summaryrefslogtreecommitdiff
path: root/spec/ruby/core/io/gets_spec.rb
diff options
context:
space:
mode:
authorNobuyoshi Nakada <nobu@ruby-lang.org>2021-10-14 14:27:30 +0900
committerNobuyoshi Nakada <nobu@ruby-lang.org>2021-10-14 18:43:32 +0900
commit1d6a490c2c67d4796c52335bdb28038960c29d9d (patch)
tree18838f1f76237ad5e7b02c684ceaaaa540eb42cd /spec/ruby/core/io/gets_spec.rb
parent1220556f33e21b4ba76e982f1a3b18cb47403bfb (diff)
Cast up to get rid of the potential overflow posibility
Notes
Notes: Merged: https://github.com/ruby/ruby/pull/4968
Diffstat (limited to 'spec/ruby/core/io/gets_spec.rb')
0 files changed, 0 insertions, 0 deletions
=389723d85433df0b487f02c94ca6a243d39a189e'>.gitattributes8
-rw-r--r--.github/SECURITY.md9
-rw-r--r--.github/workflows/check_branch.yml22
-rw-r--r--.github/workflows/macos.yml82
-rw-r--r--.github/workflows/mjit.yml76
-rw-r--r--.github/workflows/ubuntu.yml114
-rw-r--r--.github/workflows/windows.yml91
-rw-r--r--.gitignore225
-rw-r--r--.rspec_parallel2
-rw-r--r--.travis.yml550
-rw-r--r--BSDL22
-rw-r--r--CONTRIBUTING.md4
-rw-r--r--COPYING80
-rw-r--r--COPYING.ja72
-rw-r--r--ChangeLog7482
-rw-r--r--GPL39
-rw-r--r--KNOWNBUGS.rb7
-rw-r--r--LEGAL834
-rw-r--r--LGPL504
-rw-r--r--MANIFEST1054
-rw-r--r--Makefile.in380
-rw-r--r--NEWS826
-rw-r--r--README106
-rw-r--r--README.EXT1070
-rw-r--r--README.EXT.ja1198
-rw-r--r--README.ja153
-rw-r--r--README.ja.md185
-rw-r--r--README.md176
-rw-r--r--ToDo126
-rw-r--r--aclocal.m447
-rw-r--r--addr2line.c2665
-rw-r--r--addr2line.h21
-rw-r--r--appveyor.yml94
-rw-r--r--array.c7211
-rw-r--r--ast.c694
-rw-r--r--ast.rb144
-rwxr-xr-xbasictest/runner.rb33
-rwxr-xr-xbasictest/test.rb2360
-rw-r--r--bcc32/Makefile.sub585
-rw-r--r--bcc32/README.bcc32125
-rw-r--r--bcc32/configure.bat32
-rw-r--r--bcc32/mkexports.rb25
-rw-r--r--bcc32/setup.mak89
-rw-r--r--benchmark/README.md72
-rw-r--r--benchmark/app_answer.rb15
-rw-r--r--benchmark/app_aobench.rb297
-rw-r--r--benchmark/app_erb.yml23
-rw-r--r--benchmark/app_factorial.rb11
-rw-r--r--benchmark/app_fib.rb10
-rw-r--r--benchmark/app_lc_fizzbuzz.rb52
-rw-r--r--benchmark/app_mandelbrot.rb23
-rw-r--r--benchmark/app_pentomino.rb130
-rw-r--r--benchmark/app_raise.rb8
-rw-r--r--benchmark/app_strconcat.rb5
-rw-r--r--benchmark/app_tak.rb13
-rw-r--r--benchmark/app_tarai.rb10
-rw-r--r--benchmark/app_uri.rb8
-rw-r--r--benchmark/array_flatten.yml19
-rw-r--r--benchmark/array_intersection.yml14
-rw-r--r--benchmark/array_sample_100k_10.rb2
-rw-r--r--benchmark/array_sample_100k_11.rb2
-rw-r--r--benchmark/array_sample_100k__100.rb2
-rw-r--r--benchmark/array_sample_100k__1k.rb2
-rw-r--r--benchmark/array_sample_100k__6k.rb2
-rw-r--r--benchmark/array_sample_100k___10k.rb2
-rw-r--r--benchmark/array_sample_100k___50k.rb2
-rw-r--r--benchmark/array_shift.rb14
-rw-r--r--benchmark/array_small_and.rb17
-rw-r--r--benchmark/array_small_diff.rb17
-rw-r--r--benchmark/array_small_or.rb17
-rw-r--r--benchmark/array_sort_block.rb2
-rw-r--r--benchmark/array_sort_float.rb2
-rw-r--r--benchmark/array_values_at_int.rb2
-rw-r--r--benchmark/array_values_at_range.rb2
-rw-r--r--benchmark/bighash.rb1
-rw-r--r--benchmark/cgi_escape_html.yml40
-rw-r--r--benchmark/complex_float_add.yml7
-rw-r--r--benchmark/complex_float_div.yml7
-rw-r--r--benchmark/complex_float_mul.yml7
-rw-r--r--benchmark/complex_float_new.yml7
-rw-r--r--benchmark/complex_float_power.yml7
-rw-r--r--benchmark/complex_float_sub.yml7
-rw-r--r--benchmark/dir_empty_p.rb5
-rw-r--r--benchmark/enum_lazy_grep_v_100.rb4
-rw-r--r--benchmark/enum_lazy_grep_v_20.rb4
-rw-r--r--benchmark/enum_lazy_grep_v_50.rb4
-rw-r--r--benchmark/enum_lazy_uniq_100.rb4
-rw-r--r--benchmark/enum_lazy_uniq_20.rb4
-rw-r--r--benchmark/enum_lazy_uniq_50.rb4
-rw-r--r--benchmark/erb_render.yml24
-rwxr-xr-xbenchmark/fiber_chain.yml36
-rw-r--r--benchmark/file_chmod.rb9
-rw-r--r--benchmark/file_rename.rb11
-rw-r--r--benchmark/gc/aobench.rb1
-rw-r--r--benchmark/gc/binary_trees.rb1
-rw-r--r--benchmark/gc/gcbench.rb57
-rw-r--r--benchmark/gc/hash1.rb11
-rw-r--r--benchmark/gc/hash2.rb7
-rw-r--r--benchmark/gc/null.rb1
-rw-r--r--benchmark/gc/pentomino.rb1
-rw-r--r--benchmark/gc/rdoc.rb13
-rw-r--r--benchmark/gc/redblack.rb366
-rw-r--r--benchmark/gc/ring.rb29
-rw-r--r--benchmark/hash_aref_dsym.rb4
-rw-r--r--benchmark/hash_aref_dsym_long.rb21
-rw-r--r--benchmark/hash_aref_fix.rb4
-rw-r--r--benchmark/hash_aref_flo.rb4
-rw-r--r--benchmark/hash_aref_miss.rb5
-rw-r--r--benchmark/hash_aref_str.rb4
-rw-r--r--benchmark/hash_aref_sym.rb9
-rw-r--r--benchmark/hash_aref_sym_long.rb13
-rw-r--r--benchmark/hash_dup.yml8
-rw-r--r--benchmark/hash_flatten.rb9
-rw-r--r--benchmark/hash_ident_flo.rb4
-rw-r--r--benchmark/hash_ident_num.rb4
-rw-r--r--benchmark/hash_ident_obj.rb4
-rw-r--r--benchmark/hash_ident_str.rb4
-rw-r--r--benchmark/hash_ident_sym.rb4
-rw-r--r--benchmark/hash_keys.rb9
-rw-r--r--benchmark/hash_literal_small2.rb3
-rw-r--r--benchmark/hash_literal_small4.rb3
-rw-r--r--benchmark/hash_literal_small8.rb3
-rw-r--r--benchmark/hash_long.rb4
-rw-r--r--benchmark/hash_shift.rb10
-rw-r--r--benchmark/hash_shift_u16.rb10
-rw-r--r--benchmark/hash_shift_u24.rb10
-rw-r--r--benchmark/hash_shift_u32.rb10
-rw-r--r--benchmark/hash_small2.rb1
-rw-r--r--benchmark/hash_small4.rb1
-rw-r--r--benchmark/hash_small8.rb1
-rw-r--r--benchmark/hash_to_proc.rb9
-rw-r--r--benchmark/hash_values.rb9
-rw-r--r--benchmark/int_quo.rb1
-rw-r--r--benchmark/io_copy_stream_write.rb24
-rw-r--r--benchmark/io_copy_stream_write_socket.rb35
-rw-r--r--benchmark/io_file_create.rb13
-rw-r--r--benchmark/io_file_read.rb15
-rw-r--r--benchmark/io_file_write.rb14
-rw-r--r--benchmark/io_nonblock_noex.rb22
-rw-r--r--benchmark/io_nonblock_noex2.rb21
-rw-r--r--benchmark/io_pipe_rw.rb13
-rw-r--r--benchmark/io_select.rb9
-rw-r--r--benchmark/io_select2.rb22
-rw-r--r--benchmark/io_select3.rb21
-rw-r--r--benchmark/irb_color.yml13
-rw-r--r--benchmark/irb_exec.yml10
-rw-r--r--benchmark/lib/benchmark_driver/output/driver.rb36
-rw-r--r--benchmark/lib/benchmark_driver/runner/cstime.rb22
-rw-r--r--benchmark/lib/benchmark_driver/runner/cutime.rb22
-rw-r--r--benchmark/lib/benchmark_driver/runner/mjit_exec.rb237
-rw-r--r--benchmark/lib/benchmark_driver/runner/peak.rb151
-rw-r--r--benchmark/lib/benchmark_driver/runner/size.rb25
-rw-r--r--benchmark/lib/benchmark_driver/runner/stime.rb22
-rw-r--r--benchmark/lib/benchmark_driver/runner/total.rb137
-rw-r--r--benchmark/lib/benchmark_driver/runner/utime.rb22
-rw-r--r--benchmark/lib/load.rb18
-rw-r--r--benchmark/loop_for.rb3
-rw-r--r--benchmark/loop_generator.rb14
-rw-r--r--benchmark/loop_times.rb1
-rw-r--r--benchmark/loop_whileloop.rb4
-rw-r--r--benchmark/loop_whileloop2.rb4
-rw-r--r--benchmark/marshal_dump_flo.rb2
-rw-r--r--benchmark/marshal_dump_load_geniv.rb10
-rw-r--r--benchmark/marshal_dump_load_time.rb1
-rw-r--r--benchmark/match_gt4.rb1
-rw-r--r--benchmark/match_small.rb1
-rw-r--r--benchmark/mjit_exec_jt2jt.yml8
-rw-r--r--benchmark/mjit_exec_vm2jt.yml8
-rw-r--r--benchmark/mjit_exec_vm2vm.yml8
-rw-r--r--benchmark/nil_p.yml9
-rw-r--r--benchmark/other-lang/ack.pl11
-rw-r--r--benchmark/other-lang/ack.py16
-rw-r--r--benchmark/other-lang/ack.rb12
-rw-r--r--benchmark/other-lang/ack.scm7
-rw-r--r--benchmark/other-lang/eval.rb66
-rw-r--r--benchmark/other-lang/fact.pl13
-rw-r--r--benchmark/other-lang/fact.py18
-rw-r--r--benchmark/other-lang/fact.rb13
-rw-r--r--benchmark/other-lang/fact.scm8
-rw-r--r--benchmark/other-lang/fib.pl11
-rw-r--r--benchmark/other-lang/fib.py7
-rw-r--r--benchmark/other-lang/fib.rb9
-rw-r--r--benchmark/other-lang/fib.scm7
-rw-r--r--benchmark/other-lang/loop.pl3
-rw-r--r--benchmark/other-lang/loop.py2
-rw-r--r--benchmark/other-lang/loop.rb4
-rw-r--r--benchmark/other-lang/loop.scm1
-rw-r--r--benchmark/other-lang/loop2.rb1
-rw-r--r--benchmark/other-lang/tak.pl11
-rw-r--r--benchmark/other-lang/tak.py8
-rw-r--r--benchmark/other-lang/tak.rb13
-rw-r--r--benchmark/other-lang/tak.scm10
-rw-r--r--benchmark/range_last.yml4
-rw-r--r--benchmark/realpath.yml30
-rw-r--r--benchmark/require.yml32
-rw-r--r--benchmark/require_thread.yml40
-rw-r--r--benchmark/securerandom.rb5
-rw-r--r--benchmark/so_ackermann.rb19
-rw-r--r--benchmark/so_array.rb23
-rw-r--r--benchmark/so_binary_trees.rb62
-rw-r--r--benchmark/so_concatenate.rb18
-rw-r--r--benchmark/so_count_words.yml65
-rw-r--r--benchmark/so_exception.rb61
-rw-r--r--benchmark/so_fannkuch.rb45
-rw-r--r--benchmark/so_fasta.rb81
-rw-r--r--benchmark/so_k_nucleotide.yml155
-rw-r--r--benchmark/so_lists.rb47
-rw-r--r--benchmark/so_mandelbrot.rb57
-rw-r--r--benchmark/so_matrix.rb48
-rw-r--r--benchmark/so_meteor_contest.rb563
-rw-r--r--benchmark/so_nbody.rb148
-rw-r--r--benchmark/so_nested_loop.rb24
-rw-r--r--benchmark/so_nsieve.rb35
-rw-r--r--benchmark/so_nsieve_bits.rb43
-rw-r--r--benchmark/so_object.rb56
-rw-r--r--benchmark/so_partial_sums.rb31
-rw-r--r--benchmark/so_pidigits.rb92
-rw-r--r--benchmark/so_random.rb20
-rw-r--r--benchmark/so_reverse_complement.yml137
-rw-r--r--benchmark/so_sieve.rb24
-rw-r--r--benchmark/so_spectralnorm.rb50
-rw-r--r--benchmark/string_capitalize.yml10
-rw-r--r--benchmark/string_downcase.yml10
-rw-r--r--benchmark/string_index.rb3
-rw-r--r--benchmark/string_scan_re.rb2
-rw-r--r--benchmark/string_scan_str.rb2
-rw-r--r--benchmark/string_split.yml7
-rw-r--r--benchmark/string_swapcase.yml10
-rw-r--r--benchmark/string_upcase.yml10
-rw-r--r--benchmark/time_strptime.yml13
-rw-r--r--benchmark/time_subsec.rb2
-rw-r--r--benchmark/vm1_attr_ivar.yml14
-rw-r--r--benchmark/vm1_attr_ivar_set.yml14
-rw-r--r--benchmark/vm1_block.yml9
-rw-r--r--benchmark/vm1_blockparam.yml7
-rw-r--r--benchmark/vm1_blockparam_call.yml8
-rw-r--r--benchmark/vm1_blockparam_pass.yml12
-rw-r--r--benchmark/vm1_blockparam_yield.yml8
-rw-r--r--benchmark/vm1_const.yml7
-rw-r--r--benchmark/vm1_ensure.yml14
-rw-r--r--benchmark/vm1_float_simple.yml8
-rw-r--r--benchmark/vm1_gc_short_lived.yml9
-rw-r--r--benchmark/vm1_gc_short_with_complex_long.yml25
-rw-r--r--benchmark/vm1_gc_short_with_long.yml13
-rw-r--r--benchmark/vm1_gc_short_with_symbol.yml13
-rw-r--r--benchmark/vm1_gc_wb_ary.yml12
-rw-r--r--benchmark/vm1_gc_wb_ary_promoted.yml15
-rw-r--r--benchmark/vm1_gc_wb_obj.yml15
-rw-r--r--benchmark/vm1_gc_wb_obj_promoted.yml17
-rw-r--r--benchmark/vm1_ivar.yml6
-rw-r--r--benchmark/vm1_ivar_set.yml5
-rw-r--r--benchmark/vm1_length.yml8
-rw-r--r--benchmark/vm1_lvar_init.yml21
-rw-r--r--benchmark/vm1_lvar_set.yml4
-rw-r--r--benchmark/vm1_neq.yml7
-rw-r--r--benchmark/vm1_not.yml6
-rw-r--r--benchmark/vm1_rescue.yml6
-rw-r--r--benchmark/vm1_simplereturn.yml7
-rw-r--r--benchmark/vm1_swap.yml7
-rw-r--r--benchmark/vm1_yield.yml13
-rw-r--r--benchmark/vm2_array.yml4
-rw-r--r--benchmark/vm2_bigarray.yml105
-rw-r--r--benchmark/vm2_bighash.yml4
-rw-r--r--benchmark/vm2_case.yml13
-rw-r--r--benchmark/vm2_case_lit.yml23
-rw-r--r--benchmark/vm2_defined_method.yml8
-rw-r--r--benchmark/vm2_dstr.yml6
-rw-r--r--benchmark/vm2_eval.yml4
-rw-r--r--benchmark/vm2_fiber_allocate.yml8
-rw-r--r--benchmark/vm2_fiber_count.yml10
-rw-r--r--benchmark/vm2_fiber_reuse.yml14
-rw-r--r--benchmark/vm2_fiber_reuse_gc.yml12
-rw-r--r--benchmark/vm2_fiber_switch.yml9
-rw-r--r--benchmark/vm2_freezestring.yml10
-rw-r--r--benchmark/vm2_method.yml8
-rw-r--r--benchmark/vm2_method_missing.yml11
-rw-r--r--benchmark/vm2_method_with_block.yml8
-rw-r--r--benchmark/vm2_module_ann_const_set.yml4
-rw-r--r--benchmark/vm2_module_const_set.yml8
-rw-r--r--benchmark/vm2_mutex.yml8
-rw-r--r--benchmark/vm2_newlambda.yml4
-rw-r--r--benchmark/vm2_poly_method.yml24
-rw-r--r--benchmark/vm2_poly_method_ov.yml24
-rw-r--r--benchmark/vm2_poly_same_method.yml25
-rw-r--r--benchmark/vm2_poly_singleton.yml18
-rw-r--r--benchmark/vm2_proc.yml12
-rw-r--r--benchmark/vm2_raise1.yml16
-rw-r--r--benchmark/vm2_raise2.yml16
-rw-r--r--benchmark/vm2_regexp.yml8
-rw-r--r--benchmark/vm2_send.yml11
-rw-r--r--benchmark/vm2_string_literal.yml4
-rw-r--r--benchmark/vm2_struct_big_aref_hi.yml7
-rw-r--r--benchmark/vm2_struct_big_aref_lo.yml7
-rw-r--r--benchmark/vm2_struct_big_aset.yml11
-rw-r--r--benchmark/vm2_struct_big_href_hi.yml7
-rw-r--r--benchmark/vm2_struct_big_href_lo.yml7
-rw-r--r--benchmark/vm2_struct_big_hset.yml11
-rw-r--r--benchmark/vm2_struct_small_aref.yml7
-rw-r--r--benchmark/vm2_struct_small_aset.yml11
-rw-r--r--benchmark/vm2_struct_small_href.yml7
-rw-r--r--benchmark/vm2_struct_small_hset.yml7
-rw-r--r--benchmark/vm2_super.yml17
-rw-r--r--benchmark/vm2_unif1.yml7
-rw-r--r--benchmark/vm2_zsuper.yml18
-rw-r--r--benchmark/vm3_backtrace.rb22
-rw-r--r--benchmark/vm3_clearmethodcache.rb8
-rw-r--r--benchmark/vm3_gc.rb6
-rw-r--r--benchmark/vm3_gc_old_full.rb4
-rw-r--r--benchmark/vm3_gc_old_immediate.rb4
-rw-r--r--benchmark/vm3_gc_old_lazy.rb4
-rw-r--r--benchmark/vm_symbol_block_pass.rb13
-rw-r--r--benchmark/vm_thread_alive_check.yml8
-rw-r--r--benchmark/vm_thread_close.rb6
-rw-r--r--benchmark/vm_thread_condvar1.rb28
-rw-r--r--benchmark/vm_thread_condvar2.rb35
-rw-r--r--benchmark/vm_thread_create_join.rb6
-rw-r--r--benchmark/vm_thread_mutex1.rb21
-rw-r--r--benchmark/vm_thread_mutex2.rb21
-rw-r--r--benchmark/vm_thread_mutex3.rb20
-rw-r--r--benchmark/vm_thread_pass.rb15
-rw-r--r--benchmark/vm_thread_pass_flood.rb10
-rw-r--r--benchmark/vm_thread_pipe.rb17
-rw-r--r--benchmark/vm_thread_queue.rb18
-rw-r--r--benchmark/vm_thread_sized_queue.rb20
-rw-r--r--benchmark/vm_thread_sized_queue2.rb23
-rw-r--r--benchmark/vm_thread_sized_queue3.rb22
-rw-r--r--benchmark/vm_thread_sized_queue4.rb26
-rw-r--r--benchmark/vm_thread_sleep.yml4
-rw-r--r--bignum.c7856
-rwxr-xr-xbin/bundle27
-rwxr-xr-xbin/bundler27
-rwxr-xr-xbin/erb209
-rwxr-xr-xbin/gem25
-rw-r--r--[-rwxr-xr-x]bin/irb34
-rwxr-xr-xbin/racc27
-rwxr-xr-xbin/racc2y27
-rw-r--r--[-rwxr-xr-x]bin/rdoc72
-rwxr-xr-xbin/ri33
-rwxr-xr-xbin/testrb5
-rwxr-xr-xbin/y2racc27
-rw-r--r--bootstraptest/pending.rb44
-rwxr-xr-xbootstraptest/runner.rb530
-rw-r--r--bootstraptest/test_attr.rb36
-rw-r--r--bootstraptest/test_autoload.rb70
-rw-r--r--bootstraptest/test_block.rb613
-rw-r--r--bootstraptest/test_class.rb169
-rw-r--r--bootstraptest/test_env.rb12
-rw-r--r--bootstraptest/test_eval.rb325
-rw-r--r--bootstraptest/test_exception.rb432
-rw-r--r--bootstraptest/test_fiber.rb39
-rw-r--r--bootstraptest/test_finalizer.rb8
-rw-r--r--bootstraptest/test_flip.rb1
-rw-r--r--bootstraptest/test_flow.rb601
-rw-r--r--bootstraptest/test_fork.rb77
-rw-r--r--bootstraptest/test_gc.rb34
-rw-r--r--bootstraptest/test_insns.rb440
-rw-r--r--bootstraptest/test_io.rb112
-rw-r--r--bootstraptest/test_jump.rb309
-rw-r--r--bootstraptest/test_literal.rb247
-rw-r--r--bootstraptest/test_literal_suffix.rb54
-rw-r--r--bootstraptest/test_load.rb27
-rw-r--r--bootstraptest/test_marshal.rb5
-rw-r--r--bootstraptest/test_massign.rb183
-rw-r--r--bootstraptest/test_method.rb1192
-rw-r--r--bootstraptest/test_objectspace.rb55
-rw-r--r--bootstraptest/test_proc.rb483
-rw-r--r--bootstraptest/test_string.rb3
-rw-r--r--bootstraptest/test_struct.rb5
-rw-r--r--bootstraptest/test_syntax.rb904
-rw-r--r--bootstraptest/test_thread.rb486
-rw-r--r--builtin.c69
-rw-r--r--builtin.h78
-rw-r--r--ccan/build_assert/build_assert.h40
-rw-r--r--ccan/check_type/check_type.h63
-rw-r--r--ccan/container_of/container_of.h142
-rw-r--r--ccan/licenses/BSD-MIT17
-rw-r--r--ccan/licenses/CC028
-rw-r--r--ccan/list/list.h788
-rw-r--r--ccan/str/str.h16
-rw-r--r--class.c2268
-rw-r--r--common.mk3284
-rw-r--r--compar.c286
-rw-r--r--compile.c11638
-rw-r--r--complex.c2449
-rw-r--r--config.guess1405
-rw-r--r--config.sub1537
-rw-r--r--configure.ac4108
-rw-r--r--configure.in1483
-rw-r--r--constant.h50
-rw-r--r--cont.c2483
-rw-r--r--coroutine/amd64/Context.S46
-rw-r--r--coroutine/amd64/Context.h52
-rw-r--r--coroutine/arm32/Context.S29
-rw-r--r--coroutine/arm32/Context.h51
-rw-r--r--coroutine/arm64/Context.S62
-rw-r--r--coroutine/arm64/Context.h50
-rw-r--r--coroutine/copy/Context.c162
-rw-r--r--coroutine/copy/Context.h86
-rw-r--r--coroutine/ppc64le/Context.S75
-rw-r--r--coroutine/ppc64le/Context.h49
-rw-r--r--coroutine/ucontext/Context.c22
-rw-r--r--coroutine/ucontext/Context.h70
-rw-r--r--coroutine/win32/Context.S47
-rw-r--r--coroutine/win32/Context.asm55
-rw-r--r--coroutine/win32/Context.h57
-rw-r--r--coroutine/win64/Context.S77
-rw-r--r--coroutine/win64/Context.asm79
-rw-r--r--coroutine/win64/Context.h67
-rw-r--r--coroutine/x86/Context.S42
-rw-r--r--coroutine/x86/Context.h53
-rw-r--r--coverage/README17
-rw-r--r--cygwin/GNUmakefile.in71
-rw-r--r--debug.c229
-rw-r--r--debug_counter.c135
-rw-r--r--debug_counter.h390
-rw-r--r--defines.h255
-rw-r--r--defs/gmake.mk350
-rw-r--r--defs/id.def206
-rw-r--r--defs/keywords53
-rw-r--r--defs/known_errors.def157
-rw-r--r--defs/lex.c.src53
-rw-r--r--defs/opt_insn_unif.def27
-rw-r--r--defs/opt_operand.def22
-rw-r--r--defs/separated_version.mk38
-rw-r--r--defs/universal.mk5
-rw-r--r--dir.c3505
-rw-r--r--djgpp/GNUmakefile.in2
-rw-r--r--djgpp/README.djgpp21
-rw-r--r--djgpp/config.hin114
-rw-r--r--djgpp/config.sed128
-rw-r--r--djgpp/configure.bat20
-rw-r--r--djgpp/mkver.sed1
-rw-r--r--dln.c907
-rw-r--r--dln.h21
-rw-r--r--dln_find.c290
-rw-r--r--dmydln.c10
-rw-r--r--dmyenc.c10
-rw-r--r--dmyext.c2
-rw-r--r--doc/.document3
-rw-r--r--doc/ChangeLog-0.06_to_0.521147
-rw-r--r--doc/ChangeLog-0.50_to_0.60462
-rw-r--r--doc/ChangeLog-0.60_to_1.13955
-rw-r--r--doc/ChangeLog-1.8.0167
-rw-r--r--doc/ChangeLog-1.9.392772
-rw-r--r--doc/ChangeLog-2.0.024015
-rw-r--r--doc/ChangeLog-2.1.018060
-rw-r--r--doc/ChangeLog-2.2.012157
-rw-r--r--doc/ChangeLog-2.3.012187
-rw-r--r--doc/ChangeLog-2.4.09492
-rw-r--r--doc/ChangeLog-YARV6917
-rw-r--r--doc/NEWS837
-rw-r--r--doc/NEWS-1.8.7669
-rw-r--r--doc/NEWS-1.9.1429
-rw-r--r--doc/NEWS-1.9.2509
-rw-r--r--doc/NEWS-1.9.3341
-rw-r--r--doc/NEWS-2.0.0530
-rw-r--r--doc/NEWS-2.1.0376
-rw-r--r--doc/NEWS-2.2.0361
-rw-r--r--doc/NEWS-2.3.0404
-rw-r--r--doc/NEWS-2.4.0397
-rw-r--r--doc/NEWS-2.5.0565
-rw-r--r--doc/NEWS-2.6.0662
-rw-r--r--doc/bug_triaging.rdoc79
-rw-r--r--doc/contributing.rdoc447
-rw-r--r--doc/contributors.rdoc793
-rw-r--r--doc/dtrace_probes.rdoc178
-rw-r--r--doc/extension.ja.rdoc1834
-rw-r--r--doc/extension.rdoc2105
-rw-r--r--doc/forwardable.rd84
-rw-r--r--doc/forwardable.rd.ja47
-rw-r--r--doc/globals.rdoc72
-rw-r--r--doc/images/boottime-classes.pngbin28677 -> 0 bytes-rw-r--r--doc/irb/irb-tools.rd.ja117
-rw-r--r--doc/irb/irb.rd392
-rw-r--r--doc/irb/irb.rd.ja407
-rw-r--r--doc/keywords.rdoc160
-rw-r--r--doc/maintainers.rdoc359
-rw-r--r--doc/marshal.rdoc313
-rw-r--r--doc/pty/README.expect.ja21
-rw-r--r--doc/pty/README.ja76
-rw-r--r--doc/regexp.rdoc724
-rw-r--r--doc/security.rdoc139
-rw-r--r--doc/shell.rd348
-rw-r--r--doc/shell.rd.ja336
-rw-r--r--doc/signals.rdoc106
-rw-r--r--doc/standard_library.rdoc121
-rw-r--r--doc/syntax.rdoc36
-rw-r--r--doc/syntax/assignment.rdoc477
-rw-r--r--doc/syntax/calling_methods.rdoc377
-rw-r--r--doc/syntax/comments.rdoc37
-rw-r--r--doc/syntax/control_expressions.rdoc557
-rw-r--r--doc/syntax/exceptions.rdoc102
-rw-r--r--doc/syntax/literals.rdoc400
-rw-r--r--doc/syntax/methods.rdoc611
-rw-r--r--doc/syntax/miscellaneous.rdoc106
-rw-r--r--doc/syntax/modules_and_classes.rdoc376
-rw-r--r--doc/syntax/precedence.rdoc64
-rw-r--r--doc/syntax/refinements.rdoc283
-rw-r--r--doc/yarvarch.en7
-rw-r--r--doc/yarvarch.ja454
-rw-r--r--enc/Makefile.in84
-rw-r--r--enc/ascii.c104
-rw-r--r--enc/big5.c376
-rw-r--r--enc/cesu_8.c454
-rw-r--r--enc/cp949.c222
-rw-r--r--enc/depend722
-rw-r--r--enc/ebcdic.h11
-rw-r--r--enc/emacs_mule.c342
-rw-r--r--enc/encdb.c26
-rw-r--r--enc/encinit.c.erb37
-rw-r--r--enc/euc_jp.c616
-rw-r--r--enc/euc_kr.c220
-rw-r--r--enc/euc_tw.c228
-rw-r--r--enc/gb18030.c603
-rw-r--r--enc/gb2312.c11
-rw-r--r--enc/gbk.c225
-rw-r--r--enc/iso_2022_jp.h47
-rw-r--r--enc/iso_8859.h1
-rw-r--r--enc/iso_8859_1.c322
-rw-r--r--enc/iso_8859_10.c294
-rw-r--r--enc/iso_8859_11.c114
-rw-r--r--enc/iso_8859_13.c289
-rw-r--r--enc/iso_8859_14.c305
-rw-r--r--enc/iso_8859_15.c296
-rw-r--r--enc/iso_8859_16.c300
-rw-r--r--enc/iso_8859_2.c291
-rw-r--r--enc/iso_8859_3.c301
-rw-r--r--enc/iso_8859_4.c297
-rw-r--r--enc/iso_8859_5.c265
-rw-r--r--enc/iso_8859_6.c110
-rw-r--r--enc/iso_8859_7.c284
-rw-r--r--enc/iso_8859_8.c110
-rw-r--r--enc/iso_8859_9.c290
-rw-r--r--enc/jis/props.h.blt217
-rw-r--r--enc/jis/props.kwd52
-rw-r--r--enc/jis/props.src52
-rw-r--r--enc/koi8_r.c221
-rw-r--r--enc/koi8_u.c224
-rwxr-xr-xenc/make_encmake.rb159
-rw-r--r--enc/mktable.c1184
-rw-r--r--enc/shift_jis.c67
-rw-r--r--enc/shift_jis.h546
-rw-r--r--enc/trans/CP/CP932UDA%UCS.src1912
-rw-r--r--enc/trans/CP/CP932VDC@IBM%UCS.src420
-rw-r--r--enc/trans/CP/CP932VDC@NEC_IBM%UCS.src406
-rw-r--r--enc/trans/CP/UCS%CP932UDA.src1912
-rw-r--r--enc/trans/CP/UCS%CP932VDC@IBM.src420
-rw-r--r--enc/trans/CP/UCS%CP932VDC@NEC_IBM.src406
-rw-r--r--enc/trans/EMOJI/EMOJI_ISO-2022-JP-KDDI%UCS.src658
-rw-r--r--enc/trans/EMOJI/EMOJI_SHIFT_JIS-DOCOMO%UCS.src293
-rw-r--r--enc/trans/EMOJI/EMOJI_SHIFT_JIS-KDDI%UCS.src658
-rw-r--r--enc/trans/EMOJI/EMOJI_SHIFT_JIS-KDDI-UNDOC%UCS.src658
-rw-r--r--enc/trans/EMOJI/EMOJI_SHIFT_JIS-SOFTBANK%UCS.src496
-rw-r--r--enc/trans/EMOJI/UCS%EMOJI_ISO-2022-JP-KDDI-UNDOC.src658
-rw-r--r--enc/trans/EMOJI/UCS%EMOJI_ISO-2022-JP-KDDI.src658
-rw-r--r--enc/trans/EMOJI/UCS%EMOJI_SHIFT_JIS-DOCOMO.src293
-rw-r--r--enc/trans/EMOJI/UCS%EMOJI_SHIFT_JIS-KDDI-UNDOC.src658
-rw-r--r--enc/trans/EMOJI/UCS%EMOJI_SHIFT_JIS-KDDI.src658
-rw-r--r--enc/trans/EMOJI/UCS%EMOJI_SHIFT_JIS-SOFTBANK.src496
-rw-r--r--enc/trans/GB/GB12345%UCS.src7567
-rw-r--r--enc/trans/GB/GB2312%UCS.src7470
-rw-r--r--enc/trans/GB/UCS%GB12345.src7569
-rw-r--r--enc/trans/GB/UCS%GB2312.src7466
-rw-r--r--enc/trans/JIS/JISX0201-KANA%UCS.src124
-rw-r--r--enc/trans/JIS/JISX0208@1990%UCS.src6964
-rw-r--r--enc/trans/JIS/JISX0208@MS%UCS.src6893
-rw-r--r--enc/trans/JIS/JISX0208UDC%UCS.src954
-rw-r--r--enc/trans/JIS/JISX0208VDC@NEC%UCS.src97
-rw-r--r--enc/trans/JIS/JISX0212%UCS.src6159
-rw-r--r--enc/trans/JIS/JISX0212@MS%UCS.src6081
-rw-r--r--enc/trans/JIS/JISX0212UDC%UCS.src954
-rw-r--r--enc/trans/JIS/JISX0212VDC@IBM%UCS.src120
-rw-r--r--enc/trans/JIS/JISX0213-1%UCS@BMP.src1926
-rw-r--r--enc/trans/JIS/JISX0213-1%UCS@SIP.src60
-rw-r--r--enc/trans/JIS/JISX0213-2%UCS@BMP.src2193
-rw-r--r--enc/trans/JIS/JISX0213-2%UCS@SIP.src311
-rw-r--r--enc/trans/JIS/UCS%JISX0201-KANA.src125
-rw-r--r--enc/trans/JIS/UCS%JISX0208@1990.src6965
-rw-r--r--enc/trans/JIS/UCS%JISX0208@MS.src6894
-rw-r--r--enc/trans/JIS/UCS%JISX0208UDC.src955
-rw-r--r--enc/trans/JIS/UCS%JISX0208VDC@NEC.src98
-rw-r--r--enc/trans/JIS/UCS%JISX0212.src6163
-rw-r--r--enc/trans/JIS/UCS%JISX0212@MS.src6082
-rw-r--r--enc/trans/JIS/UCS%JISX0212UDC.src955
-rw-r--r--enc/trans/JIS/UCS%JISX0212VDC@IBM.src121
-rw-r--r--enc/trans/JIS/UCS@BMP%JISX0213-1.src1922
-rw-r--r--enc/trans/JIS/UCS@BMP%JISX0213-2.src2189
-rw-r--r--enc/trans/JIS/UCS@SIP%JISX0213-1.src56
-rw-r--r--enc/trans/JIS/UCS@SIP%JISX0213-2.src307
-rw-r--r--enc/trans/big5-hkscs-tbl.rb37302
-rw-r--r--enc/trans/big5-uao-tbl.rb19784
-rw-r--r--enc/trans/big5.trans32
-rw-r--r--enc/trans/cesu_8.trans85
-rw-r--r--enc/trans/chinese.trans31
-rw-r--r--enc/trans/cp850-tbl.rb130
-rw-r--r--enc/trans/cp852-tbl.rb130
-rw-r--r--enc/trans/cp855-tbl.rb130
-rw-r--r--enc/trans/cp949-tbl.rb8831
-rw-r--r--enc/trans/ebcdic.trans278
-rw-r--r--enc/trans/emoji-exchange-tbl.rb8407
-rw-r--r--enc/trans/emoji.trans36
-rw-r--r--enc/trans/emoji_iso2022_kddi.trans216
-rw-r--r--enc/trans/emoji_sjis_docomo.trans32
-rw-r--r--enc/trans/emoji_sjis_kddi.trans33
-rw-r--r--enc/trans/emoji_sjis_softbank.trans32
-rw-r--r--enc/trans/escape.trans93
-rw-r--r--enc/trans/euckr-tbl.rb8230
-rw-r--r--enc/trans/gb18030-tbl.rb63362
-rw-r--r--enc/trans/gb18030.trans183
-rw-r--r--enc/trans/gbk-tbl.rb21794
-rw-r--r--enc/trans/gbk.trans15
-rw-r--r--enc/trans/ibm437-tbl.rb130
-rw-r--r--enc/trans/ibm737-tbl.rb130
-rw-r--r--enc/trans/ibm775-tbl.rb130
-rw-r--r--enc/trans/ibm852-tbl.rb130
-rw-r--r--enc/trans/ibm855-tbl.rb130
-rw-r--r--enc/trans/ibm857-tbl.rb127
-rw-r--r--enc/trans/ibm860-tbl.rb130
-rw-r--r--enc/trans/ibm861-tbl.rb130
-rw-r--r--enc/trans/ibm862-tbl.rb130
-rw-r--r--enc/trans/ibm863-tbl.rb130
-rw-r--r--enc/trans/ibm865-tbl.rb130
-rw-r--r--enc/trans/ibm866-tbl.rb130
-rw-r--r--enc/trans/ibm869-tbl.rb121
-rw-r--r--enc/trans/iso-8859-1-tbl.rb98
-rw-r--r--enc/trans/iso-8859-10-tbl.rb98
-rw-r--r--enc/trans/iso-8859-11-tbl.rb90
-rw-r--r--enc/trans/iso-8859-13-tbl.rb98
-rw-r--r--enc/trans/iso-8859-14-tbl.rb98
-rw-r--r--enc/trans/iso-8859-15-tbl.rb98
-rw-r--r--enc/trans/iso-8859-16-tbl.rb98
-rw-r--r--enc/trans/iso-8859-2-tbl.rb98
-rw-r--r--enc/trans/iso-8859-3-tbl.rb91
-rw-r--r--enc/trans/iso-8859-4-tbl.rb98
-rw-r--r--enc/trans/iso-8859-5-tbl.rb98
-rw-r--r--enc/trans/iso-8859-6-tbl.rb53
-rw-r--r--enc/trans/iso-8859-7-tbl.rb95
-rw-r--r--enc/trans/iso-8859-8-tbl.rb62
-rw-r--r--enc/trans/iso-8859-9-tbl.rb98
-rw-r--r--enc/trans/iso2022.trans567
-rw-r--r--enc/trans/japanese.trans97
-rw-r--r--enc/trans/japanese_euc.trans57
-rw-r--r--enc/trans/japanese_sjis.trans33
-rw-r--r--enc/trans/koi8-r-tbl.rb130
-rw-r--r--enc/trans/koi8-u-tbl.rb130
-rw-r--r--enc/trans/korean.trans18
-rw-r--r--enc/trans/maccroatian-tbl.rb129
-rw-r--r--enc/trans/maccyrillic-tbl.rb130
-rw-r--r--enc/trans/macgreek-tbl.rb129
-rw-r--r--enc/trans/maciceland-tbl.rb129
-rw-r--r--enc/trans/macroman-tbl.rb129
-rw-r--r--enc/trans/macromania-tbl.rb129
-rw-r--r--enc/trans/macturkish-tbl.rb128
-rw-r--r--enc/trans/macukraine-tbl.rb130
-rw-r--r--enc/trans/newline.trans135
-rw-r--r--enc/trans/single_byte.trans88
-rw-r--r--enc/trans/tis-620-tbl.rb89
-rw-r--r--enc/trans/transdb.c18
-rw-r--r--enc/trans/ucm/glibc-BIG5-2.3.3.ucm14087
-rw-r--r--enc/trans/ucm/glibc-BIG5HKSCS-2.3.3.ucm18332
-rw-r--r--enc/trans/ucm/windows-950-2000.ucm20379
-rw-r--r--enc/trans/ucm/windows-950_hkscs-2001.ucm23446
-rw-r--r--enc/trans/utf8_mac-tbl.rb23154
-rw-r--r--enc/trans/utf8_mac.trans256
-rw-r--r--enc/trans/utf_16_32.trans556
-rw-r--r--enc/trans/windows-1250-tbl.rb125
-rw-r--r--enc/trans/windows-1251-tbl.rb129
-rw-r--r--enc/trans/windows-1252-tbl.rb125
-rw-r--r--enc/trans/windows-1253-tbl.rb113
-rw-r--r--enc/trans/windows-1254-tbl.rb123
-rw-r--r--enc/trans/windows-1255-tbl.rb142
-rw-r--r--enc/trans/windows-1256-tbl.rb130
-rw-r--r--enc/trans/windows-1257-tbl.rb118
-rw-r--r--enc/trans/windows-874-tbl.rb99
-rw-r--r--enc/unicode.c816
-rw-r--r--enc/unicode/12.1.0/casefold.h7428
-rw-r--r--enc/unicode/12.1.0/name2ctype.h41810
-rwxr-xr-xenc/unicode/case-folding.rb418
-rw-r--r--enc/us_ascii.c41
-rw-r--r--enc/utf_16_32.h5
-rw-r--r--enc/utf_16be.c256
-rw-r--r--enc/utf_16le.c248
-rw-r--r--enc/utf_32be.c206
-rw-r--r--enc/utf_32le.c206
-rw-r--r--enc/utf_7.h5
-rw-r--r--enc/utf_8.c449
-rw-r--r--enc/windows_1250.c271
-rw-r--r--enc/windows_1251.c253
-rw-r--r--enc/windows_1252.c260
-rw-r--r--enc/windows_1253.c297
-rw-r--r--enc/windows_1254.c302
-rw-r--r--enc/windows_1257.c304
-rw-r--r--enc/windows_31j.c81
-rw-r--r--enc/x_emoji.h26
-rw-r--r--encindex.h69
-rw-r--r--encoding.c1975
-rw-r--r--enum.c4280
-rw-r--r--enumerator.c4192
-rw-r--r--env.h60
-rw-r--r--error.c3388
-rw-r--r--eval.c13156
-rw-r--r--eval_error.c495
-rw-r--r--eval_intern.h321
-rw-r--r--eval_jump.c138
-rw-r--r--ext/-test-/arith_seq/extract/depend13
-rw-r--r--ext/-test-/arith_seq/extract/extconf.rb2
-rw-r--r--ext/-test-/arith_seq/extract/extract.c27
-rw-r--r--ext/-test-/array/resize/depend13
-rw-r--r--ext/-test-/array/resize/extconf.rb2
-rw-r--r--ext/-test-/array/resize/resize.c14
-rw-r--r--ext/-test-/auto_ext.rb10
-rw-r--r--ext/-test-/bignum/big2str.c53
-rw-r--r--ext/-test-/bignum/bigzero.c26
-rw-r--r--ext/-test-/bignum/depend92
-rw-r--r--ext/-test-/bignum/div.c35
-rw-r--r--ext/-test-/bignum/extconf.rb3
-rw-r--r--ext/-test-/bignum/init.c11
-rw-r--r--ext/-test-/bignum/intpack.c87
-rw-r--r--ext/-test-/bignum/mul.c65
-rw-r--r--ext/-test-/bignum/str2big.c38
-rw-r--r--ext/-test-/bug-14834/bug-14384.c39
-rw-r--r--ext/-test-/bug-14834/depend14
-rw-r--r--ext/-test-/bug-14834/extconf.rb2
-rw-r--r--ext/-test-/bug-3571/bug.c23
-rw-r--r--ext/-test-/bug-3571/depend14
-rw-r--r--ext/-test-/bug-3571/extconf.rb2
-rw-r--r--ext/-test-/bug-5832/bug.c14
-rw-r--r--ext/-test-/bug-5832/depend14
-rw-r--r--ext/-test-/bug-5832/extconf.rb2
-rw-r--r--ext/-test-/bug_reporter/bug_reporter.c24
-rw-r--r--ext/-test-/bug_reporter/depend14
-rw-r--r--ext/-test-/bug_reporter/extconf.rb2
-rw-r--r--ext/-test-/class/class2name.c14
-rw-r--r--ext/-test-/class/depend25
-rw-r--r--ext/-test-/class/extconf.rb3
-rw-r--r--ext/-test-/class/init.c11
-rw-r--r--ext/-test-/cxxanyargs/cxxanyargs.cpp619
-rw-r--r--ext/-test-/cxxanyargs/depend25
-rw-r--r--ext/-test-/cxxanyargs/extconf.rb33
-rw-r--r--ext/-test-/cxxanyargs/failure.cpp13
-rw-r--r--ext/-test-/cxxanyargs/failurem1.cpp13
-rw-r--r--ext/-test-/debug/depend38
-rw-r--r--ext/-test-/debug/extconf.rb3
-rw-r--r--ext/-test-/debug/init.c11
-rw-r--r--ext/-test-/debug/inspector.c32
-rw-r--r--ext/-test-/debug/profile_frames.c43
-rw-r--r--ext/-test-/dln/empty/depend3
-rw-r--r--ext/-test-/dln/empty/empty.c4
-rw-r--r--ext/-test-/dln/empty/extconf.rb2
-rw-r--r--ext/-test-/enumerator_kw/depend14
-rw-r--r--ext/-test-/enumerator_kw/enumerator_kw.c21
-rw-r--r--ext/-test-/enumerator_kw/extconf.rb1
-rw-r--r--ext/-test-/exception/dataerror.c31
-rw-r--r--ext/-test-/exception/depend52
-rw-r--r--ext/-test-/exception/enc_raise.c15
-rw-r--r--ext/-test-/exception/ensured.c39
-rw-r--r--ext/-test-/exception/extconf.rb3
-rw-r--r--ext/-test-/exception/init.c11
-rw-r--r--ext/-test-/fatal/depend14
-rw-r--r--ext/-test-/fatal/extconf.rb2
-rw-r--r--ext/-test-/fatal/rb_fatal.c19
-rw-r--r--ext/-test-/file/depend44
-rw-r--r--ext/-test-/file/extconf.rb18
-rw-r--r--ext/-test-/file/fs.c111
-rw-r--r--ext/-test-/file/init.c11
-rw-r--r--ext/-test-/file/stat.c27
-rw-r--r--ext/-test-/float/depend30
-rw-r--r--ext/-test-/float/extconf.rb3
-rw-r--r--ext/-test-/float/init.c11
-rw-r--r--ext/-test-/float/nextafter.c36
-rw-r--r--ext/-test-/funcall/depend14
-rw-r--r--ext/-test-/funcall/extconf.rb3
-rw-r--r--ext/-test-/funcall/funcall.c72
-rw-r--r--ext/-test-/gvl/call_without_gvl/call_without_gvl.c76
-rw-r--r--ext/-test-/gvl/call_without_gvl/depend14
-rw-r--r--ext/-test-/gvl/call_without_gvl/extconf.rb2
-rw-r--r--ext/-test-/hash/delete.c16
-rw-r--r--ext/-test-/hash/depend26
-rw-r--r--ext/-test-/hash/extconf.rb3
-rw-r--r--ext/-test-/hash/init.c11
-rw-r--r--ext/-test-/integer/core_ext.c36
-rw-r--r--ext/-test-/integer/depend39
-rw-r--r--ext/-test-/integer/extconf.rb3
-rw-r--r--ext/-test-/integer/init.c11
-rw-r--r--ext/-test-/integer/my_integer.c16
-rw-r--r--ext/-test-/iseq_load/depend14
-rw-r--r--ext/-test-/iseq_load/extconf.rb2
-rw-r--r--ext/-test-/iseq_load/iseq_load.c21
-rw-r--r--ext/-test-/iter/break.c25
-rw-r--r--ext/-test-/iter/depend38
-rw-r--r--ext/-test-/iter/extconf.rb3
-rw-r--r--ext/-test-/iter/init.c11
-rw-r--r--ext/-test-/iter/yield.c16
-rw-r--r--ext/-test-/load/dot.dot/depend3
-rw-r--r--ext/-test-/load/dot.dot/dot.dot.c1
-rw-r--r--ext/-test-/load/dot.dot/extconf.rb2
-rw-r--r--ext/-test-/load/protect/depend14
-rw-r--r--ext/-test-/load/protect/extconf.rb1
-rw-r--r--ext/-test-/load/protect/protect.c19
-rw-r--r--ext/-test-/marshal/compat/depend14
-rw-r--r--ext/-test-/marshal/compat/extconf.rb2
-rw-r--r--ext/-test-/marshal/compat/usrcompat.c32
-rw-r--r--ext/-test-/marshal/internal_ivar/depend14
-rw-r--r--ext/-test-/marshal/internal_ivar/extconf.rb2
-rw-r--r--ext/-test-/marshal/internal_ivar/internal_ivar.c48
-rw-r--r--ext/-test-/marshal/usr/depend14
-rw-r--r--ext/-test-/marshal/usr/extconf.rb2
-rw-r--r--ext/-test-/marshal/usr/usrmarshal.c50
-rw-r--r--ext/-test-/memory_status/depend14
-rw-r--r--ext/-test-/memory_status/extconf.rb12
-rw-r--r--ext/-test-/memory_status/memory_status.c69
-rw-r--r--ext/-test-/method/arity.c22
-rw-r--r--ext/-test-/method/depend26
-rw-r--r--ext/-test-/method/extconf.rb3
-rw-r--r--ext/-test-/method/init.c11
-rw-r--r--ext/-test-/notimplement/bug.c18
-rw-r--r--ext/-test-/notimplement/depend14
-rw-r--r--ext/-test-/notimplement/extconf.rb2
-rw-r--r--ext/-test-/num2int/depend14
-rw-r--r--ext/-test-/num2int/extconf.rb2
-rw-r--r--ext/-test-/num2int/num2int.c136
-rw-r--r--ext/-test-/path_to_class/depend14
-rw-r--r--ext/-test-/path_to_class/extconf.rb7
-rw-r--r--ext/-test-/path_to_class/path_to_class.c15
-rw-r--r--ext/-test-/popen_deadlock/depend14
-rw-r--r--ext/-test-/popen_deadlock/extconf.rb5
-rw-r--r--ext/-test-/popen_deadlock/infinite_loop_dlsym.c50
-rw-r--r--ext/-test-/postponed_job/depend15
-rw-r--r--ext/-test-/postponed_job/extconf.rb2
-rw-r--r--ext/-test-/postponed_job/postponed_job.c69
-rw-r--r--ext/-test-/printf/depend17
-rw-r--r--ext/-test-/printf/extconf.rb2
-rw-r--r--ext/-test-/printf/printf.c109
-rw-r--r--ext/-test-/proc/depend38
-rw-r--r--ext/-test-/proc/extconf.rb3
-rw-r--r--ext/-test-/proc/init.c11
-rw-r--r--ext/-test-/proc/receiver.c21
-rw-r--r--ext/-test-/proc/super.c27
-rw-r--r--ext/-test-/rational/depend19
-rw-r--r--ext/-test-/rational/extconf.rb8
-rw-r--r--ext/-test-/rational/rat.c37
-rw-r--r--ext/-test-/rb_call_super_kw/depend14
-rw-r--r--ext/-test-/rb_call_super_kw/extconf.rb1
-rw-r--r--ext/-test-/rb_call_super_kw/rb_call_super_kw.c14
-rw-r--r--ext/-test-/recursion/depend14
-rw-r--r--ext/-test-/recursion/extconf.rb3
-rw-r--r--ext/-test-/recursion/recursion.c28
-rw-r--r--ext/-test-/regexp/depend27
-rw-r--r--ext/-test-/regexp/extconf.rb3
-rw-r--r--ext/-test-/regexp/init.c11
-rw-r--r--ext/-test-/regexp/parse_depth_limit.c23
-rw-r--r--ext/-test-/scan_args/depend14
-rw-r--r--ext/-test-/scan_args/extconf.rb1
-rw-r--r--ext/-test-/scan_args/scan_args.c315
-rw-r--r--ext/-test-/st/foreach/depend14
-rw-r--r--ext/-test-/st/foreach/extconf.rb2
-rw-r--r--ext/-test-/st/foreach/foreach.c175
-rw-r--r--ext/-test-/st/numhash/depend14
-rw-r--r--ext/-test-/st/numhash/extconf.rb2
-rw-r--r--ext/-test-/st/numhash/numhash.c137
-rw-r--r--ext/-test-/st/update/depend14
-rw-r--r--ext/-test-/st/update/extconf.rb2
-rw-r--r--ext/-test-/st/update/update.c34
-rw-r--r--ext/-test-/string/capacity.c17
-rw-r--r--ext/-test-/string/coderange.c47
-rw-r--r--ext/-test-/string/cstr.c147
-rw-r--r--ext/-test-/string/depend202
-rw-r--r--ext/-test-/string/ellipsize.c13
-rw-r--r--ext/-test-/string/enc_associate.c22
-rw-r--r--ext/-test-/string/enc_str_buf_cat.c14
-rw-r--r--ext/-test-/string/extconf.rb3
-rw-r--r--ext/-test-/string/fstring.c15
-rw-r--r--ext/-test-/string/init.c11
-rw-r--r--ext/-test-/string/modify.c22
-rw-r--r--ext/-test-/string/new.c21
-rw-r--r--ext/-test-/string/nofree.c13
-rw-r--r--ext/-test-/string/normalize.c17
-rw-r--r--ext/-test-/string/qsort.c61
-rw-r--r--ext/-test-/string/rb_str_dup.c35
-rw-r--r--ext/-test-/string/set_len.c14
-rw-r--r--ext/-test-/struct/depend50
-rw-r--r--ext/-test-/struct/duplicate.c24
-rw-r--r--ext/-test-/struct/extconf.rb3
-rw-r--r--ext/-test-/struct/init.c11
-rw-r--r--ext/-test-/struct/len.c13
-rw-r--r--ext/-test-/struct/member.c18
-rw-r--r--ext/-test-/symbol/depend26
-rw-r--r--ext/-test-/symbol/extconf.rb4
-rw-r--r--ext/-test-/symbol/init.c39
-rw-r--r--ext/-test-/symbol/type.c78
-rw-r--r--ext/-test-/thread_fd_close/depend13
-rw-r--r--ext/-test-/thread_fd_close/extconf.rb2
-rw-r--r--ext/-test-/thread_fd_close/thread_fd_close.c14
-rw-r--r--ext/-test-/time/depend38
-rw-r--r--ext/-test-/time/extconf.rb3
-rw-r--r--ext/-test-/time/init.c11
-rw-r--r--ext/-test-/time/leap_second.c15
-rw-r--r--ext/-test-/time/new.c34
-rw-r--r--ext/-test-/tracepoint/depend26
-rw-r--r--ext/-test-/tracepoint/extconf.rb2
-rw-r--r--ext/-test-/tracepoint/gc_hook.c88
-rw-r--r--ext/-test-/tracepoint/tracepoint.c96
-rw-r--r--ext/-test-/typeddata/depend14
-rw-r--r--ext/-test-/typeddata/extconf.rb2
-rw-r--r--ext/-test-/typeddata/typeddata.c44
-rw-r--r--ext/-test-/vm/at_exit.c44
-rw-r--r--ext/-test-/vm/depend14
-rw-r--r--ext/-test-/vm/extconf.rb1
-rw-r--r--ext/-test-/wait_for_single_fd/depend17
-rw-r--r--ext/-test-/wait_for_single_fd/extconf.rb4
-rw-r--r--ext/-test-/wait_for_single_fd/wait_for_single_fd.c94
-rw-r--r--ext/-test-/win32/console/attribute.c69
-rw-r--r--ext/-test-/win32/console/depend1
-rw-r--r--ext/-test-/win32/console/extconf.rb5
-rw-r--r--ext/-test-/win32/console/init.c11
-rw-r--r--ext/-test-/win32/dln/depend9
-rw-r--r--ext/-test-/win32/dln/dlntest.c17
-rw-r--r--ext/-test-/win32/dln/extconf.rb33
-rw-r--r--ext/-test-/win32/dln/libdlntest.c4
-rw-r--r--ext/-test-/win32/dln/libdlntest.def2
-rw-r--r--ext/-test-/win32/fd_setsize/depend1
-rw-r--r--ext/-test-/win32/fd_setsize/extconf.rb4
-rw-r--r--ext/-test-/win32/fd_setsize/fd_setsize.c55
-rw-r--r--ext/.cvsignore2
-rw-r--r--ext/.document93
-rw-r--r--ext/Setup28
-rw-r--r--ext/Setup.atheos10
-rw-r--r--ext/Setup.dj33
-rw-r--r--ext/Setup.emx33
-rw-r--r--ext/Setup.nt11
-rw-r--r--ext/Setup.x6833
-rw-r--r--ext/Win32API/.cvsignore3
-rw-r--r--ext/Win32API/MANIFEST8
-rw-r--r--ext/Win32API/Win32API.c212
-rw-r--r--ext/Win32API/depend1
-rw-r--r--ext/Win32API/extconf.rb5
-rw-r--r--ext/Win32API/getch.rb5
-rw-r--r--ext/Win32API/lib/win32/registry.rb831
-rw-r--r--ext/Win32API/lib/win32/resolv.rb366
-rw-r--r--ext/Win32API/point.rb18
-rw-r--r--ext/bigdecimal/.cvsignore3
-rw-r--r--ext/bigdecimal/MANIFEST18
-rw-r--r--ext/bigdecimal/README60
-rw-r--r--ext/bigdecimal/bigdecimal.c7410
-rw-r--r--ext/bigdecimal/bigdecimal.def2
-rw-r--r--ext/bigdecimal/bigdecimal.gemspec39
-rw-r--r--ext/bigdecimal/bigdecimal.h314
-rw-r--r--ext/bigdecimal/bigdecimal_en.html797
-rw-r--r--ext/bigdecimal/bigdecimal_ja.html798
-rw-r--r--ext/bigdecimal/depend18
-rw-r--r--ext/bigdecimal/extconf.rb52
-rw-r--r--ext/bigdecimal/lib/bigdecimal.rb1
-rw-r--r--ext/bigdecimal/lib/bigdecimal/jacobian.rb59
-rw-r--r--ext/bigdecimal/lib/bigdecimal/ludcmp.rb54
-rw-r--r--ext/bigdecimal/lib/bigdecimal/math.rb174
-rw-r--r--ext/bigdecimal/lib/bigdecimal/newton.rb47
-rw-r--r--ext/bigdecimal/lib/bigdecimal/nlsolve.rb38
-rw-r--r--ext/bigdecimal/lib/bigdecimal/util.rb176
-rw-r--r--ext/bigdecimal/sample/linear.rb29
-rw-r--r--ext/bigdecimal/sample/nlsolve.rb26
-rw-r--r--ext/bigdecimal/sample/pi.rb1
-rw-r--r--ext/bigdecimal/util/depend14
-rw-r--r--ext/cgi/escape/depend17
-rw-r--r--ext/cgi/escape/escape.c408
-rw-r--r--ext/cgi/escape/extconf.rb3
-rw-r--r--ext/continuation/continuation.c13
-rw-r--r--ext/continuation/depend13
-rw-r--r--ext/continuation/extconf.rb4
-rw-r--r--ext/coverage/coverage.c341
-rw-r--r--ext/coverage/depend29
-rw-r--r--ext/coverage/extconf.rb5
-rw-r--r--ext/coverage/lib/coverage.rb14
-rw-r--r--ext/curses/.cvsignore3
-rw-r--r--ext/curses/MANIFEST9
-rw-r--r--ext/curses/curses.c2023
-rw-r--r--ext/curses/depend1
-rw-r--r--ext/curses/extconf.rb31
-rw-r--r--ext/curses/hello.rb30
-rw-r--r--ext/curses/mouse.rb53
-rw-r--r--ext/curses/rain.rb76
-rw-r--r--ext/curses/view.rb91
-rw-r--r--ext/curses/view2.rb115
-rw-r--r--ext/date/date.gemspec26
-rw-r--r--ext/date/date_core.c9957
-rw-r--r--ext/date/date_parse.c3035
-rw-r--r--ext/date/date_strftime.c638
-rw-r--r--ext/date/date_strptime.c702
-rw-r--r--ext/date/date_tmx.h56
-rw-r--r--ext/date/depend67
-rw-r--r--ext/date/extconf.rb9
-rw-r--r--ext/date/lib/date.rb66
-rw-r--r--ext/date/prereq.mk12
-rw-r--r--ext/date/update-abbr35
-rw-r--r--ext/date/zonetab.h1562
-rw-r--r--ext/date/zonetab.list327
-rw-r--r--ext/dbm/.cvsignore3
-rw-r--r--ext/dbm/MANIFEST5
-rw-r--r--ext/dbm/dbm.c873
-rw-r--r--ext/dbm/dbm.gemspec20
-rw-r--r--ext/dbm/depend15
-rw-r--r--ext/dbm/extconf.rb303
-rw-r--r--ext/dbm/testdbm.rb593
-rw-r--r--ext/digest/.cvsignore3
-rw-r--r--ext/digest/MANIFEST11
-rw-r--r--ext/digest/bubblebabble/bubblebabble.c147
-rw-r--r--ext/digest/bubblebabble/depend15
-rw-r--r--ext/digest/bubblebabble/extconf.rb6
-rw-r--r--ext/digest/defs.h18
-rw-r--r--ext/digest/depend17
-rw-r--r--ext/digest/digest.c883
-rw-r--r--ext/digest/digest.h58
-rw-r--r--ext/digest/digest.txt113
-rw-r--r--ext/digest/digest.txt.ja111
-rw-r--r--ext/digest/digest_conf.rb84
-rw-r--r--ext/digest/extconf.rb5
-rw-r--r--ext/digest/lib/digest.rb109
-rw-r--r--ext/digest/lib/md5.rb14
-rw-r--r--ext/digest/lib/sha1.rb14
-rw-r--r--ext/digest/md5/.cvsignore3
-rw-r--r--ext/digest/md5/MANIFEST8
-rw-r--r--ext/digest/md5/depend25
-rw-r--r--ext/digest/md5/extconf.rb19
-rw-r--r--ext/digest/md5/md5.c40
-rw-r--r--ext/digest/md5/md5.h13
-rw-r--r--ext/digest/md5/md5cc.h19
-rw-r--r--ext/digest/md5/md5init.c59
-rw-r--r--ext/digest/md5/md5ossl.c30
-rw-r--r--ext/digest/md5/md5ossl.h8
-rw-r--r--ext/digest/rmd160/.cvsignore3
-rw-r--r--ext/digest/rmd160/MANIFEST9
-rw-r--r--ext/digest/rmd160/depend27
-rw-r--r--ext/digest/rmd160/extconf.rb18
-rw-r--r--ext/digest/rmd160/rmd160.c25
-rw-r--r--ext/digest/rmd160/rmd160.h22
-rw-r--r--ext/digest/rmd160/rmd160hl.c96
-rw-r--r--ext/digest/rmd160/rmd160init.c60
-rw-r--r--ext/digest/rmd160/rmd160ossl.c45
-rw-r--r--ext/digest/rmd160/rmd160ossl.h6
-rw-r--r--ext/digest/sha1/.cvsignore3
-rw-r--r--ext/digest/sha1/MANIFEST9
-rw-r--r--ext/digest/sha1/depend27
-rw-r--r--ext/digest/sha1/extconf.rb18
-rw-r--r--ext/digest/sha1/sha1.c24
-rw-r--r--ext/digest/sha1/sha1.h25
-rw-r--r--ext/digest/sha1/sha1cc.h14
-rw-r--r--ext/digest/sha1/sha1hl.c102
-rw-r--r--ext/digest/sha1/sha1init.c64
-rw-r--r--ext/digest/sha1/sha1ossl.c45
-rw-r--r--ext/digest/sha1/sha1ossl.h10
-rw-r--r--ext/digest/sha2/.cvsignore3
-rw-r--r--ext/digest/sha2/MANIFEST7
-rw-r--r--ext/digest/sha2/depend26
-rw-r--r--ext/digest/sha2/extconf.rb29
-rw-r--r--ext/digest/sha2/lib/sha2.rb142
-rw-r--r--ext/digest/sha2/sha2.c318
-rw-r--r--ext/digest/sha2/sha2.h194
-rw-r--r--ext/digest/sha2/sha2cc.h31
-rw-r--r--ext/digest/sha2/sha2hl.c252
-rw-r--r--ext/digest/sha2/sha2init.c42
-rw-r--r--ext/digest/sha2/sha2ossl.h27
-rw-r--r--ext/digest/test.sh5
-rw-r--r--ext/dl/.cvsignore8
-rw-r--r--ext/dl/MANIFEST31
-rw-r--r--ext/dl/depend46
-rw-r--r--ext/dl/dl.c714
-rw-r--r--ext/dl/dl.def59
-rw-r--r--ext/dl/dl.h313
-rw-r--r--ext/dl/doc/dl.txt266
-rw-r--r--ext/dl/extconf.rb193
-rw-r--r--ext/dl/h2rb500
-rw-r--r--ext/dl/handle.c215
-rw-r--r--ext/dl/install.rb49
-rw-r--r--ext/dl/lib/dl/import.rb219
-rw-r--r--ext/dl/lib/dl/struct.rb146
-rw-r--r--ext/dl/lib/dl/types.rb179
-rw-r--r--ext/dl/lib/dl/win32.rb25
-rw-r--r--ext/dl/mkcall.rb62
-rw-r--r--ext/dl/mkcallback.rb53
-rw-r--r--ext/dl/mkcbtable.rb18
-rw-r--r--ext/dl/ptr.c1065
-rw-r--r--ext/dl/sample/c++sample.C35
-rw-r--r--ext/dl/sample/c++sample.rb60
-rw-r--r--ext/dl/sample/drives.rb70
-rw-r--r--ext/dl/sample/getch.rb5
-rw-r--r--ext/dl/sample/libc.rb69
-rw-r--r--ext/dl/sample/msgbox.rb19
-rw-r--r--ext/dl/sample/msgbox2.rb18
-rw-r--r--ext/dl/sample/stream.rb87
-rw-r--r--ext/dl/sym.c990
-rw-r--r--ext/dl/test/libtest.def28
-rw-r--r--ext/dl/test/test.c247
-rw-r--r--ext/dl/test/test.rb295
-rw-r--r--ext/dl/type.rb115
-rw-r--r--ext/enumerator/.cvsignore2
-rw-r--r--ext/enumerator/MANIFEST3
-rw-r--r--ext/enumerator/enumerator.c201
-rw-r--r--ext/enumerator/enumerator.txt102
-rw-r--r--ext/etc/.cvsignore3
-rw-r--r--ext/etc/MANIFEST6
-rw-r--r--ext/etc/depend24
-rw-r--r--ext/etc/etc.c1052
-rw-r--r--ext/etc/etc.gemspec45
-rw-r--r--ext/etc/etc.txt72
-rw-r--r--ext/etc/etc.txt.ja72
-rw-r--r--ext/etc/extconf.rb62
-rw-r--r--ext/etc/mkconstants.rb340
-rw-r--r--[-rwxr-xr-x]ext/extmk.rb777
-rw-r--r--ext/fcntl/.cvsignore3
-rw-r--r--ext/fcntl/MANIFEST3
-rw-r--r--ext/fcntl/depend15
-rw-r--r--ext/fcntl/extconf.rb3
-rw-r--r--ext/fcntl/fcntl.c149
-rw-r--r--ext/fcntl/fcntl.gemspec25
-rw-r--r--ext/fiber/depend3
-rw-r--r--ext/fiber/extconf.rb4
-rw-r--r--ext/fiber/fiber.c8
-rw-r--r--ext/fiddle/closure.c342
-rw-r--r--ext/fiddle/closure.h8
-rw-r--r--ext/fiddle/conversions.c141
-rw-r--r--ext/fiddle/conversions.h44
-rw-r--r--ext/fiddle/depend157
-rw-r--r--ext/fiddle/extconf.rb202
-rw-r--r--ext/fiddle/extlibs5
-rw-r--r--ext/fiddle/fiddle.c454
-rw-r--r--ext/fiddle/fiddle.gemspec23
-rw-r--r--ext/fiddle/fiddle.h138
-rw-r--r--ext/fiddle/function.c308
-rw-r--r--ext/fiddle/function.h8
-rw-r--r--ext/fiddle/handle.c477
-rw-r--r--ext/fiddle/lib/fiddle.rb56
-rw-r--r--ext/fiddle/lib/fiddle/closure.rb49
-rw-r--r--ext/fiddle/lib/fiddle/cparser.rb197
-rw-r--r--ext/fiddle/lib/fiddle/function.rb18
-rw-r--r--ext/fiddle/lib/fiddle/import.rb322
-rw-r--r--ext/fiddle/lib/fiddle/pack.rb136
-rw-r--r--ext/fiddle/lib/fiddle/struct.rb244
-rw-r--r--ext/fiddle/lib/fiddle/types.rb73
-rw-r--r--ext/fiddle/lib/fiddle/value.rb122
-rw-r--r--ext/fiddle/pointer.c720
-rwxr-xr-xext/fiddle/win32/fficonfig.h29
-rw-r--r--ext/fiddle/win32/libffi-3.2.1-mswin.patch191
-rwxr-xr-xext/fiddle/win32/libffi-config.rb48
-rwxr-xr-xext/fiddle/win32/libffi.mk.tmpl96
-rw-r--r--ext/gdbm/.cvsignore3
-rw-r--r--ext/gdbm/MANIFEST6
-rw-r--r--ext/gdbm/depend15
-rw-r--r--ext/gdbm/extconf.rb12
-rw-r--r--ext/gdbm/gdbm.c992
-rw-r--r--ext/gdbm/gdbm.gemspec21
-rw-r--r--ext/gdbm/testgdbm.rb663
-rw-r--r--ext/iconv/.cvsignore5
-rw-r--r--ext/iconv/MANIFEST5
-rw-r--r--ext/iconv/charset_alias.rb52
-rw-r--r--ext/iconv/depend2
-rw-r--r--ext/iconv/extconf.rb49
-rw-r--r--ext/iconv/iconv.c885
-rwxr-xr-xext/io/console/buildgem.sh5
-rw-r--r--ext/io/console/console.c1661
-rw-r--r--ext/io/console/depend39
-rw-r--r--ext/io/console/extconf.rb33
-rw-r--r--ext/io/console/io-console.gemspec27
-rw-r--r--ext/io/console/lib/console/size.rb23
-rw-r--r--ext/io/console/win32_vk.chksum1
-rw-r--r--ext/io/console/win32_vk.inc1391
-rw-r--r--ext/io/console/win32_vk.list166
-rw-r--r--ext/io/nonblock/depend18
-rw-r--r--ext/io/nonblock/extconf.rb9
-rw-r--r--ext/io/nonblock/nonblock.c140
-rw-r--r--ext/io/wait/.cvsignore2
-rw-r--r--ext/io/wait/MANIFEST4
-rw-r--r--ext/io/wait/depend18
-rw-r--r--ext/io/wait/extconf.rb11
-rw-r--r--ext/io/wait/lib/nonblock.rb23
-rw-r--r--ext/io/wait/wait.c261
-rw-r--r--ext/json/depend2
-rw-r--r--ext/json/extconf.rb2
-rw-r--r--ext/json/fbuffer/fbuffer.h187
-rw-r--r--ext/json/generator/depend24
-rw-r--r--ext/json/generator/extconf.rb4
-rw-r--r--ext/json/generator/generator.c1499
-rw-r--r--ext/json/generator/generator.h171
-rw-r--r--ext/json/json.gemspec133
-rw-r--r--ext/json/lib/json.rb63
-rw-r--r--ext/json/lib/json/add/bigdecimal.rb29
-rw-r--r--ext/json/lib/json/add/complex.rb29
-rw-r--r--ext/json/lib/json/add/core.rb12
-rw-r--r--ext/json/lib/json/add/date.rb34
-rw-r--r--ext/json/lib/json/add/date_time.rb50
-rw-r--r--ext/json/lib/json/add/exception.rb31
-rw-r--r--ext/json/lib/json/add/ostruct.rb31
-rw-r--r--ext/json/lib/json/add/range.rb29
-rw-r--r--ext/json/lib/json/add/rational.rb28
-rw-r--r--ext/json/lib/json/add/regexp.rb30
-rw-r--r--ext/json/lib/json/add/set.rb29
-rw-r--r--ext/json/lib/json/add/struct.rb30
-rw-r--r--ext/json/lib/json/add/symbol.rb25
-rw-r--r--ext/json/lib/json/add/time.rb38
-rw-r--r--ext/json/lib/json/common.rb456
-rw-r--r--ext/json/lib/json/ext.rb15
-rw-r--r--ext/json/lib/json/generic_object.rb71
-rw-r--r--ext/json/lib/json/version.rb9
-rw-r--r--ext/json/parser/depend23
-rw-r--r--ext/json/parser/extconf.rb6
-rw-r--r--ext/json/parser/parser.c2136
-rw-r--r--ext/json/parser/parser.h91
-rw-r--r--ext/json/parser/parser.rl896
-rw-r--r--ext/json/parser/prereq.mk11
-rw-r--r--ext/monitor/depend13
-rw-r--r--ext/monitor/extconf.rb2
-rw-r--r--ext/monitor/lib/monitor.rb284
-rw-r--r--ext/monitor/monitor.c221
-rw-r--r--ext/nkf/.cvsignore3
-rw-r--r--ext/nkf/MANIFEST7
-rw-r--r--ext/nkf/depend26
-rw-r--r--ext/nkf/extconf.rb1
-rw-r--r--ext/nkf/lib/kconv.rb288
-rw-r--r--ext/nkf/nkf-utf8/config.h51
-rw-r--r--ext/nkf/nkf-utf8/nkf.c7205
-rw-r--r--ext/nkf/nkf-utf8/nkf.h189
-rw-r--r--ext/nkf/nkf-utf8/utf8tbl.c14638
-rw-r--r--ext/nkf/nkf-utf8/utf8tbl.h72
-rw-r--r--ext/nkf/nkf.c613
-rw-r--r--ext/nkf/nkf1.7/nkf.c1900
-rw-r--r--ext/nkf/test.rb318
-rw-r--r--ext/objspace/depend73
-rw-r--r--ext/objspace/extconf.rb4
-rw-r--r--ext/objspace/object_tracing.c500
-rw-r--r--ext/objspace/objspace.c983
-rw-r--r--ext/objspace/objspace.h20
-rw-r--r--ext/objspace/objspace_dump.c517
-rw-r--r--ext/openssl/.cvsignore4
-rw-r--r--ext/openssl/History.md375
-rw-r--r--ext/openssl/MANIFEST62
-rw-r--r--ext/openssl/depend1185
-rw-r--r--ext/openssl/deprecation.rb27
-rw-r--r--ext/openssl/extconf.rb256
-rw-r--r--ext/openssl/lib/net/ftptls.rb43
-rw-r--r--ext/openssl/lib/net/https.rb188
-rw-r--r--ext/openssl/lib/net/protocols.rb56
-rw-r--r--ext/openssl/lib/net/telnets.rb250
-rw-r--r--ext/openssl/lib/openssl.rb14
-rw-r--r--ext/openssl/lib/openssl/bn.rb47
-rw-r--r--ext/openssl/lib/openssl/buffering.rb352
-rw-r--r--ext/openssl/lib/openssl/cipher.rb103
-rw-r--r--ext/openssl/lib/openssl/config.rb492
-rw-r--r--ext/openssl/lib/openssl/digest.rb101
-rw-r--r--ext/openssl/lib/openssl/pkcs5.rb22
-rw-r--r--ext/openssl/lib/openssl/pkey.rb25
-rw-r--r--ext/openssl/lib/openssl/ssl.rb437
-rw-r--r--ext/openssl/lib/openssl/x509.rb192
-rw-r--r--ext/openssl/openssl.gemspec27
-rw-r--r--ext/openssl/openssl_missing.c370
-rw-r--r--ext/openssl/openssl_missing.h242
-rw-r--r--ext/openssl/ossl.c1238
-rw-r--r--ext/openssl/ossl.h163
-rw-r--r--ext/openssl/ossl_asn1.c1597
-rw-r--r--ext/openssl/ossl_asn1.h22
-rw-r--r--ext/openssl/ossl_bio.c58
-rw-r--r--ext/openssl/ossl_bio.h9
-rw-r--r--ext/openssl/ossl_bn.c780
-rw-r--r--ext/openssl/ossl_bn.h13
-rw-r--r--ext/openssl/ossl_cipher.c913
-rw-r--r--ext/openssl/ossl_cipher.h7
-rw-r--r--ext/openssl/ossl_config.c444
-rw-r--r--ext/openssl/ossl_config.h5
-rw-r--r--ext/openssl/ossl_digest.c464
-rw-r--r--ext/openssl/ossl_digest.h7
-rw-r--r--ext/openssl/ossl_engine.c456
-rw-r--r--ext/openssl/ossl_engine.h3
-rw-r--r--ext/openssl/ossl_hmac.c337
-rw-r--r--ext/openssl/ossl_hmac.h3
-rw-r--r--ext/openssl/ossl_kdf.c319
-rw-r--r--ext/openssl/ossl_kdf.h6
-rw-r--r--ext/openssl/ossl_ns_spki.c279
-rw-r--r--ext/openssl/ossl_ns_spki.h4
-rw-r--r--ext/openssl/ossl_ocsp.c1655
-rw-r--r--ext/openssl/ossl_ocsp.h5
-rw-r--r--ext/openssl/ossl_pkcs12.c185
-rw-r--r--ext/openssl/ossl_pkcs12.h7
-rw-r--r--ext/openssl/ossl_pkcs7.c482
-rw-r--r--ext/openssl/ossl_pkcs7.h8
-rw-r--r--ext/openssl/ossl_pkey.c420
-rw-r--r--ext/openssl/ossl_pkey.h200
-rw-r--r--ext/openssl/ossl_pkey_dh.c459
-rw-r--r--ext/openssl/ossl_pkey_dsa.c477
-rw-r--r--ext/openssl/ossl_pkey_ec.c1798
-rw-r--r--ext/openssl/ossl_pkey_rsa.c809
-rw-r--r--ext/openssl/ossl_rand.c190
-rw-r--r--ext/openssl/ossl_rand.h4
-rw-r--r--ext/openssl/ossl_ssl.c2978
-rw-r--r--ext/openssl/ossl_ssl.h23
-rw-r--r--ext/openssl/ossl_ssl_session.c332
-rw-r--r--ext/openssl/ossl_version.h5
-rw-r--r--ext/openssl/ossl_x509.c186
-rw-r--r--ext/openssl/ossl_x509.h29
-rw-r--r--ext/openssl/ossl_x509attr.c224
-rw-r--r--ext/openssl/ossl_x509cert.c548
-rw-r--r--ext/openssl/ossl_x509crl.c277
-rw-r--r--ext/openssl/ossl_x509ext.c256
-rw-r--r--ext/openssl/ossl_x509name.c411
-rw-r--r--ext/openssl/ossl_x509req.c235
-rw-r--r--ext/openssl/ossl_x509revoked.c163
-rw-r--r--ext/openssl/ossl_x509store.c689
-rw-r--r--ext/openssl/ruby_missing.h18
-rw-r--r--ext/pathname/depend17
-rw-r--r--ext/pathname/extconf.rb4
-rw-r--r--ext/pathname/lib/pathname.rb593
-rw-r--r--ext/pathname/pathname.c1670
-rw-r--r--ext/psych/depend104
-rw-r--r--ext/psych/extconf.rb43
-rw-r--r--ext/psych/lib/psych.rb641
-rw-r--r--ext/psych/lib/psych/class_loader.rb102
-rw-r--r--ext/psych/lib/psych/coder.rb95
-rw-r--r--ext/psych/lib/psych/core_ext.rb19
-rw-r--r--ext/psych/lib/psych/exception.rb14
-rw-r--r--ext/psych/lib/psych/handler.rb255
-rw-r--r--ext/psych/lib/psych/handlers/document_stream.rb23
-rw-r--r--ext/psych/lib/psych/handlers/recorder.rb40
-rw-r--r--ext/psych/lib/psych/json/ruby_events.rb20
-rw-r--r--ext/psych/lib/psych/json/stream.rb17
-rw-r--r--ext/psych/lib/psych/json/tree_builder.rb13
-rw-r--r--ext/psych/lib/psych/json/yaml_events.rb30
-rw-r--r--ext/psych/lib/psych/nodes.rb78
-rw-r--r--ext/psych/lib/psych/nodes/alias.rb21
-rw-r--r--ext/psych/lib/psych/nodes/document.rb63
-rw-r--r--ext/psych/lib/psych/nodes/mapping.rb59
-rw-r--r--ext/psych/lib/psych/nodes/node.rb75
-rw-r--r--ext/psych/lib/psych/nodes/scalar.rb70
-rw-r--r--ext/psych/lib/psych/nodes/sequence.rb84
-rw-r--r--ext/psych/lib/psych/nodes/stream.rb40
-rw-r--r--ext/psych/lib/psych/omap.rb5
-rw-r--r--ext/psych/lib/psych/parser.rb52
-rw-r--r--ext/psych/lib/psych/scalar_scanner.rb136
-rw-r--r--ext/psych/lib/psych/set.rb5
-rw-r--r--ext/psych/lib/psych/stream.rb38
-rw-r--r--ext/psych/lib/psych/streaming.rb28
-rw-r--r--ext/psych/lib/psych/syntax_error.rb22
-rw-r--r--ext/psych/lib/psych/tree_builder.rb137
-rw-r--r--ext/psych/lib/psych/versions.rb10
-rw-r--r--ext/psych/lib/psych/visitors.rb7
-rw-r--r--ext/psych/lib/psych/visitors/depth_first.rb27
-rw-r--r--ext/psych/lib/psych/visitors/emitter.rb52
-rw-r--r--ext/psych/lib/psych/visitors/json_tree.rb25
-rw-r--r--ext/psych/lib/psych/visitors/to_ruby.rb421
-rw-r--r--ext/psych/lib/psych/visitors/visitor.rb20
-rw-r--r--ext/psych/lib/psych/visitors/yaml_tree.rb539
-rw-r--r--ext/psych/lib/psych/y.rb10
-rw-r--r--ext/psych/psych.c34
-rw-r--r--ext/psych/psych.gemspec70
-rw-r--r--ext/psych/psych.h17
-rw-r--r--ext/psych/psych_emitter.c555
-rw-r--r--ext/psych/psych_emitter.h8
-rw-r--r--ext/psych/psych_parser.c579
-rw-r--r--ext/psych/psych_parser.h6
-rw-r--r--ext/psych/psych_to_ruby.c39
-rw-r--r--ext/psych/psych_to_ruby.h8
-rw-r--r--ext/psych/psych_yaml_tree.c24
-rw-r--r--ext/psych/psych_yaml_tree.h8
-rw-r--r--ext/psych/yaml/api.c1395
-rw-r--r--ext/psych/yaml/config.h10
-rw-r--r--ext/psych/yaml/dumper.c394
-rw-r--r--ext/psych/yaml/emitter.c2324
-rw-r--r--ext/psych/yaml/loader.c444
-rw-r--r--ext/psych/yaml/parser.c1370
-rw-r--r--ext/psych/yaml/reader.c469
-rw-r--r--ext/psych/yaml/scanner.c3578
-rw-r--r--ext/psych/yaml/writer.c141
-rw-r--r--ext/psych/yaml/yaml.h1971
-rw-r--r--ext/psych/yaml/yaml_private.h688
-rw-r--r--ext/pty/.cvsignore3
-rw-r--r--ext/pty/MANIFEST12
-rw-r--r--ext/pty/README65
-rw-r--r--ext/pty/README.expect22
-rw-r--r--ext/pty/README.expect.ja21
-rw-r--r--ext/pty/README.ja89
-rw-r--r--ext/pty/depend21
-rw-r--r--ext/pty/expect_sample.rb55
-rw-r--r--ext/pty/extconf.rb10
-rw-r--r--ext/pty/lib/expect.rb45
-rw-r--r--ext/pty/pty.c897
-rw-r--r--ext/pty/script.rb37
-rw-r--r--ext/pty/shl.rb92
-rw-r--r--ext/racc/cparse/.cvsignore3
-rw-r--r--ext/racc/cparse/MANIFEST4
-rw-r--r--ext/racc/cparse/README11
-rw-r--r--ext/racc/cparse/cparse.c355
-rw-r--r--ext/racc/cparse/depend15
-rw-r--r--ext/racc/cparse/extconf.rb6
-rw-r--r--ext/rbconfig/sizeof/depend39
-rw-r--r--ext/rbconfig/sizeof/extconf.rb36
-rw-r--r--ext/readline/.cvsignore3
-rw-r--r--ext/readline/.gitignore1
-rw-r--r--ext/readline/MANIFEST6
-rw-r--r--ext/readline/README68
-rw-r--r--ext/readline/README.ja393
-rw-r--r--ext/readline/depend19
-rw-r--r--ext/readline/extconf.rb116
-rw-r--r--ext/readline/readline-ext.gemspec26
-rw-r--r--ext/readline/readline.c2132
-rw-r--r--ext/ripper/README30
-rw-r--r--ext/ripper/depend81
-rw-r--r--ext/ripper/eventids2.c305
-rw-r--r--ext/ripper/extconf.rb26
-rw-r--r--ext/ripper/lib/ripper.rb74
-rw-r--r--ext/ripper/lib/ripper/core.rb74
-rw-r--r--ext/ripper/lib/ripper/filter.rb86
-rw-r--r--ext/ripper/lib/ripper/lexer.rb303
-rw-r--r--ext/ripper/lib/ripper/sexp.rb158
-rw-r--r--ext/ripper/tools/dsl.rb85
-rw-r--r--ext/ripper/tools/generate-param-macros.rb15
-rw-r--r--ext/ripper/tools/generate.rb171
-rw-r--r--ext/ripper/tools/preproc.rb107
-rw-r--r--ext/ripper/tools/strip.rb12
-rw-r--r--ext/rubyvm/depend2
-rw-r--r--ext/rubyvm/extconf.rb1
-rw-r--r--ext/rubyvm/lib/forwardable/impl.rb16
-rw-r--r--ext/sdbm/.cvsignore3
-rw-r--r--ext/sdbm/MANIFEST7
-rw-r--r--ext/sdbm/_sdbm.c285
-rw-r--r--ext/sdbm/depend29
-rw-r--r--ext/sdbm/extconf.rb2
-rw-r--r--ext/sdbm/init.c827
-rw-r--r--ext/sdbm/sdbm.gemspec21
-rw-r--r--ext/sdbm/sdbm.h10
-rw-r--r--ext/sdbm/testsdbm.rb556
-rw-r--r--ext/socket/.cvsignore3
-rw-r--r--ext/socket/.document17
-rw-r--r--ext/socket/MANIFEST8
-rw-r--r--ext/socket/addrinfo.h49
-rw-r--r--ext/socket/ancdata.c1736
-rw-r--r--ext/socket/basicsocket.c757
-rw-r--r--ext/socket/constants.c144
-rw-r--r--ext/socket/depend347
-rw-r--r--ext/socket/extconf.rb851
-rw-r--r--ext/socket/getaddrinfo.c118
-rw-r--r--ext/socket/getnameinfo.c75
-rw-r--r--ext/socket/ifaddr.c477
-rw-r--r--ext/socket/init.c843
-rw-r--r--ext/socket/ipsocket.c388
-rw-r--r--ext/socket/lib/socket.rb1357
-rw-r--r--ext/socket/mkconstants.rb814
-rw-r--r--ext/socket/option.c1477
-rw-r--r--ext/socket/raddrinfo.c2748
-rw-r--r--ext/socket/rubysocket.h452
-rw-r--r--ext/socket/socket.c4148
-rw-r--r--ext/socket/sockport.h84
-rw-r--r--ext/socket/sockssocket.c74
-rw-r--r--ext/socket/tcpserver.c146
-rw-r--r--ext/socket/tcpsocket.c91
-rw-r--r--ext/socket/udpsocket.c247
-rw-r--r--ext/socket/unixserver.c128
-rw-r--r--ext/socket/unixsocket.c595
-rw-r--r--ext/stringio/.cvsignore3
-rw-r--r--ext/stringio/MANIFEST4
-rw-r--r--ext/stringio/README19
-rw-r--r--ext/stringio/README.md10
-rw-r--r--ext/stringio/depend20
-rw-r--r--ext/stringio/extconf.rb4
-rw-r--r--ext/stringio/stringio.c1741
-rw-r--r--ext/stringio/stringio.gemspec34
-rw-r--r--ext/strscan/.cvsignore3
-rw-r--r--ext/strscan/MANIFEST4
-rw-r--r--ext/strscan/depend19
-rw-r--r--ext/strscan/extconf.rb3
-rw-r--r--ext/strscan/strscan.c959
-rw-r--r--ext/strscan/strscan.gemspec20
-rw-r--r--ext/syck/.cvsignore3
-rw-r--r--ext/syck/MANIFEST16
-rw-r--r--ext/syck/bytecode.c1109
-rw-r--r--ext/syck/depend12
-rw-r--r--ext/syck/emitter.c444
-rw-r--r--ext/syck/extconf.rb5
-rw-r--r--ext/syck/gram.c1796
-rw-r--r--ext/syck/gram.h81
-rw-r--r--ext/syck/handler.c156
-rw-r--r--ext/syck/implicit.c2859
-rw-r--r--ext/syck/node.c337
-rw-r--r--ext/syck/rubyext.c1556
-rw-r--r--ext/syck/syck.c506
-rw-r--r--ext/syck/syck.h409
-rw-r--r--ext/syck/token.c2467
-rw-r--r--ext/syck/yaml2byte.c251
-rw-r--r--ext/syck/yamlbyte.h170
-rw-r--r--ext/syslog/.cvsignore3
-rw-r--r--ext/syslog/MANIFEST6
-rw-r--r--ext/syslog/depend16
-rw-r--r--ext/syslog/extconf.rb3
-rw-r--r--ext/syslog/lib/syslog/logger.rb209
-rw-r--r--ext/syslog/syslog.c394
-rw-r--r--ext/syslog/syslog.txt9
-rw-r--r--ext/syslog/test.rb164
-rw-r--r--ext/tcltklib/.cvsignore3
-rw-r--r--ext/tcltklib/MANIFEST22
-rw-r--r--ext/tcltklib/MANUAL.eng407
-rw-r--r--ext/tcltklib/MANUAL.euc520
-rw-r--r--ext/tcltklib/README.1st53
-rw-r--r--ext/tcltklib/README.ActiveTcl49
-rw-r--r--ext/tcltklib/README.euc159
-rw-r--r--ext/tcltklib/demo/lines0.tcl42
-rw-r--r--ext/tcltklib/demo/lines1.rb50
-rw-r--r--ext/tcltklib/demo/lines2.rb54
-rw-r--r--ext/tcltklib/demo/lines3.rb54
-rw-r--r--ext/tcltklib/demo/lines4.rb54
-rw-r--r--ext/tcltklib/demo/safeTk.rb22
-rw-r--r--ext/tcltklib/depend2
-rw-r--r--ext/tcltklib/extconf.rb234
-rw-r--r--ext/tcltklib/lib/tcltk.rb367
-rw-r--r--ext/tcltklib/sample/batsu.gifbin0 -> 538 bytes-rw-r--r--ext/tcltklib/sample/maru.gifbin0 -> 481 bytes-rw-r--r--ext/tcltklib/sample/sample0.rb39
-rw-r--r--ext/tcltklib/sample/sample1.rb634
-rw-r--r--ext/tcltklib/sample/sample2.rb449
-rw-r--r--ext/tcltklib/stubs.c97
-rw-r--r--ext/tcltklib/tcltklib.c5340
-rw-r--r--ext/tk/.cvsignore3
-rw-r--r--ext/tk/ChangeLog.tkextlib45
-rw-r--r--ext/tk/MANIFEST685
-rw-r--r--ext/tk/README.1st23
-rw-r--r--ext/tk/README.fork34
-rw-r--r--ext/tk/depend1
-rw-r--r--ext/tk/extconf.rb3
-rw-r--r--ext/tk/lib/README30
-rw-r--r--ext/tk/lib/multi-tk.rb1665
-rw-r--r--ext/tk/lib/remote-tk.rb424
-rw-r--r--ext/tk/lib/tk.rb3807
-rw-r--r--ext/tk/lib/tk/after.rb6
-rw-r--r--ext/tk/lib/tk/autoload.rb190
-rw-r--r--ext/tk/lib/tk/bgerror.rb29
-rw-r--r--ext/tk/lib/tk/bindtag.rb79
-rw-r--r--ext/tk/lib/tk/button.rb27
-rw-r--r--ext/tk/lib/tk/canvas.rb703
-rw-r--r--ext/tk/lib/tk/canvastag.rb351
-rw-r--r--ext/tk/lib/tk/checkbutton.rb25
-rw-r--r--ext/tk/lib/tk/clipboard.rb75
-rw-r--r--ext/tk/lib/tk/clock.rb57
-rw-r--r--ext/tk/lib/tk/composite.rb293
-rw-r--r--ext/tk/lib/tk/console.rb29
-rw-r--r--ext/tk/lib/tk/dialog.rb293
-rw-r--r--ext/tk/lib/tk/encodedstr.rb107
-rw-r--r--ext/tk/lib/tk/entry.rb110
-rw-r--r--ext/tk/lib/tk/event.rb180
-rw-r--r--ext/tk/lib/tk/font.rb1464
-rw-r--r--ext/tk/lib/tk/frame.rb123
-rw-r--r--ext/tk/lib/tk/grid.rb210
-rw-r--r--ext/tk/lib/tk/image.rb186
-rw-r--r--ext/tk/lib/tk/itemconfig.rb788
-rw-r--r--ext/tk/lib/tk/itemfont.rb297
-rw-r--r--ext/tk/lib/tk/kinput.rb71
-rw-r--r--ext/tk/lib/tk/label.rb22
-rw-r--r--ext/tk/lib/tk/labelframe.rb20
-rw-r--r--ext/tk/lib/tk/listbox.rb253
-rw-r--r--ext/tk/lib/tk/macpkg.rb68
-rw-r--r--ext/tk/lib/tk/menu.rb488
-rw-r--r--ext/tk/lib/tk/menubar.rb131
-rw-r--r--ext/tk/lib/tk/menuspec.rb265
-rw-r--r--ext/tk/lib/tk/message.rb19
-rw-r--r--ext/tk/lib/tk/mngfocus.rb33
-rw-r--r--ext/tk/lib/tk/msgcat.rb272
-rw-r--r--ext/tk/lib/tk/namespace.rb294
-rw-r--r--ext/tk/lib/tk/optiondb.rb299
-rw-r--r--ext/tk/lib/tk/optionobj.rb212
-rw-r--r--ext/tk/lib/tk/pack.rb89
-rw-r--r--ext/tk/lib/tk/package.rb139
-rw-r--r--ext/tk/lib/tk/palette.rb54
-rw-r--r--ext/tk/lib/tk/panedwindow.rb204
-rw-r--r--ext/tk/lib/tk/place.rb127
-rw-r--r--ext/tk/lib/tk/radiobutton.rb32
-rw-r--r--ext/tk/lib/tk/root.rb86
-rw-r--r--ext/tk/lib/tk/scale.rb81
-rw-r--r--ext/tk/lib/tk/scrollable.rb70
-rw-r--r--ext/tk/lib/tk/scrollbar.rb115
-rw-r--r--ext/tk/lib/tk/scrollbox.rb36
-rw-r--r--ext/tk/lib/tk/selection.rb86
-rw-r--r--ext/tk/lib/tk/spinbox.rb39
-rw-r--r--ext/tk/lib/tk/tagfont.rb43
-rw-r--r--ext/tk/lib/tk/text.rb1251
-rw-r--r--ext/tk/lib/tk/textimage.rb72
-rw-r--r--ext/tk/lib/tk/textmark.rb135
-rw-r--r--ext/tk/lib/tk/texttag.rb253
-rw-r--r--ext/tk/lib/tk/textwindow.rb137
-rw-r--r--ext/tk/lib/tk/timer.rb456
-rw-r--r--ext/tk/lib/tk/toplevel.rb232
-rw-r--r--ext/tk/lib/tk/txtwin_abst.rb39
-rw-r--r--ext/tk/lib/tk/validation.rb353
-rw-r--r--ext/tk/lib/tk/variable.rb1008
-rw-r--r--ext/tk/lib/tk/virtevent.rb90
-rw-r--r--ext/tk/lib/tk/winfo.rb387
-rw-r--r--ext/tk/lib/tk/winpkg.rb136
-rw-r--r--ext/tk/lib/tk/wm.rb250
-rw-r--r--ext/tk/lib/tk/xim.rb122
-rw-r--r--ext/tk/lib/tkafter.rb4
-rw-r--r--ext/tk/lib/tkbgerror.rb4
-rw-r--r--ext/tk/lib/tkcanvas.rb4
-rw-r--r--ext/tk/lib/tkclass.rb47
-rw-r--r--ext/tk/lib/tkconsole.rb4
-rw-r--r--ext/tk/lib/tkdialog.rb4
-rw-r--r--ext/tk/lib/tkentry.rb4
-rw-r--r--ext/tk/lib/tkextlib/ICONS.rb13
-rw-r--r--ext/tk/lib/tkextlib/ICONS/icons.rb108
-rw-r--r--ext/tk/lib/tkextlib/ICONS/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/SUPPORT_STATUS162
-rw-r--r--ext/tk/lib/tkextlib/bwidget.rb146
-rw-r--r--ext/tk/lib/tkextlib/bwidget/arrowbutton.rb21
-rw-r--r--ext/tk/lib/tkextlib/bwidget/bitmap.rb21
-rw-r--r--ext/tk/lib/tkextlib/bwidget/button.rb21
-rw-r--r--ext/tk/lib/tkextlib/bwidget/buttonbox.rb73
-rw-r--r--ext/tk/lib/tkextlib/bwidget/combobox.rb45
-rw-r--r--ext/tk/lib/tkextlib/bwidget/dialog.rb147
-rw-r--r--ext/tk/lib/tkextlib/bwidget/dragsite.rb31
-rw-r--r--ext/tk/lib/tkextlib/bwidget/dropsite.rb39
-rw-r--r--ext/tk/lib/tkextlib/bwidget/dynamichelp.rb51
-rw-r--r--ext/tk/lib/tkextlib/bwidget/entry.rb28
-rw-r--r--ext/tk/lib/tkextlib/bwidget/label.rb26
-rw-r--r--ext/tk/lib/tkextlib/bwidget/labelentry.rb45
-rw-r--r--ext/tk/lib/tkextlib/bwidget/labelframe.rb30
-rw-r--r--ext/tk/lib/tkextlib/bwidget/listbox.rb290
-rw-r--r--ext/tk/lib/tkextlib/bwidget/mainframe.rb73
-rw-r--r--ext/tk/lib/tkextlib/bwidget/messagedlg.rb167
-rw-r--r--ext/tk/lib/tkextlib/bwidget/notebook.rb116
-rw-r--r--ext/tk/lib/tkextlib/bwidget/pagesmanager.rb61
-rw-r--r--ext/tk/lib/tkextlib/bwidget/panedwindow.rb31
-rw-r--r--ext/tk/lib/tkextlib/bwidget/passwddlg.rb27
-rw-r--r--ext/tk/lib/tkextlib/bwidget/progressbar.rb20
-rw-r--r--ext/tk/lib/tkextlib/bwidget/progressdlg.rb54
-rw-r--r--ext/tk/lib/tkextlib/bwidget/scrollableframe.rb34
-rw-r--r--ext/tk/lib/tkextlib/bwidget/scrolledwindow.rb32
-rw-r--r--ext/tk/lib/tkextlib/bwidget/scrollview.rb20
-rw-r--r--ext/tk/lib/tkextlib/bwidget/selectcolor.rb45
-rw-r--r--ext/tk/lib/tkextlib/bwidget/selectfont.rb79
-rw-r--r--ext/tk/lib/tkextlib/bwidget/separator.rb20
-rw-r--r--ext/tk/lib/tkextlib/bwidget/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/bwidget/spinbox.rb58
-rw-r--r--ext/tk/lib/tkextlib/bwidget/titleframe.rb27
-rw-r--r--ext/tk/lib/tkextlib/bwidget/tree.rb374
-rw-r--r--ext/tk/lib/tkextlib/bwidget/widget.rb113
-rw-r--r--ext/tk/lib/tkextlib/itcl.rb13
-rw-r--r--ext/tk/lib/tkextlib/itcl/incr_tcl.rb167
-rw-r--r--ext/tk/lib/tkextlib/itcl/setup.rb13
-rw-r--r--ext/tk/lib/tkextlib/itk.rb13
-rw-r--r--ext/tk/lib/tkextlib/itk/incr_tk.rb381
-rw-r--r--ext/tk/lib/tkextlib/itk/setup.rb13
-rw-r--r--ext/tk/lib/tkextlib/iwidgets.rb89
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/buttonbox.rb114
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/calendar.rb88
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/canvasprintbox.rb43
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/canvasprintdialog.rb38
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/checkbox.rb111
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/combobox.rb99
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/dateentry.rb20
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/datefield.rb43
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/dialog.rb20
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/dialogshell.rb114
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/disjointlistbox.rb45
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/entryfield.rb161
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/extbutton.rb30
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/extfileselectionbox.rb33
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/extfileselectiondialog.rb33
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/feedback.rb30
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/fileselectionbox.rb33
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/fileselectiondialog.rb33
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/finddialog.rb29
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/hierarchy.rb294
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/hyperhelp.rb40
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/labeledframe.rb24
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/labeledwidget.rb30
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/mainwindow.rb52
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/menubar.rb190
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/messagebox.rb81
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/messagedialog.rb20
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/notebook.rb163
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/optionmenu.rb87
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/panedwindow.rb127
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/promptdialog.rb131
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/pushbutton.rb30
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/radiobox.rb111
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/scopedobject.rb24
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/scrolledcanvas.rb315
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/scrolledframe.rb59
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/scrolledhtml.rb43
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/scrolledlistbox.rb190
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/scrolledtext.rb518
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/scrolledwidget.rb20
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/selectionbox.rb92
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/selectiondialog.rb92
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/shell.rb38
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/spindate.rb38
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/spinint.rb20
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/spinner.rb150
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/spintime.rb38
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/tabnotebook.rb154
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/tabset.rb89
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/timeentry.rb20
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/timefield.rb43
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/toolbar.rb87
-rw-r--r--ext/tk/lib/tkextlib/iwidgets/watch.rb45
-rwxr-xr-xext/tk/lib/tkextlib/pkg_checker.rb129
-rw-r--r--ext/tk/lib/tkextlib/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/tcllib.rb66
-rw-r--r--ext/tk/lib/tkextlib/tcllib/README135
-rw-r--r--ext/tk/lib/tkextlib/tcllib/autoscroll.rb142
-rw-r--r--ext/tk/lib/tkextlib/tcllib/ctext.rb143
-rw-r--r--ext/tk/lib/tkextlib/tcllib/cursor.rb89
-rw-r--r--ext/tk/lib/tkextlib/tcllib/datefield.rb52
-rw-r--r--ext/tk/lib/tkextlib/tcllib/ip_entry.rb55
-rw-r--r--ext/tk/lib/tkextlib/tcllib/plotchart.rb707
-rw-r--r--ext/tk/lib/tkextlib/tcllib/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/tcllib/style.rb53
-rw-r--r--ext/tk/lib/tkextlib/tcllib/tkpiechart.rb287
-rw-r--r--ext/tk/lib/tkextlib/tile.rb69
-rw-r--r--ext/tk/lib/tkextlib/tile/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/tile/style.rb69
-rw-r--r--ext/tk/lib/tkextlib/tile/tbutton.rb30
-rw-r--r--ext/tk/lib/tkextlib/tile/tcheckbutton.rb31
-rw-r--r--ext/tk/lib/tkextlib/tile/tlabel.rb30
-rw-r--r--ext/tk/lib/tkextlib/tile/tmenubutton.rb30
-rw-r--r--ext/tk/lib/tkextlib/tile/tnotebook.rb92
-rw-r--r--ext/tk/lib/tkextlib/tile/tradiobutton.rb31
-rw-r--r--ext/tk/lib/tkextlib/tkDND.rb18
-rw-r--r--ext/tk/lib/tkextlib/tkDND/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/tkDND/shape.rb116
-rw-r--r--ext/tk/lib/tkextlib/tkDND/tkdnd.rb124
-rw-r--r--ext/tk/lib/tkextlib/tkHTML.rb13
-rw-r--r--ext/tk/lib/tkextlib/tkHTML/htmlwidget.rb433
-rw-r--r--ext/tk/lib/tkextlib/tkHTML/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/tkimg.rb31
-rw-r--r--ext/tk/lib/tkextlib/tkimg/README26
-rw-r--r--ext/tk/lib/tkextlib/tkimg/bmp.rb28
-rw-r--r--ext/tk/lib/tkextlib/tkimg/gif.rb28
-rw-r--r--ext/tk/lib/tkextlib/tkimg/ico.rb28
-rw-r--r--ext/tk/lib/tkextlib/tkimg/jpeg.rb28
-rw-r--r--ext/tk/lib/tkextlib/tkimg/pcx.rb28
-rw-r--r--ext/tk/lib/tkextlib/tkimg/pixmap.rb39
-rw-r--r--ext/tk/lib/tkextlib/tkimg/png.rb28
-rw-r--r--ext/tk/lib/tkextlib/tkimg/ppm.rb28
-rw-r--r--ext/tk/lib/tkextlib/tkimg/ps.rb28
-rw-r--r--ext/tk/lib/tkextlib/tkimg/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/tkimg/sgi.rb28
-rw-r--r--ext/tk/lib/tkextlib/tkimg/sun.rb28
-rw-r--r--ext/tk/lib/tkextlib/tkimg/tga.rb28
-rw-r--r--ext/tk/lib/tkextlib/tkimg/tiff.rb28
-rw-r--r--ext/tk/lib/tkextlib/tkimg/window.rb28
-rw-r--r--ext/tk/lib/tkextlib/tkimg/xbm.rb28
-rw-r--r--ext/tk/lib/tkextlib/tkimg/xpm.rb28
-rw-r--r--ext/tk/lib/tkextlib/tktable.rb14
-rw-r--r--ext/tk/lib/tkextlib/tktable/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/tktable/tktable.rb796
-rw-r--r--ext/tk/lib/tkextlib/tktrans.rb14
-rw-r--r--ext/tk/lib/tkextlib/tktrans/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/tktrans/tktrans.rb59
-rw-r--r--ext/tk/lib/tkextlib/treectrl.rb13
-rw-r--r--ext/tk/lib/tkextlib/treectrl/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/treectrl/tktreectrl.rb903
-rw-r--r--ext/tk/lib/tkextlib/vu.rb43
-rw-r--r--ext/tk/lib/tkextlib/vu/bargraph.rb51
-rw-r--r--ext/tk/lib/tkextlib/vu/charts.rb47
-rw-r--r--ext/tk/lib/tkextlib/vu/dial.rb102
-rw-r--r--ext/tk/lib/tkextlib/vu/pie.rb235
-rw-r--r--ext/tk/lib/tkextlib/vu/setup.rb8
-rw-r--r--ext/tk/lib/tkextlib/vu/spinbox.rb22
-rw-r--r--ext/tk/lib/tkfont.rb4
-rw-r--r--ext/tk/lib/tkmacpkg.rb4
-rw-r--r--ext/tk/lib/tkmenubar.rb4
-rw-r--r--ext/tk/lib/tkmngfocus.rb4
-rw-r--r--ext/tk/lib/tkpalette.rb4
-rw-r--r--ext/tk/lib/tkscrollbox.rb4
-rw-r--r--ext/tk/lib/tktext.rb4
-rw-r--r--ext/tk/lib/tkvirtevent.rb4
-rw-r--r--ext/tk/lib/tkwinpkg.rb4
-rw-r--r--ext/tk/sample/binding_sample.rb87
-rw-r--r--ext/tk/sample/bindtag_sample.rb127
-rw-r--r--ext/tk/sample/binstr_usage.rb39
-rw-r--r--ext/tk/sample/btn_with_frame.rb20
-rw-r--r--ext/tk/sample/demos-en/ChangeLog64
-rw-r--r--ext/tk/sample/demos-en/ChangeLog.prev9
-rw-r--r--ext/tk/sample/demos-en/README138
-rw-r--r--ext/tk/sample/demos-en/README.1st18
-rw-r--r--ext/tk/sample/demos-en/README.tkencoding29
-rw-r--r--ext/tk/sample/demos-en/arrow.rb239
-rw-r--r--ext/tk/sample/demos-en/bind.rb110
-rw-r--r--ext/tk/sample/demos-en/bitmap.rb73
-rw-r--r--ext/tk/sample/demos-en/browse163
-rw-r--r--ext/tk/sample/demos-en/browse282
-rw-r--r--ext/tk/sample/demos-en/button.rb84
-rw-r--r--ext/tk/sample/demos-en/check.rb70
-rw-r--r--ext/tk/sample/demos-en/check2.rb107
-rw-r--r--ext/tk/sample/demos-en/clrpick.rb77
-rw-r--r--ext/tk/sample/demos-en/colors.rb148
-rw-r--r--ext/tk/sample/demos-en/cscroll.rb134
-rw-r--r--ext/tk/sample/demos-en/ctext.rb186
-rw-r--r--ext/tk/sample/demos-en/dialog1.rb38
-rw-r--r--ext/tk/sample/demos-en/dialog2.rb41
-rw-r--r--ext/tk/sample/demos-en/doc.org/README7
-rw-r--r--ext/tk/sample/demos-en/doc.org/README.JP14
-rw-r--r--ext/tk/sample/demos-en/doc.org/README.tk8046
-rw-r--r--ext/tk/sample/demos-en/doc.org/license.terms39
-rw-r--r--ext/tk/sample/demos-en/doc.org/license.terms.tk8039
-rw-r--r--ext/tk/sample/demos-en/entry1.rb56
-rw-r--r--ext/tk/sample/demos-en/entry2.rb91
-rw-r--r--ext/tk/sample/demos-en/entry3.rb200
-rw-r--r--ext/tk/sample/demos-en/filebox.rb97
-rw-r--r--ext/tk/sample/demos-en/floor.rb1721
-rw-r--r--ext/tk/sample/demos-en/floor2.rb1720
-rw-r--r--ext/tk/sample/demos-en/form.rb62
-rw-r--r--ext/tk/sample/demos-en/hello14
-rw-r--r--ext/tk/sample/demos-en/hscale.rb74
-rw-r--r--ext/tk/sample/demos-en/icon.rb99
-rw-r--r--ext/tk/sample/demos-en/image1.rb60
-rw-r--r--ext/tk/sample/demos-en/image2.rb105
-rw-r--r--ext/tk/sample/demos-en/image3.rb121
-rw-r--r--ext/tk/sample/demos-en/items.rb374
-rw-r--r--ext/tk/sample/demos-en/ixset333
-rw-r--r--ext/tk/sample/demos-en/ixset2367
-rw-r--r--ext/tk/sample/demos-en/label.rb69
-rw-r--r--ext/tk/sample/demos-en/labelframe.rb93
-rw-r--r--ext/tk/sample/demos-en/menu.rb186
-rw-r--r--ext/tk/sample/demos-en/menu84.rb213
-rw-r--r--ext/tk/sample/demos-en/menubu.rb235
-rw-r--r--ext/tk/sample/demos-en/msgbox.rb88
-rw-r--r--ext/tk/sample/demos-en/paned1.rb45
-rw-r--r--ext/tk/sample/demos-en/paned2.rb92
-rw-r--r--ext/tk/sample/demos-en/patch_1.1c193
-rw-r--r--ext/tk/sample/demos-en/plot.rb122
-rw-r--r--ext/tk/sample/demos-en/puzzle.rb120
-rw-r--r--ext/tk/sample/demos-en/radio.rb84
-rw-r--r--ext/tk/sample/demos-en/radio2.rb106
-rw-r--r--ext/tk/sample/demos-en/radio3.rb114
-rw-r--r--ext/tk/sample/demos-en/rmt268
-rw-r--r--ext/tk/sample/demos-en/rolodex320
-rw-r--r--ext/tk/sample/demos-en/rolodex-j323
-rw-r--r--ext/tk/sample/demos-en/ruler.rb203
-rw-r--r--ext/tk/sample/demos-en/sayings.rb104
-rw-r--r--ext/tk/sample/demos-en/search.rb180
-rw-r--r--ext/tk/sample/demos-en/spin.rb63
-rw-r--r--ext/tk/sample/demos-en/square81
-rw-r--r--ext/tk/sample/demos-en/states.rb78
-rw-r--r--ext/tk/sample/demos-en/style.rb211
-rw-r--r--ext/tk/sample/demos-en/tcolor521
-rw-r--r--ext/tk/sample/demos-en/tcolor.bak513
-rw-r--r--ext/tk/sample/demos-en/text.rb126
-rw-r--r--ext/tk/sample/demos-en/timer136
-rw-r--r--ext/tk/sample/demos-en/tkencoding.rb42
-rw-r--r--ext/tk/sample/demos-en/twind.rb285
-rw-r--r--ext/tk/sample/demos-en/twind2.rb382
-rw-r--r--ext/tk/sample/demos-en/unicodeout.rb112
-rw-r--r--ext/tk/sample/demos-en/vscale.rb78
-rw-r--r--ext/tk/sample/demos-en/widget822
-rw-r--r--ext/tk/sample/demos-jp/README54
-rw-r--r--ext/tk/sample/demos-jp/README.1st20
-rw-r--r--ext/tk/sample/demos-jp/arrow.rb236
-rw-r--r--ext/tk/sample/demos-jp/bind.rb107
-rw-r--r--ext/tk/sample/demos-jp/bitmap.rb71
-rw-r--r--ext/tk/sample/demos-jp/browse163
-rw-r--r--ext/tk/sample/demos-jp/browse282
-rw-r--r--ext/tk/sample/demos-jp/button.rb81
-rw-r--r--ext/tk/sample/demos-jp/check.rb67
-rw-r--r--ext/tk/sample/demos-jp/check2.rb107
-rw-r--r--ext/tk/sample/demos-jp/clrpick.rb75
-rw-r--r--ext/tk/sample/demos-jp/colors.rb144
-rw-r--r--ext/tk/sample/demos-jp/cscroll.rb131
-rw-r--r--ext/tk/sample/demos-jp/ctext.rb182
-rw-r--r--ext/tk/sample/demos-jp/dialog1.rb38
-rw-r--r--ext/tk/sample/demos-jp/dialog2.rb42
-rw-r--r--ext/tk/sample/demos-jp/doc.org/README7
-rw-r--r--ext/tk/sample/demos-jp/doc.org/README.JP14
-rw-r--r--ext/tk/sample/demos-jp/doc.org/README.tk8046
-rw-r--r--ext/tk/sample/demos-jp/doc.org/license.terms39
-rw-r--r--ext/tk/sample/demos-jp/doc.org/license.terms.tk8039
-rw-r--r--ext/tk/sample/demos-jp/entry1.rb57
-rw-r--r--ext/tk/sample/demos-jp/entry2.rb88
-rw-r--r--ext/tk/sample/demos-jp/entry3.rb204
-rw-r--r--ext/tk/sample/demos-jp/filebox.rb96
-rw-r--r--ext/tk/sample/demos-jp/floor.rb1718
-rw-r--r--ext/tk/sample/demos-jp/floor2.rb1716
-rw-r--r--ext/tk/sample/demos-jp/form.rb63
-rw-r--r--ext/tk/sample/demos-jp/hello9
-rw-r--r--ext/tk/sample/demos-jp/hscale.rb77
-rw-r--r--ext/tk/sample/demos-jp/icon.rb96
-rw-r--r--ext/tk/sample/demos-jp/image1.rb58
-rw-r--r--ext/tk/sample/demos-jp/image2.rb102
-rw-r--r--ext/tk/sample/demos-jp/image3.rb122
-rw-r--r--ext/tk/sample/demos-jp/items.rb371
-rw-r--r--ext/tk/sample/demos-jp/ixset333
-rw-r--r--ext/tk/sample/demos-jp/ixset2368
-rw-r--r--ext/tk/sample/demos-jp/label.rb65
-rw-r--r--ext/tk/sample/demos-jp/labelframe.rb98
-rw-r--r--ext/tk/sample/demos-jp/menu.rb188
-rw-r--r--ext/tk/sample/demos-jp/menu84.rb210
-rw-r--r--ext/tk/sample/demos-jp/menu8x.rb222
-rw-r--r--ext/tk/sample/demos-jp/menubu.rb235
-rw-r--r--ext/tk/sample/demos-jp/msgbox.rb86
-rw-r--r--ext/tk/sample/demos-jp/paned1.rb48
-rw-r--r--ext/tk/sample/demos-jp/paned2.rb96
-rw-r--r--ext/tk/sample/demos-jp/plot.rb119
-rw-r--r--ext/tk/sample/demos-jp/puzzle.rb116
-rw-r--r--ext/tk/sample/demos-jp/radio.rb81
-rw-r--r--ext/tk/sample/demos-jp/radio2.rb107
-rw-r--r--ext/tk/sample/demos-jp/radio3.rb114
-rw-r--r--ext/tk/sample/demos-jp/rmt268
-rw-r--r--ext/tk/sample/demos-jp/rolodex320
-rw-r--r--ext/tk/sample/demos-jp/rolodex-j299
-rw-r--r--ext/tk/sample/demos-jp/ruler.rb200
-rw-r--r--ext/tk/sample/demos-jp/sayings.rb100
-rw-r--r--ext/tk/sample/demos-jp/search.rb176
-rw-r--r--ext/tk/sample/demos-jp/spin.rb67
-rw-r--r--ext/tk/sample/demos-jp/square81
-rw-r--r--ext/tk/sample/demos-jp/states.rb71
-rw-r--r--ext/tk/sample/demos-jp/style.rb248
-rw-r--r--ext/tk/sample/demos-jp/tcolor528
-rw-r--r--ext/tk/sample/demos-jp/text.rb117
-rw-r--r--ext/tk/sample/demos-jp/timer136
-rw-r--r--ext/tk/sample/demos-jp/twind.rb285
-rw-r--r--ext/tk/sample/demos-jp/twind2.rb381
-rw-r--r--ext/tk/sample/demos-jp/unicodeout.rb115
-rw-r--r--ext/tk/sample/demos-jp/vscale.rb78
-rw-r--r--ext/tk/sample/demos-jp/widget848
-rw-r--r--ext/tk/sample/encstr_usage.rb29
-rw-r--r--ext/tk/sample/images/earth.gifbin0 -> 51712 bytes-rw-r--r--ext/tk/sample/images/earthris.gifbin0 -> 6343 bytes-rw-r--r--ext/tk/sample/images/face.xbm173
-rw-r--r--ext/tk/sample/images/flagdown.xbm27
-rw-r--r--ext/tk/sample/images/flagup.xbm27
-rw-r--r--ext/tk/sample/images/gray25.xbm6
-rw-r--r--ext/tk/sample/images/grey.256
-rw-r--r--ext/tk/sample/images/grey.56
-rw-r--r--ext/tk/sample/images/letters.xbm27
-rw-r--r--ext/tk/sample/images/noletter.xbm27
-rw-r--r--ext/tk/sample/images/pattern.xbm6
-rw-r--r--ext/tk/sample/images/tcllogo.gifbin0 -> 2341 bytes-rw-r--r--ext/tk/sample/images/teapot.ppm56
-rw-r--r--ext/tk/sample/iso2022-kr.txt2
-rw-r--r--ext/tk/sample/menubar1.rb51
-rw-r--r--ext/tk/sample/menubar2.rb56
-rw-r--r--ext/tk/sample/msgs_rb/README3
-rw-r--r--ext/tk/sample/msgs_rb/cs.msg84
-rw-r--r--ext/tk/sample/msgs_rb/de.msg88
-rw-r--r--ext/tk/sample/msgs_rb/el.msg98
-rw-r--r--ext/tk/sample/msgs_rb/en.msg83
-rw-r--r--ext/tk/sample/msgs_rb/en_gb.msg7
-rw-r--r--ext/tk/sample/msgs_rb/eo.msg87
-rw-r--r--ext/tk/sample/msgs_rb/es.msg84
-rw-r--r--ext/tk/sample/msgs_rb/fr.msg84
-rw-r--r--ext/tk/sample/msgs_rb/it.msg84
-rw-r--r--ext/tk/sample/msgs_rb/ja.msg13
-rw-r--r--ext/tk/sample/msgs_rb/nl.msg123
-rw-r--r--ext/tk/sample/msgs_rb/pl.msg87
-rw-r--r--ext/tk/sample/msgs_rb/ru.msg87
-rw-r--r--ext/tk/sample/msgs_rb2/README5
-rw-r--r--ext/tk/sample/msgs_rb2/de.msg88
-rw-r--r--ext/tk/sample/msgs_rb2/ja.msg85
-rw-r--r--ext/tk/sample/msgs_tk/README4
-rw-r--r--ext/tk/sample/msgs_tk/cs.msg84
-rw-r--r--ext/tk/sample/msgs_tk/de.msg88
-rw-r--r--ext/tk/sample/msgs_tk/el.msg103
-rw-r--r--ext/tk/sample/msgs_tk/en.msg83
-rw-r--r--ext/tk/sample/msgs_tk/en_gb.msg7
-rw-r--r--ext/tk/sample/msgs_tk/eo.msg87
-rw-r--r--ext/tk/sample/msgs_tk/es.msg84
-rw-r--r--ext/tk/sample/msgs_tk/fr.msg84
-rw-r--r--ext/tk/sample/msgs_tk/it.msg84
-rw-r--r--ext/tk/sample/msgs_tk/ja.msg13
-rw-r--r--ext/tk/sample/msgs_tk/license.terms39
-rw-r--r--ext/tk/sample/msgs_tk/nl.msg123
-rw-r--r--ext/tk/sample/msgs_tk/pl.msg87
-rw-r--r--ext/tk/sample/msgs_tk/ru.msg87
-rw-r--r--ext/tk/sample/optobj_sample.rb67
-rw-r--r--ext/tk/sample/propagate.rb30
-rw-r--r--ext/tk/sample/remote-ip_sample.rb33
-rw-r--r--ext/tk/sample/remote-ip_sample2.rb53
-rw-r--r--ext/tk/sample/resource.en13
-rw-r--r--ext/tk/sample/resource.ja13
-rw-r--r--ext/tk/sample/safe-tk.rb102
-rw-r--r--ext/tk/sample/tkalignbox.rb225
-rw-r--r--ext/tk/sample/tkballoonhelp.rb99
-rw-r--r--ext/tk/sample/tkbiff.rb155
-rw-r--r--ext/tk/sample/tkbrowse.rb79
-rw-r--r--ext/tk/sample/tkcombobox.rb426
-rw-r--r--ext/tk/sample/tkdialog.rb61
-rw-r--r--ext/tk/sample/tkextlib/ICONS/LICENSE.orig61
-rw-r--r--ext/tk/sample/tkextlib/ICONS/tkIcons195
-rw-r--r--ext/tk/sample/tkextlib/ICONS/tkIcons-sample.kde658
-rw-r--r--ext/tk/sample/tkextlib/ICONS/tkIcons.kde195
-rw-r--r--ext/tk/sample/tkextlib/ICONS/viewIcons.rb329
-rw-r--r--ext/tk/sample/tkextlib/bwidget/LICENSE.orig53
-rw-r--r--ext/tk/sample/tkextlib/bwidget/basic.rb198
-rw-r--r--ext/tk/sample/tkextlib/bwidget/bwidget.xbm46
-rw-r--r--ext/tk/sample/tkextlib/bwidget/demo.rb243
-rw-r--r--ext/tk/sample/tkextlib/bwidget/dnd.rb46
-rw-r--r--ext/tk/sample/tkextlib/bwidget/manager.rb150
-rw-r--r--ext/tk/sample/tkextlib/bwidget/select.rb82
-rw-r--r--ext/tk/sample/tkextlib/bwidget/tmpldlg.rb221
-rw-r--r--ext/tk/sample/tkextlib/bwidget/tree.rb289
-rw-r--r--ext/tk/sample/tkextlib/bwidget/x1.xbm2258
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/LICENSE.orig42
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/box.xbm14
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/clear.gifbin0 -> 279 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/close.gifbin0 -> 249 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/copy.gifbin0 -> 269 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/cut.gifbin0 -> 179 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/exit.gifbin0 -> 396 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/find.gifbin0 -> 386 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/help.gifbin0 -> 591 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/line.xbm14
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/mag.gifbin0 -> 183 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/new.gifbin0 -> 212 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/open.gifbin0 -> 258 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/oval.xbm14
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/paste.gifbin0 -> 376 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/points.xbm14
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/poly.gifbin0 -> 141 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/print.gifbin0 -> 263 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/ruler.gifbin0 -> 174 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/save.gifbin0 -> 270 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/select.gifbin0 -> 124 bytes-rw-r--r--ext/tk/sample/tkextlib/iwidgets/catalog_demo/images/text.xbm14
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/buttonbox.rb22
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/calendar.rb10
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/canvasprintbox.rb8
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/canvasprintdialog.rb8
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/checkbox.rb12
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/combobox.rb32
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/dateentry.rb7
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/datefield.rb8
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/dialog.rb20
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/dialogshell.rb14
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/disjointlistbox.rb16
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/entryfield-1.rb39
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/entryfield-2.rb40
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/entryfield-3.rb40
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/extbutton.rb20
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/extfileselectionbox.rb8
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/extfileselectiondialog.rb29
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/feedback.rb10
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/fileselectionbox.rb8
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/fileselectiondialog.rb28
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/finddialog.rb15
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/hierarchy.rb25
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/hyperhelp.rb14
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/labeledframe.rb14
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/labeledwidget.rb13
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/mainwindow.rb64
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/menubar.rb124
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/menubar2.rb44
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/messagebox1.rb19
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/messagebox2.rb19
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/messagedialog.rb44
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/notebook.rb30
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/notebook2.rb30
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/optionmenu.rb14
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/panedwindow.rb22
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/panedwindow2.rb22
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/promptdialog.rb17
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/pushbutton.rb9
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/radiobox.rb13
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/scrolledcanvas.rb13
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/scrolledframe.rb18
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/scrolledhtml.rb15
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/scrolledlistbox.rb22
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/scrolledtext.rb11
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/selectionbox.rb19
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/selectiondialog.rb12
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/shell.rb17
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/spindate.rb7
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/spinint.rb10
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/spinner.rb33
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/spintime.rb7
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/tabnotebook.rb26
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/tabnotebook2.rb30
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/tabset.rb34
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/timeentry.rb7
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/timefield.rb8
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/toolbar.rb152
-rw-r--r--ext/tk/sample/tkextlib/iwidgets/sample/watch.rb18
-rw-r--r--ext/tk/sample/tkextlib/tcllib/LICENSE.orig46
-rw-r--r--ext/tk/sample/tkextlib/tcllib/datefield.rb29
-rw-r--r--ext/tk/sample/tkextlib/tcllib/plotdemos1.rb158
-rw-r--r--ext/tk/sample/tkextlib/tcllib/plotdemos2.rb71
-rw-r--r--ext/tk/sample/tkextlib/tcllib/plotdemos3.rb83
-rw-r--r--ext/tk/sample/tkextlib/tcllib/xyplot.rb17
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/COPYRIGHT.orig12
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/README12
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/hv.rb306
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image1bin0 -> 8995 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image10bin0 -> 3095 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image11bin0 -> 1425 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image12bin0 -> 2468 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image13bin0 -> 4073 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image14bin0 -> 53 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image2bin0 -> 42 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image3bin0 -> 3473 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image4bin0 -> 1988 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image5bin0 -> 973 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image6bin0 -> 2184 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image7bin0 -> 2022 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image8bin0 -> 1186 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/image9bin0 -> 139 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page1/index.html115
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image1bin0 -> 1966 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image10bin0 -> 255 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image11bin0 -> 590 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image12bin0 -> 254 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image13bin0 -> 493 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image14bin0 -> 195 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image15bin0 -> 68 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image16bin0 -> 157 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image17bin0 -> 81 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image18bin0 -> 545 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image19bin0 -> 53 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image2bin0 -> 49 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image20bin0 -> 533 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image21bin0 -> 564 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image22bin0 -> 81 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image23bin0 -> 539 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image24bin0 -> 151 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image25bin0 -> 453 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image26bin0 -> 520 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image27bin0 -> 565 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image28bin0 -> 416 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image29bin0 -> 121 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image3bin0 -> 10835 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image30bin0 -> 663 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image31bin0 -> 78 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image32bin0 -> 556 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image33bin0 -> 598 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image34bin0 -> 496 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image35bin0 -> 724 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image36bin0 -> 404 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image37bin0 -> 124 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image38bin0 -> 8330 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image39bin0 -> 369 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image4bin0 -> 268 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image5bin0 -> 492 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image6bin0 -> 246 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image7bin0 -> 551 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image8bin0 -> 497 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/image9bin0 -> 492 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page2/index.html433
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image1bin0 -> 113 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image10bin0 -> 5088 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image11bin0 -> 4485 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image12bin0 -> 3579 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image13bin0 -> 5119 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image14bin0 -> 3603 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image2bin0 -> 74 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image3bin0 -> 681 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image4bin0 -> 3056 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image5bin0 -> 2297 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image6bin0 -> 79 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image7bin0 -> 1613 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image8bin0 -> 864 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/image9bin0 -> 2379 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page3/index.html2787
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/image1bin0 -> 42 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/image2bin0 -> 14343 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/image3bin0 -> 17750 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/image4bin0 -> 61 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/image5bin0 -> 201 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/image6bin0 -> 214 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/image7bin0 -> 149 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/image8bin0 -> 203 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/image9bin0 -> 1504 bytes-rw-r--r--ext/tk/sample/tkextlib/tkHTML/page4/index.html768
-rw-r--r--ext/tk/sample/tkextlib/tkHTML/ss.rb404
-rw-r--r--ext/tk/sample/tkextlib/tktable/LICENSE.orig52
-rw-r--r--ext/tk/sample/tkextlib/tktable/basic.rb60
-rw-r--r--ext/tk/sample/tkextlib/tktable/buttons.rb76
-rw-r--r--ext/tk/sample/tkextlib/tktable/command.rb89
-rw-r--r--ext/tk/sample/tkextlib/tktable/debug.rb101
-rw-r--r--ext/tk/sample/tkextlib/tktable/dynarows.rb99
-rw-r--r--ext/tk/sample/tkextlib/tktable/maxsize.rb67
-rw-r--r--ext/tk/sample/tkextlib/tktable/spreadsheet.rb137
-rwxr-xr-xext/tk/sample/tkextlib/tktable/tcllogo.gifbin0 -> 2341 bytes-rw-r--r--ext/tk/sample/tkextlib/tktable/valid.rb88
-rw-r--r--ext/tk/sample/tkextlib/vu/LICENSE.orig51
-rw-r--r--ext/tk/sample/tkextlib/vu/README.txt50
-rw-r--r--ext/tk/sample/tkextlib/vu/canvItems.rb90
-rw-r--r--ext/tk/sample/tkextlib/vu/canvSticker.rb82
-rw-r--r--ext/tk/sample/tkextlib/vu/canvSticker2.rb99
-rw-r--r--ext/tk/sample/tkextlib/vu/dial.rb113
-rw-r--r--ext/tk/sample/tkextlib/vu/m128_000.xbm174
-rw-r--r--ext/tk/sample/tkextlib/vu/oscilloscope.rb68
-rw-r--r--ext/tk/sample/tkextlib/vu/pie.rb56
-rw-r--r--ext/tk/sample/tkextlib/vu/vu.rb67
-rw-r--r--ext/tk/sample/tkfrom.rb132
-rw-r--r--ext/tk/sample/tkhello.rb10
-rw-r--r--ext/tk/sample/tkline.rb47
-rw-r--r--ext/tk/sample/tkmenubutton.rb135
-rw-r--r--ext/tk/sample/tkmsgcat-load_rb.rb102
-rw-r--r--ext/tk/sample/tkmsgcat-load_rb2.rb102
-rw-r--r--ext/tk/sample/tkmsgcat-load_tk.rb118
-rw-r--r--ext/tk/sample/tkmulticolumnlist.rb743
-rw-r--r--ext/tk/sample/tkmultilistbox.rb654
-rw-r--r--ext/tk/sample/tkmultilistframe.rb940
-rw-r--r--ext/tk/sample/tkoptdb-safeTk.rb35
-rw-r--r--ext/tk/sample/tkoptdb.rb106
-rw-r--r--ext/tk/sample/tktextframe.rb162
-rw-r--r--ext/tk/sample/tktimer.rb50
-rw-r--r--ext/tk/sample/tktimer2.rb47
-rw-r--r--ext/tk/sample/tktimer3.rb59
-rw-r--r--ext/tk/sample/tktree.rb103
-rw-r--r--ext/tk/sample/tktree.tcl305
-rw-r--r--ext/tk/tkutil.c1310
-rw-r--r--ext/win32/depend2
-rw-r--r--ext/win32/extconf.rb4
-rw-r--r--ext/win32/lib/Win32API.rb47
-rw-r--r--ext/win32/lib/win32/importer.rb9
-rw-r--r--ext/win32/lib/win32/registry.rb913
-rw-r--r--ext/win32/lib/win32/resolv.rb148
-rw-r--r--ext/win32/lib/win32/resolv9x.rb253
-rw-r--r--ext/win32/lib/win32/sspi.rb331
-rw-r--r--ext/win32/resolv/depend17
-rw-r--r--ext/win32/resolv/extconf.rb3
-rw-r--r--ext/win32/resolv/resolv.c65
-rw-r--r--ext/win32ole/.cvsignore3
-rw-r--r--ext/win32ole/MANIFEST24
-rw-r--r--ext/win32ole/depend13
-rw-r--r--ext/win32ole/doc/win32ole.rd294
-rw-r--r--ext/win32ole/extconf.rb32
-rw-r--r--ext/win32ole/lib/win32ole.rb33
-rw-r--r--ext/win32ole/lib/win32ole/property.rb1
-rw-r--r--ext/win32ole/sample/excel1.rb21
-rw-r--r--ext/win32ole/sample/excel2.rb21
-rw-r--r--ext/win32ole/sample/excel3.rb10
-rw-r--r--ext/win32ole/sample/ie.rb3
-rw-r--r--ext/win32ole/sample/ieconst.rb3
-rw-r--r--ext/win32ole/sample/ienavi.rb9
-rw-r--r--ext/win32ole/sample/ienavi2.rb41
-rw-r--r--ext/win32ole/sample/oledirs.rb3
-rw-r--r--ext/win32ole/sample/olegen.rb34
-rw-r--r--ext/win32ole/sample/xml.rb37
-rw-r--r--ext/win32ole/tests/oleserver.rb10
-rw-r--r--ext/win32ole/tests/testOLEEVENT.rb33
-rw-r--r--ext/win32ole/tests/testOLEMETHOD.rb87
-rw-r--r--ext/win32ole/tests/testOLEPARAM.rb74
-rw-r--r--ext/win32ole/tests/testOLETYPE.rb96
-rw-r--r--ext/win32ole/tests/testOLEVARIABLE.rb49
-rw-r--r--ext/win32ole/tests/testVARIANT.rb32
-rw-r--r--ext/win32ole/tests/testWIN32OLE.rb298
-rw-r--r--ext/win32ole/tests/testall.rb11
-rw-r--r--ext/win32ole/win32ole.c6342
-rw-r--r--ext/win32ole/win32ole.h155
-rw-r--r--ext/win32ole/win32ole_error.c87
-rw-r--r--ext/win32ole/win32ole_error.h9
-rw-r--r--ext/win32ole/win32ole_event.c1277
-rw-r--r--ext/win32ole/win32ole_event.h6
-rw-r--r--ext/win32ole/win32ole_method.c952
-rw-r--r--ext/win32ole/win32ole_method.h16
-rw-r--r--ext/win32ole/win32ole_param.c438
-rw-r--r--ext/win32ole/win32ole_param.h8
-rw-r--r--ext/win32ole/win32ole_record.c606
-rw-r--r--ext/win32ole/win32ole_record.h10
-rw-r--r--ext/win32ole/win32ole_type.c917
-rw-r--r--ext/win32ole/win32ole_type.h8
-rw-r--r--ext/win32ole/win32ole_typelib.c846
-rw-r--r--ext/win32ole/win32ole_typelib.h11
-rw-r--r--ext/win32ole/win32ole_variable.c382
-rw-r--r--ext/win32ole/win32ole_variable.h8
-rw-r--r--ext/win32ole/win32ole_variant.c735
-rw-r--r--ext/win32ole/win32ole_variant.h9
-rw-r--r--ext/win32ole/win32ole_variant_m.c151
-rw-r--r--ext/win32ole/win32ole_variant_m.h7
-rw-r--r--ext/zlib/.cvsignore3
-rw-r--r--ext/zlib/.gitignore1
-rw-r--r--ext/zlib/MANIFEST4
-rw-r--r--ext/zlib/depend19
-rw-r--r--ext/zlib/doc/zlib.rd911
-rw-r--r--ext/zlib/extconf.rb94
-rw-r--r--ext/zlib/zlib.c3630
-rw-r--r--ext/zlib/zlib.gemspec35
-rw-r--r--file.c5829
-rw-r--r--gc.c12777
-rw-r--r--gc.h133
-rw-r--r--gc.rb169
-rw-r--r--gem_prelude.rb2
-rw-r--r--gems/bundled_gems6
-rw-r--r--golf_prelude.rb130
-rw-r--r--goruby.c66
-rw-r--r--hash.c6452
-rw-r--r--hrtime.h168
-rw-r--r--id_table.c325
-rw-r--r--id_table.h34
-rw-r--r--include/ruby.h35
-rw-r--r--include/ruby/assert.h54
-rw-r--r--include/ruby/backward.h79
-rw-r--r--include/ruby/backward/classext.h18
-rw-r--r--include/ruby/backward/cxxanyargs.hpp439
-rw-r--r--include/ruby/backward/rubyio.h6
-rw-r--r--include/ruby/backward/rubysig.h47
-rw-r--r--include/ruby/backward/st.h6
-rw-r--r--include/ruby/backward/util.h6
-rw-r--r--include/ruby/debug.h115
-rw-r--r--include/ruby/defines.h541
-rw-r--r--include/ruby/encoding.h429
-rw-r--r--include/ruby/intern.h1230
-rw-r--r--include/ruby/io.h185
-rw-r--r--include/ruby/missing.h278
-rw-r--r--include/ruby/onigmo.h941
-rw-r--r--include/ruby/oniguruma.h8
-rw-r--r--include/ruby/re.h71
-rw-r--r--include/ruby/regex.h46
-rw-r--r--include/ruby/ruby.h2873
-rw-r--r--include/ruby/st.h197
-rw-r--r--include/ruby/subst.h19
-rw-r--r--include/ruby/thread.h57
-rw-r--r--include/ruby/thread_native.h56
-rw-r--r--include/ruby/util.h89
-rw-r--r--include/ruby/version.h74
-rw-r--r--include/ruby/vm.h63
-rw-r--r--include/ruby/win32.h825
-rw-r--r--inits.c136
-rw-r--r--insns.def1543
-rw-r--r--install-sh (renamed from lib/rdoc/generator/template/darkfish/.document)0
-rw-r--r--instruby.rb215
-rw-r--r--intern.h487
-rw-r--r--internal.h2720
-rw-r--r--io.c13836
-rw-r--r--io.rb123
-rw-r--r--iseq.c3589
-rw-r--r--iseq.h312
-rw-r--r--keywords42
-rw-r--r--lex.c136
-rw-r--r--lex.c.blt303
-rw-r--r--lib/.document52
-rw-r--r--lib/English.rb109
-rw-r--r--lib/Env.rb18
-rw-r--r--lib/README96
-rw-r--r--lib/abbrev.rb135
-rw-r--r--lib/base64.rb155
-rw-r--r--lib/benchmark.rb488
-rw-r--r--lib/benchmark/benchmark.gemspec29
-rw-r--r--lib/benchmark/version.rb3
-rw-r--r--lib/bundler.rb682
-rw-r--r--lib/bundler/build_metadata.rb51
-rw-r--r--lib/bundler/bundler.gemspec44
-rw-r--r--lib/bundler/capistrano.rb22
-rw-r--r--lib/bundler/cli.rb828
-rw-r--r--lib/bundler/cli/add.rb47
-rw-r--r--lib/bundler/cli/binstubs.rb49
-rw-r--r--lib/bundler/cli/cache.rb48
-rw-r--r--lib/bundler/cli/check.rb38
-rw-r--r--lib/bundler/cli/clean.rb25
-rw-r--r--lib/bundler/cli/common.rb101
-rw-r--r--lib/bundler/cli/config.rb194
-rw-r--r--lib/bundler/cli/console.rb43
-rw-r--r--lib/bundler/cli/doctor.rb140
-rw-r--r--lib/bundler/cli/exec.rb93
-rw-r--r--lib/bundler/cli/gem.rb252
-rw-r--r--lib/bundler/cli/info.rb62
-rw-r--r--lib/bundler/cli/init.rb47
-rw-r--r--lib/bundler/cli/inject.rb60
-rw-r--r--lib/bundler/cli/install.rb219
-rw-r--r--lib/bundler/cli/issue.rb40
-rw-r--r--lib/bundler/cli/list.rb58
-rw-r--r--lib/bundler/cli/lock.rb63
-rw-r--r--lib/bundler/cli/open.rb30
-rw-r--r--lib/bundler/cli/outdated.rb270
-rw-r--r--lib/bundler/cli/package.rb48
-rw-r--r--lib/bundler/cli/platform.rb46
-rw-r--r--lib/bundler/cli/plugin.rb31
-rw-r--r--lib/bundler/cli/pristine.rb47
-rw-r--r--lib/bundler/cli/remove.rb18
-rw-r--r--lib/bundler/cli/show.rb75
-rw-r--r--lib/bundler/cli/update.rb111
-rw-r--r--lib/bundler/cli/viz.rb31
-rw-r--r--lib/bundler/compact_index_client.rb125
-rw-r--r--lib/bundler/compact_index_client/cache.rb118
-rw-r--r--lib/bundler/compact_index_client/updater.rb112
-rw-r--r--lib/bundler/constants.rb7
-rw-r--r--lib/bundler/current_ruby.rb95
-rw-r--r--lib/bundler/definition.rb1002
-rw-r--r--lib/bundler/dep_proxy.rb48
-rw-r--r--lib/bundler/dependency.rb151
-rw-r--r--lib/bundler/deployment.rb69
-rw-r--r--lib/bundler/deprecate.rb44
-rw-r--r--lib/bundler/dsl.rb591
-rw-r--r--lib/bundler/endpoint_specification.rb141
-rw-r--r--lib/bundler/env.rb150
-rw-r--r--lib/bundler/environment_preserver.rb58
-rw-r--r--lib/bundler/errors.rb158
-rw-r--r--lib/bundler/feature_flag.rb63
-rw-r--r--lib/bundler/fetcher.rb315
-rw-r--r--lib/bundler/fetcher/base.rb52
-rw-r--r--lib/bundler/fetcher/compact_index.rb140
-rw-r--r--lib/bundler/fetcher/dependency.rb82
-rw-r--r--lib/bundler/fetcher/downloader.rb87
-rw-r--r--lib/bundler/fetcher/index.rb54
-rw-r--r--lib/bundler/friendly_errors.rb130
-rw-r--r--lib/bundler/gem_helper.rb216
-rw-r--r--lib/bundler/gem_helpers.rb99
-rw-r--r--lib/bundler/gem_remote_fetcher.rb43
-rw-r--r--lib/bundler/gem_tasks.rb7
-rw-r--r--lib/bundler/gem_version_promoter.rb190
-rw-r--r--lib/bundler/gemdeps.rb29
-rw-r--r--lib/bundler/graph.rb152
-rw-r--r--lib/bundler/index.rb213
-rw-r--r--lib/bundler/injector.rb255
-rw-r--r--lib/bundler/inline.rb84
-rw-r--r--lib/bundler/installer.rb311
-rw-r--r--lib/bundler/installer/gem_installer.rb89
-rw-r--r--lib/bundler/installer/parallel_installer.rb229
-rw-r--r--lib/bundler/installer/standalone.rb52
-rw-r--r--lib/bundler/lazy_specification.rb122
-rw-r--r--lib/bundler/lockfile_generator.rb95
-rw-r--r--lib/bundler/lockfile_parser.rb249
-rw-r--r--lib/bundler/match_platform.rb24
-rw-r--r--lib/bundler/mirror.rb223
-rw-r--r--lib/bundler/plugin.rb305
-rw-r--r--lib/bundler/plugin/api.rb81
-rw-r--r--lib/bundler/plugin/api/source.rb304
-rw-r--r--lib/bundler/plugin/dsl.rb53
-rw-r--r--lib/bundler/plugin/events.rb61
-rw-r--r--lib/bundler/plugin/index.rb173
-rw-r--r--lib/bundler/plugin/installer.rb109
-rw-r--r--lib/bundler/plugin/installer/git.rb38
-rw-r--r--lib/bundler/plugin/installer/rubygems.rb27
-rw-r--r--lib/bundler/plugin/source_list.rb27
-rw-r--r--lib/bundler/process_lock.rb24
-rw-r--r--lib/bundler/psyched_yaml.rb37
-rw-r--r--lib/bundler/remote_specification.rb112
-rw-r--r--lib/bundler/resolver.rb421
-rw-r--r--lib/bundler/resolver/spec_group.rb107
-rw-r--r--lib/bundler/retry.rb66
-rw-r--r--lib/bundler/ruby_dsl.rb18
-rw-r--r--lib/bundler/ruby_version.rb137
-rw-r--r--lib/bundler/rubygems_ext.rb154
-rw-r--r--lib/bundler/rubygems_gem_installer.rb99
-rw-r--r--lib/bundler/rubygems_integration.rb648
-rw-r--r--lib/bundler/runtime.rb315
-rw-r--r--lib/bundler/settings.rb434
-rw-r--r--lib/bundler/settings/validator.rb102
-rw-r--r--lib/bundler/setup.rb27
-rw-r--r--lib/bundler/shared_helpers.rb358
-rw-r--r--lib/bundler/similarity_detector.rb63
-rw-r--r--lib/bundler/source.rb94
-rw-r--r--lib/bundler/source/gemspec.rb18
-rw-r--r--lib/bundler/source/git.rb336
-rw-r--r--lib/bundler/source/git/git_proxy.rb259
-rw-r--r--lib/bundler/source/metadata.rb67
-rw-r--r--lib/bundler/source/path.rb254
-rw-r--r--lib/bundler/source/path/installer.rb74
-rw-r--r--lib/bundler/source/rubygems.rb545
-rw-r--r--lib/bundler/source/rubygems/remote.rb68
-rw-r--r--lib/bundler/source_list.rb183
-rw-r--r--lib/bundler/spec_set.rb203
-rw-r--r--lib/bundler/stub_specification.rb96
-rw-r--r--lib/bundler/templates/.document1
-rw-r--r--lib/bundler/templates/Executable29
-rw-r--r--lib/bundler/templates/Executable.bundler114
-rw-r--r--lib/bundler/templates/Executable.standalone14
-rw-r--r--lib/bundler/templates/Gemfile7
-rw-r--r--lib/bundler/templates/gems.rb8
-rw-r--r--lib/bundler/templates/newgem/CODE_OF_CONDUCT.md.tt74
-rw-r--r--lib/bundler/templates/newgem/Gemfile.tt12
-rw-r--r--lib/bundler/templates/newgem/LICENSE.txt.tt21
-rw-r--r--lib/bundler/templates/newgem/README.md.tt48
-rw-r--r--lib/bundler/templates/newgem/Rakefile.tt29
-rw-r--r--lib/bundler/templates/newgem/bin/console.tt14
-rw-r--r--lib/bundler/templates/newgem/bin/setup.tt8
-rw-r--r--lib/bundler/templates/newgem/exe/newgem.tt3
-rw-r--r--lib/bundler/templates/newgem/ext/newgem/extconf.rb.tt3
-rw-r--r--lib/bundler/templates/newgem/ext/newgem/newgem.c.tt9
-rw-r--r--lib/bundler/templates/newgem/ext/newgem/newgem.h.tt6
-rw-r--r--lib/bundler/templates/newgem/gitignore.tt20
-rw-r--r--lib/bundler/templates/newgem/lib/newgem.rb.tt13
-rw-r--r--lib/bundler/templates/newgem/lib/newgem/version.rb.tt7
-rw-r--r--lib/bundler/templates/newgem/newgem.gemspec.tt34
-rw-r--r--lib/bundler/templates/newgem/rspec.tt3
-rw-r--r--lib/bundler/templates/newgem/spec/newgem_spec.rb.tt9
-rw-r--r--lib/bundler/templates/newgem/spec/spec_helper.rb.tt14
-rw-r--r--lib/bundler/templates/newgem/test/newgem_test.rb.tt11
-rw-r--r--lib/bundler/templates/newgem/test/test_helper.rb.tt4
-rw-r--r--lib/bundler/templates/newgem/travis.yml.tt6
-rw-r--r--lib/bundler/ui.rb9
-rw-r--r--lib/bundler/ui/rg_proxy.rb19
-rw-r--r--lib/bundler/ui/shell.rb142
-rw-r--r--lib/bundler/ui/silent.rb69
-rw-r--r--lib/bundler/uri_credentials_filter.rb41
-rw-r--r--lib/bundler/vendor/connection_pool/lib/connection_pool.rb161
-rw-r--r--lib/bundler/vendor/connection_pool/lib/connection_pool/monotonic_time.rb66
-rw-r--r--lib/bundler/vendor/connection_pool/lib/connection_pool/timed_stack.rb176
-rw-r--r--lib/bundler/vendor/connection_pool/lib/connection_pool/version.rb3
-rw-r--r--lib/bundler/vendor/fileutils/lib/fileutils.rb1764
-rw-r--r--lib/bundler/vendor/fileutils/lib/fileutils/version.rb5
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo.rb12
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/compatibility.rb26
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/delegates/resolution_state.rb57
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/delegates/specification_provider.rb81
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/dependency_graph.rb223
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/dependency_graph/action.rb36
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/dependency_graph/add_edge_no_circular.rb66
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/dependency_graph/add_vertex.rb62
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/dependency_graph/delete_edge.rb63
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/dependency_graph/detach_vertex_named.rb61
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/dependency_graph/log.rb126
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/dependency_graph/set_payload.rb46
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/dependency_graph/tag.rb36
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/dependency_graph/vertex.rb158
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/errors.rb143
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/gem_metadata.rb6
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/modules/specification_provider.rb101
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/modules/ui.rb67
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/resolution.rb837
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/resolver.rb46
-rw-r--r--lib/bundler/vendor/molinillo/lib/molinillo/state.rb58
-rw-r--r--lib/bundler/vendor/net-http-persistent/lib/net/http/persistent.rb1180
-rw-r--r--lib/bundler/vendor/net-http-persistent/lib/net/http/persistent/connection.rb40
-rw-r--r--lib/bundler/vendor/net-http-persistent/lib/net/http/persistent/pool.rb53
-rw-r--r--lib/bundler/vendor/net-http-persistent/lib/net/http/persistent/timed_stack_multi.rb79
-rw-r--r--lib/bundler/vendor/thor/lib/thor.rb524
-rw-r--r--lib/bundler/vendor/thor/lib/thor/actions.rb336
-rw-r--r--lib/bundler/vendor/thor/lib/thor/actions/create_file.rb104
-rw-r--r--lib/bundler/vendor/thor/lib/thor/actions/create_link.rb60
-rw-r--r--lib/bundler/vendor/thor/lib/thor/actions/directory.rb108
-rw-r--r--lib/bundler/vendor/thor/lib/thor/actions/empty_directory.rb143
-rw-r--r--lib/bundler/vendor/thor/lib/thor/actions/file_manipulation.rb373
-rw-r--r--lib/bundler/vendor/thor/lib/thor/actions/inject_into_file.rb120
-rw-r--r--lib/bundler/vendor/thor/lib/thor/base.rb690
-rw-r--r--lib/bundler/vendor/thor/lib/thor/command.rb142
-rw-r--r--lib/bundler/vendor/thor/lib/thor/core_ext/hash_with_indifferent_access.rb97
-rw-r--r--lib/bundler/vendor/thor/lib/thor/core_ext/io_binary_read.rb12
-rw-r--r--lib/bundler/vendor/thor/lib/thor/core_ext/ordered_hash.rb129
-rw-r--r--lib/bundler/vendor/thor/lib/thor/error.rb110
-rw-r--r--lib/bundler/vendor/thor/lib/thor/group.rb281
-rw-r--r--lib/bundler/vendor/thor/lib/thor/invocation.rb178
-rw-r--r--lib/bundler/vendor/thor/lib/thor/line_editor.rb17
-rw-r--r--lib/bundler/vendor/thor/lib/thor/line_editor/basic.rb37
-rw-r--r--lib/bundler/vendor/thor/lib/thor/line_editor/readline.rb88
-rw-r--r--lib/bundler/vendor/thor/lib/thor/nested_context.rb29
-rw-r--r--lib/bundler/vendor/thor/lib/thor/parser.rb4
-rw-r--r--lib/bundler/vendor/thor/lib/thor/parser/argument.rb70
-rw-r--r--lib/bundler/vendor/thor/lib/thor/parser/arguments.rb175
-rw-r--r--lib/bundler/vendor/thor/lib/thor/parser/option.rb159
-rw-r--r--lib/bundler/vendor/thor/lib/thor/parser/options.rb236
-rw-r--r--lib/bundler/vendor/thor/lib/thor/rake_compat.rb72
-rw-r--r--lib/bundler/vendor/thor/lib/thor/runner.rb325
-rw-r--r--lib/bundler/vendor/thor/lib/thor/shell.rb81
-rw-r--r--lib/bundler/vendor/thor/lib/thor/shell/basic.rb491
-rw-r--r--lib/bundler/vendor/thor/lib/thor/shell/color.rb153
-rw-r--r--lib/bundler/vendor/thor/lib/thor/shell/html.rb126
-rw-r--r--lib/bundler/vendor/thor/lib/thor/util.rb284
-rw-r--r--lib/bundler/vendor/thor/lib/thor/version.rb3
-rw-r--r--lib/bundler/vendor/uri/lib/uri.rb104
-rw-r--r--lib/bundler/vendor/uri/lib/uri/common.rb744
-rw-r--r--lib/bundler/vendor/uri/lib/uri/file.rb94
-rw-r--r--lib/bundler/vendor/uri/lib/uri/ftp.rb267
-rw-r--r--lib/bundler/vendor/uri/lib/uri/generic.rb1568
-rw-r--r--lib/bundler/vendor/uri/lib/uri/http.rb88
-rw-r--r--lib/bundler/vendor/uri/lib/uri/https.rb23
-rw-r--r--lib/bundler/vendor/uri/lib/uri/ldap.rb261
-rw-r--r--lib/bundler/vendor/uri/lib/uri/ldaps.rb21
-rw-r--r--lib/bundler/vendor/uri/lib/uri/mailto.rb294
-rw-r--r--lib/bundler/vendor/uri/lib/uri/rfc2396_parser.rb546
-rw-r--r--lib/bundler/vendor/uri/lib/uri/rfc3986_parser.rb125
-rw-r--r--lib/bundler/vendor/uri/lib/uri/version.rb6
-rw-r--r--lib/bundler/vendored_fileutils.rb4
-rw-r--r--lib/bundler/vendored_molinillo.rb4
-rw-r--r--lib/bundler/vendored_persistent.rb54
-rw-r--r--lib/bundler/vendored_thor.rb8
-rw-r--r--lib/bundler/vendored_uri.rb4
-rw-r--r--lib/bundler/version.rb9
-rw-r--r--lib/bundler/version_ranges.rb122
-rw-r--r--lib/bundler/vlad.rb17
-rw-r--r--lib/bundler/worker.rb104
-rw-r--r--lib/bundler/yaml_serializer.rb89
-rw-r--r--lib/cgi-lib.rb270
-rw-r--r--lib/cgi.rb2226
-rw-r--r--lib/cgi/.document2
-rw-r--r--lib/cgi/cgi.gemspec27
-rw-r--r--lib/cgi/cookie.rb181
-rw-r--r--lib/cgi/core.rb889
-rw-r--r--lib/cgi/html.rb1035
-rw-r--r--lib/cgi/session.rb357
-rw-r--r--lib/cgi/session/pstore.rb99
-rw-r--r--lib/cgi/util.rb223
-rw-r--r--lib/cgi/version.rb3
-rw-r--r--lib/complex.rb631
-rw-r--r--lib/csv.rb2261
-rw-r--r--lib/csv/core_ext/array.rb9
-rw-r--r--lib/csv/core_ext/string.rb9
-rw-r--r--lib/csv/csv.gemspec44
-rw-r--r--lib/csv/delete_suffix.rb18
-rw-r--r--lib/csv/fields_converter.rb84
-rw-r--r--lib/csv/match_p.rb20
-rw-r--r--lib/csv/parser.rb1136
-rw-r--r--lib/csv/row.rb390
-rw-r--r--lib/csv/table.rb402
-rw-r--r--lib/csv/version.rb6
-rw-r--r--lib/csv/writer.rb168
-rw-r--r--lib/date.rb1328
-rw-r--r--lib/date/format.rb563
-rw-r--r--lib/date2.rb5
-rw-r--r--lib/debug.rb1731
-rw-r--r--lib/delegate.rb494
-rw-r--r--lib/delegate/delegate.gemspec27
-rw-r--r--lib/delegate/version.rb3
-rw-r--r--lib/did_you_mean.rb110
-rw-r--r--lib/did_you_mean/core_ext/name_error.rb25
-rw-r--r--lib/did_you_mean/did_you_mean.gemspec27
-rw-r--r--lib/did_you_mean/experimental.rb2
-rw-r--r--lib/did_you_mean/experimental/initializer_name_correction.rb20
-rw-r--r--lib/did_you_mean/experimental/ivar_name_correction.rb76
-rw-r--r--lib/did_you_mean/formatters/plain_formatter.rb33
-rw-r--r--lib/did_you_mean/formatters/verbose_formatter.rb49
-rw-r--r--lib/did_you_mean/jaro_winkler.rb87
-rw-r--r--lib/did_you_mean/levenshtein.rb57
-rw-r--r--lib/did_you_mean/spell_checker.rb46
-rw-r--r--lib/did_you_mean/spell_checkers/key_error_checker.rb20
-rw-r--r--lib/did_you_mean/spell_checkers/method_name_checker.rb64
-rw-r--r--lib/did_you_mean/spell_checkers/name_error_checkers.rb20
-rw-r--r--lib/did_you_mean/spell_checkers/name_error_checkers/class_name_checker.rb49
-rw-r--r--lib/did_you_mean/spell_checkers/name_error_checkers/variable_name_checker.rb82
-rw-r--r--lib/did_you_mean/spell_checkers/null_checker.rb6
-rw-r--r--lib/did_you_mean/tree_spell_checker.rb137
-rw-r--r--lib/did_you_mean/verbose.rb4
-rw-r--r--lib/did_you_mean/version.rb3
-rw-r--r--lib/drb.rb1
-rw-r--r--lib/drb/acl.rb179
-rw-r--r--lib/drb/drb.rb1040
-rw-r--r--lib/drb/eq.rb5
-rw-r--r--lib/drb/extserv.rb53
-rw-r--r--lib/drb/extservm.rb80
-rw-r--r--lib/drb/gw.rb119
-rw-r--r--lib/drb/invokemethod.rb15
-rw-r--r--lib/drb/observer.rb24
-rw-r--r--lib/drb/ssl.rb353
-rw-r--r--lib/drb/timeridconv.rb112
-rw-r--r--lib/drb/unix.rb69
-rw-r--r--lib/drb/weakidconv.rb59
-rw-r--r--lib/e2mmap.rb195
-rw-r--r--lib/erb.rb1202
-rw-r--r--lib/eregex.rb37
-rw-r--r--lib/fileutils.gemspec31
-rw-r--r--lib/fileutils.rb2013
-rw-r--r--lib/finalize.rb186
-rw-r--r--lib/find.rb65
-rw-r--r--lib/forwardable.rb342
-rw-r--r--lib/forwardable/forwardable.gemspec23
-rw-r--r--lib/forwardable/impl.rb16
-rw-r--r--lib/forwardable/version.rb5
-rw-r--r--lib/ftools.rb255
-rw-r--r--lib/generator.rb380
-rw-r--r--lib/getoptlong.rb427
-rw-r--r--lib/getoptlong/getoptlong.gemspec29
-rw-r--r--lib/getoptlong/version.rb3
-rw-r--r--lib/getopts.rb124
-rw-r--r--lib/gserver.rb249
-rw-r--r--lib/importenv.rb31
-rw-r--r--lib/ipaddr.gemspec28
-rw-r--r--lib/ipaddr.rb782
-rw-r--r--lib/irb.rb931
-rw-r--r--lib/irb/.document1
-rw-r--r--lib/irb/cmd/chws.rb27
-rw-r--r--lib/irb/cmd/fork.rb48
-rw-r--r--lib/irb/cmd/help.rb46
-rw-r--r--lib/irb/cmd/info.rb24
-rw-r--r--lib/irb/cmd/load.rb74
-rw-r--r--lib/irb/cmd/nop.rb26
-rw-r--r--lib/irb/cmd/pushws.rb33
-rw-r--r--lib/irb/cmd/subirb.rb34
-rw-r--r--lib/irb/color.rb235
-rw-r--r--lib/irb/completion.rb439
-rw-r--r--lib/irb/context.rb441
-rw-r--r--lib/irb/easter-egg.rb137
-rw-r--r--lib/irb/ext/change-ws.rb61
-rw-r--r--lib/irb/ext/history.rb133
-rw-r--r--lib/irb/ext/loader.rb152
-rw-r--r--lib/irb/ext/math-mode.rb37
-rw-r--r--lib/irb/ext/multi-irb.rb252
-rw-r--r--lib/irb/ext/save-history.rb120
-rw-r--r--lib/irb/ext/tracer.rb63
-rw-r--r--lib/irb/ext/use-loader.rb58
-rw-r--r--lib/irb/ext/workspaces.rb50
-rw-r--r--lib/irb/extend-command.rb378
-rw-r--r--lib/irb/frame.rb45
-rw-r--r--lib/irb/help.rb37
-rw-r--r--lib/irb/init.rb328
-rw-r--r--lib/irb/input-method.rb312
-rw-r--r--lib/irb/inspector.rb138
-rw-r--r--lib/irb/irb.gemspec84
-rw-r--r--lib/irb/lc/error.rb83
-rw-r--r--lib/irb/lc/help-message57
-rw-r--r--lib/irb/lc/ja/encoding_aliases.rb11
-rw-r--r--lib/irb/lc/ja/error.rb85
-rw-r--r--lib/irb/lc/ja/help-message75
-rw-r--r--lib/irb/locale.rb205
-rw-r--r--lib/irb/magic-file.rb38
-rw-r--r--lib/irb/notifier.rb236
-rw-r--r--lib/irb/output-method.rb92
-rw-r--r--lib/irb/ruby-lex.rb1472
-rw-r--r--lib/irb/ruby-token.rb273
-rw-r--r--lib/irb/ruby_logo.aa37
-rw-r--r--lib/irb/slex.rb278
-rw-r--r--lib/irb/src_encoding.rb7
-rw-r--r--lib/irb/version.rb13
-rw-r--r--lib/irb/workspace.rb212
-rw-r--r--lib/irb/ws-for-case-2.rb12
-rw-r--r--lib/irb/xmp.rb120
-rw-r--r--lib/jcode.rb219
-rw-r--r--lib/logger.rb723
-rw-r--r--lib/logger/errors.rb9
-rw-r--r--lib/logger/formatter.rb36
-rw-r--r--lib/logger/log_device.rb205
-rw-r--r--lib/logger/logger.gemspec29
-rw-r--r--lib/logger/period.rb47
-rw-r--r--lib/logger/severity.rb19
-rw-r--r--lib/logger/version.rb5
-rw-r--r--lib/mailread.rb48
-rw-r--r--lib/mathn.rb306
-rw-r--r--lib/matrix.rb2391
-rw-r--r--lib/matrix/eigenvalue_decomposition.rb882
-rw-r--r--lib/matrix/lup_decomposition.rb219
-rw-r--r--lib/matrix/matrix.gemspec28
-rw-r--r--lib/matrix/version.rb5
-rw-r--r--lib/mkmf.rb3391
-rw-r--r--lib/monitor.rb321
-rw-r--r--lib/mutex_m.gemspec27
-rw-r--r--lib/mutex_m.rb148
-rw-r--r--lib/net/ftp.rb1489
-rw-r--r--lib/net/http.rb2580
-rw-r--r--lib/net/http/backward.rb26
-rw-r--r--lib/net/http/exceptions.rb33
-rw-r--r--lib/net/http/generic_request.rb339
-rw-r--r--lib/net/http/header.rb496
-rw-r--r--lib/net/http/proxy_delta.rb17
-rw-r--r--lib/net/http/request.rb21
-rw-r--r--lib/net/http/requests.rb123
-rw-r--r--lib/net/http/response.rb427
-rw-r--r--lib/net/http/responses.rb307
-rw-r--r--lib/net/http/status.rb83
-rw-r--r--lib/net/https.rb23
-rw-r--r--lib/net/imap.rb3853
-rw-r--r--lib/net/pop.rb392
-rw-r--r--lib/net/pop/net-pop.gemspec27
-rw-r--r--lib/net/pop/version.rb6
-rw-r--r--lib/net/protocol.rb509
-rw-r--r--lib/net/smtp.rb843
-rw-r--r--lib/net/smtp/net-smtp.gemspec27
-rw-r--r--lib/net/smtp/version.rb6
-rw-r--r--lib/net/telnet.rb742
-rw-r--r--lib/observer.rb108
-rw-r--r--lib/observer/observer.gemspec29
-rw-r--r--lib/observer/version.rb3
-rw-r--r--lib/open-uri.rb863
-rw-r--r--lib/open3.rb790
-rw-r--r--lib/open3/open3.gemspec29
-rw-r--r--lib/open3/version.rb3
-rw-r--r--lib/optionparser.rb2
-rw-r--r--lib/optparse.rb2255
-rw-r--r--lib/optparse/ac.rb54
-rw-r--r--lib/optparse/date.rb1
-rw-r--r--lib/optparse/kwargs.rb17
-rw-r--r--lib/optparse/shellwords.rb1
-rw-r--r--lib/optparse/time.rb1
-rw-r--r--lib/optparse/uri.rb1
-rw-r--r--lib/optparse/version.rb49
-rw-r--r--lib/ostruct.rb363
-rw-r--r--lib/ostruct/ostruct.gemspec28
-rw-r--r--lib/ostruct/version.rb5
-rw-r--r--lib/parsearg.rb83
-rw-r--r--lib/parsedate.rb15
-rw-r--r--lib/pathname.rb1197
-rw-r--r--lib/ping.rb64
-rw-r--r--lib/pp.rb708
-rw-r--r--lib/prettyprint.rb966
-rw-r--r--lib/prime.gemspec27
-rw-r--r--lib/prime.rb463
-rw-r--r--lib/profile.rb6
-rw-r--r--lib/profiler.rb59
-rw-r--r--lib/pstore.rb498
-rw-r--r--lib/pstore/pstore.gemspec29
-rw-r--r--lib/pstore/version.rb3
-rw-r--r--lib/racc.rb6
-rw-r--r--lib/racc/compat.rb32
-rw-r--r--lib/racc/debugflags.rb59
-rw-r--r--lib/racc/exception.rb13
-rw-r--r--lib/racc/grammar.rb1113
-rw-r--r--lib/racc/grammarfileparser.rb560
-rw-r--r--lib/racc/info.rb14
-rw-r--r--lib/racc/iset.rb91
-rw-r--r--lib/racc/logfilegenerator.rb211
-rw-r--r--lib/racc/parser-text.rb643
-rw-r--r--lib/racc/parser.rb364
-rw-r--r--lib/racc/parserfilegenerator.rb510
-rw-r--r--lib/racc/pre-setup13
-rw-r--r--lib/racc/racc.gemspec105
-rw-r--r--lib/racc/rdoc/grammar.en.rdoc219
-rw-r--r--lib/racc/sourcetext.rb34
-rw-r--r--lib/racc/state.rb969
-rw-r--r--lib/racc/statetransitiontable.rb316
-rw-r--r--lib/racc/static.rb5
-rw-r--r--lib/rational.rb374
-rw-r--r--lib/rdoc.rb180
-rw-r--r--lib/rdoc/.document2
-rw-r--r--lib/rdoc/README472
-rw-r--r--lib/rdoc/alias.rb112
-rw-r--r--lib/rdoc/anon_class.rb11
-rw-r--r--lib/rdoc/any_method.rb316
-rw-r--r--lib/rdoc/attr.rb176
-rw-r--r--lib/rdoc/class_module.rb802
-rw-r--r--lib/rdoc/code_object.rb421
-rw-r--r--lib/rdoc/code_objects.rb701
-rw-r--r--lib/rdoc/comment.rb250
-rw-r--r--lib/rdoc/constant.rb187
-rw-r--r--lib/rdoc/context.rb1258
-rw-r--r--lib/rdoc/context/section.rb245
-rw-r--r--lib/rdoc/cross_reference.rb202
-rw-r--r--lib/rdoc/diagram.rb333
-rw-r--r--lib/rdoc/dot/dot.rb255
-rw-r--r--lib/rdoc/encoding.rb136
-rw-r--r--lib/rdoc/erb_partial.rb19
-rw-r--r--lib/rdoc/erbio.rb42
-rw-r--r--lib/rdoc/extend.rb10
-rw-r--r--lib/rdoc/generator.rb51
-rw-r--r--lib/rdoc/generator/darkfish.rb790
-rw-r--r--lib/rdoc/generator/json_index.rb300
-rw-r--r--lib/rdoc/generator/markup.rb160
-rw-r--r--lib/rdoc/generator/pot.rb98
-rw-r--r--lib/rdoc/generator/pot/message_extractor.rb68
-rw-r--r--lib/rdoc/generator/pot/po.rb84
-rw-r--r--lib/rdoc/generator/pot/po_entry.rb141
-rw-r--r--lib/rdoc/generator/ri.rb31
-rw-r--r--lib/rdoc/generator/template/darkfish/_footer.rhtml5
-rw-r--r--lib/rdoc/generator/template/darkfish/_head.rhtml23
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_VCS_info.rhtml19
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_classes.rhtml9
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_extends.rhtml15
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_in_files.rhtml9
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_includes.rhtml15
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_installed.rhtml15
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_methods.rhtml12
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_navigation.rhtml11
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_pages.rhtml12
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_parent.rhtml11
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_search.rhtml14
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_sections.rhtml11
-rw-r--r--lib/rdoc/generator/template/darkfish/_sidebar_table_of_contents.rhtml18
-rw-r--r--lib/rdoc/generator/template/darkfish/class.rhtml172
-rw-r--r--lib/rdoc/generator/template/darkfish/css/fonts.css167
-rw-r--r--lib/rdoc/generator/template/darkfish/css/rdoc.css619
-rw-r--r--lib/rdoc/generator/template/darkfish/fonts/Lato-Light.ttfbin94668 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/fonts/Lato-LightItalic.ttfbin94196 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/fonts/Lato-Regular.ttfbin96184 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/fonts/Lato-RegularItalic.ttfbin95316 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/fonts/SourceCodePro-Bold.ttfbin71200 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/fonts/SourceCodePro-Regular.ttfbin71692 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/add.pngbin733 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/arrow_up.pngbin372 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/brick.pngbin452 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/brick_link.pngbin764 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/bug.pngbin774 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/bullet_black.pngbin211 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/bullet_toggle_minus.pngbin207 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/bullet_toggle_plus.pngbin209 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/date.pngbin626 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/delete.pngbin715 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/find.pngbin659 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/loadingAnimation.gifbin5886 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/macFFBgHack.pngbin207 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/package.pngbin853 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/page_green.pngbin621 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/page_white_text.pngbin342 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/page_white_width.pngbin309 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/plugin.pngbin591 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/ruby.pngbin592 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/tag_blue.pngbin1880 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/tag_green.pngbin613 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/transparent.pngbin97 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/wrench.pngbin610 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/wrench_orange.pngbin584 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/images/zoom.pngbin692 -> 0 bytes-rw-r--r--lib/rdoc/generator/template/darkfish/index.rhtml23
-rw-r--r--lib/rdoc/generator/template/darkfish/js/darkfish.js84
-rw-r--r--lib/rdoc/generator/template/darkfish/js/search.js110
-rw-r--r--lib/rdoc/generator/template/darkfish/page.rhtml18
-rw-r--r--lib/rdoc/generator/template/darkfish/servlet_not_found.rhtml18
-rw-r--r--lib/rdoc/generator/template/darkfish/servlet_root.rhtml63
-rw-r--r--lib/rdoc/generator/template/darkfish/table_of_contents.rhtml58
-rw-r--r--lib/rdoc/generator/template/json_index/.document1
-rw-r--r--lib/rdoc/generator/template/json_index/js/navigation.js105
-rw-r--r--lib/rdoc/generator/template/json_index/js/searcher.js229
-rw-r--r--lib/rdoc/generators/chm_generator.rb112
-rw-r--r--lib/rdoc/generators/html_generator.rb1442
-rw-r--r--lib/rdoc/generators/ri_generator.rb268
-rw-r--r--lib/rdoc/generators/template/chm/chm.rb87
-rw-r--r--lib/rdoc/generators/template/html/hefss.rb418
-rw-r--r--lib/rdoc/generators/template/html/html.rb647
-rw-r--r--lib/rdoc/generators/template/html/kilmer.rb416
-rw-r--r--lib/rdoc/generators/template/html/old_html.rb728
-rw-r--r--lib/rdoc/generators/template/html/one_page_html.rb122
-rw-r--r--lib/rdoc/generators/template/xml/rdf.rb112
-rw-r--r--lib/rdoc/generators/template/xml/xml.rb112
-rw-r--r--lib/rdoc/generators/xml_generator.rb130
-rw-r--r--lib/rdoc/ghost_method.rb7
-rw-r--r--lib/rdoc/i18n.rb10
-rw-r--r--lib/rdoc/i18n/locale.rb102
-rw-r--r--lib/rdoc/i18n/text.rb126
-rw-r--r--lib/rdoc/include.rb10
-rw-r--r--lib/rdoc/known_classes.rb73
-rw-r--r--lib/rdoc/markdown.rb16287
-rw-r--r--lib/rdoc/markdown/entities.rb2132
-rw-r--r--lib/rdoc/markdown/literals.rb417
-rw-r--r--lib/rdoc/markup.rb866
-rw-r--r--lib/rdoc/markup/attr_changer.rb23
-rw-r--r--lib/rdoc/markup/attr_span.rb30
-rw-r--r--lib/rdoc/markup/attribute_manager.rb344
-rw-r--r--lib/rdoc/markup/attributes.rb71
-rw-r--r--lib/rdoc/markup/blank_line.rb28
-rw-r--r--lib/rdoc/markup/block_quote.rb15
-rw-r--r--lib/rdoc/markup/document.rb165
-rw-r--r--lib/rdoc/markup/formatter.rb266
-rw-r--r--lib/rdoc/markup/hard_break.rb32
-rw-r--r--lib/rdoc/markup/heading.rb79
-rw-r--r--lib/rdoc/markup/include.rb43
-rw-r--r--lib/rdoc/markup/indented_paragraph.rb48
-rw-r--r--lib/rdoc/markup/list.rb102
-rw-r--r--lib/rdoc/markup/list_item.rb100
-rw-r--r--lib/rdoc/markup/paragraph.rb29
-rw-r--r--lib/rdoc/markup/parser.rb575
-rw-r--r--lib/rdoc/markup/pre_process.rb296
-rw-r--r--lib/rdoc/markup/raw.rb70
-rw-r--r--lib/rdoc/markup/regexp_handling.rb41
-rw-r--r--lib/rdoc/markup/rule.rb21
-rw-r--r--lib/rdoc/markup/sample/rdoc2latex.rb16
-rw-r--r--lib/rdoc/markup/sample/sample.rb42
-rw-r--r--lib/rdoc/markup/simple_markup.rb477
-rw-r--r--lib/rdoc/markup/simple_markup/fragments.rb328
-rw-r--r--lib/rdoc/markup/simple_markup/inline.rb338
-rw-r--r--lib/rdoc/markup/simple_markup/lines.rb151
-rw-r--r--lib/rdoc/markup/simple_markup/preprocess.rb70
-rw-r--r--lib/rdoc/markup/simple_markup/to_flow.rb189
-rw-r--r--lib/rdoc/markup/simple_markup/to_html.rb289
-rw-r--r--lib/rdoc/markup/simple_markup/to_latex.rb333
-rw-r--r--lib/rdoc/markup/test/AllTests.rb2
-rw-r--r--lib/rdoc/markup/test/TestInline.rb154
-rw-r--r--lib/rdoc/markup/test/TestParse.rb503
-rw-r--r--lib/rdoc/markup/to_ansi.rb94
-rw-r--r--lib/rdoc/markup/to_bs.rb77
-rw-r--r--lib/rdoc/markup/to_html.rb404
-rw-r--r--lib/rdoc/markup/to_html_crossref.rb168
-rw-r--r--lib/rdoc/markup/to_html_snippet.rb285
-rw-r--r--lib/rdoc/markup/to_joined_paragraph.rb46
-rw-r--r--lib/rdoc/markup/to_label.rb75
-rw-r--r--lib/rdoc/markup/to_markdown.rb192
-rw-r--r--lib/rdoc/markup/to_rdoc.rb334
-rw-r--r--lib/rdoc/markup/to_table_of_contents.rb88
-rw-r--r--lib/rdoc/markup/to_test.rb70
-rw-r--r--lib/rdoc/markup/to_tt_only.rb121
-rw-r--r--lib/rdoc/markup/verbatim.rb84
-rw-r--r--lib/rdoc/meta_method.rb7
-rw-r--r--lib/rdoc/method_attr.rb419
-rw-r--r--lib/rdoc/mixin.rb121
-rw-r--r--lib/rdoc/normal_class.rb93
-rw-r--r--lib/rdoc/normal_module.rb74
-rw-r--r--lib/rdoc/options.rb1652
-rw-r--r--lib/rdoc/parser.rb277
-rw-r--r--lib/rdoc/parser/c.rb1259
-rw-r--r--lib/rdoc/parser/changelog.rb204
-rw-r--r--lib/rdoc/parser/markdown.rb24
-rw-r--r--lib/rdoc/parser/rd.rb23
-rw-r--r--lib/rdoc/parser/ripper_state_lex.rb590
-rw-r--r--lib/rdoc/parser/ruby.rb2327
-rw-r--r--lib/rdoc/parser/ruby_tools.rb167
-rw-r--r--lib/rdoc/parser/simple.rb61
-rw-r--r--lib/rdoc/parser/text.rb12
-rw-r--r--lib/rdoc/parsers/parse_c.rb522
-rw-r--r--lib/rdoc/parsers/parse_f95.rb119
-rw-r--r--lib/rdoc/parsers/parse_rb.rb2592
-rw-r--r--lib/rdoc/parsers/parse_simple.rb37
-rw-r--r--lib/rdoc/parsers/parserfactory.rb99
-rw-r--r--lib/rdoc/rd.rb100
-rw-r--r--lib/rdoc/rd/block_parser.rb1056
-rw-r--r--lib/rdoc/rd/inline.rb72
-rw-r--r--lib/rdoc/rd/inline_parser.rb1208
-rw-r--r--lib/rdoc/rdoc.gemspec246
-rw-r--r--lib/rdoc/rdoc.rb720
-rw-r--r--lib/rdoc/require.rb52
-rw-r--r--lib/rdoc/ri.rb21
-rw-r--r--lib/rdoc/ri/driver.rb1568
-rw-r--r--lib/rdoc/ri/formatter.rb6
-rw-r--r--lib/rdoc/ri/paths.rb185
-rw-r--r--lib/rdoc/ri/ri_cache.rb176
-rw-r--r--lib/rdoc/ri/ri_descriptions.rb148
-rw-r--r--lib/rdoc/ri/ri_display.rb273
-rw-r--r--lib/rdoc/ri/ri_driver.rb132
-rw-r--r--lib/rdoc/ri/ri_formatter.rb599
-rw-r--r--lib/rdoc/ri/ri_options.rb246
-rw-r--r--lib/rdoc/ri/ri_paths.rb51
-rw-r--r--lib/rdoc/ri/ri_reader.rb91
-rw-r--r--lib/rdoc/ri/ri_util.rb75
-rw-r--r--lib/rdoc/ri/ri_writer.rb62
-rw-r--r--lib/rdoc/ri/store.rb7
-rw-r--r--lib/rdoc/ri/task.rb71
-rw-r--r--lib/rdoc/rubygems_hook.rb246
-rw-r--r--lib/rdoc/servlet.rb446
-rw-r--r--lib/rdoc/single_class.rb26
-rw-r--r--lib/rdoc/stats.rb462
-rw-r--r--lib/rdoc/stats/normal.rb58
-rw-r--r--lib/rdoc/stats/quiet.rb60
-rw-r--r--lib/rdoc/stats/verbose.rb46
-rw-r--r--lib/rdoc/store.rb979
-rw-r--r--lib/rdoc/task.rb329
-rw-r--r--lib/rdoc/template.rb234
-rw-r--r--lib/rdoc/text.rb304
-rw-r--r--lib/rdoc/token_stream.rb119
-rw-r--r--lib/rdoc/tokenstream.rb25
-rw-r--r--lib/rdoc/tom_doc.rb263
-rw-r--r--lib/rdoc/top_level.rb289
-rw-r--r--lib/rdoc/version.rb8
-rw-r--r--lib/readbytes.rb36
-rw-r--r--lib/readline.gemspec35
-rw-r--r--lib/readline.rb6
-rw-r--r--lib/reline.rb441
-rw-r--r--lib/reline/ansi.rb202
-rw-r--r--lib/reline/config.rb345
-rw-r--r--lib/reline/general_io.rb75
-rw-r--r--lib/reline/history.rb76
-rw-r--r--lib/reline/key_actor.rb7
-rw-r--r--lib/reline/key_actor/base.rb7
-rw-r--r--lib/reline/key_actor/emacs.rb517
-rw-r--r--lib/reline/key_actor/vi_command.rb518
-rw-r--r--lib/reline/key_actor/vi_insert.rb517
-rw-r--r--lib/reline/key_stroke.rb55
-rw-r--r--lib/reline/kill_ring.rb113
-rw-r--r--lib/reline/line_editor.rb2304
-rw-r--r--lib/reline/reline.gemspec26
-rw-r--r--lib/reline/unicode.rb595
-rw-r--r--lib/reline/unicode/east_asian_width.rb1145
-rw-r--r--lib/reline/version.rb3
-rw-r--r--lib/reline/windows.rb282
-rw-r--r--lib/resolv-replace.rb26
-rw-r--r--lib/resolv.rb2107
-rw-r--r--lib/rexml/attlistdecl.rb117
-rw-r--r--lib/rexml/attribute.rb328
-rw-r--r--lib/rexml/cdata.rb122
-rw-r--r--lib/rexml/child.rb167
-rw-r--r--lib/rexml/comment.rb136
-rw-r--r--lib/rexml/doctype.rb495
-rw-r--r--lib/rexml/document.rb437
-rw-r--r--lib/rexml/dtd/attlistdecl.rb17
-rw-r--r--lib/rexml/dtd/dtd.rb90
-rw-r--r--lib/rexml/dtd/elementdecl.rb29
-rw-r--r--lib/rexml/dtd/entitydecl.rb101
-rw-r--r--lib/rexml/dtd/notationdecl.rb67
-rw-r--r--lib/rexml/element.rb2366
-rw-r--r--lib/rexml/encoding.rb97
-rw-r--r--lib/rexml/encodings/CP-1252.rb98
-rw-r--r--lib/rexml/encodings/EUC-JP.rb37
-rw-r--r--lib/rexml/encodings/ICONV.rb16
-rw-r--r--lib/rexml/encodings/ISO-8859-1.rb25
-rw-r--r--lib/rexml/encodings/ISO-8859-15.rb69
-rw-r--r--lib/rexml/encodings/SHIFT-JIS.rb37
-rw-r--r--lib/rexml/encodings/SHIFT_JIS.rb1
-rw-r--r--lib/rexml/encodings/UNILE.rb29
-rw-r--r--lib/rexml/encodings/US-ASCII.rb25
-rw-r--r--lib/rexml/encodings/UTF-16.rb29
-rw-r--r--lib/rexml/encodings/UTF-8.rb13
-rw-r--r--lib/rexml/entity.rb304
-rw-r--r--lib/rexml/formatters/default.rb116
-rw-r--r--lib/rexml/formatters/pretty.rb142
-rw-r--r--lib/rexml/formatters/transitive.rb58
-rw-r--r--lib/rexml/functions.rb277
-rw-r--r--lib/rexml/instruction.rb127
-rw-r--r--lib/rexml/light/node.rb384
-rw-r--r--lib/rexml/namespace.rb92
-rw-r--r--lib/rexml/node.rb110
-rw-r--r--lib/rexml/output.rb32
-rw-r--r--lib/rexml/parent.rb321
-rw-r--r--lib/rexml/parseexception.rb9
-rw-r--r--lib/rexml/parsers/baseparser.rb1071
-rw-r--r--lib/rexml/parsers/lightparser.rb91
-rw-r--r--lib/rexml/parsers/pullparser.rb326
-rw-r--r--lib/rexml/parsers/sax2parser.rb460
-rw-r--r--lib/rexml/parsers/streamparser.rb86
-rw-r--r--lib/rexml/parsers/treeparser.rb25
-rw-r--r--lib/rexml/parsers/ultralightparser.rb85
-rw-r--r--lib/rexml/parsers/xpathparser.rb234
-rw-r--r--lib/rexml/quickpath.rb500
-rw-r--r--lib/rexml/rexml.gemspec84
-rw-r--r--lib/rexml/rexml.rb24
-rw-r--r--lib/rexml/sax2listener.rb188
-rw-r--r--lib/rexml/security.rb28
-rw-r--r--lib/rexml/source.rb470
-rw-r--r--lib/rexml/streamlistener.rb178
-rw-r--r--lib/rexml/text.rb714
-rw-r--r--lib/rexml/undefinednamespaceexception.rb9
-rw-r--r--lib/rexml/validation/relaxng.rb62
-rw-r--r--lib/rexml/validation/validation.rb30
-rw-r--r--lib/rexml/validation/validationexception.rb1
-rw-r--r--lib/rexml/xmldecl.rb159
-rw-r--r--lib/rexml/xmltokens.rb95
-rw-r--r--lib/rexml/xpath.rb131
-rw-r--r--lib/rexml/xpath_parser.rb1228
-rw-r--r--lib/rinda/rinda.rb245
-rw-r--r--lib/rinda/ring.rb462
-rw-r--r--lib/rinda/tuplespace.rb595
-rw-r--r--lib/rss.rb94
-rw-r--r--lib/rss/0.9.rb967
-rw-r--r--lib/rss/1.0.rb1120
-rw-r--r--lib/rss/2.0.rb281
-rw-r--r--lib/rss/atom.rb1025
-rw-r--r--lib/rss/content.rb80
-rw-r--r--lib/rss/content/1.0.rb10
-rw-r--r--lib/rss/content/2.0.rb12
-rw-r--r--lib/rss/converter.rb317
-rw-r--r--lib/rss/dublincore.rb218
-rw-r--r--lib/rss/dublincore/1.0.rb13
-rw-r--r--lib/rss/dublincore/2.0.rb13
-rw-r--r--lib/rss/dublincore/atom.rb17
-rw-r--r--lib/rss/image.rb198
-rw-r--r--lib/rss/itunes.rb425
-rw-r--r--lib/rss/maker.rb79
-rw-r--r--lib/rss/maker/0.9.rb509
-rw-r--r--lib/rss/maker/1.0.rb436
-rw-r--r--lib/rss/maker/2.0.rb224
-rw-r--r--lib/rss/maker/atom.rb173
-rw-r--r--lib/rss/maker/base.rb945
-rw-r--r--lib/rss/maker/content.rb22
-rw-r--r--lib/rss/maker/dublincore.rb122
-rw-r--r--lib/rss/maker/entry.rb164
-rw-r--r--lib/rss/maker/feed.rb427
-rw-r--r--lib/rss/maker/image.rb112
-rw-r--r--lib/rss/maker/itunes.rb243
-rw-r--r--lib/rss/maker/slash.rb34
-rw-r--r--lib/rss/maker/syndication.rb19
-rw-r--r--lib/rss/maker/taxonomy.rb119
-rw-r--r--lib/rss/maker/trackback.rb62
-rw-r--r--lib/rss/parser.rb973
-rw-r--r--lib/rss/rexmlparser.rb85
-rw-r--r--lib/rss/rss.gemspec80
-rw-r--r--lib/rss/rss.rb1957
-rw-r--r--lib/rss/slash.rb52
-rw-r--r--lib/rss/syndication.rb122
-rw-r--r--lib/rss/taxonomy.rb170
-rw-r--r--lib/rss/trackback.rb581
-rw-r--r--lib/rss/utils.rb205
-rw-r--r--lib/rss/version.rb4
-rw-r--r--lib/rss/xml-stylesheet.rb172
-rw-r--r--lib/rss/xml.rb72
-rw-r--r--lib/rss/xmlparser.rb158
-rw-r--r--lib/rss/xmlscanner.rb120
-rw-r--r--lib/rubygems.rb1447
-rw-r--r--lib/rubygems/available_set.rb166
-rw-r--r--lib/rubygems/basic_specification.rb343
-rw-r--r--lib/rubygems/bundler_version_finder.rb104
-rw-r--r--lib/rubygems/command.rb660
-rw-r--r--lib/rubygems/command_manager.rb234
-rw-r--r--lib/rubygems/commands/build_command.rb112
-rw-r--r--lib/rubygems/commands/cert_command.rb322
-rw-r--r--lib/rubygems/commands/check_command.rb94
-rw-r--r--lib/rubygems/commands/cleanup_command.rb185
-rw-r--r--lib/rubygems/commands/contents_command.rb190
-rw-r--r--lib/rubygems/commands/dependency_command.rb219
-rw-r--r--lib/rubygems/commands/environment_command.rb176
-rw-r--r--lib/rubygems/commands/fetch_command.rb77
-rw-r--r--lib/rubygems/commands/generate_index_command.rb87
-rw-r--r--lib/rubygems/commands/help_command.rb374
-rw-r--r--lib/rubygems/commands/info_command.rb35
-rw-r--r--lib/rubygems/commands/install_command.rb274
-rw-r--r--lib/rubygems/commands/list_command.rb40
-rw-r--r--lib/rubygems/commands/lock_command.rb110
-rw-r--r--lib/rubygems/commands/mirror_command.rb27
-rw-r--r--lib/rubygems/commands/open_command.rb88
-rw-r--r--lib/rubygems/commands/outdated_command.rb34
-rw-r--r--lib/rubygems/commands/owner_command.rb113
-rw-r--r--lib/rubygems/commands/pristine_command.rb184
-rw-r--r--lib/rubygems/commands/push_command.rb146
-rw-r--r--lib/rubygems/commands/query_command.rb373
-rw-r--r--lib/rubygems/commands/rdoc_command.rb97
-rw-r--r--lib/rubygems/commands/search_command.rb40
-rw-r--r--lib/rubygems/commands/server_command.rb86
-rw-r--r--lib/rubygems/commands/setup_command.rb644
-rw-r--r--lib/rubygems/commands/signin_command.rb35
-rw-r--r--lib/rubygems/commands/signout_command.rb33
-rw-r--r--lib/rubygems/commands/sources_command.rb224
-rw-r--r--lib/rubygems/commands/specification_command.rb147
-rw-r--r--lib/rubygems/commands/stale_command.rb41
-rw-r--r--lib/rubygems/commands/uninstall_command.rb199
-rw-r--r--lib/rubygems/commands/unpack_command.rb177
-rw-r--r--lib/rubygems/commands/update_command.rb284
-rw-r--r--lib/rubygems/commands/which_command.rb89
-rw-r--r--lib/rubygems/commands/yank_command.rb101
-rw-r--r--lib/rubygems/compatibility.rb40
-rw-r--r--lib/rubygems/config_file.rb492
-rw-r--r--lib/rubygems/core_ext/kernel_gem.rb75
-rw-r--r--lib/rubygems/core_ext/kernel_require.rb172
-rw-r--r--lib/rubygems/core_ext/kernel_warn.rb55
-rw-r--r--lib/rubygems/defaults.rb201
-rw-r--r--lib/rubygems/dependency.rb351
-rw-r--r--lib/rubygems/dependency_installer.rb411
-rw-r--r--lib/rubygems/dependency_list.rb244
-rw-r--r--lib/rubygems/deprecate.rb70
-rw-r--r--lib/rubygems/doctor.rb131
-rw-r--r--lib/rubygems/errors.rb194
-rw-r--r--lib/rubygems/exceptions.rb292
-rw-r--r--lib/rubygems/ext.rb18
-rw-r--r--lib/rubygems/ext/build_error.rb6
-rw-r--r--lib/rubygems/ext/builder.rb231
-rw-r--r--lib/rubygems/ext/cmake_builder.rb19
-rw-r--r--lib/rubygems/ext/configure_builder.rb23
-rw-r--r--lib/rubygems/ext/ext_conf_builder.rb97
-rw-r--r--lib/rubygems/ext/rake_builder.rb35
-rw-r--r--lib/rubygems/gem_runner.rb86
-rw-r--r--lib/rubygems/gemcutter_utilities.rb198
-rw-r--r--lib/rubygems/indexer.rb446
-rw-r--r--lib/rubygems/install_default_message.rb12
-rw-r--r--lib/rubygems/install_message.rb12
-rw-r--r--lib/rubygems/install_update_options.rb190
-rw-r--r--lib/rubygems/installer.rb962
-rw-r--r--lib/rubygems/installer_test_case.rb233
-rw-r--r--lib/rubygems/local_remote_options.rb150
-rw-r--r--lib/rubygems/mock_gem_ui.rb91
-rw-r--r--lib/rubygems/name_tuple.rb125
-rw-r--r--lib/rubygems/package.rb731
-rw-r--r--lib/rubygems/package/digest_io.rb64
-rw-r--r--lib/rubygems/package/file_source.rb33
-rw-r--r--lib/rubygems/package/io_source.rb45
-rw-r--r--lib/rubygems/package/old.rb170
-rw-r--r--lib/rubygems/package/source.rb3
-rw-r--r--lib/rubygems/package/tar_header.rb245
-rw-r--r--lib/rubygems/package/tar_reader.rb127
-rw-r--r--lib/rubygems/package/tar_reader/entry.rb170
-rw-r--r--lib/rubygems/package/tar_test_case.rb141
-rw-r--r--lib/rubygems/package/tar_writer.rb338
-rw-r--r--lib/rubygems/package_task.rb128
-rw-r--r--lib/rubygems/path_support.rb92
-rw-r--r--lib/rubygems/platform.rb206
-rw-r--r--lib/rubygems/psych_additions.rb10
-rw-r--r--lib/rubygems/psych_tree.rb34
-rw-r--r--lib/rubygems/rdoc.rb24
-rw-r--r--lib/rubygems/remote_fetcher.rb359
-rw-r--r--lib/rubygems/request.rb299
-rw-r--r--lib/rubygems/request/connection_pools.rb99
-rw-r--r--lib/rubygems/request/http_pool.rb48
-rw-r--r--lib/rubygems/request/https_pool.rb11
-rw-r--r--lib/rubygems/request_set.rb479
-rw-r--r--lib/rubygems/request_set/gem_dependency_api.rb846
-rw-r--r--lib/rubygems/request_set/lockfile.rb243
-rw-r--r--lib/rubygems/request_set/lockfile/parser.rb345
-rw-r--r--lib/rubygems/request_set/lockfile/tokenizer.rb114
-rw-r--r--lib/rubygems/requirement.rb313
-rw-r--r--lib/rubygems/resolver.rb345
-rw-r--r--lib/rubygems/resolver/activation_request.rb156
-rw-r--r--lib/rubygems/resolver/api_set.rb125
-rw-r--r--lib/rubygems/resolver/api_specification.rb90
-rw-r--r--lib/rubygems/resolver/best_set.rb78
-rw-r--r--lib/rubygems/resolver/composed_set.rb66
-rw-r--r--lib/rubygems/resolver/conflict.rb155
-rw-r--r--lib/rubygems/resolver/current_set.rb13
-rw-r--r--lib/rubygems/resolver/dependency_request.rb120
-rw-r--r--lib/rubygems/resolver/git_set.rb122
-rw-r--r--lib/rubygems/resolver/git_specification.rb58
-rw-r--r--lib/rubygems/resolver/index_set.rb80
-rw-r--r--lib/rubygems/resolver/index_specification.rb69
-rw-r--r--lib/rubygems/resolver/installed_specification.rb58
-rw-r--r--lib/rubygems/resolver/installer_set.rb227
-rw-r--r--lib/rubygems/resolver/local_specification.rb41
-rw-r--r--lib/rubygems/resolver/lock_set.rb82
-rw-r--r--lib/rubygems/resolver/lock_specification.rb87
-rw-r--r--lib/rubygems/resolver/molinillo.rb2
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo.rb10
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/delegates/resolution_state.rb50
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/delegates/specification_provider.rb80
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph.rb222
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/action.rb35
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/add_edge_no_circular.rb65
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/add_vertex.rb61
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/delete_edge.rb62
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/detach_vertex_named.rb60
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/log.rb125
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/set_payload.rb45
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/tag.rb35
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/dependency_graph/vertex.rb125
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/errors.rb75
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/gem_metadata.rb5
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/modules/specification_provider.rb100
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/modules/ui.rb65
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/resolution.rb494
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/resolver.rb45
-rw-r--r--lib/rubygems/resolver/molinillo/lib/molinillo/state.rb54
-rw-r--r--lib/rubygems/resolver/requirement_list.rb83
-rw-r--r--lib/rubygems/resolver/set.rb57
-rw-r--r--lib/rubygems/resolver/source_set.rb47
-rw-r--r--lib/rubygems/resolver/spec_specification.rb56
-rw-r--r--lib/rubygems/resolver/specification.rb115
-rw-r--r--lib/rubygems/resolver/stats.rb47
-rw-r--r--lib/rubygems/resolver/vendor_set.rb87
-rw-r--r--lib/rubygems/resolver/vendor_specification.rb24
-rw-r--r--lib/rubygems/s3_uri_signer.rb183
-rw-r--r--lib/rubygems/safe_yaml.rb59
-rw-r--r--lib/rubygems/security.rb607
-rw-r--r--lib/rubygems/security/policies.rb115
-rw-r--r--lib/rubygems/security/policy.rb295
-rw-r--r--lib/rubygems/security/signer.rb206
-rw-r--r--lib/rubygems/security/trust_dir.rb119
-rw-r--r--lib/rubygems/security_option.rb42
-rw-r--r--lib/rubygems/server.rb879
-rw-r--r--lib/rubygems/source.rb235
-rw-r--r--lib/rubygems/source/git.rb241
-rw-r--r--lib/rubygems/source/installed.rb40
-rw-r--r--lib/rubygems/source/local.rb133
-rw-r--r--lib/rubygems/source/lock.rb52
-rw-r--r--lib/rubygems/source/specific_file.rb73
-rw-r--r--lib/rubygems/source/vendor.rb27
-rw-r--r--lib/rubygems/source_list.rb153
-rw-r--r--lib/rubygems/source_local.rb7
-rw-r--r--lib/rubygems/source_specific_file.rb6
-rw-r--r--lib/rubygems/spec_fetcher.rb260
-rw-r--r--lib/rubygems/specification.rb2688
-rw-r--r--lib/rubygems/specification_policy.rb435
-rw-r--r--lib/rubygems/ssl_certs/.document1
-rw-r--r--lib/rubygems/ssl_certs/index.rubygems.org/GlobalSignRootCA.pem21
-rw-r--r--lib/rubygems/ssl_certs/rubygems.global.ssl.fastly.net/DigiCertHighAssuranceEVRootCA.pem23
-rw-r--r--lib/rubygems/ssl_certs/rubygems.org/AddTrustExternalCARoot.pem25
-rw-r--r--lib/rubygems/ssl_certs/rubygems.org/GlobalSignRootCA.pem21
-rw-r--r--lib/rubygems/ssl_certs/rubygems.org/GlobalSignRootCA_R3.pem21
-rw-r--r--lib/rubygems/stub_specification.rb216
-rw-r--r--lib/rubygems/syck_hack.rb79
-rw-r--r--lib/rubygems/test_case.rb1554
-rw-r--r--lib/rubygems/test_utilities.rb380
-rw-r--r--lib/rubygems/text.rb85
-rw-r--r--lib/rubygems/uninstaller.rb357
-rw-r--r--lib/rubygems/uri_formatter.rb48
-rw-r--r--lib/rubygems/uri_parser.rb36
-rw-r--r--lib/rubygems/uri_parsing.rb23
-rw-r--r--lib/rubygems/user_interaction.rb665
-rw-r--r--lib/rubygems/util.rb113
-rw-r--r--lib/rubygems/util/licenses.rb439
-rw-r--r--lib/rubygems/util/list.rb39
-rw-r--r--lib/rubygems/validator.rb145
-rw-r--r--lib/rubygems/version.rb408
-rw-r--r--lib/rubygems/version_option.rb76
-rw-r--r--lib/rubyunit.rb6
-rw-r--r--lib/runit/assert.rb73
-rw-r--r--lib/runit/cui/testrunner.rb51
-rw-r--r--lib/runit/error.rb9
-rw-r--r--lib/runit/testcase.rb45
-rw-r--r--lib/runit/testresult.rb44
-rw-r--r--lib/runit/testsuite.rb26
-rw-r--r--lib/runit/topublic.rb8
-rw-r--r--lib/scanf.rb702
-rw-r--r--lib/securerandom.rb333
-rw-r--r--lib/set.rb1404
-rw-r--r--lib/shell.rb269
-rw-r--r--lib/shell/builtin-command.rb154
-rw-r--r--lib/shell/command-processor.rb592
-rw-r--r--lib/shell/error.rb26
-rw-r--r--lib/shell/filter.rb110
-rw-r--r--lib/shell/process-controller.rb258
-rw-r--r--lib/shell/system-command.rb168
-rw-r--r--lib/shell/version.rb16
-rw-r--r--lib/shellwords.rb251
-rw-r--r--lib/singleton.rb425
-rw-r--r--lib/singleton/singleton.gemspec27
-rw-r--r--lib/singleton/version.rb3
-rw-r--r--lib/soap/attachment.rb107
-rw-r--r--lib/soap/baseData.rb815
-rw-r--r--lib/soap/element.rb251
-rw-r--r--lib/soap/encodingstyle/aspDotNetHandler.rb220
-rw-r--r--lib/soap/encodingstyle/handler.rb100
-rw-r--r--lib/soap/encodingstyle/literalHandler.rb227
-rw-r--r--lib/soap/encodingstyle/soapHandler.rb589
-rw-r--r--lib/soap/generator.rb210
-rw-r--r--lib/soap/header/handler.rb57
-rw-r--r--lib/soap/header/handlerset.rb58
-rw-r--r--lib/soap/header/simplehandler.rb44
-rw-r--r--lib/soap/mapping.rb10
-rw-r--r--lib/soap/mapping/factory.rb388
-rw-r--r--lib/soap/mapping/mapping.rb218
-rw-r--r--lib/soap/mapping/registry.rb479
-rw-r--r--lib/soap/mapping/rubytypeFactory.rb452
-rw-r--r--lib/soap/mapping/typeMap.rb41
-rw-r--r--lib/soap/mapping/wsdlRegistry.rb155
-rw-r--r--lib/soap/marshal.rb58
-rw-r--r--lib/soap/mimemessage.rb238
-rw-r--r--lib/soap/netHttpClient.rb174
-rw-r--r--lib/soap/parser.rb252
-rw-r--r--lib/soap/processor.rb66
-rw-r--r--lib/soap/property.rb328
-rw-r--r--lib/soap/rpc/cgistub.rb206
-rw-r--r--lib/soap/rpc/driver.rb300
-rw-r--r--lib/soap/rpc/element.rb270
-rw-r--r--lib/soap/rpc/httpserver.rb105
-rw-r--r--lib/soap/rpc/proxy.rb171
-rw-r--r--lib/soap/rpc/router.rb235
-rw-r--r--lib/soap/rpc/rpc.rb25
-rw-r--r--lib/soap/rpc/soaplet.rb200
-rw-r--r--lib/soap/rpc/standaloneServer.rb43
-rw-r--r--lib/soap/soap.rb115
-rw-r--r--lib/soap/streamHandler.rb267
-rw-r--r--lib/soap/wsdlDriver.rb598
-rw-r--r--lib/sync.rb311
-rw-r--r--lib/tempfile.rb409
-rw-r--r--lib/test/unit.rb283
-rw-r--r--lib/test/unit/assertionfailederror.rb12
-rw-r--r--lib/test/unit/assertions.rb472
-rw-r--r--lib/test/unit/autorunner.rb189
-rw-r--r--lib/test/unit/collector.rb43
-rw-r--r--lib/test/unit/collector/dir.rb86
-rw-r--r--lib/test/unit/collector/objectspace.rb34
-rw-r--r--lib/test/unit/error.rb54
-rw-r--r--lib/test/unit/failure.rb49
-rw-r--r--lib/test/unit/testcase.rb150
-rw-r--r--lib/test/unit/testresult.rb79
-rw-r--r--lib/test/unit/testsuite.rb74
-rw-r--r--lib/test/unit/ui/console/testrunner.rb125
-rw-r--r--lib/test/unit/ui/fox/testrunner.rb266
-rw-r--r--lib/test/unit/ui/gtk/testrunner.rb414
-rw-r--r--lib/test/unit/ui/gtk2/testrunner.rb463
-rw-r--r--lib/test/unit/ui/testrunnermediator.rb66
-rw-r--r--lib/test/unit/ui/testrunnerutilities.rb44
-rw-r--r--lib/test/unit/ui/tk/testrunner.rb258
-rw-r--r--lib/test/unit/util/backtracefilter.rb40
-rw-r--r--lib/test/unit/util/observable.rb88
-rw-r--r--lib/test/unit/util/procwrapper.rb46
-rw-r--r--lib/thread.rb420
-rw-r--r--lib/thwait.rb166
-rw-r--r--lib/time.rb931
-rw-r--r--lib/timeout.rb168
-rw-r--r--lib/timeout/timeout.gemspec27
-rw-r--r--lib/timeout/version.rb3
-rw-r--r--lib/tmpdir.rb147
-rw-r--r--lib/tracer.rb267
-rw-r--r--lib/tracer/tracer.gemspec23
-rw-r--r--lib/tracer/version.rb5
-rw-r--r--lib/tsort.rb433
-rw-r--r--lib/un.rb307
-rw-r--r--lib/unicode_normalize/normalize.rb175
-rw-r--r--lib/unicode_normalize/tables.rb9039
-rw-r--r--lib/uri.rb93
-rw-r--r--lib/uri/common.rb895
-rw-r--r--lib/uri/file.rb94
-rw-r--r--lib/uri/ftp.rb187
-rw-r--r--lib/uri/generic.rb1203
-rw-r--r--lib/uri/http.rb77
-rw-r--r--lib/uri/https.rb11
-rw-r--r--lib/uri/ldap.rb92
-rw-r--r--lib/uri/ldaps.rb21
-rw-r--r--lib/uri/mailto.rb223
-rw-r--r--lib/uri/rfc2396_parser.rb546
-rw-r--r--lib/uri/rfc3986_parser.rb125
-rw-r--r--lib/uri/uri.gemspec29
-rw-r--r--lib/uri/version.rb6
-rw-r--r--lib/weakref.rb109
-rw-r--r--lib/webrick.rb204
-rw-r--r--lib/webrick/.document6
-rw-r--r--lib/webrick/accesslog.rb107
-rw-r--r--lib/webrick/cgi.rb159
-rw-r--r--lib/webrick/compat.rb21
-rw-r--r--lib/webrick/config.rb95
-rw-r--r--lib/webrick/cookie.rb106
-rw-r--r--lib/webrick/htmlutils.rb11
-rw-r--r--lib/webrick/httpauth.rb70
-rw-r--r--lib/webrick/httpauth/authenticator.rb70
-rw-r--r--lib/webrick/httpauth/basicauth.rb64
-rw-r--r--lib/webrick/httpauth/digestauth.rb141
-rw-r--r--lib/webrick/httpauth/htdigest.rb59
-rw-r--r--lib/webrick/httpauth/htgroup.rb48
-rw-r--r--lib/webrick/httpauth/htpasswd.rb105
-rw-r--r--lib/webrick/httpauth/userdb.rb32
-rw-r--r--lib/webrick/httpproxy.rb347
-rw-r--r--lib/webrick/httprequest.rb406
-rw-r--r--lib/webrick/httpresponse.rb418
-rw-r--r--lib/webrick/https.rb97
-rw-r--r--lib/webrick/httpserver.rb156
-rw-r--r--lib/webrick/httpservlet.rb11
-rw-r--r--lib/webrick/httpservlet/abstract.rb103
-rw-r--r--lib/webrick/httpservlet/cgi_runner.rb14
-rw-r--r--lib/webrick/httpservlet/cgihandler.rb89
-rw-r--r--lib/webrick/httpservlet/erbhandler.rb55
-rw-r--r--lib/webrick/httpservlet/filehandler.rb383
-rw-r--r--lib/webrick/httpservlet/prochandler.rb24
-rw-r--r--lib/webrick/httpstatus.rb182
-rw-r--r--lib/webrick/httputils.rb237
-rw-r--r--lib/webrick/httpversion.rb31
-rw-r--r--lib/webrick/log.rb84
-rw-r--r--lib/webrick/server.rb315
-rw-r--r--lib/webrick/ssl.rb123
-rw-r--r--lib/webrick/utils.rb252
-rw-r--r--lib/webrick/version.rb9
-rw-r--r--lib/webrick/webrick.gemspec76
-rw-r--r--lib/wsdl/binding.rb65
-rw-r--r--lib/wsdl/data.rb64
-rw-r--r--lib/wsdl/definitions.rb240
-rw-r--r--lib/wsdl/documentation.rb32
-rw-r--r--lib/wsdl/import.rb70
-rw-r--r--lib/wsdl/importer.rb73
-rw-r--r--lib/wsdl/info.rb33
-rw-r--r--lib/wsdl/message.rb54
-rw-r--r--lib/wsdl/operation.rb129
-rw-r--r--lib/wsdl/operationBinding.rb80
-rw-r--r--lib/wsdl/param.rb74
-rw-r--r--lib/wsdl/parser.rb160
-rw-r--r--lib/wsdl/part.rb52
-rw-r--r--lib/wsdl/port.rb84
-rw-r--r--lib/wsdl/portType.rb72
-rw-r--r--lib/wsdl/service.rb61
-rw-r--r--lib/wsdl/soap/address.rb40
-rw-r--r--lib/wsdl/soap/binding.rb48
-rw-r--r--lib/wsdl/soap/body.rb52
-rw-r--r--lib/wsdl/soap/cgiStubCreator.rb73
-rw-r--r--lib/wsdl/soap/classDefCreator.rb112
-rw-r--r--lib/wsdl/soap/classDefCreatorSupport.rb106
-rw-r--r--lib/wsdl/soap/clientSkeltonCreator.rb78
-rw-r--r--lib/wsdl/soap/complexType.rb107
-rw-r--r--lib/wsdl/soap/data.rb41
-rw-r--r--lib/wsdl/soap/definitions.rb152
-rw-r--r--lib/wsdl/soap/driverCreator.rb84
-rw-r--r--lib/wsdl/soap/fault.rb52
-rw-r--r--lib/wsdl/soap/header.rb79
-rw-r--r--lib/wsdl/soap/headerfault.rb56
-rw-r--r--lib/wsdl/soap/mappingRegistryCreator.rb90
-rw-r--r--lib/wsdl/soap/methodDefCreator.rb148
-rw-r--r--lib/wsdl/soap/operation.rb123
-rw-r--r--lib/wsdl/soap/servantSkeltonCreator.rb65
-rw-r--r--lib/wsdl/soap/standaloneServerStubCreator.rb79
-rw-r--r--lib/wsdl/types.rb43
-rw-r--r--lib/wsdl/wsdl.rb23
-rw-r--r--lib/wsdl/xmlSchema/all.rb65
-rw-r--r--lib/wsdl/xmlSchema/any.rb56
-rw-r--r--lib/wsdl/xmlSchema/attribute.rb74
-rw-r--r--lib/wsdl/xmlSchema/choice.rb65
-rw-r--r--lib/wsdl/xmlSchema/complexContent.rb83
-rw-r--r--lib/wsdl/xmlSchema/complexType.rb133
-rw-r--r--lib/wsdl/xmlSchema/content.rb96
-rw-r--r--lib/wsdl/xmlSchema/data.rb68
-rw-r--r--lib/wsdl/xmlSchema/element.rb104
-rw-r--r--lib/wsdl/xmlSchema/enumeration.rb36
-rw-r--r--lib/wsdl/xmlSchema/import.rb44
-rw-r--r--lib/wsdl/xmlSchema/parser.rb162
-rw-r--r--lib/wsdl/xmlSchema/schema.rb106
-rw-r--r--lib/wsdl/xmlSchema/sequence.rb65
-rw-r--r--lib/wsdl/xmlSchema/simpleRestriction.rb48
-rw-r--r--lib/wsdl/xmlSchema/simpleType.rb81
-rw-r--r--lib/wsdl/xmlSchema/unique.rb34
-rw-r--r--lib/xmlrpc/README.txt31
-rw-r--r--lib/xmlrpc/base64.rb81
-rw-r--r--lib/xmlrpc/client.rb605
-rw-r--r--lib/xmlrpc/config.rb40
-rw-r--r--lib/xmlrpc/create.rb280
-rw-r--r--lib/xmlrpc/datetime.rb138
-rw-r--r--lib/xmlrpc/httpserver.rb178
-rw-r--r--lib/xmlrpc/marshal.rb76
-rw-r--r--lib/xmlrpc/parser.rb808
-rw-r--r--lib/xmlrpc/server.rb833
-rw-r--r--lib/xmlrpc/utils.rb172
-rw-r--r--lib/xsd/charset.rb167
-rw-r--r--lib/xsd/codegen.rb12
-rw-r--r--lib/xsd/codegen/classdef.rb203
-rw-r--r--lib/xsd/codegen/commentdef.rb34
-rw-r--r--lib/xsd/codegen/gensupport.rb112
-rw-r--r--lib/xsd/codegen/methoddef.rb63
-rw-r--r--lib/xsd/codegen/moduledef.rb191
-rw-r--r--lib/xsd/datatypes.rb1116
-rw-r--r--lib/xsd/datatypes1999.rb20
-rw-r--r--lib/xsd/iconvcharset.rb33
-rw-r--r--lib/xsd/namedelements.rb79
-rw-r--r--lib/xsd/ns.rb130
-rw-r--r--lib/xsd/qname.rb71
-rw-r--r--lib/xsd/xmlparser.rb61
-rw-r--r--lib/xsd/xmlparser/parser.rb96
-rw-r--r--lib/xsd/xmlparser/rexmlparser.rb54
-rw-r--r--lib/xsd/xmlparser/xmlparser.rb50
-rw-r--r--lib/xsd/xmlparser/xmlscanner.rb147
-rw-r--r--lib/yaml.rb406
-rw-r--r--lib/yaml/baseemitter.rb249
-rw-r--r--lib/yaml/basenode.rb216
-rw-r--r--lib/yaml/constants.rb45
-rw-r--r--lib/yaml/dbm.rb201
-rw-r--r--lib/yaml/emitter.rb107
-rw-r--r--lib/yaml/encoding.rb29
-rw-r--r--lib/yaml/error.rb33
-rw-r--r--lib/yaml/loader.rb14
-rw-r--r--lib/yaml/rubytypes.rb624
-rw-r--r--lib/yaml/store.rb73
-rw-r--r--lib/yaml/stream.rb44
-rw-r--r--lib/yaml/stringio.rb83
-rw-r--r--lib/yaml/syck.rb27
-rw-r--r--lib/yaml/types.rb196
-rw-r--r--lib/yaml/yaml.gemspec23
-rw-r--r--lib/yaml/yamlnode.rb54
-rw-r--r--lib/yaml/ypath.rb52
-rwxr-xr-xlibexec/bundle47
-rwxr-xr-xlibexec/bundler4
-rwxr-xr-xlibexec/irb11
-rwxr-xr-xlibexec/racc306
-rwxr-xr-xlibexec/racc2y195
-rwxr-xr-xlibexec/rdoc44
-rwxr-xr-xlibexec/ri12
-rwxr-xr-xlibexec/y2racc339
-rw-r--r--load.c1331
-rw-r--r--loadpath.c91
-rw-r--r--localeinit.c137
-rw-r--r--main.c60
-rw-r--r--man/bundle-add.166
-rw-r--r--man/bundle-add.1.txt58
-rw-r--r--man/bundle-add.ronn46
-rw-r--r--man/bundle-binstubs.140
-rw-r--r--man/bundle-binstubs.1.txt48
-rw-r--r--man/bundle-binstubs.ronn43
-rw-r--r--man/bundle-cache.155
-rw-r--r--man/bundle-cache.1.txt78
-rw-r--r--man/bundle-cache.ronn72
-rw-r--r--man/bundle-check.131
-rw-r--r--man/bundle-check.1.txt33
-rw-r--r--man/bundle-check.ronn26
-rw-r--r--man/bundle-clean.124
-rw-r--r--man/bundle-clean.1.txt26
-rw-r--r--man/bundle-clean.ronn18
-rw-r--r--man/bundle-config.1497
-rw-r--r--man/bundle-config.1.txt528
-rw-r--r--man/bundle-config.ronn399
-rw-r--r--man/bundle-doctor.144
-rw-r--r--man/bundle-doctor.1.txt44
-rw-r--r--man/bundle-doctor.ronn33
-rw-r--r--man/bundle-exec.1165
-rw-r--r--man/bundle-exec.1.txt178
-rw-r--r--man/bundle-exec.ronn152
-rw-r--r--man/bundle-gem.180
-rw-r--r--man/bundle-gem.1.txt91
-rw-r--r--man/bundle-gem.ronn78
-rw-r--r--man/bundle-info.120
-rw-r--r--man/bundle-info.1.txt21
-rw-r--r--man/bundle-info.ronn17
-rw-r--r--man/bundle-init.125
-rw-r--r--man/bundle-init.1.txt34
-rw-r--r--man/bundle-init.ronn29
-rw-r--r--man/bundle-inject.133
-rw-r--r--man/bundle-inject.1.txt32
-rw-r--r--man/bundle-inject.ronn22
-rw-r--r--man/bundle-install.1311
-rw-r--r--man/bundle-install.1.txt401
-rw-r--r--man/bundle-install.ronn383
-rw-r--r--man/bundle-list.150
-rw-r--r--man/bundle-list.1.txt43
-rw-r--r--man/bundle-list.ronn33
-rw-r--r--man/bundle-lock.184
-rw-r--r--man/bundle-lock.1.txt93
-rw-r--r--man/bundle-lock.ronn94
-rw-r--r--man/bundle-open.132
-rw-r--r--man/bundle-open.1.txt29
-rw-r--r--man/bundle-open.ronn19
-rw-r--r--man/bundle-outdated.1155
-rw-r--r--man/bundle-outdated.1.txt131
-rw-r--r--man/bundle-outdated.ronn111
-rw-r--r--man/bundle-package.155
-rw-r--r--man/bundle-package.1.txt79
-rw-r--r--man/bundle-package.ronn72
-rw-r--r--man/bundle-platform.161
-rw-r--r--man/bundle-platform.1.txt57
-rw-r--r--man/bundle-platform.ronn42
-rw-r--r--man/bundle-pristine.134
-rw-r--r--man/bundle-pristine.1.txt44
-rw-r--r--man/bundle-pristine.ronn34
-rw-r--r--man/bundle-remove.131
-rw-r--r--man/bundle-remove.1.txt34
-rw-r--r--man/bundle-remove.ronn23
-rw-r--r--man/bundle-show.123
-rw-r--r--man/bundle-show.1.txt27
-rw-r--r--man/bundle-show.ronn21
-rw-r--r--man/bundle-update.1394
-rw-r--r--man/bundle-update.1.txt390
-rw-r--r--man/bundle-update.ronn350
-rw-r--r--man/bundle-viz.139
-rw-r--r--man/bundle-viz.1.txt39
-rw-r--r--man/bundle-viz.ronn30
-rw-r--r--man/bundle.1136
-rw-r--r--man/bundle.1.txt116
-rw-r--r--man/bundle.ronn111
-rw-r--r--man/erb.1160
-rw-r--r--man/gemfile.5686
-rw-r--r--man/gemfile.5.ronn517
-rw-r--r--man/gemfile.5.txt649
-rw-r--r--man/goruby.139
-rw-r--r--man/index.txt25
-rw-r--r--man/irb.1207
-rw-r--r--man/ri.1247
-rw-r--r--man/ruby.1664
-rw-r--r--marshal.c2133
-rw-r--r--math.c969
-rwxr-xr-xmdoc2man.rb465
-rw-r--r--method.h230
-rw-r--r--mini_builtin.c83
-rw-r--r--miniinit.c51
-rw-r--r--misc/README11
-rwxr-xr-xmisc/expand_tabs.rb169
-rw-r--r--misc/inf-ruby.el405
-rwxr-xr-xmisc/lldb_cruby.py279
-rw-r--r--misc/rb_optparse.bash20
-rwxr-xr-xmisc/rb_optparse.zsh38
-rw-r--r--misc/ruby-mode.el1206
-rw-r--r--misc/ruby-style.el94
-rw-r--r--misc/rubydb2x.el104
-rw-r--r--misc/rubydb3x.el115
-rw-r--r--misc/test_lldb_cruby.rb40
-rw-r--r--missing.h139
-rw-r--r--missing/acosh.c19
-rw-r--r--missing/alloca.c13
-rw-r--r--missing/cbrt.c11
-rw-r--r--missing/close.c72
-rw-r--r--missing/crt_externs.h8
-rw-r--r--missing/crypt.c1159
-rw-r--r--missing/crypt.h248
-rw-r--r--missing/des_tables.c1616
-rw-r--r--missing/dtoa.c3417
-rw-r--r--missing/dup2.c5
-rw-r--r--missing/erf.c16
-rw-r--r--missing/explicit_bzero.c94
-rw-r--r--missing/ffs.c49
-rw-r--r--missing/file.h2
-rw-r--r--missing/fileblocks.c1
-rw-r--r--missing/finite.c5
-rw-r--r--missing/flock.c28
-rw-r--r--missing/hypot.c4
-rw-r--r--missing/isinf.c25
-rw-r--r--missing/isnan.c25
-rw-r--r--missing/langinfo.c148
-rw-r--r--missing/lgamma_r.c80
-rw-r--r--missing/memcmp.c13
-rw-r--r--missing/memmove.c18
-rw-r--r--missing/mkdir.c104
-rw-r--r--missing/mt19937.c158
-rw-r--r--missing/nan.c28
-rw-r--r--missing/nextafter.c77
-rw-r--r--missing/os2.c113
-rw-r--r--missing/procstat_vm.c85
-rw-r--r--missing/setproctitle.c175
-rw-r--r--missing/signbit.c19
-rw-r--r--missing/stdbool.h20
-rw-r--r--missing/strcasecmp.c16
-rw-r--r--missing/strchr.c22
-rw-r--r--missing/strerror.c7
-rw-r--r--missing/strftime.c907
-rw-r--r--missing/strlcat.c56
-rw-r--r--missing/strlcpy.c51
-rw-r--r--missing/strncasecmp.c21
-rw-r--r--missing/strstr.c15
-rw-r--r--missing/strtod.c271
-rw-r--r--missing/strtol.c29
-rw-r--r--missing/strtoul.c184
-rw-r--r--missing/tgamma.c97
-rw-r--r--missing/vsnprintf.c1134
-rw-r--r--missing/x68.c40
-rw-r--r--missing/x86_64-chkstk.S10
-rw-r--r--mjit.c1046
-rw-r--r--mjit.h177
-rw-r--r--mjit_compile.c478
-rw-r--r--mjit_worker.c1259
-rw-r--r--mkconfig.rb142
-rw-r--r--node.c1399
-rw-r--r--node.h473
-rw-r--r--numeric.c5881
-rw-r--r--object.c4872
-rw-r--r--pack.c2026
-rw-r--r--pack.rb283
-rw-r--r--parse.y14463
-rw-r--r--prec.c141
-rw-r--r--prelude.rb37
-rw-r--r--probes.d234
-rw-r--r--probes_helper.h42
-rw-r--r--proc.c4081
-rw-r--r--process.c8395
-rw-r--r--random.c1705
-rw-r--r--range.c1889
-rw-r--r--rational.c2814
-rw-r--r--re.c4248
-rw-r--r--re.h42
-rw-r--r--regcomp.c6746
-rw-r--r--regenc.c1012
-rw-r--r--regenc.h254
-rw-r--r--regerror.c387
-rw-r--r--regex.c4643
-rw-r--r--regex.h221
-rw-r--r--regexec.c4621
-rw-r--r--regint.h938
-rw-r--r--regparse.c6643
-rw-r--r--regparse.h370
-rw-r--r--regsyntax.c388
-rw-r--r--ruby-runner.c98
-rw-r--r--ruby.1350
-rw-r--r--ruby.c2738
-rw-r--r--ruby.h702
-rw-r--r--ruby_assert.h15
-rw-r--r--ruby_atomic.h244
-rw-r--r--rubyio.h77
-rw-r--r--rubysig.h101
-rw-r--r--rubystub.c60
-rw-r--r--rubytest.rb46
-rw-r--r--safe.c145
-rw-r--r--sample/README17
-rw-r--r--sample/benchmark.rb19
-rw-r--r--sample/biorhythm.rb143
-rw-r--r--sample/cal.rb86
-rw-r--r--sample/cbreak.rb12
-rw-r--r--sample/cgi-session-pstore.rb11
-rw-r--r--sample/coverage.rb62
-rw-r--r--sample/dbmtest.rb14
-rw-r--r--sample/delegate.rb31
-rw-r--r--sample/dir.rb2
-rw-r--r--sample/drb/README.ja.rdoc59
-rw-r--r--sample/drb/README.rd56
-rw-r--r--sample/drb/README.rd.ja59
-rw-r--r--sample/drb/README.rdoc56
-rw-r--r--sample/drb/acl.rb15
-rw-r--r--sample/drb/darray.rb2
-rw-r--r--sample/drb/darrayc.rb16
-rw-r--r--sample/drb/dbiff.rb24
-rw-r--r--sample/drb/dchatc.rb4
-rw-r--r--sample/drb/dchats.rb23
-rw-r--r--sample/drb/dhasen.rb7
-rw-r--r--sample/drb/dhasenc.rb7
-rw-r--r--sample/drb/dlogc.rb2
-rw-r--r--sample/drb/dlogd.rb9
-rw-r--r--sample/drb/dqin.rb2
-rw-r--r--sample/drb/dqout.rb2
-rw-r--r--sample/drb/dqueue.rb5
-rw-r--r--sample/drb/drbc.rb2
-rw-r--r--sample/drb/drbch.rb2
-rw-r--r--sample/drb/drbm.rb6
-rw-r--r--sample/drb/drbmc.rb2
-rw-r--r--sample/drb/drbs-acl.rb6
-rw-r--r--sample/drb/drbs.rb4
-rw-r--r--sample/drb/extserv_test.rb12
-rw-r--r--sample/drb/gw_cu.rb2
-rw-r--r--sample/drb/holderc.rb2
-rw-r--r--sample/drb/holders.rb6
-rw-r--r--sample/drb/http0.rb64
-rw-r--r--sample/drb/http0serv.rb125
-rw-r--r--sample/drb/name.rb21
-rw-r--r--sample/drb/namec.rb2
-rw-r--r--sample/drb/old_tuplespace.rb84
-rw-r--r--sample/drb/ring_echo.rb3
-rw-r--r--sample/drb/ring_place.rb6
-rw-r--r--sample/drb/simpletuple.rb16
-rw-r--r--sample/drb/speedc.rb2
-rw-r--r--sample/drb/speeds.rb4
-rw-r--r--sample/dualstack-fetch.rb2
-rw-r--r--sample/dualstack-httpd.rb37
-rw-r--r--sample/eval.rb2
-rw-r--r--sample/export.rb2
-rw-r--r--sample/exyacc.rb34
-rw-r--r--sample/fact.rb4
-rw-r--r--sample/fib.awk8
-rw-r--r--sample/fib.pl4
-rw-r--r--sample/fib.py2
-rw-r--r--sample/fib.scm4
-rw-r--r--sample/freq.rb12
-rw-r--r--sample/from.rb161
-rw-r--r--sample/fullpath.rb2
-rw-r--r--sample/getopts.test36
-rw-r--r--sample/goodfriday.rb48
-rw-r--r--sample/iseq_loader.rb243
-rw-r--r--sample/list.rb3
-rw-r--r--sample/list2.rb2
-rw-r--r--sample/list3.rb4
-rw-r--r--sample/logger/app.rb2
-rw-r--r--[-rwxr-xr-x]sample/mine.rb39
-rw-r--r--sample/mkproto.rb24
-rw-r--r--sample/mrshtest.rb13
-rw-r--r--sample/net-imap.rb167
-rw-r--r--sample/observ.rb11
-rw-r--r--sample/occur.pl8
-rw-r--r--sample/occur.rb6
-rw-r--r--sample/occur2.rb16
-rw-r--r--sample/open3.rb12
-rw-r--r--sample/openssl/c_rehash.rb42
-rw-r--r--sample/openssl/cert_store_view.rb911
-rw-r--r--sample/openssl/certstore.rb54
-rw-r--r--sample/openssl/cipher.rb69
-rw-r--r--sample/openssl/crlstore.rb32
-rw-r--r--sample/openssl/echo_cli.rb21
-rw-r--r--sample/openssl/echo_svr.rb15
-rw-r--r--sample/openssl/gen_csr.rb13
-rw-r--r--sample/openssl/smime_read.rb10
-rw-r--r--sample/openssl/smime_write.rb12
-rw-r--r--sample/openssl/wget.rb17
-rw-r--r--[-rwxr-xr-x]sample/optparse/opttest.rb76
-rwxr-xr-xsample/optparse/subcommand.rb19
-rw-r--r--sample/philos.rb5
-rw-r--r--sample/pstore.rb19
-rw-r--r--sample/pty/expect_sample.rb58
-rw-r--r--sample/pty/script.rb37
-rw-r--r--sample/pty/shl.rb93
-rw-r--r--sample/rcs.awk54
-rw-r--r--sample/rdoc/markup/rdoc2latex.rb15
-rw-r--r--sample/rdoc/markup/sample.rb40
-rw-r--r--sample/regx.rb23
-rw-r--r--sample/rinda-ring.rb22
-rw-r--r--sample/ripper/ruby2html.rb116
-rw-r--r--sample/ripper/strip-comment.rb19
-rwxr-xr-xsample/rss/blend.rb79
-rwxr-xr-xsample/rss/convert.rb69
-rw-r--r--[-rwxr-xr-x]sample/rss/list_description.rb127
-rwxr-xr-xsample/rss/re_read.rb64
-rw-r--r--[-rwxr-xr-x]sample/rss/rss_recent.rb122
-rw-r--r--sample/rss/tdiary_plugin/rss-recent.rb213
-rw-r--r--sample/simple-bench.rb140
-rw-r--r--sample/soap/authheader/authmgr.rb41
-rw-r--r--sample/soap/authheader/client.rb40
-rw-r--r--sample/soap/authheader/client2.rb39
-rw-r--r--sample/soap/authheader/server.rb72
-rw-r--r--sample/soap/authheader/server2.rb77
-rw-r--r--sample/soap/babelfish.rb16
-rw-r--r--sample/soap/calc/calc.rb17
-rw-r--r--sample/soap/calc/calc2.rb29
-rw-r--r--sample/soap/calc/client.rb26
-rw-r--r--sample/soap/calc/client2.rb29
-rw-r--r--sample/soap/calc/httpd.rb20
-rw-r--r--sample/soap/calc/samplehttpd.conf2
-rw-r--r--sample/soap/calc/server.cgi15
-rw-r--r--sample/soap/calc/server.rb17
-rw-r--r--sample/soap/calc/server2.rb20
-rw-r--r--sample/soap/digraph.rb43
-rw-r--r--sample/soap/exchange/client.rb19
-rw-r--r--sample/soap/exchange/exchange.rb17
-rw-r--r--sample/soap/exchange/httpd.rb20
-rw-r--r--sample/soap/exchange/samplehttpd.conf2
-rw-r--r--sample/soap/exchange/server.cgi14
-rw-r--r--sample/soap/exchange/server.rb16
-rw-r--r--sample/soap/helloworld/hw_c.rb6
-rw-r--r--sample/soap/helloworld/hw_s.rb17
-rw-r--r--sample/soap/icd/IICD.rb17
-rw-r--r--sample/soap/icd/icd.rb46
-rw-r--r--sample/soap/raa/iRAA.rb154
-rw-r--r--sample/soap/raa/soap4r.rb30
-rw-r--r--sample/soap/raa2.4/raa.rb332
-rw-r--r--sample/soap/raa2.4/raaDriver.rb255
-rw-r--r--sample/soap/raa2.4/raaServiceClient.rb354
-rw-r--r--sample/soap/raa2.4/sample.rb115
-rw-r--r--sample/soap/sampleStruct/client.rb16
-rw-r--r--sample/soap/sampleStruct/httpd.rb20
-rw-r--r--sample/soap/sampleStruct/iSampleStruct.rb22
-rw-r--r--sample/soap/sampleStruct/sampleStruct.rb13
-rw-r--r--sample/soap/sampleStruct/samplehttpd.conf2
-rw-r--r--sample/soap/sampleStruct/server.cgi14
-rw-r--r--sample/soap/sampleStruct/server.rb20
-rw-r--r--sample/soap/ssl/files/README1
-rw-r--r--sample/soap/ssl/files/ca.cert23
-rw-r--r--sample/soap/ssl/files/client.cert19
-rw-r--r--sample/soap/ssl/files/client.key15
-rw-r--r--sample/soap/ssl/files/server.cert19
-rw-r--r--sample/soap/ssl/files/server.key15
-rw-r--r--sample/soap/ssl/files/sslclient.properties5
-rw-r--r--sample/soap/ssl/files/sslclient_require_noserverauth.properties2
-rw-r--r--sample/soap/ssl/files/sslclient_with_clientauth.properties9
-rw-r--r--sample/soap/ssl/files/subca.cert21
-rw-r--r--sample/soap/ssl/sslclient.rb12
-rw-r--r--sample/soap/ssl/sslclient_require_noserverauth.rb12
-rw-r--r--sample/soap/ssl/sslclient_with_clientauth.rb12
-rw-r--r--sample/soap/ssl/sslserver.rb49
-rw-r--r--sample/soap/ssl/sslserver_noauth.rb45
-rw-r--r--sample/soap/ssl/sslserver_require_clientauth.rb50
-rw-r--r--sample/soap/swa/client.rb13
-rw-r--r--sample/soap/swa/server.rb23
-rw-r--r--sample/soap/whois.rb14
-rw-r--r--sample/svr.rb10
-rw-r--r--sample/tempfile.rb8
-rw-r--r--sample/test.rb2038
-rw-r--r--sample/time.rb16
-rw-r--r--sample/timeout.rb42
-rw-r--r--sample/trick2013/README.md15
-rw-r--r--sample/trick2013/kinaba/authors.markdown3
-rw-r--r--sample/trick2013/kinaba/entry.rb1
-rw-r--r--sample/trick2013/kinaba/remarks.markdown37
-rw-r--r--sample/trick2013/mame/authors.markdown3
-rw-r--r--sample/trick2013/mame/entry.rb97
-rw-r--r--sample/trick2013/mame/remarks.markdown47
-rw-r--r--sample/trick2013/shinh/authors.markdown2
-rw-r--r--sample/trick2013/shinh/entry.rb10
-rw-r--r--sample/trick2013/shinh/remarks.markdown4
-rw-r--r--sample/trick2013/yhara/authors.markdown3
-rw-r--r--sample/trick2013/yhara/entry.rb28
-rw-r--r--sample/trick2013/yhara/remarks.en.markdown23
-rw-r--r--sample/trick2013/yhara/remarks.markdown24
-rw-r--r--sample/trick2015/README.md16
-rw-r--r--sample/trick2015/eregon/authors.markdown3
-rw-r--r--sample/trick2015/eregon/entry.rb16
-rw-r--r--sample/trick2015/eregon/remarks.markdown70
-rw-r--r--sample/trick2015/kinaba/authors.markdown4
-rw-r--r--sample/trick2015/kinaba/entry.rb150
-rw-r--r--sample/trick2015/kinaba/remarks.markdown85
-rw-r--r--sample/trick2015/ksk_1/authors.markdown3
-rw-r--r--sample/trick2015/ksk_1/entry.rb1
-rw-r--r--sample/trick2015/ksk_1/remarks.markdown120
-rw-r--r--sample/trick2015/ksk_2/abnormal.cnf6
-rw-r--r--sample/trick2015/ksk_2/authors.markdown3
-rw-r--r--sample/trick2015/ksk_2/entry.rb1
-rw-r--r--sample/trick2015/ksk_2/quinn.cnf21
-rw-r--r--sample/trick2015/ksk_2/remarks.markdown204
-rw-r--r--sample/trick2015/ksk_2/sample.cnf9
-rw-r--r--sample/trick2015/ksk_2/uf20-01.cnf99
-rw-r--r--sample/trick2015/ksk_2/unsat.cnf11
-rw-r--r--sample/trick2015/monae/authors.markdown1
-rw-r--r--sample/trick2015/monae/entry.rb26
-rw-r--r--sample/trick2015/monae/remarks.markdown25
-rw-r--r--sample/trick2018/01-kinaba/authors.markdown3
-rw-r--r--sample/trick2018/01-kinaba/entry.rb8
-rw-r--r--sample/trick2018/01-kinaba/remarks.markdown55
-rw-r--r--sample/trick2018/02-mame/authors.markdown3
-rw-r--r--sample/trick2018/02-mame/entry.rb15
-rw-r--r--sample/trick2018/02-mame/remarks.markdown16
-rw-r--r--sample/trick2018/03-tompng/Gemfile2
-rw-r--r--sample/trick2018/03-tompng/Gemfile.lock13
-rw-r--r--sample/trick2018/03-tompng/authors.markdown3
-rw-r--r--sample/trick2018/03-tompng/entry.rb31
-rw-r--r--sample/trick2018/03-tompng/output.txt44
-rw-r--r--sample/trick2018/03-tompng/remarks.markdown19
-rw-r--r--sample/trick2018/03-tompng/trick.pngbin5661 -> 0 bytes-rw-r--r--sample/trick2018/04-colin/authors.markdown3
-rw-r--r--sample/trick2018/04-colin/entry.rb2
-rw-r--r--sample/trick2018/04-colin/remarks.markdown62
-rw-r--r--sample/trick2018/05-tompng/authors.markdown3
-rw-r--r--sample/trick2018/05-tompng/entry.rb41
-rw-r--r--sample/trick2018/05-tompng/preview_of_output.pngbin66800 -> 0 bytes-rw-r--r--sample/trick2018/05-tompng/remarks.markdown31
-rw-r--r--sample/trick2018/README.md16
-rw-r--r--sample/trojan.rb4
-rw-r--r--sample/tsvr.rb2
-rw-r--r--sample/weakref.rb9
-rw-r--r--sample/webrick/httpproxy.rb25
-rw-r--r--sample/webrick/httpsd.rb4
-rw-r--r--sample/wsdl/amazon/AmazonSearch.rb3057
-rw-r--r--sample/wsdl/amazon/AmazonSearchDriver.rb536
-rw-r--r--sample/wsdl/amazon/sampleClient.rb37
-rw-r--r--sample/wsdl/amazon/wsdlDriver.rb52
-rw-r--r--sample/wsdl/googleSearch/GoogleSearch.rb258
-rw-r--r--sample/wsdl/googleSearch/GoogleSearchDriver.rb101
-rw-r--r--sample/wsdl/googleSearch/README6
-rw-r--r--sample/wsdl/googleSearch/httpd.rb20
-rw-r--r--sample/wsdl/googleSearch/sampleClient.rb56
-rw-r--r--sample/wsdl/googleSearch/samplehttpd.conf2
-rw-r--r--sample/wsdl/googleSearch/sjissearch.sh3
-rw-r--r--sample/wsdl/googleSearch/wsdlDriver.rb23
-rw-r--r--sample/wsdl/raa/raa.wsdl264
-rw-r--r--sample/wsdl/raa/soap4r.rb31
-rw-r--r--sample/wsdl/raa2.4/raa.rb332
-rw-r--r--sample/wsdl/raa2.4/wsdlDriver.rb117
-rw-r--r--signal.c1642
-rw-r--r--siphash.c482
-rw-r--r--siphash.h48
-rw-r--r--sparc.c40
-rw-r--r--spec/README.md130
-rw-r--r--spec/bundler/bundler/build_metadata_spec.rb49
-rw-r--r--spec/bundler/bundler/bundler_spec.rb460
-rw-r--r--spec/bundler/bundler/cli_spec.rb223
-rw-r--r--spec/bundler/bundler/compact_index_client/updater_spec.rb55
-rw-r--r--spec/bundler/bundler/definition_spec.rb351
-rw-r--r--spec/bundler/bundler/dep_proxy_spec.rb22
-rw-r--r--spec/bundler/bundler/dsl_spec.rb302
-rw-r--r--spec/bundler/bundler/endpoint_specification_spec.rb71
-rw-r--r--spec/bundler/bundler/env_spec.rb200
-rw-r--r--spec/bundler/bundler/environment_preserver_spec.rb79
-rw-r--r--spec/bundler/bundler/fetcher/base_spec.rb76
-rw-r--r--spec/bundler/bundler/fetcher/compact_index_spec.rb106
-rw-r--r--spec/bundler/bundler/fetcher/dependency_spec.rb287
-rw-r--r--spec/bundler/bundler/fetcher/downloader_spec.rb269
-rw-r--r--spec/bundler/bundler/fetcher/index_spec.rb116
-rw-r--r--spec/bundler/bundler/fetcher_spec.rb161
-rw-r--r--spec/bundler/bundler/friendly_errors_spec.rb255
-rw-r--r--spec/bundler/bundler/gem_helper_spec.rb348
-rw-r--r--spec/bundler/bundler/gem_version_promoter_spec.rb179
-rw-r--r--spec/bundler/bundler/index_spec.rb36
-rw-r--r--spec/bundler/bundler/installer/gem_installer_spec.rb40
-rw-r--r--spec/bundler/bundler/installer/parallel_installer_spec.rb47
-rw-r--r--spec/bundler/bundler/installer/spec_installation_spec.rb62
-rw-r--r--spec/bundler/bundler/lockfile_parser_spec.rb153
-rw-r--r--spec/bundler/bundler/mirror_spec.rb329
-rw-r--r--spec/bundler/bundler/plugin/api/source_spec.rb82
-rw-r--r--spec/bundler/bundler/plugin/api_spec.rb83
-rw-r--r--spec/bundler/bundler/plugin/dsl_spec.rb38
-rw-r--r--spec/bundler/bundler/plugin/events_spec.rb22
-rw-r--r--spec/bundler/bundler/plugin/index_spec.rb197
-rw-r--r--spec/bundler/bundler/plugin/installer_spec.rb131
-rw-r--r--spec/bundler/bundler/plugin/source_list_spec.rb25
-rw-r--r--spec/bundler/bundler/plugin_spec.rb334
-rw-r--r--spec/bundler/bundler/psyched_yaml_spec.rb9
-rw-r--r--spec/bundler/bundler/remote_specification_spec.rb187
-rw-r--r--spec/bundler/bundler/retry_spec.rb81
-rw-r--r--spec/bundler/bundler/ruby_dsl_spec.rb95
-rw-r--r--spec/bundler/bundler/ruby_version_spec.rb528
-rw-r--r--spec/bundler/bundler/rubygems_integration_spec.rb102
-rw-r--r--spec/bundler/bundler/settings/validator_spec.rb111
-rw-r--r--spec/bundler/bundler/settings_spec.rb328
-rw-r--r--spec/bundler/bundler/shared_helpers_spec.rb515
-rw-r--r--spec/bundler/bundler/source/git/git_proxy_spec.rb148
-rw-r--r--spec/bundler/bundler/source/git_spec.rb28
-rw-r--r--spec/bundler/bundler/source/path_spec.rb31
-rw-r--r--spec/bundler/bundler/source/rubygems/remote_spec.rb172
-rw-r--r--spec/bundler/bundler/source/rubygems_spec.rb33
-rw-r--r--spec/bundler/bundler/source_list_spec.rb463
-rw-r--r--spec/bundler/bundler/source_spec.rb200
-rw-r--r--spec/bundler/bundler/spec_set_spec.rb77
-rw-r--r--spec/bundler/bundler/stub_specification_spec.rb22
-rw-r--r--spec/bundler/bundler/ui/shell_spec.rb53
-rw-r--r--spec/bundler/bundler/ui_spec.rb41
-rw-r--r--spec/bundler/bundler/uri_credentials_filter_spec.rb127
-rw-r--r--spec/bundler/bundler/vendored_persistent_spec.rb77
-rw-r--r--spec/bundler/bundler/version_ranges_spec.rb40
-rw-r--r--spec/bundler/bundler/worker_spec.rb22
-rw-r--r--spec/bundler/bundler/yaml_serializer_spec.rb194
-rw-r--r--spec/bundler/cache/cache_path_spec.rb32
-rw-r--r--spec/bundler/cache/gems_spec.rb304
-rw-r--r--spec/bundler/cache/git_spec.rb239
-rw-r--r--spec/bundler/cache/path_spec.rb144
-rw-r--r--spec/bundler/cache/platform_spec.rb49
-rw-r--r--spec/bundler/commands/add_spec.rb251
-rw-r--r--spec/bundler/commands/binstubs_spec.rb465
-rw-r--r--spec/bundler/commands/cache_spec.rb351
-rw-r--r--spec/bundler/commands/check_spec.rb359
-rw-r--r--spec/bundler/commands/clean_spec.rb892
-rw-r--r--spec/bundler/commands/config_spec.rb493
-rw-r--r--spec/bundler/commands/console_spec.rb106
-rw-r--r--spec/bundler/commands/doctor_spec.rb116
-rw-r--r--spec/bundler/commands/exec_spec.rb913
-rw-r--r--spec/bundler/commands/help_spec.rb89
-rw-r--r--spec/bundler/commands/info_spec.rb145
-rw-r--r--spec/bundler/commands/init_spec.rb177
-rw-r--r--spec/bundler/commands/inject_spec.rb117
-rw-r--r--spec/bundler/commands/install_spec.rb589
-rw-r--r--spec/bundler/commands/issue_spec.rb16
-rw-r--r--spec/bundler/commands/licenses_spec.rb31
-rw-r--r--spec/bundler/commands/list_spec.rb168
-rw-r--r--spec/bundler/commands/lock_spec.rb362
-rw-r--r--spec/bundler/commands/newgem_spec.rb732
-rw-r--r--spec/bundler/commands/open_spec.rb117
-rw-r--r--spec/bundler/commands/outdated_spec.rb780
-rw-r--r--spec/bundler/commands/post_bundle_message_spec.rb210
-rw-r--r--spec/bundler/commands/pristine_spec.rb191
-rw-r--r--spec/bundler/commands/remove_spec.rb595
-rw-r--r--spec/bundler/commands/show_spec.rb225
-rw-r--r--spec/bundler/commands/update_spec.rb1021
-rw-r--r--spec/bundler/commands/version_spec.rb47
-rw-r--r--spec/bundler/commands/viz_spec.rb149
-rw-r--r--spec/bundler/install/allow_offline_install_spec.rb92
-rw-r--r--spec/bundler/install/binstubs_spec.rb51
-rw-r--r--spec/bundler/install/bundler_spec.rb182
-rw-r--r--spec/bundler/install/deploy_spec.rb429
-rw-r--r--spec/bundler/install/failure_spec.rb144
-rw-r--r--spec/bundler/install/gemfile/eval_gemfile_spec.rb82
-rw-r--r--spec/bundler/install/gemfile/gemspec_spec.rb583
-rw-r--r--spec/bundler/install/gemfile/git_spec.rb1455
-rw-r--r--spec/bundler/install/gemfile/groups_spec.rb384
-rw-r--r--spec/bundler/install/gemfile/install_if.rb44
-rw-r--r--spec/bundler/install/gemfile/lockfile_spec.rb48
-rw-r--r--spec/bundler/install/gemfile/path_spec.rb747
-rw-r--r--spec/bundler/install/gemfile/platform_spec.rb425
-rw-r--r--spec/bundler/install/gemfile/ruby_spec.rb108
-rw-r--r--spec/bundler/install/gemfile/sources_spec.rb647
-rw-r--r--spec/bundler/install/gemfile/specific_platform_spec.rb114
-rw-r--r--spec/bundler/install/gemfile_spec.rb124
-rw-r--r--spec/bundler/install/gems/compact_index_spec.rb940
-rw-r--r--spec/bundler/install/gems/dependency_api_spec.rb760
-rw-r--r--spec/bundler/install/gems/env_spec.rb107
-rw-r--r--spec/bundler/install/gems/flex_spec.rb353
-rw-r--r--spec/bundler/install/gems/mirror_spec.rb39
-rw-r--r--spec/bundler/install/gems/native_extensions_spec.rb131
-rw-r--r--spec/bundler/install/gems/post_install_spec.rb150
-rw-r--r--spec/bundler/install/gems/resolving_spec.rb214
-rw-r--r--spec/bundler/install/gems/standalone_spec.rb337
-rw-r--r--spec/bundler/install/gems/sudo_spec.rb187
-rw-r--r--spec/bundler/install/gems/win32_spec.rb26
-rw-r--r--spec/bundler/install/gemspecs_spec.rb151
-rw-r--r--spec/bundler/install/git_spec.rb85
-rw-r--r--spec/bundler/install/global_cache_spec.rb235
-rw-r--r--spec/bundler/install/path_spec.rb221
-rw-r--r--spec/bundler/install/prereleases_spec.rb41
-rw-r--r--spec/bundler/install/process_lock_spec.rb35
-rw-r--r--spec/bundler/install/redownload_spec.rb90
-rw-r--r--spec/bundler/install/security_policy_spec.rb76
-rw-r--r--spec/bundler/install/yanked_spec.rb73
-rw-r--r--spec/bundler/lock/git_spec.rb34
-rw-r--r--spec/bundler/lock/lockfile_spec.rb1489
-rw-r--r--spec/bundler/other/cli_dispatch_spec.rb20
-rw-r--r--spec/bundler/other/ext_spec.rb61
-rw-r--r--spec/bundler/other/major_deprecation_spec.rb562
-rw-r--r--spec/bundler/other/platform_spec.rb1307
-rw-r--r--spec/bundler/plugins/command_spec.rb80
-rw-r--r--spec/bundler/plugins/hook_spec.rb109
-rw-r--r--spec/bundler/plugins/install_spec.rb309
-rw-r--r--spec/bundler/plugins/list_spec.rb60
-rw-r--r--spec/bundler/plugins/source/example_spec.rb508
-rw-r--r--spec/bundler/plugins/source_spec.rb108
-rw-r--r--spec/bundler/quality_es_spec.rb65
-rw-r--r--spec/bundler/quality_spec.rb289
-rw-r--r--spec/bundler/realworld/dependency_api_spec.rb46
-rw-r--r--spec/bundler/realworld/double_check_spec.rb40
-rw-r--r--spec/bundler/realworld/edgecases_spec.rb347
-rw-r--r--spec/bundler/realworld/gemfile_source_header_spec.rb53
-rw-r--r--spec/bundler/realworld/mirror_probe_spec.rb144
-rw-r--r--spec/bundler/realworld/parallel_spec.rb66
-rw-r--r--spec/bundler/resolver/basic_spec.rb308
-rw-r--r--spec/bundler/resolver/platform_spec.rb100
-rw-r--r--spec/bundler/runtime/executable_spec.rb173
-rw-r--r--spec/bundler/runtime/gem_tasks_spec.rb80
-rw-r--r--spec/bundler/runtime/inline_spec.rb353
-rw-r--r--spec/bundler/runtime/load_spec.rb111
-rw-r--r--spec/bundler/runtime/platform_spec.rb169
-rw-r--r--spec/bundler/runtime/require_spec.rb450
-rw-r--r--spec/bundler/runtime/setup_spec.rb1375
-rw-r--r--spec/bundler/runtime/with_unbundled_env_spec.rb270
-rw-r--r--spec/bundler/spec_helper.rb130
-rw-r--r--spec/bundler/support/artifice/compact_index.rb118
-rw-r--r--spec/bundler/support/artifice/compact_index_api_missing.rb18
-rw-r--r--spec/bundler/support/artifice/compact_index_basic_authentication.rb15
-rw-r--r--spec/bundler/support/artifice/compact_index_checksum_mismatch.rb16
-rw-r--r--spec/bundler/support/artifice/compact_index_concurrent_download.rb32
-rw-r--r--spec/bundler/support/artifice/compact_index_creds_diff_host.rb39
-rw-r--r--spec/bundler/support/artifice/compact_index_extra.rb37
-rw-r--r--spec/bundler/support/artifice/compact_index_extra_api.rb52
-rw-r--r--spec/bundler/support/artifice/compact_index_extra_api_missing.rb17
-rw-r--r--spec/bundler/support/artifice/compact_index_extra_missing.rb17
-rw-r--r--spec/bundler/support/artifice/compact_index_forbidden.rb13
-rw-r--r--spec/bundler/support/artifice/compact_index_host_redirect.rb21
-rw-r--r--spec/bundler/support/artifice/compact_index_no_gem.rb13
-rw-r--r--spec/bundler/support/artifice/compact_index_partial_update.rb38
-rw-r--r--spec/bundler/support/artifice/compact_index_range_not_satisfiable.rb34
-rw-r--r--spec/bundler/support/artifice/compact_index_rate_limited.rb48
-rw-r--r--spec/bundler/support/artifice/compact_index_redirects.rb21
-rw-r--r--spec/bundler/support/artifice/compact_index_strict_basic_authentication.rb20
-rw-r--r--spec/bundler/support/artifice/compact_index_wrong_dependencies.rb17
-rw-r--r--spec/bundler/support/artifice/compact_index_wrong_gem_checksum.rb20
-rw-r--r--spec/bundler/support/artifice/endopint_marshal_fail_basic_authentication.rb15
-rw-r--r--spec/bundler/support/artifice/endpoint.rb100
-rw-r--r--spec/bundler/support/artifice/endpoint_500.rb19
-rw-r--r--spec/bundler/support/artifice/endpoint_api_forbidden.rb13
-rw-r--r--spec/bundler/support/artifice/endpoint_api_missing.rb18
-rw-r--r--spec/bundler/support/artifice/endpoint_basic_authentication.rb15
-rw-r--r--spec/bundler/support/artifice/endpoint_creds_diff_host.rb39
-rw-r--r--spec/bundler/support/artifice/endpoint_extra.rb33
-rw-r--r--spec/bundler/support/artifice/endpoint_extra_api.rb34
-rw-r--r--spec/bundler/support/artifice/endpoint_extra_missing.rb17
-rw-r--r--spec/bundler/support/artifice/endpoint_fallback.rb19
-rw-r--r--spec/bundler/support/artifice/endpoint_host_redirect.rb17
-rw-r--r--spec/bundler/support/artifice/endpoint_marshal_fail.rb13
-rw-r--r--spec/bundler/support/artifice/endpoint_mirror_source.rb15
-rw-r--r--spec/bundler/support/artifice/endpoint_redirect.rb17
-rw-r--r--spec/bundler/support/artifice/endpoint_strict_basic_authentication.rb20
-rw-r--r--spec/bundler/support/artifice/endpoint_timeout.rb15
-rw-r--r--spec/bundler/support/artifice/fail.rb39
-rw-r--r--spec/bundler/support/artifice/vcr.rb152
-rw-r--r--spec/bundler/support/artifice/windows.rb47
-rw-r--r--spec/bundler/support/builders.rb823
-rw-r--r--spec/bundler/support/command_execution.rb44
-rw-r--r--spec/bundler/support/filters.rb45
-rw-r--r--spec/bundler/support/hax.rb68
-rw-r--r--spec/bundler/support/helpers.rb587
-rw-r--r--spec/bundler/support/indexes.rb421
-rw-r--r--spec/bundler/support/matchers.rb224
-rw-r--r--spec/bundler/support/parallel.rb5
-rw-r--r--spec/bundler/support/path.rb191
-rw-r--r--spec/bundler/support/permissions.rb12
-rw-r--r--spec/bundler/support/platforms.rb106
-rw-r--r--spec/bundler/support/rubygems_ext.rb107
-rw-r--r--spec/bundler/support/rubygems_version_manager.rb103
-rw-r--r--spec/bundler/support/silent_logger.rb10
-rw-r--r--spec/bundler/support/sometimes.rb57
-rw-r--r--spec/bundler/support/streams.rb19
-rw-r--r--spec/bundler/support/sudo.rb18
-rw-r--r--spec/bundler/support/the_bundle.rb35
-rw-r--r--spec/bundler/update/gemfile_spec.rb49
-rw-r--r--spec/bundler/update/gems/post_install_spec.rb76
-rw-r--r--spec/bundler/update/git_spec.rb374
-rw-r--r--spec/bundler/update/path_spec.rb18
-rw-r--r--spec/bundler/update/redownload_spec.rb34
-rw-r--r--spec/default.mspec67
-rw-r--r--spec/mspec/Gemfile4
-rw-r--r--spec/mspec/Gemfile.lock21
-rw-r--r--spec/mspec/LICENSE22
-rw-r--r--spec/mspec/README.md86
-rw-r--r--spec/mspec/Rakefile6
-rwxr-xr-xspec/mspec/bin/mkspec7
-rwxr-xr-xspec/mspec/bin/mkspec.bat1
-rwxr-xr-xspec/mspec/bin/mspec7
-rwxr-xr-xspec/mspec/bin/mspec-ci7
-rwxr-xr-xspec/mspec/bin/mspec-ci.bat1
-rwxr-xr-xspec/mspec/bin/mspec-run7
-rwxr-xr-xspec/mspec/bin/mspec-run.bat1
-rwxr-xr-xspec/mspec/bin/mspec-tag7
-rwxr-xr-xspec/mspec/bin/mspec-tag.bat1
-rwxr-xr-xspec/mspec/bin/mspec.bat1
-rw-r--r--spec/mspec/lib/mspec.rb8
-rwxr-xr-xspec/mspec/lib/mspec/commands/mkspec.rb155
-rw-r--r--spec/mspec/lib/mspec/commands/mspec-ci.rb79
-rw-r--r--spec/mspec/lib/mspec/commands/mspec-run.rb87
-rw-r--r--spec/mspec/lib/mspec/commands/mspec-tag.rb133
-rwxr-xr-xspec/mspec/lib/mspec/commands/mspec.rb118
-rw-r--r--spec/mspec/lib/mspec/expectations.rb2
-rw-r--r--spec/mspec/lib/mspec/expectations/expectations.rb35
-rw-r--r--spec/mspec/lib/mspec/expectations/should.rb29
-rw-r--r--spec/mspec/lib/mspec/guards.rb11
-rw-r--r--spec/mspec/lib/mspec/guards/block_device.rb16
-rw-r--r--spec/mspec/lib/mspec/guards/bug.rb28
-rw-r--r--spec/mspec/lib/mspec/guards/conflict.rb23
-rw-r--r--spec/mspec/lib/mspec/guards/endian.rb25
-rw-r--r--spec/mspec/lib/mspec/guards/feature.rb45
-rw-r--r--spec/mspec/lib/mspec/guards/guard.rb141
-rw-r--r--spec/mspec/lib/mspec/guards/platform.rb89
-rw-r--r--spec/mspec/lib/mspec/guards/quarantine.rb11
-rw-r--r--spec/mspec/lib/mspec/guards/superuser.rb15
-rw-r--r--spec/mspec/lib/mspec/guards/support.rb14
-rw-r--r--spec/mspec/lib/mspec/guards/version.rb37
-rw-r--r--spec/mspec/lib/mspec/helpers.rb14
-rw-r--r--spec/mspec/lib/mspec/helpers/argf.rb35
-rw-r--r--spec/mspec/lib/mspec/helpers/argv.rb44
-rw-r--r--spec/mspec/lib/mspec/helpers/datetime.rb47
-rw-r--r--spec/mspec/lib/mspec/helpers/fixture.rb24
-rw-r--r--spec/mspec/lib/mspec/helpers/flunk.rb3
-rw-r--r--spec/mspec/lib/mspec/helpers/frozen_error_class.rb17
-rw-r--r--spec/mspec/lib/mspec/helpers/fs.rb64
-rw-r--r--spec/mspec/lib/mspec/helpers/io.rb91
-rw-r--r--spec/mspec/lib/mspec/helpers/mock_to_path.rb6
-rw-r--r--spec/mspec/lib/mspec/helpers/numeric.rb70
-rw-r--r--spec/mspec/lib/mspec/helpers/ruby_exe.rb157
-rw-r--r--spec/mspec/lib/mspec/helpers/scratch.rb17
-rw-r--r--spec/mspec/lib/mspec/helpers/tmp.rb43
-rw-r--r--spec/mspec/lib/mspec/helpers/warning.rb19
-rw-r--r--spec/mspec/lib/mspec/matchers.rb37
-rw-r--r--spec/mspec/lib/mspec/matchers/base.rb61
-rw-r--r--spec/mspec/lib/mspec/matchers/be_an_instance_of.rb26
-rw-r--r--spec/mspec/lib/mspec/matchers/be_ancestor_of.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/be_close.rb29
-rw-r--r--spec/mspec/lib/mspec/matchers/be_computed_by.rb37
-rw-r--r--spec/mspec/lib/mspec/matchers/be_empty.rb20
-rw-r--r--spec/mspec/lib/mspec/matchers/be_false.rb20
-rw-r--r--spec/mspec/lib/mspec/matchers/be_kind_of.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/be_nan.rb20
-rw-r--r--spec/mspec/lib/mspec/matchers/be_nil.rb20
-rw-r--r--spec/mspec/lib/mspec/matchers/be_true.rb20
-rw-r--r--spec/mspec/lib/mspec/matchers/be_true_or_false.rb20
-rw-r--r--spec/mspec/lib/mspec/matchers/block_caller.rb37
-rw-r--r--spec/mspec/lib/mspec/matchers/complain.rb71
-rw-r--r--spec/mspec/lib/mspec/matchers/eql.rb26
-rw-r--r--spec/mspec/lib/mspec/matchers/equal.rb26
-rw-r--r--spec/mspec/lib/mspec/matchers/equal_element.rb78
-rw-r--r--spec/mspec/lib/mspec/matchers/have_class_variable.rb12
-rw-r--r--spec/mspec/lib/mspec/matchers/have_constant.rb12
-rw-r--r--spec/mspec/lib/mspec/matchers/have_instance_method.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/have_instance_variable.rb12
-rw-r--r--spec/mspec/lib/mspec/matchers/have_method.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/have_private_instance_method.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/have_private_method.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/have_protected_instance_method.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/have_public_instance_method.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/have_singleton_method.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/include.rb31
-rw-r--r--spec/mspec/lib/mspec/matchers/include_any_of.rb29
-rw-r--r--spec/mspec/lib/mspec/matchers/infinity.rb28
-rw-r--r--spec/mspec/lib/mspec/matchers/match_yaml.rb46
-rw-r--r--spec/mspec/lib/mspec/matchers/method.rb10
-rw-r--r--spec/mspec/lib/mspec/matchers/output.rb67
-rw-r--r--spec/mspec/lib/mspec/matchers/output_to_fd.rb71
-rw-r--r--spec/mspec/lib/mspec/matchers/raise_error.rb80
-rw-r--r--spec/mspec/lib/mspec/matchers/respond_to.rb24
-rw-r--r--spec/mspec/lib/mspec/matchers/signed_zero.rb28
-rw-r--r--spec/mspec/lib/mspec/matchers/skip.rb5
-rw-r--r--spec/mspec/lib/mspec/matchers/variable.rb24
-rw-r--r--spec/mspec/lib/mspec/mocks.rb3
-rw-r--r--spec/mspec/lib/mspec/mocks/mock.rb212
-rw-r--r--spec/mspec/lib/mspec/mocks/object.rb28
-rw-r--r--spec/mspec/lib/mspec/mocks/proxy.rb186
-rw-r--r--spec/mspec/lib/mspec/runner.rb12
-rw-r--r--spec/mspec/lib/mspec/runner/actions.rb6
-rw-r--r--spec/mspec/lib/mspec/runner/actions/constants_leak_checker.rb79
-rw-r--r--spec/mspec/lib/mspec/runner/actions/filter.rb40
-rw-r--r--spec/mspec/lib/mspec/runner/actions/leakchecker.rb294
-rw-r--r--spec/mspec/lib/mspec/runner/actions/profile.rb60
-rw-r--r--spec/mspec/lib/mspec/runner/actions/tag.rb133
-rw-r--r--spec/mspec/lib/mspec/runner/actions/taglist.rb56
-rw-r--r--spec/mspec/lib/mspec/runner/actions/tagpurge.rb56
-rw-r--r--spec/mspec/lib/mspec/runner/actions/tally.rb133
-rw-r--r--spec/mspec/lib/mspec/runner/actions/timeout.rb60
-rw-r--r--spec/mspec/lib/mspec/runner/actions/timer.rb22
-rw-r--r--spec/mspec/lib/mspec/runner/context.rb239
-rw-r--r--spec/mspec/lib/mspec/runner/evaluate.rb54
-rw-r--r--spec/mspec/lib/mspec/runner/example.rb34
-rw-r--r--spec/mspec/lib/mspec/runner/exception.rb43
-rw-r--r--spec/mspec/lib/mspec/runner/filters.rb4
-rw-r--r--spec/mspec/lib/mspec/runner/filters/match.rb18
-rw-r--r--spec/mspec/lib/mspec/runner/filters/profile.rb54
-rw-r--r--spec/mspec/lib/mspec/runner/filters/regexp.rb23
-rw-r--r--spec/mspec/lib/mspec/runner/filters/tag.rb29
-rw-r--r--spec/mspec/lib/mspec/runner/formatters.rb12
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/base.rb128
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/describe.rb23
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/dotted.rb23
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/file.rb24
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/html.rb81
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/junit.rb87
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/method.rb95
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/multi.rb47
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/profile.rb18
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/specdoc.rb41
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/spinner.rb111
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/summary.rb4
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/unit.rb20
-rw-r--r--spec/mspec/lib/mspec/runner/formatters/yaml.rb38
-rw-r--r--spec/mspec/lib/mspec/runner/mspec.rb410
-rw-r--r--spec/mspec/lib/mspec/runner/object.rb26
-rw-r--r--spec/mspec/lib/mspec/runner/parallel.rb98
-rw-r--r--spec/mspec/lib/mspec/runner/shared.rb10
-rw-r--r--spec/mspec/lib/mspec/runner/tag.rb38
-rw-r--r--spec/mspec/lib/mspec/utils/deprecate.rb6
-rw-r--r--spec/mspec/lib/mspec/utils/format.rb20
-rw-r--r--spec/mspec/lib/mspec/utils/name_map.rb121
-rw-r--r--spec/mspec/lib/mspec/utils/options.rb489
-rw-r--r--spec/mspec/lib/mspec/utils/script.rb284
-rw-r--r--spec/mspec/lib/mspec/utils/version.rb52
-rw-r--r--spec/mspec/lib/mspec/utils/warnings.rb61
-rw-r--r--spec/mspec/lib/mspec/version.rb5
-rw-r--r--spec/mspec/spec/commands/fixtures/level2/three_spec.rb1
-rw-r--r--spec/mspec/spec/commands/fixtures/one_spec.rb1
-rw-r--r--spec/mspec/spec/commands/fixtures/three.rb1
-rw-r--r--spec/mspec/spec/commands/fixtures/two_spec.rb1
-rw-r--r--spec/mspec/spec/commands/mkspec_spec.rb363
-rw-r--r--spec/mspec/spec/commands/mspec_ci_spec.rb150
-rw-r--r--spec/mspec/spec/commands/mspec_run_spec.rb173
-rw-r--r--spec/mspec/spec/commands/mspec_spec.rb207
-rw-r--r--spec/mspec/spec/commands/mspec_tag_spec.rb414
-rw-r--r--spec/mspec/spec/expectations/expectations_spec.rb29
-rw-r--r--spec/mspec/spec/expectations/should.rb73
-rw-r--r--spec/mspec/spec/expectations/should_spec.rb61
