4414 files changed, 1802116 insertions, 28294 deletions

diff --git a/.document b/.document
new file mode 100644
index 0000000000..fb27ba325d
--- /dev/null
+++ b/.document
@@ -0,0 +1,26 @@
+# This file determines which files in the
+# Ruby hierarchy will be processed by the RDoc
+# tool when it is given the top-level directory
+# as an argument
+
+# Process all the C source files
+*.c
+
+# prelude
+prelude.rb
+
+# the lib/ directory (which has its own .document file)
+lib
+
+# and some of the ext/ directory (which has its own .document file)
+ext
+
+# rdoc files
+ChangeLog
+
+NEWS
+
+README.md
+README.ja.md
+
+doc
diff --git a/.editorconfig b/.editorconfig
new file mode 100644
index 0000000000..67abf4b978
--- /dev/null
+++ b/.editorconfig
@@ -0,0 +1,16 @@
+root = true
+
+[*]
+end_of_line = lf
+insert_final_newline = true
+trim_trailing_whitespace = true
+tab_width = 8
+indent_style = tab
+indent_size = 4
+
+[**.bat]
+end_of_line = crlf
+
+[**.rb]
+indent_style = space
+indent_size = 2
diff --git a/.gdbinit b/.gdbinit
new file mode 100644
index 0000000000..03c2b653cb
--- /dev/null
+++ b/.gdbinit
@@ -0,0 +1,966 @@
+define hook-run
+  set $color_type = 0
+  set $color_highlite = 0
+  set $color_end = 0
+end
+
+define ruby_gdb_init
+  if !$color_type
+    set $color_type = "\033[31m"
+  end
+  if !$color_highlite
+    set $color_highlite = "\033[36m"
+  end
+  if !$color_end
+    set $color_end = "\033[m"
+  end
+  if ruby_dummy_gdb_enums.special_consts
+  end
+end
+
+# set prompt \033[36m(gdb)\033[m\040
+
+define rp
+  ruby_gdb_init
+  if (VALUE)($arg0) & RUBY_FIXNUM_FLAG
+    printf "FIXNUM: %ld\n", (long)($arg0) >> 1
+  else
+  if ((VALUE)($arg0) & ~(~(VALUE)0<<RUBY_SPECIAL_SHIFT)) == RUBY_SYMBOL_FLAG
+    set $id = (($arg0) >> RUBY_SPECIAL_SHIFT)
+    printf "%sSYMBOL%s: ", $color_type, $color_end
+    rp_id $id
+  else
+  if ($arg0) == RUBY_Qfalse
+    echo false\n
+  else
+  if ($arg0) == RUBY_Qtrue
+    echo true\n
+  else
+  if ($arg0) == RUBY_Qnil
+    echo nil\n
+  else
+  if ($arg0) == RUBY_Qundef
+    echo undef\n
+  else
+  if (VALUE)($arg0) & RUBY_IMMEDIATE_MASK
+    if ((VALUE)($arg0) & RUBY_FLONUM_MASK) == RUBY_FLONUM_FLAG
+      printf "%sFLONUM%s: %g\n", $color_type, $color_end, (double)rb_float_value($arg0)
+    else
+      echo immediate\n
+    end
+  else
+  set $flags = ((struct RBasic*)($arg0))->flags
+  if ($flags & RUBY_FL_PROMOTED) == RUBY_FL_PROMOTED
+    printf "[PROMOTED] "
+  end
+  if ($flags & RUBY_T_MASK) == RUBY_T_NONE
+    printf "%sT_NONE%s: ", $color_type, $color_end
+    print (struct RBasic *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_NIL
+    printf "%sT_NIL%s: ", $color_type, $color_end
+    print (struct RBasic *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_OBJECT
+    printf "%sT_OBJECT%s: ", $color_type, $color_end
+    print (struct RObject *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_CLASS
+    printf "%sT_CLASS%s%s: ", $color_type, ($flags & RUBY_FL_SINGLETON) ? "*" : "", $color_end
+    rp_class $arg0
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_ICLASS
+    printf "%sT_ICLASS%s: ", $color_type, $color_end
+    rp_class $arg0
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_MODULE
+    printf "%sT_MODULE%s: ", $color_type, $color_end
+    rp_class $arg0
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_FLOAT
+    printf "%sT_FLOAT%s: %.16g ", $color_type, $color_end, (((struct RFloat*)($arg0))->float_value)
+    print (struct RFloat *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_STRING
+    printf "%sT_STRING%s: ", $color_type, $color_end
+    rp_string $arg0 $flags
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_REGEXP
+    set $regsrc = ((struct RRegexp*)($arg0))->src
+    set $rsflags = ((struct RBasic*)$regsrc)->flags
+    printf "%sT_REGEXP%s: ", $color_type, $color_end
+    set print address off
+    output (char *)(($rsflags & RUBY_FL_USER1) ? \
+	    ((struct RString*)$regsrc)->as.heap.ptr : \
+	    ((struct RString*)$regsrc)->as.ary)
+    set print address on
+    printf " len:%ld ", ($rsflags & RUBY_FL_USER1) ? \
+            ((struct RString*)$regsrc)->as.heap.len : \
+            (($rsflags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
+    if $flags & RUBY_FL_USER6
+      printf "(none) "
+    end
+    if $flags & RUBY_FL_USER5
+      printf "(literal) "
+    end
+    if $flags & RUBY_FL_USER4
+      printf "(fixed) "
+    end
+    printf "encoding:%d ", ($flags & RUBY_ENCODING_MASK) >> RUBY_ENCODING_SHIFT
+    print (struct RRegexp *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_ARRAY
+    if ($flags & RUBY_FL_USER1)
+      set $len = (($flags & (RUBY_FL_USER3|RUBY_FL_USER4)) >> (RUBY_FL_USHIFT+3))
+      printf "%sT_ARRAY%s: len=%ld ", $color_type, $color_end, $len
+      printf "(embed) "
+      if ($len == 0)
+	printf "{(empty)} "
+      else
+	output/x *((VALUE*)((struct RArray*)($arg0))->as.ary) @ $len
+	printf " "
+      end
+    else
+      set $len = ((struct RArray*)($arg0))->as.heap.len
+      printf "%sT_ARRAY%s: len=%ld ", $color_type, $color_end, $len
+      if ($flags & RUBY_FL_USER2)
+	printf "(shared) shared="
+	output/x ((struct RArray*)($arg0))->as.heap.aux.shared
+	printf " "
+      else
+	printf "(ownership) capa=%ld ", ((struct RArray*)($arg0))->as.heap.aux.capa
+      end
+      if ($len == 0)
+	printf "{(empty)} "
+      else
+	output/x *((VALUE*)((struct RArray*)($arg0))->as.heap.ptr) @ $len
+	printf " "
+      end
+    end
+    print (struct RArray *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_FIXNUM
+    printf "%sT_FIXNUM%s: ", $color_type, $color_end
+    print (struct RBasic *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_HASH
+    printf "%sT_HASH%s: ", $color_type, $color_end,
+    if ((struct RHash *)($arg0))->ntbl
+      printf "len=%ld ", ((struct RHash *)($arg0))->ntbl->num_entries
+    end
+    print (struct RHash *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_STRUCT
+    printf "%sT_STRUCT%s: len=%ld ", $color_type, $color_end, \
+      (($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
+       ($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) >> (RUBY_FL_USHIFT+1) : \
+       ((struct RStruct *)($arg0))->as.heap.len)
+    print (struct RStruct *)($arg0)
+    x/xw (($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
+          ((struct RStruct *)($arg0))->as.ary : \
+          ((struct RStruct *)($arg0))->as.heap.ptr)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_BIGNUM
+    printf "%sT_BIGNUM%s: sign=%d len=%ld ", $color_type, $color_end, \
+      (($flags & RUBY_FL_USER1) != 0), \
+      (($flags & RUBY_FL_USER2) ? \
+       ($flags & (RUBY_FL_USER5|RUBY_FL_USER4|RUBY_FL_USER3)) >> (RUBY_FL_USHIFT+3) : \
+       ((struct RBignum*)($arg0))->as.heap.len)
+    if $flags & RUBY_FL_USER2
+      printf "(embed) "
+    end
+    print (struct RBignum *)($arg0)
+    x/xw (($flags & RUBY_FL_USER2) ? \
+          ((struct RBignum*)($arg0))->as.ary : \
+          ((struct RBignum*)($arg0))->as.heap.digits)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_RATIONAL
+    printf "%sT_RATIONAL%s: ", $color_type, $color_end
+    print (struct RRational *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_COMPLEX
+    printf "%sT_COMPLEX%s: ", $color_type, $color_end
+    print (struct RComplex *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_FILE
+    printf "%sT_FILE%s: ", $color_type, $color_end
+    print (struct RFile *)($arg0)
+    output *((struct RFile *)($arg0))->fptr
+    printf "\n"
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_TRUE
+    printf "%sT_TRUE%s: ", $color_type, $color_end
+    print (struct RBasic *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_FALSE
+    printf "%sT_FALSE%s: ", $color_type, $color_end
+    print (struct RBasic *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_DATA
+    if ((struct RTypedData *)($arg0))->typed_flag == 1
+      printf "%sT_DATA%s(%s): ", $color_type, $color_end, ((struct RTypedData *)($arg0))->type->wrap_struct_name
+      print (struct RTypedData *)($arg0)
+    else
+      printf "%sT_DATA%s: ", $color_type, $color_end
+      print (struct RData *)($arg0)
+    end
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_MATCH
+    printf "%sT_MATCH%s: ", $color_type, $color_end
+    print (struct RMatch *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_SYMBOL
