString, etc.  To refer the values in structures, use
-casting macros like RSTRING(obj).
-
-** Variables and constants
-
- Qnil
-
-const: nil object
-
- Qtrue
-
-const: true object(default true value)
-
- Qfalse
-
-const: false object
-
-** C pointer wrapping
-
- Data_Wrap_Struct(VALUE klass, void (*mark)(), void (*free)(), void *sval)
-
-Wrap a C pointer into a Ruby object.  If object has references to other
-Ruby objects, they should be marked by using the mark function during
-the GC process.  Otherwise, mark should be 0.  When this object is no
-longer referred by anywhere, the pointer will be discarded by free
-function.
-
- Data_Make_Struct(klass, type, mark, free, sval)
-
-This macro allocates memory using malloc(), assigns it to the variable
-sval, and returns the DATA encapsulating the pointer to memory region.
-
- Data_Get_Struct(data, type, sval)
-
-This macro retrieves the pointer value from DATA, and assigns it to
-the variable sval. 
-
-** Checking data types
-
-TYPE(value)
-FIXNUM_P(value)
-NIL_P(value)
-void Check_Type(VALUE value, int type)
-void Check_SafeStr(VALUE value)
-
-** Data type conversion
-
-FIX2INT(value)
-INT2FIX(i)
-NUM2INT(value)
-INT2NUM(i)
-NUM2DBL(value)
-rb_float_new(f)
-StringValue(value)
-StringValuePtr(value)
-StringValueCStr(value)
-rb_str_new2(s)
-
-** defining class/module
-
- VALUE rb_define_class(const char *name, VALUE super)
-
-Defines a new Ruby class as a subclass of super.
-
- VALUE rb_define_class_under(VALUE module, const char *name, VALUE super)
-
-Creates a new Ruby class as a subclass of super, under the module's
-namespace.
-
- VALUE rb_define_module(const char *name)
-
-Defines a new Ruby module.
-
- VALUE rb_define_module_under(VALUE module, const char *name)
-
-Defines a new Ruby module under the module's namespace.
-
- void rb_include_module(VALUE klass, VALUE module)
-
-Includes module into class.  If class already includes it, just
-ignored.
-
- void rb_extend_object(VALUE object, VALUE module)
-
-Extend the object with the module's attributes.
-
-** Defining Global Variables
-
- void rb_define_variable(const char *name, VALUE *var)
-
-Defines a global variable which is shared between C and Ruby.  If name
-contains a character which is not allowed to be part of the symbol,
-it can't be seen from Ruby programs.
-
- void rb_define_readonly_variable(const char *name, VALUE *var)
-
-Defines a read-only global variable.  Works just like
-rb_define_variable(), except the defined variable is read-only.
-
- void rb_define_virtual_variable(const char *name,
-				 VALUE (*getter)(), VALUE (*setter)())
-
-Defines a virtual variable, whose behavior is defined by a pair of C
-functions.  The getter function is called when the variable is
-referenced.  The setter function is called when the variable is set to a
-value.  The prototype for getter/setter functions are:
-
-	VALUE getter(ID id)
-	void setter(VALUE val, ID id)
-
-The getter function must return the value for the access.
-
- void rb_define_hooked_variable(const char *name, VALUE *var,
-				VALUE (*getter)(), VALUE (*setter)())
-
-Defines hooked variable.  It's a virtual variable with a C variable.  
-The getter is called as
-
-	VALUE getter(ID id, VALUE *var)
-
-returning a new value.  The setter is called as
-
-	void setter(VALUE val, ID id, VALUE *var)
-
-GC requires C global variables which hold Ruby values to be marked.
-
- void rb_global_variable(VALUE *var)
-
-Tells GC to protect these variables.
-
-** Constant Definition
-
- void rb_define_const(VALUE klass, const char *name, VALUE val)
-
-Defines a new constant under the class/module.
-
- void rb_define_global_const(const char *name, VALUE val)
-
-Defines a global constant.  This is just the same as
-
-     rb_define_const(cKernal, name, val)
-
-** Method Definition
-
- rb_define_method(VALUE klass, const char *name, VALUE (*func)(), int argc)
-
-Defines a method for the class.  func is the function pointer.  argc
-is the number of arguments.  if argc is -1, the function will receive
-3 arguments: argc, argv, and self.  if argc is -2, the function will
-receive 2 arguments, self and args, where args is a Ruby array of
-the method arguments.
-
- rb_define_private_method(VALUE klass, const char *name, VALUE (*func)(), int argc)
-
-Defines a private method for the class.  Arguments are same as
-rb_define_method().
-
- rb_define_singleton_method(VALUE klass, const char *name, VALUE (*func)(), int argc)
-
-Defines a singleton method.  Arguments are same as rb_define_method().
-
- rb_scan_args(int argc, VALUE *argv, const char *fmt, ...)
-
-Retrieve argument from argc, argv.  The fmt is the format string for
-the arguments, such as "12" for 1 non-optional argument, 2 optional
-arguments.  If `*' appears at the end of fmt, it means the rest of
-the arguments are assigned to the corresponding variable, packed in
-an array.
-
-** Invoking Ruby method
-
- VALUE rb_funcall(VALUE recv, ID mid, int narg, ...)
-
-Invokes a method.  To retrieve mid from a method name, use rb_intern().
-
- VALUE rb_funcall2(VALUE recv, ID mid, int argc, VALUE *argv)
-
-Invokes a method, passing arguments by an array of values.
-
- VALUE rb_eval_string(const char *str)
-
-Compiles and executes the string as a Ruby program.
-
- ID rb_intern(const char *name)
-
-Returns ID corresponding to the name.
-
- char *rb_id2name(ID id)
-
-Returns the name corresponding ID.
-
- char *rb_class2name(VALUE klass)
-
-Returns the name of the class.
-
- int rb_respond_to(VALUE object, ID id)
-
-Returns true if the object responds to the message specified by id.
-
-** Instance Variables
-
- VALUE rb_iv_get(VALUE obj, const char *name)
-
-Retrieve the value of the instance variable.  If the name is not
-prefixed by `@', that variable shall be inaccessible from Ruby.
-
- VALUE rb_iv_set(VALUE obj, const char *name, VALUE val)
-
-Sets the value of the instance variable.
-
-** Control Structure
-
- VALUE rb_iterate(VALUE (*func1)(), void *arg1, VALUE (*func2)(), void *arg2)
-
-Calls the function func1, supplying func2 as the block.  func1 will be
-called with the argument arg1.  func2 receives the value from yield as
-the first argument, arg2 as the second argument.
- 
- VALUE rb_yield(VALUE val)
-
-Evaluates the block with value val.
-
- VALUE rb_rescue(VALUE (*func1)(), void *arg1, VALUE (*func2)(), void *arg2)
-
-Calls the function func1, with arg1 as the argument.  If an exception
-occurs during func1, it calls func2 with arg2 as the argument.  The
-return value of rb_rescue() is the return value from func1 if no
-exception occurs, from func2 otherwise.
-
- VALUE rb_ensure(VALUE (*func1)(), void *arg1, void (*func2)(), void *arg2)
-
-Calls the function func1 with arg1 as the argument, then calls func2
-with arg2 if execution terminated.  The return value from
-rb_ensure() is that of func1.
-
-** Exceptions and Errors
-
- void rb_warn(const char *fmt, ...)
-
-Prints a warning message according to a printf-like format.
-
- void rb_warning(const char *fmt, ...)
-
-Prints a warning message according to a printf-like format, if
-$VERBOSE is true.
-
-void rb_raise(rb_eRuntimeError, const char *fmt, ...)
-
-Raises RuntimeError.  The fmt is a format string just like printf().
-
- void rb_raise(VALUE exception, const char *fmt, ...)
-
-Raises a class exception.  The fmt is a format string just like printf().
-
- void rb_fatal(const char *fmt, ...)
-
-Raises a fatal error, terminates the interpreter.  No exception handling
-will be done for fatal errors, but ensure blocks will be executed.
-
- void rb_bug(const char *fmt, ...)
-
-Terminates the interpreter immediately.  This function should be
-called under the situation caused by the bug in the interpreter.  No
-exception handling nor ensure execution will be done.
-
-** Initialize and Start the Interpreter
-
-The embedding API functions are below (not needed for extension libraries):
-
- void ruby_init()
-
-Initializes the interpreter.
-
- void ruby_options(int argc, char **argv)
-
-Process command line arguments for the interpreter.
-
- void ruby_run()
-
-Starts execution of the interpreter.
-
- void ruby_script(char *name)
-
-Specifies the name of the script ($0).
-
-** Hooks for the Interpreter Events
-
- void rb_add_event_hook(rb_event_hook_func_t func, rb_event_t events)
-
-Adds a hook function for the specified interpreter events.
-events should be Or'ed value of:
-
-	RUBY_EVENT_LINE
-	RUBY_EVENT_CLASS
-	RUBY_EVENT_END
-	RUBY_EVENT_CALL
-	RUBY_EVENT_RETURN
-	RUBY_EVENT_C_CALL
-	RUBY_EVENT_C_RETURN
-	RUBY_EVENT_RAISE
-	RUBY_EVENT_ALL
-
-The definition of rb_event_hook_func_t is below:
-
- typedef void (*rb_event_hook_func_t)(rb_event_t event, NODE *node,
- 				      VALUE self, ID id, VALUE klass)
-
- int rb_remove_event_hook(rb_event_hook_func_t func)
-
-Removes the specified hook function.
-
-Appendix C. Functions Available in extconf.rb
-
-These functions are available in extconf.rb:
-
- have_macro(macro, headers)
-
-Checks whether macro is defined with header.  Returns true if the macro
-is defined.
-
- have_library(lib, func)
-
-Checks whether the library exists, containing the specified function.
-Returns true if the library exists.
-
- find_library(lib, func, path...)
-
-Checks whether a library which contains the specified function exists in
-path.  Returns true if the library exists.
-
- have_func(func, header)
-
-Checks whether func exists with header.  Returns true if the function
-exists.  To check functions in an additional library, you need to
-check that library first using have_library().
-
- have_var(var, header)
-
-Checks whether var exists with header.  Returns true if the variable
-exists.  To check variables in an additional library, you need to
-check that library first using have_library().
-
- have_header(header)
-
-Checks whether header exists.  Returns true if the header file exists.
-
- find_header(header, path...)
-
-Checks whether header exists in path.  Returns true if the header file
-exists.
-
- have_struct_member(type, member, header)
-
-Checks whether type has member with header.  Returns true if the type
-is defined and has the member.
-
- have_type(type, header, opt)
-
-Checks whether type is defined with header.  Returns true if the type
-is defined.
-
- check_sizeof(type, header)
-
-Checks the size of type in char with header.  Returns the size if the
-type is defined, otherwise nil.
-
- create_makefile(target)
-
-Generates the Makefile for the extension library.  If you don't invoke
-this method, the compilation will not be done.
-
- find_executable(bin, path)
-
-Finds command in path, which is File::PATH_SEPARATOR-separated list of
-directories.  If path is nil or omitted, environment varialbe PATH
-will be used.  Returns the path name of the command if it is found,
-otherwise nil.
-
- with_config(withval[, default=nil])
-
-Parses the command line options and returns the value specified by
---with-<withval>.
-
- enable_config(config, *defaults)
- disable_config(config, *defaults)
-
-Parses the command line options for boolean.  Returns true if
---enable-<config> is given, or false if --disable-<config> is given.
-Otherwise, yields defaults to the given block and returns the result
-if it is called with a block, or returns defaults.
-
- dir_config(target[, default_dir])
- dir_config(target[, default_include, default_lib])
-
-Parses the command line options and adds the directories specified by
---with-<target>-dir, --with-<target>-include, and/or --with-<target>-lib
-to $CFLAGS and/or $LDFLAGS.  --with-<target>-dir=/path is equivalent to
---with-<target>-include=/path/include --with-<target>-lib=/path/lib.
-Returns an array of the added directories ([include_dir, lib_dir]).
-
- pkg_config(pkg)
-
-Obtains the information for pkg by pkg-config command.  The actual
-command name can be overriden by --with-pkg-config command line
-option.
-
-/*
- * Local variables:
- * fill-column: 70
- * end:
- */
+Moved to doc/extension.rdoc
diff --git a/README.EXT.ja b/README.EXT.ja
index 30c4d520ba..f884ecbb0e 100644
--- a/README.EXT.ja
+++ b/README.EXT.ja
@@ -1,1258 +1 @@
-.\" README.EXT.ja -  -*- Text -*- created at: Mon Aug  7 16:45:54 JST 1995
-
-Ruby�γ�ĥ�饤�֥��κ�������������ޤ���
-
-1�������μ�
-
-C���ѿ��ˤϷ������ꡤ�ǡ����ˤϷ�������ޤ��󡥤Ǥ����顤��
-�Ȥ��Хݥ��󥿤�int���ѿ�����������ȡ������ͤ������Ȥ��Ƽ�
-�갷���ޤ����դ�Ruby���ѿ��ˤϷ����ʤ����ǡ����˷��������
-�������ΰ㤤�Τ��ᡤC��Ruby����ߤ��Ѵ����ʤ���С����ߤ���
-�ǡ����򥢥������Ǥ��ޤ���
-
-Ruby�Υǡ�����VALUE�Ȥ���C�η���ɽ������ޤ���VALUE���Υǡ�
-���Ϥ��Υǡ��������פ�ʬ���ΤäƤ��ޤ������Υǡ��������פ�
-�����Τϥǡ���(���֥�������)�μºݤι�¤���̣���Ƥ��ơ�Ruby
-�Υ��饹�ȤϤޤ���ä���ΤǤ���
-
-VALUE����C�ˤȤäư�̣�Τ���ǡ�������Ф�����ˤ�
-
- (1) VALUE�Υǡ��������פ��Τ�
- (2) VALUE��C�Υǡ������Ѵ�����
-
-��ξ����ɬ�פǤ���(1)��˺���ȴְ�ä��ǡ������Ѵ����Ԥ��
-�ơ��ǰ��ץ�����बcore dump���ޤ���
-
-1.1 �ǡ���������
-
-Ruby�ˤϥ桼�����Ȥ���ǽ���Τ���ʲ��Υ����פ�����ޤ���
-
-	T_NIL		nil
-	T_OBJECT	�̾�Υ��֥�������
-	T_CLASS		���饹
-	T_MODULE	�⥸�塼��
-	T_FLOAT		��ư��������
-	T_STRING	ʸ����
-	T_REGEXP	����ɽ��
-	T_ARRAY		����
-	T_FIXNUM	Fixnum(31bitĹ����)
-	T_HASH		Ϣ������
-	T_STRUCT	(Ruby��)��¤��
-	T_BIGNUM	¿��Ĺ����
-	T_FILE		������
-	T_TRUE		��
-	T_FALSE		��
-	T_DATA		�ǡ���
-	T_SYMBOL	����ܥ�
-
-����¾�����������Ѥ���Ƥ���ʲ��Υ����פ�����ޤ���
-
-	T_ICLASS
-	T_MATCH
-	T_UNDEF
-	T_VARMAP
-	T_SCOPE
-	T_NODE
-
-�ۤȤ�ɤΥ����פ�C�ι�¤�ΤǼ�������Ƥ��ޤ���
-
-1.2 VALUE�Υǡ��������פ�����å�����
-
-ruby.h�Ǥ�TYPE()�Ȥ����ޥ������������Ƥ��ơ�VALUE�Υǡ���
-�����פ��Τ뤳�Ȥ�����ޤ���TYPE()�ޥ����Ͼ�ǾҲ𤷤�T_XXXX
-�η�����������֤��ޤ���VALUE�Υǡ��������פ˱����ƽ�������
-���ˤϡ�TYPE()���ͤ�ʬ�����뤳�Ȥˤʤ�ޤ���
-
-  switch (TYPE(obj)) {
-    case T_FIXNUM:
-      /* FIXNUM�ν��� */
-      break;
-    case T_STRING:
-      /* ʸ����ν��� */
-      break;
-    case T_ARRAY:
-      /* ����ν��� */
-      break;
-    default:
-      /* �㳰��ȯ�������� */
-      rb_raise(rb_eTypeError, "not valid value");
-      break;
-  }
-
-����ȥǡ��������פ�����å����ơ��������ʤ�����㳰��ȯ����
-��ؿ����Ѱդ���Ƥ��ޤ���
-
-  void Check_Type(VALUE value, int type)
-
-���δؿ���value��type��̵����С��㳰��ȯ�������ޤ���������
-����Ϳ����줿VALUE�Υǡ��������פ����������ɤ��������å���
-�뤿��ˤϡ����δؿ���Ȥ��ޤ���
-
-FIXNUM��NIL�˴ؤ��ƤϤ���®��Ƚ�̥ޥ������Ѱդ���Ƥ��ޤ���
-
-  FIXNUM_P(obj)
-  NIL_P(obj)
-
-1.3 VALUE��C�Υǡ������Ѵ�����
-
-�ǡ��������פ�T_NIL, T_FALSE, T_TRUE�Ǥ�������ǡ����Ϥ��줾
-��nil, false, true�Ǥ������Υǡ��������פΥ��֥������ȤϤҤ�
-�Ĥ��Ĥ���¸�ߤ��ޤ���
-
-�ǡ��������פ�T_FIXNUM�λ��������31bit�Υ����������������
-����FIXNUM��C���������Ѵ����뤿��ˤϥޥ�����FIX2INT()�פ��
-���ޤ������줫�顤FIXNUM�˸¤餺Ruby�Υǡ������������Ѵ�����
-��NUM2INT()�פȤ����ޥ���������ޤ������Υޥ����ϥǡ�������
-�פΥ����å�̵���ǻȤ��ޤ�(�������Ѵ��Ǥ��ʤ����ˤ��㳰��
-ȯ������)��Ʊ�ͤ˥����å�̵���ǻȤ����Ѵ��ޥ�����double��
-���Ф���NUM2DBL()�פ�����ޤ���
-
-char* ����Ф���硢version 1.6 �����Ǥϡ�STR2CSTR()�פ�
-�����ޥ�����ȤäƤ��ޤ������������ to_str() �ˤ����ۤ�
-���Ѵ���̤� GC ������ǽ�������뤿�ᡢversion 1.7 �ʹߤǤ�
-obsolete �Ȥʤꡢ����� StringValue() �� StringValuePtr()
-��Ȥ�����侩���Ƥ��ޤ���StringValue(var) �� var �� String
- �Ǥ���в��⤻���������Ǥʤ���� var �� var.to_str() �η�̤�
-�֤�������ޥ�����StringValuePtr(var) ��Ʊ�ͤ� var ���֤�����
-�Ƥ��� var ��ʸ����ɽ�����Ф��� char* ���֤��ޥ����Ǥ���var ��
-���Ƥ�ľ���֤����������������Τǡ�var �� lvalue �Ǥ���ɬ�פ�
-����ޤ���
-
-����ʳ��Υǡ��������פ��б�����C�ι�¤�Τ�����ޤ����б���
-�빽¤�ΤΤ���VALUE�Ϥ��Τޤޥ��㥹��(���Ѵ�)����й�¤�Τ�
-�ݥ��󥿤��Ѵ��Ǥ��ޤ���
-
-��¤�Τϡ�struct RXxxxx�פȤ���̾����ruby.h���������Ƥ���
-�����㤨��ʸ����ϡ�struct RString�פǤ����ºݤ˻Ȥ���ǽ����
-����Τ�ʸ��������󤯤餤���Ȼפ��ޤ���
-
-ruby.h�ǤϹ�¤�Τإ��㥹�Ȥ���ޥ������RXXXXX()��(������ʸ
-���ˤ������)�Ȥ���̾�����󶡤���Ƥ��ޤ�(��: RSTRING())��
-
-�㤨�С�ʸ����str��Ĺ�������뤿��ˤϡ�RSTRING(str)->len�פ�
-����ʸ����str��char*�Ȥ������뤿��ˤϡ�RSTRING(str)->ptr��
-�Ȥ��ޤ�������ξ��ˤϡ����줾���RARRAY(ary)->len�ס�
-��RARRAY(ary)->ptr�פȤʤ�ޤ���
-
-Ruby�ι�¤�Τ�ľ�ܥ�������������˵���Ĥ��ʤ���Фʤ�ʤ���
-�Ȥϡ������ʸ����ι�¤�Τ���Ȥϻ��Ȥ�������ǡ�ľ���ѹ���
-�ʤ����ȤǤ���ľ���ѹ�������硤���֥������Ȥ����Ƥ���������
-�Ȥ�ʤ��ʤäơ��פ�̥Х��θ����ˤʤ�ޤ���
-
-1.4 C�Υǡ�����VALUE���Ѵ�����
-
-VALUE�μºݤι�¤��
-
-  * FIXNUM�ξ��
-
-    1bit�����եȤ��ơ�LSB��Ω�Ƥ롥
-
-  * ����¾�Υݥ��󥿤ξ��
-
-    ���Τޤ�VALUE�˥��㥹�Ȥ��롥
-
-�ȤʤäƤ��ޤ�����äơ�LSB������å������VALUE��FIXNUM����
-�����狼��櫓�Ǥ�(�ݥ��󥿤�LSB��Ω�äƤ��ʤ����Ȥ��ꤷ��
-����)��
-
-�Ǥ����顤FIXNUM�ʳ���Ruby�Υ��֥������Ȥι�¤�Τ�ñ��VALUE
-�˥��㥹�Ȥ��������VALUE���Ѵ�����ޤ�����������Ǥ�դι�¤
-�Τ�VALUE�˥��㥹�Ƚ����櫓�ǤϤ���ޤ��󡥥��㥹�Ȥ����
-��Ruby���ΤäƤ��빽¤��(ruby.h���������Ƥ���struct RXxxx
-�Τ��)�����Ǥ���
-
-FIXNUM�˴ؤ��Ƥ��Ѵ��ޥ������ͳ����ɬ�פ�����ޤ���C������
-����VALUE���Ѵ�����ޥ����ϰʲ��Τ�Τ�����ޤ���ɬ�פ˱���
-�ƻȤ�ʬ���Ƥ���������
-
-  INT2FIX()	��Ȥ�������31bit����˼��ޤ뼫���������
-  INT2NUM()	Ǥ�դ���������VALUE��
-
-INT2NUM()��������FIXNUM���ϰϤ˼��ޤ�ʤ���硤Bignum���Ѵ�
-���Ƥ���ޤ�(���������٤�)��
-
-1.5 Ruby�Υǡ���������
-
-������Ҥ٤��̤ꡤRuby�ι�¤�Τ򥢥���������������Ƥι�����
-�Ԥ����Ȥϴ�����ޤ��󡥤ǡ�Ruby�Υǡ�����������ˤ�
-Ruby���Ѱդ��Ƥ���ؿ����Ѥ��Ƥ���������
-
-�����ǤϤ�äȤ�Ȥ���Ǥ�����ʸ��������������/�����
-���ؿ��򤢤��ޤ�(�����ǤϤʤ��Ǥ�)��
-
- ʸ������Ф���ؿ�
-
-  rb_str_new(const char *ptr, long len)
-
-    ������Ruby��ʸ������������롥
-
-  rb_str_new2(const char *ptr)
-
-    C��ʸ���󤫤�Ruby��ʸ������������롥���δؿ��ε�ǽ��
-    rb_str_new(ptr, strlen(ptr))��Ʊ���Ǥ��롥
-
-  rb_tainted_str_new(const char *ptr, long len)
-
-    �����ޡ������ղä��줿������Ruby��ʸ������������롥����
-    ����Υǡ����˴�Ť�ʸ����ˤϱ����ޡ������ղä����٤�
-    �Ǥ��롥
-
-  rb_tainted_str_new2(const char *ptr)
-
-    C��ʸ���󤫤�����ޡ������ղä��줿Ruby��ʸ������������롥
-
-  rb_str_cat(VALUE str, const char *ptr, long len)
-
-    Ruby��ʸ����str��len�Х��Ȥ�ʸ����ptr���ɲä��롥
-
- ������Ф���ؿ�
-
-  rb_ary_new()
-
-    ���Ǥ�0��������������롥
-
-  rb_ary_new2(long len)
-
-    ���Ǥ�0��������������롥len����ʬ���ΰ�򤢤餫������
-    ���ƤƤ�����
-
-  rb_ary_new3(long n, ...)
-
-    �����ǻ��ꤷ��n���Ǥ�ޤ�������������롥
-
-  rb_ary_new4(long n, VALUE *elts)
-
-    �����Ϳ����n���Ǥ�������������롥
-
-  rb_ary_push(VALUE ary, VALUE val)
-  rb_ary_pop(VALUE ary)
-  rb_ary_shift(VALUE ary)
-  rb_ary_unshift(VALUE ary, VALUE val)
-
-    Array��Ʊ̾�Υ᥽�åɤ�Ʊ��Ư���򤹤�ؿ�����1������ɬ��
-    ����Ǥʤ���Фʤ�ʤ���
-
-2��Ruby�ε�ǽ��Ȥ�
-
-����Ū��Ruby�ǽ񤱤뤳�Ȥ�C�Ǥ�񤱤ޤ���Ruby���Τ�Τ�C�ǵ�
-�Ҥ���Ƥ����Ǥ����顤�����Ȥ����������ʤ�Ǥ����ɡ�������
-��Ruby�γ�ĥ�˻Ȥ����Ȥ�¿����������ͽ¬����뵡ǽ���濴�˾�
-�𤷤ޤ���
-
-2.1 Ruby�˵�ǽ���ɲä���
-
-Ruby���󶡤���Ƥ���ؿ���Ȥ���Ruby���󥿥ץ꥿�˿�������ǽ
-���ɲä��뤳�Ȥ��Ǥ��ޤ���Ruby�Ǥϰʲ��ε�ǽ���ɲä���ؿ���
-�󶡤���Ƥ��ޤ���
-
- * ���饹���⥸�塼��
- * �᥽�åɡ��ðۥ᥽�åɤʤ�
- * ���
-
-�ǤϽ�˾Ҳ𤷤ޤ���
-
-2.1.1 ���饹/�⥸�塼�����
-
-���饹��⥸�塼���������뤿��ˤϡ��ʲ��δؿ���Ȥ��ޤ���
-
-  VALUE rb_define_class(const char *name, VALUE super)
-  VALUE rb_define_module(const char *name)
-
-�����δؿ��Ͽ�����������줿���饹��⥸�塼����֤��ޤ���
-�᥽�åɤ����������ˤ������ͤ�ɬ�פʤΤǡ��ۤȤ�ɤξ��
-������ͤ��ѿ��˳�Ǽ���Ƥ���ɬ�פ�����Ǥ��礦��
-
-���饹��⥸�塼���¾�Υ��饹�������˥ͥ��Ȥ�������������
-�ϰʲ��δؿ���Ȥ��ޤ���
-
-  VALUE rb_define_class_under(VALUE outer, const char *name, VALUE super)
-  VALUE rb_define_module_under(VALUE outer, const char *name)
-
-2.1.2 �᥽�å�/�ðۥ᥽�å����
-
-�᥽�åɤ��ðۥ᥽�åɤ��������ˤϰʲ��δؿ���Ȥ��ޤ���
-
-  void rb_define_method(VALUE klass, const char *name, 
-		        VALUE (*func)(), int argc)
-
-  void rb_define_singleton_method(VALUE object, const char *name, 
-			          VALUE (*func)(), int argc)
-
-
-ǰ�Τ�����������ȡ��ðۥ᥽�åɡפȤϡ���������Υ��֥�����
-�Ȥ��Ф��Ƥ���ͭ���ʥ᥽�åɤǤ���Ruby�ǤϤ褯Smalltalk�ˤ�
-���륯�饹�᥽�åɤȤ��ơ����饹���Ф����ðۥ᥽�åɤ��Ȥ��
-�ޤ���
-
-�����δؿ��� argc�Ȥ���������C�δؿ����Ϥ��������ο�(��
-����)����ޤ���argc��0�ʾ�λ��ϴؿ��˰����Ϥ������ο����
-̣���ޤ���16�İʾ�ΰ����ϻȤ��ޤ���(�����פ�ޤ����͡���
-��ʤ�)���ºݤδؿ��ˤ���Ƭ�ΰ����Ȥ���self��Ϳ�����ޤ���
-�ǡ����ꤷ�������1¿����������Ĥ��Ȥˤʤ�ޤ���
-
-argc����λ��ϰ����ο��ǤϤʤ�����������ꤷ�����Ȥˤʤ�ޤ���
-argc��-1�λ��ϰ����������������Ϥ���ޤ���argc��-2�λ��ϰ�
-����Ruby������Ȥ����Ϥ���ޤ���
-
-�᥽�åɤ��������ؿ��Ϥ⤦��Ĥ���ޤ����ҤȤĤ�private��
-���åɤ��������ؿ��ǡ�������rb_define_method()��Ʊ���Ǥ���
-
-  void rb_define_private_method(VALUE klass, const char *name, 
-				VALUE (*func)(), int argc)
-
-private�᥽�åɤȤϴؿ������Ǥ����ƤӽФ����Ȥν���ʤ��᥽��
-�ɤǤ���
-
-�⤦�ҤȤĤϥ⥸�塼��ؿ�����������ΤǤ����⥸�塼��ؿ�
-�Ȥϥ⥸�塼����ðۥ᥽�åɤǤ��ꡤƱ����private�᥽�åɤ�
-�⤢���ΤǤ�����򤢤����Math�⥸�塼���sqrt()�ʤɤ�����
-���ޤ������Υ᥽�åɤ�
-
-  Math.sqrt(4)
-
-�Ȥ��������Ǥ�
-
-  include Math
-  sqrt(4)
-
-�Ȥ��������Ǥ�Ȥ��ޤ����⥸�塼��ؿ����������ؿ��ϰʲ���
-�̤�Ǥ���
-
-  void rb_define_module_function(VALUE module, const char *name, 
-		                 VALUE (*func)(), int argc)
-
-�ؿ�Ū�᥽�å�(Kernel�⥸�塼���private method)��������뤿
-��δؿ��ϰʲ����̤�Ǥ���
-
-  void rb_define_global_function(const char *name, VALUE (*func)(), int argc)
-
-
-�᥽�åɤ���̾��������뤿��δؿ��ϰʲ����̤�Ǥ���
-
-  void rb_define_alias(VALUE module, const char* new, const char* old);
-
-���饹�᥽�å�allocate������������������ꤹ�뤿��δؿ���
-�ʲ����̤�Ǥ���
-
-  void rb_define_alloc_func(VALUE klass, VALUE (*func)(VALUE klass));
-  void rb_undef_alloc_func(VALUE klass);
-
-func�ϥ��饹������Ȥ��Ƽ�����äơ�������������Ƥ�줿����
-�����󥹤��֤��ʤ��ƤϤʤ�ޤ��󡣤��Υ��󥹥��󥹤ϡ�������
-�������ʤɤ�ޤޤʤ����Ǥ�������ֶ��פΤޤޤˤ��Ƥ������ۤ�
-���褤�Ǥ��礦��
-
-2.1.3 ������
-
-��ĥ�饤�֥�꤬ɬ�פ�����Ϥ��餫����������Ƥ����������ɤ�
-�Ǥ��礦��������������ؿ�����Ĥ���ޤ���
-
-  void rb_define_const(VALUE klass, const char *name, VALUE val)
-  void rb_define_global_const(const char *name, VALUE val)
-
-���Ԥ�����Υ��饹/�⥸�塼���°�����������������Ρ���
-�Ԥϥ������Х���������������ΤǤ���
-
-2.2 Ruby�ε�ǽ��C����ƤӽФ�
-
-���ˡ�1.5 Ruby�Υǡ���������٤ǰ����Ҳ𤷤��褦�ʴؿ���
-�Ȥ��С�Ruby�ε�ǽ��¸����Ƥ���ؿ���ľ�ܸƤӽФ����Ȥ�����
-�ޤ���
-
-# ���Τ褦�ʴؿ��ΰ���ɽ�Ϥ��ޤΤȤ�������ޤ��󡥥�������
-# �뤷���ʤ��Ǥ��͡�
-
-����ʳ��ˤ�Ruby�ε�ǽ��ƤӽФ���ˡ�Ϥ����Ĥ�����ޤ���
-
-2.2.1 Ruby�Υץ�������eval����
-
-C����Ruby�ε�ǽ��ƤӽФ���äȤ��ñ����ˡ�Ȥ��ơ�ʸ�����
-Ϳ����줿Ruby�Υץ�������ɾ������ʲ��δؿ�������ޤ���
-
-  VALUE rb_eval_string(const char *str)
-
-����ɾ���ϸ��ߤδĶ��ǹԤ��ޤ����Ĥޤꡤ���ߤΥ��������ѿ�
-�ʤɤ�����Ѥ��ޤ���
-
-2.2.2 ID�ޤ��ϥ���ܥ�
-
-C����ʸ������ͳ������Ruby�Υ᥽�åɤ�ƤӽФ����Ȥ�Ǥ���
-�����������ˡ�Ruby���󥿥ץ꥿��ǥ᥽�åɤ��ѿ�̾����ꤹ��
-���˻Ȥ��Ƥ���ID�ˤĤ����������Ƥ����ޤ��礦��
-
-ID�Ȥ��ѿ�̾���᥽�å�̾��ɽ�������Ǥ���Ruby�Ǥ�ID���б�����
-���֥������ȤȤ��ƥ���ܥ�(Symbol)�����ꡤ
-
- :���̻�
-
-�ǥ��������Ǥ��ޤ���C���餳�����������뤿��ˤϴؿ�
-
-  rb_intern(const char *name)
-
-��Ȥ��ޤ���Ruby��������Ȥ���Ϳ����줿����ܥ�(�ޤ���ʸ��
-��)��ID���Ѵ�����ˤϰʲ��δؿ���Ȥ��ޤ���
-
-  rb_to_id(VALUE symbol)
-
-ID���饷��ܥ�����뤿��ˤϰʲ��Υޥ�����Ȥ��ޤ���
-
-  VALUE ID2SYM(ID id)
-
-����ܥ뤫��ID�����뤿��ˤϰʲ��Υޥ�����Ȥ��ޤ���
-
-  ID SYM2ID(VALUE symbol)
-
-2.2.3 C����Ruby�Υ᥽�åɤ�ƤӽФ�
-
-C����ʸ������ͳ������Ruby�Υ᥽�åɤ�ƤӽФ�����ˤϰʲ�
-�δؿ���Ȥ��ޤ���
-
-  VALUE rb_funcall(VALUE recv, ID mid, int argc, ...)
-
-���δؿ��ϥ��֥�������recv��mid�ǻ��ꤵ���᥽�åɤ�Ƥӽ�
-���ޤ�������¾�˰����λ���λ������㤦�ʲ��δؿ��⤢��ޤ���
-
-  VALUE rb_funcall2(VALUE recv, ID mid, int argc, VALUE *argv)
-  VALUE rb_apply(VALUE recv, ID mid, VALUE args)
-
-apply�ˤϰ����Ȥ���Ruby�������Ϳ���ޤ���
-
-2.2.4 �ѿ�/����򻲾�/��������
-
-C����ؿ���Ȥäƻ��ȡ������Ǥ���Τϡ���������󥹥�����
-���Ǥ�������ѿ��ϰ����Τ�Τ�C������ѿ��Ȥ��ƥ��������Ǥ�
-�ޤ������������ѿ��򻲾Ȥ�����ˡ�ϸ������Ƥ��ޤ���
-
-���֥������ȤΥ��󥹥����ѿ��򻲾ȡ���������ؿ��ϰʲ�����
-��Ǥ���
-
-  VALUE rb_ivar_get(VALUE obj, ID id)
-  VALUE rb_ivar_set(VALUE obj, ID id, VALUE val)
-
-id��rb_intern()���������Τ�ȤäƤ���������
-
-����򻲾Ȥ���ˤϰʲ��δؿ���ȤäƤ���������
-
-  VALUE rb_const_get(VALUE obj, ID id)
-
-����򿷤���������뤿��ˤϡ�2.1.3 �������٤ǾҲ�
-��Ƥ���ؿ���ȤäƤ���������
-
-3��Ruby��C�Ȥξ���ͭ
-
-C�����Ruby�δ֤Ǿ����ͭ������ˡ�ˤĤ��Ʋ��⤷�ޤ���
-
-3.1 C���黲�ȤǤ���Ruby�����
-
-�ʲ���Ruby�������C�Υ�٥뤫�黲�ȤǤ��ޤ���
-
-  Qtrue
-  Qfalse
-
-    �����͡�Qfalse��C����Ǥ⵶�Ȥߤʤ���ޤ�(�Ĥޤ�0)��
-
-  Qnil
-
-    C���줫�鸫����nil�ס�
-
-3.2 C��Ruby�Ƕ�ͭ���������ѿ�
-
-C��Ruby������ѿ���Ȥäƾ����ͭ�Ǥ��ޤ�����ͭ�Ǥ������
-�ѿ��ˤϤ����Ĥ��μ��ब����ޤ������Τʤ��Ǥ�äȤ��ɤ��Ȥ�
-���Ȼפ���Τ�rb_define_variable()�Ǥ���
-
-  void rb_define_variable(const char *name, VALUE *var)
-
-���δؿ���Ruby��C�ȤǶ�ͭ��������ѿ���������ޤ����ѿ�̾��
-`$'�ǻϤޤ�ʤ����ˤϼ�ưŪ���ɲä���ޤ��������ѿ����ͤ���
-������ȼ�ưŪ��Ruby���б������ѿ����ͤ��Ѥ��ޤ���
-
-�ޤ�Ruby¦����Ϲ����Ǥ��ʤ��ѿ��⤢��ޤ�������read only��
-�ѿ��ϰʲ��δؿ���������ޤ���
-
-  void rb_define_readonly_variable(const char *name, VALUE *var)
-
-������ѿ���¾��hook��Ĥ�������ѿ�������Ǥ��ޤ���hook�դ�
-������ѿ��ϰʲ��δؿ����Ѥ���������ޤ���hook�դ�����ѿ���
-�ͤλ��Ȥ������hook�ǹԤ�ɬ�פ�����ޤ���
-
-  void rb_define_hooked_variable(const char *name, VALUE *var,
-				 VALUE (*getter)(), void (*setter)())
-
-���δؿ���C�δؿ��ˤ�ä�hook�ΤĤ���줿����ѿ����������
-�����ѿ������Ȥ��줿���ˤϴؿ�getter�����ѿ����ͤ����åȤ���
-�����ˤϴؿ�setter���ƤФ�롥hook����ꤷ�ʤ�����getter��
-setter��0����ꤷ�ޤ���
-
-# getter��setter��0�ʤ��rb_define_variable()��Ʊ���ˤʤ롥
-
-���줫�顤C�δؿ��ˤ�äƼ¸������Ruby������ѿ����������
-�ؿ�������ޤ���
-
-  void rb_define_virtual_variable(const char *name,
-				  VALUE (*getter)(), void (*setter)())
-
-���δؿ��ˤ�ä�������줿Ruby������ѿ������Ȥ��줿���ˤ�
-getter�����ѿ����ͤ����åȤ��줿���ˤ�setter���ƤФ�ޤ���
-
-getter��setter�λ��ͤϰʲ����̤�Ǥ���
-
-  (*getter)(ID id, void *data, struct global_entry* entry);
-  (*setter)(VALUE val, ID id, void *data, struct global_entry* entry);
-
-3.3 C�Υǡ�����Ruby���֥������Ȥˤ���
-
-C��������������줿�ǡ���(��¤��)��Ruby�Υ��֥������ȤȤ���
-��갷��������礬���ꤨ�ޤ������Τ褦�ʾ��ˤϡ�Data�Ȥ���
-Ruby���֥������Ȥ�C�ι�¤��(�ؤΥݥ���)�򤯤�ळ�Ȥ�Ruby
-���֥������ȤȤ��Ƽ�갷����褦�ˤʤ�ޤ���
-
-Data���֥������Ȥ��������ƹ�¤�Τ�Ruby���֥������Ȥ˥��ץ���
-�����뤿��ˤϡ��ʲ��Υޥ�����Ȥ��ޤ���
-
-  Data_Wrap_Struct(klass, mark, free, ptr)
-
-���Υޥ���������ͤ��������줿Data���֥������ȤǤ���
-
-klass�Ϥ���Data���֥������ȤΥ��饹�Ǥ���ptr�ϥ��ץ��벽����
-C�ι�¤�ΤؤΥݥ��󥿤Ǥ���mark�Ϥ��ι�¤�Τ�Ruby�Υ��֥���
-���Ȥؤλ��Ȥ�������˻Ȥ��ؿ��Ǥ������Τ褦�ʻ��Ȥ�ޤޤʤ�
-���ˤ�0����ꤷ�ޤ���
-
-# ���Τ褦�ʻ��Ȥϴ�����ޤ���
-
-free�Ϥ��ι�¤�Τ��⤦���פˤʤä����˸ƤФ��ؿ��Ǥ�������
-�ؿ��������١������쥯������ƤФ�ޤ������줬-1�ξ��ϡ�ñ
-��˳�������ޤ���
-
-C�ι�¤�Τγ�����Data���֥������Ȥ�������Ʊ���˹Ԥ��ޥ�����
-���ưʲ��Τ�Τ��󶡤���Ƥ��ޤ���
-
-  Data_Make_Struct(klass, type, mark, free, sval)
-
-���Υޥ���������ͤ��������줿Data���֥������ȤǤ���
-
-klass, mark, free��Data_Wrap_Struct��Ʊ��Ư���򤷤ޤ���type
-�ϳ�����Ƥ�C��¤�Τη��Ǥ���������Ƥ�줿��¤�Τ��ѿ�sval
-����������ޤ��������ѿ��η��� (type*) �Ǥ���ɬ�פ�����ޤ���
-
-Data���֥������Ȥ���ݥ��󥿤���Ф��Τϰʲ��Υޥ������Ѥ�
-�ޤ���
-
-  Data_Get_Struct(obj, type, sval)
-
-C�ι�¤�ΤؤΥݥ��󥿤��ѿ�sval����������ޤ���
-
-������Data�λȤ����Ϥ���ä�ʬ����ˤ����Τǡ������������
-����򻲾Ȥ��Ƥ���������
-
-4������ - dbm�ѥå���������
-
-�����ޤǤ������ǤȤꤢ������ĥ�饤�֥��Ϻ���Ϥ��Ǥ���
-Ruby��ext�ǥ��쥯�ȥ�ˤ��Ǥ˴ޤޤ�Ƥ���dbm�饤�֥������
-�����ʳ�Ū���������ޤ���
-
-(1) �ǥ��쥯�ȥ����
-
-  % mkdir ext/dbm
-
-Ruby 1.1�����Ǥ�դΥǥ��쥯�ȥ�ǥ����ʥߥå��饤�֥����
-�뤳�Ȥ��Ǥ���褦�ˤʤ�ޤ�����Ruby����Ū�˥�󥯤������
-��Ruby��Ÿ�������ǥ��쥯�ȥ�β���ext�ǥ��쥯�ȥ����˳�ĥ
-�饤�֥���ѤΥǥ��쥯�ȥ����ɬ�פ�����ޤ���̾����Ŭ����
-����ǹ����ޤ���
-
-(2) �߷פ���
-
-�ޤ��������ʤ�Ǥ����ɡ��ɤ�������ǽ��¸����뤫�ɤ����ޤ���
-�פ���ɬ�פ�����ޤ����ɤ�ʥ��饹��Ĥ��뤫�����Υ��饹�ˤ�
-�ɤ�ʥ᥽�åɤ����뤫�����饹���󶡤�������ʤɤˤĤ����߷�
-���ޤ���
-
-(3) C�����ɤ��
-
-��ĥ�饤�֥�����ΤȤʤ�C����Υ�������񤭤ޤ���C����Υ���
-�����ҤȤĤλ��ˤϡ֥饤�֥��̾.c�פ����֤��ɤ��Ǥ��礦��C
-����Υ�������ʣ���ξ��ˤϵդˡ֥饤�֥��̾.c�פȤ����ե�
-����̾���򤱤�ɬ�פ�����ޤ������֥������ȥե�����ȥ⥸�塼
-�������������Ū�����������֥饤�֥��̾.o�פȤ����ե�����
-�Ȥ����ͤ��뤫��Ǥ���
-
-Ruby�ϳ�ĥ�饤�֥�������ɤ�����ˡ�Init_�饤�֥��̾�פ�
-�����ؿ���ưŪ�˼¹Ԥ��ޤ���dbm�饤�֥��ξ���Init_dbm��
-�Ǥ������δؿ�����ǥ��饹���⥸�塼�롤�᥽�åɡ�����ʤɤ�
-�����Ԥ��ޤ���dbm.c����������Ѥ��ޤ���
-
---
-Init_dbm()
-{
-    /* DBM���饹��������� */
-    cDBM = rb_define_class("DBM", rb_cObject);
-    /* DBM��Enumerate�⥸�塼��򥤥󥯥롼�ɤ��� */
-    rb_include_module(cDBM, rb_mEnumerable);
-
-    /* DBM���饹�Υ��饹�᥽�å�open(): ������C������Ǽ����� */
-    rb_define_singleton_method(cDBM, "open", fdbm_s_open, -1);
-
-    /* DBM���饹�Υ᥽�å�close(): �����Ϥʤ� */
-    rb_define_method(cDBM, "close", fdbm_close, 0);
-    /* DBM���饹�Υ᥽�å�[]: ������1�� */
-    rb_define_method(cDBM, "[]", fdbm_fetch, 1);
-		:
-
-    /* DBM�ǡ������Ǽ���륤�󥹥����ѿ�̾�Τ����ID */
-    id_dbm = rb_intern("dbm");
-}
---
-
-DBM�饤�֥���dbm�Υǡ������б����륪�֥������Ȥˤʤ�Ϥ���
-�����顤C��������dbm��Ruby�������˼�����ɬ�פ�����ޤ���
-
-
-dbm.c�Ǥ�Data_Make_Struct��ʲ��Τ褦�˻ȤäƤ��ޤ���
-
---
-struct dbmdata {
-    int  di_size;
-    DBM *di_dbm;
-};
-
-
-obj = Data_Make_Struct(klass, struct dbmdata, 0, free_dbm, dbmp);
---
-
-�����Ǥ�dbmstruct��¤�ΤؤΥݥ��󥿤�Data�˥��ץ��벽���Ƥ�
-�ޤ���DBM*��ľ�ܥ��ץ��벽���ʤ��Τ�close()�������ν������
-���ƤΤ��ȤǤ���
-
-Data���֥������Ȥ���dbmstruct��¤�ΤΥݥ��󥿤���Ф�����
-�˰ʲ��Υޥ�����ȤäƤ��ޤ���
-
---
-#define GetDBM(obj, dbmp) {\
-    Data_Get_Struct(obj, struct dbmdata, dbmp);\
-    if (dbmp->di_dbm == 0) closed_dbm();\
-}
---
-
-����ä�ʣ���ʥޥ����Ǥ������פ����dbmdata��¤�ΤΥݥ���
-�μ��Ф��ȡ�close����Ƥ��뤫�ɤ����Υ����å���ޤȤ�Ƥ�
-������Ǥ���
-
-DBM���饹�ˤϤ�������᥽�åɤ�����ޤ�����ʬ�ह���3�����
-�����μ�����������ޤ����ҤȤĤϰ����ο�������Τ�Τǡ����
-���Ƥ�delete�᥽�åɤ�����ޤ���delete�᥽�åɤ�������Ƥ���
-fdbm_delete()�Ϥ��Τ褦�ˤʤäƤ��ޤ���
-
---
-static VALUE
-fdbm_delete(obj, keystr)
-    VALUE obj, keystr;
-{
-	:
-}
---
-
-�����ο�������Υ����פ���1������self����2�����ʹߤ��᥽�å�
-�ΰ����Ȥʤ�ޤ���
-
-�����ο�������Τ�Τ�C������Ǽ������Τ�Ruby������Ǽ���
-���ΤȤ�����ޤ���dbm�饤�֥�����ǡ�C������Ǽ�������
-��DBM�Υ��饹�᥽�åɤǤ���open()�Ǥ��������������Ƥ����
-��fdbm_s_open()�Ϥ����ʤäƤ��ޤ���
-
---
-static VALUE
-fdbm_s_open(argc, argv, klass)
-    int argc;
-    VALUE *argv;
-    VALUE klass;
-{
-	:
-    if (rb_scan_args(argc, argv, "11", &file, &vmode) == 1) {
-	mode = 0666;		/* default value */
-    }
-	:
-}
---
-
-���Υ����פδؿ�����1������Ϳ����줿�����ο�����2������Ϳ��
-��줿���������äƤ�������ˤʤ�ޤ���self����3�����Ȥ���Ϳ
-�����ޤ���
-
-���������Ϳ����줿��������Ϥ��뤿��δؿ���open()�Ǥ�Ȥ�
-��Ƥ���rb_scan_args()�Ǥ�����3�����˻��ꤷ���ե����ޥåȤ�
-��������4�ѿ��ʹߤ˻��ꤷ���ѿ����ͤ��������Ƥ���ޤ�������
-�ե����ޥåȤϡ���1ʸ���ܤ���ά�Ǥ��ʤ������ο�����2ʸ���ܤ�
-��ά�Ǥ�������ο�����3ʸ���ܤ��б�������̵꤬�����ޤ�ΰ�
-�������뤫�ɤ����򼨤�"*"�Ǥ���2ʸ���ܤ�3ʸ���ܤϾ�ά�Ǥ���
-����dbm.c����Ǥϡ��ե����ޥåȤ�"11"�Ǥ����顤�����Ϻ���1��
-�ǡ�2�Ĥޤǵ������Ȥ�����̣�ˤʤ�ޤ�����ά����Ƥ������
-�ѿ����ͤ�nil(C����Υ�٥�Ǥ�Qnil)�ˤʤ�ޤ���
-
-Ruby������ǰ������������Τ�indexes������ޤ��������Ϥ�
-���Ǥ���
-
---
-static VALUE
-fdbm_indexes(obj, args)
-    VALUE obj, args;
-{
-	:
-}
---
-
-��1������self����2������Ruby������Ǥ���
-
-** ���ջ���
-
-Ruby�ȶ�ͭ�Ϥ��ʤ���Ruby�Υ��֥������Ȥ��Ǽ�����ǽ���Τ���
-C������ѿ��ϰʲ��δؿ���Ȥä�Ruby���󥿥ץ꥿���ѿ���¸��
-�򶵤��Ƥ����Ƥ����������Ǥʤ���GC�ǥȥ�֥�򵯤����ޤ���
-
-  void rb_global_variable(VALUE *var)
-
-(4) extconf.rb���Ѱդ���
-
-Makefile������ο����ˤʤ�extconf.rb�Ȥ����ե��������
-�ޤ���extconf.rb�ϥ饤�֥��Υ���ѥ����ɬ�פʾ��Υ�����
-���ʤɤ�Ԥ����Ȥ���Ū�Ǥ����ޤ���
-
-  require 'mkmf'
-
-��extconf.rb����Ƭ���֤��ޤ���extconf.rb����Ǥϰʲ���Ruby��
-����Ȥ����Ȥ�����ޤ���
-
-  have_library(lib, func): �饤�֥���¸�ߥ����å�
-  have_func(func, header): �ؿ���¸�ߥ����å�
-  have_header(header): �إå��ե������¸�ߥ����å�
-  create_makefile(target): Makefile������
-
-�ʲ����ѿ���Ȥ����Ȥ��Ǥ��ޤ���
-
-  $CFLAGS: ����ѥ�������ɲ�Ū�˻��ꤹ��ե饰(-O�ʤ�)
-  $CPPFLAGS: �ץ�ץ����å����ɲ�Ū�˻��ꤹ��ե饰(-I��-D�ʤ�)
-  $LDFLAGS: ��󥯻����ɲ�Ū�˻��ꤹ��ե饰(-L�ʤ�)
-  $objs: ��󥯤���륪�֥������ȥե�����̾�Υꥹ��
-
-���֥������ȥե�����Υꥹ�Ȥϡ��̾�ϥ������ե�����򸡺���
-�Ƽ�ưŪ����������ޤ�����make������ǥ���������������褦��
-��������Ū�˻��ꤹ��ɬ�פ�����ޤ���
-
-�饤�֥��򥳥�ѥ��뤹���郎·�鷺�����Υ饤�֥��򥳥�
-�ѥ��뤷�ʤ����ˤ�create_makefile��ƤФʤ����Makefile����
-�����줺������ѥ����Ԥ��ޤ���
-
-(5) depend���Ѱդ���
-
-�⤷���ǥ��쥯�ȥ��depend�Ȥ����ե����뤬¸�ߤ���С�
-Makefile����¸�ط�������å����Ƥ���ޤ���
-
-  % gcc -MM *.c > depend
-
-�ʤɤǺ�뤳�Ȥ�����ޤ������ä�»��̵���Ǥ��礦��
-
-(6) Makefile����������
-
-Makefile��ºݤ��������뤿��ˤ�
-
-  ruby extconf.rb
-
-�Ȥ��ޤ���extconf.rb�� require 'mkmf' �ιԤ��ʤ����ˤϥ��顼
-�ˤʤ�ޤ��Τǡ��������ɲä���
-
-  ruby -r mkmf extconf.rb
-
-�Ȥ��Ƥ���������
-
-�ǥ��쥯�ȥ��ext�ʲ����Ѱդ������ˤ�Ruby���Τ�make�λ���
-��ưŪ��Makefile����������ޤ��Τǡ����Υ��ƥåפ����פǤ���
-
-(7) make����
-
-ưŪ��󥯥饤�֥�������������ˤϤ��ξ��make���Ƥ�����
-����ɬ�פǤ���� make install �ǥ��󥹥ȡ��뤵��ޤ���
-
-ext�ʲ��˥ǥ��쥯�ȥ���Ѱդ������ϡ�Ruby�Υǥ��쥯�ȥ��
-make��¹Ԥ����Makefile����������make��ɬ�פˤ�äƤϤ��Υ�
-���塼���Ruby�ؤΥ�󥯤ޤǼ�ưŪ�˼¹Ԥ��Ƥ���ޤ���
-extconf.rb��񤭴�����ʤɤ���Makefile�κ�������ɬ�פʻ��Ϥ�
-��Ruby�ǥ��쥯�ȥ��make���Ƥ���������
-
-��ĥ�饤�֥���make install��Ruby�饤�֥��Υǥ��쥯�ȥ��
-���˥��ԡ�����ޤ����⤷��ĥ�饤�֥��ȶ�Ĵ���ƻȤ�Ruby�ǵ�
-�Ҥ��줿�ץ�����ब���ꡤRuby�饤�֥����֤��������ˤϡ�
-��ĥ�饤�֥���ѤΥǥ��쥯�ȥ�β��� lib �Ȥ����ǥ��쥯�ȥ�
-���ꡤ������ ��ĥ�� .rb �Υե�������֤��Ƥ�����Ʊ���˥���
-���ȡ��뤵��ޤ���
-
-(8) �ǥХå�
-
-�ޤ����ǥХå����ʤ���ư���ʤ��Ǥ��礦�͡�ext/Setup�˥ǥ���
-���ȥ�̾��񤯤���Ū�˥�󥯤���ΤǥǥХå����Ȥ���褦�ˤ�
-��ޤ�������ʬ����ѥ��뤬�٤��ʤ�ޤ����ɡ�
-
-(9) �Ǥ�������
-
-��Ϥ��ä���Ȥ��ʤꡤ������������ʤꡤ���ʤꡤ����ͳ�ˤ�
-�Ȥ�����������Ruby�κ�Ԥϳ�ĥ�饤�֥��˴ؤ��ư��ڤθ�����
-��ĥ���ޤ���
-
-Appendix A. Ruby�Υ����������ɤ�ʬ��
-
-Ruby�Υ������Ϥ����Ĥ���ʬ�ह�뤳�Ȥ�����ޤ������Τ�������
-���饤�֥�����ʬ�ϴ���Ū�˳�ĥ�饤�֥���Ʊ��������ˤʤ�
-�Ƥ��ޤ��������Υ������Ϻ��ޤǤ������ǤۤȤ������Ǥ����
-�פ��ޤ���
-
-Ruby����Υ���
-
-  class.c
-  error.c
-  eval.c
-  gc.c
-  object.c
-  parse.y
-  variable.c
-
-�桼�ƥ���ƥ��ؿ�
-
-  dln.c
-  regex.c
-  st.c
-  util.c
-
-Ruby���ޥ�ɤμ���
-
-  dmyext.c
-  inits.c
-  main.c
-  ruby.c
-  version.c
-
-���饹�饤�֥��
-
-  array.c
-  bignum.c
-  compar.c
-  dir.c
-  enum.c
-  file.c
-  hash.c
-  io.c
-  marshal.c
-  math.c
-  numeric.c
-  pack.c
-  prec.c
-  process.c
-  random.c
-  range.c
-  re.c
-  signal.c
-  sprintf.c
-  string.c
-  struct.c
-  time.c
-
-Appendix B. ��ĥ�Ѵؿ���ե����
-
-C���줫��Ruby�ε�ǽ�����Ѥ���API�ϰʲ����̤�Ǥ��롥
-
-** ��
-
-VALUE
-
-  Ruby���֥������Ȥ�ɽ�����뷿��ɬ�פ˱����ƥ��㥹�Ȥ����Ѥ��롥
-  �Ȥ߹��߷���ɽ������C�η���ruby.h�˵��Ҥ��Ƥ���R�ǻϤޤ빽¤
-  �ΤǤ��롥VALUE���򤳤��˥��㥹�Ȥ��뤿���R�ǻϤޤ빽¤��
-  ̾��������ʸ���ˤ���̾���Υޥ������Ѱդ���Ƥ��롥
-
-** �ѿ������
-
-Qnil
-
-  ���: nil���֥�������
-
-Qtrue
-
-  ���: true���֥�������(���Υǥե������)
-
-Qfalse
-
-  ���: false���֥�������
-
-** C�ǡ����Υ��ץ��벽
-
-Data_Wrap_Struct(VALUE klass, void (*mark)(), void (*free)(), void *sval)
-
-  C��Ǥ�դΥݥ��󥿤򥫥ץ��벽����Ruby���֥������Ȥ��֤�����
-  �Υݥ��󥿤�Ruby���饢����������ʤ��ʤä�����free�ǻ��ꤷ��
-  �ؿ����ƤФ�롥�ޤ������Υݥ��󥿤λؤ��ǡ�����¾��Ruby����
-  �������Ȥ�ؤ��Ƥ����硤mark�˻��ꤹ��ؿ��ǥޡ�������ɬ��
-  �����롥
-
-Data_Make_Struct(klass, type, mark, free, sval)
-
-  type���Υ����malloc�����ѿ�sval�����������塤����򥫥ץ�
-  �벽�����ǡ������֤��ޥ�����
-
-Data_Get_Struct(data, type, sval)
-
-  data����type���Υݥ��󥿤���Ф��ѿ�sval����������ޥ�����
-
-** �������å�
-
-TYPE(value)
-FIXNUM_P(value)
-NIL_P(value)
-void Check_Type(VALUE value, int type)
-void Check_SafeStr(VALUE value)
-
-** ���Ѵ�
-
-FIX2INT(value)
-INT2FIX(i)
-NUM2INT(value)
-INT2NUM(i)
-NUM2DBL(value)
-rb_float_new(f)
-StringValue(value)
-StringValuePtr(value)
-StringValueCStr(value)
-rb_str_new2(s)
-
-** ���饹/�⥸�塼�����
-
-VALUE rb_define_class(const char *name, VALUE super)
-
-  super�Υ��֥��饹�Ȥ��ƿ�����Ruby���饹��������롥
-
-VALUE rb_define_class_under(VALUE module, const char *name, VALUE super)
-
-  super�Υ��֥��饹�Ȥ��ƿ�����Ruby���饹���������module��
-  ����Ȥ���������롥
-
-VALUE rb_define_module(const char *name)
-
-  ������Ruby�⥸�塼���������롥
-
-VALUE rb_define_module_under(VALUE module, const char *name)
-
-  ������Ruby�⥸�塼����������module������Ȥ���������롥
-
-void rb_include_module(VALUE klass, VALUE module)
-
-  �⥸�塼��򥤥󥯥롼�ɤ��롥class�����Ǥ�module�򥤥�
-  �롼�ɤ��Ƥ�����ˤϲ��⤷�ʤ�(¿�ť��󥯥롼�ɤζػ�)��
-
-void rb_extend_object(VALUE object, VALUE module)
-
-  ���֥������Ȥ�⥸�塼��(���������Ƥ���᥽�å�)�ǳ�ĥ���롥
-
-** ����ѿ����
-
-void rb_define_variable(const char *name, VALUE *var)
-
-  Ruby��C�ȤǶ�ͭ���륰�����Х��ѿ���������롥�ѿ�̾��`$'��
-  �Ϥޤ�ʤ����ˤϼ�ưŪ���ɲä���롥name�Ȥ���Ruby�μ��̻�
-  �Ȥ��Ƶ�����ʤ�ʸ��(�㤨��` ')��ޤ���ˤ�Ruby�ץ�����
-  �फ��ϸ����ʤ��ʤ롥
-
-void rb_define_readonly_variable(const char *name, VALUE *var)
-
-  Ruby��C�ȤǶ�ͭ����read only�Υ������Х��ѿ���������롥
-  read only�Ǥ��뤳�Ȱʳ���rb_define_variable()��Ʊ����
-
-void rb_define_virtual_variable(const char *name,
-				VALUE (*getter)(), void (*setter)())
-
-  �ؿ��ˤ�äƼ¸������Ruby�ѿ���������롥�ѿ������Ȥ��줿
-  ���ˤ�getter�����ѿ����ͤ����åȤ��줿���ˤ�setter���ƤФ�
-  �롥
-
-void rb_define_hooked_variable(const char *name, VALUE *var,
-			       VALUE (*getter)(), void (*setter)())
-
-  �ؿ��ˤ�ä�hook�ΤĤ���줿�������Х��ѿ���������롥�ѿ�
-  �����Ȥ��줿���ˤ�getter�����ؿ����ͤ����åȤ��줿���ˤ�
-  setter���ƤФ�롥getter��setter��0����ꤷ�����ˤ�hook��
-  ���ꤷ�ʤ��Τ�Ʊ�����ˤʤ롥
-
-void rb_global_variable(VALUE *var)
-
-  GC�Τ��ᡤRuby�ץ�����फ��ϥ�����������ʤ���, Ruby����
-  �������Ȥ�ޤ�����ѿ���ޡ������롥
-
-** ���
-
-void rb_define_const(VALUE klass, const char *name, VALUE val)
-
-  �����������롥
-
-void rb_define_global_const(const char *name, VALUE val)
-
-  ��������������롥
-
-     rb_define_const(rb_cObject, name, val)
-
-  ��Ʊ����̣��
-
-** �᥽�å����
-
-rb_define_method(VALUE klass, const char *name, VALUE (*func)(), int argc)
-
-  �᥽�åɤ�������롥argc��self����������ο���argc��-1�λ�, 
-  �ؿ��ˤϰ����ο�(self��ޤޤʤ�)����1����, �������������2
-  �����Ȥ��������Ϳ������(��3������self)��argc��-2�λ�, 
-  ��1������self, ��2������args(args�ϰ�����ޤ�Ruby������)��
-  ����������Ϳ�����롥
- 
-rb_define_private_method(VALUE klass, const char *name, VALUE (*func)(), int argc)
-
-  private�᥽�åɤ�������롥������rb_define_method()��Ʊ����
-
-rb_define_singleton_method(VALUE klass, const char *name, VALUE (*func)(), int argc)
-
-  �ðۥ᥽�åɤ�������롥������rb_define_method()��Ʊ����
-
-rb_scan_args(int argc, VALUE *argv, const char *fmt, ...)
-
-  argc, argv������Ϳ����줿������ʬ�򤹤롥fmt��ɬ�ܰ����ο�, 
-  �ղð����ο�, �Ĥ�ΰ��������뤫����ꤹ��ʸ�����, "����
-  ����*"�Ȥ��������Ǥ��롥 2 ���ܤο�����"*"�Ϥ��줾���ά��
-  ǽ�Ǥ��롥ɬ�ܰ�������Ĥ�ʤ�����0����ꤹ�롥��3������
-  �ߤ��ѿ��ؤΥݥ��󥿤�, �����������Ǥ������ѿ��˳�Ǽ����롥
-  �ղð������б����������Ϳ�����Ƥ��ʤ������ѿ���Qnil��
-  ��������롥
-
-** Ruby�᥽�åɸƤӽФ�
-
-VALUE rb_funcall(VALUE recv, ID mid, int narg, ...)
-
-  �᥽�åɸƤӽФ���ʸ���󤫤�mid�����뤿��ˤ�rb_intern()��
-  �Ȥ���
-
-VALUE rb_funcall2(VALUE recv, ID mid, int argc, VALUE *argv)
-
-  �᥽�åɸƤӽФ���������argc, argv�������Ϥ���
-
-VALUE rb_eval_string(const char *str)
-
-  ʸ�����Ruby������ץȤȤ��ƥ���ѥ��롦�¹Ԥ��롥
-
-ID rb_intern(const char *name)
-
-  ʸ������б�����ID���֤���
-
-char *rb_id2name(ID id)
-
-  ID���б�����ʸ������֤�(�ǥХå���)��
-
-char *rb_class2name(VALUE klass)
-
-  ���饹��̾�����֤�(�ǥХå���)�����饹��̾��������ʤ����ˤ�, 
-  ������̤ä�̾������ĥ��饹��̾�����֤���
-
-int rb_respond_to(VALUE obj, ID id)
-
-  obj��id�Ǽ������᥽�åɤ���Ĥ��ɤ������֤���
-
-** ���󥹥����ѿ�
-
-VALUE rb_iv_get(VALUE obj, const char *name)
-
-  obj�Υ��󥹥����ѿ����ͤ����롥`@'�ǻϤޤ�ʤ����󥹥���
-  ���ѿ��� Ruby�ץ�����फ�饢�������Ǥ��ʤ��ֱ��줿�ץ���
-  �������ѿ��ˤʤ롥�������ʸ����̾������ĥ��饹(�ޤ���
-  �⥸�塼��)�Υ��󥹥����ѿ��Ȥ��Ƽ�������Ƥ��롥
-
-VALUE rb_iv_set(VALUE obj, const char *name, VALUE val)
-
-  obj�Υ��󥹥����ѿ���val�˥��åȤ��롥
-
-** ���湽¤
-
-VALUE rb_iterate(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2)
-
-  func2��֥��å��Ȥ������ꤷ, func1�򥤥ƥ졼���Ȥ��ƸƤ֡� 
-  func1�ˤ� arg1�������Ȥ����Ϥ���, func2�ˤ���1�����˥��ƥ졼
-  ������Ϳ����줿��, ��2������arg2���Ϥ���롥
- 
-VALUE rb_yield(VALUE val)
-
-  val���ͤȤ��ƥ��ƥ졼���֥��å���ƤӽФ���
-
-VALUE rb_rescue(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2)
-
-  �ؿ�func1��arg1������˸ƤӽФ���func1�μ¹�����㳰��ȯ��
-  �������ˤ� func2��arg2������Ȥ��ƸƤ֡�����ͤ��㳰��ȯ��
-  ���ʤ��ä�����func1�������, �㳰��ȯ���������ˤ�func2����
-  ���ͤǤ��롥
-
-VALUE rb_ensure(VALUE (*func1)(), VALUE arg1, void (*func2)(), VALUE arg2)
-
-  �ؿ�func1��arg1������Ȥ��Ƽ¹Ԥ�, �¹Խ�λ��(���Ȥ��㳰��
-  ȯ�����Ƥ�) func2��arg2������Ȥ��Ƽ¹Ԥ��롥����ͤ�func1
-  ������ͤǤ���(�㳰��ȯ�������������ʤ�)��
-
-** �㳰�����顼
-
-void rb_warning(const char *fmt, ...)
-
-  rb_verbose����ɸ�२�顼���Ϥ˷ٹ�����ɽ�����롥������
-  printf()��Ʊ����
-
-void rb_raise(rb_eRuntimeError, const char *fmt, ...)
-
-  RuntimeError�㳰��ȯ�������롥������printf()��Ʊ����
-
-void rb_raise(VALUE exception, const char *fmt, ...)
-
-  exception�ǻ��ꤷ���㳰��ȯ�������롥fmt�ʲ��ΰ�����
-  printf()��Ʊ����
-
-void rb_fatal(const char *fmt, ...)
-
-  ��̿Ū�㳰��ȯ�������롥�̾���㳰�����ϹԤʤ�줺, ���󥿡�
-  �ץ꥿����λ����(������ensure�ǻ��ꤵ�줿�����ɤϽ�λ����
-  �¹Ԥ����)��
-
-void rb_bug(const char *fmt, ...)
-
-  ���󥿡��ץ꥿�ʤɥץ������ΥХ��Ǥ���ȯ������Ϥ��Τʤ�
-  �����λ��Ƥ֡����󥿡��ץ꥿�ϥ�������פ�ľ���˽�λ���롥
-  �㳰�����ϰ��ڹԤʤ��ʤ���
-
-** Ruby�ν�������¹�
-
-Ruby�򥢥ץꥱ����������������ˤϰʲ��Υ��󥿥ե�����
-��Ȥ����̾�γ�ĥ�饤�֥��ˤ�ɬ�פʤ���
-
-void ruby_init()
-
-  Ruby���󥿥ץ꥿�ν������Ԥʤ���
-
-void ruby_options(int argc, char **argv)
-
-  Ruby���󥿥ץ꥿�Υ��ޥ�ɥ饤������ν�����Ԥʤ���
-
-void ruby_run()
-
-  Ruby���󥿥ץ꥿��¹Ԥ��롥
-
-void ruby_script(char *name)
-
-  Ruby�Υ�����ץ�̾($0)�����ꤹ�롥
-
-
-Appendix C. extconf.rb�ǻȤ���ؿ�����
-
-extconf.rb����Ǥ����Ѳ�ǽ�ʥ���ѥ���������å��δؿ��ϰ�
-�����̤�Ǥ��롥
-
-have_macro(macro, headers)
-
-  �إå��ե�����header�򥤥󥯥롼�ɤ��ƥޥ���macro�������
-  ��Ƥ��뤫�ɤ��������å����롥�ޥ������������Ƥ����true
-  ���֤���
-
-have_library(lib, func)
-
-  �ؿ�func��������Ƥ���饤�֥��lib��¸�ߤ�����å����롥
-  �饤�֥�꤬¸�ߤ������true���֤���
-
-find_library(lib, func, path...)
-
-  �ؿ�func��������Ƥ���饤�֥��lib��¸�ߤ� -Lpath ���ɲ�
-  ���ʤ�������å����롥�饤�֥�꤬���դ��ä�����true���֤���
-
-have_func(func, header)
-
-  �إå��ե�����header�򥤥󥯥롼�ɤ��ƴؿ�func��¸�ߤ������
-  �����롥func��ɸ��Ǥϥ�󥯤���ʤ��饤�֥����Τ�ΤǤ�
-  ����ˤ����have_library�Ǥ��Υ饤�֥�������å����Ƥ���
-  �����ؿ���¸�ߤ����true���֤���
-
-have_var(var, header)
-
-  �إå��ե�����header�򥤥󥯥롼�ɤ����ѿ�var��¸�ߤ������
-  �����롥var��ɸ��Ǥϥ�󥯤���ʤ��饤�֥����Τ�ΤǤ�
-  ����ˤ����have_library�Ǥ��Υ饤�֥�������å����Ƥ���
-  �����ѿ���¸�ߤ����true���֤���
-
-have_header(header)
-
-  �إå��ե������¸�ߤ�����å����롥�إå��ե����뤬¸�ߤ�
-  ���true���֤���
-
-find_header(header, path...)
-
-  �إå��ե�����header��¸�ߤ� -Ipath ���ɲä��ʤ�������å�
-  ���롥�إå��ե����뤬���դ��ä�����true���֤���
-
-have_struct_member(type, member, header)
-
-  �إå��ե�����header�򥤥󥯥롼�ɤ��Ʒ�type�˥���member
-  ��¸�ߤ��뤫������å����롥type���������Ƥ��ơ�member��
-  ���Ĥ����true���֤���
-
-have_type(type, header, opt)
-
-  �إå��ե�����header�򥤥󥯥롼�ɤ��Ʒ�type��¸�ߤ��뤫��
-  �����å����롥type���������Ƥ����true���֤���
-
-check_sizeof(type, header)
-
-  �إå��ե�����header�򥤥󥯥롼�ɤ��Ʒ�type��charñ�̥���
-  ����Ĵ�٤롥type���������Ƥ�������Υ��������֤��������
-  ��Ƥ��ʤ��Ȥ���nil���֤���
-
-create_makefile(target)
-
-  ��ĥ�饤�֥���Ѥ�Makefile���������롥���δؿ���ƤФʤ���
-  �Ф��Υ饤�֥��ϥ���ѥ��뤵��ʤ���target�ϥ⥸�塼��̾
-  ��ɽ����
-
-find_executable(command, path)
-
-  ���ޥ��command��File::PATH_SEPARATOR�Ƕ��ڤ�줿�ѥ�̾��
-  �ꥹ��path����õ����path��nil�ޤ��Ͼ�ά���줿���ϡ��Ķ�
-  �ѿ�PATH���ͤ���Ѥ��롥�¹Բ�ǽ�ʥ��ޥ�ɤ����Ĥ��ä����
-  �ϥѥ���ޤ�ե�����̾�����Ĥ���ʤ��ä�����nil���֤���
-
-with_config(withval[, default=nil])
-
-  ���ޥ�ɥ饤����--with-<withval>�ǻ��ꤵ�줿���ץ�����ͤ����롥
-
-enable_config(config, *defaults)
-disable_config(config, *defaults)
-
-  ���ޥ�ɥ饤����--enable-<config>�ޤ���
-  --disable-<config>�ǻ��ꤵ�줿�����ͤ����롥
-  --enable-<config>�����ꤵ��Ƥ�������true��
-  --disable-<config>�����ꤵ��Ƥ�������false���֤���
-  �ɤ������ꤵ��Ƥ��ʤ����ϡ��֥��å��Ĥ��ǸƤӽФ���Ƥ������
-  *defaults��yield������̡��֥��å��ʤ��ʤ�*defaults���֤���
-
-dir_config(target[, default_dir])
-dir_config(target[, default_include, default_lib])
-
-  ���ޥ�ɥ饤����--with-<target>-dir, --with-<target>-include,
-  --with-<target>-lib�Τ����줫�ǻ��ꤵ���ǥ��쥯�ȥ��
-  $CFLAGS �� $LDFLAGS ���ɲä��롥--with-<target>-dir=/path��
-  --with-<target>-include=/path/include --with-<target>-lib=/path/lib
-  �������Ǥ��롥�ɲä��줿 include �ǥ��쥯�ȥ�� lib �ǥ��쥯�ȥ��
-  ������֤��� ([include_dir, lib_dir])
-
-pkg_config(pkg)
-
-  pkg-config���ޥ�ɤ���ѥå�����pkg�ξ�������롥 
-  pkg-config�μºݤΥ��ޥ��̾�ϡ�--with-pkg-config���ޥ��
-  �饤�󥪥ץ����ǻ����ǽ��
-
-/*
- * Local variables:
- * fill-column: 60
- * end:
- */
+doc/extension.ja.rdocに移動しました
diff --git a/README.ja b/README.ja
deleted file mode 100644
index df8cfc03f4..0000000000
--- a/README.ja
+++ /dev/null
@@ -1,160 +0,0 @@
-* Ruby�Ȥ�
-
-Ruby�ϥ���ץ뤫�Ķ��Ϥʥ��֥������Ȼظ�������ץȸ���Ǥ���
-Ruby�Ϻǽ餫����ʥ��֥������Ȼظ�����Ȥ����߷פ���Ƥ���
-�����顤���֥������Ȼظ��ץ�����ߥ󥰤��ڤ˹Ԥ����������
-������������̾�μ�³�����Υץ�����ߥ󥰤��ǽ�Ǥ���
-
-Ruby�ϥƥ����Ƚ����ط���ǽ�Ϥʤɤ�ͥ�졤Perl��Ʊ�����餤����
-�Ǥ�������˥���ץ��ʸˡ�ȡ��㳰�����䥤�ƥ졼���ʤɤε���
-�ˤ�äơ����ʬ����䤹���ץ�����ߥ󥰤�����ޤ���
-
-
-* Ruby����Ĺ
-
-  + ����ץ��ʸˡ
-  + ���̤Υ��֥������Ȼظ���ǽ(���饹���᥽�åɥ�����ʤ�)
-  + �ü�ʥ��֥������Ȼظ���ǽ(Mixin, �ðۥ᥽�åɤʤ�)
-  + �黻�ҥ����С�������
-  + �㳰������ǽ
-  + ���ƥ졼���ȥ���������
-  + �����١������쥯��
-  + �����ʥߥå������ǥ��� (�������ƥ�����ˤ��)
-  + �ܿ������⤤��¿����UNIX���ư�������Ǥʤ���DOS��Windows��
-    Mac��BeOS�ʤɤξ�Ǥ�ư��
-
-
-* ����ˡ
-
-** FTP��
-
-�ʲ��ξ��ˤ����Ƥ���ޤ���
-
-  ftp://ftp.ruby-lang.org/pub/ruby/
-
-** Subversion��
-
-�ܥ֥�����Ruby�κǿ��Υ����������ɤϼ��Υ��ޥ�ɤǼ����Ǥ��ޤ���
-
-  $ svn co http://svn.ruby-lang.org/repos/ruby/branches/ruby_1_8_6/
-
-��ȯ��ü�Υ����������ɤϼ��Υ��ޥ�ɤǼ����Ǥ��ޤ���
-
-  $ svn co http://svn.ruby-lang.org/repos/ruby/trunk/ ruby
-
-¾�˳�ȯ��Υ֥����ΰ����ϼ��Υ��ޥ�ɤǸ����ޤ���
-
-  $ svn ls http://svn.ruby-lang.org/repos/ruby/branches/
-
-
-* �ۡ���ڡ���
-
-Ruby�Υۡ���ڡ�����URL��
-
-   http://www.ruby-lang.org/
-
-�Ǥ���
-
-
-* �᡼��󥰥ꥹ��
-
-Ruby�Υ᡼��󥰥ꥹ�Ȥ�����ޤ������ô�˾������
-
-   ruby-list-ctl@ruby-lang.org
-
-�ޤ���ʸ��
-
-   subscribe YourFirstName YourFamilyName
-   
-�Ƚ񤤤����äƲ������� 
-
-Ruby��ȯ�Ը����᡼��󥰥ꥹ�Ȥ⤢��ޤ���������Ǥ�ruby�Υ�
-��������λ��ͳ�ĥ�ʤɼ����������ˤĤ��Ƶ�������Ƥ��ޤ���
-���ô�˾������
-
-   ruby-dev-ctl@ruby-lang.org
-
-�ޤ�ruby-list��Ʊ�ͤ���ˡ�ǥ᡼�뤷�Ƥ��������� 
-
-Ruby��ĥ�⥸�塼��ˤĤ����ä��礦ruby-ext�᡼��󥰥ꥹ�Ȥ�
-���شط�������ˤĤ����ä��礦ruby-math�᡼��󥰥ꥹ�Ȥ�
-�Ѹ���ä��礦ruby-talk�᡼��󥰥ꥹ�Ȥ⤢��ޤ���������ˡ
-�Ϥɤ��Ʊ���Ǥ��� 
-
-
-* ����ѥ��롦���󥹥ȡ���
-
-�ʲ��μ��ǹԤäƤ���������
-
-  1. �⤷configure�ե����뤬���Ĥ���ʤ����⤷����
-     configure.in���Ť��褦�ʤ顢autoconf��¹Ԥ���
-     ������configure����������
-
-  2. configure��¹Ԥ���Makefile�ʤɤ���������
-
-  3. (ɬ�פʤ��)defines.h���Խ�����
-
-     ¿ʬ��ɬ��̵���Ȼפ��ޤ���
-
-  4. (ɬ�פʤ��)ext/Setup����Ū�˥�󥯤����ĥ�⥸�塼���
-     ���ꤹ��
-
-     ext/Setup�˵��Ҥ����⥸�塼�����Ū�˥�󥯤���ޤ���
-
-     �����ʥߥå������ǥ��󥰤򥵥ݡ��Ȥ��Ƥ��ʤ��������ƥ�
-     ����Ǥ�Setup��1���ܤΡ�option nodynamic�פȤ����ԤΥ�
-     ���Ȥ򳰤�ɬ�פ�����ޤ����ޤ������Υ������ƥ������
-     ��ĥ�⥸�塼������Ѥ��뤿��ˤϡ����餫������Ū�˥��
-     �����Ƥ���ɬ�פ�����ޤ���
-
-  5. make��¹Ԥ��ƥ���ѥ��뤹��
-
-  6. make test�ǥƥ��Ȥ�Ԥ���
-
-     ��test succeeded�פ�ɽ�������������Ǥ����������ƥ���
-     ���������Ƥⴰ�������ݾڤ���Ƥ������ǤϤ���ޤ���
-
-  7. make install
-
-     root�Ǻ�Ȥ���ɬ�פ����뤫�⤷��ޤ���
-
-�⤷������ѥ�����˥��顼��ȯ���������ˤϥ��顼�Υ����ȥ�
-����OS�μ����ޤ�Ǥ�������ܤ�����ݡ��Ȥ��Ԥ����äƤ�
-�������¾�����Τ���ˤ�ʤ�ޤ���
-
-
-* �ܿ�
-
-UNIX�Ǥ����configure���ۤȤ�ɤκ��ۤ�ۼ����Ƥ����Ϥ���
-�������פ�̸���Ȥ������ä����(����˰㤤�ʤ�)����Ԥˤ���
-���Ȥ��ݡ��Ȥ���С����Ǥ��뤫���Τ�ޤ���
-
-�������ƥ�����ˤ�äȤ��¸����Τ�GC���Ǥ���Ruby��GC���о�
-�Υ������ƥ����㤬setjmp()�ˤ�ä����ƤΥ쥸������ jmp_buf��
-��Ǽ���뤳�Ȥȡ�jmp_buf�ȥ����å���32bit���饤����Ȥ����
-���뤳�Ȥ��ꤷ�Ƥ��ޤ����ä����Ԥ���Ω���ʤ������б�����
-��˺���Ǥ��礦����Ԥβ������Ū��ñ�ǡ�gc.c�ǥ����å���
-�ޡ������Ƥ�����ʬ�˥��饤����ȤΥХ��ȿ��������餷�ƥޡ�
-�����륳���ɤ��ɲä�������ǺѤߤޤ�����defined(THINK_C)�פ�
-����Ƥ�����ʬ�򻲹ͤˤ��Ƥ�������
-
-# �ºݤˤ�Ruby��Think C�Ǥϥ���ѥ���Ǥ��ޤ���
-
-�쥸����������ɥ������CPU�Ǥϡ��쥸����������ɥ��򥹥���
-���˥ե�å��夹�륢����֥饳���ɤ��ɲä���ɬ�פ����뤫����
-��ޤ���
-
-
-* ���۾��
-
-COPYING.ja�ե�����򻲾Ȥ��Ƥ���������
-
-
-* ����
-
-�����ȡ��Х���ݡ��Ȥ���¾�� matz@netlab.jp �ޤǡ�
--------------------------------------------------------
-created at: Thu Aug  3 11:57:36 JST 1995
-Local variables:
-mode: indented-text
-end:
diff --git a/README.ja.md b/README.ja.md
new file mode 100644
index 0000000000..eee54a9171
--- /dev/null
+++ b/README.ja.md
@@ -0,0 +1,171 @@
+# Rubyとは
+
+Rubyはシンプルかつ強力なオブジェクト指向スクリプト言語です． Rubyは純粋なオブジェクト指向言語として設計されているので，
+オブジェクト指向プログラミングを手軽に行う事が出来ます．もちろん普通の手続き型のプログラミングも可能です．
+
+Rubyはテキスト処理関係の能力などに優れ，Perlと同じくらい強力です．さらにシンプルな文法と，
+例外処理やイテレータなどの機構によって，より分かりやすいプログラミングが出来ます．
+
+## Rubyの特長
+
+*   シンプルな文法
+*   普通のオブジェクト指向機能(クラス，メソッドコールなど)
+*   特殊なオブジェクト指向機能(Mixin, 特異メソッドなど)
+*   演算子オーバーロード
+*   例外処理機能
+*   イテレータとクロージャ
+*   ガーベージコレクタ
+*   ダイナミックローディング (アーキテクチャによる)
+*   移植性が高い．多くのUnix-like/POSIX互換プラットフォーム上で動くだけでなく，Windows， Mac OS
+    X，BeOSなどの上でも動く cf.
+    http://bugs.ruby-lang.org/projects/ruby-trunk/wiki/SupportedPlatformsJa
+
+
+## 入手法
+
+### FTPで
+
+以下の場所においてあります．
+
+ftp://ftp.ruby-lang.org/pub/ruby/
+
+### Subversionで
+
+開発先端のソースコードは次のコマンドで取得できます．
+
+    $ svn co http://svn.ruby-lang.org/repos/ruby/trunk/ ruby
+
+他に開発中のブランチの一覧は次のコマンドで見られます．
+
+    $ svn ls http://svn.ruby-lang.org/repos/ruby/branches/
+
+### Gitで
+
+SubversionのミラーをGitHubに公開しています． 以下のコマンドでリポジトリを取得できます．
+
+    $ git clone git://github.com/ruby/ruby.git
+
+## ホームページ
+
+RubyのホームページのURLは
+
+http://www.ruby-lang.org/
+
+です．
+
+## メーリングリスト
+
+Rubyのメーリングリストがあります．参加希望の方は
+
+mailto:ruby-list-request@ruby-lang.org
+
+まで本文に
+
+    subscribe
+
+と書いて送って下さい．
+
+Ruby開発者向けメーリングリストもあります．こちらではrubyのバグ，将来の仕様拡張など実装上の問題について議論されています． 参加希望の方は
+
+mailto:ruby-dev-request@ruby-lang.org
+
+までruby-listと同様の方法でメールしてください．
+
+Ruby拡張モジュールについて話し合うruby-extメーリングリストと数学関係の話題について話し合うruby-mathメーリングリストと
+英語でrubyについて話し合うruby-talkメーリングリストもあります．参加方法はどれも同じです．
+
+## コンパイル・インストール
+
+以下の手順で行ってください．
+
+1.  もし `configure` ファイルが見つからない，もしくは `configure.in` より古いようなら， `autoconf` を実行して
+    新しく `configure` を生成する
+
+2.  `configure` を実行して `Makefile` などを生成する
+
+    環境によってはデフォルトのCコンパイラ用オプションが付きます． `configure` オプションで `optflags=..`
+    `warnflags=..` 等で上書きできます．
+
+3.  (必要ならば)`defines.h` を編集する
+
+    多分，必要無いと思います．
+
+4.  (必要ならば)`ext/Setup` に静的にリンクする拡張モジュールを指定する
+
+    `ext/Setup` に記述したモジュールは静的にリンクされます．
+
+    ダイナミックローディングをサポートしていないアーキテクチャでは `Setup` の1行目の「`option nodynamic`」という行のコ
+    メントを外す必要があります．また，このアーキテクチャで拡張モジュールを利用するためには，あらかじめ静的にリンクをしておく必要があります．
+
+5.  `make` を実行してコンパイルする
+
+6.  `make check`でテストを行う．
+
+    「`check succeeded`」と表示されれば成功です．ただしテストに成功しても完璧だと保証されている訳ではありません．
+
+7.  `make install`
+
+    以下のディレクトリを作って，そこにファイルをインストー ルします．
+
+    *   `${DESTDIR}${prefix}/bin`
+    *   `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}`
+    *   `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
+    *   `${DESTDIR}${prefix}/lib`
+    *   `${DESTDIR}${prefix}/lib/ruby`
+    *   `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}`
+    *   `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
+    *   `${DESTDIR}${prefix}/lib/ruby/site_ruby`
+    *   `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}`
+    *   `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
+    *   `${DESTDIR}${prefix}/lib/ruby/vendor_ruby`
+    *   `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}`
+    *   `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
+    *   `${DESTDIR}${prefix}/lib/ruby/gems/${MAJOR}.${MINOR}.${TEENY}`
+    *   `${DESTDIR}${prefix}/share/man/man1`
+    *   `${DESTDIR}${prefix}/share/ri/${MAJOR}.${MINOR}.${TEENY}/system`
+
+
+    RubyのAPIバージョンが'*x.y.z*'であれば，`${MAJOR}`は
+    '*x*'で，`${MINOR}`は'*y*'，`${TEENY}`は'*z*'です．
+
+    **注意**: APIバージョンの `teeny` は，Rubyプログラムのバージョンとは異なることがあります．
+
+    `root` で作業する必要があるかもしれません．
+
+
+もし，コンパイル時にエラーが発生した場合にはエラーのログとマシン，OSの種類を含むできるだけ詳しいレポートを作者に送って下さると他の方のためにもなります．
+
+## 移植
+
+UNIXであれば `configure` がほとんどの差異を吸収してくれるはずですが，思わぬ見落としがあった場合(ある事が多い)，作者にその
+ことを報告すれば，解決できる可能性があります．
+
+アーキテクチャにもっとも依存するのはGC部です．RubyのGCは対象
+のアーキテクチャが`setjmp()`または`getcontext()`によって全てのレジスタを `jmp_buf` や `ucontext_t`
+に格納することと， `jmp_buf` や `ucontext_t` とスタックが32bitアラインメントされていることを仮定
+しています．特に前者が成立しない場合の対応は非常に困難でしょう． 後者の解決は比較的簡単で， `gc.c` でスタックをマークしている
+部分にアラインメントのバイト数だけずらしてマークするコードを追加するだけで済みます．`defined(__mc68000__)`で括られてい
+る部分を参考にしてください．
+
+レジスタウィンドウを持つCPUでは，レジスタウィンドウをスタックにフラッシュするアセンブラコードを追加する必要があるかもしれません．
+
+## 配布条件
+
+`COPYING.ja` ファイルを参照してください．
+
+## フィードバック
+
+Rubyに関する質問は Ruby-Talk（英語）や Ruby-List（日本語） (https://www.ruby-lang.org/ja/community/mailing-lists) や，
+stackoverflow (http://ja.stackoverflow.com/) などのWebサイトに投稿してください．
+
+バグ報告は http://bugs.ruby-lang.org で受け付けています．
+
+
+## 著者
+
+Rubyのオリジナル版は，1995年にまつもとゆきひろ氏によって設計・開発されました．
+
+<mailto:matz@ruby-lang.org>
+
+---
+created at: Thu Aug  3 11:57:36 JST 1995
diff --git a/README.md b/README.md
new file mode 100644
index 0000000000..14fb7aa213
--- /dev/null
+++ b/README.md
@@ -0,0 +1,164 @@
+# What's Ruby
+
+Ruby is the interpreted scripting language for quick and easy object-oriented
+programming.  It has many features to process text files and to do system
+management tasks (as in Perl).  It is simple, straight-forward, and
+extensible.
+
+## Features of Ruby
+
+*   Simple Syntax
+*   **Normal** Object-oriented Features (e.g. class, method calls)
+*   **Advanced** Object-oriented Features (e.g. Mix-in, Singleton-method)
+*   Operator Overloading
+*   Exception Handling
+*   Iterators and Closures
+*   Garbage Collection
+*   Dynamic Loading of Object Files (on some architectures)
+*   Highly Portable (works on many Unix-like/POSIX compatible platforms as
+    well as Windows, Mac OS X, BeOS, etc.) cf.
+    http://bugs.ruby-lang.org/projects/ruby-trunk/wiki/SupportedPlatforms
+
+
+## How to get Ruby
+
+For a complete list of ways to install Ruby, including using third-party tools
+like rvm, see:
+
+http://www.ruby-lang.org/en/downloads/
+
+The Ruby distribution files can be found on the following FTP site:
+
+ftp://ftp.ruby-lang.org/pub/ruby/
+
+The trunk of the Ruby source tree can be checked out with the following
+command:
+
+    $ svn co http://svn.ruby-lang.org/repos/ruby/trunk/ ruby
+
+Or if you are using git then use the following command:
+
+    $ git clone git://github.com/ruby/ruby.git
+
+There are some other branches under development.  Try the following command
+to see the list of branches:
+
+    $ svn ls http://svn.ruby-lang.org/repos/ruby/branches/
+
+Or if you are using git then use the following command:
+
+    $ git ls-remote git://github.com/ruby/ruby.git
+
+## Ruby home page
+
+The URL of the Ruby home page is:
+
+http://www.ruby-lang.org/
+
+## Mailing list
+
+There is a mailing list to talk about Ruby. To subscribe this list, please
+send the following phrase:
+
+    subscribe
+
+in the mail body (not subject) to the address
+<mailto:ruby-talk-request@ruby-lang.org>.
+
+## How to compile and install
+
+This is what you need to do to compile and install Ruby:
+
+1.  If you want to use Microsoft Visual C++ to compile ruby, read
+    win32/README.win32 instead of this document.
+
+2.  If `./configure` does not exist or is older than configure.in, run
+    `autoconf` to (re)generate configure.
+
+3.  Run `./configure`, which will generate `config.h` and `Makefile`.
+
+    Some C compiler flags may be added by default depending on your
+    environment.  Specify `optflags=..` and `warnflags=..` as necessary to
+    override them.
+
+4.  Edit `defines.h` if you need. Usually this step will not be needed.
+
+5.  Remove comment mark(`#`) before the module names from `ext/Setup` (or add
+    module names if not present), if you want to link modules statically.
+
+    If you don't want to compile non static extension modules (probably on
+    architectures which do not allow dynamic loading), remove comment mark
+    from the line "`#option nodynamic`" in `ext/Setup`.
+
+    Usually this step will not be needed.
+
+6.  Run `make`.
+
+7.  Optionally, run '`make check`' to check whether the compiled Ruby
+    interpreter works well. If you see the message "`check succeeded`", your
+    ruby works as it should (hopefully).
+
+8.  Run '`make install`'
+
+    This command will create following directories and install files onto
+    them.
+
+    *   `${DESTDIR}${prefix}/bin`
+    *   `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}`
+    *   `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
+    *   `${DESTDIR}${prefix}/lib`
+    *   `${DESTDIR}${prefix}/lib/ruby`
+    *   `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}`
+    *   `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
+    *   `${DESTDIR}${prefix}/lib/ruby/site_ruby`
+    *   `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}`
+    *   `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
+    *   `${DESTDIR}${prefix}/lib/ruby/vendor_ruby`
+    *   `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}`
+    *   `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
+    *   `${DESTDIR}${prefix}/lib/ruby/gems/${MAJOR}.${MINOR}.${TEENY}`
+    *   `${DESTDIR}${prefix}/share/man/man1`
+    *   `${DESTDIR}${prefix}/share/ri/${MAJOR}.${MINOR}.${TEENY}/system`
+
+
+    If Ruby's API version is '*x.y.z*', the `${MAJOR}` is '*x*', the
+    `${MINOR}` is '*y*', and the `${TEENY}` is '*z*'.
+
+    **NOTE**: teeny of the API version may be different from one of Ruby's
+    program version
+
+    You may have to be a super user to install ruby.
+
+
+If you fail to compile ruby, please send the detailed error report with the
+error log and machine/OS type, to help others.
+
+Some extension libraries may not get compiled because of lack of necessary
+external libraries and/or headers, then you will need to run '`make distclean-ext`'
+to remove old configuration after installing them in such case.
+
+## Copying
+
+See the file `COPYING`.
+
+## Feedback
+
+Questions about the Ruby language can be asked on the Ruby-Talk mailing list
+(http://www.ruby-lang.org/en/community/mailing-lists) or on websites like
+(http://stackoverflow.com).
+
+Bug reports should be filed at http://bugs.ruby-lang.org. Read [HowToReport] for more information.
+
+[HowToReport]: https://bugs.ruby-lang.org/projects/ruby/wiki/HowToReport
+
+##Contributing
+
+See the file `CONTRIBUTING.md`
+
+
+## The Author
+
+Ruby was originally designed and developed by Yukihiro Matsumoto (Matz) in
+1995.
+
+<mailto:matz@ruby-lang.org>
diff --git a/ToDo b/ToDo
deleted file mode 100644
index b55e399edf..0000000000
--- a/ToDo
+++ /dev/null
@@ -1,126 +0,0 @@
-Language Spec.
-
-- Class#allocate - basicNew
-- class Foo::Bar<Baz .. end, module Boo::Bar .. end
-* operator !! for rescue. ???
-* objectify characters
-* ../... outside condition invokes operator method too.
-* ... inside condition turns off just before right condition.???
-* package or access control for global variables??
-* named arguments like foo(nation:="german") or foo(nation: "german").
-* method to retrieve argument information (needs new C API)
-* multiple return values, yield values.  maybe incompatible ???
-* cascading method invocation ???
-* def Class#method .. end ??
-* def Foo::Bar::baz() .. end ??
-* I18N (or M17N) script/string/regexp
-* Fixnum 0 as false ????
-* discourage use of symbol variables (e.g. $/, etc.) in manual
-* discourage use of Perlish features by giving warnings.
-* non confusing in-block local variable (is it possible?)
-  + remove scope by block
-  + variables appears within block may have independent values.
-* Regexp: make /o thread safe.
-* decide whether begin with rescue or ensure make do..while loop.
-* a +1 to be a+1, not a(+1).
-* unify == and eql? again
-* to_i returns nil if str contains no digit.
-* raise exception by `` error
-* jar like combined library package. -> RubyGems?
-* resumable Exception via Exception#resume.
-* method combination, e.g. before, after, around, etc.
-* .. or something like defadvice in Emacs.
-* property - for methods, or for objects in general.
-* "in" modifier, to annotate, or to encourage assertion.
-* selector namespace - something like generic-flet in CLOS, to help RubyBehavior
-* private instance variable (as in Python?) @_foo in class Foo => @_Foo_foo
-* warn/error "bare word" method, like "foo",  you should type "foo()"
-* clarify evaluation order of operator argument (=~, .., ...)
-* :symbol => value hash in the form of {symbol: value, ...} ??
-
-Hacking Interpreter
-
-- generational GC
-* non-blocking open (e.g. for named pipe) for thread
-* avoid blocking with gethostbyname/gethostbyaddr (use fork ???)
-* objectify interpreters ???
-* remove rb_eval() recursions
-* syntax tree -> bytecode ???
-* scrambled script, or script filter
-* setuid ruby
-* performance tune for in-block (dynamic) local variables.
-* give warnings to assign magic variables.
-* export rb_io_{addstr,printf,puts,print}
-* autoload should work with threads [ruby-talk:4589]
-* remove stdio dependency from IOs.
-* warn for inconsistent local variable usage (lv m and method m at the same time). 
-* MicroRuby
-* Built-in Interactive Ruby.
-* Parser API
-* trap every method invocation, which can be enabled by e.g. trap_call :method.
-* unify Errno exceptions of same errno, or new exception comparison scheme.
-* 2.times{|i| if i==0 then a = 15 else puts eval("a") end} should print nil.
-* Thread#max_stack_size attribute (possible??)
-
-Standard Libraries
-
-- Module#define_method which takes a name and a body (block, proc or method).
-- Enume#inject
-- Array#fetch
-- IO::for_fd
-- Process::waitall [ruby-talk:4557]
-- Process::Status
-- File::lchown, File::lchmod; xxx - still need work for non existing platforms
-- move Time::times to Process.
-- Enumerable#sort_by for Schwartzian transformation
-- fork_and_kill_other_threads.
-- signal list (Signal::trap, Signal::list).
-- move NameError under StandardError.
-- Integer#to_s(base)
-- Hash::new{default}
-- hash etc. should handle self referenceing array/hash
-- Array#select(n1,n2...) works like Array#indexes(n1,n2...)
-- use Mersenne Twister RNG for random.
-- deprecate Array#indexes, and Array#indices.
-- remove dependency on MAXPATHLEN.
-* String#scanf(?)
-* Object#fmt(?)
-* Time::strptime
-* Integer[num], Float[num];  Fixnum[num]?
-* method to retrieve non-number trailer for to_i/to_f.
-* Stream or Port, abstract superclass of IO ?
-* String#{pred,prev}, String#downto
-* optional stepsize argument for succ()
-* Ruby module -- Ruby::Version, Ruby::Interpreter
-* introduce Boolean class; super of TrueClass, FalseClass
-* synchronized method - synchronized{...}, synchronized :foo, :bar
-* Array#&, Array#| to allow duplication. ???
-* way to specify immortal (fork endurance) thread;
-* or raise ForkException to every thread but fork caller.
-* new user-defined marshal scheme. _dump(dumper), _load(restorer)
-* library to load per-user profile seeking .ruby_profile or ruby.ini file.
-* warning framework (warn, warning for Ruby level)
-* marshal should not depend on sprintf (works bad with locale).
-* ternary arg pow: a.pow(b,c) == a**b%c
-* new caller(), e.g. call_stack; needs better name.
-* pointer share mechanism similar to one in String for Array.
-* require "1.6" etc. by /usr/lib/ruby/1.6/1.6.rb ;-)
-* save both "feature names" and "normalized path" in $"
-* implement Mutex_m (or MutexMixin) using Mutex.
-
-Extension Libraries
-
-* ptk.rb pTk wrapper that is compatible to tk.rb
-* Berkeley DB extension
-* BitVector
-* thread-safe fcgi
-
-Ruby Libraries
-
-* urllib.rb, nttplib.rb, etc.
-* format like perl's
-
-Tools
-
-* freeze or undump to bundle everything
-* bundle using zlib
diff --git a/aclocal.m4 b/aclocal.m4
new file mode 100644
index 0000000000..30fccd52fe
--- /dev/null
+++ b/aclocal.m4
@@ -0,0 +1,46 @@
+# -*- autoconf -*-
+
+AC_DEFUN([_COLORIZE_RESULT_PREPARE], [
+    msg_checking= msg_result_yes= msg_result_no= msg_result_other= msg_reset=
+    AS_IF([test "x${CONFIGURE_TTY}" = xyes -o -t 1], [
+	msg_begin="`tput smso 2>/dev/null`"
+    	AS_CASE(["$msg_begin"], ['@<:@'*m],
+	    [msg_begin="`echo "$msg_begin" | sed ['s/[0-9]*m$//']`"
+	    msg_checking="${msg_begin}33m"
+	    AS_IF([test ${TEST_COLORS:+set}], [
+		msg_result_yes=[`expr ":$TEST_COLORS:" : ".*:pass=\([^:]*\):"`]
+		msg_result_no=[`expr ":$TEST_COLORS:" : ".*:fail=\([^:]*\):"`]
+		msg_result_other=[`expr ":$TEST_COLORS:" : ".*:skip=\([^:]*\):"`]
+	    ])
+	    msg_result_yes="${msg_begin}${msg_result_yes:-32;1}m"
+	    msg_result_no="${msg_begin}${msg_result_no:-31;1}m"
+	    msg_result_other="${msg_begin}${msg_result_other:-33;1}m"
+	    msg_reset="${msg_begin}m"
+	    ])
+	AS_UNSET(msg_begin)
+	])
+    AS_REQUIRE_SHELL_FN([colorize_result],
+	[AS_FUNCTION_DESCRIBE([colorize_result], [MSG], [Colorize result])],
+        [AS_CASE(["$[]1"],
+            [yes], [AS_ECHO(["${msg_result_yes}$[]1${msg_reset}]")],
+            [no], [AS_ECHO(["${msg_result_no}$[]1${msg_reset}]")],
+            [AS_ECHO(["${msg_result_other}$[]1${msg_reset}]")])])
+])
+
+AC_DEFUN([COLORIZE_RESULT], [AC_REQUIRE([_COLORIZE_RESULT_PREPARE])dnl
+    AS_LITERAL_IF([$1],
+	[m4_case([$1],
+		[yes], [AS_ECHO(["${msg_result_yes}$1${msg_reset}"])],
+		[no], [AS_ECHO(["${msg_result_no}$1${msg_reset}"])],
+		[AS_ECHO(["${msg_result_other}$1${msg_reset}"])])],
+	[colorize_result "$1"]) dnl
+])
+
+AC_DEFUN([AC_CHECKING],[dnl
+AC_REQUIRE([_COLORIZE_RESULT_PREPARE])dnl
+AS_MESSAGE([checking ${msg_checking}$1${msg_reset}...])])
+
+AC_DEFUN([AC_MSG_RESULT], [dnl
+{ _AS_ECHO_LOG([result: $1])
+COLORIZE_RESULT([$1]); dnl
+}])
diff --git a/addr2line.c b/addr2line.c
new file mode 100644
index 0000000000..c8faf48d62
--- /dev/null
+++ b/addr2line.c
@@ -0,0 +1,1208 @@
+/**********************************************************************
+
+  addr2line.c -
+
+  $Author$
+
+  Copyright (C) 2010 Shinichiro Hamaji
+
+**********************************************************************/
+
+#include "ruby/config.h"
+#include "ruby/missing.h"
+#include "addr2line.h"
+
+#include <stdio.h>
+#include <errno.h>
+
+#ifdef USE_ELF
+
+#include <fcntl.h>
+#include <limits.h>
+#include <stdio.h>
+#include <stdint.h>
+#include <stdlib.h>
+#include <string.h>
+#include <sys/mman.h>
+#include <sys/types.h>
+#include <sys/stat.h>
+#include <unistd.h>
+
+#ifdef __OpenBSD__
+#include <elf_abi.h>
+#else
+#include <elf.h>
+#endif
+
+/* Make alloca work the best possible way.  */
+#ifdef __GNUC__
+# ifndef atarist
+#  ifndef alloca
+#   define alloca __builtin_alloca
+#  endif
+# endif	/* atarist */
+#else
+# ifdef HAVE_ALLOCA_H
+#  include <alloca.h>
+# else
+#  ifdef _AIX
+#pragma alloca
+#  else
+#   ifndef alloca		/* predefined by HP cc +Olibcalls */
+void *alloca();
+#   endif
+#  endif /* AIX */
+# endif	/* HAVE_ALLOCA_H */
+#endif /* __GNUC__ */
+
+#ifdef HAVE_DLADDR
+# include <dlfcn.h>
+#endif
+
+#define DW_LNS_copy                     0x01
+#define DW_LNS_advance_pc               0x02
+#define DW_LNS_advance_line             0x03
+#define DW_LNS_set_file                 0x04
+#define DW_LNS_set_column               0x05
+#define DW_LNS_negate_stmt              0x06
+#define DW_LNS_set_basic_block          0x07
+#define DW_LNS_const_add_pc             0x08
+#define DW_LNS_fixed_advance_pc         0x09
+#define DW_LNS_set_prologue_end         0x0a /* DWARF3 */
+#define DW_LNS_set_epilogue_begin       0x0b /* DWARF3 */
+#define DW_LNS_set_isa                  0x0c /* DWARF3 */
+
+/* Line number extended opcode name. */
+#define DW_LNE_end_sequence             0x01
+#define DW_LNE_set_address              0x02
+#define DW_LNE_define_file              0x03
+#define DW_LNE_set_discriminator        0x04  /* DWARF4 */
+
+#ifndef ElfW
+# if SIZEOF_VOIDP == 8
+#  define ElfW(x) Elf64##_##x
+# else
+#  define ElfW(x) Elf32##_##x
+# endif
+#endif
+#ifndef ELF_ST_TYPE
+# if SIZEOF_VOIDP == 8
+#  define ELF_ST_TYPE ELF64_ST_TYPE
+# else
+#  define ELF_ST_TYPE ELF32_ST_TYPE
+# endif
+#endif
+#ifndef PATH_MAX
+#define PATH_MAX 4096
+#endif
+
+int kprintf(const char *fmt, ...);
+
+typedef struct {
+    const char *dirname;
+    const char *filename;
+    const char *path; /* object path */
+    int line;
+
+    uintptr_t base_addr;
+    uintptr_t saddr;
+    const char *sname; /* function name */
+} line_info_t;
+typedef struct obj_info obj_info_t;
+struct obj_info {
+    const char *path; /* object path */
+    int fd;
+    void *mapped;
+    size_t mapped_size;
+    uintptr_t base_addr;
+    obj_info_t *next;
+};
+
+/* Avoid consuming stack as this module may be used from signal handler */
+static char binary_filename[PATH_MAX];
+
+static unsigned long
+uleb128(char **p)
+{
+    unsigned long r = 0;
+    int s = 0;
+    for (;;) {
+	unsigned char b = *(unsigned char *)(*p)++;
+	if (b < 0x80) {
+	    r += (unsigned long)b << s;
+	    break;
+	}
+	r += (b & 0x7f) << s;
+	s += 7;
+    }
+    return r;
+}
+
+static long
+sleb128(char **p)
+{
+    long r = 0;
+    int s = 0;
+    for (;;) {
+	unsigned char b = *(unsigned char *)(*p)++;
+	if (b < 0x80) {
+	    if (b & 0x40) {
+		r -= (0x80 - b) << s;
+	    }
+	    else {
+		r += (b & 0x3f) << s;
+	    }
+	    break;
+	}
+	r += (b & 0x7f) << s;
+	s += 7;
+    }
+    return r;
+}
+
+static const char *
+get_nth_dirname(unsigned long dir, char *p)
+{
+    if (!dir--) {
+	return "";
+    }
+    while (dir--) {
+	while (*p) p++;
+	p++;
+	if (!*p) {
+	    kprintf("Unexpected directory number %lu in %s\n",
+		    dir, binary_filename);
+	    return "";
+	}
+    }
+    return p;
+}
+
+static void
+fill_filename(int file, char *include_directories, char *filenames,
+	      line_info_t *line)
+{
+    int i;
+    char *p = filenames;
+    char *filename;
+    unsigned long dir;
+    for (i = 1; i <= file; i++) {
+	filename = p;
+	if (!*p) {
+	    /* Need to output binary file name? */
+	    kprintf("Unexpected file number %d in %s\n",
+		    file, binary_filename);
+	    return;
+	}
+	while (*p) p++;
+	p++;
+	dir = uleb128(&p);
+	/* last modified. */
+	uleb128(&p);
+	/* size of the file. */
+	uleb128(&p);
+
+	if (i == file) {
+	    line->filename = filename;
+	    line->dirname = get_nth_dirname(dir, include_directories);
+	}
+    }
+}
+
+static void
+fill_line(int num_traces, void **traces, uintptr_t addr, int file, int line,
+	  char *include_directories, char *filenames,
+	  obj_info_t *obj, line_info_t *lines, int offset)
+{
+    int i;
+    addr += obj->base_addr;
+    for (i = offset; i < num_traces; i++) {
+	uintptr_t a = (uintptr_t)traces[i];
+	/* We assume one line code doesn't result >100 bytes of native code.
+       We may want more reliable way eventually... */
+	if (addr < a && a < addr + 100) {
+	    fill_filename(file, include_directories, filenames, &lines[i]);
+	    lines[i].line = line;
+	}
+    }
+}
+
+static void
+parse_debug_line_cu(int num_traces, void **traces, char **debug_line,
+		obj_info_t *obj, line_info_t *lines, int offset)
+{
+    char *p, *cu_end, *cu_start, *include_directories, *filenames;
+    unsigned long unit_length;
+    int default_is_stmt, line_base;
+    unsigned int header_length, minimum_instruction_length, line_range,
+		 opcode_base;
+    /* unsigned char *standard_opcode_lengths; */
+
+    /* The registers. */
+    unsigned long addr = 0;
+    unsigned int file = 1;
+    unsigned int line = 1;
+    /* unsigned int column = 0; */
+    int is_stmt;
+    /* int basic_block = 0; */
+    /* int end_sequence = 0; */
+    /* int prologue_end = 0; */
+    /* int epilogue_begin = 0; */
+    /* unsigned int isa = 0; */
+
+    p = *debug_line;
+
+    unit_length = *(unsigned int *)p;
+    p += sizeof(unsigned int);
+    if (unit_length == 0xffffffff) {
+	unit_length = *(unsigned long *)p;
+	p += sizeof(unsigned long);
+    }
+
+    cu_end = p + unit_length;
+
+    /*dwarf_version = *(unsigned short *)p;*/
+    p += 2;
+
+    header_length = *(unsigned int *)p;
+    p += sizeof(unsigned int);
+
+    cu_start = p + header_length;
+
+    minimum_instruction_length = *(unsigned char *)p;
+    p++;
+
+    is_stmt = default_is_stmt = *(unsigned char *)p;
+    p++;
+
+    line_base = *(signed char *)p;
+    p++;
+
+    line_range = *(unsigned char *)p;
+    p++;
+
+    opcode_base = *(unsigned char *)p;
+    p++;
+
+    /* standard_opcode_lengths = (unsigned char *)p - 1; */
+    p += opcode_base - 1;
+
+    include_directories = p;
+
+    /* skip include directories */
+    while (*p) {
+	while (*p) p++;
+	p++;
+    }
+    p++;
+
+    filenames = p;
+
+    p = cu_start;
+
+#define FILL_LINE()						    \
+    do {							    \
+	fill_line(num_traces, traces, addr, file, line,		    \
+		  include_directories, filenames,		    \
+		  obj, lines, offset);				    \
+	/*basic_block = prologue_end = epilogue_begin = 0;*/	    \
+    } while (0)
+
+    while (p < cu_end) {
+	unsigned long a;
+	unsigned char op = *p++;
+	switch (op) {
+	case DW_LNS_copy:
+	    FILL_LINE();
+	    break;
+	case DW_LNS_advance_pc:
+	    a = uleb128(&p);
+	    addr += a;
+	    break;
+	case DW_LNS_advance_line: {
+	    long a = sleb128(&p);
+	    line += a;
+	    break;
+	}
+	case DW_LNS_set_file:
+	    file = (unsigned int)uleb128(&p);
+	    break;
+	case DW_LNS_set_column:
+	    /*column = (unsigned int)*/(void)uleb128(&p);
+	    break;
+	case DW_LNS_negate_stmt:
+	    is_stmt = !is_stmt;
+	    break;
+	case DW_LNS_set_basic_block:
+	    /*basic_block = 1; */
+	    break;
+	case DW_LNS_const_add_pc:
+	    a = ((255 - opcode_base) / line_range) *
+		minimum_instruction_length;
+	    addr += a;
+	    break;
+	case DW_LNS_fixed_advance_pc:
+	    a = *(unsigned char *)p++;
+	    addr += a;
+	    break;
+	case DW_LNS_set_prologue_end:
+	    /* prologue_end = 1; */
+	    break;
+	case DW_LNS_set_epilogue_begin:
+	    /* epilogue_begin = 1; */
+	    break;
+	case DW_LNS_set_isa:
+	    /* isa = (unsigned int)*/(void)uleb128(&p);
+	    break;
+	case 0:
+	    a = *(unsigned char *)p++;
+	    op = *p++;
+	    switch (op) {
+	    case DW_LNE_end_sequence:
+		/* end_sequence = 1; */
+		FILL_LINE();
+		addr = 0;
+		file = 1;
+		line = 1;
+		/* column = 0; */
+		is_stmt = default_is_stmt;
+		/* end_sequence = 0; */
+		/* isa = 0; */
+		break;
+	    case DW_LNE_set_address:
+		addr = *(unsigned long *)p;
+		p += sizeof(unsigned long);
+		break;
+	    case DW_LNE_define_file:
+		kprintf("Unsupported operation in %s\n",
+			binary_filename);
+		break;
+	    case DW_LNE_set_discriminator:
+		/* TODO:currently ignore */
+		uleb128(&p);
+		break;
+	    default:
+		kprintf("Unknown extended opcode: %d in %s\n",
+			op, binary_filename);
+	    }
+	    break;
+	default: {
+	    unsigned long addr_incr;
+	    unsigned long line_incr;
+	    a = op - opcode_base;
+	    addr_incr = (a / line_range) * minimum_instruction_length;
+	    line_incr = line_base + (a % line_range);
+	    addr += (unsigned int)addr_incr;
+	    line += (unsigned int)line_incr;
+	    FILL_LINE();
+	}
+	}
+    }
+    *debug_line = p;
+}
+
+static void
+parse_debug_line(int num_traces, void **traces,
+		 char *debug_line, unsigned long size,
+		 obj_info_t *obj, line_info_t *lines, int offset)
+{
+    char *debug_line_end = debug_line + size;
+    while (debug_line < debug_line_end) {
+	parse_debug_line_cu(num_traces, traces, &debug_line, obj, lines, offset);
+    }
+    if (debug_line != debug_line_end) {
+	kprintf("Unexpected size of .debug_line in %s\n",
+		binary_filename);
+    }
+}
+
+/* read file and fill lines */
+static uintptr_t
+fill_lines(int num_traces, void **traces, int check_debuglink,
+	   obj_info_t **objp, line_info_t *lines, int offset);
+
+static void
+append_obj(obj_info_t **objp) {
+    obj_info_t *newobj = calloc(1, sizeof(obj_info_t));
+    if (*objp) (*objp)->next = newobj;
+    *objp = newobj;
+}
+
+static void
+follow_debuglink(char *debuglink, int num_traces, void **traces,
+		 obj_info_t **objp, line_info_t *lines, int offset)
+{
+    /* Ideally we should check 4 paths to follow gnu_debuglink,
+       but we handle only one case for now as this format is used
+       by some linux distributions. See GDB's info for detail. */
+    static const char global_debug_dir[] = "/usr/lib/debug";
+    char *p, *subdir;
+    obj_info_t *o1 = *objp, *o2;
+
+    p = strrchr(binary_filename, '/');
+    if (!p) {
+	return;
+    }
+    p[1] = '\0';
+
+    subdir = (char *)alloca(strlen(binary_filename) + 1);
+    strcpy(subdir, binary_filename);
+    strcpy(binary_filename, global_debug_dir);
+    strlcat(binary_filename, subdir, PATH_MAX);
+    strlcat(binary_filename, debuglink, PATH_MAX);
+
+    append_obj(objp);
+    o2 = *objp;
+    o2->base_addr = o1->base_addr;
+    o2->path = o1->path;
+    fill_lines(num_traces, traces, 0, objp, lines, offset);
+}
+
+/* read file and fill lines */
+static uintptr_t
+fill_lines(int num_traces, void **traces, int check_debuglink,
+	   obj_info_t **objp, line_info_t *lines, int offset)
+{
+    int i, j;
+    char *shstr;
+    char *section_name;
+    ElfW(Ehdr) *ehdr;
+    ElfW(Shdr) *shdr, *shstr_shdr;
+    ElfW(Shdr) *debug_line_shdr = NULL, *gnu_debuglink_shdr = NULL;
+    int fd;
+    off_t filesize;
+    char *file;
+    ElfW(Shdr) *symtab_shdr = NULL, *strtab_shdr = NULL;
+    ElfW(Shdr) *dynsym_shdr = NULL, *dynstr_shdr = NULL;
+    obj_info_t *obj = *objp;
+    uintptr_t dladdr_fbase = 0;
+
+    fd = open(binary_filename, O_RDONLY);
+    if (fd < 0) {
+	goto fail;
+    }
+    filesize = lseek(fd, 0, SEEK_END);
+    if (filesize < 0) {
+	int e = errno;
+	close(fd);
+	kprintf("lseek: %s\n", strerror(e));
+	goto fail;
+    }
+#if SIZEOF_OFF_T > SIZEOF_SIZE_T
+    if (filesize > (off_t)SIZE_MAX) {
+	close(fd);
+	kprintf("Too large file %s\n", binary_filename);
+	goto fail;
+    }
+#endif
+    lseek(fd, 0, SEEK_SET);
+    /* async-signal unsafe */
+    file = (char *)mmap(NULL, (size_t)filesize, PROT_READ, MAP_SHARED, fd, 0);
+    if (file == MAP_FAILED) {
+	int e = errno;
+	close(fd);
+	kprintf("mmap: %s\n", strerror(e));
+	goto fail;
+    }
+
+    ehdr = (ElfW(Ehdr) *)file;
+    if (memcmp(ehdr->e_ident, "\177ELF", 4) != 0) {
+	/*
+	 * Huh? Maybe filename was overridden by setproctitle() and
+	 * it match non-elf file.
+	 */
+	close(fd);
+	goto fail;
+    }
+
+    obj->fd = fd;
+    obj->mapped = file;
+    obj->mapped_size = (size_t)filesize;
+
+    shdr = (ElfW(Shdr) *)(file + ehdr->e_shoff);
+
+    shstr_shdr = shdr + ehdr->e_shstrndx;
+    shstr = file + shstr_shdr->sh_offset;
+
+    for (i = 0; i < ehdr->e_shnum; i++) {
+	section_name = shstr + shdr[i].sh_name;
+	switch (shdr[i].sh_type) {
+	  case SHT_STRTAB:
+	    if (!strcmp(section_name, ".strtab")) {
+		strtab_shdr = shdr + i;
+	    }
+	    else if (!strcmp(section_name, ".dynstr")) {
+		dynstr_shdr = shdr + i;
+	    }
+	    break;
+	  case SHT_SYMTAB:
+	    /* if (!strcmp(section_name, ".symtab")) */
+	    symtab_shdr = shdr + i;
+	    break;
+	  case SHT_DYNSYM:
+	    /* if (!strcmp(section_name, ".dynsym")) */
+	    dynsym_shdr = shdr + i;
+	    break;
+	  case SHT_PROGBITS:
+	    if (!strcmp(section_name, ".debug_line")) {
+		debug_line_shdr = shdr + i;
+	    }
+	    else if (!strcmp(section_name, ".gnu_debuglink")) {
+		gnu_debuglink_shdr = shdr + i;
+	    }
+	    break;
+	}
+    }
+
+    if (offset == -1) {
+	/* main executable */
+	offset = 0;
+	if (dynsym_shdr && dynstr_shdr) {
+	    char *strtab = file + dynstr_shdr->sh_offset;
+	    ElfW(Sym) *symtab = (ElfW(Sym) *)(file + dynsym_shdr->sh_offset);
+	    int symtab_count = (int)(dynsym_shdr->sh_size / sizeof(ElfW(Sym)));
+	    for (j = 0; j < symtab_count; j++) {
+		ElfW(Sym) *sym = &symtab[j];
+		Dl_info info;
+		void *h, *s;
+		if (ELF_ST_TYPE(sym->st_info) != STT_FUNC || sym->st_size <= 0) continue;
+		h = dlopen(NULL, RTLD_NOW|RTLD_LOCAL);
+		if (!h) continue;
+		s = dlsym(h, strtab + sym->st_name);
+		if (!s) continue;
+		if (dladdr(s, &info)) {
+		    dladdr_fbase = (uintptr_t)info.dli_fbase;
+		    break;
+		}
+	    }
+	    if (ehdr->e_type == ET_EXEC) {
+		obj->base_addr = 0;
+	    }
+	    else {
+		/* PIE (position-independent executable) */
+		obj->base_addr = dladdr_fbase;
+	    }
+	}
+    }
+
+    if (!symtab_shdr) {
+	symtab_shdr = dynsym_shdr;
+	strtab_shdr = dynstr_shdr;
+    }
+
+    if (symtab_shdr && strtab_shdr) {
+	char *strtab = file + strtab_shdr->sh_offset;
+	ElfW(Sym) *symtab = (ElfW(Sym) *)(file + symtab_shdr->sh_offset);
+	int symtab_count = (int)(symtab_shdr->sh_size / sizeof(ElfW(Sym)));
+	for (j = 0; j < symtab_count; j++) {
+	    ElfW(Sym) *sym = &symtab[j];
+	    uintptr_t saddr = (uintptr_t)sym->st_value + obj->base_addr;
+	    if (ELF_ST_TYPE(sym->st_info) != STT_FUNC || sym->st_size <= 0) continue;
+	    for (i = offset; i < num_traces; i++) {
+		uintptr_t d = (uintptr_t)traces[i] - saddr;
+		if (lines[i].line > 0 || d <= 0 || d > (uintptr_t)sym->st_size)
+		    continue;
+		/* fill symbol name and addr from .symtab */
+		lines[i].sname = strtab + sym->st_name;
+		lines[i].saddr = saddr;
+		lines[i].path  = obj->path;
+		lines[i].base_addr = obj->base_addr;
+	    }
+	}
+    }
+
+    if (!debug_line_shdr) {
+	/* This file doesn't have .debug_line section,
+	   let's check .gnu_debuglink section instead. */
+	if (gnu_debuglink_shdr && check_debuglink) {
+	    follow_debuglink(file + gnu_debuglink_shdr->sh_offset,
+			     num_traces, traces,
+			     objp, lines, offset);
+	}
+	goto finish;
+    }
+
+    parse_debug_line(num_traces, traces,
+		     file + debug_line_shdr->sh_offset,
+		     debug_line_shdr->sh_size,
+		     obj, lines, offset);
+finish:
+    return dladdr_fbase;
+fail:
+    return (uintptr_t)-1;
+}
+
+#define HAVE_MAIN_EXE_PATH
+#if defined(__FreeBSD__)
+# include <sys/sysctl.h>
+#endif
+/* ssize_t main_exe_path(void)
+ *
+ * store the path of the main executable to `binary_filename`,
+ * and returns strlen(binary_filename).
+ * it is NUL terminated.
+ */
+#if defined(__linux__)
+ssize_t
+main_exe_path(void)
+{
+# define PROC_SELF_EXE "/proc/self/exe"
+    ssize_t len = readlink(PROC_SELF_EXE, binary_filename, PATH_MAX);
+    binary_filename[len] = 0;
+    return len;
+}
+#elif defined(__FreeBSD__)
+ssize_t
+main_exe_path(void)
+{
+    int mib[4] = {CTL_KERN, KERN_PROC, KERN_PROC_PATHNAME, -1};
+    size_t len = PATH_MAX;
+    int err = sysctl(mib, 4, binary_filename, &len, NULL, 0);
+    if (err) {
+	kprintf("Can't get the path of ruby");
+	return -1;
+    }
+    len--; /* sysctl sets strlen+1 */
+    return len;
+}
+#else
+#undef HAVE_MAIN_EXE_PATH
+#endif
+
+void
+rb_dump_backtrace_with_lines(int num_traces, void **traces)
+{
+    int i;
+    /* async-signal unsafe */
+    line_info_t *lines = (line_info_t *)calloc(num_traces, sizeof(line_info_t));
+    obj_info_t *obj = NULL;
+    /* 2 is NULL + main executable */
+    void **dladdr_fbases = (void **)calloc(num_traces+2, sizeof(void *));
+#ifdef HAVE_MAIN_EXE_PATH
+    char *main_path = NULL; /* used on printing backtrace */
+    ssize_t len;
+    if ((len = main_exe_path()) > 0) {
+	main_path = (char *)alloca(len + 1);
+	if (main_path) {
+	    uintptr_t addr;
+	    memcpy(main_path, binary_filename, len+1);
+	    append_obj(&obj);
+	    obj->path = main_path;
+	    addr = fill_lines(num_traces, traces, 1, &obj, lines, -1);
+	    if (addr != (uintptr_t)-1) {
+		dladdr_fbases[0] = (void *)addr;
+	    }
+	}
+    }
+#endif
+
+    /* fill source lines by reading dwarf */
+    for (i = 0; i < num_traces; i++) {
+	Dl_info info;
+	if (lines[i].line) continue;
+	if (dladdr(traces[i], &info)) {
+	    const char *path;
+	    void **p;
+
+	    /* skip symbols which is in already checked objects */
+	    /* if the binary is strip-ed, this may effect */
+	    for (p=dladdr_fbases; *p; p++) {
+		if (*p == info.dli_fbase) {
+		    lines[i].path = info.dli_fname;
+		    lines[i].sname = info.dli_sname;
+		    goto next_line;
+		}
+	    }
+	    *p = info.dli_fbase;
+
+	    append_obj(&obj);
+	    obj->base_addr = (uintptr_t)info.dli_fbase;
+	    path = info.dli_fname;
+	    obj->path = path;
+	    lines[i].path = path;
+	    strcpy(binary_filename, path);
+	    fill_lines(num_traces, traces, 1, &obj, lines, i);
+	}
+next_line:
+	continue;
+    }
+
+    /* output */
+    for (i = 0; i < num_traces; i++) {
+	line_info_t *line = &lines[i];
+	uintptr_t addr = (uintptr_t)traces[i];
+	uintptr_t d = addr - line->saddr;
+	if (!line->path) {
+	    kprintf("[0x%lx]\n", addr);
+	}
+	else if (!line->saddr || !line->sname) {
+	    kprintf("%s [0x%lx]\n", line->path, addr);
+	}
+	else if (line->line <= 0) {
+	    kprintf("%s(%s+0x%lx) [0x%lx]\n", line->path, line->sname,
+		    d, addr);
+	}
+	else if (!line->filename) {
+	    kprintf("%s(%s+0x%lx) [0x%lx] ???:%d\n", line->path, line->sname,
+		    d, addr, line->line);
+	}
+	else if (line->dirname && line->dirname[0]) {
+	    kprintf("%s(%s+0x%lx) [0x%lx] %s/%s:%d\n", line->path, line->sname,
+		    d, addr, line->dirname, line->filename, line->line);
+	}
+	else {
+	    kprintf("%s(%s+0x%lx) [0x%lx] %s:%d\n", line->path, line->sname,
+		    d, addr, line->filename, line->line);
+	}
+	/* FreeBSD's backtrace may show _start and so on */
+	if (line->sname && strcmp("main", line->sname) == 0)
+	    break;
+    }
+
+    /* free */
+    while (obj) {
+	obj_info_t *o = obj;
+	obj = o->next;
+	if (o->fd) {
+	    munmap(o->mapped, o->mapped_size);
+	    close(o->fd);
+	}
+	free(o);
+    }
+    free(lines);
+    free(dladdr_fbases);
+}
+
+/* From FreeBSD's lib/libstand/printf.c */
+/*-
+ * Copyright (c) 1986, 1988, 1991, 1993
+ *	The Regents of the University of California.  All rights reserved.
+ * (c) UNIX System Laboratories, Inc.
+ * All or some portions of this file are derived from material licensed
+ * to the University of California by American Telephone and Telegraph
+ * Co. or Unix System Laboratories, Inc. and are reproduced herein with
+ * the permission of UNIX System Laboratories, Inc.
+ *
+ * Redistribution and use in source and binary forms, with or without
+ * modification, are permitted provided that the following conditions
+ * are met:
+ * 1. Redistributions of source code must retain the above copyright
+ *    notice, this list of conditions and the following disclaimer.
+ * 2. Redistributions in binary form must reproduce the above copyright
+ *    notice, this list of conditions and the following disclaimer in the
+ *    documentation and/or other materials provided with the distribution.
+ * 4. Neither the name of the University nor the names of its contributors
+ *    may be used to endorse or promote products derived from this software
+ *    without specific prior written permission.
+ *
+ * THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+ * ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ * ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+ * FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+ * DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+ * OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+ * HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+ * LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+ * OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+ * SUCH DAMAGE.
+ *
+ *	@(#)subr_prf.c	8.3 (Berkeley) 1/21/94
+ */
+
+#include <stdarg.h>
+#define MAXNBUF (sizeof(intmax_t) * CHAR_BIT + 1)
+extern int rb_toupper(int c);
+#define    toupper(c)  rb_toupper(c)
+#define    hex2ascii(hex)  (hex2ascii_data[hex])
+char const hex2ascii_data[] = "0123456789abcdefghijklmnopqrstuvwxyz";
+static inline int imax(int a, int b) { return (a > b ? a : b); }
+static int kvprintf(char const *fmt, void (*func)(int), void *arg, int radix, va_list ap);
+
+static void putce(int c)
+{
+    char s[1];
+    ssize_t ret;
+
+    s[0] = (char)c;
+    ret = write(2, s, 1);
+    (void)ret;
+}
+
+int
+kprintf(const char *fmt, ...)
+{
+	va_list ap;
+	int retval;
+
+	va_start(ap, fmt);
+	retval = kvprintf(fmt, putce, NULL, 10, ap);
+	va_end(ap);
+	return retval;
+}
+
+/*
+ * Put a NUL-terminated ASCII number (base <= 36) in a buffer in reverse
+ * order; return an optional length and a pointer to the last character
+ * written in the buffer (i.e., the first character of the string).
+ * The buffer pointed to by `nbuf' must have length >= MAXNBUF.
+ */
+static char *
+ksprintn(char *nbuf, uintmax_t num, int base, int *lenp, int upper)
+{
+	char *p, c;
+
+	p = nbuf;
+	*p = '\0';
+	do {
+		c = hex2ascii(num % base);
+		*++p = upper ? toupper(c) : c;
+	} while (num /= base);
+	if (lenp)
+		*lenp = (int)(p - nbuf);
+	return (p);
+}
+
+/*
+ * Scaled down version of printf(3).
+ *
+ * Two additional formats:
+ *
+ * The format %b is supported to decode error registers.
+ * Its usage is:
+ *
+ *	printf("reg=%b\n", regval, "<base><arg>*");
+ *
+ * where <base> is the output base expressed as a control character, e.g.
+ * \10 gives octal; \20 gives hex.  Each arg is a sequence of characters,
+ * the first of which gives the bit number to be inspected (origin 1), and
+ * the next characters (up to a control character, i.e. a character <= 32),
+ * give the name of the register.  Thus:
+ *
+ *	kvprintf("reg=%b\n", 3, "\10\2BITTWO\1BITONE\n");
+ *
+ * would produce output:
+ *
+ *	reg=3<BITTWO,BITONE>
+ *
+ * XXX:  %D  -- Hexdump, takes pointer and separator string:
+ *		("%6D", ptr, ":")   -> XX:XX:XX:XX:XX:XX
+ *		("%*D", len, ptr, " " -> XX XX XX XX ...
+ */
+static int
+kvprintf(char const *fmt, void (*func)(int), void *arg, int radix, va_list ap)
+{
+#define PCHAR(c) {int cc=(c); if (func) (*func)(cc); else *d++ = cc; retval++; }
+	char nbuf[MAXNBUF];
+	char *d;
+	const char *p, *percent, *q;
+	unsigned char *up;
+	int ch, n;
+	uintmax_t num;
+	int base, lflag, qflag, tmp, width, ladjust, sharpflag, neg, sign, dot;
+	int cflag, hflag, jflag, tflag, zflag;
+	int dwidth, upper;
+	char padc;
+	int stop = 0, retval = 0;
+
+	num = 0;
+	if (!func)
+		d = (char *) arg;
+	else
+		d = NULL;
+
+	if (fmt == NULL)
+		fmt = "(fmt null)\n";
+
+	if (radix < 2 || radix > 36)
+		radix = 10;
+
+	for (;;) {
+		padc = ' ';
+		width = 0;
+		while ((ch = (unsigned char)*fmt++) != '%' || stop) {
+			if (ch == '\0')
+				return (retval);
+			PCHAR(ch);
+		}
+		percent = fmt - 1;
+		qflag = 0; lflag = 0; ladjust = 0; sharpflag = 0; neg = 0;
+		sign = 0; dot = 0; dwidth = 0; upper = 0;
+		cflag = 0; hflag = 0; jflag = 0; tflag = 0; zflag = 0;
+reswitch:	switch (ch = (unsigned char)*fmt++) {
+		case '.':
+			dot = 1;
+			goto reswitch;
+		case '#':
+			sharpflag = 1;
+			goto reswitch;
+		case '+':
+			sign = 1;
+			goto reswitch;
+		case '-':
+			ladjust = 1;
+			goto reswitch;
+		case '%':
+			PCHAR(ch);
+			break;
+		case '*':
+			if (!dot) {
+				width = va_arg(ap, int);
+				if (width < 0) {
+					ladjust = !ladjust;
+					width = -width;
+				}
+			} else {
+				dwidth = va_arg(ap, int);
+			}
+			goto reswitch;
+		case '0':
+			if (!dot) {
+				padc = '0';
+				goto reswitch;
+			}
+		case '1': case '2': case '3': case '4':
+		case '5': case '6': case '7': case '8': case '9':
+				for (n = 0;; ++fmt) {
+					n = n * 10 + ch - '0';
+					ch = *fmt;
+					if (ch < '0' || ch > '9')
+						break;
+				}
+			if (dot)
+				dwidth = n;
+			else
+				width = n;
+			goto reswitch;
+		case 'b':
+			num = (unsigned int)va_arg(ap, int);
+			p = va_arg(ap, char *);
+			for (q = ksprintn(nbuf, num, *p++, NULL, 0); *q;)
+				PCHAR(*q--);
+
+			if (num == 0)
+				break;
+
+			for (tmp = 0; *p;) {
+				n = *p++;
+				if (num & (1 << (n - 1))) {
+					PCHAR(tmp ? ',' : '<');
+					for (; (n = *p) > ' '; ++p)
+						PCHAR(n);
+					tmp = 1;
+				} else
+					for (; *p > ' '; ++p)
+						continue;
+			}
+			if (tmp)
+				PCHAR('>');
+			break;
+		case 'c':
+			PCHAR(va_arg(ap, int));
+			break;
+		case 'D':
+			up = va_arg(ap, unsigned char *);
+			p = va_arg(ap, char *);
+			if (!width)
+				width = 16;
+			while(width--) {
+				PCHAR(hex2ascii(*up >> 4));
+				PCHAR(hex2ascii(*up & 0x0f));
+				up++;
+				if (width)
+					for (q=p;*q;q++)
+						PCHAR(*q);
+			}
+			break;
+		case 'd':
+		case 'i':
+			base = 10;
+			sign = 1;
+			goto handle_sign;
+		case 'h':
+			if (hflag) {
+				hflag = 0;
+				cflag = 1;
+			} else
+				hflag = 1;
+			goto reswitch;
+		case 'j':
+			jflag = 1;
+			goto reswitch;
+		case 'l':
+			if (lflag) {
+				lflag = 0;
+				qflag = 1;
+			} else
+				lflag = 1;
+			goto reswitch;
+		case 'n':
+			if (jflag)
+				*(va_arg(ap, intmax_t *)) = retval;
+			else if (qflag)
+				*(va_arg(ap, int64_t *)) = retval;
+			else if (lflag)
+				*(va_arg(ap, long *)) = retval;
+			else if (zflag)
+				*(va_arg(ap, size_t *)) = retval;
+			else if (hflag)
+				*(va_arg(ap, short *)) = retval;
+			else if (cflag)
+				*(va_arg(ap, char *)) = retval;
+			else
+				*(va_arg(ap, int *)) = retval;
+			break;
+		case 'o':
+			base = 8;
+			goto handle_nosign;
+		case 'p':
+			base = 16;
+			sharpflag = (width == 0);
+			sign = 0;
+			num = (uintptr_t)va_arg(ap, void *);
+			goto number;
+		case 'q':
+			qflag = 1;
+			goto reswitch;
+		case 'r':
+			base = radix;
+			if (sign)
+				goto handle_sign;
+			goto handle_nosign;
+		case 's':
+			p = va_arg(ap, char *);
+			if (p == NULL)
+				p = "(null)";
+			if (!dot)
+				n = (int)strlen (p);
+			else
+				for (n = 0; n < dwidth && p[n]; n++)
+					continue;
+
+			width -= n;
+
+			if (!ladjust && width > 0)
+				while (width--)
+					PCHAR(padc);
+			while (n--)
+				PCHAR(*p++);
+			if (ladjust && width > 0)
+				while (width--)
+					PCHAR(padc);
+			break;
+		case 't':
+			tflag = 1;
+			goto reswitch;
+		case 'u':
+			base = 10;
+			goto handle_nosign;
+		case 'X':
+			upper = 1;
+		case 'x':
+			base = 16;
+			goto handle_nosign;
+		case 'y':
+			base = 16;
+			sign = 1;
+			goto handle_sign;
+		case 'z':
+			zflag = 1;
+			goto reswitch;
+handle_nosign:
+			sign = 0;
+			if (jflag)
+				num = va_arg(ap, uintmax_t);
+			else if (qflag)
+				num = va_arg(ap, uint64_t);
+			else if (tflag)
+				num = va_arg(ap, ptrdiff_t);
+			else if (lflag)
+				num = va_arg(ap, unsigned long);
+			else if (zflag)
+				num = va_arg(ap, size_t);
+			else if (hflag)
+				num = (unsigned short)va_arg(ap, int);
+			else if (cflag)
+				num = (unsigned char)va_arg(ap, int);
+			else
+				num = va_arg(ap, unsigned int);
+			goto number;
+handle_sign:
+			if (jflag)
+				num = va_arg(ap, intmax_t);
+			else if (qflag)
+				num = va_arg(ap, int64_t);
+			else if (tflag)
+				num = va_arg(ap, ptrdiff_t);
+			else if (lflag)
+				num = va_arg(ap, long);
+			else if (zflag)
+				num = va_arg(ap, ssize_t);
+			else if (hflag)
+				num = (short)va_arg(ap, int);
+			else if (cflag)
+				num = (char)va_arg(ap, int);
+			else
+				num = va_arg(ap, int);
+number:
+			if (sign && (intmax_t)num < 0) {
+				neg = 1;
+				num = -(intmax_t)num;
+			}
+			p = ksprintn(nbuf, num, base, &n, upper);
+			tmp = 0;
+			if (sharpflag && num != 0) {
+				if (base == 8)
+					tmp++;
+				else if (base == 16)
+					tmp += 2;
+			}
+			if (neg)
+				tmp++;
+
+			if (!ladjust && padc == '0')
+				dwidth = width - tmp;
+			width -= tmp + imax(dwidth, n);
+			dwidth -= n;
+			if (!ladjust)
+				while (width-- > 0)
+					PCHAR(' ');
+			if (neg)
+				PCHAR('-');
+			if (sharpflag && num != 0) {
+				if (base == 8) {
+					PCHAR('0');
+				} else if (base == 16) {
+					PCHAR('0');
+					PCHAR('x');
+				}
+			}
+			while (dwidth-- > 0)
+				PCHAR('0');
+
+			while (*p)
+				PCHAR(*p--);
+
+			if (ladjust)
+				while (width-- > 0)
+					PCHAR(' ');
+
+			break;
+		default:
+			while (percent < fmt)
+				PCHAR(*percent++);
+			/*
+			 * Since we ignore an formatting argument it is no
+			 * longer safe to obey the remaining formatting
+			 * arguments as the arguments will no longer match
+			 * the format specs.
+			 */
+			stop = 1;
+			break;
+		}
+	}
+#undef PCHAR
+}
+#else /* defined(USE_ELF) */
+#error not supported
+#endif
diff --git a/addr2line.h b/addr2line.h
new file mode 100644
index 0000000000..d99f010934
--- /dev/null
+++ b/addr2line.h
@@ -0,0 +1,21 @@
+/**********************************************************************
+
+  addr2line.h -
+
+  $Author$
+
+  Copyright (C) 2010 Shinichiro Hamaji
+
+**********************************************************************/
+
+#ifndef RUBY_ADDR2LINE_H
+#define RUBY_ADDR2LINE_H
+
+#ifdef USE_ELF
+
+void
+rb_dump_backtrace_with_lines(int num_traces, void **traces);
+
+#endif /* USE_ELF */
+
+#endif /* RUBY_ADDR2LINE_H */
diff --git a/array.c b/array.c
index fbca3c193e..de81ee7fab 100644
--- a/array.c
+++ b/array.c
@@ -3,163 +3,500 @@
   array.c -
 