-rw-r--r--spec/mspec/spec/fixtures/a_spec.rb15
-rw-r--r--spec/mspec/spec/fixtures/b_spec.rb7
-rw-r--r--spec/mspec/spec/fixtures/chatty_spec.rb8
-rw-r--r--spec/mspec/spec/fixtures/config.mspec10
-rw-r--r--spec/mspec/spec/fixtures/die_spec.rb7
-rwxr-xr-xspec/mspec/spec/fixtures/my_ruby4
-rw-r--r--spec/mspec/spec/fixtures/object_methods_spec.rb8
-rw-r--r--spec/mspec/spec/fixtures/print_interpreter_spec.rb4
-rw-r--r--spec/mspec/spec/fixtures/tagging_spec.rb16
-rw-r--r--spec/mspec/spec/guards/block_device_spec.rb46
-rw-r--r--spec/mspec/spec/guards/bug_spec.rb151
-rw-r--r--spec/mspec/spec/guards/conflict_spec.rb53
-rw-r--r--spec/mspec/spec/guards/endian_spec.rb55
-rw-r--r--spec/mspec/spec/guards/feature_spec.rb120
-rw-r--r--spec/mspec/spec/guards/guard_spec.rb421
-rw-r--r--spec/mspec/spec/guards/platform_spec.rb337
-rw-r--r--spec/mspec/spec/guards/quarantine_spec.rb35
-rw-r--r--spec/mspec/spec/guards/superuser_spec.rb35
-rw-r--r--spec/mspec/spec/guards/support_spec.rb54
-rw-r--r--spec/mspec/spec/guards/user_spec.rb20
-rw-r--r--spec/mspec/spec/guards/version_spec.rb90
-rw-r--r--spec/mspec/spec/helpers/argf_spec.rb37
-rw-r--r--spec/mspec/spec/helpers/argv_spec.rb27
-rw-r--r--spec/mspec/spec/helpers/datetime_spec.rb44
-rw-r--r--spec/mspec/spec/helpers/fixture_spec.rb25
-rw-r--r--spec/mspec/spec/helpers/flunk_spec.rb20
-rw-r--r--spec/mspec/spec/helpers/fs_spec.rb195
-rw-r--r--spec/mspec/spec/helpers/io_spec.rb136
-rw-r--r--spec/mspec/spec/helpers/mock_to_path_spec.rb17
-rw-r--r--spec/mspec/spec/helpers/numeric_spec.rb25
-rw-r--r--spec/mspec/spec/helpers/ruby_exe_spec.rb197
-rw-r--r--spec/mspec/spec/helpers/scratch_spec.rb24
-rw-r--r--spec/mspec/spec/helpers/suppress_warning_spec.rb19
-rw-r--r--spec/mspec/spec/helpers/tmp_spec.rb27
-rw-r--r--spec/mspec/spec/integration/interpreter_spec.rb18
-rw-r--r--spec/mspec/spec/integration/object_methods_spec.rb18
-rw-r--r--spec/mspec/spec/integration/run_spec.rb73
-rw-r--r--spec/mspec/spec/integration/tag_spec.rb61
-rw-r--r--spec/mspec/spec/matchers/base_spec.rb228
-rw-r--r--spec/mspec/spec/matchers/be_an_instance_of_spec.rb50
-rw-r--r--spec/mspec/spec/matchers/be_ancestor_of_spec.rb28
-rw-r--r--spec/mspec/spec/matchers/be_close_spec.rb48
-rw-r--r--spec/mspec/spec/matchers/be_computed_by_spec.rb42
-rw-r--r--spec/mspec/spec/matchers/be_empty_spec.rb26
-rw-r--r--spec/mspec/spec/matchers/be_false_spec.rb28
-rw-r--r--spec/mspec/spec/matchers/be_kind_of_spec.rb31
-rw-r--r--spec/mspec/spec/matchers/be_nan_spec.rb28
-rw-r--r--spec/mspec/spec/matchers/be_nil_spec.rb27
-rw-r--r--spec/mspec/spec/matchers/be_true_or_false_spec.rb19
-rw-r--r--spec/mspec/spec/matchers/be_true_spec.rb28
-rw-r--r--spec/mspec/spec/matchers/block_caller_spec.rb13
-rw-r--r--spec/mspec/spec/matchers/complain_spec.rb97
-rw-r--r--spec/mspec/spec/matchers/eql_spec.rb33
-rw-r--r--spec/mspec/spec/matchers/equal_element_spec.rb75
-rw-r--r--spec/mspec/spec/matchers/equal_spec.rb32
-rw-r--r--spec/mspec/spec/matchers/have_class_variable_spec.rb49
-rw-r--r--spec/mspec/spec/matchers/have_constant_spec.rb37
-rw-r--r--spec/mspec/spec/matchers/have_instance_method_spec.rb53
-rw-r--r--spec/mspec/spec/matchers/have_instance_variable_spec.rb50
-rw-r--r--spec/mspec/spec/matchers/have_method_spec.rb55
-rw-r--r--spec/mspec/spec/matchers/have_private_instance_method_spec.rb57
-rw-r--r--spec/mspec/spec/matchers/have_private_method_spec.rb44
-rw-r--r--spec/mspec/spec/matchers/have_protected_instance_method_spec.rb57
-rw-r--r--spec/mspec/spec/matchers/have_public_instance_method_spec.rb53
-rw-r--r--spec/mspec/spec/matchers/have_singleton_method_spec.rb45
-rw-r--r--spec/mspec/spec/matchers/include_any_of_spec.rb42
-rw-r--r--spec/mspec/spec/matchers/include_spec.rb37
-rw-r--r--spec/mspec/spec/matchers/infinity_spec.rb34
-rw-r--r--spec/mspec/spec/matchers/match_yaml_spec.rb39
-rw-r--r--spec/mspec/spec/matchers/output_spec.rb74
-rw-r--r--spec/mspec/spec/matchers/output_to_fd_spec.rb44
-rw-r--r--spec/mspec/spec/matchers/raise_error_spec.rb132
-rw-r--r--spec/mspec/spec/matchers/respond_to_spec.rb33
-rw-r--r--spec/mspec/spec/matchers/signed_zero_spec.rb32
-rw-r--r--spec/mspec/spec/mocks/mock_spec.rb530
-rw-r--r--spec/mspec/spec/mocks/proxy_spec.rb405
-rw-r--r--spec/mspec/spec/runner/actions/filter_spec.rb84
-rw-r--r--spec/mspec/spec/runner/actions/tag_spec.rb315
-rw-r--r--spec/mspec/spec/runner/actions/taglist_spec.rb152
-rw-r--r--spec/mspec/spec/runner/actions/tagpurge_spec.rb154
-rw-r--r--spec/mspec/spec/runner/actions/tally_spec.rb352
-rw-r--r--spec/mspec/spec/runner/actions/timer_spec.rb44
-rw-r--r--spec/mspec/spec/runner/context_spec.rb1041
-rw-r--r--spec/mspec/spec/runner/example_spec.rb117
-rw-r--r--spec/mspec/spec/runner/exception_spec.rb146
-rw-r--r--spec/mspec/spec/runner/filters/a.yaml4
-rw-r--r--spec/mspec/spec/runner/filters/b.yaml11
-rw-r--r--spec/mspec/spec/runner/filters/match_spec.rb34
-rw-r--r--spec/mspec/spec/runner/filters/profile_spec.rb117
-rw-r--r--spec/mspec/spec/runner/filters/regexp_spec.rb31
-rw-r--r--spec/mspec/spec/runner/filters/tag_spec.rb92
-rw-r--r--spec/mspec/spec/runner/formatters/describe_spec.rb67
-rw-r--r--spec/mspec/spec/runner/formatters/dotted_spec.rb285
-rw-r--r--spec/mspec/spec/runner/formatters/file_spec.rb84
-rw-r--r--spec/mspec/spec/runner/formatters/html_spec.rb216
-rw-r--r--spec/mspec/spec/runner/formatters/junit_spec.rb147
-rw-r--r--spec/mspec/spec/runner/formatters/method_spec.rb178
-rw-r--r--spec/mspec/spec/runner/formatters/multi_spec.rb70
-rw-r--r--spec/mspec/spec/runner/formatters/specdoc_spec.rb106
-rw-r--r--spec/mspec/spec/runner/formatters/spinner_spec.rb83
-rw-r--r--spec/mspec/spec/runner/formatters/summary_spec.rb26
-rw-r--r--spec/mspec/spec/runner/formatters/unit_spec.rb74
-rw-r--r--spec/mspec/spec/runner/formatters/yaml_spec.rb125
-rw-r--r--spec/mspec/spec/runner/mspec_spec.rb595
-rw-r--r--spec/mspec/spec/runner/shared_spec.rb90
-rw-r--r--spec/mspec/spec/runner/tag_spec.rb123
-rw-r--r--spec/mspec/spec/runner/tags.txt4
-rw-r--r--spec/mspec/spec/spec_helper.rb55
-rw-r--r--spec/mspec/spec/utils/deprecate_spec.rb17
-rw-r--r--spec/mspec/spec/utils/name_map_spec.rb175
-rw-r--r--spec/mspec/spec/utils/options_spec.rb1285
-rw-r--r--spec/mspec/spec/utils/script_spec.rb475
-rw-r--r--spec/mspec/spec/utils/version_spec.rb45
-rwxr-xr-xspec/mspec/tool/find.rb10
-rwxr-xr-xspec/mspec/tool/pull-latest-mspec-spec26
-rw-r--r--spec/mspec/tool/remove_old_guards.rb65
-rw-r--r--spec/mspec/tool/sync/.gitignore4
-rw-r--r--spec/mspec/tool/sync/sync-rubyspec.rb230
-rwxr-xr-xspec/mspec/tool/tag_from_output.rb42
-rw-r--r--spec/ruby/.gitignore5
-rw-r--r--spec/ruby/.mspec.constants225
-rw-r--r--spec/ruby/.rubocop.yml124
-rw-r--r--spec/ruby/.rubocop_todo.yml149
-rw-r--r--spec/ruby/CONTRIBUTING.md251
-rw-r--r--spec/ruby/LICENSE22
-rw-r--r--spec/ruby/README.md138
-rw-r--r--spec/ruby/TODO8
-rw-r--r--spec/ruby/command_line/dash_a_spec.rb19
-rw-r--r--spec/ruby/command_line/dash_c_spec.rb13
-rw-r--r--spec/ruby/command_line/dash_d_spec.rb22
-rw-r--r--spec/ruby/command_line/dash_e_spec.rb41
-rw-r--r--spec/ruby/command_line/dash_encoding_spec.rb30
-rw-r--r--spec/ruby/command_line/dash_external_encoding_spec.rb15
-rw-r--r--spec/ruby/command_line/dash_internal_encoding_spec.rb15
-rw-r--r--spec/ruby/command_line/dash_n_spec.rb36
-rw-r--r--spec/ruby/command_line/dash_p_spec.rb19
-rw-r--r--spec/ruby/command_line/dash_r_spec.rb13
-rw-r--r--spec/ruby/command_line/dash_s_spec.rb52
-rw-r--r--spec/ruby/command_line/dash_upper_c_spec.rb6
-rw-r--r--spec/ruby/command_line/dash_upper_e_spec.rb36
-rw-r--r--spec/ruby/command_line/dash_upper_f_spec.rb13
-rw-r--r--spec/ruby/command_line/dash_upper_i_spec.rb51
-rw-r--r--spec/ruby/command_line/dash_upper_k_spec.rb65
-rw-r--r--spec/ruby/command_line/dash_upper_s_spec.rb29
-rw-r--r--spec/ruby/command_line/dash_upper_u_spec.rb43
-rw-r--r--spec/ruby/command_line/dash_upper_w_spec.rb20
-rw-r--r--spec/ruby/command_line/dash_upper_x_spec.rb6
-rw-r--r--spec/ruby/command_line/dash_v_spec.rb12
-rw-r--r--spec/ruby/command_line/dash_w_spec.rb6
-rw-r--r--spec/ruby/command_line/dash_x_spec.rb21
-rw-r--r--spec/ruby/command_line/error_message_spec.rb11
-rw-r--r--spec/ruby/command_line/feature_spec.rb56
-rw-r--r--spec/ruby/command_line/fixtures/bad_syntax.rb1
-rw-r--r--spec/ruby/command_line/fixtures/bin/bad_embedded_ruby.txt3
-rw-r--r--spec/ruby/command_line/fixtures/bin/dash_s_fail1
-rw-r--r--spec/ruby/command_line/fixtures/bin/embedded_ruby.txt3
-rw-r--r--spec/ruby/command_line/fixtures/bin/hybrid_launcher.sh4
-rwxr-xr-xspec/ruby/command_line/fixtures/bin/launcher.rb2
-rw-r--r--spec/ruby/command_line/fixtures/change_directory_script.rb1
-rw-r--r--spec/ruby/command_line/fixtures/conditional_range.txt5
-rw-r--r--spec/ruby/command_line/fixtures/dash_s_script.rb12
-rw-r--r--spec/ruby/command_line/fixtures/debug.rb10
-rw-r--r--spec/ruby/command_line/fixtures/debug_info.rb11
-rw-r--r--spec/ruby/command_line/fixtures/freeze_flag_across_files.rb3
-rw-r--r--spec/ruby/command_line/fixtures/freeze_flag_across_files_diff_enc.rb3
-rw-r--r--spec/ruby/command_line/fixtures/freeze_flag_one_literal.rb2
-rw-r--r--spec/ruby/command_line/fixtures/freeze_flag_required.rb1
-rw-r--r--spec/ruby/command_line/fixtures/freeze_flag_required_diff_enc.rbbin121 -> 0 bytes-rw-r--r--spec/ruby/command_line/fixtures/freeze_flag_two_literals.rb1
-rw-r--r--spec/ruby/command_line/fixtures/full_names.txt3
-rw-r--r--spec/ruby/command_line/fixtures/loadpath.rb1
-rw-r--r--spec/ruby/command_line/fixtures/names.txt3
-rw-r--r--spec/ruby/command_line/fixtures/passwd_file.txt3
-rw-r--r--spec/ruby/command_line/fixtures/require.rb1
-rw-r--r--spec/ruby/command_line/fixtures/rubyopt.rb1
-rw-r--r--spec/ruby/command_line/fixtures/test_file.rb1
-rw-r--r--spec/ruby/command_line/fixtures/verbose.rb1
-rw-r--r--spec/ruby/command_line/frozen_strings_spec.rb29
-rw-r--r--spec/ruby/command_line/rubylib_spec.rb69
-rw-r--r--spec/ruby/command_line/rubyopt_spec.rb167
-rw-r--r--spec/ruby/command_line/shared/change_directory.rb21
-rw-r--r--spec/ruby/command_line/shared/verbose.rb9
-rw-r--r--spec/ruby/command_line/syntax_error_spec.rb13
-rw-r--r--spec/ruby/core/argf/argf_spec.rb11
-rw-r--r--spec/ruby/core/argf/argv_spec.rb19
-rw-r--r--spec/ruby/core/argf/binmode_spec.rb43
-rw-r--r--spec/ruby/core/argf/bytes_spec.rb6
-rw-r--r--spec/ruby/core/argf/chars_spec.rb6
-rw-r--r--spec/ruby/core/argf/close_spec.rb35
-rw-r--r--spec/ruby/core/argf/closed_spec.rb18
-rw-r--r--spec/ruby/core/argf/codepoints_spec.rb6
-rw-r--r--spec/ruby/core/argf/each_byte_spec.rb6
-rw-r--r--spec/ruby/core/argf/each_char_spec.rb6
-rw-r--r--spec/ruby/core/argf/each_codepoint_spec.rb6
-rw-r--r--spec/ruby/core/argf/each_line_spec.rb6
-rw-r--r--spec/ruby/core/argf/each_spec.rb6
-rw-r--r--spec/ruby/core/argf/eof_spec.rb10
-rw-r--r--spec/ruby/core/argf/file_spec.rb21
-rw-r--r--spec/ruby/core/argf/filename_spec.rb6
-rw-r--r--spec/ruby/core/argf/fileno_spec.rb6
-rw-r--r--spec/ruby/core/argf/fixtures/bin_file.txt2
-rw-r--r--spec/ruby/core/argf/fixtures/file1.txt2
-rw-r--r--spec/ruby/core/argf/fixtures/file2.txt2
-rw-r--r--spec/ruby/core/argf/fixtures/filename.rb3
-rw-r--r--spec/ruby/core/argf/fixtures/lineno.rb5
-rw-r--r--spec/ruby/core/argf/fixtures/rewind.rb5
-rw-r--r--spec/ruby/core/argf/fixtures/stdin.txt2
-rw-r--r--spec/ruby/core/argf/getc_spec.rb20
-rw-r--r--spec/ruby/core/argf/gets_spec.rb49
-rw-r--r--spec/ruby/core/argf/lineno_spec.rb30
-rw-r--r--spec/ruby/core/argf/lines_spec.rb6
-rw-r--r--spec/ruby/core/argf/path_spec.rb6
-rw-r--r--spec/ruby/core/argf/pos_spec.rb38
-rw-r--r--spec/ruby/core/argf/read_nonblock_spec.rb80
-rw-r--r--spec/ruby/core/argf/read_spec.rb85
-rw-r--r--spec/ruby/core/argf/readchar_spec.rb19
-rw-r--r--spec/ruby/core/argf/readline_spec.rb23
-rw-r--r--spec/ruby/core/argf/readlines_spec.rb6
-rw-r--r--spec/ruby/core/argf/readpartial_spec.rb75
-rw-r--r--spec/ruby/core/argf/rewind_spec.rb39
-rw-r--r--spec/ruby/core/argf/seek_spec.rb63
-rw-r--r--spec/ruby/core/argf/set_encoding_spec.rb41
-rw-r--r--spec/ruby/core/argf/shared/each_byte.rb58
-rw-r--r--spec/ruby/core/argf/shared/each_char.rb58
-rw-r--r--spec/ruby/core/argf/shared/each_codepoint.rb58
-rw-r--r--spec/ruby/core/argf/shared/each_line.rb62
-rw-r--r--spec/ruby/core/argf/shared/eof.rb24
-rw-r--r--spec/ruby/core/argf/shared/filename.rb28
-rw-r--r--spec/ruby/core/argf/shared/fileno.rb24
-rw-r--r--spec/ruby/core/argf/shared/getc.rb17
-rw-r--r--spec/ruby/core/argf/shared/gets.rb99
-rw-r--r--spec/ruby/core/argf/shared/pos.rb31
-rw-r--r--spec/ruby/core/argf/shared/read.rb58
-rw-r--r--spec/ruby/core/argf/shared/readlines.rb22
-rw-r--r--spec/ruby/core/argf/skip_spec.rb42
-rw-r--r--spec/ruby/core/argf/tell_spec.rb6
-rw-r--r--spec/ruby/core/argf/to_a_spec.rb6
-rw-r--r--spec/ruby/core/argf/to_i_spec.rb6
-rw-r--r--spec/ruby/core/argf/to_io_spec.rb23
-rw-r--r--spec/ruby/core/argf/to_s_spec.rb14
-rw-r--r--spec/ruby/core/array/allocate_spec.rb19
-rw-r--r--spec/ruby/core/array/any_spec.rb37
-rw-r--r--spec/ruby/core/array/append_spec.rb42
-rw-r--r--spec/ruby/core/array/array_spec.rb7
-rw-r--r--spec/ruby/core/array/assoc_spec.rb40
-rw-r--r--spec/ruby/core/array/at_spec.rb56
-rw-r--r--spec/ruby/core/array/bsearch_index_spec.rb85
-rw-r--r--spec/ruby/core/array/bsearch_spec.rb84
-rw-r--r--spec/ruby/core/array/clear_spec.rb52
-rw-r--r--spec/ruby/core/array/clone_spec.rb31
-rw-r--r--spec/ruby/core/array/collect_spec.rb11
-rw-r--r--spec/ruby/core/array/combination_spec.rb74
-rw-r--r--spec/ruby/core/array/compact_spec.rb81
-rw-r--r--spec/ruby/core/array/comparison_spec.rb97
-rw-r--r--spec/ruby/core/array/concat_spec.rb132
-rw-r--r--spec/ruby/core/array/constructor_spec.rb24
-rw-r--r--spec/ruby/core/array/count_spec.rb15
-rw-r--r--spec/ruby/core/array/cycle_spec.rb101
-rw-r--r--spec/ruby/core/array/delete_at_spec.rb63
-rw-r--r--spec/ruby/core/array/delete_if_spec.rb68
-rw-r--r--spec/ruby/core/array/delete_spec.rb68
-rw-r--r--spec/ruby/core/array/difference_spec.rb24
-rw-r--r--spec/ruby/core/array/dig_spec.rb52
-rw-r--r--spec/ruby/core/array/drop_spec.rb51
-rw-r--r--spec/ruby/core/array/drop_while_spec.rb15
-rw-r--r--spec/ruby/core/array/dup_spec.rb31
-rw-r--r--spec/ruby/core/array/each_index_spec.rb42
-rw-r--r--spec/ruby/core/array/each_spec.rb48
-rw-r--r--spec/ruby/core/array/element_reference_spec.rb50
-rw-r--r--spec/ruby/core/array/element_set_spec.rb436
-rw-r--r--spec/ruby/core/array/empty_spec.rb10
-rw-r--r--spec/ruby/core/array/eql_spec.rb19
-rw-r--r--spec/ruby/core/array/equal_value_spec.rb51
-rw-r--r--spec/ruby/core/array/fetch_spec.rb55
-rw-r--r--spec/ruby/core/array/fill_spec.rb317
-rw-r--r--spec/ruby/core/array/filter_spec.rb16
-rw-r--r--spec/ruby/core/array/find_index_spec.rb6
-rw-r--r--spec/ruby/core/array/first_spec.rb93
-rw-r--r--spec/ruby/core/array/fixtures/classes.rb522
-rw-r--r--spec/ruby/core/array/fixtures/encoded_strings.rb69
-rw-r--r--spec/ruby/core/array/flatten_spec.rb286
-rw-r--r--spec/ruby/core/array/frozen_spec.rb16
-rw-r--r--spec/ruby/core/array/hash_spec.rb83
-rw-r--r--spec/ruby/core/array/include_spec.rb33
-rw-r--r--spec/ruby/core/array/index_spec.rb6
-rw-r--r--spec/ruby/core/array/initialize_spec.rb156
-rw-r--r--spec/ruby/core/array/insert_spec.rb78
-rw-r--r--spec/ruby/core/array/inspect_spec.rb7
-rw-r--r--spec/ruby/core/array/intersection_spec.rb87
-rw-r--r--spec/ruby/core/array/join_spec.rb50
-rw-r--r--spec/ruby/core/array/keep_if_spec.rb10
-rw-r--r--spec/ruby/core/array/last_spec.rb87
-rw-r--r--spec/ruby/core/array/length_spec.rb7
-rw-r--r--spec/ruby/core/array/map_spec.rb11
-rw-r--r--spec/ruby/core/array/max_spec.rb116
-rw-r--r--spec/ruby/core/array/min_spec.rb121
-rw-r--r--spec/ruby/core/array/minus_spec.rb7
-rw-r--r--spec/ruby/core/array/multiply_spec.rb134
-rw-r--r--spec/ruby/core/array/new_spec.rb122
-rw-r--r--spec/ruby/core/array/pack/a_spec.rb62
-rw-r--r--spec/ruby/core/array/pack/at_spec.rb30
-rw-r--r--spec/ruby/core/array/pack/b_spec.rb108
-rw-r--r--spec/ruby/core/array/pack/buffer_spec.rb50
-rw-r--r--spec/ruby/core/array/pack/c_spec.rb75
-rw-r--r--spec/ruby/core/array/pack/comment_spec.rb25
-rw-r--r--spec/ruby/core/array/pack/d_spec.rb39
-rw-r--r--spec/ruby/core/array/pack/e_spec.rb25
-rw-r--r--spec/ruby/core/array/pack/empty_spec.rb11
-rw-r--r--spec/ruby/core/array/pack/f_spec.rb39
-rw-r--r--spec/ruby/core/array/pack/g_spec.rb25
-rw-r--r--spec/ruby/core/array/pack/h_spec.rb200
-rw-r--r--spec/ruby/core/array/pack/i_spec.rb133
-rw-r--r--spec/ruby/core/array/pack/j_spec.rb217
-rw-r--r--spec/ruby/core/array/pack/l_spec.rb221
-rw-r--r--spec/ruby/core/array/pack/m_spec.rb309
-rw-r--r--spec/ruby/core/array/pack/n_spec.rb25
-rw-r--r--spec/ruby/core/array/pack/p_spec.rb62
-rw-r--r--spec/ruby/core/array/pack/percent_spec.rb7
-rw-r--r--spec/ruby/core/array/pack/q_spec.rb61
-rw-r--r--spec/ruby/core/array/pack/s_spec.rb133
-rw-r--r--spec/ruby/core/array/pack/shared/basic.rb69
-rw-r--r--spec/ruby/core/array/pack/shared/encodings.rb16
-rw-r--r--spec/ruby/core/array/pack/shared/float.rb229
-rw-r--r--spec/ruby/core/array/pack/shared/integer.rb381
-rw-r--r--spec/ruby/core/array/pack/shared/numeric_basic.rb44
-rw-r--r--spec/ruby/core/array/pack/shared/string.rb48
-rw-r--r--spec/ruby/core/array/pack/shared/taint.rb35
-rw-r--r--spec/ruby/core/array/pack/shared/unicode.rb94
-rw-r--r--spec/ruby/core/array/pack/u_spec.rb130
-rw-r--r--spec/ruby/core/array/pack/v_spec.rb25
-rw-r--r--spec/ruby/core/array/pack/w_spec.rb42
-rw-r--r--spec/ruby/core/array/pack/x_spec.rb64
-rw-r--r--spec/ruby/core/array/pack/z_spec.rb34
-rw-r--r--spec/ruby/core/array/partition_spec.rb43
-rw-r--r--spec/ruby/core/array/permutation_spec.rb138
-rw-r--r--spec/ruby/core/array/plus_spec.rb59
-rw-r--r--spec/ruby/core/array/pop_spec.rb176
-rw-r--r--spec/ruby/core/array/prepend_spec.rb9
-rw-r--r--spec/ruby/core/array/product_spec.rb68
-rw-r--r--spec/ruby/core/array/push_spec.rb7
-rw-r--r--spec/ruby/core/array/rassoc_spec.rb38
-rw-r--r--spec/ruby/core/array/reject_spec.rb143
-rw-r--r--spec/ruby/core/array/repeated_combination_spec.rb84
-rw-r--r--spec/ruby/core/array/repeated_permutation_spec.rb94
-rw-r--r--spec/ruby/core/array/replace_spec.rb7
-rw-r--r--spec/ruby/core/array/reverse_each_spec.rb43
-rw-r--r--spec/ruby/core/array/reverse_spec.rb42
-rw-r--r--spec/ruby/core/array/rindex_spec.rb80
-rw-r--r--spec/ruby/core/array/rotate_spec.rb129
-rw-r--r--spec/ruby/core/array/sample_spec.rb155
-rw-r--r--spec/ruby/core/array/select_spec.rb14
-rw-r--r--spec/ruby/core/array/shared/clone.rb44
-rw-r--r--spec/ruby/core/array/shared/collect.rb140
-rw-r--r--spec/ruby/core/array/shared/delete_if.rb13
-rw-r--r--spec/ruby/core/array/shared/difference.rb78
-rw-r--r--spec/ruby/core/array/shared/enumeratorize.rb5
-rw-r--r--spec/ruby/core/array/shared/eql.rb92
-rw-r--r--spec/ruby/core/array/shared/index.rb37
-rw-r--r--spec/ruby/core/array/shared/inspect.rb133
-rw-r--r--spec/ruby/core/array/shared/join.rb167
-rw-r--r--spec/ruby/core/array/shared/keep_if.rb60
-rw-r--r--spec/ruby/core/array/shared/length.rb11
-rw-r--r--spec/ruby/core/array/shared/push.rb33
-rw-r--r--spec/ruby/core/array/shared/replace.rb60
-rw-r--r--spec/ruby/core/array/shared/select.rb32
-rw-r--r--spec/ruby/core/array/shared/slice.rb480
-rw-r--r--spec/ruby/core/array/shared/union.rb79
-rw-r--r--spec/ruby/core/array/shared/unshift.rb46
-rw-r--r--spec/ruby/core/array/shift_spec.rb136
-rw-r--r--spec/ruby/core/array/shuffle_spec.rb102
-rw-r--r--spec/ruby/core/array/size_spec.rb7
-rw-r--r--spec/ruby/core/array/slice_spec.rb160
-rw-r--r--spec/ruby/core/array/sort_by_spec.rb52
-rw-r--r--spec/ruby/core/array/sort_spec.rb252
-rw-r--r--spec/ruby/core/array/sum_spec.rb42
-rw-r--r--spec/ruby/core/array/take_spec.rb27
-rw-r--r--spec/ruby/core/array/take_while_spec.rb15
-rw-r--r--spec/ruby/core/array/to_a_spec.rb24
-rw-r--r--spec/ruby/core/array/to_ary_spec.rb20
-rw-r--r--spec/ruby/core/array/to_h_spec.rb81
-rw-r--r--spec/ruby/core/array/to_s_spec.rb8
-rw-r--r--spec/ruby/core/array/transpose_spec.rb53
-rw-r--r--spec/ruby/core/array/try_convert_spec.rb50
-rw-r--r--spec/ruby/core/array/union_spec.rb27
-rw-r--r--spec/ruby/core/array/uniq_spec.rb253
-rw-r--r--spec/ruby/core/array/unshift_spec.rb7
-rw-r--r--spec/ruby/core/array/values_at_spec.rb63
-rw-r--r--spec/ruby/core/array/zip_spec.rb65
-rw-r--r--spec/ruby/core/basicobject/__id__spec.rb6
-rw-r--r--spec/ruby/core/basicobject/__send___spec.rb10
-rw-r--r--spec/ruby/core/basicobject/basicobject_spec.rb91
-rw-r--r--spec/ruby/core/basicobject/equal_spec.rb52
-rw-r--r--spec/ruby/core/basicobject/equal_value_spec.rb10
-rw-r--r--spec/ruby/core/basicobject/fixtures/classes.rb33
-rw-r--r--spec/ruby/core/basicobject/fixtures/common.rb9
-rw-r--r--spec/ruby/core/basicobject/fixtures/remove_method_missing.rb9
-rw-r--r--spec/ruby/core/basicobject/fixtures/singleton_method.rb10
-rw-r--r--spec/ruby/core/basicobject/initialize_spec.rb13
-rw-r--r--spec/ruby/core/basicobject/instance_eval_spec.rb188
-rw-r--r--spec/ruby/core/basicobject/instance_exec_spec.rb107
-rw-r--r--spec/ruby/core/basicobject/method_missing_spec.rb39
-rw-r--r--spec/ruby/core/basicobject/not_equal_spec.rb53
-rw-r--r--spec/ruby/core/basicobject/not_spec.rb11
-rw-r--r--spec/ruby/core/basicobject/singleton_method_added_spec.rb86
-rw-r--r--spec/ruby/core/basicobject/singleton_method_removed_spec.rb24
-rw-r--r--spec/ruby/core/basicobject/singleton_method_undefined_spec.rb24
-rw-r--r--spec/ruby/core/binding/clone_spec.rb7
-rw-r--r--spec/ruby/core/binding/dup_spec.rb7
-rw-r--r--spec/ruby/core/binding/eval_spec.rb95
-rw-r--r--spec/ruby/core/binding/fixtures/classes.rb52
-rw-r--r--spec/ruby/core/binding/fixtures/irb.rb3
-rw-r--r--spec/ruby/core/binding/fixtures/irbrc1
-rw-r--r--spec/ruby/core/binding/fixtures/location.rb6
-rw-r--r--spec/ruby/core/binding/irb_spec.rb18
-rw-r--r--spec/ruby/core/binding/local_variable_defined_spec.rb46
-rw-r--r--spec/ruby/core/binding/local_variable_get_spec.rb56
-rw-r--r--spec/ruby/core/binding/local_variable_set_spec.rb71
-rw-r--r--spec/ruby/core/binding/local_variables_spec.rb35
-rw-r--r--spec/ruby/core/binding/receiver_spec.rb11
-rw-r--r--spec/ruby/core/binding/shared/clone.rb34
-rw-r--r--spec/ruby/core/binding/source_location_spec.rb11
-rw-r--r--spec/ruby/core/builtin_constants/builtin_constants_spec.rb57
-rw-r--r--spec/ruby/core/class/allocate_spec.rb41
-rw-r--r--spec/ruby/core/class/dup_spec.rb64
-rw-r--r--spec/ruby/core/class/fixtures/classes.rb47
-rw-r--r--spec/ruby/core/class/inherited_spec.rb101
-rw-r--r--spec/ruby/core/class/initialize_spec.rb34
-rw-r--r--spec/ruby/core/class/new_spec.rb154
-rw-r--r--spec/ruby/core/class/superclass_spec.rb27
-rw-r--r--spec/ruby/core/comparable/between_spec.rb25
-rw-r--r--spec/ruby/core/comparable/clamp_spec.rb88
-rw-r--r--spec/ruby/core/comparable/equal_value_spec.rb114
-rw-r--r--spec/ruby/core/comparable/fixtures/classes.rb36
-rw-r--r--spec/ruby/core/comparable/gt_spec.rb43
-rw-r--r--spec/ruby/core/comparable/gte_spec.rb47
-rw-r--r--spec/ruby/core/comparable/lt_spec.rb43
-rw-r--r--spec/ruby/core/comparable/lte_spec.rb46
-rw-r--r--spec/ruby/core/complex/abs2_spec.rb9
-rw-r--r--spec/ruby/core/complex/abs_spec.rb6
-rw-r--r--spec/ruby/core/complex/angle_spec.rb6
-rw-r--r--spec/ruby/core/complex/arg_spec.rb6
-rw-r--r--spec/ruby/core/complex/coerce_spec.rb70
-rw-r--r--spec/ruby/core/complex/conj_spec.rb6
-rw-r--r--spec/ruby/core/complex/conjugate_spec.rb6
-rw-r--r--spec/ruby/core/complex/constants_spec.rb7
-rw-r--r--spec/ruby/core/complex/denominator_spec.rb13
-rw-r--r--spec/ruby/core/complex/divide_spec.rb6
-rw-r--r--spec/ruby/core/complex/eql_spec.rb31
-rw-r--r--spec/ruby/core/complex/equal_value_spec.rb93
-rw-r--r--spec/ruby/core/complex/exponent_spec.rb61
-rw-r--r--spec/ruby/core/complex/fdiv_spec.rb129
-rw-r--r--spec/ruby/core/complex/finite_spec.rb32
-rw-r--r--spec/ruby/core/complex/hash_spec.rb16
-rw-r--r--spec/ruby/core/complex/imag_spec.rb6
-rw-r--r--spec/ruby/core/complex/imaginary_spec.rb6
-rw-r--r--spec/ruby/core/complex/infinite_spec.rb32
-rw-r--r--spec/ruby/core/complex/inspect_spec.rb16
-rw-r--r--spec/ruby/core/complex/integer_spec.rb11
-rw-r--r--spec/ruby/core/complex/magnitude_spec.rb6
-rw-r--r--spec/ruby/core/complex/marshal_dump_spec.rb11
-rw-r--r--spec/ruby/core/complex/minus_spec.rb45
-rw-r--r--spec/ruby/core/complex/multiply_spec.rb49
-rw-r--r--spec/ruby/core/complex/negative_spec.rb13
-rw-r--r--spec/ruby/core/complex/numerator_spec.rb19
-rw-r--r--spec/ruby/core/complex/phase_spec.rb6
-rw-r--r--spec/ruby/core/complex/plus_spec.rb45
-rw-r--r--spec/ruby/core/complex/polar_spec.rb27
-rw-r--r--spec/ruby/core/complex/positive_spec.rb13
-rw-r--r--spec/ruby/core/complex/quo_spec.rb6
-rw-r--r--spec/ruby/core/complex/rationalize_spec.rb31
-rw-r--r--spec/ruby/core/complex/real_spec.rb28
-rw-r--r--spec/ruby/core/complex/rect_spec.rb10
-rw-r--r--spec/ruby/core/complex/rectangular_spec.rb10
-rw-r--r--spec/ruby/core/complex/shared/abs.rb10
-rw-r--r--spec/ruby/core/complex/shared/arg.rb9
-rw-r--r--spec/ruby/core/complex/shared/conjugate.rb8
-rw-r--r--spec/ruby/core/complex/shared/divide.rb82
-rw-r--r--spec/ruby/core/complex/shared/image.rb8
-rw-r--r--spec/ruby/core/complex/shared/rect.rb94
-rw-r--r--spec/ruby/core/complex/spaceship_spec.rb27
-rw-r--r--spec/ruby/core/complex/to_f_spec.rb41
-rw-r--r--spec/ruby/core/complex/to_i_spec.rb41
-rw-r--r--spec/ruby/core/complex/to_r_spec.rb41
-rw-r--r--spec/ruby/core/complex/to_s_spec.rb44
-rw-r--r--spec/ruby/core/complex/uminus_spec.rb11
-rw-r--r--spec/ruby/core/data/constants_spec.rb22
-rw-r--r--spec/ruby/core/dir/chdir_spec.rb124
-rw-r--r--spec/ruby/core/dir/children_spec.rb138
-rw-r--r--spec/ruby/core/dir/chroot_spec.rb47
-rw-r--r--spec/ruby/core/dir/close_spec.rb19
-rw-r--r--spec/ruby/core/dir/delete_spec.rb15
-rw-r--r--spec/ruby/core/dir/dir_spec.rb7
-rw-r--r--spec/ruby/core/dir/each_child_spec.rb105
-rw-r--r--spec/ruby/core/dir/each_spec.rb64
-rw-r--r--spec/ruby/core/dir/element_reference_spec.rb33
-rw-r--r--spec/ruby/core/dir/empty_spec.rb31
-rw-r--r--spec/ruby/core/dir/entries_spec.rb70
-rw-r--r--spec/ruby/core/dir/exist_spec.rb15
-rw-r--r--spec/ruby/core/dir/exists_spec.rb15
-rw-r--r--spec/ruby/core/dir/fileno_spec.rb37
-rw-r--r--spec/ruby/core/dir/fixtures/common.rb169
-rw-r--r--spec/ruby/core/dir/foreach_spec.rb56
-rw-r--r--spec/ruby/core/dir/getwd_spec.rb15
-rw-r--r--spec/ruby/core/dir/glob_spec.rb168
-rw-r--r--spec/ruby/core/dir/home_spec.rb45
-rw-r--r--spec/ruby/core/dir/initialize_spec.rb23
-rw-r--r--spec/ruby/core/dir/inspect_spec.rb24
-rw-r--r--spec/ruby/core/dir/mkdir_spec.rb87
-rw-r--r--spec/ruby/core/dir/open_spec.rb15
-rw-r--r--spec/ruby/core/dir/path_spec.rb15
-rw-r--r--spec/ruby/core/dir/pos_spec.rb40
-rw-r--r--spec/ruby/core/dir/pwd_spec.rb39
-rw-r--r--spec/ruby/core/dir/read_spec.rb43
-rw-r--r--spec/ruby/core/dir/rewind_spec.rb36
-rw-r--r--spec/ruby/core/dir/rmdir_spec.rb15
-rw-r--r--spec/ruby/core/dir/seek_spec.rb19
-rw-r--r--spec/ruby/core/dir/shared/chroot.rb41
-rw-r--r--spec/ruby/core/dir/shared/closed.rb9
-rw-r--r--spec/ruby/core/dir/shared/delete.rb63
-rw-r--r--spec/ruby/core/dir/shared/exist.rb56
-rw-r--r--spec/ruby/core/dir/shared/glob.rb415
-rw-r--r--spec/ruby/core/dir/shared/open.rb73
-rw-r--r--spec/ruby/core/dir/shared/path.rb30
-rw-r--r--spec/ruby/core/dir/shared/pos.rb51
-rw-r--r--spec/ruby/core/dir/shared/pwd.rb45
-rw-r--r--spec/ruby/core/dir/tell_spec.rb18
-rw-r--r--spec/ruby/core/dir/to_path_spec.rb15
-rw-r--r--spec/ruby/core/dir/unlink_spec.rb15
-rw-r--r--spec/ruby/core/encoding/_dump_spec.rb5
-rw-r--r--spec/ruby/core/encoding/_load_spec.rb5
-rw-r--r--spec/ruby/core/encoding/aliases_spec.rb43
-rw-r--r--spec/ruby/core/encoding/ascii_compatible_spec.rb11
-rw-r--r--spec/ruby/core/encoding/compatible_spec.rb379
-rw-r--r--spec/ruby/core/encoding/converter/asciicompat_encoding_spec.rb37
-rw-r--r--spec/ruby/core/encoding/converter/constants_spec.rb131
-rw-r--r--spec/ruby/core/encoding/converter/convert_spec.rb45
-rw-r--r--spec/ruby/core/encoding/converter/convpath_spec.rb24
-rw-r--r--spec/ruby/core/encoding/converter/destination_encoding_spec.rb11
-rw-r--r--spec/ruby/core/encoding/converter/finish_spec.rb36
-rw-r--r--spec/ruby/core/encoding/converter/insert_output_spec.rb5
-rw-r--r--spec/ruby/core/encoding/converter/inspect_spec.rb13
-rw-r--r--spec/ruby/core/encoding/converter/last_error_spec.rb91
-rw-r--r--spec/ruby/core/encoding/converter/new_spec.rb119
-rw-r--r--spec/ruby/core/encoding/converter/primitive_convert_spec.rb211
-rw-r--r--spec/ruby/core/encoding/converter/primitive_errinfo_spec.rb68
-rw-r--r--spec/ruby/core/encoding/converter/putback_spec.rb47
-rw-r--r--spec/ruby/core/encoding/converter/replacement_spec.rb72
-rw-r--r--spec/ruby/core/encoding/converter/search_convpath_spec.rb30
-rw-r--r--spec/ruby/core/encoding/converter/source_encoding_spec.rb11
-rw-r--r--spec/ruby/core/encoding/default_external_spec.rb63
-rw-r--r--spec/ruby/core/encoding/default_internal_spec.rb74
-rw-r--r--spec/ruby/core/encoding/dummy_spec.rb14
-rw-r--r--spec/ruby/core/encoding/find_spec.rb82
-rw-r--r--spec/ruby/core/encoding/fixtures/classes.rb49
-rw-r--r--spec/ruby/core/encoding/inspect_spec.rb19
-rw-r--r--spec/ruby/core/encoding/invalid_byte_sequence_error/destination_encoding_name_spec.rb18
-rw-r--r--spec/ruby/core/encoding/invalid_byte_sequence_error/destination_encoding_spec.rb18
-rw-r--r--spec/ruby/core/encoding/invalid_byte_sequence_error/error_bytes_spec.rb30
-rw-r--r--spec/ruby/core/encoding/invalid_byte_sequence_error/incomplete_input_spec.rb29
-rw-r--r--spec/ruby/core/encoding/invalid_byte_sequence_error/readagain_bytes_spec.rb30
-rw-r--r--spec/ruby/core/encoding/invalid_byte_sequence_error/source_encoding_name_spec.rb28
-rw-r--r--spec/ruby/core/encoding/invalid_byte_sequence_error/source_encoding_spec.rb33
-rw-r--r--spec/ruby/core/encoding/list_spec.rb41
-rw-r--r--spec/ruby/core/encoding/locale_charmap_spec.rb45
-rw-r--r--spec/ruby/core/encoding/name_list_spec.rb23
-rw-r--r--spec/ruby/core/encoding/name_spec.rb5
-rw-r--r--spec/ruby/core/encoding/names_spec.rb35
-rw-r--r--spec/ruby/core/encoding/replicate_spec.rb46
-rw-r--r--spec/ruby/core/encoding/shared/name.rb15
-rw-r--r--spec/ruby/core/encoding/to_s_spec.rb5
-rw-r--r--spec/ruby/core/encoding/undefined_conversion_error/destination_encoding_name_spec.rb15
-rw-r--r--spec/ruby/core/encoding/undefined_conversion_error/destination_encoding_spec.rb15
-rw-r--r--spec/ruby/core/encoding/undefined_conversion_error/error_char_spec.rb27
-rw-r--r--spec/ruby/core/encoding/undefined_conversion_error/source_encoding_name_spec.rb28
-rw-r--r--spec/ruby/core/encoding/undefined_conversion_error/source_encoding_spec.rb29
-rw-r--r--spec/ruby/core/enumerable/all_spec.rb201
-rw-r--r--spec/ruby/core/enumerable/any_spec.rb214
-rw-r--r--spec/ruby/core/enumerable/chain_spec.rb25
-rw-r--r--spec/ruby/core/enumerable/chunk_spec.rb67
-rw-r--r--spec/ruby/core/enumerable/chunk_while_spec.rb42
-rw-r--r--spec/ruby/core/enumerable/collect_concat_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/collect_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/count_spec.rb59
-rw-r--r--spec/ruby/core/enumerable/cycle_spec.rb104
-rw-r--r--spec/ruby/core/enumerable/detect_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/drop_spec.rb43
-rw-r--r--spec/ruby/core/enumerable/drop_while_spec.rb50
-rw-r--r--spec/ruby/core/enumerable/each_cons_spec.rb99
-rw-r--r--spec/ruby/core/enumerable/each_entry_spec.rb41
-rw-r--r--spec/ruby/core/enumerable/each_slice_spec.rb101
-rw-r--r--spec/ruby/core/enumerable/each_with_index_spec.rb53
-rw-r--r--spec/ruby/core/enumerable/each_with_object_spec.rb41
-rw-r--r--spec/ruby/core/enumerable/entries_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/filter_map_spec.rb26
-rw-r--r--spec/ruby/core/enumerable/filter_spec.rb9
-rw-r--r--spec/ruby/core/enumerable/find_all_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/find_index_spec.rb89
-rw-r--r--spec/ruby/core/enumerable/find_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/first_spec.rb28
-rw-r--r--spec/ruby/core/enumerable/fixtures/classes.rb345
-rw-r--r--spec/ruby/core/enumerable/flat_map_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/grep_spec.rb74
-rw-r--r--spec/ruby/core/enumerable/grep_v_spec.rb63
-rw-r--r--spec/ruby/core/enumerable/group_by_spec.rb47
-rw-r--r--spec/ruby/core/enumerable/include_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/inject_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/lazy_spec.rb10
-rw-r--r--spec/ruby/core/enumerable/map_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/max_by_spec.rb81
-rw-r--r--spec/ruby/core/enumerable/max_spec.rb119
-rw-r--r--spec/ruby/core/enumerable/member_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/min_by_spec.rb81
-rw-r--r--spec/ruby/core/enumerable/min_spec.rb123
-rw-r--r--spec/ruby/core/enumerable/minmax_by_spec.rb44
-rw-r--r--spec/ruby/core/enumerable/minmax_spec.rb44
-rw-r--r--spec/ruby/core/enumerable/none_spec.rb167
-rw-r--r--spec/ruby/core/enumerable/one_spec.rb169
-rw-r--r--spec/ruby/core/enumerable/partition_spec.rb20
-rw-r--r--spec/ruby/core/enumerable/reduce_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/reject_spec.rb25
-rw-r--r--spec/ruby/core/enumerable/reverse_each_spec.rb26
-rw-r--r--spec/ruby/core/enumerable/select_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/shared/collect.rb38
-rw-r--r--spec/ruby/core/enumerable/shared/collect_concat.rb54
-rw-r--r--spec/ruby/core/enumerable/shared/entries.rb26
-rw-r--r--spec/ruby/core/enumerable/shared/enumerable_enumeratorized.rb33
-rw-r--r--spec/ruby/core/enumerable/shared/enumeratorized.rb42
-rw-r--r--spec/ruby/core/enumerable/shared/find.rb77
-rw-r--r--spec/ruby/core/enumerable/shared/find_all.rb31
-rw-r--r--spec/ruby/core/enumerable/shared/include.rb34
-rw-r--r--spec/ruby/core/enumerable/shared/inject.rb69
-rw-r--r--spec/ruby/core/enumerable/shared/take.rb63
-rw-r--r--spec/ruby/core/enumerable/slice_after_spec.rb61
-rw-r--r--spec/ruby/core/enumerable/slice_before_spec.rb64
-rw-r--r--spec/ruby/core/enumerable/slice_when_spec.rb54
-rw-r--r--spec/ruby/core/enumerable/sort_by_spec.rb43
-rw-r--r--spec/ruby/core/enumerable/sort_spec.rb54
-rw-r--r--spec/ruby/core/enumerable/sum_spec.rb28
-rw-r--r--spec/ruby/core/enumerable/take_spec.rb13
-rw-r--r--spec/ruby/core/enumerable/take_while_spec.rb51
-rw-r--r--spec/ruby/core/enumerable/tally_spec.rb35
-rw-r--r--spec/ruby/core/enumerable/to_a_spec.rb7
-rw-r--r--spec/ruby/core/enumerable/to_h_spec.rb90
-rw-r--r--spec/ruby/core/enumerable/uniq_spec.rb122
-rw-r--r--spec/ruby/core/enumerable/zip_spec.rb41
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/begin_spec.rb11
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/each_spec.rb19
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/end_spec.rb11
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/eq_spec.rb20
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/exclude_end_spec.rb19
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/first_spec.rb11
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/hash_spec.rb22
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/inspect_spec.rb22
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/last_spec.rb11
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/new_spec.rb19
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/size_spec.rb19
-rw-r--r--spec/ruby/core/enumerator/arithmetic_sequence/step_spec.rb15
-rw-r--r--spec/ruby/core/enumerator/chain/each_spec.rb17
-rw-r--r--spec/ruby/core/enumerator/chain/initialize_spec.rb33
-rw-r--r--spec/ruby/core/enumerator/chain/inspect_spec.rb16
-rw-r--r--spec/ruby/core/enumerator/chain/rewind_spec.rb53
-rw-r--r--spec/ruby/core/enumerator/chain/size_spec.rb24
-rw-r--r--spec/ruby/core/enumerator/each_spec.rb89
-rw-r--r--spec/ruby/core/enumerator/each_with_index_spec.rb36
-rw-r--r--spec/ruby/core/enumerator/each_with_object_spec.rb6
-rw-r--r--spec/ruby/core/enumerator/enum_for_spec.rb6
-rw-r--r--spec/ruby/core/enumerator/enumerator_spec.rb7
-rw-r--r--spec/ruby/core/enumerator/feed_spec.rb52
-rw-r--r--spec/ruby/core/enumerator/first_spec.rb7
-rw-r--r--spec/ruby/core/enumerator/fixtures/common.rb9
-rw-r--r--spec/ruby/core/enumerator/generator/each_spec.rb40
-rw-r--r--spec/ruby/core/enumerator/generator/initialize_spec.rb26
-rw-r--r--spec/ruby/core/enumerator/initialize_spec.rb61
-rw-r--r--spec/ruby/core/enumerator/inspect_spec.rb17
-rw-r--r--spec/ruby/core/enumerator/lazy/chunk_spec.rb67
-rw-r--r--spec/ruby/core/enumerator/lazy/chunk_while_spec.rb9
-rw-r--r--spec/ruby/core/enumerator/lazy/collect_concat_spec.rb8
-rw-r--r--spec/ruby/core/enumerator/lazy/collect_spec.rb8
-rw-r--r--spec/ruby/core/enumerator/lazy/drop_spec.rb58
-rw-r--r--spec/ruby/core/enumerator/lazy/drop_while_spec.rb66
-rw-r--r--spec/ruby/core/enumerator/lazy/enum_for_spec.rb8
-rw-r--r--spec/ruby/core/enumerator/lazy/filter_spec.rb8
-rw-r--r--spec/ruby/core/enumerator/lazy/find_all_spec.rb8
-rw-r--r--spec/ruby/core/enumerator/lazy/fixtures/classes.rb54
-rw-r--r--spec/ruby/core/enumerator/lazy/flat_map_spec.rb16
-rw-r--r--spec/ruby/core/enumerator/lazy/force_spec.rb36
-rw-r--r--spec/ruby/core/enumerator/lazy/grep_spec.rb121
-rw-r--r--spec/ruby/core/enumerator/lazy/grep_v_spec.rb123
-rw-r--r--spec/ruby/core/enumerator/lazy/initialize_spec.rb63
-rw-r--r--spec/ruby/core/enumerator/lazy/lazy_spec.rb28
-rw-r--r--spec/ruby/core/enumerator/lazy/map_spec.rb12
-rw-r--r--spec/ruby/core/enumerator/lazy/reject_spec.rb78
-rw-r--r--spec/ruby/core/enumerator/lazy/select_spec.rb47
-rw-r--r--spec/ruby/core/enumerator/lazy/shared/collect.rb62
-rw-r--r--spec/ruby/core/enumerator/lazy/shared/collect_concat.rb78
-rw-r--r--spec/ruby/core/enumerator/lazy/shared/select.rb66
-rw-r--r--spec/ruby/core/enumerator/lazy/shared/to_enum.rb55
-rw-r--r--spec/ruby/core/enumerator/lazy/slice_after_spec.rb9
-rw-r--r--spec/ruby/core/enumerator/lazy/slice_before_spec.rb9
-rw-r--r--spec/ruby/core/enumerator/lazy/slice_when_spec.rb9
-rw-r--r--spec/ruby/core/enumerator/lazy/take_spec.rb66
-rw-r--r--spec/ruby/core/enumerator/lazy/take_while_spec.rb60
-rw-r--r--spec/ruby/core/enumerator/lazy/to_enum_spec.rb8
-rw-r--r--spec/ruby/core/enumerator/lazy/uniq_spec.rb74
-rw-r--r--spec/ruby/core/enumerator/lazy/zip_spec.rb86
-rw-r--r--spec/ruby/core/enumerator/new_spec.rb41
-rw-r--r--spec/ruby/core/enumerator/next_spec.rb27
-rw-r--r--spec/ruby/core/enumerator/next_values_spec.rb55
-rw-r--r--spec/ruby/core/enumerator/peek_spec.rb36
-rw-r--r--spec/ruby/core/enumerator/peek_values_spec.rb57
-rw-r--r--spec/ruby/core/enumerator/plus_spec.rb35
-rw-r--r--spec/ruby/core/enumerator/rewind_spec.rb70
-rw-r--r--spec/ruby/core/enumerator/size_spec.rb26
-rw-r--r--spec/ruby/core/enumerator/to_enum_spec.rb6
-rw-r--r--spec/ruby/core/enumerator/with_index_spec.rb72
-rw-r--r--spec/ruby/core/enumerator/with_object_spec.rb6
-rw-r--r--spec/ruby/core/enumerator/yielder/append_spec.rb24
-rw-r--r--spec/ruby/core/enumerator/yielder/initialize_spec.rb18
-rw-r--r--spec/ruby/core/enumerator/yielder/yield_spec.rb23
-rw-r--r--spec/ruby/core/env/assoc_spec.rb31
-rw-r--r--spec/ruby/core/env/clear_spec.rb20
-rw-r--r--spec/ruby/core/env/delete_if_spec.rb54
-rw-r--r--spec/ruby/core/env/delete_spec.rb42
-rw-r--r--spec/ruby/core/env/each_key_spec.rb34
-rw-r--r--spec/ruby/core/env/each_pair_spec.rb6
-rw-r--r--spec/ruby/core/env/each_spec.rb6
-rw-r--r--spec/ruby/core/env/each_value_spec.rb34
-rw-r--r--spec/ruby/core/env/element_reference_spec.rb75
-rw-r--r--spec/ruby/core/env/element_set_spec.rb6
-rw-r--r--spec/ruby/core/env/empty_spec.rb23
-rw-r--r--spec/ruby/core/env/fetch_spec.rb62
-rw-r--r--spec/ruby/core/env/filter_spec.rb15
-rw-r--r--spec/ruby/core/env/has_key_spec.rb6
-rw-r--r--spec/ruby/core/env/has_value_spec.rb6
-rw-r--r--spec/ruby/core/env/include_spec.rb6
-rw-r--r--spec/ruby/core/env/index_spec.rb14
-rw-r--r--spec/ruby/core/env/indexes_spec.rb1
-rw-r--r--spec/ruby/core/env/indices_spec.rb1
-rw-r--r--spec/ruby/core/env/inspect_spec.rb11
-rw-r--r--spec/ruby/core/env/invert_spec.rb16
-rw-r--r--spec/ruby/core/env/keep_if_spec.rb54
-rw-r--r--spec/ruby/core/env/key_spec.rb11
-rw-r--r--spec/ruby/core/env/keys_spec.rb14
-rw-r--r--spec/ruby/core/env/length_spec.rb6
-rw-r--r--spec/ruby/core/env/member_spec.rb6
-rw-r--r--spec/ruby/core/env/merge_spec.rb8
-rw-r--r--spec/ruby/core/env/rassoc_spec.rb42
-rw-r--r--spec/ruby/core/env/rehash_spec.rb7
-rw-r--r--spec/ruby/core/env/reject_spec.rb101
-rw-r--r--spec/ruby/core/env/replace_spec.rb51
-rw-r--r--spec/ruby/core/env/select_spec.rb13
-rw-r--r--spec/ruby/core/env/shared/each.rb65
-rw-r--r--spec/ruby/core/env/shared/include.rb23
-rw-r--r--spec/ruby/core/env/shared/key.rb23
-rw-r--r--spec/ruby/core/env/shared/length.rb13
-rw-r--r--spec/ruby/core/env/shared/select.rb61
-rw-r--r--spec/ruby/core/env/shared/store.rb60
-rw-r--r--spec/ruby/core/env/shared/to_hash.rb33
-rw-r--r--spec/ruby/core/env/shared/update.rb100
-rw-r--r--spec/ruby/core/env/shared/value.rb22
-rw-r--r--spec/ruby/core/env/shift_spec.rb57
-rw-r--r--spec/ruby/core/env/size_spec.rb6
-rw-r--r--spec/ruby/core/env/slice_spec.rb29
-rw-r--r--spec/ruby/core/env/spec_helper.rb26
-rw-r--r--spec/ruby/core/env/store_spec.rb6
-rw-r--r--spec/ruby/core/env/to_a_spec.rb18
-rw-r--r--spec/ruby/core/env/to_h_spec.rb60
-rw-r--r--spec/ruby/core/env/to_hash_spec.rb6
-rw-r--r--spec/ruby/core/env/to_s_spec.rb7
-rw-r--r--spec/ruby/core/env/update_spec.rb6
-rw-r--r--spec/ruby/core/env/value_spec.rb6
-rw-r--r--spec/ruby/core/env/values_at_spec.rb37
-rw-r--r--spec/ruby/core/env/values_spec.rb14
-rw-r--r--spec/ruby/core/exception/backtrace_locations_spec.rb39
-rw-r--r--spec/ruby/core/exception/backtrace_spec.rb93
-rw-r--r--spec/ruby/core/exception/case_compare_spec.rb39
-rw-r--r--spec/ruby/core/exception/cause_spec.rb56
-rw-r--r--spec/ruby/core/exception/destination_encoding_name_spec.rb23
-rw-r--r--spec/ruby/core/exception/destination_encoding_spec.rb23
-rw-r--r--spec/ruby/core/exception/dup_spec.rb74
-rw-r--r--spec/ruby/core/exception/equal_value_spec.rb68
-rw-r--r--spec/ruby/core/exception/errno_spec.rb48
-rw-r--r--spec/ruby/core/exception/error_bytes_spec.rb12
-rw-r--r--spec/ruby/core/exception/error_char_spec.rb12
-rw-r--r--spec/ruby/core/exception/exception_spec.rb69
-rw-r--r--spec/ruby/core/exception/exit_value_spec.rb5
-rw-r--r--spec/ruby/core/exception/fixtures/common.rb95
-rw-r--r--spec/ruby/core/exception/frozen_error_spec.rb34
-rw-r--r--spec/ruby/core/exception/full_message_spec.rb94
-rw-r--r--spec/ruby/core/exception/hierarchy_spec.rb62
-rw-r--r--spec/ruby/core/exception/incomplete_input_spec.rb5
-rw-r--r--spec/ruby/core/exception/initialize_spec.rb1
-rw-r--r--spec/ruby/core/exception/inspect_spec.rb24
-rw-r--r--spec/ruby/core/exception/interrupt_spec.rb35
-rw-r--r--spec/ruby/core/exception/io_error_spec.rb51
-rw-r--r--spec/ruby/core/exception/key_error_spec.rb15
-rw-r--r--spec/ruby/core/exception/load_error_spec.rb21
-rw-r--r--spec/ruby/core/exception/message_spec.rb27
-rw-r--r--spec/ruby/core/exception/name_error_spec.rb24
-rw-r--r--spec/ruby/core/exception/name_spec.rb45
-rw-r--r--spec/ruby/core/exception/new_spec.rb7
-rw-r--r--spec/ruby/core/exception/no_method_error_spec.rb106
-rw-r--r--spec/ruby/core/exception/range_error_spec.rb7
-rw-r--r--spec/ruby/core/exception/readagain_bytes_spec.rb12
-rw-r--r--spec/ruby/core/exception/reason_spec.rb5
-rw-r--r--spec/ruby/core/exception/receiver_spec.rb60
-rw-r--r--spec/ruby/core/exception/result_spec.rb29
-rw-r--r--spec/ruby/core/exception/set_backtrace_spec.rb56
-rw-r--r--spec/ruby/core/exception/shared/new.rb18
-rw-r--r--spec/ruby/core/exception/signal_exception_spec.rb125
-rw-r--r--spec/ruby/core/exception/signm_spec.rb5
-rw-r--r--spec/ruby/core/exception/signo_spec.rb5
-rw-r--r--spec/ruby/core/exception/source_encoding_name_spec.rb23
-rw-r--r--spec/ruby/core/exception/source_encoding_spec.rb23
-rw-r--r--spec/ruby/core/exception/standard_error_spec.rb23
-rw-r--r--spec/ruby/core/exception/status_spec.rb5
-rw-r--r--spec/ruby/core/exception/success_spec.rb5
-rw-r--r--spec/ruby/core/exception/system_call_error_spec.rb130
-rw-r--r--spec/ruby/core/exception/system_stack_error_spec.rb7
-rw-r--r--spec/ruby/core/exception/to_s_spec.rb37
-rw-r--r--spec/ruby/core/exception/uncaught_throw_error_spec.rb18
-rw-r--r--spec/ruby/core/false/and_spec.rb11
-rw-r--r--spec/ruby/core/false/dup_spec.rb7
-rw-r--r--spec/ruby/core/false/falseclass_spec.rb15
-rw-r--r--spec/ruby/core/false/inspect_spec.rb7
-rw-r--r--spec/ruby/core/false/or_spec.rb11
-rw-r--r--spec/ruby/core/false/to_s_spec.rb17
-rw-r--r--spec/ruby/core/false/xor_spec.rb11
-rw-r--r--spec/ruby/core/fiber/new_spec.rb39
-rw-r--r--spec/ruby/core/fiber/resume_spec.rb48
-rw-r--r--spec/ruby/core/fiber/yield_spec.rb49
-rw-r--r--spec/ruby/core/file/absolute_path_spec.rb90
-rw-r--r--spec/ruby/core/file/atime_spec.rb55
-rw-r--r--spec/ruby/core/file/basename_spec.rb168
-rw-r--r--spec/ruby/core/file/birthtime_spec.rb60
-rw-r--r--spec/ruby/core/file/blockdev_spec.rb6
-rw-r--r--spec/ruby/core/file/chardev_spec.rb6
-rw-r--r--spec/ruby/core/file/chmod_spec.rb185
-rw-r--r--spec/ruby/core/file/chown_spec.rb144
-rw-r--r--spec/ruby/core/file/constants/constants_spec.rb31
-rw-r--r--spec/ruby/core/file/constants_spec.rb141
-rw-r--r--spec/ruby/core/file/ctime_spec.rb51
-rw-r--r--spec/ruby/core/file/delete_spec.rb6
-rw-r--r--spec/ruby/core/file/directory_spec.rb10
-rw-r--r--spec/ruby/core/file/dirname_spec.rb108
-rw-r--r--spec/ruby/core/file/empty_spec.rb13
-rw-r--r--spec/ruby/core/file/executable_real_spec.rb7
-rw-r--r--spec/ruby/core/file/executable_spec.rb7
-rw-r--r--spec/ruby/core/file/exist_spec.rb6
-rw-r--r--spec/ruby/core/file/exists_spec.rb6
-rw-r--r--spec/ruby/core/file/expand_path_spec.rb265
-rw-r--r--spec/ruby/core/file/extname_spec.rb66
-rw-r--r--spec/ruby/core/file/file_spec.rb16
-rw-r--r--spec/ruby/core/file/fixtures/common.rb22
-rw-r--r--spec/ruby/core/file/fixtures/do_not_remove1
-rw-r--r--spec/ruby/core/file/fixtures/file_types.rb66
-rw-r--r--spec/ruby/core/file/flock_spec.rb106
-rw-r--r--spec/ruby/core/file/fnmatch_spec.rb10
-rw-r--r--spec/ruby/core/file/ftype_spec.rb74
-rw-r--r--spec/ruby/core/file/grpowned_spec.rb10
-rw-r--r--spec/ruby/core/file/identical_spec.rb6
-rw-r--r--spec/ruby/core/file/initialize_spec.rb19
-rw-r--r--spec/ruby/core/file/inspect_spec.rb17
-rw-r--r--spec/ruby/core/file/join_spec.rb139
-rw-r--r--spec/ruby/core/file/lchmod_spec.rb38
-rw-r--r--spec/ruby/core/file/lchown_spec.rb59
-rw-r--r--spec/ruby/core/file/link_spec.rb39
-rw-r--r--spec/ruby/core/file/lstat_spec.rb33
-rw-r--r--spec/ruby/core/file/lutime_spec.rb40
-rw-r--r--spec/ruby/core/file/mkfifo_spec.rb51
-rw-r--r--spec/ruby/core/file/mtime_spec.rb51
-rw-r--r--spec/ruby/core/file/new_spec.rb162
-rw-r--r--spec/ruby/core/file/null_spec.rb15
-rw-r--r--spec/ruby/core/file/open_spec.rb700
-rw-r--r--spec/ruby/core/file/owned_spec.rb35
-rw-r--r--spec/ruby/core/file/path_spec.rb40
-rw-r--r--spec/ruby/core/file/pipe_spec.rb32
-rw-r--r--spec/ruby/core/file/printf_spec.rb18
-rw-r--r--spec/ruby/core/file/read_spec.rb6
-rw-r--r--spec/ruby/core/file/readable_real_spec.rb7
-rw-r--r--spec/ruby/core/file/readable_spec.rb7
-rw-r--r--spec/ruby/core/file/readlink_spec.rb86
-rw-r--r--spec/ruby/core/file/realdirpath_spec.rb104
-rw-r--r--spec/ruby/core/file/realpath_spec.rb88
-rw-r--r--spec/ruby/core/file/rename_spec.rb37
-rw-r--r--spec/ruby/core/file/reopen_spec.rb32
-rw-r--r--spec/ruby/core/file/setgid_spec.rb36
-rw-r--r--spec/ruby/core/file/setuid_spec.rb38
-rw-r--r--spec/ruby/core/file/shared/fnmatch.rb241
-rw-r--r--spec/ruby/core/file/shared/open.rb12
-rw-r--r--spec/ruby/core/file/shared/path.rb77
-rw-r--r--spec/ruby/core/file/shared/read.rb15
-rw-r--r--spec/ruby/core/file/shared/stat.rb32
-rw-r--r--spec/ruby/core/file/shared/unlink.rb61
-rw-r--r--spec/ruby/core/file/size_spec.rb119
-rw-r--r--spec/ruby/core/file/socket_spec.rb42
-rw-r--r--spec/ruby/core/file/split_spec.rb64
-rw-r--r--spec/ruby/core/file/stat/atime_spec.rb18
-rw-r--r--spec/ruby/core/file/stat/birthtime_spec.rb27
-rw-r--r--spec/ruby/core/file/stat/blksize_spec.rb27
-rw-r--r--spec/ruby/core/file/stat/blockdev_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/blocks_spec.rb27
-rw-r--r--spec/ruby/core/file/stat/chardev_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/comparison_spec.rb66
-rw-r--r--spec/ruby/core/file/stat/ctime_spec.rb18
-rw-r--r--spec/ruby/core/file/stat/dev_major_spec.rb23
-rw-r--r--spec/ruby/core/file/stat/dev_minor_spec.rb23
-rw-r--r--spec/ruby/core/file/stat/dev_spec.rb15
-rw-r--r--spec/ruby/core/file/stat/directory_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/executable_real_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/executable_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/file_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/fixtures/classes.rb5
-rw-r--r--spec/ruby/core/file/stat/ftype_spec.rb64
-rw-r--r--spec/ruby/core/file/stat/gid_spec.rb19
-rw-r--r--spec/ruby/core/file/stat/grpowned_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/ino_spec.rb28
-rw-r--r--spec/ruby/core/file/stat/inspect_spec.rb26
-rw-r--r--spec/ruby/core/file/stat/mode_spec.rb19
-rw-r--r--spec/ruby/core/file/stat/mtime_spec.rb18
-rw-r--r--spec/ruby/core/file/stat/new_spec.rb32
-rw-r--r--spec/ruby/core/file/stat/nlink_spec.rb21
-rw-r--r--spec/ruby/core/file/stat/owned_spec.rb33
-rw-r--r--spec/ruby/core/file/stat/pipe_spec.rb32
-rw-r--r--spec/ruby/core/file/stat/rdev_major_spec.rb31
-rw-r--r--spec/ruby/core/file/stat/rdev_minor_spec.rb31
-rw-r--r--spec/ruby/core/file/stat/rdev_spec.rb15
-rw-r--r--spec/ruby/core/file/stat/readable_real_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/readable_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/setgid_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/setuid_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/size_spec.rb21
-rw-r--r--spec/ruby/core/file/stat/socket_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/sticky_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/symlink_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/uid_spec.rb18
-rw-r--r--spec/ruby/core/file/stat/world_readable_spec.rb11
-rw-r--r--spec/ruby/core/file/stat/world_writable_spec.rb11
-rw-r--r--spec/ruby/core/file/stat/writable_real_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/writable_spec.rb7
-rw-r--r--spec/ruby/core/file/stat/zero_spec.rb7
-rw-r--r--spec/ruby/core/file/stat_spec.rb45
-rw-r--r--spec/ruby/core/file/sticky_spec.rb50
-rw-r--r--spec/ruby/core/file/symlink_spec.rb57
-rw-r--r--spec/ruby/core/file/to_path_spec.rb6
-rw-r--r--spec/ruby/core/file/truncate_spec.rb177
-rw-r--r--spec/ruby/core/file/umask_spec.rb57
-rw-r--r--spec/ruby/core/file/unlink_spec.rb6
-rw-r--r--spec/ruby/core/file/utime_spec.rb85
-rw-r--r--spec/ruby/core/file/world_readable_spec.rb12
-rw-r--r--spec/ruby/core/file/world_writable_spec.rb12
-rw-r--r--spec/ruby/core/file/writable_real_spec.rb7
-rw-r--r--spec/ruby/core/file/writable_spec.rb7
-rw-r--r--spec/ruby/core/file/zero_spec.rb13
-rw-r--r--spec/ruby/core/filetest/blockdev_spec.rb6
-rw-r--r--spec/ruby/core/filetest/chardev_spec.rb6
-rw-r--r--spec/ruby/core/filetest/directory_spec.rb10
-rw-r--r--spec/ruby/core/filetest/executable_real_spec.rb7
-rw-r--r--spec/ruby/core/filetest/executable_spec.rb7
-rw-r--r--spec/ruby/core/filetest/exist_spec.rb6
-rw-r--r--spec/ruby/core/filetest/exists_spec.rb6
-rw-r--r--spec/ruby/core/filetest/file_spec.rb10
-rw-r--r--spec/ruby/core/filetest/grpowned_spec.rb10
-rw-r--r--spec/ruby/core/filetest/identical_spec.rb6
-rw-r--r--spec/ruby/core/filetest/owned_spec.rb6
-rw-r--r--spec/ruby/core/filetest/pipe_spec.rb6
-rw-r--r--spec/ruby/core/filetest/readable_real_spec.rb7
-rw-r--r--spec/ruby/core/filetest/readable_spec.rb7
-rw-r--r--spec/ruby/core/filetest/setgid_spec.rb6
-rw-r--r--spec/ruby/core/filetest/setuid_spec.rb6
-rw-r--r--spec/ruby/core/filetest/size_spec.rb34
-rw-r--r--spec/ruby/core/filetest/socket_spec.rb6
-rw-r--r--spec/ruby/core/filetest/sticky_spec.rb7
-rw-r--r--spec/ruby/core/filetest/symlink_spec.rb10
-rw-r--r--spec/ruby/core/filetest/world_readable_spec.rb5
-rw-r--r--spec/ruby/core/filetest/world_writable_spec.rb5
-rw-r--r--spec/ruby/core/filetest/writable_real_spec.rb7
-rw-r--r--spec/ruby/core/filetest/writable_spec.rb7
-rw-r--r--spec/ruby/core/filetest/zero_spec.rb13
-rw-r--r--spec/ruby/core/float/abs_spec.rb6
-rw-r--r--spec/ruby/core/float/angle_spec.rb6
-rw-r--r--spec/ruby/core/float/arg_spec.rb6
-rw-r--r--spec/ruby/core/float/case_compare_spec.rb6
-rw-r--r--spec/ruby/core/float/ceil_spec.rb21
-rw-r--r--spec/ruby/core/float/coerce_spec.rb18
-rw-r--r--spec/ruby/core/float/comparison_spec.rb68
-rw-r--r--spec/ruby/core/float/constants_spec.rb55
-rw-r--r--spec/ruby/core/float/denominator_spec.rb29
-rw-r--r--spec/ruby/core/float/divide_spec.rb39
-rw-r--r--spec/ruby/core/float/divmod_spec.rb43
-rw-r--r--spec/ruby/core/float/dup_spec.rb8
-rw-r--r--spec/ruby/core/float/eql_spec.rb16
-rw-r--r--spec/ruby/core/float/equal_value_spec.rb6
-rw-r--r--spec/ruby/core/float/exponent_spec.rb15
-rw-r--r--spec/ruby/core/float/fdiv_spec.rb6
-rw-r--r--spec/ruby/core/float/finite_spec.rb19
-rw-r--r--spec/ruby/core/float/fixtures/classes.rb4
-rw-r--r--spec/ruby/core/float/fixtures/coerce.rb15
-rw-r--r--spec/ruby/core/float/float_spec.rb19
-rw-r--r--spec/ruby/core/float/floor_spec.rb21
-rw-r--r--spec/ruby/core/float/gt_spec.rb17
-rw-r--r--spec/ruby/core/float/gte_spec.rb17
-rw-r--r--spec/ruby/core/float/hash_spec.rb11
-rw-r--r--spec/ruby/core/float/infinite_spec.rb19
-rw-r--r--spec/ruby/core/float/lt_spec.rb17
-rw-r--r--spec/ruby/core/float/lte_spec.rb18
-rw-r--r--spec/ruby/core/float/magnitude_spec.rb5
-rw-r--r--spec/ruby/core/float/minus_spec.rb12
-rw-r--r--spec/ruby/core/float/modulo_spec.rb10
-rw-r--r--spec/ruby/core/float/multiply_spec.rb17
-rw-r--r--spec/ruby/core/float/nan_spec.rb9
-rw-r--r--spec/ruby/core/float/next_float_spec.rb49
-rw-r--r--spec/ruby/core/float/numerator_spec.rb39
-rw-r--r--spec/ruby/core/float/phase_spec.rb6
-rw-r--r--spec/ruby/core/float/plus_spec.rb12
-rw-r--r--spec/ruby/core/float/prev_float_spec.rb49
-rw-r--r--spec/ruby/core/float/quo_spec.rb6
-rw-r--r--spec/ruby/core/float/rationalize_spec.rb43
-rw-r--r--spec/ruby/core/float/round_spec.rb117
-rw-r--r--spec/ruby/core/float/shared/abs.rb21
-rw-r--r--spec/ruby/core/float/shared/arg.rb36
-rw-r--r--spec/ruby/core/float/shared/arithmetic_exception_in_coerce.rb33
-rw-r--r--spec/ruby/core/float/shared/comparison_exception_in_coerce.rb35
-rw-r--r--spec/ruby/core/float/shared/equal.rb17
-rw-r--r--spec/ruby/core/float/shared/modulo.rb48
-rw-r--r--spec/ruby/core/float/shared/quo.rb59
-rw-r--r--spec/ruby/core/float/shared/to_i.rb10
-rw-r--r--spec/ruby/core/float/to_f_spec.rb9
-rw-r--r--spec/ruby/core/float/to_i_spec.rb6
-rw-r--r--spec/ruby/core/float/to_int_spec.rb6
-rw-r--r--spec/ruby/core/float/to_r_spec.rb5
-rw-r--r--spec/ruby/core/float/to_s_spec.rb310
-rw-r--r--spec/ruby/core/float/truncate_spec.rb14
-rw-r--r--spec/ruby/core/float/uminus_spec.rb28
-rw-r--r--spec/ruby/core/float/uplus_spec.rb9
-rw-r--r--spec/ruby/core/float/zero_spec.rb9
-rw-r--r--spec/ruby/core/gc/count_spec.rb17
-rw-r--r--spec/ruby/core/gc/disable_spec.rb18
-rw-r--r--spec/ruby/core/gc/enable_spec.rb13
-rw-r--r--spec/ruby/core/gc/garbage_collect_spec.rb15
-rw-r--r--spec/ruby/core/gc/profiler/clear_spec.rb5
-rw-r--r--spec/ruby/core/gc/profiler/disable_spec.rb16
-rw-r--r--spec/ruby/core/gc/profiler/enable_spec.rb17
-rw-r--r--spec/ruby/core/gc/profiler/enabled_spec.rb21
-rw-r--r--spec/ruby/core/gc/profiler/report_spec.rb5
-rw-r--r--spec/ruby/core/gc/profiler/result_spec.rb7
-rw-r--r--spec/ruby/core/gc/profiler/total_time_spec.rb7
-rw-r--r--spec/ruby/core/gc/start_spec.rb8
-rw-r--r--spec/ruby/core/gc/stat_spec.rb16
-rw-r--r--spec/ruby/core/gc/stress_spec.rb27
-rw-r--r--spec/ruby/core/hash/allocate_spec.rb15
-rw-r--r--spec/ruby/core/hash/any_spec.rb30
-rw-r--r--spec/ruby/core/hash/assoc_spec.rb50
-rw-r--r--spec/ruby/core/hash/clear_spec.rb32
-rw-r--r--spec/ruby/core/hash/clone_spec.rb12
-rw-r--r--spec/ruby/core/hash/compact_spec.rb59
-rw-r--r--spec/ruby/core/hash/compare_by_identity_spec.rb138
-rw-r--r--spec/ruby/core/hash/constructor_spec.rb123
-rw-r--r--spec/ruby/core/hash/default_proc_spec.rb80
-rw-r--r--spec/ruby/core/hash/default_spec.rb46
-rw-r--r--spec/ruby/core/hash/delete_if_spec.rb44
-rw-r--r--spec/ruby/core/hash/delete_spec.rb44
-rw-r--r--spec/ruby/core/hash/dig_spec.rb66
-rw-r--r--spec/ruby/core/hash/each_key_spec.rb23
-rw-r--r--spec/ruby/core/hash/each_pair_spec.rb11
-rw-r--r--spec/ruby/core/hash/each_spec.rb11
-rw-r--r--spec/ruby/core/hash/each_value_spec.rb23
-rw-r--r--spec/ruby/core/hash/element_reference_spec.rb120
-rw-r--r--spec/ruby/core/hash/element_set_spec.rb7
-rw-r--r--spec/ruby/core/hash/empty_spec.rb15
-rw-r--r--spec/ruby/core/hash/eql_spec.rb9
-rw-r--r--spec/ruby/core/hash/equal_value_spec.rb18
-rw-r--r--spec/ruby/core/hash/fetch_spec.rb44
-rw-r--r--spec/ruby/core/hash/fetch_values_spec.rb35
-rw-r--r--spec/ruby/core/hash/filter_spec.rb12
-rw-r--r--spec/ruby/core/hash/fixtures/classes.rb75
-rw-r--r--spec/ruby/core/hash/flatten_spec.rb62
-rw-r--r--spec/ruby/core/hash/gt_spec.rb42
-rw-r--r--spec/ruby/core/hash/gte_spec.rb42
-rw-r--r--spec/ruby/core/hash/has_key_spec.rb7
-rw-r--r--spec/ruby/core/hash/has_value_spec.rb7
-rw-r--r--spec/ruby/core/hash/hash_spec.rb44
-rw-r--r--spec/ruby/core/hash/include_spec.rb7
-rw-r--r--spec/ruby/core/hash/index_spec.rb7
-rw-r--r--spec/ruby/core/hash/initialize_spec.rb61
-rw-r--r--spec/ruby/core/hash/inspect_spec.rb7
-rw-r--r--spec/ruby/core/hash/invert_spec.rb27
-rw-r--r--spec/ruby/core/hash/keep_if_spec.rb37
-rw-r--r--spec/ruby/core/hash/key_spec.rb12
-rw-r--r--spec/ruby/core/hash/keys_spec.rb23
-rw-r--r--spec/ruby/core/hash/length_spec.rb7
-rw-r--r--spec/ruby/core/hash/lt_spec.rb42
-rw-r--r--spec/ruby/core/hash/lte_spec.rb42
-rw-r--r--spec/ruby/core/hash/member_spec.rb7
-rw-r--r--spec/ruby/core/hash/merge_spec.rb102
-rw-r--r--spec/ruby/core/hash/new_spec.rb36
-rw-r--r--spec/ruby/core/hash/rassoc_spec.rb42
-rw-r--r--spec/ruby/core/hash/rehash_spec.rb66
-rw-r--r--spec/ruby/core/hash/reject_spec.rb102
-rw-r--r--spec/ruby/core/hash/replace_spec.rb7
-rw-r--r--spec/ruby/core/hash/select_spec.rb10
-rw-r--r--spec/ruby/core/hash/shared/comparison.rb15
-rw-r--r--spec/ruby/core/hash/shared/each.rb85
-rw-r--r--spec/ruby/core/hash/shared/eql.rb250
-rw-r--r--spec/ruby/core/hash/shared/equal.rb90
-rw-r--r--spec/ruby/core/hash/shared/greater_than.rb23
-rw-r--r--spec/ruby/core/hash/shared/index.rb27
-rw-r--r--spec/ruby/core/hash/shared/iteration.rb19
-rw-r--r--spec/ruby/core/hash/shared/key.rb38
-rw-r--r--spec/ruby/core/hash/shared/length.rb12
-rw-r--r--spec/ruby/core/hash/shared/less_than.rb23
-rw-r--r--spec/ruby/core/hash/shared/replace.rb51
-rw-r--r--spec/ruby/core/hash/shared/select.rb91
-rw-r--r--spec/ruby/core/hash/shared/store.rb98
-rw-r--r--spec/ruby/core/hash/shared/to_s.rb98
-rw-r--r--spec/ruby/core/hash/shared/update.rb78
-rw-r--r--spec/ruby/core/hash/shared/value.rb14
-rw-r--r--spec/ruby/core/hash/shared/values_at.rb9
-rw-r--r--spec/ruby/core/hash/shift_spec.rb79
-rw-r--r--spec/ruby/core/hash/size_spec.rb7
-rw-r--r--spec/ruby/core/hash/slice_spec.rb55
-rw-r--r--spec/ruby/core/hash/sort_spec.rb17
-rw-r--r--spec/ruby/core/hash/store_spec.rb7
-rw-r--r--spec/ruby/core/hash/to_a_spec.rb39
-rw-r--r--spec/ruby/core/hash/to_h_spec.rb74
-rw-r--r--spec/ruby/core/hash/to_hash_spec.rb14
-rw-r--r--spec/ruby/core/hash/to_proc_spec.rb87
-rw-r--r--spec/ruby/core/hash/to_s_spec.rb7
-rw-r--r--spec/ruby/core/hash/transform_keys_spec.rb132
-rw-r--r--spec/ruby/core/hash/transform_values_spec.rb97
-rw-r--r--spec/ruby/core/hash/try_convert_spec.rb50
-rw-r--r--spec/ruby/core/hash/update_spec.rb7
-rw-r--r--spec/ruby/core/hash/value_spec.rb7
-rw-r--r--spec/ruby/core/hash/values_at_spec.rb7
-rw-r--r--spec/ruby/core/hash/values_spec.rb10
-rw-r--r--spec/ruby/core/integer/abs_spec.rb6
-rw-r--r--spec/ruby/core/integer/allbits_spec.rb39
-rw-r--r--spec/ruby/core/integer/anybits_spec.rb38
-rw-r--r--spec/ruby/core/integer/bit_and_spec.rb97
-rw-r--r--spec/ruby/core/integer/bit_length_spec.rb76
-rw-r--r--spec/ruby/core/integer/bit_or_spec.rb68
-rw-r--r--spec/ruby/core/integer/bit_xor_spec.rb72
-rw-r--r--spec/ruby/core/integer/case_compare_spec.rb6
-rw-r--r--spec/ruby/core/integer/ceil_spec.rb19
-rw-r--r--spec/ruby/core/integer/chr_spec.rb243
-rw-r--r--spec/ruby/core/integer/coerce_spec.rb104
-rw-r--r--spec/ruby/core/integer/comparison_spec.rb189
-rw-r--r--spec/ruby/core/integer/complement_spec.rb20
-rw-r--r--spec/ruby/core/integer/constants_spec.rb27
-rw-r--r--spec/ruby/core/integer/denominator_spec.rb20
-rw-r--r--spec/ruby/core/integer/digits_spec.rb32
-rw-r--r--spec/ruby/core/integer/div_spec.rb146
-rw-r--r--spec/ruby/core/integer/divide_spec.rb95
-rw-r--r--spec/ruby/core/integer/divmod_spec.rb117
-rw-r--r--spec/ruby/core/integer/downto_spec.rb69
-rw-r--r--spec/ruby/core/integer/dup_spec.rb13
-rw-r--r--spec/ruby/core/integer/element_reference_spec.rb111
-rw-r--r--spec/ruby/core/integer/equal_value_spec.rb6
-rw-r--r--spec/ruby/core/integer/even_spec.rb40
-rw-r--r--spec/ruby/core/integer/exponent_spec.rb7
-rw-r--r--spec/ruby/core/integer/fdiv_spec.rb49
-rw-r--r--spec/ruby/core/integer/fixtures/classes.rb4
-rw-r--r--spec/ruby/core/integer/floor_spec.rb19
-rw-r--r--spec/ruby/core/integer/gcd_spec.rb69
-rw-r--r--spec/ruby/core/integer/gcdlcm_spec.rb53
-rw-r--r--spec/ruby/core/integer/gt_spec.rb49
-rw-r--r--spec/ruby/core/integer/gte_spec.rb49
-rw-r--r--spec/ruby/core/integer/integer_spec.rb20
-rw-r--r--spec/ruby/core/integer/lcm_spec.rb58
-rw-r--r--spec/ruby/core/integer/left_shift_spec.rb165
-rw-r--r--spec/ruby/core/integer/lt_spec.rb51
-rw-r--r--spec/ruby/core/integer/lte_spec.rb54
-rw-r--r--spec/ruby/core/integer/magnitude_spec.rb6
-rw-r--r--spec/ruby/core/integer/minus_spec.rb49
-rw-r--r--spec/ruby/core/integer/modulo_spec.rb10
-rw-r--r--spec/ruby/core/integer/multiply_spec.rb51
-rw-r--r--spec/ruby/core/integer/next_spec.rb6
-rw-r--r--spec/ruby/core/integer/nobits_spec.rb38
-rw-r--r--spec/ruby/core/integer/numerator_spec.rb18
-rw-r--r--spec/ruby/core/integer/odd_spec.rb38
-rw-r--r--spec/ruby/core/integer/ord_spec.rb17
-rw-r--r--spec/ruby/core/integer/plus_spec.rb49
-rw-r--r--spec/ruby/core/integer/pow_spec.rb49
-rw-r--r--spec/ruby/core/integer/pred_spec.rb11
-rw-r--r--spec/ruby/core/integer/rationalize_spec.rb39
-rw-r--r--spec/ruby/core/integer/remainder_spec.rb51
-rw-r--r--spec/ruby/core/integer/right_shift_spec.rb191
-rw-r--r--spec/ruby/core/integer/round_spec.rb101
-rw-r--r--spec/ruby/core/integer/shared/abs.rb18
-rw-r--r--spec/ruby/core/integer/shared/arithmetic_coerce.rb31
-rw-r--r--spec/ruby/core/integer/shared/comparison_coerce.rb33
-rw-r--r--spec/ruby/core/integer/shared/equal.rb58
-rw-r--r--spec/ruby/core/integer/shared/exponent.rb118
-rw-r--r--spec/ruby/core/integer/shared/integer_rounding.rb29
-rw-r--r--spec/ruby/core/integer/shared/modulo.rb74
-rw-r--r--spec/ruby/core/integer/shared/next.rb25
-rw-r--r--spec/ruby/core/integer/shared/to_i.rb8
-rw-r--r--spec/ruby/core/integer/size_spec.rb34
-rw-r--r--spec/ruby/core/integer/sqrt_spec.rb33
-rw-r--r--spec/ruby/core/integer/succ_spec.rb6
-rw-r--r--spec/ruby/core/integer/times_spec.rb79
-rw-r--r--spec/ruby/core/integer/to_f_spec.rb23
-rw-r--r--spec/ruby/core/integer/to_i_spec.rb6
-rw-r--r--spec/ruby/core/integer/to_int_spec.rb6
-rw-r--r--spec/ruby/core/integer/to_r_spec.rb26
-rw-r--r--spec/ruby/core/integer/to_s_spec.rb95
-rw-r--r--spec/ruby/core/integer/truncate_spec.rb19
-rw-r--r--spec/ruby/core/integer/uminus_spec.rb30
-rw-r--r--spec/ruby/core/integer/upto_spec.rb69
-rw-r--r--spec/ruby/core/io/advise_spec.rb96
-rw-r--r--spec/ruby/core/io/binmode_spec.rb60
-rw-r--r--spec/ruby/core/io/binread_spec.rb47
-rw-r--r--spec/ruby/core/io/binwrite_spec.rb6
-rw-r--r--spec/ruby/core/io/bytes_spec.rb43
-rw-r--r--spec/ruby/core/io/chars_spec.rb12
-rw-r--r--spec/ruby/core/io/close_on_exec_spec.rb80
-rw-r--r--spec/ruby/core/io/close_read_spec.rb60
-rw-r--r--spec/ruby/core/io/close_spec.rb97
-rw-r--r--spec/ruby/core/io/close_write_spec.rb64
-rw-r--r--spec/ruby/core/io/closed_spec.rb20
-rw-r--r--spec/ruby/core/io/codepoints_spec.rb25
-rw-r--r--spec/ruby/core/io/constants_spec.rb19
-rw-r--r--spec/ruby/core/io/copy_stream_spec.rb282
-rw-r--r--spec/ruby/core/io/dup_spec.rb87
-rw-r--r--spec/ruby/core/io/each_byte_spec.rb57
-rw-r--r--spec/ruby/core/io/each_char_spec.rb12
-rw-r--r--spec/ruby/core/io/each_codepoint_spec.rb43
-rw-r--r--spec/ruby/core/io/each_line_spec.rb11
-rw-r--r--spec/ruby/core/io/each_spec.rb11
-rw-r--r--spec/ruby/core/io/eof_spec.rb107
-rw-r--r--spec/ruby/core/io/external_encoding_spec.rb216
-rw-r--r--spec/ruby/core/io/fcntl_spec.rb8
-rw-r--r--spec/ruby/core/io/fdatasync_spec.rb5
-rw-r--r--spec/ruby/core/io/fileno_spec.rb12
-rw-r--r--spec/ruby/core/io/fixtures/bom_UTF-16BE.txtbin20 -> 0 bytes-rw-r--r--spec/ruby/core/io/fixtures/bom_UTF-16LE.txtbin20 -> 0 bytes-rw-r--r--spec/ruby/core/io/fixtures/bom_UTF-32BE.txtbin40 -> 0 bytes-rw-r--r--spec/ruby/core/io/fixtures/bom_UTF-32LE.txtbin40 -> 0 bytes-rw-r--r--spec/ruby/core/io/fixtures/bom_UTF-8.txt1
-rw-r--r--spec/ruby/core/io/fixtures/classes.rb189
-rw-r--r--spec/ruby/core/io/fixtures/copy_stream.txt6
-rw-r--r--spec/ruby/core/io/fixtures/empty.txt0
-rw-r--r--spec/ruby/core/io/fixtures/incomplete.txt1
-rw-r--r--spec/ruby/core/io/fixtures/lines.txt9
-rw-r--r--spec/ruby/core/io/fixtures/no_bom_UTF-8.txt1
-rw-r--r--spec/ruby/core/io/fixtures/numbered_lines.txt5
-rw-r--r--spec/ruby/core/io/fixtures/one_byte.txt1
-rw-r--r--spec/ruby/core/io/fixtures/read_binary.txt1
-rw-r--r--spec/ruby/core/io/fixtures/read_euc_jp.txt1
-rw-r--r--spec/ruby/core/io/fixtures/read_text.txt1
-rw-r--r--spec/ruby/core/io/fixtures/reopen_stdout.rb3
-rw-r--r--spec/ruby/core/io/flush_spec.rb37
-rw-r--r--spec/ruby/core/io/for_fd_spec.rb10
-rw-r--r--spec/ruby/core/io/foreach_spec.rb81
-rw-r--r--spec/ruby/core/io/fsync_spec.rb24
-rw-r--r--spec/ruby/core/io/getbyte_spec.rb42
-rw-r--r--spec/ruby/core/io/getc_spec.rb42
-rw-r--r--spec/ruby/core/io/gets_spec.rb327
-rw-r--r--spec/ruby/core/io/initialize_spec.rb49
-rw-r--r--spec/ruby/core/io/inspect_spec.rb23
-rw-r--r--spec/ruby/core/io/internal_encoding_spec.rb138
-rw-r--r--spec/ruby/core/io/io_spec.rb11
-rw-r--r--spec/ruby/core/io/ioctl_spec.rb32
-rw-r--r--spec/ruby/core/io/isatty_spec.rb6
-rw-r--r--spec/ruby/core/io/lineno_spec.rb95
-rw-r--r--spec/ruby/core/io/lines_spec.rb42
-rw-r--r--spec/ruby/core/io/new_spec.rb10
-rw-r--r--spec/ruby/core/io/open_spec.rb86
-rw-r--r--spec/ruby/core/io/output_spec.rb27
-rw-r--r--spec/ruby/core/io/pid_spec.rb35
-rw-r--r--spec/ruby/core/io/pipe_spec.rb214
-rw-r--r--spec/ruby/core/io/popen_spec.rb271
-rw-r--r--spec/ruby/core/io/pos_spec.rb11
-rw-r--r--spec/ruby/core/io/pread_spec.rb52
-rw-r--r--spec/ruby/core/io/print_spec.rb53
-rw-r--r--spec/ruby/core/io/printf_spec.rb32
-rw-r--r--spec/ruby/core/io/putc_spec.rb11
-rw-r--r--spec/ruby/core/io/puts_spec.rb139
-rw-r--r--spec/ruby/core/io/pwrite_spec.rb45
-rw-r--r--spec/ruby/core/io/read_nonblock_spec.rb99
-rw-r--r--spec/ruby/core/io/read_spec.rb616
-rw-r--r--spec/ruby/core/io/readbyte_spec.rb24
-rw-r--r--spec/ruby/core/io/readchar_spec.rb44
-rw-r--r--spec/ruby/core/io/readline_spec.rb51
-rw-r--r--spec/ruby/core/io/readlines_spec.rb210
-rw-r--r--spec/ruby/core/io/readpartial_spec.rb96
-rw-r--r--spec/ruby/core/io/reopen_spec.rb313
-rw-r--r--spec/ruby/core/io/rewind_spec.rb38
-rw-r--r--spec/ruby/core/io/seek_spec.rb79
-rw-r--r--spec/ruby/core/io/select_spec.rb120
-rw-r--r--spec/ruby/core/io/set_encoding_spec.rb191
-rw-r--r--spec/ruby/core/io/shared/binwrite.rb78
-rw-r--r--spec/ruby/core/io/shared/chars.rb73
-rw-r--r--spec/ruby/core/io/shared/codepoints.rb54
-rw-r--r--spec/ruby/core/io/shared/each.rb183
-rw-r--r--spec/ruby/core/io/shared/gets_ascii.rb19
-rw-r--r--spec/ruby/core/io/shared/new.rb382
-rw-r--r--spec/ruby/core/io/shared/pos.rb72
-rw-r--r--spec/ruby/core/io/shared/readlines.rb209
-rw-r--r--spec/ruby/core/io/shared/tty.rb24
-rw-r--r--spec/ruby/core/io/shared/write.rb109
-rw-r--r--spec/ruby/core/io/stat_spec.rb24
-rw-r--r--spec/ruby/core/io/sync_spec.rb64
-rw-r--r--spec/ruby/core/io/sysopen_spec.rb50
-rw-r--r--spec/ruby/core/io/sysread_spec.rb98
-rw-r--r--spec/ruby/core/io/sysseek_spec.rb44
-rw-r--r--spec/ruby/core/io/syswrite_spec.rb71
-rw-r--r--spec/ruby/core/io/tell_spec.rb7
-rw-r--r--spec/ruby/core/io/to_i_spec.rb12
-rw-r--r--spec/ruby/core/io/to_io_spec.rb21
-rw-r--r--spec/ruby/core/io/try_convert_spec.rb49
-rw-r--r--spec/ruby/core/io/tty_spec.rb6
-rw-r--r--spec/ruby/core/io/ungetbyte_spec.rb73
-rw-r--r--spec/ruby/core/io/ungetc_spec.rb135
-rw-r--r--spec/ruby/core/io/write_nonblock_spec.rb85
-rw-r--r--spec/ruby/core/io/write_spec.rb166
-rw-r--r--spec/ruby/core/kernel/Array_spec.rb97
-rw-r--r--spec/ruby/core/kernel/Complex_spec.rb187
-rw-r--r--spec/ruby/core/kernel/Float_spec.rb341
-rw-r--r--spec/ruby/core/kernel/Hash_spec.rb63
-rw-r--r--spec/ruby/core/kernel/Integer_spec.rb818
-rw-r--r--spec/ruby/core/kernel/Rational_spec.rb6
-rw-r--r--spec/ruby/core/kernel/String_spec.rb106
-rw-r--r--spec/ruby/core/kernel/__callee___spec.rb48
-rw-r--r--spec/ruby/core/kernel/__dir___spec.rb20
-rw-r--r--spec/ruby/core/kernel/__method___spec.rb40
-rw-r--r--spec/ruby/core/kernel/abort_spec.rb15
-rw-r--r--spec/ruby/core/kernel/at_exit_spec.rb44
-rw-r--r--spec/ruby/core/kernel/autoload_spec.rb160
-rw-r--r--spec/ruby/core/kernel/backtick_spec.rb80
-rw-r--r--spec/ruby/core/kernel/binding_spec.rb51
-rw-r--r--spec/ruby/core/kernel/block_given_spec.rb38
-rw-r--r--spec/ruby/core/kernel/caller_locations_spec.rb32
-rw-r--r--spec/ruby/core/kernel/caller_spec.rb46
-rw-r--r--spec/ruby/core/kernel/case_compare_spec.rb135
-rw-r--r--spec/ruby/core/kernel/catch_spec.rb127
-rw-r--r--spec/ruby/core/kernel/chomp_spec.rb65
-rw-r--r--spec/ruby/core/kernel/chop_spec.rb53
-rw-r--r--spec/ruby/core/kernel/class_spec.rb26
-rw-r--r--spec/ruby/core/kernel/clone_spec.rb122
-rw-r--r--spec/ruby/core/kernel/comparison_spec.rb31
-rw-r--r--spec/ruby/core/kernel/define_singleton_method_spec.rb99
-rw-r--r--spec/ruby/core/kernel/display_spec.rb6
-rw-r--r--spec/ruby/core/kernel/dup_spec.rb67
-rw-r--r--spec/ruby/core/kernel/enum_for_spec.rb5
-rw-r--r--spec/ruby/core/kernel/eql_spec.rb10
-rw-r--r--spec/ruby/core/kernel/equal_value_spec.rb15
-rw-r--r--spec/ruby/core/kernel/eval_spec.rb362
-rw-r--r--spec/ruby/core/kernel/exec_spec.rb18
-rw-r--r--spec/ruby/core/kernel/exit_spec.rb27
-rw-r--r--spec/ruby/core/kernel/extend_spec.rb79
-rw-r--r--spec/ruby/core/kernel/fail_spec.rb42
-rw-r--r--spec/ruby/core/kernel/fixtures/__callee__.rb34
-rw-r--r--spec/ruby/core/kernel/fixtures/__method__.rb34
-rw-r--r--spec/ruby/core/kernel/fixtures/autoload_b.rb5
-rw-r--r--spec/ruby/core/kernel/fixtures/autoload_d.rb5
-rw-r--r--spec/ruby/core/kernel/fixtures/autoload_from_included_module.rb9
-rw-r--r--spec/ruby/core/kernel/fixtures/autoload_from_included_module2.rb9
-rw-r--r--spec/ruby/core/kernel/fixtures/autoload_frozen.rb7
-rw-r--r--spec/ruby/core/kernel/fixtures/caller.rb7
-rw-r--r--spec/ruby/core/kernel/fixtures/caller_at_exit.rb7
-rw-r--r--spec/ruby/core/kernel/fixtures/caller_locations.rb7
-rw-r--r--spec/ruby/core/kernel/fixtures/chomp.rb4
-rw-r--r--spec/ruby/core/kernel/fixtures/chomp_f.rb4
-rw-r--r--spec/ruby/core/kernel/fixtures/chop.rb4
-rw-r--r--spec/ruby/core/kernel/fixtures/chop_f.rb4
-rw-r--r--spec/ruby/core/kernel/fixtures/classes.rb492
-rw-r--r--spec/ruby/core/kernel/fixtures/eval_locals.rb6
-rw-r--r--spec/ruby/core/kernel/fixtures/eval_return_with_lambda.rb12
-rw-r--r--spec/ruby/core/kernel/fixtures/eval_return_without_lambda.rb14
-rw-r--r--spec/ruby/core/kernel/fixtures/singleton_methods.rb13
-rw-r--r--spec/ruby/core/kernel/fixtures/test.rb362
-rw-r--r--spec/ruby/core/kernel/fork_spec.rb15
-rw-r--r--spec/ruby/core/kernel/format_spec.rb14
-rw-r--r--spec/ruby/core/kernel/freeze_spec.rb85
-rw-r--r--spec/ruby/core/kernel/frozen_spec.rb78
-rw-r--r--spec/ruby/core/kernel/gets_spec.rb17
-rw-r--r--spec/ruby/core/kernel/global_variables_spec.rb26
-rw-r--r--spec/ruby/core/kernel/gsub_spec.rb96
-rw-r--r--spec/ruby/core/kernel/inspect_spec.rb33
-rw-r--r--spec/ruby/core/kernel/instance_of_spec.rb40
-rw-r--r--spec/ruby/core/kernel/instance_variable_defined_spec.rb41
-rw-r--r--spec/ruby/core/kernel/instance_variable_get_spec.rb105
-rw-r--r--spec/ruby/core/kernel/instance_variable_set_spec.rb93
-rw-r--r--spec/ruby/core/kernel/instance_variables_spec.rb27
-rw-r--r--spec/ruby/core/kernel/is_a_spec.rb6
-rw-r--r--spec/ruby/core/kernel/iterator_spec.rb12
-rw-r--r--spec/ruby/core/kernel/itself_spec.rb9
-rw-r--r--spec/ruby/core/kernel/kind_of_spec.rb6
-rw-r--r--spec/ruby/core/kernel/lambda_spec.rb122
-rw-r--r--spec/ruby/core/kernel/load_spec.rb40
-rw-r--r--spec/ruby/core/kernel/local_variables_spec.rb48
-rw-r--r--spec/ruby/core/kernel/loop_spec.rb79
-rw-r--r--spec/ruby/core/kernel/match_spec.rb24
-rw-r--r--spec/ruby/core/kernel/method_spec.rb37
-rw-r--r--spec/ruby/core/kernel/methods_spec.rb101
-rw-r--r--spec/ruby/core/kernel/nil_spec.rb6
-rw-r--r--spec/ruby/core/kernel/not_match_spec.rb21
-rw-r--r--spec/ruby/core/kernel/object_id_spec.rb6
-rw-r--r--spec/ruby/core/kernel/open_spec.rb144
-rw-r--r--spec/ruby/core/kernel/p_spec.rb83
-rw-r--r--spec/ruby/core/kernel/pp_spec.rb11
-rw-r--r--spec/ruby/core/kernel/print_spec.rb12
-rw-r--r--spec/ruby/core/kernel/printf_spec.rb60
-rw-r--r--spec/ruby/core/kernel/private_methods_spec.rb69
-rw-r--r--spec/ruby/core/kernel/proc_spec.rb70
-rw-r--r--spec/ruby/core/kernel/protected_methods_spec.rb69
-rw-r--r--spec/ruby/core/kernel/public_method_spec.rb32
-rw-r--r--spec/ruby/core/kernel/public_methods_spec.rb76
-rw-r--r--spec/ruby/core/kernel/public_send_spec.rb108
-rw-r--r--spec/ruby/core/kernel/putc_spec.rb39
-rw-r--r--spec/ruby/core/kernel/puts_spec.rb29
-rw-r--r--spec/ruby/core/kernel/raise_spec.rb17
-rw-r--r--spec/ruby/core/kernel/rand_spec.rb155
-rw-r--r--spec/ruby/core/kernel/readline_spec.rb12
-rw-r--r--spec/ruby/core/kernel/readlines_spec.rb12
-rw-r--r--spec/ruby/core/kernel/remove_instance_variable_spec.rb59
-rw-r--r--spec/ruby/core/kernel/require_relative_spec.rb427
-rw-r--r--spec/ruby/core/kernel/require_spec.rb34
-rw-r--r--spec/ruby/core/kernel/respond_to_missing_spec.rb100
-rw-r--r--spec/ruby/core/kernel/respond_to_spec.rb73
-rw-r--r--spec/ruby/core/kernel/select_spec.rb18
-rw-r--r--spec/ruby/core/kernel/send_spec.rb68
-rw-r--r--spec/ruby/core/kernel/set_trace_func_spec.rb12
-rw-r--r--spec/ruby/core/kernel/shared/dup_clone.rb129
-rw-r--r--spec/ruby/core/kernel/shared/kind_of.rb55
-rw-r--r--spec/ruby/core/kernel/shared/lambda.rb9
-rw-r--r--spec/ruby/core/kernel/shared/load.rb172
-rw-r--r--spec/ruby/core/kernel/shared/method.rb50
-rw-r--r--spec/ruby/core/kernel/shared/require.rb773
-rw-r--r--spec/ruby/core/kernel/shared/sprintf.rb877
-rw-r--r--spec/ruby/core/kernel/shared/sprintf_encoding.rb28
-rw-r--r--spec/ruby/core/kernel/shared/then.rb20
-rw-r--r--spec/ruby/core/kernel/singleton_class_spec.rb27
-rw-r--r--spec/ruby/core/kernel/singleton_method_spec.rb41
-rw-r--r--spec/ruby/core/kernel/singleton_methods_spec.rb192
-rw-r--r--spec/ruby/core/kernel/sleep_spec.rb56
-rw-r--r--spec/ruby/core/kernel/spawn_spec.rb25
-rw-r--r--spec/ruby/core/kernel/sprintf_spec.rb24
-rw-r--r--spec/ruby/core/kernel/srand_spec.rb61
-rw-r--r--spec/ruby/core/kernel/sub_spec.rb26
-rw-r--r--spec/ruby/core/kernel/syscall_spec.rb12
-rw-r--r--spec/ruby/core/kernel/system_spec.rb117
-rw-r--r--spec/ruby/core/kernel/taint_spec.rb47
-rw-r--r--spec/ruby/core/kernel/tainted_spec.rb14
-rw-r--r--spec/ruby/core/kernel/tap_spec.rb13
-rw-r--r--spec/ruby/core/kernel/test_spec.rb109
-rw-r--r--spec/ruby/core/kernel/then_spec.rb8
-rw-r--r--spec/ruby/core/kernel/throw_spec.rb80
-rw-r--r--spec/ruby/core/kernel/to_enum_spec.rb5
-rw-r--r--spec/ruby/core/kernel/to_s_spec.rb18
-rw-r--r--spec/ruby/core/kernel/trace_var_spec.rb54
-rw-r--r--spec/ruby/core/kernel/trap_spec.rb12
-rw-r--r--spec/ruby/core/kernel/trust_spec.rb27
-rw-r--r--spec/ruby/core/kernel/untaint_spec.rb27
-rw-r--r--spec/ruby/core/kernel/untrace_var_spec.rb12
-rw-r--r--spec/ruby/core/kernel/untrust_spec.rb27
-rw-r--r--spec/ruby/core/kernel/untrusted_spec.rb30
-rw-r--r--spec/ruby/core/kernel/warn_spec.rb156
-rw-r--r--spec/ruby/core/kernel/yield_self_spec.rb8
-rw-r--r--spec/ruby/core/main/define_method_spec.rb28
-rw-r--r--spec/ruby/core/main/fixtures/classes.rb18
-rw-r--r--spec/ruby/core/main/fixtures/string_refinement.rb7
-rw-r--r--spec/ruby/core/main/fixtures/string_refinement_user.rb11
-rw-r--r--spec/ruby/core/main/fixtures/wrapped_include.rb1
-rw-r--r--spec/ruby/core/main/include_spec.rb16
-rw-r--r--spec/ruby/core/main/private_spec.rb23
-rw-r--r--spec/ruby/core/main/public_spec.rb23
-rw-r--r--spec/ruby/core/main/to_s_spec.rb7
-rw-r--r--spec/ruby/core/main/using_spec.rb132
-rw-r--r--spec/ruby/core/marshal/dump_spec.rb615
-rw-r--r--spec/ruby/core/marshal/fixtures/marshal_data.rb420
-rw-r--r--spec/ruby/core/marshal/fixtures/random.dumpbin2520 -> 0 bytes-rw-r--r--spec/ruby/core/marshal/float_spec.rb77
-rw-r--r--spec/ruby/core/marshal/load_spec.rb6
-rw-r--r--spec/ruby/core/marshal/major_version_spec.rb7
-rw-r--r--spec/ruby/core/marshal/minor_version_spec.rb7
-rw-r--r--spec/ruby/core/marshal/restore_spec.rb6
-rw-r--r--spec/ruby/core/marshal/shared/load.rb920
-rw-r--r--spec/ruby/core/matchdata/allocate_spec.rb10
-rw-r--r--spec/ruby/core/matchdata/begin_spec.rb104
-rw-r--r--spec/ruby/core/matchdata/captures_spec.rb7
-rw-r--r--spec/ruby/core/matchdata/dup_spec.rb14
-rw-r--r--spec/ruby/core/matchdata/element_reference_spec.rb87
-rw-r--r--spec/ruby/core/matchdata/end_spec.rb104
-rw-r--r--spec/ruby/core/matchdata/eql_spec.rb6
-rw-r--r--spec/ruby/core/matchdata/equal_value_spec.rb6
-rw-r--r--spec/ruby/core/matchdata/hash_spec.rb5
-rw-r--r--spec/ruby/core/matchdata/inspect_spec.rb23
-rw-r--r--spec/ruby/core/matchdata/length_spec.rb6
-rw-r--r--spec/ruby/core/matchdata/named_captures_spec.rb15
-rw-r--r--spec/ruby/core/matchdata/names_spec.rb33
-rw-r--r--spec/ruby/core/matchdata/offset_spec.rb30
-rw-r--r--spec/ruby/core/matchdata/post_match_spec.rb36
-rw-r--r--spec/ruby/core/matchdata/pre_match_spec.rb36
-rw-r--r--spec/ruby/core/matchdata/regexp_spec.rb24
-rw-r--r--spec/ruby/core/matchdata/shared/eql.rb26
-rw-r--r--spec/ruby/core/matchdata/shared/length.rb5
-rw-r--r--spec/ruby/core/matchdata/size_spec.rb6
-rw-r--r--spec/ruby/core/matchdata/string_spec.rb25
-rw-r--r--spec/ruby/core/matchdata/to_a_spec.rb7
-rw-r--r--spec/ruby/core/matchdata/to_s_spec.rb7
-rw-r--r--spec/ruby/core/matchdata/values_at_spec.rb21
-rw-r--r--spec/ruby/core/math/acos_spec.rb56
-rw-r--r--spec/ruby/core/math/acosh_spec.rb41
-rw-r--r--spec/ruby/core/math/asin_spec.rb48
-rw-r--r--spec/ruby/core/math/asinh_spec.rb42
-rw-r--r--spec/ruby/core/math/atan2_spec.rb54
-rw-r--r--spec/ruby/core/math/atan_spec.rb40
-rw-r--r--spec/ruby/core/math/atanh_spec.rb14
-rw-r--r--spec/ruby/core/math/cbrt_spec.rb27
-rw-r--r--spec/ruby/core/math/constants_spec.rb22
-rw-r--r--spec/ruby/core/math/cos_spec.rb42
-rw-r--r--spec/ruby/core/math/cosh_spec.rb37
-rw-r--r--spec/ruby/core/math/erf_spec.rb44
-rw-r--r--spec/ruby/core/math/erfc_spec.rb43
-rw-r--r--spec/ruby/core/math/exp_spec.rb37
-rw-r--r--spec/ruby/core/math/fixtures/classes.rb28
-rw-r--r--spec/ruby/core/math/frexp_spec.rb37
-rw-r--r--spec/ruby/core/math/gamma_spec.rb69
-rw-r--r--spec/ruby/core/math/hypot_spec.rb41
-rw-r--r--spec/ruby/core/math/ldexp_spec.rb54
-rw-r--r--spec/ruby/core/math/lgamma_spec.rb54
-rw-r--r--spec/ruby/core/math/log10_spec.rb43
-rw-r--r--spec/ruby/core/math/log2_spec.rb41
-rw-r--r--spec/ruby/core/math/log_spec.rb57
-rw-r--r--spec/ruby/core/math/sin_spec.rb39
-rw-r--r--spec/ruby/core/math/sinh_spec.rb37
-rw-r--r--spec/ruby/core/math/sqrt_spec.rb36
-rw-r--r--spec/ruby/core/math/tan_spec.rb42
-rw-r--r--spec/ruby/core/math/tanh_spec.rb39
-rw-r--r--spec/ruby/core/method/arity_spec.rb222
-rw-r--r--spec/ruby/core/method/call_spec.rb7
-rw-r--r--spec/ruby/core/method/case_compare_spec.rb9
-rw-r--r--spec/ruby/core/method/clone_spec.rb14
-rw-r--r--spec/ruby/core/method/compose_spec.rb101
-rw-r--r--spec/ruby/core/method/curry_spec.rb36
-rw-r--r--spec/ruby/core/method/element_reference_spec.rb7
-rw-r--r--spec/ruby/core/method/eql_spec.rb6
-rw-r--r--spec/ruby/core/method/equal_value_spec.rb6
-rw-r--r--spec/ruby/core/method/fixtures/classes.rb210
-rw-r--r--spec/ruby/core/method/hash_spec.rb15
-rw-r--r--spec/ruby/core/method/inspect_spec.rb6
-rw-r--r--spec/ruby/core/method/name_spec.rb22
-rw-r--r--spec/ruby/core/method/original_name_spec.rb22
-rw-r--r--spec/ruby/core/method/owner_spec.rb26
-rw-r--r--spec/ruby/core/method/parameters_spec.rb261
-rw-r--r--spec/ruby/core/method/receiver_spec.rb22
-rw-r--r--spec/ruby/core/method/shared/call.rb51
-rw-r--r--spec/ruby/core/method/shared/eql.rb94
-rw-r--r--spec/ruby/core/method/shared/to_s.rb34
-rw-r--r--spec/ruby/core/method/source_location_spec.rb95
-rw-r--r--spec/ruby/core/method/super_method_spec.rb45
-rw-r--r--spec/ruby/core/method/to_proc_spec.rb104
-rw-r--r--spec/ruby/core/method/to_s_spec.rb6
-rw-r--r--spec/ruby/core/method/unbind_spec.rb37
-rw-r--r--spec/ruby/core/module/alias_method_spec.rb157
-rw-r--r--spec/ruby/core/module/allocate_spec.rb14
-rw-r--r--spec/ruby/core/module/ancestors_spec.rb70
-rw-r--r--spec/ruby/core/module/append_features_spec.rb75
-rw-r--r--spec/ruby/core/module/attr_accessor_spec.rb97
-rw-r--r--spec/ruby/core/module/attr_reader_spec.rb71
-rw-r--r--spec/ruby/core/module/attr_spec.rb155
-rw-r--r--spec/ruby/core/module/attr_writer_spec.rb71
-rw-r--r--spec/ruby/core/module/autoload_spec.rb915
-rw-r--r--spec/ruby/core/module/case_compare_spec.rb31
-rw-r--r--spec/ruby/core/module/class_eval_spec.rb7
-rw-r--r--spec/ruby/core/module/class_exec_spec.rb7
-rw-r--r--spec/ruby/core/module/class_variable_defined_spec.rb72
-rw-r--r--spec/ruby/core/module/class_variable_get_spec.rb76
-rw-r--r--spec/ruby/core/module/class_variable_set_spec.rb62
-rw-r--r--spec/ruby/core/module/class_variables_spec.rb26
-rw-r--r--spec/ruby/core/module/comparison_spec.rb36
-rw-r--r--spec/ruby/core/module/const_defined_spec.rb144
-rw-r--r--spec/ruby/core/module/const_get_spec.rb229
-rw-r--r--spec/ruby/core/module/const_missing_spec.rb36
-rw-r--r--spec/ruby/core/module/const_set_spec.rb133
-rw-r--r--spec/ruby/core/module/constants_spec.rb91
-rw-r--r--spec/ruby/core/module/define_method_spec.rb678
-rw-r--r--spec/ruby/core/module/define_singleton_method_spec.rb15
-rw-r--r--spec/ruby/core/module/deprecate_constant_spec.rb60
-rw-r--r--spec/ruby/core/module/eql_spec.rb7
-rw-r--r--spec/ruby/core/module/equal_spec.rb7
-rw-r--r--spec/ruby/core/module/equal_value_spec.rb7
-rw-r--r--spec/ruby/core/module/extend_object_spec.rb70
-rw-r--r--spec/ruby/core/module/extended_spec.rb44
-rw-r--r--spec/ruby/core/module/fixtures/autoload.rb1
-rw-r--r--spec/ruby/core/module/fixtures/autoload_abc.rb11
-rw-r--r--spec/ruby/core/module/fixtures/autoload_c.rb11
-rw-r--r--spec/ruby/core/module/fixtures/autoload_callback.rb2
-rw-r--r--spec/ruby/core/module/fixtures/autoload_concur.rb9
-rw-r--r--spec/ruby/core/module/fixtures/autoload_d.rb11
-rw-r--r--spec/ruby/core/module/fixtures/autoload_during_autoload.rb7
-rw-r--r--spec/ruby/core/module/fixtures/autoload_during_require.rb4
-rw-r--r--spec/ruby/core/module/fixtures/autoload_e.rb7
-rw-r--r--spec/ruby/core/module/fixtures/autoload_empty.rb1
-rw-r--r--spec/ruby/core/module/fixtures/autoload_ex1.rb16
-rw-r--r--spec/ruby/core/module/fixtures/autoload_exception.rb3
-rw-r--r--spec/ruby/core/module/fixtures/autoload_f.rb7
-rw-r--r--spec/ruby/core/module/fixtures/autoload_g.rb7
-rw-r--r--spec/ruby/core/module/fixtures/autoload_h.rb7
-rw-r--r--spec/ruby/core/module/fixtures/autoload_i.rb5
-rw-r--r--spec/ruby/core/module/fixtures/autoload_j.rb3
-rw-r--r--spec/ruby/core/module/fixtures/autoload_k.rb7
-rw-r--r--spec/ruby/core/module/fixtures/autoload_lm.rb4
-rw-r--r--spec/ruby/core/module/fixtures/autoload_nested.rb8
-rw-r--r--spec/ruby/core/module/fixtures/autoload_never_set.rb1
-rw-r--r--spec/ruby/core/module/fixtures/autoload_o.rb2
-rw-r--r--spec/ruby/core/module/fixtures/autoload_overridden.rb3
-rw-r--r--spec/ruby/core/module/fixtures/autoload_r.rb4
-rw-r--r--spec/ruby/core/module/fixtures/autoload_raise.rb2
-rw-r--r--spec/ruby/core/module/fixtures/autoload_required_directly.rb7
-rw-r--r--spec/ruby/core/module/fixtures/autoload_required_directly_nested.rb1
-rw-r--r--spec/ruby/core/module/fixtures/autoload_s.rb5
-rw-r--r--spec/ruby/core/module/fixtures/autoload_self_during_require.rb5
-rw-r--r--spec/ruby/core/module/fixtures/autoload_subclass.rb11
-rw-r--r--spec/ruby/core/module/fixtures/autoload_t.rb3
-rw-r--r--spec/ruby/core/module/fixtures/autoload_v.rb7
-rw-r--r--spec/ruby/core/module/fixtures/autoload_w.rb2
-rw-r--r--spec/ruby/core/module/fixtures/autoload_w2.rb1
-rw-r--r--spec/ruby/core/module/fixtures/autoload_x.rb3
-rw-r--r--spec/ruby/core/module/fixtures/autoload_z.rb5
-rw-r--r--spec/ruby/core/module/fixtures/classes.rb614
-rw-r--r--spec/ruby/core/module/fixtures/constant_unicode.rb5
-rw-r--r--spec/ruby/core/module/fixtures/constants_autoload.rb6
-rw-r--r--spec/ruby/core/module/fixtures/constants_autoload_a.rb2
-rw-r--r--spec/ruby/core/module/fixtures/constants_autoload_b.rb2
-rw-r--r--spec/ruby/core/module/fixtures/constants_autoload_c.rb3
-rw-r--r--spec/ruby/core/module/fixtures/constants_autoload_d.rb4
-rw-r--r--spec/ruby/core/module/fixtures/module.rb4
-rw-r--r--spec/ruby/core/module/fixtures/multi/foo.rb6
-rw-r--r--spec/ruby/core/module/fixtures/multi/foo/bar_baz.rb11
-rw-r--r--spec/ruby/core/module/fixtures/name.rb10
-rw-r--r--spec/ruby/core/module/fixtures/path1/load_path.rb9
-rw-r--r--spec/ruby/core/module/fixtures/path2/load_path.rb1
-rw-r--r--spec/ruby/core/module/fixtures/refine.rb13
-rw-r--r--spec/ruby/core/module/fixtures/repeated_concurrent_autoload.rb8
-rw-r--r--spec/ruby/core/module/freeze_spec.rb6
-rw-r--r--spec/ruby/core/module/gt_spec.rb36
-rw-r--r--spec/ruby/core/module/gte_spec.rb33
-rw-r--r--spec/ruby/core/module/include_spec.rb258
-rw-r--r--spec/ruby/core/module/included_modules_spec.rb12
-rw-r--r--spec/ruby/core/module/included_spec.rb44
-rw-r--r--spec/ruby/core/module/initialize_copy_spec.rb18
-rw-r--r--spec/ruby/core/module/initialize_spec.rb18
-rw-r--r--spec/ruby/core/module/instance_method_spec.rb85
-rw-r--r--spec/ruby/core/module/instance_methods_spec.rb61
-rw-r--r--spec/ruby/core/module/lt_spec.rb36
-rw-r--r--spec/ruby/core/module/lte_spec.rb33
-rw-r--r--spec/ruby/core/module/method_added_spec.rb62
-rw-r--r--spec/ruby/core/module/method_defined_spec.rb100
-rw-r--r--spec/ruby/core/module/method_removed_spec.rb33
-rw-r--r--spec/ruby/core/module/method_undefined_spec.rb33
-rw-r--r--spec/ruby/core/module/module_eval_spec.rb7
-rw-r--r--spec/ruby/core/module/module_exec_spec.rb7
-rw-r--r--spec/ruby/core/module/module_function_spec.rb269
-rw-r--r--spec/ruby/core/module/name_spec.rb128
-rw-r--r--spec/ruby/core/module/nesting_spec.rb31
-rw-r--r--spec/ruby/core/module/new_spec.rb31
-rw-r--r--spec/ruby/core/module/prepend_features_spec.rb78
-rw-r--r--spec/ruby/core/module/prepend_spec.rb361
-rw-r--r--spec/ruby/core/module/prepended_spec.rb25
-rw-r--r--spec/ruby/core/module/private_class_method_spec.rb81
-rw-r--r--spec/ruby/core/module/private_constant_spec.rb32
-rw-r--r--spec/ruby/core/module/private_instance_methods_spec.rb54
-rw-r--r--spec/ruby/core/module/private_method_defined_spec.rb122
-rw-r--r--spec/ruby/core/module/private_spec.rb93
-rw-r--r--spec/ruby/core/module/protected_instance_methods_spec.rb57
-rw-r--r--spec/ruby/core/module/protected_method_defined_spec.rb122
-rw-r--r--spec/ruby/core/module/protected_spec.rb55
-rw-r--r--spec/ruby/core/module/public_class_method_spec.rb80
-rw-r--r--spec/ruby/core/module/public_constant_spec.rb38
-rw-r--r--spec/ruby/core/module/public_instance_method_spec.rb65
-rw-r--r--spec/ruby/core/module/public_instance_methods_spec.rb61
-rw-r--r--spec/ruby/core/module/public_method_defined_spec.rb72
-rw-r--r--spec/ruby/core/module/public_spec.rb44
-rw-r--r--spec/ruby/core/module/refine_spec.rb782
-rw-r--r--spec/ruby/core/module/remove_class_variable_spec.rb44
-rw-r--r--spec/ruby/core/module/remove_const_spec.rb84
-rw-r--r--spec/ruby/core/module/remove_method_spec.rb116
-rw-r--r--spec/ruby/core/module/shared/class_eval.rb115
-rw-r--r--spec/ruby/core/module/shared/class_exec.rb29
-rw-r--r--spec/ruby/core/module/shared/equal_value.rb14
-rw-r--r--spec/ruby/core/module/shared/set_visibility.rb152
-rw-r--r--spec/ruby/core/module/singleton_class_spec.rb27
-rw-r--r--spec/ruby/core/module/to_s_spec.rb45
-rw-r--r--spec/ruby/core/module/undef_method_spec.rb188
-rw-r--r--spec/ruby/core/module/using_spec.rb287
-rw-r--r--spec/ruby/core/mutex/lock_spec.rb34
-rw-r--r--spec/ruby/core/mutex/locked_spec.rb36
-rw-r--r--spec/ruby/core/mutex/owned_spec.rb43
-rw-r--r--spec/ruby/core/mutex/sleep_spec.rb95
-rw-r--r--spec/ruby/core/mutex/synchronize_spec.rb66
-rw-r--r--spec/ruby/core/mutex/try_lock_spec.rb32
-rw-r--r--spec/ruby/core/mutex/unlock_spec.rb38
-rw-r--r--spec/ruby/core/nil/and_spec.rb11
-rw-r--r--spec/ruby/core/nil/dup_spec.rb7
-rw-r--r--spec/ruby/core/nil/inspect_spec.rb7
-rw-r--r--spec/ruby/core/nil/match_spec.rb19
-rw-r--r--spec/ruby/core/nil/nil_spec.rb7
-rw-r--r--spec/ruby/core/nil/nilclass_spec.rb15
-rw-r--r--spec/ruby/core/nil/or_spec.rb11
-rw-r--r--spec/ruby/core/nil/rationalize_spec.rb16
-rw-r--r--spec/ruby/core/nil/to_a_spec.rb7
-rw-r--r--spec/ruby/core/nil/to_c_spec.rb7
-rw-r--r--spec/ruby/core/nil/to_f_spec.rb11
-rw-r--r--spec/ruby/core/nil/to_h_spec.rb8
-rw-r--r--spec/ruby/core/nil/to_i_spec.rb11
-rw-r--r--spec/ruby/core/nil/to_r_spec.rb7
-rw-r--r--spec/ruby/core/nil/to_s_spec.rb17
-rw-r--r--spec/ruby/core/nil/xor_spec.rb11
-rw-r--r--spec/ruby/core/numeric/abs2_spec.rb34
-rw-r--r--spec/ruby/core/numeric/abs_spec.rb6
-rw-r--r--spec/ruby/core/numeric/angle_spec.rb6
-rw-r--r--spec/ruby/core/numeric/arg_spec.rb6
-rw-r--r--spec/ruby/core/numeric/ceil_spec.rb15
-rw-r--r--spec/ruby/core/numeric/coerce_spec.rb59
-rw-r--r--spec/ruby/core/numeric/comparison_spec.rb48
-rw-r--r--spec/ruby/core/numeric/conj_spec.rb6
-rw-r--r--spec/ruby/core/numeric/conjugate_spec.rb6
-rw-r--r--spec/ruby/core/numeric/denominator_spec.rb24
-rw-r--r--spec/ruby/core/numeric/div_spec.rb22
-rw-r--r--spec/ruby/core/numeric/divmod_spec.rb15
-rw-r--r--spec/ruby/core/numeric/eql_spec.rb22
-rw-r--r--spec/ruby/core/numeric/fdiv_spec.rb32
-rw-r--r--spec/ruby/core/numeric/finite_spec.rb8
-rw-r--r--spec/ruby/core/numeric/fixtures/classes.rb17
-rw-r--r--spec/ruby/core/numeric/floor_spec.rb14
-rw-r--r--spec/ruby/core/numeric/i_spec.rb15
-rw-r--r--spec/ruby/core/numeric/imag_spec.rb6
-rw-r--r--spec/ruby/core/numeric/imaginary_spec.rb6
-rw-r--r--spec/ruby/core/numeric/infinite_spec.rb8
-rw-r--r--spec/ruby/core/numeric/integer_spec.rb8
-rw-r--r--spec/ruby/core/numeric/magnitude_spec.rb5
-rw-r--r--spec/ruby/core/numeric/modulo_spec.rb24
-rw-r--r--spec/ruby/core/numeric/negative_spec.rb41
-rw-r--r--spec/ruby/core/numeric/nonzero_spec.rb18
-rw-r--r--spec/ruby/core/numeric/numerator_spec.rb33
-rw-r--r--spec/ruby/core/numeric/numeric_spec.rb7
-rw-r--r--spec/ruby/core/numeric/phase_spec.rb6
-rw-r--r--spec/ruby/core/numeric/polar_spec.rb50
-rw-r--r--spec/ruby/core/numeric/positive_spec.rb41
-rw-r--r--spec/ruby/core/numeric/quo_spec.rb55
-rw-r--r--spec/ruby/core/numeric/real_spec.rb37
-rw-r--r--spec/ruby/core/numeric/rect_spec.rb6
-rw-r--r--spec/ruby/core/numeric/rectangular_spec.rb6
-rw-r--r--spec/ruby/core/numeric/remainder_spec.rb67
-rw-r--r--spec/ruby/core/numeric/round_spec.rb14
-rw-r--r--spec/ruby/core/numeric/shared/abs.rb19
-rw-r--r--spec/ruby/core/numeric/shared/arg.rb38
-rw-r--r--spec/ruby/core/numeric/shared/conj.rb20
-rw-r--r--spec/ruby/core/numeric/shared/imag.rb26
-rw-r--r--spec/ruby/core/numeric/shared/quo.rb7
-rw-r--r--spec/ruby/core/numeric/shared/rect.rb48
-rw-r--r--spec/ruby/core/numeric/shared/step.rb433
-rw-r--r--spec/ruby/core/numeric/singleton_method_added_spec.rb41
-rw-r--r--spec/ruby/core/numeric/step_spec.rb200
-rw-r--r--spec/ruby/core/numeric/to_c_spec.rb45
-rw-r--r--spec/ruby/core/numeric/to_int_spec.rb10
-rw-r--r--spec/ruby/core/numeric/truncate_spec.rb14
-rw-r--r--spec/ruby/core/numeric/uminus_spec.rb31
-rw-r--r--spec/ruby/core/numeric/uplus_spec.rb9
-rw-r--r--spec/ruby/core/numeric/zero_spec.rb18
-rw-r--r--spec/ruby/core/objectspace/_id2ref_spec.rb25
-rw-r--r--spec/ruby/core/objectspace/add_finalizer_spec.rb5
-rw-r--r--spec/ruby/core/objectspace/call_finalizer_spec.rb5
-rw-r--r--spec/ruby/core/objectspace/count_objects_spec.rb5
-rw-r--r--spec/ruby/core/objectspace/define_finalizer_spec.rb68
-rw-r--r--spec/ruby/core/objectspace/each_object_spec.rb213
-rw-r--r--spec/ruby/core/objectspace/finalizers_spec.rb5
-rw-r--r--spec/ruby/core/objectspace/fixtures/classes.rb64
-rw-r--r--spec/ruby/core/objectspace/garbage_collect_spec.rb22
-rw-r--r--spec/ruby/core/objectspace/remove_finalizer_spec.rb5
-rw-r--r--spec/ruby/core/objectspace/undefine_finalizer_spec.rb5
-rw-r--r--spec/ruby/core/proc/allocate_spec.rb9
-rw-r--r--spec/ruby/core/proc/arity_spec.rb640
-rw-r--r--spec/ruby/core/proc/binding_spec.rb21
-rw-r--r--spec/ruby/core/proc/block_pass_spec.rb43
-rw-r--r--spec/ruby/core/proc/call_spec.rb16
-rw-r--r--spec/ruby/core/proc/case_compare_spec.rb16
-rw-r--r--spec/ruby/core/proc/clone_spec.rb6
-rw-r--r--spec/ruby/core/proc/compose_spec.rb156
-rw-r--r--spec/ruby/core/proc/curry_spec.rb180
-rw-r--r--spec/ruby/core/proc/dup_spec.rb6
-rw-r--r--spec/ruby/core/proc/element_reference_spec.rb27
-rw-r--r--spec/ruby/core/proc/eql_spec.rb6
-rw-r--r--spec/ruby/core/proc/equal_value_spec.rb6
-rw-r--r--spec/ruby/core/proc/fixtures/common.rb51
-rw-r--r--spec/ruby/core/proc/fixtures/proc_aref.rb9
-rw-r--r--spec/ruby/core/proc/fixtures/proc_aref_frozen.rb10
-rw-r--r--spec/ruby/core/proc/fixtures/source_location.rb55
-rw-r--r--spec/ruby/core/proc/hash_spec.rb17
-rw-r--r--spec/ruby/core/proc/inspect_spec.rb6
-rw-r--r--spec/ruby/core/proc/lambda_spec.rb60
-rw-r--r--spec/ruby/core/proc/new_spec.rb234
-rw-r--r--spec/ruby/core/proc/parameters_spec.rb95
-rw-r--r--spec/ruby/core/proc/shared/call.rb96
-rw-r--r--spec/ruby/core/proc/shared/call_arguments.rb29
-rw-r--r--spec/ruby/core/proc/shared/compose.rb47
-rw-r--r--spec/ruby/core/proc/shared/dup.rb10
-rw-r--r--spec/ruby/core/proc/shared/equal.rb100
-rw-r--r--spec/ruby/core/proc/shared/to_s.rb57
-rw-r--r--spec/ruby/core/proc/source_location_spec.rb86
-rw-r--r--spec/ruby/core/proc/to_proc_spec.rb9
-rw-r--r--spec/ruby/core/proc/to_s_spec.rb6
-rw-r--r--spec/ruby/core/proc/yield_spec.rb16
-rw-r--r--spec/ruby/core/process/abort_spec.rb6
-rw-r--r--spec/ruby/core/process/clock_getres_spec.rb33
-rw-r--r--spec/ruby/core/process/clock_gettime_spec.rb137
-rw-r--r--spec/ruby/core/process/constants_spec.rb63
-rw-r--r--spec/ruby/core/process/daemon_spec.rb115
-rw-r--r--spec/ruby/core/process/detach_spec.rb46
-rw-r--r--spec/ruby/core/process/egid_spec.rb19
-rw-r--r--spec/ruby/core/process/euid_spec.rb46
-rw-r--r--spec/ruby/core/process/exec_spec.rb247
-rw-r--r--spec/ruby/core/process/exit_spec.rb10
-rw-r--r--spec/ruby/core/process/fixtures/clocks.rb18
-rw-r--r--spec/ruby/core/process/fixtures/common.rb88
-rw-r--r--spec/ruby/core/process/fixtures/daemon.rb111
-rw-r--r--spec/ruby/core/process/fixtures/in.txt1
-rw-r--r--spec/ruby/core/process/fixtures/kill.rb45
-rw-r--r--spec/ruby/core/process/fixtures/map_fd.rb9
-rw-r--r--spec/ruby/core/process/fixtures/setpriority.rb12
-rw-r--r--spec/ruby/core/process/fork_spec.rb6
-rw-r--r--spec/ruby/core/process/getpgid_spec.rb17
-rw-r--r--spec/ruby/core/process/getpgrp_spec.rb7
-rw-r--r--spec/ruby/core/process/getpriority_spec.rb23
-rw-r--r--spec/ruby/core/process/getrlimit_spec.rb91
-rw-r--r--spec/ruby/core/process/gid/change_privilege_spec.rb5
-rw-r--r--spec/ruby/core/process/gid/eid_spec.rb9
-rw-r--r--spec/ruby/core/process/gid/grant_privilege_spec.rb5
-rw-r--r--spec/ruby/core/process/gid/re_exchange_spec.rb5
-rw-r--r--spec/ruby/core/process/gid/re_exchangeable_spec.rb5
-rw-r--r--spec/ruby/core/process/gid/rid_spec.rb5
-rw-r--r--spec/ruby/core/process/gid/sid_available_spec.rb5
-rw-r--r--spec/ruby/core/process/gid/switch_spec.rb5
-rw-r--r--spec/ruby/core/process/gid_spec.rb22
-rw-r--r--spec/ruby/core/process/groups_spec.rb63
-rw-r--r--spec/ruby/core/process/initgroups_spec.rb22
-rw-r--r--spec/ruby/core/process/kill_spec.rb132
-rw-r--r--spec/ruby/core/process/last_status_spec.rb20
-rw-r--r--spec/ruby/core/process/maxgroups_spec.rb19
-rw-r--r--spec/ruby/core/process/pid_spec.rb9
-rw-r--r--spec/ruby/core/process/ppid_spec.rb9
-rw-r--r--spec/ruby/core/process/set_proctitle_spec.rb23
-rw-r--r--spec/ruby/core/process/setpgid_spec.rb29
-rw-r--r--spec/ruby/core/process/setpgrp_spec.rb37
-rw-r--r--spec/ruby/core/process/setpriority_spec.rb60
-rw-r--r--spec/ruby/core/process/setrlimit_spec.rb232
-rw-r--r--spec/ruby/core/process/setsid_spec.rb16
-rw-r--r--spec/ruby/core/process/spawn_spec.rb712
-rw-r--r--spec/ruby/core/process/status/bit_and_spec.rb5
-rw-r--r--spec/ruby/core/process/status/coredump_spec.rb5
-rw-r--r--spec/ruby/core/process/status/equal_value_spec.rb15
-rw-r--r--spec/ruby/core/process/status/exited_spec.rb37
-rw-r--r--spec/ruby/core/process/status/exitstatus_spec.rb25
-rw-r--r--spec/ruby/core/process/status/inspect_spec.rb5
-rw-r--r--spec/ruby/core/process/status/pid_spec.rb15
-rw-r--r--spec/ruby/core/process/status/right_shift_spec.rb5
-rw-r--r--spec/ruby/core/process/status/signaled_spec.rb35
-rw-r--r--spec/ruby/core/process/status/stopped_spec.rb5
-rw-r--r--spec/ruby/core/process/status/stopsig_spec.rb5
-rw-r--r--spec/ruby/core/process/status/success_spec.rb51
-rw-r--r--spec/ruby/core/process/status/termsig_spec.rb43
-rw-r--r--spec/ruby/core/process/status/to_i_spec.rb13
-rw-r--r--spec/ruby/core/process/status/to_int_spec.rb5
-rw-r--r--spec/ruby/core/process/status/to_s_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/getegid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/geteuid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/getgid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/getuid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/issetugid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/setegid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/seteuid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/setgid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/setregid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/setresgid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/setresuid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/setreuid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/setrgid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/setruid_spec.rb5
-rw-r--r--spec/ruby/core/process/sys/setuid_spec.rb5
-rw-r--r--spec/ruby/core/process/times_spec.rb30
-rw-r--r--spec/ruby/core/process/uid/change_privilege_spec.rb5
-rw-r--r--spec/ruby/core/process/uid/eid_spec.rb9
-rw-r--r--spec/ruby/core/process/uid/grant_privilege_spec.rb5
-rw-r--r--spec/ruby/core/process/uid/re_exchange_spec.rb5
-rw-r--r--spec/ruby/core/process/uid/re_exchangeable_spec.rb5
-rw-r--r--spec/ruby/core/process/uid/rid_spec.rb5
-rw-r--r--spec/ruby/core/process/uid/sid_available_spec.rb5
-rw-r--r--spec/ruby/core/process/uid/switch_spec.rb5
-rw-r--r--spec/ruby/core/process/uid_spec.rb57
-rw-r--r--spec/ruby/core/process/wait2_spec.rb36
-rw-r--r--spec/ruby/core/process/wait_spec.rb92
-rw-r--r--spec/ruby/core/process/waitall_spec.rb48
-rw-r--r--spec/ruby/core/process/waitpid2_spec.rb5
-rw-r--r--spec/ruby/core/process/waitpid_spec.rb13
-rw-r--r--spec/ruby/core/queue/append_spec.rb6
-rw-r--r--spec/ruby/core/queue/clear_spec.rb6
-rw-r--r--spec/ruby/core/queue/close_spec.rb6
-rw-r--r--spec/ruby/core/queue/closed_spec.rb6
-rw-r--r--spec/ruby/core/queue/deq_spec.rb6
-rw-r--r--spec/ruby/core/queue/empty_spec.rb6
-rw-r--r--spec/ruby/core/queue/enq_spec.rb6
-rw-r--r--spec/ruby/core/queue/length_spec.rb6
-rw-r--r--spec/ruby/core/queue/num_waiting_spec.rb6
-rw-r--r--spec/ruby/core/queue/pop_spec.rb6
-rw-r--r--spec/ruby/core/queue/push_spec.rb6
-rw-r--r--spec/ruby/core/queue/shift_spec.rb6
-rw-r--r--spec/ruby/core/queue/size_spec.rb6
-rw-r--r--spec/ruby/core/random/bytes_spec.rb32
-rw-r--r--spec/ruby/core/random/default_spec.rb7
-rw-r--r--spec/ruby/core/random/equal_value_spec.rb37
-rw-r--r--spec/ruby/core/random/fixtures/classes.rb15
-rw-r--r--spec/ruby/core/random/new_seed_spec.rb24
-rw-r--r--spec/ruby/core/random/new_spec.rb37
-rw-r--r--spec/ruby/core/random/rand_spec.rb219
-rw-r--r--spec/ruby/core/random/random_number_spec.rb10
-rw-r--r--spec/ruby/core/random/raw_seed_spec.rb9
-rw-r--r--spec/ruby/core/random/seed_spec.rb29
-rw-r--r--spec/ruby/core/random/shared/bytes.rb17
-rw-r--r--spec/ruby/core/random/shared/rand.rb9
-rw-r--r--spec/ruby/core/random/shared/urandom.rb23
-rw-r--r--spec/ruby/core/random/srand_spec.rb39
-rw-r--r--spec/ruby/core/random/urandom_spec.rb9
-rw-r--r--spec/ruby/core/range/begin_spec.rb6
-rw-r--r--spec/ruby/core/range/bsearch_spec.rb137
-rw-r--r--spec/ruby/core/range/case_compare_spec.rb28
-rw-r--r--spec/ruby/core/range/cover_spec.rb9
-rw-r--r--spec/ruby/core/range/dup_spec.rb15
-rw-r--r--spec/ruby/core/range/each_spec.rb66
-rw-r--r--spec/ruby/core/range/end_spec.rb6
-rw-r--r--spec/ruby/core/range/eql_spec.rb10
-rw-r--r--spec/ruby/core/range/equal_value_spec.rb10
-rw-r--r--spec/ruby/core/range/exclude_end_spec.rb19
-rw-r--r--spec/ruby/core/range/first_spec.rb49
-rw-r--r--spec/ruby/core/range/fixtures/classes.rb90
-rw-r--r--spec/ruby/core/range/hash_spec.rb24
-rw-r--r--spec/ruby/core/range/include_spec.rb10
-rw-r--r--spec/ruby/core/range/initialize_spec.rb41
-rw-r--r--spec/ruby/core/range/inspect_spec.rb28
-rw-r--r--spec/ruby/core/range/last_spec.rb49
-rw-r--r--spec/ruby/core/range/max_spec.rb82
-rw-r--r--spec/ruby/core/range/member_spec.rb10
-rw-r--r--spec/ruby/core/range/min_spec.rb75
-rw-r--r--spec/ruby/core/range/new_spec.rb87
-rw-r--r--spec/ruby/core/range/percent_spec.rb18
-rw-r--r--spec/ruby/core/range/range_spec.rb7
-rw-r--r--spec/ruby/core/range/shared/begin.rb10
-rw-r--r--spec/ruby/core/range/shared/cover.rb153
-rw-r--r--spec/ruby/core/range/shared/cover_and_include.rb66
-rw-r--r--spec/ruby/core/range/shared/end.rb10
-rw-r--r--spec/ruby/core/range/shared/equal_value.rb45
-rw-r--r--spec/ruby/core/range/shared/include.rb91
-rw-r--r--spec/ruby/core/range/size_spec.rb31
-rw-r--r--spec/ruby/core/range/step_spec.rb397
-rw-r--r--spec/ruby/core/range/to_a_spec.rb22
-rw-r--r--spec/ruby/core/range/to_s_spec.rb27
-rw-r--r--spec/ruby/core/rational/abs_spec.rb5
-rw-r--r--spec/ruby/core/rational/ceil_spec.rb5
-rw-r--r--spec/ruby/core/rational/coerce_spec.rb5
-rw-r--r--spec/ruby/core/rational/comparison_spec.rb22
-rw-r--r--spec/ruby/core/rational/denominator_spec.rb5
-rw-r--r--spec/ruby/core/rational/div_spec.rb17
-rw-r--r--spec/ruby/core/rational/divide_spec.rb19
-rw-r--r--spec/ruby/core/rational/divmod_spec.rb13
-rw-r--r--spec/ruby/core/rational/equal_value_spec.rb17
-rw-r--r--spec/ruby/core/rational/exponent_spec.rb5
-rw-r--r--spec/ruby/core/rational/fdiv_spec.rb5
-rw-r--r--spec/ruby/core/rational/floor_spec.rb5
-rw-r--r--spec/ruby/core/rational/hash_spec.rb5
-rw-r--r--spec/ruby/core/rational/inspect_spec.rb5
-rw-r--r--spec/ruby/core/rational/integer_spec.rb12
-rw-r--r--spec/ruby/core/rational/magnitude_spec.rb5
-rw-r--r--spec/ruby/core/rational/marshal_dump_spec.rb11
-rw-r--r--spec/ruby/core/rational/minus_spec.rb7
-rw-r--r--spec/ruby/core/rational/modulo_spec.rb5
-rw-r--r--spec/ruby/core/rational/multiply_spec.rb19
-rw-r--r--spec/ruby/core/rational/numerator_spec.rb5
-rw-r--r--spec/ruby/core/rational/plus_spec.rb18
-rw-r--r--spec/ruby/core/rational/quo_spec.rb5
-rw-r--r--spec/ruby/core/rational/rational_spec.rb7
-rw-r--r--spec/ruby/core/rational/rationalize_spec.rb36
-rw-r--r--spec/ruby/core/rational/remainder_spec.rb5
-rw-r--r--spec/ruby/core/rational/round_spec.rb6
-rw-r--r--spec/ruby/core/rational/to_f_spec.rb5
-rw-r--r--spec/ruby/core/rational/to_i_spec.rb5
-rw-r--r--spec/ruby/core/rational/to_r_spec.rb20
-rw-r--r--spec/ruby/core/rational/to_s_spec.rb5
-rw-r--r--spec/ruby/core/rational/truncate_spec.rb5
-rw-r--r--spec/ruby/core/rational/zero_spec.rb13
-rw-r--r--spec/ruby/core/regexp/case_compare_spec.rb25
-rw-r--r--spec/ruby/core/regexp/casefold_spec.rb8
-rw-r--r--spec/ruby/core/regexp/compile_spec.rb15
-rw-r--r--spec/ruby/core/regexp/encoding_spec.rb62
-rw-r--r--spec/ruby/core/regexp/eql_spec.rb6
-rw-r--r--spec/ruby/core/regexp/equal_value_spec.rb6
-rw-r--r--spec/ruby/core/regexp/escape_spec.rb6
-rw-r--r--spec/ruby/core/regexp/fixed_encoding_spec.rb36
-rw-r--r--spec/ruby/core/regexp/hash_spec.rb20
-rw-r--r--spec/ruby/core/regexp/initialize_spec.rb15
-rw-r--r--spec/ruby/core/regexp/inspect_spec.rb44
-rw-r--r--spec/ruby/core/regexp/last_match_spec.rb14
-rw-r--r--spec/ruby/core/regexp/match_spec.rb146
-rw-r--r--spec/ruby/core/regexp/named_captures_spec.rb35
-rw-r--r--spec/ruby/core/regexp/names_spec.rb29
-rw-r--r--spec/ruby/core/regexp/new_spec.rb27
-rw-r--r--spec/ruby/core/regexp/options_spec.rb54
-rw-r--r--spec/ruby/core/regexp/quote_spec.rb6
-rw-r--r--spec/ruby/core/regexp/shared/equal_value.rb31
-rw-r--r--spec/ruby/core/regexp/shared/new.rb505
-rw-r--r--spec/ruby/core/regexp/shared/quote.rb31
-rw-r--r--spec/ruby/core/regexp/source_spec.rb29
-rw-r--r--spec/ruby/core/regexp/to_s_spec.rb62
-rw-r--r--spec/ruby/core/regexp/try_convert_spec.rb21
-rw-r--r--spec/ruby/core/regexp/union_spec.rb149
-rw-r--r--spec/ruby/core/signal/fixtures/trap_all.rb15
-rw-r--r--spec/ruby/core/signal/list_spec.rb68
-rw-r--r--spec/ruby/core/signal/signame_spec.rb22
-rw-r--r--spec/ruby/core/signal/trap_spec.rb182
-rw-r--r--spec/ruby/core/sizedqueue/append_spec.rb11
-rw-r--r--spec/ruby/core/sizedqueue/clear_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/close_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/closed_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/deq_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/empty_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/enq_spec.rb11
-rw-r--r--spec/ruby/core/sizedqueue/length_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/max_spec.rb10
-rw-r--r--spec/ruby/core/sizedqueue/new_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/num_waiting_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/pop_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/push_spec.rb11
-rw-r--r--spec/ruby/core/sizedqueue/shift_spec.rb6
-rw-r--r--spec/ruby/core/sizedqueue/size_spec.rb6
-rw-r--r--spec/ruby/core/string/allocate_spec.rb19
-rw-r--r--spec/ruby/core/string/append_spec.rb8
-rw-r--r--spec/ruby/core/string/ascii_only_spec.rb83
-rw-r--r--spec/ruby/core/string/b_spec.rb24
-rw-r--r--spec/ruby/core/string/bytes_spec.rb55
-rw-r--r--spec/ruby/core/string/bytesize_spec.rb33
-rw-r--r--spec/ruby/core/string/byteslice_spec.rb27
-rw-r--r--spec/ruby/core/string/capitalize_spec.rb187
-rw-r--r--spec/ruby/core/string/case_compare_spec.rb8
-rw-r--r--spec/ruby/core/string/casecmp_spec.rb210
-rw-r--r--spec/ruby/core/string/center_spec.rb135
-rw-r--r--spec/ruby/core/string/chars_spec.rb10
-rw-r--r--spec/ruby/core/string/chomp_spec.rb407
-rw-r--r--spec/ruby/core/string/chop_spec.rb126
-rw-r--r--spec/ruby/core/string/chr_spec.rb42
-rw-r--r--spec/ruby/core/string/clear_spec.rb37
-rw-r--r--spec/ruby/core/string/clone_spec.rb57
-rw-r--r--spec/ruby/core/string/codepoints_spec.rb18
-rw-r--r--spec/ruby/core/string/comparison_spec.rb108
-rw-r--r--spec/ruby/core/string/concat_spec.rb26
-rw-r--r--spec/ruby/core/string/count_spec.rb105
-rw-r--r--spec/ruby/core/string/crypt_spec.rb122
-rw-r--r--spec/ruby/core/string/delete_prefix_spec.rb83
-rw-r--r--spec/ruby/core/string/delete_spec.rb121
-rw-r--r--spec/ruby/core/string/delete_suffix_spec.rb83
-rw-r--r--spec/ruby/core/string/downcase_spec.rb182
-rw-r--r--spec/ruby/core/string/dump_spec.rb402
-rw-r--r--spec/ruby/core/string/dup_spec.rb52
-rw-r--r--spec/ruby/core/string/each_byte_spec.rb61
-rw-r--r--spec/ruby/core/string/each_char_spec.rb7
-rw-r--r--spec/ruby/core/string/each_codepoint_spec.rb8
-rw-r--r--spec/ruby/core/string/each_grapheme_cluster_spec.rb11
-rw-r--r--spec/ruby/core/string/each_line_spec.rb9
-rw-r--r--spec/ruby/core/string/element_reference_spec.rb35
-rw-r--r--spec/ruby/core/string/element_set_spec.rb606
-rw-r--r--spec/ruby/core/string/empty_spec.rb12
-rw-r--r--spec/ruby/core/string/encode_spec.rb163
-rw-r--r--spec/ruby/core/string/encoding_spec.rb187
-rw-r--r--spec/ruby/core/string/end_with_spec.rb56
-rw-r--r--spec/ruby/core/string/eql_spec.rb21
-rw-r--r--spec/ruby/core/string/equal_value_spec.rb8
-rw-r--r--spec/ruby/core/string/fixtures/classes.rb49
-rw-r--r--spec/ruby/core/string/fixtures/freeze_magic_comment.rb3
-rw-r--r--spec/ruby/core/string/fixtures/iso-8859-9-encoding.rb9
-rw-r--r--spec/ruby/core/string/fixtures/utf-8-encoding.rb7
-rw-r--r--spec/ruby/core/string/force_encoding_spec.rb71
-rw-r--r--spec/ruby/core/string/freeze_spec.rb17
-rw-r--r--spec/ruby/core/string/getbyte_spec.rb69
-rw-r--r--spec/ruby/core/string/grapheme_clusters_spec.rb15
-rw-r--r--spec/ruby/core/string/gsub_spec.rb708
-rw-r--r--spec/ruby/core/string/hash_spec.rb9
-rw-r--r--spec/ruby/core/string/hex_spec.rb49
-rw-r--r--spec/ruby/core/string/include_spec.rb35
-rw-r--r--spec/ruby/core/string/index_spec.rb312
-rw-r--r--spec/ruby/core/string/initialize_spec.rb26
-rw-r--r--spec/ruby/core/string/insert_spec.rb84
-rw-r--r--spec/ruby/core/string/inspect_spec.rb502
-rw-r--r--spec/ruby/core/string/intern_spec.rb7
-rw-r--r--spec/ruby/core/string/length_spec.rb7
-rw-r--r--spec/ruby/core/string/lines_spec.rb20
-rw-r--r--spec/ruby/core/string/ljust_spec.rb118
-rw-r--r--spec/ruby/core/string/lstrip_spec.rb52
-rw-r--r--spec/ruby/core/string/match_spec.rb167
-rw-r--r--spec/ruby/core/string/modulo_spec.rb815
-rw-r--r--spec/ruby/core/string/multiply_spec.rb7
-rw-r--r--spec/ruby/core/string/new_spec.rb61
-rw-r--r--spec/ruby/core/string/next_spec.rb11
-rw-r--r--spec/ruby/core/string/oct_spec.rb88
-rw-r--r--spec/ruby/core/string/ord_spec.rb28
-rw-r--r--spec/ruby/core/string/partition_spec.rb38
-rw-r--r--spec/ruby/core/string/percent_spec.rb13
-rw-r--r--spec/ruby/core/string/plus_spec.rb49
-rw-r--r--spec/ruby/core/string/prepend_spec.rb64
-rw-r--r--spec/ruby/core/string/replace_spec.rb7
-rw-r--r--spec/ruby/core/string/reverse_spec.rb50
-rw-r--r--spec/ruby/core/string/rindex_spec.rb366
-rw-r--r--spec/ruby/core/string/rjust_spec.rb118
-rw-r--r--spec/ruby/core/string/rpartition_spec.rb33
-rw-r--r--spec/ruby/core/string/rstrip_spec.rb54
-rw-r--r--spec/ruby/core/string/scan_spec.rb201
-rw-r--r--spec/ruby/core/string/scrub_spec.rb101
-rw-r--r--spec/ruby/core/string/setbyte_spec.rb105
-rw-r--r--spec/ruby/core/string/shared/chars.rb80
-rw-r--r--spec/ruby/core/string/shared/codepoints.rb62
-rw-r--r--spec/ruby/core/string/shared/concat.rb162
-rw-r--r--spec/ruby/core/string/shared/each_char_without_block.rb26
-rw-r--r--spec/ruby/core/string/shared/each_codepoint_without_block.rb33
-rw-r--r--spec/ruby/core/string/shared/each_line.rb178
-rw-r--r--spec/ruby/core/string/shared/each_line_without_block.rb17
-rw-r--r--spec/ruby/core/string/shared/encode.rb247
-rw-r--r--spec/ruby/core/string/shared/eql.rb34
-rw-r--r--spec/ruby/core/string/shared/equal_value.rb29
-rw-r--r--spec/ruby/core/string/shared/grapheme_clusters.rb16
-rw-r--r--spec/ruby/core/string/shared/length.rb26
-rw-r--r--spec/ruby/core/string/shared/replace.rb77
-rw-r--r--spec/ruby/core/string/shared/slice.rb569
-rw-r--r--spec/ruby/core/string/shared/succ.rb90
-rw-r--r--spec/ruby/core/string/shared/to_a.rb9
-rw-r--r--spec/ruby/core/string/shared/to_s.rb20
-rw-r--r--spec/ruby/core/string/shared/to_sym.rb63
-rw-r--r--spec/ruby/core/string/size_spec.rb7
-rw-r--r--spec/ruby/core/string/slice_spec.rb476
-rw-r--r--spec/ruby/core/string/split_spec.rb433
-rw-r--r--spec/ruby/core/string/squeeze_spec.rb115
-rw-r--r--spec/ruby/core/string/start_with_spec.rb76
-rw-r--r--spec/ruby/core/string/string_spec.rb7
-rw-r--r--spec/ruby/core/string/strip_spec.rb62
-rw-r--r--spec/ruby/core/string/sub_spec.rb583
-rw-r--r--spec/ruby/core/string/succ_spec.rb11
-rw-r--r--spec/ruby/core/string/sum_spec.rb22
-rw-r--r--spec/ruby/core/string/swapcase_spec.rb173
-rw-r--r--spec/ruby/core/string/to_c_spec.rb99
-rw-r--r--spec/ruby/core/string/to_f_spec.rb70
-rw-r--r--spec/ruby/core/string/to_i_spec.rb337
-rw-r--r--spec/ruby/core/string/to_r_spec.rb58
-rw-r--r--spec/ruby/core/string/to_s_spec.rb7
-rw-r--r--spec/ruby/core/string/to_str_spec.rb7
-rw-r--r--spec/ruby/core/string/to_sym_spec.rb7
-rw-r--r--spec/ruby/core/string/tr_s_spec.rb136
-rw-r--r--spec/ruby/core/string/tr_spec.rb131
-rw-r--r--spec/ruby/core/string/try_convert_spec.rb50
-rw-r--r--spec/ruby/core/string/uminus_spec.rb74
-rw-r--r--spec/ruby/core/string/undump_spec.rb453
-rw-r--r--spec/ruby/core/string/unicode_normalize_spec.rb115
-rw-r--r--spec/ruby/core/string/unicode_normalized_spec.rb74
-rw-r--r--spec/ruby/core/string/unpack/a_spec.rb66
-rw-r--r--spec/ruby/core/string/unpack/at_spec.rb29
-rw-r--r--spec/ruby/core/string/unpack/b_spec.rb193
-rw-r--r--spec/ruby/core/string/unpack/c_spec.rb63
-rw-r--r--spec/ruby/core/string/unpack/comment_spec.rb25
-rw-r--r--spec/ruby/core/string/unpack/d_spec.rb28
-rw-r--r--spec/ruby/core/string/unpack/e_spec.rb14
-rw-r--r--spec/ruby/core/string/unpack/f_spec.rb28
-rw-r--r--spec/ruby/core/string/unpack/g_spec.rb14
-rw-r--r--spec/ruby/core/string/unpack/h_spec.rb135
-rw-r--r--spec/ruby/core/string/unpack/i_spec.rb152
-rw-r--r--spec/ruby/core/string/unpack/j_spec.rb272
-rw-r--r--spec/ruby/core/string/unpack/l_spec.rb265
-rw-r--r--spec/ruby/core/string/unpack/m_spec.rb173
-rw-r--r--spec/ruby/core/string/unpack/n_spec.rb18
-rw-r--r--spec/ruby/core/string/unpack/p_spec.rb56
-rw-r--r--spec/ruby/core/string/unpack/percent_spec.rb7
-rw-r--r--spec/ruby/core/string/unpack/q_spec.rb64
-rw-r--r--spec/ruby/core/string/unpack/s_spec.rb152
-rw-r--r--spec/ruby/core/string/unpack/shared/basic.rb29
-rw-r--r--spec/ruby/core/string/unpack/shared/float.rb271
-rw-r--r--spec/ruby/core/string/unpack/shared/integer.rb339
-rw-r--r--spec/ruby/core/string/unpack/shared/string.rb51
-rw-r--r--spec/ruby/core/string/unpack/shared/taint.rb83
-rw-r--r--spec/ruby/core/string/unpack/shared/unicode.rb60
-rw-r--r--spec/ruby/core/string/unpack/u_spec.rb97
-rw-r--r--spec/ruby/core/string/unpack/v_spec.rb18
-rw-r--r--spec/ruby/core/string/unpack/w_spec.rb25
-rw-r--r--spec/ruby/core/string/unpack/x_spec.rb62
-rw-r--r--spec/ruby/core/string/unpack/z_spec.rb23
-rw-r--r--spec/ruby/core/string/unpack1_spec.rb10
-rw-r--r--spec/ruby/core/string/upcase_spec.rb168
-rw-r--r--spec/ruby/core/string/uplus_spec.rb22
-rw-r--r--spec/ruby/core/string/upto_spec.rb98
-rw-r--r--spec/ruby/core/string/valid_encoding_spec.rb127
-rw-r--r--spec/ruby/core/struct/clone_spec.rb7
-rw-r--r--spec/ruby/core/struct/dig_spec.rb42
-rw-r--r--spec/ruby/core/struct/dup_spec.rb23
-rw-r--r--spec/ruby/core/struct/each_pair_spec.rb33
-rw-r--r--spec/ruby/core/struct/each_spec.rb27
-rw-r--r--spec/ruby/core/struct/element_reference_spec.rb52
-rw-r--r--spec/ruby/core/struct/element_set_spec.rb29
-rw-r--r--spec/ruby/core/struct/eql_spec.rb13
-rw-r--r--spec/ruby/core/struct/equal_value_spec.rb7
-rw-r--r--spec/ruby/core/struct/filter_spec.rb12
-rw-r--r--spec/ruby/core/struct/fixtures/classes.rb26
-rw-r--r--spec/ruby/core/struct/hash_spec.rb46
-rw-r--r--spec/ruby/core/struct/initialize_spec.rb43
-rw-r--r--spec/ruby/core/struct/inspect_spec.rb12
-rw-r--r--spec/ruby/core/struct/instance_variable_get_spec.rb16
-rw-r--r--spec/ruby/core/struct/instance_variables_spec.rb16
-rw-r--r--spec/ruby/core/struct/length_spec.rb12
-rw-r--r--spec/ruby/core/struct/members_spec.rb13
-rw-r--r--spec/ruby/core/struct/new_spec.rb217
-rw-r--r--spec/ruby/core/struct/select_spec.rb10
-rw-r--r--spec/ruby/core/struct/shared/accessor.rb7
-rw-r--r--spec/ruby/core/struct/shared/dup.rb9
-rw-r--r--spec/ruby/core/struct/shared/equal_value.rb37
-rw-r--r--spec/ruby/core/struct/shared/inspect.rb5
-rw-r--r--spec/ruby/core/struct/shared/select.rb26
-rw-r--r--spec/ruby/core/struct/size_spec.rb11
-rw-r--r--spec/ruby/core/struct/struct_spec.rb43
-rw-r--r--spec/ruby/core/struct/to_a_spec.rb12
-rw-r--r--spec/ruby/core/struct/to_h_spec.rb58
-rw-r--r--spec/ruby/core/struct/to_s_spec.rb12
-rw-r--r--spec/ruby/core/struct/values_at_spec.rb16
-rw-r--r--spec/ruby/core/struct/values_spec.rb11
-rw-r--r--spec/ruby/core/symbol/all_symbols_spec.rb14
-rw-r--r--spec/ruby/core/symbol/capitalize_spec.rb41
-rw-r--r--spec/ruby/core/symbol/case_compare_spec.rb11
-rw-r--r--spec/ruby/core/symbol/casecmp_spec.rb144
-rw-r--r--spec/ruby/core/symbol/comparison_spec.rb51
-rw-r--r--spec/ruby/core/symbol/downcase_spec.rb25
-rw-r--r--spec/ruby/core/symbol/dup_spec.rb7
-rw-r--r--spec/ruby/core/symbol/element_reference_spec.rb6
-rw-r--r--spec/ruby/core/symbol/empty_spec.rb11
-rw-r--r--spec/ruby/core/symbol/encoding_spec.rb23
-rw-r--r--spec/ruby/core/symbol/equal_value_spec.rb14
-rw-r--r--spec/ruby/core/symbol/fixtures/classes.rb3
-rw-r--r--spec/ruby/core/symbol/id2name_spec.rb6
-rw-r--r--spec/ruby/core/symbol/inspect_spec.rb105
-rw-r--r--spec/ruby/core/symbol/intern_spec.rb11
-rw-r--r--spec/ruby/core/symbol/length_spec.rb6
-rw-r--r--spec/ruby/core/symbol/match_spec.rb60
-rw-r--r--spec/ruby/core/symbol/next_spec.rb6
-rw-r--r--spec/ruby/core/symbol/shared/id2name.rb9
-rw-r--r--spec/ruby/core/symbol/shared/length.rb23
-rw-r--r--spec/ruby/core/symbol/shared/slice.rb282
-rw-r--r--spec/ruby/core/symbol/shared/succ.rb18
-rw-r--r--spec/ruby/core/symbol/size_spec.rb6
-rw-r--r--spec/ruby/core/symbol/slice_spec.rb6
-rw-r--r--spec/ruby/core/symbol/succ_spec.rb6
-rw-r--r--spec/ruby/core/symbol/swapcase_spec.rb29
-rw-r--r--spec/ruby/core/symbol/symbol_spec.rb19
-rw-r--r--spec/ruby/core/symbol/to_proc_spec.rb41
-rw-r--r--spec/ruby/core/symbol/to_s_spec.rb6
-rw-r--r--spec/ruby/core/symbol/to_sym_spec.rb9
-rw-r--r--spec/ruby/core/symbol/upcase_spec.rb21
-rw-r--r--spec/ruby/core/systemexit/initialize_spec.rb26
-rw-r--r--spec/ruby/core/systemexit/success_spec.rb13
-rw-r--r--spec/ruby/core/thread/abort_on_exception_spec.rb106
-rw-r--r--spec/ruby/core/thread/add_trace_func_spec.rb5
-rw-r--r--spec/ruby/core/thread/alive_spec.rb58
-rw-r--r--spec/ruby/core/thread/allocate_spec.rb9
-rw-r--r--spec/ruby/core/thread/backtrace/location/absolute_path_spec.rb61
-rw-r--r--spec/ruby/core/thread/backtrace/location/base_label_spec.rb22
-rw-r--r--spec/ruby/core/thread/backtrace/location/fixtures/absolute_path.rb4
-rw-r--r--spec/ruby/core/thread/backtrace/location/fixtures/absolute_path_method_added.rb10
-rw-r--r--spec/ruby/core/thread/backtrace/location/fixtures/classes.rb35
-rw-r--r--spec/ruby/core/thread/backtrace/location/fixtures/locations_in_main.rb5
-rw-r--r--spec/ruby/core/thread/backtrace/location/fixtures/locations_in_required.rb3
-rw-r--r--spec/ruby/core/thread/backtrace/location/fixtures/main.rb5
-rw-r--r--spec/ruby/core/thread/backtrace/location/inspect_spec.rb13
-rw-r--r--spec/ruby/core/thread/backtrace/location/label_spec.rb37
-rw-r--r--spec/ruby/core/thread/backtrace/location/lineno_spec.rb13
-rw-r--r--spec/ruby/core/thread/backtrace/location/path_spec.rb89
-rw-r--r--spec/ruby/core/thread/backtrace/location/to_s_spec.rb13
-rw-r--r--spec/ruby/core/thread/backtrace_locations_spec.rb33
-rw-r--r--spec/ruby/core/thread/backtrace_spec.rb35
-rw-r--r--spec/ruby/core/thread/current_spec.rb31
-rw-r--r--spec/ruby/core/thread/element_reference_spec.rb44
-rw-r--r--spec/ruby/core/thread/element_set_spec.rb51
-rw-r--r--spec/ruby/core/thread/exclusive_spec.rb47
-rw-r--r--spec/ruby/core/thread/exit_spec.rb15
-rw-r--r--spec/ruby/core/thread/fetch_spec.rb38
-rw-r--r--spec/ruby/core/thread/fixtures/classes.rb297
-rw-r--r--spec/ruby/core/thread/fork_spec.rb9
-rw-r--r--spec/ruby/core/thread/group_spec.rb5
-rw-r--r--spec/ruby/core/thread/initialize_spec.rb27
-rw-r--r--spec/ruby/core/thread/inspect_spec.rb6
-rw-r--r--spec/ruby/core/thread/join_spec.rb65
-rw-r--r--spec/ruby/core/thread/key_spec.rb53
-rw-r--r--spec/ruby/core/thread/keys_spec.rb44
-rw-r--r--spec/ruby/core/thread/kill_spec.rb25
-rw-r--r--spec/ruby/core/thread/list_spec.rb55
-rw-r--r--spec/ruby/core/thread/main_spec.rb10
-rw-r--r--spec/ruby/core/thread/name_spec.rb54
-rw-r--r--spec/ruby/core/thread/new_spec.rb83
-rw-r--r--spec/ruby/core/thread/pass_spec.rb8
-rw-r--r--spec/ruby/core/thread/priority_spec.rb72
-rw-r--r--spec/ruby/core/thread/raise_spec.rb208
-rw-r--r--spec/ruby/core/thread/report_on_exception_spec.rb116
-rw-r--r--spec/ruby/core/thread/run_spec.rb8
-rw-r--r--spec/ruby/core/thread/set_trace_func_spec.rb5
-rw-r--r--spec/ruby/core/thread/shared/exit.rb180
-rw-r--r--spec/ruby/core/thread/shared/start.rb41
-rw-r--r--spec/ruby/core/thread/shared/to_s.rb53
-rw-r--r--spec/ruby/core/thread/shared/wakeup.rb61
-rw-r--r--spec/ruby/core/thread/start_spec.rb9
-rw-r--r--spec/ruby/core/thread/status_spec.rb60
-rw-r--r--spec/ruby/core/thread/stop_spec.rb54
-rw-r--r--spec/ruby/core/thread/terminate_spec.rb7
-rw-r--r--spec/ruby/core/thread/thread_variable_get_spec.rb25
-rw-r--r--spec/ruby/core/thread/thread_variable_set_spec.rb26
-rw-r--r--spec/ruby/core/thread/thread_variable_spec.rb21
-rw-r--r--spec/ruby/core/thread/thread_variables_spec.rb29
-rw-r--r--spec/ruby/core/thread/to_s_spec.rb8
-rw-r--r--spec/ruby/core/thread/value_spec.rb31
-rw-r--r--spec/ruby/core/thread/wakeup_spec.rb7
-rw-r--r--spec/ruby/core/threadgroup/add_spec.rb39
-rw-r--r--spec/ruby/core/threadgroup/default_spec.rb11
-rw-r--r--spec/ruby/core/threadgroup/enclose_spec.rb24
-rw-r--r--spec/ruby/core/threadgroup/enclosed_spec.rb14
-rw-r--r--spec/ruby/core/threadgroup/list_spec.rb23
-rw-r--r--spec/ruby/core/time/_dump_spec.rb55
-rw-r--r--spec/ruby/core/time/_load_spec.rb52
-rw-r--r--spec/ruby/core/time/asctime_spec.rb6
-rw-r--r--spec/ruby/core/time/at_spec.rb254
-rw-r--r--spec/ruby/core/time/ceil_spec.rb45
-rw-r--r--spec/ruby/core/time/comparison_spec.rb104
-rw-r--r--spec/ruby/core/time/ctime_spec.rb6
-rw-r--r--spec/ruby/core/time/day_spec.rb6
-rw-r--r--spec/ruby/core/time/dst_spec.rb6
-rw-r--r--spec/ruby/core/time/dup_spec.rb46
-rw-r--r--spec/ruby/core/time/eql_spec.rb29
-rw-r--r--spec/ruby/core/time/fixtures/classes.rb106
-rw-r--r--spec/ruby/core/time/floor_spec.rb37
-rw-r--r--spec/ruby/core/time/friday_spec.rb11
-rw-r--r--spec/ruby/core/time/getgm_spec.rb6
-rw-r--r--spec/ruby/core/time/getlocal_spec.rb169
-rw-r--r--spec/ruby/core/time/getutc_spec.rb6
-rw-r--r--spec/ruby/core/time/gm_spec.rb10
-rw-r--r--spec/ruby/core/time/gmt_offset_spec.rb6
-rw-r--r--spec/ruby/core/time/gmt_spec.rb8
-rw-r--r--spec/ruby/core/time/gmtime_spec.rb6
-rw-r--r--spec/ruby/core/time/gmtoff_spec.rb6
-rw-r--r--spec/ruby/core/time/hash_spec.rb11
-rw-r--r--spec/ruby/core/time/hour_spec.rb17
-rw-r--r--spec/ruby/core/time/inspect_spec.rb6
-rw-r--r--spec/ruby/core/time/isdst_spec.rb6
-rw-r--r--spec/ruby/core/time/local_spec.rb11
-rw-r--r--spec/ruby/core/time/localtime_spec.rb140
-rw-r--r--spec/ruby/core/time/mday_spec.rb6
-rw-r--r--spec/ruby/core/time/min_spec.rb17
-rw-r--r--spec/ruby/core/time/minus_spec.rb123
-rw-r--r--spec/ruby/core/time/mktime_spec.rb11
-rw-r--r--spec/ruby/core/time/mon_spec.rb6
-rw-r--r--spec/ruby/core/time/monday_spec.rb11
-rw-r--r--spec/ruby/core/time/month_spec.rb6
-rw-r--r--spec/ruby/core/time/new_spec.rb337
-rw-r--r--spec/ruby/core/time/now_spec.rb6
-rw-r--r--spec/ruby/core/time/nsec_spec.rb31
-rw-r--r--spec/ruby/core/time/plus_spec.rb120
-rw-r--r--spec/ruby/core/time/round_spec.rb35
-rw-r--r--spec/ruby/core/time/saturday_spec.rb11
-rw-r--r--spec/ruby/core/time/sec_spec.rb7
-rw-r--r--spec/ruby/core/time/shared/asctime.rb6
-rw-r--r--spec/ruby/core/time/shared/day.rb15
-rw-r--r--spec/ruby/core/time/shared/getgm.rb9
-rw-r--r--spec/ruby/core/time/shared/gm.rb70
-rw-r--r--spec/ruby/core/time/shared/gmt_offset.rb59
-rw-r--r--spec/ruby/core/time/shared/gmtime.rb33
-rw-r--r--spec/ruby/core/time/shared/inspect.rb21
-rw-r--r--spec/ruby/core/time/shared/isdst.rb8
-rw-r--r--spec/ruby/core/time/shared/local.rb45
-rw-r--r--spec/ruby/core/time/shared/month.rb15
-rw-r--r--spec/ruby/core/time/shared/now.rb35
-rw-r--r--spec/ruby/core/time/shared/time_params.rb262
-rw-r--r--spec/ruby/core/time/shared/to_i.rb9
-rw-r--r--spec/ruby/core/time/strftime_spec.rb52
-rw-r--r--spec/ruby/core/time/subsec_spec.rb27
-rw-r--r--spec/ruby/core/time/succ_spec.rb39
-rw-r--r--spec/ruby/core/time/sunday_spec.rb11
-rw-r--r--spec/ruby/core/time/thursday_spec.rb11
-rw-r--r--spec/ruby/core/time/time_spec.rb7
-rw-r--r--spec/ruby/core/time/to_a_spec.rb12
-rw-r--r--spec/ruby/core/time/to_f_spec.rb7
-rw-r--r--spec/ruby/core/time/to_i_spec.rb6
-rw-r--r--spec/ruby/core/time/to_r_spec.rb11
-rw-r--r--spec/ruby/core/time/to_s_spec.rb6
-rw-r--r--spec/ruby/core/time/tuesday_spec.rb11
-rw-r--r--spec/ruby/core/time/tv_nsec_spec.rb5
-rw-r--r--spec/ruby/core/time/tv_sec_spec.rb6
-rw-r--r--spec/ruby/core/time/tv_usec_spec.rb5
-rw-r--r--spec/ruby/core/time/usec_spec.rb43
-rw-r--r--spec/ruby/core/time/utc_offset_spec.rb6
-rw-r--r--spec/ruby/core/time/utc_spec.rb21
-rw-r--r--spec/ruby/core/time/wday_spec.rb9
-rw-r--r--spec/ruby/core/time/wednesday_spec.rb11
-rw-r--r--spec/ruby/core/time/yday_spec.rb21
-rw-r--r--spec/ruby/core/time/year_spec.rb17
-rw-r--r--spec/ruby/core/time/zone_spec.rb90
-rw-r--r--spec/ruby/core/tracepoint/binding_spec.rb19
-rw-r--r--spec/ruby/core/tracepoint/callee_id_spec.rb17
-rw-r--r--spec/ruby/core/tracepoint/defined_class_spec.rb26
-rw-r--r--spec/ruby/core/tracepoint/disable_spec.rb73
-rw-r--r--spec/ruby/core/tracepoint/enable_spec.rb480
-rw-r--r--spec/ruby/core/tracepoint/enabled_spec.rb14
-rw-r--r--spec/ruby/core/tracepoint/eval_script_spec.rb24
-rw-r--r--spec/ruby/core/tracepoint/event_spec.rb21
-rw-r--r--spec/ruby/core/tracepoint/fixtures/classes.rb34
-rw-r--r--spec/ruby/core/tracepoint/inspect_spec.rb28
-rw-r--r--spec/ruby/core/tracepoint/lineno_spec.rb10
-rw-r--r--spec/ruby/core/tracepoint/method_id_spec.rb13
-rw-r--r--spec/ruby/core/tracepoint/new_spec.rb67
-rw-r--r--spec/ruby/core/tracepoint/parameters_spec.rb23
-rw-r--r--spec/ruby/core/tracepoint/path_spec.rb18
-rw-r--r--spec/ruby/core/tracepoint/raised_exception_spec.rb16
-rw-r--r--spec/ruby/core/tracepoint/return_value_spec.rb13
-rw-r--r--spec/ruby/core/tracepoint/self_spec.rb20
-rw-r--r--spec/ruby/core/tracepoint/trace_spec.rb9
-rw-r--r--spec/ruby/core/true/and_spec.rb11
-rw-r--r--spec/ruby/core/true/dup_spec.rb7
-rw-r--r--spec/ruby/core/true/inspect_spec.rb7
-rw-r--r--spec/ruby/core/true/or_spec.rb11
-rw-r--r--spec/ruby/core/true/to_s_spec.rb17
-rw-r--r--spec/ruby/core/true/trueclass_spec.rb15
-rw-r--r--spec/ruby/core/true/xor_spec.rb11
-rw-r--r--spec/ruby/core/unboundmethod/arity_spec.rb207
-rw-r--r--spec/ruby/core/unboundmethod/bind_call_spec.rb52
-rw-r--r--spec/ruby/core/unboundmethod/bind_spec.rb61
-rw-r--r--spec/ruby/core/unboundmethod/clone_spec.rb12
-rw-r--r--spec/ruby/core/unboundmethod/eql_spec.rb5
-rw-r--r--spec/ruby/core/unboundmethod/equal_value_spec.rb101
-rw-r--r--spec/ruby/core/unboundmethod/fixtures/classes.rb87
-rw-r--r--spec/ruby/core/unboundmethod/hash_spec.rb15
-rw-r--r--spec/ruby/core/unboundmethod/inspect_spec.rb7
-rw-r--r--spec/ruby/core/unboundmethod/name_spec.rb15
-rw-r--r--spec/ruby/core/unboundmethod/original_name_spec.rb22
-rw-r--r--spec/ruby/core/unboundmethod/owner_spec.rb26
-rw-r--r--spec/ruby/core/unboundmethod/parameters_spec.rb5
-rw-r--r--spec/ruby/core/unboundmethod/shared/to_s.rb25
-rw-r--r--spec/ruby/core/unboundmethod/source_location_spec.rb52
-rw-r--r--spec/ruby/core/unboundmethod/super_method_spec.rb28
-rw-r--r--spec/ruby/core/unboundmethod/to_s_spec.rb7
-rw-r--r--spec/ruby/core/warning/warn_spec.rb66
-rw-r--r--spec/ruby/default.mspec49
-rw-r--r--spec/ruby/fixtures/basicobject/method_missing.rb55
-rw-r--r--spec/ruby/fixtures/class.rb138
-rw-r--r--spec/ruby/fixtures/class_variables.rb58
-rw-r--r--spec/ruby/fixtures/code/a/load_fixture.bundle1
-rw-r--r--spec/ruby/fixtures/code/a/load_fixture.dll1
-rw-r--r--spec/ruby/fixtures/code/a/load_fixture.so1
-rw-r--r--spec/ruby/fixtures/code/b/load_fixture.rb1
-rw-r--r--spec/ruby/fixtures/code/concurrent.rb12
-rw-r--r--spec/ruby/fixtures/code/concurrent2.rb8
-rw-r--r--spec/ruby/fixtures/code/concurrent3.rb2
-rw-r--r--spec/ruby/fixtures/code/file_fixture.rb1
-rw-r--r--spec/ruby/fixtures/code/gem/load_fixture.rb1
-rw-r--r--spec/ruby/fixtures/code/line_fixture.rb5
-rw-r--r--spec/ruby/fixtures/code/load_ext_fixture.rb1
-rw-r--r--spec/ruby/fixtures/code/load_fixture1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.bundle1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.dll1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.ext1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.ext.bundle1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.ext.dll1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.ext.rb1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.ext.so1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.rb1
-rw-r--r--spec/ruby/fixtures/code/load_fixture.so1
-rw-r--r--spec/ruby/fixtures/code/load_fixture_and__FILE__.rb1
-rw-r--r--spec/ruby/fixtures/code/load_wrap_method_fixture.rb9
-rw-r--r--spec/ruby/fixtures/code/methods_fixture.rb364
-rw-r--r--spec/ruby/fixtures/code/raise_fixture.rb1
-rw-r--r--spec/ruby/fixtures/code/recursive_load_fixture.rb5
-rw-r--r--spec/ruby/fixtures/code/recursive_require_fixture.rb3
-rw-r--r--spec/ruby/fixtures/code/symlink/symlink1.rb1
-rw-r--r--spec/ruby/fixtures/code/symlink/symlink2/symlink2.rb1
-rw-r--r--spec/ruby/fixtures/code/wrap_fixture.rb9
-rw-r--r--spec/ruby/fixtures/code_loading.rb26
-rw-r--r--spec/ruby/fixtures/constants.rb288
-rw-r--r--spec/ruby/fixtures/enumerator/classes.rb15
-rw-r--r--spec/ruby/fixtures/math/common.rb3
-rw-r--r--spec/ruby/fixtures/rational.rb14
-rw-r--r--spec/ruby/fixtures/reflection.rb352
-rw-r--r--spec/ruby/language/BEGIN_spec.rb36
-rw-r--r--spec/ruby/language/README30
-rw-r--r--spec/ruby/language/alias_spec.rb258
-rw-r--r--spec/ruby/language/and_spec.rb80
-rw-r--r--spec/ruby/language/array_spec.rb162
-rw-r--r--spec/ruby/language/block_spec.rb933
-rw-r--r--spec/ruby/language/break_spec.rb365
-rw-r--r--spec/ruby/language/case_spec.rb427
-rw-r--r--spec/ruby/language/class_spec.rb332
-rw-r--r--spec/ruby/language/class_variable_spec.rb84
-rw-r--r--spec/ruby/language/constants_spec.rb745
-rw-r--r--spec/ruby/language/def_spec.rb776
-rw-r--r--spec/ruby/language/defined_spec.rb1130
-rw-r--r--spec/ruby/language/encoding_spec.rb36
-rw-r--r--spec/ruby/language/ensure_spec.rb333
-rw-r--r--spec/ruby/language/execution_spec.rb15
-rw-r--r--spec/ruby/language/file_spec.rb29
-rw-r--r--spec/ruby/language/fixtures/argv_encoding.rb1
-rw-r--r--spec/ruby/language/fixtures/array.rb32
-rw-r--r--spec/ruby/language/fixtures/begin_file.rb3
-rw-r--r--spec/ruby/language/fixtures/binary_symbol.rb4
-rw-r--r--spec/ruby/language/fixtures/block.rb61
-rw-r--r--spec/ruby/language/fixtures/break.rb291
-rw-r--r--spec/ruby/language/fixtures/break_lambda_toplevel.rb9
-rw-r--r--spec/ruby/language/fixtures/break_lambda_toplevel_block.rb23
-rw-r--r--spec/ruby/language/fixtures/break_lambda_toplevel_method.rb17
-rw-r--r--spec/ruby/language/fixtures/bytes_magic_comment.rb2
-rw-r--r--spec/ruby/language/fixtures/case_magic_comment.rb2
-rw-r--r--spec/ruby/language/fixtures/classes.rb31
-rw-r--r--spec/ruby/language/fixtures/coding_us_ascii.rb11
-rw-r--r--spec/ruby/language/fixtures/coding_utf_8.rb11
-rw-r--r--spec/ruby/language/fixtures/constant_visibility.rb98
-rw-r--r--spec/ruby/language/fixtures/constants_sclass.rb54
-rw-r--r--spec/ruby/language/fixtures/def.rb14
-rw-r--r--spec/ruby/language/fixtures/defined.rb303
-rw-r--r--spec/ruby/language/fixtures/dollar_zero.rb6
-rw-r--r--spec/ruby/language/fixtures/emacs_magic_comment.rb2
-rw-r--r--spec/ruby/language/fixtures/ensure.rb121
-rw-r--r--spec/ruby/language/fixtures/file.rb1
-rw-r--r--spec/ruby/language/fixtures/for_scope.rb15
-rw-r--r--spec/ruby/language/fixtures/freeze_magic_comment_across_files.rb5
-rw-r--r--spec/ruby/language/fixtures/freeze_magic_comment_across_files_diff_enc.rb5
-rw-r--r--spec/ruby/language/fixtures/freeze_magic_comment_across_files_no_comment.rb5
-rw-r--r--spec/ruby/language/fixtures/freeze_magic_comment_one_literal.rb4
-rw-r--r--spec/ruby/language/fixtures/freeze_magic_comment_required.rb3
-rw-r--r--spec/ruby/language/fixtures/freeze_magic_comment_required_diff_enc.rbbin181 -> 0 bytes-rw-r--r--spec/ruby/language/fixtures/freeze_magic_comment_required_no_comment.rb1
-rw-r--r--spec/ruby/language/fixtures/freeze_magic_comment_two_literals.rb3
-rw-r--r--spec/ruby/language/fixtures/hash_strings_binary.rb7
-rw-r--r--spec/ruby/language/fixtures/hash_strings_usascii.rb7
-rw-r--r--spec/ruby/language/fixtures/hash_strings_utf8.rb7
-rw-r--r--spec/ruby/language/fixtures/magic_comment.rb2
-rw-r--r--spec/ruby/language/fixtures/match_operators.rb9
-rw-r--r--spec/ruby/language/fixtures/metaclass.rb33
-rw-r--r--spec/ruby/language/fixtures/module.rb24
-rw-r--r--spec/ruby/language/fixtures/next.rb134
-rw-r--r--spec/ruby/language/fixtures/no_magic_comment.rb1
-rw-r--r--spec/ruby/language/fixtures/precedence.rb16
-rw-r--r--spec/ruby/language/fixtures/print_magic_comment_result_at_exit.rb3
-rw-r--r--spec/ruby/language/fixtures/private.rb59
-rw-r--r--spec/ruby/language/fixtures/rescue.rb67
-rw-r--r--spec/ruby/language/fixtures/return.rb139
-rw-r--r--spec/ruby/language/fixtures/second_line_magic_comment.rb3
-rw-r--r--spec/ruby/language/fixtures/second_token_magic_comment.rb2
-rw-r--r--spec/ruby/language/fixtures/send.rb141
-rwxr-xr-xspec/ruby/language/fixtures/shebang_magic_comment.rb3
-rw-r--r--spec/ruby/language/fixtures/squiggly_heredoc.rb39
-rw-r--r--spec/ruby/language/fixtures/super.rb696
-rw-r--r--spec/ruby/language/fixtures/utf16-be-nobom.rbbin68 -> 0 bytes-rw-r--r--spec/ruby/language/fixtures/utf16-le-nobom.rbbin69 -> 0 bytes-rw-r--r--spec/ruby/language/fixtures/utf8-bom.rb2
-rw-r--r--spec/ruby/language/fixtures/utf8-nobom.rb2
-rw-r--r--spec/ruby/language/fixtures/variables.rb85
-rw-r--r--spec/ruby/language/fixtures/vim_magic_comment.rb2
-rw-r--r--spec/ruby/language/fixtures/yield.rb41
-rw-r--r--spec/ruby/language/for_spec.rb182
-rw-r--r--spec/ruby/language/hash_spec.rb163
-rw-r--r--spec/ruby/language/heredoc_spec.rb91
-rw-r--r--spec/ruby/language/if_spec.rb371
-rw-r--r--spec/ruby/language/lambda_spec.rb623
-rw-r--r--spec/ruby/language/line_spec.rb45
-rw-r--r--spec/ruby/language/loop_spec.rb67
-rw-r--r--spec/ruby/language/magic_comment_spec.rb92
-rw-r--r--spec/ruby/language/match_spec.rb81
-rw-r--r--spec/ruby/language/metaclass_spec.rb143
-rw-r--r--spec/ruby/language/method_spec.rb1487
-rw-r--r--spec/ruby/language/module_spec.rb91
-rw-r--r--spec/ruby/language/next_spec.rb410
-rw-r--r--spec/ruby/language/not_spec.rb51
-rw-r--r--spec/ruby/language/numbers_spec.rb97
-rw-r--r--spec/ruby/language/optional_assignments_spec.rb353
-rw-r--r--spec/ruby/language/or_spec.rb90
-rw-r--r--spec/ruby/language/order_spec.rb75
-rw-r--r--spec/ruby/language/precedence_spec.rb447
-rw-r--r--spec/ruby/language/predefined/data_spec.rb48
-rw-r--r--spec/ruby/language/predefined/fixtures/data1.rb4
-rw-r--r--spec/ruby/language/predefined/fixtures/data2.rb3
-rw-r--r--spec/ruby/language/predefined/fixtures/data3.rb6
-rw-r--r--spec/ruby/language/predefined/fixtures/data4.rb4
-rw-r--r--spec/ruby/language/predefined/fixtures/data5.rb5
-rw-r--r--spec/ruby/language/predefined/fixtures/data_offset.rb12
-rw-r--r--spec/ruby/language/predefined/fixtures/data_only.rb2
-rw-r--r--spec/ruby/language/predefined/fixtures/empty_data.rb3
-rw-r--r--spec/ruby/language/predefined/fixtures/print_data.rb3
-rw-r--r--spec/ruby/language/predefined/fixtures/toplevel_binding_dynamic.rb4
-rw-r--r--spec/ruby/language/predefined/fixtures/toplevel_binding_dynamic_required.rb2
-rw-r--r--spec/ruby/language/predefined/fixtures/toplevel_binding_id.rb4
-rw-r--r--spec/ruby/language/predefined/fixtures/toplevel_binding_id_required.rb1
-rw-r--r--spec/ruby/language/predefined/fixtures/toplevel_binding_required_before.rb2
-rw-r--r--spec/ruby/language/predefined/fixtures/toplevel_binding_values.rb9
-rw-r--r--spec/ruby/language/predefined/fixtures/toplevel_binding_variables.rb4
-rw-r--r--spec/ruby/language/predefined/fixtures/toplevel_binding_variables_required.rb2
-rw-r--r--spec/ruby/language/predefined/toplevel_binding_spec.rb34
-rw-r--r--spec/ruby/language/predefined_spec.rb1242
-rw-r--r--spec/ruby/language/private_spec.rb67
-rw-r--r--spec/ruby/language/proc_spec.rb220
-rw-r--r--spec/ruby/language/range_spec.rb19
-rw-r--r--spec/ruby/language/redo_spec.rb66
-rw-r--r--spec/ruby/language/regexp/anchors_spec.rb179
-rw-r--r--spec/ruby/language/regexp/back-references_spec.rb53
-rw-r--r--spec/ruby/language/regexp/character_classes_spec.rb631
-rw-r--r--spec/ruby/language/regexp/encoding_spec.rb119
-rw-r--r--spec/ruby/language/regexp/escapes_spec.rb81
-rw-r--r--spec/ruby/language/regexp/grouping_spec.rb23
-rw-r--r--spec/ruby/language/regexp/interpolation_spec.rb58
-rw-r--r--spec/ruby/language/regexp/modifiers_spec.rb115
-rw-r--r--spec/ruby/language/regexp/repetition_spec.rb48
-rw-r--r--spec/ruby/language/regexp_spec.rb177
-rw-r--r--spec/ruby/language/rescue_spec.rb485
-rw-r--r--spec/ruby/language/retry_spec.rb52
-rw-r--r--spec/ruby/language/return_spec.rb511
-rw-r--r--spec/ruby/language/safe_navigator_spec.rb99
-rw-r--r--spec/ruby/language/safe_spec.rb138
-rw-r--r--spec/ruby/language/send_spec.rb562
-rw-r--r--spec/ruby/language/shared/__FILE__.rb23
-rw-r--r--spec/ruby/language/shared/__LINE__.rb15
-rw-r--r--spec/ruby/language/singleton_class_spec.rb293
-rw-r--r--spec/ruby/language/source_encoding_spec.rb61
-rw-r--r--spec/ruby/language/string_spec.rb289
-rw-r--r--spec/ruby/language/super_spec.rb388
-rw-r--r--spec/ruby/language/symbol_spec.rb106
-rw-r--r--spec/ruby/language/throw_spec.rb81
-rw-r--r--spec/ruby/language/undef_spec.rb72
-rw-r--r--spec/ruby/language/unless_spec.rb43
-rw-r--r--spec/ruby/language/until_spec.rb234
-rw-r--r--spec/ruby/language/variables_spec.rb788
-rw-r--r--spec/ruby/language/while_spec.rb344
-rw-r--r--spec/ruby/language/yield_spec.rb187
-rw-r--r--spec/ruby/library/English/English_spec.rb171
-rw-r--r--spec/ruby/library/abbrev/abbrev_spec.rb31
-rw-r--r--spec/ruby/library/base64/decode64_spec.rb25
-rw-r--r--spec/ruby/library/base64/encode64_spec.rb23
-rw-r--r--spec/ruby/library/base64/strict_decode64_spec.rb41
-rw-r--r--spec/ruby/library/base64/strict_encode64_spec.rb19
-rw-r--r--spec/ruby/library/base64/urlsafe_decode64_spec.rb19
-rw-r--r--spec/ruby/library/base64/urlsafe_encode64_spec.rb20
-rw-r--r--spec/ruby/library/bigdecimal/BigDecimal_spec.rb257
-rw-r--r--spec/ruby/library/bigdecimal/abs_spec.rb50
-rw-r--r--spec/ruby/library/bigdecimal/add_spec.rb193
-rw-r--r--spec/ruby/library/bigdecimal/case_compare_spec.rb7
-rw-r--r--spec/ruby/library/bigdecimal/ceil_spec.rb104
-rw-r--r--spec/ruby/library/bigdecimal/clone_spec.rb6
-rw-r--r--spec/ruby/library/bigdecimal/coerce_spec.rb26
-rw-r--r--spec/ruby/library/bigdecimal/comparison_spec.rb81
-rw-r--r--spec/ruby/library/bigdecimal/constants_spec.rb72
-rw-r--r--spec/ruby/library/bigdecimal/div_spec.rb110
-rw-r--r--spec/ruby/library/bigdecimal/divide_spec.rb17
-rw-r--r--spec/ruby/library/bigdecimal/divmod_spec.rb180
-rw-r--r--spec/ruby/library/bigdecimal/double_fig_spec.rb9
-rw-r--r--spec/ruby/library/bigdecimal/dup_spec.rb6
-rw-r--r--spec/ruby/library/bigdecimal/eql_spec.rb6
-rw-r--r--spec/ruby/library/bigdecimal/equal_value_spec.rb7
-rw-r--r--spec/ruby/library/bigdecimal/exponent_spec.rb38
-rw-r--r--spec/ruby/library/bigdecimal/finite_spec.rb34
-rw-r--r--spec/ruby/library/bigdecimal/fix_spec.rb57
-rw-r--r--spec/ruby/library/bigdecimal/fixtures/classes.rb17
-rw-r--r--spec/ruby/library/bigdecimal/floor_spec.rb100
-rw-r--r--spec/ruby/library/bigdecimal/frac_spec.rb48
-rw-r--r--spec/ruby/library/bigdecimal/gt_spec.rb96
-rw-r--r--spec/ruby/library/bigdecimal/gte_spec.rb100
-rw-r--r--spec/ruby/library/bigdecimal/hash_spec.rb30
-rw-r--r--spec/ruby/library/bigdecimal/infinite_spec.rb32
-rw-r--r--spec/ruby/library/bigdecimal/inspect_spec.rb30
-rw-r--r--spec/ruby/library/bigdecimal/limit_spec.rb55
-rw-r--r--spec/ruby/library/bigdecimal/lt_spec.rb94
-rw-r--r--spec/ruby/library/bigdecimal/lte_spec.rb100
-rw-r--r--spec/ruby/library/bigdecimal/minus_spec.rb66
-rw-r--r--spec/ruby/library/bigdecimal/mode_spec.rb36
-rw-r--r--spec/ruby/library/bigdecimal/modulo_spec.rb12
-rw-r--r--spec/ruby/library/bigdecimal/mult_spec.rb32
-rw-r--r--spec/ruby/library/bigdecimal/multiply_spec.rb41
-rw-r--r--spec/ruby/library/bigdecimal/nan_spec.rb23
-rw-r--r--spec/ruby/library/bigdecimal/nonzero_spec.rb29
-rw-r--r--spec/ruby/library/bigdecimal/plus_spec.rb54
-rw-r--r--spec/ruby/library/bigdecimal/power_spec.rb6
-rw-r--r--spec/ruby/library/bigdecimal/precs_spec.rb48
-rw-r--r--spec/ruby/library/bigdecimal/quo_spec.rb12
-rw-r--r--spec/ruby/library/bigdecimal/remainder_spec.rb92
-rw-r--r--spec/ruby/library/bigdecimal/round_spec.rb234
-rw-r--r--spec/ruby/library/bigdecimal/shared/clone.rb24
-rw-r--r--spec/ruby/library/bigdecimal/shared/eql.rb61
-rw-r--r--spec/ruby/library/bigdecimal/shared/modulo.rb125
-rw-r--r--spec/ruby/library/bigdecimal/shared/mult.rb97
-rw-r--r--spec/ruby/library/bigdecimal/shared/power.rb72
-rw-r--r--spec/ruby/library/bigdecimal/shared/quo.rb67
-rw-r--r--spec/ruby/library/bigdecimal/shared/to_int.rb16
-rw-r--r--spec/ruby/library/bigdecimal/sign_spec.rb46
-rw-r--r--spec/ruby/library/bigdecimal/split_spec.rb86
-rw-r--r--spec/ruby/library/bigdecimal/sqrt_spec.rb112
-rw-r--r--spec/ruby/library/bigdecimal/sub_spec.rb70
-rw-r--r--spec/ruby/library/bigdecimal/to_d_spec.rb10
-rw-r--r--spec/ruby/library/bigdecimal/to_f_spec.rb54
-rw-r--r--spec/ruby/library/bigdecimal/to_i_spec.rb7
-rw-r--r--spec/ruby/library/bigdecimal/to_int_spec.rb8
-rw-r--r--spec/ruby/library/bigdecimal/to_r_spec.rb16
-rw-r--r--spec/ruby/library/bigdecimal/to_s_spec.rb80
-rw-r--r--spec/ruby/library/bigdecimal/truncate_spec.rb81
-rw-r--r--spec/ruby/library/bigdecimal/uminus_spec.rb58
-rw-r--r--spec/ruby/library/bigdecimal/uplus_spec.rb17
-rw-r--r--spec/ruby/library/bigdecimal/util_spec.rb42
-rw-r--r--spec/ruby/library/bigdecimal/zero_spec.rb27
-rw-r--r--spec/ruby/library/bigmath/log_spec.rb10
-rw-r--r--spec/ruby/library/cgi/cookie/domain_spec.rb23
-rw-r--r--spec/ruby/library/cgi/cookie/expires_spec.rb23
-rw-r--r--spec/ruby/library/cgi/cookie/initialize_spec.rb147
-rw-r--r--spec/ruby/library/cgi/cookie/name_spec.rb23
-rw-r--r--spec/ruby/library/cgi/cookie/parse_spec.rb26
-rw-r--r--spec/ruby/library/cgi/cookie/path_spec.rb23
-rw-r--r--spec/ruby/library/cgi/cookie/secure_spec.rb70
-rw-r--r--spec/ruby/library/cgi/cookie/to_s_spec.rb42
-rw-r--r--spec/ruby/library/cgi/cookie/value_spec.rb76
-rw-r--r--spec/ruby/library/cgi/escapeElement_spec.rb20
-rw-r--r--spec/ruby/library/cgi/escapeHTML_spec.rb13
-rw-r--r--spec/ruby/library/cgi/escape_spec.rb26
-rw-r--r--spec/ruby/library/cgi/htmlextension/a_spec.rb49
-rw-r--r--spec/ruby/library/cgi/htmlextension/base_spec.rb33
-rw-r--r--spec/ruby/library/cgi/htmlextension/blockquote_spec.rb33
-rw-r--r--spec/ruby/library/cgi/htmlextension/br_spec.rb22
-rw-r--r--spec/ruby/library/cgi/htmlextension/caption_spec.rb33
-rw-r--r--spec/ruby/library/cgi/htmlextension/checkbox_group_spec.rb76
-rw-r--r--spec/ruby/library/cgi/htmlextension/checkbox_spec.rb77
-rw-r--r--spec/ruby/library/cgi/htmlextension/doctype_spec.rb27
-rw-r--r--spec/ruby/library/cgi/htmlextension/file_field_spec.rb72
-rw-r--r--spec/ruby/library/cgi/htmlextension/fixtures/common.rb15
-rw-r--r--spec/ruby/library/cgi/htmlextension/form_spec.rb58
-rw-r--r--spec/ruby/library/cgi/htmlextension/frame_spec.rb14
-rw-r--r--spec/ruby/library/cgi/htmlextension/frameset_spec.rb14
-rw-r--r--spec/ruby/library/cgi/htmlextension/hidden_spec.rb59
-rw-r--r--spec/ruby/library/cgi/htmlextension/html_spec.rb66
-rw-r--r--spec/ruby/library/cgi/htmlextension/image_button_spec.rb69
-rw-r--r--spec/ruby/library/cgi/htmlextension/img_spec.rb83
-rw-r--r--spec/ruby/library/cgi/htmlextension/multipart_form_spec.rb64
-rw-r--r--spec/ruby/library/cgi/htmlextension/password_field_spec.rb84
-rw-r--r--spec/ruby/library/cgi/htmlextension/popup_menu_spec.rb8
-rw-r--r--spec/ruby/library/cgi/htmlextension/radio_button_spec.rb77
-rw-r--r--spec/ruby/library/cgi/htmlextension/radio_group_spec.rb77
-rw-r--r--spec/ruby/library/cgi/htmlextension/reset_spec.rb57
-rw-r--r--spec/ruby/library/cgi/htmlextension/scrolling_list_spec.rb8
-rw-r--r--spec/ruby/library/cgi/htmlextension/shared/popup_menu.rb94
-rw-r--r--spec/ruby/library/cgi/htmlextension/submit_spec.rb57
-rw-r--r--spec/ruby/library/cgi/htmlextension/text_field_spec.rb84
-rw-r--r--spec/ruby/library/cgi/htmlextension/textarea_spec.rb73
-rw-r--r--spec/ruby/library/cgi/http_header_spec.rb8
-rw-r--r--spec/ruby/library/cgi/initialize_spec.rb133
-rw-r--r--spec/ruby/library/cgi/out_spec.rb51
-rw-r--r--spec/ruby/library/cgi/parse_spec.rb24
-rw-r--r--spec/ruby/library/cgi/pretty_spec.rb24
-rw-r--r--spec/ruby/library/cgi/print_spec.rb26
-rw-r--r--spec/ruby/library/cgi/queryextension/accept_charset_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/accept_encoding_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/accept_language_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/accept_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/auth_type_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/cache_control_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/content_length_spec.rb26
-rw-r--r--spec/ruby/library/cgi/queryextension/content_type_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/cookies_spec.rb10
-rw-r--r--spec/ruby/library/cgi/queryextension/element_reference_spec.rb27
-rw-r--r--spec/ruby/library/cgi/queryextension/from_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/gateway_interface_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/has_key_spec.rb7
-rw-r--r--spec/ruby/library/cgi/queryextension/host_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/include_spec.rb7
-rw-r--r--spec/ruby/library/cgi/queryextension/key_spec.rb7
-rw-r--r--spec/ruby/library/cgi/queryextension/keys_spec.rb20
-rw-r--r--spec/ruby/library/cgi/queryextension/multipart_spec.rb40
-rw-r--r--spec/ruby/library/cgi/queryextension/negotiate_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/params_spec.rb37
-rw-r--r--spec/ruby/library/cgi/queryextension/path_info_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/path_translated_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/pragma_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/query_string_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/raw_cookie2_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/raw_cookie_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/referer_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/remote_addr_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/remote_host_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/remote_ident_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/remote_user_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/request_method_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/script_name_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/server_name_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/server_port_spec.rb26
-rw-r--r--spec/ruby/library/cgi/queryextension/server_protocol_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/server_software_spec.rb22
-rw-r--r--spec/ruby/library/cgi/queryextension/shared/has_key.rb19
-rw-r--r--spec/ruby/library/cgi/queryextension/user_agent_spec.rb22
-rw-r--r--spec/ruby/library/cgi/rfc1123_date_spec.rb10
-rw-r--r--spec/ruby/library/cgi/shared/http_header.rb112
-rw-r--r--spec/ruby/library/cgi/unescapeElement_spec.rb20
-rw-r--r--spec/ruby/library/cgi/unescapeHTML_spec.rb39
-rw-r--r--spec/ruby/library/cgi/unescape_spec.rb15
-rw-r--r--spec/ruby/library/cmath/math/acos_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/acosh_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/asin_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/asinh_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/atan2_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/atan_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/atanh_spec.rb20
-rw-r--r--spec/ruby/library/cmath/math/cos_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/cosh_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/exp_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/fixtures/classes.rb4
-rw-r--r--spec/ruby/library/cmath/math/log10_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/log_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/shared/acos.rb41
-rw-r--r--spec/ruby/library/cmath/math/shared/acosh.rb37
-rw-r--r--spec/ruby/library/cmath/math/shared/asin.rb47
-rw-r--r--spec/ruby/library/cmath/math/shared/asinh.rb32
-rw-r--r--spec/ruby/library/cmath/math/shared/atan.rb32
-rw-r--r--spec/ruby/library/cmath/math/shared/atan2.rb34
-rw-r--r--spec/ruby/library/cmath/math/shared/atanh.rb30
-rw-r--r--spec/ruby/library/cmath/math/shared/cos.rb30
-rw-r--r--spec/ruby/library/cmath/math/shared/cosh.rb28
-rw-r--r--spec/ruby/library/cmath/math/shared/exp.rb28
-rw-r--r--spec/ruby/library/cmath/math/shared/log.rb39
-rw-r--r--spec/ruby/library/cmath/math/shared/log10.rb41
-rw-r--r--spec/ruby/library/cmath/math/shared/sin.rb30
-rw-r--r--spec/ruby/library/cmath/math/shared/sinh.rb28
-rw-r--r--spec/ruby/library/cmath/math/shared/sqrt.rb34
-rw-r--r--spec/ruby/library/cmath/math/shared/tan.rb28
-rw-r--r--spec/ruby/library/cmath/math/shared/tanh.rb32
-rw-r--r--spec/ruby/library/cmath/math/sin_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/sinh_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/sqrt_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/tan_spec.rb18
-rw-r--r--spec/ruby/library/cmath/math/tanh_spec.rb18
-rw-r--r--spec/ruby/library/conditionvariable/broadcast_spec.rb67
-rw-r--r--spec/ruby/library/conditionvariable/marshal_dump_spec.rb9
-rw-r--r--spec/ruby/library/conditionvariable/signal_spec.rb104
-rw-r--r--spec/ruby/library/conditionvariable/wait_spec.rb132
-rw-r--r--spec/ruby/library/coverage/fixtures/second_class.rb5
-rw-r--r--spec/ruby/library/coverage/fixtures/some_class.rb16
-rw-r--r--spec/ruby/library/coverage/fixtures/start_coverage.rb3
-rw-r--r--spec/ruby/library/coverage/peek_result_spec.rb64
-rw-r--r--spec/ruby/library/coverage/result_spec.rb78
-rw-r--r--spec/ruby/library/coverage/start_spec.rb6
-rw-r--r--spec/ruby/library/csv/basicwriter/close_on_terminate_spec.rb6
-rw-r--r--spec/ruby/library/csv/basicwriter/initialize_spec.rb6
-rw-r--r--spec/ruby/library/csv/basicwriter/terminate_spec.rb6
-rw-r--r--spec/ruby/library/csv/cell/data_spec.rb6
-rw-r--r--spec/ruby/library/csv/cell/initialize_spec.rb6
-rw-r--r--spec/ruby/library/csv/fixtures/one_line.csv1
-rw-r--r--spec/ruby/library/csv/foreach_spec.rb6
-rw-r--r--spec/ruby/library/csv/generate_line_spec.rb30
-rw-r--r--spec/ruby/library/csv/generate_row_spec.rb6
-rw-r--r--spec/ruby/library/csv/generate_spec.rb32
-rw-r--r--spec/ruby/library/csv/iobuf/close_spec.rb6
-rw-r--r--spec/ruby/library/csv/iobuf/initialize_spec.rb6
-rw-r--r--spec/ruby/library/csv/iobuf/read_spec.rb6
-rw-r--r--spec/ruby/library/csv/iobuf/terminate_spec.rb6
-rw-r--r--spec/ruby/library/csv/ioreader/close_on_terminate_spec.rb6
-rw-r--r--spec/ruby/library/csv/ioreader/get_row_spec.rb6
-rw-r--r--spec/ruby/library/csv/ioreader/initialize_spec.rb6
-rw-r--r--spec/ruby/library/csv/ioreader/terminate_spec.rb6
-rw-r--r--spec/ruby/library/csv/liberal_parsing_spec.rb19
-rw-r--r--spec/ruby/library/csv/open_spec.rb6
-rw-r--r--spec/ruby/library/csv/parse_spec.rb93
-rw-r--r--spec/ruby/library/csv/read_spec.rb6
-rw-r--r--spec/ruby/library/csv/readlines_spec.rb35
-rw-r--r--spec/ruby/library/csv/streambuf/add_buf_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/buf_size_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/drop_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/element_reference_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/get_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/idx_is_eos_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/initialize_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/is_eos_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/read_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/rel_buf_spec.rb6
-rw-r--r--spec/ruby/library/csv/streambuf/terminate_spec.rb6
-rw-r--r--spec/ruby/library/csv/stringreader/get_row_spec.rb6
-rw-r--r--spec/ruby/library/csv/stringreader/initialize_spec.rb6
-rw-r--r--spec/ruby/library/csv/writer/add_row_spec.rb6
-rw-r--r--spec/ruby/library/csv/writer/append_spec.rb6
-rw-r--r--spec/ruby/library/csv/writer/close_spec.rb6
-rw-r--r--spec/ruby/library/csv/writer/create_spec.rb6
-rw-r--r--spec/ruby/library/csv/writer/generate_spec.rb6
-rw-r--r--spec/ruby/library/csv/writer/initialize_spec.rb6
-rw-r--r--spec/ruby/library/csv/writer/terminate_spec.rb6
-rw-r--r--spec/ruby/library/date/accessor_spec.rb91
-rw-r--r--spec/ruby/library/date/add_month_spec.rb38
-rw-r--r--spec/ruby/library/date/add_spec.rb30
-rw-r--r--spec/ruby/library/date/ajd_spec.rb6
-rw-r--r--spec/ruby/library/date/ajd_to_amjd_spec.rb6
-rw-r--r--spec/ruby/library/date/ajd_to_jd_spec.rb6
-rw-r--r--spec/ruby/library/date/amjd_spec.rb6
-rw-r--r--spec/ruby/library/date/amjd_to_ajd_spec.rb6
-rw-r--r--spec/ruby/library/date/append_spec.rb6
-rw-r--r--spec/ruby/library/date/asctime_spec.rb6
-rw-r--r--spec/ruby/library/date/boat_spec.rb24
-rw-r--r--spec/ruby/library/date/case_compare_spec.rb6
-rw-r--r--spec/ruby/library/date/civil_spec.rb12
-rw-r--r--spec/ruby/library/date/commercial_spec.rb17
-rw-r--r--spec/ruby/library/date/commercial_to_jd_spec.rb6
-rw-r--r--spec/ruby/library/date/comparison_spec.rb6
-rw-r--r--spec/ruby/library/date/constants_spec.rb48
-rw-r--r--spec/ruby/library/date/conversions_spec.rb43
-rw-r--r--spec/ruby/library/date/ctime_spec.rb6
-rw-r--r--spec/ruby/library/date/cwday_spec.rb6
-rw-r--r--spec/ruby/library/date/cweek_spec.rb6
-rw-r--r--spec/ruby/library/date/cwyear_spec.rb6
-rw-r--r--spec/ruby/library/date/day_fraction_spec.rb6
-rw-r--r--spec/ruby/library/date/day_fraction_to_time_spec.rb6
-rw-r--r--spec/ruby/library/date/day_spec.rb9
-rw-r--r--spec/ruby/library/date/downto_spec.rb18
-rw-r--r--spec/ruby/library/date/england_spec.rb6
-rw-r--r--spec/ruby/library/date/eql_spec.rb12
-rw-r--r--spec/ruby/library/date/format/bag/method_missing_spec.rb6
-rw-r--r--spec/ruby/library/date/format/bag/to_hash_spec.rb6
-rw-r--r--spec/ruby/library/date/friday_spec.rb12
-rw-r--r--spec/ruby/library/date/gregorian_leap_spec.rb15
-rw-r--r--spec/ruby/library/date/gregorian_spec.rb16
-rw-r--r--spec/ruby/library/date/hash_spec.rb8
-rw-r--r--spec/ruby/library/date/infinity/abs_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity/coerce_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity/comparison_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity/d_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity/finite_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity/infinite_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity/nan_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity/uminus_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity/uplus_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity/zero_spec.rb6
-rw-r--r--spec/ruby/library/date/infinity_spec.rb67
-rw-r--r--spec/ruby/library/date/inspect_spec.rb6
-rw-r--r--spec/ruby/library/date/iso8601_spec.rb44
-rw-r--r--spec/ruby/library/date/italy_spec.rb6
-rw-r--r--spec/ruby/library/date/jd_spec.rb15
-rw-r--r--spec/ruby/library/date/jd_to_ajd_spec.rb6
-rw-r--r--spec/ruby/library/date/jd_to_civil_spec.rb6
-rw-r--r--spec/ruby/library/date/jd_to_commercial_spec.rb6
-rw-r--r--spec/ruby/library/date/jd_to_ld_spec.rb6
-rw-r--r--spec/ruby/library/date/jd_to_mjd_spec.rb6
-rw-r--r--spec/ruby/library/date/jd_to_ordinal_spec.rb6
-rw-r--r--spec/ruby/library/date/jd_to_wday_spec.rb6
-rw-r--r--spec/ruby/library/date/julian_leap_spec.rb15
-rw-r--r--spec/ruby/library/date/julian_spec.rb16
-rw-r--r--spec/ruby/library/date/ld_spec.rb6
-rw-r--r--spec/ruby/library/date/ld_to_jd_spec.rb6
-rw-r--r--spec/ruby/library/date/leap_spec.rb10
-rw-r--r--spec/ruby/library/date/mday_spec.rb6
-rw-r--r--spec/ruby/library/date/minus_month_spec.rb23
-rw-r--r--spec/ruby/library/date/minus_spec.rb30
-rw-r--r--spec/ruby/library/date/mjd_spec.rb6
-rw-r--r--spec/ruby/library/date/mjd_to_jd_spec.rb6
-rw-r--r--spec/ruby/library/date/mon_spec.rb6
-rw-r--r--spec/ruby/library/date/monday_spec.rb8
-rw-r--r--spec/ruby/library/date/month_spec.rb9
-rw-r--r--spec/ruby/library/date/new_spec.rb8
-rw-r--r--spec/ruby/library/date/new_start_spec.rb6
-rw-r--r--spec/ruby/library/date/next_day_spec.rb14
-rw-r--r--spec/ruby/library/date/next_month_spec.rb29
-rw-r--r--spec/ruby/library/date/next_spec.rb6
-rw-r--r--spec/ruby/library/date/next_year_spec.rb12
-rw-r--r--spec/ruby/library/date/ordinal_spec.rb7
-rw-r--r--spec/ruby/library/date/ordinal_to_jd_spec.rb6
-rw-r--r--spec/ruby/library/date/parse_spec.rb142
-rw-r--r--spec/ruby/library/date/plus_spec.rb20
-rw-r--r--spec/ruby/library/date/prev_day_spec.rb14
-rw-r--r--spec/ruby/library/date/prev_month_spec.rb29
-rw-r--r--spec/ruby/library/date/prev_year_spec.rb12
-rw-r--r--spec/ruby/library/date/relationship_spec.rb20
-rw-r--r--spec/ruby/library/date/rfc3339_spec.rb13
-rw-r--r--spec/ruby/library/date/right_shift_spec.rb6
-rw-r--r--spec/ruby/library/date/saturday_spec.rb8
-rw-r--r--spec/ruby/library/date/shared/civil.rb57
-rw-r--r--spec/ruby/library/date/shared/commercial.rb39
-rw-r--r--spec/ruby/library/date/shared/jd.rb14
-rw-r--r--spec/ruby/library/date/shared/new_bang.rb14
-rw-r--r--spec/ruby/library/date/shared/ordinal.rb22
-rw-r--r--spec/ruby/library/date/shared/parse.rb54
-rw-r--r--spec/ruby/library/date/shared/parse_eu.rb37
-rw-r--r--spec/ruby/library/date/shared/parse_us.rb36
-rw-r--r--spec/ruby/library/date/shared/valid_civil.rb36
-rw-r--r--spec/ruby/library/date/shared/valid_commercial.rb34
-rw-r--r--spec/ruby/library/date/shared/valid_jd.rb32
-rw-r--r--spec/ruby/library/date/shared/valid_ordinal.rb26
-rw-r--r--spec/ruby/library/date/start_spec.rb6
-rw-r--r--spec/ruby/library/date/step_spec.rb56
-rw-r--r--spec/ruby/library/date/strftime_spec.rb40
-rw-r--r--spec/ruby/library/date/strptime_spec.rb149
-rw-r--r--spec/ruby/library/date/succ_spec.rb6
-rw-r--r--spec/ruby/library/date/sunday_spec.rb8
-rw-r--r--spec/ruby/library/date/thursday_spec.rb8
-rw-r--r--spec/ruby/library/date/time_to_day_fraction_spec.rb6
-rw-r--r--spec/ruby/library/date/to_s_spec.rb6
-rw-r--r--spec/ruby/library/date/today_spec.rb14
-rw-r--r--spec/ruby/library/date/tuesday_spec.rb8
-rw-r--r--spec/ruby/library/date/upto_spec.rb16
-rw-r--r--spec/ruby/library/date/valid_civil_spec.rb9
-rw-r--r--spec/ruby/library/date/valid_commercial_spec.rb8
-rw-r--r--spec/ruby/library/date/valid_date_spec.rb7
-rw-r--r--spec/ruby/library/date/valid_jd_spec.rb9
-rw-r--r--spec/ruby/library/date/valid_ordinal_spec.rb9
-rw-r--r--spec/ruby/library/date/valid_time_spec.rb6
-rw-r--r--spec/ruby/library/date/wday_spec.rb9
-rw-r--r--spec/ruby/library/date/wednesday_spec.rb8
-rw-r--r--spec/ruby/library/date/yday_spec.rb6
-rw-r--r--spec/ruby/library/date/year_spec.rb9
-rw-r--r--spec/ruby/library/date/zone_to_diff_spec.rb6
-rw-r--r--spec/ruby/library/datetime/_strptime_spec.rb6
-rw-r--r--spec/ruby/library/datetime/add_spec.rb9
-rw-r--r--spec/ruby/library/datetime/civil_spec.rb6
-rw-r--r--spec/ruby/library/datetime/commercial_spec.rb6
-rw-r--r--spec/ruby/library/datetime/hour_spec.rb47
-rw-r--r--spec/ruby/library/datetime/httpdate_spec.rb6
-rw-r--r--spec/ruby/library/datetime/iso8601_spec.rb10
-rw-r--r--spec/ruby/library/datetime/jd_spec.rb6
-rw-r--r--spec/ruby/library/datetime/jisx0301_spec.rb10
-rw-r--r--spec/ruby/library/datetime/min_spec.rb6
-rw-r--r--spec/ruby/library/datetime/minute_spec.rb6
-rw-r--r--spec/ruby/library/datetime/new_offset_spec.rb6
-rw-r--r--spec/ruby/library/datetime/new_spec.rb52
-rw-r--r--spec/ruby/library/datetime/now_spec.rb25
-rw-r--r--spec/ruby/library/datetime/offset_spec.rb6
-rw-r--r--spec/ruby/library/datetime/ordinal_spec.rb6
-rw-r--r--spec/ruby/library/datetime/parse_spec.rb127
-rw-r--r--spec/ruby/library/datetime/rfc2822_spec.rb6
-rw-r--r--spec/ruby/library/datetime/rfc3339_spec.rb10
-rw-r--r--spec/ruby/library/datetime/rfc822_spec.rb6
-rw-r--r--spec/ruby/library/datetime/sec_fraction_spec.rb6
-rw-r--r--spec/ruby/library/datetime/sec_spec.rb6
-rw-r--r--spec/ruby/library/datetime/second_fraction_spec.rb6
-rw-r--r--spec/ruby/library/datetime/second_spec.rb6
-rw-r--r--spec/ruby/library/datetime/shared/min.rb40
-rw-r--r--spec/ruby/library/datetime/shared/sec.rb45
-rw-r--r--spec/ruby/library/datetime/strftime_spec.rb51
-rw-r--r--spec/ruby/library/datetime/strptime_spec.rb6
-rw-r--r--spec/ruby/library/datetime/subtract_spec.rb19
-rw-r--r--spec/ruby/library/datetime/to_date_spec.rb37
-rw-r--r--spec/ruby/library/datetime/to_datetime_spec.rb9
-rw-r--r--spec/ruby/library/datetime/to_s_spec.rb17
-rw-r--r--spec/ruby/library/datetime/to_time_spec.rb36
-rw-r--r--spec/ruby/library/datetime/xmlschema_spec.rb10
-rw-r--r--spec/ruby/library/datetime/zone_spec.rb6
-rw-r--r--spec/ruby/library/delegate/delegate_class/instance_method_spec.rb52
-rw-r--r--spec/ruby/library/delegate/delegate_class/instance_methods_spec.rb26
-rw-r--r--spec/ruby/library/delegate/delegate_class/private_instance_methods_spec.rb23
-rw-r--r--spec/ruby/library/delegate/delegate_class/protected_instance_methods_spec.rb29
-rw-r--r--spec/ruby/library/delegate/delegate_class/public_instance_methods_spec.rb25
-rw-r--r--spec/ruby/library/delegate/delegate_class/respond_to_missing_spec.rb23
-rw-r--r--spec/ruby/library/delegate/delegator/case_compare_spec.rb11
-rw-r--r--spec/ruby/library/delegate/delegator/compare_spec.rb11
-rw-r--r--spec/ruby/library/delegate/delegator/complement_spec.rb11
-rw-r--r--spec/ruby/library/delegate/delegator/eql_spec.rb46
-rw-r--r--spec/ruby/library/delegate/delegator/equal_spec.rb13
-rw-r--r--spec/ruby/library/delegate/delegator/equal_value_spec.rb24
-rw-r--r--spec/ruby/library/delegate/delegator/frozen_spec.rb39
-rw-r--r--spec/ruby/library/delegate/delegator/hash_spec.rb11
-rw-r--r--spec/ruby/library/delegate/delegator/marshal_spec.rb21
-rw-r--r--spec/ruby/library/delegate/delegator/method_spec.rb69
-rw-r--r--spec/ruby/library/delegate/delegator/methods_spec.rb37
-rw-r--r--spec/ruby/library/delegate/delegator/not_equal_spec.rb24
-rw-r--r--spec/ruby/library/delegate/delegator/not_spec.rb11
-rw-r--r--spec/ruby/library/delegate/delegator/private_methods_spec.rb20
-rw-r--r--spec/ruby/library/delegate/delegator/protected_methods_spec.rb18
-rw-r--r--spec/ruby/library/delegate/delegator/public_methods_spec.rb18
-rw-r--r--spec/ruby/library/delegate/delegator/send_spec.rb26
-rw-r--r--spec/ruby/library/delegate/delegator/taint_spec.rb25
-rw-r--r--spec/ruby/library/delegate/delegator/tap_spec.rb16
-rw-r--r--spec/ruby/library/delegate/delegator/trust_spec.rb24
-rw-r--r--spec/ruby/library/delegate/delegator/untaint_spec.rb26
-rw-r--r--spec/ruby/library/delegate/delegator/untrust_spec.rb25
-rw-r--r--spec/ruby/library/delegate/fixtures/classes.rb60
-rw-r--r--spec/ruby/library/digest/bubblebabble_spec.rb29
-rw-r--r--spec/ruby/library/digest/hexencode_spec.rb31
-rw-r--r--spec/ruby/library/digest/md5/append_spec.rb7
-rw-r--r--spec/ruby/library/digest/md5/block_length_spec.rb11
-rw-r--r--spec/ruby/library/digest/md5/digest_bang_spec.rb13
-rw-r--r--spec/ruby/library/digest/md5/digest_length_spec.rb11
-rw-r--r--spec/ruby/library/digest/md5/digest_spec.rb32
-rw-r--r--spec/ruby/library/digest/md5/equal_spec.rb37
-rw-r--r--spec/ruby/library/digest/md5/file_spec.rb43
-rw-r--r--spec/ruby/library/digest/md5/hexdigest_bang_spec.rb14
-rw-r--r--spec/ruby/library/digest/md5/hexdigest_spec.rb32
-rw-r--r--spec/ruby/library/digest/md5/inspect_spec.rb11
-rw-r--r--spec/ruby/library/digest/md5/length_spec.rb7
-rw-r--r--spec/ruby/library/digest/md5/reset_spec.rb14
-rw-r--r--spec/ruby/library/digest/md5/shared/constants.rb16
-rw-r--r--spec/ruby/library/digest/md5/shared/length.rb8
-rw-r--r--spec/ruby/library/digest/md5/shared/sample.rb17
-rw-r--r--spec/ruby/library/digest/md5/shared/update.rb7
-rw-r--r--spec/ruby/library/digest/md5/size_spec.rb7
-rw-r--r--spec/ruby/library/digest/md5/to_s_spec.rb24
-rw-r--r--spec/ruby/library/digest/md5/update_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha1/digest_spec.rb20
-rw-r--r--spec/ruby/library/digest/sha1/file_spec.rb43
-rw-r--r--spec/ruby/library/digest/sha1/shared/constants.rb17
-rw-r--r--spec/ruby/library/digest/sha256/append_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha256/block_length_spec.rb11
-rw-r--r--spec/ruby/library/digest/sha256/digest_bang_spec.rb13
-rw-r--r--spec/ruby/library/digest/sha256/digest_length_spec.rb11
-rw-r--r--spec/ruby/library/digest/sha256/digest_spec.rb32
-rw-r--r--spec/ruby/library/digest/sha256/equal_spec.rb36
-rw-r--r--spec/ruby/library/digest/sha256/file_spec.rb43
-rw-r--r--spec/ruby/library/digest/sha256/hexdigest_bang_spec.rb14
-rw-r--r--spec/ruby/library/digest/sha256/hexdigest_spec.rb32
-rw-r--r--spec/ruby/library/digest/sha256/inspect_spec.rb11
-rw-r--r--spec/ruby/library/digest/sha256/length_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha256/reset_spec.rb14
-rw-r--r--spec/ruby/library/digest/sha256/shared/constants.rb17
-rw-r--r--spec/ruby/library/digest/sha256/shared/length.rb8
-rw-r--r--spec/ruby/library/digest/sha256/shared/update.rb7
-rw-r--r--spec/ruby/library/digest/sha256/size_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha256/to_s_spec.rb21
-rw-r--r--spec/ruby/library/digest/sha256/update_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha384/append_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha384/block_length_spec.rb11
-rw-r--r--spec/ruby/library/digest/sha384/digest_bang_spec.rb13
-rw-r--r--spec/ruby/library/digest/sha384/digest_length_spec.rb11
-rw-r--r--spec/ruby/library/digest/sha384/digest_spec.rb32
-rw-r--r--spec/ruby/library/digest/sha384/equal_spec.rb36
-rw-r--r--spec/ruby/library/digest/sha384/file_spec.rb43
-rw-r--r--spec/ruby/library/digest/sha384/hexdigest_bang_spec.rb14
-rw-r--r--spec/ruby/library/digest/sha384/hexdigest_spec.rb32
-rw-r--r--spec/ruby/library/digest/sha384/inspect_spec.rb11
-rw-r--r--spec/ruby/library/digest/sha384/length_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha384/reset_spec.rb14
-rw-r--r--spec/ruby/library/digest/sha384/shared/constants.rb18
-rw-r--r--spec/ruby/library/digest/sha384/shared/length.rb8
-rw-r--r--spec/ruby/library/digest/sha384/shared/update.rb7
-rw-r--r--spec/ruby/library/digest/sha384/size_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha384/to_s_spec.rb21
-rw-r--r--spec/ruby/library/digest/sha384/update_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha512/append_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha512/block_length_spec.rb11
-rw-r--r--spec/ruby/library/digest/sha512/digest_bang_spec.rb13
-rw-r--r--spec/ruby/library/digest/sha512/digest_length_spec.rb11
-rw-r--r--spec/ruby/library/digest/sha512/digest_spec.rb32
-rw-r--r--spec/ruby/library/digest/sha512/equal_spec.rb36
-rw-r--r--spec/ruby/library/digest/sha512/file_spec.rb43
-rw-r--r--spec/ruby/library/digest/sha512/hexdigest_bang_spec.rb14
-rw-r--r--spec/ruby/library/digest/sha512/hexdigest_spec.rb32
-rw-r--r--spec/ruby/library/digest/sha512/inspect_spec.rb11
-rw-r--r--spec/ruby/library/digest/sha512/length_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha512/reset_spec.rb14
-rw-r--r--spec/ruby/library/digest/sha512/shared/constants.rb17
-rw-r--r--spec/ruby/library/digest/sha512/shared/length.rb8
-rw-r--r--spec/ruby/library/digest/sha512/shared/update.rb7
-rw-r--r--spec/ruby/library/digest/sha512/size_spec.rb7
-rw-r--r--spec/ruby/library/digest/sha512/to_s_spec.rb21
-rw-r--r--spec/ruby/library/digest/sha512/update_spec.rb7
-rw-r--r--spec/ruby/library/drb/fixtures/test_server.rb8
-rw-r--r--spec/ruby/library/drb/start_service_spec.rb28
-rw-r--r--spec/ruby/library/erb/def_class_spec.rb29
-rw-r--r--spec/ruby/library/erb/def_method_spec.rb26
-rw-r--r--spec/ruby/library/erb/def_module_spec.rb27
-rw-r--r--spec/ruby/library/erb/defmethod/def_erb_method_spec.rb64
-rw-r--r--spec/ruby/library/erb/filename_spec.rb40
-rw-r--r--spec/ruby/library/erb/fixtures/classes.rb9
-rw-r--r--spec/ruby/library/erb/new_spec.rb148
-rw-r--r--spec/ruby/library/erb/result_spec.rb86
-rw-r--r--spec/ruby/library/erb/run_spec.rb96
-rw-r--r--spec/ruby/library/erb/src_spec.rb33
-rw-r--r--spec/ruby/library/erb/util/h_spec.rb7
-rw-r--r--spec/ruby/library/erb/util/html_escape_spec.rb7
-rw-r--r--spec/ruby/library/erb/util/shared/html_escape.rb42
-rw-r--r--spec/ruby/library/erb/util/shared/url_encode.rb50
-rw-r--r--spec/ruby/library/erb/util/u_spec.rb7
-rw-r--r--spec/ruby/library/erb/util/url_encode_spec.rb7
-rw-r--r--spec/ruby/library/etc/confstr_spec.rb14
-rw-r--r--spec/ruby/library/etc/endgrent_spec.rb7
-rw-r--r--spec/ruby/library/etc/endpwent_spec.rb7
-rw-r--r--spec/ruby/library/etc/getgrent_spec.rb7
-rw-r--r--spec/ruby/library/etc/getgrgid_spec.rb76
-rw-r--r--spec/ruby/library/etc/getgrnam_spec.rb30
-rw-r--r--spec/ruby/library/etc/getlogin_spec.rb43
-rw-r--r--spec/ruby/library/etc/getpwent_spec.rb7
-rw-r--r--spec/ruby/library/etc/getpwnam_spec.rb28
-rw-r--r--spec/ruby/library/etc/getpwuid_spec.rb36
-rw-r--r--spec/ruby/library/etc/group_spec.rb27
-rw-r--r--spec/ruby/library/etc/nprocessors_spec.rb9
-rw-r--r--spec/ruby/library/etc/passwd_spec.rb15
-rw-r--r--spec/ruby/library/etc/shared/windows.rb7
-rw-r--r--spec/ruby/library/etc/struct_group_spec.rb35
-rw-r--r--spec/ruby/library/etc/struct_passwd_spec.rb43
-rw-r--r--spec/ruby/library/etc/sysconf_spec.rb22
-rw-r--r--spec/ruby/library/etc/sysconfdir_spec.rb8
-rw-r--r--spec/ruby/library/etc/systmpdir_spec.rb8
-rw-r--r--spec/ruby/library/expect/expect_spec.rb62
-rw-r--r--spec/ruby/library/fiber/alive_spec.rb46
-rw-r--r--spec/ruby/library/fiber/current_spec.rb51
-rw-r--r--spec/ruby/library/fiber/resume_spec.rb12
-rw-r--r--spec/ruby/library/fiber/transfer_spec.rb86
-rw-r--r--spec/ruby/library/find/find_spec.rb30
-rw-r--r--spec/ruby/library/find/fixtures/common.rb174
-rw-r--r--spec/ruby/library/find/prune_spec.rb12
-rw-r--r--spec/ruby/library/getoptlong/each_option_spec.rb7
-rw-r--r--spec/ruby/library/getoptlong/each_spec.rb7
-rw-r--r--spec/ruby/library/getoptlong/error_message_spec.rb23
-rw-r--r--spec/ruby/library/getoptlong/get_option_spec.rb7
-rw-r--r--spec/ruby/library/getoptlong/get_spec.rb7
-rw-r--r--spec/ruby/library/getoptlong/initialize_spec.rb28
-rw-r--r--spec/ruby/library/getoptlong/ordering_spec.rb38
-rw-r--r--spec/ruby/library/getoptlong/set_options_spec.rb98
-rw-r--r--spec/ruby/library/getoptlong/shared/each.rb18
-rw-r--r--spec/ruby/library/getoptlong/shared/get.rb64
-rw-r--r--spec/ruby/library/getoptlong/terminate_spec.rb30
-rw-r--r--spec/ruby/library/getoptlong/terminated_spec.rb17
-rw-r--r--spec/ruby/library/ipaddr/hton_spec.rb30
-rw-r--r--spec/ruby/library/ipaddr/ipv4_conversion_spec.rb44
-rw-r--r--spec/ruby/library/ipaddr/new_spec.rb93
-rw-r--r--spec/ruby/library/ipaddr/operator_spec.rb82
-rw-r--r--spec/ruby/library/ipaddr/reverse_spec.rb27
-rw-r--r--spec/ruby/library/ipaddr/to_s_spec.rb20
-rw-r--r--spec/ruby/library/logger/device/close_spec.rb31
-rw-r--r--spec/ruby/library/logger/device/new_spec.rb47
-rw-r--r--spec/ruby/library/logger/device/write_spec.rb51
-rw-r--r--spec/ruby/library/logger/fixtures/common.rb9
-rw-r--r--spec/ruby/library/logger/logger/add_spec.rb81
-rw-r--r--spec/ruby/library/logger/logger/close_spec.rb20
-rw-r--r--spec/ruby/library/logger/logger/datetime_format_spec.rb60
-rw-r--r--spec/ruby/library/logger/logger/debug_spec.rb52
-rw-r--r--spec/ruby/library/logger/logger/error_spec.rb53
-rw-r--r--spec/ruby/library/logger/logger/fatal_spec.rb53
-rw-r--r--spec/ruby/library/logger/logger/info_spec.rb53
-rw-r--r--spec/ruby/library/logger/logger/new_spec.rb118
-rw-r--r--spec/ruby/library/logger/logger/unknown_spec.rb36
-rw-r--r--spec/ruby/library/logger/logger/warn_spec.rb53
-rw-r--r--spec/ruby/library/logger/severity_spec.rb13
-rw-r--r--spec/ruby/library/mathn/bignum/exponent_spec.rb21
-rw-r--r--spec/ruby/library/mathn/complex/Complex_spec.rb14
-rw-r--r--spec/ruby/library/mathn/fixnum/exponent_spec.rb17
-rw-r--r--spec/ruby/library/mathn/float/exponent_spec.rb17
-rw-r--r--spec/ruby/library/mathn/integer/from_prime_division_spec.rb11
-rw-r--r--spec/ruby/library/mathn/integer/prime_division_spec.rb21
-rw-r--r--spec/ruby/library/mathn/math/fixtures/classes.rb3
-rw-r--r--spec/ruby/library/mathn/math/rsqrt_spec.rb17
-rw-r--r--spec/ruby/library/mathn/math/shared/rsqrt.rb21
-rw-r--r--spec/ruby/library/mathn/math/shared/sqrt.rb25
-rw-r--r--spec/ruby/library/mathn/math/sqrt_spec.rb17
-rw-r--r--spec/ruby/library/mathn/mathn_spec.rb13
-rw-r--r--spec/ruby/library/mathn/rational/Rational_spec.rb14
-rw-r--r--spec/ruby/library/mathn/rational/inspect_spec.rb15
-rw-r--r--spec/ruby/library/matrix/I_spec.rb6
-rw-r--r--spec/ruby/library/matrix/antisymmetric_spec.rb37
-rw-r--r--spec/ruby/library/matrix/build_spec.rb73
-rw-r--r--spec/ruby/library/matrix/clone_spec.rb25
-rw-r--r--spec/ruby/library/matrix/coerce_spec.rb8
-rw-r--r--spec/ruby/library/matrix/collect_spec.rb6
-rw-r--r--spec/ruby/library/matrix/column_size_spec.rb13
-rw-r--r--spec/ruby/library/matrix/column_spec.rb35
-rw-r--r--spec/ruby/library/matrix/column_vector_spec.rb25
-rw-r--r--spec/ruby/library/matrix/column_vectors_spec.rb26
-rw-r--r--spec/ruby/library/matrix/columns_spec.rb42
-rw-r--r--spec/ruby/library/matrix/conj_spec.rb6
-rw-r--r--spec/ruby/library/matrix/conjugate_spec.rb6
-rw-r--r--spec/ruby/library/matrix/constructor_spec.rb65
-rw-r--r--spec/ruby/library/matrix/det_spec.rb7
-rw-r--r--spec/ruby/library/matrix/determinant_spec.rb7
-rw-r--r--spec/ruby/library/matrix/diagonal_spec.rb72
-rw-r--r--spec/ruby/library/matrix/divide_spec.rb54
-rw-r--r--spec/ruby/library/matrix/each_spec.rb74
-rw-r--r--spec/ruby/library/matrix/each_with_index_spec.rb81
-rw-r--r--spec/ruby/library/matrix/eigenvalue_decomposition/eigenvalue_matrix_spec.rb9
-rw-r--r--spec/ruby/library/matrix/eigenvalue_decomposition/eigenvalues_spec.rb22
-rw-r--r--spec/ruby/library/matrix/eigenvalue_decomposition/eigenvector_matrix_spec.rb20
-rw-r--r--spec/ruby/library/matrix/eigenvalue_decomposition/eigenvectors_spec.rb22
-rw-r--r--spec/ruby/library/matrix/eigenvalue_decomposition/initialize_spec.rb24
-rw-r--r--spec/ruby/library/matrix/eigenvalue_decomposition/to_a_spec.rb18
-rw-r--r--spec/ruby/library/matrix/element_reference_spec.rb23
-rw-r--r--spec/ruby/library/matrix/empty_spec.rb68
-rw-r--r--spec/ruby/library/matrix/eql_spec.rb11
-rw-r--r--spec/ruby/library/matrix/equal_value_spec.rb11
-rw-r--r--spec/ruby/library/matrix/exponent_spec.rb51
-rw-r--r--spec/ruby/library/matrix/find_index_spec.rb146
-rw-r--r--spec/ruby/library/matrix/fixtures/classes.rb7
-rw-r--r--spec/ruby/library/matrix/hash_spec.rb15
-rw-r--r--spec/ruby/library/matrix/hermitian_spec.rb34
-rw-r--r--spec/ruby/library/matrix/identity_spec.rb6
-rw-r--r--spec/ruby/library/matrix/imag_spec.rb6
-rw-r--r--spec/ruby/library/matrix/imaginary_spec.rb6
-rw-r--r--spec/ruby/library/matrix/inspect_spec.rb27
-rw-r--r--spec/ruby/library/matrix/inv_spec.rb7
-rw-r--r--spec/ruby/library/matrix/inverse_from_spec.rb6
-rw-r--r--spec/ruby/library/matrix/inverse_spec.rb7
-rw-r--r--spec/ruby/library/matrix/lower_triangular_spec.rb24
-rw-r--r--spec/ruby/library/matrix/lup_decomposition/determinant_spec.rb21
-rw-r--r--spec/ruby/library/matrix/lup_decomposition/initialize_spec.rb13
-rw-r--r--spec/ruby/library/matrix/lup_decomposition/l_spec.rb18
-rw-r--r--spec/ruby/library/matrix/lup_decomposition/p_spec.rb18
-rw-r--r--spec/ruby/library/matrix/lup_decomposition/solve_spec.rb53
-rw-r--r--spec/ruby/library/matrix/lup_decomposition/to_a_spec.rb33
-rw-r--r--spec/ruby/library/matrix/lup_decomposition/u_spec.rb18
-rw-r--r--spec/ruby/library/matrix/map_spec.rb6
-rw-r--r--spec/ruby/library/matrix/minor_spec.rb85
-rw-r--r--spec/ruby/library/matrix/minus_spec.rb42
-rw-r--r--spec/ruby/library/matrix/multiply_spec.rb68
-rw-r--r--spec/ruby/library/matrix/new_spec.rb8
-rw-r--r--spec/ruby/library/matrix/normal_spec.rb26
-rw-r--r--spec/ruby/library/matrix/orthogonal_spec.rb26
-rw-r--r--spec/ruby/library/matrix/permutation_spec.rb32
-rw-r--r--spec/ruby/library/matrix/plus_spec.rb42
-rw-r--r--spec/ruby/library/matrix/rank_spec.rb19
-rw-r--r--spec/ruby/library/matrix/real_spec.rb43
-rw-r--r--spec/ruby/library/matrix/rect_spec.rb6
-rw-r--r--spec/ruby/library/matrix/rectangular_spec.rb6
-rw-r--r--spec/ruby/library/matrix/regular_spec.rb31
-rw-r--r--spec/ruby/library/matrix/round_spec.rb21
-rw-r--r--spec/ruby/library/matrix/row_size_spec.rb13
-rw-r--r--spec/ruby/library/matrix/row_spec.rb36
-rw-r--r--spec/ruby/library/matrix/row_vector_spec.rb24
-rw-r--r--spec/ruby/library/matrix/row_vectors_spec.rb26
-rw-r--r--spec/ruby/library/matrix/rows_spec.rb41
-rw-r--r--spec/ruby/library/matrix/scalar/Fail_spec.rb6
-rw-r--r--spec/ruby/library/matrix/scalar/Raise_spec.rb6
-rw-r--r--spec/ruby/library/matrix/scalar/divide_spec.rb6
-rw-r--r--spec/ruby/library/matrix/scalar/exponent_spec.rb6
-rw-r--r--spec/ruby/library/matrix/scalar/included_spec.rb6
-rw-r--r--spec/ruby/library/matrix/scalar/initialize_spec.rb6
-rw-r--r--spec/ruby/library/matrix/scalar/minus_spec.rb6
-rw-r--r--spec/ruby/library/matrix/scalar/multiply_spec.rb6
-rw-r--r--spec/ruby/library/matrix/scalar/plus_spec.rb6
-rw-r--r--spec/ruby/library/matrix/scalar_spec.rb67
-rw-r--r--spec/ruby/library/matrix/shared/collect.rb26
-rw-r--r--spec/ruby/library/matrix/shared/conjugate.rb20
-rw-r--r--spec/ruby/library/matrix/shared/determinant.rb38
-rw-r--r--spec/ruby/library/matrix/shared/equal_value.rb33
-rw-r--r--spec/ruby/library/matrix/shared/identity.rb19
-rw-r--r--spec/ruby/library/matrix/shared/imaginary.rb20
-rw-r--r--spec/ruby/library/matrix/shared/inverse.rb38
-rw-r--r--spec/ruby/library/matrix/shared/rectangular.rb18
-rw-r--r--spec/ruby/library/matrix/shared/trace.rb12
-rw-r--r--spec/ruby/library/matrix/shared/transpose.rb19
-rw-r--r--spec/ruby/library/matrix/singular_spec.rb31
-rw-r--r--spec/ruby/library/matrix/spec_helper.rb35
-rw-r--r--spec/ruby/library/matrix/square_spec.rb28
-rw-r--r--spec/ruby/library/matrix/symmetric_spec.rb29
-rw-r--r--spec/ruby/library/matrix/t_spec.rb6
-rw-r--r--spec/ruby/library/matrix/to_a_spec.rb11
-rw-r--r--spec/ruby/library/matrix/to_s_spec.rb6
-rw-r--r--spec/ruby/library/matrix/tr_spec.rb7
-rw-r--r--spec/ruby/library/matrix/trace_spec.rb7
-rw-r--r--spec/ruby/library/matrix/transpose_spec.rb6
-rw-r--r--spec/ruby/library/matrix/unit_spec.rb6
-rw-r--r--spec/ruby/library/matrix/unitary_spec.rb28
-rw-r--r--spec/ruby/library/matrix/upper_triangular_spec.rb24
-rw-r--r--spec/ruby/library/matrix/vector/cross_product_spec.rb14
-rw-r--r--spec/ruby/library/matrix/vector/each2_spec.rb49
-rw-r--r--spec/ruby/library/matrix/vector/eql_spec.rb16
-rw-r--r--spec/ruby/library/matrix/vector/inner_product_spec.rb22
-rw-r--r--spec/ruby/library/matrix/vector/normalize_spec.rb18
-rw-r--r--spec/ruby/library/matrix/zero_spec.rb52
-rw-r--r--spec/ruby/library/mkmf/mkmf_spec.rb7
-rw-r--r--spec/ruby/library/monitor/mon_initialize_spec.rb31
-rw-r--r--spec/ruby/library/net/FTPError_spec.rb8
-rw-r--r--spec/ruby/library/net/FTPPermError_spec.rb12
-rw-r--r--spec/ruby/library/net/FTPProtoError_spec.rb12
-rw-r--r--spec/ruby/library/net/FTPReplyError_spec.rb12
-rw-r--r--spec/ruby/library/net/FTPTempError_spec.rb12
-rw-r--r--spec/ruby/library/net/ftp/abort_spec.rb62
-rw-r--r--spec/ruby/library/net/ftp/acct_spec.rb58
-rw-r--r--spec/ruby/library/net/ftp/binary_spec.rb24
-rw-r--r--spec/ruby/library/net/ftp/chdir_spec.rb99
-rw-r--r--spec/ruby/library/net/ftp/close_spec.rb30
-rw-r--r--spec/ruby/library/net/ftp/closed_spec.rb21
-rw-r--r--spec/ruby/library/net/ftp/connect_spec.rb49
-rw-r--r--spec/ruby/library/net/ftp/debug_mode_spec.rb23
-rw-r--r--spec/ruby/library/net/ftp/default_passive_spec.rb8
-rw-r--r--spec/ruby/library/net/ftp/delete_spec.rb59
-rw-r--r--spec/ruby/library/net/ftp/dir_spec.rb8
-rw-r--r--spec/ruby/library/net/ftp/fixtures/default_passive.rb3
-rw-r--r--spec/ruby/library/net/ftp/fixtures/passive.rb2
-rw-r--r--spec/ruby/library/net/ftp/fixtures/putbinaryfile3
-rw-r--r--spec/ruby/library/net/ftp/fixtures/puttextfile3
-rw-r--r--spec/ruby/library/net/ftp/fixtures/server.rb277
-rw-r--r--spec/ruby/library/net/ftp/get_spec.rb21
-rw-r--r--spec/ruby/library/net/ftp/getbinaryfile_spec.rb8
-rw-r--r--spec/ruby/library/net/ftp/getdir_spec.rb7
-rw-r--r--spec/ruby/library/net/ftp/gettextfile_spec.rb8
-rw-r--r--spec/ruby/library/net/ftp/help_spec.rb66
-rw-r--r--spec/ruby/library/net/ftp/initialize_spec.rb407
-rw-r--r--spec/ruby/library/net/ftp/last_response_code_spec.rb8
-rw-r--r--spec/ruby/library/net/ftp/last_response_spec.rb25
-rw-r--r--spec/ruby/library/net/ftp/lastresp_spec.rb8
-rw-r--r--spec/ruby/library/net/ftp/list_spec.rb8
-rw-r--r--spec/ruby/library/net/ftp/login_spec.rb195
-rw-r--r--spec/ruby/library/net/ftp/ls_spec.rb8
-rw-r--r--spec/ruby/library/net/ftp/mdtm_spec.rb38
-rw-r--r--spec/ruby/library/net/ftp/mkdir_spec.rb61
-rw-r--r--spec/ruby/library/net/ftp/mtime_spec.rb50
-rw-r--r--spec/ruby/library/net/ftp/nlst_spec.rb92
-rw-r--r--spec/ruby/library/net/ftp/noop_spec.rb38
-rw-r--r--spec/ruby/library/net/ftp/open_spec.rb55
-rw-r--r--spec/ruby/library/net/ftp/passive_spec.rb28
-rw-r--r--spec/ruby/library/net/ftp/put_spec.rb21
-rw-r--r--spec/ruby/library/net/ftp/putbinaryfile_spec.rb8
-rw-r--r--spec/ruby/library/net/ftp/puttextfile_spec.rb8
-rw-r--r--spec/ruby/library/net/ftp/pwd_spec.rb53
-rw-r--r--spec/ruby/library/net/ftp/quit_spec.rb33
-rw-r--r--spec/ruby/library/net/ftp/rename_spec.rb94
-rw-r--r--spec/ruby/library/net/ftp/resume_spec.rb23
-rw-r--r--spec/ruby/library/net/ftp/retrbinary_spec.rb30
-rw-r--r--spec/ruby/library/net/ftp/retrlines_spec.rb34
-rw-r--r--spec/ruby/library/net/ftp/return_code_spec.rb24
-rw-r--r--spec/ruby/library/net/ftp/rmdir_spec.rb58
-rw-r--r--spec/ruby/library/net/ftp/sendcmd_spec.rb54
-rw-r--r--spec/ruby/library/net/ftp/set_socket_spec.rb8
-rw-r--r--spec/ruby/library/net/ftp/shared/getbinaryfile.rb150
-rw-r--r--spec/ruby/library/net/ftp/shared/gettextfile.rb100
-rw-r--r--spec/ruby/library/net/ftp/shared/last_response_code.rb25
-rw-r--r--spec/ruby/library/net/ftp/shared/list.rb104
-rw-r--r--spec/ruby/library/net/ftp/shared/putbinaryfile.rb167
-rw-r--r--spec/ruby/library/net/ftp/shared/puttextfile.rb120
-rw-r--r--spec/ruby/library/net/ftp/shared/pwd.rb3
-rw-r--r--spec/ruby/library/net/ftp/site_spec.rb53
-rw-r--r--spec/ruby/library/net/ftp/size_spec.rb48
-rw-r--r--spec/ruby/library/net/ftp/spec_helper.rb5
-rw-r--r--spec/ruby/library/net/ftp/status_spec.rb67
-rw-r--r--spec/ruby/library/net/ftp/storbinary_spec.rb48
-rw-r--r--spec/ruby/library/net/ftp/storlines_spec.rb43
-rw-r--r--spec/ruby/library/net/ftp/system_spec.rb48
-rw-r--r--spec/ruby/library/net/ftp/voidcmd_spec.rb54
-rw-r--r--spec/ruby/library/net/ftp/welcome_spec.rb25
-rw-r--r--spec/ruby/library/net/http/HTTPBadResponse_spec.rb8
-rw-r--r--spec/ruby/library/net/http/HTTPClientExcepton_spec.rb14
-rw-r--r--spec/ruby/library/net/http/HTTPError_spec.rb12
-rw-r--r--spec/ruby/library/net/http/HTTPFatalError_spec.rb12
-rw-r--r--spec/ruby/library/net/http/HTTPHeaderSyntaxError_spec.rb8
-rw-r--r--spec/ruby/library/net/http/HTTPRetriableError_spec.rb12
-rw-r--r--spec/ruby/library/net/http/HTTPServerException_spec.rb26
-rw-r--r--spec/ruby/library/net/http/http/Proxy_spec.rb35
-rw-r--r--spec/ruby/library/net/http/http/active_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/address_spec.rb9
-rw-r--r--spec/ruby/library/net/http/http/close_on_empty_response_spec.rb10
-rw-r--r--spec/ruby/library/net/http/http/copy_spec.rb21
-rw-r--r--spec/ruby/library/net/http/http/default_port_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/delete_spec.rb21
-rw-r--r--spec/ruby/library/net/http/http/finish_spec.rb29
-rw-r--r--spec/ruby/library/net/http/http/fixtures/http_server.rb105
-rw-r--r--spec/ruby/library/net/http/http/get2_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/get_print_spec.rb30
-rw-r--r--spec/ruby/library/net/http/http/get_response_spec.rb30
-rw-r--r--spec/ruby/library/net/http/http/get_spec.rb95
-rw-r--r--spec/ruby/library/net/http/http/head2_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/head_spec.rb25
-rw-r--r--spec/ruby/library/net/http/http/http_default_port_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/https_default_port_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/initialize_spec.rb46
-rw-r--r--spec/ruby/library/net/http/http/inspect_spec.rb24
-rw-r--r--spec/ruby/library/net/http/http/is_version_1_1_spec.rb7
-rw-r--r--spec/ruby/library/net/http/http/is_version_1_2_spec.rb7
-rw-r--r--spec/ruby/library/net/http/http/lock_spec.rb21
-rw-r--r--spec/ruby/library/net/http/http/mkcol_spec.rb21
-rw-r--r--spec/ruby/library/net/http/http/move_spec.rb25
-rw-r--r--spec/ruby/library/net/http/http/new_spec.rb86
-rw-r--r--spec/ruby/library/net/http/http/newobj_spec.rb48
-rw-r--r--spec/ruby/library/net/http/http/open_timeout_spec.rb24
-rw-r--r--spec/ruby/library/net/http/http/options_spec.rb25
-rw-r--r--spec/ruby/library/net/http/http/port_spec.rb9
-rw-r--r--spec/ruby/library/net/http/http/post2_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/post_form_spec.rb22
-rw-r--r--spec/ruby/library/net/http/http/post_spec.rb74
-rw-r--r--spec/ruby/library/net/http/http/propfind_spec.rb24
-rw-r--r--spec/ruby/library/net/http/http/proppatch_spec.rb24
-rw-r--r--spec/ruby/library/net/http/http/proxy_address_spec.rb31
-rw-r--r--spec/ruby/library/net/http/http/proxy_class_spec.rb9
-rw-r--r--spec/ruby/library/net/http/http/proxy_pass_spec.rb39
-rw-r--r--spec/ruby/library/net/http/http/proxy_port_spec.rb39
-rw-r--r--spec/ruby/library/net/http/http/proxy_user_spec.rb39
-rw-r--r--spec/ruby/library/net/http/http/put2_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/put_spec.rb24
-rw-r--r--spec/ruby/library/net/http/http/read_timeout_spec.rb24
-rw-r--r--spec/ruby/library/net/http/http/request_get_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/request_head_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/request_post_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/request_put_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/request_spec.rb109
-rw-r--r--spec/ruby/library/net/http/http/request_types_spec.rb254
-rw-r--r--spec/ruby/library/net/http/http/send_request_spec.rb61
-rw-r--r--spec/ruby/library/net/http/http/set_debug_output_spec.rb33
-rw-r--r--spec/ruby/library/net/http/http/shared/request_get.rb41
-rw-r--r--spec/ruby/library/net/http/http/shared/request_head.rb41
-rw-r--r--spec/ruby/library/net/http/http/shared/request_post.rb41
-rw-r--r--spec/ruby/library/net/http/http/shared/request_put.rb41
-rw-r--r--spec/ruby/library/net/http/http/shared/started.rb26
-rw-r--r--spec/ruby/library/net/http/http/shared/version_1_1.rb6
-rw-r--r--spec/ruby/library/net/http/http/shared/version_1_2.rb6
-rw-r--r--spec/ruby/library/net/http/http/socket_type_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/start_spec.rb111
-rw-r--r--spec/ruby/library/net/http/http/started_spec.rb8
-rw-r--r--spec/ruby/library/net/http/http/trace_spec.rb24
-rw-r--r--spec/ruby/library/net/http/http/unlock_spec.rb24
-rw-r--r--spec/ruby/library/net/http/http/use_ssl_spec.rb9
-rw-r--r--spec/ruby/library/net/http/http/version_1_1_spec.rb7
-rw-r--r--spec/ruby/library/net/http/http/version_1_2_spec.rb20
-rw-r--r--spec/ruby/library/net/http/httpexceptions/fixtures/classes.rb5
-rw-r--r--spec/ruby/library/net/http/httpexceptions/initialize_spec.rb17
-rw-r--r--spec/ruby/library/net/http/httpexceptions/response_spec.rb10
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/body_exist_spec.rb21
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/body_spec.rb30
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/body_stream_spec.rb32
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/exec_spec.rb131
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/inspect_spec.rb25
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/method_spec.rb15
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/path_spec.rb12
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/request_body_permitted_spec.rb12
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/response_body_permitted_spec.rb12
-rw-r--r--spec/ruby/library/net/http/httpgenericrequest/set_body_internal_spec.rb21
-rw-r--r--spec/ruby/library/net/http/httpheader/add_field_spec.rb31
-rw-r--r--spec/ruby/library/net/http/httpheader/basic_auth_spec.rb14
-rw-r--r--spec/ruby/library/net/http/httpheader/canonical_each_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/chunked_spec.rb22
-rw-r--r--spec/ruby/library/net/http/httpheader/content_length_spec.rb54
-rw-r--r--spec/ruby/library/net/http/httpheader/content_range_spec.rb32
-rw-r--r--spec/ruby/library/net/http/httpheader/content_type_spec.rb26
-rw-r--r--spec/ruby/library/net/http/httpheader/delete_spec.rb30
-rw-r--r--spec/ruby/library/net/http/httpheader/each_capitalized_name_spec.rb35
-rw-r--r--spec/ruby/library/net/http/httpheader/each_capitalized_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/each_header_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/each_key_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/each_name_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/each_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/each_value_spec.rb35
-rw-r--r--spec/ruby/library/net/http/httpheader/element_reference_spec.rb39
-rw-r--r--spec/ruby/library/net/http/httpheader/element_set_spec.rb41
-rw-r--r--spec/ruby/library/net/http/httpheader/fetch_spec.rb68
-rw-r--r--spec/ruby/library/net/http/httpheader/fixtures/classes.rb11
-rw-r--r--spec/ruby/library/net/http/httpheader/form_data_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/get_fields_spec.rb39
-rw-r--r--spec/ruby/library/net/http/httpheader/initialize_http_header_spec.rb21
-rw-r--r--spec/ruby/library/net/http/httpheader/key_spec.rb21
-rw-r--r--spec/ruby/library/net/http/httpheader/length_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/main_type_spec.rb24
-rw-r--r--spec/ruby/library/net/http/httpheader/proxy_basic_auth_spec.rb14
-rw-r--r--spec/ruby/library/net/http/httpheader/range_length_spec.rb32
-rw-r--r--spec/ruby/library/net/http/httpheader/range_spec.rb48
-rw-r--r--spec/ruby/library/net/http/httpheader/set_content_type_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/set_form_data_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/set_range_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/shared/each_capitalized.rb31
-rw-r--r--spec/ruby/library/net/http/httpheader/shared/each_header.rb31
-rw-r--r--spec/ruby/library/net/http/httpheader/shared/each_name.rb31