+    printf "%sT_SYMBOL%s: ", $color_type, $color_end
+    print (struct RSymbol *)($arg0)
+    set $id_type = ((struct RSymbol *)($arg0))->id & RUBY_ID_SCOPE_MASK
+    if $id_type == RUBY_ID_LOCAL
+      printf "l"
+    else
+    if $id_type == RUBY_ID_INSTANCE
+      printf "i"
+    else
+    if $id_type == RUBY_ID_GLOBAL
+      printf "G"
+    else
+    if $id_type == RUBY_ID_ATTRSET
+      printf "a"
+    else
+    if $id_type == RUBY_ID_CONST
+      printf "C"
+    else
+    if $id_type == RUBY_ID_CLASS
+      printf "c"
+    else
+      printf "j"
+    end
+    end
+    end
+    end
+    end
+    end
+    set $id_fstr = ((struct RSymbol *)($arg0))->fstr
+    rp_string $id_fstr
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_UNDEF
+    printf "%sT_UNDEF%s: ", $color_type, $color_end
+    print (struct RBasic *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_IMEMO
+    printf "%sT_IMEMO%s(", $color_type, $color_end
+    output (enum imemo_type)(($flags>>RUBY_FL_USHIFT)&imemo_mask)
+    printf "): "
+    rp_imemo $arg0
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_NODE
+    printf "%sT_NODE%s(", $color_type, $color_end
+    output (enum node_type)(($flags&RUBY_NODE_TYPEMASK)>>RUBY_NODE_TYPESHIFT)
+    printf "): "
+    print *(NODE *)($arg0)
+  else
+  if ($flags & RUBY_T_MASK) == RUBY_T_ZOMBIE
+    printf "%sT_ZOMBIE%s: ", $color_type, $color_end
+    print (struct RData *)($arg0)
+  else
+    printf "%sunknown%s: ", $color_type, $color_end
+    print (struct RBasic *)($arg0)
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+end
+document rp
+  Print a Ruby's VALUE.
+end
+
+define rp_id
+  set $id = (ID)$arg0
+  if $id == '!' || $id == '+' || $id == '-' || $id == '*' || $id == '/' || $id == '%' || $id == '<' || $id == '>' || $id == '`'
+    printf "(:%c)\n", $id
+  else
+  if $id == idDot2
+    printf "(:..)\n"
+  else
+  if $id == idDot3
+    printf "(:...)\n"
+  else
+  if $id == idUPlus
+    printf "(:+@)\n"
+  else
+  if $id == idUMinus
+    printf "(:-@)\n"
+  else
+  if $id == idPow
+    printf "(:**)\n"
+  else
+  if $id == idCmp
+    printf "(:<=>)\n"
+  else
+  if $id == idLTLT
+    printf "(:<<)\n"
+  else
+  if $id == idLE
+    printf "(:<=)\n"
+  else
+  if $id == idGE
+    printf "(:>=)\n"
+  else
+  if $id == idEq
+    printf "(:==)\n"
+  else
+  if $id == idEqq
+    printf "(:===)\n"
+  else
+  if $id == idNeq
+    printf "(:!=)\n"
+  else
+  if $id == idEqTilde
+    printf "(:=~)\n"
+  else
+  if $id == idNeqTilde
+    printf "(:!~)\n"
+  else
+  if $id == idAREF
+    printf "(:[])\n"
+  else
+  if $id == idASET
+    printf "(:[]=)\n"
+  else
+    if $id <= tLAST_OP_ID
+      printf "O"
+    else
+      set $id_type = $id & RUBY_ID_SCOPE_MASK
+      if $id_type == RUBY_ID_LOCAL
+        printf "l"
+      else
+      if $id_type == RUBY_ID_INSTANCE
+        printf "i"
+      else
+      if $id_type == RUBY_ID_GLOBAL
+        printf "G"
+      else
+      if $id_type == RUBY_ID_ATTRSET
+        printf "a"
+      else
+      if $id_type == RUBY_ID_CONST
+        printf "C"
+      else
+      if $id_type == RUBY_ID_CLASS
+        printf "c"
+      else
+        printf "j"
+      end
+      end
+      end
+      end
+      end
+      end
+    end
+    printf "(%ld): ", $id
+    set $str = lookup_id_str($id)
+    if $str
+      rp_string $str
+    else
+      echo undef\n
+    end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+  end
+end
+document rp_id
+  Print an ID.
+end
+
+define rp_string
+  set $flags = ((struct RBasic*)($arg0))->flags
+  set print address off
+  output (char *)(($flags & RUBY_FL_USER1) ? \
+	    ((struct RString*)($arg0))->as.heap.ptr : \
+	    ((struct RString*)($arg0))->as.ary)
+  set print address on
+  printf " bytesize:%ld ", ($flags & RUBY_FL_USER1) ? \
+          ((struct RString*)($arg0))->as.heap.len : \
+          (($flags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
+  if !($flags & RUBY_FL_USER1)
+    printf "(embed) "
+  else
+    if ($flags & RUBY_FL_USER2)
+      printf "(shared) "
+    end
+    if ($flags & RUBY_FL_USER3)
+      printf "(assoc) "
+    end
+  end
+  printf "encoding:%d ", ($flags & RUBY_ENCODING_MASK) >> RUBY_ENCODING_SHIFT
+  if ($flags & RUBY_ENC_CODERANGE_MASK) == 0
+    printf "coderange:unknown "
+  else
+  if ($flags & RUBY_ENC_CODERANGE_MASK) == RUBY_ENC_CODERANGE_7BIT
+    printf "coderange:7bit "
+  else
+  if ($flags & RUBY_ENC_CODERANGE_MASK) == RUBY_ENC_CODERANGE_VALID
+    printf "coderange:valid "
+  else
+    printf "coderange:broken "
+  end
+  end
+  end
+  print (struct RString *)($arg0)
+end
+document rp_string
+  Print the content of a String.
+end
+
+define rp_class
+  printf "(struct RClass *) %p", (void*)$arg0
+  if ((struct RClass *)($arg0))->ptr.origin_ != $arg0
+    printf " -> %p", ((struct RClass *)($arg0))->ptr.origin_
+  end
+  printf "\n"
+  rb_classname $arg0
+  print *(struct RClass *)($arg0)
+  print *((struct RClass *)($arg0))->ptr
+end
+document rp_class
+  Print the content of a Class/Module.
+end
+
+define rp_imemo
+  set $flags = (((struct RBasic *)($arg0))->flags >> RUBY_FL_USHIFT) & imemo_mask
+  if $flags == imemo_cref
+    printf "(rb_cref_t *) %p\n", (void*)$arg0
+    print *(rb_cref_t *)$arg0
+  else
+  if $flags == imemo_svar
+    printf "(struct vm_svar *) %p\n", (void*)$arg0
+    print *(struct vm_svar *)$arg0
+  else
+  if $flags == imemo_throw_data
+    printf "(struct vm_throw_data *) %p\n", (void*)$arg0
+    print *(struct vm_throw_data *)$arg0
+  else
+  if $flags == imemo_ifunc
+    printf "(struct vm_ifunc *) %p\n", (void*)$arg0
+    print *(struct vm_ifunc *)$arg0
+  else
+  if $flags == imemo_memo
+    printf "(struct MEMO *) %p\n", (void*)$arg0
+    print *(struct MEMO *)$arg0
+  else
+    printf "(struct RIMemo *) %p\n", (void*)$arg0
+    print *(struct RIMemo *)$arg0
+  end
+  end
+  end
+  end
+  end
+end
+document rp_imemo
+  Print the content of a memo
+end
+
+define nd_type
+  print (enum node_type)((((NODE*)($arg0))->flags&RUBY_NODE_TYPEMASK)>>RUBY_NODE_TYPESHIFT)
+end
+document nd_type
+  Print a Ruby' node type.
+end
+
+define nd_file
+  print ((NODE*)($arg0))->nd_file
+end
+document nd_file
+  Print the source file name of a node.
+end
+
+define nd_line
+  print ((unsigned int)((((NODE*)($arg0))->flags>>RUBY_NODE_LSHIFT)&RUBY_NODE_LMASK))
+end
+document nd_line
+  Print the source line number of a node.
+end
+
+# Print members of ruby node.
+
+define nd_head
+  printf "%su1.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u1.node
+end
+
+define nd_alen
+  printf "%su2.argc%s: ", $color_highlite, $color_end
+  p ($arg0).u2.argc
+end
+
+define nd_next
+  printf "%su3.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u3.node
+end
+
+
+define nd_cond
+  printf "%su1.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u1.node
+end
+
+define nd_body
+  printf "%su2.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u2.node
+end
+
+define nd_else
+  printf "%su3.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u3.node
+end
+
+
+define nd_orig
+  printf "%su3.value%s: ", $color_highlite, $color_end
+  rp ($arg0).u3.value
+end
+
+
+define nd_resq
+  printf "%su2.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u2.node
+end
+
+define nd_ensr
+  printf "%su3.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u3.node
+end
+
+
+define nd_1st
+  printf "%su1.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u1.node
+end
+
+define nd_2nd
+  printf "%su2.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u2.node
+end
+
+
+define nd_stts
+  printf "%su1.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u1.node
+end
+
+
+define nd_entry
+  printf "%su3.entry%s: ", $color_highlite, $color_end
+  p ($arg0).u3.entry
+end
+
+define nd_vid
+  printf "%su1.id%s: ", $color_highlite, $color_end
+  p ($arg0).u1.id
+end
+
+define nd_cflag
+  printf "%su2.id%s: ", $color_highlite, $color_end
+  p ($arg0).u2.id
+end
+
+define nd_cval
+  printf "%su3.value%s: ", $color_highlite, $color_end
+  rp ($arg0).u3.value
+end
+
+
+define nd_cnt
+  printf "%su3.cnt%s: ", $color_highlite, $color_end
+  p ($arg0).u3.cnt
+end
+
+define nd_tbl
+  printf "%su1.tbl%s: ", $color_highlite, $color_end
+  p ($arg0).u1.tbl
+end
+
+
+define nd_var
+  printf "%su1.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u1.node
+end
+
+define nd_ibdy