   $Author$
-  $Date$
   created at: Fri Aug  6 09:46:12 JST 1993
 
-  Copyright (C) 1993-2003 Yukihiro Matsumoto
+  Copyright (C) 1993-2007 Yukihiro Matsumoto
   Copyright (C) 2000  Network Applied Communication Laboratory, Inc.
   Copyright (C) 2000  Information-technology Promotion Agency, Japan
 
 **********************************************************************/
 
-#include "ruby.h"
-#include "util.h"
-#include "st.h"
+#include "internal.h"
+#include "ruby/util.h"
+#include "ruby/st.h"
+#include "probes.h"
+#include "id.h"
+
+#ifndef ARRAY_DEBUG
+# define NDEBUG
+#endif
+#include <assert.h>
 
 VALUE rb_cArray;
-static ID id_cmp;
+
+static ID id_cmp, id_div, id_power;
 
 #define ARY_DEFAULT_SIZE 16
+#define ARY_MAX_SIZE (LONG_MAX / (int)sizeof(VALUE))
+
+# define ARY_SHARED_P(ary) \
+    (assert(!FL_TEST((ary), ELTS_SHARED) || !FL_TEST((ary), RARRAY_EMBED_FLAG)), \
+     FL_TEST((ary),ELTS_SHARED)!=0)
+# define ARY_EMBED_P(ary) \
+    (assert(!FL_TEST((ary), ELTS_SHARED) || !FL_TEST((ary), RARRAY_EMBED_FLAG)), \
+     FL_TEST((ary), RARRAY_EMBED_FLAG)!=0)
+
+#define ARY_HEAP_PTR(a) (assert(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.ptr)
+#define ARY_HEAP_LEN(a) (assert(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.len)
+#define ARY_EMBED_PTR(a) (assert(ARY_EMBED_P(a)), RARRAY(a)->as.ary)
+#define ARY_EMBED_LEN(a) \
+    (assert(ARY_EMBED_P(a)), \
+     (long)((RBASIC(a)->flags >> RARRAY_EMBED_LEN_SHIFT) & \
+	 (RARRAY_EMBED_LEN_MASK >> RARRAY_EMBED_LEN_SHIFT)))
+#define ARY_HEAP_SIZE(a) (assert(!ARY_EMBED_P(a)), assert(ARY_OWNS_HEAP_P(a)), RARRAY(a)->as.heap.aux.capa * sizeof(VALUE))
+
+#define ARY_OWNS_HEAP_P(a) (!FL_TEST((a), ELTS_SHARED|RARRAY_EMBED_FLAG))
+#define FL_SET_EMBED(a) do { \
+    assert(!ARY_SHARED_P(a)); \
+    FL_SET((a), RARRAY_EMBED_FLAG); \
+} while (0)
+#define FL_UNSET_EMBED(ary) FL_UNSET((ary), RARRAY_EMBED_FLAG|RARRAY_EMBED_LEN_MASK)
+#define FL_SET_SHARED(ary) do { \
+    assert(!ARY_EMBED_P(ary)); \
+    FL_SET((ary), ELTS_SHARED); \
+} while (0)
+#define FL_UNSET_SHARED(ary) FL_UNSET((ary), ELTS_SHARED)
+
+#define ARY_SET_PTR(ary, p) do { \
+    assert(!ARY_EMBED_P(ary)); \
+    assert(!OBJ_FROZEN(ary)); \
+    RARRAY(ary)->as.heap.ptr = (p); \
+} while (0)
+#define ARY_SET_EMBED_LEN(ary, n) do { \
+    long tmp_n = (n); \
+    assert(ARY_EMBED_P(ary)); \
+    assert(!OBJ_FROZEN(ary)); \
+    RBASIC(ary)->flags &= ~RARRAY_EMBED_LEN_MASK; \
+    RBASIC(ary)->flags |= (tmp_n) << RARRAY_EMBED_LEN_SHIFT; \
+} while (0)
+#define ARY_SET_HEAP_LEN(ary, n) do { \
+    assert(!ARY_EMBED_P(ary)); \
+    RARRAY(ary)->as.heap.len = (n); \
+} while (0)
+#define ARY_SET_LEN(ary, n) do { \
+    if (ARY_EMBED_P(ary)) { \
+        ARY_SET_EMBED_LEN((ary), (n)); \
+    } \
+    else { \
+        ARY_SET_HEAP_LEN((ary), (n)); \
+    } \
+    assert(RARRAY_LEN(ary) == (n)); \
+} while (0)
+#define ARY_INCREASE_PTR(ary, n) do  { \
+    assert(!ARY_EMBED_P(ary)); \
+    assert(!OBJ_FROZEN(ary)); \
+    RARRAY(ary)->as.heap.ptr += (n); \
+} while (0)
+#define ARY_INCREASE_LEN(ary, n) do  { \
+    assert(!OBJ_FROZEN(ary)); \
+    if (ARY_EMBED_P(ary)) { \
+        ARY_SET_EMBED_LEN((ary), RARRAY_LEN(ary)+(n)); \
+    } \
+    else { \
+        RARRAY(ary)->as.heap.len += (n); \
+    } \
+} while (0)
+
+#define ARY_CAPA(ary) (ARY_EMBED_P(ary) ? RARRAY_EMBED_LEN_MAX : \
+		       ARY_SHARED_ROOT_P(ary) ? RARRAY_LEN(ary) : RARRAY(ary)->as.heap.aux.capa)
+#define ARY_SET_CAPA(ary, n) do { \
+    assert(!ARY_EMBED_P(ary)); \
+    assert(!ARY_SHARED_P(ary)); \
+    assert(!OBJ_FROZEN(ary)); \
+    RARRAY(ary)->as.heap.aux.capa = (n); \
+} while (0)
+
+#define ARY_SHARED(ary) (assert(ARY_SHARED_P(ary)), RARRAY(ary)->as.heap.aux.shared)
+#define ARY_SET_SHARED(ary, value) do { \
+    const VALUE _ary_ = (ary); \
+    const VALUE _value_ = (value); \
+    assert(!ARY_EMBED_P(_ary_)); \
+    assert(ARY_SHARED_P(_ary_)); \
+    assert(ARY_SHARED_ROOT_P(_value_)); \
+    RB_OBJ_WRITE(_ary_, &RARRAY(_ary_)->as.heap.aux.shared, _value_); \
+} while (0)
+#define RARRAY_SHARED_ROOT_FLAG FL_USER5
+#define ARY_SHARED_ROOT_P(ary) (FL_TEST((ary), RARRAY_SHARED_ROOT_FLAG))
+#define ARY_SHARED_NUM(ary) \
+    (assert(ARY_SHARED_ROOT_P(ary)), RARRAY(ary)->as.heap.aux.capa)
+#define ARY_SHARED_OCCUPIED(ary) (ARY_SHARED_NUM(ary) == 1)
+#define ARY_SET_SHARED_NUM(ary, value) do { \
+    assert(ARY_SHARED_ROOT_P(ary)); \
+    RARRAY(ary)->as.heap.aux.capa = (value); \
+} while (0)
+#define FL_SET_SHARED_ROOT(ary) do { \
+    assert(!ARY_EMBED_P(ary)); \
+    FL_SET((ary), RARRAY_SHARED_ROOT_FLAG); \
+} while (0)
+
+#define ARY_SET(a, i, v) RARRAY_ASET((assert(!ARY_SHARED_P(a)), (a)), (i), (v))
 
 void
-rb_mem_clear(mem, size)
-    register VALUE *mem;
-    register long size;
+rb_mem_clear(register VALUE *mem, register long size)
 {
     while (size--) {
 	*mem++ = Qnil;
     }
 }
 
+static void
+ary_mem_clear(VALUE ary, long beg, long size)
+{
+    RARRAY_PTR_USE(ary, ptr, {
+	rb_mem_clear(ptr + beg, size);
+    });
+}
+
 static inline void
-memfill(mem, size, val)
-    register VALUE *mem;
-    register long size;
-    register VALUE val;
+memfill(register VALUE *mem, register long size, register VALUE val)
 {
     while (size--) {
 	*mem++ = val;
     }
 }
 