-rw-r--r--spec/ruby/library/net/http/httpheader/shared/set_content_type.rb18
-rw-r--r--spec/ruby/library/net/http/httpheader/shared/set_form_data.rb27
-rw-r--r--spec/ruby/library/net/http/httpheader/shared/set_range.rb89
-rw-r--r--spec/ruby/library/net/http/httpheader/shared/size.rb18
-rw-r--r--spec/ruby/library/net/http/httpheader/size_spec.rb8
-rw-r--r--spec/ruby/library/net/http/httpheader/sub_type_spec.rb32
-rw-r--r--spec/ruby/library/net/http/httpheader/to_hash_spec.rb25
-rw-r--r--spec/ruby/library/net/http/httpheader/type_params_spec.rb24
-rw-r--r--spec/ruby/library/net/http/httprequest/initialize_spec.rb45
-rw-r--r--spec/ruby/library/net/http/httpresponse/body_permitted_spec.rb13
-rw-r--r--spec/ruby/library/net/http/httpresponse/body_spec.rb7
-rw-r--r--spec/ruby/library/net/http/httpresponse/code_spec.rb24
-rw-r--r--spec/ruby/library/net/http/httpresponse/code_type_spec.rb24
-rw-r--r--spec/ruby/library/net/http/httpresponse/entity_spec.rb7
-rw-r--r--spec/ruby/library/net/http/httpresponse/error_spec.rb29
-rw-r--r--spec/ruby/library/net/http/httpresponse/error_type_spec.rb29
-rw-r--r--spec/ruby/library/net/http/httpresponse/exception_type_spec.rb18
-rw-r--r--spec/ruby/library/net/http/httpresponse/header_spec.rb9
-rw-r--r--spec/ruby/library/net/http/httpresponse/http_version_spec.rb12
-rw-r--r--spec/ruby/library/net/http/httpresponse/initialize_spec.rb11
-rw-r--r--spec/ruby/library/net/http/httpresponse/inspect_spec.rb15
-rw-r--r--spec/ruby/library/net/http/httpresponse/message_spec.rb9
-rw-r--r--spec/ruby/library/net/http/httpresponse/msg_spec.rb9
-rw-r--r--spec/ruby/library/net/http/httpresponse/read_body_spec.rb85
-rw-r--r--spec/ruby/library/net/http/httpresponse/read_header_spec.rb9
-rw-r--r--spec/ruby/library/net/http/httpresponse/read_new_spec.rb22
-rw-r--r--spec/ruby/library/net/http/httpresponse/reading_body_spec.rb58
-rw-r--r--spec/ruby/library/net/http/httpresponse/response_spec.rb9
-rw-r--r--spec/ruby/library/net/http/httpresponse/shared/body.rb18
-rw-r--r--spec/ruby/library/net/http/httpresponse/value_spec.rb29
-rw-r--r--spec/ruby/library/objectspace/memsize_of_spec.rb30
-rw-r--r--spec/ruby/library/objectspace/reachable_objects_from_spec.rb61
-rw-r--r--spec/ruby/library/observer/add_observer_spec.rb23
-rw-r--r--spec/ruby/library/observer/count_observers_spec.rb23
-rw-r--r--spec/ruby/library/observer/delete_observer_spec.rb19
-rw-r--r--spec/ruby/library/observer/delete_observers_spec.rb19
-rw-r--r--spec/ruby/library/observer/fixtures/classes.rb17
-rw-r--r--spec/ruby/library/observer/notify_observers_spec.rb31
-rw-r--r--spec/ruby/library/open3/capture2_spec.rb6
-rw-r--r--spec/ruby/library/open3/capture2e_spec.rb6
-rw-r--r--spec/ruby/library/open3/capture3_spec.rb6
-rw-r--r--spec/ruby/library/open3/pipeline_r_spec.rb6
-rw-r--r--spec/ruby/library/open3/pipeline_rw_spec.rb6
-rw-r--r--spec/ruby/library/open3/pipeline_spec.rb6
-rw-r--r--spec/ruby/library/open3/pipeline_start_spec.rb6
-rw-r--r--spec/ruby/library/open3/pipeline_w_spec.rb6
-rw-r--r--spec/ruby/library/open3/popen2_spec.rb6
-rw-r--r--spec/ruby/library/open3/popen2e_spec.rb6
-rw-r--r--spec/ruby/library/open3/popen3_spec.rb41
-rw-r--r--spec/ruby/library/openssl/cipher_spec.rb9
-rw-r--r--spec/ruby/library/openssl/config/freeze_spec.rb20
-rw-r--r--spec/ruby/library/openssl/hmac/digest_spec.rb16
-rw-r--r--spec/ruby/library/openssl/hmac/hexdigest_spec.rb16
-rw-r--r--spec/ruby/library/openssl/random/pseudo_bytes_spec.rb8
-rw-r--r--spec/ruby/library/openssl/random/random_bytes_spec.rb6
-rw-r--r--spec/ruby/library/openssl/random/shared/random_bytes.rb29
-rw-r--r--spec/ruby/library/openssl/shared/constants.rb11
-rw-r--r--spec/ruby/library/openssl/x509/name/parse_spec.rb48
-rw-r--r--spec/ruby/library/openstruct/delete_field_spec.rb19
-rw-r--r--spec/ruby/library/openstruct/element_reference_spec.rb13
-rw-r--r--spec/ruby/library/openstruct/element_set_spec.rb13
-rw-r--r--spec/ruby/library/openstruct/equal_value_spec.rb28
-rw-r--r--spec/ruby/library/openstruct/fixtures/classes.rb4
-rw-r--r--spec/ruby/library/openstruct/frozen_spec.rb38
-rw-r--r--spec/ruby/library/openstruct/initialize_spec.rb8
-rw-r--r--spec/ruby/library/openstruct/inspect_spec.rb8
-rw-r--r--spec/ruby/library/openstruct/marshal_dump_spec.rb9
-rw-r--r--spec/ruby/library/openstruct/marshal_load_spec.rb12
-rw-r--r--spec/ruby/library/openstruct/method_missing_spec.rb49
-rw-r--r--spec/ruby/library/openstruct/new_spec.rb20
-rw-r--r--spec/ruby/library/openstruct/shared/inspect.rb20
-rw-r--r--spec/ruby/library/openstruct/to_h_spec.rb70
-rw-r--r--spec/ruby/library/openstruct/to_s_spec.rb8
-rw-r--r--spec/ruby/library/optionparser/order_spec.rb28
-rw-r--r--spec/ruby/library/optionparser/parse_spec.rb28
-rw-r--r--spec/ruby/library/pathname/absolute_spec.rb22
-rw-r--r--spec/ruby/library/pathname/empty_spec.rb32
-rw-r--r--spec/ruby/library/pathname/equal_value_spec.rb14
-rw-r--r--spec/ruby/library/pathname/hash_spec.rb14
-rw-r--r--spec/ruby/library/pathname/join_spec.rb40
-rw-r--r--spec/ruby/library/pathname/new_spec.rb30
-rw-r--r--spec/ruby/library/pathname/parent_spec.rb18
-rw-r--r--spec/ruby/library/pathname/realdirpath_spec.rb10
-rw-r--r--spec/ruby/library/pathname/realpath_spec.rb10
-rw-r--r--spec/ruby/library/pathname/relative_path_from_spec.rb51
-rw-r--r--spec/ruby/library/pathname/relative_spec.rb22
-rw-r--r--spec/ruby/library/pathname/root_spec.rb26
-rw-r--r--spec/ruby/library/pathname/sub_spec.rb15
-rw-r--r--spec/ruby/library/pp/pp_spec.rb23
-rw-r--r--spec/ruby/library/prime/each_spec.rb167
-rw-r--r--spec/ruby/library/prime/instance_spec.rb21
-rw-r--r--spec/ruby/library/prime/int_from_prime_division_spec.rb13
-rw-r--r--spec/ruby/library/prime/integer/each_prime_spec.rb13
-rw-r--r--spec/ruby/library/prime/integer/from_prime_division_spec.rb13
-rw-r--r--spec/ruby/library/prime/integer/prime_division_spec.rb19
-rw-r--r--spec/ruby/library/prime/integer/prime_spec.rb17
-rw-r--r--spec/ruby/library/prime/next_spec.rb7
-rw-r--r--spec/ruby/library/prime/prime_division_spec.rb25
-rw-r--r--spec/ruby/library/prime/prime_spec.rb17
-rw-r--r--spec/ruby/library/prime/shared/next.rb8
-rw-r--r--spec/ruby/library/prime/succ_spec.rb7
-rw-r--r--spec/ruby/library/rbconfig/rbconfig_spec.rb48
-rw-r--r--spec/ruby/library/rbconfig/sizeof/limits_spec.rb42
-rw-r--r--spec/ruby/library/rbconfig/sizeof/sizeof_spec.rb30
-rw-r--r--spec/ruby/library/rbconfig/unicode_emoji_version_spec.rb22
-rw-r--r--spec/ruby/library/rbconfig/unicode_version_spec.rb34
-rw-r--r--spec/ruby/library/readline/basic_quote_characters_spec.rb18
-rw-r--r--spec/ruby/library/readline/basic_word_break_characters_spec.rb16
-rw-r--r--spec/ruby/library/readline/completer_quote_characters_spec.rb16
-rw-r--r--spec/ruby/library/readline/completer_word_break_characters_spec.rb16
-rw-r--r--spec/ruby/library/readline/completion_append_character_spec.rb16
-rw-r--r--spec/ruby/library/readline/completion_case_fold_spec.rb18
-rw-r--r--spec/ruby/library/readline/completion_proc_spec.rb22
-rw-r--r--spec/ruby/library/readline/constants_spec.rb18
-rw-r--r--spec/ruby/library/readline/emacs_editing_mode_spec.rb11
-rw-r--r--spec/ruby/library/readline/filename_quote_characters_spec.rb18
-rw-r--r--spec/ruby/library/readline/history/append_spec.rb28
-rw-r--r--spec/ruby/library/readline/history/delete_at_spec.rb47
-rw-r--r--spec/ruby/library/readline/history/each_spec.rb31
-rw-r--r--spec/ruby/library/readline/history/element_reference_spec.rb42
-rw-r--r--spec/ruby/library/readline/history/element_set_spec.rb35
-rw-r--r--spec/ruby/library/readline/history/empty_spec.rb13
-rw-r--r--spec/ruby/library/readline/history/history_spec.rb9
-rw-r--r--spec/ruby/library/readline/history/length_spec.rb9
-rw-r--r--spec/ruby/library/readline/history/pop_spec.rb32
-rw-r--r--spec/ruby/library/readline/history/push_spec.rb26
-rw-r--r--spec/ruby/library/readline/history/shared/size.rb14
-rw-r--r--spec/ruby/library/readline/history/shift_spec.rb32
-rw-r--r--spec/ruby/library/readline/history/size_spec.rb9
-rw-r--r--spec/ruby/library/readline/history/to_s_spec.rb9
-rw-r--r--spec/ruby/library/readline/readline_spec.rb33
-rw-r--r--spec/ruby/library/readline/spec_helper.rb11
-rw-r--r--spec/ruby/library/readline/vi_editing_mode_spec.rb11
-rw-r--r--spec/ruby/library/resolv/fixtures/hosts1
-rw-r--r--spec/ruby/library/resolv/get_address_spec.rb19
-rw-r--r--spec/ruby/library/resolv/get_addresses_spec.rb12
-rw-r--r--spec/ruby/library/resolv/get_name_spec.rb18
-rw-r--r--spec/ruby/library/resolv/get_names_spec.rb11
-rw-r--r--spec/ruby/library/rexml/attribute/clone_spec.rb11
-rw-r--r--spec/ruby/library/rexml/attribute/element_spec.rb23
-rw-r--r--spec/ruby/library/rexml/attribute/equal_value_spec.rb18
-rw-r--r--spec/ruby/library/rexml/attribute/hash_spec.rb13
-rw-r--r--spec/ruby/library/rexml/attribute/initialize_spec.rb29
-rw-r--r--spec/ruby/library/rexml/attribute/inspect_spec.rb19
-rw-r--r--spec/ruby/library/rexml/attribute/namespace_spec.rb24
-rw-r--r--spec/ruby/library/rexml/attribute/node_type_spec.rb10
-rw-r--r--spec/ruby/library/rexml/attribute/prefix_spec.rb18
-rw-r--r--spec/ruby/library/rexml/attribute/remove_spec.rb20
-rw-r--r--spec/ruby/library/rexml/attribute/to_s_spec.rb14
-rw-r--r--spec/ruby/library/rexml/attribute/to_string_spec.rb14
-rw-r--r--spec/ruby/library/rexml/attribute/value_spec.rb14
-rw-r--r--spec/ruby/library/rexml/attribute/write_spec.rb23
-rw-r--r--spec/ruby/library/rexml/attribute/xpath_spec.rb19
-rw-r--r--spec/ruby/library/rexml/attributes/add_spec.rb7
-rw-r--r--spec/ruby/library/rexml/attributes/append_spec.rb7
-rw-r--r--spec/ruby/library/rexml/attributes/delete_all_spec.rb31
-rw-r--r--spec/ruby/library/rexml/attributes/delete_spec.rb27
-rw-r--r--spec/ruby/library/rexml/attributes/each_attribute_spec.rb22
-rw-r--r--spec/ruby/library/rexml/attributes/each_spec.rb23
-rw-r--r--spec/ruby/library/rexml/attributes/element_reference_spec.rb18
-rw-r--r--spec/ruby/library/rexml/attributes/element_set_spec.rb25
-rw-r--r--spec/ruby/library/rexml/attributes/get_attribute_ns_spec.rb14
-rw-r--r--spec/ruby/library/rexml/attributes/get_attribute_spec.rb29
-rw-r--r--spec/ruby/library/rexml/attributes/initialize_spec.rb18
-rw-r--r--spec/ruby/library/rexml/attributes/length_spec.rb7
-rw-r--r--spec/ruby/library/rexml/attributes/namespaces_spec.rb6
-rw-r--r--spec/ruby/library/rexml/attributes/prefixes_spec.rb24
-rw-r--r--spec/ruby/library/rexml/attributes/shared/add.rb17
-rw-r--r--spec/ruby/library/rexml/attributes/shared/length.rb13
-rw-r--r--spec/ruby/library/rexml/attributes/size_spec.rb7
-rw-r--r--spec/ruby/library/rexml/attributes/to_a_spec.rb19
-rw-r--r--spec/ruby/library/rexml/cdata/clone_spec.rb10
-rw-r--r--spec/ruby/library/rexml/cdata/initialize_spec.rb24
-rw-r--r--spec/ruby/library/rexml/cdata/shared/to_s.rb11
-rw-r--r--spec/ruby/library/rexml/cdata/to_s_spec.rb7
-rw-r--r--spec/ruby/library/rexml/cdata/value_spec.rb7
-rw-r--r--spec/ruby/library/rexml/document/add_element_spec.rb31
-rw-r--r--spec/ruby/library/rexml/document/add_spec.rb57
-rw-r--r--spec/ruby/library/rexml/document/clone_spec.rb20
-rw-r--r--spec/ruby/library/rexml/document/doctype_spec.rb15
-rw-r--r--spec/ruby/library/rexml/document/encoding_spec.rb22
-rw-r--r--spec/ruby/library/rexml/document/expanded_name_spec.rb16
-rw-r--r--spec/ruby/library/rexml/document/new_spec.rb36
-rw-r--r--spec/ruby/library/rexml/document/node_type_spec.rb8
-rw-r--r--spec/ruby/library/rexml/document/root_spec.rb12
-rw-r--r--spec/ruby/library/rexml/document/stand_alone_spec.rb19
-rw-r--r--spec/ruby/library/rexml/document/version_spec.rb14
-rw-r--r--spec/ruby/library/rexml/document/write_spec.rb35
-rw-r--r--spec/ruby/library/rexml/document/xml_decl_spec.rb15
-rw-r--r--spec/ruby/library/rexml/element/add_attribute_spec.rb41
-rw-r--r--spec/ruby/library/rexml/element/add_attributes_spec.rb22
-rw-r--r--spec/ruby/library/rexml/element/add_element_spec.rb39
-rw-r--r--spec/ruby/library/rexml/element/add_namespace_spec.rb23
-rw-r--r--spec/ruby/library/rexml/element/add_text_spec.rb24
-rw-r--r--spec/ruby/library/rexml/element/attribute_spec.rb17
-rw-r--r--spec/ruby/library/rexml/element/attributes_spec.rb19
-rw-r--r--spec/ruby/library/rexml/element/cdatas_spec.rb24
-rw-r--r--spec/ruby/library/rexml/element/clone_spec.rb29
-rw-r--r--spec/ruby/library/rexml/element/comments_spec.rb20
-rw-r--r--spec/ruby/library/rexml/element/delete_attribute_spec.rb39
-rw-r--r--spec/ruby/library/rexml/element/delete_element_spec.rb49
-rw-r--r--spec/ruby/library/rexml/element/delete_namespace_spec.rb25
-rw-r--r--spec/ruby/library/rexml/element/document_spec.rb16
-rw-r--r--spec/ruby/library/rexml/element/each_element_with_attribute_spec.rb35
-rw-r--r--spec/ruby/library/rexml/element/each_element_with_text_spec.rb31
-rw-r--r--spec/ruby/library/rexml/element/element_reference_spec.rb20
-rw-r--r--spec/ruby/library/rexml/element/get_text_spec.rb18
-rw-r--r--spec/ruby/library/rexml/element/has_attributes_spec.rb17
-rw-r--r--spec/ruby/library/rexml/element/has_elements_spec.rb18
-rw-r--r--spec/ruby/library/rexml/element/has_text_spec.rb16
-rw-r--r--spec/ruby/library/rexml/element/inspect_spec.rb27
-rw-r--r--spec/ruby/library/rexml/element/instructions_spec.rb21
-rw-r--r--spec/ruby/library/rexml/element/namespace_spec.rb27
-rw-r--r--spec/ruby/library/rexml/element/namespaces_spec.rb32
-rw-r--r--spec/ruby/library/rexml/element/new_spec.rb35
-rw-r--r--spec/ruby/library/rexml/element/next_element_spec.rb19
-rw-r--r--spec/ruby/library/rexml/element/node_type_spec.rb8
-rw-r--r--spec/ruby/library/rexml/element/prefixes_spec.rb23
-rw-r--r--spec/ruby/library/rexml/element/previous_element_spec.rb20
-rw-r--r--spec/ruby/library/rexml/element/raw_spec.rb24
-rw-r--r--spec/ruby/library/rexml/element/root_spec.rb28
-rw-r--r--spec/ruby/library/rexml/element/text_spec.rb46
-rw-r--r--spec/ruby/library/rexml/element/texts_spec.rb16
-rw-r--r--spec/ruby/library/rexml/element/whitespace_spec.rb23
-rw-r--r--spec/ruby/library/rexml/node/each_recursive_spec.rb21
-rw-r--r--spec/ruby/library/rexml/node/find_first_recursive_spec.rb25
-rw-r--r--spec/ruby/library/rexml/node/index_in_parent_spec.rb15
-rw-r--r--spec/ruby/library/rexml/node/next_sibling_node_spec.rb21
-rw-r--r--spec/ruby/library/rexml/node/parent_spec.rb20
-rw-r--r--spec/ruby/library/rexml/node/previous_sibling_node_spec.rb21
-rw-r--r--spec/ruby/library/rexml/shared/each_element.rb36
-rw-r--r--spec/ruby/library/rexml/shared/elements_to_a.rb34
-rw-r--r--spec/ruby/library/rexml/text/append_spec.rb10
-rw-r--r--spec/ruby/library/rexml/text/clone_spec.rb10
-rw-r--r--spec/ruby/library/rexml/text/comparison_spec.rb25
-rw-r--r--spec/ruby/library/rexml/text/empty_spec.rb12
-rw-r--r--spec/ruby/library/rexml/text/indent_text_spec.rb23
-rw-r--r--spec/ruby/library/rexml/text/inspect_spec.rb8
-rw-r--r--spec/ruby/library/rexml/text/new_spec.rb48
-rw-r--r--spec/ruby/library/rexml/text/node_type_spec.rb8
-rw-r--r--spec/ruby/library/rexml/text/normalize_spec.rb8
-rw-r--r--spec/ruby/library/rexml/text/read_with_substitution_spec.rb12
-rw-r--r--spec/ruby/library/rexml/text/to_s_spec.rb17
-rw-r--r--spec/ruby/library/rexml/text/unnormalize_spec.rb8
-rw-r--r--spec/ruby/library/rexml/text/value_spec.rb37
-rw-r--r--spec/ruby/library/rexml/text/wrap_spec.rb20
-rw-r--r--spec/ruby/library/rexml/text/write_with_substitution_spec.rb33
-rw-r--r--spec/ruby/library/rubygems/gem/bin_path_spec.rb34
-rw-r--r--spec/ruby/library/scanf/io/block_scanf_spec.rb10
-rw-r--r--spec/ruby/library/scanf/io/fixtures/date.txt4
-rw-r--r--spec/ruby/library/scanf/io/fixtures/helloworld.txt1
-rw-r--r--spec/ruby/library/scanf/io/scanf_spec.rb38
-rw-r--r--spec/ruby/library/scanf/io/shared/block_scanf.rb28
-rw-r--r--spec/ruby/library/scanf/string/block_scanf_spec.rb10
-rw-r--r--spec/ruby/library/scanf/string/scanf_spec.rb56
-rw-r--r--spec/ruby/library/scanf/string/shared/block_scanf.rb25
-rw-r--r--spec/ruby/library/securerandom/base64_spec.rb55
-rw-r--r--spec/ruby/library/securerandom/bytes_spec.rb8
-rw-r--r--spec/ruby/library/securerandom/hex_spec.rb54
-rw-r--r--spec/ruby/library/securerandom/random_bytes_spec.rb53
-rw-r--r--spec/ruby/library/securerandom/random_number_spec.rb97
-rw-r--r--spec/ruby/library/set/add_spec.rb27
-rw-r--r--spec/ruby/library/set/append_spec.rb7
-rw-r--r--spec/ruby/library/set/case_compare_spec.rb14
-rw-r--r--spec/ruby/library/set/case_equality_spec.rb9
-rw-r--r--spec/ruby/library/set/classify_spec.rb27
-rw-r--r--spec/ruby/library/set/clear_spec.rb17
-rw-r--r--spec/ruby/library/set/collect_spec.rb7
-rw-r--r--spec/ruby/library/set/compare_by_identity_spec.rb143
-rw-r--r--spec/ruby/library/set/constructor_spec.rb15
-rw-r--r--spec/ruby/library/set/delete_if_spec.rb38
-rw-r--r--spec/ruby/library/set/delete_spec.rb37
-rw-r--r--spec/ruby/library/set/difference_spec.rb7
-rw-r--r--spec/ruby/library/set/disjoint_spec.rb23
-rw-r--r--spec/ruby/library/set/divide_spec.rb34
-rw-r--r--spec/ruby/library/set/each_spec.rb26
-rw-r--r--spec/ruby/library/set/empty_spec.rb10
-rw-r--r--spec/ruby/library/set/enumerable/to_set_spec.rb19
-rw-r--r--spec/ruby/library/set/eql_spec.rb15
-rw-r--r--spec/ruby/library/set/equal_value_spec.rb33
-rw-r--r--spec/ruby/library/set/exclusion_spec.rb18
-rw-r--r--spec/ruby/library/set/filter_spec.rb8
-rw-r--r--spec/ruby/library/set/fixtures/set_like.rb31
-rw-r--r--spec/ruby/library/set/flatten_merge_spec.rb23
-rw-r--r--spec/ruby/library/set/flatten_spec.rb53
-rw-r--r--spec/ruby/library/set/hash_spec.rb13
-rw-r--r--spec/ruby/library/set/include_spec.rb7
-rw-r--r--spec/ruby/library/set/initialize_spec.rb48
-rw-r--r--spec/ruby/library/set/inspect_spec.rb7
-rw-r--r--spec/ruby/library/set/intersect_spec.rb23
-rw-r--r--spec/ruby/library/set/intersection_spec.rb11
-rw-r--r--spec/ruby/library/set/keep_if_spec.rb38
-rw-r--r--spec/ruby/library/set/length_spec.rb7
-rw-r--r--spec/ruby/library/set/map_spec.rb7
-rw-r--r--spec/ruby/library/set/member_spec.rb7
-rw-r--r--spec/ruby/library/set/merge_spec.rb19
-rw-r--r--spec/ruby/library/set/minus_spec.rb7
-rw-r--r--spec/ruby/library/set/plus_spec.rb7
-rw-r--r--spec/ruby/library/set/pretty_print_cycle_spec.rb10
-rw-r--r--spec/ruby/library/set/pretty_print_spec.rb17
-rw-r--r--spec/ruby/library/set/proper_subset_spec.rb41
-rw-r--r--spec/ruby/library/set/proper_superset_spec.rb41
-rw-r--r--spec/ruby/library/set/reject_spec.rb42
-rw-r--r--spec/ruby/library/set/replace_spec.rb17
-rw-r--r--spec/ruby/library/set/select_spec.rb6
-rw-r--r--spec/ruby/library/set/shared/add.rb14
-rw-r--r--spec/ruby/library/set/shared/collect.rb20
-rw-r--r--spec/ruby/library/set/shared/difference.rb15
-rw-r--r--spec/ruby/library/set/shared/include.rb29
-rw-r--r--spec/ruby/library/set/shared/inspect.rb15
-rw-r--r--spec/ruby/library/set/shared/intersection.rb15
-rw-r--r--spec/ruby/library/set/shared/length.rb6
-rw-r--r--spec/ruby/library/set/shared/select.rb42
-rw-r--r--spec/ruby/library/set/shared/union.rb15
-rw-r--r--spec/ruby/library/set/size_spec.rb7
-rw-r--r--spec/ruby/library/set/sortedset/add_spec.rb39
-rw-r--r--spec/ruby/library/set/sortedset/append_spec.rb7
-rw-r--r--spec/ruby/library/set/sortedset/case_equality_spec.rb9
-rw-r--r--spec/ruby/library/set/sortedset/classify_spec.rb27
-rw-r--r--spec/ruby/library/set/sortedset/clear_spec.rb17
-rw-r--r--spec/ruby/library/set/sortedset/collect_spec.rb7
-rw-r--r--spec/ruby/library/set/sortedset/constructor_spec.rb15
-rw-r--r--spec/ruby/library/set/sortedset/delete_if_spec.rb38
-rw-r--r--spec/ruby/library/set/sortedset/delete_spec.rb37
-rw-r--r--spec/ruby/library/set/sortedset/difference_spec.rb7
-rw-r--r--spec/ruby/library/set/sortedset/divide_spec.rb34
-rw-r--r--spec/ruby/library/set/sortedset/each_spec.rb26
-rw-r--r--spec/ruby/library/set/sortedset/empty_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/eql_spec.rb16
-rw-r--r--spec/ruby/library/set/sortedset/equal_value_spec.rb13
-rw-r--r--spec/ruby/library/set/sortedset/exclusion_spec.rb18
-rw-r--r--spec/ruby/library/set/sortedset/filter_spec.rb9
-rw-r--r--spec/ruby/library/set/sortedset/flatten_merge_spec.rb8
-rw-r--r--spec/ruby/library/set/sortedset/flatten_spec.rb44
-rw-r--r--spec/ruby/library/set/sortedset/hash_spec.rb13
-rw-r--r--spec/ruby/library/set/sortedset/include_spec.rb7
-rw-r--r--spec/ruby/library/set/sortedset/initialize_spec.rb30
-rw-r--r--spec/ruby/library/set/sortedset/inspect_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/intersection_spec.rb11
-rw-r--r--spec/ruby/library/set/sortedset/keep_if_spec.rb31
-rw-r--r--spec/ruby/library/set/sortedset/length_spec.rb7
-rw-r--r--spec/ruby/library/set/sortedset/map_spec.rb7
-rw-r--r--spec/ruby/library/set/sortedset/member_spec.rb7
-rw-r--r--spec/ruby/library/set/sortedset/merge_spec.rb19
-rw-r--r--spec/ruby/library/set/sortedset/minus_spec.rb7
-rw-r--r--spec/ruby/library/set/sortedset/plus_spec.rb7
-rw-r--r--spec/ruby/library/set/sortedset/pretty_print_cycle_spec.rb10
-rw-r--r--spec/ruby/library/set/sortedset/pretty_print_spec.rb17
-rw-r--r--spec/ruby/library/set/sortedset/proper_subset_spec.rb33
-rw-r--r--spec/ruby/library/set/sortedset/proper_superset_spec.rb33
-rw-r--r--spec/ruby/library/set/sortedset/reject_spec.rb42
-rw-r--r--spec/ruby/library/set/sortedset/replace_spec.rb17
-rw-r--r--spec/ruby/library/set/sortedset/select_spec.rb7
-rw-r--r--spec/ruby/library/set/sortedset/shared/add.rb14
-rw-r--r--spec/ruby/library/set/sortedset/shared/collect.rb20
-rw-r--r--spec/ruby/library/set/sortedset/shared/difference.rb15
-rw-r--r--spec/ruby/library/set/sortedset/shared/include.rb7
-rw-r--r--spec/ruby/library/set/sortedset/shared/intersection.rb15
-rw-r--r--spec/ruby/library/set/sortedset/shared/length.rb6
-rw-r--r--spec/ruby/library/set/sortedset/shared/select.rb35
-rw-r--r--spec/ruby/library/set/sortedset/shared/union.rb15
-rw-r--r--spec/ruby/library/set/sortedset/size_spec.rb7
-rw-r--r--spec/ruby/library/set/sortedset/subset_spec.rb33
-rw-r--r--spec/ruby/library/set/sortedset/subtract_spec.rb17
-rw-r--r--spec/ruby/library/set/sortedset/superset_spec.rb33
-rw-r--r--spec/ruby/library/set/sortedset/to_a_spec.rb17
-rw-r--r--spec/ruby/library/set/sortedset/union_spec.rb11
-rw-r--r--spec/ruby/library/set/subset_spec.rb41
-rw-r--r--spec/ruby/library/set/subtract_spec.rb17
-rw-r--r--spec/ruby/library/set/superset_spec.rb41
-rw-r--r--spec/ruby/library/set/to_a_spec.rb8
-rw-r--r--spec/ruby/library/set/to_s_spec.rb13
-rw-r--r--spec/ruby/library/set/union_spec.rb11
-rw-r--r--spec/ruby/library/shellwords/shellwords_spec.rb34
-rw-r--r--spec/ruby/library/singleton/allocate_spec.rb8
-rw-r--r--spec/ruby/library/singleton/clone_spec.rb8
-rw-r--r--spec/ruby/library/singleton/dump_spec.rb14
-rw-r--r--spec/ruby/library/singleton/dup_spec.rb8
-rw-r--r--spec/ruby/library/singleton/fixtures/classes.rb18
-rw-r--r--spec/ruby/library/singleton/instance_spec.rb30
-rw-r--r--spec/ruby/library/singleton/load_spec.rb21
-rw-r--r--spec/ruby/library/singleton/new_spec.rb8
-rw-r--r--spec/ruby/library/socket/addrinfo/afamily_spec.rb37
-rw-r--r--spec/ruby/library/socket/addrinfo/bind_spec.rb28
-rw-r--r--spec/ruby/library/socket/addrinfo/canonname_spec.rb27
-rw-r--r--spec/ruby/library/socket/addrinfo/connect_from_spec.rb75
-rw-r--r--spec/ruby/library/socket/addrinfo/connect_spec.rb35
-rw-r--r--spec/ruby/library/socket/addrinfo/connect_to_spec.rb75
-rw-r--r--spec/ruby/library/socket/addrinfo/family_addrinfo_spec.rb115
-rw-r--r--spec/ruby/library/socket/addrinfo/foreach_spec.rb9
-rw-r--r--spec/ruby/library/socket/addrinfo/getaddrinfo_spec.rb91
-rw-r--r--spec/ruby/library/socket/addrinfo/getnameinfo_spec.rb40
-rw-r--r--spec/ruby/library/socket/addrinfo/initialize_spec.rb587
-rw-r--r--spec/ruby/library/socket/addrinfo/inspect_sockaddr_spec.rb50
-rw-r--r--spec/ruby/library/socket/addrinfo/inspect_spec.rb65
-rw-r--r--spec/ruby/library/socket/addrinfo/ip_address_spec.rb66
-rw-r--r--spec/ruby/library/socket/addrinfo/ip_port_spec.rb35
-rw-r--r--spec/ruby/library/socket/addrinfo/ip_spec.rb64
-rw-r--r--spec/ruby/library/socket/addrinfo/ip_unpack_spec.rb35
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv4_loopback_spec.rb43
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv4_multicast_spec.rb29
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv4_private_spec.rb47
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv4_spec.rb35
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_linklocal_spec.rb23
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_loopback_spec.rb45
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_mc_global_spec.rb20
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_mc_linklocal_spec.rb19
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_mc_nodelocal_spec.rb18
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_mc_orglocal_spec.rb18
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_mc_sitelocal_spec.rb18
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_multicast_spec.rb48
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_sitelocal_spec.rb23
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_spec.rb35
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_to_ipv4_spec.rb71
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_unique_local_spec.rb18
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_unspecified_spec.rb15
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_v4compat_spec.rb20
-rw-r--r--spec/ruby/library/socket/addrinfo/ipv6_v4mapped_spec.rb20
-rw-r--r--spec/ruby/library/socket/addrinfo/listen_spec.rb34
-rw-r--r--spec/ruby/library/socket/addrinfo/marshal_dump_spec.rb84
-rw-r--r--spec/ruby/library/socket/addrinfo/marshal_load_spec.rb35
-rw-r--r--spec/ruby/library/socket/addrinfo/pfamily_spec.rb43
-rw-r--r--spec/ruby/library/socket/addrinfo/protocol_spec.rb24
-rw-r--r--spec/ruby/library/socket/addrinfo/shared/to_sockaddr.rb51
-rw-r--r--spec/ruby/library/socket/addrinfo/socktype_spec.rb23
-rw-r--r--spec/ruby/library/socket/addrinfo/tcp_spec.rb34
-rw-r--r--spec/ruby/library/socket/addrinfo/to_s_spec.rb6
-rw-r--r--spec/ruby/library/socket/addrinfo/to_sockaddr_spec.rb6
-rw-r--r--spec/ruby/library/socket/addrinfo/udp_spec.rb36
-rw-r--r--spec/ruby/library/socket/addrinfo/unix_path_spec.rb37
-rw-r--r--spec/ruby/library/socket/addrinfo/unix_spec.rb71
-rw-r--r--spec/ruby/library/socket/ancillarydata/cmsg_is_spec.rb33
-rw-r--r--spec/ruby/library/socket/ancillarydata/data_spec.rb9
-rw-r--r--spec/ruby/library/socket/ancillarydata/family_spec.rb9
-rw-r--r--spec/ruby/library/socket/ancillarydata/initialize_spec.rb284
-rw-r--r--spec/ruby/library/socket/ancillarydata/int_spec.rb43
-rw-r--r--spec/ruby/library/socket/ancillarydata/ip_pktinfo_spec.rb145
-rw-r--r--spec/ruby/library/socket/ancillarydata/ipv6_pktinfo_addr_spec.rb11
-rw-r--r--spec/ruby/library/socket/ancillarydata/ipv6_pktinfo_ifindex_spec.rb11
-rw-r--r--spec/ruby/library/socket/ancillarydata/ipv6_pktinfo_spec.rb89
-rw-r--r--spec/ruby/library/socket/ancillarydata/level_spec.rb9
-rw-r--r--spec/ruby/library/socket/ancillarydata/type_spec.rb9
-rw-r--r--spec/ruby/library/socket/ancillarydata/unix_rights_spec.rb61
-rw-r--r--spec/ruby/library/socket/basicsocket/close_read_spec.rb43
-rw-r--r--spec/ruby/library/socket/basicsocket/close_write_spec.rb48
-rw-r--r--spec/ruby/library/socket/basicsocket/connect_address_spec.rb154
-rw-r--r--spec/ruby/library/socket/basicsocket/do_not_reverse_lookup_spec.rb103
-rw-r--r--spec/ruby/library/socket/basicsocket/for_fd_spec.rb38
-rw-r--r--spec/ruby/library/socket/basicsocket/getpeereid_spec.rb36
-rw-r--r--spec/ruby/library/socket/basicsocket/getpeername_spec.rb25
-rw-r--r--spec/ruby/library/socket/basicsocket/getsockname_spec.rb28
-rw-r--r--spec/ruby/library/socket/basicsocket/getsockopt_spec.rb188
-rw-r--r--spec/ruby/library/socket/basicsocket/ioctl_spec.rb42
-rw-r--r--spec/ruby/library/socket/basicsocket/read_nonblock_spec.rb46
-rw-r--r--spec/ruby/library/socket/basicsocket/recv_nonblock_spec.rb70
-rw-r--r--spec/ruby/library/socket/basicsocket/recv_spec.rb159
-rw-r--r--spec/ruby/library/socket/basicsocket/recvmsg_nonblock_spec.rb209
-rw-r--r--spec/ruby/library/socket/basicsocket/recvmsg_spec.rb197
-rw-r--r--spec/ruby/library/socket/basicsocket/send_spec.rb212
-rw-r--r--spec/ruby/library/socket/basicsocket/sendmsg_nonblock_spec.rb113
-rw-r--r--spec/ruby/library/socket/basicsocket/sendmsg_spec.rb111
-rw-r--r--spec/ruby/library/socket/basicsocket/setsockopt_spec.rb336
-rw-r--r--spec/ruby/library/socket/basicsocket/shutdown_spec.rb155
-rw-r--r--spec/ruby/library/socket/basicsocket/write_nonblock_spec.rb45
-rw-r--r--spec/ruby/library/socket/constants/constants_spec.rb108
-rw-r--r--spec/ruby/library/socket/fixtures/classes.rb164
-rw-r--r--spec/ruby/library/socket/fixtures/send_io.txt1
-rw-r--r--spec/ruby/library/socket/ipsocket/addr_spec.rb105
-rw-r--r--spec/ruby/library/socket/ipsocket/getaddress_spec.rb25
-rw-r--r--spec/ruby/library/socket/ipsocket/peeraddr_spec.rb117
-rw-r--r--spec/ruby/library/socket/ipsocket/recvfrom_spec.rb123
-rw-r--r--spec/ruby/library/socket/option/bool_spec.rb27
-rw-r--r--spec/ruby/library/socket/option/initialize_spec.rb83
-rw-r--r--spec/ruby/library/socket/option/inspect_spec.rb19
-rw-r--r--spec/ruby/library/socket/option/int_spec.rb43
-rw-r--r--spec/ruby/library/socket/option/linger_spec.rb76
-rw-r--r--spec/ruby/library/socket/option/new_spec.rb35
-rw-r--r--spec/ruby/library/socket/shared/pack_sockaddr.rb99
-rw-r--r--spec/ruby/library/socket/shared/partially_closable_sockets.rb13
-rw-r--r--spec/ruby/library/socket/shared/socketpair.rb138
-rw-r--r--spec/ruby/library/socket/socket/accept_loop_spec.rb84
-rw-r--r--spec/ruby/library/socket/socket/accept_nonblock_spec.rb138
-rw-r--r--spec/ruby/library/socket/socket/accept_spec.rb121
-rw-r--r--spec/ruby/library/socket/socket/bind_spec.rb146
-rw-r--r--spec/ruby/library/socket/socket/connect_nonblock_spec.rb149
-rw-r--r--spec/ruby/library/socket/socket/connect_spec.rb56
-rw-r--r--spec/ruby/library/socket/socket/for_fd_spec.rb30
-rw-r--r--spec/ruby/library/socket/socket/getaddrinfo_spec.rb373
-rw-r--r--spec/ruby/library/socket/socket/gethostbyaddr_spec.rb124
-rw-r--r--spec/ruby/library/socket/socket/gethostbyname_spec.rb135
-rw-r--r--spec/ruby/library/socket/socket/gethostname_spec.rb8
-rw-r--r--spec/ruby/library/socket/socket/getifaddrs_spec.rb117
-rw-r--r--spec/ruby/library/socket/socket/getnameinfo_spec.rb147
-rw-r--r--spec/ruby/library/socket/socket/getservbyname_spec.rb32
-rw-r--r--spec/ruby/library/socket/socket/getservbyport_spec.rb23
-rw-r--r--spec/ruby/library/socket/socket/initialize_spec.rb87
-rw-r--r--spec/ruby/library/socket/socket/ip_address_list_spec.rb50
-rw-r--r--spec/ruby/library/socket/socket/ipv6only_bang_spec.rb20
-rw-r--r--spec/ruby/library/socket/socket/listen_spec.rb64
-rw-r--r--spec/ruby/library/socket/socket/local_address_spec.rb43
-rw-r--r--spec/ruby/library/socket/socket/new_spec.rb2
-rw-r--r--spec/ruby/library/socket/socket/pack_sockaddr_in_spec.rb7
-rw-r--r--spec/ruby/library/socket/socket/pack_sockaddr_un_spec.rb7
-rw-r--r--spec/ruby/library/socket/socket/pair_spec.rb7
-rw-r--r--spec/ruby/library/socket/socket/recvfrom_nonblock_spec.rb118
-rw-r--r--spec/ruby/library/socket/socket/recvfrom_spec.rb92
-rw-r--r--spec/ruby/library/socket/socket/remote_address_spec.rb54
-rw-r--r--spec/ruby/library/socket/socket/sockaddr_in_spec.rb7
-rw-r--r--spec/ruby/library/socket/socket/sockaddr_un_spec.rb7
-rw-r--r--spec/ruby/library/socket/socket/socket_spec.rb38
-rw-r--r--spec/ruby/library/socket/socket/socketpair_spec.rb7
-rw-r--r--spec/ruby/library/socket/socket/sysaccept_spec.rb91
-rw-r--r--spec/ruby/library/socket/socket/tcp_server_loop_spec.rb54
-rw-r--r--spec/ruby/library/socket/socket/tcp_server_sockets_spec.rb39
-rw-r--r--spec/ruby/library/socket/socket/tcp_spec.rb70
-rw-r--r--spec/ruby/library/socket/socket/udp_server_loop_on_spec.rb47
-rw-r--r--spec/ruby/library/socket/socket/udp_server_loop_spec.rb57
-rw-r--r--spec/ruby/library/socket/socket/udp_server_recv_spec.rb35
-rw-r--r--spec/ruby/library/socket/socket/udp_server_sockets_spec.rb39
-rw-r--r--spec/ruby/library/socket/socket/unix_server_loop_spec.rb58
-rw-r--r--spec/ruby/library/socket/socket/unix_server_socket_spec.rb48
-rw-r--r--spec/ruby/library/socket/socket/unix_spec.rb45
-rw-r--r--spec/ruby/library/socket/socket/unpack_sockaddr_in_spec.rb46
-rw-r--r--spec/ruby/library/socket/socket/unpack_sockaddr_un_spec.rb26
-rw-r--r--spec/ruby/library/socket/spec_helper.rb13
-rw-r--r--spec/ruby/library/socket/tcpserver/accept_nonblock_spec.rb85
-rw-r--r--spec/ruby/library/socket/tcpserver/accept_spec.rb99
-rw-r--r--spec/ruby/library/socket/tcpserver/gets_spec.rb16
-rw-r--r--spec/ruby/library/socket/tcpserver/initialize_spec.rb101
-rw-r--r--spec/ruby/library/socket/tcpserver/listen_spec.rb22
-rw-r--r--spec/ruby/library/socket/tcpserver/new_spec.rb131
-rw-r--r--spec/ruby/library/socket/tcpserver/sysaccept_spec.rb66
-rw-r--r--spec/ruby/library/socket/tcpsocket/gethostbyname_spec.rb111
-rw-r--r--spec/ruby/library/socket/tcpsocket/initialize_spec.rb61
-rw-r--r--spec/ruby/library/socket/tcpsocket/local_address_spec.rb73
-rw-r--r--spec/ruby/library/socket/tcpsocket/new_spec.rb5
-rw-r--r--spec/ruby/library/socket/tcpsocket/open_spec.rb5
-rw-r--r--spec/ruby/library/socket/tcpsocket/partially_closable_spec.rb21
-rw-r--r--spec/ruby/library/socket/tcpsocket/recv_nonblock_spec.rb34
-rw-r--r--spec/ruby/library/socket/tcpsocket/recv_spec.rb28
-rw-r--r--spec/ruby/library/socket/tcpsocket/remote_address_spec.rb72
-rw-r--r--spec/ruby/library/socket/tcpsocket/setsockopt_spec.rb45
-rw-r--r--spec/ruby/library/socket/tcpsocket/shared/new.rb79
-rw-r--r--spec/ruby/library/socket/udpsocket/bind_spec.rb83
-rw-r--r--spec/ruby/library/socket/udpsocket/connect_spec.rb35
-rw-r--r--spec/ruby/library/socket/udpsocket/initialize_spec.rb40
-rw-r--r--spec/ruby/library/socket/udpsocket/inspect_spec.rb25
-rw-r--r--spec/ruby/library/socket/udpsocket/local_address_spec.rb80
-rw-r--r--spec/ruby/library/socket/udpsocket/new_spec.rb34
-rw-r--r--spec/ruby/library/socket/udpsocket/open_spec.rb13
-rw-r--r--spec/ruby/library/socket/udpsocket/recvfrom_nonblock_spec.rb95
-rw-r--r--spec/ruby/library/socket/udpsocket/remote_address_spec.rb79
-rw-r--r--spec/ruby/library/socket/udpsocket/send_spec.rb154
-rw-r--r--spec/ruby/library/socket/udpsocket/write_spec.rb21
-rw-r--r--spec/ruby/library/socket/unixserver/accept_nonblock_spec.rb92
-rw-r--r--spec/ruby/library/socket/unixserver/accept_spec.rb117
-rw-r--r--spec/ruby/library/socket/unixserver/for_fd_spec.rb23
-rw-r--r--spec/ruby/library/socket/unixserver/initialize_spec.rb28
-rw-r--r--spec/ruby/library/socket/unixserver/listen_spec.rb21
-rw-r--r--spec/ruby/library/socket/unixserver/new_spec.rb6
-rw-r--r--spec/ruby/library/socket/unixserver/open_spec.rb26
-rw-r--r--spec/ruby/library/socket/unixserver/shared/new.rb22
-rw-r--r--spec/ruby/library/socket/unixserver/sysaccept_spec.rb52
-rw-r--r--spec/ruby/library/socket/unixsocket/addr_spec.rb36
-rw-r--r--spec/ruby/library/socket/unixsocket/initialize_spec.rb38
-rw-r--r--spec/ruby/library/socket/unixsocket/inspect_spec.rb17
-rw-r--r--spec/ruby/library/socket/unixsocket/local_address_spec.rb96
-rw-r--r--spec/ruby/library/socket/unixsocket/new_spec.rb6
-rw-r--r--spec/ruby/library/socket/unixsocket/open_spec.rb28
-rw-r--r--spec/ruby/library/socket/unixsocket/pair_spec.rb39
-rw-r--r--spec/ruby/library/socket/unixsocket/partially_closable_spec.rb25
-rw-r--r--spec/ruby/library/socket/unixsocket/path_spec.rb28
-rw-r--r--spec/ruby/library/socket/unixsocket/peeraddr_spec.rb30
-rw-r--r--spec/ruby/library/socket/unixsocket/recv_io_spec.rb87
-rw-r--r--spec/ruby/library/socket/unixsocket/recvfrom_spec.rb98
-rw-r--r--spec/ruby/library/socket/unixsocket/remote_address_spec.rb45
-rw-r--r--spec/ruby/library/socket/unixsocket/send_io_spec.rb58
-rw-r--r--spec/ruby/library/socket/unixsocket/shared/new.rb24
-rw-r--r--spec/ruby/library/socket/unixsocket/socketpair_spec.rb40
-rw-r--r--spec/ruby/library/stringio/append_spec.rb86
-rw-r--r--spec/ruby/library/stringio/binmode_spec.rb9
-rw-r--r--spec/ruby/library/stringio/bytes_spec.rb11
-rw-r--r--spec/ruby/library/stringio/chars_spec.rb11
-rw-r--r--spec/ruby/library/stringio/close_read_spec.rb31
-rw-r--r--spec/ruby/library/stringio/close_spec.rb23
-rw-r--r--spec/ruby/library/stringio/close_write_spec.rb31
-rw-r--r--spec/ruby/library/stringio/closed_read_spec.rb12
-rw-r--r--spec/ruby/library/stringio/closed_spec.rb16
-rw-r--r--spec/ruby/library/stringio/closed_write_spec.rb12
-rw-r--r--spec/ruby/library/stringio/codepoints_spec.rb9
-rw-r--r--spec/ruby/library/stringio/each_byte_spec.rb11
-rw-r--r--spec/ruby/library/stringio/each_char_spec.rb11
-rw-r--r--spec/ruby/library/stringio/each_codepoint_spec.rb9
-rw-r--r--spec/ruby/library/stringio/each_line_spec.rb19
-rw-r--r--spec/ruby/library/stringio/each_spec.rb19
-rw-r--r--spec/ruby/library/stringio/eof_spec.rb11
-rw-r--r--spec/ruby/library/stringio/external_encoding_spec.rb25
-rw-r--r--spec/ruby/library/stringio/fcntl_spec.rb8
-rw-r--r--spec/ruby/library/stringio/fileno_spec.rb9
-rw-r--r--spec/ruby/library/stringio/fixtures/classes.rb15
-rw-r--r--spec/ruby/library/stringio/flush_spec.rb9
-rw-r--r--spec/ruby/library/stringio/fsync_spec.rb9
-rw-r--r--spec/ruby/library/stringio/getbyte_spec.rb19
-rw-r--r--spec/ruby/library/stringio/getc_spec.rb19
-rw-r--r--spec/ruby/library/stringio/getch_spec.rb44
-rw-r--r--spec/ruby/library/stringio/gets_spec.rb245
-rw-r--r--spec/ruby/library/stringio/initialize_spec.rb212
-rw-r--r--spec/ruby/library/stringio/internal_encoding_spec.rb10
-rw-r--r--spec/ruby/library/stringio/isatty_spec.rb7
-rw-r--r--spec/ruby/library/stringio/length_spec.rb7
-rw-r--r--spec/ruby/library/stringio/lineno_spec.rb30
-rw-r--r--spec/ruby/library/stringio/lines_spec.rb19
-rw-r--r--spec/ruby/library/stringio/open_spec.rb207
-rw-r--r--spec/ruby/library/stringio/path_spec.rb8
-rw-r--r--spec/ruby/library/stringio/pid_spec.rb8
-rw-r--r--spec/ruby/library/stringio/pos_spec.rb28
-rw-r--r--spec/ruby/library/stringio/print_spec.rb100
-rw-r--r--spec/ruby/library/stringio/printf_spec.rb70
-rw-r--r--spec/ruby/library/stringio/putc_spec.rb88
-rw-r--r--spec/ruby/library/stringio/puts_spec.rb167
-rw-r--r--spec/ruby/library/stringio/read_nonblock_spec.rb42
-rw-r--r--spec/ruby/library/stringio/read_spec.rb62
-rw-r--r--spec/ruby/library/stringio/readbyte_spec.rb20
-rw-r--r--spec/ruby/library/stringio/readchar_spec.rb20
-rw-r--r--spec/ruby/library/stringio/readline_spec.rb129
-rw-r--r--spec/ruby/library/stringio/readlines_spec.rb99
-rw-r--r--spec/ruby/library/stringio/readpartial_spec.rb80
-rw-r--r--spec/ruby/library/stringio/reopen_spec.rb292
-rw-r--r--spec/ruby/library/stringio/rewind_spec.rb24
-rw-r--r--spec/ruby/library/stringio/seek_spec.rb67
-rw-r--r--spec/ruby/library/stringio/set_encoding_spec.rb20
-rw-r--r--spec/ruby/library/stringio/shared/codepoints.rb45
-rw-r--r--spec/ruby/library/stringio/shared/each.rb114
-rw-r--r--spec/ruby/library/stringio/shared/each_byte.rb48
-rw-r--r--spec/ruby/library/stringio/shared/each_char.rb36
-rw-r--r--spec/ruby/library/stringio/shared/eof.rb24
-rw-r--r--spec/ruby/library/stringio/shared/getc.rb43
-rw-r--r--spec/ruby/library/stringio/shared/isatty.rb5
-rw-r--r--spec/ruby/library/stringio/shared/length.rb5
-rw-r--r--spec/ruby/library/stringio/shared/read.rb121
-rw-r--r--spec/ruby/library/stringio/shared/readchar.rb29
-rw-r--r--spec/ruby/library/stringio/shared/sysread.rb15
-rw-r--r--spec/ruby/library/stringio/shared/tell.rb12
-rw-r--r--spec/ruby/library/stringio/shared/write.rb89
-rw-r--r--spec/ruby/library/stringio/size_spec.rb7
-rw-r--r--spec/ruby/library/stringio/string_spec.rb50
-rw-r--r--spec/ruby/library/stringio/stringio_spec.rb8
-rw-r--r--spec/ruby/library/stringio/sync_spec.rb19
-rw-r--r--spec/ruby/library/stringio/sysread_spec.rb48
-rw-r--r--spec/ruby/library/stringio/syswrite_spec.rb19
-rw-r--r--spec/ruby/library/stringio/tell_spec.rb7
-rw-r--r--spec/ruby/library/stringio/truncate_spec.rb70
-rw-r--r--spec/ruby/library/stringio/tty_spec.rb7
-rw-r--r--spec/ruby/library/stringio/ungetbyte_spec.rb6
-rw-r--r--spec/ruby/library/stringio/ungetc_spec.rb72
-rw-r--r--spec/ruby/library/stringio/write_nonblock_spec.rb19
-rw-r--r--spec/ruby/library/stringio/write_spec.rb19
-rw-r--r--spec/ruby/library/stringscanner/append_spec.rb11
-rw-r--r--spec/ruby/library/stringscanner/beginning_of_line_spec.rb7
-rw-r--r--spec/ruby/library/stringscanner/bol_spec.rb7
-rw-r--r--spec/ruby/library/stringscanner/check_spec.rb16
-rw-r--r--spec/ruby/library/stringscanner/check_until_spec.rb15
-rw-r--r--spec/ruby/library/stringscanner/clear_spec.rb18
-rw-r--r--spec/ruby/library/stringscanner/concat_spec.rb11
-rw-r--r--spec/ruby/library/stringscanner/dup_spec.rb39
-rw-r--r--spec/ruby/library/stringscanner/element_reference_spec.rb60
-rw-r--r--spec/ruby/library/stringscanner/empty_spec.rb18
-rw-r--r--spec/ruby/library/stringscanner/eos_spec.rb7
-rw-r--r--spec/ruby/library/stringscanner/exist_spec.rb24
-rw-r--r--spec/ruby/library/stringscanner/get_byte_spec.rb7
-rw-r--r--spec/ruby/library/stringscanner/getbyte_spec.rb21
-rw-r--r--spec/ruby/library/stringscanner/getch_spec.rb35
-rw-r--r--spec/ruby/library/stringscanner/initialize_spec.rb27
-rw-r--r--spec/ruby/library/stringscanner/inspect_spec.rb20
-rw-r--r--spec/ruby/library/stringscanner/match_spec.rb28
-rw-r--r--spec/ruby/library/stringscanner/matched_size_spec.rb7
-rw-r--r--spec/ruby/library/stringscanner/matched_spec.rb41
-rw-r--r--spec/ruby/library/stringscanner/must_C_version_spec.rb8
-rw-r--r--spec/ruby/library/stringscanner/peek_spec.rb7
-rw-r--r--spec/ruby/library/stringscanner/peep_spec.rb18
-rw-r--r--spec/ruby/library/stringscanner/pointer_spec.rb11
-rw-r--r--spec/ruby/library/stringscanner/pos_spec.rb11
-rw-r--r--spec/ruby/library/stringscanner/post_match_spec.rb28
-rw-r--r--spec/ruby/library/stringscanner/pre_match_spec.rb41
-rw-r--r--spec/ruby/library/stringscanner/reset_spec.rb15
-rw-r--r--spec/ruby/library/stringscanner/rest_size_spec.rb7
-rw-r--r--spec/ruby/library/stringscanner/rest_spec.rb48
-rw-r--r--spec/ruby/library/stringscanner/restsize_spec.rb18
-rw-r--r--spec/ruby/library/stringscanner/scan_full_spec.rb30
-rw-r--r--spec/ruby/library/stringscanner/scan_spec.rb97
-rw-r--r--spec/ruby/library/stringscanner/scan_until_spec.rb23
-rw-r--r--spec/ruby/library/stringscanner/search_full_spec.rb30
-rw-r--r--spec/ruby/library/stringscanner/shared/bol.rb25
-rw-r--r--spec/ruby/library/stringscanner/shared/concat.rb30
-rw-r--r--spec/ruby/library/stringscanner/shared/eos.rb17
-rw-r--r--spec/ruby/library/stringscanner/shared/extract_range.rb24
-rw-r--r--spec/ruby/library/stringscanner/shared/extract_range_matched.rb24
-rw-r--r--spec/ruby/library/stringscanner/shared/get_byte.rb29
-rw-r--r--spec/ruby/library/stringscanner/shared/matched_size.rb21
-rw-r--r--spec/ruby/library/stringscanner/shared/peek.rb49
-rw-r--r--spec/ruby/library/stringscanner/shared/pos.rb52
-rw-r--r--spec/ruby/library/stringscanner/shared/rest_size.rb18
-rw-r--r--spec/ruby/library/stringscanner/shared/terminate.rb8
-rw-r--r--spec/ruby/library/stringscanner/skip_spec.rb18
-rw-r--r--spec/ruby/library/stringscanner/skip_until_spec.rb18
-rw-r--r--spec/ruby/library/stringscanner/string_spec.rb40
-rw-r--r--spec/ruby/library/stringscanner/terminate_spec.rb7
-rw-r--r--spec/ruby/library/stringscanner/unscan_spec.rb28
-rw-r--r--spec/ruby/library/syslog/alert_spec.rb10
-rw-r--r--spec/ruby/library/syslog/close_spec.rb58
-rw-r--r--spec/ruby/library/syslog/constants_spec.rb41
-rw-r--r--spec/ruby/library/syslog/crit_spec.rb10
-rw-r--r--spec/ruby/library/syslog/debug_spec.rb10
-rw-r--r--spec/ruby/library/syslog/emerg_spec.rb16
-rw-r--r--spec/ruby/library/syslog/err_spec.rb10
-rw-r--r--spec/ruby/library/syslog/facility_spec.rb48
-rw-r--r--spec/ruby/library/syslog/ident_spec.rb35
-rw-r--r--spec/ruby/library/syslog/info_spec.rb10
-rw-r--r--spec/ruby/library/syslog/inspect_spec.rb39
-rw-r--r--spec/ruby/library/syslog/instance_spec.rb13
-rw-r--r--spec/ruby/library/syslog/log_spec.rb56
-rw-r--r--spec/ruby/library/syslog/mask_spec.rb113
-rw-r--r--spec/ruby/library/syslog/notice_spec.rb10
-rw-r--r--spec/ruby/library/syslog/open_spec.rb92
-rw-r--r--spec/ruby/library/syslog/opened_spec.rb39
-rw-r--r--spec/ruby/library/syslog/options_spec.rb48
-rw-r--r--spec/ruby/library/syslog/reopen_spec.rb10
-rw-r--r--spec/ruby/library/syslog/shared/log.rb39
-rw-r--r--spec/ruby/library/syslog/shared/reopen.rb40
-rw-r--r--spec/ruby/library/syslog/warning_spec.rb10
-rw-r--r--spec/ruby/library/tempfile/_close_spec.rb21
-rw-r--r--spec/ruby/library/tempfile/callback_spec.rb6
-rw-r--r--spec/ruby/library/tempfile/close_spec.rb57
-rw-r--r--spec/ruby/library/tempfile/delete_spec.rb7
-rw-r--r--spec/ruby/library/tempfile/initialize_spec.rb46
-rw-r--r--spec/ruby/library/tempfile/length_spec.rb7
-rw-r--r--spec/ruby/library/tempfile/open_spec.rb97
-rw-r--r--spec/ruby/library/tempfile/path_spec.rb26
-rw-r--r--spec/ruby/library/tempfile/shared/length.rb21
-rw-r--r--spec/ruby/library/tempfile/shared/unlink.rb12
-rw-r--r--spec/ruby/library/tempfile/size_spec.rb7
-rw-r--r--spec/ruby/library/tempfile/unlink_spec.rb7
-rw-r--r--spec/ruby/library/thread/queue_spec.rb8
-rw-r--r--spec/ruby/library/thread/sizedqueue_spec.rb8
-rw-r--r--spec/ruby/library/time/httpdate_spec.rb21
-rw-r--r--spec/ruby/library/time/iso8601_spec.rb7
-rw-r--r--spec/ruby/library/time/rfc2822_spec.rb7
-rw-r--r--spec/ruby/library/time/rfc822_spec.rb7
-rw-r--r--spec/ruby/library/time/shared/rfc2822.rb65
-rw-r--r--spec/ruby/library/time/shared/xmlschema.rb53
-rw-r--r--spec/ruby/library/time/to_date_spec.rb42
-rw-r--r--spec/ruby/library/time/to_datetime_spec.rb27
-rw-r--r--spec/ruby/library/time/to_time_spec.rb15
-rw-r--r--spec/ruby/library/time/xmlschema_spec.rb7
-rw-r--r--spec/ruby/library/timeout/error_spec.rb8
-rw-r--r--spec/ruby/library/timeout/timeout_spec.rb26
-rw-r--r--spec/ruby/library/tmpdir/dir/mktmpdir_spec.rb117
-rw-r--r--spec/ruby/library/tmpdir/dir/tmpdir_spec.rb10
-rw-r--r--spec/ruby/library/uri/decode_www_form_component_spec.rb6
-rw-r--r--spec/ruby/library/uri/decode_www_form_spec.rb6
-rw-r--r--spec/ruby/library/uri/encode_www_form_component_spec.rb6
-rw-r--r--spec/ruby/library/uri/encode_www_form_spec.rb6
-rw-r--r--spec/ruby/library/uri/eql_spec.rb10
-rw-r--r--spec/ruby/library/uri/equality_spec.rb46
-rw-r--r--spec/ruby/library/uri/escape/decode_spec.rb6
-rw-r--r--spec/ruby/library/uri/escape/encode_spec.rb6
-rw-r--r--spec/ruby/library/uri/escape/escape_spec.rb6
-rw-r--r--spec/ruby/library/uri/escape/unescape_spec.rb6
-rw-r--r--spec/ruby/library/uri/extract_spec.rb86
-rw-r--r--spec/ruby/library/uri/fixtures/classes.rb11
-rw-r--r--spec/ruby/library/uri/fixtures/normalization.rb54
-rw-r--r--spec/ruby/library/uri/ftp/build_spec.rb6
-rw-r--r--spec/ruby/library/uri/ftp/merge_spec.rb6
-rw-r--r--spec/ruby/library/uri/ftp/new2_spec.rb6
-rw-r--r--spec/ruby/library/uri/ftp/path_spec.rb26
-rw-r--r--spec/ruby/library/uri/ftp/set_typecode_spec.rb6
-rw-r--r--spec/ruby/library/uri/ftp/to_s_spec.rb15
-rw-r--r--spec/ruby/library/uri/ftp/typecode_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/absolute_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/build2_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/build_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/coerce_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/component_ary_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/component_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/default_port_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/eql_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/equal_value_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/fragment_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/hash_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/hierarchical_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/host_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/inspect_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/merge_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/minus_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/normalize_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/opaque_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/password_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/path_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/plus_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/port_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/query_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/registry_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/relative_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/route_from_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/route_to_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/scheme_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/select_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_fragment_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_host_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_opaque_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_password_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_path_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_port_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_query_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_registry_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_scheme_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_user_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/set_userinfo_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/to_s_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/use_registry_spec.rb6
-rw-r--r--spec/ruby/library/uri/generic/user_spec.rb10
-rw-r--r--spec/ruby/library/uri/generic/userinfo_spec.rb10
-rw-r--r--spec/ruby/library/uri/http/build_spec.rb6
-rw-r--r--spec/ruby/library/uri/http/request_uri_spec.rb16
-rw-r--r--spec/ruby/library/uri/join_spec.rb59
-rw-r--r--spec/ruby/library/uri/ldap/attributes_spec.rb10
-rw-r--r--spec/ruby/library/uri/ldap/build_spec.rb6
-rw-r--r--spec/ruby/library/uri/ldap/dn_spec.rb10
-rw-r--r--spec/ruby/library/uri/ldap/extensions_spec.rb10
-rw-r--r--spec/ruby/library/uri/ldap/filter_spec.rb10
-rw-r--r--spec/ruby/library/uri/ldap/hierarchical_spec.rb6
-rw-r--r--spec/ruby/library/uri/ldap/scope_spec.rb10
-rw-r--r--spec/ruby/library/uri/ldap/set_attributes_spec.rb6
-rw-r--r--spec/ruby/library/uri/ldap/set_dn_spec.rb6
-rw-r--r--spec/ruby/library/uri/ldap/set_extensions_spec.rb6
-rw-r--r--spec/ruby/library/uri/ldap/set_filter_spec.rb6
-rw-r--r--spec/ruby/library/uri/ldap/set_scope_spec.rb6
-rw-r--r--spec/ruby/library/uri/mailto/build_spec.rb92
-rw-r--r--spec/ruby/library/uri/mailto/headers_spec.rb10
-rw-r--r--spec/ruby/library/uri/mailto/set_headers_spec.rb6
-rw-r--r--spec/ruby/library/uri/mailto/set_to_spec.rb6
-rw-r--r--spec/ruby/library/uri/mailto/to_mailtext_spec.rb6
-rw-r--r--spec/ruby/library/uri/mailto/to_rfc822text_spec.rb6
-rw-r--r--spec/ruby/library/uri/mailto/to_s_spec.rb6
-rw-r--r--spec/ruby/library/uri/mailto/to_spec.rb10
-rw-r--r--spec/ruby/library/uri/merge_spec.rb20
-rw-r--r--spec/ruby/library/uri/normalize_spec.rb35
-rw-r--r--spec/ruby/library/uri/parse_spec.rb203
-rw-r--r--spec/ruby/library/uri/parser/escape_spec.rb6
-rw-r--r--spec/ruby/library/uri/parser/extract_spec.rb7
-rw-r--r--spec/ruby/library/uri/parser/inspect_spec.rb6
-rw-r--r--spec/ruby/library/uri/parser/join_spec.rb7
-rw-r--r--spec/ruby/library/uri/parser/make_regexp_spec.rb6
-rw-r--r--spec/ruby/library/uri/parser/parse_spec.rb7
-rw-r--r--spec/ruby/library/uri/parser/split_spec.rb6
-rw-r--r--spec/ruby/library/uri/parser/unescape_spec.rb6
-rw-r--r--spec/ruby/library/uri/plus_spec.rb459
-rw-r--r--spec/ruby/library/uri/regexp_spec.rb18
-rw-r--r--spec/ruby/library/uri/route_from_spec.rb23
-rw-r--r--spec/ruby/library/uri/route_to_spec.rb26
-rw-r--r--spec/ruby/library/uri/select_spec.rb27
-rw-r--r--spec/ruby/library/uri/set_component_spec.rb45
-rw-r--r--spec/ruby/library/uri/shared/eql.rb17
-rw-r--r--spec/ruby/library/uri/shared/extract.rb83
-rw-r--r--spec/ruby/library/uri/shared/join.rb56
-rw-r--r--spec/ruby/library/uri/shared/parse.rb199
-rw-r--r--spec/ruby/library/uri/split_spec.rb6
-rw-r--r--spec/ruby/library/uri/uri_spec.rb29
-rw-r--r--spec/ruby/library/uri/util/make_components_hash_spec.rb6
-rw-r--r--spec/ruby/library/weakref/__getobj___spec.rb17
-rw-r--r--spec/ruby/library/weakref/allocate_spec.rb8
-rw-r--r--spec/ruby/library/weakref/fixtures/classes.rb24
-rw-r--r--spec/ruby/library/weakref/new_spec.rb13
-rw-r--r--spec/ruby/library/weakref/send_spec.rb37
-rw-r--r--spec/ruby/library/weakref/weakref_alive_spec.rb15
-rw-r--r--spec/ruby/library/win32ole/fixtures/classes.rb22
-rw-r--r--spec/ruby/library/win32ole/fixtures/event.xml4
-rw-r--r--spec/ruby/library/win32ole/win32ole/_getproperty_spec.rb14
-rw-r--r--spec/ruby/library/win32ole/win32ole/_invoke_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole/codepage_spec.rb13
-rw-r--r--spec/ruby/library/win32ole/win32ole/connect_spec.rb15
-rw-r--r--spec/ruby/library/win32ole/win32ole/const_load_spec.rb32
-rw-r--r--spec/ruby/library/win32ole/win32ole/constants_spec.rb42
-rw-r--r--spec/ruby/library/win32ole/win32ole/create_guid_spec.rb9
-rw-r--r--spec/ruby/library/win32ole/win32ole/invoke_spec.rb14
-rw-r--r--spec/ruby/library/win32ole/win32ole/locale_spec.rb29
-rw-r--r--spec/ruby/library/win32ole/win32ole/new_spec.rb25
-rw-r--r--spec/ruby/library/win32ole/win32ole/ole_func_methods_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole/ole_get_methods_spec.rb16
-rw-r--r--spec/ruby/library/win32ole/win32ole/ole_method_help_spec.rb10
-rw-r--r--spec/ruby/library/win32ole/win32ole/ole_method_spec.rb10
-rw-r--r--spec/ruby/library/win32ole/win32ole/ole_methods_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole/ole_obj_help_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole/ole_put_methods_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole/setproperty_spec.rb10
-rw-r--r--spec/ruby/library/win32ole/win32ole/shared/ole_method.rb19
-rw-r--r--spec/ruby/library/win32ole/win32ole/shared/setproperty.rb23
-rw-r--r--spec/ruby/library/win32ole/win32ole_event/new_spec.rb33
-rw-r--r--spec/ruby/library/win32ole/win32ole_event/on_event_spec.rb70
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/dispid_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/event_interface_spec.rb28
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/event_spec.rb22
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/helpcontext_spec.rb26
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/helpfile_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/helpstring_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/invkind_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/invoke_kind_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/name_spec.rb11
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/new_spec.rb33
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/offset_vtbl_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/params_spec.rb28
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/return_type_detail_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/return_type_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/return_vtype_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/shared/name.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/size_opt_params_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/size_params_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/to_s_spec.rb11
-rw-r--r--spec/ruby/library/win32ole/win32ole_method/visible_spec.rb20
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/default_spec.rb31
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/input_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/name_spec.rb11
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/ole_type_detail_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/ole_type_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/optional_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/retval_spec.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/shared/name.rb21
-rw-r--r--spec/ruby/library/win32ole/win32ole_param/to_s_spec.rb11
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/guid_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/helpcontext_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/helpfile_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/helpstring_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/major_version_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/minor_version_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/name_spec.rb11
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/new_spec.rb40
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/ole_classes_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/ole_methods_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/ole_type_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/progid_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/progids_spec.rb14
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/shared/name.rb19
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/src_type_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/to_s_spec.rb11
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/typekind_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/typelibs_spec.rb22
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/variables_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_type/visible_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/name_spec.rb11
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/ole_type_detail_spec.rb19
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/ole_type_spec.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/shared/name.rb18
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/to_s_spec.rb11
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/value_spec.rb19
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/variable_kind_spec.rb19
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/varkind_spec.rb19
-rw-r--r--spec/ruby/library/win32ole/win32ole_variable/visible_spec.rb18
-rw-r--r--spec/ruby/library/yaml/add_builtin_type_spec.rb2
-rw-r--r--spec/ruby/library/yaml/add_domain_type_spec.rb2
-rw-r--r--spec/ruby/library/yaml/add_private_type_spec.rb2
-rw-r--r--spec/ruby/library/yaml/add_ruby_type_spec.rb2
-rw-r--r--spec/ruby/library/yaml/detect_implicit_spec.rb2
-rw-r--r--spec/ruby/library/yaml/dump_spec.rb51
-rw-r--r--spec/ruby/library/yaml/dump_stream_spec.rb8
-rw-r--r--spec/ruby/library/yaml/each_node_spec.rb2
-rw-r--r--spec/ruby/library/yaml/emitter_spec.rb2
-rw-r--r--spec/ruby/library/yaml/fixtures/common.rb10
-rw-r--r--spec/ruby/library/yaml/fixtures/example_class.rb7
-rw-r--r--spec/ruby/library/yaml/fixtures/strings.rb36
-rw-r--r--spec/ruby/library/yaml/fixtures/test_yaml.yml2
-rw-r--r--spec/ruby/library/yaml/generic_parser_spec.rb2
-rw-r--r--spec/ruby/library/yaml/load_documents_spec.rb10
-rw-r--r--spec/ruby/library/yaml/load_file_spec.rb13
-rw-r--r--spec/ruby/library/yaml/load_spec.rb137
-rw-r--r--spec/ruby/library/yaml/load_stream_spec.rb8
-rw-r--r--spec/ruby/library/yaml/object_maker_spec.rb2
-rw-r--r--spec/ruby/library/yaml/parse_documents_spec.rb2
-rw-r--r--spec/ruby/library/yaml/parse_file_spec.rb8
-rw-r--r--spec/ruby/library/yaml/parse_spec.rb22
-rw-r--r--spec/ruby/library/yaml/parser_spec.rb2
-rw-r--r--spec/ruby/library/yaml/quick_emit_spec.rb2
-rw-r--r--spec/ruby/library/yaml/read_type_class_spec.rb2
-rw-r--r--spec/ruby/library/yaml/shared/each_document.rb18
-rw-r--r--spec/ruby/library/yaml/tagurize_spec.rb11
-rw-r--r--spec/ruby/library/yaml/to_yaml_spec.rb106
-rw-r--r--spec/ruby/library/yaml/transfer_spec.rb2
-rw-r--r--spec/ruby/library/yaml/try_implicit_spec.rb2
-rw-r--r--spec/ruby/library/zlib/adler32_spec.rb46
-rw-r--r--spec/ruby/library/zlib/crc32_spec.rb54
-rw-r--r--spec/ruby/library/zlib/crc_table_spec.rb75
-rw-r--r--spec/ruby/library/zlib/deflate/deflate_spec.rb128
-rw-r--r--spec/ruby/library/zlib/deflate/new_spec.rb1
-rw-r--r--spec/ruby/library/zlib/deflate/params_spec.rb17
-rw-r--r--spec/ruby/library/zlib/deflate/set_dictionary_spec.rb14
-rw-r--r--spec/ruby/library/zlib/deflate_spec.rb8
-rw-r--r--spec/ruby/library/zlib/gunzip_spec.rb14
-rw-r--r--spec/ruby/library/zlib/gzip_spec.rb15
-rw-r--r--spec/ruby/library/zlib/gzipfile/close_spec.rb21
-rw-r--r--spec/ruby/library/zlib/gzipfile/closed_spec.rb16
-rw-r--r--spec/ruby/library/zlib/gzipfile/comment_spec.rb26
-rw-r--r--spec/ruby/library/zlib/gzipfile/orig_name_spec.rb26
-rw-r--r--spec/ruby/library/zlib/gzipreader/each_byte_spec.rb51
-rw-r--r--spec/ruby/library/zlib/gzipreader/each_line_spec.rb5
-rw-r--r--spec/ruby/library/zlib/gzipreader/each_spec.rb5
-rw-r--r--spec/ruby/library/zlib/gzipreader/eof_spec.rb54
-rw-r--r--spec/ruby/library/zlib/gzipreader/getc_spec.rb39
-rw-r--r--spec/ruby/library/zlib/gzipreader/gets_spec.rb22
-rw-r--r--spec/ruby/library/zlib/gzipreader/new_spec.rb1
-rw-r--r--spec/ruby/library/zlib/gzipreader/pos_spec.rb24
-rw-r--r--spec/ruby/library/zlib/gzipreader/read_spec.rb66
-rw-r--r--spec/ruby/library/zlib/gzipreader/readpartial_spec.rb17
-rw-r--r--spec/ruby/library/zlib/gzipreader/rewind_spec.rb47
-rw-r--r--spec/ruby/library/zlib/gzipreader/shared/each.rb49
-rw-r--r--spec/ruby/library/zlib/gzipreader/ungetbyte_spec.rb120
-rw-r--r--spec/ruby/library/zlib/gzipreader/ungetc_spec.rb284
-rw-r--r--spec/ruby/library/zlib/gzipwriter/append_spec.rb15
-rw-r--r--spec/ruby/library/zlib/gzipwriter/mtime_spec.rb38
-rw-r--r--spec/ruby/library/zlib/gzipwriter/write_spec.rb36
-rw-r--r--spec/ruby/library/zlib/inflate/append_spec.rb60
-rw-r--r--spec/ruby/library/zlib/inflate/finish_spec.rb28
-rw-r--r--spec/ruby/library/zlib/inflate/inflate_spec.rb152
-rw-r--r--spec/ruby/library/zlib/inflate/new_spec.rb1
-rw-r--r--spec/ruby/library/zlib/inflate/set_dictionary_spec.rb20
-rw-r--r--spec/ruby/library/zlib/inflate_spec.rb8
-rw-r--r--spec/ruby/library/zlib/zlib_version_spec.rb8
-rw-r--r--spec/ruby/library/zlib/zstream/adler_spec.rb11
-rw-r--r--spec/ruby/library/zlib/zstream/avail_in_spec.rb9
-rw-r--r--spec/ruby/library/zlib/zstream/avail_out_spec.rb9
-rw-r--r--spec/ruby/library/zlib/zstream/data_type_spec.rb9
-rw-r--r--spec/ruby/library/zlib/zstream/flush_next_out_spec.rb14
-rw-r--r--spec/ruby/optional/capi/README16
-rw-r--r--spec/ruby/optional/capi/array_spec.rb471
-rw-r--r--spec/ruby/optional/capi/bignum_spec.rb224
-rw-r--r--spec/ruby/optional/capi/boolean_spec.rb33
-rw-r--r--spec/ruby/optional/capi/class_spec.rb384
-rw-r--r--spec/ruby/optional/capi/complex_spec.rb45
-rw-r--r--spec/ruby/optional/capi/constants_spec.rb258
-rw-r--r--spec/ruby/optional/capi/data_spec.rb45
-rw-r--r--spec/ruby/optional/capi/encoding_spec.rb482
-rw-r--r--spec/ruby/optional/capi/enumerator_spec.rb66
-rw-r--r--spec/ruby/optional/capi/exception_spec.rb58
-rw-r--r--spec/ruby/optional/capi/ext/.gitignore9
-rw-r--r--spec/ruby/optional/capi/ext/array_spec.c285
-rw-r--r--spec/ruby/optional/capi/ext/bignum_spec.c106
-rw-r--r--spec/ruby/optional/capi/ext/boolean_spec.c33
-rw-r--r--spec/ruby/optional/capi/ext/class_id_under_autoload_spec.c5
-rw-r--r--spec/ruby/optional/capi/ext/class_spec.c170
-rw-r--r--spec/ruby/optional/capi/ext/class_under_autoload_spec.c5
-rw-r--r--spec/ruby/optional/capi/ext/complex_spec.c45
-rw-r--r--spec/ruby/optional/capi/ext/constants_spec.c339
-rw-r--r--spec/ruby/optional/capi/ext/data_spec.c83
-rw-r--r--spec/ruby/optional/capi/ext/encoding_spec.c249
-rw-r--r--spec/ruby/optional/capi/ext/enumerator_spec.c32
-rw-r--r--spec/ruby/optional/capi/ext/exception_spec.c46
-rw-r--r--spec/ruby/optional/capi/ext/file_spec.c29
-rw-r--r--spec/ruby/optional/capi/ext/fixnum_spec.c26
-rw-r--r--spec/ruby/optional/capi/ext/float_spec.c38
-rw-r--r--spec/ruby/optional/capi/ext/gc_spec.c55
-rw-r--r--spec/ruby/optional/capi/ext/globals_spec.c118
-rw-r--r--spec/ruby/optional/capi/ext/hash_spec.c143
-rw-r--r--spec/ruby/optional/capi/ext/integer_spec.c34
-rw-r--r--spec/ruby/optional/capi/ext/io_spec.c242
-rw-r--r--spec/ruby/optional/capi/ext/kernel_spec.c350
-rw-r--r--spec/ruby/optional/capi/ext/marshal_spec.c24
-rw-r--r--spec/ruby/optional/capi/ext/module_spec.c155
-rw-r--r--spec/ruby/optional/capi/ext/module_under_autoload_spec.c7
-rw-r--r--spec/ruby/optional/capi/ext/mutex_spec.c55
-rw-r--r--spec/ruby/optional/capi/ext/numeric_spec.c125
-rw-r--r--spec/ruby/optional/capi/ext/object_spec.c419
-rw-r--r--spec/ruby/optional/capi/ext/proc_spec.c68
-rw-r--r--spec/ruby/optional/capi/ext/range_spec.c50
-rw-r--r--spec/ruby/optional/capi/ext/rational_spec.c54
-rw-r--r--spec/ruby/optional/capi/ext/regexp_spec.c53
-rw-r--r--spec/ruby/optional/capi/ext/rubyspec.h34
-rw-r--r--spec/ruby/optional/capi/ext/st_spec.c83
-rw-r--r--spec/ruby/optional/capi/ext/string_spec.c507
-rw-r--r--spec/ruby/optional/capi/ext/struct_spec.c89
-rw-r--r--spec/ruby/optional/capi/ext/symbol_spec.c90
-rw-r--r--spec/ruby/optional/capi/ext/thread_spec.c148
-rw-r--r--spec/ruby/optional/capi/ext/time_spec.c81
-rw-r--r--spec/ruby/optional/capi/ext/typed_data_spec.c167
-rw-r--r--spec/ruby/optional/capi/ext/util_spec.c108
-rw-r--r--spec/ruby/optional/capi/file_spec.rb89
-rw-r--r--spec/ruby/optional/capi/fixnum_spec.rb101
-rw-r--r--spec/ruby/optional/capi/fixtures/class.rb91
-rw-r--r--spec/ruby/optional/capi/fixtures/const_get.rb5
-rw-r--r--spec/ruby/optional/capi/fixtures/const_get_at.rb5
-rw-r--r--spec/ruby/optional/capi/fixtures/const_get_from.rb5
-rw-r--r--spec/ruby/optional/capi/fixtures/const_get_object.rb3
-rw-r--r--spec/ruby/optional/capi/fixtures/encoding.rb3
-rw-r--r--spec/ruby/optional/capi/fixtures/foo.rb1
-rw-r--r--spec/ruby/optional/capi/fixtures/module.rb35
-rw-r--r--spec/ruby/optional/capi/fixtures/module_autoload.rb4
-rw-r--r--spec/ruby/optional/capi/fixtures/path_to_class.rb6
-rw-r--r--spec/ruby/optional/capi/fixtures/proc.rb20
-rw-r--r--spec/ruby/optional/capi/float_spec.rb30
-rw-r--r--spec/ruby/optional/capi/gc_spec.rb61
-rw-r--r--spec/ruby/optional/capi/globals_spec.rb224
-rw-r--r--spec/ruby/optional/capi/hash_spec.rb257
-rw-r--r--spec/ruby/optional/capi/integer_spec.rb275
-rw-r--r--spec/ruby/optional/capi/io_spec.rb367
-rw-r--r--spec/ruby/optional/capi/kernel_spec.rb599
-rw-r--r--spec/ruby/optional/capi/marshal_spec.rb46
-rw-r--r--spec/ruby/optional/capi/module_spec.rb378
-rw-r--r--spec/ruby/optional/capi/mutex_spec.rb89
-rw-r--r--spec/ruby/optional/capi/numeric_spec.rb485
-rw-r--r--spec/ruby/optional/capi/object_spec.rb890
-rw-r--r--spec/ruby/optional/capi/proc_spec.rb116
-rw-r--r--spec/ruby/optional/capi/rake_helper.rb22
-rw-r--r--spec/ruby/optional/capi/range_spec.rb95
-rw-r--r--spec/ruby/optional/capi/rational_spec.rb57
-rw-r--r--spec/ruby/optional/capi/regexp_spec.rb71
-rw-r--r--spec/ruby/optional/capi/spec_helper.rb132
-rw-r--r--spec/ruby/optional/capi/st_spec.rb41
-rw-r--r--spec/ruby/optional/capi/string_spec.rb1034
-rw-r--r--spec/ruby/optional/capi/struct_spec.rb211
-rw-r--r--spec/ruby/optional/capi/symbol_spec.rb133
-rw-r--r--spec/ruby/optional/capi/thread_spec.rb145
-rw-r--r--spec/ruby/optional/capi/time_spec.rb300
-rw-r--r--spec/ruby/optional/capi/typed_data_spec.rb60
-rw-r--r--spec/ruby/optional/capi/util_spec.rb263
-rw-r--r--spec/ruby/security/cve_2010_1330_spec.rb21
-rw-r--r--spec/ruby/security/cve_2011_4815_spec.rb47
-rw-r--r--spec/ruby/security/cve_2013_4164_spec.rb19
-rw-r--r--spec/ruby/security/cve_2014_8080_spec.rb32
-rw-r--r--spec/ruby/security/cve_2017_17742_spec.rb34
-rw-r--r--spec/ruby/security/cve_2018_16396_spec.rb25
-rw-r--r--spec/ruby/security/cve_2018_6914_spec.rb55
-rw-r--r--spec/ruby/security/cve_2018_8778_spec.rb12
-rw-r--r--spec/ruby/security/cve_2018_8779_spec.rb30
-rw-r--r--spec/ruby/security/cve_2018_8780_spec.rb45
-rw-r--r--spec/ruby/security/cve_2019_8321_spec.rb22
-rw-r--r--spec/ruby/security/cve_2019_8322_spec.rb23
-rw-r--r--spec/ruby/security/cve_2019_8323_spec.rb38
-rw-r--r--spec/ruby/security/cve_2019_8325_spec.rb38
-rw-r--r--spec/ruby/shared/basicobject/method_missing.rb124
-rw-r--r--spec/ruby/shared/basicobject/send.rb128
-rw-r--r--spec/ruby/shared/enumerator/enum_for.rb50
-rw-r--r--spec/ruby/shared/enumerator/with_index.rb33
-rw-r--r--spec/ruby/shared/enumerator/with_object.rb42
-rw-r--r--spec/ruby/shared/fiber/resume.rb79
-rw-r--r--spec/ruby/shared/file/blockdev.rb9
-rw-r--r--spec/ruby/shared/file/chardev.rb9
-rw-r--r--spec/ruby/shared/file/directory.rb66
-rw-r--r--spec/ruby/shared/file/executable.rb48
-rw-r--r--spec/ruby/shared/file/executable_real.rb46
-rw-r--r--spec/ruby/shared/file/exist.rb24
-rw-r--r--spec/ruby/shared/file/file.rb45
-rw-r--r--spec/ruby/shared/file/grpowned.rb39
-rw-r--r--spec/ruby/shared/file/identical.rb47
-rw-r--r--spec/ruby/shared/file/owned.rb3
-rw-r--r--spec/ruby/shared/file/pipe.rb3
-rw-r--r--spec/ruby/shared/file/readable.rb30
-rw-r--r--spec/ruby/shared/file/readable_real.rb23
-rw-r--r--spec/ruby/shared/file/setgid.rb2
-rw-r--r--spec/ruby/shared/file/setuid.rb2
-rw-r--r--spec/ruby/shared/file/size.rb124
-rw-r--r--spec/ruby/shared/file/socket.rb3
-rw-r--r--spec/ruby/shared/file/sticky.rb29
-rw-r--r--spec/ruby/shared/file/symlink.rb46
-rw-r--r--spec/ruby/shared/file/world_readable.rb49
-rw-r--r--spec/ruby/shared/file/world_writable.rb49
-rw-r--r--spec/ruby/shared/file/writable.rb28
-rw-r--r--spec/ruby/shared/file/writable_real.rb33
-rw-r--r--spec/ruby/shared/file/zero.rb68
-rw-r--r--spec/ruby/shared/hash/key_error.rb25
-rw-r--r--spec/ruby/shared/io/putc.rb57
-rw-r--r--spec/ruby/shared/kernel/equal.rb54
-rw-r--r--spec/ruby/shared/kernel/object_id.rb80
-rw-r--r--spec/ruby/shared/kernel/raise.rb85
-rw-r--r--spec/ruby/shared/math/atanh.rb44
-rw-r--r--spec/ruby/shared/process/abort.rb36
-rw-r--r--spec/ruby/shared/process/exit.rb94
-rw-r--r--spec/ruby/shared/process/fork.rb90
-rw-r--r--spec/ruby/shared/queue/clear.rb12
-rw-r--r--spec/ruby/shared/queue/close.rb14
-rw-r--r--spec/ruby/shared/queue/closed.rb12
-rw-r--r--spec/ruby/shared/queue/deque.rb85
-rw-r--r--spec/ruby/shared/queue/empty.rb12
-rw-r--r--spec/ruby/shared/queue/enque.rb18
-rw-r--r--spec/ruby/shared/queue/length.rb9
-rw-r--r--spec/ruby/shared/queue/num_waiting.rb16
-rw-r--r--spec/ruby/shared/rational/Rational.rb143
-rw-r--r--spec/ruby/shared/rational/abs.rb11
-rw-r--r--spec/ruby/shared/rational/arithmetic_exception_in_coerce.rb33
-rw-r--r--spec/ruby/shared/rational/ceil.rb45
-rw-r--r--spec/ruby/shared/rational/coerce.rb29
-rw-r--r--spec/ruby/shared/rational/comparison.rb117
-rw-r--r--spec/ruby/shared/rational/denominator.rb14
-rw-r--r--spec/ruby/shared/rational/div.rb54
-rw-r--r--spec/ruby/shared/rational/divide.rb71
-rw-r--r--spec/ruby/shared/rational/divmod.rb42
-rw-r--r--spec/ruby/shared/rational/equal_value.rb39
-rw-r--r--spec/ruby/shared/rational/exponent.rb178
-rw-r--r--spec/ruby/shared/rational/fdiv.rb5
-rw-r--r--spec/ruby/shared/rational/floor.rb45
-rw-r--r--spec/ruby/shared/rational/hash.rb9
-rw-r--r--spec/ruby/shared/rational/inspect.rb14
-rw-r--r--spec/ruby/shared/rational/marshal_dump.rb5
-rw-r--r--spec/ruby/shared/rational/marshal_load.rb5
-rw-r--r--spec/ruby/shared/rational/minus.rb48
-rw-r--r--spec/ruby/shared/rational/modulo.rb43
-rw-r--r--spec/ruby/shared/rational/multiply.rb62
-rw-r--r--spec/ruby/shared/rational/numerator.rb10
-rw-r--r--spec/ruby/shared/rational/plus.rb48
-rw-r--r--spec/ruby/shared/rational/quo.rb5
-rw-r--r--spec/ruby/shared/rational/remainder.rb5
-rw-r--r--spec/ruby/shared/rational/round.rb106
-rw-r--r--spec/ruby/shared/rational/to_f.rb10
-rw-r--r--spec/ruby/shared/rational/to_i.rb12
-rw-r--r--spec/ruby/shared/rational/to_r.rb11
-rw-r--r--spec/ruby/shared/rational/to_s.rb14
-rw-r--r--spec/ruby/shared/rational/truncate.rb45
-rw-r--r--spec/ruby/shared/sizedqueue/enque.rb50
-rw-r--r--spec/ruby/shared/sizedqueue/max.rb47
-rw-r--r--spec/ruby/shared/sizedqueue/new.rb18
-rw-r--r--spec/ruby/shared/sizedqueue/num_waiting.rb12
-rw-r--r--spec/ruby/shared/string/times.rb64
-rw-r--r--spec/ruby/shared/time/strftime_for_date.rb273
-rw-r--r--spec/ruby/shared/time/strftime_for_time.rb173
-rw-r--r--spec/ruby/spec_helper.rb32
-rw-r--r--sprintf.c1334
-rw-r--r--st.c2626
-rw-r--r--st.h54
-rw-r--r--strftime.c1273
-rw-r--r--string.c11885
-rw-r--r--struct.c1527
-rw-r--r--symbol.c1073
-rw-r--r--symbol.h119
-rw-r--r--template/Doxyfile.tmpl265
-rw-r--r--template/GNUmakefile.in11
-rw-r--r--template/Makefile.in683
-rw-r--r--template/configure-ext.mk.tmpl44
-rw-r--r--template/depend.tmpl2
-rw-r--r--template/encdb.h.tmpl100
-rw-r--r--template/extinit.c.tmpl17
-rw-r--r--template/exts.mk.tmpl159
-rw-r--r--template/fake.rb.in50
-rw-r--r--template/id.c.tmpl43
-rw-r--r--template/id.h.tmpl97
-rw-r--r--template/known_errors.inc.tmpl14
-rw-r--r--template/limits.c.tmpl97
-rw-r--r--template/prelude.c.tmpl278
-rw-r--r--template/ruby-runner.h.in9
-rw-r--r--template/ruby.pc.in59
-rw-r--r--template/sizes.c.tmpl54
-rw-r--r--template/transdb.h.tmpl60
-rw-r--r--template/unicode_norm_gen.tmpl220
-rw-r--r--template/verconf.h.tmpl63
-rw-r--r--test/-ext-/arith_seq/test_arith_seq_extract.rb40
-rw-r--r--test/-ext-/array/test_resize.rb30
-rw-r--r--test/-ext-/bignum/test_big2str.rb30
-rw-r--r--test/-ext-/bignum/test_bigzero.rb20
-rw-r--r--test/-ext-/bignum/test_div.rb29
-rw-r--r--test/-ext-/bignum/test_mul.rb138
-rw-r--r--test/-ext-/bignum/test_pack.rb399
-rw-r--r--test/-ext-/bignum/test_str2big.rb38
-rw-r--r--test/-ext-/bug_reporter/test_bug_reporter.rb26
-rw-r--r--test/-ext-/class/test_class2name.rb19
-rw-r--r--test/-ext-/debug/test_debug.rb75
-rw-r--r--test/-ext-/debug/test_profile_frames.rb150
-rw-r--r--test/-ext-/exception/test_data_error.rb14
-rw-r--r--test/-ext-/exception/test_enc_raise.rb16
-rw-r--r--test/-ext-/exception/test_ensured.rb32
-rw-r--r--test/-ext-/exception/test_exception_at_throwing.rb18
-rw-r--r--test/-ext-/file/test_stat.rb15
-rw-r--r--test/-ext-/float/test_nextafter.rb65
-rw-r--r--test/-ext-/funcall/test_funcall.rb11
-rw-r--r--test/-ext-/funcall/test_passing_block.rb75
-rw-r--r--test/-ext-/gvl/test_last_thread.rb22
-rw-r--r--test/-ext-/gvl/test_ubf_async_safe.rb20
-rw-r--r--test/-ext-/hash/test_delete.rb20
-rw-r--r--test/-ext-/integer/test_integer.rb26
-rw-r--r--test/-ext-/integer/test_my_integer.rb48
-rw-r--r--test/-ext-/iseq_load/test_iseq_load.rb156
-rw-r--r--test/-ext-/iter/test_iter_break.rb16
-rw-r--r--test/-ext-/iter/test_yield_block.rb34
-rw-r--r--test/-ext-/load/script.rb2
-rw-r--r--test/-ext-/load/test_dot_dot.rb11
-rw-r--r--test/-ext-/load/test_protect.rb14
-rw-r--r--test/-ext-/marshal/test_internal_ivar.rb24
-rw-r--r--test/-ext-/marshal/test_usrmarshal.rb33
-rw-r--r--test/-ext-/method/test_arity.rb38
-rw-r--r--test/-ext-/num2int/test_num2int.rb265
-rw-r--r--test/-ext-/path_to_class/test_path_to_class.rb13
-rw-r--r--test/-ext-/popen_deadlock/test_popen_deadlock.rb36
-rw-r--r--test/-ext-/postponed_job/test_postponed_job.rb28
-rw-r--r--test/-ext-/proc/test_bmethod.rb38
-rw-r--r--test/-ext-/rational/test_rat.rb32
-rw-r--r--test/-ext-/st/test_foreach.rb16
-rw-r--r--test/-ext-/st/test_numhash.rb50
-rw-r--r--test/-ext-/st/test_update.rb51
-rw-r--r--test/-ext-/string/test_capacity.rb59
-rw-r--r--test/-ext-/string/test_coderange.rb60
-rw-r--r--test/-ext-/string/test_cstr.rb164
-rw-r--r--test/-ext-/string/test_ellipsize.rb47
-rw-r--r--test/-ext-/string/test_enc_associate.rb24
-rw-r--r--test/-ext-/string/test_enc_str_buf_cat.rb16
-rw-r--r--test/-ext-/string/test_external_new.rb17
-rw-r--r--test/-ext-/string/test_fstring.rb58
-rw-r--r--test/-ext-/string/test_modify_expand.rb26
-rw-r--r--test/-ext-/string/test_nofree.rb13
-rw-r--r--test/-ext-/string/test_normalize.rb110
-rw-r--r--test/-ext-/string/test_qsort.rb20
-rw-r--r--test/-ext-/string/test_rb_str_dup.rb16
-rw-r--r--test/-ext-/string/test_set_len.rb35
-rw-r--r--test/-ext-/struct/test_duplicate.rb22
-rw-r--r--test/-ext-/struct/test_len.rb10
-rw-r--r--test/-ext-/struct/test_member.rb14
-rw-r--r--test/-ext-/symbol/noninterned_name.rb17
-rw-r--r--test/-ext-/symbol/test_inadvertent_creation.rb495
-rw-r--r--test/-ext-/symbol/test_type.rb139
-rw-r--r--test/-ext-/test_bug-14834.rb12
-rw-r--r--test/-ext-/test_bug-3571.rb21
-rw-r--r--test/-ext-/test_bug-5832.rb22
-rw-r--r--test/-ext-/test_enumerator_kw.rb11
-rw-r--r--test/-ext-/test_notimplement.rb44
-rw-r--r--test/-ext-/test_printf.rb184
-rw-r--r--test/-ext-/test_recursion.rb36
-rw-r--r--test/-ext-/test_scan_args.rb324
-rw-r--r--test/-ext-/thread_fd_close/test_thread_fd_close.rb25
-rw-r--r--test/-ext-/time/test_new.rb44
-rw-r--r--test/-ext-/tracepoint/test_tracepoint.rb86
-rw-r--r--test/-ext-/typeddata/test_typeddata.rb29
-rw-r--r--test/-ext-/vm/test_at_exit.rb19
-rw-r--r--test/-ext-/wait_for_single_fd/test_wait_for_single_fd.rb49
-rw-r--r--test/-ext-/win32/test_console_attr.rb55
-rw-r--r--test/-ext-/win32/test_dln.rb39
-rw-r--r--test/-ext-/win32/test_fd_setsize.rb25
-rw-r--r--test/base64/test_base64.rb115
-rw-r--r--test/benchmark/test_benchmark.rb158
-rw-r--r--test/bigdecimal/test_bigdecimal.rb1910
-rw-r--r--test/bigdecimal/test_bigdecimal_util.rb93
-rw-r--r--test/bigdecimal/test_bigmath.rb81
-rw-r--r--test/bigdecimal/testbase.rb28
-rw-r--r--test/cgi/test_cgi_cookie.rb126
-rw-r--r--test/cgi/test_cgi_core.rb303
-rw-r--r--test/cgi/test_cgi_header.rb184
-rw-r--r--test/cgi/test_cgi_modruby.rb149
-rw-r--r--test/cgi/test_cgi_multipart.rb385
-rw-r--r--test/cgi/test_cgi_session.rb169
-rw-r--r--test/cgi/test_cgi_tag_helper.rb355
-rw-r--r--test/cgi/test_cgi_util.rb193
-rw-r--r--test/cgi/testdata/file1.html10
-rw-r--r--test/cgi/testdata/large.pngbin156414 -> 0 bytes-rw-r--r--test/cgi/testdata/small.pngbin82 -> 0 bytes-rw-r--r--test/cgi/update_env.rb9
-rw-r--r--test/coverage/test_coverage.rb743
-rw-r--r--test/csv/helper.rb18
-rw-r--r--test/csv/interface/test_delegation.rb47
-rw-r--r--test/csv/interface/test_read.rb277
-rw-r--r--test/csv/interface/test_read_write.rb50
-rw-r--r--test/csv/interface/test_write.rb174
-rw-r--r--test/csv/line_endings.gzbin59 -> 0 bytes-rw-r--r--test/csv/parse/test_column_separator.rb40
-rw-r--r--test/csv/parse/test_convert.rb110
-rw-r--r--test/csv/parse/test_each.rb23
-rw-r--r--test/csv/parse/test_general.rb255
-rw-r--r--test/csv/parse/test_header.rb335
-rw-r--r--test/csv/parse/test_invalid.rb39
-rw-r--r--test/csv/parse/test_liberal_parsing.rb160
-rw-r--r--test/csv/parse/test_quote_char_nil.rb93
-rw-r--r--test/csv/parse/test_rewind.rb40
-rw-r--r--test/csv/parse/test_row_separator.rb16
-rw-r--r--test/csv/parse/test_skip_lines.rb105
-rw-r--r--test/csv/parse/test_strip.rb78
-rw-r--r--test/csv/parse/test_unconverted_fields.rb117
-rw-r--r--test/csv/test_csv.rb1753
-rw-r--r--test/csv/test_data_converters.rb106
-rw-r--r--test/csv/test_encodings.rb350
-rw-r--r--test/csv/test_features.rb359
-rw-r--r--test/csv/test_row.rb432
-rw-r--r--test/csv/test_table.rb620
-rw-r--r--test/csv/write/test_converters.rb53
-rw-r--r--test/csv/write/test_general.rb258
-rw-r--r--test/csv/write/test_quote_empty.rb70
-rw-r--r--test/date/test_date.rb166
-rw-r--r--test/date/test_date_arith.rb294
-rw-r--r--test/date/test_date_attr.rb103
-rw-r--r--test/date/test_date_compat.rb22
-rw-r--r--test/date/test_date_conv.rb171
-rw-r--r--test/date/test_date_marshal.rb59
-rw-r--r--test/date/test_date_new.rb332
-rw-r--r--test/date/test_date_parse.rb1302
-rw-r--r--test/date/test_date_strftime.rb439
-rw-r--r--test/date/test_date_strptime.rb514
-rw-r--r--test/date/test_switch_hitter.rb637
-rw-r--r--test/dbm/test_dbm.rb606
-rw-r--r--test/did_you_mean/core_ext/test_name_error_extension.rb48
-rw-r--r--test/did_you_mean/edit_distance/test_jaro_winkler.rb36
-rw-r--r--test/did_you_mean/fixtures/book.rb4
-rw-r--r--test/did_you_mean/fixtures/mini_dir.yml15
-rw-r--r--test/did_you_mean/fixtures/rspec_dir.yml112
-rw-r--r--test/did_you_mean/helper.rb29
-rw-r--r--test/did_you_mean/spell_checking/test_class_name_check.rb79
-rw-r--r--test/did_you_mean/spell_checking/test_key_name_check.rb54
-rw-r--r--test/did_you_mean/spell_checking/test_method_name_check.rb140
-rw-r--r--test/did_you_mean/spell_checking/test_uncorrectable_name_check.rb15
-rw-r--r--test/did_you_mean/spell_checking/test_variable_name_check.rb140
-rw-r--r--test/did_you_mean/test_spell_checker.rb77
-rw-r--r--test/did_you_mean/test_tree_spell_checker.rb173
-rw-r--r--test/did_you_mean/test_verbose_formatter.rb21
-rw-r--r--test/did_you_mean/tree_spell/change_word.rb61
-rw-r--r--test/did_you_mean/tree_spell/human_typo.rb89
-rw-r--r--test/did_you_mean/tree_spell/test_change_word.rb38
-rw-r--r--test/did_you_mean/tree_spell/test_human_typo.rb24
-rw-r--r--test/digest/digest/foo.rb11
-rw-r--r--test/digest/test_digest.rb307
-rw-r--r--test/digest/test_digest_extend.rb159
-rw-r--r--test/drb/drbtest.rb237
-rw-r--r--test/drb/ignore_test_drb.rb14
-rw-r--r--test/drb/test_acl.rb106
-rw-r--r--test/drb/test_drb.rb238
-rw-r--r--test/drb/test_drbobject.rb69
-rw-r--r--test/drb/test_drbssl.rb69
-rw-r--r--test/drb/test_drbunix.rb35
-rw-r--r--test/drb/ut_array.rb4
-rw-r--r--test/drb/ut_array_drbssl.rb17
-rw-r--r--test/drb/ut_array_drbunix.rb2
-rw-r--r--test/drb/ut_drb.rb50
-rw-r--r--test/drb/ut_drb_drbssl.rb19
-rw-r--r--test/drb/ut_drb_drbunix.rb4
-rw-r--r--test/drb/ut_eq.rb37
-rw-r--r--test/drb/ut_eval.rb23
-rw-r--r--test/drb/ut_large.rb36
-rw-r--r--test/drb/ut_port.rb2
-rw-r--r--test/drb/ut_safe1.rb7
-rw-r--r--test/drb/ut_timerholder.rb109
-rw-r--r--test/dtrace/dummy.rb2
-rw-r--r--test/dtrace/helper.rb165
-rw-r--r--test/dtrace/test_array_create.rb36
-rw-r--r--test/dtrace/test_cmethod.rb50
-rw-r--r--test/dtrace/test_function_entry.rb89
-rw-r--r--test/dtrace/test_gc.rb27
-rw-r--r--test/dtrace/test_hash_create.rb53
-rw-r--r--test/dtrace/test_load.rb53
-rw-r--r--test/dtrace/test_method_cache.rb29
-rw-r--r--test/dtrace/test_object_create_start.rb36
-rw-r--r--test/dtrace/test_raise.rb30
-rw-r--r--test/dtrace/test_require.rb41
-rw-r--r--test/dtrace/test_singleton_function.rb57
-rw-r--r--test/dtrace/test_string.rb28
-rw-r--r--test/erb/hello.erb4
-rw-r--r--test/erb/test_erb.rb689
-rw-r--r--test/erb/test_erb_command.rb30
-rw-r--r--test/erb/test_erb_m17n.rb124
-rw-r--r--test/etc/test_etc.rb172
-rw-r--r--test/excludes/TestException.rb8
-rw-r--r--test/excludes/TestIO_Console.rb2
-rw-r--r--test/excludes/TestISeq.rb1
-rw-r--r--test/excludes/TestThread.rb2
-rw-r--r--test/excludes/_appveyor/TestArray.rb7
-rw-r--r--test/fiddle/helper.rb146
-rw-r--r--test/fiddle/test_c_struct_entry.rb77
-rw-r--r--test/fiddle/test_c_union_entity.rb35
-rw-r--r--test/fiddle/test_closure.rb85
-rw-r--r--test/fiddle/test_cparser.rb217
-rw-r--r--test/fiddle/test_fiddle.rb17
-rw-r--r--test/fiddle/test_func.rb83
-rw-r--r--test/fiddle/test_function.rb117
-rw-r--r--test/fiddle/test_handle.rb175
-rw-r--r--test/fiddle/test_import.rb155
-rw-r--r--test/fiddle/test_pointer.rb231
-rw-r--r--test/fileutils/clobber.rb92
-rw-r--r--test/fileutils/fileasserts.rb127
-rw-r--r--test/fileutils/test_dryrun.rb18
-rw-r--r--test/fileutils/test_fileutils.rb1485
-rw-r--r--test/fileutils/test_nowrite.rb85
-rw-r--r--test/fileutils/test_verbose.rb18
-rw-r--r--test/fileutils/visibility_tests.rb42
-rw-r--r--test/gdbm/test_gdbm.rb710
-rw-r--r--test/io/console/test_io_console.rb527
-rw-r--r--test/io/nonblock/test_flush.rb73
-rw-r--r--test/io/wait/test_io_wait.rb179
-rw-r--r--test/io/wait/test_io_wait_uncommon.rb78
-rw-r--r--test/irb/test_cmd.rb129
-rw-r--r--test/irb/test_color.rb193
-rw-r--r--test/irb/test_completion.rb51
-rw-r--r--test/irb/test_context.rb426
-rw-r--r--test/irb/test_history.rb175
-rw-r--r--test/irb/test_init.rb77
-rw-r--r--test/irb/test_option.rb13
-rw-r--r--test/irb/test_raise_no_backtrace_exception.rb16
-rw-r--r--test/irb/test_ruby_lex.rb264
-rw-r--r--test/irb/test_workspace.rb105
-rw-r--r--test/json/fixtures/fail10.json1
-rw-r--r--test/json/fixtures/fail11.json1
-rw-r--r--test/json/fixtures/fail12.json1
-rw-r--r--test/json/fixtures/fail13.json1
-rw-r--r--test/json/fixtures/fail14.json1
-rw-r--r--test/json/fixtures/fail18.json1
-rw-r--r--test/json/fixtures/fail19.json1
-rw-r--r--test/json/fixtures/fail2.json1
-rw-r--r--test/json/fixtures/fail20.json1
-rw-r--r--test/json/fixtures/fail21.json1
-rw-r--r--test/json/fixtures/fail22.json1
-rw-r--r--test/json/fixtures/fail23.json1
-rw-r--r--test/json/fixtures/fail24.json1
-rw-r--r--test/json/fixtures/fail25.json1
-rw-r--r--test/json/fixtures/fail27.json2
-rw-r--r--test/json/fixtures/fail28.json2
-rw-r--r--test/json/fixtures/fail3.json1
-rw-r--r--test/json/fixtures/fail4.json1
-rw-r--r--test/json/fixtures/fail5.json1
-rw-r--r--test/json/fixtures/fail6.json1
-rw-r--r--test/json/fixtures/fail7.json1
-rw-r--r--test/json/fixtures/fail8.json1
-rw-r--r--test/json/fixtures/fail9.json1
-rw-r--r--test/json/fixtures/obsolete_fail1.json1
-rw-r--r--test/json/fixtures/pass1.json56
-rw-r--r--test/json/fixtures/pass15.json1
-rw-r--r--test/json/fixtures/pass16.json1
-rw-r--r--test/json/fixtures/pass17.json1
-rw-r--r--test/json/fixtures/pass2.json1
-rw-r--r--test/json/fixtures/pass26.json1
-rw-r--r--test/json/fixtures/pass3.json6
-rw-r--r--test/json/json_addition_test.rb203
-rw-r--r--test/json/json_common_interface_test.rb126
-rw-r--r--test/json/json_encoding_test.rb107
-rw-r--r--test/json/json_ext_parser_test.rb15
-rw-r--r--test/json/json_fixtures_test.rb32
-rw-r--r--test/json/json_generator_test.rb421
-rw-r--r--test/json/json_generic_object_test.rb82
-rw-r--r--test/json/json_parser_test.rb472
-rw-r--r--test/json/json_string_matching_test.rb38
-rw-r--r--test/json/test_helper.rb17
-rw-r--r--test/lib/jit_support.rb78
-rw-r--r--test/lib/with_different_ofs.rb22
-rw-r--r--test/logger/helper.rb13
-rw-r--r--test/logger/test_logdevice.rb858
-rw-r--r--test/logger/test_logger.rb241
-rw-r--r--test/logger/test_logperiod.rb80
-rw-r--r--test/logger/test_severity.rb26
-rw-r--r--test/matrix/test_matrix.rb795
-rw-r--r--test/matrix/test_vector.rb335
-rw-r--r--test/misc/test_ruby_mode.rb183
-rw-r--r--test/mkmf/base.rb155
-rw-r--r--test/mkmf/test_config.rb17
-rw-r--r--test/mkmf/test_constant.rb38
-rw-r--r--test/mkmf/test_convertible.rb35
-rw-r--r--test/mkmf/test_find_executable.rb58
-rw-r--r--test/mkmf/test_flags.rb57
-rw-r--r--test/mkmf/test_framework.rb49
-rw-r--r--test/mkmf/test_have_func.rb17
-rw-r--r--test/mkmf/test_have_library.rb56
-rw-r--r--test/mkmf/test_have_macro.rb36
-rw-r--r--test/mkmf/test_libs.rb87
-rw-r--r--test/mkmf/test_signedness.rb30
-rw-r--r--test/mkmf/test_sizeof.rb48
-rw-r--r--test/monitor/test_monitor.rb261
-rw-r--r--test/net/fixtures/Makefile15
-rw-r--r--test/net/fixtures/cacert.pem24
-rw-r--r--test/net/fixtures/dhparams.pem29
-rw-r--r--test/net/fixtures/server.crt82
-rw-r--r--test/net/fixtures/server.key28
-rw-r--r--test/net/ftp/test_buffered_socket.rb48
-rw-r--r--test/net/ftp/test_ftp.rb2723
-rw-r--r--test/net/ftp/test_mlsx_entry.rb98
-rw-r--r--test/net/http/test_buffered_io.rb18
-rw-r--r--test/net/http/test_http.rb1207
-rw-r--r--test/net/http/test_http_request.rb93
-rw-r--r--test/net/http/test_httpheader.rb444
-rw-r--r--test/net/http/test_httpresponse.rb467
-rw-r--r--test/net/http/test_httpresponses.rb25
-rw-r--r--test/net/http/test_https.rb291
-rw-r--r--test/net/http/test_https_proxy.rb47
-rw-r--r--test/net/http/utils.rb129
-rw-r--r--test/net/imap/test_imap.rb825
-rw-r--r--test/net/imap/test_imap_response_parser.rb311
-rw-r--r--test/net/pop/test_pop.rb166
-rw-r--r--test/net/protocol/test_protocol.rb122
-rw-r--r--test/net/smtp/test_response.rb100
-rw-r--r--test/net/smtp/test_smtp.rb200
-rw-r--r--test/net/smtp/test_ssl_socket.rb97
-rw-r--r--test/nkf/test_kconv.rb82
-rw-r--r--test/nkf/test_nkf.rb23
-rw-r--r--test/objspace/test_objspace.rb506
-rw-r--r--test/open-uri/test_open-uri.rb912
-rw-r--r--test/open-uri/test_ssl.rb513
-rw-r--r--test/openssl/fixtures/pkey/dh-1.pem13
-rw-r--r--test/openssl/fixtures/pkey/dh1024.pem5
-rw-r--r--test/openssl/fixtures/pkey/dsa1024.pem12
-rw-r--r--test/openssl/fixtures/pkey/dsa256.pem8
-rw-r--r--test/openssl/fixtures/pkey/dsa512.pem8
-rw-r--r--test/openssl/fixtures/pkey/p256.pem5
-rw-r--r--test/openssl/fixtures/pkey/rsa-1.pem51
-rw-r--r--test/openssl/fixtures/pkey/rsa-2.pem51
-rw-r--r--test/openssl/fixtures/pkey/rsa-3.pem51
-rw-r--r--test/openssl/fixtures/pkey/rsa1024.pem15
-rw-r--r--test/openssl/fixtures/pkey/rsa2048.pem27
-rw-r--r--test/openssl/ssl_server.rb71
-rw-r--r--test/openssl/test_asn1.rb689
-rw-r--r--test/openssl/test_bn.rb277
-rw-r--r--test/openssl/test_buffering.rb90
-rw-r--r--test/openssl/test_cipher.rb343
-rw-r--r--test/openssl/test_config.rb358
-rw-r--r--test/openssl/test_digest.rb112
-rw-r--r--test/openssl/test_engine.rb97
-rw-r--r--test/openssl/test_fips.rb30
-rw-r--r--test/openssl/test_hmac.rb52
-rw-r--r--test/openssl/test_kdf.rb183
-rw-r--r--test/openssl/test_ns_spki.rb53
-rw-r--r--test/openssl/test_ocsp.rb310
-rw-r--r--test/openssl/test_pair.rb523
-rw-r--r--test/openssl/test_pkcs12.rb313
-rw-r--r--test/openssl/test_pkcs7.rb285
-rw-r--r--test/openssl/test_pkey_dh.rb103
-rw-r--r--test/openssl/test_pkey_dsa.rb200
-rw-r--r--test/openssl/test_pkey_ec.rb353
-rw-r--r--test/openssl/test_pkey_rsa.rb312
-rw-r--r--test/openssl/test_random.rb19
-rw-r--r--test/openssl/test_ssl.rb1731
-rw-r--r--test/openssl/test_ssl_session.rb401
-rw-r--r--test/openssl/test_x509attr.rb84
-rw-r--r--test/openssl/test_x509cert.rb196
-rw-r--r--test/openssl/test_x509crl.rb129
-rw-r--r--test/openssl/test_x509ext.rb91
-rw-r--r--test/openssl/test_x509name.rb372
-rw-r--r--test/openssl/test_x509req.rb71
-rw-r--r--test/openssl/test_x509store.rb174
-rw-r--r--test/openssl/ut_eof.rb133
-rw-r--r--test/openssl/utils.rb348
-rw-r--r--test/optparse/test_acceptable.rb199
-rw-r--r--test/optparse/test_autoconf.rb71
-rw-r--r--test/optparse/test_bash_completion.rb48
-rw-r--r--test/optparse/test_cclass.rb18
-rw-r--r--test/optparse/test_did_you_mean.rb52
-rw-r--r--test/optparse/test_getopts.rb35
-rw-r--r--test/optparse/test_kwargs.rb40
-rw-r--r--test/optparse/test_noarg.rb38
-rw-r--r--test/optparse/test_optarg.rb18
-rw-r--r--test/optparse/test_optparse.rb34
-rw-r--r--test/optparse/test_placearg.rb27
-rw-r--r--test/optparse/test_reqarg.rb40
-rw-r--r--test/optparse/test_summary.rb58
-rw-r--r--test/optparse/test_zsh_completion.rb23
-rw-r--r--test/ostruct/test_ostruct.rb206
-rw-r--r--test/pathname/test_pathname.rb1476
-rw-r--r--test/psych/handlers/test_recorder.rb26
-rw-r--r--test/psych/helper.rb128
-rw-r--r--test/psych/json/test_stream.rb110
-rw-r--r--test/psych/nodes/test_enumerable.rb44
-rw-r--r--test/psych/test_alias_and_anchor.rb97
-rw-r--r--test/psych/test_array.rb64
-rw-r--r--test/psych/test_boolean.rb37
-rw-r--r--test/psych/test_class.rb37
-rw-r--r--test/psych/test_coder.rb207
-rw-r--r--test/psych/test_date_time.rb70
-rw-r--r--test/psych/test_deprecated.rb91
-rw-r--r--test/psych/test_document.rb47
-rw-r--r--test/psych/test_emitter.rb112
-rw-r--r--test/psych/test_encoding.rb281
-rw-r--r--test/psych/test_exception.rb183
-rw-r--r--test/psych/test_hash.rb129
-rw-r--r--test/psych/test_json_tree.rb66
-rw-r--r--test/psych/test_marshalable.rb55
-rw-r--r--test/psych/test_merge_keys.rb181
-rw-r--r--test/psych/test_nil.rb19
-rw-r--r--test/psych/test_null.rb20
-rw-r--r--test/psych/test_numeric.rb46
-rw-r--r--test/psych/test_object.rb45
-rw-r--r--test/psych/test_object_references.rb72
-rw-r--r--test/psych/test_omap.rb76
-rw-r--r--test/psych/test_parser.rb392
-rw-r--r--test/psych/test_psych.rb325
-rw-r--r--test/psych/test_safe_load.rb171
-rw-r--r--test/psych/test_scalar.rb17
-rw-r--r--test/psych/test_scalar_scanner.rb134
-rw-r--r--test/psych/test_serialize_subclasses.rb39
-rw-r--r--test/psych/test_set.rb50
-rw-r--r--test/psych/test_stream.rb110
-rw-r--r--test/psych/test_string.rb231
-rw-r--r--test/psych/test_struct.rb50
-rw-r--r--test/psych/test_symbol.rb26
-rw-r--r--test/psych/test_tree_builder.rb94
-rw-r--r--test/psych/test_yaml.rb1293
-rw-r--r--test/psych/test_yaml_special_cases.rb130
-rw-r--r--test/psych/test_yamldbm.rb193
-rw-r--r--test/psych/test_yamlstore.rb86
-rw-r--r--test/psych/visitors/test_depth_first.rb50
-rw-r--r--test/psych/visitors/test_emitter.rb145
-rw-r--r--test/psych/visitors/test_to_ruby.rb332
-rw-r--r--test/psych/visitors/test_yaml_tree.rb197
-rw-r--r--test/racc/assets/cadenza.y170
-rw-r--r--test/racc/assets/cast.y926
-rw-r--r--test/racc/assets/chk.y126
-rw-r--r--test/racc/assets/conf.y16
-rw-r--r--test/racc/assets/csspool.y729
-rw-r--r--test/racc/assets/digraph.y29
-rw-r--r--test/racc/assets/echk.y118
-rw-r--r--test/racc/assets/edtf.y583
-rw-r--r--test/racc/assets/err.y60
-rw-r--r--test/racc/assets/error_recovery.y35
-rw-r--r--test/racc/assets/expect.y7
-rw-r--r--test/racc/assets/firstline.y4
-rw-r--r--test/racc/assets/huia.y318
-rw-r--r--test/racc/assets/ichk.y102
-rw-r--r--test/racc/assets/intp.y546
-rw-r--r--test/racc/assets/journey.y47
-rw-r--r--test/racc/assets/liquor.y313
-rw-r--r--test/racc/assets/machete.y423
-rw-r--r--test/racc/assets/macruby.y2197
-rw-r--r--test/racc/assets/mailp.y437
-rw-r--r--test/racc/assets/mediacloth.y599
-rw-r--r--test/racc/assets/mof.y649
-rw-r--r--test/racc/assets/namae.y302
-rw-r--r--test/racc/assets/nasl.y626
-rw-r--r--test/racc/assets/newsyn.y25
-rw-r--r--test/racc/assets/noend.y4
-rw-r--r--test/racc/assets/nokogiri-css.y255
-rw-r--r--test/racc/assets/nonass.y41
-rw-r--r--test/racc/assets/normal.y27
-rw-r--r--test/racc/assets/norule.y4
-rw-r--r--test/racc/assets/nullbug1.y25
-rw-r--r--test/racc/assets/nullbug2.y15
-rw-r--r--test/racc/assets/opal.y1807
-rw-r--r--test/racc/assets/opt.y123
-rw-r--r--test/racc/assets/percent.y35
-rw-r--r--test/racc/assets/php_serialization.y98
-rw-r--r--test/racc/assets/recv.y97
-rw-r--r--test/racc/assets/riml.y665
-rw-r--r--test/racc/assets/rrconf.y14
-rw-r--r--test/racc/assets/ruby18.y1943
-rw-r--r--test/racc/assets/ruby19.y2174
-rw-r--r--test/racc/assets/ruby20.y2350
-rw-r--r--test/racc/assets/ruby21.y2359
-rw-r--r--test/racc/assets/ruby22.y2381
-rw-r--r--test/racc/assets/scan.y72
-rw-r--r--test/racc/assets/syntax.y50
-rw-r--r--test/racc/assets/tp_plus.y622
-rw-r--r--test/racc/assets/twowaysql.y278
-rw-r--r--test/racc/assets/unterm.y5
-rw-r--r--test/racc/assets/useless.y12
-rw-r--r--test/racc/assets/yyerr.y46
-rw-r--r--test/racc/bench.y36
-rw-r--r--test/racc/helper.rb115
-rw-r--r--test/racc/infini.y8
-rw-r--r--test/racc/regress/README.txt7
-rw-r--r--test/racc/regress/cadenza796
-rw-r--r--test/racc/regress/cast3425
-rw-r--r--test/racc/regress/csspool2318
-rw-r--r--test/racc/regress/edtf1794
-rw-r--r--test/racc/regress/huia1392
-rw-r--r--test/racc/regress/journey222
-rw-r--r--test/racc/regress/liquor885
-rw-r--r--test/racc/regress/machete833
-rw-r--r--test/racc/regress/mediacloth1463
-rw-r--r--test/racc/regress/mof1368
-rw-r--r--test/racc/regress/namae634
-rw-r--r--test/racc/regress/nasl2058
-rw-r--r--test/racc/regress/nokogiri-css836
-rw-r--r--test/racc/regress/opal6429
-rw-r--r--test/racc/regress/php_serialization336
-rw-r--r--test/racc/regress/riml3297
-rw-r--r--test/racc/regress/ruby186351
-rw-r--r--test/racc/regress/ruby227456
-rw-r--r--test/racc/regress/tp_plus1933
-rw-r--r--test/racc/regress/twowaysql556
-rw-r--r--test/racc/scandata/brace7
-rw-r--r--test/racc/scandata/gvar1
-rw-r--r--test/racc/scandata/normal4
-rw-r--r--test/racc/scandata/percent18
-rw-r--r--test/racc/scandata/slash10
-rw-r--r--test/racc/src.intp34
-rw-r--r--test/racc/start.y20
-rw-r--r--test/racc/test_chk_y.rb52
-rw-r--r--test/racc/test_grammar_file_parser.rb15
-rw-r--r--test/racc/test_racc_command.rb322
-rw-r--r--test/racc/test_scan_y.rb52
-rw-r--r--test/racc/testscanner.rb51
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Amps and angle encoding.text21
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Auto links.text13
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Backslash escapes.text120
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Blockquotes with code blocks.text11
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Code Blocks.text14
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Code Spans.text6
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Hard-wrapped paragraphs with list-like lines.text8
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Horizontal rules.text67
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Inline HTML (Advanced).text15
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Inline HTML (Simple).text69
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Inline HTML comments.text13
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Links, inline style.text12
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Links, reference style.text71
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Links, shortcut references.text20
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Literal quotes in titles.text7
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Markdown Documentation - Basics.text306
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Markdown Documentation - Syntax.text888
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Nested blockquotes.text5
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Ordered and unordered lists.text131
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Strong and em together.text7
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Tabs.text21
-rw-r--r--test/rdoc/MarkdownTest_1.0.3/Tidyness.text5
-rw-r--r--test/rdoc/README1
-rw-r--r--test/rdoc/binary.datbin1024 -> 0 bytes-rw-r--r--test/rdoc/helper.rb5
-rw-r--r--test/rdoc/hidden.zip.txt1
-rw-r--r--test/rdoc/support/formatter_test_case.rb764
-rw-r--r--test/rdoc/support/test_case.rb216
-rw-r--r--test/rdoc/support/text_formatter_test_case.rb115
-rw-r--r--test/rdoc/test.ja.largedoc3
-rw-r--r--test/rdoc/test.ja.rdoc10
-rw-r--r--test/rdoc/test.ja.txt8
-rw-r--r--test/rdoc/test.txt1
-rw-r--r--test/rdoc/test_rdoc_alias.rb14
-rw-r--r--test/rdoc/test_rdoc_any_method.rb509
-rw-r--r--test/rdoc/test_rdoc_attr.rb190
-rw-r--r--test/rdoc/test_rdoc_class_module.rb1504
-rw-r--r--test/rdoc/test_rdoc_code_object.rb440
-rw-r--r--test/rdoc/test_rdoc_comment.rb497
-rw-r--r--test/rdoc/test_rdoc_constant.rb182
-rw-r--r--test/rdoc/test_rdoc_context.rb965
-rw-r--r--test/rdoc/test_rdoc_context_section.rb155
-rw-r--r--test/rdoc/test_rdoc_cross_reference.rb207
-rw-r--r--test/rdoc/test_rdoc_encoding.rb184
-rw-r--r--test/rdoc/test_rdoc_extend.rb95
-rw-r--r--test/rdoc/test_rdoc_generator_darkfish.rb246
-rw-r--r--test/rdoc/test_rdoc_generator_json_index.rb349
-rw-r--r--test/rdoc/test_rdoc_generator_markup.rb60
-rw-r--r--test/rdoc/test_rdoc_generator_pot.rb92
-rw-r--r--test/rdoc/test_rdoc_generator_pot_po.rb52
-rw-r--r--test/rdoc/test_rdoc_generator_pot_po_entry.rb140
-rw-r--r--test/rdoc/test_rdoc_generator_ri.rb76
-rw-r--r--test/rdoc/test_rdoc_i18n_locale.rb74
-rw-r--r--test/rdoc/test_rdoc_i18n_text.rb124
-rw-r--r--test/rdoc/test_rdoc_include.rb109
-rw-r--r--test/rdoc/test_rdoc_markdown.rb1018
-rw-r--r--test/rdoc/test_rdoc_markdown_test.rb1883
-rw-r--r--test/rdoc/test_rdoc_markup.rb96
-rw-r--r--test/rdoc/test_rdoc_markup_attribute_manager.rb375
-rw-r--r--test/rdoc/test_rdoc_markup_attributes.rb40
-rw-r--r--test/rdoc/test_rdoc_markup_document.rb208
-rw-r--r--test/rdoc/test_rdoc_markup_formatter.rb175
-rw-r--r--test/rdoc/test_rdoc_markup_hard_break.rb32
-rw-r--r--test/rdoc/test_rdoc_markup_heading.rb30
-rw-r--r--test/rdoc/test_rdoc_markup_include.rb20
-rw-r--r--test/rdoc/test_rdoc_markup_indented_paragraph.rb54
-rw-r--r--test/rdoc/test_rdoc_markup_paragraph.rb33
-rw-r--r--test/rdoc/test_rdoc_markup_parser.rb1684
-rw-r--r--test/rdoc/test_rdoc_markup_pre_process.rb467
-rw-r--r--test/rdoc/test_rdoc_markup_raw.rb23
-rw-r--r--test/rdoc/test_rdoc_markup_to_ansi.rb370
-rw-r--r--test/rdoc/test_rdoc_markup_to_bs.rb352
-rw-r--r--test/rdoc/test_rdoc_markup_to_html.rb809
-rw-r--r--test/rdoc/test_rdoc_markup_to_html_crossref.rb242
-rw-r--r--test/rdoc/test_rdoc_markup_to_html_snippet.rb709
-rw-r--r--test/rdoc/test_rdoc_markup_to_joined_paragraph.rb33
-rw-r--r--test/rdoc/test_rdoc_markup_to_label.rb113
-rw-r--r--test/rdoc/test_rdoc_markup_to_markdown.rb390
-rw-r--r--test/rdoc/test_rdoc_markup_to_rdoc.rb378
-rw-r--r--test/rdoc/test_rdoc_markup_to_table_of_contents.rb127
-rw-r--r--test/rdoc/test_rdoc_markup_to_tt_only.rb247
-rw-r--r--test/rdoc/test_rdoc_markup_verbatim.rb30
-rw-r--r--test/rdoc/test_rdoc_method_attr.rb194
-rw-r--r--test/rdoc/test_rdoc_normal_class.rb48
-rw-r--r--test/rdoc/test_rdoc_normal_module.rb43
-rw-r--r--test/rdoc/test_rdoc_options.rb780
-rw-r--r--test/rdoc/test_rdoc_parser.rb323
-rw-r--r--test/rdoc/test_rdoc_parser_c.rb1945
-rw-r--r--test/rdoc/test_rdoc_parser_changelog.rb316
-rw-r--r--test/rdoc/test_rdoc_parser_markdown.rb62
-rw-r--r--test/rdoc/test_rdoc_parser_rd.rb56
-rw-r--r--test/rdoc/test_rdoc_parser_ruby.rb4300
-rw-r--r--test/rdoc/test_rdoc_parser_simple.rb116
-rw-r--r--test/rdoc/test_rdoc_rd.rb31
-rw-r--r--test/rdoc/test_rdoc_rd_block_parser.rb536
-rw-r--r--test/rdoc/test_rdoc_rd_inline.rb64
-rw-r--r--test/rdoc/test_rdoc_rd_inline_parser.rb178
-rw-r--r--test/rdoc/test_rdoc_rdoc.rb578
-rw-r--r--test/rdoc/test_rdoc_require.rb26
-rw-r--r--test/rdoc/test_rdoc_ri_driver.rb1556
-rw-r--r--test/rdoc/test_rdoc_ri_paths.rb158
-rw-r--r--test/rdoc/test_rdoc_rubygems_hook.rb256
-rw-r--r--test/rdoc/test_rdoc_servlet.rb549
-rw-r--r--test/rdoc/test_rdoc_single_class.rb21
-rw-r--r--test/rdoc/test_rdoc_stats.rb723
-rw-r--r--test/rdoc/test_rdoc_store.rb998
-rw-r--r--test/rdoc/test_rdoc_task.rb174
-rw-r--r--test/rdoc/test_rdoc_text.rb575
-rw-r--r--test/rdoc/test_rdoc_token_stream.rb58
-rw-r--r--test/rdoc/test_rdoc_tom_doc.rb579
-rw-r--r--test/rdoc/test_rdoc_top_level.rb288
-rw-r--r--test/rdoc/xref_data.rb135
-rw-r--r--test/rdoc/xref_test_case.rb86
-rw-r--r--test/readline/helper.rb24
-rw-r--r--test/readline/test_readline.rb816
-rw-r--r--test/readline/test_readline_history.rb287
-rw-r--r--test/reline/helper.rb90
-rw-r--r--test/reline/test_config.rb325
-rw-r--r--test/reline/test_history.rb301
-rw-r--r--test/reline/test_key_actor_emacs.rb2082
-rw-r--r--test/reline/test_key_actor_vi.rb1240
-rw-r--r--test/reline/test_key_stroke.rb49
-rw-r--r--test/reline/test_kill_ring.rb256
-rw-r--r--test/reline/test_macro.rb39
-rw-r--r--test/reline/test_reline.rb315
-rw-r--r--test/reline/test_string_processing.rb23
-rw-r--r--test/reline/test_within_pipe.rb61
-rw-r--r--test/reline/yamatanooroti/test_rendering.rb224
-rw-r--r--test/resolv/test_addr.rb41
-rw-r--r--test/resolv/test_dns.rb430
-rw-r--r--test/resolv/test_mdns.rb27
-rw-r--r--test/resolv/test_resource.rb26
-rw-r--r--test/rexml/data/LostineRiver.kml.gzbin50154 -> 0 bytes-rw-r--r--test/rexml/data/ProductionSupport.xml29
-rw-r--r--test/rexml/data/axis.xml25
-rw-r--r--test/rexml/data/bad.xml5
-rw-r--r--test/rexml/data/basic.xml11
-rw-r--r--test/rexml/data/basicupdate.xml47
-rw-r--r--test/rexml/data/broken.rss20
-rw-r--r--test/rexml/data/contents.xml70
-rw-r--r--test/rexml/data/dash.xml12
-rw-r--r--test/rexml/data/defaultNamespace.xml6
-rw-r--r--test/rexml/data/doctype_test.xml34
-rw-r--r--test/rexml/data/documentation.xml542
-rw-r--r--test/rexml/data/euc.xml296
-rw-r--r--test/rexml/data/evaluate.xml28
-rw-r--r--test/rexml/data/fibo.xml29
-rw-r--r--test/rexml/data/foo.xml10
-rw-r--r--test/rexml/data/google.2.xml156
-rw-r--r--test/rexml/data/id.xml21
-rw-r--r--test/rexml/data/iso8859-1.xml4
-rw-r--r--test/rexml/data/jaxen24.xml2
-rw-r--r--test/rexml/data/jaxen3.xml15
-rw-r--r--test/rexml/data/lang.xml11
-rw-r--r--test/rexml/data/lang0.xml18
-rw-r--r--test/rexml/data/message.xml27
-rw-r--r--test/rexml/data/moreover.xml244
-rw-r--r--test/rexml/data/much_ado.xml6850
-rw-r--r--test/rexml/data/namespaces.xml18
-rw-r--r--test/rexml/data/nitf.xml67
-rw-r--r--test/rexml/data/numbers.xml18
-rw-r--r--test/rexml/data/ofbiz-issues-full-177.xml13971
-rw-r--r--test/rexml/data/pi.xml13
-rw-r--r--test/rexml/data/pi2.xml6
-rw-r--r--test/rexml/data/project.xml1
-rw-r--r--test/rexml/data/simple.xml2
-rw-r--r--test/rexml/data/stream_accents.xml4
-rw-r--r--test/rexml/data/t63-1.xmlbin161690 -> 0 bytes-rw-r--r--test/rexml/data/t63-2.svg2828
-rw-r--r--test/rexml/data/t75.xml31
-rw-r--r--test/rexml/data/test/tests.xml683
-rw-r--r--test/rexml/data/test/tests.xsl369
-rw-r--r--test/rexml/data/testNamespaces.xml22
-rw-r--r--test/rexml/data/testsrc.xml64
-rw-r--r--test/rexml/data/text.xml10
-rw-r--r--test/rexml/data/ticket_61.xml4
-rw-r--r--test/rexml/data/ticket_68.xml590
-rw-r--r--test/rexml/data/tutorial.xml678
-rw-r--r--test/rexml/data/underscore.xml6
-rw-r--r--test/rexml/data/utf16.xmlbin207464 -> 0 bytes-rw-r--r--test/rexml/data/web.xml42
-rw-r--r--test/rexml/data/web2.xml7
-rw-r--r--test/rexml/data/working.rss202
-rw-r--r--test/rexml/data/xmlfile-bug.xml15
-rw-r--r--test/rexml/data/xp.tst27
-rw-r--r--test/rexml/data/yahoo.xml80
-rw-r--r--test/rexml/formatter/test_default.rb19
-rw-r--r--test/rexml/functions/test_base.rb261
-rw-r--r--test/rexml/functions/test_boolean.rb75
-rw-r--r--test/rexml/functions/test_local_name.rb44
-rw-r--r--test/rexml/functions/test_number.rb38
-rw-r--r--test/rexml/listener.rb51
-rw-r--r--test/rexml/parse/test_document_type_declaration.rb229
-rw-r--r--test/rexml/parse/test_element.rb77
-rw-r--r--test/rexml/parse/test_notation_declaration.rb281
-rw-r--r--test/rexml/parse/test_processing_instruction.rb44
-rw-r--r--test/rexml/parser/test_sax2.rb203
-rw-r--r--test/rexml/parser/test_stream.rb32
-rw-r--r--test/rexml/parser/test_tree.rb43
-rw-r--r--test/rexml/parser/test_ultra_light.rb69
-rw-r--r--test/rexml/rexml_test_utils.rb10
-rw-r--r--test/rexml/test_attribute.rb14
-rw-r--r--test/rexml/test_attributes.rb223
-rw-r--r--test/rexml/test_attributes_mixin.rb32
-rw-r--r--test/rexml/test_changing_encoding.rb45
-rw-r--r--test/rexml/test_comment.rb26
-rw-r--r--test/rexml/test_contrib.rb585
-rw-r--r--test/rexml/test_core.rb1517
-rw-r--r--test/rexml/test_doctype.rb147
-rw-r--r--test/rexml/test_document.rb416
-rw-r--r--test/rexml/test_element.rb18
-rw-r--r--test/rexml/test_elements.rb119
-rw-r--r--test/rexml/test_encoding.rb108
-rw-r--r--test/rexml/test_entity.rb206
-rw-r--r--test/rexml/test_instruction.rb14
-rw-r--r--test/rexml/test_jaxen.rb131
-rw-r--r--test/rexml/test_light.rb107
-rw-r--r--test/rexml/test_lightparser.rb16
-rw-r--r--test/rexml/test_listener.rb131
-rw-r--r--test/rexml/test_martin_fowler.rb40
-rw-r--r--test/rexml/test_namespace.rb41
-rw-r--r--test/rexml/test_order.rb110
-rw-r--r--test/rexml/test_preceding_sibling.rb41
-rw-r--r--test/rexml/test_pullparser.rb103
-rw-r--r--test/rexml/test_rexml_issuezilla.rb19
-rw-r--r--test/rexml/test_sax.rb287
-rw-r--r--test/rexml/test_stream.rb130
-rw-r--r--test/rexml/test_text.rb75
-rw-r--r--test/rexml/test_ticket_80.rb59
-rw-r--r--test/rexml/test_validation_rng.rb793
-rw-r--r--test/rexml/test_xml_declaration.rb48
-rw-r--r--test/rexml/xpath/test_attribute.rb38
-rw-r--r--test/rexml/xpath/test_axis_preceding_sibling.rb40
-rw-r--r--test/rexml/xpath/test_base.rb1125
-rw-r--r--test/rexml/xpath/test_compare.rb256
-rw-r--r--test/rexml/xpath/test_node.rb43
-rw-r--r--test/rexml/xpath/test_predicate.rb83
-rw-r--r--test/rexml/xpath/test_text.rb77
-rw-r--r--test/rinda/test_rinda.rb795
-rw-r--r--test/rinda/test_tuplebag.rb173
-rw-r--r--test/ripper/assert_parse_files.rb32
-rw-r--r--test/ripper/dummyparser.rb284
-rw-r--r--test/ripper/test_files_ext.rb8
-rw-r--r--test/ripper/test_files_lib.rb14
-rw-r--r--test/ripper/test_files_sample.rb8
-rw-r--r--test/ripper/test_files_test.rb8
-rw-r--r--test/ripper/test_files_test_1.rb9
-rw-r--r--test/ripper/test_files_test_2.rb9
-rw-r--r--test/ripper/test_filter.rb95
-rw-r--r--test/ripper/test_lexer.rb141
-rw-r--r--test/ripper/test_parser_events.rb1569
-rw-r--r--test/ripper/test_ripper.rb152
-rw-r--r--test/ripper/test_scanner_events.rb991
-rw-r--r--test/ripper/test_sexp.rb473
-rw-r--r--test/rss/dot.pngbin111 -> 0 bytes-rw-r--r--test/rss/rss-assertions.rb2253
-rw-r--r--test/rss/rss-testcase.rb532
-rw-r--r--test/rss/test_1.0.rb553
-rw-r--r--test/rss/test_2.0.rb412
-rw-r--r--test/rss/test_accessor.rb118
-rw-r--r--test/rss/test_atom.rb684
-rw-r--r--test/rss/test_content.rb172
-rw-r--r--test/rss/test_dublincore.rb372
-rw-r--r--test/rss/test_image.rb215
-rw-r--r--test/rss/test_inherit.rb41
-rw-r--r--test/rss/test_itunes.rb356
-rw-r--r--test/rss/test_maker_0.9.rb477
-rw-r--r--test/rss/test_maker_1.0.rb519
-rw-r--r--test/rss/test_maker_2.0.rb758
-rw-r--r--test/rss/test_maker_atom_entry.rb394
-rw-r--r--test/rss/test_maker_atom_feed.rb455
-rw-r--r--test/rss/test_maker_content.rb48
-rw-r--r--test/rss/test_maker_dc.rb150
-rw-r--r--test/rss/test_maker_image.rb63
-rw-r--r--test/rss/test_maker_itunes.rb487
-rw-r--r--test/rss/test_maker_slash.rb38
-rw-r--r--test/rss/test_maker_sy.rb45
-rw-r--r--test/rss/test_maker_taxo.rb82
-rw-r--r--test/rss/test_maker_trackback.rb42
-rw-r--r--test/rss/test_maker_xml-stylesheet.rb84
-rw-r--r--test/rss/test_parser.rb670
-rw-r--r--test/rss/test_parser_1.0.rb529
-rw-r--r--test/rss/test_parser_2.0.rb123
-rw-r--r--test/rss/test_parser_atom_entry.rb164
-rw-r--r--test/rss/test_parser_atom_feed.rb277
-rw-r--r--test/rss/test_setup_maker_0.9.rb247
-rw-r--r--test/rss/test_setup_maker_1.0.rb551
-rw-r--r--test/rss/test_setup_maker_2.0.rb309
-rw-r--r--test/rss/test_setup_maker_atom_entry.rb410
-rw-r--r--test/rss/test_setup_maker_atom_feed.rb446
-rw-r--r--test/rss/test_setup_maker_itunes.rb144
-rw-r--r--test/rss/test_setup_maker_slash.rb39
-rw-r--r--test/rss/test_slash.rb65
-rw-r--r--test/rss/test_syndication.rb215
-rw-r--r--test/rss/test_taxonomy.rb173
-rw-r--r--test/rss/test_to_s.rb701
-rw-r--r--test/rss/test_trackback.rb215
-rw-r--r--test/rss/test_xml-stylesheet.rb203
-rw-r--r--test/ruby/allpairs.rb103
-rw-r--r--test/ruby/beginmainend.rb12
-rw-r--r--test/ruby/bug-11928.rb14
-rw-r--r--test/ruby/bug-13526.rb22
-rw-r--r--test/ruby/enc/test_big5.rb29
-rw-r--r--test/ruby/enc/test_case_comprehensive.rb307
-rw-r--r--test/ruby/enc/test_case_mapping.rb231
-rw-r--r--test/ruby/enc/test_case_options.rb81
-rw-r--r--test/ruby/enc/test_cesu8.rb109
-rw-r--r--test/ruby/enc/test_cp949.rb29
-rw-r--r--test/ruby/enc/test_emoji.rb443
-rw-r--r--test/ruby/enc/test_emoji_breaks.rb122
-rw-r--r--test/ruby/enc/test_euc_jp.rb25
-rw-r--r--test/ruby/enc/test_euc_kr.rb37
-rw-r--r--test/ruby/enc/test_euc_tw.rb29
-rw-r--r--test/ruby/enc/test_gb18030.rb127
-rw-r--r--test/ruby/enc/test_gbk.rb29
-rw-r--r--test/ruby/enc/test_grapheme_breaks.rb95
-rw-r--r--test/ruby/enc/test_iso_8859.rb166
-rw-r--r--test/ruby/enc/test_koi8.rb23
-rw-r--r--test/ruby/enc/test_regex_casefold.rb120
-rw-r--r--test/ruby/enc/test_shift_jis.rb28
-rw-r--r--test/ruby/enc/test_utf16.rb397
-rw-r--r--test/ruby/enc/test_utf32.rb162
-rw-r--r--test/ruby/enc/test_windows_1251.rb17
-rw-r--r--test/ruby/enc/test_windows_1252.rb26
-rw-r--r--test/ruby/endblockwarn.rb12
-rw-r--r--test/ruby/envutil.rb21
-rw-r--r--test/ruby/lbtest.rb49
-rw-r--r--test/ruby/marshaltestlib.rb191
-rw-r--r--test/ruby/sentence.rb669
-rw-r--r--test/ruby/test_alias.rb251
-rw-r--r--test/ruby/test_argf.rb1080
-rw-r--r--test/ruby/test_arithmetic_sequence.rb494
-rw-r--r--test/ruby/test_arity.rb70
-rw-r--r--test/ruby/test_array.rb3156
-rw-r--r--test/ruby/test_assignment.rb805
-rw-r--r--test/ruby/test_ast.rb348
-rw-r--r--test/ruby/test_autoload.rb462
-rw-r--r--test/ruby/test_backtrace.rb346
-rw-r--r--test/ruby/test_basicinstructions.rb722
-rw-r--r--test/ruby/test_beginendblock.rb194
-rw-r--r--test/ruby/test_bignum.rb718
-rw-r--r--test/ruby/test_call.rb87
-rw-r--r--test/ruby/test_case.rb97
-rw-r--r--test/ruby/test_class.rb733
-rw-r--r--test/ruby/test_clone.rb38
-rw-r--r--test/ruby/test_comparable.rb145
-rw-r--r--test/ruby/test_complex.rb1145
-rw-r--r--test/ruby/test_complex2.rb736
-rw-r--r--test/ruby/test_complexrational.rb408
-rw-r--r--test/ruby/test_condition.rb1
-rw-r--r--test/ruby/test_const.rb62
-rw-r--r--test/ruby/test_continuation.rb145
-rw-r--r--test/ruby/test_default_gems.rb16
-rw-r--r--test/ruby/test_defined.rb267
-rw-r--r--test/ruby/test_dir.rb479
-rw-r--r--test/ruby/test_dir_m17n.rb449
-rw-r--r--test/ruby/test_econv.rb928
-rw-r--r--test/ruby/test_encoding.rb137
-rw-r--r--test/ruby/test_enum.rb1179
-rw-r--r--test/ruby/test_enumerator.rb882
-rw-r--r--test/ruby/test_env.rb540
-rw-r--r--test/ruby/test_eval.rb519
-rw-r--r--test/ruby/test_exception.rb1397
-rw-r--r--test/ruby/test_fiber.rb457
-rw-r--r--test/ruby/test_file.rb525
-rw-r--r--test/ruby/test_file_exhaustive.rb1726
-rw-r--r--test/ruby/test_fixnum.rb352
-rw-r--r--test/ruby/test_flip.rb75
-rw-r--r--test/ruby/test_float.rb940
-rw-r--r--test/ruby/test_fnmatch.rb169
-rw-r--r--test/ruby/test_gc.rb452
-rw-r--r--test/ruby/test_gc_compact.rb65
-rw-r--r--test/ruby/test_hash.rb1781
-rw-r--r--test/ruby/test_ifunless.rb17
-rw-r--r--test/ruby/test_integer.rb662
-rw-r--r--test/ruby/test_integer_comb.rb634
-rw-r--r--test/ruby/test_io.rb3912
-rw-r--r--test/ruby/test_io_m17n.rb2747
-rw-r--r--test/ruby/test_iseq.rb571
-rw-r--r--test/ruby/test_iterator.rb214
-rw-r--r--test/ruby/test_jit.rb1124
-rw-r--r--test/ruby/test_key_error.rb42
-rw-r--r--test/ruby/test_keyword.rb5083
-rw-r--r--test/ruby/test_lambda.rb245
-rw-r--r--test/ruby/test_lazy_enumerator.rb681
-rw-r--r--test/ruby/test_literal.rb603
-rw-r--r--test/ruby/test_m17n.rb1714
-rw-r--r--test/ruby/test_m17n_comb.rb1653
-rw-r--r--test/ruby/test_marshal.rb775
-rw-r--r--test/ruby/test_math.rb343
-rw-r--r--test/ruby/test_metaclass.rb168
-rw-r--r--test/ruby/test_method.rb1362
-rw-r--r--test/ruby/test_mixed_unicode_escapes.rb30
-rw-r--r--test/ruby/test_module.rb2548
-rw-r--r--test/ruby/test_not.rb13
-rw-r--r--test/ruby/test_numeric.rb443
-rw-r--r--test/ruby/test_object.rb957
-rw-r--r--test/ruby/test_objectspace.rb236
-rw-r--r--test/ruby/test_optimization.rb848
-rw-r--r--test/ruby/test_pack.rb853
-rw-r--r--test/ruby/test_parse.rb1180
-rw-r--r--test/ruby/test_path.rb225
-rw-r--r--test/ruby/test_pattern_matching.rb1342
-rw-r--r--test/ruby/test_pipe.rb37
-rw-r--r--test/ruby/test_primitive.rb424
-rw-r--r--test/ruby/test_proc.rb1567
-rw-r--r--test/ruby/test_process.rb2461
-rw-r--r--test/ruby/test_rand.rb594
-rw-r--r--test/ruby/test_range.rb955
-rw-r--r--test/ruby/test_rational.rb1069
-rw-r--r--test/ruby/test_rational2.rb1387
-rw-r--r--test/ruby/test_readpartial.rb73
-rw-r--r--test/ruby/test_refinement.rb2390
-rw-r--r--test/ruby/test_regexp.rb1331
-rw-r--r--test/ruby/test_require.rb870
-rw-r--r--test/ruby/test_require_lib.rb28
-rw-r--r--test/ruby/test_rubyoptions.rb1095
-rw-r--r--test/ruby/test_rubyvm.rb18
-rw-r--r--test/ruby/test_rubyvm_mjit.rb91
-rw-r--r--test/ruby/test_settracefunc.rb2308
-rw-r--r--test/ruby/test_signal.rb386
-rw-r--r--test/ruby/test_sleep.rb17
-rw-r--r--test/ruby/test_sprintf.rb546
-rw-r--r--test/ruby/test_sprintf_comb.rb554
-rw-r--r--test/ruby/test_string.rb3189
-rw-r--r--test/ruby/test_stringchar.rb116
-rw-r--r--test/ruby/test_struct.rb457
-rw-r--r--test/ruby/test_super.rb586
-rw-r--r--test/ruby/test_symbol.rb581
-rw-r--r--test/ruby/test_syntax.rb1706
-rw-r--r--test/ruby/test_system.rb220
-rw-r--r--test/ruby/test_thread.rb1392
-rw-r--r--test/ruby/test_thread_cv.rb245
-rw-r--r--test/ruby/test_thread_queue.rb630
-rw-r--r--test/ruby/test_threadgroup.rb57
-rw-r--r--test/ruby/test_time.rb1224
-rw-r--r--test/ruby/test_time_tz.rb800
-rw-r--r--test/ruby/test_trace.rb36
-rw-r--r--test/ruby/test_transcode.rb2261
-rw-r--r--test/ruby/test_undef.rb38
-rw-r--r--test/ruby/test_unicode_escape.rb272
-rw-r--r--test/ruby/test_variable.rb190
-rw-r--r--test/ruby/test_vm_dump.rb21
-rw-r--r--test/ruby/test_weakmap.rb170
-rw-r--r--test/ruby/test_whileuntil.rb114
-rw-r--r--test/ruby/test_yield.rb425
-rw-r--r--test/ruby/ut_eof.rb26
-rw-r--r--test/rubygems/alternate_cert.pem19
-rw-r--r--test/rubygems/alternate_cert_32.pem19
-rw-r--r--test/rubygems/alternate_key.pem27
-rw-r--r--test/rubygems/bad_rake.rb2
-rw-r--r--test/rubygems/bogussources.rb9
-rw-r--r--test/rubygems/ca_cert.pem77
-rw-r--r--test/rubygems/child_cert.pem20
-rw-r--r--test/rubygems/child_cert_32.pem20
-rw-r--r--test/rubygems/child_key.pem27
-rw-r--r--test/rubygems/client.pem107
-rw-r--r--test/rubygems/data/gem-private_key.pem27
-rw-r--r--test/rubygems/data/gem-public_cert.pem20
-rw-r--r--test/rubygems/data/null-type.gemspec.rzbin554 -> 0 bytes-rw-r--r--test/rubygems/encrypted_private_key.pem30
-rw-r--r--test/rubygems/expired_cert.pem19
-rw-r--r--test/rubygems/fake_certlib/openssl.rb8
-rw-r--r--test/rubygems/foo/discover.rb1
-rw-r--r--test/rubygems/future_cert.pem19
-rw-r--r--test/rubygems/future_cert_32.pem19
-rw-r--r--test/rubygems/good_rake.rb2
-rw-r--r--test/rubygems/grandchild_cert.pem20
-rw-r--r--test/rubygems/grandchild_cert_32.pem20
-rw-r--r--test/rubygems/grandchild_key.pem27
-rw-r--r--test/rubygems/invalid_client.pem49
-rw-r--r--test/rubygems/invalid_issuer_cert.pem20
-rw-r--r--test/rubygems/invalid_issuer_cert_32.pem20
-rw-r--r--test/rubygems/invalid_key.pem27
-rw-r--r--test/rubygems/invalid_signer_cert.pem19
-rw-r--r--test/rubygems/invalid_signer_cert_32.pem19
-rw-r--r--test/rubygems/invalidchild_cert.pem20
-rw-r--r--test/rubygems/invalidchild_cert_32.pem20
-rw-r--r--test/rubygems/invalidchild_key.pem27
-rw-r--r--test/rubygems/plugin/exception/rubygems_plugin.rb3
-rw-r--r--test/rubygems/plugin/load/rubygems_plugin.rb6
-rw-r--r--test/rubygems/plugin/standarderror/rubygems_plugin.rb3
-rw-r--r--test/rubygems/private3072_key.pem40
-rw-r--r--test/rubygems/private_key.pem27
-rw-r--r--test/rubygems/public3072_cert.pem25
-rw-r--r--test/rubygems/public_cert.pem20
-rw-r--r--test/rubygems/public_cert_32.pem19
-rw-r--r--test/rubygems/public_key.pem9
-rw-r--r--test/rubygems/rubygems/commands/crash_command.rb6
-rw-r--r--test/rubygems/rubygems_plugin.rb25
-rw-r--r--test/rubygems/sff/discover.rb1
-rw-r--r--test/rubygems/simple_gem.rb67
-rw-r--r--test/rubygems/specifications/bar-0.0.2.gemspec9
-rw-r--r--test/rubygems/specifications/foo-0.0.1-x86-mswin32.gemspecbin269 -> 0 bytes-rw-r--r--test/rubygems/specifications/rubyforge-0.0.1.gemspec14
-rw-r--r--test/rubygems/ssl_cert.pem80
-rw-r--r--test/rubygems/ssl_key.pem27
-rw-r--r--test/rubygems/test_bundled_ca.rb67
-rw-r--r--test/rubygems/test_config.rb29
-rw-r--r--test/rubygems/test_deprecate.rb80
-rw-r--r--test/rubygems/test_gem.rb2032
-rw-r--r--test/rubygems/test_gem_available_set.rb131
-rw-r--r--test/rubygems/test_gem_bundler_version_finder.rb132
-rw-r--r--test/rubygems/test_gem_command.rb371
-rw-r--r--test/rubygems/test_gem_command_manager.rb271
-rw-r--r--test/rubygems/test_gem_commands_build_command.rb509
-rw-r--r--test/rubygems/test_gem_commands_cert_command.rb810
-rw-r--r--test/rubygems/test_gem_commands_check_command.rb69
-rw-r--r--test/rubygems/test_gem_commands_cleanup_command.rb282
-rw-r--r--test/rubygems/test_gem_commands_contents_command.rb239
-rw-r--r--test/rubygems/test_gem_commands_dependency_command.rb229
-rw-r--r--test/rubygems/test_gem_commands_environment_command.rb145
-rw-r--r--test/rubygems/test_gem_commands_fetch_command.rb126
-rw-r--r--test/rubygems/test_gem_commands_generate_index_command.rb86
-rw-r--r--test/rubygems/test_gem_commands_help_command.rb75
-rw-r--r--test/rubygems/test_gem_commands_info_command.rb45
-rw-r--r--test/rubygems/test_gem_commands_install_command.rb1350
-rw-r--r--test/rubygems/test_gem_commands_list_command.rb34
-rw-r--r--test/rubygems/test_gem_commands_lock_command.rb68
-rw-r--r--test/rubygems/test_gem_commands_mirror.rb21
-rw-r--r--test/rubygems/test_gem_commands_open_command.rb100
-rw-r--r--test/rubygems/test_gem_commands_outdated_command.rb33
-rw-r--r--test/rubygems/test_gem_commands_owner_command.rb272
-rw-r--r--test/rubygems/test_gem_commands_pristine_command.rb627
-rw-r--r--test/rubygems/test_gem_commands_push_command.rb409
-rw-r--r--test/rubygems/test_gem_commands_query_command.rb857
-rw-r--r--test/rubygems/test_gem_commands_search_command.rb17
-rw-r--r--test/rubygems/test_gem_commands_server_command.rb63
-rw-r--r--test/rubygems/test_gem_commands_setup_command.rb372
-rw-r--r--test/rubygems/test_gem_commands_signin_command.rb99
-rw-r--r--test/rubygems/test_gem_commands_signout_command.rb37
-rw-r--r--test/rubygems/test_gem_commands_sources_command.rb426
-rw-r--r--test/rubygems/test_gem_commands_specification_command.rb250
-rw-r--r--test/rubygems/test_gem_commands_stale_command.rb44
-rw-r--r--test/rubygems/test_gem_commands_uninstall_command.rb506
-rw-r--r--test/rubygems/test_gem_commands_unpack_command.rb225
-rw-r--r--test/rubygems/test_gem_commands_update_command.rb588
-rw-r--r--test/rubygems/test_gem_commands_which_command.rb86
-rw-r--r--test/rubygems/test_gem_commands_yank_command.rb144
-rw-r--r--test/rubygems/test_gem_config_file.rb499
-rw-r--r--test/rubygems/test_gem_dependency.rb395
-rw-r--r--test/rubygems/test_gem_dependency_installer.rb1269
-rw-r--r--test/rubygems/test_gem_dependency_list.rb266
-rw-r--r--test/rubygems/test_gem_dependency_resolution_error.rb28
-rw-r--r--test/rubygems/test_gem_doctor.rb168
-rw-r--r--test/rubygems/test_gem_ext_builder.rb332
-rw-r--r--test/rubygems/test_gem_ext_cmake_builder.rb90
-rw-r--r--test/rubygems/test_gem_ext_configure_builder.rb95
-rw-r--r--test/rubygems/test_gem_ext_ext_conf_builder.rb245
-rw-r--r--test/rubygems/test_gem_ext_rake_builder.rb95
-rw-r--r--test/rubygems/test_gem_gem_runner.rb70
-rw-r--r--test/rubygems/test_gem_gemcutter_utilities.rb261
-rw-r--r--test/rubygems/test_gem_impossible_dependencies_error.rb61
-rw-r--r--test/rubygems/test_gem_indexer.rb363
-rw-r--r--test/rubygems/test_gem_install_update_options.rb197
-rw-r--r--test/rubygems/test_gem_installer.rb2090
-rw-r--r--test/rubygems/test_gem_local_remote_options.rb134
-rw-r--r--test/rubygems/test_gem_name_tuple.rb44
-rw-r--r--test/rubygems/test_gem_package.rb1165
-rw-r--r--test/rubygems/test_gem_package_old.rb92
-rw-r--r--test/rubygems/test_gem_package_tar_header.rb208
-rw-r--r--test/rubygems/test_gem_package_tar_reader.rb89
-rw-r--r--test/rubygems/test_gem_package_tar_reader_entry.rb154
-rw-r--r--test/rubygems/test_gem_package_tar_writer.rb334
-rw-r--r--test/rubygems/test_gem_package_task.rb84
-rw-r--r--test/rubygems/test_gem_path_support.rb144
-rw-r--r--test/rubygems/test_gem_platform.rb309
-rw-r--r--test/rubygems/test_gem_rdoc.rb138
-rw-r--r--test/rubygems/test_gem_remote_fetcher.rb1187
-rw-r--r--test/rubygems/test_gem_request.rb513
-rw-r--r--test/rubygems/test_gem_request_connection_pools.rb154
-rw-r--r--test/rubygems/test_gem_request_set.rb672
-rw-r--r--test/rubygems/test_gem_request_set_gem_dependency_api.rb849
-rw-r--r--test/rubygems/test_gem_request_set_lockfile.rb470
-rw-r--r--test/rubygems/test_gem_request_set_lockfile_parser.rb545
-rw-r--r--test/rubygems/test_gem_request_set_lockfile_tokenizer.rb308
-rw-r--r--test/rubygems/test_gem_requirement.rb425
-rw-r--r--test/rubygems/test_gem_resolver.rb793
-rw-r--r--test/rubygems/test_gem_resolver_activation_request.rb44
-rw-r--r--test/rubygems/test_gem_resolver_api_set.rb208
-rw-r--r--test/rubygems/test_gem_resolver_api_specification.rb168
-rw-r--r--test/rubygems/test_gem_resolver_best_set.rb137
-rw-r--r--test/rubygems/test_gem_resolver_composed_set.rb45
-rw-r--r--test/rubygems/test_gem_resolver_conflict.rb83
-rw-r--r--test/rubygems/test_gem_resolver_dependency_request.rb84
-rw-r--r--test/rubygems/test_gem_resolver_git_set.rb189
-rw-r--r--test/rubygems/test_gem_resolver_git_specification.rb114
-rw-r--r--test/rubygems/test_gem_resolver_index_set.rb89
-rw-r--r--test/rubygems/test_gem_resolver_index_specification.rb94
-rw-r--r--test/rubygems/test_gem_resolver_installed_specification.rb48
-rw-r--r--test/rubygems/test_gem_resolver_installer_set.rb259
-rw-r--r--test/rubygems/test_gem_resolver_local_specification.rb45
-rw-r--r--test/rubygems/test_gem_resolver_lock_set.rb63
-rw-r--r--test/rubygems/test_gem_resolver_lock_specification.rb99
-rw-r--r--test/rubygems/test_gem_resolver_requirement_list.rb20
-rw-r--r--test/rubygems/test_gem_resolver_specification.rb66
-rw-r--r--test/rubygems/test_gem_resolver_vendor_set.rb83
-rw-r--r--test/rubygems/test_gem_resolver_vendor_specification.rb83
-rw-r--r--test/rubygems/test_gem_security.rb314
-rw-r--r--test/rubygems/test_gem_security_policy.rb540
-rw-r--r--test/rubygems/test_gem_security_signer.rb219
-rw-r--r--test/rubygems/test_gem_security_trust_dir.rb100
-rw-r--r--test/rubygems/test_gem_server.rb612
-rw-r--r--test/rubygems/test_gem_silent_ui.rb118
-rw-r--r--test/rubygems/test_gem_source.rb252
-rw-r--r--test/rubygems/test_gem_source_fetch_problem.rb28
-rw-r--r--test/rubygems/test_gem_source_git.rb303
-rw-r--r--test/rubygems/test_gem_source_installed.rb36
-rw-r--r--test/rubygems/test_gem_source_list.rb119
-rw-r--r--test/rubygems/test_gem_source_local.rb108
-rw-r--r--test/rubygems/test_gem_source_lock.rb114
-rw-r--r--test/rubygems/test_gem_source_specific_file.rb77
-rw-r--r--test/rubygems/test_gem_source_vendor.rb31
-rw-r--r--test/rubygems/test_gem_spec_fetcher.rb330
-rw-r--r--test/rubygems/test_gem_specification.rb3900
-rw-r--r--test/rubygems/test_gem_stream_ui.rb224
-rw-r--r--test/rubygems/test_gem_stub_specification.rb295
-rw-r--r--test/rubygems/test_gem_text.rb98
-rw-r--r--test/rubygems/test_gem_uninstaller.rb545
-rw-r--r--test/rubygems/test_gem_unsatisfiable_dependency_error.rb32
-rw-r--r--test/rubygems/test_gem_uri_formatter.rb28
-rw-r--r--test/rubygems/test_gem_util.rb88
-rw-r--r--test/rubygems/test_gem_validator.rb44
-rw-r--r--test/rubygems/test_gem_version.rb302
-rw-r--r--test/rubygems/test_gem_version_option.rb166
-rw-r--r--test/rubygems/test_kernel.rb143
-rw-r--r--test/rubygems/test_project_sanity.rb15
-rw-r--r--test/rubygems/test_remote_fetch_error.rb21
-rw-r--r--test/rubygems/test_require.rb646
-rw-r--r--test/rubygems/wrong_key_cert.pem19
-rw-r--r--test/rubygems/wrong_key_cert_32.pem19
-rw-r--r--test/runner.rb14
-rw-r--r--test/sdbm/test_sdbm.rb544
-rw-r--r--test/soap/calc/calc.rb17
-rw-r--r--test/soap/calc/calc2.rb29
-rw-r--r--test/soap/calc/server.cgi13
-rw-r--r--test/soap/calc/server.rb17
-rw-r--r--test/soap/calc/server2.rb20
-rw-r--r--test/soap/calc/test_calc.rb56
-rw-r--r--test/soap/calc/test_calc2.rb60
-rw-r--r--test/soap/calc/test_calc_cgi.rb76
-rw-r--r--test/soap/header/server.cgi119
-rw-r--r--test/soap/header/test_authheader.rb247
-rw-r--r--test/soap/header/test_authheader_cgi.rb128
-rw-r--r--test/soap/helloworld/hw_s.rb16
-rw-r--r--test/soap/helloworld/test_helloworld.rb47
-rw-r--r--test/soap/marshal/test_digraph.rb56
-rw-r--r--test/soap/marshal/test_marshal.rb26
-rw-r--r--test/soap/marshal/test_struct.rb47
-rw-r--r--test/soap/ssl/README1
-rw-r--r--test/soap/ssl/ca.cert23
-rw-r--r--test/soap/ssl/client.cert19
-rw-r--r--test/soap/ssl/client.key15
-rw-r--r--test/soap/ssl/server.cert19
-rw-r--r--test/soap/ssl/server.key15
-rw-r--r--test/soap/ssl/sslsvr.rb56
-rw-r--r--test/soap/ssl/subca.cert21
-rw-r--r--test/soap/ssl/test_ssl.rb212
-rw-r--r--test/soap/struct/test_struct.rb83
-rw-r--r--test/soap/swa/test_file.rb77
-rw-r--r--test/soap/test_basetype.rb964
-rw-r--r--test/soap/test_property.rb422
-rw-r--r--test/soap/test_soapelement.rb121
-rw-r--r--test/soap/test_streamhandler.rb197
-rw-r--r--test/soap/wsdlDriver/README.txt2
-rw-r--r--test/soap/wsdlDriver/echo_version.rb20
-rw-r--r--test/soap/wsdlDriver/simpletype.wsdl63
-rw-r--r--test/soap/wsdlDriver/test_simpletype.rb92
-rw-r--r--test/socket/test_addrinfo.rb696
-rw-r--r--test/socket/test_ancdata.rb68
-rw-r--r--test/socket/test_basicsocket.rb230
-rw-r--r--test/socket/test_nonblock.rb397
-rw-r--r--test/socket/test_socket.rb754
-rw-r--r--test/socket/test_sockopt.rb80
-rw-r--r--test/socket/test_tcp.rb123
-rw-r--r--test/socket/test_udp.rb116
-rw-r--r--test/socket/test_unix.rb711
-rw-r--r--test/stringio/test_stringio.rb806
-rw-r--r--test/strscan/test_stringscanner.rb563
-rw-r--r--test/syslog/test_syslog_logger.rb588
-rw-r--r--test/test_abbrev.rb55
-rw-r--r--test/test_delegate.rb355
-rw-r--r--test/test_extlibs.rb83
-rw-r--r--test/test_find.rb334
-rw-r--r--test/test_forwardable.rb402
-rw-r--r--test/test_ipaddr.rb391
-rw-r--r--test/test_mutex_m.rb26
-rw-r--r--test/test_observer.rb66
-rw-r--r--test/test_open3.rb325
-rw-r--r--test/test_pp.rb223
-rw-r--r--test/test_prettyprint.rb521
-rw-r--r--test/test_prime.rb280
-rw-r--r--test/test_pstore.rb150
-rw-r--r--test/test_pty.rb239
-rw-r--r--test/test_rbconfig.rb63
-rw-r--r--test/test_securerandom.rb199
-rw-r--r--test/test_set.rb918
-rw-r--r--test/test_shellwords.rb131
-rw-r--r--test/test_singleton.rb104
-rw-r--r--test/test_syslog.rb193
-rw-r--r--test/test_tempfile.rb405
-rw-r--r--test/test_time.rb579
-rw-r--r--test/test_timeout.rb110
-rw-r--r--test/test_tmpdir.rb95
-rw-r--r--test/test_tracer.rb234
-rw-r--r--test/test_tsort.rb115
-rw-r--r--test/test_unicode_normalize.rb212
-rw-r--r--test/test_weakref.rb72
-rw-r--r--test/test_win32api.rb27
-rw-r--r--test/testunit/collector/test_dir.rb389
-rw-r--r--test/testunit/collector/test_objectspace.rb98
-rw-r--r--test/testunit/runit/test_assert.rb402
-rw-r--r--test/testunit/runit/test_testcase.rb91
-rw-r--r--test/testunit/runit/test_testresult.rb144
-rw-r--r--test/testunit/runit/test_testsuite.rb49
-rw-r--r--test/testunit/test_assertions.rb528
-rw-r--r--test/testunit/test_error.rb26
-rw-r--r--test/testunit/test_failure.rb33
-rw-r--r--test/testunit/test_testcase.rb275
-rw-r--r--test/testunit/test_testresult.rb104
-rw-r--r--test/testunit/test_testsuite.rb129
-rw-r--r--test/testunit/util/test_backtracefilter.rb41
-rw-r--r--test/testunit/util/test_observable.rb102
-rw-r--r--test/testunit/util/test_procwrapper.rb36
-rw-r--r--test/uri/test_common.rb176
-rw-r--r--test/uri/test_file.rb67
-rw-r--r--test/uri/test_ftp.rb31
-rw-r--r--test/uri/test_generic.rb520
-rw-r--r--test/uri/test_http.rb11
-rw-r--r--test/uri/test_ldap.rb37
-rw-r--r--test/uri/test_mailto.rb117
-rw-r--r--test/uri/test_parser.rb61
-rw-r--r--test/webrick/.htaccess1
-rw-r--r--test/webrick/test_cgi.rb170
-rw-r--r--test/webrick/test_config.rb17
-rw-r--r--test/webrick/test_cookie.rb141
-rw-r--r--test/webrick/test_do_not_reverse_lookup.rb71
-rw-r--r--test/webrick/test_filehandler.rb353
-rw-r--r--test/webrick/test_htgroup.rb19
-rw-r--r--test/webrick/test_htmlutils.rb21
-rw-r--r--test/webrick/test_httpauth.rb366
-rw-r--r--test/webrick/test_httpproxy.rb466
-rw-r--r--test/webrick/test_httprequest.rb476
-rw-r--r--test/webrick/test_httpresponse.rb282
-rw-r--r--test/webrick/test_https.rb112
-rw-r--r--test/webrick/test_httpserver.rb543
-rw-r--r--test/webrick/test_httpstatus.rb35
-rw-r--r--test/webrick/test_httputils.rb101
-rw-r--r--test/webrick/test_httpversion.rb41
-rw-r--r--test/webrick/test_server.rb163
-rw-r--r--test/webrick/test_ssl_server.rb67
-rw-r--r--test/webrick/test_utils.rb110
-rw-r--r--test/webrick/utils.rb82
-rw-r--r--test/webrick/webrick.cgi38
-rw-r--r--test/webrick/webrick.rhtml4
-rw-r--r--test/webrick/webrick_long_filename.cgi36
-rw-r--r--test/win32ole/available_ole.rb41
-rw-r--r--test/win32ole/err_in_callback.rb10
-rw-r--r--test/win32ole/orig_data.csv5
-rw-r--r--test/win32ole/test_err_in_callback.rb56
-rw-r--r--test/win32ole/test_folderitem2_invokeverb.rb66
-rw-r--r--test/win32ole/test_nil2vtempty.rb37
-rw-r--r--test/win32ole/test_ole_methods.rb35
-rw-r--r--test/win32ole/test_propertyputref.rb31
-rw-r--r--test/win32ole/test_thread.rb34
-rw-r--r--test/win32ole/test_win32ole.rb534
-rw-r--r--test/win32ole/test_win32ole_event.rb406
-rw-r--r--test/win32ole/test_win32ole_method.rb134
-rw-r--r--test/win32ole/test_win32ole_method_event.rb36
-rw-r--r--test/win32ole/test_win32ole_param.rb98
-rw-r--r--test/win32ole/test_win32ole_param_event.rb30
-rw-r--r--test/win32ole/test_win32ole_record.rb209
-rw-r--r--test/win32ole/test_win32ole_type.rb200
-rw-r--r--test/win32ole/test_win32ole_type_event.rb44
-rw-r--r--test/win32ole/test_win32ole_typelib.rb117
-rw-r--r--test/win32ole/test_win32ole_variable.rb62
-rw-r--r--test/win32ole/test_win32ole_variant.rb722
-rw-r--r--test/win32ole/test_win32ole_variant_m.rb36
-rw-r--r--test/win32ole/test_win32ole_variant_outarg.rb69
-rw-r--r--test/win32ole/test_word.rb73
-rw-r--r--test/wsdl/axisArray/axisArray.wsdl60
-rw-r--r--test/wsdl/axisArray/itemList.rb27
-rw-r--r--test/wsdl/axisArray/test_axisarray.rb69
-rw-r--r--test/wsdl/datetime/DatetimeService.rb38
-rw-r--r--test/wsdl/datetime/datetime.rb (renamed from spec/mspec/spec/commands/fixtures/four.txt)0
-rw-r--r--test/wsdl/datetime/datetime.wsdl45
-rw-r--r--test/wsdl/datetime/datetimeServant.rb21
-rw-r--r--test/wsdl/datetime/test_datetime.rb88
-rw-r--r--test/wsdl/emptycomplextype.wsdl31
-rw-r--r--test/wsdl/map/map.wsdl66
-rw-r--r--test/wsdl/map/map.xml43
-rw-r--r--test/wsdl/map/test_map.rb37
-rw-r--r--test/wsdl/multiplefault.wsdl68
-rw-r--r--test/wsdl/raa/RAA.rb243
-rw-r--r--test/wsdl/raa/RAAServant.rb99
-rw-r--r--test/wsdl/raa/RAAService.rb101
-rw-r--r--test/wsdl/raa/README.txt8
-rw-r--r--test/wsdl/raa/raa.wsdl264
-rw-r--r--test/wsdl/raa/test_raa.rb78
-rw-r--r--test/wsdl/simpletype/simpletype.wsdl67
-rw-r--r--test/wsdl/simpletype/test_simpletype.rb81
-rw-r--r--test/wsdl/soap/soapbodyparts.wsdl103
-rw-r--r--test/wsdl/soap/test_soapbodyparts.rb86
-rw-r--r--test/wsdl/test_emptycomplextype.rb21
-rw-r--r--test/wsdl/test_fault.rb51
-rw-r--r--test/wsdl/test_multiplefault.rb39
-rw-r--r--test/xsd/noencoding.xml4
-rw-r--r--test/xsd/test_noencoding.rb32
-rw-r--r--test/xsd/test_xmlschemaparser.rb22
-rw-r--r--test/xsd/test_xsd.rb1011
-rw-r--r--test/xsd/xmlschema.xml12
-rw-r--r--test/yaml/test_store.rb180
-rw-r--r--test/yaml/test_yaml.rb1246
-rw-r--r--test/zlib/test_zlib.rb1308
-rw-r--r--thread.c5563
-rw-r--r--thread_pthread.c2176
-rw-r--r--thread_pthread.h77
-rw-r--r--thread_sync.c1540
-rw-r--r--thread_win32.c845
-rw-r--r--thread_win32.h38
-rw-r--r--time.c6427
-rw-r--r--timev.h56
-rwxr-xr-xtool/actions-commit-info.sh17
-rw-r--r--tool/asm_parse.rb53
-rwxr-xr-xtool/bisect.sh50
-rwxr-xr-xtool/build-transcode16
-rwxr-xr-xtool/checksum.rb72
-rw-r--r--tool/colors3
-rwxr-xr-xtool/darwin-cc6
-rw-r--r--tool/downloader.rb392
-rw-r--r--tool/enc-emoji-citrus-gen.rb131
-rw-r--r--tool/enc-emoji4unicode.rb133
-rwxr-xr-xtool/enc-unicode.rb577
-rw-r--r--tool/eval.rb158
-rwxr-xr-xtool/expand-config.rb33
-rwxr-xr-xtool/extlibs.rb187
-rw-r--r--tool/fake.rb57
-rwxr-xr-xtool/fetch-bundled_gems.rb31
-rwxr-xr-xtool/file2lastrev.rb124
-rwxr-xr-xtool/format-release245
-rw-r--r--tool/gem-unpack.rb18
-rwxr-xr-xtool/gen-mailmap.rb47
-rwxr-xr-xtool/gen_dummy_probes.rb32
-rwxr-xr-xtool/gen_ruby_tapset.rb105
-rw-r--r--tool/generic_erb.rb61
-rwxr-xr-xtool/git-refresh46
-rw-r--r--tool/gperf.sed22
-rwxr-xr-xtool/id2token.rb26
-rwxr-xr-xtool/ifchange90
-rwxr-xr-xtool/insns2vm.rb15
-rw-r--r--tool/install-sh17
-rwxr-xr-xtool/leaked-globals40
-rw-r--r--tool/lib/-test-/integer.rb14
-rw-r--r--tool/lib/colorize.rb51
-rw-r--r--tool/lib/envutil.rb345
-rw-r--r--tool/lib/find_executable.rb22
-rw-r--r--tool/lib/gc_compact_checker.rb10
-rw-r--r--tool/lib/iseq_loader_checker.rb81
-rw-r--r--tool/lib/jisx0208.rb86
-rw-r--r--tool/lib/leakchecker.rb240
-rw-r--r--tool/lib/memory_status.rb149
-rw-r--r--tool/lib/minitest/README.txt457
-rw-r--r--tool/lib/minitest/autorun.rb14
-rw-r--r--tool/lib/minitest/benchmark.rb418
-rw-r--r--tool/lib/minitest/mock.rb196
-rw-r--r--tool/lib/minitest/unit.rb1434
-rw-r--r--tool/lib/profile_test_all.rb91
-rw-r--r--tool/lib/test/unit.rb1219
-rw-r--r--tool/lib/test/unit/assertions.rb583
-rw-r--r--tool/lib/test/unit/core_assertions.rb420
-rw-r--r--tool/lib/test/unit/parallel.rb214
-rw-r--r--tool/lib/test/unit/testcase.rb36
-rw-r--r--tool/lib/tracepointchecker.rb126
-rw-r--r--tool/lib/vcs.rb749
-rw-r--r--tool/lib/vpath.rb87
-rw-r--r--tool/lib/zombie_hunter.rb10
-rw-r--r--tool/m4/_colorize_result_prepare.m433
-rw-r--r--tool/m4/ac_msg_result.m45
-rw-r--r--tool/m4/colorize_result.m49
-rw-r--r--tool/m4/ruby_append_option.m45
-rw-r--r--tool/m4/ruby_append_options.m47
-rw-r--r--tool/m4/ruby_check_builtin_func.m410
-rw-r--r--tool/m4/ruby_check_builtin_setjmp.m427
-rw-r--r--tool/m4/ruby_check_printf_prefix.m429
-rw-r--r--tool/m4/ruby_check_setjmp.m417
-rw-r--r--tool/m4/ruby_check_signedness.m45
-rw-r--r--tool/m4/ruby_check_sizeof.m4108
-rw-r--r--tool/m4/ruby_check_sysconf.m413
-rw-r--r--tool/m4/ruby_cppoutfile.m418
-rw-r--r--tool/m4/ruby_decl_attribute.m445
-rw-r--r--tool/m4/ruby_default_arch.m411
-rw-r--r--tool/m4/ruby_define_if.m412
-rw-r--r--tool/m4/ruby_defint.m440
-rw-r--r--tool/m4/ruby_dtrace_available.m420
-rw-r--r--tool/m4/ruby_dtrace_postprocess.m430
-rw-r--r--tool/m4/ruby_func_attribute.m47
-rw-r--r--tool/m4/ruby_mingw32.m424
-rw-r--r--tool/m4/ruby_prepend_option.m45
-rw-r--r--tool/m4/ruby_prog_gnu_ld.m410
-rw-r--r--tool/m4/ruby_replace_funcs.m413
-rw-r--r--tool/m4/ruby_replace_type.m458
-rw-r--r--tool/m4/ruby_rm_recursive.m418
-rw-r--r--tool/m4/ruby_setjmp_type.m452
-rw-r--r--tool/m4/ruby_stack_grow_direction.m430
-rw-r--r--tool/m4/ruby_try_cflags.m412
-rw-r--r--tool/m4/ruby_try_ldflags.m415
-rw-r--r--tool/m4/ruby_type_attribute.m48
-rw-r--r--tool/m4/ruby_universal_arch.m490
-rw-r--r--tool/m4/ruby_werror_flag.m418
-rwxr-xr-xtool/make-snapshot644
-rw-r--r--tool/make_hgraph.rb95
-rwxr-xr-xtool/mdoc2man.rb505
-rwxr-xr-xtool/merger.rb371
-rw-r--r--tool/mjit_archflag.sh40
-rw-r--r--tool/mk_builtin_binary.rb44
-rw-r--r--tool/mk_builtin_loader.rb201
-rw-r--r--tool/mk_call_iseq_optimized.rb74
-rwxr-xr-xtool/mkconfig.rb380
-rwxr-xr-xtool/mkrunnable.rb135
-rwxr-xr-xtool/node_name.rb8
-rw-r--r--tool/parse.rb16
-rw-r--r--tool/prereq.status44
-rw-r--r--tool/probes_to_wiki.rb16
-rwxr-xr-xtool/pure_parser.rb24
-rwxr-xr-xtool/rbinstall.rb956
-rwxr-xr-xtool/rbuninstall.rb71
-rwxr-xr-xtool/redmine-backporter.rb589
-rwxr-xr-xtool/release.sh19
-rwxr-xr-xtool/rmdirs14
-rw-r--r--tool/ruby_vm/controllers/application_controller.rb25
-rw-r--r--tool/ruby_vm/helpers/c_escape.rb128
-rw-r--r--tool/ruby_vm/helpers/dumper.rb112
-rw-r--r--tool/ruby_vm/helpers/scanner.rb52
-rw-r--r--tool/ruby_vm/loaders/insns_def.rb96
-rw-r--r--tool/ruby_vm/loaders/opt_insn_unif_def.rb34
-rw-r--r--tool/ruby_vm/loaders/opt_operand_def.rb56
-rw-r--r--tool/ruby_vm/loaders/vm_opts_h.rb37
-rw-r--r--tool/ruby_vm/models/attribute.rb59
-rwxr-xr-xtool/ruby_vm/models/bare_instructions.rb236
-rw-r--r--tool/ruby_vm/models/c_expr.rb41
-rw-r--r--tool/ruby_vm/models/instructions.rb22
-rw-r--r--tool/ruby_vm/models/instructions_unifications.rb43
-rw-r--r--tool/ruby_vm/models/operands_unifications.rb142
-rw-r--r--tool/ruby_vm/models/trace_instructions.rb71
-rw-r--r--tool/ruby_vm/models/typemap.rb63
-rw-r--r--tool/ruby_vm/scripts/converter.rb29
-rw-r--r--tool/ruby_vm/scripts/insns2vm.rb93
-rw-r--r--tool/ruby_vm/tests/.gitkeep0
-rw-r--r--tool/ruby_vm/views/_attributes.erb35
-rw-r--r--tool/ruby_vm/views/_c_expr.erb17
-rw-r--r--tool/ruby_vm/views/_comptime_insn_stack_increase.erb62
-rw-r--r--tool/ruby_vm/views/_copyright.erb31
-rw-r--r--tool/ruby_vm/views/_insn_entry.erb76
-rw-r--r--tool/ruby_vm/views/_insn_len_info.erb21
-rw-r--r--tool/ruby_vm/views/_insn_name_info.erb38
-rw-r--r--tool/ruby_vm/views/_insn_operand_info.erb46
-rw-r--r--tool/ruby_vm/views/_insn_sp_pc_dependency.erb27
-rw-r--r--tool/ruby_vm/views/_insn_type_chars.erb13
-rw-r--r--tool/ruby_vm/views/_leaf_helpers.erb108
-rw-r--r--tool/ruby_vm/views/_mjit_compile_insn.erb92
-rw-r--r--tool/ruby_vm/views/_mjit_compile_insn_body.erb115
-rw-r--r--tool/ruby_vm/views/_mjit_compile_ivar.erb54
-rw-r--r--tool/ruby_vm/views/_mjit_compile_pc_and_sp.erb36
-rw-r--r--tool/ruby_vm/views/_mjit_compile_send.erb107
-rw-r--r--tool/ruby_vm/views/_notice.erb22
-rw-r--r--tool/ruby_vm/views/_sp_inc_helpers.erb37
-rw-r--r--tool/ruby_vm/views/_trace_instruction.erb16
-rw-r--r--tool/ruby_vm/views/insns.inc.erb26
-rw-r--r--tool/ruby_vm/views/insns_info.inc.erb22
-rw-r--r--tool/ruby_vm/views/mjit_compile.inc.erb93
-rw-r--r--tool/ruby_vm/views/opt_sc.inc.erb40
-rw-r--r--tool/ruby_vm/views/optinsn.inc.erb71
-rw-r--r--tool/ruby_vm/views/optunifs.inc.erb21
-rw-r--r--tool/ruby_vm/views/vm.inc.erb30
-rw-r--r--tool/ruby_vm/views/vmtc.inc.erb21
-rw-r--r--tool/run-gcov.rb54
-rw-r--r--tool/run-lcov.rb164
-rwxr-xr-xtool/runruby.rb175
-rwxr-xr-xtool/strip-rdoc.rb26
-rw-r--r--tool/sync_default_gems.rb407
-rw-r--r--tool/test-bundled-gems.rb28
-rw-r--r--tool/test-coverage.rb118
-rw-r--r--tool/test/minitest/metametameta.rb71
-rw-r--r--tool/test/minitest/test_minitest_benchmark.rb131
-rw-r--r--tool/test/minitest/test_minitest_mock.rb404
-rw-r--r--tool/test/minitest/test_minitest_unit.rb1790
-rw-r--r--tool/test/runner.rb23
-rw-r--r--tool/test/test_jisx0208.rb40
-rw-r--r--tool/test/testunit/test4test_hideskip.rb10
-rw-r--r--tool/test/testunit/test4test_redefinition.rb14
-rw-r--r--tool/test/testunit/test4test_sorting.rb18
-rw-r--r--tool/test/testunit/test_assertion.rb29
-rw-r--r--tool/test/testunit/test_hideskip.rb21
-rw-r--r--tool/test/testunit/test_parallel.rb204
-rw-r--r--tool/test/testunit/test_redefinition.rb16
-rw-r--r--tool/test/testunit/test_sorting.rb18
-rw-r--r--tool/test/testunit/tests_for_parallel/ptest_first.rb8
-rw-r--r--tool/test/testunit/tests_for_parallel/ptest_forth.rb30
-rw-r--r--tool/test/testunit/tests_for_parallel/ptest_second.rb12
-rw-r--r--tool/test/testunit/tests_for_parallel/ptest_third.rb11
-rw-r--r--tool/test/testunit/tests_for_parallel/runner.rb14
-rw-r--r--tool/transcode-tblgen.rb1118
-rw-r--r--tool/transform_mjit_header.rb298
-rwxr-xr-xtool/travis_retry.sh13
-rwxr-xr-xtool/update-deps637
-rw-r--r--tool/vtlh.rb17
-rwxr-xr-xtool/ytab.sed80
-rw-r--r--trace_point.rb348
-rw-r--r--transcode.c4567
-rw-r--r--transcode_data.h139
-rw-r--r--transient_heap.c940
-rw-r--r--transient_heap.h62
-rw-r--r--util.c979
-rw-r--r--util.h66
-rw-r--r--variable.c3540
-rw-r--r--variable.h9
-rw-r--r--version.c135
-rw-r--r--version.h92
-rw-r--r--vm.c3708
-rw-r--r--vm_args.c1256
-rw-r--r--vm_backtrace.c1497
-rw-r--r--vm_core.h1968
-rw-r--r--vm_debug.h34
-rw-r--r--vm_dump.c1094
-rw-r--r--vm_eval.c2515
-rw-r--r--vm_exec.c175
-rw-r--r--vm_exec.h193
-rw-r--r--vm_insnhelper.c5064
-rw-r--r--vm_insnhelper.h267
-rw-r--r--vm_method.c2339
-rw-r--r--vm_opts.h72
-rw-r--r--vm_trace.c1712
-rw-r--r--vms/config.h_in61
-rw-r--r--vms/vms.h6
-rw-r--r--vsnprintf.c1314
-rw-r--r--warning.rb45
-rw-r--r--win32/.document1
-rw-r--r--win32/Makefile.sub1564
-rw-r--r--win32/README.win32133
-rwxr-xr-xwin32/configure.bat264
-rw-r--r--win32/dir.h42
-rw-r--r--win32/enc-setup.mak10
-rw-r--r--win32/file.c726
-rw-r--r--win32/file.h48
-rwxr-xr-xwin32/ifchange.bat88
-rwxr-xr-xwin32/makedirs.bat3
-rw-r--r--[-rwxr-xr-x]win32/mkexports.rb195
-rw-r--r--[-rwxr-xr-x]win32/resource.rb47
-rwxr-xr-xwin32/rm.bat18
-rwxr-xr-xwin32/rmdirs.bat30
-rwxr-xr-xwin32/rtname.cmd35
-rw-r--r--win32/setup.mak226
-rw-r--r--win32/win32.c7984
-rw-r--r--win32/win32.h493
-rw-r--r--win32/winmain.c4
-rw-r--r--wince/Makefile.sub718
-rw-r--r--wince/README.wince121
-rw-r--r--wince/assert.c11
-rw-r--r--wince/assert.h6
-rw-r--r--wince/configure.bat59
-rw-r--r--wince/direct.c54
-rw-r--r--wince/direct.h22
-rw-r--r--wince/errno.c11
-rw-r--r--wince/errno.h55
-rw-r--r--wince/fcntl.h42
-rw-r--r--wince/io.h76
-rw-r--r--wince/io_wce.c230
-rw-r--r--wince/mkconfig_wce.rb7
-rw-r--r--wince/mkexports.rb35
-rw-r--r--wince/process.h46
-rw-r--r--wince/process_wce.c47
-rw-r--r--wince/resource.rb96
-rw-r--r--wince/setup.mak233
-rw-r--r--wince/signal.h71
-rw-r--r--wince/signal_wce.c26
-rw-r--r--wince/stddef.h5
-rw-r--r--wince/stdio.c36
-rw-r--r--wince/stdlib.c57
-rw-r--r--wince/string_wce.c89
-rw-r--r--wince/sys/stat.c102
-rw-r--r--wince/sys/stat.h68
-rw-r--r--wince/sys/timeb.c25
-rw-r--r--wince/sys/timeb.h26
-rw-r--r--wince/sys/types.h67
-rw-r--r--wince/sys/utime.c44
-rw-r--r--wince/sys/utime.h27
-rw-r--r--wince/time.h63
-rw-r--r--wince/time_wce.c301
-rw-r--r--wince/varargs.h34
-rw-r--r--wince/wince.c583
-rw-r--r--wince/wince.h191
-rw-r--r--wince/wincemain.c19
-rw-r--r--wince/wincon.h7
-rw-r--r--wince/winsock2.c338
-rw-r--r--x68/_dtos18.c250
-rw-r--r--x68/_round.c45
-rw-r--r--x68/fconvert.c81
-rw-r--r--x68/select.c167
10833 files changed, 343923 insertions, 2004774 deletions
diff --git a/.cvsignore b/.cvsignore
new file mode 100644
index 0000000000..52a5620133
--- /dev/null
+++ b/.cvsignore
@@ -0,0 +1,54 @@
+*.bak
+*.orig
+*.rej
+*.sav
+*~
+.ccmalloc
+.ppack
+COPYING.LIB
+ChangeLog.pre-alpha
+ChangeLog.pre1_1
+Makefile
+README.fat-patch
+README.v6
+README.atheos
+archive
+autom4te*.cache
+automake
+beos
+config.cache
+config.h
+config.h.in
+config.log
+config.status
+configure
+foo.rb
+libruby.so.*
+miniruby
+miniruby.elhash
+miniruby.elhash2
+miniruby.orig2
+miniruby.plhash
+miniruby.plhash2
+modex.rb
+newdate.rb
+newver.rb
+parse.c
+parse.y.try
+pitest.rb
+ppack
+preview
+rbconfig.rb
+rename2.h
+repack
+riscos
+rubicon
+ruby
+ruby-man.rd.gz
+rubyunit
+st.c.power
+this that
+tmp
+web
+y.output
+y.tab.c
diff --git a/.dir-locals.el b/.dir-locals.el
deleted file mode 100644
index 7c32d1f7ee..0000000000
--- a/.dir-locals.el
+++ /dev/null
@@ -1,37 +0,0 @@
-;; Copyright (c) 2018 Urabe, Shyouhei. All rights reserved.
-;;
-;; This file is a part of the programming language Ruby. Permission is hereby
-;; granted, to either redistribute and/or modify this file, provided that the
-;; conditions mentioned in the file COPYING are met. Consult the file for
-;; details.
-
-((nil .
- ((indent-tabs-mode . nil)
- (require-final-newline . t)
- (tab-width . 8)
- (show-trailing-whitespace . t)
- (whitespace-line-column . 80))) ;; See also [Misc #12277]
-
- ;; (bat-mode . ((buffer-file-coding-system . utf-8-dos)))
-
- (ruby-mode . ((ruby-indent-level . 2)))
-
- (rdoc-mode . ((fill-column . 74)))
-
- (yaml-mode . ((yaml-indent-offset . 2)))
-
- (makefile-mode . ((indent-tabs-mode . t)))
-
- (c-mode . ((c-file-style . "ruby")))
-
- (change-log-mode .
- ((buffer-file-coding-system . us-ascii)
- (indent-tabs-mode . t)
- (change-log-indent-text . 2)
- (add-log-time-format . (lambda (&optional x y)
- (let* ((time (or x (current-time)))
- (system-time-locale "C")
- (diff (+ (cadr time) 32400))
- (lo (% diff 65536))
- (hi (+ (car time) (/ diff 65536))))
- (format-time-string "%a %b %e %H:%M:%S %Y" (list hi lo) t)))))))
diff --git a/.document b/.document
index 8a418e5d4a..2471a9ce85 100644
--- a/.document
+++ b/.document
@@ -5,38 +5,7 @@
# Process all the C source files
*.c
-*.y
-
-# prelude
-prelude.rb
-rbconfig.rb
-
-ast.rb
-gc.rb
-io.rb
-pack.rb
-trace_point.rb
-warning.rb
# the lib/ directory (which has its own .document file)
-lib
-
-# and some of the ext/ directory (which has its own .document file)
-ext
-
-# rdoc files
-NEWS
-README.md
-README.ja.md
-
-COPYING
-COPYING.ja
-CONTRIBUTING.md
-
-LEGAL
-
-# win32/README.win32 linked from README.md
-win32
-
-doc
+lib
diff --git a/.editorconfig b/.editorconfig
deleted file mode 100644
index 4633a7acae..0000000000
--- a/.editorconfig
+++ /dev/null
@@ -1,30 +0,0 @@
-root = true
-
-[*]
-end_of_line = lf
-indent_size = 4
-indent_style = space
-insert_final_newline = true
-tab_width = 8
-trim_trailing_whitespace = true
-
-[*.bat]
-end_of_line = crlf
-
-[*.gemspec]
-indent_size = 2
-
-[*.rb]
-indent_size = 2
-
-[*.yml]
-indent_size = 2
-
-[{*[Mm]akefile*,*.mak,*.mk,depend}]
-indent_style = tab
-
-[enc/*]
-indent_size = 2
-
-[reg*.[ch]]
-indent_size = 2
diff --git a/.gdbinit b/.gdbinit
deleted file mode 100644
index 0d44622691..0000000000
--- a/.gdbinit
+++ /dev/null
@@ -1,1346 +0,0 @@
-set startup-with-shell off
-
-define hook-run
- set $color_type = 0
- set $color_highlite = 0
- set $color_end = 0
-end
-
-define ruby_gdb_init
- if !$color_type
- set $color_type = "\033[31m"
- end
- if !$color_highlite
- set $color_highlite = "\033[36m"
- end
- if !$color_end
- set $color_end = "\033[m"
- end
- if ruby_dummy_gdb_enums.special_consts
- end
-end
-
-# set prompt \033[36m(gdb)\033[m\040
-
-define rp
- ruby_gdb_init
- if (VALUE)($arg0) & RUBY_FIXNUM_FLAG
- printf "FIXNUM: %ld\n", (long)($arg0) >> 1
- else
- if ((VALUE)($arg0) & ~(~(VALUE)0<<RUBY_SPECIAL_SHIFT)) == RUBY_SYMBOL_FLAG
- set $id = (($arg0) >> RUBY_SPECIAL_SHIFT)
- printf "%sSYMBOL%s: ", $color_type, $color_end
- rp_id $id
- else
- if ($arg0) == RUBY_Qfalse
- echo false\n
- else
- if ($arg0) == RUBY_Qtrue
- echo true\n
- else
- if ($arg0) == RUBY_Qnil
- echo nil\n
- else
- if ($arg0) == RUBY_Qundef
- echo undef\n
- else
- if (VALUE)($arg0) & RUBY_IMMEDIATE_MASK
- if ((VALUE)($arg0) & RUBY_FLONUM_MASK) == RUBY_FLONUM_FLAG
- printf "%sFLONUM%s: %g\n", $color_type, $color_end, (double)rb_float_value($arg0)
- else
- echo immediate\n
- end
- else
- set $flags = ((struct RBasic*)($arg0))->flags
- if ($flags & RUBY_FL_PROMOTED) == RUBY_FL_PROMOTED
- printf "[PROMOTED] "
- end
- if ($flags & RUBY_T_MASK) == RUBY_T_NONE
- printf "%sT_NONE%s: ", $color_type, $color_end
- print (struct RBasic *)($arg0)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_NIL
- printf "%sT_NIL%s: ", $color_type, $color_end
- print (struct RBasic *)($arg0)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_OBJECT
- printf "%sT_OBJECT%s: ", $color_type, $color_end
- print ((struct RObject *)($arg0))->basic
- if ($flags & ROBJECT_EMBED)
- print/x *((VALUE*)((struct RObject*)($arg0))->as.ary) @ (ROBJECT_EMBED_LEN_MAX+0)
- else
- print (((struct RObject *)($arg0))->as.heap)
- if (((struct RObject*)($arg0))->as.heap.numiv) > 0
- print/x *(((struct RObject*)($arg0))->as.heap.ivptr) @ (((struct RObject*)($arg0))->as.heap.numiv)
- end
- end
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_CLASS
- printf "%sT_CLASS%s%s: ", $color_type, ($flags & RUBY_FL_SINGLETON) ? "*" : "", $color_end
- rp_class $arg0
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_ICLASS
- printf "%sT_ICLASS%s: ", $color_type, $color_end
- rp_class $arg0
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_MODULE
- printf "%sT_MODULE%s: ", $color_type, $color_end
- rp_class $arg0
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_FLOAT
- printf "%sT_FLOAT%s: %.16g ", $color_type, $color_end, (((struct RFloat*)($arg0))->float_value)
- print (struct RFloat *)($arg0)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_STRING
- printf "%sT_STRING%s: ", $color_type, $color_end
- rp_string $arg0 $flags
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_REGEXP
- set $regsrc = ((struct RRegexp*)($arg0))->src
- set $rsflags = ((struct RBasic*)$regsrc)->flags
- printf "%sT_REGEXP%s: ", $color_type, $color_end
- set $len = ($rsflags & RUBY_FL_USER1) ? \
- ((struct RString*)$regsrc)->as.heap.len : \
- (($rsflags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
- set print address off
- output *(char *)(($rsflags & RUBY_FL_USER1) ? \
- ((struct RString*)$regsrc)->as.heap.ptr : \
- ((struct RString*)$regsrc)->as.ary) @ $len
- set print address on
- printf " len:%ld ", $len
- if $flags & RUBY_FL_USER6
- printf "(none) "
- end
- if $flags & RUBY_FL_USER5
- printf "(literal) "
- end
- if $flags & RUBY_FL_USER4
- printf "(fixed) "
- end
- printf "encoding:%d ", ($flags & RUBY_ENCODING_MASK) >> RUBY_ENCODING_SHIFT
- print (struct RRegexp *)($arg0)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_ARRAY
- if ($flags & RUBY_FL_USER1)
- set $len = (($flags & (RUBY_FL_USER3|RUBY_FL_USER4)) >> (RUBY_FL_USHIFT+3))
- printf "%sT_ARRAY%s: len=%ld ", $color_type, $color_end, $len
- printf "(embed) "
- if ($len == 0)
- printf "{(empty)} "
- else
- print/x *((VALUE*)((struct RArray*)($arg0))->as.ary) @ $len
- printf " "
- end
- else
- set $len = ((struct RArray*)($arg0))->as.heap.len
- printf "%sT_ARRAY%s: len=%ld ", $color_type, $color_end, $len
- if ($flags & RUBY_FL_USER2)
- printf "(shared) shared="
- output/x ((struct RArray*)($arg0))->as.heap.aux.shared
- printf " "
- else
- printf "(ownership) capa=%ld ", ((struct RArray*)($arg0))->as.heap.aux.capa
- end
- if ($len == 0)
- printf "{(empty)} "
- else
- print/x *((VALUE*)((struct RArray*)($arg0))->as.heap.ptr) @ $len
- printf " "
- end
- end
- print (struct RArray *)($arg0)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_FIXNUM
- printf "%sT_FIXNUM%s: ", $color_type, $color_end
- print (struct RBasic *)($arg0)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_HASH
- printf "%sT_HASH%s: ", $color_type, $color_end,
- if (((struct RHash *)($arg0))->basic->flags & RHASH_ST_TABLE_FLAG)
- printf "st len=%ld ", ((struct RHash *)($arg0))->as.st->num_entries
- else
- printf "li len=%ld bound=%ld ", \
- ((((struct RHash *)($arg0))->basic->flags & RHASH_AR_TABLE_SIZE_MASK) >> RHASH_AR_TABLE_SIZE_SHIFT), \
- ((((struct RHash *)($arg0))->basic->flags & RHASH_AR_TABLE_BOUND_MASK) >> RHASH_AR_TABLE_BOUND_SHIFT)
- end
- print (struct RHash *)($arg0)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_STRUCT
- set $len = (($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
- ($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) >> (RUBY_FL_USHIFT+1) : \
- ((struct RStruct *)($arg0))->as.heap.len)
- printf "%sT_STRUCT%s: len=%ld ", $color_type, $color_end, $len
- print (struct RStruct *)($arg0)
- output/x *(($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
- ((struct RStruct *)($arg0))->as.ary : \
- ((struct RStruct *)($arg0))->as.heap.ptr) @ $len
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_BIGNUM
- rp_bignum $arg0
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_RATIONAL
- printf "%sT_RATIONAL%s: ", $color_type, $color_end
- print (struct RRational *)($arg0)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_COMPLEX
- printf "%sT_COMPLEX%s: ", $color_type, $color_end
- print (struct RComplex *)($arg0)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_FILE
- printf "%sT_FILE%s: ", $color_type, $color_end
- print (struct RFile *)($arg0)
- output *((struct RFile *)($arg0))->fptr
- printf "\n"
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_TRUE
- printf "%sT_TRUE%s: ", $color_type, $color_end
- print (struct RBasic *)($arg0)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_FALSE
- printf "%sT_FALSE%s: ", $color_type, $color_end
- print (struct RBasic *)($arg0)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_DATA
- if ((struct RTypedData *)($arg0))->typed_flag == 1
- printf "%sT_DATA%s(%s): ", $color_type, $color_end, ((struct RTypedData *)($arg0))->type->wrap_struct_name
- print (struct RTypedData *)($arg0)
- else
- printf "%sT_DATA%s: ", $color_type, $color_end
- print (struct RData *)($arg0)
- end
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_MATCH
- printf "%sT_MATCH%s: ", $color_type, $color_end
- print (struct RMatch *)($arg0)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_SYMBOL
- printf "%sT_SYMBOL%s: ", $color_type, $color_end
- print (struct RSymbol *)($arg0)
- set $id_type = ((struct RSymbol *)($arg0))->id & RUBY_ID_SCOPE_MASK
- if $id_type == RUBY_ID_LOCAL
- printf "l"
- else
- if $id_type == RUBY_ID_INSTANCE
- printf "i"
- else
- if $id_type == RUBY_ID_GLOBAL
- printf "G"
- else
- if $id_type == RUBY_ID_ATTRSET
- printf "a"
- else
- if $id_type == RUBY_ID_CONST
- printf "C"
- else
- if $id_type == RUBY_ID_CLASS
- printf "c"
- else
- printf "j"
- end
- end
- end
- end
- end
- end
- set $id_fstr = ((struct RSymbol *)($arg0))->fstr
- rp_string $id_fstr
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_UNDEF
- printf "%sT_UNDEF%s: ", $color_type, $color_end
- print (struct RBasic *)($arg0)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_IMEMO
- printf "%sT_IMEMO%s(", $color_type, $color_end
- output (enum imemo_type)(($flags>>RUBY_FL_USHIFT)&RUBY_IMEMO_MASK)
- printf "): "
- rp_imemo $arg0
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_NODE
- printf "%sT_NODE%s(", $color_type, $color_end
- output (enum node_type)(($flags&RUBY_NODE_TYPEMASK)>>RUBY_NODE_TYPESHIFT)
- printf "): "
- print *(NODE *)($arg0)
- else
- if ($flags & RUBY_T_MASK) == RUBY_T_ZOMBIE
- printf "%sT_ZOMBIE%s: ", $color_type, $color_end
- print (struct RData *)($arg0)
- else
- printf "%sunknown%s: ", $color_type, $color_end
- print (struct RBasic *)($arg0)
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
-end
-document rp
- Print a Ruby's VALUE.
-end
-
-define rp_id
- set $id = (ID)$arg0
- if $id == '!' || $id == '+' || $id == '-' || $id == '*' || $id == '/' || $id == '%' || $id == '<' || $id == '>' || $id == '`'
- printf "(:%c)\n", $id
- else
- if $id == idDot2
- printf "(:..)\n"
- else
- if $id == idDot3
- printf "(:...)\n"
- else
- if $id == idUPlus
- printf "(:+@)\n"
- else
- if $id == idUMinus
- printf "(:-@)\n"
- else
- if $id == idPow
- printf "(:**)\n"
- else
- if $id == idCmp
- printf "(:<=>)\n"
- else
- if $id == idLTLT
- printf "(:<<)\n"
- else
- if $id == idGTGT
- printf "(:>>)\n"
- else
- if $id == idLE
- printf "(:<=)\n"
- else
- if $id == idGE
- printf "(:>=)\n"
- else
- if $id == idEq
- printf "(:==)\n"
- else
- if $id == idEqq
- printf "(:===)\n"
- else
- if $id == idNeq
- printf "(:!=)\n"
- else
- if $id == idEqTilde
- printf "(:=~)\n"
- else
- if $id == idNeqTilde
- printf "(:!~)\n"
- else
- if $id == idAREF
- printf "(:[])\n"
- else
- if $id == idASET
- printf "(:[]=)\n"
- else
- if $id == idCOLON2
- printf "(:'::')\n"
- else
- if $id == idANDOP
- printf "(:&&)\n"
- else
- if $id == idOROP
- printf "(:||)\n"
- else
- if $id == idANDDOT
- printf "(:&.)\n"
- else
- if $id <= tLAST_OP_ID
- printf "O"
- else
- set $id_type = $id & RUBY_ID_SCOPE_MASK
- if $id_type == RUBY_ID_LOCAL
- printf "l"
- else
- if $id_type == RUBY_ID_INSTANCE
- printf "i"
- else
- if $id_type == RUBY_ID_GLOBAL
- printf "G"
- else
- if $id_type == RUBY_ID_ATTRSET
- printf "a"
- else
- if $id_type == RUBY_ID_CONST
- printf "C"
- else
- if $id_type == RUBY_ID_CLASS
- printf "c"
- else
- printf "j"
- end
- end
- end
- end
- end
- end
- end
- printf "(%ld): ", $id
- print_id $id
- echo \n
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
- end
-end
-document rp_id
- Print an ID.
-end
-
-define output_string
- set $flags = ((struct RBasic*)($arg0))->flags
- set $len = ($flags & RUBY_FL_USER1) ? \
- ((struct RString*)($arg0))->as.heap.len : \
- (($flags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
- if $len > 0
- output *(char *)(($flags & RUBY_FL_USER1) ? \
- ((struct RString*)($arg0))->as.heap.ptr : \
- ((struct RString*)($arg0))->as.ary) @ $len
- else
- output ""
- end
-end
-
-define print_string
- set $flags = ((struct RBasic*)($arg0))->flags
- set $len = ($flags & RUBY_FL_USER1) ? \
- ((struct RString*)($arg0))->as.heap.len : \
- (($flags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
- if $len > 0
- printf "%s", *(char *)(($flags & RUBY_FL_USER1) ? \
- ((struct RString*)($arg0))->as.heap.ptr : \
- ((struct RString*)($arg0))->as.ary) @ $len
- end
-end
-
-define rp_string
- output_string $arg0
- printf " bytesize:%ld ", $len
- if !($flags & RUBY_FL_USER1)
- printf "(embed) "
- else
- if ($flags & RUBY_FL_USER2)
- printf "(shared) "
- end
- if ($flags & RUBY_FL_USER3)
- printf "(assoc) "
- end
- end
- printf "encoding:%d ", ($flags & RUBY_ENCODING_MASK) >> RUBY_ENCODING_SHIFT
- if ($flags & RUBY_ENC_CODERANGE_MASK) == 0
- printf "coderange:unknown "
- else
- if ($flags & RUBY_ENC_CODERANGE_MASK) == RUBY_ENC_CODERANGE_7BIT
- printf "coderange:7bit "
- else
- if ($flags & RUBY_ENC_CODERANGE_MASK) == RUBY_ENC_CODERANGE_VALID
- printf "coderange:valid "
- else
- printf "coderange:broken "
- end
- end
- end
- print (struct RString *)($arg0)
-end
-document rp_string
- Print the content of a String.
-end
-
-define rp_bignum
- set $flags = ((struct RBignum*)($arg0))->basic.flags
- set $len = (($flags & RUBY_FL_USER2) ? \
- ($flags & (RUBY_FL_USER5|RUBY_FL_USER4|RUBY_FL_USER3)) >> (RUBY_FL_USHIFT+3) : \
- ((struct RBignum*)($arg0))->as.heap.len)
- printf "%sT_BIGNUM%s: sign=%d len=%ld ", $color_type, $color_end, \
- (($flags & RUBY_FL_USER1) != 0), $len
- if $flags & RUBY_FL_USER2
- printf "(embed) "
- end
- print (struct RBignum *)($arg0)
- set $ptr = (($flags & RUBY_FL_USER2) ? \
- ((struct RBignum*)($arg0))->as.ary : \
- ((struct RBignum*)($arg0))->as.heap.digits)
- set $len = $len-1
- printf "0x%x", $ptr[$len]
- while $len > 0
- set $len = $len-1
- set $val = $ptr[$len]
- set $w = sizeof($ptr[0])
- printf "_"
- if $w > 8
- printf "%.32x", $val
- else
- if $w > 4
- printf "%.16x", $val
- else
- if $w > 2
- printf "%.8x", $val
- else
- if $w > 1
- printf "%.4x", $val
- else
- printf "%.2x", $val
- end
- end
- end
- end
- end
- printf "\n"
-end
-document rp_bignum
- Print the content of a Bignum.
-end
-
-define rp_class
- printf "(struct RClass *) %p", (void*)$arg0
- if ((struct RClass *)($arg0))->ptr.origin_ != $arg0
- printf " -> %p", ((struct RClass *)($arg0))->ptr.origin_
- end
- printf "\n"
- rb_classname $arg0
- print/x *(struct RClass *)($arg0)
- print *((struct RClass *)($arg0))->ptr
-end
-document rp_class
- Print the content of a Class/Module.
-end
-
-define rp_imemo
- set $flags = (enum imemo_type)((((struct RBasic *)($arg0))->flags >> RUBY_FL_USHIFT) & RUBY_IMEMO_MASK)
- if $flags == imemo_cref
- printf "(rb_cref_t *) %p\n", (void*)$arg0
- print *(rb_cref_t *)$arg0
- else
- if $flags == imemo_svar
- printf "(struct vm_svar *) %p\n", (void*)$arg0
- print *(struct vm_svar *)$arg0
- else
- if $flags == imemo_throw_data
- printf "(struct vm_throw_data *) %p\n", (void*)$arg0
- print *(struct vm_throw_data *)$arg0
- else
- if $flags == imemo_ifunc
- printf "(struct vm_ifunc *) %p\n", (void*)$arg0
- print *(struct vm_ifunc *)$arg0
- else
- if $flags == imemo_memo
- printf "(struct MEMO *) %p\n", (void*)$arg0
- print *(struct MEMO *)$arg0
- else
- if $flags == imemo_ment
- printf "(rb_method_entry_t *) %p\n", (void*)$arg0
- print *(rb_method_entry_t *)$arg0
- else
- if $flags == imemo_iseq
- printf "(rb_iseq_t *) %p\n", (void*)$arg0
- print *(rb_iseq_t *)$arg0
- else
- printf "(struct RIMemo *) %p\n", (void*)$arg0
- print *(struct RIMemo *)$arg0
- end
- end
- end
- end
- end
- end
- end
-end
-document rp_imemo
- Print the content of a memo
-end
-
-define nd_type
- print (enum node_type)((((NODE*)($arg0))->flags&RUBY_NODE_TYPEMASK)>>RUBY_NODE_TYPESHIFT)
-end
-document nd_type
- Print a Ruby' node type.
-end
-
-define nd_file
- print ((NODE*)($arg0))->nd_file
-end
-document nd_file
- Print the source file name of a node.
-end
-
-define nd_line
- print ((unsigned int)((((NODE*)($arg0))->flags>>RUBY_NODE_LSHIFT)&RUBY_NODE_LMASK))
-end
-document nd_line
- Print the source line number of a node.
-end
-
-# Print members of ruby node.
-
-define nd_head
- printf "%su1.node%s: ", $color_highlite, $color_end
- rp ($arg0).u1.node
-end
-
-define nd_alen
- printf "%su2.argc%s: ", $color_highlite, $color_end
- p ($arg0).u2.argc
-end
-
-define nd_next
- printf "%su3.node%s: ", $color_highlite, $color_end
- rp ($arg0).u3.node
-end
-
-
-define nd_cond
- printf "%su1.node%s: ", $color_highlite, $color_end
- rp ($arg0).u1.node
-end
-
-define nd_body
- printf "%su2.node%s: ", $color_highlite, $color_end
- rp ($arg0).u2.node
-end
-
-define nd_else
- printf "%su3.node%s: ", $color_highlite, $color_end
- rp ($arg0).u3.node
-end
-
-
-define nd_orig
- printf "%su3.value%s: ", $color_highlite, $color_end
- rp ($arg0).u3.value
-end
-
-
-define nd_resq
- printf "%su2.node%s: ", $color_highlite, $color_end
- rp ($arg0).u2.node
-end
-
-define nd_ensr
- printf "%su3.node%s: ", $color_highlite, $color_end
- rp ($arg0).u3.node
-end
-
-
-define nd_1st
- printf "%su1.node%s: ", $color_highlite, $color_end
- rp ($arg0).u1.node
-end
-
-define nd_2nd
- printf "%su2.node%s: ", $color_highlite, $color_end
- rp ($arg0).u2.node
-end
-
-
-define nd_stts
- printf "%su1.node%s: ", $color_highlite, $color_end
- rp ($arg0).u1.node
-end
-
-
-define nd_entry
- printf "%su3.entry%s: ", $color_highlite, $color_end
- p ($arg0).u3.entry
-end
-
-define nd_vid
- printf "%su1.id%s: ", $color_highlite, $color_end
- p ($arg0).u1.id
-end
-
-define nd_cflag
- printf "%su2.id%s: ", $color_highlite, $color_end
- p ($arg0).u2.id
-end
-
-define nd_cval
- printf "%su3.value%s: ", $color_highlite, $color_end
- rp ($arg0).u3.value
-end
-
-define nd_tbl
- printf "%su1.tbl%s: ", $color_highlite, $color_end
- p ($arg0).u1.tbl
-end
-
-
-define nd_var
- printf "%su1.node%s: ", $color_highlite, $color_end
- rp ($arg0).u1.node
-end
-
-define nd_ibdy
- printf "%su2.node%s: ", $color_highlite, $color_end
- rp ($arg0).u2.node
-end
-
-define nd_iter
- printf "%su3.node%s: ", $color_highlite, $color_end
- rp ($arg0).u3.node
-end
-
-
-define nd_value
- printf "%su2.node%s: ", $color_highlite, $color_end
- rp ($arg0).u2.node
-end
-
-define nd_aid
- printf "%su3.id%s: ", $color_highlite, $color_end
- p ($arg0).u3.id
-end
-
-
-define nd_lit
- printf "%su1.value%s: ", $color_highlite, $color_end
- rp ($arg0).u1.value
-end
-
-define nd_rest
- printf "%su2.argc%s: ", $color_highlite, $color_end
- p ($arg0).u2.argc
-end
-
-define nd_opt
- printf "%su1.node%s: ", $color_highlite, $color_end
- rp ($arg0).u1.node
-end
-
-
-define nd_recv
- printf "%su1.node%s: ", $color_highlite, $color_end
- rp ($arg0).u1.node
-end
-
-define nd_mid
- printf "%su2.id%s: ", $color_highlite, $color_end
- p ($arg0).u2.id
-end
-
-define nd_args
- printf "%su3.node%s: ", $color_highlite, $color_end
- rp ($arg0).u3.node
-end
-
-define nd_defn
- printf "%su3.node%s: ", $color_highlite, $color_end
- rp ($arg0).u3.node
-end
-
-
-define nd_old
- printf "%su1.id%s: ", $color_highlite, $color_end
- p ($arg0).u1.id
-end
-
-define nd_new
- printf "%su2.id%s: ", $color_highlite, $color_end
- p ($arg0).u2.id
-end
-
-
-define nd_cname
- printf "%su1.id%s: ", $color_highlite, $color_end
- p ($arg0).u1.id
-end
-
-define nd_super
- printf "%su3.node%s: ", $color_highlite, $color_end
- rp ($arg0).u3.node
-end
-
-
-define nd_modl
- printf "%su1.id%s: ", $color_highlite, $color_end
- p ($arg0).u1.id
-end
-
-define nd_clss
- printf "%su1.value%s: ", $color_highlite, $color_end
- rp ($arg0).u1.value
-end
-
-
-define nd_beg
- printf "%su1.node%s: ", $color_highlite, $color_end
- rp ($arg0).u1.node
-end
-
-define nd_end
- printf "%su2.node%s: ", $color_highlite, $color_end
- rp ($arg0).u2.node
-end
-
-define nd_state
- printf "%su3.state%s: ", $color_highlite, $color_end
- p ($arg0).u3.state
-end
-
-define nd_rval
- printf "%su2.value%s: ", $color_highlite, $color_end
- rp ($arg0).u2.value
-end
-
-
-define nd_nth
- printf "%su2.argc%s: ", $color_highlite, $color_end
- p ($arg0).u2.argc
-end
-
-
-define nd_tag
- printf "%su1.id%s: ", $color_highlite, $color_end
- p ($arg0).u1.id
-end
-
-define nd_tval
- printf "%su2.value%s: ", $color_highlite, $color_end
- rp ($arg0).u2.value
-end
-
-define nd_tree
- set $buf = (struct RString *)rb_str_buf_new(0)
- call dump_node((VALUE)($buf), rb_str_tmp_new(0), 0, ($arg0))
- printf "%s\n", $buf->as.heap.ptr
-end
-
-define rb_p
- call rb_p($arg0)
-end
-
-define rb_numtable_entry
- set $rb_numtable_tbl = $arg0
- set $rb_numtable_id = (st_data_t)$arg1
- set $rb_numtable_key = 0
- set $rb_numtable_rec = 0
- if $rb_numtable_tbl->entries_packed
- set $rb_numtable_p = $rb_numtable_tbl->as.packed.bins
- while $rb_numtable_p && $rb_numtable_p < $rb_numtable_tbl->as.packed.bins+$rb_numtable_tbl->num_entries
- if $rb_numtable_p.k == $rb_numtable_id
- set $rb_numtable_key = $rb_numtable_p.k
- set $rb_numtable_rec = $rb_numtable_p.v
- set $rb_numtable_p = 0
- else
- set $rb_numtable_p = $rb_numtable_p + 1
- end
- end
- else
- set $rb_numtable_p = $rb_numtable_tbl->as.big.bins[st_numhash($rb_numtable_id) % $rb_numtable_tbl->num_bins]
- while $rb_numtable_p
- if $rb_numtable_p->key == $rb_numtable_id
- set $rb_numtable_key = $rb_numtable_p->key
- set $rb_numtable_rec = $rb_numtable_p->record
- set $rb_numtable_p = 0
- else
- set $rb_numtable_p = $rb_numtable_p->next
- end
- end
- end
-end
-
-define rb_id2name
- ruby_gdb_init
- printf "%sID%s: ", $color_type, $color_end
- rp_id $arg0
-end
-document rb_id2name
- Print the name of id
-end
-
-define rb_method_entry
- set $rb_method_entry_klass = (struct RClass *)$arg0
- set $rb_method_entry_id = (ID)$arg1
- set $rb_method_entry_me = (rb_method_entry_t *)0
- while !$rb_method_entry_me && $rb_method_entry_klass
- rb_numtable_entry $rb_method_entry_klass->m_tbl_wrapper->tbl $rb_method_entry_id
- set $rb_method_entry_me = (rb_method_entry_t *)$rb_numtable_rec
- if !$rb_method_entry_me
- set $rb_method_entry_klass = (struct RClass *)RCLASS_SUPER($rb_method_entry_klass)
- end
- end
- if $rb_method_entry_me
- print *$rb_method_entry_klass
- print *$rb_method_entry_me
- else
- echo method not found\n
- end
-end
-document rb_method_entry
- Search method entry by class and id
-end
-
-define rb_classname
- # up to 128bit int
- set $rb_classname = rb_mod_name($arg0)
- if $rb_classname != RUBY_Qnil
- rp $rb_classname
- else
- echo anonymous class/module\n
- end
-end
-
-define rb_ancestors
- set $rb_ancestors_module = $arg0
- while $rb_ancestors_module
- rp_class $rb_ancestors_module
- set $rb_ancestors_module = RCLASS_SUPER($rb_ancestors_module)
- end
-end
-document rb_ancestors
- Print ancestors.
-end
-
-define rb_backtrace
- call rb_backtrace()
-end
-
-define iseq
- if ruby_dummy_gdb_enums.special_consts
- end
- if ($arg0)->type == ISEQ_ELEMENT_NONE
- echo [none]\n
- end
- if ($arg0)->type == ISEQ_ELEMENT_LABEL
- print *(LABEL*)($arg0)
- end
- if ($arg0)->type == ISEQ_ELEMENT_INSN
- print *(INSN*)($arg0)
- if ((INSN*)($arg0))->insn_id != YARVINSN_jump
- set $i = 0
- set $operand_size = ((INSN*)($arg0))->operand_size
- set $operands = ((INSN*)($arg0))->operands
- while $i < $operand_size
- rp $operands[$i++]
- end
- end
- end
- if ($arg0)->type == ISEQ_ELEMENT_ADJUST
- print *(ADJUST*)($arg0)
- end
-end
-
-define rb_ps
- rb_ps_vm ruby_current_vm_ptr
-end
-document rb_ps
-Dump all threads and their callstacks
-end
-
-define rb_ps_vm
- print $ps_vm = (rb_vm_t*)$arg0
- set $ps_thread_ln = $ps_vm->living_threads.n.next
- set $ps_thread_ln_last = $ps_vm->living_threads.n.prev
- while 1
- set $ps_thread_th = (rb_thread_t *)$ps_thread_ln
- set $ps_thread = (VALUE)($ps_thread_th->self)
- rb_ps_thread $ps_thread
- if $ps_thread_ln == $ps_thread_ln_last
- loop_break
- end
- set $ps_thread_ln = $ps_thread_ln->next
- end
-end
-document rb_ps_vm
-Dump all threads in a (rb_vm_t*) and their callstacks
-end
-
-define print_lineno
- set $cfp = $arg0
- set $iseq = $cfp->iseq
- set $pos = $cfp->pc - $iseq->body->iseq_encoded
- if $pos != 0
- set $pos = $pos - 1
- end
-
- set $index = 0
- set $size = $iseq->body->insns_info.size
- set $table = $iseq->body->insns_info.body
- set $positions = $iseq->body->insns_info.positions
- #printf "size: %d\n", $size
- if $size == 0
- else
- if $size == 1
- printf "%d", $table[0].line_no
- else
- if $positions
- # get_insn_info_linear_search
- set $index = 1
- while $index < $size
- #printf "table[%d]: position: %d, line: %d, pos: %d\n", $i, $positions[$i], $table[$i].line_no, $pos
- if $positions[$index] > $pos
- loop_break
- end
- set $index = $index + 1
- if $positions[$index] == $pos
- loop_break
- end
- end
- else
- # get_insn_info_succinct_bitvector
- set $sd = $iseq->body->insns_info.succ_index_table
- set $immediate_table_size = sizeof($sd->imm_part) / sizeof(uint64_t) * 9
- if $pos < $immediate_table_size
- set $i = $pos / 9
- set $j = $pos % 9
- set $index = ((int)($sd->imm_part[$i] >> ($j * 7))) & 0x7f
- else
- set $block_index = ($pos - $immediate_table_size) / 512
- set $block = &$sd->succ_part[$block_index]
- set $block_bit_index = ($pos - $immediate_table_size) % 512
- set $small_block_index = $block_bit_index / 64
- set $small_block_popcount = $small_block_index == 0 ? 0 : (((int)($block->small_block_ranks >> (($small_block_index - 1) * 9))) & 0x1ff)
- set $x = $block->bits[$small_block_index] << (63 - $block_bit_index % 64)
- set $x = ($x & 0x5555555555555555) + ($x >> 1 & 0x5555555555555555)
- set $x = ($x & 0x3333333333333333) + ($x >> 2 & 0x3333333333333333)
- set $x = ($x & 0x0707070707070707) + ($x >> 4 & 0x0707070707070707)
- set $x = ($x & 0x001f001f001f001f) + ($x >> 8 & 0x001f001f001f001f)
- set $x = ($x & 0x0000003f0000003f) + ($x >>16 & 0x0000003f0000003f)
- set $popcnt = ($x & 0x7f) + ($x >>32 & 0x7f)
- set $index = $block->rank + $small_block_popcount + $popcnt
- end
- end
- printf "%d", $table[$index-1].line_no
- end
- end
-end
-
-define check_method_entry
- set $imemo = (struct RBasic *)$arg0
- if $imemo != RUBY_Qfalse
- set $type = ($imemo->flags >> 12) & 0x07
- if $type == imemo_ment
- set $me = (rb_callable_method_entry_t *)$imemo
- else
- if $type == imemo_svar
- set $imemo = ((struct vm_svar *)$imemo)->cref_or_me
- check_method_entry $imemo
- end
- end
- end
-end
-
-define print_id
- set $id = $arg0
- # rb_id_to_serial
- if $id > tLAST_OP_ID
- set $serial = (rb_id_serial_t)($id >> RUBY_ID_SCOPE_SHIFT)
- else
- set $serial = (rb_id_serial_t)$id
- end
- if $serial && $serial <= ruby_global_symbols.last_id
- set $idx = $serial / ID_ENTRY_UNIT
- set $ids = (struct RArray *)ruby_global_symbols.ids
- set $flags = $ids->basic.flags
- if ($flags & RUBY_FL_USER1)
- set $idsptr = $ids->as.ary
- set $idslen = (($flags & (RUBY_FL_USER3|RUBY_FL_USER4)) >> (RUBY_FL_USHIFT+3))
- else
- set $idsptr = $ids->as.heap.ptr
- set $idslen = $ids->as.heap.len
- end
- if $idx < $idslen
- set $t = 0
- set $ary = (struct RArray *)$idsptr[$idx]
- if $ary != RUBY_Qnil
- set $flags = $ary->basic.flags
- if ($flags & RUBY_FL_USER1)
- set $aryptr = $ary->as.ary
- set $arylen = (($flags & (RUBY_FL_USER3|RUBY_FL_USER4)) >> (RUBY_FL_USHIFT+3))
- else
- set $aryptr = $ary->as.heap.ptr
- set $arylen = $ary->as.heap.len
- end
- set $result = $aryptr[($serial % ID_ENTRY_UNIT) * ID_ENTRY_SIZE + $t]
- if $result != RUBY_Qnil
- print_string $result
- else
- echo undef
- end
- end
- end
- end
-end
-
-define print_pathobj
- set $flags = ((struct RBasic*)($arg0))->flags
- if ($flags & RUBY_T_MASK) == RUBY_T_STRING
- print_string $arg0
- end
- if ($flags & RUBY_T_MASK) == RUBY_T_ARRAY
- if $flags & RUBY_FL_USER1
- set $str = ((struct RArray*)($arg0))->as.ary[0]
- else
- set $str = ((struct RArray*)($arg0))->as.heap.ptr[0]
- end
- print_string $str
- end
-end
-
-define rb_ps_thread
- set $ps_thread = (struct RTypedData*)$arg0
- set $ps_thread_th = (rb_thread_t*)$ps_thread->data
- printf "* #<Thread:%p rb_thread_t:%p native_thread:%p>\n", \
- $ps_thread, $ps_thread_th, $ps_thread_th->thread_id
- set $cfp = $ps_thread_th->ec->cfp
- set $cfpend = (rb_control_frame_t *)($ps_thread_th->ec->vm_stack + $ps_thread_th->ec->vm_stack_size)-1
- while $cfp < $cfpend
- if $cfp->iseq
- if !((VALUE)$cfp->iseq & RUBY_IMMEDIATE_MASK) && (((imemo_ifunc << RUBY_FL_USHIFT) | RUBY_T_IMEMO)==$cfp->iseq->flags & ((RUBY_IMEMO_MASK << RUBY_FL_USHIFT) | RUBY_T_MASK))
- printf "%d:ifunc ", $cfpend-$cfp
- set print symbol-filename on
- output/a $cfp->iseq.body
- set print symbol-filename off
- printf "\n"
- else
- if $cfp->pc
- set $location = $cfp->iseq->body->location
- printf "%d:", $cfpend-$cfp
- print_pathobj $location.pathobj
- printf ":"
- print_lineno $cfp
- printf ":in `"
- print_string $location.label
- printf "'\n"
- else
- printf "%d: ???.rb:???:in `???'\n", $cfpend-$cfp
- end
- end
- else
- # if VM_FRAME_TYPE($cfp->flag) == VM_FRAME_MAGIC_CFUNC
- set $ep = $cfp->ep
- if ($ep[0] & 0xffff0001) == 0x55550001
- #define VM_ENV_FLAG_LOCAL 0x02
- #define VM_ENV_PREV_EP(ep) GC_GUARDED_PTR_REF(ep[VM_ENV_DATA_INDEX_SPECVAL])
- set $me = 0
- set $env_specval = $ep[-1]
- set $env_me_cref = $ep[-2]
- while ($env_specval & 0x02) != 0
- check_method_entry $env_me_cref
- if $me != 0
- loop_break
- end
- set $ep = $ep[0]
- set $env_specval = $ep[-1]
- set $env_me_cref = $ep[-2]
- end
- if $me == 0
- check_method_entry $env_me_cref
- end
- printf "%d:", $cfpend-$cfp
- set print symbol-filename on
- output/a $me->def->body.cfunc.func
- set print symbol-filename off
- set $mid = $me->def->original_id
- printf ":in `"
- print_id $mid
- printf "'\n"
- else
- printf "%d:unknown_frame:???:in `???'\n", $cfpend-$cfp
- end
- end
- set $cfp = $cfp + 1
- end
-end
-
-define rb_count_objects
- set $objspace = ruby_current_vm_ptr->objspace
- set $counts_00 = 0
- set $counts_01 = 0
- set $counts_02 = 0
- set $counts_03 = 0
- set $counts_04 = 0
- set $counts_05 = 0
- set $counts_06 = 0
- set $counts_07 = 0
- set $counts_08 = 0
- set $counts_09 = 0
- set $counts_0a = 0
- set $counts_0b = 0
- set $counts_0c = 0
- set $counts_0d = 0
- set $counts_0e = 0
- set $counts_0f = 0
- set $counts_10 = 0
- set $counts_11 = 0
- set $counts_12 = 0
- set $counts_13 = 0
- set $counts_14 = 0
- set $counts_15 = 0
- set $counts_16 = 0
- set $counts_17 = 0
- set $counts_18 = 0
- set $counts_19 = 0
- set $counts_1a = 0
- set $counts_1b = 0
- set $counts_1c = 0
- set $counts_1d = 0
- set $counts_1e = 0
- set $counts_1f = 0
- set $total = 0
- set $i = 0
- while $i < $objspace->heap_pages.allocated_pages
- printf "\rcounting... %d/%d", $i, $objspace->heap_pages.allocated_pages
- set $page = $objspace->heap_pages.sorted[$i]
- set $p = $page->start
- set $pend = $p + $page->total_slots
- while $p < $pend
- set $flags = $p->as.basic.flags & 0x1f
- eval "set $counts_%02x = $counts_%02x + 1", $flags, $flags
- set $p = $p + 1
- end
- set $total = $total + $page->total_slots
- set $i = $i + 1
- end
- printf "\rTOTAL: %d, FREE: %d\n", $total, $counts_00
- printf "T_OBJECT: %d\n", $counts_01
- printf "T_CLASS: %d\n", $counts_02
- printf "T_MODULE: %d\n", $counts_03
- printf "T_FLOAT: %d\n", $counts_04
- printf "T_STRING: %d\n", $counts_05
- printf "T_REGEXP: %d\n", $counts_06
- printf "T_ARRAY: %d\n", $counts_07
- printf "T_HASH: %d\n", $counts_08
- printf "T_STRUCT: %d\n", $counts_09
- printf "T_BIGNUM: %d\n", $counts_0a
- printf "T_FILE: %d\n", $counts_0b
- printf "T_DATA: %d\n", $counts_0c
- printf "T_MATCH: %d\n", $counts_0d
- printf "T_COMPLEX: %d\n", $counts_0e
- printf "T_RATIONAL: %d\n", $counts_0f
- #printf "UNKNOWN_10: %d\n", $counts_10
- printf "T_NIL: %d\n", $counts_11
- printf "T_TRUE: %d\n", $counts_12
- printf "T_FALSE: %d\n", $counts_13
- printf "T_SYMBOL: %d\n", $counts_14
- printf "T_FIXNUM: %d\n", $counts_15
- printf "T_UNDEF: %d\n", $counts_16
- #printf "UNKNOWN_17: %d\n", $counts_17
- #printf "UNKNOWN_18: %d\n", $counts_18
- #printf "UNKNOWN_19: %d\n", $counts_19
- printf "T_IMEMO: %d\n", $counts_1a
- printf "T_NODE: %d\n", $counts_1b
- printf "T_ICLASS: %d\n", $counts_1c
- printf "T_ZOMBIE: %d\n", $counts_1d
- #printf "UNKNOWN_1E: %d\n", $counts_1e
- printf "T_MASK: %d\n", $counts_1f
-end
-document rb_count_objects
- Counts all objects grouped by type.
-end
-
-# Details: https://bugs.ruby-lang.org/projects/ruby-trunk/wiki/MachineInstructionsTraceWithGDB
-define trace_machine_instructions
- set logging on
- set height 0
- set width 0
- display/i $pc
- while !$exit_code
- info line *$pc
- si
- end
-end
-
-define SDR
- call rb_vmdebug_stack_dump_raw_current()
-end
-
-define rbi
- if ((LINK_ELEMENT*)$arg0)->type == ISEQ_ELEMENT_LABEL
- p *(LABEL*)$arg0
- else
- if ((LINK_ELEMENT*)$arg0)->type == ISEQ_ELEMENT_INSN
- p *(INSN*)$arg0
- else
- if ((LINK_ELEMENT*)$arg0)->type == ISEQ_ELEMENT_ADJUST
- p *(ADJUST*)$arg0
- else
- print *$arg0
- end
- end
- end
-end
-
-define dump_node
- set $str = rb_parser_dump_tree($arg0, 0)
- set $flags = ((struct RBasic*)($str))->flags
- printf "%s", (char *)(($flags & RUBY_FL_USER1) ? \
- ((struct RString*)$str)->as.heap.ptr : \
- ((struct RString*)$str)->as.ary)
-end
-
-define print_flags
- printf "RUBY_FL_WB_PROTECTED: %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_WB_PROTECTED ? "1" : "0"
- printf "RUBY_FL_PROMOTED0 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_PROMOTED0 ? "1" : "0"
- printf "RUBY_FL_PROMOTED1 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_PROMOTED1 ? "1" : "0"
- printf "RUBY_FL_FINALIZE : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_FINALIZE ? "1" : "0"
- printf "RUBY_FL_TAINT : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_TAINT ? "1" : "0"
- printf "RUBY_FL_UNTRUSTED : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_UNTRUSTED ? "1" : "0"
- printf "RUBY_FL_EXIVAR : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_EXIVAR ? "1" : "0"
- printf "RUBY_FL_FREEZE : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_FREEZE ? "1" : "0"
-
- printf "RUBY_FL_USER0 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER0 ? "1" : "0"
- printf "RUBY_FL_USER1 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER1 ? "1" : "0"
- printf "RUBY_FL_USER2 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER2 ? "1" : "0"
- printf "RUBY_FL_USER3 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER3 ? "1" : "0"
- printf "RUBY_FL_USER4 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER4 ? "1" : "0"
- printf "RUBY_FL_USER5 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER5 ? "1" : "0"
- printf "RUBY_FL_USER6 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER6 ? "1" : "0"
- printf "RUBY_FL_USER7 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER7 ? "1" : "0"
- printf "RUBY_FL_USER8 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER8 ? "1" : "0"
- printf "RUBY_FL_USER9 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER9 ? "1" : "0"
- printf "RUBY_FL_USER10 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER10 ? "1" : "0"
- printf "RUBY_FL_USER11 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER11 ? "1" : "0"
- printf "RUBY_FL_USER12 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER12 ? "1" : "0"
- printf "RUBY_FL_USER13 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER13 ? "1" : "0"
- printf "RUBY_FL_USER14 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER14 ? "1" : "0"
- printf "RUBY_FL_USER15 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER15 ? "1" : "0"
- printf "RUBY_FL_USER16 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER16 ? "1" : "0"
- printf "RUBY_FL_USER17 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER17 ? "1" : "0"
- printf "RUBY_FL_USER18 : %s\n", ((struct RBasic*)($arg0))->flags & RUBY_FL_USER18 ? "1" : "0"
-end
diff --git a/.gitattributes b/.gitattributes
deleted file mode 100644
index d0c2d266b4..0000000000
--- a/.gitattributes
+++ /dev/null
@@ -1,8 +0,0 @@
-*.gemspec diff=ruby
-*.rb diff=ruby
-bin svn-properties=svn:ignore=ruby
-bin/* diff=ruby
-tool/update-deps diff=ruby
-tool/make-snapshot diff=ruby
-tool/format-release diff=ruby
-tool/leaked-globals diff=ruby
diff --git a/.github/SECURITY.md b/.github/SECURITY.md
deleted file mode 100644
index 56baa29942..0000000000
--- a/.github/SECURITY.md
+++ /dev/null
@@ -1,9 +0,0 @@
-# Security Policy
-
-## Supported Versions
-
-See <https://www.ruby-lang.org/en/downloads/branches/>.
-
-## Reporting a Vulnerability
-
-See <https://www.ruby-lang.org/en/security/>.
diff --git a/.github/workflows/check_branch.yml b/.github/workflows/check_branch.yml
deleted file mode 100644
index 40292838f2..0000000000
--- a/.github/workflows/check_branch.yml
+++ /dev/null
@@ -1,22 +0,0 @@
-# We bidirectionally synchronize github.com/ruby/ruby.git's ruby_2_7 branch and
-# git.ruby-lang.org/ruby.git's ruby_2_7 branch.
-# We can use a pull request's merge button only on the ruby_2_7 branch.
-#
-# Therefore, we require to pass this "check_branch" on all protected branches
-# to prevent us from accidentally pushing commits to GitHub directly.
-#
-# Details: https://bugs.ruby-lang.org/issues/16094
-name: Pull Request
-on: [pull_request]
-jobs:
- check_branch:
- runs-on: ubuntu-latest
- steps:
- - name: Check if branch is ruby_2_7
- run: |
- if [ "$BASE_REF" != ruby_2_7 ]; then
- echo "Only ruby_2_7 branch accepts a pull request, but it's '$BASE_REF'."
- exit 1
- fi
- env:
- BASE_REF: ${{ github.base_ref }}
diff --git a/.github/workflows/macos.yml b/.github/workflows/macos.yml
deleted file mode 100644
index 6cdbdc272b..0000000000
--- a/.github/workflows/macos.yml
+++ /dev/null
@@ -1,82 +0,0 @@
-name: macOS
-on:
- push:
- branches:
- - '*'
- pull_request:
- branches:
- - '*'
-jobs:
- make:
- runs-on: macos-latest
- strategy:
- matrix:
- test_task: [ "check", "test-bundler", "test-bundled-gems" ]
- fail-fast: false
- if: "!contains(github.event.head_commit.message, '[ci skip]')"
- steps:
- - name: Disable Firewall
- run: |
- sudo /usr/libexec/ApplicationFirewall/socketfilterfw --setglobalstate off
- sudo /usr/libexec/ApplicationFirewall/socketfilterfw --getglobalstate
- # Not using official actions/checkout because it's unstable and sometimes doesn't work for a fork.
- - name: Checkout ruby
- run: |
- git clone --single-branch --shallow-since=yesterday --branch=${GITHUB_REF#refs/heads/} https://github.com/${{ github.repository }} src
- git -C src reset --hard "$GITHUB_SHA"
- if: github.event_name == 'push'
- - name: Checkout a pull request
- run: |
- git clone --single-branch --shallow-since=yesterday --branch=${{ github.event.pull_request.head.ref }} https://github.com/${{ github.event.pull_request.head.repo.full_name }} src
- git -C src reset --hard ${{ github.event.pull_request.head.sha }}
- if: github.event_name == 'pull_request'
- - run: ./src/tool/actions-commit-info.sh
- id: commit_info
- - name: Install libraries
- run: |
- export WAITS='5 60'
- cd src
- tool/travis_retry.sh brew upgrade
- tool/travis_retry.sh brew install gdbm gmp libffi openssl@1.1 zlib autoconf automake libtool readline
- - name: Set ENV
- run: |
- echo "JOBS=-j$((1 + $(sysctl -n hw.activecpu)))" >> $GITHUB_ENV
- - name: Autoconf
- run: |
- cd src
- autoconf
- - name: Configure
- run: |
- mkdir build
- cd build
- ../src/configure -C --disable-install-doc --with-openssl-dir=$(brew --prefix openssl@1.1) --with-readline-dir=$(brew --prefix readline)
- - name: Make
- run: make -C build $JOBS
- - name: Remove system gems
- run: rm -rf /usr/local/lib/ruby/gems/2.7.0/
- - name: Extract gems
- run: make -C build update-gems extract-gems
- if: matrix.test_task == 'check'
- - name: Tests
- run: make -C build $JOBS -s ${{ matrix.test_task }}
- env:
- RUBY_TESTOPTS: "-q --tty=no"
- # Remove minitest from TEST_BUNDLED_GEMS_ALLOW_FAILURES if https://github.com/seattlerb/minitest/pull/798 is resolved
- # rss needs to add workaround for the non rexml environment
- TEST_BUNDLED_GEMS_ALLOW_FAILURES: "minitest,xmlrpc,rss,rexml"
- - name: Leaked Globals
- run: make -C build -s leaked-globals
- - uses: k0kubun/action-slack@v2.0.0
- with:
- payload: |
- {
- "attachments": [{
- "text": "${{ github.workflow }} / ${{ matrix.test_task }} <https://github.com/${{ github.repository }}/commit/${{ github.sha }}/checks|${{ steps.commit_info.outputs.COMMIT_DATE }} #${{ steps.commit_info.outputs.COMMIT_NUMBER_OF_DAY }}> " +
- "(<https://github.com/${{ github.repository }}/commit/${{ github.sha }}|" + "${{ github.sha }}".substring(0, 10) + ">) " +
- "of ${{ github.repository }}@" + "${{ github.ref }}".split('/').reverse()[0] + " by ${{ github.event.head_commit.committer.name }} failed",
- "color": "danger"
- }]
- }
- env:
- SLACK_WEBHOOK_URL: ${{ secrets.SLACK_WEBHOOK_URL }}
- if: failure() && github.event_name == 'push'
diff --git a/.github/workflows/mjit.yml b/.github/workflows/mjit.yml
deleted file mode 100644
index 5b662caa14..0000000000
--- a/.github/workflows/mjit.yml
+++ /dev/null
@@ -1,76 +0,0 @@
-name: MJIT
-on:
- push:
- branches:
- - '*'
- pull_request:
- branches:
- - '*'
-jobs:
- make:
- strategy:
- matrix:
- test_task: [ "check" ] # to make job names consistent
- jit_opts: [ "--jit", "--jit-wait" ]
- fail-fast: false
- runs-on: ubuntu-latest
- if: "!contains(github.event.head_commit.message, '[ci skip]')"
- steps:
- - name: Install libraries
- run: |
- set -x
- sudo apt-get update -q || :
- sudo apt-get install --no-install-recommends -q -y build-essential libssl-dev libyaml-dev libreadline6-dev zlib1g-dev libncurses5-dev libffi-dev libgdbm-dev bison autoconf ruby
- # Not using official actions/checkout because it's unstable and sometimes doesn't work for a fork.
- - name: Checkout ruby
- run: |
- git clone --single-branch --shallow-since=yesterday --branch=${GITHUB_REF#refs/heads/} https://github.com/${{ github.repository }} src
- git -C src reset --hard "$GITHUB_SHA"
- if: github.event_name == 'push'
- - name: Checkout a pull request
- run: |
- git clone --single-branch --shallow-since=yesterday --branch=${{ github.event.pull_request.head.ref }} https://github.com/${{ github.event.pull_request.head.repo.full_name }} src
- git -C src reset --hard ${{ github.event.pull_request.head.sha }}
- if: github.event_name == 'pull_request'
- - run: ./src/tool/actions-commit-info.sh
- id: commit_info
- - name: Fixed world writable dirs
- run: |
- chmod go-w $HOME
- sudo chmod -R go-w /usr/share
- - name: Set ENV
- run: |
- echo "JOBS=-j$((1 + $(nproc --all)))" >> $GITHUB_ENV
- - name: Autoconf
- run: cd src && exec autoconf
- - name: configure
- run: |
- mkdir build
- cd build
- ../src/configure -C --disable-install-doc
- - name: make all
- run: make -C build $JOBS
- - name: make install
- run: sudo make -C build $JOBS install
- - name: make test
- run: "make -C build $JOBS -s test TESTOPTS='-q --tty=no' RUN_OPTS='--disable-gems --jit-warnings ${{ matrix.jit_opts }}'"
- - name: make test-all
- run: "make -C build $JOBS -s test-all TESTOPTS='-q --tty=no' RUN_OPTS='--disable-gems --jit-warnings ${{ matrix.jit_opts }}'"
- - name: make test-spec
- run: "make -C build $JOBS -s test-spec RUN_OPTS='--disable-gems --jit-warnings ${{ matrix.jit_opts }}'"
- - name: Leaked Globals
- run: make -C build -s leaked-globals
- - uses: k0kubun/action-slack@v2.0.0
- with:
- payload: |
- {
- "attachments": [{
- "text": "${{ github.workflow }} / ${{ matrix.test_task }} ${{ matrix.jit_opts }} <https://github.com/${{ github.repository }}/commit/${{ github.sha }}/checks|${{ steps.commit_info.outputs.COMMIT_DATE }} #${{ steps.commit_info.outputs.COMMIT_NUMBER_OF_DAY }}> " +
- "(<https://github.com/${{ github.repository }}/commit/${{ github.sha }}|" + "${{ github.sha }}".substring(0, 10) + ">) " +
- "of ${{ github.repository }}@" + "${{ github.ref }}".split('/').reverse()[0] + " by ${{ github.event.head_commit.committer.name }} failed",
- "color": "danger"
- }]
- }
- env:
- SLACK_WEBHOOK_URL: ${{ secrets.SLACK_WEBHOOK_URL }}
- if: failure() && github.event_name == 'push'
diff --git a/.github/workflows/ubuntu.yml b/.github/workflows/ubuntu.yml
deleted file mode 100644
index 68f28d7b40..0000000000
--- a/.github/workflows/ubuntu.yml
+++ /dev/null
@@ -1,114 +0,0 @@
-name: Ubuntu
-on:
- push:
- branches:
- - '*'
- pull_request:
- branches:
- - '*'
-jobs:
- make:
- strategy:
- matrix:
- test_task: [ "check", "test-bundler", "test-bundled-gems" ]
- os: [ubuntu-latest, ubuntu-16.04]
- exclude:
- - test_task: test-bundler
- os: ubuntu-16.04
- - test_task: test-bundled-gems
- os: ubuntu-16.04
- fail-fast: false
- runs-on: ${{ matrix.os }}
- if: "!contains(github.event.head_commit.message, '[ci skip]')"
- steps:
- - run: env | sort
- - name: Dump GitHub context
- env:
- GITHUB_CONTEXT: ${{ toJson(github) }}
- run: echo "$GITHUB_CONTEXT"
- - name: Dump job context
- env:
- JOB_CONTEXT: ${{ toJson(job) }}
- run: echo "$JOB_CONTEXT"
- - name: Dump steps context
- env:
- STEPS_CONTEXT: ${{ toJson(steps) }}
- run: echo "$STEPS_CONTEXT"
- - name: Dump runner context
- env:
- RUNNER_CONTEXT: ${{ toJson(runner) }}
- run: echo "$RUNNER_CONTEXT"
- - name: Dump strategy context
- env:
- STRATEGY_CONTEXT: ${{ toJson(strategy) }}
- run: echo "$STRATEGY_CONTEXT"
- - name: Dump matrix context
- env:
- MATRIX_CONTEXT: ${{ toJson(matrix) }}
- run: echo "$MATRIX_CONTEXT"
-
- - name: Install libraries
- run: |
- set -x
- sudo apt-get update -q || :
- sudo apt-get install --no-install-recommends -q -y build-essential libssl-dev libyaml-dev libreadline6-dev zlib1g-dev libncurses5-dev libffi-dev libgdbm-dev bison autoconf ruby
- # Not using official actions/checkout because it's unstable and sometimes doesn't work for a fork.