+  printf "%su2.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u2.node
+end
+
+define nd_iter
+  printf "%su3.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u3.node
+end
+
+
+define nd_value
+  printf "%su2.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u2.node
+end
+
+define nd_aid
+  printf "%su3.id%s: ", $color_highlite, $color_end
+  p ($arg0).u3.id
+end
+
+
+define nd_lit
+  printf "%su1.value%s: ", $color_highlite, $color_end
+  rp ($arg0).u1.value
+end
+
+
+define nd_frml
+  printf "%su1.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u1.node
+end
+
+define nd_rest
+  printf "%su2.argc%s: ", $color_highlite, $color_end
+  p ($arg0).u2.argc
+end
+
+define nd_opt
+  printf "%su1.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u1.node
+end
+
+
+define nd_recv
+  printf "%su1.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u1.node
+end
+
+define nd_mid
+  printf "%su2.id%s: ", $color_highlite, $color_end
+  p ($arg0).u2.id
+end
+
+define nd_args
+  printf "%su3.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u3.node
+end
+
+
+define nd_noex
+  printf "%su1.id%s: ", $color_highlite, $color_end
+  p ($arg0).u1.id
+end
+
+define nd_defn
+  printf "%su3.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u3.node
+end
+
+
+define nd_old
+  printf "%su1.id%s: ", $color_highlite, $color_end
+  p ($arg0).u1.id
+end
+
+define nd_new
+  printf "%su2.id%s: ", $color_highlite, $color_end
+  p ($arg0).u2.id
+end
+
+
+define nd_cfnc
+  printf "%su1.cfunc%s: ", $color_highlite, $color_end
+  p ($arg0).u1.cfunc
+end
+
+define nd_argc
+  printf "%su2.argc%s: ", $color_highlite, $color_end
+  p ($arg0).u2.argc
+end
+
+
+define nd_cname
+  printf "%su1.id%s: ", $color_highlite, $color_end
+  p ($arg0).u1.id
+end
+
+define nd_super
+  printf "%su3.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u3.node
+end
+
+
+define nd_modl
+  printf "%su1.id%s: ", $color_highlite, $color_end
+  p ($arg0).u1.id
+end
+
+define nd_clss
+  printf "%su1.value%s: ", $color_highlite, $color_end
+  rp ($arg0).u1.value
+end
+
+
+define nd_beg
+  printf "%su1.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u1.node
+end
+
+define nd_end
+  printf "%su2.node%s: ", $color_highlite, $color_end
+  rp ($arg0).u2.node
+end
+
+define nd_state
+  printf "%su3.state%s: ", $color_highlite, $color_end
+  p ($arg0).u3.state
+end
+
+define nd_rval
+  printf "%su2.value%s: ", $color_highlite, $color_end
+  rp ($arg0).u2.value
+end
+
+
+define nd_nth
+  printf "%su2.argc%s: ", $color_highlite, $color_end
+  p ($arg0).u2.argc
+end
+
+
+define nd_tag
+  printf "%su1.id%s: ", $color_highlite, $color_end
+  p ($arg0).u1.id
+end
+
+define nd_tval
+  printf "%su2.value%s: ", $color_highlite, $color_end
+  rp ($arg0).u2.value
+end
+
+define nd_tree
+  set $buf = (struct RString *)rb_str_buf_new(0)
+  call dump_node((VALUE)($buf), rb_str_new(0, 0), 0, ($arg0))
+  printf "%s\n", $buf->as.heap.ptr
+end
+
+define rb_p
+  call rb_p($arg0)
+end
+
+define rb_numtable_entry
+  set $rb_numtable_tbl = $arg0
+  set $rb_numtable_id = (st_data_t)$arg1
+  set $rb_numtable_key = 0
+  set $rb_numtable_rec = 0
+  if $rb_numtable_tbl->entries_packed
+    set $rb_numtable_p = $rb_numtable_tbl->as.packed.bins
+    while $rb_numtable_p && $rb_numtable_p < $rb_numtable_tbl->as.packed.bins+$rb_numtable_tbl->num_entries
+      if $rb_numtable_p.k == $rb_numtable_id
+	set $rb_numtable_key = $rb_numtable_p.k
+	set $rb_numtable_rec = $rb_numtable_p.v
+	set $rb_numtable_p = 0
+      else
+	set $rb_numtable_p = $rb_numtable_p + 1
+      end
+    end
+  else
+    set $rb_numtable_p = $rb_numtable_tbl->as.big.bins[st_numhash($rb_numtable_id) % $rb_numtable_tbl->num_bins]
+    while $rb_numtable_p
+      if $rb_numtable_p->key == $rb_numtable_id
+	set $rb_numtable_key = $rb_numtable_p->key
+	set $rb_numtable_rec = $rb_numtable_p->record
+	set $rb_numtable_p = 0
+      else
+	set $rb_numtable_p = $rb_numtable_p->next
+      end
+    end
+  end
+end
+
+define rb_id2name
+  ruby_gdb_init
+  printf "%sID%s: ", $color_type, $color_end
+  rp_id $arg0
+end
+document rb_id2name
+  Print the name of id
+end
+
+define rb_method_entry
+  set $rb_method_entry_klass = (struct RClass *)$arg0
+  set $rb_method_entry_id = (ID)$arg1
+  set $rb_method_entry_me = (rb_method_entry_t *)0
+  while !$rb_method_entry_me && $rb_method_entry_klass
+    rb_numtable_entry $rb_method_entry_klass->m_tbl_wrapper->tbl $rb_method_entry_id
+    set $rb_method_entry_me = (rb_method_entry_t *)$rb_numtable_rec
+    if !$rb_method_entry_me
+      set $rb_method_entry_klass = (struct RClass *)RCLASS_SUPER($rb_method_entry_klass)
+    end
+  end
+  if $rb_method_entry_me
+    print *$rb_method_entry_klass
+    print *$rb_method_entry_me
+  else
+    echo method not found\n
+  end
+end
+document rb_method_entry
+  Search method entry by class and id
+end
+
+define rb_classname
+  # up to 128bit int
+  set $rb_classname_permanent = "0123456789ABCDEF"
+  set $rb_classname = classname($arg0, $rb_classname_permanent)
+  if $rb_classname != RUBY_Qnil
+    rp $rb_classname
+  else
+    echo anonymous class/module\n
+  end
+end
+
+define rb_ancestors
+  set $rb_ancestors_module = $arg0
+  while $rb_ancestors_module
+    rp_class $rb_ancestors_module
+    set $rb_ancestors_module = RCLASS_SUPER($rb_ancestors_module)
+  end
+end
+document rb_ancestors
+  Print ancestors.
+end
+
+define rb_backtrace
+  call rb_backtrace()
+end
+
+define iseq
+  if ruby_dummy_gdb_enums.special_consts
+  end
+  if ($arg0)->type == ISEQ_ELEMENT_NONE
+    echo [none]\n
+  end
+  if ($arg0)->type == ISEQ_ELEMENT_LABEL
+    print *(LABEL*)($arg0)
+  end
+  if ($arg0)->type == ISEQ_ELEMENT_INSN
+    print *(INSN*)($arg0)
+    if ((INSN*)($arg0))->insn_id != YARVINSN_jump
+      set $i = 0
+      set $operand_size = ((INSN*)($arg0))->operand_size
+      set $operands = ((INSN*)($arg0))->operands
+      while $i < $operand_size
+	rp $operands[$i++]
+      end
+    end
+  end
+  if ($arg0)->type == ISEQ_ELEMENT_ADJUST
+    print *(ADJUST*)($arg0)
+  end
+end
+
+define rb_ps
+  rb_ps_vm ruby_current_vm
+end
+document rb_ps
+Dump all threads and their callstacks
+end
+
+define rb_ps_vm
+  print $ps_vm = (rb_vm_t*)$arg0
+  set $ps_thread_ln = $ps_vm->living_threads.n.next
+  set $ps_thread_ln_last = $ps_vm->living_threads.n.prev
+  while 1
+    set $ps_thread_th = (rb_thread_t *)$ps_thread_ln
+    set $ps_thread = (VALUE)($ps_thread_th->self)
+    rb_ps_thread $ps_thread
+    if $ps_thread_ln == $ps_thread_ln_last
+      loop_break
+    end
+    set $ps_thread_ln = $ps_thread_ln->next
+  end
+end
+document rb_ps_vm
+Dump all threads in a (rb_vm_t*) and their callstacks
+end
+
+define rb_ps_thread
+  set $ps_thread = (struct RTypedData*)$arg0
+  set $ps_thread_th = (rb_thread_t*)$ps_thread->data
+  printf "* #<Thread:%p rb_thread_t:%p native_thread:%p>\n", \
+    $ps_thread, $ps_thread_th, $ps_thread_th->thread_id
+end
+
+# Details: https://bugs.ruby-lang.org/projects/ruby-trunk/wiki/MachineInstructionsTraceWithGDB
+define trace_machine_instructions
+  set logging on
+  set height 0
+  set width 0
+  display/i $pc
+  while !$exit_code
+    info line *$pc
+    si
+  end
+end
+
+define SDR
+  call rb_vmdebug_stack_dump_raw_current()
+end
+
+define rbi
+  if ((LINK_ELEMENT*)$arg0)->type == ISEQ_ELEMENT_LABEL
+    p *(LABEL*)$arg0
+  else
+  if ((LINK_ELEMENT*)$arg0)->type == ISEQ_ELEMENT_INSN
+    p *(INSN*)$arg0
+  else
+  if ((LINK_ELEMENT*)$arg0)->type == ISEQ_ELEMENT_ADJUST
+    p *(ADJUST*)$arg0
+  else
+    print *$arg0
+  end
+  end
+  end
+end
diff --git a/.gitattributes b/.gitattributes
new file mode 100644
index 0000000000..d9785fad00
--- /dev/null
+++ b/.gitattributes
@@ -0,0 +1,5 @@
+*.gemspec diff=ruby
+*.rb diff=ruby
+bin/* diff=ruby
+tool/update-deps diff=ruby
+tool/make-snapshot diff=ruby
diff --git a/.gitignore b/.gitignore
new file mode 100644
index 0000000000..80c12594dd
--- /dev/null
+++ b/.gitignore
@@ -0,0 +1,183 @@
+*-*-*.def
+*-*-*.exp
+*-*-*.lib
+*.a
+*.bak
+*.dSYM
+*.dmyh
+*.dylib
+*.elc
+*.inc
+*.log
+*.o
+*.obj
+*.orig
+*.pdb
+*.rej
+*.sav
+*.swp
+*.yarb
+*~
+.*-*
+.*.list
+.*.time
+.DS_Store
+.ccmalloc
+.ext
+.pc
+.ppack
+.svn
+Makefile
+Makefile.old
+cygruby*.def
+extconf.h
+y.output
+y.tab.c
+
+# /
+/*-fake.rb
+/*.dll
+/*.exe
+/*.res
+/*.pc
+/*.rc
+/*_prelude.c
+/COPYING.LIB
+/ChangeLog-*
+/ChangeLog.pre-alpha
+/ChangeLog.pre1_1
+/Doxyfile
+/GNUmakefile