-#define ARY_TMPLOCK  FL_USER1
+static void
+ary_memfill(VALUE ary, long beg, long size, VALUE val)
+{
+    RARRAY_PTR_USE(ary, ptr, {
+	memfill(ptr + beg, size, val);
+	RB_OBJ_WRITTEN(ary, Qundef, val);
+    });
+}
+
+static void
+ary_memcpy0(VALUE ary, long beg, long argc, const VALUE *argv, VALUE buff_owner_ary)
+{
+#if 1
+    assert(!ARY_SHARED_P(buff_owner_ary));
+
+    if (argc > (int)(128/sizeof(VALUE)) /* is magic number (cache line size) */) {
+	rb_gc_writebarrier_remember(buff_owner_ary);
+	RARRAY_PTR_USE(ary, ptr, {
+	    MEMCPY(ptr+beg, argv, VALUE, argc);
+	});
+    }
+    else {
+	int i;
+	RARRAY_PTR_USE(ary, ptr, {
+	    for (i=0; i<argc; i++) {
+		RB_OBJ_WRITE(buff_owner_ary, &ptr[i+beg], argv[i]);
+	    }
+	});
+    }
+#else
+    /* giveup write barrier (traditional way) */
+    RARRAY_PTR(buff_owner_ary);
+    MEMCPY(RARRAY_PTR(ary)+beg, argv, VALUE, argc);
+#endif
+}
+
+static void
+ary_memcpy(VALUE ary, long beg, long argc, const VALUE *argv)
+{
+    ary_memcpy0(ary, beg, argc, argv, ary);
+}
+
+static void
+ary_resize_capa(VALUE ary, long capacity)
+{
+    assert(RARRAY_LEN(ary) <= capacity);
+    assert(!OBJ_FROZEN(ary));
+    assert(!ARY_SHARED_P(ary));
+    if (capacity > RARRAY_EMBED_LEN_MAX) {
+        if (ARY_EMBED_P(ary)) {
+            long len = ARY_EMBED_LEN(ary);
+            VALUE *ptr = ALLOC_N(VALUE, (capacity));
+            MEMCPY(ptr, ARY_EMBED_PTR(ary), VALUE, len);
+            FL_UNSET_EMBED(ary);
+            ARY_SET_PTR(ary, ptr);
+            ARY_SET_HEAP_LEN(ary, len);
+        }
+        else {
+	    SIZED_REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, capacity, RARRAY(ary)->as.heap.aux.capa);
+        }
+        ARY_SET_CAPA(ary, (capacity));
+    }
+    else {
+        if (!ARY_EMBED_P(ary)) {
+            long len = RARRAY_LEN(ary);
+	    const VALUE *ptr = RARRAY_CONST_PTR(ary);
+
+	    if (len > capacity) len = capacity;
+            MEMCPY((VALUE *)RARRAY(ary)->as.ary, ptr, VALUE, len);
+            FL_SET_EMBED(ary);
+            ARY_SET_LEN(ary, len);
+	    ruby_xfree((VALUE *)ptr);
+        }
+    }
+}
 
 static inline void
-rb_ary_modify_check(ary)
-    VALUE ary;
+ary_shrink_capa(VALUE ary)
 {
-    if (OBJ_FROZEN(ary)) rb_error_frozen("array");
-    if (FL_TEST(ary, ARY_TMPLOCK))
-	rb_raise(rb_eRuntimeError, "can't modify array during iteration");
-    if (!OBJ_TAINTED(ary) && rb_safe_level() >= 4)
-	rb_raise(rb_eSecurityError, "Insecure: can't modify array");
+    long capacity = ARY_HEAP_LEN(ary);
+    long old_capa = RARRAY(ary)->as.heap.aux.capa;
+    assert(!ARY_SHARED_P(ary));
+    assert(old_capa >= capacity);
+    if (old_capa > capacity)
+	REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, capacity);
 }
 
 static void
-rb_ary_modify(ary)
-    VALUE ary;
+ary_double_capa(VALUE ary, long min)
+{
+    long new_capa = ARY_CAPA(ary) / 2;
+
+    if (new_capa < ARY_DEFAULT_SIZE) {
+	new_capa = ARY_DEFAULT_SIZE;
+    }
+    if (new_capa >= ARY_MAX_SIZE - min) {
+	new_capa = (ARY_MAX_SIZE - min) / 2;
+    }
+    new_capa += min;
+    ary_resize_capa(ary, new_capa);
+}
+
+static void
+rb_ary_decrement_share(VALUE shared)
+{
+    if (shared) {
+	long num = ARY_SHARED_NUM(shared) - 1;
+	if (num == 0) {
+	    rb_ary_free(shared);
+	    rb_gc_force_recycle(shared);
+	}
+	else if (num > 0) {
+	    ARY_SET_SHARED_NUM(shared, num);
+	}
+    }
+}
+
+static void
+rb_ary_unshare(VALUE ary)
+{
+    VALUE shared = RARRAY(ary)->as.heap.aux.shared;
+    rb_ary_decrement_share(shared);
+    FL_UNSET_SHARED(ary);
+}
+
+static inline void
+rb_ary_unshare_safe(VALUE ary)
+{
+    if (ARY_SHARED_P(ary) && !ARY_EMBED_P(ary)) {
+	rb_ary_unshare(ary);
+    }
+}
+
+static VALUE
+rb_ary_increment_share(VALUE shared)
+{
+    long num = ARY_SHARED_NUM(shared);
+    if (num >= 0) {
+	ARY_SET_SHARED_NUM(shared, num + 1);
+    }
+    return shared;
+}
+
+static void
+rb_ary_set_shared(VALUE ary, VALUE shared)
 {
-    VALUE *ptr;
+    rb_ary_increment_share(shared);
+    FL_SET_SHARED(ary);
+    ARY_SET_SHARED(ary, shared);
+}
 
+static inline void
+rb_ary_modify_check(VALUE ary)
+{
+    rb_check_frozen(ary);
+}
+
+void
+rb_ary_modify(VALUE ary)
+{
     rb_ary_modify_check(ary);
-    if (FL_TEST(ary, ELTS_SHARED)) {
-	ptr = ALLOC_N(VALUE, RARRAY(ary)->len);
-	FL_UNSET(ary, ELTS_SHARED);
-	RARRAY(ary)->aux.capa = RARRAY(ary)->len;
-	MEMCPY(ptr, RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
-	RARRAY(ary)->ptr = ptr;
+    if (ARY_SHARED_P(ary)) {
+	long shared_len, len = RARRAY_LEN(ary);
+	VALUE shared = ARY_SHARED(ary);
+        if (len <= RARRAY_EMBED_LEN_MAX) {
+	    const VALUE *ptr = ARY_HEAP_PTR(ary);
+            FL_UNSET_SHARED(ary);
+            FL_SET_EMBED(ary);
+	    MEMCPY((VALUE *)ARY_EMBED_PTR(ary), ptr, VALUE, len);
+            rb_ary_decrement_share(shared);
+            ARY_SET_EMBED_LEN(ary, len);
+        }
+	else if (ARY_SHARED_OCCUPIED(shared) && len > ((shared_len = RARRAY_LEN(shared))>>1)) {
+	    long shift = RARRAY_CONST_PTR(ary) - RARRAY_CONST_PTR(shared);
+	    FL_UNSET_SHARED(ary);
+	    ARY_SET_PTR(ary, RARRAY_CONST_PTR(shared));
+	    ARY_SET_CAPA(ary, shared_len);
+	    RARRAY_PTR_USE(ary, ptr, {
+		MEMMOVE(ptr, ptr+shift, VALUE, len);
+	    });
+	    FL_SET_EMBED(shared);
+	    rb_ary_decrement_share(shared);
+	}
+        else {
+            VALUE *ptr = ALLOC_N(VALUE, len);
+            MEMCPY(ptr, RARRAY_CONST_PTR(ary), VALUE, len);
+            rb_ary_unshare(ary);
+            ARY_SET_CAPA(ary, len);
+            ARY_SET_PTR(ary, ptr);
+        }
+
+	rb_gc_writebarrier_remember(ary);
+    }
+}
+
+static VALUE
+ary_ensure_room_for_push(VALUE ary, long add_len)
+{
+    long old_len = RARRAY_LEN(ary);
+    long new_len = old_len + add_len;
+    long capa;
+
+    if (old_len > ARY_MAX_SIZE - add_len) {
+	rb_raise(rb_eIndexError, "index %ld too big", new_len);
+    }
+    if (ARY_SHARED_P(ary)) {
+	if (new_len > RARRAY_EMBED_LEN_MAX) {
+	    VALUE shared = ARY_SHARED(ary);
+	    if (ARY_SHARED_OCCUPIED(shared)) {
+		if (RARRAY_CONST_PTR(ary) - RARRAY_CONST_PTR(shared) + new_len <= RARRAY_LEN(shared)) {
+		    rb_ary_modify_check(ary);
+		    return shared;
+		}
+		else {
+		    /* if array is shared, then it is likely it participate in push/shift pattern */
+		    rb_ary_modify(ary);
+		    capa = ARY_CAPA(ary);
+		    if (new_len > capa - (capa >> 6)) {
+			ary_double_capa(ary, new_len);
+		    }
+		    return ary;
+		}
+	    }
+	}
     }
+    rb_ary_modify(ary);
+    capa = ARY_CAPA(ary);
+    if (new_len > capa) {
+	ary_double_capa(ary, new_len);
+    }
+
+    return ary;
 }
 
+/*
+ *  call-seq:
+ *      ary.freeze -> ary
+ *
+ *  Calls Object#freeze on +ary+ to prevent any further
+ *  modification. A RuntimeError will be raised if a modification
+ *  attempt is made.
+ *
+ */
+
 VALUE
-rb_ary_freeze(ary)
-    VALUE ary;
+rb_ary_freeze(VALUE ary)
 {
     return rb_obj_freeze(ary);
 }
 
 /*
  *  call-seq:
- *     array.frozen?  -> true or false
+ *     ary.frozen?  -> true or false
  *
- *  Return <code>true</code> if this array is frozen (or temporarily frozen
- *  while being sorted).
+ *  Return +true+ if this array is frozen (or temporarily frozen
+ *  while being sorted). See also Object#frozen?
  */
 
 static VALUE
-rb_ary_frozen_p(ary)
-    VALUE ary;
+rb_ary_frozen_p(VALUE ary)
 {
     if (OBJ_FROZEN(ary)) return Qtrue;
-    if (FL_TEST(ary, ARY_TMPLOCK)) return Qtrue;
     return Qfalse;
 }
 
-static VALUE ary_alloc _((VALUE));
-static VALUE
-ary_alloc(klass)
-    VALUE klass;
+/* This can be used to take a snapshot of an array (with
+   e.g. rb_ary_replace) and check later whether the array has been
+   modified from the snapshot.  The snapshot is cheap, though if
+   something does modify the array it will pay the cost of copying
+   it.  If Array#pop or Array#shift has been called, the array will
+   be still shared with the snapshot, but the array length will
+   differ. */
+VALUE
+rb_ary_shared_with_p(VALUE ary1, VALUE ary2)
 {
-    NEWOBJ(ary, struct RArray);
-    OBJSETUP(ary, klass, T_ARRAY);
-
-    ary->len = 0;
-    ary->ptr = 0;
-    ary->aux.capa = 0;
+    if (!ARY_EMBED_P(ary1) && ARY_SHARED_P(ary1) &&
+	!ARY_EMBED_P(ary2) && ARY_SHARED_P(ary2) &&
+	RARRAY(ary1)->as.heap.aux.shared == RARRAY(ary2)->as.heap.aux.shared &&
+	RARRAY(ary1)->as.heap.len == RARRAY(ary2)->as.heap.len) {
+	return Qtrue;
+    }
+    return Qfalse;
+}
 
+static VALUE
+ary_alloc(VALUE klass)
+{
+    NEWOBJ_OF(ary, struct RArray, klass, T_ARRAY | RARRAY_EMBED_FLAG | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0));
+    /* Created array is:
+     *   FL_SET_EMBED((VALUE)ary);
+     *   ARY_SET_EMBED_LEN((VALUE)ary, 0);
+     */
     return (VALUE)ary;
 }
 
 static VALUE
-ary_new(klass, len)
-    VALUE klass;
-    long len;
+empty_ary_alloc(VALUE klass)
 {
-    VALUE ary = ary_alloc(klass);
+    RUBY_DTRACE_CREATE_HOOK(ARRAY, 0);
+    return ary_alloc(klass);
+}
 
-    if (len < 0) {
+static VALUE
+ary_new(VALUE klass, long capa)
+{
+    VALUE ary,*ptr;
+
+    if (capa < 0) {
 	rb_raise(rb_eArgError, "negative array size (or size too big)");
     }
-    if (len > 0 && len * sizeof(VALUE) <= len) {
+    if (capa > ARY_MAX_SIZE) {
 	rb_raise(rb_eArgError, "array size too big");
     }
-    if (len == 0) len++;
-    RARRAY(ary)->ptr = ALLOC_N(VALUE, len);
-    RARRAY(ary)->aux.capa = len;
+
+    RUBY_DTRACE_CREATE_HOOK(ARRAY, capa);
+
+    ary = ary_alloc(klass);
+    if (capa > RARRAY_EMBED_LEN_MAX) {
+	ptr = ALLOC_N(VALUE, capa);
+        FL_UNSET_EMBED(ary);
+        ARY_SET_PTR(ary, ptr);
+        ARY_SET_CAPA(ary, capa);
+        ARY_SET_HEAP_LEN(ary, 0);
+    }
 
     return ary;
 }
 
 VALUE
-rb_ary_new2(len)
-    long len;
+rb_ary_new_capa(long capa)
 {
-    return ary_new(rb_cArray, len);
+    return ary_new(rb_cArray, capa);
 }
 
-
 VALUE
-rb_ary_new()
+rb_ary_new(void)
 {
-    return rb_ary_new2(ARY_DEFAULT_SIZE);
+    return rb_ary_new2(RARRAY_EMBED_LEN_MAX);
 }
 
-#ifdef HAVE_STDARG_PROTOTYPES
-#include <stdarg.h>
-#define va_init_list(a,b) va_start(a,b)
-#else
-#include <varargs.h>
-#define va_init_list(a,b) va_start(a)
-#endif
-
 VALUE
-#ifdef HAVE_STDARG_PROTOTYPES
-rb_ary_new3(long n, ...)
-#else
-rb_ary_new3(n, va_alist)
-    long n;
-    va_dcl
-#endif
+(rb_ary_new_from_args)(long n, ...)
 {
     va_list ar;
     VALUE ary;
@@ -167,120 +504,240 @@ rb_ary_new3(n, va_alist)
 
     ary = rb_ary_new2(n);
 
-    va_init_list(ar, n);
+    va_start(ar, n);
     for (i=0; i<n; i++) {
-	RARRAY(ary)->ptr[i] = va_arg(ar, VALUE);
+	ARY_SET(ary, i, va_arg(ar, VALUE));
     }
     va_end(ar);
 
-    RARRAY(ary)->len = n;
+    ARY_SET_LEN(ary, n);
     return ary;
 }
 
 VALUE
-rb_ary_new4(n, elts)
-    long n;
-    const VALUE *elts;
+rb_ary_new_from_values(long n, const VALUE *elts)
 {
     VALUE ary;
 
     ary = rb_ary_new2(n);
     if (n > 0 && elts) {
-	MEMCPY(RARRAY(ary)->ptr, elts, VALUE, n);
+	ary_memcpy(ary, 0, n, elts);
+	ARY_SET_LEN(ary, n);
     }
 
-    /* This assignment to len will be moved to the above "if" block in Ruby 1.9 */
-    RARRAY(ary)->len = n;
-
     return ary;
 }
 
 VALUE
-rb_assoc_new(car, cdr)
-    VALUE car, cdr;
+rb_ary_tmp_new(long capa)
 {
-    VALUE ary;
-
-    ary = rb_ary_new2(2);
-    RARRAY(ary)->ptr[0] = car;
-    RARRAY(ary)->ptr[1] = cdr;
-    RARRAY(ary)->len = 2;
+    return ary_new(0, capa);
+}
 
+VALUE
+rb_ary_tmp_new_fill(long capa)
+{
+    VALUE ary = ary_new(0, capa);
+    ary_memfill(ary, 0, capa, Qnil);
+    ARY_SET_LEN(ary, capa);
     return ary;
 }
 
+void
+rb_ary_free(VALUE ary)
+{
+    if (ARY_OWNS_HEAP_P(ary)) {
+	ruby_sized_xfree((void *)ARY_HEAP_PTR(ary), ARY_HEAP_SIZE(ary));
+    }
+}
+
+RUBY_FUNC_EXPORTED size_t
+rb_ary_memsize(VALUE ary)
+{
+    if (ARY_OWNS_HEAP_P(ary)) {
+	return RARRAY(ary)->as.heap.aux.capa * sizeof(VALUE);
+    }
+    else {
+	return 0;
+    }
+}
+
+static inline void
+ary_discard(VALUE ary)
+{
+    rb_ary_free(ary);
+    RBASIC(ary)->flags |= RARRAY_EMBED_FLAG;
+    RBASIC(ary)->flags &= ~RARRAY_EMBED_LEN_MASK;
+}
+
 static VALUE
-to_ary(ary)
-    VALUE ary;
+ary_make_shared(VALUE ary)
+{
+    assert(!ARY_EMBED_P(ary));
+    if (ARY_SHARED_P(ary)) {
+	return ARY_SHARED(ary);
+    }
+    else if (ARY_SHARED_ROOT_P(ary)) {
+	return ary;
+    }
+    else if (OBJ_FROZEN(ary)) {
+	ary_shrink_capa(ary);
+	FL_SET_SHARED_ROOT(ary);
+	ARY_SET_SHARED_NUM(ary, 1);
+	return ary;
+    }
+    else {
+	long capa = ARY_CAPA(ary), len = RARRAY_LEN(ary);
+	NEWOBJ_OF(shared, struct RArray, 0, T_ARRAY | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0));
+        FL_UNSET_EMBED(shared);
+
+	ARY_SET_LEN((VALUE)shared, capa);
+	ARY_SET_PTR((VALUE)shared, RARRAY_CONST_PTR(ary));
+	ary_mem_clear((VALUE)shared, len, capa - len);
+	FL_SET_SHARED_ROOT(shared);
+	ARY_SET_SHARED_NUM((VALUE)shared, 1);
+	FL_SET_SHARED(ary);
+	ARY_SET_SHARED(ary, (VALUE)shared);
+	OBJ_FREEZE(shared);
+	return (VALUE)shared;
+    }
+}
+
+static VALUE
+ary_make_substitution(VALUE ary)
+{
+    long len = RARRAY_LEN(ary);
+
+    if (len <= RARRAY_EMBED_LEN_MAX) {
+	VALUE subst = rb_ary_new2(len);
+	ary_memcpy(subst, 0, len, RARRAY_CONST_PTR(ary));
+        ARY_SET_EMBED_LEN(subst, len);
+        return subst;
+    }
+    else {
+        return rb_ary_increment_share(ary_make_shared(ary));
+    }
+}
+
+VALUE
+rb_assoc_new(VALUE car, VALUE cdr)
+{
+    return rb_ary_new3(2, car, cdr);
+}
+
+static VALUE
+to_ary(VALUE ary)
 {
     return rb_convert_type(ary, T_ARRAY, "Array", "to_ary");
 }
 
 VALUE
-rb_check_array_type(ary)
-    VALUE ary;
+rb_check_array_type(VALUE ary)
 {
     return rb_check_convert_type(ary, T_ARRAY, "Array", "to_ary");
 }
 
-static VALUE rb_ary_replace _((VALUE, VALUE));
+/*
+ *  call-seq:
+ *     Array.try_convert(obj) -> array or nil
+ *
+ *  Tries to convert +obj+ into an array, using +to_ary+ method.  Returns the
+ *  converted array or +nil+ if +obj+ cannot be converted for any reason.
+ *  This method can be used to check if an argument is an array.
+ *
+ *     Array.try_convert([1])   #=> [1]
+ *     Array.try_convert("1")   #=> nil
+ *
+ *     if tmp = Array.try_convert(arg)
+ *       # the argument is an array
+ *     elsif tmp = String.try_convert(arg)
+ *       # the argument is a string
+ *     end
+ *
+ */
+
+static VALUE
+rb_ary_s_try_convert(VALUE dummy, VALUE ary)
+{
+    return rb_check_array_type(ary);
+}
 
 /*
  *  call-seq:
- *     Array.new(size=0, obj=nil)
+ *     Array.new(size=0, default=nil)
  *     Array.new(array)
  *     Array.new(size) {|index| block }
  *
- *  Returns a new array. In the first form, the new array is
- *  empty. In the second it is created with _size_ copies of _obj_
- *  (that is, _size_ references to the same
- *  _obj_). The third form creates a copy of the array
- *  passed as a parameter (the array is generated by calling
- *  to_ary  on the parameter). In the last form, an array
- *  of the given size is created. Each element in this array is
- *  calculated by passing the element's index to the given block and
- *  storing the return value.
- *
- *     Array.new
- *     Array.new(2)
- *     Array.new(5, "A")
- * 
- *     # only one copy of the object is created
+ *  Returns a new array.
+ *
+ *  In the first form, if no arguments are sent, the new array will be empty.
+ *  When a +size+ and an optional +default+ are sent, an array is created with
+ *  +size+ copies of +default+.  Take notice that all elements will reference the
+ *  same object +default+.
+ *
+ *  The second form creates a copy of the array passed as a parameter (the
+ *  array is generated by calling to_ary on the parameter).
+ *
+ *    first_array = ["Matz", "Guido"]
+ *
+ *    second_array = Array.new(first_array) #=> ["Matz", "Guido"]
+ *
+ *    first_array.equal? second_array       #=> false
+ *
+ *  In the last form, an array of the given size is created.  Each element in
+ *  this array is created by passing the element's index to the given block
+ *  and storing the return value.
+ *
+ *    Array.new(3){ |index| index ** 2 }
+ *    # => [0, 1, 4]
+ *
+ *  == Common gotchas
+ *
+ *  When sending the second parameter, the same object will be used as the
+ *  value for all the array elements:
+ *
  *     a = Array.new(2, Hash.new)
+ *     # => [{}, {}]
+ *
  *     a[0]['cat'] = 'feline'
- *     a
+ *     a # => [{"cat"=>"feline"}, {"cat"=>"feline"}]
+ *
  *     a[1]['cat'] = 'Felix'
- *     a
- * 
- *     # here multiple copies are created
+ *     a # => [{"cat"=>"Felix"}, {"cat"=>"Felix"}]
+ *
+ *  Since all the Array elements store the same hash, changes to one of them
+ *  will affect them all.
+ *
+ *  If multiple copies are what you want, you should use the block
+ *  version which uses the result of that block each time an element
+ *  of the array needs to be initialized:
+ *
  *     a = Array.new(2) { Hash.new }
  *     a[0]['cat'] = 'feline'
- *     a
- * 
- *     squares = Array.new(5) {|i| i*i}
- *     squares
- * 
- *     copy = Array.new(squares)
+ *     a # => [{"cat"=>"feline"}, {}]
+ *
  */
 
 static VALUE
-rb_ary_initialize(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+rb_ary_initialize(int argc, VALUE *argv, VALUE ary)
 {
     long len;
     VALUE size, val;
 
     rb_ary_modify(ary);
-    if (rb_scan_args(argc, argv, "02", &size, &val) == 0) {
-	RARRAY(ary)->len = 0;
+    if (argc == 0) {
+	if (ARY_OWNS_HEAP_P(ary) && RARRAY_CONST_PTR(ary) != 0) {
+	    ruby_sized_xfree((void *)RARRAY_CONST_PTR(ary), ARY_HEAP_SIZE(ary));
+	}
+        rb_ary_unshare_safe(ary);
+        FL_SET_EMBED(ary);
+	ARY_SET_EMBED_LEN(ary, 0);
 	if (rb_block_given_p()) {
 	    rb_warning("given block not used");
 	}
 	return ary;
     }
-
+    rb_scan_args(argc, argv, "02", &size, &val);
     if (argc == 1 && !FIXNUM_P(size)) {
 	val = rb_check_array_type(size);
 	if (!NIL_P(val)) {
@@ -290,16 +747,16 @@ rb_ary_initialize(argc, argv, ary)
     }
 
     len = NUM2LONG(size);
+    /* NUM2LONG() may call size.to_int, ary can be frozen, modified, etc */
     if (len < 0) {
 	rb_raise(rb_eArgError, "negative array size");
     }
-    if (len > 0 && len * (long)sizeof(VALUE) <= len) {
+    if (len > ARY_MAX_SIZE) {
 	rb_raise(rb_eArgError, "array size too big");
     }
-    if (len > RARRAY(ary)->aux.capa) {
-	REALLOC_N(RARRAY(ary)->ptr, VALUE, len);
-	RARRAY(ary)->aux.capa = len;
-    }
+    /* recheck after argument conversion */
+    rb_ary_modify(ary);
+    ary_resize_capa(ary, len);
     if (rb_block_given_p()) {
 	long i;
 
@@ -308,86 +765,133 @@ rb_ary_initialize(argc, argv, ary)
 	}
 	for (i=0; i<len; i++) {
 	    rb_ary_store(ary, i, rb_yield(LONG2NUM(i)));
-	    RARRAY(ary)->len = i + 1;
+	    ARY_SET_LEN(ary, i + 1);
 	}
     }
     else {
-	memfill(RARRAY(ary)->ptr, len, val);
-	RARRAY(ary)->len = len;
+	ary_memfill(ary, 0, len, val);
+	ARY_SET_LEN(ary, len);
     }
-
     return ary;
 }
 
-
-/* 
-* Returns a new array populated with the given objects. 
-*
-*   Array.[]( 1, 'a', /^A/ )
-*   Array[ 1, 'a', /^A/ ]
-*   [ 1, 'a', /^A/ ]
-*/
+/*
+ * Returns a new array populated with the given objects.
+ *
+ *   Array.[]( 1, 'a', /^A/ ) # => [1, "a", /^A/]
+ *   Array[ 1, 'a', /^A/ ]    # => [1, "a", /^A/]
+ *   [ 1, 'a', /^A/ ]         # => [1, "a", /^A/]
+ */
 
 static VALUE
-rb_ary_s_create(argc, argv, klass)
-    int argc;
-    VALUE *argv;
-    VALUE klass;
+rb_ary_s_create(int argc, VALUE *argv, VALUE klass)
 {
-    VALUE ary = ary_alloc(klass);
-
-    if (argc > 0) {
-	RARRAY(ary)->ptr = ALLOC_N(VALUE, argc);
-	MEMCPY(RARRAY(ary)->ptr, argv, VALUE, argc);
+    VALUE ary = ary_new(klass, argc);
+    if (argc > 0 && argv) {
+        ary_memcpy(ary, 0, argc, argv);
+        ARY_SET_LEN(ary, argc);
     }
-    RARRAY(ary)->len = RARRAY(ary)->aux.capa = argc;
 
     return ary;
 }
 
 void
-rb_ary_store(ary, idx, val)
-    VALUE ary;
-    long idx;
-    VALUE val;
+rb_ary_store(VALUE ary, long idx, VALUE val)
 {
+    long len = RARRAY_LEN(ary);
+
     if (idx < 0) {
-	idx += RARRAY(ary)->len;
+	idx += len;
 	if (idx < 0) {
-	    rb_raise(rb_eIndexError, "index %ld out of array",
-		    idx - RARRAY(ary)->len);
+	    rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
+		     idx - len, -len);
 	}
     }
+    else if (idx >= ARY_MAX_SIZE) {
+	rb_raise(rb_eIndexError, "index %ld too big", idx);
+    }
 
     rb_ary_modify(ary);
-    if (idx >= RARRAY(ary)->aux.capa) {
-	long new_capa = RARRAY(ary)->aux.capa / 2;
+    if (idx >= ARY_CAPA(ary)) {
+	ary_double_capa(ary, idx);
+    }
+    if (idx > len) {
+	ary_mem_clear(ary, len, idx - len + 1);
+    }
 
-	if (new_capa < ARY_DEFAULT_SIZE) {
-	    new_capa = ARY_DEFAULT_SIZE;
-	}
-	new_capa += idx;
-	if (new_capa * (long)sizeof(VALUE) <= new_capa) {
-	    rb_raise(rb_eArgError, "index too big");
-	}
-	REALLOC_N(RARRAY(ary)->ptr, VALUE, new_capa);
-	RARRAY(ary)->aux.capa = new_capa;
+    if (idx >= len) {
+	ARY_SET_LEN(ary, idx + 1);
     }
-    if (idx > RARRAY(ary)->len) {
-	rb_mem_clear(RARRAY(ary)->ptr + RARRAY(ary)->len,
-		     idx-RARRAY(ary)->len + 1);
+    ARY_SET(ary, idx, val);
+}
+
+static VALUE
+ary_make_partial(VALUE ary, VALUE klass, long offset, long len)
+{
+    assert(offset >= 0);
+    assert(len >= 0);
+    assert(offset+len <= RARRAY_LEN(ary));
+
+    if (len <= RARRAY_EMBED_LEN_MAX) {
+        VALUE result = ary_alloc(klass);
+	ary_memcpy(result, 0, len, RARRAY_CONST_PTR(ary) + offset);
+        ARY_SET_EMBED_LEN(result, len);
+        return result;
+    }
+    else {
+        VALUE shared, result = ary_alloc(klass);
+        FL_UNSET_EMBED(result);
+
+        shared = ary_make_shared(ary);
+        ARY_SET_PTR(result, RARRAY_CONST_PTR(ary));
+        ARY_SET_LEN(result, RARRAY_LEN(ary));
+        rb_ary_set_shared(result, shared);
+
+        ARY_INCREASE_PTR(result, offset);
+        ARY_SET_LEN(result, len);
+        return result;
     }
+}
+
+static VALUE
+ary_make_shared_copy(VALUE ary)
+{
+    return ary_make_partial(ary, rb_obj_class(ary), 0, RARRAY_LEN(ary));
+}
 
-    if (idx >= RARRAY(ary)->len) {
-	RARRAY(ary)->len = idx + 1;
+enum ary_take_pos_flags
+{
+    ARY_TAKE_FIRST = 0,
+    ARY_TAKE_LAST = 1
+};
+
+static VALUE
+ary_take_first_or_last(int argc, const VALUE *argv, VALUE ary, enum ary_take_pos_flags last)
+{
+    VALUE nv;
+    long n;
+    long len;
+    long offset = 0;
+
+    rb_scan_args(argc, argv, "1", &nv);
+    n = NUM2LONG(nv);
+    len = RARRAY_LEN(ary);
+    if (n > len) {
+	n = len;
+    }
+    else if (n < 0) {
+	rb_raise(rb_eArgError, "negative array size");
+    }
+    if (last) {
+	offset = len - n;
     }
-    RARRAY(ary)->ptr[idx] = val;
+    return ary_make_partial(ary, rb_cArray, offset, n);
 }
 
 /*
  *  call-seq:
- *     array << obj            -> array
- *  
+ *     ary << obj            -> ary
+ *
  *  Append---Pushes the given object on to the end of this array. This
  *  expression returns the array itself, so several appends
  *  may be chained together.
@@ -398,249 +902,342 @@ rb_ary_store(ary, idx, val)
  */
 
 VALUE
-rb_ary_push(ary, item)
-    VALUE ary;
-    VALUE item;
+rb_ary_push(VALUE ary, VALUE item)
 {
-    rb_ary_store(ary, RARRAY(ary)->len, item);
+    long idx = RARRAY_LEN(ary);
+    VALUE target_ary = ary_ensure_room_for_push(ary, 1);
+    RARRAY_PTR_USE(ary, ptr, {
+	RB_OBJ_WRITE(target_ary, &ptr[idx], item);
+    });
+    ARY_SET_LEN(ary, idx + 1);
     return ary;
 }
 
-/* 
+VALUE
+rb_ary_cat(VALUE ary, const VALUE *argv, long len)
+{
+    long oldlen = RARRAY_LEN(ary);
+    VALUE target_ary = ary_ensure_room_for_push(ary, len);
+    ary_memcpy0(ary, oldlen, len, argv, target_ary);
+    ARY_SET_LEN(ary, oldlen + len);
+    return ary;
+}
+
+/*
  *  call-seq:
- *     array.push(obj, ... )   -> array
- *  
- *  Append---Pushes the given object(s) on to the end of this array. This
+ *     ary.push(obj, ... )   -> ary
+ *
+ *  Append --- Pushes the given object(s) on to the end of this array. This
  *  expression returns the array itself, so several appends
- *  may be chained together.
+ *  may be chained together. See also Array#pop for the opposite
+ *  effect.
  *
  *     a = [ "a", "b", "c" ]
- *     a.push("d", "e", "f")  
+ *     a.push("d", "e", "f")
  *             #=> ["a", "b", "c", "d", "e", "f"]
+ *     [1, 2, 3,].push(4).push(5)
+ *             #=> [1, 2, 3, 4, 5]
  */
 
 static VALUE
-rb_ary_push_m(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+rb_ary_push_m(int argc, VALUE *argv, VALUE ary)
 {
-    while (argc--) {
-	rb_ary_push(ary, *argv++);
-    }
-    return ary;
+    return rb_ary_cat(ary, argv, argc);
+}
+
+VALUE
+rb_ary_pop(VALUE ary)
+{
+    long n;
+    rb_ary_modify_check(ary);
+    n = RARRAY_LEN(ary);
+    if (n == 0) return Qnil;
+    if (ARY_OWNS_HEAP_P(ary) &&
+	n * 3 < ARY_CAPA(ary) &&
+	ARY_CAPA(ary) > ARY_DEFAULT_SIZE)
+    {
+	ary_resize_capa(ary, n * 2);
+    }
+    --n;
+    ARY_SET_LEN(ary, n);
+    return RARRAY_AREF(ary, n);
 }
 
 /*
  *  call-seq:
- *     array.pop  -> obj or nil
- *  
- *  Removes the last element from <i>self</i> and returns it, or
- *  <code>nil</code> if the array is empty.
- *     
- *     a = [ "a", "m", "z" ]
- *     a.pop   #=> "z"
- *     a       #=> ["a", "m"]
+ *     ary.pop    -> obj or nil
+ *     ary.pop(n) -> new_ary
+ *
+ *  Removes the last element from +self+ and returns it, or
+ *  +nil+ if the array is empty.
+ *
+ *  If a number +n+ is given, returns an array of the last +n+ elements
+ *  (or less) just like <code>array.slice!(-n, n)</code> does. See also
+ *  Array#push for the opposite effect.
+ *
+ *     a = [ "a", "b", "c", "d" ]
+ *     a.pop     #=> "d"
+ *     a.pop(2)  #=> ["b", "c"]
+ *     a         #=> ["a"]
  */
 
-VALUE
-rb_ary_pop(ary)
-    VALUE ary;
+static VALUE
+rb_ary_pop_m(int argc, VALUE *argv, VALUE ary)
 {
-    rb_ary_modify_check(ary);
-    if (RARRAY(ary)->len == 0) return Qnil;
-    if (!FL_TEST(ary, ELTS_SHARED) &&
-	    RARRAY(ary)->len * 2 < RARRAY(ary)->aux.capa &&
-	    RARRAY(ary)->aux.capa > ARY_DEFAULT_SIZE) {
-	RARRAY(ary)->aux.capa = RARRAY(ary)->len * 2;
-	REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->aux.capa);
+    VALUE result;
+
+    if (argc == 0) {
+	return rb_ary_pop(ary);
     }
-    return RARRAY(ary)->ptr[--RARRAY(ary)->len];
+
+    rb_ary_modify_check(ary);
+    result = ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
+    ARY_INCREASE_LEN(ary, -RARRAY_LEN(result));
+    return result;
 }
 
-static VALUE
-ary_make_shared(ary)
-    VALUE ary;
+VALUE
+rb_ary_shift(VALUE ary)
 {
-    if (!FL_TEST(ary, ELTS_SHARED)) {
-	NEWOBJ(shared, struct RArray);
-	OBJSETUP(shared, rb_cArray, T_ARRAY);
+    VALUE top;
+    long len = RARRAY_LEN(ary);
 
-	shared->len = RARRAY(ary)->len;
-	shared->ptr = RARRAY(ary)->ptr;
-	shared->aux.capa = RARRAY(ary)->aux.capa;
-	RARRAY(ary)->aux.shared = (VALUE)shared;
-	FL_SET(ary, ELTS_SHARED);
-	OBJ_FREEZE(shared);
-	return (VALUE)shared;
+    rb_ary_modify_check(ary);
+    if (len == 0) return Qnil;
+    top = RARRAY_AREF(ary, 0);
+    if (!ARY_SHARED_P(ary)) {
+	if (len < ARY_DEFAULT_SIZE) {
+	    RARRAY_PTR_USE(ary, ptr, {
+		MEMMOVE(ptr, ptr+1, VALUE, len-1);
+	    }); /* WB: no new reference */
+            ARY_INCREASE_LEN(ary, -1);
+	    return top;
+	}
+        assert(!ARY_EMBED_P(ary)); /* ARY_EMBED_LEN_MAX < ARY_DEFAULT_SIZE */
+
+	ARY_SET(ary, 0, Qnil);
+	ary_make_shared(ary);
     }
-    else {
-	return RARRAY(ary)->aux.shared;
+    else if (ARY_SHARED_OCCUPIED(ARY_SHARED(ary))) {
+	RARRAY_PTR_USE(ary, ptr, ptr[0] = Qnil);
     }
+    ARY_INCREASE_PTR(ary, 1);		/* shift ptr */
+    ARY_INCREASE_LEN(ary, -1);
+
+    return top;
 }
 
 /*
  *  call-seq:
- *     array.shift   ->   obj or nil
- *  
- *  Returns the first element of <i>self</i> and removes it (shifting all
- *  other elements down by one). Returns <code>nil</code> if the array
+ *     ary.shift    -> obj or nil
+ *     ary.shift(n) -> new_ary
+ *
+ *  Removes the first element of +self+ and returns it (shifting all
+ *  other elements down by one). Returns +nil+ if the array
  *  is empty.
- *     
+ *
+ *  If a number +n+ is given, returns an array of the first +n+ elements
+ *  (or less) just like <code>array.slice!(0, n)</code> does. With +ary+
+ *  containing only the remainder elements, not including what was shifted to
+ *  +new_ary+. See also Array#unshift for the opposite effect.
+ *
+ *     args = [ "-m", "-q", "filename" ]
+ *     args.shift     #=> "-m"
+ *     args           #=> ["-q", "filename"]
+ *
  *     args = [ "-m", "-q", "filename" ]
- *     args.shift   #=> "-m"
- *     args         #=> ["-q", "filename"]
+ *     args.shift(2)  #=> ["-m", "-q"]
+ *     args           #=> ["filename"]
  */
 
-VALUE
-rb_ary_shift(ary)
-    VALUE ary;
+static VALUE
+rb_ary_shift_m(int argc, VALUE *argv, VALUE ary)
 {
-    VALUE top;
+    VALUE result;
+    long n;
+
+    if (argc == 0) {
+	return rb_ary_shift(ary);
+    }
 
     rb_ary_modify_check(ary);
-    if (RARRAY(ary)->len == 0) return Qnil;
-    top = RARRAY(ary)->ptr[0];
-    if (RARRAY_LEN(ary) < ARY_DEFAULT_SIZE && !FL_TEST(ary, ELTS_SHARED)) {
-	MEMMOVE(RARRAY_PTR(ary), RARRAY_PTR(ary)+1, VALUE, RARRAY_LEN(ary)-1);
+    result = ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
+    n = RARRAY_LEN(result);
+    if (ARY_SHARED_P(ary)) {
+	if (ARY_SHARED_OCCUPIED(ARY_SHARED(ary))) {
+	  setup_occupied_shared:
+	    ary_mem_clear(ary, 0, n);
+	}
+        ARY_INCREASE_PTR(ary, n);
     }
     else {
-	if (!FL_TEST(ary, ELTS_SHARED)) {
-	    RARRAY(ary)->ptr[0] = Qnil;
+	if (RARRAY_LEN(ary) < ARY_DEFAULT_SIZE) {
+	    RARRAY_PTR_USE(ary, ptr, {
+		MEMMOVE(ptr, ptr+n, VALUE, RARRAY_LEN(ary)-n);
+	    }); /* WB: no new reference */
+	}
+	else {
+	    ary_make_shared(ary);
+	    goto setup_occupied_shared;
 	}
-	ary_make_shared(ary);
-	RARRAY(ary)->ptr++;		/* shift ptr */
     }
-    RARRAY(ary)->len--;
+    ARY_INCREASE_LEN(ary, -n);
 
-    return top;
+    return result;
 }
 
-VALUE
-rb_ary_unshift(ary, item)
-    VALUE ary, item;
+static VALUE
+ary_ensure_room_for_unshift(VALUE ary, int argc)
 {
-    rb_ary_modify(ary);
-    if (RARRAY(ary)->len == RARRAY(ary)->aux.capa) {
-	long capa_inc = RARRAY(ary)->aux.capa / 2;
-	if (capa_inc < ARY_DEFAULT_SIZE) {
-	    capa_inc = ARY_DEFAULT_SIZE;
+    long len = RARRAY_LEN(ary);
+    long new_len = len + argc;
+    long capa;
+    const VALUE *head, *sharedp;
+
+    if (len > ARY_MAX_SIZE - argc) {
+	rb_raise(rb_eIndexError, "index %ld too big", new_len);
+    }
+
+    if (ARY_SHARED_P(ary)) {
+	VALUE shared = ARY_SHARED(ary);
+	capa = RARRAY_LEN(shared);
+	if (ARY_SHARED_OCCUPIED(shared) && capa > new_len) {
+	    head = RARRAY_CONST_PTR(ary);
+	    sharedp = RARRAY_CONST_PTR(shared);
+	    goto makeroom_if_need;
 	}
-	RARRAY(ary)->aux.capa += capa_inc;
-	REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->aux.capa);
     }
 
-    /* sliding items */
-    MEMMOVE(RARRAY(ary)->ptr + 1, RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
+    rb_ary_modify(ary);
+    capa = ARY_CAPA(ary);
+    if (capa - (capa >> 6) <= new_len) {
+	ary_double_capa(ary, new_len);
+    }
 
-    RARRAY(ary)->len++;
-    RARRAY(ary)->ptr[0] = item;
+    /* use shared array for big "queues" */
+    if (new_len > ARY_DEFAULT_SIZE * 4) {
+	/* make a room for unshifted items */
+	capa = ARY_CAPA(ary);
+	ary_make_shared(ary);
 
-    return ary;
+	head = sharedp = RARRAY_CONST_PTR(ary);
+	goto makeroom;
+      makeroom_if_need:
+	if (head - sharedp < argc) {
+	    long room;
+	  makeroom:
+	    room = capa - new_len;
+	    room -= room >> 4;
+	    MEMMOVE((VALUE *)sharedp + argc + room, head, VALUE, len);
+	    head = sharedp + argc + room;
+	}
+	ARY_SET_PTR(ary, head - argc);
+	assert(ARY_SHARED_OCCUPIED(ARY_SHARED(ary)));
+	return ARY_SHARED(ary);
+    }
+    else {
+	/* sliding items */
+	RARRAY_PTR_USE(ary, ptr, {
+	    MEMMOVE(ptr + argc, ptr, VALUE, len);
+	});
+
+	return ary;
+    }
 }
 
 /*
  *  call-seq:
- *     array.unshift(obj, ...)  -> array
- *  
- *  Prepends objects to the front of <i>array</i>.
- *  other elements up one.
- *     
+ *     ary.unshift(obj, ...)  -> ary
+ *
+ *  Prepends objects to the front of +self+, moving other elements upwards.
+ *  See also Array#shift for the opposite effect.
+ *
  *     a = [ "b", "c", "d" ]
  *     a.unshift("a")   #=> ["a", "b", "c", "d"]
  *     a.unshift(1, 2)  #=> [ 1, 2, "a", "b", "c", "d"]
  */
 
 static VALUE
-rb_ary_unshift_m(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+rb_ary_unshift_m(int argc, VALUE *argv, VALUE ary)
 {
-    long len = RARRAY(ary)->len;
-
-    if (argc == 0) return ary;
+    long len = RARRAY_LEN(ary);
+    VALUE target_ary;
 
-    /* make rooms by setting the last item */
-    rb_ary_store(ary, len + argc - 1, Qnil);
+    if (argc == 0) {
+	rb_ary_modify_check(ary);
+	return ary;
+    }
 
-    /* sliding items */
-    MEMMOVE(RARRAY(ary)->ptr + argc, RARRAY(ary)->ptr, VALUE, len);
-    MEMCPY(RARRAY(ary)->ptr, argv, VALUE, argc);
-    
+    target_ary = ary_ensure_room_for_unshift(ary, argc);
+    ary_memcpy0(ary, 0, argc, argv, target_ary);
+    ARY_SET_LEN(ary, len + argc);
     return ary;
 }
 
+VALUE
+rb_ary_unshift(VALUE ary, VALUE item)
+{
+    return rb_ary_unshift_m(1,&item,ary);
+}
+
 /* faster version - use this if you don't need to treat negative offset */
 static inline VALUE
-rb_ary_elt(ary, offset)
-    VALUE ary;
-    long offset;
+rb_ary_elt(VALUE ary, long offset)
 {
-    if (RARRAY(ary)->len == 0) return Qnil;
-    if (offset < 0 || RARRAY(ary)->len <= offset) {
+    long len = RARRAY_LEN(ary);
+    if (len == 0) return Qnil;
+    if (offset < 0 || len <= offset) {
 	return Qnil;
     }
-    return RARRAY(ary)->ptr[offset];
+    return RARRAY_AREF(ary, offset);
 }
 
 VALUE
-rb_ary_entry(ary, offset)
-    VALUE ary;
-    long offset;
+rb_ary_entry(VALUE ary, long offset)
 {
     if (offset < 0) {
-	offset += RARRAY(ary)->len;
+	offset += RARRAY_LEN(ary);
     }
     return rb_ary_elt(ary, offset);
 }
 
-static VALUE
-rb_ary_subseq(ary, beg, len)
-    VALUE ary;
-    long beg, len;
+VALUE
+rb_ary_subseq(VALUE ary, long beg, long len)
 {
-    VALUE klass, ary2, shared;
-    VALUE *ptr;
+    VALUE klass;
+    long alen = RARRAY_LEN(ary);
 
-    if (beg > RARRAY(ary)->len) return Qnil;
+    if (beg > alen) return Qnil;
     if (beg < 0 || len < 0) return Qnil;
 
-    if (RARRAY(ary)->len < len || RARRAY(ary)->len < beg + len) {
-	len = RARRAY(ary)->len - beg;
-	if (len < 0)
-	    len = 0;
+    if (alen < len || alen < beg + len) {
+	len = alen - beg;
     }
     klass = rb_obj_class(ary);
     if (len == 0) return ary_new(klass, 0);
 
-    shared = ary_make_shared(ary);
-    ptr = RARRAY(ary)->ptr;
-    ary2 = ary_alloc(klass);
-    RARRAY(ary2)->ptr = ptr + beg;
-    RARRAY(ary2)->len = len;
-    RARRAY(ary2)->aux.shared = shared;
-    FL_SET(ary2, ELTS_SHARED);
-
-    return ary2;
+    return ary_make_partial(ary, klass, beg, len);
 }
 
-/* 
+/*
  *  call-seq:
- *     array[index]                -> obj      or nil
- *     array[start, length]        -> an_array or nil
- *     array[range]                -> an_array or nil
- *     array.slice(index)          -> obj      or nil
- *     array.slice(start, length)  -> an_array or nil
- *     array.slice(range)          -> an_array or nil
+ *     ary[index]                -> obj     or nil
+ *     ary[start, length]        -> new_ary or nil
+ *     ary[range]                -> new_ary or nil
+ *     ary.slice(index)          -> obj     or nil
+ *     ary.slice(start, length)  -> new_ary or nil
+ *     ary.slice(range)          -> new_ary or nil
  *
- *  Element Reference---Returns the element at _index_,
- *  or returns a subarray starting at _start_ and
- *  continuing for _length_ elements, or returns a subarray
- *  specified by _range_.
- *  Negative indices count backward from the end of the
- *  array (-1 is the last element). Returns nil if the index
- *  (or starting index) are out of range.
+ *  Element Reference --- Returns the element at +index+, or returns a
+ *  subarray starting at the +start+ index and continuing for +length+
+ *  elements, or returns a subarray specified by +range+ of indices.
+ *
+ *  Negative indices count backward from the end of the array (-1 is the last
+ *  element).  For +start+ and +range+ cases the starting index is just before
+ *  an element.  Additionally, an empty array is returned when the starting
+ *  index for an element range is at the end of the array.
+ *
+ *  Returns +nil+ if the index (or starting index) are out of range.
  *
  *     a = [ "a", "b", "c", "d", "e" ]
  *     a[2] +  a[0] + a[1]    #=> "cab"
@@ -652,44 +1249,36 @@ rb_ary_subseq(ary, beg, len)
  *     a[-3, 3]               #=> [ "c", "d", "e" ]
  *     # special cases
  *     a[5]                   #=> nil
+ *     a[6, 1]                #=> nil
  *     a[5, 1]                #=> []
  *     a[5..10]               #=> []
  *
  */
 
 VALUE
-rb_ary_aref(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+rb_ary_aref(int argc, const VALUE *argv, VALUE ary)
 {
     VALUE arg;
     long beg, len;
 
     if (argc == 2) {
-	if (SYMBOL_P(argv[0])) {
-	    rb_raise(rb_eTypeError, "Symbol as array index");
-	}
 	beg = NUM2LONG(argv[0]);
 	len = NUM2LONG(argv[1]);
 	if (beg < 0) {
-	    beg += RARRAY(ary)->len;
+	    beg += RARRAY_LEN(ary);
 	}
 	return rb_ary_subseq(ary, beg, len);
     }
     if (argc != 1) {
-	rb_scan_args(argc, argv, "11", 0, 0);
+	rb_scan_args(argc, argv, "11", NULL, NULL);
     }
     arg = argv[0];
     /* special case - speeding up */
     if (FIXNUM_P(arg)) {
 	return rb_ary_entry(ary, FIX2LONG(arg));
     }
-    if (SYMBOL_P(arg)) {
-	rb_raise(rb_eTypeError, "Symbol as array index");
-    }
     /* check if idx is Range */
-    switch (rb_range_beg_len(arg, &beg, &len, RARRAY(ary)->len, 0)) {
+    switch (rb_range_beg_len(arg, &beg, &len, RARRAY_LEN(ary), 0)) {
       case Qfalse:
 	break;
       case Qnil:
@@ -700,129 +1289,105 @@ rb_ary_aref(argc, argv, ary)
     return rb_ary_entry(ary, NUM2LONG(arg));
 }
 
-/* 
+/*
  *  call-seq:
- *     array.at(index)   ->   obj  or nil
+ *     ary.at(index)   ->   obj  or nil
  *
- *  Returns the element at _index_. A
- *  negative index counts from the end of _self_.  Returns +nil+
- *  if the index is out of range. See also <code>Array#[]</code>.
- *  (<code>Array#at</code> is slightly faster than <code>Array#[]</code>,
- *  as it does not accept ranges and so on.)
+ *  Returns the element at +index+. A negative index counts from the end of
+ *  +self+. Returns +nil+ if the index is out of range. See also
+ *  Array#[].
  *
  *     a = [ "a", "b", "c", "d", "e" ]
  *     a.at(0)     #=> "a"
  *     a.at(-1)    #=> "e"
  */
 
-static VALUE
-rb_ary_at(ary, pos)
-    VALUE ary, pos;
+VALUE
+rb_ary_at(VALUE ary, VALUE pos)
 {
     return rb_ary_entry(ary, NUM2LONG(pos));
 }
 
 /*
  *  call-seq:
- *     array.first   ->   obj or nil
- *     array.first(n) -> an_array
+ *     ary.first     ->   obj or nil
+ *     ary.first(n)  ->   new_ary
  *
  *  Returns the first element, or the first +n+ elements, of the array.
- *  If the array is empty, the first form returns <code>nil</code>, and the
- *  second form returns an empty array.
+ *  If the array is empty, the first form returns +nil+, and the
+ *  second form returns an empty array. See also Array#last for
+ *  the opposite effect.
  *
  *     a = [ "q", "r", "s", "t" ]
- *     a.first    #=> "q"
- *     a.first(1) #=> ["q"]
- *     a.first(3) #=> ["q", "r", "s"]
+ *     a.first     #=> "q"
+ *     a.first(2)  #=> ["q", "r"]
  */
 
 static VALUE
-rb_ary_first(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+rb_ary_first(int argc, VALUE *argv, VALUE ary)
 {
     if (argc == 0) {
-	if (RARRAY(ary)->len == 0) return Qnil;
-	return RARRAY(ary)->ptr[0];
+	if (RARRAY_LEN(ary) == 0) return Qnil;
+	return RARRAY_AREF(ary, 0);
     }
     else {
-	VALUE nv, result;
-	long n, i;
-
-	rb_scan_args(argc, argv, "01", &nv);
-	n = NUM2LONG(nv);
-	if (n > RARRAY(ary)->len) n = RARRAY(ary)->len;
-	result = rb_ary_new2(n);
-	for (i=0; i<n; i++) {
-	    rb_ary_push(result, RARRAY(ary)->ptr[i]);
-	}
-	return result;
+	return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
     }
 }
 
 /*
  *  call-seq:
- *     array.last     ->  obj or nil
- *     array.last(n)  ->  an_array
- *  
- *  Returns the last element(s) of <i>self</i>. If the array is empty,
- *  the first form returns <code>nil</code>.
- *     
- *     [ "w", "x", "y", "z" ].last   #=> "z"
+ *     ary.last     ->  obj or nil
+ *     ary.last(n)  ->  new_ary
+ *
+ *  Returns the last element(s) of +self+. If the array is empty,
+ *  the first form returns +nil+.
+ *
+ *  See also Array#first for the opposite effect.
+ *
+ *     a = [ "w", "x", "y", "z" ]
+ *     a.last     #=> "z"
+ *     a.last(2)  #=> ["y", "z"]
  */
 
-static VALUE
-rb_ary_last(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+VALUE
+rb_ary_last(int argc, const VALUE *argv, VALUE ary)
 {
     if (argc == 0) {
-	if (RARRAY(ary)->len == 0) return Qnil;
-	return RARRAY(ary)->ptr[RARRAY(ary)->len-1];
+	long len = RARRAY_LEN(ary);
+	if (len == 0) return Qnil;
+	return RARRAY_AREF(ary, len-1);
     }
     else {
-	VALUE nv, result;
-	long n, i;
-
-	rb_scan_args(argc, argv, "01", &nv);
-	n = NUM2LONG(nv);
-	if (n > RARRAY(ary)->len) n = RARRAY(ary)->len;
-	result = rb_ary_new2(n);
-	for (i=RARRAY(ary)->len-n; n--; i++) {
-	    rb_ary_push(result, RARRAY(ary)->ptr[i]);
-	}
-	return result;
+	return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
     }
 }
 
 /*
  *  call-seq:
- *     array.fetch(index)                    -> obj
- *     array.fetch(index, default )          -> obj
- *     array.fetch(index) {|index| block }   -> obj
- *  
- *  Tries to return the element at position <i>index</i>. If the index
- *  lies outside the array, the first form throws an
- *  <code>IndexError</code> exception, the second form returns
- *  <i>default</i>, and the third form returns the value of invoking
- *  the block, passing in the index. Negative values of <i>index</i>
- *  count from the end of the array.
- *     
+ *     ary.fetch(index)                    -> obj
+ *     ary.fetch(index, default)           -> obj
+ *     ary.fetch(index) { |index| block }  -> obj
+ *
+ *  Tries to return the element at position +index+, but throws an IndexError
+ *  exception if the referenced +index+ lies outside of the array bounds.  This
+ *  error can be prevented by supplying a second argument, which will act as a
+ *  +default+ value.
+ *
+ *  Alternatively, if a block is given it will only be executed when an
+ *  invalid +index+ is referenced.  Negative values of +index+ count from the
+ *  end of the array.
+ *
  *     a = [ 11, 22, 33, 44 ]
  *     a.fetch(1)               #=> 22
  *     a.fetch(-1)              #=> 44
  *     a.fetch(4, 'cat')        #=> "cat"
- *     a.fetch(4) { |i| i*i }   #=> 16
+ *     a.fetch(100) { |i| puts "#{i} is out of bounds" }
+ *                              #=> "100 is out of bounds"
  */
 
 static VALUE
-rb_ary_fetch(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+rb_ary_fetch(int argc, VALUE *argv, VALUE ary)
 {
     VALUE pos, ifnone;
     long block_given;
@@ -836,198 +1401,305 @@ rb_ary_fetch(argc, argv, ary)
     idx = NUM2LONG(pos);
 
     if (idx < 0) {
-	idx +=  RARRAY(ary)->len;
+	idx +=  RARRAY_LEN(ary);
     }
-    if (idx < 0 || RARRAY(ary)->len <= idx) {
+    if (idx < 0 || RARRAY_LEN(ary) <= idx) {
 	if (block_given) return rb_yield(pos);
 	if (argc == 1) {
-	    rb_raise(rb_eIndexError, "index %ld out of array", idx);
+	    rb_raise(rb_eIndexError, "index %ld outside of array bounds: %ld...%ld",
+			idx - (idx < 0 ? RARRAY_LEN(ary) : 0), -RARRAY_LEN(ary), RARRAY_LEN(ary));
 	}
 	return ifnone;
     }
-    return RARRAY(ary)->ptr[idx];
+    return RARRAY_AREF(ary, idx);
 }
 
 /*
  *  call-seq:
- *     array.index(obj)   ->  int or nil
- *  
- *  Returns the index of the first object in <i>self</i> such that is 
- *  <code>==</code> to <i>obj</i>. Returns <code>nil</code> if
- *  no match is found.
- *     
+ *     ary.find_index(obj)             ->  int or nil
+ *     ary.find_index { |item| block } ->  int or nil
+ *     ary.find_index                  ->  Enumerator
+ *     ary.index(obj)             ->  int or nil
+ *     ary.index { |item| block } ->  int or nil
+ *     ary.index                  ->  Enumerator
+ *
+ *  Returns the _index_ of the first object in +ary+ such that the object is
+ *  <code>==</code> to +obj+.
+ *
+ *  If a block is given instead of an argument, returns the _index_ of the
+ *  first object for which the block returns +true+.  Returns +nil+ if no
+ *  match is found.
+ *
+ *  See also Array#rindex.
+ *
+ *  An Enumerator is returned if neither a block nor argument is given.
+ *
  *     a = [ "a", "b", "c" ]
- *     a.index("b")   #=> 1
- *     a.index("z")   #=> nil
+ *     a.index("b")              #=> 1
+ *     a.index("z")              #=> nil
+ *     a.index { |x| x == "b" }  #=> 1
  */
 
 static VALUE
-rb_ary_index(ary, val)
-    VALUE ary;
-    VALUE val;
+rb_ary_index(int argc, VALUE *argv, VALUE ary)
 {
-    long i;
+    const VALUE *ptr;
+    VALUE val;
+    long i, len;
 
-    for (i=0; i<RARRAY(ary)->len; i++) {
-	if (rb_equal(RARRAY(ary)->ptr[i], val))
+    if (argc == 0) {
+	RETURN_ENUMERATOR(ary, 0, 0);
+	for (i=0; i<RARRAY_LEN(ary); i++) {
+	    if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
+		return LONG2NUM(i);
+	    }
+	}
+	return Qnil;
+    }
+    rb_check_arity(argc, 0, 1);
+    val = argv[0];
+    if (rb_block_given_p())
+	rb_warn("given block not used");
+    len = RARRAY_LEN(ary);
+    ptr = RARRAY_CONST_PTR(ary);
+    for (i=0; i<len; i++) {
+	VALUE e = ptr[i];
+	switch (rb_equal_opt(e, val)) {
+	  case Qundef:
+	    if (!rb_equal(e, val)) break;
+	  case Qtrue:
 	    return LONG2NUM(i);
+	  case Qfalse:
+	    continue;
+	}
+	len = RARRAY_LEN(ary);
+	ptr = RARRAY_CONST_PTR(ary);
     }
     return Qnil;
 }
 
 /*
  *  call-seq:
- *     array.rindex(obj)    ->  int or nil
- *  
- *  Returns the index of the last object in <i>array</i> 
- *  <code>==</code> to <i>obj</i>. Returns <code>nil</code> if
- *  no match is found.
- *     
+ *     ary.rindex(obj)             ->  int or nil
+ *     ary.rindex { |item| block } ->  int or nil
+ *     ary.rindex                  ->  Enumerator
+ *
+ *  Returns the _index_ of the last object in +self+ <code>==</code> to +obj+.
+ *
+ *  If a block is given instead of an argument, returns the _index_ of the
+ *  first object for which the block returns +true+, starting from the last
+ *  object.
+ *
+ *  Returns +nil+ if no match is found.
+ *
+ *  See also Array#index.
+ *
+ *  If neither block nor argument is given, an Enumerator is returned instead.
+ *
  *     a = [ "a", "b", "b", "b", "c" ]
- *     a.rindex("b")   #=> 3
- *     a.rindex("z")   #=> nil
+ *     a.rindex("b")             #=> 3
+ *     a.rindex("z")             #=> nil
+ *     a.rindex { |x| x == "b" } #=> 3
  */
 
 static VALUE
-rb_ary_rindex(ary, val)
-    VALUE ary;
-    VALUE val;
+rb_ary_rindex(int argc, VALUE *argv, VALUE ary)
 {
-    long i = RARRAY(ary)->len;
+    const VALUE *ptr;
+    VALUE val;
+    long i = RARRAY_LEN(ary), len;
 
+    if (argc == 0) {
+	RETURN_ENUMERATOR(ary, 0, 0);
+	while (i--) {
+	    if (RTEST(rb_yield(RARRAY_AREF(ary, i))))
+		return LONG2NUM(i);
+	    if (i > (len = RARRAY_LEN(ary))) {
+		i = len;
+	    }
+	}
+	return Qnil;
+    }
+    rb_check_arity(argc, 0, 1);
+    val = argv[0];
+    if (rb_block_given_p())
+	rb_warn("given block not used");
+    ptr = RARRAY_CONST_PTR(ary);
     while (i--) {
-	if (i > RARRAY(ary)->len) {
-	    i = RARRAY(ary)->len;
+	VALUE e = ptr[i];
+	switch (rb_equal_opt(e, val)) {
+	  case Qundef:
+	    if (!rb_equal(e, val)) break;
+	  case Qtrue:
+	    return LONG2NUM(i);
+	  case Qfalse:
 	    continue;
 	}
-	if (rb_equal(RARRAY(ary)->ptr[i], val))
-	    return LONG2NUM(i);
+	if (i > (len = RARRAY_LEN(ary))) {
+	    i = len;
+	}
+	ptr = RARRAY_CONST_PTR(ary);
     }
     return Qnil;
 }
 
-/*
- *  call-seq:
- *     array.indexes( i1, i2, ... iN )   -> an_array
- *     array.indices( i1, i2, ... iN )   -> an_array
- *  
- *  Deprecated; use <code>Array#values_at</code>.
- */
-
-static VALUE
-rb_ary_indexes(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
-{
-    VALUE new_ary;
-    long i;
-
-    rb_warn("Array#%s is deprecated; use Array#values_at", rb_id2name(rb_frame_last_func()));
-    new_ary = rb_ary_new2(argc);
-    for (i=0; i<argc; i++) {
-	rb_ary_push(new_ary, rb_ary_aref(1, argv+i, ary));
-    }
-
-    return new_ary;
-}
-
 VALUE
-rb_ary_to_ary(obj)
-    VALUE obj;
+rb_ary_to_ary(VALUE obj)
 {
-    if (TYPE(obj) == T_ARRAY) {
-	return obj;
-    }
-    if (rb_respond_to(obj, rb_intern("to_ary"))) {
-	return rb_convert_type(obj, T_ARRAY, "Array", "to_ary");
-    }
+    VALUE tmp = rb_check_array_type(obj);
+
+    if (!NIL_P(tmp)) return tmp;
     return rb_ary_new3(1, obj);
 }
 
 static void
-rb_ary_splice(ary, beg, len, rpl)
-    VALUE ary;
-    long beg, len;
-    VALUE rpl;
+rb_ary_splice(VALUE ary, long beg, long len, VALUE rpl)
 {
     long rlen;
+    long olen;
 
     if (len < 0) rb_raise(rb_eIndexError, "negative length (%ld)", len);
+    olen = RARRAY_LEN(ary);
     if (beg < 0) {
-	beg += RARRAY(ary)->len;
+	beg += olen;
 	if (beg < 0) {
-	    beg -= RARRAY(ary)->len;
-	    rb_raise(rb_eIndexError, "index %ld out of array", beg);
+	    rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
+		     beg - olen, -olen);
 	}
     }
-    if (RARRAY(ary)->len < len || RARRAY(ary)->len < beg + len) {
-	len = RARRAY(ary)->len - beg;
+    if (olen < len || olen < beg + len) {
+	len = olen - beg;
     }
 
-    if (NIL_P(rpl)) {
+    if (rpl == Qundef) {
 	rlen = 0;
     }
     else {
 	rpl = rb_ary_to_ary(rpl);
-	rlen = RARRAY(rpl)->len;
+	rlen = RARRAY_LEN(rpl);
+	olen = RARRAY_LEN(ary);	/* ary may be resized in rpl.to_ary too */
     }
-    rb_ary_modify(ary);
-
-    if (beg >= RARRAY(ary)->len) {
-	len = beg + rlen;
-	if (len >= RARRAY(ary)->aux.capa) {
-	    REALLOC_N(RARRAY(ary)->ptr, VALUE, len);
-	    RARRAY(ary)->aux.capa = len;
+    if (beg >= olen) {
+	VALUE target_ary;
+	if (beg > ARY_MAX_SIZE - rlen) {
+	    rb_raise(rb_eIndexError, "index %ld too big", beg);
 	}
-	rb_mem_clear(RARRAY(ary)->ptr + RARRAY(ary)->len, beg - RARRAY(ary)->len);
+	target_ary = ary_ensure_room_for_push(ary, rlen-len); /* len is 0 or negative */
+	len = beg + rlen;
+	ary_mem_clear(ary, olen, beg - olen);
 	if (rlen > 0) {
-	    MEMCPY(RARRAY(ary)->ptr + beg, RARRAY(rpl)->ptr, VALUE, rlen);
+	    ary_memcpy0(ary, beg, rlen, RARRAY_CONST_PTR(rpl), target_ary);
 	}
-	RARRAY(ary)->len = len;
+	ARY_SET_LEN(ary, len);
     }
     else {
 	long alen;
 
-	if (beg + len > RARRAY(ary)->len) {
-	    len = RARRAY(ary)->len - beg;
+	if (olen - len > ARY_MAX_SIZE - rlen) {
+	    rb_raise(rb_eIndexError, "index %ld too big", olen + rlen - len);
 	}
-
-	alen = RARRAY(ary)->len + rlen - len;
-	if (alen >= RARRAY(ary)->aux.capa) {
-	    REALLOC_N(RARRAY(ary)->ptr, VALUE, alen);
-	    RARRAY(ary)->aux.capa = alen;
+	rb_ary_modify(ary);
+	alen = olen + rlen - len;
+	if (alen >= ARY_CAPA(ary)) {
+	    ary_double_capa(ary, alen);
 	}
 
 	if (len != rlen) {
-	    MEMMOVE(RARRAY(ary)->ptr + beg + rlen, RARRAY(ary)->ptr + beg + len,
-		    VALUE, RARRAY(ary)->len - (beg + len));
-	    RARRAY(ary)->len = alen;
+	    RARRAY_PTR_USE(ary, ptr,
+			   MEMMOVE(ptr + beg + rlen, ptr + beg + len,
+				   VALUE, olen - (beg + len)));
+	    ARY_SET_LEN(ary, alen);
 	}
 	if (rlen > 0) {
-	    MEMMOVE(RARRAY(ary)->ptr + beg, RARRAY(rpl)->ptr, VALUE, rlen);
+	    MEMMOVE(RARRAY_PTR(ary) + beg, RARRAY_CONST_PTR(rpl), VALUE, rlen);
+	}
+    }
+    RB_GC_GUARD(rpl);
+}
+
+void
+rb_ary_set_len(VALUE ary, long len)
+{
+    long capa;
+
+    rb_ary_modify_check(ary);
+    if (ARY_SHARED_P(ary)) {
+	rb_raise(rb_eRuntimeError, "can't set length of shared ");
+    }
+    if (len > (capa = (long)ARY_CAPA(ary))) {
+	rb_bug("probable buffer overflow: %ld for %ld", len, capa);
+    }
+    ARY_SET_LEN(ary, len);
+}
+
+/*!
+ * expands or shrinks \a ary to \a len elements.
+ * expanded region will be filled with Qnil.
+ * \param ary  an array
+ * \param len  new size
+ * \return     \a ary
+ * \post       the size of \a ary is \a len.
+ */
+VALUE
+rb_ary_resize(VALUE ary, long len)
+{
+    long olen;
+
+    rb_ary_modify(ary);
+    olen = RARRAY_LEN(ary);
+    if (len == olen) return ary;
+    if (len > ARY_MAX_SIZE) {
+	rb_raise(rb_eIndexError, "index %ld too big", len);
+    }
+    if (len > olen) {
+	if (len >= ARY_CAPA(ary)) {
+	    ary_double_capa(ary, len);
 	}
+	ary_mem_clear(ary, olen, len - olen);
+	ARY_SET_LEN(ary, len);
+    }
+    else if (ARY_EMBED_P(ary)) {
+        ARY_SET_EMBED_LEN(ary, len);
     }
+    else if (len <= RARRAY_EMBED_LEN_MAX) {
+	VALUE tmp[RARRAY_EMBED_LEN_MAX];
+	MEMCPY(tmp, ARY_HEAP_PTR(ary), VALUE, len);
+	ary_discard(ary);
+	MEMCPY((VALUE *)ARY_EMBED_PTR(ary), tmp, VALUE, len); /* WB: no new reference */
+        ARY_SET_EMBED_LEN(ary, len);
+    }
+    else {
+	if (olen > len + ARY_DEFAULT_SIZE) {
+	    SIZED_REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, len, RARRAY(ary)->as.heap.aux.capa);
+	    ARY_SET_CAPA(ary, len);
+	}
+	ARY_SET_HEAP_LEN(ary, len);
+    }
+    return ary;
 }
 
-/* 
+/*
  *  call-seq:
- *     array[index]         = obj                     ->  obj
- *     array[start, length] = obj or an_array or nil  ->  obj or an_array or nil
- *     array[range]         = obj or an_array or nil  ->  obj or an_array or nil
+ *     ary[index]         = obj                      ->  obj
+ *     ary[start, length] = obj or other_ary or nil  ->  obj or other_ary or nil
+ *     ary[range]         = obj or other_ary or nil  ->  obj or other_ary or nil
+ *
+ *  Element Assignment --- Sets the element at +index+, or replaces a subarray
+ *  from the +start+ index for +length+ elements, or replaces a subarray
+ *  specified by the +range+ of indices.
+ *
+ *  If indices are greater than the current capacity of the array, the array
+ *  grows automatically.  Elements are inserted into the array at +start+ if
+ *  +length+ is zero.
+ *
+ *  Negative indices will count backward from the end of the array.  For
+ *  +start+ and +range+ cases the starting index is just before an element.
+ *
+ *  An IndexError is raised if a negative index points past the beginning of
+ *  the array.
+ *
+ *  See also Array#push, and Array#unshift.
  *
- *  Element Assignment---Sets the element at _index_,
- *  or replaces a subarray starting at _start_ and
- *  continuing for _length_ elements, or replaces a subarray
- *  specified by _range_.  If indices are greater than
- *  the current capacity of the array, the array grows
- *  automatically. A negative indices will count backward
- *  from the end of the array. Inserts elements if _length_ is
- *  zero. If +nil+ is used in the second and third form,
- *  deletes elements from _self_. An +IndexError+ is raised if a
- *  negative index points past the beginning of the array. See also
- *  <code>Array#push</code>, and <code>Array#unshift</code>.
- * 
  *     a = Array.new
  *     a[4] = "4";                 #=> [nil, nil, nil, nil, "4"]
  *     a[0, 3] = [ 'a', 'b', 'c' ] #=> ["a", "b", "c", nil, "4"]
@@ -1035,38 +1707,31 @@ rb_ary_splice(ary, beg, len, rpl)
  *     a[0, 2] = "?"               #=> ["?", 2, nil, "4"]
  *     a[0..2] = "A"               #=> ["A", "4"]
  *     a[-1]   = "Z"               #=> ["A", "Z"]
- *     a[1..-1] = nil              #=> ["A"]
+ *     a[1..-1] = nil              #=> ["A", nil]
+ *     a[1..-1] = []               #=> ["A"]
+ *     a[0, 0] = [ 1, 2 ]          #=> [1, 2, "A"]
+ *     a[3, 0] = "B"               #=> [1, 2, "A", "B"]
  */
 
 static VALUE
-rb_ary_aset(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+rb_ary_aset(int argc, VALUE *argv, VALUE ary)
 {
     long offset, beg, len;
 
     if (argc == 3) {
-	if (SYMBOL_P(argv[0])) {
-	    rb_raise(rb_eTypeError, "Symbol as array index");
-	}
-	if (SYMBOL_P(argv[1])) {
-	    rb_raise(rb_eTypeError, "Symbol as subarray length");
-	}
-	rb_ary_splice(ary, NUM2LONG(argv[0]), NUM2LONG(argv[1]), argv[2]);
+	rb_ary_modify_check(ary);
+	beg = NUM2LONG(argv[0]);
+	len = NUM2LONG(argv[1]);
+	rb_ary_splice(ary, beg, len, argv[2]);
 	return argv[2];
     }
-    if (argc != 2) {
-	rb_raise(rb_eArgError, "wrong number of arguments (%d for 2)", argc);
-    }
+    rb_check_arity(argc, 2, 2);
+    rb_ary_modify_check(ary);
     if (FIXNUM_P(argv[0])) {
 	offset = FIX2LONG(argv[0]);
 	goto fixnum;
     }
-    if (SYMBOL_P(argv[0])) {
-	rb_raise(rb_eTypeError, "Symbol as array index");
-    }
-    if (rb_range_beg_len(argv[0], &beg, &len, RARRAY(ary)->len, 1)) {
+    if (rb_range_beg_len(argv[0], &beg, &len, RARRAY_LEN(ary), 1)) {
 	/* check if idx is Range */
 	rb_ary_splice(ary, beg, len, argv[1]);
 	return argv[1];
@@ -1080,31 +1745,31 @@ fixnum:
 
 /*
  *  call-seq:
- *     array.insert(index, obj...)  -> array
- *  
- *  Inserts the given values before the element with the given index
- *  (which may be negative).
- *     
+ *     ary.insert(index, obj...)  -> ary
+ *
+ *  Inserts the given values before the element with the given +index+.
+ *
+ *  Negative indices count backwards from the end of the array, where +-1+ is
+ *  the last element. If a negative index is used, the given values will be
+ *  inserted after that element, so using an index of +-1+ will insert the
+ *  values at the end of the array.
+ *
  *     a = %w{ a b c d }
  *     a.insert(2, 99)         #=> ["a", "b", 99, "c", "d"]
  *     a.insert(-2, 1, 2, 3)   #=> ["a", "b", 99, "c", 1, 2, 3, "d"]
  */
 
 static VALUE
-rb_ary_insert(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+rb_ary_insert(int argc, VALUE *argv, VALUE ary)
 {
     long pos;
 
-    if (argc == 1) return ary;
-    if (argc < 1) {
-	rb_raise(rb_eArgError, "wrong number of arguments (at least 1)");
-    }
+    rb_check_arity(argc, 1, UNLIMITED_ARGUMENTS);
+    rb_ary_modify_check(ary);
     pos = NUM2LONG(argv[0]);
+    if (argc == 1) return ary;
     if (pos == -1) {
-	pos = RARRAY(ary)->len;
+	pos = RARRAY_LEN(ary);
     }
     if (pos < 0) {
 	pos++;
@@ -1113,55 +1778,70 @@ rb_ary_insert(argc, argv, ary)
     return ary;
 }
 
+static VALUE
+rb_ary_length(VALUE ary);
+
+static VALUE
+ary_enum_length(VALUE ary, VALUE args, VALUE eobj)
+{
+    return rb_ary_length(ary);
+}
+
 /*
  *  call-seq:
- *     array.each {|item| block }   ->   array
- *  
- *  Calls <i>block</i> once for each element in <i>self</i>, passing that
- *  element as a parameter.
- *     
+ *     ary.each { |item| block }  -> ary
+ *     ary.each                   -> Enumerator
+ *
+ *  Calls the given block once for each element in +self+, passing that element
+ *  as a parameter.  Returns the array itself.
+ *
+ *  If no block is given, an Enumerator is returned.
+ *
  *     a = [ "a", "b", "c" ]
  *     a.each {|x| print x, " -- " }
- *     
+ *
  *  produces:
- *     
+ *
  *     a -- b -- c --
  */
 
 VALUE
-rb_ary_each(ary)
-    VALUE ary;
+rb_ary_each(VALUE ary)
 {
     long i;
 
-    for (i=0; i<RARRAY(ary)->len; i++) {
-	rb_yield(RARRAY(ary)->ptr[i]);
+    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+	rb_yield(RARRAY_AREF(ary, i));
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *     array.each_index {|index| block }  ->  array
- *  
- *  Same as <code>Array#each</code>, but passes the index of the element
- *  instead of the element itself.
- *     
+ *     ary.each_index { |index| block }  -> ary
+ *     ary.each_index                    -> Enumerator
+ *
+ *  Same as Array#each, but passes the +index+ of the element instead of the
+ *  element itself.
+ *
+ *  An Enumerator is returned if no block is given.
+ *
  *     a = [ "a", "b", "c" ]
  *     a.each_index {|x| print x, " -- " }
- *     
+ *
  *  produces:
- *     
+ *
  *     0 -- 1 -- 2 --
  */
 
 static VALUE
-rb_ary_each_index(ary)
-    VALUE ary;
+rb_ary_each_index(VALUE ary)
 {
     long i;
+    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
 
-    for (i=0; i<RARRAY(ary)->len; i++) {
+    for (i=0; i<RARRAY_LEN(ary); i++) {
 	rb_yield(LONG2NUM(i));
     }
     return ary;
@@ -1169,29 +1849,32 @@ rb_ary_each_index(ary)
 
 /*
  *  call-seq:
- *     array.reverse_each {|item| block } 
- *  
- *  Same as <code>Array#each</code>, but traverses <i>self</i> in reverse
- *  order.
- *     
+ *     ary.reverse_each { |item| block }  -> ary
+ *     ary.reverse_each                   -> Enumerator
+ *
+ *  Same as Array#each, but traverses +self+ in reverse order.
+ *
  *     a = [ "a", "b", "c" ]
  *     a.reverse_each {|x| print x, " " }
- *     
+ *
  *  produces:
- *     
+ *
  *     c b a
  */
 
 static VALUE
-rb_ary_reverse_each(ary)
-    VALUE ary;
+rb_ary_reverse_each(VALUE ary)
 {
-    long len = RARRAY(ary)->len;
+    long len;
 