- - name: Checkout ruby
- run: |
- git clone --single-branch --shallow-since=yesterday --branch=${GITHUB_REF#refs/heads/} https://github.com/${{ github.repository }} src
- git -C src reset --hard "$GITHUB_SHA"
- if: github.event_name == 'push'
- - name: Checkout a pull request
- run: |
- git clone --single-branch --shallow-since=yesterday --branch=${{ github.event.pull_request.head.ref }} https://github.com/${{ github.event.pull_request.head.repo.full_name }} src
- git -C src reset --hard ${{ github.event.pull_request.head.sha }}
- if: github.event_name == 'pull_request'
- - run: ./src/tool/actions-commit-info.sh
- id: commit_info
- - name: Fixed world writable dirs
- run: |
- chmod go-w $HOME
- sudo chmod -R go-w /usr/share
- - name: Set ENV
- run: |
- echo "JOBS=-j$((1 + $(nproc --all)))" >> $GITHUB_ENV
- - name: Autoconf
- run: cd src && exec autoconf
- - name: configure
- run: |
- mkdir build
- cd build
- ../src/configure -C --disable-install-doc
- - name: Make
- run: make -C build $JOBS
- - name: Extract gems
- run: make -C build update-gems extract-gems
- if: matrix.test_task == 'check'
- - name: Create dummy files in build dir
- run: |
- cd build
- ./miniruby -e '(("a".."z").to_a+("A".."Z").to_a+("0".."9").to_a+%w[foo bar test zzz]).each{|basename|File.write("#{basename}.rb", "raise %(do not load #{basename}.rb)")}'
- if: matrix.test_task == 'check'
- - name: Tests
- run: make -C build $JOBS -s ${{ matrix.test_task }}
- env:
- RUBY_TESTOPTS: "-q --tty=no"
- # Remove minitest from TEST_BUNDLED_GEMS_ALLOW_FAILURES if https://github.com/seattlerb/minitest/pull/798 is resolved
- # rss needs to add workaround for the non rexml environment
- TEST_BUNDLED_GEMS_ALLOW_FAILURES: "minitest,xmlrpc,rss"
- - name: Leaked Globals
- run: make -C build -s leaked-globals
- - uses: k0kubun/action-slack@v2.0.0
- with:
- payload: |
- {
- "attachments": [{
- "text": "${{ matrix.os }} / ${{ matrix.test_task }} <https://github.com/${{ github.repository }}/commit/${{ github.sha }}/checks|${{ steps.commit_info.outputs.COMMIT_DATE }} #${{ steps.commit_info.outputs.COMMIT_NUMBER_OF_DAY }}> " +
- "(<https://github.com/${{ github.repository }}/commit/${{ github.sha }}|" + "${{ github.sha }}".substring(0, 10) + ">) " +
- "of ${{ github.repository }}@" + "${{ github.ref }}".split('/').reverse()[0] + " by ${{ github.event.head_commit.committer.name }} failed",
- "color": "danger"
- }]
- }
- env:
- SLACK_WEBHOOK_URL: ${{ secrets.SLACK_WEBHOOK_URL }}
- if: failure() && github.event_name == 'push'
diff --git a/.github/workflows/windows.yml b/.github/workflows/windows.yml
deleted file mode 100644
index 82cca9353b..0000000000
--- a/.github/workflows/windows.yml
+++ /dev/null
@@ -1,91 +0,0 @@
-name: Windows
-on:
- push:
- branches:
- - '*'
- pull_request:
- branches:
- - '*'
-jobs:
- make:
- strategy:
- matrix:
- test_task: [test]
- os: [windows-2019]
- vs: [2019]
- fail-fast: false
- runs-on: ${{ matrix.os }}
- if: "!contains(github.event.head_commit.message, '[ci skip]')"
- steps:
- - uses: actions/cache@v1
- with:
- path: C:\vcpkg\downloads
- key: ${{ runner.os }}-vcpkg-download-${{ matrix.os }}-${{ github.sha }}
- restore-keys: |
- ${{ runner.os }}-vcpkg-download-${{ matrix.os }}-
- ${{ runner.os }}-vcpkg-download-
- - name: Install libraries with vcpkg
- run: |
- vcpkg --triplet x64-windows install readline zlib
- - uses: actions/cache@v1
- with:
- path: C:\Users\runneradmin\AppData\Local\Temp\chocolatey
- key: ${{ runner.os }}-chocolatey-${{ matrix.os }}-${{ github.sha }}
- restore-keys: |
- ${{ runner.os }}-chocolatey-${{ matrix.os }}-
- ${{ runner.os }}-chocolatey-
- - name: Install libraries with chocolatey
- run: |
- choco install --no-progress openssl winflexbison3
- # Not using official actions/checkout because it's unstable and sometimes doesn't work for a fork.
- - name: Checkout ruby
- run: |
- git clone --single-branch --shallow-since=yesterday --branch=${GITHUB_REF#refs/heads/} https://github.com/${{ github.repository }} src
- git -C src reset --hard ${{ github.sha }}
- if: github.event_name == 'push'
- shell: bash
- - name: Checkout a pull request
- run: |
- git clone --single-branch --shallow-since=yesterday --branch=${{ github.event.pull_request.head.ref }} https://github.com/${{ github.event.pull_request.head.repo.full_name }} src
- git -C src reset --hard ${{ github.event.pull_request.head.sha }}
- if: github.event_name == 'pull_request'
- - run: ./src/tool/actions-commit-info.sh
- shell: bash
- id: commit_info
- - name: Configure
- run: |
- md build
- cd build
- call "C:\Program Files (x86)\Microsoft Visual Studio\${{ matrix.vs }}\Enterprise\VC\Auxiliary\Build\vcvars64.bat"
- ../src/win32/configure.bat --disable-install-doc --without-ext=+,dbm,gdbm --enable-bundled-libffi --with-opt-dir=C:/vcpkg/installed/x64-windows --with-openssl-dir="C:/Program Files/OpenSSL-Win64"
- shell: cmd
- - name: nmake
- run: |
- call "C:\Program Files (x86)\Microsoft Visual Studio\${{ matrix.vs }}\Enterprise\VC\Auxiliary\Build\vcvars64.bat"
- set YACC=win_bison
- cd build
- echo on
- nmake up
- nmake extract-gems
- nmake
- shell: cmd
- - name: nmake test
- run: |
- call "C:\Program Files (x86)\Microsoft Visual Studio\${{ matrix.vs }}\Enterprise\VC\Auxiliary\Build\vcvars64.bat"
- cd build
- nmake ${{ matrix.test_task }}
- shell: cmd
- - uses: k0kubun/action-slack@v2.0.0
- with:
- payload: |
- {
- "attachments": [{
- "text": "${{ matrix.os }} / ${{ matrix.test_task }} <https://github.com/${{ github.repository }}/commit/${{ github.sha }}/checks|${{ steps.commit_info.outputs.COMMIT_DATE }} #${{ steps.commit_info.outputs.COMMIT_NUMBER_OF_DAY }}> " +
- "(<https://github.com/${{ github.repository }}/commit/${{ github.sha }}|" + "${{ github.sha }}".substring(0, 10) + ">) " +
- "of ${{ github.repository }}@" + "${{ github.ref }}".split('/').reverse()[0] + " by ${{ github.event.head_commit.committer.name }} failed",
- "color": "danger"
- }]
- }
- env:
- SLACK_WEBHOOK_URL: ${{ secrets.SLACK_WEBHOOK_URL }}
- if: failure() && github.event_name == 'push'
diff --git a/.gitignore b/.gitignore
deleted file mode 100644
index 487af950f3..0000000000
--- a/.gitignore
+++ /dev/null
@@ -1,225 +0,0 @@
-*-*-*.def
-*-*-*.exp
-*-*-*.lib
-*.a
-*.bak
-*.bc
-*.bundle
-*.dSYM
-*.dmyh
-*.dylib
-*.elc
-*.i
-*.inc
-*.log
-*.o
-*.obj
-*.old
-*.orig
-*.pch
-*.pdb
-*.rbinc
-*.rej
-*.s
-*.sav
-*.sl
-*.so
-*.swp
-*.yarb
-*~
-.*-*
-.*.list
-.*.time
-.DS_Store
-.bundle
-.ccmalloc
-.ext
-.pc
-.ppack
-.svn
-.time
-Makefile
-cygruby*.def
-extconf.h
-y.output
-y.tab.c
-*.gcda
-*.gcno
-*.gcov
-*.vscode
-lcov*.info
-
-# /
-/*-fake.rb
-/*.dll
-/*.exe
-/*.res
-/*.pc
-/*.rc
-/*_prelude.c
-/build*/
-/COPYING.LIB
-/ChangeLog
-/Doxyfile
-/GNUmakefile
-/README.atheos
-/README.fat-patch
-/README.v6
-/TAGS
-/archive
-/autom4te*.cache
-/automake
-/benchmark/benchmark-driver
-/beos
-/bmlog-*
-/breakpoints.gdb
-/config.cache
-/config.h
-/config.h.in
-/config.status
-/config.status.lineno
-/configure
-/coverage/simplecov
-/coverage/simplecov-html
-/coverage/doclie
-/coverage/.last_run.json
-/coverage/.resultset.json*
-/coverage/assets
-/coverage/index.html
-/doc/capi
-/enc.mk
-/encdb.h
-/exts.mk
-/goruby
-/id.[ch]
-/largefile.h
-/lcov-c-out
-/lcov-rb-out
-/lcov-out
-/lex.c
-/libruby*.*
-/miniprelude.c
-/miniruby
-/newdate.rb
-/newline.c
-/newver.rb
-/parse.c
-/parse.h
-/patches
-/patches-master
-/pitest.rb
-/ppack
-/prelude.c
-/preview
-/probes.dmyh
-/probes.h
-/rbconfig.rb
-/rename2.h
-/repack
-/revision.h
-/riscos
-/rubicon
-/ruby
-/ruby-runner
-/ruby-runner.h
-/ruby-man.rd.gz
-/run.gdb
-/sizes.c
-/test.rb
-/test-coverage.dat
-/tmp
-/transdb.h
-/uncommon.mk
-/verconf.h
-/verconf.mk
-/web
-/yasmdata.rb
-
-# /bin/
-
-/bin/*.exe
-/bin/*.dll
-
-# /benchmark/
-/benchmark/bm_require.data
-/benchmark/bmx_*.rb
-/benchmark/fasta.output.*
-/benchmark/wc.input
-
-/enc/*.def
-/enc/*.exp
-/enc/*.lib
-/enc/jis/props.h
-/enc/unicode/data
-
-# /coroutine/
-!/coroutine/**/*.s
-
-# /enc/trans/
-/enc/trans/*.c
-/enc/trans/*.def
-/enc/trans/*.exp
-/enc/trans/*.lib
-
-# /exe/
-/exe/goruby
-/exe/ruby
-
-# /ext/
-/ext/extinit.c
-/ext/configure-ext.mk
-/ext/*/exts.mk
-
-# /ext/-test-/cxxanyargs
-/ext/-test-/cxxanyargs/failure*.failed
-
-# /ext/-test-/win32/dln/
-/ext/-test-/win32/dln/dlntest.dll
-/ext/-test-/win32/dln/dlntest.exp
-/ext/-test-/win32/dln/dlntest.lib
-
-# /ext/etc/
-/ext/etc/constdefs.h
-
-# /ext/fiddle/
-/ext/fiddle/libffi-*
-
-# /ext/rbconfig/
-/ext/rbconfig/sizeof/sizes.c
-/ext/rbconfig/sizeof/limits.c
-
-# /ext/ripper/
-/ext/ripper/eventids1.c
-/ext/ripper/eventids2table.c
-/ext/ripper/ripper.*
-/ext/ripper/ids1
-/ext/ripper/ids2
-
-# /ext/socket/
-/ext/socket/constants.h
-/ext/socket/constdefs.h
-/ext/socket/constdefs.c
-
-# /gems
-/gems/*.gem
-/gems/src
-/gems/*-*
-
-# /lib/
-/lib/ruby/[1-9]*.*
-/lib/ruby/vendor_ruby
-
-# /spec/bundler
-/.rspec_status
-
-# /tool/
-/tool/config.guess
-/tool/config.sub
-
-# /win32/
-/win32/*.ico
-
-# MJIT
-/rb_mjit_header.h
-/mjit_config.h
-/include/ruby-*/*/rb_mjit_min_header-*.h
diff --git a/.rspec_parallel b/.rspec_parallel
deleted file mode 100644
index aaff198a32..0000000000
--- a/.rspec_parallel
+++ /dev/null
@@ -1,2 +0,0 @@
---format progress
---format ParallelTests::RSpec::RuntimeLogger --out tmp/parallel_runtime_rspec.log
diff --git a/.travis.yml b/.travis.yml
deleted file mode 100644
index 71945e349e..0000000000
--- a/.travis.yml
+++ /dev/null
@@ -1,550 +0,0 @@
-# -*- YAML -*-
-# Copyright (C) 2011 Urabe, Shyouhei. All rights reserved.
-#
-# This file is a part of the programming language Ruby. Permission is hereby
-# granted, to either redistribute or modify this file, provided that the
-# conditions mentioned in the file COPYING are met. Consult the file for
-# details.
-
-# This is a Travis-CI build configuration file. The list of configurations
-# available is located in
-#
-# http://about.travis-ci.org/docs/user/build-configuration/
-#
-# and as Ruby itself is a project written in C language,
-#
-# http://about.travis-ci.org/docs/user/languages/c/
-#
-# is also a good place to look at.
-
-language: c
-
-os: linux
-
-dist: xenial
-
-git:
- quiet: true
-
-cache:
- ccache: true
- directories:
- - $HOME/config_2nd
- - $HOME/.downloaded-cache
-
-env:
- global:
- # Reset timestamps early
- - _=$(touch NEWS && find . -type f -exec touch -r NEWS {} +)
- - CONFIGURE_TTY=no
- - CCACHE_COMPILERCHECK=none
- - CCACHE_NOCOMPRESS=1
- - CCACHE_MAXSIZE=512Mi
- - NPROC="`nproc`"
- # JOBS and SETARCH are overridden when necessary; see below.
- - JOBS=-j$((1+${NPROC}))
- - SETARCH=
- - RUBY_PREFIX=/tmp/ruby-prefix
- - GEMS_FOR_TEST='timezone tzinfo'
- - UPDATE_UNICODE="UNICODE_FILES=. UNICODE_PROPERTY_FILES=. UNICODE_AUXILIARY_FILES=. UNICODE_EMOJI_FILES=."
- # https://github.com/travis-ci/travis-build/blob/e411371dda21430a60f61b8f3f57943d2fe4d344/lib/travis/build/bash/travis_apt_get_options.bash#L7
- - travis_apt_get_options='--allow-downgrades --allow-remove-essential --allow-change-held-packages'
- - travis_apt_get_options="-yq --no-install-suggests --no-install-recommends $travis_apt_get_options"
-
-.org.ruby-lang.ci.matrix-definitions:
-
- - &cron-only
- if: (type = cron) AND (branch = master) AND (fork = false)
-
- - &make-test-only
- script:
- - $SETARCH make -s test TESTOPTS="${TESTOPTS=$JOBS -q --tty=no}"
-
- - &gcc-8
- compiler: gcc-8
- # # Not using addon to control retries
- # addons:
- # apt:
- # sources:
- # - ubuntu-toolchain-r-test
- before_install:
- - tool/travis_retry.sh sudo -E apt-add-repository -y "ppa:ubuntu-toolchain-r/test"
- - tool/travis_retry.sh sudo bash -c "rm -rf '${TRAVIS_ROOT}/var/lib/apt/lists/'* && exec apt-get update -yq"
- - |-
- ${BEFORE_INSTALL}
- tool/travis_retry.sh sudo -E apt-get $travis_apt_get_options install \
- ccache \
- gcc-8 \
- g++-8 \
- libffi-dev \
- libgdbm-dev \
- libgmp-dev \
- libjemalloc-dev \
- libncurses5-dev \
- libncursesw5-dev \
- libreadline6-dev \
- libssl-dev \
- libyaml-dev \
- openssl \
- valgrind \
- zlib1g-dev
-
- - &clang-8
- compiler: clang-8
- addons:
- apt:
- # Not doing this manually unlike other sources, because it has been stable.
- sources:
- - llvm-toolchain-xenial-8
- config:
- retries: true
- before_install:
- - tool/travis_retry.sh sudo bash -c "rm -rf '${TRAVIS_ROOT}/var/lib/apt/lists/'* && exec apt-get update -yq"
- - |-
- tool/travis_retry.sh sudo -E apt-get $travis_apt_get_options install \
- clang-8 \
- llvm-8-tools \
- libffi-dev \
- libgdbm-dev \
- libgmp-dev \
- libjemalloc-dev \
- libncurses5-dev \
- libncursesw5-dev \
- libreadline6-dev \
- libssl-dev \
- libyaml-dev \
- openssl \
- valgrind \
- zlib1g-dev
-
- # --------
-
- - &x86_64-linux
- name: x86_64-linux
- <<: *gcc-8
-
- - &arm64-linux
- name: arm64-linux
- arch: arm64
- <<: *gcc-8
-
- - &s390x-linux
- name: s390x-linux
- arch: s390x
- <<: *gcc-8
-
- - &jemalloc
- name: --with-jemalloc
- <<: *gcc-8
- <<: *cron-only
- env:
- - CONFIG_FLAG='--with-gmp --with-jemalloc --with-valgrind'
-
- - &assertions
- name: RUBY_DEBUG=1
- <<: *gcc-8
- #<<: *cron-only
- <<: *make-test-only
- env:
- - GEMS_FOR_TEST=
- - cppflags='-DRUBY_DEBUG -DVM_CHECK_MODE=1 -DTRANSIENT_HEAP_CHECK_MODE -DRGENGC_CHECK_MODE -DENC_DEBUG'
-
- - &VM_CHECK_MODE
- name: VM_CHECK_MODE=3
- <<: *gcc-8
- <<: *cron-only
- <<: *make-test-only
- env:
- - GEMS_FOR_TEST=
- - cppflags=-DVM_CHECK_MODE=0x0003
-
- - &SUPPORT_JOKE
- name: SUPPORT_JOKE
- <<: *gcc-8
- <<: *cron-only
- <<: *make-test-only
- env:
- - BEFORE_INSTALL="sed vm_opts.h -e 's/OPT_SUPPORT_JOKE *0/OPT_SUPPORT_JOKE 1/' -i"
-
- - &CPDEBUG
- name: CPDEBUG
- <<: *gcc-8
- <<: *cron-only
- <<: *make-test-only
- env:
- - cppflags=-DCPDEBUG
-
- - &WITH_COROUTINE_UCONTEXT
- name: COROUTINE=ucontext
- <<: *gcc-8
- <<: *cron-only
- env:
- - CONFIG_FLAG='--with-coroutine=ucontext'
-
- - &WITH_COROUTINE_COPY
- name: COROUTINE=copy
- <<: *gcc-8
- <<: *cron-only
- env:
- - CONFIG_FLAG='--with-coroutine=copy'
-
- - &TOKEN_THREADED_CODE
- name: TOKEN_THREADED_CODE
- <<: *gcc-8
- <<: *cron-only
- <<: *make-test-only
- env:
- - GEMS_FOR_TEST=
- - cppflags=-DOPT_THREADED_CODE=1
-
- - &CALL_THREADED_CODE
- name: CALL_THREADED_CODE
- <<: *gcc-8
- <<: *cron-only
- <<: *make-test-only
- env:
- - GEMS_FOR_TEST=
- - cppflags=-DOPT_THREADED_CODE=2
-
- - &NO_THREADED_CODE
- name: NO_THREADED_CODE
- <<: *gcc-8
- <<: *cron-only
- <<: *make-test-only
- env:
- - GEMS_FOR_TEST=
- - cppflags=-DOPT_THREADED_CODE=3
-
- - &ASAN
- name: -fsanitize=address
- <<: *clang-8
- #<<: *cron-only
- <<: *make-test-only
- env:
- - GEMS_FOR_TEST=
- - ASAN_OPTIONS=detect_leaks=0
- - cflags='-U_FORTIFY_SOURCE -march=native -fsanitize=address -fno-omit-frame-pointer -fPIC'
- - debugflags=-ggdb3
- - optflags=-O1
- - LD=clang-8
- - LDFLAGS='-fsanitize=address -fPIC'
- - CONFIG_FLAG='--with-out-ext=openssl --without-gmp --without-jemalloc --without-valgrind'
-
- - &MSAN
- name: -fsanitize=memory
- <<: *clang-8
- #<<: *cron-only
- <<: *make-test-only
- env:
- - GEMS_FOR_TEST=
- - cflags='-U_FORTIFY_SOURCE -fsanitize=memory -fsanitize-memory-track-origins=2 -fno-omit-frame-pointer -fPIC'
- - optflags=-O1
- - LD=clang-8
- - LDFLAGS='-fsanitize=memory -fPIC'
- - CONFIG_FLAG='--with-out-ext=openssl --without-gmp --without-jemalloc --without-valgrind'
-
- - &UBSAN
- name: -fsanitize=undefined
- <<: *clang-8
- #<<: *cron-only
- <<: *make-test-only
- env:
- - GEMS_FOR_TEST=
- - cflags='-U_FORTIFY_SOURCE -fsanitize=undefined,integer,nullability -fno-sanitize=implicit-integer-sign-change,unsigned-integer-overflow'
- - cppflags=-DUNALIGNED_WORD_ACCESS=0
- - debugflags=-ggdb3
- - optflags='-O1 -march=native'
- - LD=clang-8
- - LDFLAGS='-fsanitize=undefined,integer,nullability -fno-sanitize=implicit-integer-sign-change,unsigned-integer-overflow'
-
- - &i686-linux
- name: i686-linux
- compiler: gcc-8
- env:
- - GCC_FLAGS=-m32
- - CXX='g++-8 -m32'
- - debugflags=-g0
- - SETARCH='setarch i686 --verbose --3gb'
- # # Not using addon to control retries
- # addons:
- # apt:
- # sources:
- # - ubuntu-toolchain-r-test
- before_install:
- - tool/travis_retry.sh sudo -E apt-add-repository -y "ppa:ubuntu-toolchain-r/test"
- - tool/travis_retry.sh sudo bash -c "rm -rf '${TRAVIS_ROOT}/var/lib/apt/lists/'* && exec apt-get update -yq"
- - |-
- tool/travis_retry.sh sudo -E apt-get $travis_apt_get_options install \
- gcc-8-multilib \
- g++-8 \
- g++-8-multilib \
- libstdc++-8-dev:i386 \
- libffi-dev:i386 \
- libffi6:i386 \
- libgdbm-dev:i386 \
- libgdbm3:i386 \
- libncurses5-dev:i386 \
- libncurses5:i386 \
- libncursesw5-dev:i386 \
- libreadline6-dev:i386 \
- libreadline6:i386 \
- libssl-dev:i386 \
- libssl1.0.0:i386 \
- linux-libc-dev:i386 \
- zlib1g-dev:i386 \
- zlib1g:i386
-
- - &arm32-linux
- name: arm32-linux
- arch: arm64
- # https://packages.ubuntu.com/xenial/crossbuild-essential-armhf
- compiler: arm-linux-gnueabihf-gcc
- env:
- - debugflags=-g0
- - SETARCH='setarch linux32 --verbose --32bit'
- before_install:
- - sudo dpkg --add-architecture armhf
- - tool/travis_retry.sh sudo bash -c "rm -rf '${TRAVIS_ROOT}/var/lib/apt/lists/'* && exec apt-get update -yq"
- - |-
- tool/travis_retry.sh sudo -E apt-get $travis_apt_get_options install \
- ccache \
- crossbuild-essential-armhf \
- libc6:armhf \
- libstdc++-5-dev:armhf \
- libffi-dev:armhf \
- libffi6:armhf \
- libgdbm-dev:armhf \
- libgdbm3:armhf \
- libncurses5-dev:armhf \
- libncurses5:armhf \
- libncursesw5-dev:armhf \
- libreadline6-dev:armhf \
- libreadline6:armhf \
- libssl-dev:armhf \
- libssl1.0.0:armhf \
- linux-libc-dev:armhf \
- zlib1g-dev:armhf \
- zlib1g:armhf
-
- - &pedanticism
- name: -std=c99 -pedantic
- compiler: clang
- <<: *make-test-only
- env:
- - GEMS_FOR_TEST=
- - GCC_FLAGS='-std=c99 -Werror=pedantic -pedantic-errors'
- - CONFIG_FLAG=
- - JOBS=
- - >-
- warnflags='
- -Wall
- -Wextra
- -Werror=deprecated-declarations
- -Werror=division-by-zero
- -Werror=extra-tokens
- -Werror=implicit-function-declaration
- -Werror=implicit-int
- -Werror=pointer-arith
- -Werror=shorten-64-to-32
- -Werror=write-strings
- -Wmissing-noreturn
- -Wno-constant-logical-operand
- -Wno-missing-field-initializers
- -Wno-overlength-strings
- -Wno-parentheses-equality
- -Wno-self-assign
- -Wno-tautological-compare
- -Wno-unused-local-typedef
- -Wno-unused-parameter
- -Wunused-variable'
- - LDFLAGS=-Wno-unused-command-line-argument
-
- - &rubyspec
- name: Check ruby/spec version guards on Ruby 2.4
- language: ruby
- rvm: 2.4.6
- before_install:
- install:
- before_script: chmod -R u+w spec/ruby
- # -j randomly hangs.
- script: ruby -C spec/ruby ../mspec/bin/mspec .
- after_failure:
- - echo "ruby/spec failed on Ruby 2.4. This is likely because of a missing ruby_version_is guard, please add it. See spec/README.md."
-
- - &baseruby
- name: "BASERUBY: Ruby 2.2"
- <<: *gcc-8
- <<: *make-test-only
- language: ruby
- rvm: 2.2
-
- - &dependency
- name: Check dependencies in makefiles
- language: ruby
- before_install:
- install:
- before_script:
- - |-
- ruby -e 'new = []
- Dir.glob("ext/**/extconf.rb") {|ex|
- unless File.exist?(dep = File.dirname(ex)+"/depend")
- puts "Adding "+dep
- File.copy_stream("template/depend.tmpl", dep)
- new << dep
- end
- }
- exec("git", "add", *new) unless new.empty?'
- - git diff --cached
- - "> config.status"
- - "> .rbconfig.time"
- - sed -f tool/prereq.status template/Makefile.in common.mk > Makefile
- - make touch-unicode-files
- - make -s $JOBS $UPDATE_UNICODE up
- - make -s $JOBS srcs
- - rm -f config.status Makefile rbconfig.rb .rbconfig.time
- - $SETARCH ./configure -C --disable-install-doc --prefix=$RUBY_PREFIX --disable-rubygems 'optflags=-O0' 'debugflags=-save-temps=obj -g'
- - ruby tool/update-deps --fix
- script:
- - git diff --no-ext-diff --ignore-submodules --exit-code
- after_failure:
- - echo "Dependencies need to update"
- env:
- - CONFIG_FLAG=
-
-matrix:
- include:
- # Build every commit:
- - <<: *x86_64-linux
- - <<: *arm64-linux
- - <<: *i686-linux
- - <<: *arm32-linux
- - <<: *s390x-linux
- - <<: *pedanticism
- - <<: *assertions
- - <<: *baseruby
- - <<: *rubyspec
- - <<: *dependency
- # Build every commit (Allowed Failures):
- - <<: *ASAN
- - <<: *MSAN
- - <<: *UBSAN
- # Cron only:
- - <<: *jemalloc
- - <<: *VM_CHECK_MODE
- - <<: *SUPPORT_JOKE
- - <<: *CPDEBUG
- - <<: *WITH_COROUTINE_UCONTEXT
- - <<: *WITH_COROUTINE_COPY
- - <<: *TOKEN_THREADED_CODE
- - <<: *CALL_THREADED_CODE
- - <<: *NO_THREADED_CODE
- allow_failures:
- - name: s390x-linux
- - name: -fsanitize=address
- - name: -fsanitize=memory
- - name: -fsanitize=undefined
- fast_finish: true
-
-before_script:
- - date # Debugging "Permission defined" failure on darwin like https://travis-ci.org/ruby/ruby/jobs/508683759
- - dpkg --print-architecture
- - dpkg --print-foreign-architectures
- - setarch --list
- - echo JOBS=${JOBS} SETARCH=${SETARCH}
- - $SETARCH uname -a
- - $SETARCH uname -r
- - rm -fr .ext autom4te.cache
- - echo $TERM
- - |-
- [ -d ~/.downloaded-cache ] ||
- mkdir ~/.downloaded-cache
- - ln -s ~/.downloaded-cache
- - "> config.status"
- - "> .rbconfig.time"
- - sed -f tool/prereq.status template/Makefile.in common.mk > Makefile
- - date; make touch-unicode-files
- - date; make -s $JOBS $UPDATE_UNICODE up
- - date; make -s $JOBS srcs
- - rm -f config.status Makefile rbconfig.rb .rbconfig.time
- - |-
- if [ -d ~/config_2nd ]; then
- cp -pr ~/config_2nd build
- else
- mkdir build
- fi
- - mkdir config_1st config_2nd
- - chmod -R a-w .
- - chmod -R u+w build config_1st config_2nd
- - cd build
- - ccache --show-stats
- - |-
- case "$CC" in
- gcc*) CC="ccache $CC${GCC_FLAGS:+ }$GCC_FLAGS -fno-diagnostics-color";;
- clang*) CC="ccache $CC${GCC_FLAGS:+ }$GCC_FLAGS -fno-color-diagnostics";;
- esac
- - |-
- [ ! -f config.cache ] ||
- [ "$CC" = "`sed -n s/^ac_cv_prog_CC=//p config.cache`" ] ||
- (set -x; exec rm config.cache)
- - $SETARCH ../configure -C --disable-install-doc --prefix=$RUBY_PREFIX $CONFIG_FLAG
- - cp -pr config.cache config.status .ext/include ../config_1st
- - $SETARCH make reconfig
- - cp -pr config.cache config.status .ext/include ../config_2nd
- - (cd .. && exec diff -ru config_1st config_2nd)
- - chmod u+w ..
- - rm -rf ~/config_2nd
- - mv ../config_2nd ~
- - chmod u-w ..
- - $SETARCH make -s $JOBS
- - |-
- date; : # Debugging "Permission defined" failure on darwin like https://travis-ci.org/ruby/ruby/jobs/508683759
- if ! make install; then
- if [ "$(uname)" = Darwin ]; then
- # Debugging "Permission defined" failure on darwin like https://travis-ci.org/ruby/ruby/jobs/508683759
- set -x
- date
- ./miniruby -e 'ARGV.map{|path|[path,File.stat(path)]}.sort_by{|path,st|st.mtime}.each{|path,st|p mtime:st.mtime.to_f, ctime:st.ctime.to_f, path:path}' .ext/.timestamp/.RUBYCOMMONDIR*time .ext/common/bigdecimal/*.rb ../ext/bigdecimal/lib/bigdecimal/*.rb . .. .ext .ext/common .ext/common/bigdecimal ext/bigdecimal ../ext ../ext/bigdecimal ../ext/bigdecimal/lib ../ext/bigdecimal/lib/bigdecimal
- make COPY='cp -f' install
- else
- exit 1
- fi
- fi
- - ccache --show-stats
- - |-
- [ -z "${GEMS_FOR_TEST}" ] ||
- $RUBY_PREFIX/bin/gem install --no-document $GEMS_FOR_TEST
- - echo "raise 'do not load ~/.irbrc in test'" > ~/.irbrc
-
-script:
- - $SETARCH make -s test -o showflags TESTOPTS="${TESTOPTS=$JOBS -q --tty=no}"
- - travis_wait 50 $SETARCH make -s test-all -o exts TESTOPTS="${TESTOPTS} ${TEST_ALL_OPTS}" RUBYOPT="-w"
- - $SETARCH make -s test-spec MSPECOPT=-ff # not using `-j` because sometimes `mspec -j` silently dies
- - $SETARCH make -s -o showflags leaked-globals
-
-# Branch matrix. Not all branches are Travis-ready so we limit branches here.
-branches:
- only:
- - master
- - ruby_2_4
- - ruby_2_5
- - ruby_2_6
-
-# We want to be notified when something happens.
-notifications:
- irc:
- channels:
- - "chat.freenode.net#ruby-core"
- on_success: change # [always|never|change] # default: always
- on_failure: always # [always|never|change] # default: always
- template:
- - "%{message} by @%{author}: See %{build_url}"
-
- slack:
- rooms:
- - secure: ah7UEHBvncXT7bM5mvYIQAO+tIyV/wl7nXLb7wQD16dO2v8Gragy0mWjB79Q09hrrMGmp6H9bCDpdGS80boIA5EHaHoG4QaP0i9bsSt8U2AMWgZtfyIgQKJ4H2kXkGlrjO+AXTgnIkP7LNjdgAVUUTGQPb26T3QmoN2Splt+fIQ= # ruby:<token>#alerts
- on_pull_requests: false
- on_success: change
- on_failure: always
-
- email:
- - ko1c-failure@atdot.net
diff --git a/BSDL b/BSDL
deleted file mode 100644
index a009caefea..0000000000
--- a/BSDL
+++ /dev/null
@@ -1,22 +0,0 @@
-Copyright (C) 1993-2013 Yukihiro Matsumoto. All rights reserved.
-
-Redistribution and use in source and binary forms, with or without
-modification, are permitted provided that the following conditions
-are met:
-1. Redistributions of source code must retain the above copyright
-notice, this list of conditions and the following disclaimer.
-2. Redistributions in binary form must reproduce the above copyright
-notice, this list of conditions and the following disclaimer in the
-documentation and/or other materials provided with the distribution.
-
-THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
-ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
-IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
-ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
-FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
-DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
-OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
-HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
-LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
-OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
-SUCH DAMAGE.
diff --git a/CONTRIBUTING.md b/CONTRIBUTING.md
deleted file mode 100644
index ffdf2dd4b8..0000000000
--- a/CONTRIBUTING.md
+++ /dev/null
@@ -1,4 +0,0 @@
-Please see the [official issue tracker] and wiki [HowToContribute].
-
-[official issue tracker]: https://bugs.ruby-lang.org
-[HowToContribute]: https://bugs.ruby-lang.org/projects/ruby/wiki/HowToContribute
diff --git a/COPYING b/COPYING
index 48e5a96de7..870a5f22d6 100644
--- a/COPYING
+++ b/COPYING
@@ -1,56 +1,56 @@
Ruby is copyrighted free software by Yukihiro Matsumoto <matz@netlab.jp>.
-You can redistribute it and/or modify it under either the terms of the
-2-clause BSDL (see the file BSDL), or the conditions below:
+You can redistribute it and/or modify it under either the terms of the GPL
+(see the file GPL), or the conditions below:
-1. You may make and give away verbatim copies of the source form of the
- software without restriction, provided that you duplicate all of the
- original copyright notices and associated disclaimers.
+ 1. You may make and give away verbatim copies of the source form of the
+ software without restriction, provided that you duplicate all of the
+ original copyright notices and associated disclaimers.
-2. You may modify your copy of the software in any way, provided that
- you do at least ONE of the following:
+ 2. You may modify your copy of the software in any way, provided that
+ you do at least ONE of the following:
- a. place your modifications in the Public Domain or otherwise
- make them Freely Available, such as by posting said
- modifications to Usenet or an equivalent medium, or by allowing
- the author to include your modifications in the software.
+ a) place your modifications in the Public Domain or otherwise
+ make them Freely Available, such as by posting said
+ modifications to Usenet or an equivalent medium, or by allowing
+ the author to include your modifications in the software.
- b. use the modified software only within your corporation or
- organization.
+ b) use the modified software only within your corporation or
+ organization.
- c. give non-standard binaries non-standard names, with
- instructions on where to get the original software distribution.
+ c) give non-standard binaries non-standard names, with
+ instructions on where to get the original software distribution.
- d. make other distribution arrangements with the author.
+ d) make other distribution arrangements with the author.
-3. You may distribute the software in object code or binary form,
- provided that you do at least ONE of the following:
+ 3. You may distribute the software in object code or binary form,
+ provided that you do at least ONE of the following:
- a. distribute the binaries and library files of the software,
- together with instructions (in the manual page or equivalent)
- on where to get the original distribution.
+ a) distribute the binaries and library files of the software,
+ together with instructions (in the manual page or equivalent)
+ on where to get the original distribution.
- b. accompany the distribution with the machine-readable source of
- the software.
+ b) accompany the distribution with the machine-readable source of
+ the software.
- c. give non-standard binaries non-standard names, with
- instructions on where to get the original software distribution.
+ c) give non-standard binaries non-standard names, with
+ instructions on where to get the original software distribution.
- d. make other distribution arrangements with the author.
+ d) make other distribution arrangements with the author.
-4. You may modify and include the part of the software into any other
- software (possibly commercial). But some files in the distribution
- are not written by the author, so that they are not under these terms.
+ 4. You may modify and include the part of the software into any other
+ software (possibly commercial). But some files in the distribution
+ are not written by the author, so that they are not under these terms.
- For the list of those files and their copying conditions, see the
- file LEGAL.
+ For the list of those files and their copying conditions, see the
+ file LEGAL.
-5. The scripts and library files supplied as input to or produced as
- output from the software do not automatically fall under the
- copyright of the software, but belong to whomever generated them,
- and may be sold commercially, and may be aggregated with this
- software.
+ 5. The scripts and library files supplied as input to or produced as
+ output from the software do not automatically fall under the
+ copyright of the software, but belong to whomever generated them,
+ and may be sold commercially, and may be aggregated with this
+ software.
-6. THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR
- IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED
- WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
- PURPOSE.
+ 6. THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR
+ IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED
+ WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
+ PURPOSE.
diff --git a/COPYING.ja b/COPYING.ja
index 230376bc60..933cc7cb9a 100644
--- a/COPYING.ja
+++ b/COPYING.ja
@@ -1,51 +1,51 @@
-本プログラムはフリーソフトウェアです.2-clause BSDL
-または以下に示す条件で本プログラムを再配布できます
-2-clause BSDLについてはBSDLファイルを参照して下さい.
+$BK\%W%m%0%i%`$O%U%j!<%=%U%H%&%'%"$G$9!%(BGPL(the GNU General
+Public License)$B$^$?$O0J2<$K<($9>r7o$GK\%W%m%0%i%`$r:FG[I[$G(B
+$B$-$^$9!%(BGPL$B$K$D$$$F$O(BGPL$B%U%!%$%k$r;2>H$7$F2<$5$$!%(B
-1. 複製は制限なく自由です.
+ 1. $BJ#@=$O@)8B$J$/<+M3$G$9!%(B
-2. 以下の条件のいずれかを満たす時に本プログラムのソースを
- 自由に変更できます.
+ 2. $B0J2<$N>r7o$N$$$:$l$+$rK~$?$9;~$KK\%W%m%0%i%`$N%=!<%9$r(B
+ $B<+M3$KJQ99$G$-$^$9!%(B
- a. ネットニューズにポストしたり,作者に変更を送付する
- などの方法で,変更を公開する.
+ (a) $B%M%C%H%K%e!<%:$K%]%9%H$7$?$j!$:n<T$KJQ99$rAwIU$9$k(B
+ $B$J$I$NJ}K!$G!$JQ99$r8x3+$9$k!%(B
- b. 変更した本プログラムを自分の所属する組織内部だけで
- 使う.
+ (b) $BJQ99$7$?K\%W%m%0%i%`$r<+J,$N=jB0$9$kAH?%FbIt$@$1$G(B
+ $B;H$&!%(B
- c. 変更点を明示したうえ,ソフトウェアの名前を変更する.
- そのソフトウェアを配布する時には変更前の本プログラ
- ムも同時に配布する.または変更前の本プログラムのソー
- スの入手法を明示する.
+ (c) $BJQ99E@$rL@<($7$?$&$(!$%=%U%H%&%'%"$NL>A0$rJQ99$9$k!%(B
+ $B$=$N%=%U%H%&%'%"$rG[I[$9$k;~$K$OJQ99A0$NK\%W%m%0%i(B
+ $B%`$bF1;~$KG[I[$9$k!%$^$?$OJQ99A0$NK\%W%m%0%i%`$N%=!<(B
+ $B%9$NF~<jK!$rL@<($9$k!%(B
- d. その他の変更条件を作者と合意する.
+ (d) $B$=$NB>$NJQ99>r7o$r:n<T$H9g0U$9$k!%(B
-3. 以下の条件のいずれかを満たす時に本プログラムをコンパイ
- ルしたオブジェクトコードや実行形式でも配布できます.
+ 3. $B0J2<$N>r7o$N$$$:$l$+$rK~$?$9;~$KK\%W%m%0%i%`$r%3%s%Q%$(B
+ $B%k$7$?%*%V%8%'%/%H%3!<%I$d<B9T7A<0$G$bG[I[$G$-$^$9!%(B
- a. バイナリを受け取った人がソースを入手できるように,
- ソースの入手法を明示する.
+ (a) $B%P%$%J%j$r<u$1<h$C$??M$,%=!<%9$rF~<j$G$-$k$h$&$K!$(B
+ $B%=!<%9$NF~<jK!$rL@<($9$k!%(B
- b. 機械可読なソースコードを添付する.
+ (b) $B5!3#2DFI$J%=!<%9%3!<%I$rE:IU$9$k!%(B
- c. 変更を行ったバイナリは名前を変更したうえ,オリジナ
- ルのソースコードの入手法を明示する.
+ (c) $BJQ99$r9T$C$?%P%$%J%j$OL>A0$rJQ99$7$?$&$(!$%*%j%8%J(B
+ $B%k$N%=!<%9%3!<%I$NF~<jK!$rL@<($9$k!%(B
- d. その他の配布条件を作者と合意する.
+ (d) $B$=$NB>$NG[I[>r7o$r:n<T$H9g0U$9$k!%(B
-4. 他のプログラムへの引用はいかなる目的であれ自由です.た
- だし,本プログラムに含まれる他の作者によるコードは,そ
- れぞれの作者の意向による制限が加えられる場合があります.
+ 4. $BB>$N%W%m%0%i%`$X$N0zMQ$O$$$+$J$kL\E*$G$"$l<+M3$G$9!%$?(B
+ $B$@$7!$K\%W%m%0%i%`$K4^$^$l$kB>$N:n<T$K$h$k%3!<%I$O!$$=(B
+ $B$l$>$l$N:n<T$N0U8~$K$h$k@)8B$,2C$($i$l$k>l9g$,$"$j$^$9!%(B
- それらファイルの一覧とそれぞれの配布条件などに付いては
- LEGALファイルを参照してください.
+ $B$=$l$i%U%!%$%k$N0lMw$H$=$l$>$l$NG[I[>r7o$J$I$KIU$$$F$O(B
+ LEGAL$B%U%!%$%k$r;2>H$7$F$/$@$5$$!%(B
-5. 本プログラムへの入力となるスクリプトおよび,本プログラ
- ムからの出力の権利は本プログラムの作者ではなく,それぞ
- れの入出力を生成した人に属します.また,本プログラムに
- 組み込まれるための拡張ライブラリについても同様です.
+ 5. $BK\%W%m%0%i%`$X$NF~NO$H$J$k%9%/%j%W%H$*$h$S!$K\%W%m%0%i(B
+ $B%`$+$i$N=PNO$N8"Mx$OK\%W%m%0%i%`$N:n<T$G$O$J$/!$$=$l$>(B
+ $B$l$NF~=PNO$r@8@.$7$??M$KB0$7$^$9!%$^$?!$K\%W%m%0%i%`$K(B
+ $BAH$_9~$^$l$k$?$a$N3HD%%i%$%V%i%j$K$D$$$F$bF1MM$G$9!%(B
-6. 本プログラムは無保証です.作者は本プログラムをサポート
- する意志はありますが,プログラム自身のバグあるいは本プ
- ログラムの実行などから発生するいかなる損害に対しても責
- 任を持ちません.
+ 6. $BK\%W%m%0%i%`$OL5J]>Z$G$9!%:n<T$OK\%W%m%0%i%`$r%5%]!<%H(B
+ $B$9$k0U;V$O$"$j$^$9$,!$%W%m%0%i%`<+?H$N%P%0$"$k$$$OK\%W(B
+ $B%m%0%i%`$N<B9T$J$I$+$iH/@8$9$k$$$+$J$kB;32$KBP$7$F$b@U(B
+ $BG$$r;}$A$^$;$s!%(B
diff --git a/ChangeLog b/ChangeLog
new file mode 100644
index 0000000000..bcc57b6623
--- /dev/null
+++ b/ChangeLog
@@ -0,0 +1,7482 @@
+Fri Jul 16 15:23:53 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (return_jump, break_jump): raise unexpceted local jump
+ exception directly. [ruby-dev:23740]
+
+ * lib/base64.rb (Deprecated): super in bound method calls original
+ name method in stable version. [ruby-dev:23916]
+
+Fri Jul 16 11:31:49 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+
+ * lib/test/unit/ui/{fox,gtk,gtk2}/testrunner.rb: remove
+ garbage (patch from akira yamada) [ruby-dev:23911]
+
+Fri Jul 16 11:20:00 2004 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * sprintf.c (rb_f_sprintf): fix output of NaN, Inf and -Inf with
+ "%f" or etc on MSVCRT platforms. (backported from HEAD)
+
+Fri Jul 16 11:17:38 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * error.c (exit_initialize): use EXIT_SUCCESS instead of 0.
+ [ruby-dev:23913]
+
+ * error.c (exit_success_p): new method SystemExit#success?.
+ [ruby-dev:23912]
+
+ * error.c (syserr_initialize): initialization for subclasses.
+ [ruby-dev:23912]
+
+Thu Jul 15 23:53:38 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * lib/optparse.rb (OptionParser#warn, OptionParser#abort): Exception
+ no longer has to_str method.
+
+Thu Jul 15 22:59:48 2004 Shugo Maeda <shugo@ruby-lang.org>
+
+ * ext/readline/extconf.rb: added dir_config for curses, ncurses,
+ termcap. (backported from HEAD)
+
+Thu Jul 15 20:29:15 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+
+ * class.c, error.c, eval.c, intern.h, object.c, variable.c:
+ do not set path if it is a singleton class. [ruby-dev:22588]
+ (backport from 1.9)
+
+Thu Jul 15 10:15:04 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tk/, ext/tcltklib/: bug fix
+
+ * ext/tk/lib/tk.rb: better operation for SIGINT when processing
+ callbacks.
+ * ext/tk/lib/tk/msgcat.rb: ditto.
+ * ext/tk/lib/tk/variable.rb: ditto.
+ * ext/tk/lib/tk/timer.rb: ditto.
+
+ * ext/tk/lib/tk/validation.rb: add Tk::ValidateConfigure.__def_validcmd
+ to define validatecommand methods easier
+
+ * ext/tk/lib/tk.rb (_genobj_for_tkwidget): support autoload Tk ext
+ classes
+
+ * ext/tk/lib/tk/canvas.rb and so on: remove the parent widget type
+ check for items (e.g. canvas items; depends on the class) to
+ avoid some troubles on Tk extension widget class definition.
+
+ * ext/tk/lib/tkextlib/: add Iwidget and TkTable extension support
+
+ * ext/tk/sample/tkextlib/: add samples of Iwidget and TkTable
+
+
+Wed Jul 14 18:08:37 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * ext/openssl/ossl_asn1.c (ossl_asn1cons_to_der): fix type of
+ argument. [ruby-dev:23891]
+
+ * test/openssl/test_x509store.rb: prune tests for CRL checking
+ unless X509::V_FLAG_CRL_CHECK is defined.
+
+Wed Jul 14 12:29:07 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+
+ * util.c (ruby_strtod): should not convert string in the form of
+ "-I.FE-X" which both "I" and "F" are ommitted. [ruby-dev:23883]
+
+ * test/ruby/test_float.rb (test_strtod): add test for bug fix.
+
+Wed Jul 14 01:18:45 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+
+ * array.c: rdoc patch - unified margin.
+
+Wed Jul 14 00:31:15 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+
+ * array.c: rdoc patch. merged patch from Johan Holmberg
+ <holmberg@iar.se> [ruby-core:3170]
+
+Tue Jul 13 19:39:12 2004 akira yamada <akira@ruby-lang.org>
+
+ * lib/uri/generic.rb (URI::Generic#merge_path):
+ "URI('http://www.example.com/foo/..') + './'" should return
+ "URI('http://www.example.com/')". [ruby-list:39838]
+ "URI('http://www.example.com/') + './foo/bar/..'" should return
+ "URI('http://www.example.com/foo/')". [ruby-list:39844]
+
+ * test/uri/test_generic.rb (TestGeneric#test_merge): added tests.
+
+Tue Jul 13 15:51:45 2004 Akinori MUSHA <knu@iDaemons.org>
+
+ * lib/mkmf.rb (init_mkmf): Do not add $(libdir) to $LIBPATH in
+ extmk mode.
+
+ * lib/mkmf.rb (dir_config): Prepend a new library path instead of
+ appending so it is tried first.
+
+Tue Jul 13 00:50:48 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/parsers/parse_rb.rb: Support call-seq: for Ruby files.
+
+Mon Jul 12 21:20:36 2004 Dave Thomas <dave@pragprog.com>
+
+ * html_generator.rb: Support hyperlinks of the form {any text}[xxx]
+ as well as stuff[xxx]
+
+Sat Jul 10 09:30:24 2004 NAKAMURA, Hiroshi <nakahiro@sarion.co.jp>
+
+ * test/soap/marshal/test_struct.rb: use qualified build-tin class name
+ (::Struct) to avoid name crash.
+
+Sat Jul 10 04:21:56 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tk/lib/tk.rb: better operation for SIGINT when processing
+ callbacks.
+ * ext/tk/lib/tk/msgcat.rb: ditto.
+ * ext/tk/lib/tk/variable.rb: ditto.
+ * ext/tk/lib/tk/timer.rb: ditto.
+
+ * ext/tk/lib/tk/validation.rb (__def_validcmd): add a module
+ function of Tk::ValidateConfigure to define validatecommand
+ methods easier
+
+Fri Jul 9 22:36:36 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+
+ * array.c, enum.c, pack.c: rdoc patch from Johan Holmberg
+ <holmberg@iar.se> [ruby-core:3132] [ruby-core:3136]
+
+ * numeric.c: rdoc patch.
+
+Fri Jul 9 19:26:39 2004 Tanaka Akira <akr@m17n.org>
+
+ * lib/open-uri.rb (URI::HTTPS#proxy_open): raise ArgumentError to
+ notice https is not supported.
+
+Fri Jul 9 14:28:54 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (rb_thread_raise): accept third argument as well as
+ Kernel#raise, and evaluate the arguments to create an exception in
+ the caller's context. [ruby-talk:105507]
+
+Fri Jul 9 01:47:08 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tk/lib : bug fix
+ * ext/tk/lib/tkextlib/itcl : add [incr Tcl] support
+ * ext/tk/lib/tkextlib/itk : add [incr Tk] support
+ * ext/tk/lib/tkextlib/iwidgets : midway point of [incr Widgets] support
+ * ext/tk/sample/tkextlib/iwidgets : very simple examples of
+ [incr Widgets]
+
+Thu Jul 8 22:52:19 2004 Kouhei Sutou <kou@cozmixng.org>
+
+ * lib/rss/{rss,parser,0.9,1.0,2.0}.rb: supported RSS 0.9x/2.0
+ validation and validation which disregard order of elements.
+ * test/rss/test_parser.rb: added tests for RSS 0.9x/2.0
+ validation.
+ * test/rss/{test_trackback,rss-testcase}.rb: fixed no good method
+ name.
+
+Thu Jul 8 00:05:23 2004 akira yamada <akira@ruby-lang.org>
+
+ * lib/tempfile.rb (Tempfile::initialize): got out code of
+ generating tmpname. [ruby-dev:23832][ruby-dev:23837]
+
+Wed Jul 7 15:53:14 2004 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * string.c (rb_str_match): raise TypeError when both arguments are
+ strings. [ruby-dev:22869] (backported from HEAD)
+
+ * string.c (rb_str_match2): removed.
+
+ * Makefile.in, bcc32/Makefile.sub, win32/Makefile.sub,
+ wince/Makefile.sub (string.c): now not depend on version.h.
+
+Wed Jul 7 00:48:34 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * ext/tk/lib/tkextlib/tktrans.rb,
+ ext/tk/lib/tkextlib/treectrl.rb: fix syntax errors.
+
+Tue Jul 6 18:38:45 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tk/lib : improve framework of developping Tcl/Tk extension
+ wrappers
+
+Mon Jul 5 23:56:42 2004 Kouhei Sutou <kou@cozmixng.org>
+
+ * lib/rss/{trackback,syndication,dublincore,content}.rb: worked
+ with ruby 1.6 again.
+
+ * test/rss/rss-assertions.rb: ditto.
+
+Mon Jul 5 22:54:39 2004 Tanaka Akira <akr@m17n.org>
+
+ * lib/uri/common.rb (Kernel#URI): new global method for parsing URIs.
+
+Mon Jul 5 09:02:52 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (rb_thread_yield, rb_f_catch): 4th argument to rb_yield_0()
+ is a set of bit flags. [ruby-dev:23859]
+
+Mon Jul 5 01:27:32 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+
+ * lib/drb/drb.rb(DRbConn self.open): If socket pool is full, close
+ the socket whose last-access-time is oldest. (and add new one)
+ [ruby-dev:23860]
+
+Sun Jul 4 12:24:50 2004 Kouhei Sutou <kou@cozmixng.org>
+
+ * lib/rss/rss.rb: added copyright header.
+
+Sun Jul 4 00:24:40 2004 NAKAMURA, Hiroshi <nakahiro@sarion.co.jp>
+
+ * added files
+ * lib/soap/attachment.rb
+ * lib/soap/header
+ * lib/soap/mimemessage.rb
+ * lib/soap/rpc/httpserver.rb
+ * lib/wsdl/soap/cgiStubCreator.rb
+ * lib/wsdl/soap/classDefCreator.rb
+ * lib/wsdl/soap/classDefCreatorSupport.rb
+ * lib/wsdl/soap/clientSkeltonCreator.rb
+ * lib/wsdl/soap/driverCreator.rb
+ * lib/wsdl/soap/mappingRegistryCreator.rb
+ * lib/wsdl/soap/methodDefCreator.rb
+ * lib/wsdl/soap/servantSkeltonCreator.rb
+ * lib/wsdl/soap/standaloneServerStubCreator.rb
+ * lib/wsdl/xmlSchema/enumeration.rb
+ * lib/wsdl/xmlSchema/simpleRestriction.rb
+ * lib/wsdl/xmlSchema/simpleType.rb
+ * lib/xsd/codegen
+ * lib/xsd/codegen.rb
+ * sample/soap/authheader
+ * sample/soap/raa2.4
+ * sample/soap/ssl
+ * sample/soap/swa
+ * sample/soap/whois.rb
+ * sample/soap/calc/samplehttpd.conf
+ * sample/soap/exchange/samplehttpd.conf
+ * sample/soap/sampleStruct/samplehttpd.conf
+ * sample/wsdl/raa2.4
+ * sample/wsdl/googleSearch/samplehttpd.conf
+ * test/openssl/_test_ssl.rb
+ * test/soap/header
+ * test/soap/ssl
+ * test/soap/struct
+ * test/soap/swa
+ * test/soap/wsdlDriver
+ * test/wsdl/multiplefault.wsdl
+ * test/wsdl/simpletype
+ * test/wsdl/test_multiplefault.rb
+
+ * modified files
+ * lib/soap/baseData.rb
+ * lib/soap/element.rb
+ * lib/soap/generator.rb
+ * lib/soap/marshal.rb
+ * lib/soap/netHttpClient.rb
+ * lib/soap/parser.rb
+ * lib/soap/processor.rb
+ * lib/soap/property.rb
+ * lib/soap/soap.rb
+ * lib/soap/streamHandler.rb
+ * lib/soap/wsdlDriver.rb
+ * lib/soap/encodingstyle/handler.rb
+ * lib/soap/encodingstyle/literalHandler.rb
+ * lib/soap/encodingstyle/soapHandler.rb
+ * lib/soap/mapping/factory.rb
+ * lib/soap/mapping/mapping.rb
+ * lib/soap/mapping/registry.rb
+ * lib/soap/mapping/rubytypeFactory.rb
+ * lib/soap/mapping/wsdlRegistry.rb
+ * lib/soap/rpc/cgistub.rb
+ * lib/soap/rpc/driver.rb
+ * lib/soap/rpc/element.rb
+ * lib/soap/rpc/proxy.rb
+ * lib/soap/rpc/router.rb
+ * lib/soap/rpc/soaplet.rb
+ * lib/soap/rpc/standaloneServer.rb
+ * lib/wsdl/data.rb
+ * lib/wsdl/definitions.rb
+ * lib/wsdl/operation.rb
+ * lib/wsdl/parser.rb
+ * lib/wsdl/soap/definitions.rb
+ * lib/wsdl/xmlSchema/complexContent.rb
+ * lib/wsdl/xmlSchema/complexType.rb
+ * lib/wsdl/xmlSchema/data.rb
+ * lib/wsdl/xmlSchema/parser.rb
+ * lib/wsdl/xmlSchema/schema.rb
+ * lib/xsd/datatypes.rb
+ * lib/xsd/qname.rb
+ * sample/soap/calc/httpd.rb
+ * sample/soap/exchange/httpd.rb
+ * sample/soap/sampleStruct/httpd.rb
+ * sample/soap/sampleStruct/server.rb
+ * sample/wsdl/amazon/AmazonSearch.rb
+ * sample/wsdl/amazon/AmazonSearchDriver.rb
+ * sample/wsdl/googleSearch/httpd.rb
+ * test/soap/test_basetype.rb
+ * test/soap/test_property.rb
+ * test/soap/test_streamhandler.rb
+ * test/soap/calc/test_calc.rb
+ * test/soap/calc/test_calc2.rb
+ * test/soap/calc/test_calc_cgi.rb
+ * test/soap/helloworld/test_helloworld.rb
+ * test/wsdl/test_emptycomplextype.rb
+ * test/wsdl/axisArray/test_axisarray.rb
+ * test/wsdl/datetime/test_datetime.rb
+ * test/wsdl/raa/test_raa.rb
+ * test/xsd/test_xmlschemaparser.rb
+ * test/xsd/test_xsd.rb
+
+ * summary
+ * add SOAP Header mustUnderstand support.
+
+ * add HTTP client SSL configuration and Cookies support (works
+ completely with http-access2).
+
+ * add header handler for handling sending/receiving SOAP Header.
+
+ * map Ruby's anonymous Struct to common SOAP Struct in SOAP Object
+ Model. it caused error.
+
+ * add WSDL simpleType support to restrict lexical value space.
+
+ * add SOAP with Attachment support.
+
+Sat Jul 3 17:19:44 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * ext/tk/lib/tkextlib/tkDND.rb: fix syntax error.
+
+Thu Jul 1 23:15:29 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * lib/pstore.rb (transaction): safer backup scheme. [ruby-list:39102]
+
+ * lib/pstore.rb (commit_new): use FileUtils.copy_stream for Cygwin.
+ [ruby-dev:23157]
+
+ * lib/pstore.rb (transaction): allow overriding dump and load.
+ [ruby-dev:23567]
+
+ * lib/pstore.rb (PStore#transaction): get rid of opening in write mode
+ when read only transaction. [ruby-dev:23842]
+
+ * lib/yaml/store.rb: follow lib/pstore.rb's change.
+
+Thu Jul 1 18:36:08 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tk/lib/tcltklib : bug fix
+
+ * ext/tk/lib/tk : bug fix and add Tcl/Tk extension support libraries
+
+Thu Jul 1 11:59:45 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * ext/openssl/extconf.rb: check for EVP_CIPHER_CTX_copy, ENGINE_add,
+ EVP_CIPHER_CTX_set_padding, EVP_CipherFinal_ex, EVP_CipherInit_ex,
+ EVP_DigestFinal_ex and EVP_DigestInit_ex.
+
+ * ext/openssl/openssl_missing.c (EVP_CIPHER_CTX_copy): new function.
+
+ * ext/openssl/openssl_missing.h (EVP_DigestInit_ex, EVP_DigestFinal_ex,
+ EVP_CipherInit_ex, EVP_CipherFinal_ex, HMAC_Init_ex): new macro for
+ OpenSSL 0.9.6.
+
+ * ext/openssl/ossl_cipher.c (ossl_cipher_encrypt, ossl_cipher_decrypt):
+ re-implemnt (the arguments for this method is ).
+
+ * ext/openssl/ossl_cipher.c (ossl_cipher_pkcs5_keyivgen): new method
+ OpenSSL::Cipher::Cipher#pkcs5_keyivgen. it calls EVP_BytesToKey().
+
+ * ext/openssl/ossl_cipher.c (ossl_cipher_alloc, ossl_cipher_initialize,
+ ossl_cipher_copy, ossl_cipher_reset ossl_cipher_final,
+ ossl_cipher_set_key, ossl_cipher_set_iv): replace all EVP_CipherInit
+ and EVP_CipherFinal into EVP_CipherInit_ex and EVP_CipherFinal_ex.
+ and EVP_CIPHER_CTX_init should only be called once.
+
+ * ext/openssl/ossl_cipher.c (ossl_cipher_set_key_length): new method
+ OpenSSL::Cipher::Cipher#key_len=.
+
+ * ext/openssl/ossl_cipher.c (ossl_cipher_init_deprecated): new
+ finction; print warning for Cipher#<<.
+
+ * ext/openssl/ossl_digest.c: replace all EVP_DigestInit and
+ EVP_DigestFinal into EVP_DigestInit_ex and EVP_DigestFinal_ex.
+ and EVP_MD_CTX_init should only be called once.
+
+ * ext/openssl/ossl_digest.c (digest_final): should call
+ EVP_MD_CTX_cleanup to avoid memory leak.
+
+ * ext/openssl/ossl_hmac.c (ossl_hmac_initialize): repalce HMAC_init
+ into HMAC_init_ex. and HMAC_CTX_init is moved to ossl_hmac_alloc.
+
+ * ext/openssl/ossl_hmac.c (hmac_final): should call
+ HMAC_CTX_cleanup to avoid memory leak.
+
+ * test/openssl/test_cipher.rb, test/openssl/test_digest.rb,
+ test/openssl/test_hmac.rb: new file.
+
+Thu Jul 1 04:08:30 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * ext/openssl/ossl_asn1.c (ossl_i2d_ASN1_TYPE, ossl_ASN1_TYPE_free):
+ workaround for the versions earlier than OpenSSL-0.9.7.
+
+Thu Jul 1 03:33:55 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * ext/openssl/ossl_pkey_dh.c (ossl_dh_initialize): should create
+ empty pkey object if no argument is passed. [ruby-talk:103328]
+
+ * ext/openssl/ossl_pkey_dsa.c (ossl_dsa_initialize): ditto.
+
+ * ext/openssl/ossl_pkey_rsa.c (ossl_rsa_initialize): ditto.
+
+ * ext/openssl/ossl_pkey_dh.c: add new methods: OpenSSL::PKey::DH#p,
+ OpenSSL::PKey::DH#p=, OpenSSL::PKey::DH#g, OpenSSL::PKey::DH#g=,
+ OpenSSL::PKey::DH#pub_key, OpenSSL::PKey::DH#pub_key=,
+ OpenSSL::PKey::DH#priv_key and OpenSSL::PKey::DH#priv_key=.
+
+ * ext/openssl/ossl_pkey_dsa.c: add new methods: OpenSSL::PKey::DSA#p,
+ OpenSSL::PKey::DSA#p=, OpenSSL::PKey::DSA#q, OpenSSL::PKey::DSA#q=,
+ OpenSSL::PKey::DSA#g, OpenSSL::PKey::DSA#g=,
+ OpenSSL::PKey::DSA#pub_key, OpenSSL::PKey::DSA#pub_key=,
+ OpenSSL::PKey::DSA#priv_key and OpenSSL::PKey::DSA#priv_key=.
+
+Thu Jul 1 03:16:09 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * ext/openssl/ossl_ssl.c (ossl_ssl_read): take optional second argument
+ to specify a string to be written.
+
+ * ext/openssl/lib/openssl/buffering.rb (OpenSSL::Buffering#read):
+ take optional second argument to specify a string to be written.
+
+ * ext/openssl/lib/openssl/buffering.rb (OpenSSL::Buffering#gets):
+ refine regexp for end-of-line.
+
+ * ext/opnessl/lib/openssl/ssl.rb
+ (OpenSSL::SSL::SocketForwarder#listen): fix typo.
+
+Wed Jun 30 11:38:51 2004 Elven <elven@elven.de>
+
+ * parse.y (primary): should not be NULL. [ruby-core:03098]
+
+Wed Jun 30 02:53:24 2004 why the lucky stiff <why@ruby-lang.org>
+
+ * ext/syck/rubyext.c (syck_emitter_new): set buffer after
+ Data_Wrap_Struct to avoid possible GC. [ruby-talk:104835]
+
+Tue Jun 29 10:31:19 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (rb_eval_cmd, rb_thread_trap_eval): restore safe level.
+
+ * gc.c (define_final, run_final): preserve and restore safe level for
+ finalizers. [ruby-core:03058]
+
+ * signal.c (signal_exec, rb_trap_exit, trap): preserve and restore
+ safe level for signal handlers. [ruby-dev:23829]
+
+Mon Jun 28 14:57:56 2004 Jeff Mitchell <quixoticsycophant@yahoo.com>
+
+ * configure.in, lib/mkmf.rb (LIBPATHFLAG): use double quotes due to
+ DOSISH compilers. [ruby-core:03107]
+
+Mon Jun 28 00:30:19 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+
+ * sample/drb/*.rb: using 'DRb.thread.join' instead of 'gets'
+
+Sun Jun 27 22:39:51 2004 Kouhei Sutou <kou@cozmixng.org>
+
+ * sample/rss/tdiary_plugin/rss-recent.rb: supported Hiki.
+
+Sun Jun 27 12:19:46 2004 Kouhei Sutou <kou@cozmixng.org>
+
+ * {lib,sample,test}/rss: added RSS Parser. [ruby-dev:23780]
+
+Sat Jun 26 11:07:30 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * configure.in (aix): -b must come at the start of the command line,
+ and -e must not appear while testing libraries. [ruby-talk:104501]
+
+ * lib/mkmf.rb (dir_config): quote directory names if necessary.
+ [ruby-talk:104505]
+
+Fri Jun 25 15:33:19 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/iconv/extconf.rb: check stricter. [ruby-talk:104501]
+
+ * ext/iconv/extconf.rb: include iconv.h for libiconv. [ruby-dev:22715]
+
+Fri Jun 25 02:04:23 2004 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * {bcc32,win32,wince}/setup.mak: remove RUBY_EXTERN lines when
+ including version.h. [ruby-talk:104456] (backported from HEAD)
+
+Thu Jun 24 14:23:29 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * io.c (rb_io_fread): return already read data when system call is
+ interrupted. [ruby-talk:97206]
+
+Thu Jun 24 01:32:43 2004 Shugo Maeda <shugo@ruby-lang.org>
+
+ * version.h: added declarations of ruby_version,
+ ruby_release_date, ruby_platform.
+ (backported from HEAD)
+
+Wed Jun 23 22:23:37 2004 Dave Thomas <dave@pragprog.com>
+
+ * ext/socket/socket.c (sock_s_gethostbyaddr): Work around problem
+ with OS X not returning 'from' parameter to recvfrom for
+ connection-oriented sockets.
+
+Thu Jun 24 01:07:15 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_thread_atfork): remove "fork terminates thread"
+ warning. [ruby-dev:
+
+ * object.c (rb_obj_clone): backport FL_FINALIZE patch from 1.9.
+ [ruby-core:02786][ruby-core:03067]
+
+ * ext/socket/socket.c (sock_sockaddr): Socket#gethostbyname()
+ should give us packed address, not struct sockaddr.
+ [ruby-core:03053]
+
+Wed Jun 23 01:45:27 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/parsers/parse_rb.rb (RubyLex::identify_quotation):
+ Fix problem with the 'r' being dropped from %r{xxx}
+
+Wed Jun 23 00:20:20 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+
+ * ext/win32ole/win32ole.c (ole_hresult2msg): remove trailing
+ CR and LF. (doesn't depend on CR+LF) [ruby-dev:23694]
+
+Wed Jun 23 00:00:25 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * io.c (rb_io_initialize): should check fcntl result. [ruby-dev:23742]
+
+Tue Jun 22 21:11:36 2004 Masaki Suketa <masaki.suketa@nifty.ne.jp>
+
+ * ext/win32ole/win32ole.c (OLE_FREE): should not call CoFreeUnuse-
+ dLibraries().
+
+ * ext/win32ole/win32ole.c (ole_event_free): ditto.
+
+ * ext/win32ole/win32ole.c (ole_hresult2msg): truncate error message
+ before CR.
+
+Tue Jun 22 16:47:42 2004 Shugo Maeda <shugo@ruby-lang.org>
+
+ * lib/net/ftp.rb (MDTM_REGEXP): fix for demon's ftp server.
+ Thanks, Rutger Nijlunsing.
+
+Mon Jun 21 10:19:23 2004 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * win32/win32.c (rb_w32_opendir): use FindFirstFile()/FindNextFile()/
+ FindClose() instead of _findfirst()/_findnext()/_findclose().
+ merge from HEAD.
+
+Sat Jun 19 13:24:15 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (method_call): allow changing $SAFE. [ruby-dev:23713]
+
+Fri Jun 18 23:12:22 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (proc_save_safe_level, rb_set_safe_level, safe_setter): limit
+ safe level.
+
+Wed Jun 16 23:05:57 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * object.c (rb_mod_freeze): prepare string representation before
+ freezing. [ruby-talk:103646]
+
+Wed Jun 16 16:04:40 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * object.c (rb_mod_le): singleton class inherits Class rather than its
+ object's class. [ruby-dev:23690]
+
+Wed Jun 16 16:01:17 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * gc.c (stack_grow_direction): memoize the direction.
+
+ * gc.c (Init_stack): should always move to end of VALUE.
+
+Tue Jun 15 12:10:04 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tk/lib/tk.rb: bug fix (TkWindow#grab)
+
+Mon Jun 14 18:23:27 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tk/lib/remote-tk.rb: bug fix
+
+Sun Jun 13 00:23:04 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tcltklib/extconf.rb: [EXPERIMENTAL] MacOS X (darwin) support
+
+ * ext/tcltklib/tcltklib.c: fix thread trouble on callback proc, and
+ eliminate warning about instance variable access
+
+ * ext/tk/lib/tk/menubar.rb: improve supported menu_spec
+
+ * ext/tk/lib/tk/menuspec.rb: [add] menu_spec support library
+
+ * ext/tk/lib/tk/root.rb: add menu_spec support
+
+ * ext/tk/lib/tk/text.rb: bug fix
+
+ * ext/tk/lib/tk/toplevel.rb: add menu_spec support
+
+ * ext/tk/sample/menubar?.rb: [add] sample of menu_spec usage
+
+Sat Jun 12 11:15:53 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * configure.in (target_os): strip -gnu suffix on Linux.
+
+Fri Jun 11 17:08:21 2004 Akinori MUSHA <knu@iDaemons.org>
+
+ * config.guess: Restore a wrongly removed hyphen.
+
+Fri Jun 11 14:30:08 2004 Akinori MUSHA <knu@iDaemons.org>
+
+ * config.guess: Attempt to avoid system name change on
+ Darwin platfowms also.
+
+Fri Jun 11 14:22:45 2004 Akinori MUSHA <knu@iDaemons.org>
+
+ * config.guess, config.sub: Attempt to avoid system name change on
+ Linux platforms. We have been using "linux" instead of
+ "linux-gnu" on this branch.
+
+Thu Jun 10 19:19:41 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * ext/sdbm/init.c (fsdbm_store): sdbm should use StringValue().
+ [ruby-talk:103062]
+
+Wed Jun 9 18:04:14 2004 akira yamada <akira@ruby-lang.org>
+
+ * lib/uri/generic.rb (URI::Generic::merge,
+ URI::Generic::route_from): accepts non-hierarchical URI.
+ [ruby-dev:23631]
+
+ * test/uri/test_generic.rb (TestGeneric::test_route,
+ TestGeneric::test_merge): added tests for above changes.
+
+Wed Jun 9 17:39:37 2004 Akinori MUSHA <knu@iDaemons.org>
+
+ * config.guess, config.sub: Update to a more recent version as of
+ 2004-01-20.
+
+ * configure.in: Add support for DragonFly BSD.
+
+Wed Jun 2 20:16:03 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * string.c (str_new4): should share shared instance if it already
+ exists. [ruby-dev:23665]
+
+Wed Jun 2 12:41:53 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * io.c (rb_io_gets_m): set lastline ($_) even when read line is
+ nil. [ruby-dev:23663]
+
+Fri May 28 11:20:31 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (rb_eval): bad influence on frame node.
+
+ * eval.c (eval): reverted wrongly removed condition. [ruby-dev:23638]
+
+Thu May 27 23:15:18 2004 NAKAMURA, Hiroshi <nakahiro@sarion.co.jp>
+
+ * lib/logger.rb: leading 0 padding of timestamp usec part.
+
+ * lib/csv.rb (CSV.parse): [CAUTION] behavior changed. in the past,
+ CSV.parse accepts a filename to be read-opened (it was just a
+ shortcut of CSV.open(filename, 'r')). now CSV.parse accepts a
+ string or a stream to be parsed e.g.
+ CSV.parse("1,2\n3,r") #=> [['1', '2'], ['3', '4']]
+
+ * lib/csv.rb: CSV::Row and CSV::Cell are deprecated. these classes
+ are removed in the future. in the new csv.rb, row is represented
+ as just an Array. since CSV::Row was a subclass of Array, it won't
+ hurt almost all programs except one which depended CSV::Row#match.
+ and a cell is represented as just a String or nil(NULL). this
+ change will cause widespread destruction.
+
+ CSV.open("foo.csv", "r") do |row|
+ row.each do |cell|
+ if cell.is_null # using Cell#is_null
+ p "(NULL)"
+ else
+ p cell.data # using Cell#data
+ end
+ end
+ end
+
+ must be just;
+
+ CSV.open("foo.csv", "r") do |row|
+ row.each do |cell|
+ if cell.nil?
+ p "(NULL)"
+ else
+ p cell
+ end
+ end
+ end
+
+ * lib/csv.rb: [CAUTION] record separator(CR, LF, CR+LF) behavior
+ change. CSV.open, CSV.parse, and CSV,generate now do not force
+ opened file binmode. formerly it set binmode explicitly.
+
+ with CSV.open, binmode of opened file depends the given mode
+ parameter "r", "w", "rb", and "wb". CSV.parse and CSV.generate open
+ file with "r" and "w".
+
+ setting mode properly is user's responsibility now.
+
+ * lib/csv.rb: accepts String as a fs (field separator/column separator)
+ and rs (record separator/row separator)
+
+ * lib/csv.rb (CSV.read, CSV.readlines): added. works as IO.read and
+ IO.readlines in CSV format.
+
+ * lib/csv.rb: added CSV.foreach(path, rs = nil, &block). CSV.foreach
+ now does not handle "| cmd" as a path different from IO.foreach.
+ needed?
+
+ * test/csv/test_csv.rb: updated.
+
+ * test/ruby/test_float.rb: added test_strtod to test Float("0").
+
+Thu May 27 21:37:50 2004 Tanaka Akira <akr@m17n.org>
+
+ * lib/pathname.rb (Pathname#initialize): refine pathname initialization
+ by pathname.
+
+Thu May 27 20:22:05 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+
+ * io.c (rb_io_fwrite): check all case errno != 0 [ruby-dev:23648]
+
+Thu May 27 14:53:13 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * io.c (rb_io_fwrite): workaround for bcc32's fwrite bug.
+ add errno checking. [ruby-dev:23627]
+
+Wed May 26 14:19:42 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (rb_eval, eval): make line number consistent on eval with
+ Proc. [ruby-talk:101253]
+
+Wed May 26 13:59:17 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::skip_for_variable): Allow for
+ 'do' after for statement
+
+Wed May 26 13:56:03 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/generators/html_generator.rb (Generators::MarkUp::style_url): Fix
+ relative path to code CSS file
+
+Wed May 26 13:14:52 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * io.c (rb_io_init_copy): copy also positions. [ruby-talk:100910]
+
+Wed May 26 00:00:00 2004 why the lucky stiff <why@ruby-lang.org>
+
+ * ext/syck/syck.c (syck_new_parser): clear parser on init.
+ thanks, ts. [ruby-core:02931]
+
+ * ext/syck/token.c (sycklex_yaml_utf8): buffer underflow.
+ thanks, ts. [ruby-core:02929]
+
+ * lib/yaml/baseemitter.rb (indent_text): simpler flow block code.
+
+ * lib/yaml.rb: added rdoc to beginning of lib.
+
+Mon May 24 10:46:26 2004 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+
+ * lib/rdoc/generators/template/html/html.rb: SYSTEM identifiers
+ must be absolute URIs
+
+Sat May 22 12:00:04 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * MANIFEST: add new encodings in rexml.
+
+ * ext/tk/MANIFEST: add recent files.
+
+Sat May 22 05:37:11 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tk/lib/remote-tk.rb: (NEW library) controll Tk interpreters
+ on the other processes by Tcl/Tk's 'send' command
+
+Fri May 21 09:22:05 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_method_parameters):
+ Add ()'s around parameters that don't have them
+
+Thu May 20 17:02:03 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * lib/mkmf.rb (check_sizeof): define result size. [ruby-core:02911]
+
+ * lib/mkmf.rb (create_header): macro name should not include equal
+ sign.
+
+Thu May 20 15:59:50 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+
+ * ext/socket/socket.c: fix SEGV. [ruby-dev:23550]
+
+Thu May 20 14:35:52 2004 Tanaka Akira <akr@m17n.org>
+
+ * ext/socket/socket.c: check SCM_RIGHTS macro addition to
+ the msg_control field to test existence of file descriptor passing
+ by msg_control.
+
+Thu May 20 12:38:06 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * numeric.c (flo_eq): alway check if operands are NaN.
+ [ruby-list:39685]
+
+Thu May 20 12:34:39 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_visibility):
+ At Ryan Davis' suggestion, honor visibility modifers if guarded by a
+ statement modifier
+
+Thu May 20 12:22:13 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * lib/mkmf.rb (have_type): do not check pointer to incomplete type,
+ which always get compiled. [ruby-list:39683]
+
+Wed May 19 11:09:00 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tk/lib/tk.rb: change permition of TkObject#tk_send from
+ private to public
+
+Tue May 18 14:00:46 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * node.h (NEW_DSTR): adjust list length.
+
+ * parse.y (literal_concat): ditto.
+
+Mon May 17 16:14:25 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+
+ * numeric.c (flo_to_s): p 0.0 should be '0.0' not '0.0e+00'.
+
+ * numeric.c (flo_to_s): the number of significand is correctly handled,
+ there is assumption that DBL_DIG == 15 though.
+ (p 0.00000000000000000001 was '9.999999999999999e-21', now is
+ '1.0e-20')
+
+ [ruby-dev:23480]
+
+Mon May 17 10:13:33 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * ext/socket/socket.c (setup_domain_and_type): honor duck typing.
+ [ruby-dev:23522]
+
+ * ext/socket/socket.c (sock_s_getnameinfo): ditto.
+
+Mon May 17 01:15:23 2004 why the lucky stiff <why@ruby-lang.org>
+
+ * lib/yaml.rb: removed fallback to pure Ruby parser.
+
+ * lib/yaml/baseemitter.rb (indent_text): was forcing a mod value
+ of zero at times, which kept some blocks from getting indentation.
+
+ * lib/yaml/baseemitter.rb (node_text): rewriting folded scalars.
+
+ * ext/syck/syck.h: reports style of scalars now, be they plain, block
+ single-, or double-quoted.
+
+ * ext/syck/syck.c: ditto.
+
+ * ext/syck/gram.c: ditto.
+
+ * ext/syck/node.c: ditto.
+
+ * ext/syck/token.c: ditto.
+
+ * ext/syck/rubyext.c (yaml_org_handler): symbols loaded only
+ if scalar style is plain.
+
+ * ext/syck/rubyext.c (yaml_org_handler): some empty strings were
+ loaded as symbols.
+
+ * test/yaml/test_yaml.rb (test_perl_regexp): updated test to
+ match new regexp serialization.
+
+Mon May 17 00:03:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
+
+ * lib/drb/drb.rb: Cosmetic documentation changes.
+
+Sun May 16 22:36:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
+
+ * lib/test/unit.rb: Removed :nodoc: directive (it prevented effective
+ RDoc operation), and added file-level comment.
+
+Sun May 16 20:55:49 2004 Tanaka Akira <akr@m17n.org>
+
+ * ext/dbm/dbm.c (fdbm_initialize): accept optional 3rd argument to
+ specify an open flag.
+ (Init_dbm): define open flags: DBM::READER, DBM::WRITER, DBM::WRCREAT
+ and DBM::NEWDB.
+
+Sun May 16 13:10:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
+
+ * lib/test/unit/**/*.rb: Removed :nodoc: directives (many were
+ generating warnings, many were on private methods).
+
+Sat May 15 01:41:34 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (eval): forgot to restore $SAFE value before evaluating
+ compiled node. [ruby-core:02872]
+
+Sat May 15 01:33:12 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * range.c (range_each_func): terminates loop if generating value
+ is same to @end. [ruby-talk:100269]
+
+Fri May 14 22:08:38 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * string.c (rb_str_new4): should not reuse frozen shared string if
+ the original is not an instance of String. [ruby-talk:100193]
+
+Fri May 14 18:39:25 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tk/lib/tk/canvas.rb: improve coords support for canvas items.
+ Now, supports all of the followings.
+ TkcLine.new(c, 0, 0, 100, 100, :fill=>'red')
+ TkcLine.new(c, [0, 0, 100, 100], :fill=>'red')
+ TkcLine.new(c, [0, 0], [100, 100], :fill=>'red')
+ TkcLine.new(c, [[0, 0], [100, 100]], :fill=>'red')
+ TkcLine.new(c, :coords=>[0, 0, 100, 100], :fill=>'red')
+ TkcLine.new(c, :coords=>[[0, 0], [100, 100]], :fill=>'red')
+
+Fri May 14 12:11:43 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+
+ * util.c (ruby_strtod): strtod("0", &end); => end should point '\0'.
+ [ruby-dev:23498]
+
+Thu May 13 15:47:30 2004 akira yamada <akira@ruby-lang.org>
+
+ * lib/net/telnet.rb (Net::Telnet::login): "options" can specify
+ regexps for login prompt and/or password prompt.
+
+Thu May 13 14:23:45 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * hash.c (delete_if_i): use st_delete_safe() (via
+ rb_hash_delete()) instead of returning ST_DELETE.
+ backport from HEAD. [ruby-dev:23487]
+
+Thu May 13 13:01:30 2004 akira yamada <akira@ruby-lang.org>
+
+ * lib/uri/mailto.rb (URI::MailTo::to_s): should include fragment.
+
+Thu May 13 11:04:08 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * pack.c (pack_pack): always add with null for 'Z'.
+
+ * pack.c (pack_unpack): terminated by null for 'Z'. [ruby-talk:98281]
+
+Wed May 12 19:59:43 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * lib/mkmf.rb (have_type, check_sizeof): replace unusable characters.
+ [ruby-talk:99788]
+
+Wed May 12 17:41:42 2004 Tanaka Akira <akr@m17n.org>
+
+ * lib/resolv.rb (Resolv::DNS::Config): make it configurable without
+ external file such as /etc/resolv.conf.
+
+Wed May 12 14:37:27 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * ext/openssl/ossl_x509name.c: attribute value of DC (short name of
+ domainComponent) should be IA5String.
+
+Wed May 12 13:20:19 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tk/lib/tk/composite.rb: improve configure methods (based on
+ the proposal of [ruby-talk:99671]).
+
+Wed May 12 11:51:08 2004 Dave Thomas <dave@pragprog.com>
+
+ * class.c (rb_obj_singleton_methods): fix rdoc
+
+Mon May 10 21:44:42 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/generators/html_generator.rb: Change scheme for
+ looking up symbols in HTML generator.
+
+Mon May 10 16:45:21 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (eval): warning during eval should not cause deadlock.
+ [ruby-talk:98651]
+
+ * eval.c (rb_eval): raise TypeError exception for superclass
+ mismatch. [ruby-list:39567]
+
+Mon May 10 12:11:37 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/generators/html_generator.rb: Hack to search parents
+ for unqualified constant names.
+
+Mon May 10 12:11:37 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/generators/html_generator.rb: Hack to search parents
+ for unqualified constant names.
+
+Sun May 9 22:37:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
+
+ * lib/net/ftp.rb: improved documentation
+ * lib/net/imap.rb: ditto
+ * lib/net/pop.rb: ditto
+ * lib/net/smtp.rb: ditto
+ * lib/net/telnet.rb: ditto
+
+Fri May 7 21:50:21 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/parsers/parse_rb.rb (RDoc::parse_include): Allow
+ multiple arguments to 'include'
+
+Fri May 7 21:31:56 2004 Minero Aoki <aamine@loveruby.net>
+
+ * lib/fileutils.rb (fu_list): Array() breaks pathes including "\n".
+ [ruby-core:02843]
+
+Fri May 7 11:25:53 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+
+ * util.c (ruby_strtod): 0.0000000000000000001 == 0.0 should be false.
+ [ruby-talk:99318] [ruby-dev:23465]
+
+Fri May 7 10:00:05 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tk/tkutil.c (get_eval_string_core): bug fix. [ruby-dev:23466]
+
+Thu May 6 22:13:17 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+
+ * ext/socket/socket.c (ippaddr): use NUMERICHOST if can not resolve
+ hostname.
+
+Thu May 6 14:22:29 2004 why the lucky stiff <why@ruby-lang.org>
+
+ * lib/yaml/rubytypes.rb (to_yaml): added instance variable handling
+ for Ranges, Strings, Structs, Regexps.
+
+ * lib/yaml/rubytypes.rb (to_yaml_fold): new method for setting a
+ String's flow style.
+
+ * lib/yaml.rb (YAML::object_maker): now uses Object.allocate.
+
+ * ext/syck/gram.c: fixed transfer methods on structs, broke it
+ last commit.
+
+Thu May 6 11:40:28 2004 Shugo Maeda <shugo@ruby-lang.org>
+
+ * lib/net/imap.rb (string): accept NIL.
+
+ * lib/net/imap.rb (body_type_basic): allow body-fields omissions.
+
+Thu May 6 01:59:04 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/generators/html_generator.rb (Generators::HtmlMethod::params):
+ Don't include the &block parameter if we have explicit
+ yield parameters.
+
+Wed May 5 03:40:29 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+
+ * lib/rinda/ring.rb: use recv instead of recvfrom.
+
+Tue May 4 23:52:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
+
+ * lib/gserver.rb: documented
+
+Tue May 4 23:46:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
+
+ * lib/xmlrpc/README.txt: introduced for documentation purposes
+
+Mon May 3 09:47:24 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_method_or_yield_parameters):
+ Fix parsing bug if yield called within 1 line block
+
+Sun May 2 01:04:38 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tcltklib, ext/tk: renewal Ruby/Tk
+
+Fri Apr 30 20:08:41 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * time.c (SIZEOF_TIME_T): support SIZEOF_TIME_T == SIZEOF_INT.
+
+Tue Apr 27 13:12:42 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_eval): too many line trace call. (ruby-bugs PR#1320)
+
+Tue Apr 27 08:41:28 2004 why the lucky stiff <why@ruby-lang.org>
+
+ * lib/yaml/rubytypes.rb: passing Range tests.
+
+ * ext/syck/syck.h: version 0.44.
+
+ * ext/syck/gram.c: transfers no longer open an indentation.
+ fixed transfers which precede blocks.
+
+ * ext/syck/token.c: ditto.
+
+ * ext/syck/syck.c: fixed segfault if an anchor has been released already.
+
+ * ext/syck/node.c (syck_free_members): organized order of free'd nodes.
+
+ * ext/syck/rubyext.c (syck_emitter_write_m): test for proper string with
+ StringValue.
+
+Mon Apr 26 23:56:54 2004 Daniel Kelley <news-1082945587@dkelley.gmp.san-jose.ca.us>
+
+ * README.EXT, README.EXT.ja: fixed wrong function signature.
+ [ruby-talk:98349]
+
+Mon Apr 26 21:40:09 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/code_objects.rb (RDoc::Context::add_alias): Only alias
+ to instance methods.
+
+Sat Apr 24 10:38:31 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/markup/simple_markup.rb (SM::SimpleMarkup::group_lines):
+ Fix bug where consecutive headings are merged.
+
+Fri Apr 23 23:26:13 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * lib/mkmf.rb: $hdrdir should not contain macros for backward
+ compatibilitiy. [bruby-dev:28]
+
+ * version.c (ruby_show_copyright): obtain copyright year from
+ RUBY_RELEASE_YEAR.
+
+ * win32/resource.rb: ditto.
+
+ * win32/resource.rb: default rubyw icon to ruby.ico, and let DLL also
+ include them.
+
+ * win32/resource.rb: include winver.h for older WindowsCE.
+
+Fri Apr 23 16:38:46 2004 Tanaka Akira <akr@m17n.org>
+
+ * lib/pathname.rb: sync taint/freeze flag between
+ a pathname object and its internal string object.
+
+Fri Apr 23 14:52:08 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * parse.y (stmt, arg, aref_args): should not make sole splat into
+ array, in aref_args other than aref with op_asgn.
+
+Fri Apr 23 14:14:38 2004 Tanaka Akira <akr@m17n.org>
+
+ * lib/resolv.rb: don't use Regexp#source to embed regexps.
+ [ruby-dev:23432]
+
+Thu Apr 22 04:15:36 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * parse.y (aref_args): should pass expanded list. [ruby-core:02793]
+
+Thu Apr 22 01:12:57 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * numeric.c (flo_to_s): tweak output string based to preserve
+ decimal point and to remove trailing zeros. [ruby-talk:97891]
+
+ * string.c (rb_str_index_m): use unsigned comparison for T_FIXNUM
+ search. [ruby-talk:97342]
+
+Wed Apr 21 22:57:27 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+
+ * lib/rinda/rinda.rb, test/rinda/test_rinda.rb: check Hash tuple size.
+
+Wed Apr 21 20:05:00 2004 Tanaka Akira <akr@m17n.org>
+
+ * lib/open-uri.rb (URI::HTTP#proxy_open): set Host: field explicitly.
+ [ruby-list:39542]
+
+Mon Apr 19 18:11:15 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * hash.c (rb_hash_equal): returns true if two hashes have same set
+ of key-value set. [ruby-talk:97559]
+
+ * hash.c (rb_hash_eql): returns true if two hashes are equal and
+ have same default values.
+
+Mon Apr 19 08:19:58 2004 Doug Kearns <djkea2@mugca.its.monash.edu.au>
+
+ * dln.c, io.c, lib/benchmark.rb, lib/cgi.rb, lib/csv.rb, lib/date.rb,
+ lib/ftools.rb, lib/getoptlong.rb, lib/logger.rb, lib/matrix.rb,
+ lib/monitor.rb, lib/set.rb, lib/thwait.rb, lib/timeout.rb,
+ lib/yaml.rb, lib/drb/drb.rb, lib/irb/workspace.rb, lib/net/ftp.rb,
+ lib/net/http.rb, lib/net/imap.rb, lib/net/telnet.rb,
+ lib/racc/parser.rb, lib/rinda/rinda.rb, lib/rinda/tuplespace.rb,
+ lib/shell/command-processor.rb, lib/soap/rpc/soaplet.rb,
+ lib/test/unit/testcase.rb, lib/test/unit/testsuite.rb: typo fix.
+
+Mon Apr 19 08:14:18 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::find_body): Allow for
+ #ifdef HAVE_PROTOTYPES
+
+Fri Apr 16 22:33:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
+
+ * ext/iconv/iconv.c: nearly finished RDoc comments.
+
+Fri Apr 16 17:04:07 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * string.c (rb_str_equal): always returns true or false, never
+ returns nil. [ruby-dev:23404]
+
+Fri Apr 16 08:27:02 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/extmk.rb: skip linking when libraries to be preloaded not
+ compiled. [ruby-list:39561]
+
+Thu Apr 15 23:21:52 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * process.c (pst_success_p): new method Process::Status#success?.
+ [ruby-dev:23385]
+
+Thu Apr 15 17:12:13 2004 Tanaka Akira <akr@m17n.org>
+
+ * ext/gdbm/gdbm.c (Init_gdbm): define GDBM::READER, GDBM::WRITER,
+ GDBM::WRCREAT and GDBM::NEWDB.
+ (fgdbm_initialize): use specified read/write flag.
+
+Wed Apr 14 11:29:56 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * numeric.c (flo_eq): workaround for bcc32's bug.
+ (ruby-bugs-ja:PR#594)
+
+Wed Apr 14 13:06:35 2004 Doug Kearns <djkea2@mugca.its.monash.edu.au>
+
+ * array.c, enum.c, eval.c, file.c, io.c, numeric.c, object.c, prec.c,
+ process.c, re.c, string.c: typos in RDoc comments. [ruby-core:02783]
+
+Wed Apr 14 11:03:22 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+
+ * defines.h: include <net/socket.h> to get fd_set definition in BeOS.
+
+Tue Apr 13 23:06:30 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+
+ * lib/rinda/rinda.rb: change pattern matching.
+ a === b -> a == b || a === b. [druby-ja:98]
+
+ * test/rinda/test_rinda.rb: ditto.
+
+Tue Apr 13 19:54:29 2004 Minero Aoki <aamine@loveruby.net>
+
+ * lib/net/http.rb: should not overwrite HTTP request header.
+ [ruby-list:39543]
+
+Tue Apr 13 01:30:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
+
+ * ext/iconv/iconv.c: RDoc documentation (from RD; nearly finished).
+ * ext/iconv/charset_alias.rb: Prevent from RDoc'ing.
+
+Mon Apr 12 19:11:29 2004 Eric Hodel <drbrain@segment7.net>
+
+Wed Apr 14 11:06:38 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::scan): Changed
+ behavior of :enddoc: -- it now unconditionally terminates
+ processing of the current file.
+
+ * gc.c (rb_gc_copy_finalizer): typo. [ruby-core:02774]
+
+Mon Apr 12 18:52:32 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * ext/openssl/ossl_x509name.c (ossl_x509name_init_i): should return
+ a value.
+
+Mon Apr 12 10:43:47 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+
+ * dir.c (rb_glob2, rb_glob, rb_globi, push_globs, push_braces,
+ rb_push_glob):
+ fix memory leak to occur when block is interrupted in Dir.glob.
+
+Mon Apr 12 10:27:37 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+
+ * bcc32/Makefile.sub: backport SIZEOF_TIME_T definition from 1.9.
+
+ * win32/Makefile.sub: ditto.
+
+ * wince/Makefile.sub: ditto.
+
+Sun Apr 11 19:12:35 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ruby.c (require_libraries): restore source file/line after
+ statically linked extensions initialized. [ruby-dev:23357]
+
+Sun Apr 11 10:47:04 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/code_objects.rb (RDoc::TopLevel::add_class_or_module): Toplevel
+ classes and modules are a special case too... (handle extending existing
+ classes with or without :enddoc:)
+
+Sat Apr 10 23:51:13 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/code_objects.rb (RDoc::Context::add_to): Implementation of :enddoc:
+ made one too many assumptions...
+
+Sat Apr 10 00:00:19 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/markup/simple_markup/inline.rb: Fix problem
+ with \_cat_<b>dog</b>
+
+Wed Apr 7 00:19:50 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+
+ * lib/rinda/rinda.rb: fix hash tuple bug.
+
+ * lib/rinda/tuplespace.rb: ditto.
+
+ * test/rinda/test_rinda.rb
+
+Tue Apr 6 18:24:18 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * io.c (rb_io_reopen): should use rb_io_check_io().
+
+Tue Apr 6 16:46:09 2004 Tanaka Akira <akr@m17n.org>
+
+ * configure.in: check the size of time_t.
+
+ * time.c (time_add): new function.
+ (time_plus): use time_add.
+ (time_minus): use time_add.
+
+Tue Apr 6 13:21:30 2004 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * ext/socket/socket.c (make_hostent): must return value.
+
+Tue Apr 6 00:05:30 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+
+ * lib/rinda/rinda.rb: add require 'drb/drb'
+
+Mon Apr 5 08:18:23 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/rdoc.rb: Remove leading ./ from file names so that cross
+ references work properly.
+
+Sun Apr 4 20:33:42 2004 Minero Aoki <aamine@loveruby.net>
+
+ * eval.c (Init_load): make $LOADED_FEATURES built-in.
+ [ruby-dev:23299]
+
+ * ruby.c (ruby_prog_init): make $PROGRAM_NAME built-in.
+
+ * lib/English.rb: remove $LOADED_FEATURES and $PROGRAM_NAME.
+
+Sun Apr 4 14:01:20 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/options.rb (Options::parse): Allow multiple -x options to RDoc.
+ Fix bug where files weren't being excluded properly
+
+Sat Apr 3 17:11:05 2004 why the lucky stiff <why@ruby-lang.org>
+
+ * ext/syck/syck.h: version 0.43.
+
+ * ext/syck/lib/gram.c: allow root-level inline collections.
+ [ruby-talk:94922]
+
+ * lib/yaml/rubytypes.rb (Symbol#to_yaml): emit symbols as implicits.
+ [ruby-talk:94930]
+
+ * ext/syck/bytecode.c: turn off default implicit typing.
+
+ * ext/syck/implicit.c: detect base60 integers.
+
+ * ext/syck/rubyext.c: handle base60, as well as hex and octal
+ with commas. implicit typing of ruby symbols.
+
+Fri Apr 2 17:27:17 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (top_include): include in the wrapped load is done for
+ the wrapper, not for a singleton class for wrapped main.
+ [ruby-dev:23305]
+
+Fri Apr 2 15:13:44 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * bignum.c (rb_big_eq): use temporary double variable to save the
+ result (internal float register may be bigger than 64 bits, for
+ example, 80 bits on x86). [ruby-dev:23311]
+
+Fri Apr 2 14:35:26 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (block_pass): should generate unique identifier of the
+ pushing block. [ruby-talk:96363]
+
+Fri Apr 2 07:31:38 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * ext/socket/socket.c (make_hostent): fix memory leak, based on
+ the patch from HORIKAWA Hisashi <vzw00011@nifty.ne.jp>.
+
+Thu Apr 1 19:58:37 2004 NAKAMURA, Hiroshi <nakahiro@sarion.co.jp>
+
+ * lib/soap/mapping/{factory.rb,registry.rb}: fixed illegal mapped URI
+ object with soap/marshal.
+ added URIFactory class for URI mapping. BasetypeFactory checks
+
+Thu Apr 1 22:55:33 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/parsers/parse_rb.rb: Allow rdoc comments in
+ =begin rdoc/=end
+
+ * lib/rdoc/parsers/parse_rb.rb: Fix problem with comment in
+ top-level method being taken as file comment.
+
+Thu Apr 1 22:55:04 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/ri/ri_options.rb: Fix undefined variable warning.
+
+ instance_variables when original mapping is not allowed (ivar must
+ be empty). Instance of URI have instance_variables but it must be
+ llowed whenever original mapping is allowed or not.
+
+ * lib/xsd/datatypes.rb: check the smallest positive non-zero
+ single-precision float exactly instead of packing with "f".
+ [ruby-talk:88822]
+
+ * lib/soap/mapping/rubytypeFactory.rb: should not dump singleton class.
+ [ruby-dev:22588]
+ c = class << Object.new; class C; self; end; end; SOAPMarshal.dump(c)
+
+Wed Mar 31 19:06:23 2004 Tanaka Akira <akr@m17n.org>
+
+ * time.c (year_leap_p): new function.
+ (timegm_noleapsecond): ditto.
+ (search_time_t): use timegm_noleapsecond instead of
+ mktime for first guess.
+
+Wed Mar 31 12:04:04 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * lib/delegate.rb (DelegateClass): define internal methods of the
+ result class, but not metaclass of the caller. [ruby-talk:96156]
+
+ * intern.h: provide proper prototypes. [ruby-core:02724]
+
+ * ruby.h: missing.h is now prerequisite to intern.h.
+
+Tue Mar 30 20:25:34 2004 Tanaka Akira <akr@m17n.org>
+
+ * time.c (search_time_t): limit guess range by mktime if it is
+ available. [ruby-dev:23274]
+
+Sun Mar 28 14:16:59 2004 Minero Aoki <aamine@loveruby.net>
+
+ * lib/net/pop.rb (auth): failed when account/password include "%".
+ [ruby-talk:95933]
+
+Sat Mar 27 21:40:41 2004 Tanaka Akira <akr@m17n.org>
+
+ * lib/open-uri.rb: permit extra semicolon in content-type field.
+
+Sat Mar 27 10:40:48 2004 Tanaka Akira <akr@m17n.org>
+
+ * (lib/pp.rb, lib/prettyprint.rb): define seplist in PP::PPMethods
+ instead of PrettyPrint.
+
+Thu Mar 25 23:28:52 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * time.c (time_overflow_p): backport 1.9 usec overflow function.
+ (ruby-bugs PR#1307)
+
+Thu Mar 25 23:15:24 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/ri/ri_options.rb (RI::Options::show_version):
+ Add --version option
+
+Thu Mar 25 04:16:18 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/ri/ri_options.rb (RI::Options): Add the --list-names option,
+ which dumps our all known names
+
+Thu Mar 25 03:57:47 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/ri/ri_util.rb (NameDescriptor::initialize): No longer
+ allow nested classes to be designated using "."--you must
+ now use "::"
+
+Thu Mar 25 02:00:18 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/generators/template/html/one_page_html.rb (Page):
+ Fix to work with C modules.
+
+Wed Mar 24 21:17:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
+
+ * lib/uri.rb: Documented (thanks Dmitry V. Sabanin).
+ * lib/uri/common.rb: Ditto.
+ * lib/uri/ftp.rb: Ditto.
+ * lib/uri/generic.rb: Ditto.
+ * lib/uri/http.rb: Ditto.
+ * lib/uri/https.rb: Ditto.
+ * lib/uri/ldap.rb: Ditto.
+ * lib/uri/mailto.rb: Ditto.
+ (All backported from 1.9)
+
+Wed Mar 24 18:48:26 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * lib/mkmf.rb ($ruby, $topdir, $hdrdir): should not be affected by
+ DESTDIR after installed.
+
+ * lib/mkmf.rb (RUBY): / is not recognized as path separator on
+ nmake/bmake. [ruby-list:39388]
+
+ * lib/mkmf.rb (init_mkmf): $INCFLAGS also should be lazy-evaluated.
+
+Wed Mar 24 12:32:56 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::handle_class_module):
+ Don't document methods if we don't know for sure the
+ class or module.
+
+ * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_class):
+ Don't store documentation for singleton classes if we
+ don't know the real class.
+
+Wed Mar 24 11:11:26 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/generators/html_generator.rb (Generators::HTMLGenerator::load_html_template):
+ Allow non-RDoc templates by putting a slash in the template name
+
+Mon Mar 22 16:19:57 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * ruby.1: add -width option to .Bl for old groff.
+
+Sun Mar 21 21:11:16 2004 Keiju Ishitsuka <keiju@ishitsuka.com>
+
+ * lib/shell/*: bug fix for Shell#system(command_line_string).
+
+Sat Mar 20 20:57:10 2004 David Black <dblack@wobblini.net>
+
+ * lib/scanf.rb: Backported 1.9 branch
+ modifications/corrections to 1.8 branch
+
+Sat Mar 20 23:51:03 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * eval.c (rb_require_safe): preserve old ruby_errinfo.
+ [ruby-talk:95409]
+
+ * eval.c (rb_f_raise): should not clear backtrace information if
+ exception object already have one.
+
+Sat Mar 20 15:25:36 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/generators/template/html/html.rb (RDoc::Page): Force
+ page background to white.
+
+Sat Mar 20 09:52:33 2004 Tadayoshi Funaba <tadf@dotrb.org>
+
+ * lib/date.rb, lib/date/format.rb: _parse() now accepts fractional
+ part of second minute that follows a comma or a full stop.
+
+Fri Mar 19 01:55:57 2004 Mauricio Fernandez <batsman.geo@yahoo.com>
+
+ * io.c (rb_io_sync): need not to check writable. [ruby-core:02674]
+
+Thu Mar 18 21:44:38 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+
+ * lib/drb/drb.rb: backport drb.rb 1.16.
+
+Thu Mar 18 16:22:38 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (proc_eq): avoid false positive by using scope and
+ dyna_vars. no longer use frame.uniq.
+
+Wed Mar 17 14:44:43 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+
+ * dir.c (range): fix possible "\0" overrun. (in case of "\0-")
+
+Mon Mar 15 07:39:13 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_yield_0): should not re-submit TAG_BREAK if this
+ yield is not break destination. [ruby-dev:23197]
+
+Sat Mar 13 14:28:16 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+
+ * test/drb/test_drbssl.rb: rescue LoadError. (Barkport from main
+ trunk)
+
+ * test/drb/test_drbunix.rb: ditto.
+
+Wed Mar 10 22:28:09 2004 Minero Aoki <aamine@loveruby.net>
+
+ * lib/fileutils.rb (remove_dir): should handle symlink correctly.
+ This patch is contributed by Christian Loew. [ruby-talk:94635]
+ (Backport from main trunk)
+
+Wed Mar 10 16:28:42 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (return_jump): set return value to the return
+ destination. separated from localjump_destination().
+
+ * eval.c (break_jump): break innermost loop (or thread or proc).
+
+ * eval.c (rb_yield_0): set exit_value for block break.
+
+Wed Mar 10 15:58:43 2004 Ryan Davis <ryand@zenspider.com>
+
+ * eval.c (eval): Only print backtrace if generating the backtrace
+ doesn't generate an exception. [ruby-core:02621]
+
+Tue Mar 9 13:04:26 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * io.c (rb_io_ungetc): raise IOError instead of calling
+ rb_sys_fail(). [ruby-talk:23181]
+
+Mon Mar 8 19:32:28 2004 akira yamada <akira@ruby-lang.org>
+
+ * lib/uri/common.rb (URI::REGEXP::PATTERN::HOSTPORT): (?:#{PORT})
+ -> (?::#{PORT}). [ruby-dev:23170]
+
+Mon Mar 8 15:31:41 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+
+ * dir.c (range): treat incomplete '[' as ordinary character (like
+ has_magic does).
+
+ * dir.c (range): Cancel above change. More discussion is needed.
+
+Sun Mar 7 22:37:46 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+
+ * test/drb/ut_drb.rb: use 'druby://localhost:0'. [ruby-dev:23078]
+
+ * test/drb/ut_eval.rb: ditto.
+
+ * test/drb/ut_large.rb: ditto.
+
+ * test/drb/ut_safe1.rb: ditto.
+
+ * test/drb/ut_drb_drbssl.rb: use 'drbssl://localhost:0'.
+
+Sun Mar 7 16:22:26 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * Makefile.in (lex.c): use $? instead of $<.
+
+Fri Mar 5 00:54:14 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/test/unit.rb: MOve RDoc documentation so that you can
+ now say 'ri Test::Unit'
+
+Tue Mar 2 12:32:59 2004 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * win32/Makefile.sub, wince/Makefile.sub (config.h): shouldn't check
+ defined? NORETURN. [ruby-dev:23100]
+
+Mon Mar 1 12:24:10 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_alias):
+ Allow aliases to have parentheses
+
+Sun Feb 29 23:14:53 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_class):
+ Handle :nodoc: on singleton classes.
+
+Sat Feb 28 10:58:49 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+
+ * MANIFEST: add test_erb.rb
+
+ * lib/erb.rb, test/erb/test_erb.rb: don't forget filename,
+ if both filename and safe_level given. [ruby-dev:23050]
+
+Fri Feb 27 01:00:09 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+
+ * lib/drb/drb.rb, test/drb/drbtest.rb: require drb/eq.rb by default
+
+Wed Feb 25 21:16:25 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * instruby.rb (with_destdir): should return the given argument if no
+ DESTDIR is given.
+
+ * instruby.rb: use path name expansion of cmd.exe.
+
+Wed Feb 25 09:35:22 2004 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * error.c (NameError::Message): new class for lazy evaluation of
+ message to ensure replaced before marshalling. merge from HEAD.
+ (ruby-bugs-ja:PR#588)
+
+ * eval.c (rb_method_missing): use NameError::Message. merge from
+ HEAD. (ruby-bugs-ja:PR#588)
+
+Tue Feb 24 18:59:37 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+
+ * dir.c (glob_helper): '**/' should not match leading period
+ unless File::FNM_DOTMATCH is set. (like '*/') [ruby-dev:23014]
+
+Tue Feb 24 13:22:21 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/rdoc.rb (RDoc::RDoc::normalized_file_list): Attempt to get better
+ heuristics on which files to include and exclude. Now only include
+ non-standard files if they are explicitly named in ARGV.
+
+Tue Feb 24 07:23:30 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/generators/html_generator.rb: Deal with :stopdoc: when
+ choosing a default main page to display (ie. don't select a page
+ if we don't have documentation for it).
+
+Tue Feb 24 06:40:14 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/parsers/parse_rb.rb (RubyLex::identify_identifier): Handle
+ class variables in code listings
+
+Tue Feb 24 06:40:14 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/parsers/parse_rb.rb (RubyLex::identify_identifier): Handle
+ class variables in code listings
+
+Tue Feb 24 06:32:27 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::do_aliases): Handle
+ aliases in C files.
+
+Tue Feb 24 06:16:22 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/rdoc.rb (RDoc::RDoc::document): Now create op dir _before_
+ parsing files.
+
+Tue Feb 24 06:08:47 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_constant):
+ Start collecting text of constant values earlier: was missing
+ values in output if there was no space after '='
+
+Tue Feb 24 06:08:25 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/generators/html_generator.rb: Escape contant values.
+
+Tue Feb 24 03:45:06 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * ext/openssl/ossl_config.c (ossl_config_each): add new method
+ OpenSSL::Config#each. it iterates with section name, field name
+ and value.
+
+ * ext/openssl/ossl_config.c (Init_ossl_config): include Enumerable.
+
+Mon Feb 23 09:16:35 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * instruby.rb (DOSISH): embedded path in batch files should not be
+ prefixed by DESTDIR. [ruby-core:02186]
+
+Sat Feb 22 09:54:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
+
+ * re.c: corrected documentation format (again)
+
+Sat Feb 22 09:43:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
+
+ * re.c: corrected documentation format (rb_reg_initialize_m)
+
+Sat Feb 21 22:36:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
+
+ * ext/zlib/zlib.c: documented, but needs more effort.
+
+Sat Feb 21 11:12:15 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * missing/os2.c, missing/x68.c: typo fix. pointed out by greentea.
+
+Fri Feb 20 18:59:47 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * lib/irb/init.rb (IRB::IRB.parse_opts): add -I option to
+ irb. [ruby-dev:39243]
+
+Thu Feb 19 23:24:16 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/generators/html_generator.rb (Generators::HtmlClass::build_attribute_list):
+ Support visibility modifiers for attributes
+
+Thu Feb 19 23:24:16 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/generators/html_generator.rb (Generators::HtmlClass::build_attribute_list):
+ Support visibility modifiers for attributes
+
+Thu Feb 19 22:39:04 2004 NAKAMURA, Hiroshi <nakahiro@sarion.co.jp>
+
+ * test/rinda/test_rinda.rb: DRb.start_service only once in testsuites.
+ DRb.start_service could handle this.
+
+Thu Feb 19 22:19:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
+
+ * lib/ostruct.rb: documented
+
+Thu Feb 19 21:28:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
+
+ * ext/strscan/strscan.c: improved documentation
+
+Thu Feb 19 03:10:52 2004 Minero Aoki <aamine@loveruby.net>
+
+ * ext/strscan/strscan.c: synchronized with main trunk (rev 1.11).
+
+Thu Feb 19 02:30:34 2004 Minero Aoki <aamine@loveruby.net>
+
+ * ext/strscan/strscan.c: documentation checked.
+
+Thu Feb 19 00:11:05 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/markup/simple_markup/preprocess.rb (SM::PreProcess::handle):
+ Strip extraneous space from filenames in :include:
+
+Wed Feb 18 22:52:00 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+
+ * lib/drb/unix.rb: remove O_NONBLOCK, thanks \ay
+
+Wed Feb 18 22:47:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
+
+ * ext/strscan/strscan.c: documented
+
+Wed Feb 18 22:03:11 2004 NAKAMURA, Hiroshi <nakahiro@sarion.co.jp>
+
+ * test/*: should not depend on $KCODE.
+
+Wed Feb 18 17:18:01 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * ext/win32ole/win32ole.c: need to include <olectl.h> on Cygwin.
+
+Wed Feb 18 10:40:38 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * sprintf.c (rb_f_sprintf): do not prepend dots for negative
+ numbers if FZERO is specified. [ruby-dev:39218]
+
+Tue Feb 17 23:40:34 2004 Guy Decoux <ts@moulon.inra.fr>
+
+ * sprintf.c (rb_f_sprintf): preserve original val for
+ format_integer. [ruby-talk:92975]
+
+Tue Feb 17 23:28:45 2004 NAKAMURA, Hiroshi <nakahiro@sarion.co.jp>
+
+ * test/ruby/marshaltestlib.rb: common marshal testcase added.
+
+ * test/ruby/test_marshal.rb: use above testsuite.
+
+ * test/soap/marshal/test_marshal.rb: ditto.
+
+ * test/soap/marshal/cmarshal.rb: removed (not used).
+
+Tue Feb 17 10:51:23 2004 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * ext/syck/rubyext.c (syck_emitter_end_object): takes only one arg.
+
+Tue Feb 17 01:35:28 2004 Tanaka Akira <akr@m17n.org>
+
+ * eval.c (rb_eval): care that another thread replace NODE_DREGX_ONCE
+ to NODE_LIT. [ruby-dev:22920]
+
+Tue Feb 17 01:24:35 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+
+ * bcc32/Makefile.sub: backport from 1.9 - configure. (Thanks Nakada)
+ [ruby-dev:22910]
+
+ * win32/Makefile.sub: ditto.
+
+ * wince/Makefile.sub: ditto.
+
+Tue Feb 17 00:38:10 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+
+ * lib/rinda/tuplespace.rb: TupleSpace#initialize, stop doubling timeout
+
+Tue Feb 17 00:18:03 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+
+ * test/rinda/test_rinda.rb: import test_rinda.rb
+
+Tue Feb 17 00:14:30 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+
+ * bcc32/Makefile.sub: avoid warning "Redefinition of macro
+ 'HAVE_GETLOGIN'".
+
+ * vms/config.h_in: ditto.
+
+Mon Feb 16 23:28:14 2004 NAKAMURA, Hiroshi <nakahiro@sarion.co.jp>
+
+ * lib/csv.rb: document reduction. [ruby-core:02429]
+
+Mon Feb 16 22:08:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
+
+ * lib/generator.rb: corrected doc format
+ * lib/rinda/rinda.rb: added documentation (from Hugh Sasse)
+ * lib/rinda/tuplespace.rb: ditto
+
+Mon Feb 16 20:41:32 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+
+ * bcc32/Makefile.sub: show more warnings. (refering to mingw)
+
+ * bcc32/setup.mak: ditto.
+
+Mon Feb 16 13:39:44 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+
+ * dir.c (rb_glob, rb_globi): add const.
+
+ * ruby.h: ditto.
+
+Mon Feb 16 02:16:33 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+
+ * bcc32/Makefile.sub: should warn suspicious pointer conversion.
+
+ * bcc32/setup.mak: ditto.
+
+Sun Feb 15 19:06:42 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+
+ * lib/rinda/tuplespace.rb: TupleSpace#read(tpl, 0), raise
+ RequestExpiredError if not found.
+
+Sun Feb 15 15:56:46 2004 Masaki Suketa <masaki.suketa@nifty.ne.jp>
+
+ * ext/win32ole/win32ole.c: add IDispatch wrapper in val2variant.
+ Thanks, arton.
+
+Sun Feb 15 01:46:05 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * lib/mkmf.rb: absolute path of ruby is assigned to $(RUBY).
+ [ruby-dev:22870]
+
+Sat Feb 14 11:29:41 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+
+ * sample/drb/*: import lib/drb/sample
+
+Sat Feb 14 11:08:23 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+
+ * lib/drb/drb.rb: add pretty_print, thanks gotoken.
+
+Fri Feb 13 12:35:08 2004 Minero Aoki <aamine@loveruby.net>
+
+ * test/fileutils/test_fileutils.rb: File.link may raise EINVAL and
+ EACCES on Windows.
+
+Thu Feb 12 21:45:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
+
+ * lib/ftools.rb: documented
+
+Thu Feb 12 21:25:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
+
+ * lib/base64.rb: backported from HEAD (modularised and documented)
+
+Thu Feb 12 20:31:48 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * lib/mkmf.rb (create_tmpsrc): cpp32 of Borland C++ ignores #error
+ directives in DOS line-ending files at all.
+
+Thu Feb 12 02:23:56 2004 Tanaka Akira <akr@m17n.org>
+
+ * lib/pathname.rb: use assert_raise instead of assert_raises.
+
+ * lib/pp.rb: ditto.
+
+ * lib/time.rb: ditto.
+
+ * lib/tsort.rb: ditto.
+ use TSortHash and TSortArray instead of Hash and Array in test.
+
+Wed Feb 11 20:01:12 2004 akira yamada <akira@ruby-lang.org>
+
+ * test/ruby/test_file.rb (TestFile::test_fnmatch): added tests for
+ File.fnmatch. [ruby-dev:22815][ruby-dev:22819]
+
+ * test/ruby/test_proc.rb (TestProc::test_eq): added a
+ test. [ruby-dev:22599]
+
+ * test/ruby/test_proc.rb (TestProc::test_eq): added tests for
+ Proc#==. [ruby-dev:22592], [ruby-dev:22601]
+
+Tue Feb 10 16:43:56 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (umethod_bind): purge unused check. [ruby-dev:22850]
+
+Mon Feb 9 17:16:00 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * lib/rdoc/parsers/parse_c.rb: escape '{' and '}' to avoid warnings.
+
+Mon Feb 9 13:00:55 2004 Hirokazu Yamamoto <ocean@m2.ccsnet.ne.jp>
+
+ * dir.c (fnmatch):
+ File.fnmatch('*?', 'a') should return true. [ruby-dev:22815]
+ File.fnmatch('\[1\]' , '[1]') should return true. [ruby-dev:22819]
+
+Sun Feb 8 16:46:13 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * lib/pp.rb (PP::PPMethods::object_address_group): suppress negative
+ sign for higher heap areas.
+
+Fri Feb 6 22:48:16 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/generators/html_generator.rb (gen_url): Support
+ https in RDoc hyperlinks
+
+Fri Feb 6 22:41:22 2004 NAKAMURA, Hiroshi <nakahiro@sarion.co.jp>
+
+ * lib/pp.rb (PPInspectTest#test_to_s_with_iv): rollback the previous
+ commit. [ruby-dev:22813]
+
+Fri Feb 6 22:22:50 2004 NAKAMURA, Hiroshi <nakahiro@sarion.co.jp>
+
+ * lib/pp.rb (PPInspectTest#test_to_s_with_iv): remove instance
+ variable which is defined in the test.
+
+Fri Feb 6 00:48:37 2004 Tanaka Akira <akr@m17n.org>
+
+ * lib/prettyprint.rb (PrettyPrint#first?): obsoleted.
+
+Thu Feb 5 23:56:55 2004 Tanaka Akira <akr@m17n.org>
+
+ * lib/prettyprint.rb (PrettyPrint#seplist): added.
+
+ * lib/pp.rb (PPMethods#pp_object): use seplist.
+ (PPMethods#pp_hash): ditto.
+ (Array#pretty_print): ditto.
+ (Struct#pretty_print): ditto.
+ (MatchData#pretty_print): ditto.
+
+ * lib/set.rb (Set#pretty_print): use seplist.
+
+Wed Feb 4 02:12:06 2004 Tanaka Akira <akr@m17n.org>
+
+ * file.c (test_l): fix wrong method name in document.
+ (test_S): ditto.
+ (test_b): ditto.
+ (test_c): ditto.
+ (test_suid): ditto.
+ (test_sgid): ditto.
+ (test_sticky): ditto.
+
+Tue Feb 3 08:04:57 2004 Tanaka Akira <akr@m17n.org>
+
+ * lib/pp.rb (Struct#pretty_print_cycle): follow 1.8 style.
+
+Mon Feb 2 19:33:49 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * configure.in: backport from 1.9 for Interix.
+
+ * dln.c (dln_load): ditto.
+
+Mon Feb 2 13:31:51 2004 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * lib/net/http.rb (canonical_each): fix merge miss.
+
+Mon Feb 2 01:54:00 2004 Tanaka Akira <akr@m17n.org>
+
+ * lib/pp.rb (Struct#pretty_print): make it 1.8 style.
+ (Numeric#pretty_print, FalseClass#pretty_print)
+ (TrueClass#pretty_print, Module#pretty_print): fix pp for objects
+ with instance variables. [ruby-talk:91157]
+
+ * lib/open-uri.rb (URI::Generic#find_proxy): return nil on loopback
+ address.
+
+ * lib/resolv-replace.rb (BasicSocket#send): don't replace because
+ it has no hostname argument.
+ (IPSocket.getaddress): raise SocketError instead of
+ Resolv::ResolvError for errors.
+ (TCPSocket#initialize, UDPSocket#bind, UDPSocket#connect)
+ (SOCKSSocket#initialize): use IPSocket.getaddress instead of
+ Resolv.getaddress.
+ (UDPSocket#send): recognize 3 arguments form. try all addresses on
+ 4 arguments form.
+
+Sun Feb 1 18:17:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
+
+ * lib/net/http.rb: merged coding style changes from HEAD.
+
+Sun Feb 1 16:15:00 2004 Gavin Sinclair <gsinclair@soyabean.com.au>
+
+ * lib/test/unit.rb: rearranged documentation for RDoc's sake.
+ * lib/matrix.rb: improved documentation.
+ * lib/net/http.rb: slight documentation formatting improvement.
+
+Sun Feb 1 05:30:06 2004 Tanaka Akira <akr@m17n.org>
+
+ * lib/open-uri.rb (URI::Generic#find_proxy): warn HTTP_PROXY.
+ raise an errror on non-http proxy URI.
+ (OpenURI::Buffer#<<): make a tempfile binmode. [ruby-talk:90793]
+
+Sat Jan 31 09:20:32 2004 NAKAMURA, Hiroshi <nakahiro@sairon.co.jp>
+
+ * sample/openssl/gen_csr.rb: wrong usage string.
+
+Sat Jan 31 01:00:32 2004 NAKAMURA, Hiroshi <nakahiro@sarion.co.jp>
+
+ * lib/soap/wsdlDriver.rb, lib/wsdl/soap/operation.rb: add support of
+ "parts" attribute of soap:body element in WSDL.
+
+ * lib/wsdl/xmlSchema/schema.rb: friendly warning message for
+ simpleType element which is not supported for now.
+
+ * lib/soap/mapping/factory.rb: deleted unused methods.
+
+ * lib/soap/mapping/rubytypeFactory.rb: do no ignore case while xsi:type
+ string <-> Ruby class name matching.
+
+ * test/wsdl/soap/{soapbodyparts.wsdl,test_soapbodyparts.wsdl}: new
+ files.
+
+Thu Jan 29 23:56:00 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * util.c (mblen): fix overrun. [ruby-dev:22672]
+
+Thu Jan 29 22:41:53 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/generators/html_generator.rb: Allow 'link:' in Tidylinks.
+ THis means you can write "see f1[link:files/f1_rb.html]".
+
+Thu Jan 29 15:33:23 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * ext/openssl/ossl_x509hame.c (ossl_x509name_initialize): change
+ second argument. it expected to be a Hash not an Integer.
+
+ * ext/openssl/ossl_x509name.c (ossl_x509name_add_entry): add new
+ function for OpenSSL::X509::Name#add_entry.
+
+ * ext/openssl/ossl_x509name.c (ossl_x509name_to_a): append ASN.1
+ tag number to each element of return value.
+
+ * ext/openssl/ossl_x509name.c (Init_ossl_x509name): add constants
+ OpenSSL::X509::Name::DEFAULT_OBJECT_TYPE and OBJECT_TYPE_TEMPLATE.
+
+ * ext/openssl/lib/openssl/x509.rb (OpenSSL::X509::Name#initialize):
+ second argument takes OBJECT_TYPE_TEMPLATE by default.
+
+ * sample/openssl/gen_csr.rb: use OpenSSL::X509::Name.parse.
+
+Wed Jan 28 04:29:41 2004 Eric Schwartz <emschwar@fc.hp.com>
+
+ * lib/cgi/session.rb: use LOCK_SH to read, and a few other
+ improvements. [ruby-core:02328]
+
+Tue Jan 27 11:09:29 2004 FUKUMOTO Atsushi <fukumoto@nospam.imasy.or.jp>
+
+ * ext/socket/socket.c (s_recvfrom): sending length should be an
+ invariant while retrying on EAGAIN. [ruby-talk:89962]
+
+Tue Jan 27 10:35:18 2004 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * ext/win32ole/win32ole.c (set_argv): fix condition.
+
+Tue Jan 27 02:26:31 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * lib/webrick/httputils.rb (WEBrick:HTTPUtils::parse_header):
+ refine regex for header-name.
+
+Tue Jan 27 00:30:11 2004 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * win32/Makefile.sub: rollback.
+
+Mon Jan 26 22:53:04 2004 Dave Thomas <dave@pragprog.com>
+
+ * io.c: Remove documentation references to $defout.
+
+Mon Jan 26 15:11:47 2004 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * sample/exyacc.rb: escape '}' to avoid warning.
+
+Mon Jan 26 14:41:46 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * lib/delegate.rb (Delegator::initialize): preserve
+ singleton_method_added method [ruby-dev:22685]
+
+ * lib/delegate.rb (Delegator::initialize): use Kernel::raise
+ instead of mere raise. [ruby-dev:22681]
+
+Mon Jan 26 12:47:17 2004 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tcltklib/tcltklib.c: define CONST84 when TCL_MAJOR_VERSION == 7
+
+Mon Jan 26 11:35:23 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/extmk.rb: Makefiles should depend on also rbconfig.rb.
+ (ruby-bugs:PR#1256)
+
+ * ext/win32ole/win32ole.c (set_argv): set real arguments to
+ WIN32OLE::ARGV. [ruby-list:39073]
+
+Thu Jan 22 22:54:53 2004 Shugo Maeda <shugo@ruby-lang.org>
+
+ * lib/net/imap.rb (BEG_REGEXP): allow 8-bit characters in quoted
+ strings for Novell GroupWise Internet Agent.
+ * lib/net/imap.rb (DATA_REGEXP): ditto.
+
+Thu Jan 22 16:21:33 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * parse.y (string_content): reset lexical states at the beginning of
+ string contents. [ruby-list:39061]
+
+Wed Jan 21 21:55:51 2004 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+
+ * lib/drb/drb.rb: remove O_NONBLOCK, thanks \ay
+ * lib/drb/extserv.rb: typo
+
+Wed Jan 21 17:57:56 2004 Shugo Maeda <shugo@ruby-lang.org>
+
+ * lib/net/imap.rb (envelope): allow NIL.
+ * lib/net/imap.rb (body): ditto.
+ * lib/net/imap.rb (number): ditto.
+ * lib/net/imap.rb (ensure_nz_number): show a detailed error
+ message.
+
+Wed Jan 21 16:44:20 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * lib/mkmf.rb (merge_libs): squeeze successive same libraries.
+ [ruby-dev:22652]
+
+Wed Jan 21 16:01:37 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/digest/rmd160/extconf.rb: have_library appends found library.
+
+Wed Jan 21 11:36:00 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * parse.y (block_append): update nd_end for "real" head node.
+ [ruby-list:39058]
+
+Tue Jan 20 14:48:13 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * ext/openssl/extconf.rb: should check <openssl/conf_api.h> instead
+ of OPENSSL_VERSION_NUMBER. [ruby-list:39056]
+
+Tue Jan 20 14:43:17 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/base64.rb: Add RDoc
+
+Tue Jan 20 14:25:51 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/abbrev.rb: Add RDoc
+
+Tue Jan 20 13:22:39 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/generators/html_generator.rb: Document aliases at
+ top-most level.
+
+ * lib/English.rb: Document English.rb.
+
+Tue Jan 20 02:49:22 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * ext/openssl/extconf.rb: add check for OpenSSL version.
+ [ruby-list:39054]
+
+Tue Jan 20 02:38:13 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * marshal.c (w_class): should not dump singleton class.
+ [ruby-dev:22631]
+
+Tue Jan 20 01:31:36 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * io.c (lineno): typo fix(FIX2INT -> INT2FIX).
+
+Mon Jan 19 21:53:38 2004 akira yamada <akira@ruby-lang.org>
+
+ * io.c, re.c, string.c, time.c: fixed up positions of RDocs.
+
+Mon Jan 19 07:09:20 2004 Tadayoshi Funaba <tadf@dotrb.org>
+
+ * lib/date.rb: zone was wrong when it was behind UTC.
+ Thanks Mark J. Reed.
+
+ * lib/date/format.rb: %z is now always replaced by four digits
+ with a leading plus or minus sign.
+
+ * sample/cal.rb: added a class, anyway.
+
+Sun Jan 18 20:47:35 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * ruby.c: use translate_char() on Cygwin.
+
+Sun Jan 18 02:33:26 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * defines.h (_WIN32): undef _WIN32 on Cygwin before defining DOSISH.
+
+Sun Jan 18 00:23:55 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * marshal.c (class2path): check anonymous class/module before
+ checking referable, and allow singleton classes.
+
+Fri Jan 16 14:33:35 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * marshal.c (class2path): get class path and check referable.
+ [ruby-dev:22588]
+
+Fri Jan 16 09:52:23 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (proc_eq): Proc with empty body may not be equal.
+ [ruby-dev:22590]
+
+Thu Jan 15 13:03:10 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * io.c (argf_read): do not append EOF. (ruby-bugs-ja:PR#585)
+
+ * io.c (rb_io_fwrite): ad-hockery hack to get rid of HP-UX stdio
+ weird behavior. [ruby-dev:22424]
+
+Wed Jan 14 13:31:06 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/iconv/extconf.rb: wrapper iconv.rb is dependent on platform.
+
+Tue Jan 13 18:54:28 2004 NAKAMURA, Hiroshi <nakahiro@sarion.co.jp>
+
+ * lib/logger.rb(Logger#msg2str): no special treatment for the object
+ which responds to :to_str. commited at 2004-01-11T21:46:27 by
+ gsinclair.
+
+ * lib/logger.rb(LogDevice#initialize): remove type checking if the
+ given object is a String. Kernel.open handles it correctly.
+ commited at 2004-01-11T21:46:27 by gsinclair.
+
+ * test/logger/test_logger.rb: follow above change (ArgumentError ->
+ TypeError.) follow above commit.
+
+Tue Jan 13 14:27:13 2004 Kazuhiro NISHIYAMA <zn@mbf.nifty.com>
+
+ * lib/test/unit/ui/testrunnerutilities.rb (TestRunnerUtilities):
+ moved run method which allows output level. [ruby-dev:22554]
+
+Tue Jan 13 04:29:52 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/ri/ri_driver.rb (RiDriver::report_method_stuff):
+ Show fully-qualified class names in class list.
+
+Tue Jan 13 01:04:37 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/ri/ri_paths.rb (RI::Paths): First attempt at
+ incorporating DESTDIR in the rdoc installation.
+
+Mon Jan 12 23:27:19 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * parse.y (primary): fix position after FCALL. [ruby-dev:22574]
+
+Mon Jan 12 12:07:22 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::do_methods):
+ Someone changed the "// in eval.c" comments to "/*...*/" style,
+ so the parsing of the source file name broke.
+
+ * object.c: Remove spurious space in TrueClass documentation.
+
+ * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::find_body): Fix
+ bad regexp: if the code before a documented method contained
+ a comment that wasn't terminated by whitespace, that comment
+ and all intervening code was included in the following
+ method's documentation.
+
+ * lib/rdoc/ri/ri_formatter.rb (RI::HtmlFormatter::break_to_newline):
+ HTML formats need explicit line breaks.
+
+Mon Jan 12 11:46:30 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * configure.in (LIBPATHFLAG, RPATHFLAG): enclose paths with single
+ quotes. [ruby-dev:22564]
+
+ * lib/mkmf.rb (libpathflag): do not enclose with quotes always.
+
+ * {bcc32,win32,wince}/Makefile.sub (LIBPATHFLAG): quoted.
+
+Mon Jan 12 02:24:07 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/ri/ri_formatter.rb (RI::HtmlFormatter): Add HTML
+ generation support to ri (Elliot Hughes)
+
+Mon Jan 12 02:24:07 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/ri/ri_formatter.rb (RI::HtmlFormatter): Add HTML
+ generation support to ri (Elliot Hughes)
+
+Sun Jan 11 02:07:47 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/ri/ri_options.rb (RI::Options::OptionList::OptionList):
+ Also accept command line options via the 'RI' environment variable.
+
+Sun Jan 11 02:07:47 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/ri/ri_options.rb (RI::Options::OptionList::OptionList):
+ Also accept command line options via the 'RI' environment variable.
+
+Sat Jan 10 21:27:41 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (eval): need to add message delimiter. [ruby-dev:22561]
+
+Sat Jan 10 01:54:50 2004 Eric Sunshine <sunshine@sunshineco.com>
+
+ * defines.h (__NeXT__): Ensure that all standard S_IRUSR, S_IWGRP,
+ S_IRWXO, etc. macros are defined since future code might require
+ them (even though present code only requires a subset).
+
+ * defines.h (__NeXT__): Bug fix: WORDS_BIGENDIAN was not being set
+ correctly on Rhapsody when -arch compiler flag was used (via
+ configure's --enable-fat-binary option).
+
+Fri Jan 9 10:05:14 2004 Siena. <siena@faculty.chiba-u.jp>
+
+ * lib/mkmf.rb (libpathflag): use single quotes. [ruby-dev:22440]
+
+Thu Jan 8 23:49:21 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * configure.in (RDOCTARGET): new macro. if you want to install
+ rdoc documentation, you need to run configure with
+ --enable-install-doc.
+
+Thu Jan 8 21:29:43 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * ext/openssl/ossl_pkey.c (ossl_pkey_to_der): removed; it returns
+ public key only.
+
+ * ext/openssl/ossl_pkey_dh.c (ossl_dh_to_der): new function for
+ OpenSSL::PKey::DH#to_der.
+
+ * ext/openssl/ossl_pkey_dsa.c (ossl_dsa_to_der): new function for
+ OpenSSL::PKey::DSA#to_der.
+
+ * ext/openssl/ossl_pkey_rsa.c (ossl_rsa_to_der): new function for
+ OpenSSL::PKey::RSA#to_der.
+
+Thu Jan 8 16:51:04 2004 NAKAMURA, Hiroshi <nakahiro@sarion.co.jp>
+
+ * test/wsdl/datetime/test_datetime.rb: fixed a stupid testcase which
+ dumps "E" at month-end.
+
+Thu Jan 8 11:20:01 2004 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * eval.c, object.c, process.c, re.c: don't use C++ style comments.
+
+Thu Jan 8 04:36:21 2004 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * lib/webrick/cgi.rb (WEBrick::CGI#initialize): should create
+ @config[:Logger] if it was not given.
+
+ * sample/webrick/*: new files.
+
+ * MANIFEST: add sample/webrick/*
+
+Wed Jan 7 13:00:18 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/ri/ri_driver.rb: Fix problem where ri was
+ being too eager to find matches of ambiguous method
+ names (such as "ri Thread.join" would return both
+ Thread.join and ThreadsWait.join)
+
+Wed Jan 7 12:35:41 2004 NAKAMURA, Hiroshi <nakahiro@sarion.co.jp>
+
+ * lib/debug.rb: revert command parse regexps. [ruby-list:39014] by
+ Shirai,Kaoru.
+
+Wed Jan 7 08:21:04 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/parsers/parserfactory.rb: Check for shebang
+ line in files that would otherwise be treated as
+ plain text.
+
+Tue Jan 6 22:13:34 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_mod_modfunc): should break if m has no super class.
+ [ruby-dev:22498]
+
+Tue Jan 6 21:55:02 2004 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * io.c (fptr_finalize): should save errno just after failure.
+ [ruby-dev:22492]
+
+Tue Jan 6 14:53:14 2004 Dave Thomas <dave@pragprog.com>
+
+ * bin/ri: split out the display side, making it pluggable. Added
+ new ri_driver and ri_display files in lib/rdoc/ri.
+
+Tue Jan 6 06:37:53 2004 Dave Thomas <dave@pragprog.com>
+
+ * bin/rdoc: Add --ri-system switch
+
+ * lib/.document: Update with list of files that seem to have
+ documentation
+
+ * lib/test/unit.rb: Reorder comment to make it RDoc friendly.
+
+ * Makefile.in: add install-nodoc target, and make it
+ generate RDoc on default install.
+
+ * lib/rdoc/ri/ri_options.rb (RI::Options::parse): Add
+ --doc-dir option to ri.
+
+Tue Jan 6 00:04:40 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_method_or_yield_parameters):
+ fix parsing if there are braces in a method parameter list
+
+Tue Jan 6 06:37:53 2004 Dave Thomas <dave@pragprog.com>
+
+ * bin/rdoc: Add --ri-system switch
+
+ * lib/.document: Update with list of files that seem to have
+ documentation
+
+ * lib/test/unit.rb: Reorder comment to make it RDoc friendly.
+
+ * Makefile.in: add install-nodoc target, and make it
+ generate RDoc on default install.
+
+ * lib/rdoc/ri/ri_options.rb (RI::Options::parse): Add
+ --doc-dir option to ri.
+
+Tue Jan 6 00:04:40 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_method_or_yield_parameters):
+ fix parsing if there are braces in a method parameter list
+
+Tue Jan 6 00:04:40 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_method_or_yield_parameters):
+ fix parsing if there are braces in a method parameter list
+
+Tue Jan 6 00:04:40 2004 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_method_or_yield_parameters):
+ fix parsing if there are braces in a method parameter list
+
+Fri Jan 2 14:54:11 2004 Dave Thomas <dave@pragprog.com>
+
+ * bin/ri: Add new --classes option, and arrange for
+ help messages to be paged too.
+
+ * bin/rdoc: Add statistics.
+
+ * process.c: (MG) Added Process documentation
+
+ * lib/rdoc/ri/ri_formatter.rb (RI::AttributeFormatter::wrap):
+ Fix problem with labels not displaying in RI labeled
+ lists using BS and ANSI modes.
+
+Fri Jan 2 01:50:13 2004 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * io.c (argf_eof): ARGF.eof? should not have any side effect.
+ [ruby-dev:22469]
+
+Wed Dec 31 17:25:17 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * io.c (argf_each_byte): should return self. [ruby-dev:22465]
+
+Wed Dec 31 11:20:34 2003 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::do_methods): Make
+ file referenced in "// in sss.c" relative to current file.
+
+Wed Dec 31 11:17:37 2003 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/generators/html_generator.rb: Fix problem when
+ a public method was aliased, but the alias is then
+ made private, and hence doesn't appear in RDoc output.
+
+Wed Dec 31 01:33:05 2003 Dave Thomas <dave@pragprog.com>
+
+ * array.c, error.c, eval.c, io.c, prec.c, range.c, re.c,
+ string.c, time.c: Add RDoc for Kernel functions, and tidy.
+
+Tue Dec 30 19:39:14 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * io.c (rb_f_readline): should raise EOFError at the end of
+ files. [ruby-dev:22458]
+
+ * io.c (argf_read): should concatenate input files when length
+ argument is nil. [ruby-dev:22450]
+
+ * io.c (argf_read): should update supplied string buffer (2nd
+ argument) even when IO#read is called multiple times.
+
+ * io.c: should initialize lineno by zero. [ruby-dev:22460]
+
+Tue Dec 30 12:30:30 2003 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/code_objects.rb (RDoc::Context::find_symbol): If a
+ class and a method have the same name, finding Xxx.abc was trying
+ to find 'abc' in method 'Xxx', not class 'Xxx'.
+
+
+Tue Dec 30 08:32:32 2003 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_method):
+ Handle undoing nesting of yield parameters correctly for:
+
+ def each_entry(&b) Dir.foreach(@path) {|f| yield P.new(f) } end
+
+
+Tue Dec 30 08:32:32 2003 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_method):
+ Handle undoing nesting of yield parameters correctly for:
+
+ def each_entry(&block) Dir.foreach(@path) {|f| yield Pathname.new(f) } end
+
+Mon Dec 29 12:51:02 2003 Dave Thomas <dave@pragprog.com>
+
+ * eval.c: Add RDoc for Kernel global functions.
+
+Mon Dec 29 11:00:16 2003 Dave Thomas <dave@pragprog.com>
+
+ * array.c: Tidy up RDoc loose ends.
+
+Mon Dec 29 05:05:51 2003 Dave Thomas <dave@pragprog.com>
+
+ * struct.c, random: Add RDoc comments
+
+Mon Dec 29 02:20:54 2003 Dave Thomas <dave@pragprog.com>
+
+ * eval.c: Add RDoc for class Proc, Method, UnboundMethod
+
+Mon Dec 29 00:41:44 2003 Dave Thomas <dave@pragprog.com>
+
+ * math.c: Add RDoc comments
+
+Sun Dec 28 20:19:11 2003 Tanaka Akira <akr@m17n.org>
+
+ * ext/stringio/stringio.c (strio_sysread): StringIO.new.sysread didn't
+ raise EOFError.
+
+ * ext/zlib/zlib.c (gzreader_gets): don't increment lineno when
+ gzfile_read_all returns "".
+
+Sun Dec 28 15:25:08 2003 Dave Thomas <dave@pragprog.com>
+
+ * class.c,object.c,parse.y,sprintf.c,variable.c: Document classes
+ Object, Module, etc...
+
+Sun Dec 28 11:55:29 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * test/csv/test_csv.rb: generate bom.csv and mac.csv files on the fly.
+ [ruby-talk:88852]
+
+ * test/csv/{bom.csv,mac.csv}: removed.
+
+Sun Dec 28 08:56:51 2003 Dave Thomas <dave@pragprog.com>
+
+ * eval.c: Thead[Group] RDoc (thanks to MG)
+
+Sun Dec 28 03:50:05 2003 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::find_override_comment):
+ Escape method names used in regexp
+
+Sun Dec 28 01:46:02 2003 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/ri/ri_formatter.rb (RI::TextFormatter::display_flow_item):
+ Add support for rules in 'ri' output.
+
+Sun Dec 28 01:35:35 2003 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::find_body):
+ Sometimes the Ruby source aliases two otherwise
+ unrelated methods (for example Kernel#object_id and
+ Kernel#hash are both the same C function). Provide a
+ facility to allow the methods to be documented
+ separately.
+
+Sun Dec 28 01:05:31 2003 Dave Thomas <dave@pragprog.com>
+
+ * marshal.c, signal.c: RDoc collemts added by Elliott Hughes
+
+Sun Dec 28 00:48:47 2003 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::find_class_comment):
+ Some source files use lower case class or module names
+ when naming the Init_XXX function in C.
+
+Sat Dec 27 23:41:46 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * configure.in: fix "test: too many arguments" error.
+
+Sat Dec 27 15:32:19 2003 Dave Thomas <dave@wireless_3.local.thomases.com>
+
+ * time.c: RDoc comments added
+
+Sat Dec 27 15:07:57 2003 Dave Thomas <dave@pragprog.com>
+
+ * object.c: Add RDoc comments for Symbol class.
+
+Sat Dec 27 14:42:30 2003 Dave Thomas <dave@pragprog.com>
+
+ * numeric.c: Add RDoc comments.
+
+Sat Dec 27 00:44:00 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * io.c (next_argv): warn always for stdin on inplace edit mode.
+
+ * io.c (read_all): need to check string value.
+
+ * io.c (argf_read): allow ARGF.read(nil). [ruby-dev:22433]
+
+Fri Dec 26 23:02:09 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * io.c (rb_f_backquote): need not to check nil result.
+ [ruby-core:02078]
+
+ * io.c (rb_io_getline): should return nil when read_all gives
+ empty string, even when nil rs is specified. [ruby-core:02077]
+
+Fri Dec 26 18:50:59 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * configure.in: check if getcontext and setcontext are available.
+
+ * eval.c: use presence of getcontext/setcontext.
+
+Fri Dec 26 16:40:53 2003 Tanaka Akira <akr@m17n.org>
+
+ * lib/pathname.rb (PathnameTest#test_plus): add 2 assertions.
+
+Fri Dec 26 09:26:58 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * pack.c (pack_pack): add sign check for 'i', and 'l'.
+ [ruby-dev:22427]
+
+ * bignum.c (rb_quad_pack): add range check for 'quad int'.
+
+Thu Dec 25 22:39:59 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * string.c (rb_str_update): don't return any value.
+
+Thu Dec 25 15:30:17 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * string.c (rb_str_update): call rb_str_modify().
+
+Thu Dec 25 05:08:09 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (search_required): search actual file name once when no
+ extension specified.
+
+Thu Dec 25 04:00:44 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * stable version 1.8.1 released.
+
+Thu Dec 25 00:17:53 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * configure.in: check for nanosleep, -lrt if required.
+ [ruby-core:02059]
+
+ * eval.c (thread_timer): use select(2) if nanosleep(2) is not
+ available.
+
+ * eval.c: check __stub_getcontext for glibc on some platforms.
+ [ruby-list:38984]
+
+Wed Dec 24 23:48:04 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * test/soap/test_basetype.rb, test/soap/marshal/test_marshal.rb
+ test/xsd/test_xsd.rb: use "(-1.0 / (1.0 / 0.0))" instead of "-0.0"
+ to express -0.0. [ruby-talk:88786]
+
+Wed Dec 24 23:29:30 2003 Tanaka Akira <akr@m17n.org>
+
+ * lib/tsort.rb (test_orphaned_break): removed.
+
+Wed Dec 24 20:53:06 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tk/sample/tkmulticolumnlist.rb: new sample
+
+ * ext/tk/sample/tkmultilistframe.rb: bug fix
+
+Wed Dec 24 20:37:37 2003 Eric Sunshine <sunshine@sunshineco.com>
+
+ * configure.in (LDSHARED): Fixed typographical error in assignment of
+ LDSHARED for Rhapsody which caused linking of extension modules to
+ fail.
+
+Wed Dec 24 17:51:18 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * file.c (rb_thread_flock): enable thread support again.
+
+Wed Dec 24 16:46:08 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (catch_timer): do not call rb_thread_schedule() inside to
+ avoid pthread_mutex_lock() deadlock. interrupts to system calls
+ are detected by TRAP_END via EINTR error.
+
+ * eval.c (thread_timer): do not post signal unless it is
+ absolutely necessary.
+
+ * rubysig.h (TRAP_END): add CHECK_INTS to switch thread.
+
+ * regex.c (re_compile_pattern): check if nextp is smaller than
+ pend. [ruby-dev:22372]
+
+ * eval.c (umethod_bind): remove method overridden check.
+ [ruby-dev:22366]
+
+Wed Dec 24 16:13:05 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * ext/openssl/ossl_ssl.c (ossl_ssl_read): should check for error
+ status by SSL_get_error().
+
+ * ext/openssl/ossl_ssl.c (ossl_ssl_write): ditto.
+
+Wed Dec 24 14:23:27 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/stringio/stringio.c (strio_read): clear the buffer argument
+ when returning nil. [ruby-dev:22363]
+
+ * test/ruby/ut_eof.rb (TestEOF::test_eof_0, TestEOF::test_eof_1):
+ add buffer argument tests.
+
+Wed Dec 24 14:07:55 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * lib/test/unit/assertions.rb: Modules are allowed to rescue.
+
+ * lib/test/unit/autorunner.rb: show output_level in order.
+
+ * lib/test/unit/collector/dir.rb: get rid of successive same
+ directories in load path.
+
+ * test/testunit/test_assertions.rb (test_assert_nothing_raised,
+ test_assert_raise): test for modules.
+
+Wed Dec 24 13:43:34 2003 Shugo Maeda <shugo@ruby-lang.org>
+
+ * lib/net/imap.rb (authenticate): remove "\n" from base64 encoded
+ strings.
+
+Wed Dec 24 11:26:41 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * test/fileutils/test_fileutils.rb: should not create any
+ files or directories in current directory. [ruby-talk:88724]
+
+Wed Dec 24 10:29:53 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/stringio/stringio.c (strio_read): never return nil at
+ unlimited read. [ruby-dev:22334]
+
+ * ext/stringio/stringio.c (strio_read): support second
+ argument. [ruby-dev:22350]
+
+Wed Dec 24 09:38:49 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * parse.y (arg): should return 0 after error. [ruby-dev:22360]
+
+Wed Dec 24 00:56:54 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * io.c (read_all): do not return nil at the end of file.
+ [ruby-dev:22334]
+
+ * io.c (argf_read): do not depend on nil at eof behavior of
+ IO#read().
+
+ * eval.c (rb_thread_join): dup exception before re-raising it.
+
+ * io.c (rb_io_eof): call clearerr() to prevent side effect. this
+ patch is supplied by Masahiro Sakai <sakai@tom.sfc.keio.ac.jp>.
+ [ruby-dev:22234]
+
+ * pack.c (OFF16): get offset for big endian machines.
+
+ * pack.c (pack_pack): use OFF16 instead of OFF16B.
+ [ruby-dev:22344]
+
+ * pack.c (pack_unpack): ditto.
+
+Tue Dec 23 22:47:14 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * io.c (rb_io_check_readable): set FMODE_RBUF always, even if
+ NEED_IO_SEEK_BETWEEN_RW is not defined. [ruby-dev:22340]
+
+ * io.c (rb_io_check_writable): clear FMODE_RBUF before writing
+ something.
+
+Tue Dec 23 22:25:00 2003 Gavin Sinclair <gsinclair@soyabean.com.au>
+
+ * lib/optparse.rb: incomplete RDoc documentation added in place of
+ existing RD comments. Tabs converted to spaces.
+
+Tue Dec 23 19:44:47 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * test/soap/test_streamhandler.rb (test_basic_auth): removed.
+ soap4r + basic_auth is not officially supported in ruby/1.8.1 even
+ though soap4r + basic_auth + http-access2 should run fine.
+
+Tue Dec 23 19:42:59 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * io.c (rb_io_ungetc): raise an exception at unread stream to
+ avoid unspecified behavior. [ruby-dev:22330]
+
+ * test/ruby/test_system.rb (test_syntax): glob relatively from
+ __FILE__.
+
+Tue Dec 23 18:09:40 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * pack.c (pack_pack): remove unnecessary negative value check.
+ [ruby-dev:22329]
+
+Tue Dec 23 17:26:55 2003 KONISHI Hiromasa <konishih@fd6.so-net.ne.jp>
+
+ * bcc32/Makefile.sub (config.h): bcc has finite(). [ruby-list:38940]
+
+Tue Dec 23 16:08:16 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * lib/rexml/encodings/US-ASCII.rb: typo. [ruby-talk:88650]
+
+ * test/ruby/test_system.rb: num of asserts depended on running dir.
+
+ * test/xsd/test_noencoding.rb: rexml + without iconv/uconv cannot
+ handle euc-jp. install iconv, uconv or xmlscan.
+
+Tue Dec 23 14:13:51 2003 akira yamada <akira@ruby-lang.org>
+
+ * lib/uri/generic.rb (URI::Generic::check_userinfo,
+ URI::Generic::check_user, URI::Generic::check_password): tests
+ conflicts/depends with other components closely.
+
+ * test/uri/test_generic.rb (TestGeneric::test_set_component):
+ added tets.
+
+Tue Dec 23 11:08:34 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * test/xsd/test_noencoding.rb: rescue Errno::EINVAL and do not test.
+ "euc-jp" might not be in supported encoding name list.
+ [ruby-talk:88650]
+
+Tue Dec 23 06:10:31 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * lib/webrick/cgi.rb (CGI): add support for mod_ruby.
+
+ * lib/webrick/cgi.rb (CGI::Socket): add check for existence of
+ OpenSSL module in all HTTPS related methods.
+
+ * lib/webrick/cgi.rb (CGI::Socket#cipher): should create similar
+ value to OpenSSL::SSLSocket#cipher.
+
+ * lib/webrick/httpresponse.rb (HTTPResponse#setup_header): should
+ set "connection: close" if @keep_alive is false.
+
+ * lib/webrick/https.rb (HTTPrequest#meta_vars): add supprt for
+ SSL_PROTOCOL, SSL_CIPHER_USEKEYSIZE and SSL_CIPHER_ALGKEYSIZE.
+
+Mon Dec 22 23:00:05 2003 akira yamada <akira@ruby-lang.org>
+
+ * lib/uri/generic.rb (URI::Generic::check_opaque): fixed typo.
+
+Mon Dec 22 21:59:24 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/iconv/iconv.c (map_charset): always ensure code is a String.
+
+Mon Dec 22 21:15:29 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * class.c (rb_mod_init_copy): always copy singleton class.
+ [ruby-dev:22325]
+
+Mon Dec 22 20:44:36 2003 akira yamada <akira@ruby-lang.org>
+
+ * lib/uri/generic.rb (URI::Generic#route_from): accepts urls which
+ has no host-part.
+
+ * test/uri/test_generic.rb (TestGeneric::test_route): added a test.
+
+Mon Dec 22 20:38:44 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * lib/cgi.rb: reduce eval.
+
+ * lib/cgi.rb (CGI::QueryExtension::read_multipart): alias path to
+ local_path. [ruby-list:38883]
+
+Mon Dec 22 20:09:31 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * test/soap/test_property.rb: remove duplicated test method.
+
+Mon Dec 22 18:22:04 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * bcc32/Makefile.sub, win32/Makefile.sub (config.h): remove
+ HAVE_ISINF definition to follow previous commits of missing.h
+ and win32/win32.h.
+
+Mon Dec 22 17:23:42 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * configure.in (ac_cv_func_setitimer): moved from defines.h
+
+ * defines.h, rubysig.h, signal.c: removed macro handling which
+ should be done in configure.
+
+ * configure.in (intrinsics.h): check if present.
+
+ * ruby.h: include intrinsics.h if available.
+
+ * bignum.c, marshal.c: include ieeefp.h if available.
+
+ * missing.h (isinf): define as a macro if finite() and isnan()
+ are available. [ruby-core:02032]
+
+Mon Dec 22 17:07:31 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * configure.in (mingw): set isnan, finite and isinf to yes.
+
+Mon Dec 22 13:40:19 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * lib/soap/property.rb: passing block by reference.
+
+Mon Dec 22 00:32:43 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_with_disable_interrupt): use ENABLE_INTS instead of
+ ALLOW_INTS which may switch context. [ruby-dev:22319]
+
+ * ext/syck/emitter.c (syck_emitter_write): str bigger than
+ e->bufsize causes buffer overflow. [ruby-dev:22307]
+
+Sun Dec 21 17:29:00 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * class.c (rb_check_inheritable): new function. [ruby-dev:22316]
+
+ * intern.h: add prototype.
+
+ * eval.c (superclass): use rb_check_inheritable().
+
+ * object.c (rb_class_initialize): check argument validity.
+
+Sun Dec 21 16:25:10 2003 Tanaka Akira <akr@m17n.org>
+
+ * lib/pathname.rb (Pathname#+): re-implemented to resolve ".." in
+ beginning of the argument.
+ (Pathname#join): concatenate from the last argument.
+ (Pathname#parent): just use Pathname#+.
+
+Sun Dec 21 00:12:37 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tk/lib/tk.rb: add new methods (TkScrollbar#assign, assign_list)
+
+ * ext/tk/sample/tkmultilistframe.rb: use TkScrollbar#assign method
+
+Sat Dec 20 21:59:03 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * lib/webrick/httprequest.rb (HTTPRequest#meta_vars): refine regexp.
+
+ * lib/webrick/cgi.rb (CGI#start): NPH scripts return status line
+ instead of Status: header field.
+
+ * lib/webrick/cgi.rb (CGI::Socket): refine some coditions.
+
+Sat Dec 20 16:07:14 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * lib/optparse.rb (OptionParser::Completion::complete): wrong
+ Regexp for word boundary. pointed out by Gavin Sinclair.
+
+ * lib/optparse.rb (OptionParser::make_switch): [no-] prefix was
+ missing.
+
+Sat Dec 20 11:40:10 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * lib/yaml.rb (YAML::YAML): adjust Marshal version.
+
+Sat Dec 20 03:56:02 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_with_disable_interrupt): prohibit thread context
+ switch during proc execution. [ruby-dev:21899]
+
+Sat Dec 20 02:41:02 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * lib/webrick/cgi.rb: add file. (yet another CGI library)
+
+ * MANIFEST: add lib/webrick/cgi.rb.
+
+Sat Dec 20 02:18:31 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * misc/ruby-mode.el (ruby-calculate-indent): proper indentation
+ inside of parentheses. [ruby-dev:22308]
+
+Fri Dec 19 21:24:22 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * lib/webrick/httprequest.rb (HTTPRequest#meta_vars): should not set
+ HTTP_CONTENT_TYPE and HTTP_CONTENT_LENGTH.
+
+ * lib/webrick/https.rb (HTTPRequest#parse): should check presence
+ of cert() method to detect SSLSocket.
+
+Fri Dec 19 22:56:46 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * lib/soap/property.rb (SOAP::Property#load): new method for loading
+ property value into existing property tree.
+
+ * test/soap/test_property.rb: add test.
+
+Fri Dec 19 19:21:49 2003 akira yamada <akira@ruby-lang.org>
+
+ * lib/runit/cui/testrunner.rb (RUNIT::CUI::TestRunner::run):
+ should use Test::Unit::UI::{PROGRESS_ONLY,VERBOSE}.
+
+Fri Dec 19 17:36:49 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tk/sample/tkmultilistbox.rb: bug fix
+
+ * ext/tk/sample/tkmultilistframe.rb: new sample script
+
+Fri Dec 19 03:44:27 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * lib/webrick/httputils.rb (parse_form_data): should return an
+ empty Hash if the body is empty.
+
+Thu Dec 18 21:47:35 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * lib/mkmf.rb (create_makefile): should remove deffile if it's
+ made by miniruby. based on nobu's patch.
+
+Thu Dec 18 21:44:21 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * eval.c (stack_extend): ignore inline optimization on VC7.
+
+ * win32/Makefile.sub (OS, RT): can override.
+
+ * win32/Makefile.sub (LDFLAGS): ditto. shouldn't use pdb:none
+ option. based on Tietew's patch [ruby-dev:22289]
+
+Thu Dec 18 16:38:44 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * dir.c (fnmatch): unlike find_dirsep(), rb_path_next() never
+ return NULL.
+
+Thu Dec 18 15:27:59 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * lib/ipaddr.rb (IPSocket::getaddress): merge usa's patch.
+ [ruby-dev:21678]
+
+Wed Dec 17 15:15:30 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * lib/cgi.rb (CGI::QueryExtension::Value::[]): should work like
+ String#[] if more than one arguments are specified.
+
+ * lib/delegate.rb: avoid using common instance name as "@obj".
+
+ * lib/cgi.rb (CGI::QueryExtension::Value): Value is no longer
+ subclass of String, but DelegateClass(String).
+
+ * ext/curses/extconf.rb: restore function check for init_color.
+ [ruby-list:38905]
+
+ * Makefile.in: need to specify $(MAINLIBS) for the miniruby
+ generation rule.
+
+ * configure.in: better FreeBSD -lc_r support.
+
+Wed Dec 17 00:16:14 2003 Minero Aoki <aamine@loveruby.net>
+
+ * ext/strscan/strscan.c: new method
+ StringScanner#beginning_of_line? (alias #bol?)
+
+ * ext/strscan/strscan.c: new method StringScanner#concat and #<<.
+
+ * ext/strscan/strscan.c: StringScanner#new(str) does not duplicate
+ nor freeze STR (allow destructive modification).
+
+ * test/strscan/test_stringscanner.rb: test new methods above.
+
+ * test/strscan/test_stringscanner.rb: test destructive string
+ modification.
+
+Tue Dec 16 21:20:47 2003 Tanaka Akira <akr@m17n.org>
+
+ * lib/pp.rb: don't use local variable `pp'.
+
+ * lib/prettyprint.rb: ditto.
+
+Tue Dec 16 13:20:43 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tk/lib/tk.rb: condition bug of if statement on
+ {pack,grid}_propagate methods
+
+Tue Dec 16 03:17:29 2003 why the lucky stiff <why@ruby-lang.org>
+
+ * lib/yaml/rubytypes.rb: comments in strings. [ruby-talk:88012]
+
+ * test/yaml/test_yaml.rb: add test.
+
+Tue Dec 16 01:14:44 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (catch_timer): check rb_thread_crtical in main native
+ thread.
+
+ * eval.c (thread_timer): just sends signals periodically, to
+ prevent main native thread from receiving them in critical
+ section. [ruby-core:01959]
+
+Mon Dec 15 13:32:22 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * dir.c (check_dirname): check string safety and remove extraneous
+ trailing directory separators. [ruby-dev:22279]
+
+ * file.c: renamed and externalized rb_path_next,
+ rb_path_skip_prefix, rb_path_last_separator, rb_path_end.
+
+ * intern.h: prototypes for rb_path_next, rb_path_skip_prefix,
+ rb_path_last_separator, rb_path_end.
+
+Mon Dec 15 09:27:46 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * ext/openssl/ossl_pkcs12.c (ossl_pkcs12_initialize): first argument
+ of rb_protect should take an argument of VALUE.
+
+Sun Dec 14 18:46:48 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * ext/socket/socket.c (Init_socket): IPv6 is not supported although
+ AF_INET6 is defined on MinGW.
+
+ * lib/ipaddr.rb (AF_INET6): workaround in the environment which does
+ not support IPv6.
+
+Sat Dec 13 18:55:16 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/iconv/charset_alias.rb: preserve original order.
+
+ * ext/iconv/extconf.rb: remove wrapper file at clean.
+
+Sat Dec 13 18:09:42 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (thread_timer): use timer by sub-thread and nanosleep.
+ [ruby-talk:87519]
+
+ * gc.c (Init_stack): no stack adjustment for THREAD_SAFE.
+
+Sat Dec 13 17:17:59 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (proc_alloc): cache the created object at first time.
+ [ruby-talk:61288], [ruby-dev:22240]
+
+Sat Dec 13 09:01:23 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * configure.in: check ucontext.h.
+
+ * eval.c: use getcontext/setcontext() instead of setjmp/longjmp()
+ on ia64 or with native thread enabled. [ruby-core:01932]
+
+Sat Dec 13 03:09:14 2003 why the lucky stiff <why@ruby-lang.org>
+
+ * lib/yaml/rubytypes.rb: anonymous struct fix. [ruby-core:01946]
+
+ * test/yaml/test_yaml.rb: add test.
+
+Fri Dec 12 22:36:44 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * lib/csv.rb: add Cell#to_str and Cell#to_s for /.../ =~ aCell,
+ "#{aCell}" and so on.
+
+ * test/csv/test_csv.rb: add tests.
+
+Fri Dec 12 19:33:06 2003 Minero Aoki <aamine@loveruby.net>
+
+ * lib/fileutils.rb (mkdir): remove trailing `/' from pathes.
+
+ * lib/fileutils.rb (rmdir): ditto. [ruby-dev:22238]
+
+ * lib/fileutils.rb (rmdir_r): ditto.
+
+ * lib/fileutils.rb (fu_copy_dir): check if it is a directory after
+ mkdir(2).
+
+Fri Dec 12 06:06:09 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (proc_invoke): fix class name in warning message for
+ define_method. [ruby-dev:22235]
+
+Thu Dec 11 21:24:43 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * ext/openssl/ossl_pkcs12.[ch]: new files. add OpenSSL::PKCS12.
+
+ * ext/openssl/ossl.[ch]: ditto.
+
+ * ext/openssl/MANIFEST: add ossl_pkcs12.[ch].
+
+Thu Dec 11 20:54:28 2003 Minero Aoki <aamine@loveruby.net>
+
+ * lib/fileutils.rb (mkdir_p): remove trailing `/' befere mkdir(2).
+ mkdir("nonexistdir/") does not work on NetBSD/Alpha 1.6.1.
+
+ * lib/fileutils.rb (fu_list): call to_str for all arguments.
+
+Thu Dec 11 20:07:01 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * lib/ftools.rb (makedirs): sync with fileutils.
+
+Thu Dec 11 19:53:03 2003 Minero Aoki <aamine@loveruby.net>
+
+ * lib/fileutils.rb (mkdir_p): catch all SystemCallErrors.
+ (mkdir("C:\") causes EACCESS on Windows 2000/NTFS)
+
+Thu Dec 11 19:08:02 2003 Minero Aoki <aamine@loveruby.net>
+
+ * lib/fileutils.rb (mkdir_p): check if it is a directory after
+ mkdir(2) instead of before mkdir(2), to avoid race condition.
+ [ruby-talk:87730]
+ Refer: mkinstalldirs sh script, GNU mkdir(1) (coreutils 5.0)
+
+Thu Dec 11 18:49:30 2003 Minero Aoki <aamine@loveruby.net>
+
+ * lib/fileutils.rb: def m( arg ) -> def m(arg).
+
+Thu Dec 11 11:39:43 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * configure.in (ieeefp.h), numeric.c: needed for finite() on
+ Solaris. [ruby-core:01921]
+
+ * file.c (rb_stat_inspect): adjust format specifier.
+
+ * parse.c (arg_prepend): nodetype() is for debug use.
+
+ * ruby.h (ISASCII, etc): cast to int to get rid of warning.
+
+ * ruby.h (alloca.h): include even in GCC. [ruby-core:01925]
+
+ * ext/bigdecimal/bigdecimal.c (GetVpValue): adjust format
+ specifier.
+
+ * ext/bigdecimal/bigdecimal.c (BigDecimal_prec, BigDecimal_coerce,
+ BigDecimal_divmod): use rb_assoc_new() to suppress memory usage.
+
+ * ext/bigdecimal/bigdecimal.c (BigDecimal_split): ditto.
+
+ * ext/dl/sym.c (rb_dlsym_guardcall): guard itself should be
+ volatile.
+
+ * ext/iconv/iconv.c (iconv_convert): ensure actual parameter with
+ format specifier.
+
+ * ext/pty/pty.c (MasterDevice, SlaveDevice, deviceNo): do not
+ define unless used.
+
+ * ext/pty/pty.c (getDevice): get rid of warning.
+
+ * ext/socket/socket.c (port_str, sock_s_getaddrinfo,
+ sock_s_getnameinfo): FIX2INT() now returns long.
+
+ * ext/socket/socket.c (init_inetsock_internal): uninitialized
+ variable.
+
+ * ext/syck/rubyext.c (syck_parser_assign_io): add prototype.
+
+ * ext/syck/rubyext.c (rb_syck_mktime, yaml_org_handler): use
+ ISDIGIT() instead of isdigit() to avoid warnings and for
+ platforms which don't support non-ascii charater.
+
+Wed Dec 10 19:28:56 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/stringio/stringio.c (strio_read): set EOF flag at short read.
+ [ruby-dev:22223], [ruby-dev:22224]
+
+Wed Dec 10 18:07:25 2003 Minero Aoki <aamine@loveruby.net>
+
+ * lib/erb.rb: new method ERB#filename(=). [ruby-dev:22208]
+
+Wed Dec 10 17:54:51 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/stringio/stringio.c (strio_read): do not set EOF flag when
+ requested length is zero. [ruby-dev:22214]
+
+Wed Dec 10 17:17:18 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * io.c (read_all): should return given string even if data read is
+ empty. [ruby-dev:22207]
+
+Wed Dec 10 17:16:06 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/stringio/stringio.c (strio_read): adjust behavior at reading
+ beyond EOF to IO. [ruby-dev:22205]
+
+ * test/ruby/ut_eof.rb (TestEOF::Seek): test behaviors at reading
+ beyond EOF.
+
+ * test/ruby/test_file.rb, test/stringio/test_stringio.rb: include
+ TestEOF::Seek test case.
+
+Wed Dec 10 15:01:19 2003 Shugo Maeda <shugo@ruby-lang.org>
+
+ * test/monitor/test_monitor.rb (test_cond): use Queue#deq
+ instead of sleep.
+
+Wed Dec 10 14:45:39 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * ext/pty/pty.c (HAVE_SYS_IOCTL_H): need to include <sys/ioctl.h>
+ for TIOCSCTTY on *BSD. based on gotoyuzo's patch.
+ (ruby-bugs:PR#1211)
+
+ * ext/pty/pty.c (establishShell): should close descriptors if fork
+ failed.
+
+Wed Dec 10 12:53:05 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * win32/win32.h: define execv() using do_aspawn().
+
+ * process.c (proc_exec_v): remove #ifdef's which stopped needing.
+
+Tue Dec 9 23:32:23 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tk/lib/tk.rb, ext/tk/lib/tkcanvas.rb, ext/tk/lib/tkdialog.rb,
+ ext/tk/lib/tkentry.rb, ext/tk/lib/tkscrollbox.rb, ext/tk/lib/tktext.rb,
+ ext/tk/sample/tkalignbox.rb, ext/tk/sample/tkcombobox.rb,
+ ext/tk/sample/tkmultilistbox.rb, ext/tk/sample/tkoptdb.rb, ext/tk/sample/tktextframe.rb,
+ ext/tk/sample/demos-en/dialog1.rb, ext/tk/sample/demos-en/dialog2.rb,
+ ext/tk/sample/demos-jp/dialog1.rb, ext/tk/sample/demos-jp/dialog2.rb:
+ overrided instance methods, which are private methods on the super
+ class, are changed to 'private'
+
+Tue Dec 9 19:53:02 2003 akira yamada <akira@ruby-lang.org>
+
+ * lib/uri/generic.rb (URI::Generic#route_from0): make case insensitive
+ for host-part.
+
+ * test/uri/test_generic.rb (test_route): added tests for the above
+ change.
+
+Tue Dec 9 14:10:48 2003 Tanaka Akira <akr@m17n.org>
+
+ * io.c (rb_io_check_readable): don't call io_seek if EOF flag is set,
+ to avoid clearing EOF flag.
+ (rb_io_check_writable): ditto.
+
+Tue Dec 9 02:53:55 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tk/sample/tkalignbox.rb: new sample script
+
+Tue Dec 9 00:45:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
+
+ * lib/test/unit/assertions.rb: renamed #assert_raises to #assert_raise
+ and made the former call the latter. [ruby-core:01890]
+
+ * test/testunit/test_assertions.rb: ditto.
+
+Tue Dec 9 00:07:35 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * lib/soap/rpc/standaloneServer.rb: add 'shutdown' and 'status'
+ methods as delegates to WEBrick.
+
+ * test/soap/calc/{test_calc.rb,test_calc2.rb},
+ test/soap/helloworld/test_helloworld.rb,
+ test/wsdl/datetime/test_datetime.rb, test/wsdl/raa/test_raa.rb:
+ follow the change.
+
+Mon Dec 8 22:48:03 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * lib/test/unit/autorunner.rb: remove dependency to a particular
+ runner. [ruby-core:01901], [ruby-list:38869]
+
+ * lib/test/unit/ui/testrunnerutilities.rb: moved output level
+ constants from Console.
+
+ * lib/test/unit/ui/console/testrunner.rb: ditto.
+
+ * lib/test/unit/ui/{fox,gtk,gtk2,tk}/testrunner.rb (initialize):
+ accept output_level.
+
+Mon Dec 8 15:03:30 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/syck/syck.c (syck_io_str_read): get rid of buffer overflow.
+
+Mon Dec 8 13:02:11 2003 Minero Aoki <aamine@loveruby.net>
+
+ * lib/uri/common.rb: new method URI.regexp. [ruby-dev:22121]
+
+ * test/uri/test_common.rb: add test for URI.regexp.
+
+Mon Dec 8 12:44:14 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * pack.c: define swap16 and swap32 only if they are not
+ defined. OpenBSD defines these macros. [ruby-dev:22181]
+
+Sun Dec 7 20:54:17 2003 Tanaka Akira <akr@m17n.org>
+
+ * ext/iconv/iconv.c (map_charset): make case sensitive.
+ ext/iconv/charset_alias.rb (charset_alias): don't ignore
+ config.charset's information. sort aliases.
+
+Sat Dec 6 22:58:03 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * ext/openssl/ossl_ssl.c (ossl_start_ssl): new function to wrap
+ SSL_connect and SSL_accept; if SSL_connect (or SSL_accept) returned
+ but not finished the handshake process, we should retry it.
+
+ * ext/openssl/ossl_ssl.c (ossl_ssl_connect): call ossl_start_ssl.
+
+ * ext/openssl/ossl_ssl.c (ossl_ssl_accept): ditto.
+
+ * ext/openssl/ossl_ssl.c (ossl_ssl_read): allow signal traps.
+
+Sat Dec 6 21:45:10 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * io.c (flush_before_seek): flush before seek on any platform.
+
+ * configure.in: ditto.
+
+Sat Dec 6 17:23:00 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * lib/soap/soap.rb(SOAP::Env.getenv): allow upcase environment variable
+ as well as downcase one.
+
+ * lib/soap/netHttpClient.rb(SOAP::NetHttpClient#proxy=): check URI.
+
+Fri Dec 5 23:22:30 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * lib/test/unit/assertions.rb (Test::Unit::Assertions::assert_raises,
+ Test::Unit::Assertions::assert_nothing_raised): use the last
+ argument as message unless class object.
+
+ * test/testunit/test_assertions.rb (test_assert_raises): test for
+ multiple exception list. [ruby-core:01891]
+
+ * test/testunit/test_assertions.rb (test_assert_nothing_raised): test
+ for non-exception classes.
+
+Fri Dec 5 22:23:04 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * lib/soap/netHttpClient.rb: proxy support did not work. fixed.
+
+ * lib/soap/property.rb: add class methods for loading property from
+ stream/file/propertyfile. propertyfile is a file which is located at
+ somedir in $:.
+
+ * lib/soap/soap.rb, lib/soap/wsdlDriver.rb, lib/soap/rpc/driver.rb,
+ lib/wsdl/importer.rb: load property from propertyfile 'soap/property'
+ e.g. /usr/local/lib/ruby/site_ruby/1.8/soap/property.
+
+ * test/soap/test_property.rb, test/soap/test_streamhandler.rb: new file.
+
+Fri Dec 5 17:26:23 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (rb_exec_end_proc): maintain tmp_end_procs.
+ [ruby-dev:22154]
+
+Fri Dec 5 13:36:59 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_exec_end_proc): should not clear end_procs and
+ ephemeral_end_procs before execution. [ruby-dev:22144]
+
+ * eval.c (rb_obj_extend): call Module#extended hook after
+ extended_object. [ruby-list:38866]
+
+ * object.c (Init_Object): Module#extended defined.
+
+Fri Dec 5 13:17:30 2003 Tanaka Akira <akr@m17n.org>
+
+ * test/ruby/test_pipe.rb: use IO.pipe instead of IO.popen.
+
+Fri Dec 5 11:54:45 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/stringio/stringio.c (strio_read): follow IO#read.
+
+ * test/ruby/ut_eof.rb, test/ruby/test_file.rb, test/ruby/test_pipe.rb,
+ test/stringio/test_stringio.rb: add EOF test.
+
+Fri Dec 5 02:49:35 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * lib/test/unit/assertions.rb (Test::Unit::Assertions::assert_raises):
+ allow multiple exception list. [ruby-core:01884]
+
+ * lib/test/unit/assertions.rb (Test::Unit::Assertions::assert_nothing_raised):
+ check whether arguments are subclass of Exception.
+
+Thu Dec 4 23:54:00 2003 Rick Ohnemus <rick.ohnemus@systemware.com>
+
+ * dln.c (aix_loaderror): should not use member named 'errno' which
+ might be a macro (e.g. on AIX).
+
+Thu Dec 4 23:32:26 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * io.c (read_all): do not depend on lseek position.
+ [ruby-dev:22026]
+
+Thu Dec 4 22:37:26 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (rb_eval): preserve $! value when retry happens in the
+ rescue clause. [ruby-talk:86697]
+
+Thu Dec 4 21:50:07 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * lib/drb/drb.rb (DRb::DRbMessage::send_request, send_reply):
+ should rescue errors and re-raise DRbConnError on write too.
+ [ruby-dev:22132]
+
+Thu Dec 4 16:41:17 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * parse.y (exc_list): allow expanding list. [ruby-dev:22134]
+
+Thu Dec 4 14:09:24 2003 Minero Aoki <aamine@loveruby.net>
+
+ * test/fileutils/test_fileutils.rb (test_cp): test if the error is
+ kind of SystemCallError. It is needless details that which errno
+ is set on each systems.
+
+Thu Dec 4 13:24:13 2003 Shugo Maeda <shugo@ruby-lang.org>
+
+ * lib/monitor.rb: use Object#__send__ instead of Object#send.
+
+Thu Dec 4 13:17:45 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * lib/soap/streamHandler.rb: support latest released version of
+ http-access2.
+
+Thu Dec 4 13:04:44 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * lib/soap/soap.rb: add SOAP::Env module for environment repository
+ such as HTTP_PROXY.
+
+ * lib/soap/property.rb: property implementation.
+
+ * lib/soap/streamHandler.rb, lib/soap/wsdlDriver.rb,
+ lib/soap/rpc/driver.rb: use soap/property.rb.
+
+ * lib/wsdl/importer.rb, lib/soap/wsdlDriver.rb, lib/soap/rpc/driver.rb:
+ use SOAP::Env.
+
+ * lib/soap/netHttpClient.rb: add basic_auth, ssl_config, and cookie
+ management interface, but ignored for now.
+
+ * lib/xsd/charset.rb: add XSD::Charset.encoding= interface to set
+ wiredump charset explicitly. it was fixed to 'utf-8' when iconv or
+ uconv module was found.
+
+Thu Dec 4 10:43:58 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * ext/dl/sym.c (rb_dlsym_guardcall): __declspec(noinline) is VC7
+ feature.
+
+Thu Dec 4 10:27:12 2003 Minero Aoki <aamine@loveruby.net>
+
+ * lib/net/http.rb: update hyperlink to the Japanese document.
+
+Thu Dec 4 09:12:43 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * ext/openssl/ossl_asn1.c (asn1time_to_time): should check that
+ the underlying value of ASN1_TIME isn't NULL. [ruby-core:01881]
+
+Thu Dec 4 08:29:43 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * lib/webrick/server.rb (GenericServer#start): should rescue
+ Exception to avoid unexpected aborting. [ruby-core:01853]
+
+ * lib/webrick/server.rb (GenericServer#start_thread): should check
+ that peeraddr isn't nil before printing.
+
+ * lib/webrick/httpresponse.rb (HTTPResponse#start_thread): should
+ rescue Exception to avoid unexpected aborting of thread.
+
+Thu Dec 4 03:48:59 2003 Tanaka Akira <akr@m17n.org>
+
+ * lib/pathname.rb (Pathname#link, Pathname#symlink): obsoleted.
+ (Pathname#make_link, Pathname#make_symlink): new method.
+
+Thu Dec 4 01:45:24 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * io.c (argf_read): should not terminate on empty string; wait
+ until real EOF. [ruby-dev:21969]
+
+ * io.c (argf_read): should adjust length to read, when length is
+ specified and read spans command line argument files.
+
+Wed Dec 3 19:38:36 2003 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+
+ * lib/drb/drb.rb: correct fcntl parameter. [ruby-dev:22120]
+
+Wed Dec 3 13:49:07 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tk/lib/tk.rb: 'format'==>'Kernel.format' (avoid override trouble)
+
+ * ext/tk/lib/tkafter.rb: ditto.
+
+ * ext/tk/lib/tkcanvas.rb: ditto.
+
+ * ext/tk/lib/tkdialog.rb: ditto.
+
+ * ext/tk/lib/tktext.rb: ditto.
+
+Wed Dec 3 13:28:13 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * Makefile.in (lex.c): try gperf first, and copy from the source
+ directory if failed. [ruby-dev:22123]
+
+ * ext/extmk.rb (MTIMES): let makefiles depend to mkmf.rb.
+
+ * lib/mkmf.rb (configuration): DLDFLAGS was duplicated.
+
+Tue Dec 2 23:18:12 2003 Minero Aoki <aamine@loveruby.net>
+
+ * lib/net/http.rb: wrote the warning about HTTP_PROXY environment
+ variable.
+
+Tue Dec 2 21:31:42 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * bin/testrb: new test runner. [ruby-core:01845]
+
+ * lib/test/unit/autorunner.rb (Test::Unit::AutoRunner.run,
+ Test::Unit::AutoRunner#process_args): take test list to run and
+ options.
+
+ * lib/test/unit/autorunner.rb (Test::Unit::AutoRunner::RUNNERS,
+ Test::Unit::AutoRunner#run): should not exit inside a library,
+ just return the result instead.
+
+ * lib/test/unit.rb: ditto.
+
+ * test/runner.rb: exit with the test result.
+
+Tue Dec 2 20:18:48 2003 Eric Sunshine <sunshine@sunshineco.com>
+
+ * configure.in (AC_PROG_YACC): AC_DEFINE(OLD_YACC) if Yacc is found
+ instead of Bison or byacc.
+
+ * parse.y: If OLD_YACC is defined, ensure that YYMAXDEPTH is at least
+ 10000 (Bison's default) since some old versions of Yacc define it as
+ low as 150 by default, which is too low for Ruby to parse some files,
+ such as date/format.rb. Among other issues, the parse problem causes
+ "make test" to fail.
+
+Tue Dec 2 20:03:20 2003 Minero Aoki <aamine@loveruby.net>
+
+ * test/fileutils/test_fileutils.rb: check if Pathnames are usable
+ for arguments.
+
+Tue Dec 2 04:22:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
+
+ * lib/test/unit/assertions.rb: fixed #assert_no_match message.
+
+ * test/testunit/test_assertions.rb: ditto.
+
+Tue Dec 2 00:43:00 2003 why the lucky stiff <why@ruby-lang.org>
+
+ * ext/syck/syck.c: string buffering bug. decrementing by full
+ max_size now. [ruby-core:01834]
+
+Mon Dec 1 21:33:08 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * numeric.c (num_sadded): prohibit singleton method definition for
+ Numerics. fill yet another gap between Fixnum and Bignum.
+
+Mon Dec 1 17:33:47 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * pack.c (htov16): converts endian using swap16. htov32(), hton16,
+ hton32 as well. [ruby-talk:85377]
+
+ * pack.c (swap16): swap 2 bytes no matter how big short is on the
+ platform. swap32() is also prepared.
+
+ * numeric.c (rb_num2int): returns long to preserve information.
+ rb_fix2int(), rb_num2uint(), rb_fix2uint() as well.
+ [ruby-talk:85377]
+
+ * numeric.c (rb_num2uint): should not check for value range if the
+ source value is negative.
+
+Mon Dec 1 17:14:34 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * sample/optparse/opttest.rb: added.
+
+Mon Dec 1 16:10:52 2003 Dave Thomas <dave@pragprog.com>
+
+ * lib/rdoc/rdoc.rb: (etc) initial merge into main tree.
+
+Mon Dec 1 14:17:49 2003 Minero Aoki <aamine@loveruby.net>
+
+ * lib/fileutils.rb (fu_each_src_dest0): call #to_str to allow
+ Pathname for arguments. [ruby-core:01795]
+
+ * test/fileutils/test_fileutils.rb: does much strict test on
+ "same" files detecting.
+
+Mon Dec 1 09:28:14 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub
+ (XCFLAGS): re-export $(XCFLAGS).
+
+ * bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub
+ (ARCH_FLAG): export $(ARCH_FLAG) (perhaps empty value).
+
+Mon Dec 1 01:03:27 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * lib/mkmf.rb (TRY_LINK, link_command): added support for DLDFLAGS
+ and ARCH_FLAG. [ruby-dev:22085]
+
+Sun Nov 30 20:18:07 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * configure.in: keep ARCH_FLAG separate. export ARCH_FLAG.
+ [ruby-core:01819]
+
+ * Makefile.in: add ARCH_FLAG to CFLAGS.
+
+ * Makefile.in: add @CPPFLAGS@ to CPPFLAGS.
+
+ * lib/mkmf.rb (link_command, cc_command): use ARCH_FLAG.
+
+ * lib/mkmf.rb (configuration): add ARCH_FLAG to DLDFLAGS.
+
+ * Makefile.in: add ARCH_FLAG to DLDFLAGS.
+
+ * configure.in: should put getcwd in AC_CHECK_FUNCS, not
+ AC_REPLACE_FUNCS. [ruby-core:01826]
+
+Sun Nov 30 18:22:48 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * configure.in: do not override CCDLDFLAGS, LDFLAGS, XLDFLAGS,
+ DLDFLAGS and LDSHARED.
+
+ * configure.in: XCFLAGS for compiling ruby itself. ARCH_FLAG is
+ reflected in CFLAGS.
+
+ * lib/mkmf.rb: ditto. do not import XCFLAGS from config.status.
+
+Sun Nov 30 17:37:36 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tk/lib/tk.rb: bug fix [ruby-talk:86746]
+
+Sun Nov 30 13:02:00 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * lib/soap/encodingstyle/soapHandler.rb: refactoring - Simplifying
+ Conditional Expressions.
+
+ * lib/wsdl/soap/definitions.rb: refactoring - Move Method.
+
+ * test/xsd/{test_noencoding.rb,noencoding.xml}: new files. test for
+ encoding unspecified XML file parsing.
+
+ * test/wsdl/{test_fault.rb,map,datetime}: new files. test of
+ SOAPFault, dateTime and Apache's Map.
+
+Sun Nov 30 09:35:14 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * string.c (rb_str_update): get rid of SEGV at just allocated String.
+ [ruby-core:01812]
+
+Fri Nov 28 23:19:34 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * gc.c (gc_mark): explicitly check mark recursion levels, instead
+ of unreliable stack length.
+
+Fri Nov 28 22:49:56 2003 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+
+ * lib/rinda/rinda.rb: fix TupleSpaceProxy#read, read_all.
+
+Fri Nov 28 21:44:40 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * test/fileutils/test_fileutils.rb (test_ln_s): should be a file, not
+ a directory for FreeBSD.
+
+Fri Nov 28 19:37:56 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * hash.c (env_has_value, env_index): must match exactly.
+
+ * test/ruby/test_env.rb (test_has_value, test_index): condition for
+ aboves.
+
+Fri Nov 28 17:59:20 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * test/ruby/test_env.rb: add tests for ENV.
+
+Fri Nov 28 17:47:46 2003 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+
+ * lib/drb/drb.rb (DRbMessage#load): rescue Errno::* and raise
+ DRbConnError.
+
+Fri Nov 28 15:41:15 2003 Tanaka Akira <akr@m17n.org>
+
+ * lib/pathname.rb (Pathname#realpath): obsolete the force_absolute
+ argument.
+
+Fri Nov 28 14:41:52 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * lib/soap/streamHandler.rb: drop unused http parameters.
+
+ * lib/soap/encodingstyle/soapHandler.rb, lib/soap/mapping/factory.rb,
+ lib/soap/mapping/mapping.rb, lib/soap/mapping/registry.rb,
+ lib/wsdl/soap/complexType.rb: ApacheSOAP's map support was broken
+ under WSDL dynanic client environment. fixed.
+
+ * test/wsdl/raa/*: add tests.
+
+ * lib/xsd/datatypes.rb: dateTime precision bug fix (at least, I hope.)
+ bug of soap4r. XSDDateTimeImple.to_time passed a Float to
+ Time.local/Time.gm as an usec, and NUM2LONG(rb_num2long for Float)
+ causes rounding error.
+
+ * test/soap/test_basetype.rb, test/xsd/test_xsd.rb: add tests.
+
+Fri Nov 28 04:15:24 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (method_arity): used wrong Proc object. [ruby-talk:86504]
+
+Fri Nov 28 00:47:29 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (rb_f_exit), process.c (rb_f_exit_bang): treat true as
+ success, false as failure. [ruby-dev:22067]
+
+ * eval.c (rb_f_abort, rb_thread_switch), process.c (rb_f_system): use
+ ANSI macro instead of hard coded value.
+
+ * eval.c (rb_f_exit), process.c (rb_f_exit_bang): use VALUEs not but
+ TYPEs.
+
+Thu Nov 27 22:05:48 2003 Akinori MUSHA <knu@iDaemons.org>
+
+ * eval.c, gc.c: FreeBSD/ia64 currently does not have a way for a
+ process to get the base address for the RSE backing store, so
+ hardcode it for the moment.
+ [submitted by: Marcel Moolenaar <marcel@FreeBSD.org>]
+
+Thu Nov 27 17:36:42 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tk/lib/tkafter.rb: bug fix on TkTimer#cancel_on_exception=(mode).
+ TkTimer#wait recieves the exception of the callback.
+ The exception is kept on @return_value.
+
+Thu Nov 27 16:58:48 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * win32/win32.c (rb_w32_stat): remove _fullpath() for NUL: device.
+
+Wed Nov 26 15:38:47 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * test/fileutils/test_fileutils.rb (test_ln_s): should take the
+ existing symbolic link for OpenBSD.
+
+Wed Nov 26 04:48:42 2003 why the lucky stiff <why@ruby-lang.org>
+
+ * ext/syck/token.c: removed YYTOKTMP references which
+ were causing buffer overflows on large block scalars,
+ comments, quoted scalars and plain scalars.
+
+ * ext/syck/rubyext.c: dynamic changing of buffer size.
+
+ * ext/syck/syck.h: default buffer size of 4k.
+
+Wed Nov 26 00:55:30 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * lib/webrick/httpresponse.rb: add HTTPResponse#keep_alive=.
+
+ * lib/webrick/httpserver.rb (HTTPServer#run): should pass the
+ request's keep_alive flag to the response.
+
+Tue Nov 25 21:41:35 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * defines.h (ENV_IGNORECASE): should define when DOSISH without
+ human68k. [ruby-dev:22047]
+
+ * hash.c (env_has_value, env_index): don't ignore case of value.
+ [ruby-dev:22048]
+
+Tue Nov 25 21:39:37 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * file.c (path_check_1): honor sticky bits always.
+ [ruby-talk:86273]
+
+Tue Nov 25 20:02:14 2003 Minero Aoki <aamine@loveruby.net>
+
+ * test/fileutils/test_fileutils.rb: do test in more deep
+ directory.
+
+ * test/fileutils/test_nowrite.rb: ditto.
+
+Tue Nov 25 19:04:23 2003 Tanaka Akira <akr@m17n.org>
+
+ * lib/open-uri.rb (URI::Generic#find_proxy): ENV case sensitivity test
+ refined.
+
+Tue Nov 25 18:13:30 2003 Minero Aoki <aamine@loveruby.net>
+
+ * test/fileutils/test_fileutils.rb: chdir Dir.tmpdir before each
+ test. [ruby-dev:22045]
+
+ * test/fileutils/test_nowrite.rb: ditto.
+
+Tue Nov 25 17:52:11 2003 Tanaka Akira <akr@m17n.org>
+
+ * lib/open-uri.rb (URI::Generic#find_proxy): use http_proxy under CGI
+ if the environment variable is case sensitive.
+
+Tue Nov 25 16:41:33 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * test/wsdl/multiplefault.wsdl, test/wsdl/test_multiplefault.rb:
+ removed. this test requires extra libraries in soap4r/1.5.*.
+
+Tue Nov 25 16:24:42 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * lib/soap/**/*.rb, lib/wsdl/**/*.rb, lib/xsd/**/*.rb: changed license;
+ GPL2 -> Ruby's.
+
+ * lib/soap/rpc/driver.rb, lib/soap/wsdlDriver.rb,
+ lib/soap/streamHandler.rb: add interface to streamhandler.
+
+ * lib/soap/marshal.rb: raise error if parse fails.
+
+ * lib/soap/netHttpClient.rb: add https support. Patched by
+ Oliver M. Bolzer.
+
+ * lib/soap/netHttpClient.rb: dump HTTP response message body by itself.
+
+ * lib/soap/rpc/driver.rb, lib/soap/rpc/proxy.rb,
+ lib/soap/wsdlDriver.rb: add driver#mandatorycharset interface to foce
+ using charset for parsing response from buggy server.
+
+ * lib/soap/encodingstyle/soapHandler.rb: support Apache Axis's half
+ typed multi-ref array.
+
+ * lib/soap/mapping/factory.rb, lib/soap/mapping/registry.rb: map
+ SOAPStruct which has multi-accessors which name are the same, to an
+ array.
+
+ * lib/soap/rpc/element.rb: fixed illegal parameter order.
+
+ * lib/soap/rpc/element.rb: element name of response message could have
+ the name other than 'return'.
+
+ * lib/wsdl/operation.rb, lib/wsdl/operationBinding.rb,
+ lib/wsdl/soap/classDefCreator.rb, lib/wsdl/soap/methodDefCreator.rb,
+ lib/wsdl/soap/methodDefCreatorSupport.rb: WSDL/1.1 allows plural
+ fault definition in a operation. [ruby-talk:84948]
+
+ * test/wsdl/multiplefault.wsdl, test/wsdl/test_multiplefault.rb: add
+ test for above fix.
+
+ * lib/wsdl/soap/complexType.rb: support WSDL array definition with
+ maxOccures="unbound".
+
+ * lib/xsd/charset.rb: use cp932 under emx. Patched by
+ Siena. / SHINAGAWA, Norihide in [ruby-dev:21972]
+
+ * lib/xsd/xmlparser/parser.rb: set @charset nil by default. Nil means
+ 'follow encoding declaration in XML'.
+
+ * sample/soap/digraph.rb, sample/wsdl/amazon/wsdlDriver.rb,
+ sample/wsdl/googleSearch/sampleClient.rb,
+ sample/wsdl/googleSearch/wsdlDriver.rb,
+ test/wsdl/test_emptycomplextype.rb,
+ test/wsdl/marshal/test_wsdlmarshal.rb,
+ test/xsd/test_xmlschemaparser.rb: use File.open(...) { |f| f.read }
+ instead of File.open(...).read. [ruby-dev:21964]
+
+ * test/wsdl/emptycomplextype.wsdl, test/wsdl/test_emptycomplextype.rb:
+ simplify the test case.
+
+ * test/wsdl/axisArray/*: add tests for axis's array encoding.
+
+Tue Nov 25 16:15:29 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * ruby.h: don't treat Cygwin as Windows.
+
+Tue Nov 25 15:18:28 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * configure.in: change default value of --enable-pthread (default: no)
+
+Tue Nov 25 07:31:16 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * parse.y (primary): allow newlines just before right argument
+ parenthesis. (ruby-bugs:PR#1221)
+
+Mon Nov 24 23:32:06 2003 Tanaka Akira <akr@m17n.org>
+
+ * lib/open-uri.rb (OpenURI.open_loop, URI::HTTP#proxy_open): use
+ catch/throw for redirection instead of exception.
+ (OpenURI.open_loop, OpenURI.redirectable?): restrict redirection.
+
+Mon Nov 24 19:59:48 2003 Tanaka Akira <akr@m17n.org>
+
+ * lib/open-uri.rb (URI::Generic#find_proxy): use CGI_HTTP_PROXY
+ instead of HTTP_PROXY in the CGI environment.
+
+Mon Nov 24 19:32:55 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * ext/etc/extconf.rb: check for pw_passwd in struct passwd and
+ gr_passwd in struct group for DJGPP.
+
+ * ext/etc/etc.c: ditto.
+
+ * ext/Setup.dj: support for curses, etc, zlib.
+
+Mon Nov 24 17:00:00 2003 Tanaka Akira <akr@m17n.org>
+
+ * lib/open-uri.rb: validate option names.
+ :content_length_proc and :progress_proc option implemented.
+
+Mon Nov 24 14:53:10 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub
+ (XCFLAGS): output empty value instead of `-DRUBY_EXPORT'.
+
+Sat Nov 22 23:09:45 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * configure.in: set enable_pthread to no on MinGW.
+
+Sat Nov 22 22:56:20 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * configure.in: add --enable-pthread option (default: yes)
+
+Sat Nov 22 22:48:46 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tk/lib/tk.rb: add Tk.grab_release and fix bug of TkComposite
+
+ * ext/tk/lib/tkafter.rb: bug fix of TkAfter#start
+
+ * ext/tk/sample/tkcombobox.rb: new sample script
+
+ * ext/tcltklib/tcltklib.c: add native thread check
+
+Sat Nov 22 18:49:47 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * ext/curses/curses.c (window_nodelay): nodelay() of NetBSD's
+ libcruses returns no value, just like keypad().
+
+Sat Nov 22 17:36:36 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub
+ (HAVE_GETCWD): output to config.h.
+
+ * bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub
+ (XCFLAGS): output to config.status.
+
+Sat Nov 22 13:10:10 2003 Minero Aoki <aamine@loveruby.net>
+
+ * lib/fileutils.rb (have_st_ino?): djgpp has valid st_ino.
+
+Sat Nov 22 11:28:48 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * gc.c (Init_stack): stack region is far smaller than usual if
+ pthread is used.
+
+Sat Nov 22 07:30:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
+
+ * lib/test/unit/util/backtracefilter.rb: fixed a bug that occurred
+ when an exception had no backtrace.
+
+ * test/testunit/util/test_backtracefilter.rb: ditto.
+
+Fri Nov 21 16:44:18 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tk/lib/tkentry.rb: fix the encoding trouble of percent
+ substitutions on validatecommand option of TkEntry widget
+
+ * ext/tk/lib/tk.rb: fix bug on {pack|grid}_propagate() method
+
+Fri Nov 21 16:12:11 2003 Akinori MUSHA <knu@iDaemons.org>
+
+ * ruby.1: Fix markups and grammar.
+
+Fri Nov 21 14:49:42 2003 Minero Aoki <aamine@loveruby.net>
+
+ * ruby.1: wrote about ruby related environment variables.
+
+Fri Nov 21 12:28:03 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * marshal.c (w_extended): singleton methods should not be checked
+ when dumping via marshal_dump() or _dump(). [ruby-talk:85909]
+
+Fri Nov 21 01:40:00 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * configure.in: check <pthread.h>
+
+ * ruby.h: include pthread.h if existence.
+ define is_ruby_native() macro when not HAVE_NATIVETHREAD
+
+ * eval.c: undef is_ruby_native() function when not HAVE_NATIVETHREAD
+
+Fri Nov 21 00:43:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
+
+ * lib/test/unit/assertions.rb: use #__send__ instead of #send.
+
+ * lib/test/unit/testcase.rb: ditto.
+
+Thu Nov 20 19:19:22 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * configure.in: don't find the Cygwin's pthread library on MinGW.
+
+Thu Nov 20 19:15:50 2003 Minero Aoki <aamine@loveruby.net>
+
+ * lib/fileutils.rb (have_st_ino?): emx (OS/2 with EMX) does not
+ have st_ino (always 0). [ruby-dev:21972]
+
+ * lib/fileutils.rb (rename_cannot_overwrite_file?): emx does not
+ allow overwriting files by rename(2).
+
+ * test/fileutils/test_fileutils.rb: windows? ->
+ have_drive_letter?, have_file_perm?
+
+Thu Nov 20 17:50:58 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tk/sample/tkballoonhelp.rb: new sample script
+
+ * ext/tk/sample/tkmultilistbox.rb: ditto
+
+ * ext/tk/sample/tktextframe.rb: ditto
+
+Thu Nov 20 13:37:34 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ruby.h: define is_ruby_native_thread() for no native thread
+ environment
+
+ * eval.c: ditto
+
+Thu Nov 20 12:42:47 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * configure.in: always check existence of the pthread library
+
+ * ruby.h: define macros for ruby's native thread check
+
+ * eval.c: add ruby's native thread check
+
+ * gc.c: ditto
+
+Wed Nov 19 14:45:18 2003 Minero Aoki <aamine@loveruby.net>
+
+ * lib/net/http.rb (to_ary): print more friendly warning message.
+
+Wed Nov 19 14:32:08 2003 Minero Aoki <aamine@loveruby.net>
+
+ * lib/fileutils.rb (fu_same?): add djgpp and wince.
+
+ * lib/fileutils.rb (cannot_overwrite_file?): add wince.
+
+Wed Nov 19 11:04:47 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * lib/fileutils.rb (cannot_overwrite_file?, have_st_ino?): bccwin32
+ is same as mswin32.
+
+Wed Nov 19 07:54:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
+
+ * lib/test/unit.rb: do not run tests if $! is set.
+
+ * lib/test/unit/assertionfailederror.rb: extend StandardError instead
+ Exception (irb catches the former but not the latter).
+
+Tue Nov 18 23:31:36 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * missing/memmove.c (memmove): take void *, not char *.
+
+ * missing.h (memmove): ditto.
+
+ * missing.h (strchr, strrchr): return char *, not int.
+
+Tue Nov 18 22:20:10 2003 Minero Aoki <aamine@loveruby.net>
+
+ * lib/fileutils.rb (fu_same?): temporal fix for windows.
+
+Tue Nov 18 19:05:04 2003 Minero Aoki <aamine@loveruby.net>
+
+ * lib/fileutils.rb (fu_same?): check by inode instead of path
+ name, to detect two hard links pointing to the same content.
+
+ * test/fileutils.rb: did not create correctly looped symlinks.
+
+Tue Nov 18 18:23:05 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/stringio/stringio.c (strio_read): behave as IO at empty string.
+ [ruby-dev:21939], [ruby-dev:21941]
+
+ * ext/stringio/stringio.c (strio_getc, strio_getline): set EOF flag.
+
+ * ext/stringio/stringio.c (strio_rewind, strio_seek, strio_ungetc):
+ clear EOF flag.
+
+ * test/stringio/test_stringio.rb: imported from [ruby-dev:21941].
+
+Tue Nov 18 14:06:35 2003 Minero Aoki <aamine@loveruby.net>
+
+ * lib/fileutils.rb (fu_each_src_dest): raise if src==dest.
+ [ruby-talk:85344] [ruby-core:01699]
+
+ * lib/fileutils.rb: use Object#is_a? instead of Class#=== to allow
+ e.g. remote objects for receivers.
+
+ * lib/fileutils.rb: FileTest -> File.
+
+ * lib/fileutils.rb: put parentheses for arguments of File.xxxx?
+
+ * test/fileutils/test_fileutils.rb (test_cp): test "cp a a".
+
+ * test/fileutils/test_fileutils.rb (test_mv): test "mv a a".
+
+ * test/fileutils/test_fileutils.rb (test_ln): test "ln a a".
+
+ * test/fileutils/test_fileutils.rb (test_ln_s): test "ln_s a a".
+
+ * test/fileutils/test_fileutils.rb (test_install): test "install a a".
+
+ * test/fileutils/fileasserts.rb: new method assert_symlink.
+
+ * test/fileutils/fileasserts.rb: assert_is_directory -> assert_directory.
+
+Mon Nov 17 19:38:49 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * file.c (getcwdofdrv): avoid using getcwd() directly, use
+ my_getcwd() instead.
+
+ * merged NeXT, OpenStep, Rhapsody ports patch from Eric Sunshine
+ <sunshine@sunshineco.com>. [ruby-core:01596]
+
+Mon Nov 17 10:50:27 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * lib/optparse.rb (OptionParser::Completion::complete): allow least
+ common completion for three or more candidates.
+
+Mon Nov 17 09:41:38 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * lib/test/unit/ui/tk/testrunner.rb,
+ lib/test/unit/ui/gtk/testrunner.rb:
+ run GUI main loop in sub thread.
+
+ * lib/test/unit/ui/gtk2/testrunner.rb: imported from rough.
+
+ * lib/test/unit/autorunner.rb (keyword_display): sort keywords.
+
+Sun Nov 16 18:10:57 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (rb_eval): iterator should return value from next inside
+ begin/rescue/end. (ruby-bugs:PR#1218)
+
+Sun Nov 16 13:26:07 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * marshal.c (w_object): LINK check earlier than anything else,
+ i.e. do not dump TYPE_IVAR for already dumped objects.
+ (ruby-bugs:PR#1220)
+
+ * eval.c (rb_eval): call "inherited" only when a new class is
+ generated; not on reopening.
+
+ * eval.c (eval): prepend error position in evaluating string to
+ "mesg" attribute string only when it's available and is a
+ string.
+
+Sun Nov 16 12:16:10 2003 Minero Aoki <aamine@loveruby.net>
+
+ * lib/net/protocol.rb: logging response body. [experimental]
+ [ruby-list:38800]
+
+Sun Nov 16 10:49:38 2003 Gavin Sinclair <gsinclair@soyabean.com.au>
+
+ * lib/thread.rb (Thread.exclusive): wrap method definition in
+ class Thread to enable rdoc to process.
+
+Sun Nov 16 09:45:23 2003 Minero Aoki <aamine@loveruby.net>
+
+ * lib/net/http.rb (set_debug_output): warn if method is called
+ after #start. [ruby-dev:38798]
+
+Sun Nov 16 04:41:33 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (eval): do not re-raise exception to avoid unnecessary
+ exception copying, instead modify exception and internal
+ information to adjust eval().
+
+ * eval.c (backtrace): can return the current frame information
+ only if lev < -1.
+
+Sat Nov 15 22:16:42 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * /ext/openssl/ossl_x509ext.c (ossl_x509extfactory_create_ext):
+ refine error message.
+
+Sat Nov 15 10:05:40 2003 Tanaka Akira <akr@m17n.org>
+
+ * lib/open-uri.rb (OpenURI.open_loop, OpenURI::HTTP#proxy_open):
+ refactored to support options.
+ (Buffer): maintain size by this class.
+
+Sat Nov 15 07:40:14 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_method_node): new API to retrieve method body.
+
+Fri Nov 14 13:21:30 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tcltklib/tcltklib.c: fix (en-bugged at 2003/11/07)
+
+ * ext/tk/lib/tkdialog.rb: TkDialog.new accepts a parent widget
+ argument [ruby-talk:85066]
+
+Thu Nov 13 20:53:35 2003 Tanaka Akira <akr@m17n.org>
+
+ * lib/open-uri.rb (Kernel[#.]open): hard coded URI schemes removed.
+ [ruby-ext:02251]
+
+Thu Nov 13 19:17:00 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * lib/test/unit/ui/tk/testrunner.rb: use grid and panedwindow
+ (if available)
+
+Thu Nov 13 17:56:41 2003 Tanaka Akira <akr@m17n.org>
+
+ * lib/open-uri.rb (OpenURI.open_uri): use File::RDONLY.
+ reported by Take_tk <ggb03124@nifty.ne.jp>.
+ [ruby-ext:02245]
+
+Thu Nov 13 16:45:53 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * ext/openssl/ossl_x509req.c (ossl_x509req_to_der): add function for
+ X509::Request#to_der.
+
+Thu Nov 13 11:31:14 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * lib/optparse.rb (OptionParser::Completion#complete): prior shorter
+ name to containing longer name.
+
+Thu Nov 13 06:08:54 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tk/lib/tk.rb: stop freezing some classes
+
+ * ext/tk/lib/multi-tk.rb: ditto.
+
+Wed Nov 12 17:32:49 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * lib/test/unit/assertions.rb (assert_throws, assert_nothing_thrown):
+ uncaught throw in sub thread raises ThreadError.
+
+ * lib/test/unit/ui/tk/testrunner.rb (setup_ui): "expand" is not
+ necessary.
+
+Wed Nov 12 14:09:43 2003 Shugo Maeda <shugo@ruby-lang.org>
+
+ * test/monitor/test_monitor.rb: fix the timing problem by Queue.
+
+Wed Nov 12 12:59:44 2003 Shugo Maeda <shugo@ruby-lang.org>
+
+ * test/monitor/test_monitor.rb: added.
+
+Wed Nov 12 10:14:28 2003 Shugo Maeda <shugo@ruby-lang.org>
+
+ * lib/monitor.rb: refactored. Thanks, Gennady Bystritsky.
+
+Wed Nov 12 06:11:39 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * ext/openssl/ossl.c (ossl_x509_sk2ary, ossl_x509crl_sk2ary):
+ add functions to convert STACK into Array.
+
+ * ext/openssl/ossl.h: add prototypes.
+
+ * ext/openssl/ossl_pkcs7.c (ossl_pkcs7_set_certificates,
+ ossl_pkcs7_get_certificates, ossl_pkcs7_get_crls,
+ ossl_pkcs7_set_crls): add functions for PKCS7#certificates=
+ PKCS7#certificates, PKCS7#crls= and PKCS7#crls.
+
+Wed Nov 12 00:47:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
+
+ * lib/test/unit/ui/testrunnermediator.rb: should require 'test/unit'.
+
+Tue Nov 11 23:54:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
+
+ * lib/test/unit/ui/gtk/testrunner.rb: added a rescue clause to handle
+ the case when the requested font is not available.
+
+Tue Nov 11 22:44:08 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * io.c (appendline): file may not end with newline. a bug if
+ READ_DATA_PENDING_PTR is defined. [ruby-talk:84925]
+
+Tue Nov 11 10:42:41 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tk/lib/tk.rb: raise an exception when creating TkWindow
+ object, because TkWindow class is an abstract class.
+
+Tue Nov 11 03:30:43 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * lib/ext/openssl/ossl_conf.c (ossl_config_get_value): return nil
+ if the specified value doesn't exist.
+
+ * lib/ext/openssl/ossl_conf.c (ossl_config_get_section): return
+ a empty hash if the specified section doesn't exist.
+
+Mon Nov 10 11:40:29 2003 Shugo Maeda <shugo@ruby-lang.org>
+
+ * lib/monitor.rb (wait): return true on signal/broadcastfalse and
+ false on timeout. Thanks Gennady Bystritsky.
+
+Mon Nov 10 00:07:10 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * parse.y (primary): primary_value may be 0 when syntax error.
+ [ruby-talk:84893]
+
+Sun Nov 9 02:05:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
+
+ * lib/test/unit/assertions.rb: un-deprecated #assert_not_nil to
+ maintain symmetry with #assert_nil. Also added better output for
+ #assert_kind_of.
+
+ * test/testunit/tc_assertions.rb: ditto.
+
+Sat Nov 8 18:50:20 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * test/wsdl/raa/*: add new testcase for WSDL loading, parsing and
+ reading.
+
+ * test/soap/marshal/*: backport from soap4r/1.5.1. all differences are
+ for ruby/1.6.
+
+ * lib/soap/*: backport from soap4r/1.5.1. all differences are for
+ ruby/1.6.
+
+ * lib/wsdl/data.rb, lib/wsdl/xmlSchema/data.rb: move definition of
+ ArrayTypeAttrName from ::WSDL::XMLSchema::* to ::WSDL::*.
+ [ruby-talk:84813]
+
+ * lib/wsdl/soap/definitions.rb: element name typo in custom exception
+ struct definition which is needed for wsdlDriver; camelCase ->
+ underscore_name.
+
+Sat Nov 8 13:49:50 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * configure.in: improvement of pthread check
+
+Sat Nov 8 13:28:46 2003 Takaaki Tateishi <ttate@ttsky.net>
+ * ext/dl/sym.c: Add DL.win32_last_error and DL.last_error.
+ Thanks, Kaoru Shirai.
+
+Sat Nov 8 06:19:38 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tcltklib/tcltklib.c: To fix 'pthread-enabled Tcl/Tk' problem,
+ TclTkIp#_eval calls Tcl_Eval() on the mainloop thread only
+ (queueing a handler to the EventQueue).
+
+ * ext/tcltklib/README.1st: edit the description of '--with-pthread-ext'
+
+Fri Nov 7 23:23:04 2003 Tanaka Akira <akr@m17n.org>
+
+ * lib/pathname.rb (Pathname#+): if self or the argument is `.', return
+ another.
+ (Pathname#parent): if self is `.', return `..'.
+ (Pathname#children): if self is `.', don't prepend self for a
+ pathname in a result.
+ (Pathname#join): re-implemented using Pathname#+.
+ (Pathname#find): if self is `.', remove `./' prefix of yielding
+ pathname.
+
+Fri Nov 7 10:23:24 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/socket/socket.c (make_hostent): get rid of SEGV on aliases
+ lookup failure. (ruby-bugs:PR#1215)
+
+Fri Nov 7 04:08:05 2003 UENO Katsuhiro <katsu@blue.sky.or.jp>
+
+ * ext/zlib/zlib.c (Init_zlib): define Zlib::GzipReader#each_line as
+ an alias of Zlib::GzipReader#each.
+
+Fri Nov 7 01:03:16 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_load): save and restore rb_prohibit_interrupt.
+ [ruby-dev:21857]
+
+Thu Nov 6 18:05:07 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * io.c (rb_io_inspect): show the path also at a closed file.
+ [ruby-dev:21851]
+
+Thu Nov 6 11:42:07 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/stringio/stringio.c (strio_set_string, strio_reopen): check
+ tainted.
+
+ * ext/stringio/stringio.c (strio_copy, strio_ungetc, strio_write,
+ strio_putc): add infection.
+
+ * ext/stringio/stringio.c (strio_path): just nil. [ruby-dev:21846]
+
+ * ruby.c (proc_options): reserve searched script path in the
+ source file name table. [ruby-list:38765]
+
+ * lib/optparse.rb (OptionParser::Completion#complete): default not to
+ ignore case on completion. [ruby-talk:84726]
+
+ * win32/win32.c (make_cmdvector): process backslashes even if a quote
+ is not enclosed.
+
+Wed Nov 5 23:49:45 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * sample/openssl/gen_csr.rb: there (at least) is a CA which does not
+ accept DN in UTF8STRING format. it's a sample.
+
+Wed Nov 5 22:55:16 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * configure.in, eval.c, signal.c: : add '--with-pthread-ext'
+ option to fix the pthread trouble on 'tcltklib'
+
+ * ext/tcltklib/README.1st: add the description of '--with-pthread-ext'
+
+ * ext/tk/lib/tktext.rb : add TkText#text_copy, text_cut, text_paste
+ to support Tcl/Tk8.4's tk_textCopy, tk_textCut, tk_textPaste
+
+ * ext/tk/lib/tk.rb : add TkMenu#set_focus support Tcl/Tk's
+ tk_menuSetFocus
+
+Wed Nov 5 17:33:45 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_load): allow interrupt during loaded program
+ evaluation. [ruby-dev:21834]
+
+ * hash.c (rb_hash_fetch): always warn if default argument and a
+ block are supplied at the same time. [ruby-dev:21842]
+
+ * hash.c (env_fetch): ditto.
+
+ * array.c (rb_ary_fetch): ditto.
+
+Wed Nov 5 19:08:47 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * lib/optparse.rb (OptionParser::Switch::PlacedArgument::parse):
+ do not remove next argument if empty value is placed.
+
+ * test/optparse: added.
+
+Wed Nov 5 17:05:18 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * lib/test/unit/ui/gtk/testrunner.rb: typo.
+
+Wed Nov 5 11:13:32 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * string.c: add #include "version.h". this file still depends on it.
+
+ * Makefile.in, bcc32/Makefile.sub, win32/Makefile.sub,
+ wince/Makefile.sub: add version.h dependency to string.c.
+
+Wed Nov 5 09:14:23 2003 Shugo Maeda <shugo@ruby-lang.org>
+
+ * lib/monitor.rb: revert to the previous revision.
+
+Wed Nov 5 08:39:51 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * lib/webrick/https.rb (HTTPRequest#parse): set @client_cert_chain.
+
+ * lib/webrick/https.rb (HTTPRequest#meta_vars): create
+ SSL_CLIENT_CERT_CHAIN_n from @client_cert_chain.
+
+ * ext/openssl/ossl_ssl.c (ossl_ssl_get_peer_cert_chain): return nil
+ if no cert-chain was given.
+
+Tue Nov 4 23:44:48 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub:
+ remove needless version.h dependency.
+
+Tue Nov 4 23:38:43 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * class.c, hash.c, string.c: remove #include "version.h".
+
+ * Makefile.in: remove needless version.h dependency.
+
+Tue Nov 4 06:54:52 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * io.c (read_all): fptr->f may be NULL, if IO is closed in the
+ signal handler.
+
+ * io.c (io_read): ditto.
+
+ * string.c (get_pat): remove 1.8.0 warning code.
+
+ * string.c (rb_str_match): extend warning until 1.8.2.
+
+ * string.c (rb_str_match2): ditto.
+
+ * class.c (class_instance_method_list): remove 1.8.0 warnings.
+ method_list now recurs. [ruby-dev:21816]
+
+ * class.c (rb_obj_singleton_methods): ditto.
+
+ * array.c (rb_ary_select): remove select with block.
+ [ruby-dev:21824]
+
+ * hash.c (rb_hash_select): ditto.
+
+ * hash.c (env_select): ditto.
+
+ * re.c (match_select): ditto.
+
+ * struct.c (rb_struct_select): ditto.
+
+Mon Nov 3 22:53:21 2003 Minero Aoki <aamine@loveruby.net>
+
+ * lib/racc/parser.rb: synchronize with Racc 1.4.4.
+
+ * ext/racc/cparse/cparse.c: ditto.
+
+ * ext/racc/cparse/cparse.c (parse_main): should abort when
+ the length of LR state stack <=1, not ==0.
+
+Mon Nov 3 08:50:47 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * process.c (check_uid_switch): remove duplicated error messages.
+
+ * process.c (check_gid_switch): ditto.
+
+Sun Nov 2 02:28:33 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * lib/webrick/ssl.rb: new option :SSLExtraChainCert.
+
+Sun Nov 2 01:02:04 2003 Akinori MUSHA <knu@iDaemons.org>
+
+ * string.c (rb_str_hash): Update the HASH_PERL alternative hash
+ algorithm in sync with Perl 5.8.
+
+ * st.c (strhash): Ditto.
+
+Sat Nov 1 18:21:09 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * ext/openssl/ossl_ssl.c (ossl_ssl_peer_cert_chain): add new method
+ SSLSocket#peer_cert_chain.
+
+ * ext/openssl/ossl_x509req.c (GetX509ReqPtr): new function
+ which returns underlying X509_REQ.
+
+ * ext/openssl/ossl_x509ext.c (ossl_x509extfactory_set_issuer_cert,
+ ossl_x509extfactory_set_subject_cert, ossl_x509extfactory_set_crl,
+ ossl_x509extfactory_set_subject_req, ossl_x509extfactory_set_config):
+ use underlying C struct without duplication not to leak momory.
+
+Sat Nov 1 01:49:03 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * lib/soap/mapping/factory.rb: mark marshalled basetype objects when
+ @allow_original_mapping is true. multi-referencing basetype node is
+ prohibited in SOAP/1.1 encoding but soap4r's original ruby object
+ mapping requires basetype to be marked to detect self referencing
+ loop. e.g. o = 1; o.instance_eval { @iv = o } soap4r's original
+ mapping is only used through soap/marshal API.
+
+ * test/soap/marshal/test_marshal.rb: add tests for self referencing
+ immutable objects.
+
+ * test/soap/calc/test_calc_cgi.rb: fix test name.
+
+Fri Oct 31 22:26:29 2003 Takaaki Uematsu <uema2x@jcom.home.ne.jp>
+
+ * wince/string_wce.c (strrchr): should decrement pointer.
+
+ * wince/Makefile.sub: correct a range of isdigit().
+
+Fri Oct 31 12:55:24 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * configure.in, lib/mkmf.rb: add RPATHFLAG for NetBSD.
+ [ruby-dev:21791]
+
+ * bcc32/Makefile.sub, win32/Makefile.sub, win32/Makefile.sub: ditto.
+
+Fri Oct 31 01:38:14 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * wince/Makefile.sub, win32/Makefile.sub (.y.c): allow white spaces
+ at the beginning of line to remove by sed. (ruby-bugs-ja:PR#580)
+
+Fri Oct 31 01:02:24 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * compar.c (cmp_equal): protect exceptions from <=> comparison
+ again. returns nil if any exception or error happened during
+ comparison.
+
+ * eval.c (search_required): should update *featurep when DLEXT2 is
+ defined. (ruby-bugs-ja:PR#581)
+
+Thu Oct 30 23:41:04 2003 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+
+ * lib/drb/drb.rb: add DRbArray
+
+ * lib/drb/invokemethod.rb: fix Hash#each problem. [ruby-dev:21773]
+
+ * lib/drb/unix.rb: add LoadError. [ruby-dev:21743]
+
+Thu Oct 30 23:19:11 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * lib/soap/generator.rb: better XML pretty printing.
+
+ * lib/soap/encodingstyle/soapHandler.rb: remove unnecessary namespace
+ assignment in the element which has "encodingStyle" attribute, and
+ add necessary namespace assignment for "arrayType" attribute.
+
+ * test/soap/calc/test_calc_cgi.rb: take over $DEBUG to ruby process
+ through CGI.
+
+Thu Oct 30 22:59:39 2003 why the lucky stiff <why@ruby-lang.org>
+
+ * ext/syck/yaml2byte.c: HASH const too long. Thanks, matz.
+
+Thu Oct 30 19:13:53 2003 Akinori MUSHA <knu@iDaemons.org>
+
+ * ext/syck/MANIFEST: Add yamlbyte.h.
+
+Thu Oct 30 14:25:31 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * io.c (READ_DATA_BUFFERED): new macro to detect whether stdio
+ buffer filled.
+
+ * io.c (rb_io_fptr_cleanup): move path deallocation to
+ rb_io_fptr_finalize (finalizer called by GC).
+
+Thu Oct 30 13:23:39 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * parse.y (logop): left may be NULL. [ruby-talk:84539]
+
+ * eval.c (rb_eval): NODE_CASE nd_head may be NULL.
+
+Thu Oct 30 10:14:51 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * lib/test/unit/autorunner.rb: make fox runner work.
+
+Thu Oct 30 09:32:26 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * process.c (rb_f_system): fixed lack of security check before
+ calling do_spawn() on win32. [ruby-talk:84555]
+
+Thu Oct 30 02:46:35 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (proc_invoke): single array value to normal Proc#call
+ (i.e. not via lambda call), should be treated just like yield.
+ [ruby-dev:21726]
+
+Thu Oct 30 02:25:48 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * ext/openssl/lib/openssl/buffering.rb (Buffering#initialize):
+ add new method to inherit @sync from @io.sync.
+
+ * ext/openssl/lib/net/protocols.rb (SSLIO#ssl_connect): no need to
+ set sync flag explicitly.
+
+ * ext/openssl/ossl_ssl.c (ossl_sslctx_initialize): call super.
+
+ * ext/openssl/ossl_ssl.c (ossl_sslctx_setup): set extra chain
+ certificates in @extra_chain_cert.
+
+Wed Oct 29 22:02:04 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * test/drb/drbtest.rb: use rbconfig.rb to make the path of ruby
+ interpreter to exec, instead of test/ruby/envutil.rb,
+
+Wed Oct 29 19:58:59 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * ext/tcltklib/tcltklib.c (CONST84): define CONST84 when it is not
+ defined and TCL_MAJOR_VERSION >= 8.
+
+ * ext/tcltklib/tcltklib.c (VwaitVarProc, WaitVariableProc,
+ rb_threadVwaitProc): use CONST84 instead of CONST.
+
+ * ext/tcltklib/tcltklib.c (ip_rbTkWaitCommand,
+ ip_rb_threadTkWaitCommand): use CONST84 always.
+
+Wed Oct 29 17:27:05 2003 Tanaka Akira <akr@m17n.org>
+
+ * re.c (rb_reg_s_union, Init_Regexp): new method `Regexp.union'.
+
+ * lib/pathname.rb (realpath): examine Dir.pwd because it may have
+ symlinks.
+
+Wed Oct 29 17:16:31 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (rb_longjmp): must not disturb original jump.
+ [ruby-dev:21733]
+
+Wed Oct 29 15:28:34 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (Init_Proc): taint preallocated exception object
+ sysstack_error. [ruby-talk:84534]
+
+Wed Oct 29 11:27:39 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * parse.y (ret_args): node may be NULL. [ruby-talk:84530]
+
+Tue Oct 28 15:20:12 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * ext/tcltklib/tcltklib.c (VwaitVarProc, ip_rbVwaitObjCmd,
+ WaitVariableProc, WaitVisibilityProc, WaitWindowProc,
+ ip_rbTkWaitObjCmd, ip_rbTkWaitCommand, rb_threadVwaitProc,
+ rb_threadWaitVisibilityProc, rb_threadWaitWindowProc,
+ ip_rb_threadVwaitObjCmd, ip_rb_threadTkWaitObjCmd): prototype;
+ avoid VC++ warnings.
+
+Mon Oct 27 19:19:55 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (rb_longjmp): ignore reentering error while warning.
+ [ruby-dev:21730]
+
+Mon Oct 27 00:23:50 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tcltklib/tcltklib.c (ip_ruby): bug fix on Win : hang-up when
+ calling 'exit' in the Tk callback procedure. [ruby-list:38656]
+
+Sat Oct 25 09:18:04 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_method_missing): protect exception from within
+ "inspect". (ruby-bugs:PR#1204)
+
+Fri Oct 24 23:26:34 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * hash.c (rb_hash_each): Hash#each should yield single value.
+ [ruby-talk:84420]
+
+ * hash.c (env_each): ditto for ENV.each.
+
+Thu Oct 23 20:25:32 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * lib/webrick/server.rb (GenericServer#start): should rescue
+ IOError from IO::accept. [ruby-dev:21692]
+
+Thu Oct 23 17:59:36 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (ruby_cleanup): initialize stack bottom for embedding.
+ [ruby-dev:21686]
+
+ * ext/dl/extconf.rb: move list of files to clean from DEPEND file,
+ to get rid of macro redefinitions.
+
+Thu Oct 23 13:44:00 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * parse.y: integrate operations for stack_type. [ruby-dev:21681]
+
+Thu Oct 23 00:41:45 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * test/soap/calc/*, test/soap/helloworld/*: set logging threshold
+ to ERROR.
+
+Wed Oct 22 12:53:31 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * lib/test/unit/collector/dir.rb (Test::Unit::Collector::Dir#collect_file):
+ ignore tests which raised LoadError.
+
+ * test/drb/drbtest.rb, test/ruby/test_beginendblock.rb,
+ test/ruby/test_system.rb: avoid requiring same file twice.
+
+ * test/drb/test_drbssl.rb, test/drb/test_drbunix.rb: should not use
+ ARGV unless invoked directly. do not create test cases unless
+ required libraries are available.
+
+Wed Oct 22 02:31:34 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (ruby_cleanup): should not ignore exit_value in END
+ execution. [ruby-dev:21670]
+
+Tue Oct 21 23:16:26 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (ruby_cleanup): call finalizers and exit procs before
+ terminating threads.
+
+ * eval.c (ruby_cleanup): preserve ruby_errinfo before ruby_finalize_0().
+
+Tue Oct 21 15:57:11 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * lib/test/unit/collector/dir.rb (Test::Unit::Collector::Dir#collect_file):
+ prepend the directory of target file to the load path.
+
+Tue Oct 21 15:08:53 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * win32/win32.c (do_spawn, do_aspawn): should wait child process even
+ if callded with P_OVERLAY.
+
+ * win32/win32.c (do_spawn, do_aspawn): should return child's exit
+ status to parent.
+
+Tue Oct 21 00:35:02 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * test/soap/calc/*, test/soap/helloworld/*: catch the exception from
+ test server thread and recover.
+
+Tue Oct 21 00:22:57 2003 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+
+ * test/drb/*: import drb/runit.
+
+Mon Oct 20 23:55:47 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (rb_eval): set current node after arguments evaluation.
+ [ruby-dev:21632]
+
+ * eval.c (rb_yield_0): set current node and keep it at local jump.
+
+Mon Oct 20 22:01:18 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (rb_thread_cleanup): keep thread group for main thread.
+ [ruby-dev:21644]
+
+Mon Oct 20 18:28:10 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (rb_catch): backout.
+
+Mon Oct 20 17:31:46 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (PUSH_FRAME): generate unique number to be TAG_JUMP()
+ destination.
+
+ * eval.c (localjump_destination): use unique number in ruby_frame
+ for localjump destination.
+
+Mon Oct 20 11:31:44 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * test/ruby/test_signal.rb (test_signal): restore old trap.
+
+Mon Oct 20 11:00:46 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * gc.c (gc_sweep): loosen page free condition to avoid add_heap()
+ race condition. [ruby-dev:21633]
+
+ * gc.c (gc_sweep): do not update malloc_limit when malloc_increase
+ is smaller than malloc_limit.
+
+Mon Oct 20 09:45:12 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * lib/debug.rb (debug_command): remove debug print.
+
+Sun Oct 19 13:12:30 2003 Tanaka Akira <akr@m17n.org>
+
+ * lib/pathname.rb (foreachline, dir_foreach): add obsolete warning.
+
+Sun Oct 19 00:14:22 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * test/soap/calc/*, test/soap/helloworkd/*: changed port# of test
+ server. (17171)
+
+Sat Oct 18 23:01:32 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * missing/acosh.c (DBL_MANT_DIG): typo fix(ifdef -> ifndef).
+
+Sat Oct 18 05:48:59 2003 why the lucky stiff <why@ruby-lang.org>
+
+ * ext/syck/rubyext.c: YAML::Syck::compile method.
+
+ * ext/syck/syck.c: Buffer edge bug.
+
+ * ext/syck/yaml2byte.c: YAML to bytecode converter.
+
+ * ext/syck/yamlbyte.h: Ditto.
+
+ * ext/syck/bytecode.c: Bytecode parser fixes to empty collections
+ and empty strings.
+
+ * ext/syck/token.c: Ditto.
+
+Fri Oct 17 23:07:38 2003 Akinori MUSHA <knu@iDaemons.org>
+
+ * ext/enumerator/enumerator.c, ext/enumerator/enumerator.txt:
+ Provide Kernel#to_enum as an alias for Kernel#enum_for. Maybe
+ this is a better name.
+
+Fri Oct 17 23:00:30 2003 Akinori MUSHA <knu@iDaemons.org>
+
+ * lib/generator.rb: Add rdoc documentation.
+
+Fri Oct 17 22:16:42 2003 Akinori MUSHA <knu@iDaemons.org>
+
+ * lib/set.rb: Reword and fix Overview.
+
+ * lib/set.rb: It is not necessary to require
+ 'test/unit/ui/console/testrunner'.
+
+Fri Oct 17 11:15:22 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * test/ruby/test_range.rb: added.
+
+ * MANIFEST: add test/ruby/test_range.rb.
+
+Fri Oct 17 03:21:23 2003 William Sobel <will.sobel@barra.com>
+
+ * ext/socket/socket.c (make_hostent): h_aliases may be NULL.
+ (ruby-bugs:PR#1195)
+
+ * ext/socket/socket.c (sock_s_gethostbyaddr): ditto.
+
+Fri Oct 17 00:12:41 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tk/lib/tk.rb: (bug fix) instance variable @frame was used
+ without initializing on TkComposite module.
+
+Thu Oct 16 23:51:04 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tk/lib/tk.rb: If $DEBUG == true and some exception is caused
+ in a callback operation, Ruby/Tk shows a (verbose) backtrace
+ information on the callback process.
+
+Thu Oct 16 17:09:19 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * lib/debug.rb (DEBUGGER__::Context::debug_command): do not call
+ debug_silent_eval() when $1 is not set. (ruby-bugs:PR#1194)
+
+Thu Oct 16 16:54:57 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * string.c (rb_str_upto): ("a"..."a").to_a should return [].
+ [ruby-core:01634]
+
+Thu Oct 16 16:40:51 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tk/lib/tk.rb:
+ Add Tk::EncodedString and Tk::UTF8_String class to support
+ characters using the \uXXXX escape to the UNICODE string.
+
+ * ext/tk/sample/{demos-en,demos-jp}/unicodeout.rb
+ new demo-scripts (samples of Tk::UTF8_String)
+
+ * ext/tk/sample/{demos-en,demos-jp}/widget
+ add entries for 'unicodeout.rb'
+
+Thu Oct 16 08:38:06 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * test/digest/test_digest.rb (test_eq): show failed class.
+
+ * test/ruby/test_iterator.rb (test_break, test_return_trace_func):
+ test localjump destination.
+
+Wed Oct 15 20:22:31 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * lib/soap/netHttpClient.rb: use URI::HTTP#request_uri instead of
+ instance_eval('path_query'). [ruby-list:38575]
+
+Wed Oct 15 17:24:45 2003 URABE Shyouhei <root@mput.dip.jp>
+
+ * lib/cgi.rb (CGI::Cookie): tiny typo fix.
+
+Wed Oct 15 15:00:54 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (ruby_run): just return FAILURE instead of parse error
+ count. [ruby-list:38569]
+
+Wed Oct 15 13:17:02 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * ext/digest/digest.c (rb_digest_base_alloc): need to initialize
+ buffer. [ruby-dev:21622]
+
+Wed Oct 15 11:23:05 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * marshal.c (w_object): dump extended modules as well.
+
+ * marshal.c (r_object0): TYPE_USRMARSHAL should restore extended
+ modules before invoking marshal_load. these two fixes are done
+ by Masatoshi Seki <m_seki@mva.biglobe.ne.jp>.
+
+Wed Oct 15 09:30:34 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * ext/enumerator/enumerator.c (enumerator_each): avoid VC++ warning.
+
+ * ext/syck/syck.h: include stdio.h for definition of FILE.
+
+Wed Oct 15 08:09:07 2003 why the lucky stiff <why@ruby-lang.org>
+
+ * ext/syck/bytecode.c: Checkin of YAML bytecode support.
+
+ * ext/syck/gram.c: Ditto.
+
+ * ext/syck/syck.c: Ditto.
+
+ * ext/syck/token.c: Ditto.
+
+ * ext/syck/handler.c: Ditto.
+
+ * ext/syck/handler.c: Now using 'tag' rather than 'taguri' in type URIs.
+
+ * ext/syck/rubyext.c: Ditto (on both counts).
+
+Wed Oct 15 05:05:53 2003 Akinori MUSHA <knu@iDaemons.org>
+
+ * lib/generator.rb: A new library which converts an internal
+ iterator to an external iterator.
+
+ * lib/abbrev.rb: A new library which creates an abbreviation table
+ from a list.
+
+Wed Oct 15 04:31:51 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tk/sample/demos-en/entry3.rb, ext/tk/sample/demos-jp/entry3.rb :
+ new demo-scripts
+
+ * ext/tk/sample/demos-en/widget, ext/tk/sample/demos-jp/widget :
+ add entries for 'entry3.rb'
+
+Wed Oct 15 04:31:47 2003 Akinori MUSHA <knu@iDaemons.org>
+
+ * test/digest/test_digest.rb: Moved from ext/digest/test.rb.
+
+Wed Oct 15 03:53:20 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tk/lib/tk.rb: fixed trouble on auto-load Tcl commands (enbug
+ on the last commit).
+
+Wed Oct 15 00:25:00 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * parse.y (yylex): argument parentheses preceded by spaces should
+ be warned; not error. [ruby-talk:84103]
+
+Wed Oct 15 00:20:15 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tcltklib/tcltklib.c: replace Tcl/Tk's vwait and tkwait to
+ switch on threads smoothly and avoid seg-fault.
+
+ * ext/tcltklib/tcltklib.c: add TclTkIp._thread_vwait and
+ _thread_tkwait for waiting on a thread. (Because Tcl/Tk's vwait
+ and tkwait command wait on an eventloop.)
+
+ * ext/tk/lib/multi-tk.rb: support TclTkIp._thread_vwait and
+ _thread_tkwait.
+
+ * ext/tk/lib/tk.rb: now, TkVariable#wait has 2 arguments.
+ If 1st argument is true, waits on a thread. If false, waits on
+ an eventloop. If 2nd argument is true, checks existence of
+ rootwidgets. If false, doesn't. Default is wait(true, false).
+
+ * ext/tk/lib/tk.rb: add TkVariable#tkwait(arg) which is equal to
+ TkVariable#wait(arg, true). wait_visibility and wait_destroy
+ have an argument for waiting on a thread or an eventloop.
+
+ * ext/tk/lib/tk.rb: improve of accessing Tcl/Tk's special variables.
+
+ * ext/tk/lib/tkafter.rb: support 'wait on a thread' and 'wait on
+ an eventloop'.
+
+Wed Oct 15 00:10:24 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * lib/soap/baseData.rb: Introduce SOAPType as the common ancestor of
+ SOAPBasetype and SOAPCompoundtype.
+
+ * lib/soap/generator.rb, lib/soap/element.rb, lib/soap/encodingstyle/*:
+ Encoding methods signature change. Pass SOAPGenerator as a parameter.
+
+ * lib/soap/mapping/*, test/soap/marshal/test_marshal.rb: Refactoring
+ for better marshalling/unmarshalling support. Now I think SOAP
+ marshaller supports all kind of object graph which is supported by
+ Ruby's original marshaller. Of course there could be bugs as always.
+ Find it. :-)
+
+ * lib/soap/rpc/standaloneServer.rb: Set severity threshould to INFO.
+ DEBUG is too noisy.
+
+ * lib/xsd/datatypes.rb: DateTime#of is obsoleted. Use DateTime#offset.
+
+ * test/wsdl/emptycomplextype.wsdl, test/xsd/xmlschema.xml: Avoid
+ useless warning.
+
+Tue Oct 14 19:09:35 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (ruby_finalize_0): return the given exit status unless
+ SystemExit got raised.
+
+Tue Oct 14 11:53:49 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * intern.h (ruby_stop): never return.
+
+ * ruby.h (ruby_run): ditto.
+
+Tue Oct 14 04:43:55 2003 Tanaka Akira <akr@m17n.org>
+
+ * lib/pathname.rb (realpath): make ELOOP check bit more robust.
+ (children): prepend self by default.
+ (chroot): obsoleted.
+
+Tue Oct 14 02:29:31 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (rb_require_safe): segfault after loading .so.
+
+Tue Oct 14 02:05:23 2003 Akinori MUSHA <knu@iDaemons.org>
+
+ * ext/Setup*, ext/enumerator/*: Add ext/enumerator, a helper
+ module for the Enumerable interface.
+
+Mon Oct 13 23:55:59 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * test/ruby/envutil.rb: use Config::CONFIG["ruby_install_name"],
+ not "ruby".
+
+Mon Oct 13 23:57:29 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (rb_feature_p): match by classified suffix.
+
+ * eval.c (rb_require_safe): require library in the specified safe
+ level.
+
+ * variable.c (rb_autoload, rb_autoload_load): restore safe level
+ when autoload was called. [ruby-dev:21338]
+
+ * intern.h: prototypes; rb_require_safe.
+
+ * test/runner.rb: accept non-option arguments.
+
+Mon Oct 13 20:49:51 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * string.c (str_new4): should not preserve FL_TAINT status in the
+ internal shared string. [ruby-dev:21601]
+
+ * string.c (rb_str_new4): ditto.
+
+ * eval.c: use EXIT_SUCCESS and EXIT_FAILURE for exit values.
+
+ * process.c: ditto. [ruby-list:38521]
+
+Mon Oct 13 19:51:02 2003 Koji Arai <jca02266@nifty.ne.jp>
+
+ * lib/debug.rb (debug_command): should enter emacs mode when
+ assigned any value to the environment variable "EMACS".
+ On Meadow, (getenv "EMACS") is "meadow".
+
+Sun Oct 12 14:45:03 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * ext/win32ole/extconf.rb: check "windows.h", not "windows".
+ [ruby-talk:84051]
+
+Sat Oct 11 20:41:03 2003 Corinna Vinschen <corinna@vinschen.de>
+
+ * file.c (eaccess): Use access(2) on Cygwin.
+
+Sat Oct 11 17:09:21 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * lib/rexml/quickpath.rb (REXML::QuickPath::match):
+ escape '[' to avoid warning.
+
+Sat Oct 11 16:08:41 2003 Tanaka Akira <akr@m17n.org>
+
+ * lib/pathname.rb (realpath): check existence of the file.
+
+ * lib/pathname.rb (realpath): re-implemented.
+ (realpath_root?, realpath_rec): removed
+
+Sat Oct 11 10:19:39 2003 Shugo Maeda <shugo@ruby-lang.org>
+
+ * lib/monitor.rb: handle exceptions correctly. Thanks, Gennady
+ Bystritsky.
+
+Fri Oct 10 07:50:54 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (is_defined): inheritance line adjustment as like as
+ rb_call_super().
+
+Fri Oct 10 01:19:00 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * ext/openssl/ossl_x509name.c (ossl_x509name_initialize): add
+ optional argument to specify the DirectoryString type
+ (ASN1::UTF8STRING by default). RFC3280 deprecates PrintableString
+ for DirectoryString, and strongly requires to use UTF8String for
+ all certificates issued after December, 31 2003.
+
+ * ext/openssl/lib/openssl/x509.rb (X509::Name::parse): ditto.
+
+Thu Oct 9 23:50:21 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (rb_thread_start_0): prevent thread from GC.
+ [ruby-dev:21572]
+
+Thu Oct 9 19:11:44 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (rb_thread_start_0): non-volatile should be restored from
+ volatile.
+
+Thu Oct 9 17:43:36 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (proc_save_safe_level, proc_get_safe_level,
+ proc_set_safe_level): save/restore safe level 1..4.
+
+Thu Oct 9 16:33:23 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * marshal.c (r_object0): remove unnecessary iv restoration for
+ USRMARSHAL. [ruby-dev:21582]
+
+ * marshal.c (w_object): dump generic instance variables from
+ a string from '_dump'.
+
+ * variable.c (rb_generic_ivar_table): return 0 if obj's FL_EXIVAR
+ is not set.
+
+ * time.c (time_dump): copy instance variables to dumped string, to
+ be included in the marshaled data.
+
+ * bignum.c (rb_big2ulong): add range check to ensure round trip.
+
+Thu Oct 9 15:45:27 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * pack.c (uv_to_utf8): change message to "out of range", since
+ negative values are not "too big". [ruby-dev:21567]
+
+Thu Oct 9 14:05:38 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (rb_set_end_proc, rb_exec_end_proc): restore safe level.
+ [ruby-dev:21557]
+
+Thu Oct 9 10:51:04 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (rb_yield_0): no error if block is empty.
+
+Thu Oct 9 06:43:33 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (localjump_error): id should be ID.
+
+ * eval.c (rb_eval): nd_rval is set in copy_node_scope().
+
+ * eval.c (rb_yield_0): unused variable.
+
+ * eval.c (rb_yield_0): nothing to do for empty node.
+
+ * eval.c (call_end_proc, proc_invoke): adjust backtrace in END.
+ [ruby-dev:21551]
+
+ * eval.c (rb_thread_start_0): set the value by break as the result.
+ [ruby-dev:21552]
+
+ * eval.c (rb_thread_start_0, rb_thread_raise, rb_callcc): save
+ variables across THREAD_SAVE_CONTEXT.
+
+Thu Oct 9 12:05:46 2003 Eric Sunshine <sunshine@sunshineco.com>
+
+ * configure.in: revived NextStep, OpenStep, and Rhapsody ports which
+ had become unbuildable; enhanced --enable-fat-binary option so that
+ it accepts a list of desired architectures (rather than assuming a
+ fixed list), or defaults to a platform-appropriate list if user does
+ not provide an explicit list; made the default list of architectures
+ for MAB (fat binary) more comprehensive; now uses -fno-common even
+ when building the interpreter (in addition to using it for
+ extensions), thus allowing the interpreter to be embedded into a
+ plugin module of an external project (in addition to allowing
+ embedding directly into an application); added checks for
+ <netinet/in_systm.h> (needed by `socket' extension) and getcwd(); now
+ ensures that -I/usr/local/include is employed when extensions'
+ extconf.rb scripts invoke have_header() since extension checks on
+ NextStep and OpenStep will fail without it if the desired resource
+ resides in the /usr/local tree; fixed formatting of --help message.
+
+ * Makefile.in: $(LIBRUBY_A) rule now deletes the archive before
+ invoking $(AR) since `ar' on Apple/NeXT can not "update" MAB archives
+ (see configure's --enable-fat-binary option); added rule for new
+ missing/getcwd.c.
+
+ * defines.h: fixed endian handling during MAB build (see configure's
+ --enable-fat-binary option) to ensure that all portions of the
+ project see the correct WORDS_BIGENDIAN value (some extension modules
+ were getting the wrong endian setting); added missing constants
+ GETPGRP_VOID, WNOHANG, WUNTRACED, X_OK, and type pid_t for NextStep
+ and OpenStep; removed unnecessary and problematic HAVE_SYS_WAIT_H
+ define in NeXT section.
+
+ * dir.c: do not allow NAMLEN() macro to trust dirent::d_namlen on
+ NextStep since, on some installations, this value always resolves
+ uselessly to zero.
+
+ * dln.c: added error reporting to NextStep extension loader since the
+ previous behavior of failing silently was not useful; now ensures
+ that NSLINKMODULE_OPTION_BINDNOW compatibility constant is defined
+ for OpenStep and Rhapsody; no longer includes <mach-o/dyld.h> twice
+ on Rhapsody since this header lacks multiple-include protection,
+ which resulted in "redefinition" compilation errors.
+
+ * main.c: also create hard reference to objc_msgSend() on NeXT
+ platforms (in addition to Apple platforms).
+
+ * lib/mkmf.rb: now exports XCFLAGS from configure script to extension
+ makefiles so that extensions can be built MAB (see configure's
+ --enable-fat-binary option); also utilize XCFLAGS in cc_command()
+ (but not cpp_command() because MAB flags are incompatible with
+ direct invocation of `cpp').
+
+ * ext/curses/extconf.rb: now additionally checks for presence of these
+ curses functions which are not present on NextStep or Openstep:
+ bkgd(), bkgdset(), color(), curs(), getbkgd(), init(), scrl(), set(),
+ setscrreg(), wattroff(), wattron(), wattrset(), wbkgd(), wbkgdset(),
+ wscrl(), wsetscrreg()
+
+ * ext/curses/curses.c: added appropriate #ifdef's for additional set of
+ curses functions now checked by extconf.rb; fixed curses_bkgd() and
+ window_bkgd() to correctly return boolean result rather than numeric
+ result; fixed window_getbkgd() to correctly signal an error by
+ returning nil rather than -1.
+
+ * ext/etc/etc.c: setup_passwd() and setup_group() now check for null
+ pointers before invoking rb_tainted_str_new2() upon fields extracted
+ from `struct passwd' and `struct group' since null pointers in some
+ fields are common on NextStep/OpenStep (especially so for the
+ `pw_comment' field) and rb_tainted_str_new2() throws an exception
+ when it receives a null pointer.
+
+ * ext/pty/pty.c: include "util.h" for strdup()/ruby_strdup() for
+ platforms such as NextStep and OpenStep which lack strdup().
+
+ * ext/socket/getaddrinfo.c: cast first argument of getservbyname(),
+ gethostbyaddr(), and gethostbyname() from (const char*) to non-const
+ (char*) for older platforms such as NextStep and OpenStep.
+
+ * ext/socket/socket.c: include "util.h" for strdup()/ruby_strdup() for
+ platforms such as NextStep and OpenStep which lack strdup(); include
+ <netinet/in_systm.h> if present for NextStep and OpenStep; cast first
+ argument of gethostbyaddr() and getservbyname() from (const char*) to
+ non-const (char*) for older platforms.
+
+ * ext/syslog/syslog.c: include "util.h" for strdup()/ruby_strdup() for
+ platforms such as NextStep and OpenStep which lack strdup().
+
+Wed Oct 8 22:19:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
+
+ * lib/test/unit.rb: removed installation instructions.
+
+ * lib/test/unit/ui/testrunnermediator.rb: moved the run flag to a more
+ central location.
+
+ * lib/test/unit.rb: ditto.
+
+ * lib/test/unit.rb: extracted the running code in to AutoRunner.
+
+ * lib/test/unit/autorunner.rb: added.
+
+ * lib/test/unit/collector/objectspace.rb: extracted common test
+ collection functionality in to a module.
+
+ * lib/test/unit/collector.rb: ditto; added.
+
+ * test/testunit/collector/test_objectspace.rb: ditto.
+
+ * lib/test/unit/collector/dir.rb: added. Supports collecting tests out
+ of a directory structure.
+
+ * test/testunit/collector/test_dir.rb: added.
+
+ * test/runner.rb: simplified to use the new capabilities.
+
+Tue Oct 7 15:23:09 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * test/ruby/test_beginendblock.rb: add tests for nested BEGIN/END.
+
+ * test/ruby/beginmainend.rb: add tests for nested BEGIN/END.
+
+ * test/ruby/endblockwarn.rb: new file added to test of END-in-method
+ warning.
+
+Tue Oct 7 12:23:47 2003 Tanaka Akira <akr@m17n.org>
+
+ * ext/fcntl/fcntl.c (Init_fcntl): define Fcntl::O_ACCMODE.
+
+ * ext/socket/extconf.rb: useless assignment removed.
+
+Tue Oct 7 09:13:24 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * test/ruby/test_beginendblock.rb (test_endinmethod): END{} is now
+ allowed in eval.
+
+Tue Oct 7 04:15:25 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * parse.y (stmt): should not expand mrhs if lhs is solely starred.
+
+Tue Oct 7 02:57:53 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * parse.y (stmt): rhs of multiple assignment should not be
+ expanded using "to_a". [ruby-dev:21527]
+
+Tue Oct 7 01:42:34 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * ext/openssl/ossl_asn1.c (ossl_asn1_get_asn1type): use appropriate
+ free function for ASN1_OBJECT.
+
+ * ext/openssl/ossl_asn1.c (ossl_asn1obj_get_sn): add new function for
+ ASN1::ObjectId#sn; it returns short name text representation of OID.
+
+ * ext/openssl/ossl_asn1.c (ossl_asn1obj_get_ln): add new function for
+ ASN1::ObjectId#ln; it returns long name text representation of OID.
+
+ * ext/openssl/ossl_asn1.c (ossl_asn1obj_get_oid): add new function for
+ ASN1::ObjectId#oid; it returns numerical representation of OID.
+
+Mon Oct 6 22:59:46 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * lib/csv.rb (IOReader, BasicWriter): call binmode when a given IO
+ respond_to?(:binmode). record separator was wrong when you gave
+ text mode IO to Reader.parse and Writer.generate.
+
+ * test/csv/test_csv.rb: add tests for above change.
+
+Sun Oct 5 23:27:09 2003 Tanaka Akira <akr@m17n.org>
+
+ * ext/socket/extconf.rb: check recvmsg even if sendmsg is exists.
+
+ * ext/socket/socket.c (thread_read_select): restored.
+
+Mon Oct 6 16:23:38 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * marshal.c (w_object): wrong method name in the message.
+
+Mon Oct 6 16:02:05 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * parse.y (stmt): END in method should cause warning.
+ [ruby-dev:21519]
+
+Mon Oct 6 15:17:23 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * test/ruby/test_iterator.rb (test_block_argument_without_paren):
+ added. (follows sample/test.rb)
+
+Mon Oct 6 11:57:06 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * test/ruby/test_beginendblock.rb, test/ruby/beginmainend.rb: added
+ test for eval-ed BEGIN END order.
+
+Mon Oct 6 09:19:54 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * marshal.c (w_object): should pass "weak" value to next level.
+ [ruby-dev:21496]
+
+ * eval.c (proc_alloc): should not use cached object if klass is
+ different. [ruby-talk:83685]
+
+Sun Oct 5 23:27:09 2003 Tanaka Akira <akr@m17n.org>
+
+ * lib/pathname.rb: version information is added in document.
+
+Sun Oct 5 23:07:03 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (rb_f_END): block should be given. [ruby-dev:21497]
+
+Sun Oct 5 22:51:23 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * lib/ext/openssl/extconf.rb: add check for some engine functions
+ unavailable in OpenSSL-0.9.6.
+
+ * lib/ext/openssl/ossl_engine.c: ditto.
+
+Sun Oct 5 17:56:30 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (rb_eval): fix evaluation order. [ruby-list:38431]
+
+Sun Oct 5 15:05:06 2003 akira yamada <akira@ruby-lang.org>
+
+ * test/uri/*: translated RUNIT to Test::Unit.
+
+Sun Oct 5 14:37:39 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * lib/xsd/datatypes.rb: Rational -> Decimal string bug fix.
+
+ * test/soap/marshal/test_marshal.rb: ditto.
+
+ * test/soap/calc/test_calc_cgi.rb: add Config::CONFIG["EXEEXT"] to
+ RUBYBIN.
+
+Sun Oct 5 13:47:22 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * test/ruby/test_beginendblock.rb, test/ruby/beginmainend.rb: add tests
+ about scope, order and allowed syntax.
+
+Sun Oct 5 11:54:29 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * test/ruby/envutil.rb: added. split "rubybin" from test_system.rb.
+
+ * test/ruby/test_system.rb: use envutil.rb
+
+ * test/ruby/test_beginendblock.rb: added.
+
+ * test/ruby/beginmainend.rb: added. used in test_beginendblock.rb.
+
+Sun Oct 5 11:23:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
+
+ * test/testunit/runit/test_testresult.rb: removed some unnecessary
+ cruft.
+
+Sun Oct 5 11:14:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
+
+ * lib/rubyunit.rb: aliasing TestCase into the top level is
+ problematic.
+
+ * lib/runit/assert.rb: fixed a couple of bugs caused by recent
+ refactoring in Test::Unit.
+
+ * test/testunit/runit/*: added.
+
+Sun Oct 5 10:55:29 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * lib/open-uri.rb (URI::Generic#find_proxy): no_proxy support did not
+ work. [ruby-dev:21484]
+
+Sun Oct 5 09:52:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
+
+ * lib/test/unit/assertions.rb: will use pp for output if available.
+ Can be disabled by setting Assertions.use_pp = false.
+
+ * test/testunit/test_assertions.rb: made a small change to exception
+ formatting.
+
+Sun Oct 5 07:42:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
+
+ * lib/test/unit/assertions.rb: made small improvements to assertion
+ messages. Deprecated Assertions#assert_not_nil; use #assert instead.
+
+ * test/testunit/test_assertions.rb: ditto.
+
+ * test/testunit/util/test_procwrapper.rb: use #assert instead of
+ #assert_not_nil.
+
+Sun Oct 5 04:10:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
+
+ * lib/test/unit/assertions.rb: refactored message building.
+
+Sun Oct 5 03:40:22 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * ext/openssl/ossl_asn1.h: global symbols should be declared
+ as external.
+
+Sun Oct 5 03:03:20 2003 akira yamada <akira@ruby-lang.org>
+
+ * test/ruby/test_exception.rb (test_else): added.
+
+Sun Oct 5 02:12:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
+
+ * lib/test/unit/assertions.rb: changed assertion messages to rely more
+ heavily on #inspect. Added backtrace filtering for exceptions in
+ assertion messages.
+
+ * test/testunit/test_assertions.rb: ditto.
+
+Sun Oct 5 02:12:00 2003 Masatoshi SEKI <m_seki@mva.biglobe.ne.jp>
+
+ * lib/drb/acl.rb, lib/drb/ssl.rb: added.
+
+ * lib/drb/drb.rb: exit from a thread using 'break'.
+
+Sat Oct 4 21:49:14 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * gc.c (Init_stack): the type of space is changed to unsigned int
+ from double. [ruby-dev:21483]
+
+Sat Oct 4 17:52:59 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * lib/soap/netHttpClient.rb: follow http-access2. hosts which matches
+ ENV['no_proxy'] or ENV['NO_PROXY'] are not proxyed.
+ - [,:] separated. ("ruby-lang.org:rubyist.net")
+ - no regexp. (give "ruby-lang.org", not "*.ruby-lang.org")
+ - if you want specify host by IP address, give full address.
+ ("192.168.1.1, 192.168.1.2")
+
+ * lib/soap/rpc/cgistub.rb: return "Status: XXX MMM" line.
+
+ * test/runner.rb: give testsuite name.
+
+Sat Oct 4 15:16:02 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * marshal.c (w_object): instance variable dump do not cause error
+ for objects that cannot be dumped, if they traversed from
+ marshal_dump. they are just ignored.
+
+ * gc.c (Init_stack): cast "space" (doble value) into unsigned
+ int. should run on PowerPC.
+
+ * eval.c (rb_eval): should not execute else part if any exception
+ is caught. [ruby-dev:21482]
+
+ * parse.y (f_args): should allow unparenthesized block argument.
+
+ * parse.y (f_rest_arg): should allow unparenthesized rest
+ argument.
+
+Sat Oct 4 14:59:51 2003 Tanaka Akira <akr@m17n.org>
+
+ * lib/pathname.rb (initialize): raise ArgumentError if argument has
+ '\0' character.
+ (relative_path_from): new method.
+ (each_entry): new method for replacement of dir_foreach.
+ (foreach, foreachline, dir_foreach, chdir): obsoleted.
+
+Sat Oct 4 12:58:48 2003 akira yamada <akira@ruby-lang.org>
+
+ * test/uri/* (6 files): added.
+
+Sat Oct 4 12:44:45 2003 akira yamada <akira@ruby-lang.org>
+
+ * lib/uri/ftp.rb, lib/uri/mailto.rb: renamed to #to_s from #to_str.
+
+Sat Oct 4 07:33:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
+
+ * lib/test/unit/testsuite.rb: changed #<< to return self, and added
+ #delete.
+
+ * test/testunit/test_testsuite.rb: ditto. Also slightly refactored
+ #test_size.
+
+ * lib/test/unit/collector/objectspace.rb: collector now preserves the
+ hierarchy of suites.
+
+ * test/testunit/collector/test_objectspace.rb: ditto.
+
+Sat Oct 4 04:48:49 2003 why the lucky stiff <why@ruby-lang.org>
+
+ * ext/syck/rubyext.c: default keys handled.
+
+ * ext/syck/syck.h: lowered default buffer size to 16k for increased
+ performance.
+
+ * test/yaml: checkin of basic unit tests.
+
+Sat Oct 4 04:24:19 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * ext/openssl/extconf.rb: add check for X509V3_set_nconf.
+
+ * ext/openssl/ossl_x509ext.c (ossl_x509extfactory_set_config):
+ cannot implement if X509V3_set_nconf doesn't exist.
+
+Sat Oct 4 02:12:44 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * lib/xsd/datatypes.rb: dump sign by itself. under the problematic
+ platform, sprintf("%+.10g", -0.0) => +0. sigh.
+
+ * sample/wsdl/amazon/*: update schema ver2 to ver3.
+
+Sat Oct 4 01:33:46 2003 Tanaka Akira <akr@m17n.org>
+
+ * lib/pathname.rb (initialize): duplicate and freeze argument.
+ (to_s): return duplicated string.
+ (children): new method.
+ (each_line): new alias to foreachline.
+
+Fri Oct 3 16:13:19 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * ext/openssl/ossl_asn1.c: add DER encoder and decoder.
+
+ * ext/openssl/ossl_asn1.h: add OpenSSL::ASN1 module.
+
+ * ext/openssl/ossl.c (Init_openssl): call Init_ossl_asn1.
+
+ * ext/openssl/extconf.rb: check if X509_ATTRIBUTE has field "single".
+
+ * ext/openssl/ossl_x509attr.c (ossl_x509attr_set_value): accept
+ DER encoded data argument.
+
+ * ext/openssl/ossl_x509attr.c (ossl_x509attr_get_value): return
+ DER encoded data in OpenSSL::ASN1 types.
+
+Fri Oct 3 13:02:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
+
+ * lib/test/unit.rb: refactored to use optparse.
+
+ * lib/test/unit.rb: added support for selecting the output
+ level from the command-line.
+
+ * lib/test/unit.rb: added a command-line switch to stop processing
+ the command-line, allowing arguments to be passed to tests.
+
+ * lib/test/unit.rb: changed the method for specifying a runner or a
+ filter from the command-line.
+
+ * lib/test/unit/collector/objectspace.rb: fixed a bug causing all
+ tests to be excluded when the filter was set to an empty array.
+
+ * test/testunit/collector/test_objectspace.rb: ditto.
+
+Fri Oct 3 08:14:32 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * lib/irb/ruby-lex.rb (RubyLex::identify_identifier): support
+ 'class ::Foo' syntax. [ruby-talk:83514]
+
+Fri Oct 3 08:01:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
+
+ * lib/test/unit/assertions.rb: added a default message for #assert,
+ #assert_block, and #flunk.
+
+ * test/testunit/test_assertions.rb: ditto.
+
+ * lib/test/unit/failure.rb: failures now show a better trace of where
+ they occurred.
+
+ * test/testunit/test_failure.rb: ditto (added).
+
+ * lib/test/unit/testcase.rb: ditto.
+
+ * test/testunit/test_testcase.rb: ditto.
+
+ * lib/test/unit/util/backtracefilter.rb: added.
+
+ * test/testunit/util/test_backtracefilter.rb: added.
+
+ * lib/test/unit/error.rb: changed to use BacktraceFilter and improved
+ output.
+
+ * test/testunit/test_error.rb: ditto.
+
+Thu Oct 2 20:33:49 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/iconv/iconv.c (iconv_failure_initialize): conform with
+ orthodox initialization method.
+
+ * ext/iconv/iconv.c (iconv_fail): initialize exception instance
+ from the class, and do not share instance variables with the
+ others. [ruby-dev:21470]
+
+Thu Oct 2 18:20:27 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * time.c (Init_Time): define initialize. [ruby-dev:21469]
+
+Thu Oct 2 17:39:38 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * ext/openssl/ossl_engine.c: add a new module OpenSSL::Engine.
+ it supports OpenSSL hardware cryptographic engine interface.
+
+ * ext/openssl/ossl_engine.h: ditto.
+
+ * ext/openssl/MANIFEST: add ossl_engine.c and ossl_engine.h.
+
+ * ext/openssl/extconf.rb: add check for openssl/engine.h.
+
+ * ext/openssl/ossl.c: call Init_ossl_engine().
+
+ * ext/openssl/ossl.h: include openssl/engine.h.
+
+ * ext/openssl/ossl_pkey_{rsa,dsa,dh}.c: check if underlying
+ EVP_PKEY referes engine.
+
+Thu Oct 2 17:22:37 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * time.c (time_load): restore instance variables (if any) before
+ loading from marshaled data.
+
+Thu Oct 2 14:19:15 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/iconv/iconv.c (iconv_fail): now yield erred substring, and
+ set error object to $!.
+
+ * ext/iconv/iconv.c (iconv_convert): error handler block should
+ return appended part and the rest. if rest is nil, the
+ conversion stops.
+
+Thu Oct 2 12:00:18 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * variable.c (rb_const_defined_0): look up constants in Object as
+ well. [ruby-dev:21458]
+
+ * test/ruby/test_defined.rb (TestDefined::test_defined): test for
+ constants.
+
+Thu Oct 2 11:17:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
+
+ * lib/test/unit/assertions.rb: should not capture an
+ AssertionFailedError unless explicitly requested.