+/GNUmakefile.old
+/README.atheos
+/README.fat-patch
+/README.v6
+/TAGS
+/archive
+/autom4te*.cache
+/automake
+/beos
+/bmlog-*
+/breakpoints.gdb
+/config.cache
+/config.h
+/config.h.in
+/config.status
+/config.status.lineno
+/configure
+/coverage/simplecov
+/coverage/simplecov-html
+/coverage/doclie
+/coverage/.last_run.json
+/coverage/.resultset.json*
+/coverage/assets
+/coverage/index.html
+/doc/capi
+/enc.mk
+/encdb.h
+/exts.mk
+/goruby
+/id.[ch]
+/largefile.h
+/lex.c
+/libruby*.*
+/miniprelude.c
+/miniruby
+/newdate.rb
+/newline.c
+/newver.rb
+/parse.c
+/parse.h
+/patches
+/patches-master
+/pitest.rb
+/ppack
+/prelude.c
+/preview
+/probes.h
+/rbconfig.rb
+/rename2.h
+/repack
+/revision.h
+/riscos
+/rubicon
+/ruby
+/ruby-runner
+/ruby-runner.c
+/ruby-man.rd.gz
+/sizes.c
+/test.rb
+/tmp
+/transdb.h
+/uncommon.mk
+/verconf.h
+/verconf.mk
+/web
+/yasmdata.rb
+
+# /benchmark/
+/benchmark/bmx_*.rb
+/benchmark/fasta.output.*
+/benchmark/wc.input
+
+/enc/*.def
+/enc/*.exp
+/enc/*.lib
+/enc/unicode/data
+
+# /enc/trans/
+/enc/trans/*.c
+/enc/trans/*.def
+/enc/trans/*.exp
+/enc/trans/*.lib
+/enc/trans/.time
+
+# /ext/
+/ext/extinit.c
+
+# /ext/-test-/win32/dln/
+/ext/-test-/win32/dln/dlntest.exp
+/ext/-test-/win32/dln/dlntest.lib
+
+# /ext/dl/callback/
+/ext/dl/callback/callback-*.c
+/ext/dl/callback/callback.c
+
+# /ext/etc/
+/ext/etc/constdefs.h
+
+# /ext/fiddle/
+/ext/fiddle/libffi-*
+
+# /ext/rbconfig/
+/ext/rbconfig/sizeof/sizes.c
+
+# /ext/ripper/
+/ext/ripper/eventids1.c
+/ext/ripper/eventids2table.c
+/ext/ripper/ripper.*
+/ext/ripper/ids1
+/ext/ripper/ids2
+
+# /ext/socket/
+/ext/socket/constants.h
+/ext/socket/constdefs.h
+/ext/socket/constdefs.c
+
+# /ext/tk/
+/ext/tk/config_list
+
+# /gems
+/gems/*.gem
+
+# /spec/
+/spec/mspec
+/spec/rubyspec
+
+# /tool/
+/tool/config.guess
+/tool/config.sub
+
+# /win32/
+/win32/*.ico
+/win32/.time
diff --git a/.indent.pro b/.indent.pro
new file mode 100644
index 0000000000..6a207a0554
--- /dev/null
+++ b/.indent.pro
@@ -0,0 +1,21 @@
+-bap
+-nbbb
+-nbc
+-br
+-nbs
+-ncdb
+-ce
+-cli0.5
+-ndj
+-ei
+-nfc1
+-i4
+-l120
+-lp
+-npcs
+-psl
+-sc
+-sob
+
+-TID
+-TVALUE
diff --git a/.travis.yml b/.travis.yml
new file mode 100644
index 0000000000..f87ffd3483
--- /dev/null
+++ b/.travis.yml
@@ -0,0 +1,101 @@
+# Copyright (C) 2011 Urabe, Shyouhei.  All rights reserved.
+#
+# This file is  a part of the programming language  Ruby.  Permission is hereby
+# granted,  to either  redistribute  or  modify this  file,  provided that  the
+# conditions  mentioned in  the file  COPYING are  met.  Consult  the  file for
+# details.
+
+# This is  a Travis-CI  build configuration file.   The list  of configurations
+# available is located in
+#
+#     http://about.travis-ci.org/docs/user/build-configuration/
+#
+# and as Ruby itself is a project written in C language,
+#
+#     http://about.travis-ci.org/docs/user/languages/c/
+#
+# is also a good place to look at.
+
+# Language specification.
+language: c
+sudo: false
+
+# Compilers.  Several  compilers are  provided in Travis,  so we try  them all.
+# The value set here is visible via $CC environment variable.
+compiler:
+  - gcc
+
+os:
+  - linux
+
+# Dependencies.  Some  header files are missing  in a Travis' worker  VM, so we
+# have  to install  them.  The  "1.9.1" here  is OK.   It is  the  most adopted
+# version string  for Debian/Ubuntu, and  no dependencies have been  changed so
+# far since the 1.9.1 release.
+before_install:
+  - "CONFIG_FLAG="
+  - "JOBS='-j 4'"
+
+# Script is where the test runs.  Note  we just do "make test", not other tests
+# like  test-all, test-rubyspec.   This is  because  they take  too much  time,
+# enough for Travis to shut down the VM as being stalled.
+before_script:
+  - "uname -a"
+  - "uname -r"
+  - "rm -fr .ext autom4te.cache"
+  - "echo $TERM"
+  - "make -f common.mk BASERUBY=ruby MAKEDIRS='mkdir -p' srcdir=. update-config_files"
+  - "autoconf"
+  - "mkdir config_1st config_2nd"
+  - "./configure -C --disable-install-doc --with-gcc=$CC $CONFIG_FLAG"
+  - "cp -pr config.status .ext/include config_1st"
+  - "make reconfig"
+  - "cp -pr config.status .ext/include config_2nd"
+  - "diff -ru config_1st config_2nd"
+  - "make after-update BASERUBY=ruby"
+  - "make -s $JOBS"
+  - "make update-rubyspec"
+script:
+  - "make test TESTOPTS=--color=never"
+  - "make test-all TESTOPTS='-q -j3 --color=never --job-status=normal'"
+  - "make test-rubyspec MSPECOPT=-fm"
+
+# Branch matrix.  Not all branches are Travis-ready so we limit branches here.
+branches:
+  only:
+    - trunk
+    - ruby_2_0_0
+    - ruby_2_1
+    - ruby_2_2
+    - ruby_2_3
+
+# We want to be notified when something happens.
+notifications:
+  irc:
+    channels:
+      - "irc.freenode.org#ruby-core"
+      - "irc.freenode.org#ruby-ja"
+    on_success: change # [always|never|change] # default: always
+    on_failure: always # [always|never|change] # default: always
+    template:
+      - "%{message} by @%{author}: See %{build_url}"
+
+  # Update ruby-head installed on Travis CI so other projects can test against it.
+  webhooks:
+    urls:
+      - "https://rubies.travis-ci.org/rebuild/ruby-head"
+    on_success: always
+    on_failure: never
+
+  email:
+    - ko1c-failure@atdot.net
+    - shibata.hiroshi@gmail.com
+
+# Local Variables:
+# mode: YAML
+# coding: utf-8-unix
+# indent-tabs-mode: nil
+# tab-width: 4
+# fill-column: 79
+# default-justification: full
+# End:
diff --git a/BSDL b/BSDL
new file mode 100644
index 0000000000..a009caefea
--- /dev/null
+++ b/BSDL
@@ -0,0 +1,22 @@
+Copyright (C) 1993-2013 Yukihiro Matsumoto. All rights reserved.
+
+Redistribution and use in source and binary forms, with or without
+modification, are permitted provided that the following conditions
+are met:
+1. Redistributions of source code must retain the above copyright
+notice, this list of conditions and the following disclaimer.
+2. Redistributions in binary form must reproduce the above copyright
+notice, this list of conditions and the following disclaimer in the
+documentation and/or other materials provided with the distribution.
+
+THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+SUCH DAMAGE.
diff --git a/C-IF b/C-IF
deleted file mode 100644
index 5c66a20ddc..0000000000
--- a/C-IF
+++ /dev/null
@@ -1,204 +0,0 @@
-.\" C-IF -  -*- Text -*- created at: Tue Oct 12 14:15:00 JST 1993
-
-Ruby-C ¥¤¥ó¥¿¡¼¥Õ¥§¡¼¥¹
-
-·¿
-
- VALUE
-
-   Ruby¥ª¥Ö¥¸¥§¥¯¥È¤òɽ¸½¤¹¤ë·¿. ɬÍפ˱þ¤¸¤Æ¥­¥ã¥¹¥È¤·¤ÆÍѤ¤¤ë. ÁȤß
-   ¹þ¤ß·¿¤òɽ¸½¤¹¤ëC¤Î·¿¤Ïruby.h¤Ëµ­½Ò¤·¤Æ¤¢¤ëR¤Ç»Ï¤Þ¤ë¹½Â¤ÂΤǤ¢¤ë.
-   VALUE·¿¤ò¤³¤ì¤é¤Ë¥­¥ã¥¹¥È¤¹¤ë¤¿¤á¤ËR¤Ç»Ï¤Þ¤ë¹½Â¤ÂÎ̾¤òÁ´¤ÆÂçʸ»ú¤Ë
-   ¤·¤¿Ì¾Á°¤Î¥Þ¥¯¥í¤¬ÍÑ°Õ¤µ¤ì¤Æ¤¤¤ë.
-
-ÊÑ¿ô¡¦Äê¿ô
-
- Qnil
-
-   Äê¿ô: nil¥ª¥Ö¥¸¥§¥¯¥È
-
- Qself
-
-   ÊÑ¿ô: ¸½ºß¤Îself¥ª¥Ö¥¸¥§¥¯¥È¤ÎÃÍ. °ìÈ̤˥᥽¥Ã¥É¤Ë¤Ïself¤ò»Ø¤¹°ú¿ô
-   ¤¬Í¿¤¨¤é¤ì¤ë¤Î¤Ç, ¤³¤ÎÊÑ¿ô¤Ë¥¢¥¯¥»¥¹¤¹¤ëɬÍפϤʤ¤. ¤³¤ÎÊÑ¿ô¤ÎÃͤò
-   Êѹ¹¤¹¤ë»þ¤Ï°Ê¸å¤Îself¤ÎÃͤ½¤Î¤â¤Î¤¬ÊѤï¤Ã¤Æ¤·¤Þ¤¦¤Î¤Ç, ÆÃÊ̤ʻö¾ð
-   ¤¬¤Ê¤¤¸Â¤êÂåÆþ¤·¤Æ¤Ï¤Ê¤é¤Ê¤¤.
-
- TRUE
-
-   Äê¿ô: t¥ª¥Ö¥¸¥§¥¯¥È(¿¿¤Î¥Ç¥Õ¥©¥ë¥ÈÃÍ)
-
- FALSE
-
-   Äê¿ô: nil¥ª¥Ö¥¸¥§¥¯¥È
-
-¥¯¥é¥¹¡¦¥â¥¸¥å¡¼¥ëÄêµÁ
-
- VALUE rb_define_class(char *name, VALUE super)
-
-   super¤Î¥µ¥Ö¥¯¥é¥¹¤È¤·¤Æ¿·¤·¤¤Ruby¥¯¥é¥¹¤òÄêµÁ¤¹¤ë.
-
- VALUE rb_define_module(char *name)
-
-   ¿·¤·¤¤Ruby¥â¥¸¥å¡¼¥ë¤òÄêµÁ¤¹¤ë.
-
- void rb_include_module(VALUE class, VALUE module)
-
-   ¥â¥¸¥å¡¼¥ë¤ò¥¤¥ó¥¯¥ë¡¼¥É¤¹¤ë. class¤¬¤¹¤Ç¤Ëmodule¤ò¥¤¥ó¥¯¥ë¡¼¥É¤·¤Æ
-   ¤¤¤ë»þ¤Ë¤Ï²¿¤â¤·¤Ê¤¤(¿½Å¥¤¥ó¥¯¥ë¡¼¥É¤Î¶Ø»ß).
-
-Âç°èÊÑ¿ô
-
- void rb_define_variable(char *name, VALUE *var,
-			 VALUE (*get_hook), VALUE (*set_hook)(), void *data)
-
-   Ruby¤ÈC¤È¤Ç¶¦Í­¤¹¤ë¥°¥í¡¼¥Ð¥ëÊÑ¿ô¤òÄêµÁ¤¹¤ë. get_hook¤¬Qnil¤Ç¤Ê¤¤»þ, 
-   ÊÑ¿ô»²¾È¤ÎºÝ¤Ëget_hook¤Ë¥»¥Ã¥È¤µ¤ì¤¿´Ø¿ô¤¬¸Æ¤Ð¤ì¤ë. set_hook¤¬Qnil 
-   ¤Ç¤Ê¤¤»þ¤Ë¤ÏÂåÆþ¤Î»þ¤Ëset_hook¤¬¸Æ¤Ð¤ì¤ë. hook´Ø¿ô¤Ë¤ÏÊÑ¿ô̾¤ò¼¨¤¹ 
-   ID¡¤(set hook¤Î¾ì¹ç¿·¤·¤¤Ãͤâ)¤È¤È¤â¤Ëdata¤ÇÍ¿¤¨¤¿¥Ç¡¼¥¿¤¬°ú¿ô¤È¤·
-   ¤ÆÅϤµ¤ì¤ë.
-
-   ÊÑ¿ô̾¤¬`$'¤Ç»Ï¤Þ¤é¤Ê¤¤»þ¤Ë¤Ï¼«Æ°Åª¤ËÄɲ䵤ì¤ë. ÊÑ¿ô̾¤È¤·¤Æruby¤Î
-   ¼±Ê̻ҤȤ·¤Æµö¤µ¤ì¤Ê¤¤Ê¸»ú(Î㤨¤Ð` ')¤ò´Þ¤à¾ì¹ç¤Ë¤Ïruby¥×¥í¥°¥é¥à¤«
-   ¤é¥¢¥¯¥»¥¹¤Ç¤­¤Ê¤¯¤Ê¤ë.
-
- void rb_global_variable(VALUE *var)
-
-   GC¤Î¤¿¤á¡¤Ruby¥×¥í¥°¥é¥à¤«¤é¤Ï¥¢¥¯¥»¥¹¤µ¤ì¤Ê¤¤¤¬, Ruby¥ª¥Ö¥¸¥§¥¯¥È
-   ¤ò´Þ¤àÂç°èÊÑ¿ô¤ò¥Þ¡¼¥¯¤¹¤ë.
-
- void rb_read_only_hook()
-
-   Æɤ߽Ф·ÀìÍѤÎÊÑ¿ô¤Î¤¿¤á¤Îset_hook´Ø¿ô. ÃͤòÀßÄꤷ¤è¤¦¤È¤¹¤ë¤ÈÎã³°
-   ¤òȯÀ¸¤µ¤»¤ë.
-
-¥¯¥é¥¹Äê¿ô
-
- void rb_define_const(VALUE class, char *name, VALUE val)
-
-   ¥¯¥é¥¹Äê¿ô¤òÄêµÁ¤¹¤ë.
-
-¥á¥½¥Ã¥ÉÄêµÁ