+    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+    len = RARRAY_LEN(ary);
     while (len--) {
-	rb_yield(RARRAY(ary)->ptr[len]);
-	if (RARRAY(ary)->len < len) {
-	    len = RARRAY(ary)->len;
+	long nlen;
+	rb_yield(RARRAY_AREF(ary, len));
+	nlen = RARRAY_LEN(ary);
+	if (nlen < len) {
+	    len = nlen;
 	}
     }
     return ary;
@@ -1199,555 +1882,896 @@ rb_ary_reverse_each(ary)
 
 /*
  *  call-seq:
- *     array.length -> int
- *  
- *  Returns the number of elements in <i>self</i>. May be zero.
- *     
+ *     ary.length -> int
+ *
+ *  Returns the number of elements in +self+. May be zero.
+ *
  *     [ 1, 2, 3, 4, 5 ].length   #=> 5
+ *     [].length                  #=> 0
  */
 
 static VALUE
-rb_ary_length(ary)
-    VALUE ary;
+rb_ary_length(VALUE ary)
 {
-    return LONG2NUM(RARRAY(ary)->len);
+    long len = RARRAY_LEN(ary);
+    return LONG2NUM(len);
 }
 
 /*
  *  call-seq:
- *     array.empty?   -> true or false
- *  
- *  Returns <code>true</code> if <i>self</i> array contains no elements.
- *     
+ *     ary.empty?   -> true or false
+ *
+ *  Returns +true+ if +self+ contains no elements.
+ *
  *     [].empty?   #=> true
  */
 
 static VALUE
-rb_ary_empty_p(ary)
-    VALUE ary;
+rb_ary_empty_p(VALUE ary)
 {
-    if (RARRAY(ary)->len == 0)
+    if (RARRAY_LEN(ary) == 0)
 	return Qtrue;
     return Qfalse;
 }
 
 VALUE
-rb_ary_dup(ary)
-    VALUE ary;
+rb_ary_dup(VALUE ary)
 {
-    VALUE dup = rb_ary_new2(RARRAY(ary)->len);
-
-    DUPSETUP(dup, ary);
-    MEMCPY(RARRAY(dup)->ptr, RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
-    RARRAY(dup)->len = RARRAY(ary)->len;
+    long len = RARRAY_LEN(ary);
+    VALUE dup = rb_ary_new2(len);
+    ary_memcpy(dup, 0, len, RARRAY_CONST_PTR(ary));
+    ARY_SET_LEN(dup, len);
     return dup;
 }
 
+VALUE
+rb_ary_resurrect(VALUE ary)
+{
+    return rb_ary_new4(RARRAY_LEN(ary), RARRAY_CONST_PTR(ary));
+}
+
 extern VALUE rb_output_fs;
 
+static void ary_join_1(VALUE obj, VALUE ary, VALUE sep, long i, VALUE result, int *first);
+
 static VALUE
-inspect_join(ary, arg)
-    VALUE ary;
-    VALUE *arg;
+recursive_join(VALUE obj, VALUE argp, int recur)
 {
-    return rb_ary_join(arg[0], arg[1]);
+    VALUE *arg = (VALUE *)argp;
+    VALUE ary = arg[0];
+    VALUE sep = arg[1];
+    VALUE result = arg[2];
+    int *first = (int *)arg[3];
+
+    if (recur) {
+	rb_raise(rb_eArgError, "recursive array join");
+    }
+    else {
+	ary_join_1(obj, ary, sep, 0, result, first);
+    }
+    return Qnil;
 }
 
-VALUE
-rb_ary_join(ary, sep)
-    VALUE ary, sep;
+static void
+ary_join_0(VALUE ary, VALUE sep, long max, VALUE result)
 {
-    long len = 1, i;
-    int taint = Qfalse;
-    VALUE result, tmp;
-
-    if (RARRAY(ary)->len == 0) return rb_str_new(0, 0);
-    if (OBJ_TAINTED(ary) || OBJ_TAINTED(sep)) taint = Qtrue;
+    long i;
+    VALUE val;
 
-    for (i=0; i<RARRAY(ary)->len; i++) {
-	tmp = rb_check_string_type(RARRAY(ary)->ptr[i]);
-	len += NIL_P(tmp) ? 10 : RSTRING(tmp)->len;
-    }
-    if (!NIL_P(sep)) {
-	StringValue(sep);
-	len += RSTRING(sep)->len * (RARRAY(ary)->len - 1);
+    if (max > 0) rb_enc_copy(result, RARRAY_AREF(ary, 0));
+    for (i=0; i<max; i++) {
+	val = RARRAY_AREF(ary, i);
+	if (i > 0 && !NIL_P(sep))
+	    rb_str_buf_append(result, sep);
+	rb_str_buf_append(result, val);
+	if (OBJ_TAINTED(val)) OBJ_TAINT(result);
     }
-    result = rb_str_buf_new(len);
-    for (i=0; i<RARRAY(ary)->len; i++) {
-	tmp = RARRAY(ary)->ptr[i];
-	switch (TYPE(tmp)) {
-	  case T_STRING:
-	    break;
-	  case T_ARRAY:
-	    if (rb_inspecting_p(tmp)) {
-		tmp = rb_str_new2("[...]");
+}
+
+static void
+ary_join_1(VALUE obj, VALUE ary, VALUE sep, long i, VALUE result, int *first)
+{
+    VALUE val, tmp;
+
+    for (; i<RARRAY_LEN(ary); i++) {
+	if (i > 0 && !NIL_P(sep))
+	    rb_str_buf_append(result, sep);
+
+	val = RARRAY_AREF(ary, i);
+	if (RB_TYPE_P(val, T_STRING)) {
+	  str_join:
+	    rb_str_buf_append(result, val);
+	    *first = FALSE;
+	}
+	else if (RB_TYPE_P(val, T_ARRAY)) {
+	    obj = val;
+	  ary_join:
+	    if (val == ary) {
+		rb_raise(rb_eArgError, "recursive array join");
 	    }
 	    else {
-		VALUE args[2];
+		VALUE args[4];
 
-		args[0] = tmp;
+		args[0] = val;
 		args[1] = sep;
-		tmp = rb_protect_inspect(inspect_join, ary, (VALUE)args);
+		args[2] = result;
+		args[3] = (VALUE)first;
+		rb_exec_recursive(recursive_join, obj, (VALUE)args);
 	    }
-	    break;
-	  default:
-	    tmp = rb_obj_as_string(tmp);
 	}
-	if (i > 0 && !NIL_P(sep))
-	    rb_str_buf_append(result, sep);
-	rb_str_buf_append(result, tmp);
-	if (OBJ_TAINTED(tmp)) taint = Qtrue;
+	else {
+	    tmp = rb_check_string_type(val);
+	    if (!NIL_P(tmp)) {
+		val = tmp;
+		goto str_join;
+	    }
+	    tmp = rb_check_convert_type(val, T_ARRAY, "Array", "to_ary");
+	    if (!NIL_P(tmp)) {
+		obj = val;
+		val = tmp;
+		goto ary_join;
+	    }
+	    val = rb_obj_as_string(val);
+	    if (*first) {
+		rb_enc_copy(result, val);
+		*first = FALSE;
+	    }
+	    goto str_join;
+	}
     }
+}
 
+VALUE
+rb_ary_join(VALUE ary, VALUE sep)
+{
+    long len = 1, i;
+    int taint = FALSE;
+    VALUE val, tmp, result;
+
+    if (RARRAY_LEN(ary) == 0) return rb_usascii_str_new(0, 0);
+    if (OBJ_TAINTED(ary)) taint = TRUE;
+
+    if (!NIL_P(sep)) {
+	StringValue(sep);
+	len += RSTRING_LEN(sep) * (RARRAY_LEN(ary) - 1);
+    }
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+	val = RARRAY_AREF(ary, i);
+	tmp = rb_check_string_type(val);
+
+	if (NIL_P(tmp) || tmp != val) {
+	    int first;
+	    result = rb_str_buf_new(len + (RARRAY_LEN(ary)-i)*10);
+	    rb_enc_associate(result, rb_usascii_encoding());
+	    if (taint) OBJ_TAINT(result);
+	    ary_join_0(ary, sep, i, result);
+	    first = i == 0;
+	    ary_join_1(ary, ary, sep, i, result, &first);
+	    return result;
+	}
+
+	len += RSTRING_LEN(tmp);
+    }
+
+    result = rb_str_buf_new(len);
     if (taint) OBJ_TAINT(result);
+    ary_join_0(ary, sep, RARRAY_LEN(ary), result);
+
     return result;
 }
 
 /*
  *  call-seq:
- *     array.join(sep=$,)    -> str
- *  
+ *     ary.join(separator=$,)    -> str
+ *
  *  Returns a string created by converting each element of the array to
- *  a string, separated by <i>sep</i>.
- *     
+ *  a string, separated by the given +separator+.
+ *  If the +separator+ is +nil+, it uses current $,.
+ *  If both the +separator+ and $, are nil, it uses empty string.
+ *
  *     [ "a", "b", "c" ].join        #=> "abc"
  *     [ "a", "b", "c" ].join("-")   #=> "a-b-c"
  */
 
 static VALUE
-rb_ary_join_m(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+rb_ary_join_m(int argc, VALUE *argv, VALUE ary)
 {
     VALUE sep;
 
     rb_scan_args(argc, argv, "01", &sep);
     if (NIL_P(sep)) sep = rb_output_fs;
-    
+
     return rb_ary_join(ary, sep);
 }
 
+static VALUE
+inspect_ary(VALUE ary, VALUE dummy, int recur)
+{
+    int tainted = OBJ_TAINTED(ary);
+    long i;
+    VALUE s, str;
+
+    if (recur) return rb_usascii_str_new_cstr("[...]");
+    str = rb_str_buf_new2("[");
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+	s = rb_inspect(RARRAY_AREF(ary, i));
+	if (OBJ_TAINTED(s)) tainted = TRUE;
+	if (i > 0) rb_str_buf_cat2(str, ", ");
+	else rb_enc_copy(str, s);
+	rb_str_buf_append(str, s);
+    }
+    rb_str_buf_cat2(str, "]");
+    if (tainted) OBJ_TAINT(str);
+    return str;
+}
+
 /*
  *  call-seq:
- *     array.to_s -> string
- *  
- *  Returns _self_<code>.join</code>.
- *     
- *     [ "a", "e", "i", "o" ].to_s   #=> "aeio"
+ *     ary.inspect  -> string
+ *     ary.to_s     -> string
  *
+ *  Creates a string representation of +self+.
+ *
+ *     [ "a", "b", "c" ].to_s     #=> "[\"a\", \"b\", \"c\"]"
  */
 
-VALUE
-rb_ary_to_s(ary)
-    VALUE ary;
+static VALUE
+rb_ary_inspect(VALUE ary)
 {
-    if (RARRAY(ary)->len == 0) return rb_str_new(0, 0);
-    
-    return rb_ary_join(ary, rb_output_fs);
+    if (RARRAY_LEN(ary) == 0) return rb_usascii_str_new2("[]");
+    return rb_exec_recursive(inspect_ary, ary, 0);
 }
 
-static ID inspect_key;
+VALUE
+rb_ary_to_s(VALUE ary)
+{
+    return rb_ary_inspect(ary);
+}
 
-struct inspect_arg {
-    VALUE (*func)();
-    VALUE arg1, arg2;
-};
+/*
+ *  call-seq:
+ *     ary.to_a     -> ary
+ *
+ *  Returns +self+.
+ *
+ *  If called on a subclass of Array, converts the receiver to an Array object.
+ */
 
 static VALUE
-inspect_call(arg)
-    struct inspect_arg *arg;
+rb_ary_to_a(VALUE ary)
 {
-    return (*arg->func)(arg->arg1, arg->arg2);
+    if (rb_obj_class(ary) != rb_cArray) {
+	VALUE dup = rb_ary_new2(RARRAY_LEN(ary));
+	rb_ary_replace(dup, ary);
+	return dup;
+    }
+    return ary;
 }
 
+/*
+ *  call-seq:
+ *     ary.to_h     -> hash
+ *
+ *  Returns the result of interpreting <i>ary</i> as an array of
+ *  <tt>[key, value]</tt> pairs.
+ *
+ *     [[:foo, :bar], [1, 2]].to_h
+ *       # => {:foo => :bar, 1 => 2}
+ */
+
 static VALUE
-get_inspect_tbl(create)
-    int create;
+rb_ary_to_h(VALUE ary)
 {
-    VALUE inspect_tbl = rb_thread_local_aref(rb_thread_current(), inspect_key);
-
-    if (NIL_P(inspect_tbl)) {
-	if (create) {
-	  tbl_init:
-	    inspect_tbl = rb_ary_new();
-	    rb_thread_local_aset(rb_thread_current(), inspect_key, inspect_tbl);
+    long i;
+    VALUE hash = rb_hash_new();
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+	const VALUE elt = rb_ary_elt(ary, i);
+	const VALUE key_value_pair = rb_check_array_type(elt);
+	if (NIL_P(key_value_pair)) {
+	    rb_raise(rb_eTypeError, "wrong element type %"PRIsVALUE" at %ld (expected array)",
+		     rb_obj_class(elt), i);
 	}
+	if (RARRAY_LEN(key_value_pair) != 2) {
+	    rb_raise(rb_eArgError, "wrong array length at %ld (expected 2, was %ld)",
+		i, RARRAY_LEN(key_value_pair));
+	}
+	rb_hash_aset(hash, RARRAY_AREF(key_value_pair, 0), RARRAY_AREF(key_value_pair, 1));
     }
-    else if (TYPE(inspect_tbl) != T_ARRAY) {
-	rb_warn("invalid inspect_tbl value");
-	if (create) goto tbl_init;
-	rb_thread_local_aset(rb_thread_current(), inspect_key, Qnil);
-	return Qnil;
-    }
-    return inspect_tbl;
+    return hash;
 }
 
+/*
+ *  call-seq:
+ *     ary.to_ary -> ary
+ *
+ *  Returns +self+.
+ */
+
 static VALUE
-inspect_ensure(obj)
-    VALUE obj;
+rb_ary_to_ary_m(VALUE ary)
 {
-    VALUE inspect_tbl;
-
-    inspect_tbl = get_inspect_tbl(Qfalse);
-    if (!NIL_P(inspect_tbl)) {
-	rb_ary_pop(inspect_tbl);
-    }
-    return 0;
+    return ary;
 }
 
-VALUE
-rb_protect_inspect(func, obj, arg)
-    VALUE (*func)(ANYARGS);
-    VALUE obj, arg;
+static void
+ary_reverse(VALUE *p1, VALUE *p2)
 {
-    struct inspect_arg iarg;
-    VALUE inspect_tbl;
-    VALUE id;
-
-    inspect_tbl = get_inspect_tbl(Qtrue);
-    id = rb_obj_id(obj);
-    if (rb_ary_includes(inspect_tbl, id)) {
-	return (*func)(obj, arg);
+    while (p1 < p2) {
+	VALUE tmp = *p1;
+	*p1++ = *p2;
+	*p2-- = tmp;
     }
-    rb_ary_push(inspect_tbl, id);
-    iarg.func = func;
-    iarg.arg1 = obj;
-    iarg.arg2 = arg;
-
-    return rb_ensure(inspect_call, (VALUE)&iarg, inspect_ensure, obj);
 }
 
 VALUE
-rb_inspecting_p(obj)
-    VALUE obj;
-{
-    VALUE inspect_tbl;
-
-    inspect_tbl = get_inspect_tbl(Qfalse);
-    if (NIL_P(inspect_tbl)) return Qfalse;
-    return rb_ary_includes(inspect_tbl, rb_obj_id(obj));
-}
-
-static VALUE
-inspect_ary(ary)
-    VALUE ary;
+rb_ary_reverse(VALUE ary)
 {
-    int tainted = OBJ_TAINTED(ary);
-    long i;
-    VALUE s, str;
+    VALUE *p2;
+    long len = RARRAY_LEN(ary);
 
-    str = rb_str_buf_new2("[");
-    for (i=0; i<RARRAY(ary)->len; i++) {
-	s = rb_inspect(RARRAY(ary)->ptr[i]);
-	if (OBJ_TAINTED(s)) tainted = Qtrue;
-	if (i > 0) rb_str_buf_cat2(str, ", ");
-	rb_str_buf_append(str, s);
+    rb_ary_modify(ary);
+    if (len > 1) {
+	RARRAY_PTR_USE(ary, p1, {
+	    p2 = p1 + len - 1;	/* points last item */
+	    ary_reverse(p1, p2);
+	}); /* WB: no new reference */
     }
-    rb_str_buf_cat2(str, "]");
-    if (tainted) OBJ_TAINT(str);
-    return str;
+    return ary;
 }
 
 /*
  *  call-seq:
- *     array.inspect  -> string
+ *     ary.reverse!   -> ary
  *
- *  Create a printable version of <i>array</i>.
+ *  Reverses +self+ in place.
+ *
+ *     a = [ "a", "b", "c" ]
+ *     a.reverse!       #=> ["c", "b", "a"]
+ *     a                #=> ["c", "b", "a"]
  */
 
 static VALUE
-rb_ary_inspect(ary)
-    VALUE ary;
+rb_ary_reverse_bang(VALUE ary)
 {
-    if (RARRAY(ary)->len == 0) return rb_str_new2("[]");
-    if (rb_inspecting_p(ary)) return rb_str_new2("[...]");
-    return rb_protect_inspect(inspect_ary, ary, 0);
+    return rb_ary_reverse(ary);
 }
 
 /*
  *  call-seq:
- *     array.to_a     -> array
- *  
- *  Returns _self_. If called on a subclass of Array, converts
- *  the receiver to an Array object.
+ *     ary.reverse    -> new_ary
+ *
+ *  Returns a new array containing +self+'s elements in reverse order.
+ *
+ *     [ "a", "b", "c" ].reverse   #=> ["c", "b", "a"]
+ *     [ 1 ].reverse               #=> [1]
  */
 
 static VALUE
-rb_ary_to_a(ary)
-    VALUE ary;
+rb_ary_reverse_m(VALUE ary)
 {
-    if (rb_obj_class(ary) != rb_cArray) {
-	VALUE dup = rb_ary_new2(RARRAY(ary)->len);
-	rb_ary_replace(dup, ary);
-	return dup;
+    long len = RARRAY_LEN(ary);
+    VALUE dup = rb_ary_new2(len);
+
+    if (len > 0) {
+	const VALUE *p1 = RARRAY_CONST_PTR(ary);
+	VALUE *p2 = (VALUE *)RARRAY_CONST_PTR(dup) + len - 1;
+	do *p2-- = *p1++; while (--len > 0);
     }
-    return ary;
+    ARY_SET_LEN(dup, RARRAY_LEN(ary));
+    return dup;
 }
 
-/*
- *  call-seq:
- *     array.to_ary -> array
- *  
- *  Returns _self_.
- */
-
-static VALUE
-rb_ary_to_ary_m(ary)
-    VALUE ary;
+static inline long
+rotate_count(long cnt, long len)
 {
-    return ary;
+    return (cnt < 0) ? (len - (~cnt % len) - 1) : (cnt % len);
 }
 
 VALUE
-rb_ary_reverse(ary)
-    VALUE ary;
+rb_ary_rotate(VALUE ary, long cnt)
 {
-    VALUE *p1, *p2;
-    VALUE tmp;
-
     rb_ary_modify(ary);
-    if (RARRAY(ary)->len > 1) {
-	p1 = RARRAY(ary)->ptr;
-	p2 = p1 + RARRAY(ary)->len - 1;	/* points last item */
 
-	while (p1 < p2) {
-	    tmp = *p1;
-	    *p1++ = *p2;
-	    *p2-- = tmp;
+    if (cnt != 0) {
+	VALUE *ptr = RARRAY_PTR(ary);
+	long len = RARRAY_LEN(ary);
+
+	if (len > 0 && (cnt = rotate_count(cnt, len)) > 0) {
+	    --len;
+	    if (cnt < len) ary_reverse(ptr + cnt, ptr + len);
+	    if (--cnt > 0) ary_reverse(ptr, ptr + cnt);
+	    if (len > 0) ary_reverse(ptr, ptr + len);
+	    return ary;
 	}
     }
-    return ary;
+
+    return Qnil;
 }
 
 /*
  *  call-seq:
- *     array.reverse!   -> array 
- *  
- *  Reverses _self_ in place.
- *     
- *     a = [ "a", "b", "c" ]
- *     a.reverse!       #=> ["c", "b", "a"]
- *     a                #=> ["c", "b", "a"]
+ *     ary.rotate!(count=1)   -> ary
+ *
+ *  Rotates +self+ in place so that the element at +count+ comes first, and
+ *  returns +self+.
+ *
+ *  If +count+ is negative then it rotates in the opposite direction, starting
+ *  from the end of the array where +-1+ is the last element.
+ *
+ *     a = [ "a", "b", "c", "d" ]
+ *     a.rotate!        #=> ["b", "c", "d", "a"]
+ *     a                #=> ["b", "c", "d", "a"]
+ *     a.rotate!(2)     #=> ["d", "a", "b", "c"]
+ *     a.rotate!(-3)    #=> ["a", "b", "c", "d"]
  */
 
 static VALUE
-rb_ary_reverse_bang(ary)
-    VALUE ary;
+rb_ary_rotate_bang(int argc, VALUE *argv, VALUE ary)
 {
-    return rb_ary_reverse(ary);
+    long n = 1;
+
+    switch (argc) {
+      case 1: n = NUM2LONG(argv[0]);
+      case 0: break;
+      default: rb_scan_args(argc, argv, "01", NULL);
+    }
+    rb_ary_rotate(ary, n);
+    return ary;
 }
 
 /*
  *  call-seq:
- *     array.reverse -> an_array
- *  
- *  Returns a new array containing <i>self</i>'s elements in reverse order.
- *     
- *     [ "a", "b", "c" ].reverse   #=> ["c", "b", "a"]
- *     [ 1 ].reverse               #=> [1]
+ *     ary.rotate(count=1)    -> new_ary
+ *
+ *  Returns a new array by rotating +self+ so that the element at +count+ is
+ *  the first element of the new array.
+ *
+ *  If +count+ is negative then it rotates in the opposite direction, starting
+ *  from the end of +self+ where +-1+ is the last element.
+ *
+ *     a = [ "a", "b", "c", "d" ]
+ *     a.rotate         #=> ["b", "c", "d", "a"]
+ *     a                #=> ["a", "b", "c", "d"]
+ *     a.rotate(2)      #=> ["c", "d", "a", "b"]
+ *     a.rotate(-3)     #=> ["b", "c", "d", "a"]
  */
 
 static VALUE
-rb_ary_reverse_m(ary)
-    VALUE ary;
+rb_ary_rotate_m(int argc, VALUE *argv, VALUE ary)
 {
-    return rb_ary_reverse(rb_ary_dup(ary));
+    VALUE rotated;
+    const VALUE *ptr;
+    long len, cnt = 1;
+
+    switch (argc) {
+      case 1: cnt = NUM2LONG(argv[0]);
+      case 0: break;
+      default: rb_scan_args(argc, argv, "01", NULL);
+    }
+
+    len = RARRAY_LEN(ary);
+    rotated = rb_ary_new2(len);
+    if (len > 0) {
+	cnt = rotate_count(cnt, len);
+	ptr = RARRAY_CONST_PTR(ary);
+	len -= cnt;
+	ary_memcpy(rotated, 0, len, ptr + cnt);
+	ary_memcpy(rotated, len, cnt, ptr);
+    }
+    ARY_SET_LEN(rotated, RARRAY_LEN(ary));
+    return rotated;
 }
 
 struct ary_sort_data {
     VALUE ary;
-    VALUE *ptr;
-    long len;
+    int opt_methods;
+    int opt_inited;
 };
 
-static void
-ary_sort_check(data)
-    struct ary_sort_data *data;
+enum {
+    sort_opt_Fixnum,
+    sort_opt_String,
+    sort_optimizable_count
+};
+
+#define STRING_P(s) (RB_TYPE_P((s), T_STRING) && CLASS_OF(s) == rb_cString)
+
+#define SORT_OPTIMIZABLE_BIT(type) (1U << TOKEN_PASTE(sort_opt_,type))
+#define SORT_OPTIMIZABLE(data, type) \
+    (((data)->opt_inited & SORT_OPTIMIZABLE_BIT(type)) ? \
+     ((data)->opt_methods & SORT_OPTIMIZABLE_BIT(type)) : \
+     (((data)->opt_inited |= SORT_OPTIMIZABLE_BIT(type)), \
+      rb_method_basic_definition_p(TOKEN_PASTE(rb_c,type), id_cmp) && \
+      ((data)->opt_methods |= SORT_OPTIMIZABLE_BIT(type))))
+
+static VALUE
+sort_reentered(VALUE ary)
 {
-    if (RARRAY(data->ary)->ptr != data->ptr || RARRAY(data->ary)->len != data->len) {
-	rb_raise(rb_eArgError, "array modified during sort");
+    if (RBASIC(ary)->klass) {
+	rb_raise(rb_eRuntimeError, "sort reentered");
     }
+    return Qnil;
 }
 
 static int
-sort_1(a, b, data)
-    VALUE *a, *b;
-    struct ary_sort_data *data;
+sort_1(const void *ap, const void *bp, void *dummy)
 {
-    VALUE retval = rb_yield_values(2, *a, *b);
+    struct ary_sort_data *data = dummy;
+    VALUE retval = sort_reentered(data->ary);
+    VALUE a = *(const VALUE *)ap, b = *(const VALUE *)bp;
     int n;
 
-    n = rb_cmpint(retval, *a, *b);
-    ary_sort_check(data);
+    retval = rb_yield_values(2, a, b);
+    n = rb_cmpint(retval, a, b);
+    sort_reentered(data->ary);
     return n;
 }
 
 static int
-sort_2(ap, bp, data)
-    VALUE *ap, *bp;
-    struct ary_sort_data *data;
+sort_2(const void *ap, const void *bp, void *dummy)
 {
-    VALUE retval;
-    VALUE a = *ap, b = *bp;
+    struct ary_sort_data *data = dummy;
+    VALUE retval = sort_reentered(data->ary);
+    VALUE a = *(const VALUE *)ap, b = *(const VALUE *)bp;
     int n;
 
-    if (FIXNUM_P(a) && FIXNUM_P(b)) {
+    if (FIXNUM_P(a) && FIXNUM_P(b) && SORT_OPTIMIZABLE(data, Fixnum)) {
 	if ((long)a > (long)b) return 1;
 	if ((long)a < (long)b) return -1;
 	return 0;
     }
-    if (TYPE(a) == T_STRING) {
-	if (TYPE(b) == T_STRING) return rb_str_cmp(a, b);
+    if (STRING_P(a) && STRING_P(b) && SORT_OPTIMIZABLE(data, String)) {
+	return rb_str_cmp(a, b);
     }
 
-    retval = rb_funcall(a, id_cmp, 1, b);
+    retval = rb_funcallv(a, id_cmp, 1, &b);
     n = rb_cmpint(retval, a, b);
-    ary_sort_check(data);
+    sort_reentered(data->ary);
 
     return n;
 }
 
-static VALUE
-sort_internal(ary)
-    VALUE ary;
-{
-    struct ary_sort_data data;
-
-    data.ary = ary;
-    data.ptr = RARRAY(ary)->ptr; data.len = RARRAY(ary)->len;
-    qsort(RARRAY(ary)->ptr, RARRAY(ary)->len, sizeof(VALUE),
-	  rb_block_given_p()?sort_1:sort_2, &data);
-    return ary;
-}
-
-static VALUE
-sort_unlock(ary)
-    VALUE ary;
-{
-    FL_UNSET(ary, ARY_TMPLOCK);
-    return ary;
-}
-
 /*
  *  call-seq:
- *     array.sort!                   -> array
- *     array.sort! {| a,b | block }  -> array 
- *  
- *  Sorts _self_. Comparisons for
- *  the sort will be done using the <code><=></code> operator or using
- *  an optional code block. The block implements a comparison between
- *  <i>a</i> and <i>b</i>, returning -1, 0, or +1. See also
- *  <code>Enumerable#sort_by</code>.
- *     
+ *     ary.sort!                   -> ary
+ *     ary.sort! { |a, b| block }  -> ary
+ *
+ *  Sorts +self+ in place.
+ *
+ *  Comparisons for the sort will be done using the <code><=></code> operator
+ *  or using an optional code block.
+ *
+ *  The block must implement a comparison between +a+ and +b+ and return
+ *  an integer less than 0 when +b+ follows +a+, +0+ when +a+ and +b+
+ *  are equivalent, or an integer greater than 0 when +a+ follows +b+.
+ *
+ *  See also Enumerable#sort_by.
+ *
  *     a = [ "d", "a", "e", "c", "b" ]
- *     a.sort                    #=> ["a", "b", "c", "d", "e"]
- *     a.sort {|x,y| y <=> x }   #=> ["e", "d", "c", "b", "a"]
+ *     a.sort!                    #=> ["a", "b", "c", "d", "e"]
+ *     a.sort! { |x,y| y <=> x }  #=> ["e", "d", "c", "b", "a"]
  */
 
 VALUE
-rb_ary_sort_bang(ary)
-    VALUE ary;
+rb_ary_sort_bang(VALUE ary)
 {
     rb_ary_modify(ary);
-    if (RARRAY(ary)->len > 1) {
-	FL_SET(ary, ARY_TMPLOCK);	/* prohibit modification during sort */
-	rb_ensure(sort_internal, ary, sort_unlock, ary);
+    assert(!ARY_SHARED_P(ary));
+    if (RARRAY_LEN(ary) > 1) {
+	VALUE tmp = ary_make_substitution(ary); /* only ary refers tmp */
+	struct ary_sort_data data;
+	long len = RARRAY_LEN(ary);
+
+	RBASIC_CLEAR_CLASS(tmp);
+	data.ary = tmp;
+	data.opt_methods = 0;
+	data.opt_inited = 0;
+	RARRAY_PTR_USE(tmp, ptr, {
+	    ruby_qsort(ptr, len, sizeof(VALUE),
+		       rb_block_given_p()?sort_1:sort_2, &data);
+	}); /* WB: no new reference */
+	rb_ary_modify(ary);
+        if (ARY_EMBED_P(tmp)) {
+            if (ARY_SHARED_P(ary)) { /* ary might be destructively operated in the given block */
+                rb_ary_unshare(ary);
+		FL_SET_EMBED(ary);
+            }
+	    ary_memcpy(ary, 0, ARY_EMBED_LEN(tmp), ARY_EMBED_PTR(tmp));
+            ARY_SET_LEN(ary, ARY_EMBED_LEN(tmp));
+        }
+        else {
+            if (!ARY_EMBED_P(ary) && ARY_HEAP_PTR(ary) == ARY_HEAP_PTR(tmp)) {
+                FL_UNSET_SHARED(ary);
+                ARY_SET_CAPA(ary, RARRAY_LEN(tmp));
+            }
+            else {
+                assert(!ARY_SHARED_P(tmp));
+                if (ARY_EMBED_P(ary)) {
+                    FL_UNSET_EMBED(ary);
+                }
+                else if (ARY_SHARED_P(ary)) {
+                    /* ary might be destructively operated in the given block */
+                    rb_ary_unshare(ary);
+                }
+                else {
+		    ruby_sized_xfree((void *)ARY_HEAP_PTR(ary), ARY_HEAP_SIZE(ary));
+                }
+                ARY_SET_PTR(ary, RARRAY_CONST_PTR(tmp));
+                ARY_SET_HEAP_LEN(ary, len);
+                ARY_SET_CAPA(ary, RARRAY_LEN(tmp));
+            }
+            /* tmp was lost ownership for the ptr */
+            FL_UNSET(tmp, FL_FREEZE);
+            FL_SET_EMBED(tmp);
+            ARY_SET_EMBED_LEN(tmp, 0);
+            FL_SET(tmp, FL_FREEZE);
+	}
+        /* tmp will be GC'ed. */
+        RBASIC_SET_CLASS_RAW(tmp, rb_cArray); /* rb_cArray must be marked */
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *     array.sort                   -> an_array 
- *     array.sort {| a,b | block }  -> an_array 
- *  
- *  Returns a new array created by sorting <i>self</i>. Comparisons for
- *  the sort will be done using the <code><=></code> operator or using
- *  an optional code block. The block implements a comparison between
- *  <i>a</i> and <i>b</i>, returning -1, 0, or +1. See also
- *  <code>Enumerable#sort_by</code>.
- *     
+ *     ary.sort                   -> new_ary
+ *     ary.sort { |a, b| block }  -> new_ary
+ *
+ *  Returns a new array created by sorting +self+.
+ *
+ *  Comparisons for the sort will be done using the <code><=></code> operator
+ *  or using an optional code block.
+ *
+ *  The block must implement a comparison between +a+ and +b+ and return
+ *  an integer less than 0 when +b+ follows +a+, +0+ when +a+ and +b+
+ *  are equivalent, or an integer greater than 0 when +a+ follows +b+.
+ *
+ *
+ *  See also Enumerable#sort_by.
+ *
  *     a = [ "d", "a", "e", "c", "b" ]
  *     a.sort                    #=> ["a", "b", "c", "d", "e"]
- *     a.sort {|x,y| y <=> x }   #=> ["e", "d", "c", "b", "a"]
+ *     a.sort { |x,y| y <=> x }  #=> ["e", "d", "c", "b", "a"]
  */
 
 VALUE
-rb_ary_sort(ary)
-    VALUE ary;
+rb_ary_sort(VALUE ary)
 {
     ary = rb_ary_dup(ary);
     rb_ary_sort_bang(ary);
     return ary;
 }
 
+static VALUE rb_ary_bsearch_index(VALUE ary);
+
 /*
  *  call-seq:
- *     array.collect {|item| block }  -> an_array
- *     array.map     {|item| block }  -> an_array
- *  
- *  Invokes <i>block</i> once for each element of <i>self</i>. Creates a 
- *  new array containing the values returned by the block.
- *  See also <code>Enumerable#collect</code>.
- *     
+ *     ary.bsearch {|x| block }  -> elem
+ *
+ *  By using binary search, finds a value from this array which meets
+ *  the given condition in O(log n) where n is the size of the array.
+ *
+ *  You can use this method in two use cases: a find-minimum mode and
+ *  a find-any mode.  In either case, the elements of the array must be
+ *  monotone (or sorted) with respect to the block.
+ *
+ *  In find-minimum mode (this is a good choice for typical use case),
+ *  the block must return true or false, and there must be an index i
+ *  (0 <= i <= ary.size) so that:
+ *
+ *  - the block returns false for any element whose index is less than
+ *    i, and
+ *  - the block returns true for any element whose index is greater
+ *    than or equal to i.
+ *
+ *  This method returns the i-th element.  If i is equal to ary.size,
+ *  it returns nil.
+ *
+ *     ary = [0, 4, 7, 10, 12]
+ *     ary.bsearch {|x| x >=   4 } #=> 4
+ *     ary.bsearch {|x| x >=   6 } #=> 7
+ *     ary.bsearch {|x| x >=  -1 } #=> 0
+ *     ary.bsearch {|x| x >= 100 } #=> nil
+ *
+ *  In find-any mode (this behaves like libc's bsearch(3)), the block
+ *  must return a number, and there must be two indices i and j
+ *  (0 <= i <= j <= ary.size) so that:
+ *
+ *  - the block returns a positive number for ary[k] if 0 <= k < i,
+ *  - the block returns zero for ary[k] if i <= k < j, and
+ *  - the block returns a negative number for ary[k] if
+ *    j <= k < ary.size.
+ *
+ *  Under this condition, this method returns any element whose index
+ *  is within i...j.  If i is equal to j (i.e., there is no element
+ *  that satisfies the block), this method returns nil.
+ *
+ *     ary = [0, 4, 7, 10, 12]
+ *     # try to find v such that 4 <= v < 8
+ *     ary.bsearch {|x| 1 - x / 4 } #=> 4 or 7
+ *     # try to find v such that 8 <= v < 10
+ *     ary.bsearch {|x| 4 - x / 2 } #=> nil
+ *
+ *  You must not mix the two modes at a time; the block must always
+ *  return either true/false, or always return a number.  It is
+ *  undefined which value is actually picked up at each iteration.
+ */
+
+static VALUE
+rb_ary_bsearch(VALUE ary)
+{
+    VALUE index_result = rb_ary_bsearch_index(ary);
+
+    if (FIXNUM_P(index_result)) {
+	return rb_ary_entry(ary, FIX2LONG(index_result));
+    }
+    return index_result;
+}
+
+/*
+ *  call-seq:
+ *     ary.bsearch_index {|x| block }  -> int or nil
+ *
+ *  By using binary search, finds an index of a value from this array which
+ *  meets the given condition in O(log n) where n is the size of the array.
+ *
+ *  It supports two modes, depending on the nature of the block and they are
+ *  exactly the same as in the case of #bsearch method with the only difference
+ *  being that this method returns the index of the element instead of the
+ *  element itself. For more details consult the documentation for #bsearch.
+ */
+
+static VALUE
+rb_ary_bsearch_index(VALUE ary)
+{
+    long low = 0, high = RARRAY_LEN(ary), mid;
+    int smaller = 0, satisfied = 0;
+    VALUE v, val;
+
+    RETURN_ENUMERATOR(ary, 0, 0);
+    while (low < high) {
+	mid = low + ((high - low) / 2);
+	val = rb_ary_entry(ary, mid);
+	v = rb_yield(val);
+	if (FIXNUM_P(v)) {
+	    if (v == INT2FIX(0)) return INT2FIX(mid);
+	    smaller = (SIGNED_VALUE)v < 0; /* Fixnum preserves its sign-bit */
+	}
+	else if (v == Qtrue) {
+	    satisfied = 1;
+	    smaller = 1;
+	}
+	else if (v == Qfalse || v == Qnil) {
+	    smaller = 0;
+	}
+	else if (rb_obj_is_kind_of(v, rb_cNumeric)) {
+	    const VALUE zero = INT2FIX(0);
+	    switch (rb_cmpint(rb_funcallv(v, id_cmp, 1, &zero), v, zero)) {
+	      case 0: return INT2FIX(mid);
+	      case 1: smaller = 1; break;
+	      case -1: smaller = 0;
+	    }
+	}
+	else {
+	    rb_raise(rb_eTypeError, "wrong argument type %"PRIsVALUE
+		     " (must be numeric, true, false or nil)",
+		     rb_obj_class(v));
+	}
+	if (smaller) {
+	    high = mid;
+	}
+	else {
+	    low = mid + 1;
+	}
+    }
+    if (!satisfied) return Qnil;
+    return INT2FIX(low);
+}
+
+
+static VALUE
+sort_by_i(RB_BLOCK_CALL_FUNC_ARGLIST(i, dummy))
+{
+    return rb_yield(i);
+}
+
+/*
+ *  call-seq:
+ *     ary.sort_by! { |obj| block }    -> ary
+ *     ary.sort_by!                    -> Enumerator
+ *
+ *  Sorts +self+ in place using a set of keys generated by mapping the
+ *  values in +self+ through the given block.
+ *
+ *  If no block is given, an Enumerator is returned instead.
+ *
+ */
+
+static VALUE
+rb_ary_sort_by_bang(VALUE ary)
+{
+    VALUE sorted;
+
+    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+    rb_ary_modify(ary);
+    sorted = rb_block_call(ary, rb_intern("sort_by"), 0, 0, sort_by_i, 0);
+    rb_ary_replace(ary, sorted);
+    return ary;
+}
+
+
+/*
+ *  call-seq:
+ *     ary.collect { |item| block }  -> new_ary
+ *     ary.map     { |item| block }  -> new_ary
+ *     ary.collect                   -> Enumerator
+ *     ary.map                       -> Enumerator
+ *
+ *  Invokes the given block once for each element of +self+.
+ *
+ *  Creates a new array containing the values returned by the block.
+ *
+ *  See also Enumerable#collect.
+ *
+ *  If no block is given, an Enumerator is returned instead.
+ *
  *     a = [ "a", "b", "c", "d" ]
- *     a.collect {|x| x + "!" }   #=> ["a!", "b!", "c!", "d!"]
- *     a                          #=> ["a", "b", "c", "d"]
+ *     a.collect { |x| x + "!" }         #=> ["a!", "b!", "c!", "d!"]
+ *     a.map.with_index { |x, i| x * i } #=> ["", "b", "cc", "ddd"]
+ *     a                                 #=> ["a", "b", "c", "d"]
  */
 
 static VALUE
-rb_ary_collect(ary)
-    VALUE ary;
+rb_ary_collect(VALUE ary)
 {
     long i;
     VALUE collect;
 
-    if (!rb_block_given_p()) {
-	return rb_ary_new4(RARRAY(ary)->len, RARRAY(ary)->ptr);
-    }
-
-    collect = rb_ary_new2(RARRAY(ary)->len);
-    for (i = 0; i < RARRAY(ary)->len; i++) {
-	rb_ary_push(collect, rb_yield(RARRAY(ary)->ptr[i]));
+    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+    collect = rb_ary_new2(RARRAY_LEN(ary));
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+	rb_ary_push(collect, rb_yield(RARRAY_AREF(ary, i)));
     }
     return collect;
 }
 
-/* 
+
+/*
  *  call-seq:
- *     array.collect! {|item| block }   ->   array
- *     array.map!     {|item| block }   ->   array
+ *     ary.collect! {|item| block }   -> ary
+ *     ary.map!     {|item| block }   -> ary
+ *     ary.collect!                   -> Enumerator
+ *     ary.map!                       -> Enumerator
+ *
+ *  Invokes the given block once for each element of +self+, replacing the
+ *  element with the value returned by the block.
+ *
+ *  See also Enumerable#collect.
+ *
+ *  If no block is given, an Enumerator is returned instead.
  *
- *  Invokes the block once for each element of _self_, replacing the
- *  element with the value returned by _block_.
- *  See also <code>Enumerable#collect</code>.
- *   
  *     a = [ "a", "b", "c", "d" ]
- *     a.collect! {|x| x + "!" }
- *     a             #=>  [ "a!", "b!", "c!", "d!" ]
+ *     a.map! {|x| x + "!" }
+ *     a #=>  [ "a!", "b!", "c!", "d!" ]
+ *     a.collect!.with_index {|x, i| x[0...i] }
+ *     a #=>  ["", "b", "c!", "d!"]
  */
 
 static VALUE
-rb_ary_collect_bang(ary)
-    VALUE ary;
+rb_ary_collect_bang(VALUE ary)
 {
     long i;
 
+    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
     rb_ary_modify(ary);
-    for (i = 0; i < RARRAY(ary)->len; i++) {
-	rb_ary_store(ary, i, rb_yield(RARRAY(ary)->ptr[i]));
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+	rb_ary_store(ary, i, rb_yield(RARRAY_AREF(ary, i)));
     }
     return ary;
 }
 
 VALUE
-rb_values_at(obj, olen, argc, argv, func)
-    VALUE obj;
-    long olen;
-    int argc;
-    VALUE *argv;
-    VALUE (*func) _((VALUE,long));
+rb_get_values_at(VALUE obj, long olen, int argc, const VALUE *argv, VALUE (*func) (VALUE, long))
 {
     VALUE result = rb_ary_new2(argc);
     long beg, len, i, j;
@@ -1758,15 +2782,13 @@ rb_values_at(obj, olen, argc, argv, func)
 	    continue;
 	}
 	/* check if idx is Range */
-	switch (rb_range_beg_len(argv[i], &beg, &len, olen, 0)) {
-	  case Qfalse:
-	    break;
-	  case Qnil:
-	    continue;
-	  default:
-	    for (j=0; j<len; j++) {
-		rb_ary_push(result, (*func)(obj, j+beg));
+	if (rb_range_beg_len(argv[i], &beg, &len, olen, 1)) {
+	    long end = olen < beg+len ? olen : beg+len;
+	    for (j = beg; j < end; j++) {
+		rb_ary_push(result, (*func)(obj, j));
 	    }
+	    if (beg + len > j)
+		rb_ary_resize(result, RARRAY_LEN(result) + (beg + len) - j);
 	    continue;
 	}
 	rb_ary_push(result, (*func)(obj, NUM2LONG(argv[i])));
@@ -1774,69 +2796,190 @@ rb_values_at(obj, olen, argc, argv, func)
     return result;
 }
 
-/* 
+/*
  *  call-seq:
- *     array.values_at(selector,... )  -> an_array
+ *     ary.values_at(selector, ...)  -> new_ary
+ *
+ *  Returns an array containing the elements in +self+ corresponding to the
+ *  given +selector+(s).
+ *
+ *  The selectors may be either integer indices or ranges.
+ *
+ *  See also Array#select.
  *
- *  Returns an array containing the elements in
- *  _self_ corresponding to the given selector(s). The selectors
- *  may be either integer indices or ranges. 
- *  See also <code>Array#select</code>.
- * 
  *     a = %w{ a b c d e f }
- *     a.values_at(1, 3, 5)
- *     a.values_at(1, 3, 5, 7)
- *     a.values_at(-1, -3, -5, -7)
- *     a.values_at(1..3, 2...5)
+ *     a.values_at(1, 3, 5)          # => ["b", "d", "f"]
+ *     a.values_at(1, 3, 5, 7)       # => ["b", "d", "f", nil]
+ *     a.values_at(-1, -2, -2, -7)   # => ["f", "e", "e", nil]
+ *     a.values_at(4..6, 3...6)      # => ["e", "f", nil, "d", "e", "f"]
  */
 
 static VALUE
-rb_ary_values_at(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+rb_ary_values_at(int argc, VALUE *argv, VALUE ary)
 {
-    return rb_values_at(ary, RARRAY(ary)->len, argc, argv, rb_ary_entry);
+    return rb_get_values_at(ary, RARRAY_LEN(ary), argc, argv, rb_ary_entry);
 }
 
+
 /*
  *  call-seq:
- *     array.select {|item| block } -> an_array
- *  
- *  Invokes the block passing in successive elements from <i>array</i>,
- *  returning an array containing those elements for which the block
- *  returns a true value (equivalent to <code>Enumerable#select</code>).
- *     
+ *     ary.select { |item| block } -> new_ary
+ *     ary.select                  -> Enumerator
+ *
+ *  Returns a new array containing all elements of +ary+
+ *  for which the given +block+ returns a true value.
+ *
+ *  If no block is given, an Enumerator is returned instead.
+ *
+ *     [1,2,3,4,5].select { |num|  num.even?  }   #=> [2, 4]
+ *
  *     a = %w{ a b c d e f }
- *     a.select {|v| v =~ /[aeiou]/}   #=> ["a", "e"]
+ *     a.select { |v| v =~ /[aeiou]/ }  #=> ["a", "e"]
+ *
+ *  See also Enumerable#select.
  */
 
 static VALUE
-rb_ary_select(ary)
-    VALUE ary;
+rb_ary_select(VALUE ary)
 {
     VALUE result;
     long i;
 
-    result = rb_ary_new2(RARRAY(ary)->len);
-    for (i = 0; i < RARRAY(ary)->len; i++) {
-	if (RTEST(rb_yield(RARRAY(ary)->ptr[i]))) {
+    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+    result = rb_ary_new2(RARRAY_LEN(ary));
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+	if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
 	    rb_ary_push(result, rb_ary_elt(ary, i));
 	}
     }
     return result;
 }
 
+struct select_bang_arg {
+    VALUE ary;
+    long len[2];
+};
+
+static VALUE
+select_bang_i(VALUE a)
+{
+    volatile struct select_bang_arg *arg = (void *)a;
+    VALUE ary = arg->ary;
+    long i1, i2;
+
+    for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); arg->len[0] = ++i1) {
+	VALUE v = RARRAY_AREF(ary, i1);
+	if (!RTEST(rb_yield(v))) continue;
+	if (i1 != i2) {
+	    rb_ary_store(ary, i2, v);
+	}
+	arg->len[1] = ++i2;
+    }
+    return (i1 == i2) ? Qnil : ary;
+}
+
+static VALUE
+select_bang_ensure(VALUE a)
+{
+    volatile struct select_bang_arg *arg = (void *)a;
+    VALUE ary = arg->ary;
+    long len = RARRAY_LEN(ary);
+    long i1 = arg->len[0], i2 = arg->len[1];
+
+    if (i2 < len && i2 < i1) {
+	long tail = 0;
+	if (i1 < len) {
+	    tail = len - i1;
+	    RARRAY_PTR_USE(ary, ptr, {
+		    MEMMOVE(ptr + i2, ptr + i1, VALUE, tail);
+		});
+	}
+	ARY_SET_LEN(ary, i2 + tail);
+    }
+    return ary;
+}
+
+/*
+ *  call-seq:
+ *     ary.select!  {|item| block } -> ary or nil
+ *     ary.select!                  -> Enumerator
+ *
+ *  Invokes the given block passing in successive elements from +self+,
+ *  deleting elements for which the block returns a +false+ value.
+ *
+ *  The array may not be changed instantly every time the block is called.
+ *
+ *  If changes were made, it will return +self+, otherwise it returns +nil+.
+ *
+ *  See also Array#keep_if
+ *
+ *  If no block is given, an Enumerator is returned instead.
+ *
+ */
+
+static VALUE
+rb_ary_select_bang(VALUE ary)
+{
+    struct select_bang_arg args;
+
+    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+    rb_ary_modify(ary);
+
+    args.ary = ary;
+    args.len[0] = args.len[1] = 0;
+    return rb_ensure(select_bang_i, (VALUE)&args, select_bang_ensure, (VALUE)&args);
+}
+
+/*
+ *  call-seq:
+ *     ary.keep_if { |item| block } -> ary
+ *     ary.keep_if                  -> Enumerator
+ *
+ *  Deletes every element of +self+ for which the given block evaluates to
+ *  +false+.
+ *
+ *  See also Array#select!
+ *
+ *  If no block is given, an Enumerator is returned instead.
+ *
+ *     a = %w{ a b c d e f }
+ *     a.keep_if { |v| v =~ /[aeiou]/ }  #=> ["a", "e"]
+ */
+
+static VALUE
+rb_ary_keep_if(VALUE ary)
+{
+    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+    rb_ary_select_bang(ary);
+    return ary;
+}
+
+static void
+ary_resize_smaller(VALUE ary, long len)
+{
+    rb_ary_modify(ary);
+    if (RARRAY_LEN(ary) > len) {
+	ARY_SET_LEN(ary, len);
+	if (len * 2 < ARY_CAPA(ary) &&
+	    ARY_CAPA(ary) > ARY_DEFAULT_SIZE) {
+	    ary_resize_capa(ary, len * 2);
+	}
+    }
+}
+
 /*
  *  call-seq:
- *     array.delete(obj)            -> obj or nil 
- *     array.delete(obj) { block }  -> obj or nil
- *  
- *  Deletes items from <i>self</i> that are equal to <i>obj</i>. If
- *  the item is not found, returns <code>nil</code>. If the optional
- *  code block is given, returns the result of <i>block</i> if the item
- *  is not found.
- *     
+ *     ary.delete(obj)            -> item or nil
+ *     ary.delete(obj) { block }  -> item or result of block
+ *
+ *  Deletes all items from +self+ that are equal to +obj+.
+ *
+ *  Returns the last deleted item, or +nil+ if no matching item is found.
+ *
+ *  If the optional code block is given, the result of the block is returned if
+ *  the item is not found.  (To remove +nil+ elements and get an informative
+ *  return value, use Array#compact!)
+ *
  *     a = [ "a", "b", "b", "b", "c" ]
  *     a.delete("b")                   #=> "b"
  *     a                               #=> ["a", "c"]
@@ -1845,47 +2988,62 @@ rb_ary_select(ary)
  */
 
 VALUE
-rb_ary_delete(ary, item)
-    VALUE ary;
-    VALUE item;
+rb_ary_delete(VALUE ary, VALUE item)
 {
+    VALUE v = item;
     long i1, i2;
 
-    for (i1 = i2 = 0; i1 < RARRAY(ary)->len; i1++) {
-	VALUE e = RARRAY(ary)->ptr[i1];
+    for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); i1++) {
+	VALUE e = RARRAY_AREF(ary, i1);
 
-	if (rb_equal(e, item)) continue;
+	if (rb_equal(e, item)) {
+	    v = e;
+	    continue;
+	}
 	if (i1 != i2) {
 	    rb_ary_store(ary, i2, e);
 	}
 	i2++;
     }
-    if (RARRAY(ary)->len == i2) {
+    if (RARRAY_LEN(ary) == i2) {
 	if (rb_block_given_p()) {
 	    return rb_yield(item);
 	}
 	return Qnil;
     }
 
-    rb_ary_modify(ary);
-    if (RARRAY(ary)->len > i2) {
-	RARRAY(ary)->len = i2;
-	if (i2 * 2 < RARRAY(ary)->aux.capa &&
-	    RARRAY(ary)->aux.capa > ARY_DEFAULT_SIZE) {
-	    REALLOC_N(RARRAY(ary)->ptr, VALUE, i2 * 2);
-	    RARRAY(ary)->aux.capa = i2 * 2;
+    ary_resize_smaller(ary, i2);
+
+    return v;
+}
+
+void
+rb_ary_delete_same(VALUE ary, VALUE item)
+{
+    long i1, i2;
+
+    for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); i1++) {
+	VALUE e = RARRAY_AREF(ary, i1);
+
+	if (e == item) {
+	    continue;
 	}
+	if (i1 != i2) {
+	    rb_ary_store(ary, i2, e);
+	}
+	i2++;
+    }
+    if (RARRAY_LEN(ary) == i2) {
+	return;
     }
 
-    return item;
+    ary_resize_smaller(ary, i2);
 }
 
 VALUE
-rb_ary_delete_at(ary, pos)
-    VALUE ary;
-    long pos;
+rb_ary_delete_at(VALUE ary, long pos)
 {
-    long i, len = RARRAY(ary)->len;
+    long len = RARRAY_LEN(ary);
     VALUE del;
 
     if (pos >= len) return Qnil;
@@ -1895,52 +3053,48 @@ rb_ary_delete_at(ary, pos)
     }
 
     rb_ary_modify(ary);
-    del = RARRAY(ary)->ptr[pos];
-    for (i = pos + 1; i < len; i++, pos++) {
-	RARRAY(ary)->ptr[pos] = RARRAY(ary)->ptr[i];
-    }
-    RARRAY(ary)->len = pos;
+    del = RARRAY_AREF(ary, pos);
+    RARRAY_PTR_USE(ary, ptr, {
+	MEMMOVE(ptr+pos, ptr+pos+1, VALUE, len-pos-1);
+    });
+    ARY_INCREASE_LEN(ary, -1);
 
     return del;
 }
 
 /*
  *  call-seq:
- *     array.delete_at(index)  -> obj or nil
- *  
- *  Deletes the element at the specified index, returning that element,
- *  or <code>nil</code> if the index is out of range. See also
- *  <code>Array#slice!</code>.
- *     
- *     a = %w( ant bat cat dog )
+ *     ary.delete_at(index)  -> obj or nil
+ *
+ *  Deletes the element at the specified +index+, returning that element, or
+ *  +nil+ if the +index+ is out of range.
+ *
+ *  See also Array#slice!
+ *
+ *     a = ["ant", "bat", "cat", "dog"]
  *     a.delete_at(2)    #=> "cat"
  *     a                 #=> ["ant", "bat", "dog"]
  *     a.delete_at(99)   #=> nil
  */
 
 static VALUE
-rb_ary_delete_at_m(ary, pos)
-    VALUE ary, pos;
+rb_ary_delete_at_m(VALUE ary, VALUE pos)
 {
     return rb_ary_delete_at(ary, NUM2LONG(pos));
 }
 
 /*
  *  call-seq:
- *     array.slice!(index)         -> obj or nil
- *     array.slice!(start, length) -> sub_array or nil
- *     array.slice!(range)         -> sub_array or nil 
- *  
- *  Deletes the element(s) given by an index (optionally with a length)
- *  or by a range. Returns the deleted object, subarray, or
- *  <code>nil</code> if the index is out of range. Equivalent to:
- *     
- *     def slice!(*args)
- *       result = self[*args]
- *       self[*args] = nil
- *       result
- *     end
- *     
+ *     ary.slice!(index)         -> obj or nil
+ *     ary.slice!(start, length) -> new_ary or nil
+ *     ary.slice!(range)         -> new_ary or nil
+ *
+ *  Deletes the element(s) given by an +index+ (optionally up to +length+
+ *  elements) or by a +range+.
+ *
+ *  Returns the deleted object (or objects), or +nil+ if the +index+ is out of
+ *  range.
+ *
  *     a = [ "a", "b", "c" ]
  *     a.slice!(1)     #=> "b"
  *     a               #=> ["a", "c"]
@@ -1951,194 +3105,312 @@ rb_ary_delete_at_m(ary, pos)
  */
 
 static VALUE
-rb_ary_slice_bang(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+rb_ary_slice_bang(int argc, VALUE *argv, VALUE ary)
 {
     VALUE arg1, arg2;
-    long pos, len;
+    long pos, len, orig_len;
 
-    if (rb_scan_args(argc, argv, "11", &arg1, &arg2) == 2) {
-	pos = NUM2LONG(arg1);
-	len = NUM2LONG(arg2);
+    rb_ary_modify_check(ary);
+    if (argc == 2) {
+	pos = NUM2LONG(argv[0]);
+	len = NUM2LONG(argv[1]);
       delete_pos_len:
+	if (len < 0) return Qnil;
+	orig_len = RARRAY_LEN(ary);
 	if (pos < 0) {
-	    pos = RARRAY(ary)->len + pos;
+	    pos += orig_len;
+	    if (pos < 0) return Qnil;
+	}
+	else if (orig_len < pos) return Qnil;
+	if (orig_len < pos + len) {
+	    len = orig_len - pos;
 	}
-	arg2 = rb_ary_subseq(ary, pos, len);
-	rb_ary_splice(ary, pos, len, Qnil);	/* Qnil/rb_ary_new2(0) */
+	if (len == 0) return rb_ary_new2(0);
+	arg2 = rb_ary_new4(len, RARRAY_CONST_PTR(ary)+pos);
+	RBASIC_SET_CLASS(arg2, rb_obj_class(ary));
+	rb_ary_splice(ary, pos, len, Qundef);
 	return arg2;
     }
 
-    if (!FIXNUM_P(arg1) && rb_range_beg_len(arg1, &pos, &len, RARRAY(ary)->len, 1)) {
-	goto delete_pos_len;
+    if (argc != 1) {
+	/* error report */
+	rb_scan_args(argc, argv, "11", NULL, NULL);
+    }
+    arg1 = argv[0];
+
+    if (!FIXNUM_P(arg1)) {
+	switch (rb_range_beg_len(arg1, &pos, &len, RARRAY_LEN(ary), 0)) {
+	  case Qtrue:
+	    /* valid range */
+	    goto delete_pos_len;
+	  case Qnil:
+	    /* invalid range */
+	    return Qnil;
+	  default:
+	    /* not a range */
+	    break;
+	}
     }
 
     return rb_ary_delete_at(ary, NUM2LONG(arg1));
 }
 
-/*
- *  call-seq:
- *     array.reject! {|item| block }  -> array or nil
- *  
- *  Equivalent to <code>Array#delete_if</code>, deleting elements from
- *  _self_ for which the block evaluates to true, but returns
- *  <code>nil</code> if no changes were made. Also see
- *  <code>Enumerable#reject</code>.
- */
+static VALUE
+ary_reject(VALUE orig, VALUE result)
+{
+    long i;
+
+    for (i = 0; i < RARRAY_LEN(orig); i++) {
+	VALUE v = RARRAY_AREF(orig, i);
+	if (!RTEST(rb_yield(v))) {
+	    rb_ary_push(result, v);
+	}
+    }
+    return result;
+}
 
 static VALUE
-rb_ary_reject_bang(ary)
-    VALUE ary;
+reject_bang_i(VALUE a)
 {
+    volatile struct select_bang_arg *arg = (void *)a;
+    VALUE ary = arg->ary;
     long i1, i2;
 
-    rb_ary_modify(ary);
-    for (i1 = i2 = 0; i1 < RARRAY(ary)->len; i1++) {
-	VALUE v = RARRAY(ary)->ptr[i1];
+    for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); arg->len[0] = ++i1) {
+	VALUE v = RARRAY_AREF(ary, i1);
 	if (RTEST(rb_yield(v))) continue;
 	if (i1 != i2) {
 	    rb_ary_store(ary, i2, v);
 	}
-	i2++;
+	arg->len[1] = ++i2;
     }
-    if (RARRAY(ary)->len == i2) return Qnil;
-    if (i2 < RARRAY(ary)->len)
-	RARRAY(ary)->len = i2;
+    return (i1 == i2) ? Qnil : ary;
+}
 
-    return ary;
+static VALUE
+ary_reject_bang(VALUE ary)
+{
+    struct select_bang_arg args;
+
+    rb_ary_modify_check(ary);
+    args.ary = ary;
+    args.len[0] = args.len[1] = 0;
+    return rb_ensure(reject_bang_i, (VALUE)&args, select_bang_ensure, (VALUE)&args);
 }
 
 /*
  *  call-seq:
- *     array.reject {|item| block }  -> an_array
- *  
- *  Returns a new array containing the items in _self_
- *  for which the block is not true.
+ *     ary.reject! { |item| block }  -> ary or nil
+ *     ary.reject!                   -> Enumerator
+ *
+ *  Deletes every element of +self+ for which the block evaluates to +true+,
+ *  if no changes were made returns +nil+.
+ *
+ *  The array may not be changed instantly every time the block is called.
+ *
+ *  See also Enumerable#reject and Array#delete_if.
+ *
+ *  If no block is given, an Enumerator is returned instead.
  */
 
 static VALUE
-rb_ary_reject(ary)
-    VALUE ary;
+rb_ary_reject_bang(VALUE ary)
 {
-    ary = rb_ary_dup(ary);
-    rb_ary_reject_bang(ary);
-    return ary;
+    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+    return ary_reject_bang(ary);
 }
 
 /*
  *  call-seq:
- *     array.delete_if {|item| block }  -> array
- *  
- *  Deletes every element of <i>self</i> for which <i>block</i> evaluates
- *  to <code>true</code>.
- *     
- *     a = [ "a", "b", "c" ]
- *     a.delete_if {|x| x >= "b" }   #=> ["a"]
+ *     ary.reject  {|item| block }  -> new_ary
+ *     ary.reject                   -> Enumerator
+ *
+ *  Returns a new array containing the items in +self+ for which the given
+ *  block is not +true+. The ordering of non-rejected elements is maintained.
+ *
+ *  See also Array#delete_if
+ *
+ *  If no block is given, an Enumerator is returned instead.
  */
 
 static VALUE
-rb_ary_delete_if(ary)
-    VALUE ary;
+rb_ary_reject(VALUE ary)
 {
-    rb_ary_reject_bang(ary);
+    VALUE rejected_ary;
+
+    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+    rejected_ary = rb_ary_new();
+    ary_reject(ary, rejected_ary);
+    return rejected_ary;
+}
+
+/*
+ *  call-seq:
+ *     ary.delete_if { |item| block }  -> ary
+ *     ary.delete_if                   -> Enumerator
+ *
+ *  Deletes every element of +self+ for which block evaluates to +true+.
+ *
+ *  The array is changed instantly every time the block is called, not after
+ *  the iteration is over.
+ *
+ *  See also Array#reject!
+ *
+ *  If no block is given, an Enumerator is returned instead.
+ *
+ *     scores = [ 97, 42, 75 ]
+ *     scores.delete_if {|score| score < 80 }   #=> [97]
+ */
+
+static VALUE
+rb_ary_delete_if(VALUE ary)
+{
+    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+    ary_reject_bang(ary);
     return ary;
 }
 
+static VALUE
+take_i(RB_BLOCK_CALL_FUNC_ARGLIST(val, cbarg))
+{
+    VALUE *args = (VALUE *)cbarg;
+    if (args[1]-- == 0) rb_iter_break();
+    if (argc > 1) val = rb_ary_new4(argc, argv);
+    rb_ary_push(args[0], val);
+    return Qnil;
+}
+
+static VALUE
+take_items(VALUE obj, long n)
+{
+    VALUE result = rb_check_array_type(obj);
+    VALUE args[2];
+
+    if (!NIL_P(result)) return rb_ary_subseq(result, 0, n);
+    result = rb_ary_new2(n);
+    args[0] = result; args[1] = (VALUE)n;
+    if (rb_check_block_call(obj, idEach, 0, 0, take_i, (VALUE)args) == Qundef)
+	rb_raise(rb_eTypeError, "wrong argument type %"PRIsVALUE" (must respond to :each)",
+		 rb_obj_class(obj));
+    return result;
+}
+
+
 /*
  *  call-seq:
- *     array.zip(arg, ...)                   -> an_array
- *     array.zip(arg, ...) {| arr | block }  -> nil
- *  
- *  Converts any arguments to arrays, then merges elements of
- *  <i>self</i> with corresponding elements from each argument. This
- *  generates a sequence of <code>self.size</code> <em>n</em>-element
- *  arrays, where <em>n</em> is one more that the count of arguments. If
- *  the size of any argument is less than <code>enumObj.size</code>,
- *  <code>nil</code> values are supplied. If a block given, it is
- *  invoked for each output array, otherwise an array of arrays is
- *  returned.
- *     
+ *     ary.zip(arg, ...)                  -> new_ary
+ *     ary.zip(arg, ...) { |arr| block }  -> nil
+ *
+ *  Converts any arguments to arrays, then merges elements of +self+ with
+ *  corresponding elements from each argument.
+ *
+ *  This generates a sequence of <code>ary.size</code> _n_-element arrays,
+ *  where _n_ is one more than the count of arguments.
+ *
+ *  If the size of any argument is less than the size of the initial array,
+ *  +nil+ values are supplied.
+ *
+ *  If a block is given, it is invoked for each output +array+, otherwise an
+ *  array of arrays is returned.
+ *
  *     a = [ 4, 5, 6 ]
  *     b = [ 7, 8, 9 ]
- *     
- *     [1,2,3].zip(a, b)      #=> [[1, 4, 7], [2, 5, 8], [3, 6, 9]]
- *     [1,2].zip(a,b)         #=> [[1, 4, 7], [2, 5, 8]]
- *     a.zip([1,2],[8])       #=> [[4,1,8], [5,2,nil], [6,nil,nil]]
+ *     [1, 2, 3].zip(a, b)   #=> [[1, 4, 7], [2, 5, 8], [3, 6, 9]]
+ *     [1, 2].zip(a, b)      #=> [[1, 4, 7], [2, 5, 8]]
+ *     a.zip([1, 2], [8])    #=> [[4, 1, 8], [5, 2, nil], [6, nil, nil]]
  */
 
 static VALUE
-rb_ary_zip(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+rb_ary_zip(int argc, VALUE *argv, VALUE ary)
 {
     int i, j;
-    long len;
-    VALUE result;
+    long len = RARRAY_LEN(ary);
+    VALUE result = Qnil;
 
     for (i=0; i<argc; i++) {
-	argv[i] = to_ary(argv[i]);
+	argv[i] = take_items(argv[i], len);
     }
+
     if (rb_block_given_p()) {
-	for (i=0; i<RARRAY(ary)->len; i++) {
-	    VALUE tmp = rb_ary_new2(argc+1);
+	int arity = rb_block_arity();
 
-	    rb_ary_push(tmp, rb_ary_elt(ary, i));
-	    for (j=0; j<argc; j++) {
-		rb_ary_push(tmp, rb_ary_elt(argv[j], i));
+	if (arity > 1) {
+	    VALUE work, *tmp;
+
+	    tmp = ALLOCV_N(VALUE, work, argc+1);
+
+	    for (i=0; i<RARRAY_LEN(ary); i++) {
+		tmp[0] = RARRAY_AREF(ary, i);
+		for (j=0; j<argc; j++) {
+		    tmp[j+1] = rb_ary_elt(argv[j], i);
+		}
+		rb_yield_values2(argc+1, tmp);
+	    }
+
+	    if (work) ALLOCV_END(work);
+	}
+	else {
+	    for (i=0; i<RARRAY_LEN(ary); i++) {
+		VALUE tmp = rb_ary_new2(argc+1);
+
+		rb_ary_push(tmp, RARRAY_AREF(ary, i));
+		for (j=0; j<argc; j++) {
+		    rb_ary_push(tmp, rb_ary_elt(argv[j], i));
+		}
+		rb_yield(tmp);
 	    }
-	    rb_yield(tmp);
 	}
-	return Qnil;
     }
-    len = RARRAY(ary)->len;
-    result = rb_ary_new2(len);
-    for (i=0; i<len; i++) {
-	VALUE tmp = rb_ary_new2(argc+1);
+    else {
+	result = rb_ary_new_capa(len);
 
-	rb_ary_push(tmp, rb_ary_elt(ary, i));
-	for (j=0; j<argc; j++) {
-	    rb_ary_push(tmp, rb_ary_elt(argv[j], i));
+	for (i=0; i<len; i++) {
+	    VALUE tmp = rb_ary_new_capa(argc+1);
+
+	    rb_ary_push(tmp, RARRAY_AREF(ary, i));
+	    for (j=0; j<argc; j++) {
+		rb_ary_push(tmp, rb_ary_elt(argv[j], i));
+	    }
+	    rb_ary_push(result, tmp);
 	}
-	rb_ary_push(result, tmp);
     }
+
     return result;
 }
 
 /*
  *  call-seq:
- *     array.transpose -> an_array
- *  
- *  Assumes that <i>self</i> is an array of arrays and transposes the
- *  rows and columns.
- *     
+ *     ary.transpose -> new_ary
+ *
+ *  Assumes that +self+ is an array of arrays and transposes the rows and
+ *  columns.
+ *
  *     a = [[1,2], [3,4], [5,6]]
  *     a.transpose   #=> [[1, 3, 5], [2, 4, 6]]
+ *
+ *  If the length of the subarrays don't match, an IndexError is raised.
  */
 
 static VALUE
-rb_ary_transpose(ary)
-    VALUE ary;
+rb_ary_transpose(VALUE ary)
 {
     long elen = -1, alen, i, j;
     VALUE tmp, result = 0;
 
-    alen = RARRAY(ary)->len;
+    alen = RARRAY_LEN(ary);
     if (alen == 0) return rb_ary_dup(ary);
     for (i=0; i<alen; i++) {
 	tmp = to_ary(rb_ary_elt(ary, i));
 	if (elen < 0) {		/* first element */
-	    elen = RARRAY(tmp)->len;
+	    elen = RARRAY_LEN(tmp);
 	    result = rb_ary_new2(elen);
 	    for (j=0; j<elen; j++) {
 		rb_ary_store(result, j, rb_ary_new2(alen));
 	    }
 	}
-	else if (elen != RARRAY(tmp)->len) {
-	    rb_raise(rb_eIndexError, "element size differs (%d should be %d)",
-		     RARRAY(tmp)->len, elen);
+	else if (elen != RARRAY_LEN(tmp)) {
+	    rb_raise(rb_eIndexError, "element size differs (%ld should be %ld)",
+		     RARRAY_LEN(tmp), elen);
 	}
 	for (j=0; j<elen; j++) {
 	    rb_ary_store(rb_ary_elt(result, j), i, rb_ary_elt(tmp, j));
@@ -2149,96 +3421,123 @@ rb_ary_transpose(ary)
 
 /*
  *  call-seq:
- *     array.replace(other_array)  -> array
- *  
- *  Replaces the contents of <i>self</i> with the contents of
- *  <i>other_array</i>, truncating or expanding if necessary.
- *     
+ *     ary.replace(other_ary)  -> ary
+ *     ary.initialize_copy(other_ary)	-> ary
+ *
+ *  Replaces the contents of +self+ with the contents of +other_ary+,
+ *  truncating or expanding if necessary.
+ *
  *     a = [ "a", "b", "c", "d", "e" ]
  *     a.replace([ "x", "y", "z" ])   #=> ["x", "y", "z"]
  *     a                              #=> ["x", "y", "z"]
  */
 
-static VALUE
-rb_ary_replace(copy, orig)
-    VALUE copy, orig;
+VALUE
+rb_ary_replace(VALUE copy, VALUE orig)
 {
-    VALUE shared;
-
-    rb_ary_modify(copy);
+    rb_ary_modify_check(copy);
     orig = to_ary(orig);
     if (copy == orig) return copy;
-    shared = ary_make_shared(orig);
-    if (RARRAY(copy)->ptr && !FL_TEST(copy, ELTS_SHARED))
-	free(RARRAY(copy)->ptr);
-    RARRAY(copy)->ptr = RARRAY(orig)->ptr;
-    RARRAY(copy)->len = RARRAY(orig)->len;
-    RARRAY(copy)->aux.shared = shared;
-    FL_SET(copy, ELTS_SHARED);
 
+    if (RARRAY_LEN(orig) <= RARRAY_EMBED_LEN_MAX) {
+        VALUE shared = 0;
+
+        if (ARY_OWNS_HEAP_P(copy)) {
+	    RARRAY_PTR_USE(copy, ptr, ruby_sized_xfree(ptr, ARY_HEAP_SIZE(copy)));
+	}
+        else if (ARY_SHARED_P(copy)) {
+            shared = ARY_SHARED(copy);
+            FL_UNSET_SHARED(copy);
+        }
+        FL_SET_EMBED(copy);
+	ary_memcpy(copy, 0, RARRAY_LEN(orig), RARRAY_CONST_PTR(orig));
+        if (shared) {
+            rb_ary_decrement_share(shared);
+        }
+        ARY_SET_LEN(copy, RARRAY_LEN(orig));
+    }
+    else {
+        VALUE shared = ary_make_shared(orig);
+        if (ARY_OWNS_HEAP_P(copy)) {
+	    RARRAY_PTR_USE(copy, ptr, ruby_sized_xfree(ptr, ARY_HEAP_SIZE(copy)));
+        }
+        else {
+            rb_ary_unshare_safe(copy);
+        }
+        FL_UNSET_EMBED(copy);
+        ARY_SET_PTR(copy, RARRAY_CONST_PTR(orig));
+        ARY_SET_LEN(copy, RARRAY_LEN(orig));
+        rb_ary_set_shared(copy, shared);
+    }
     return copy;
 }
 
-/* 
+/*
  *  call-seq:
- *     array.clear    ->  array
+ *     ary.clear    -> ary
  *
- *  Removes all elements from _self_.
+ *  Removes all elements from +self+.
  *
  *     a = [ "a", "b", "c", "d", "e" ]
  *     a.clear    #=> [ ]
  */
 