+
+ * test/testunit/test_assertions.rb: ditto.
+
+ * test/testunit/collector/test_objectspace.rb: fixed a test failure
+ caused by methods being returned in different orders on different
+ platforms by moving test sorting from TestSuite into the locations
+ where suites are constructed. [ruby-talk:83156]
+
+ * lib/test/unit/testcase.rb: ditto.
+
+ * lib/test/unit/testsuite.rb: ditto.
+
+ * lib/test/unit/collector/objectspace.rb: ditto.
+
+Thu Oct 2 03:25:01 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * eval.c (rb_thread_raise): prototype; avoid VC++ warning.
+
+Thu Oct 2 01:37:34 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * time.c (time_mdump): new marshal dumper. _dump is still
+ available for compatibility.
+
+ * time.c (time_mload): new marshal loader.
+
+ * marshal.c (w_object): preserve instance variables for objects
+ with marshal_dump.
+
+ * marshal.c (r_object0): restore instance variables before calling
+ marshal_load.
+
+ * error.c (rb_warn_m): always return nil.
+
+Thu Oct 2 01:32:46 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_f_block_given_p): real required condition is
+ ruby_frame->prev->iter == ITER_CUR.
+
+ * eval.c (rb_block_given_p): ditto.
+
+ * eval.c (block_pass): update ruby_frame->iter only when previous
+ value is ITER_NOT.
+
+Thu Oct 2 01:02:35 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * variable.c (rb_const_defined_at): should exclude constants from
+ Object when TYPE(klass) == T_MODULE *and* exclude is on.
+ [ruby-dev:21458]
+
+ * variable.c (rb_const_get_0): do not lookup constants from Object
+ when TYPE(klass) == T_MODULE *and* exclude is on.
+
+Thu Oct 2 00:21:11 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * test/logger/test_logger.rb: unlinking file before close causes
+ problem under win32 box.
+
+ * lib/xsd/datatypes.rb(XSDFloat, XSDDouble): add +/- sign explicitly
+ when stringified and embedded into XML instance. Ruby's sprintf may
+ format -0.0 as "0.0" (no minus sign) depending on underlying C
+ sprintf implementation.
+
+ * test/xsd/test_xsd.rb, test/soap/test_basetype.rb: follow above change.
+
+ * test/soap/calc/*: give httpd config param "CGIInterpreter".
+ "/usr/bin/env ruby" thing does not work under non-Unix boxes.
+
+Thu Oct 2 00:25:21 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * signal.c (ruby_signal_name): adjust to the prototype.
+
+ * process.c (pst_inspect): ditto.
+
+ * ext/etc/etc.c (etc_getgrent, Init_etc): typo.
+
+Wed Oct 1 20:49:41 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * gc.c (heaps): manage slots and limits together. [ruby-dev:21453]
+
+ * gc.c (add_heap): should not clear heaps slot even if realloc()
+ failed.
+
+Wed Oct 1 20:36:49 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * MANIFEST: add wince/mkconfig_wce.rb.
+
+Wed Oct 1 17:22:33 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * ext/etc/etc.c: add new functions: setpwent, getpwent, endpwent,
+ setgrent, getgrent, endgrent.
+
+ * ext/socket/socket.c (sock_s_gethostbyname): do not reverse lookup.
+
+Wed Oct 1 17:01:30 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (rb_load): Object scope had priority over required file
+ scope. [ruby-dev:21415]
+
+Wed Oct 01 14:09:53 2003 Takaaki Uematsu <uema2x@jcom.home.ne.jp>
+
+ * wince/mkconfig_wce.rb: sorry, forget to commit.
+
+Wed Oct 01 10:08:42 2003 Takaaki Uematsu <uema2x@jcom.home.ne.jp>
+
+ * wince/setup.mak: add sigmarionIII SDK support.
+
+ * wince/Makefile.sub: ditto.
+
+ * wince/mkexports.rb: fix linker error in SH4.
+
+ * wince/mkconfig_wce.rb: camouflage RUBY_PLATFORM for compiling ext.
+
+Wed Oct 01 08:02:52 2003 Takaaki Uematsu <uema2x@jcom.home.ne.jp>
+
+ * wince/time_wce.c (time): add zero check.
+
+Tue Sep 30 16:11:05 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * Makefile.in: copy lex.c from $(srcdir) if it's not the current
+ directory. [ruby-dev:21437]
+
+Tue Sep 30 11:29:23 2003 Tanaka Akira <akr@m17n.org>
+
+ * process.c (pst_inspect): describe stopped process "stopped".
+
+Tue Sep 30 09:31:56 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * test/runner.rb: glob for directories.
+
+Tue Sep 30 09:11:43 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_eval): while/until should not capture break unless
+ they are destination of the break.
+
+Tue Sep 30 03:12:02 2003 Minero Aoki <aamine@loveruby.net>
+
+ * lib/net/http.rb (finish): revert to 1.93.
+
+ * lib/net/pop.rb (finish): revert to 1.60.
+
+ * lib/net/smtp.rb (finish): revert to 1.67.
+
+ * lib/net/http.rb (do_start): ensure to close socket if failed to
+ start session.
+
+ * lib/net/pop.rb (do_start): ditto.
+
+ * lib/net/smtp.rb (do_start): ditto.
+
+ * lib/net/smtp.rb: SMTP#started? wrongly returned false always.
+
+Tue Sep 30 02:54:49 2003 Minero Aoki <aamine@loveruby.net>
+
+ * test/ruby/test_iterator.rb: new test
+ test_break__nested_loop[123].
+
+Mon Sep 29 23:39:13 2003 Minero Aoki <aamine@loveruby.net>
+
+ * lib/net/http.rb (finish): does not raise IOError even if
+ !started?, to allow closing socket which was opened before
+ session started.
+
+ * lib/net/pop.rb (finish): ditto.
+
+ * lib/net/smtp.rb (finish): ditto.
+
+Mon Sep 29 19:06:51 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * ext/win32ole/extconf.rb: add windows.h checking.
+ (ruby-bugs:PR#1185)
+
+Mon Sep 29 16:18:30 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * lib/logger.rb: check if the given logdevice object respond_to :write
+ and :close, not is_a? IO. duck duck.
+
+ * test/logger/test_logger.rb: self IO.pipe reading/writing may be
+ locked by the flood. use tempfile.
+
+ * lib/wsdl/xmlSchema/data.rb: wrong constant reference.
+
+Mon Sep 29 16:11:23 2003 Minero Aoki <aamine@loveruby.net>
+
+ * test/fileutils/test_fileutils.rb: clean up temporary symlink.
+ Patched by NaHi. [ruby-dev:21420]
+
+Mon Sep 29 11:16:55 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_thread_atfork): wrong format specifier.
+ [ruby-dev:21428]
+
+ * process.c (pst_inspect): better description.
+
+Mon Sep 29 02:31:44 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * lib/webrick/utils.rb (Utils::su): use setgid and setuid to
+ set real and effective IDs. and setup group access list by
+ initgroups.
+
+Sun Sep 28 11:14:19 2003 Koji Arai <jca02266@nifty.ne.jp>
+
+ * ext/digest/digest.c (Init_digest): `copy_object' was deprecated.
+ `initialize_copy' should be defined.
+
+ * ext/stringio/stringio.c (Init_stringio): ditto.
+
+Sat Sep 27 18:25:13 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * lib/xsd/charset.rb: XSD::Charset.is_ces did return always true under
+ $KCODE = "NONE" environment. check added.
+
+ * test/xsd/test_xsd.rb: add tests for above fix.
+
+Sat Sep 27 15:58:50 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * lib/soap/rpc/cgistub.rb: make logging severity threshold higher.
+
+ * lib/soap/rpc/standaloneServer.rb: defer WEBrick server start to give
+ a chance to reset logging severity threshold.
+
+ * test/soap/calc/test_*, test/soap/helloworld/test_helloworld.rb: run
+ silent.
+
+Sat Sep 27 09:44:18 2003 Minero Aoki <aamine@loveruby.net>
+
+ * test/fileutils/test_fileutils.rb: clear all errors on Windows.
+ [ruby-dev:21417]
+
+ * test/fileutils/test_nowrite.rb: ditto.
+
+Sat Sep 27 04:57:07 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * test/ruby/test_file.rb: new file. only asserts unlink-before-close
+ behaviour now.
+
+ * test/soap/marshal/test_digraph.rb: should close before unlink.
+ unlink-before-close pattern is not needed here.
+
+Sat Sep 27 03:32:37 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * test/soap/*, test/wsdl/*, test/xsd/*: move TestCase classes into
+ each module namespace. TestMarshal in
+ test/soap/marshal/test_marshal.rb crashed with
+ test/ruby/test_marshal.rb.
+
+Sat Sep 27 01:30:59 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * ext/socket/socket.c (ruby_connect): on win32, type of the 4th
+ argument of getsockopt is char *.
+
+Fri Sep 26 18:35:40 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * lib/resolv-replace.rb: 1.8 compliance. [ruby-talk:82946]
+
+Fri Sep 26 17:39:27 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * test/ruby/test_marshal.rb: add test for ruby's objects.
+
+Fri Sep 26 09:52:44 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * defines.h (flush_register_windows): use volatile only for gcc on
+ Solaris. [ruby-dev:21403]
+
+ * lib/mkmf.rb (xsystem): use system directly to honor shell meta
+ charaters.
+
+Fri Sep 26 00:10:13 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * lib/README: updated.
+
+Thu Sep 25 17:48:10 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * ext/openssl/ossl.c (ossl_buf2str): fix type of 1st argument for
+ rb_protect.
+
+ * ext/openssl/ossl_hmac.c (ossl_hmac_digest): should return meaningful
+ value.
+
+Thu Sep 25 09:00:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
+
+ * lib/ostruct.rb: Added OpenStruct#==.
+
+ * test/ostruct/test_ostruct.rb: Added.
+
+Thu Sep 25 07:55:26 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/win32ole/win32ole.c, ext/openssl/ossl_pkey_dsa.c,
+ ext/openssl/ossl_pkey_rsa.c, ext/bigdecimal/bigdecimal.h: must
+ not use C++ or C99 style comment yet. (ruby-bugs:PR#1184)
+
+Thu Sep 25 00:23:22 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * MANIFEST: add SOAP4R.
+
+Thu Sep 25 00:13:15 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * lib/soap/* (29 files): SOAP4R added.
+
+ * lib/wsdl/* (42 files): WSDL4R added.
+
+ * lib/xsd/* (12 files): XSD4R added.
+
+ * test/soap/* (16 files): added.
+
+ * test/wsdl/* (2 files): added.
+
+ * test/xsd/* (3 files): added.
+
+ * sample/soap/* (27 files): added.
+
+ * sample/wsdl/* (13 files): added.
+
+Wed Sep 24 02:08:11 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * lib/webrick/httpservlet/cgihandler.rb: conform to mswin32.
+ [ruby-talk:82735], [ruby-talk:82748], [ruby-talk:82818]
+
+Tue Sep 23 23:10:16 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * lib/logger.rb: add Logger#<<(msg) for writing msg without any
+ formatting.
+
+ * test/logger/test_logger.rb: ditto.
+
+Tue Sep 23 20:47:51 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * error.c (rb_warn_m): should not warn if -W0 is specified.
+ [ruby-talk:82675]
+
+Mon Sep 22 21:28:57 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * MANIFEST: updated.
+
+Mon Sep 22 19:22:26 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * configure.in (AC_CHECK_FUNCS): add setuid and setgid.
+
+Mon Sep 22 12:34:55 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * util.c (ruby_strtod): skip preceding zeros before counting
+ digits in the mantissa. (ruby-bugs:PR#1181)
+
+Sun Sep 21 04:12:36 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * ext/openssl/ossl_ocsp.c (ossl_ocspreq_initialize): the argument
+ should be a String.
+
+ * ext/openssl/ossl_ocsp.c (ossl_ocspres_initialize): ditt.
+
+ * ext/openssl/ossl_x509attr.c (ossl_x509attr_initialize): ditto.
+
+ * ext/openssl/ossl_x509ext.c (ossl_x509ext_initialize): ditto.
+
+ * ext/openssl/ossl_x509ext.c (ossl_x509ext_set_value): ditto.
+
+Sat Sep 20 11:49:05 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * lib/logger.rb: typo fixed.
+
+ * test/logger/test_logger.rb: new file.
+
+Fri Sep 19 11:39:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
+
+ * test/testunit/*: Added.
+
+ * lib/test/unit.rb: Documentation update.
+
+ * lib/test/unit/ui/console/testrunner.rb (TestRunner#initialize):
+ Ditto.
+
+ * lib/test/unit.rb: Factored out an ObjectSpace collector.
+
+ * lib/test/unit/collector/objectspace.rb: Ditto.
+
+ * sample/testunit/*: Added.
+
+Fri Sep 19 01:00:48 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * lib/webrick/log.rb (BasicLog#log): get rid of as ineffectual
+ condition.
+
+ * lib/webrick/log.rb (BasicLog#format): add "\n" to message.
+
+Thu Sep 18 22:43:20 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (proc_invoke): should push PROT_PCALL tag for orphans.
+
+ * eval.c (proc_invoke): should update "result" for orphans.
+
+Thu Sep 18 20:33:03 2003 Tietew <tietew-ml-ruby-list@tietew.net>
+
+ * parse.y (str_xquote): do not prepend escapes in
+ backqoute literals. [ruby-list:38409]
+
+Thu Sep 18 20:30:17 2003 Tanaka Akira <akr@m17n.org>
+
+ * lib/pathname.rb: update document.
+
+Thu Sep 18 15:27:05 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * lib/logger.rb: new file. Logger, formerly called devel-logger or
+ Devel::Logger.
+
+ * sample/logger/*: new file. samples of logger.rb.
+
+Wed Sep 17 23:41:45 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (localjump_destination): should not raise ThreadError
+ exception for "break". [ruby-dev:21348]
+
+ * eval.c (proc_invoke): use result instead of prot_tag->retval.
+ retval is no longer propagated to the ancestors.
+
+Wed Sep 17 20:34:00 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * parse.y (tokadd_string, parse_string, yylex): escaped terminator
+ is now interpreted as is. [ruby-talk:82206]
+
+Wed Sep 17 18:52:36 2003 Minero Aoki <aamine@loveruby.net>
+
+ * test/fileutils/fileassertions.rb: new file.
+
+ * test/fileutils/test_fileutils.rb: new file.
+
+ * test/fileutils/test_nowrite.rb: new file.
+
+Wed Sep 17 18:51:02 2003 Minero Aoki <aamine@loveruby.net>
+
+ * test/strscan/test_stringscanner.rb: require test/unit.
+
+Wed Sep 17 18:35:34 2003 Minero Aoki <aamine@loveruby.net>
+
+ * test/strscan/test_stringscanner.rb: new file.
+
+Wed Sep 17 18:03:30 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * ext/openssl: all files are reviewed to simplify and avoid memory leak.
+
+ * ext/openssl/extconf.rb: add check for assert.h.
+
+ * ext/openssl/ossl.c (ossl_buf2str): new function to convert
+ C buffer to String and free buffer.
+
+ * ext/openssl/ossl.c (ossl_x509_ary2sk): new function to convert
+ Array of OpenSSL::X509 to STACK_OF(X509) with exception safe.
+
+ * ext/openssl/ossl.c (ossl_to_der, ossl_to_der_if_possible): new
+ functions to convert object to DER string.
+
+ * ext/openssl/ossl.h: ditto.
+
+ * ext/openssl/ossl_bio.c (ossl_membio2str): new function to convert
+ BIO to String object and free BIO.
+
+ * ext/openssl/ossl_bio.h: ditto.
+
+ * ext/openssl/ossl_pkcs7.c (ossl_pkcs7_to_der): add for "to_der".
+
+ * ext/openssl/ossl_x509name.c (ossl_x509name_to_der): ditto.
+
+ * ext/openssl/ossl_x509ext.c (ossl_x509ext_to_der): ditto.
+
+ * ext/openssl/ossl_x509ext.c (create_ext_from_array): removed
+ and reimplement in openssl/x509.rb.
+
+ * ext/openssl/ossl_x509attr.c: reimplemented and disable some
+ method temporarily. this class doesn't work fine without ASN.1
+ data support;-) I'll rewrite in near future.
+
+ * ext/openssl/lib/openssl/x509.c (X509::Attribute): get rid off
+ unused code.
+
+ * ext/openssl/lib/openssl/x509.c (X509::ExtensionFactory): refine all.
+
+Tue Sep 16 22:25:06 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * test/csv/test_csv.rb: add negative tests of row_sep.
+
+Tue Sep 16 18:02:36 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * regex.c (re_compile_pattern): should not translate character
+ class range edge. [ruby-list:38393]
+
+Tue Sep 16 16:47:56 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * MANIFEST: add test/csv/mac.csv.
+
+ * win32/Makefile.sub, bcc32/Makefile.sub (test): add phony NUL target.
+
+Mon Sep 15 19:02:52 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * lib/csv.rb: add extra pamameter to specify row(record) separater
+ character. To parse Mac's CR separated CSV, do like this.
+ CSV.open("mac.csv", "r", ?,, ?\r) { |row| p row.to_a }
+ The 3rd parameter in this example ?, is for column separater and the
+ 4th ?\r is for row separater. Row separater is nil by default. Nil
+ separater means "\r\n" or "\n".
+
+ * test/csv/test_csv.rb: add tests for above feature.
+
+ * test/csv/mac.csv: added. Sample CR separated CSV file.
+
+Fri Sep 12 22:41:48 2003 Michal Rokos <m.rokos@sh.cvut.cz>
+
+ * ext/openssl/ossl.c: move ASN.1 stuff to ossl_asn1.[ch]
+
+ * ext/openssl/ossl.c: move BIO stuff to ossl_bio.[ch]
+
+ * ext/openssl/ossl_asn1.[ch]: new files
+
+ * ext/openssl/ossl_bio.[ch]: new files
+
+Fri Sep 12 12:30:41 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * intern.h (rb_disable_super, rb_enable_super): replace with dummy
+ expressions instead of prototypes. the functions remain yet for
+ binary compatibility. [ruby-talk:81758]
+
+Fri Sep 12 12:09:54 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * bignum.c (rb_big_and): convert argument using 'to_int'.
+
+ * bignum.c (rb_big_or): ditto.
+
+ * bignum.c (rb_big_xor): ditto.
+
+Fri Sep 11 22:06:14 2003 David Black <dblack@superlink.net>
+
+ * lib/scanf.rb: Took out useless @matched_item variable; some small
+ refactoring.
+
+Thu Sep 11 08:43:44 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_f_require): allow "require" on $SAFE>0, if feature
+ name is not tainted.
+
+ * lib/rexml/parsers/baseparser.rb (REXML::Parsers::BaseParser::stream):
+ Supports StringIO.
+
+Wed Sep 10 22:47:30 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * ext/openssl/ossl.h: add a workaround for win32 platform.
+ libeay32.dll doesn't export functions defined in conf_api.h.
+
+ * ext/openssl/ossl_config.c (ossl_config_initialize): ditto.
+
+ * ext/openssl/ossl_config.c (ossl_config_add_value): ditto.
+
+ * ext/openssl/ossl_config.c (set_conf_section_i): should check
+ if the argument is Array.
+
+Wed Sep 10 22:41:54 2003 Tietew <tietew@tietew.net>
+
+ * eval.c (win32_get_exception_list): avoid VC7 warning.
+ [ruby-win32:577]
+
+Tue Sep 9 10:39:51 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (struct tag): dst should be VALUE.
+
+Tue Sep 9 10:39:51 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (localjump_destination): stop at the scope where the current
+ block was created. [ruby-dev:21353]
+
+Tue Sep 9 05:17:04 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * ext/openssl/ossl_config.rb: avoid compile error in OpenSSL-0.9.6.
+
+Tue Sep 9 02:41:35 2003 Michal Rokos <m.rokos@sh.cvut.cz>
+
+ * ext/openssl/ossl_config.c: Refine compatibility.
+
+Tue Sep 9 01:50:45 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * lib/webrick/httpserver.rb (HTTPServer#access_log): add "\n" to
+ the message.
+
+ * lib/webrick/log.rb (BasicLog#log): add "\n" only if needed.
+
+Mon Sep 8 22:15:33 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tk/lib/multi-tk.rb: modify security check at creating
+ a new interpreter
+
+Mon Sep 8 20:00:12 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * lib/optparse.rb, lib/optparse/version.rb: search also all
+ capital versions.
+
+Mon Sep 8 19:26:33 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * ext/openssl/ossl.h: include openssl/conf.h and openssl/conf_api.h.
+
+ * ext/openssl/ossl_config.c: refine all with backward compatibility.
+
+ * ext/openssl/ossl_config.h: export GetConfigPtr() and DupConfigPtr().
+
+ * ext/openssl/ossl_x509.c: added new constants under X509 module.
+ DEFAULT_CERT_AREA, DEFAULT_CERT_DIR, DEFAULT_CERT_FILE,
+ DEFAULT_CERT_DIR_ENV, DEFAULT_CERT_FILE_ENV and DEFAULT_PRIVATE_DIR.
+
+ * ext/openssl/ossl_x509ext.c (ossl_x509extfactory_free): don't free
+ the members of the struct. it's left to GC.
+
+ * ext/openssl/ossl_x509ext.c (ossl_x509_set_config): add for config=.
+
+ * ext/openssl/ossl_x509ext.c (Xossl_x509extfactory_initialize):
+ add attr readers: issuer_certificate, subject_certificate,
+ subject_request, crl and config.
+
+Mon Sep 8 18:26:41 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * lib/webrick/accesslog.rb (AccessLog::setup_params): use req.port
+ instead of config[:Port] or req.request_uri.port.
+
+ * lib/webrick/httprequest.rb (HTTPRequest#meta_vars): ditto.
+
+ * lib/webrick/httpservlet/filehandler.rb (FileHandler#dir_list): ditto.
+
+ * lib/webrick/config.rb: :Listen option never be used.
+
+ * lib/webrick/server.rb (GenericServer#initialize): don't use :Listen
+ option and add warning message.
+
+ * lib/webrick/log.rb (BasicLog#<<): shortcut of log(INFO, ...).
+
+ * lib/webrick/httpserver.rb (HTTPServer#accesslog): use << for logging.
+
+Sun Sep 7 16:08:28 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tcltklib/tcltklib.c (lib_mainloop_core): fixed signal-trap bug
+
+ * ext/tk/lib/*.rb : Ruby/Tk works at $SAFE == 4
+
+Sat Sep 6 02:26:34 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * test/ruby/test_*.rb: assert_same, assert_match, and so on.
+
+Sat Sep 6 18:45:46 2003 Mauricio Fernandez <batsman.geo@yahoo.com>
+
+ * parse.y (assignable): call rb_compile_error(), not rb_bug().
+ [ruby-core:01523]
+
+Sat Sep 6 17:40:41 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * ext/openssl/ruby_missing.c: rid of unnecessary backward
+ compatibility stuff. and remove DEFINE_ALLOC_WRAPPER from
+ all sources.
+
+ * ext/openssl/ossl_x509ext.c (X509::Extension.new): new method.
+
+ * ext/openssl/ossl_x509ext.c (X509::Extension#oid=): new method.
+
+ * ext/openssl/ossl_x509ext.c (X509::Extension#value=): new method.
+
+ * ext/openssl/ossl_x509ext.c (X509::Extension#critical=): new method.
+
+Sat Sep 6 01:23:22 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * win32/win32.c (CreateChild): need to quote cmd if RUBYSHELL is set.
+
+ * win32/win32.c (CreateChild): fix condition about whether to call
+ shell or not.
+
+Sat Sep 6 00:36:20 2003 Nobuyoshi Nakada <nobu.nokada@softhome.net>
+
+ * Makefile.in (test): phony target.
+
+ * lib/mkmf.rb (have_library, find_library): configure by library
+ name.
+
+ * lib/optparse.rb (OptionParser#order, #permute, #parse): allow an
+ array as argument.
+
+ * test/ruby/test_*.rb: moved invariants to left side in
+ assert_equal, and use assert_nil, assert_raises and so on.
+
+ * win32/win32.c (isInternalCmd): distinguish command.com and
+ cmd.exe.
+
+ * win32/win32.c (make_cmdvector): a character just after wildcard
+ was ignored. [ruby-core:01518]
+
+Fri Sep 5 20:27:08 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * test/ruby/test_*.rb: replace 'assert(a == b)' with assert_equal(a, b)'
+
+Fri Sep 5 18:00:51 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * ext/openssl/lib/openssl/x509.rb: new method X509::Name::parse.
+
+ * ext/openssl/ossl_digest.c: add ossl_digest_new().
+
+ * ext/openssl/ossl_digest.h: ditto.
+
+ * ext/openssl/ossl_cipher.c: add ossl_cipher_new().
+
+ * ext/openssl/ossl_cipher.h: ditto.
+
+Fri Sep 5 15:32:04 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * misc/ruby-mode.el (ruby-font-lock-maybe-here-docs): should not
+ search delimiter forward if found in backward.
+
+Fri Sep 5 13:32:48 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * test/runner.rb: arguments should be keys.
+
+Fri Sep 5 12:09:55 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * test/ruby/test_system.rb (test_system): check existence of ruby
+ interpreter.
+
+Fri Sep 5 11:32:17 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * lib/optparse.rb (--version): fix assignment/reference order.
+
+ * lib/optparse.rb (OptionParser#help): new; OptionParser#to_s may
+ be deprecated in future.
+
+ * lib/optparse/version.rb (OptionParser#show_version): hide Object.
+
+ * test/runner.rb: fix optparse usage.
+
+ * test/runner.rb: glob all testsuits if no tests given.
+
+Fri Sep 5 10:42:58 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * test/runner.rb: added. gets testcases from command line and runs it.
+
+ * test/ruby/test_gc.rb: remove useless part which was for dumping test
+ result.
+
+Fri Sep 5 09:28:59 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * test/ruby/test_gc.rb: added. splitter.rb which I made to split
+ sample/test.rb into test/ruby/test_* kindly removed GC test (the
+ last section in the original test) to reduce things to be worried.
+
+Fri Sep 5 03:00:04 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * test/ruby/test_iterator.rb (test_block_in_arg): add no block
+ given tests.
+
+ * test/ruby/test_iterator.rb (test_ljump): uncomment LocalJumpError
+ test.
+
+Fri Sep 5 01:10:11 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * test/ruby: tests for ruby itself.
+
+ * test/ruby/test_*.rb: split sample/test.rb into 28 test/unit testcases.
+ some tests could not be translates... search '!!' mark to see it.
+
+ * test/csv/test_csv.rb: should require 'csv', not '../lib/csv'. test
+ runner should set load path correctly.
+
+Fri Sep 5 01:03:59 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * test/csv/test_csv.rb: close opened files for CSV::IOBuf explicitly.
+ opened file cannot be removed under win32 box.
+
+Thu Sep 4 23:59:40 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * parse.y (tokadd_string): newlines have no special meanings in
+ %w/%W, otherwise they are ignored only when interpolation is
+ enabled. [ruby-dev:21325]
+
+Thu Sep 4 19:38:25 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * ext/io/wait/.cvsignore: added.
+
+ * ext/openssl/.cvsignore: added.
+
+Thu Sep 4 19:28:24 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * sample/openssl: added. Sample of standard distribution library
+ should be locate in sample/{module_name}/*.
+
+ * ext/openssl/sample/*: removed. move to sample/openssl/*.
+
+Thu Sep 4 18:02:15 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * test/csv/test_csv.rb: use remove_const to reduce warnings. use
+ Dir.tmpdir to locate working files.
+
+Thu Sep 4 17:41:31 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * misc/ruby-mode.el (ruby-here-doc-beg-re): underscore also is
+ valid delimiter.
+
+ * misc/ruby-mode.el (ruby-here-doc-end-match): must quote
+ arbitrary string to use as regexp.
+
+ * misc/ruby-mode.el (ruby-font-lock-maybe-here-docs): must not
+ call `ruby-here-doc-end-match' unless `ruby-here-doc-beg-re'
+ matched.
+
+Thu Sep 4 15:40:07 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * test/csv/test_csv.rb: run on test/unit original layer.
+
+Thu Sep 4 12:54:50 2003 why the lucky stiff <why@ruby-lang.org>
+
+ * ext/syck/token.c: headerless documents with root-level spacing now
+ honored.
+
+Thu Sep 4 00:06:14 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (mark_frame_adj): need to adjust argv pointer if using
+ system's alloca. [ruby-core:01503]
+
+Wed Sep 3 21:33:20 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+
+ * test: add test directory. Test::Unit aware testcases and needed
+ files should be located in this directory. dir/file name convention;
+ test/{module_name}/test_{testcase_name}.rb
+ test/{module_name}/{needed_files}
+ someday, someone will write testrunner which searches test_*.rb and
+ run testcases automatically.
+
+ * test/csv/*: add testcase for lib/csv.rb.
+
+Wed Sep 3 01:37:09 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * io.c (rb_f_gets): should call next_argv() before type check
+ current_file. [ruby-list:38336]
+
+Tue Sep 2 20:37:15 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * ext/openssl/lib/net/protocols.rb (SSLIO#ssl_connect): warning
+ for skipping server verification.
+
+Tue Sep 2 23:36:57 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (proc_invoke): should retrieve retval when pcall is true.
+
+Tue Sep 2 14:09:20 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * ext/socket/extconf.rb: check s6_addr8 in in6_addr (Tru64 UNIX).
+ the patch is submitted by nmu <nmu@users.sourceforge.jp>.
+
+ * ext/socket/getaddrinfo.c (getaddrinfo): should use in6_addr8 on
+ some platforms.
+
+ * ext/socket/getnameinfo.c (getnameinfo): ditto.
+
+Tue Sep 2 14:02:19 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * ext/tcltklib/tcltklib.c (ip_invoke): fixed bug on passing a exception
+
+ * ext/tk/lib/{tk.rb, tkcanvas.rb, tkfont.rb, tktext.rb} :
+ bug fix and improvement of font control
+
+Tue Sep 2 09:51:36 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (rb_eval): should not handle exceptions within rescue
+ argument. [ruby-talk:80804]
+
+Tue Sep 2 00:44:37 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * re.c (rb_memsearch): fix overrun. [ruby-talk:80759]
+
+Tue Sep 2 00:41:27 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/iconv/iconv.c (map_charset): use lower case keys.
+
+ * ext/iconv/iconv.c (iconv_fail): just yield error and return the
+ result if a block is given.
+
+ * ext/iconv/iconv.c (iconv_convert): yield error and append the
+ result if a block is given.
+
+ * ext/iconv/charset_alias.rb (charset_alias): optional third
+ argument.
+
+ * ext/iconv/charset_alias.rb (charset_alias): use CP932 instead of
+ SHIFT_JIS on cygwin.
+
+Mon Sep 1 18:34:25 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (rb_eval): make tail recursion in ELSE clause of
+ RESCUE a jump.
+
+Mon Sep 1 18:00:02 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * parse.y (aref_args): forgot to call NEW_SPLAT(). reported by
+ Dave Butcher.
+
+ * eval.c (Init_Thread): protect thgroup_default. suggested by Guy
+ Decoux in [ruby-talk:80623]
+
+Mon Sep 1 16:59:10 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (rb_thread_switch): add RESTORE_EXIT; exit by another
+ thread termination.
+
+ * eval.c (rb_thread_start_0): should not error_print() within
+ terminated thread, because $stderr used by it might be
+ overriden now. [ruby-dev:21280]
+
+Sun Aug 31 22:46:55 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * eval.c (TAG_DST()): take no argument.
+
+ * process.c (p_gid_sw_ensure): return VALUE.
+
+Sun Aug 31 22:27:10 2003 Hidetoshi NAGAI <nagai@dumbo.ai.kyutech.ac.jp>
+
+ * process.c (p_gid_sw_ensure): lack of function type
+
+Sun Aug 31 12:25:06 2003 Nobuyoshi Nakada <nobu.nokada@softhome.net>
+
+ * lib/optparse.rb: --version takes an optional argument; "all" or
+ a list of package names.
+
+Sun Aug 31 10:17:02 2003 Tadayoshi Funaba <tadf@dotrb.org>
+
+ * lib/date/format.rb: yyyy/mm is not an acceptable format.
+
+ * lib/time.rb: follow above.
+
+Sat Aug 30 14:25:43 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_iter_break): should not call TAG_JUMP directly.
+
+Sat Aug 30 03:58:21 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (struct BLOCK): remove BLOCKTAG, use scope instead.
+
+ * eval.c (POP_TAG): no longer propagate retval. retval is now set
+ directly by localjump_destination().
+
+ * eval.c (localjump_destination): new function to cast
+ return/break local jump.
+
+ * eval.c (rb_yield_0): stop TAG_RETURN/TAG_BREAK escaping.
+
+Fri Aug 29 22:35:00 2003 Shigeo Kobayashi <shigek@ruby-lang.org>
+
+ * bigdecimal.c *.html: The 2nd arg. for add,sub,mult, and div is 0,
+ then result will be the same as +,-,*,/ respectively.
+
+Fri Aug 29 17:30:15 2003 Hidetoshi NAGAI <nagai@ai.kyutech.ac.jp>
+
+ * process.c: bug fix
+
+ * process.c: add rb_secure(2) to methods of Process::{UID,GID,Sys}
+
+ * process.c: deny handling IDs during evaluating the block given to
+ the Process::{UID,GID}.switch method
+
+ * ext/tcltklib/tcltklib.c : some methods have no effect if on slave-IP
+
+ * ext/tcltklib/tcltklib.c : can create a interpreter without Tk
+
+ * ext/tcltklib/tcltklib.c : bug fix on handling exceptions
+
+ * ext/tcltklib/MANUAL.euc : modify
+
+ * ext/tk/lib/tk.rb : freeze some core modules
+
+ * ext/tk/lib/multi-tk.rb : more secure
+
+ * ext/tk/lib/tk.rb: TkVariable.new(array) --> treat the array as the
+ Tk's list
+
+ * ext/tk/lib/tk.rb: improve accessibility of TkVariable object
+
+ * ext/tk/lib/tk.rb, ext/tk/lib/tkfont.rb, ext/tk/lib/tkcanvas.rb,
+ ext/tk/lib/tktext.rb : fix bug of font handling
+
+ * ext/tk/lib/tkfont.rb TkFont.new() accepts compound fonts
+
+Thu Aug 28 22:07:12 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * variable.c (rb_autoload_load): call const_missing if autoloading
+ constant is not defined to allow hook.
+
+ * eval.c (rb_eval): use rb_const_get_from() instead of
+ rb_const_get_at().
+
+ * eval.c (is_defined): forgot to check NODE_COLON3.
+
+Thu Aug 28 17:30:24 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * variable.c (rb_const_get_0): should check constants defined in
+ included modules, if klass is Object. [ruby-talk:79302]
+
+ * numeric.c (check_uint): check should be done using UINT_MAX, not
+ INT_MAX. this fix is submitted by Lyle Johnson
+ <lyle@knology.net> in [ruby-core:01486]
+
+Thu Aug 28 05:02:52 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * parse.y (singleton): typo fixed (ruby-bugs-ja:PR#562)
+
+Thu Aug 28 02:37:45 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_eval): *a = [1,2] now assigns [[1,2]] to a.
+ consistent with *a = [1], which set [[1]] to a.
+
+ * node.h: merge NODE_RESTARY to NODE_SPLAT.
+
+ * parse.y: rules simplified a bit by removing NODE_RESTARY.
+
+ * sample/test.rb: updated for new assignment behavior.
+
+Wed Aug 27 22:33:24 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * error.c (rb_bug): should not use other methods; this function is
+ not for ordinary use. [ruby-dev:21259]
+
+Wed Aug 27 15:07:57 2003 Minero Aoki <aamine@loveruby.net>
+
+ * lib/net/smtp.rb (check_response): AUTH CRAM-MD5 returns 334
+ response. [ruby-list:38279]
+
+Wed Aug 27 05:10:15 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * win32/win32.c (map_errno): support winsock error.
+
+ * win32/win32.c (pipe_exec, CreateChild, poll_child_status, waitpid,
+ kill, link, rb_w32_rename, unixtime_to_filetime, rb_w32_utime):
+ pass errno to map_errno().
+
+ * win32/win32.c (rb_w32_select, rb_w32_accept, rb_w32_bind,
+ rb_w32_connect, rb_w32_getpeername, rb_w32_getsockname,
+ rb_w32_getsockopt, rb_w32_ioctlsocket, rb_w32_listen, rb_w32_recv,
+ rb_w32_recvfrom, rb_w32_send, rb_w32_sendto, rb_w32_setsockopt,
+ rb_w32_shutdown, rb_w32_socket, rb_w32_gethostbyaddr,
+ rb_w32_gethostbyname, rb_w32_gethostname, rb_w32_getprotobyname,
+ rb_w32_getprotobynumber, rb_w32_getservbyname, rb_w32_getservbyport,
+ rb_w32_fclose, rb_w32_close): use map_errno().
+
+ * win32/win32.h: add winsock errors.
+
+Tue Aug 26 23:53:23 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * lib/ostruct.rb (OpenStruct::method_missing): prohibit modifying
+ frozen OpenStruct. [ruby-talk:80214]
+
+Tue Aug 26 20:03:50 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * lib/mkmf.rb (create_tmpsrc): add the hook for source.
+ [ruby-list:38122]
+
+Tue Aug 26 15:59:53 2003 why the lucky stiff <why@ruby-lang.org>
+
+ * implicit.c (syck_type_id_to_taguri): corrected detection of
+ x-private types.
+
+Sun Aug 24 01:02:48 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * file.c (file_expand_path): performance improvement.
+ [ruby-talk:79748]
+
+Sat Aug 23 23:41:16 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * file.c (rb_file_s_expand_path): avoid calling rb_scan_args() for
+ apparent cases. [ruby-talk:79748]
+
+Sat Aug 23 18:56:53 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/nkf/nkf.c (rb_nkf_putchar): should use rb_str_resize() to just
+ resize a string, rb_str_cat() disallows NULL. [ruby-dev:21237]
+
+Sat Aug 23 16:48:41 2003 Keiju Ishitsuka <keiju@ishitsuka.com>
+
+ * lib/irb/ruby-lex.rb: bug fix for "foo" !~ /bar/. [ruby-talk:79942]
+
+Sat Aug 23 15:59:58 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (rb_eval, rb_iterate, block_pass): reduce PUSH/POP_TAG and
+ EXEC_TAG() for retry. [ruby-dev:21216]
+
+Sat Aug 23 02:32:33 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_yield_splat): should check if "values" is array.
+
+ * enum.c (each_with_index_i): typo.
+
+Fri Aug 22 17:07:05 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * enum.c (inject_i): use rb_yield_values.
+
+ * enum.c (each_with_index_i): ditto.
+
+ * eval.c (rb_yield_splat): new function to call "yield *values".
+
+ * string.c (rb_str_scan): use rb_yield_splat().
+
+Fri Aug 22 06:13:22 2003 why the lucky stiff <why@ruby-lang.org>
+
+ * ext/syck/rubyext.c: refactoring of the transfer method
+ dispatch. added yaml_org_handler for faster dispatch of
+ transfers to base types.
+
+ * lib/yaml/rubytypes.rb: removed handling of builtins from
+ Ruby library.
+
+ * ext/syck/token.c: quoted and block scalars are now implicit !str
+
+ * ext/syck/implicit.c: empty string detected as !null.
+
+Fri Aug 22 01:00:31 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (block_pass): improve passing current block.
+
+Tue Aug 21 00:13:00 2003 Shigeo Kobayashi <shigek@ruby-lang.org>
+
+ * ext/bigdecimal/bigdecimal.c: Int. overflow bug in multiplication
+ fixed, and VpNmlz() speed up.
+
+Wed Aug 20 16:44:49 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/socket/socket.c (ruby_connect): many systems seem to have
+ a problem in select() after EINPROGRESS. [ruby-list:38080]
+
+Wed Aug 20 01:31:17 2003 why the lucky stiff <why@ruby-lang.org>
+
+ * ext/syck/syck.h: Parser definition problems on HP-UX.
+ [ruby-talk:79389]
+
+ * ext/syck/handler.c (syck_hdlr_get_anchor): Memory leak.
+
+ * ext/syck/syck.s (syck_io_file_read): Bad arguments to fread.
+
+ * ext/syck/rubyext.c: Tainting issues.
+
+Tue Aug 19 23:20:00 2003 Shigeo Kobayashi <shigek@ruby-lang.org>
+
+ * ext/bigdecimal/bigdecimal.c .h .html: to_s("+") implemented.
+
+ * ext/bigdecimal/lib/bigdecimal/math.rb: E implemented.
+
+Tue Aug 19 07:47:09 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * lib/webrick/ssl.rb: new file; SSL/TLS enhancement for GenericServer.
+
+ * lib/webrick/https.rb: SSLSocket handling is moved to webrick/ssl.rb.
+
+ * lib/webrick/compat.rb (File::fnmatch): remove old migration code.
+
+ * lib/webrick/httpserver.rb (HTTPServer#run): ditto.
+
+ * lib/webrick/server.rb (GenericServer#listen): the body of this
+ method is pull out as Utils::create_lisnteners.
+
+ * lib/webrick/utils.rb (Utils::create_lisnteners): new method.
+
+ * lib/webrick/server.rb (GenericServer#start): should rescue
+ unknown errors. and refine comments.
+
+ * ext/openssl/lib/openssl/ssl.rb (SSLServer#accept): should close
+ socket if SSLSocket raises error.
+
+Tue Aug 19 11:19:33 2003 Shugo Maeda <shugo@ruby-lang.org>
+
+ * io.c (next_argv): should not call GetOpenFile() if rb_stdout is
+ not a IO (T_FILE).
+
+Tue Aug 19 07:47:09 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * ext/openssl/ossl_ssl.c: sync_close is moved to SSLSocket as
+ a builtin.
+
+ * ext/openssl/lib/openssl/buffering.rb (Buffering#close): ditto.
+
+ * ext/openssl/lib/openssl/buffering.rb (Buffering#puts): should
+ add a return to the tails of each line.
+
+ * ext/openssl/lib/openssl/ssl.rb: new class OpenSSL::SSL::SSLServer.
+
+ * ext/openssl/lib/net/protocols.rb (SSLIO#ssl_connect): use sync_close.
+
+ * ext/openssl/sample/echo_svr.rb: use SSLServer.
+
+ * ext/openssl/sample/echo_cli.rb: add example of SSLSocket#sync_close.
+
+Tue Aug 19 01:24:34 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/curses/curses.c (_XOPEN_SOURCE_EXTENDED): Mac OS X standard
+ headers are inconsistent at this macro. [ruby-core:01432]
+
+ * ext/curses/extconf.rb: check if _XOPEN_SOURCE_EXTENDED breaks.
+
+ * ext/tcltklib/stubs.c: Status macro in X11/Xthreads.h bothers
+ winspool.h
+
+ * instruby.rb: make list at first instead of iterator.
+ [ruby-talk:79347]
+
+Mon Aug 18 11:23:11 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * dir.c (glob_helper): preserve raw order for **.
+
+Sun Aug 17 23:39:55 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/openssl/extconf.rb (HAVE_VA_ARGS_MACRO): need to compile.
+
+Sun Aug 17 17:10:03 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * ext/openssl/lib/openssl/ssl.rb (SSLSocket#sync_close=): add a
+ method to specify if the underlying IO will be closed in
+ SSLSocket#close.
+
+ * ext/openssl/lib/openssl/buffering.rb: add forwarders to
+ setsockopt, getsockopt and fcntl.
+
+ * ext/openssl/lib/net/protocols.rb: enable sync for SSLSocket.
+
+Sun Aug 17 11:32:04 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/extmk.rb (extmake): should not force to remake Makefile when
+ installation and so on.
+
+Sat Aug 16 23:58:18 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * marshal.c (w_symbol, w_object): get rid of warnings.
+
+ * re.c (rb_memsearch): ditto.
+
+ * time.c (time_dump): ditto.
+
+ * ext/extmk.rb (extmake): not continue making when extconf.rb
+ failed.
+
+ * ext/openssl/extconf.rb: check __VA_ARGS__ macro more precisely.
+
+ * ext/openssl/ossl.h: remove version.h dependency.
+
+ * ext/openssl/ruby_missing.h: ditto.
+
+ * lib/mkmf.rb (pkg_config): use --libs output except with
+ only-L for other options. [ruby-list:38099]
+
+ * lib/mkmf.rb (create_makefile): separate rule for static
+ library from shared object.
+
+ * win32/Makefile.sub, bcc32/Makefile.sub, wince/Makefile.sub:
+ define exec_prefix and libdir.
+
+Fri Aug 15 23:15:00 2003 Shigeo Kobayashi <shigek@ruby-lang.org>
+
+ * ext/bigdecimal/bigdecimal.c .h: Bug in combination of limit & div
+ method fixed.
+
+ * ext/bigdecimal/lib/bigdecimal/math.rb: atan() & sqrt() added.
+
+Fri Aug 15 12:01:43 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * configure.in (HUGE_ST_INO): check whether struct stat.st_ino
+ is larger than long. [ruby-dev:21194]
+ http://www.geocities.co.jp/SiliconValley-PaloAlto/1409/ruby/beos.html
+
+ * error.c (syserr_eqq): errno might exceed Fixnum limit.
+
+ * error.c (Init_Exception): moved base initialization from
+ init_syserr().
+
+ * inits.c (rb_call_inits): postpone initializing errnos until
+ Bignum is available.
+
+Fri Aug 15 12:01:43 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/curses/curses.c (_XOPEN_SOURCE_EXTENDED): needed to let
+ keyname() and so on be declared.
+
+ * ext/curses/curses.c (curses_resizeterm, window_resize):
+ arguments conflicted with macros in term.h.
+
+ * ext/curses/curses.c (Curses module methods): ensure
+ initialized. [ruby-dev:21191]
+
+Fri Aug 15 02:08:53 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * gc.c (id2ref): recycle check should be done by klass == 0.
+ [ruby-core:01408]
+
+Fri Aug 15 01:34:23 2003 Michal Rokos <m.rokos@sh.cvut.cz>
+
+ * ext/openssl/ossl_pkey.c: move generate_cb here
+
+ * ext/openssl/ossl_pkey_{dh|dsa|rsa}.c: adapt to this cb
+
+ * ext/openssl/openssl_missing.[ch]: add (0.9.6x, x<j) missing BN funcs
+
+ * ext/openssl/ossl_bn.c: use supplied funcs from openssl_missing.c
+
+Fri Aug 15 00:38:00 2003 Shigeo Kobayashi <shigek@ruby-lang.org>
+
+ * ext/bigdecimal/bigdecimal.c: Bug in div method fixed.
+
+ * ext/bigdecimal/lib/bigdecimal/math.rb: Newly added.
+
+ * ext/bigdecimal/sample/pi.rb: Changed so as to use math.rb.
+
+Thu Aug 14 21:19:14 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (Init_Thread): Continuation#[] added. [ruby-talk:79028]
+
+Thu Aug 14 20:03:34 2003 Masaki Suketa <masaki.suketa@nifty.ne.jp>
+
+ * ext/win32ole/win32ole.c (OLE_FREE): should not call
+ ole_message_loop.
+
+ * ext/win32ole/win32ole.c (ole_event_free): ditto.
+
+ * ext/win32ole/win32ole.c (ole_initialize): stop calling
+ OleUninitialize at exit.
+
+Thu Aug 14 11:27:37 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * gc.c (rb_data_object_alloc): check type of 1st argument.
+ [ruby-dev:21192]
+
+Thu Aug 14 00:21:14 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * parse.y (mlhs_node): should allow "::Foo" (colon3) as lhs.
+
+ * parse.y (lhs): ditto.
+
+ * parse.y (yylex): should return tCOLON3 right after kCLASS.
+ [ruby-talk:78918]
+
+ * error.c (exc_initialize): was converting argument to string too
+ eagerly. Only check was needed. [ruby-talk:78958]
+
+Wed Aug 13 23:31:00 2003 Shigeo Kobayashi <shigek@ruby-lang.org>
+
+ * ext/bigdecimal/bigdecimal.c .h .html: Ambiguity of
+ BigDecimal::limit removed.
+
+Wed Aug 13 19:21:34 2003 Christian Neukirchen <chneukirchen@yahoo.de>
+
+ * lib/webrick/https.rb (HTTPServer#run): should set syncing-mode
+ to SSLSocket. [ruby-talk:78919]
+
+Wed Aug 13 18:13:49 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (POP_BLOCK): turn on BLOCK_LEFT flag when leaving block.
+
+ * eval.c (proc_invoke): unpack return/break destination when block
+ is already left.
+
+Wed Aug 13 15:58:31 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * object.c (rb_class_s_alloc): add function prototype to avoid VC++
+ warning.
+
+Wed Aug 13 13:50:59 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * ext/Win32API/Win32API.c (Win32API_initialize): should pass some
+ class to first argument of Data_Wrap_Struct(). (ruby-bugs:PR#1109)
+
+Tue Aug 12 16:55:11 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * Makefile.in: static link libraries to LIBRUBY_SO with static linked
+ ext. [ruby-dev:21157]
+
+ * ext/extmk.rb (extmake): sort extension library initialization order.
+
+ * ext/extmk.rb (extmake): compact $extlibs.
+
+Tue Aug 12 02:48:56 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (THREAD_SAVE_CONTEXT): should explicitly turn off the
+ flag before calling getcontext(2).
+
+ * eval.c (struct thread): add member to save backing store on
+ IA64. (ruby-bugs PR1086)
+
+ * eval.c (thread_mark): mark IA64 backing store region.
+
+ * eval.c (thread_free): free saved IA64 backing store.
+
+ * eval.c (rb_thread_save_context): save IA64 backing store as well.
+
+ * eval.c (rb_thread_restore_context): restore IA64 backing store.
+
+ * eval.c (THREAD_ALLOC): initialize IA64 members.
+
+Mon Aug 11 22:31:50 2003 NAKAMURA, Hiroshi <nahi@ruby-lang.org>
+ * lib/debug.rb(debug_command): inspection command should inspect
+ resulting value even if it's nil. [ruby-dev:21180] by OMAE, jun
+ <jun66j5@ybb.ne.jp>.
+
+ * lib/debug.rb(debug_command): incomplete regexp.
+
+Mon Aug 11 17:33:07 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_call_super): do not use rb_block_given_p() for
+ check. [ruby-talk:78656]
+
+ * eval.c (BEGIN_CALLARGS): push ITER_NOT only when ITER_PRE.
+
+Sun Aug 10 10:43:05 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * ext/openssl/lib/openssl/buffering.rb: increase BLOCK_SIZE
+ from 1k to 16k bytes. [ruby-talk:78603]
+
+ * ext/openssl/ossl_ssl.c (ossl_sslctx_s_alloc): enable
+ partial write to allow interruption in SSLSocket#write.
+
+Sun Aug 10 00:34:16 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * cygwin/GNUmakefile: remove unnecessary '--drive-name=$(CC)'
+ for ccache.
+
+Sat Aug 9 10:36:21 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * marshal.c (w_object): do not dump generic instance variable when
+ marshal_dump is defined.
+
+Sat Aug 9 00:35:00 2003 Shigeo Kobayashi <shigek@ruby-lang.org>
+
+ * ext/bigdecimal.c: F style output(like 1234.56789) implemented
+ to to_s method.
+ * ext/bigdecimal_??.html: F style output(like 1234.56789)
+ implemented to to_s method.
+
+Fri Aug 8 12:33:17 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * bcc32/Makefile.sub: rubyw.exe should be a Windows GUI program.
+ add the -aa option to WLDFLAGS.
+
+Fri Aug 8 11:29:26 2003 Koji Arai <jca02266@nifty.ne.jp>
+
+ * marshal.c (w_object): should set `c_arg' at first.
+
+Fri Aug 8 03:22:28 2003 GOTOU Yuuzou <gotoyuzo@notwork.org>
+
+ * lib/webrick/httputils.rb (FormData#list): should not take
+ a side effect for the receiver.
+
+Thu Aug 7 14:40:37 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * cygwin/GNUmakefile: better --disbale-shared option support.
+
+ * cygwin/GNUmakefile: add forwarding DLL target for cygwin.
+
+Thu Aug 7 14:21:05 2003 Corinna Vinschen <vinschen@redhat.com>
+
+ * configure.in: Fix Cygwin specific naming of libraries to
+ be net distribution compliant. (ruby-bugs:PR#1077)
+ cygwin-ruby18.dll -> cygruby18.dll
+
+Thu Aug 7 12:51:38 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_f_at_exit): should not be called without a block.
+ block_given check added.
+
+Thu Aug 7 06:46:06 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_call0): forgot to pop ruby_class.
+
+ * eval.c (rb_call0): update ruby_class as well as ruby_cref.
+ (ruby-bugs-ja:PR#540)
+
+Thu Aug 7 04:52:50 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_yield_0): remove ruby_frame->cbase and unify to
+ ruby_cref. [ruby-talk:78141]
+
+Thu Aug 7 04:19:15 2003 Akinori MUSHA <knu@iDaemons.org>
+
+ * gc.c: FreeBSD/ia64's mcontext_t is a bit different from that of
+ Linux/ia64. This makes gc.c compile but miniruby coredumps for
+ the moment.
+
+Wed Aug 7 00:15:00 2003 Shigeo Kobayashi <shigek@ruby-lang.org>
+
+ * ext/bigdecimal.c: Comparison results adjusted to Float's.
+ * ext/bigdecimal.c: Use rb_num_coerce_????(x,y) instead of own.
+
+Wed Aug 6 22:58:00 2003 Nathaniel Talbott <ntalbott@ruby-lang.org>
+
+ * lib/test/unit/testcase.rb: Added equality checking.
+ * lib/test/unit/testsuite.rb: Added equality checking.
+ * lib/test/unit/assertions.rb: Fixed a warning.
+
+Wed Aug 6 17:28:10 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * ext/extmk.rb (extmake): pass LIBPATH to make ruby. [ruby-dev:21137]
+
+ * ext/extmk.rb (extmake): set library name as source file name in
+ Init_ext(). [ruby-dev:21137]
+
+ * lib/mkmf.rb (Logging::postpone): postpone logging messages after
+ heading message as the result of the block.
+
+ * lib/mkmf.rb (macro_defined?): append newline to src unless ended
+ with it.
+
+ * lib/mkmf.rb (have_library): treat nil function name as "main".
+ (ruby-bugs:PR#1083)
+
+ * lib/mkmf.rb (pkg_config): should append additional libraries to
+ $libs but not $LIBS. [ruby-dev:21137]
+
+ * ext/io/wait/extconf.rb: check DOSISH macro instead of platform.
+
+ * ext/digest/sha1/extconf.rb: have_library already appends library
+ name.
+
+Wed Aug 6 17:23:57 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c: initialize /* OK */ variables by Qnil to stop warnings.
+
+Wed Aug 6 04:58:32 2003 NAKAMURA Usaku <usa@ruby-lang.org>
+
+ * ext/Setup*: add io/wait and openssl.
+
+Wed Aug 6 01:13:38 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * eval.c (rb_f_autoload): use ruby_cbase instead of ruby_class.
+
+ * eval.c (rb_f_autoload_p): ditto.
+
+ * class.c (rb_mod_init_copy): no longer implements independent
+ clone and dup methods. override "initialize_copy" instead.
+ [ruby-core:01352]
+
+ * object.c (rb_class_s_alloc): define Class allocation function.
+ this makes Classes to follow clone framework that uses
+ initialize_copy.
+
+ * object.c (rb_class_initialize): separate instantiation and
+ initialization.
+
+ * object.c (rb_obj_alloc): prohibit instantiation from
+ uninitialized class.
+
+ * object.c (rb_class_superclass): check uninitialized class.
+
+ * array.c (rb_ary_fill): wrong index processing with block. this
+ fix was done by Koji Arai <JCA02266@nifty.ne.jp> [ruby-list:38029]
+
+ * marshal.c (w_object): should preserve generic ivar for nil,
+ true, false, symbols, and fixnums.
+
+ * marshal.c (w_uclass): base_klass check should be done after
+ rb_class_real().
+
+Wed Aug 6 01:18:50 2003 Minero Aoki <aamine@loveruby.net>
+
+ * lib/net/http.rb: update document.
+
+ * lib/net/pop.rb: ditto.
+
+ * lib/net/protocol.rb: ditto.
+
+Wed Aug 6 00:48:37 2003 Koji Arai <jca02266@nifty.ne.jp>
+
+ * marshal.c (w_object): should recommend marshal_dump rather than
+ _dump_data.
+
+Tue Aug 5 17:58:57 2003 WATANABE Hirofumi <eban@ruby-lang.org>
+
+ * lib/fileutils.rb (install): should preserve timestamp only.
+
+Tue Aug 5 17:31:59 2003 Ian Macdonald <ian@caliban.org>
+
+ * lib/shell/command-processor.rb (Shell::CommandProcessor::rmdir):
+ simple typo.
+
+Tue Aug 5 15:47:34 2003 Nobuyoshi Nakada <nobu@ruby-lang.org>
+
+ * eval.c (rb_load): should preserve current source file/line.
+
+Tue Aug 5 10:04:42 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * string.c (str_new4): ptr may refer null_str.
+
+Mon Aug 4 17:25:18 2003 Yukihiro Matsumoto <matz@ruby-lang.org>
+
+ * stable version 1.8.0 released.
+
+For the changes before 1.8.0, see doc/ChangeLog-1.8.0
+
+Local variables:
+add-log-time-format: (lambda ()
+ (let* ((time (current-time))
+ (diff (+ (cadr time) 32400))
+ (lo (% diff 65536))
+ (hi (+ (car time) (/ diff 65536))))
+ (format-time-string "%a %b %e %H:%M:%S %Y" (list hi lo) t)))
+indent-tabs-mode: t
+tab-width: 8
+end:
diff --git a/GPL b/GPL
index d159169d10..5b6e7c66c2 100644
--- a/GPL
+++ b/GPL
@@ -1,12 +1,12 @@
- GNU GENERAL PUBLIC LICENSE
- Version 2, June 1991
+ GNU GENERAL PUBLIC LICENSE
+ Version 2, June 1991
- Copyright (C) 1989, 1991 Free Software Foundation, Inc.,
- 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA
+ Copyright (C) 1989, 1991 Free Software Foundation, Inc.
+ 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA
Everyone is permitted to copy and distribute verbatim copies
of this license document, but changing it is not allowed.
- Preamble
+ Preamble
The licenses for most software are designed to take away your
freedom to share and change it. By contrast, the GNU General Public
@@ -15,7 +15,7 @@ software--to make sure the software is free for all its users. This
General Public License applies to most of the Free Software
Foundation's software and to any other program whose authors commit to
using it. (Some other Free Software Foundation software is covered by
-the GNU Lesser General Public License instead.) You can apply it to
+the GNU Library General Public License instead.) You can apply it to
your programs, too.
When we speak of free software, we are referring to freedom, not
@@ -55,8 +55,8 @@ patent must be licensed for everyone's free use or not licensed at all.
The precise terms and conditions for copying, distribution and
modification follow.
-
- GNU GENERAL PUBLIC LICENSE
+
+ GNU GENERAL PUBLIC LICENSE
TERMS AND CONDITIONS FOR COPYING, DISTRIBUTION AND MODIFICATION
0. This License applies to any program or other work which contains
@@ -110,7 +110,7 @@ above, provided that you also meet all of these conditions:
License. (Exception: if the Program itself is interactive but
does not normally print such an announcement, your work based on
the Program is not required to print an announcement.)
-
+
These requirements apply to the modified work as a whole. If
identifiable sections of that work are not derived from the Program,
and can be reasonably considered independent and separate works in
@@ -168,7 +168,7 @@ access to copy from a designated place, then offering equivalent
access to copy the source code from the same place counts as
distribution of the source code, even though third parties are not
compelled to copy the source along with the object code.
-
+
4. You may not copy, modify, sublicense, or distribute the Program
except as expressly provided under this License. Any attempt
otherwise to copy, modify, sublicense or distribute the Program is
@@ -225,7 +225,7 @@ impose that choice.
This section is intended to make thoroughly clear what is believed to
be a consequence of the rest of this License.
-
+
8. If the distribution and/or use of the Program is restricted in
certain countries either by patents or by copyrighted interfaces, the
original copyright holder who places the Program under this License
@@ -255,7 +255,7 @@ make exceptions for this. Our decision will be guided by the two goals
of preserving the free status of all derivatives of our free software and
of promoting the sharing and reuse of software generally.
- NO WARRANTY
+ NO WARRANTY
11. BECAUSE THE PROGRAM IS LICENSED FREE OF CHARGE, THERE IS NO WARRANTY
FOR THE PROGRAM, TO THE EXTENT PERMITTED BY APPLICABLE LAW. EXCEPT WHEN
@@ -277,9 +277,9 @@ YOU OR THIRD PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER
PROGRAMS), EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE
POSSIBILITY OF SUCH DAMAGES.
- END OF TERMS AND CONDITIONS
-
- How to Apply These Terms to Your New Programs
+ END OF TERMS AND CONDITIONS
+
+ How to Apply These Terms to Your New Programs
If you develop a new program, and you want it to be of the greatest
possible use to the public, the best way to achieve this is to make it
@@ -303,9 +303,10 @@ the "copyright" line and a pointer to where the full notice is found.
MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
GNU General Public License for more details.
- You should have received a copy of the GNU General Public License along
- with this program; if not, write to the Free Software Foundation, Inc.,
- 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA.
+ You should have received a copy of the GNU General Public License
+ along with this program; if not, write to the Free Software
+ Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA
+
Also add information on how to contact you by electronic and paper mail.
@@ -335,5 +336,5 @@ necessary. Here is a sample; alter the names:
This General Public License does not permit incorporating your program into
proprietary programs. If your program is a subroutine library, you may
consider it more useful to permit linking proprietary applications with the
-library. If this is what you want to do, use the GNU Lesser General
+library. If this is what you want to do, use the GNU Library General
Public License instead of this License.
diff --git a/KNOWNBUGS.rb b/KNOWNBUGS.rb
deleted file mode 100644
index 35a8e75876..0000000000
--- a/KNOWNBUGS.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-#
-# IMPORTANT: Always keep the first 7 lines (comments),
-# even if this file is otherwise empty.
-#
-# This test file includes tests which point out known bugs.
-# So all tests will cause failure.
-#
diff --git a/LEGAL b/LEGAL
index 565c4c9cde..dce7c1acbf 100644
--- a/LEGAL
+++ b/LEGAL
@@ -1,231 +1,61 @@
-# -*- rdoc -*-
-
-= LEGAL NOTICE INFORMATION
---------------------------
+LEGAL NOTICE INFORMATION
+------------------------
All the files in this distribution are covered under either the Ruby's
license (see the file COPYING) or public-domain except some files
mentioned below.
-ccan/build_assert/build_assert.h::
-ccan/check_type/check_type.h::
-ccan/container_of/container_of.h::
-ccan/str/str.h::
-
- These files are licensed under the CC0.
-
- >>>
- https://creativecommons.org/choose/zero/
-
-ccan/list/list.h::
-
- This file is licensed under the MIT License.
-
- >>>
- Permission is hereby granted, free of charge, to any person obtaining a copy
- of this software and associated documentation files (the "Software"), to deal
- in the Software without restriction, including without limitation the rights
- to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
- copies of the Software, and to permit persons to whom the Software is
- furnished to do so, subject to the following conditions:
-
- The above copyright notice and this permission notice shall be included in
- all copies or substantial portions of the Software.
-
- THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
- IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
- FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
- AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
- LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
- OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN
- THE SOFTWARE.
-
-include/ruby/onigmo.h::
-include/ruby/oniguruma.h::
-regcomp.c::
-regenc.c::
-regenc.h::
-regerror.c::
-regexec.c::
-regint.h::
-regparse.c::
-regparse.h::
-enc/ascii.c::
-enc/big5.c::
-enc/cp949.c::
-enc/emacs_mule.c::
-enc/encdb.c::
-enc/euc_jp.c::
-enc/euc_kr.c::
-enc/euc_tw.c::
-enc/gb18030.c::
-enc/gb2312.c::
-enc/gbk.c::
-enc/iso_8859_1.c::
-enc/iso_8859_10.c::
-enc/iso_8859_11.c::
-enc/iso_8859_13.c::
-enc/iso_8859_14.c::
-enc/iso_8859_15.c::
-enc/iso_8859_16.c::
-enc/iso_8859_2.c::
-enc/iso_8859_3.c::
-enc/iso_8859_4.c::
-enc/iso_8859_5.c::
-enc/iso_8859_6.c::
-enc/iso_8859_7.c::
-enc/iso_8859_8.c::
-enc/iso_8859_9.c::
-enc/koi8_r.c::
-enc/koi8_u.c::
-enc/shift_jis.c::
-enc/unicode.c::
-enc/us_ascii.c::
-enc/utf_16be.c::
-enc/utf_16le.c::
-enc/utf_32be.c::
-enc/utf_32le.c::
-enc/utf_8.c::
-enc/windows_1251.c::
-
- Onigmo (Oniguruma-mod) LICENSE
-
- >>>
- Copyright (c) 2002-2009 K.Kosako <sndgk393 AT ybb DOT ne DOT jp>
- Copyright (c) 2011-2014 K.Takata <kentkt AT csc DOT jp>
- All rights reserved.
-
- Redistribution and use in source and binary forms, with or without
- modification, are permitted provided that the following conditions
- are met:
- 1. Redistributions of source code must retain the above copyright
- notice, this list of conditions and the following disclaimer.
- 2. Redistributions in binary form must reproduce the above copyright
- notice, this list of conditions and the following disclaimer in the
- documentation and/or other materials provided with the distribution.
-
- THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
- ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
- IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
- FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
- DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
- OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
- HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
- LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
- OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
- SUCH DAMAGE.
-
- Oniguruma LICENSE
-
- >>>
- Copyright (c) 2002-2009 K.Kosako <sndgk393 AT ybb DOT ne DOT jp>
- All rights reserved.
-
- Redistribution and use in source and binary forms, with or without
- modification, are permitted provided that the following conditions
- are met:
- 1. Redistributions of source code must retain the above copyright
- notice, this list of conditions and the following disclaimer.
- 2. Redistributions in binary form must reproduce the above copyright
- notice, this list of conditions and the following disclaimer in the
- documentation and/or other materials provided with the distribution.
-
- THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
- ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
- IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
- FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
- DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
- OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
- HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
- LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
- OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
- SUCH DAMAGE.
-
- * https://github.com/k-takata/Onigmo/
- * https://github.com/kkos/oniguruma
- * https://svnweb.freebsd.org/ports/head/devel/oniguruma/
+regex.[ch]:
- When this software is partly used or it is distributed with Ruby,
- this of Ruby follows the license of Ruby.
+ These files are under LGPL. Treat them as LGPL says. (See the file
+ LGPL for details)
-enc/trans/GB/GB12345%UCS.src::
-enc/trans/GB/UCS%GB12345.src::
-enc/trans/GB/GB2312%UCS.src::
-enc/trans/GB/UCS%GB2312.src::
+ Extended regular expression matching and search library.
+ Copyright (C) 1993, 94, 95, 96, 97, 98 Free Software Foundation, Inc.
- These files have this explanatory texts.
+ The GNU C Library is free software; you can redistribute it and/or
+ modify it under the terms of the GNU Library General Public License as
+ published by the Free Software Foundation; either version 2 of the
+ License, or (at your option) any later version.
- >>>
- This mapping data was created from files provided by Unicode, Inc.
- (The Unicode Consortium). The files were used to create a product supporting
- Unicode, as explicitly permitted in the files' copyright notices.
- Please note that Unicode, Inc. never made any claims as to fitness of these
- files for any particular purpose, and has ceased to publish the files many
- years ago.
-
-enc/trans/JIS/JISX0201-KANA%UCS.src::
-enc/trans/JIS/JISX0208\@1990%UCS.src::
-enc/trans/JIS/JISX0212%UCS.src::
-enc/trans/JIS/UCS%JISX0201-KANA.src::
-enc/trans/JIS/UCS%JISX0208@1990.src::
-enc/trans/JIS/UCS%JISX0212.src::
-
- These files are copyrighted as the following.
-
- >>>
- © 2015 Unicode®, Inc.
-
- For terms of use, see http://www.unicode.org/terms_of_use.html
-
-enc/trans/JIS/JISX0213-1%UCS@BMP.src::
-enc/trans/JIS/JISX0213-1%UCS@SIP.src::
-enc/trans/JIS/JISX0213-2%UCS@BMP.src::
-enc/trans/JIS/JISX0213-2%UCS@SIP.src::
-
- These files are copyrighted as the following.
-
- >>>
- Copyright (C) 2001 earthian@tama.or.jp, All Rights Reserved.
- Copyright (C) 2001 I'O, All Rights Reserved.
- Copyright (C) 2006 Project X0213, All Rights Reserved.
- You can use, modify, distribute this table freely.
-
-enc/trans/JIS/UCS@BMP%JISX0213-1.src::
-enc/trans/JIS/UCS@BMP%JISX0213-2.src::
-enc/trans/JIS/UCS@SIP%JISX0213-1.src::
-enc/trans/JIS/UCS@SIP%JISX0213-2.src::
+ The GNU C Library is distributed in the hope that it will be useful,
+ but WITHOUT ANY WARRANTY; without even the implied warranty of
+ MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU
+ Library General Public License for more details.
- These files are copyrighted as the following.
+ You should have received a copy of the GNU Library General Public
+ License along with the GNU C Library; see the file LGPL. If not,
+ write to the Free Software Foundation, Inc., 59 Temple Place - Suite 330,
+ Boston, MA 02111-1307, USA. */
- >>>
- Copyright (C) 2001 earthian@tama.or.jp, All Rights Reserved.
- Copyright (C) 2001 I'O, All Rights Reserved.
- You can use, modify, distribute this table freely.
+ Multi-byte extension added May, 1993 by t^2 (Takahiro Tanimoto)
+ Last change: May 21, 1993 by t^2
+ removed gapped buffer support, multiple syntax support by matz <matz@nts.co.jp>
+ Perl5 extension added by matz <matz@caelum.co.jp>
+ UTF-8 extension added Jan 16 1999 by Yoshida Masato <yoshidam@tau.bekkoame.ne.jp>
-configure::
+configure:
This file is free software.
- >>>
- Copyright (C) 1992-1996, 1998-2012 Free Software Foundation, Inc.
+ Copyright (C) 1992, 93, 94, 95, 96 Free Software Foundation, Inc.
This configure script is free software; the Free Software Foundation
gives unlimited permission to copy, distribute and modify it.
-tool/config.guess::
-tool/config.sub::
+config.guess:
+config.sub:
+parse.c:
As long as you distribute these files with the file configure, they
are covered under the Ruby's license.
- >>>
- Copyright 1992-2018 Free Software Foundation, Inc.
+ Copyright (C) 1992, 1993, 1994, 1995, 1996, 1997, 1998, 1999
+ Free Software Foundation, Inc.
This file is free software; you can redistribute it and/or modify it
under the terms of the GNU General Public License as published by
- the Free Software Foundation; either version 3 of the License, or
+ the Free Software Foundation; either version 2 of the License, or
(at your option) any later version.
This program is distributed in the hope that it will be useful, but
@@ -234,134 +64,54 @@ tool/config.sub::
General Public License for more details.
You should have received a copy of the GNU General Public License
- along with this program; if not, see <https://www.gnu.org/licenses/>.
+ along with this program; if not, write to the Free Software
+ Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
As a special exception to the GNU General Public License, if you
distribute this file as part of a program that contains a
configuration script generated by Autoconf, you may include it under
- the same distribution terms that you use for the rest of that
- program. This Exception is an additional permission under section 7
- of the GNU General Public License, version 3 ("GPLv3").
-
-parse.c::
+ the same distribution terms that you use for the rest of that program.
- This file is licensed under the GPL, but is incorporated into Ruby and
- redistributed under the terms of the Ruby license, as permitted by the
- exception to the GPL below.
-
- >>>
- Copyright (C) 1984, 1989-1990, 2000-2015, 2018 Free Software Foundation, Inc.
-
- This program is free software: you can redistribute it and/or modify
- it under the terms of the GNU General Public License as published by
- the Free Software Foundation, either version 3 of the License, or
- (at your option) any later version.
-
- This program is distributed in the hope that it will be useful,
- but WITHOUT ANY WARRANTY; without even the implied warranty of
- MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
- GNU General Public License for more details.
-
- You should have received a copy of the GNU General Public License
- along with this program. If not, see <http://www.gnu.org/licenses/>.
-
- As a special exception, you may create a larger work that contains
- part or all of the Bison parser skeleton and distribute that work
- under terms of your choice, so long as that work isn't itself a
- parser generator using the skeleton or a modified version thereof
- as a parser skeleton. Alternatively, if you modify or redistribute
- the parser skeleton itself, you may (at your option) remove this
- special exception, which will cause the skeleton and the resulting
- Bison output files to be licensed under the GNU General Public
- License without this special exception.
-
- This special exception was added by the Free Software Foundation in
- version 2.2 of Bison.
-
-missing/dtoa.c::
-
- This file is under these licenses.
-
- >>>
- Copyright (c) 1991, 2000, 2001 by Lucent Technologies.
-
- Permission to use, copy, modify, and distribute this software for any
- purpose without fee is hereby granted, provided that this entire notice
- is included in all copies of any software which is or includes a copy
- or modification of this software and in all copies of the supporting
- documentation for such software.
-
- THIS SOFTWARE IS BEING PROVIDED "AS IS", WITHOUT ANY EXPRESS OR IMPLIED
- WARRANTY. IN PARTICULAR, NEITHER THE AUTHOR NOR LUCENT MAKES ANY
- REPRESENTATION OR WARRANTY OF ANY KIND CONCERNING THE MERCHANTABILITY
- OF THIS SOFTWARE OR ITS FITNESS FOR ANY PARTICULAR PURPOSE.
-
- >>>
- Copyright (c) 2004-2008 David Schultz <das@FreeBSD.ORG>
- All rights reserved.
-
- Redistribution and use in source and binary forms, with or without
- modification, are permitted provided that the following conditions
- are met:
- 1. Redistributions of source code must retain the above copyright
- notice, this list of conditions and the following disclaimer.
- 2. Redistributions in binary form must reproduce the above copyright
- notice, this list of conditions and the following disclaimer in the
- documentation and/or other materials provided with the distribution.
-
- THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
- ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
- IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
- FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
- DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
- OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
- HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
- LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
- OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
- SUCH DAMAGE.
-
-win32/win32.{c,h}::
+util.c (partly):
+win32/win32.[ch]:
You can apply the Artistic License to these files. (or GPL,
alternatively)
- >>>
Copyright (c) 1993, Intergraph Corporation
You may distribute under the terms of either the GNU General Public
License or the Artistic License, as specified in the perl README file.
-missing/mt19937.c::
+random.c
This file is under the new-style BSD license.
- >>>
A C-program for MT19937, with initialization improved 2002/2/10.
- Coded by Takuji Nishimura and Makoto Matsumoto.
+ Coded by Takuji Nishimura and Makoto Matsumoto.
This is a faster version by taking Shawn Cokus's optimization,
Matthe Bellew's simplification, Isaku Wada's real version.
- Before using, initialize the state by using init_genrand(seed)
+ Before using, initialize the state by using init_genrand(seed)
or init_by_array(init_key, key_length).
Copyright (C) 1997 - 2002, Makoto Matsumoto and Takuji Nishimura,
- All rights reserved.
+ All rights reserved.
Redistribution and use in source and binary forms, with or without
modification, are permitted provided that the following conditions
are met:
- 1. Redistributions of source code must retain the above copyright
- notice, this list of conditions and the following disclaimer.
+ 1. Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
- 2. Redistributions in binary form must reproduce the above copyright
- notice, this list of conditions and the following disclaimer in the
- documentation and/or other materials provided with the distribution.
+ 2. Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
- 3. The names of its contributors may not be used to endorse or promote
- products derived from this software without specific prior written
- permission.
+ 3. The names of its contributors may not be used to endorse or promote
+ products derived from this software without specific prior written
+ permission.
THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS
"AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
@@ -380,47 +130,69 @@ missing/mt19937.c::
http://www.math.keio.ac.jp/matumoto/emt.html
email: matumoto@math.keio.ac.jp
- The Wayback Machine url: http://web.archive.org/web/19990429082237/http://www.math.keio.ac.jp/matumoto/emt.html
+st.[ch]:
+x68/*:
+missing/alloca.c:
+missing/dup2.c:
+missing/erf.c:
+missing/finite.c:
+missing/hypot.c:
+missing/isinf.c:
+missing/isnan.c:
+missing/memcmp.c:
+missing/memmove.c:
+missing/mkdir.c:
+missing/strcasecmp.c:
+missing/strchr.c:
+missing/streror.c:
+missing/strftime.c:
+missing/strncasecmp.c:
+missing/strstr.c:
+missing/strtol.c:
+ext/digest/sha1/sha1.[ch]:
-missing/procstat_vm.c::
+ These files are all under public domain.
- This file is under the new-style BSD license.
+missing/strtod.c:
- >>>
- Copyright (c) 2007 Robert N. M. Watson
- All rights reserved.
+ This file will not be used on most platforms depending on how the
+ configure script results. In any case you must not receive any fee
+ with the file itself.
- Redistribution and use in source and binary forms, with or without
- modification, are permitted provided that the following conditions
- are met:
- 1. Redistributions of source code must retain the above copyright
- notice, this list of conditions and the following disclaimer.
- 2. Redistributions in binary form must reproduce the above copyright
- notice, this list of conditions and the following disclaimer in the
- documentation and/or other materials provided with the distribution.
+ Copyright (c) 1988-1993 The Regents of the University of California.
+ Copyright (c) 1994 Sun Microsystems, Inc.
- THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
- ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
- IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
- FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
- DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
- OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
- HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
- LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
- OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
- SUCH DAMAGE.
+ Permission to use, copy, modify, and distribute this
+ software and its documentation for any purpose and without
+ fee is hereby granted, provided that the above copyright
+ notice appear in all copies. The University of California
+ makes no representations about the suitability of this
+ software for any purpose. It is provided "as is" without
+ express or implied warranty.
+
+missing/strtoul.c:
+
+ This file will not be used on most platforms depending on how the
+ configure script results. In any case you must not receive any fee
+ with the file itself.
- $FreeBSD: head/usr.bin/procstat/procstat_vm.c 261780 2014-02-11 21:57:37Z jhb $
+ Copyright 1988 Regents of the University of California
-vsnprintf.c::
+ Permission to use, copy, modify, and distribute this
+ software and its documentation for any purpose and without
+ fee is hereby granted, provided that the above copyright
+ notice appear in all copies. The University of California
+ makes no representations about the suitability of this
+ software for any purpose. It is provided "as is" without
+ express or implied warranty.
+
+missing/vsnprintf.c:
This file is under the old-style BSD license. Note that the
paragraph 3 below is now null and void.
- >>>
- Copyright (c) 1990, 1993
- The Regents of the University of California. All rights reserved.
+ Copyright (c) 1990, 1993
+ The Regents of the University of California. All rights reserved.
This code is derived from software contributed to Berkeley by
Chris Torek.
@@ -433,7 +205,11 @@ vsnprintf.c::
2. Redistributions in binary form must reproduce the above copyright
notice, this list of conditions and the following disclaimer in the
documentation and/or other materials provided with the distribution.
- 3. Neither the name of the University nor the names of its contributors
+ 3. All advertising materials mentioning features or use of this software
+ must display the following acknowledgement:
+ This product includes software developed by the University of
+ California, Berkeley and its contributors.
+ 4. Neither the name of the University nor the names of its contributors
may be used to endorse or promote products derived from this software
without specific prior written permission.
@@ -454,142 +230,11 @@ vsnprintf.c::
From ftp://ftp.cs.berkeley.edu/pub/4bsd/README.Impt.License.Change
paragraph 3 above is now null and void.
-st.c::
-strftime.c::
-include/ruby/st.h::
-missing/acosh.c::
-missing/alloca.c::
-missing/dup2.c::
-missing/erf.c::
-missing/finite.c::
-missing/hypot.c::
-missing/isinf.c::
-missing/isnan.c::
-missing/lgamma_r.c::
-missing/memcmp.c::
-missing/memmove.c::
-missing/strchr.c::
-missing/strerror.c::
-missing/strstr.c::
-missing/tgamma.c::
-ext/date/date_strftime.c::
-ext/digest/sha1/sha1.c::
-ext/digest/sha1/sha1.h::
-ext/sdbm/_sdbm.c::
-ext/sdbm/sdbm.h::
-
- These files are all under public domain.
-
-missing/crypt.c::
-
- This file is under the old-style BSD license. Note that the
- paragraph 3 below is now null and void.
-
- >>>
- Copyright (c) 1989, 1993
- The Regents of the University of California. All rights reserved.
-
- This code is derived from software contributed to Berkeley by
- Tom Truscott.
-
- Redistribution and use in source and binary forms, with or without
- modification, are permitted provided that the following conditions
- are met:
- 1. Redistributions of source code must retain the above copyright
- notice, this list of conditions and the following disclaimer.
- 2. Redistributions in binary form must reproduce the above copyright
- notice, this list of conditions and the following disclaimer in the
- documentation and/or other materials provided with the distribution.
- 3. Neither the name of the University nor the names of its contributors
- may be used to endorse or promote products derived from this software
- without specific prior written permission.
-
- THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
- ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
- IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- ARE DISCLAIMED. IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
- FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
- DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
- OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
- HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
- LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
- OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
- SUCH DAMAGE.
-
-missing/setproctitle.c::
-
- This file is under the old-style BSD license. Note that the
- paragraph 3 below is now null and void.
-
- >>>
- Copyright 2003 Damien Miller
- Copyright (c) 1983, 1995-1997 Eric P. Allman
- Copyright (c) 1988, 1993
- The Regents of the University of California. All rights reserved.
-
- Redistribution and use in source and binary forms, with or without
- modification, are permitted provided that the following conditions
- are met:
- 1. Redistributions of source code must retain the above copyright
- notice, this list of conditions and the following disclaimer.
- 2. Redistributions in binary form must reproduce the above copyright
- notice, this list of conditions and the following disclaimer in the
- documentation and/or other materials provided with the distribution.
- 3. Neither the name of the University nor the names of its contributors
- may be used to endorse or promote products derived from this software
- without specific prior written permission.
-
- THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
- ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
- IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- ARE DISCLAIMED. IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
- FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
- DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
- OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
- HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
- LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
- OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
- SUCH DAMAGE.
-
-missing/strlcat.c::
-missing/strlcpy.c::
-
- These files are under an ISC-style license.
-
- >>>
- Copyright (c) 1998, 2015 Todd C. Miller <Todd.Miller@courtesan.com>
-
- Permission to use, copy, modify, and distribute this software for any
- purpose with or without fee is hereby granted, provided that the above
- copyright notice and this permission notice appear in all copies.
-
- THE SOFTWARE IS PROVIDED "AS IS" AND THE AUTHOR DISCLAIMS ALL WARRANTIES
- WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF
- MERCHANTABILITY AND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR
- ANY SPECIAL, DIRECT, INDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES
- WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, WHETHER IN AN
- ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF
- OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE.
-
-missing/langinfo.c::
-
- This file is from http://www.cl.cam.ac.uk/~mgk25/ucs/langinfo.c.
- Ruby uses a modified version. The file contains the following
- author/copyright notice:
-
- >>>
- Markus.Kuhn@cl.cam.ac.uk -- 2002-03-11
- Permission to use, copy, modify, and distribute this software
- for any purpose and without fee is hereby granted. The author
- disclaims all warranties with regard to this software.
-
-ext/digest/md5/md5.c::
-ext/digest/md5/md5.h::
+ext/digest/md5/md5.[ch]:
These files are under the following license. Ruby uses modified
versions of them.
- >>>
Copyright (C) 1999, 2000 Aladdin Enterprises. All rights reserved.
This software is provided 'as-is', without any express or implied
@@ -611,26 +256,33 @@ ext/digest/md5/md5.h::
L. Peter Deutsch
ghost@aladdin.com
-ext/digest/rmd160/rmd160.c::
-ext/digest/rmd160/rmd160.h::
+ext/digest/rmd160/rmd160.[ch]:
These files have the following copyright information, and by the
author we are allowed to use it under the new-style BSD license.
- >>>
- AUTHOR:: Antoon Bosselaers, ESAT-COSIC
+ AUTHOR: Antoon Bosselaers, ESAT-COSIC
(Arranged for libc by Todd C. Miller)
- DATE:: 1 March 1996
+ DATE: 1 March 1996
Copyright (c) Katholieke Universiteit Leuven
1996, All Rights Reserved
-ext/digest/sha2/sha2.c::
-ext/digest/sha2/sha2.h::
+ext/digest/rmd160/rmd160hl.c:
+ext/digest/sha1/sha1hl.c:
+
+ These files are under the beer-ware license.
+
+ "THE BEER-WARE LICENSE" (Revision 42):
+ <phk@login.dkuug.dk> wrote this file. As long as you retain this notice you
+ can do whatever you want with this stuff. If we meet some day, and you think
+ this stuff is worth it, you can buy me a beer in return. Poul-Henning Kamp
+
+ext/digest/sha2/sha2.[ch]:
+ext/digest/sha2/sha2hl.c:
These files are under the new-style BSD license.
- >>>
Copyright 2000 Aaron D. Gifford. All rights reserved.
Redistribution and use in source and binary forms, with or without
@@ -657,108 +309,25 @@ ext/digest/sha2/sha2.h::
OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
SUCH DAMAGE.
-ext/json/generator/generator.c::
-
- The file contains the following copyright notice.
-
- >>>
- Copyright 2001-2004 Unicode, Inc.
+ext/nkf/nkf1.7/nkf.c:
- Disclaimer::
-
- This source code is provided as is by Unicode, Inc. No claims are
- made as to fitness for any particular purpose. No warranties of any
- kind are expressed or implied. The recipient agrees to determine
- applicability of information provided. If this file has been
- purchased on magnetic or optical media from Unicode, Inc., the
- sole remedy for any claim will be exchange of defective media
- within 90 days of receipt.
-
- Limitations on Rights to Redistribute This Code::
-
- Unicode, Inc. hereby grants the right to freely use the information
- supplied in this file in the creation of products supporting the
- Unicode Standard, and to make copies of this file in any form
- for internal or external distribution as long as this notice
- remains attached.
-
-ext/nkf/nkf-utf8/config.h::
-ext/nkf/nkf-utf8/nkf.c::
-ext/nkf/nkf-utf8/utf8tbl.c::
-
- These files are under the following license. So to speak, it is
+ This file is under the following license. So to speak, it is
copyrighted semi-public-domain software.
- >>>
Copyright (C) 1987, Fujitsu LTD. (Itaru ICHIKAWA)
+ Everyone is permitted to do anything on this program
+ including copying, modifying, improving.
+ as long as you don't try to pretend that you wrote it.
+ i.e., the above copyright notice has to appear in all copies.
+ You don't have to ask before copying or publishing.
+ THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE.
- Everyone is permitted to do anything on this program
- including copying, modifying, improving,
- as long as you don't try to pretend that you wrote it.
- i.e., the above copyright notice has to appear in all copies.
- Binary distribution requires original version messages.
- You don't have to ask before copying, redistribution or publishing.
- THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE.
-
-ext/psych::
-test/psych::
-
- The files under these directories are under the following license, except for
- ext/psych/yaml.
-
- >>>
- Copyright 2009 Aaron Patterson, et al.
-
- Permission is hereby granted, free of charge, to any person obtaining a copy of
- this software and associated documentation files (the 'Software'), to deal in
- the Software without restriction, including without limitation the rights to
- use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies
- of the Software, and to permit persons to whom the Software is furnished to do
- so, subject to the following conditions:
-
- The above copyright notice and this permission notice shall be included in all
- copies or substantial portions of the Software.
-
- THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
- IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
- FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
- AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
- LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
- OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
- SOFTWARE.
-
-ext/psych/yaml::
-
- The files under this directory are under the following license.
-
- >>>
- Copyright (c) 2006 Kirill Simonov
-
- Permission is hereby granted, free of charge, to any person obtaining a copy of
- this software and associated documentation files (the "Software"), to deal in
- the Software without restriction, including without limitation the rights to
- use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies
- of the Software, and to permit persons to whom the Software is furnished to do
- so, subject to the following conditions:
-
- The above copyright notice and this permission notice shall be included in all
- copies or substantial portions of the Software.
-
- THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
- IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
- FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
- AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
- LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
- OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
- SOFTWARE.
-
-ext/socket/addrinfo.h::
-ext/socket/getaddrinfo.c::
-ext/socket/getnameinfo.c::
+ext/socket/addrinfo.h:
+ext/socket/getaddrinfo.c:
+ext/socket/getnameinfo.c:
These files are under the new-style BSD license.
- >>>
Copyright (C) 1995, 1996, 1997, 1998, and 1999 WIDE Project.
All rights reserved.
@@ -786,150 +355,17 @@ ext/socket/getnameinfo.c::
OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
SUCH DAMAGE.
-ext/win32ole/win32ole.c::
+ext/win32ole/win32ole.c:
You can apply the Artistic License to this file. (or GPL,
alternatively)
- >>>
(c) 1995 Microsoft Corporation. All rights reserved.
Developed by ActiveWare Internet Corp., http://www.ActiveWare.com
Other modifications Copyright (c) 1997, 1998 by Gurusamy Sarathy
<gsar@umich.edu> and Jan Dubois <jan.dubois@ibm.net>
-
+
You may distribute under the terms of either the GNU General Public
License or the Artistic License, as specified in the README file
of the Perl distribution.
-
- The Wayback Machine url: http://web.archive.org/web/19970607104352/http://www.activeware.com:80/
-
-lib/rdoc/generator/template/darkfish/css/fonts.css::
-
- This file is licensed under the SIL Open Font License.
-
- >>>
- http://scripts.sil.org/OFL
-
-spec/mspec::
-spec/ruby::
-
- The files under these directories are under the following license.
-
- >>>
- Copyright (c) 2008 Engine Yard, Inc. All rights reserved.
-
- Permission is hereby granted, free of charge, to any person
- obtaining a copy of this software and associated documentation
- files (the "Software"), to deal in the Software without
- restriction, including without limitation the rights to use,
- copy, modify, merge, publish, distribute, sublicense, and/or sell
- copies of the Software, and to permit persons to whom the
- Software is furnished to do so, subject to the following
- conditions:
-
- The above copyright notice and this permission notice shall be
- included in all copies or substantial portions of the Software.
-
- THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
- EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
- OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
- NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
- HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
- WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
- FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR
- OTHER DEALINGS IN THE SOFTWARE.
-
-lib/rubygems.rb::
-lib/rubygems::
-test/rubygems::
-
- RubyGems is under the following license.
-
- >>>
- RubyGems is copyrighted free software by Chad Fowler, Rich Kilmer, Jim
- Weirich and others. You can redistribute it and/or modify it under
- either the terms of the MIT license (see the file MIT.txt), or the
- conditions below:
-
- 1. You may make and give away verbatim copies of the source form of the
- software without restriction, provided that you duplicate all of the
- original copyright notices and associated disclaimers.
-
- 2. You may modify your copy of the software in any way, provided that
- you do at least ONE of the following:
-
- a. place your modifications in the Public Domain or otherwise
- make them Freely Available, such as by posting said
- modifications to Usenet or an equivalent medium, or by allowing
- the author to include your modifications in the software.
-
- b. use the modified software only within your corporation or
- organization.
-
- c. give non-standard executables non-standard names, with
- instructions on where to get the original software distribution.
-
- d. make other distribution arrangements with the author.
-
- 3. You may distribute the software in object code or executable
- form, provided that you do at least ONE of the following:
-
- a. distribute the executables and library files of the software,
- together with instructions (in the manual page or equivalent)
- on where to get the original distribution.
-
- b. accompany the distribution with the machine-readable source of
- the software.
-
- c. give non-standard executables non-standard names, with
- instructions on where to get the original software distribution.
-
- d. make other distribution arrangements with the author.
-
- 4. You may modify and include the part of the software into any other
- software (possibly commercial).
-
- 5. The scripts and library files supplied as input to or produced as
- output from the software do not automatically fall under the
- copyright of the software, but belong to whomever generated them,
- and may be sold commercially, and may be aggregated with this
- software.
-
- 6. THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR
- IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED
- WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
- PURPOSE.
-
-lib/bundler::
-lib/bundler.rb::
-lib/bundler.gemspec::
-spec/bundler::
-man/bundle-*,gemfile.*::
-
- Bundler is under the following license.
-
- >>>
- Portions copyright (c) 2010 Andre Arko
- Portions copyright (c) 2009 Engine Yard
-
- MIT License::
-
- Permission is hereby granted, free of charge, to any person obtaining
- a copy of this software and associated documentation files (the
- "Software"), to deal in the Software without restriction, including
- without limitation the rights to use, copy, modify, merge, publish,
- distribute, sublicense, and/or sell copies of the Software, and to
- permit persons to whom the Software is furnished to do so, subject to
- the following conditions:
-
- The above copyright notice and this permission notice shall be
- included in all copies or substantial portions of the Software.
-
- THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
- EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
- MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
- NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE
- LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION
- OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION
- WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
diff --git a/LGPL b/LGPL
new file mode 100644
index 0000000000..b1e3f5a263
--- /dev/null
+++ b/LGPL
@@ -0,0 +1,504 @@
+ GNU LESSER GENERAL PUBLIC LICENSE
+ Version 2.1, February 1999
+
+ Copyright (C) 1991, 1999 Free Software Foundation, Inc.
+ 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA
+ Everyone is permitted to copy and distribute verbatim copies
+ of this license document, but changing it is not allowed.
+
+[This is the first released version of the Lesser GPL. It also counts
+ as the successor of the GNU Library Public License, version 2, hence
+ the version number 2.1.]
+
+ Preamble
+
+ The licenses for most software are designed to take away your
+freedom to share and change it. By contrast, the GNU General Public
+Licenses are intended to guarantee your freedom to share and change
+free software--to make sure the software is free for all its users.
+
+ This license, the Lesser General Public License, applies to some
+specially designated software packages--typically libraries--of the
+Free Software Foundation and other authors who decide to use it. You
+can use it too, but we suggest you first think carefully about whether
+this license or the ordinary General Public License is the better
+strategy to use in any particular case, based on the explanations below.
+
+ When we speak of free software, we are referring to freedom of use,
+not price. Our General Public Licenses are designed to make sure that
+you have the freedom to distribute copies of free software (and charge
+for this service if you wish); that you receive source code or can get
+it if you want it; that you can change the software and use pieces of
+it in new free programs; and that you are informed that you can do
+these things.
+
+ To protect your rights, we need to make restrictions that forbid
+distributors to deny you these rights or to ask you to surrender these
+rights. These restrictions translate to certain responsibilities for
+you if you distribute copies of the library or if you modify it.
+
+ For example, if you distribute copies of the library, whether gratis
+or for a fee, you must give the recipients all the rights that we gave
+you. You must make sure that they, too, receive or can get the source
+code. If you link other code with the library, you must provide
+complete object files to the recipients, so that they can relink them
+with the library after making changes to the library and recompiling
+it. And you must show them these terms so they know their rights.
+
+ We protect your rights with a two-step method: (1) we copyright the
+library, and (2) we offer you this license, which gives you legal
+permission to copy, distribute and/or modify the library.
+
+ To protect each distributor, we want to make it very clear that
+there is no warranty for the free library. Also, if the library is
+modified by someone else and passed on, the recipients should know
+that what they have is not the original version, so that the original
+author's reputation will not be affected by problems that might be
+introduced by others.
+
+ Finally, software patents pose a constant threat to the existence of
+any free program. We wish to make sure that a company cannot
+effectively restrict the users of a free program by obtaining a
+restrictive license from a patent holder. Therefore, we insist that
+any patent license obtained for a version of the library must be
+consistent with the full freedom of use specified in this license.
+
+ Most GNU software, including some libraries, is covered by the
+ordinary GNU General Public License. This license, the GNU Lesser
+General Public License, applies to certain designated libraries, and
+is quite different from the ordinary General Public License. We use
+this license for certain libraries in order to permit linking those
+libraries into non-free programs.
+
+ When a program is linked with a library, whether statically or using
+a shared library, the combination of the two is legally speaking a
+combined work, a derivative of the original library. The ordinary
+General Public License therefore permits such linking only if the
+entire combination fits its criteria of freedom. The Lesser General
+Public License permits more lax criteria for linking other code with
+the library.
+
+ We call this license the "Lesser" General Public License because it
+does Less to protect the user's freedom than the ordinary General
+Public License. It also provides other free software developers Less
+of an advantage over competing non-free programs. These disadvantages
+are the reason we use the ordinary General Public License for many
+libraries. However, the Lesser license provides advantages in certain
+special circumstances.
+
+ For example, on rare occasions, there may be a special need to
+encourage the widest possible use of a certain library, so that it becomes
+a de-facto standard. To achieve this, non-free programs must be
+allowed to use the library. A more frequent case is that a free
+library does the same job as widely used non-free libraries. In this
+case, there is little to gain by limiting the free library to free
+software only, so we use the Lesser General Public License.
+
+ In other cases, permission to use a particular library in non-free
+programs enables a greater number of people to use a large body of
+free software. For example, permission to use the GNU C Library in
+non-free programs enables many more people to use the whole GNU
+operating system, as well as its variant, the GNU/Linux operating
+system.
+
+ Although the Lesser General Public License is Less protective of the
+users' freedom, it does ensure that the user of a program that is
+linked with the Library has the freedom and the wherewithal to run
+that program using a modified version of the Library.
+
+ The precise terms and conditions for copying, distribution and
+modification follow. Pay close attention to the difference between a
+"work based on the library" and a "work that uses the library". The
+former contains code derived from the library, whereas the latter must
+be combined with the library in order to run.
+
+ GNU LESSER GENERAL PUBLIC LICENSE
+ TERMS AND CONDITIONS FOR COPYING, DISTRIBUTION AND MODIFICATION
+
+ 0. This License Agreement applies to any software library or other
+program which contains a notice placed by the copyright holder or
+other authorized party saying it may be distributed under the terms of
+this Lesser General Public License (also called "this License").
+Each licensee is addressed as "you".
+
+ A "library" means a collection of software functions and/or data
+prepared so as to be conveniently linked with application programs
+(which use some of those functions and data) to form executables.
+
+ The "Library", below, refers to any such software library or work
+which has been distributed under these terms. A "work based on the
+Library" means either the Library or any derivative work under
+copyright law: that is to say, a work containing the Library or a
+portion of it, either verbatim or with modifications and/or translated
+straightforwardly into another language. (Hereinafter, translation is
+included without limitation in the term "modification".)
+
+ "Source code" for a work means the preferred form of the work for
+making modifications to it. For a library, complete source code means
+all the source code for all modules it contains, plus any associated
+interface definition files, plus the scripts used to control compilation
+and installation of the library.
+
+ Activities other than copying, distribution and modification are not
+covered by this License; they are outside its scope. The act of
+running a program using the Library is not restricted, and output from
+such a program is covered only if its contents constitute a work based
+on the Library (independent of the use of the Library in a tool for
+writing it). Whether that is true depends on what the Library does
+and what the program that uses the Library does.
+
+ 1. You may copy and distribute verbatim copies of the Library's
+complete source code as you receive it, in any medium, provided that
+you conspicuously and appropriately publish on each copy an
+appropriate copyright notice and disclaimer of warranty; keep intact
+all the notices that refer to this License and to the absence of any
+warranty; and distribute a copy of this License along with the
+Library.
+
+ You may charge a fee for the physical act of transferring a copy,
+and you may at your option offer warranty protection in exchange for a
+fee.
+
+ 2. You may modify your copy or copies of the Library or any portion
+of it, thus forming a work based on the Library, and copy and
+distribute such modifications or work under the terms of Section 1
+above, provided that you also meet all of these conditions:
+
+ a) The modified work must itself be a software library.
+
+ b) You must cause the files modified to carry prominent notices
+ stating that you changed the files and the date of any change.
+
+ c) You must cause the whole of the work to be licensed at no
+ charge to all third parties under the terms of this License.
+
+ d) If a facility in the modified Library refers to a function or a
+ table of data to be supplied by an application program that uses
+ the facility, other than as an argument passed when the facility
+ is invoked, then you must make a good faith effort to ensure that,
+ in the event an application does not supply such function or
+ table, the facility still operates, and performs whatever part of
+ its purpose remains meaningful.
+
+ (For example, a function in a library to compute square roots has
+ a purpose that is entirely well-defined independent of the
+ application. Therefore, Subsection 2d requires that any
+ application-supplied function or table used by this function must
+ be optional: if the application does not supply it, the square
+ root function must still compute square roots.)
+
+These requirements apply to the modified work as a whole. If
+identifiable sections of that work are not derived from the Library,
+and can be reasonably considered independent and separate works in
+themselves, then this License, and its terms, do not apply to those
+sections when you distribute them as separate works. But when you
+distribute the same sections as part of a whole which is a work based
+on the Library, the distribution of the whole must be on the terms of
+this License, whose permissions for other licensees extend to the
+entire whole, and thus to each and every part regardless of who wrote
+it.
+
+Thus, it is not the intent of this section to claim rights or contest
+your rights to work written entirely by you; rather, the intent is to
+exercise the right to control the distribution of derivative or
+collective works based on the Library.
+
+In addition, mere aggregation of another work not based on the Library
+with the Library (or with a work based on the Library) on a volume of
+a storage or distribution medium does not bring the other work under
+the scope of this License.
+
+ 3. You may opt to apply the terms of the ordinary GNU General Public
+License instead of this License to a given copy of the Library. To do
+this, you must alter all the notices that refer to this License, so
+that they refer to the ordinary GNU General Public License, version 2,
+instead of to this License. (If a newer version than version 2 of the
+ordinary GNU General Public License has appeared, then you can specify
+that version instead if you wish.) Do not make any other change in
+these notices.
+
+ Once this change is made in a given copy, it is irreversible for
+that copy, so the ordinary GNU General Public License applies to all
+subsequent copies and derivative works made from that copy.
+
+ This option is useful when you wish to copy part of the code of
+the Library into a program that is not a library.
+
+ 4. You may copy and distribute the Library (or a portion or
+derivative of it, under Section 2) in object code or executable form
+under the terms of Sections 1 and 2 above provided that you accompany
+it with the complete corresponding machine-readable source code, which
+must be distributed under the terms of Sections 1 and 2 above on a
+medium customarily used for software interchange.
+
+ If distribution of object code is made by offering access to copy
+from a designated place, then offering equivalent access to copy the
+source code from the same place satisfies the requirement to
+distribute the source code, even though third parties are not
+compelled to copy the source along with the object code.
+
+ 5. A program that contains no derivative of any portion of the
+Library, but is designed to work with the Library by being compiled or
+linked with it, is called a "work that uses the Library". Such a
+work, in isolation, is not a derivative work of the Library, and
+therefore falls outside the scope of this License.
+
+ However, linking a "work that uses the Library" with the Library
+creates an executable that is a derivative of the Library (because it
+contains portions of the Library), rather than a "work that uses the
+library". The executable is therefore covered by this License.
+Section 6 states terms for distribution of such executables.
+
+ When a "work that uses the Library" uses material from a header file
+that is part of the Library, the object code for the work may be a
+derivative work of the Library even though the source code is not.
+Whether this is true is especially significant if the work can be
+linked without the Library, or if the work is itself a library. The
+threshold for this to be true is not precisely defined by law.
+
+ If such an object file uses only numerical parameters, data
+structure layouts and accessors, and small macros and small inline
+functions (ten lines or less in length), then the use of the object
+file is unrestricted, regardless of whether it is legally a derivative
+work. (Executables containing this object code plus portions of the
+Library will still fall under Section 6.)
+
+ Otherwise, if the work is a derivative of the Library, you may
+distribute the object code for the work under the terms of Section 6.
+Any executables containing that work also fall under Section 6,
+whether or not they are linked directly with the Library itself.
+
+ 6. As an exception to the Sections above, you may also combine or
+link a "work that uses the Library" with the Library to produce a
+work containing portions of the Library, and distribute that work
+under terms of your choice, provided that the terms permit
+modification of the work for the customer's own use and reverse
+engineering for debugging such modifications.
+
+ You must give prominent notice with each copy of the work that the
+Library is used in it and that the Library and its use are covered by
+this License. You must supply a copy of this License. If the work
+during execution displays copyright notices, you must include the
+copyright notice for the Library among them, as well as a reference
+directing the user to the copy of this License. Also, you must do one
+of these things:
+
+ a) Accompany the work with the complete corresponding
+ machine-readable source code for the Library including whatever
+ changes were used in the work (which must be distributed under
+ Sections 1 and 2 above); and, if the work is an executable linked
+ with the Library, with the complete machine-readable "work that
+ uses the Library", as object code and/or source code, so that the
+ user can modify the Library and then relink to produce a modified
+ executable containing the modified Library. (It is understood
+ that the user who changes the contents of definitions files in the
+ Library will not necessarily be able to recompile the application
+ to use the modified definitions.)
+
+ b) Use a suitable shared library mechanism for linking with the
+ Library. A suitable mechanism is one that (1) uses at run time a
+ copy of the library already present on the user's computer system,
+ rather than copying library functions into the executable, and (2)
+ will operate properly with a modified version of the library, if
+ the user installs one, as long as the modified version is
+ interface-compatible with the version that the work was made with.
+
+ c) Accompany the work with a written offer, valid for at
+ least three years, to give the same user the materials
+ specified in Subsection 6a, above, for a charge no more
+ than the cost of performing this distribution.
+
+ d) If distribution of the work is made by offering access to copy
+ from a designated place, offer equivalent access to copy the above
+ specified materials from the same place.
+
+ e) Verify that the user has already received a copy of these
+ materials or that you have already sent this user a copy.
+
+ For an executable, the required form of the "work that uses the
+Library" must include any data and utility programs needed for
+reproducing the executable from it. However, as a special exception,
+the materials to be distributed need not include anything that is
+normally distributed (in either source or binary form) with the major
+components (compiler, kernel, and so on) of the operating system on
+which the executable runs, unless that component itself accompanies
+the executable.
+
+ It may happen that this requirement contradicts the license
+restrictions of other proprietary libraries that do not normally
+accompany the operating system. Such a contradiction means you cannot
+use both them and the Library together in an executable that you
+distribute.
+
+ 7. You may place library facilities that are a work based on the
+Library side-by-side in a single library together with other library
+facilities not covered by this License, and distribute such a combined
+library, provided that the separate distribution of the work based on
+the Library and of the other library facilities is otherwise
+permitted, and provided that you do these two things:
+
+ a) Accompany the combined library with a copy of the same work
+ based on the Library, uncombined with any other library
+ facilities. This must be distributed under the terms of the
+ Sections above.
+
+ b) Give prominent notice with the combined library of the fact
+ that part of it is a work based on the Library, and explaining
+ where to find the accompanying uncombined form of the same work.
+
+ 8. You may not copy, modify, sublicense, link with, or distribute
+the Library except as expressly provided under this License. Any
+attempt otherwise to copy, modify, sublicense, link with, or
+distribute the Library is void, and will automatically terminate your
+rights under this License. However, parties who have received copies,
+or rights, from you under this License will not have their licenses
+terminated so long as such parties remain in full compliance.
+
+ 9. You are not required to accept this License, since you have not
+signed it. However, nothing else grants you permission to modify or
+distribute the Library or its derivative works. These actions are
+prohibited by law if you do not accept this License. Therefore, by
+modifying or distributing the Library (or any work based on the
+Library), you indicate your acceptance of this License to do so, and
+all its terms and conditions for copying, distributing or modifying
+the Library or works based on it.
+
+ 10. Each time you redistribute the Library (or any work based on the
+Library), the recipient automatically receives a license from the
+original licensor to copy, distribute, link with or modify the Library
+subject to these terms and conditions. You may not impose any further
+restrictions on the recipients' exercise of the rights granted herein.
+You are not responsible for enforcing compliance by third parties with
+this License.
+
+ 11. If, as a consequence of a court judgment or allegation of patent
+infringement or for any other reason (not limited to patent issues),
+conditions are imposed on you (whether by court order, agreement or
+otherwise) that contradict the conditions of this License, they do not
+excuse you from the conditions of this License. If you cannot
+distribute so as to satisfy simultaneously your obligations under this
+License and any other pertinent obligations, then as a consequence you
+may not distribute the Library at all. For example, if a patent
+license would not permit royalty-free redistribution of the Library by
+all those who receive copies directly or indirectly through you, then
+the only way you could satisfy both it and this License would be to
+refrain entirely from distribution of the Library.
+
+If any portion of this section is held invalid or unenforceable under any
+particular circumstance, the balance of the section is intended to apply,
+and the section as a whole is intended to apply in other circumstances.
+
+It is not the purpose of this section to induce you to infringe any
+patents or other property right claims or to contest validity of any
+such claims; this section has the sole purpose of protecting the
+integrity of the free software distribution system which is
+implemented by public license practices. Many people have made
+generous contributions to the wide range of software distributed
+through that system in reliance on consistent application of that
+system; it is up to the author/donor to decide if he or she is willing
+to distribute software through any other system and a licensee cannot
+impose that choice.
+
+This section is intended to make thoroughly clear what is believed to
+be a consequence of the rest of this License.
+
+ 12. If the distribution and/or use of the Library is restricted in
+certain countries either by patents or by copyrighted interfaces, the
+original copyright holder who places the Library under this License may add
+an explicit geographical distribution limitation excluding those countries,
+so that distribution is permitted only in or among countries not thus
+excluded. In such case, this License incorporates the limitation as if
+written in the body of this License.
+
+ 13. The Free Software Foundation may publish revised and/or new
+versions of the Lesser General Public License from time to time.
+Such new versions will be similar in spirit to the present version,
+but may differ in detail to address new problems or concerns.
+
+Each version is given a distinguishing version number. If the Library
+specifies a version number of this License which applies to it and
+"any later version", you have the option of following the terms and
+conditions either of that version or of any later version published by
+the Free Software Foundation. If the Library does not specify a
+license version number, you may choose any version ever published by
+the Free Software Foundation.
+
+ 14. If you wish to incorporate parts of the Library into other free
+programs whose distribution conditions are incompatible with these,
+write to the author to ask for permission. For software which is
+copyrighted by the Free Software Foundation, write to the Free
+Software Foundation; we sometimes make exceptions for this. Our
+decision will be guided by the two goals of preserving the free status
+of all derivatives of our free software and of promoting the sharing
+and reuse of software generally.
+
+ NO WARRANTY
+
+ 15. BECAUSE THE LIBRARY IS LICENSED FREE OF CHARGE, THERE IS NO
+WARRANTY FOR THE LIBRARY, TO THE EXTENT PERMITTED BY APPLICABLE LAW.
+EXCEPT WHEN OTHERWISE STATED IN WRITING THE COPYRIGHT HOLDERS AND/OR
+OTHER PARTIES PROVIDE THE LIBRARY "AS IS" WITHOUT WARRANTY OF ANY
+KIND, EITHER EXPRESSED OR IMPLIED, INCLUDING, BUT NOT LIMITED TO, THE
+IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
+PURPOSE. THE ENTIRE RISK AS TO THE QUALITY AND PERFORMANCE OF THE
+LIBRARY IS WITH YOU. SHOULD THE LIBRARY PROVE DEFECTIVE, YOU ASSUME
+THE COST OF ALL NECESSARY SERVICING, REPAIR OR CORRECTION.
+
+ 16. IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN
+WRITING WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MAY MODIFY
+AND/OR REDISTRIBUTE THE LIBRARY AS PERMITTED ABOVE, BE LIABLE TO YOU
+FOR DAMAGES, INCLUDING ANY GENERAL, SPECIAL, INCIDENTAL OR
+CONSEQUENTIAL DAMAGES ARISING OUT OF THE USE OR INABILITY TO USE THE
+LIBRARY (INCLUDING BUT NOT LIMITED TO LOSS OF DATA OR DATA BEING
+RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU OR THIRD PARTIES OR A
+FAILURE OF THE LIBRARY TO OPERATE WITH ANY OTHER SOFTWARE), EVEN IF
+SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE POSSIBILITY OF SUCH
+DAMAGES.
+
+ END OF TERMS AND CONDITIONS
+
+ How to Apply These Terms to Your New Libraries
+
+ If you develop a new library, and you want it to be of the greatest
+possible use to the public, we recommend making it free software that
+everyone can redistribute and change. You can do so by permitting
+redistribution under these terms (or, alternatively, under the terms of the
+ordinary General Public License).
+
+ To apply these terms, attach the following notices to the library. It is
+safest to attach them to the start of each source file to most effectively
+convey the exclusion of warranty; and each file should have at least the
+"copyright" line and a pointer to where the full notice is found.
+
+ <one line to give the library's name and a brief idea of what it does.>
+ Copyright (C) <year> <name of author>
+
+ This library is free software; you can redistribute it and/or
+ modify it under the terms of the GNU Lesser General Public
+ License as published by the Free Software Foundation; either
+ version 2.1 of the License, or (at your option) any later version.
+
+ This library is distributed in the hope that it will be useful,
+ but WITHOUT ANY WARRANTY; without even the implied warranty of
+ MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU
+ Lesser General Public License for more details.
+
+ You should have received a copy of the GNU Lesser General Public
+ License along with this library; if not, write to the Free Software
+ Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA
+
+Also add information on how to contact you by electronic and paper mail.
+
+You should also get your employer (if you work as a programmer) or your
+school, if any, to sign a "copyright disclaimer" for the library, if
+necessary. Here is a sample; alter the names:
+
+ Yoyodyne, Inc., hereby disclaims all copyright interest in the
+ library `Frob' (a library for tweaking knobs) written by James Random Hacker.
+
+ <signature of Ty Coon>, 1 April 1990
+ Ty Coon, President of Vice
+
+That's all there is to it!
+
+
diff --git a/MANIFEST b/MANIFEST
new file mode 100644
index 0000000000..5273b4c253
--- /dev/null
+++ b/MANIFEST
@@ -0,0 +1,1054 @@
+.document
+COPYING
+COPYING.ja
+ChangeLog
+GPL
+LEGAL
+LGPL
+MANIFEST
+Makefile.in
+README
+README.EXT
+README.EXT.ja
+README.ja
+ToDo
+array.c
+bignum.c
+class.c
+compar.c
+config.guess
+config.sub
+configure
+configure.in
+defines.h
+dir.c
+dln.c
+dln.h
+dmyext.c
+enum.c
+env.h
+error.c
+eval.c
+file.c
+gc.c
+hash.c
+inits.c
+install-sh
+instruby.rb
+intern.h
+io.c
+keywords
+lex.c
+main.c
+marshal.c
+math.c
+mdoc2man.rb
+missing.h
+mkconfig.rb
+node.h
+numeric.c
+object.c
+pack.c
+parse.c
+parse.y
+prec.c
+process.c
+random.c
+range.c
+re.c
+re.h
+regex.c
+regex.h
+ruby.1
+ruby.c
+ruby.h
+rubyio.h
+rubysig.h
+rubytest.rb
+signal.c
+sprintf.c
+st.c
+st.h
+string.c
+struct.c
+time.c
+util.c
+util.h
+variable.c
+version.c
+version.h
+bcc32/Makefile.sub
+bcc32/README.bcc32
+bcc32/configure.bat
+bcc32/mkexports.rb
+bcc32/setup.mak
+bin/erb
+bin/irb
+bin/rdoc
+bin/ri
+bin/testrb
+cygwin/GNUmakefile.in
+djgpp/GNUmakefile.in
+djgpp/README.djgpp
+djgpp/config.hin
+djgpp/config.sed
+djgpp/configure.bat
+djgpp/mkver.sed
+doc/ChangeLog-1.8.0
+doc/NEWS
+doc/forwardable.rd
+doc/forwardable.rd.ja
+doc/irb/irb-tools.rd.ja
+doc/irb/irb.rd
+doc/irb/irb.rd.ja
+doc/shell.rd
+doc/shell.rd.ja
+ext/Setup
+ext/Setup.atheos
+ext/Setup.dj
+ext/Setup.emx
+ext/Setup.nt
+ext/Setup.x68
+ext/extmk.rb
+lib/.document
+lib/English.rb
+lib/Env.rb
+lib/README
+lib/abbrev.rb
+lib/base64.rb
+lib/benchmark.rb
+lib/cgi-lib.rb
+lib/cgi.rb
+lib/cgi/.document
+lib/cgi/session.rb
+lib/cgi/session/pstore.rb
+lib/complex.rb
+lib/csv.rb
+lib/date.rb
+lib/date/format.rb
+lib/date2.rb
+lib/debug.rb
+lib/delegate.rb
+lib/drb.rb
+lib/drb/acl.rb
+lib/drb/drb.rb
+lib/drb/eq.rb
+lib/drb/extserv.rb
+lib/drb/extservm.rb
+lib/drb/gw.rb
+lib/drb/invokemethod.rb
+lib/drb/observer.rb
+lib/drb/ssl.rb
+lib/drb/timeridconv.rb
+lib/drb/unix.rb
+lib/e2mmap.rb
+lib/erb.rb
+lib/eregex.rb
+lib/fileutils.rb
+lib/finalize.rb
+lib/find.rb
+lib/forwardable.rb
+lib/ftools.rb
+lib/generator.rb
+lib/getoptlong.rb
+lib/getopts.rb
+lib/gserver.rb
+lib/importenv.rb
+lib/ipaddr.rb
+lib/irb.rb
+lib/irb/cmd/chws.rb
+lib/irb/cmd/fork.rb
+lib/irb/cmd/load.rb
+lib/irb/cmd/nop.rb
+lib/irb/cmd/pushws.rb
+lib/irb/cmd/subirb.rb
+lib/irb/completion.rb
+lib/irb/context.rb
+lib/irb/ext/change-ws.rb
+lib/irb/ext/history.rb
+lib/irb/ext/loader.rb
+lib/irb/ext/math-mode.rb
+lib/irb/ext/multi-irb.rb
+lib/irb/ext/tracer.rb
+lib/irb/ext/use-loader.rb
+lib/irb/ext/workspaces.rb
+lib/irb/extend-command.rb
+lib/irb/frame.rb
+lib/irb/help.rb
+lib/irb/init.rb
+lib/irb/input-method.rb
+lib/irb/lc/error.rb
+lib/irb/lc/help-message
+lib/irb/lc/ja/error.rb
+lib/irb/lc/ja/help-message
+lib/irb/locale.rb
+lib/irb/ruby-lex.rb
+lib/irb/ruby-token.rb
+lib/irb/slex.rb
+lib/irb/version.rb
+lib/irb/workspace.rb
+lib/irb/ws-for-case-2.rb
+lib/irb/xmp.rb
+lib/jcode.rb
+lib/logger.rb
+lib/mailread.rb
+lib/mathn.rb
+lib/matrix.rb
+lib/mkmf.rb
+lib/monitor.rb
+lib/mutex_m.rb
+lib/net/ftp.rb
+lib/net/http.rb
+lib/net/imap.rb
+lib/net/pop.rb
+lib/net/protocol.rb
+lib/net/smtp.rb
+lib/net/telnet.rb
+lib/observer.rb
+lib/open-uri.rb
+lib/open3.rb
+lib/optparse.rb
+lib/optparse/date.rb
+lib/optparse/shellwords.rb
+lib/optparse/time.rb
+lib/optparse/uri.rb
+lib/optparse/version.rb
+lib/ostruct.rb
+lib/parsearg.rb
+lib/parsedate.rb
+lib/pathname.rb
+lib/ping.rb
+lib/pp.rb
+lib/prettyprint.rb
+lib/profile.rb
+lib/profiler.rb
+lib/pstore.rb
+lib/racc/parser.rb
+lib/rational.rb
+lib/rdoc/README
+lib/rdoc/code_objects.rb
+lib/rdoc/diagram.rb
+lib/rdoc/dot/dot.rb
+lib/rdoc/generators/chm_generator.rb
+lib/rdoc/generators/html_generator.rb
+lib/rdoc/generators/ri_generator.rb
+lib/rdoc/generators/template/chm/chm.rb
+lib/rdoc/generators/template/html/hefss.rb
+lib/rdoc/generators/template/html/html.rb
+lib/rdoc/generators/template/html/kilmer.rb
+lib/rdoc/generators/template/html/old_html.rb
+lib/rdoc/generators/template/html/one_page_html.rb
+lib/rdoc/generators/template/xml/rdf.rb
+lib/rdoc/generators/template/xml/xml.rb
+lib/rdoc/generators/xml_generator.rb
+lib/rdoc/markup/sample/rdoc2latex.rb
+lib/rdoc/markup/sample/sample.rb
+lib/rdoc/markup/simple_markup.rb
+lib/rdoc/markup/simple_markup/fragments.rb
+lib/rdoc/markup/simple_markup/inline.rb
+lib/rdoc/markup/simple_markup/lines.rb
+lib/rdoc/markup/simple_markup/preprocess.rb
+lib/rdoc/markup/simple_markup/to_flow.rb
+lib/rdoc/markup/simple_markup/to_html.rb
+lib/rdoc/markup/simple_markup/to_latex.rb
+lib/rdoc/markup/test/AllTests.rb
+lib/rdoc/markup/test/TestInline.rb
+lib/rdoc/markup/test/TestParse.rb
+lib/rdoc/options.rb
+lib/rdoc/parsers/parse_c.rb
+lib/rdoc/parsers/parse_f95.rb
+lib/rdoc/parsers/parse_rb.rb
+lib/rdoc/parsers/parse_simple.rb
+lib/rdoc/parsers/parserfactory.rb
+lib/rdoc/rdoc.rb
+lib/rdoc/ri/ri_cache.rb
+lib/rdoc/ri/ri_descriptions.rb
+lib/rdoc/ri/ri_display.rb
+lib/rdoc/ri/ri_driver.rb
+lib/rdoc/ri/ri_formatter.rb
+lib/rdoc/ri/ri_options.rb
+lib/rdoc/ri/ri_paths.rb
+lib/rdoc/ri/ri_reader.rb
+lib/rdoc/ri/ri_util.rb
+lib/rdoc/ri/ri_writer.rb
+lib/rdoc/template.rb
+lib/rdoc/tokenstream.rb
+lib/readbytes.rb
+lib/resolv-replace.rb
+lib/resolv.rb
+lib/rexml/attlistdecl.rb
+lib/rexml/attribute.rb
+lib/rexml/cdata.rb
+lib/rexml/child.rb
+lib/rexml/comment.rb
+lib/rexml/doctype.rb
+lib/rexml/document.rb
+lib/rexml/dtd/attlistdecl.rb
+lib/rexml/dtd/dtd.rb
+lib/rexml/dtd/elementdecl.rb
+lib/rexml/dtd/entitydecl.rb
+lib/rexml/dtd/notationdecl.rb
+lib/rexml/element.rb
+lib/rexml/encoding.rb
+lib/rexml/encodings/CP-1252.rb
+lib/rexml/encodings/EUC-JP.rb
+lib/rexml/encodings/ICONV.rb
+lib/rexml/encodings/ISO-8859-1.rb
+lib/rexml/encodings/ISO-8859-15.rb
+lib/rexml/encodings/SHIFT-JIS.rb
+lib/rexml/encodings/SHIFT_JIS.rb
+lib/rexml/encodings/UNILE.rb
+lib/rexml/encodings/US-ASCII.rb
+lib/rexml/encodings/UTF-16.rb
+lib/rexml/encodings/UTF-8.rb
+lib/rexml/entity.rb
+lib/rexml/functions.rb
+lib/rexml/instruction.rb
+lib/rexml/light/node.rb
+lib/rexml/namespace.rb
+lib/rexml/node.rb
+lib/rexml/output.rb
+lib/rexml/parent.rb
+lib/rexml/parseexception.rb
+lib/rexml/parsers/baseparser.rb
+lib/rexml/parsers/lightparser.rb
+lib/rexml/parsers/pullparser.rb
+lib/rexml/parsers/sax2parser.rb
+lib/rexml/parsers/streamparser.rb
+lib/rexml/parsers/treeparser.rb
+lib/rexml/parsers/ultralightparser.rb
+lib/rexml/parsers/xpathparser.rb
+lib/rexml/quickpath.rb
+lib/rexml/rexml.rb
+lib/rexml/sax2listener.rb
+lib/rexml/source.rb
+lib/rexml/streamlistener.rb
+lib/rexml/text.rb
+lib/rexml/validation/relaxng.rb
+lib/rexml/validation/validation.rb
+lib/rexml/validation/validationexception.rb
+lib/rexml/xmldecl.rb
+lib/rexml/xmltokens.rb
+lib/rexml/xpath.rb
+lib/rexml/xpath_parser.rb
+lib/rinda/rinda.rb
+lib/rinda/ring.rb
+lib/rinda/tuplespace.rb
+lib/rss/0.9.rb
+lib/rss/1.0.rb
+lib/rss/2.0.rb
+lib/rss/content.rb
+lib/rss/converter.rb
+lib/rss/dublincore.rb
+lib/rss/parser.rb
+lib/rss/rexmlparser.rb
+lib/rss/rss.rb
+lib/rss/syndication.rb
+lib/rss/taxonomy.rb
+lib/rss/trackback.rb
+lib/rss/utils.rb
+lib/rss/xml-stylesheet.rb
+lib/rss/xmlparser.rb
+lib/rss/xmlscanner.rb
+lib/rubyunit.rb
+lib/runit/assert.rb
+lib/runit/cui/testrunner.rb
+lib/runit/error.rb
+lib/runit/testcase.rb
+lib/runit/testresult.rb
+lib/runit/testsuite.rb
+lib/runit/topublic.rb
+lib/scanf.rb
+lib/set.rb
+lib/shell.rb
+lib/shell/builtin-command.rb
+lib/shell/command-processor.rb
+lib/shell/error.rb
+lib/shell/filter.rb
+lib/shell/process-controller.rb
+lib/shell/system-command.rb
+lib/shell/version.rb
+lib/shellwords.rb
+lib/singleton.rb
+lib/soap/attachment.rb
+lib/soap/baseData.rb
+lib/soap/element.rb
+lib/soap/encodingstyle/aspDotNetHandler.rb
+lib/soap/encodingstyle/handler.rb
+lib/soap/encodingstyle/literalHandler.rb
+lib/soap/encodingstyle/soapHandler.rb
+lib/soap/generator.rb
+lib/soap/header/handler.rb
+lib/soap/header/handlerset.rb
+lib/soap/header/simplehandler.rb
+lib/soap/mapping.rb
+lib/soap/mapping/factory.rb
+lib/soap/mapping/mapping.rb
+lib/soap/mapping/registry.rb
+lib/soap/mapping/rubytypeFactory.rb
+lib/soap/mapping/typeMap.rb
+lib/soap/mapping/wsdlRegistry.rb
+lib/soap/marshal.rb
+lib/soap/mimemessage.rb
+lib/soap/netHttpClient.rb
+lib/soap/parser.rb
+lib/soap/processor.rb
+lib/soap/property.rb
+lib/soap/rpc/cgistub.rb
+lib/soap/rpc/driver.rb
+lib/soap/rpc/element.rb
+lib/soap/rpc/httpserver.rb
+lib/soap/rpc/proxy.rb
+lib/soap/rpc/router.rb
+lib/soap/rpc/rpc.rb
+lib/soap/rpc/soaplet.rb
+lib/soap/rpc/standaloneServer.rb
+lib/soap/soap.rb
+lib/soap/streamHandler.rb
+lib/soap/wsdlDriver.rb
+lib/sync.rb
+lib/tempfile.rb
+lib/test/unit.rb
+lib/test/unit/assertionfailederror.rb
+lib/test/unit/assertions.rb
+lib/test/unit/autorunner.rb
+lib/test/unit/collector.rb
+lib/test/unit/collector/dir.rb
+lib/test/unit/collector/objectspace.rb
+lib/test/unit/error.rb
+lib/test/unit/failure.rb
+lib/test/unit/testcase.rb
+lib/test/unit/testresult.rb
+lib/test/unit/testsuite.rb
+lib/test/unit/ui/console/testrunner.rb
+lib/test/unit/ui/fox/testrunner.rb
+lib/test/unit/ui/gtk/testrunner.rb
+lib/test/unit/ui/gtk2/testrunner.rb
+lib/test/unit/ui/testrunnermediator.rb
+lib/test/unit/ui/testrunnerutilities.rb
+lib/test/unit/ui/tk/testrunner.rb
+lib/test/unit/util/backtracefilter.rb
+lib/test/unit/util/observable.rb
+lib/test/unit/util/procwrapper.rb
+lib/thread.rb
+lib/thwait.rb
+lib/time.rb
+lib/timeout.rb
+lib/tmpdir.rb
+lib/tracer.rb
+lib/tsort.rb
+lib/un.rb
+lib/uri.rb
+lib/uri/common.rb
+lib/uri/ftp.rb
+lib/uri/generic.rb
+lib/uri/http.rb
+lib/uri/https.rb
+lib/uri/ldap.rb
+lib/uri/mailto.rb
+lib/weakref.rb
+lib/webrick.rb
+lib/webrick/accesslog.rb
+lib/webrick/cgi.rb
+lib/webrick/compat.rb
+lib/webrick/config.rb
+lib/webrick/cookie.rb
+lib/webrick/htmlutils.rb
+lib/webrick/httpauth.rb
+lib/webrick/httpauth/authenticator.rb
+lib/webrick/httpauth/basicauth.rb
+lib/webrick/httpauth/digestauth.rb
+lib/webrick/httpauth/htdigest.rb
+lib/webrick/httpauth/htgroup.rb
+lib/webrick/httpauth/htpasswd.rb
+lib/webrick/httpauth/userdb.rb
+lib/webrick/httpproxy.rb
+lib/webrick/httprequest.rb
+lib/webrick/httpresponse.rb
+lib/webrick/https.rb
+lib/webrick/httpserver.rb
+lib/webrick/httpservlet.rb
+lib/webrick/httpservlet/abstract.rb
+lib/webrick/httpservlet/cgi_runner.rb
+lib/webrick/httpservlet/cgihandler.rb
+lib/webrick/httpservlet/erbhandler.rb
+lib/webrick/httpservlet/filehandler.rb
+lib/webrick/httpservlet/prochandler.rb
+lib/webrick/httpstatus.rb
+lib/webrick/httputils.rb
+lib/webrick/httpversion.rb
+lib/webrick/log.rb
+lib/webrick/server.rb
+lib/webrick/ssl.rb
+lib/webrick/utils.rb
+lib/webrick/version.rb
+lib/wsdl/binding.rb
+lib/wsdl/data.rb
+lib/wsdl/definitions.rb
+lib/wsdl/documentation.rb
+lib/wsdl/import.rb
+lib/wsdl/importer.rb
+lib/wsdl/info.rb
+lib/wsdl/message.rb
+lib/wsdl/operation.rb
+lib/wsdl/operationBinding.rb
+lib/wsdl/param.rb
+lib/wsdl/parser.rb
+lib/wsdl/part.rb
+lib/wsdl/port.rb
+lib/wsdl/portType.rb
+lib/wsdl/service.rb
+lib/wsdl/soap/address.rb
+lib/wsdl/soap/binding.rb
+lib/wsdl/soap/body.rb
+lib/wsdl/soap/cgiStubCreator.rb
+lib/wsdl/soap/classDefCreator.rb
+lib/wsdl/soap/classDefCreatorSupport.rb
+lib/wsdl/soap/clientSkeltonCreator.rb
+lib/wsdl/soap/complexType.rb
+lib/wsdl/soap/data.rb
+lib/wsdl/soap/definitions.rb
+lib/wsdl/soap/driverCreator.rb
+lib/wsdl/soap/fault.rb
+lib/wsdl/soap/header.rb
+lib/wsdl/soap/headerfault.rb
+lib/wsdl/soap/mappingRegistryCreator.rb
+lib/wsdl/soap/methodDefCreator.rb
+lib/wsdl/soap/operation.rb
+lib/wsdl/soap/servantSkeltonCreator.rb
+lib/wsdl/soap/standaloneServerStubCreator.rb
+lib/wsdl/types.rb
+lib/wsdl/wsdl.rb
+lib/wsdl/xmlSchema/all.rb
+lib/wsdl/xmlSchema/any.rb
+lib/wsdl/xmlSchema/attribute.rb
+lib/wsdl/xmlSchema/choice.rb
+lib/wsdl/xmlSchema/complexContent.rb
+lib/wsdl/xmlSchema/complexType.rb
+lib/wsdl/xmlSchema/content.rb
+lib/wsdl/xmlSchema/data.rb
+lib/wsdl/xmlSchema/element.rb
+lib/wsdl/xmlSchema/enumeration.rb
+lib/wsdl/xmlSchema/import.rb
+lib/wsdl/xmlSchema/parser.rb
+lib/wsdl/xmlSchema/schema.rb
+lib/wsdl/xmlSchema/sequence.rb
+lib/wsdl/xmlSchema/simpleRestriction.rb
+lib/wsdl/xmlSchema/simpleType.rb
+lib/wsdl/xmlSchema/unique.rb
+lib/xmlrpc/README.txt
+lib/xmlrpc/base64.rb
+lib/xmlrpc/client.rb
+lib/xmlrpc/config.rb
+lib/xmlrpc/create.rb
+lib/xmlrpc/datetime.rb
+lib/xmlrpc/httpserver.rb
+lib/xmlrpc/marshal.rb
+lib/xmlrpc/parser.rb
+lib/xmlrpc/server.rb
+lib/xmlrpc/utils.rb
+lib/xsd/charset.rb
+lib/xsd/codegen.rb
+lib/xsd/codegen/classdef.rb
+lib/xsd/codegen/commentdef.rb
+lib/xsd/codegen/gensupport.rb
+lib/xsd/codegen/methoddef.rb
+lib/xsd/codegen/moduledef.rb
+lib/xsd/datatypes.rb
+lib/xsd/datatypes1999.rb
+lib/xsd/iconvcharset.rb
+lib/xsd/namedelements.rb
+lib/xsd/ns.rb
+lib/xsd/qname.rb
+lib/xsd/xmlparser.rb
+lib/xsd/xmlparser/parser.rb
+lib/xsd/xmlparser/rexmlparser.rb
+lib/xsd/xmlparser/xmlparser.rb
+lib/xsd/xmlparser/xmlscanner.rb
+lib/yaml.rb
+lib/yaml/baseemitter.rb
+lib/yaml/basenode.rb
+lib/yaml/constants.rb
+lib/yaml/dbm.rb
+lib/yaml/emitter.rb
+lib/yaml/encoding.rb
+lib/yaml/error.rb
+lib/yaml/loader.rb
+lib/yaml/rubytypes.rb
+lib/yaml/store.rb
+lib/yaml/stream.rb
+lib/yaml/stringio.rb
+lib/yaml/syck.rb
+lib/yaml/types.rb
+lib/yaml/yamlnode.rb
+lib/yaml/ypath.rb
+misc/README
+misc/inf-ruby.el
+misc/ruby-mode.el
+misc/rubydb2x.el
+misc/rubydb3x.el
+missing/acosh.c
+missing/alloca.c
+missing/crypt.c
+missing/dup2.c
+missing/erf.c
+missing/file.h
+missing/fileblocks.c
+missing/finite.c
+missing/flock.c
+missing/hypot.c
+missing/isinf.c
+missing/isnan.c
+missing/memcmp.c
+missing/memmove.c
+missing/mkdir.c
+missing/os2.c
+missing/strcasecmp.c
+missing/strchr.c
+missing/strerror.c
+missing/strftime.c
+missing/strncasecmp.c
+missing/strstr.c
+missing/strtod.c
+missing/strtol.c
+missing/strtoul.c
+missing/vsnprintf.c
+missing/x68.c
+sample/README
+sample/biorhythm.rb
+sample/cal.rb
+sample/cbreak.rb
+sample/clnt.rb
+sample/dbmtest.rb
+sample/dir.rb
+sample/drb/README.rd
+sample/drb/README.rd.ja
+sample/drb/darray.rb
+sample/drb/darrayc.rb
+sample/drb/dbiff.rb
+sample/drb/dcdbiff.rb
+sample/drb/dchatc.rb
+sample/drb/dchats.rb
+sample/drb/dhasen.rb
+sample/drb/dhasenc.rb
+sample/drb/dlogc.rb
+sample/drb/dlogd.rb
+sample/drb/dqin.rb
+sample/drb/dqlib.rb
+sample/drb/dqout.rb
+sample/drb/dqueue.rb
+sample/drb/drbc.rb
+sample/drb/drbch.rb
+sample/drb/drbm.rb
+sample/drb/drbmc.rb
+sample/drb/drbs-acl.rb
+sample/drb/drbs.rb
+sample/drb/drbssl_c.rb
+sample/drb/drbssl_s.rb
+sample/drb/extserv_test.rb
+sample/drb/gw_ct.rb
+sample/drb/gw_cu.rb
+sample/drb/gw_s.rb
+sample/drb/holderc.rb
+sample/drb/holders.rb
+sample/drb/http0.rb
+sample/drb/http0serv.rb
+sample/drb/name.rb
+sample/drb/namec.rb
+sample/drb/old_tuplespace.rb
+sample/drb/rinda_ts.rb
+sample/drb/rindac.rb
+sample/drb/rindas.rb
+sample/drb/ring_echo.rb
+sample/drb/ring_inspect.rb
+sample/drb/ring_place.rb
+sample/drb/simpletuple.rb
+sample/drb/speedc.rb
+sample/drb/speeds.rb
+sample/dualstack-fetch.rb
+sample/dualstack-httpd.rb
+sample/eval.rb
+sample/export.rb
+sample/exyacc.rb
+sample/fact.rb
+sample/fib.awk
+sample/fib.pl
+sample/fib.py
+sample/fib.rb
+sample/fib.scm
+sample/freq.rb
+sample/from.rb
+sample/fullpath.rb
+sample/getopts.test
+sample/goodfriday.rb
+sample/less.rb
+sample/list.rb
+sample/list2.rb
+sample/list3.rb
+sample/logger/app.rb
+sample/logger/log.rb
+sample/logger/shifting.rb
+sample/mine.rb
+sample/mkproto.rb
+sample/mpart.rb
+sample/mrshtest.rb
+sample/observ.rb
+sample/occur.pl
+sample/occur.rb
+sample/occur2.rb
+sample/openssl/c_rehash.rb
+sample/openssl/cert2text.rb
+sample/openssl/cert_store_view.rb
+sample/openssl/certstore.rb
+sample/openssl/cipher.rb
+sample/openssl/crlstore.rb
+sample/openssl/echo_cli.rb
+sample/openssl/echo_svr.rb
+sample/openssl/gen_csr.rb
+sample/openssl/smime_read.rb
+sample/openssl/smime_write.rb
+sample/openssl/wget.rb
+sample/optparse/opttest.rb
+sample/philos.rb
+sample/pi.rb
+sample/rcs.awk
+sample/rcs.dat
+sample/rcs.rb
+sample/regx.rb
+sample/rss/list_description.rb
+sample/rss/rss_recent.rb
+sample/rss/tdiary_plugin/rss-recent.rb
+sample/sieve.rb
+sample/soap/authheader/authmgr.rb
+sample/soap/authheader/client.rb
+sample/soap/authheader/client2.rb
+sample/soap/authheader/server.rb
+sample/soap/authheader/server2.rb
+sample/soap/babelfish.rb
+sample/soap/calc/calc.rb
+sample/soap/calc/calc2.rb
+sample/soap/calc/client.rb
+sample/soap/calc/client2.rb
+sample/soap/calc/httpd.rb
+sample/soap/calc/samplehttpd.conf
+sample/soap/calc/server.cgi
+sample/soap/calc/server.rb
+sample/soap/calc/server2.rb
+sample/soap/digraph.rb
+sample/soap/exchange/client.rb
+sample/soap/exchange/exchange.rb
+sample/soap/exchange/httpd.rb
+sample/soap/exchange/samplehttpd.conf
+sample/soap/exchange/server.cgi
+sample/soap/exchange/server.rb
+sample/soap/helloworld/hw_c.rb
+sample/soap/helloworld/hw_s.rb
+sample/soap/icd/IICD.rb
+sample/soap/icd/icd.rb
+sample/soap/raa/iRAA.rb
+sample/soap/raa/soap4r.rb
+sample/soap/raa2.4/raa.rb
+sample/soap/raa2.4/raaDriver.rb
+sample/soap/raa2.4/raaServiceClient.rb
+sample/soap/raa2.4/sample.rb
+sample/soap/sampleStruct/client.rb
+sample/soap/sampleStruct/httpd.rb
+sample/soap/sampleStruct/iSampleStruct.rb
+sample/soap/sampleStruct/sampleStruct.rb
+sample/soap/sampleStruct/samplehttpd.conf
+sample/soap/sampleStruct/server.cgi
+sample/soap/sampleStruct/server.rb
+sample/soap/ssl/files/README
+sample/soap/ssl/files/ca.cert
+sample/soap/ssl/files/client.cert
+sample/soap/ssl/files/client.key
+sample/soap/ssl/files/server.cert
+sample/soap/ssl/files/server.key
+sample/soap/ssl/files/sslclient.properties
+sample/soap/ssl/files/sslclient_require_noserverauth.properties
+sample/soap/ssl/files/sslclient_with_clientauth.properties
+sample/soap/ssl/files/subca.cert
+sample/soap/ssl/sslclient.rb
+sample/soap/ssl/sslclient_require_noserverauth.rb
+sample/soap/ssl/sslclient_with_clientauth.rb
+sample/soap/ssl/sslserver.rb
+sample/soap/ssl/sslserver_noauth.rb
+sample/soap/ssl/sslserver_require_clientauth.rb
+sample/soap/swa/client.rb
+sample/soap/swa/server.rb
+sample/soap/whois.rb
+sample/svr.rb
+sample/test.rb
+sample/testunit/adder.rb
+sample/testunit/subtracter.rb
+sample/testunit/tc_adder.rb
+sample/testunit/tc_subtracter.rb
+sample/testunit/ts_examples.rb
+sample/time.rb
+sample/trojan.rb
+sample/tsvr.rb
+sample/uumerge.rb
+sample/webrick/demo-app.rb
+sample/webrick/demo-multipart.cgi
+sample/webrick/demo-servlet.rb
+sample/webrick/demo-urlencoded.cgi
+sample/webrick/hello.cgi
+sample/webrick/hello.rb
+sample/webrick/httpd.rb
+sample/webrick/httpsd.rb
+sample/wsdl/amazon/AmazonSearch.rb
+sample/wsdl/amazon/AmazonSearchDriver.rb
+sample/wsdl/amazon/sampleClient.rb
+sample/wsdl/amazon/wsdlDriver.rb
+sample/wsdl/googleSearch/GoogleSearch.rb
+sample/wsdl/googleSearch/GoogleSearchDriver.rb
+sample/wsdl/googleSearch/README
+sample/wsdl/googleSearch/httpd.rb
+sample/wsdl/googleSearch/sampleClient.rb
+sample/wsdl/googleSearch/samplehttpd.conf
+sample/wsdl/googleSearch/sjissearch.sh
+sample/wsdl/googleSearch/wsdlDriver.rb
+sample/wsdl/raa/raa.wsdl
+sample/wsdl/raa/soap4r.rb
+sample/wsdl/raa2.4/raa.rb
+sample/wsdl/raa2.4/wsdlDriver.rb
+test/csv/test_csv.rb
+test/dbm/test_dbm.rb
+test/digest/test_digest.rb
+test/drb/drbtest.rb
+test/drb/test_acl.rb
+test/drb/test_drb.rb
+test/drb/test_drbssl.rb
+test/drb/test_drbunix.rb
+test/drb/ut_array.rb
+test/drb/ut_array_drbssl.rb
+test/drb/ut_array_drbunix.rb
+test/drb/ut_drb.rb
+test/drb/ut_drb_drbssl.rb
+test/drb/ut_drb_drbunix.rb
+test/drb/ut_eval.rb
+test/drb/ut_large.rb
+test/drb/ut_port.rb
+test/drb/ut_safe1.rb
+test/drb/ut_timerholder.rb
+test/erb/test_erb.rb
+test/fileutils/fileasserts.rb
+test/fileutils/test_fileutils.rb
+test/fileutils/test_nowrite.rb
+test/gdbm/test_gdbm.rb
+test/logger/test_logger.rb
+test/monitor/test_monitor.rb
+test/openssl/ssl_server.rb
+test/openssl/test_cipher.rb
+test/openssl/test_digest.rb
+test/openssl/test_hmac.rb
+test/openssl/test_ssl.rb
+test/openssl/test_x509cert.rb
+test/openssl/test_x509crl.rb
+test/openssl/test_x509name.rb
+test/openssl/test_x509req.rb
+test/openssl/test_x509store.rb
+test/openssl/utils.rb
+test/optparse/test_noarg.rb
+test/optparse/test_optarg.rb
+test/optparse/test_optparse.rb
+test/optparse/test_placearg.rb
+test/optparse/test_reqarg.rb
+test/ostruct/test_ostruct.rb
+test/rinda/test_rinda.rb
+test/rss/rss-assertions.rb
+test/rss/rss-testcase.rb
+test/rss/test_1.0.rb
+test/rss/test_accessor.rb
+test/rss/test_content.rb
+test/rss/test_dublincore.rb
+test/rss/test_parser.rb
+test/rss/test_syndication.rb
+test/rss/test_trackback.rb
+test/rss/test_xml-stylesheet.rb
+test/ruby/beginmainend.rb
+test/ruby/endblockwarn.rb
+test/ruby/envutil.rb
+test/ruby/marshaltestlib.rb
+test/ruby/test_alias.rb
+test/ruby/test_array.rb
+test/ruby/test_assignment.rb
+test/ruby/test_beginendblock.rb
+test/ruby/test_bignum.rb
+test/ruby/test_call.rb
+test/ruby/test_case.rb
+test/ruby/test_clone.rb
+test/ruby/test_condition.rb
+test/ruby/test_const.rb
+test/ruby/test_defined.rb
+test/ruby/test_env.rb
+test/ruby/test_eval.rb
+test/ruby/test_exception.rb
+test/ruby/test_file.rb
+test/ruby/test_float.rb
+test/ruby/test_gc.rb
+test/ruby/test_hash.rb
+test/ruby/test_ifunless.rb
+test/ruby/test_iterator.rb
+test/ruby/test_marshal.rb
+test/ruby/test_math.rb
+test/ruby/test_pack.rb
+test/ruby/test_path.rb
+test/ruby/test_pipe.rb
+test/ruby/test_proc.rb
+test/ruby/test_range.rb
+test/ruby/test_signal.rb
+test/ruby/test_stringchar.rb
+test/ruby/test_struct.rb
+test/ruby/test_system.rb
+test/ruby/test_time.rb
+test/ruby/test_trace.rb
+test/ruby/test_variable.rb
+test/ruby/test_whileuntil.rb
+test/ruby/ut_eof.rb
+test/runner.rb
+test/soap/calc/calc.rb
+test/soap/calc/calc2.rb
+test/soap/calc/server.cgi
+test/soap/calc/server.rb
+test/soap/calc/server2.rb
+test/soap/calc/test_calc.rb
+test/soap/calc/test_calc2.rb
+test/soap/calc/test_calc_cgi.rb
+test/soap/header/server.cgi
+test/soap/header/test_authheader.rb
+test/soap/header/test_authheader_cgi.rb
+test/soap/helloworld/hw_s.rb
+test/soap/helloworld/test_helloworld.rb
+test/soap/marshal/test_digraph.rb
+test/soap/marshal/test_marshal.rb
+test/soap/marshal/test_struct.rb
+test/soap/ssl/README
+test/soap/ssl/ca.cert
+test/soap/ssl/client.cert
+test/soap/ssl/client.key
+test/soap/ssl/server.cert
+test/soap/ssl/server.key
+test/soap/ssl/sslsvr.rb
+test/soap/ssl/subca.cert
+test/soap/ssl/test_ssl.rb
+test/soap/struct/test_struct.rb
+test/soap/swa/test_file.rb
+test/soap/test_basetype.rb
+test/soap/test_property.rb
+test/soap/test_soapelement.rb
+test/soap/test_streamhandler.rb
+test/soap/wsdlDriver/README.txt
+test/soap/wsdlDriver/echo_version.rb
+test/soap/wsdlDriver/simpletype.wsdl
+test/soap/wsdlDriver/test_simpletype.rb
+test/stringio/test_stringio.rb
+test/strscan/test_stringscanner.rb
+test/testunit/collector/test_dir.rb
+test/testunit/collector/test_objectspace.rb
+test/testunit/runit/test_assert.rb
+test/testunit/runit/test_testcase.rb
+test/testunit/runit/test_testresult.rb
+test/testunit/runit/test_testsuite.rb
+test/testunit/test_assertions.rb
+test/testunit/test_error.rb
+test/testunit/test_failure.rb
+test/testunit/test_testcase.rb
+test/testunit/test_testresult.rb
+test/testunit/test_testsuite.rb
+test/testunit/util/test_backtracefilter.rb
+test/testunit/util/test_observable.rb
+test/testunit/util/test_procwrapper.rb
+test/uri/test_common.rb
+test/uri/test_ftp.rb
+test/uri/test_generic.rb
+test/uri/test_http.rb
+test/uri/test_ldap.rb
+test/uri/test_mailto.rb
+test/wsdl/axisArray/axisArray.wsdl
+test/wsdl/axisArray/itemList.rb
+test/wsdl/axisArray/test_axisarray.rb
+test/wsdl/datetime/DatetimeService.rb
+test/wsdl/datetime/datetime.rb
+test/wsdl/datetime/datetime.wsdl
+test/wsdl/datetime/datetimeServant.rb
+test/wsdl/datetime/test_datetime.rb
+test/wsdl/emptycomplextype.wsdl
+test/wsdl/map/map.wsdl
+test/wsdl/map/map.xml
+test/wsdl/map/test_map.rb
+test/wsdl/multiplefault.wsdl
+test/wsdl/raa/RAA.rb
+test/wsdl/raa/RAAServant.rb
+test/wsdl/raa/RAAService.rb
+test/wsdl/raa/README.txt
+test/wsdl/raa/raa.wsdl
+test/wsdl/raa/test_raa.rb
+test/wsdl/simpletype/simpletype.wsdl
+test/wsdl/simpletype/test_simpletype.rb
+test/wsdl/soap/soapbodyparts.wsdl
+test/wsdl/soap/test_soapbodyparts.rb
+test/wsdl/test_emptycomplextype.rb
+test/wsdl/test_fault.rb
+test/wsdl/test_multiplefault.rb
+test/xsd/noencoding.xml
+test/xsd/test_noencoding.rb
+test/xsd/test_xmlschemaparser.rb
+test/xsd/test_xsd.rb
+test/xsd/xmlschema.xml
+test/yaml/test_yaml.rb
+vms/config.h_in
+vms/vms.h
+win32/Makefile.sub
+win32/README.win32
+win32/configure.bat
+win32/dir.h
+win32/mkexports.rb
+win32/resource.rb
+win32/setup.mak
+win32/win32.c
+win32/win32.h
+win32/winmain.c
+wince/Makefile.sub
+wince/README.wince
+wince/assert.c
+wince/assert.h
+wince/configure.bat
+wince/direct.c
+wince/direct.h
+wince/errno.c
+wince/errno.h
+wince/fcntl.h
+wince/io.h
+wince/io_wce.c
+wince/mkconfig_wce.rb
+wince/mkexports.rb
+wince/process.h
+wince/process_wce.c
+wince/resource.rb
+wince/setup.mak
+wince/signal.h
+wince/signal_wce.c
+wince/stddef.h
+wince/stdio.c
+wince/stdlib.c
+wince/string_wce.c
+wince/sys/stat.c
+wince/sys/stat.h
+wince/sys/timeb.c
+wince/sys/timeb.h
+wince/sys/types.h
+wince/sys/utime.c
+wince/sys/utime.h
+wince/time.h
+wince/time_wce.c
+wince/varargs.h
+wince/wince.c
+wince/wince.h
+wince/wincemain.c
+wince/wincon.h
+wince/winsock2.c
+x68/_dtos18.c
+x68/_round.c
+x68/fconvert.c
+x68/select.c
diff --git a/Makefile.in b/Makefile.in
new file mode 100644
index 0000000000..663ba43111
--- /dev/null
+++ b/Makefile.in
@@ -0,0 +1,380 @@
+SHELL = /bin/sh
+
+#### Start of system configuration section. ####
+
+srcdir = @srcdir@
+VPATH = $(srcdir):$(srcdir)/missing
+
+CC = @CC@
+YACC = @YACC@
+PURIFY =
+AUTOCONF = autoconf
+@SET_MAKE@
+
+prefix = @prefix@
+exec_prefix = @exec_prefix@
+bindir = @bindir@
+sbindir = @sbindir@
+libdir = @libdir@
+libexecdir = @libexecdir@
+arch = @arch@
+sitearch = @sitearch@
+sitedir = @sitedir@
+
+CFLAGS = @CFLAGS@ @XCFLAGS@ @ARCH_FLAG@
+CPPFLAGS = -I. -I$(srcdir) @CPPFLAGS@
+LDFLAGS = @STATIC@ $(CFLAGS) @LDFLAGS@
+EXTLDFLAGS =
+XLDFLAGS = @XLDFLAGS@ $(EXTLDFLAGS)
+EXTLIBS =
+LIBS = @LIBS@ $(EXTLIBS)
+MISSING = @LIBOBJS@ @ALLOCA@
+LDSHARED = @LIBRUBY_LDSHARED@
+DLDFLAGS = @LIBRUBY_DLDFLAGS@ $(EXTLDFLAGS) @ARCH_FLAG@
+SOLIBS = @SOLIBS@
+MAINLIBS = @MAINLIBS@
+
+RUBY_INSTALL_NAME=@RUBY_INSTALL_NAME@
+RUBY_SO_NAME=@RUBY_SO_NAME@
+EXEEXT = @EXEEXT@
+PROGRAM=$(RUBY_INSTALL_NAME)$(EXEEXT)
+RUBY = $(RUBY_INSTALL_NAME)
+MINIRUBY = @MINIRUBY@
+
+#### End of system configuration section. ####
+
+MAJOR= @MAJOR@
+MINOR= @MINOR@
+TEENY= @TEENY@
+
+LIBRUBY_A = @LIBRUBY_A@
+LIBRUBY_SO = @LIBRUBY_SO@
+LIBRUBY_ALIASES= @LIBRUBY_ALIASES@
+LIBRUBY = @LIBRUBY@
+LIBRUBYARG = @LIBRUBYARG@
+LIBRUBYARG_STATIC = @LIBRUBYARG_STATIC@
+LIBRUBYARG_SHARED = @LIBRUBYARG_SHARED@
+
+PREP = @PREP@ @ARCHFILE@
+SETUP =
+EXTSTATIC = @EXTSTATIC@
+
+EXTOBJS =
+DLDOBJS = $(DMYEXT)
+DMYEXT = dmyext.@OBJEXT@
+
+MAINOBJ = main.@OBJEXT@
+
+OBJS = array.@OBJEXT@ \
+ bignum.@OBJEXT@ \
+ class.@OBJEXT@ \
+ compar.@OBJEXT@ \
+ dir.@OBJEXT@ \
+ dln.@OBJEXT@ \
+ enum.@OBJEXT@ \
+ error.@OBJEXT@ \
+ eval.@OBJEXT@ \
+ file.@OBJEXT@ \
+ gc.@OBJEXT@ \
+ hash.@OBJEXT@ \
+ inits.@OBJEXT@ \
+ io.@OBJEXT@ \
+ marshal.@OBJEXT@ \
+ math.@OBJEXT@ \
+ numeric.@OBJEXT@ \
+ object.@OBJEXT@ \
+ pack.@OBJEXT@ \
+ parse.@OBJEXT@ \
+ process.@OBJEXT@ \
+ prec.@OBJEXT@ \
+ random.@OBJEXT@ \
+ range.@OBJEXT@ \
+ re.@OBJEXT@ \
+ regex.@OBJEXT@ \
+ ruby.@OBJEXT@ \
+ signal.@OBJEXT@ \
+ sprintf.@OBJEXT@ \
+ st.@OBJEXT@ \
+ string.@OBJEXT@ \
+ struct.@OBJEXT@ \
+ time.@OBJEXT@ \
+ util.@OBJEXT@ \
+ variable.@OBJEXT@ \
+ version.@OBJEXT@ \
+ $(MISSING)
+
+MANTYPE = @MANTYPE@
+
+SCRIPT_ARGS = --dest-dir="$(DESTDIR)" \
+ --make="$(MAKE)" \
+ --mflags="$(MFLAGS)" \
+ --make-flags="$(MAKEFLAGS)"
+
+all: @MAKEFILES@ miniruby$(EXEEXT) rbconfig.rb $(LIBRUBY)
+ @$(MINIRUBY) $(srcdir)/ext/extmk.rb --extstatic="$(EXTSTATIC)" $(SCRIPT_ARGS)
+
+miniruby$(EXEEXT): config.status $(LIBRUBY_A) $(MAINOBJ) $(DMYEXT)
+ @rm -f $@
+ $(PURIFY) $(CC) $(LDFLAGS) $(MAINLIBS) $(MAINOBJ) $(DMYEXT) $(LIBRUBY_A) $(LIBS) -o $@
+
+$(PROGRAM): $(LIBRUBY) $(MAINOBJ) $(EXTOBJS) $(SETUP) miniruby$(EXEEXT)
+ @rm -f $@
+ $(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(MAINLIBS) $(MAINOBJ) $(EXTOBJS) $(LIBRUBYARG) $(LIBS) -o $@
+
+# We must `rm' the library each time this rule is invoked because "updating" a
+# MAB library on Apple/NeXT (see --enable-fat-binary in configure) is not
+# supported.
+$(LIBRUBY_A): $(OBJS) $(DMYEXT)
+ @rm -f $@
+ @AR@ rcu $@ $(OBJS) $(DMYEXT)
+ @-@RANLIB@ $@ 2> /dev/null || true
+
+$(LIBRUBY_SO): $(OBJS) $(DLDOBJS) miniruby$(EXEEXT) $(PREP)
+ $(LDSHARED) $(DLDFLAGS) $(OBJS) $(DLDOBJS) $(SOLIBS) -o $@
+ @-$(MINIRUBY) -e 'ARGV.each{|link| File.delete link if File.exist? link; \
+ File.symlink "$(LIBRUBY_SO)", link}' \
+ $(LIBRUBY_ALIASES) || true
+
+ruby.imp: $(LIBRUBY_A)
+ @@NM@ -Pgp $(LIBRUBY_A) | awk 'BEGIN{print "#!"}; $$2~/^[BD]$$/{print $$1}' | sort -u -o $@
+# $(MINIRUBY) $< $@
+
+install: install-nodoc @RDOCTARGET@
+
+install-nodoc: rbconfig.rb
+ $(MINIRUBY) $(srcdir)/instruby.rb $(SCRIPT_ARGS) --mantype="$(MANTYPE)"
+ $(MINIRUBY) $(srcdir)/ext/extmk.rb $(SCRIPT_ARGS) install
+
+what-where no-install: rbconfig.rb
+ $(MINIRUBY) $(srcdir)/instruby.rb -n $(SCRIPT_ARGS) --mantype="$(MANTYPE)"
+ $(MINIRUBY) $(srcdir)/ext/extmk.rb -n $(SCRIPT_ARGS) install
+
+install-doc:
+ @echo Generating RDoc documentation
+ $(bindir)/$(PROGRAM) $(srcdir)/bin/rdoc --all --ri-system $(srcdir)
+
+clean-ext:
+ @-$(MINIRUBY) $(srcdir)/ext/extmk.rb $(SCRIPT_ARGS) clean 2> /dev/null || true
+
+clean-local:
+ @rm -f $(OBJS) $(MAINOBJ) $(LIBRUBY_A) $(LIBRUBY_SO) $(LIBRUBY_ALIASES)
+ @rm -f ext/extinit.c ext/extinit.@OBJEXT@ dmyext.@OBJEXT@
+ @rm -f $(PROGRAM) miniruby$(EXEEXT)
+
+clean: clean-ext clean-local
+
+distclean-ext:
+ @-$(MINIRUBY) $(srcdir)/ext/extmk.rb $(SCRIPT_ARGS) distclean 2> /dev/null || true
+
+distclean-local: clean-local
+ @rm -f @MAKEFILES@ config.h rbconfig.rb
+ @rm -f ext/config.cache config.cache config.log config.status
+ @rm -f *~ core *.core gmon.out y.tab.c y.output ruby.imp
+
+distclean: distclean-ext distclean-local
+
+realclean: distclean
+ @rm -f parse.c
+ @rm -f lex.c
+
+test: miniruby$(EXEEXT) rbconfig.rb $(PROGRAM) PHONY
+ @./miniruby$(EXEEXT) $(srcdir)/rubytest.rb
+
+rbconfig.rb: miniruby$(EXEEXT) $(srcdir)/mkconfig.rb config.status $(PREP)
+ @$(MINIRUBY) $(srcdir)/mkconfig.rb rbconfig.rb
+
+fake.rb: miniruby$(EXEEXT) Makefile
+ @echo ' \
+ class Object; \
+ CROSS_COMPILING = RUBY_PLATFORM; \
+ remove_const :RUBY_PLATFORM; \
+ remove_const :RUBY_VERSION; \
+ RUBY_PLATFORM = "@arch@"; \
+ RUBY_VERSION = "@MAJOR@.@MINOR@.@TEENY@"; \
+ end; \
+ if RUBY_PLATFORM =~ /mswin|bccwin|mingw/; \
+ class File; \
+ remove_const :ALT_SEPARATOR; \
+ ALT_SEPARATOR = "\\"; \
+ end; \
+ end; \
+ ' > $@
+
+Makefile: $(srcdir)/Makefile.in
+
+.PRECIOUS: @MAKEFILES@
+
+.PHONY: test install install-nodoc install-doc
+
+PHONY:
+
+@MAKEFILES@: config.status
+ MAKE=$(MAKE) $(SHELL) ./config.status
+ @{ \
+ echo "all:; -@rm -f conftest.mk"; \
+ echo "conftest.mk: .force; @echo AUTO_REMAKE"; \
+ echo ".force:"; \
+ } > conftest.mk || exit 1; \
+ $(MAKE) -f conftest.mk | grep '^AUTO_REMAKE$$' >/dev/null 2>&1 || \
+ { echo "Makefile updated, restart."; exit 1; }
+
+config.status: $(srcdir)/configure
+ MINIRUBY="$(MINIRUBY)" $(SHELL) ./config.status --recheck
+
+$(srcdir)/configure: $(srcdir)/configure.in
+ cd $(srcdir) && $(AUTOCONF)
+
+.c.@OBJEXT@:
+ $(CC) $(CFLAGS) $(CPPFLAGS) -c $<
+
+lex.c: keywords
+ @-rm -f $@
+ gperf -p -j1 -i 1 -g -o -t -N rb_reserved_word -k1,3,$$ $? > $@ || \
+ cp "$(srcdir)/$@" .
+
+.y.c:
+ $(YACC) $<
+ sed '/^#/s|y\.tab\.c|$@|' y.tab.c > $@
+ rm -f y.tab.c
+
+ext/extinit.@OBJEXT@: ext/extinit.c $(SETUP)
+ $(CC) $(CFLAGS) $(CPPFLAGS) @OUTFLAG@$@ -c ext/extinit.c
+
+acosh.@OBJEXT@: $(srcdir)/missing/acosh.c
+ $(CC) -I. $(CFLAGS) $(CPPFLAGS) -c $(srcdir)/missing/acosh.c
+
+alloca.@OBJEXT@: $(srcdir)/missing/alloca.c
+ $(CC) -I. $(CFLAGS) $(CPPFLAGS) -c $(srcdir)/missing/alloca.c
+
+crypt.@OBJEXT@: $(srcdir)/missing/crypt.c
+ $(CC) -I. $(CFLAGS) $(CPPFLAGS) -c $(srcdir)/missing/crypt.c
+
+dup2.@OBJEXT@: $(srcdir)/missing/dup2.c
+ $(CC) -I. $(CFLAGS) $(CPPFLAGS) -c $(srcdir)/missing/dup2.c
+
+fileblocks.@OBJEXT@: $(srcdir)/missing/fileblocks.c
+ $(CC) -I. $(CFLAGS) $(CPPFLAGS) -c $(srcdir)/missing/fileblocks.c
+
+finite.@OBJEXT@: $(srcdir)/missing/finite.c
+ $(CC) -I. $(CFLAGS) $(CPPFLAGS) -c $(srcdir)/missing/finite.c
+
+flock.@OBJEXT@: $(srcdir)/missing/flock.c
+ $(CC) -I. $(CFLAGS) $(CPPFLAGS) -c $(srcdir)/missing/flock.c
+
+isinf.@OBJEXT@: $(srcdir)/missing/isinf.c
+ $(CC) -I. $(CFLAGS) $(CPPFLAGS) -c $(srcdir)/missing/isinf.c
+
+isnan.@OBJEXT@: $(srcdir)/missing/isnan.c
+ $(CC) -I. $(CFLAGS) $(CPPFLAGS) -c $(srcdir)/missing/isnan.c
+
+fnmatch.@OBJEXT@: $(srcdir)/missing/fnmatch.c
+ $(CC) -I. $(CFLAGS) $(CPPFLAGS) -c $(srcdir)/missing/fnmatch.c
+
+memcmp.@OBJEXT@: $(srcdir)/missing/memcmp.c
+ $(CC) $(CFLAGS) $(CPPFLAGS) -c $(srcdir)/missing/memcmp.c
+
+memmove.@OBJEXT@: $(srcdir)/missing/memmove.c
+ $(CC) $(CFLAGS) $(CPPFLAGS) -c $(srcdir)/missing/memmove.c
+
+mkdir.@OBJEXT@: $(srcdir)/missing/mkdir.c
+ $(CC) $(CFLAGS) $(CPPFLAGS) -c $(srcdir)/missing/mkdir.c
+
+vsnprintf.@OBJEXT@: $(srcdir)/missing/vsnprintf.c
+ $(CC) $(CFLAGS) $(CPPFLAGS) -c $(srcdir)/missing/vsnprintf.c
+
+strcasecmp.@OBJEXT@: $(srcdir)/missing/strcasecmp.c
+ $(CC) $(CFLAGS) $(CPPFLAGS) -c $(srcdir)/missing/strcasecmp.c
+
+strncasecmp.@OBJEXT@: $(srcdir)/missing/strncasecmp.c
+ $(CC) $(CFLAGS) $(CPPFLAGS) -c $(srcdir)/missing/strncasecmp.c
+
+strchr.@OBJEXT@: $(srcdir)/missing/strchr.c
+ $(CC) $(CFLAGS) $(CPPFLAGS) -c $(srcdir)/missing/strchr.c
+
+strerror.@OBJEXT@: $(srcdir)/missing/strerror.c
+ $(CC) $(CFLAGS) $(CPPFLAGS) -c $(srcdir)/missing/strerror.c
+
+strftime.@OBJEXT@: $(srcdir)/missing/strftime.c
+ $(CC) -I. $(CFLAGS) $(CPPFLAGS) -c $(srcdir)/missing/strftime.c
+
+strstr.@OBJEXT@: $(srcdir)/missing/strstr.c
+ $(CC) $(CFLAGS) $(CPPFLAGS) -c $(srcdir)/missing/strstr.c
+
+strtol.@OBJEXT@: $(srcdir)/missing/strtol.c
+ $(CC) $(CFLAGS) $(CPPFLAGS) -c $(srcdir)/missing/strtol.c
+
+strtoul.@OBJEXT@: $(srcdir)/missing/strtoul.c
+ $(CC) $(CFLAGS) $(CPPFLAGS) -c $(srcdir)/missing/strtoul.c
+
+x68.@OBJEXT@: $(srcdir)/missing/x68.c
+ $(CC) $(CFLAGS) $(CPPFLAGS) -c $(srcdir)/missing/x68.c
+
+os2.@OBJEXT@: $(srcdir)/missing/os2.c
+ $(CC) $(CFLAGS) $(CPPFLAGS) -c $(srcdir)/missing/os2.c
+
+dl_os2.@OBJEXT@: $(srcdir)/missing/dl_os2.c
+ $(CC) $(CFLAGS) $(CPPFLAGS) -c $(srcdir)/missing/dl_os2.c
+
+win32.@OBJEXT@: $(srcdir)/win32/win32.c
+ $(CC) $(CFLAGS) $(CPPFLAGS) -I$(srcdir)/win32 -c $(srcdir)/win32/win32.c
+
+# Prevent GNU make v3 from overflowing arg limit on SysV.
+.NOEXPORT:
+###
+array.@OBJEXT@: array.c ruby.h config.h defines.h intern.h missing.h \
+ util.h st.h
+bignum.@OBJEXT@: bignum.c ruby.h config.h defines.h intern.h missing.h
+class.@OBJEXT@: class.c ruby.h config.h defines.h intern.h missing.h \
+ rubysig.h node.h st.h
+compar.@OBJEXT@: compar.c ruby.h config.h defines.h intern.h missing.h
+dir.@OBJEXT@: dir.c ruby.h config.h defines.h intern.h missing.h util.h
+dln.@OBJEXT@: dln.c ruby.h config.h defines.h intern.h missing.h dln.h
+dmyext.@OBJEXT@: dmyext.c
+enum.@OBJEXT@: enum.c ruby.h config.h defines.h intern.h missing.h node.h \
+ util.h
+error.@OBJEXT@: error.c ruby.h config.h defines.h intern.h missing.h \
+ env.h st.h
+eval.@OBJEXT@: eval.c ruby.h config.h defines.h intern.h missing.h node.h \
+ env.h util.h rubysig.h st.h dln.h
+file.@OBJEXT@: file.c ruby.h config.h defines.h intern.h missing.h \
+ rubyio.h rubysig.h util.h dln.h
+gc.@OBJEXT@: gc.c ruby.h config.h defines.h intern.h missing.h rubysig.h \
+ st.h node.h env.h re.h regex.h
+hash.@OBJEXT@: hash.c ruby.h config.h defines.h intern.h missing.h st.h \
+ util.h rubysig.h
+inits.@OBJEXT@: inits.c ruby.h config.h defines.h intern.h missing.h
+io.@OBJEXT@: io.c ruby.h config.h defines.h intern.h missing.h rubyio.h \
+ rubysig.h env.h util.h
+main.@OBJEXT@: main.c ruby.h config.h defines.h intern.h missing.h
+marshal.@OBJEXT@: marshal.c ruby.h config.h defines.h intern.h missing.h \
+ rubyio.h st.h util.h
+math.@OBJEXT@: math.c ruby.h config.h defines.h intern.h missing.h
+numeric.@OBJEXT@: numeric.c ruby.h config.h defines.h intern.h missing.h
+object.@OBJEXT@: object.c ruby.h config.h defines.h intern.h missing.h \
+ st.h util.h
+pack.@OBJEXT@: pack.c ruby.h config.h defines.h intern.h missing.h
+parse.@OBJEXT@: parse.c ruby.h config.h defines.h intern.h missing.h \
+ env.h node.h st.h regex.h util.h lex.c
+prec.@OBJEXT@: prec.c ruby.h config.h defines.h intern.h missing.h
+process.@OBJEXT@: process.c ruby.h config.h defines.h intern.h missing.h \
+ rubysig.h st.h
+random.@OBJEXT@: random.c ruby.h config.h defines.h intern.h missing.h
+range.@OBJEXT@: range.c ruby.h config.h defines.h intern.h missing.h
+re.@OBJEXT@: re.c ruby.h config.h defines.h intern.h missing.h re.h \
+ regex.h
+regex.@OBJEXT@: regex.c config.h regex.h
+ruby.@OBJEXT@: ruby.c ruby.h config.h defines.h intern.h missing.h dln.h \
+ node.h util.h
+signal.@OBJEXT@: signal.c ruby.h config.h defines.h intern.h missing.h \
+ rubysig.h
+sprintf.@OBJEXT@: sprintf.c ruby.h config.h defines.h intern.h missing.h
+st.@OBJEXT@: st.c config.h st.h
+string.@OBJEXT@: string.c ruby.h config.h defines.h intern.h missing.h \
+ re.h regex.h
+struct.@OBJEXT@: struct.c ruby.h config.h defines.h intern.h missing.h
+time.@OBJEXT@: time.c ruby.h config.h defines.h intern.h missing.h
+util.@OBJEXT@: util.c ruby.h config.h defines.h intern.h missing.h util.h
+variable.@OBJEXT@: variable.c ruby.h config.h defines.h intern.h \
+ missing.h env.h node.h st.h util.h
+version.@OBJEXT@: version.c ruby.h config.h defines.h intern.h missing.h \
+ version.h
diff --git a/NEWS b/NEWS
deleted file mode 100644
index e1adb5115d..0000000000
--- a/NEWS
+++ /dev/null
@@ -1,826 +0,0 @@
-# -*- rdoc -*-
-
-= NEWS for Ruby 2.7.0
-
-This document is a list of user visible feature changes made between
-releases except for bug fixes.
-
-Note that each entry is kept so brief that no reason behind or reference
-information is supplied with. For a full list of changes with all
-sufficient information, see the ChangeLog file or Redmine
-(e.g. <tt>https://bugs.ruby-lang.org/issues/$FEATURE_OR_BUG_NUMBER</tt>).
-
-== Changes since the 2.6.0 release
-
-=== Language changes
-
-==== Pattern matching
-
-* Pattern matching is introduced as an experimental feature. [Feature #14912]
-
- case [0, [1, 2, 3]]
- in [a, [b, *c]]
- p a #=> 0
- p b #=> 1
- p c #=> [2, 3]
- end
-
- case {a: 0, b: 1}
- in {a: 0, x: 1}
- :unreachable
- in {a: 0, b: var}
- p var #=> 1
- end
-
- case -1
- in 0 then :unreachable
- in 1 then :unreachable
- end #=> NoMatchingPatternError
-
- json = <<END
- {
- "name": "Alice",
- "age": 30,
- "children": [{ "name": "Bob", "age": 2 }]
- }
- END
-
- JSON.parse(json, symbolize_names: true) in {name: "Alice", children: [{name: name, age: age}]}
-
- p name #=> "Bob"
- p age #=> 2
-
- JSON.parse(json, symbolize_names: true) in {name: "Alice", children: [{name: "Charlie", age: age}]}
- #=> NoMatchingPatternError
-
-* See the following slides for more details:
- * https://speakerdeck.com/k_tsj/pattern-matching-new-feature-in-ruby-2-dot-7
- * Note that the slides are slightly obsolete.
-
-* The warning against pattern matching can be suppressed with
- {-W:no-experimental option}[#label-Warning+option].
-
-==== The spec of keyword arguments is changed towards 3.0
-
-* Automatic conversion of keyword arguments and positional arguments is
- deprecated, and conversion will be removed in Ruby 3. [Feature #14183]
-
- * When a method call passes a Hash at the last argument, and when it
- passes no keywords, and when the called method accepts keywords,
- a warning is emitted. To continue treating the hash as keywords,
- add a double splat operator to avoid the warning and ensure
- correct behavior in Ruby 3.
-
- def foo(key: 42); end; foo({key: 42}) # warned
- def foo(**kw); end; foo({key: 42}) # warned
- def foo(key: 42); end; foo(**{key: 42}) # OK
- def foo(**kw); end; foo(**{key: 42}) # OK
-
- * When a method call passes keywords to a method that accepts keywords,
- but it does not pass enough required positional arguments, the
- keywords are treated as a final required positional argument, and a
- warning is emitted. Pass the argument as a hash instead of keywords
- to avoid the warning and ensure correct behavior in Ruby 3.
-
- def foo(h, **kw); end; foo(key: 42) # warned
- def foo(h, key: 42); end; foo(key: 42) # warned
- def foo(h, **kw); end; foo({key: 42}) # OK
- def foo(h, key: 42); end; foo({key: 42}) # OK
-
- * When a method accepts specific keywords but not a keyword splat, and
- a hash or keywords splat is passed to the method that includes both
- Symbol and non-Symbol keys, the hash will continue to be split, and
- a warning will be emitted. You will need to update the calling code
- to pass separate hashes to ensure correct behavior in Ruby 3.
-
- def foo(h={}, key: 42); end; foo("key" => 43, key: 42) # warned
- def foo(h={}, key: 42); end; foo({"key" => 43, key: 42}) # warned
- def foo(h={}, key: 42); end; foo({"key" => 43}, key: 42) # OK
-
- * If a method does not accept keywords, and is called with keywords,
- the keywords are still treated as a positional hash, with no warning.
- This behavior will continue to work in Ruby 3.
-
- def foo(opt={}); end; foo( key: 42 ) # OK
-
-* Non-symbols are allowed as keyword argument keys if the method accepts
- arbitrary keywords. [Feature #14183]
-
- * Non-Symbol keys in a keyword arguments hash were prohibited in 2.6.0,
- but are now allowed again. [Bug #15658]
-
- def foo(**kw); p kw; end; foo("str" => 1) #=> {"str"=>1}
-
-* <code>**nil</code> is allowed in method definitions to explicitly mark
- that the method accepts no keywords. Calling such a method with keywords
- will result in an ArgumentError. [Feature #14183]
-
- def foo(h, **nil); end; foo(key: 1) # ArgumentError
- def foo(h, **nil); end; foo(**{key: 1}) # ArgumentError
- def foo(h, **nil); end; foo("str" => 1) # ArgumentError
- def foo(h, **nil); end; foo({key: 1}) # OK
- def foo(h, **nil); end; foo({"str" => 1}) # OK
-
-* Passing an empty keyword splat to a method that does not accept keywords
- no longer passes an empty hash, unless the empty hash is necessary for
- a required parameter, in which case a warning will be emitted. Remove
- the double splat to continue passing a positional hash. [Feature #14183]
-
- h = {}; def foo(*a) a end; foo(**h) # []
- h = {}; def foo(a) a end; foo(**h) # {} and warning
- h = {}; def foo(*a) a end; foo(h) # [{}]
- h = {}; def foo(a) a end; foo(h) # {}
-
-* Above warnings can be suppressed also with {-W:no-deprecated option}[#label-Warning+option].
-
-==== Numbered parameters
-
-* Numbered parameters as default block parameters are introduced.
- [Feature #4475]
-
- [1, 2, 10].map { _1.to_s(16) } #=> ["1", "2", "a"]
- [[1, 2], [3, 4]].map { _1 + _2 } #=> [3, 7]
-
- You can still define a local variable named +_1+ and so on,
- and that is honored when present, but renders a warning.
-
- _1 = 0 #=> warning: `_1' is reserved for numbered parameter; consider another name
- [1].each { p _1 } # prints 0 instead of 1
-
-==== proc/lambda without block is deprecated
-
-* Proc.new and Kernel#proc with no block in a method called with a block is
- warned now.
-
- def foo
- proc
- end
- foo { puts "Hello" } #=> warning: Capturing the given block using Kernel#proc is deprecated; use `&block` instead
-
- This warning can be suppressed with {-W:no-deprecated option}[#label-Warning+option].
-
-* Kernel#lambda with no block in a method called with a block raises an exception.
-
- def bar
- lambda
- end
- bar { puts "Hello" } #=> tried to create Proc object without a block (ArgumentError)
-
-==== Other miscellaneous changes
-
-* A beginless range is experimentally introduced. It might be useful
- in +case+, new call-sequence of the <code>Comparable#clamp</code>,
- constants and DSLs. [Feature #14799]
-
- ary[..3] # identical to ary[0..3]
-
- case RUBY_VERSION
- when ..."2.4" then puts "EOL"
- # ...
- end
-
- age.clamp(..100)
-
- where(sales: ..100)
-
-* Setting <code>$;</code> to a non-nil value is warned now. [Feature #14240]
- Use of it in String#split is warned too.
- This warning can be suppressed with {-W:no-deprecated option}[#label-Warning+option].
-
-* Setting <code>$,</code> to a non-nil value is warned now. [Feature #14240]
- Use of it in Array#join is warned too.
- This warning can be suppressed with {-W:no-deprecated option}[#label-Warning+option].
-
-* Quoted here-document identifiers must end within the same line.
-
- <<"EOS
- " # This had been warned since 2.4; Now it raises a SyntaxError
- EOS
-
-* The flip-flop syntax deprecation is reverted. [Feature #5400]
-
-* Comment lines can be placed between fluent dot now.
-
- foo
- # .bar
- .baz # => foo.baz
-
-* Calling a private method with a literal +self+ as the receiver
- is now allowed. [Feature #11297] [Feature #16123]
-
-* Modifier rescue now operates the same for multiple assignment as single
- assignment. [Bug #8279]
-
- a, b = raise rescue [1, 2]
- # Previously parsed as: (a, b = raise) rescue [1, 2]
- # Now parsed as: a, b = (raise rescue [1, 2])
-
-* +yield+ in singleton class syntax is warned and will be deprecated later. [Feature #15575].
-
- def foo
- class << Object.new
- yield #=> warning: `yield' in class syntax will not be supported from Ruby 3.0. [Feature #15575]
- end
- end
- foo { p :ok }
-
- This warning can be suppressed with {-W:no-deprecated option}[#label-Warning+option].
-
-* Argument forwarding by <code>(...)</code> is introduced. [Feature #16253]
-
- def foo(...)
- bar(...)
- end
-
- All arguments to +foo+ are forwarded to +bar+, including keyword and
- block arguments.
- Note that the parentheses are mandatory. <code>bar ...</code> is parsed
- as an endless range.
-
-* Access and setting of <code>$SAFE</code> is now always warned. <code>$SAFE</code>
- will become a normal global variable in Ruby 3.0. [Feature #16131]
-
-* <code>Object#{taint,untaint,trust,untrust}</code> and related functions in the C-API
- no longer have an effect (all objects are always considered untainted), and are now
- warned in verbose mode. This warning will be disabled even in non-verbose mode in
- Ruby 3.0, and the methods and C functions will be removed in Ruby 3.2. [Feature #16131]
-
-* Refinements take place at Object#method and Module#instance_method. [Feature #15373]
-
-=== Command line options
-
-==== Warning option
-
-The +-W+ option has been extended with a following +:+, to manage categorized
-warnings. [Feature #16345] [Feature #16420]
-
-* To suppress deprecation warnings:
-
- $ ruby -e '$; = ""'
- -e:1: warning: `$;' is deprecated
-
- $ ruby -W:no-deprecated -e '$; = //'
-
-* It works with the +RUBYOPT+ environment variable:
-
- $ RUBYOPT=-W:no-deprecated ruby -e '$; = //'
-
-* To suppress experimental feature warnings:
-
- $ ruby -e '0 in a'
- -e:1: warning: Pattern matching is experimental, and the behavior may change in future versions of Ruby!
-
- $ ruby -W:no-experimental -e '0 in a'
-
-* To suppress both by using +RUBYOPT+, set space separated values:
-
- $ RUBYOPT='-W:no-deprecated -W:no-experimental' ruby -e '($; = "") in a'
-
-See also Warning in {Core classes updates}[#label-Core+classes+updates+-28outstanding+ones+only-29].
-
-=== Core classes updates (outstanding ones only)
-
-Array::
-
- New methods::
-
- * Added Array#intersection. [Feature #16155]
-
- * Added Array#minmax, with a faster implementation than Enumerable#minmax. [Bug #15929]
-
-Comparable::
-
- Modified method::
-
- * Comparable#clamp now accepts a Range argument. [Feature #14784]
-
- -1.clamp(0..2) #=> 0
- 1.clamp(0..2) #=> 1
- 3.clamp(0..2) #=> 2
- # With beginless and endless ranges:
- -1.clamp(0..) #=> 0
- 3.clamp(..2) #=> 2
-
-
-Complex::
-
- New method::
-
- * Added Complex#<=>.
- So <code>0 <=> 0i</code> will not raise NoMethodError. [Bug #15857]
-
-Dir::
-
- Modified methods::
-
- * Dir.glob and Dir.[] no longer allow NUL-separated glob pattern.
- Use Array instead. [Feature #14643]
-
-Encoding::
-
- New encoding::
-
- * Added new encoding CESU-8. [Feature #15931]
-
-Enumerable::
-
- New methods::
-
- * Added Enumerable#filter_map. [Feature #15323]
-
- [1, 2, 3].filter_map {|x| x.odd? ? x.to_s : nil } #=> ["1", "3"]
-
- * Added Enumerable#tally. [Feature #11076]
-
- ["A", "B", "C", "B", "A"].tally #=> {"A"=>2, "B"=>2, "C"=>1}
-
-Enumerator::
-
- New methods::
-
- * Added Enumerator.produce to generate an Enumerator from any custom
- data transformation. [Feature #14781]
-
- require "date"
- dates = Enumerator.produce(Date.today, &:succ) #=> infinite sequence of dates
- dates.detect(&:tuesday?) #=> next Tuesday
-
- * Added Enumerator::Lazy#eager that generates a non-lazy enumerator
- from a lazy enumerator. [Feature #15901]
-
- a = %w(foo bar baz)
- e = a.lazy.map {|x| x.upcase }.map {|x| x + "!" }.eager
- p e.class #=> Enumerator
- p e.map {|x| x + "?" } #=> ["FOO!?", "BAR!?", "BAZ!?"]
-
- * Added Enumerator::Yielder#to_proc so that a Yielder object
- can be directly passed to another method as a block
- argument. [Feature #15618]
-
-Fiber::
-
- New method::
-
- * Added Fiber#raise that behaves like Fiber#resume but raises an
- exception on the resumed fiber. [Feature #10344]
-
-File::
-
- Modified method::
-
- * File.extname now returns a dot string for names ending with a dot on
- non-Windows platforms. [Bug #15267]
-
- File.extname("foo.") #=> "."
-
-FrozenError::
-
- New method::
-
- * Added FrozenError#receiver to return the frozen object on which
- modification was attempted. To set this object when raising
- FrozenError in Ruby code, FrozenError.new accepts a +:receiver+
- option. [Feature #15751]
-
-GC::
-
- New method::
-
- * Added GC.compact method for compacting the heap.
- This function compacts live objects in the heap so that fewer pages may
- be used, and the heap may be more CoW (copy-on-write) friendly. [Feature #15626]
-
- Details on the algorithm and caveats can be found here:
- https://bugs.ruby-lang.org/issues/15626
-
-IO::
-
- New method::
-
- * Added IO#set_encoding_by_bom to check the BOM and set the external
- encoding. [Bug #15210]
-
-Integer::
-
- Modified method::
-
- * Integer#[] now supports range operations. [Feature #8842]
-
- 0b01001101[2, 4] #=> 0b0011
- 0b01001100[2..5] #=> 0b0011
- 0b01001100[2...6] #=> 0b0011
- # ^^^^
-
-Method::
-
- Modified method::
-
- * Method#inspect shows more information. [Feature #14145]
-
-Module::
-
- New methods::
-
- * Added Module#const_source_location to retrieve the location where a
- constant is defined. [Feature #10771]
-
- * Added Module#ruby2_keywords for marking a method as passing keyword
- arguments through a regular argument splat, useful when delegating
- all arguments to another method in a way that can be backwards
- compatible with older Ruby versions. [Bug #16154]
-
- Modified methods::
-
- * Module#autoload? now takes an +inherit+ optional argument, like
- Module#const_defined?. [Feature #15777]
-
- * Module#name now always returns a frozen String. The returned String is
- always the same for a given Module. This change is
- experimental. [Feature #16150]
-
-NilClass / TrueClass / FalseClass::
-
- Modified methods::
-
- * NilClass#to_s, TrueClass#to_s, and FalseClass#to_s now always return a
- frozen String. The returned String is always the same for each of these
- values. This change is experimental. [Feature #16150]
-
-ObjectSpace::WeakMap::
-
- Modified method::
-
- * ObjectSpace::WeakMap#[]= now accepts special objects as either key or
- values. [Feature #16035]
-
-Proc::
-
- New method::
-
- * Added Proc#ruby2_keywords for marking the proc as passing keyword
- arguments through a regular argument splat, useful when delegating
- all arguments to another method or proc in a way that can be backwards
- compatible with older Ruby versions. [Feature #16404]
-
-Range::
-
- New method::
-
- * Added Range#minmax, with a faster implementation than Enumerable#minmax.
- It returns a maximum that now corresponds to Range#max. [Bug #15807]
-
- Modified method::
-
- * Range#=== now uses Range#cover? for String arguments, too (in Ruby 2.6, it was
- changed from Range#include? for all types except strings). [Bug #15449]
-
-
-RubyVM::
-
- Removed method::
-
- * +RubyVM.resolve_feature_path+ moved to
- <code>$LOAD_PATH.resolve_feature_path</code>. [Feature #15903] [Feature #15230]
-
-String::
-
- Unicode::
-
- * Update Unicode version and Emoji version from 11.0.0 to
- 12.0.0. [Feature #15321]
-
- * Update Unicode version to 12.1.0, adding support for
- U+32FF SQUARE ERA NAME REIWA. [Feature #15195]
-
- * Update Unicode Emoji version to 12.1. [Feature #16272]
-
-Symbol::
-
- New methods::
-
- * Added Symbol#start_with? and Symbol#end_with? methods. [Feature #16348]
-
-Time::
-
- New methods::
-
- * Added Time#ceil method. [Feature #15772]
-
- * Added Time#floor method. [Feature #15653]
-
- Modified method::
-
- * Time#inspect is separated from Time#to_s and it shows
- the time's sub second. [Feature #15958]
-
-UnboundMethod::
-
- New method::
-
- * Added UnboundMethod#bind_call method. [Feature #15955]
-
- <code>umethod.bind_call(obj, ...)</code> is semantically equivalent
- to <code>umethod.bind(obj).call(...)</code>. This idiom is used in
- some libraries to call a method that is overridden. The added
- method does the same without allocation of an intermediate Method
- object.
-
- class Foo
- def add_1(x)
- x + 1
- end
- end
- class Bar < Foo
- def add_1(x) # override
- x + 2
- end
- end
-
- obj = Bar.new
- p obj.add_1(1) #=> 3
- p Foo.instance_method(:add_1).bind(obj).call(1) #=> 2
- p Foo.instance_method(:add_1).bind_call(obj, 1) #=> 2
-
-Warning::
-
- New methods::
-
- * Added Warning.[] and Warning.[]= to manage emitting/suppressing
- some categories of warnings. [Feature #16345] [Feature #16420]
-
-$LOAD_PATH::
-
- New method::
-
- * Added <code>$LOAD_PATH.resolve_feature_path</code>. [Feature #15903] [Feature #15230]
-
-=== Stdlib updates (outstanding ones only)
-
-Bundler::
-
- * Upgrade to Bundler 2.1.2.
- See https://github.com/bundler/bundler/releases/tag/v2.1.2
-
-CGI::
-
- * CGI.escapeHTML becomes 2~5x faster when there is at least one escaped character.
- See https://github.com/ruby/ruby/pull/2226
-
-CSV::
-
- * Upgrade to 3.1.2.
- See https://github.com/ruby/csv/blob/master/NEWS.md.
-
-Date::
-
- * Date.jisx0301, Date#jisx0301, and Date.parse support the new Japanese
- era. [Feature #15742]
-
-Delegator::
-
- * Object#DelegateClass accepts a block and module_evals it in the context
- of the returned class, similar to Class.new and Struct.new.
-
-ERB::
-
- * Prohibit marshaling ERB instance.
-
-IRB::
-
- * Introduce syntax highlighting inspired by the Pry gem to Binding#irb
- source lines, REPL input, and inspect output of some core-class objects.
-
- * Introduce multiline editing mode provided by Reline.
-
- * Show documentation when completion.
-
- * Enable auto indent and save/load history by default.
-
-JSON::
-
- * Upgrade to 2.3.0.
-
-Net::FTP::
-
- * Add Net::FTP#features to check available features, and Net::FTP#option to
- enable/disable each of them. [Feature #15964]
-
-Net::HTTP::
-
- * Add +ipaddr+ optional parameter to Net::HTTP#start to replace the address for
- the TCP/IP connection. [Feature #5180]
-
-Net::IMAP::
-
- * Add Server Name Indication (SNI) support. [Feature #15594]
-
-open-uri::
-
- * Warn open-uri's "open" method at Kernel.
- Use URI.open instead. [Misc #15893]
-
- * The default charset of "text/*" media type is UTF-8 instead of
- ISO-8859-1. [Bug #15933]
-
-OptionParser::
-
- * Now show "Did you mean?" for unknown options. [Feature #16256]
-
- test.rb:
-
- require "optparse"
- OptionParser.new do |opts|
- opts.on("-f", "--foo", "foo") {|v| }
- opts.on("-b", "--bar", "bar") {|v| }
- opts.on("-c", "--baz", "baz") {|v| }
- end.parse!
-
- example:
-
- $ ruby test.rb --baa
- Traceback (most recent call last):
- test.rb:7:in `<main>': invalid option: --baa (OptionParser::InvalidOption)
- Did you mean? baz
- bar
-
-Pathname::
-
- * Pathname.glob now delegates 3 arguments to Dir.glob
- to accept +base+ keyword. [Feature #14405]
-
-Racc::
-
- * Merge 1.4.15 from upstream repository and added cli of racc.
-
-Reline::
-
- * New stdlib that is compatible with the readline stdlib but is
- implemented in pure Ruby. It also provides a multiline editing mode.
-
-REXML::
-
- * Upgrade to 3.2.3.
- See https://github.com/ruby/rexml/blob/master/NEWS.md.
-
-RSS::
-
- * Upgrade to RSS 0.2.8.
- See https://github.com/ruby/rss/blob/master/NEWS.md.
-
-RubyGems::
-
- * Upgrade to RubyGems 3.1.2.
- * https://github.com/rubygems/rubygems/releases/tag/v3.1.0
- * https://github.com/rubygems/rubygems/releases/tag/v3.1.1
- * https://github.com/rubygems/rubygems/releases/tag/v3.1.2
-
-StringScanner::
-
- * Upgrade to 1.0.3.
- See https://github.com/ruby/strscan/blob/master/NEWS.md.
-
-=== Compatibility issues (excluding feature bug fixes)
-
-* The following libraries are no longer bundled gems.
- Install corresponding gems to use these features.
- * CMath (cmath gem)
- * Scanf (scanf gem)
- * Shell (shell gem)
- * Synchronizer (sync gem)
- * ThreadsWait (thwait gem)
- * E2MM (e2mmap gem)
-
-Proc::
- * The Proc#to_s format was changed. [Feature #16101]
-
-Range::
- * Range#minmax used to iterate on the range to determine the maximum.
- It now uses the same algorithm as Range#max. In rare cases (e.g.
- ranges of Floats or Strings), this may yield different results. [Bug #15807]
-
-=== Stdlib compatibility issues (excluding feature bug fixes)
-
-* Promote stdlib to default gems
- * The following default gems were published on rubygems.org
- * benchmark
- * cgi
- * delegate
- * getoptlong
- * net-pop
- * net-smtp
- * open3
- * pstore
- * readline
- * readline-ext
- * singleton
- * The following default gems were only promoted at ruby-core,
- but not yet published on rubygems.org.
- * monitor
- * observer
- * timeout
- * tracer
- * uri
- * yaml
-* The <tt>did_you_mean</tt> gem has been promoted up to a default gem from a bundled gem
-
-pathname::
-
- * Kernel#Pathname when called with a Pathname argument now returns
- the argument instead of creating a new Pathname. This is more
- similar to other Kernel methods, but can break code that modifies
- the return value and expects the argument not to be modified.
-
-profile.rb, Profiler__::
-
- * Removed from standard library. It was unmaintained since Ruby 2.0.0.
-
-=== C API updates
-
-* Many <code>*_kw</code> functions have been added for setting whether
- the final argument being passed should be treated as keywords. You
- may need to switch to these functions to avoid keyword argument
- separation warnings, and to ensure correct behavior in Ruby 3.
-
-* The <code>:</code> character in rb_scan_args format string is now
- treated as keyword arguments. Passing a positional hash instead of
- keyword arguments will emit a deprecation warning.
-
-* C API declarations with +ANYARGS+ are changed not to use +ANYARGS+.
- See https://github.com/ruby/ruby/pull/2404
-
-=== Implementation improvements
-
-Fiber::
-
- * Allow selecting different coroutine implementations by using
- +--with-coroutine=+, e.g.
-
- $ ./configure --with-coroutine=ucontext
- $ ./configure --with-coroutine=copy
-
- * Replace previous stack cache with fiber pool cache. The fiber pool
- allocates many stacks in a single memory region. Stack allocation
- becomes O(log N) and fiber creation is amortized O(1). Around 10x
- performance improvement was measured in micro-benchmarks.
- https://github.com/ruby/ruby/pull/2224
-
-File::
- * File.realpath now uses realpath(3) on many platforms, which can
- significantly improve performance. [Feature #15797]
-
-Hash::
- * Change data structure of small Hash objects. [Feature #15602]
-
-Monitor::
- * Monitor class is written in C-extension. [Feature #16255]
-
-Thread::
-
- * VM stack memory allocation is now combined with native thread stack,
- improving thread allocation performance and reducing allocation related
- failures. Around 10x performance improvement was measured in micro-benchmarks.
-
-JIT::
-
- * JIT-ed code is recompiled to less-optimized code when an optimization assumption is invalidated.
-
- * Method inlining is performed when a method is considered as pure.
- This optimization is still experimental and many methods are NOT considered as pure yet.
-
- * The default value of +--jit-max-cache+ is changed from 1,000 to 100.
-
- * The default value of +--jit-min-calls+ is changed from 5 to 10,000.
-
-RubyVM::
-
- * Per-call-site method cache, which has been there since around 1.9, was
- improved: cache hit rate raised from 89% to 94%.
- See https://github.com/ruby/ruby/pull/2583
-
-RubyVM::InstructionSequence::
-
- * RubyVM::InstructionSequence#to_binary method generates compiled binary.
- The binary size is reduced. [Feature #16163]
-
-=== Miscellaneous changes
-
-* Support for IA64 architecture has been removed. Hardware for testing was
- difficult to find, native fiber code is difficult to implement, and it added
- non-trivial complexity to the interpreter. [Feature #15894]
-
-* Require compilers to support C99. [Misc #15347]
-
- * Details of our dialect: https://bugs.ruby-lang.org/projects/ruby-trunk/wiki/C99
-
-* Ruby's upstream repository is changed from Subversion to Git.
-
- * https://git.ruby-lang.org/ruby.git
-
- * RUBY_REVISION class is changed from Integer to String.
-
- * RUBY_DESCRIPTION includes Git revision instead of Subversion's one.
-
-* Support built-in methods in Ruby with the <code>_\_builtin_</code> syntax. [Feature #16254]
-
- Some methods are defined in *.rb (such as trace_point.rb).
- For example, it is easy to define a method which accepts keyword arguments.
diff --git a/README b/README
new file mode 100644
index 0000000000..bde22dff78
--- /dev/null
+++ b/README
@@ -0,0 +1,106 @@
+* What's Ruby
+
+Ruby is the interpreted scripting language for quick and
+easy object-oriented programming. It has many features to
+process text files and to do system management tasks (as in
+Perl). It is simple, straight-forward, and extensible.
+
+
+* Features of Ruby
+
+ + Simple Syntax
+ + *Normal* Object-Oriented features(ex. class, method calls)
+ + *Advanced* Object-Oriented features(ex. Mix-in, Singleton-method)
+ + Operator Overloading
+ + Exception Handling
+ + Iterators and Closures
+ + Garbage Collection
+ + Dynamic Loading of Object files(on some architecture)
+ + Highly Portable(works on many UNIX machines, and on DOS,
+ Windows, Mac, BeOS etc.)
+
+
+* How to get Ruby
+
+The Ruby distribution can be found on:
+
+ ftp://ftp.ruby-lang.org/pub/ruby/
+
+You can get it by anonymous CVS. How to check out is:
+
+ $ cvs -d :pserver:anonymous@cvs.ruby-lang.org:/src login
+ (Logging in to anonymous@cvs.ruby-lang.org)
+ CVS password: anonymous
+ $ cvs -z4 -d :pserver:anonymous@cvs.ruby-lang.org:/src checkout ruby
+
+
+* Ruby home-page
+
+The URL of the Ruby home-page is:
+
+ http://www.ruby-lang.org/
+
+
+* Mailing list
+
+There is a mailing list to talk about Ruby.
+To subscribe this list, please send the following phrase
+
+ subscribe YourFirstName YourFamilyName
+e.g.
+ subscribe Joseph Smith
+
+in the mail body (not subject) to the address <ruby-talk-ctl@ruby-lang.org>.
+
+
+* How to compile and install
+
+This is what you need to do to compile and install Ruby:
+
+ 1. If ./configure does not exist or is older than configure.in,
+ run autoconf to (re)generate configure.
+
+ 2. Run ./configure, which will generate config.h and Makefile.
+
+ 3. Edit defines.h if you need. Probably this step will not need.
+
+ 4. Remove comment mark(#) before the module names from ext/Setup (or
+ add module names if not present), if you want to link modules
+ statically.
+
+ If you don't want to compile non static extension modules
+ (probably on architectures which does not allow dynamic loading),
+ remove comment mark from the line "#option nodynamic" in
+ ext/Setup.
+
+ 5. Run make.
+
+ 6. Optionally, run 'make test' to check whether the compiled Ruby
+ interpreter works well. If you see the message "test succeeded",
+ your ruby works as it should (hopefully).
+
+ 7. Run 'make install'
+
+ You may have to be a super user to install ruby.
+
+If you fail to compile ruby, please send the detailed error report with
+the error log and machine/OS type, to help others.
+
+
+* Copying
+
+See the file COPYING.
+
+
+* The Author
+
+Feel free to send comments and bug reports to the author. Here is the
+author's latest mail address:
+
+ matz@netlab.jp
+
+-------------------------------------------------------
+created at: Thu Aug 3 11:57:36 JST 1995
+Local variables:
+mode: indented-text
+end:
diff --git a/README.EXT b/README.EXT
index 48b8d964c4..c65c177a27 100644
--- a/README.EXT
+++ b/README.EXT
@@ -1 +1,1069 @@
-Moved to doc/extension.rdoc
+.\" README.EXT - -*- Text -*- created at: Mon Aug 7 16:45:54 JST 1995
+
+This document explains how to make extension libraries for Ruby.
+
+1. Basic knowledge
+
+In C, variables have types and data do not have types. In contrast,
+Ruby variables do not have a static type, and data themselves have
+types, so data will need to be converted between the languages.
+
+Data in Ruby are represented by C type `VALUE'. Each VALUE data has
+its data-type.
+
+To retrieve C data from a VALUE, you need to:
+
+ (1) Identify the VALUE's data type
+ (2) Convert the VALUE into C data
+
+Converting to the wrong data type may cause serious problems.
+
+
+1.1 Data-types
+
+The Ruby interpreter has the following data types:
+
+ T_NIL nil
+ T_OBJECT ordinary object
+ T_CLASS class
+ T_MODULE module
+ T_FLOAT floating point number
+ T_STRING string
+ T_REGEXP regular expression
+ T_ARRAY array
+ T_FIXNUM Fixnum(31bit integer)
+ T_HASH associative array
+ T_STRUCT (Ruby) structure
+ T_BIGNUM multi precision integer
+ T_FILE IO
+ T_TRUE true
+ T_FALSE false
+ T_DATA data
+ T_SYMBOL symbol
+
+In addition, there are several other types used internally:
+
+ T_ICLASS
+ T_MATCH
+ T_UNDEF
+ T_VARMAP
+ T_SCOPE
+ T_NODE
+
+Most of the types are represented by C structures.
+
+1.2 Check Data Type of the VALUE
+
+The macro TYPE() defined in ruby.h shows the data type of the VALUE.
+TYPE() returns the constant number T_XXXX described above. To handle
+data types, your code will look something like this:
+
+ switch (TYPE(obj)) {
+ case T_FIXNUM:
+ /* process Fixnum */
+ break;
+ case T_STRING:
+ /* process String */
+ break;
+ case T_ARRAY:
+ /* process Array */
+ break;
+ default:
+ /* raise exception */
+ rb_raise(rb_eTypeError, "not valid value");
+ break;
+ }
+
+There is the data-type check function
+
+ void Check_Type(VALUE value, int type)
+
+which raises an exception if the VALUE does not have the type specified.
+
+There are also faster check macros for fixnums and nil.
+
+ FIXNUM_P(obj)
+ NIL_P(obj)
+
+1.3 Convert VALUE into C data
+
+The data for type T_NIL, T_FALSE, T_TRUE are nil, true, false
+respectively. They are singletons for the data type.
+
+The T_FIXNUM data is a 31bit length fixed integer (63bit length on
+some machines), which can be convert to a C integer by using the
+FIX2INT() macro. There is also NUM2INT() which converts any Ruby
+numbers into C integers. The NUM2INT() macro includes a type check, so
+an exception will be raised if the conversion failed. NUM2DBL() can
+be used to retrieve the double float value in same way.
+
+To get char* from a VALUE, version 1.7 recommend to use new macros
+StringValue() and StringValuePtr(). StringValue(var) replaces var's
+value to the result of "var.to_str()". StringValuePtr(var) does same
+replacement and returns char* representation of var. These macros
+will skip the replacement if var is a String. Notice that the macros
+requires to take only lvalue as their argument, to change the value
+of var in the replacement.
+
+In version 1.6 or earlier, STR2CSTR() was used to do same thing
+but now it is obsoleted in version 1.7 because of STR2CSTR() has
+a risk of dangling pointer problem in to_str() impliclit conversion.
+
+Other data types have corresponding C structures, e.g. struct RArray
+for T_ARRAY etc. The VALUE of the type which has corresponding structure
+can be cast to retrieve the pointer to the struct. The casting macro
+will be of the form RXXXX for each data type; for instance, RARRAY(obj).
+See "ruby.h".
+
+For example, `RSTRING(str)->len' is the way to get the size of the
+Ruby String object. The allocated region can be accessed by
+`RSTRING(str)->ptr'. For arrays, use `RARRAY(ary)->len' and
+`RARRAY(ary)->ptr' respectively.
+
+Notice: Do not change the value of the structure directly, unless you
+are responsible for the result. This ends up being the cause of interesting
+bugs.
+
+1.4 Convert C data into VALUE
+
+To convert C data to Ruby values:
+
+ * FIXNUM
+
+ left shift 1 bit, and turn on LSB.
+
+ * Other pointer values
+
+ cast to VALUE.
+
+You can determine whether a VALUE is pointer or not by checking its LSB.
+
+Notice Ruby does not allow arbitrary pointer values to be a VALUE. They
+should be pointers to the structures which Ruby knows about. The known
+structures are defined in <ruby.h>.
+
+To convert C numbers to Ruby values, use these macros.
+
+ INT2FIX() for integers within 31bits.
+ INT2NUM() for arbitrary sized integer.
+
+INT2NUM() converts an integer into a Bignum if it is out of the FIXNUM
+range, but is a bit slower.
+
+1.5 Manipulating Ruby data
+
+As I already mentioned, it is not recommended to modify an object's internal
+structure. To manipulate objects, use the functions supplied by the Ruby
+interpreter. Some (not all) of the useful functions are listed below:
+
+ String functions
+
+ rb_str_new(const char *ptr, long len)
+
+ Creates a new Ruby string.
+
+ rb_str_new2(const char *ptr)
+
+ Creates a new Ruby string from a C string. This is equivalent to
+ rb_str_new(ptr, strlen(ptr)).
+
+ rb_tainted_str_new(const char *ptr, long len)
+
+ Creates a new tainted Ruby string. Strings from external data
+ sources should be tainted.
+
+ rb_tainted_str_new2(const char *ptr)
+
+ Creates a new tainted Ruby string from a C string.
+
+ rb_str_cat(VALUE str, const char *ptr, long len)
+
+ Appends len bytes of data from ptr to the Ruby string.
+
+ Array functions
+
+ rb_ary_new()
+
+ Creates an array with no elements.
+
+ rb_ary_new2(long len)
+
+ Creates an array with no elements, allocating internal buffer
+ for len elements.
+
+ rb_ary_new3(long n, ...)
+
+ Creates an n-element array from the arguments.
+
+ rb_ary_new4(long n, VALUE *elts)
+
+ Creates an n-element array from a C array.
+
+ rb_ary_push(VALUE ary, VALUE val)
+ rb_ary_pop(VALUE ary)
+ rb_ary_shift(VALUE ary)
+ rb_ary_unshift(VALUE ary, VALUE val)
+
+ Array operations. The first argument to each functions must be an
+ array. They may dump core if other types given.
+
+2. Extending Ruby with C
+
+2.1 Addding new features to Ruby
+
+You can add new features (classes, methods, etc.) to the Ruby
+interpreter. Ruby provides APIs for defining the following things:
+
+ * Classes, Modules
+ * Methods, Singleton Methods
+ * Constants
+
+2.1.1 Class/module definition
+
+To define a class or module, use the functions below:
+
+ VALUE rb_define_class(const char *name, VALUE super)
+ VALUE rb_define_module(const char *name)
+
+These functions return the newly created class or module. You may
+want to save this reference into a variable to use later.
+
+To define nested classes or modules, use the functions below:
+
+ VALUE rb_define_class_under(VALUE outer, const char *name, VALUE super)
+ VALUE rb_define_module_under(VALUE outer, const char *name)
+
+2.1.2 Method/singleton method definition
+
+To define methods or singleton methods, use these functions:
+
+ void rb_define_method(VALUE klass, const char *name,
+ VALUE (*func)(), int argc)
+
+ void rb_define_singleton_method(VALUE object, const char *name,
+ VALUE (*func)(), int argc)
+
+The `argc' represents the number of the arguments to the C function,
+which must be less than 17. But I believe you don't need that much. :-)
+
+If `argc' is negative, it specifies the calling sequence, not number of
+the arguments.
+
+If argc is -1, the function will be called as:
+
+ VALUE func(int argc, VALUE *argv, VALUE obj)
+
+where argc is the actual number of arguments, argv is the C array of
+the arguments, and obj is the receiver.
+
+If argc is -2, the arguments are passed in a Ruby array. The function
+will be called like:
+
+ VALUE func(VALUE obj, VALUE args)
+
+where obj is the receiver, and args is the Ruby array containing
+actual arguments.
+
+There are two more functions to define methods. One is to define
+private methods:
+
+ void rb_define_private_method(VALUE klass, const char *name,
+ VALUE (*func)(), int argc)
+
+The other is to define module functions, which are private AND singleton
+methods of the module. For example, sqrt is the module function
+defined in Math module. It can be call in the form like:
+
+ Math.sqrt(4)
+
+or
+
+ include Math
+ sqrt(4)
+
+To define module functions, use:
+
+ void rb_define_module_function(VALUE module, const char *name,
+ VALUE (*func)(), int argc)
+
+Oh, in addition, function-like methods, which are private methods defined
+in the Kernel module, can be defined using:
+
+ void rb_define_global_function(const char *name, VALUE (*func)(), int argc)
+
+To define alias to the method,
+
+ void rb_define_alias(VALUE module, const char* new, const char* old);
+
+2.1.3 Constant definition
+
+We have 2 functions to define constants:
+
+ void rb_define_const(VALUE klass, const char *name, VALUE val)
+ void rb_define_global_const(const char *name, VALUE val)
+
+The former is to define a constant under specified class/module. The
+latter is to define a global constant.
+
+2.2 Use Ruby features from C
+
+There are several ways to invoke Ruby's features from C code.
+
+2.2.1 Evaluate Ruby Programs in a String
+
+The easiest way to use Ruby's functionality from a C program is to
+evaluate the string as Ruby program. This function will do the job.
+
+ VALUE rb_eval_string(const char *str)
+
+Evaluation is done under the current context, thus current local variables
+of the innermost method (which is defined by Ruby) can be accessed.
+
+2.2.2 ID or Symbol
+
+You can invoke methods directly, without parsing the string. First I
+need to explain about symbols (whose data type is ID). ID is the
+integer number to represent Ruby's identifiers such as variable names.
+It can be accessed from Ruby in the form:
+
+ :Identifier
+
+You can get the symbol value from a string within C code by using
+
+ rb_intern(const char *name)
+
+2.2.3 Invoke Ruby method from C
+
+To invoke methods directly, you can use the function below
+
+ VALUE rb_funcall(VALUE recv, ID mid, int argc, ...)
+
+This function invokes a method on the recv, with the method name
+specified by the symbol mid.
+
+2.2.4 Accessing the variables and constants
+
+You can access class variables and instance variables using access
+functions. Also, global variables can be shared between both environments.
+There's no way to access Ruby's local variables.
+
+The functions to access/modify instance variables are below:
+
+ VALUE rb_ivar_get(VALUE obj, ID id)
+ VALUE rb_ivar_set(VALUE obj, ID id, VALUE val)
+
+id must be the symbol, which can be retrieved by rb_intern().
+
+To access the constants of the class/module:
+
+ VALUE rb_const_get(VALUE obj, ID id)
+
+See 2.1.3 for defining new constant.
+
+3. Information sharing between Ruby and C
+
+3.1 Ruby constants that C can be accessed from C
+
+The following Ruby constants can be referred from C.
+
+ Qtrue
+ Qfalse
+
+Boolean values. Qfalse is false in C also (i.e. 0).
+
+ Qnil
+
+Ruby nil in C scope.
+
+3.2 Global variables shared between C and Ruby
+
+Information can be shared between the two environments using shared global
+variables. To define them, you can use functions listed below:
+
+ void rb_define_variable(const char *name, VALUE *var)
+
+This function defines the variable which is shared by both environments.
+The value of the global variable pointed to by `var' can be accessed
+through Ruby's global variable named `name'.
+
+You can define read-only (from Ruby, of course) variables using the
+function below.
+
+ void rb_define_readonly_variable(const char *name, VALUE *var)
+
+You can defined hooked variables. The accessor functions (getter and
+setter) are called on access to the hooked variables.
+
+ void rb_define_hooked_variable(constchar *name, VALUE *var,
+ VALUE (*getter)(), void (*setter)())
+
+If you need to supply either setter or getter, just supply 0 for the
+hook you don't need. If both hooks are 0, rb_define_hooked_variable()
+works just like rb_define_variable().
+
+ void rb_define_virtual_variable(const char *name,
+ VALUE (*getter)(), void (*setter)())
+
+This function defines a Ruby global variable without a corresponding C
+variable. The value of the variable will be set/get only by hooks.
+
+The prototypes of the getter and setter functions are as follows:
+
+ (*getter)(ID id, void *data, struct global_entry* entry);
+ (*setter)(VALUE val, ID id, void *data, struct global_entry* entry);
+
+3.3 Encapsulate C data into Ruby object
+
+To wrap and objectify a C pointer as a Ruby object (so called
+DATA), use Data_Wrap_Struct().
+
+ Data_Wrap_Struct(klass, mark, free, ptr)
+
+Data_Wrap_Struct() returns a created DATA object. The klass argument
+is the class for the DATA object. The mark argument is the function
+to mark Ruby objects pointed by this data. The free argument is the
+function to free the pointer allocation. If this is -1, the pointer
+will be just freed. The functions mark and free will be called from
+garbage collector.
+
+You can allocate and wrap the structure in one step.
+
+ Data_Make_Struct(klass, type, mark, free, sval)
+
+This macro returns an allocated Data object, wrapping the pointer to
+the structure, which is also allocated. This macro works like:
+
+ (sval = ALLOC(type), Data_Wrap_Struct(klass, mark, free, sval))
+
+Arguments klass, mark, and free work like their counterparts in
+Data_Wrap_Struct(). A pointer to the allocated structure will be
+assigned to sval, which should be a pointer of the type specified.
+
+To retrieve the C pointer from the Data object, use the macro
+Data_Get_Struct().
+
+ Data_Get_Struct(obj, type, sval)
+
+A pointer to the structure will be assigned to the variable sval.
+
+See the example below for details.
+
+4. Example - Creating dbm extension
+
+OK, here's the example of making an extension library. This is the
+extension to access DBMs. The full source is included in the ext/
+directory in the Ruby's source tree.
+
+(1) make the directory
+
+ % mkdir ext/dbm
+
+Make a directory for the extension library under ext directory.
+
+(2) create MANIFEST file
+
+ % cd ext/dbm
+ % touch MANIFEST
+
+There should be MANIFEST file in the directory for the extension
+library. Make an empty file for now.
+
+(3) design the library
+
+You need to design the library features, before making it.
+
+(4) write C code.
+
+You need to write C code for your extension library. If your library
+has only one source file, choosing ``LIBRARY.c'' as a file name is
+preferred. On the other hand, in case your library has multiple source
+files, avoid choosing ``LIBRARY.c'' for a file name. It may conflict
+with an intermediate file ``LIBRARY.o'' on some platforms.
+
+Ruby will execute the initializing function named ``Init_LIBRARY'' in
+the library. For example, ``Init_dbm()'' will be executed when loading
+the library.
+
+Here's the example of an initializing function.
+
+--
+Init_dbm()
+{
+ /* define DBM class */
+ cDBM = rb_define_class("DBM", rb_cObject);
+ /* DBM includes Enumerate module */
+ rb_include_module(cDBM, rb_mEnumerable);
+
+ /* DBM has class method open(): arguments are received as C array */
+ rb_define_singleton_method(cDBM, "open", fdbm_s_open, -1);
+
+ /* DBM instance method close(): no args */
+ rb_define_method(cDBM, "close", fdbm_close, 0);
+ /* DBM instance method []: 1 argument */
+ rb_define_method(cDBM, "[]", fdbm_fetch, 1);
+ :
+
+ /* ID for a instance variable to store DBM data */
+ id_dbm = rb_intern("dbm");
+}
+--
+
+The dbm extension wraps the dbm struct in the C environment using
+Data_Make_Struct.
+
+--
+struct dbmdata {
+ int di_size;
+ DBM *di_dbm;
+};
+
+
+obj = Data_Make_Struct(klass, struct dbmdata, 0, free_dbm, dbmp);
+--
+
+This code wraps the dbmdata structure into a Ruby object. We avoid wrapping
+DBM* directly, because we want to cache size information.
+
+To retrieve the dbmdata structure from a Ruby object, we define the
+following macro:
+
+--
+#define GetDBM(obj, dbmp) {\
+ Data_Get_Struct(obj, struct dbmdata, dbmp);\
+ if (dbmp->di_dbm == 0) closed_dbm();\
+}
+--
+
+This sort of complicated macro does the retrieving and close checking for
+the DBM.
+
+There are three kinds of way to receive method arguments. First,
+methods with a fixed number of arguments receive arguments like this:
+
+--
+static VALUE
+fdbm_delete(obj, keystr)
+ VALUE obj, keystr;
+{
+ :
+}
+--
+
+The first argument of the C function is the self, the rest are the
+arguments to the method.
+
+Second, methods with an arbitrary number of arguments receive
+arguments like this:
+
+--
+static VALUE
+fdbm_s_open(argc, argv, klass)
+ int argc;
+ VALUE *argv;
+ VALUE klass;
+{
+ :
+ if (rb_scan_args(argc, argv, "11", &file, &vmode) == 1) {
+ mode = 0666; /* default value */
+ }
+ :
+}
+--
+
+The first argument is the number of method arguments, the second
+argument is the C array of the method arguments, and the third
+argument is the receiver of the method.
+
+You can use the function rb_scan_args() to check and retrieve the
+arguments. For example, "11" means that the method requires at least one
+argument, and at most receives two arguments.
+
+Methods with an arbitrary number of arguments can receive arguments
+by Ruby's array, like this:
+
+--
+static VALUE
+fdbm_indexes(obj, args)
+ VALUE obj, args;
+{
+ :
+}
+--
+
+The first argument is the receiver, the second one is the Ruby array
+which contains the arguments to the method.
+
+** Notice
+
+GC should know about global variables which refer to Ruby's objects, but
+are not exported to the Ruby world. You need to protect them by
+
+ void rb_global_variable(VALUE *var)
+
+(5) prepare extconf.rb
+
+If the file named extconf.rb exists, it will be executed to generate
+Makefile. If not, the compilation scheme will try to generate Makefile
+anyway.
+
+extconf.rb is the file for check compilation conditions etc. You
+need to put
+
+ require 'mkmf'
+
+at the top of the file. You can use the functions below to check
+various conditions.
+
+ have_library(lib, func): check whether library containing function exists.
+ have_func(func, header): check whether function exists
+ have_header(header): check whether header file exists
+ create_makefile(target): generate Makefile
+
+The value of the variables below will affect the Makefile.
+
+ $CFLAGS: included in CFLAGS make variable (such as -I)
+ $LDFLAGS: included in LDFLAGS make variable (such as -L)
+
+If a compilation condition is not fulfilled, you should not call
+``create_makefile''. The Makefile will not generated, compilation will
+not be done.
+
+(6) prepare depend (optional)
+
+If the file named depend exists, Makefile will include that file to
+check dependencies. You can make this file by invoking
+
+ % gcc -MM *.c > depend
+
+It's no harm. Prepare it.
+
+(7) put file names into MANIFEST (optional)
+
+ % find * -type f -print > MANIFEST
+ % vi MANIFEST
+
+Append file names into MANIFEST. The compilation scheme requires
+MANIFEST only to exist, but it's better to take this step in order
+to distinguish which files are required.
+
+(8) generate Makefile
+
+Try generating the Makefile by:
+
+ ruby extconf.rb
+
+You don't need this step if you put the extension library under the ext
+directory of the ruby source tree. In that case, compilation of the
+interpreter will do this step for you.
+
+(9) make
+
+Type
+
+ make
+
+to compile your extension. You don't need this step either if you have
+put extension library under the ext directory of the ruby source tree.
+
+(9) debug
+
+You may need to rb_debug the extension. Extensions can be linked
+statically by the adding directory name in the ext/Setup file so that
+you can inspect the extension with the debugger.
+
+(10) done, now you have the extension library
+
+You can do anything you want with your library. The author of Ruby
+will not claim any restrictions on your code depending on the Ruby API.
+Feel free to use, modify, distribute or sell your program.
+
+Appendix A. Ruby source files overview
+
+ruby language core
+
+ class.c
+ error.c
+ eval.c
+ gc.c
+ object.c
+ parse.y
+ variable.c
+
+utility functions
+
+ dln.c
+ regex.c
+ st.c
+ util.c
+
+ruby interpreter implementation
+
+ dmyext.c
+ inits.c
+ main.c
+ ruby.c
+ version.c
+
+class library
+
+ array.c
+ bignum.c
+ compar.c
+ dir.c
+ enum.c
+ file.c
+ hash.c
+ io.c
+ marshal.c
+ math.c
+ numeric.c
+ pack.c
+ prec.c
+ process.c
+ random.c
+ range.c
+ re.c
+ signal.c
+ sprintf.c
+ string.c
+ struct.c
+ time.c
+
+Appendix B. Ruby extension API reference
+
+** Types
+
+ VALUE
+
+The type for the Ruby object. Actual structures are defined in ruby.h,
+such as struct RString, etc. To refer the values in structures, use
+casting macros like RSTRING(obj).
+
+** Variables and constants
+
+ Qnil
+
+const: nil object
+
+ Qtrue
+
+const: true object(default true value)
+
+ Qfalse
+
+const: false object
+
+** C pointer wrapping
+
+ Data_Wrap_Struct(VALUE klass, void (*mark)(), void (*free)(), void *sval)
+
+Wrap a C pointer into a Ruby object. If object has references to other
+Ruby objects, they should be marked by using the mark function during
+the GC process. Otherwise, mark should be 0. When this object is no
+longer referred by anywhere, the pointer will be discarded by free
+function.
+
+ Data_Make_Struct(klass, type, mark, free, sval)
+
+This macro allocates memory using malloc(), assigns it to the variable
+sval, and returns the DATA encapsulating the pointer to memory region.
+
+ Data_Get_Struct(data, type, sval)
+
+This macro retrieves the pointer value from DATA, and assigns it to
+the variable sval.
+
+** Checking data types
+
+TYPE(value)
+FIXNUM_P(value)
+NIL_P(value)
+void Check_Type(VALUE value, int type)
+void Check_SafeStr(VALUE value)
+
+** Data type conversion
+
+FIX2INT(value)
+INT2FIX(i)
+NUM2INT(value)
+INT2NUM(i)
+NUM2DBL(value)
+rb_float_new(f)
+STR2CSTR(value)
+rb_str_new2(s)
+
+** defining class/module
+
+ VALUE rb_define_class(const char *name, VALUE super)
+
+Defines a new Ruby class as a subclass of super.
+
+ VALUE rb_define_class_under(VALUE module, const char *name, VALUE super)
+
+Creates a new Ruby class as a subclass of super, under the module's
+namespace.
+
+ VALUE rb_define_module(const char *name)
+
+Defines a new Ruby module.
+
+ VALUE rb_define_module_under(VALUE module, const char *name)
+
+Defines a new Ruby module under the module's namespace.
+
+ void rb_include_module(VALUE klass, VALUE module)
+
+Includes module into class. If class already includes it, just
+ignored.
+
+ void rb_extend_object(VALUE object, VALUE module)
+
+Extend the object with the module's attributes.
+
+** Defining Global Variables
+
+ void rb_define_variable(const char *name, VALUE *var)
+
+Defines a global variable which is shared between C and Ruby. If name
+contains a character which is not allowed to be part of the symbol,
+it can't be seen from Ruby programs.
+
+ void rb_define_readonly_variable(const char *name, VALUE *var)
+
+Defines a read-only global variable. Works just like
+rb_define_variable(), except defined variable is read-only.
+
+ void rb_define_virtual_variable(const char *name,
+ VALUE (*getter)(), VALUE (*setter)())
+
+Defines a virtual variable, whose behavior is defined by a pair of C
+functions. The getter function is called when the variable is
+referred. The setter function is called when the value is set to the
+variable. The prototype for getter/setter functions are:
+
+ VALUE getter(ID id)
+ void setter(VALUE val, ID id)
+
+The getter function must return the value for the access.
+
+ void rb_define_hooked_variable(const char *name, VALUE *var,
+ VALUE (*getter)(), VALUE (*setter)())
+
+Defines hooked variable. It's a virtual variable with a C variable.
+The getter is called as
+
+ VALUE getter(ID id, VALUE *var)
+
+returning a new value. The setter is called as
+
+ void setter(VALUE val, ID id, VALUE *var)
+
+GC requires C global variables which hold Ruby values to be marked.
+
+ void rb_global_variable(VALUE *var)
+
+Tells GC to protect these variables.
+
+** Constant Definition
+
+ void rb_define_const(VALUE klass, const char *name, VALUE val)
+
+Defines a new constant under the class/module.
+
+ void rb_define_global_const(const char *name, VALUE val)
+
+Defines a global constant. This is just the same as
+
+ rb_define_const(cKernal, name, val)
+
+** Method Definition
+
+ rb_define_method(VALUE klass, const char *name, VALUE (*func)(), int argc)
+
+Defines a method for the class. func is the function pointer. argc
+is the number of arguments. if argc is -1, the function will receive
+3 arguments: argc, argv, and self. if argc is -2, the function will
+receive 2 arguments, self and args, where args is a Ruby array of
+the method arguments.
+
+ rb_define_private_method(VALUE klass, const char *name, VALUE (*func)(), int argc)
+
+Defines a private method for the class. Arguments are same as
+rb_define_method().
+
+ rb_define_singleton_method(VALUE klass, const char *name, VALUE (*func)(), int argc)
+
+Defines a singleton method. Arguments are same as rb_define_method().
+
+ rb_scan_args(int argc, VALUE *argv, const char *fmt, ...)
+
+Retrieve argument from argc, argv. The fmt is the format string for
+the arguments, such as "12" for 1 non-optional argument, 2 optional
+arguments. If `*' appears at the end of fmt, it means the rest of
+the arguments are assigned to the corresponding variable, packed in
+an array.
+
+** Invoking Ruby method
+
+ VALUE rb_funcall(VALUE recv, ID mid, int narg, ...)
+
+Invokes a method. To retrieve mid from a method name, use rb_intern().
+
+ VALUE rb_funcall2(VALUE recv, ID mid, int argc, VALUE *argv)
+
+Invokes a method, passing arguments by an array of values.
+
+ VALUE rb_eval_string(const char *str)
+
+Compiles and executes the string as a Ruby program.
+
+ ID rb_intern(const char *name)
+
+Returns ID corresponding to the name.
+
+ char *rb_id2name(ID id)
+
+Returns the name corresponding ID.
+
+ char *rb_class2name(VALUE klass)
+
+Returns the name of the class.
+
+ int rb_respond_to(VALUE object, ID id)
+
+Returns true if the object responds to the message specified by id.
+
+** Instance Variables
+
+ VALUE rb_iv_get(VALUE obj, const char *name)
+
+Retrieve the value of the instance variable. If the name is not
+prefixed by `@', that variable shall be inaccessible from Ruby.
+
+ VALUE rb_iv_set(VALUE obj, const char *name, VALUE val)
+
+Sets the value of the instance variable.
+
+** Control Structure
+
+ VALUE rb_iterate(VALUE (*func1)(), void *arg1, VALUE (*func2)(), void *arg2)
+
+Calls the function func1, supplying func2 as the block. func1 will be
+called with the argument arg1. func2 receives the value from yield as
+the first argument, arg2 as the second argument.
+
+ VALUE rb_yield(VALUE val)
+
+Evaluates the block with value val.
+
+ VALUE rb_rescue(VALUE (*func1)(), void *arg1, VALUE (*func2)(), void *arg2)
+
+Calls the function func1, with arg1 as the argument. If an exception
+occurs during func1, it calls func2 with arg2 as the argument. The
+return value of rb_rescue() is the return value from func1 if no
+exception occurs, from func2 otherwise.
+
+ VALUE rb_ensure(VALUE (*func1)(), void *arg1, void (*func2)(), void *arg2)
+
+Calls the function func1 with arg1 as the argument, then calls func2
+with arg2 if execution terminated. The return value from
+rb_ensure() is that of func1.
+
+** Exceptions and Errors
+
+ void rb_warn(const char *fmt, ...)
+
+Prints a warning message according to a printf-like format.
+
+ void rb_warning(const char *fmt, ...)
+
+Prints a warning message according to a printf-like format, if
+$VERBOSE is true.
+
+void rb_raise(rb_eRuntimeError, const char *fmt, ...)
+
+Raises RuntimeError. The fmt is a format string just like printf().
+
+ void rb_raise(VALUE exception, const char *fmt, ...)
+
+Raises a class exception. The fmt is a format string just like printf().
+
+ void rb_fatal(const char *fmt, ...)
+
+Raises a fatal error, terminates the interpreter. No exception handling
+will be done for fatal errors, but ensure blocks will be executed.
+
+ void rb_bug(const char *fmt, ...)
+
+Terminates the interpreter immediately. This function should be
+called under the situation caused by the bug in the interpreter. No
+exception handling nor ensure execution will be done.
+
+** Initialize and Starts the Interpreter
+
+The embedding API functions are below (not needed for extension libraries):
+
+ void ruby_init()
+
+Initializes the interpreter.
+
+ void ruby_options(int argc, char **argv)
+
+Process command line arguments for the interpreter.
+
+ void ruby_run()
+
+Starts execution of the interpreter.
+
+ void ruby_script(char *name)
+
+Specifies the name of the script ($0).
+
+Appendix C. Functions Available in extconf.rb
+
+These functions are available in extconf.rb:
+
+ have_library(lib, func)
+
+Checks whether the library exists, containing the specified function.
+Returns true if the library exists.
+
+ find_library(lib, func, path...)
+
+Checks whether a library which contains the specified function exists in
+path. Returns true if the library exists.
+
+ have_func(func, header)
+
+Checks whether func exists with header. Returns true if the function
+exists. To check functions in an additional library, you need to
+check that library first using have_library().
+
+ have_header(header)
+
+Checks whether header exists. Returns true if the header file exists.
+
+ create_makefile(target)
+
+Generates the Makefile for the extension library. If you don't invoke
+this method, the compilation will not be done.
+
+ with_config(withval[, default=nil])
+
+Parses the command line options and returns the value specified by
+--with-<withval>.
+
+ dir_config(target[, default_dir])
+ dir_config(target[, default_include, default_lib])
+
+Parses the command line options and adds the directories specified by
+--with-<target>-dir, --with-<target>-include, and/or --with-<target>-lib
+to $CFLAGS and/or $LDFLAGS. --with-<target>-dir=/path is equivalent to
+--with-<target>-include=/path/include --with-<target>-lib=/path/lib.
+Returns an array of the added directories ([include_dir, lib_dir]).
+
+/*
+ * Local variables:
+ * fill-column: 70
+ * end:
+ */
diff --git a/README.EXT.ja b/README.EXT.ja
index f884ecbb0e..c4d79f1c1e 100644
--- a/README.EXT.ja
+++ b/README.EXT.ja
@@ -1 +1,1197 @@
-doc/extension.ja.rdocに移動しました
+.\" README.EXT.ja - -*- Text -*- created at: Mon Aug 7 16:45:54 JST 1995
+
+Rubyγĥ饤֥κޤ
+
+1μ
+
+CѿˤϷꡤǡˤϷޤ󡥤Ǥ顤
+ȤХݥ󥿤intѿȡͤȤƼ
+갷ޤդRubyѿˤϷʤǡ˷
+ΰ㤤ΤᡤCRubyߤѴʤСߤ
+ǡ򥢥Ǥޤ
+
+RubyΥǡVALUEȤCηɽޤVALUEΥǡ
+ϤΥǡפʬΤäƤޤΥǡפ
+Τϥǡ(֥)μºݤι¤̣ƤơRuby
+Υ饹ȤϤޤäΤǤ
+
+VALUECˤȤäựΤǡФˤ
+
+ (1) VALUEΥǡפΤ
+ (2) VALUECΥǡѴ
+
+ξɬפǤ(1)˺ȴְäǡѴԤ
+ơǰץबcore dumpޤ
+
+1.1 ǡ
+
+Rubyˤϥ桼ȤǽΤʲΥפޤ
+
+ T_NIL nil
+ T_OBJECT ̾Υ֥
+ T_CLASS 饹
+ T_MODULE ⥸塼
+ T_FLOAT ư
+ T_STRING ʸ
+ T_REGEXP ɽ
+ T_ARRAY
+ T_FIXNUM Fixnum(31bitĹ)
+ T_HASH Ϣ
+ T_STRUCT (Ruby)¤
+ T_BIGNUM ¿Ĺ
+ T_FILE
+ T_TRUE
+ T_FALSE
+ T_DATA ǡ
+ T_SYMBOL ܥ
+
+¾ѤƤʲΥפޤ
+
+ T_ICLASS
+ T_MATCH
+ T_UNDEF
+ T_VARMAP
+ T_SCOPE
+ T_NODE
+
+ۤȤɤΥפCι¤ΤǼƤޤ
+
+1.2 VALUEΥǡפå
+
+ruby.hǤTYPE()ȤޥƤơVALUEΥǡ
+פΤ뤳ȤޤTYPE()ޥϾǾҲ𤷤T_XXXX
+η֤ޤVALUEΥǡפ˱ƽ
+ˤϡTYPE()ͤʬ뤳Ȥˤʤޤ
+
+ switch (TYPE(obj)) {
+ case T_FIXNUM:
+ /* FIXNUMν */
+ break;
+ case T_STRING:
+ /* ʸν */
+ break;
+ case T_ARRAY:
+ /* ν */
+ break;
+ default:
+ /* 㳰ȯ */
+ rb_raise(rb_eTypeError, "not valid value");
+ break;
+ }
+
+ȥǡפåơʤ㳰ȯ
+ؿѰդƤޤ
+
+ void Check_Type(VALUE value, int type)
+
+δؿvaluetype̵С㳰ȯޤ
+Ϳ줿VALUEΥǡפɤå
+뤿ˤϡδؿȤޤ
+
+FIXNUMNIL˴ؤƤϤ®Ƚ̥ޥѰդƤޤ
+
+ FIXNUM_P(obj)
+ NIL_P(obj)
+
+1.3 VALUECΥǡѴ
+
+ǡפT_NIL, T_FALSE, T_TRUEǤǡϤ줾
+nil, false, trueǤΥǡפΥ֥ȤϤҤ
+ĤĤ¸ߤޤ
+
+ǡפT_FIXNUMλ31bitΥ
+FIXNUMCѴ뤿ˤϥޥFIX2INT()פ
+ޤ줫顤FIXNUM˸¤餺RubyΥǡѴ
+NUM2INT()פȤޥޤΥޥϥǡ
+פΥå̵ǻȤޤ(ѴǤʤˤ㳰
+ȯ)Ʊͤ˥å̵ǻȤѴޥdouble
+ФNUM2DBL()פޤ
+
+char* Ф硢version 1.6 ǤϡSTR2CSTR()פ
+ޥȤäƤޤ to_str() ˤۤ
+Ѵ̤ GC ǽ뤿ᡢversion 1.7 ʹߤǤ
+obsolete Ȥʤꡢ StringValue() StringValuePtr()
+Ȥ侩ƤޤStringValue(var) var String
+ Ǥв⤻Ǥʤ var var.to_str() η̤
+֤ޥStringValuePtr(var) Ʊͤ var ֤
+Ƥ var ʸɽФ char* ֤ޥǤvar
+Ƥľ֤Τǡvar lvalue Ǥɬפ
+
+ʳΥǡפбCι¤Τޤб
+빽¤ΤΤVALUEϤΤޤޥ㥹(Ѵ)й¤Τ
+ݥ󥿤ѴǤޤ
+
+¤Τϡstruct RXxxxxפȤ̾ruby.hƤ
+㤨ʸϡstruct RStringפǤºݤ˻Ȥǽ
+Τʸ󤯤餤Ȼפޤ
+
+ruby.hǤϹ¤Τإ㥹ȤޥRXXXXX()(ʸ
+ˤ)Ȥ̾󶡤Ƥޤ(: RSTRING())
+
+㤨СʸstrĹ뤿ˤϡRSTRING(str)->lenפ
+ʸstrchar*Ȥ뤿ˤϡRSTRING(str)->ptr
+Ȥޤξˤϡ줾RARRAY(ary)->lenס
+RARRAY(ary)->ptrפȤʤޤ
+
+Rubyι¤Τľܥ˵ĤʤФʤʤ
+Ȥϡʸι¤ΤȤϻȤǡľѹ
+ʤȤǤľѹ硤֥ȤƤ
+Ȥʤʤäơפ̥Хθˤʤޤ
+
+1.4 CΥǡVALUEѴ
+
+VALUEμºݤι¤
+
+ * FIXNUMξ
+
+ 1bitեȤơLSBΩƤ롥
+
+ * ¾Υݥ󥿤ξ
+
+ ΤޤVALUE˥㥹Ȥ롥
+
+ȤʤäƤޤäơLSBåVALUEFIXNUM
+狼櫓Ǥ(ݥ󥿤LSBΩäƤʤȤꤷ
+)
+
+Ǥ顤FIXNUMʳRubyΥ֥Ȥι¤ΤñVALUE
+˥㥹ȤVALUEѴޤǤդι¤
+ΤVALUE˥㥹Ƚ櫓ǤϤޤ󡥥㥹Ȥ
+RubyΤäƤ빽¤(ruby.hƤstruct RXxxx
+Τ)Ǥ
+
+FIXNUM˴ؤƤѴޥͳɬפޤC
+VALUEѴޥϰʲΤΤޤɬפ˱
+ƻȤʬƤ
+
+ INT2FIX() Ȥ31bit˼ޤ뼫
+ INT2NUM() ǤդVALUE
+
+INT2NUM()FIXNUMϰϤ˼ޤʤ硤BignumѴ
+Ƥޤ(٤)
+
+1.5 RubyΥǡ
+
+Ҥ٤̤ꡤRubyι¤Τ򥢥Ƥι
+ԤȤϴޤ󡥤ǡRubyΥǡˤ
+RubyѰդƤؿѤƤ
+
+ǤϤäȤȤǤʸ/
+ؿ򤢤ޤ(ǤϤʤǤ)
+
+ ʸФؿ
+
+ rb_str_new(const char *ptr, long len)
+
+ Rubyʸ롥
+
+ rb_str_new2(const char *ptr)
+
+ Cʸ󤫤Rubyʸ롥δؿεǽ
+ rb_str_new(ptr, strlen(ptr))ƱǤ롥
+
+ rb_tainted_str_new(const char *ptr, long len)
+
+ ޡղä줿Rubyʸ롥
+ Υǡ˴Ťʸˤϱޡղä٤
+ Ǥ롥
+
+ rb_tainted_str_new2(const char *ptr)
+
+ Cʸ󤫤ޡղä줿Rubyʸ롥
+
+ rb_str_cat(VALUE str, const char *ptr, long len)
+
+ RubyʸstrlenХȤʸptrɲä롥
+
+ Фؿ
+
+ rb_ary_new()
+
+ Ǥ0롥
+
+ rb_ary_new2(long len)
+
+ Ǥ0롥lenʬΰ򤢤餫
+ ƤƤ
+
+ rb_ary_new3(long n, ...)
+
+ ǻꤷnǤޤ롥
+
+ rb_ary_new4(long n, VALUE *elts)
+
+ ͿnǤ롥
+
+ rb_ary_push(VALUE ary, VALUE val)
+ rb_ary_pop(VALUE ary)
+ rb_ary_shift(VALUE ary)
+ rb_ary_unshift(VALUE ary, VALUE val)
+
+ ArrayƱ̾Υ᥽åɤƱƯ򤹤ؿ1ɬ
+ ǤʤФʤʤ
+
+2RubyεǽȤ
+
+ŪRubyǽ񤱤뤳ȤCǤ񤱤ޤRubyΤΤCǵ
+ҤƤǤ顤ȤʤǤɡ
+Rubyγĥ˻ȤȤ¿ͽ¬뵡ǽ濴˾
+𤷤ޤ
+
+2.1 Ruby˵ǽɲä
+
+Ruby󶡤ƤؿȤRuby󥿥ץ꥿˿ǽ
+ɲä뤳ȤǤޤRubyǤϰʲεǽɲäؿ
+󶡤Ƥޤ
+
+ * 饹⥸塼
+ * ᥽åɡðۥ᥽åɤʤ
+ *
+
+ǤϽ˾Ҳ𤷤ޤ
+
+2.1.1 饹/⥸塼
+
+饹⥸塼뤿ˤϡʲδؿȤޤ
+
+ VALUE rb_define_class(const char *name, VALUE super)
+ VALUE rb_define_module(const char *name)
+
+δؿϿ줿饹⥸塼֤ޤ
+᥽åɤˤͤɬפʤΤǡۤȤɤξ
+ͤѿ˳ǼƤɬפǤ礦
+
+饹⥸塼¾Υ饹˥ͥȤ
+ϰʲδؿȤޤ
+
+ VALUE rb_define_class_under(VALUE outer, const char *name, VALUE super)
+ VALUE rb_define_module_under(VALUE outer, const char *name)
+
+2.1.2 ᥽å/ðۥ᥽å
+
+᥽åɤðۥ᥽åɤˤϰʲδؿȤޤ
+
+ void rb_define_method(VALUE klass, const char *name,
+ VALUE (*func)(), int argc)
+
+ void rb_define_singleton_method(VALUE object, const char *name,
+ VALUE (*func)(), int argc)
+
+
+ǰΤȡðۥ᥽åɡפȤϡΥ֥
+ȤФƤͭʥ᥽åɤǤRubyǤϤ褯Smalltalkˤ
+륯饹᥽åɤȤơ饹Фðۥ᥽åɤȤ
+
+δؿ argcȤCδؿϤο(
+)ޤargc0ʾλϴؿ˰Ϥο
+̣ޤ16İʾΰϻȤޤ(פޤ͡
+ʤ)ºݤδؿˤƬΰȤselfͿޤ
+ǡꤷ1¿ĤȤˤʤޤ
+
+argcλϰοǤϤʤꤷȤˤʤޤ
+argc-1λϰϤޤargc-2λϰ
+RubyȤϤޤ
+
+᥽åɤؿϤ⤦ĤޤҤȤĤprivate
+åɤؿǡrb_define_method()ƱǤ
+
+ void rb_define_private_method(VALUE klass, const char *name,
+ VALUE (*func)(), int argc)
+
+private᥽åɤȤϴؿǤƤӽФȤνʤ᥽
+ɤǤ
+
+⤦ҤȤĤϥ⥸塼ؿΤǤ⥸塼ؿ
+Ȥϥ⥸塼ðۥ᥽åɤǤꡤƱprivate᥽åɤ
+⤢ΤǤ򤢤Math⥸塼sqrt()ʤɤ
+ޤΥ᥽åɤ
+
+ Math.sqrt(4)
+
+ȤǤ
+
+ include Math
+ sqrt(4)
+
+ȤǤȤޤ⥸塼ؿؿϰʲ
+̤Ǥ
+
+ void rb_define_module_function(VALUE module, const char *name,
+ VALUE (*func)(), int argc)
+
+ؿŪ᥽å(Kernel⥸塼private method)뤿
+δؿϰʲ̤Ǥ
+
+ void rb_define_global_function(const char *name, VALUE (*func)(), int argc)
+
+
+᥽åɤ̾뤿δؿϰʲ̤Ǥ
+
+ void rb_define_alias(VALUE module, const char* new, const char* old);
+
+2.1.3
+
+ĥ饤֥꤬ɬפϤ餫Ƥɤ
+Ǥ礦ؿĤޤ
+
+ void rb_define_const(VALUE klass, const char *name, VALUE val)
+ void rb_define_global_const(const char *name, VALUE val)
+
+ԤΥ饹/⥸塼°Ρ
+ԤϥХΤǤ
+
+2.2 RubyεǽCƤӽФ
+
+ˡ1.5 RubyΥǡ٤ǰҲ𤷤褦ʴؿ
+ȤСRubyεǽ¸ƤؿľܸƤӽФȤ
+
+# Τ褦ʴؿΰɽϤޤΤȤޤ󡥥
+# 뤷ʤǤ͡
+
+ʳˤRubyεǽƤӽФˡϤĤޤ
+
+2.2.1 RubyΥץeval
+
+CRubyεǽƤӽФäȤñˡȤơʸ
+Ϳ줿RubyΥץɾʲδؿޤ
+
+ VALUE rb_eval_string(const char *str)
+
+ɾϸߤδĶǹԤޤĤޤꡤߤΥѿ
+ʤɤѤޤ
+
+2.2.2 IDޤϥܥ
+
+CʸͳRubyΥ᥽åɤƤӽФȤǤ
+ˡRuby󥿥ץ꥿ǥ᥽åɤѿ̾ꤹ
+˻ȤƤIDˤĤƤޤ礦
+
+IDȤѿ̾᥽å̾ɽǤRubyǤ
+
+ :̻
+
+ǥǤޤC餳뤿ˤϴؿ
+
+ rb_intern(const char *name)
+
+ȤޤRubyȤͿ줿ܥ(ޤʸ
+)IDѴˤϰʲδؿȤޤ
+
+ rb_to_id(VALUE symbol)
+
+2.2.3 CRubyΥ᥽åɤƤӽФ
+
+CʸͳRubyΥ᥽åɤƤӽФˤϰʲ
+δؿȤޤ
+
+ VALUE rb_funcall(VALUE recv, ID mid, int argc, ...)
+
+δؿϥ֥recvmidǻꤵ᥽åɤƤӽ
+ޤ¾˰λλ㤦ʲδؿ⤢ޤ
+
+ VALUE rb_funcall2(VALUE recv, ID mid, int argc, VALUE *argv)
+ VALUE rb_apply(VALUE recv, ID mid, VALUE args)
+
+applyˤϰȤRubyͿޤ
+
+2.2.4 ѿ/򻲾/
+
+CؿȤäƻȡǤΤϡ󥹥
+ǤѿϰΤΤCѿȤƥǤ
+ޤѿ򻲾ȤˡϸƤޤ
+
+֥ȤΥ󥹥ѿ򻲾ȡؿϰʲ
+
+ VALUE rb_ivar_get(VALUE obj, ID id)
+ VALUE rb_ivar_set(VALUE obj, ID id, VALUE val)
+
+idrb_intern()ΤȤäƤ
+
+򻲾ȤˤϰʲδؿȤäƤ
+
+ VALUE rb_const_get(VALUE obj, ID id)
+
+򿷤뤿ˤϡ2.1.3 ٤ǾҲ
+ƤؿȤäƤ
+
+3RubyCȤξͭ
+
+CRubyδ֤ǾͭˡˤĤƲ⤷ޤ
+
+3.1 C黲ȤǤRuby
+
+ʲRubyCΥ٥뤫黲ȤǤޤ
+
+ Qtrue
+ Qfalse
+
+ ͡QfalseCǤ⵶Ȥߤʤޤ(Ĥޤ0)
+
+ Qnil
+
+ C줫鸫nilס
+
+3.2 CRubyǶͭѿ
+
+CRubyѿȤäƾͭǤޤͭǤ
+ѿˤϤĤμबޤΤʤǤäȤɤȤ
+ȻפΤrb_define_variable()Ǥ
+
+ void rb_define_variable(const char *name, VALUE *var)
+
+δؿRubyCȤǶͭѿޤѿ̾
+`$'ǻϤޤʤˤϼưŪɲäޤѿͤ
+ȼưŪRubyбѿͤѤޤ
+
+ޤRuby¦ϹǤʤѿ⤢ޤread only
+ѿϰʲδؿޤ
+
+ void rb_define_readonly_variable(const char *name, VALUE *var)
+
+ѿ¾hookĤѿǤޤhookդ
+ѿϰʲδؿѤޤhookդѿ
+ͤλȤhookǹԤɬפޤ
+
+ void rb_define_hooked_variable(const char *name, VALUE *var,
+ VALUE (*getter)(), void (*setter)())
+
+δؿCδؿˤähookΤĤ줿ѿ
+ѿȤ줿ˤϴؿgetterѿͤåȤ
+ˤϴؿsetterƤФ롥hookꤷʤgetter
+setter0ꤷޤ
+
+# gettersetter0ʤrb_define_variable()Ʊˤʤ롥
+
+줫顤CδؿˤäƼ¸Rubyѿ
+ؿޤ
+
+ void rb_define_virtual_variable(const char *name,
+ VALUE (*getter)(), void (*setter)())
+
+δؿˤä줿RubyѿȤ줿ˤ
+getterѿͤåȤ줿ˤsetterƤФޤ
+
+gettersetterλͤϰʲ̤Ǥ
+
+ (*getter)(ID id, void *data, struct global_entry* entry);
+ (*setter)(VALUE val, ID id, void *data, struct global_entry* entry);
+
+3.3 CΥǡRuby֥Ȥˤ
+
+C줿ǡ(¤)RubyΥ֥ȤȤ
+갷礬ꤨޤΤ褦ʾˤϡDataȤ
+Ruby֥ȤCι¤(ؤΥݥ)򤯤ळȤRuby
+֥ȤȤƼ갷褦ˤʤޤ
+
+Data֥Ȥƹ¤ΤRuby֥Ȥ˥ץ
+뤿ˤϡʲΥޥȤޤ
+
+ Data_Wrap_Struct(klass, mark, free, ptr)
+
+Υޥͤ줿Data֥ȤǤ
+
+klassϤData֥ȤΥ饹Ǥptrϥץ벽
+Cι¤ΤؤΥݥ󥿤ǤmarkϤι¤ΤRubyΥ֥
+ȤؤλȤ˻ȤؿǤΤ褦ʻȤޤޤʤ
+ˤ0ꤷޤ
+
+# Τ褦ʻȤϴޤ
+
+freeϤι¤Τ⤦פˤʤä˸ƤФؿǤ
+ؿ١쥯ƤФޤ줬-1ξϡñ
+˳ޤ
+
+Cι¤ΤγData֥ȤƱ˹Ԥޥ
+ưʲΤΤ󶡤Ƥޤ
+
+ Data_Make_Struct(klass, type, mark, free, sval)
+
+Υޥͤ줿Data֥ȤǤ
+
+klass, mark, freeData_Wrap_StructƱƯ򤷤ޤtype
+ϳƤC¤ΤηǤƤ줿¤Τѿsval
+ޤѿη (type*) Ǥɬפޤ
+
+Data֥Ȥݥ󥿤ФΤϰʲΥޥѤ
+
+ Data_Get_Struct(obj, type, sval)
+
+Cι¤ΤؤΥݥ󥿤ѿsvalޤ
+
+DataλȤϤäʬˤΤǡ
+򻲾ȤƤ
+
+4 - dbmѥå
+
+ޤǤǤȤꤢĥ饤֥ϺϤǤ
+Rubyextǥ쥯ȥˤǤ˴ޤޤƤdbm饤֥
+ʳŪޤ
+
+(1) ǥ쥯ȥ
+
+ % mkdir ext/dbm
+
+Ruby 1.1ǤդΥǥ쥯ȥǥʥߥå饤֥
+뤳ȤǤ褦ˤʤޤRubyŪ˥󥯤
+RubyŸǥ쥯ȥβextǥ쥯ȥ˳ĥ
+饤֥ѤΥǥ쥯ȥɬפޤ̾Ŭ
+ǹޤ
+
+(2) MANIFESTե
+
+ % cd ext/dbm
+ % touch MANIFEST
+
+ĥ饤֥Υǥ쥯ȥβˤMANIFESTȤե뤬
+ɬפʤΤǡȤꤢΥեäƤޤǤ
+եˤɬפʥե뤳Ȥˤʤޤ
+
+MANIFESTȤեϡŪ󥯤makeλ˥ǥ쥯ȥ
+ĥ饤֥ޤǤ뤫ɤȽꤹ뤿˻Ȥ
+ޤʥߥå饤֥ˤɬɬפǤ
+
+(3) ߷פ
+
+ޤʤǤɡɤǽ¸뤫ɤޤ
+פɬפޤɤʥ饹Ĥ뤫Υ饹ˤ
+ɤʥ᥽åɤ뤫饹󶡤ʤɤˤĤ߷
+
+(4) Cɤ
+
+ĥ饤֥ΤȤʤCΥ񤭤ޤCΥ
+ҤȤĤλˤϡ֥饤֥̾.cפ֤ɤǤ礦C
+Υʣξˤϵդˡ֥饤֥̾.cפȤե
+̾򤱤ɬפޤ֥ȥեȥ⥸塼
+Ū֥饤֥̾.oפȤե
+Ȥͤ뤫Ǥ
+
+Rubyϳĥ饤֥ɤˡInit_饤֥̾פ
+ؿưŪ˼¹Ԥޤdbm饤֥ξInit_dbm
+Ǥδؿǥ饹⥸塼롤᥽åɡʤɤ
+Ԥޤdbm.cѤޤ
+
+--
+Init_dbm()
+{
+ /* DBM饹 */
+ cDBM = rb_define_class("DBM", rb_cObject);
+ /* DBMEnumerate⥸塼򥤥󥯥롼ɤ */
+ rb_include_module(cDBM, rb_mEnumerable);
+
+ /* DBM饹Υ饹᥽åopen(): CǼ */
+ rb_define_singleton_method(cDBM, "open", fdbm_s_open, -1);
+
+ /* DBM饹Υ᥽åclose(): Ϥʤ */
+ rb_define_method(cDBM, "close", fdbm_close, 0);
+ /* DBM饹Υ᥽å[]: 1 */
+ rb_define_method(cDBM, "[]", fdbm_fetch, 1);
+ :
+
+ /* DBMǡǼ륤󥹥ѿ̾ΤID */
+ id_dbm = rb_intern("dbm");
+}
+--
+
+DBM饤֥dbmΥǡб륪֥ȤˤʤϤ
+顤CdbmRuby˼ɬפޤ
+
+
+dbm.cǤData_Make_StructʲΤ褦˻ȤäƤޤ
+
+--
+struct dbmdata {
+ int di_size;
+ DBM *di_dbm;
+};
+
+
+obj = Data_Make_Struct(klass, struct dbmdata, 0, free_dbm, dbmp);
+--
+
+Ǥdbmstruct¤ΤؤΥݥ󥿤Data˥ץ벽Ƥ
+ޤDBM*ľܥץ벽ʤΤclose()ν
+ƤΤȤǤ
+
+Data֥Ȥdbmstruct¤ΤΥݥ󥿤Ф
+˰ʲΥޥȤäƤޤ
+
+--
+#define GetDBM(obj, dbmp) {\
+ Data_Get_Struct(obj, struct dbmdata, dbmp);\
+ if (dbmp->di_dbm == 0) closed_dbm();\
+}
+--
+
+äʣʥޥǤפdbmdata¤ΤΥݥ
+μФȡcloseƤ뤫ɤΥåޤȤƤ
+
+DBM饹ˤϤ᥽åɤޤʬह3
+μޤҤȤĤϰοΤΤǡ
+Ƥdelete᥽åɤޤdelete᥽åɤƤ
+fdbm_delete()ϤΤ褦ˤʤäƤޤ
+
+--
+static VALUE
+fdbm_delete(obj, keystr)
+ VALUE obj, keystr;
+{
+ :
+}
+--
+
+οΥפ1self2ʹߤ᥽å
+ΰȤʤޤ
+
+οΤΤCǼΤRubyǼ
+ΤȤޤdbm饤֥ǡCǼ
+DBMΥ饹᥽åɤǤopen()ǤƤ
+fdbm_s_open()ϤʤäƤޤ
+
+--
+static VALUE
+fdbm_s_open(argc, argv, klass)
+ int argc;
+ VALUE *argv;
+ VALUE klass;
+{
+ :
+ if (rb_scan_args(argc, argv, "11", &file, &vmode) == 1) {
+ mode = 0666; /* default value */
+ }
+ :
+}
+--
+
+Υפδؿ1Ϳ줿ο2Ϳ
+줿äƤˤʤޤself3ȤͿ
+
+Ϳ줿Ϥ뤿δؿopen()ǤȤ
+Ƥrb_scan_args()Ǥ3˻ꤷեޥåȤ
+4ѿʹߤ˻ꤷѿͤƤޤ
+եޥåȤϡ1ʸܤάǤʤο2ʸܤ
+άǤο3ʸܤб̵꤬ޤΰ
+뤫ɤ򼨤"*"Ǥ2ʸܤ3ʸܤϾάǤ
+dbm.cǤϡեޥåȤ"11"Ǥ顤Ϻ1
+ǡ2ĤޤǵȤ̣ˤʤޤάƤ
+ѿͤnil(CΥ٥ǤQnil)ˤʤޤ
+
+RubyǰΤindexesޤϤ
+
+--
+static VALUE
+fdbm_indexes(obj, args)
+ VALUE obj, args;
+{
+ :
+}
+--
+
+1self2RubyǤ
+
+** ջ
+
+RubyȶͭϤʤRubyΥ֥ȤǼǽΤ
+CѿϰʲδؿȤäRuby󥿥ץ꥿ѿ¸
+򶵤ƤƤǤʤGCǥȥ֥򵯤ޤ
+
+ void rb_global_variable(VALUE *var)
+
+(5) extconf.rbѰդ
+
+Makefileοˤʤextconf.rbȤե
+ޤextconf.rbϥ饤֥ΥѥɬפʾΥ
+ʤɤԤȤŪǤޤ
+
+ require 'mkmf'
+
+extconf.rbƬ֤ޤextconf.rbǤϰʲRuby
+ȤȤޤ
+
+ have_library(lib, func): 饤֥¸ߥå
+ have_func(func, header): ؿ¸ߥå
+ have_header(header): إåե¸ߥå
+ create_makefile(target): Makefile
+
+ʲѿȤȤǤޤ
+
+ $CFLAGS: ѥɲŪ˻ꤹե饰(-Iʤ)
+ $LDFLAGS: 󥯻ɲŪ˻ꤹե饰(-Lʤ)
+
+饤֥򥳥ѥ뤹郎·鷺Υ饤֥򥳥
+ѥ뤷ʤˤcreate_makefileƤФʤMakefile
+줺ѥԤޤ
+
+(6) dependѰդ
+
+⤷ǥ쥯ȥdependȤե뤬¸ߤС
+Makefile¸طåƤޤ
+
+ % gcc -MM *.c > depend
+
+ʤɤǺ뤳Ȥޤä»̵Ǥ礦
+
+(7) MANIFESTե˥ե̾
+
+ % find * -type f -print > MANIFEST
+ % vi MANIFEST
+
+*.o, *~ʤɬפʥեʳMANIFESTɲäƤޤ
+makeˤMANIFESTƤϻȤޤΤǡΤޤޤǤ
+ϵޤ󤬡ѥå󥰤λ˻Ȥ뤳ȤΤȡ
+ɬפʥե̤ǤΤǡѰդƤɤǤ
+
+
+(8) Makefile
+
+Makefileºݤ뤿ˤ
+
+ ruby extconf.rb
+
+Ȥޤextconf.rb require 'mkmf' ιԤʤˤϥ顼
+ˤʤޤΤǡɲä
+
+ ruby -r mkmf extconf.rb
+
+ȤƤ
+
+ǥ쥯ȥextʲѰդˤRubyΤmakeλ
+ưŪMakefileޤΤǡΥƥåפפǤ
+
+(9) make
+
+ưŪ󥯥饤֥ˤϤξmakeƤ
+ɬפǤ make install ǥ󥹥ȡ뤵ޤ
+
+extʲ˥ǥ쥯ȥѰդϡRubyΥǥ쥯ȥ
+make¹ԤMakefilemakeɬפˤäƤϤΥ
+塼RubyؤΥ󥯤ޤǼưŪ˼¹ԤƤޤ
+extconf.rb񤭴ʤɤMakefileκɬפʻϤ
+Rubyǥ쥯ȥmakeƤ
+
+ĥ饤֥make installRuby饤֥Υǥ쥯ȥ
+˥ԡޤ⤷ĥ饤֥ȶĴƻȤRubyǵ
+Ҥ줿ץबꡤRuby饤֥֤ˤϡ
+ĥ饤֥ѤΥǥ쥯ȥβ lib Ȥǥ쥯ȥ
+ꡤ ĥ .rb Υե֤ƤƱ˥
+ȡ뤵ޤ
+
+(10) ǥХå
+
+ޤǥХåʤưʤǤ礦͡ext/Setup˥ǥ
+ȥ̾񤯤Ū˥󥯤ΤǥǥХåȤ褦ˤ
+ޤʬѥ뤬٤ʤޤɡ
+
+(11) Ǥ
+
+ϤäȤʤꡤʤꡤʤꡤͳˤ
+ȤRubyκԤϳĥ饤֥˴ؤưڤθ
+ĥޤ
+
+Appendix A. RubyΥɤʬ
+
+RubyΥϤĤʬह뤳ȤޤΤ
+饤֥ʬϴŪ˳ĥ饤֥Ʊˤʤ
+ƤޤΥϺޤǤǤۤȤǤ
+פޤ
+
+RubyΥ
+
+ class.c
+ error.c
+ eval.c
+ gc.c
+ object.c
+ parse.y
+ variable.c
+
+桼ƥƥؿ
+
+ dln.c
+ regex.c
+ st.c
+ util.c
+
+Rubyޥɤμ
+
+ dmyext.c
+ inits.c
+ main.c
+ ruby.c
+ version.c
+
+饹饤֥
+
+ array.c
+ bignum.c
+ compar.c
+ dir.c
+ enum.c
+ file.c
+ hash.c
+ io.c
+ marshal.c
+ math.c
+ numeric.c
+ pack.c
+ prec.c
+ process.c
+ random.c
+ range.c
+ re.c
+ signal.c
+ sprintf.c
+ string.c
+ struct.c
+ time.c
+
+Appendix B. ĥѴؿե
+
+C줫RubyεǽѤAPIϰʲ̤Ǥ롥
+
+**
+
+VALUE
+
+ Ruby֥Ȥɽ뷿ɬפ˱ƥ㥹ȤѤ롥
+ Ȥ߹߷ɽCηruby.h˵ҤƤRǻϤޤ빽¤
+ ΤǤ롥VALUE򤳤˥㥹Ȥ뤿RǻϤޤ빽¤
+ ̾ʸˤ̾ΥޥѰդƤ롥
+
+** ѿ
+
+Qnil
+
+ : nil֥
+
+Qtrue
+
+ : true֥(Υǥե)
+
+Qfalse
+
+ : false֥
+
+** CǡΥץ벽
+
+Data_Wrap_Struct(VALUE klass, void (*mark)(), void (*free)(), void *sval)
+
+ CǤդΥݥ󥿤򥫥ץ벽Ruby֥Ȥ֤
+ Υݥ󥿤Ruby饢ʤʤäfreeǻꤷ
+ ؿƤФ롥ޤΥݥ󥿤λؤǡ¾Ruby
+ ȤؤƤ硤mark˻ꤹؿǥޡɬ
+ 롥
+
+Data_Make_Struct(klass, type, mark, free, sval)
+
+ typeΥmallocѿsval塤򥫥ץ
+ 벽ǡ֤ޥ
+
+Data_Get_Struct(data, type, sval)
+
+ datatypeΥݥ󥿤Фѿsvalޥ
+
+** å
+
+TYPE(value)
+FIXNUM_P(value)
+NIL_P(value)
+void Check_Type(VALUE value, int type)
+void Check_SafeStr(VALUE value)
+
+** Ѵ
+
+FIX2INT(value)
+INT2FIX(i)
+NUM2INT(value)
+INT2NUM(i)
+NUM2DBL(value)
+rb_float_new(f)
+STR2CSTR(value)
+rb_str_new2(s)
+
+** 饹/⥸塼
+
+VALUE rb_define_class(const char *name, VALUE super)
+
+ superΥ֥饹ȤƿRuby饹롥
+
+VALUE rb_define_class_under(VALUE module, const char *name, VALUE super)
+
+ superΥ֥饹ȤƿRuby饹module
+ Ȥ롥
+
+VALUE rb_define_module(const char *name)
+
+ Ruby⥸塼롥
+
+VALUE rb_define_module_under(VALUE module, const char *name)
+
+ Ruby⥸塼moduleȤ롥
+
+void rb_include_module(VALUE klass, VALUE module)
+
+ ⥸塼򥤥󥯥롼ɤ롥classǤmodule򥤥
+ 롼ɤƤˤϲ⤷ʤ(¿ť󥯥롼ɤζػ)
+
+void rb_extend_object(VALUE object, VALUE module)
+
+ ֥Ȥ⥸塼(Ƥ᥽å)dzĥ롥
+
+** ѿ
+
+void rb_define_variable(const char *name, VALUE *var)
+
+ RubyCȤǶͭ륰Хѿ롥ѿ̾`$'
+ ϤޤʤˤϼưŪɲä롥nameȤRubyμ̻
+ ȤƵʤʸ(㤨` ')ޤˤRubyץ
+ फϸʤʤ롥
+
+void rb_define_readonly_variable(const char *name, VALUE *var)
+
+ RubyCȤǶͭread onlyΥХѿ롥
+ read onlyǤ뤳Ȱʳrb_define_variable()Ʊ
+
+void rb_define_virtual_variable(const char *name,
+ VALUE (*getter)(), void (*setter)())
+
+ ؿˤäƼ¸Rubyѿ롥ѿȤ줿
+ ˤgetterѿͤåȤ줿ˤsetterƤФ
+ 롥
+
+void rb_define_hooked_variable(const char *name, VALUE *var,
+ VALUE (*getter)(), void (*setter)())
+
+ ؿˤähookΤĤ줿Хѿ롥ѿ
+ Ȥ줿ˤgetterؿͤåȤ줿ˤ
+ setterƤФ롥gettersetter0ꤷˤhook
+ ꤷʤΤƱˤʤ롥
+
+void rb_global_variable(VALUE *var)
+
+ GCΤᡤRubyץफϥʤ, Ruby
+ Ȥޤѿޡ롥
+
+**
+
+void rb_define_const(VALUE klass, const char *name, VALUE val)
+
+ 롥
+
+void rb_define_global_const(const char *name, VALUE val)
+
+ 롥
+
+ rb_define_const(rb_cObject, name, val)
+
+ Ʊ̣
+
+** ᥽å
+
+rb_define_method(VALUE klass, const char *name, VALUE (*func)(), int argc)
+
+ ᥽åɤ롥argcselfοargc-1λ,
+ ؿˤϰο(selfޤޤʤ)1, 2
+ ȤͿ(3self)argc-2λ,
+ 1self, 2args(argsϰޤRuby)
+ Ϳ롥
+
+rb_define_private_method(VALUE klass, const char *name, VALUE (*func)(), int argc)
+
+ private᥽åɤ롥rb_define_method()Ʊ
+
+rb_define_singleton_method(VALUE klass, const char *name, VALUE (*func)(), int argc)
+
+ ðۥ᥽åɤ롥rb_define_method()Ʊ
+
+rb_scan_args(int argc, VALUE *argv, const char *fmt, ...)