-
- rb_define_method(VALUE class, char *name, VALUE (*func)(), int argc)
-
-   ¥á¥½¥Ã¥É¤òÄêµÁ¤¹¤ë. argc¤Ïself¤ò½ü¤¯°ú¿ô¤Î¿ô. argc¤¬-1¤Î»þ, ´Ø¿ô¤Ë
-   ¤Ï°ú¿ô¤Î¿ô(self¤ò´Þ¤Þ¤Ê¤¤)¤òÂè1°ú¿ô, °ú¿ô¤ÎÇÛÎó¤òÂè2°ú¿ô¤È¤¹¤ë·Á¼°
-   ¤ÇÍ¿¤¨¤é¤ì¤ë(Âè3°ú¿ô¤Ïself). argc¤¬-2¤Î»þ, °ú¿ô¤Ïself, args(args¤Ï
-   °ú¿ô¤ò´Þ¤àruby¤ÎÇÛÎó)¤È¤¤¤¦·Á¼°¤ÇÍ¿¤¨¤é¤ì¤ë.
-
- rb_define_single_method(VALUE class, char *name, VALUE (*func)(), int argc)
-
-   Æðۥ᥽¥Ã¥É¤òÄêµÁ¤¹¤ë. °ú¿ô¤Ïrb_define_method()¤ÈƱ¤¸.
-
- rb_scan_args(int atgc, VALUE *argv, char *fmt, ...)
-
-   argc,argv·Á¼°¤ÇÍ¿¤¨¤é¤ì¤¿°ú¿ô¤òʬ²ò¤¹¤ë. fmt¤Ïɬ¿Ü°ú¿ô¤Î¿ô, Éղðú
-   ¿ô¤Î¿ô, »Ä¤ê¤Î°ú¿ô¤¬¤¢¤ë¤«¤ò»ØÄꤹ¤ëʸ»úÎó¤Ç, "¿ô»ú¿ô»ú*"¤È¤¤¤¦·Á¼°
-   ¤Ç¤¢¤ë.  2 ÈÖÌܤοô»ú¤È"*"¤Ï¤½¤ì¤¾¤ì¾Êά²Äǽ¤Ç¤¢¤ë. ɬ¿Ü°ú¿ô¤¬°ì¤Ä
-   ¤â¤Ê¤¤¾ì¹ç¤Ï0¤ò»ØÄꤹ¤ë¡¥Âè3°ú¿ô°Ê¹ß¤ÏÊÑ¿ô¤Ø¤Î¥Ý¥¤¥ó¥¿¤Ç, ³ºÅö¤¹¤ë
-   Í×ÁǤ¬¤½¤ÎÊÑ¿ô¤Ë³ÊǼ¤µ¤ì¤ë. Éղðú¿ô¤ËÂбþ¤¹¤ë°ú¿ô¤¬Í¿¤¨¤é¤ì¤Æ¤¤¤Ê
-   ¤¤¾ì¹ç¤ÏÊÑ¿ô¤ËQnil¤¬ÂåÆþ¤µ¤ì¤ë.
-
-Ruby¥á¥½¥Ã¥É¸Æ¤Ó½Ð¤·
-
- VALUE rb_funcall(VALUE recv, ID mid, int narg, ...)
-
-   ¥á¥½¥Ã¥É¸Æ¤Ó½Ð¤·. ʸ»úÎ󤫤émid¤òÆÀ¤ë¤¿¤á¤Ë¤Ïrb_intern()¤ò»È¤¦.
-
- VALUE rb_funcall2(VALUE recv, ID mid, int argc, VALUE *argv)
-
-   ¥á¥½¥Ã¥É¸Æ¤Ó½Ð¤·. °ú¿ô¤òargc,argv·Á¼°¤ÇÅϤ¹¡¥
-
- VALUE rb_eval_string(char *str)
-
-   ʸ»úÎó¤òruby¤È¥¹¥¯¥ê¥×¥È¤·¤Æ¥³¥ó¥Ñ¥¤¥ë¡¦¼Â¹Ô¤¹¤ë¡¥
-
- ID rb_intern(char *name)
-
-   ʸ»úÎó¤ËÂбþ¤¹¤ëID¤òÊÖ¤¹.
-
- char *rb_id2name(ID id)
-
-   ID¤ËÂбþ¤¹¤ëʸ»úÎó¤òÊÖ¤¹(¥Ç¥Ð¥Ã¥°ÍÑ).
-
- char *rb_class2name(VALUE class)
-
-   class¤Î̾Á°¤òÊÖ¤¹(¥Ç¥Ð¥Ã¥°ÍÑ). class¤¬Ì¾Á°¤ò»ý¤¿¤Ê¤¤»þ¤Ë¤Ï, °ìÈÖ¶á
-   ¤¤Ì¾Á°¤ò»ý¤Ä¥¯¥é¥¹¤Î̾Á°¤òÊÖ¤¹.
-
-¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô
-
- VALUE rb_iv_get(VALUE obj, char *name)
-
-   obj¤Î¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô¤ÎÃͤòÆÀ¤ë. `@'¤Ç»Ï¤Þ¤é¤Ê¤¤¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô¤Ï 
-   Ruby¥×¥í¥°¥é¥à¤«¤é¥¢¥¯¥»¥¹¤Ç¤­¤Ê¤¤.
-
- VALUE rb_iv_set(VALUE obj, char *name, VALUE val)
-
-   obj¤Î¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô¤òval¤Ë¥»¥Ã¥È¤¹¤ë.
-
-À©¸æ¹½Â¤
-
- VALUE rb_iterate(VALUE (*func1)(), char *arg1, VALUE (*func2)(), char *arg2)
-
-   func2¤ò¥Ö¥í¥Ã¥¯¤È¤·¤ÆÀßÄꤷ, func1¤ò¥¤¥Æ¥ì¡¼¥¿¤È¤·¤Æ¸Æ¤Ö.  func1¤Ë
-   ¤Ï arg1¤¬°ú¿ô¤È¤·¤ÆÅϤµ¤ì, func2¤Ë¤ÏÂè1°ú¿ô¤Ë¥¤¥Æ¥ì¡¼¥¿¤«¤éÍ¿¤¨¤é¤ì
-   ¤¿ÃÍ, Âè2°ú¿ô¤Ëarg2¤¬ÅϤµ¤ì¤ë.
- 
- VALUE rb_yield(VALUE val)
-
-   val¤òÃͤȤ·¤Æ¥¤¥Æ¥ì¡¼¥¿¥Ö¥í¥Ã¥¯¤ò¸Æ¤Ó½Ð¤¹.
-
- VALUE rb_resque(VALUE (*func1)(), char *arg1, VALUE (*func2)(), char *arg2)
-
-   ´Ø¿ôfunc1¤òarg1¤ò°ú¿ô¤Ë¸Æ¤Ó½Ð¤¹. func1¤Î¼Â¹ÔÃæ¤ËÎã³°¤¬È¯À¸¤·¤¿»þ¤Ë
-   ¤Ï func2¤òarg2¤ò°ú¿ô¤È¤·¤Æ¸Æ¤Ö. Ìá¤êÃͤÏÎã³°¤¬È¯À¸¤·¤Ê¤«¤Ã¤¿»þ¤Ï
-   func1¤ÎÌá¤êÃÍ, Îã³°¤¬È¯À¸¤·¤¿»þ¤Ë¤Ïfunc2¤ÎÌá¤êÃͤǤ¢¤ë.
-
- VALUE rb_ensure(VALUE (*func1)(), char *arg1, VALUE (*func2)(), char *arg2)
-
-   ´Ø¿ôfunc1¤òarg1¤ò°ú¿ô¤È¤·¤Æ¼Â¹Ô¤·, ¼Â¹Ô½ªÎ»¸å(¤¿¤È¤¨Îã³°¤¬È¯À¸¤·¤Æ
-   ¤â) func2¤òarg2¤ò°ú¿ô¤È¤·¤Æ¼Â¹Ô¤¹¤ë. Ìá¤êÃͤÏfunc1¤ÎÌá¤êÃͤǤ¢¤ë(Îã
-   ³°¤¬È¯À¸¤·¤¿»þ¤ÏÌá¤é¤Ê¤¤).
-
-Îã³°¡¦¥¨¥é¡¼
-
- void Warning(char *fmt, ...)
-
-   ɸ½à¥¨¥é¡¼½ÐÎϤ˷ٹð¾ðÊó¤òɽ¼¨¤¹¤ë. °ú¿ô¤Ïprintf()¤ÈƱ¤¸.
-
- void Fail(char *fmt, ...)
-
-   Îã³°¤òȯÀ¸¤µ¤»¤ë. °ú¿ô¤Ïprintf()¤ÈƱ¤¸.
-
- void Fatal(char *fmt, ...)
-
-   Ã×̿ŪÎã³°¤òȯÀ¸¤µ¤»¤ë. Ä̾ï¤ÎÎã³°½èÍý¤Ï¹Ô¤Ê¤ï¤ì¤º, ¥¤¥ó¥¿¡¼¥×¥ê¥¿
-   ¤¬½ªÎ»¤¹¤ë(¤¿¤À¤·ensure¤Ç»ØÄꤵ¤ì¤¿¥³¡¼¥É¤Ï½ªÎ»Á°¤Ë¼Â¹Ô¤µ¤ì¤ë).
-
- void Bug(char *fmt, ...)
-
-   ¥¤¥ó¥¿¡¼¥×¥ê¥¿¤Ê¤É¥×¥í¥°¥é¥à¤Î¥Ð¥°¤Ç¤·¤«È¯À¸¤¹¤ë¤Ï¤º¤Î¤Ê¤¤¾õ¶·¤Î»þ
-   ¸Æ¤Ö. ¥¤¥ó¥¿¡¼¥×¥ê¥¿¤Ï¥³¥¢¥À¥ó¥×¤·Ä¾¤Á¤Ë½ªÎ»¤¹¤ë. Îã³°½èÍý¤Ï°ìÀÚ¹Ô
-   ¤Ê¤ï¤ì¤Ê¤¤.
-
-ruby¤Î½é´ü²½¡¦¼Â¹Ô
-
- void ruby_init(int argc, char **argv, char **envp)
-
-  ruby¥¤¥ó¥¿¥×¥ê¥¿¤Î½é´ü²½¤ò¹Ô¤Ê¤¦.
-
- void ruby_run()
-
-  ruby¥¤¥ó¥¿¥×¥ê¥¿¤ò¼Â¹Ô¤¹¤ë.
-
- void ruby_script(char *name)
-
-  ruby¤Î¥¹¥¯¥ê¥×¥È̾($0)¤òÀßÄꤹ¤ë.
-
-/*
- * Local variables:
- * fill-column: 70
- * end:
- */
diff --git a/CONTRIBUTING.md b/CONTRIBUTING.md
new file mode 100644
index 0000000000..ffdf2dd4b8
--- /dev/null
+++ b/CONTRIBUTING.md
@@ -0,0 +1,4 @@
+Please see the [official issue tracker] and wiki [HowToContribute].
+
+[official issue tracker]: https://bugs.ruby-lang.org
+[HowToContribute]: https://bugs.ruby-lang.org/projects/ruby/wiki/HowToContribute
diff --git a/COPYING b/COPYING
new file mode 100644
index 0000000000..a1f19ff99d
--- /dev/null
+++ b/COPYING
@@ -0,0 +1,56 @@
+Ruby is copyrighted free software by Yukihiro Matsumoto <matz@netlab.jp>.
+You can redistribute it and/or modify it under either the terms of the
+2-clause BSDL (see the file BSDL), or the conditions below:
+
+  1. You may make and give away verbatim copies of the source form of the
+     software without restriction, provided that you duplicate all of the
+     original copyright notices and associated disclaimers.
+
+  2. You may modify your copy of the software in any way, provided that
+     you do at least ONE of the following:
+
+       a) place your modifications in the Public Domain or otherwise
+          make them Freely Available, such as by posting said
+	  modifications to Usenet or an equivalent medium, or by allowing
+	  the author to include your modifications in the software.
+
+       b) use the modified software only within your corporation or
+          organization.
+
+       c) give non-standard binaries non-standard names, with
+          instructions on where to get the original software distribution.
+
+       d) make other distribution arrangements with the author.
+
+  3. You may distribute the software in object code or binary form,
+     provided that you do at least ONE of the following:
+
+       a) distribute the binaries and library files of the software,
+	  together with instructions (in the manual page or equivalent)
+	  on where to get the original distribution.
+
+       b) accompany the distribution with the machine-readable source of
+	  the software.
+
+       c) give non-standard binaries non-standard names, with
+          instructions on where to get the original software distribution.
+
+       d) make other distribution arrangements with the author.
+
+  4. You may modify and include the part of the software into any other
+     software (possibly commercial).  But some files in the distribution
+     are not written by the author, so that they are not under these terms.
+
+     For the list of those files and their copying conditions, see the
+     file LEGAL.
+
+  5. The scripts and library files supplied as input to or produced as 
+     output from the software do not automatically fall under the
+     copyright of the software, but belong to whomever generated them, 
+     and may be sold commercially, and may be aggregated with this
+     software.
+
+  6. THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR
+     IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED
+     WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
+     PURPOSE.
diff --git a/COPYING.ja b/COPYING.ja
new file mode 100644
index 0000000000..e50d01c8d1
--- /dev/null
+++ b/COPYING.ja
@@ -0,0 +1,51 @@
+本プログラム�フリーソフトウェア��．2-clause BSDL
+���以下�示��件�本プログラムを��布����
+2-clause BSDL�����BSDLファイルを�照��下��．
+
+  1. 複製�制���自由��．
+
+  2. 以下��件���れ�を満��時�本プログラム�ソースを
+     自由�変更����．
+
+     (a) �ットニューズ��スト��り，作者�変更を�付�る
+         ���方法�，変更を公開�る．
+
+     (b) 変更��本プログラムを自分�所属�る組織内部���
+         使�．
+
+     (c) 変更点を明示����，ソフトウェア���を変更�る．
+         ��ソフトウェアを�布�る時��変更��本プログラ
+         ムも�時��布�る．���変更��本プログラム�ソー
+         ス�入手法を明示�る．
+
+     (d) ��他�変更�件を作者����る．
+
+  3. 以下��件���れ�を満��時�本プログラムをコンパイ
+     ル��オブジェクトコードや実行形��も�布����．
+
+     (a) �イナリを�����人�ソースを入手��るよ��，
+         ソース�入手法を明示�る．
+
+     (b) 機械�読�ソースコードを添付�る．
+
+     (c) 変更を行���イナリ���を変更����，オリジナ
+         ル�ソースコード�入手法を明示�る．
+
+     (d) ��他��布�件を作者����る．
+
+  4. 他�プログラム��引用����る目的��れ自由��．�
+     ��，本プログラム���れる他�作者�よるコード�，�
+     れ�れ�作者����よる制��加�られる場���り��．
+
+     �れらファイル�一覧��れ�れ��布�件���付���
+     LEGALファイルを�照������．
+
+  5. 本プログラム��入力��るスクリプト�よ�，本プログラ
+     ム�ら�出力�権利�本プログラム�作者����，�れ�
+     れ�入出力を生���人�属���．��，本プログラム�
+     組�込�れる���拡張ライブラリ����も�様��．
+
+  6. 本プログラム�無�証��．作者�本プログラムをサ�ート
+     �る�志��り���，プログラム自身��グ�る��本プ
+     ログラム�実行���ら発生�る���る�害�対��も責
+     任を����ん．
diff --git a/ChangeLog b/ChangeLog
index ce97fa374c..2d26904f0b 100644
--- a/ChangeLog
+++ b/ChangeLog
@@ -1,524 +1,14558 @@
-Fri May 19 15:33:23 1995  Yukihiro Matsumoto  <matz@ix-02>
+Thu Dec 14 23:53:41 2017  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* version 0.76
+	* test/net/ftp/test_ftp.rb (process_port_or_eprt): merge a part of
+	  r56973 to pass the test introduced at previous commit.
 