 VALUE
-rb_ary_clear(ary)
-    VALUE ary;
+rb_ary_clear(VALUE ary)
 {
-    rb_ary_modify(ary);
-    RARRAY(ary)->len = 0;
-    if (ARY_DEFAULT_SIZE * 2 < RARRAY(ary)->aux.capa) {
-	REALLOC_N(RARRAY(ary)->ptr, VALUE, ARY_DEFAULT_SIZE * 2);
-	RARRAY(ary)->aux.capa = ARY_DEFAULT_SIZE * 2;
+    rb_ary_modify_check(ary);
+    ARY_SET_LEN(ary, 0);
+    if (ARY_SHARED_P(ary)) {
+	if (!ARY_EMBED_P(ary)) {
+	    rb_ary_unshare(ary);
+	    FL_SET_EMBED(ary);
+	}
+    }
+    else if (ARY_DEFAULT_SIZE * 2 < ARY_CAPA(ary)) {
+	ary_resize_capa(ary, ARY_DEFAULT_SIZE * 2);
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *     array.fill(obj)                                -> array
- *     array.fill(obj, start [, length])              -> array
- *     array.fill(obj, range )                        -> array
- *     array.fill {|index| block }                    -> array
- *     array.fill(start [, length] ) {|index| block } -> array
- *     array.fill(range) {|index| block }             -> array
- *  
- *  The first three forms set the selected elements of <i>self</i> (which
- *  may be the entire array) to <i>obj</i>. A <i>start</i> of
- *  <code>nil</code> is equivalent to zero. A <i>length</i> of
- *  <code>nil</code> is equivalent to <i>self.length</i>. The last three
- *  forms fill the array with the value of the block. The block is
- *  passed the absolute index of each element to be filled.
- *     
+ *     ary.fill(obj)                                 -> ary
+ *     ary.fill(obj, start [, length])               -> ary
+ *     ary.fill(obj, range )                         -> ary
+ *     ary.fill { |index| block }                    -> ary
+ *     ary.fill(start [, length] ) { |index| block } -> ary
+ *     ary.fill(range) { |index| block }             -> ary
+ *
+ *  The first three forms set the selected elements of +self+ (which
+ *  may be the entire array) to +obj+.
+ *
+ *  A +start+ of +nil+ is equivalent to zero.
+ *
+ *  A +length+ of +nil+ is equivalent to the length of the array.
+ *
+ *  The last three forms fill the array with the value of the given block,
+ *  which is passed the absolute index of each element to be filled.
+ *
+ *  Negative values of +start+ count from the end of the array, where +-1+ is
+ *  the last element.
+ *
  *     a = [ "a", "b", "c", "d" ]
  *     a.fill("x")              #=> ["x", "x", "x", "x"]
  *     a.fill("z", 2, 2)        #=> ["x", "x", "z", "z"]
  *     a.fill("y", 0..1)        #=> ["y", "y", "z", "z"]
- *     a.fill {|i| i*i}         #=> [0, 1, 4, 9]
- *     a.fill(-2) {|i| i*i*i}   #=> [0, 1, 8, 27]
+ *     a.fill { |i| i*i }       #=> [0, 1, 4, 9]
+ *     a.fill(-2) { |i| i*i*i } #=> [0, 1, 8, 27]
  */
 
 static VALUE
-rb_ary_fill(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    VALUE ary;
+rb_ary_fill(int argc, VALUE *argv, VALUE ary)
 {
     VALUE item, arg1, arg2;
     long beg = 0, end = 0, len = 0;
-    VALUE *p, *pend;
-    int block_p = Qfalse;
+    int block_p = FALSE;
 
     if (rb_block_given_p()) {
-	block_p = Qtrue;
+	block_p = TRUE;
 	rb_scan_args(argc, argv, "02", &arg1, &arg2);
 	argc += 1;		/* hackish */
     }
@@ -2248,34 +3547,36 @@ rb_ary_fill(argc, argv, ary)
     switch (argc) {
       case 1:
 	beg = 0;
-	len = RARRAY(ary)->len;
+	len = RARRAY_LEN(ary);
 	break;
       case 2:
-	if (rb_range_beg_len(arg1, &beg, &len, RARRAY(ary)->len, 1)) {
+	if (rb_range_beg_len(arg1, &beg, &len, RARRAY_LEN(ary), 1)) {
 	    break;
 	}
 	/* fall through */
       case 3:
 	beg = NIL_P(arg1) ? 0 : NUM2LONG(arg1);
 	if (beg < 0) {
-	    beg = RARRAY(ary)->len + beg;
+	    beg = RARRAY_LEN(ary) + beg;
 	    if (beg < 0) beg = 0;
 	}
-	len = NIL_P(arg2) ? RARRAY(ary)->len - beg : NUM2LONG(arg2);
+	len = NIL_P(arg2) ? RARRAY_LEN(ary) - beg : NUM2LONG(arg2);
 	break;
     }
     rb_ary_modify(ary);
-    end = beg + len;
-    if (end < 0) {
+    if (len < 0) {
+        return ary;
+    }
+    if (beg >= ARY_MAX_SIZE || len > ARY_MAX_SIZE - beg) {
 	rb_raise(rb_eArgError, "argument too big");
     }
-    if (end > RARRAY(ary)->len) {
-	if (end >= RARRAY(ary)->aux.capa) {
-	    REALLOC_N(RARRAY(ary)->ptr, VALUE, end);
-	    RARRAY(ary)->aux.capa = end;
+    end = beg + len;
+    if (RARRAY_LEN(ary) < end) {
+	if (end >= ARY_CAPA(ary)) {
+	    ary_resize_capa(ary, end);
 	}
-	rb_mem_clear(RARRAY(ary)->ptr + RARRAY(ary)->len, end - RARRAY(ary)->len);
-	RARRAY(ary)->len = end;
+	ary_mem_clear(ary, RARRAY_LEN(ary), end - RARRAY_LEN(ary));
+	ARY_SET_LEN(ary, end);
     }
 
     if (block_p) {
@@ -2284,76 +3585,93 @@ rb_ary_fill(argc, argv, ary)
 
 	for (i=beg; i<end; i++) {
 	    v = rb_yield(LONG2NUM(i));
-	    if (i>=RARRAY(ary)->len) break;
-	    RARRAY(ary)->ptr[i] = v;
+	    if (i>=RARRAY_LEN(ary)) break;
+	    ARY_SET(ary, i, v);
 	}
     }
     else {
-	p = RARRAY(ary)->ptr + beg;
-	pend = p + len;
-	while (p < pend) {
-	    *p++ = item;
-	}
+	ary_memfill(ary, beg, len, item);
     }
     return ary;
 }
 
-/* 
+/*
  *  call-seq:
- *     array + other_array   -> an_array
+ *     ary + other_ary   -> new_ary
  *
- *  Concatenation---Returns a new array built by concatenating the
+ *  Concatenation --- Returns a new array built by concatenating the
  *  two arrays together to produce a third array.
- * 
+ *
  *     [ 1, 2, 3 ] + [ 4, 5 ]    #=> [ 1, 2, 3, 4, 5 ]
+ *     a = [ "a", "b", "c" ]
+ *     c = a + [ "d", "e", "f" ]
+ *     c                         #=> [ "a", "b", "c", "d", "e", "f" ]
+ *     a                         #=> [ "a", "b", "c" ]
+ *
+ *  Note that
+ *     x += y
+ *  is the same as
+ *     x = x + y
+ *  This means that it produces a new array. As a consequence,
+ *  repeated use of <code>+=</code> on arrays can be quite inefficient.
+ *
+ *  See also Array#concat.
  */
 
 VALUE
-rb_ary_plus(x, y)
-    VALUE x, y;
+rb_ary_plus(VALUE x, VALUE y)
 {
     VALUE z;
-    long len;
+    long len, xlen, ylen;
 
     y = to_ary(y);
-    len = RARRAY(x)->len + RARRAY(y)->len;
+    xlen = RARRAY_LEN(x);
+    ylen = RARRAY_LEN(y);
+    len = xlen + ylen;
     z = rb_ary_new2(len);
-    MEMCPY(RARRAY(z)->ptr, RARRAY(x)->ptr, VALUE, RARRAY(x)->len);
-    MEMCPY(RARRAY(z)->ptr + RARRAY(x)->len, RARRAY(y)->ptr, VALUE, RARRAY(y)->len);
-    RARRAY(z)->len = len;
+
+    ary_memcpy(z, 0, xlen, RARRAY_CONST_PTR(x));
+    ary_memcpy(z, xlen, ylen, RARRAY_CONST_PTR(y));
+    ARY_SET_LEN(z, len);
     return z;
 }
 
-/* 
+/*
  *  call-seq:
- *     array.concat(other_array)   ->  array
+ *     ary.concat(other_ary)   -> ary
+ *
+ *  Appends the elements of +other_ary+ to +self+.
  *
- *  Appends the elements in other_array to _self_.
- *  
  *     [ "a", "b" ].concat( ["c", "d"] ) #=> [ "a", "b", "c", "d" ]
+ *     a = [ 1, 2, 3 ]
+ *     a.concat( [ 4, 5 ] )
+ *     a                                 #=> [ 1, 2, 3, 4, 5 ]
+ *
+ *  See also Array#+.
  */
 
-
 VALUE
-rb_ary_concat(x, y)
-    VALUE x, y;
+rb_ary_concat(VALUE x, VALUE y)
 {
+    rb_ary_modify_check(x);
     y = to_ary(y);
-    if (RARRAY(y)->len > 0) {
-	rb_ary_splice(x, RARRAY(x)->len, 0, y);
+    if (RARRAY_LEN(y) > 0) {
+	rb_ary_splice(x, RARRAY_LEN(x), 0, y);
     }
     return x;
 }
 
 
-/* 
+/*
  *  call-seq:
- *     array * int     ->    an_array
- *     array * str     ->    a_string
+ *     ary * int     -> new_ary
+ *     ary * str     -> new_string
+ *
+ *  Repetition --- With a String argument, equivalent to
+ *  <code>ary.join(str)</code>.
  *
- *  Repetition---With a String argument, equivalent to
- *  self.join(str). Otherwise, returns a new array
- *  built by concatenating the _int_ copies of _self_.
+ *  Otherwise, returns a new array built by concatenating the +int+ copies of
+ *  +self+.
  *
  *
  *     [ 1, 2, 3 ] * 3    #=> [ 1, 2, 3, 1, 2, 3, 1, 2, 3 ]
@@ -2362,11 +3680,11 @@ rb_ary_concat(x, y)
  */
 
 static VALUE
-rb_ary_times(ary, times)
-    VALUE ary, times;
+rb_ary_times(VALUE ary, VALUE times)
 {
     VALUE ary2, tmp;
-    long i, len;
+    const VALUE *ptr;
+    long t, len;
 
     tmp = rb_check_string_type(times);
     if (!NIL_P(tmp)) {
@@ -2374,37 +3692,50 @@ rb_ary_times(ary, times)
     }
 
     len = NUM2LONG(times);
-    if (len == 0) return ary_new(rb_obj_class(ary), 0);
+    if (len == 0) {
+	ary2 = ary_new(rb_obj_class(ary), 0);
+	goto out;
+    }
     if (len < 0) {
 	rb_raise(rb_eArgError, "negative argument");
     }
-    if (LONG_MAX/len < RARRAY(ary)->len) {
+    if (ARY_MAX_SIZE/len < RARRAY_LEN(ary)) {
 	rb_raise(rb_eArgError, "argument too big");
     }
-    len *= RARRAY(ary)->len;
+    len *= RARRAY_LEN(ary);
 
     ary2 = ary_new(rb_obj_class(ary), len);
-    RARRAY(ary2)->len = len;
-
-    for (i=0; i<len; i+=RARRAY(ary)->len) {
-	MEMCPY(RARRAY(ary2)->ptr+i, RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
-    }
+    ARY_SET_LEN(ary2, len);
+
+    ptr = RARRAY_CONST_PTR(ary);
+    t = RARRAY_LEN(ary);
+    if (0 < t) {
+	ary_memcpy(ary2, 0, t, ptr);
+	while (t <= len/2) {
+	    ary_memcpy(ary2, t, t, RARRAY_CONST_PTR(ary2));
+            t *= 2;
+        }
+        if (t < len) {
+	    ary_memcpy(ary2, t, len-t, RARRAY_CONST_PTR(ary2));
+        }
+    }
+  out:
     OBJ_INFECT(ary2, ary);
 
     return ary2;
 }
 
-/* 
+/*
  *  call-seq:
- *     array.assoc(obj)   ->  an_array  or  nil
+ *     ary.assoc(obj)   -> element_ary  or  nil
  *
- *  Searches through an array whose elements are also arrays
- *  comparing _obj_ with the first element of each contained array
- *  using obj.==.
- *  Returns the first contained array that matches (that
- *  is, the first associated array),
- *  or +nil+ if no match is found.
- *  See also <code>Array#rassoc</code>.
+ *  Searches through an array whose elements are also arrays comparing +obj+
+ *  with the first element of each contained array using <code>obj.==</code>.
+ *
+ *  Returns the first contained array that matches (that is, the first
+ *  associated array), or +nil+ if no match is found.
+ *
+ *  See also Array#rassoc
  *
  *     s1 = [ "colors", "red", "blue", "green" ]
  *     s2 = [ "letters", "a", "b", "c" ]
@@ -2415,17 +3746,15 @@ rb_ary_times(ary, times)
  */
 
 VALUE
-rb_ary_assoc(ary, key)
-    VALUE ary, key;
+rb_ary_assoc(VALUE ary, VALUE key)
 {
     long i;
     VALUE v;
 
-    for (i = 0; i < RARRAY(ary)->len; ++i) {
-	v = RARRAY(ary)->ptr[i];
-	if (TYPE(v) == T_ARRAY &&
-	    RARRAY(v)->len > 0 &&
-	    rb_equal(RARRAY(v)->ptr[0], key))
+    for (i = 0; i < RARRAY_LEN(ary); ++i) {
+	v = rb_check_array_type(RARRAY_AREF(ary, i));
+	if (!NIL_P(v) && RARRAY_LEN(v) > 0 &&
+	    rb_equal(RARRAY_AREF(v, 0), key))
 	    return v;
     }
     return Qnil;
@@ -2433,42 +3762,78 @@ rb_ary_assoc(ary, key)
 
 /*
  *  call-seq:
- *     array.rassoc(key) -> an_array or nil
- *  
- *  Searches through the array whose elements are also arrays. Compares
- *  <em>key</em> with the second element of each contained array using
- *  <code>==</code>. Returns the first contained array that matches. See
- *  also <code>Array#assoc</code>.
- *     
+ *     ary.rassoc(obj) -> element_ary or nil
+ *
+ *  Searches through the array whose elements are also arrays.
+ *
+ *  Compares +obj+ with the second element of each contained array using
+ *  <code>obj.==</code>.
+ *
+ *  Returns the first contained array that matches +obj+.
+ *
+ *  See also Array#assoc.
+ *
  *     a = [ [ 1, "one"], [2, "two"], [3, "three"], ["ii", "two"] ]
  *     a.rassoc("two")    #=> [2, "two"]
  *     a.rassoc("four")   #=> nil
  */
 
 VALUE
-rb_ary_rassoc(ary, value)
-    VALUE ary, value;
+rb_ary_rassoc(VALUE ary, VALUE value)
 {
     long i;
     VALUE v;
 
-    for (i = 0; i < RARRAY(ary)->len; ++i) {
-	v = RARRAY(ary)->ptr[i];
-	if (TYPE(v) == T_ARRAY &&
-	    RARRAY(v)->len > 1 &&
-	    rb_equal(RARRAY(v)->ptr[1], value))
+    for (i = 0; i < RARRAY_LEN(ary); ++i) {
+	v = RARRAY_AREF(ary, i);
+	if (RB_TYPE_P(v, T_ARRAY) &&
+	    RARRAY_LEN(v) > 1 &&
+	    rb_equal(RARRAY_AREF(v, 1), value))
 	    return v;
     }
     return Qnil;
 }
 
-/* 
+static VALUE
+recursive_equal(VALUE ary1, VALUE ary2, int recur)
+{
+    long i, len1;
+    const VALUE *p1, *p2;
+
+    if (recur) return Qtrue; /* Subtle! */
+
+    p1 = RARRAY_CONST_PTR(ary1);
+    p2 = RARRAY_CONST_PTR(ary2);
+    len1 = RARRAY_LEN(ary1);
+
+    for (i = 0; i < len1; i++) {
+	if (*p1 != *p2) {
+	    if (rb_equal(*p1, *p2)) {
+		len1 = RARRAY_LEN(ary1);
+		if (len1 != RARRAY_LEN(ary2))
+		    return Qfalse;
+		if (len1 < i)
+		    return Qtrue;
+		p1 = RARRAY_CONST_PTR(ary1) + i;
+		p2 = RARRAY_CONST_PTR(ary2) + i;
+	    }
+	    else {
+		return Qfalse;
+	    }
+	}
+	p1++;
+	p2++;
+    }
+    return Qtrue;
+}
+
+/*
  *  call-seq:
- *     array == other_array   ->   bool
+ *     ary == other_ary   ->   bool
  *
- *  Equality---Two arrays are equal if they contain the same number
- *  of elements and if each element is equal to (according to
- *  Object.==) the corresponding element in the other array.
+ *  Equality --- Two arrays are equal if they contain the same number of
+ *  elements and if each element is equal to (according to Object#==) the
+ *  corresponding element in +other_ary+.
  *
  *     [ "a", "c" ]    == [ "a", "c", 7 ]     #=> false
  *     [ "a", "c", 7 ] == [ "a", "c", 7 ]     #=> true
@@ -2477,21 +3842,28 @@ rb_ary_rassoc(ary, value)
  */
 
 static VALUE
-rb_ary_equal(ary1, ary2)
-    VALUE ary1, ary2;
+rb_ary_equal(VALUE ary1, VALUE ary2)
 {
-    long i;
-
     if (ary1 == ary2) return Qtrue;
-    if (TYPE(ary2) != T_ARRAY) {
-	if (!rb_respond_to(ary2, rb_intern("to_ary"))) {
+    if (!RB_TYPE_P(ary2, T_ARRAY)) {
+	if (!rb_respond_to(ary2, idTo_ary)) {
 	    return Qfalse;
 	}
 	return rb_equal(ary2, ary1);
     }
-    if (RARRAY(ary1)->len != RARRAY(ary2)->len) return Qfalse;
-    for (i=0; i<RARRAY(ary1)->len; i++) {
-	if (!rb_equal(rb_ary_elt(ary1, i), rb_ary_elt(ary2, i)))
+    if (RARRAY_LEN(ary1) != RARRAY_LEN(ary2)) return Qfalse;
+    if (RARRAY_CONST_PTR(ary1) == RARRAY_CONST_PTR(ary2)) return Qtrue;
+    return rb_exec_recursive_paired(recursive_equal, ary1, ary2, ary2);
+}
+
+static VALUE
+recursive_eql(VALUE ary1, VALUE ary2, int recur)
+{
+    long i;
+
+    if (recur) return Qtrue; /* Subtle! */
+    for (i=0; i<RARRAY_LEN(ary1); i++) {
+	if (!rb_eql(rb_ary_elt(ary1, i), rb_ary_elt(ary2, i)))
 	    return Qfalse;
     }
     return Qtrue;
@@ -2499,74 +3871,76 @@ rb_ary_equal(ary1, ary2)
 
 /*
  *  call-seq:
- *     array.eql?(other)  -> true or false
+ *     ary.eql?(other)  -> true or false
  *
- *  Returns <code>true</code> if _array_ and _other_ are the same object,
- *  or are both arrays with the same content.
+ *  Returns +true+ if +self+ and +other+ are the same object,
+ *  or are both arrays with the same content (according to Object#eql?).
  */
 
 static VALUE
-rb_ary_eql(ary1, ary2)
-    VALUE ary1, ary2;
+rb_ary_eql(VALUE ary1, VALUE ary2)
 {
-    long i;
-
     if (ary1 == ary2) return Qtrue;
-    if (TYPE(ary2) != T_ARRAY) return Qfalse;
-    if (RARRAY(ary1)->len != RARRAY(ary2)->len) return Qfalse;
-    for (i=0; i<RARRAY(ary1)->len; i++) {
-	if (!rb_eql(rb_ary_elt(ary1, i), rb_ary_elt(ary2, i)))
-	    return Qfalse;
-    }
-    return Qtrue;
+    if (!RB_TYPE_P(ary2, T_ARRAY)) return Qfalse;
+    if (RARRAY_LEN(ary1) != RARRAY_LEN(ary2)) return Qfalse;
+    if (RARRAY_CONST_PTR(ary1) == RARRAY_CONST_PTR(ary2)) return Qtrue;
+    return rb_exec_recursive_paired(recursive_eql, ary1, ary2, ary2);
 }
 
 /*
  *  call-seq:
- *     array.hash   -> fixnum
+ *     ary.hash   -> fixnum
  *
- *  Compute a hash-code for this array. Two arrays with the same content
- *  will have the same hash code (and will compare using <code>eql?</code>).
+ *  Compute a hash-code for this array.
+ *
+ *  Two arrays with the same content will have the same hash code (and will
+ *  compare using #eql?).
+ *
+ *  See also Object#hash.
  */
 
 static VALUE
-rb_ary_hash(ary)
-    VALUE ary;
+rb_ary_hash(VALUE ary)
 {
-    long i, h;
+    long i;
+    st_index_t h;
     VALUE n;
 
-    h = RARRAY(ary)->len;
-    for (i=0; i<RARRAY(ary)->len; i++) {
-	h = (h << 1) | (h<0 ? 1 : 0);
-	n = rb_hash(RARRAY(ary)->ptr[i]);
-	h ^= NUM2LONG(n);
+    h = rb_hash_start(RARRAY_LEN(ary));
+    h = rb_hash_uint(h, (st_index_t)rb_ary_hash);
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+	n = rb_hash(RARRAY_AREF(ary, i));
+	h = rb_hash_uint(h, NUM2LONG(n));
     }
+    h = rb_hash_end(h);
     return LONG2FIX(h);
 }
 
 /*
  *  call-seq:
- *     array.include?(obj)   -> true or false
- *  
- *  Returns <code>true</code> if the given object is present in
- *  <i>self</i> (that is, if any object <code>==</code> <i>anObject</i>),
- *  <code>false</code> otherwise.
- *     
+ *     ary.include?(object)   -> true or false
+ *
+ *  Returns +true+ if the given +object+ is present in +self+ (that is, if any
+ *  element <code>==</code> +object+), otherwise returns +false+.
+ *
  *     a = [ "a", "b", "c" ]
  *     a.include?("b")   #=> true
  *     a.include?("z")   #=> false
  */
 
 VALUE
-rb_ary_includes(ary, item)
-    VALUE ary;
-    VALUE item;
+rb_ary_includes(VALUE ary, VALUE item)
 {
     long i;
-    
-    for (i=0; i<RARRAY(ary)->len; i++) {
-	if (rb_equal(RARRAY(ary)->ptr[i], item)) {
+    VALUE e;
+
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+	e = RARRAY_AREF(ary, i);
+	switch (rb_equal_opt(e, item)) {
+	  case Qundef:
+	    if (rb_equal(e, item)) return Qtrue;
+	    break;
+	  case Qtrue:
 	    return Qtrue;
 	}
     }
@@ -2574,271 +3948,409 @@ rb_ary_includes(ary, item)
 }
 
 
-/* 
+static VALUE
+recursive_cmp(VALUE ary1, VALUE ary2, int recur)
+{
+    long i, len;
+
+    if (recur) return Qundef;	/* Subtle! */
+    len = RARRAY_LEN(ary1);
+    if (len > RARRAY_LEN(ary2)) {
+	len = RARRAY_LEN(ary2);
+    }
+    for (i=0; i<len; i++) {
+	VALUE e1 = rb_ary_elt(ary1, i), e2 = rb_ary_elt(ary2, i);
+	VALUE v = rb_funcallv(e1, id_cmp, 1, &e2);
+	if (v != INT2FIX(0)) {
+	    return v;
+	}
+    }
+    return Qundef;
+}
+
+/*
  *  call-seq:
- *     array <=> other_array   ->  -1, 0, +1
+ *     ary <=> other_ary   ->  -1, 0, +1 or nil
+ *
+ *  Comparison --- Returns an integer (+-1+, +0+, or <code>+1</code>) if this
+ *  array is less than, equal to, or greater than +other_ary+.
+ *
+ *  Each object in each array is compared (using the <=> operator).
+ *
+ *  Arrays are compared in an "element-wise" manner; the first element of +ary+
+ *  is compared with the first one of +other_ary+ using the <=> operator, then
+ *  each of the second elements, etc...
+ *  As soon as the result of any such comparison is non zero (i.e. the two
+ *  corresponding elements are not equal), that result is returned for the
+ *  whole array comparison.
+ *
+ *  If all the elements are equal, then the result is based on a comparison of
+ *  the array lengths. Thus, two arrays are "equal" according to Array#<=> if,
+ *  and only if, they have the same length and the value of each element is
+ *  equal to the value of the corresponding element in the other array.
+ *
+ *  +nil+ is returned if the +other_ary+ is not an array or if the comparison
+ *  of two elements returned +nil+.
  *
- *  Comparison---Returns an integer (-1, 0,
- *  or +1) if this array is less than, equal to, or greater than
- *  other_array.  Each object in each array is compared
- *  (using <=>). If any value isn't
- *  equal, then that inequality is the return value. If all the
- *  values found are equal, then the return is based on a
- *  comparison of the array lengths.  Thus, two arrays are
- *  ``equal'' according to <code>Array#<=></code> if and only if they have
- *  the same length and the value of each element is equal to the
- *  value of the corresponding element in the other array.
- *  
  *     [ "a", "a", "c" ]    <=> [ "a", "b", "c" ]   #=> -1
  *     [ 1, 2, 3, 4, 5, 6 ] <=> [ 1, 2 ]            #=> +1
+ *     [ 1, 2 ]             <=> [ 1, :two ]         #=> nil
  *
  */
 
 VALUE
-rb_ary_cmp(ary1, ary2)
-    VALUE ary1, ary2;
+rb_ary_cmp(VALUE ary1, VALUE ary2)
 {
-    long i, len;
+    long len;
+    VALUE v;
 
-    ary2 = to_ary(ary2);
-    len = RARRAY(ary1)->len;
-    if (len > RARRAY(ary2)->len) {
-	len = RARRAY(ary2)->len;
-    }
-    for (i=0; i<len; i++) {
-	VALUE v = rb_funcall(rb_ary_elt(ary1, i), id_cmp, 1, rb_ary_elt(ary2, i));
-	if (v != INT2FIX(0)) {
-	    return v;
-	}
-    }
-    len = RARRAY(ary1)->len - RARRAY(ary2)->len;
+    ary2 = rb_check_array_type(ary2);
+    if (NIL_P(ary2)) return Qnil;
+    if (ary1 == ary2) return INT2FIX(0);
+    v = rb_exec_recursive_paired(recursive_cmp, ary1, ary2, ary2);
+    if (v != Qundef) return v;
+    len = RARRAY_LEN(ary1) - RARRAY_LEN(ary2);
     if (len == 0) return INT2FIX(0);
     if (len > 0) return INT2FIX(1);
     return INT2FIX(-1);
 }
 
 static VALUE
-ary_make_hash(ary1, ary2)
-    VALUE ary1, ary2;
+ary_add_hash(VALUE hash, VALUE ary)
 {
-    VALUE hash = rb_hash_new();
     long i;
 
-    for (i=0; i<RARRAY(ary1)->len; i++) {
-	rb_hash_aset(hash, RARRAY(ary1)->ptr[i], Qtrue);
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+	VALUE elt = RARRAY_AREF(ary, i);
+	if (rb_hash_lookup2(hash, elt, Qundef) == Qundef) {
+	    rb_hash_aset(hash, elt, elt);
+	}
     }
-    if (ary2) {
-	for (i=0; i<RARRAY(ary2)->len; i++) {
-	    rb_hash_aset(hash, RARRAY(ary2)->ptr[i], Qtrue);
+    return hash;
+}
+
+static inline VALUE
+ary_tmp_hash_new(void)
+{
+    VALUE hash = rb_hash_new();
+
+    RBASIC_CLEAR_CLASS(hash);
+    return hash;
+}
+
+static VALUE
+ary_make_hash(VALUE ary)
+{
+    VALUE hash = ary_tmp_hash_new();
+    return ary_add_hash(hash, ary);
+}
+
+static VALUE
+ary_add_hash_by(VALUE hash, VALUE ary)
+{
+    long i;
+
+    for (i = 0; i < RARRAY_LEN(ary); ++i) {
+	VALUE v = rb_ary_elt(ary, i), k = rb_yield(v);
+	if (rb_hash_lookup2(hash, k, Qundef) == Qundef) {
+	    rb_hash_aset(hash, k, v);
 	}
     }
     return hash;
 }
 
-/* 
+static VALUE
+ary_make_hash_by(VALUE ary)
+{
+    VALUE hash = ary_tmp_hash_new();
+    return ary_add_hash_by(hash, ary);
+}
+
+static inline void
+ary_recycle_hash(VALUE hash)
+{
+    if (RHASH(hash)->ntbl) {
+	st_table *tbl = RHASH(hash)->ntbl;
+	RHASH(hash)->ntbl = 0;
+	st_free_table(tbl);
+    }
+    RB_GC_GUARD(hash);
+}
+
+/*
  *  call-seq:
- *     array - other_array    -> an_array
+ *     ary - other_ary    -> new_ary
+ *
+ *  Array Difference
+ *
+ *  Returns a new array that is a copy of the original array, removing any
+ *  items that also appear in +other_ary+. The order is preserved from the
+ *  original array.
  *
- *  Array Difference---Returns a new array that is a copy of
- *  the original array, removing any items that also appear in
- *  other_array. (If you need set-like behavior, see the
- *  library class Set.)
+ *  It compares elements using their #hash and #eql? methods for efficiency.
  *
  *     [ 1, 1, 2, 2, 3, 3, 4, 5 ] - [ 1, 2, 4 ]  #=>  [ 3, 3, 5 ]
+ *
+ *  If you need set-like behavior, see the library class Set.
  */
 
 static VALUE
-rb_ary_diff(ary1, ary2)
-    VALUE ary1, ary2;
+rb_ary_diff(VALUE ary1, VALUE ary2)
 {
     VALUE ary3;
-    volatile VALUE hash;
+    VALUE hash;
     long i;
 
-    hash = ary_make_hash(to_ary(ary2), 0);
+    hash = ary_make_hash(to_ary(ary2));
     ary3 = rb_ary_new();
 
-    for (i=0; i<RARRAY(ary1)->len; i++) {
-	if (st_lookup(RHASH(hash)->tbl, RARRAY(ary1)->ptr[i], 0)) continue;
+    for (i=0; i<RARRAY_LEN(ary1); i++) {
+	if (st_lookup(rb_hash_tbl_raw(hash), RARRAY_AREF(ary1, i), 0)) continue;
 	rb_ary_push(ary3, rb_ary_elt(ary1, i));
     }
+    ary_recycle_hash(hash);
     return ary3;
 }
 
-/* 
+/*
  *  call-seq:
- *     array & other_array
+ *     ary & other_ary      -> new_ary
+ *
+ *  Set Intersection --- Returns a new array containing elements common to the
+ *  two arrays, excluding any duplicates. The order is preserved from the
+ *  original array.
  *
- *  Set Intersection---Returns a new array
- *  containing elements common to the two arrays, with no duplicates.
+ *  It compares elements using their #hash and #eql? methods for efficiency.
  *
- *     [ 1, 1, 3, 5 ] & [ 1, 2, 3 ]   #=> [ 1, 3 ]
+ *     [ 1, 1, 3, 5 ] & [ 1, 2, 3 ]                 #=> [ 1, 3 ]
+ *     [ 'a', 'b', 'b', 'z' ] & [ 'a', 'b', 'c' ]   #=> [ 'a', 'b' ]
+ *
+ *  See also Array#uniq.
  */
 
 
 static VALUE
-rb_ary_and(ary1, ary2)
-    VALUE ary1, ary2;
+rb_ary_and(VALUE ary1, VALUE ary2)
 {
-    VALUE hash, ary3, v, vv;
+    VALUE hash, ary3, v;
+    st_table *table;
+    st_data_t vv;
     long i;
 
     ary2 = to_ary(ary2);
-    ary3 = rb_ary_new2(RARRAY(ary1)->len < RARRAY(ary2)->len ?
-	    RARRAY(ary1)->len : RARRAY(ary2)->len);
-    hash = ary_make_hash(ary2, 0);
-
-    for (i=0; i<RARRAY(ary1)->len; i++) {
-	v = vv = rb_ary_elt(ary1, i);
-	if (st_delete(RHASH(hash)->tbl, (st_data_t*)&vv, 0)) {
+    ary3 = rb_ary_new();
+    if (RARRAY_LEN(ary2) == 0) return ary3;
+    hash = ary_make_hash(ary2);
+    table = rb_hash_tbl_raw(hash);
+
+    for (i=0; i<RARRAY_LEN(ary1); i++) {
+	v = RARRAY_AREF(ary1, i);
+	vv = (st_data_t)v;
+	if (st_delete(table, &vv, 0)) {
 	    rb_ary_push(ary3, v);
 	}
     }
+    ary_recycle_hash(hash);
 
     return ary3;
 }
 
-/* 
+static int
+ary_hash_orset(st_data_t *key, st_data_t *value, st_data_t arg, int existing)
+{
+    if (existing) return ST_STOP;
+    *key = *value = (VALUE)arg;
+    return ST_CONTINUE;
+}
+
+/*
  *  call-seq:
- *     array | other_array     ->  an_array
+ *     ary | other_ary     -> new_ary
+ *
+ *  Set Union --- Returns a new array by joining +ary+ with +other_ary+,
+ *  excluding any duplicates and preserving the order from the original array.
  *
- *  Set Union---Returns a new array by joining this array with
- *  other_array, removing duplicates.
+ *  It compares elements using their #hash and #eql? methods for efficiency.
  *
- *     [ "a", "b", "c" ] | [ "c", "d", "a" ]
- *            #=> [ "a", "b", "c", "d" ]
+ *     [ "a", "b", "c" ] | [ "c", "d", "a" ]    #=> [ "a", "b", "c", "d" ]
+ *
+ *  See also Array#uniq.
  */
 
 static VALUE
-rb_ary_or(ary1, ary2)
-    VALUE ary1, ary2;
+rb_ary_or(VALUE ary1, VALUE ary2)
 {
     VALUE hash, ary3;
-    VALUE v, vv;
     long i;
 
     ary2 = to_ary(ary2);
-    ary3 = rb_ary_new2(RARRAY(ary1)->len+RARRAY(ary2)->len);
-    hash = ary_make_hash(ary1, ary2);
+    hash = ary_make_hash(ary1);
 
-    for (i=0; i<RARRAY(ary1)->len; i++) {
-	v = vv = rb_ary_elt(ary1, i);
-	if (st_delete(RHASH(hash)->tbl, (st_data_t*)&vv, 0)) {
-	    rb_ary_push(ary3, v);
-	}
-    }
-    for (i=0; i<RARRAY(ary2)->len; i++) {
-	v = vv = rb_ary_elt(ary2, i);
-	if (st_delete(RHASH(hash)->tbl, (st_data_t*)&vv, 0)) {
-	    rb_ary_push(ary3, v);
+    for (i=0; i<RARRAY_LEN(ary2); i++) {
+	VALUE elt = RARRAY_AREF(ary2, i);
+	if (!st_update(RHASH_TBL_RAW(hash), (st_data_t)elt, ary_hash_orset, (st_data_t)elt)) {
+	    RB_OBJ_WRITTEN(hash, Qundef, elt);
 	}
     }
+    ary3 = rb_hash_values(hash);
+    ary_recycle_hash(hash);
     return ary3;
 }
 
+static int
+push_value(st_data_t key, st_data_t val, st_data_t ary)
+{
+    rb_ary_push((VALUE)ary, (VALUE)val);
+    return ST_CONTINUE;
+}
+
 /*
  *  call-seq:
- *     array.uniq! -> array or nil
- *  
- *  Removes duplicate elements from _self_.
- *  Returns <code>nil</code> if no changes are made (that is, no
- *  duplicates are found).
- *     
+ *     ary.uniq!                -> ary or nil
+ *     ary.uniq! { |item| ... } -> ary or nil
+ *
+ *  Removes duplicate elements from +self+.
+ *
+ *  If a block is given, it will use the return value of the block for
+ *  comparison.
+ *
+ *  It compares values using their #hash and #eql? methods for efficiency.
+ *
+ *  +self+ is traversed in order, and the first occurrence is kept.
+ *
+ *  Returns +nil+ if no changes are made (that is, no duplicates are found).
+ *
  *     a = [ "a", "a", "b", "b", "c" ]
- *     a.uniq!   #=> ["a", "b", "c"]
+ *     a.uniq!   # => ["a", "b", "c"]
+ *
  *     b = [ "a", "b", "c" ]
- *     b.uniq!   #=> nil
+ *     b.uniq!   # => nil
+ *
+ *     c = [["student","sam"], ["student","george"], ["teacher","matz"]]
+ *     c.uniq! { |s| s.first } # => [["student", "sam"], ["teacher", "matz"]]
+ *
  */
 
 static VALUE
-rb_ary_uniq_bang(ary)
-    VALUE ary;
+rb_ary_uniq_bang(VALUE ary)
 {
-    VALUE hash, v, vv;
-    long i, j;
+    VALUE hash;
+    long hash_size;
 
-    hash = ary_make_hash(ary, 0);
-
-    if (RARRAY(ary)->len == RHASH(hash)->tbl->num_entries) {
+    rb_ary_modify_check(ary);
+    if (RARRAY_LEN(ary) <= 1)
+        return Qnil;
+    if (rb_block_given_p())
+	hash = ary_make_hash_by(ary);
+    else
+	hash = ary_make_hash(ary);
+
+    hash_size = RHASH_SIZE(hash);
+    if (RARRAY_LEN(ary) == hash_size) {
 	return Qnil;
     }
-    for (i=j=0; i<RARRAY(ary)->len; i++) {
-	v = vv = rb_ary_elt(ary, i);
-	if (st_delete(RHASH(hash)->tbl, (st_data_t*)&vv, 0)) {
-	    rb_ary_store(ary, j++, v);
-	}
+    rb_ary_modify_check(ary);
+    ARY_SET_LEN(ary, 0);
+    if (ARY_SHARED_P(ary) && !ARY_EMBED_P(ary)) {
+	rb_ary_unshare(ary);
+	FL_SET_EMBED(ary);
     }
-    RARRAY(ary)->len = j;
+    ary_resize_capa(ary, hash_size);
+    st_foreach(rb_hash_tbl_raw(hash), push_value, ary);
+    ary_recycle_hash(hash);
 
     return ary;
 }
 
 /*
  *  call-seq:
- *     array.uniq   -> an_array
- *  
- *  Returns a new array by removing duplicate values in <i>self</i>.
- *     
+ *     ary.uniq                -> new_ary
+ *     ary.uniq { |item| ... } -> new_ary
+ *
+ *  Returns a new array by removing duplicate values in +self+.
+ *
+ *  If a block is given, it will use the return value of the block for comparison.
+ *
+ *  It compares values using their #hash and #eql? methods for efficiency.
+ *
+ *  +self+ is traversed in order, and the first occurrence is kept.
+ *
  *     a = [ "a", "a", "b", "b", "c" ]
- *     a.uniq   #=> ["a", "b", "c"]
+ *     a.uniq   # => ["a", "b", "c"]
+ *
+ *     b = [["student","sam"], ["student","george"], ["teacher","matz"]]
+ *     b.uniq { |s| s.first } # => [["student", "sam"], ["teacher", "matz"]]
+ *
  */
 
 static VALUE
-rb_ary_uniq(ary)
-    VALUE ary;
+rb_ary_uniq(VALUE ary)
 {
-    ary = rb_ary_dup(ary);
-    rb_ary_uniq_bang(ary);
-    return ary;
+    VALUE hash, uniq;
+
+    if (RARRAY_LEN(ary) <= 1)
+        return rb_ary_dup(ary);
+    if (rb_block_given_p()) {
+	hash = ary_make_hash_by(ary);
+	uniq = rb_hash_values(hash);
+    }
+    else {
+	hash = ary_make_hash(ary);
+	uniq = rb_hash_values(hash);
+    }
+    RBASIC_SET_CLASS(uniq, rb_obj_class(ary));
+    ary_recycle_hash(hash);
+
+    return uniq;
 }
 
-/* 
+/*
  *  call-seq:
- *     array.compact!    ->   array  or  nil
+ *     ary.compact!    -> ary  or  nil
+ *
+ *  Removes +nil+ elements from the array.
  *
- *  Removes +nil+ elements from array.
- *  Returns +nil+ if no changes were made.
+ *  Returns +nil+ if no changes were made, otherwise returns the array.
  *
  *     [ "a", nil, "b", nil, "c" ].compact! #=> [ "a", "b", "c" ]
  *     [ "a", "b", "c" ].compact!           #=> nil
  */
 
 static VALUE
-rb_ary_compact_bang(ary)
-    VALUE ary;
+rb_ary_compact_bang(VALUE ary)
 {
     VALUE *p, *t, *end;
+    long n;
 
     rb_ary_modify(ary);
-    p = t = RARRAY(ary)->ptr;
-    end = p + RARRAY(ary)->len;
-    
+    p = t = (VALUE *)RARRAY_CONST_PTR(ary); /* WB: no new reference */
+    end = p + RARRAY_LEN(ary);
+
     while (t < end) {
 	if (NIL_P(*t)) t++;
 	else *p++ = *t++;
     }
-    if (RARRAY(ary)->len == (p - RARRAY(ary)->ptr)) {
+    n = p - RARRAY_CONST_PTR(ary);
+    if (RARRAY_LEN(ary) == n) {
 	return Qnil;
     }
-    RARRAY(ary)->len = RARRAY(ary)->aux.capa = (p - RARRAY(ary)->ptr);
-    REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
+    ary_resize_smaller(ary, n);
 
     return ary;
 }
 
 /*
  *  call-seq:
- *     array.compact     ->  an_array
+ *     ary.compact     -> new_ary
  *
- *  Returns a copy of _self_ with all +nil+ elements removed.
+ *  Returns a copy of +self+ with all +nil+ elements removed.
  *
  *     [ "a", nil, "b", nil, "c", nil ].compact
  *                       #=> [ "a", "b", "c" ]
  */
 
 static VALUE
-rb_ary_compact(ary)
-    VALUE ary;
+rb_ary_compact(VALUE ary)
 {
     ary = rb_ary_dup(ary);
     rb_ary_compact_bang(ary);
@@ -2847,147 +4359,1463 @@ rb_ary_compact(ary)
 
 /*
  *  call-seq:
- *     array.nitems -> int
- *  
- *  Returns the number of non-<code>nil</code> elements in _self_.
- *  May be zero.
- *     
- *     [ 1, nil, 3, nil, 5 ].nitems   #=> 3
+ *     ary.count                   -> int
+ *     ary.count(obj)              -> int
+ *     ary.count { |item| block }  -> int
+ *
+ *  Returns the number of elements.
+ *
+ *  If an argument is given, counts the number of elements which equal +obj+
+ *  using <code>==</code>.
+ *
+ *  If a block is given, counts the number of elements for which the block
+ *  returns a true value.
+ *
+ *     ary = [1, 2, 4, 2]
+ *     ary.count                  #=> 4
+ *     ary.count(2)               #=> 2
+ *     ary.count { |x| x%2 == 0 } #=> 3
+ *
  */
 
 static VALUE
-rb_ary_nitems(ary)
-    VALUE ary;
+rb_ary_count(int argc, VALUE *argv, VALUE ary)
 {
-    long n = 0;
-    VALUE *p, *pend;
+    long i, n = 0;
+
+    if (argc == 0) {
+	VALUE v;
 
-    p = RARRAY(ary)->ptr;
-    pend = p + RARRAY(ary)->len;
+	if (!rb_block_given_p())
+	    return LONG2NUM(RARRAY_LEN(ary));
 
-    while (p < pend) {
-	if (!NIL_P(*p)) n++;
-	p++;
+	for (i = 0; i < RARRAY_LEN(ary); i++) {
+	    v = RARRAY_AREF(ary, i);
+	    if (RTEST(rb_yield(v))) n++;
+	}
     }
+    else {
+	VALUE obj;
+
+	rb_scan_args(argc, argv, "1", &obj);
+	if (rb_block_given_p()) {
+	    rb_warn("given block not used");
+	}
+	for (i = 0; i < RARRAY_LEN(ary); i++) {
+	    if (rb_equal(RARRAY_AREF(ary, i), obj)) n++;
+	}
+    }
+
     return LONG2NUM(n);
 }
 
-static long
-flatten(ary, idx, ary2, memo)
-    VALUE ary;
-    long idx;
-    VALUE ary2, memo;
+static VALUE
+flatten(VALUE ary, int level, int *modified)
 {
-    VALUE id;
-    long i = idx;
-    long n, lim = idx + RARRAY(ary2)->len;
-
-    id = rb_obj_id(ary2);
-    if (rb_ary_includes(memo, id)) {
-	rb_raise(rb_eArgError, "tried to flatten recursive array");
-    }
-    rb_ary_push(memo, id);
-    rb_ary_splice(ary, idx, 1, ary2);
-    while (i < lim) {
-	VALUE tmp;
-
-	tmp = rb_check_array_type(rb_ary_elt(ary, i));
-	if (!NIL_P(tmp)) {
-	    n = flatten(ary, i, tmp, memo);
-	    i += n; lim += n;
+    long i = 0;
+    VALUE stack, result, tmp, elt;
+    st_table *memo;
+    st_data_t id;
+
+    stack = ary_new(0, ARY_DEFAULT_SIZE);
+    result = ary_new(0, RARRAY_LEN(ary));
+    memo = st_init_numtable();
+    st_insert(memo, (st_data_t)ary, (st_data_t)Qtrue);
+    *modified = 0;
+
+    while (1) {
+	while (i < RARRAY_LEN(ary)) {
+	    elt = RARRAY_AREF(ary, i++);
+	    if (level >= 0 && RARRAY_LEN(stack) / 2 >= level) {
+		rb_ary_push(result, elt);
+		continue;
+	    }
+	    tmp = rb_check_array_type(elt);
+	    if (RBASIC(result)->klass) {
+		rb_raise(rb_eRuntimeError, "flatten reentered");
+	    }
+	    if (NIL_P(tmp)) {
+		rb_ary_push(result, elt);
+	    }
+	    else {
+		*modified = 1;
+		id = (st_data_t)tmp;
+		if (st_lookup(memo, id, 0)) {
+		    st_free_table(memo);
+		    rb_raise(rb_eArgError, "tried to flatten recursive array");
+		}
+		st_insert(memo, id, (st_data_t)Qtrue);
+		rb_ary_push(stack, ary);
+		rb_ary_push(stack, LONG2NUM(i));
+		ary = tmp;
+		i = 0;
+	    }
 	}
-	i++;
+	if (RARRAY_LEN(stack) == 0) {
+	    break;
+	}
+	id = (st_data_t)ary;
+	st_delete(memo, &id, 0);
+	tmp = rb_ary_pop(stack);
+	i = NUM2LONG(tmp);
+	ary = rb_ary_pop(stack);
     }
-    rb_ary_pop(memo);
 
-    return lim - idx - 1;	/* returns number of increased items */
+    st_free_table(memo);
+
+    RBASIC_SET_CLASS(result, rb_obj_class(ary));
+    return result;
 }
 
 /*
  *  call-seq:
- *     array.flatten! -> array or nil
- *  
- *  Flattens _self_ in place.
- *  Returns <code>nil</code> if no modifications were made (i.e.,
- *  <i>array</i> contains no subarrays.)
- *     
+ *     ary.flatten!        -> ary or nil
+ *     ary.flatten!(level) -> ary or nil
+ *
+ *  Flattens +self+ in place.
+ *
+ *  Returns +nil+ if no modifications were made (i.e., the array contains no
+ *  subarrays.)
+ *
+ *  The optional +level+ argument determines the level of recursion to flatten.
+ *
  *     a = [ 1, 2, [3, [4, 5] ] ]
  *     a.flatten!   #=> [1, 2, 3, 4, 5]
  *     a.flatten!   #=> nil
  *     a            #=> [1, 2, 3, 4, 5]
+ *     a = [ 1, 2, [3, [4, 5] ] ]
+ *     a.flatten!(1) #=> [1, 2, 3, [4, 5]]
  */
 
 static VALUE
-rb_ary_flatten_bang(ary)
-    VALUE ary;
+rb_ary_flatten_bang(int argc, VALUE *argv, VALUE ary)
 {
-    long i = 0;
-    int mod = 0;
-    VALUE memo = Qnil;
+    int mod = 0, level = -1;
+    VALUE result, lv;
 
-    while (i<RARRAY(ary)->len) {
-	VALUE ary2 = RARRAY(ary)->ptr[i];
-	VALUE tmp;
+    rb_scan_args(argc, argv, "01", &lv);
+    rb_ary_modify_check(ary);
+    if (!NIL_P(lv)) level = NUM2INT(lv);
+    if (level == 0) return Qnil;
 
-	tmp = rb_check_array_type(ary2);
-	if (!NIL_P(tmp)) {
-	    if (NIL_P(memo)) {
-		memo = rb_ary_new();
-	    }
-	    i += flatten(ary, i, tmp, memo);
-	    mod = 1;
-	}
-	i++;
+    result = flatten(ary, level, &mod);
+    if (mod == 0) {
+	ary_discard(result);
+	return Qnil;
     }
-    if (mod == 0) return Qnil;
+    if (!(mod = ARY_EMBED_P(result))) rb_obj_freeze(result);
+    rb_ary_replace(ary, result);
+    if (mod) ARY_SET_EMBED_LEN(result, 0);
+
     return ary;
 }
 
 /*
  *  call-seq:
- *     array.flatten -> an_array
- *  
- *  Returns a new array that is a one-dimensional flattening of this
- *  array (recursively). That is, for every element that is an array,
- *  extract its elements into the new array.
- *     
+ *     ary.flatten -> new_ary
+ *     ary.flatten(level) -> new_ary
+ *
+ *  Returns a new array that is a one-dimensional flattening of +self+
+ *  (recursively).
+ *
+ *  That is, for every element that is an array, extract its elements into
+ *  the new array.
+ *
+ *  The optional +level+ argument determines the level of recursion to
+ *  flatten.
+ *
  *     s = [ 1, 2, 3 ]           #=> [1, 2, 3]
  *     t = [ 4, 5, 6, [7, 8] ]   #=> [4, 5, 6, [7, 8]]
  *     a = [ s, t, 9, 10 ]       #=> [[1, 2, 3], [4, 5, 6, [7, 8]], 9, 10]
- *     a.flatten                 #=> [1, 2, 3, 4, 5, 6, 7, 8, 9, 10
+ *     a.flatten                 #=> [1, 2, 3, 4, 5, 6, 7, 8, 9, 10]
+ *     a = [ 1, 2, [3, [4, 5] ] ]
+ *     a.flatten(1)              #=> [1, 2, 3, [4, 5]]
  */
 
 static VALUE
-rb_ary_flatten(ary)
-    VALUE ary;
+rb_ary_flatten(int argc, VALUE *argv, VALUE ary)
+{
+    int mod = 0, level = -1;
+    VALUE result, lv;
+
+    rb_scan_args(argc, argv, "01", &lv);
+    if (!NIL_P(lv)) level = NUM2INT(lv);
+    if (level == 0) return ary_make_shared_copy(ary);
+
+    result = flatten(ary, level, &mod);
+    OBJ_INFECT(result, ary);
+
+    return result;
+}
+
+#define OPTHASH_GIVEN_P(opts) \
+    (argc > 0 && !NIL_P((opts) = rb_check_hash_type(argv[argc-1])) && (--argc, 1))
+static ID id_random;
+
+#define RAND_UPTO(max) (long)rb_random_ulong_limited((randgen), (max)-1)
+
+/*
+ *  call-seq:
+ *     ary.shuffle!              -> ary
+ *     ary.shuffle!(random: rng) -> ary
+ *
+ *  Shuffles elements in +self+ in place.
+ *
+ *     a = [ 1, 2, 3 ]           #=> [1, 2, 3]
+ *     a.shuffle!                #=> [2, 3, 1]
+ *     a                         #=> [2, 3, 1]
+ *
+ *  The optional +rng+ argument will be used as the random number generator.
+ *
+ *     a.shuffle!(random: Random.new(1))  #=> [1, 3, 2]
+ */
+
+static VALUE
+rb_ary_shuffle_bang(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE opts, randgen = rb_cRandom;
+    long i, len;
+
+    if (OPTHASH_GIVEN_P(opts)) {
+	VALUE rnd;
+	ID keyword_ids[1];
+
+	keyword_ids[0] = id_random;
+	rb_get_kwargs(opts, keyword_ids, 0, 1, &rnd);
+	if (rnd != Qundef) {
+	    randgen = rnd;
+	}
+    }
+    rb_check_arity(argc, 0, 0);
+    rb_ary_modify(ary);
+    i = len = RARRAY_LEN(ary);
+    RARRAY_PTR_USE(ary, ptr, {
+	while (i) {
+	    long j = RAND_UPTO(i);
+	    VALUE tmp;
+	    if (len != RARRAY_LEN(ary) || ptr != RARRAY_CONST_PTR(ary)) {
+		rb_raise(rb_eRuntimeError, "modified during shuffle");
+	    }
+	    tmp = ptr[--i];
+	    ptr[i] = ptr[j];
+	    ptr[j] = tmp;
+	}
+    }); /* WB: no new reference */
+    return ary;
+}
+
+
+/*
+ *  call-seq:
+ *     ary.shuffle              -> new_ary
+ *     ary.shuffle(random: rng) -> new_ary
+ *
+ *  Returns a new array with elements of +self+ shuffled.
+ *
+ *     a = [ 1, 2, 3 ]           #=> [1, 2, 3]
+ *     a.shuffle                 #=> [2, 3, 1]
+ *     a                         #=> [1, 2, 3]
+ *
+ *  The optional +rng+ argument will be used as the random number generator.
+ *
+ *     a.shuffle(random: Random.new(1))  #=> [1, 3, 2]
+ */
+
+static VALUE
+rb_ary_shuffle(int argc, VALUE *argv, VALUE ary)
 {
     ary = rb_ary_dup(ary);
-    rb_ary_flatten_bang(ary);
+    rb_ary_shuffle_bang(argc, argv, ary);
+    return ary;
+}
+
+
+/*
+ *  call-seq:
+ *     ary.sample                  -> obj
+ *     ary.sample(random: rng)     -> obj
+ *     ary.sample(n)               -> new_ary
+ *     ary.sample(n, random: rng)  -> new_ary
+ *
+ *  Choose a random element or +n+ random elements from the array.
+ *
+ *  The elements are chosen by using random and unique indices into the array
+ *  in order to ensure that an element doesn't repeat itself unless the array
+ *  already contained duplicate elements.
+ *
+ *  If the array is empty the first form returns +nil+ and the second form
+ *  returns an empty array.
+ *
+ *  The optional +rng+ argument will be used as the random number generator.
+ *
+ *     a = [ 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 ]
+ *     a.sample         #=> 7
+ *     a.sample(4)      #=> [6, 4, 2, 5]
+ */
+
+
+static VALUE
+rb_ary_sample(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE nv, result;
+    VALUE opts, randgen = rb_cRandom;
+    long n, len, i, j, k, idx[10];
+    long rnds[numberof(idx)];
+
+    if (OPTHASH_GIVEN_P(opts)) {
+	VALUE rnd;
+	ID keyword_ids[1];
+
+	keyword_ids[0] = id_random;
+	rb_get_kwargs(opts, keyword_ids, 0, 1, &rnd);
+	if (rnd != Qundef) {
+	    randgen = rnd;
+	}
+    }
+    len = RARRAY_LEN(ary);
+    if (argc == 0) {
+	if (len < 2)
+	    i = 0;
+	else
+	    i = RAND_UPTO(len);
+
+	return rb_ary_elt(ary, i);
+    }
+    rb_scan_args(argc, argv, "1", &nv);
+    n = NUM2LONG(nv);
+    if (n < 0) rb_raise(rb_eArgError, "negative sample number");
+    if (n > len) n = len;
+    if (n <= numberof(idx)) {
+	for (i = 0; i < n; ++i) {
+	    rnds[i] = RAND_UPTO(len - i);
+	}
+    }
+    k = len;
+    len = RARRAY_LEN(ary);
+    if (len < k && n <= numberof(idx)) {
+	for (i = 0; i < n; ++i) {
+	    if (rnds[i] >= len) return rb_ary_new_capa(0);
+	}
+    }
+    if (n > len) n = len;
+    switch (n) {
+      case 0:
+	return rb_ary_new_capa(0);
+      case 1:
+	i = rnds[0];
+	return rb_ary_new_from_values(1, &RARRAY_AREF(ary, i));
+      case 2:
+	i = rnds[0];
+	j = rnds[1];
+	if (j >= i) j++;
+	return rb_ary_new_from_args(2, RARRAY_AREF(ary, i), RARRAY_AREF(ary, j));
+      case 3:
+	i = rnds[0];
+	j = rnds[1];
+	k = rnds[2];
+	{
+	    long l = j, g = i;
+	    if (j >= i) l = i, g = ++j;
+	    if (k >= l && (++k >= g)) ++k;
+	}
+	return rb_ary_new_from_args(3, RARRAY_AREF(ary, i), RARRAY_AREF(ary, j), RARRAY_AREF(ary, k));
+    }
+    if (n <= numberof(idx)) {
+	long sorted[numberof(idx)];
+	sorted[0] = idx[0] = rnds[0];
+	for (i=1; i<n; i++) {
+	    k = rnds[i];
+	    for (j = 0; j < i; ++j) {
+		if (k < sorted[j]) break;
+		++k;
+	    }
+	    memmove(&sorted[j+1], &sorted[j], sizeof(sorted[0])*(i-j));
+	    sorted[j] = idx[i] = k;
+	}
+	result = rb_ary_new_capa(n);
+	RARRAY_PTR_USE(result, ptr_result, {
+	    for (i=0; i<n; i++) {
+		ptr_result[i] = RARRAY_AREF(ary, idx[i]);
+	    }
+	});
+    }
+    else {
+	result = rb_ary_dup(ary);
+	RBASIC_CLEAR_CLASS(result);
+	RB_GC_GUARD(ary);
+	RARRAY_PTR_USE(result, ptr_result, {
+	    for (i=0; i<n; i++) {
+		j = RAND_UPTO(len-i) + i;
+		nv = ptr_result[j];
+		ptr_result[j] = ptr_result[i];
+		ptr_result[i] = nv;
+	    }
+	});
+	RBASIC_SET_CLASS_RAW(result, rb_cArray);
+    }
+    ARY_SET_LEN(result, n);
+
+    return result;
+}
+
+static VALUE
+rb_ary_cycle_size(VALUE self, VALUE args, VALUE eobj)
+{
+    long mul;
+    VALUE n = Qnil;
+    if (args && (RARRAY_LEN(args) > 0)) {
+	n = RARRAY_AREF(args, 0);
+    }
+    if (RARRAY_LEN(self) == 0) return INT2FIX(0);
+    if (n == Qnil) return DBL2NUM(INFINITY);
+    mul = NUM2LONG(n);
+    if (mul <= 0) return INT2FIX(0);
+    n = LONG2FIX(mul);
+    return rb_funcallv(rb_ary_length(self), '*', 1, &n);
+}
+
+/*
+ *  call-seq:
+ *     ary.cycle(n=nil) { |obj| block }  -> nil
+ *     ary.cycle(n=nil)                  -> Enumerator
+ *
+ *  Calls the given block for each element +n+ times or forever if +nil+ is
+ *  given.
+ *
+ *  Does nothing if a non-positive number is given or the array is empty.
+ *
+ *  Returns +nil+ if the loop has finished without getting interrupted.
+ *
+ *  If no block is given, an Enumerator is returned instead.
+ *
+ *     a = ["a", "b", "c"]
+ *     a.cycle { |x| puts x }     # print, a, b, c, a, b, c,.. forever.
+ *     a.cycle(2) { |x| puts x }  # print, a, b, c, a, b, c.
+ *
+ */
+
+static VALUE
+rb_ary_cycle(int argc, VALUE *argv, VALUE ary)
+{
+    long n, i;
+    VALUE nv = Qnil;
+
+    rb_scan_args(argc, argv, "01", &nv);
+
+    RETURN_SIZED_ENUMERATOR(ary, argc, argv, rb_ary_cycle_size);
+    if (NIL_P(nv)) {
+        n = -1;
+    }
+    else {
+        n = NUM2LONG(nv);
+        if (n <= 0) return Qnil;
+    }
+
+    while (RARRAY_LEN(ary) > 0 && (n < 0 || 0 < n--)) {
+        for (i=0; i<RARRAY_LEN(ary); i++) {
+            rb_yield(RARRAY_AREF(ary, i));
+        }
+    }
+    return Qnil;
+}
+
+#define tmpbuf(n, size) rb_str_tmp_new((n)*(size))
+#define tmpbuf_discard(s) (rb_str_resize((s), 0L), RBASIC_SET_CLASS_RAW(s, rb_cString))
+#define tmpary(n) rb_ary_tmp_new(n)
+#define tmpary_discard(a) (ary_discard(a), RBASIC_SET_CLASS_RAW(a, rb_cArray))
+
+/*
+ * Build a ruby array of the corresponding values and yield it to the
+ * associated block.
+ * Return the class of +values+ for reentry check.
+ */
+static int
+yield_indexed_values(const VALUE values, const long r, const long *const p)
+{
+    const VALUE result = rb_ary_new2(r);
+    VALUE *const result_array = RARRAY_PTR(result);
+    const VALUE *const values_array = RARRAY_CONST_PTR(values);
+    long i;
+
+    for (i = 0; i < r; i++) result_array[i] = values_array[p[i]];
+    ARY_SET_LEN(result, r);
+    rb_yield(result);
+    return !RBASIC(values)->klass;
+}
+
+/*
+ * Compute permutations of +r+ elements of the set <code>[0..n-1]</code>.
+ *
+ * When we have a complete permutation of array indexes, copy the values
+ * at those indexes into a new array and yield that array.
+ *
+ * n: the size of the set
+ * r: the number of elements in each permutation
+ * p: the array (of size r) that we're filling in
+ * used: an array of booleans: whether a given index is already used
+ * values: the Ruby array that holds the actual values to permute
+ */
+static void
+permute0(const long n, const long r, long *const p, char *const used, const VALUE values)
+{
+    long i = 0, index = 0;
+
+    for (;;) {
+	const char *const unused = memchr(&used[i], 0, n-i);
+	if (!unused) {
+	    if (!index) break;
+	    i = p[--index];                /* pop index */
+	    used[i++] = 0;                 /* index unused */
+	}
+	else {
+	    i = unused - used;
+	    p[index] = i;
+	    used[i] = 1;                   /* mark index used */
+	    ++index;
+	    if (index < r-1) {             /* if not done yet */
+		p[index] = i = 0;
+		continue;
+	    }
+	    for (i = 0; i < n; ++i) {
+		if (used[i]) continue;
+		p[index] = i;
+		if (!yield_indexed_values(values, r, p)) {
+		    rb_raise(rb_eRuntimeError, "permute reentered");
+		}
+	    }
+	    i = p[--index];                /* pop index */
+	    used[i] = 0;                   /* index unused */
+	    p[index] = ++i;
+	}
+    }
+}
+
+/*
+ * Returns the product of from, from-1, ..., from - how_many + 1.
+ * http://en.wikipedia.org/wiki/Pochhammer_symbol
+ */
+static VALUE
+descending_factorial(long from, long how_many)
+{
+    VALUE cnt = LONG2FIX(how_many >= 0);
+    while (how_many-- > 0) {
+	VALUE v = LONG2FIX(from--);
+	cnt = rb_funcallv(cnt, '*', 1, &v);
+    }
+    return cnt;
+}
+
+static VALUE
+binomial_coefficient(long comb, long size)
+{
+    VALUE r, v;
+    if (comb > size-comb) {
+	comb = size-comb;
+    }
+    if (comb < 0) {
+	return LONG2FIX(0);
+    }
+    r = descending_factorial(size, comb);
+    v = descending_factorial(comb, comb);
+    return rb_funcallv(r, id_div, 1, &v);
+}
+
+static VALUE
+rb_ary_permutation_size(VALUE ary, VALUE args, VALUE eobj)
+{
+    long n = RARRAY_LEN(ary);
+    long k = (args && (RARRAY_LEN(args) > 0)) ? NUM2LONG(RARRAY_AREF(args, 0)) : n;
+
+    return descending_factorial(n, k);
+}
+
+/*
+ *  call-seq:
+ *     ary.permutation { |p| block }          -> ary
+ *     ary.permutation                        -> Enumerator
+ *     ary.permutation(n) { |p| block }       -> ary
+ *     ary.permutation(n)                     -> Enumerator
+ *
+ * When invoked with a block, yield all permutations of length +n+ of the
+ * elements of the array, then return the array itself.
+ *
+ * If +n+ is not specified, yield all permutations of all elements.
+ *
+ * The implementation makes no guarantees about the order in which the
+ * permutations are yielded.
+ *
+ * If no block is given, an Enumerator is returned instead.
+ *
+ * Examples:
+ *
+ *   a = [1, 2, 3]
+ *   a.permutation.to_a    #=> [[1,2,3],[1,3,2],[2,1,3],[2,3,1],[3,1,2],[3,2,1]]
+ *   a.permutation(1).to_a #=> [[1],[2],[3]]
+ *   a.permutation(2).to_a #=> [[1,2],[1,3],[2,1],[2,3],[3,1],[3,2]]
+ *   a.permutation(3).to_a #=> [[1,2,3],[1,3,2],[2,1,3],[2,3,1],[3,1,2],[3,2,1]]
+ *   a.permutation(0).to_a #=> [[]] # one permutation of length 0
+ *   a.permutation(4).to_a #=> []   # no permutations of length 4
+ */
+
+static VALUE
+rb_ary_permutation(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE num;
+    long r, n, i;
+
+    n = RARRAY_LEN(ary);                  /* Array length */
+    RETURN_SIZED_ENUMERATOR(ary, argc, argv, rb_ary_permutation_size);   /* Return enumerator if no block */
+    rb_scan_args(argc, argv, "01", &num);
+    r = NIL_P(num) ? n : NUM2LONG(num);   /* Permutation size from argument */
+
+    if (r < 0 || n < r) {
+	/* no permutations: yield nothing */
+    }
+    else if (r == 0) { /* exactly one permutation: the zero-length array */
+	rb_yield(rb_ary_new2(0));
+    }
+    else if (r == 1) { /* this is a special, easy case */
+	for (i = 0; i < RARRAY_LEN(ary); i++) {
+	    rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+	}
+    }
+    else {             /* this is the general case */
+	volatile VALUE t0;
+	long *p = ALLOCV_N(long, t0, r+roomof(n, sizeof(long)));
+	char *used = (char*)(p + r);
+	VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+	RBASIC_CLEAR_CLASS(ary0);
+
+	MEMZERO(used, char, n); /* initialize array */
+
+	permute0(n, r, p, used, ary0); /* compute and yield permutations */
+	ALLOCV_END(t0);
+	RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
+    }
+    return ary;
+}
+
+static void
+combinate0(const long len, const long n, long *const stack, const VALUE values)
+{
+    long lev = 0;
+
+    MEMZERO(stack+1, long, n);
+    stack[0] = -1;
+    for (;;) {
+	for (lev++; lev < n; lev++) {
+	    stack[lev+1] = stack[lev]+1;
+	}
+	if (!yield_indexed_values(values, n, stack+1)) {
+	    rb_raise(rb_eRuntimeError, "combination reentered");
+	}
+	do {
+	    if (lev == 0) return;
+	    stack[lev--]++;
+	} while (stack[lev+1]+n == len+lev+1);
+    }
+}
+
+static VALUE
+rb_ary_combination_size(VALUE ary, VALUE args, VALUE eobj)
+{
+    long n = RARRAY_LEN(ary);
+    long k = NUM2LONG(RARRAY_AREF(args, 0));
+
+    return binomial_coefficient(k, n);
+}
+
+/*
+ *  call-seq:
+ *     ary.combination(n) { |c| block }    -> ary
+ *     ary.combination(n)                  -> Enumerator
+ *
+ * When invoked with a block, yields all combinations of length +n+ of elements
+ * from the array and then returns the array itself.
+ *
+ * The implementation makes no guarantees about the order in which the
+ * combinations are yielded.
+ *
+ * If no block is given, an Enumerator is returned instead.
+ *
+ * Examples:
+ *
+ *     a = [1, 2, 3, 4]
+ *     a.combination(1).to_a  #=> [[1],[2],[3],[4]]
+ *     a.combination(2).to_a  #=> [[1,2],[1,3],[1,4],[2,3],[2,4],[3,4]]
+ *     a.combination(3).to_a  #=> [[1,2,3],[1,2,4],[1,3,4],[2,3,4]]
+ *     a.combination(4).to_a  #=> [[1,2,3,4]]
+ *     a.combination(0).to_a  #=> [[]] # one combination of length 0
+ *     a.combination(5).to_a  #=> []   # no combinations of length 5
+ *
+ */
+
+static VALUE
+rb_ary_combination(VALUE ary, VALUE num)
+{
+    long i, n, len;
+
+    n = NUM2LONG(num);
+    RETURN_SIZED_ENUMERATOR(ary, 1, &num, rb_ary_combination_size);
+    len = RARRAY_LEN(ary);
+    if (n < 0 || len < n) {
+	/* yield nothing */
+    }
+    else if (n == 0) {
+	rb_yield(rb_ary_new2(0));
+    }
+    else if (n == 1) {
+	for (i = 0; i < RARRAY_LEN(ary); i++) {
+	    rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+	}
+    }
+    else {
+	VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+	volatile VALUE t0;
+	long *stack = ALLOCV_N(long, t0, n+1);
+
+	RBASIC_CLEAR_CLASS(ary0);
+	combinate0(len, n, stack, ary0);
+	ALLOCV_END(t0);
+	RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
+    }
+    return ary;
+}
+
+/*
+ * Compute repeated permutations of +r+ elements of the set
+ * <code>[0..n-1]</code>.
+ *
+ * When we have a complete repeated permutation of array indexes, copy the
+ * values at those indexes into a new array and yield that array.
+ *
+ * n: the size of the set
+ * r: the number of elements in each permutation
+ * p: the array (of size r) that we're filling in
+ * values: the Ruby array that holds the actual values to permute
+ */
+static void
+rpermute0(const long n, const long r, long *const p, const VALUE values)
+{
+    long i = 0, index = 0;
+
+    p[index] = i;
+    for (;;) {
+	if (++index < r-1) {
+	    p[index] = i = 0;
+	    continue;
+	}
+	for (i = 0; i < n; ++i) {
+	    p[index] = i;
+	    if (!yield_indexed_values(values, r, p)) {
+		rb_raise(rb_eRuntimeError, "repeated permute reentered");
+	    }
+	}
+	do {
+	    if (index <= 0) return;
+	} while ((i = ++p[--index]) >= n);
+    }
+}
+
+static VALUE
+rb_ary_repeated_permutation_size(VALUE ary, VALUE args, VALUE eobj)
+{
+    long n = RARRAY_LEN(ary);
+    long k = NUM2LONG(RARRAY_AREF(args, 0));
+    VALUE v;
+
+    if (k < 0) {
+	return LONG2FIX(0);
+    }
+
+    v = LONG2NUM(k);
+    return rb_funcallv(LONG2NUM(n), id_power, 1, &v);
+}
+
+/*
+ *  call-seq:
+ *     ary.repeated_permutation(n) { |p| block } -> ary
+ *     ary.repeated_permutation(n)               -> Enumerator
+ *
+ * When invoked with a block, yield all repeated permutations of length +n+ of
+ * the elements of the array, then return the array itself.
+ *
+ * The implementation makes no guarantees about the order in which the repeated
+ * permutations are yielded.
+ *
+ * If no block is given, an Enumerator is returned instead.
+ *
+ * Examples:
+ *
+ *     a = [1, 2]
+ *     a.repeated_permutation(1).to_a  #=> [[1], [2]]
+ *     a.repeated_permutation(2).to_a  #=> [[1,1],[1,2],[2,1],[2,2]]
+ *     a.repeated_permutation(3).to_a  #=> [[1,1,1],[1,1,2],[1,2,1],[1,2,2],
+ *                                     #    [2,1,1],[2,1,2],[2,2,1],[2,2,2]]
+ *     a.repeated_permutation(0).to_a  #=> [[]] # one permutation of length 0
+ */
+
+static VALUE
+rb_ary_repeated_permutation(VALUE ary, VALUE num)
+{
+    long r, n, i;
+
+    n = RARRAY_LEN(ary);                  /* Array length */
+    RETURN_SIZED_ENUMERATOR(ary, 1, &num, rb_ary_repeated_permutation_size);      /* Return Enumerator if no block */
+    r = NUM2LONG(num);                    /* Permutation size from argument */
+
+    if (r < 0) {
+	/* no permutations: yield nothing */
+    }
+    else if (r == 0) { /* exactly one permutation: the zero-length array */
+	rb_yield(rb_ary_new2(0));
+    }
+    else if (r == 1) { /* this is a special, easy case */
+	for (i = 0; i < RARRAY_LEN(ary); i++) {
+	    rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+	}
+    }
+    else {             /* this is the general case */
+	volatile VALUE t0;
+	long *p = ALLOCV_N(long, t0, r);
+	VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+	RBASIC_CLEAR_CLASS(ary0);
+
+	rpermute0(n, r, p, ary0); /* compute and yield repeated permutations */
+	ALLOCV_END(t0);
+	RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
+    }
+    return ary;
+}
+
+static void
+rcombinate0(const long n, const long r, long *const p, const long rest, const VALUE values)
+{
+    long i = 0, index = 0;
+
+    p[index] = i;
+    for (;;) {
+	if (++index < r-1) {
+	    p[index] = i;
+	    continue;
+	}
+	for (; i < n; ++i) {
+	    p[index] = i;
+	    if (!yield_indexed_values(values, r, p)) {
+		rb_raise(rb_eRuntimeError, "repeated combination reentered");
+	    }
+	}
+	do {
+	    if (index <= 0) return;
+	} while ((i = ++p[--index]) >= n);
+    }
+}
+
+static VALUE
+rb_ary_repeated_combination_size(VALUE ary, VALUE args, VALUE eobj)
+{
+    long n = RARRAY_LEN(ary);
+    long k = NUM2LONG(RARRAY_AREF(args, 0));
+    if (k == 0) {
+	return LONG2FIX(1);
+    }
+    return binomial_coefficient(k, n + k - 1);
+}
+
+/*
+ *  call-seq:
+ *     ary.repeated_combination(n) { |c| block } -> ary
+ *     ary.repeated_combination(n)               -> Enumerator
+ *
+ * When invoked with a block, yields all repeated combinations of length +n+ of
+ * elements from the array and then returns the array itself.
+ *
+ * The implementation makes no guarantees about the order in which the repeated
+ * combinations are yielded.
+ *
+ * If no block is given, an Enumerator is returned instead.
+ *
+ * Examples:
+ *
+ *   a = [1, 2, 3]
+ *   a.repeated_combination(1).to_a  #=> [[1], [2], [3]]
+ *   a.repeated_combination(2).to_a  #=> [[1,1],[1,2],[1,3],[2,2],[2,3],[3,3]]
+ *   a.repeated_combination(3).to_a  #=> [[1,1,1],[1,1,2],[1,1,3],[1,2,2],[1,2,3],
+ *                                   #    [1,3,3],[2,2,2],[2,2,3],[2,3,3],[3,3,3]]
+ *   a.repeated_combination(4).to_a  #=> [[1,1,1,1],[1,1,1,2],[1,1,1,3],[1,1,2,2],[1,1,2,3],
+ *                                   #    [1,1,3,3],[1,2,2,2],[1,2,2,3],[1,2,3,3],[1,3,3,3],
+ *                                   #    [2,2,2,2],[2,2,2,3],[2,2,3,3],[2,3,3,3],[3,3,3,3]]
+ *   a.repeated_combination(0).to_a  #=> [[]] # one combination of length 0
+ *
+ */
+
+static VALUE
+rb_ary_repeated_combination(VALUE ary, VALUE num)
+{
+    long n, i, len;
+
+    n = NUM2LONG(num);                 /* Combination size from argument */
+    RETURN_SIZED_ENUMERATOR(ary, 1, &num, rb_ary_repeated_combination_size);   /* Return enumerator if no block */
+    len = RARRAY_LEN(ary);
+    if (n < 0) {
+	/* yield nothing */
+    }
+    else if (n == 0) {
+	rb_yield(rb_ary_new2(0));
+    }
+    else if (n == 1) {
+	for (i = 0; i < RARRAY_LEN(ary); i++) {
+	    rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+	}
+    }
+    else if (len == 0) {
+	/* yield nothing */
+    }
+    else {
+	volatile VALUE t0;
+	long *p = ALLOCV_N(long, t0, n);
+	VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+	RBASIC_CLEAR_CLASS(ary0);
+
+	rcombinate0(len, n, p, n, ary0); /* compute and yield repeated combinations */
+	ALLOCV_END(t0);
+	RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
+    }
     return ary;
 }
 