+
+ argc, argvͿ줿ʬ򤹤롥fmtɬܰο,
+ ղðο, Ĥΰ뤫ꤹʸ, "
+ *"ȤǤ롥 2 ܤο"*"Ϥ줾ά
+ ǽǤ롥ɬܰĤʤ0ꤹ롥3
+ ߤѿؤΥݥ󥿤, Ǥѿ˳Ǽ롥
+ ղðбͿƤʤѿQnil
+ 롥
+
+** Ruby᥽åɸƤӽФ
+
+VALUE rb_funcall(VALUE recv, ID mid, int narg, ...)
+
+ ᥽åɸƤӽФʸ󤫤mid뤿ˤrb_intern()
+ Ȥ
+
+VALUE rb_funcall2(VALUE recv, ID mid, int argc, VALUE *argv)
+
+ ᥽åɸƤӽФargc, argvϤ
+
+VALUE rb_eval_string(const char *str)
+
+ ʸRubyץȤȤƥѥ롦¹Ԥ롥
+
+ID rb_intern(const char *name)
+
+ ʸбID֤
+
+char *rb_id2name(ID id)
+
+ IDбʸ֤(ǥХå)
+
+char *rb_class2name(VALUE klass)
+
+ 饹֤̾(ǥХå)饹̾ʤˤ,
+ ̤ä̾ĥ饹֤̾
+
+int rb_respond_to(VALUE obj, ID id)
+
+ objidǼ᥽åɤĤɤ֤
+
+** 󥹥ѿ
+
+VALUE rb_iv_get(VALUE obj, const char *name)
+
+ objΥ󥹥ѿͤ롥`@'ǻϤޤʤ󥹥
+ ѿ Rubyץफ饢Ǥʤֱ줿ץ
+ ѿˤʤ롥ʸ̾ĥ饹(ޤ
+ ⥸塼)Υ󥹥ѿȤƼƤ롥
+
+VALUE rb_iv_set(VALUE obj, const char *name, VALUE val)
+
+ objΥ󥹥ѿval˥åȤ롥
+
+** 湽¤
+
+VALUE rb_iterate(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2)
+
+ func2֥åȤꤷ, func1򥤥ƥ졼ȤƸƤ֡
+ func1ˤ arg1ȤϤ, func2ˤ1˥ƥ졼
+ Ϳ줿, 2arg2Ϥ롥
+
+VALUE rb_yield(VALUE val)
+
+ valͤȤƥƥ졼֥åƤӽФ
+
+VALUE rb_rescue(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2)
+
+ ؿfunc1arg1˸ƤӽФfunc1μ¹㳰ȯ
+ ˤ func2arg2ȤƸƤ֡ͤ㳰ȯ
+ ʤäfunc1, 㳰ȯˤfunc2
+ ͤǤ롥
+
+VALUE rb_ensure(VALUE (*func1)(), VALUE arg1, void (*func2)(), VALUE arg2)
+
+ ؿfunc1arg1ȤƼ¹Ԥ, ¹Խλ(Ȥ㳰
+ ȯƤ) func2arg2ȤƼ¹Ԥ롥ͤfunc1
+ ͤǤ(㳰ȯʤ)
+
+** 㳰顼
+
+void rb_warning(const char *fmt, ...)
+
+ rb_verboseɸ२顼Ϥ˷ٹɽ롥
+ printf()Ʊ
+
+void rb_raise(rb_eRuntimeError, const char *fmt, ...)
+
+ RuntimeError㳰ȯ롥printf()Ʊ
+
+void rb_raise(VALUE exception, const char *fmt, ...)
+
+ exceptionǻꤷ㳰ȯ롥fmtʲΰ
+ printf()Ʊ
+
+void rb_fatal(const char *fmt, ...)
+
+ ̿Ū㳰ȯ롥̾㳰ϹԤʤ줺, 󥿡
+ ץ꥿λ(ensureǻꤵ줿ɤϽλ
+ ¹Ԥ)
+
+void rb_bug(const char *fmt, ...)
+
+ 󥿡ץ꥿ʤɥץΥХǤȯϤΤʤ
+ λƤ֡󥿡ץ꥿ϥפľ˽λ롥
+ 㳰ϰڹԤʤʤ
+
+** Rubyν¹
+
+Ruby򥢥ץꥱˤϰʲΥ󥿥ե
+Ȥ̾γĥ饤֥ˤɬפʤ
+
+void ruby_init()
+
+ Ruby󥿥ץ꥿νԤʤ
+
+void ruby_options(int argc, char **argv)
+
+ Ruby󥿥ץ꥿Υޥɥ饤νԤʤ
+
+void ruby_run()
+
+ Ruby󥿥ץ꥿¹Ԥ롥
+
+void ruby_script(char *name)
+
+ RubyΥץ̾($0)ꤹ롥
+
+
+Appendix C. extconf.rbǻȤؿ
+
+extconf.rbǤѲǽʥѥåδؿϰ
+̤Ǥ롥
+
+have_library(lib, func)
+
+ ؿfuncƤ饤֥lib¸ߤå롥
+ 饤֥꤬¸ߤtrue֤
+
+find_library(lib, func, path...)
+
+ ؿfuncƤ饤֥lib¸ߤ -Lpath ɲ
+ ʤå롥饤֥꤬դätrue֤
+
+have_func(func, header)
+
+ إåեheader򥤥󥯥롼ɤƴؿfunc¸ߤ
+ 롥funcɸǤϥ󥯤ʤ饤֥ΤΤǤ
+ ˤhave_libraryǤΥ饤֥åƤ
+ ؿ¸ߤtrue֤
+
+have_header(header)
+
+ إåե¸ߤå롥إåե뤬¸ߤ
+ true֤
+
+create_makefile(target)
+
+ ĥ饤֥ѤMakefile롥δؿƤФʤ
+ ФΥ饤֥ϥѥ뤵ʤtargetϥ⥸塼̾
+ ɽ
+
+with_config(withval[, default=nil])
+
+ ޥɥ饤--with-<withval>ǻꤵ줿ץͤ롥
+
+dir_config(target[, default_dir])
+dir_config(target[, default_include, default_lib])
+
+ ޥɥ饤--with-<target>-dir, --with-<target>-include,
+ --with-<target>-libΤ줫ǻꤵǥ쥯ȥ
+ $CFLAGS $LDFLAGS ɲä롥--with-<target>-dir=/path
+ --with-<target>-include=/path/include --with-<target>-lib=/path/lib
+ Ǥ롥ɲä줿 include ǥ쥯ȥ lib ǥ쥯ȥ
+ ֤ ([include_dir, lib_dir])
+
+/*
+ * Local variables:
+ * fill-column: 60
+ * end:
+ */
diff --git a/README.ja b/README.ja
new file mode 100644
index 0000000000..fc502dd440
--- /dev/null
+++ b/README.ja
@@ -0,0 +1,153 @@
+* RubyȤ
+
+Rubyϥץ뤫ĶϤʥ֥ȻظץȸǤ
+RubyϺǽ餫ʥ֥ȻظȤ߷פƤ
+顤֥Ȼظץߥ󥰤ڤ˹Ԥ
+̾μ³Υץߥ󥰤ǽǤ
+
+RubyϥƥȽطǽϤʤɤͥ졤PerlƱ餤
+Ǥ˥ץʸˡȡ㳰䥤ƥ졼ʤɤε
+ˤäơʬ䤹ץߥ󥰤ޤ
+
+
+* RubyĹ
+
+ + ץʸˡ
+ + ̤Υ֥Ȼظǽ(饹᥽åɥʤ)
+ + üʥ֥Ȼظǽ(Mixin, ðۥ᥽åɤʤ)
+ + 黻ҥС
+ + 㳰ǽ
+ + ƥ졼ȥ
+ + ١쥯
+ + ʥߥåǥ (ƥˤ)
+ + ܿ⤤¿UNIXưǤʤDOSWindows
+ MacBeOSʤɤξǤư
+
+
+* ˡ
+
+** ftp
+
+ʲξˤƤޤ
+
+ ftp://ftp.ruby-lang.org/pub/ruby/
+
+** CVS
+
+ $ cvs -d :pserver:anonymous@cvs.ruby-lang.org:/src login
+ (Logging in to anonymous@cvs.ruby-lang.org)
+ CVS password: anonymous
+ $ cvs -z4 -d :pserver:anonymous@cvs.ruby-lang.org:src checkout ruby
+
+
+* ۡڡ
+
+RubyΥۡڡURL
+
+ http://www.ruby-lang.org/
+
+
+
+* ᡼󥰥ꥹ
+
+RubyΥ᡼󥰥ꥹȤޤô˾
+
+ ruby-list-ctl@ruby-lang.org
+
+ޤʸ
+
+ subscribe YourFirstName YourFamilyName
+
+Ƚ񤤤äƲ
+
+RubyȯԸ᡼󥰥ꥹȤ⤢ޤǤrubyΥ
+λͳĥʤɼˤĤƵƤޤ
+ô˾
+
+ ruby-dev-ctl@ruby-lang.org
+
+ޤruby-listƱͤˡǥ᡼뤷Ƥ
+
+Rubyĥ⥸塼ˤĤä礦ruby-ext᡼󥰥ꥹȤ
+شطˤĤä礦ruby-math᡼󥰥ꥹȤ
+Ѹä礦ruby-talk᡼󥰥ꥹȤ⤢ޤˡ
+ϤɤƱǤ
+
+
+* ѥ롦󥹥ȡ
+
+ʲμǹԤäƤ
+
+ 1. ⤷configureե뤬Ĥʤ⤷
+ configure.inŤ褦ʤ顢autoconf¹Ԥ
+ configure
+
+ 2. configure¹ԤMakefileʤɤ
+
+ 3. (ɬפʤ)defines.hԽ
+
+ ¿ʬɬ̵Ȼפޤ
+
+ 4. (ɬפʤ)ext/SetupŪ˥󥯤ĥ⥸塼
+ ꤹ
+
+ ext/Setup˵Ҥ⥸塼Ū˥󥯤ޤ
+
+ ʥߥåǥ󥰤򥵥ݡȤƤʤƥ
+ ǤSetup1ܤΡoption nodynamicפȤԤΥ
+ Ȥ򳰤ɬפޤޤΥƥ
+ ĥ⥸塼Ѥ뤿ˤϡ餫Ū˥
+ Ƥɬפޤ
+
+ 5. make¹Ԥƥѥ뤹
+
+ 6. make testǥƥȤԤ
+
+ test succeededפɽǤƥ
+ ƤⴰݾڤƤǤϤޤ
+
+ 7. make install
+
+ rootǺȤɬפ뤫⤷ޤ
+
+⤷ѥ˥顼ȯˤϥ顼Υȥ
+OSμޤǤܤݡȤԤäƤ
+¾Τˤʤޤ
+
+
+* ܿ
+
+UNIXǤconfigureۤȤɤκۤۼƤϤ
+פ̸Ȥä(˰㤤ʤ)Ԥˤ
+ȤݡȤСǤ뤫Τޤ
+
+ƥˤäȤ¸ΤGCǤRubyGCо
+Υƥ㤬setjmp()ˤäƤΥ쥸 jmp_buf
+Ǽ뤳Ȥȡjmp_bufȥå32bit饤Ȥ
+뤳ȤꤷƤޤäԤΩʤб
+˺Ǥ礦ԤβŪñǡgc.cǥå
+ޡƤʬ˥饤ȤΥХȿ餷ƥޡ
+륳ɤɲäǺѤߤޤdefined(THINK_C)פ
+Ƥʬ򻲹ͤˤƤ
+
+# ºݤˤRubyThink CǤϥѥǤޤ
+
+쥸ɥCPUǤϡ쥸ɥ򥹥
+˥եå夹륢֥饳ɤɲäɬפ뤫
+
+
+* ۾
+
+COPYING.jaե򻲾ȤƤ
+
+
+*
+
+ȡХݡȤ¾ matz@netlab.jp ޤǡ
+-------------------------------------------------------
+created at: Thu Aug 3 11:57:36 JST 1995
+Local variables:
+mode: indented-text
+end:
diff --git a/README.ja.md b/README.ja.md
deleted file mode 100644
index 4e1e6b9d87..0000000000
--- a/README.ja.md
+++ /dev/null
@@ -1,185 +0,0 @@
-[![Build Status](https://travis-ci.org/ruby/ruby.svg?branch=master)](https://travis-ci.org/ruby/ruby)
-[![Build status](https://ci.appveyor.com/api/projects/status/0sy8rrxut4o0k960/branch/master?svg=true)](https://ci.appveyor.com/project/ruby/ruby/branch/master)
-![](https://github.com/ruby/ruby/workflows/Cygwin/badge.svg)
-![](https://github.com/ruby/ruby/workflows/macOS/badge.svg)
-![](https://github.com/ruby/ruby/workflows/MJIT/badge.svg)
-![](https://github.com/ruby/ruby/workflows/Ubuntu/badge.svg)
-![](https://github.com/ruby/ruby/workflows/Windows/badge.svg)
-
-# Rubyとは
-
-Rubyはシンプルかつ強力なオブジェクト指向スクリプト言語です. Rubyは純粋なオブジェクト指向言語として設計されているので,
-オブジェクト指向プログラミングを手軽に行う事が出来ます.もちろん普通の手続き型のプログラミングも可能です.
-
-Rubyはテキスト処理関係の能力などに優れ,Perlと同じくらい強力です.さらにシンプルな文法と,
-例外処理やイテレータなどの機構によって,より分かりやすいプログラミングが出来ます.
-
-## Rubyの特長
-
-* シンプルな文法
-* 普通のオブジェクト指向機能(クラス,メソッドコールなど)
-* 特殊なオブジェクト指向機能(Mixin,特異メソッドなど)
-* 演算子オーバーロード
-* 例外処理機能
-* イテレータとクロージャ
-* ガーベージコレクタ
-* ダイナミックローディング (アーキテクチャによる)
-* 移植性が高い.多くのUnix-like/POSIX互換プラットフォーム上で動くだけでなく,Windows, macOS,
- Haikuなどの上でも動く cf.
- https://github.com/ruby/ruby/blob/master/doc/contributing.rdoc#platform-maintainers
-
-
-## 入手法
-
-サードパーティーツールを使った方法を含むRubyのインストール方法の一覧は
-
-https://www.ruby-lang.org/ja/downloads/
-
-を参照してください.
-
-### Git
-
-ミラーをGitHubに公開しています. 以下のコマンドでリポジトリを取得できます.
-
- $ git clone https://github.com/ruby/ruby.git
-
-他のブランチの一覧は次のコマンドで見られます.
-
- $ git ls-remote https://github.com/ruby/ruby.git
-
-Rubyリポジトリの本来のmasterは https://git.ruby-lang.org/ruby.git にあります.
-コミッタはこちらを使います.
-
-### Subversion
-
-古いRubyのバージョンのソースコードは次のコマンドで取得できます.
-
- $ svn co https://svn.ruby-lang.org/repos/ruby/branches/ruby_2_6/ ruby
-
-他に開発中のブランチの一覧は次のコマンドで見られます.
-
- $ svn ls https://svn.ruby-lang.org/repos/ruby/branches/
-
-
-## ホームページ
-
-RubyのホームページのURLは
-
-https://www.ruby-lang.org/
-
-です.
-
-## メーリングリスト
-
-Rubyのメーリングリストがあります.参加希望の方は
-
-mailto:ruby-list-request@ruby-lang.org
-
-まで本文に
-
- subscribe
-
-と書いて送って下さい.
-
-Ruby開発者向けメーリングリストもあります.こちらではrubyのバグ,将来の仕様拡張など実装上の問題について議論されています. 参加希望の方は
-
-mailto:ruby-dev-request@ruby-lang.org
-
-までruby-listと同様の方法でメールしてください.
-
-Ruby拡張モジュールについて話し合うruby-extメーリングリストと数学関係の話題について話し合うruby-mathメーリングリストと
-英語でrubyについて話し合うruby-talkメーリングリストもあります.参加方法はどれも同じです.
-
-## コンパイル・インストール
-
-以下の手順で行ってください.
-
-1. もし `configure` ファイルが見つからない,もしくは `configure.ac` より古いようなら, `autoconf` を実行して
- 新しく `configure` を生成する
-
-2. `configure` を実行して `Makefile` などを生成する
-
- 環境によってはデフォルトのCコンパイラ用オプションが付きます. `configure` オプションで `optflags=..`
- `warnflags=..` 等で上書きできます.
-
-3. (必要ならば)`defines.h` を編集する
-
- 多分,必要無いと思います.
-
-4. (必要ならば)`ext/Setup` に静的にリンクする拡張モジュールを指定する
-
- `ext/Setup` に記述したモジュールは静的にリンクされます.
-
- ダイナミックローディングをサポートしていないアーキテクチャでは `Setup` の1行目の「`option nodynamic`」という行のコ
- メントを外す必要があります.
- また,このアーキテクチャで拡張モジュールを利用するためには,あらかじめ静的にリンクをしておく必要があります.
-
-5. `make` を実行してコンパイルする
-
-6. `make check`でテストを行う.
-
- 「`check succeeded`」と表示されれば成功です.ただしテストに成功しても完璧だと保証されている訳ではありません.
-
-7. `make install`
-
- 以下のディレクトリを作って,そこにファイルをインストー ルします.
-
- * `${DESTDIR}${prefix}/bin`
- * `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}`
- * `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
- * `${DESTDIR}${prefix}/lib`
- * `${DESTDIR}${prefix}/lib/ruby`
- * `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}`
- * `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
- * `${DESTDIR}${prefix}/lib/ruby/site_ruby`
- * `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}`
- * `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
- * `${DESTDIR}${prefix}/lib/ruby/vendor_ruby`
- * `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}`
- * `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
- * `${DESTDIR}${prefix}/lib/ruby/gems/${MAJOR}.${MINOR}.${TEENY}`
- * `${DESTDIR}${prefix}/share/man/man1`
- * `${DESTDIR}${prefix}/share/ri/${MAJOR}.${MINOR}.${TEENY}/system`
-
-
- RubyのAPIバージョンが'*x.y.z*'であれば,`${MAJOR}`は
- '*x*'で,`${MINOR}`は'*y*',`${TEENY}`は'*z*'です.
-
- **注意**: APIバージョンの `teeny` は,Rubyプログラムのバージョンとは異なることがあります.
-
- `root` で作業する必要があるかもしれません.
-
-
-もし,コンパイル時にエラーが発生した場合にはエラーのログとマシン,OSの種類を含むできるだけ詳しいレポートを作者に送って下さると他の方のためにもなります.
-
-## 移植
-
-UNIXであれば `configure` がほとんどの差異を吸収してくれるはずですが,思わぬ見落としがあった場合(ある事が多い),作者にその
-ことを報告すれば,解決できる可能性があります.
-
-アーキテクチャにもっとも依存するのはGC部です.RubyのGCは対象
-のアーキテクチャが`setjmp()`または`getcontext()`によって全てのレジスタを `jmp_buf` や `ucontext_t`
-に格納することと, `jmp_buf` や `ucontext_t` とスタックが32bitアラインメントされていることを仮定
-しています.特に前者が成立しない場合の対応は非常に困難でしょう. 後者の解決は比較的簡単で, `gc.c` でスタックをマークしている
-部分にアラインメントのバイト数だけずらしてマークするコードを追加するだけで済みます.`defined(__mc68000__)`で括られてい
-る部分を参考にしてください.
-
-レジスタウィンドウを持つCPUでは,レジスタウィンドウをスタックにフラッシュするアセンブラコードを追加する必要があるかもしれません.
-
-## 配布条件
-
-[COPYING.ja](COPYING.ja) ファイルを参照してください.
-
-## フィードバック
-
-Rubyに関する質問は Ruby-Talk(英語)や Ruby-List(日本語) (https://www.ruby-lang.org/ja/community/mailing-lists) や,
-stackoverflow (https://ja.stackoverflow.com/) などのWebサイトに投稿してください.
-
-バグ報告は https://bugs.ruby-lang.org で受け付けています.
-
-
-## 著者
-
-Rubyのオリジナル版は,1995年にまつもとゆきひろ氏によって設計・開発されました.
-
-<mailto:matz@ruby-lang.org>
diff --git a/README.md b/README.md
deleted file mode 100644
index 1e935095c6..0000000000
--- a/README.md
+++ /dev/null
@@ -1,176 +0,0 @@
-[![Build Status](https://travis-ci.org/ruby/ruby.svg?branch=master)](https://travis-ci.org/ruby/ruby)
-[![Build status](https://ci.appveyor.com/api/projects/status/0sy8rrxut4o0k960/branch/master?svg=true)](https://ci.appveyor.com/project/ruby/ruby/branch/master)
-![](https://github.com/ruby/ruby/workflows/Cygwin/badge.svg)
-![](https://github.com/ruby/ruby/workflows/macOS/badge.svg)
-![](https://github.com/ruby/ruby/workflows/MJIT/badge.svg)
-![](https://github.com/ruby/ruby/workflows/Ubuntu/badge.svg)
-![](https://github.com/ruby/ruby/workflows/Windows/badge.svg)
-
-# What's Ruby
-
-Ruby is an interpreted object-oriented programming language often
-used for web development. It also offers many scripting features
-to process plain text and serialized files, or manage system tasks.
-It is simple, straightforward, and extensible.
-
-## Features of Ruby
-
-* Simple Syntax
-* **Normal** Object-oriented Features (e.g. class, method calls)
-* **Advanced** Object-oriented Features (e.g. mix-in, singleton-method)
-* Operator Overloading
-* Exception Handling
-* Iterators and Closures
-* Garbage Collection
-* Dynamic Loading of Object Files (on some architectures)
-* Highly Portable (works on many Unix-like/POSIX compatible platforms as
- well as Windows, macOS, Haiku, etc.) cf.
- https://github.com/ruby/ruby/blob/master/doc/contributing.rdoc#platform-maintainers
-
-
-## How to get Ruby
-
-For a complete list of ways to install Ruby, including using third-party tools
-like rvm, see:
-
-https://www.ruby-lang.org/en/downloads/
-
-### Git
-
-The mirror of the Ruby source tree can be checked out with the following command:
-
- $ git clone https://github.com/ruby/ruby.git
-
-There are some other branches under development. Try the following command
-to see the list of branches:
-
- $ git ls-remote https://github.com/ruby/ruby.git
-
-You may also want to use https://git.ruby-lang.org/ruby.git (actual master of Ruby source)
-if you are a committer.
-
-### Subversion
-
-Stable branches for older Ruby versions can be checked out with the following command:
-
- $ svn co https://svn.ruby-lang.org/repos/ruby/branches/ruby_2_6/ ruby
-
-Try the following command to see the list of branches:
-
- $ svn ls https://svn.ruby-lang.org/repos/ruby/branches/
-
-
-## Ruby home page
-
-https://www.ruby-lang.org/
-
-## Mailing list
-
-There is a mailing list to discuss Ruby. To subscribe to this list, please
-send the following phrase:
-
- subscribe
-
-in the mail body (not subject) to the address
-[ruby-talk-request@ruby-lang.org](mailto:ruby-talk-request@ruby-lang.org?subject=Join%20Ruby%20Mailing%20List&body=subscribe).
-
-## How to compile and install
-
-1. If you want to use Microsoft Visual C++ to compile Ruby, read
- [win32/README.win32](win32/README.win32) instead of this document.
-
-2. If `./configure` does not exist or is older than `configure.ac`, run
- `autoconf` to (re)generate configure.
-
-3. Run `./configure`, which will generate `config.h` and `Makefile`.
-
- Some C compiler flags may be added by default depending on your
- environment. Specify `optflags=..` and `warnflags=..` as necessary to
- override them.
-
-4. Edit `defines.h` if you need. Usually this step will not be needed.
-
-5. Remove comment mark(`#`) before the module names from `ext/Setup` (or add
- module names if not present), if you want to link modules statically.
-
- If you don't want to compile non static extension modules (probably on
- architectures which do not allow dynamic loading), remove comment mark
- from the line "`#option nodynamic`" in `ext/Setup`.
-
- Usually this step will not be needed.
-
-6. Run `make`.
-
- * On Mac, set RUBY\_CODESIGN environment variable with a signing identity.
- It uses the identity to sign `ruby` binary. See also codesign(1).
-
-7. Optionally, run '`make check`' to check whether the compiled Ruby
- interpreter works well. If you see the message "`check succeeded`", your
- Ruby works as it should (hopefully).
-
-8. Optionally, run `make update-gems` and `make extract-gems`.
-
- If you want to install bundled gems, run `make update-gems` and
- `make extract-gems` before running `make install`.
-
-9. Run '`make install`'.
-
- This command will create the following directories and install files into
- them.
-
- * `${DESTDIR}${prefix}/bin`
- * `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}`
- * `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
- * `${DESTDIR}${prefix}/lib`
- * `${DESTDIR}${prefix}/lib/ruby`
- * `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}`
- * `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
- * `${DESTDIR}${prefix}/lib/ruby/site_ruby`
- * `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}`
- * `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
- * `${DESTDIR}${prefix}/lib/ruby/vendor_ruby`
- * `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}`
- * `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
- * `${DESTDIR}${prefix}/lib/ruby/gems/${MAJOR}.${MINOR}.${TEENY}`
- * `${DESTDIR}${prefix}/share/man/man1`
- * `${DESTDIR}${prefix}/share/ri/${MAJOR}.${MINOR}.${TEENY}/system`
-
-
- If Ruby's API version is '*x.y.z*', the `${MAJOR}` is '*x*', the
- `${MINOR}` is '*y*', and the `${TEENY}` is '*z*'.
-
- **NOTE**: teeny of the API version may be different from one of Ruby's
- program version
-
- You may have to be a super user to install Ruby.
-
-If you fail to compile Ruby, please send the detailed error report with the
-error log and machine/OS type, to help others.
-
-Some extension libraries may not get compiled because of lack of necessary
-external libraries and/or headers, then you will need to run '`make distclean-ext`'
-to remove old configuration after installing them in such case.
-
-## Copying
-
-See the file [COPYING](COPYING).
-
-## Feedback
-
-Questions about the Ruby language can be asked on the Ruby-Talk mailing list
-(https://www.ruby-lang.org/en/community/mailing-lists) or on websites like
-(https://stackoverflow.com).
-
-Bugs should be reported at https://bugs.ruby-lang.org. Read [HowToReport] for more information.
-
-[HowToReport]: https://bugs.ruby-lang.org/projects/ruby/wiki/HowToReport
-
-## Contributing
-
-See the file [CONTRIBUTING.md](CONTRIBUTING.md)
-
-## The Author
-
-Ruby was originally designed and developed by Yukihiro Matsumoto (Matz) in 1995.
-
-<matz@ruby-lang.org>
diff --git a/ToDo b/ToDo
new file mode 100644
index 0000000000..b55e399edf
--- /dev/null
+++ b/ToDo
@@ -0,0 +1,126 @@
+Language Spec.
+
+- Class#allocate - basicNew
+- class Foo::Bar<Baz .. end, module Boo::Bar .. end
+* operator !! for rescue. ???
+* objectify characters
+* ../... outside condition invokes operator method too.
+* ... inside condition turns off just before right condition.???
+* package or access control for global variables??
+* named arguments like foo(nation:="german") or foo(nation: "german").
+* method to retrieve argument information (needs new C API)
+* multiple return values, yield values. maybe incompatible ???
+* cascading method invocation ???
+* def Class#method .. end ??
+* def Foo::Bar::baz() .. end ??
+* I18N (or M17N) script/string/regexp
+* Fixnum 0 as false ????
+* discourage use of symbol variables (e.g. $/, etc.) in manual
+* discourage use of Perlish features by giving warnings.
+* non confusing in-block local variable (is it possible?)
+ + remove scope by block
+ + variables appears within block may have independent values.
+* Regexp: make /o thread safe.
+* decide whether begin with rescue or ensure make do..while loop.
+* a +1 to be a+1, not a(+1).
+* unify == and eql? again
+* to_i returns nil if str contains no digit.
+* raise exception by `` error
+* jar like combined library package. -> RubyGems?
+* resumable Exception via Exception#resume.
+* method combination, e.g. before, after, around, etc.
+* .. or something like defadvice in Emacs.
+* property - for methods, or for objects in general.
+* "in" modifier, to annotate, or to encourage assertion.
+* selector namespace - something like generic-flet in CLOS, to help RubyBehavior
+* private instance variable (as in Python?) @_foo in class Foo => @_Foo_foo
+* warn/error "bare word" method, like "foo", you should type "foo()"
+* clarify evaluation order of operator argument (=~, .., ...)
+* :symbol => value hash in the form of {symbol: value, ...} ??
+
+Hacking Interpreter
+
+- generational GC
+* non-blocking open (e.g. for named pipe) for thread
+* avoid blocking with gethostbyname/gethostbyaddr (use fork ???)
+* objectify interpreters ???
+* remove rb_eval() recursions
+* syntax tree -> bytecode ???
+* scrambled script, or script filter
+* setuid ruby
+* performance tune for in-block (dynamic) local variables.
+* give warnings to assign magic variables.
+* export rb_io_{addstr,printf,puts,print}
+* autoload should work with threads [ruby-talk:4589]
+* remove stdio dependency from IOs.
+* warn for inconsistent local variable usage (lv m and method m at the same time).
+* MicroRuby
+* Built-in Interactive Ruby.
+* Parser API
+* trap every method invocation, which can be enabled by e.g. trap_call :method.
+* unify Errno exceptions of same errno, or new exception comparison scheme.
+* 2.times{|i| if i==0 then a = 15 else puts eval("a") end} should print nil.
+* Thread#max_stack_size attribute (possible??)
+
+Standard Libraries
+
+- Module#define_method which takes a name and a body (block, proc or method).
+- Enume#inject
+- Array#fetch
+- IO::for_fd
+- Process::waitall [ruby-talk:4557]
+- Process::Status
+- File::lchown, File::lchmod; xxx - still need work for non existing platforms
+- move Time::times to Process.
+- Enumerable#sort_by for Schwartzian transformation
+- fork_and_kill_other_threads.
+- signal list (Signal::trap, Signal::list).
+- move NameError under StandardError.
+- Integer#to_s(base)
+- Hash::new{default}
+- hash etc. should handle self referenceing array/hash
+- Array#select(n1,n2...) works like Array#indexes(n1,n2...)
+- use Mersenne Twister RNG for random.
+- deprecate Array#indexes, and Array#indices.
+- remove dependency on MAXPATHLEN.
+* String#scanf(?)
+* Object#fmt(?)
+* Time::strptime
+* Integer[num], Float[num]; Fixnum[num]?
+* method to retrieve non-number trailer for to_i/to_f.
+* Stream or Port, abstract superclass of IO ?
+* String#{pred,prev}, String#downto
+* optional stepsize argument for succ()
+* Ruby module -- Ruby::Version, Ruby::Interpreter
+* introduce Boolean class; super of TrueClass, FalseClass
+* synchronized method - synchronized{...}, synchronized :foo, :bar
+* Array#&, Array#| to allow duplication. ???
+* way to specify immortal (fork endurance) thread;
+* or raise ForkException to every thread but fork caller.
+* new user-defined marshal scheme. _dump(dumper), _load(restorer)
+* library to load per-user profile seeking .ruby_profile or ruby.ini file.
+* warning framework (warn, warning for Ruby level)
+* marshal should not depend on sprintf (works bad with locale).
+* ternary arg pow: a.pow(b,c) == a**b%c
+* new caller(), e.g. call_stack; needs better name.
+* pointer share mechanism similar to one in String for Array.
+* require "1.6" etc. by /usr/lib/ruby/1.6/1.6.rb ;-)
+* save both "feature names" and "normalized path" in $"
+* implement Mutex_m (or MutexMixin) using Mutex.
+
+Extension Libraries
+
+* ptk.rb pTk wrapper that is compatible to tk.rb
+* Berkeley DB extension
+* BitVector
+* thread-safe fcgi
+
+Ruby Libraries
+
+* urllib.rb, nttplib.rb, etc.
+* format like perl's
+
+Tools
+
+* freeze or undump to bundle everything
+* bundle using zlib
diff --git a/aclocal.m4 b/aclocal.m4
deleted file mode 100644
index ed7d14ef63..0000000000
--- a/aclocal.m4
+++ /dev/null
@@ -1,47 +0,0 @@
-# generated automatically by aclocal 1.16.1 -*- Autoconf -*-
-
-# Copyright (C) 1996-2018 Free Software Foundation, Inc.
-
-# This file is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# This program is distributed in the hope that it will be useful,
-# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
-# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
-# PARTICULAR PURPOSE.
-
-m4_ifndef([AC_CONFIG_MACRO_DIRS], [m4_defun([_AM_CONFIG_MACRO_DIRS], [])m4_defun([AC_CONFIG_MACRO_DIRS], [_AM_CONFIG_MACRO_DIRS($@)])])
-m4_include([tool/m4/_colorize_result_prepare.m4])
-m4_include([tool/m4/ac_msg_result.m4])
-m4_include([tool/m4/colorize_result.m4])
-m4_include([tool/m4/ruby_append_option.m4])
-m4_include([tool/m4/ruby_append_options.m4])
-m4_include([tool/m4/ruby_check_builtin_func.m4])
-m4_include([tool/m4/ruby_check_builtin_setjmp.m4])
-m4_include([tool/m4/ruby_check_printf_prefix.m4])
-m4_include([tool/m4/ruby_check_setjmp.m4])
-m4_include([tool/m4/ruby_check_signedness.m4])
-m4_include([tool/m4/ruby_check_sizeof.m4])
-m4_include([tool/m4/ruby_check_sysconf.m4])
-m4_include([tool/m4/ruby_cppoutfile.m4])
-m4_include([tool/m4/ruby_decl_attribute.m4])
-m4_include([tool/m4/ruby_default_arch.m4])
-m4_include([tool/m4/ruby_define_if.m4])
-m4_include([tool/m4/ruby_defint.m4])
-m4_include([tool/m4/ruby_dtrace_available.m4])
-m4_include([tool/m4/ruby_dtrace_postprocess.m4])
-m4_include([tool/m4/ruby_func_attribute.m4])
-m4_include([tool/m4/ruby_mingw32.m4])
-m4_include([tool/m4/ruby_prepend_option.m4])
-m4_include([tool/m4/ruby_prog_gnu_ld.m4])
-m4_include([tool/m4/ruby_replace_funcs.m4])
-m4_include([tool/m4/ruby_replace_type.m4])
-m4_include([tool/m4/ruby_rm_recursive.m4])
-m4_include([tool/m4/ruby_setjmp_type.m4])
-m4_include([tool/m4/ruby_stack_grow_direction.m4])
-m4_include([tool/m4/ruby_try_cflags.m4])
-m4_include([tool/m4/ruby_try_ldflags.m4])
-m4_include([tool/m4/ruby_type_attribute.m4])
-m4_include([tool/m4/ruby_universal_arch.m4])
-m4_include([tool/m4/ruby_werror_flag.m4])
diff --git a/addr2line.c b/addr2line.c
deleted file mode 100644
index 283382f51d..0000000000
--- a/addr2line.c
+++ /dev/null
@@ -1,2665 +0,0 @@
-/**********************************************************************
-
- addr2line.c -
-
- $Author$
-
- Copyright (C) 2010 Shinichiro Hamaji
-
-**********************************************************************/
-
-#if defined(__clang__)
-#pragma clang diagnostic ignored "-Wgnu-empty-initializer"
-#pragma clang diagnostic ignored "-Wgcc-compat"
-#endif
-
-#include "ruby/config.h"
-#include "ruby/defines.h"
-#include "ruby/missing.h"
-#include "addr2line.h"
-
-#include <stdio.h>
-#include <errno.h>
-
-#ifdef HAVE_LIBPROC_H
-#include <libproc.h>
-#endif
-
-#ifdef HAVE_STDBOOL_H
-#include <stdbool.h>
-#else
-#include "missing/stdbool.h"
-#endif
-
-#if defined(USE_ELF) || defined(HAVE_MACH_O_LOADER_H)
-
-#include <fcntl.h>
-#include <limits.h>
-#include <stdio.h>
-#include <stdint.h>
-#include <stdlib.h>
-#include <string.h>
-#include <sys/mman.h>
-#include <sys/types.h>
-#include <sys/stat.h>
-#include <unistd.h>
-
-/* Make alloca work the best possible way. */
-#ifdef __GNUC__
-# ifndef alloca
-# define alloca __builtin_alloca
-# endif
-#else
-# ifdef HAVE_ALLOCA_H
-# include <alloca.h>
-# else
-# ifdef _AIX
-#pragma alloca
-# else
-# ifndef alloca /* predefined by HP cc +Olibcalls */
-void *alloca();
-# endif
-# endif /* AIX */
-# endif /* HAVE_ALLOCA_H */
-#endif /* __GNUC__ */
-
-#ifdef HAVE_DLADDR
-# include <dlfcn.h>
-#endif
-
-#ifdef HAVE_MACH_O_LOADER_H
-# include <crt_externs.h>
-# include <mach-o/fat.h>
-# include <mach-o/loader.h>
-# include <mach-o/nlist.h>
-# include <mach-o/stab.h>
-#endif
-
-#ifdef USE_ELF
-# ifdef __OpenBSD__
-# include <elf_abi.h>
-# else
-# include <elf.h>
-# endif
-
-#ifndef ElfW
-# if SIZEOF_VOIDP == 8
-# define ElfW(x) Elf64##_##x
-# else
-# define ElfW(x) Elf32##_##x
-# endif
-#endif
-#ifndef ELF_ST_TYPE
-# if SIZEOF_VOIDP == 8
-# define ELF_ST_TYPE ELF64_ST_TYPE
-# else
-# define ELF_ST_TYPE ELF32_ST_TYPE
-# endif
-#endif
-#endif
-
-#ifdef SHF_COMPRESSED
-# if defined(ELFCOMPRESS_ZLIB) && defined(HAVE_LIBZ)
- /* FreeBSD 11.0 lacks ELFCOMPRESS_ZLIB */
-# include <zlib.h>
-# define SUPPORT_COMPRESSED_DEBUG_LINE
-# endif
-#else /* compatibility with glibc < 2.22 */
-# define SHF_COMPRESSED 0
-#endif
-
-#ifndef PATH_MAX
-#define PATH_MAX 4096
-#endif
-
-#define DW_LNS_copy 0x01
-#define DW_LNS_advance_pc 0x02
-#define DW_LNS_advance_line 0x03
-#define DW_LNS_set_file 0x04
-#define DW_LNS_set_column 0x05
-#define DW_LNS_negate_stmt 0x06
-#define DW_LNS_set_basic_block 0x07
-#define DW_LNS_const_add_pc 0x08
-#define DW_LNS_fixed_advance_pc 0x09
-#define DW_LNS_set_prologue_end 0x0a /* DWARF3 */
-#define DW_LNS_set_epilogue_begin 0x0b /* DWARF3 */
-#define DW_LNS_set_isa 0x0c /* DWARF3 */
-
-/* Line number extended opcode name. */
-#define DW_LNE_end_sequence 0x01
-#define DW_LNE_set_address 0x02
-#define DW_LNE_define_file 0x03
-#define DW_LNE_set_discriminator 0x04 /* DWARF4 */
-
-PRINTF_ARGS(static int kprintf(const char *fmt, ...), 1, 2);
-
-typedef struct line_info {
- const char *dirname;
- const char *filename;
- const char *path; /* object path */
- int line;
-
- uintptr_t base_addr;
- uintptr_t saddr;
- const char *sname; /* function name */
-
- struct line_info *next;
-} line_info_t;
-
-struct dwarf_section {
- char *ptr;
- size_t size;
- uint64_t flags;
-};
-
-typedef struct obj_info {
- const char *path; /* object path */
- char *mapped;
- size_t mapped_size;
- void *uncompressed;
- uintptr_t base_addr;
- uintptr_t vmaddr;
- struct dwarf_section debug_abbrev;
- struct dwarf_section debug_info;
- struct dwarf_section debug_line;
- struct dwarf_section debug_ranges;
- struct dwarf_section debug_str;
- struct obj_info *next;
-} obj_info_t;
-
-#define DWARF_SECTION_COUNT 5
-
-static struct dwarf_section *
-obj_dwarf_section_at(obj_info_t *obj, int n)
-{
- struct dwarf_section *ary[] = {
- &obj->debug_abbrev,
- &obj->debug_info,
- &obj->debug_line,
- &obj->debug_ranges,
- &obj->debug_str
- };
- if (n < 0 || DWARF_SECTION_COUNT <= n) {
- abort();
- }
- return ary[n];
-}
-
-struct debug_section_definition {
- const char *name;
- struct dwarf_section *dwarf;
-};
-
-/* Avoid consuming stack as this module may be used from signal handler */
-static char binary_filename[PATH_MAX + 1];
-
-static unsigned long
-uleb128(char **p)
-{
- unsigned long r = 0;
- int s = 0;
- for (;;) {
- unsigned char b = *(unsigned char *)(*p)++;
- if (b < 0x80) {
- r += (unsigned long)b << s;
- break;
- }
- r += (b & 0x7f) << s;
- s += 7;
- }
- return r;
-}
-
-static long
-sleb128(char **p)
-{
- long r = 0;
- int s = 0;
- for (;;) {
- unsigned char b = *(unsigned char *)(*p)++;
- if (b < 0x80) {
- if (b & 0x40) {
- r -= (0x80 - b) << s;
- }
- else {
- r += (b & 0x3f) << s;
- }
- break;
- }
- r += (b & 0x7f) << s;
- s += 7;
- }
- return r;
-}
-
-static const char *
-get_nth_dirname(unsigned long dir, char *p)
-{
- if (!dir--) {
- return "";
- }
- while (dir--) {
- while (*p) p++;
- p++;
- if (!*p) {
- kprintf("Unexpected directory number %lu in %s\n",
- dir, binary_filename);
- return "";
- }
- }
- return p;
-}
-
-static void
-fill_filename(int file, char *include_directories, char *filenames, line_info_t *line, obj_info_t *obj)
-{
- int i;
- char *p = filenames;
- char *filename;
- unsigned long dir;
- for (i = 1; i <= file; i++) {
- filename = p;
- if (!*p) {
- /* Need to output binary file name? */
- kprintf("Unexpected file number %d in %s at %tx\n",
- file, binary_filename, filenames - obj->mapped);
- return;
- }
- while (*p) p++;
- p++;
- dir = uleb128(&p);
- /* last modified. */
- uleb128(&p);
- /* size of the file. */
- uleb128(&p);
-
- if (i == file) {
- line->filename = filename;
- line->dirname = get_nth_dirname(dir, include_directories);
- }
- }
-}
-
-static void
-fill_line(int num_traces, void **traces, uintptr_t addr, int file, int line,
- char *include_directories, char *filenames,
- obj_info_t *obj, line_info_t *lines, int offset)
-{
- int i;
- addr += obj->base_addr - obj->vmaddr;
- for (i = offset; i < num_traces; i++) {
- uintptr_t a = (uintptr_t)traces[i];
- /* We assume one line code doesn't result >100 bytes of native code.
- We may want more reliable way eventually... */
- if (addr < a && a < addr + 100) {
- fill_filename(file, include_directories, filenames, &lines[i], obj);
- lines[i].line = line;
- }
- }
-}
-
-struct LineNumberProgramHeader {
- uint64_t unit_length;
- uint16_t version;
- uint8_t format; /* 4 or 8 */
- uint64_t header_length;
- uint8_t minimum_instruction_length;
- uint8_t maximum_operations_per_instruction;
- uint8_t default_is_stmt;
- int8_t line_base;
- uint8_t line_range;
- uint8_t opcode_base;
- /* uint8_t standard_opcode_lengths[opcode_base-1]; */
- const char *include_directories;
- const char *filenames;
- const char *cu_start;
- const char *cu_end;
-};
-
-static int
-parse_debug_line_header(const char **pp, struct LineNumberProgramHeader *header)
-{
- const char *p = *pp;
- header->unit_length = *(uint32_t *)p;
- p += sizeof(uint32_t);
-
- header->format = 4;
- if (header->unit_length == 0xffffffff) {
- header->unit_length = *(uint64_t *)p;
- p += sizeof(uint64_t);
- header->format = 8;
- }
-
- header->cu_end = p + header->unit_length;
-
- header->version = *(uint16_t *)p;
- p += sizeof(uint16_t);
- if (header->version > 4) return -1;
-
- header->header_length = header->format == 4 ? *(uint32_t *)p : *(uint64_t *)p;
- p += header->format;
- header->cu_start = p + header->header_length;
-
- header->minimum_instruction_length = *(uint8_t *)p++;
-
- if (header->version >= 4) {
- /* maximum_operations_per_instruction = *(uint8_t *)p; */
- if (*p != 1) return -1; /* For non-VLIW architectures, this field is 1 */
- p++;
- }
-
- header->default_is_stmt = *(uint8_t *)p++;
- header->line_base = *(int8_t *)p++;
- header->line_range = *(uint8_t *)p++;
- header->opcode_base = *(uint8_t *)p++;
- /* header->standard_opcode_lengths = (uint8_t *)p - 1; */
- p += header->opcode_base - 1;
-
- header->include_directories = p;
-
- /* temporary measure for compress-debug-sections */
- if (p >= header->cu_end) return -1;
-
- /* skip include directories */
- while (*p) {
- p = memchr(p, '\0', header->cu_end - p);
- if (!p) return -1;
- p++;
- }
- p++;
-
- header->filenames = p;
-
- *pp = header->cu_start;
-
- return 0;
-}
-
-static int
-parse_debug_line_cu(int num_traces, void **traces, char **debug_line,
- obj_info_t *obj, line_info_t *lines, int offset)
-{
- const char *p = (const char *)*debug_line;
- struct LineNumberProgramHeader header;
-
- /* The registers. */
- unsigned long addr = 0;
- unsigned int file = 1;
- unsigned int line = 1;
- /* unsigned int column = 0; */
- int is_stmt;
- /* int basic_block = 0; */
- /* int end_sequence = 0; */
- /* int prologue_end = 0; */
- /* int epilogue_begin = 0; */
- /* unsigned int isa = 0; */
-
- if (parse_debug_line_header(&p, &header))
- return -1;
- is_stmt = header.default_is_stmt;
-
-#define FILL_LINE() \
- do { \
- fill_line(num_traces, traces, addr, file, line, \
- (char *)header.include_directories, \
- (char *)header.filenames, \
- obj, lines, offset); \
- /*basic_block = prologue_end = epilogue_begin = 0;*/ \
- } while (0)
-
- while (p < header.cu_end) {
- unsigned long a;
- unsigned char op = *p++;
- switch (op) {
- case DW_LNS_copy:
- FILL_LINE();
- break;
- case DW_LNS_advance_pc:
- a = uleb128((char **)&p);
- addr += a;
- break;
- case DW_LNS_advance_line: {
- long a = sleb128((char **)&p);
- line += a;
- break;
- }
- case DW_LNS_set_file:
- file = (unsigned int)uleb128((char **)&p);
- break;
- case DW_LNS_set_column:
- /*column = (unsigned int)*/(void)uleb128((char **)&p);
- break;
- case DW_LNS_negate_stmt:
- is_stmt = !is_stmt;
- break;
- case DW_LNS_set_basic_block:
- /*basic_block = 1; */
- break;
- case DW_LNS_const_add_pc:
- a = ((255UL - header.opcode_base) / header.line_range) *
- header.minimum_instruction_length;
- addr += a;
- break;
- case DW_LNS_fixed_advance_pc:
- a = *(unsigned char *)p++;
- addr += a;
- break;
- case DW_LNS_set_prologue_end:
- /* prologue_end = 1; */
- break;
- case DW_LNS_set_epilogue_begin:
- /* epilogue_begin = 1; */
- break;
- case DW_LNS_set_isa:
- /* isa = (unsigned int)*/(void)uleb128((char **)&p);
- break;
- case 0:
- a = *(unsigned char *)p++;
- op = *p++;
- switch (op) {
- case DW_LNE_end_sequence:
- /* end_sequence = 1; */
- FILL_LINE();
- addr = 0;
- file = 1;
- line = 1;
- /* column = 0; */
- is_stmt = header.default_is_stmt;
- /* end_sequence = 0; */
- /* isa = 0; */
- break;
- case DW_LNE_set_address:
- addr = *(unsigned long *)p;
- p += sizeof(unsigned long);
- break;
- case DW_LNE_define_file:
- kprintf("Unsupported operation in %s\n",
- binary_filename);
- break;
- case DW_LNE_set_discriminator:
- /* TODO:currently ignore */
- uleb128((char **)&p);
- break;
- default:
- kprintf("Unknown extended opcode: %d in %s\n",
- op, binary_filename);
- }
- break;
- default: {
- uint8_t adjusted_opcode = op - header.opcode_base;
- uint8_t operation_advance = adjusted_opcode / header.line_range;
- /* NOTE: this code doesn't support VLIW */
- addr += operation_advance * header.minimum_instruction_length;
- line += header.line_base + (adjusted_opcode % header.line_range);
- FILL_LINE();
- }
- }
- }
- *debug_line = (char *)p;
- return 0;
-}
-
-static int
-parse_debug_line(int num_traces, void **traces,
- char *debug_line, unsigned long size,
- obj_info_t *obj, line_info_t *lines, int offset)
-{
- char *debug_line_end = debug_line + size;
- while (debug_line < debug_line_end) {
- if (parse_debug_line_cu(num_traces, traces, &debug_line, obj, lines, offset))
- return -1;
- }
- if (debug_line != debug_line_end) {
- kprintf("Unexpected size of .debug_line in %s\n",
- binary_filename);
- }
- return 0;
-}
-
-/* read file and fill lines */
-static uintptr_t
-fill_lines(int num_traces, void **traces, int check_debuglink,
- obj_info_t **objp, line_info_t *lines, int offset);
-
-static void
-append_obj(obj_info_t **objp)
-{
- obj_info_t *newobj = calloc(1, sizeof(obj_info_t));
- if (*objp) (*objp)->next = newobj;
- *objp = newobj;
-}
-
-#ifdef USE_ELF
-static void
-follow_debuglink(const char *debuglink, int num_traces, void **traces,
- obj_info_t **objp, line_info_t *lines, int offset)
-{
- /* Ideally we should check 4 paths to follow gnu_debuglink,
- but we handle only one case for now as this format is used
- by some linux distributions. See GDB's info for detail. */
- static const char global_debug_dir[] = "/usr/lib/debug";
- const size_t global_debug_dir_len = sizeof(global_debug_dir) - 1;
- char *p;
- obj_info_t *o1 = *objp, *o2;
- size_t len;
-
- p = strrchr(binary_filename, '/');
- if (!p) {
- return;
- }
- p[1] = '\0';
-
- len = strlen(binary_filename);
- if (len >= PATH_MAX - global_debug_dir_len)
- len = PATH_MAX - global_debug_dir_len - 1;
- memmove(binary_filename + global_debug_dir_len, binary_filename, len);
- memcpy(binary_filename, global_debug_dir, global_debug_dir_len);
- len += global_debug_dir_len;
- strlcpy(binary_filename + len, debuglink, PATH_MAX - len);
-
- append_obj(objp);
- o2 = *objp;
- o2->base_addr = o1->base_addr;
- o2->path = o1->path;
- fill_lines(num_traces, traces, 0, objp, lines, offset);
-}
-#endif
-
-enum
-{
- DW_TAG_compile_unit = 0x11,
- DW_TAG_inlined_subroutine = 0x1d,
- DW_TAG_subprogram = 0x2e,
-};
-
-/* Attributes encodings */
-enum
-{
- DW_AT_sibling = 0x01,
- DW_AT_location = 0x02,
- DW_AT_name = 0x03,
- /* Reserved 0x04 */
- /* Reserved 0x05 */
- /* Reserved 0x06 */
- /* Reserved 0x07 */
- /* Reserved 0x08 */
- DW_AT_ordering = 0x09,
- /* Reserved 0x0a */
- DW_AT_byte_size = 0x0b,
- /* Reserved 0x0c */
- DW_AT_bit_size = 0x0d,
- /* Reserved 0x0e */
- /* Reserved 0x0f */
- DW_AT_stmt_list = 0x10,
- DW_AT_low_pc = 0x11,
- DW_AT_high_pc = 0x12,
- DW_AT_language = 0x13,
- /* Reserved 0x14 */
- DW_AT_discr = 0x15,
- DW_AT_discr_value = 0x16,
- DW_AT_visibility = 0x17,
- DW_AT_import = 0x18,
- DW_AT_string_length = 0x19,
- DW_AT_common_reference = 0x1a,
- DW_AT_comp_dir = 0x1b,
- DW_AT_const_value = 0x1c,
- DW_AT_containing_type = 0x1d,
- DW_AT_default_value = 0x1e,
- /* Reserved 0x1f */
- DW_AT_inline = 0x20,
- DW_AT_is_optional = 0x21,
- DW_AT_lower_bound = 0x22,
- /* Reserved 0x23 */
- /* Reserved 0x24 */
- DW_AT_producer = 0x25,
- /* Reserved 0x26 */
- DW_AT_prototyped = 0x27,
- /* Reserved 0x28 */
- /* Reserved 0x29 */
- DW_AT_return_addr = 0x2a,
- /* Reserved 0x2b */
- DW_AT_start_scope = 0x2c,
- /* Reserved 0x2d */
- DW_AT_bit_stride = 0x2e,
- DW_AT_upper_bound = 0x2f,
- /* Reserved 0x30 */
- DW_AT_abstract_origin = 0x31,
- DW_AT_accessibility = 0x32,
- DW_AT_address_class = 0x33,
- DW_AT_artificial = 0x34,
- DW_AT_base_types = 0x35,
- DW_AT_calling_convention = 0x36,
- DW_AT_count = 0x37,
- DW_AT_data_member_location = 0x38,
- DW_AT_decl_column = 0x39,
- DW_AT_decl_file = 0x3a,
- DW_AT_decl_line = 0x3b,
- DW_AT_declaration = 0x3c,
- DW_AT_discr_list = 0x3d,
- DW_AT_encoding = 0x3e,
- DW_AT_external = 0x3f,
- DW_AT_frame_base = 0x40,
- DW_AT_friend = 0x41,
- DW_AT_identifier_case = 0x42,
- /* Reserved 0x43 */
- DW_AT_namelist_item = 0x44,
- DW_AT_priority = 0x45,
- DW_AT_segment = 0x46,
- DW_AT_specification = 0x47,
- DW_AT_static_link = 0x48,
- DW_AT_type = 0x49,
- DW_AT_use_location = 0x4a,
- DW_AT_variable_parameter = 0x4b,
- DW_AT_virtuality = 0x4c,
- DW_AT_vtable_elem_location = 0x4d,
- DW_AT_allocated = 0x4e,
- DW_AT_associated = 0x4f,
- DW_AT_data_location = 0x50,
- DW_AT_byte_stride = 0x51,
- DW_AT_entry_pc = 0x52,
- DW_AT_use_UTF8 = 0x53,
- DW_AT_extension = 0x54,
- DW_AT_ranges = 0x55,
- DW_AT_trampoline = 0x56,
- DW_AT_call_column = 0x57,
- DW_AT_call_file = 0x58,
- DW_AT_call_line = 0x59,
- DW_AT_description = 0x5a,
- DW_AT_binary_scale = 0x5b,
- DW_AT_decimal_scale = 0x5c,
- DW_AT_small = 0x5d,
- DW_AT_decimal_sign = 0x5e,
- DW_AT_digit_count = 0x5f,
- DW_AT_picture_string = 0x60,
- DW_AT_mutable = 0x61,
- DW_AT_threads_scaled = 0x62,
- DW_AT_explicit = 0x63,
- DW_AT_object_pointer = 0x64,
- DW_AT_endianity = 0x65,
- DW_AT_elemental = 0x66,
- DW_AT_pure = 0x67,
- DW_AT_recursive = 0x68,
- DW_AT_signature = 0x69,
- DW_AT_main_subprogram = 0x6a,
- DW_AT_data_bit_offset = 0x6b,
- DW_AT_const_expr = 0x6c,
- DW_AT_enum_class = 0x6d,
- DW_AT_linkage_name = 0x6e,
- DW_AT_string_length_bit_size = 0x6f,
- DW_AT_string_length_byte_size = 0x70,
- DW_AT_rank = 0x71,
- DW_AT_str_offsets_base = 0x72,
- DW_AT_addr_base = 0x73,
- DW_AT_rnglists_base = 0x74,
- /* Reserved 0x75 */
- DW_AT_dwo_name = 0x76,
- DW_AT_reference = 0x77,
- DW_AT_rvalue_reference = 0x78,
- DW_AT_macros = 0x79,
- DW_AT_call_all_calls = 0x7a,
- DW_AT_call_all_source_calls = 0x7b,
- DW_AT_call_all_tail_calls = 0x7c,
- DW_AT_call_return_pc = 0x7d,
- DW_AT_call_value = 0x7e,
- DW_AT_call_origin = 0x7f,
- DW_AT_call_parameter = 0x80,
- DW_AT_call_pc = 0x81,
- DW_AT_call_tail_call = 0x82,
- DW_AT_call_target = 0x83,
- DW_AT_call_target_clobbered = 0x84,
- DW_AT_call_data_location = 0x85,
- DW_AT_call_data_value = 0x86,
- DW_AT_noreturn = 0x87,
- DW_AT_alignment = 0x88,
- DW_AT_export_symbols = 0x89,
- DW_AT_deleted = 0x8a,
- DW_AT_defaulted = 0x8b,
- DW_AT_loclists_base = 0x8c,
- DW_AT_lo_user = 0x2000,
- DW_AT_hi_user = 0x3fff
-};
-
-/* Attribute form encodings */
-enum
-{
- DW_FORM_addr = 0x01,
- /* Reserved 0x02 */
- DW_FORM_block2 = 0x03,
- DW_FORM_block4 = 0x04,
- DW_FORM_data2 = 0x05,
- DW_FORM_data4 = 0x06,
- DW_FORM_data8 = 0x07,
- DW_FORM_string = 0x08,
- DW_FORM_block = 0x09,
- DW_FORM_block1 = 0x0a,
- DW_FORM_data1 = 0x0b,
- DW_FORM_flag = 0x0c,
- DW_FORM_sdata = 0x0d,
- DW_FORM_strp = 0x0e,
- DW_FORM_udata = 0x0f,
- DW_FORM_ref_addr = 0x10,
- DW_FORM_ref1 = 0x11,
- DW_FORM_ref2 = 0x12,
- DW_FORM_ref4 = 0x13,
- DW_FORM_ref8 = 0x14,
- DW_FORM_ref_udata = 0x15,
- DW_FORM_indirect = 0x16,
- DW_FORM_sec_offset = 0x17,
- DW_FORM_exprloc = 0x18,
- DW_FORM_flag_present = 0x19,
- DW_FORM_strx = 0x1a,
- DW_FORM_addrx = 0x1b,
- DW_FORM_ref_sup4 = 0x1c,
- DW_FORM_strp_sup = 0x1d,
- DW_FORM_data16 = 0x1e,
- DW_FORM_line_strp = 0x1f,
- DW_FORM_ref_sig8 = 0x20,
- DW_FORM_implicit_const = 0x21,
- DW_FORM_loclistx = 0x22,
- DW_FORM_rnglistx = 0x23,
- DW_FORM_ref_sup8 = 0x24,
- DW_FORM_strx1 = 0x25,
- DW_FORM_strx2 = 0x26,
- DW_FORM_strx3 = 0x27,
- DW_FORM_strx4 = 0x28,
- DW_FORM_addrx1 = 0x29,
- DW_FORM_addrx2 = 0x2a,
- DW_FORM_addrx3 = 0x2b,
- DW_FORM_addrx4 = 0x2c
-};
-
-enum {
- VAL_none = 0,
- VAL_cstr = 1,
- VAL_data = 2,
- VAL_uint = 3,
- VAL_int = 4
-};
-
-# define ABBREV_TABLE_SIZE 256
-typedef struct {
- obj_info_t *obj;
- char *file;
- char *current_cu;
- uint64_t current_low_pc;
- char *debug_line_cu_end;
- char *debug_line_files;
- char *debug_line_directories;
- char *p;
- char *cu_end;
- char *pend;
- char *q0;
- char *q;
- int format; // 4 or 8
- uint8_t address_size;
- int level;
- char *abbrev_table[ABBREV_TABLE_SIZE];
-} DebugInfoReader;
-
-typedef struct {
- ptrdiff_t pos;
- int tag;
- int has_children;
-} DIE;
-
-typedef struct {
- union {
- char *ptr;
- uint64_t uint64;
- int64_t int64;
- } as;
- uint64_t off;
- uint64_t at;
- uint64_t form;
- size_t size;
- int type;
-} DebugInfoValue;
-
-/* TODO: Big Endian */
-#define MERGE_2INTS(a,b,sz) (((uint64_t)(b)<<sz)|(a))
-
-static uint16_t
-get_uint16(const uint8_t *p)
-{
- return (uint16_t)MERGE_2INTS(p[0],p[1],8);
-}
-
-static uint32_t
-get_uint32(const uint8_t *p)
-{
- return (uint32_t)MERGE_2INTS(get_uint16(p),get_uint16(p+2),16);
-}
-
-static uint64_t
-get_uint64(const uint8_t *p)
-{
- return MERGE_2INTS(get_uint32(p),get_uint32(p+4),32);
-}
-
-static uint8_t
-read_uint8(char **ptr)
-{
- const unsigned char *p = (const unsigned char *)*ptr;
- *ptr = (char *)(p + 1);
- return *p;
-}
-
-static uint16_t
-read_uint16(char **ptr)
-{
- const unsigned char *p = (const unsigned char *)*ptr;
- *ptr = (char *)(p + 2);
- return get_uint16(p);
-}
-
-static uint32_t
-read_uint24(char **ptr)
-{
- const unsigned char *p = (const unsigned char *)*ptr;
- *ptr = (char *)(p + 3);
- return (*p << 16) | get_uint16(p+1);
-}
-
-static uint32_t
-read_uint32(char **ptr)
-{
- const unsigned char *p = (const unsigned char *)*ptr;
- *ptr = (char *)(p + 4);
- return get_uint32(p);
-}
-
-static uint64_t
-read_uint64(char **ptr)
-{
- const unsigned char *p = (const unsigned char *)*ptr;
- *ptr = (char *)(p + 8);
- return get_uint64(p);
-}
-
-static uintptr_t
-read_uintptr(char **ptr)
-{
- const unsigned char *p = (const unsigned char *)*ptr;
- *ptr = (char *)(p + SIZEOF_VOIDP);
-#if SIZEOF_VOIDP == 8
- return get_uint64(p);
-#else
- return get_uint32(p);
-#endif
-}
-
-static uint64_t
-read_uint(DebugInfoReader *reader)
-{
- if (reader->format == 4) {
- return read_uint32(&reader->p);
- } else { /* 64 bit */
- return read_uint64(&reader->p);
- }
-}
-
-static uint64_t
-read_uleb128(DebugInfoReader *reader)
-{
- return uleb128(&reader->p);
-}
-
-static int64_t
-read_sleb128(DebugInfoReader *reader)
-{
- return sleb128(&reader->p);
-}
-
-static void
-debug_info_reader_init(DebugInfoReader *reader, obj_info_t *obj)
-{
- reader->file = obj->mapped;
- reader->obj = obj;
- reader->p = obj->debug_info.ptr;
- reader->pend = obj->debug_info.ptr + obj->debug_info.size;
- reader->debug_line_cu_end = obj->debug_line.ptr;
-}
-
-static void
-di_read_debug_abbrev_cu(DebugInfoReader *reader)
-{
- uint64_t prev = 0;
- char *p = reader->q0;
- for (;;) {
- uint64_t abbrev_number = uleb128(&p);
- if (abbrev_number <= prev) break;
- if (abbrev_number < ABBREV_TABLE_SIZE) {
- reader->abbrev_table[abbrev_number] = p;
- }
- prev = abbrev_number;
- uleb128(&p); /* tag */
- p++; /* has_children */
- /* skip content */
- for (;;) {
- uint64_t at = uleb128(&p);
- uint64_t form = uleb128(&p);
- if (!at && !form) break;
- }
- }
-}
-
-static int
-di_read_debug_line_cu(DebugInfoReader *reader)
-{
- const char *p;
- struct LineNumberProgramHeader header;
-
- p = (const char *)reader->debug_line_cu_end;
- if (parse_debug_line_header(&p, &header))
- return -1;
-
- reader->debug_line_cu_end = (char *)header.cu_end;
- reader->debug_line_directories = (char *)header.include_directories;
- reader->debug_line_files = (char *)header.filenames;
-
- return 0;
-}
-
-static void
-set_uint_value(DebugInfoValue *v, uint64_t n)
-{
- v->as.uint64 = n;
- v->type = VAL_uint;
-}
-
-static void
-set_int_value(DebugInfoValue *v, int64_t n)
-{
- v->as.int64 = n;
- v->type = VAL_int;
-}
-
-static void
-set_cstr_value(DebugInfoValue *v, char *s)
-{
- v->as.ptr = s;
- v->off = 0;
- v->type = VAL_cstr;
-}
-
-static void
-set_cstrp_value(DebugInfoValue *v, char *s, uint64_t off)
-{
- v->as.ptr = s;
- v->off = off;
- v->type = VAL_cstr;
-}
-
-static void
-set_data_value(DebugInfoValue *v, char *s)
-{
- v->as.ptr = s;
- v->type = VAL_data;
-}
-
-static const char *
-get_cstr_value(DebugInfoValue *v)
-{
- if (v->as.ptr) {
- return v->as.ptr + v->off;
- } else {
- return NULL;
- }
-}
-
-static void
-debug_info_reader_read_value(DebugInfoReader *reader, uint64_t form, DebugInfoValue *v)
-{
- switch (form) {
- case DW_FORM_addr:
- if (reader->address_size == 4) {
- set_uint_value(v, read_uint32(&reader->p));
- } else if (reader->address_size == 8) {
- set_uint_value(v, read_uint64(&reader->p));
- } else {
- fprintf(stderr,"unknown address_size:%d", reader->address_size);
- abort();
- }
- break;
- case DW_FORM_block2:
- v->size = read_uint16(&reader->p);
- set_data_value(v, reader->p);
- reader->p += v->size;
- break;
- case DW_FORM_block4:
- v->size = read_uint32(&reader->p);
- set_data_value(v, reader->p);
- reader->p += v->size;
- break;
- case DW_FORM_data2:
- set_uint_value(v, read_uint16(&reader->p));
- break;
- case DW_FORM_data4:
- set_uint_value(v, read_uint32(&reader->p));
- break;
- case DW_FORM_data8:
- set_uint_value(v, read_uint64(&reader->p));
- break;
- case DW_FORM_string:
- v->size = strlen(reader->p);
- set_cstr_value(v, reader->p);
- reader->p += v->size + 1;
- break;
- case DW_FORM_block:
- v->size = uleb128(&reader->p);
- set_data_value(v, reader->p);
- reader->p += v->size;
- break;
- case DW_FORM_block1:
- v->size = read_uint8(&reader->p);
- set_data_value(v, reader->p);
- reader->p += v->size;
- break;
- case DW_FORM_data1:
- set_uint_value(v, read_uint8(&reader->p));
- break;
- case DW_FORM_flag:
- set_uint_value(v, read_uint8(&reader->p));
- break;
- case DW_FORM_sdata:
- set_int_value(v, read_sleb128(reader));
- break;
- case DW_FORM_strp:
- set_cstrp_value(v, reader->obj->debug_str.ptr, read_uint(reader));
- break;
- case DW_FORM_udata:
- set_uint_value(v, read_uleb128(reader));
- break;
- case DW_FORM_ref_addr:
- if (reader->address_size == 4) {
- set_uint_value(v, read_uint32(&reader->p));
- } else if (reader->address_size == 8) {
- set_uint_value(v, read_uint64(&reader->p));
- } else {
- fprintf(stderr,"unknown address_size:%d", reader->address_size);
- abort();
- }
- break;
- case DW_FORM_ref1:
- set_uint_value(v, read_uint8(&reader->p));
- break;
- case DW_FORM_ref2:
- set_uint_value(v, read_uint16(&reader->p));
- break;
- case DW_FORM_ref4:
- set_uint_value(v, read_uint32(&reader->p));
- break;
- case DW_FORM_ref8:
- set_uint_value(v, read_uint64(&reader->p));
- break;
- case DW_FORM_ref_udata:
- set_uint_value(v, uleb128(&reader->p));
- break;
- case DW_FORM_indirect:
- /* TODO: read the referred value */
- set_uint_value(v, uleb128(&reader->p));
- break;
- case DW_FORM_sec_offset:
- set_uint_value(v, read_uint(reader)); /* offset */
- /* addrptr: debug_addr */
- /* lineptr: debug_line */
- /* loclist: debug_loclists */
- /* loclistptr: debug_loclists */
- /* macptr: debug_macro */
- /* rnglist: debug_rnglists */
- /* rnglistptr: debug_rnglists */
- /* stroffsetsptr: debug_str_offsets */
- break;
- case DW_FORM_exprloc:
- v->size = (size_t)read_uleb128(reader);
- set_data_value(v, reader->p);
- reader->p += v->size;
- break;
- case DW_FORM_flag_present:
- set_uint_value(v, 1);
- break;
- case DW_FORM_strx:
- set_uint_value(v, uleb128(&reader->p));
- break;
- case DW_FORM_addrx:
- /* TODO: read .debug_addr */
- set_uint_value(v, uleb128(&reader->p));
- break;
- case DW_FORM_ref_sup4:
- set_uint_value(v, read_uint32(&reader->p));
- break;
- case DW_FORM_strp_sup:
- set_uint_value(v, read_uint(reader));
- /* *p = reader->sup_file + reader->sup_str->sh_offset + ret; */
- break;
- case DW_FORM_data16:
- v->size = 16;
- set_data_value(v, reader->p);
- reader->p += v->size;
- break;
- case DW_FORM_line_strp:
- set_uint_value(v, read_uint(reader));
- /* *p = reader->file + reader->line->sh_offset + ret; */
- break;
- case DW_FORM_ref_sig8:
- set_uint_value(v, read_uint64(&reader->p));
- break;
- case DW_FORM_implicit_const:
- set_int_value(v, sleb128(&reader->q));
- break;
- case DW_FORM_loclistx:
- set_uint_value(v, read_uleb128(reader));
- break;
- case DW_FORM_rnglistx:
- set_uint_value(v, read_uleb128(reader));
- break;
- case DW_FORM_ref_sup8:
- set_uint_value(v, read_uint64(&reader->p));
- break;
- case DW_FORM_strx1:
- set_uint_value(v, read_uint8(&reader->p));
- break;
- case DW_FORM_strx2:
- set_uint_value(v, read_uint16(&reader->p));
- break;
- case DW_FORM_strx3:
- set_uint_value(v, read_uint24(&reader->p));
- break;
- case DW_FORM_strx4:
- set_uint_value(v, read_uint32(&reader->p));
- break;
- case DW_FORM_addrx1:
- set_uint_value(v, read_uint8(&reader->p));
- break;
- case DW_FORM_addrx2:
- set_uint_value(v, read_uint16(&reader->p));
- break;
- case DW_FORM_addrx3:
- set_uint_value(v, read_uint24(&reader->p));
- break;
- case DW_FORM_addrx4:
- set_uint_value(v, read_uint32(&reader->p));
- break;
- case 0:
- goto fail;
- break;
- }
- return;
-
- fail:
- fprintf(stderr, "%d: unsupported form: %#"PRIx64"\n", __LINE__, form);
- exit(1);
-}
-
-/* find abbrev in current compilation unit */
-static char *
-di_find_abbrev(DebugInfoReader *reader, uint64_t abbrev_number)
-{
- char *p;
- if (abbrev_number < ABBREV_TABLE_SIZE) {
- return reader->abbrev_table[abbrev_number];
- }
- p = reader->abbrev_table[ABBREV_TABLE_SIZE-1];
- /* skip 255th record */
- uleb128(&p); /* tag */
- p++; /* has_children */
- /* skip content */
- for (;;) {
- uint64_t at = uleb128(&p);
- uint64_t form = uleb128(&p);
- if (!at && !form) break;
- }
- for (uint64_t n = uleb128(&p); abbrev_number != n; n = uleb128(&p)) {
- if (n == 0) {
- fprintf(stderr,"%d: Abbrev Number %"PRId64" not found\n",__LINE__, abbrev_number);
- exit(1);
- }
- uleb128(&p); /* tag */
- p++; /* has_children */
- /* skip content */
- for (;;) {
- uint64_t at = uleb128(&p);
- uint64_t form = uleb128(&p);
- if (!at && !form) break;
- }
- }
- return p;
-}
-
-#if 0
-static void
-hexdump0(const unsigned char *p, size_t n)
-{
- size_t i;
- fprintf(stderr, " 0 1 2 3 4 5 6 7 8 9 A B C D E F\n");
- for (i=0; i < n; i++){
- switch (i & 15) {
- case 0:
- fprintf(stderr, "%02zd: %02X ", i/16, p[i]);
- break;
- case 15:
- fprintf(stderr, "%02X\n", p[i]);
- break;
- default:
- fprintf(stderr, "%02X ", p[i]);
- break;
- }
- }
- if ((i & 15) != 15) {
- fprintf(stderr, "\n");
- }
-}
-#define hexdump(p,n) hexdump0((const unsigned char *)p, n)
-
-static void
-div_inspect(DebugInfoValue *v)
-{
- switch (v->type) {
- case VAL_uint:
- fprintf(stderr,"%d: type:%d size:%zx v:%lx\n",__LINE__,v->type,v->size,v->as.uint64);
- break;
- case VAL_int:
- fprintf(stderr,"%d: type:%d size:%zx v:%ld\n",__LINE__,v->type,v->size,(int64_t)v->as.uint64);
- break;
- case VAL_cstr:
- fprintf(stderr,"%d: type:%d size:%zx v:'%s'\n",__LINE__,v->type,v->size,v->as.ptr);
- break;
- case VAL_data:
- fprintf(stderr,"%d: type:%d size:%zx v:\n",__LINE__,v->type,v->size);
- hexdump(v->as.ptr, 16);
- break;
- }
-}
-#endif
-
-static DIE *
-di_read_die(DebugInfoReader *reader, DIE *die)
-{
- uint64_t abbrev_number = uleb128(&reader->p);
- if (abbrev_number == 0) {
- reader->level--;
- return NULL;
- }
-
- reader->q = di_find_abbrev(reader, abbrev_number);
-
- die->pos = reader->p - reader->obj->debug_info.ptr - 1;
- die->tag = (int)uleb128(&reader->q); /* tag */
- die->has_children = *reader->q++; /* has_children */
- if (die->has_children) {
- reader->level++;
- }
- return die;
-}
-
-static DebugInfoValue *
-di_read_record(DebugInfoReader *reader, DebugInfoValue *vp)
-{
- uint64_t at = uleb128(&reader->q);
- uint64_t form = uleb128(&reader->q);
- if (!at || !form) return NULL;
- vp->at = at;
- vp->form = form;
- debug_info_reader_read_value(reader, form, vp);
- return vp;
-}
-
-static void
-di_skip_records(DebugInfoReader *reader)
-{
- for (;;) {
- DebugInfoValue v = {{}};
- uint64_t at = uleb128(&reader->q);
- uint64_t form = uleb128(&reader->q);
- if (!at || !form) return;
- debug_info_reader_read_value(reader, form, &v);
- }
-}
-
-typedef struct {
- uint64_t low_pc;
- uint64_t high_pc;
- uint64_t ranges;
- bool low_pc_set;
- bool high_pc_set;
- bool ranges_set;
-} ranges_t;
-
-static void
-ranges_set(ranges_t *ptr, DebugInfoValue *v)
-{
- switch (v->at) {
- case DW_AT_low_pc:
- ptr->low_pc = v->as.uint64;
- ptr->low_pc_set = true;
- break;
- case DW_AT_high_pc:
- if (v->form == DW_FORM_addr) {
- ptr->high_pc = v->as.uint64;
- }
- else {
- ptr->high_pc = ptr->low_pc + v->as.uint64;
- }
- ptr->high_pc_set = true;
- break;
- case DW_AT_ranges:
- ptr->ranges = v->as.uint64;
- ptr->ranges_set = true;
- break;
- }
-}
-
-static uintptr_t
-ranges_include(DebugInfoReader *reader, ranges_t *ptr, uint64_t addr)
-{
- if (ptr->high_pc_set) {
- if (ptr->ranges_set || !ptr->low_pc_set) {
- exit(1);
- }
- if (ptr->low_pc <= addr && addr <= ptr->high_pc) {
- return (uintptr_t)ptr->low_pc;
- }
- }
- else if (ptr->ranges_set) {
- /* TODO: support base address selection entry */
- char *p = reader->obj->debug_ranges.ptr + ptr->ranges;
- uint64_t base = ptr->low_pc_set ? ptr->low_pc : reader->current_low_pc;
- for (;;) {
- uintptr_t from = read_uintptr(&p);
- uintptr_t to = read_uintptr(&p);
- if (!from && !to) break;
- if (from == UINTPTR_MAX) {
- /* base address selection entry */
- base = to;
- }
- else if (base + from <= addr && addr < base + to) {
- return from;
- }
- }
- }
- else if (ptr->low_pc_set) {
- if (ptr->low_pc == addr) {
- return (uintptr_t)ptr->low_pc;
- }
- }
- return false;
-}
-
-#if 0
-static void
-ranges_inspect(DebugInfoReader *reader, ranges_t *ptr)
-{
- if (ptr->high_pc_set) {
- if (ptr->ranges_set || !ptr->low_pc_set) {
- fprintf(stderr,"low_pc_set:%d high_pc_set:%d ranges_set:%d\n",ptr->low_pc_set,ptr->high_pc_set,ptr->ranges_set);
- exit(1);
- }
- fprintf(stderr,"low_pc:%"PRIx64" high_pc:%"PRIx64"\n",ptr->low_pc,ptr->high_pc);
- }
- else if (ptr->ranges_set) {
- char *p = reader->obj->debug_ranges.ptr + ptr->ranges;
- fprintf(stderr,"low_pc:%"PRIx64" ranges:%"PRIx64" %lx ",ptr->low_pc,ptr->ranges, p-reader->obj->mapped);
- for (;;) {
- uintptr_t from = read_uintptr(&p);
- uintptr_t to = read_uintptr(&p);
- if (!from && !to) break;
- fprintf(stderr,"%"PRIx64"-%"PRIx64" ",ptr->low_pc+from,ptr->low_pc+to);
- }
- fprintf(stderr,"\n");
- }
- else if (ptr->low_pc_set) {
- fprintf(stderr,"low_pc:%"PRIx64"\n",ptr->low_pc);
- }
- else {
- fprintf(stderr,"empty\n");
- }
-}
-#endif
-
-static int
-di_read_cu(DebugInfoReader *reader)
-{
- uint64_t unit_length;
- uint16_t version;
- uint64_t debug_abbrev_offset;
- reader->format = 4;
- reader->current_cu = reader->p;
- unit_length = read_uint32(&reader->p);
- if (unit_length == 0xffffffff) {
- unit_length = read_uint64(&reader->p);
- reader->format = 8;
- }
- reader->cu_end = reader->p + unit_length;
- version = read_uint16(&reader->p);
- if (version > 5) {
- return -1;
- }
- else if (version == 5) {
- /* unit_type = */ read_uint8(&reader->p);
- reader->address_size = read_uint8(&reader->p);
- debug_abbrev_offset = read_uint(reader);
- }
- else {
- debug_abbrev_offset = read_uint(reader);
- reader->address_size = read_uint8(&reader->p);
- }
- reader->q0 = reader->obj->debug_abbrev.ptr + debug_abbrev_offset;
-
- reader->level = 0;
- di_read_debug_abbrev_cu(reader);
- if (di_read_debug_line_cu(reader)) return -1;
-
-#if defined(__GNUC__) && !defined(__clang__) && !defined(__INTEL_COMPILER_BUILD_DATE)
- /* Though DWARF specifies "the applicable base address defaults to the base
- address of the compilation unit", but GCC seems to use zero as default */
-#else
- do {
- DIE die;
-
- if (!di_read_die(reader, &die)) continue;
-
- if (die.tag != DW_TAG_compile_unit) {
- di_skip_records(reader);
- break;
- }
-
- /* enumerate abbrev */
- for (;;) {
- DebugInfoValue v = {{}};
- if (!di_read_record(reader, &v)) break;
- switch (v.at) {
- case DW_AT_low_pc:
- reader->current_low_pc = v.as.uint64;
- break;
- }
- }
- } while (0);
-#endif
- return 0;
-}
-
-static void
-read_abstract_origin(DebugInfoReader *reader, uint64_t abstract_origin, line_info_t *line)
-{
- char *p = reader->p;
- char *q = reader->q;
- int level = reader->level;
- DIE die;
-
- reader->p = reader->current_cu + abstract_origin;
- if (!di_read_die(reader, &die)) goto finish;
-
- /* enumerate abbrev */
- for (;;) {
- DebugInfoValue v = {{}};
- if (!di_read_record(reader, &v)) break;
- switch (v.at) {
- case DW_AT_name:
- line->sname = get_cstr_value(&v);
- break;
- }
- }
-
- finish:
- reader->p = p;
- reader->q = q;
- reader->level = level;
-}
-
-static void
-debug_info_read(DebugInfoReader *reader, int num_traces, void **traces,
- line_info_t *lines, int offset) {
- while (reader->p < reader->cu_end) {
- DIE die;
- ranges_t ranges = {};
- line_info_t line = {};
-
- if (!di_read_die(reader, &die)) continue;
- /* fprintf(stderr,"%d:%tx: <%d>\n",__LINE__,die.pos,reader->level,die.tag); */
-
- if (die.tag != DW_TAG_subprogram && die.tag != DW_TAG_inlined_subroutine) {
- skip_die:
- di_skip_records(reader);
- continue;
- }
-
- /* enumerate abbrev */
- for (;;) {
- DebugInfoValue v = {{}};
- /* ptrdiff_t pos = reader->p - reader->p0; */
- if (!di_read_record(reader, &v)) break;
- /* fprintf(stderr,"\n%d:%tx: AT:%lx FORM:%lx\n",__LINE__,pos,v.at,v.form); */
- /* div_inspect(&v); */
- switch (v.at) {
- case DW_AT_name:
- line.sname = get_cstr_value(&v);
- break;
- case DW_AT_call_file:
- fill_filename((int)v.as.uint64, reader->debug_line_directories, reader->debug_line_files, &line, reader->obj);
- break;
- case DW_AT_call_line:
- line.line = (int)v.as.uint64;
- break;
- case DW_AT_low_pc:
- case DW_AT_high_pc:
- case DW_AT_ranges:
- ranges_set(&ranges, &v);
- break;
- case DW_AT_declaration:
- goto skip_die;
- case DW_AT_inline:
- /* 1 or 3 */
- break; /* goto skip_die; */
- case DW_AT_abstract_origin:
- read_abstract_origin(reader, v.as.uint64, &line);
- break; /* goto skip_die; */
- }
- }
- /* ranges_inspect(reader, &ranges); */
- /* fprintf(stderr,"%d:%tx: %x ",__LINE__,diepos,die.tag); */
- for (int i=offset; i < num_traces; i++) {
- uintptr_t addr = (uintptr_t)traces[i];
- uintptr_t offset = addr - reader->obj->base_addr + reader->obj->vmaddr;
- uintptr_t saddr = ranges_include(reader, &ranges, offset);
- if (saddr) {
- /* fprintf(stderr, "%d:%tx: %d %lx->%lx %x %s: %s/%s %d %s %s %s\n",__LINE__,die.pos, i,addr,offset, die.tag,line.sname,line.dirname,line.filename,line.line,reader->obj->path,line.sname,lines[i].sname); */
- if (lines[i].sname) {
- line_info_t *lp = malloc(sizeof(line_info_t));
- memcpy(lp, &lines[i], sizeof(line_info_t));
- lines[i].next = lp;
- lp->dirname = line.dirname;
- lp->filename = line.filename;
- lp->line = line.line;
- lp->saddr = 0;
- }
- lines[i].path = reader->obj->path;
- lines[i].base_addr = line.base_addr;
- lines[i].sname = line.sname;
- lines[i].saddr = saddr + reader->obj->base_addr - reader->obj->vmaddr;
- }
- }
- }
-}
-
-#ifdef USE_ELF
-static unsigned long
-uncompress_debug_section(ElfW(Shdr) *shdr, char *file, char **ptr)
-{
- *ptr = NULL;
-#ifdef SUPPORT_COMPRESSED_DEBUG_LINE
- ElfW(Chdr) *chdr = (ElfW(Chdr) *)(file + shdr->sh_offset);
- unsigned long destsize = chdr->ch_size;
- int ret = 0;
-
- if (chdr->ch_type != ELFCOMPRESS_ZLIB) {
- /* unsupported compression type */
- return 0;
- }
-
- *ptr = malloc(destsize);
- if (!*ptr) return 0;
- ret = uncompress((Bytef *)*ptr, &destsize,
- (const Bytef*)chdr + sizeof(ElfW(Chdr)),
- shdr->sh_size - sizeof(ElfW(Chdr)));
- if (ret != Z_OK) goto fail;
- return destsize;
-
-fail:
- free(*ptr);
- *ptr = NULL;
-#endif
- return 0;
-}
-
-/* read file and fill lines */
-static uintptr_t
-fill_lines(int num_traces, void **traces, int check_debuglink,
- obj_info_t **objp, line_info_t *lines, int offset)
-{
- int i, j;
- char *shstr;
- ElfW(Ehdr) *ehdr;
- ElfW(Shdr) *shdr, *shstr_shdr;
- ElfW(Shdr) *gnu_debuglink_shdr = NULL;
- int fd;
- off_t filesize;
- char *file;
- ElfW(Shdr) *symtab_shdr = NULL, *strtab_shdr = NULL;
- ElfW(Shdr) *dynsym_shdr = NULL, *dynstr_shdr = NULL;
- obj_info_t *obj = *objp;
- uintptr_t dladdr_fbase = 0;
-
- fd = open(binary_filename, O_RDONLY);
- if (fd < 0) {
- goto fail;
- }
- filesize = lseek(fd, 0, SEEK_END);
- if (filesize < 0) {
- int e = errno;
- close(fd);
- kprintf("lseek: %s\n", strerror(e));
- goto fail;
- }
-#if SIZEOF_OFF_T > SIZEOF_SIZE_T
- if (filesize > (off_t)SIZE_MAX) {
- close(fd);
- kprintf("Too large file %s\n", binary_filename);
- goto fail;
- }
-#endif
- lseek(fd, 0, SEEK_SET);
- /* async-signal unsafe */
- file = (char *)mmap(NULL, (size_t)filesize, PROT_READ, MAP_SHARED, fd, 0);
- if (file == MAP_FAILED) {
- int e = errno;
- close(fd);
- kprintf("mmap: %s\n", strerror(e));
- goto fail;
- }
- close(fd);
-
- ehdr = (ElfW(Ehdr) *)file;
- if (memcmp(ehdr->e_ident, "\177ELF", 4) != 0) {
- /*
- * Huh? Maybe filename was overridden by setproctitle() and
- * it match non-elf file.
- */
- goto fail;
- }
- obj->mapped = file;
- obj->mapped_size = (size_t)filesize;
-
- shdr = (ElfW(Shdr) *)(file + ehdr->e_shoff);
-
- shstr_shdr = shdr + ehdr->e_shstrndx;
- shstr = file + shstr_shdr->sh_offset;
-
- for (i = 0; i < ehdr->e_shnum; i++) {
- char *section_name = shstr + shdr[i].sh_name;
- switch (shdr[i].sh_type) {
- case SHT_STRTAB:
- if (!strcmp(section_name, ".strtab")) {
- strtab_shdr = shdr + i;
- }
- else if (!strcmp(section_name, ".dynstr")) {
- dynstr_shdr = shdr + i;
- }
- break;
- case SHT_SYMTAB:
- /* if (!strcmp(section_name, ".symtab")) */
- symtab_shdr = shdr + i;
- break;
- case SHT_DYNSYM:
- /* if (!strcmp(section_name, ".dynsym")) */
- dynsym_shdr = shdr + i;
- break;
- case SHT_PROGBITS:
- if (!strcmp(section_name, ".gnu_debuglink")) {
- gnu_debuglink_shdr = shdr + i;
- }
- else {
- const char *debug_section_names[] = {
- ".debug_abbrev",
- ".debug_info",
- ".debug_line",
- ".debug_ranges",
- ".debug_str"
- };
-
- for (j=0; j < DWARF_SECTION_COUNT; j++) {
- struct dwarf_section *s = obj_dwarf_section_at(obj, j);
-
- if (strcmp(section_name, debug_section_names[j]) != 0)
- continue;
-
- s->ptr = file + shdr[i].sh_offset;
- s->size = shdr[i].sh_size;
- s->flags = shdr[i].sh_flags;
- if (s->flags & SHF_COMPRESSED) {
- s->size = uncompress_debug_section(&shdr[i], file, &s->ptr);
- if (!s->size) goto fail;
- }
- break;
- }
- }
- break;
- }
- }
-
- if (offset == -1) {
- /* main executable */
- offset = 0;
- if (dynsym_shdr && dynstr_shdr) {
- char *strtab = file + dynstr_shdr->sh_offset;
- ElfW(Sym) *symtab = (ElfW(Sym) *)(file + dynsym_shdr->sh_offset);
- int symtab_count = (int)(dynsym_shdr->sh_size / sizeof(ElfW(Sym)));
- void *handle = dlopen(NULL, RTLD_NOW|RTLD_LOCAL);
- if (handle) {
- for (j = 0; j < symtab_count; j++) {
- ElfW(Sym) *sym = &symtab[j];
- Dl_info info;
- void *s;
- if (ELF_ST_TYPE(sym->st_info) != STT_FUNC || sym->st_size == 0) continue;
- s = dlsym(handle, strtab + sym->st_name);
- if (s && dladdr(s, &info)) {
- obj->base_addr = dladdr_fbase;
- dladdr_fbase = (uintptr_t)info.dli_fbase;
- break;
- }
- }
- dlclose(handle);
- }
- if (ehdr->e_type == ET_EXEC) {
- obj->base_addr = 0;
- }
- else {
- /* PIE (position-independent executable) */
- obj->base_addr = dladdr_fbase;
- }
- }
- }
-
- if (obj->debug_info.ptr && obj->debug_abbrev.ptr) {
- DebugInfoReader reader;
- debug_info_reader_init(&reader, obj);
- i = 0;
- while (reader.p < reader.pend) {
- /* fprintf(stderr, "%d:%tx: CU[%d]\n", __LINE__, reader.p - reader.obj->debug_info.ptr, i++); */
- if (di_read_cu(&reader)) goto use_symtab;
- debug_info_read(&reader, num_traces, traces, lines, offset);
- }
- }
- else {
- /* This file doesn't have dwarf, use symtab or dynsym */
-use_symtab:
- if (!symtab_shdr) {
- /* This file doesn't have symtab, use dynsym instead */
- symtab_shdr = dynsym_shdr;
- strtab_shdr = dynstr_shdr;
- }
-
- if (symtab_shdr && strtab_shdr) {
- char *strtab = file + strtab_shdr->sh_offset;
- ElfW(Sym) *symtab = (ElfW(Sym) *)(file + symtab_shdr->sh_offset);
- int symtab_count = (int)(symtab_shdr->sh_size / sizeof(ElfW(Sym)));
- for (j = 0; j < symtab_count; j++) {
- ElfW(Sym) *sym = &symtab[j];
- uintptr_t saddr = (uintptr_t)sym->st_value + obj->base_addr;
- if (ELF_ST_TYPE(sym->st_info) != STT_FUNC) continue;
- for (i = offset; i < num_traces; i++) {
- uintptr_t d = (uintptr_t)traces[i] - saddr;
- if (lines[i].line > 0 || d > (uintptr_t)sym->st_size)
- continue;
- /* fill symbol name and addr from .symtab */
- if (!lines[i].sname) lines[i].sname = strtab + sym->st_name;
- lines[i].saddr = saddr;
- lines[i].path = obj->path;
- lines[i].base_addr = obj->base_addr;
- }
- }
- }
- }
-
- if (!obj->debug_line.ptr) {
- /* This file doesn't have .debug_line section,
- let's check .gnu_debuglink section instead. */
- if (gnu_debuglink_shdr && check_debuglink) {
- follow_debuglink(file + gnu_debuglink_shdr->sh_offset,
- num_traces, traces,
- objp, lines, offset);
- }
- goto finish;
- }
-
- if (parse_debug_line(num_traces, traces,
- obj->debug_line.ptr,
- obj->debug_line.size,
- obj, lines, offset) == -1)
- goto fail;
-
-finish:
- return dladdr_fbase;
-fail:
- return (uintptr_t)-1;
-}
-#else /* Mach-O */
-/* read file and fill lines */
-static uintptr_t
-fill_lines(int num_traces, void **traces, int check_debuglink,
- obj_info_t **objp, line_info_t *lines, int offset)
-{
-# ifdef __LP64__
-# define LP(x) x##_64
-# else
-# define LP(x) x
-# endif
- int fd;
- off_t filesize;
- char *file, *p = NULL;
- obj_info_t *obj = *objp;
- struct LP(mach_header) *header;
- uintptr_t dladdr_fbase = 0;
-
- {
- char *s = binary_filename;
- char *base = strrchr(binary_filename, '/')+1;
- size_t max = PATH_MAX;
- size_t size = strlen(binary_filename);
- size_t basesize = size - (base - binary_filename);
- s += size;
- max -= size;
- p = s;
- size = strlcpy(s, ".dSYM/Contents/Resources/DWARF/", max);
- if (size == 0) goto fail;
- s += size;
- max -= size;
- if (max <= basesize) goto fail;
- memcpy(s, base, basesize);
- s[basesize] = 0;
-
- fd = open(binary_filename, O_RDONLY);
- if (fd < 0) {
- *p = 0; /* binary_filename becomes original file name */
- fd = open(binary_filename, O_RDONLY);
- if (fd < 0) {
- goto fail;
- }
- }
- }
-
- filesize = lseek(fd, 0, SEEK_END);
- if (filesize < 0) {
- int e = errno;
- close(fd);
- kprintf("lseek: %s\n", strerror(e));
- goto fail;
- }
-#if SIZEOF_OFF_T > SIZEOF_SIZE_T
- if (filesize > (off_t)SIZE_MAX) {
- close(fd);
- kprintf("Too large file %s\n", binary_filename);
- goto fail;
- }
-#endif
- lseek(fd, 0, SEEK_SET);
- /* async-signal unsafe */
- file = (char *)mmap(NULL, (size_t)filesize, PROT_READ, MAP_SHARED, fd, 0);
- if (file == MAP_FAILED) {
- int e = errno;
- close(fd);
- kprintf("mmap: %s\n", strerror(e));
- goto fail;
- }
- close(fd);
-
- obj->mapped = file;
- obj->mapped_size = (size_t)filesize;
-
- header = (struct LP(mach_header) *)file;
- if (header->magic == LP(MH_MAGIC)) {
- /* non universal binary */
- p = file;
- }
- else if (header->magic == FAT_CIGAM) {
- struct LP(mach_header) *mhp = _NSGetMachExecuteHeader();
- struct fat_header *fat = (struct fat_header *)file;
- char *q = file + sizeof(*fat);
- uint32_t nfat_arch = __builtin_bswap32(fat->nfat_arch);
- /* fprintf(stderr,"%d: fat:%s %d\n",__LINE__, binary_filename,nfat_arch); */
- for (uint32_t i = 0; i < nfat_arch; i++) {
- struct fat_arch *arch = (struct fat_arch *)q;
- cpu_type_t cputype = __builtin_bswap32(arch->cputype);
- cpu_subtype_t cpusubtype = __builtin_bswap32(arch->cpusubtype);
- uint32_t offset = __builtin_bswap32(arch->offset);
- /* fprintf(stderr,"%d: fat %d %x/%x %x/%x\n",__LINE__, i, mhp->cputype,mhp->cpusubtype, cputype,cpusubtype); */
- if (mhp->cputype == cputype &&
- (cpu_subtype_t)(mhp->cpusubtype & ~CPU_SUBTYPE_MASK) == cpusubtype) {
- p = file + offset;
- file = p;
- header = (struct LP(mach_header) *)p;
- if (header->magic == LP(MH_MAGIC)) {
- goto found_mach_header;
- }
- break;
- }
- q += sizeof(*arch);
- }
- kprintf("'%s' is not a Mach-O universal binary file!\n",binary_filename);
- close(fd);
- goto fail;
- }
- else {
- kprintf("'%s' is not a "
-# ifdef __LP64__
- "64"
-# else
- "32"
-# endif
- "-bit Mach-O file!\n",binary_filename);
- close(fd);
- goto fail;
- }
-found_mach_header:
- p += sizeof(*header);
-
- for (uint32_t i = 0; i < (uint32_t)header->ncmds; i++) {
- struct load_command *lcmd = (struct load_command *)p;
- switch (lcmd->cmd) {
- case LP(LC_SEGMENT):
- {
- static const char *debug_section_names[] = {
- "__debug_abbrev",
- "__debug_info",
- "__debug_line",
- "__debug_ranges",
- "__debug_str"
- };
- struct LP(segment_command) *scmd = (struct LP(segment_command) *)lcmd;
- if (strcmp(scmd->segname, "__TEXT") == 0) {
- obj->vmaddr = scmd->vmaddr;
- }
- else if (strcmp(scmd->segname, "__DWARF") == 0) {
- p += sizeof(struct LP(segment_command));
- for (uint64_t i = 0; i < scmd->nsects; i++) {
- struct LP(section) *sect = (struct LP(section) *)p;
- p += sizeof(struct LP(section));
- for (int j=0; j < DWARF_SECTION_COUNT; j++) {
- struct dwarf_section *s = obj_dwarf_section_at(obj, j);
-
- if (strcmp(sect->sectname, debug_section_names[j]) != 0)
- continue;
-
- s->ptr = file + sect->offset;
- s->size = sect->size;
- s->flags = sect->flags;
- if (s->flags & SHF_COMPRESSED) {
- goto fail;
- }
- break;
- }
- }
- }
- }
- break;
-
- case LC_SYMTAB:
- {
- struct symtab_command *cmd = (struct symtab_command *)lcmd;
- struct LP(nlist) *nl = (struct LP(nlist) *)(file + cmd->symoff);
- char *strtab = file + cmd->stroff, *sname = 0;
- uint32_t j;
- uintptr_t saddr = 0;
- /* kprintf("[%2d]: %x/symtab %p\n", i, cmd->cmd, p); */
- for (j = 0; j < cmd->nsyms; j++) {
- uintptr_t symsize, d;
- struct LP(nlist) *e = &nl[j];
- /* kprintf("[%2d][%4d]: %02x/%x/%x: %s %llx\n", i, j, e->n_type,e->n_sect,e->n_desc,strtab+e->n_un.n_strx,e->n_value); */
- if (e->n_type != N_FUN) continue;
- if (e->n_sect) {
- saddr = (uintptr_t)e->n_value + obj->base_addr - obj->vmaddr;
- sname = strtab + e->n_un.n_strx;
- /* kprintf("[%2d][%4d]: %02x/%x/%x: %s %llx\n", i, j, e->n_type,e->n_sect,e->n_desc,strtab+e->n_un.n_strx,e->n_value); */
- continue;
- }
- for (int k = offset; k < num_traces; k++) {
- d = (uintptr_t)traces[k] - saddr;
- symsize = e->n_value;
- /* kprintf("%lx %lx %lx\n",saddr,symsize,traces[k]); */
- if (lines[k].line > 0 || d > (uintptr_t)symsize)
- continue;
- /* fill symbol name and addr from .symtab */
- if (!lines[k].sname) lines[k].sname = sname;
- lines[k].saddr = saddr;
- lines[k].path = obj->path;
- lines[k].base_addr = obj->base_addr;
- }
- }
- }
- }
- p += lcmd->cmdsize;
- }
-
- if (obj->debug_info.ptr && obj->debug_abbrev.ptr) {
- DebugInfoReader reader;
- debug_info_reader_init(&reader, obj);
- while (reader.p < reader.pend) {
- if (di_read_cu(&reader)) goto fail;
- debug_info_read(&reader, num_traces, traces, lines, offset);
- }
- }
-
- if (parse_debug_line(num_traces, traces,
- obj->debug_line.ptr,
- obj->debug_line.size,
- obj, lines, offset) == -1)
- goto fail;
-
- return dladdr_fbase;
-fail:
- return (uintptr_t)-1;
-}
-#endif
-
-#define HAVE_MAIN_EXE_PATH
-#if defined(__FreeBSD__)
-# include <sys/sysctl.h>
-#endif
-/* ssize_t main_exe_path(void)
- *
- * store the path of the main executable to `binary_filename`,
- * and returns strlen(binary_filename).
- * it is NUL terminated.
- */
-#if defined(__linux__)
-static ssize_t
-main_exe_path(void)
-{
-# define PROC_SELF_EXE "/proc/self/exe"
- ssize_t len = readlink(PROC_SELF_EXE, binary_filename, PATH_MAX);
- if (len < 0) return 0;
- binary_filename[len] = 0;
- return len;
-}
-#elif defined(__FreeBSD__)
-static ssize_t
-main_exe_path(void)
-{
- int mib[4] = {CTL_KERN, KERN_PROC, KERN_PROC_PATHNAME, -1};
- size_t len = PATH_MAX;
- int err = sysctl(mib, 4, binary_filename, &len, NULL, 0);
- if (err) {
- kprintf("Can't get the path of ruby");
- return -1;
- }
- len--; /* sysctl sets strlen+1 */
- return len;
-}
-#elif defined(HAVE_LIBPROC_H)
-static ssize_t
-main_exe_path(void)
-{
- int len = proc_pidpath(getpid(), binary_filename, PATH_MAX);
- if (len == 0) return 0;
- binary_filename[len] = 0;
- return len;
-}
-#else
-#undef HAVE_MAIN_EXE_PATH
-#endif
-
-static void
-print_line0(line_info_t *line, void *address)
-{
- uintptr_t addr = (uintptr_t)address;
- uintptr_t d = addr - line->saddr;
- if (!address) {
- /* inlined */
- if (line->dirname && line->dirname[0]) {
- kprintf("%s(%s) %s/%s:%d\n", line->path, line->sname, line->dirname, line->filename, line->line);
- }
- else {
- kprintf("%s(%s) %s:%d\n", line->path, line->sname, line->filename, line->line);
- }
- }
- else if (!line->path) {
- kprintf("[0x%"PRIxPTR"]\n", addr);
- }
- else if (!line->saddr || !line->sname) {
- kprintf("%s(0x%"PRIxPTR") [0x%"PRIxPTR"]\n", line->path, addr-line->base_addr, addr);
- }
- else if (line->line <= 0) {
- kprintf("%s(%s+0x%"PRIxPTR") [0x%"PRIxPTR"]\n", line->path, line->sname,
- d, addr);
- }
- else if (!line->filename) {
- kprintf("%s(%s+0x%"PRIxPTR") [0x%"PRIxPTR"] ???:%d\n", line->path, line->sname,
- d, addr, line->line);
- }
- else if (line->dirname && line->dirname[0]) {
- kprintf("%s(%s+0x%"PRIxPTR") [0x%"PRIxPTR"] %s/%s:%d\n", line->path, line->sname,
- d, addr, line->dirname, line->filename, line->line);
- }
- else {
- kprintf("%s(%s+0x%"PRIxPTR") [0x%"PRIxPTR"] %s:%d\n", line->path, line->sname,
- d, addr, line->filename, line->line);
- }
-}
-
-static void
-print_line(line_info_t *line, void *address)
-{
- print_line0(line, address);
- if (line->next) {
- print_line(line->next, NULL);
- }
-}
-
-void
-rb_dump_backtrace_with_lines(int num_traces, void **traces)
-{
- int i;
- /* async-signal unsafe */
- line_info_t *lines = (line_info_t *)calloc(num_traces, sizeof(line_info_t));
- obj_info_t *obj = NULL;
- /* 2 is NULL + main executable */
- void **dladdr_fbases = (void **)calloc(num_traces+2, sizeof(void *));
-#ifdef HAVE_MAIN_EXE_PATH
- char *main_path = NULL; /* used on printing backtrace */
- ssize_t len;
- if ((len = main_exe_path()) > 0) {
- main_path = (char *)alloca(len + 1);
- if (main_path) {
- uintptr_t addr;
- memcpy(main_path, binary_filename, len+1);
- append_obj(&obj);
- obj->path = main_path;
- addr = fill_lines(num_traces, traces, 1, &obj, lines, -1);
- if (addr != (uintptr_t)-1) {
- dladdr_fbases[0] = (void *)addr;
- }
- }
- }
-#endif
-
- /* fill source lines by reading dwarf */
- for (i = 0; i < num_traces; i++) {
- Dl_info info;
- if (lines[i].line) continue;
- if (dladdr(traces[i], &info)) {
- const char *path;
- void **p;
-
- /* skip symbols which is in already checked objects */
- /* if the binary is strip-ed, this may effect */
- for (p=dladdr_fbases; *p; p++) {
- if (*p == info.dli_fbase) {
- lines[i].path = info.dli_fname;
- lines[i].sname = info.dli_sname;
- goto next_line;
- }
- }
- *p = info.dli_fbase;
-
- append_obj(&obj);
- obj->base_addr = (uintptr_t)info.dli_fbase;
- path = info.dli_fname;
- obj->path = path;
- lines[i].path = path;
- lines[i].sname = info.dli_sname;
- lines[i].saddr = (uintptr_t)info.dli_saddr;
- strlcpy(binary_filename, path, PATH_MAX);
- if (fill_lines(num_traces, traces, 1, &obj, lines, i) == (uintptr_t)-1)
- break;
- }
-next_line:
- continue;
- }
-
- /* output */
- for (i = 0; i < num_traces; i++) {
- print_line(&lines[i], traces[i]);
-
- /* FreeBSD's backtrace may show _start and so on */
- if (lines[i].sname && strcmp("main", lines[i].sname) == 0)
- break;
- }
-
- /* free */
- while (obj) {
- obj_info_t *o = obj;
- for (i=0; i < DWARF_SECTION_COUNT; i++) {
- struct dwarf_section *s = obj_dwarf_section_at(obj, i);
- if (s->flags & SHF_COMPRESSED) {
- free(s->ptr);
- }
- }
- if (obj->mapped_size) {
- munmap(obj->mapped, obj->mapped_size);
- }
- obj = o->next;
- free(o);
- }
- for (i = 0; i < num_traces; i++) {
- line_info_t *line = lines[i].next;
- while (line) {
- line_info_t *l = line;
- line = line->next;
- free(l);
- }
- }
- free(lines);
- free(dladdr_fbases);
-}
-
-/* From FreeBSD's lib/libstand/printf.c */
-/*-
- * Copyright (c) 1986, 1988, 1991, 1993
- * The Regents of the University of California. All rights reserved.
- * (c) UNIX System Laboratories, Inc.
- * All or some portions of this file are derived from material licensed
- * to the University of California by American Telephone and Telegraph
- * Co. or Unix System Laboratories, Inc. and are reproduced herein with
- * the permission of UNIX System Laboratories, Inc.
- *
- * Redistribution and use in source and binary forms, with or without
- * modification, are permitted provided that the following conditions
- * are met:
- * 1. Redistributions of source code must retain the above copyright
- * notice, this list of conditions and the following disclaimer.
- * 2. Redistributions in binary form must reproduce the above copyright
- * notice, this list of conditions and the following disclaimer in the
- * documentation and/or other materials provided with the distribution.
- * 4. Neither the name of the University nor the names of its contributors
- * may be used to endorse or promote products derived from this software
- * without specific prior written permission.
- *
- * THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
- * ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
- * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- * ARE DISCLAIMED. IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
- * FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
- * DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
- * OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
- * HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
- * LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
- * OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
- * SUCH DAMAGE.
- *
- * @(#)subr_prf.c 8.3 (Berkeley) 1/21/94
- */
-
-#include <stdarg.h>
-#define MAXNBUF (sizeof(intmax_t) * CHAR_BIT + 1)
-static inline int toupper(int c) { return ('A' <= c && c <= 'Z') ? (c&0x5f) : c; }
-#define hex2ascii(hex) (hex2ascii_data[hex])
-static const char hex2ascii_data[] = "0123456789abcdefghijklmnopqrstuvwxyz";
-static inline int imax(int a, int b) { return (a > b ? a : b); }
-static int kvprintf(char const *fmt, void (*func)(int), void *arg, int radix, va_list ap);
-
-static void putce(int c)
-{
- char s[1];
- ssize_t ret;
-
- s[0] = (char)c;
- ret = write(2, s, 1);
- (void)ret;
-}
-
-static int
-kprintf(const char *fmt, ...)
-{
- va_list ap;
- int retval;
-
- va_start(ap, fmt);
- retval = kvprintf(fmt, putce, NULL, 10, ap);
- va_end(ap);
- return retval;
-}
-
-/*
- * Put a NUL-terminated ASCII number (base <= 36) in a buffer in reverse
- * order; return an optional length and a pointer to the last character
- * written in the buffer (i.e., the first character of the string).
- * The buffer pointed to by `nbuf' must have length >= MAXNBUF.
- */
-static char *
-ksprintn(char *nbuf, uintmax_t num, int base, int *lenp, int upper)
-{
- char *p, c;
-
- p = nbuf;
- *p = '\0';
- do {
- c = hex2ascii(num % base);
- *++p = upper ? toupper(c) : c;
- } while (num /= base);
- if (lenp)
- *lenp = (int)(p - nbuf);
- return (p);
-}
-
-/*
- * Scaled down version of printf(3).
- *
- * Two additional formats:
- *
- * The format %b is supported to decode error registers.
- * Its usage is:
- *
- * printf("reg=%b\n", regval, "<base><arg>*");
- *
- * where <base> is the output base expressed as a control character, e.g.
- * \10 gives octal; \20 gives hex. Each arg is a sequence of characters,
- * the first of which gives the bit number to be inspected (origin 1), and
- * the next characters (up to a control character, i.e. a character <= 32),
- * give the name of the register. Thus:
- *
- * kvprintf("reg=%b\n", 3, "\10\2BITTWO\1BITONE\n");
- *
- * would produce output:
- *
- * reg=3<BITTWO,BITONE>
- *
- * XXX: %D -- Hexdump, takes pointer and separator string:
- * ("%6D", ptr, ":") -> XX:XX:XX:XX:XX:XX
- * ("%*D", len, ptr, " " -> XX XX XX XX ...
- */
-static int
-kvprintf(char const *fmt, void (*func)(int), void *arg, int radix, va_list ap)
-{
-#define PCHAR(c) {int cc=(c); if (func) (*func)(cc); else *d++ = cc; retval++; }
- char nbuf[MAXNBUF];
- char *d;
- const char *p, *percent, *q;
- unsigned char *up;
- int ch, n;
- uintmax_t num;
- int base, lflag, qflag, tmp, width, ladjust, sharpflag, neg, sign, dot;
- int cflag, hflag, jflag, tflag, zflag;
- int dwidth, upper;
- char padc;
- int stop = 0, retval = 0;
-
- num = 0;
- if (!func)
- d = (char *) arg;
- else
- d = NULL;
-
- if (fmt == NULL)
- fmt = "(fmt null)\n";
-
- if (radix < 2 || radix > 36)
- radix = 10;
-
- for (;;) {
- padc = ' ';
- width = 0;
- while ((ch = (unsigned char)*fmt++) != '%' || stop) {
- if (ch == '\0')
- return (retval);
- PCHAR(ch);
- }
- percent = fmt - 1;
- qflag = 0; lflag = 0; ladjust = 0; sharpflag = 0; neg = 0;
- sign = 0; dot = 0; dwidth = 0; upper = 0;
- cflag = 0; hflag = 0; jflag = 0; tflag = 0; zflag = 0;
-reswitch: switch (ch = (unsigned char)*fmt++) {
- case '.':
- dot = 1;
- goto reswitch;
- case '#':
- sharpflag = 1;
- goto reswitch;
- case '+':
- sign = 1;
- goto reswitch;
- case '-':
- ladjust = 1;
- goto reswitch;
- case '%':
- PCHAR(ch);
- break;
- case '*':
- if (!dot) {
- width = va_arg(ap, int);
- if (width < 0) {
- ladjust = !ladjust;
- width = -width;
- }
- } else {
- dwidth = va_arg(ap, int);
- }
- goto reswitch;
- case '0':
- if (!dot) {
- padc = '0';
- goto reswitch;
- }
- case '1': case '2': case '3': case '4':
- case '5': case '6': case '7': case '8': case '9':
- for (n = 0;; ++fmt) {
- n = n * 10 + ch - '0';
- ch = *fmt;
- if (ch < '0' || ch > '9')
- break;
- }
- if (dot)
- dwidth = n;
- else
- width = n;
- goto reswitch;
- case 'b':
- num = (unsigned int)va_arg(ap, int);
- p = va_arg(ap, char *);
- for (q = ksprintn(nbuf, num, *p++, NULL, 0); *q;)
- PCHAR(*q--);
-
- if (num == 0)
- break;
-
- for (tmp = 0; *p;) {
- n = *p++;
- if (num & (1 << (n - 1))) {
- PCHAR(tmp ? ',' : '<');
- for (; (n = *p) > ' '; ++p)
- PCHAR(n);
- tmp = 1;
- } else
- for (; *p > ' '; ++p)
- continue;
- }
- if (tmp)
- PCHAR('>');
- break;
- case 'c':
- PCHAR(va_arg(ap, int));
- break;
- case 'D':
- up = va_arg(ap, unsigned char *);
- p = va_arg(ap, char *);
- if (!width)
- width = 16;
- while(width--) {
- PCHAR(hex2ascii(*up >> 4));
- PCHAR(hex2ascii(*up & 0x0f));
- up++;
- if (width)
- for (q=p;*q;q++)
- PCHAR(*q);
- }
- break;
- case 'd':
- case 'i':
- base = 10;
- sign = 1;
- goto handle_sign;
- case 'h':
- if (hflag) {
- hflag = 0;
- cflag = 1;
- } else
- hflag = 1;
- goto reswitch;
- case 'j':
- jflag = 1;
- goto reswitch;
- case 'l':
- if (lflag) {
- lflag = 0;
- qflag = 1;
- } else
- lflag = 1;
- goto reswitch;
- case 'n':
- if (jflag)
- *(va_arg(ap, intmax_t *)) = retval;
- else if (qflag)
- *(va_arg(ap, int64_t *)) = retval;
- else if (lflag)
- *(va_arg(ap, long *)) = retval;
- else if (zflag)
- *(va_arg(ap, size_t *)) = retval;
- else if (hflag)
- *(va_arg(ap, short *)) = retval;
- else if (cflag)
- *(va_arg(ap, char *)) = retval;
- else
- *(va_arg(ap, int *)) = retval;
- break;
- case 'o':
- base = 8;
- goto handle_nosign;
- case 'p':
- base = 16;
- sharpflag = (width == 0);
- sign = 0;
- num = (uintptr_t)va_arg(ap, void *);
- goto number;
- case 'q':
- qflag = 1;
- goto reswitch;
- case 'r':
- base = radix;
- if (sign)
- goto handle_sign;
- goto handle_nosign;
- case 's':
- p = va_arg(ap, char *);
- if (p == NULL)
- p = "(null)";
- if (!dot)
- n = (int)strlen (p);
- else
- for (n = 0; n < dwidth && p[n]; n++)
- continue;
-
- width -= n;
-
- if (!ladjust && width > 0)
- while (width--)
- PCHAR(padc);
- while (n--)
- PCHAR(*p++);
- if (ladjust && width > 0)
- while (width--)
- PCHAR(padc);
- break;
- case 't':
- tflag = 1;
- goto reswitch;
- case 'u':
- base = 10;
- goto handle_nosign;
- case 'X':
- upper = 1;
- case 'x':
- base = 16;
- goto handle_nosign;
- case 'y':
- base = 16;
- sign = 1;
- goto handle_sign;
- case 'z':
- zflag = 1;
- goto reswitch;
-handle_nosign:
- sign = 0;
- if (jflag)
- num = va_arg(ap, uintmax_t);
- else if (qflag)
- num = va_arg(ap, uint64_t);
- else if (tflag)
- num = va_arg(ap, ptrdiff_t);
- else if (lflag)
- num = va_arg(ap, unsigned long);
- else if (zflag)
- num = va_arg(ap, size_t);
- else if (hflag)
- num = (unsigned short)va_arg(ap, int);
- else if (cflag)
- num = (unsigned char)va_arg(ap, int);
- else
- num = va_arg(ap, unsigned int);
- goto number;
-handle_sign:
- if (jflag)
- num = va_arg(ap, intmax_t);
- else if (qflag)
- num = va_arg(ap, int64_t);
- else if (tflag)
- num = va_arg(ap, ptrdiff_t);
- else if (lflag)
- num = va_arg(ap, long);
- else if (zflag)
- num = va_arg(ap, ssize_t);
- else if (hflag)
- num = (short)va_arg(ap, int);
- else if (cflag)
- num = (char)va_arg(ap, int);
- else
- num = va_arg(ap, int);
-number:
- if (sign && (intmax_t)num < 0) {
- neg = 1;
- num = -(intmax_t)num;
- }
- p = ksprintn(nbuf, num, base, &n, upper);
- tmp = 0;
- if (sharpflag && num != 0) {
- if (base == 8)
- tmp++;
- else if (base == 16)
- tmp += 2;
- }
- if (neg)
- tmp++;
-
- if (!ladjust && padc == '0')
- dwidth = width - tmp;
- width -= tmp + imax(dwidth, n);
- dwidth -= n;
- if (!ladjust)
- while (width-- > 0)
- PCHAR(' ');
- if (neg)
- PCHAR('-');
- if (sharpflag && num != 0) {
- if (base == 8) {
- PCHAR('0');
- } else if (base == 16) {
- PCHAR('0');
- PCHAR('x');
- }
- }
- while (dwidth-- > 0)
- PCHAR('0');
-
- while (*p)
- PCHAR(*p--);
-
- if (ladjust)
- while (width-- > 0)
- PCHAR(' ');
-
- break;
- default:
- while (percent < fmt)
- PCHAR(*percent++);
- /*
- * Since we ignore an formatting argument it is no
- * longer safe to obey the remaining formatting
- * arguments as the arguments will no longer match
- * the format specs.
- */
- stop = 1;
- break;
- }
- }
-#undef PCHAR
-}
-#else /* defined(USE_ELF) */
-#error not supported
-#endif
diff --git a/addr2line.h b/addr2line.h
deleted file mode 100644
index 4f6cf179ef..0000000000
--- a/addr2line.h
+++ /dev/null
@@ -1,21 +0,0 @@
-/**********************************************************************
-
- addr2line.h -
-
- $Author$
-
- Copyright (C) 2010 Shinichiro Hamaji
-
-**********************************************************************/
-
-#ifndef RUBY_ADDR2LINE_H
-#define RUBY_ADDR2LINE_H
-
-#if (defined(USE_ELF) || defined(HAVE_MACH_O_LOADER_H))
-
-void
-rb_dump_backtrace_with_lines(int num_traces, void **traces);
-
-#endif /* USE_ELF */
-
-#endif /* RUBY_ADDR2LINE_H */
diff --git a/appveyor.yml b/appveyor.yml
deleted file mode 100644
index 7909de9e6b..0000000000
--- a/appveyor.yml
+++ /dev/null
@@ -1,94 +0,0 @@
----
-version: '{build}'
-shallow_clone: true
-platform:
- - x64
-environment:
- ruby_version: "24-%Platform%"
- zlib_version: "1.2.11"
- matrix:
- - build: vs
- vs: 120
- ssl: OpenSSL
- APPVEYOR_BUILD_WORKER_IMAGE: Visual Studio 2013
- GEMS_FOR_TEST: ""
- - build: vs
- vs: 140
- ssl: OpenSSL-v111
- APPVEYOR_BUILD_WORKER_IMAGE: Visual Studio 2015
- GEMS_FOR_TEST: ""
- RELINE_TEST_ENCODING: "Windows-31J"
- UPDATE_UNICODE: "UNICODE_FILES=. UNICODE_PROPERTY_FILES=. UNICODE_AUXILIARY_FILES=. UNICODE_EMOJI_FILES=."
-for:
--
- matrix:
- only:
- - build: vs
- install:
- - ver
- - chcp
- - SET BITS=%Platform:x86=32%
- - SET BITS=%BITS:x=%
- - SET OPENSSL_DIR=C:\%ssl%-Win%BITS%
- - CALL SET vcvars=%%^VS%VS%COMNTOOLS^%%..\..\VC\vcvarsall.bat
- - SET vcvars
- - '"%vcvars%" %Platform:x64=amd64%'
- - SET ruby_path=C:\Ruby%ruby_version:-x86=%
- - SET PATH=\usr\local\bin;%ruby_path%\bin;%PATH%;C:\msys64\mingw64\bin;C:\msys64\usr\bin
- - ruby --version
- - 'cl'
- - echo> Makefile srcdir=.
- - echo>> Makefile MSC_VER=0
- - echo>> Makefile RT=none
- - echo>> Makefile RT_VER=0
- - echo>> Makefile BUILTIN_ENCOBJS=nul
- - type win32\Makefile.sub >> Makefile
- - nmake %mflags% touch-unicode-files
- - nmake %mflags% %UPDATE_UNICODE% up incs
- - del Makefile
- - mkdir \usr\local\bin
- - mkdir \usr\local\include
- - mkdir \usr\local\lib
- - curl -fsSL -o zlib%zlib_version:.=%.zip --retry 10 https://zlib.net/zlib%zlib_version:.=%.zip
- - 7z x -o%APPVEYOR_BUILD_FOLDER%\ext\zlib zlib%zlib_version:.=%.zip
- - for %%I in (%OPENSSL_DIR%\*.dll) do mklink /h \usr\local\bin\%%~nxI %%I
- - attrib +r /s /d
- - mkdir %Platform%-mswin_%vs%
- build_script:
- - cd %APPVEYOR_BUILD_FOLDER%
- - cd %Platform%-mswin_%vs%
- - ..\win32\configure.bat --without-ext=+,dbm,gdbm,readline --with-opt-dir=/usr/local --with-openssl-dir=%OPENSSL_DIR:\=/%
- - nmake -l
- - nmake install-nodoc
- - \usr\bin\ruby -v -e "p :locale => Encoding.find('locale'), :filesystem => Encoding.find('filesystem')"
- - if not "%GEMS_FOR_TEST%" == "" \usr\bin\gem install --no-document %GEMS_FOR_TEST%
- - \usr\bin\ruby -ropenssl -e "puts 'Build ' + OpenSSL::OPENSSL_VERSION, 'Runtime ' + OpenSSL::OPENSSL_LIBRARY_VERSION"
- test_script:
- - set /a JOBS=%NUMBER_OF_PROCESSORS%
- - nmake -l "TESTOPTS=-v -q" btest
- - nmake -l "TESTOPTS=-v -q" test-basic
- - nmake -l "TESTOPTS=-v --timeout-scale=3.0 --excludes=../test/excludes/_appveyor -j%JOBS% --exclude readline --exclude win32ole --exclude test_bignum --exclude test_syntax --exclude test_open-uri --exclude test_bundled_ca" test-all
- # separately execute tests without -j which may crash worker with -j.
- - nmake -l "TESTOPTS=-v --timeout-scale=3.0 --excludes=../test/excludes/_appveyor" test-all TESTS="../test/win32ole ../test/ruby/test_bignum.rb ../test/ruby/test_syntax.rb ../test/open-uri/test_open-uri.rb ../test/rubygems/test_bundled_ca.rb"
- - nmake -l test-spec MSPECOPT=-fs # not using `-j` because sometimes `mspec -j` silently dies on Windows
-notifications:
- # Using "Webhook" with templated body to skip notification on Pull Request
- - provider: Webhook
- method: POST
- url:
- secure: iMINHMS0nZabaDsxN9omRDsekxzVvAAzEq5ev7lN6vb+gUETT+rbDKLGxBxBpEpxlnPlLdzroIJ+DTKlwfJA8VkGawTn9EXNsucH0OkSf2M= # AppVeyor CI
- body: >-
- {{^isPullRequest}}
- {
- "attachments": [
- {
- "text": "Build <{{buildUrl}}|#{{buildVersion}}> (<{{commitUrl}}|{{commitId}}>) of {{repositoryName}}@{{branch}} by {{commitAuthor}} {{status}}",
- "color": "{{#passed}}good{{/passed}}{{#failed}}danger{{/failed}}"
- }
- ],
- "channel": "#alerts"
- }
- {{/isPullRequest}}
- on_build_success: false
- on_build_failure: true
- on_build_status_changed: true
diff --git a/array.c b/array.c
index 90fa2e06d6..10b6d64504 100644
--- a/array.c
+++ b/array.c
@@ -3,244 +3,28 @@
array.c -
$Author$
+ $Date$
created at: Fri Aug 6 09:46:12 JST 1993
- Copyright (C) 1993-2007 Yukihiro Matsumoto
+ Copyright (C) 1993-2003 Yukihiro Matsumoto
Copyright (C) 2000 Network Applied Communication Laboratory, Inc.
Copyright (C) 2000 Information-technology Promotion Agency, Japan
**********************************************************************/
-#include "ruby/encoding.h"
-#include "ruby/util.h"
-#include "ruby/st.h"
-#include "probes.h"
-#include "id.h"
-#include "debug_counter.h"
-#include "transient_heap.h"
-#include "internal.h"
-
-#if !ARRAY_DEBUG
-# define NDEBUG
-#endif
-#include "ruby_assert.h"
-VALUE rb_cArray;
+#include "ruby.h"
+#include "util.h"
+#include "st.h"
-/* for OPTIMIZED_CMP: */
-#define id_cmp idCmp
+VALUE rb_cArray;
+static ID id_cmp;
#define ARY_DEFAULT_SIZE 16
-#define ARY_MAX_SIZE (LONG_MAX / (int)sizeof(VALUE))
-#define SMALL_ARRAY_LEN 16
-
-static int
-should_be_T_ARRAY(VALUE ary)
-{
- return RB_TYPE_P(ary, T_ARRAY);
-}
-
-static int
-should_not_be_shared_and_embedded(VALUE ary)
-{
- return !FL_TEST((ary), ELTS_SHARED) || !FL_TEST((ary), RARRAY_EMBED_FLAG);
-}
-
-#define ARY_SHARED_P(ary) \
- (assert(should_be_T_ARRAY((VALUE)(ary))), \
- assert(should_not_be_shared_and_embedded((VALUE)ary)), \
- FL_TEST_RAW((ary),ELTS_SHARED)!=0)
-
-#define ARY_EMBED_P(ary) \
- (assert(should_be_T_ARRAY((VALUE)(ary))), \
- assert(should_not_be_shared_and_embedded((VALUE)ary)), \
- FL_TEST_RAW((ary), RARRAY_EMBED_FLAG) != 0)
-
-#define ARY_HEAP_PTR(a) (assert(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.ptr)
-#define ARY_HEAP_LEN(a) (assert(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.len)
-#define ARY_HEAP_CAPA(a) (assert(!ARY_EMBED_P(a)), assert(!ARY_SHARED_ROOT_P(a)), \
- RARRAY(a)->as.heap.aux.capa)
-
-#define ARY_EMBED_PTR(a) (assert(ARY_EMBED_P(a)), RARRAY(a)->as.ary)
-#define ARY_EMBED_LEN(a) \
- (assert(ARY_EMBED_P(a)), \
- (long)((RBASIC(a)->flags >> RARRAY_EMBED_LEN_SHIFT) & \
- (RARRAY_EMBED_LEN_MASK >> RARRAY_EMBED_LEN_SHIFT)))
-#define ARY_HEAP_SIZE(a) (assert(!ARY_EMBED_P(a)), assert(ARY_OWNS_HEAP_P(a)), ARY_CAPA(a) * sizeof(VALUE))
-
-#define ARY_OWNS_HEAP_P(a) (assert(should_be_T_ARRAY((VALUE)(a))), \
- !FL_TEST_RAW((a), ELTS_SHARED|RARRAY_EMBED_FLAG))
-
-#define FL_SET_EMBED(a) do { \
- assert(!ARY_SHARED_P(a)); \
- FL_SET((a), RARRAY_EMBED_FLAG); \
- RARY_TRANSIENT_UNSET(a); \
- ary_verify(a); \
-} while (0)
-
-#define FL_UNSET_EMBED(ary) FL_UNSET((ary), RARRAY_EMBED_FLAG|RARRAY_EMBED_LEN_MASK)
-#define FL_SET_SHARED(ary) do { \
- assert(!ARY_EMBED_P(ary)); \
- FL_SET((ary), ELTS_SHARED); \
-} while (0)
-#define FL_UNSET_SHARED(ary) FL_UNSET((ary), ELTS_SHARED)
-
-#define ARY_SET_PTR(ary, p) do { \
- assert(!ARY_EMBED_P(ary)); \
- assert(!OBJ_FROZEN(ary)); \
- RARRAY(ary)->as.heap.ptr = (p); \
-} while (0)
-#define ARY_SET_EMBED_LEN(ary, n) do { \
- long tmp_n = (n); \
- assert(ARY_EMBED_P(ary)); \
- assert(!OBJ_FROZEN(ary)); \
- RBASIC(ary)->flags &= ~RARRAY_EMBED_LEN_MASK; \
- RBASIC(ary)->flags |= (tmp_n) << RARRAY_EMBED_LEN_SHIFT; \
-} while (0)
-#define ARY_SET_HEAP_LEN(ary, n) do { \
- assert(!ARY_EMBED_P(ary)); \
- RARRAY(ary)->as.heap.len = (n); \
-} while (0)
-#define ARY_SET_LEN(ary, n) do { \
- if (ARY_EMBED_P(ary)) { \
- ARY_SET_EMBED_LEN((ary), (n)); \
- } \
- else { \
- ARY_SET_HEAP_LEN((ary), (n)); \
- } \
- assert(RARRAY_LEN(ary) == (n)); \
-} while (0)
-#define ARY_INCREASE_PTR(ary, n) do { \
- assert(!ARY_EMBED_P(ary)); \
- assert(!OBJ_FROZEN(ary)); \
- RARRAY(ary)->as.heap.ptr += (n); \
-} while (0)
-#define ARY_INCREASE_LEN(ary, n) do { \
- assert(!OBJ_FROZEN(ary)); \
- if (ARY_EMBED_P(ary)) { \
- ARY_SET_EMBED_LEN((ary), RARRAY_LEN(ary)+(n)); \
- } \
- else { \
- RARRAY(ary)->as.heap.len += (n); \
- } \
-} while (0)
-
-#define ARY_CAPA(ary) (ARY_EMBED_P(ary) ? RARRAY_EMBED_LEN_MAX : \
- ARY_SHARED_ROOT_P(ary) ? RARRAY_LEN(ary) : ARY_HEAP_CAPA(ary))
-#define ARY_SET_CAPA(ary, n) do { \
- assert(!ARY_EMBED_P(ary)); \
- assert(!ARY_SHARED_P(ary)); \
- assert(!OBJ_FROZEN(ary)); \
- RARRAY(ary)->as.heap.aux.capa = (n); \
-} while (0)
-
-#define ARY_SHARED_ROOT(ary) (assert(ARY_SHARED_P(ary)), RARRAY(ary)->as.heap.aux.shared_root)
-#define ARY_SET_SHARED(ary, value) do { \
- const VALUE _ary_ = (ary); \
- const VALUE _value_ = (value); \
- assert(!ARY_EMBED_P(_ary_)); \
- assert(ARY_SHARED_P(_ary_)); \
- assert(ARY_SHARED_ROOT_P(_value_)); \
- RB_OBJ_WRITE(_ary_, &RARRAY(_ary_)->as.heap.aux.shared_root, _value_); \
-} while (0)
-#define RARRAY_SHARED_ROOT_FLAG FL_USER5
-#define ARY_SHARED_ROOT_P(ary) (assert(should_be_T_ARRAY((VALUE)(ary))), \
- FL_TEST_RAW((ary), RARRAY_SHARED_ROOT_FLAG))
-#define ARY_SHARED_ROOT_REFCNT(ary) \
- (assert(ARY_SHARED_ROOT_P(ary)), RARRAY(ary)->as.heap.aux.capa)
-#define ARY_SHARED_ROOT_OCCUPIED(ary) (ARY_SHARED_ROOT_REFCNT(ary) == 1)
-#define ARY_SET_SHARED_ROOT_REFCNT(ary, value) do { \
- assert(ARY_SHARED_ROOT_P(ary)); \
- RARRAY(ary)->as.heap.aux.capa = (value); \
-} while (0)
-#define FL_SET_SHARED_ROOT(ary) do { \
- assert(!ARY_EMBED_P(ary)); \
- assert(!RARRAY_TRANSIENT_P(ary)); \
- FL_SET((ary), RARRAY_SHARED_ROOT_FLAG); \
-} while (0)
-
-static inline void
-ARY_SET(VALUE a, long i, VALUE v)
-{
- assert(!ARY_SHARED_P(a));
- assert(!OBJ_FROZEN(a));
-
- RARRAY_ASET(a, i, v);
-}
-#undef RARRAY_ASET
-
-
-#if ARRAY_DEBUG
-#define ary_verify(ary) ary_verify_(ary, __FILE__, __LINE__)
-
-static VALUE
-ary_verify_(VALUE ary, const char *file, int line)
-{
- assert(RB_TYPE_P(ary, T_ARRAY));
-
- if (FL_TEST(ary, ELTS_SHARED)) {
- VALUE root = RARRAY(ary)->as.heap.aux.shared_root;
- const VALUE *ptr = ARY_HEAP_PTR(ary);
- const VALUE *root_ptr = RARRAY_CONST_PTR_TRANSIENT(root);
- long len = ARY_HEAP_LEN(ary), root_len = RARRAY_LEN(root);
- assert(FL_TEST(root, RARRAY_SHARED_ROOT_FLAG));
- assert(root_ptr <= ptr && ptr + len <= root_ptr + root_len);
- ary_verify(root);
- }
- else if (ARY_EMBED_P(ary)) {
- assert(!RARRAY_TRANSIENT_P(ary));
- assert(!ARY_SHARED_P(ary));
- assert(RARRAY_LEN(ary) <= RARRAY_EMBED_LEN_MAX);
- }
- else {
-#if 1
- const VALUE *ptr = RARRAY_CONST_PTR_TRANSIENT(ary);
- long i, len = RARRAY_LEN(ary);
- volatile VALUE v;
- if (len > 1) len = 1; /* check only HEAD */
- for (i=0; i<len; i++) {
- v = ptr[i]; /* access check */
- }
- v = v;
-#endif
- }
-
- if (RARRAY_TRANSIENT_P(ary)) {
- assert(rb_transient_heap_managed_ptr_p(RARRAY_CONST_PTR_TRANSIENT(ary)));
- }
-
- rb_transient_heap_verify();
-
- return ary;
-}
void
-rb_ary_verify(VALUE ary)
-{
- ary_verify(ary);
-}
-#else
-#define ary_verify(ary) ((void)0)
-#endif
-
-VALUE *
-rb_ary_ptr_use_start(VALUE ary)
-{
-#if ARRAY_DEBUG
- FL_SET_RAW(ary, RARRAY_PTR_IN_USE_FLAG);
-#endif
- return (VALUE *)RARRAY_CONST_PTR_TRANSIENT(ary);
-}
-
-void
-rb_ary_ptr_use_end(VALUE ary)
-{
-#if ARRAY_DEBUG
- FL_UNSET_RAW(ary, RARRAY_PTR_IN_USE_FLAG);
-#endif
-}
-
-void
-rb_mem_clear(VALUE *mem, long size)
+rb_mem_clear(mem, size)
+ register VALUE *mem;
+ register long size;
{
while (size--) {
*mem++ = Qnil;
@@ -248,485 +32,133 @@ rb_mem_clear(VALUE *mem, long size)
}
static void
-ary_mem_clear(VALUE ary, long beg, long size)
-{
- RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
- rb_mem_clear(ptr + beg, size);
- });
-}
-
-static inline void
-memfill(register VALUE *mem, register long size, register VALUE val)
+memfill(mem, size, val)
+ register VALUE *mem;
+ register long size;
+ register VALUE val;
{
while (size--) {
*mem++ = val;
}
}
-static void
-ary_memfill(VALUE ary, long beg, long size, VALUE val)
-{
- RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
- memfill(ptr + beg, size, val);
- RB_OBJ_WRITTEN(ary, Qundef, val);
- });
-}
-
-static void
-ary_memcpy0(VALUE ary, long beg, long argc, const VALUE *argv, VALUE buff_owner_ary)
-{
- assert(!ARY_SHARED_P(buff_owner_ary));
-
- if (argc > (int)(128/sizeof(VALUE)) /* is magic number (cache line size) */) {
- rb_gc_writebarrier_remember(buff_owner_ary);
- RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
- MEMCPY(ptr+beg, argv, VALUE, argc);
- });
- }
- else {
- int i;
- RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
- for (i=0; i<argc; i++) {
- RB_OBJ_WRITE(buff_owner_ary, &ptr[i+beg], argv[i]);
- }
- });
- }
-}
-
-static void
-ary_memcpy(VALUE ary, long beg, long argc, const VALUE *argv)
-{
- ary_memcpy0(ary, beg, argc, argv, ary);
-}
+#define ARY_TMPLOCK FL_USER1
-static VALUE *
-ary_heap_alloc(VALUE ary, size_t capa)
-{
- VALUE *ptr = rb_transient_heap_alloc(ary, sizeof(VALUE) * capa);
-
- if (ptr != NULL) {
- RARY_TRANSIENT_SET(ary);
- }
- else {
- RARY_TRANSIENT_UNSET(ary);
- ptr = ALLOC_N(VALUE, capa);
- }
-
- return ptr;
-}
-
-static void
-ary_heap_free_ptr(VALUE ary, const VALUE *ptr, long size)
-{
- if (RARRAY_TRANSIENT_P(ary)) {
- /* ignore it */
- }
- else {
- ruby_sized_xfree((void *)ptr, size);
- }
-}
-
-static void
-ary_heap_free(VALUE ary)
-{
- if (RARRAY_TRANSIENT_P(ary)) {
- RARY_TRANSIENT_UNSET(ary);
- }
- else {
- ary_heap_free_ptr(ary, ARY_HEAP_PTR(ary), ARY_HEAP_SIZE(ary));
- }
-}
-
-static void
-ary_heap_realloc(VALUE ary, size_t new_capa)
-{
- size_t old_capa = ARY_HEAP_CAPA(ary);
-
- if (RARRAY_TRANSIENT_P(ary)) {
- if (new_capa <= old_capa) {
- /* do nothing */
- }
- else {
- VALUE *new_ptr = rb_transient_heap_alloc(ary, sizeof(VALUE) * new_capa);
-
- if (new_ptr == NULL) {
- new_ptr = ALLOC_N(VALUE, new_capa);
- RARY_TRANSIENT_UNSET(ary);
- }
-
- MEMCPY(new_ptr, ARY_HEAP_PTR(ary), VALUE, old_capa);
- ARY_SET_PTR(ary, new_ptr);
- }
- }
- else {
- SIZED_REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, new_capa, old_capa);
- }
- ary_verify(ary);
-}
-
-#if USE_TRANSIENT_HEAP
static inline void
-rb_ary_transient_heap_evacuate_(VALUE ary, int transient, int promote)
-{
- if (transient) {
- VALUE *new_ptr;
- const VALUE *old_ptr = ARY_HEAP_PTR(ary);
- long capa = ARY_HEAP_CAPA(ary);
- long len = ARY_HEAP_LEN(ary);
-
- if (ARY_SHARED_ROOT_P(ary)) {
- capa = len;
- }
-
- assert(ARY_OWNS_HEAP_P(ary));
- assert(RARRAY_TRANSIENT_P(ary));
- assert(!ARY_PTR_USING_P(ary));
-
- if (promote) {
- new_ptr = ALLOC_N(VALUE, capa);
- RARY_TRANSIENT_UNSET(ary);
- }
- else {
- new_ptr = ary_heap_alloc(ary, capa);
- }
-
- MEMCPY(new_ptr, old_ptr, VALUE, capa);
- /* do not use ARY_SET_PTR() because they assert !frozen */
- RARRAY(ary)->as.heap.ptr = new_ptr;
- }
-
- ary_verify(ary);
-}
-
-void
-rb_ary_transient_heap_evacuate(VALUE ary, int promote)
-{
- rb_ary_transient_heap_evacuate_(ary, RARRAY_TRANSIENT_P(ary), promote);
-}
-
-void
-rb_ary_detransient(VALUE ary)
-{
- assert(RARRAY_TRANSIENT_P(ary));
- rb_ary_transient_heap_evacuate_(ary, TRUE, TRUE);
-}
-#else
-void
-rb_ary_detransient(VALUE ary)
-{
- /* do nothing */
-}
-#endif
-
-static void
-ary_resize_capa(VALUE ary, long capacity)
-{
- assert(RARRAY_LEN(ary) <= capacity);
- assert(!OBJ_FROZEN(ary));
- assert(!ARY_SHARED_P(ary));
-
- if (capacity > RARRAY_EMBED_LEN_MAX) {
- if (ARY_EMBED_P(ary)) {
- long len = ARY_EMBED_LEN(ary);
- VALUE *ptr = ary_heap_alloc(ary, capacity);
-
- MEMCPY(ptr, ARY_EMBED_PTR(ary), VALUE, len);
- FL_UNSET_EMBED(ary);
- ARY_SET_PTR(ary, ptr);
- ARY_SET_HEAP_LEN(ary, len);
- }
- else {
- ary_heap_realloc(ary, capacity);
- }
- ARY_SET_CAPA(ary, capacity);
- }
- else {
- if (!ARY_EMBED_P(ary)) {
- long len = ARY_HEAP_LEN(ary);
- long old_capa = ARY_HEAP_CAPA(ary);
- const VALUE *ptr = ARY_HEAP_PTR(ary);
-
- if (len > capacity) len = capacity;
- MEMCPY((VALUE *)RARRAY(ary)->as.ary, ptr, VALUE, len);
- ary_heap_free_ptr(ary, ptr, old_capa);
-
- FL_SET_EMBED(ary);
- ARY_SET_LEN(ary, len);
- }
- }
-
- ary_verify(ary);
-}
-
-static inline void
-ary_shrink_capa(VALUE ary)
-{
- long capacity = ARY_HEAP_LEN(ary);
- long old_capa = ARY_HEAP_CAPA(ary);
- assert(!ARY_SHARED_P(ary));
- assert(old_capa >= capacity);
- if (old_capa > capacity) ary_heap_realloc(ary, capacity);
-
- ary_verify(ary);
-}
-
-static void
-ary_double_capa(VALUE ary, long min)
-{
- long new_capa = ARY_CAPA(ary) / 2;
-
- if (new_capa < ARY_DEFAULT_SIZE) {
- new_capa = ARY_DEFAULT_SIZE;
- }
- if (new_capa >= ARY_MAX_SIZE - min) {
- new_capa = (ARY_MAX_SIZE - min) / 2;
- }
- new_capa += min;
- ary_resize_capa(ary, new_capa);
-
- ary_verify(ary);
-}
-
-static void
-rb_ary_decrement_share(VALUE shared_root)
-{
- if (shared_root) {
- long num = ARY_SHARED_ROOT_REFCNT(shared_root) - 1;
- if (num == 0) {
- rb_ary_free(shared_root);
- rb_gc_force_recycle(shared_root);
- }
- else if (num > 0) {
- ARY_SET_SHARED_ROOT_REFCNT(shared_root, num);
- }
- }
-}
-
-static void
-rb_ary_unshare(VALUE ary)
-{
- VALUE shared_root = RARRAY(ary)->as.heap.aux.shared_root;
- rb_ary_decrement_share(shared_root);
- FL_UNSET_SHARED(ary);
-}
-
-static inline void
-rb_ary_unshare_safe(VALUE ary)
-{
- if (ARY_SHARED_P(ary) && !ARY_EMBED_P(ary)) {
- rb_ary_unshare(ary);
- }
-}
-
-static VALUE
-rb_ary_increment_share(VALUE shared_root)
+rb_ary_modify_check(ary)
+ VALUE ary;
{
- long num = ARY_SHARED_ROOT_REFCNT(shared_root);
- if (num >= 0) {
- ARY_SET_SHARED_ROOT_REFCNT(shared_root, num + 1);
- }
- return shared_root;
+ if (OBJ_FROZEN(ary)) rb_error_frozen("array");
+ if (FL_TEST(ary, ARY_TMPLOCK))
+ rb_raise(rb_eTypeError, "can't modify array during iteration");
+ if (!OBJ_TAINTED(ary) && rb_safe_level() >= 4)
+ rb_raise(rb_eSecurityError, "Insecure: can't modify array");
}
static void
-rb_ary_set_shared(VALUE ary, VALUE shared_root)
-{
- rb_ary_increment_share(shared_root);
- FL_SET_SHARED(ary);
- RB_DEBUG_COUNTER_INC(obj_ary_shared_create);
- ARY_SET_SHARED(ary, shared_root);
-}
-
-static inline void
-rb_ary_modify_check(VALUE ary)
+rb_ary_modify(ary)
+ VALUE ary;
{
- rb_check_frozen(ary);
- ary_verify(ary);
-}
+ VALUE *ptr;
-void
-rb_ary_modify(VALUE ary)
-{
rb_ary_modify_check(ary);
- if (ARY_SHARED_P(ary)) {
- long shared_len, len = RARRAY_LEN(ary);
- VALUE shared_root = ARY_SHARED_ROOT(ary);
-
- ary_verify(shared_root);
-
- if (len <= RARRAY_EMBED_LEN_MAX) {
- const VALUE *ptr = ARY_HEAP_PTR(ary);
- FL_UNSET_SHARED(ary);
- FL_SET_EMBED(ary);
- MEMCPY((VALUE *)ARY_EMBED_PTR(ary), ptr, VALUE, len);
- rb_ary_decrement_share(shared_root);
- ARY_SET_EMBED_LEN(ary, len);
- }
- else if (ARY_SHARED_ROOT_OCCUPIED(shared_root) && len > ((shared_len = RARRAY_LEN(shared_root))>>1)) {
- long shift = RARRAY_CONST_PTR_TRANSIENT(ary) - RARRAY_CONST_PTR_TRANSIENT(shared_root);
- FL_UNSET_SHARED(ary);
- ARY_SET_PTR(ary, RARRAY_CONST_PTR_TRANSIENT(shared_root));
- ARY_SET_CAPA(ary, shared_len);
- RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
- MEMMOVE(ptr, ptr+shift, VALUE, len);
- });
- FL_SET_EMBED(shared_root);
- rb_ary_decrement_share(shared_root);
- }
- else {
- VALUE *ptr = ary_heap_alloc(ary, len);
- MEMCPY(ptr, ARY_HEAP_PTR(ary), VALUE, len);
- rb_ary_unshare(ary);
- ARY_SET_CAPA(ary, len);
- ARY_SET_PTR(ary, ptr);
- }
-
- rb_gc_writebarrier_remember(ary);
+ if (FL_TEST(ary, ELTS_SHARED)) {
+ ptr = ALLOC_N(VALUE, RARRAY(ary)->len);
+ FL_UNSET(ary, ELTS_SHARED);
+ RARRAY(ary)->aux.capa = RARRAY(ary)->len;
+ MEMCPY(ptr, RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
+ RARRAY(ary)->ptr = ptr;
}
- ary_verify(ary);
}
-
-static VALUE
-ary_ensure_room_for_push(VALUE ary, long add_len)
+VALUE
+rb_ary_freeze(ary)
+ VALUE ary;
{
- long old_len = RARRAY_LEN(ary);
- long new_len = old_len + add_len;
- long capa;
-
- if (old_len > ARY_MAX_SIZE - add_len) {
- rb_raise(rb_eIndexError, "index %ld too big", new_len);
- }
- if (ARY_SHARED_P(ary)) {
- if (new_len > RARRAY_EMBED_LEN_MAX) {
- VALUE shared_root = ARY_SHARED_ROOT(ary);
- if (ARY_SHARED_ROOT_OCCUPIED(shared_root)) {
- if (ARY_HEAP_PTR(ary) - RARRAY_CONST_PTR_TRANSIENT(shared_root) + new_len <= RARRAY_LEN(shared_root)) {
- rb_ary_modify_check(ary);
-
- ary_verify(ary);
- ary_verify(shared_root);
- return shared_root;
- }
- else {
- /* if array is shared, then it is likely it participate in push/shift pattern */
- rb_ary_modify(ary);
- capa = ARY_CAPA(ary);
- if (new_len > capa - (capa >> 6)) {
- ary_double_capa(ary, new_len);
- }
- ary_verify(ary);
- return ary;
- }
- }
- }
- ary_verify(ary);
- rb_ary_modify(ary);
- }
- else {
- rb_ary_modify_check(ary);
- }
- capa = ARY_CAPA(ary);
- if (new_len > capa) {
- ary_double_capa(ary, new_len);
- }
-
- ary_verify(ary);
- return ary;
+ return rb_obj_freeze(ary);
}
/*
* call-seq:
- * ary.freeze -> ary
- *
- * Calls Object#freeze on +ary+ to prevent any further
- * modification. A RuntimeError will be raised if a modification
- * attempt is made.
+ * array.frozen? -> true or false
*
+ * Return <code>true</code> if this array is frozen (or temporarily frozen
+ * while being sorted).
*/
-VALUE
-rb_ary_freeze(VALUE ary)
-{
- return rb_obj_freeze(ary);
-}
-
-/* This can be used to take a snapshot of an array (with
- e.g. rb_ary_replace) and check later whether the array has been
- modified from the snapshot. The snapshot is cheap, though if
- something does modify the array it will pay the cost of copying
- it. If Array#pop or Array#shift has been called, the array will
- be still shared with the snapshot, but the array length will
- differ. */
-VALUE
-rb_ary_shared_with_p(VALUE ary1, VALUE ary2)
+static VALUE
+rb_ary_frozen_p(ary)
+ VALUE ary;
{
- if (!ARY_EMBED_P(ary1) && ARY_SHARED_P(ary1) &&
- !ARY_EMBED_P(ary2) && ARY_SHARED_P(ary2) &&
- RARRAY(ary1)->as.heap.aux.shared_root == RARRAY(ary2)->as.heap.aux.shared_root &&
- RARRAY(ary1)->as.heap.len == RARRAY(ary2)->as.heap.len) {
- return Qtrue;
- }
+ if (OBJ_FROZEN(ary)) return Qtrue;
+ if (FL_TEST(ary, ARY_TMPLOCK)) return Qtrue;
return Qfalse;
}
+static VALUE ary_alloc _((VALUE));
static VALUE
-ary_alloc(VALUE klass)
+ary_alloc(klass)
+ VALUE klass;
{
- NEWOBJ_OF(ary, struct RArray, klass, T_ARRAY | RARRAY_EMBED_FLAG | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0));
- /* Created array is:
- * FL_SET_EMBED((VALUE)ary);
- * ARY_SET_EMBED_LEN((VALUE)ary, 0);
- */
- return (VALUE)ary;
-}
+ NEWOBJ(ary, struct RArray);
+ OBJSETUP(ary, klass, T_ARRAY);
-static VALUE
-empty_ary_alloc(VALUE klass)
-{
- RUBY_DTRACE_CREATE_HOOK(ARRAY, 0);
- return ary_alloc(klass);
+ ary->len = 0;
+ ary->ptr = 0;
+ ary->aux.capa = 0;
+
+ return (VALUE)ary;
}
static VALUE
-ary_new(VALUE klass, long capa)
+ary_new(klass, len)
+ VALUE klass;
+ long len;
{
- VALUE ary,*ptr;
+ VALUE ary = ary_alloc(klass);
- if (capa < 0) {
+ if (len < 0) {
rb_raise(rb_eArgError, "negative array size (or size too big)");
}
- if (capa > ARY_MAX_SIZE) {
+ if (len > 0 && len * sizeof(VALUE) <= len) {
rb_raise(rb_eArgError, "array size too big");
}
-
- RUBY_DTRACE_CREATE_HOOK(ARRAY, capa);
-
- ary = ary_alloc(klass);
- if (capa > RARRAY_EMBED_LEN_MAX) {
- ptr = ary_heap_alloc(ary, capa);
- FL_UNSET_EMBED(ary);
- ARY_SET_PTR(ary, ptr);
- ARY_SET_CAPA(ary, capa);
- ARY_SET_HEAP_LEN(ary, 0);
- }
+ if (len == 0) len++;
+ RARRAY(ary)->ptr = ALLOC_N(VALUE, len);
+ RARRAY(ary)->aux.capa = len;
return ary;
}
VALUE
-rb_ary_new_capa(long capa)
+rb_ary_new2(len)
+ long len;
{
- return ary_new(rb_cArray, capa);
+ return ary_new(rb_cArray, len);
}
+
VALUE
-rb_ary_new(void)
+rb_ary_new()
{
- return rb_ary_new2(RARRAY_EMBED_LEN_MAX);
+ return rb_ary_new2(ARY_DEFAULT_SIZE);
}
+#ifdef HAVE_STDARG_PROTOTYPES
+#include <stdarg.h>
+#define va_init_list(a,b) va_start(a,b)
+#else
+#include <varargs.h>
+#define va_init_list(a,b) va_start(a)
+#endif
+
VALUE
-(rb_ary_new_from_args)(long n, ...)
+#ifdef HAVE_STDARG_PROTOTYPES
+rb_ary_new3(long n, ...)
+#else
+rb_ary_new3(n, va_alist)
+ long n;
+ va_dcl
+#endif
{
va_list ar;
VALUE ary;
@@ -734,290 +166,118 @@ VALUE
ary = rb_ary_new2(n);
- va_start(ar, n);
+ va_init_list(ar, n);
for (i=0; i<n; i++) {
- ARY_SET(ary, i, va_arg(ar, VALUE));
+ RARRAY(ary)->ptr[i] = va_arg(ar, VALUE);
}
va_end(ar);
- ARY_SET_LEN(ary, n);
+ RARRAY(ary)->len = n;
return ary;
}
-MJIT_FUNC_EXPORTED VALUE
-rb_ary_tmp_new_from_values(VALUE klass, long n, const VALUE *elts)
+VALUE
+rb_ary_new4(n, elts)
+ long n;
+ const VALUE *elts;
{
VALUE ary;
- ary = ary_new(klass, n);
+ ary = rb_ary_new2(n);
if (n > 0 && elts) {
- ary_memcpy(ary, 0, n, elts);
- ARY_SET_LEN(ary, n);
+ MEMCPY(RARRAY(ary)->ptr, elts, VALUE, n);
}
+ RARRAY(ary)->len = n;
return ary;
}
VALUE
-rb_ary_new_from_values(long n, const VALUE *elts)
+rb_assoc_new(car, cdr)
+ VALUE car, cdr;
{
- return rb_ary_tmp_new_from_values(rb_cArray, n, elts);
-}
+ VALUE ary;
-VALUE
-rb_ary_tmp_new(long capa)
-{
- VALUE ary = ary_new(0, capa);
- rb_ary_transient_heap_evacuate(ary, TRUE);
- return ary;
-}
+ ary = rb_ary_new2(2);
+ RARRAY(ary)->ptr[0] = car;
+ RARRAY(ary)->ptr[1] = cdr;
+ RARRAY(ary)->len = 2;
-VALUE
-rb_ary_tmp_new_fill(long capa)
-{
- VALUE ary = ary_new(0, capa);
- ary_memfill(ary, 0, capa, Qnil);
- ARY_SET_LEN(ary, capa);
- rb_ary_transient_heap_evacuate(ary, TRUE);
return ary;
}
-void
-rb_ary_free(VALUE ary)
-{
- if (ARY_OWNS_HEAP_P(ary)) {
- if (USE_DEBUG_COUNTER &&
- !ARY_SHARED_ROOT_P(ary) &&
- ARY_HEAP_CAPA(ary) > RARRAY_LEN(ary)) {
- RB_DEBUG_COUNTER_INC(obj_ary_extracapa);
- }
-
- if (RARRAY_TRANSIENT_P(ary)) {
- RB_DEBUG_COUNTER_INC(obj_ary_transient);
- }
- else {
- RB_DEBUG_COUNTER_INC(obj_ary_ptr);
- ary_heap_free(ary);
- }
- }
- else {
- RB_DEBUG_COUNTER_INC(obj_ary_embed);
- }
-
- if (ARY_SHARED_P(ary)) {
- RB_DEBUG_COUNTER_INC(obj_ary_shared);
- }
- if (ARY_SHARED_ROOT_P(ary) && ARY_SHARED_ROOT_OCCUPIED(ary)) {
- RB_DEBUG_COUNTER_INC(obj_ary_shared_root_occupied);
- }
-}
-
-RUBY_FUNC_EXPORTED size_t
-rb_ary_memsize(VALUE ary)
-{
- if (ARY_OWNS_HEAP_P(ary)) {
- return ARY_CAPA(ary) * sizeof(VALUE);
- }
- else {
- return 0;
- }
-}
-
-static inline void
-ary_discard(VALUE ary)
-{
- rb_ary_free(ary);
- RBASIC(ary)->flags |= RARRAY_EMBED_FLAG;
- RBASIC(ary)->flags &= ~(RARRAY_EMBED_LEN_MASK | RARRAY_TRANSIENT_FLAG);
-}
-
static VALUE
-ary_make_shared(VALUE ary)
-{
- assert(!ARY_EMBED_P(ary));
- ary_verify(ary);
-
- if (ARY_SHARED_P(ary)) {
- return ARY_SHARED_ROOT(ary);
- }
- else if (ARY_SHARED_ROOT_P(ary)) {
- return ary;
- }
- else if (OBJ_FROZEN(ary)) {
- rb_ary_transient_heap_evacuate(ary, TRUE);
- ary_shrink_capa(ary);
- FL_SET_SHARED_ROOT(ary);
- ARY_SET_SHARED_ROOT_REFCNT(ary, 1);
- return ary;
- }
- else {
- long capa = ARY_CAPA(ary), len = RARRAY_LEN(ary);
- const VALUE *ptr;
- NEWOBJ_OF(shared, struct RArray, 0, T_ARRAY | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0));
-
- rb_ary_transient_heap_evacuate(ary, TRUE);
- ptr = ARY_HEAP_PTR(ary);
-
- FL_UNSET_EMBED(shared);
- ARY_SET_LEN((VALUE)shared, capa);
- ARY_SET_PTR((VALUE)shared, ptr);
- ary_mem_clear((VALUE)shared, len, capa - len);
- FL_SET_SHARED_ROOT(shared);
- ARY_SET_SHARED_ROOT_REFCNT((VALUE)shared, 1);
- FL_SET_SHARED(ary);
- RB_DEBUG_COUNTER_INC(obj_ary_shared_create);
- ARY_SET_SHARED(ary, (VALUE)shared);
- OBJ_FREEZE(shared);
-
- ary_verify((VALUE)shared);
- ary_verify(ary);
-
- return (VALUE)shared;
- }
-}
-
-static VALUE
-ary_make_substitution(VALUE ary)
-{
- long len = RARRAY_LEN(ary);
-
- if (len <= RARRAY_EMBED_LEN_MAX) {
- VALUE subst = rb_ary_new2(len);
- ary_memcpy(subst, 0, len, RARRAY_CONST_PTR_TRANSIENT(ary));
- ARY_SET_EMBED_LEN(subst, len);
- return subst;
- }
- else {
- return rb_ary_increment_share(ary_make_shared(ary));
- }
-}
-
-VALUE
-rb_assoc_new(VALUE car, VALUE cdr)
-{
- return rb_ary_new3(2, car, cdr);
-}
-
-VALUE
-rb_to_array_type(VALUE ary)
+to_ary(ary)
+ VALUE ary;
{
- return rb_convert_type_with_id(ary, T_ARRAY, "Array", idTo_ary);
+ return rb_convert_type(ary, T_ARRAY, "Array", "to_ary");
}
-#define to_ary rb_to_array_type
VALUE
-rb_check_array_type(VALUE ary)
-{
- return rb_check_convert_type_with_id(ary, T_ARRAY, "Array", idTo_ary);
-}
-
-MJIT_FUNC_EXPORTED VALUE
-rb_check_to_array(VALUE ary)
+rb_check_array_type(ary)
+ VALUE ary;
{
- return rb_check_convert_type_with_id(ary, T_ARRAY, "Array", idTo_a);
+ return rb_check_convert_type(ary, T_ARRAY, "Array", "to_ary");
}
-/*
- * call-seq:
- * Array.try_convert(obj) -> array or nil
- *
- * Tries to convert +obj+ into an array, using the +to_ary+ method. Returns
- * the converted array or +nil+ if +obj+ cannot be converted.
- * This method can be used to check if an argument is an array.
- *
- * Array.try_convert([1]) #=> [1]
- * Array.try_convert("1") #=> nil
- *
- * if tmp = Array.try_convert(arg)
- * # the argument is an array
- * elsif tmp = String.try_convert(arg)
- * # the argument is a string
- * end
- *
- */
-
-static VALUE
-rb_ary_s_try_convert(VALUE dummy, VALUE ary)
-{
- return rb_check_array_type(ary);
-}
+static VALUE rb_ary_replace _((VALUE, VALUE));
/*
* call-seq:
- * Array.new(size=0, default=nil)
+ * Array.new(size=0, obj=nil)
* Array.new(array)
* Array.new(size) {|index| block }
*
- * Returns a new array.
- *
- * In the first form, if no arguments are sent, the new array will be empty.
- * When a +size+ and an optional +default+ are sent, an array is created with
- * +size+ copies of +default+. Take notice that all elements will reference the
- * same object +default+.
- *
- * The second form creates a copy of the array passed as a parameter (the
- * array is generated by calling to_ary on the parameter).
- *
- * first_array = ["Matz", "Guido"]
- *
- * second_array = Array.new(first_array) #=> ["Matz", "Guido"]
- *
- * first_array.equal? second_array #=> false
- *
- * In the last form, an array of the given size is created. Each element in
- * this array is created by passing the element's index to the given block
- * and storing the return value.
- *
- * Array.new(3) {|index| index ** 2}
- * # => [0, 1, 4]
- *
- * == Common gotchas
- *
- * When sending the second parameter, the same object will be used as the
- * value for all the array elements:
- *
+ * Returns a new array. In the first form, the new array is
+ * empty. In the second it is created with _size_ copies of _obj_
+ * (that is, _size_ references to the same
+ * _obj_). The third form creates a copy of the array
+ * passed as a parameter (the array is generated by calling
+ * to_ary on the parameter). In the last form, an array
+ * of the given size is created. Each element in this array is
+ * calculated by passing the element's index to the given block and
+ * storing the return value.
+ *
+ * Array.new
+ * Array.new(2)
+ * Array.new(5, "A")
+ *
+ * # only one copy of the object is created
* a = Array.new(2, Hash.new)
- * # => [{}, {}]
- *
* a[0]['cat'] = 'feline'
- * a # => [{"cat"=>"feline"}, {"cat"=>"feline"}]
- *
+ * a
* a[1]['cat'] = 'Felix'
- * a # => [{"cat"=>"Felix"}, {"cat"=>"Felix"}]
- *
- * Since all the Array elements store the same hash, changes to one of them
- * will affect them all.
- *
- * If multiple copies are what you want, you should use the block
- * version which uses the result of that block each time an element
- * of the array needs to be initialized:
- *
- * a = Array.new(2) {Hash.new}
+ * a
+ *
+ * # here multiple copies are created
+ * a = Array.new(2) { Hash.new }
* a[0]['cat'] = 'feline'
- * a # => [{"cat"=>"feline"}, {}]
- *
+ * a
+ *
+ * squares = Array.new(5) {|i| i*i}
+ * squares
+ *
+ * copy = Array.new(squares)
*/
static VALUE
-rb_ary_initialize(int argc, VALUE *argv, VALUE ary)
+rb_ary_initialize(argc, argv, ary)
+ int argc;
+ VALUE *argv;
+ VALUE ary;
{
long len;
VALUE size, val;
rb_ary_modify(ary);
- if (argc == 0) {
- if (ARY_OWNS_HEAP_P(ary) && ARY_HEAP_PTR(ary) != NULL) {
- ary_heap_free(ary);
- }
- rb_ary_unshare_safe(ary);
- FL_SET_EMBED(ary);
- ARY_SET_EMBED_LEN(ary, 0);
+ if (rb_scan_args(argc, argv, "02", &size, &val) == 0) {
+ RARRAY(ary)->len = 0;
if (rb_block_given_p()) {
rb_warning("given block not used");
}
return ary;
}
- rb_scan_args(argc, argv, "02", &size, &val);
+
if (argc == 1 && !FIXNUM_P(size)) {
val = rb_check_array_type(size);
if (!NIL_P(val)) {
@@ -1027,16 +287,16 @@ rb_ary_initialize(int argc, VALUE *argv, VALUE ary)
}
len = NUM2LONG(size);
- /* NUM2LONG() may call size.to_int, ary can be frozen, modified, etc */
if (len < 0) {
rb_raise(rb_eArgError, "negative array size");
}
- if (len > ARY_MAX_SIZE) {
+ if (len > 0 && len * (long)sizeof(VALUE) <= len) {
rb_raise(rb_eArgError, "array size too big");
}
- /* recheck after argument conversion */
- rb_ary_modify(ary);
- ary_resize_capa(ary, len);
+ if (len > RARRAY(ary)->aux.capa) {
+ REALLOC_N(RARRAY(ary)->ptr, VALUE, len);
+ RARRAY(ary)->aux.capa = len;
+ }
if (rb_block_given_p()) {
long i;
@@ -1044,515 +304,326 @@ rb_ary_initialize(int argc, VALUE *argv, VALUE ary)
rb_warn("block supersedes default value argument");
}
for (i=0; i<len; i++) {
- rb_ary_store(ary, i, rb_yield(LONG2NUM(i)));
- ARY_SET_LEN(ary, i + 1);
+ RARRAY(ary)->ptr[i] = rb_yield(LONG2NUM(i));
+ RARRAY(ary)->len = i + 1;
}
}
else {
- ary_memfill(ary, 0, len, val);
- ARY_SET_LEN(ary, len);
+ memfill(RARRAY(ary)->ptr, len, val);
+ RARRAY(ary)->len = len;
}
+
return ary;
}
-/*
- * Returns a new array populated with the given objects.
- *
- * Array.[]( 1, 'a', /^A/) # => [1, "a", /^A/]
- * Array[ 1, 'a', /^A/ ] # => [1, "a", /^A/]
- * [ 1, 'a', /^A/ ] # => [1, "a", /^A/]
- */
+
+/*
+* Returns a new array populated with the given objects.
+*
+* Array.[]( 1, 'a', /^A/ )
+* Array[ 1, 'a', /^A/ ]
+* [ 1, 'a', /^A/ ]
+*/
static VALUE
-rb_ary_s_create(int argc, VALUE *argv, VALUE klass)
+rb_ary_s_create(argc, argv, klass)
+ int argc;
+ VALUE *argv;
+ VALUE klass;
{
- VALUE ary = ary_new(klass, argc);
- if (argc > 0 && argv) {
- ary_memcpy(ary, 0, argc, argv);
- ARY_SET_LEN(ary, argc);
+ VALUE ary = ary_alloc(klass);
+
+ if (argc < 0) {
+ rb_raise(rb_eArgError, "negative number of arguments");
}
+ if (argc > 0) {
+ RARRAY(ary)->ptr = ALLOC_N(VALUE, argc);
+ MEMCPY(RARRAY(ary)->ptr, argv, VALUE, argc);
+ }
+ RARRAY(ary)->len = RARRAY(ary)->aux.capa = argc;
return ary;
}
void
-rb_ary_store(VALUE ary, long idx, VALUE val)
+rb_ary_store(ary, idx, val)
+ VALUE ary;
+ long idx;
+ VALUE val;
{
- long len = RARRAY_LEN(ary);
-
+ rb_ary_modify(ary);
if (idx < 0) {
- idx += len;
+ idx += RARRAY(ary)->len;
if (idx < 0) {
- rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
- idx - len, -len);
+ rb_raise(rb_eIndexError, "index %ld out of array",
+ idx - RARRAY(ary)->len);
}
}
- else if (idx >= ARY_MAX_SIZE) {
- rb_raise(rb_eIndexError, "index %ld too big", idx);
- }
-
- rb_ary_modify(ary);
- if (idx >= ARY_CAPA(ary)) {
- ary_double_capa(ary, idx);
- }
- if (idx > len) {
- ary_mem_clear(ary, len, idx - len + 1);
- }
- if (idx >= len) {
- ARY_SET_LEN(ary, idx + 1);
- }
- ARY_SET(ary, idx, val);
-}
+ if (idx >= RARRAY(ary)->aux.capa) {
+ long new_capa = RARRAY(ary)->aux.capa / 2;
-static VALUE
-ary_make_partial(VALUE ary, VALUE klass, long offset, long len)
-{
- assert(offset >= 0);
- assert(len >= 0);
- assert(offset+len <= RARRAY_LEN(ary));
-
- if (len <= RARRAY_EMBED_LEN_MAX) {
- VALUE result = ary_alloc(klass);
- ary_memcpy(result, 0, len, RARRAY_CONST_PTR_TRANSIENT(ary) + offset);
- ARY_SET_EMBED_LEN(result, len);
- return result;
+ if (new_capa < ARY_DEFAULT_SIZE) {
+ new_capa = ARY_DEFAULT_SIZE;
+ }
+ new_capa += idx;
+ if (new_capa * (long)sizeof(VALUE) <= new_capa) {
+ rb_raise(rb_eArgError, "index too big");
+ }
+ REALLOC_N(RARRAY(ary)->ptr, VALUE, new_capa);
+ RARRAY(ary)->aux.capa = new_capa;
}
- else {
- VALUE shared, result = ary_alloc(klass);
- FL_UNSET_EMBED(result);
-
- shared = ary_make_shared(ary);
- ARY_SET_PTR(result, RARRAY_CONST_PTR_TRANSIENT(ary));
- ARY_SET_LEN(result, RARRAY_LEN(ary));
- rb_ary_set_shared(result, shared);
-
- ARY_INCREASE_PTR(result, offset);
- ARY_SET_LEN(result, len);
-
- ary_verify(shared);
- ary_verify(result);
- return result;
+ if (idx > RARRAY(ary)->len) {
+ rb_mem_clear(RARRAY(ary)->ptr + RARRAY(ary)->len,
+ idx-RARRAY(ary)->len + 1);
}
-}
-
-static VALUE
-ary_make_shared_copy(VALUE ary)
-{
- return ary_make_partial(ary, rb_obj_class(ary), 0, RARRAY_LEN(ary));
-}
-
-enum ary_take_pos_flags
-{
- ARY_TAKE_FIRST = 0,
- ARY_TAKE_LAST = 1
-};
-
-static VALUE
-ary_take_first_or_last(int argc, const VALUE *argv, VALUE ary, enum ary_take_pos_flags last)
-{
- long n;
- long len;
- long offset = 0;
-
- argc = rb_check_arity(argc, 0, 1);
- /* the case optional argument is omitted should be handled in
- * callers of this function. if another arity case is added,
- * this arity check needs to rewrite. */
- RUBY_ASSERT_ALWAYS(argc == 1);
- n = NUM2LONG(argv[0]);
- len = RARRAY_LEN(ary);
- if (n > len) {
- n = len;
+ if (idx >= RARRAY(ary)->len) {
+ RARRAY(ary)->len = idx + 1;
}
- else if (n < 0) {
- rb_raise(rb_eArgError, "negative array size");
- }
- if (last) {
- offset = len - n;
- }
- return ary_make_partial(ary, rb_cArray, offset, n);
+ RARRAY(ary)->ptr[idx] = val;
}
/*
* call-seq:
- * ary << obj -> ary
- *
+ * array << obj -> array
+ *
* Append---Pushes the given object on to the end of this array. This
* expression returns the array itself, so several appends
* may be chained together.
*
- * a = [ 1, 2 ]
- * a << "c" << "d" << [ 3, 4 ]
- * #=> [ 1, 2, "c", "d", [ 3, 4 ] ]
- * a
+ * [ 1, 2 ] << "c" << "d" << [ 3, 4 ]
* #=> [ 1, 2, "c", "d", [ 3, 4 ] ]
*
*/
VALUE
-rb_ary_push(VALUE ary, VALUE item)
-{
- long idx = RARRAY_LEN((ary_verify(ary), ary));
- VALUE target_ary = ary_ensure_room_for_push(ary, 1);
- RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
- RB_OBJ_WRITE(target_ary, &ptr[idx], item);
- });
- ARY_SET_LEN(ary, idx + 1);
- ary_verify(ary);
- return ary;
-}
-
-VALUE
-rb_ary_cat(VALUE ary, const VALUE *argv, long len)
+rb_ary_push(ary, item)
+ VALUE ary;
+ VALUE item;
{
- long oldlen = RARRAY_LEN(ary);
- VALUE target_ary = ary_ensure_room_for_push(ary, len);
- ary_memcpy0(ary, oldlen, len, argv, target_ary);
- ARY_SET_LEN(ary, oldlen + len);
+ rb_ary_store(ary, RARRAY(ary)->len, item);
return ary;
}
-/*
+/*
* call-seq:
- * ary.push(obj, ...) -> ary
- * ary.append(obj, ...) -> ary
- *
- * Append --- Pushes the given object(s) on to the end of this array. This
+ * array.push(obj, ... ) -> array
+ *
+ * Append---Pushes the given object(s) on to the end of this array. This
* expression returns the array itself, so several appends
- * may be chained together. See also Array#pop for the opposite
- * effect.
+ * may be chained together.
*
* a = [ "a", "b", "c" ]
- * a.push("d", "e", "f")
+ * a.push("d", "e", "f")
* #=> ["a", "b", "c", "d", "e", "f"]
- * [1, 2, 3].push(4).push(5)
- * #=> [1, 2, 3, 4, 5]
*/
static VALUE
-rb_ary_push_m(int argc, VALUE *argv, VALUE ary)
-{
- return rb_ary_cat(ary, argv, argc);
-}
-
-VALUE
-rb_ary_pop(VALUE ary)
+rb_ary_push_m(argc, argv, ary)
+ int argc;
+ VALUE *argv;
+ VALUE ary;
{
- long n;
- rb_ary_modify_check(ary);
- n = RARRAY_LEN(ary);
- if (n == 0) return Qnil;
- if (ARY_OWNS_HEAP_P(ary) &&
- n * 3 < ARY_CAPA(ary) &&
- ARY_CAPA(ary) > ARY_DEFAULT_SIZE)
- {
- ary_resize_capa(ary, n * 2);
- }
- --n;
- ARY_SET_LEN(ary, n);
- ary_verify(ary);
- return RARRAY_AREF(ary, n);
+ while (argc--) {
+ rb_ary_push(ary, *argv++);
+ }
+ return ary;
}
/*
* call-seq:
- * ary.pop -> obj or nil
- * ary.pop(n) -> new_ary
- *
- * Removes the last element from +self+ and returns it, or
- * +nil+ if the array is empty.
- *
- * If a number +n+ is given, returns an array of the last +n+ elements
- * (or less) just like <code>array.slice!(-n, n)</code> does. See also
- * Array#push for the opposite effect.
- *
- * a = [ "a", "b", "c", "d" ]
- * a.pop #=> "d"
- * a.pop(2) #=> ["b", "c"]
- * a #=> ["a"]
+ * array.pop -> obj or nil
+ *
+ * Removes the last element from <i>self</i> and returns it, or
+ * <code>nil</code> if the array is empty.
+ *
+ * a = [ "a", "m", "z" ]
+ * a.pop #=> "z"
+ * a #=> ["a", "m"]
*/
-static VALUE
-rb_ary_pop_m(int argc, VALUE *argv, VALUE ary)
+VALUE
+rb_ary_pop(ary)
+ VALUE ary;
{
- VALUE result;
-
- if (argc == 0) {
- return rb_ary_pop(ary);
- }
-
rb_ary_modify_check(ary);
- result = ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
- ARY_INCREASE_LEN(ary, -RARRAY_LEN(result));
- ary_verify(ary);
- return result;
+ if (RARRAY(ary)->len == 0) return Qnil;
+ if (!FL_TEST(ary, ELTS_SHARED) &&
+ RARRAY(ary)->len * 2 < RARRAY(ary)->aux.capa &&
+ RARRAY(ary)->aux.capa > ARY_DEFAULT_SIZE) {
+ RARRAY(ary)->aux.capa = RARRAY(ary)->len * 2;
+ REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->aux.capa);
+ }
+ return RARRAY(ary)->ptr[--RARRAY(ary)->len];
}
-VALUE
-rb_ary_shift(VALUE ary)
+static void
+ary_make_shared(ary)
+ VALUE ary;
{
- VALUE top;
- long len = RARRAY_LEN(ary);
-
- rb_ary_modify_check(ary);
- if (len == 0) return Qnil;
- top = RARRAY_AREF(ary, 0);
- if (!ARY_SHARED_P(ary)) {
- if (len < ARY_DEFAULT_SIZE) {
- RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
- MEMMOVE(ptr, ptr+1, VALUE, len-1);
- }); /* WB: no new reference */
- ARY_INCREASE_LEN(ary, -1);
- ary_verify(ary);
- return top;
- }
- assert(!ARY_EMBED_P(ary)); /* ARY_EMBED_LEN_MAX < ARY_DEFAULT_SIZE */
+ if (!FL_TEST(ary, ELTS_SHARED)) {
+ NEWOBJ(shared, struct RArray);
+ OBJSETUP(shared, rb_cArray, T_ARRAY);
- ARY_SET(ary, 0, Qnil);
- ary_make_shared(ary);
+ shared->len = RARRAY(ary)->len;
+ shared->ptr = RARRAY(ary)->ptr;
+ shared->aux.capa = RARRAY(ary)->aux.capa;
+ RARRAY(ary)->aux.shared = (VALUE)shared;
+ FL_SET(ary, ELTS_SHARED);
}
- else if (ARY_SHARED_ROOT_OCCUPIED(ARY_SHARED_ROOT(ary))) {
- RARRAY_PTR_USE_TRANSIENT(ary, ptr, ptr[0] = Qnil);
- }
- ARY_INCREASE_PTR(ary, 1); /* shift ptr */
- ARY_INCREASE_LEN(ary, -1);
-
- ary_verify(ary);
-
- return top;
}
/*
* call-seq:
- * ary.shift -> obj or nil
- * ary.shift(n) -> new_ary
- *
- * Removes the first element of +self+ and returns it (shifting all
- * other elements down by one). Returns +nil+ if the array
+ * array.shift -> obj or nil
+ *
+ * Returns the first element of <i>self</i> and removes it (shifting all
+ * other elements down by one). Returns <code>nil</code> if the array
* is empty.
- *
- * If a number +n+ is given, returns an array of the first +n+ elements
- * (or less) just like <code>array.slice!(0, n)</code> does. With +ary+
- * containing only the remainder elements, not including what was shifted to
- * +new_ary+. See also Array#unshift for the opposite effect.
- *
- * args = [ "-m", "-q", "filename" ]
- * args.shift #=> "-m"
- * args #=> ["-q", "filename"]
- *
+ *
* args = [ "-m", "-q", "filename" ]
- * args.shift(2) #=> ["-m", "-q"]
- * args #=> ["filename"]
+ * args.shift #=> "-m"
+ * args #=> ["-q", "filename"]
*/
-static VALUE
-rb_ary_shift_m(int argc, VALUE *argv, VALUE ary)
-{
- VALUE result;
- long n;
-
- if (argc == 0) {
- return rb_ary_shift(ary);
- }
-
- rb_ary_modify_check(ary);
- result = ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
- n = RARRAY_LEN(result);
- rb_ary_behead(ary,n);
-
- return result;
-}
-
-MJIT_FUNC_EXPORTED VALUE
-rb_ary_behead(VALUE ary, long n)
+VALUE
+rb_ary_shift(ary)
+ VALUE ary;
{
- if (n<=0) return ary;
+ VALUE top;
rb_ary_modify_check(ary);
- if (ARY_SHARED_P(ary)) {
- if (ARY_SHARED_ROOT_OCCUPIED(ARY_SHARED_ROOT(ary))) {
- setup_occupied_shared:
- ary_mem_clear(ary, 0, n);
- }
- ARY_INCREASE_PTR(ary, n);
- }
- else {
- if (RARRAY_LEN(ary) < ARY_DEFAULT_SIZE) {
- RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
- MEMMOVE(ptr, ptr+n, VALUE, RARRAY_LEN(ary)-n);
- }); /* WB: no new reference */
- }
- else {
- ary_make_shared(ary);
- goto setup_occupied_shared;
- }
- }
- ARY_INCREASE_LEN(ary, -n);
+ if (RARRAY(ary)->len == 0) return Qnil;
+ top = RARRAY(ary)->ptr[0];
+ ary_make_shared(ary);
+ RARRAY(ary)->ptr++; /* shift ptr */
+ RARRAY(ary)->len--;
- ary_verify(ary);
- return ary;
+ return top;
}
-static VALUE
-ary_ensure_room_for_unshift(VALUE ary, int argc)
+VALUE
+rb_ary_unshift(ary, item)
+ VALUE ary, item;
{
- long len = RARRAY_LEN(ary);
- long new_len = len + argc;
- long capa;
- const VALUE *head, *sharedp;
-
- if (len > ARY_MAX_SIZE - argc) {
- rb_raise(rb_eIndexError, "index %ld too big", new_len);
- }
-
- if (ARY_SHARED_P(ary)) {
- VALUE shared_root = ARY_SHARED_ROOT(ary);
- capa = RARRAY_LEN(shared_root);
- if (ARY_SHARED_ROOT_OCCUPIED(shared_root) && capa > new_len) {
- rb_ary_modify_check(ary);
- head = RARRAY_CONST_PTR_TRANSIENT(ary);
- sharedp = RARRAY_CONST_PTR_TRANSIENT(shared_root);
- goto makeroom_if_need;
+ rb_ary_modify(ary);
+ if (RARRAY(ary)->len == RARRAY(ary)->aux.capa) {
+ long capa_inc = RARRAY(ary)->aux.capa / 2;
+ if (capa_inc < ARY_DEFAULT_SIZE) {
+ capa_inc = ARY_DEFAULT_SIZE;
}
+ RARRAY(ary)->aux.capa += capa_inc;
+ REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->aux.capa);
}
- rb_ary_modify(ary);
- capa = ARY_CAPA(ary);
- if (capa - (capa >> 6) <= new_len) {
- ary_double_capa(ary, new_len);
- }
-
- /* use shared array for big "queues" */
- if (new_len > ARY_DEFAULT_SIZE * 4) {
- ary_verify(ary);
-
- /* make a room for unshifted items */
- capa = ARY_CAPA(ary);
- ary_make_shared(ary);
-
- head = sharedp = RARRAY_CONST_PTR_TRANSIENT(ary);
- goto makeroom;
- makeroom_if_need:
- if (head - sharedp < argc) {
- long room;
- makeroom:
- room = capa - new_len;
- room -= room >> 4;
- MEMMOVE((VALUE *)sharedp + argc + room, head, VALUE, len);
- head = sharedp + argc + room;
- }
- ARY_SET_PTR(ary, head - argc);
- assert(ARY_SHARED_ROOT_OCCUPIED(ARY_SHARED_ROOT(ary)));
+ /* sliding items */
+ MEMMOVE(RARRAY(ary)->ptr + 1, RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
- ary_verify(ary);
- return ARY_SHARED_ROOT(ary);
- }
- else {
- /* sliding items */
- RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
- MEMMOVE(ptr + argc, ptr, VALUE, len);
- });
+ RARRAY(ary)->len++;
+ RARRAY(ary)->ptr[0] = item;
- ary_verify(ary);
- return ary;
- }
+ return ary;
}
/*
* call-seq:
- * ary.unshift(obj, ...) -> ary
- * ary.prepend(obj, ...) -> ary
- *
- * Prepends objects to the front of +self+, moving other elements upwards.
- * See also Array#shift for the opposite effect.
- *
+ * array.unshift(obj, ...) -> array
+ *
+ * Prepends objects to the front of <i>array</i>.
+ * other elements up one.
+ *
* a = [ "b", "c", "d" ]
* a.unshift("a") #=> ["a", "b", "c", "d"]
* a.unshift(1, 2) #=> [ 1, 2, "a", "b", "c", "d"]
*/
static VALUE
-rb_ary_unshift_m(int argc, VALUE *argv, VALUE ary)
+rb_ary_unshift_m(argc, argv, ary)
+ int argc;
+ VALUE *argv;
+ VALUE ary;
{
- long len = RARRAY_LEN(ary);
- VALUE target_ary;
+ long len = RARRAY(ary)->len;
- if (argc == 0) {
- rb_ary_modify_check(ary);
- return ary;
+ if (argc < 0) {
+ rb_raise(rb_eArgError, "negative number of arguments");
}
+ if (argc == 0) return ary;
+
+ /* make rooms by setting the last item */
+ rb_ary_store(ary, len + argc - 1, Qnil);
- target_ary = ary_ensure_room_for_unshift(ary, argc);
- ary_memcpy0(ary, 0, argc, argv, target_ary);
- ARY_SET_LEN(ary, len + argc);
+ /* sliding items */
+ MEMMOVE(RARRAY(ary)->ptr + argc, RARRAY(ary)->ptr, VALUE, len);
+ MEMCPY(RARRAY(ary)->ptr, argv, VALUE, argc);
+
return ary;
}
VALUE
-rb_ary_unshift(VALUE ary, VALUE item)
+rb_ary_entry(ary, offset)
+ VALUE ary;
+ long offset;
{
- return rb_ary_unshift_m(1,&item,ary);
-}
+ if (RARRAY(ary)->len == 0) return Qnil;
-/* faster version - use this if you don't need to treat negative offset */
-static inline VALUE
-rb_ary_elt(VALUE ary, long offset)
-{
- long len = RARRAY_LEN(ary);
- if (len == 0) return Qnil;
- if (offset < 0 || len <= offset) {
+ if (offset < 0) {
+ offset += RARRAY(ary)->len;
+ }
+ if (offset < 0 || RARRAY(ary)->len <= offset) {
return Qnil;
}
- return RARRAY_AREF(ary, offset);
-}
-VALUE
-rb_ary_entry(VALUE ary, long offset)
-{
- return rb_ary_entry_internal(ary, offset);
+ return RARRAY(ary)->ptr[offset];
}
-VALUE
-rb_ary_subseq(VALUE ary, long beg, long len)
+static VALUE
+rb_ary_subseq(ary, beg, len)
+ VALUE ary;
+ long beg, len;
{
- VALUE klass;
- long alen = RARRAY_LEN(ary);
+ VALUE klass, ary2;
- if (beg > alen) return Qnil;
+ if (beg > RARRAY(ary)->len) return Qnil;
if (beg < 0 || len < 0) return Qnil;
- if (alen < len || alen < beg + len) {
- len = alen - beg;
+ if (beg + len > RARRAY(ary)->len) {
+ len = RARRAY(ary)->len - beg;
+ if (len < 0)
+ len = 0;
}
klass = rb_obj_class(ary);
if (len == 0) return ary_new(klass, 0);
- return ary_make_partial(ary, klass, beg, len);
-}
+ ary_make_shared(ary);
+ ary2 = ary_alloc(klass);
+ RARRAY(ary2)->ptr = RARRAY(ary)->ptr + beg;
+ RARRAY(ary2)->len = len;
+ RARRAY(ary2)->aux.shared = RARRAY(ary)->aux.shared;
+ FL_SET(ary2, ELTS_SHARED);
-static VALUE rb_ary_aref2(VALUE ary, VALUE b, VALUE e);
+ return ary2;
+}
-/*
+/*
* call-seq:
- * ary[index] -> obj or nil
- * ary[start, length] -> new_ary or nil
- * ary[range] -> new_ary or nil
- * ary.slice(index) -> obj or nil
- * ary.slice(start, length) -> new_ary or nil
- * ary.slice(range) -> new_ary or nil
- *
- * Element Reference --- Returns the element at +index+, or returns a
- * subarray starting at the +start+ index and continuing for +length+
- * elements, or returns a subarray specified by +range+ of indices.
- *
- * Negative indices count backward from the end of the array (-1 is the last
- * element). For +start+ and +range+ cases the starting index is just before
- * an element. Additionally, an empty array is returned when the starting
- * index for an element range is at the end of the array.
+ * array[index] -> obj or nil
+ * array[start, length] -> an_array or nil
+ * array[range] -> an_array or nil
+ * array.slice(index) -> obj or nil
+ * array.slice(start, length) -> an_array or nil
+ * array.slice(range) -> an_array or nil
*
- * Returns +nil+ if the index (or starting index) are out of range.
+ * Element Reference---Returns the element at _index_,
+ * or returns a subarray starting at _start_ and
+ * continuing for _length_ elements, or returns a subarray
+ * specified by _range_.
+ * Negative indices count backward from the end of the
+ * array (-1 is the last element). Returns nil if any indices
+ * are out of range unless the index equals the array size and a
+ * _length_ or _range_ parameter is given, in which case an
+ * empty array is returned.
*
* a = [ "a", "b", "c", "d", "e" ]
* a[2] + a[0] + a[1] #=> "cab"
@@ -1564,44 +635,44 @@ static VALUE rb_ary_aref2(VALUE ary, VALUE b, VALUE e);
* a[-3, 3] #=> [ "c", "d", "e" ]
* # special cases
* a[5] #=> nil
- * a[6, 1] #=> nil
* a[5, 1] #=> []
* a[5..10] #=> []
*
*/
VALUE
-rb_ary_aref(int argc, const VALUE *argv, VALUE ary)
+rb_ary_aref(argc, argv, ary)
+ int argc;
+ VALUE *argv;
+ VALUE ary;
{
- rb_check_arity(argc, 1, 2);
+ VALUE arg;
+ long beg, len;
+
if (argc == 2) {
- return rb_ary_aref2(ary, argv[0], argv[1]);
+ if (SYMBOL_P(argv[0])) {
+ rb_raise(rb_eTypeError, "Symbol as array index");
+ }
+ beg = NUM2LONG(argv[0]);
+ len = NUM2LONG(argv[1]);
+ if (beg < 0) {
+ beg += RARRAY(ary)->len;
+ }
+ return rb_ary_subseq(ary, beg, len);
}
- return rb_ary_aref1(ary, argv[0]);
-}
-
-VALUE
-rb_ary_aref2(VALUE ary, VALUE b, VALUE e)
-{
- long beg = NUM2LONG(b);
- long len = NUM2LONG(e);
- if (beg < 0) {
- beg += RARRAY_LEN(ary);
+ if (argc != 1) {
+ rb_scan_args(argc, argv, "11", 0, 0);
}
- return rb_ary_subseq(ary, beg, len);
-}
-
-MJIT_FUNC_EXPORTED VALUE
-rb_ary_aref1(VALUE ary, VALUE arg)
-{
- long beg, len;
-
+ arg = argv[0];
/* special case - speeding up */
if (FIXNUM_P(arg)) {
return rb_ary_entry(ary, FIX2LONG(arg));
}
+ if (SYMBOL_P(arg)) {
+ rb_raise(rb_eTypeError, "Symbol as array index");
+ }
/* check if idx is Range */
- switch (rb_range_beg_len(arg, &beg, &len, RARRAY_LEN(ary), 0)) {
+ switch (rb_range_beg_len(arg, &beg, &len, RARRAY(ary)->len, 0)) {
case Qfalse:
break;
case Qnil:
@@ -1612,106 +683,125 @@ rb_ary_aref1(VALUE ary, VALUE arg)
return rb_ary_entry(ary, NUM2LONG(arg));
}
-/*
+/*
* call-seq:
- * ary.at(index) -> obj or nil
+ * array.at(index) -> obj or nil
*
- * Returns the element at +index+. A negative index counts from the end of
- * +self+. Returns +nil+ if the index is out of range. See also
- * Array#[].
+ * Returns the element at _index_. A
+ * negative index counts from the end of _self_. Returns +nil+
+ * if the index is out of range. See also <code>Array#[]</code>.
+ * (<code>Array#at</code> is slightly faster than <code>Array#[]</code>,
+ * as it does not accept ranges and so on.)
*
* a = [ "a", "b", "c", "d", "e" ]
* a.at(0) #=> "a"
* a.at(-1) #=> "e"
*/
-VALUE
-rb_ary_at(VALUE ary, VALUE pos)
+static VALUE
+rb_ary_at(ary, pos)
+ VALUE ary, pos;
{
return rb_ary_entry(ary, NUM2LONG(pos));
}
/*
* call-seq:
- * ary.first -> obj or nil
- * ary.first(n) -> new_ary
- *
- * Returns the first element, or the first +n+ elements, of the array.
- * If the array is empty, the first form returns +nil+, and the
- * second form returns an empty array. See also Array#last for
- * the opposite effect.
- *
+ * array.first -> obj or nil
+ *
+ * Returns the first element of the array. If the array is empty,
+ * returns <code>nil</code>.
+ *
* a = [ "q", "r", "s", "t" ]
- * a.first #=> "q"
- * a.first(2) #=> ["q", "r"]
+ * a.first #=> "q"
*/
static VALUE
-rb_ary_first(int argc, VALUE *argv, VALUE ary)
+rb_ary_first(argc, argv, ary)
+ int argc;
+ VALUE *argv;
+ VALUE ary;
{
if (argc == 0) {
- if (RARRAY_LEN(ary) == 0) return Qnil;
- return RARRAY_AREF(ary, 0);
+ if (RARRAY(ary)->len == 0) return Qnil;
+ return RARRAY(ary)->ptr[0];
}
else {
- return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
+ VALUE nv, result;
+ long n, i;
+
+ rb_scan_args(argc, argv, "01", &nv);
+ n = NUM2LONG(nv);
+ if (n > RARRAY(ary)->len) n = RARRAY(ary)->len;
+ result = rb_ary_new2(n);
+ for (i=0; i<n; i++) {
+ rb_ary_push(result, RARRAY(ary)->ptr[i]);
+ }
+ return result;
}
}
/*
* call-seq:
- * ary.last -> obj or nil
- * ary.last(n) -> new_ary
- *
- * Returns the last element(s) of +self+. If the array is empty,
- * the first form returns +nil+.
- *
- * See also Array#first for the opposite effect.
- *
- * a = [ "w", "x", "y", "z" ]
- * a.last #=> "z"
- * a.last(2) #=> ["y", "z"]
+ * array.last -> obj or nil
+ * array.last(n) -> an_array
+ *
+ * Returns the last element(s) of <i>self</i>. If the array is empty,
+ * the first form returns <code>nil</code>.
+ *
+ * [ "w", "x", "y", "z" ].last #=> "z"
*/
-VALUE
-rb_ary_last(int argc, const VALUE *argv, VALUE ary)
+static VALUE
+rb_ary_last(argc, argv, ary)
+ int argc;
+ VALUE *argv;
+ VALUE ary;
{
if (argc == 0) {
- long len = RARRAY_LEN(ary);
- if (len == 0) return Qnil;
- return RARRAY_AREF(ary, len-1);
+ if (RARRAY(ary)->len == 0) return Qnil;
+ return RARRAY(ary)->ptr[RARRAY(ary)->len-1];
}
else {
- return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
+ VALUE nv, result;
+ long n, i;
+
+ rb_scan_args(argc, argv, "01", &nv);
+ n = NUM2LONG(nv);
+ if (n > RARRAY(ary)->len) n = RARRAY(ary)->len;
+ result = rb_ary_new2(n);
+ for (i=RARRAY(ary)->len-n; n--; i++) {
+ rb_ary_push(result, RARRAY(ary)->ptr[i]);
+ }
+ return result;
}
}
/*
* call-seq:
- * ary.fetch(index) -> obj
- * ary.fetch(index, default) -> obj
- * ary.fetch(index) {|index| block} -> obj
- *
- * Tries to return the element at position +index+, but throws an IndexError
- * exception if the referenced +index+ lies outside of the array bounds. This
- * error can be prevented by supplying a second argument, which will act as a
- * +default+ value.
- *
- * Alternatively, if a block is given it will only be executed when an
- * invalid +index+ is referenced.
- *
- * Negative values of +index+ count from the end of the array.
- *
+ * array.fetch(index) -> obj
+ * array.fetch(index, default ) -> obj
+ * array.fetch(index) {|index| block } -> obj
+ *
+ * Tries to return the element at position <i>index</i>. If the index
+ * lies outside the array, the first form throws an
+ * <code>IndexError</code> exception, the second form returns
+ * <i>default</i>, and the third form returns the value of invoking
+ * the block, passing in the index. Negative values of <i>index</i>
+ * count from the end of the array.
+ *
* a = [ 11, 22, 33, 44 ]
* a.fetch(1) #=> 22
* a.fetch(-1) #=> 44
* a.fetch(4, 'cat') #=> "cat"
- * a.fetch(100) {|i| puts "#{i} is out of bounds"}
- * #=> "100 is out of bounds"
+ * a.fetch(4) { |i| i*i } #=> 16
*/
static VALUE
-rb_ary_fetch(int argc, VALUE *argv, VALUE ary)
+rb_ary_fetch(argc, argv, ary)
+ int argc;
+ VALUE *argv;
+ VALUE ary;
{
VALUE pos, ifnone;
long block_given;
@@ -1725,293 +815,194 @@ rb_ary_fetch(int argc, VALUE *argv, VALUE ary)
idx = NUM2LONG(pos);
if (idx < 0) {
- idx += RARRAY_LEN(ary);
+ idx += RARRAY(ary)->len;
}
- if (idx < 0 || RARRAY_LEN(ary) <= idx) {
+ if (idx < 0 || RARRAY(ary)->len <= idx) {
if (block_given) return rb_yield(pos);
if (argc == 1) {
- rb_raise(rb_eIndexError, "index %ld outside of array bounds: %ld...%ld",
- idx - (idx < 0 ? RARRAY_LEN(ary) : 0), -RARRAY_LEN(ary), RARRAY_LEN(ary));
+ rb_raise(rb_eIndexError, "index %ld out of array", idx);
}
return ifnone;
}
- return RARRAY_AREF(ary, idx);
+ return RARRAY(ary)->ptr[idx];
}
/*
* call-seq:
- * ary.find_index(obj) -> int or nil
- * ary.find_index {|item| block} -> int or nil
- * ary.find_index -> Enumerator
- * ary.index(obj) -> int or nil
- * ary.index {|item| block} -> int or nil
- * ary.index -> Enumerator
- *
- * Returns the _index_ of the first object in +ary+ such that the object is
- * <code>==</code> to +obj+.
- *
- * If a block is given instead of an argument, returns the _index_ of the
- * first object for which the block returns +true+. Returns +nil+ if no
- * match is found.
- *
- * See also Array#rindex.
- *
- * An Enumerator is returned if neither a block nor argument is given.
- *
+ * array.index(obj) -> int or nil
+ *
+ * Returns the index of the first object in <i>self</i> such that is
+ * <code>==</code> to <i>obj</i>. Returns <code>nil</code> if
+ * no match is found.
+ *
* a = [ "a", "b", "c" ]
- * a.index("b") #=> 1
- * a.index("z") #=> nil
- * a.index {|x| x == "b"} #=> 1
+ * a.index("b") #=> 1
+ * a.index("z") #=> nil
*/
static VALUE
-rb_ary_index(int argc, VALUE *argv, VALUE ary)
-{
+rb_ary_index(ary, val)
+ VALUE ary;
VALUE val;
+{
long i;
- if (argc == 0) {
- RETURN_ENUMERATOR(ary, 0, 0);
- for (i=0; i<RARRAY_LEN(ary); i++) {
- if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
- return LONG2NUM(i);
- }
- }
- return Qnil;
- }
- rb_check_arity(argc, 0, 1);
- val = argv[0];
- if (rb_block_given_p())
- rb_warn("given block not used");
- for (i=0; i<RARRAY_LEN(ary); i++) {
- VALUE e = RARRAY_AREF(ary, i);
- if (rb_equal(e, val)) {
+ for (i=0; i<RARRAY(ary)->len; i++) {
+ if (rb_equal(RARRAY(ary)->ptr[i], val))
return LONG2NUM(i);
- }
}
return Qnil;
}
/*
* call-seq:
- * ary.rindex(obj) -> int or nil
- * ary.rindex {|item| block} -> int or nil
- * ary.rindex -> Enumerator
- *
- * Returns the _index_ of the last object in +self+ <code>==</code> to +obj+.
- *
- * If a block is given instead of an argument, returns the _index_ of the
- * first object for which the block returns +true+, starting from the last
- * object.
- *
- * Returns +nil+ if no match is found.
- *
- * See also Array#index.
- *
- * If neither block nor argument is given, an Enumerator is returned instead.
- *
+ * array.rindex(obj) -> int or nil
+ *
+ * Returns the index of the last object in <i>array</i>
+ * <code>==</code> to <i>obj</i>. Returns <code>nil</code> if
+ * no match is found.
+ *
* a = [ "a", "b", "b", "b", "c" ]
- * a.rindex("b") #=> 3
- * a.rindex("z") #=> nil
- * a.rindex {|x| x == "b"} #=> 3
+ * a.rindex("b") #=> 3
+ * a.rindex("z") #=> nil
*/
static VALUE
-rb_ary_rindex(int argc, VALUE *argv, VALUE ary)
-{
+rb_ary_rindex(ary, val)
+ VALUE ary;
VALUE val;
- long i = RARRAY_LEN(ary), len;
+{
+ long i = RARRAY(ary)->len;
- if (argc == 0) {
- RETURN_ENUMERATOR(ary, 0, 0);
- while (i--) {
- if (RTEST(rb_yield(RARRAY_AREF(ary, i))))
- return LONG2NUM(i);
- if (i > (len = RARRAY_LEN(ary))) {
- i = len;
- }
- }
- return Qnil;
- }
- rb_check_arity(argc, 0, 1);
- val = argv[0];
- if (rb_block_given_p())
- rb_warn("given block not used");
while (i--) {
- VALUE e = RARRAY_AREF(ary, i);
- if (rb_equal(e, val)) {
+ if (rb_equal(RARRAY(ary)->ptr[i], val))
return LONG2NUM(i);
- }
- if (i > RARRAY_LEN(ary)) {
- break;
- }
}
return Qnil;
}
-VALUE
-rb_ary_to_ary(VALUE obj)
+/*
+ * call-seq:
+ * array.indexes( i1, i2, ... iN ) -> an_array
+ * array.indices( i1, i2, ... iN ) -> an_array
+ *
+ * Deprecated; use <code>Array#select</code>.
+ */
+
+static VALUE
+rb_ary_indexes(argc, argv, ary)
+ int argc;
+ VALUE *argv;
+ VALUE ary;
{
- VALUE tmp = rb_check_array_type(obj);
+ VALUE new_ary;
+ long i;
+
+ rb_warn("Array#%s is deprecated; use Array#values_at", rb_id2name(rb_frame_last_func()));
+ new_ary = rb_ary_new2(argc);
+ for (i=0; i<argc; i++) {
+ rb_ary_push(new_ary, rb_ary_aref(1, argv+i, ary));
+ }
+
+ return new_ary;
+}
- if (!NIL_P(tmp)) return tmp;
+VALUE
+rb_ary_to_ary(obj)
+ VALUE obj;
+{
+ if (TYPE(obj) == T_ARRAY) {
+ return obj;
+ }
+ if (rb_respond_to(obj, rb_intern("to_ary"))) {
+ return rb_convert_type(obj, T_ARRAY, "Array", "to_ary");
+ }
return rb_ary_new3(1, obj);
}
static void
-rb_ary_splice(VALUE ary, long beg, long len, const VALUE *rptr, long rlen)
+rb_ary_update(ary, beg, len, rpl)
+ VALUE ary;
+ long beg, len;
+ VALUE rpl;
{
- long olen;
- long rofs;
+ long rlen;
if (len < 0) rb_raise(rb_eIndexError, "negative length (%ld)", len);
- olen = RARRAY_LEN(ary);
if (beg < 0) {
- beg += olen;
+ beg += RARRAY(ary)->len;
if (beg < 0) {
- rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
- beg - olen, -olen);
+ beg -= RARRAY(ary)->len;
+ rb_raise(rb_eIndexError, "index %ld out of array", beg);
}
}
- if (olen < len || olen < beg + len) {
- len = olen - beg;
+ if (beg + len > RARRAY(ary)->len) {
+ len = RARRAY(ary)->len - beg;
}
- {
- const VALUE *optr = RARRAY_CONST_PTR_TRANSIENT(ary);
- rofs = (rptr >= optr && rptr < optr + olen) ? rptr - optr : -1;
+ rb_ary_modify(ary);
+ if (NIL_P(rpl)) {
+ rlen = 0;
+ }
+ else {
+ rpl = rb_ary_to_ary(rpl);
+ rlen = RARRAY(rpl)->len;
}
- if (beg >= olen) {
- VALUE target_ary;
- if (beg > ARY_MAX_SIZE - rlen) {
- rb_raise(rb_eIndexError, "index %ld too big", beg);
- }
- target_ary = ary_ensure_room_for_push(ary, rlen-len); /* len is 0 or negative */
+ if (beg >= RARRAY(ary)->len) {
len = beg + rlen;
- ary_mem_clear(ary, olen, beg - olen);
+ if (len >= RARRAY(ary)->aux.capa) {
+ REALLOC_N(RARRAY(ary)->ptr, VALUE, len);
+ RARRAY(ary)->aux.capa = len;
+ }
+ rb_mem_clear(RARRAY(ary)->ptr + RARRAY(ary)->len, beg - RARRAY(ary)->len);
if (rlen > 0) {
- if (rofs != -1) rptr = RARRAY_CONST_PTR_TRANSIENT(ary) + rofs;
- ary_memcpy0(ary, beg, rlen, rptr, target_ary);
+ MEMCPY(RARRAY(ary)->ptr + beg, RARRAY(rpl)->ptr, VALUE, rlen);
}
- ARY_SET_LEN(ary, len);
+ RARRAY(ary)->len = len;
}
else {
long alen;
- if (olen - len > ARY_MAX_SIZE - rlen) {
- rb_raise(rb_eIndexError, "index %ld too big", olen + rlen - len);
+ if (beg + len > RARRAY(ary)->len) {
+ len = RARRAY(ary)->len - beg;
}
- rb_ary_modify(ary);
- alen = olen + rlen - len;
- if (alen >= ARY_CAPA(ary)) {
- ary_double_capa(ary, alen);
+
+ alen = RARRAY(ary)->len + rlen - len;
+ if (alen >= RARRAY(ary)->aux.capa) {
+ REALLOC_N(RARRAY(ary)->ptr, VALUE, alen);
+ RARRAY(ary)->aux.capa = alen;
}
if (len != rlen) {
- RARRAY_PTR_USE_TRANSIENT(ary, ptr,
- MEMMOVE(ptr + beg + rlen, ptr + beg + len,
- VALUE, olen - (beg + len)));
- ARY_SET_LEN(ary, alen);
+ MEMMOVE(RARRAY(ary)->ptr + beg + rlen, RARRAY(ary)->ptr + beg + len,
+ VALUE, RARRAY(ary)->len - (beg + len));
+ RARRAY(ary)->len = alen;
}
if (rlen > 0) {
- if (rofs != -1) rptr = RARRAY_CONST_PTR_TRANSIENT(ary) + rofs;
- /* give up wb-protected ary */
- RB_OBJ_WB_UNPROTECT_FOR(ARRAY, ary);
-
- /* do not use RARRAY_PTR() because it can causes GC.
- * ary can contain T_NONE object because it is not cleared.
- */
- RARRAY_PTR_USE_TRANSIENT(ary, ptr,
- MEMMOVE(ptr + beg, rptr, VALUE, rlen));
- }
- }
-}
-
-void
-rb_ary_set_len(VALUE ary, long len)
-{
- long capa;
-
- rb_ary_modify_check(ary);
- if (ARY_SHARED_P(ary)) {
- rb_raise(rb_eRuntimeError, "can't set length of shared ");
- }
- if (len > (capa = (long)ARY_CAPA(ary))) {
- rb_bug("probable buffer overflow: %ld for %ld", len, capa);
- }
- ARY_SET_LEN(ary, len);
-}
-
-/*!
- * expands or shrinks \a ary to \a len elements.
- * expanded region will be filled with Qnil.
- * \param ary an array
- * \param len new size
- * \return \a ary
- * \post the size of \a ary is \a len.
- */
-VALUE
-rb_ary_resize(VALUE ary, long len)
-{
- long olen;
-
- rb_ary_modify(ary);
- olen = RARRAY_LEN(ary);
- if (len == olen) return ary;
- if (len > ARY_MAX_SIZE) {
- rb_raise(rb_eIndexError, "index %ld too big", len);
- }
- if (len > olen) {
- if (len >= ARY_CAPA(ary)) {
- ary_double_capa(ary, len);
- }
- ary_mem_clear(ary, olen, len - olen);
- ARY_SET_LEN(ary, len);
- }
- else if (ARY_EMBED_P(ary)) {
- ARY_SET_EMBED_LEN(ary, len);
- }
- else if (len <= RARRAY_EMBED_LEN_MAX) {
- VALUE tmp[RARRAY_EMBED_LEN_MAX];
- MEMCPY(tmp, ARY_HEAP_PTR(ary), VALUE, len);
- ary_discard(ary);
- MEMCPY((VALUE *)ARY_EMBED_PTR(ary), tmp, VALUE, len); /* WB: no new reference */
- ARY_SET_EMBED_LEN(ary, len);
- }
- else {
- if (olen > len + ARY_DEFAULT_SIZE) {
- ary_heap_realloc(ary, len);
- ARY_SET_CAPA(ary, len);
+ MEMMOVE(RARRAY(ary)->ptr + beg, RARRAY(rpl)->ptr, VALUE, rlen);
}
- ARY_SET_HEAP_LEN(ary, len);
}
- ary_verify(ary);
- return ary;
}
-/*
+/*
* call-seq:
- * ary[index] = obj -> obj
- * ary[start, length] = obj or other_ary or nil -> obj or other_ary or nil
- * ary[range] = obj or other_ary or nil -> obj or other_ary or nil
- *
- * Element Assignment --- Sets the element at +index+, or replaces a subarray
- * from the +start+ index for +length+ elements, or replaces a subarray
- * specified by the +range+ of indices.
- *
- * If indices are greater than the current capacity of the array, the array
- * grows automatically. Elements are inserted into the array at +start+ if
- * +length+ is zero.
- *
- * Negative indices will count backward from the end of the array. For
- * +start+ and +range+ cases the starting index is just before an element.
- *
- * An IndexError is raised if a negative index points past the beginning of
- * the array.
- *
- * See also Array#push, and Array#unshift.
+ * array[index] = obj -> obj
+ * array[start, length] = obj or an_array or nil -> obj or an_array or nil
+ * array[range] = obj or an_array or nil -> obj or an_array or nil
*
+ * Element Assignment---Sets the element at _index_,
+ * or replaces a subarray starting at _start_ and
+ * continuing for _length_ elements, or replaces a subarray
+ * specified by _range_. If indices are greater than
+ * the current capacity of the array, the array grows
+ * automatically. A negative indices will count backward
+ * from the end of the array. Inserts elements if _length_ is
+ * zero. If +nil+ is used in the second and third form,
+ * deletes elements from _self_. An +IndexError+ is raised if a
+ * negative index points past the beginning of the array. See also
+ * <code>Array#push</code>, and <code>Array#unshift</code>.
+ *
* a = Array.new
* a[4] = "4"; #=> [nil, nil, nil, nil, "4"]
* a[0, 3] = [ 'a', 'b', 'c' ] #=> ["a", "b", "c", nil, "4"]
@@ -2019,37 +1010,41 @@ rb_ary_resize(VALUE ary, long len)
* a[0, 2] = "?" #=> ["?", 2, nil, "4"]
* a[0..2] = "A" #=> ["A", "4"]
* a[-1] = "Z" #=> ["A", "Z"]
- * a[1..-1] = nil #=> ["A", nil]
- * a[1..-1] = [] #=> ["A"]
- * a[0, 0] = [ 1, 2 ] #=> [1, 2, "A"]
- * a[3, 0] = "B" #=> [1, 2, "A", "B"]
+ * a[1..-1] = nil #=> ["A"]
*/
static VALUE
-rb_ary_aset(int argc, VALUE *argv, VALUE ary)
+rb_ary_aset(argc, argv, ary)
+ int argc;
+ VALUE *argv;
+ VALUE ary;
{
long offset, beg, len;
- VALUE rpl;
if (argc == 3) {
- rb_ary_modify_check(ary);
- beg = NUM2LONG(argv[0]);
- len = NUM2LONG(argv[1]);
- goto range;
+ if (SYMBOL_P(argv[0])) {
+ rb_raise(rb_eTypeError, "Symbol as array index");
+ }
+ if (SYMBOL_P(argv[1])) {
+ rb_raise(rb_eTypeError, "Symbol as subarray length");
+ }
+ rb_ary_update(ary, NUM2LONG(argv[0]), NUM2LONG(argv[1]), argv[2]);
+ return argv[2];
+ }
+ if (argc != 2) {
+ rb_raise(rb_eArgError, "wrong number of arguments (%d for 2)", argc);
}
- rb_check_arity(argc, 2, 2);
- rb_ary_modify_check(ary);
if (FIXNUM_P(argv[0])) {
offset = FIX2LONG(argv[0]);
goto fixnum;
}
- if (rb_range_beg_len(argv[0], &beg, &len, RARRAY_LEN(ary), 1)) {
+ if (SYMBOL_P(argv[0])) {
+ rb_raise(rb_eTypeError, "Symbol as array index");
+ }
+ if (rb_range_beg_len(argv[0], &beg, &len, RARRAY(ary)->len, 1)) {
/* check if idx is Range */
- range:
- rpl = rb_ary_to_ary(argv[argc-1]);
- rb_ary_splice(ary, beg, len, RARRAY_CONST_PTR_TRANSIENT(rpl), RARRAY_LEN(rpl));
- RB_GC_GUARD(rpl);
- return argv[argc-1];
+ rb_ary_update(ary, beg, len, argv[1]);
+ return argv[1];
}
offset = NUM2LONG(argv[0]);
@@ -2060,108 +1055,89 @@ fixnum:
/*
* call-seq:
- * ary.insert(index, obj...) -> ary
- *
- * Inserts the given values before the element with the given +index+.
- *
- * Negative indices count backwards from the end of the array, where +-1+ is
- * the last element. If a negative index is used, the given values will be
- * inserted after that element, so using an index of +-1+ will insert the
- * values at the end of the array.
- *
+ * array.insert(index, obj...) -> array
+ *
+ * Inserts the given values before the element with the given index
+ * (which may be negative).
+ *
* a = %w{ a b c d }
* a.insert(2, 99) #=> ["a", "b", 99, "c", "d"]
* a.insert(-2, 1, 2, 3) #=> ["a", "b", 99, "c", 1, 2, 3, "d"]
*/
static VALUE
-rb_ary_insert(int argc, VALUE *argv, VALUE ary)
+rb_ary_insert(argc, argv, ary)
+ int argc;
+ VALUE *argv;
+ VALUE ary;
{
long pos;
- rb_check_arity(argc, 1, UNLIMITED_ARGUMENTS);
- rb_ary_modify_check(ary);
+ if (argc < 1) {
+ rb_raise(rb_eArgError, "wrong number of arguments (at least 1)");
+ }
pos = NUM2LONG(argv[0]);
- if (argc == 1) return ary;
if (pos == -1) {
- pos = RARRAY_LEN(ary);
+ pos = RARRAY(ary)->len;
}
else if (pos < 0) {
- long minpos = -RARRAY_LEN(ary) - 1;
- if (pos < minpos) {
- rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
- pos, minpos);
- }
pos++;
}
- rb_ary_splice(ary, pos, 0, argv + 1, argc - 1);
- return ary;
-}
-static VALUE
-rb_ary_length(VALUE ary);
-
-static VALUE
-ary_enum_length(VALUE ary, VALUE args, VALUE eobj)
-{
- return rb_ary_length(ary);
+ if (argc == 1) return ary;
+ rb_ary_update(ary, pos, 0, rb_ary_new4(argc - 1, argv + 1));
+ return ary;
}
/*
* call-seq:
- * ary.each {|item| block} -> ary
- * ary.each -> Enumerator
- *
- * Calls the given block once for each element in +self+, passing that element
- * as a parameter. Returns the array itself.
- *
- * If no block is given, an Enumerator is returned.
- *
+ * array.each {|item| block } -> array
+ *
+ * Calls <i>block</i> once for each element in <i>self</i>, passing that
+ * element as a parameter.
+ *
* a = [ "a", "b", "c" ]
* a.each {|x| print x, " -- " }
- *
+ *
* produces:
- *
+ *
* a -- b -- c --
*/
VALUE
-rb_ary_each(VALUE ary)
+rb_ary_each(ary)
+ VALUE ary;
{
long i;
- ary_verify(ary);
- RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
- for (i=0; i<RARRAY_LEN(ary); i++) {
- rb_yield(RARRAY_AREF(ary, i));
+
+ for (i=0; i<RARRAY(ary)->len; i++) {
+ rb_yield(RARRAY(ary)->ptr[i]);
}
return ary;
}
/*
* call-seq:
- * ary.each_index {|index| block} -> ary
- * ary.each_index -> Enumerator
- *
- * Same as Array#each, but passes the +index+ of the element instead of the
- * element itself.
- *
- * An Enumerator is returned if no block is given.
- *
+ * array.each_index {|index| block } -> array
+ *
+ * Same as <code>Array#each</code>, but passes the index of the element
+ * instead of the element itself.
+ *
* a = [ "a", "b", "c" ]
* a.each_index {|x| print x, " -- " }
- *
+ *
* produces:
- *
+ *
* 0 -- 1 -- 2 --
*/
static VALUE
-rb_ary_each_index(VALUE ary)
+rb_ary_each_index(ary)
+ VALUE ary;
{
long i;
- RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
- for (i=0; i<RARRAY_LEN(ary); i++) {
+ for (i=0; i<RARRAY(ary)->len; i++) {
rb_yield(LONG2NUM(i));
}
return ary;
@@ -2169,32 +1145,29 @@ rb_ary_each_index(VALUE ary)
/*
* call-seq:
- * ary.reverse_each {|item| block} -> ary
- * ary.reverse_each -> Enumerator
- *
- * Same as Array#each, but traverses +self+ in reverse order.
- *
+ * array.reverse_each {|item| block }
+ *
+ * Same as <code>Array#each</code>, but traverses <i>self</i> in reverse
+ * order.
+ *
* a = [ "a", "b", "c" ]
* a.reverse_each {|x| print x, " " }
- *
+ *
* produces:
- *
+ *
* c b a
*/
static VALUE
-rb_ary_reverse_each(VALUE ary)
+rb_ary_reverse_each(ary)
+ VALUE ary;
{
- long len;
+ long len = RARRAY(ary)->len;
- RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
- len = RARRAY_LEN(ary);
while (len--) {
- long nlen;
- rb_yield(RARRAY_AREF(ary, len));
- nlen = RARRAY_LEN(ary);
- if (nlen < len) {
- len = nlen;
+ rb_yield(RARRAY(ary)->ptr[len]);
+ if (RARRAY(ary)->len < len) {
+ len = RARRAY(ary)->len;
}
}
return ary;
@@ -2202,908 +1175,526 @@ rb_ary_reverse_each(VALUE ary)
/*
* call-seq:
- * ary.length -> int
- *
- * Returns the number of elements in +self+. May be zero.
- *
+ * array.length -> int
+ *
+ * Returns the number of elements in <i>self</i>. May be zero.
+ *
* [ 1, 2, 3, 4, 5 ].length #=> 5
- * [].length #=> 0
*/
static VALUE
-rb_ary_length(VALUE ary)
+rb_ary_length(ary)
+ VALUE ary;
{
- long len = RARRAY_LEN(ary);
- return LONG2NUM(len);
+ return LONG2NUM(RARRAY(ary)->len);
}
/*
* call-seq:
- * ary.empty? -> true or false
- *
- * Returns +true+ if +self+ contains no elements.
- *
+ * array.empty? -> true or false
+ *
+ * Returns <code>true</code> if <i>self</i> array contains no elements.
+ *
* [].empty? #=> true
*/
static VALUE
-rb_ary_empty_p(VALUE ary)
+rb_ary_empty_p(ary)
+ VALUE ary;
{
- if (RARRAY_LEN(ary) == 0)
+ if (RARRAY(ary)->len == 0)
return Qtrue;
return Qfalse;
}
VALUE
-rb_ary_dup(VALUE ary)
+rb_ary_dup(ary)
+ VALUE ary;
{
- long len = RARRAY_LEN(ary);
- VALUE dup = rb_ary_new2(len);
- ary_memcpy(dup, 0, len, RARRAY_CONST_PTR_TRANSIENT(ary));
- ARY_SET_LEN(dup, len);
+ VALUE dup = rb_ary_new2(RARRAY(ary)->len);
- ary_verify(ary);
- ary_verify(dup);
+ DUPSETUP(dup, ary);
+ MEMCPY(RARRAY(dup)->ptr, RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
+ RARRAY(dup)->len = RARRAY(ary)->len;
return dup;
}
-VALUE
-rb_ary_resurrect(VALUE ary)
-{
- return ary_make_partial(ary, rb_cArray, 0, RARRAY_LEN(ary));
-}
-
extern VALUE rb_output_fs;
-static void ary_join_1(VALUE obj, VALUE ary, VALUE sep, long i, VALUE result, int *first);
-
static VALUE
-recursive_join(VALUE obj, VALUE argp, int recur)
-{
- VALUE *arg = (VALUE *)argp;
- VALUE ary = arg[0];
- VALUE sep = arg[1];
- VALUE result = arg[2];
- int *first = (int *)arg[3];
-
- if (recur) {
- rb_raise(rb_eArgError, "recursive array join");
- }
- else {
- ary_join_1(obj, ary, sep, 0, result, first);
- }
- return Qnil;
-}
-
-static void
-ary_join_0(VALUE ary, VALUE sep, long max, VALUE result)
+inspect_join(ary, arg)
+ VALUE ary;
+ VALUE *arg;
{
- long i;
- VALUE val;
-
- if (max > 0) rb_enc_copy(result, RARRAY_AREF(ary, 0));
- for (i=0; i<max; i++) {
- val = RARRAY_AREF(ary, i);
- if (i > 0 && !NIL_P(sep))
- rb_str_buf_append(result, sep);
- rb_str_buf_append(result, val);
- }
+ return rb_ary_join(arg[0], arg[1]);
}
-static void
-ary_join_1(VALUE obj, VALUE ary, VALUE sep, long i, VALUE result, int *first)
+VALUE
+rb_ary_join(ary, sep)
+ VALUE ary, sep;
{
- VALUE val, tmp;
+ long len = 1, i;
+ int taint = Qfalse;
+ VALUE result, tmp;
- for (; i<RARRAY_LEN(ary); i++) {
- if (i > 0 && !NIL_P(sep))
- rb_str_buf_append(result, sep);
+ if (RARRAY(ary)->len == 0) return rb_str_new(0, 0);
+ if (OBJ_TAINTED(ary) || OBJ_TAINTED(sep)) taint = Qtrue;
- val = RARRAY_AREF(ary, i);
- if (RB_TYPE_P(val, T_STRING)) {
- str_join:
- rb_str_buf_append(result, val);
- if (*first) {
- rb_enc_copy(result, val);
- *first = FALSE;
- }
- }
- else if (RB_TYPE_P(val, T_ARRAY)) {
- obj = val;
- ary_join:
- if (val == ary) {
- rb_raise(rb_eArgError, "recursive array join");
+ for (i=0; i<RARRAY(ary)->len; i++) {
+ tmp = rb_check_string_type(RARRAY(ary)->ptr[i]);
+ len += NIL_P(tmp) ? 10 : RSTRING(tmp)->len;
+ }
+ if (!NIL_P(sep)) {
+ StringValue(sep);
+ len += RSTRING(sep)->len * (RARRAY(ary)->len - 1);
+ }
+ result = rb_str_buf_new(len);
+ for (i=0; i<RARRAY(ary)->len; i++) {
+ tmp = RARRAY(ary)->ptr[i];
+ switch (TYPE(tmp)) {
+ case T_STRING:
+ break;
+ case T_ARRAY:
+ if (rb_inspecting_p(tmp)) {
+ tmp = rb_str_new2("[...]");
}
else {
- VALUE args[4];
+ VALUE args[2];
- *first = FALSE;
- args[0] = val;
+ args[0] = tmp;
args[1] = sep;
- args[2] = result;
- args[3] = (VALUE)first;
- rb_exec_recursive(recursive_join, obj, (VALUE)args);
- }
- }
- else {
- tmp = rb_check_string_type(val);
- if (!NIL_P(tmp)) {
- val = tmp;
- goto str_join;
+ tmp = rb_protect_inspect(inspect_join, ary, (VALUE)args);
}
- tmp = rb_check_array_type(val);
- if (!NIL_P(tmp)) {
- obj = val;
- val = tmp;
- goto ary_join;
- }
- val = rb_obj_as_string(val);
- goto str_join;
- }
- }
-}
-
-VALUE
-rb_ary_join(VALUE ary, VALUE sep)
-{
- long len = 1, i;
- VALUE val, tmp, result;
-
- if (RARRAY_LEN(ary) == 0) return rb_usascii_str_new(0, 0);
-
- if (!NIL_P(sep)) {
- StringValue(sep);
- len += RSTRING_LEN(sep) * (RARRAY_LEN(ary) - 1);
- }
- for (i=0; i<RARRAY_LEN(ary); i++) {
- val = RARRAY_AREF(ary, i);
- tmp = rb_check_string_type(val);
-
- if (NIL_P(tmp) || tmp != val) {
- int first;
- result = rb_str_buf_new(len + (RARRAY_LEN(ary)-i)*10);
- rb_enc_associate(result, rb_usascii_encoding());
- ary_join_0(ary, sep, i, result);
- first = i == 0;
- ary_join_1(ary, ary, sep, i, result, &first);
- return result;
+ break;
+ default:
+ tmp = rb_obj_as_string(tmp);
}
-
- len += RSTRING_LEN(tmp);
+ if (i > 0 && !NIL_P(sep))
+ rb_str_buf_append(result, sep);
+ rb_str_buf_append(result, tmp);
+ if (OBJ_TAINTED(tmp)) taint = Qtrue;
}
- result = rb_str_new(0, len);
- rb_str_set_len(result, 0);
-
- ary_join_0(ary, sep, RARRAY_LEN(ary), result);
-
+ if (taint) OBJ_TAINT(result);
return result;
}
/*
* call-seq:
- * ary.join(separator=$,) -> str
- *
+ * array.join(sep=$,) -> str
+ *
* Returns a string created by converting each element of the array to
- * a string, separated by the given +separator+.
- * If the +separator+ is +nil+, it uses current <code>$,</code>.
- * If both the +separator+ and <code>$,</code> are +nil+,
- * it uses an empty string.
- *
+ * a string, separated by <i>sep</i>.
+ *
* [ "a", "b", "c" ].join #=> "abc"
* [ "a", "b", "c" ].join("-") #=> "a-b-c"
- *
- * For nested arrays, join is applied recursively:
- *
- * [ "a", [1, 2, [:x, :y]], "b" ].join("-") #=> "a-1-2-x-y-b"
*/
static VALUE
-rb_ary_join_m(int argc, VALUE *argv, VALUE ary)
+rb_ary_join_m(argc, argv, ary)
+ int argc;
+ VALUE *argv;
+ VALUE ary;
{
VALUE sep;
- if (rb_check_arity(argc, 0, 1) == 0 || NIL_P(sep = argv[0])) {
- sep = rb_output_fs;
- if (!NIL_P(sep)) {
- rb_warn("$, is set to non-nil value");
- }
- }
-
+ rb_scan_args(argc, argv, "01", &sep);
+ if (NIL_P(sep)) sep = rb_output_fs;
+
return rb_ary_join(ary, sep);
}
-static VALUE
-inspect_ary(VALUE ary, VALUE dummy, int recur)
-{
- long i;
- VALUE s, str;
-
- if (recur) return rb_usascii_str_new_cstr("[...]");
- str = rb_str_buf_new2("[");
- for (i=0; i<RARRAY_LEN(ary); i++) {
- s = rb_inspect(RARRAY_AREF(ary, i));
- if (i > 0) rb_str_buf_cat2(str, ", ");
- else rb_enc_copy(str, s);
- rb_str_buf_append(str, s);
- }
- rb_str_buf_cat2(str, "]");
- return str;
-}
-
/*
* call-seq:
- * ary.inspect -> string
- * ary.to_s -> string
- *
- * Creates a string representation of +self+, by calling #inspect
- * on each element.
+ * array.to_s -> string
+ *
+ * Returns _self_<code>.join</code>.
+ *
+ * [ "a", "e", "i", "o" ].to_s #=> "aeio"
*
- * [ "a", "b", "c" ].to_s #=> "[\"a\", \"b\", \"c\"]"
*/
-static VALUE
-rb_ary_inspect(VALUE ary)
-{
- if (RARRAY_LEN(ary) == 0) return rb_usascii_str_new2("[]");
- return rb_exec_recursive(inspect_ary, ary, 0);
-}
-
VALUE
-rb_ary_to_s(VALUE ary)
+rb_ary_to_s(ary)
+ VALUE ary;
{
- return rb_ary_inspect(ary);
+ if (RARRAY(ary)->len == 0) return rb_str_new(0, 0);
+
+ return rb_ary_join(ary, rb_output_fs);
}
-/*
- * call-seq:
- * ary.to_a -> ary
- *
- * Returns +self+.
- *
- * If called on a subclass of Array, converts the receiver to an Array object.
- */
+static ID inspect_key;
+
+struct inspect_arg {
+ VALUE (*func)();
+ VALUE arg1, arg2;
+};
static VALUE
-rb_ary_to_a(VALUE ary)
+inspect_call(arg)
+ struct inspect_arg *arg;
{
- if (rb_obj_class(ary) != rb_cArray) {
- VALUE dup = rb_ary_new2(RARRAY_LEN(ary));
- rb_ary_replace(dup, ary);
- return dup;
- }
- return ary;
+ return (*arg->func)(arg->arg1, arg->arg2);
}
-/*
- * call-seq:
- * ary.to_h -> hash
- * ary.to_h {|item| block } -> hash
- *
- * Returns the result of interpreting <i>ary</i> as an array of
- * <tt>[key, value]</tt> pairs.
- *
- * [[:foo, :bar], [1, 2]].to_h
- * # => {:foo => :bar, 1 => 2}
- *
- * If a block is given, the results of the block on each element of
- * the array will be used as pairs.
- *
- * ["foo", "bar"].to_h {|s| [s.ord, s]}
- * # => {102=>"foo", 98=>"bar"}
- */
-
static VALUE
-rb_ary_to_h(VALUE ary)
+get_inspect_tbl(create)
+ int create;
{
- long i;
- VALUE hash = rb_hash_new_with_size(RARRAY_LEN(ary));
- int block_given = rb_block_given_p();
-
- for (i=0; i<RARRAY_LEN(ary); i++) {
- const VALUE e = rb_ary_elt(ary, i);
- const VALUE elt = block_given ? rb_yield_force_blockarg(e) : e;
- const VALUE key_value_pair = rb_check_array_type(elt);
- if (NIL_P(key_value_pair)) {
- rb_raise(rb_eTypeError, "wrong element type %"PRIsVALUE" at %ld (expected array)",
- rb_obj_class(elt), i);
- }
- if (RARRAY_LEN(key_value_pair) != 2) {
- rb_raise(rb_eArgError, "wrong array length at %ld (expected 2, was %ld)",
- i, RARRAY_LEN(key_value_pair));
+ VALUE inspect_tbl = rb_thread_local_aref(rb_thread_current(), inspect_key);
+
+ if (NIL_P(inspect_tbl)) {
+ if (create) {
+ tbl_init:
+ inspect_tbl = rb_ary_new();
+ rb_thread_local_aset(rb_thread_current(), inspect_key, inspect_tbl);
}
- rb_hash_aset(hash, RARRAY_AREF(key_value_pair, 0), RARRAY_AREF(key_value_pair, 1));
}
- return hash;
+ else if (TYPE(inspect_tbl) != T_ARRAY) {
+ rb_warn("invalid inspect_tbl value");
+ if (create) goto tbl_init;
+ rb_thread_local_aset(rb_thread_current(), inspect_key, Qnil);
+ return Qnil;
+ }
+ return inspect_tbl;
}
-/*
- * call-seq:
- * ary.to_ary -> ary
- *
- * Returns +self+.
- */
-
static VALUE
-rb_ary_to_ary_m(VALUE ary)
+inspect_ensure(obj)
+ VALUE obj;
{
- return ary;
+ VALUE inspect_tbl;
+
+ inspect_tbl = get_inspect_tbl(Qfalse);
+ if (!NIL_P(inspect_tbl)) {
+ rb_ary_pop(inspect_tbl);
+ }
+ return 0;
}
-static void
-ary_reverse(VALUE *p1, VALUE *p2)
+VALUE
+rb_protect_inspect(func, obj, arg)
+ VALUE (*func)(ANYARGS);
+ VALUE obj, arg;
{
- while (p1 < p2) {
- VALUE tmp = *p1;
- *p1++ = *p2;
- *p2-- = tmp;
+ struct inspect_arg iarg;
+ VALUE inspect_tbl;
+ VALUE id;
+
+ inspect_tbl = get_inspect_tbl(Qtrue);
+ id = rb_obj_id(obj);
+ if (rb_ary_includes(inspect_tbl, id)) {
+ return (*func)(obj, arg);
}
+ rb_ary_push(inspect_tbl, id);
+ iarg.func = func;
+ iarg.arg1 = obj;
+ iarg.arg2 = arg;
+
+ return rb_ensure(inspect_call, (VALUE)&iarg, inspect_ensure, obj);
}
VALUE
-rb_ary_reverse(VALUE ary)
+rb_inspecting_p(obj)
+ VALUE obj;
{
- VALUE *p2;
- long len = RARRAY_LEN(ary);
+ VALUE inspect_tbl;
- rb_ary_modify(ary);
- if (len > 1) {
- RARRAY_PTR_USE_TRANSIENT(ary, p1, {
- p2 = p1 + len - 1; /* points last item */
- ary_reverse(p1, p2);
- }); /* WB: no new reference */
+ inspect_tbl = get_inspect_tbl(Qfalse);
+ if (NIL_P(inspect_tbl)) return Qfalse;
+ return rb_ary_includes(inspect_tbl, rb_obj_id(obj));
+}
+
+static VALUE
+inspect_ary(ary)
+ VALUE ary;
+{
+ int tainted = OBJ_TAINTED(ary);
+ long i;
+ VALUE s, str;
+
+ str = rb_str_buf_new2("[");
+ for (i=0; i<RARRAY(ary)->len; i++) {
+ s = rb_inspect(RARRAY(ary)->ptr[i]);
+ if (OBJ_TAINTED(s)) tainted = Qtrue;
+ if (i > 0) rb_str_buf_cat2(str, ", ");
+ rb_str_buf_append(str, s);
}
- return ary;
+ rb_str_buf_cat2(str, "]");
+ if (tainted) OBJ_TAINT(str);
+ return str;
}
/*
* call-seq:
- * ary.reverse! -> ary
+ * array.inspect -> string
*
- * Reverses +self+ in place.
- *
- * a = [ "a", "b", "c" ]
- * a.reverse! #=> ["c", "b", "a"]
- * a #=> ["c", "b", "a"]
+ * Create a printable version of <i>array</i>.
*/
static VALUE
-rb_ary_reverse_bang(VALUE ary)
+rb_ary_inspect(ary)
+ VALUE ary;
{
- return rb_ary_reverse(ary);
+ if (RARRAY(ary)->len == 0) return rb_str_new2("[]");
+ if (rb_inspecting_p(ary)) return rb_str_new2("[...]");
+ return rb_protect_inspect(inspect_ary, ary, 0);
}
/*
* call-seq:
- * ary.reverse -> new_ary
- *
- * Returns a new array containing +self+'s elements in reverse order.
- *
- * [ "a", "b", "c" ].reverse #=> ["c", "b", "a"]
- * [ 1 ].reverse #=> [1]
+ * array.to_a -> array
+ *
+ * Returns _self_. If called on a subclass of Array, converts
+ * the receiver to an Array object.
*/
static VALUE
-rb_ary_reverse_m(VALUE ary)
+rb_ary_to_a(ary)
+ VALUE ary;
{
- long len = RARRAY_LEN(ary);
- VALUE dup = rb_ary_new2(len);
-
- if (len > 0) {
- const VALUE *p1 = RARRAY_CONST_PTR_TRANSIENT(ary);
- VALUE *p2 = (VALUE *)RARRAY_CONST_PTR_TRANSIENT(dup) + len - 1;
- do *p2-- = *p1++; while (--len > 0);
+ if (rb_obj_class(ary) != rb_cArray) {
+ VALUE dup = rb_ary_new2(RARRAY(ary)->len);
+ rb_ary_replace(dup, ary);
+ return dup;
}
- ARY_SET_LEN(dup, RARRAY_LEN(ary));
- return dup;
+ return ary;
}
-static inline long
-rotate_count(long cnt, long len)
-{
- return (cnt < 0) ? (len - (~cnt % len) - 1) : (cnt % len);
-}
+/*
+ * call-seq:
+ * array.to_ary -> array
+ *
+ * Returns _self_.
+ */
-static void
-ary_rotate_ptr(VALUE *ptr, long len, long cnt)
+static VALUE
+rb_ary_to_ary_m(ary)
+ VALUE ary;
{
- --len;
- if (cnt < len) ary_reverse(ptr + cnt, ptr + len);
- if (--cnt > 0) ary_reverse(ptr, ptr + cnt);
- if (len > 0) ary_reverse(ptr, ptr + len);
+ return ary;
}
VALUE
-rb_ary_rotate(VALUE ary, long cnt)
+rb_ary_reverse(ary)
+ VALUE ary;
{
+ VALUE *p1, *p2;
+ VALUE tmp;
+
rb_ary_modify(ary);
+ if (RARRAY(ary)->len > 1) {
+ p1 = RARRAY(ary)->ptr;
+ p2 = p1 + RARRAY(ary)->len - 1; /* points last item */
- if (cnt != 0) {
- long len = RARRAY_LEN(ary);
- if (len > 0 && (cnt = rotate_count(cnt, len)) > 0) {
- RARRAY_PTR_USE_TRANSIENT(ary, ptr, ary_rotate_ptr(ptr, len, cnt));
- return ary;
- }
+ while (p1 < p2) {
+ tmp = *p1;
+ *p1++ = *p2;
+ *p2-- = tmp;
+ }
}
- return Qnil;
+ return ary;
}
/*
* call-seq:
- * ary.rotate!(count=1) -> ary
- *
- * Rotates +self+ in place so that the element at +count+ comes first, and
- * returns +self+.
- *
- * If +count+ is negative then it rotates in the opposite direction, starting
- * from the end of the array where +-1+ is the last element.
- *
- * a = [ "a", "b", "c", "d" ]
- * a.rotate! #=> ["b", "c", "d", "a"]
- * a #=> ["b", "c", "d", "a"]
- * a.rotate!(2) #=> ["d", "a", "b", "c"]
- * a.rotate!(-3) #=> ["a", "b", "c", "d"]
+ * array.reverse! -> array
+ *
+ * Reverses _self_ in place.
+ *
+ * a = [ "a", "b", "c" ]
+ * a.reverse! #=> ["c", "b", "a"]
+ * a #=> ["c", "b", "a"]
*/
static VALUE
-rb_ary_rotate_bang(int argc, VALUE *argv, VALUE ary)
+rb_ary_reverse_bang(ary)
+ VALUE ary;
{
- long n = (rb_check_arity(argc, 0, 1) ? NUM2LONG(argv[0]) : 1);
- rb_ary_rotate(ary, n);
- return ary;
+ return rb_ary_reverse(ary);
}
/*
* call-seq:
- * ary.rotate(count=1) -> new_ary
- *
- * Returns a new array by rotating +self+ so that the element at +count+ is
- * the first element of the new array.
- *
- * If +count+ is negative then it rotates in the opposite direction, starting
- * from the end of +self+ where +-1+ is the last element.
- *
- * a = [ "a", "b", "c", "d" ]
- * a.rotate #=> ["b", "c", "d", "a"]
- * a #=> ["a", "b", "c", "d"]
- * a.rotate(2) #=> ["c", "d", "a", "b"]
- * a.rotate(-3) #=> ["b", "c", "d", "a"]
+ * array.reverse -> an_array
+ *
+ * Returns a new array containing <i>self</i>'s elements in reverse order.
+ *
+ * [ "a", "b", "c" ].reverse #=> ["c", "b", "a"]
+ * [ 1 ].reverse #=> [1]
*/
static VALUE
-rb_ary_rotate_m(int argc, VALUE *argv, VALUE ary)
-{
- VALUE rotated;
- const VALUE *ptr;
- long len;
- long cnt = (rb_check_arity(argc, 0, 1) ? NUM2LONG(argv[0]) : 1);
-
- len = RARRAY_LEN(ary);
- rotated = rb_ary_new2(len);
- if (len > 0) {
- cnt = rotate_count(cnt, len);
- ptr = RARRAY_CONST_PTR_TRANSIENT(ary);
- len -= cnt;
- ary_memcpy(rotated, 0, len, ptr + cnt);
- ary_memcpy(rotated, len, cnt, ptr);
- }
- ARY_SET_LEN(rotated, RARRAY_LEN(ary));
- return rotated;
-}
-
-struct ary_sort_data {
+rb_ary_reverse_m(ary)
VALUE ary;
- struct cmp_opt_data cmp_opt;
-};
-
-static VALUE
-sort_reentered(VALUE ary)
{
- if (RBASIC(ary)->klass) {
- rb_raise(rb_eRuntimeError, "sort reentered");
- }
- return Qnil;
+ return rb_ary_reverse(rb_ary_dup(ary));
}
static int
-sort_1(const void *ap, const void *bp, void *dummy)
+sort_1(a, b)
+ VALUE *a, *b;
{
- struct ary_sort_data *data = dummy;
- VALUE retval = sort_reentered(data->ary);
- VALUE a = *(const VALUE *)ap, b = *(const VALUE *)bp;
- VALUE args[2];
- int n;
-
- args[0] = a;
- args[1] = b;
- retval = rb_yield_values2(2, args);
- n = rb_cmpint(retval, a, b);
- sort_reentered(data->ary);
- return n;
+ VALUE retval = rb_yield_values(2, *a, *b);
+ return rb_cmpint(retval, *a, *b);
}
static int
-sort_2(const void *ap, const void *bp, void *dummy)
+sort_2(ap, bp)
+ VALUE *ap, *bp;
{
- struct ary_sort_data *data = dummy;
- VALUE retval = sort_reentered(data->ary);
- VALUE a = *(const VALUE *)ap, b = *(const VALUE *)bp;
- int n;
-
- if (FIXNUM_P(a) && FIXNUM_P(b) && CMP_OPTIMIZABLE(data->cmp_opt, Fixnum)) {
- if ((long)a > (long)b) return 1;
- if ((long)a < (long)b) return -1;
+ VALUE retval;
+ long a = (long)*ap, b = (long)*bp;
+
+ if (FIXNUM_P(a) && FIXNUM_P(b)) {
+ if (a > b) return 1;
+ if (a < b) return -1;
return 0;
}
- if (STRING_P(a) && STRING_P(b) && CMP_OPTIMIZABLE(data->cmp_opt, String)) {
+ if (TYPE(a) == T_STRING && TYPE(b) == T_STRING) {
return rb_str_cmp(a, b);
}
- if (RB_FLOAT_TYPE_P(a) && CMP_OPTIMIZABLE(data->cmp_opt, Float)) {
- return rb_float_cmp(a, b);
- }
-
- retval = rb_funcallv(a, id_cmp, 1, &b);
- n = rb_cmpint(retval, a, b);
- sort_reentered(data->ary);
- return n;
+ retval = rb_funcall(a, id_cmp, 1, b);
+ return rb_cmpint(retval, a, b);
}
-/*
- * call-seq:
- * ary.sort! -> ary
- * ary.sort! {|a, b| block} -> ary
- *
- * Sorts +self+ in place.
- *
- * Comparisons for the sort will be done using the <code><=></code> operator
- * or using an optional code block.
- *
- * The block must implement a comparison between +a+ and +b+ and return
- * an integer less than 0 when +b+ follows +a+, +0+ when +a+ and +b+
- * are equivalent, or an integer greater than 0 when +a+ follows +b+.
- *
- * The result is not guaranteed to be stable. When the comparison of two
- * elements returns +0+, the order of the elements is unpredictable.
- *
- * ary = [ "d", "a", "e", "c", "b" ]
- * ary.sort! #=> ["a", "b", "c", "d", "e"]
- * ary.sort! {|a, b| b <=> a} #=> ["e", "d", "c", "b", "a"]
- *
- * See also Enumerable#sort_by.
- */
-
-VALUE
-rb_ary_sort_bang(VALUE ary)
-{
- rb_ary_modify(ary);
- assert(!ARY_SHARED_P(ary));
- if (RARRAY_LEN(ary) > 1) {
- VALUE tmp = ary_make_substitution(ary); /* only ary refers tmp */
- struct ary_sort_data data;
- long len = RARRAY_LEN(ary);
- RBASIC_CLEAR_CLASS(tmp);
- data.ary = tmp;
- data.cmp_opt.opt_methods = 0;
- data.cmp_opt.opt_inited = 0;
- RARRAY_PTR_USE(tmp, ptr, {
- ruby_qsort(ptr, len, sizeof(VALUE),
- rb_block_given_p()?sort_1:sort_2, &data);
- }); /* WB: no new reference */
- rb_ary_modify(ary);
- if (ARY_EMBED_P(tmp)) {
- if (ARY_SHARED_P(ary)) { /* ary might be destructively operated in the given block */
- rb_ary_unshare(ary);
- FL_SET_EMBED(ary);
- }
- ary_memcpy(ary, 0, ARY_EMBED_LEN(tmp), ARY_EMBED_PTR(tmp));
- ARY_SET_LEN(ary, ARY_EMBED_LEN(tmp));
- }
- else {
- if (!ARY_EMBED_P(ary) && ARY_HEAP_PTR(ary) == ARY_HEAP_PTR(tmp)) {
- FL_UNSET_SHARED(ary);
- ARY_SET_CAPA(ary, RARRAY_LEN(tmp));
- }
- else {
- assert(!ARY_SHARED_P(tmp));
- if (ARY_EMBED_P(ary)) {
- FL_UNSET_EMBED(ary);
- }
- else if (ARY_SHARED_P(ary)) {
- /* ary might be destructively operated in the given block */
- rb_ary_unshare(ary);
- }
- else {
- ary_heap_free(ary);
- }
- ARY_SET_PTR(ary, ARY_HEAP_PTR(tmp));
- ARY_SET_HEAP_LEN(ary, len);
- ARY_SET_CAPA(ary, ARY_HEAP_LEN(tmp));
- }
- /* tmp was lost ownership for the ptr */
- FL_UNSET(tmp, FL_FREEZE);
- FL_SET_EMBED(tmp);
- ARY_SET_EMBED_LEN(tmp, 0);
- FL_SET(tmp, FL_FREEZE);
- }
- /* tmp will be GC'ed. */
- RBASIC_SET_CLASS_RAW(tmp, rb_cArray); /* rb_cArray must be marked */
- }
- ary_verify(ary);
- return ary;
-}
-
-/*
- * call-seq:
- * ary.sort -> new_ary
- * ary.sort {|a, b| block} -> new_ary
- *
- * Returns a new array created by sorting +self+.
- *
- * Comparisons for the sort will be done using the <code><=></code> operator
- * or using an optional code block.
- *
- * The block must implement a comparison between +a+ and +b+ and return
- * an integer less than 0 when +b+ follows +a+, +0+ when +a+ and +b+
- * are equivalent, or an integer greater than 0 when +a+ follows +b+.
- *
- * The result is not guaranteed to be stable. When the comparison of two
- * elements returns +0+, the order of the elements is unpredictable.
- *
- * ary = [ "d", "a", "e", "c", "b" ]
- * ary.sort #=> ["a", "b", "c", "d", "e"]
- * ary.sort {|a, b| b <=> a} #=> ["e", "d", "c", "b", "a"]
- *
- * To produce the reverse order, the following can also be used
- * (and may be faster):
- *
- * ary.sort.reverse! #=> ["e", "d", "c", "b", "a"]
- *
- * See also Enumerable#sort_by.
- */
-
-VALUE
-rb_ary_sort(VALUE ary)
+static VALUE
+sort_internal(ary)
+ VALUE ary;
{
- ary = rb_ary_dup(ary);
- rb_ary_sort_bang(ary);
+ qsort(RARRAY(ary)->ptr, RARRAY(ary)->len, sizeof(VALUE),
+ rb_block_given_p()?sort_1:sort_2);
return ary;
}
-static VALUE rb_ary_bsearch_index(VALUE ary);
-
-/*
- * call-seq:
- * ary.bsearch {|x| block } -> elem
- *
- * By using binary search, finds a value from this array which meets
- * the given condition in O(log n) where n is the size of the array.
- *
- * You can use this method in two modes: a find-minimum mode and
- * a find-any mode. In either case, the elements of the array must be
- * monotone (or sorted) with respect to the block.
- *
- * In find-minimum mode (this is a good choice for typical use cases),
- * the block must always return true or false, and there must be an index i
- * (0 <= i <= ary.size) so that:
- *
- * - the block returns false for any element whose index is less than
- * i, and
- * - the block returns true for any element whose index is greater
- * than or equal to i.
- *
- * This method returns the i-th element. If i is equal to ary.size,
- * it returns nil.
- *
- * ary = [0, 4, 7, 10, 12]
- * ary.bsearch {|x| x >= 4 } #=> 4
- * ary.bsearch {|x| x >= 6 } #=> 7
- * ary.bsearch {|x| x >= -1 } #=> 0
- * ary.bsearch {|x| x >= 100 } #=> nil
- *
- * In find-any mode (this behaves like libc's bsearch(3)), the block
- * must always return a number, and there must be two indices i and j
- * (0 <= i <= j <= ary.size) so that:
- *
- * - the block returns a positive number for ary[k] if 0 <= k < i,
- * - the block returns zero for ary[k] if i <= k < j, and
- * - the block returns a negative number for ary[k] if
- * j <= k < ary.size.
- *
- * Under this condition, this method returns any element whose index
- * is within i...j. If i is equal to j (i.e., there is no element
- * that satisfies the block), this method returns nil.
- *
- * ary = [0, 4, 7, 10, 12]
- * # try to find v such that 4 <= v < 8
- * ary.bsearch {|x| 1 - x / 4 } #=> 4 or 7
- * # try to find v such that 8 <= v < 10
- * ary.bsearch {|x| 4 - x / 2 } #=> nil
- *
- * You must not mix the two modes at a time; the block must always
- * return either true/false, or always return a number. It is
- * undefined which value is actually picked up at each iteration.
- */
-
static VALUE
-rb_ary_bsearch(VALUE ary)
+sort_unlock(ary)
+ VALUE ary;
{
- VALUE index_result = rb_ary_bsearch_index(ary);
-
- if (FIXNUM_P(index_result)) {
- return rb_ary_entry(ary, FIX2LONG(index_result));
- }
- return index_result;
+ FL_UNSET(ary, ARY_TMPLOCK);
+ return ary;
}
/*
* call-seq:
- * ary.bsearch_index {|x| block } -> int or nil
- *
- * By using binary search, finds an index of a value from this array which
- * meets the given condition in O(log n) where n is the size of the array.
- *
- * It supports two modes, depending on the nature of the block. They are
- * exactly the same as in the case of the #bsearch method, with the only difference
- * being that this method returns the index of the element instead of the
- * element itself. For more details consult the documentation for #bsearch.
+ * array.sort! -> array
+ * array.sort! {| a,b | block } -> array
+ *
+ * Sorts _self_. Comparisons for
+ * the sort will be done using the <code><=></code> operator or using
+ * an optional code block. The block implements a comparison between
+ * <i>a</i> and <i>b</i>, returning -1, 0, or +1. See also
+ * <code>Enumerable#sort_by</code>.
+ *
+ * a = [ "d", "a", "e", "c", "b" ]
+ * a.sort #=> ["a", "b", "c", "d", "e"]
+ * a.sort {|x,y| y <=> x } #=> ["e", "d", "c", "b", "a"]
*/
-static VALUE
-rb_ary_bsearch_index(VALUE ary)
+VALUE
+rb_ary_sort_bang(ary)
+ VALUE ary;
{
- long low = 0, high = RARRAY_LEN(ary), mid;
- int smaller = 0, satisfied = 0;
- VALUE v, val;
-
- RETURN_ENUMERATOR(ary, 0, 0);
- while (low < high) {
- mid = low + ((high - low) / 2);
- val = rb_ary_entry(ary, mid);
- v = rb_yield(val);
- if (FIXNUM_P(v)) {
- if (v == INT2FIX(0)) return INT2FIX(mid);
- smaller = (SIGNED_VALUE)v < 0; /* Fixnum preserves its sign-bit */
- }
- else if (v == Qtrue) {
- satisfied = 1;
- smaller = 1;
- }
- else if (v == Qfalse || v == Qnil) {
- smaller = 0;
- }
- else if (rb_obj_is_kind_of(v, rb_cNumeric)) {
- const VALUE zero = INT2FIX(0);
- switch (rb_cmpint(rb_funcallv(v, id_cmp, 1, &zero), v, zero)) {
- case 0: return INT2FIX(mid);
- case 1: smaller = 1; break;
- case -1: smaller = 0;
- }
- }
- else {
- rb_raise(rb_eTypeError, "wrong argument type %"PRIsVALUE
- " (must be numeric, true, false or nil)",
- rb_obj_class(v));
- }
- if (smaller) {
- high = mid;
- }
- else {
- low = mid + 1;
- }
+ rb_ary_modify(ary);
+ if (RARRAY(ary)->len > 1) {
+ FL_SET(ary, ARY_TMPLOCK); /* prohibit modification during sort */
+ rb_ensure(sort_internal, ary, sort_unlock, ary);
}
- if (!satisfied) return Qnil;
- return INT2FIX(low);
-}
-
-
-static VALUE
-sort_by_i(RB_BLOCK_CALL_FUNC_ARGLIST(i, dummy))
-{
- return rb_yield(i);
+ return ary;
}
/*
* call-seq:
- * ary.sort_by! {|obj| block} -> ary
- * ary.sort_by! -> Enumerator
- *
- * Sorts +self+ in place using a set of keys generated by mapping the
- * values in +self+ through the given block.
- *
- * The result is not guaranteed to be stable. When two keys are equal,
- * the order of the corresponding elements is unpredictable.
- *
- * If no block is given, an Enumerator is returned instead.
- *
- * See also Enumerable#sort_by.
+ * array.sort -> an_array
+ * array.sort {| a,b | block } -> an_array
+ *
+ * Returns a new array created by sorting <i>self</i>. Comparisons for
+ * the sort will be done using the <code><=></code> operator or using
+ * an optional code block. The block implements a comparison between
+ * <i>a</i> and <i>b</i>, returning -1, 0, or +1. See also
+ * <code>Enumerable#sort_by</code>.
+ *
+ * a = [ "d", "a", "e", "c", "b" ]
+ * a.sort #=> ["a", "b", "c", "d", "e"]
+ * a.sort {|x,y| y <=> x } #=> ["e", "d", "c", "b", "a"]
*/
-static VALUE
-rb_ary_sort_by_bang(VALUE ary)
+VALUE
+rb_ary_sort(ary)
+ VALUE ary;
{
- VALUE sorted;
-
- RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
- rb_ary_modify(ary);
- sorted = rb_block_call(ary, rb_intern("sort_by"), 0, 0, sort_by_i, 0);
- rb_ary_replace(ary, sorted);
+ ary = rb_ary_dup(ary);
+ rb_ary_sort_bang(ary);
return ary;
}
-
/*
* call-seq:
- * ary.collect {|item| block} -> new_ary
- * ary.map {|item| block} -> new_ary
- * ary.collect -> Enumerator
- * ary.map -> Enumerator
- *
- * Invokes the given block once for each element of +self+.
- *
- * Creates a new array containing the values returned by the block.
- *
- * See also Enumerable#collect.
- *
- * If no block is given, an Enumerator is returned instead.