-Fri May 19 00:48:08 1995  Yukihiro Matsumoto  (matz@dyna)
+Thu Dec 14 22:55:05 2017  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* string.c (Fstr_each): ¥¤¥Æ¥ì¡¼¥¿¥Ö¥í¥Ã¥¯Ãæ¤Çʸ»úÎó¤ÎÊѹ¹¤¬¹Ô¤ï¤ì
-	  ¤¿¤«¤É¤¦¤«¤ò¥Á¥§¥Ã¥¯¡¥¥Ý¥¤¥ó¥¿¤ÎÃͤ¬ÊѤï¤Ã¤Æ¤¤¤ì¤ÐÎã³°¤òȯÀ¸¤¹¤ë¡¥
+	Fix a command injection vulnerability in Net::FTP.
 
-	* ruby-mode.el: ruby-electric-brace¤Î¿·Àß¡¥
+Thu Dec 14 22:35:19 2017  Eric Wong  <normalperson@yhbt.net>
 
-Thu May 18 12:27:23 1995  Yukihiro Matsumoto  <matz@ix-02>
+	webrick: compile RE correctly for beginning and end match
 
-	* string.c (Fstr_tr): tr¤ÎÃÖ´¹ÂоݤË`\0'¤ò´Þ¤à»þ¤ËÀµ¤·¤¯ÃÖ´¹¤ò¹Ô¤ï
-	  ¤Ê¤¤¥Ð¥°¤¬¤¢¤Ã¤¿¡¥¹¹¤ËÃÖ´¹Ê¸»úÎó¤òASCII½ç¤Ë»ØÄꤷ¤Ê¤¤¤ÈÆ°ºî¤·¤Ê
-	  ¤¤ÌäÂê¤â¤¢¤Ã¤¿¡¥·ë²Ì¤È¤·¤Ætr¤ò½ñ¤­´¹¤¨¤¿¤Î¤Ç¡¤copyright¤ÎÌäÂê¤Ï
-	  ̵¤¯¤Ê¤Ã¤¿(¤È»×¤¦)¡¥
+	Using ^ and $ in regexps means we can accidentally get fooled
+	by "%0a" in HTTP request paths being decoded to newline
+	characters.  Use \A and \z to match beginning and end-of-string
+	respectively, instead.
 
-	* gc.c (gc): the_scope¤ò¥Þ¡¼¥¯¤·¤Æ¤¤¤Ê¤«¤Ã¤¿¤Î¤Ç¡¤¥í¡¼¥«¥ëÊÑ¿ô¤¬´Ö
-	  °ã¤Ã¤Æ³«Êü¤µ¤ì¤ë¾ì¹ç¤¬¤¢¤Ã¤¿¡¥
+	Thanks to mame and hsbt for reporting.
 
-	* gc.c (mark_locations_array): ¼ã´³¤Î¹â®²½¡¥
+	* lib/webrick/httpserver.rb (MountTable#compile):
+	  use \A and \z instead of ^ and $
+	* lib/webrick/httpserver.rb (MountTable#normalize): use \z instead of $
+	* test/webrick/test_httpserver.rb (test_cntrl_in_path): new test
 
-Mon May 15 11:43:49 1995  Yukihiro Matsumoto  <matz@ix-02>
+Thu Dec 14 22:29:04 2017  Eric Wong  <normalperson@yhbt.net>
 
-	* ext/extmk.rb.in: Dynamic Load¥â¥¸¥å¡¼¥ë¤Î¥³¥ó¥Ñ¥¤¥ëÍÑ¥Á¥§¥Ã¥¯¤ò
-	  ¹Ô¤¦ruby script¡¥autoconf¤Ë¶á¤¤´¶³Ð¤Ç»È¤¨¤ë¡¥¿·¤·¤¤¥â¥¸¥å¡¼¥ë¤ò
-	  Ä󶡤·¤¿¤¤¿Í¤Ïext¤Î²¼¤Ë¥Ç¥£¥ì¥¯¥È¥ê¤òºî¤ë¤À¤±¤ÇÎɤ¤¡¥É¬¿Ü¤Î¥Õ¥¡
-	  ¥¤¥ë¤Ï¥Õ¥¡¥¤¥ë̾¤Î°ìÍ÷¤òµ­Ï¿¤·¤¿`MANIFEST'¤È¤¤¤¦¥Õ¥¡¥¤¥ë¤Î¤ß¡¥É¬
-	  Íפ˱þ¤¸¤Æ`depend'(¥Õ¥¡¥¤¥ë¤Î°Í¸´Ø·¸¤òµ­½Ò¤¹¤ë¥Õ¥¡¥¤¥ë gcc -MM
-	  ¤Î½ÐÎÏ)¡¤`extconf.rb'(¥³¥ó¥Ñ¥¤¥ëÍѤ˥饤¥Ö¥é¥ê¤È´Ø¿ô¤Î¸ºß¥Á¥§¥Ã
-	  ¥¯¤¹¤ë¥Õ¥¡¥¤¥ë)¤òÍѰդǤ­¤ë¡¥
+	webrick: do not hang acceptor on slow TLS connections
 
-	* eval.c (rb_call): ruby¥á¥½¥Ã¥É¤Î°ú¿ô¥Á¥§¥Ã¥¯»þ¤Ë̤½é´ü²½¤Î
-	  jmp_buf¤ò»ÈÍѤ·¤Æ¤¤¤¿¡¥
+	OpenSSL::SSL::SSLSocket#accept may block indefinitely on clients
+	which negotiate the TCP connection, but fail (or are slow) to
+	negotiate the subsequent TLS handshake.  This prevents the
+	multi-threaded WEBrick server from accepting other connections.
 
-	* parse.y: `or'¤È`and'¤ÎÍ¥Àè½ç°Ì¤òƱ¤¸¤Ë¤·¤¿¡¥
+	Since the TLS handshake (via OpenSSL::SSL::SSLSocket#accept)
+	consists of normal read/write traffic over TCP, handle it in the
+	per-client thread, instead.
 
-Wed May  3 18:21:36 1995  Yukihiro Matsumoto  (matz@dyna)
+	Furthermore, using non-blocking accept() is useful for non-TLS
+	sockets anyways because spurious wakeups are possible from
+	select(2).
 
-	* dln.c: Linux¤Ç¤Ï`__.SYMDEF/'¤Ç¤¢¤Ã¤¿¡¥
+	* lib/webrick/server.rb (accept_client): use TCPServer#accept_nonblock
+	  and remove OpenSSL::SSL::SSLSocket#accept call
+	* lib/webrick/server.rb (start_thread): call OpenSSL::SSL::SSLSocket#acc
+ept
+	* test/webrick/test_ssl_server.rb (test_slow_connect): new test
+	  [ruby-core:83221] [Bug #14005]
 
-	* dln.c: system call¤Î¥¨¥é¡¼¥Á¥§¥Ã¥¯¤ò˺¤ì¤Æ¤¤¤¿¡¥
+	webrick: fix up r60172
 
-Wed Apr 26 09:50:56 1995  Yukihiro Matsumoto  (matz@ix-02)
+	By making the socket non-blocking in r60172, TLS/SSL negotiation
+	via the SSL_accept function must handle non-blocking sockets
+	properly and retry on SSL_ERROR_WANT_READ/SSL_ERROR_WANT_WRITE.
+	OpenSSL::SSL::SSLSocket#accept cannot do that properly with a
+	non-blocking socket, so it must use non-blocking logic of
+	OpenSSL::SSL::SSLSocket#accept_nonblock.
 
-	* parse.y: ¥¤¥Æ¥ì¡¼¥¿¥Ö¥í¥Ã¥¯¤ÎÊÑ¿ôÀë¸À¤ò`|'¤Ç³ç¤ë¤è¤¦¤Ë¤·¤¿¡¥¤³¤ì
-	  ¤Ç¥¤¥Æ¥ì¡¼¥¿ÊÑ¿ô¤¬¤Ê¤¤»þ¤ÏÀë¸À¤½¤Î¤â¤Î¤ò¾Êά¤Ç¤­¤ë¡¥Ê¸Ë¡¤ÎÊѹ¹¤Ï
-	  µ×¤·¤Ö¤ê¤À¡¥
+	Thanks to MSP-Greg (Greg L) for finding this.
 
-Tue Apr 25 12:04:17 1995  Yukihiro Matsumoto  (matz@ix-02)
+	* lib/webrick/server.rb (start_thread): use SSL_accept properly
+	  with non-blocking socket.
+	  [Bug #14013] [Bug #14005]
 
-	* eval.c(require): load¤«¤é¥À¥¤¥Ê¥ß¥Ã¥¯¥í¡¼¥É¤Îµ¡Ç½¤ò°Ü¤·¤Æ¤­¤¿¡¥
-	  ¤µ¤é¤Ë³ÈÄ¥»Ò¤ÎÊä´°µ¡Ç½¤òÄɲ䷤ƥ桼¥¶¤¬dln/dlopen¤Îº¹¤ò°Õ¼±¤¹¤ë
-	  ɬÍפΤʤ¤¤è¤¦¤Ë¤·¤¿¡¥
+	webrick: fix up r60172 and revert r60189
 
-	* string.c(sub,sub): ¥¤¥Æ¥ì¡¼¥¿¤È¤·¤Æ¤âÆ°ºî¤¹¤ë¤è¤¦¤Ë¡¥
+	Thanks to MSP-Greg (Greg L) for helping with this.
 