+/*
+ *  call-seq:
+ *     ary.product(other_ary, ...)                -> new_ary
+ *     ary.product(other_ary, ...) { |p| block }  -> ary
+ *
+ *  Returns an array of all combinations of elements from all arrays.
+ *
+ *  The length of the returned array is the product of the length of +self+ and
+ *  the argument arrays.
+ *
+ *  If given a block, #product will yield all combinations and return +self+
+ *  instead.
+ *
+ *     [1,2,3].product([4,5])     #=> [[1,4],[1,5],[2,4],[2,5],[3,4],[3,5]]
+ *     [1,2].product([1,2])       #=> [[1,1],[1,2],[2,1],[2,2]]
+ *     [1,2].product([3,4],[5,6]) #=> [[1,3,5],[1,3,6],[1,4,5],[1,4,6],
+ *                                #     [2,3,5],[2,3,6],[2,4,5],[2,4,6]]
+ *     [1,2].product()            #=> [[1],[2]]
+ *     [1,2].product([])          #=> []
+ */
+
+static VALUE
+rb_ary_product(int argc, VALUE *argv, VALUE ary)
+{
+    int n = argc+1;    /* How many arrays we're operating on */
+    volatile VALUE t0 = tmpary(n);
+    volatile VALUE t1 = tmpbuf(n, sizeof(int));
+    VALUE *arrays = RARRAY_PTR(t0); /* The arrays we're computing the product of */
+    int *counters = (int*)RSTRING_PTR(t1); /* The current position in each one */
+    VALUE result = Qnil;      /* The array we'll be returning, when no block given */
+    long i,j;
+    long resultlen = 1;
+
+    RBASIC_CLEAR_CLASS(t0);
+    RBASIC_CLEAR_CLASS(t1);
+
+    /* initialize the arrays of arrays */
+    ARY_SET_LEN(t0, n);
+    arrays[0] = ary;
+    for (i = 1; i < n; i++) arrays[i] = Qnil;
+    for (i = 1; i < n; i++) arrays[i] = to_ary(argv[i-1]);
+
+    /* initialize the counters for the arrays */
+    for (i = 0; i < n; i++) counters[i] = 0;
+
+    /* Otherwise, allocate and fill in an array of results */
+    if (rb_block_given_p()) {
+	/* Make defensive copies of arrays; exit if any is empty */
+	for (i = 0; i < n; i++) {
+	    if (RARRAY_LEN(arrays[i]) == 0) goto done;
+	    arrays[i] = ary_make_shared_copy(arrays[i]);
+	}
+    }
+    else {
+	/* Compute the length of the result array; return [] if any is empty */
+	for (i = 0; i < n; i++) {
+	    long k = RARRAY_LEN(arrays[i]);
+	    if (k == 0) {
+		result = rb_ary_new2(0);
+		goto done;
+	    }
+            if (MUL_OVERFLOW_LONG_P(resultlen, k))
+		rb_raise(rb_eRangeError, "too big to product");
+	    resultlen *= k;
+	}
+	result = rb_ary_new2(resultlen);
+    }
+    for (;;) {
+	int m;
+	/* fill in one subarray */
+	VALUE subarray = rb_ary_new2(n);
+	for (j = 0; j < n; j++) {
+	    rb_ary_push(subarray, rb_ary_entry(arrays[j], counters[j]));
+	}
+
+	/* put it on the result array */
+	if (NIL_P(result)) {
+	    FL_SET(t0, FL_USER5);
+	    rb_yield(subarray);
+	    if (! FL_TEST(t0, FL_USER5)) {
+		rb_raise(rb_eRuntimeError, "product reentered");
+	    }
+	    else {
+		FL_UNSET(t0, FL_USER5);
+	    }
+	}
+	else {
+	    rb_ary_push(result, subarray);
+	}
+
+	/*
+	 * Increment the last counter.  If it overflows, reset to 0
+	 * and increment the one before it.
+	 */
+	m = n-1;
+	counters[m]++;
+	while (counters[m] == RARRAY_LEN(arrays[m])) {
+	    counters[m] = 0;
+	    /* If the first counter overflows, we are done */
+	    if (--m < 0) goto done;
+	    counters[m]++;
+	}
+    }
+done:
+    tmpary_discard(t0);
+    tmpbuf_discard(t1);
+
+    return NIL_P(result) ? ary : result;
+}
+
+/*
+ *  call-seq:
+ *     ary.take(n)               -> new_ary
+ *
+ *  Returns first +n+ elements from the array.
+ *
+ *  If a negative number is given, raises an ArgumentError.
+ *
+ *  See also Array#drop
+ *
+ *     a = [1, 2, 3, 4, 5, 0]
+ *     a.take(3)             #=> [1, 2, 3]
+ *
+ */
+
+static VALUE
+rb_ary_take(VALUE obj, VALUE n)
+{
+    long len = NUM2LONG(n);
+    if (len < 0) {
+	rb_raise(rb_eArgError, "attempt to take negative size");
+    }
+    return rb_ary_subseq(obj, 0, len);
+}
+
+/*
+ *  call-seq:
+ *     ary.take_while { |obj| block }  -> new_ary
+ *     ary.take_while                  -> Enumerator
+ *
+ *  Passes elements to the block until the block returns +nil+ or +false+, then
+ *  stops iterating and returns an array of all prior elements.
+ *
+ *  If no block is given, an Enumerator is returned instead.
+ *
+ *  See also Array#drop_while
+ *
+ *     a = [1, 2, 3, 4, 5, 0]
+ *     a.take_while { |i| i < 3 }  #=> [1, 2]
+ *
+ */
+
+static VALUE
+rb_ary_take_while(VALUE ary)
+{
+    long i;
+
+    RETURN_ENUMERATOR(ary, 0, 0);
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+	if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) break;
+    }
+    return rb_ary_take(ary, LONG2FIX(i));
+}
 
-/* Arrays are ordered, integer-indexed collections of any object. 
- * Array indexing starts at 0, as in C or Java.  A negative index is 
- * assumed to be relative to the end of the array---that is, an index of -1 
- * indicates the last element of the array, -2 is the next to last 
- * element in the array, and so on. 
+/*
+ *  call-seq:
+ *     ary.drop(n)               -> new_ary
+ *
+ *  Drops first +n+ elements from +ary+ and returns the rest of the elements in
+ *  an array.
+ *
+ *  If a negative number is given, raises an ArgumentError.
+ *
+ *  See also Array#take
+ *
+ *     a = [1, 2, 3, 4, 5, 0]
+ *     a.drop(3)             #=> [4, 5, 0]
+ *
+ */
+
+static VALUE
+rb_ary_drop(VALUE ary, VALUE n)
+{
+    VALUE result;
+    long pos = NUM2LONG(n);
+    if (pos < 0) {
+	rb_raise(rb_eArgError, "attempt to drop negative size");
+    }
+
+    result = rb_ary_subseq(ary, pos, RARRAY_LEN(ary));
+    if (result == Qnil) result = rb_ary_new();
+    return result;
+}
+
+/*
+ *  call-seq:
+ *     ary.drop_while { |obj| block }   -> new_ary
+ *     ary.drop_while                  -> Enumerator
+ *
+ *  Drops elements up to, but not including, the first element for which the
+ *  block returns +nil+ or +false+ and returns an array containing the
+ *  remaining elements.
+ *
+ *  If no block is given, an Enumerator is returned instead.
+ *
+ *  See also Array#take_while
+ *
+ *     a = [1, 2, 3, 4, 5, 0]
+ *     a.drop_while {|i| i < 3 }   #=> [3, 4, 5, 0]
+ *
+ */
+
+static VALUE
+rb_ary_drop_while(VALUE ary)
+{
+    long i;
+
+    RETURN_ENUMERATOR(ary, 0, 0);
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+	if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) break;
+    }
+    return rb_ary_drop(ary, LONG2FIX(i));
+}
+
+/*
+ *  call-seq:
+ *     ary.any? [{ |obj| block }]   -> true or false
+ *
+ *  See also Enumerable#any?
+ */
+
+static VALUE
+rb_ary_any_p(VALUE ary)
+{
+    long i, len = RARRAY_LEN(ary);
+    const VALUE *ptr = RARRAY_CONST_PTR(ary);
+
+    if (!len) return Qfalse;
+    if (!rb_block_given_p()) {
+	for (i = 0; i < len; ++i) if (RTEST(ptr[i])) return Qtrue;
+    }
+    else {
+	for (i = 0; i < RARRAY_LEN(ary); ++i) {
+	    if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) return Qtrue;
+	}
+    }
+    return Qfalse;
+}
+
+/*
+ * call-seq:
+ *   ary.dig(idx, ...)                 -> object
+ *
+ * Extracts the nested value specified by the sequence of <i>idx</i>
+ * objects by calling +dig+ at each step, returning +nil+ if any
+ * intermediate step is +nil+.
+ *
+ *   a = [[1, [2, 3]]]
+ *
+ *   a.dig(0, 1, 1)                    #=> 3
+ *   a.dig(1, 2, 3)                    #=> nil
+ *   a.dig(0, 0, 0)                    #=> NoMethodError, undefined method `dig' for 1:Fixnum
+ *   [42, {foo: :bar}].dig(1, :foo)    #=> :bar
+ */
+
+VALUE
+rb_ary_dig(int argc, VALUE *argv, VALUE self)
+{
+    rb_check_arity(argc, 1, UNLIMITED_ARGUMENTS);
+    self = rb_ary_at(self, *argv);
+    if (!--argc) return self;
+    ++argv;
+    return rb_obj_dig(argc, argv, self, Qnil);
+}
+
+/*
+ *  Arrays are ordered, integer-indexed collections of any object.
+ *
+ *  Array indexing starts at 0, as in C or Java.  A negative index is assumed
+ *  to be relative to the end of the array---that is, an index of -1 indicates
+ *  the last element of the array, -2 is the next to last element in the
+ *  array, and so on.
+ *
+ *  == Creating Arrays
+ *
+ *  A new array can be created by using the literal constructor
+ *  <code>[]</code>.  Arrays can contain different types of objects.  For
+ *  example, the array below contains an Integer, a String and a Float:
+ *
+ *     ary = [1, "two", 3.0] #=> [1, "two", 3.0]
+ *
+ *  An array can also be created by explicitly calling Array.new with zero, one
+ *  (the initial size of the Array) or two arguments (the initial size and a
+ *  default object).
+ *
+ *     ary = Array.new    #=> []
+ *     Array.new(3)       #=> [nil, nil, nil]
+ *     Array.new(3, true) #=> [true, true, true]
+ *
+ *  Note that the second argument populates the array with references to the
+ *  same object.  Therefore, it is only recommended in cases when you need to
+ *  instantiate arrays with natively immutable objects such as Symbols,
+ *  numbers, true or false.
+ *
+ *  To create an array with separate objects a block can be passed instead.
+ *  This method is safe to use with mutable objects such as hashes, strings or
+ *  other arrays:
+ *
+ *     Array.new(4) { Hash.new }  #=> [{}, {}, {}, {}]
+ *     Array.new(4) {|i| i.to_s } #=> ["0", "1", "2", "3"]
+ *
+ *  This is also a quick way to build up multi-dimensional arrays:
+ *
+ *     empty_table = Array.new(3) { Array.new(3) }
+ *     #=> [[nil, nil, nil], [nil, nil, nil], [nil, nil, nil]]
+ *
+ *  An array can also be created by using the Array() method, provided by
+ *  Kernel, which tries to call #to_ary, then #to_a on its argument.
+ *
+ *	Array({:a => "a", :b => "b"}) #=> [[:a, "a"], [:b, "b"]]
+ *
+ *  == Example Usage
+ *
+ *  In addition to the methods it mixes in through the Enumerable module, the
+ *  Array class has proprietary methods for accessing, searching and otherwise
+ *  manipulating arrays.
+ *
+ *  Some of the more common ones are illustrated below.
+ *
+ *  == Accessing Elements
+ *
+ *  Elements in an array can be retrieved using the Array#[] method.  It can
+ *  take a single integer argument (a numeric index), a pair of arguments
+ *  (start and length) or a range. Negative indices start counting from the end,
+ *  with -1 being the last element.
+ *
+ *     arr = [1, 2, 3, 4, 5, 6]
+ *     arr[2]    #=> 3
+ *     arr[100]  #=> nil
+ *     arr[-3]   #=> 4
+ *     arr[2, 3] #=> [3, 4, 5]
+ *     arr[1..4] #=> [2, 3, 4, 5]
+ *     arr[1..-3] #=> [2, 3, 4]
+ *
+ *  Another way to access a particular array element is by using the #at method
+ *
+ *     arr.at(0) #=> 1
+ *
+ *  The #slice method works in an identical manner to Array#[].
+ *
+ *  To raise an error for indices outside of the array bounds or else to
+ *  provide a default value when that happens, you can use #fetch.
+ *
+ *     arr = ['a', 'b', 'c', 'd', 'e', 'f']
+ *     arr.fetch(100) #=> IndexError: index 100 outside of array bounds: -6...6
+ *     arr.fetch(100, "oops") #=> "oops"
+ *
+ *  The special methods #first and #last will return the first and last
+ *  elements of an array, respectively.
+ *
+ *     arr.first #=> 1
+ *     arr.last  #=> 6
+ *
+ *  To return the first +n+ elements of an array, use #take
+ *
+ *     arr.take(3) #=> [1, 2, 3]
+ *
+ *  #drop does the opposite of #take, by returning the elements after +n+
+ *  elements have been dropped:
+ *
+ *     arr.drop(3) #=> [4, 5, 6]
+ *
+ *  == Obtaining Information about an Array
+ *
+ *  Arrays keep track of their own length at all times.  To query an array
+ *  about the number of elements it contains, use #length, #count or #size.
+ *
+ *    browsers = ['Chrome', 'Firefox', 'Safari', 'Opera', 'IE']
+ *    browsers.length #=> 5
+ *    browsers.count #=> 5
+ *
+ *  To check whether an array contains any elements at all
+ *
+ *    browsers.empty? #=> false
+ *
+ *  To check whether a particular item is included in the array
+ *
+ *    browsers.include?('Konqueror') #=> false
+ *
+ *  == Adding Items to Arrays
+ *
+ *  Items can be added to the end of an array by using either #push or #<<
+ *
+ *    arr = [1, 2, 3, 4]
+ *    arr.push(5) #=> [1, 2, 3, 4, 5]
+ *    arr << 6    #=> [1, 2, 3, 4, 5, 6]
+ *
+ *  #unshift will add a new item to the beginning of an array.
+ *
+ *     arr.unshift(0) #=> [0, 1, 2, 3, 4, 5, 6]
+ *
+ *  With #insert you can add a new element to an array at any position.
+ *
+ *     arr.insert(3, 'apple')  #=> [0, 1, 2, 'apple', 3, 4, 5, 6]
+ *
+ *  Using the #insert method, you can also insert multiple values at once:
+ *
+ *     arr.insert(3, 'orange', 'pear', 'grapefruit')
+ *     #=> [0, 1, 2, "orange", "pear", "grapefruit", "apple", 3, 4, 5, 6]
+ *
+ *  == Removing Items from an Array
+ *
+ *  The method #pop removes the last element in an array and returns it:
+ *
+ *     arr =  [1, 2, 3, 4, 5, 6]
+ *     arr.pop #=> 6
+ *     arr #=> [1, 2, 3, 4, 5]
+ *
+ *  To retrieve and at the same time remove the first item, use #shift:
+ *
+ *     arr.shift #=> 1
+ *     arr #=> [2, 3, 4, 5]
+ *
+ *  To delete an element at a particular index:
+ *
+ *     arr.delete_at(2) #=> 4
+ *     arr #=> [2, 3, 5]
+ *
+ *  To delete a particular element anywhere in an array, use #delete:
+ *
+ *     arr = [1, 2, 2, 3]
+ *     arr.delete(2) #=> 2
+ *     arr #=> [1,3]
+ *
+ *  A useful method if you need to remove +nil+ values from an array is
+ *  #compact:
+ *
+ *     arr = ['foo', 0, nil, 'bar', 7, 'baz', nil]
+ *     arr.compact  #=> ['foo', 0, 'bar', 7, 'baz']
+ *     arr          #=> ['foo', 0, nil, 'bar', 7, 'baz', nil]
+ *     arr.compact! #=> ['foo', 0, 'bar', 7, 'baz']
+ *     arr          #=> ['foo', 0, 'bar', 7, 'baz']
+ *
+ *  Another common need is to remove duplicate elements from an array.
+ *
+ *  It has the non-destructive #uniq, and destructive method #uniq!
+ *
+ *     arr = [2, 5, 6, 556, 6, 6, 8, 9, 0, 123, 556]
+ *     arr.uniq #=> [2, 5, 6, 556, 8, 9, 0, 123]
+ *
+ *  == Iterating over Arrays
+ *
+ *  Like all classes that include the Enumerable module, Array has an each
+ *  method, which defines what elements should be iterated over and how.  In
+ *  case of Array's #each, all elements in the Array instance are yielded to
+ *  the supplied block in sequence.
+ *
+ *  Note that this operation leaves the array unchanged.
+ *
+ *     arr = [1, 2, 3, 4, 5]
+ *     arr.each { |a| print a -= 10, " " }
+ *     # prints: -9 -8 -7 -6 -5
+ *     #=> [1, 2, 3, 4, 5]
+ *
+ *  Another sometimes useful iterator is #reverse_each which will iterate over
+ *  the elements in the array in reverse order.
+ *
+ *     words = %w[first second third fourth fifth sixth]
+ *     str = ""
+ *     words.reverse_each { |word| str += "#{word} " }
+ *     p str #=> "sixth fifth fourth third second first "
+ *
+ *  The #map method can be used to create a new array based on the original
+ *  array, but with the values modified by the supplied block:
+ *
+ *     arr.map { |a| 2*a }   #=> [2, 4, 6, 8, 10]
+ *     arr                   #=> [1, 2, 3, 4, 5]
+ *     arr.map! { |a| a**2 } #=> [1, 4, 9, 16, 25]
+ *     arr                   #=> [1, 4, 9, 16, 25]
+ *
+ *  == Selecting Items from an Array
+ *
+ *  Elements can be selected from an array according to criteria defined in a
+ *  block.  The selection can happen in a destructive or a non-destructive
+ *  manner.  While the destructive operations will modify the array they were
+ *  called on, the non-destructive methods usually return a new array with the
+ *  selected elements, but leave the original array unchanged.
+ *
+ *  === Non-destructive Selection
+ *
+ *     arr = [1, 2, 3, 4, 5, 6]
+ *     arr.select { |a| a > 3 }     #=> [4, 5, 6]
+ *     arr.reject { |a| a < 3 }     #=> [3, 4, 5, 6]
+ *     arr.drop_while { |a| a < 4 } #=> [4, 5, 6]
+ *     arr                          #=> [1, 2, 3, 4, 5, 6]
+ *
+ *  === Destructive Selection
+ *
+ *  #select! and #reject! are the corresponding destructive methods to #select
+ *  and #reject
+ *
+ *  Similar to #select vs. #reject, #delete_if and #keep_if have the exact
+ *  opposite result when supplied with the same block:
+ *
+ *     arr.delete_if { |a| a < 4 } #=> [4, 5, 6]
+ *     arr                         #=> [4, 5, 6]
+ *
+ *     arr = [1, 2, 3, 4, 5, 6]
+ *     arr.keep_if { |a| a < 4 } #=> [1, 2, 3]
+ *     arr                       #=> [1, 2, 3]
+ *
  */
 
 void
-Init_Array()
+Init_Array(void)
 {
+#undef rb_intern
+#define rb_intern(str) rb_intern_const(str)
+
     rb_cArray  = rb_define_class("Array", rb_cObject);
     rb_include_module(rb_cArray, rb_mEnumerable);
 
-    rb_define_alloc_func(rb_cArray, ary_alloc);
+    rb_define_alloc_func(rb_cArray, empty_ary_alloc);
     rb_define_singleton_method(rb_cArray, "[]", rb_ary_s_create, -1);
+    rb_define_singleton_method(rb_cArray, "try_convert", rb_ary_s_try_convert, 1);
     rb_define_method(rb_cArray, "initialize", rb_ary_initialize, -1);
     rb_define_method(rb_cArray, "initialize_copy", rb_ary_replace, 1);
 
-    rb_define_method(rb_cArray, "to_s", rb_ary_to_s, 0);
     rb_define_method(rb_cArray, "inspect", rb_ary_inspect, 0);
+    rb_define_alias(rb_cArray,  "to_s", "inspect");
     rb_define_method(rb_cArray, "to_a", rb_ary_to_a, 0);
+    rb_define_method(rb_cArray, "to_h", rb_ary_to_h, 0);
     rb_define_method(rb_cArray, "to_ary", rb_ary_to_ary_m, 0);
     rb_define_method(rb_cArray, "frozen?",  rb_ary_frozen_p, 0);
 
@@ -3004,8 +5832,8 @@ Init_Array()
     rb_define_method(rb_cArray, "concat", rb_ary_concat, 1);
     rb_define_method(rb_cArray, "<<", rb_ary_push, 1);
     rb_define_method(rb_cArray, "push", rb_ary_push_m, -1);
-    rb_define_method(rb_cArray, "pop", rb_ary_pop, 0);
-    rb_define_method(rb_cArray, "shift", rb_ary_shift, 0);
+    rb_define_method(rb_cArray, "pop", rb_ary_pop_m, -1);
+    rb_define_method(rb_cArray, "shift", rb_ary_shift_m, -1);
     rb_define_method(rb_cArray, "unshift", rb_ary_unshift_m, -1);
     rb_define_method(rb_cArray, "insert", rb_ary_insert, -1);
     rb_define_method(rb_cArray, "each", rb_ary_each, 0);
@@ -3014,20 +5842,24 @@ Init_Array()
     rb_define_method(rb_cArray, "length", rb_ary_length, 0);
     rb_define_alias(rb_cArray,  "size", "length");
     rb_define_method(rb_cArray, "empty?", rb_ary_empty_p, 0);
-    rb_define_method(rb_cArray, "index", rb_ary_index, 1);
-    rb_define_method(rb_cArray, "rindex", rb_ary_rindex, 1);
-    rb_define_method(rb_cArray, "indexes", rb_ary_indexes, -1);
-    rb_define_method(rb_cArray, "indices", rb_ary_indexes, -1);
+    rb_define_method(rb_cArray, "find_index", rb_ary_index, -1);
+    rb_define_method(rb_cArray, "index", rb_ary_index, -1);
+    rb_define_method(rb_cArray, "rindex", rb_ary_rindex, -1);
     rb_define_method(rb_cArray, "join", rb_ary_join_m, -1);
     rb_define_method(rb_cArray, "reverse", rb_ary_reverse_m, 0);
     rb_define_method(rb_cArray, "reverse!", rb_ary_reverse_bang, 0);
+    rb_define_method(rb_cArray, "rotate", rb_ary_rotate_m, -1);
+    rb_define_method(rb_cArray, "rotate!", rb_ary_rotate_bang, -1);
     rb_define_method(rb_cArray, "sort", rb_ary_sort, 0);
     rb_define_method(rb_cArray, "sort!", rb_ary_sort_bang, 0);
+    rb_define_method(rb_cArray, "sort_by!", rb_ary_sort_by_bang, 0);
     rb_define_method(rb_cArray, "collect", rb_ary_collect, 0);
     rb_define_method(rb_cArray, "collect!", rb_ary_collect_bang, 0);
     rb_define_method(rb_cArray, "map", rb_ary_collect, 0);
     rb_define_method(rb_cArray, "map!", rb_ary_collect_bang, 0);
     rb_define_method(rb_cArray, "select", rb_ary_select, 0);
+    rb_define_method(rb_cArray, "select!", rb_ary_select_bang, 0);
+    rb_define_method(rb_cArray, "keep_if", rb_ary_keep_if, 0);
     rb_define_method(rb_cArray, "values_at", rb_ary_values_at, -1);
     rb_define_method(rb_cArray, "delete", rb_ary_delete, 1);
     rb_define_method(rb_cArray, "delete_at", rb_ary_delete_at_m, 1);
@@ -3059,10 +5891,30 @@ Init_Array()
     rb_define_method(rb_cArray, "uniq!", rb_ary_uniq_bang, 0);
     rb_define_method(rb_cArray, "compact", rb_ary_compact, 0);
     rb_define_method(rb_cArray, "compact!", rb_ary_compact_bang, 0);
-    rb_define_method(rb_cArray, "flatten", rb_ary_flatten, 0);
-    rb_define_method(rb_cArray, "flatten!", rb_ary_flatten_bang, 0);
-    rb_define_method(rb_cArray, "nitems", rb_ary_nitems, 0);
+    rb_define_method(rb_cArray, "flatten", rb_ary_flatten, -1);
+    rb_define_method(rb_cArray, "flatten!", rb_ary_flatten_bang, -1);
+    rb_define_method(rb_cArray, "count", rb_ary_count, -1);
+    rb_define_method(rb_cArray, "shuffle!", rb_ary_shuffle_bang, -1);
+    rb_define_method(rb_cArray, "shuffle", rb_ary_shuffle, -1);
+    rb_define_method(rb_cArray, "sample", rb_ary_sample, -1);
+    rb_define_method(rb_cArray, "cycle", rb_ary_cycle, -1);
+    rb_define_method(rb_cArray, "permutation", rb_ary_permutation, -1);
+    rb_define_method(rb_cArray, "combination", rb_ary_combination, 1);
+    rb_define_method(rb_cArray, "repeated_permutation", rb_ary_repeated_permutation, 1);
+    rb_define_method(rb_cArray, "repeated_combination", rb_ary_repeated_combination, 1);
+    rb_define_method(rb_cArray, "product", rb_ary_product, -1);
+
+    rb_define_method(rb_cArray, "take", rb_ary_take, 1);
+    rb_define_method(rb_cArray, "take_while", rb_ary_take_while, 0);
+    rb_define_method(rb_cArray, "drop", rb_ary_drop, 1);
+    rb_define_method(rb_cArray, "drop_while", rb_ary_drop_while, 0);
+    rb_define_method(rb_cArray, "bsearch", rb_ary_bsearch, 0);
+    rb_define_method(rb_cArray, "bsearch_index", rb_ary_bsearch_index, 0);
+    rb_define_method(rb_cArray, "any?", rb_ary_any_p, 0);
+    rb_define_method(rb_cArray, "dig", rb_ary_dig, -1);
 