- *
+ * array.collect {|item| block } -> an_array
+ * array.map {|item| block } -> an_array
+ *
+ * Invokes <i>block</i> once for each element of <i>self</i>. Creates a
+ * new array containing the values returned by the block.
+ * See also <code>Enumerable#collect</code>.
+ *
* a = [ "a", "b", "c", "d" ]
- * a.collect {|x| x + "!"} #=> ["a!", "b!", "c!", "d!"]
- * a.map.with_index {|x, i| x * i} #=> ["", "b", "cc", "ddd"]
- * a #=> ["a", "b", "c", "d"]
+ * a.collect {|x| x + "!" } #=> ["a!", "b!", "c!", "d!"]
+ * a #=> ["a", "b", "c", "d"]
*/
static VALUE
-rb_ary_collect(VALUE ary)
+rb_ary_collect(ary)
+ VALUE ary;
{
long i;
VALUE collect;
- RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
- collect = rb_ary_new2(RARRAY_LEN(ary));
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- rb_ary_push(collect, rb_yield(RARRAY_AREF(ary, i)));
+ if (!rb_block_given_p()) {
+ return rb_ary_new4(RARRAY(ary)->len, RARRAY(ary)->ptr);
+ }
+
+ collect = rb_ary_new2(RARRAY(ary)->len);
+ for (i = 0; i < RARRAY(ary)->len; i++) {
+ rb_ary_push(collect, rb_yield(RARRAY(ary)->ptr[i]));
}
return collect;
}
-
-/*
+/*
* call-seq:
- * ary.collect! {|item| block } -> ary
- * ary.map! {|item| block } -> ary
- * ary.collect! -> Enumerator
- * ary.map! -> Enumerator
- *
- * Invokes the given block once for each element of +self+, replacing the
- * element with the value returned by the block.
- *
- * See also Enumerable#collect.
- *
- * If no block is given, an Enumerator is returned instead.
+ * array.collect! {|item| block } -> array
+ * array.map! {|item| block } -> array
*
+ * Invokes the block once for each element of _self_, replacing the
+ * element with the value returned by _block_.
+ * See also <code>Enumerable#collect</code>.
+ *
* a = [ "a", "b", "c", "d" ]
- * a.map! {|x| x + "!" }
- * a #=> [ "a!", "b!", "c!", "d!" ]
- * a.collect!.with_index {|x, i| x[0...i] }
- * a #=> ["", "b", "c!", "d!"]
+ * a.collect! {|x| x + "!" }
+ * a #=> [ "a!", "b!", "c!", "d!" ]
*/
static VALUE
-rb_ary_collect_bang(VALUE ary)
+rb_ary_collect_bang(ary)
+ VALUE ary;
{
long i;
- RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
rb_ary_modify(ary);
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- rb_ary_store(ary, i, rb_yield(RARRAY_AREF(ary, i)));
+ for (i = 0; i < RARRAY(ary)->len; i++) {
+ RARRAY(ary)->ptr[i] = rb_yield(RARRAY(ary)->ptr[i]);
}
return ary;
}
VALUE
-rb_get_values_at(VALUE obj, long olen, int argc, const VALUE *argv, VALUE (*func) (VALUE, long))
+rb_values_at(obj, olen, argc, argv, func)
+ VALUE obj;
+ long olen;
+ int argc;
+ VALUE *argv;
+ VALUE (*func) _((VALUE,long));
{
VALUE result = rb_ary_new2(argc);
long beg, len, i, j;
@@ -3114,13 +1705,15 @@ rb_get_values_at(VALUE obj, long olen, int argc, const VALUE *argv, VALUE (*func
continue;
}
/* check if idx is Range */
- if (rb_range_beg_len(argv[i], &beg, &len, olen, 1)) {
- long end = olen < beg+len ? olen : beg+len;
- for (j = beg; j < end; j++) {
- rb_ary_push(result, (*func)(obj, j));
+ switch (rb_range_beg_len(argv[i], &beg, &len, olen, 0)) {
+ case Qfalse:
+ break;
+ case Qnil:
+ continue;
+ default:
+ for (j=0; j<len; j++) {
+ rb_ary_push(result, (*func)(obj, j+beg));
}
- if (beg + len > j)
- rb_ary_resize(result, RARRAY_LEN(result) + (beg + len) - j);
continue;
}
rb_ary_push(result, (*func)(obj, NUM2LONG(argv[i])));
@@ -3128,348 +1721,174 @@ rb_get_values_at(VALUE obj, long olen, int argc, const VALUE *argv, VALUE (*func
return result;
}
-static VALUE
-append_values_at_single(VALUE result, VALUE ary, long olen, VALUE idx)
-{
- long beg, len;
- if (FIXNUM_P(idx)) {
- beg = FIX2LONG(idx);
- }
- /* check if idx is Range */
- else if (rb_range_beg_len(idx, &beg, &len, olen, 1)) {
- if (len > 0) {
- const VALUE *const src = RARRAY_CONST_PTR_TRANSIENT(ary);
- const long end = beg + len;
- const long prevlen = RARRAY_LEN(result);
- if (beg < olen) {
- rb_ary_cat(result, src + beg, end > olen ? olen-beg : len);
- }
- if (end > olen) {
- rb_ary_store(result, prevlen + len - 1, Qnil);
- }
- }
- return result;
- }
- else {
- beg = NUM2LONG(idx);
- }
- return rb_ary_push(result, rb_ary_entry(ary, beg));
-}
-
-/*
+/*
* call-seq:
- * ary.values_at(selector, ...) -> new_ary
- *
- * Returns an array containing the elements in +self+ corresponding to the
- * given +selector+(s).
- *
- * The selectors may be either integer indices or ranges.
- *
- * See also Array#select.
+ * array.values_at(selector,... ) -> an_array
*
+ * Returns an array containing the elements in
+ * _self_ corresponding to the given selector(s). The selectors
+ * may be either integer indices or ranges.
+ * See also <code>Array#select</code>.
+ *
* a = %w{ a b c d e f }
- * a.values_at(1, 3, 5) # => ["b", "d", "f"]
- * a.values_at(1, 3, 5, 7) # => ["b", "d", "f", nil]
- * a.values_at(-1, -2, -2, -7) # => ["f", "e", "e", nil]
- * a.values_at(4..6, 3...6) # => ["e", "f", nil, "d", "e", "f"]
+ * a.values_at(1, 3, 5)
+ * a.values_at(1, 3, 5, 7)
+ * a.values_at(-1, -3, -5, -7)
+ * a.values_at(1..3, 2...5)
*/
static VALUE
-rb_ary_values_at(int argc, VALUE *argv, VALUE ary)
+rb_ary_values_at(argc, argv, ary)
+ int argc;
+ VALUE *argv;
+ VALUE ary;
{
- long i, olen = RARRAY_LEN(ary);
- VALUE result = rb_ary_new_capa(argc);
- for (i = 0; i < argc; ++i) {
- append_values_at_single(result, ary, olen, argv[i]);
- }
- RB_GC_GUARD(ary);
- return result;
+ return rb_values_at(ary, RARRAY(ary)->len, argc, argv, rb_ary_entry);
}
-
/*
* call-seq:
- * ary.select {|item| block} -> new_ary
- * ary.select -> Enumerator
- * ary.filter {|item| block} -> new_ary
- * ary.filter -> Enumerator
- *
- * Returns a new array containing all elements of +ary+
- * for which the given +block+ returns a true value.
- *
- * If no block is given, an Enumerator is returned instead.
- *
- * [1,2,3,4,5].select {|num| num.even? } #=> [2, 4]
- *
- * a = %w[ a b c d e f ]
- * a.select {|v| v =~ /[aeiou]/ } #=> ["a", "e"]
- *
- * See also Enumerable#select.
- *
- * Array#filter is an alias for Array#select.
+ * array.select {|item| block } -> an_array
+ *
+ * Invokes the block passing in successive elements from <i>array</i>,
+ * returning an array containing those elements for which the block
+ * returns a true value (equivalent to <code>Enumerable#select</code>).
+ *
+ * a = %w{ a b c d e f }
+ * a.select {|v| v =~ /[aeiou]/} #=> ["a", "e"]
*/
static VALUE
-rb_ary_select(VALUE ary)
+rb_ary_select(argc, argv, ary)
+ int argc;
+ VALUE *argv;
+ VALUE ary;
{
VALUE result;
long i;
- RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
- result = rb_ary_new2(RARRAY_LEN(ary));
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
- rb_ary_push(result, rb_ary_elt(ary, i));
- }
- }
- return result;
-}
-
-struct select_bang_arg {
- VALUE ary;
- long len[2];
-};
-
-static VALUE
-select_bang_i(VALUE a)
-{
- volatile struct select_bang_arg *arg = (void *)a;
- VALUE ary = arg->ary;
- long i1, i2;
-
- for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); arg->len[0] = ++i1) {
- VALUE v = RARRAY_AREF(ary, i1);
- if (!RTEST(rb_yield(v))) continue;
- if (i1 != i2) {
- rb_ary_store(ary, i2, v);
- }
- arg->len[1] = ++i2;
+ if (argc > 0) {
+ rb_raise(rb_eArgError, "wrong number of arguments (%d for 0)", argc);
}
- return (i1 == i2) ? Qnil : ary;
-}
-
-static VALUE
-select_bang_ensure(VALUE a)
-{
- volatile struct select_bang_arg *arg = (void *)a;
- VALUE ary = arg->ary;
- long len = RARRAY_LEN(ary);
- long i1 = arg->len[0], i2 = arg->len[1];
-
- if (i2 < len && i2 < i1) {
- long tail = 0;
- if (i1 < len) {
- tail = len - i1;
- RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
- MEMMOVE(ptr + i2, ptr + i1, VALUE, tail);
- });
- }
- ARY_SET_LEN(ary, i2 + tail);
- }
- return ary;
-}
-
-/*
- * call-seq:
- * ary.select! {|item| block } -> ary or nil
- * ary.select! -> Enumerator
- * ary.filter! {|item| block } -> ary or nil
- * ary.filter! -> Enumerator
- *
- * Invokes the given block passing in successive elements from +self+,
- * deleting elements for which the block returns a +false+ value.
- *
- * The array may not be changed instantly every time the block is called.
- *
- * If changes were made, it will return +self+, otherwise it returns +nil+.
- *
- * If no block is given, an Enumerator is returned instead.
- *
- * See also Array#keep_if.
- *
- * Array#filter! is an alias for Array#select!.
- */
-
-static VALUE
-rb_ary_select_bang(VALUE ary)
-{
- struct select_bang_arg args;
-
- RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
- rb_ary_modify(ary);
-
- args.ary = ary;
- args.len[0] = args.len[1] = 0;
- return rb_ensure(select_bang_i, (VALUE)&args, select_bang_ensure, (VALUE)&args);
-}
-
-/*
- * call-seq:
- * ary.keep_if {|item| block} -> ary
- * ary.keep_if -> Enumerator
- *
- * Deletes every element of +self+ for which the given block evaluates to
- * +false+, and returns +self+.
- *
- * If no block is given, an Enumerator is returned instead.
- *
- * a = %w[ a b c d e f ]
- * a.keep_if {|v| v =~ /[aeiou]/ } #=> ["a", "e"]
- * a #=> ["a", "e"]
- *
- * See also Array#select!.
- */
-
-static VALUE
-rb_ary_keep_if(VALUE ary)
-{
- RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
- rb_ary_select_bang(ary);
- return ary;
-}
-
-static void
-ary_resize_smaller(VALUE ary, long len)
-{
- rb_ary_modify(ary);
- if (RARRAY_LEN(ary) > len) {
- ARY_SET_LEN(ary, len);
- if (len * 2 < ARY_CAPA(ary) &&
- ARY_CAPA(ary) > ARY_DEFAULT_SIZE) {
- ary_resize_capa(ary, len * 2);
+ result = rb_ary_new2(RARRAY(ary)->len);
+ for (i = 0; i < RARRAY(ary)->len; i++) {
+ if (RTEST(rb_yield(RARRAY(ary)->ptr[i]))) {
+ rb_ary_push(result, RARRAY(ary)->ptr[i]);
}
}
+ return result;
}
/*
* call-seq:
- * ary.delete(obj) -> item or nil
- * ary.delete(obj) {block} -> item or result of block
- *
- * Deletes all items from +self+ that are equal to +obj+.
- *
- * Returns the last deleted item, or +nil+ if no matching item is found.
- *
- * If the optional code block is given, the result of the block is returned if
- * the item is not found. (To remove +nil+ elements and get an informative
- * return value, use Array#compact!)
- *
+ * array.delete(obj) -> obj or nil
+ * array.delete(obj) { block } -> obj or nil
+ *
+ * Deletes items from <i>self</i> that are equal to <i>obj</i>. If
+ * the item is not found, returns <code>nil</code>. If the optional
+ * code block is given, returns the result of <i>block</i> if the item
+ * is not found.
+ *
* a = [ "a", "b", "b", "b", "c" ]
* a.delete("b") #=> "b"
* a #=> ["a", "c"]
* a.delete("z") #=> nil
- * a.delete("z") {"not found"} #=> "not found"
+ * a.delete("z") { "not found" } #=> "not found"
*/
VALUE
-rb_ary_delete(VALUE ary, VALUE item)
+rb_ary_delete(ary, item)
+ VALUE ary;
+ VALUE item;
{
- VALUE v = item;
long i1, i2;
- for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); i1++) {
- VALUE e = RARRAY_AREF(ary, i1);
-
- if (rb_equal(e, item)) {
- v = e;
- continue;
- }
+ rb_ary_modify(ary);
+ for (i1 = i2 = 0; i1 < RARRAY(ary)->len; i1++) {
+ if (rb_equal(RARRAY(ary)->ptr[i1], item)) continue;
if (i1 != i2) {
- rb_ary_store(ary, i2, e);
+ RARRAY(ary)->ptr[i2] = RARRAY(ary)->ptr[i1];
}
i2++;
}
- if (RARRAY_LEN(ary) == i2) {
+ if (RARRAY(ary)->len == i2) {
if (rb_block_given_p()) {
return rb_yield(item);
}
return Qnil;
}
- ary_resize_smaller(ary, i2);
-
- ary_verify(ary);
- return v;
-}
-
-void
-rb_ary_delete_same(VALUE ary, VALUE item)
-{
- long i1, i2;
-
- for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); i1++) {
- VALUE e = RARRAY_AREF(ary, i1);
-
- if (e == item) {
- continue;
- }
- if (i1 != i2) {
- rb_ary_store(ary, i2, e);
- }
- i2++;
- }
- if (RARRAY_LEN(ary) == i2) {
- return;
+ RARRAY(ary)->len = i2;
+ if (i2 * 2 < RARRAY(ary)->aux.capa &&
+ RARRAY(ary)->aux.capa > ARY_DEFAULT_SIZE) {
+ REALLOC_N(RARRAY(ary)->ptr, VALUE, i2 * 2);
+ RARRAY(ary)->aux.capa = i2 * 2;
}
- ary_resize_smaller(ary, i2);
+ return item;
}
VALUE
-rb_ary_delete_at(VALUE ary, long pos)
+rb_ary_delete_at(ary, pos)
+ VALUE ary;
+ long pos;
{
- long len = RARRAY_LEN(ary);
+ long i, len = RARRAY(ary)->len;
VALUE del;
+ rb_ary_modify(ary);
if (pos >= len) return Qnil;
if (pos < 0) {
pos += len;
if (pos < 0) return Qnil;
}
- rb_ary_modify(ary);
- del = RARRAY_AREF(ary, pos);
- RARRAY_PTR_USE_TRANSIENT(ary, ptr, {
- MEMMOVE(ptr+pos, ptr+pos+1, VALUE, len-pos-1);
- });
- ARY_INCREASE_LEN(ary, -1);
- ary_verify(ary);
+ del = RARRAY(ary)->ptr[pos];
+ for (i = pos + 1; i < len; i++, pos++) {
+ RARRAY(ary)->ptr[pos] = RARRAY(ary)->ptr[i];
+ }
+ RARRAY(ary)->len = pos;
+
return del;
}
/*
* call-seq:
- * ary.delete_at(index) -> obj or nil
- *
- * Deletes the element at the specified +index+, returning that element, or
- * +nil+ if the +index+ is out of range.
- *
- * See also Array#slice!
- *
- * a = ["ant", "bat", "cat", "dog"]
+ * array.delete_at(index) -> obj or nil
+ *
+ * Deletes the element at the specified index, returning that element,
+ * or <code>nil</code> if the index is out of range. See also
+ * <code>Array#slice!</code>.
+ *
+ * a = %w( ant bat cat dog )
* a.delete_at(2) #=> "cat"
* a #=> ["ant", "bat", "dog"]
* a.delete_at(99) #=> nil
*/
static VALUE
-rb_ary_delete_at_m(VALUE ary, VALUE pos)
+rb_ary_delete_at_m(ary, pos)
+ VALUE ary, pos;
{
return rb_ary_delete_at(ary, NUM2LONG(pos));
}
/*
* call-seq:
- * ary.slice!(index) -> obj or nil
- * ary.slice!(start, length) -> new_ary or nil
- * ary.slice!(range) -> new_ary or nil
- *
- * Deletes the element(s) given by an +index+ (optionally up to +length+
- * elements) or by a +range+.
- *
- * Returns the deleted object (or objects), or +nil+ if the +index+ is out of
- * range.
- *
+ * array.slice!(index) -> obj or nil
+ * array.slice!(start, length) -> sub_array or nil
+ * array.slice!(range) -> sub_array or nil
+ *
+ * Deletes the element(s) given by an index (optionally with a length)
+ * or by a range. Returns the deleted object, subarray, or
+ * <code>nil</code> if the index is out of range. Equivalent to:
+ *
+ * def slice!(*args)
+ * result = self[*args]
+ * self[*args] = nil
+ * result
+ * end
+ *
* a = [ "a", "b", "c" ]
* a.slice!(1) #=> "b"
* a #=> ["a", "c"]
@@ -3480,315 +1899,196 @@ rb_ary_delete_at_m(VALUE ary, VALUE pos)
*/
static VALUE
-rb_ary_slice_bang(int argc, VALUE *argv, VALUE ary)
+rb_ary_slice_bang(argc, argv, ary)
+ int argc;
+ VALUE *argv;
+ VALUE ary;
{
VALUE arg1, arg2;
- long pos, len, orig_len;
+ long pos, len;
- rb_ary_modify_check(ary);
- if (argc == 2) {
- pos = NUM2LONG(argv[0]);
- len = NUM2LONG(argv[1]);
+ rb_ary_modify(ary);
+ if (rb_scan_args(argc, argv, "11", &arg1, &arg2) == 2) {
+ pos = NUM2LONG(arg1);
+ len = NUM2LONG(arg2);
delete_pos_len:
- if (len < 0) return Qnil;
- orig_len = RARRAY_LEN(ary);
if (pos < 0) {
- pos += orig_len;
- if (pos < 0) return Qnil;
- }
- else if (orig_len < pos) return Qnil;
- if (orig_len < pos + len) {
- len = orig_len - pos;
+ pos = RARRAY(ary)->len + pos;
}
- if (len == 0) return rb_ary_new2(0);
- arg2 = rb_ary_new4(len, RARRAY_CONST_PTR_TRANSIENT(ary)+pos);
- RBASIC_SET_CLASS(arg2, rb_obj_class(ary));
- rb_ary_splice(ary, pos, len, 0, 0);
+ arg2 = rb_ary_subseq(ary, pos, len);
+ rb_ary_update(ary, pos, len, Qnil); /* Qnil/rb_ary_new2(0) */
return arg2;
}
- rb_check_arity(argc, 1, 2);
- arg1 = argv[0];
-
- if (!FIXNUM_P(arg1)) {
- switch (rb_range_beg_len(arg1, &pos, &len, RARRAY_LEN(ary), 0)) {
- case Qtrue:
- /* valid range */
- goto delete_pos_len;
- case Qnil:
- /* invalid range */
- return Qnil;
- default:
- /* not a range */
- break;
- }
+ if (!FIXNUM_P(arg1) && rb_range_beg_len(arg1, &pos, &len, RARRAY(ary)->len, 1)) {
+ goto delete_pos_len;
}
return rb_ary_delete_at(ary, NUM2LONG(arg1));
}
-static VALUE
-ary_reject(VALUE orig, VALUE result)
-{
- long i;
-
- for (i = 0; i < RARRAY_LEN(orig); i++) {
- VALUE v = RARRAY_AREF(orig, i);
-
- if (!RTEST(rb_yield(v))) {
- rb_ary_push(result, v);
- }
- }
- return result;
-}
+/*
+ * call-seq:
+ * array.reject! {|item| block } -> array or nil
+ *
+ * Equivalent to <code>Array#delete_if</code>, deleting elements from
+ * _self_ for which the block evaluates to true, but returns
+ * <code>nil</code> if no changes were made. Also see
+ * <code>Enumerable#reject</code>.
+ */
static VALUE
-reject_bang_i(VALUE a)
+rb_ary_reject_bang(ary)
+ VALUE ary;
{
- volatile struct select_bang_arg *arg = (void *)a;
- VALUE ary = arg->ary;
long i1, i2;
- for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); arg->len[0] = ++i1) {
- VALUE v = RARRAY_AREF(ary, i1);
- if (RTEST(rb_yield(v))) continue;
+ rb_ary_modify(ary);
+ for (i1 = i2 = 0; i1 < RARRAY(ary)->len; i1++) {
+ if (RTEST(rb_yield(RARRAY(ary)->ptr[i1]))) continue;
if (i1 != i2) {
- rb_ary_store(ary, i2, v);
+ RARRAY(ary)->ptr[i2] = RARRAY(ary)->ptr[i1];
}
- arg->len[1] = ++i2;
+ i2++;
}
- return (i1 == i2) ? Qnil : ary;
-}
-
-static VALUE
-ary_reject_bang(VALUE ary)
-{
- struct select_bang_arg args;
- rb_ary_modify_check(ary);
- args.ary = ary;
- args.len[0] = args.len[1] = 0;
- return rb_ensure(reject_bang_i, (VALUE)&args, select_bang_ensure, (VALUE)&args);
-}
-
-/*
- * call-seq:
- * ary.reject! {|item| block} -> ary or nil
- * ary.reject! -> Enumerator
- *
- * Deletes every element of +self+ for which the block evaluates to +true+,
- * if no changes were made returns +nil+.
- *
- * The array may not be changed instantly every time the block is called.
- *
- * See also Enumerable#reject and Array#delete_if.
- *
- * If no block is given, an Enumerator is returned instead.
- */
+ if (RARRAY(ary)->len == i2) return Qnil;
+ RARRAY(ary)->len = i2;
-static VALUE
-rb_ary_reject_bang(VALUE ary)
-{
- RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
- rb_ary_modify(ary);
- return ary_reject_bang(ary);
+ return ary;
}
/*
* call-seq:
- * ary.reject {|item| block } -> new_ary
- * ary.reject -> Enumerator
- *
- * Returns a new array containing the items in +self+ for which the given
- * block is not +true+. The ordering of non-rejected elements is maintained.
- *
- * See also Array#delete_if
- *
- * If no block is given, an Enumerator is returned instead.
+ * array.reject {|item| block } -> an_array
+ *
+ * Returns a new array containing the items in _self_
+ * for which the block is not true.
*/
static VALUE
-rb_ary_reject(VALUE ary)
+rb_ary_reject(ary)
+ VALUE ary;
{
- VALUE rejected_ary;
-
- RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
- rejected_ary = rb_ary_new();
- ary_reject(ary, rejected_ary);
- return rejected_ary;
+ ary = rb_ary_dup(ary);
+ rb_ary_reject_bang(ary);
+ return ary;
}
/*
* call-seq:
- * ary.delete_if {|item| block} -> ary
- * ary.delete_if -> Enumerator
- *
- * Deletes every element of +self+ for which block evaluates to +true+.
- *
- * The array is changed instantly every time the block is called, not after
- * the iteration is over.
- *
- * See also Array#reject!
- *
- * If no block is given, an Enumerator is returned instead.
- *
- * scores = [ 97, 42, 75 ]
- * scores.delete_if {|score| score < 80 } #=> [97]
+ * array.delete_if {|item| block } -> array
+ *
+ * Deletes every element of <i>self</i> for which <i>block</i> evaluates
+ * to <code>true</code>.
+ *
+ * a = [ "a", "b", "c" ]
+ * a.delete_if {|x| x >= "b" } #=> ["a"]
*/
static VALUE
-rb_ary_delete_if(VALUE ary)
+rb_ary_delete_if(ary)
+ VALUE ary;
{
- ary_verify(ary);
- RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
- ary_reject_bang(ary);
+ rb_ary_reject_bang(ary);
return ary;
}
-static VALUE
-take_i(RB_BLOCK_CALL_FUNC_ARGLIST(val, cbarg))
-{
- VALUE *args = (VALUE *)cbarg;
- if (args[1] == 0) rb_iter_break();
- else args[1]--;
- if (argc > 1) val = rb_ary_new4(argc, argv);
- rb_ary_push(args[0], val);
- return Qnil;
-}
-
-static VALUE
-take_items(VALUE obj, long n)
-{
- VALUE result = rb_check_array_type(obj);
- VALUE args[2];
-
- if (!NIL_P(result)) return rb_ary_subseq(result, 0, n);
- result = rb_ary_new2(n);
- args[0] = result; args[1] = (VALUE)n;
- if (rb_check_block_call(obj, idEach, 0, 0, take_i, (VALUE)args) == Qundef)
- rb_raise(rb_eTypeError, "wrong argument type %"PRIsVALUE" (must respond to :each)",
- rb_obj_class(obj));
- return result;
-}
-
-
/*
* call-seq:
- * ary.zip(arg, ...) -> new_ary
- * ary.zip(arg, ...) {|arr| block} -> nil
- *
- * Converts any arguments to arrays, then merges elements of +self+ with
- * corresponding elements from each argument.
- *
- * This generates a sequence of <code>ary.size</code> _n_-element arrays,
- * where _n_ is one more than the count of arguments.
- *
- * If the size of any argument is less than the size of the initial array,
- * +nil+ values are supplied.
- *
- * If a block is given, it is invoked for each output +array+, otherwise an
- * array of arrays is returned.
- *
+ * array.zip(arg, ...) -> an_array
+ * array.zip(arg, ...) {| arr | block } -> nil
+ *
+ * Converts any arguments to arrays, then merges elements of
+ * <i>self</i> with corresponding elements from each argument. This
+ * generates a sequence of <code>self.size</code> <em>n</em>-element
+ * arrays, where <em>n</em> is one more that the count of arguments. If
+ * the size of any argument is less than <code>enumObj.size</code>,
+ * <code>nil</code> values are supplied. If a block given, it is
+ * invoked for each output array, otherwise an array of arrays is
+ * returned.
+ *
* a = [ 4, 5, 6 ]
* b = [ 7, 8, 9 ]
- * [1, 2, 3].zip(a, b) #=> [[1, 4, 7], [2, 5, 8], [3, 6, 9]]
- * [1, 2].zip(a, b) #=> [[1, 4, 7], [2, 5, 8]]
- * a.zip([1, 2], [8]) #=> [[4, 1, 8], [5, 2, nil], [6, nil, nil]]
+ *
+ * [1,2,3].zip(a, b) #=> [[1, 4, 7], [2, 5, 8], [3, 6, 9]]
+ * [1,2].zip(a,b) #=> [[1, 4, 7], [2, 5, 8]]
+ * a.zip([1,2],[8]) #=> [[4,1,8], [5,2,nil], [6,nil,nil]]
*/
static VALUE
-rb_ary_zip(int argc, VALUE *argv, VALUE ary)
+rb_ary_zip(argc, argv, ary)
+ int argc;
+ VALUE *argv;
+ VALUE ary;
{
int i, j;
- long len = RARRAY_LEN(ary);
- VALUE result = Qnil;
+ long len;
+ VALUE result;
for (i=0; i<argc; i++) {
- argv[i] = take_items(argv[i], len);
+ argv[i] = to_ary(argv[i]);
}
-
if (rb_block_given_p()) {
- int arity = rb_block_arity();
-
- if (arity > 1) {
- VALUE work, *tmp;
+ for (i=0; i<RARRAY(ary)->len; i++) {
+ VALUE tmp = rb_ary_new2(argc+1);
- tmp = ALLOCV_N(VALUE, work, argc+1);
-
- for (i=0; i<RARRAY_LEN(ary); i++) {
- tmp[0] = RARRAY_AREF(ary, i);
- for (j=0; j<argc; j++) {
- tmp[j+1] = rb_ary_elt(argv[j], i);
- }
- rb_yield_values2(argc+1, tmp);
- }
-
- if (work) ALLOCV_END(work);
- }
- else {
- for (i=0; i<RARRAY_LEN(ary); i++) {
- VALUE tmp = rb_ary_new2(argc+1);
-
- rb_ary_push(tmp, RARRAY_AREF(ary, i));
- for (j=0; j<argc; j++) {
- rb_ary_push(tmp, rb_ary_elt(argv[j], i));
- }
- rb_yield(tmp);
+ rb_ary_push(tmp, rb_ary_entry(ary, i));
+ for (j=0; j<argc; j++) {
+ rb_ary_push(tmp, rb_ary_entry(argv[j], i));
}
+ rb_yield(tmp);
}
+ return Qnil;
}
- else {
- result = rb_ary_new_capa(len);
-
- for (i=0; i<len; i++) {
- VALUE tmp = rb_ary_new_capa(argc+1);
+ len = RARRAY(ary)->len;
+ result = rb_ary_new2(len);
+ for (i=0; i<len; i++) {
+ VALUE tmp = rb_ary_new2(argc+1);
- rb_ary_push(tmp, RARRAY_AREF(ary, i));
- for (j=0; j<argc; j++) {
- rb_ary_push(tmp, rb_ary_elt(argv[j], i));
- }
- rb_ary_push(result, tmp);
+ rb_ary_push(tmp, rb_ary_entry(ary, i));
+ for (j=0; j<argc; j++) {
+ rb_ary_push(tmp, rb_ary_entry(argv[j], i));
}
+ rb_ary_push(result, tmp);
}
-
return result;
}
/*
* call-seq:
- * ary.transpose -> new_ary
- *
- * Assumes that +self+ is an array of arrays and transposes the rows and
- * columns.
- *
+ * array.transpose -> an_array
+ *
+ * Assumes that <i>self</i> is an array of arrays and transposes the
+ * rows and columns.
+ *
* a = [[1,2], [3,4], [5,6]]
* a.transpose #=> [[1, 3, 5], [2, 4, 6]]
- *
- * If the length of the subarrays don't match, an IndexError is raised.
*/
static VALUE
-rb_ary_transpose(VALUE ary)
+rb_ary_transpose(ary)
+ VALUE ary;
{
long elen = -1, alen, i, j;
VALUE tmp, result = 0;
- alen = RARRAY_LEN(ary);
+ alen = RARRAY(ary)->len;
if (alen == 0) return rb_ary_dup(ary);
for (i=0; i<alen; i++) {
- tmp = to_ary(rb_ary_elt(ary, i));
+ tmp = to_ary(RARRAY(ary)->ptr[i]);
if (elen < 0) { /* first element */
- elen = RARRAY_LEN(tmp);
+ elen = RARRAY(tmp)->len;
result = rb_ary_new2(elen);
for (j=0; j<elen; j++) {
rb_ary_store(result, j, rb_ary_new2(alen));
}
}
- else if (elen != RARRAY_LEN(tmp)) {
- rb_raise(rb_eIndexError, "element size differs (%ld should be %ld)",
- RARRAY_LEN(tmp), elen);
+ else if (elen != RARRAY(tmp)->len) {
+ rb_raise(rb_eIndexError, "element size differ (%d should be %d)",
+ RARRAY(tmp)->len, elen);
}
for (j=0; j<elen; j++) {
- rb_ary_store(rb_ary_elt(result, j), i, rb_ary_elt(tmp, j));
+ rb_ary_store(RARRAY(result)->ptr[j], i, RARRAY(tmp)->ptr[j]);
}
}
return result;
@@ -3796,111 +2096,73 @@ rb_ary_transpose(VALUE ary)
/*
* call-seq:
- * ary.replace(other_ary) -> ary
- * ary.initialize_copy(other_ary) -> ary
- *
- * Replaces the contents of +self+ with the contents of +other_ary+,
- * truncating or expanding if necessary.
- *
+ * array.replace(other_array) -> array
+ *
+ * Replaces the contents of <i>self</i> with the contents of
+ * <i>other_array</i>, truncating or expanding if necessary.
+ *
* a = [ "a", "b", "c", "d", "e" ]
* a.replace([ "x", "y", "z" ]) #=> ["x", "y", "z"]
* a #=> ["x", "y", "z"]
*/
-VALUE
-rb_ary_replace(VALUE copy, VALUE orig)
+static VALUE
+rb_ary_replace(copy, orig)
+ VALUE copy, orig;
{
- rb_ary_modify_check(copy);
+ rb_ary_modify(copy);
orig = to_ary(orig);
if (copy == orig) return copy;
+ ary_make_shared(orig);
+ if (RARRAY(copy)->ptr && !FL_TEST(copy, ELTS_SHARED))
+ free(RARRAY(copy)->ptr);
+ RARRAY(copy)->ptr = RARRAY(orig)->ptr;
+ RARRAY(copy)->len = RARRAY(orig)->len;
+ RARRAY(copy)->aux.shared = RARRAY(orig)->aux.shared;
+ FL_SET(copy, ELTS_SHARED);
- if (RARRAY_LEN(orig) <= RARRAY_EMBED_LEN_MAX) {
- VALUE shared_root = 0;
-
- if (ARY_OWNS_HEAP_P(copy)) {
- ary_heap_free(copy);
- }
- else if (ARY_SHARED_P(copy)) {
- shared_root = ARY_SHARED_ROOT(copy);
- FL_UNSET_SHARED(copy);
- }
- FL_SET_EMBED(copy);
- ary_memcpy(copy, 0, RARRAY_LEN(orig), RARRAY_CONST_PTR_TRANSIENT(orig));
- if (shared_root) {
- rb_ary_decrement_share(shared_root);
- }
- ARY_SET_LEN(copy, RARRAY_LEN(orig));
- }
- else {
- VALUE shared_root = ary_make_shared(orig);
- if (ARY_OWNS_HEAP_P(copy)) {
- ary_heap_free(copy);
- }
- else {
- rb_ary_unshare_safe(copy);
- }
- FL_UNSET_EMBED(copy);
- ARY_SET_PTR(copy, ARY_HEAP_PTR(orig));
- ARY_SET_LEN(copy, ARY_HEAP_LEN(orig));
- rb_ary_set_shared(copy, shared_root);
- }
- ary_verify(copy);
return copy;
}
-/*
+/*
* call-seq:
- * ary.clear -> ary
+ * array.clear -> array
*
- * Removes all elements from +self+.
+ * Removes all elements from _self_.
*
* a = [ "a", "b", "c", "d", "e" ]
* a.clear #=> [ ]
*/
VALUE
-rb_ary_clear(VALUE ary)
+rb_ary_clear(ary)
+ VALUE ary;
{
- rb_ary_modify_check(ary);
- if (ARY_SHARED_P(ary)) {
- if (!ARY_EMBED_P(ary)) {
- rb_ary_unshare(ary);
- FL_SET_EMBED(ary);
- ARY_SET_EMBED_LEN(ary, 0);
- }
- }
- else {
- ARY_SET_LEN(ary, 0);
- if (ARY_DEFAULT_SIZE * 2 < ARY_CAPA(ary)) {
- ary_resize_capa(ary, ARY_DEFAULT_SIZE * 2);
- }
+ rb_ary_modify(ary);
+ RARRAY(ary)->len = 0;
+ if (ARY_DEFAULT_SIZE * 2 < RARRAY(ary)->aux.capa) {
+ REALLOC_N(RARRAY(ary)->ptr, VALUE, ARY_DEFAULT_SIZE * 2);
+ RARRAY(ary)->aux.capa = ARY_DEFAULT_SIZE * 2;
}
- ary_verify(ary);
return ary;
}
/*
* call-seq:
- * ary.fill(obj) -> ary
- * ary.fill(obj, start [, length]) -> ary
- * ary.fill(obj, range) -> ary
- * ary.fill {|index| block} -> ary
- * ary.fill(start [, length]) {|index| block} -> ary
- * ary.fill(range) {|index| block} -> ary
- *
- * The first three forms set the selected elements of +self+ (which
- * may be the entire array) to +obj+.
- *
- * A +start+ of +nil+ is equivalent to zero.
- *
- * A +length+ of +nil+ is equivalent to the length of the array.
- *
- * The last three forms fill the array with the value of the given block,
- * which is passed the absolute index of each element to be filled.
- *
- * Negative values of +start+ count from the end of the array, where +-1+ is
- * the last element.
- *
+ * array.fill(obj) -> array
+ * array.fill(obj, start [, length]) -> array
+ * array.fill(obj, range ) -> array
+ * array.fill {|index| block } -> array
+ * array.fill(start [, length] ) {|index| block } -> array
+ * array.fill(range) {|index| block } -> array
+ *
+ * The first three forms set the selected elements of <i>self</i> (which
+ * may be the entire array) to <i>obj</i>. A <i>start</i> of
+ * <code>nil</code> is equivalent to zero. A <i>length</i> of
+ * <code>nil</code> is equivalent to <i>self.length</i>. The last three
+ * forms fill the array with the value of the block. The block is
+ * passed the absolute index of each element to be filled.
+ *
* a = [ "a", "b", "c", "d" ]
* a.fill("x") #=> ["x", "x", "x", "x"]
* a.fill("z", 2, 2) #=> ["x", "x", "z", "z"]
@@ -3910,12 +2172,18 @@ rb_ary_clear(VALUE ary)
*/
static VALUE
-rb_ary_fill(int argc, VALUE *argv, VALUE ary)
+rb_ary_fill(argc, argv, ary)
+ int argc;
+ VALUE *argv;
+ VALUE ary;
{
- VALUE item = Qundef, arg1, arg2;
- long beg = 0, end = 0, len = 0;
+ VALUE item, arg1, arg2;
+ long beg, end, len;
+ VALUE *p, *pend;
+ int block_p = Qfalse;
if (rb_block_given_p()) {
+ block_p = Qtrue;
rb_scan_args(argc, argv, "02", &arg1, &arg2);
argc += 1; /* hackish */
}
@@ -3925,162 +2193,111 @@ rb_ary_fill(int argc, VALUE *argv, VALUE ary)
switch (argc) {
case 1:
beg = 0;
- len = RARRAY_LEN(ary);
+ len = RARRAY(ary)->len;
break;
case 2:
- if (rb_range_beg_len(arg1, &beg, &len, RARRAY_LEN(ary), 1)) {
+ if (rb_range_beg_len(arg1, &beg, &len, RARRAY(ary)->len, 1)) {
break;
}
/* fall through */
case 3:
beg = NIL_P(arg1) ? 0 : NUM2LONG(arg1);
if (beg < 0) {
- beg = RARRAY_LEN(ary) + beg;
+ beg = RARRAY(ary)->len + beg;
if (beg < 0) beg = 0;
}
- len = NIL_P(arg2) ? RARRAY_LEN(ary) - beg : NUM2LONG(arg2);
+ len = NIL_P(arg2) ? RARRAY(ary)->len - beg : NUM2LONG(arg2);
break;
}
rb_ary_modify(ary);
- if (len < 0) {
- return ary;
- }
- if (beg >= ARY_MAX_SIZE || len > ARY_MAX_SIZE - beg) {
- rb_raise(rb_eArgError, "argument too big");
- }
end = beg + len;
- if (RARRAY_LEN(ary) < end) {
- if (end >= ARY_CAPA(ary)) {
- ary_resize_capa(ary, end);
+ if (end > RARRAY(ary)->len) {
+ if (end >= RARRAY(ary)->aux.capa) {
+ REALLOC_N(RARRAY(ary)->ptr, VALUE, end);
+ RARRAY(ary)->aux.capa = end;
+ }
+ if (beg > RARRAY(ary)->len) {
+ rb_mem_clear(RARRAY(ary)->ptr + RARRAY(ary)->len, end - RARRAY(ary)->len);
}
- ary_mem_clear(ary, RARRAY_LEN(ary), end - RARRAY_LEN(ary));
- ARY_SET_LEN(ary, end);
+ RARRAY(ary)->len = end;
}
- if (item == Qundef) {
+ if (block_p) {
VALUE v;
long i;
- for (i=beg; i<end; i++) {
+ for (i=beg; i<RARRAY(ary)->len; i++) {
v = rb_yield(LONG2NUM(i));
- if (i>=RARRAY_LEN(ary)) break;
- ARY_SET(ary, i, v);
+ if (i>=RARRAY(ary)->len) break;
+ RARRAY(ary)->ptr[i] = v;
}
}
else {
- ary_memfill(ary, beg, len, item);
+ p = RARRAY(ary)->ptr + beg;
+ pend = p + len;
+ while (p < pend) {
+ *p++ = item;
+ }
}
return ary;
}
-/*
+/*
* call-seq:
- * ary + other_ary -> new_ary
+ * array + other_array -> an_array
*
- * Concatenation --- Returns a new array built by concatenating the
+ * Concatenation---Returns a new array built by concatenating the
* two arrays together to produce a third array.
- *
+ *
* [ 1, 2, 3 ] + [ 4, 5 ] #=> [ 1, 2, 3, 4, 5 ]
- * a = [ "a", "b", "c" ]
- * c = a + [ "d", "e", "f" ]
- * c #=> [ "a", "b", "c", "d", "e", "f" ]
- * a #=> [ "a", "b", "c" ]
- *
- * Note that
- * x += y
- * is the same as
- * x = x + y
- * This means that it produces a new array. As a consequence,
- * repeated use of <code>+=</code> on arrays can be quite inefficient.
- *
- * See also Array#concat.
*/
VALUE
-rb_ary_plus(VALUE x, VALUE y)
+rb_ary_plus(x, y)
+ VALUE x, y;
{
VALUE z;
- long len, xlen, ylen;
+ long len;
y = to_ary(y);
- xlen = RARRAY_LEN(x);
- ylen = RARRAY_LEN(y);
- len = xlen + ylen;
+ len = RARRAY(x)->len + RARRAY(y)->len;
z = rb_ary_new2(len);
-
- ary_memcpy(z, 0, xlen, RARRAY_CONST_PTR_TRANSIENT(x));
- ary_memcpy(z, xlen, ylen, RARRAY_CONST_PTR_TRANSIENT(y));
- ARY_SET_LEN(z, len);
+ MEMCPY(RARRAY(z)->ptr, RARRAY(x)->ptr, VALUE, RARRAY(x)->len);
+ MEMCPY(RARRAY(z)->ptr + RARRAY(x)->len, RARRAY(y)->ptr, VALUE, RARRAY(y)->len);
+ RARRAY(z)->len = len;
return z;
}
-static VALUE
-ary_append(VALUE x, VALUE y)
-{
- long n = RARRAY_LEN(y);
- if (n > 0) {
- rb_ary_splice(x, RARRAY_LEN(x), 0, RARRAY_CONST_PTR_TRANSIENT(y), n);
- }
- return x;
-}
-
-/*
+/*
* call-seq:
- * ary.concat(other_ary1, other_ary2, ...) -> ary
- *
- * Appends the elements of <code>other_ary</code>s to +self+.
+ * array.concat(other_array) -> array
*
- * [ "a", "b" ].concat( ["c", "d"]) #=> [ "a", "b", "c", "d" ]
- * [ "a" ].concat( ["b"], ["c", "d"]) #=> [ "a", "b", "c", "d" ]
- * [ "a" ].concat #=> [ "a" ]
- *
- * a = [ 1, 2, 3 ]
- * a.concat( [ 4, 5 ])
- * a #=> [ 1, 2, 3, 4, 5 ]
- *
- * a = [ 1, 2 ]
- * a.concat(a, a) #=> [1, 2, 1, 2, 1, 2]
- *
- * See also Array#+.
+ * Appends the elements in other_array to _self_.
+ *
+ * [ "a", "b" ].concat( ["c", "d"] ) #=> [ "a", "b", "c", "d" ]
*/
-static VALUE
-rb_ary_concat_multi(int argc, VALUE *argv, VALUE ary)
-{
- rb_ary_modify_check(ary);
-
- if (argc == 1) {
- rb_ary_concat(ary, argv[0]);
- }
- else if (argc > 1) {
- int i;
- VALUE args = rb_ary_tmp_new(argc);
- for (i = 0; i < argc; i++) {
- rb_ary_concat(args, argv[i]);
- }
- ary_append(ary, args);
- }
-
- ary_verify(ary);
- return ary;
-}
VALUE
-rb_ary_concat(VALUE x, VALUE y)
+rb_ary_concat(x, y)
+ VALUE x, y;
{
- return ary_append(x, to_ary(y));
+ y = to_ary(y);
+ if (RARRAY(y)->len > 0) {
+ rb_ary_update(x, RARRAY(x)->len, 0, y);
+ }
+ return x;
}
-/*
+
+/*
* call-seq:
- * ary * int -> new_ary
- * ary * str -> new_string
- *
- * Repetition --- With a String argument, equivalent to
- * <code>ary.join(str)</code>.
+ * array * int -> an_array
+ * array * str -> a_string
*
- * Otherwise, returns a new array built by concatenating the +int+ copies of
- * +self+.
+ * Repetition---With a String argument, equivalent to
+ * self.join(str). Otherwise, returns a new array
+ * built by concatenating the _int_ copies of _self_.
*
*
* [ 1, 2, 3 ] * 3 #=> [ 1, 2, 3, 1, 2, 3, 1, 2, 3 ]
@@ -4089,11 +2306,11 @@ rb_ary_concat(VALUE x, VALUE y)
*/
static VALUE
-rb_ary_times(VALUE ary, VALUE times)
+rb_ary_times(ary, times)
+ VALUE ary, times;
{
VALUE ary2, tmp;
- const VALUE *ptr;
- long t, len;
+ long i, len;
tmp = rb_check_string_type(times);
if (!NIL_P(tmp)) {
@@ -4101,48 +2318,37 @@ rb_ary_times(VALUE ary, VALUE times)
}
len = NUM2LONG(times);
- if (len == 0) {
- ary2 = ary_new(rb_obj_class(ary), 0);
- goto out;
- }
+ if (len == 0) return rb_ary_new2(0);
if (len < 0) {
rb_raise(rb_eArgError, "negative argument");
}
- if (ARY_MAX_SIZE/len < RARRAY_LEN(ary)) {
+ if (LONG_MAX/len < RARRAY(ary)->len) {
rb_raise(rb_eArgError, "argument too big");
}
- len *= RARRAY_LEN(ary);
+ len *= RARRAY(ary)->len;
ary2 = ary_new(rb_obj_class(ary), len);
- ARY_SET_LEN(ary2, len);
-
- ptr = RARRAY_CONST_PTR_TRANSIENT(ary);
- t = RARRAY_LEN(ary);
- if (0 < t) {
- ary_memcpy(ary2, 0, t, ptr);
- while (t <= len/2) {
- ary_memcpy(ary2, t, t, RARRAY_CONST_PTR_TRANSIENT(ary2));
- t *= 2;
- }
- if (t < len) {
- ary_memcpy(ary2, t, len-t, RARRAY_CONST_PTR_TRANSIENT(ary2));
- }
- }
- out:
+ RARRAY(ary2)->len = len;
+
+ for (i=0; i<len; i+=RARRAY(ary)->len) {
+ MEMCPY(RARRAY(ary2)->ptr+i, RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
+ }
+ OBJ_INFECT(ary2, ary);
+
return ary2;
}
-/*
+/*
* call-seq:
- * ary.assoc(obj) -> element_ary or nil
- *
- * Searches through an array whose elements are also arrays comparing +obj+
- * with the first element of each contained array using <code>obj.==</code>.
+ * array.assoc(obj) -> an_array or nil
*
- * Returns the first contained array that matches (that is, the first
- * associated array), or +nil+ if no match is found.
- *
- * See also Array#rassoc
+ * Searches through an array whose elements are also arrays
+ * comparing _obj_ with the first element of each contained array
+ * using obj.==.
+ * Returns the first contained array that matches (that
+ * is, the first associated array),
+ * or +nil+ if no match is found.
+ * See also <code>Array#rassoc</code>.
*
* s1 = [ "colors", "red", "blue", "green" ]
* s2 = [ "letters", "a", "b", "c" ]
@@ -4153,95 +2359,64 @@ rb_ary_times(VALUE ary, VALUE times)
*/
VALUE
-rb_ary_assoc(VALUE ary, VALUE key)
+rb_ary_assoc(ary, key)
+ VALUE ary, key;
{
- long i;
- VALUE v;
+ VALUE *p, *pend;
- for (i = 0; i < RARRAY_LEN(ary); ++i) {
- v = rb_check_array_type(RARRAY_AREF(ary, i));
- if (!NIL_P(v) && RARRAY_LEN(v) > 0 &&
- rb_equal(RARRAY_AREF(v, 0), key))
- return v;
+ p = RARRAY(ary)->ptr;
+ pend = p + RARRAY(ary)->len;
+
+ while (p < pend) {
+ if (TYPE(*p) == T_ARRAY &&
+ RARRAY(*p)->len > 0 &&
+ rb_equal(RARRAY(*p)->ptr[0], key))
+ return *p;
+ p++;
}
return Qnil;
}
/*
* call-seq:
- * ary.rassoc(obj) -> element_ary or nil
- *
- * Searches through the array whose elements are also arrays.
- *
- * Compares +obj+ with the second element of each contained array using
- * <code>obj.==</code>.
- *
- * Returns the first contained array that matches +obj+.
- *
- * See also Array#assoc.
- *
+ * array.rassoc(key) -> an_array or nil
+ *
+ * Searches through the array whose elements are also arrays. Compares
+ * <em>key</em> with the second element of each contained array using
+ * <code>==</code>. Returns the first contained array that matches. See
+ * also <code>Array#assoc</code>.
+ *
* a = [ [ 1, "one"], [2, "two"], [3, "three"], ["ii", "two"] ]
* a.rassoc("two") #=> [2, "two"]
* a.rassoc("four") #=> nil
*/
VALUE
-rb_ary_rassoc(VALUE ary, VALUE value)
+rb_ary_rassoc(ary, value)
+ VALUE ary, value;
{
- long i;
- VALUE v;
+ VALUE *p, *pend;
- for (i = 0; i < RARRAY_LEN(ary); ++i) {
- v = RARRAY_AREF(ary, i);
- if (RB_TYPE_P(v, T_ARRAY) &&
- RARRAY_LEN(v) > 1 &&
- rb_equal(RARRAY_AREF(v, 1), value))
- return v;
- }
- return Qnil;
-}
+ p = RARRAY(ary)->ptr;
+ pend = p + RARRAY(ary)->len;
-static VALUE
-recursive_equal(VALUE ary1, VALUE ary2, int recur)
-{
- long i, len1;
- const VALUE *p1, *p2;
-
- if (recur) return Qtrue; /* Subtle! */
-
- /* rb_equal() can evacuate ptrs */
- p1 = RARRAY_CONST_PTR(ary1);
- p2 = RARRAY_CONST_PTR(ary2);
- len1 = RARRAY_LEN(ary1);
-
- for (i = 0; i < len1; i++) {
- if (*p1 != *p2) {
- if (rb_equal(*p1, *p2)) {
- len1 = RARRAY_LEN(ary1);
- if (len1 != RARRAY_LEN(ary2))
- return Qfalse;
- if (len1 < i)
- return Qtrue;
- p1 = RARRAY_CONST_PTR(ary1) + i;
- p2 = RARRAY_CONST_PTR(ary2) + i;
- }
- else {
- return Qfalse;
- }
- }
- p1++;
- p2++;
+ while (p < pend) {
+ if (TYPE(*p) == T_ARRAY
+ && RARRAY(*p)->len > 1
+ && rb_equal(RARRAY(*p)->ptr[1], value))
+ return *p;
+ p++;
}
- return Qtrue;
+ return Qnil;
}
-/*
+/*
* call-seq:
- * ary == other_ary -> bool
+ * array == other_array -> bool
*
- * Equality --- Two arrays are equal if they contain the same number of
- * elements and if each element is equal to (according to Object#==) the
- * corresponding element in +other_ary+.
+ * Equality---Two arrays are equal if they contain the same number
+ * of elements and if each element is equal to (according to
+ * Object.==) the corresponding element in the other array.
*
* [ "a", "c" ] == [ "a", "c", 7 ] #=> false
* [ "a", "c", 7 ] == [ "a", "c", 7 ] #=> true
@@ -4250,28 +2425,21 @@ recursive_equal(VALUE ary1, VALUE ary2, int recur)
*/
static VALUE
-rb_ary_equal(VALUE ary1, VALUE ary2)
+rb_ary_equal(ary1, ary2)
+ VALUE ary1, ary2;
{
+ long i;
+
if (ary1 == ary2) return Qtrue;
- if (!RB_TYPE_P(ary2, T_ARRAY)) {
- if (!rb_respond_to(ary2, idTo_ary)) {
+ if (TYPE(ary2) != T_ARRAY) {
+ if (!rb_respond_to(ary2, rb_intern("to_ary"))) {
return Qfalse;
}
return rb_equal(ary2, ary1);
}
- if (RARRAY_LEN(ary1) != RARRAY_LEN(ary2)) return Qfalse;
- if (RARRAY_CONST_PTR_TRANSIENT(ary1) == RARRAY_CONST_PTR_TRANSIENT(ary2)) return Qtrue;
- return rb_exec_recursive_paired(recursive_equal, ary1, ary2, ary2);
-}
-
-static VALUE
-recursive_eql(VALUE ary1, VALUE ary2, int recur)
-{
- long i;
-
- if (recur) return Qtrue; /* Subtle! */
- for (i=0; i<RARRAY_LEN(ary1); i++) {
- if (!rb_eql(rb_ary_elt(ary1, i), rb_ary_elt(ary2, i)))
+ if (RARRAY(ary1)->len != RARRAY(ary2)->len) return Qfalse;
+ for (i=0; i<RARRAY(ary1)->len; i++) {
+ if (!rb_equal(RARRAY(ary1)->ptr[i], RARRAY(ary2)->ptr[i]))
return Qfalse;
}
return Qtrue;
@@ -4279,814 +2447,350 @@ recursive_eql(VALUE ary1, VALUE ary2, int recur)
/*
* call-seq:
- * ary.eql?(other) -> true or false
+ * array.eql?(other) -> true or false
*
- * Returns +true+ if +self+ and +other+ are the same object,
- * or are both arrays with the same content (according to Object#eql?).
+ * Returns <code>true</code> if _array_ and _other_ are the same object,
+ * or are both arrays with the same content.
*/
static VALUE
-rb_ary_eql(VALUE ary1, VALUE ary2)
+rb_ary_eql(ary1, ary2)
+ VALUE ary1, ary2;
{
+ long i;
+
if (ary1 == ary2) return Qtrue;
- if (!RB_TYPE_P(ary2, T_ARRAY)) return Qfalse;
- if (RARRAY_LEN(ary1) != RARRAY_LEN(ary2)) return Qfalse;
- if (RARRAY_CONST_PTR_TRANSIENT(ary1) == RARRAY_CONST_PTR_TRANSIENT(ary2)) return Qtrue;
- return rb_exec_recursive_paired(recursive_eql, ary1, ary2, ary2);
+ if (TYPE(ary2) != T_ARRAY) return Qfalse;
+ if (RARRAY(ary1)->len != RARRAY(ary2)->len) return Qfalse;
+ for (i=0; i<RARRAY(ary1)->len; i++) {
+ if (!rb_eql(RARRAY(ary1)->ptr[i], RARRAY(ary2)->ptr[i]))
+ return Qfalse;
+ }
+ return Qtrue;
}
/*
* call-seq:
- * ary.hash -> integer
+ * array.hash -> fixnum
*
- * Compute a hash-code for this array.
- *
- * Two arrays with the same content will have the same hash code (and will
- * compare using #eql?).
- *
- * See also Object#hash.
+ * Compute a hash-code for this array. Two arrays with the same content
+ * will have the same hash code (and will compare using <code>eql?</code>).
*/
static VALUE
-rb_ary_hash(VALUE ary)
+rb_ary_hash(ary)
+ VALUE ary;
{
- long i;
- st_index_t h;
+ long i, h;
VALUE n;
- h = rb_hash_start(RARRAY_LEN(ary));
- h = rb_hash_uint(h, (st_index_t)rb_ary_hash);
- for (i=0; i<RARRAY_LEN(ary); i++) {
- n = rb_hash(RARRAY_AREF(ary, i));
- h = rb_hash_uint(h, NUM2LONG(n));
+ h = RARRAY(ary)->len;
+ for (i=0; i<RARRAY(ary)->len; i++) {
+ h = (h << 1) | (h<0 ? 1 : 0);
+ n = rb_hash(RARRAY(ary)->ptr[i]);
+ h ^= NUM2LONG(n);
}
- h = rb_hash_end(h);
- return ST2FIX(h);
+ return LONG2FIX(h);
}
/*
* call-seq:
- * ary.include?(object) -> true or false
- *
- * Returns +true+ if the given +object+ is present in +self+ (that is, if any
- * element <code>==</code> +object+), otherwise returns +false+.
- *
+ * array.include?(obj) -> true or false
+ *
+ * Returns <code>true</code> if the given object is present in
+ * <i>self</i> (that is, if any object <code>==</code> <i>anObject</i>),
+ * <code>false</code> otherwise.
+ *
* a = [ "a", "b", "c" ]
* a.include?("b") #=> true
* a.include?("z") #=> false
*/
VALUE
-rb_ary_includes(VALUE ary, VALUE item)
-{
- long i;
- VALUE e;
-
- for (i=0; i<RARRAY_LEN(ary); i++) {
- e = RARRAY_AREF(ary, i);
- if (rb_equal(e, item)) {
- return Qtrue;
- }
- }
- return Qfalse;
-}
-
-static VALUE
-rb_ary_includes_by_eql(VALUE ary, VALUE item)
+rb_ary_includes(ary, item)
+ VALUE ary;
+ VALUE item;
{
long i;
- VALUE e;
-
- for (i=0; i<RARRAY_LEN(ary); i++) {
- e = RARRAY_AREF(ary, i);
- if (rb_eql(item, e)) {
+
+ for (i=0; i<RARRAY(ary)->len; i++) {
+ if (rb_equal(RARRAY(ary)->ptr[i], item)) {
return Qtrue;
}
}
return Qfalse;
}
-static VALUE
-recursive_cmp(VALUE ary1, VALUE ary2, int recur)
-{
- long i, len;
-
- if (recur) return Qundef; /* Subtle! */
- len = RARRAY_LEN(ary1);
- if (len > RARRAY_LEN(ary2)) {
- len = RARRAY_LEN(ary2);
- }
- for (i=0; i<len; i++) {
- VALUE e1 = rb_ary_elt(ary1, i), e2 = rb_ary_elt(ary2, i);
- VALUE v = rb_funcallv(e1, id_cmp, 1, &e2);
- if (v != INT2FIX(0)) {
- return v;
- }
- }
- return Qundef;
-}
-/*
+/*
* call-seq:
- * ary <=> other_ary -> -1, 0, +1 or nil
- *
- * Comparison --- Returns an integer (+-1+, +0+, or <code>+1</code>) if this
- * array is less than, equal to, or greater than +other_ary+.
- *
- * Each object in each array is compared (using the <=> operator).
- *
- * Arrays are compared in an "element-wise" manner; the first element of +ary+
- * is compared with the first one of +other_ary+ using the <=> operator, then
- * each of the second elements, etc...
- * As soon as the result of any such comparison is non zero (i.e. the two
- * corresponding elements are not equal), that result is returned for the
- * whole array comparison.
- *
- * If all the elements are equal, then the result is based on a comparison of
- * the array lengths. Thus, two arrays are "equal" according to Array#<=> if,
- * and only if, they have the same length and the value of each element is
- * equal to the value of the corresponding element in the other array.
- *
- * +nil+ is returned if the +other_ary+ is not an array or if the comparison
- * of two elements returned +nil+.
+ * array <=> other_array -> -1, 0, +1
*
+ * Comparison---Returns an integer (-1, 0,
+ * or +1) if this array is less than, equal to, or greater than
+ * other_array. Each object in each array is compared
+ * (using <=>). If any value isn't
+ * equal, then that inequality is the return value. If all the
+ * values found are equal, then the return is based on a
+ * comparison of the array lengths. Thus, two arrays are
+ * ``equal'' according to <code>Array#<=></code> if and only if they have
+ * the same length and the value of each element is equal to the
+ * value of the corresponding element in the other array.
+ *
* [ "a", "a", "c" ] <=> [ "a", "b", "c" ] #=> -1
* [ 1, 2, 3, 4, 5, 6 ] <=> [ 1, 2 ] #=> +1
- * [ 1, 2 ] <=> [ 1, :two ] #=> nil
*
*/
VALUE
-rb_ary_cmp(VALUE ary1, VALUE ary2)
+rb_ary_cmp(ary1, ary2)
+ VALUE ary1, ary2;
{
- long len;
- VALUE v;
+ long i, len;
- ary2 = rb_check_array_type(ary2);
- if (NIL_P(ary2)) return Qnil;
- if (ary1 == ary2) return INT2FIX(0);
- v = rb_exec_recursive_paired(recursive_cmp, ary1, ary2, ary2);
- if (v != Qundef) return v;
- len = RARRAY_LEN(ary1) - RARRAY_LEN(ary2);
+ ary2 = to_ary(ary2);
+ len = RARRAY(ary1)->len;
+ if (len > RARRAY(ary2)->len) {
+ len = RARRAY(ary2)->len;
+ }
+ for (i=0; i<len; i++) {
+ VALUE v = rb_funcall(RARRAY(ary1)->ptr[i], id_cmp, 1, RARRAY(ary2)->ptr[i]);
+ if (v != INT2FIX(0)) {
+ return v;
+ }
+ }
+ len = RARRAY(ary1)->len - RARRAY(ary2)->len;
if (len == 0) return INT2FIX(0);
if (len > 0) return INT2FIX(1);
return INT2FIX(-1);
}
static VALUE
-ary_add_hash(VALUE hash, VALUE ary)
+ary_make_hash(ary1, ary2)
+ VALUE ary1, ary2;
{
+ VALUE hash = rb_hash_new();
long i;
- for (i=0; i<RARRAY_LEN(ary); i++) {
- VALUE elt = RARRAY_AREF(ary, i);
- rb_hash_add_new_element(hash, elt, elt);
+ for (i=0; i<RARRAY(ary1)->len; i++) {
+ rb_hash_aset(hash, RARRAY(ary1)->ptr[i], Qtrue);
}
- return hash;
-}
-
-static inline VALUE
-ary_tmp_hash_new(VALUE ary)
-{
- long size = RARRAY_LEN(ary);
- VALUE hash = rb_hash_new_with_size(size);
-
- RBASIC_CLEAR_CLASS(hash);
- return hash;
-}
-
-static VALUE
-ary_make_hash(VALUE ary)
-{
- VALUE hash = ary_tmp_hash_new(ary);
- return ary_add_hash(hash, ary);
-}
-
-static VALUE
-ary_add_hash_by(VALUE hash, VALUE ary)
-{
- long i;
-
- for (i = 0; i < RARRAY_LEN(ary); ++i) {
- VALUE v = rb_ary_elt(ary, i), k = rb_yield(v);
- rb_hash_add_new_element(hash, k, v);
+ if (ary2) {
+ for (i=0; i<RARRAY(ary2)->len; i++) {
+ rb_hash_aset(hash, RARRAY(ary2)->ptr[i], Qtrue);
+ }
}
return hash;
}
-static VALUE
-ary_make_hash_by(VALUE ary)
-{
- VALUE hash = ary_tmp_hash_new(ary);
- return ary_add_hash_by(hash, ary);
-}
-
-static inline void
-ary_recycle_hash(VALUE hash)
-{
- assert(RBASIC_CLASS(hash) == 0);
- if (RHASH_ST_TABLE_P(hash)) {
- st_table *tbl = RHASH_ST_TABLE(hash);
- st_free_table(tbl);
- RHASH_ST_CLEAR(hash);
- }
-}
-
-/*
+/*
* call-seq:
- * ary - other_ary -> new_ary
- *
- * Array Difference
- *
- * Returns a new array that is a copy of the original array, removing all
- * occurrences of any item that also appear in +other_ary+. The order is
- * preserved from the original array.
+ * array - other_array -> an_array
*
- * It compares elements using their #hash and #eql? methods for efficiency.
+ * Array Difference---Returns a new array that is a copy of
+ * the original array, removing any items that also appear in
+ * other_array. (If you need set-like behavior, see the
+ * library class Set.)
*
* [ 1, 1, 2, 2, 3, 3, 4, 5 ] - [ 1, 2, 4 ] #=> [ 3, 3, 5 ]
- *
- * Note that while 1 and 2 were only present once in the array argument, and
- * were present twice in the receiver array, all occurrences of each Integer are
- * removed in the returned array.
- *
- * If you need set-like behavior, see the library class Set.
- *
- * See also Array#difference.
*/
static VALUE
-rb_ary_diff(VALUE ary1, VALUE ary2)
+rb_ary_diff(ary1, ary2)
+ VALUE ary1, ary2;
{
- VALUE ary3;
- VALUE hash;
+ VALUE ary3, hash;
long i;
- ary2 = to_ary(ary2);
+ hash = ary_make_hash(to_ary(ary2), 0);
ary3 = rb_ary_new();
- if (RARRAY_LEN(ary1) <= SMALL_ARRAY_LEN || RARRAY_LEN(ary2) <= SMALL_ARRAY_LEN) {
- for (i=0; i<RARRAY_LEN(ary1); i++) {
- VALUE elt = rb_ary_elt(ary1, i);
- if (rb_ary_includes_by_eql(ary2, elt)) continue;
- rb_ary_push(ary3, elt);
- }
- return ary3;
+ for (i=0; i<RARRAY(ary1)->len; i++) {
+ if (st_lookup(RHASH(hash)->tbl, RARRAY(ary1)->ptr[i], 0)) continue;
+ rb_ary_push(ary3, RARRAY(ary1)->ptr[i]);
}
-
- hash = ary_make_hash(ary2);
- for (i=0; i<RARRAY_LEN(ary1); i++) {
- if (rb_hash_stlike_lookup(hash, RARRAY_AREF(ary1, i), NULL)) continue;
- rb_ary_push(ary3, rb_ary_elt(ary1, i));
- }
- ary_recycle_hash(hash);
return ary3;
}
-/*
- * call-seq:
- * ary.difference(other_ary1, other_ary2, ...) -> new_ary
- *
- * Array Difference
- *
- * Returns a new array that is a copy of the original array, removing all
- * occurrences of any item that also appear in +other_ary+. The order is
- * preserved from the original array.
- *
- * It compares elements using their #hash and #eql? methods for efficiency.
- *
- * [ 1, 1, 2, 2, 3, 3, 4, 5 ].difference([ 1, 2, 4 ]) #=> [ 3, 3, 5 ]
- *
- * Note that while 1 and 2 were only present once in the array argument, and
- * were present twice in the receiver array, all occurrences of each Integer are
- * removed in the returned array.
- *
- * Multiple array arguments can be supplied and all occurrences of any element
- * in those supplied arrays that match the receiver will be removed from the
- * returned array.
- *
- * [ 1, 'c', :s, 'yep' ].difference([ 1 ], [ 'a', 'c' ]) #=> [ :s, "yep" ]
- *
- * If you need set-like behavior, see the library class Set.
- *
- * See also Array#-.
- */
-
-static VALUE
-rb_ary_difference_multi(int argc, VALUE *argv, VALUE ary)
-{
- VALUE ary_diff;
- long i, length;
- volatile VALUE t0;
- bool *is_hash = ALLOCV_N(bool, t0, argc);
- ary_diff = rb_ary_new();
- length = RARRAY_LEN(ary);
-
- for (i = 0; i < argc; i++) {
- argv[i] = to_ary(argv[i]);
- is_hash[i] = (length > SMALL_ARRAY_LEN && RARRAY_LEN(argv[i]) > SMALL_ARRAY_LEN);
- if (is_hash[i]) argv[i] = ary_make_hash(argv[i]);
- }
-
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- int j;
- VALUE elt = rb_ary_elt(ary, i);
- for (j = 0; j < argc; j++) {
- if (is_hash[j]) {
- if (rb_hash_stlike_lookup(argv[j], RARRAY_AREF(ary, i), NULL))
- break;
- }
- else {
- if (rb_ary_includes_by_eql(argv[j], elt)) break;
- }
- }
- if (j == argc) rb_ary_push(ary_diff, elt);
- }
-
- ALLOCV_END(t0);
-
- return ary_diff;
-}
-
-
-/*
+/*
* call-seq:
- * ary & other_ary -> new_ary
+ * array & other_array
*
- * Set Intersection --- Returns a new array containing unique elements common to the
- * two arrays. The order is preserved from the original array.
+ * Set Intersection---Returns a new array
+ * containing elements common to the two arrays, with no duplicates.
*
- * It compares elements using their #hash and #eql? methods for efficiency.
- *
- * [ 1, 1, 3, 5 ] & [ 3, 2, 1 ] #=> [ 1, 3 ]
- * [ 'a', 'b', 'b', 'z' ] & [ 'a', 'b', 'c' ] #=> [ 'a', 'b' ]
- *
- * See also Array#uniq.
+ * [ 1, 1, 3, 5 ] & [ 1, 2, 3 ] #=> [ 1, 3 ]
*/
static VALUE
-rb_ary_and(VALUE ary1, VALUE ary2)
+rb_ary_and(ary1, ary2)
+ VALUE ary1, ary2;
{
- VALUE hash, ary3, v;
- st_data_t vv;
+ VALUE hash, ary3;
long i;
ary2 = to_ary(ary2);
- ary3 = rb_ary_new();
- if (RARRAY_LEN(ary1) == 0 || RARRAY_LEN(ary2) == 0) return ary3;
-
- if (RARRAY_LEN(ary1) <= SMALL_ARRAY_LEN && RARRAY_LEN(ary2) <= SMALL_ARRAY_LEN) {
- for (i=0; i<RARRAY_LEN(ary1); i++) {
- v = RARRAY_AREF(ary1, i);
- if (!rb_ary_includes_by_eql(ary2, v)) continue;
- if (rb_ary_includes_by_eql(ary3, v)) continue;
- rb_ary_push(ary3, v);
- }
- return ary3;
- }
-
- hash = ary_make_hash(ary2);
+ ary3 = rb_ary_new2(RARRAY(ary1)->len < RARRAY(ary2)->len ?
+ RARRAY(ary1)->len : RARRAY(ary2)->len);
+ hash = ary_make_hash(ary2, 0);
- for (i=0; i<RARRAY_LEN(ary1); i++) {
- v = RARRAY_AREF(ary1, i);
- vv = (st_data_t)v;
- if (rb_hash_stlike_delete(hash, &vv, 0)) {
- rb_ary_push(ary3, v);
+ for (i=0; i<RARRAY(ary1)->len; i++) {
+ VALUE v = RARRAY(ary1)->ptr[i];
+ if (st_delete(RHASH(hash)->tbl, (st_data_t*)&v, 0)) {
+ rb_ary_push(ary3, RARRAY(ary1)->ptr[i]);
}
}
- ary_recycle_hash(hash);
return ary3;
}
-/*
- * call-seq:
- * ary.intersection(other_ary1, other_ary2, ...) -> new_ary
- *
- * Set Intersection --- Returns a new array containing unique elements common
- * to +self+ and <code>other_ary</code>s. Order is preserved from the original
- * array.
- *
- * It compares elements using their #hash and #eql? methods for efficiency.
- *
- * [ 1, 1, 3, 5 ].intersection([ 3, 2, 1 ]) # => [ 1, 3 ]
- * [ "a", "b", "z" ].intersection([ "a", "b", "c" ], [ "b" ]) # => [ "b" ]
- * [ "a" ].intersection #=> [ "a" ]
- *
- * See also Array#&.
- */
-
-static VALUE
-rb_ary_intersection_multi(int argc, VALUE *argv, VALUE ary)
-{
- VALUE result = rb_ary_dup(ary);
- int i;
-
- for (i = 0; i < argc; i++) {
- result = rb_ary_and(result, argv[i]);
- }
-
- return result;
-}
-
-static int
-ary_hash_orset(st_data_t *key, st_data_t *value, st_data_t arg, int existing)
-{
- if (existing) return ST_STOP;
- *key = *value = (VALUE)arg;
- return ST_CONTINUE;
-}
-
-static void
-rb_ary_union(VALUE ary_union, VALUE ary)
-{
- long i;
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- VALUE elt = rb_ary_elt(ary, i);
- if (rb_ary_includes_by_eql(ary_union, elt)) continue;
- rb_ary_push(ary_union, elt);
- }
-}
-
-static void
-rb_ary_union_hash(VALUE hash, VALUE ary2)
-{
- long i;
- for (i = 0; i < RARRAY_LEN(ary2); i++) {
- VALUE elt = RARRAY_AREF(ary2, i);
- if (!rb_hash_stlike_update(hash, (st_data_t)elt, ary_hash_orset, (st_data_t)elt)) {
- RB_OBJ_WRITTEN(hash, Qundef, elt);
- }
- }
-}
-
-/*
+/*
* call-seq:
- * ary | other_ary -> new_ary
- *
- * Set Union --- Returns a new array by joining +ary+ with +other_ary+,
- * excluding any duplicates and preserving the order from the given arrays.
- *
- * It compares elements using their #hash and #eql? methods for efficiency.
+ * array | other_array -> an_array
*
- * [ "a", "b", "c" ] | [ "c", "d", "a" ] #=> [ "a", "b", "c", "d" ]
- * [ "c", "d", "a" ] | [ "a", "b", "c" ] #=> [ "c", "d", "a", "b" ]
+ * Set Union---Returns a new array by joining this array with
+ * other_array, removing duplicates.
*
- * See also Array#union.
+ * [ "a", "b", "c" ] | [ "c", "d", "a" ]
+ * #=> [ "a", "b", "c", "d" ]
*/
static VALUE
-rb_ary_or(VALUE ary1, VALUE ary2)
+rb_ary_or(ary1, ary2)
+ VALUE ary1, ary2;
{
VALUE hash, ary3;
-
- ary2 = to_ary(ary2);
- if (RARRAY_LEN(ary1) + RARRAY_LEN(ary2) <= SMALL_ARRAY_LEN) {
- ary3 = rb_ary_new();
- rb_ary_union(ary3, ary1);
- rb_ary_union(ary3, ary2);
- return ary3;
- }
-
- hash = ary_make_hash(ary1);
- rb_ary_union_hash(hash, ary2);
-
- ary3 = rb_hash_values(hash);
- ary_recycle_hash(hash);
- return ary3;
-}
-
-/*
- * call-seq:
- * ary.union(other_ary1, other_ary2, ...) -> new_ary
- *
- * Set Union --- Returns a new array by joining <code>other_ary</code>s with +self+,
- * excluding any duplicates and preserving the order from the given arrays.
- *
- * It compares elements using their #hash and #eql? methods for efficiency.
- *
- * [ "a", "b", "c" ].union( [ "c", "d", "a" ] ) #=> [ "a", "b", "c", "d" ]
- * [ "a" ].union( ["e", "b"], ["a", "c", "b"] ) #=> [ "a", "e", "b", "c" ]
- * [ "a" ].union #=> [ "a" ]
- *
- * See also Array#|.
- */
-
-static VALUE
-rb_ary_union_multi(int argc, VALUE *argv, VALUE ary)
-{
- int i;
- long sum;
- VALUE hash, ary_union;
-
- sum = RARRAY_LEN(ary);
- for (i = 0; i < argc; i++) {
- argv[i] = to_ary(argv[i]);
- sum += RARRAY_LEN(argv[i]);
- }
-
- if (sum <= SMALL_ARRAY_LEN) {
- ary_union = rb_ary_new();
-
- rb_ary_union(ary_union, ary);
- for (i = 0; i < argc; i++) rb_ary_union(ary_union, argv[i]);
-
- return ary_union;
- }
-
- hash = ary_make_hash(ary);
- for (i = 0; i < argc; i++) rb_ary_union_hash(hash, argv[i]);
-
- ary_union = rb_hash_values(hash);
- ary_recycle_hash(hash);
- return ary_union;
-}
-
-/*
- * call-seq:
- * ary.max -> obj
- * ary.max {|a, b| block} -> obj
- * ary.max(n) -> array
- * ary.max(n) {|a, b| block} -> array
- *
- * Returns the object in _ary_ with the maximum value. The
- * first form assumes all objects implement Comparable;
- * the second uses the block to return <em>a <=> b</em>.
- *
- * ary = %w(albatross dog horse)
- * ary.max #=> "horse"
- * ary.max {|a, b| a.length <=> b.length} #=> "albatross"
- *
- * If the +n+ argument is given, maximum +n+ elements are returned
- * as an array.
- *
- * ary = %w[albatross dog horse]
- * ary.max(2) #=> ["horse", "dog"]
- * ary.max(2) {|a, b| a.length <=> b.length } #=> ["albatross", "horse"]
- */
-static VALUE
-rb_ary_max(int argc, VALUE *argv, VALUE ary)
-{
- struct cmp_opt_data cmp_opt = { 0, 0 };
- VALUE result = Qundef, v;
- VALUE num;
- long i;
-
- if (rb_check_arity(argc, 0, 1) && !NIL_P(num = argv[0]))
- return rb_nmin_run(ary, num, 0, 1, 1);
-
- if (rb_block_given_p()) {
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- v = RARRAY_AREF(ary, i);
- if (result == Qundef || rb_cmpint(rb_yield_values(2, v, result), v, result) > 0) {
- result = v;
- }
- }
- }
- else {
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- v = RARRAY_AREF(ary, i);
- if (result == Qundef || OPTIMIZED_CMP(v, result, cmp_opt) > 0) {
- result = v;
- }
- }
- }
- if (result == Qundef) return Qnil;
- return result;
-}
-
-/*
- * call-seq:
- * ary.min -> obj
- * ary.min {| a,b | block } -> obj
- * ary.min(n) -> array
- * ary.min(n) {| a,b | block } -> array
- *
- * Returns the object in _ary_ with the minimum value. The
- * first form assumes all objects implement Comparable;
- * the second uses the block to return <em>a <=> b</em>.
- *
- * ary = %w(albatross dog horse)
- * ary.min #=> "albatross"
- * ary.min {|a, b| a.length <=> b.length} #=> "dog"
- *
- * If the +n+ argument is given, minimum +n+ elements are returned
- * as an array.
- *
- * ary = %w[albatross dog horse]
- * ary.min(2) #=> ["albatross", "dog"]
- * ary.min(2) {|a, b| a.length <=> b.length } #=> ["dog", "horse"]
- */
-static VALUE
-rb_ary_min(int argc, VALUE *argv, VALUE ary)
-{
- struct cmp_opt_data cmp_opt = { 0, 0 };
- VALUE result = Qundef, v;
- VALUE num;
+ VALUE v;
long i;
- if (rb_check_arity(argc, 0, 1) && !NIL_P(num = argv[0]))
- return rb_nmin_run(ary, num, 0, 0, 1);
+ ary2 = to_ary(ary2);
+ ary3 = rb_ary_new2(RARRAY(ary1)->len+RARRAY(ary2)->len);
+ hash = ary_make_hash(ary1, ary2);
- if (rb_block_given_p()) {
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- v = RARRAY_AREF(ary, i);
- if (result == Qundef || rb_cmpint(rb_yield_values(2, v, result), v, result) < 0) {
- result = v;
- }
+ for (i=0; i<RARRAY(ary1)->len; i++) {
+ v = RARRAY(ary1)->ptr[i];
+ if (st_delete(RHASH(hash)->tbl, (st_data_t*)&v, 0)) {
+ rb_ary_push(ary3, RARRAY(ary1)->ptr[i]);
}
}
- else {
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- v = RARRAY_AREF(ary, i);
- if (result == Qundef || OPTIMIZED_CMP(v, result, cmp_opt) < 0) {
- result = v;
- }
+ for (i=0; i<RARRAY(ary2)->len; i++) {
+ v = RARRAY(ary2)->ptr[i];
+ if (st_delete(RHASH(hash)->tbl, (st_data_t*)&v, 0)) {
+ rb_ary_push(ary3, RARRAY(ary2)->ptr[i]);
}
}
- if (result == Qundef) return Qnil;
- return result;
-}
-
-/*
- * call-seq:
- * ary.minmax -> [obj, obj]
- * ary.minmax {| a,b | block } -> [obj, obj]
- *
- * Returns a two element array which contains the minimum and the
- * maximum value in the array.
- *
- * Can be given an optional block to override the default comparison
- * method <code>a <=> b</code>.
- */
-static VALUE
-rb_ary_minmax(VALUE ary)
-{
- if (rb_block_given_p()) {
- return rb_call_super(0, NULL);
- }
- return rb_assoc_new(rb_ary_min(0, 0, ary), rb_ary_max(0, 0, ary));
-}
-
-static int
-push_value(st_data_t key, st_data_t val, st_data_t ary)
-{
- rb_ary_push((VALUE)ary, (VALUE)val);
- return ST_CONTINUE;
+ return ary3;
}
/*
* call-seq:
- * ary.uniq! -> ary or nil
- * ary.uniq! {|item| ...} -> ary or nil
- *
- * Removes duplicate elements from +self+.
- *
- * If a block is given, it will use the return value of the block for
- * comparison.
- *
- * It compares values using their #hash and #eql? methods for efficiency.
- *
- * +self+ is traversed in order, and the first occurrence is kept.
- *
- * Returns +nil+ if no changes are made (that is, no duplicates are found).
- *
+ * array.uniq! -> array or nil
+ *
+ * Removes duplicate elements from _self_.
+ * Returns <code>nil</code> if no changes are made (that is, no
+ * duplicates are found).
+ *
* a = [ "a", "a", "b", "b", "c" ]
- * a.uniq! # => ["a", "b", "c"]
- *
+ * a.uniq! #=> ["a", "b", "c"]
* b = [ "a", "b", "c" ]
- * b.uniq! # => nil
- *
- * c = [["student","sam"], ["student","george"], ["teacher","matz"]]
- * c.uniq! {|s| s.first} # => [["student", "sam"], ["teacher", "matz"]]
- *
+ * b.uniq! #=> nil
*/
static VALUE
-rb_ary_uniq_bang(VALUE ary)
+rb_ary_uniq_bang(ary)
+ VALUE ary;
{
VALUE hash;
- long hash_size;
+ VALUE *p, *q, *end;
- rb_ary_modify_check(ary);
- if (RARRAY_LEN(ary) <= 1)
- return Qnil;
- if (rb_block_given_p())
- hash = ary_make_hash_by(ary);
- else
- hash = ary_make_hash(ary);
-
- hash_size = RHASH_SIZE(hash);
- if (RARRAY_LEN(ary) == hash_size) {
+ rb_ary_modify(ary);
+
+ hash = ary_make_hash(ary, 0);
+
+ if (RARRAY(ary)->len == RHASH(hash)->tbl->num_entries) {
return Qnil;
}
- rb_ary_modify_check(ary);
- ARY_SET_LEN(ary, 0);
- if (ARY_SHARED_P(ary) && !ARY_EMBED_P(ary)) {
- rb_ary_unshare(ary);
- FL_SET_EMBED(ary);
+ p = q = RARRAY(ary)->ptr;
+ end = p + RARRAY(ary)->len;
+ while (p < end) {
+ VALUE v = *p;
+ if (st_delete(RHASH(hash)->tbl, (st_data_t*)&v, 0)) {
+ *q++ = *p;
+ }
+ p++;
}
- ary_resize_capa(ary, hash_size);
- rb_hash_foreach(hash, push_value, ary);
- ary_recycle_hash(hash);
+ RARRAY(ary)->len = (q - RARRAY(ary)->ptr);
return ary;
}
/*
* call-seq:
- * ary.uniq -> new_ary
- * ary.uniq {|item| ...} -> new_ary
- *
- * Returns a new array by removing duplicate values in +self+.
- *
- * If a block is given, it will use the return value of the block for comparison.
- *
- * It compares values using their #hash and #eql? methods for efficiency.
- *
- * +self+ is traversed in order, and the first occurrence is kept.
- *
+ * array.uniq -> an_array
+ *
+ * Returns a new array by removing duplicate values in <i>self</i>.
+ *
* a = [ "a", "a", "b", "b", "c" ]
- * a.uniq # => ["a", "b", "c"]
- *
- * b = [["student","sam"], ["student","george"], ["teacher","matz"]]
- * b.uniq {|s| s.first} # => [["student", "sam"], ["teacher", "matz"]]
- *
+ * a.uniq #=> ["a", "b", "c"]
*/
static VALUE
-rb_ary_uniq(VALUE ary)
+rb_ary_uniq(ary)
+ VALUE ary;
{
- VALUE hash, uniq;
-
- if (RARRAY_LEN(ary) <= 1) {
- hash = 0;
- uniq = rb_ary_dup(ary);
- }
- else if (rb_block_given_p()) {
- hash = ary_make_hash_by(ary);
- uniq = rb_hash_values(hash);
- }
- else {
- hash = ary_make_hash(ary);
- uniq = rb_hash_values(hash);
- }
- RBASIC_SET_CLASS(uniq, rb_obj_class(ary));
- if (hash) {
- ary_recycle_hash(hash);
- }
-
- return uniq;
+ ary = rb_ary_dup(ary);
+ rb_ary_uniq_bang(ary);
+ return ary;
}
-/*
+/*
* call-seq:
- * ary.compact! -> ary or nil
- *
- * Removes +nil+ elements from the array.
+ * array.compact! -> array or nil
*
- * Returns +nil+ if no changes were made, otherwise returns the array.
+ * Removes +nil+ elements from array.
+ * Returns +nil+ if no changes were made.
*
* [ "a", nil, "b", nil, "c" ].compact! #=> [ "a", "b", "c" ]
* [ "a", "b", "c" ].compact! #=> nil
*/
static VALUE
-rb_ary_compact_bang(VALUE ary)
+rb_ary_compact_bang(ary)
+ VALUE ary;
{
VALUE *p, *t, *end;
- long n;
rb_ary_modify(ary);
- p = t = (VALUE *)RARRAY_CONST_PTR_TRANSIENT(ary); /* WB: no new reference */
- end = p + RARRAY_LEN(ary);
-
+ p = t = RARRAY(ary)->ptr;
+ end = p + RARRAY(ary)->len;
+
while (t < end) {
if (NIL_P(*t)) t++;
else *p++ = *t++;
}
- n = p - RARRAY_CONST_PTR_TRANSIENT(ary);
- if (RARRAY_LEN(ary) == n) {
+ if (RARRAY(ary)->len == (p - RARRAY(ary)->ptr)) {
return Qnil;
}
- ary_resize_smaller(ary, n);
+ RARRAY(ary)->len = RARRAY(ary)->aux.capa = (p - RARRAY(ary)->ptr);
+ REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
return ary;
}
/*
* call-seq:
- * ary.compact -> new_ary
+ * array.compact -> an_array
*
- * Returns a copy of +self+ with all +nil+ elements removed.
+ * Returns a copy of _self_ with all +nil+ elements removed.
*
* [ "a", nil, "b", nil, "c", nil ].compact
* #=> [ "a", "b", "c" ]
*/
static VALUE
-rb_ary_compact(VALUE ary)
+rb_ary_compact(ary)
+ VALUE ary;
{
ary = rb_ary_dup(ary);
rb_ary_compact_bang(ary);
@@ -5095,1854 +2799,145 @@ rb_ary_compact(VALUE ary)
/*
* call-seq:
- * ary.count -> int
- * ary.count(obj) -> int
- * ary.count {|item| block} -> int
- *
- * Returns the number of elements.
- *
- * If an argument is given, counts the number of elements which equal +obj+
- * using <code>==</code>.
- *
- * If a block is given, counts the number of elements for which the block
- * returns a true value.
- *
- * ary = [1, 2, 4, 2]
- * ary.count #=> 4
- * ary.count(2) #=> 2
- * ary.count {|x| x%2 == 0} #=> 3
- *
+ * array.nitems -> int
+ *
+ * Returns the number of non-<code>nil</code> elements in _self_.
+ * May be zero.
+ *
+ * [ 1, nil, 3, nil, 5 ].nitems #=> 3
*/
static VALUE
-rb_ary_count(int argc, VALUE *argv, VALUE ary)
+rb_ary_nitems(ary)
+ VALUE ary;
{
- long i, n = 0;
-
- if (rb_check_arity(argc, 0, 1) == 0) {
- VALUE v;
+ long n = 0;
+ VALUE *p, *pend;
- if (!rb_block_given_p())
- return LONG2NUM(RARRAY_LEN(ary));
-
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- v = RARRAY_AREF(ary, i);
- if (RTEST(rb_yield(v))) n++;
- }
- }
- else {
- VALUE obj = argv[0];
+ p = RARRAY(ary)->ptr;
+ pend = p + RARRAY(ary)->len;
- if (rb_block_given_p()) {
- rb_warn("given block not used");
- }
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- if (rb_equal(RARRAY_AREF(ary, i), obj)) n++;
- }
+ while (p < pend) {
+ if (!NIL_P(*p)) n++;
+ p++;
}
-
return LONG2NUM(n);
}
-static VALUE
-flatten(VALUE ary, int level)
+static long
+flatten(ary, idx, ary2, memo)
+ VALUE ary;
+ long idx;
+ VALUE ary2, memo;
{
- long i;
- VALUE stack, result, tmp, elt, vmemo;
- st_table *memo = 0;
- st_data_t id;
-
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- elt = RARRAY_AREF(ary, i);
- tmp = rb_check_array_type(elt);
- if (!NIL_P(tmp)) {
- break;
- }
- }
- if (i == RARRAY_LEN(ary)) {
- return ary;
- }
-
- result = ary_new(0, RARRAY_LEN(ary));
- ary_memcpy(result, 0, i, RARRAY_CONST_PTR_TRANSIENT(ary));
- ARY_SET_LEN(result, i);
-
- stack = ary_new(0, ARY_DEFAULT_SIZE);
- rb_ary_push(stack, ary);
- rb_ary_push(stack, LONG2NUM(i + 1));
-
- if (level < 0) {
- vmemo = rb_hash_new();
- RBASIC_CLEAR_CLASS(vmemo);
- memo = st_init_numtable();
- rb_hash_st_table_set(vmemo, memo);
- st_insert(memo, (st_data_t)ary, (st_data_t)Qtrue);
- st_insert(memo, (st_data_t)tmp, (st_data_t)Qtrue);
- }
-
- ary = tmp;
- i = 0;
-
- while (1) {
- while (i < RARRAY_LEN(ary)) {
- elt = RARRAY_AREF(ary, i++);
- if (level >= 0 && RARRAY_LEN(stack) / 2 >= level) {
- rb_ary_push(result, elt);
- continue;
- }
- tmp = rb_check_array_type(elt);
- if (RBASIC(result)->klass) {
- if (memo) {
- RB_GC_GUARD(vmemo);
- st_clear(memo);
- }
- rb_raise(rb_eRuntimeError, "flatten reentered");
- }
- if (NIL_P(tmp)) {
- rb_ary_push(result, elt);
- }
- else {
- if (memo) {
- id = (st_data_t)tmp;
- if (st_is_member(memo, id)) {
- st_clear(memo);
- rb_raise(rb_eArgError, "tried to flatten recursive array");
- }
- st_insert(memo, id, (st_data_t)Qtrue);
- }
- rb_ary_push(stack, ary);
- rb_ary_push(stack, LONG2NUM(i));
- ary = tmp;
- i = 0;
- }
- }
- if (RARRAY_LEN(stack) == 0) {
- break;
- }
- if (memo) {
- id = (st_data_t)ary;
- st_delete(memo, &id, 0);
- }
- tmp = rb_ary_pop(stack);
- i = NUM2LONG(tmp);
- ary = rb_ary_pop(stack);
- }
+ VALUE id;
+ long i = idx;
+ long n, lim = idx + RARRAY(ary2)->len;
- if (memo) {
- st_clear(memo);
+ id = rb_obj_id(ary2);
+ if (rb_ary_includes(memo, id)) {
+ rb_raise(rb_eArgError, "tried to flatten recursive array");
+ }
+ rb_ary_push(memo, id);
+ rb_ary_update(ary, idx, 1, ary2);
+ while (i < lim) {
+ if (TYPE(RARRAY(ary)->ptr[i]) == T_ARRAY) {
+ n = flatten(ary, i, RARRAY(ary)->ptr[i], memo);
+ i += n; lim += n;
+ }
+ i++;
}
+ rb_ary_pop(memo);
- RBASIC_SET_CLASS(result, rb_obj_class(ary));
- return result;
+ return lim - idx - 1; /* returns number of increased items */
}
/*
* call-seq:
- * ary.flatten! -> ary or nil
- * ary.flatten!(level) -> ary or nil
- *
- * Flattens +self+ in place.
- *
- * Returns +nil+ if no modifications were made (i.e., the array contains no
- * subarrays.)
- *
- * The optional +level+ argument determines the level of recursion to flatten.
- *
+ * array.flatten! -> array or nil
+ *
+ * Flattens _self_ in place.
+ * Returns <code>nil</code> if no modifications were made (i.e.,
+ * <i>array</i> contains no subarrays.)
+ *
* a = [ 1, 2, [3, [4, 5] ] ]
* a.flatten! #=> [1, 2, 3, 4, 5]
* a.flatten! #=> nil
* a #=> [1, 2, 3, 4, 5]
- * a = [ 1, 2, [3, [4, 5] ] ]
- * a.flatten!(1) #=> [1, 2, 3, [4, 5]]
*/
static VALUE
-rb_ary_flatten_bang(int argc, VALUE *argv, VALUE ary)
+rb_ary_flatten_bang(ary)
+ VALUE ary;
{
- int mod = 0, level = -1;
- VALUE result, lv;
+ long i = 0;
+ int mod = 0;
+ VALUE memo = Qnil;
- lv = (rb_check_arity(argc, 0, 1) ? argv[0] : Qnil);
- rb_ary_modify_check(ary);
- if (!NIL_P(lv)) level = NUM2INT(lv);
- if (level == 0) return Qnil;
+ rb_ary_modify(ary);
+ while (i<RARRAY(ary)->len) {
+ VALUE ary2 = RARRAY(ary)->ptr[i];
- result = flatten(ary, level);
- if (result == ary) {
- return Qnil;
+ if (TYPE(ary2) == T_ARRAY) {
+ if (NIL_P(memo)) {
+ memo = rb_ary_new();
+ }
+ i += flatten(ary, i, ary2, memo);
+ mod = 1;
+ }
+ i++;
}
- if (!(mod = ARY_EMBED_P(result))) rb_obj_freeze(result);
- rb_ary_replace(ary, result);
- if (mod) ARY_SET_EMBED_LEN(result, 0);
-
+ if (mod == 0) return Qnil;
return ary;
}
/*
* call-seq:
- * ary.flatten -> new_ary
- * ary.flatten(level) -> new_ary
- *
- * Returns a new array that is a one-dimensional flattening of +self+
- * (recursively).
- *
- * That is, for every element that is an array, extract its elements into
- * the new array.
- *
- * The optional +level+ argument determines the level of recursion to
- * flatten.
- *
+ * array.flatten -> an_array
+ *
+ * Returns a new array that is a one-dimensional flattening of this
+ * array (recursively). That is, for every element that is an array,
+ * extract its elements into the new array.
+ *
* s = [ 1, 2, 3 ] #=> [1, 2, 3]
* t = [ 4, 5, 6, [7, 8] ] #=> [4, 5, 6, [7, 8]]
* a = [ s, t, 9, 10 ] #=> [[1, 2, 3], [4, 5, 6, [7, 8]], 9, 10]
- * a.flatten #=> [1, 2, 3, 4, 5, 6, 7, 8, 9, 10]
- * a = [ 1, 2, [3, [4, 5] ] ]
- * a.flatten(1) #=> [1, 2, 3, [4, 5]]
- */
-
-static VALUE
-rb_ary_flatten(int argc, VALUE *argv, VALUE ary)
-{
- int level = -1;
- VALUE result;
-
- if (rb_check_arity(argc, 0, 1) && !NIL_P(argv[0])) {
- level = NUM2INT(argv[0]);
- if (level == 0) return ary_make_shared_copy(ary);
- }
-
- result = flatten(ary, level);
- if (result == ary) {
- result = ary_make_shared_copy(ary);
- }
-
- return result;
-}
-
-#define OPTHASH_GIVEN_P(opts) \
- (argc > 0 && !NIL_P((opts) = rb_check_hash_type(argv[argc-1])) && (--argc, 1))
-static ID id_random;
-
-#define RAND_UPTO(max) (long)rb_random_ulong_limited((randgen), (max)-1)
-
-/*
- * call-seq:
- * ary.shuffle! -> ary
- * ary.shuffle!(random: rng) -> ary
- *
- * Shuffles elements in +self+ in place.
- *
- * a = [ 1, 2, 3 ] #=> [1, 2, 3]
- * a.shuffle! #=> [2, 3, 1]
- * a #=> [2, 3, 1]
- *
- * The optional +rng+ argument will be used as the random number generator.
- *
- * a.shuffle!(random: Random.new(1)) #=> [1, 3, 2]
- */
-
-static VALUE
-rb_ary_shuffle_bang(int argc, VALUE *argv, VALUE ary)
-{
- VALUE opts, randgen = rb_cRandom;
- long i, len;
-
- if (OPTHASH_GIVEN_P(opts)) {
- VALUE rnd;
- ID keyword_ids[1];
-
- keyword_ids[0] = id_random;
- rb_get_kwargs(opts, keyword_ids, 0, 1, &rnd);
- if (rnd != Qundef) {
- randgen = rnd;
- }
- }
- rb_check_arity(argc, 0, 0);
- rb_ary_modify(ary);
- i = len = RARRAY_LEN(ary);
- RARRAY_PTR_USE(ary, ptr, {
- while (i) {
- long j = RAND_UPTO(i);
- VALUE tmp;
- if (len != RARRAY_LEN(ary) || ptr != RARRAY_CONST_PTR_TRANSIENT(ary)) {
- rb_raise(rb_eRuntimeError, "modified during shuffle");
- }
- tmp = ptr[--i];
- ptr[i] = ptr[j];
- ptr[j] = tmp;
- }
- }); /* WB: no new reference */
- return ary;
-}
-
-
-/*
- * call-seq:
- * ary.shuffle -> new_ary
- * ary.shuffle(random: rng) -> new_ary
- *
- * Returns a new array with elements of +self+ shuffled.
- *
- * a = [ 1, 2, 3 ] #=> [1, 2, 3]
- * a.shuffle #=> [2, 3, 1]
- * a #=> [1, 2, 3]
- *
- * The optional +rng+ argument will be used as the random number generator.
- *
- * a.shuffle(random: Random.new(1)) #=> [1, 3, 2]
+ * a.flatten #=> [1, 2, 3, 4, 5, 6, 7, 8, 9, 10
*/
static VALUE
-rb_ary_shuffle(int argc, VALUE *argv, VALUE ary)
+rb_ary_flatten(ary)
+ VALUE ary;
{
ary = rb_ary_dup(ary);
- rb_ary_shuffle_bang(argc, argv, ary);
+ rb_ary_flatten_bang(ary);
return ary;
}
-/*
- * call-seq:
- * ary.sample -> obj
- * ary.sample(random: rng) -> obj
- * ary.sample(n) -> new_ary
- * ary.sample(n, random: rng) -> new_ary
- *
- * Choose a random element or +n+ random elements from the array.
- *
- * The elements are chosen by using random and unique indices into the array
- * in order to ensure that an element doesn't repeat itself unless the array
- * already contained duplicate elements.
- *
- * If the array is empty the first form returns +nil+ and the second form
- * returns an empty array.
- *
- * a = [ 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 ]
- * a.sample #=> 7
- * a.sample(4) #=> [6, 4, 2, 5]
- *
- * The optional +rng+ argument will be used as the random number generator.
- *
- * a.sample(random: Random.new(1)) #=> 6
- * a.sample(4, random: Random.new(1)) #=> [6, 10, 9, 2]
- */
-
-
-static VALUE
-rb_ary_sample(int argc, VALUE *argv, VALUE ary)
-{
- VALUE nv, result;
- VALUE opts, randgen = rb_cRandom;
- long n, len, i, j, k, idx[10];
- long rnds[numberof(idx)];
- long memo_threshold;
-
- if (OPTHASH_GIVEN_P(opts)) {
- VALUE rnd;
- ID keyword_ids[1];
-
- keyword_ids[0] = id_random;
- rb_get_kwargs(opts, keyword_ids, 0, 1, &rnd);
- if (rnd != Qundef) {
- randgen = rnd;
- }
- }
- len = RARRAY_LEN(ary);
- if (rb_check_arity(argc, 0, 1) == 0) {
- if (len < 2)
- i = 0;
- else
- i = RAND_UPTO(len);
-
- return rb_ary_elt(ary, i);
- }
- nv = argv[0];
- n = NUM2LONG(nv);
- if (n < 0) rb_raise(rb_eArgError, "negative sample number");
- if (n > len) n = len;
- if (n <= numberof(idx)) {
- for (i = 0; i < n; ++i) {
- rnds[i] = RAND_UPTO(len - i);
- }
- }
- k = len;
- len = RARRAY_LEN(ary);
- if (len < k && n <= numberof(idx)) {
- for (i = 0; i < n; ++i) {
- if (rnds[i] >= len) return rb_ary_new_capa(0);
- }
- }
- if (n > len) n = len;
- switch (n) {
- case 0:
- return rb_ary_new_capa(0);
- case 1:
- i = rnds[0];
- return rb_ary_new_from_values(1, &RARRAY_AREF(ary, i));
- case 2:
- i = rnds[0];
- j = rnds[1];
- if (j >= i) j++;
- return rb_ary_new_from_args(2, RARRAY_AREF(ary, i), RARRAY_AREF(ary, j));
- case 3:
- i = rnds[0];
- j = rnds[1];
- k = rnds[2];
- {
- long l = j, g = i;
- if (j >= i) l = i, g = ++j;
- if (k >= l && (++k >= g)) ++k;
- }
- return rb_ary_new_from_args(3, RARRAY_AREF(ary, i), RARRAY_AREF(ary, j), RARRAY_AREF(ary, k));
- }
- memo_threshold =
- len < 2560 ? len / 128 :
- len < 5120 ? len / 64 :
- len < 10240 ? len / 32 :
- len / 16;
- if (n <= numberof(idx)) {
- long sorted[numberof(idx)];
- sorted[0] = idx[0] = rnds[0];
- for (i=1; i<n; i++) {
- k = rnds[i];
- for (j = 0; j < i; ++j) {
- if (k < sorted[j]) break;
- ++k;
- }
- memmove(&sorted[j+1], &sorted[j], sizeof(sorted[0])*(i-j));
- sorted[j] = idx[i] = k;
- }
- result = rb_ary_new_capa(n);
- RARRAY_PTR_USE_TRANSIENT(result, ptr_result, {
- for (i=0; i<n; i++) {
- ptr_result[i] = RARRAY_AREF(ary, idx[i]);
- }
- });
- }
- else if (n <= memo_threshold / 2) {
- long max_idx = 0;
-#undef RUBY_UNTYPED_DATA_WARNING
-#define RUBY_UNTYPED_DATA_WARNING 0
- VALUE vmemo = Data_Wrap_Struct(0, 0, st_free_table, 0);
- st_table *memo = st_init_numtable_with_size(n);
- DATA_PTR(vmemo) = memo;
- result = rb_ary_new_capa(n);
- RARRAY_PTR_USE(result, ptr_result, {
- for (i=0; i<n; i++) {
- long r = RAND_UPTO(len-i) + i;
- ptr_result[i] = r;
- if (r > max_idx) max_idx = r;
- }
- len = RARRAY_LEN(ary);
- if (len <= max_idx) n = 0;
- else if (n > len) n = len;
- RARRAY_PTR_USE_TRANSIENT(ary, ptr_ary, {
- for (i=0; i<n; i++) {
- long j2 = j = ptr_result[i];
- long i2 = i;
- st_data_t value;
- if (st_lookup(memo, (st_data_t)i, &value)) i2 = (long)value;
- if (st_lookup(memo, (st_data_t)j, &value)) j2 = (long)value;
- st_insert(memo, (st_data_t)j, (st_data_t)i2);
- ptr_result[i] = ptr_ary[j2];
- }
- });
- });
- DATA_PTR(vmemo) = 0;
- st_free_table(memo);
- }
- else {
- result = rb_ary_dup(ary);
- RBASIC_CLEAR_CLASS(result);
- RB_GC_GUARD(ary);
- RARRAY_PTR_USE(result, ptr_result, {
- for (i=0; i<n; i++) {
- j = RAND_UPTO(len-i) + i;
- nv = ptr_result[j];
- ptr_result[j] = ptr_result[i];
- ptr_result[i] = nv;
- }
- });
- RBASIC_SET_CLASS_RAW(result, rb_cArray);
- }
- ARY_SET_LEN(result, n);
-
- return result;
-}
-
-static VALUE
-rb_ary_cycle_size(VALUE self, VALUE args, VALUE eobj)
-{
- long mul;
- VALUE n = Qnil;
- if (args && (RARRAY_LEN(args) > 0)) {
- n = RARRAY_AREF(args, 0);
- }
- if (RARRAY_LEN(self) == 0) return INT2FIX(0);
- if (n == Qnil) return DBL2NUM(HUGE_VAL);
- mul = NUM2LONG(n);
- if (mul <= 0) return INT2FIX(0);
- n = LONG2FIX(mul);
- return rb_fix_mul_fix(rb_ary_length(self), n);
-}
-
-/*
- * call-seq:
- * ary.cycle(n=nil) {|obj| block} -> nil
- * ary.cycle(n=nil) -> Enumerator
- *
- * Calls the given block for each element +n+ times or forever if +nil+ is
- * given.
- *
- * Does nothing if a non-positive number is given or the array is empty.
- *
- * Returns +nil+ if the loop has finished without getting interrupted.
- *
- * If no block is given, an Enumerator is returned instead.
- *
- * a = ["a", "b", "c"]
- * a.cycle {|x| puts x} # print, a, b, c, a, b, c,.. forever.
- * a.cycle(2) {|x| puts x} # print, a, b, c, a, b, c.
- *
- */
-
-static VALUE
-rb_ary_cycle(int argc, VALUE *argv, VALUE ary)
-{
- long n, i;
-
- rb_check_arity(argc, 0, 1);
-
- RETURN_SIZED_ENUMERATOR(ary, argc, argv, rb_ary_cycle_size);
- if (argc == 0 || NIL_P(argv[0])) {
- n = -1;
- }
- else {
- n = NUM2LONG(argv[0]);
- if (n <= 0) return Qnil;
- }
-
- while (RARRAY_LEN(ary) > 0 && (n < 0 || 0 < n--)) {
- for (i=0; i<RARRAY_LEN(ary); i++) {
- rb_yield(RARRAY_AREF(ary, i));
- }
- }
- return Qnil;
-}
-
-#define tmpary(n) rb_ary_tmp_new(n)
-#define tmpary_discard(a) (ary_discard(a), RBASIC_SET_CLASS_RAW(a, rb_cArray))
-
-/*
- * Build a ruby array of the corresponding values and yield it to the
- * associated block.
- * Return the class of +values+ for reentry check.
- */
-static int
-yield_indexed_values(const VALUE values, const long r, const long *const p)
-{
- const VALUE result = rb_ary_new2(r);
- long i;
-
- for (i = 0; i < r; i++) ARY_SET(result, i, RARRAY_AREF(values, p[i]));
- ARY_SET_LEN(result, r);
- rb_yield(result);
- return !RBASIC(values)->klass;
-}
-
-/*
- * Compute permutations of +r+ elements of the set <code>[0..n-1]</code>.
- *
- * When we have a complete permutation of array indices, copy the values
- * at those indices into a new array and yield that array.
- *
- * n: the size of the set
- * r: the number of elements in each permutation
- * p: the array (of size r) that we're filling in
- * used: an array of booleans: whether a given index is already used
- * values: the Ruby array that holds the actual values to permute
- */
-static void
-permute0(const long n, const long r, long *const p, char *const used, const VALUE values)
-{
- long i = 0, index = 0;
-
- for (;;) {
- const char *const unused = memchr(&used[i], 0, n-i);
- if (!unused) {
- if (!index) break;
- i = p[--index]; /* pop index */
- used[i++] = 0; /* index unused */
- }
- else {
- i = unused - used;
- p[index] = i;
- used[i] = 1; /* mark index used */
- ++index;
- if (index < r-1) { /* if not done yet */
- p[index] = i = 0;
- continue;
- }
- for (i = 0; i < n; ++i) {
- if (used[i]) continue;
- p[index] = i;
- if (!yield_indexed_values(values, r, p)) {
- rb_raise(rb_eRuntimeError, "permute reentered");
- }
- }
- i = p[--index]; /* pop index */
- used[i] = 0; /* index unused */
- p[index] = ++i;
- }
- }
-}
-
-/*
- * Returns the product of from, from-1, ..., from - how_many + 1.
- * http://en.wikipedia.org/wiki/Pochhammer_symbol
- */
-static VALUE
-descending_factorial(long from, long how_many)
-{
- VALUE cnt;
- if (how_many > 0) {
- cnt = LONG2FIX(from);
- while (--how_many > 0) {
- long v = --from;
- cnt = rb_int_mul(cnt, LONG2FIX(v));
- }
- }
- else {
- cnt = LONG2FIX(how_many == 0);
- }
- return cnt;
-}
-
-static VALUE
-binomial_coefficient(long comb, long size)
-{
- VALUE r;
- long i;
- if (comb > size-comb) {
- comb = size-comb;
- }
- if (comb < 0) {
- return LONG2FIX(0);
- }
- else if (comb == 0) {
- return LONG2FIX(1);
- }
- r = LONG2FIX(size);
- for (i = 1; i < comb; ++i) {
- r = rb_int_mul(r, LONG2FIX(size - i));
- r = rb_int_idiv(r, LONG2FIX(i + 1));
- }
- return r;
-}
-
-static VALUE
-rb_ary_permutation_size(VALUE ary, VALUE args, VALUE eobj)
-{
- long n = RARRAY_LEN(ary);
- long k = (args && (RARRAY_LEN(args) > 0)) ? NUM2LONG(RARRAY_AREF(args, 0)) : n;
-
- return descending_factorial(n, k);
-}
-
-/*
- * call-seq:
- * ary.permutation {|p| block} -> ary
- * ary.permutation -> Enumerator
- * ary.permutation(n) {|p| block} -> ary
- * ary.permutation(n) -> Enumerator
- *
- * When invoked with a block, yield all permutations of length +n+ of the
- * elements of the array, then return the array itself.
- *
- * If +n+ is not specified, yield all permutations of all elements.
- *
- * The implementation makes no guarantees about the order in which the
- * permutations are yielded.
- *
- * If no block is given, an Enumerator is returned instead.
- *
- * Examples:
- *
- * a = [1, 2, 3]
- * a.permutation.to_a #=> [[1,2,3],[1,3,2],[2,1,3],[2,3,1],[3,1,2],[3,2,1]]
- * a.permutation(1).to_a #=> [[1],[2],[3]]
- * a.permutation(2).to_a #=> [[1,2],[1,3],[2,1],[2,3],[3,1],[3,2]]
- * a.permutation(3).to_a #=> [[1,2,3],[1,3,2],[2,1,3],[2,3,1],[3,1,2],[3,2,1]]
- * a.permutation(0).to_a #=> [[]] # one permutation of length 0
- * a.permutation(4).to_a #=> [] # no permutations of length 4
- */
-
-static VALUE
-rb_ary_permutation(int argc, VALUE *argv, VALUE ary)
-{
- long r, n, i;
-
- n = RARRAY_LEN(ary); /* Array length */
- RETURN_SIZED_ENUMERATOR(ary, argc, argv, rb_ary_permutation_size); /* Return enumerator if no block */
- r = n;
- if (rb_check_arity(argc, 0, 1) && !NIL_P(argv[0]))
- r = NUM2LONG(argv[0]); /* Permutation size from argument */
-
- if (r < 0 || n < r) {
- /* no permutations: yield nothing */
- }
- else if (r == 0) { /* exactly one permutation: the zero-length array */
- rb_yield(rb_ary_new2(0));
- }
- else if (r == 1) { /* this is a special, easy case */
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
- }
- }
- else { /* this is the general case */
- volatile VALUE t0;
- long *p = ALLOCV_N(long, t0, r+roomof(n, sizeof(long)));
- char *used = (char*)(p + r);
- VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
- RBASIC_CLEAR_CLASS(ary0);
-
- MEMZERO(used, char, n); /* initialize array */
-
- permute0(n, r, p, used, ary0); /* compute and yield permutations */
- ALLOCV_END(t0);
- RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
- }
- return ary;
-}
-
-static void
-combinate0(const long len, const long n, long *const stack, const VALUE values)
-{
- long lev = 0;
-
- MEMZERO(stack+1, long, n);
- stack[0] = -1;
- for (;;) {
- for (lev++; lev < n; lev++) {
- stack[lev+1] = stack[lev]+1;
- }
- if (!yield_indexed_values(values, n, stack+1)) {
- rb_raise(rb_eRuntimeError, "combination reentered");
- }
- do {
- if (lev == 0) return;
- stack[lev--]++;
- } while (stack[lev+1]+n == len+lev+1);
- }
-}
-
-static VALUE
-rb_ary_combination_size(VALUE ary, VALUE args, VALUE eobj)
-{
- long n = RARRAY_LEN(ary);
- long k = NUM2LONG(RARRAY_AREF(args, 0));
-
- return binomial_coefficient(k, n);
-}
-
-/*
- * call-seq:
- * ary.combination(n) {|c| block} -> ary
- * ary.combination(n) -> Enumerator
- *
- * When invoked with a block, yields all combinations of length +n+ of elements
- * from the array and then returns the array itself.
- *
- * The implementation makes no guarantees about the order in which the
- * combinations are yielded.
- *
- * If no block is given, an Enumerator is returned instead.
- *
- * Examples:
- *
- * a = [1, 2, 3, 4]
- * a.combination(1).to_a #=> [[1],[2],[3],[4]]
- * a.combination(2).to_a #=> [[1,2],[1,3],[1,4],[2,3],[2,4],[3,4]]
- * a.combination(3).to_a #=> [[1,2,3],[1,2,4],[1,3,4],[2,3,4]]
- * a.combination(4).to_a #=> [[1,2,3,4]]
- * a.combination(0).to_a #=> [[]] # one combination of length 0
- * a.combination(5).to_a #=> [] # no combinations of length 5
- *
- */
-
-static VALUE
-rb_ary_combination(VALUE ary, VALUE num)
-{
- long i, n, len;
-
- n = NUM2LONG(num);
- RETURN_SIZED_ENUMERATOR(ary, 1, &num, rb_ary_combination_size);
- len = RARRAY_LEN(ary);
- if (n < 0 || len < n) {
- /* yield nothing */
- }
- else if (n == 0) {
- rb_yield(rb_ary_new2(0));
- }
- else if (n == 1) {
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
- }
- }
- else {
- VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
- volatile VALUE t0;
- long *stack = ALLOCV_N(long, t0, n+1);
-
- RBASIC_CLEAR_CLASS(ary0);
- combinate0(len, n, stack, ary0);
- ALLOCV_END(t0);
- RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
- }
- return ary;
-}
-
-/*
- * Compute repeated permutations of +r+ elements of the set
- * <code>[0..n-1]</code>.
- *
- * When we have a complete repeated permutation of array indices, copy the
- * values at those indices into a new array and yield that array.
- *
- * n: the size of the set
- * r: the number of elements in each permutation
- * p: the array (of size r) that we're filling in
- * values: the Ruby array that holds the actual values to permute
- */
-static void
-rpermute0(const long n, const long r, long *const p, const VALUE values)
-{
- long i = 0, index = 0;
-
- p[index] = i;
- for (;;) {
- if (++index < r-1) {
- p[index] = i = 0;
- continue;
- }
- for (i = 0; i < n; ++i) {
- p[index] = i;
- if (!yield_indexed_values(values, r, p)) {
- rb_raise(rb_eRuntimeError, "repeated permute reentered");
- }
- }
- do {
- if (index <= 0) return;
- } while ((i = ++p[--index]) >= n);
- }
-}
-
-static VALUE
-rb_ary_repeated_permutation_size(VALUE ary, VALUE args, VALUE eobj)
-{
- long n = RARRAY_LEN(ary);
- long k = NUM2LONG(RARRAY_AREF(args, 0));
-
- if (k < 0) {
- return LONG2FIX(0);
- }
- if (n <= 0) {
- return LONG2FIX(!k);
- }
- return rb_int_positive_pow(n, (unsigned long)k);
-}
-
-/*
- * call-seq:
- * ary.repeated_permutation(n) {|p| block} -> ary
- * ary.repeated_permutation(n) -> Enumerator
- *
- * When invoked with a block, yield all repeated permutations of length +n+ of
- * the elements of the array, then return the array itself.
- *
- * The implementation makes no guarantees about the order in which the repeated
- * permutations are yielded.
- *
- * If no block is given, an Enumerator is returned instead.
- *
- * Examples:
- *
- * a = [1, 2]
- * a.repeated_permutation(1).to_a #=> [[1], [2]]
- * a.repeated_permutation(2).to_a #=> [[1,1],[1,2],[2,1],[2,2]]
- * a.repeated_permutation(3).to_a #=> [[1,1,1],[1,1,2],[1,2,1],[1,2,2],
- * # [2,1,1],[2,1,2],[2,2,1],[2,2,2]]
- * a.repeated_permutation(0).to_a #=> [[]] # one permutation of length 0
- */
-
-static VALUE
-rb_ary_repeated_permutation(VALUE ary, VALUE num)
-{
- long r, n, i;
-
- n = RARRAY_LEN(ary); /* Array length */
- RETURN_SIZED_ENUMERATOR(ary, 1, &num, rb_ary_repeated_permutation_size); /* Return Enumerator if no block */
- r = NUM2LONG(num); /* Permutation size from argument */
-
- if (r < 0) {
- /* no permutations: yield nothing */
- }
- else if (r == 0) { /* exactly one permutation: the zero-length array */
- rb_yield(rb_ary_new2(0));
- }
- else if (r == 1) { /* this is a special, easy case */
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
- }
- }
- else { /* this is the general case */
- volatile VALUE t0;
- long *p = ALLOCV_N(long, t0, r);
- VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
- RBASIC_CLEAR_CLASS(ary0);
-
- rpermute0(n, r, p, ary0); /* compute and yield repeated permutations */
- ALLOCV_END(t0);
- RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
- }
- return ary;
-}
-
-static void
-rcombinate0(const long n, const long r, long *const p, const long rest, const VALUE values)
-{
- long i = 0, index = 0;
-
- p[index] = i;
- for (;;) {
- if (++index < r-1) {
- p[index] = i;
- continue;
- }
- for (; i < n; ++i) {
- p[index] = i;
- if (!yield_indexed_values(values, r, p)) {
- rb_raise(rb_eRuntimeError, "repeated combination reentered");
- }
- }
- do {
- if (index <= 0) return;
- } while ((i = ++p[--index]) >= n);
- }
-}
-
-static VALUE
-rb_ary_repeated_combination_size(VALUE ary, VALUE args, VALUE eobj)
-{
- long n = RARRAY_LEN(ary);
- long k = NUM2LONG(RARRAY_AREF(args, 0));
- if (k == 0) {
- return LONG2FIX(1);
- }
- return binomial_coefficient(k, n + k - 1);
-}
-
-/*
- * call-seq:
- * ary.repeated_combination(n) {|c| block} -> ary
- * ary.repeated_combination(n) -> Enumerator
- *
- * When invoked with a block, yields all repeated combinations of length +n+ of
- * elements from the array and then returns the array itself.
- *
- * The implementation makes no guarantees about the order in which the repeated
- * combinations are yielded.
- *
- * If no block is given, an Enumerator is returned instead.
- *
- * Examples:
- *
- * a = [1, 2, 3]
- * a.repeated_combination(1).to_a #=> [[1], [2], [3]]
- * a.repeated_combination(2).to_a #=> [[1,1],[1,2],[1,3],[2,2],[2,3],[3,3]]
- * a.repeated_combination(3).to_a #=> [[1,1,1],[1,1,2],[1,1,3],[1,2,2],[1,2,3],
- * # [1,3,3],[2,2,2],[2,2,3],[2,3,3],[3,3,3]]
- * a.repeated_combination(4).to_a #=> [[1,1,1,1],[1,1,1,2],[1,1,1,3],[1,1,2,2],[1,1,2,3],
- * # [1,1,3,3],[1,2,2,2],[1,2,2,3],[1,2,3,3],[1,3,3,3],
- * # [2,2,2,2],[2,2,2,3],[2,2,3,3],[2,3,3,3],[3,3,3,3]]
- * a.repeated_combination(0).to_a #=> [[]] # one combination of length 0
- *
- */
-
-static VALUE
-rb_ary_repeated_combination(VALUE ary, VALUE num)
-{
- long n, i, len;
-
- n = NUM2LONG(num); /* Combination size from argument */
- RETURN_SIZED_ENUMERATOR(ary, 1, &num, rb_ary_repeated_combination_size); /* Return enumerator if no block */
- len = RARRAY_LEN(ary);
- if (n < 0) {
- /* yield nothing */
- }
- else if (n == 0) {
- rb_yield(rb_ary_new2(0));
- }
- else if (n == 1) {
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
- }
- }
- else if (len == 0) {
- /* yield nothing */
- }
- else {
- volatile VALUE t0;
- long *p = ALLOCV_N(long, t0, n);
- VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
- RBASIC_CLEAR_CLASS(ary0);
-
- rcombinate0(len, n, p, n, ary0); /* compute and yield repeated combinations */
- ALLOCV_END(t0);
- RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
- }
- return ary;
-}
-
-/*
- * call-seq:
- * ary.product(other_ary, ...) -> new_ary
- * ary.product(other_ary, ...) {|p| block} -> ary
- *
- * Returns an array of all combinations of elements from all arrays.
- *
- * The length of the returned array is the product of the length of +self+ and
- * the argument arrays.
- *
- * If given a block, #product will yield all combinations and return +self+
- * instead.
- *
- * [1,2,3].product([4,5]) #=> [[1,4],[1,5],[2,4],[2,5],[3,4],[3,5]]
- * [1,2].product([1,2]) #=> [[1,1],[1,2],[2,1],[2,2]]
- * [1,2].product([3,4],[5,6]) #=> [[1,3,5],[1,3,6],[1,4,5],[1,4,6],
- * # [2,3,5],[2,3,6],[2,4,5],[2,4,6]]
- * [1,2].product() #=> [[1],[2]]
- * [1,2].product([]) #=> []
- */
-
-static VALUE
-rb_ary_product(int argc, VALUE *argv, VALUE ary)
-{
- int n = argc+1; /* How many arrays we're operating on */
- volatile VALUE t0 = tmpary(n);
- volatile VALUE t1 = Qundef;
- VALUE *arrays = RARRAY_PTR(t0); /* The arrays we're computing the product of */
- int *counters = ALLOCV_N(int, t1, n); /* The current position in each one */
- VALUE result = Qnil; /* The array we'll be returning, when no block given */
- long i,j;
- long resultlen = 1;
-
- RBASIC_CLEAR_CLASS(t0);
-
- /* initialize the arrays of arrays */
- ARY_SET_LEN(t0, n);
- arrays[0] = ary;
- for (i = 1; i < n; i++) arrays[i] = Qnil;
- for (i = 1; i < n; i++) arrays[i] = to_ary(argv[i-1]);
-
- /* initialize the counters for the arrays */
- for (i = 0; i < n; i++) counters[i] = 0;
-
- /* Otherwise, allocate and fill in an array of results */
- if (rb_block_given_p()) {
- /* Make defensive copies of arrays; exit if any is empty */
- for (i = 0; i < n; i++) {
- if (RARRAY_LEN(arrays[i]) == 0) goto done;
- arrays[i] = ary_make_shared_copy(arrays[i]);
- }
- }
- else {
- /* Compute the length of the result array; return [] if any is empty */
- for (i = 0; i < n; i++) {
- long k = RARRAY_LEN(arrays[i]);
- if (k == 0) {
- result = rb_ary_new2(0);
- goto done;
- }
- if (MUL_OVERFLOW_LONG_P(resultlen, k))
- rb_raise(rb_eRangeError, "too big to product");
- resultlen *= k;
- }
- result = rb_ary_new2(resultlen);
- }
- for (;;) {
- int m;
- /* fill in one subarray */
- VALUE subarray = rb_ary_new2(n);
- for (j = 0; j < n; j++) {
- rb_ary_push(subarray, rb_ary_entry(arrays[j], counters[j]));
- }
-
- /* put it on the result array */
- if (NIL_P(result)) {
- FL_SET(t0, FL_USER5);
- rb_yield(subarray);
- if (! FL_TEST(t0, FL_USER5)) {
- rb_raise(rb_eRuntimeError, "product reentered");
- }
- else {
- FL_UNSET(t0, FL_USER5);
- }
- }
- else {
- rb_ary_push(result, subarray);
- }
-
- /*
- * Increment the last counter. If it overflows, reset to 0
- * and increment the one before it.
- */
- m = n-1;
- counters[m]++;
- while (counters[m] == RARRAY_LEN(arrays[m])) {
- counters[m] = 0;
- /* If the first counter overflows, we are done */
- if (--m < 0) goto done;
- counters[m]++;
- }
- }
-done:
- tmpary_discard(t0);
- ALLOCV_END(t1);
-
- return NIL_P(result) ? ary : result;
-}
-
-/*
- * call-seq:
- * ary.take(n) -> new_ary
- *
- * Returns first +n+ elements from the array.
- *
- * If a negative number is given, raises an ArgumentError.
- *
- * See also Array#drop
- *
- * a = [1, 2, 3, 4, 5, 0]
- * a.take(3) #=> [1, 2, 3]
- *
- */
-
-static VALUE
-rb_ary_take(VALUE obj, VALUE n)
-{
- long len = NUM2LONG(n);
- if (len < 0) {
- rb_raise(rb_eArgError, "attempt to take negative size");
- }
- return rb_ary_subseq(obj, 0, len);
-}
-
-/*
- * call-seq:
- * ary.take_while {|obj| block} -> new_ary
- * ary.take_while -> Enumerator
- *
- * Passes elements to the block until the block returns +nil+ or +false+, then
- * stops iterating and returns an array of all prior elements.
- *
- * If no block is given, an Enumerator is returned instead.
- *
- * See also Array#drop_while
- *
- * a = [1, 2, 3, 4, 5, 0]
- * a.take_while {|i| i < 3} #=> [1, 2]
- *
- */
-
-static VALUE
-rb_ary_take_while(VALUE ary)
-{
- long i;
-
- RETURN_ENUMERATOR(ary, 0, 0);
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) break;
- }
- return rb_ary_take(ary, LONG2FIX(i));
-}
-
-/*
- * call-seq:
- * ary.drop(n) -> new_ary
- *
- * Drops first +n+ elements from +ary+ and returns the rest of the elements in
- * an array.
- *
- * If a negative number is given, raises an ArgumentError.
- *
- * See also Array#take
- *
- * a = [1, 2, 3, 4, 5, 0]
- * a.drop(3) #=> [4, 5, 0]
- *
- */
-
-static VALUE
-rb_ary_drop(VALUE ary, VALUE n)
-{
- VALUE result;
- long pos = NUM2LONG(n);
- if (pos < 0) {
- rb_raise(rb_eArgError, "attempt to drop negative size");
- }
-
- result = rb_ary_subseq(ary, pos, RARRAY_LEN(ary));
- if (result == Qnil) result = rb_ary_new();
- return result;
-}
-
-/*
- * call-seq:
- * ary.drop_while {|obj| block} -> new_ary
- * ary.drop_while -> Enumerator
- *
- * Drops elements up to, but not including, the first element for which the
- * block returns +nil+ or +false+ and returns an array containing the
- * remaining elements.
- *
- * If no block is given, an Enumerator is returned instead.
- *
- * See also Array#take_while
- *
- * a = [1, 2, 3, 4, 5, 0]
- * a.drop_while {|i| i < 3 } #=> [3, 4, 5, 0]
- *
- */
-
-static VALUE
-rb_ary_drop_while(VALUE ary)
-{
- long i;
-
- RETURN_ENUMERATOR(ary, 0, 0);
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) break;
- }
- return rb_ary_drop(ary, LONG2FIX(i));
-}
-
-/*
- * call-seq:
- * ary.any? [{|obj| block} ] -> true or false
- * ary.any?(pattern) -> true or false
- *
- * See also Enumerable#any?
- */
-
-static VALUE
-rb_ary_any_p(int argc, VALUE *argv, VALUE ary)
-{
- long i, len = RARRAY_LEN(ary);
-
- rb_check_arity(argc, 0, 1);
- if (!len) return Qfalse;
- if (argc) {
- if (rb_block_given_p()) {
- rb_warn("given block not used");
- }
- for (i = 0; i < RARRAY_LEN(ary); ++i) {
- if (RTEST(rb_funcall(argv[0], idEqq, 1, RARRAY_AREF(ary, i)))) return Qtrue;
- }
- }
- else if (!rb_block_given_p()) {
- for (i = 0; i < len; ++i) {
- if (RTEST(RARRAY_AREF(ary, i))) return Qtrue;
- }
- }
- else {
- for (i = 0; i < RARRAY_LEN(ary); ++i) {
- if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) return Qtrue;
- }
- }
- return Qfalse;
-}
-
-/*
- * call-seq:
- * ary.all? [{|obj| block} ] -> true or false
- * ary.all?(pattern) -> true or false
- *
- * See also Enumerable#all?
- */
-
-static VALUE
-rb_ary_all_p(int argc, VALUE *argv, VALUE ary)
-{
- long i, len = RARRAY_LEN(ary);
-
- rb_check_arity(argc, 0, 1);
- if (!len) return Qtrue;
- if (argc) {
- if (rb_block_given_p()) {
- rb_warn("given block not used");
- }
- for (i = 0; i < RARRAY_LEN(ary); ++i) {
- if (!RTEST(rb_funcall(argv[0], idEqq, 1, RARRAY_AREF(ary, i)))) return Qfalse;
- }
- }
- else if (!rb_block_given_p()) {
- for (i = 0; i < len; ++i) {
- if (!RTEST(RARRAY_AREF(ary, i))) return Qfalse;
- }
- }
- else {
- for (i = 0; i < RARRAY_LEN(ary); ++i) {
- if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) return Qfalse;
- }
- }
- return Qtrue;
-}
-
-/*
- * call-seq:
- * ary.none? [{|obj| block} ] -> true or false
- * ary.none?(pattern) -> true or false
- *
- * See also Enumerable#none?
- */
-
-static VALUE
-rb_ary_none_p(int argc, VALUE *argv, VALUE ary)
-{
- long i, len = RARRAY_LEN(ary);
-
- rb_check_arity(argc, 0, 1);
- if (!len) return Qtrue;
- if (argc) {
- if (rb_block_given_p()) {
- rb_warn("given block not used");
- }
- for (i = 0; i < RARRAY_LEN(ary); ++i) {
- if (RTEST(rb_funcall(argv[0], idEqq, 1, RARRAY_AREF(ary, i)))) return Qfalse;
- }
- }
- else if (!rb_block_given_p()) {
- for (i = 0; i < len; ++i) {
- if (RTEST(RARRAY_AREF(ary, i))) return Qfalse;
- }
- }
- else {
- for (i = 0; i < RARRAY_LEN(ary); ++i) {
- if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) return Qfalse;
- }
- }
- return Qtrue;
-}
-
-/*
- * call-seq:
- * ary.one? [{|obj| block} ] -> true or false
- * ary.one?(pattern) -> true or false
- *
- * See also Enumerable#one?
- */
-
-static VALUE
-rb_ary_one_p(int argc, VALUE *argv, VALUE ary)
-{
- long i, len = RARRAY_LEN(ary);
- VALUE result = Qfalse;
-
- rb_check_arity(argc, 0, 1);
- if (!len) return Qfalse;
- if (argc) {
- if (rb_block_given_p()) {
- rb_warn("given block not used");
- }
- for (i = 0; i < RARRAY_LEN(ary); ++i) {
- if (RTEST(rb_funcall(argv[0], idEqq, 1, RARRAY_AREF(ary, i)))) {
- if (result) return Qfalse;
- result = Qtrue;
- }
- }
- }
- else if (!rb_block_given_p()) {
- for (i = 0; i < len; ++i) {
- if (RTEST(RARRAY_AREF(ary, i))) {
- if (result) return Qfalse;
- result = Qtrue;
- }
- }
- }
- else {
- for (i = 0; i < RARRAY_LEN(ary); ++i) {
- if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
- if (result) return Qfalse;
- result = Qtrue;
- }
- }
- }
- return result;
-}
-
-/*
- * call-seq:
- * ary.dig(idx, ...) -> object
- *
- * Extracts the nested value specified by the sequence of <i>idx</i>
- * objects by calling +dig+ at each step, returning +nil+ if any
- * intermediate step is +nil+.
- *
- * a = [[1, [2, 3]]]
- *
- * a.dig(0, 1, 1) #=> 3
- * a.dig(1, 2, 3) #=> nil
- * a.dig(0, 0, 0) #=> TypeError: Integer does not have #dig method
- * [42, {foo: :bar}].dig(1, :foo) #=> :bar
- */
-
-static VALUE
-rb_ary_dig(int argc, VALUE *argv, VALUE self)
-{
- rb_check_arity(argc, 1, UNLIMITED_ARGUMENTS);
- self = rb_ary_at(self, *argv);
- if (!--argc) return self;
- ++argv;
- return rb_obj_dig(argc, argv, self, Qnil);
-}
-
-static inline VALUE
-finish_exact_sum(long n, VALUE r, VALUE v, int z)
-{
- if (n != 0)
- v = rb_fix_plus(LONG2FIX(n), v);
- if (r != Qundef) {
- /* r can be an Integer when mathn is loaded */
- if (FIXNUM_P(r))
- v = rb_fix_plus(r, v);
- else if (RB_TYPE_P(r, T_BIGNUM))
- v = rb_big_plus(r, v);
- else
- v = rb_rational_plus(r, v);
- }
- else if (!n && z) {
- v = rb_fix_plus(LONG2FIX(0), v);
- }
- return v;
-}
-
-/*
- * call-seq:
- * ary.sum(init=0) -> number
- * ary.sum(init=0) {|e| expr } -> number
- *
- * Returns the sum of elements.
- * For example, [e1, e2, e3].sum returns init + e1 + e2 + e3.
- *
- * If a block is given, the block is applied to each element
- * before addition.
- *
- * If <i>ary</i> is empty, it returns <i>init</i>.
- *
- * [].sum #=> 0
- * [].sum(0.0) #=> 0.0
- * [1, 2, 3].sum #=> 6
- * [3, 5.5].sum #=> 8.5
- * [2.5, 3.0].sum(0.0) {|e| e * e } #=> 15.25
- * [Object.new].sum #=> TypeError
- *
- * The (arithmetic) mean value of an array can be obtained as follows.
- *
- * mean = ary.sum(0.0) / ary.length
- *
- * This method can be used for non-numeric objects by
- * explicit <i>init</i> argument.
- *
- * ["a", "b", "c"].sum("") #=> "abc"
- * [[1], [[2]], [3]].sum([]) #=> [1, [2], 3]
- *
- * However, Array#join and Array#flatten is faster than Array#sum for
- * array of strings and array of arrays.
- *
- * ["a", "b", "c"].join #=> "abc"
- * [[1], [[2]], [3]].flatten(1) #=> [1, [2], 3]
- *
- *
- * Array#sum method may not respect method redefinition of "+" methods
- * such as Integer#+.
- *
- */
-
-static VALUE
-rb_ary_sum(int argc, VALUE *argv, VALUE ary)
-{
- VALUE e, v, r;
- long i, n;
- int block_given;
-
- v = (rb_check_arity(argc, 0, 1) ? argv[0] : LONG2FIX(0));
-
- block_given = rb_block_given_p();
-
- if (RARRAY_LEN(ary) == 0)
- return v;
-
- n = 0;
- r = Qundef;
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- e = RARRAY_AREF(ary, i);
- if (block_given)
- e = rb_yield(e);
- if (FIXNUM_P(e)) {
- n += FIX2LONG(e); /* should not overflow long type */
- if (!FIXABLE(n)) {
- v = rb_big_plus(LONG2NUM(n), v);
- n = 0;
- }
- }
- else if (RB_TYPE_P(e, T_BIGNUM))
- v = rb_big_plus(e, v);
- else if (RB_TYPE_P(e, T_RATIONAL)) {
- if (r == Qundef)
- r = e;
- else
- r = rb_rational_plus(r, e);
- }
- else
- goto not_exact;
- }
- v = finish_exact_sum(n, r, v, argc!=0);
- return v;
-
- not_exact:
- v = finish_exact_sum(n, r, v, i!=0);
-
- if (RB_FLOAT_TYPE_P(e)) {
- /*
- * Kahan-Babuska balancing compensated summation algorithm
- * See http://link.springer.com/article/10.1007/s00607-005-0139-x
- */
- double f, c;
- double x, t;
-
- f = NUM2DBL(v);
- c = 0.0;
- goto has_float_value;
- for (; i < RARRAY_LEN(ary); i++) {
- e = RARRAY_AREF(ary, i);
- if (block_given)
- e = rb_yield(e);
- if (RB_FLOAT_TYPE_P(e))
- has_float_value:
- x = RFLOAT_VALUE(e);
- else if (FIXNUM_P(e))
- x = FIX2LONG(e);
- else if (RB_TYPE_P(e, T_BIGNUM))
- x = rb_big2dbl(e);
- else if (RB_TYPE_P(e, T_RATIONAL))
- x = rb_num2dbl(e);
- else
- goto not_float;
-
- if (isnan(f)) continue;
- if (isnan(x)) {
- f = x;
- continue;
- }
- if (isinf(x)) {
- if (isinf(f) && signbit(x) != signbit(f))
- f = NAN;
- else
- f = x;
- continue;
- }
- if (isinf(f)) continue;
-
- t = f + x;
- if (fabs(f) >= fabs(x))
- c += ((f - t) + x);
- else
- c += ((x - t) + f);
- f = t;
- }
- f += c;
- return DBL2NUM(f);
-
- not_float:
- v = DBL2NUM(f);
- }
-
- goto has_some_value;
- for (; i < RARRAY_LEN(ary); i++) {
- e = RARRAY_AREF(ary, i);
- if (block_given)
- e = rb_yield(e);
- has_some_value:
- v = rb_funcall(v, idPLUS, 1, e);
- }
- return v;
-}
-
-static VALUE
-rb_ary_deconstruct(VALUE ary)
-{
- return ary;
-}
-
-/*
- * Arrays are ordered, integer-indexed collections of any object.
- *
- * Array indexing starts at 0, as in C or Java. A negative index is assumed
- * to be relative to the end of the array---that is, an index of -1 indicates
- * the last element of the array, -2 is the next to last element in the
- * array, and so on.
- *
- * == Creating Arrays
- *
- * A new array can be created by using the literal constructor
- * <code>[]</code>. Arrays can contain different types of objects. For
- * example, the array below contains an Integer, a String and a Float:
- *
- * ary = [1, "two", 3.0] #=> [1, "two", 3.0]
- *
- * An array can also be created by explicitly calling Array.new with zero, one
- * (the initial size of the Array) or two arguments (the initial size and a
- * default object).
- *
- * ary = Array.new #=> []
- * Array.new(3) #=> [nil, nil, nil]
- * Array.new(3, true) #=> [true, true, true]
- *
- * Note that the second argument populates the array with references to the
- * same object. Therefore, it is only recommended in cases when you need to
- * instantiate arrays with natively immutable objects such as Symbols,
- * numbers, true or false.
- *
- * To create an array with separate objects a block can be passed instead.
- * This method is safe to use with mutable objects such as hashes, strings or
- * other arrays:
- *
- * Array.new(4) {Hash.new} #=> [{}, {}, {}, {}]
- * Array.new(4) {|i| i.to_s } #=> ["0", "1", "2", "3"]
- *
- * This is also a quick way to build up multi-dimensional arrays:
- *
- * empty_table = Array.new(3) {Array.new(3)}
- * #=> [[nil, nil, nil], [nil, nil, nil], [nil, nil, nil]]
- *
- * An array can also be created by using the Array() method, provided by
- * Kernel, which tries to call #to_ary, then #to_a on its argument.
- *
- * Array({:a => "a", :b => "b"}) #=> [[:a, "a"], [:b, "b"]]
- *
- * == Example Usage
- *
- * In addition to the methods it mixes in through the Enumerable module, the
- * Array class has proprietary methods for accessing, searching and otherwise
- * manipulating arrays.
- *
- * Some of the more common ones are illustrated below.
- *
- * == Accessing Elements
- *
- * Elements in an array can be retrieved using the Array#[] method. It can
- * take a single integer argument (a numeric index), a pair of arguments
- * (start and length) or a range. Negative indices start counting from the end,
- * with -1 being the last element.
- *
- * arr = [1, 2, 3, 4, 5, 6]
- * arr[2] #=> 3
- * arr[100] #=> nil
- * arr[-3] #=> 4
- * arr[2, 3] #=> [3, 4, 5]
- * arr[1..4] #=> [2, 3, 4, 5]
- * arr[1..-3] #=> [2, 3, 4]
- *
- * Another way to access a particular array element is by using the #at method
- *
- * arr.at(0) #=> 1
- *
- * The #slice method works in an identical manner to Array#[].
- *
- * To raise an error for indices outside of the array bounds or else to
- * provide a default value when that happens, you can use #fetch.
- *
- * arr = ['a', 'b', 'c', 'd', 'e', 'f']
- * arr.fetch(100) #=> IndexError: index 100 outside of array bounds: -6...6
- * arr.fetch(100, "oops") #=> "oops"
- *
- * The special methods #first and #last will return the first and last
- * elements of an array, respectively.
- *
- * arr.first #=> 1
- * arr.last #=> 6
- *
- * To return the first +n+ elements of an array, use #take
- *
- * arr.take(3) #=> [1, 2, 3]
- *
- * #drop does the opposite of #take, by returning the elements after +n+
- * elements have been dropped:
- *
- * arr.drop(3) #=> [4, 5, 6]
- *
- * == Obtaining Information about an Array
- *
- * Arrays keep track of their own length at all times. To query an array
- * about the number of elements it contains, use #length, #count or #size.
- *
- * browsers = ['Chrome', 'Firefox', 'Safari', 'Opera', 'IE']
- * browsers.length #=> 5
- * browsers.count #=> 5
- *
- * To check whether an array contains any elements at all
- *
- * browsers.empty? #=> false
- *
- * To check whether a particular item is included in the array
- *
- * browsers.include?('Konqueror') #=> false
- *
- * == Adding Items to Arrays
- *
- * Items can be added to the end of an array by using either #push or #<<
- *
- * arr = [1, 2, 3, 4]
- * arr.push(5) #=> [1, 2, 3, 4, 5]
- * arr << 6 #=> [1, 2, 3, 4, 5, 6]
- *
- * #unshift will add a new item to the beginning of an array.
- *
- * arr.unshift(0) #=> [0, 1, 2, 3, 4, 5, 6]
- *
- * With #insert you can add a new element to an array at any position.
- *
- * arr.insert(3, 'apple') #=> [0, 1, 2, 'apple', 3, 4, 5, 6]
- *
- * Using the #insert method, you can also insert multiple values at once:
- *
- * arr.insert(3, 'orange', 'pear', 'grapefruit')
- * #=> [0, 1, 2, "orange", "pear", "grapefruit", "apple", 3, 4, 5, 6]
- *
- * == Removing Items from an Array
- *
- * The method #pop removes the last element in an array and returns it:
- *
- * arr = [1, 2, 3, 4, 5, 6]
- * arr.pop #=> 6
- * arr #=> [1, 2, 3, 4, 5]
- *
- * To retrieve and at the same time remove the first item, use #shift:
- *
- * arr.shift #=> 1
- * arr #=> [2, 3, 4, 5]
- *
- * To delete an element at a particular index:
- *
- * arr.delete_at(2) #=> 4
- * arr #=> [2, 3, 5]
- *
- * To delete a particular element anywhere in an array, use #delete:
- *
- * arr = [1, 2, 2, 3]
- * arr.delete(2) #=> 2
- * arr #=> [1,3]
- *
- * A useful method if you need to remove +nil+ values from an array is
- * #compact:
- *
- * arr = ['foo', 0, nil, 'bar', 7, 'baz', nil]
- * arr.compact #=> ['foo', 0, 'bar', 7, 'baz']
- * arr #=> ['foo', 0, nil, 'bar', 7, 'baz', nil]
- * arr.compact! #=> ['foo', 0, 'bar', 7, 'baz']
- * arr #=> ['foo', 0, 'bar', 7, 'baz']
- *
- * Another common need is to remove duplicate elements from an array.
- *
- * It has the non-destructive #uniq, and destructive method #uniq!
- *
- * arr = [2, 5, 6, 556, 6, 6, 8, 9, 0, 123, 556]
- * arr.uniq #=> [2, 5, 6, 556, 8, 9, 0, 123]
- *
- * == Iterating over Arrays
- *
- * Like all classes that include the Enumerable module, Array has an each
- * method, which defines what elements should be iterated over and how. In
- * case of Array's #each, all elements in the Array instance are yielded to
- * the supplied block in sequence.
- *
- * Note that this operation leaves the array unchanged.
- *
- * arr = [1, 2, 3, 4, 5]
- * arr.each {|a| print a -= 10, " "}
- * # prints: -9 -8 -7 -6 -5
- * #=> [1, 2, 3, 4, 5]
- *
- * Another sometimes useful iterator is #reverse_each which will iterate over
- * the elements in the array in reverse order.
- *
- * words = %w[first second third fourth fifth sixth]
- * str = ""
- * words.reverse_each {|word| str += "#{word} "}
- * p str #=> "sixth fifth fourth third second first "
- *
- * The #map method can be used to create a new array based on the original
- * array, but with the values modified by the supplied block:
- *
- * arr.map {|a| 2*a} #=> [2, 4, 6, 8, 10]
- * arr #=> [1, 2, 3, 4, 5]
- * arr.map! {|a| a**2} #=> [1, 4, 9, 16, 25]
- * arr #=> [1, 4, 9, 16, 25]
- *
- * == Selecting Items from an Array
- *
- * Elements can be selected from an array according to criteria defined in a
- * block. The selection can happen in a destructive or a non-destructive
- * manner. While the destructive operations will modify the array they were
- * called on, the non-destructive methods usually return a new array with the
- * selected elements, but leave the original array unchanged.
- *
- * === Non-destructive Selection
- *
- * arr = [1, 2, 3, 4, 5, 6]
- * arr.select {|a| a > 3} #=> [4, 5, 6]
- * arr.reject {|a| a < 3} #=> [3, 4, 5, 6]
- * arr.drop_while {|a| a < 4} #=> [4, 5, 6]
- * arr #=> [1, 2, 3, 4, 5, 6]
- *
- * === Destructive Selection
- *
- * #select! and #reject! are the corresponding destructive methods to #select
- * and #reject
- *
- * Similar to #select vs. #reject, #delete_if and #keep_if have the exact
- * opposite result when supplied with the same block:
- *
- * arr.delete_if {|a| a < 4} #=> [4, 5, 6]
- * arr #=> [4, 5, 6]
- *
- * arr = [1, 2, 3, 4, 5, 6]
- * arr.keep_if {|a| a < 4} #=> [1, 2, 3]
- * arr #=> [1, 2, 3]
- *
+/* Arrays are ordered, integer-indexed collections of any object.
+ * Array indexing starts at 0, as in C or Java. A negative index is
+ * assumed to be relative to the end of the array---that is, an index of -1
+ * indicates the last element of the array, -2 is the next to last
+ * element in the array, and so on.
*/
void
-Init_Array(void)
+Init_Array()
{
-#undef rb_intern
-#define rb_intern(str) rb_intern_const(str)
-
rb_cArray = rb_define_class("Array", rb_cObject);
rb_include_module(rb_cArray, rb_mEnumerable);
- rb_define_alloc_func(rb_cArray, empty_ary_alloc);
+ rb_define_alloc_func(rb_cArray, ary_alloc);
rb_define_singleton_method(rb_cArray, "[]", rb_ary_s_create, -1);
- rb_define_singleton_method(rb_cArray, "try_convert", rb_ary_s_try_convert, 1);
rb_define_method(rb_cArray, "initialize", rb_ary_initialize, -1);
rb_define_method(rb_cArray, "initialize_copy", rb_ary_replace, 1);
+ rb_define_method(rb_cArray, "to_s", rb_ary_to_s, 0);
rb_define_method(rb_cArray, "inspect", rb_ary_inspect, 0);
- rb_define_alias(rb_cArray, "to_s", "inspect");
rb_define_method(rb_cArray, "to_a", rb_ary_to_a, 0);
- rb_define_method(rb_cArray, "to_h", rb_ary_to_h, 0);
rb_define_method(rb_cArray, "to_ary", rb_ary_to_ary_m, 0);
+ rb_define_method(rb_cArray, "frozen?", rb_ary_frozen_p, 0);
rb_define_method(rb_cArray, "==", rb_ary_equal, 1);
rb_define_method(rb_cArray, "eql?", rb_ary_eql, 1);
@@ -6954,17 +2949,12 @@ Init_Array(void)
rb_define_method(rb_cArray, "fetch", rb_ary_fetch, -1);
rb_define_method(rb_cArray, "first", rb_ary_first, -1);
rb_define_method(rb_cArray, "last", rb_ary_last, -1);
- rb_define_method(rb_cArray, "concat", rb_ary_concat_multi, -1);
- rb_define_method(rb_cArray, "union", rb_ary_union_multi, -1);
- rb_define_method(rb_cArray, "difference", rb_ary_difference_multi, -1);
- rb_define_method(rb_cArray, "intersection", rb_ary_intersection_multi, -1);
+ rb_define_method(rb_cArray, "concat", rb_ary_concat, 1);
rb_define_method(rb_cArray, "<<", rb_ary_push, 1);
rb_define_method(rb_cArray, "push", rb_ary_push_m, -1);
- rb_define_alias(rb_cArray, "append", "push");
- rb_define_method(rb_cArray, "pop", rb_ary_pop_m, -1);
- rb_define_method(rb_cArray, "shift", rb_ary_shift_m, -1);
+ rb_define_method(rb_cArray, "pop", rb_ary_pop, 0);
+ rb_define_method(rb_cArray, "shift", rb_ary_shift, 0);
rb_define_method(rb_cArray, "unshift", rb_ary_unshift_m, -1);
- rb_define_alias(rb_cArray, "prepend", "unshift");
rb_define_method(rb_cArray, "insert", rb_ary_insert, -1);
rb_define_method(rb_cArray, "each", rb_ary_each, 0);
rb_define_method(rb_cArray, "each_index", rb_ary_each_index, 0);
@@ -6972,26 +2962,20 @@ Init_Array(void)
rb_define_method(rb_cArray, "length", rb_ary_length, 0);
rb_define_alias(rb_cArray, "size", "length");
rb_define_method(rb_cArray, "empty?", rb_ary_empty_p, 0);
- rb_define_method(rb_cArray, "find_index", rb_ary_index, -1);
- rb_define_method(rb_cArray, "index", rb_ary_index, -1);
- rb_define_method(rb_cArray, "rindex", rb_ary_rindex, -1);
+ rb_define_method(rb_cArray, "index", rb_ary_index, 1);
+ rb_define_method(rb_cArray, "rindex", rb_ary_rindex, 1);
+ rb_define_method(rb_cArray, "indexes", rb_ary_indexes, -1);
+ rb_define_method(rb_cArray, "indices", rb_ary_indexes, -1);
rb_define_method(rb_cArray, "join", rb_ary_join_m, -1);
rb_define_method(rb_cArray, "reverse", rb_ary_reverse_m, 0);
rb_define_method(rb_cArray, "reverse!", rb_ary_reverse_bang, 0);
- rb_define_method(rb_cArray, "rotate", rb_ary_rotate_m, -1);
- rb_define_method(rb_cArray, "rotate!", rb_ary_rotate_bang, -1);
rb_define_method(rb_cArray, "sort", rb_ary_sort, 0);
rb_define_method(rb_cArray, "sort!", rb_ary_sort_bang, 0);
- rb_define_method(rb_cArray, "sort_by!", rb_ary_sort_by_bang, 0);
rb_define_method(rb_cArray, "collect", rb_ary_collect, 0);
rb_define_method(rb_cArray, "collect!", rb_ary_collect_bang, 0);
rb_define_method(rb_cArray, "map", rb_ary_collect, 0);
rb_define_method(rb_cArray, "map!", rb_ary_collect_bang, 0);
- rb_define_method(rb_cArray, "select", rb_ary_select, 0);
- rb_define_method(rb_cArray, "select!", rb_ary_select_bang, 0);
- rb_define_method(rb_cArray, "filter", rb_ary_select, 0);
- rb_define_method(rb_cArray, "filter!", rb_ary_select_bang, 0);
- rb_define_method(rb_cArray, "keep_if", rb_ary_keep_if, 0);
+ rb_define_method(rb_cArray, "select", rb_ary_select, -1);
rb_define_method(rb_cArray, "values_at", rb_ary_values_at, -1);
rb_define_method(rb_cArray, "delete", rb_ary_delete, 1);
rb_define_method(rb_cArray, "delete_at", rb_ary_delete_at_m, 1);
@@ -7019,41 +3003,14 @@ Init_Array(void)
rb_define_method(rb_cArray, "&", rb_ary_and, 1);
rb_define_method(rb_cArray, "|", rb_ary_or, 1);
- rb_define_method(rb_cArray, "max", rb_ary_max, -1);
- rb_define_method(rb_cArray, "min", rb_ary_min, -1);
- rb_define_method(rb_cArray, "minmax", rb_ary_minmax, 0);
-
rb_define_method(rb_cArray, "uniq", rb_ary_uniq, 0);
rb_define_method(rb_cArray, "uniq!", rb_ary_uniq_bang, 0);
rb_define_method(rb_cArray, "compact", rb_ary_compact, 0);
rb_define_method(rb_cArray, "compact!", rb_ary_compact_bang, 0);
- rb_define_method(rb_cArray, "flatten", rb_ary_flatten, -1);
- rb_define_method(rb_cArray, "flatten!", rb_ary_flatten_bang, -1);
- rb_define_method(rb_cArray, "count", rb_ary_count, -1);
- rb_define_method(rb_cArray, "shuffle!", rb_ary_shuffle_bang, -1);
- rb_define_method(rb_cArray, "shuffle", rb_ary_shuffle, -1);
- rb_define_method(rb_cArray, "sample", rb_ary_sample, -1);
- rb_define_method(rb_cArray, "cycle", rb_ary_cycle, -1);
- rb_define_method(rb_cArray, "permutation", rb_ary_permutation, -1);
- rb_define_method(rb_cArray, "combination", rb_ary_combination, 1);
- rb_define_method(rb_cArray, "repeated_permutation", rb_ary_repeated_permutation, 1);
- rb_define_method(rb_cArray, "repeated_combination", rb_ary_repeated_combination, 1);
- rb_define_method(rb_cArray, "product", rb_ary_product, -1);
-
- rb_define_method(rb_cArray, "take", rb_ary_take, 1);
- rb_define_method(rb_cArray, "take_while", rb_ary_take_while, 0);
- rb_define_method(rb_cArray, "drop", rb_ary_drop, 1);
- rb_define_method(rb_cArray, "drop_while", rb_ary_drop_while, 0);
- rb_define_method(rb_cArray, "bsearch", rb_ary_bsearch, 0);
- rb_define_method(rb_cArray, "bsearch_index", rb_ary_bsearch_index, 0);
- rb_define_method(rb_cArray, "any?", rb_ary_any_p, -1);
- rb_define_method(rb_cArray, "all?", rb_ary_all_p, -1);
- rb_define_method(rb_cArray, "none?", rb_ary_none_p, -1);
- rb_define_method(rb_cArray, "one?", rb_ary_one_p, -1);
- rb_define_method(rb_cArray, "dig", rb_ary_dig, -1);
- rb_define_method(rb_cArray, "sum", rb_ary_sum, -1);
-
- rb_define_method(rb_cArray, "deconstruct", rb_ary_deconstruct, 0);
-
- id_random = rb_intern("random");
+ rb_define_method(rb_cArray, "flatten", rb_ary_flatten, 0);
+ rb_define_method(rb_cArray, "flatten!", rb_ary_flatten_bang, 0);
+ rb_define_method(rb_cArray, "nitems", rb_ary_nitems, 0);
+
+ id_cmp = rb_intern("<=>");
+ inspect_key = rb_intern("__inspect_key__");
}
diff --git a/ast.c b/ast.c
deleted file mode 100644
index a0c026229c..0000000000
--- a/ast.c
+++ /dev/null
@@ -1,694 +0,0 @@
-/* indent-tabs-mode: nil */
-#include "ruby.h"
-#include "ruby/encoding.h"
-#include "ruby/util.h"
-#include "internal.h"
-#include "node.h"
-#include "vm_core.h"
-#include "iseq.h"
-#include "builtin.h"
-
-static VALUE rb_mAST;
-static VALUE rb_cNode;
-
-struct ASTNodeData {
- rb_ast_t *ast;
- NODE *node;
-};
-
-static void
-node_gc_mark(void *ptr)
-{
- struct ASTNodeData *data = (struct ASTNodeData *)ptr;
- rb_gc_mark((VALUE)data->ast);
-}
-
-static size_t
-node_memsize(const void *ptr)
-{
- struct ASTNodeData *data = (struct ASTNodeData *)ptr;
- return rb_ast_memsize(data->ast);
-}
-
-static const rb_data_type_t rb_node_type = {
- "AST/node",
- {node_gc_mark, RUBY_TYPED_DEFAULT_FREE, node_memsize,},
- 0, 0,
- RUBY_TYPED_FREE_IMMEDIATELY,
-};
-
-static VALUE rb_ast_node_alloc(VALUE klass);
-
-static void
-setup_node(VALUE obj, rb_ast_t *ast, NODE *node)
-{
- struct ASTNodeData *data;
-
- TypedData_Get_Struct(obj, struct ASTNodeData, &rb_node_type, data);
- data->ast = ast;
- data->node = node;
-}
-
-static VALUE
-ast_new_internal(rb_ast_t *ast, NODE *node)
-{
- VALUE obj;
-
- obj = rb_ast_node_alloc(rb_cNode);
- setup_node(obj, ast, node);
-
- return obj;
-}
-
-static VALUE rb_ast_parse_str(VALUE str);
-static VALUE rb_ast_parse_file(VALUE path);
-static VALUE rb_ast_parse_array(VALUE array);
-
-static VALUE
-ast_parse_new(void)
-{
- return rb_parser_set_context(rb_parser_new(), NULL, 0);
-}
-
-static VALUE
-ast_parse_done(rb_ast_t *ast)
-{
- if (!ast->body.root) {
- rb_ast_dispose(ast);
- rb_exc_raise(GET_EC()->errinfo);
- }
-
- return ast_new_internal(ast, (NODE *)ast->body.root);
-}
-
-static VALUE
-ast_s_parse(rb_execution_context_t *ec, VALUE module, VALUE str)
-{
- return rb_ast_parse_str(str);
-}
-
-static VALUE
-rb_ast_parse_str(VALUE str)
-{
- rb_ast_t *ast = 0;
-
- StringValue(str);
- ast = rb_parser_compile_string_path(ast_parse_new(), Qnil, str, 1);
- return ast_parse_done(ast);
-}
-
-static VALUE
-ast_s_parse_file(rb_execution_context_t *ec, VALUE module, VALUE path)
-{
- return rb_ast_parse_file(path);
-}
-
-static VALUE
-rb_ast_parse_file(VALUE path)
-{
- VALUE f;
- rb_ast_t *ast = 0;
- rb_encoding *enc = rb_utf8_encoding();
-
- FilePathValue(path);
- f = rb_file_open_str(path, "r");
- rb_funcall(f, rb_intern("set_encoding"), 2, rb_enc_from_encoding(enc), rb_str_new_cstr("-"));
- ast = rb_parser_compile_file_path(ast_parse_new(), Qnil, f, 1);
- rb_io_close(f);
- return ast_parse_done(ast);
-}
-
-static VALUE
-lex_array(VALUE array, int index)
-{
- VALUE str = rb_ary_entry(array, index);
- if (!NIL_P(str)) {
- StringValue(str);
- if (!rb_enc_asciicompat(rb_enc_get(str))) {
- rb_raise(rb_eArgError, "invalid source encoding");
- }
- }
- return str;
-}
-
-static VALUE
-rb_ast_parse_array(VALUE array)
-{
- rb_ast_t *ast = 0;
-
- array = rb_check_array_type(array);
- ast = rb_parser_compile_generic(ast_parse_new(), lex_array, Qnil, array, 1);
- return ast_parse_done(ast);
-}
-
-static VALUE node_children(rb_ast_t*, NODE*);
-
-static VALUE
-node_find(VALUE self, const int node_id)
-{
- VALUE ary;
- long i;
- struct ASTNodeData *data;
- TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
-
- if (nd_node_id(data->node) == node_id) return self;
-
- ary = node_children(data->ast, data->node);
-
- for (i = 0; i < RARRAY_LEN(ary); i++) {
- VALUE child = RARRAY_AREF(ary, i);
-
- if (CLASS_OF(child) == rb_cNode) {
- VALUE result = node_find(child, node_id);
- if (RTEST(result)) return result;
- }
- }
-
- return Qnil;
-}
-
-extern VALUE rb_e_script;
-
-static VALUE
-script_lines(VALUE path)
-{
- VALUE hash, lines;
- ID script_lines;
- CONST_ID(script_lines, "SCRIPT_LINES__");
- if (!rb_const_defined_at(rb_cObject, script_lines)) return Qnil;
- hash = rb_const_get_at(rb_cObject, script_lines);
- if (!RB_TYPE_P(hash, T_HASH)) return Qnil;
- lines = rb_hash_lookup(hash, path);
- if (!RB_TYPE_P(lines, T_ARRAY)) return Qnil;
- return lines;
-}
-
-static VALUE
-ast_s_of(rb_execution_context_t *ec, VALUE module, VALUE body)
-{
- VALUE path, node, lines;
- int node_id;
- const rb_iseq_t *iseq = NULL;
-
- if (rb_obj_is_proc(body)) {
- iseq = vm_proc_iseq(body);
-
- if (!rb_obj_is_iseq((VALUE)iseq)) {
- iseq = NULL;
- }
- }
- else {
- iseq = rb_method_iseq(body);
- }
-
- if (!iseq) return Qnil;
-
- path = rb_iseq_path(iseq);
- node_id = iseq->body->location.node_id;
- if (!NIL_P(lines = script_lines(path))) {
- node = rb_ast_parse_array(lines);
- }
- else if (RSTRING_LEN(path) == 2 && memcmp(RSTRING_PTR(path), "-e", 2) == 0) {
- node = rb_ast_parse_str(rb_e_script);
- }
- else {
- node = rb_ast_parse_file(path);
- }
-
- return node_find(node, node_id);
-}
-
-static VALUE
-rb_ast_node_alloc(VALUE klass)
-{
- struct ASTNodeData *data;
- VALUE obj = TypedData_Make_Struct(klass, struct ASTNodeData, &rb_node_type, data);
-
- return obj;
-}
-
-static const char*
-node_type_to_str(const NODE *node)
-{
- return (ruby_node_name(nd_type(node)) + rb_strlen_lit("NODE_"));
-}
-
-static VALUE
-ast_node_type(rb_execution_context_t *ec, VALUE self)
-{
- struct ASTNodeData *data;
- TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
-
- return rb_sym_intern_ascii_cstr(node_type_to_str(data->node));
-}
-
-#define NEW_CHILD(ast, node) node ? ast_new_internal(ast, node) : Qnil
-
-static VALUE
-rb_ary_new_from_node_args(rb_ast_t *ast, long n, ...)
-{
- va_list ar;
- VALUE ary;
- long i;
-
- ary = rb_ary_new2(n);
-
- va_start(ar, n);
- for (i=0; i<n; i++) {
- NODE *node;
- node = va_arg(ar, NODE *);
- rb_ary_push(ary, NEW_CHILD(ast, node));
- }
- va_end(ar);
- return ary;
-}
-
-static VALUE
-dump_block(rb_ast_t *ast, NODE *node)
-{
- VALUE ary = rb_ary_new();
- do {
- rb_ary_push(ary, NEW_CHILD(ast, node->nd_head));
- } while (node->nd_next &&
- nd_type(node->nd_next) == NODE_BLOCK &&
- (node = node->nd_next, 1));
- if (node->nd_next) {
- rb_ary_push(ary, NEW_CHILD(ast, node->nd_next));
- }
-
- return ary;
-}
-
-static VALUE
-dump_array(rb_ast_t *ast, NODE *node)
-{
- VALUE ary = rb_ary_new();
- rb_ary_push(ary, NEW_CHILD(ast, node->nd_head));
-
- while (node->nd_next && nd_type(node->nd_next) == NODE_LIST) {
- node = node->nd_next;
- rb_ary_push(ary, NEW_CHILD(ast, node->nd_head));
- }
- rb_ary_push(ary, NEW_CHILD(ast, node->nd_next));
-
- return ary;
-}
-
-static VALUE
-var_name(ID id)
-{
- if (!id) return Qnil;
- if (!rb_id2str(id)) return Qnil;
- return ID2SYM(id);
-}
-
-static VALUE
-node_children(rb_ast_t *ast, NODE *node)
-{
- char name[DECIMAL_SIZE_OF_BITS(sizeof(long) * CHAR_BIT) + 2]; /* including '$' */
-
- enum node_type type = nd_type(node);
- switch (type) {
- case NODE_BLOCK:
- return dump_block(ast, node);
- case NODE_IF:
- return rb_ary_new_from_node_args(ast, 3, node->nd_cond, node->nd_body, node->nd_else);
- case NODE_UNLESS:
- return rb_ary_new_from_node_args(ast, 3, node->nd_cond, node->nd_body, node->nd_else);
- case NODE_CASE:
- return rb_ary_new_from_node_args(ast, 2, node->nd_head, node->nd_body);
- case NODE_CASE2:
- return rb_ary_new_from_node_args(ast, 2, node->nd_head, node->nd_body);
- case NODE_CASE3:
- return rb_ary_new_from_node_args(ast, 2, node->nd_head, node->nd_body);
- case NODE_WHEN:
- return rb_ary_new_from_node_args(ast, 3, node->nd_head, node->nd_body, node->nd_next);
- case NODE_IN:
- return rb_ary_new_from_node_args(ast, 3, node->nd_head, node->nd_body, node->nd_next);
- case NODE_WHILE:
- goto loop;
- case NODE_UNTIL:
- loop:
- return rb_ary_push(rb_ary_new_from_node_args(ast, 2, node->nd_cond, node->nd_body),
- (node->nd_state ? Qtrue : Qfalse));
- case NODE_ITER:
- case NODE_FOR:
- return rb_ary_new_from_node_args(ast, 2, node->nd_iter, node->nd_body);
- case NODE_FOR_MASGN:
- return rb_ary_new_from_node_args(ast, 1, node->nd_var);
- case NODE_BREAK:
- goto jump;
- case NODE_NEXT:
- goto jump;
- case NODE_RETURN:
- jump:
- return rb_ary_new_from_node_args(ast, 1, node->nd_stts);
- case NODE_REDO:
- return rb_ary_new_from_node_args(ast, 0);
- case NODE_RETRY:
- return rb_ary_new_from_node_args(ast, 0);
- case NODE_BEGIN:
- return rb_ary_new_from_node_args(ast, 1, node->nd_body);
- case NODE_RESCUE:
- return rb_ary_new_from_node_args(ast, 3, node->nd_head, node->nd_resq, node->nd_else);
- case NODE_RESBODY:
- return rb_ary_new_from_node_args(ast, 3, node->nd_args, node->nd_body, node->nd_head);
- case NODE_ENSURE:
- return rb_ary_new_from_node_args(ast, 2, node->nd_head, node->nd_ensr);
- case NODE_AND:
- goto andor;
- case NODE_OR:
- andor:
- {
- VALUE ary = rb_ary_new();
-
- while (1) {
- rb_ary_push(ary, NEW_CHILD(ast, node->nd_1st));
- if (!node->nd_2nd || nd_type(node->nd_2nd) != (int)type)
- break;
- node = node->nd_2nd;
- }
- rb_ary_push(ary, NEW_CHILD(ast, node->nd_2nd));
- return ary;
- }
- case NODE_MASGN:
- if (NODE_NAMED_REST_P(node->nd_args)) {
- return rb_ary_new_from_node_args(ast, 3, node->nd_value, node->nd_head, node->nd_args);
- }
- else {
- return rb_ary_new_from_args(3, NEW_CHILD(ast, node->nd_value),
- NEW_CHILD(ast, node->nd_head),
- ID2SYM(rb_intern("NODE_SPECIAL_NO_NAME_REST")));
- }
- case NODE_LASGN:
- goto asgn;
- case NODE_DASGN:
- goto asgn;
- case NODE_DASGN_CURR:
- goto asgn;
- case NODE_IASGN:
- goto asgn;
- case NODE_CVASGN:
- asgn:
- if (NODE_REQUIRED_KEYWORD_P(node)) {
- return rb_ary_new_from_args(2, var_name(node->nd_vid), ID2SYM(rb_intern("NODE_SPECIAL_REQUIRED_KEYWORD")));
- }
- return rb_ary_new_from_args(2, var_name(node->nd_vid), NEW_CHILD(ast, node->nd_value));
- case NODE_GASGN:
- goto asgn;
- case NODE_CDECL:
- if (node->nd_vid) {
- return rb_ary_new_from_args(2, ID2SYM(node->nd_vid), NEW_CHILD(ast, node->nd_value));
- }
- return rb_ary_new_from_args(3, NEW_CHILD(ast, node->nd_else), ID2SYM(node->nd_else->nd_mid), NEW_CHILD(ast, node->nd_value));
- case NODE_OP_ASGN1:
- return rb_ary_new_from_args(4, NEW_CHILD(ast, node->nd_recv),
- ID2SYM(node->nd_mid),
- NEW_CHILD(ast, node->nd_args->nd_head),
- NEW_CHILD(ast, node->nd_args->nd_body));
- case NODE_OP_ASGN2:
- return rb_ary_new_from_args(5, NEW_CHILD(ast, node->nd_recv),
- node->nd_next->nd_aid ? Qtrue : Qfalse,
- ID2SYM(node->nd_next->nd_vid),
- ID2SYM(node->nd_next->nd_mid),
- NEW_CHILD(ast, node->nd_value));
- case NODE_OP_ASGN_AND:
- return rb_ary_new_from_args(3, NEW_CHILD(ast, node->nd_head), ID2SYM(idANDOP),
- NEW_CHILD(ast, node->nd_value));
- case NODE_OP_ASGN_OR:
- return rb_ary_new_from_args(3, NEW_CHILD(ast, node->nd_head), ID2SYM(idOROP),
- NEW_CHILD(ast, node->nd_value));
- case NODE_OP_CDECL:
- return rb_ary_new_from_args(3, NEW_CHILD(ast, node->nd_head),
- ID2SYM(node->nd_aid),
- NEW_CHILD(ast, node->nd_value));
- case NODE_CALL:
- case NODE_OPCALL:
- case NODE_QCALL:
- return rb_ary_new_from_args(3, NEW_CHILD(ast, node->nd_recv),
- ID2SYM(node->nd_mid),
- NEW_CHILD(ast, node->nd_args));
- case NODE_FCALL:
- return rb_ary_new_from_args(2, ID2SYM(node->nd_mid),
- NEW_CHILD(ast, node->nd_args));
- case NODE_VCALL:
- return rb_ary_new_from_args(1, ID2SYM(node->nd_mid));
- case NODE_SUPER:
- return rb_ary_new_from_node_args(ast, 1, node->nd_args);
- case NODE_ZSUPER:
- return rb_ary_new_from_node_args(ast, 0);
- case NODE_LIST:
- goto ary;
- case NODE_VALUES:
- ary:
- return dump_array(ast, node);
- case NODE_ZLIST:
- return rb_ary_new_from_node_args(ast, 0);
- case NODE_HASH:
- return rb_ary_new_from_node_args(ast, 1, node->nd_head);
- case NODE_YIELD:
- return rb_ary_new_from_node_args(ast, 1, node->nd_head);
- case NODE_LVAR:
- case NODE_DVAR:
- return rb_ary_new_from_args(1, var_name(node->nd_vid));
- case NODE_IVAR:
- case NODE_CONST:
- case NODE_CVAR:
- case NODE_GVAR:
- return rb_ary_new_from_args(1, ID2SYM(node->nd_vid));
- case NODE_NTH_REF:
- snprintf(name, sizeof(name), "$%ld", node->nd_nth);
- return rb_ary_new_from_args(1, ID2SYM(rb_intern(name)));
- case NODE_BACK_REF:
- name[0] = '$';
- name[1] = (char)node->nd_nth;
- name[2] = '\0';
- return rb_ary_new_from_args(1, ID2SYM(rb_intern(name)));
- case NODE_MATCH:
- goto lit;
- case NODE_MATCH2:
- if (node->nd_args) {
- return rb_ary_new_from_node_args(ast, 3, node->nd_recv, node->nd_value, node->nd_args);
- }
- return rb_ary_new_from_node_args(ast, 2, node->nd_recv, node->nd_value);
- case NODE_MATCH3:
- return rb_ary_new_from_node_args(ast, 2, node->nd_recv, node->nd_value);
- case NODE_LIT:
- goto lit;
- case NODE_STR:
- goto lit;
- case NODE_XSTR:
- lit:
- return rb_ary_new_from_args(1, node->nd_lit);
- case NODE_ONCE:
- return rb_ary_new_from_node_args(ast, 1, node->nd_body);
- case NODE_DSTR:
- goto dlit;
- case NODE_DXSTR:
- goto dlit;
- case NODE_DREGX:
- goto dlit;
- case NODE_DSYM:
- dlit:
- return rb_ary_new_from_args(3, node->nd_lit,
- NEW_CHILD(ast, node->nd_next->nd_head),
- NEW_CHILD(ast, node->nd_next->nd_next));
- case NODE_EVSTR:
- return rb_ary_new_from_node_args(ast, 1, node->nd_body);
- case NODE_ARGSCAT:
- return rb_ary_new_from_node_args(ast, 2, node->nd_head, node->nd_body);
- case NODE_ARGSPUSH:
- return rb_ary_new_from_node_args(ast, 2, node->nd_head, node->nd_body);
- case NODE_SPLAT:
- return rb_ary_new_from_node_args(ast, 1, node->nd_head);
- case NODE_BLOCK_PASS:
- return rb_ary_new_from_node_args(ast, 2, node->nd_head, node->nd_body);
- case NODE_DEFN:
- return rb_ary_new_from_args(2, ID2SYM(node->nd_mid), NEW_CHILD(ast, node->nd_defn));
- case NODE_DEFS:
- return rb_ary_new_from_args(3, NEW_CHILD(ast, node->nd_recv), ID2SYM(node->nd_mid), NEW_CHILD(ast, node->nd_defn));
- case NODE_ALIAS:
- return rb_ary_new_from_node_args(ast, 2, node->nd_1st, node->nd_2nd);
- case NODE_VALIAS:
- return rb_ary_new_from_args(2, ID2SYM(node->nd_alias), ID2SYM(node->nd_orig));
- case NODE_UNDEF:
- return rb_ary_new_from_node_args(ast, 1, node->nd_undef);
- case NODE_CLASS:
- return rb_ary_new_from_node_args(ast, 3, node->nd_cpath, node->nd_super, node->nd_body);
- case NODE_MODULE:
- return rb_ary_new_from_node_args(ast, 2, node->nd_cpath, node->nd_body);
- case NODE_SCLASS:
- return rb_ary_new_from_node_args(ast, 2, node->nd_recv, node->nd_body);
- case NODE_COLON2:
- return rb_ary_new_from_args(2, NEW_CHILD(ast, node->nd_head), ID2SYM(node->nd_mid));
- case NODE_COLON3:
- return rb_ary_new_from_args(1, ID2SYM(node->nd_mid));
- case NODE_DOT2:
- goto dot;
- case NODE_DOT3:
- goto dot;
- case NODE_FLIP2:
- goto dot;
- case NODE_FLIP3:
- dot:
- return rb_ary_new_from_node_args(ast, 2, node->nd_beg, node->nd_end);
- case NODE_SELF:
- return rb_ary_new_from_node_args(ast, 0);
- case NODE_NIL:
- return rb_ary_new_from_node_args(ast, 0);
- case NODE_TRUE:
- return rb_ary_new_from_node_args(ast, 0);
- case NODE_FALSE:
- return rb_ary_new_from_node_args(ast, 0);
- case NODE_ERRINFO:
- return rb_ary_new_from_node_args(ast, 0);
- case NODE_DEFINED:
- return rb_ary_new_from_node_args(ast, 1, node->nd_head);
- case NODE_POSTEXE:
- return rb_ary_new_from_node_args(ast, 1, node->nd_body);
- case NODE_ATTRASGN:
- return rb_ary_new_from_args(3, NEW_CHILD(ast, node->nd_recv), ID2SYM(node->nd_mid), NEW_CHILD(ast, node->nd_args));
- case NODE_LAMBDA:
- return rb_ary_new_from_node_args(ast, 1, node->nd_body);
- case NODE_OPT_ARG:
- return rb_ary_new_from_node_args(ast, 2, node->nd_body, node->nd_next);
- case NODE_KW_ARG:
- return rb_ary_new_from_node_args(ast, 2, node->nd_body, node->nd_next);
- case NODE_POSTARG:
- if (NODE_NAMED_REST_P(node->nd_1st)) {
- return rb_ary_new_from_node_args(ast, 2, node->nd_1st, node->nd_2nd);
- }
- return rb_ary_new_from_args(2, ID2SYM(rb_intern("NODE_SPECIAL_NO_NAME_REST")),
- NEW_CHILD(ast, node->nd_2nd));
- case NODE_ARGS:
- {
- struct rb_args_info *ainfo = node->nd_ainfo;
- return rb_ary_new_from_args(10,
- INT2NUM(ainfo->pre_args_num),
- NEW_CHILD(ast, ainfo->pre_init),
- NEW_CHILD(ast, ainfo->opt_args),
- var_name(ainfo->first_post_arg),
- INT2NUM(ainfo->post_args_num),
- NEW_CHILD(ast, ainfo->post_init),
- (ainfo->rest_arg == NODE_SPECIAL_EXCESSIVE_COMMA
- ? ID2SYM(rb_intern("NODE_SPECIAL_EXCESSIVE_COMMA"))
- : var_name(ainfo->rest_arg)),
- (ainfo->no_kwarg ? Qfalse : NEW_CHILD(ast, ainfo->kw_args)),
- (ainfo->no_kwarg ? Qfalse : NEW_CHILD(ast, ainfo->kw_rest_arg)),
- var_name(ainfo->block_arg));
- }
- case NODE_SCOPE:
- {
- ID *tbl = node->nd_tbl;
- int i, size = tbl ? (int)*tbl++ : 0;
- VALUE locals = rb_ary_new_capa(size);
- for (i = 0; i < size; i++) {
- rb_ary_push(locals, var_name(tbl[i]));
- }
- return rb_ary_new_from_args(3, locals, NEW_CHILD(ast, node->nd_args), NEW_CHILD(ast, node->nd_body));
- }
- case NODE_ARYPTN:
- {
- struct rb_ary_pattern_info *apinfo = node->nd_apinfo;
- VALUE rest = NODE_NAMED_REST_P(apinfo->rest_arg) ? NEW_CHILD(ast, apinfo->rest_arg) :
- ID2SYM(rb_intern("NODE_SPECIAL_NO_NAME_REST"));
- return rb_ary_new_from_args(4,
- NEW_CHILD(ast, node->nd_pconst),
- NEW_CHILD(ast, apinfo->pre_args),
- rest,
- NEW_CHILD(ast, apinfo->post_args));
- }
- case NODE_HSHPTN:
- {
- VALUE kwrest = node->nd_pkwrestarg == NODE_SPECIAL_NO_REST_KEYWORD ? ID2SYM(rb_intern("NODE_SPECIAL_NO_REST_KEYWORD")) :
- NEW_CHILD(ast, node->nd_pkwrestarg);
-
- return rb_ary_new_from_args(3,
- NEW_CHILD(ast, node->nd_pconst),
- NEW_CHILD(ast, node->nd_pkwargs),
- kwrest);
- }
- case NODE_ARGS_AUX:
- case NODE_LAST:
- break;
- }
-
- rb_bug("node_children: unknown node: %s", ruby_node_name(type));
-}
-
-static VALUE
-ast_node_children(rb_execution_context_t *ec, VALUE self)
-{
- struct ASTNodeData *data;
- TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
-
- return node_children(data->ast, data->node);
-}
-
-static VALUE
-ast_node_first_lineno(rb_execution_context_t *ec, VALUE self)
-{
- struct ASTNodeData *data;
- TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
-
- return INT2NUM(nd_first_lineno(data->node));
-}
-
-static VALUE
-ast_node_first_column(rb_execution_context_t *ec, VALUE self)
-{
- struct ASTNodeData *data;
- TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
-
- return INT2NUM(nd_first_column(data->node));
-}
-
-static VALUE
-ast_node_last_lineno(rb_execution_context_t *ec, VALUE self)
-{
- struct ASTNodeData *data;
- TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
-
- return INT2NUM(nd_last_lineno(data->node));
-}
-
-static VALUE
-ast_node_last_column(rb_execution_context_t *ec, VALUE self)
-{
- struct ASTNodeData *data;
- TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
-
- return INT2NUM(nd_last_column(data->node));
-}
-
-static VALUE
-ast_node_inspect(rb_execution_context_t *ec, VALUE self)
-{
- VALUE str;
- VALUE cname;
- struct ASTNodeData *data;
- TypedData_Get_Struct(self, struct ASTNodeData, &rb_node_type, data);
-
- cname = rb_class_path(rb_obj_class(self));
- str = rb_str_new2("#<");
-
- rb_str_append(str, cname);
- rb_str_catf(str, ":%s@%d:%d-%d:%d>",
- node_type_to_str(data->node),
- nd_first_lineno(data->node), nd_first_column(data->node),
- nd_last_lineno(data->node), nd_last_column(data->node));
-
- return str;
-}
-
-#include "ast.rbinc"
-
-void
-Init_ast(void)
-{
- rb_mAST = rb_define_module_under(rb_cRubyVM, "AbstractSyntaxTree");
- rb_cNode = rb_define_class_under(rb_mAST, "Node", rb_cObject);
- rb_undef_alloc_func(rb_cNode);
-
- load_ast();
-}
diff --git a/ast.rb b/ast.rb
deleted file mode 100644
index 1fedf76649..0000000000
--- a/ast.rb
+++ /dev/null
@@ -1,144 +0,0 @@
-# for ast.c
-
-class RubyVM
-
- # AbstractSyntaxTree provides methods to parse Ruby code into
- # abstract syntax trees. The nodes in the tree
- # are instances of RubyVM::AbstractSyntaxTree::Node.
- #
- # This class is MRI specific as it exposes implementation details
- # of the MRI abstract syntax tree.
- #
- # This class is experimental and its API is not stable, therefore it might
- # change without notice. As examples, the order of children nodes is not
- # guaranteed, the number of children nodes might change, there is no way to
- # access children nodes by name, etc.
- #
- # If you are looking for a stable API or an API working under multiple Ruby
- # implementations, consider using the _parser_ gem or Ripper. If you would
- # like to make RubyVM::AbstractSyntaxTree stable, please join the discussion
- # at https://bugs.ruby-lang.org/issues/14844.
- #
- module AbstractSyntaxTree
-
- # call-seq:
- # RubyVM::AbstractSyntaxTree.parse(string) -> RubyVM::AbstractSyntaxTree::Node
- #
- # Parses the given _string_ into an abstract syntax tree,
- # returning the root node of that tree.
- #
- # SyntaxError is raised if the given _string_ is invalid syntax.
- #
- # RubyVM::AbstractSyntaxTree.parse("x = 1 + 2")
- # # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:0-1:9>
- def self.parse string
- __builtin_ast_s_parse string
- end
-
- # call-seq:
- # RubyVM::AbstractSyntaxTree.parse_file(pathname) -> RubyVM::AbstractSyntaxTree::Node
- #
- # Reads the file from _pathname_, then parses it like ::parse,
- # returning the root node of the abstract syntax tree.
- #
- # SyntaxError is raised if _pathname_'s contents are not
- # valid Ruby syntax.
- #
- # RubyVM::AbstractSyntaxTree.parse_file("my-app/app.rb")
- # # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:0-31:3>
- def self.parse_file pathname
- __builtin_ast_s_parse_file pathname
- end
-
- # call-seq:
- # RubyVM::AbstractSyntaxTree.of(proc) -> RubyVM::AbstractSyntaxTree::Node
- # RubyVM::AbstractSyntaxTree.of(method) -> RubyVM::AbstractSyntaxTree::Node
- #
- # Returns AST nodes of the given _proc_ or _method_.
- #
- # RubyVM::AbstractSyntaxTree.of(proc {1 + 2})
- # # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:35-1:42>
- #
- # def hello
- # puts "hello, world"
- # end
- #
- # RubyVM::AbstractSyntaxTree.of(method(:hello))
- # # => #<RubyVM::AbstractSyntaxTree::Node:SCOPE@1:0-3:3>
- def self.of body
- __builtin_ast_s_of body
- end
-
- # RubyVM::AbstractSyntaxTree::Node instances are created by parse methods in
- # RubyVM::AbstractSyntaxTree.
- #
- # This class is MRI specific.
- #
- class Node
-
- # call-seq:
- # node.type -> symbol
- #
- # Returns the type of this node as a symbol.
- #
- # root = RubyVM::AbstractSyntaxTree.parse("x = 1 + 2")
- # root.type # => :SCOPE
- # call = root.children[2]
- # call.type # => :OPCALL
- def type
- __builtin_ast_node_type
- end
-
- # call-seq:
- # node.first_lineno -> integer
- #
- # The line number in the source code where this AST's text began.
- def first_lineno
- __builtin_ast_node_first_lineno
- end
-
- # call-seq:
- # node.first_column -> integer
- #
- # The column number in the source code where this AST's text began.
- def first_column
- __builtin_ast_node_first_column
- end
-
- # call-seq:
- # node.last_lineno -> integer
- #
- # The line number in the source code where this AST's text ended.
- def last_lineno
- __builtin_ast_node_last_lineno
- end
-
- # call-seq:
- # node.last_column -> integer
- #
- # The column number in the source code where this AST's text ended.
- def last_column
- __builtin_ast_node_last_column
- end
-
- # call-seq:
- # node.children -> array
- #
- # Returns AST nodes under this one. Each kind of node
- # has different children, depending on what kind of node it is.
- #
- # The returned array may contain other nodes or <code>nil</code>.
- def children
- __builtin_ast_node_children
- end
-
- # call-seq:
- # node.inspect -> string
- #
- # Returns debugging information about this node as a string.
- def inspect
- __builtin_ast_node_inspect
- end
- end
- end
-end
diff --git a/basictest/runner.rb b/basictest/runner.rb
deleted file mode 100755
index 0f398e7acc..0000000000
--- a/basictest/runner.rb
+++ /dev/null
@@ -1,33 +0,0 @@
-#! ./miniruby
-
-exit if defined?(CROSS_COMPILING) and CROSS_COMPILING
-ruby = ENV["RUBY"]
-unless ruby
- load './rbconfig.rb'
- ruby = "./#{RbConfig::CONFIG['ruby_install_name']}#{RbConfig::CONFIG['EXEEXT']}"
-end
-unless File.exist? ruby
- print "#{ruby} is not found.\n"
- print "Try `make' first, then `make test', please.\n"
- exit false
-end
-ARGV[0] and opt = ARGV[0][/\A--run-opt=(.*)/, 1] and ARGV.shift
-
-$stderr.reopen($stdout)
-error = ''
-
-srcdir = File.expand_path('..', File.dirname(__FILE__))
-if env = ENV["RUBYOPT"]
- ENV["RUBYOPT"] = env + " -W1"
-end
-`#{ruby} #{opt} -W1 #{srcdir}/basictest/test.rb #{ARGV.join(' ')}`.each_line do |line|
- if line =~ /^end of test/
- print "\ntest succeeded\n"
- exit true
- end
- error << line if %r:^(basictest/test.rb|not): =~ line
-end
-puts
-print error
-print "test failed\n"
-exit false
diff --git a/basictest/test.rb b/basictest/test.rb
deleted file mode 100755
index 25a4298234..0000000000
--- a/basictest/test.rb
+++ /dev/null
@@ -1,2360 +0,0 @@
-#! /usr/bin/env ruby
-# -*- coding: us-ascii -*-
-
-$testnum=0
-$ntest=0
-$failed = 0
-class Progress
- def initialize
- @color = nil
- @tty = nil
- @quiet = nil
- @verbose = nil
- ARGV.each do |arg|
- case arg
- when /\A--color(?:=(?:always|(auto)|(never)|(.*)))?\z/
- warn "unknown --color argument: #$3" if $3
- @color = $1 ? nil : !$2
- when /\A--tty(=(?:yes|(no)|(.*)))?\z/
- warn "unknown --tty argument: #$3" if $3
- @tty = !$1 || !$2
- true
- when /\A-(q|-quiet)\z/
- @quiet = true
- when /\A-(v|-verbose)\z/
- @verbose = true
- end
- end
- @tty = STDERR.tty? && !STDOUT.tty? && /dumb/ !~ ENV["TERM"] if @tty.nil?
- @eol = @tty && !@verbose ? "\r\e[K\r" : "\n"
- case @color
- when nil
- @color = @tty
- end
- if @color
- # dircolors-like style
- colors = (colors = ENV['TEST_COLORS']) ? Hash[colors.scan(/(\w+)=([^:\n]*)/)] : {}
- begin
- File.read(File.join(__dir__, "../tool/colors")).scan(/(\w+)=([^:\n]*)/) do |n, c|
- colors[n] ||= c
- end
- rescue
- end
- @passed = "\e[;#{colors["pass"] || "32"}m"
- @failed = "\e[;#{colors["fail"] || "31"}m"
- @reset = "\e[m"
- else
- @passed = @failed = @reset = ""
- end
- extend(Rotator) if @tty
- end
-
- def passed_string
- "."
- end
- def failed_string
- "#{@failed}F#{@reset}"
- end
- def init_string
- end
- def finish_string
- if @quiet
- @eol
- else
- "#{@passed}#{@ok ? 'OK' : ''} #{$testnum}#{@reset}#{@eol}"
- end
- end
- def pass
- STDERR.print passed_string
- end
- def fail
- @ok = false
- STDERR.print failed_string
- end
- def init
- @ok = true
- STDERR.print init_string
- end
- def finish
- STDERR.print finish_string
- end
-
- module Rotator
- ROTATOR = %w[- \\ | /]
- BS = "\b" * ROTATOR[0].size
- def passed_string
- "#{BS}#{ROTATOR[(@count += 1) % ROTATOR.size]}"
- end
- def failed_string
- "#{BS}#{super}#{ROTATOR[@count % ROTATOR.size]}"
- end
- def init_string
- @count = 0
- " "
- end
- def finish_string
- s = "#{BS}#{' ' * BS.size}#{BS}#{super}"
- s.gsub!(/\n/, "\r\e[2K\r") if @quiet
- s
- end
- end
-end
-PROGRESS = Progress.new
-
-def test_check(what)
- unless $ntest.zero?
- PROGRESS.finish
- end
- STDERR.print "#{$0}:#{what} "
- PROGRESS.init
- $what = what
- $testnum = 0
-end
-
-def test_ok(cond,n=1)
- $testnum+=1
- $ntest+=1
- where = (st = caller(n)) ? st[0] : "caller error! (n=#{n}, trace=#{caller(0).join(', ')}"
- if cond
- PROGRESS.pass
- printf "ok %d (%s)\n", $testnum, where
- else
- PROGRESS.fail
- printf "not ok %s %d -- %s\n", $what, $testnum, where
- $failed+=1
- end
- STDOUT.flush
- STDERR.flush
-end
-
-# make sure conditional operators work
-
-test_check "assignment"
-
-a=[]; a[0] ||= "bar";
-test_ok(a[0] == "bar")
-h={}; h["foo"] ||= "bar";
-test_ok(h["foo"] == "bar")
-
-aa = 5
-aa ||= 25
-test_ok(aa == 5)
-bb ||= 25
-test_ok(bb == 25)
-cc &&=33
-test_ok(cc == nil)
-cc = 5
-cc &&=44
-test_ok(cc == 44)
-
-a = nil; test_ok(a == nil)
-a = 1; test_ok(a == 1)
-a = []; test_ok(a == [])
-a = [1]; test_ok(a == [1])
-a = [nil]; test_ok(a == [nil])
-a = [[]]; test_ok(a == [[]])
-a = [1,2]; test_ok(a == [1,2])
-a = [*[]]; test_ok(a == [])
-a = [*[1]]; test_ok(a == [1])
-a = [*[1,2]]; test_ok(a == [1,2])
-
-a = *[]; test_ok(a == [])
-a = *[1]; test_ok(a == [1])
-a = *[nil]; test_ok(a == [nil])
-a = *[[]]; test_ok(a == [[]])
-a = *[1,2]; test_ok(a == [1,2])
-a = *[*[]]; test_ok(a == [])
-a = *[*[1]]; test_ok(a == [1])
-a = *[*[1,2]]; test_ok(a == [1,2])
-
-a, = nil; test_ok(a == nil)
-a, = 1; test_ok(a == 1)
-a, = []; test_ok(a == nil)
-a, = [1]; test_ok(a == 1)
-a, = [nil]; test_ok(a == nil)
-a, = [[]]; test_ok(a == [])
-a, = 1,2; test_ok(a == 1)
-a, = [1,2]; test_ok(a == 1)
-a, = [*[]]; test_ok(a == nil)
-a, = [*[1]]; test_ok(a == 1)
-a, = *[1,2]; test_ok(a == 1)
-a, = [*[1,2]]; test_ok(a == 1)
-
-a, = *[]; test_ok(a == nil)
-a, = *[1]; test_ok(a == 1)
-a, = *[nil]; test_ok(a == nil)
-a, = *[[]]; test_ok(a == [])
-a, = *[1,2]; test_ok(a == 1)
-a, = *[*[]]; test_ok(a == nil)
-a, = *[*[1]]; test_ok(a == 1)
-a, = *[*[1,2]]; test_ok(a == 1)
-
-*a = nil; test_ok(a == [nil])
-*a = 1; test_ok(a == [1])
-*a = []; test_ok(a == [])
-*a = [1]; test_ok(a == [1])
-*a = [nil]; test_ok(a == [nil])
-*a = [[]]; test_ok(a == [[]])
-*a = [1,2]; test_ok(a == [1,2])
-*a = [*[]]; test_ok(a == [])
-*a = [*[1]]; test_ok(a == [1])
-*a = [*[1,2]]; test_ok(a == [1,2])
-
-*a = *[]; test_ok(a == [])
-*a = *[1]; test_ok(a == [1])
-*a = *[nil]; test_ok(a == [nil])
-*a = *[[]]; test_ok(a == [[]])
-*a = *[1,2]; test_ok(a == [1,2])
-*a = *[*[]]; test_ok(a == [])
-*a = *[*[1]]; test_ok(a == [1])
-*a = *[*[1,2]]; test_ok(a == [1,2])
-
-a,b,*c = nil; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = 1; test_ok([a,b,c] == [1,nil,[]])
-a,b,*c = []; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = [1]; test_ok([a,b,c] == [1,nil,[]])
-a,b,*c = [nil]; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = [[]]; test_ok([a,b,c] == [[],nil,[]])
-a,b,*c = [1,2]; test_ok([a,b,c] == [1,2,[]])
-a,b,*c = [*[]]; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = [*[1]]; test_ok([a,b,c] == [1,nil,[]])
-a,b,*c = [*[1,2]]; test_ok([a,b,c] == [1,2,[]])
-
-a,b,*c = *[]; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = *[1]; test_ok([a,b,c] == [1,nil,[]])
-a,b,*c = *[nil]; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = *[[]]; test_ok([a,b,c] == [[],nil,[]])
-a,b,*c = *[1,2]; test_ok([a,b,c] == [1,2,[]])
-a,b,*c = *[*[]]; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = *[*[1]]; test_ok([a,b,c] == [1,nil,[]])
-a,b,*c = *[*[1,2]]; test_ok([a,b,c] == [1,2,[]])
-
-def f; yield nil; end; f {|a| test_ok(a == nil)}
-def f; yield 1; end; f {|a| test_ok(a == 1)}
-def f; yield []; end; f {|a| test_ok(a == [])}
-def f; yield [1]; end; f {|a| test_ok(a == [1])}
-def f; yield [nil]; end; f {|a| test_ok(a == [nil])}
-def f; yield [[]]; end; f {|a| test_ok(a == [[]])}
-def f; yield [*[]]; end; f {|a| test_ok(a == [])}
-def f; yield [*[1]]; end; f {|a| test_ok(a == [1])}
-def f; yield [*[1,2]]; end; f {|a| test_ok(a == [1,2])}
-def f; yield *[]; end; f {|a| test_ok(a == nil)}
-def f; yield *[1]; end; f {|a| test_ok(a == 1)}
-def f; yield *[nil]; end; f {|a| test_ok(a == nil)}
-def f; yield *[[]]; end; f {|a| test_ok(a == [])}
-def f; yield *[*[]]; end; f {|a| test_ok(a == nil)}
-def f; yield *[*[1]]; end; f {|a| test_ok(a == 1)}
-def f; yield *[*[1,2]]; end; f {|a| test_ok(a == 1)}
-
-def f; yield; end; f {|a,| test_ok(a == nil)}
-def f; yield nil; end; f {|a,| test_ok(a == nil)}
-def f; yield 1; end; f {|a,| test_ok(a == 1)}
-def f; yield []; end; f {|a,| test_ok(a == nil)}
-def f; yield [1]; end; f {|a,| test_ok(a == 1)}
-def f; yield [nil]; end; f {|a,| test_ok(a == nil)}
-def f; yield [[]]; end; f {|a,| test_ok(a == [])}
-def f; yield [*[]]; end; f {|a,| test_ok(a == nil)}
-def f; yield [*[1]]; end; f {|a,| test_ok(a == 1)}
-def f; yield [*[1,2]]; end; f {|a,| test_ok(a == 1)}
-
-def f; yield *[]; end; f {|a,| test_ok(a == nil)}
-def f; yield *[1]; end; f {|a,| test_ok(a == 1)}
-def f; yield *[nil]; end; f {|a,| test_ok(a == nil)}
-def f; yield *[[]]; end; f {|a,| test_ok(a == nil)}
-def f; yield *[*[]]; end; f {|a,| test_ok(a == nil)}
-def f; yield *[*[1]]; end; f {|a,| test_ok(a == 1)}
-def f; yield *[*[1,2]]; end; f {|a,| test_ok(a == 1)}
-
-def f; yield; end; f {|*a| test_ok(a == [])}
-def f; yield nil; end; f {|*a| test_ok(a == [nil])}
-def f; yield 1; end; f {|*a| test_ok(a == [1])}
-def f; yield []; end; f {|*a| test_ok(a == [[]])}
-def f; yield [1]; end; f {|*a| test_ok(a == [[1]])}
-def f; yield [nil]; end; f {|*a| test_ok(a == [[nil]])}
-def f; yield [[]]; end; f {|*a| test_ok(a == [[[]]])}
-def f; yield [1,2]; end; f {|*a| test_ok(a == [[1,2]])}
-def f; yield [*[]]; end; f {|*a| test_ok(a == [[]])}
-def f; yield [*[1]]; end; f {|*a| test_ok(a == [[1]])}
-def f; yield [*[1,2]]; end; f {|*a| test_ok(a == [[1,2]])}
-
-def f; yield *[]; end; f {|*a| test_ok(a == [])}
-def f; yield *[1]; end; f {|*a| test_ok(a == [1])}
-def f; yield *[nil]; end; f {|*a| test_ok(a == [nil])}
-def f; yield *[[]]; end; f {|*a| test_ok(a == [[]])}
-def f; yield *[*[]]; end; f {|*a| test_ok(a == [])}
-def f; yield *[*[1]]; end; f {|*a| test_ok(a == [1])}
-def f; yield *[*[1,2]]; end; f {|*a| test_ok(a == [1,2])}
-
-def f; yield; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
-def f; yield nil; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
-def f; yield 1; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
-def f; yield []; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
-def f; yield [1]; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
-def f; yield [nil]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
-def f; yield [[]]; end; f {|a,b,*c| test_ok([a,b,c] == [[],nil,[]])}
-def f; yield [*[]]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
-def f; yield [*[1]]; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
-def f; yield [*[1,2]]; end; f {|a,b,*c| test_ok([a,b,c] == [1,2,[]])}
-
-def f; yield *[]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
-def f; yield *[1]; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
-def f; yield *[nil]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
-def f; yield *[[]]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
-def f; yield *[*[]]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
-def f; yield *[*[1]]; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
-def f; yield *[*[1,2]]; end; f {|a,b,*c| test_ok([a,b,c] == [1,2,[]])}
-
-def r; return; end; a = r(); test_ok(a == nil)
-def r; return nil; end; a = r(); test_ok(a == nil)
-def r; return 1; end; a = r(); test_ok(a == 1)
-def r; return []; end; a = r(); test_ok(a == [])
-def r; return [1]; end; a = r(); test_ok(a == [1])
-def r; return [nil]; end; a = r(); test_ok(a == [nil])
-def r; return [[]]; end; a = r(); test_ok(a == [[]])
-def r; return [*[]]; end; a = r(); test_ok(a == [])
-def r; return [*[1]]; end; a = r(); test_ok(a == [1])
-def r; return [*[1,2]]; end; a = r(); test_ok(a == [1,2])
-
-def r; return *[]; end; a = r(); test_ok(a == [])
-def r; return *[1]; end; a = r(); test_ok(a == [1])
-def r; return *[nil]; end; a = r(); test_ok(a == [nil])
-def r; return *[[]]; end; a = r(); test_ok(a == [[]])
-def r; return *[*[]]; end; a = r(); test_ok(a == [])
-def r; return *[*[1]]; end; a = r(); test_ok(a == [1])
-def r; return *[*[1,2]]; end; a = r(); test_ok(a == [1,2])
-
-def r; return *[[]]; end; a = *r(); test_ok(a == [[]])
-def r; return *[*[1,2]]; end; a = *r(); test_ok(a == [1,2])
-
-def r; return; end; *a = r(); test_ok(a == [nil])
-def r; return nil; end; *a = r(); test_ok(a == [nil])
-def r; return 1; end; *a = r(); test_ok(a == [1])
-def r; return []; end; *a = r(); test_ok(a == [])
-def r; return [1]; end; *a = r(); test_ok(a == [1])
-def r; return [nil]; end; *a = r(); test_ok(a == [nil])
-def r; return [[]]; end; *a = r(); test_ok(a == [[]])
-def r; return [1,2]; end; *a = r(); test_ok(a == [1,2])
-def r; return [*[]]; end; *a = r(); test_ok(a == [])
-def r; return [*[1]]; end; *a = r(); test_ok(a == [1])
-def r; return [*[1,2]]; end; *a = r(); test_ok(a == [1,2])
-
-def r; return *[]; end; *a = r(); test_ok(a == [])
-def r; return *[1]; end; *a = r(); test_ok(a == [1])
-def r; return *[nil]; end; *a = r(); test_ok(a == [nil])
-def r; return *[[]]; end; *a = r(); test_ok(a == [[]])
-def r; return *[1,2]; end; *a = r(); test_ok(a == [1,2])
-def r; return *[*[]]; end; *a = r(); test_ok(a == [])
-def r; return *[*[1]]; end; *a = r(); test_ok(a == [1])
-def r; return *[*[1,2]]; end; *a = r(); test_ok(a == [1,2])
-
-def r; return *[[]]; end; *a = *r(); test_ok(a == [[]])
-def r; return *[1,2]; end; *a = *r(); test_ok(a == [1,2])
-def r; return *[*[1,2]]; end; *a = *r(); test_ok(a == [1,2])
-
-def r; return; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
-def r; return nil; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
-def r; return 1; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
-def r; return []; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
-def r; return [1]; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
-def r; return [nil]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
-def r; return [[]]; end; a,b,*c = r(); test_ok([a,b,c] == [[],nil,[]])
-def r; return [1,2]; end; a,b,*c = r(); test_ok([a,b,c] == [1,2,[]])
-def r; return [*[]]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
-def r; return [*[1]]; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
-def r; return [*[1,2]]; end; a,b,*c = r(); test_ok([a,b,c] == [1,2,[]])
-
-def r; return *[]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
-def r; return *[1]; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
-def r; return *[nil]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
-def r; return *[[]]; end; a,b,*c = r(); test_ok([a,b,c] == [[],nil,[]])
-def r; return *[1,2]; end; a,b,*c = r(); test_ok([a,b,c] == [1,2,[]])
-def r; return *[*[]]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
-def r; return *[*[1]]; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
-def r; return *[*[1,2]]; end; a,b,*c = r(); test_ok([a,b,c] == [1,2,[]])
-
-f = lambda {|r,| test_ok([] == r)}
-f.call([], *[])
-
-f = lambda {|r,*l| test_ok([] == r); test_ok([1] == l)}
-f.call([], *[1])
-
-f = lambda{|x| x}
-test_ok(f.call(42) == 42)
-test_ok(f.call([42]) == [42])
-test_ok(f.call([[42]]) == [[42]])
-test_ok(f.call([42,55]) == [42,55])
-
-f = lambda{|x,| x}
-test_ok(f.call(42) == 42)
-test_ok(f.call([42]) == [42])
-test_ok(f.call([[42]]) == [[42]])
-test_ok(f.call([42,55]) == [42,55])
-
-f = lambda{|*x| x}
-test_ok(f.call(42) == [42])
-test_ok(f.call([42]) == [[42]])
-test_ok(f.call([[42]]) == [[[42]]])
-test_ok(f.call([42,55]) == [[42,55]])
-test_ok(f.call(42,55) == [42,55])
-
-f = lambda { |a, b=42, *c| [a,b,c] }
-test_ok(f.call(1 ) == [1,42,[ ]] )
-test_ok(f.call(1,43 ) == [1,43,[ ]] )
-test_ok(f.call(1,43,44) == [1,43,[44]] )
-
-f = lambda { |a, b=(a|16), *c, &block| [a,b,c,block&&block[]] }
-test_ok(f.call(8 ) == [8,24,[ ],nil] )
-test_ok(f.call(8,43 ) == [8,43,[ ],nil] )
-test_ok(f.call(8,43,44) == [8,43,[44],nil] )
-test_ok(f.call(8 ){45} == [8,24,[ ],45 ] )
-test_ok(f.call(8,43 ){45} == [8,43,[ ],45 ] )
-test_ok(f.call(8,43,44){45} == [8,43,[44],45 ] )
-
-f = lambda { |a, b=42, *c, d| [a,b,c,d] }
-test_ok(f.call(1 ,99) == [1,42,[ ],99] )
-test_ok(f.call(1,43 ,99) == [1,43,[ ],99] )
-test_ok(f.call(1,43,44,99) == [1,43,[44],99] )
-
-f = lambda { |a, b=(a|16), &block| [a,b,block&&block[]] }
-test_ok(f.call(8 ) == [8,24,nil] )
-test_ok(f.call(8,43) == [8,43,nil] )
-test_ok(f.call(8,43) == [8,43,nil] )
-test_ok(f.call(8 ){45} == [8,24,45 ] )
-test_ok(f.call(8,43){45} == [8,43,45 ] )
-test_ok(f.call(8,43){45} == [8,43,45 ] )
-
-f = lambda { |a, b=42, d| [a,b,d] }
-test_ok(f.call(1 ,99) == [1,42,99] )
-test_ok(f.call(1,43,99) == [1,43,99] )
-test_ok(f.call(1,43,99) == [1,43,99] )
-
-f = lambda { |b=42, *c, &block| [b,c,block&&block[]] }
-test_ok(f.call( ) == [42,[ ],nil] )
-test_ok(f.call(43 ) == [43,[ ],nil] )
-test_ok(f.call(43,44) == [43,[44],nil] )
-test_ok(f.call( ){45} == [42,[ ],45 ] )
-test_ok(f.call(43 ){45} == [43,[ ],45 ] )
-test_ok(f.call(43,44){45} == [43,[44],45 ] )
-
-f = lambda { |b=42, *c, d| [b,c,d] }
-test_ok(f.call( 99) == [42,[ ],99] )
-test_ok(f.call(43 ,99) == [43,[ ],99] )
-test_ok(f.call(43,44,99) == [43,[44],99] )
-
-f = lambda { |b=42, &block| [b,block&&block[]] }
-test_ok(f.call( ) == [42,nil] )
-test_ok(f.call(43) == [43,nil] )
-test_ok(f.call(43) == [43,nil] )
-test_ok(f.call( ){45} == [42,45 ] )
-test_ok(f.call(43){45} == [43,45 ] )
-test_ok(f.call(43){45} == [43,45 ] )
-
-f = lambda { |b=42, d| [b,d] }
-test_ok(f.call( 99) == [42,99] )
-test_ok(f.call(43,99) == [43,99] )
-test_ok(f.call(43,99) == [43,99] )
-
-
-a,=*[1]
-test_ok(a == 1)
-a,=*[[1]]
-test_ok(a == [1])
-a,=*[[[1]]]
-test_ok(a == [[1]])
-
-x, (y, z) = 1, 2, 3
-test_ok([1,2,nil] == [x,y,z])
-x, (y, z) = 1, [2,3]
-test_ok([1,2,3] == [x,y,z])
-x, (y, z) = 1, [2]
-test_ok([1,2,nil] == [x,y,z])
-
-a = loop do break; end; test_ok(a == nil)
-a = loop do break nil; end; test_ok(a == nil)
-a = loop do break 1; end; test_ok(a == 1)
-a = loop do break []; end; test_ok(a == [])
-a = loop do break [1]; end; test_ok(a == [1])
-a = loop do break [nil]; end; test_ok(a == [nil])
-a = loop do break [[]]; end; test_ok(a == [[]])
-a = loop do break [*[]]; end; test_ok(a == [])
-a = loop do break [*[1]]; end; test_ok(a == [1])
-a = loop do break [*[1,2]]; end; test_ok(a == [1,2])
-
-a = loop do break *[]; end; test_ok(a == [])
-a = loop do break *[1]; end; test_ok(a == [1])
-a = loop do break *[nil]; end; test_ok(a == [nil])
-a = loop do break *[[]]; end; test_ok(a == [[]])
-a = loop do break *[*[]]; end; test_ok(a == [])
-a = loop do break *[*[1]]; end; test_ok(a == [1])
-a = loop do break *[*[1,2]]; end; test_ok(a == [1,2])
-
-*a = loop do break; end; test_ok(a == [nil])
-*a = loop do break nil; end; test_ok(a == [nil])
-*a = loop do break 1; end; test_ok(a == [1])
-*a = loop do break []; end; test_ok(a == [])
-*a = loop do break [1]; end; test_ok(a == [1])
-*a = loop do break [nil]; end; test_ok(a == [nil])
-*a = loop do break [[]]; end; test_ok(a == [[]])
-*a = loop do break [1,2]; end; test_ok(a == [1,2])
-*a = loop do break [*[]]; end; test_ok(a == [])
-*a = loop do break [*[1]]; end; test_ok(a == [1])
-*a = loop do break [*[1,2]]; end; test_ok(a == [1,2])
-
-*a = loop do break *[]; end; test_ok(a == [])
-*a = loop do break *[1]; end; test_ok(a == [1])
-*a = loop do break *[nil]; end; test_ok(a == [nil])
-*a = loop do break *[[]]; end; test_ok(a == [[]])
-*a = loop do break *[1,2]; end; test_ok(a == [1,2])
-*a = loop do break *[*[]]; end; test_ok(a == [])
-*a = loop do break *[*[1]]; end; test_ok(a == [1])
-*a = loop do break *[*[1,2]]; end; test_ok(a == [1,2])
-
-*a = *loop do break *[[]]; end; test_ok(a == [[]])
-*a = *loop do break *[1,2]; end; test_ok(a == [1,2])
-*a = *loop do break *[*[1,2]]; end; test_ok(a == [1,2])
-
-a,b,*c = loop do break; end; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = loop do break nil; end; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = loop do break 1; end; test_ok([a,b,c] == [1,nil,[]])
-a,b,*c = loop do break []; end; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = loop do break [1]; end; test_ok([a,b,c] == [1,nil,[]])
-a,b,*c = loop do break [nil]; end; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = loop do break [[]]; end; test_ok([a,b,c] == [[],nil,[]])
-a,b,*c = loop do break [1,2]; end; test_ok([a,b,c] == [1,2,[]])
-a,b,*c = loop do break [*[]]; end; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = loop do break [*[1]]; end; test_ok([a,b,c] == [1,nil,[]])
-a,b,*c = loop do break [*[1,2]]; end; test_ok([a,b,c] == [1,2,[]])
-
-a,b,*c = loop do break *[]; end; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = loop do break *[1]; end; test_ok([a,b,c] == [1,nil,[]])
-a,b,*c = loop do break *[nil]; end; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = loop do break *[[]]; end; test_ok([a,b,c] == [[],nil,[]])
-a,b,*c = loop do break *[1,2]; end; test_ok([a,b,c] == [1,2,[]])
-a,b,*c = loop do break *[*[]]; end; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = loop do break *[*[1]]; end; test_ok([a,b,c] == [1,nil,[]])
-a,b,*c = loop do break *[*[1,2]]; end; test_ok([a,b,c] == [1,2,[]])
-
-def r(val); a = yield(); test_ok(a == val, 2); end
-r(nil){next}
-r(nil){next nil}
-r(1){next 1}
-r([]){next []}
-r([1]){next [1]}
-r([nil]){next [nil]}
-r([[]]){next [[]]}
-r([]){next [*[]]}
-r([1]){next [*[1]]}
-r([1,2]){next [*[1,2]]}
-
-r([]){next *[]}
-r([1]){next *[1]}
-r([nil]){next *[nil]}
-r([[]]){next *[[]]}
-r([]){next *[*[]]}
-r([1]){next *[*[1]]}
-r([1,2]){next *[*[1,2]]}
-
-def r(val); *a = yield(); test_ok(a == val, 2); end
-r([nil]){next}
-r([nil]){next nil}
-r([1]){next 1}
-r([]){next []}
-r([1]){next [1]}
-r([nil]){next [nil]}
-r([[]]){next [[]]}
-r([1,2]){next [1,2]}
-r([]){next [*[]]}
-r([1]){next [*[1]]}
-r([1,2]){next [*[1,2]]}
-
-def r(val); *a = *yield(); test_ok(a == val, 2); end
-r([[]]){next *[[]]}
-r([1,2]){next *[1,2]}
-r([1,2]){next *[*[1,2]]}
-
-def r(val); a,b,*c = yield(); test_ok([a,b,c] == val, 2); end
-r([nil,nil,[]]){next}
-r([nil,nil,[]]){next nil}
-r([1,nil,[]]){next 1}
-r([nil,nil,[]]){next []}
-r([1,nil,[]]){next [1]}
-r([nil,nil,[]]){next [nil]}
-r([[],nil,[]]){next [[]]}
-r([1,2,[]]){next [1,2]}
-r([nil,nil,[]]){next [*[]]}
-r([1,nil,[]]){next [*[1]]}
-r([1,2,[]]){next [*[1,2]]}
-
-def r(val); a,b,*c = *yield(); test_ok([a,b,c] == val, 2); end
-r([[],nil,[]]){next *[[]]}
-r([1,2,[]]){next *[1,2]}
-r([1,2,[]]){next *[*[1,2]]}
-
-test_check "condition"
-
-$x = '0';
-
-$x == $x && test_ok(true)
-$x != $x && test_ok(false)
-$x == $x || test_ok(false)
-$x != $x || test_ok(true)
-
-# first test to see if we can run the tests.
-
-test_check "if/unless";
-
-$x = 'test';
-test_ok(if $x == $x then true else false end)
-$bad = false
-unless $x == $x
- $bad = true
-end
-test_ok(!$bad)
-test_ok(unless $x != $x then true else false end)
-
-test_check "case"
-
-case 5
-when 1, 2, 3, 4, 6, 7, 8
- test_ok(false)
-when 5
- test_ok(true)
-end
-
-case 5
-when 5
- test_ok(true)
-when 1..10
- test_ok(false)
-end
-
-case 5
-when 1..10
- test_ok(true)
-else
- test_ok(false)
-end
-
-case 5
-when 5
- test_ok(true)
-else
- test_ok(false)
-end
-
-case "foobar"
-when /^f.*r$/
- test_ok(true)
-else
- test_ok(false)
-end
-
-test_check "while/until";
-
-while_tmp = "while_tmp.#{$$}"
-tmp = open(while_tmp, "w")
-tmp.print "tvi925\n";
-tmp.print "tvi920\n";
-tmp.print "vt100\n";
-tmp.print "Amiga\n";
-tmp.print "paper\n";
-tmp.close
-
-# test break
-
-tmp = open(while_tmp, "r")
-test_ok(tmp.kind_of?(File))
-
-while line = tmp.gets()
- break if /vt100/ =~ line
-end
-
-test_ok(!tmp.eof? && /vt100/ =~ line)
-tmp.close
-
-# test next
-$bad = false
-tmp = open(while_tmp, "r")
-while line = tmp.gets()
- next if /vt100/ =~ line
- $bad = 1 if /vt100/ =~ line
-end
-test_ok(!(!tmp.eof? || /vt100/ =~ line || $bad))
-tmp.close
-
-# test redo
-$bad = false
-tmp = open(while_tmp, "r")
-while line = tmp.gets()
- lastline = line
- line = line.gsub(/vt100/, 'VT100')
- if lastline != line
- line.gsub!('VT100', 'Vt100')
- redo
- end
- $bad = 1 if /vt100/ =~ line
- $bad = 1 if /VT100/ =~ line
-end
-test_ok(tmp.eof? && !$bad)
-tmp.close
-
-sum=0
-for i in 1..10
- sum += i
- i -= 1
- if i > 0
- redo
- end
-end
-test_ok(sum == 220)
-
-# test interval
-$bad = false
-tmp = open(while_tmp, "r")
-while line = tmp.gets()
- break if 3
- case line
- when /vt100/, /Amiga/, /paper/
- $bad = true
- end
-end
-test_ok(!$bad)
-tmp.close
-
-File.unlink while_tmp or `/bin/rm -f "#{while_tmp}"`
-test_ok(!File.exist?(while_tmp))
-
-i = 0
-until i>4
- i+=1
-end
-test_ok(i>4)
-
-
-# exception handling
-test_check "exception";
-
-begin
- raise "this must be handled"
- test_ok(false)
-rescue
- test_ok(true)
-end
-
-$bad = true
-begin
- raise "this must be handled no.2"
-rescue
- if $bad
- $bad = false
- retry
- test_ok(false)
- end
-end
-test_ok(true)
-
-# exception in rescue clause
-$string = "this must be handled no.3"
-begin
- begin
- raise "exception in rescue clause"
- rescue
- raise $string
- end
- test_ok(false)
-rescue => e
- test_ok($! == e)
- test_ok(e.message == $string)
- test_ok(e != $string)
-end
-
-# exception in ensure clause
-begin
- begin
- raise "this must be handled no.4"
- ensure
- raise "exception in ensure clause"
- end
- test_ok(false)
-rescue
- test_ok(true)
-end
-
-$bad = true
-begin
- begin
- raise "this must be handled no.5"
- ensure
- $bad = false
- end
-rescue
-end
-test_ok(!$bad)
-
-$bad = true
-begin
- begin
- raise "this must be handled no.6"
- ensure
- $bad = false
- end
-rescue
-end
-test_ok(!$bad)
-
-$bad = true
-while true
- begin
- break
- ensure
- $bad = false
- end
-end
-test_ok(!$bad)
-
-test_ok(catch(:foo) {
- loop do
- loop do
- throw :foo, true
- break
- end
- break
- test_ok(false) # should not reach here
- end
- false
- })
-
-test_check "array"
-test_ok([1, 2] + [3, 4] == [1, 2, 3, 4])
-test_ok([1, 2] * 2 == [1, 2, 1, 2])
-test_ok([1, 2] * ":" == "1:2")
-
-test_ok([1, 2].hash == [1, 2].hash)
-
-test_ok([1,2,3] & [2,3,4] == [2,3])
-test_ok([1,2,3] | [2,3,4] == [1,2,3,4])
-test_ok([1,2,3] - [2,3] == [1])
-
-$x = [0, 1, 2, 3, 4, 5]
-test_ok($x[2] == 2)
-test_ok($x[1..3] == [1, 2, 3])
-test_ok($x[1,3] == [1, 2, 3])
-
-$x[0, 2] = 10
-test_ok($x[0] == 10 && $x[1] == 2)
-
-$x[0, 0] = -1
-test_ok($x[0] == -1 && $x[1] == 10)
-
-$x[-1, 1] = 20
-test_ok($x[-1] == 20 && $x.pop == 20)
-
-# array and/or
-test_ok(([1,2,3]&[2,4,6]) == [2])
-test_ok(([1,2,3]|[2,4,6]) == [1,2,3,4,6])
-
-# compact
-$x = [nil, 1, nil, nil, 5, nil, nil]
-$x.compact!
-test_ok($x == [1, 5])
-
-# uniq
-$x = [1, 1, 4, 2, 5, 4, 5, 1, 2]
-$x.uniq!
-test_ok($x == [1, 4, 2, 5])
-
-# empty?
-test_ok(!$x.empty?)
-$x = []
-test_ok($x.empty?)
-
-# sort
-$x = ["it", "came", "to", "pass", "that", "..."]
-$x = $x.sort.join(" ")
-test_ok($x == "... came it pass that to")
-$x = [2,5,3,1,7]
-$x.sort!{|a,b| a<=>b} # sort with condition
-test_ok($x == [1,2,3,5,7])
-$x.sort!{|a,b| b-a} # reverse sort
-test_ok($x == [7,5,3,2,1])
-
-# split test
-$x = "The Book of Mormon"
-test_ok($x.split(//).reverse!.join == $x.reverse)
-test_ok($x.reverse == $x.reverse!)
-test_ok("1 byte string".split(//).reverse.join(":") == "g:n:i:r:t:s: :e:t:y:b: :1")
-$x = "a b c d"
-test_ok($x.split == ['a', 'b', 'c', 'd'])
-test_ok($x.split(' ') == ['a', 'b', 'c', 'd'])
-test_ok(defined? "a".chomp)
-test_ok("abc".scan(/./) == ["a", "b", "c"])
-test_ok("1a2b3c".scan(/(\d.)/) == [["1a"], ["2b"], ["3c"]])
-# non-greedy match
-test_ok("a=12;b=22".scan(/(.*?)=(\d*);?/) == [["a", "12"], ["b", "22"]])
-
-$x = [1]
-test_ok(($x * 5).join(":") == '1:1:1:1:1')
-test_ok(($x * 1).join(":") == '1')
-test_ok(($x * 0).join(":") == '')
-
-*$x = *(1..7).to_a
-test_ok($x.size == 7)
-test_ok($x == [1, 2, 3, 4, 5, 6, 7])
-
-$x = [1,2,3]
-$x[1,0] = $x
-test_ok($x == [1,1,2,3,2,3])
-
-$x = [1,2,3]
-$x[-1,0] = $x
-test_ok($x == [1,2,1,2,3,3])
-
-$x = [1,2,3]
-$x.concat($x)
-test_ok($x == [1,2,3,1,2,3])
-
-test_check "hash"
-$x = {1=>2, 2=>4, 3=>6}
-
-test_ok($x[1] == 2)
-
-test_ok(begin
- for k,v in $x
- raise if k*2 != v
- end
- true
- rescue
- false
- end)
-
-test_ok($x.length == 3)
-test_ok($x.has_key?(1))
-test_ok($x.has_value?(4))
-test_ok($x.values_at(2,3) == [4,6])
-test_ok($x == {1=>2, 2=>4, 3=>6})
-
-$z = $x.keys.sort.join(":")
-test_ok($z == "1:2:3")
-
-$z = $x.values.sort.join(":")
-test_ok($z == "2:4:6")
-test_ok($x == $x)
-
-$x.shift
-test_ok($x.length == 2)
-
-$z = [1,2]
-$x[$z] = 256
-test_ok($x[$z] == 256)
-
-$x = Hash.new(0)
-$x[1] = 1
-test_ok($x[1] == 1)
-test_ok($x[2] == 0)
-
-$x = Hash.new([])
-test_ok($x[22] == [])
-test_ok($x[22].equal?($x[22]))
-
-$x = Hash.new{[]}
-test_ok($x[22] == [])
-test_ok(!$x[22].equal?($x[22]))
-
-$x = Hash.new{|h,k| $z = k; h[k] = k*2}
-$z = 0
-test_ok($x[22] == 44)
-test_ok($z == 22)
-$z = 0
-test_ok($x[22] == 44)
-test_ok($z == 0)
-$x.default = 5
-test_ok($x[23] == 5)
-
-$x = Hash.new
-def $x.default(k)
- $z = k
- self[k] = k*2
-end
-$z = 0
-test_ok($x[22] == 44)
-test_ok($z == 22)
-$z = 0
-test_ok($x[22] == 44)
-test_ok($z == 0)
-
-test_check "iterator"
-
-# yield at top level
-test_ok(!defined?(yield))
-
-$x = [1, 2, 3, 4]
-$y = []
-
-# iterator over array
-for i in $x
- $y.push i
-end
-test_ok($x == $y)
-
-# nested iterator
-def tt
- 1.upto(10) {|i|
- yield i
- }
-end
-
-i=0
-tt{|i| break if i == 5}
-test_ok(i == 0)
-
-def tt2(dummy)
- yield 1
-end
-
-def tt3(&block)
- tt2(raise(ArgumentError,""),&block)
-end
-
-$x = false
-begin
- tt3{}
-rescue ArgumentError
- $x = true
-rescue Exception
-end
-test_ok($x)
-
-def tt4 &block
- tt2(raise(ArgumentError,""),&block)
-end
-$x = false
-begin
- tt4{}
-rescue ArgumentError
- $x = true
-rescue Exception
-end
-test_ok($x)
-
-# iterator break/redo/next/retry
-done = true
-loop{
- break
- done = false # should not reach here
-}
-test_ok(done)
-
-done = false
-$bad = false
-loop {
- break if done
- done = true
- next
- $bad = true # should not reach here
-}
-test_ok(!$bad)
-
-done = false
-$bad = false
-loop {
- break if done
- done = true
- redo
- $bad = true # should not reach here
-}
-test_ok(!$bad)
-
-$x = []
-for i in 1 .. 7
- $x.push i
-end
-test_ok($x.size == 7)
-test_ok($x == [1, 2, 3, 4, 5, 6, 7])
-
-# append method to built-in class
-class Array
- def iter_test1
- collect{|e| [e, yield(e)]}.sort{|a,b|a[1]<=>b[1]}
- end
- def iter_test2
- a = collect{|e| [e, yield(e)]}
- a.sort{|a,b|a[1]<=>b[1]}
- end
-end
-$x = [[1,2],[3,4],[5,6]]
-test_ok($x.iter_test1{|x|x} == $x.iter_test2{|x|x})
-
-class IterTest
- def initialize(e); @body = e; end
-
- def each0(&block); @body.each(&block); end
- def each1(&block); @body.each {|*x| block.call(*x) } end
- def each2(&block); @body.each {|*x| block.call(x) } end
- def each3(&block); @body.each {|x| block.call(*x) } end
- def each4(&block); @body.each {|x| block.call(x) } end
- def each5; @body.each {|*x| yield(*x) } end
- def each6; @body.each {|*x| yield(x) } end
- def each7; @body.each {|x| yield(*x) } end
- def each8; @body.each {|x| yield(x) } end
-
- def f(a)
- a
- end
-end
-test_ok(IterTest.new(nil).method(:f).to_proc.call([1]) == [1])
-m = /\w+/.match("abc")
-test_ok(IterTest.new(nil).method(:f).to_proc.call([m]) == [m])
-
-IterTest.new([0]).each0 {|x| test_ok(x == 0)}
-IterTest.new([1]).each1 {|x| test_ok(x == 1)}
-IterTest.new([2]).each2 {|x| test_ok(x == [2])}
-#IterTest.new([3]).each3 {|x| test_ok(x == 3)}
-IterTest.new([4]).each4 {|x| test_ok(x == 4)}
-IterTest.new([5]).each5 {|x| test_ok(x == 5)}
-IterTest.new([6]).each6 {|x| test_ok(x == [6])}
-#IterTest.new([7]).each7 {|x| test_ok(x == 7)}
-IterTest.new([8]).each8 {|x| test_ok(x == 8)}
-
-IterTest.new([[0]]).each0 {|x| test_ok(x == [0])}
-IterTest.new([[1]]).each1 {|x| test_ok(x == [1])}
-IterTest.new([[2]]).each2 {|x| test_ok(x == [[2]])}
-IterTest.new([[3]]).each3 {|x| test_ok(x == 3)}
-IterTest.new([[4]]).each4 {|x| test_ok(x == [4])}
-IterTest.new([[5]]).each5 {|x| test_ok(x == [5])}
-IterTest.new([[6]]).each6 {|x| test_ok(x == [[6]])}
-IterTest.new([[7]]).each7 {|x| test_ok(x == 7)}
-IterTest.new([[8]]).each8 {|x| test_ok(x == [8])}
-
-IterTest.new([[0,0]]).each0 {|*x| test_ok(x == [[0,0]])}
-IterTest.new([[8,8]]).each8 {|*x| test_ok(x == [[8,8]])}
-
-def m0(v)
- v
-end
-
-def m1
- m0(block_given?)
-end
-test_ok(m1{p 'test'})
-test_ok(!m1)
-
-def m
- m0(block_given?,&Proc.new{})
-end
-test_ok(m1{p 'test'})
-test_ok(!m1)
-
-class C
- include Enumerable
- def initialize
- @a = [1,2,3]
- end
- def each(&block)
- @a.each(&block)
- end
-end
-
-test_ok(C.new.collect{|n| n} == [1,2,3])
-
-test_ok(Proc == lambda{}.class)
-test_ok(Proc == Proc.new{}.class)
-lambda{|a|test_ok(a==1)}.call(1)
-def block_test(klass, &block)
- test_ok(klass === block)
-end
-
-block_test(NilClass)
-block_test(Proc){}
-
-def call_argument_test(state, proc, *args)
- x = state
- begin
- proc.call(*args)
- rescue ArgumentError
- x = !x
- end
- test_ok(x,2)
-end
-
-call_argument_test(true, lambda{||})
-call_argument_test(false, lambda{||}, 1)
-call_argument_test(true, lambda{|a,|}, 1)
-call_argument_test(false, lambda{|a,|})
-call_argument_test(false, lambda{|a,|}, 1,2)
-
-call_argument_test(true, Proc.new{||})
-call_argument_test(true, Proc.new{||}, 1)
-call_argument_test(true, Proc.new{|a,|}, 1)
-call_argument_test(true, Proc.new{|a,|})
-call_argument_test(true, Proc.new{|a,|}, 1,2)
-
-def block_get(&block)
- block
-end
-
-test_ok(Proc == block_get{}.class)
-call_argument_test(true, block_get{||})
-call_argument_test(true, block_get{||}, 1)
-call_argument_test(true, block_get{|a,|}, 1)
-call_argument_test(true, block_get{|a,|})
-call_argument_test(true, block_get{|a,|}, 1,2)
-
-call_argument_test(true, block_get(&lambda{||}))
-call_argument_test(false, block_get(&lambda{||}),1)
-call_argument_test(true, block_get(&lambda{|a,|}),1)
-call_argument_test(false, block_get(&lambda{|a,|}),1,2)
-
-blk = block_get{11}
-test_ok(blk.class == Proc)
-test_ok(blk.to_proc.class == Proc)
-test_ok(blk.clone.call == 11)
-test_ok(block_get(&blk).class == Proc)
-
-lmd = lambda{44}
-test_ok(lmd.class == Proc)
-test_ok(lmd.to_proc.class == Proc)
-test_ok(lmd.clone.call == 44)
-test_ok(block_get(&lmd).class == Proc)
-
-test_ok(Proc.new{|a,| a}.yield(1,2,3) == 1)
-call_argument_test(true, Proc.new{|a,|}, 1,2)
-
-test_ok(Proc.new{|&b| b.call(10)}.call {|x| x} == 10)
-test_ok(Proc.new{|a,&b| b.call(a)}.call(12) {|x| x} == 12)
-
-def test_return1
- Proc.new {
- return 55
- }.yield + 5
-end
-test_ok(test_return1() == 55)
-def test_return2
- lambda {
- return 55
- }.call + 5
-end
-test_ok(test_return2() == 60)
-
-def proc_call(&b)
- b.call
-end
-def proc_yield()
- yield
-end
-def proc_return1
- lambda{return 42}.call+1
-end
-test_ok(proc_return1() == 43)
-def proc_return2
- ->{return 42}.call+1
-end
-test_ok(proc_return2() == 43)
-def proc_return3
- proc_call{return 42}+1
-end
-test_ok(proc_return3() == 42)
-def proc_return4
- proc_yield{return 42}+1
-end
-test_ok(proc_return4() == 42)
-
-def ljump_test(state, proc, *args)
- x = state
- begin
- proc.call(*args)
- rescue LocalJumpError
- x = !x
- end
- test_ok(x,2)
-end
-
-ljump_test(false, block_get{break})
-ljump_test(true, lambda{break})
-
-def exit_value_test(&block)
- block.call
-rescue LocalJumpError
- $!.exit_value
-end
-
-test_ok(45 == exit_value_test{break 45})
-
-test_ok(55 == begin
- block_get{break 55}.call
- rescue LocalJumpError
- $!.exit_value
- end)
-
-def block_call(&block)
- block.call
-end
-
-def test_b1
- block_call{break 11}
-end
-test_ok(test_b1() == 11)
-
-def ljump_rescue(r)
- begin
- yield
- rescue LocalJumpError => e
- r if /from proc-closure/ =~ e.message
- end
-end
-
-def test_b2
- ljump_rescue(22) do
- block_get{break 21}.call
- end
-end
-test_ok(test_b2() == 22)
-
-def test_b3
- ljump_rescue(33) do
- Proc.new{break 31}.yield
- end
-end
-test_ok(test_b3() == 33)
-
-def test_b4
- lambda{break 44}.call
-end
-test_ok(test_b4() == 44)
-
-def test_b5
- ljump_rescue(55) do
- b = block_get{break 54}
- block_call(&b)
- end
-end
-test_ok(test_b5() == 55)
-
-def test_b6
- b = lambda{break 67}
- block_call(&b)
- 66
-end
-test_ok(test_b6() == 66)
-
-def util_r7
- block_get{break 78}
-end
-
-def test_b7
- b = util_r7()
- ljump_rescue(77) do
- block_call(&b)
- end
-end
-test_ok(test_b7() == 77)
-
-def util_b8(&block)
- block_call(&block)
-end
-
-def test_b8
- util_b8{break 88}
-end
-test_ok(test_b8() == 88)
-
-def util_b9(&block)
- lambda{block.call; 98}.call
-end
-
-def test_b9
- util_b9{break 99}
-end
-test_ok(test_b9() == 99)
-
-def util_b10
- util_b9{break 100}
-end
-
-def test_b10
- util_b10()
-end
-test_ok(test_b10() == 100)
-
-def test_b11
- ljump_rescue(111) do
- loop do
- Proc.new{break 110}.yield
- break 112
- end
- end
-end
-test_ok(test_b11() == 111)
-
-def test_b12
- loop do
- break lambda{break 122}.call
- break 121
- end
-end
-test_ok(test_b12() == 122)
-
-def test_b13
- ljump_rescue(133) do
- while true
- Proc.new{break 130}.yield
- break 131
- end
- end
-end
-test_ok(test_b13() == 133)
-
-def test_b14
- while true
- break lambda{break 144}.call
- break 143
- end
-end
-test_ok(test_b14() == 144)
-
-def test_b15
- [0].each {|c| yield 1 }
- 156
-end
-test_ok(test_b15{|e| break 155 } == 155)
-
-def marity_test(m)
- method = method(m)
- test_ok(method.arity == method.to_proc.arity, 2)
-end
-marity_test(:test_ok)
-marity_test(:marity_test)
-marity_test(:p)
-
-lambda(&method(:test_ok)).call(true)
-lambda(&block_get{|a,n| test_ok(a,n)}).call(true, 2)
-
-class ITER_TEST1
- def a
- block_given?
- end
-end
-
-class ITER_TEST2 < ITER_TEST1
- def a
- test_ok(super)
- super
- end
-end
-test_ok(ITER_TEST2.new.a {})
-
-class ITER_TEST3
- def foo x
- return yield if block_given?
- x
- end
-end
-
-class ITER_TEST4 < ITER_TEST3
- def foo x
- test_ok(super == yield)
- test_ok(super(x, &nil) == x)
- end
-end
-
-ITER_TEST4.new.foo(44){55}
-
-class ITER_TEST5
- def tt(aa)
- aa
- end
-
- def uu(a)
- class << self
- define_method(:tt) do |sym|
- super(sym)
- end
- end
- end
-
- def xx(*x)
- x.size
- end
-end
-
-a = ITER_TEST5.new
-a.uu(12)
-test_ok(a.tt(1) == 1)
-
-class ITER_TEST6 < ITER_TEST5
- def xx(*a)
- a << 12
- super
- end
-end
-
-test_ok(ITER_TEST6.new.xx([24]) == 2)
-
-test_check "float"
-test_ok(2.6.floor == 2)
-test_ok((-2.6).floor == -3)
-test_ok(2.6.ceil == 3)
-test_ok((-2.6).ceil == -2)
-test_ok(2.6.truncate == 2)
-test_ok((-2.6).truncate == -2)
-test_ok(2.6.round == 3)
-test_ok((-2.4).truncate == -2)
-test_ok((13.4 % 1 - 0.4).abs < 0.0001)
-nan = 0.0/0
-def nan_test(x,y)
- test_ok(x != y)
- test_ok((x < y) == false)
- test_ok((x > y) == false)
- test_ok((x <= y) == false)
- test_ok((x >= y) == false)
-end
-nan_test(nan, nan)
-nan_test(nan, 0)
-nan_test(nan, 1)
-nan_test(nan, -1)
-nan_test(nan, 1000)
-nan_test(nan, -1000)
-nan_test(nan, 1_000_000_000_000)
-nan_test(nan, -1_000_000_000_000)
-nan_test(nan, 100.0);
-nan_test(nan, -100.0);
-nan_test(nan, 0.001);
-nan_test(nan, -0.001);
-nan_test(nan, 1.0/0);
-nan_test(nan, -1.0/0);
-
-#s = "3.7517675036461267e+17"
-#test_ok(s == sprintf("%.16e", s.to_f))
-f = 3.7517675036461267e+17
-test_ok(f == sprintf("%.16e", f).to_f)
-
-
-test_check "bignum"
-def fact(n)
- return 1 if n == 0
- f = 1
- while n>0
- f *= n
- n -= 1
- end
- return f
-end
-$x = fact(40)
-test_ok($x == $x)
-test_ok($x == fact(40))
-test_ok($x < $x+2)
-test_ok($x > $x-2)
-test_ok($x == 815915283247897734345611269596115894272000000000)
-test_ok($x != 815915283247897734345611269596115894272000000001)
-test_ok($x+1 == 815915283247897734345611269596115894272000000001)
-test_ok($x/fact(20) == 335367096786357081410764800000)
-$x = -$x
-test_ok($x == -815915283247897734345611269596115894272000000000)
-test_ok(2-(2**32) == -(2**32-2))
-test_ok(2**32 - 5 == (2**32-3)-2)
-
-$good = true;
-for i in 1000..1014
- $good = false if ((1 << i) != (2**i))
-end
-test_ok($good)
-
-$good = true;
-n1= 1 << 1000
-for i in 1000..1014
- $good = false if ((1 << i) != n1)
- n1 *= 2
-end
-test_ok($good)
-
-$good = true;
-n2=n1
-for i in 1..10
- n1 = n1 / 2
- n2 = n2 >> 1
- $good = false if (n1 != n2)
-end
-test_ok($good)
-
-$good = true;
-for i in 4000..4096
- n1 = 1 << i;
- if (n1**2-1) / (n1+1) != (n1-1)
- $good = false
- end
-end
-test_ok($good)
-
-b = 10**80
-a = b * 9 + 7
-test_ok(7 == a.modulo(b))
-test_ok(-b + 7 == a.modulo(-b))
-test_ok(b + -7 == (-a).modulo(b))
-test_ok(-7 == (-a).modulo(-b))
-test_ok(7 == a.remainder(b))
-test_ok(7 == a.remainder(-b))
-test_ok(-7 == (-a).remainder(b))
-test_ok(-7 == (-a).remainder(-b))
-
-test_ok(10**40+10**20 == 10000000000000000000100000000000000000000)
-test_ok(10**40/10**20 == 100000000000000000000)
-
-a = 677330545177305025495135714080
-b = 14269972710765292560
-test_ok(a % b == 0)
-test_ok(-a % b == 0)
-
-def shift_test(a)
- b = a / (2 ** 32)
- c = a >> 32
- test_ok(b == c)
-
- b = a * (2 ** 32)
- c = a << 32
- test_ok(b == c)
-end
-
-shift_test(-4518325415524767873)
-shift_test(-0xfffffffffffffffff)
-
-test_check "string & char"
-
-test_ok("abcd" == "abcd")
-test_ok("abcd" =~ /abcd/)
-test_ok("abcd" === "abcd")
-# compile time string concatenation
-test_ok("ab" "cd" == "abcd")
-test_ok("#{22}aa" "cd#{44}" == "22aacd44")
-test_ok("#{22}aa" "cd#{44}" "55" "#{66}" == "22aacd445566")
-test_ok("abc" !~ /^$/)
-test_ok("abc\n" !~ /^$/)
-test_ok("abc" !~ /^d*$/)
-test_ok(("abc" =~ /d*$/) == 3)
-test_ok("" =~ /^$/)
-test_ok("\n" =~ /^$/)
-test_ok("a\n\n" =~ /^$/)
-test_ok("abcabc" =~ /.*a/ && $& == "abca")
-test_ok("abcabc" =~ /.*c/ && $& == "abcabc")
-test_ok("abcabc" =~ /.*?a/ && $& == "a")
-test_ok("abcabc" =~ /.*?c/ && $& == "abc")
-test_ok(/(.|\n)*?\n(b|\n)/ =~ "a\nb\n\n" && $& == "a\nb")
-
-test_ok(/^(ab+)+b/ =~ "ababb" && $& == "ababb")
-test_ok(/^(?:ab+)+b/ =~ "ababb" && $& == "ababb")
-test_ok(/^(ab+)+/ =~ "ababb" && $& == "ababb")
-test_ok(/^(?:ab+)+/ =~ "ababb" && $& == "ababb")
-
-test_ok(/(\s+\d+){2}/ =~ " 1 2" && $& == " 1 2")
-test_ok(/(?:\s+\d+){2}/ =~ " 1 2" && $& == " 1 2")
-
-$x = <<END;
-ABCD
-ABCD
-END
-$x.gsub!(/((.|\n)*?)B((.|\n)*?)D/, '\1\3')
-test_ok($x == "AC\nAC\n")
-
-test_ok("foobar" =~ /foo(?=(bar)|(baz))/)
-test_ok("foobaz" =~ /foo(?=(bar)|(baz))/)
-
-$foo = "abc"
-test_ok("#$foo = abc" == "abc = abc")
-test_ok("#{$foo} = abc" == "abc = abc")
-
-foo = "abc"
-test_ok("#{foo} = abc" == "abc = abc")
-
-test_ok('-' * 5 == '-----')
-test_ok('-' * 1 == '-')
-test_ok('-' * 0 == '')
-
-foo = '-'
-test_ok(foo * 5 == '-----')
-test_ok(foo * 1 == '-')
-test_ok(foo * 0 == '')
-
-$x = "a.gif"
-test_ok($x.sub(/.*\.([^\.]+)$/, '\1') == "gif")
-test_ok($x.sub(/.*\.([^\.]+)$/, 'b.\1') == "b.gif")
-test_ok($x.sub(/.*\.([^\.]+)$/, '\2') == "")
-test_ok($x.sub(/.*\.([^\.]+)$/, 'a\2b') == "ab")
-test_ok($x.sub(/.*\.([^\.]+)$/, '<\&>') == "<a.gif>")
-
-# character constants(assumes ASCII)
-test_ok("a"[0] == ?a)
-test_ok(?a == ?a)
-test_ok(?\C-a == "\1")
-test_ok(?\M-a == "\341")
-test_ok(?\M-\C-a == "\201")
-test_ok("a".upcase![0] == ?A)
-test_ok("A".downcase![0] == ?a)
-test_ok("abc".tr!("a-z", "A-Z") == "ABC")
-test_ok("aabbcccc".tr_s!("a-z", "A-Z") == "ABC")
-test_ok("abcc".squeeze!("a-z") == "abc")
-test_ok("abcd".delete!("bc") == "ad")
-
-$x = "abcdef"
-$y = [ ?a, ?b, ?c, ?d, ?e, ?f ]
-$bad = false
-$x.each_byte {|i|
- if i.chr != $y.shift
- $bad = true
- break
- end
-}
-test_ok(!$bad)
-
-s = "a string"
-s[0..s.size]="another string"
-test_ok(s == "another string")
-
-s = <<EOS
-#{
-[1,2,3].join(",")
-}
-EOS
-test_ok(s == "1,2,3\n")
-test_ok("Just".to_i(36) == 926381)
-test_ok("-another".to_i(36) == -23200231779)
-test_ok(1299022.to_s(36) == "ruby")
-test_ok(-1045307475.to_s(36) == "-hacker")
-test_ok("Just_another_Ruby_hacker".to_i(36) == 265419172580680477752431643787347)
-test_ok(-265419172580680477752431643787347.to_s(36) == "-justanotherrubyhacker")
-
-a = []
-(0..255).each {|n|
- ch = [n].pack("C")
- a.push ch if /a#{Regexp.quote ch}b/x =~ "ab"
-}
-test_ok(a.size == 0)
-
-test_check "assignment"
-a = nil
-test_ok(defined?(a))
-test_ok(a == nil)
-
-# multiple assignment
-a, b = 1, 2
-test_ok(a == 1 && b == 2)
-
-a, b = b, a
-test_ok(a == 2 && b == 1)
-
-a, = 1,2
-test_ok(a == 1)
-
-a, *b = 1, 2, 3
-test_ok(a == 1 && b == [2, 3])
-
-a, (b, c), d = 1, [2, 3], 4
-test_ok(a == 1 && b == 2 && c == 3 && d == 4)
-
-*a = 1, 2, 3
-test_ok(a == [1, 2, 3])
-
-*a = 4
-test_ok(a == [4])
-
-*a = nil
-test_ok(a == [nil])
-
-test_check "call"
-def aaa(a, b=100, *rest)
- res = [a, b]
- res += rest if rest
- return res
-end
-
-# not enough argument
-begin
- aaa() # need at least 1 arg
- test_ok(false)
-rescue
- test_ok(true)
-end
-
-begin
- aaa # no arg given (exception raised)
- test_ok(false)
-rescue
- test_ok(true)
-end
-
-test_ok(aaa(1) == [1, 100])
-test_ok(aaa(1, 2) == [1, 2])
-test_ok(aaa(1, 2, 3, 4) == [1, 2, 3, 4])
-test_ok(aaa(1, *[2, 3, 4]) == [1, 2, 3, 4])
-
-test_check "proc"
-$proc = Proc.new{|i| i}
-test_ok($proc.call(2) == 2)
-test_ok($proc.call(3) == 3)
-
-$proc = Proc.new{|i| i*2}
-test_ok($proc.call(2) == 4)
-test_ok($proc.call(3) == 6)
-
-Proc.new{
- iii=5 # nested local variable
- $proc = Proc.new{|i|
- iii = i
- }
- $proc2 = Proc.new {
- $x = iii # nested variables shared by procs
- }
- # scope of nested variables
- test_ok(defined?(iii))
-}.call
-test_ok(!defined?(iii)) # out of scope
-
-loop{iii=5; test_ok(eval("defined? iii")); break}
-loop {
- iii = 10
- def dyna_var_check
- loop {
- test_ok(!defined?(iii))
- break
- }
- end
- dyna_var_check
- break
-}
-$x=0
-$proc.call(5)
-$proc2.call
-test_ok($x == 5)
-
-if defined? Process.kill
- test_check "signal"
-
- $x = 0
- trap "SIGINT", Proc.new{|sig| $x = 2}
- Process.kill "SIGINT", $$
- 100.times {
- sleep 0.1
- break if $x != 0
- }
- test_ok($x == 2)
-
- trap "SIGINT", Proc.new{raise "Interrupt"}
-
- x = false
- begin
- Process.kill "SIGINT", $$
- sleep 0.1
- rescue
- x = $!
- end
- test_ok(x && /Interrupt/ =~ x.message)
-end
-
-test_check "eval"
-test_ok(eval("") == nil)
-$bad=false
-eval 'while false; $bad = true; print "foo\n" end'
-test_ok(!$bad)
-
-test_ok(eval('Object'))
-test_ok(eval('true'))
-test_ok(!eval('nil'))
-test_ok(!eval('false'))
-
-$foo = 'test_ok(true)'
-begin
- eval $foo
-rescue
- test_ok(false)
-end
-
-test_ok(eval("$foo") == 'test_ok(true)')
-test_ok(eval("true") == true)
-i = 5
-test_ok(eval("i == 5"))
-test_ok(eval("i") == 5)
-test_ok(eval("defined? i"))
-
-# eval with binding
-def test_ev
- local1 = "local1"
- lambda {
- local2 = "local2"
- return binding
- }.call
-end
-
-$x = test_ev
-test_ok(eval("local1", $x) == "local1") # normal local var
-test_ok(eval("local2", $x) == "local2") # nested local var
-$bad = true
-begin
- p eval("local1")
-rescue NameError # must raise error
- $bad = false
-end
-test_ok(!$bad)
-
-module EvTest
- EVTEST1 = 25
- evtest2 = 125
- $x = binding
-end
-test_ok(eval("EVTEST1", $x) == 25) # constant in module
-test_ok(eval("evtest2", $x) == 125) # local var in module
-$bad = true
-begin
- eval("EVTEST1")
-rescue NameError # must raise error
- $bad = false
-end
-test_ok(!$bad)
-
-x = binding #! YARV Limitation: Proc.new{}
-eval "i4 = 1", x
-test_ok(eval("i4", x) == 1)
-x = Proc.new{binding}.call #! YARV Limitation: Proc.new{Proc.new{}}.call
-eval "i4 = 22", x
-test_ok(eval("i4", x) == 22)
-$x = []
-x = Proc.new{binding}.call #! YARV Limitation: Proc.new{Proc.new{}}.call
-eval "(0..9).each{|i5| $x[i5] = Proc.new{i5*2}}", x
-test_ok($x[4].call == 8)
-
-x = binding
-eval "i = 1", x
-test_ok(eval("i", x) == 1)
-x = Proc.new{binding}.call
-eval "i = 22", x
-test_ok(eval("i", x) == 22)
-$x = []
-x = Proc.new{binding}.call
-eval "(0..9).each{|i5| $x[i5] = Proc.new{i5*2}}", x
-test_ok($x[4].call == 8)
-x = Proc.new{binding}.call
-eval "for i6 in 1..1; j6=i6; end", x
-test_ok(eval("defined? i6", x))
-test_ok(eval("defined? j6", x))
-
-Proc.new {
- p = binding
- eval "foo11 = 1", p
- foo22 = 5
- Proc.new{foo11=22}.call
- Proc.new{foo22=55}.call
- test_ok(eval("foo11", p) == eval("foo11"))
- test_ok(eval("foo11") == 1)
- test_ok(eval("foo22", p) == eval("foo22"))
- test_ok(eval("foo22") == 55)
-}.call if false #! YARV Limitation
-
-#! YARV Limitation: p1 = Proc.new{i7 = 0; Proc.new{i7}}.call
-p1 = Proc.new{i7 = 0; binding}.call
-#! YARV Limitation: test_ok(p1.call == 0)
-eval "i7=5", p1
-#! YARV Limitation: test_ok(p1.call == 5)
-test_ok(!defined?(i7))
-
-if false #! YARV Limitation
-p1 = Proc.new{i7 = 0; Proc.new{i7}}.call
-i7 = nil
-test_ok(p1.call == 0)
-eval "i7=1", p1
-test_ok(p1.call == 1)
-eval "i7=5", p1
-test_ok(p1.call == 5)
-test_ok(i7 == nil)
-end
-
-test_check "system"
-test_ok(`echo foobar` == "foobar\n")
-test_ok(`./miniruby -e 'print "foobar"'` == 'foobar')
-
-script_tmp = "script_tmp.#{$$}"
-tmp = open(script_tmp, "w")
-tmp.print "print $zzz\n";
-tmp.close
-
-test_ok(`./miniruby -s #{script_tmp} -zzz` == 'true')
-test_ok(`./miniruby -s #{script_tmp} -zzz=555` == '555')
-
-tmp = open(script_tmp, "w")
-tmp.print "#! /usr/local/bin/ruby -s\n";
-tmp.print "print $zzz\n";
-tmp.close
-
-test_ok(`./miniruby #{script_tmp} -zzz=678` == '678')
-
-tmp = open(script_tmp, "w")
-tmp.print "this is a leading junk\n";
-tmp.print "#! /usr/local/bin/ruby -s\n";
-tmp.print "print $zzz\n";
-tmp.print "__END__\n";
-tmp.print "this is a trailing junk\n";
-tmp.close
-
-test_ok(`./miniruby -x #{script_tmp}` == '')
-test_ok(`./miniruby -x #{script_tmp} -zzz=555` == '555')
-
-tmp = open(script_tmp, "w")
-for i in 1..5
- tmp.print i, "\n"
-end
-tmp.close
-
-`./miniruby -i.bak -pe '$_.sub!(/^[0-9]+$/){$&.to_i * 5}' #{script_tmp}`
-done = true
-tmp = open(script_tmp, "r")
-while tmp.gets
- if $_.to_i % 5 != 0
- done = false
- break
- end
-end
-tmp.close
-test_ok(done)
-
-File.unlink script_tmp or `/bin/rm -f "#{script_tmp}"`
-File.unlink "#{script_tmp}.bak" or `/bin/rm -f "#{script_tmp}.bak"`
-
-test_check "const"
-TEST1 = 1
-TEST2 = 2
-
-module Const
- TEST3 = 3
- TEST4 = 4
-end
-
-module Const2
- TEST3 = 6
- TEST4 = 8
-end
-
-include Const
-
-test_ok([TEST1,TEST2,TEST3,TEST4] == [1,2,3,4])
-
-include Const2
-STDERR.print "intentionally redefines TEST3, TEST4\n" if $VERBOSE
-test_ok([TEST1,TEST2,TEST3,TEST4] == [1,2,6,8])
-
-
-test_ok((String <=> Object) == -1)
-test_ok((Object <=> String) == 1)
-test_ok((Array <=> String) == nil)
-
-test_check "clone"
-foo = Object.new
-def foo.test
- "test"
-end
-bar = foo.clone
-def bar.test2
- "test2"
-end
-
-test_ok(bar.test2 == "test2")
-test_ok(bar.test == "test")
-test_ok(foo.test == "test")
-
-begin
- foo.test2
- test_ok false
-rescue NoMethodError
- test_ok true
-end
-
-module M001; end
-module M002; end
-module M003; include M002; end
-module M002; include M001; end
-module M003; include M002; end
-
-test_ok(M003.ancestors == [M003, M002, M001])
-
-test_check "marshal"
-$x = [1,2,3,[4,5,"foo"],{1=>"bar"},2.5,fact(30)]
-$y = Marshal.dump($x)
-test_ok($x == Marshal.load($y))
-
-StrClone=String.clone;
-test_ok(Marshal.load(Marshal.dump(StrClone.new("abc"))).class == StrClone)
-
-[[1,2,3,4], [81, 2, 118, 3146]].each { |w,x,y,z|
- a = (x.to_f + y.to_f / z.to_f) * Math.exp(w.to_f / (x.to_f + y.to_f / z.to_f))
- ma = Marshal.dump(a)
- b = Marshal.load(ma)
- test_ok(a == b)
-}
-
-test_check "pack"
-
-$format = "c2x5CCxsdils_l_a6";
-# Need the expression in here to force ary[5] to be numeric. This avoids
-# test2 failing because ary2 goes str->numeric->str and ary does not.
-ary = [1,-100,127,128,32767,987.654321098 / 100.0,12345,123456,-32767,-123456,"abcdef"]
-$x = ary.pack($format)
-ary2 = $x.unpack($format)
-
-test_ok(ary.length == ary2.length)
-test_ok(ary.join(':') == ary2.join(':'))
-test_ok($x =~ /def/)
-
-$x = [-1073741825]
-test_ok($x.pack("q").unpack("q") == $x)
-
-test_check "math"
-test_ok(Math.sqrt(4) == 2)
-
-include Math
-test_ok(sqrt(4) == 2)
-
-test_check "struct"
-struct_test = Struct.new("Test", :foo, :bar)
-test_ok(struct_test == Struct::Test)
-
-test = struct_test.new(1, 2)
-test_ok(test.foo == 1 && test.bar == 2)
-test_ok(test[0] == 1 && test[1] == 2)
-
-a, b = test.to_a
-test_ok(a == 1 && b == 2)
-
-test[0] = 22
-test_ok(test.foo == 22)
-
-test.bar = 47
-test_ok(test.bar == 47)
-
-test_check "variable"
-test_ok($$.instance_of?(Integer))
-
-# read-only variable
-begin
- $$ = 5
- test_ok false
-rescue NameError
- test_ok true
-end
-
-foobar = "foobar"
-$_ = foobar
-test_ok($_ == foobar)
-
-class Gods
- @@rule = "Uranus" # private to Gods
- def ruler0
- @@rule
- end
-
- def self.ruler1 # <= per method definition style
- @@rule
- end
- class << self # <= multiple method definition style
- def ruler2
- @@rule
- end
- end
-end
-
-module Olympians
- @@rule ="Zeus"
- def ruler3
- @@rule
- end
-end
-
-class Titans < Gods
- @@rule = "Cronus" # do not affect @@rule in Gods
- include Olympians
- def ruler4
- @@rule
- end
-end
-
-test_ok(Gods.new.ruler0 == "Cronus")
-test_ok(Gods.ruler1 == "Cronus")
-test_ok(Gods.ruler2 == "Cronus")
-test_ok(Titans.ruler1 == "Cronus")
-test_ok(Titans.ruler2 == "Cronus")
-atlas = Titans.new
-test_ok(atlas.ruler0 == "Cronus")
-test_ok(atlas.ruler3 == "Zeus")
-test_ok(atlas.ruler4 == "Cronus")
-
-test_check "trace"
-$x = 1234
-$y = 0
-trace_var :$x, Proc.new{$y = $x}
-$x = 40414
-test_ok($y == $x)
-
-untrace_var :$x
-$x = 19660208
-test_ok($y != $x)
-
-trace_var :$x, Proc.new{$x *= 2}
-$x = 5
-test_ok($x == 10)
-
-untrace_var :$x
-
-test_check "defined?"
-
-test_ok(defined?($x)) # global variable
-test_ok(defined?($x) == 'global-variable')# returns description
-
-foo=5
-test_ok(defined?(foo)) # local variable
-
-test_ok(defined?(Array)) # constant
-test_ok(defined?(Object.new)) # method
-test_ok(!defined?(Object.print))# private method
-test_ok(defined?(1 == 2)) # operator expression
-
-class Foo
- def foo
- p :foo
- end
- protected :foo
- def bar(f)
- test_ok(defined?(self.foo))
- test_ok(defined?(f.foo))
- end
-end
-f = Foo.new
-test_ok(defined?(f.foo) == nil)
-f.bar(f)
-
-def defined_test
- return !defined?(yield)
-end
-
-test_ok(defined_test) # not iterator
-test_ok(!defined_test{}) # called as iterator
-
-test_check "alias"
-class Alias0
- def foo; "foo" end
-end
-class Alias1 < Alias0
- alias bar foo
- def foo; "foo+" + super end
-end
-class Alias2 < Alias1
- alias baz foo
- undef foo
-end
-
-x = Alias2.new
-test_ok(x.bar == "foo")
-test_ok(x.baz == "foo+foo")
-
-# test_check for cache
-test_ok(x.baz == "foo+foo")
-
-class Alias3 < Alias2
- def foo
- defined? super
- end
- def bar
- defined? super
- end
- def quux
- defined? super
- end
-end
-x = Alias3.new
-test_ok(!x.foo)
-test_ok(x.bar)
-test_ok(!x.quux)
-
-test_check "path"
-test_ok(File.basename("a") == "a")
-test_ok(File.basename("a/b") == "b")
-test_ok(File.basename("a/b/") == "b")
-test_ok(File.basename("/") == "/")
-test_ok(File.basename("//") == "/")
-test_ok(File.basename("///") == "/")
-test_ok(File.basename("a/b////") == "b")
-test_ok(File.basename("a.rb", ".rb") == "a")
-test_ok(File.basename("a.rb///", ".rb") == "a")
-test_ok(File.basename("a.rb///", ".*") == "a")
-test_ok(File.basename("a.rb///", ".c") == "a.rb")
-test_ok(File.dirname("a") == ".")