-	* object.c: init_object -> initialize.
+	* lib/webrick/server.rb (start_thread): ignore ECONNRESET, ECONNABORTED,
+	  EPROTO, and EINVAL on TLS negotiation errors the same way they
+	  were ignored before r60172 in the accept_client method of the
+	  main acceptor thread.
+	  [Bug #14013] [Bug #14005]
 
-Mon Apr 24 14:22:39 1995  Yukihiro Matsumoto  (matz@ix-02)
+	webrick: fix up r60172 and r60208
 
-	* NEWS-OS 3.4Âбþ
+	Thanks to MSP-Greg (Greg L) for helping with this.
 
-	* io.c: Solaris¤Îstdio¤ÎÆ°ºî¤¬°ã¤¦¤è¤¦¤À¡¥signal¤ÇEOF¤òÊÖ¤·¤Æ¤·¤Þ
-	  ¤¦¡Ä¡¥perl¤Ç¤âƱÍͤÎÌäÂ꤬¤¢¤ë¡¥
+	* lib/webrick/server.rb (start_thread): fix non-local return
+	  introduced in r60208
 
-Fri Apr 21 20:04:39 1995  Yukihiro Matsumoto  (matz@ix-02)
+	webrick: fix up r60172 and r60210
 
-	* version 0.75
+	Thanks to MSP-Greg (Greg L) for helping with this.
 
-	* signal.c: trap¤¬¤Ê¤¯¤Ê¤Ã¤Æ¤¤¤¿¡¥¤¦¡¼¤à¡¥
+	* lib/webrick/server.rb (start_thread): properly fix non-local return
+	  introduced in r60208 and r60210
 
-	* configure: Solaris 2.3Âбþ¡¥
+Thu Nov 30 23:37:08 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* io.c: #elif¤Î¤Ê¤¤cpp¤â¤¢¤ë¡¥
+	parse.y: fix line in rescue
 
-	* dir.c: autoconf 2.x¤Ø¤ÎÂбþ¤¬ÉÔ½½Ê¬
+	* parse.y (set_line_body, primary): fix line number of bodystmt as the
+	  beginning of the block. [Bug #13181]
 
-Thu Apr 20 12:31:24 1995  Yukihiro Matsumoto  (matz@ix-02)
+Thu Nov 30 23:29:00 2017  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* version 0.74
+	Merge rubygems-2.6.14 changes.
 
-	* env.h, gc.c, regex.c: IRIX¤Ø¤Î°Ü¿¢Âбþ
+	It fixed http://blog.rubygems.org/2017/10/09/unsafe-object-deserialization-vulnerability.html
 
-	* configure: pic¤òÀ¸À®¤¹¤ëoption¤Î¸¡½Ð¤Î¤¿¤á¡¤¥·¥¹¥Æ¥à¥¿¥¤¥×¤ò¥Á¥§¥Ã
-	  ¥¯¤¹¤ë¤è¤¦¤Ë¡¥
+Fri Sep 15 05:40:40 2017  URABE Shyouhei  <shyouhei@ruby-lang.org>
 
-Tue Apr 18 19:08:17 1995  Yukihiro Matsumoto  (matz@ix-02)
+	fix --with-gmp (broken by r57490)
 
-	* gc.c(xrealloc): ptr=nil¤Î»þ¡¤malloc()¤ÈƱ¤¸Æ¯¤­¤ò
+	Looking at the generated shell script (also the autoconf manual), it
+	seems AC_SEARCH_LIBS() m4 macro does not define HAVE_LIBsomething C
+	preprocessor macros, unlike AC_CHECK_LIB() which does define them.
+	This previous change effectively killed building with GMP because
+	building that mode depends on existence of HAVE_LIBGMP. [Bug #13402]
 
-	* array.c(astore): ¶õ¤ÎÇÛÎó¤Î0ÈÖÌܤÎÍ×ÁǤËÂåÆþ¤¹¤ë¤Èsize=0¤Ç
-	  realloc()¤ò¸Æ¤ó¤Ç¤¤¤¿¡¥
+Thu Sep 14 20:25:55 2017  Yusuke Endoh  <mame@ruby-lang.org>
 
-	* configure, glob.c: Solaris 2.x¤Ç¥³¥ó¥Ñ¥¤¥ë¤Ç¤­¤ë¤è¤¦¤Ë
+	lib/webrick/log.rb: sanitize any type of logs
 
-Mon Apr 10 18:36:06 1995  Yukihiro Matsumoto  (matz@ix-02)
+	It had failed to sanitize some type of exception messages.  Reported and
+	patched by Yusuke Endoh (mame) at https://hackerone.com/reports/223363
 
-	* version 0.73
+Thu Sep 14 13:32:39 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Apr  7 13:51:08 1995  Yukihiro Matsumoto  (matz@ix-02)
+	parse.y: empty hash in defined
 
-	* cons.c->assoc.c: cons¤Î;·×¤Êµ¡Ç½¤Ï³°¤·¤Æpair¤È¤·¤Æ¤Îµ¡Ç½¤À¤±¤ò
-	  »Ä¤·¤¿¡¥enumerable¤òinclude¤¹¤ë¤Î¤â¤ä¤á¤¿¡¥
+	* parse.y (command): NODE_ARRAY with NULL is invalid.  traversal
+	  in defined_expr0 is simplified than iseq_compile_each0.
+	  [ruby-core:82113] [Bug #13756]
 
-	* string.c(esub): ʸ»úÎóÃÖ´¹¥¤¥Æ¥ì¡¼¥¿¡¥perl¤Îs///e¤ÎÁêÅö¤¹¤ë¡¥
+Thu Sep 14 13:26:31 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Apr  5 11:35:21 1995  Yukihiro Matsumoto  (matz@ix-02)
+	string.c: fix false coderange
 
-	* version 0.72
+	* string.c (rb_enc_str_scrub): enc can differ from the actual encoding
+	  of the string, the cached coderange is useless then. [Bug #13874]
 
-	* EWS4800Âбþ
+Thu Sep 14 13:24:51 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* file.c: utimes¤¬¤Ê¤¤»þ¤Ïutime¤ò»È¤¦¤è¤¦¤Ë¡¥
+	parse.y: primary should not be 0
 
-Mon Apr  3 15:19:41 1995  Yukihiro Matsumoto  (matz@ix-02)
+	* parse.y (primary): should not be 0, since it can be a receiver.
+	  [ruby-core:82447] [Bug #13836]
 
-	* version 0.71
+Thu Sep 14 13:19:30 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* regexp.c(re_match): ¥Ð¥°¤¬¤¢¤Ã¤¿¡¥match_2¤òºï½ü¤·¤¿»þ¤Ëenbug¤·¤Æ
-	  ¤¤¤¿¤Î¤À¤Ã¤¿¡¥
+	vm_method.c: alias warning at refined method
 
-Mon Mar 27 15:41:43 1995  Yukihiro Matsumoto  (matz@ix-02)
+	* vm_method.c (rb_method_entry_make): suppress a warning at
+	  refined method which will not be redefined.
+	  [ruby-core:82385] [Bug #13817]
 
-	* dict.c: Dict->Hash¤ËÁ´ÌÌŪ¤Ë°Ü¹Ô¡¥
+Thu Sep 14 13:14:19 2017  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Thu Mar 23 20:30:00 1995  Yukihiro Matsumoto  (matz@ix-02)
+	* ext/bigdecimal/bigdecimal.c (BigDecimal_hash): st_index_t may not be
+	  fixable on 64bit mswin/mingw.
 
-	* dbm.c,socket.c: ext¥Ç¥£¥ì¥¯¥È¥ê¤ËʬΥ¡¥
+	* ext/date/date_core.c (d_lite_hash): ditto.
+	  [Backport #13877]
 
-	* configure: dln¼þ¤ê¤Î¥Á¥§¥Ã¥¯¤Î¶¯²½
+	* ext/openssl/ossl_bn.c (ossl_bn_hash): ditto.
 
-	* dln.c: init¤Î¸Æ¤Ó½Ð¤·¤òdlopen()ÈǤ˹ç¤ï¤»¤¿¡¥
+Sat Sep  9 23:05:31 2017  Kazuki Yamaguchi <k@rhe.jp>
 
-Mon Mar 20 17:45:08 1995  Yukihiro Matsumoto  (matz@ix-02)
+	asn1: fix out-of-bounds read in decoding constructed objects
 
-	* configure: autoconf 2.2¤ËÂбþ(°ìÉô)¡¥
+	* OpenSSL::ASN1.{decode,decode_all,traverse}: have a bug of
+	  out-of-bounds read. int_ossl_asn1_decode0_cons() does not give the
+	  correct available length to ossl_asn1_decode() when decoding the
+	  inner components of a constructed object. This can cause
+	  out-of-bounds read if a crafted input given.
 
-Fri Mar 17 15:56:44 1995  Yukihiro Matsumoto  (matz@ix-02)
+	Reference: https://hackerone.com/reports/170316
+	https://github.com/ruby/openssl/commit/1648afef33c1d97fb203c82291b8a61269e85d3b
 
-	* dln.c: dlopen¤Î¤¢¤ë¥Þ¥·¥ó¤Ç¤Ï¤½¤Á¤é¤ò»È¤¦¤è¤¦¤Ë¡¥¤¿¤À¤·¡¤¤Á¤ã¤ó
-	  ¤ÈÆ°¤¤¤Æ¤¤¤ë¤«¤É¤¦¤«¤Ï¼«¿®¤¬¤Ê¤¤¡¥
+Sat Sep  9 22:57:24 2017  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* regex.c: virtual concatination¤ò¤ä¤á¤¿¡¥
+	* ext/json: bump to version 1.8.3.1. [Backport #13853]
 
-Thu Mar 16 11:32:57 1995  Yukihiro Matsumoto  (matz@ix-02)
+Sat Sep  9 22:50:10 2017  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* version 0.70
+	A HTTP Header value must not contain CR or LF.
+	to_str -> to_s
 
-	* eval.c,regex.c: gcc¤Ç¤Î¥³¥ó¥Ñ¥¤¥ë¥¨¥é¡¼¡¥
+	* lib/net/http/header.rb (set_field): `val` can not have `to_str`.
 
-	* io.c: inplace-edit¤Ç³ÈÄ¥»Ò¤¬»ØÄꤵ¤ì¤Ê¤¤¾ì¹ç¡¤¤â¤È¤Î¥Õ¥¡¥¤¥ë¤òºï
-	  ½ü¤¹¤ë¡¥
+Sat Sep  9 22:42:22 2017  Kouhei Sutou  <kou@cozmixng.org>
 
-Wed Mar 15 14:59:18 1995  Yukihiro Matsumoto  (matz@ix-02)
+	* REXML: Fix a bug that unexpected methods can be called as a XPath
+	  function. [HackerOne:249295] Reported by Andrea Jegher. Thanks!!!
 
-	* version 0.69
+Sat Sep  9 22:16:01 2017  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* eval.c(method_missing): unknown¤«¤é̾¾ÎÊѹ¹¡¥
+	* lib/rubygems: fix several vulnerabilities in RubyGems; bump to version
+	  2.5.2.1. [Backport #13842]
 
-	* eval.c(single_method_added): Æðۥ᥽¥Ã¥É¤¬ÄêµÁ¤µ¤ì¤¿»þ¤Ë¸Æ¤Ð¤ì
-	  ¤ë¥á¥½¥Ã¥É¡¥hook¤È¤·¤Æ»È¤¨¤ë¡¥¼ÂºÝ¤ËÄêµÁ¤µ¤ì¤ëľÁ°¤Ë¸Æ¤Ð¤ì¤ë¡¥
+Wed Aug  9 22:27:23 2017  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Tue Mar 14 14:46:44 1995  Yukihiro Matsumoto  (matz@ix-02)
+	* test/ruby/test_syntax.rb (test_invalid_{break,next}): use
+	  assert_in_out_err instead of assert_syntax_error because on ruby_2_3
+	  assert_syntax_error uses eval.
 