     id_cmp = rb_intern("<=>");
-    inspect_key = rb_intern("__inspect_key__");
+    id_random = rb_intern("random");
+    id_div = rb_intern("div");
+    id_power = rb_intern("**");
 }
diff --git a/bcc32/Makefile.sub b/bcc32/Makefile.sub
deleted file mode 100644
index b5546104d0..0000000000
--- a/bcc32/Makefile.sub
+++ /dev/null
@@ -1,499 +0,0 @@
-# -*- makefile -*-
-
-SHELL = $(COMSPEC)
-MKFILES = Makefile
-
-#### Start of system configuration section. ####
-OS = bccwin32
-RT = $(OS)
-
-## variables may be overridden by $(compile_dir)/Makefile
-!ifndef srcdir
-srcdir = ..
-!endif
-!ifndef RUBY_INSTALL_NAME
-RUBY_INSTALL_NAME = ruby
-!endif
-!ifndef RUBYW_INSTALL_NAME
-RUBYW_INSTALL_NAME = $(RUBY_INSTALL_NAME:ruby=rubyw)
-!elif "$(RUBYW_INSTALL_NAME)" == "$(RUBY_INSTALL_NAME)"
-RUBYW_INSTALL_NAME = $(RUBY_INSTALL_NAME:ruby=rubyw)
-!endif
-!if "$(RUBYW_INSTALL_NAME)" == "$(RUBY_INSTALL_NAME)"
-RUBYW_INSTALL_NAME = $(RUBY_INSTALL_NAME)w
-!endif
-!ifndef RUBY_SO_NAME
-RUBY_SO_NAME = $(RT)-$(RUBY_INSTALL_NAME)$(MAJOR)$(MINOR)
-!endif
-!ifndef icondirs
-!ifdef ICONDIRS
-icondirs=$(ICONDIRS)
-!endif
-!endif
-!ifdef icondirs
-icondirs=$(icondirs:\=/)
-iconinc=-I$(icondirs: = -I)
-!endif
-###############
-
-VPATH = $(srcdir):$(srcdir)/missing
-.SUFFIXES: .y
-
-!ifndef CC
-CC = bcc32
-!endif
-!ifndef CPP
-CPP = cpp32
-!endif
-!ifndef RC
-RC = brcc32
-!endif
-!ifndef YACC
-YACC = byacc
-!endif
-!ifndef AR
-AR = tlib
-!endif
-
-PURIFY =
-AUTOCONF = autoconf
-RM = $(srcdir:/=\)\win32\rm.bat
-
-!if !defined(PROCESSOR_ARCHITECTURE)
-PROCESSOR_ARCHITECTURE = x86
-!endif
-MACHINE = $(PROCESSOR_ARCHITECTURE)
-!if "$(PROCESSOR_ARCHITECTURE)" == "x86"
-!ifndef PROCESSOR_LEVEL
-PROCESSOR_LEVEL = 5
-!endif
-!if 6 < $(PROCESSOR_LEVEL)
-PROCESSOR_LEVEL = 6
-!endif
-PROCESSOR_FLAG = -$(PROCESSOR_LEVEL)
-CPU = i$(PROCESSOR_LEVEL)86
-ARCH = i386
-!else
-CPU = $(PROCESSOR_ARCHITECTURE)
-ARCH = $(PROCESSOR_ARCHITECTURE)
-!endif
-!ifndef DEBUGFLAGS
-DEBUGFLAGS = 
-!endif
-!ifndef OPTFLAGS
-OPTFLAGS = -O
-!endif
-
-!ifndef prefix
-prefix = /usr
-!endif
-!ifndef exec_prefix
-exec_prefix = $(prefix)
-!endif
-!ifndef libdir
-libdir = $(exec_prefix)/lib
-!endif
-!if !defined(datadir)
-datadir = /share
-!endif
-!ifndef EXTOUT
-EXTOUT = .ext
-!endif
-!ifndef RIDATADIR
-RIDATADIR = $(DESTDIR)$(datadir)/ri/$(MAJOR).$(MINOR)/system
-!endif
-!ifndef TESTUI
-TESTUI = console
-!endif
-!ifndef TESTS
-TESTS =
-!endif
-!ifndef RDOCTARGET
-RDOCTARGET = install-nodoc
-!endif
-
-OUTFLAG       = -o
-!ifndef CFLAGS
-CFLAGS = -q -tWR -tWC $(DEBUGFLAGS) $(OPTFLAGS) $(PROCESSOR_FLAG) -w- -wsus -wcpt -wdup -wext -wrng -wrpt -wzdi
-!endif
-!ifndef LDFLAGS
-LDFLAGS = -S:$(STACK)
-!endif
-!ifndef RFLAGS
-RFLAGS = $(iconinc)
-!endif
-!ifndef EXTLIBS
-EXTLIBS =
-!endif
-!ifndef MEMLIB
-MEMLIB =
-!endif
-LIBS = $(MEMLIB) cw32i.lib import32.lib ws2_32.lib $(EXTLIBS)
-MISSING = acosh.obj crypt.obj erf.obj win32.obj
-
-!ifndef STACK
-STACK = 0x2000000
-!endif
-
-XCFLAGS = -DRUBY_EXPORT -I. -I$(srcdir) -I$(srcdir)/missing
-
-ARFLAGS = /a
-LD = ilink32 -q -Gn
-LDSHARED  = $(LD)
-XLDFLAGS  = -Tpe c0x32.obj
-WLDFLAGS  = -aa -Tpe c0w32.obj
-DLDFLAGS  = -Tpd c0d32.obj
-LIBRUBY_LDSHARED = $(LDSHARED)
-LIBRUBY_DLDFLAGS = -Gi $(DLDFLAGS) $(EXTLDFLAGS)
-LDOBJECTS = $(MAINOBJ)
-
-SOLIBS = 
-
-EXEEXT = .exe
-PROGRAM=$(RUBY_INSTALL_NAME)$(EXEEXT)
-WPROGRAM=$(RUBYW_INSTALL_NAME)$(EXEEXT)
-RUBYDEF = $(RUBY_SO_NAME).def
-MINIRUBY = .\miniruby$(EXEEXT) $(MINIRUBYOPT)
-RUNRUBY = .\ruby$(EXEEXT) "$(srcdir)/runruby.rb" --extout="$(EXTOUT)" --
-
-ORGLIBPATH = $(LIB)
-
-#### End of system configuration section. ####
-
-LIBRUBY_A     = $(RUBY_SO_NAME)-static.lib
-LIBRUBY_SO    = $(RUBY_SO_NAME).dll
-LIBRUBY       = $(RUBY_SO_NAME).lib
-LIBRUBYARG    = $(LIBRUBY)
-
-PREP          = miniruby$(EXEEXT)
-
-OBJEXT        = obj
-
-INSTALLED_LIST= .installed.list
-
-WINMAINOBJ    = winmain.$(OBJEXT)
-MINIOBJS      = dmydln.$(OBJEXT)
-
-.path.c = .;$(srcdir);$(srcdir)/win32;$(srcdir)/missing
-.path.h = .;$(srcdir);$(srcdir)/win32;$(srcdir)/missing
-.path.y = $(srcdir)
-.path. = $(srcdir)
-
-.c.obj:
-	$(CC) $(CFLAGS) $(XCFLAGS) -I. $(CPPFLAGS) -c $(<:/=\)
-
-.rc.res:
-	$(RC) $(RFLAGS) -I. -I$(<D). $(iconinc) -I$(srcdir)/win32 $(RFLAGS) -fo$@ $(<:/=\)
-
-.y.c:
-	$(YACC) $(YFLAGS) $(<:\=/)
-	sed -e "s!^ *extern char \*getenv();!/* & */!;s/^\(#.*\)y\.tab/\1parse/" y.tab.c > $(@F)
-	@del y.tab.c
-
-all: $(srcdir)/bcc32/Makefile.sub $(srcdir)/common.mk
-
-ruby: $(PROGRAM)
-rubyw: $(WPROGRAM)
-
-!include $(srcdir)/common.mk
-
-PHONY: Makefile
-
-CONFIG_H = ./.config.h.time
-
-config: config.status
-
-config.status: $(CONFIG_H)
-
-$(CONFIG_H): $(MKFILES) $(srcdir)/bcc32/Makefile.sub
-	@$(srcdir:/=\)\win32\ifchange.bat config.h &&|
-\#define HAVE_SYS_TYPES_H 1
-\#define HAVE_SYS_STAT_H 1
-\#define HAVE_STDLIB_H 1
-\#define HAVE_STRING_H 1
-\#define HAVE_MEMORY_H 1
-\#define HAVE_OFF_T 1
-\#define SIZEOF_INT 4
-\#define SIZEOF_SHORT 2
-\#define SIZEOF_LONG 4
-\#define SIZEOF_LONG_LONG 0
-\#define SIZEOF___INT64 8
-\#define SIZEOF_OFF_T 4
-\#define SIZEOF_VOIDP 4
-\#define SIZEOF_FLOAT 4
-\#define SIZEOF_DOUBLE 8
-\#define SIZEOF_TIME_T 4
-\#define HAVE_PROTOTYPES 1
-\#define TOKEN_PASTE(x,y) x\#\#y
-\#define HAVE_STDARG_PROTOTYPES 1
-\#define NORETURN(x) x
-\#define RUBY_EXTERN extern __declspec(dllimport)
-\#define HAVE_DECL_SYS_NERR 1
-\#define HAVE_LIMITS_H 1
-\#define HAVE_FCNTL_H 1
-\#define HAVE_UTIME_H 1
-\#define HAVE_FLOAT_H 1
-\#define rb_uid_t uid_t
-\#define rb_gid_t gid_t
-\#define rb_pid_t int
-\#define HAVE_STRUCT_STAT_ST_RDEV 1
-\#define HAVE_ST_RDEV 1
-\#define GETGROUPS_T int
-\#define RETSIGTYPE void
-\#define HAVE_ALLOCA 1
-\#define HAVE_DUP2 1
-\#define HAVE_MEMMOVE 1
-\#define HAVE_MKDIR 1
-\#define HAVE_STRCASECMP 1
-\#define HAVE_STRNCASECMP 1
-\#define HAVE_STRERROR 1
-\#define HAVE_STRFTIME 1
-\#define HAVE_STRCHR 1
-\#define HAVE_STRSTR 1
-\#define HAVE_STRTOD 1
-\#define HAVE_STRTOL 1
-\#define HAVE_STRTOUL 1
-\#define HAVE_ISNAN 1
-\#define HAVE_FINITE 1
-\#define HAVE_HYPOT 1
-\#define HAVE_FMOD 1
-\#define HAVE_WAITPID 1
-\#define HAVE_FSYNC 1
-\#define HAVE_GETCWD 1
-\#define HAVE_CHSIZE 1
-\#define HAVE_TIMES 1
-\#define HAVE_FCNTL 1
-\#define HAVE_LINK 1
-\#define HAVE_TELLDIR 1
-\#define HAVE_SEEKDIR 1
-\#define HAVE_COSH 1
-\#define HAVE_SINH 1
-\#define HAVE_TANH 1
-\#define RSHIFT(x,y) ((x)>>(int)y)
-\#define FILE_COUNT level
-\#define FILE_READPTR curp
-\#define inline __inline
-\#define NEED_IO_SEEK_BETWEEN_RW 1
-\#define STACK_GROW_DIRECTION -1
-\#define DEFAULT_KCODE KCODE_NONE
-\#define DLEXT ".so"
-\#define RUBY_LIB "/lib/ruby/$(MAJOR).$(MINOR)"
-\#define RUBY_SITE_LIB "/lib/ruby/site_ruby"
-\#define RUBY_SITE_LIB2 "/lib/ruby/site_ruby/$(MAJOR).$(MINOR)"
-\#define RUBY_PLATFORM "$(ARCH)-$(OS)"
-\#define RUBY_ARCHLIB "/lib/ruby/$(MAJOR).$(MINOR)/$(ARCH)-$(OS)"
-\#define RUBY_SITE_ARCHLIB "/lib/ruby/site_ruby/$(MAJOR).$(MINOR)/$(ARCH)-$(OS)"
-|
-	@exit > $@
-
-config.status: $(MKFILES) $(srcdir)/bcc32/Makefile.sub $(srcdir)/common.mk
-	@echo Creating $@
-	@type > $@ &&|
-# Generated automatically by Makefile.sub.
-s,@SHELL@,$$(COMSPEC),;t t
-s,@BUILD_FILE_SEPARATOR@,\,;t t
-s,@PATH_SEPARATOR@,;,;t t
-s,@CFLAGS@,$(CFLAGS),;t t
-s,@CPPFLAGS@,$(CPPFLAGS),;t t
-s,@CXXFLAGS@,$(CXXFLAGS),;t t
-s,@FFLAGS@,$(FFLAGS),;t t
-s,@LDFLAGS@,,;t t
-s,@LIBS@,$(LIBS),;t t
-s,@exec_prefix@,$${prefix},;t t
-s,@prefix@,,;t t
-s,@program_transform_name@,s,,,,;t t
-s,@bindir@,$${exec_prefix}/bin,;t t
-s,@sbindir@,$${exec_prefix}/sbin,;t t
-s,@libexecdir@,$${exec_prefix}/libexec,;t t
-s,@datadir@,$${prefix}/share,;t t
-s,@sysconfdir@,$${prefix}/etc,;t t
-s,@sharedstatedir@,/etc,;t t
-s,@localstatedir@,/var,;t t
-s,@libdir@,$${exec_prefix}/lib,;t t
-s,@includedir@,$${prefix}/include,;t t
-s,@oldincludedir@,/usr/include,;t t
-s,@infodir@,$${prefix}/info,;t t
-s,@mandir@,$${prefix}/man,;t t
-s,@build@,$(CPU)-pc-$(OS),;t t
-s,@build_alias@,$(CPU)-$(OS),;t t
-s,@build_cpu@,$(CPU),;t t
-s,@build_vendor@,pc,;t t
-s,@build_os@,$(OS),;t t
-s,@host@,$(CPU)-pc-$(OS),;t t
-s,@host_alias@,$(CPU)-$(OS),;t t
-s,@host_cpu@,$(CPU),;t t
-s,@host_vendor@,pc,;t t
-s,@host_os@,$(OS),;t t
-s,@target@,$(ARCH)-pc-$(OS),;t t
-s,@target_alias@,$(ARCH)-$(OS),;t t
-s,@target_cpu@,$(ARCH),;t t
-s,@target_vendor@,pc,;t t
-s,@target_os@,$(OS),;t t
-s,@CC@,$(CC),;t t
-s,@CPP@,cpp32,;t t
-s,@YACC@,$(YACC),;t t
-s,@RANLIB@,,;t t
-s,@AR@,$(AR),;t t
-s,@ARFLAGS@,$(ARFLAGS) ,;t t
-s,@LN_S@,$(LN_S),;t t
-s,@SET_MAKE@,$(SET_MAKE),;t t
-s,@CP@,copy > nul,;t t
-s,@LIBOBJS@, acosh.obj crypt.obj erf.obj win32.obj,;t t
-s,@ALLOCA@,$(ALLOCA),;t t
-s,@DEFAULT_KCODE@,$(DEFAULT_KCODE),;t t
-s,@EXEEXT@,.exe,;t t
-s,@OBJEXT@,obj,;t t
-s,@XCFLAGS@,$(XCFLAGS),;t t
-s,@XLDFLAGS@,$(XLDFLAGS),;t t
-s,@DLDFLAGS@,$(DLDFLAGS),;t t
-s,@ARCH_FLAG@,$(ARCH_FLAG),;t t
-s,@STATIC@,$(STATIC),;t t
-s,@CCDLFLAGS@,,;t t
-s,@LDSHARED@,$(LDSHARED),;t t
-s,@DLEXT@,so,;t t
-s,@LIBEXT@,lib,;t t
-s,@STRIP@,$(STRIP),;t t
-s,@EXTSTATIC@,$(EXTSTATIC),;t t
-s,@setup@,Setup,;t t
-s,@MINIRUBY@,$(MINIRUBY),;t t
-s,@PREP@,miniruby$(EXEEXT),;t t
-s,@RUNRUBY@,$(RUNRUBY),;t t
-s,@EXTOUT@,$(EXTOUT),;t t
-s,@ARCHFILE@,,;t t
-s,@RDOCTARGET@,,;t t
-s,@LIBRUBY_LDSHARED@,$$(LDSHARED),;t t
-s,@LIBRUBY_DLDFLAGS@,-Gi $$(DLDFLAGS),;t t
-s,@RUBY_INSTALL_NAME@,$(RUBY_INSTALL_NAME),;t t
-s,@rubyw_install_name@,$(RUBYW_INSTALL_NAME),;t t
-s,@RUBYW_INSTALL_NAME@,$(RUBYW_INSTALL_NAME),;t t
-s,@RUBY_SO_NAME@,$(RUBY_SO_NAME),;t t
-s,@LIBRUBY_A@,$$(RUBY_SO_NAME)-static.lib,;t t
-s,@LIBRUBY_SO@,$$(RUBY_SO_NAME).dll,;t t
-s,@LIBRUBY_ALIASES@,$(LIBRUBY_ALIASES),;t t
-s,@LIBRUBY@,$$(RUBY_SO_NAME).lib,;t t
-s,@LIBRUBYARG@,$$(LIBRUBYARG_SHARED),;t t
-s,@LIBRUBYARG_STATIC@,$$(LIBRUBY_A),;t t
-s,@LIBRUBYARG_SHARED@,$$(LIBRUBY),;t t
-s,@SOLIBS@,$(SOLIBS),;t t
-s,@DLDLIBS@,$(DLDLIBS),;t t
-s,@ENABLE_SHARED@,yes,;t t
-s,@OUTFLAG@,$(OUTFLAG),;t t
-s,@CPPOUTFILE@,,;t t
-s,@LIBPATHFLAG@, -L"%s",;t t
-s,@RPATHFLAG@,,;t t
-s,@LIBARG@,%s.lib,;t t
-s,@LINK_SO@,$$(LDSHARED) $$(DLDFLAGS) $$(LIBPATH) $$(OBJS), $$(@:/=\), nul, $$(LIBS) $$(LOCAL_LIBS), $$(DEFFILE), $$(RESFILE),;t t
-s,@COMPILE_C@,$$(CC) $$(INCFLAGS) $$(CFLAGS) $$(CPPFLAGS) -c $$(<:/=\),;t t
-s,@COMPILE_CXX@,$$(CXX) $$(INCFLAGS) $$(CXXFLAGS) $$(CPPFLAGS) -P -c $$(<:/=\),;t t
-s,@COMPILE_RULES@,{$$(srcdir)}.%s{}.%s: {$$(topdir)}.%s{}.%s: {$$(hdrdir)}.%s{}.%s: .%s.%s:,;t t
-s,@RULE_SUBST@,{.;$$(VPATH)}%s,;t t
-s,@COMMON_LIBS@,m advapi32 avicap32 avifil32 cap comctl32 comdlg32 dlcapi gdi32 glu32 imagehlp imm32 inetmib1 kernel32 loadperf lsapi32 lz32 mapi32 mgmtapi mpr msacm32 msvfw32 nddeapi netapi32 ole32 oleaut32 oledlg olepro32 opengl32 pdh pkpd32 rasapi32 rasdlg rassapi rpcrt4 setupapi shell32 shfolder snmpapi sporder tapi32 url user32 vdmdbg version win32spl winmm wintrust wsock32,;t t
-s,@COMMON_MACROS@,WIN32_LEAN_AND_MEAN WIN32,;t t
-s,@COMMON_HEADERS@,winsock2.h windows.h,;t t
-s,@TRY_LINK@,$$(CC) -oconftest $$(INCFLAGS) -I$$(hdrdir) $$(CPPFLAGS) $$(CFLAGS) $$(LIBPATH) $$(LDFLAGS) $$(src) $$(LOCAL_LIBS) $$(LIBS),;t t
-s,@EXPORT_PREFIX@,_,;t t
-s,@arch@,$(ARCH)-$(OS),;t t
-s,@sitearch@,$(ARCH)-$(OS),;t t
-s,@sitedir@,$${prefix}/lib/ruby/site_ruby,;t t
-s,@configure_args@,--enable-shared $(configure_args),;t t
-s,@configure_input@,$$configure_input,;t t
-s,@srcdir@,$(srcdir),;t t
-s,@top_srcdir@,$(srcdir),;t t
-|
-
-miniruby$(EXEEXT):
-		@echo $(LIBS)
-		$(LD) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ) $(MINIOBJS),$@,nul,$(LIBRUBY_A) $(LIBS)
-
-$(PROGRAM):	$(MAINOBJ) $(LIBRUBY_SO) $(RUBY_INSTALL_NAME).res
-		$(LD) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ),$@,nul,$(LIBRUBYARG) $(LIBS),,$(RUBY_INSTALL_NAME).res
-
-$(WPROGRAM):	$(MAINOBJ) $(WINMAINOBJ) $(LIBRUBY_SO) $(RUBYW_INSTALL_NAME).res
-		$(LD) $(LDFLAGS) $(WLDFLAGS) $(MAINOBJ) $(WINMAINOBJ),$@,nul,$(LIBRUBYARG) $(LIBS),,$(RUBYW_INSTALL_NAME).res
-
-$(LIBRUBY_A):	$(OBJS) $(DMYEXT)
-		@-if exist $@ del $@
-		$(AR) $(ARFLAGS) "$@" $(OBJS) $(DMYEXT)
-
-# $(LIBRUBY):	$(LIBRUBY_SO)
-#		implib $@ $(LIBRUBY_SO)
-
-$(LIBRUBY_SO): $(LIBRUBY_A) $(DLDOBJS) $(RUBYDEF) $(RUBY_SO_NAME).res
-		@echo $(DLDOBJS)
-		@$(PRE_LIBRUBY_UPDATE)
-		$(LIBRUBY_LDSHARED) $(LIBRUBY_DLDFLAGS) $(DLDOBJS:/=\),$(LIBRUBY_SO),nul,$(LIBRUBY_A) $(LIBS),$(RUBYDEF),$(RUBY_SO_NAME).res
-
-$(LIBRUBY): $(LIBRUBY_SO)
-
-$(RUBYDEF):	$(LIBRUBY_A) $(PREP)
-		$(MINIRUBY) $(srcdir)/bcc32/mkexports.rb -output=$@ -base=$(RUBY_SO_NAME) $(LIBRUBY_A)
-
-$(RUBY_INSTALL_NAME).rc $(RUBYW_INSTALL_NAME).rc $(RUBY_SO_NAME).rc: rbconfig.rb
-		@$(MINIRUBY) $(srcdir)/win32/resource.rb \
-			-ruby_name=$(RUBY_INSTALL_NAME) \
-			-rubyw_name=$(RUBYW_INSTALL_NAME) \
-			-so_name=$(RUBY_SO_NAME) \
-			. $(icondirs) $(srcdir)/win32
-
-post-install-bin::
-	@$(NULLCMD)
-post-install-lib::
-	@$(NULLCMD)
-post-install-ext-comm::
-	@$(NULLCMD)
-post-install-ext-arch::
-	@$(NULLCMD)
-post-install-man::
-	@$(NULLCMD)
-post-install-doc::
-	@$(NULLCMD)
-
-clean-local::
-		@$(RM) ext\extinit.c ext\extinit.$(OBJEXT) *.tds *.il? $(RUBY_SO_NAME).lib
-		@$(RM) $(RUBY_INSTALL_NAME).res $(RUBYW_INSTALL_NAME).res $(RUBY_SO_NAME).res
-
-distclean-local::
-		@$(RM) ext\config.cache $(RBCONFIG:/=\)
-		@$(RM) *.map *.pdb *.ilk *.exp $(RUBYDEF)
-		@$(RM) $(RUBY_INSTALL_NAME).rc $(RUBYW_INSTALL_NAME).rc $(RUBY_SO_NAME).rc
-
-ext/extinit.obj: ext/extinit.c $(SETUP)
-	$(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) -o$@ -c ext/extinit.c
-
-main.$(OBJEXT): win32.h
-array.$(OBJEXT): win32.h
-bignum.$(OBJEXT): win32.h
-class.$(OBJEXT): win32.h
-compar.$(OBJEXT): win32.h
-dir.$(OBJEXT): dir.h win32.h
-dln.$(OBJEXT): win32.h
-enum.$(OBJEXT): win32.h
-error.$(OBJEXT): win32.h
-eval.$(OBJEXT): win32.h
-file.$(OBJEXT): win32.h
-gc.$(OBJEXT): win32.h
-hash.$(OBJEXT): win32.h
-inits.$(OBJEXT): win32.h
-io.$(OBJEXT): win32.h
-marshal.$(OBJEXT): win32.h
-math.$(OBJEXT): win32.h
-numeric.$(OBJEXT): win32.h
-object.$(OBJEXT): win32.h
-pack.$(OBJEXT): win32.h
-parse.$(OBJEXT): win32.h
-process.$(OBJEXT): win32.h
-prec.$(OBJEXT): win32.h
-random.$(OBJEXT): win32.h
-range.$(OBJEXT): win32.h
-re.$(OBJEXT): win32.h
-regex.$(OBJEXT): win32.h
-ruby.$(OBJEXT): win32.h
-signal.$(OBJEXT): win32.h
-sprintf.$(OBJEXT): win32.h
-st.$(OBJEXT): win32.h
-string.$(OBJEXT): win32.h
-struct.$(OBJEXT): win32.h
-time.$(OBJEXT): win32.h
-util.$(OBJEXT): win32.h
-variable.$(OBJEXT): win32.h
-version.$(OBJEXT): win32.h
diff --git a/bcc32/README.bcc32 b/bcc32/README.bcc32
deleted file mode 100644
index c27a1261f1..0000000000
--- a/bcc32/README.bcc32
+++ /dev/null
@@ -1,137 +0,0 @@
-=begin
-
-= How to build ruby using Borland C++
-
-== Requirement
-
-(1) Borland C++ 5.0 or later.
-
-(2) Please set environment variable (({PATH}))
-    to run required commands properly from the command line.
-
-    Note: building ruby requires following commands.
-     * make
-     * bcc32
-     * tlib
-     * ilink32
-
-(3) If you want to build from CVS source, following commands are required.
-     * byacc ((<URL:http://gnuwin32.sourceforge.net/packages/byacc.htm>))
-     * sed   ((<URL:http://gnuwin32.sourceforge.net/packages/sed.htm>))
-
-(4) We strongly recommend to build ruby on C++Builder, to link following files.
-     * usebormm.lib
-     * memmgr.lib
-
-    RTL's internal memory manager cannot handle large memory block properly,
-    so we should use borlndmm.dll instead.
-     10000.times { "" << "." * 529671; GC.start } # crash
-
-== How to compile and install
-
-(1) Execute bcc32\configure.bat on your build directory.
-     ex. c:\ruby-1.6.7>bcc32\configure.bat
-     
-(2) Change ((|RUBY_INSTALL_NAME|)) and ((|RUBY_SO_NAME|)) in (({Makefile}))
-    if you want to change the name of the executable files. 
-    And add ((|RUBYW_INSTALL_NAME|)) to change the name of the
-    executable without console window if also you want.
-
-(3) Run `((%make%))'
-
-(4) Run `((%make test%))'
-
-(5) Run `((%make DESTDIR=<install_directory> install%))'
-
-    This command will create following directories and install files onto them.
-      * <install_directory>\bin
-      * <install_directory>\lib
-      * <install_directory>\lib\ruby
-      * <install_directory>\lib\ruby\<MAJOR>.<MINOR>
-      * <install_directory>\lib\ruby\<MAJOR>.<MINOR>\<PLATFORM>
-      * <install_directory>\lib\ruby\site_ruby
-      * <install_directory>\lib\ruby\site_ruby\<MAJOR>.<MINOR>
-      * <install_directory>\lib\ruby\site_ruby\<MAJOR>.<MINOR>\<PLATFORM>
-      * <install_directory>\man\man1
-    If Ruby's version is `x.y.z', the ((|<MAJOR>|)) is `x' and the ((|<MINOR>|)) is `y'.
-    The ((|<PLATFORM>|)) is usually `(({i586-bccwin32}))'.
-
-(6) Requires dynamic RTL (cc3250.dll on C++Builder5) and borlndmm.dll (If built with
-    usebormm.lib) to use installed binary. These files are ordinary in bcc32's bin
-    directory.
-
-== Icons
-
-Any icon files(*.ico) in the build directory, directories specified with
-((|icondirs|)) make variable and (({win32})) directory under the ruby
-source directory will be included in DLL or executable files, according
-to their base names.
-    $(RUBY_INSTALL_NAME).ico or ruby.ico   --> $(RUBY_INSTALL_NAME).exe
-    $(RUBYW_INSTALL_NAME).ico or rubyw.ico --> $(RUBYW_INSTALL_NAME).exe
-    the others                             --> $(RUBY_SO_NAME).dll
-
-Although no icons are distributed with the ruby source or in the official 
-site, you can use anything you like. For example, followings are written 
-in Japanese, but you can download at least.
-
-* ((<URL:http://member.nifty.ne.jp/ueivu/rubyico.html>)) or
-  ((<zipped icons|URL:http://member.nifty.ne.jp/ueivu/Ruby_ico.zip>))
-* ((<URL:http://homepage1.nifty.com/a_nakata/ruby/>)) or
-  ((<icon itself|URL:http://homepage1.nifty.com/a_nakata/ruby/RubyIcon.ico>))
-
-== Build examples
-
-* Build on the ruby source directory.
-
-  ex.)
-    ruby source directory:  C:\ruby
-    build directory:        C:\ruby
-    install directory:      C:\usr\local
-
-    C:
-    cd \ruby
-    bcc32\configure
-    make
-    make test
-    make DESTDIR=/usr/local install
-
-* Build on the relative directory from the ruby source directory and CPU type 
-  i386.
-
-  ex.)
-    ruby source directory:  C:\ruby
-    build directory:        C:\ruby\bccwin32
-    install directory:      C:\usr\local
-    CPU                     i386
-    
-    C:
-    cd \ruby
-    mkdir bccwin32
-    cd bccwin32
-    ..\bcc32\configure target i386-bccwin32
-    make
-    make test
-    make DESTDIR=/usr/local install
-
-* Build on the different drive.
-
-  ex.)
-    ruby source directory:  C:\src\ruby
-    build directory:        D:\build\ruby
-    install directory:      C:\usr\local
-
-    D:
-    cd D:\build\ruby
-    C:\src\ruby\bcc32\configure
-    make
-    make test
-    make DESTDIR=C:/usr/local install
-
-== Bugs
-
-You can ((*NOT*)) use a path name contains any white space characters as
-the ruby source directory, this restriction comes from the behavior of
-(({!INCLUDE})) directives of (({MAKE})).
-((- you may call it a bug. -))
-
-=end
diff --git a/bcc32/configure.bat b/bcc32/configure.bat
deleted file mode 100755
index 143ad947f0..0000000000
--- a/bcc32/configure.bat
+++ /dev/null
@@ -1,92 +0,0 @@
-@echo off
-::: Don't set environment variable in batch file other than autoexec.bat
-::: to avoid "Out of environment space" problem on Windows 95/98.
-::: set TMPMAKE=~tmp~.mak
-
-echo> ~tmp~.mak ####
-echo>> ~tmp~.mak conf = %0
-echo>> ~tmp~.mak $(conf:\=/): nul
-echo>> ~tmp~.mak 	@del ~tmp~.mak
-echo>> ~tmp~.mak 	@-$(MAKE) -l$(MAKEFLAGS) -f $(@D)setup.mak \
-:loop
-if "%1" == "" goto :end
-if "%1" == "--prefix" goto :prefix
-if "%1" == "--srcdir" goto :srcdir
-if "%1" == "srcdir" goto :srcdir
-if "%1" == "--target" goto :target
-if "%1" == "target" goto :target
-if "%1" == "--with-static-linked-ext" goto :extstatic
-if "%1" == "--program-suffix" goto :suffix
-if "%1" == "--program-name" goto :progname
-if "%1" == "--enable-install-doc" goto :enable-rdoc
-if "%1" == "--disable-install-doc" goto :disable-rdoc
-if "%1" == "--extout" goto :extout
-if "%1" == "-h" goto :help
-if "%1" == "--help" goto :help
-  echo>> ~tmp~.mak 	"%1" \
-  shift
-goto :loop
-:srcdir
-  echo>> ~tmp~.mak 	-D"srcdir=%2" \
-  shift
-  shift
-goto :loop
-:prefix
-  echo>> ~tmp~.mak 	-D"prefix=%2" \
-  shift
-  shift
-goto :loop
-:suffix
-  echo>> ~tmp~.mak 	-D"RUBY_SUFFIX=%2" \
-  shift
-  shift
-goto :loop
-:installname
-  echo>> ~tmp~.mak 	-D"RUBY_INSTALL_NAME=%2" \
-  shift
-  shift
-goto :loop
-:soname
-  echo>> ~tmp~.mak 	-D"RUBY_SO_NAME=%2" \
-  shift
-  shift
-goto :loop
-:target
-  echo>> ~tmp~.mak 	"%2" \
-  shift
-  shift
-goto :loop
-:extstatic
-  echo>> ~tmp~.mak 	-D"EXTSTATIC=static" \
-  shift
-goto :loop
-:enable-rdoc
-  echo>> ~tmp~.mak 	-D"RDOCTARGET=install-doc" \
-  shift
-goto :loop
-:disable-rdoc
-  echo>> ~tmp~.mak 	-D"RDOCTARGET=install-nodoc" \
-  shift
-goto :loop
-:extout
-  echo>> ~tmp~.mak 	-D"EXTOUT=%2" \
-  shift
-  shift
-goto :loop
-:help
-  echo Configuration:
-  echo   --help                  display this help
-  echo   --srcdir=DIR            find the sources in DIR [configure dir or `..']
-  echo Installation directories:
-  echo   --prefix=PREFIX         install files in PREFIX (ignored currently)
-  echo System types:
-  echo   --target=TARGET         configure for TARGET [i386-bccwin32]
-  echo Optional Package:
-  echo   --with-static-linked-ext link external modules statically
-  echo   --enable-install-doc    install rdoc indexes during install
-  del ~tmp~.mak
-goto :exit
-:end
-echo>> ~tmp~.mak 	-Dbcc32dir="$(@D)"
-make -s -f ~tmp~.mak
-:exit
diff --git a/bcc32/mkexports.rb b/bcc32/mkexports.rb
deleted file mode 100755
index dc523e2541..0000000000
--- a/bcc32/mkexports.rb
+++ /dev/null
@@ -1,27 +0,0 @@
-#!./miniruby -s
-
-$name = $library = $description = nil
-
-SYM = {}
-STDIN.reopen(open("nul"))
-ARGV.each do |obj|
-  IO.foreach("|tdump -q -oiPUBDEF -oiPUBD32 #{obj.tr('/', '\\')}") do |l|
-    next unless /(?:PUBDEF|PUBD32)/ =~ l
-    SYM[$1] = true if /'(.*?)'/ =~ l
-  end
-end
-
-exports = []
-if $name
-  exports << "Name " + $name
-elsif $library
-  exports << "Library " + $library
-end
-exports << "Description " + $description.dump if $description
-exports << "EXPORTS" << SYM.keys.sort
-
-if $output
-  open($output, 'w') {|f| f.puts exports.join("\n")}
-else
-  puts exports.join("\n")
-end
diff --git a/bcc32/setup.mak b/bcc32/setup.mak
deleted file mode 100644
index b7a2539d0a..0000000000
--- a/bcc32/setup.mak
+++ /dev/null
@@ -1,133 +0,0 @@
-# -*- makefile -*-
-
-!if "$(srcdir)" != ""
-bcc32dir = $(srcdir)/bcc32
-!elseif "$(bcc32dir)" == "bcc32/"
-srcdir = .
-!elseif "$(bcc32dir:/bcc32/=)/bcc32/" == "$(bcc32dir)"
-srcdir = $(bcc32dir:/bcc32/=)
-!else
-srcdir = $(bcc32dir)/..
-!endif
-!ifndef prefix
-prefix = /usr
-!endif
-OS = bccwin32
-RT = $(OS)
-BANG = !
-APPEND = echo>>$(MAKEFILE)
-!ifdef MAKEFILE
-MAKE = $(MAKE) -f $(MAKEFILE)
-!else
-MAKEFILE = Makefile
-!endif
-
-all: Makefile
-Makefile: -prologue- -generic- -epilogue-
-i386-$(OS): -prologue- -i386- -epilogue-
-i486-$(OS): -prologue- -i486- -epilogue-
-i586-$(OS): -prologue- -i586- -epilogue-
-i686-$(OS): -prologue- -i686- -epilogue-
-alpha-$(OS): -prologue- -alpha- -epilogue-
-
--prologue-: nul
-	@echo Creating $(MAKEFILE)
-	@type > $(MAKEFILE) &&|
-\#\#\# Makefile for ruby $(OS) \#\#\#
-$(BANG)ifndef srcdir
-srcdir = $(srcdir:\=/)
-$(BANG)endif
-$(BANG)ifndef prefix
-prefix = $(prefix:\=/)
-$(BANG)endif
-$(BANG)ifndef EXTSTATIC
-EXTSTATIC = $(EXTSTATIC)
-$(BANG)endif
-!if defined(RDOCTARGET)
-$(BANG)ifndef RDOCTARGET
-RDOCTARGET = $(RDOCTARGET)
-$(BANG)endif
-!endif
-!if defined(EXTOUT)
-$(BANG)ifndef EXTOUT
-EXTOUT = $(EXTOUT)
-$(BANG)endif
-!endif
-|
-	@type > usebormm.bat &&|
-@echo off
-ilink32 -Gn -x usebormm.lib > nul
-if exist usebormm.tds echo MEMLIB = usebormm.lib
-|
-	@usebormm.bat >> $(MAKEFILE)
-	@del usebormm.*
-
-	@cpp32 -I$(srcdir) -P- -o$(MAKEFILE) > nul &&|
-\#include "version.h"
-MAJOR = RUBY_VERSION_MAJOR
-MINOR = RUBY_VERSION_MINOR
-TEENY = RUBY_VERSION_TEENY
-|
-	@type $(MAKEFILE).i >> $(MAKEFILE)
-	@del $(MAKEFILE).i
-
--generic-: nul
-!if defined(PROCESSOR_ARCHITECTURE) ||  defined(PROCESSOR_LEVEL)
-	@type >> $(MAKEFILE) &&|
-!if defined(PROCESSOR_ARCHITECTURE)
-$(BANG)ifndef PROCESSOR_ARCHITECTURE
-PROCESSOR_ARCHITECTURE = $(PROCESSOR_ARCHITECTURE)
-$(BANG)endif
-!endif
-!if defined(PROCESSOR_LEVEL)
-$(BANG)ifndef PROCESSOR_LEVEL
-PROCESSOR_LEVEL = $(PROCESSOR_LEVEL)
-$(BANG)endif
-!endif
-
-|
-!endif
-
--alpha-: nul
-	@$(APPEND) !ifndef PROCESSOR_ARCHITECTURE
-	@$(APPEND) PROCESSOR_ARCHITECTURE = alpha
-	@$(APPEND) !endif
--ix86-: nul
-	@$(APPEND) !ifndef PROCESSOR_ARCHITECTURE
-	@$(APPEND) PROCESSOR_ARCHITECTURE = x86
-	@$(APPEND) !endif
-
--i386-: -ix86-
-	@$(APPEND) !ifndef PROCESSOR_LEVEL
-	@$(APPEND) PROCESSOR_LEVEL = 3
-	@$(APPEND) !endif
--i486-: -ix86-
-	@$(APPEND) !ifndef PROCESSOR_LEVEL
-	@$(APPEND) PROCESSOR_LEVEL = 4
-	@$(APPEND) !endif
--i586-: -ix86-
-	@$(APPEND) !ifndef PROCESSOR_LEVEL
-	@$(APPEND) PROCESSOR_LEVEL = 5
-	@$(APPEND) !endif
--i686-: -ix86-
-	@$(APPEND) !ifndef PROCESSOR_LEVEL
-	@$(APPEND) PROCESSOR_LEVEL = 6
-	@$(APPEND) !endif
-
--epilogue-: nul
-	@type >> $(MAKEFILE) &&|
-
-\# OS = $(OS)
-\# RT = $(RT)
-\# RUBY_INSTALL_NAME = ruby
-\# RUBY_SO_NAME = $$(RT)-$$(RUBY_INSTALL_NAME)$$(MAJOR)$$(MINOR)
-\# CFLAGS = -q $$(DEBUGFLAGS) $$(OPTFLAGS) $$(PROCESSOR_FLAG) -w- -wsus -wcpt -wdup -wext -wrng -wrpt -wzdi
-\# CPPFLAGS = -I. -I$$(srcdir) -I$$(srcdir)/missing -DLIBRUBY_SO=\"$$(LIBRUBY_SO)\"
-\# STACK = 0x2000000
-\# LDFLAGS = -S:$$(STACK)
-\# RFLAGS = $$(iconinc)
-\# EXTLIBS = cw32.lib import32.lib user32.lib kernel32.lib
-$(BANG)include $$(srcdir)/bcc32/Makefile.sub
-|
-	@$(srcdir:/=\)\win32\rm.bat config.h config.status
-	@echo type "`$(MAKE)'" to make ruby for $(OS).
diff --git a/benchmark/bm_app_answer.rb b/benchmark/bm_app_answer.rb
new file mode 100644
index 0000000000..3cd8a8fd37
--- /dev/null
+++ b/benchmark/bm_app_answer.rb
@@ -0,0 +1,15 @@
+def ack(m, n)
+  if m == 0 then
+    n + 1
+  elsif n == 0 then
+    ack(m - 1, 1)
+  else
+    ack(m - 1, ack(m, n - 1))
+  end
+end
+
+def the_answer_to_life_the_universe_and_everything
+  (ack(3,7).to_s.split(//).inject(0){|s,x| s+x.to_i}.to_s + "2" ).to_i
+end
+
+answer = the_answer_to_life_the_universe_and_everything
diff --git a/benchmark/bm_app_aobench.rb b/benchmark/bm_app_aobench.rb
new file mode 100644
index 0000000000..2bd6acfaf8
--- /dev/null
+++ b/benchmark/bm_app_aobench.rb
@@ -0,0 +1,291 @@
+# AO render benchmark
+# Original program (C) Syoyo Fujita in Javascript (and other languages)
+#      https://code.google.com/p/aobench/
+# Ruby(yarv2llvm) version by Hideki Miura
+#
+
+IMAGE_WIDTH = 256
+IMAGE_HEIGHT = 256
+NSUBSAMPLES = 2
+NAO_SAMPLES = 8
+
+class Vec
+  def initialize(x, y, z)
+    @x = x
+    @y = y
+    @z = z
+  end
+
+  attr_accessor :x, :y, :z
+
+  def vadd(b)
+    Vec.new(@x + b.x, @y + b.y, @z + b.z)
+  end
+
+  def vsub(b)
+    Vec.new(@x - b.x, @y - b.y, @z - b.z)
+  end
+
+  def vcross(b)
+    Vec.new(@y * b.z - @z * b.y,
+            @z * b.x - @x * b.z,
+            @x * b.y - @y * b.x)
+  end
+
+  def vdot(b)
+    @x * b.x + @y * b.y + @z * b.z
+  end
+
+  def vlength
+    Math.sqrt(@x * @x + @y * @y + @z * @z)
+  end
+
+  def vnormalize
+    len = vlength
+    v = Vec.new(@x, @y, @z)
+    if len > 1.0e-17 then
+      v.x = v.x / len
+      v.y = v.y / len
+      v.z = v.z / len
+    end
+    v
+  end
+end
+
+
+class Sphere
+  def initialize(center, radius)
+    @center = center
+    @radius = radius
+  end
+
+  attr_reader :center, :radius
+
+  def intersect(ray, isect)
+    rs = ray.org.vsub(@center)
+    b = rs.vdot(ray.dir)
+    c = rs.vdot(rs) - (@radius * @radius)
+    d = b * b - c
+    if d > 0.0 then
+      t = - b - Math.sqrt(d)
+
+      if t > 0.0 and t < isect.t then
+        isect.t = t
+        isect.hit = true
+        isect.pl = Vec.new(ray.org.x + ray.dir.x * t,
+                          ray.org.y + ray.dir.y * t,
+                          ray.org.z + ray.dir.z * t)
+        n = isect.pl.vsub(@center)
+        isect.n = n.vnormalize
+      else
+        0.0
+      end
+    end
+    nil
+  end
+end
+
+class Plane
+  def initialize(p, n)
+    @p = p
+    @n = n
+  end
+
+  def intersect(ray, isect)
+    d = -@p.vdot(@n)
+    v = ray.dir.vdot(@n)
+    v0 = v
+    if v < 0.0 then
+      v0 = -v
+    end
+    if v0 < 1.0e-17 then
+      return
+    end
+
+    t = -(ray.org.vdot(@n) + d) / v
+
+    if t > 0.0 and t < isect.t then
+      isect.hit = true
+      isect.t = t
+      isect.n = @n
+      isect.pl = Vec.new(ray.org.x + t * ray.dir.x,
+                        ray.org.y + t * ray.dir.y,
+                        ray.org.z + t * ray.dir.z)
+    end
+    nil
+  end
+end
+
+class Ray
+  def initialize(org, dir)
+    @org = org
+    @dir = dir
+  end
+
+  attr_accessor :org, :dir
+end
+
+class Isect
+  def initialize
+    @t = 10000000.0
+    @hit = false
+    @pl = Vec.new(0.0, 0.0, 0.0)
+    @n = Vec.new(0.0, 0.0, 0.0)
+  end
+
+  attr_accessor :t, :hit, :pl, :n
+end
+
+def clamp(f)
+  i = f * 255.5
+  if i > 255.0 then
+    i = 255.0
+  end
+  if i < 0.0 then
+    i = 0.0
+  end
+  i.to_i
+end
+
+def otherBasis(basis, n)
+  basis[2] = Vec.new(n.x, n.y, n.z)
+  basis[1] = Vec.new(0.0, 0.0, 0.0)
+
+  if n.x < 0.6 and n.x > -0.6 then
+    basis[1].x = 1.0
+  elsif n.y < 0.6 and n.y > -0.6 then
+    basis[1].y = 1.0
+  elsif n.z < 0.6 and n.z > -0.6 then
+    basis[1].z = 1.0
+  else
+    basis[1].x = 1.0
+  end
+
+  basis[0] = basis[1].vcross(basis[2])
+  basis[0] = basis[0].vnormalize
+
+  basis[1] = basis[2].vcross(basis[0])
+  basis[1] = basis[1].vnormalize
+end
+
+class Scene
+  def initialize
+    @spheres = Array.new
+    @spheres[0] = Sphere.new(Vec.new(-2.0, 0.0, -3.5), 0.5)
+    @spheres[1] = Sphere.new(Vec.new(-0.5, 0.0, -3.0), 0.5)
+    @spheres[2] = Sphere.new(Vec.new(1.0, 0.0, -2.2), 0.5)
+    @plane = Plane.new(Vec.new(0.0, -0.5, 0.0), Vec.new(0.0, 1.0, 0.0))
+  end
+
+  def ambient_occlusion(isect)
+    basis = Array.new
+    otherBasis(basis, isect.n)
+
+    ntheta    = NAO_SAMPLES
+    nphi      = NAO_SAMPLES
+    eps       = 0.0001
+    occlusion = 0.0
+
+    p0 = Vec.new(isect.pl.x + eps * isect.n.x,
+                isect.pl.y + eps * isect.n.y,
+                isect.pl.z + eps * isect.n.z)
+    nphi.times do |j|
+      ntheta.times do |i|
+        r = rand
+        phi = 2.0 * 3.14159265 * rand
+        x = Math.cos(phi) * Math.sqrt(1.0 - r)
+        y = Math.sin(phi) * Math.sqrt(1.0 - r)
+        z = Math.sqrt(r)
+
+        rx = x * basis[0].x + y * basis[1].x + z * basis[2].x
+        ry = x * basis[0].y + y * basis[1].y + z * basis[2].y
+        rz = x * basis[0].z + y * basis[1].z + z * basis[2].z
+
+        raydir = Vec.new(rx, ry, rz)
+        ray = Ray.new(p0, raydir)
+
+        occisect = Isect.new
+        @spheres[0].intersect(ray, occisect)
+        @spheres[1].intersect(ray, occisect)
+        @spheres[2].intersect(ray, occisect)
+        @plane.intersect(ray, occisect)
+        if occisect.hit then
+          occlusion = occlusion + 1.0
+        else
+          0.0
+        end
+      end
+    end
+
+    occlusion = (ntheta.to_f * nphi.to_f - occlusion) / (ntheta.to_f * nphi.to_f)
+
+    Vec.new(occlusion, occlusion, occlusion)
+  end
+
+  def render(w, h, nsubsamples)
+    cnt = 0
+    nsf = nsubsamples.to_f
+    h.times do |y|
+      w.times do |x|
+        rad = Vec.new(0.0, 0.0, 0.0)
+
+        # Subsampling
+        nsubsamples.times do |v|
+          nsubsamples.times do |u|
+
+            cnt = cnt + 1
+            wf = w.to_f
+            hf = h.to_f
+            xf = x.to_f
+            yf = y.to_f
+            uf = u.to_f
+            vf = v.to_f
+
+            px = (xf + (uf / nsf) - (wf / 2.0)) / (wf / 2.0)
+            py = -(yf + (vf / nsf) - (hf / 2.0)) / (hf / 2.0)
+
+            eye = Vec.new(px, py, -1.0).vnormalize
+
+            ray = Ray.new(Vec.new(0.0, 0.0, 0.0), eye)
+
+            isect = Isect.new
+            @spheres[0].intersect(ray, isect)
+            @spheres[1].intersect(ray, isect)
+            @spheres[2].intersect(ray, isect)
+            @plane.intersect(ray, isect)
+            if isect.hit then
+              col = ambient_occlusion(isect)
+              rad.x = rad.x + col.x
+              rad.y = rad.y + col.y
+              rad.z = rad.z + col.z
+            end
+          end
+        end
+
+        r = rad.x / (nsf * nsf)
+        g = rad.y / (nsf * nsf)
+        b = rad.z / (nsf * nsf)
+        printf("%c", clamp(r))
+        printf("%c", clamp(g))
+        printf("%c", clamp(b))
+      end
+      nil
+    end
+
+    nil
+  end
+end
+
+alias printf_orig printf
+def printf *args
+end
+
+# File.open("ao.ppm", "w") do |fp|
+  printf("P6\n")
+  printf("%d %d\n", IMAGE_WIDTH, IMAGE_HEIGHT)
+  printf("255\n", IMAGE_WIDTH, IMAGE_HEIGHT)
+  Scene.new.render(IMAGE_WIDTH, IMAGE_HEIGHT, NSUBSAMPLES)
+# end
+
+undef printf
+alias printf printf_orig
diff --git a/benchmark/bm_app_erb.rb b/benchmark/bm_app_erb.rb
new file mode 100644
index 0000000000..77c66a7949
--- /dev/null
+++ b/benchmark/bm_app_erb.rb
@@ -0,0 +1,26 @@
+#
+# Create many HTML strings with ERB.
+#
+
+require 'erb'
+
+data = DATA.read
+max = 15_000
+title = "hello world!"
+content = "hello world!\n" * 10
+
+max.times{
+  ERB.new(data).result(binding)
+}
+
+__END__
+
+<html>
+  <head> <%= title %> </head>
+  <body>
+    <h1> <%= title %> </h1>
+    <p>
+      <%= content %>
+    </p>
+  </body>
+</html>
diff --git a/benchmark/bm_app_factorial.rb b/benchmark/bm_app_factorial.rb
new file mode 100644
index 0000000000..45f471dfdb
--- /dev/null
+++ b/benchmark/bm_app_factorial.rb
@@ -0,0 +1,11 @@
+def fact(n)
+  if(n > 1)
+    n * fact(n-1)
+  else
+    1
+  end
+end
+
+100.times {
+  fact(5000)
+}
diff --git a/benchmark/bm_app_fib.rb b/benchmark/bm_app_fib.rb
new file mode 100644
index 0000000000..34a7b2e725
--- /dev/null
+++ b/benchmark/bm_app_fib.rb
@@ -0,0 +1,10 @@
+def fib n
+  if n < 3
+    1
+  else
+    fib(n-1) + fib(n-2)
+  end
+end
+
+fib(34)
+
diff --git a/benchmark/bm_app_lc_fizzbuzz.rb b/benchmark/bm_app_lc_fizzbuzz.rb
new file mode 100644
index 0000000000..f09574bbeb
--- /dev/null
+++ b/benchmark/bm_app_lc_fizzbuzz.rb
@@ -0,0 +1,52 @@
+#
+# FizzBuzz program using only lambda calculus
+#
+# This program is quoted from
+#   "Understanding Computation" by Tom Stuart
+#   http://computationbook.com/
+#
+# You can understand why this program works fine by reading this book.
+#
+
+solution = -> k { -> f { -> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> l { -> x { -> g { -> b { b }[-> p { p[-> x { -> y { x } }] }[l]][x][-> y { g[f[-> l { -> p { p[-> x { -> y { y } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][x][g]][-> l { -> p { p[-> x { -> y { x } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][y] }] } } } }][k][-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> l { -> x { -> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[l][f[x]] } }] } }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[m][n]][-> x { -> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[f[-> n { -> p { -> x { p[n[p][x]] } } }[m]][n]][m][x] }][-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]] } } }][-> p { -> x { p[x] } }][-> p { -> x { p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[x]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]] } }]][-> n { -> b { b }[-> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> p { -> x { p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[x]]]]]]]]]]]]]]] } }]]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]][-> b { b }[-> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> p { -> x { p[p[p[x]]] } }]]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]][-> b { b }[-> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> n { -> l { -> x { -> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> l { -> x { -> g { -> b { b }[-> p { p[-> x { -> y { x } }] }[l]][x][-> y { g[f[-> l { -> p { p[-> x { -> y { y } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][x][g]][-> l { -> p { p[-> x { -> y { x } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][y] }] } } } }][l][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][x]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }] } }[-> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]][-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> x { f[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { -> n { -> p { -> x { p[n[p][x]] } } }[f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n]][x] }][-> p { -> x { x } }] } } }][n][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][x] }]][-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]] } }][n]]]] }]
+
+FIRST     = -> l { LEFT[RIGHT[l]] }
+IF        = -> b { b }
+LEFT      = -> p { p[-> x { -> y { x } } ] }
+RIGHT     = -> p { p[-> x { -> y { y } } ] }
+IS_EMPTY  = LEFT
+REST      = -> l { RIGHT[RIGHT[l]] }
+
+def to_integer(proc)
+  proc[-> n { n + 1 }][0]
+end
+
+def to_boolean(proc)
+  IF[proc][true][false]
+end
+
+def to_array(proc)
+  array = []
+
+  until to_boolean(IS_EMPTY[proc])
+    array.push(FIRST[proc])
+    proc = REST[proc]
+  end
+
+  array
+end
+
+def to_char(c)
+  '0123456789BFiuz'.slice(to_integer(c))
+end
+
+def to_string(s)
+  to_array(s).map { |c| to_char(c) }.join
+end
+
+answer = to_array(solution).map do |p|
+  to_string(p)
+end
+
+answer_ary = answer.to_a
+# puts answer_ary
diff --git a/benchmark/bm_app_mandelbrot.rb b/benchmark/bm_app_mandelbrot.rb
new file mode 100644
index 0000000000..801b75e8e2
--- /dev/null
+++ b/benchmark/bm_app_mandelbrot.rb
@@ -0,0 +1,23 @@
+require 'complex'
+
+def mandelbrot? z
+  i = 0
+  while i<100
+    i += 1
+    z = z * z
+    return false if z.abs > 2
+  end
+  true
+end
+
+ary = []
+
+(0..1000).each{|dx|
+  (0..1000).each{|dy|
+    x = dx / 50.0
+    y = dy / 50.0
+    c = Complex(x, y)
+    ary << c if mandelbrot?(c)
+  }
+}
+
diff --git a/benchmark/bm_app_pentomino.rb b/benchmark/bm_app_pentomino.rb
new file mode 100644
index 0000000000..59c63f358e
--- /dev/null
+++ b/benchmark/bm_app_pentomino.rb
@@ -0,0 +1,259 @@
+#!/usr/local/bin/ruby
+# This program is contributed by Shin Nishiyama
+
+
+# modified by K.Sasada
+
+NP = 5
+ROW = 8 + NP
+COL = 8
+
+$p = []
+$b = []
+$no = 0
+
+def piece(n, a, nb)
+  nb.each{|x|
+    a[n] = x
+    if n == NP-1
+      $p << [a.sort]
+    else
+      nbc=nb.dup
+      [-ROW, -1, 1, ROW].each{|d|
+        if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
+          nbc << x+d
+        end
+      }
+      nbc.delete x
+      piece(n+1,a[0..n],nbc)
+    end
+  }
+end
+
+def kikaku(a)
+  a.collect {|x| x - a[0]}
+end
+def ud(a)
+  kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
+end
+def rl(a)
+  kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
+end
+def xy(a)
+  kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
+end
+
+def mkpieces
+  piece(0,[],[0])
+  $p.each do |a|
+    a0 = a[0]
+    a[1] = ud(a0)
+    a[2] = rl(a0)
+    a[3] = ud(rl(a0))
+    a[4] = xy(a0)
+    a[5] = ud(xy(a0))
+    a[6] = rl(xy(a0))
+    a[7] = ud(rl(xy(a0)))
+    a.sort!
+    a.uniq!
+  end
+  $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
+end
+
+def mkboard
+  (0...ROW*COL).each{|i|
+    if i % ROW >= ROW-NP
+      $b[i] = -2
+    else
+      $b[i] = -1
+    end
+    $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
+  }
+end
+
+def pboard
+  return # skip print
+  print "No. #$no\n"
+  (0...COL).each{|i|
+    print "|"
+    (0...ROW-NP).each{|j|
+      x = $b[i*ROW+j]
+      if x < 0
+        print "..|"
+      else
+        printf "%2d|",x+1
+      end
+    }
+    print "\n"
+  }
+  print "\n"
+end
+
+$pnum=[]
+def setpiece(a,pos)
+  if a.length == $p.length then
+    $no += 1
+    pboard
+    return
+  end
+  while $b[pos] != -1
+    pos += 1
+  end
+  ($pnum - a).each do |i|
+    $p[i].each do |x|
+      f = 0
+      x.each{|s|
+        if $b[pos+s] != -1
+          f=1
+          break
+        end
+      }
+      if f == 0 then
+        x.each{|s|
+          $b[pos+s] = i
+        }
+        a << i
+        setpiece(a.dup, pos)
+        a.pop
+        x.each{|s|
+          $b[pos+s] = -1
+        }
+      end
+    end
+  end
+end
+
+mkpieces
+mkboard
+$p[4] = [$p[4][0]]
+$pnum = (0...$p.length).to_a
+setpiece([],0)
+
+
+__END__
+
+# original
+
+NP = 5
+ROW = 8 + NP
+COL = 8
+
+$p = []
+$b = []
+$no = 0
+
+def piece(n,a,nb)
+  for x in nb
+    a[n] = x
+    if n == NP-1
+      $p << [a.sort]
+    else
+      nbc=nb.dup
+      for d in [-ROW, -1, 1, ROW]
+        if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
+          nbc << x+d
+        end
+      end
+      nbc.delete x
+      piece(n+1,a[0..n],nbc)
+    end
+  end
+end
+
+def kikaku(a)
+  a.collect {|x| x - a[0]}
+end
+def ud(a)
+  kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
+end
+def rl(a)
+  kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
+end
+def xy(a)
+  kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
+end
+
+def mkpieces
+  piece(0,[],[0])
+  $p.each do |a|
+    a0 = a[0]
+    a[1] = ud(a0)
+    a[2] = rl(a0)
+    a[3] = ud(rl(a0))
+    a[4] = xy(a0)
+    a[5] = ud(xy(a0))
+    a[6] = rl(xy(a0))
+    a[7] = ud(rl(xy(a0)))
+    a.sort!
+    a.uniq!
+  end
+  $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
+end
+
+def mkboard
+  for i in 0...ROW*COL
+    if i % ROW >= ROW-NP
+      $b[i] = -2
+    else
+      $b[i] = -1
+    end
+    $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
+  end
+end
+
+def pboard
+  print "No. #$no\n"
+  for i in 0...COL
+    print "|"
+    for j in 0...ROW-NP
+      x = $b[i*ROW+j]
+      if x < 0
+        print "..|"
+      else
+        printf "%2d|",x+1
+      end
+    end
+    print "\n"
+  end
+  print "\n"
+end
+
+$pnum=[]
+def setpiece(a,pos)
+  if a.length == $p.length then
+    $no += 1
+    pboard
+    return
+  end
+  while $b[pos] != -1
+    pos += 1
+  end
+  ($pnum - a).each do |i|
+    $p[i].each do |x|
+      f = 0
+      for s in x do
+        if $b[pos+s] != -1
+          f=1
+          break
+        end
+      end
+      if f == 0 then
+        for s in x do
+          $b[pos+s] = i
+        end
+        a << i
+        setpiece(a.dup, pos)
+        a.pop
+        for s in x do
+          $b[pos+s] = -1
+        end
+      end
+    end
+  end
+end
+
+mkpieces
+mkboard
+$p[4] = [$p[4][0]]
+$pnum = (0...$p.length).to_a
+setpiece([],0)
diff --git a/benchmark/bm_app_raise.rb b/benchmark/bm_app_raise.rb
new file mode 100644
index 0000000000..5db8f95d50
--- /dev/null
+++ b/benchmark/bm_app_raise.rb
@@ -0,0 +1,8 @@
+i = 0
+while i<300000
+  i += 1
+  begin
+    raise
+  rescue
+  end
+end
diff --git a/benchmark/bm_app_strconcat.rb b/benchmark/bm_app_strconcat.rb
new file mode 100644
index 0000000000..7eed7c1aed
--- /dev/null
+++ b/benchmark/bm_app_strconcat.rb
@@ -0,0 +1,5 @@
+i = 0
+while i<2_000_000
+  "#{1+1} #{1+1} #{1+1}"
+  i += 1
+end
diff --git a/benchmark/bm_app_tak.rb b/benchmark/bm_app_tak.rb
new file mode 100644
index 0000000000..efe5380f4e
--- /dev/null
+++ b/benchmark/bm_app_tak.rb
@@ -0,0 +1,13 @@
+
+def tak x, y, z
+  unless y < x
+    z
+  else
+    tak( tak(x-1, y, z),
+         tak(y-1, z, x),
+         tak(z-1, x, y))
+  end
+end
+
+tak(18, 9, 0)
+
diff --git a/benchmark/bm_app_tarai.rb b/benchmark/bm_app_tarai.rb
new file mode 100644
index 0000000000..4c146f5ccf
--- /dev/null
+++ b/benchmark/bm_app_tarai.rb
@@ -0,0 +1,10 @@
+def tarai( x, y, z )
+  if x <= y
+  then y
+  else tarai(tarai(x-1, y, z),
+             tarai(y-1, z, x),
+             tarai(z-1, x, y))
+  end
+end
+
+tarai(12, 6, 0)
diff --git a/benchmark/bm_app_uri.rb b/benchmark/bm_app_uri.rb
new file mode 100644
index 0000000000..586edfd5dc
--- /dev/null
+++ b/benchmark/bm_app_uri.rb
@@ -0,0 +1,8 @@
+require 'uri'
+
+100_000.times{
+  uri = URI.parse('http://www.ruby-lang.org')
+  uri.scheme
+  uri.host
+  uri.port
+}
diff --git a/benchmark/bm_array_shift.rb b/benchmark/bm_array_shift.rb
new file mode 100644
index 0000000000..798bb9e3f4
--- /dev/null
+++ b/benchmark/bm_array_shift.rb
@@ -0,0 +1,14 @@
+require 'benchmark'
+
+Benchmark.bm do |x|
+  [10_000,1_000_000,100_000_000].each do |n|
+    ary = Array.new(n,0)
+    GC.start
+    x.report("#{n}:shift"){ ary.shift }
+    (0..4).each do |i|
+      ary = Array.new(n,0)
+      GC.start
+      x.report("#{n}:shift(#{i})"){ ary.shift(i) }
+    end
+  end
+end
diff --git a/benchmark/bm_hash_aref_dsym.rb b/benchmark/bm_hash_aref_dsym.rb
new file mode 100644
index 0000000000..af4f8c36d4
--- /dev/null
+++ b/benchmark/bm_hash_aref_dsym.rb
@@ -0,0 +1,4 @@
+h = {}
+syms = ('a'..'z').map { |s| s.to_sym }
+syms.each { |s| h[s] = 1 }
+200_000.times { syms.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_aref_dsym_long.rb b/benchmark/bm_hash_aref_dsym_long.rb
new file mode 100644
index 0000000000..9d7759379e
--- /dev/null
+++ b/benchmark/bm_hash_aref_dsym_long.rb
@@ -0,0 +1,21 @@
+# [ruby-core:70129] [Bug #11396]
+collection_size = 200000
+sample_size = 10000
+
+values = (1..collection_size).to_a.map do |x|
+  "THIS IS A LONGER STRING THAT IS ALSO UNIQUE #{x}"
+end
+
+symbol_hash = {}
+
+values.each do |x|
+  symbol_hash[x.to_sym] = 1
+end
+
+# use the same samples each time to minimize deviations
+rng = Random.new(0)
+symbol_sample_array = values.sample(sample_size, random: rng).map(&:to_sym)
+
+3000.times do
+  symbol_sample_array.each { |x| symbol_hash[x] }
+end
diff --git a/benchmark/bm_hash_aref_fix.rb b/benchmark/bm_hash_aref_fix.rb
new file mode 100644
index 0000000000..1346890582
--- /dev/null
+++ b/benchmark/bm_hash_aref_fix.rb
@@ -0,0 +1,4 @@
+h = {}
+nums = (1..26).to_a
+nums.each { |i| h[i] = i }
+200_000.times { nums.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_aref_flo.rb b/benchmark/bm_hash_aref_flo.rb
new file mode 100644
index 0000000000..2217274c82
--- /dev/null
+++ b/benchmark/bm_hash_aref_flo.rb
@@ -0,0 +1,4 @@
+h = {}
+strs = [*1..10000].map! {|i| i.fdiv(10)}
+strs.each { |s| h[s] = s }
+50.times { strs.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_aref_miss.rb b/benchmark/bm_hash_aref_miss.rb
new file mode 100644
index 0000000000..b0913dd4bb
--- /dev/null
+++ b/benchmark/bm_hash_aref_miss.rb
@@ -0,0 +1,5 @@
+h = {}
+strs = ('a'..'z').to_a.map!(&:freeze)
+strs.each { |s| h[s] = s }
+strs = ('A'..'Z').to_a
+200_000.times { strs.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_aref_str.rb b/benchmark/bm_hash_aref_str.rb
new file mode 100644
index 0000000000..19439b061b
--- /dev/null
+++ b/benchmark/bm_hash_aref_str.rb
@@ -0,0 +1,4 @@
+h = {}
+strs = ('a'..'z').to_a.map!(&:freeze)
+strs.each { |s| h[s] = s }
+200_000.times { strs.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_aref_sym.rb b/benchmark/bm_hash_aref_sym.rb
new file mode 100644
index 0000000000..f75d163fe6
--- /dev/null
+++ b/benchmark/bm_hash_aref_sym.rb
@@ -0,0 +1,9 @@
+h = {}
+syms = ('a'..'z').to_a
+begin
+  syms = eval("%i[#{syms.join(' ')}]")
+rescue SyntaxError # <= 1.9.3
+  syms.map!(&:to_sym)
+end
+syms.each { |s| h[s] = s }
+200_000.times { syms.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_aref_sym_long.rb b/benchmark/bm_hash_aref_sym_long.rb
new file mode 100644
index 0000000000..9dab8df7be
--- /dev/null
+++ b/benchmark/bm_hash_aref_sym_long.rb
@@ -0,0 +1,13 @@
+h = {}
+syms = %w[puts warn syswrite write stat bacon lettuce tomato
+some symbols in this array may already be interned  others should not be
+hash browns make good breakfast but not cooked using prime numbers
+shift for division entries delete_if keys exist?
+]
+begin
+  syms = eval("%i[#{syms.join(' ')}]")
+rescue SyntaxError # <= 1.9.3
+  syms.map!(&:to_sym)
+end
+syms.each { |s| h[s] = s }
+200_000.times { syms.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_flatten.rb b/benchmark/bm_hash_flatten.rb
new file mode 100644
index 0000000000..e944aae9f2
--- /dev/null
+++ b/benchmark/bm_hash_flatten.rb
@@ -0,0 +1,9 @@
+h = {}
+
+10000.times do |i|
+  h[i] = nil
+end
+
+1000.times do
+  h.flatten
+end
diff --git a/benchmark/bm_hash_ident_flo.rb b/benchmark/bm_hash_ident_flo.rb
new file mode 100644
index 0000000000..0c7edfed3e
--- /dev/null
+++ b/benchmark/bm_hash_ident_flo.rb
@@ -0,0 +1,4 @@
+h = {}.compare_by_identity
+strs = (1..10000).to_a.map!(&:to_f)
+strs.each { |s| h[s] = s }
+50.times { strs.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_ident_num.rb b/benchmark/bm_hash_ident_num.rb
new file mode 100644
index 0000000000..b226736c6f
--- /dev/null
+++ b/benchmark/bm_hash_ident_num.rb
@@ -0,0 +1,4 @@
+h = {}.compare_by_identity
+nums = (1..26).to_a
+nums.each { |n| h[n] = n }
+200_000.times { nums.each { |n| h[n] } }
diff --git a/benchmark/bm_hash_ident_obj.rb b/benchmark/bm_hash_ident_obj.rb
new file mode 100644
index 0000000000..4b3b58edec
--- /dev/null
+++ b/benchmark/bm_hash_ident_obj.rb
@@ -0,0 +1,4 @@
+h = {}.compare_by_identity
+objs = 26.times.map { Object.new }
+objs.each { |o| h[o] = o }
+200_000.times { objs.each { |o| h[o] } }
diff --git a/benchmark/bm_hash_ident_str.rb b/benchmark/bm_hash_ident_str.rb
new file mode 100644
index 0000000000..8582b38e31
--- /dev/null
+++ b/benchmark/bm_hash_ident_str.rb
@@ -0,0 +1,4 @@
+h = {}.compare_by_identity
+strs = ('a'..'z').to_a
+strs.each { |s| h[s] = s }
+200_000.times { strs.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_ident_sym.rb b/benchmark/bm_hash_ident_sym.rb
new file mode 100644
index 0000000000..4c81e3d28e
--- /dev/null
+++ b/benchmark/bm_hash_ident_sym.rb
@@ -0,0 +1,4 @@
+h = {}.compare_by_identity
+syms = ('a'..'z').to_a.map(&:to_sym)
+syms.each { |s| h[s] = s }
+200_000.times { syms.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_keys.rb b/benchmark/bm_hash_keys.rb
new file mode 100644
index 0000000000..6863cd01f9
--- /dev/null
+++ b/benchmark/bm_hash_keys.rb
@@ -0,0 +1,9 @@
+h = {}
+
+10000.times do |i|
+  h[i] = nil
+end
+
+5000.times do
+  h.keys
+end
diff --git a/benchmark/bm_hash_shift.rb b/benchmark/bm_hash_shift.rb
new file mode 100644
index 0000000000..a645671a5b
--- /dev/null
+++ b/benchmark/bm_hash_shift.rb
@@ -0,0 +1,10 @@
+h = {}
+
+10000.times do |i|
+  h[i] = nil
+end
+
+50000.times do
+  k, v = h.shift
+  h[k] = v
+end
diff --git a/benchmark/bm_hash_shift_u16.rb b/benchmark/bm_hash_shift_u16.rb
new file mode 100644
index 0000000000..ec800d0342
--- /dev/null
+++ b/benchmark/bm_hash_shift_u16.rb
@@ -0,0 +1,10 @@
+h = {}
+
+(16384..65536).each do |i|
+  h[i] = nil
+end
+
+300000.times do
+  k, v = h.shift
+  h[k] = v
+end
diff --git a/benchmark/bm_hash_shift_u24.rb b/benchmark/bm_hash_shift_u24.rb
new file mode 100644
index 0000000000..de4e0fa696
--- /dev/null
+++ b/benchmark/bm_hash_shift_u24.rb
@@ -0,0 +1,10 @@
+h = {}
+
+(0xff4000..0xffffff).each do |i|
+  h[i] = nil
+end
+
+300000.times do
+  k, v = h.shift
+  h[k] = v
+end
diff --git a/benchmark/bm_hash_shift_u32.rb b/benchmark/bm_hash_shift_u32.rb
new file mode 100644
index 0000000000..656aa55583
--- /dev/null
+++ b/benchmark/bm_hash_shift_u32.rb
@@ -0,0 +1,10 @@
+h = {}
+
+(0xffff4000..0xffffffff).each do |i|
+  h[i] = nil
+end
+
+300000.times do
+  k, v = h.shift
+  h[k] = v
+end
diff --git a/benchmark/bm_hash_to_proc.rb b/benchmark/bm_hash_to_proc.rb
new file mode 100644
index 0000000000..2b675bf509
--- /dev/null
+++ b/benchmark/bm_hash_to_proc.rb
@@ -0,0 +1,9 @@
+h = {}
+
+10000.times do |i|
+  h[i] = nil
+end
+
+5000.times do |i|
+  [i].map(&h)
+end
diff --git a/benchmark/bm_hash_values.rb b/benchmark/bm_hash_values.rb
new file mode 100644
index 0000000000..069441302f
--- /dev/null
+++ b/benchmark/bm_hash_values.rb
@@ -0,0 +1,9 @@
+h = {}
+
+10000.times do |i|
+  h[i] = nil
+end
+
+5000.times do
+  h.values
+end
diff --git a/benchmark/bm_io_file_create.rb b/benchmark/bm_io_file_create.rb
new file mode 100644
index 0000000000..2f205c1333
--- /dev/null
+++ b/benchmark/bm_io_file_create.rb
@@ -0,0 +1,13 @@
+#
+# Create files
+#
+
+max = 200_000
+file = './tmpfile_of_bm_io_file_create'
+
+max.times{
+  f = open(file, 'w')
+  f.close#(true)
+}
+File.unlink(file)
+
diff --git a/benchmark/bm_io_file_read.rb b/benchmark/bm_io_file_read.rb
new file mode 100644
index 0000000000..b9e796ed30
--- /dev/null
+++ b/benchmark/bm_io_file_read.rb
@@ -0,0 +1,15 @@
+#
+# Seek and Read file.
+#
+
+require 'tempfile'
+
+max = 200_000
+str = "Hello world!  " * 1000
+f = Tempfile.new('yarv-benchmark')
+f.write str
+
+max.times{
+  f.seek 0
+  f.read
+}
diff --git a/benchmark/bm_io_file_write.rb b/benchmark/bm_io_file_write.rb
new file mode 100644
index 0000000000..aa1be0e5fe
--- /dev/null
+++ b/benchmark/bm_io_file_write.rb
@@ -0,0 +1,14 @@
+#
+# Seek and Write file.
+#
+
+require 'tempfile'
+
+max = 200_000
+str = "Hello world!  " * 1000
+f = Tempfile.new('yarv-benchmark')
+
+max.times{
+  f.seek 0
+  f.write str
+}
diff --git a/benchmark/bm_io_nonblock_noex.rb b/benchmark/bm_io_nonblock_noex.rb
new file mode 100644
index 0000000000..da9357fdc6
--- /dev/null
+++ b/benchmark/bm_io_nonblock_noex.rb
@@ -0,0 +1,22 @@
+nr = 1_000_000
+i = 0
+msg = '.'
+buf = '.'
+noex = { exception: false }
+begin
+  r, w = IO.pipe
+  while i < nr
+    i += 1
+    w.write_nonblock(msg, noex)
+    r.read_nonblock(1, buf, noex)
+  end
+rescue ArgumentError # old Rubies
+  while i < nr
+    i += 1
+    w.write_nonblock(msg)
+    r.read_nonblock(1, buf)
+  end
+ensure
+  r.close
+  w.close
+end
diff --git a/benchmark/bm_io_nonblock_noex2.rb b/benchmark/bm_io_nonblock_noex2.rb
new file mode 100644
index 0000000000..56819d049b
--- /dev/null
+++ b/benchmark/bm_io_nonblock_noex2.rb
@@ -0,0 +1,21 @@
+nr = 1_000_000
+i = 0
+msg = '.'
+buf = '.'
+begin
+  r, w = IO.pipe
+  while i < nr
+    i += 1
+    w.write_nonblock(msg, exception: false)
+    r.read_nonblock(1, buf, exception: false)
+  end
+rescue ArgumentError # old Rubies
+  while i < nr
+    i += 1
+    w.write_nonblock(msg)
+    r.read_nonblock(1, buf)
+  end
+ensure
+  r.close
+  w.close
+end
diff --git a/benchmark/bm_io_select.rb b/benchmark/bm_io_select.rb
new file mode 100644
index 0000000000..19248daeb1
--- /dev/null
+++ b/benchmark/bm_io_select.rb
@@ -0,0 +1,9 @@
+# IO.select performance
+
+w = [ IO.pipe[1] ];
+
+nr = 1000000
+nr.times {
+  IO.select nil, w
+}
+
diff --git a/benchmark/bm_io_select2.rb b/benchmark/bm_io_select2.rb
new file mode 100644
index 0000000000..10e37d71b2
--- /dev/null
+++ b/benchmark/bm_io_select2.rb
@@ -0,0 +1,22 @@
+# IO.select performance. worst case of single fd.
+
+ios = []
+nr = 1000000
+if defined?(Process::RLIMIT_NOFILE)
+  max = Process.getrlimit(Process::RLIMIT_NOFILE)[0]
+else
+  max = 64
+end
+puts "max fd: #{max} (results not apparent with <= 1024 max fd)"
+
+((max / 2) - 10).times do
+  ios.concat IO.pipe
+end
+
+last = [ ios[-1] ]
+puts "last IO: #{last[0].inspect}"
+
+nr.times do
+  IO.select nil, last
+end
+
diff --git a/benchmark/bm_io_select3.rb b/benchmark/bm_io_select3.rb
new file mode 100644
index 0000000000..7d0ba1f092
--- /dev/null
+++ b/benchmark/bm_io_select3.rb
@@ -0,0 +1,21 @@
+# IO.select performance. a lot of fd
+
+ios = []
+nr = 100
+if defined?(Process::RLIMIT_NOFILE)
+  max = Process.getrlimit(Process::RLIMIT_NOFILE)[0]
+else
+  max = 64
+end
+puts "max fd: #{max} (results not apparent with <= 1024 max fd)"
+
+(max - 10).times do
+  r, w = IO.pipe
+  r.close
+  ios.push w
+end
+
+nr.times do
+  IO.select nil, ios
+end
+
diff --git a/benchmark/bm_loop_for.rb b/benchmark/bm_loop_for.rb
new file mode 100644
index 0000000000..0fc4cc1511
--- /dev/null
+++ b/benchmark/bm_loop_for.rb
@@ -0,0 +1,3 @@
+for i in 1..30_000_000
+  #
+end
diff --git a/benchmark/bm_loop_generator.rb b/benchmark/bm_loop_generator.rb
new file mode 100644
index 0000000000..d3375c744c
--- /dev/null
+++ b/benchmark/bm_loop_generator.rb
@@ -0,0 +1,14 @@
+max = 600000
+
+if defined? Fiber
+  gen = (1..max).each
+  loop do
+    gen.next
+  end
+else
+  require 'generator'
+  gen = Generator.new((0..max))
+  while gen.next?
+    gen.next
+  end
+end
diff --git a/benchmark/bm_loop_times.rb b/benchmark/bm_loop_times.rb
new file mode 100644
index 0000000000..521f72ad1a
--- /dev/null
+++ b/benchmark/bm_loop_times.rb
@@ -0,0 +1 @@
+30_000_000.times{|e|}
diff --git a/benchmark/bm_loop_whileloop.rb b/benchmark/bm_loop_whileloop.rb
new file mode 100644
index 0000000000..0072822c06
--- /dev/null
+++ b/benchmark/bm_loop_whileloop.rb
@@ -0,0 +1,4 @@
+i = 0
+while i<30_000_000 # benchmark loop 1
+  i += 1
+end
diff --git a/benchmark/bm_loop_whileloop2.rb b/benchmark/bm_loop_whileloop2.rb
new file mode 100644
index 0000000000..47d02dffc4
--- /dev/null
+++ b/benchmark/bm_loop_whileloop2.rb
@@ -0,0 +1,4 @@
+i = 0
+while i< 6_000_000 # benchmark loop 2
+  i += 1
+end
diff --git a/benchmark/bm_marshal_dump_flo.rb b/benchmark/bm_marshal_dump_flo.rb
new file mode 100644
index 0000000000..9b8d0c6afb
--- /dev/null
+++ b/benchmark/bm_marshal_dump_flo.rb
@@ -0,0 +1,2 @@
+bug10761 = 10000.times.map { |x| x.to_f }
+100.times { Marshal.dump(bug10761) }
diff --git a/benchmark/bm_marshal_dump_load_geniv.rb b/benchmark/bm_marshal_dump_load_geniv.rb
new file mode 100644
index 0000000000..8252ad90fa
--- /dev/null
+++ b/benchmark/bm_marshal_dump_load_geniv.rb
@@ -0,0 +1,10 @@
+a = ''
+a.instance_eval do
+  @a = :a
+  @b = :b
+  @c = :c
+end
+100000.times do
+  a = Marshal.load(Marshal.dump(a))
+end
+#p(a.instance_eval { @a == :a && @b == :b && @c == :c })
diff --git a/benchmark/bm_marshal_dump_load_time.rb b/benchmark/bm_marshal_dump_load_time.rb
new file mode 100644
index 0000000000..e29743b791
--- /dev/null
+++ b/benchmark/bm_marshal_dump_load_time.rb
@@ -0,0 +1 @@
+100000.times { Marshal.load(Marshal.dump(Time.now)) }
diff --git a/benchmark/bm_require.rb b/benchmark/bm_require.rb
new file mode 100644
index 0000000000..b8abc88f41
--- /dev/null
+++ b/benchmark/bm_require.rb
@@ -0,0 +1,7 @@
+$:.push File.join(File.dirname(__FILE__), "bm_require.data")
+
+1.upto(10000) do |i|
+  require "c#{i}"
+end
+
+$:.pop
diff --git a/benchmark/bm_require_thread.rb b/benchmark/bm_require_thread.rb
new file mode 100644
index 0000000000..e54db6c6e5
--- /dev/null
+++ b/benchmark/bm_require_thread.rb
@@ -0,0 +1,15 @@
+$:.push File.join(File.dirname(__FILE__), "bm_require.data")
+
+i=0
+t = Thread.new do
+  while true
+    i = i+1 # dummy loop
+  end
+end
+
+1.upto(100) do |i|
+  require "c#{i}"
+end
+
+$:.pop
+t.kill
diff --git a/benchmark/bm_securerandom.rb b/benchmark/bm_securerandom.rb
new file mode 100644
index 0000000000..a082ea6d5b
--- /dev/null
+++ b/benchmark/bm_securerandom.rb
@@ -0,0 +1,5 @@
+require "securerandom"
+
+20_0000.times do
+  SecureRandom.random_number(100)
+end
diff --git a/benchmark/bm_so_ackermann.rb b/benchmark/bm_so_ackermann.rb
new file mode 100644
index 0000000000..7db5be9050
--- /dev/null
+++ b/benchmark/bm_so_ackermann.rb
@@ -0,0 +1,19 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: ackermann-ruby.code,v 1.4 2004/11/13 07:40:41 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+def ack(m, n)
+    if m == 0 then
+        n + 1
+    elsif n == 0 then
+        ack(m - 1, 1)
+    else
+        ack(m - 1, ack(m, n - 1))
+    end
+end
+
+NUM = 9
+ack(3, NUM)
+
+
diff --git a/benchmark/bm_so_array.rb b/benchmark/bm_so_array.rb
new file mode 100644
index 0000000000..2b8fce8f99
--- /dev/null
+++ b/benchmark/bm_so_array.rb
@@ -0,0 +1,23 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: ary-ruby.code,v 1.4 2004/11/13 07:41:27 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# with help from Paul Brannan and Mark Hubbart
+
+n = 9000 # Integer(ARGV.shift || 1)
+
+x = Array.new(n)
+y = Array.new(n, 0)
+
+n.times{|bi|
+  x[bi] = bi + 1
+}
+
+(0 .. 999).each do |e|
+  (n-1).step(0,-1) do |bi|
+    y[bi] += x.at(bi)
+  end
+end
+# puts "#{y.first} #{y.last}"
+
+
diff --git a/benchmark/bm_so_binary_trees.rb b/benchmark/bm_so_binary_trees.rb
new file mode 100644
index 0000000000..b1693e4109
--- /dev/null
+++ b/benchmark/bm_so_binary_trees.rb
@@ -0,0 +1,62 @@
+# The Computer Language Shootout Benchmarks
+# http://shootout.alioth.debian.org
+#
+# contributed by Jesse Millikan
+
+# disable output
+alias puts_orig puts
+def puts str
+  # disable puts
+end
+
+def item_check(tree)
+ if tree[0] == nil
+  tree[1]
+ else
+  tree[1] + item_check(tree[0]) - item_check(tree[2])
+ end
+end
+
+def bottom_up_tree(item, depth)
+ if depth > 0
+  item_item = 2 * item
+  depth -= 1
+  [bottom_up_tree(item_item - 1, depth), item, bottom_up_tree(item_item, depth)]
+ else
+  [nil, item, nil]
+ end
+end
+
+max_depth = 16 # ARGV[0].to_i
+min_depth = 4
+
+max_depth = min_depth + 2 if min_depth + 2 > max_depth
+
+stretch_depth = max_depth + 1
+stretch_tree = bottom_up_tree(0, stretch_depth)
+
+puts "stretch tree of depth #{stretch_depth}\t check: #{item_check(stretch_tree)}"
+stretch_tree = nil
+
+long_lived_tree = bottom_up_tree(0, max_depth)
+
+min_depth.step(max_depth + 1, 2) do |depth|
+ iterations = 2**(max_depth - depth + min_depth)
+
+ check = 0
+
+ for i in 1..iterations
+  temp_tree = bottom_up_tree(i, depth)
+  check += item_check(temp_tree)
+
+  temp_tree = bottom_up_tree(-i, depth)
+  check += item_check(temp_tree)
+ end
+
+ puts "#{iterations * 2}\t trees of depth #{depth}\t check: #{check}"
+end
+
+puts "long lived tree of depth #{max_depth}\t check: #{item_check(long_lived_tree)}"
+
+undef puts
+alias puts puts_orig
diff --git a/benchmark/bm_so_concatenate.rb b/benchmark/bm_so_concatenate.rb
new file mode 100644
index 0000000000..873214de7c
--- /dev/null
+++ b/benchmark/bm_so_concatenate.rb
@@ -0,0 +1,18 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: strcat-ruby.code,v 1.4 2004/11/13 07:43:28 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# based on code from Aristarkh A Zagorodnikov and Dat Nguyen
+
+STUFF = "hello\n"
+i = 0
+while i<10
+  i += 1
+  hello = ''
+  4_000_000.times do |e|
+    hello << STUFF
+  end
+end
+# puts hello.length
+
+
diff --git a/benchmark/bm_so_count_words.rb b/benchmark/bm_so_count_words.rb
new file mode 100644
index 0000000000..65f6337a4a
--- /dev/null
+++ b/benchmark/bm_so_count_words.rb
@@ -0,0 +1,19 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: wc-ruby.code,v 1.4 2004/11/13 07:43:32 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# with help from Paul Brannan
+
+input = open(File.join(File.dirname($0), 'wc.input'), 'rb')
+
+nl = nw = nc = 0
+while true
+  tmp = input.read(4096) or break
+  data = tmp << (input.gets || "")
+  nc += data.length
+  nl += data.count("\n")
+  ((data.strip! || data).tr!("\n", " ") || data).squeeze!
+  nw += data.count(" ") + 1
+end
+# STDERR.puts "#{nl} #{nw} #{nc}"
+
diff --git a/benchmark/bm_so_exception.rb b/benchmark/bm_so_exception.rb
new file mode 100644
index 0000000000..deb003a594
--- /dev/null
+++ b/benchmark/bm_so_exception.rb
@@ -0,0 +1,61 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: except-ruby.code,v 1.4 2004/11/13 07:41:33 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+$HI = 0
+$LO = 0
+NUM = 250000 # Integer(ARGV[0] || 1)
+
+
+class Lo_Exception < Exception
+  def initialize(num)
+    @value = num
+  end
+end
+
+class Hi_Exception < Exception
+  def initialize(num)
+    @value = num
+  end
+end
+
+def some_function(num)
+  begin
+    hi_function(num)
+  rescue
+    print "We shouldn't get here, exception is: #{$!.type}\n"
+  end
+end
+
+def hi_function(num)
+  begin
+    lo_function(num)
+  rescue Hi_Exception
+    $HI = $HI + 1
+  end
+end
+
+def lo_function(num)
+  begin
+    blowup(num)
+  rescue Lo_Exception
+    $LO = $LO + 1
+  end
+end
+
+def blowup(num)
+  if num % 2 == 0
+    raise Lo_Exception.new(num)
+  else
+    raise Hi_Exception.new(num)
+  end
+end
+
+
+i = 1
+max = NUM+1
+while i < max
+  i += 1
+  some_function(i+1)
+end
diff --git a/benchmark/bm_so_fannkuch.rb b/benchmark/bm_so_fannkuch.rb
new file mode 100644
index 0000000000..bac5ecd44c
--- /dev/null
+++ b/benchmark/bm_so_fannkuch.rb
@@ -0,0 +1,45 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+# Contributed by Sokolov Yura
+# Modified by Ryan Williams
+
+def fannkuch(n)
+   maxFlips, m, r, check = 0, n-1, n, 0
+   count = (1..n).to_a
+   perm = (1..n).to_a
+
+   while true
+      if check < 30
+         puts "#{perm}"
+         check += 1
+      end
+
+      while r != 1
+         count[r-1] = r
+         r -= 1
+      end
+
+      if perm[0] != 1 and perm[m] != n
+         perml = perm.clone #.dup
+         flips = 0
+         while (k = perml.first ) != 1
+            perml = perml.slice!(0, k).reverse + perml
+            flips += 1
+         end
+         maxFlips = flips if flips > maxFlips
+      end
+      while true
+         if r==n then return maxFlips end
+         perm.insert r,perm.shift
+         break if (count[r] -= 1) > 0
+         r += 1
+      end
+   end
+end
+
+def puts *args
+end
+
+N = 9 # (ARGV[0] || 1).to_i
+puts "Pfannkuchen(#{N}) = #{fannkuch(N)}"
+
diff --git a/benchmark/bm_so_fasta.rb b/benchmark/bm_so_fasta.rb
new file mode 100644
index 0000000000..3f759ba7ae
--- /dev/null
+++ b/benchmark/bm_so_fasta.rb
@@ -0,0 +1,81 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+# Contributed by Sokolov Yura
+
+$last = 42.0
+def gen_random (max,im=139968,ia=3877,ic=29573)
+    (max * ($last = ($last * ia + ic) % im)) / im
+end
+
+alu =
+   "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
+   "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
+   "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
+   "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
+   "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
+   "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
+   "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
+
+iub = [
+    ["a", 0.27],
+    ["c", 0.12],
+    ["g", 0.12],
+    ["t", 0.27],
+
+    ["B", 0.02],
+    ["D", 0.02],
+    ["H", 0.02],
+    ["K", 0.02],
+    ["M", 0.02],
+    ["N", 0.02],
+    ["R", 0.02],
+    ["S", 0.02],
+    ["V", 0.02],
+    ["W", 0.02],
+    ["Y", 0.02],
+]
+homosapiens = [
+    ["a", 0.3029549426680],
+    ["c", 0.1979883004921],
+    ["g", 0.1975473066391],
+    ["t", 0.3015094502008],
+]
+
+def make_repeat_fasta(id, desc, src, n)
+    puts ">#{id} #{desc}"
+    v = nil
+    width = 60
+    l = src.length
+    s = src * ((n / l) + 1)
+    s.slice!(n, l)
+    puts(s.scan(/.{1,#{width}}/).join("\n"))
+end
+
+def make_random_fasta(id, desc, table, n)
+    puts ">#{id} #{desc}"
+    rand, v = nil,nil
+    width = 60
+    chunk = 1 * width
+    prob = 0.0
+    table.each{|v| v[1]= (prob += v[1])}
+    for i in 1..(n/width)
+        puts((1..width).collect{
+            rand = gen_random(1.0)
+            table.find{|v| v[1]>rand}[0]
+        }.join)
+    end
+    if n%width != 0
+        puts((1..(n%width)).collect{
+            rand = gen_random(1.0)
+            table.find{|v| v[1]>rand}[0]
+        }.join)
+    end
+end
+
+
+n = (ARGV[0] or 250_000).to_i
+
+make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
+make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
+make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
+
diff --git a/benchmark/bm_so_k_nucleotide.rb b/benchmark/bm_so_k_nucleotide.rb
new file mode 100644
index 0000000000..dadab3e79c
--- /dev/null
+++ b/benchmark/bm_so_k_nucleotide.rb
@@ -0,0 +1,48 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org
+#
+# contributed by jose fco. gonzalez
+# modified by Sokolov Yura
+
+seq = String.new
+
+def frecuency( seq,length )
+    n, table = seq.length - length + 1, Hash.new(0)
+    f, i = nil, nil
+    (0 ... length).each do |f|
+        (f ... n).step(length) do |i|
+            table[seq[i,length]] += 1
+        end
+    end
+    [n,table]
+
+end
+
+def sort_by_freq( seq,length )
+    n,table = frecuency( seq,length )
+    a, b, v = nil, nil, nil
+    table.sort{|a,b| b[1] <=> a[1]}.each do |v|
+        puts "%s %.3f" % [v[0].upcase,((v[1]*100).to_f/n)]
+    end
+    puts
+end
+
+def find_seq( seq,s )
+    n,table = frecuency( seq,s.length )
+    puts "#{table[s].to_s}\t#{s.upcase}"
+end
+
+input = open(File.join(File.dirname($0), 'fasta.output.100000'), 'rb')
+
+line = input.gets while line !~ /^>THREE/
+line = input.gets
+
+while (line !~ /^>/) & line do
+    seq << line.chomp
+    line = input.gets
+end
+
+[1,2].each {|i| sort_by_freq( seq,i ) }
+
+%w(ggt ggta ggtatt ggtattttaatt ggtattttaatttatagt).each{|s| find_seq( seq,s) }
+
diff --git a/benchmark/bm_so_lists.rb b/benchmark/bm_so_lists.rb
new file mode 100644
index 0000000000..e8f4a2a5f7
--- /dev/null
+++ b/benchmark/bm_so_lists.rb
@@ -0,0 +1,47 @@
+#from http://www.bagley.org/~doug/shootout/bench/lists/lists.ruby
+
+NUM = 300
+SIZE = 10000
+
+def test_lists()
+  # create a list of integers (Li1) from 1 to SIZE
+  li1 = (1..SIZE).to_a
+  # copy the list to li2 (not by individual items)
+  li2 = li1.dup
+  # remove each individual item from left side of li2 and
+  # append to right side of li3 (preserving order)
+  li3 = Array.new
+  while (not li2.empty?)
+    li3.push(li2.shift)
+  end
+  # li2 must now be empty
+  # remove each individual item from right side of li3 and
+  # append to right side of li2 (reversing list)
+  while (not li3.empty?)
+    li2.push(li3.pop)
+  end
+  # li3 must now be empty
+  # reverse li1 in place
+  li1.reverse!
+  # check that first item is now SIZE
+  if li1[0] != SIZE then
+    p "not SIZE"
+    0
+  else
+    # compare li1 and li2 for equality
+    if li1 != li2 then
+      return(0)
+    else
+      # return the length of the list
+      li1.length
+    end
+  end
+end
+
+i = 0
+while i<NUM
+  i += 1
+  result = test_lists()
+end
+
+result
diff --git a/benchmark/bm_so_mandelbrot.rb b/benchmark/bm_so_mandelbrot.rb
new file mode 100644
index 0000000000..76331c64b8
--- /dev/null
+++ b/benchmark/bm_so_mandelbrot.rb
@@ -0,0 +1,57 @@
+#  The Computer Language Benchmarks Game
+#  http://shootout.alioth.debian.org/
+#
+#  contributed by Karl von Laudermann
+#  modified by Jeremy Echols
+
+size = 600 # ARGV[0].to_i
+
+puts "P4\n#{size} #{size}"
+
+ITER = 49                           # Iterations - 1 for easy for..in looping
+LIMIT_SQUARED = 4.0                 # Presquared limit
+
+byte_acc = 0
+bit_num = 0
+
+count_size = size - 1               # Precomputed size for easy for..in looping
+
+# For..in loops are faster than .upto, .downto, .times, etc.
+for y in 0..count_size
+  for x in 0..count_size
+    zr = 0.0
+    zi = 0.0
+    cr = (2.0*x/size)-1.5
+    ci = (2.0*y/size)-1.0
+    escape = false
+
+    # To make use of the for..in code, we use a dummy variable,
+    # like one would in C
+    for dummy in 0..ITER
+      tr = zr*zr - zi*zi + cr
+      ti = 2*zr*zi + ci
+      zr, zi = tr, ti
+
+      if (zr*zr+zi*zi) > LIMIT_SQUARED
+        escape = true
+        break
+      end
+    end
+
+    byte_acc = (byte_acc << 1) | (escape ? 0b0 : 0b1)
+    bit_num += 1
+
+    # Code is very similar for these cases, but using separate blocks
+    # ensures we skip the shifting when it's unnecessary, which is most cases.
+    if (bit_num == 8)
+      print byte_acc.chr
+      byte_acc = 0
+      bit_num = 0
+    elsif (x == count_size)
+      byte_acc <<= (8 - bit_num)
+      print byte_acc.chr
+      byte_acc = 0
+      bit_num = 0
+    end
+  end
+end
diff --git a/benchmark/bm_so_matrix.rb b/benchmark/bm_so_matrix.rb
new file mode 100644
index 0000000000..e2c5c8e559
--- /dev/null
+++ b/benchmark/bm_so_matrix.rb
@@ -0,0 +1,48 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: matrix-ruby.code,v 1.4 2004/11/13 07:42:14 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+n = 60 #Integer(ARGV.shift || 1)
+
+size = 40
+
+def mkmatrix(rows, cols)
+    count = 1
+    mx = Array.new(rows)
+    (0 .. (rows - 1)).each do |bi|
+        row = Array.new(cols, 0)
+        (0 .. (cols - 1)).each do |j|
+            row[j] = count
+            count += 1
+        end
+        mx[bi] = row
+    end
+    mx
+end
+
+def mmult(rows, cols, m1, m2)
+    m3 = Array.new(rows)
+    (0 .. (rows - 1)).each do |bi|
+        row = Array.new(cols, 0)
+        (0 .. (cols - 1)).each do |j|
+            val = 0
+            (0 .. (cols - 1)).each do |k|
+                val += m1.at(bi).at(k) * m2.at(k).at(j)
+            end
+            row[j] = val
+        end
+        m3[bi] = row
+    end
+    m3
+end
+
+m1 = mkmatrix(size, size)
+m2 = mkmatrix(size, size)
+mm = Array.new
+n.times do
+    mm = mmult(size, size, m1, m2)
+end
+# puts "#{mm[0][0]} #{mm[2][3]} #{mm[3][2]} #{mm[4][4]}"
+
+
diff --git a/benchmark/bm_so_meteor_contest.rb b/benchmark/bm_so_meteor_contest.rb
new file mode 100644
index 0000000000..17e9c046a8
--- /dev/null
+++ b/benchmark/bm_so_meteor_contest.rb
@@ -0,0 +1,564 @@
+#!/usr/bin/env ruby
+#
+# The Computer Language Shootout
+#   http://shootout.alioth.debian.org
+#   contributed by Kevin Barnes (Ruby novice)
+
+# PROGRAM:  the main body is at the bottom.
+#   1) read about the problem here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
+#   2) see how I represent a board as a bitmask by reading the blank_board comments
+#   3) read as your mental paths take you
+
+def print *args
+end
+
+# class to represent all information about a particular rotation of a particular piece
+class Rotation
+  # an array (by location) containing a bit mask for how the piece maps at the given location.
+  # if the rotation is invalid at that location the mask will contain false
+  attr_reader :start_masks
+
+  # maps a direction to a relative location.  these differ depending on whether it is an even or
+  # odd row being mapped from
+  @@rotation_even_adder = { :west => -1, :east => 1, :nw => -7, :ne => -6, :sw => 5, :se => 6 }
+  @@rotation_odd_adder = { :west => -1, :east => 1, :nw => -6, :ne => -5, :sw => 6, :se => 7 }
+
+  def initialize( directions )
+    @even_offsets, @odd_offsets = normalize_offsets( get_values( directions ))
+
+    @even_mask = mask_for_offsets( @even_offsets)
+    @odd_mask = mask_for_offsets( @odd_offsets)
+
+    @start_masks = Array.new(60)
+
+    # create the rotational masks by placing the base mask at the location and seeing if
+    # 1) it overlaps the boundaries and 2) it produces a prunable board.  if either of these
+    # is true the piece cannot be placed
+    0.upto(59) do | offset |
+      mask = is_even(offset) ? (@even_mask << offset) : (@odd_mask << offset)
+      if (blank_board & mask == 0 && !prunable(blank_board | mask, 0, true)) then
+        imask = compute_required( mask, offset)
+        @start_masks[offset] = [ mask, imask, imask | mask ]
+      else
+        @start_masks[offset] = false
+      end
+    end
+  end
+
+  def compute_required( mask, offset )
+    board = blank_board
+    0.upto(offset) { | i | board |= 1 << i }
+    board |= mask
+    return 0 if (!prunable(board | mask, offset))
+    board = flood_fill(board,58)
+    count = 0
+    imask = 0
+    0.upto(59) do | i |
+      if (board[i] == 0) then
+        imask |= (1 << i)
+        count += 1
+      end
+    end
+    (count > 0 && count < 5) ? imask : 0
+  end
+
+  def flood_fill( board, location)
+    return board if (board[location] == 1)
+    board |= 1 << location
+    row, col = location.divmod(6)
+    board = flood_fill( board, location - 1) if (col > 0)
+    board = flood_fill( board, location + 1) if (col < 4)
+    if (row % 2 == 0) then
+      board = flood_fill( board, location - 7) if (col > 0 && row > 0)
+      board = flood_fill( board, location - 6) if (row > 0)
+      board = flood_fill( board, location + 6) if (row < 9)
+      board = flood_fill( board, location + 5) if (col > 0 && row < 9)
+    else
+      board = flood_fill( board, location - 5) if (col < 4 && row > 0)
+      board = flood_fill( board, location - 6) if (row > 0)
+      board = flood_fill( board, location + 6) if (row < 9)
+      board = flood_fill( board, location + 7) if (col < 4 && row < 9)
+    end
+    board
+  end
+
+  # given a location, produces a list of relative locations covered by the piece at this rotation
+  def offsets( location)
+    if is_even( location) then
+      @even_offsets.collect { | value | value + location }
+    else
+      @odd_offsets.collect { | value | value + location }
+    end
+  end
+
+  # returns a set of offsets relative to the top-left most piece of the rotation (by even or odd rows)
+  # this is hard to explain. imagine we have this partial board:
+  #   0 0 0 0 0 x        [positions 0-5]
+  #    0 0 1 1 0 x       [positions 6-11]
+  #   0 0 1 0 0 x        [positions 12-17]
+  #    0 1 0 0 0 x       [positions 18-23]
+  #   0 1 0 0 0 x        [positions 24-29]
+  #    0 0 0 0 0 x       [positions 30-35]
+  #       ...
+  # The top-left of the piece is at position 8, the
+  # board would be passed as a set of positions (values array) containing [8,9,14,19,25] not necessarily in that
+  # sorted order.  Since that array starts on an odd row, the offsets for an odd row are: [0,1,6,11,17] obtained
+  # by subtracting 8 from everything.  Now imagine the piece shifted up and to the right so it's on an even row:
+  #   0 0 0 1 1 x        [positions 0-5]
+  #    0 0 1 0 0 x       [positions 6-11]
+  #   0 0 1 0 0 x        [positions 12-17]
+  #    0 1 0 0 0 x       [positions 18-23]
+  #   0 0 0 0 0 x        [positions 24-29]
+  #    0 0 0 0 0 x       [positions 30-35]
+  #       ...
+  # Now the positions are [3,4,8,14,19] which after subtracting the lowest value (3) gives [0,1,5,11,16] thus, the
+  # offsets for this particular piece are (in even, odd order) [0,1,5,11,16],[0,1,6,11,17] which is what
+  # this function would return
+  def normalize_offsets( values)
+    min = values.min
+    even_min = is_even(min)
+    other_min = even_min ? min + 6 : min + 7
+    other_values = values.collect do | value |
+      if is_even(value) then
+        value + 6 - other_min
+      else
+        value + 7 - other_min
+      end
+    end
+    values.collect! { | value | value - min }
+
+    if even_min then
+      [values, other_values]
+    else
+      [other_values, values]
+    end
+  end
+
+  # produce a bitmask representation of an array of offset locations
+  def mask_for_offsets( offsets )
+    mask = 0
+    offsets.each { | value | mask = mask + ( 1 << value ) }
+    mask
+  end
+
+  # finds a "safe" position that a position as described by a list of directions can be placed
+  # without falling off any edge of the board.  the values returned a location to place the first piece
+  # at so it will fit after making the described moves
+  def start_adjust( directions )
+    south = east = 0;
+    directions.each do | direction |
+      east += 1 if ( direction == :sw || direction == :nw || direction == :west )
+      south += 1 if ( direction == :nw || direction == :ne )
+    end
+    south * 6 + east
+  end
+
+  # given a set of directions places the piece (as defined by a set of directions) on the board at
+  # a location that will not take it off the edge
+  def get_values ( directions )
+    start = start_adjust(directions)
+    values = [ start ]
+    directions.each do | direction |
+      if (start % 12 >= 6) then
+        start += @@rotation_odd_adder[direction]
+      else
+        start += @@rotation_even_adder[direction]
+      end
+      values += [ start ]
+    end
+
+    # some moves take you back to an existing location, we'll strip duplicates
+    values.uniq
+  end
+end
+
+# describes a piece and caches information about its rotations to as to be efficient for iteration
+# ATTRIBUTES:
+#   rotations -- all the rotations of the piece
+#   type -- a numeic "name" of the piece
+#   masks -- an array by location of all legal rotational masks (a n inner array) for that location
+#   placed -- the mask that this piece was last placed at (not a location, but the actual mask used)
+class Piece
+  attr_reader :rotations, :type, :masks
+  attr_accessor :placed
+
+  # transform hashes that change one direction into another when you either flip or rotate a set of directions
+  @@flip_converter = { :west => :west, :east => :east, :nw => :sw, :ne => :se, :sw => :nw, :se => :ne }
+  @@rotate_converter = { :west => :nw, :east => :se, :nw => :ne, :ne => :east, :sw => :west, :se => :sw }
+
+  def initialize( directions, type )
+    @type = type
+    @rotations = Array.new();
+    @map = {}
+
+    generate_rotations( directions )
+    directions.collect! { | value | @@flip_converter[value] }
+    generate_rotations( directions )
+
+    # creates the masks AND a map that returns [location, rotation] for any given mask
+    # this is used when a board is found and we want to draw it, otherwise the map is unused
+    @masks = Array.new();
+    0.upto(59) do | i |
+      even = true
+      @masks[i] = @rotations.collect do | rotation |