-test_ok(File.dirname("/") == "/")
-test_ok(File.dirname("/a") == "/")
-test_ok(File.dirname("a/b") == "a")
-test_ok(File.dirname("a/b/c") == "a/b")
-test_ok(File.dirname("/a/b/c") == "/a/b")
-test_ok(File.dirname("/a/b/") == "/a")
-test_ok(File.dirname("/a/b///") == "/a")
-case Dir.pwd
-when %r'\A\w:'
- test_ok(/\A\w:\/\z/ =~ File.expand_path(".", "/"))
- test_ok(/\A\w:\/a\z/ =~ File.expand_path("a", "/"))
- dosish = true
-when %r'\A//'
- test_ok(%r'\A//[^/]+/[^/]+\z' =~ File.expand_path(".", "/"))
- test_ok(%r'\A//[^/]+/[^/]+/a\z' =~ File.expand_path(".", "/"))
- dosish = true
-else
- test_ok(File.expand_path(".", "/") == "/")
- test_ok(File.expand_path("sub", "/") == "/sub")
-end
-if dosish
- test_ok(File.expand_path("/", "//machine/share/sub") == "//machine/share")
- test_ok(File.expand_path("/dir", "//machine/share/sub") == "//machine/share/dir")
- test_ok(File.expand_path("/", "z:/sub") == "z:/")
- test_ok(File.expand_path("/dir", "z:/sub") == "z:/dir")
-end
-test_ok(File.expand_path(".", "//") == "//")
-test_ok(File.expand_path("sub", "//") == "//sub")
-
-# test_check "Proc#binding"
-ObjectSpace.each_object(Proc){|o|
- begin
- b = o.binding
- eval 'self', b
- rescue ArgumentError
- end
-}
-
-test_check "gc"
-begin
- 1.upto(10000) {
- tmp = [0,1,2,3,4,5,6,7,8,9]
- }
- tmp = nil
- test_ok true
-rescue
- test_ok false
-end
-class S
- def initialize(a)
- @a = a
- end
-end
-l=nil
-100000.times {
- l = S.new(l)
-}
-GC.start
-test_ok true # reach here or dumps core
-l = []
-100000.times {
- l.push([l])
-}
-GC.start
-test_ok true # reach here or dumps core
-
-ObjectSpace.each_object{|o|
- o.class.name
-}
-
-test_ok true # reach here or dumps core
-
-PROGRESS.finish
-if $failed > 0
- printf "not ok/test: %d failed %d\n", $ntest, $failed
-else
- printf "end of test(test: %d)\n", $ntest
-end
diff --git a/bcc32/Makefile.sub b/bcc32/Makefile.sub
new file mode 100644
index 0000000000..0c4c6bb126
--- /dev/null
+++ b/bcc32/Makefile.sub
@@ -0,0 +1,585 @@
+# -*- makefile -*-
+
+SHELL = $(COMSPEC)
+
+#### Start of system configuration section. ####
+OS = bccwin32
+RT = $(OS)
+
+## variables may be overridden by $(compile_dir)/Makefile
+!ifndef srcdir
+srcdir = ..
+!endif
+!ifndef RUBY_INSTALL_NAME
+RUBY_INSTALL_NAME = ruby
+!endif
+!ifndef RUBYW_INSTALL_NAME
+RUBYW_INSTALL_NAME = $(RUBY_INSTALL_NAME:ruby=rubyw)
+!elif "$(RUBYW_INSTALL_NAME)" == "$(RUBY_INSTALL_NAME)"
+RUBYW_INSTALL_NAME = $(RUBY_INSTALL_NAME:ruby=rubyw)
+!endif
+!if "$(RUBYW_INSTALL_NAME)" == "$(RUBY_INSTALL_NAME)"
+RUBYW_INSTALL_NAME = $(RUBY_INSTALL_NAME)w
+!endif
+!ifndef RUBY_SO_NAME
+RUBY_SO_NAME = $(RT)-$(RUBY_INSTALL_NAME)$(MAJOR)$(MINOR)
+!endif
+!ifndef icondirs
+!ifdef ICONDIRS
+icondirs=$(ICONDIRS)
+!endif
+!endif
+!ifdef icondirs
+icondirs=$(icondirs:\=/)
+iconinc=-I$(icondirs: = -I)
+!endif
+###############
+
+VPATH = $(srcdir):$(srcdir)/missing
+.SUFFIXES: .y
+
+!ifndef CC
+CC = bcc32
+!endif
+!ifndef CPP
+CPP = cpp32
+!endif
+!ifndef RC
+RC = brcc32
+!endif
+!ifndef YACC
+YACC = byacc
+!endif
+!ifndef AR
+AR = tlib
+!endif
+
+PURIFY =
+AUTOCONF = autoconf
+
+!if !defined(PROCESSOR_ARCHITECTURE)
+PROCESSOR_ARCHITECTURE = x86
+!endif
+MACHINE = $(PROCESSOR_ARCHITECTURE)
+!if "$(PROCESSOR_ARCHITECTURE)" == "x86"
+!ifndef PROCESSOR_LEVEL
+PROCESSOR_LEVEL = 5
+!endif
+!if 6 < $(PROCESSOR_LEVEL)
+PROCESSOR_LEVEL = 6
+!endif
+PROCESSOR_FLAG = -$(PROCESSOR_LEVEL)
+CPU = i$(PROCESSOR_LEVEL)86
+ARCH = i386
+!else
+CPU = $(PROCESSOR_ARCHITECTURE)
+ARCH = $(PROCESSOR_ARCHITECTURE)
+!endif
+!ifndef DEBUGFLAGS
+DEBUGFLAGS =
+!endif
+!ifndef OPTFLAGS
+OPTFLAGS = -O
+!endif
+
+!ifndef prefix
+prefix = /usr
+!endif
+!ifndef exec_prefix
+exec_prefix = $(prefix)
+!endif
+!ifndef libdir
+libdir = $(exec_prefix)/lib
+!endif
+!ifndef DESTDIR
+DESTDIR = $(prefix)
+!endif
+!ifndef CFLAGS
+CFLAGS = -q $(DEBUGFLAGS) $(OPTFLAGS) $(PROCESSOR_FLAG) -w- -wsus -wcpt -wdup -wext -wrng -wrpt -wzdi
+!endif
+!ifndef CPPFLAGS
+CPPFLAGS = -I. -I$(srcdir) -I$(srcdir)missing
+!endif
+!ifndef LDFLAGS
+LDFLAGS = -S:$(STACK)
+!endif
+!ifndef RFLAGS
+RFLAGS = $(iconinc)
+!endif
+!ifndef EXTLIBS
+EXTLIBS =
+!endif
+LIBS = cw32.lib import32.lib ws2_32.lib $(EXTLIBS)
+MISSING = acosh.obj crypt.obj erf.obj win32.obj
+
+!ifndef STACK
+STACK = 0x2000000
+!endif
+
+XCFLAGS = -DRUBY_EXPORT
+
+ARFLAGS = /a
+LD = ilink32 -q -Gn
+LDSHARED = $(LD)
+XLDFLAGS = -Tpe c0x32.obj
+WLDFLAGS = -aa -Tpe c0w32.obj
+DLDFLAGS = -Tpd c0d32.obj
+LIBRUBY_LDSHARED = $(LDSHARED)
+LIBRUBY_DLDFLAGS = -Gi $(DLDFLAGS) $(EXTLDFLAGS)
+LDOBJECTS = $(MAINOBJ)
+
+SOLIBS =
+
+EXEEXT = .exe
+PROGRAM=$(RUBY_INSTALL_NAME)$(EXEEXT)
+WPROGRAM=$(RUBYW_INSTALL_NAME)$(EXEEXT)
+RUBYDEF = $(RUBY_SO_NAME).def
+MINIRUBY = .\miniruby$(EXEEXT)
+
+ORGLIBPATH = $(LIB)
+
+#### End of system configuration section. ####
+
+LIBRUBY_A = $(RUBY_SO_NAME)-static.lib
+LIBRUBY_SO = $(RUBY_SO_NAME).dll
+LIBRUBY = $(RUBY_SO_NAME).lib
+LIBRUBYARG = $(LIBRUBY)
+
+!ifndef EXTOBJS
+EXTOBJS = dmyext.obj
+!endif
+
+MAINOBJ = main.obj
+WINMAINOBJ = winmain.obj
+
+OBJS = array.obj \
+ bignum.obj \
+ class.obj \
+ compar.obj \
+ dir.obj \
+ dln.obj \
+ enum.obj \
+ error.obj \
+ eval.obj \
+ file.obj \
+ gc.obj \
+ hash.obj \
+ inits.obj \
+ io.obj \
+ marshal.obj \
+ math.obj \
+ numeric.obj \
+ object.obj \
+ pack.obj \
+ parse.obj \
+ prec.obj \
+ process.obj \
+ random.obj \
+ range.obj \
+ re.obj \
+ regex.obj \
+ ruby.obj \
+ signal.obj \
+ sprintf.obj \
+ st.obj \
+ string.obj \
+ struct.obj \
+ time.obj \
+ util.obj \
+ variable.obj \
+ version.obj \
+ $(MISSING)
+
+SCRIPT_ARGS = "--dest-dir=$(DESTDIR)" \
+ "--make=$(MAKE)" \
+ "--mflags=$(MFLAGS)" \
+ "--make-flags=$(MAKEFLAGS)"
+
+all: miniruby$(EXEEXT) rbconfig.rb \
+ $(LIBRUBY) $(MISCLIBS)
+ .\miniruby$(EXEEXT) $(srcdir)ext/extmk.rb --extstatic=$(EXTSTATIC) $(SCRIPT_ARGS)
+
+ruby: $(PROGRAM)
+rubyw: $(WPROGRAM)
+lib: $(LIBRUBY)
+dll: $(LIBRUBY_SO)
+
+config: config.h config.status
+
+config.h:
+ @echo Creating $(@:.\=)
+ @type > $@ &&|
+\#define HAVE_SYS_TYPES_H 1
+\#define HAVE_SYS_STAT_H 1
+\#define HAVE_STDLIB_H 1
+\#define HAVE_STRING_H 1
+\#define HAVE_MEMORY_H 1
+\#define HAVE_OFF_T 1
+\#define SIZEOF_INT 4
+\#define SIZEOF_SHORT 2
+\#define SIZEOF_LONG 4
+\#define SIZEOF_LONG_LONG 0
+\#define SIZEOF___INT64 8
+\#define SIZEOF_OFF_T 4
+\#define SIZEOF_VOIDP 4
+\#define SIZEOF_FLOAT 4
+\#define SIZEOF_DOUBLE 8
+\#define SIZEOF_TIME_T 4
+\#define HAVE_PROTOTYPES 1
+\#define TOKEN_PASTE(x,y) x\#\#y
+\#define HAVE_STDARG_PROTOTYPES 1
+\#define NORETURN(x) x
+\#define HAVE_DECL_SYS_NERR 1
+\#define HAVE_LIMITS_H 1
+\#define HAVE_FCNTL_H 1
+\#define HAVE_UTIME_H 1
+\#define HAVE_FLOAT_H 1
+\#define HAVE_STRUCT_STAT_ST_RDEV 1
+\#define HAVE_ST_RDEV 1
+\#define GETGROUPS_T int
+\#define RETSIGTYPE void
+\#define HAVE_ALLOCA 1
+\#define HAVE_DUP2 1
+\#define HAVE_MEMMOVE 1
+\#define HAVE_MKDIR 1
+\#define HAVE_STRCASECMP 1
+\#define HAVE_STRNCASECMP 1
+\#define HAVE_STRERROR 1
+\#define HAVE_STRFTIME 1
+\#define HAVE_STRCHR 1
+\#define HAVE_STRSTR 1
+\#define HAVE_STRTOD 1
+\#define HAVE_STRTOL 1
+\#define HAVE_STRTOUL 1
+\#define HAVE_ISNAN 1
+\#define HAVE_FINITE 1
+\#define HAVE_FMOD 1
+\#define HAVE_WAITPID 1
+\#define HAVE_FSYNC 1
+\#define HAVE_GETCWD 1
+\#define HAVE_CHSIZE 1
+\#define HAVE_TIMES 1
+\#define HAVE_LINK 1
+\#define HAVE_TELLDIR 1
+\#define HAVE_SEEKDIR 1
+\#define HAVE_COSH 1
+\#define HAVE_SINH 1
+\#define HAVE_TANH 1
+\#define RSHIFT(x,y) ((x)>>(int)y)
+\#define FILE_COUNT level
+\#define FILE_READPTR curp
+\#define inline __inline
+\#define NEED_IO_SEEK_BETWEEN_RW 1
+\#define STACK_GROW_DIRECTION -1
+\#define DEFAULT_KCODE KCODE_NONE
+\#define DLEXT ".so"
+\#define DLEXT2 ".dll"
+\#define RUBY_LIB "/lib/ruby/$(MAJOR).$(MINOR)"
+\#define RUBY_SITE_LIB "/lib/ruby/site_ruby"
+\#define RUBY_SITE_LIB2 "/lib/ruby/site_ruby/$(MAJOR).$(MINOR)"
+\#define RUBY_PLATFORM "$(ARCH)-$(OS)"
+\#define RUBY_ARCHLIB "/lib/ruby/$(MAJOR).$(MINOR)/$(ARCH)-$(OS)"
+\#define RUBY_SITE_ARCHLIB "/lib/ruby/site_ruby/$(MAJOR).$(MINOR)/$(ARCH)-$(OS)"
+|
+
+config.status: Makefile $(srcdir)bcc32/Makefile.sub
+ @echo Creating $@
+ @type > $@ &&|
+# Generated automatically by Makefile.sub.
+s,@SHELL@,$$(COMSPEC),;t t
+s,@CFLAGS@,$(CFLAGS),;t t
+s,@CPPFLAGS@,$(CPPFLAGS),;t t
+s,@CXXFLAGS@,$(CXXFLAGS),;t t
+s,@FFLAGS@,$(FFLAGS),;t t
+s,@LDFLAGS@,,;t t
+s,@LIBS@,$(LIBS),;t t
+s,@exec_prefix@,$${prefix},;t t
+s,@prefix@,,;t t
+s,@program_transform_name@,s,,,,;t t
+s,@bindir@,$${exec_prefix}/bin,;t t
+s,@sbindir@,$${exec_prefix}/sbin,;t t
+s,@libexecdir@,$${exec_prefix}/libexec,;t t
+s,@datadir@,$${prefix}/share,;t t
+s,@sysconfdir@,$${prefix}/etc,;t t
+s,@sharedstatedir@,/etc,;t t
+s,@localstatedir@,/var,;t t
+s,@libdir@,$${exec_prefix}/lib,;t t
+s,@includedir@,$${prefix}/include,;t t
+s,@oldincludedir@,/usr/include,;t t
+s,@infodir@,$${prefix}/info,;t t
+s,@mandir@,$${prefix}/man,;t t
+s,@build@,$(CPU)-pc-$(OS),;t t
+s,@build_alias@,$(CPU)-$(OS),;t t
+s,@build_cpu@,$(CPU),;t t
+s,@build_vendor@,pc,;t t
+s,@build_os@,$(OS),;t t
+s,@host@,$(CPU)-pc-$(OS),;t t
+s,@host_alias@,$(CPU)-$(OS),;t t
+s,@host_cpu@,$(CPU),;t t
+s,@host_vendor@,pc,;t t
+s,@host_os@,$(OS),;t t
+s,@target@,$(ARCH)-pc-$(OS),;t t
+s,@target_alias@,$(ARCH)-$(OS),;t t
+s,@target_cpu@,$(ARCH),;t t
+s,@target_vendor@,pc,;t t
+s,@target_os@,$(OS),;t t
+s,@CC@,$(CC),;t t
+s,@CPP@,cpp32,;t t
+s,@YACC@,$(YACC),;t t
+s,@RANLIB@,,;t t
+s,@AR@,$(AR),;t t
+s,@ARFLAGS@,$(ARFLAGS) ,;t t
+s,@LN_S@,$(LN_S),;t t
+s,@SET_MAKE@,$(SET_MAKE),;t t
+s,@LIBOBJS@, acosh.obj crypt.obj erf.obj win32.obj,;t t
+s,@ALLOCA@,$(ALLOCA),;t t
+s,@DEFAULT_KCODE@,$(DEFAULT_KCODE),;t t
+s,@EXEEXT@,.exe,;t t
+s,@OBJEXT@,obj,;t t
+s,@XCFLAGS@,$(XCFLAGS),;t t
+s,@XLDFLAGS@,$(XLDFLAGS),;t t
+s,@DLDFLAGS@,$(DLDFLAGS),;t t
+s,@ARCH_FLAG@,$(ARCH_FLAG),;t t
+s,@STATIC@,$(STATIC),;t t
+s,@CCDLFLAGS@,,;t t
+s,@LDSHARED@,$(LDSHARED),;t t
+s,@DLEXT@,so,;t t
+s,@DLEXT2@,dll,;t t
+s,@LIBEXT@,lib,;t t
+s,@STRIP@,$(STRIP),;t t
+s,@EXTSTATIC@,$(EXTSTATIC),;t t
+s,@setup@,Setup,;t t
+s,@MINIRUBY@,$(MINIRUBY),;t t
+s,@LIBRUBY_LDSHARED@,$$(LDSHARED),;t t
+s,@LIBRUBY_DLDFLAGS@,-Gi $$(DLDFLAGS),;t t
+s,@RUBY_INSTALL_NAME@,$(RUBY_INSTALL_NAME),;t t
+s,@rubyw_install_name@,$(RUBYW_INSTALL_NAME),;t t
+s,@RUBYW_INSTALL_NAME@,$(RUBYW_INSTALL_NAME),;t t
+s,@RUBY_SO_NAME@,$(RUBY_SO_NAME),;t t
+s,@LIBRUBY_A@,$$(RUBY_SO_NAME)-static.lib,;t t
+s,@LIBRUBY_SO@,$$(RUBY_SO_NAME).dll,;t t
+s,@LIBRUBY_ALIASES@,$(LIBRUBY_ALIASES),;t t
+s,@LIBRUBY@,$$(RUBY_SO_NAME).lib,;t t
+s,@LIBRUBYARG@,$$(LIBRUBYARG_SHARED),;t t
+s,@LIBRUBYARG_STATIC@,$$(LIBRUBY_A),;t t
+s,@LIBRUBYARG_SHARED@,$$(LIBRUBY),;t t
+s,@SOLIBS@,$(SOLIBS),;t t
+s,@DLDLIBS@,$(DLDLIBS),;t t
+s,@ENABLE_SHARED@,yes,;t t
+s,@OUTFLAG@,-o,;t t
+s,@CPPOUTFILE@,,;t t
+s,@LIBPATHFLAG@, -L"%s",;t t
+s,@RPATHFLAG@,,;t t
+s,@LIBARG@,%s.lib,;t t
+s,@LINK_SO@,$$(LDSHARED) $$(DLDFLAGS) $$(LIBPATH) $$(OBJS), $$(@:/=\), nul, $$(LIBS) $$(LOCAL_LIBS), $$(DEFFILE), $$(RESFILE),;t t
+s,@COMPILE_C@,$$(CC) $$(CFLAGS) $$(CPPFLAGS) -c $$(<:/=\),;t t
+s,@COMPILE_CXX@,$$(CXX) $$(CXXFLAGS) $$(CPPFLAGS) -P -c $$(<:/=\),;t t
+s,@COMPILE_RULES@,{$$(srcdir)}.%s{}.%s: .%s.%s:,;t t
+s,@COMMON_LIBS@,m,;t t
+s,@COMMON_MACROS@,WIN32_LEAN_AND_MEAN;t t
+s,@COMMON_HEADERS@,winsock2.h windows.h,;t t
+s,@TRY_LINK@,$$(CC) -oconftest $$(INCFLAGS) -I$$(hdrdir) $$(CPPFLAGS) $$(CFLAGS) $$(LIBPATH) $$(LDFLAGS) $$(src) $$(LOCAL_LIBS) $$(LIBS),;t t
+s,@EXPORT_PREFIX@,_,;t t
+s,@arch@,$(ARCH)-$(OS),;t t
+s,@sitearch@,$(ARCH)-$(OS),;t t
+s,@sitedir@,$${prefix}/lib/ruby/site_ruby,;t t
+s,@configure_args@,--enable-shared $(configure_args),;t t
+s,@configure_input@,$$configure_input,;t t
+s,@srcdir@,$(srcdir),;t t
+s,@top_srcdir@,$(srcdir),;t t
+|
+
+miniruby$(EXEEXT): $(LIBRUBY_A) $(MAINOBJ) dmyext.obj
+ @echo $(LIBS)
+ $(LD) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ) dmyext.obj,$@,nul,$(LIBRUBY_A) $(LIBS)
+
+$(PROGRAM): $(MAINOBJ) $(LIBRUBY_SO) $(RUBY_INSTALL_NAME).res
+ $(LD) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ),$@,nul,$(LIBRUBYARG) $(LIBS),,$(RUBY_INSTALL_NAME).res
+
+$(WPROGRAM): $(MAINOBJ) $(WINMAINOBJ) $(LIBRUBY_SO) $(RUBYW_INSTALL_NAME).res
+ $(LD) $(LDFLAGS) $(WLDFLAGS) $(MAINOBJ) $(WINMAINOBJ),$@,nul,$(LIBRUBYARG) $(LIBS),,$(RUBYW_INSTALL_NAME).res
+
+$(LIBRUBY_A): $(OBJS) dmyext.obj
+ @-if exist $@ del $@
+ $(AR) $(ARFLAGS) "$@" $(OBJS) dmyext.obj
+
+# $(LIBRUBY): $(LIBRUBY_SO)
+# implib $@ $(LIBRUBY_SO)
+
+$(LIBRUBY_SO) $(LIBRUBY): $(LIBRUBY_A) $(EXTOBJS) $(RUBYDEF) $(RUBY_SO_NAME).res
+ @echo $(EXTOBJS)
+ $(LIBRUBY_LDSHARED) $(LIBRUBY_DLDFLAGS) $(EXTOBJS:/=\),$(LIBRUBY_SO),nul,$(LIBRUBY_A) $(LIBS),$(RUBYDEF),$(RUBY_SO_NAME).res
+
+$(RUBYDEF): $(LIBRUBY_A) miniruby$(EXEEXT)
+ $(MINIRUBY) $(srcdir)bcc32/mkexports.rb -output=$@ $(LIBRUBY_A)
+
+install: rbconfig.rb
+ $(MINIRUBY) $(srcdir)instruby.rb $(SCRIPT_ARGS)
+ $(MINIRUBY) $(srcdir)ext/extmk.rb $(SCRIPT_ARGS) install
+
+what-where no-install: rbconfig.rb
+ $(MINIRUBY) $(srcdir)instruby.rb -n $(SCRIPT_ARGS)
+ $(MINIRUBY) $(srcdir)ext/extmk.rb -n $(SCRIPT_ARGS) install
+
+clean: clean-ext clean-local
+
+clean-local:
+ @if exist $(LIBRUBY_A) del $(LIBRUBY_A)
+ @if exist $(MAINOBJ) del $(MAINOBJ)
+ @if exist rbconfig.rb del rbconfig.rb
+ @if exist ext\extinit.c del ext\extinit.c
+ @if exist ext\extinit.obj del ext\extinit.obj
+ @if exist ext\vc*.pdb del ext\vc*.pdb
+ @if exist *.obj del *.obj
+ @if exist *.res del *.res
+ @if exist *.tds del *.tds
+ @if exist *.il? del *.il?
+
+clean-ext:
+ @-$(MINIRUBY) $(srcdir)ext/extmk.rb $(SCRIPT_ARGS) clean
+
+distclean: distclean-ext distclean-local
+
+distclean-local: clean-local
+ @if exist Makefile del Makefile
+ @if exist config.h del config.h
+ @if exist ext\config.cache del ext\config.cache
+ @if exist config.cache del config.cache
+ @if exist config.log del config.log
+ @if exist config.status del config.status
+ @if exist *~ del *~
+ @if exist *.bak del *.bak
+ @if exist *.stackdump del *.stackdump
+ @if exist *.core del *.core
+ @if exist gmon.out del gmon.out
+ @if exist y.tab.c del y.tab.c
+ @if exist y.output del y.output
+ @if exist *.map del *.map
+ @if exist *.pdb del *.pdb
+ @if exist *.ilk del *.ilk
+ @if exist *.exp del *.exp
+ @if exist $(RUBYDEF) del $(RUBYDEF)
+ @if exist $(RUBY_INSTALL_NAME).rc del $(RUBY_INSTALL_NAME).rc
+ @if exist $(RUBYW_INSTALL_NAME).rc del $(RUBYW_INSTALL_NAME).rc
+ @if exist $(RUBY_SO_NAME).rc del $(RUBY_SO_NAME).rc
+ @if exist $(PROGRAM) del $(PROGRAM)
+ @if exist $(WPROGRAM) del $(WPROGRAM)
+ @if exist $(LIBRUBY_SO) del $(LIBRUBY_SO)
+ @if exist $(LIBRUBY) del $(LIBRUBY)
+ @if exist ext\nul if not exist ext\* rmdir ext
+ @if exist miniruby$(EXEEXT) del miniruby$(EXEEXT)
+
+distclean-ext:
+ @-$(MINIRUBY) $(srcdir)ext/extmk.rb $(SCRIPT_ARGS) distclean
+
+realclean: distclean
+ @if exist parse.c del parse.c
+ @if exist lex.c del lex.c
+
+test: miniruby$(EXEEXT) NUL
+ @$(MINIRUBY) $(srcdir)rubytest.rb
+
+rbconfig.rb: miniruby$(EXEEXT) config.status
+ @$(MINIRUBY) $(srcdir)mkconfig.rb -srcdir=$(srcdir) \
+ -install_name=$(RUBY_INSTALL_NAME) \
+ -so_name=$(RUBY_SO_NAME) rbconfig.rb
+
+$(RUBY_INSTALL_NAME).rc $(RUBYW_INSTALL_NAME).rc $(RUBY_SO_NAME).rc: rbconfig.rb
+ @$(MINIRUBY) $(srcdir)win32/resource.rb \
+ -ruby_name=$(RUBY_INSTALL_NAME) \
+ -rubyw_name=$(RUBYW_INSTALL_NAME) \
+ -so_name=$(RUBY_SO_NAME) \
+ . $(icondirs) $(srcdir)win32
+
+#config.status: $(srcdir)configure
+# $(SHELL) .config.status --recheck
+
+.path.c = .;$(srcdir);$(srcdir)win32;$(srcdir)missing
+.path.h = .;$(srcdir);$(srcdir)win32;$(srcdir)missing
+.path.y = $(srcdir)
+
+.c.obj:
+ $(CC) $(CFLAGS) $(XCFLAGS) -I. $(CPPFLAGS) -c $(<:/=\)
+
+.rc.res:
+ $(RC) $(RFLAGS) -I. -I$(<D). $(iconinc) -I$(srcdir)win32 $(RFLAGS) -fo$@ $(<:/=\)
+
+.y.c:
+ $(YACC) $(YFLAGS) $(<:\=/)
+ sed -e "s!^ *extern char \*getenv();!/* & */!;s/^\(#.*\)y\.tab/\1parse/" y.tab.c > $(@F)
+ @del y.tab.c
+
+parse.c: parse.y
+
+ext/extinit.obj: ext/extinit.c $(SETUP)
+ $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) -o$@ -c ext/extinit.c
+
+acosh.obj: acosh.c win32.h
+alloca.obj: alloca.c win32.h
+crypt.obj: crypt.c win32.h
+dup2.obj: dup2.c win32.h
+erf.obj: erf.c win32.h
+finite.obj: finite.c win32.h
+flock.obj: flock.c win32.h
+memcmp.obj: memcmp.c win32.h
+memmove.obj: memmove.c win32.h
+mkdir.obj: mkdir.c win32.h
+vsnprintf.obj: vsnprintf.c win32.h
+strcasecmp.obj: strcasecmp.c win32.h
+strncasecmp.obj: strncasecmp.c win32.h
+strchr.obj: strchr.c win32.h
+strdup.obj: strdup.c win32.h
+strerror.obj: strerror.c win32.h
+strftime.obj: strftime.c win32.h
+strstr.obj: strstr.c win32.h
+strtod.obj: strtod.c win32.h
+strtol.obj: strtol.c win32.h
+strtoul.obj: strtoul.c win32.h
+nt.obj: nt.c win32.h
+x68.obj: x68.c win32.h
+os2.obj: os2.c win32.h
+dl_os2.obj: dl_os2.c win32.h
+
+# when I use -I., there is confliction at "OpenFile"
+# so, set . into environment varible "include"
+win32.obj: win32.c win32.h
+
+###
+array.obj: array.c ruby.h config.h defines.h intern.h missing.h util.h st.h win32.h
+bignum.obj: bignum.c ruby.h config.h defines.h intern.h missing.h win32.h
+class.obj: class.c ruby.h config.h defines.h intern.h missing.h rubysig.h node.h st.h win32.h
+compar.obj: compar.c ruby.h config.h defines.h intern.h missing.h win32.h
+dir.obj: dir.c ruby.h config.h defines.h intern.h missing.h util.h win32.h
+dln.obj: dln.c ruby.h config.h defines.h intern.h missing.h dln.h win32.h
+dmyext.obj: dmyext.c
+enum.obj: enum.c ruby.h config.h defines.h intern.h missing.h node.h util.h win32.h
+error.obj: error.c ruby.h config.h defines.h intern.h missing.h env.h st.h win32.h
+eval.obj: eval.c ruby.h config.h defines.h intern.h missing.h node.h env.h util.h rubysig.h st.h dln.h win32.h
+file.obj: file.c ruby.h config.h defines.h intern.h missing.h rubyio.h rubysig.h util.h dln.h win32.h
+gc.obj: gc.c ruby.h config.h defines.h intern.h missing.h rubysig.h st.h node.h env.h re.h regex.h win32.h
+hash.obj: hash.c ruby.h config.h defines.h intern.h missing.h st.h util.h rubysig.h win32.h
+inits.obj: inits.c ruby.h config.h defines.h intern.h missing.h win32.h
+io.obj: io.c ruby.h config.h defines.h intern.h missing.h rubyio.h rubysig.h env.h util.h win32.h
+main.obj: main.c ruby.h config.h defines.h intern.h missing.h win32.h
+marshal.obj: marshal.c ruby.h config.h defines.h intern.h missing.h rubyio.h st.h util.h win32.h
+math.obj: math.c ruby.h config.h defines.h intern.h missing.h win32.h
+numeric.obj: numeric.c ruby.h config.h defines.h intern.h missing.h win32.h
+object.obj: object.c ruby.h config.h defines.h intern.h missing.h st.h util.h win32.h
+pack.obj: pack.c ruby.h config.h defines.h intern.h missing.h win32.h
+parse.obj: parse.c ruby.h config.h defines.h intern.h missing.h env.h node.h st.h regex.h util.h lex.c win32.h
+prec.obj: prec.c ruby.h config.h defines.h intern.h missing.h win32.h
+process.obj: process.c ruby.h config.h defines.h intern.h missing.h rubysig.h st.h win32.h
+random.obj: random.c ruby.h config.h defines.h intern.h missing.h win32.h
+range.obj: range.c ruby.h config.h defines.h intern.h missing.h win32.h
+re.obj: re.c ruby.h config.h defines.h intern.h missing.h re.h regex.h win32.h
+regex.obj: regex.c config.h regex.h win32.h
+ruby.obj: ruby.c ruby.h config.h defines.h intern.h missing.h dln.h node.h util.h win32.h
+signal.obj: signal.c ruby.h config.h defines.h intern.h missing.h rubysig.h win32.h
+sprintf.obj: sprintf.c ruby.h config.h defines.h intern.h missing.h win32.h
+st.obj: st.c config.h st.h
+string.obj: string.c ruby.h config.h defines.h intern.h missing.h re.h regex.h win32.h
+struct.obj: struct.c ruby.h config.h defines.h intern.h missing.h win32.h
+time.obj: time.c ruby.h config.h defines.h intern.h missing.h win32.h
+util.obj: util.c ruby.h config.h defines.h intern.h missing.h util.h win32.h
+variable.obj: variable.c ruby.h config.h defines.h intern.h missing.h env.h node.h st.h util.h win32.h
+version.obj: version.c ruby.h config.h defines.h intern.h missing.h version.h win32.h
diff --git a/bcc32/README.bcc32 b/bcc32/README.bcc32
new file mode 100644
index 0000000000..a699d34a4e
--- /dev/null
+++ b/bcc32/README.bcc32
@@ -0,0 +1,125 @@
+=begin
+
+= How to build ruby using Borland C++
+
+== Requirement
+
+(1) Borland C++ 5.0 or later.
+
+(2) If you want to run `((%make clean%))' or `((%make distclean%))'
+ properly, you must install UNIX compatible `((%rm%))' command on
+ your ((|PATH|)).
+
+(3) Please set environment variable (({INCLUDE})), (({LIB})), (({PATH}))
+ to run required commands properly from the command line.
+
+ Note: building ruby requires following commands.
+ * make
+ * bcc
+ * tlib
+ * ilink
+
+== How to compile and install
+
+(1) Execute bcc32\configure.bat on your build directory.
+ ex. c:\ruby-1.6.7>bcc32\configure.bat
+
+(2) Change ((|RUBY_INSTALL_NAME|)) and ((|RUBY_SO_NAME|)) in (({Makefile}))
+ if you want to change the name of the executable files.
+ And add ((|RUBYW_INSTALL_NAME|)) to change the name of the
+ executable without console window if also you want.
+
+(3) Run `((%make%))'
+
+(4) Run `((%make test%))'
+
+(5) Run `((%make DESTDIR=<install_directory> install%))'
+
+ This command will create following directories and install files onto them.
+ * <install_directory>\bin
+ * <install_directory>\lib
+ * <install_directory>\lib\ruby
+ * <install_directory>\lib\ruby\<MAJOR>.<MINOR>
+ * <install_directory>\lib\ruby\<MAJOR>.<MINOR>\<PLATFORM>
+ * <install_directory>\lib\ruby\site_ruby
+ * <install_directory>\lib\ruby\site_ruby\<MAJOR>.<MINOR>
+ * <install_directory>\lib\ruby\site_ruby\<MAJOR>.<MINOR>\<PLATFORM>
+ * <install_directory>\man\man1
+ If Ruby's version is `x.y.z', the ((|<MAJOR>|)) is `x' and the ((|<MINOR>|)) is `y'.
+ The ((|<PLATFORM>|)) is usually `(({i586-bccwin32}))'.
+
+== Icons
+
+Any icon files(*.ico) in the build directory, directories specified with
+((|icondirs|)) make variable and (({win32})) directory under the ruby
+source directory will be included in DLL or executable files, according
+to their base names.
+ $(RUBY_INSTALL_NAME).ico or ruby.ico --> $(RUBY_INSTALL_NAME).exe
+ $(RUBYW_INSTALL_NAME).ico or rubyw.ico --> $(RUBYW_INSTALL_NAME).exe
+ the others --> $(RUBY_SO_NAME).dll
+
+Although no icons are distributed with the ruby source or in the official
+site, you can use anything you like. For example, followings are written
+in Japanese, but you can download at least.
+
+* ((<URL:http://member.nifty.ne.jp/ueivu/rubyico.html>)) or
+ ((<zipped icons|URL:http://member.nifty.ne.jp/ueivu/Ruby_ico.zip>))
+* ((<URL:http://homepage1.nifty.com/a_nakata/ruby/>)) or
+ ((<icon itself|URL:http://homepage1.nifty.com/a_nakata/ruby/RubyIcon.ico>))
+
+== Build examples
+
+* Build on the ruby source directory.
+
+ ex.)
+ ruby source directory: C:\ruby
+ build directory: C:\ruby
+ install directory: C:\usr\local
+
+ C:
+ cd \ruby
+ bcc32\configure
+ make
+ make test
+ make DESTDIR=/usr/local install
+
+* Build on the relative directory from the ruby source directory and CPU type
+ i386.
+
+ ex.)
+ ruby source directory: C:\ruby
+ build directory: C:\ruby\bccwin32
+ install directory: C:\usr\local
+ CPU i386
+
+ C:
+ cd \ruby
+ mkdir bccwin32
+ cd bccwin32
+ ..\bcc32\configure target i386-bccwin32
+ make
+ make test
+ make DESTDIR=/usr/local install
+
+* Build on the different drive.
+
+ ex.)
+ ruby source directory: C:\src\ruby
+ build directory: D:\build\ruby
+ install directory: C:\usr\local
+
+ D:
+ cd D:\build\ruby
+ C:\src\ruby\bcc32\configure
+ make
+ make test
+ make DESTDIR=C:/usr/local install
+
+== Bugs
+
+You can ((*NOT*)) use a path name contains any white space characters as
+the ruby source directory, this restriction comes from the behavior of
+(({!INCLUDE})) directives of (({MAKE})).
+((- you may call it a bug. -))
+
+=end
diff --git a/bcc32/configure.bat b/bcc32/configure.bat
new file mode 100644
index 0000000000..449b6e25b5
--- /dev/null
+++ b/bcc32/configure.bat
@@ -0,0 +1,32 @@
+@echo off
+::: Don't set environment variable in batch file other than autoexec.bat
+::: to avoid "Out of environment space" problem on Windows 95/98.
+::: set TMPMAKE=~tmp~.mak
+
+echo> ~tmp~.mak ####
+echo>> ~tmp~.mak conf = %0
+echo>> ~tmp~.mak $(conf:\=/): nul
+echo>> ~tmp~.mak @del ~tmp~.mak
+echo>> ~tmp~.mak @-$(MAKE) -l$(MAKEFLAGS) -f $(@D)setup.mak \
+echo>> ~tmp~.mak bcc32dir="$(@D)" \
+:loop
+if "%1" == "" goto :end
+if "%1" == "--srcdir" goto :srcdir
+if "%1" == "srcdir" goto :srcdir
+if "%1" == "--target" goto :target
+if "%1" == "target" goto :target
+ echo>> ~tmp~.mak "%1"
+ shift
+goto :loop
+:srcdir
+ echo>> ~tmp~.mak "srcdir=%2"
+ shift
+ shift
+goto :loop
+:target
+ echo>> ~tmp~.mak %2
+ shift
+ shift
+goto :loop
+:end
+make -s -f ~tmp~.mak
diff --git a/bcc32/mkexports.rb b/bcc32/mkexports.rb
new file mode 100644
index 0000000000..e34b441e2f
--- /dev/null
+++ b/bcc32/mkexports.rb
@@ -0,0 +1,25 @@
+#!./miniruby -s
+
+SYM = {}
+STDIN.reopen(open("nul"))
+ARGV.each do |obj|
+ IO.foreach("|tdump -q -oiPUBDEF -oiPUBD32 #{obj.tr('/', '\\')}") do |l|
+ next unless /(?:PUBDEF|PUBD32)/ =~ l
+ SYM[$1] = true if /'(.*?)'/ =~ l
+ end
+end
+
+exports = []
+if $name
+ exports << "Name " + $name
+elsif $library
+ exports << "Library " + $library
+end
+exports << "Description " + $description.dump if $description
+exports << "EXPORTS" << SYM.keys.sort
+
+if $output
+ open($output, 'w') {|f| f.puts exports.join("\n")}
+else
+ puts exports.join("\n")
+end
diff --git a/bcc32/setup.mak b/bcc32/setup.mak
new file mode 100644
index 0000000000..3b37b92fa8
--- /dev/null
+++ b/bcc32/setup.mak
@@ -0,0 +1,89 @@
+# -*- makefile -*-
+
+!if "$(srcdir)" != ""
+bcc32dir = $(srcdir)bcc32/
+!elseif "$(bcc32dir)" == "bcc32/"
+srcdir = ./
+!elseif "$(bcc32dir:/bcc32/=)/bcc32/" == "$(bcc32dir)"
+srcdir = $(bcc32dir:/bcc32/=/)
+!else
+srcdir = $(bcc32dir)../
+!endif
+
+OS = bccwin32
+RT = $(OS)
+INCLUDE = !include
+APPEND = echo>>$(MAKEFILE)
+!ifdef MAKEFILE
+MAKE = $(MAKE) -f $(MAKEFILE)
+!else
+MAKEFILE = Makefile
+!endif
+
+all: Makefile
+Makefile: -prologue- -generic- -epilogue-
+i386-$(OS): -prologue- -i386- -epilogue-
+i486-$(OS): -prologue- -i486- -epilogue-
+i586-$(OS): -prologue- -i586- -epilogue-
+i686-$(OS): -prologue- -i686- -epilogue-
+alpha-$(OS): -prologue- -alpha- -epilogue-
+
+-prologue-: nul
+ @echo Creating $(MAKEFILE)
+ @type > $(MAKEFILE) &&|
+\#\#\# Makefile for ruby $(OS) \#\#\#
+srcdir = $(srcdir:\=/)
+|
+ @cpp32 -I$(srcdir) -DRUBY_EXTERN="//" -P- -o$(MAKEFILE) > nul &&|
+\#include "version.h"
+MAJOR = RUBY_VERSION_MAJOR
+MINOR = RUBY_VERSION_MINOR
+TEENY = RUBY_VERSION_TEENY
+|
+ @type $(MAKEFILE).i >> $(MAKEFILE)
+ @del $(MAKEFILE).i
+
+-generic-: nul
+!if defined(PROCESSOR_ARCHITECTURE) || defined(PROCESSOR_LEVEL)
+ @type >> $(MAKEFILE) &&|
+!if defined(PROCESSOR_ARCHITECTURE)
+PROCESSOR_ARCHITECTURE = $(PROCESSOR_ARCHITECTURE)
+!endif
+!if defined(PROCESSOR_LEVEL)
+PROCESSOR_LEVEL = $(PROCESSOR_LEVEL)
+!endif
+
+|
+!endif
+
+-alpha-: nul
+ @$(APPEND) PROCESSOR_ARCHITECTURE = alpha
+-ix86-: nul
+ @$(APPEND) PROCESSOR_ARCHITECTURE = x86
+
+-i386-: -ix86-
+ @$(APPEND) PROCESSOR_LEVEL = 3
+-i486-: -ix86-
+ @$(APPEND) PROCESSOR_LEVEL = 4
+-i586-: -ix86-
+ @$(APPEND) PROCESSOR_LEVEL = 5
+-i686-: -ix86-
+ @$(APPEND) PROCESSOR_LEVEL = 6
+
+-epilogue-: nul
+ @type >> $(MAKEFILE) &&|
+
+\# OS = $(OS)
+\# RT = $(RT)
+\# RUBY_INSTALL_NAME = ruby
+\# RUBY_SO_NAME = $$(RT)-$$(RUBY_INSTALL_NAME)$$(MAJOR)$$(MINOR)
+\# prefix = /usr
+\# CFLAGS = -q $$(DEBUGFLAGS) $$(OPTFLAGS) $$(PROCESSOR_FLAG) -w- -wsus -wcpt -wdup -wext -wrng -wrpt -wzdi
+\# CPPFLAGS = -I. -I$$(srcdir) -I$$(srcdir)missing -DLIBRUBY_SO=\"$$(LIBRUBY_SO)\"
+\# STACK = 0x2000000
+\# LDFLAGS = -S:$$(STACK)
+\# RFLAGS = $$(iconinc)
+\# EXTLIBS = cw32.lib import32.lib user32.lib kernel32.lib
+$(INCLUDE) $$(srcdir)bcc32/Makefile.sub
+|
+ @echo type "`$(MAKE)'" to make ruby for $(OS).
diff --git a/benchmark/README.md b/benchmark/README.md
deleted file mode 100644
index 24a2669143..0000000000
--- a/benchmark/README.md
+++ /dev/null
@@ -1,72 +0,0 @@
-# ruby/benchmark
-
-This directory has benchmark definitions to be run with
-[benchmark\_driver.gem](https://github.com/benchmark-driver/benchmark-driver).
-
-## Normal usage
-
-Execute `gem install benchmark_driver` and run a command like:
-
-```bash
-# Run a benchmark script with the ruby in the $PATH
-benchmark-driver benchmark/app_fib.rb
-
-# Run benchmark scripts with multiple Ruby executables or options
-benchmark-driver benchmark/*.rb -e /path/to/ruby -e '/path/to/ruby --jit'
-
-# Or compare Ruby versions managed by rbenv
-benchmark-driver benchmark/*.rb --rbenv '2.5.1;2.6.0-preview2 --jit'
-
-# You can collect many metrics in many ways
-benchmark-driver benchmark/*.rb --runner memory --output markdown
-
-# Some are defined with YAML for complex setup or accurate measurement
-benchmark-driver benchmark/*.yml
-```
-
-See also:
-
-```console
-Usage: benchmark-driver [options] RUBY|YAML...
- -r, --runner TYPE Specify runner type: ips, time, memory, once (default: ips)
- -o, --output TYPE Specify output type: compare, simple, markdown, record (default: compare)
- -e, --executables EXECS Ruby executables (e1::path1 arg1; e2::path2 arg2;...)
- --rbenv VERSIONS Ruby executables in rbenv (x.x.x arg1;y.y.y arg2;...)
- --repeat-count NUM Try benchmark NUM times and use the fastest result or the worst memory usage
- --repeat-result TYPE Yield "best", "average" or "worst" result with --repeat-count (default: best)
- --bundler Install and use gems specified in Gemfile
- --filter REGEXP Filter out benchmarks with given regexp
- --run-duration SECONDS Warmup estimates loop_count to run for this duration (default: 3)
- -v, --verbose Verbose mode. Multiple -v options increase visilibity (max: 2)
-```
-
-## make benchmark
-
-Using `make benchmark`, `make update-benchmark-driver` automatically downloads
-the supported version of benchmark\_driver, and it runs benchmarks with the downloaded
-benchmark\_driver.
-
-```bash
-# Run all benchmarks with the ruby in the $PATH and the built ruby
-make benchmark
-
-# Or compare with specific ruby binary
-make benchmark COMPARE_RUBY="/path/to/ruby --jit"
-
-# Run vm1 benchmarks
-make benchmark ITEM=vm1
-
-# Run some limited benchmarks in ITEM-matched files
-make benchmark ITEM=vm1 OPTS=--filter=block
-
-# You can specify the benchmark by an exact filename instead of using the default argument:
-# ARGS = $$(find $(srcdir)/benchmark -maxdepth 1 -name '*$(ITEM)*.yml' -o -name '*$(ITEM)*.rb')
-make benchmark ARGS=../benchmark/erb_render.yml
-
-# You can specify any option via $OPTS
-make benchmark OPTS="--help"
-
-# With `make benchmark`, some special runner plugins are available:
-# -r peak, -r size, -r total, -r utime, -r stime, -r cutime, -r cstime
-make benchmark ITEM=vm2_bigarray OPTS="-r peak"
-```
diff --git a/benchmark/app_answer.rb b/benchmark/app_answer.rb
deleted file mode 100644
index 3cd8a8fd37..0000000000
--- a/benchmark/app_answer.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-def ack(m, n)
- if m == 0 then
- n + 1
- elsif n == 0 then
- ack(m - 1, 1)
- else
- ack(m - 1, ack(m, n - 1))
- end
-end
-
-def the_answer_to_life_the_universe_and_everything
- (ack(3,7).to_s.split(//).inject(0){|s,x| s+x.to_i}.to_s + "2" ).to_i
-end
-
-answer = the_answer_to_life_the_universe_and_everything
diff --git a/benchmark/app_aobench.rb b/benchmark/app_aobench.rb
deleted file mode 100644
index 16296af12b..0000000000
--- a/benchmark/app_aobench.rb
+++ /dev/null
@@ -1,297 +0,0 @@
-# coding: US-ASCII
-
-# AO render benchmark
-# Original program (C) Syoyo Fujita in Javascript (and other languages)
-# https://code.google.com/p/aobench/
-# Ruby(yarv2llvm) version by Hideki Miura
-#
-
-IMAGE_WIDTH = 256
-IMAGE_HEIGHT = 256
-NSUBSAMPLES = 2
-NAO_SAMPLES = 8
-
-srand(0)
-
-class Vec
- def initialize(x, y, z)
- @x = x
- @y = y
- @z = z
- end
-
- attr_accessor :x, :y, :z
-
- def vadd(b)
- Vec.new(@x + b.x, @y + b.y, @z + b.z)
- end
-
- def vsub(b)
- Vec.new(@x - b.x, @y - b.y, @z - b.z)
- end
-
- def vcross(b)
- Vec.new(@y * b.z - @z * b.y,
- @z * b.x - @x * b.z,
- @x * b.y - @y * b.x)
- end
-
- def vdot(b)
- @x * b.x + @y * b.y + @z * b.z
- end
-
- def vlength
- Math.sqrt(@x * @x + @y * @y + @z * @z)
- end
-
- def vnormalize
- len = vlength
- v = Vec.new(@x, @y, @z)
- if len > 1.0e-17 then
- v.x = v.x / len
- v.y = v.y / len
- v.z = v.z / len
- end
- v
- end
-end
-
-
-class Sphere
- def initialize(center, radius)
- @center = center
- @radius = radius
- end
-
- attr_reader :center, :radius
-
- def intersect(ray, isect)
- rs = ray.org.vsub(@center)
- b = rs.vdot(ray.dir)
- c = rs.vdot(rs) - (@radius * @radius)
- d = b * b - c
- if d > 0.0 then
- t = - b - Math.sqrt(d)
-
- if t > 0.0 and t < isect.t then
- isect.t = t
- isect.hit = true
- isect.pl = Vec.new(ray.org.x + ray.dir.x * t,
- ray.org.y + ray.dir.y * t,
- ray.org.z + ray.dir.z * t)
- n = isect.pl.vsub(@center)
- isect.n = n.vnormalize
- else
- 0.0
- end
- end
- nil
- end
-end
-
-class Plane
- def initialize(p, n)
- @p = p
- @n = n
- end
-
- def intersect(ray, isect)
- d = -@p.vdot(@n)
- v = ray.dir.vdot(@n)
- v0 = v
- if v < 0.0 then
- v0 = -v
- end
- if v0 < 1.0e-17 then
- return
- end
-
- t = -(ray.org.vdot(@n) + d) / v
-
- if t > 0.0 and t < isect.t then
- isect.hit = true
- isect.t = t
- isect.n = @n
- isect.pl = Vec.new(ray.org.x + t * ray.dir.x,
- ray.org.y + t * ray.dir.y,
- ray.org.z + t * ray.dir.z)
- end
- nil
- end
-end
-
-class Ray
- def initialize(org, dir)
- @org = org
- @dir = dir
- end
-
- attr_accessor :org, :dir
-end
-
-class Isect
- def initialize
- @t = 10000000.0
- @hit = false
- @pl = Vec.new(0.0, 0.0, 0.0)
- @n = Vec.new(0.0, 0.0, 0.0)
- end
-
- attr_accessor :t, :hit, :pl, :n
-end
-
-def clamp(f)
- i = f * 255.5
- if i > 255.0 then
- i = 255.0
- end
- if i < 0.0 then
- i = 0.0
- end
- i.to_i
-end
-
-def otherBasis(basis, n)
- basis[2] = Vec.new(n.x, n.y, n.z)
- basis[1] = Vec.new(0.0, 0.0, 0.0)
-
- if n.x < 0.6 and n.x > -0.6 then
- basis[1].x = 1.0
- elsif n.y < 0.6 and n.y > -0.6 then
- basis[1].y = 1.0
- elsif n.z < 0.6 and n.z > -0.6 then
- basis[1].z = 1.0
- else
- basis[1].x = 1.0
- end
-
- basis[0] = basis[1].vcross(basis[2])
- basis[0] = basis[0].vnormalize
-
- basis[1] = basis[2].vcross(basis[0])
- basis[1] = basis[1].vnormalize
-end
-
-class Scene
- def initialize
- @spheres = Array.new
- @spheres[0] = Sphere.new(Vec.new(-2.0, 0.0, -3.5), 0.5)
- @spheres[1] = Sphere.new(Vec.new(-0.5, 0.0, -3.0), 0.5)
- @spheres[2] = Sphere.new(Vec.new(1.0, 0.0, -2.2), 0.5)
- @plane = Plane.new(Vec.new(0.0, -0.5, 0.0), Vec.new(0.0, 1.0, 0.0))
- end
-
- def ambient_occlusion(isect)
- basis = Array.new
- otherBasis(basis, isect.n)
-
- ntheta = NAO_SAMPLES
- nphi = NAO_SAMPLES
- eps = 0.0001
- occlusion = 0.0
-
- p0 = Vec.new(isect.pl.x + eps * isect.n.x,
- isect.pl.y + eps * isect.n.y,
- isect.pl.z + eps * isect.n.z)
- nphi.times do |j|
- ntheta.times do |i|
- r = rand
- phi = 2.0 * 3.14159265 * rand
- x = Math.cos(phi) * Math.sqrt(1.0 - r)
- y = Math.sin(phi) * Math.sqrt(1.0 - r)
- z = Math.sqrt(r)
-
- rx = x * basis[0].x + y * basis[1].x + z * basis[2].x
- ry = x * basis[0].y + y * basis[1].y + z * basis[2].y
- rz = x * basis[0].z + y * basis[1].z + z * basis[2].z
-
- raydir = Vec.new(rx, ry, rz)
- ray = Ray.new(p0, raydir)
-
- occisect = Isect.new
- @spheres[0].intersect(ray, occisect)
- @spheres[1].intersect(ray, occisect)
- @spheres[2].intersect(ray, occisect)
- @plane.intersect(ray, occisect)
- if occisect.hit then
- occlusion = occlusion + 1.0
- else
- 0.0
- end
- end
- end
-
- occlusion = (ntheta.to_f * nphi.to_f - occlusion) / (ntheta.to_f * nphi.to_f)
-
- Vec.new(occlusion, occlusion, occlusion)
- end
-
- def render(w, h, nsubsamples)
- cnt = 0
- nsf = nsubsamples.to_f
- h.times do |y|
- w.times do |x|
- rad = Vec.new(0.0, 0.0, 0.0)
-
- # Subsampling
- nsubsamples.times do |v|
- nsubsamples.times do |u|
-
- cnt = cnt + 1
- wf = w.to_f
- hf = h.to_f
- xf = x.to_f
- yf = y.to_f
- uf = u.to_f
- vf = v.to_f
-
- px = (xf + (uf / nsf) - (wf / 2.0)) / (wf / 2.0)
- py = -(yf + (vf / nsf) - (hf / 2.0)) / (hf / 2.0)
-
- eye = Vec.new(px, py, -1.0).vnormalize
-
- ray = Ray.new(Vec.new(0.0, 0.0, 0.0), eye)
-
- isect = Isect.new
- @spheres[0].intersect(ray, isect)
- @spheres[1].intersect(ray, isect)
- @spheres[2].intersect(ray, isect)
- @plane.intersect(ray, isect)
- if isect.hit then
- col = ambient_occlusion(isect)
- rad.x = rad.x + col.x
- rad.y = rad.y + col.y
- rad.z = rad.z + col.z
- end
- end
- end
-
- r = rad.x / (nsf * nsf)
- g = rad.y / (nsf * nsf)
- b = rad.z / (nsf * nsf)
- printf("%c", clamp(r))
- printf("%c", clamp(g))
- printf("%c", clamp(b))
- end
- nil
- end
-
- nil
- end
-end
-
-alias printf_orig printf
-def printf *args
- # $fp.printf(*args)
-end
-
-# File.open("ao.ppm", "w") do |fp|
- # $fp = fp
- printf("P6\n")
- printf("%d %d\n", IMAGE_WIDTH, IMAGE_HEIGHT)
- printf("255\n")
- Scene.new.render(IMAGE_WIDTH, IMAGE_HEIGHT, NSUBSAMPLES)
-# end
-
-undef printf
-alias printf printf_orig
diff --git a/benchmark/app_erb.yml b/benchmark/app_erb.yml
deleted file mode 100644
index 31e29b7644..0000000000
--- a/benchmark/app_erb.yml
+++ /dev/null
@@ -1,23 +0,0 @@
-#
-# Create many HTML strings with ERB.
-#
-prelude: |
- require 'erb'
-
- data = <<erb
- <html>
- <head> <%= title %> </head>
- <body>
- <h1> <%= title %> </h1>
- <p>
- <%= content %>
- </p>
- </body>
- </html>
- erb
-
- title = "hello world!"
- content = "hello world!\n" * 10
-benchmark:
- app_erb: ERB.new(data).result(binding)
-loop_count: 15000
diff --git a/benchmark/app_factorial.rb b/benchmark/app_factorial.rb
deleted file mode 100644
index 45f471dfdb..0000000000
--- a/benchmark/app_factorial.rb
+++ /dev/null
@@ -1,11 +0,0 @@
-def fact(n)
- if(n > 1)
- n * fact(n-1)
- else
- 1
- end
-end
-
-100.times {
- fact(5000)
-}
diff --git a/benchmark/app_fib.rb b/benchmark/app_fib.rb
deleted file mode 100644
index 34a7b2e725..0000000000
--- a/benchmark/app_fib.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-def fib n
- if n < 3
- 1
- else
- fib(n-1) + fib(n-2)
- end
-end
-
-fib(34)
-
diff --git a/benchmark/app_lc_fizzbuzz.rb b/benchmark/app_lc_fizzbuzz.rb
deleted file mode 100644
index f09574bbeb..0000000000
--- a/benchmark/app_lc_fizzbuzz.rb
+++ /dev/null
@@ -1,52 +0,0 @@
-#
-# FizzBuzz program using only lambda calculus
-#
-# This program is quoted from
-# "Understanding Computation" by Tom Stuart
-# http://computationbook.com/
-#
-# You can understand why this program works fine by reading this book.
-#
-
-solution = -> k { -> f { -> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> l { -> x { -> g { -> b { b }[-> p { p[-> x { -> y { x } }] }[l]][x][-> y { g[f[-> l { -> p { p[-> x { -> y { y } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][x][g]][-> l { -> p { p[-> x { -> y { x } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][y] }] } } } }][k][-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> l { -> x { -> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[l][f[x]] } }] } }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[m][n]][-> x { -> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[f[-> n { -> p { -> x { p[n[p][x]] } } }[m]][n]][m][x] }][-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]] } } }][-> p { -> x { p[x] } }][-> p { -> x { p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[x]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]] } }]][-> n { -> b { b }[-> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> p { -> x { p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[x]]]]]]]]]]]]]]] } }]]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]][-> b { b }[-> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> p { -> x { p[p[p[x]]] } }]]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]][-> b { b }[-> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> n { -> l { -> x { -> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> l { -> x { -> g { -> b { b }[-> p { p[-> x { -> y { x } }] }[l]][x][-> y { g[f[-> l { -> p { p[-> x { -> y { y } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][x][g]][-> l { -> p { p[-> x { -> y { x } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][y] }] } } } }][l][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][x]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }] } }[-> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]][-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> x { f[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { -> n { -> p { -> x { p[n[p][x]] } } }[f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n]][x] }][-> p { -> x { x } }] } } }][n][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][x] }]][-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]] } }][n]]]] }]
-
-FIRST = -> l { LEFT[RIGHT[l]] }
-IF = -> b { b }
-LEFT = -> p { p[-> x { -> y { x } } ] }
-RIGHT = -> p { p[-> x { -> y { y } } ] }
-IS_EMPTY = LEFT
-REST = -> l { RIGHT[RIGHT[l]] }
-
-def to_integer(proc)
- proc[-> n { n + 1 }][0]
-end
-
-def to_boolean(proc)
- IF[proc][true][false]
-end
-
-def to_array(proc)
- array = []
-
- until to_boolean(IS_EMPTY[proc])
- array.push(FIRST[proc])
- proc = REST[proc]
- end
-
- array
-end
-
-def to_char(c)
- '0123456789BFiuz'.slice(to_integer(c))
-end
-
-def to_string(s)
- to_array(s).map { |c| to_char(c) }.join
-end
-
-answer = to_array(solution).map do |p|
- to_string(p)
-end
-
-answer_ary = answer.to_a
-# puts answer_ary
diff --git a/benchmark/app_mandelbrot.rb b/benchmark/app_mandelbrot.rb
deleted file mode 100644
index 801b75e8e2..0000000000
--- a/benchmark/app_mandelbrot.rb
+++ /dev/null
@@ -1,23 +0,0 @@
-require 'complex'
-
-def mandelbrot? z
- i = 0
- while i<100
- i += 1
- z = z * z
- return false if z.abs > 2
- end
- true
-end
-
-ary = []
-
-(0..1000).each{|dx|
- (0..1000).each{|dy|
- x = dx / 50.0
- y = dy / 50.0
- c = Complex(x, y)
- ary << c if mandelbrot?(c)
- }
-}
-
diff --git a/benchmark/app_pentomino.rb b/benchmark/app_pentomino.rb
deleted file mode 100644
index 47be7b203f..0000000000
--- a/benchmark/app_pentomino.rb
+++ /dev/null
@@ -1,130 +0,0 @@
-#!/usr/local/bin/ruby
-# This program is contributed by Shin Nishiyama
-
-
-# modified by K.Sasada
-
-NP = 5
-ROW = 8 + NP
-COL = 8
-
-$p = []
-$b = []
-$no = 0
-
-def piece(n, a, nb)
- nb.each{|x|
- a[n] = x
- if n == NP-1
- $p << [a.sort]
- else
- nbc=nb.dup
- [-ROW, -1, 1, ROW].each{|d|
- if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
- nbc << x+d
- end
- }
- nbc.delete x
- piece(n+1,a[0..n],nbc)
- end
- }
-end
-
-def kikaku(a)
- a.collect {|x| x - a[0]}
-end
-def ud(a)
- kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
-end
-def rl(a)
- kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
-end
-def xy(a)
- kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
-end
-
-def mkpieces
- piece(0,[],[0])
- $p.each do |a|
- a0 = a[0]
- a[1] = ud(a0)
- a[2] = rl(a0)
- a[3] = ud(rl(a0))
- a[4] = xy(a0)
- a[5] = ud(xy(a0))
- a[6] = rl(xy(a0))
- a[7] = ud(rl(xy(a0)))
- a.sort!
- a.uniq!
- end
- $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
-end
-
-def mkboard
- (0...ROW*COL).each{|i|
- if i % ROW >= ROW-NP
- $b[i] = -2
- else
- $b[i] = -1
- end
- $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
- }
-end
-
-def pboard
- return # skip print
- print "No. #$no\n"
- (0...COL).each{|i|
- print "|"
- (0...ROW-NP).each{|j|
- x = $b[i*ROW+j]
- if x < 0
- print "..|"
- else
- printf "%2d|",x+1
- end
- }
- print "\n"
- }
- print "\n"
-end
-
-$pnum=[]
-def setpiece(a,pos)
- if a.length == $p.length then
- $no += 1
- pboard
- return
- end
- while $b[pos] != -1
- pos += 1
- end
- ($pnum - a).each do |i|
- $p[i].each do |x|
- f = 0
- x.each{|s|
- if $b[pos+s] != -1
- f=1
- break
- end
- }
- if f == 0 then
- x.each{|s|
- $b[pos+s] = i
- }
- a << i
- setpiece(a.dup, pos)
- a.pop
- x.each{|s|
- $b[pos+s] = -1
- }
- end
- end
- end
-end
-
-mkpieces
-mkboard
-$p[4] = [$p[4][0]]
-$pnum = (0...$p.length).to_a
-setpiece([],0)
diff --git a/benchmark/app_raise.rb b/benchmark/app_raise.rb
deleted file mode 100644
index 5db8f95d50..0000000000
--- a/benchmark/app_raise.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-i = 0
-while i<300000
- i += 1
- begin
- raise
- rescue
- end
-end
diff --git a/benchmark/app_strconcat.rb b/benchmark/app_strconcat.rb
deleted file mode 100644
index 7eed7c1aed..0000000000
--- a/benchmark/app_strconcat.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-i = 0
-while i<2_000_000
- "#{1+1} #{1+1} #{1+1}"
- i += 1
-end
diff --git a/benchmark/app_tak.rb b/benchmark/app_tak.rb
deleted file mode 100644
index efe5380f4e..0000000000
--- a/benchmark/app_tak.rb
+++ /dev/null
@@ -1,13 +0,0 @@
-
-def tak x, y, z
- unless y < x
- z
- else
- tak( tak(x-1, y, z),
- tak(y-1, z, x),
- tak(z-1, x, y))
- end
-end
-
-tak(18, 9, 0)
-
diff --git a/benchmark/app_tarai.rb b/benchmark/app_tarai.rb
deleted file mode 100644
index 4c146f5ccf..0000000000
--- a/benchmark/app_tarai.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-def tarai( x, y, z )
- if x <= y
- then y
- else tarai(tarai(x-1, y, z),
- tarai(y-1, z, x),
- tarai(z-1, x, y))
- end
-end
-
-tarai(12, 6, 0)
diff --git a/benchmark/app_uri.rb b/benchmark/app_uri.rb
deleted file mode 100644
index 586edfd5dc..0000000000
--- a/benchmark/app_uri.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-require 'uri'
-
-100_000.times{
- uri = URI.parse('http://www.ruby-lang.org')
- uri.scheme
- uri.host
- uri.port
-}
diff --git a/benchmark/array_flatten.yml b/benchmark/array_flatten.yml
deleted file mode 100644
index 88ef544ba0..0000000000
--- a/benchmark/array_flatten.yml
+++ /dev/null
@@ -1,19 +0,0 @@
-prelude: |
- small_flat_ary = 5.times.to_a
- large_flat_ary = 100.times.to_a
- small_pairs_ary = [[1, 2]] * 5
- large_pairs_ary = [[1, 2]] * 100
- mostly_flat_ary = 100.times.to_a.push([101, 102])
-
-benchmark:
- small_flat_ary.flatten: small_flat_ary.flatten
- small_flat_ary.flatten!: small_flat_ary.flatten!
- large_flat_ary.flatten: large_flat_ary.flatten
- large_flat_ary.flatten!: large_flat_ary.flatten!
- small_pairs_ary.flatten: small_pairs_ary.flatten
- small_pairs_ary.flatten!: small_pairs_ary.dup.flatten!
- large_pairs_ary.flatten: large_pairs_ary.flatten
- large_pairs_ary.flatten!: large_pairs_ary.dup.flatten!
- mostly_flat_ary.flatten: mostly_flat_ary.flatten
- mostly_flat_ary.flatten!: mostly_flat_ary.dup.flatten!
-loop_count: 10000
diff --git a/benchmark/array_intersection.yml b/benchmark/array_intersection.yml
deleted file mode 100644
index 26705323fd..0000000000
--- a/benchmark/array_intersection.yml
+++ /dev/null
@@ -1,14 +0,0 @@
-prelude: |
- small1 = [1, 2, 3]
- small2 = [1, 2, 3, 4, 5]
- small3 = [2, 3, 4, 5]
- small4 = [2]
- big1 = [1, 2, 3, 4] * 64
- big2 = [1, 2, 3] * 64
- big3 = [1, 2] * 64
-
-benchmark:
- small-&: small1 & small2 & small3 & small4
- small-intersection: small1.intersection(small2, small3, small4)
- big-&: big1 & big2 & big3
- big-intersection: big1.intersection(big2, big3)
diff --git a/benchmark/array_sample_100k_10.rb b/benchmark/array_sample_100k_10.rb
deleted file mode 100644
index 5f41ecc32b..0000000000
--- a/benchmark/array_sample_100k_10.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-arr = [*0...100000]
-10_000.times {arr.sample 10}
diff --git a/benchmark/array_sample_100k_11.rb b/benchmark/array_sample_100k_11.rb
deleted file mode 100644
index 18b1715319..0000000000
--- a/benchmark/array_sample_100k_11.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-arr = [*0...100000]
-10_000.times {arr.sample 11}
diff --git a/benchmark/array_sample_100k__100.rb b/benchmark/array_sample_100k__100.rb
deleted file mode 100644
index 22863afe89..0000000000
--- a/benchmark/array_sample_100k__100.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-arr = [*0...100000]
-10_000.times {arr.sample 100}
diff --git a/benchmark/array_sample_100k__1k.rb b/benchmark/array_sample_100k__1k.rb
deleted file mode 100644
index 4cd79e6c67..0000000000
--- a/benchmark/array_sample_100k__1k.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-arr = [*0...100000]
-10_000.times {arr.sample 1000}
diff --git a/benchmark/array_sample_100k__6k.rb b/benchmark/array_sample_100k__6k.rb
deleted file mode 100644
index b3d264249e..0000000000
--- a/benchmark/array_sample_100k__6k.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-arr = [*0...100000]
-10_000.times {arr.sample 6000}
diff --git a/benchmark/array_sample_100k___10k.rb b/benchmark/array_sample_100k___10k.rb
deleted file mode 100644
index 5dd55ec058..0000000000
--- a/benchmark/array_sample_100k___10k.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-arr = [*0...100000]
-10_000.times {arr.sample 10_000}
diff --git a/benchmark/array_sample_100k___50k.rb b/benchmark/array_sample_100k___50k.rb
deleted file mode 100644
index 1506732c3c..0000000000
--- a/benchmark/array_sample_100k___50k.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-arr = [*0...100000]
-10_000.times {arr.sample 50_000}
diff --git a/benchmark/array_shift.rb b/benchmark/array_shift.rb
deleted file mode 100644
index 798bb9e3f4..0000000000
--- a/benchmark/array_shift.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-require 'benchmark'
-
-Benchmark.bm do |x|
- [10_000,1_000_000,100_000_000].each do |n|
- ary = Array.new(n,0)
- GC.start
- x.report("#{n}:shift"){ ary.shift }
- (0..4).each do |i|
- ary = Array.new(n,0)
- GC.start
- x.report("#{n}:shift(#{i})"){ ary.shift(i) }
- end
- end
-end
diff --git a/benchmark/array_small_and.rb b/benchmark/array_small_and.rb
deleted file mode 100644
index e53a6edae6..0000000000
--- a/benchmark/array_small_and.rb
+++ /dev/null
@@ -1,17 +0,0 @@
-MIN_SIZE = ENV.fetch('SMALL_ARRAY_MIN', 0).to_i
-MAX_SIZE = ENV.fetch('SMALL_ARRAY_MAX', 16).to_i
-ITERATIONS = ENV.fetch('SMALL_ARRAY_ITERATIONS', 100).to_i
-
-ARRAYS = (MIN_SIZE..MAX_SIZE).map do |size1|
- (MIN_SIZE..MAX_SIZE).map do |size2|
- [Array.new(size1) { rand(MAX_SIZE) }, Array.new(size2) { rand(MAX_SIZE) }]
- end
-end
-
-ITERATIONS.times do
- ARRAYS.each do |group|
- group.each do |arr1, arr2|
- arr1 & arr2
- end
- end
-end
diff --git a/benchmark/array_small_diff.rb b/benchmark/array_small_diff.rb
deleted file mode 100644
index 9661ee48db..0000000000
--- a/benchmark/array_small_diff.rb
+++ /dev/null
@@ -1,17 +0,0 @@
-MIN_SIZE = ENV.fetch('SMALL_ARRAY_MIN', 0).to_i
-MAX_SIZE = ENV.fetch('SMALL_ARRAY_MAX', 16).to_i
-ITERATIONS = ENV.fetch('SMALL_ARRAY_ITERATIONS', 100).to_i
-
-ARRAYS = (MIN_SIZE..MAX_SIZE).map do |size1|
- (MIN_SIZE..MAX_SIZE).map do |size2|
- [Array.new(size1) { rand(MAX_SIZE) }, Array.new(size2) { rand(MAX_SIZE) }]
- end
-end
-
-ITERATIONS.times do
- ARRAYS.each do |group|
- group.each do |arr1, arr2|
- arr1 - arr2
- end
- end
-end
diff --git a/benchmark/array_small_or.rb b/benchmark/array_small_or.rb
deleted file mode 100644
index c58b5fd1ff..0000000000
--- a/benchmark/array_small_or.rb
+++ /dev/null
@@ -1,17 +0,0 @@
-MIN_SIZE = ENV.fetch('SMALL_ARRAY_MIN', 0).to_i
-MAX_SIZE = ENV.fetch('SMALL_ARRAY_MAX', 16).to_i
-ITERATIONS = ENV.fetch('SMALL_ARRAY_ITERATIONS', 100).to_i
-
-ARRAYS = (MIN_SIZE..MAX_SIZE).map do |size1|
- (MIN_SIZE..MAX_SIZE).map do |size2|
- [Array.new(size1) { rand(MAX_SIZE) }, Array.new(size2) { rand(MAX_SIZE) }]
- end
-end
-
-ITERATIONS.times do
- ARRAYS.each do |group|
- group.each do |arr1, arr2|
- arr1 | arr2
- end
- end
-end
diff --git a/benchmark/array_sort_block.rb b/benchmark/array_sort_block.rb
deleted file mode 100644
index 3579786056..0000000000
--- a/benchmark/array_sort_block.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-ary = Array.new(1000) { rand(1000) }
-10000.times { ary.sort { |a, b| a <=> b } }
diff --git a/benchmark/array_sort_float.rb b/benchmark/array_sort_float.rb
deleted file mode 100644
index 9a6e2f8bd2..0000000000
--- a/benchmark/array_sort_float.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-arr = Array.new(1000) { rand }
-10000.times { arr.sort }
diff --git a/benchmark/array_values_at_int.rb b/benchmark/array_values_at_int.rb
deleted file mode 100644
index 6cb394cb9f..0000000000
--- a/benchmark/array_values_at_int.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-ary = Array.new(10000) {|i| i}
-100000.times { ary.values_at(500) }
diff --git a/benchmark/array_values_at_range.rb b/benchmark/array_values_at_range.rb
deleted file mode 100644
index 5b53806d1c..0000000000
--- a/benchmark/array_values_at_range.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-ary = Array.new(10000) {|i| i}
-100000.times { ary.values_at(1..2000) }
diff --git a/benchmark/bighash.rb b/benchmark/bighash.rb
deleted file mode 100644
index e2ad5a5c94..0000000000
--- a/benchmark/bighash.rb
+++ /dev/null
@@ -1 +0,0 @@
-h = {}; 5000000.times {|n| h[n] = n }
diff --git a/benchmark/cgi_escape_html.yml b/benchmark/cgi_escape_html.yml
deleted file mode 100644
index af6abd08ac..0000000000
--- a/benchmark/cgi_escape_html.yml
+++ /dev/null
@@ -1,40 +0,0 @@
-prelude: require 'cgi/escape'
-benchmark:
- - name: escape_html_blank
- prelude: str = ""
- script: CGI.escapeHTML(str)
- loop_count: 20000000
- - name: escape_html_short_none
- prelude: str = "abcde"
- script: CGI.escapeHTML(str)
- loop_count: 20000000
- - name: escape_html_short_one
- prelude: str = "abcd<"
- script: CGI.escapeHTML(str)
- loop_count: 20000000
- - name: escape_html_short_all
- prelude: str = "'&\"<>"
- script: CGI.escapeHTML(str)
- loop_count: 5000000
- - name: escape_html_long_none
- prelude: str = "abcde" * 300
- script: CGI.escapeHTML(str)
- loop_count: 1000000
- - name: escape_html_long_all
- prelude: str = "'&\"<>" * 10
- script: CGI.escapeHTML(str)
- loop_count: 1000000
- - name: escape_html_real
- prelude: | # http://example.com/
- str = <<~HTML
- <body>
- <div>
- <h1>Example Domain</h1>
- <p>This domain is established to be used for illustrative examples in documents. You may use this
- domain in examples without prior coordination or asking for permission.</p>
- <p><a href="http://www.iana.org/domains/example">More information...</a></p>
- </div>
- </body>
- HTML
- script: CGI.escapeHTML(str)
- loop_count: 1000000
diff --git a/benchmark/complex_float_add.yml b/benchmark/complex_float_add.yml
deleted file mode 100644
index d0150c5e5b..0000000000
--- a/benchmark/complex_float_add.yml
+++ /dev/null
@@ -1,7 +0,0 @@
-prelude: |
- max, min = 1000.0, -1000.0
- a = Complex(rand(max)+min, rand(max)+min)
- b = Complex(rand(max)+min, rand(max)+min)
-benchmark:
- complex_float_add: c = a + b
-loop_count: 1000000
diff --git a/benchmark/complex_float_div.yml b/benchmark/complex_float_div.yml
deleted file mode 100644
index b9f5e1d51c..0000000000
--- a/benchmark/complex_float_div.yml
+++ /dev/null
@@ -1,7 +0,0 @@
-prelude: |
- max, min = 1000.0, -1000.0
- a = Complex(rand(max)+min, rand(max)+min)
- b = Complex(rand(max)+min, rand(max)+min)
-benchmark:
- complex_float_div: c = a / b
-loop_count: 1000000
diff --git a/benchmark/complex_float_mul.yml b/benchmark/complex_float_mul.yml
deleted file mode 100644
index 59b096a6dc..0000000000
--- a/benchmark/complex_float_mul.yml
+++ /dev/null
@@ -1,7 +0,0 @@
-prelude: |
- max, min = 1000.0, -1000.0
- a = Complex(rand(max)+min, rand(max)+min)
- b = Complex(rand(max)+min, rand(max)+min)
-benchmark:
- complex_float_mul: c = a * b
-loop_count: 1000000
diff --git a/benchmark/complex_float_new.yml b/benchmark/complex_float_new.yml
deleted file mode 100644
index 6fcde3125b..0000000000
--- a/benchmark/complex_float_new.yml
+++ /dev/null
@@ -1,7 +0,0 @@
-prelude: |
- max, min = 1000.0, -1000.0
- a = Complex(rand(max)+min, rand(max)+min)
- b = Complex(rand(max)+min, rand(max)+min)
-benchmark:
- complex_float_new: c = Complex(a, b)
-loop_count: 1000000
diff --git a/benchmark/complex_float_power.yml b/benchmark/complex_float_power.yml
deleted file mode 100644
index c40a31ab55..0000000000
--- a/benchmark/complex_float_power.yml
+++ /dev/null
@@ -1,7 +0,0 @@
-prelude: |
- max, min = 1000.0, -1000.0
- a = Complex(rand(max)+min, rand(max)+min)
- b = Complex(rand(max)+min, rand(max)+min)
-benchmark:
- complex_float_power: c = a ** b
-loop_count: 1000000
diff --git a/benchmark/complex_float_sub.yml b/benchmark/complex_float_sub.yml
deleted file mode 100644
index 3fafe7cdbe..0000000000
--- a/benchmark/complex_float_sub.yml
+++ /dev/null
@@ -1,7 +0,0 @@
-prelude: |
- max, min = 1000.0, -1000.0
- a = Complex(rand(max)+min, rand(max)+min)
- b = Complex(rand(max)+min, rand(max)+min)
-benchmark:
- complex_float_sub: c = a - b
-loop_count: 1000000
diff --git a/benchmark/dir_empty_p.rb b/benchmark/dir_empty_p.rb
deleted file mode 100644
index 8329c757cf..0000000000
--- a/benchmark/dir_empty_p.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-require 'tmpdir'
-max = 100_000
-Dir.mktmpdir('bm_dir_empty_p') do |dir|
- max.times { Dir.empty?(dir) }
-end
diff --git a/benchmark/enum_lazy_grep_v_100.rb b/benchmark/enum_lazy_grep_v_100.rb
deleted file mode 100644
index 8832392e65..0000000000
--- a/benchmark/enum_lazy_grep_v_100.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-grep_data = (1..10).to_a * 1000
-N = 100
-enum = grep_data.lazy.grep_v(->(i){i == 0}).grep_v(->(i){i == 0})
-N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_grep_v_20.rb b/benchmark/enum_lazy_grep_v_20.rb
deleted file mode 100644
index 329509fa8f..0000000000
--- a/benchmark/enum_lazy_grep_v_20.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-grep_data = (1..10).to_a * 1000
-N = 100
-enum = grep_data.lazy.grep_v(->(i){i > 2}).grep_v(->(i){i > 2})
-N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_grep_v_50.rb b/benchmark/enum_lazy_grep_v_50.rb
deleted file mode 100644
index 02ea4d4e71..0000000000
--- a/benchmark/enum_lazy_grep_v_50.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-grep_data = (1..10).to_a * 1000
-N = 100
-enum = grep_data.lazy.grep_v(->(i){i > 5}).grep_v(->(i){i > 5})
-N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_uniq_100.rb b/benchmark/enum_lazy_uniq_100.rb
deleted file mode 100644
index 2e6434d9c4..0000000000
--- a/benchmark/enum_lazy_uniq_100.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-uniq_data = (1..10_000).to_a
-N = 100
-enum = uniq_data.lazy.uniq {|i| i % 10000}.uniq {|i| i % 10000}
-N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_uniq_20.rb b/benchmark/enum_lazy_uniq_20.rb
deleted file mode 100644
index 75e6398fee..0000000000
--- a/benchmark/enum_lazy_uniq_20.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-uniq_data = (1..10_000).to_a
-N = 100
-enum = uniq_data.lazy.uniq {|i| i % 2000}.uniq {|i| i % 2000}
-N.times {enum.each {}}
diff --git a/benchmark/enum_lazy_uniq_50.rb b/benchmark/enum_lazy_uniq_50.rb
deleted file mode 100644
index 59a39b78ff..0000000000
--- a/benchmark/enum_lazy_uniq_50.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-uniq_data = (1..10_000).to_a
-N = 100
-enum = uniq_data.lazy.uniq {|i| i % 5000}.uniq {|i| i % 5000}
-N.times {enum.each {}}
diff --git a/benchmark/erb_render.yml b/benchmark/erb_render.yml
deleted file mode 100644
index 15f6c3880b..0000000000
--- a/benchmark/erb_render.yml
+++ /dev/null
@@ -1,24 +0,0 @@
-prelude: |
- require 'erb'
-
- data = <<erb
- <html>
- <head> <%= title %> </head>
- <body>
- <h1> <%= title %> </h1>
- <p>
- <%= content %>
- </p>
- </body>
- </html>
- erb
-
- title = "hello world!"
- content = "hello world!\n" * 10
-
- src = "def self.render(title, content); #{ERB.new(data).src}; end"
- mod = Module.new
- mod.instance_eval(src, "(ERB)")
-benchmark:
- erb_render: mod.render(title, content)
-loop_count: 1500000
diff --git a/benchmark/fiber_chain.yml b/benchmark/fiber_chain.yml
deleted file mode 100755
index a36c759f8e..0000000000
--- a/benchmark/fiber_chain.yml
+++ /dev/null
@@ -1,36 +0,0 @@
-prelude: |
- def make_link(previous)
- Fiber.new do
- while message = previous.resume
- Fiber.yield(message)
- end
- end
- end
-
- def make_chain(length = 1000, &block)
- chain = Fiber.new(&block)
-
- (length - 1).times do
- chain = make_link(chain)
- end
-
- return chain
- end
-
- message = "Hello World!"
-
- chain = make_chain do
- while true
- Fiber.yield(message)
- end
- end
-benchmark:
- make_chain: |
- make_chain(100) do
- while true
- Fiber.yield(message)
- end
- end
- resume_chain: |
- chain.resume
-loop_count: 5000
diff --git a/benchmark/file_chmod.rb b/benchmark/file_chmod.rb
deleted file mode 100644
index 1cd4760c9d..0000000000
--- a/benchmark/file_chmod.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-# chmod file
-require 'tempfile'
-max = 200_000
-tmp = Tempfile.new('chmod')
-path = tmp.path
-max.times do
- File.chmod(0777, path)
-end
-tmp.close!
diff --git a/benchmark/file_rename.rb b/benchmark/file_rename.rb
deleted file mode 100644
index bbb44aebac..0000000000
--- a/benchmark/file_rename.rb
+++ /dev/null
@@ -1,11 +0,0 @@
-# rename file
-require 'tempfile'
-
-max = 100_000
-tmp = [ Tempfile.new('rename-a'), Tempfile.new('rename-b') ]
-a, b = tmp.map { |x| x.path }
-tmp.each { |t| t.close } # Windows can't rename files without closing them
-max.times do
- File.rename(a, b)
- File.rename(b, a)
-end
diff --git a/benchmark/gc/aobench.rb b/benchmark/gc/aobench.rb
deleted file mode 100644
index 275f58b924..0000000000
--- a/benchmark/gc/aobench.rb
+++ /dev/null
@@ -1 +0,0 @@
-require_relative '../app_aobench'
diff --git a/benchmark/gc/binary_trees.rb b/benchmark/gc/binary_trees.rb
deleted file mode 100644
index 83347cdd20..0000000000
--- a/benchmark/gc/binary_trees.rb
+++ /dev/null
@@ -1 +0,0 @@
-require_relative '../so_binary_trees'
diff --git a/benchmark/gc/gcbench.rb b/benchmark/gc/gcbench.rb
deleted file mode 100644
index 23d0b91c6c..0000000000
--- a/benchmark/gc/gcbench.rb
+++ /dev/null
@@ -1,57 +0,0 @@
-require 'benchmark'
-require 'pp'
-require 'optparse'
-
-$list = true
-$gcprof = false
-
-opt = OptionParser.new
-opt.on('-q'){$list = false}
-opt.on('-d'){$gcprof = false}
-opt.on('-p'){$gcprof = true}
-opt.parse!(ARGV)
-
-script = File.join(File.dirname(__FILE__), ARGV.shift)
-script += '.rb' unless FileTest.exist?(script)
-raise "#{script} not found" unless FileTest.exist?(script)
-
-puts "Script: #{script}"
-
-if $gcprof
- GC::Profiler.enable
-end
-
-tms = Benchmark.measure{|x|
- load script
-}
-
-gc_time = 0
-
-if $gcprof
- gc_time = GC::Profiler.total_time
- GC::Profiler.report if $list and RUBY_VERSION >= '2.0.0' # before 1.9.3, report() may run infinite loop
- GC::Profiler.disable
-end
-
-pp GC.stat
-
-puts "#{RUBY_DESCRIPTION} #{GC::OPTS.inspect}" if defined?(GC::OPTS)
-
-desc = "#{RUBY_VERSION}#{RUBY_PATCHLEVEL >= 0 ? "p#{RUBY_PATCHLEVEL}" : "dev"}"
-name = File.basename(script, '.rb')
-
-puts
-puts script
-puts Benchmark::CAPTION
-puts tms
-puts "GC total time (sec): #{gc_time}"
-
-# show High-Water Mark on Linux
-if File.exist?('/proc/self/status') && /VmHWM:\s*(\d+.+)/ =~ File.read('/proc/self/status')
- puts
- puts "VmHWM: #{$1.chomp}"
-end
-
-puts
-puts "Summary of #{name} on #{desc}\t#{tms.real}\t#{gc_time}\t#{GC.count}"
-puts " (real time in sec, GC time in sec, GC count)"
diff --git a/benchmark/gc/hash1.rb b/benchmark/gc/hash1.rb
deleted file mode 100644
index cb030d458d..0000000000
--- a/benchmark/gc/hash1.rb
+++ /dev/null
@@ -1,11 +0,0 @@
-value = 0.01
-h = {}
-n = 50_000
-
-1.upto(n){|i|
- h["%020d" % i] = "v-#{i}"
-}
-
-(n * 1_000).times{
- ''
-}
diff --git a/benchmark/gc/hash2.rb b/benchmark/gc/hash2.rb
deleted file mode 100644
index e8c943fb21..0000000000
--- a/benchmark/gc/hash2.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-value = 0.01
-h = {}
-n = 4*(10**6)
-
-1.upto(n){|i|
- h["%020d" % i] = value * i
-}
diff --git a/benchmark/gc/null.rb b/benchmark/gc/null.rb
deleted file mode 100644
index c05a79f561..0000000000
--- a/benchmark/gc/null.rb
+++ /dev/null
@@ -1 +0,0 @@
-# null
diff --git a/benchmark/gc/pentomino.rb b/benchmark/gc/pentomino.rb
deleted file mode 100644
index 8ebdff7d1d..0000000000
--- a/benchmark/gc/pentomino.rb
+++ /dev/null
@@ -1 +0,0 @@
-require_relative '../app_pentomino'
diff --git a/benchmark/gc/rdoc.rb b/benchmark/gc/rdoc.rb
deleted file mode 100644
index 14c89f5611..0000000000
--- a/benchmark/gc/rdoc.rb
+++ /dev/null
@@ -1,13 +0,0 @@
-require 'rdoc/rdoc'
-require 'tmpdir'
-
-srcdir = File.expand_path('../..', __dir__)
-
-Dir.mktmpdir('rdocbench-'){|d|
- dir = File.join(d, 'rdocbench')
- args = %W(--root #{srcdir} --page-dir #{srcdir}/doc --encoding=UTF-8 --no-force-update --all --ri --debug --quiet #{srcdir})
- args << '--op' << dir
-
- r = RDoc::RDoc.new
- r.document args
-}
diff --git a/benchmark/gc/redblack.rb b/benchmark/gc/redblack.rb
deleted file mode 100644
index c66290140a..0000000000
--- a/benchmark/gc/redblack.rb
+++ /dev/null
@@ -1,366 +0,0 @@
-# This benchmark is imported from https://github.com/jruby/rubybench/blob/master/time/bench_red_black.rb
-# License is License is Apache-2
-
-require 'benchmark'
-
-# Algorithm based on "Introduction to Algorithms" by Cormen and others
-class RedBlackTree
- class Node
- attr_accessor :color
- attr_accessor :key
- attr_accessor :left
- attr_accessor :right
- attr_accessor :parent
-
- RED = :red
- BLACK = :black
- COLORS = [RED, BLACK].freeze
-
- def initialize(key, color = RED)
- raise ArgumentError, "Bad value for color parameter" unless COLORS.include?(color)
- @color = color
- @key = key
- @left = @right = @parent = NilNode.instance
- end
-
- def black?
- return color == BLACK
- end
-
- def red?
- return color == RED
- end
- end
-
- class NilNode < Node
- class << self
- private :new
-
- # it's not thread safe
- def instance
- @instance ||= begin
- def instance
- return @instance
- end
-
- new
- end
- end
- end
-
- def initialize
- self.color = BLACK
- self.key = 0
- self.left = nil
- self.right = nil
- self.parent = nil
- end
-
- def nil?
- return true
- end
- end
-
- include Enumerable
-
- attr_accessor :root
- attr_accessor :size
-
- def initialize
- self.root = NilNode.instance
- self.size = 0
- end
-
- def add(key)
- insert(Node.new(key))
- end
-
- def insert(x)
- insert_helper(x)
-
- x.color = Node::RED
- while x != root && x.parent.color == Node::RED
- if x.parent == x.parent.parent.left
- y = x.parent.parent.right
- if !y.nil? && y.color == Node::RED
- x.parent.color = Node::BLACK
- y.color = Node::BLACK
- x.parent.parent.color = Node::RED
- x = x.parent.parent
- else
- if x == x.parent.right
- x = x.parent
- left_rotate(x)
- end
- x.parent.color = Node::BLACK
- x.parent.parent.color = Node::RED
- right_rotate(x.parent.parent)
- end
- else
- y = x.parent.parent.left
- if !y.nil? && y.color == Node::RED
- x.parent.color = Node::BLACK
- y.color = Node::BLACK
- x.parent.parent.color = Node::RED
- x = x.parent.parent
- else
- if x == x.parent.left
- x = x.parent
- right_rotate(x)
- end
- x.parent.color = Node::BLACK
- x.parent.parent.color = Node::RED
- left_rotate(x.parent.parent)
- end
- end
- end
- root.color = Node::BLACK
- end
-
- alias << insert
-
- def delete(z)
- y = (z.left.nil? || z.right.nil?) ? z : successor(z)
- x = y.left.nil? ? y.right : y.left
- x.parent = y.parent
-
- if y.parent.nil?
- self.root = x
- else
- if y == y.parent.left
- y.parent.left = x
- else
- y.parent.right = x
- end
- end
-
- z.key = y.key if y != z
-
- if y.color == Node::BLACK
- delete_fixup(x)
- end
-
- self.size -= 1
- return y
- end
-
- def minimum(x = root)
- while !x.left.nil?
- x = x.left
- end
- return x
- end
-
- def maximum(x = root)
- while !x.right.nil?
- x = x.right
- end
- return x
- end
-
- def successor(x)
- if !x.right.nil?
- return minimum(x.right)
- end
- y = x.parent
- while !y.nil? && x == y.right
- x = y
- y = y.parent
- end
- return y
- end
-
- def predecessor(x)
- if !x.left.nil?
- return maximum(x.left)
- end
- y = x.parent
- while !y.nil? && x == y.left
- x = y
- y = y.parent
- end
- return y
- end
-
- def inorder_walk(x = root)
- x = self.minimum
- while !x.nil?
- yield x.key
- x = successor(x)
- end
- end
-
- alias each inorder_walk
-
- def reverse_inorder_walk(x = root)
- x = self.maximum
- while !x.nil?
- yield x.key
- x = predecessor(x)
- end
- end
-
- alias reverse_each reverse_inorder_walk
-
- def search(key, x = root)
- while !x.nil? && x.key != key
- key < x.key ? x = x.left : x = x.right
- end
- return x
- end
-
- def empty?
- return self.root.nil?
- end
-
- def black_height(x = root)
- height = 0
- while !x.nil?
- x = x.left
- height +=1 if x.nil? || x.black?
- end
- return height
- end
-
-private
-
- def left_rotate(x)
- raise "x.right is nil!" if x.right.nil?
- y = x.right
- x.right = y.left
- y.left.parent = x if !y.left.nil?
- y.parent = x.parent
- if x.parent.nil?
- self.root = y
- else
- if x == x.parent.left
- x.parent.left = y
- else
- x.parent.right = y
- end
- end
- y.left = x
- x.parent = y
- end
-
- def right_rotate(x)
- raise "x.left is nil!" if x.left.nil?
- y = x.left
- x.left = y.right
- y.right.parent = x if !y.right.nil?
- y.parent = x.parent
- if x.parent.nil?
- self.root = y
- else
- if x == x.parent.left
- x.parent.left = y
- else
- x.parent.right = y
- end
- end
- y.right = x
- x.parent = y
- end
-
- def insert_helper(z)
- y = NilNode.instance
- x = root
- while !x.nil?
- y = x
- z.key < x.key ? x = x.left : x = x.right
- end
- z.parent = y
- if y.nil?
- self.root = z
- else
- z.key < y.key ? y.left = z : y.right = z
- end
- self.size += 1
- end
-
- def delete_fixup(x)
- while x != root && x.color == Node::BLACK
- if x == x.parent.left
- w = x.parent.right
- if w.color == Node::RED
- w.color = Node::BLACK
- x.parent.color = Node::RED
- left_rotate(x.parent)
- w = x.parent.right
- end
- if w.left.color == Node::BLACK && w.right.color == Node::BLACK
- w.color = Node::RED
- x = x.parent
- else
- if w.right.color == Node::BLACK
- w.left.color = Node::BLACK
- w.color = Node::RED
- right_rotate(w)
- w = x.parent.right
- end
- w.color = x.parent.color
- x.parent.color = Node::BLACK
- w.right.color = Node::BLACK
- left_rotate(x.parent)
- x = root
- end
- else
- w = x.parent.left
- if w.color == Node::RED
- w.color = Node::BLACK
- x.parent.color = Node::RED
- right_rotate(x.parent)
- w = x.parent.left
- end
- if w.right.color == Node::BLACK && w.left.color == Node::BLACK
- w.color = Node::RED
- x = x.parent
- else
- if w.left.color == Node::BLACK
- w.right.color = Node::BLACK
- w.color = Node::RED
- left_rotate(w)
- w = x.parent.left
- end
- w.color = x.parent.color
- x.parent.color = Node::BLACK
- w.left.color = Node::BLACK
- right_rotate(x.parent)
- x = root
- end
- end
- end
- x.color = Node::BLACK
- end
-end
-
-def rbt_bm
- n = 100_000
- a1 = []; n.times { a1 << rand(999_999) }
- a2 = []; n.times { a2 << rand(999_999) }
-
- start = Time.now
-
- tree = RedBlackTree.new
-
- n.times {|i| tree.add(i) }
- n.times { tree.delete(tree.root) }
-
- tree = RedBlackTree.new
- a1.each {|e| tree.add(e) }
- a2.each {|e| tree.search(e) }
- tree.inorder_walk {|key| key + 1 }
- tree.reverse_inorder_walk {|key| key + 1 }
- n.times { tree.minimum }
- n.times { tree.maximum }
-
- return Time.now - start
-end
-
-N = (ARGV[0] || 10).to_i
-
-N.times do
- # puts rbt_bm.to_f
- rbt_bm.to_f
- # puts "GC.count = #{GC.count}" if GC.respond_to?(:count)
-end
diff --git a/benchmark/gc/ring.rb b/benchmark/gc/ring.rb
deleted file mode 100644
index be2c7b7250..0000000000
--- a/benchmark/gc/ring.rb
+++ /dev/null
@@ -1,29 +0,0 @@
-# create many old objects
-
-max = 30_000_000
-
-class Ring
- attr_reader :next_ring
- def initialize n = nil
- @next_ring = n
- end
-
-
- def size
- s = 1
- ring = self
- while ring.next_ring
- s += 1
- ring = ring.next_ring
- end
- s
- end
-end
-
-ring = Ring.new
-
-max.times{
- ring = Ring.new(ring)
-}
-
-# p ring.size
diff --git a/benchmark/hash_aref_dsym.rb b/benchmark/hash_aref_dsym.rb
deleted file mode 100644
index af4f8c36d4..0000000000
--- a/benchmark/hash_aref_dsym.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-h = {}
-syms = ('a'..'z').map { |s| s.to_sym }
-syms.each { |s| h[s] = 1 }
-200_000.times { syms.each { |s| h[s] } }
diff --git a/benchmark/hash_aref_dsym_long.rb b/benchmark/hash_aref_dsym_long.rb
deleted file mode 100644
index 9d7759379e..0000000000
--- a/benchmark/hash_aref_dsym_long.rb
+++ /dev/null
@@ -1,21 +0,0 @@
-# [ruby-core:70129] [Bug #11396]
-collection_size = 200000
-sample_size = 10000
-
-values = (1..collection_size).to_a.map do |x|
- "THIS IS A LONGER STRING THAT IS ALSO UNIQUE #{x}"
-end
-
-symbol_hash = {}
-
-values.each do |x|
- symbol_hash[x.to_sym] = 1
-end
-
-# use the same samples each time to minimize deviations
-rng = Random.new(0)
-symbol_sample_array = values.sample(sample_size, random: rng).map(&:to_sym)
-
-3000.times do
- symbol_sample_array.each { |x| symbol_hash[x] }
-end
diff --git a/benchmark/hash_aref_fix.rb b/benchmark/hash_aref_fix.rb
deleted file mode 100644
index 1346890582..0000000000
--- a/benchmark/hash_aref_fix.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-h = {}
-nums = (1..26).to_a
-nums.each { |i| h[i] = i }
-200_000.times { nums.each { |s| h[s] } }
diff --git a/benchmark/hash_aref_flo.rb b/benchmark/hash_aref_flo.rb
deleted file mode 100644
index 2217274c82..0000000000
--- a/benchmark/hash_aref_flo.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-h = {}
-strs = [*1..10000].map! {|i| i.fdiv(10)}
-strs.each { |s| h[s] = s }
-50.times { strs.each { |s| h[s] } }
diff --git a/benchmark/hash_aref_miss.rb b/benchmark/hash_aref_miss.rb
deleted file mode 100644
index b0913dd4bb..0000000000
--- a/benchmark/hash_aref_miss.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-h = {}
-strs = ('a'..'z').to_a.map!(&:freeze)
-strs.each { |s| h[s] = s }
-strs = ('A'..'Z').to_a
-200_000.times { strs.each { |s| h[s] } }
diff --git a/benchmark/hash_aref_str.rb b/benchmark/hash_aref_str.rb
deleted file mode 100644
index 19439b061b..0000000000
--- a/benchmark/hash_aref_str.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-h = {}
-strs = ('a'..'z').to_a.map!(&:freeze)
-strs.each { |s| h[s] = s }
-200_000.times { strs.each { |s| h[s] } }
diff --git a/benchmark/hash_aref_sym.rb b/benchmark/hash_aref_sym.rb
deleted file mode 100644
index f75d163fe6..0000000000
--- a/benchmark/hash_aref_sym.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-h = {}
-syms = ('a'..'z').to_a
-begin
- syms = eval("%i[#{syms.join(' ')}]")
-rescue SyntaxError # <= 1.9.3
- syms.map!(&:to_sym)
-end
-syms.each { |s| h[s] = s }
-200_000.times { syms.each { |s| h[s] } }
diff --git a/benchmark/hash_aref_sym_long.rb b/benchmark/hash_aref_sym_long.rb
deleted file mode 100644
index 9dab8df7be..0000000000
--- a/benchmark/hash_aref_sym_long.rb
+++ /dev/null
@@ -1,13 +0,0 @@
-h = {}
-syms = %w[puts warn syswrite write stat bacon lettuce tomato
-some symbols in this array may already be interned others should not be
-hash browns make good breakfast but not cooked using prime numbers
-shift for division entries delete_if keys exist?
-]
-begin
- syms = eval("%i[#{syms.join(' ')}]")
-rescue SyntaxError # <= 1.9.3
- syms.map!(&:to_sym)
-end
-syms.each { |s| h[s] = s }
-200_000.times { syms.each { |s| h[s] } }
diff --git a/benchmark/hash_dup.yml b/benchmark/hash_dup.yml
deleted file mode 100644
index 65f521ec94..0000000000
--- a/benchmark/hash_dup.yml
+++ /dev/null
@@ -1,8 +0,0 @@
-prelude: |
- small_hash = { a: 1 }
- larger_hash = 20.times.map { |i| [('a'.ord + i).chr.to_sym, i] }.to_h
-
-benchmark:
- dup_small: small_hash.dup
- dup_larger: larger_hash.dup
-loop_count: 10000
diff --git a/benchmark/hash_flatten.rb b/benchmark/hash_flatten.rb
deleted file mode 100644
index e944aae9f2..0000000000
--- a/benchmark/hash_flatten.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-h = {}
-
-10000.times do |i|
- h[i] = nil
-end
-
-1000.times do
- h.flatten
-end
diff --git a/benchmark/hash_ident_flo.rb b/benchmark/hash_ident_flo.rb
deleted file mode 100644
index 0c7edfed3e..0000000000
--- a/benchmark/hash_ident_flo.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-h = {}.compare_by_identity
-strs = (1..10000).to_a.map!(&:to_f)
-strs.each { |s| h[s] = s }
-50.times { strs.each { |s| h[s] } }
diff --git a/benchmark/hash_ident_num.rb b/benchmark/hash_ident_num.rb
deleted file mode 100644
index b226736c6f..0000000000
--- a/benchmark/hash_ident_num.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-h = {}.compare_by_identity
-nums = (1..26).to_a
-nums.each { |n| h[n] = n }
-200_000.times { nums.each { |n| h[n] } }
diff --git a/benchmark/hash_ident_obj.rb b/benchmark/hash_ident_obj.rb
deleted file mode 100644
index 4b3b58edec..0000000000
--- a/benchmark/hash_ident_obj.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-h = {}.compare_by_identity
-objs = 26.times.map { Object.new }
-objs.each { |o| h[o] = o }
-200_000.times { objs.each { |o| h[o] } }
diff --git a/benchmark/hash_ident_str.rb b/benchmark/hash_ident_str.rb
deleted file mode 100644
index 8582b38e31..0000000000
--- a/benchmark/hash_ident_str.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-h = {}.compare_by_identity
-strs = ('a'..'z').to_a
-strs.each { |s| h[s] = s }
-200_000.times { strs.each { |s| h[s] } }
diff --git a/benchmark/hash_ident_sym.rb b/benchmark/hash_ident_sym.rb
deleted file mode 100644
index 4c81e3d28e..0000000000
--- a/benchmark/hash_ident_sym.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-h = {}.compare_by_identity
-syms = ('a'..'z').to_a.map(&:to_sym)
-syms.each { |s| h[s] = s }
-200_000.times { syms.each { |s| h[s] } }
diff --git a/benchmark/hash_keys.rb b/benchmark/hash_keys.rb
deleted file mode 100644
index 6863cd01f9..0000000000
--- a/benchmark/hash_keys.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-h = {}
-
-10000.times do |i|
- h[i] = nil
-end
-
-5000.times do
- h.keys
-end
diff --git a/benchmark/hash_literal_small2.rb b/benchmark/hash_literal_small2.rb
deleted file mode 100644
index c188529260..0000000000
--- a/benchmark/hash_literal_small2.rb
+++ /dev/null
@@ -1,3 +0,0 @@
-# frozen_string_literal: true
-
-1_000_000.times.map { { "foo" => "bar", "bar" => "baz" } }
diff --git a/benchmark/hash_literal_small4.rb b/benchmark/hash_literal_small4.rb
deleted file mode 100644
index 739f71b5b0..0000000000
--- a/benchmark/hash_literal_small4.rb
+++ /dev/null
@@ -1,3 +0,0 @@
-# frozen_string_literal: true
-
-1_000_000.times.map { { "foo" => "bar", "bar" => "baz", "baz" => "lol", "lol" => "lgtm" } }
diff --git a/benchmark/hash_literal_small8.rb b/benchmark/hash_literal_small8.rb
deleted file mode 100644
index 53d80af535..0000000000
--- a/benchmark/hash_literal_small8.rb
+++ /dev/null
@@ -1,3 +0,0 @@
-# frozen_string_literal: true
-
-1_000_000.times.map { { "foo" => "bar", "bar" => "baz", "baz" => "lol", "lol" => "lgtm", "lgtm" => "nope", "nope" => "ok", "ok" => "again", "again" => "wait" } }
diff --git a/benchmark/hash_long.rb b/benchmark/hash_long.rb
deleted file mode 100644
index 03d9109602..0000000000
--- a/benchmark/hash_long.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-k1 = "Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong";
-k2 = "Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping Pong Ping";
-h = {k1 => 0, k2 => 0};
-3000000.times{|i| k = i % 2 ? k2 : k1; h [k] = h[k] + 1}
diff --git a/benchmark/hash_shift.rb b/benchmark/hash_shift.rb
deleted file mode 100644
index a645671a5b..0000000000
--- a/benchmark/hash_shift.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-h = {}
-
-10000.times do |i|
- h[i] = nil
-end
-
-50000.times do
- k, v = h.shift
- h[k] = v
-end
diff --git a/benchmark/hash_shift_u16.rb b/benchmark/hash_shift_u16.rb
deleted file mode 100644
index ec800d0342..0000000000
--- a/benchmark/hash_shift_u16.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-h = {}
-
-(16384..65536).each do |i|
- h[i] = nil
-end
-
-300000.times do
- k, v = h.shift
- h[k] = v
-end
diff --git a/benchmark/hash_shift_u24.rb b/benchmark/hash_shift_u24.rb
deleted file mode 100644
index de4e0fa696..0000000000
--- a/benchmark/hash_shift_u24.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-h = {}
-
-(0xff4000..0xffffff).each do |i|
- h[i] = nil
-end
-
-300000.times do
- k, v = h.shift
- h[k] = v
-end
diff --git a/benchmark/hash_shift_u32.rb b/benchmark/hash_shift_u32.rb
deleted file mode 100644
index 656aa55583..0000000000
--- a/benchmark/hash_shift_u32.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-h = {}
-
-(0xffff4000..0xffffffff).each do |i|
- h[i] = nil
-end
-
-300000.times do
- k, v = h.shift
- h[k] = v
-end
diff --git a/benchmark/hash_small2.rb b/benchmark/hash_small2.rb
deleted file mode 100644
index 45485d9c71..0000000000
--- a/benchmark/hash_small2.rb
+++ /dev/null
@@ -1 +0,0 @@
-1000000.times.map{|i| a={}; 2.times{|j| a[j]=j}; a}
diff --git a/benchmark/hash_small4.rb b/benchmark/hash_small4.rb
deleted file mode 100644
index acd4084334..0000000000
--- a/benchmark/hash_small4.rb
+++ /dev/null
@@ -1 +0,0 @@
-1000000.times.map{|i| a={}; 4.times{|j| a[j]=j}; a}
diff --git a/benchmark/hash_small8.rb b/benchmark/hash_small8.rb
deleted file mode 100644
index 9cffcc91b6..0000000000
--- a/benchmark/hash_small8.rb
+++ /dev/null
@@ -1 +0,0 @@
-1000000.times.map{|i| a={}; 8.times{|j| a[j]=j}; a}
diff --git a/benchmark/hash_to_proc.rb b/benchmark/hash_to_proc.rb
deleted file mode 100644
index 2b675bf509..0000000000
--- a/benchmark/hash_to_proc.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-h = {}
-
-10000.times do |i|
- h[i] = nil
-end
-
-5000.times do |i|
- [i].map(&h)
-end
diff --git a/benchmark/hash_values.rb b/benchmark/hash_values.rb
deleted file mode 100644
index 069441302f..0000000000
--- a/benchmark/hash_values.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-h = {}
-
-10000.times do |i|
- h[i] = nil
-end
-
-5000.times do
- h.values
-end
diff --git a/benchmark/int_quo.rb b/benchmark/int_quo.rb
deleted file mode 100644
index e22a3f8c30..0000000000
--- a/benchmark/int_quo.rb
+++ /dev/null
@@ -1 +0,0 @@
-5000000.times { 42.quo(3) }
diff --git a/benchmark/io_copy_stream_write.rb b/benchmark/io_copy_stream_write.rb
deleted file mode 100644
index 3fd87250a4..0000000000
--- a/benchmark/io_copy_stream_write.rb
+++ /dev/null
@@ -1,24 +0,0 @@
-# The goal of this is to use a synthetic (non-IO) reader
-# to trigger the read/write loop of IO.copy_stream,
-# bypassing in-kernel mechanisms like sendfile for zero copy,
-# so we wrap the /dev/zero IO object:
-
-class Zero
- def initialize
- @n = 100000
- @in = File.open('/dev/zero', 'rb')
- end
-
- def read(len, buf)
- return if (@n -= 1) == 0
- @in.read(len, buf)
- end
-end
-
-begin
- src = Zero.new
- dst = File.open(IO::NULL, 'wb')
- n = IO.copy_stream(src, dst)
-rescue Errno::ENOENT
- # not *nix
-end if IO.respond_to?(:copy_stream) && IO.const_defined?(:NULL)
diff --git a/benchmark/io_copy_stream_write_socket.rb b/benchmark/io_copy_stream_write_socket.rb
deleted file mode 100644
index 11f369bd0d..0000000000
--- a/benchmark/io_copy_stream_write_socket.rb
+++ /dev/null
@@ -1,35 +0,0 @@
-# The goal of this is to use a synthetic (non-IO) reader
-# to trigger the read/write loop of IO.copy_stream,
-# bypassing in-kernel mechanisms like sendfile for zero copy,
-# so we wrap the /dev/zero IO object:
-class Zero
- def initialize
- @n = 100000
- @in = File.open('/dev/zero', 'rb')
- end
-
- def read(len, buf)
- return if (@n -= 1) == 0
- @in.read(len, buf)
- end
-end
-
-begin
- require 'socket'
- src = Zero.new
- rd, wr = UNIXSocket.pair
- pid = fork do
- wr.close
- buf = String.new
- while rd.read(16384, buf)
- end
- end
- rd.close
- IO.copy_stream(src, wr)
-rescue Errno::ENOENT, NotImplementedError, NameError
- # not *nix: missing /dev/zero, fork, or UNIXSocket
-rescue LoadError # no socket?
-ensure
- wr.close if wr
- Process.waitpid(pid) if pid
-end if IO.respond_to?(:copy_stream)
diff --git a/benchmark/io_file_create.rb b/benchmark/io_file_create.rb
deleted file mode 100644
index 2f205c1333..0000000000
--- a/benchmark/io_file_create.rb
+++ /dev/null
@@ -1,13 +0,0 @@
-#
-# Create files
-#
-
-max = 200_000
-file = './tmpfile_of_bm_io_file_create'
-
-max.times{
- f = open(file, 'w')
- f.close#(true)
-}
-File.unlink(file)
-
diff --git a/benchmark/io_file_read.rb b/benchmark/io_file_read.rb
deleted file mode 100644
index b9e796ed30..0000000000
--- a/benchmark/io_file_read.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-#
-# Seek and Read file.
-#
-
-require 'tempfile'
-
-max = 200_000
-str = "Hello world! " * 1000
-f = Tempfile.new('yarv-benchmark')
-f.write str
-
-max.times{
- f.seek 0
- f.read
-}
diff --git a/benchmark/io_file_write.rb b/benchmark/io_file_write.rb
deleted file mode 100644
index aa1be0e5fe..0000000000
--- a/benchmark/io_file_write.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-#
-# Seek and Write file.
-#
-
-require 'tempfile'
-
-max = 200_000
-str = "Hello world! " * 1000
-f = Tempfile.new('yarv-benchmark')
-
-max.times{
- f.seek 0
- f.write str
-}
diff --git a/benchmark/io_nonblock_noex.rb b/benchmark/io_nonblock_noex.rb
deleted file mode 100644
index da9357fdc6..0000000000
--- a/benchmark/io_nonblock_noex.rb
+++ /dev/null
@@ -1,22 +0,0 @@
-nr = 1_000_000
-i = 0
-msg = '.'
-buf = '.'
-noex = { exception: false }
-begin
- r, w = IO.pipe
- while i < nr
- i += 1
- w.write_nonblock(msg, noex)
- r.read_nonblock(1, buf, noex)
- end
-rescue ArgumentError # old Rubies
- while i < nr
- i += 1
- w.write_nonblock(msg)
- r.read_nonblock(1, buf)
- end
-ensure
- r.close
- w.close
-end
diff --git a/benchmark/io_nonblock_noex2.rb b/benchmark/io_nonblock_noex2.rb
deleted file mode 100644
index 56819d049b..0000000000
--- a/benchmark/io_nonblock_noex2.rb
+++ /dev/null
@@ -1,21 +0,0 @@
-nr = 1_000_000
-i = 0
-msg = '.'
-buf = '.'
-begin
- r, w = IO.pipe
- while i < nr
- i += 1
- w.write_nonblock(msg, exception: false)
- r.read_nonblock(1, buf, exception: false)
- end
-rescue ArgumentError # old Rubies
- while i < nr
- i += 1
- w.write_nonblock(msg)
- r.read_nonblock(1, buf)
- end
-ensure
- r.close
- w.close
-end
diff --git a/benchmark/io_pipe_rw.rb b/benchmark/io_pipe_rw.rb
deleted file mode 100644
index 6862a8ae61..0000000000
--- a/benchmark/io_pipe_rw.rb
+++ /dev/null
@@ -1,13 +0,0 @@
-# Measure uncontended GVL performance via read/write with 1:1 threading
-# If we switch to M:N threading, this will benchmark something else...
-r, w = IO.pipe
-src = '0'.freeze
-dst = String.new
-i = 0
-while i < 1_000_000
- i += 1
- w.write(src)
- r.read(1, dst)
-end
-w.close
-r.close
diff --git a/benchmark/io_select.rb b/benchmark/io_select.rb
deleted file mode 100644
index 19248daeb1..0000000000
--- a/benchmark/io_select.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-# IO.select performance
-
-w = [ IO.pipe[1] ];
-
-nr = 1000000
-nr.times {
- IO.select nil, w
-}
-
diff --git a/benchmark/io_select2.rb b/benchmark/io_select2.rb
deleted file mode 100644
index 10e37d71b2..0000000000
--- a/benchmark/io_select2.rb
+++ /dev/null
@@ -1,22 +0,0 @@
-# IO.select performance. worst case of single fd.
-
-ios = []
-nr = 1000000
-if defined?(Process::RLIMIT_NOFILE)
- max = Process.getrlimit(Process::RLIMIT_NOFILE)[0]
-else
- max = 64
-end
-puts "max fd: #{max} (results not apparent with <= 1024 max fd)"
-
-((max / 2) - 10).times do
- ios.concat IO.pipe
-end
-
-last = [ ios[-1] ]
-puts "last IO: #{last[0].inspect}"
-
-nr.times do
- IO.select nil, last
-end
-
diff --git a/benchmark/io_select3.rb b/benchmark/io_select3.rb
deleted file mode 100644
index 7d0ba1f092..0000000000
--- a/benchmark/io_select3.rb
+++ /dev/null
@@ -1,21 +0,0 @@
-# IO.select performance. a lot of fd
-
-ios = []
-nr = 100
-if defined?(Process::RLIMIT_NOFILE)
- max = Process.getrlimit(Process::RLIMIT_NOFILE)[0]
-else
- max = 64
-end
-puts "max fd: #{max} (results not apparent with <= 1024 max fd)"
-
-(max - 10).times do
- r, w = IO.pipe
- r.close
- ios.push w
-end
-
-nr.times do
- IO.select nil, ios
-end
-
diff --git a/benchmark/irb_color.yml b/benchmark/irb_color.yml
deleted file mode 100644
index ebdc8d7e8b..0000000000
--- a/benchmark/irb_color.yml
+++ /dev/null
@@ -1,13 +0,0 @@
-prelude: |
- require 'irb/color'
- code = <<~'CODE'
- def self.foo # bar
- :"erb #{ERB.new("<%= self %>", trim_mode: ?-).result}"
- end
- CODE
-benchmark:
- irb_color_complete: |
- IRB::Color.colorize_code(code, complete: true)
- irb_color_incomplete: |
- IRB::Color.colorize_code(code, complete: false)
-loop_count: 2000000
diff --git a/benchmark/irb_exec.yml b/benchmark/irb_exec.yml
deleted file mode 100644
index 28933f8b38..0000000000
--- a/benchmark/irb_exec.yml
+++ /dev/null
@@ -1,10 +0,0 @@
-prelude: |
- # frozen_string_literal: true
- require 'rbconfig'
- irb_f = [File.join(File.dirname(RbConfig.ruby), 'irb'), '-f']
-benchmark:
- irb_exec: |
- IO.popen(irb_f, 'w') do |io|
- io.write('exit')
- end
-loop_count: 30
diff --git a/benchmark/lib/benchmark_driver/output/driver.rb b/benchmark/lib/benchmark_driver/output/driver.rb
deleted file mode 100644
index d22236e9fb..0000000000
--- a/benchmark/lib/benchmark_driver/output/driver.rb
+++ /dev/null
@@ -1,36 +0,0 @@
-require 'benchmark_driver/output/simple'
-
-# This replicates the legacy benchmark/driver.rb behavior.
-class BenchmarkDriver::Output::Driver < BenchmarkDriver::Output::Simple
- def initialize(*)
- super
- @stdout = $stdout
- @strio = StringIO.new
- $stdout = IOMultiplexer.new(@stdout, @strio)
- end
-
- def with_benchmark(*)
- super
- ensure
- logfile = "bmlog-#{Time.now.strftime('%Y%m%d-%H%M%S')}.#{$$}.log"
- puts "\nLog file: #{logfile}"
-
- $stdout = @stdout
- File.write(logfile, @strio.tap(&:rewind).read)
- end
-
- class IOMultiplexer
- def initialize(io1, io2)
- @io1 = io1
- @io2 = io2
- end
-
- [:write, :sync, :sync=, :puts, :print, :flush].each do |method|
- define_method(method) do |*args|
- @io1.send(method, *args)
- @io2.send(method, *args)
- end
- end
- end
- private_constant :IOMultiplexer
-end
diff --git a/benchmark/lib/benchmark_driver/runner/cstime.rb b/benchmark/lib/benchmark_driver/runner/cstime.rb
deleted file mode 100644
index 3c3453e527..0000000000
--- a/benchmark/lib/benchmark_driver/runner/cstime.rb
+++ /dev/null
@@ -1,22 +0,0 @@
-require 'benchmark_driver/runner/total'
-
-class BenchmarkDriver::Runner::Cstime < BenchmarkDriver::Runner::Total
- METRIC = BenchmarkDriver::Metric.new(name: 'cstime', unit: 's', larger_better: false)
-
- # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
- Job = Class.new(BenchmarkDriver::DefaultJob)
- # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
- JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
-
- private
-
- # Overriding BenchmarkDriver::Runner::Total#metric
- def metric
- METRIC
- end
-
- # Overriding BenchmarkDriver::Runner::Total#target
- def target
- :cstime
- end
-end
diff --git a/benchmark/lib/benchmark_driver/runner/cutime.rb b/benchmark/lib/benchmark_driver/runner/cutime.rb
deleted file mode 100644
index e139962ef2..0000000000
--- a/benchmark/lib/benchmark_driver/runner/cutime.rb
+++ /dev/null
@@ -1,22 +0,0 @@
-require 'benchmark_driver/runner/total'
-
-class BenchmarkDriver::Runner::Cutime < BenchmarkDriver::Runner::Total
- METRIC = BenchmarkDriver::Metric.new(name: 'cutime', unit: 's', larger_better: false)
-
- # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
- Job = Class.new(BenchmarkDriver::DefaultJob)
- # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
- JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
-
- private
-
- # Overriding BenchmarkDriver::Runner::Total#metric
- def metric
- METRIC
- end
-
- # Overriding BenchmarkDriver::Runner::Total#target
- def target
- :cutime
- end
-end
diff --git a/benchmark/lib/benchmark_driver/runner/mjit_exec.rb b/benchmark/lib/benchmark_driver/runner/mjit_exec.rb
deleted file mode 100644
index 9f7c8c8af3..0000000000
--- a/benchmark/lib/benchmark_driver/runner/mjit_exec.rb
+++ /dev/null
@@ -1,237 +0,0 @@
-require 'benchmark_driver/struct'
-require 'benchmark_driver/metric'
-require 'erb'
-
-# A special runner dedicated for measuring mjit_exec overhead.
-class BenchmarkDriver::Runner::MjitExec
- METRIC = BenchmarkDriver::Metric.new(name: 'Iteration per second', unit: 'i/s')
-
- # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
- Job = ::BenchmarkDriver::Struct.new(
- :name, # @param [String] name - This is mandatory for all runner
- :metrics, # @param [Array<BenchmarkDriver::Metric>]
- :num_methods, # @param [Integer] num_methods - The number of methods to be defined
- :loop_count, # @param [Integer] loop_count
- :from_jit, # @param [TrueClass,FalseClass] from_jit - Whether the mjit_exec() is from JIT or not
- :to_jit, # @param [TrueClass,FalseClass] to_jit - Whether the mjit_exec() is to JIT or not
- )
- # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
- class << JobParser = Module.new
- # @param [Array,String] num_methods
- # @param [Integer] loop_count
- # @param [TrueClass,FalseClass] from_jit
- # @param [TrueClass,FalseClass] to_jit
- def parse(num_methods:, loop_count:, from_jit:, to_jit:)
- if num_methods.is_a?(String)
- num_methods = eval(num_methods)
- end
-
- num_methods.map do |num|
- if num_methods.size > 1
- suffix = "[#{'%4d' % num}]"
- else
- suffix = "_#{num}"
- end
- Job.new(
- name: "mjit_exec_#{from_jit ? 'JT' : 'VM'}2#{to_jit ? 'JT' : 'VM'}#{suffix}",
- metrics: [METRIC],
- num_methods: num,
- loop_count: loop_count,
- from_jit: from_jit,
- to_jit: to_jit,
- )
- end
- end
- end
-
- # @param [BenchmarkDriver::Config::RunnerConfig] config
- # @param [BenchmarkDriver::Output] output
- # @param [BenchmarkDriver::Context] contexts
- def initialize(config:, output:, contexts:)
- @config = config
- @output = output
- @contexts = contexts
- end
-
- # This method is dynamically called by `BenchmarkDriver::JobRunner.run`
- # @param [Array<BenchmarkDriver::Runner::Peak::Job>] jobs
- def run(jobs)
- @output.with_benchmark do
- jobs.each do |job|
- @output.with_job(name: job.name) do
- @contexts.each do |context|
- result = BenchmarkDriver::Repeater.with_repeat(config: @config, larger_better: true, rest_on_average: :average) do
- run_benchmark(job, context: context)
- end
- value, duration = result.value
- @output.with_context(name: context.name, executable: context.executable, gems: context.gems, prelude: context.prelude) do
- @output.report(values: { METRIC => value }, duration: duration, loop_count: job.loop_count)
- end
- end
- end
- end
- end
- end
-
- private
-
- # @param [BenchmarkDriver::Runner::Ips::Job] job - loop_count is not nil
- # @param [BenchmarkDriver::Context] context
- # @return [BenchmarkDriver::Metrics]
- def run_benchmark(job, context:)
- if job.from_jit
- if job.to_jit
- benchmark = BenchmarkJT2JT.new(num_methods: job.num_methods, loop_count: job.loop_count)
- else
- raise NotImplementedError, "JT2VM is not implemented yet"
- end
- else
- if job.to_jit
- benchmark = BenchmarkVM2JT.new(num_methods: job.num_methods, loop_count: job.loop_count)
- else
- benchmark = BenchmarkVM2VM.new(num_methods: job.num_methods, loop_count: job.loop_count)
- end
- end
-
- duration = Tempfile.open(['benchmark_driver-result', '.txt']) do |f|
- with_script(benchmark.render(result: f.path)) do |path|
- opt = []
- if context.executable.command.any? { |c| c.start_with?('--jit') }
- opt << '--jit-min-calls=2'
- end
- IO.popen([*context.executable.command, '--disable-gems', *opt, path], &:read)
- if $?.success?
- Float(f.read)
- else
- BenchmarkDriver::Result::ERROR
- end
- end
- end
-
- [job.loop_count.to_f / duration, duration]
- end
-
- def with_script(script)
- if @config.verbose >= 2
- sep = '-' * 30
- $stdout.puts "\n\n#{sep}[Script begin]#{sep}\n#{script}#{sep}[Script end]#{sep}\n\n"
- end
-
- Tempfile.open(['benchmark_driver-', '.rb']) do |f|
- f.puts script
- f.close
- return yield(f.path)
- end
- end
-
- # @param [Integer] num_methods
- # @param [Integer] loop_count
- BenchmarkVM2VM = ::BenchmarkDriver::Struct.new(:num_methods, :loop_count) do
- # @param [String] result - A file to write result
- def render(result:)
- ERB.new(<<~EOS, trim_mode: '%').result(binding)
- % num_methods.times do |i|
- def a<%= i %>
- nil
- end
- % end
- RubyVM::MJIT.pause if RubyVM::MJIT.enabled?
-
- def vm
- t = Process.clock_gettime(Process::CLOCK_MONOTONIC)
- i = 0
- while i < <%= loop_count / 1000 %>
- % 1000.times do |i|
- a<%= i % num_methods %>
- % end
- i += 1
- end
- % (loop_count % 1000).times do |i|
- a<%= i % num_methods %>
- % end
- Process.clock_gettime(Process::CLOCK_MONOTONIC) - t
- end
-
- vm # warmup call cache
- File.write(<%= result.dump %>, vm)
- EOS
- end
- end
- private_constant :BenchmarkVM2VM
-
- # @param [Integer] num_methods
- # @param [Integer] loop_count
- BenchmarkVM2JT = ::BenchmarkDriver::Struct.new(:num_methods, :loop_count) do
- # @param [String] result - A file to write result
- def render(result:)
- ERB.new(<<~EOS, trim_mode: '%').result(binding)
- % num_methods.times do |i|
- def a<%= i %>
- nil
- end
- a<%= i %>
- a<%= i %> # --jit-min-calls=2
- % end
- RubyVM::MJIT.pause if RubyVM::MJIT.enabled?
-
- def vm
- t = Process.clock_gettime(Process::CLOCK_MONOTONIC)
- i = 0
- while i < <%= loop_count / 1000 %>
- % 1000.times do |i|
- a<%= i % num_methods %>
- % end
- i += 1
- end
- % (loop_count % 1000).times do |i|
- a<%= i % num_methods %>
- % end
- Process.clock_gettime(Process::CLOCK_MONOTONIC) - t
- end
-
- vm # warmup call cache
- File.write(<%= result.dump %>, vm)
- EOS
- end
- end
- private_constant :BenchmarkVM2JT
-
- # @param [Integer] num_methods
- # @param [Integer] loop_count
- BenchmarkJT2JT = ::BenchmarkDriver::Struct.new(:num_methods, :loop_count) do
- # @param [String] result - A file to write result
- def render(result:)
- ERB.new(<<~EOS, trim_mode: '%').result(binding)
- % num_methods.times do |i|
- def a<%= i %>
- nil
- end
- % end
-
- # You may need to:
- # * Increase `JIT_ISEQ_SIZE_THRESHOLD` to 10000000 in mjit.h
- # * Always return false in `inlinable_iseq_p()` of mjit_compile.c
- def jit
- t = Process.clock_gettime(Process::CLOCK_MONOTONIC)
- i = 0
- while i < <%= loop_count / 1000 %>
- % 1000.times do |i|
- a<%= i % num_methods %>
- % end
- i += 1
- end
- % (loop_count % 1000).times do |i|
- a<%= i % num_methods %>
- % end
- Process.clock_gettime(Process::CLOCK_MONOTONIC) - t
- end
-
- jit
- jit
- RubyVM::MJIT.pause if RubyVM::MJIT.enabled?
- File.write(<%= result.dump %>, jit)
- EOS
- end
- end
- private_constant :BenchmarkJT2JT
-end
diff --git a/benchmark/lib/benchmark_driver/runner/peak.rb b/benchmark/lib/benchmark_driver/runner/peak.rb
deleted file mode 100644
index d04f2e51ff..0000000000
--- a/benchmark/lib/benchmark_driver/runner/peak.rb
+++ /dev/null
@@ -1,151 +0,0 @@
-require 'benchmark_driver/struct'
-require 'benchmark_driver/metric'
-require 'benchmark_driver/default_job'
-require 'benchmark_driver/default_job_parser'
-require 'tempfile'
-
-class BenchmarkDriver::Runner::Peak
- METRIC = BenchmarkDriver::Metric.new(
- name: 'Peak memory usage', unit: 'bytes', larger_better: false, worse_word: 'larger',
- )
-
- # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
- Job = Class.new(BenchmarkDriver::DefaultJob)
- # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
- JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
-
- # @param [BenchmarkDriver::Config::RunnerConfig] config
- # @param [BenchmarkDriver::Output] output
- # @param [BenchmarkDriver::Context] contexts
- def initialize(config:, output:, contexts:)
- @config = config
- @output = output
- @contexts = contexts
- end
-
- # This method is dynamically called by `BenchmarkDriver::JobRunner.run`
- # @param [Array<BenchmarkDriver::Runner::Peak::Job>] jobs
- def run(jobs)
- if jobs.any? { |job| job.loop_count.nil? }
- jobs = jobs.map do |job|
- job.loop_count ? job : Job.new(job.to_h.merge(loop_count: 1))
- end
- end
-
- @output.with_benchmark do
- jobs.each do |job|
- @output.with_job(name: job.name) do
- job.runnable_contexts(@contexts).each do |context|
- value = BenchmarkDriver::Repeater.with_repeat(config: @config, larger_better: false) do
- run_benchmark(job, context: context)
- end
- @output.with_context(name: context.name, executable: context.executable, gems: context.gems, prelude: context.prelude) do
- @output.report(values: { metric => value }, loop_count: job.loop_count)
- end
- end
- end
- end
- end
- end
-
- private
-
- # @param [BenchmarkDriver::Runner::Ips::Job] job - loop_count is not nil
- # @param [BenchmarkDriver::Context] context
- # @return [BenchmarkDriver::Metrics]
- def run_benchmark(job, context:)
- benchmark = BenchmarkScript.new(
- preludes: [context.prelude, job.prelude],
- script: job.script,
- teardown: job.teardown,
- loop_count: job.loop_count,
- )
-
- memory_status = File.expand_path('../../../../tool/lib/memory_status', __dir__)
- Tempfile.open(['benchmark_driver-', '.rb']) do |f|
- with_script(benchmark.render) do |path|
- output = IO.popen([*context.executable.command, path, f.path, target, memory_status], &:read)
- if $?.success?
- Integer(f.read)
- else
- $stdout.print(output)
- BenchmarkDriver::Result::ERROR
- end
- end
- end
- end
-
- # Overridden by BenchmarkDriver::Runner::Size
- def target
- 'peak'
- end
-
- # Overridden by BenchmarkDriver::Runner::Size
- def metric
- METRIC
- end
-
- def with_script(script)
- if @config.verbose >= 2
- sep = '-' * 30
- $stdout.puts "\n\n#{sep}[Script begin]#{sep}\n#{script}#{sep}[Script end]#{sep}\n\n"
- end
-
- Tempfile.open(['benchmark_driver-', '.rb']) do |f|
- f.puts script
- f.close
- return yield(f.path)
- end
- end
-
- # @param [String] prelude
- # @param [String] script
- # @param [String] teardown
- # @param [Integer] loop_count
- BenchmarkScript = ::BenchmarkDriver::Struct.new(:preludes, :script, :teardown, :loop_count) do
- def render
- prelude = preludes.reject(&:nil?).reject(&:empty?).join("\n")
- <<-RUBY
-#{prelude}
-#{while_loop(script, loop_count)}
-#{teardown}
-
-result_file, target, memory_status = ARGV
-require_relative memory_status
-
-ms = Memory::Status.new
-case target.to_sym
-when :peak
- key = ms.respond_to?(:hwm) ? :hwm : :peak
-when :size
- key = ms.respond_to?(:rss) ? :rss : :size
-else
- raise('unexpected target: ' + target)
-end
-
-File.write(result_file, ms[key])
- RUBY
- end
-
- private
-
- def while_loop(content, times)
- if !times.is_a?(Integer) || times <= 0
- raise ArgumentError.new("Unexpected times: #{times.inspect}")
- end
-
- if times > 1
- <<-RUBY
-__bmdv_i = 0
-while __bmdv_i < #{times}
- #{content}
- __bmdv_i += 1
-end
- RUBY
- else
- content
- end
- end
- end
- private_constant :BenchmarkScript
-end
diff --git a/benchmark/lib/benchmark_driver/runner/size.rb b/benchmark/lib/benchmark_driver/runner/size.rb
deleted file mode 100644
index 1b31f901c7..0000000000
--- a/benchmark/lib/benchmark_driver/runner/size.rb
+++ /dev/null
@@ -1,25 +0,0 @@
-require 'benchmark_driver/runner/peak'
-
-# Actually the same as BenchmarkDriver::Runner::Memory
-class BenchmarkDriver::Runner::Size < BenchmarkDriver::Runner::Peak
- METRIC = BenchmarkDriver::Metric.new(
- name: 'Max resident set size', unit: 'bytes', larger_better: false, worse_word: 'larger',
- )
-
- # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
- Job = Class.new(BenchmarkDriver::DefaultJob)
- # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
- JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
-
- private
-
- # Overriding BenchmarkDriver::Runner::Peak#metric
- def metric
- METRIC
- end
-
- # Overriding BenchmarkDriver::Runner::Peak#target
- def target
- 'size'
- end
-end
diff --git a/benchmark/lib/benchmark_driver/runner/stime.rb b/benchmark/lib/benchmark_driver/runner/stime.rb
deleted file mode 100644
index 4577fb0bf8..0000000000
--- a/benchmark/lib/benchmark_driver/runner/stime.rb
+++ /dev/null
@@ -1,22 +0,0 @@
-require 'benchmark_driver/runner/total'
-
-class BenchmarkDriver::Runner::Stime < BenchmarkDriver::Runner::Total
- METRIC = BenchmarkDriver::Metric.new(name: 'stime', unit: 's', larger_better: false)
-
- # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
- Job = Class.new(BenchmarkDriver::DefaultJob)
- # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
- JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
-
- private
-
- # Overriding BenchmarkDriver::Runner::Total#metric
- def metric
- METRIC
- end
-
- # Overriding BenchmarkDriver::Runner::Total#target
- def target
- :stime
- end
-end
diff --git a/benchmark/lib/benchmark_driver/runner/total.rb b/benchmark/lib/benchmark_driver/runner/total.rb
deleted file mode 100644
index 64dc14f84e..0000000000
--- a/benchmark/lib/benchmark_driver/runner/total.rb
+++ /dev/null
@@ -1,137 +0,0 @@
-require 'benchmark_driver/struct'
-require 'benchmark_driver/metric'
-require 'benchmark_driver/default_job'
-require 'benchmark_driver/default_job_parser'
-require 'tempfile'
-
-class BenchmarkDriver::Runner::Total
- METRIC = BenchmarkDriver::Metric.new(name: 'Total time', unit: 's', larger_better: false)
-
- # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
- Job = Class.new(BenchmarkDriver::DefaultJob)
- # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
- JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
-
- # @param [BenchmarkDriver::Config::RunnerConfig] config
- # @param [BenchmarkDriver::Output] output
- # @param [BenchmarkDriver::Context] contexts
- def initialize(config:, output:, contexts:)
- @config = config
- @output = output
- @contexts = contexts
- end
-
- # This method is dynamically called by `BenchmarkDriver::JobRunner.run`
- # @param [Array<BenchmarkDriver::Runner::Total::Job>] jobs
- def run(jobs)
- if jobs.any? { |job| job.loop_count.nil? }
- raise 'missing loop_count is not supported in Ruby repository'
- end
-
- @output.with_benchmark do
- jobs.each do |job|
- @output.with_job(name: job.name) do
- job.runnable_contexts(@contexts).each do |context|
- duration = BenchmarkDriver::Repeater.with_repeat(config: @config, larger_better: false) do
- run_benchmark(job, context: context)
- end
- @output.with_context(name: context.name, executable: context.executable, gems: context.gems, prelude: context.prelude) do
- @output.report(values: { metric => duration }, duration: duration, loop_count: job.loop_count)
- end
- end
- end
- end
- end
- end
-
- private
-
- # @param [BenchmarkDriver::Runner::Ips::Job] job - loop_count is not nil
- # @param [BenchmarkDriver::Context] context
- # @return [BenchmarkDriver::Metrics]
- def run_benchmark(job, context:)
- benchmark = BenchmarkScript.new(
- preludes: [context.prelude, job.prelude],
- script: job.script,
- teardown: job.teardown,
- loop_count: job.loop_count,
- )
-
- Tempfile.open(['benchmark_driver-', '.rb']) do |f|
- with_script(benchmark.render(result: f.path, target: target)) do |path|
- IO.popen([*context.executable.command, path], &:read) # TODO: print stdout if verbose=2
- if $?.success?
- Float(f.read)
- else
- BenchmarkDriver::Result::ERROR
- end
- end
- end
- end
-
- # This method is overridden by some subclasses
- def metric
- METRIC
- end
-
- # This method is overridden by some subclasses
- def target
- :total
- end
-
- def with_script(script)
- if @config.verbose >= 2
- sep = '-' * 30
- $stdout.puts "\n\n#{sep}[Script begin]#{sep}\n#{script}#{sep}[Script end]#{sep}\n\n"
- end
-
- Tempfile.open(['benchmark_driver-', '.rb']) do |f|
- f.puts script
- f.close
- return yield(f.path)
- end
- end
-
- # @param [String] prelude
- # @param [String] script
- # @param [String] teardown
- # @param [Integer] loop_count
- BenchmarkScript = ::BenchmarkDriver::Struct.new(:preludes, :script, :teardown, :loop_count) do
- # @param [String] result - A file to write result
- def render(result:, target:)
- prelude = preludes.reject(&:nil?).reject(&:empty?).join("\n")
- <<-RUBY
-#{prelude}
-
-require 'benchmark'
-__bmdv_result = Benchmark.measure {
- #{while_loop(script, loop_count)}
-}
-
-#{teardown}
-
-File.write(#{result.dump}, __bmdv_result.#{target})
- RUBY
- end
-
- private
-
- def while_loop(content, times)
- if !times.is_a?(Integer) || times <= 0
- raise ArgumentError.new("Unexpected times: #{times.inspect}")
- elsif times == 1
- return content
- end
-
- # TODO: execute in batch
- <<-RUBY
-__bmdv_i = 0
-while __bmdv_i < #{times}
- #{content}
- __bmdv_i += 1
-end
- RUBY
- end
- end
- private_constant :BenchmarkScript
-end
diff --git a/benchmark/lib/benchmark_driver/runner/utime.rb b/benchmark/lib/benchmark_driver/runner/utime.rb
deleted file mode 100644
index b61d83a188..0000000000
--- a/benchmark/lib/benchmark_driver/runner/utime.rb
+++ /dev/null
@@ -1,22 +0,0 @@
-require 'benchmark_driver/runner/total'
-
-class BenchmarkDriver::Runner::Utime < BenchmarkDriver::Runner::Total
- METRIC = BenchmarkDriver::Metric.new(name: 'utime', unit: 's', larger_better: false)
-
- # JobParser returns this, `BenchmarkDriver::Runner.runner_for` searches "*::Job"
- Job = Class.new(BenchmarkDriver::DefaultJob)
- # Dynamically fetched and used by `BenchmarkDriver::JobParser.parse`
- JobParser = BenchmarkDriver::DefaultJobParser.for(klass: Job, metrics: [METRIC])
-
- private
-
- # Overriding BenchmarkDriver::Runner::Total#metric
- def metric
- METRIC
- end
-
- # Overriding BenchmarkDriver::Runner::Total#target
- def target
- :utime
- end
-end
diff --git a/benchmark/lib/load.rb b/benchmark/lib/load.rb
deleted file mode 100644
index 31b770c484..0000000000
--- a/benchmark/lib/load.rb
+++ /dev/null
@@ -1,18 +0,0 @@
-# How to use this file:
-# 1. write a `$(srcdir)/test.rb` like:
-=begin
-require_relative 'benchmark/lib/load'
-
-Benchmark.driver(repeat_count: 5){|x|
- x.executable name: 'clean-miniruby', command: %w'../clean-trunk/miniruby'
- x.executable name: 'modif-miniruby', command: %w'./miniruby'
-
- x.report %q{
- h = {a: 1, b: 2, c: 3, d: 4}
- }
-}
-=end
-#
-# 2. `make run`
-$:.unshift(File.join(__dir__, '../benchmark-driver/lib'))
-require 'benchmark_driver'
diff --git a/benchmark/loop_for.rb b/benchmark/loop_for.rb
deleted file mode 100644
index 0fc4cc1511..0000000000
--- a/benchmark/loop_for.rb
+++ /dev/null
@@ -1,3 +0,0 @@
-for i in 1..30_000_000
- #
-end
diff --git a/benchmark/loop_generator.rb b/benchmark/loop_generator.rb
deleted file mode 100644
index d3375c744c..0000000000
--- a/benchmark/loop_generator.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-max = 600000
-
-if defined? Fiber
- gen = (1..max).each
- loop do
- gen.next
- end
-else
- require 'generator'
- gen = Generator.new((0..max))
- while gen.next?
- gen.next
- end
-end
diff --git a/benchmark/loop_times.rb b/benchmark/loop_times.rb
deleted file mode 100644
index 521f72ad1a..0000000000
--- a/benchmark/loop_times.rb
+++ /dev/null
@@ -1 +0,0 @@
-30_000_000.times{|e|}
diff --git a/benchmark/loop_whileloop.rb b/benchmark/loop_whileloop.rb
deleted file mode 100644
index 0072822c06..0000000000
--- a/benchmark/loop_whileloop.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-i = 0
-while i<30_000_000 # benchmark loop 1
- i += 1
-end
diff --git a/benchmark/loop_whileloop2.rb b/benchmark/loop_whileloop2.rb
deleted file mode 100644
index 47d02dffc4..0000000000
--- a/benchmark/loop_whileloop2.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-i = 0
-while i< 6_000_000 # benchmark loop 2
- i += 1
-end
diff --git a/benchmark/marshal_dump_flo.rb b/benchmark/marshal_dump_flo.rb
deleted file mode 100644
index 9b8d0c6afb..0000000000
--- a/benchmark/marshal_dump_flo.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-bug10761 = 10000.times.map { |x| x.to_f }
-100.times { Marshal.dump(bug10761) }
diff --git a/benchmark/marshal_dump_load_geniv.rb b/benchmark/marshal_dump_load_geniv.rb
deleted file mode 100644
index 8252ad90fa..0000000000
--- a/benchmark/marshal_dump_load_geniv.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-a = ''
-a.instance_eval do
- @a = :a
- @b = :b
- @c = :c
-end
-100000.times do
- a = Marshal.load(Marshal.dump(a))
-end
-#p(a.instance_eval { @a == :a && @b == :b && @c == :c })
diff --git a/benchmark/marshal_dump_load_time.rb b/benchmark/marshal_dump_load_time.rb
deleted file mode 100644
index e29743b791..0000000000
--- a/benchmark/marshal_dump_load_time.rb
+++ /dev/null
@@ -1 +0,0 @@
-100000.times { Marshal.load(Marshal.dump(Time.now)) }
diff --git a/benchmark/match_gt4.rb b/benchmark/match_gt4.rb
deleted file mode 100644
index ffda109912..0000000000
--- a/benchmark/match_gt4.rb
+++ /dev/null
@@ -1 +0,0 @@
-1000000.times { /(.)(.)(\d+)(\d)/.match("THX1138.") }
diff --git a/benchmark/match_small.rb b/benchmark/match_small.rb
deleted file mode 100644
index 3b743d484a..0000000000
--- a/benchmark/match_small.rb
+++ /dev/null
@@ -1 +0,0 @@
-1000000.times { 'haystack'.match(/hay/) }
diff --git a/benchmark/mjit_exec_jt2jt.yml b/benchmark/mjit_exec_jt2jt.yml
deleted file mode 100644
index 5be408e30c..0000000000
--- a/benchmark/mjit_exec_jt2jt.yml
+++ /dev/null
@@ -1,8 +0,0 @@
-# Usage:
-# RUBYOPT=-Ibenchmark/lib benchmark-driver -e 'ruby --jit' benchmark/mjit_exec_vm2jt.yml
-type: mjit_exec # benchmark/lib/benchmark_driver/runner/mjit_exec.rb
-num_methods: [1]
-#num_methods: (1..100).to_a + [200, 300, 400, 500, 600, 700, 800, 900, 1000]
-loop_count: 50000000
-from_jit: true
-to_jit: true
diff --git a/benchmark/mjit_exec_vm2jt.yml b/benchmark/mjit_exec_vm2jt.yml
deleted file mode 100644
index 9947dbb7dd..0000000000
--- a/benchmark/mjit_exec_vm2jt.yml
+++ /dev/null
@@ -1,8 +0,0 @@
-# Usage:
-# RUBYOPT=-Ibenchmark/lib benchmark-driver -e 'ruby --jit' benchmark/mjit_exec_vm2jt.yml
-type: mjit_exec # benchmark/lib/benchmark_driver/runner/mjit_exec.rb
-num_methods: [1]
-#num_methods: (1..100).to_a + [200, 300, 400, 500, 600, 700, 800, 900, 1000]
-loop_count: 50000000
-from_jit: false
-to_jit: true
diff --git a/benchmark/mjit_exec_vm2vm.yml b/benchmark/mjit_exec_vm2vm.yml
deleted file mode 100644
index 4b84427b10..0000000000
--- a/benchmark/mjit_exec_vm2vm.yml
+++ /dev/null
@@ -1,8 +0,0 @@
-# Usage:
-# RUBYOPT=-Ibenchmark/lib benchmark-driver -e 'ruby --jit' benchmark/mjit_exec_vm2vm.yml
-type: mjit_exec # benchmark/lib/benchmark_driver/runner/mjit_exec.rb
-num_methods: [1]
-#num_methods: (1..100).to_a + [200, 300, 400, 500, 600, 700, 800, 900, 1000]
-loop_count: 50000000
-from_jit: false
-to_jit: false
diff --git a/benchmark/nil_p.yml b/benchmark/nil_p.yml
deleted file mode 100644
index 79ba4f2177..0000000000
--- a/benchmark/nil_p.yml
+++ /dev/null
@@ -1,9 +0,0 @@
-prelude: |
- class Niller; def nil?; true; end; end
- xnil, notnil = nil, Object.new
- niller = Niller.new
-benchmark:
- - xnil.nil?
- - notnil.nil?
- - niller.nil?
-loop_count: 10000000
diff --git a/benchmark/other-lang/ack.pl b/benchmark/other-lang/ack.pl
deleted file mode 100644
index 201e22ddfa..0000000000
--- a/benchmark/other-lang/ack.pl
+++ /dev/null
@@ -1,11 +0,0 @@
-use integer;
-
-sub Ack {
- return $_[0] ? ($_[1] ? Ack($_[0]-1, Ack($_[0], $_[1]-1))
- : Ack($_[0]-1, 1))
- : $_[1]+1;
-}
-
-my $NUM = 9;
-$NUM = 1 if ($NUM < 1);
-my $ack = Ack(3, $NUM);
diff --git a/benchmark/other-lang/ack.py b/benchmark/other-lang/ack.py
deleted file mode 100644
index 9968e7cfcf..0000000000
--- a/benchmark/other-lang/ack.py
+++ /dev/null
@@ -1,16 +0,0 @@
-import sys
-sys.setrecursionlimit(5000000)
-
-def Ack(M, N):
- if (not M):
- return( N + 1 )
- if (not N):
- return( Ack(M-1, 1) )
- return( Ack(M-1, Ack(M, N-1)) )
-
-def main():
- NUM = 9
- sys.setrecursionlimit(10000)
- Ack(3, NUM)
-
-main()
diff --git a/benchmark/other-lang/ack.rb b/benchmark/other-lang/ack.rb
deleted file mode 100644
index 7451bed6c4..0000000000
--- a/benchmark/other-lang/ack.rb
+++ /dev/null
@@ -1,12 +0,0 @@
-def ack(m, n)
- if m == 0 then
- n + 1
- elsif n == 0 then
- ack(m - 1, 1)
- else
- ack(m - 1, ack(m, n - 1))
- end
-end
-
-NUM = 9
-ack(3, NUM)
diff --git a/benchmark/other-lang/ack.scm b/benchmark/other-lang/ack.scm
deleted file mode 100644
index a80b73ba55..0000000000
--- a/benchmark/other-lang/ack.scm
+++ /dev/null
@@ -1,7 +0,0 @@
-(define (ack m n)
- (cond ((zero? m) (+ n 1))
- ((zero? n) (ack (- m 1) 1))
- (else (ack (- m 1) (ack m (- n 1))))))
-
-(ack 3 9)
-
diff --git a/benchmark/other-lang/eval.rb b/benchmark/other-lang/eval.rb
deleted file mode 100644
index 48a2cea019..0000000000
--- a/benchmark/other-lang/eval.rb
+++ /dev/null
@@ -1,66 +0,0 @@
-
-Bench = %w(
- loop
- ack
- fib
- tak
- fact
-)
-
-Lang = <<EOP.map{|l| l.strip}
- ruby-cyg
- ../../../test6/miniruby
- perl
- python
- gosh
-EOP
-
-Bench.replace ['loop2']
-Lang.replace ['ruby-cyg']
-
-Ext = %w(
- .rb
- .rb
- .pl
- .py
- .scm
-)
-
-p Bench
-p Lang
-
-require 'benchmark'
-
-def bench cmd
- m = Benchmark.measure{
- #p cmd
- system(cmd)
- }
- [m.utime, m.real]
-end
-
-Result = []
-Bench.each{|b|
- r = []
- Lang.each_with_index{|l, idx|
- cmd = "#{l} #{b}#{Ext[idx]}"
- r << bench(cmd)
- }
- Result << r
-}
-
-require 'pp'
-# utime
-puts Lang.join("\t")
-Bench.each_with_index{|b, bi|
- print b, "\t"
- puts Result[bi].map{|e| e[0]}.join("\t")
-}
-
-# rtime
-puts Lang.join("\t")
-Bench.each_with_index{|b, bi|
- print b, "\t"
- puts Result[bi].map{|e| e[1]}.join("\t")
-}
-
diff --git a/benchmark/other-lang/fact.pl b/benchmark/other-lang/fact.pl
deleted file mode 100644
index a9b0b69cdf..0000000000
--- a/benchmark/other-lang/fact.pl
+++ /dev/null
@@ -1,13 +0,0 @@
-sub fact{
- my $n = @_[0];
- if($n < 2){
- return 1;
- }
- else{
- return $n * fact($n-1);
- }
-}
-
-for($i=0; $i<10000; $i++){
- &fact(100);
-}
diff --git a/benchmark/other-lang/fact.py b/benchmark/other-lang/fact.py
deleted file mode 100644
index 1ce9f76275..0000000000
--- a/benchmark/other-lang/fact.py
+++ /dev/null
@@ -1,18 +0,0 @@
-#import sys
-#sys.setrecursionlimit(1000)
-
-def factL(n):
- r = 1
- for x in range(2, n+1):
- r *= x
- return r
-
-def factR(n):
- if n < 2:
- return 1
- else:
- return n * factR(n-1)
-
-for i in range(10000):
- factR(100)
-
diff --git a/benchmark/other-lang/fact.rb b/benchmark/other-lang/fact.rb
deleted file mode 100644
index 6cedc752cd..0000000000
--- a/benchmark/other-lang/fact.rb
+++ /dev/null
@@ -1,13 +0,0 @@
-def fact(n)
- if n < 2
- 1
- else
- n * fact(n-1)
- end
-end
-
-i = 0
-while i<10000
- i += 1
- fact(100)
-end
diff --git a/benchmark/other-lang/fact.scm b/benchmark/other-lang/fact.scm
deleted file mode 100644
index c98a7fedd3..0000000000
--- a/benchmark/other-lang/fact.scm
+++ /dev/null
@@ -1,8 +0,0 @@
-(define (fact n)
- (if (< n 2)
- 1
- (* n (fact (- n 1)))))
-
-(dotimes (i 10000)
- (fact 100))
-
diff --git a/benchmark/other-lang/fib.pl b/benchmark/other-lang/fib.pl
deleted file mode 100644
index a46f666d1e..0000000000
--- a/benchmark/other-lang/fib.pl
+++ /dev/null
@@ -1,11 +0,0 @@
-sub fib{
- my $n = $_[0];
- if($n < 3){
- return 1;
- }
- else{
- return fib($n-1) + fib($n-2);
- }
-};
-
-&fib(34);
diff --git a/benchmark/other-lang/fib.py b/benchmark/other-lang/fib.py
deleted file mode 100644
index 45f2bceb8d..0000000000
--- a/benchmark/other-lang/fib.py
+++ /dev/null
@@ -1,7 +0,0 @@
-def fib(n):
- if n < 3:
- return 1
- else:
- return fib(n-1) + fib(n-2)
-
-fib(34)
diff --git a/benchmark/other-lang/fib.rb b/benchmark/other-lang/fib.rb
deleted file mode 100644
index ec587eabe0..0000000000
--- a/benchmark/other-lang/fib.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-def fib n
- if n < 3
- 1
- else
- fib(n-1) + fib(n-2)
- end
-end
-
-fib(34)
diff --git a/benchmark/other-lang/fib.scm b/benchmark/other-lang/fib.scm
deleted file mode 100644
index 2fc4e225bd..0000000000
--- a/benchmark/other-lang/fib.scm
+++ /dev/null
@@ -1,7 +0,0 @@
-(define (fib n)
- (if (< n 3)
- 1
- (+ (fib (- n 1)) (fib (- n 2)))))
-
-(fib 34)
-
diff --git a/benchmark/other-lang/loop.pl b/benchmark/other-lang/loop.pl
deleted file mode 100644
index 2777490aaa..0000000000
--- a/benchmark/other-lang/loop.pl
+++ /dev/null
@@ -1,3 +0,0 @@
-for($i=0; $i<30000000; $i++){
-}
-
diff --git a/benchmark/other-lang/loop.py b/benchmark/other-lang/loop.py
deleted file mode 100644
index 003749bf3a..0000000000
--- a/benchmark/other-lang/loop.py
+++ /dev/null
@@ -1,2 +0,0 @@
-for i in xrange(30000000):
- pass
diff --git a/benchmark/other-lang/loop.rb b/benchmark/other-lang/loop.rb
deleted file mode 100644
index b367b9dbf3..0000000000
--- a/benchmark/other-lang/loop.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-i = 0
-while i<30000000
- i += 1
-end
diff --git a/benchmark/other-lang/loop.scm b/benchmark/other-lang/loop.scm
deleted file mode 100644
index 3364f7e679..0000000000
--- a/benchmark/other-lang/loop.scm
+++ /dev/null
@@ -1 +0,0 @@
-(dotimes (x 30000000))
diff --git a/benchmark/other-lang/loop2.rb b/benchmark/other-lang/loop2.rb
deleted file mode 100644
index df8fffc1ff..0000000000
--- a/benchmark/other-lang/loop2.rb
+++ /dev/null
@@ -1 +0,0 @@
-30000000.times{}
diff --git a/benchmark/other-lang/tak.pl b/benchmark/other-lang/tak.pl
deleted file mode 100644
index 7e748a67c6..0000000000
--- a/benchmark/other-lang/tak.pl
+++ /dev/null
@@ -1,11 +0,0 @@
-sub tak {
- local($x, $y, $z) = @_;
- if (!($y < $x)) {
- return $z;
- } else {
- return &tak(&tak($x - 1, $y, $z),
- &tak($y - 1, $z, $x),
- &tak($z - 1, $x, $y));
- }
-}
-&tak(18, 9, 0);
diff --git a/benchmark/other-lang/tak.py b/benchmark/other-lang/tak.py
deleted file mode 100644
index 04f3f6829c..0000000000
--- a/benchmark/other-lang/tak.py
+++ /dev/null
@@ -1,8 +0,0 @@
-def tak(x, y, z):
- if not(y<x):
- return z
- else:
- return tak(tak(x-1, y, z),
- tak(y-1, z, x),
- tak(z-1, x, y))
-tak(18, 9, 0)
diff --git a/benchmark/other-lang/tak.rb b/benchmark/other-lang/tak.rb
deleted file mode 100644
index efe5380f4e..0000000000
--- a/benchmark/other-lang/tak.rb
+++ /dev/null
@@ -1,13 +0,0 @@
-
-def tak x, y, z
- unless y < x
- z
- else
- tak( tak(x-1, y, z),
- tak(y-1, z, x),
- tak(z-1, x, y))
- end
-end
-
-tak(18, 9, 0)
-
diff --git a/benchmark/other-lang/tak.scm b/benchmark/other-lang/tak.scm
deleted file mode 100644
index 52a7629ee5..0000000000
--- a/benchmark/other-lang/tak.scm
+++ /dev/null
@@ -1,10 +0,0 @@
-(define (tak x y z)
- (if (not (< y x))
- z
- (tak (tak (- x 1) y z)
- (tak (- y 1) z x)
- (tak (- z 1) x y))))
-
-(tak 18 9 0)
-
-
diff --git a/benchmark/range_last.yml b/benchmark/range_last.yml
deleted file mode 100644
index a6674f82ee..0000000000
--- a/benchmark/range_last.yml
+++ /dev/null
@@ -1,4 +0,0 @@
-benchmark:
- - (1..1_000_000).last(100)
- - (1..1_000_000).last(1000)
- - (1..1_000_000).last(10000)
diff --git a/benchmark/realpath.yml b/benchmark/realpath.yml
deleted file mode 100644
index 90a029d5b9..0000000000
--- a/benchmark/realpath.yml
+++ /dev/null
@@ -1,30 +0,0 @@
-prelude: |
- f = File
- pwd = Dir.pwd
- Dir.mkdir('b') unless f.directory?('b')
- f.write('b/a', '') unless f.file?('b/a')
-
- relative = 'b/a'
- absolute = File.join(pwd, relative)
- dir = 'b'
- file = 'a'
-
- relative_dir = 'b/c'
- absolute_dir = File.join(pwd, relative_dir)
- file_dir = 'c'
-benchmark:
- relative_nil: "f.realpath(relative, nil)"
- absolute_nil: "f.realpath(absolute, nil)"
- relative_relative: "f.realpath(file, dir)"
- absolute_relative: "f.realpath(absolute, dir)"
- relative_absolute: "f.realpath(relative, pwd)"
- relative_nil_dir: "f.realdirpath(relative_dir, nil)"
- absolute_nil_dir: "f.realdirpath(absolute_dir, nil)"
- relative_relative_dir: "f.realdirpath(file_dir, dir)"
- absolute_relative_dir: "f.realdirpath(absolute_dir, dir)"
- relative_absolute_dir: "f.realdirpath(relative_dir, pwd)"
- relative_nil_notexist: "f.realpath(relative_dir, nil) rescue nil"
- absolute_nil_notexist: "f.realpath(absolute_dir, nil) rescue nil"
- relative_relative_notexist: "f.realpath(file_dir, dir) rescue nil"
- absolute_relative_notexist: "f.realpath(absolute_dir, dir) rescue nil"
- relative_absolute_notexist: "f.realpath(relative_dir, pwd) rescue nil"
diff --git a/benchmark/require.yml b/benchmark/require.yml
deleted file mode 100644
index 09f218cf08..0000000000
--- a/benchmark/require.yml
+++ /dev/null
@@ -1,32 +0,0 @@
-prelude: |
- require "fileutils"
-
- def prepare
- num_files = 10000
-
- basename = File.dirname($0)
- data_dir = File.join(basename, "bm_require.data")
-
- # skip if all of files exists
- if File.exist?(File.join(data_dir, "c#{num_files}.rb"))
- return
- end
-
- FileUtils.mkdir_p(data_dir)
-
- 1.upto(num_files) do |i|
- File.write("#{data_dir}/c#{i}.rb", "class C#{i}\n""end\n")
- end
- end
-
- prepare
-benchmark:
- require: |
- $:.push File.join(File.dirname(__FILE__), "bm_require.data")
-
- 1.upto(10000) do |i|
- require "c#{i}"
- end
-
- $:.pop
-loop_count: 1
diff --git a/benchmark/require_thread.yml b/benchmark/require_thread.yml
deleted file mode 100644
index 0c63257106..0000000000
--- a/benchmark/require_thread.yml
+++ /dev/null
@@ -1,40 +0,0 @@
-prelude: |
- require "fileutils"
-
- def prepare
- num_files = 10000
-
- basename = File.dirname($0)
- data_dir = File.join(basename, "bm_require.data")
-
- # skip if all of files exists
- if File.exist?(File.join(data_dir, "c#{num_files}.rb"))
- return
- end
-
- FileUtils.mkdir_p(data_dir)
-
- 1.upto(num_files) do |i|
- File.write("#{data_dir}/c#{i}.rb", "class C#{i}\n""end\n")
- end
- end
-
- prepare
-benchmark:
- require_thread: |
- $:.push File.join(File.dirname(__FILE__), "bm_require.data")
-
- i=0
- t = Thread.new do
- while true
- i = i+1 # dummy loop
- end
- end
-
- 1.upto(100) do |i|
- require "c#{i}"
- end
-
- $:.pop
- t.kill
-loop_count: 1
diff --git a/benchmark/securerandom.rb b/benchmark/securerandom.rb
deleted file mode 100644
index a082ea6d5b..0000000000
--- a/benchmark/securerandom.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-require "securerandom"
-
-20_0000.times do
- SecureRandom.random_number(100)
-end
diff --git a/benchmark/so_ackermann.rb b/benchmark/so_ackermann.rb
deleted file mode 100644
index 4effa1ecaf..0000000000
--- a/benchmark/so_ackermann.rb
+++ /dev/null
@@ -1,19 +0,0 @@
-#!/usr/bin/ruby
-# -*- Ruby -*-
-# $Id: ackermann-ruby.code,v 1.4 2004/11/13 07:40:41 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-
-def ack(m, n)
- if m == 0 then
- n + 1
- elsif n == 0 then
- ack(m - 1, 1)
- else
- ack(m - 1, ack(m, n - 1))
- end
-end
-
-NUM = 9
-ack(3, NUM)
-
-
diff --git a/benchmark/so_array.rb b/benchmark/so_array.rb
deleted file mode 100644
index 767e03db5f..0000000000
--- a/benchmark/so_array.rb
+++ /dev/null
@@ -1,23 +0,0 @@
-#!/usr/bin/ruby
-# -*- Ruby -*-
-# $Id: ary-ruby.code,v 1.4 2004/11/13 07:41:27 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# with help from Paul Brannan and Mark Hubbart
-
-n = 9000 # Integer(ARGV.shift || 1)
-
-x = Array.new(n)
-y = Array.new(n, 0)
-
-n.times{|bi|
- x[bi] = bi + 1
-}
-
-(0 .. 999).each do |e|
- (n-1).step(0,-1) do |bi|
- y[bi] += x.at(bi)
- end
-end
-# puts "#{y.first} #{y.last}"
-
-
diff --git a/benchmark/so_binary_trees.rb b/benchmark/so_binary_trees.rb
deleted file mode 100644
index b1693e4109..0000000000
--- a/benchmark/so_binary_trees.rb
+++ /dev/null
@@ -1,62 +0,0 @@
-# The Computer Language Shootout Benchmarks
-# http://shootout.alioth.debian.org
-#
-# contributed by Jesse Millikan
-
-# disable output
-alias puts_orig puts
-def puts str
- # disable puts
-end
-
-def item_check(tree)
- if tree[0] == nil
- tree[1]
- else
- tree[1] + item_check(tree[0]) - item_check(tree[2])
- end
-end
-
-def bottom_up_tree(item, depth)
- if depth > 0
- item_item = 2 * item
- depth -= 1
- [bottom_up_tree(item_item - 1, depth), item, bottom_up_tree(item_item, depth)]
- else
- [nil, item, nil]
- end
-end
-
-max_depth = 16 # ARGV[0].to_i
-min_depth = 4
-
-max_depth = min_depth + 2 if min_depth + 2 > max_depth
-
-stretch_depth = max_depth + 1
-stretch_tree = bottom_up_tree(0, stretch_depth)
-
-puts "stretch tree of depth #{stretch_depth}\t check: #{item_check(stretch_tree)}"
-stretch_tree = nil
-
-long_lived_tree = bottom_up_tree(0, max_depth)
-
-min_depth.step(max_depth + 1, 2) do |depth|
- iterations = 2**(max_depth - depth + min_depth)
-
- check = 0
-
- for i in 1..iterations
- temp_tree = bottom_up_tree(i, depth)
- check += item_check(temp_tree)
-
- temp_tree = bottom_up_tree(-i, depth)
- check += item_check(temp_tree)
- end
-
- puts "#{iterations * 2}\t trees of depth #{depth}\t check: #{check}"
-end
-
-puts "long lived tree of depth #{max_depth}\t check: #{item_check(long_lived_tree)}"
-
-undef puts
-alias puts puts_orig
diff --git a/benchmark/so_concatenate.rb b/benchmark/so_concatenate.rb
deleted file mode 100644
index 4468e20ac8..0000000000
--- a/benchmark/so_concatenate.rb
+++ /dev/null
@@ -1,18 +0,0 @@
-#!/usr/bin/ruby
-# -*- Ruby -*-
-# $Id: strcat-ruby.code,v 1.4 2004/11/13 07:43:28 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# based on code from Aristarkh A Zagorodnikov and Dat Nguyen
-
-STUFF = "hello\n"
-i = 0
-while i<10
- i += 1
- hello = ''
- 4_000_000.times do |e|
- hello << STUFF
- end
-end
-# puts hello.length
-
-
diff --git a/benchmark/so_count_words.yml b/benchmark/so_count_words.yml
deleted file mode 100644
index 99683505f9..0000000000
--- a/benchmark/so_count_words.yml
+++ /dev/null
@@ -1,65 +0,0 @@
-prelude: |
- #!/usr/bin/ruby
-
- wc_input_base = <<EOS
- Subject: Re: Who was Izchak Miller?
- From: "Jane D. Anonymous" <nobody@yale.edu>
- Date: 1996/04/28
- Message-Id: <4lv7bc$oh@news.ycc.yale.edu>
- References: <317C405E.5DFA@panix.com> <4lk6vl$gde@ns.oar.net>
- To: 75176.2330@compuserve.com
- Content-Type: text/plain; charset=us-ascii
- Organization: Yale University
- X-Url: news:4lk6vl$gde@ns.oar.net
- Mime-Version: 1.0
- Newsgroups: rec.games.roguelike.nethack
- X-Mailer: Mozilla 1.1N (Macintosh; I; 68K)
-
- Hello there, Izchak Miller was my father. When I was younger I spent
- many a night, hunched over the keyboard with a cup of tea, playing
- nethack with him and my brother. my dad was a philosopher with a strong
- weakness for fantasy/sci fi. I remember when he started to get involved
- with the Nethack team- my brother's Dungeons and Dragons monster book
- found a regular place beside my dad's desk. it's nice to see him living
- on in the game he loved so much :-).
- Tamar Miller
-
- The following is a really long word of 5000 characters:
-
- wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww
- EOS
-
- # prepare 'wc.input'
-
- def prepare_wc_input(wcbase)
- wcinput = File.join(File.dirname($0), 'wc.input')
- unless FileTest.exist?(wcinput)
- data = wcbase.dup
- 13.times{
- data << data
- }
- open(wcinput, 'w'){|f| f.write data}
- end
- end
-
- prepare_wc_input(wc_input_base)
-
-benchmark:
- so_count_words: |
- # $Id: wc-ruby.code,v 1.4 2004/11/13 07:43:32 bfulgham Exp $
- # http://www.bagley.org/~doug/shootout/
- # with help from Paul Brannan
- input = open(File.join(File.dirname($0), 'wc.input'), 'rb')
-
- nl = nw = nc = 0
- while true
- tmp = input.read(4096) or break
- data = tmp << (input.gets || "")
- nc += data.length
- nl += data.count("\n")
- ((data.strip! || data).tr!("\n", " ") || data).squeeze!
- nw += data.count(" ") + 1
- end
- # STDERR.puts "#{nl} #{nw} #{nc}"
-
-loop_count: 1
diff --git a/benchmark/so_exception.rb b/benchmark/so_exception.rb
deleted file mode 100644
index eb205b4df1..0000000000
--- a/benchmark/so_exception.rb
+++ /dev/null
@@ -1,61 +0,0 @@
-#!/usr/bin/ruby
-# -*- Ruby -*-
-# $Id: except-ruby.code,v 1.4 2004/11/13 07:41:33 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-
-$HI = 0
-$LO = 0
-NUM = 250000 # Integer(ARGV[0] || 1)
-
-
-class Lo_Exception < Exception
- def initialize(num)
- @value = num
- end
-end
-
-class Hi_Exception < Exception
- def initialize(num)
- @value = num
- end
-end
-
-def some_function(num)
- begin
- hi_function(num)
- rescue
- print "We shouldn't get here, exception is: #{$!.type}\n"
- end
-end
-
-def hi_function(num)
- begin
- lo_function(num)
- rescue Hi_Exception
- $HI = $HI + 1
- end
-end
-
-def lo_function(num)
- begin
- blowup(num)
- rescue Lo_Exception
- $LO = $LO + 1
- end
-end
-
-def blowup(num)
- if num % 2 == 0
- raise Lo_Exception.new(num)
- else
- raise Hi_Exception.new(num)
- end
-end
-
-
-i = 1
-max = NUM+1
-while i < max
- i += 1
- some_function(i+1)
-end
diff --git a/benchmark/so_fannkuch.rb b/benchmark/so_fannkuch.rb
deleted file mode 100644
index bac5ecd44c..0000000000
--- a/benchmark/so_fannkuch.rb
+++ /dev/null
@@ -1,45 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org/
-# Contributed by Sokolov Yura
-# Modified by Ryan Williams
-
-def fannkuch(n)
- maxFlips, m, r, check = 0, n-1, n, 0
- count = (1..n).to_a
- perm = (1..n).to_a
-
- while true
- if check < 30
- puts "#{perm}"
- check += 1
- end
-
- while r != 1
- count[r-1] = r
- r -= 1
- end
-
- if perm[0] != 1 and perm[m] != n
- perml = perm.clone #.dup
- flips = 0
- while (k = perml.first ) != 1
- perml = perml.slice!(0, k).reverse + perml
- flips += 1
- end
- maxFlips = flips if flips > maxFlips
- end
- while true
- if r==n then return maxFlips end
- perm.insert r,perm.shift
- break if (count[r] -= 1) > 0
- r += 1
- end
- end
-end
-
-def puts *args
-end
-
-N = 9 # (ARGV[0] || 1).to_i
-puts "Pfannkuchen(#{N}) = #{fannkuch(N)}"
-
diff --git a/benchmark/so_fasta.rb b/benchmark/so_fasta.rb
deleted file mode 100644
index dcc6b39507..0000000000
--- a/benchmark/so_fasta.rb
+++ /dev/null
@@ -1,81 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org/
-# Contributed by Sokolov Yura
-
-$last = 42.0
-def gen_random(max, im=139968, ia=3877, ic=29573)
- (max * ($last = ($last * ia + ic) % im)) / im
-end
-
-alu =
- "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
- "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
- "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
- "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
- "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
- "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
- "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
-
-iub = [
- ["a", 0.27],
- ["c", 0.12],
- ["g", 0.12],
- ["t", 0.27],
-
- ["B", 0.02],
- ["D", 0.02],
- ["H", 0.02],
- ["K", 0.02],
- ["M", 0.02],
- ["N", 0.02],
- ["R", 0.02],
- ["S", 0.02],
- ["V", 0.02],
- ["W", 0.02],
- ["Y", 0.02],
-]
-homosapiens = [
- ["a", 0.3029549426680],
- ["c", 0.1979883004921],
- ["g", 0.1975473066391],
- ["t", 0.3015094502008],
-]
-
-def make_repeat_fasta(id, desc, src, n)
- puts ">#{id} #{desc}"
- v = nil
- width = 60
- l = src.length
- s = src * ((n / l) + 1)
- s.slice!(n, l)
- puts(s.scan(/.{1,#{width}}/).join("\n"))
-end
-
-def make_random_fasta(id, desc, table, n)
- puts ">#{id} #{desc}"
- rand, v = nil,nil
- width = 60
- chunk = 1 * width
- prob = 0.0
- table.each{|v| v[1]= (prob += v[1])}
- for i in 1..(n/width)
- puts((1..width).collect{
- rand = gen_random(1.0)
- table.find{|v| v[1]>rand}[0]
- }.join)
- end
- if n%width != 0
- puts((1..(n%width)).collect{
- rand = gen_random(1.0)
- table.find{|v| v[1]>rand}[0]
- }.join)
- end
-end
-
-
-n = (ARGV[0] or 250_000).to_i
-
-make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
-make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
-make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
-
diff --git a/benchmark/so_k_nucleotide.yml b/benchmark/so_k_nucleotide.yml
deleted file mode 100644
index d7df086c39..0000000000
--- a/benchmark/so_k_nucleotide.yml
+++ /dev/null
@@ -1,155 +0,0 @@
-prelude: |
- bm_so_fasta = <<'EOS'
- # The Computer Language Shootout
- # http://shootout.alioth.debian.org/
- # Contributed by Sokolov Yura
-
- $last = 42.0
- def gen_random(max, im=139968, ia=3877, ic=29573)
- (max * ($last = ($last * ia + ic) % im)) / im
- end
-
- alu =
- "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
- "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
- "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
- "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
- "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
- "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
- "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
-
- iub = [
- ["a", 0.27],
- ["c", 0.12],
- ["g", 0.12],
- ["t", 0.27],
-
- ["B", 0.02],
- ["D", 0.02],
- ["H", 0.02],
- ["K", 0.02],
- ["M", 0.02],
- ["N", 0.02],
- ["R", 0.02],
- ["S", 0.02],
- ["V", 0.02],
- ["W", 0.02],
- ["Y", 0.02],
- ]
- homosapiens = [
- ["a", 0.3029549426680],
- ["c", 0.1979883004921],
- ["g", 0.1975473066391],
- ["t", 0.3015094502008],
- ]
-
- def make_repeat_fasta(id, desc, src, n)
- puts ">#{id} #{desc}"
- v = nil
- width = 60
- l = src.length
- s = src * ((n / l) + 1)
- s.slice!(n, l)
- puts(s.scan(/.{1,#{width}}/).join("\n"))
- end
-
- def make_random_fasta(id, desc, table, n)
- puts ">#{id} #{desc}"
- rand, v = nil,nil
- width = 60
- chunk = 1 * width
- prob = 0.0
- table.each{|v| v[1]= (prob += v[1])}
- for i in 1..(n/width)
- puts((1..width).collect{
- rand = gen_random(1.0)
- table.find{|v| v[1]>rand}[0]
- }.join)
- end
- if n%width != 0
- puts((1..(n%width)).collect{
- rand = gen_random(1.0)
- table.find{|v| v[1]>rand}[0]
- }.join)
- end
- end
-
-
- n = (ARGV[0] or 250_000).to_i
-
- make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
- make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
- make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
- EOS
-benchmark:
- - name: so_k_nucleotide
- prelude: |
- script = File.join(File.dirname($0), 'bm_so_fasta.rb')
- File.write(script, bm_so_fasta)
-
- def prepare_fasta_output n
- filebase = File.join(File.dirname($0), 'fasta.output')
- script = File.join(File.dirname($0), 'bm_so_fasta.rb')
- file = "#{filebase}.#{n}"
-
- unless FileTest.exist?(file)
- STDERR.puts "preparing #{file}"
-
- open(file, 'w'){|f|
- ARGV[0] = n
- $stdout = f
- load script
- $stdout = STDOUT
- }
- end
- end
- prepare_fasta_output(100_000)
- script: |
- # The Computer Language Shootout
- # http://shootout.alioth.debian.org
- #
- # contributed by jose fco. gonzalez
- # modified by Sokolov Yura
-
- seq = String.new
-
- def frecuency( seq,length )
- n, table = seq.length - length + 1, Hash.new(0)
- f, i = nil, nil
- (0 ... length).each do |f|
- (f ... n).step(length) do |i|
- table[seq[i,length]] += 1
- end
- end
- [n,table]
-
- end
-
- def sort_by_freq( seq,length )
- n,table = frecuency( seq,length )
- a, b, v = nil, nil, nil
- table.sort{|a,b| b[1] <=> a[1]}.each do |v|
- puts "%s %.3f" % [v[0].upcase,((v[1]*100).to_f/n)]
- end
- puts
- end
-
- def find_seq( seq,s )
- n,table = frecuency( seq,s.length )
- puts "#{table[s].to_s}\t#{s.upcase}"
- end
-
- input = open(File.join(File.dirname($0), 'fasta.output.100000'), 'rb')
-
- line = input.gets while line !~ /^>THREE/
- line = input.gets
-
- while (line !~ /^>/) & line do
- seq << line.chomp
- line = input.gets
- end
-
- [1,2].each {|i| sort_by_freq( seq,i ) }
-
- %w(ggt ggta ggtatt ggtattttaatt ggtattttaatttatagt).each{|s| find_seq( seq,s) }
- loop_count: 1
diff --git a/benchmark/so_lists.rb b/benchmark/so_lists.rb
deleted file mode 100644
index e8f4a2a5f7..0000000000
--- a/benchmark/so_lists.rb
+++ /dev/null
@@ -1,47 +0,0 @@
-#from http://www.bagley.org/~doug/shootout/bench/lists/lists.ruby
-
-NUM = 300
-SIZE = 10000
-
-def test_lists()
- # create a list of integers (Li1) from 1 to SIZE
- li1 = (1..SIZE).to_a
- # copy the list to li2 (not by individual items)
- li2 = li1.dup
- # remove each individual item from left side of li2 and
- # append to right side of li3 (preserving order)
- li3 = Array.new
- while (not li2.empty?)
- li3.push(li2.shift)
- end
- # li2 must now be empty
- # remove each individual item from right side of li3 and
- # append to right side of li2 (reversing list)
- while (not li3.empty?)
- li2.push(li3.pop)
- end
- # li3 must now be empty
- # reverse li1 in place
- li1.reverse!
- # check that first item is now SIZE
- if li1[0] != SIZE then
- p "not SIZE"
- 0
- else
- # compare li1 and li2 for equality
- if li1 != li2 then
- return(0)
- else
- # return the length of the list
- li1.length
- end
- end
-end
-
-i = 0
-while i<NUM
- i += 1
- result = test_lists()
-end
-
-result
diff --git a/benchmark/so_mandelbrot.rb b/benchmark/so_mandelbrot.rb
deleted file mode 100644
index 76331c64b8..0000000000
--- a/benchmark/so_mandelbrot.rb
+++ /dev/null
@@ -1,57 +0,0 @@
-# The Computer Language Benchmarks Game
-# http://shootout.alioth.debian.org/
-#
-# contributed by Karl von Laudermann
-# modified by Jeremy Echols
-
-size = 600 # ARGV[0].to_i
-
-puts "P4\n#{size} #{size}"
-
-ITER = 49 # Iterations - 1 for easy for..in looping
-LIMIT_SQUARED = 4.0 # Presquared limit
-
-byte_acc = 0
-bit_num = 0
-
-count_size = size - 1 # Precomputed size for easy for..in looping
-
-# For..in loops are faster than .upto, .downto, .times, etc.
-for y in 0..count_size
- for x in 0..count_size
- zr = 0.0
- zi = 0.0
- cr = (2.0*x/size)-1.5
- ci = (2.0*y/size)-1.0
- escape = false
-
- # To make use of the for..in code, we use a dummy variable,
- # like one would in C
- for dummy in 0..ITER
- tr = zr*zr - zi*zi + cr
- ti = 2*zr*zi + ci
- zr, zi = tr, ti
-
- if (zr*zr+zi*zi) > LIMIT_SQUARED
- escape = true
- break
- end
- end
-
- byte_acc = (byte_acc << 1) | (escape ? 0b0 : 0b1)
- bit_num += 1
-
- # Code is very similar for these cases, but using separate blocks
- # ensures we skip the shifting when it's unnecessary, which is most cases.
- if (bit_num == 8)
- print byte_acc.chr
- byte_acc = 0
- bit_num = 0
- elsif (x == count_size)
- byte_acc <<= (8 - bit_num)
- print byte_acc.chr
- byte_acc = 0
- bit_num = 0
- end
- end
-end
diff --git a/benchmark/so_matrix.rb b/benchmark/so_matrix.rb
deleted file mode 100644
index 2d1e72bda9..0000000000
--- a/benchmark/so_matrix.rb
+++ /dev/null
@@ -1,48 +0,0 @@
-#!/usr/bin/ruby
-# -*- Ruby -*-
-# $Id: matrix-ruby.code,v 1.4 2004/11/13 07:42:14 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-
-n = 60 #Integer(ARGV.shift || 1)
-
-size = 40
-
-def mkmatrix(rows, cols)
- count = 1
- mx = Array.new(rows)
- (0 .. (rows - 1)).each do |bi|
- row = Array.new(cols, 0)
- (0 .. (cols - 1)).each do |j|
- row[j] = count
- count += 1
- end
- mx[bi] = row
- end
- mx
-end
-
-def mmult(rows, cols, m1, m2)
- m3 = Array.new(rows)
- (0 .. (rows - 1)).each do |bi|
- row = Array.new(cols, 0)
- (0 .. (cols - 1)).each do |j|
- val = 0
- (0 .. (cols - 1)).each do |k|
- val += m1.at(bi).at(k) * m2.at(k).at(j)
- end
- row[j] = val
- end
- m3[bi] = row
- end
- m3
-end
-
-m1 = mkmatrix(size, size)
-m2 = mkmatrix(size, size)
-mm = Array.new
-n.times do
- mm = mmult(size, size, m1, m2)
-end
-# puts "#{mm[0][0]} #{mm[2][3]} #{mm[3][2]} #{mm[4][4]}"
-
-
diff --git a/benchmark/so_meteor_contest.rb b/benchmark/so_meteor_contest.rb
deleted file mode 100644
index 8c136baa6c..0000000000
--- a/benchmark/so_meteor_contest.rb
+++ /dev/null
@@ -1,563 +0,0 @@
-#!/usr/bin/env ruby
-#
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org
-# contributed by Kevin Barnes (Ruby novice)
-
-# PROGRAM: the main body is at the bottom.
-# 1) read about the problem here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
-# 2) see how I represent a board as a bitmask by reading the blank_board comments
-# 3) read as your mental paths take you
-
-def print *args
-end
-
-# class to represent all information about a particular rotation of a particular piece
-class Rotation
- # an array (by location) containing a bit mask for how the piece maps at the given location.
- # if the rotation is invalid at that location the mask will contain false
- attr_reader :start_masks
-
- # maps a direction to a relative location. these differ depending on whether it is an even or
- # odd row being mapped from
- @@rotation_even_adder = { :west => -1, :east => 1, :nw => -7, :ne => -6, :sw => 5, :se => 6 }
- @@rotation_odd_adder = { :west => -1, :east => 1, :nw => -6, :ne => -5, :sw => 6, :se => 7 }
-
- def initialize( directions )
- @even_offsets, @odd_offsets = normalize_offsets( get_values( directions ))
-
- @even_mask = mask_for_offsets( @even_offsets)
- @odd_mask = mask_for_offsets( @odd_offsets)
-
- @start_masks = Array.new(60)
-
- # create the rotational masks by placing the base mask at the location and seeing if
- # 1) it overlaps the boundaries and 2) it produces a prunable board. if either of these
- # is true the piece cannot be placed
- 0.upto(59) do | offset |
- mask = is_even(offset) ? (@even_mask << offset) : (@odd_mask << offset)
- if (blank_board & mask == 0 && !prunable(blank_board | mask, 0, true)) then
- imask = compute_required( mask, offset)
- @start_masks[offset] = [ mask, imask, imask | mask ]
- else
- @start_masks[offset] = false
- end
- end
- end
-
- def compute_required( mask, offset )
- board = blank_board
- 0.upto(offset) { | i | board |= 1 << i }
- board |= mask
- return 0 if (!prunable(board | mask, offset))
- board = flood_fill(board,58)
- count = 0
- imask = 0
- 0.upto(59) do | i |
- if (board[i] == 0) then
- imask |= (1 << i)
- count += 1
- end
- end
- (count > 0 && count < 5) ? imask : 0
- end
-
- def flood_fill( board, location)
- return board if (board[location] == 1)
- board |= 1 << location
- row, col = location.divmod(6)
- board = flood_fill( board, location - 1) if (col > 0)
- board = flood_fill( board, location + 1) if (col < 4)
- if (row % 2 == 0) then
- board = flood_fill( board, location - 7) if (col > 0 && row > 0)
- board = flood_fill( board, location - 6) if (row > 0)
- board = flood_fill( board, location + 6) if (row < 9)
- board = flood_fill( board, location + 5) if (col > 0 && row < 9)
- else
- board = flood_fill( board, location - 5) if (col < 4 && row > 0)
- board = flood_fill( board, location - 6) if (row > 0)
- board = flood_fill( board, location + 6) if (row < 9)
- board = flood_fill( board, location + 7) if (col < 4 && row < 9)
- end
- board
- end
-
- # given a location, produces a list of relative locations covered by the piece at this rotation
- def offsets( location)
- if is_even( location) then
- @even_offsets.collect { | value | value + location }
- else
- @odd_offsets.collect { | value | value + location }
- end
- end
-
- # returns a set of offsets relative to the top-left most piece of the rotation (by even or odd rows)
- # this is hard to explain. imagine we have this partial board:
- # 0 0 0 0 0 x [positions 0-5]
- # 0 0 1 1 0 x [positions 6-11]
- # 0 0 1 0 0 x [positions 12-17]
- # 0 1 0 0 0 x [positions 18-23]
- # 0 1 0 0 0 x [positions 24-29]
- # 0 0 0 0 0 x [positions 30-35]
- # ...
- # The top-left of the piece is at position 8, the
- # board would be passed as a set of positions (values array) containing [8,9,14,19,25] not necessarily in that
- # sorted order. Since that array starts on an odd row, the offsets for an odd row are: [0,1,6,11,17] obtained
- # by subtracting 8 from everything. Now imagine the piece shifted up and to the right so it's on an even row:
- # 0 0 0 1 1 x [positions 0-5]
- # 0 0 1 0 0 x [positions 6-11]
- # 0 0 1 0 0 x [positions 12-17]
- # 0 1 0 0 0 x [positions 18-23]
- # 0 0 0 0 0 x [positions 24-29]
- # 0 0 0 0 0 x [positions 30-35]
- # ...
- # Now the positions are [3,4,8,14,19] which after subtracting the lowest value (3) gives [0,1,5,11,16] thus, the
- # offsets for this particular piece are (in even, odd order) [0,1,5,11,16],[0,1,6,11,17] which is what
- # this function would return
- def normalize_offsets( values)
- min = values.min
- even_min = is_even(min)
- other_min = even_min ? min + 6 : min + 7
- other_values = values.collect do | value |
- if is_even(value) then
- value + 6 - other_min
- else
- value + 7 - other_min
- end
- end
- values.collect! { | value | value - min }
-
- if even_min then
- [values, other_values]
- else
- [other_values, values]
- end
- end
-
- # produce a bitmask representation of an array of offset locations
- def mask_for_offsets( offsets )
- mask = 0
- offsets.each { | value | mask = mask + ( 1 << value ) }
- mask
- end
-
- # finds a "safe" position that a position as described by a list of directions can be placed
- # without falling off any edge of the board. the values returned a location to place the first piece
- # at so it will fit after making the described moves
- def start_adjust( directions )
- south = east = 0;
- directions.each do | direction |
- east += 1 if ( direction == :sw || direction == :nw || direction == :west )
- south += 1 if ( direction == :nw || direction == :ne )
- end
- south * 6 + east
- end
-
- # given a set of directions places the piece (as defined by a set of directions) on the board at
- # a location that will not take it off the edge
- def get_values( directions )
- start = start_adjust(directions)
- values = [ start ]
- directions.each do | direction |
- if (start % 12 >= 6) then
- start += @@rotation_odd_adder[direction]
- else
- start += @@rotation_even_adder[direction]
- end
- values += [ start ]
- end
-
- # some moves take you back to an existing location, we'll strip duplicates
- values.uniq
- end
-end
-
-# describes a piece and caches information about its rotations to as to be efficient for iteration
-# ATTRIBUTES:
-# rotations -- all the rotations of the piece
-# type -- a numeic "name" of the piece
-# masks -- an array by location of all legal rotational masks (a n inner array) for that location
-# placed -- the mask that this piece was last placed at (not a location, but the actual mask used)
-class Piece
- attr_reader :rotations, :type, :masks
- attr_accessor :placed
-
- # transform hashes that change one direction into another when you either flip or rotate a set of directions
- @@flip_converter = { :west => :west, :east => :east, :nw => :sw, :ne => :se, :sw => :nw, :se => :ne }
- @@rotate_converter = { :west => :nw, :east => :se, :nw => :ne, :ne => :east, :sw => :west, :se => :sw }
-
- def initialize( directions, type )
- @type = type
- @rotations = Array.new();
- @map = {}
-
- generate_rotations( directions )
- directions.collect! { | value | @@flip_converter[value] }
- generate_rotations( directions )
-
- # creates the masks AND a map that returns [location, rotation] for any given mask
- # this is used when a board is found and we want to draw it, otherwise the map is unused
- @masks = Array.new();
- 0.upto(59) do | i |
- even = true
- @masks[i] = @rotations.collect do | rotation |
- mask = rotation.start_masks[i]
- @map[mask[0]] = [ i, rotation ] if (mask)
- mask || nil
- end
- @masks[i].compact!
- end
- end
-
- # rotates a set of directions through all six angles and adds a Rotation to the list for each one
- def generate_rotations( directions )
- 6.times do
- rotations.push( Rotation.new(directions))
- directions.collect! { | value | @@rotate_converter[value] }
- end
- end
-
- # given a board string, adds this piece to the board at whatever location/rotation
- # important: the outbound board string is 5 wide, the normal location notation is six wide (padded)
- def fill_string( board_string)
- location, rotation = @map[@placed]
- rotation.offsets(location).each do | offset |
- row, col = offset.divmod(6)
- board_string[ row*5 + col, 1 ] = @type.to_s
- end
- end
-end
-
-# a blank bit board having this form:
-#
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 0 0 0 0 0 1
-# 1 1 1 1 1 1
-#
-# where left lest significant bit is the top left and the most significant is the lower right
-# the actual board only consists of the 0 places, the 1 places are blockers to keep things from running
-# off the edges or bottom
-def blank_board
- 0b111111100000100000100000100000100000100000100000100000100000100000
-end
-
-def full_board
- 0b111111111111111111111111111111111111111111111111111111111111111111
-end
-
-# determines if a location (bit position) is in an even row
-def is_even( location)
- (location % 12) < 6
-end
-
-# support function that create three utility maps:
-# $converter -- for each row an array that maps a five bit row (via array mapping)
-# to the a five bit representation of the bits below it
-# $bit_count -- maps a five bit row (via array mapping) to the number of 1s in the row
-# @@new_regions -- maps a five bit row (via array mapping) to an array of "region" arrays
-# a region array has three values the first is a mask of bits in the region,
-# the second is the count of those bits and the third is identical to the first
-# examples:
-# 0b10010 => [ 0b01100, 2, 0b01100 ], [ 0b00001, 1, 0b00001]
-# 0b01010 => [ 0b10000, 1, 0b10000 ], [ 0b00100, 1, 0b00100 ], [ 0b00001, 1, 0b00001]
-# 0b10001 => [ 0b01110, 3, 0b01110 ]
-def create_collector_support
- odd_map = [0b11, 0b110, 0b1100, 0b11000, 0b10000]
- even_map = [0b1, 0b11, 0b110, 0b1100, 0b11000]
-
- all_odds = Array.new(0b100000)
- all_evens = Array.new(0b100000)
- bit_counts = Array.new(0b100000)
- new_regions = Array.new(0b100000)
- 0.upto(0b11111) do | i |
- bit_count = odd = even = 0
- 0.upto(4) do | bit |
- if (i[bit] == 1) then
- bit_count += 1
- odd |= odd_map[bit]
- even |= even_map[bit]
- end
- end
- all_odds[i] = odd
- all_evens[i] = even
- bit_counts[i] = bit_count
- new_regions[i] = create_regions( i)
- end
-
- $converter = []
- 10.times { | row | $converter.push((row % 2 == 0) ? all_evens : all_odds) }
- $bit_counts = bit_counts
- $regions = new_regions.collect { | set | set.collect { | value | [ value, bit_counts[value], value] } }
-end
-
-# determines if a board is punable, meaning that there is no possibility that it
-# can be filled up with pieces. A board is prunable if there is a grouping of unfilled spaces
-# that are not a multiple of five. The following board is an example of a prunable board:
-# 0 0 1 0 0
-# 0 1 0 0 0
-# 1 1 0 0 0
-# 0 1 0 0 0
-# 0 0 0 0 0
-# ...
-#
-# This board is prunable because the top left corner is only 3 bits in area, no piece will ever fit it
-# parameters:
-# board -- an initial bit board (6 bit padded rows, see blank_board for format)
-# location -- starting location, everything above and to the left is already full
-# slotting -- set to true only when testing initial pieces, when filling normally
-# additional assumptions are possible
-#
-# Algorithm:
-# The algorithm starts at the top row (as determined by location) and iterates a row at a time
-# maintainng counts of active open areas (kept in the collector array) each collector contains
-# three values at the start of an iteration:
-# 0: mask of bits that would be adjacent to the collector in this row
-# 1: the number of bits collected so far
-# 2: a scratch space starting as zero, but used during the computation to represent
-# the empty bits in the new row that are adjacent (position 0)
-# The exact procedure is described in-code
-def prunable( board, location, slotting = false)
- collectors = []
- # loop across the rows
- (location / 6).to_i.upto(9) do | row_on |
- # obtain a set of regions representing the bits of the current row.
- regions = $regions[(board >> (row_on * 6)) & 0b11111]
- converter = $converter[row_on]
-
- # track the number of collectors at the start of the cycle so that
- # we don't compute against newly created collectors, only existing collectors
- initial_collector_count = collectors.length
-
- # loop against the regions. For each region of the row
- # we will see if it connects to one or more existing collectors.
- # if it connects to 1 collector, the bits from the region are added to the
- # bits of the collector and the mask is placed in collector[2]
- # If the region overlaps more than one collector then all the collectors
- # it overlaps with are merged into the first one (the others are set to nil in the array)
- # if NO collectors are found then the region is copied as a new collector
- regions.each do | region |
- collector_found = nil
- region_mask = region[2]
- initial_collector_count.times do | collector_num |
- collector = collectors[collector_num]
- if (collector) then
- collector_mask = collector[0]
- if (collector_mask & region_mask != 0) then
- if (collector_found) then
- collector_found[0] |= collector_mask
- collector_found[1] += collector[1]
- collector_found[2] |= collector[2]
- collectors[collector_num] = nil
- else
- collector_found = collector
- collector[1] += region[1]
- collector[2] |= region_mask
- end
- end
- end
- end
- if (collector_found == nil) then
- collectors.push(Array.new(region))
- end
- end
-
- # check the existing collectors, if any collector overlapped no bits in the region its [2] value will
- # be zero. The size of any such reaason is tested if it is not a multiple of five true is returned since
- # the board is prunable. if it is a multiple of five it is removed.
- # Collector that are still active have a new adjacent value [0] set based n the matched bits
- # and have [2] cleared out for the next cycle.
- collectors.length.times do | collector_num |
- collector = collectors[collector_num]
- if (collector) then
- if (collector[2] == 0) then
- return true if (collector[1] % 5 != 0)
- collectors[collector_num] = nil
- else
- # if a collector matches all bits in the row then we can return unprunable early for the
- # following reasons:
- # 1) there can be no more unavailable bits bince we fill from the top left downward
- # 2) all previous regions have been closed or joined so only this region can fail
- # 3) this region must be good since there can never be only 1 region that is nuot
- # a multiple of five
- # this rule only applies when filling normally, so we ignore the rule if we are "slotting"
- # in pieces to see what configurations work for them (the only other time this algorithm is used).
- return false if (collector[2] == 0b11111 && !slotting)
- collector[0] = converter[collector[2]]
- collector[2] = 0
- end
- end
- end
-
- # get rid of all the empty converters for the next round
- collectors.compact!
- end
- return false if (collectors.length <= 1) # 1 collector or less and the region is fine
- collectors.any? { | collector | (collector[1] % 5) != 0 } # more than 1 and we test them all for bad size
-end
-
-# creates a region given a row mask. see prunable for what a "region" is
-def create_regions( value )
- regions = []
- cur_region = 0
- 5.times do | bit |
- if (value[bit] == 0) then
- cur_region |= 1 << bit
- else
- if (cur_region != 0 ) then
- regions.push( cur_region)
- cur_region = 0;
- end
- end
- end
- regions.push(cur_region) if (cur_region != 0)
- regions
-end
-
-# find up to the counted number of solutions (or all solutions) and prints the final result
-def find_all
- find_top( 1)
- find_top( 0)
- print_results
-end
-
-# show the board
-def print_results
- print "#{@boards_found} solutions found\n\n"
- print_full_board( @min_board)
- print "\n"
- print_full_board( @max_board)
- print "\n"
-end
-
-# finds solutions. This special version of the main function is only used for the top level
-# the reason for it is basically to force a particular ordering on how the rotations are tested for
-# the first piece. It is called twice, first looking for placements of the odd rotations and then
-# looking for placements of the even locations.
-#
-# WHY?
-# Since any found solution has an inverse we want to maximize finding solutions that are not already found
-# as an inverse. The inverse will ALWAYS be 3 one of the piece configurations that is exactly 3 rotations away
-# (an odd number). Checking even vs odd then produces a higher probability of finding more pieces earlier
-# in the cycle. We still need to keep checking all the permutations, but our probability of finding one will
-# diminsh over time. Since we are TOLD how many to search for this lets us exit before checking all pieces
-# this bennifit is very great when seeking small numbers of solutions and is 0 when looking for more than the
-# maximum number
-def find_top( rotation_skip)
- board = blank_board
- (@pieces.length-1).times do
- piece = @pieces.shift
- piece.masks[0].each do | mask, imask, cmask |
- if ((rotation_skip += 1) % 2 == 0) then
- piece.placed = mask
- find( 1, 1, board | mask)
- end
- end
- @pieces.push(piece)
- end
- piece = @pieces.shift
- @pieces.push(piece)
-end
-
-# the normail find routine, iterates through the available pieces, checks all rotations at the current location
-# and adds any boards found. depth is achieved via recursion. the overall approach is described
-# here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
-# parameters:
-# start_location -- where to start looking for place for the next piece at
-# placed -- number of pieces placed
-# board -- current state of the board
-#
-# see in-code comments
-def find( start_location, placed, board)
- # find the next location to place a piece by looking for an empty bit
- while board[start_location] == 1
- start_location += 1
- end
-
- @pieces.length.times do
- piece = @pieces.shift
- piece.masks[start_location].each do | mask, imask, cmask |
- if ( board & cmask == imask) then
- piece.placed = mask
- if (placed == 9) then
- add_board
- else
- find( start_location + 1, placed + 1, board | mask)
- end
- end
- end
- @pieces.push(piece)
- end
-end
-
-# print the board
-def print_full_board( board_string)
- 10.times do | row |
- print " " if (row % 2 == 1)
- 5.times do | col |
- print "#{board_string[row*5 + col,1]} "
- end
- print "\n"
- end
-end
-
-# when a board is found we "draw it" into a string and then flip that string, adding both to
-# the list (hash) of solutions if they are unique.
-def add_board
- board_string = "99999999999999999999999999999999999999999999999999"
- @all_pieces.each { | piece | piece.fill_string( board_string ) }
- save( board_string)
- save( board_string.reverse)
-end
-
-# adds a board string to the list (if new) and updates the current best/worst board
-def save( board_string)
- if (@all_boards[board_string] == nil) then
- @min_board = board_string if (board_string < @min_board)
- @max_board = board_string if (board_string > @max_board)
- @all_boards.store(board_string,true)
- @boards_found += 1
-
- # the exit motif is a time saver. Ideally the function should return, but those tests
- # take noticeable time (performance).
- if (@boards_found == @stop_count) then
- print_results
- exit(0)
- end
- end
-end
-
-
-##
-## MAIN BODY :)
-##
-create_collector_support
-@pieces = [
- Piece.new( [ :nw, :ne, :east, :east ], 2),
- Piece.new( [ :ne, :se, :east, :ne ], 7),
- Piece.new( [ :ne, :east, :ne, :nw ], 1),
- Piece.new( [ :east, :sw, :sw, :se ], 6),
- Piece.new( [ :east, :ne, :se, :ne ], 5),
- Piece.new( [ :east, :east, :east, :se ], 0),
- Piece.new( [ :ne, :nw, :se, :east, :se ], 4),
- Piece.new( [ :se, :se, :se, :west ], 9),
- Piece.new( [ :se, :se, :east, :se ], 8),
- Piece.new( [ :east, :east, :sw, :se ], 3)
- ];
-
-@all_pieces = Array.new( @pieces)
-
-@min_board = "99999999999999999999999999999999999999999999999999"
-@max_board = "00000000000000000000000000000000000000000000000000"
-@stop_count = ARGV[0].to_i || 2089
-@all_boards = {}
-@boards_found = 0
-
-find_all ######## DO IT!!!
diff --git a/benchmark/so_nbody.rb b/benchmark/so_nbody.rb
deleted file mode 100644
index d6c5bb9e61..0000000000
--- a/benchmark/so_nbody.rb
+++ /dev/null
@@ -1,148 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org
-#
-# Optimized for Ruby by Jesse Millikan
-# From version ported by Michael Neumann from the C gcc version,
-# which was written by Christoph Bauer.
-
-SOLAR_MASS = 4 * Math::PI**2
-DAYS_PER_YEAR = 365.24
-
-def _puts *args
-end
-
-class Planet
- attr_accessor :x, :y, :z, :vx, :vy, :vz, :mass
-
- def initialize(x, y, z, vx, vy, vz, mass)
- @x, @y, @z = x, y, z
- @vx, @vy, @vz = vx * DAYS_PER_YEAR, vy * DAYS_PER_YEAR, vz * DAYS_PER_YEAR
- @mass = mass * SOLAR_MASS
- end
-
- def move_from_i(bodies, nbodies, dt, i)
- while i < nbodies
- b2 = bodies[i]
- dx = @x - b2.x
- dy = @y - b2.y
- dz = @z - b2.z
-
- distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
- mag = dt / (distance * distance * distance)
- b_mass_mag, b2_mass_mag = @mass * mag, b2.mass * mag
-
- @vx -= dx * b2_mass_mag
- @vy -= dy * b2_mass_mag
- @vz -= dz * b2_mass_mag
- b2.vx += dx * b_mass_mag
- b2.vy += dy * b_mass_mag
- b2.vz += dz * b_mass_mag
- i += 1
- end
-
- @x += dt * @vx
- @y += dt * @vy
- @z += dt * @vz
- end
-end
-
-def energy(bodies)
- e = 0.0
- nbodies = bodies.size
-
- for i in 0 ... nbodies
- b = bodies[i]
- e += 0.5 * b.mass * (b.vx * b.vx + b.vy * b.vy + b.vz * b.vz)
- for j in (i + 1) ... nbodies
- b2 = bodies[j]
- dx = b.x - b2.x
- dy = b.y - b2.y
- dz = b.z - b2.z
- distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
- e -= (b.mass * b2.mass) / distance
- end
- end
- e
-end
-
-def offset_momentum(bodies)
- px, py, pz = 0.0, 0.0, 0.0
-
- for b in bodies
- m = b.mass
- px += b.vx * m
- py += b.vy * m
- pz += b.vz * m
- end
-
- b = bodies[0]
- b.vx = - px / SOLAR_MASS
- b.vy = - py / SOLAR_MASS
- b.vz = - pz / SOLAR_MASS
-end
-
-BODIES = [
- # sun
- Planet.new(0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0),
-
- # jupiter
- Planet.new(
- 4.84143144246472090e+00,
- -1.16032004402742839e+00,
- -1.03622044471123109e-01,
- 1.66007664274403694e-03,
- 7.69901118419740425e-03,
- -6.90460016972063023e-05,
- 9.54791938424326609e-04),
-
- # saturn
- Planet.new(
- 8.34336671824457987e+00,
- 4.12479856412430479e+00,
- -4.03523417114321381e-01,
- -2.76742510726862411e-03,
- 4.99852801234917238e-03,
- 2.30417297573763929e-05,
- 2.85885980666130812e-04),
-
- # uranus
- Planet.new(
- 1.28943695621391310e+01,
- -1.51111514016986312e+01,
- -2.23307578892655734e-01,
- 2.96460137564761618e-03,
- 2.37847173959480950e-03,
- -2.96589568540237556e-05,
- 4.36624404335156298e-05),
-
- # neptune
- Planet.new(
- 1.53796971148509165e+01,
- -2.59193146099879641e+01,
- 1.79258772950371181e-01,
- 2.68067772490389322e-03,
- 1.62824170038242295e-03,
- -9.51592254519715870e-05,
- 5.15138902046611451e-05)
-]
-
-init = 200_000 # ARGV[0]
-n = Integer(init)
-
-offset_momentum(BODIES)
-
-puts "%.9f" % energy(BODIES)
-
-nbodies = BODIES.size
-dt = 0.01
-
-n.times do
- i = 0
- while i < nbodies
- b = BODIES[i]
- b.move_from_i(BODIES, nbodies, dt, i + 1)
- i += 1
- end
-end
-
-puts "%.9f" % energy(BODIES)
diff --git a/benchmark/so_nested_loop.rb b/benchmark/so_nested_loop.rb
deleted file mode 100644
index 766fcf7b84..0000000000
--- a/benchmark/so_nested_loop.rb
+++ /dev/null
@@ -1,24 +0,0 @@
-#!/usr/bin/ruby
-# -*- Ruby -*-
-# $Id: nestedloop-ruby.code,v 1.4 2004/11/13 07:42:22 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# from Avi Bryant
-
-n = 16 # Integer(ARGV.shift || 1)
-x = 0
-n.times do
- n.times do
- n.times do
- n.times do
- n.times do
- n.times do
- x += 1
- end
- end
- end
- end
- end
-end
-# puts x
-
-
diff --git a/benchmark/so_nsieve.rb b/benchmark/so_nsieve.rb
deleted file mode 100644
index a65cc78233..0000000000
--- a/benchmark/so_nsieve.rb
+++ /dev/null
@@ -1,35 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org/
-#
-# contributed by Glenn Parker, March 2005
-# modified by Evan Phoenix, Sept 2006
-
-def sieve(m)
- flags = Flags.dup[0,m]
- count = 0
- pmax = m - 1
- p = 2
- while p <= pmax
- unless flags[p].zero?
- count += 1
- mult = p
- while mult <= pmax
- flags[mult] = 0
- mult += p
- end
- end
- p += 1
- end
- count
-end
-
-n = 9 # (ARGV[0] || 2).to_i
-Flags = ("\x1" * ( 2 ** n * 10_000)).unpack("c*")
-
-n.downto(n-2) do |exponent|
- break if exponent < 0
- m = (1 << exponent) * 10_000
- # m = (2 ** exponent) * 10_000
- count = sieve(m)
- printf "Primes up to %8d %8d\n", m, count
-end
diff --git a/benchmark/so_nsieve_bits.rb b/benchmark/so_nsieve_bits.rb
deleted file mode 100644
index 6f958ee44e..0000000000
--- a/benchmark/so_nsieve_bits.rb
+++ /dev/null
@@ -1,43 +0,0 @@
-#!/usr/bin/ruby
-#coding: us-ascii
-#
-# The Great Computer Language Shootout
-# http://shootout.alioth.debian.org/
-#
-# nsieve-bits in Ruby
-# Contributed by Glenn Parker, March 2005
-
-CharExponent = 3
-BitsPerChar = 1 << CharExponent
-LowMask = BitsPerChar - 1
-
-def sieve(m)
- items = "\xFF" * ((m / BitsPerChar) + 1)
- masks = ""
- BitsPerChar.times do |b|
- masks << (1 << b).chr
- end
-
- count = 0
- pmax = m - 1
- 2.step(pmax, 1) do |p|
- if items[p >> CharExponent][p & LowMask] == 1
- count += 1
- p.step(pmax, p) do |mult|
- a = mult >> CharExponent
- b = mult & LowMask
- items[a] -= masks[b] if items[a][b] != 0
- end
- end
- end
- count
-end
-
-n = 9 # (ARGV[0] || 2).to_i
-n.step(n - 2, -1) do |exponent|
- break if exponent < 0
- m = 2 ** exponent * 10_000
- count = sieve(m)
- printf "Primes up to %8d %8d\n", m, count
-end
-
diff --git a/benchmark/so_object.rb b/benchmark/so_object.rb
deleted file mode 100644
index 131f44624c..0000000000
--- a/benchmark/so_object.rb
+++ /dev/null
@@ -1,56 +0,0 @@
-#!/usr/bin/ruby
-# -*- Ruby -*-
-# $Id: objinst-ruby.code,v 1.4 2004/11/13 07:42:25 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# with help from Aristarkh Zagorodnikov
-
-class Toggle
- def initialize(start_state)
- @bool = start_state
- end
-
- def value
- @bool
- end
-
- def activate
- @bool = !@bool
- self
- end
-end
-
-class NthToggle < Toggle
- def initialize(start_state, max_counter)
- super start_state
- @count_max = max_counter
- @counter = 0
- end
-
- def activate
- @counter += 1
- if @counter >= @count_max
- @bool = !@bool
- @counter = 0
- end
- self
- end
-end
-
-n = 1500000 # (ARGV.shift || 1).to_i
-
-toggle = Toggle.new 1
-5.times do
- toggle.activate.value ? 'true' : 'false'
-end
-n.times do
- toggle = Toggle.new 1
-end
-
-ntoggle = NthToggle.new 1, 3
-8.times do
- ntoggle.activate.value ? 'true' : 'false'
-end
-n.times do
- ntoggle = NthToggle.new 1, 3
-end
-
diff --git a/benchmark/so_partial_sums.rb b/benchmark/so_partial_sums.rb
deleted file mode 100644
index 630b45cb8d..0000000000
--- a/benchmark/so_partial_sums.rb
+++ /dev/null
@@ -1,31 +0,0 @@
-n = 2_500_000 # (ARGV.shift || 1).to_i
-
-alt = 1.0 ; s0 = s1 = s2 = s3 = s4 = s5 = s6 = s7 = s8 = 0.0
-
-1.upto(n) do |d|
- d = d.to_f ; d2 = d * d ; d3 = d2 * d ; ds = Math.sin(d) ; dc = Math.cos(d)
-
- s0 += (2.0 / 3.0) ** (d - 1.0)
- s1 += 1.0 / Math.sqrt(d)
- s2 += 1.0 / (d * (d + 1.0))
- s3 += 1.0 / (d3 * ds * ds)
- s4 += 1.0 / (d3 * dc * dc)
- s5 += 1.0 / d
- s6 += 1.0 / d2
- s7 += alt / d
- s8 += alt / (2.0 * d - 1.0)
-
- alt = -alt
-end
-
-if false
- printf("%.9f\t(2/3)^k\n", s0)
- printf("%.9f\tk^-0.5\n", s1)
- printf("%.9f\t1/k(k+1)\n", s2)
- printf("%.9f\tFlint Hills\n", s3)
- printf("%.9f\tCookson Hills\n", s4)
- printf("%.9f\tHarmonic\n", s5)
- printf("%.9f\tRiemann Zeta\n", s6)
- printf("%.9f\tAlternating Harmonic\n", s7)
- printf("%.9f\tGregory\n", s8)
-end
diff --git a/benchmark/so_pidigits.rb b/benchmark/so_pidigits.rb
deleted file mode 100644
index 9a537b2d1c..0000000000
--- a/benchmark/so_pidigits.rb
+++ /dev/null
@@ -1,92 +0,0 @@
-# The Great Computer Language Shootout
-# http://shootout.alioth.debian.org/
-#
-# contributed by Gabriele Renzi
-
-class PiDigitSpigot
-
- def initialize()
- @z = Transformation.new 1,0,0,1
- @x = Transformation.new 0,0,0,0
- @inverse = Transformation.new 0,0,0,0
- end
-
- def next!
- @y = @z.extract(3)
- if safe? @y
- @z = produce(@y)
- @y
- else
- @z = consume @x.next!()
- next!()
- end
- end
-
- def safe?(digit)
- digit == @z.extract(4)
- end
-
- def produce(i)
- @inverse.qrst(10,-10*i,0,1).compose(@z)
- end
-
- def consume(a)
- @z.compose(a)
- end
-end
-
-
-class Transformation
- attr_reader :q, :r, :s, :t
- def initialize(q, r, s, t)
- @q,@r,@s,@t,@k = q,r,s,t,0
- end
-
- def next!()
- @q = @k = @k + 1
- @r = 4 * @k + 2
- @s = 0
- @t = 2 * @k + 1
- self
- end
-
- def extract(j)
- (@q * j + @r) / (@s * j + @t)
- end
-
- def compose(a)
- self.class.new( @q * a.q,
- @q * a.r + r * a.t,
- @s * a.q + t * a.s,
- @s * a.r + t * a.t
- )
- end
-
- def qrst *args
- initialize *args
- self
- end
-
-
-end
-
-
-WIDTH = 10
-n = 2_500 # Integer(ARGV[0])
-j = 0
-
-digits = PiDigitSpigot.new
-
-while n > 0
- if n >= WIDTH
- WIDTH.times {print digits.next!}
- j += WIDTH
- else
- n.times {print digits.next!}
- (WIDTH-n).times {print " "}
- j += n
- end
- puts "\t:"+j.to_s
- n -= WIDTH
-end
-
diff --git a/benchmark/so_random.rb b/benchmark/so_random.rb
deleted file mode 100644
index a66b9e8e63..0000000000
--- a/benchmark/so_random.rb
+++ /dev/null
@@ -1,20 +0,0 @@
-# from http://www.bagley.org/~doug/shootout/bench/random/random.ruby
-
-IM = 139968.0
-IA = 3877.0
-IC = 29573.0
-
-$last = 42.0
-
-def gen_random(max)
- (max * ($last = ($last * IA + IC) % IM)) / IM
-end
-
-N = 3_000_000
-
-i = 0
-while i<N
- i +=1
- gen_random(100.0)
-end
-# "%.9f" % gen_random(100.0)
diff --git a/benchmark/so_reverse_complement.yml b/benchmark/so_reverse_complement.yml
deleted file mode 100644
index de05eedfc4..0000000000
--- a/benchmark/so_reverse_complement.yml
+++ /dev/null
@@ -1,137 +0,0 @@
-prelude: |
- bm_so_fasta = <<'EOS'
- # The Computer Language Shootout
- # http://shootout.alioth.debian.org/
- # Contributed by Sokolov Yura
-
- $last = 42.0
- def gen_random(max, im=139968, ia=3877, ic=29573)
- (max * ($last = ($last * ia + ic) % im)) / im
- end
-
- alu =
- "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
- "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
- "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
- "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
- "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
- "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
- "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
-
- iub = [
- ["a", 0.27],
- ["c", 0.12],
- ["g", 0.12],
- ["t", 0.27],
-
- ["B", 0.02],
- ["D", 0.02],
- ["H", 0.02],
- ["K", 0.02],
- ["M", 0.02],
- ["N", 0.02],
- ["R", 0.02],
- ["S", 0.02],
- ["V", 0.02],
- ["W", 0.02],
- ["Y", 0.02],
- ]
- homosapiens = [
- ["a", 0.3029549426680],
- ["c", 0.1979883004921],
- ["g", 0.1975473066391],
- ["t", 0.3015094502008],
- ]
-
- def make_repeat_fasta(id, desc, src, n)
- puts ">#{id} #{desc}"
- v = nil
- width = 60
- l = src.length
- s = src * ((n / l) + 1)
- s.slice!(n, l)
- puts(s.scan(/.{1,#{width}}/).join("\n"))
- end
-
- def make_random_fasta(id, desc, table, n)
- puts ">#{id} #{desc}"
- rand, v = nil,nil
- width = 60
- chunk = 1 * width
- prob = 0.0
- table.each{|v| v[1]= (prob += v[1])}
- for i in 1..(n/width)
- puts((1..width).collect{
- rand = gen_random(1.0)
- table.find{|v| v[1]>rand}[0]
- }.join)
- end
- if n%width != 0
- puts((1..(n%width)).collect{
- rand = gen_random(1.0)
- table.find{|v| v[1]>rand}[0]
- }.join)
- end
- end
-
-
- n = (ARGV[0] or 250_000).to_i
-
- make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
- make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
- make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
- EOS
-benchmark:
- - name: so_reverse_complement
- prelude: |
- script = File.join(File.dirname($0), 'bm_so_fasta.rb')
- File.write(script, bm_so_fasta)
-
- def prepare_fasta_output n
- filebase = File.join(File.dirname($0), 'fasta.output')
- script = File.join(File.dirname($0), 'bm_so_fasta.rb')
- file = "#{filebase}.#{n}"
-
- unless FileTest.exist?(file)
- STDERR.puts "preparing #{file}"
-
- open(file, 'w'){|f|
- ARGV[0] = n
- $stdout = f
- load script
- $stdout = STDOUT
- }
- end
- end
- prepare_fasta_output(2_500_000)
- script: |
- # The Great Computer Language Shootout
- # http://shootout.alioth.debian.org/
- #
- # Contributed by Peter Bjarke Olsen
- # Modified by Doug King
-
- seq=Array.new
-
- def revcomp(seq)
- seq.reverse!.tr!('wsatugcyrkmbdhvnATUGCYRKMBDHVN','WSTAACGRYMKVHDBNTAACGRYMKVHDBN')
- stringlen=seq.length
- 0.step(stringlen-1,60) {|x| print seq.slice(x,60) , "\n"}
- end
-
- input = open(File.join(File.dirname($0), 'fasta.output.2500000'), 'rb')
-
- while input.gets
- if $_ =~ />/
- if seq.length != 0
- revcomp(seq.join)
- seq=Array.new
- end
- puts $_
- else
- $_.sub(/\n/,'')
- seq.push $_
- end
- end
- revcomp(seq.join)
- loop_count: 1
diff --git a/benchmark/so_sieve.rb b/benchmark/so_sieve.rb
deleted file mode 100644
index 43dc302648..0000000000
--- a/benchmark/so_sieve.rb
+++ /dev/null
@@ -1,24 +0,0 @@
-# from http://www.bagley.org/~doug/shootout/bench/sieve/sieve.ruby
-num = 500
-count = i = j = 0
-flags0 = Array.new(8192,1)
-k = 0
-while k < num
- k += 1
- count = 0
- flags = flags0.dup
- i = 2
- while i<8192
- i += 1
- if flags[i]
- # remove all multiples of prime: i
- j = i*i
- while j < 8192
- j += i
- flags[j] = nil
- end
- count += 1
- end
- end
-end
-count
diff --git a/benchmark/so_spectralnorm.rb b/benchmark/so_spectralnorm.rb
deleted file mode 100644
index 6b97206689..0000000000
--- a/benchmark/so_spectralnorm.rb
+++ /dev/null
@@ -1,50 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org/
-# Contributed by Sokolov Yura
-
-def eval_A(i,j)
- return 1.0/((i+j)*(i+j+1)/2+i+1)
-end
-
-def eval_A_times_u(u)
- v, i = nil, nil
- (0..u.length-1).collect { |i|
- v = 0
- for j in 0..u.length-1
- v += eval_A(i,j)*u[j]
- end
- v
- }
-end
-
-def eval_At_times_u(u)
- v, i = nil, nil
- (0..u.length-1).collect{|i|
- v = 0
- for j in 0..u.length-1
- v += eval_A(j,i)*u[j]
- end
- v
- }
-end
-
-def eval_AtA_times_u(u)
- return eval_At_times_u(eval_A_times_u(u))
-end
-
-n = 500 # ARGV[0].to_i
-
-u=[1]*n
-for i in 1..10
- v=eval_AtA_times_u(u)
- u=eval_AtA_times_u(v)
-end
-vBv=0
-vv=0
-for i in 0..n-1
- vBv += u[i]*v[i]
- vv += v[i]*v[i]
-end
-
-str = "%0.9f" % (Math.sqrt(vBv/vv)), "\n"
-# print str
diff --git a/benchmark/string_capitalize.yml b/benchmark/string_capitalize.yml
deleted file mode 100644
index 7d23fd3d35..0000000000
--- a/benchmark/string_capitalize.yml
+++ /dev/null
@@ -1,10 +0,0 @@
-prelude: |
- str1 = [*"a".."m",*"N".."Z",*"0".."9"].join("")
- str10 = str1 * 10
- str100 = str10 * 10
- str1000 = str100 * 10
-benchmark:
- capitalize-1: str1.capitalize
- capitalize-10: str10.capitalize
- capitalize-100: str100.capitalize
- capitalize-1000: str1000.capitalize
diff --git a/benchmark/string_downcase.yml b/benchmark/string_downcase.yml
deleted file mode 100644
index a31c3ac712..0000000000
--- a/benchmark/string_downcase.yml
+++ /dev/null
@@ -1,10 +0,0 @@
-prelude: |
- str1 = [*"A".."Z",*"0".."9"].join("")
- str10 = str1 * 10
- str100 = str10 * 10
- str1000 = str100 * 10
-benchmark:
- downcase-1: str1.upcase
- downcase-10: str10.upcase
- downcase-100: str100.upcase
- downcase-1000: str1000.upcase
diff --git a/benchmark/string_index.rb b/benchmark/string_index.rb
deleted file mode 100644
index 7783111082..0000000000
--- a/benchmark/string_index.rb
+++ /dev/null
@@ -1,3 +0,0 @@
-str1 = "あ" * 1024 + "い" # not single byte optimizable
-str2 = "い"
-100_000.times { str1.index(str2) }
diff --git a/benchmark/string_scan_re.rb b/benchmark/string_scan_re.rb
deleted file mode 100644
index b0d60201a9..0000000000
--- a/benchmark/string_scan_re.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-str = Array.new(1_000, 'abc').join(',')
-1_000.times { str.scan(/abc/) }
diff --git a/benchmark/string_scan_str.rb b/benchmark/string_scan_str.rb
deleted file mode 100644
index 42440bd948..0000000000
--- a/benchmark/string_scan_str.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-str = Array.new(1_000, 'abc').join(',')
-1_000.times { str.scan('abc') }
diff --git a/benchmark/string_split.yml b/benchmark/string_split.yml
deleted file mode 100644
index 84ffe8f6a7..0000000000
--- a/benchmark/string_split.yml
+++ /dev/null
@@ -1,7 +0,0 @@
-prelude: |
- str0 = [*0..9].join("")
-benchmark:
- to_chars-1: str0.split('')
- to_chars-10: (str0 * 10).split('')
- to_chars-100: (str0 * 100).split('')
- to_chars-1000: (str0 * 1000).split('')
diff --git a/benchmark/string_swapcase.yml b/benchmark/string_swapcase.yml
deleted file mode 100644
index afaae3f696..0000000000
--- a/benchmark/string_swapcase.yml
+++ /dev/null
@@ -1,10 +0,0 @@
-prelude: |
- str1 = [*"A".."M",*"n".."z",*"0".."9"].join("")
- str10 = str1 * 10
- str100 = str10 * 10
- str1000 = str100 * 10
-benchmark:
- swapcase-1: str1.swapcase
- swapcase-10: str10.swapcase
- swapcase-100: str100.swapcase
- swapcase-1000: str1000.swapcase
diff --git a/benchmark/string_upcase.yml b/benchmark/string_upcase.yml
deleted file mode 100644
index 456d213c74..0000000000
--- a/benchmark/string_upcase.yml
+++ /dev/null
@@ -1,10 +0,0 @@
-prelude: |
- str1 = [*"a".."z",*"0".."9"].join("")
- str10 = str1 * 10
- str100 = str10 * 10
- str1000 = str100 * 10
-benchmark:
- upcase-1: str1.upcase
- upcase-10: str10.upcase
- upcase-100: str100.upcase
- upcase-1000: str1000.upcase
diff --git a/benchmark/time_strptime.yml b/benchmark/time_strptime.yml
deleted file mode 100644
index 8d89ebb7a7..0000000000
--- a/benchmark/time_strptime.yml
+++ /dev/null
@@ -1,13 +0,0 @@
-prelude: |
- require 'time'
-benchmark:
- - Time.strptime("28/Aug/2005:06:54:20 +0000", "%d/%b/%Y:%T %z")
- - Time.strptime("1", "%s")
- - Time.strptime("0 +0100", "%s %z")
- - Time.strptime("0 UTC", "%s %z")
- - Time.strptime("1.5", "%s.%N")
- - Time.strptime("1.000000000001", "%s.%N")
- - Time.strptime("20010203 -0200", "%Y%m%d %z")
- - Time.strptime("20010203 UTC", "%Y%m%d %z")
- - Time.strptime("2018-365", "%Y-%j")
- - Time.strptime("2018-091", "%Y-%j")
diff --git a/benchmark/time_subsec.rb b/benchmark/time_subsec.rb
deleted file mode 100644
index 505021c701..0000000000
--- a/benchmark/time_subsec.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-t = Time.now
-4000000.times { t.subsec }
diff --git a/benchmark/vm1_attr_ivar.yml b/benchmark/vm1_attr_ivar.yml
deleted file mode 100644
index f714dd9bd9..0000000000
--- a/benchmark/vm1_attr_ivar.yml
+++ /dev/null
@@ -1,14 +0,0 @@
-prelude: |
- class C
- attr_reader :a, :b
- def initialize
- @a = nil
- @b = nil
- end
- end
- obj = C.new
-benchmark:
- vm1_attr_ivar: |
- j = obj.a
- k = obj.b
-loop_count: 30000000
diff --git a/benchmark/vm1_attr_ivar_set.yml b/benchmark/vm1_attr_ivar_set.yml
deleted file mode 100644
index f383e59ef4..0000000000
--- a/benchmark/vm1_attr_ivar_set.yml
+++ /dev/null
@@ -1,14 +0,0 @@
-prelude: |
- class C
- attr_accessor :a, :b
- def initialize
- @a = nil
- @b = nil
- end
- end
- obj = C.new
-benchmark:
- vm1_attr_ivar_set: |
- obj.a = 1
- obj.b = 2
-loop_count: 30000000
diff --git a/benchmark/vm1_block.yml b/benchmark/vm1_block.yml
deleted file mode 100644
index ac7c940f93..0000000000
--- a/benchmark/vm1_block.yml
+++ /dev/null
@@ -1,9 +0,0 @@
-prelude: |
- def m
- yield
- end
-benchmark:
- vm1_block: |
- m{
- }
-loop_count: 30000000
diff --git a/benchmark/vm1_blockparam.yml b/benchmark/vm1_blockparam.yml
deleted file mode 100644
index 947b8c53d5..0000000000
--- a/benchmark/vm1_blockparam.yml
+++ /dev/null
@@ -1,7 +0,0 @@
-prelude: |
- def m &b
- end
-benchmark:
- vm1_blockparam: |
- m{}
-loop_count: 30000000
diff --git a/benchmark/vm1_blockparam_call.yml b/benchmark/vm1_blockparam_call.yml
deleted file mode 100644
index e2817a3ce2..0000000000
--- a/benchmark/vm1_blockparam_call.yml
+++ /dev/null
@@ -1,8 +0,0 @@
-prelude: |
- def m &b
- b.call
- end
-benchmark:
- vm1_blockparam_call: |
- m{}
-loop_count: 30000000
diff --git a/benchmark/vm1_blockparam_pass.yml b/benchmark/vm1_blockparam_pass.yml
deleted file mode 100644
index ca1bef3369..0000000000
--- a/benchmark/vm1_blockparam_pass.yml
+++ /dev/null
@@ -1,12 +0,0 @@
-prelude: |
- def bp_yield
- yield
- end
-
- def bp_pass &b
- bp_yield &b
- end
-benchmark:
- vm1_blockparam_pass: |
- bp_pass{}
-loop_count: 30000000
diff --git a/benchmark/vm1_blockparam_yield.yml b/benchmark/vm1_blockparam_yield.yml
deleted file mode 100644
index 56ae617798..0000000000
--- a/benchmark/vm1_blockparam_yield.yml
+++ /dev/null
@@ -1,8 +0,0 @@
-prelude: |
- def bp_yield &b
- yield
- end
-benchmark:
- vm1_blockparam_yield: |
- bp_yield{}
-loop_count: 30000000
diff --git a/benchmark/vm1_const.yml b/benchmark/vm1_const.yml
deleted file mode 100644
index b98db1545c..0000000000
--- a/benchmark/vm1_const.yml
+++ /dev/null
@@ -1,7 +0,0 @@
-prelude: |
- Const = 1
-benchmark:
- vm1_const: |
- j = Const
- k = Const
-loop_count: 30000000
diff --git a/benchmark/vm1_ensure.yml b/benchmark/vm1_ensure.yml
deleted file mode 100644
index afbbe38bec..0000000000
--- a/benchmark/vm1_ensure.yml
+++ /dev/null
@@ -1,14 +0,0 @@
-# Not utilizing loop_count since using it for this is too unstable for now
-benchmark:
- vm1_ensure: |
- i = 0
- while i<30_000_000
- i += 1
- begin
- begin
- ensure
- end
- ensure
- end
- end
-loop_count: 1
diff --git a/benchmark/vm1_float_simple.yml b/benchmark/vm1_float_simple.yml
deleted file mode 100644
index 4e9ad1852b..0000000000
--- a/benchmark/vm1_float_simple.yml
+++ /dev/null
@@ -1,8 +0,0 @@
-prelude: |
- f = 0.0
-benchmark:
- vm1_float_simple: |
- f += 0.1; f -= 0.1
- f += 0.1; f -= 0.1
- f += 0.1; f -= 0.1
-loop_count: 30000000
diff --git a/benchmark/vm1_gc_short_lived.yml b/benchmark/vm1_gc_short_lived.yml
deleted file mode 100644
index 8fdcb7371d..0000000000
--- a/benchmark/vm1_gc_short_lived.yml
+++ /dev/null
@@ -1,9 +0,0 @@
-benchmark:
- vm1_gc_short_lived: |
- a = '' # short-lived String
- b = ''
- c = ''
- d = ''
- e = ''
- f = ''
-loop_count: 30000000
diff --git a/benchmark/vm1_gc_short_with_complex_long.yml b/benchmark/vm1_gc_short_with_complex_long.yml
deleted file mode 100644
index c22ea74a60..0000000000
--- a/benchmark/vm1_gc_short_with_complex_long.yml
+++ /dev/null
@@ -1,25 +0,0 @@
-prelude: |
- def nested_hash h, n
- if n == 0
- ''
- else
- 10.times{
- h[Object.new] = nested_hash(h, n-1)
- }
- end
- end
-
- long_lived = Hash.new
- nested_hash long_lived, 6
-
- GC.start
- GC.start
-benchmark:
- vm1_gc_short_with_complex_long: |
- a = '' # short-lived String
- b = ''
- c = ''
- d = ''
- e = ''
- f = ''
-loop_count: 30000000
diff --git a/benchmark/vm1_gc_short_with_long.yml b/benchmark/vm1_gc_short_with_long.yml
deleted file mode 100644
index c731aae548..0000000000
--- a/benchmark/vm1_gc_short_with_long.yml
+++ /dev/null
@@ -1,13 +0,0 @@
-prelude: |
- long_lived = Array.new(1_000_000){|i| "#{i}"}
- GC.start
- GC.start
-benchmark:
- vm1_gc_short_with_long: |
- a = '' # short-lived String
- b = ''
- c = ''
- d = ''
- e = ''
- f = ''
-loop_count: 30000000
diff --git a/benchmark/vm1_gc_short_with_symbol.yml b/benchmark/vm1_gc_short_with_symbol.yml
deleted file mode 100644
index 7fc1abedd8..0000000000
--- a/benchmark/vm1_gc_short_with_symbol.yml
+++ /dev/null
@@ -1,13 +0,0 @@
-prelude: |
- 50_000.times{|i| sym = "sym#{i}".to_sym}
- GC.start
- GC.start
-benchmark:
- vm1_gc_short_with_symbol: |
- a = '' # short-lived String
- b = ''
- c = ''
- d = ''
- e = ''
- f = ''
-loop_count: 30000000
diff --git a/benchmark/vm1_gc_wb_ary.yml b/benchmark/vm1_gc_wb_ary.yml
deleted file mode 100644
index 50fb4b6f84..0000000000
--- a/benchmark/vm1_gc_wb_ary.yml
+++ /dev/null
@@ -1,12 +0,0 @@
-prelude: |
- short_lived_ary = []
-
- if RUBY_VERSION >= "2.2.0"
- GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true)
- end
-
- short_lived = ''
-benchmark:
- vm1_gc_wb_ary: |
- short_lived_ary[0] = short_lived # write barrier
-loop_count: 30000000
diff --git a/benchmark/vm1_gc_wb_ary_promoted.yml b/benchmark/vm1_gc_wb_ary_promoted.yml
deleted file mode 100644
index cf9b5de005..0000000000
--- a/benchmark/vm1_gc_wb_ary_promoted.yml
+++ /dev/null
@@ -1,15 +0,0 @@
-prelude: |
- long_lived = []
-
- if RUBY_VERSION > "2.2.0"
- 3.times{ GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true) }
- elsif
- GC.start
- end
-
- short_lived = ''
-
-benchmark:
- vm1_gc_wb_ary_promoted: |
- long_lived[0] = short_lived # write barrier
-loop_count: 30000000
diff --git a/benchmark/vm1_gc_wb_obj.yml b/benchmark/vm1_gc_wb_obj.yml
deleted file mode 100644
index 9dc08e7e1a..0000000000
--- a/benchmark/vm1_gc_wb_obj.yml
+++ /dev/null
@@ -1,15 +0,0 @@
-prelude: |
- class C
- attr_accessor :foo
- end
- short_lived_obj = C.new
-
- if RUBY_VERSION >= "2.2.0"
- GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true)
- end
-
- short_lived = ''
-benchmark:
- vm1_gc_wb_obj: |
- short_lived_obj.foo = short_lived # write barrier
-loop_count: 30000000
diff --git a/benchmark/vm1_gc_wb_obj_promoted.yml b/benchmark/vm1_gc_wb_obj_promoted.yml
deleted file mode 100644
index 26859d2a52..0000000000
--- a/benchmark/vm1_gc_wb_obj_promoted.yml
+++ /dev/null
@@ -1,17 +0,0 @@
-prelude: |
- class C
- attr_accessor :foo
- end
- long_lived = C.new
-
- if RUBY_VERSION >= "2.2.0"
- 3.times{ GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true) }
- elsif
- GC.start
- end
-
- short_lived = ''
-benchmark:
- vm1_gc_wb_obj_promoted: |
- long_lived.foo = short_lived # write barrier
-loop_count: 30000000
diff --git a/benchmark/vm1_ivar.yml b/benchmark/vm1_ivar.yml
deleted file mode 100644
index 7aa6fac729..0000000000
--- a/benchmark/vm1_ivar.yml
+++ /dev/null
@@ -1,6 +0,0 @@
-prelude: "@a = 1\n"
-benchmark:
- vm1_ivar: |
- j = @a
- k = @a
-loop_count: 30000000
diff --git a/benchmark/vm1_ivar_set.yml b/benchmark/vm1_ivar_set.yml
deleted file mode 100644
index 6f19412d16..0000000000
--- a/benchmark/vm1_ivar_set.yml
+++ /dev/null
@@ -1,5 +0,0 @@
-benchmark:
- vm1_ivar_set: |
- @a = 1
- @b = 2
-loop_count: 30000000
diff --git a/benchmark/vm1_length.yml b/benchmark/vm1_length.yml
deleted file mode 100644
index a18e2ca2e6..0000000000
--- a/benchmark/vm1_length.yml
+++ /dev/null
@@ -1,8 +0,0 @@
-prelude: |
- a = 'abc'
- b = [1, 2, 3]
-benchmark:
- vm1_length: |
- a.length
- b.length
-loop_count: 30000000
diff --git a/benchmark/vm1_lvar_init.yml b/benchmark/vm1_lvar_init.yml
deleted file mode 100644
index 10e2becef9..0000000000
--- a/benchmark/vm1_lvar_init.yml
+++ /dev/null
@@ -1,21 +0,0 @@
-# while loop cost is not removed because `i` is used in the script
-benchmark:
- vm1_lvar_init: |
- def m v
- unless v
- # unreachable code
- v1 = v2 = v3 = v4 = v5 = v6 = v7 = v8 = v9 = v10 =
- v11 = v12 = v13 = v14 = v15 = v16 = v17 = v18 = v19 = v20 =
- v21 = v22 = v23 = v24 = v25 = v26 = v27 = v28 = v29 = v30 =
- v31 = v32 = v33 = v34 = v35 = v36 = v37 = v38 = v39 = v40 =
- v41 = v42 = v43 = v44 = v45 = v46 = v47 = v48 = v49 = v50 = 1
- end
- end
-
- i = 0
-
- while i<30_000_000
- i += 1
- m i
- end
-loop_count: 1
diff --git a/benchmark/vm1_lvar_set.yml b/benchmark/vm1_lvar_set.yml
deleted file mode 100644
index df8f6b6ea4..0000000000
--- a/benchmark/vm1_lvar_set.yml
+++ /dev/null
@@ -1,4 +0,0 @@
-benchmark:
- vm1_lvar_set: |
- a = b = c = d = e = f = g = h = j = k = l = m = n = o = p = q = r = 1
-loop_count: 30000000
diff --git a/benchmark/vm1_neq.yml b/benchmark/vm1_neq.yml
deleted file mode 100644
index 65a8128dda..0000000000
--- a/benchmark/vm1_neq.yml
+++ /dev/null
@@ -1,7 +0,0 @@
-prelude: |
- obj1 = Object.new
- obj2 = Object.new
-benchmark:
- vm1_neq: |
- obj1 != obj2
-loop_count: 30000000
diff --git a/benchmark/vm1_not.yml b/benchmark/vm1_not.yml
deleted file mode 100644
index 0fb7b282a9..0000000000
--- a/benchmark/vm1_not.yml
+++ /dev/null
@@ -1,6 +0,0 @@
-prelude: |
- obj = Object.new
-benchmark:
- vm1_not: |
- !obj
-loop_count: 30000000
diff --git a/benchmark/vm1_rescue.yml b/benchmark/vm1_rescue.yml
deleted file mode 100644
index a175b823af..0000000000
--- a/benchmark/vm1_rescue.yml
+++ /dev/null
@@ -1,6 +0,0 @@
-benchmark:
- vm1_rescue: |
- begin
- rescue
- end
-loop_count: 30000000
diff --git a/benchmark/vm1_simplereturn.yml b/benchmark/vm1_simplereturn.yml
deleted file mode 100644
index 3564aac7e2..0000000000
--- a/benchmark/vm1_simplereturn.yml
+++ /dev/null
@@ -1,7 +0,0 @@
-prelude: |
- def m
- return 1
- end
-benchmark:
- vm1_simplereturn: m
-loop_count: 30000000
diff --git a/benchmark/vm1_swap.yml b/benchmark/vm1_swap.yml
deleted file mode 100644
index fed87ccd62..0000000000
--- a/benchmark/vm1_swap.yml
+++ /dev/null
@@ -1,7 +0,0 @@
-prelude: |
- a = 1
- b = 2
-benchmark:
- vm1_swap: |
- a, b = b, a
-loop_count: 30000000
diff --git a/benchmark/vm1_yield.yml b/benchmark/vm1_yield.yml
deleted file mode 100644
index ae1f9316f9..0000000000
--- a/benchmark/vm1_yield.yml
+++ /dev/null
@@ -1,13 +0,0 @@
-# while loop cost is not removed due to benchmark_driver.gem's limitation
-benchmark:
- vm1_yield: |
- def m
- i = 0
- while i<30_000_000
- i += 1
- yield
- end
- end
-
- m{}
-loop_count: 1
diff --git a/benchmark/vm2_array.yml b/benchmark/vm2_array.yml
deleted file mode 100644
index 7373098d5e..0000000000
--- a/benchmark/vm2_array.yml
+++ /dev/null
@@ -1,4 +0,0 @@
-benchmark:
- vm2_array: |
- a = [1,2,3,4,5,6,7,8,9,10]
-loop_count: 6000000
diff --git a/benchmark/vm2_bigarray.yml b/benchmark/vm2_bigarray.yml
deleted file mode 100644
index 2ad6da3905..0000000000
--- a/benchmark/vm2_bigarray.yml
+++ /dev/null
@@ -1,105 +0,0 @@
-benchmark:
- vm2_bigarray: |
- a = [
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- 1,2,3,4,5,6,7,8,9,10,
- ]
-loop_count: 6000000
diff --git a/benchmark/vm2_bighash.yml b/benchmark/vm2_bighash.yml
deleted file mode 100644
index e9154e4ba9..0000000000
--- a/benchmark/vm2_bighash.yml
+++ /dev/null
@@ -1,4 +0,0 @@
-benchmark:
- vm2_bighash: |
- a = {0=>0, 1=>1, 2=>2, 3=>3, 4=>4, 5=>5, 6=>6, 7=>7, 8=>8, 9=>9, 10=>10, 11=>11, 12=>12, 13=>13, 14=>14, 15=>15, 16=>16, 17=>17, 18=>18, 19=>19, 20=>20, 21=>21, 22=>22, 23=>23, 24=>24, 25=>25, 26=>26, 27=>27, 28=>28, 29=>29, 30=>30, 31=>31, 32=>32, 33=>33, 34=>34, 35=>35, 36=>36, 37=>37, 38=>38, 39=>39, 40=>40, 41=>41, 42=>42, 43=>43, 44=>44, 45=>45, 46=>46, 47=>47, 48=>48, 49=>49, 50=>50, 51=>51, 52=>52, 53=>53, 54=>54, 55=>55, 56=>56, 57=>57, 58=>58, 59=>59, 60=>60, 61=>61, 62=>62, 63=>63, 64=>64, 65=>65, 66=>66, 67=>67, 68=>68, 69=>69, 70=>70, 71=>71, 72=>72, 73=>73, 74=>74, 75=>75, 76=>76, 77=>77, 78=>78, 79=>79, 80=>80, 81=>81, 82=>82, 83=>83, 84=>84, 85=>85, 86=>86, 87=>87, 88=>88, 89=>89, 90=>90, 91=>91, 92=>92, 93=>93, 94=>94, 95=>95, 96=>96, 97=>97, 98=>98, 99=>99, 100=>100, 101=>101, 102=>102, 103=>103, 104=>104, 105=>105, 106=>106, 107=>107, 108=>108, 109=>109, 110=>110, 111=>111, 112=>112, 113=>113, 114=>114, 115=>115, 116=>116, 117=>117, 118=>118, 119=>119, 120=>120, 121=>121, 122=>122, 123=>123, 124=>124, 125=>125, 126=>126, 127=>127, 128=>128, 129=>129, 130=>130, 131=>131, 132=>132, 133=>133, 134=>134, 135=>135, 136=>136, 137=>137, 138=>138, 139=>139, 140=>140, 141=>141, 142=>142, 143=>143, 144=>144, 145=>145, 146=>146, 147=>147, 148=>148, 149=>149, 150=>150, 151=>151, 152=>152, 153=>153, 154=>154, 155=>155, 156=>156, 157=>157, 158=>158, 159=>159, 160=>160, 161=>161, 162=>162, 163=>163, 164=>164, 165=>165, 166=>166, 167=>167, 168=>168, 169=>169, 170=>170, 171=>171, 172=>172, 173=>173, 174=>174, 175=>175, 176=>176, 177=>177, 178=>178, 179=>179, 180=>180, 181=>181, 182=>182, 183=>183, 184=>184, 185=>185, 186=>186, 187=>187, 188=>188, 189=>189, 190=>190, 191=>191, 192=>192, 193=>193, 194=>194, 195=>195, 196=>196, 197=>197, 198=>198, 199=>199, 200=>200, 201=>201, 202=>202, 203=>203, 204=>204, 205=>205, 206=>206, 207=>207, 208=>208, 209=>209, 210=>210, 211=>211, 212=>212, 213=>213, 214=>214, 215=>215, 216=>216, 217=>217, 218=>218, 219=>219, 220=>220, 221=>221, 222=>222, 223=>223, 224=>224, 225=>225, 226=>226, 227=>227, 228=>228, 229=>229, 230=>230, 231=>231, 232=>232, 233=>233, 234=>234, 235=>235, 236=>236, 237=>237, 238=>238, 239=>239, 240=>240, 241=>241, 242=>242, 243=>243, 244=>244, 245=>245, 246=>246, 247=>247, 248=>248, 249=>249, 250=>250, 251=>251, 252=>252, 253=>253, 254=>254, 255=>255, 256=>256, 257=>257, 258=>258, 259=>259, 260=>260, 261=>261, 262=>262, 263=>263, 264=>264, 265=>265, 266=>266, 267=>267, 268=>268, 269=>269, 270=>270, 271=>271, 272=>272, 273=>273, 274=>274, 275=>275, 276=>276, 277=>277, 278=>278, 279=>279, 280=>280, 281=>281, 282=>282, 283=>283, 284=>284, 285=>285, 286=>286, 287=>287, 288=>288, 289=>289, 290=>290, 291=>291, 292=>292, 293=>293, 294=>294, 295=>295, 296=>296, 297=>297, 298=>298, 299=>299, 300=>300, 301=>301, 302=>302, 303=>303, 304=>304, 305=>305, 306=>306, 307=>307, 308=>308, 309=>309, 310=>310, 311=>311, 312=>312, 313=>313, 314=>314, 315=>315, 316=>316, 317=>317, 318=>318, 319=>319, 320=>320, 321=>321, 322=>322, 323=>323, 324=>324, 325=>325, 326=>326, 327=>327, 328=>328, 329=>329, 330=>330, 331=>331, 332=>332, 333=>333, 334=>334, 335=>335, 336=>336, 337=>337, 338=>338, 339=>339, 340=>340, 341=>341, 342=>342, 343=>343, 344=>344, 345=>345, 346=>346, 347=>347, 348=>348, 349=>349, 350=>350, 351=>351, 352=>352, 353=>353, 354=>354, 355=>355, 356=>356, 357=>357, 358=>358, 359=>359, 360=>360, 361=>361, 362=>362, 363=>363, 364=>364, 365=>365, 366=>366, 367=>367, 368=>368, 369=>369, 370=>370, 371=>371, 372=>372, 373=>373, 374=>374, 375=>375, 376=>376, 377=>377, 378=>378, 379=>379, 380=>380, 381=>381, 382=>382, 383=>383, 384=>384, 385=>385, 386=>386, 387=>387, 388=>388, 389=>389, 390=>390, 391=>391, 392=>392, 393=>393, 394=>394, 395=>395, 396=>396, 397=>397, 398=>398, 399=>399, 400=>400, 401=>401, 402=>402, 403=>403, 404=>404, 405=>405, 406=>406, 407=>407, 408=>408, 409=>409, 410=>410, 411=>411, 412=>412, 413=>413, 414=>414, 415=>415, 416=>416, 417=>417, 418=>418, 419=>419, 420=>420, 421=>421, 422=>422, 423=>423, 424=>424, 425=>425, 426=>426, 427=>427, 428=>428, 429=>429, 430=>430, 431=>431, 432=>432, 433=>433, 434=>434, 435=>435, 436=>436, 437=>437, 438=>438, 439=>439, 440=>440, 441=>441, 442=>442, 443=>443, 444=>444, 445=>445, 446=>446, 447=>447, 448=>448, 449=>449, 450=>450, 451=>451, 452=>452, 453=>453, 454=>454, 455=>455, 456=>456, 457=>457, 458=>458, 459=>459, 460=>460, 461=>461, 462=>462, 463=>463, 464=>464, 465=>465, 466=>466, 467=>467, 468=>468, 469=>469, 470=>470, 471=>471, 472=>472, 473=>473, 474=>474, 475=>475, 476=>476, 477=>477, 478=>478, 479=>479, 480=>480, 481=>481, 482=>482, 483=>483, 484=>484, 485=>485, 486=>486, 487=>487, 488=>488, 489=>489, 490=>490, 491=>491, 492=>492, 493=>493, 494=>494, 495=>495, 496=>496, 497=>497, 498=>498, 499=>499, 500=>500,}
-loop_count: 60000
diff --git a/benchmark/vm2_case.yml b/benchmark/vm2_case.yml
deleted file mode 100644
index 7716783c09..0000000000
--- a/benchmark/vm2_case.yml
+++ /dev/null
@@ -1,13 +0,0 @@
-benchmark:
- vm2_case: |
- case :foo
- when :bar
- raise
- when :baz
- raise
- when :boo
- raise
- when :foo
- # noop
- end
-loop_count: 6000000
diff --git a/benchmark/vm2_case_lit.yml b/benchmark/vm2_case_lit.yml
deleted file mode 100644
index c49b8dfe5e..0000000000
--- a/benchmark/vm2_case_lit.yml
+++ /dev/null
@@ -1,23 +0,0 @@
-# loop_count is not utilized since `i` is involved in the script
-benchmark:
- vm2_case_lit: |
- i = 0
- @ret = [ "foo", true, false, :sym, 6, nil, 0.1, 0xffffffffffffffff ]
- def foo(i)
- @ret[i % @ret.size]
- end
-
- while i<6_000_000
- case foo(i)
- when "foo" then :foo
- when true then true
- when false then false
- when :sym then :sym
- when 6 then :fix
- when nil then nil
- when 0.1 then :float
- when 0xffffffffffffffff then :big
- end
- i += 1
- end
-loop_count: 1
diff --git a/benchmark/vm2_defined_method.yml b/benchmark/vm2_defined_method.yml
deleted file mode 100644
index e1b0d55674..0000000000
--- a/benchmark/vm2_defined_method.yml
+++ /dev/null
@@ -1,8 +0,0 @@
-prelude: |
- class Object
- define_method(:m){}
- end
-benchmark:
- vm2_defined_method: |
- m; m; m; m; m; m; m; m;
-loop_count: 6000000
diff --git a/benchmark/vm2_dstr.yml b/benchmark/vm2_dstr.yml
deleted file mode 100644
index f8bd6e0133..0000000000
--- a/benchmark/vm2_dstr.yml
+++ /dev/null
@@ -1,6 +0,0 @@
-prelude: |
- x = y = 'z'
-benchmark:
- vm2_dstr: |
- str = "foo#{x}bar#{y}baz"
-loop_count: 6000000
diff --git a/benchmark/vm2_eval.yml b/benchmark/vm2_eval.yml
deleted file mode 100644
index d506a9c079..0000000000
--- a/benchmark/vm2_eval.yml
+++ /dev/null
@@ -1,4 +0,0 @@
-benchmark:
- vm2_eval: |
- eval("1")
-loop_count: 6000000
diff --git a/benchmark/vm2_fiber_allocate.yml b/benchmark/vm2_fiber_allocate.yml
deleted file mode 100644
index f29705f694..0000000000
--- a/benchmark/vm2_fiber_allocate.yml
+++ /dev/null
@@ -1,8 +0,0 @@
-prelude: |
- # Disable GC to see raw throughput:
- GC.disable
-benchmark:
- vm2_fiber_allocate: |
- fiber = Fiber.new{Fiber.yield}
- fiber.resume
-loop_count: 100000
diff --git a/benchmark/vm2_fiber_count.yml b/benchmark/vm2_fiber_count.yml
deleted file mode 100644
index 3ecf6bdcb2..0000000000
--- a/benchmark/vm2_fiber_count.yml
+++ /dev/null
@@ -1,10 +0,0 @@
-# On Linux, you will need to increase the maximum number of memory maps:
-# sudo sysctl -w vm.max_map_count=200000
-prelude: |
- fibers = []
-benchmark:
- vm2_fiber_count: |
- fiber = Fiber.new{Fiber.yield}
- fibers << fiber
- fiber.resume
-loop_count: 100000
diff --git a/benchmark/vm2_fiber_reuse.yml b/benchmark/vm2_fiber_reuse.yml
deleted file mode 100644
index 0170650638..0000000000
--- a/benchmark/vm2_fiber_reuse.yml
+++ /dev/null
@@ -1,14 +0,0 @@
-prelude: |
- GC.disable
- fibers = []
-benchmark:
- vm2_fiber_reuse: |
- 1024.times do
- fiber = Fiber.new{Fiber.yield}
- fibers << fiber
- fiber.resume
- end
-
- fibers.clear
- GC.start
-loop_count: 200
diff --git a/benchmark/vm2_fiber_reuse_gc.yml b/benchmark/vm2_fiber_reuse_gc.yml
deleted file mode 100644
index 8fb91a84eb..0000000000
--- a/benchmark/vm2_fiber_reuse_gc.yml
+++ /dev/null
@@ -1,12 +0,0 @@
-# https://bugs.ruby-lang.org/issues/16009
-prelude: |
- fibers = []
-benchmark:
- vm2_fiber_reuse_gc: |
- 2000.times do
- fiber = Fiber.new{Fiber.yield}
- fibers << fiber
- fiber.resume
- end
- fibers.clear
-loop_count: 100
diff --git a/benchmark/vm2_fiber_switch.yml b/benchmark/vm2_fiber_switch.yml
deleted file mode 100644
index fbf7283c29..0000000000
--- a/benchmark/vm2_fiber_switch.yml
+++ /dev/null
@@ -1,9 +0,0 @@
-prelude: |
- # based on benchmark for [ruby-core:65518] [Feature #10341] by Knut Franke
- fib = Fiber.new do
- loop { Fiber.yield }
- end
-benchmark:
- vm2_fiber_switch: |
- fib.resume
-loop_count: 20000000
diff --git a/benchmark/vm2_freezestring.yml b/benchmark/vm2_freezestring.yml
deleted file mode 100644
index b78af91a20..0000000000
--- a/benchmark/vm2_freezestring.yml
+++ /dev/null
@@ -1,10 +0,0 @@
-prelude: |
- class String
- def freeze
- -self
- end
- end
-benchmark:
- vm2_freezestring: |
- "tXnL1BP5T1WPXMjuFNLQtallEtRcay1t2lHtJSrlVsDgvunlbtfpr/DGdH0NGYE9".freeze
-loop_count: 6000000
diff --git a/benchmark/vm2_method.yml b/benchmark/vm2_method.yml
deleted file mode 100644
index cc7b9b28ff..0000000000
--- a/benchmark/vm2_method.yml
+++ /dev/null
@@ -1,8 +0,0 @@
-prelude: |
- def m
- nil
- end
-benchmark:
- vm2_method: |
- m; m; m; m; m; m; m; m;
-loop_count: 6000000
diff --git a/benchmark/vm2_method_missing.yml b/benchmark/vm2_method_missing.yml
deleted file mode 100644
index cbfb794b25..0000000000
--- a/benchmark/vm2_method_missing.yml
+++ /dev/null
@@ -1,11 +0,0 @@
-prelude: |
- class C
- def method_missing mid
- end
- end
-
- obj = C.new
-benchmark:
- vm2_method_missing: |
- obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m;
-loop_count: 6000000
diff --git a/benchmark/vm2_method_with_block.yml b/benchmark/vm2_method_with_block.yml
deleted file mode 100644
index 6e522adccc..0000000000
--- a/benchmark/vm2_method_with_block.yml
+++ /dev/null
@@ -1,8 +0,0 @@
-prelude: |
- def m
- nil
- end
-benchmark:
- vm2_method_with_block: |
- m{}; m{}; m{}; m{}; m{}; m{}; m{}; m{};
-loop_count: 6000000
diff --git a/benchmark/vm2_module_ann_const_set.yml b/benchmark/vm2_module_ann_const_set.yml
deleted file mode 100644
index b0becd9d3d..0000000000
--- a/benchmark/vm2_module_ann_const_set.yml
+++ /dev/null
@@ -1,4 +0,0 @@
-benchmark:
- vm2_module_ann_const_set: |
- Module.new.const_set(:X, Module.new)
-loop_count: 6000000
diff --git a/benchmark/vm2_module_const_set.yml b/benchmark/vm2_module_const_set.yml
deleted file mode 100644
index 05a640069c..0000000000
--- a/benchmark/vm2_module_const_set.yml
+++ /dev/null
@@ -1,8 +0,0 @@
-prelude: |
- module M
- end
- $VERBOSE = nil
-benchmark:
- vm2_module_const_set: |
- M.const_set(:X, Module.new)
-loop_count: 6000000
diff --git a/benchmark/vm2_mutex.yml b/benchmark/vm2_mutex.yml
deleted file mode 100644
index c40a90444a..0000000000
--- a/benchmark/vm2_mutex.yml
+++ /dev/null
@@ -1,8 +0,0 @@
-prelude: |
- require 'thread'
-
- m = Thread::Mutex.new
-benchmark:
- vm2_mutex: |
- m.synchronize{}
-loop_count: 6000000
diff --git a/benchmark/vm2_newlambda.yml b/benchmark/vm2_newlambda.yml
deleted file mode 100644
index 93133f9f30..0000000000
--- a/benchmark/vm2_newlambda.yml
+++ /dev/null
@@ -1,4 +0,0 @@
-benchmark:
- vm2_newlambda: |
- lambda {}
-loop_count: 6000000
diff --git a/benchmark/vm2_poly_method.yml b/benchmark/vm2_poly_method.yml
deleted file mode 100644
index 0104bdfb66..0000000000
--- a/benchmark/vm2_poly_method.yml
+++ /dev/null
@@ -1,24 +0,0 @@
-# loop_count is not utilized since `i` is involved in the script
-benchmark:
- vm2_poly_method: |
- class C1
- def m
- 1
- end
- end
- class C2
- def m
- 2
- end
- end
-
- o1 = C1.new
- o2 = C2.new
-
- i = 0
- while i<6_000_000
- o = (i % 2 == 0) ? o1 : o2
- o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
- i += 1
- end
-loop_count: 1
diff --git a/benchmark/vm2_poly_method_ov.yml b/benchmark/vm2_poly_method_ov.yml
deleted file mode 100644
index 3748073ba2..0000000000
--- a/benchmark/vm2_poly_method_ov.yml
+++ /dev/null
@@ -1,24 +0,0 @@
-# loop_count is not utilized since `i` is involved in the script
-benchmark:
- vm2_poly_method_ov: |
- class C1
- def m
- 1
- end
- end
- class C2
- def m
- 2
- end
- end
-
- o1 = C1.new
- o2 = C2.new
-
- i = 0
- while i<6_000_000
- o = (i % 2 == 0) ? o1 : o2
- # o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
- i += 1
- end
-loop_count: 1
diff --git a/benchmark/vm2_poly_same_method.yml b/benchmark/vm2_poly_same_method.yml
deleted file mode 100644
index 867c433cf8..0000000000
--- a/benchmark/vm2_poly_same_method.yml
+++ /dev/null
@@ -1,25 +0,0 @@
-prelude: |
- module AR; end
- class AR::Base
- def create_or_update
- nil
- end
- def save
- create_or_update
- end
- end
- class Foo < AR::Base; end
- class Bar < AR::Base; end
- o1 = Foo.new
- o2 = Bar.new
-benchmark:
- vm2_poly_same_method: |
- o1.save; o2.save;
- o1.save; o2.save;
- o1.save; o2.save;
- o1.save; o2.save;
- o1.save; o2.save;
- o1.save; o2.save;
- o1.save; o2.save;
- o1.save; o2.save;
-loop_count: 6000000
diff --git a/benchmark/vm2_poly_singleton.yml b/benchmark/vm2_poly_singleton.yml
deleted file mode 100644
index e58d7bfb37..0000000000
--- a/benchmark/vm2_poly_singleton.yml
+++ /dev/null
@@ -1,18 +0,0 @@
-# loop_count is not utilized since `i` is involved in the script
-benchmark:
- vm2_poly_singleton: |
- class C1
- def m; 1; end
- end
-
- o1 = C1.new
- o2 = C1.new
- o2.singleton_class
-
- i = 0
- while i<6_000_000 # benchmark loop 2
- o = (i % 2 == 0) ? o1 : o2
- o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
- i += 1
- end
-loop_count: 1
diff --git a/benchmark/vm2_proc.yml b/benchmark/vm2_proc.yml
deleted file mode 100644
index 5c36e936d9..0000000000
--- a/benchmark/vm2_proc.yml
+++ /dev/null
@@ -1,12 +0,0 @@
-prelude: |
- def m &b
- b
- end
-
- pr = m{
- a = 1
- }
-benchmark:
- vm2_proc: |
- pr.call
-loop_count: 6000000
diff --git a/benchmark/vm2_raise1.yml b/benchmark/vm2_raise1.yml
deleted file mode 100644
index f6eb308968..0000000000
--- a/benchmark/vm2_raise1.yml
+++ /dev/null
@@ -1,16 +0,0 @@
-prelude: |
- def rec n
- if n > 0
- rec n-1
- else
- raise
- end
- end
-benchmark:
- vm2_raise1: |
- begin
- rec 1
- rescue
- # ignore
- end
-loop_count: 6000000
diff --git a/benchmark/vm2_raise2.yml b/benchmark/vm2_raise2.yml
deleted file mode 100644
index 7d51b1b314..0000000000
--- a/benchmark/vm2_raise2.yml
+++ /dev/null
@@ -1,16 +0,0 @@
-prelude: |
- def rec n
- if n > 0
- rec n-1
- else
- raise
- end
- end
-benchmark:
- vm2_raise2: |
- begin
- rec 10
- rescue
- # ignore
- end
-loop_count: 6000000
diff --git a/benchmark/vm2_regexp.yml b/benchmark/vm2_regexp.yml
deleted file mode 100644