+        mask = rotation.start_masks[i]
+        @map[mask[0]] = [ i, rotation ] if (mask)
+        mask || nil
+      end
+      @masks[i].compact!
+    end
+  end
+
+  # rotates a set of directions through all six angles and adds a Rotation to the list for each one
+  def generate_rotations( directions )
+    6.times do
+      rotations.push( Rotation.new(directions))
+      directions.collect! { | value | @@rotate_converter[value] }
+    end
+  end
+
+  # given a board string, adds this piece to the board at whatever location/rotation
+  # important: the outbound board string is 5 wide, the normal location notation is six wide (padded)
+  def fill_string( board_string)
+    location, rotation = @map[@placed]
+    rotation.offsets(location).each do | offset |
+      row, col = offset.divmod(6)
+      board_string[ row*5 + col, 1 ] = @type.to_s
+    end
+  end
+end
+
+# a blank bit board having this form:
+#
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    1 1 1 1 1 1
+#
+# where left lest significant bit is the top left and the most significant is the lower right
+# the actual board only consists of the 0 places, the 1 places are blockers to keep things from running
+# off the edges or bottom
+def blank_board
+  0b111111100000100000100000100000100000100000100000100000100000100000
+end
+
+def full_board
+  0b111111111111111111111111111111111111111111111111111111111111111111
+end
+
+# determines if a location (bit position) is in an even row
+def is_even( location)
+  (location % 12) < 6
+end
+
+# support function that create three utility maps:
+#  $converter -- for each row an array that maps a five bit row (via array mapping)
+#                to the a a five bit representation of the bits below it
+#  $bit_count -- maps a five bit row (via array mapping) to the number of 1s in the row
+#  @@new_regions -- maps a five bit row (via array mapping) to an array of "region" arrays
+#                   a region array has three values the first is a mask of bits in the region,
+#                   the second is the count of those bits and the third is identical to the first
+#                   examples:
+#                           0b10010 => [ 0b01100, 2, 0b01100 ], [ 0b00001, 1, 0b00001]
+#                           0b01010 => [ 0b10000, 1, 0b10000 ], [ 0b00100, 1, 0b00100 ], [ 0b00001, 1, 0b00001]
+#                           0b10001 => [ 0b01110, 3, 0b01110 ]
+def create_collector_support
+  odd_map = [0b11, 0b110, 0b1100, 0b11000, 0b10000]
+  even_map = [0b1, 0b11, 0b110, 0b1100, 0b11000]
+
+  all_odds = Array.new(0b100000)
+  all_evens = Array.new(0b100000)
+  bit_counts = Array.new(0b100000)
+  new_regions = Array.new(0b100000)
+  0.upto(0b11111) do | i |
+    bit_count = odd = even = 0
+    0.upto(4) do | bit |
+      if (i[bit] == 1) then
+        bit_count += 1
+        odd |= odd_map[bit]
+        even |= even_map[bit]
+      end
+    end
+    all_odds[i] = odd
+    all_evens[i] = even
+    bit_counts[i] = bit_count
+    new_regions[i] = create_regions( i)
+  end
+
+  $converter = []
+  10.times { | row | $converter.push((row % 2 == 0) ? all_evens : all_odds) }
+  $bit_counts = bit_counts
+  $regions = new_regions.collect { | set | set.collect { | value | [ value, bit_counts[value], value] } }
+end
+
+# determines if a board is punable, meaning that there is no possibility that it
+# can be filled up with pieces.  A board is prunable if there is a grouping of unfilled spaces
+# that are not a multiple of five.  The following board is an example of a prunable board:
+#    0 0 1 0 0
+#     0 1 0 0 0
+#    1 1 0 0 0
+#     0 1 0 0 0
+#    0 0 0 0 0
+#       ...
+#
+# This board is prunable because the top left corner is only 3 bits in area, no piece will ever fit it
+# parameters:
+#   board -- an initial bit board (6 bit padded rows, see blank_board for format)
+#   location -- starting location, everything above and to the left is already full
+#   slotting -- set to true only when testing initial pieces, when filling normally
+#               additional assumptions are possible
+#
+# Algorithm:
+#    The algorithm starts at the top row (as determined by location) and iterates a row at a time
+#    maintainng counts of active open areas (kept in the collector array) each collector contains
+#    three values at the start of an iteration:
+#          0: mask of bits that would be adjacent to the collector in this row
+#          1: the number of bits collected so far
+#          2: a scratch space starting as zero, but used during the computation to represent
+#             the empty bits in the new row that are adjacent (position 0)
+#  The exact procedure is described in-code
+def prunable( board, location, slotting = false)
+  collectors = []
+  # loop across the rows
+  (location / 6).to_i.upto(9) do | row_on |
+    # obtain a set of regions representing the bits of the current row.
+    regions = $regions[(board >> (row_on * 6)) & 0b11111]
+    converter = $converter[row_on]
+
+    # track the number of collectors at the start of the cycle so that
+    # we don't compute against newly created collectors, only existing collectors
+    initial_collector_count = collectors.length
+
+    # loop against the regions.  For each region of the row
+    # we will see if it connects to one or more existing collectors.
+    # if it connects to 1 collector, the bits from the region are added to the
+    # bits of the collector and the mask is placed in collector[2]
+    # If the region overlaps more than one collector then all the collectors
+    # it overlaps with are merged into the first one (the others are set to nil in the array)
+    # if NO collectors are found then the region is copied as a new collector
+    regions.each do | region |
+      collector_found = nil
+      region_mask = region[2]
+      initial_collector_count.times do | collector_num |
+        collector = collectors[collector_num]
+        if (collector) then
+          collector_mask = collector[0]
+          if (collector_mask & region_mask != 0) then
+            if (collector_found) then
+              collector_found[0] |= collector_mask
+              collector_found[1] += collector[1]
+              collector_found[2] |= collector[2]
+              collectors[collector_num] = nil
+            else
+              collector_found = collector
+              collector[1] += region[1]
+              collector[2] |= region_mask
+            end
+          end
+        end
+      end
+      if (collector_found == nil) then
+        collectors.push(Array.new(region))
+      end
+    end
+
+    # check the existing collectors, if any collector overlapped no bits in the region its [2] value will
+    # be zero.  The size of any such reaason is tested if it is not a multiple of five true is returned since
+    # the board is prunable.  if it is a multiple of five it is removed.
+    # Collector that are still active have a new adjacent value [0] set based n the matched bits
+    # and have [2] cleared out for the next cycle.
+    collectors.length.times do | collector_num |
+      collector = collectors[collector_num]
+      if (collector) then
+        if (collector[2] == 0) then
+          return true if (collector[1] % 5 != 0)
+          collectors[collector_num] = nil
+        else
+          # if a collector matches all bits in the row then we can return unprunable early for the
+          # following reasons:
+          #    1) there can be no more unavailable bits bince we fill from the top left downward
+          #    2) all previous regions have been closed or joined so only this region can fail
+          #    3) this region must be good since there can never be only 1 region that is nuot
+          #       a multiple of five
+          # this rule only applies when filling normally, so we ignore the rule if we are "slotting"
+          # in pieces to see what configurations work for them (the only other time this algorithm is used).
+          return false if (collector[2] == 0b11111 && !slotting)
+          collector[0] = converter[collector[2]]
+          collector[2] = 0
+        end
+      end
+    end
+
+    # get rid of all the empty converters for the next round
+    collectors.compact!
+  end
+  return false if (collectors.length <= 1) # 1 collector or less and the region is fine
+  collectors.any? { | collector | (collector[1] % 5) != 0 } # more than 1 and we test them all for bad size
+end
+
+# creates a region given a row mask.  see prunable for what a "region" is
+def create_regions( value )
+  regions = []
+  cur_region = 0
+  5.times do | bit |
+    if (value[bit] == 0) then
+      cur_region |= 1 << bit
+    else
+      if (cur_region != 0 ) then
+        regions.push( cur_region)
+        cur_region = 0;
+      end
+    end
+  end
+  regions.push(cur_region) if (cur_region != 0)
+  regions
+end
+
+# find up to the counted number of solutions (or all solutions) and prints the final result
+def find_all
+  find_top( 1)
+  find_top( 0)
+  print_results
+end
+
+# show the board
+def print_results
+  print "#{@boards_found} solutions found\n\n"
+  print_full_board( @min_board)
+  print "\n"
+  print_full_board( @max_board)
+  print "\n"
+end
+
+# finds solutions.  This special version of the main function is only used for the top level
+# the reason for it is basically to force a particular ordering on how the rotations are tested for
+# the first piece.  It is called twice, first looking for placements of the odd rotations and then
+# looking for placements of the even locations.
+#
+# WHY?
+#   Since any found solution has an inverse we want to maximize finding solutions that are not already found
+#   as an inverse.  The inverse will ALWAYS be 3 one of the piece configurations that is exactly 3 rotations away
+#   (an odd number).  Checking even vs odd then produces a higher probability of finding more pieces earlier
+#   in the cycle.  We still need to keep checking all the permutations, but our probability of finding one will
+#   diminsh over time.  Since we are TOLD how many to search for this lets us exit before checking all pieces
+#   this bennifit is very great when seeking small numbers of solutions and is 0 when looking for more than the
+#   maximum number
+def find_top( rotation_skip)
+  board = blank_board
+  (@pieces.length-1).times do
+    piece = @pieces.shift
+    piece.masks[0].each do | mask, imask, cmask |
+      if ((rotation_skip += 1) % 2 == 0) then
+        piece.placed = mask
+        find( 1, 1, board | mask)
+      end
+    end
+    @pieces.push(piece)
+  end
+  piece = @pieces.shift
+  @pieces.push(piece)
+end
+
+# the normail find routine, iterates through the available pieces, checks all rotations at the current location
+# and adds any boards found.  depth is achieved via recursion.  the overall approach is described
+# here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
+# parameters:
+#  start_location -- where to start looking for place for the next piece at
+#  placed -- number of pieces placed
+#  board -- current state of the board
+#
+# see in-code comments
+def find( start_location, placed, board)
+  # find the next location to place a piece by looking for an empty bit
+  while board[start_location] == 1
+    start_location += 1
+  end
+
+  @pieces.length.times do
+    piece = @pieces.shift
+    piece.masks[start_location].each do | mask, imask, cmask |
+      if ( board & cmask == imask) then
+        piece.placed = mask
+        if (placed == 9) then
+          add_board
+        else
+          find( start_location + 1, placed + 1, board | mask)
+        end
+      end
+    end
+    @pieces.push(piece)
+  end
+end
+
+# print the board
+def print_full_board( board_string)
+  10.times do | row |
+    print " " if (row % 2 == 1)
+    5.times do | col |
+      print "#{board_string[row*5 + col,1]} "
+    end
+    print "\n"
+  end
+end
+
+# when a board is found we "draw it" into a string and then flip that string, adding both to
+# the list (hash) of solutions if they are unique.
+def add_board
+  board_string = "99999999999999999999999999999999999999999999999999"
+  @all_pieces.each {  | piece | piece.fill_string( board_string ) }
+  save( board_string)
+  save( board_string.reverse)
+end
+
+# adds a board string to the list (if new) and updates the current best/worst board
+def save( board_string)
+  if (@all_boards[board_string] == nil) then
+    @min_board = board_string if (board_string < @min_board)
+    @max_board = board_string if (board_string > @max_board)
+    @all_boards.store(board_string,true)
+    @boards_found += 1
+
+    # the exit motif is a time saver.  Ideally the function should return, but those tests
+    # take noticeable time (performance).
+    if (@boards_found == @stop_count) then
+      print_results
+      exit(0)
+    end
+  end
+end
+
+
+##
+## MAIN BODY :)
+##
+create_collector_support
+@pieces = [
+  Piece.new( [ :nw, :ne, :east, :east ], 2),
+  Piece.new( [ :ne, :se, :east, :ne ], 7),
+  Piece.new( [ :ne, :east, :ne, :nw ], 1),
+  Piece.new( [ :east, :sw, :sw, :se ], 6),
+  Piece.new( [ :east, :ne, :se, :ne ], 5),
+  Piece.new( [ :east, :east, :east, :se ], 0),
+  Piece.new( [ :ne, :nw, :se, :east, :se ], 4),
+  Piece.new( [ :se, :se, :se, :west ], 9),
+  Piece.new( [ :se, :se, :east, :se ], 8),
+  Piece.new( [ :east, :east, :sw, :se ], 3)
+  ];
+
+@all_pieces = Array.new( @pieces)
+
+@min_board = "99999999999999999999999999999999999999999999999999"
+@max_board = "00000000000000000000000000000000000000000000000000"
+@stop_count = ARGV[0].to_i || 2089
+@all_boards = {}
+@boards_found = 0
+
+find_all ######## DO IT!!!
+
diff --git a/benchmark/bm_so_nbody.rb b/benchmark/bm_so_nbody.rb
new file mode 100644
index 0000000000..d6c5bb9e61
--- /dev/null
+++ b/benchmark/bm_so_nbody.rb
@@ -0,0 +1,148 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org
+#
+# Optimized for Ruby by Jesse Millikan
+# From version ported by Michael Neumann from the C gcc version,
+# which was written by Christoph Bauer.
+
+SOLAR_MASS = 4 * Math::PI**2
+DAYS_PER_YEAR = 365.24
+
+def _puts *args
+end
+
+class Planet
+ attr_accessor :x, :y, :z, :vx, :vy, :vz, :mass
+
+ def initialize(x, y, z, vx, vy, vz, mass)
+  @x, @y, @z = x, y, z
+  @vx, @vy, @vz = vx * DAYS_PER_YEAR, vy * DAYS_PER_YEAR, vz * DAYS_PER_YEAR
+  @mass = mass * SOLAR_MASS
+ end
+
+ def move_from_i(bodies, nbodies, dt, i)
+  while i < nbodies
+   b2 = bodies[i]
+   dx = @x - b2.x
+   dy = @y - b2.y
+   dz = @z - b2.z
+
+   distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
+   mag = dt / (distance * distance * distance)
+   b_mass_mag, b2_mass_mag = @mass * mag, b2.mass * mag
+
+   @vx -= dx * b2_mass_mag
+   @vy -= dy * b2_mass_mag
+   @vz -= dz * b2_mass_mag
+   b2.vx += dx * b_mass_mag
+   b2.vy += dy * b_mass_mag
+   b2.vz += dz * b_mass_mag
+   i += 1
+  end
+
+  @x += dt * @vx
+  @y += dt * @vy
+  @z += dt * @vz
+ end
+end
+
+def energy(bodies)
+  e = 0.0
+  nbodies = bodies.size
+
+  for i in 0 ... nbodies
+    b = bodies[i]
+    e += 0.5 * b.mass * (b.vx * b.vx + b.vy * b.vy + b.vz * b.vz)
+    for j in (i + 1) ... nbodies
+      b2 = bodies[j]
+      dx = b.x - b2.x
+      dy = b.y - b2.y
+      dz = b.z - b2.z
+      distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
+      e -= (b.mass * b2.mass) / distance
+    end
+  end
+  e
+end
+
+def offset_momentum(bodies)
+  px, py, pz = 0.0, 0.0, 0.0
+
+  for b in bodies
+    m = b.mass
+    px += b.vx * m
+    py += b.vy * m
+    pz += b.vz * m
+  end
+
+  b = bodies[0]
+  b.vx = - px / SOLAR_MASS
+  b.vy = - py / SOLAR_MASS
+  b.vz = - pz / SOLAR_MASS
+end
+
+BODIES = [
+  # sun
+  Planet.new(0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0),
+
+  # jupiter
+  Planet.new(
+    4.84143144246472090e+00,
+    -1.16032004402742839e+00,
+    -1.03622044471123109e-01,
+    1.66007664274403694e-03,
+    7.69901118419740425e-03,
+    -6.90460016972063023e-05,
+    9.54791938424326609e-04),
+
+  # saturn
+  Planet.new(
+    8.34336671824457987e+00,
+    4.12479856412430479e+00,
+    -4.03523417114321381e-01,
+    -2.76742510726862411e-03,
+    4.99852801234917238e-03,
+    2.30417297573763929e-05,
+    2.85885980666130812e-04),
+
+  # uranus
+  Planet.new(
+    1.28943695621391310e+01,
+    -1.51111514016986312e+01,
+    -2.23307578892655734e-01,
+    2.96460137564761618e-03,
+    2.37847173959480950e-03,
+    -2.96589568540237556e-05,
+    4.36624404335156298e-05),
+
+  # neptune
+  Planet.new(
+    1.53796971148509165e+01,
+    -2.59193146099879641e+01,
+    1.79258772950371181e-01,
+    2.68067772490389322e-03,
+    1.62824170038242295e-03,
+    -9.51592254519715870e-05,
+    5.15138902046611451e-05)
+]
+
+init = 200_000 # ARGV[0]
+n = Integer(init)
+
+offset_momentum(BODIES)
+
+puts "%.9f" % energy(BODIES)
+
+nbodies = BODIES.size
+dt = 0.01
+
+n.times do
+  i = 0
+  while i < nbodies
+    b = BODIES[i]
+    b.move_from_i(BODIES, nbodies, dt, i + 1)
+    i += 1
+  end
+end
+
+puts "%.9f" % energy(BODIES)
diff --git a/benchmark/bm_so_nested_loop.rb b/benchmark/bm_so_nested_loop.rb
new file mode 100644
index 0000000000..a0513f8c47
--- /dev/null
+++ b/benchmark/bm_so_nested_loop.rb
@@ -0,0 +1,24 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: nestedloop-ruby.code,v 1.4 2004/11/13 07:42:22 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# from Avi Bryant
+
+n = 16 # Integer(ARGV.shift || 1)
+x = 0
+n.times do
+    n.times do
+        n.times do
+            n.times do
+                n.times do
+                    n.times do
+                        x += 1
+                    end
+                end
+            end
+        end
+    end
+end
+# puts x
+
+
diff --git a/benchmark/bm_so_nsieve.rb b/benchmark/bm_so_nsieve.rb
new file mode 100644
index 0000000000..a65cc78233
--- /dev/null
+++ b/benchmark/bm_so_nsieve.rb
@@ -0,0 +1,35 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+#
+# contributed by Glenn Parker, March 2005
+# modified by Evan Phoenix, Sept 2006
+
+def sieve(m)
+  flags = Flags.dup[0,m]
+  count = 0
+  pmax = m - 1
+  p = 2
+  while p <= pmax
+    unless flags[p].zero?
+      count += 1
+      mult = p
+      while mult <= pmax
+        flags[mult] = 0
+        mult += p
+      end
+    end
+    p += 1
+  end
+  count
+end
+
+n = 9 # (ARGV[0] || 2).to_i
+Flags = ("\x1" * ( 2 ** n * 10_000)).unpack("c*")
+
+n.downto(n-2) do |exponent|
+  break if exponent < 0
+  m = (1 << exponent) * 10_000
+  # m = (2 ** exponent) * 10_000
+  count = sieve(m)
+  printf "Primes up to %8d %8d\n", m, count
+end
diff --git a/benchmark/bm_so_nsieve_bits.rb b/benchmark/bm_so_nsieve_bits.rb
new file mode 100644
index 0000000000..6f958ee44e
--- /dev/null
+++ b/benchmark/bm_so_nsieve_bits.rb
@@ -0,0 +1,43 @@
+#!/usr/bin/ruby
+#coding: us-ascii
+#
+# The Great Computer Language Shootout
+# http://shootout.alioth.debian.org/
+#
+# nsieve-bits in Ruby
+# Contributed by Glenn Parker, March 2005
+
+CharExponent = 3
+BitsPerChar = 1 << CharExponent
+LowMask = BitsPerChar - 1
+
+def sieve(m)
+  items = "\xFF" * ((m / BitsPerChar) + 1)
+  masks = ""
+  BitsPerChar.times do |b|
+    masks << (1 << b).chr
+  end
+
+  count = 0
+  pmax = m - 1
+  2.step(pmax, 1) do |p|
+    if items[p >> CharExponent][p & LowMask] == 1
+      count += 1
+      p.step(pmax, p) do |mult|
+	a = mult >> CharExponent
+	b = mult & LowMask
+	items[a] -= masks[b] if items[a][b] != 0
+      end
+    end
+  end
+  count
+end
+
+n = 9 # (ARGV[0] || 2).to_i
+n.step(n - 2, -1) do |exponent|
+  break if exponent < 0
+  m = 2 ** exponent * 10_000
+  count = sieve(m)
+  printf "Primes up to %8d %8d\n", m, count
+end
+
diff --git a/benchmark/bm_so_object.rb b/benchmark/bm_so_object.rb
new file mode 100644
index 0000000000..e8607c7199
--- /dev/null
+++ b/benchmark/bm_so_object.rb
@@ -0,0 +1,56 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: objinst-ruby.code,v 1.4 2004/11/13 07:42:25 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# with help from Aristarkh Zagorodnikov
+
+class Toggle
+    def initialize(start_state)
+        @bool = start_state
+    end
+
+    def value
+        @bool
+    end
+
+    def activate
+        @bool = !@bool
+        self
+    end
+end
+
+class NthToggle < Toggle
+    def initialize(start_state, max_counter)
+        super start_state
+        @count_max = max_counter
+        @counter = 0
+    end
+
+    def activate
+        @counter += 1
+        if @counter >= @count_max
+            @bool = !@bool
+            @counter = 0
+        end
+        self
+    end
+end
+
+n = 1500000 # (ARGV.shift || 1).to_i
+
+toggle = Toggle.new 1
+5.times do
+    toggle.activate.value ? 'true' : 'false'
+end
+n.times do
+    toggle = Toggle.new 1
+end
+
+ntoggle = NthToggle.new 1, 3
+8.times do
+    ntoggle.activate.value ? 'true' : 'false'
+end
+n.times do
+    ntoggle = NthToggle.new 1, 3
+end
+
diff --git a/benchmark/bm_so_partial_sums.rb b/benchmark/bm_so_partial_sums.rb
new file mode 100644
index 0000000000..630b45cb8d
--- /dev/null
+++ b/benchmark/bm_so_partial_sums.rb
@@ -0,0 +1,31 @@
+n = 2_500_000 # (ARGV.shift || 1).to_i
+
+alt = 1.0 ; s0 = s1 = s2 = s3 = s4 = s5 = s6 = s7 = s8 = 0.0
+
+1.upto(n) do |d|
+  d = d.to_f ; d2 = d * d ; d3 = d2 * d ; ds = Math.sin(d) ; dc = Math.cos(d)
+
+  s0 += (2.0 / 3.0) ** (d - 1.0)
+  s1 += 1.0 / Math.sqrt(d)
+  s2 += 1.0 / (d * (d + 1.0))
+  s3 += 1.0 / (d3 * ds * ds)
+  s4 += 1.0 / (d3 * dc * dc)
+  s5 += 1.0 / d
+  s6 += 1.0 / d2
+  s7 += alt / d
+  s8 += alt / (2.0 * d - 1.0)
+
+  alt = -alt
+end
+
+if false
+  printf("%.9f\t(2/3)^k\n", s0)
+  printf("%.9f\tk^-0.5\n", s1)
+  printf("%.9f\t1/k(k+1)\n", s2)
+  printf("%.9f\tFlint Hills\n", s3)
+  printf("%.9f\tCookson Hills\n", s4)
+  printf("%.9f\tHarmonic\n", s5)
+  printf("%.9f\tRiemann Zeta\n", s6)
+  printf("%.9f\tAlternating Harmonic\n", s7)
+  printf("%.9f\tGregory\n", s8)
+end
diff --git a/benchmark/bm_so_pidigits.rb b/benchmark/bm_so_pidigits.rb
new file mode 100644
index 0000000000..c7d6fbfb4d
--- /dev/null
+++ b/benchmark/bm_so_pidigits.rb
@@ -0,0 +1,92 @@
+# The Great Computer Language Shootout
+# http://shootout.alioth.debian.org/
+#
+# contributed by Gabriele Renzi
+
+class PiDigitSpigot
+
+    def initialize()
+        @z = Transformation.new 1,0,0,1
+        @x = Transformation.new 0,0,0,0
+        @inverse = Transformation.new 0,0,0,0
+    end
+
+    def next!
+        @y = @z.extract(3)
+        if safe? @y
+            @z = produce(@y)
+            @y
+        else
+            @z = consume @x.next!()
+            next!()
+        end
+    end
+
+    def safe?(digit)
+        digit == @z.extract(4)
+    end
+
+    def produce(i)
+        @inverse.qrst(10,-10*i,0,1).compose(@z)
+    end
+
+    def consume(a)
+        @z.compose(a)
+    end
+end
+
+
+class Transformation
+    attr_reader :q, :r, :s, :t
+    def initialize (q, r, s, t)
+        @q,@r,@s,@t,@k = q,r,s,t,0
+    end
+
+    def next!()
+        @q = @k = @k + 1
+        @r = 4 * @k + 2
+        @s = 0
+        @t = 2 * @k + 1
+        self
+    end
+
+    def extract(j)
+        (@q * j + @r) / (@s * j + @t)
+    end
+
+    def compose(a)
+        self.class.new( @q * a.q,
+                        @q * a.r + r * a.t,
+                        @s * a.q + t * a.s,
+                        @s * a.r + t * a.t
+                    )
+    end
+
+    def qrst *args
+        initialize *args
+        self
+    end
+
+
+end
+
+
+WIDTH = 10
+n = 2_500 # Integer(ARGV[0])
+j = 0
+
+digits = PiDigitSpigot.new
+
+while n > 0
+    if n >= WIDTH
+        WIDTH.times {print digits.next!}
+        j += WIDTH
+    else
+        n.times {print digits.next!}
+        (WIDTH-n).times {print " "}
+        j += n
+    end
+    puts "\t:"+j.to_s
+    n -= WIDTH
+end
+
diff --git a/benchmark/bm_so_random.rb b/benchmark/bm_so_random.rb
new file mode 100644
index 0000000000..a66b9e8e63
--- /dev/null
+++ b/benchmark/bm_so_random.rb
@@ -0,0 +1,20 @@
+# from http://www.bagley.org/~doug/shootout/bench/random/random.ruby
+
+IM = 139968.0
+IA = 3877.0
+IC = 29573.0
+
+$last = 42.0
+
+def gen_random(max)
+  (max * ($last = ($last * IA + IC) % IM)) / IM
+end
+
+N = 3_000_000
+
+i = 0
+while i<N
+  i +=1
+  gen_random(100.0)
+end
+# "%.9f" % gen_random(100.0)
diff --git a/benchmark/bm_so_reverse_complement.rb b/benchmark/bm_so_reverse_complement.rb
new file mode 100644
index 0000000000..82ea666994
--- /dev/null
+++ b/benchmark/bm_so_reverse_complement.rb
@@ -0,0 +1,30 @@
+#!/usr/bin/ruby
+# The Great Computer Language Shootout
+# http://shootout.alioth.debian.org/
+#
+# Contributed by Peter Bjarke Olsen
+# Modified by Doug King
+
+seq=Array.new
+
+def revcomp(seq)
+  seq.reverse!.tr!('wsatugcyrkmbdhvnATUGCYRKMBDHVN','WSTAACGRYMKVHDBNTAACGRYMKVHDBN')
+  stringlen=seq.length
+  0.step(stringlen-1,60) {|x| print seq.slice(x,60) , "\n"}
+end
+
+input = open(File.join(File.dirname($0), 'fasta.output.2500000'), 'rb')
+
+while input.gets
+  if $_ =~ />/
+    if seq.length != 0
+      revcomp(seq.join)
+      seq=Array.new
+    end
+    puts $_
+  else
+    $_.sub(/\n/,'')
+    seq.push $_
+  end
+end
+revcomp(seq.join)
diff --git a/benchmark/bm_so_sieve.rb b/benchmark/bm_so_sieve.rb
new file mode 100644
index 0000000000..43dc302648
--- /dev/null
+++ b/benchmark/bm_so_sieve.rb
@@ -0,0 +1,24 @@
+# from http://www.bagley.org/~doug/shootout/bench/sieve/sieve.ruby
+num = 500
+count = i = j = 0
+flags0 = Array.new(8192,1)
+k = 0
+while k < num
+  k += 1
+  count = 0
+  flags = flags0.dup
+  i = 2
+  while i<8192
+    i += 1
+    if flags[i]
+      # remove all multiples of prime: i
+      j = i*i
+      while j < 8192
+        j += i
+        flags[j] = nil
+      end
+      count += 1
+    end
+  end
+end
+count
diff --git a/benchmark/bm_so_spectralnorm.rb b/benchmark/bm_so_spectralnorm.rb
new file mode 100644
index 0000000000..6b97206689
--- /dev/null
+++ b/benchmark/bm_so_spectralnorm.rb
@@ -0,0 +1,50 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+# Contributed by Sokolov Yura
+
+def eval_A(i,j)
+	return 1.0/((i+j)*(i+j+1)/2+i+1)
+end
+
+def eval_A_times_u(u)
+        v, i = nil, nil
+	(0..u.length-1).collect { |i|
+                v = 0
+		for j in 0..u.length-1
+			v += eval_A(i,j)*u[j]
+                end
+                v
+        }
+end
+
+def eval_At_times_u(u)
+	v, i = nil, nil
+	(0..u.length-1).collect{|i|
+                v = 0
+		for j in 0..u.length-1
+			v += eval_A(j,i)*u[j]
+                end
+                v
+        }
+end
+
+def eval_AtA_times_u(u)
+	return eval_At_times_u(eval_A_times_u(u))
+end
+
+n = 500 # ARGV[0].to_i
+
+u=[1]*n
+for i in 1..10
+        v=eval_AtA_times_u(u)
+        u=eval_AtA_times_u(v)
+end
+vBv=0
+vv=0
+for i in 0..n-1
+        vBv += u[i]*v[i]
+        vv += v[i]*v[i]
+end
+
+str = "%0.9f" % (Math.sqrt(vBv/vv)), "\n"
+# print str
diff --git a/benchmark/bm_vm1_attr_ivar.rb b/benchmark/bm_vm1_attr_ivar.rb
new file mode 100644
index 0000000000..16906f3605
--- /dev/null
+++ b/benchmark/bm_vm1_attr_ivar.rb
@@ -0,0 +1,14 @@
+class C
+  attr_reader :a, :b
+  def initialize
+    @a = nil
+    @b = nil
+  end
+end
+obj = C.new
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  j = obj.a
+  k = obj.b
+end
diff --git a/benchmark/bm_vm1_attr_ivar_set.rb b/benchmark/bm_vm1_attr_ivar_set.rb
new file mode 100644
index 0000000000..7e7a6b48c0
--- /dev/null
+++ b/benchmark/bm_vm1_attr_ivar_set.rb
@@ -0,0 +1,14 @@
+class C
+  attr_accessor :a, :b
+  def initialize
+    @a = nil
+    @b = nil
+  end
+end
+obj = C.new
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  obj.a = 1
+  obj.b = 2
+end
diff --git a/benchmark/bm_vm1_block.rb b/benchmark/bm_vm1_block.rb
new file mode 100644
index 0000000000..a9f56b15ea
--- /dev/null
+++ b/benchmark/bm_vm1_block.rb
@@ -0,0 +1,10 @@
+def m
+  yield
+end
+
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  m{
+  }
+end
diff --git a/benchmark/bm_vm1_const.rb b/benchmark/bm_vm1_const.rb
new file mode 100644
index 0000000000..ac59ebccf1
--- /dev/null
+++ b/benchmark/bm_vm1_const.rb
@@ -0,0 +1,8 @@
+Const = 1
+
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  j = Const
+  k = Const
+end
diff --git a/benchmark/bm_vm1_ensure.rb b/benchmark/bm_vm1_ensure.rb
new file mode 100644
index 0000000000..a1596145f2
--- /dev/null
+++ b/benchmark/bm_vm1_ensure.rb
@@ -0,0 +1,11 @@
+i = 0
+while i<30_000_000 # benchmark loop 1
+  i += 1
+  begin
+    begin
+    ensure
+    end
+  ensure
+  end
+end
+
diff --git a/benchmark/bm_vm1_float_simple.rb b/benchmark/bm_vm1_float_simple.rb
new file mode 100644
index 0000000000..d4581439ff
--- /dev/null
+++ b/benchmark/bm_vm1_float_simple.rb
@@ -0,0 +1,7 @@
+i = 0.0; f = 0.0
+while i<30_000_000
+  i += 1
+  f += 0.1; f -= 0.1
+  f += 0.1; f -= 0.1
+  f += 0.1; f -= 0.1
+end
diff --git a/benchmark/bm_vm1_gc_short_lived.rb b/benchmark/bm_vm1_gc_short_lived.rb
new file mode 100644
index 0000000000..e78bca5668
--- /dev/null
+++ b/benchmark/bm_vm1_gc_short_lived.rb
@@ -0,0 +1,10 @@
+i = 0
+while i<30_000_000 # while loop 1
+  a = '' # short-lived String
+  b = ''
+  c = ''
+  d = ''
+  e = ''
+  f = ''
+  i+=1
+end
diff --git a/benchmark/bm_vm1_gc_short_with_complex_long.rb b/benchmark/bm_vm1_gc_short_with_complex_long.rb
new file mode 100644
index 0000000000..b66052dee0
--- /dev/null
+++ b/benchmark/bm_vm1_gc_short_with_complex_long.rb
@@ -0,0 +1,27 @@
+def nested_hash h, n
+  if n == 0
+    ''
+  else
+    10.times{
+      h[Object.new] = nested_hash(h, n-1)
+    }
+  end
+end
+
+long_lived = Hash.new
+nested_hash long_lived, 6
+
+GC.start
+GC.start
+
+i = 0
+while i<30_000_000 # while loop 1
+  a = '' # short-lived String
+  b = ''
+  c = ''
+  d = ''
+  e = ''
+  f = ''
+  i+=1
+end
+
diff --git a/benchmark/bm_vm1_gc_short_with_long.rb b/benchmark/bm_vm1_gc_short_with_long.rb
new file mode 100644
index 0000000000..298dbc845b
--- /dev/null
+++ b/benchmark/bm_vm1_gc_short_with_long.rb
@@ -0,0 +1,13 @@
+long_lived = Array.new(1_000_000){|i| "#{i}"}
+GC.start
+GC.start
+i = 0
+while i<30_000_000 # while loop 1
+  a = '' # short-lived String
+  b = ''
+  c = ''
+  d = ''
+  e = ''
+  f = ''
+  i+=1
+end
diff --git a/benchmark/bm_vm1_gc_short_with_symbol.rb b/benchmark/bm_vm1_gc_short_with_symbol.rb
new file mode 100644
index 0000000000..6b15c1b7bf
--- /dev/null
+++ b/benchmark/bm_vm1_gc_short_with_symbol.rb
@@ -0,0 +1,15 @@
+# make many symbols
+50_000.times{|i| sym = "sym#{i}".to_sym}
+GC.start
+GC.start
+
+i = 0
+while i<30_000_000 # while loop 1
+  a = '' # short-lived String
+  b = ''
+  c = ''
+  d = ''
+  e = ''
+  f = ''
+  i+=1
+end
diff --git a/benchmark/bm_vm1_gc_wb_ary.rb b/benchmark/bm_vm1_gc_wb_ary.rb
new file mode 100644
index 0000000000..881528845b
--- /dev/null
+++ b/benchmark/bm_vm1_gc_wb_ary.rb
@@ -0,0 +1,12 @@
+short_lived_ary = []
+
+if RUBY_VERSION >= "2.2.0"
+  GC.start(full_mark: false, immediate_mark: true, lazy_sweep: false)
+end
+
+i = 0
+short_lived = ''
+while i<30_000_000 # while loop 1
+  short_lived_ary[0] = short_lived # write barrier
+  i+=1
+end
diff --git a/benchmark/bm_vm1_gc_wb_ary_promoted.rb b/benchmark/bm_vm1_gc_wb_ary_promoted.rb
new file mode 100644
index 0000000000..3c8279c956
--- /dev/null
+++ b/benchmark/bm_vm1_gc_wb_ary_promoted.rb
@@ -0,0 +1,14 @@
+long_lived = []
+
+if RUBY_VERSION > "2.2.0"
+  3.times{ GC.start(full_mark: false, immediate_mark: true, lazy_sweep: false) }
+elsif
+  GC.start
+end
+
+i = 0
+short_lived = ''
+while i<30_000_000 # while loop 1
+  long_lived[0] = short_lived # write barrier
+  i+=1
+end
diff --git a/benchmark/bm_vm1_gc_wb_obj.rb b/benchmark/bm_vm1_gc_wb_obj.rb
new file mode 100644
index 0000000000..a4067af36b
--- /dev/null
+++ b/benchmark/bm_vm1_gc_wb_obj.rb
@@ -0,0 +1,15 @@
+class C
+  attr_accessor :foo
+end
+short_lived_obj = C.new
+
+if RUBY_VERSION >= "2.2.0"
+  GC.start(full_mark: false, immediate_mark: true, lazy_sweep: false)
+end
+
+i = 0
+short_lived = ''
+while i<30_000_000 # while loop 1
+  short_lived_obj.foo = short_lived # write barrier
+  i+=1
+end
diff --git a/benchmark/bm_vm1_gc_wb_obj_promoted.rb b/benchmark/bm_vm1_gc_wb_obj_promoted.rb
new file mode 100644
index 0000000000..eee07a0248
--- /dev/null
+++ b/benchmark/bm_vm1_gc_wb_obj_promoted.rb
@@ -0,0 +1,17 @@
+class C
+  attr_accessor :foo
+end
+long_lived = C.new
+
+if RUBY_VERSION >= "2.2.0"
+  3.times{ GC.start(full_mark: false, immediate_mark: true, lazy_sweep: false) }
+elsif
+  GC.start
+end
+
+i = 0
+short_lived = ''
+while i<30_000_000 # while loop 1
+  long_lived.foo = short_lived # write barrier
+  i+=1
+end
diff --git a/benchmark/bm_vm1_ivar.rb b/benchmark/bm_vm1_ivar.rb
new file mode 100644
index 0000000000..68a73cf92f
--- /dev/null
+++ b/benchmark/bm_vm1_ivar.rb
@@ -0,0 +1,8 @@
+@a = 1
+
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  j = @a
+  k = @a
+end
diff --git a/benchmark/bm_vm1_ivar_set.rb b/benchmark/bm_vm1_ivar_set.rb
new file mode 100644
index 0000000000..bd81b06c34
--- /dev/null
+++ b/benchmark/bm_vm1_ivar_set.rb
@@ -0,0 +1,6 @@
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  @a = 1
+  @b = 2
+end
diff --git a/benchmark/bm_vm1_length.rb b/benchmark/bm_vm1_length.rb
new file mode 100644
index 0000000000..353de3ab0e
--- /dev/null
+++ b/benchmark/bm_vm1_length.rb
@@ -0,0 +1,9 @@
+a = 'abc'
+b = [1, 2, 3]
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  a.length
+  b.length
+end
+
diff --git a/benchmark/bm_vm1_lvar_init.rb b/benchmark/bm_vm1_lvar_init.rb
new file mode 100644
index 0000000000..36f2068811
--- /dev/null
+++ b/benchmark/bm_vm1_lvar_init.rb
@@ -0,0 +1,18 @@
+def m v
+  unless v
+    # unreachable code
+    v1 = v2 = v3 = v4 = v5 = v6 = v7 = v8 = v9 = v10 =
+    v11 = v12 = v13 = v14 = v15 = v16 = v17 = v18 = v19 = v20 =
+    v21 = v22 = v23 = v24 = v25 = v26 = v27 = v28 = v29 = v30 =
+    v31 = v32 = v33 = v34 = v35 = v36 = v37 = v38 = v39 = v40 =
+    v41 = v42 = v43 = v44 = v45 = v46 = v47 = v48 = v49 = v50 = 1
+  end
+end
+
+i = 0
+
+while i<30_000_000 # while loop 1
+  i += 1
+  m i
+end
+
diff --git a/benchmark/bm_vm1_lvar_set.rb b/benchmark/bm_vm1_lvar_set.rb
new file mode 100644
index 0000000000..222e864134
--- /dev/null
+++ b/benchmark/bm_vm1_lvar_set.rb
@@ -0,0 +1,5 @@
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  a = b = c = d = e = f = g = h = j = k = l = m = n = o = p = q = r = 1
+end
diff --git a/benchmark/bm_vm1_neq.rb b/benchmark/bm_vm1_neq.rb
new file mode 100644
index 0000000000..bbb4ae07a4
--- /dev/null
+++ b/benchmark/bm_vm1_neq.rb
@@ -0,0 +1,8 @@
+i = 0
+obj1 = Object.new
+obj2 = Object.new
+
+while i<30_000_000 # while loop 1
+  i += 1
+  obj1 != obj2
+end
diff --git a/benchmark/bm_vm1_not.rb b/benchmark/bm_vm1_not.rb
new file mode 100644
index 0000000000..b09ecdcc21
--- /dev/null
+++ b/benchmark/bm_vm1_not.rb
@@ -0,0 +1,7 @@
+i = 0
+obj = Object.new
+
+while i<30_000_000 # while loop 1
+  i += 1
+  !obj
+end
diff --git a/benchmark/bm_vm1_rescue.rb b/benchmark/bm_vm1_rescue.rb
new file mode 100644
index 0000000000..b0d3e2bdfa
--- /dev/null
+++ b/benchmark/bm_vm1_rescue.rb
@@ -0,0 +1,7 @@
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  begin
+  rescue
+  end
+end
diff --git a/benchmark/bm_vm1_simplereturn.rb b/benchmark/bm_vm1_simplereturn.rb
new file mode 100644
index 0000000000..63f9f21675
--- /dev/null
+++ b/benchmark/bm_vm1_simplereturn.rb
@@ -0,0 +1,9 @@
+def m
+  return 1
+end
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  m
+end
+
diff --git a/benchmark/bm_vm1_swap.rb b/benchmark/bm_vm1_swap.rb
new file mode 100644
index 0000000000..918f8b2112
--- /dev/null
+++ b/benchmark/bm_vm1_swap.rb
@@ -0,0 +1,8 @@
+a = 1
+b = 2
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  a, b = b, a
+end
+
diff --git a/benchmark/bm_vm1_yield.rb b/benchmark/bm_vm1_yield.rb
new file mode 100644
index 0000000000..775597cea6
--- /dev/null
+++ b/benchmark/bm_vm1_yield.rb
@@ -0,0 +1,10 @@
+def m
+  i = 0
+  while i<30_000_000 # while loop 1
+    i += 1
+    yield
+  end
+end
+
+m{}
+
diff --git a/benchmark/bm_vm2_array.rb b/benchmark/bm_vm2_array.rb
new file mode 100644
index 0000000000..df9037c83c
--- /dev/null
+++ b/benchmark/bm_vm2_array.rb
@@ -0,0 +1,5 @@
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  a = [1,2,3,4,5,6,7,8,9,10]
+end
diff --git a/benchmark/bm_vm2_bigarray.rb b/benchmark/bm_vm2_bigarray.rb
new file mode 100644
index 0000000000..b02509d6a2
--- /dev/null
+++ b/benchmark/bm_vm2_bigarray.rb
@@ -0,0 +1,106 @@
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  a = [
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+  ]
+end
diff --git a/benchmark/bm_vm2_bighash.rb b/benchmark/bm_vm2_bighash.rb
new file mode 100644
index 0000000000..5e3f437bb8
--- /dev/null
+++ b/benchmark/bm_vm2_bighash.rb
@@ -0,0 +1,5 @@
+i = 0
+while i<60_000 # benchmark loop 2
+  i += 1
+  a = {0=>0, 1=>1, 2=>2, 3=>3, 4=>4, 5=>5, 6=>6, 7=>7, 8=>8, 9=>9, 10=>10, 11=>11, 12=>12, 13=>13, 14=>14, 15=>15, 16=>16, 17=>17, 18=>18, 19=>19, 20=>20, 21=>21, 22=>22, 23=>23, 24=>24, 25=>25, 26=>26, 27=>27, 28=>28, 29=>29, 30=>30, 31=>31, 32=>32, 33=>33, 34=>34, 35=>35, 36=>36, 37=>37, 38=>38, 39=>39, 40=>40, 41=>41, 42=>42, 43=>43, 44=>44, 45=>45, 46=>46, 47=>47, 48=>48, 49=>49, 50=>50, 51=>51, 52=>52, 53=>53, 54=>54, 55=>55, 56=>56, 57=>57, 58=>58, 59=>59, 60=>60, 61=>61, 62=>62, 63=>63, 64=>64, 65=>65, 66=>66, 67=>67, 68=>68, 69=>69, 70=>70, 71=>71, 72=>72, 73=>73, 74=>74, 75=>75, 76=>76, 77=>77, 78=>78, 79=>79, 80=>80, 81=>81, 82=>82, 83=>83, 84=>84, 85=>85, 86=>86, 87=>87, 88=>88, 89=>89, 90=>90, 91=>91, 92=>92, 93=>93, 94=>94, 95=>95, 96=>96, 97=>97, 98=>98, 99=>99, 100=>100, 101=>101, 102=>102, 103=>103, 104=>104, 105=>105, 106=>106, 107=>107, 108=>108, 109=>109, 110=>110, 111=>111, 112=>112, 113=>113, 114=>114, 115=>115, 116=>116, 117=>117, 118=>118, 119=>119, 120=>120, 121=>121, 122=>122, 123=>123, 124=>124, 125=>125, 126=>126, 127=>127, 128=>128, 129=>129, 130=>130, 131=>131, 132=>132, 133=>133, 134=>134, 135=>135, 136=>136, 137=>137, 138=>138, 139=>139, 140=>140, 141=>141, 142=>142, 143=>143, 144=>144, 145=>145, 146=>146, 147=>147, 148=>148, 149=>149, 150=>150, 151=>151, 152=>152, 153=>153, 154=>154, 155=>155, 156=>156, 157=>157, 158=>158, 159=>159, 160=>160, 161=>161, 162=>162, 163=>163, 164=>164, 165=>165, 166=>166, 167=>167, 168=>168, 169=>169, 170=>170, 171=>171, 172=>172, 173=>173, 174=>174, 175=>175, 176=>176, 177=>177, 178=>178, 179=>179, 180=>180, 181=>181, 182=>182, 183=>183, 184=>184, 185=>185, 186=>186, 187=>187, 188=>188, 189=>189, 190=>190, 191=>191, 192=>192, 193=>193, 194=>194, 195=>195, 196=>196, 197=>197, 198=>198, 199=>199, 200=>200, 201=>201, 202=>202, 203=>203, 204=>204, 205=>205, 206=>206, 207=>207, 208=>208, 209=>209, 210=>210, 211=>211, 212=>212, 213=>213, 214=>214, 215=>215, 216=>216, 217=>217, 218=>218, 219=>219, 220=>220, 221=>221, 222=>222, 223=>223, 224=>224, 225=>225, 226=>226, 227=>227, 228=>228, 229=>229, 230=>230, 231=>231, 232=>232, 233=>233, 234=>234, 235=>235, 236=>236, 237=>237, 238=>238, 239=>239, 240=>240, 241=>241, 242=>242, 243=>243, 244=>244, 245=>245, 246=>246, 247=>247, 248=>248, 249=>249, 250=>250, 251=>251, 252=>252, 253=>253, 254=>254, 255=>255, 256=>256, 257=>257, 258=>258, 259=>259, 260=>260, 261=>261, 262=>262, 263=>263, 264=>264, 265=>265, 266=>266, 267=>267, 268=>268, 269=>269, 270=>270, 271=>271, 272=>272, 273=>273, 274=>274, 275=>275, 276=>276, 277=>277, 278=>278, 279=>279, 280=>280, 281=>281, 282=>282, 283=>283, 284=>284, 285=>285, 286=>286, 287=>287, 288=>288, 289=>289, 290=>290, 291=>291, 292=>292, 293=>293, 294=>294, 295=>295, 296=>296, 297=>297, 298=>298, 299=>299, 300=>300, 301=>301, 302=>302, 303=>303, 304=>304, 305=>305, 306=>306, 307=>307, 308=>308, 309=>309, 310=>310, 311=>311, 312=>312, 313=>313, 314=>314, 315=>315, 316=>316, 317=>317, 318=>318, 319=>319, 320=>320, 321=>321, 322=>322, 323=>323, 324=>324, 325=>325, 326=>326, 327=>327, 328=>328, 329=>329, 330=>330, 331=>331, 332=>332, 333=>333, 334=>334, 335=>335, 336=>336, 337=>337, 338=>338, 339=>339, 340=>340, 341=>341, 342=>342, 343=>343, 344=>344, 345=>345, 346=>346, 347=>347, 348=>348, 349=>349, 350=>350, 351=>351, 352=>352, 353=>353, 354=>354, 355=>355, 356=>356, 357=>357, 358=>358, 359=>359, 360=>360, 361=>361, 362=>362, 363=>363, 364=>364, 365=>365, 366=>366, 367=>367, 368=>368, 369=>369, 370=>370, 371=>371, 372=>372, 373=>373, 374=>374, 375=>375, 376=>376, 377=>377, 378=>378, 379=>379, 380=>380, 381=>381, 382=>382, 383=>383, 384=>384, 385=>385, 386=>386, 387=>387, 388=>388, 389=>389, 390=>390, 391=>391, 392=>392, 393=>393, 394=>394, 395=>395, 396=>396, 397=>397, 398=>398, 399=>399, 400=>400, 401=>401, 402=>402, 403=>403, 404=>404, 405=>405, 406=>406, 407=>407, 408=>408, 409=>409, 410=>410, 411=>411, 412=>412, 413=>413, 414=>414, 415=>415, 416=>416, 417=>417, 418=>418, 419=>419, 420=>420, 421=>421, 422=>422, 423=>423, 424=>424, 425=>425, 426=>426, 427=>427, 428=>428, 429=>429, 430=>430, 431=>431, 432=>432, 433=>433, 434=>434, 435=>435, 436=>436, 437=>437, 438=>438, 439=>439, 440=>440, 441=>441, 442=>442, 443=>443, 444=>444, 445=>445, 446=>446, 447=>447, 448=>448, 449=>449, 450=>450, 451=>451, 452=>452, 453=>453, 454=>454, 455=>455, 456=>456, 457=>457, 458=>458, 459=>459, 460=>460, 461=>461, 462=>462, 463=>463, 464=>464, 465=>465, 466=>466, 467=>467, 468=>468, 469=>469, 470=>470, 471=>471, 472=>472, 473=>473, 474=>474, 475=>475, 476=>476, 477=>477, 478=>478, 479=>479, 480=>480, 481=>481, 482=>482, 483=>483, 484=>484, 485=>485, 486=>486, 487=>487, 488=>488, 489=>489, 490=>490, 491=>491, 492=>492, 493=>493, 494=>494, 495=>495, 496=>496, 497=>497, 498=>498, 499=>499, 500=>500,}
+end
diff --git a/benchmark/bm_vm2_case.rb b/benchmark/bm_vm2_case.rb
new file mode 100644
index 0000000000..adc6e4df0a
--- /dev/null
+++ b/benchmark/bm_vm2_case.rb
@@ -0,0 +1,14 @@
+i = 0
+while i<6_000_000 # while loop 2
+  case :foo
+  when :bar
+    raise
+  when :baz
+    raise
+  when :boo
+    raise
+  when :foo
+    i += 1
+  end
+end
+
diff --git a/benchmark/bm_vm2_case_lit.rb b/benchmark/bm_vm2_case_lit.rb
new file mode 100644
index 0000000000..c62b294e0e
--- /dev/null
+++ b/benchmark/bm_vm2_case_lit.rb
@@ -0,0 +1,19 @@
+i = 0
+@ret = [ "foo", true, false, :sym, 6, nil, 0.1, 0xffffffffffffffff ]
+def foo(i)
+  @ret[i % @ret.size]
+end
+
+while i<6_000_000 # while loop 2
+  case foo(i)
+  when "foo" then :foo
+  when true then true
+  when false then false
+  when :sym then :sym
+  when 6 then :fix
+  when nil then nil
+  when 0.1 then :float
+  when 0xffffffffffffffff then :big
+  end
+  i += 1
+end
diff --git a/benchmark/bm_vm2_defined_method.rb b/benchmark/bm_vm2_defined_method.rb
new file mode 100644
index 0000000000..053ed6c912
--- /dev/null
+++ b/benchmark/bm_vm2_defined_method.rb
@@ -0,0 +1,9 @@
+class Object
+  define_method(:m){}
+end
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  m; m; m; m; m; m; m; m;
+end
diff --git a/benchmark/bm_vm2_dstr.rb b/benchmark/bm_vm2_dstr.rb
new file mode 100644
index 0000000000..58c0f7bbc3
--- /dev/null
+++ b/benchmark/bm_vm2_dstr.rb
@@ -0,0 +1,6 @@
+i = 0
+x = y = 'z'
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/bm_vm2_eval.rb b/benchmark/bm_vm2_eval.rb
new file mode 100644
index 0000000000..307cfc28ef
--- /dev/null
+++ b/benchmark/bm_vm2_eval.rb
@@ -0,0 +1,6 @@
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  eval("1")
+end
+
diff --git a/benchmark/bm_vm2_method.rb b/benchmark/bm_vm2_method.rb
new file mode 100644
index 0000000000..a8ccff7138
--- /dev/null
+++ b/benchmark/bm_vm2_method.rb
@@ -0,0 +1,9 @@
+def m
+  nil
+end
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  m; m; m; m; m; m; m; m;
+end
diff --git a/benchmark/bm_vm2_method_missing.rb b/benchmark/bm_vm2_method_missing.rb
new file mode 100644
index 0000000000..2badc73101
--- /dev/null
+++ b/benchmark/bm_vm2_method_missing.rb
@@ -0,0 +1,12 @@
+class C
+  def method_missing mid
+  end
+end
+
+obj = C.new
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m;
+end
diff --git a/benchmark/bm_vm2_method_with_block.rb b/benchmark/bm_vm2_method_with_block.rb
new file mode 100644
index 0000000000..b4efb4f520
--- /dev/null
+++ b/benchmark/bm_vm2_method_with_block.rb
@@ -0,0 +1,9 @@
+def m
+  nil
+end
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  m{}; m{}; m{}; m{}; m{}; m{}; m{}; m{};
+end
diff --git a/benchmark/bm_vm2_mutex.rb b/benchmark/bm_vm2_mutex.rb
new file mode 100644
index 0000000000..7362f738c5
--- /dev/null
+++ b/benchmark/bm_vm2_mutex.rb
@@ -0,0 +1,9 @@
+require 'thread'
+
+m = Mutex.new
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  m.synchronize{}
+end
diff --git a/benchmark/bm_vm2_newlambda.rb b/benchmark/bm_vm2_newlambda.rb
new file mode 100644
index 0000000000..6422c9b0d0
--- /dev/null
+++ b/benchmark/bm_vm2_newlambda.rb
@@ -0,0 +1,5 @@
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  lambda {}
+end
diff --git a/benchmark/bm_vm2_poly_method.rb b/benchmark/bm_vm2_poly_method.rb
new file mode 100644
index 0000000000..c82c0e4bce
--- /dev/null
+++ b/benchmark/bm_vm2_poly_method.rb
@@ -0,0 +1,20 @@
+class C1
+  def m
+    1
+  end
+end
+class C2
+  def m
+    2
+  end
+end
+
+o1 = C1.new
+o2 = C2.new
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  o = (i % 2 == 0) ? o1 : o2
+  o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
+  i += 1
+end
diff --git a/benchmark/bm_vm2_poly_method_ov.rb b/benchmark/bm_vm2_poly_method_ov.rb
new file mode 100644
index 0000000000..aa5fd1dd38
--- /dev/null
+++ b/benchmark/bm_vm2_poly_method_ov.rb
@@ -0,0 +1,20 @@
+class C1
+  def m
+    1
+  end
+end
+class C2
+  def m
+    2
+  end
+end
+
+o1 = C1.new
+o2 = C2.new
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  o = (i % 2 == 0) ? o1 : o2
+#  o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
+  i += 1
+end
diff --git a/benchmark/bm_vm2_proc.rb b/benchmark/bm_vm2_proc.rb
new file mode 100644
index 0000000000..65e5217371
--- /dev/null
+++ b/benchmark/bm_vm2_proc.rb
@@ -0,0 +1,14 @@
+def m &b
+  b
+end
+
+pr = m{
+  a = 1
+}
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  pr.call
+end
+
diff --git a/benchmark/bm_vm2_raise1.rb b/benchmark/bm_vm2_raise1.rb
new file mode 100644
index 0000000000..aa5387987f
--- /dev/null
+++ b/benchmark/bm_vm2_raise1.rb
@@ -0,0 +1,18 @@
+def rec n
+  if n > 0
+    rec n-1
+  else
+    raise
+  end
+end
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+
+  begin
+    rec 1
+  rescue
+    # ignore
+  end
+end
diff --git a/benchmark/bm_vm2_raise2.rb b/benchmark/bm_vm2_raise2.rb
new file mode 100644
index 0000000000..1f61c63157
--- /dev/null
+++ b/benchmark/bm_vm2_raise2.rb
@@ -0,0 +1,18 @@
+def rec n
+  if n > 0
+    rec n-1
+  else
+    raise
+  end
+end
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+
+  begin
+    rec 10
+  rescue
+    # ignore
+  end
+end
diff --git a/benchmark/bm_vm2_regexp.rb b/benchmark/bm_vm2_regexp.rb
new file mode 100644
index 0000000000..55f9e957a3
--- /dev/null
+++ b/benchmark/bm_vm2_regexp.rb
@@ -0,0 +1,6 @@
+i = 0
+str = 'xxxhogexxx'
+while i<6_000_000 # benchmark loop 2
+  /hoge/ =~ str
+  i += 1
+end
diff --git a/benchmark/bm_vm2_send.rb b/benchmark/bm_vm2_send.rb
new file mode 100644
index 0000000000..6a3ab6fdab
--- /dev/null
+++ b/benchmark/bm_vm2_send.rb
@@ -0,0 +1,12 @@
+class C
+  def m
+  end
+end
+
+o = C.new
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  o.__send__ :m
+end
diff --git a/benchmark/bm_vm2_string_literal.rb b/benchmark/bm_vm2_string_literal.rb
new file mode 100644
index 0000000000..1d73036849
--- /dev/null
+++ b/benchmark/bm_vm2_string_literal.rb
@@ -0,0 +1,5 @@
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  x = "xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx"
+end
diff --git a/benchmark/bm_vm2_struct_big_aref_hi.rb b/benchmark/bm_vm2_struct_big_aref_hi.rb
new file mode 100644
index 0000000000..22cb26b0a5
--- /dev/null
+++ b/benchmark/bm_vm2_struct_big_aref_hi.rb
@@ -0,0 +1,7 @@
+s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+x = s.new
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  x.z # x[25]
+end
diff --git a/benchmark/bm_vm2_struct_big_aref_lo.rb b/benchmark/bm_vm2_struct_big_aref_lo.rb
new file mode 100644
index 0000000000..5e61a7087e
--- /dev/null
+++ b/benchmark/bm_vm2_struct_big_aref_lo.rb
@@ -0,0 +1,7 @@
+s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+x = s.new
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  x.k # x[10]
+end
diff --git a/benchmark/bm_vm2_struct_big_aset.rb b/benchmark/bm_vm2_struct_big_aset.rb
new file mode 100644
index 0000000000..5a1c3d16f3
--- /dev/null
+++ b/benchmark/bm_vm2_struct_big_aset.rb
@@ -0,0 +1,7 @@
+s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+x = s.new
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  x.k = i # x[10] = i
+end
diff --git a/benchmark/bm_vm2_struct_big_href_hi.rb b/benchmark/bm_vm2_struct_big_href_hi.rb
new file mode 100644
index 0000000000..fff940a80a
--- /dev/null
+++ b/benchmark/bm_vm2_struct_big_href_hi.rb
@@ -0,0 +1,7 @@
+s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+x = s.new
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  x[:z]
+end
diff --git a/benchmark/bm_vm2_struct_big_href_lo.rb b/benchmark/bm_vm2_struct_big_href_lo.rb
new file mode 100644
index 0000000000..5e4085d59d
--- /dev/null
+++ b/benchmark/bm_vm2_struct_big_href_lo.rb
@@ -0,0 +1,7 @@
+s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+x = s.new
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  x[:k]
+end
diff --git a/benchmark/bm_vm2_struct_big_hset.rb b/benchmark/bm_vm2_struct_big_hset.rb
new file mode 100644
index 0000000000..9c0cee4141
--- /dev/null
+++ b/benchmark/bm_vm2_struct_big_hset.rb
@@ -0,0 +1,7 @@
+s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+x = s.new
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  x[:k] = i
+end
diff --git a/benchmark/bm_vm2_struct_small_aref.rb b/benchmark/bm_vm2_struct_small_aref.rb
new file mode 100644
index 0000000000..8eaa555b41
--- /dev/null
+++ b/benchmark/bm_vm2_struct_small_aref.rb
@@ -0,0 +1,7 @@
+s = Struct.new(:a, :b, :c)
+x = s.new
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  x.a
+end
diff --git a/benchmark/bm_vm2_struct_small_aset.rb b/benchmark/bm_vm2_struct_small_aset.rb
new file mode 100644
index 0000000000..ecd0f95669
--- /dev/null
+++ b/benchmark/bm_vm2_struct_small_aset.rb
@@ -0,0 +1,7 @@
+s = Struct.new(:a, :b, :c)
+x = s.new
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  x.a = i
+end
diff --git a/benchmark/bm_vm2_struct_small_href.rb b/benchmark/bm_vm2_struct_small_href.rb
new file mode 100644
index 0000000000..2c88fee6bf
--- /dev/null
+++ b/benchmark/bm_vm2_struct_small_href.rb
@@ -0,0 +1,7 @@
+s = Struct.new(:a, :b, :c)
+x = s.new
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  x[:a]
+end
diff --git a/benchmark/bm_vm2_struct_small_hset.rb b/benchmark/bm_vm2_struct_small_hset.rb
new file mode 100644
index 0000000000..33c36d20f1
--- /dev/null
+++ b/benchmark/bm_vm2_struct_small_hset.rb
@@ -0,0 +1,7 @@
+s = Struct.new(:a, :b, :c)
+x = s.new
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  x[:a] = 1
+end
diff --git a/benchmark/bm_vm2_super.rb b/benchmark/bm_vm2_super.rb
new file mode 100644
index 0000000000..afd8579e7b
--- /dev/null
+++ b/benchmark/bm_vm2_super.rb
@@ -0,0 +1,20 @@
+
+class C
+  def m
+    1
+  end
+end
+
+class CC < C
+  def m
+    super()
+  end
+end
+
+obj = CC.new
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  obj.m
+  i += 1
+end
diff --git a/benchmark/bm_vm2_unif1.rb b/benchmark/bm_vm2_unif1.rb
new file mode 100644
index 0000000000..1774625942
--- /dev/null
+++ b/benchmark/bm_vm2_unif1.rb
@@ -0,0 +1,8 @@
+i = 0
+def m a, b
+end
+
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  m 100, 200
+end
diff --git a/benchmark/bm_vm2_zsuper.rb b/benchmark/bm_vm2_zsuper.rb
new file mode 100644
index 0000000000..2a43e62217
--- /dev/null
+++ b/benchmark/bm_vm2_zsuper.rb
@@ -0,0 +1,20 @@
+i = 0
+
+class C
+  def m a
+    1
+  end
+end
+
+class CC < C
+  def m a
+    super
+  end
+end
+
+obj = CC.new
+
+while i<6_000_000 # benchmark loop 2
+  obj.m 10
+  i += 1
+end
diff --git a/benchmark/bm_vm3_backtrace.rb b/benchmark/bm_vm3_backtrace.rb
new file mode 100644
index 0000000000..0fbf73e1ca
--- /dev/null
+++ b/benchmark/bm_vm3_backtrace.rb
@@ -0,0 +1,22 @@
+# get last backtrace
+
+begin
+  caller(0, 0)
+rescue ArgumentError
+  alias caller_orig caller
+  def caller lev, n
+    caller_orig(lev)[0..n]
+  end
+end
+
+def rec n
+  if n < 0
+    100_000.times{
+      caller(0, 1)
+    }
+  else
+    rec(n-1)
+  end
+end
+
+rec 50
diff --git a/benchmark/bm_vm3_clearmethodcache.rb b/benchmark/bm_vm3_clearmethodcache.rb
new file mode 100644
index 0000000000..9661323cd2
--- /dev/null
+++ b/benchmark/bm_vm3_clearmethodcache.rb
@@ -0,0 +1,8 @@
+i = 0
+while i<200_000
+  i += 1
+
+  Class.new{
+    def m; end
+  }
+end
diff --git a/benchmark/bm_vm3_gc.rb b/benchmark/bm_vm3_gc.rb
new file mode 100644
index 0000000000..e668026915
--- /dev/null
+++ b/benchmark/bm_vm3_gc.rb
@@ -0,0 +1,6 @@
+5000.times do
+  100.times do
+    {"xxxx"=>"yyyy"}
+  end
+  GC.start
+end
diff --git a/benchmark/bm_vm_symbol_block_pass.rb b/benchmark/bm_vm_symbol_block_pass.rb
new file mode 100644
index 0000000000..1d433353e1
--- /dev/null
+++ b/benchmark/bm_vm_symbol_block_pass.rb
@@ -0,0 +1,13 @@
+class C
+  1000.times {|i|
+    eval("def i#{i};end")
+  }
+end
+
+c = C.new
+m = C.instance_methods(false)
+5_000.times do
+  m.each do |n|
+    c.tap(&n)
+  end
+end
diff --git a/benchmark/bm_vm_thread_alive_check1.rb b/benchmark/bm_vm_thread_alive_check1.rb
new file mode 100644
index 0000000000..c993accdda
--- /dev/null
+++ b/benchmark/bm_vm_thread_alive_check1.rb
@@ -0,0 +1,6 @@
+5_000.times{
+  t = Thread.new{}
+  while t.alive?
+    Thread.pass
+  end
+}
diff --git a/benchmark/bm_vm_thread_close.rb b/benchmark/bm_vm_thread_close.rb
new file mode 100644
index 0000000000..3e9a265ce8
--- /dev/null
+++ b/benchmark/bm_vm_thread_close.rb
@@ -0,0 +1,6 @@
+1000.times { Thread.new { sleep } }
+i = 0
+while i<100_000 # benchmark loop 3
+  i += 1
+  IO.pipe.each(&:close)
+end
diff --git a/benchmark/bm_vm_thread_create_join.rb b/benchmark/bm_vm_thread_create_join.rb
new file mode 100644
index 0000000000..393cd45df9
--- /dev/null
+++ b/benchmark/bm_vm_thread_create_join.rb
@@ -0,0 +1,6 @@
+i = 0
+while i<100_000 # benchmark loop 3
+  i += 1
+  Thread.new{
+  }.join
+end
diff --git a/benchmark/bm_vm_thread_mutex1.rb b/benchmark/bm_vm_thread_mutex1.rb
new file mode 100644
index 0000000000..5c9f85dfb7
--- /dev/null
+++ b/benchmark/bm_vm_thread_mutex1.rb
@@ -0,0 +1,21 @@
+# one thread, one mutex (no contention)
+
+require 'thread'
+m = Mutex.new
+r = 0
+max = 2000
+lmax = max * max
+(1..1).map{
+  Thread.new{
+    i = 0
+    while i<lmax
+      i += 1
+      m.synchronize{
+        r += 1
+      }
+    end
+  }
+}.each{|e|
+  e.join
+}
+raise r.to_s if r != max * max
diff --git a/benchmark/bm_vm_thread_mutex2.rb b/benchmark/bm_vm_thread_mutex2.rb
new file mode 100644
index 0000000000..10de59054f
--- /dev/null
+++ b/benchmark/bm_vm_thread_mutex2.rb
@@ -0,0 +1,21 @@
+# two threads, one mutex
+
+require 'thread'
+m = Mutex.new
+r = 0
+max = 2000
+lmax = (max * max)/2
+(1..2).map{
+  Thread.new{
+    i = 0
+    while i<lmax
+      i += 1
+      m.synchronize{
+        r += 1
+      }
+    end
+  }
+}.each{|e|
+  e.join
+}
+raise r.to_s if r != max * max
diff --git a/benchmark/bm_vm_thread_mutex3.rb b/benchmark/bm_vm_thread_mutex3.rb
new file mode 100644
index 0000000000..7f9a44b39d
--- /dev/null
+++ b/benchmark/bm_vm_thread_mutex3.rb
@@ -0,0 +1,20 @@
+# 1000 threads, one mutex
+
+require 'thread'
+m = Mutex.new
+r = 0
+max = 2000
+(1..max).map{
+  Thread.new{
+    i = 0
+    while i<max
+      i += 1
+      m.synchronize{
+        r += 1
+      }
+    end
+  }
+}.each{|e|
+  e.join
+}
+raise r.to_s if r != max * max
diff --git a/benchmark/bm_vm_thread_pass.rb b/benchmark/bm_vm_thread_pass.rb
new file mode 100644
index 0000000000..b5b3c0bc85
--- /dev/null
+++ b/benchmark/bm_vm_thread_pass.rb
@@ -0,0 +1,15 @@
+# Plenty Thtread.pass
+# A performance may depend on GVL implementation.
+
+tmax = (ARGV.shift || 2).to_i
+lmax = 200_000 / tmax
+
+(1..tmax).map{
+  Thread.new{
+    lmax.times{
+      Thread.pass
+    }
+  }
+}.each{|t| t.join}
+
+
diff --git a/benchmark/bm_vm_thread_pass_flood.rb b/benchmark/bm_vm_thread_pass_flood.rb
new file mode 100644
index 0000000000..27157d1a6f
--- /dev/null
+++ b/benchmark/bm_vm_thread_pass_flood.rb
@@ -0,0 +1,8 @@
+1000.times{
+  Thread.new{loop{Thread.pass}}
+}
+
+i = 0
+while i<10000
+  i += 1
+end
diff --git a/benchmark/bm_vm_thread_pipe.rb b/benchmark/bm_vm_thread_pipe.rb
new file mode 100644
index 0000000000..112a621905
--- /dev/null
+++ b/benchmark/bm_vm_thread_pipe.rb
@@ -0,0 +1,17 @@
+# Measure small and plenty pipe read/write.
+# A performance may depend on GVL implementation.
+
+lmax = 100_000
+r, w = IO.pipe
+[Thread.new{
+  lmax.times{
+    w.write('a')
+  }
+  p "w:exit"
+}, Thread.new{
+  lmax.times{
+    r.read(1)
+  }
+  p "r:exit"
+}].each{|t| t.join}
+
diff --git a/benchmark/bm_vm_thread_queue.rb b/benchmark/bm_vm_thread_queue.rb
new file mode 100644
index 0000000000..37381ae62b
--- /dev/null
+++ b/benchmark/bm_vm_thread_queue.rb
@@ -0,0 +1,18 @@
+require 'thread'
+
+n = 1_000_000
+q = Queue.new
+consumer = Thread.new{
+  while q.pop
+    # consuming
+  end
+}
+
+producer = Thread.new{
+  n.times{
+    q.push true
+  }
+  q.push nil
+}
+
+consumer.join
diff --git a/benchmark/driver.rb b/benchmark/driver.rb
new file mode 100644
index 0000000000..defe3c30be
--- /dev/null
+++ b/benchmark/driver.rb
@@ -0,0 +1,400 @@
+#
+# Ruby Benchmark driver
+#
+
+first = true
+
+begin
+  require 'optparse'
+rescue LoadError
+  if first
+    first = false
+    $:.unshift File.join(File.dirname(__FILE__), '../lib')
+    retry
+  else
+    raise
+  end
+end
+
+require 'benchmark'
+require 'pp'
+
+class BenchmarkDriver
+  def self.benchmark(opt)
+    driver = self.new(opt[:execs], opt[:dir], opt)
+    begin
+      driver.run
+    ensure
+      driver.show_results
+    end
+  end
+
+  def self.load(input, type, opt)
+    attrs = [:executables, :results]
+    case type
+    when 'yaml'
+      require 'yaml'
+      h = YAML.load(input)
+    when 'json'
+      require 'json'
+      h = JSON.load(input)
+    else
+      h = eval(input.read)
+    end
+    obj = allocate
+    obj.instance_variable_set("@execs", h[:executables] || h["executables"])
+    obj.instance_variable_set("@results", h[:results] || h["results"])
+    obj.instance_variable_set("@opt", opt)
+    obj
+  end
+
+  def output *args
+    puts(*args)
+    @output and @output.puts(*args)
+  end
+
+  def message *args
+    output(*args) if @verbose
+  end
+
+  def message_print *args
+    if @verbose
+      print(*args)
+      STDOUT.flush
+      @output and @output.print(*args)
+    end
+  end
+
+  def progress_message *args
+    unless STDOUT.tty?
+      STDERR.print(*args)
+      STDERR.flush
+    end
+  end
+
+  def initialize execs, dir, opt = {}
+    @execs = execs.map{|e|
+      e.strip!
+      next if e.empty?
+
+      if /(.+)::(.+)/ =~ e
+        # ex) ruby-a::/path/to/ruby-a
+        label = $1.strip
+        path = $2
+        version = `#{path} -v`.chomp
+      else
+        path = e
+        version = label = `#{path} -v`.chomp
+      end
+      [path, label, version]
+    }.compact
+
+    @dir = dir
+    @repeat = opt[:repeat] || 1
+    @repeat = 1 if @repeat < 1
+    @pattern = opt[:pattern] || nil
+    @exclude = opt[:exclude] || nil
+    @verbose = opt[:quiet] ? false : (opt[:verbose] || false)
+    @output = opt[:output] ? open(opt[:output], 'w') : nil
+    @loop_wl1 = @loop_wl2 = nil
+    @ruby_arg = opt[:ruby_arg] || nil
+    @opt = opt
+
+    # [[name, [[r-1-1, r-1-2, ...], [r-2-1, r-2-2, ...]]], ...]
+    @results = []
+
+    if @verbose
+      @start_time = Time.now
+      message @start_time
+      @execs.each_with_index{|(path, label, version), i|
+        message "target #{i}: " + (label == version ? "#{label}" : "#{label} (#{version})") + " at \"#{path}\""
+      }
+    end
+  end
+
+  def adjusted_results name, results
+    s = nil
+    results.each_with_index{|e, i|
+      r = e.min
+      case name
+      when /^vm1_/
+        if @loop_wl1
+          r -= @loop_wl1[i]
+          r = 0 if r < 0
+          s = '*'
+        end
+      when /^vm2_/
+        if @loop_wl2
+          r -= @loop_wl2[i]
+          r = 0 if r < 0
+          s = '*'
+        end
+      end
+      yield r
+    }
+    s
+  end
+
+  def show_results
+    case @opt[:format]
+    when :tsv
+      strformat = "\t%1$s"
+      numformat = "\t%1$*2$.3f"
+      minwidth = 0
+      name_width = 0
+    when :markdown
+      markdown = true
+      strformat = "|%1$-*2$s"
+      numformat = "|%1$*2$.3f"
+    when :plain
+      strformat = " %1$-*2$s"
+      numformat = " %1$*2$.3f"
+    end
+
+    name_width ||= @results.map {|v,*| v.size}.max
+    minwidth ||= 7
+    width = @execs.map{|(_, v)| [v.size, minwidth].max}
+
+    output
+
+    if @verbose
+      message '-----------------------------------------------------------'
+      message 'raw data:'
+      message
+      message PP.pp(@results, "", 79)
+      message
+      message "Elapsed time: #{Time.now - @start_time} (sec)"
+    end
+
+    if rawdata_output = @opt[:rawdata_output]
+      h = {}
+      h[:cpuinfo] = File.read('/proc/cpuinfo') if File.exist?('/proc/cpuinfo')
+      h[:executables] = @execs
+      h[:results] = @results
+      if (type = File.extname(rawdata_output)).empty?
+        type = rawdata_output
+        rawdata_output = @output.path.sub(/\.[^.\/]+\z/, '') << '.' << rawdata_output
+      end
+      case type
+      when 'yaml'
+        require 'yaml'
+        h = YAML.dump(h)
+      when 'json'
+        require 'json'
+        h = JSON.pretty_generate(h)
+      else
+        require 'pp'
+        h = h.pretty_inspect
+      end
+      open(rawdata_output, 'w') {|f| f.puts h}
+    end
+
+    output '-----------------------------------------------------------'
+    output 'benchmark results:'
+
+    if @verbose and @repeat > 1
+      output "minimum results in each #{@repeat} measurements."
+    end
+
+    output "Execution time (sec)"
+    output if markdown
+    output ["name".ljust(name_width), @execs.map.with_index{|(_, v), i| sprintf(strformat, v, width[i])}].join("").rstrip
+    output ["-"*name_width, width.map{|n|":".rjust(n, "-")}].join("|") if markdown
+    @results.each{|v, result|
+      rets = []
+      s = adjusted_results(v, result){|r|
+        rets << sprintf(numformat, r, width[rets.size])
+      }
+      v += s if s
+      output [v.ljust(name_width), rets].join("")
+    }
+
+    if @execs.size > 1
+      output
+      output "Speedup ratio: compare with the result of `#{@execs[0][1]}' (greater is better)"
+      output if markdown
+      output ["name".ljust(name_width), @execs[1..-1].map.with_index{|(_, v), i| sprintf(strformat, v, width[i])}].join("").rstrip
+      output ["-"*name_width, width[1..-1].map{|n|":".rjust(n, "-")}].join("|") if markdown
+      @results.each{|v, result|
+        rets = []
+        first_value = nil
+        s = adjusted_results(v, result){|r|
+          if first_value
+            if r == 0
+              rets << "Error"
+            else
+              rets << sprintf(numformat, first_value/r, width[rets.size+1])
+            end
+          else
+            first_value = r
+          end
+        }
+        v += s if s
+        output [v.ljust(name_width), rets].join("")
+      }
+    end
+
+    if @opt[:output]
+      output
+      output "Log file: #{@opt[:output]}"
+    end
+  end
+
+  def files
+    flag = {}
+    @files = Dir.glob(File.join(@dir, 'bm*.rb')).map{|file|
+      next if @pattern && /#{@pattern}/ !~ File.basename(file)
+      next if @exclude && /#{@exclude}/ =~ File.basename(file)
+      case file
+      when /bm_(vm[12])_/, /bm_loop_(whileloop2?).rb/
+        flag[$1] = true
+      end
+      file
+    }.compact
+
+    if flag['vm1'] && !flag['whileloop']
+      @files << File.join(@dir, 'bm_loop_whileloop.rb')
+    elsif flag['vm2'] && !flag['whileloop2']
+      @files << File.join(@dir, 'bm_loop_whileloop2.rb')
+    end
+
+    @files.sort!
+    progress_message "total: #{@files.size * @repeat} trial(s) (#{@repeat} trial(s) for #{@files.size} benchmark(s))\n"
+    @files
+  end
+
+  def run
+    files.each_with_index{|file, i|
+      @i = i
+      r = measure_file(file)
+
+      if /bm_loop_whileloop.rb/ =~ file
+        @loop_wl1 = r[1].map{|e| e.min}
+      elsif /bm_loop_whileloop2.rb/ =~ file
+        @loop_wl2 = r[1].map{|e| e.min}
+      end
+    }
+  end
+
+  def measure_file file
+    name = File.basename(file, '.rb').sub(/^bm_/, '')
+    prepare_file = File.join(File.dirname(file), "prepare_#{name}.rb")
+    load prepare_file if FileTest.exist?(prepare_file)
+
+    if @verbose
+      output
+      output '-----------------------------------------------------------'
+      output name
+      output
+      output File.read(file)
+      output
+    end
+
+    result = [name]
+    result << @execs.map{|(e, v)|
+      (0...@repeat).map{
+        message_print "#{v}\t"
+        progress_message '.'
+
+        m = measure(e, file)
+        message "#{m}"
+        m
+      }
+    }
+    @results << result
+    result
+  end
+
+  unless defined?(File::NULL)
+    if File.exist?('/dev/null')
+      File::NULL = '/dev/null'
+    end
+  end
+
+  def measure executable, file
+    cmd = "#{executable} #{@ruby_arg} #{file}"
+
+    m = Benchmark.measure{
+      system(cmd, out: File::NULL)
+    }
+
+    if $? != 0
+      output "\`#{cmd}\' exited with abnormal status (#{$?})"
+      0
+    else
+      m.real
+    end
+  end
+end
+
+if __FILE__ == $0
+  opt = {
+    :execs => [],
+    :dir => File.dirname(__FILE__),
+    :repeat => 1,
+    :output => nil,
+    :raw_output => nil,
+    :format => :tsv,
+  }
+  formats = {
+    :tsv => ".tsv",
+    :markdown => ".md",
+    :plain => ".txt",
+  }
+
+  parser = OptionParser.new{|o|
+    o.on('-e', '--executables [EXECS]',
+      "Specify benchmark one or more targets (e1::path1; e2::path2; e3::path3;...)"){|e|
+       e.split(/;/).each{|path|
+         opt[:execs] << path
+       }
+    }
+    o.on('-d', '--directory [DIRECTORY]', "Benchmark suites directory"){|d|
+      opt[:dir] = d
+    }
+    o.on('-p', '--pattern [PATTERN]', "Benchmark name pattern"){|p|
+      opt[:pattern] = p
+    }
+    o.on('-x', '--exclude [PATTERN]', "Benchmark exclude pattern"){|e|
+      opt[:exclude] = e
+    }
+    o.on('-r', '--repeat-count [NUM]', "Repeat count"){|n|
+      opt[:repeat] = n.to_i
+    }
+    o.on('-o', '--output-file [FILE]', "Output file"){|f|
+      opt[:output] = f
+    }
+    o.on('--ruby-arg [ARG]', "Optional argument for ruby"){|a|
+      opt[:ruby_arg] = a
+    }
+    o.on('--rawdata-output [FILE]', 'output rawdata'){|r|
+      opt[:rawdata_output] = r
+    }
+    o.on('--load-rawdata=FILE', 'input rawdata'){|r|
+      opt[:rawdata_input] = r
+    }
+    o.on('-f', "--format=FORMAT", "output format (#{formats.keys.join(",")})", formats.keys){|r|
+      opt[:format] = r
+    }
+    o.on('-v', '--verbose'){|v|
+      opt[:verbose] = v
+    }
+    o.on('-q', '--quiet', "Run without notify information except result table."){|q|
+      opt[:quiet] = q
+      opt[:verbose] = false
+    }
+  }
+
+  parser.parse!(ARGV)
+  opt[:output] ||= "bmlog-#{Time.now.strftime('%Y%m%d-%H%M%S')}.#{$$}#{formats[opt[:format]]}"
+
+  if input = opt[:rawdata_input]
+    b = open(input) {|f|
+      BenchmarkDriver.load(f, File.extname(input)[1..-1], opt)
+    }
+    b.show_results
+  else
+    BenchmarkDriver.benchmark(opt)
+  end
+end
+
diff --git a/benchmark/gc/aobench.rb b/benchmark/gc/aobench.rb
new file mode 100644
index 0000000000..2eed7abc83
--- /dev/null
+++ b/benchmark/gc/aobench.rb
@@ -0,0 +1 @@
+require_relative '../bm_app_aobench.rb'
diff --git a/benchmark/gc/binary_trees.rb b/benchmark/gc/binary_trees.rb
new file mode 100644
index 0000000000..af8ea722aa
--- /dev/null
+++ b/benchmark/gc/binary_trees.rb
@@ -0,0 +1 @@
+require_relative '../bm_so_binary_trees.rb'
diff --git a/benchmark/gc/gcbench.rb b/benchmark/gc/gcbench.rb
new file mode 100644
index 0000000000..09a404466a
--- /dev/null
+++ b/benchmark/gc/gcbench.rb
@@ -0,0 +1,56 @@
+require 'benchmark'
+require 'pp'
+require 'optparse'
+
+$list = true
+$gcprof = true
+
+opt = OptionParser.new
+opt.on('-q'){$list = false}
+opt.on('-d'){$gcprof = false}
+opt.parse!(ARGV)
+
+script = File.join(File.dirname(__FILE__), ARGV.shift)
+script += '.rb' unless FileTest.exist?(script)
+raise "#{script} not found" unless FileTest.exist?(script)
+
+puts "Script: #{script}"
+
+if $gcprof
+  GC::Profiler.enable
+end
+
+tms = Benchmark.measure{|x|
+  load script
+}
+
+gc_time = 0
+
+if $gcprof
+  gc_time = GC::Profiler.total_time
+  GC::Profiler.report if $list and RUBY_VERSION >= '2.0.0' # before 1.9.3, report() may run infinite loop
+  GC::Profiler.disable
+end
+
+pp GC.stat
+
+puts "#{RUBY_DESCRIPTION} #{GC::OPTS.inspect}" if defined?(GC::OPTS)
+
+desc = "#{RUBY_VERSION}#{RUBY_PATCHLEVEL >= 0 ? "p#{RUBY_PATCHLEVEL}" : "dev"}"
+name = File.basename(script, '.rb')
+
+puts
+puts script
+puts Benchmark::CAPTION
+puts tms
+puts "GC total time (sec): #{gc_time}"
+
+# show High-Water Mark on Linux
+if File.exist?('/proc/self/status') && /VmHWM:\s*(\d+.+)/ =~ File.read('/proc/self/status')
+  puts
+  puts "VmHWM: #{$1.chomp}"
+end
+
+puts
+puts "Summary of #{name} on #{desc}\t#{tms.real}\t#{gc_time}\t#{GC.count}"
+puts "         (real time in sec, GC time in sec, GC count)"
diff --git a/benchmark/gc/hash1.rb b/benchmark/gc/hash1.rb
new file mode 100644
index 0000000000..cb030d458d
--- /dev/null
+++ b/benchmark/gc/hash1.rb
@@ -0,0 +1,11 @@
+value = 0.01
+h = {}
+n = 50_000
+
+1.upto(n){|i|
+  h["%020d" % i] = "v-#{i}"
+}
+
+(n * 1_000).times{
+  ''
+}
diff --git a/benchmark/gc/hash2.rb b/benchmark/gc/hash2.rb
new file mode 100644
index 0000000000..e8c943fb21
--- /dev/null
+++ b/benchmark/gc/hash2.rb
@@ -0,0 +1,7 @@
+value = 0.01
+h = {}
+n = 4*(10**6)
+
+1.upto(n){|i|
+  h["%020d" % i] = value * i
+}
diff --git a/benchmark/gc/null.rb b/benchmark/gc/null.rb
new file mode 100644
index 0000000000..c05a79f561
--- /dev/null
+++ b/benchmark/gc/null.rb
@@ -0,0 +1 @@
+# null
diff --git a/benchmark/gc/pentomino.rb b/benchmark/gc/pentomino.rb
new file mode 100644
index 0000000000..94ba74be89
--- /dev/null
+++ b/benchmark/gc/pentomino.rb
@@ -0,0 +1 @@
+require_relative '../bm_app_pentomino.rb'
diff --git a/benchmark/gc/rdoc.rb b/benchmark/gc/rdoc.rb
new file mode 100644
index 0000000000..14c89f5611
--- /dev/null
+++ b/benchmark/gc/rdoc.rb
@@ -0,0 +1,13 @@
+require 'rdoc/rdoc'
+require 'tmpdir'
+
+srcdir = File.expand_path('../..', __dir__)
+
+Dir.mktmpdir('rdocbench-'){|d|
+  dir = File.join(d, 'rdocbench')
+  args = %W(--root #{srcdir} --page-dir #{srcdir}/doc --encoding=UTF-8 --no-force-update --all --ri --debug --quiet #{srcdir})
+  args << '--op' << dir
+
+  r = RDoc::RDoc.new
+  r.document args
+}
diff --git a/benchmark/gc/redblack.rb b/benchmark/gc/redblack.rb
new file mode 100644
index 0000000000..c66290140a
--- /dev/null
+++ b/benchmark/gc/redblack.rb
@@ -0,0 +1,366 @@
+# This benchmark is imported from https://github.com/jruby/rubybench/blob/master/time/bench_red_black.rb
+# License is License is Apache-2
+
+require 'benchmark'
+
+# Algorithm based on "Introduction to Algorithms" by Cormen and others
+class RedBlackTree
+  class Node
+    attr_accessor :color
+    attr_accessor :key
+    attr_accessor :left
+    attr_accessor :right
+    attr_accessor :parent
+
+    RED = :red
+    BLACK = :black
+    COLORS = [RED, BLACK].freeze
+
+    def initialize(key, color = RED)
+      raise ArgumentError, "Bad value for color parameter" unless COLORS.include?(color)
+      @color = color
+      @key = key
+      @left = @right = @parent = NilNode.instance
+    end
+
+    def black?
+      return color == BLACK
+    end
+
+    def red?
+      return color == RED
+    end
+  end
+
+  class NilNode < Node
+    class << self
+      private :new
+
+      # it's not thread safe
+      def instance
+        @instance ||= begin
+          def instance
+            return @instance
+          end
+
+          new
+        end
+      end
+    end
+
+    def initialize
+      self.color = BLACK
+      self.key = 0
+      self.left = nil
+      self.right = nil
+      self.parent = nil
+    end
+
+    def nil?
+      return true
+    end
+  end
+
+  include Enumerable
+
+  attr_accessor :root
+  attr_accessor :size
+
+  def initialize
+    self.root = NilNode.instance
+    self.size = 0
+  end
+
+  def add(key)
+    insert(Node.new(key))
+  end
+
+  def insert(x)
+    insert_helper(x)
+
+    x.color = Node::RED
+    while x != root && x.parent.color == Node::RED
+      if x.parent == x.parent.parent.left
+        y = x.parent.parent.right
+        if !y.nil? && y.color == Node::RED
+          x.parent.color = Node::BLACK
+          y.color = Node::BLACK
+          x.parent.parent.color = Node::RED
+          x = x.parent.parent
+        else
+          if x == x.parent.right
+            x = x.parent
+            left_rotate(x)
+          end
+          x.parent.color = Node::BLACK
+          x.parent.parent.color = Node::RED
+          right_rotate(x.parent.parent)
+        end
+      else
+        y = x.parent.parent.left
+        if !y.nil? && y.color == Node::RED
+          x.parent.color = Node::BLACK
+          y.color = Node::BLACK
+          x.parent.parent.color = Node::RED
+          x = x.parent.parent
+        else
+          if x == x.parent.left
+            x = x.parent
+            right_rotate(x)
+          end
+          x.parent.color = Node::BLACK
+          x.parent.parent.color = Node::RED
+          left_rotate(x.parent.parent)
+        end
+      end
+    end
+    root.color = Node::BLACK
+  end
+
+  alias << insert
+
+  def delete(z)
+    y = (z.left.nil? || z.right.nil?) ? z : successor(z)
+    x = y.left.nil? ? y.right : y.left
+    x.parent = y.parent
+
+    if y.parent.nil?
+      self.root = x
+    else
+      if y == y.parent.left
+        y.parent.left = x
+      else
+        y.parent.right = x
+      end
+    end
+
+    z.key = y.key if y != z
+
+    if y.color == Node::BLACK
+      delete_fixup(x)
+    end
+
+    self.size -= 1
+    return y
+  end
+
+  def minimum(x = root)
+    while !x.left.nil?
+      x = x.left
+    end
+    return x
+  end
+
+  def maximum(x = root)
+    while !x.right.nil?
+      x = x.right
+    end
+    return x
+  end
+
+  def successor(x)
+    if !x.right.nil?
+      return minimum(x.right)
+    end
+    y = x.parent
+    while !y.nil? && x == y.right
+      x = y
+      y = y.parent
+    end
+    return y
+  end
+
+  def predecessor(x)
+    if !x.left.nil?
+      return maximum(x.left)
+    end
+    y = x.parent
+    while !y.nil? && x == y.left
+      x = y
+      y = y.parent
+    end
+    return y
+  end
+
+  def inorder_walk(x = root)
+    x = self.minimum
+    while !x.nil?
+      yield x.key
+      x = successor(x)
+    end
+  end
+
+  alias each inorder_walk
+
+  def reverse_inorder_walk(x = root)
+    x = self.maximum
+    while !x.nil?
+      yield x.key
+      x = predecessor(x)
+    end
+  end
+
+  alias reverse_each reverse_inorder_walk
+
+  def search(key, x = root)
+    while !x.nil? && x.key != key
+      key < x.key ? x = x.left : x = x.right
+    end
+    return x
+  end
+
+  def empty?
+    return self.root.nil?
+  end
+
+  def black_height(x = root)
+    height = 0
+    while !x.nil?
+      x = x.left
+      height +=1 if x.nil? || x.black?
+    end
+    return height
+  end
+
+private
+
+  def left_rotate(x)
+    raise "x.right is nil!" if x.right.nil?
+    y = x.right
+    x.right = y.left
+    y.left.parent = x if !y.left.nil?
+    y.parent = x.parent
+    if x.parent.nil?
+      self.root = y
+    else
+      if x == x.parent.left
+        x.parent.left = y
+      else
+        x.parent.right = y
+      end
+    end
+    y.left = x
+    x.parent = y
+  end
+
+  def right_rotate(x)
+    raise "x.left is nil!" if x.left.nil?
+    y = x.left
+    x.left = y.right
+    y.right.parent = x if !y.right.nil?
+    y.parent = x.parent
+    if x.parent.nil?
+      self.root = y
+    else
+      if x == x.parent.left
+        x.parent.left = y
+      else
+        x.parent.right = y
+      end
+    end
+    y.right = x
+    x.parent = y
+  end
+
+  def insert_helper(z)
+    y = NilNode.instance
+    x = root
+    while !x.nil?
+      y = x
+      z.key < x.key ? x = x.left : x = x.right
+    end
+    z.parent = y
+    if y.nil?
+      self.root = z
+    else
+      z.key < y.key ? y.left = z : y.right = z
+    end
+    self.size += 1
+  end
+
+  def delete_fixup(x)
+    while x != root && x.color == Node::BLACK
+      if x == x.parent.left
+        w = x.parent.right
+        if w.color == Node::RED
+          w.color = Node::BLACK
+          x.parent.color = Node::RED
+          left_rotate(x.parent)
+          w = x.parent.right
+        end
+        if w.left.color == Node::BLACK && w.right.color == Node::BLACK
+          w.color = Node::RED
+          x = x.parent
+        else
+          if w.right.color == Node::BLACK
+            w.left.color = Node::BLACK
+            w.color = Node::RED
+            right_rotate(w)
+            w = x.parent.right
+          end
+          w.color = x.parent.color
+          x.parent.color = Node::BLACK
+          w.right.color = Node::BLACK
+          left_rotate(x.parent)
+          x = root
+        end
+      else
+        w = x.parent.left
+        if w.color == Node::RED
+          w.color = Node::BLACK
+          x.parent.color = Node::RED
+          right_rotate(x.parent)
+          w = x.parent.left
+        end
+        if w.right.color == Node::BLACK && w.left.color == Node::BLACK
+          w.color = Node::RED
+          x = x.parent
+        else
+          if w.left.color == Node::BLACK
+            w.right.color = Node::BLACK
+            w.color = Node::RED
+            left_rotate(w)
+            w = x.parent.left
+          end
+          w.color = x.parent.color
+          x.parent.color = Node::BLACK
+          w.left.color = Node::BLACK
+          right_rotate(x.parent)
+          x = root
+        end
+      end
+    end
+    x.color = Node::BLACK
+  end
+end
+
+def rbt_bm
+  n = 100_000
+  a1 = []; n.times { a1 << rand(999_999) }
+  a2 = []; n.times { a2 << rand(999_999) }
+
+  start = Time.now
+
+  tree = RedBlackTree.new
+
+  n.times {|i| tree.add(i) }
+  n.times { tree.delete(tree.root) }
+
+  tree = RedBlackTree.new
+  a1.each {|e| tree.add(e) }
+  a2.each {|e| tree.search(e) }
+  tree.inorder_walk {|key| key + 1 }
+  tree.reverse_inorder_walk {|key| key + 1 }
+  n.times { tree.minimum }
+  n.times { tree.maximum }
+
+  return Time.now - start
+end
+
+N = (ARGV[0] || 10).to_i
+
+N.times do
+  # puts rbt_bm.to_f
+  rbt_bm.to_f
+  # puts "GC.count = #{GC.count}" if GC.respond_to?(:count)
+end
diff --git a/benchmark/gc/ring.rb b/benchmark/gc/ring.rb
new file mode 100644
index 0000000000..be2c7b7250
--- /dev/null
+++ b/benchmark/gc/ring.rb
@@ -0,0 +1,29 @@
+# create many old objects
+
+max = 30_000_000
+
+class Ring
+  attr_reader :next_ring
+  def initialize n = nil
+    @next_ring = n
+  end
+
+
+  def size
+    s = 1
+    ring = self
+    while ring.next_ring
+      s += 1
+      ring = ring.next_ring
+    end
+    s
+  end
+end
+
+ring = Ring.new
+
+max.times{
+  ring = Ring.new(ring)
+}
+
+# p ring.size
diff --git a/benchmark/make_fasta_output.rb b/benchmark/make_fasta_output.rb
new file mode 100644
index 0000000000..b6d787ae27
--- /dev/null
+++ b/benchmark/make_fasta_output.rb
@@ -0,0 +1,19 @@
+# prepare 'fasta.output'
+
+def prepare_fasta_output n
+  filebase = File.join(File.dirname($0), 'fasta.output')
+  script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+  file = "#{filebase}.#{n}"
+
+  unless FileTest.exist?(file)
+    STDERR.puts "preparing #{file}"
+
+    open(file, 'w'){|f|
+      ARGV[0] = n
+      $stdout = f
+      load script
+      $stdout = STDOUT
+    }
+  end
+end
+
diff --git a/benchmark/other-lang/ack.pl b/benchmark/other-lang/ack.pl
new file mode 100644
author	Nobuyoshi Nakada <nobu@ruby-lang.org>	2021-01-26 22:01:07 +0900
committer	Nobuyoshi Nakada <nobu@ruby-lang.org>	2021-01-26 22:19:00 +0900
commit	ed6dc066b6247465c2bc55a39c2a837e53d2d4d0 (patch)
tree	5f799585265f7d094187417350c618553d60b49a /spec/ruby/library/date/yday_spec.rb
parent	b091889ed67f278b1652ddde88596e2160d5aef0 (diff)