-	* ruby.c(proc_options): °ú¿ô¤Î²òÀϤò¼«Ê¬¤Ç¤ä¤ë¤³¤È¤Ë¤è¤ê°ú¿ô»ØÄê¤Î
-	  ÊýË¡¤¬perl¤Ë¶áÉÕ¤¤¤¿¡¥getopt_long¤Ï¤â¤¦»È¤ï¤Ê¤¤¡¥
+Wed Aug  9 22:27:23 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* dir.c(glob): `{}'¤Î¥Í¥¹¥È¤òµö¤¹¤è¤¦¤Ë¤·¤¿¡¥
+	* compile.c (iseq_compile_each0): turned dregx context in "once"
+	  into "guarded" type from "block" type, to disallow `next`,
+	  `break`, `redo` as well as outside "once".
+	  [Bug #13690]
 
-Mon Mar 13 17:56:25 1995  Yukihiro Matsumoto  (matz@ix-02)
+Wed Aug  9 21:28:34 2017  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* glob.c: Glob(¥ï¥¤¥ë¥É¥«¡¼¥É¥ª¥Ö¥¸¥§¥¯¥È)¤Ï¤Ê¤¯¤Ê¤Ã¤¿¡¥¥ï¥¤¥ë¥É¥«¡¼
-	  ¥É¤ÎŸ³«¤ÏDir.glob(ʸ»úÎó)¤ò»È¤¦¡¥¥ï¥¤¥ë¥É¥«¡¼¥É¤Î¥Þ¥Ã¥Á¤ÏÀµµ¬É½
-	  ¸½¤ÇÂåÍÑ¡¥
+	* test/ruby/test_process.rb (test_rlimit_{name,value}): test in UTF-8
+	  encoding.  fix test failures introduced at r59531 on some platforms.
 
-Fri Mar 10 18:35:46 1995  Yukihiro Matsumoto  (matz@ix-02)
+Wed Aug  9 21:16:22 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c: Math¤Î¤è¤¦¤Ê¥â¥¸¥å¡¼¥ë¤Ï¼«Ê¬¼«¿È¤Çextend¤¹¤ë¡¥
+	* marshal.c (rb_marshal_dump_limited): do not free dump_arg, which
+	  may be dereferenced in check_dump_arg due to continuation, and
+	  get rid of dangling pointers.
 
-	* eval.c: ¥¯¥é¥¹¤ä¥â¥¸¥å¡¼¥ë¤òÄêµÁ¤·¤¿´û¤ËƱ̾¤Î¤â¤Î¤¬¤¢¤ì¤ÐÄɲÃÄê
-	  µÁ¤È¤Ê¤ë¤è¤¦¤Ë¡¥¤¿¤À¤·¡¥super¥¯¥é¥¹¤Î°ã¤¤¤Ê¤É¤Ï¥Á¥§¥Ã¥¯¤¹¤ë¡¥
+	* marshal.c (rb_marshal_load_with_proc): ditto for load_arg.
 
-	* regex.c: debug.
+Wed Aug  9 21:13:24 2017  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* math.c: Äê¿ôPI¤ÈE¤òÄêµÁ¡¥
+	* compile.c (iseq_compile_each): remove unused definition of unused
+	  variable derived from original patch.
 
-Thu Mar  9 21:35:12 1995  Yukihiro Matsumoto  (matz@ix-02)
+Wed Aug  9 19:45:16 2017  sorah (Shota Fukumori)  <her@sorah.jp>
 
-	* regex.c: EUC,SJIS¥â¡¼¥É¤Ç¤Ï0x80°Ê¾å¤Î8¿Ê¡¤16¿Ê¥ê¥Æ¥é¥ë¤ò¶Ø»ß¡¥
+	Init_frozen_strings definition is removed in r51511.
+	https://bugs.ruby-lang.org/issues/11423
 
-	* regex.c: ¥¯¥é¥¹Æâ¤Ç¤â¿ôÃÍ¥ê¥Æ¥é¥ë¡¦Ê¸»ú¥¯¥é¥¹¤¬»È¤¨¤ë¤è¤¦¤·¤¿¡¥
+	Patch by Kohei Suzuki <eagletmt@gmail.com>
 
-Wed Mar  8 17:39:05 1995  Yukihiro Matsumoto  (matz@ix-02)
+	* internal.h: Remove declaration of unexist function
+	  [Fix GH-1558]
 
-	* regex.c: \200¤Ê¤É³ç¸Ì¤Î¿ô°Ê¾å¤Îɽ¸½¤Ï8¿Ê¥ê¥Æ¥é¥ë¤È²ò¼á¤¹¤ë¡¥¤¿¤À
-	  ¤·¡¤\1¤«¤é\9¤Þ¤Ç¤ÏÎã³°¡¥
+Wed Aug  9 19:34:17 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* regex.c: \9°Ê¾å¤Î¥ê¥Õ¥¡¥ì¥ó¥¹¤âÍ­¸ú¤Ë¤·¤¿¡¥
+	* internal.h (THROW_DATA_P): parenthesize the argument which is
+	  casted.
 
-Tue Mar  7 14:26:01 1995  Yukihiro Matsumoto  (matz@ix-02)
+Wed Aug  9 19:34:17 2017  Koichi Sasada  <ko1@atdot.net>
 
-	* eval.c(public/private): ¥¹¥³¡¼¥×À©¸æ¥á¥½¥Ã¥É¤Î̾¾ÎÊѹ¹¡¥ÀÅŪ¤Ê¥¢
-	  ¥¯¥»¥¹¤â½ÐÍè¤ë¤è¤¦¤Ë¤·¤Æ¤ß¤¿¤¬¡¤ÉÔºÎÍÑ¡¥
+	* vm.c: get return_value from imemo_throw_data object (THROW_DATA_VAL()).
+	  imemo_throw_data (TAG_BREAK) contains returned value.
+	  However, imemo_throw_data (TAG_BREAK) can skip several frames so that
+	  we need to use it only once (at most internal frame). To record it,
+	  we introduced THROW_DATA_CONSUMED and check it.
 
-Mon Mar  6 19:34:32 1995  Yukihiro Matsumoto  (matz@ix-02)
+	* internal.h: define THROW_DATA_CONSUMED flag.
 
-	* eval.c(inlcude): ¥á¥½¥Ã¥É²½¡¥Æ°Åª¤Ë¥â¥¸¥å¡¼¥ë¤ò¥¤¥ó¥¯¥ë¡¼¥É¤Ç¤­
-	  ¤ë¤è¤¦¤Ë¡¥¤µ¤é¤ËǤ°Õ¤Î¥ª¥Ö¥¸¥§¥¯¥È¤Ë¤â¥â¥¸¥å¡¼¥ë¤ò¥¤¥ó¥¯¥ë¡¼¥É¤Ç
-	  ¤­¤ë¥á¥½¥Ã¥É `extend'¤âÍÑ°Õ¤·¤¿¡¥
+	* test/ruby/test_settracefunc.rb: add tests for [Bug #13369]
 
-	* parse.y: ʸˡ¤«¤éinclude¤òºï½ü¡¥¥á¥½¥Ã¥É²½¡¥
+	* vm_insnhelper.h: add THROW_DATA_CONSUMED_P() and
+	  THROW_DATA_CONSUMED_SET().
 
-Tue Feb 28 15:35:10 1995  Yukihiro Matsumoto  (matz@ix-02)
+Wed Aug  9 19:32:17 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* parse.y: ÇÛÎó¡¤Ï¢ÁÛÇÛÎó¤ÎºÇ¸å¤Ë`,'¤ò¤ª¤±¤ë¤è¤¦¤Ë¡¥
+	* random.c (get_rnd, try_get_rnd): ensure initialized to get rid
+	  of crash in forked processes. [Bug #13753]
 
-Fri Feb 24 13:15:43 1995  Yukihiro Matsumoto  (matz@ix-02)
+Wed Aug  9 19:30:34 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* version 0.68
+	* ext/strscan/strscan.c (strscan_aref): fix segfault after
+	  get_byte or getch which do not apply regexp.
+	  [Bug #13759]
 
-Thu Feb 23 11:19:19 1995  Yukihiro Matsumoto  (matz@ix-02)
+Wed Aug  9 19:28:40 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c: resqueÀá¤Îself¤ÎÃͤ¬´Ö°ã¤Ã¤Æ¤¤¤¿¡¥
+	* configure.in: add rpath flags which is needed for OPTDIR as well
+	  as -L options, when it is given. [Bug #13411]
 
-	* eval.c(rb_clear_cache): ¥­¥ã¥Ã¥·¥å¤Î¥¯¥ê¥¢¤·Ëº¤ì¤¬¤¢¤Ã¤¿¡¥
+Wed Aug  9 19:14:07 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c: Äê¿ô¤Î¥¹¥³¡¼¥×¤ò¥¯¥é¥¹Æâ¤ÎÀÅŪ¥¹¥³¡¼¥×¤ËÊѹ¹¤·¤¿¡¥¤³¤ì¤Ë
-	  ¤è¤Ã¤Æ¡¤Æðۥ᥽¥Ã¥É¤«¤é¤Ï»²¾È¤µ¤ì¤ëÄê¿ô¤Ï¡¤¥ì¥·¡¼¥Ð¤Î¥¯¥é¥¹¤Ç¤Ï
-	  ¤Ê¤¯¡¤ÄêµÁ¤µ¤ì¤¿¥¹¥³¡¼¥×¤Î¥¯¥é¥¹¤ÎÄê¿ô¤È¤Ê¤ë¡¥
+	* vm_insnhelper.c (vm_throw_start): size of catch table has been
+	  included in iseq_catch_table struct, which could be NULL, since
+	  2.2. e.g., proc-closure in `once'. 
 
-Wed Feb 22 00:51:38 1995  Yukihiro Matsumoto  (matz@dyna)
+Wed Aug  9 19:09:20 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* regex.c: ignorecase¤òÀµµ¬É½¸½¤Î¥³¥ó¥Ñ¥¤¥ëÁ°¤Ë»ØÄꤷ¤Ê¤¤¤ÈÀµ¤·¤¯
-	  Æ°ºî¤·¤Ê¤¤¡¥½¤Àµ¡¥
+	* node.h (nd_line): should sign-extend.  shifting `VALUE` extends
+	  with zero bits if `sizeof(VALUE)` equals to `sizeof(int)`.  the
+	  zero bits are truncated if `sizeof(VALUE)` is bigger enough.
+	  [ruby-core:80920] [Bug #13523]
 
-	* string.c(toupper,tolower): bug fix.
+Wed Aug  9 17:53:09 2017  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ENV,VERSION: readonlyÊÑ¿ô¤«¤éÄê¿ô¤Ø¡¥
+	* compile.c (iseq_compile_each): the lifetime of new_opt have to be
+	  until this case block is end.  this is a part of r57971.
+	  [Backport #13766]
 
-Tue Feb 21 18:56:56 1995  Yukihiro Matsumoto  (matz@ix-02)
+Wed Aug  9 17:35:47 2017  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* io.c(STDIN, STDOUT, STDERR): Äê¿ô¤È¤·¤ÆÄêµÁ¡¥º£¤Þ¤Ç¤Î$stdin¤Ê¤É
-	  ¤Ï¾­Íè¤Ê¤¯¤Ê¤ë¤«¤âÃΤì¤Ê¤¤¡¥
+	this patch contains r54158, r57410, r57631 and r57954.
 
-	* io.c(select): bug fix.
+	Prevent GC by volatile [Bug #13150]
 
-	* version 0.67
+	test/ruby/test_marshal.rb test_context_switch (load) and test_gc (dump)
+	are failed on FreeBSD 10.3 and gcc7 (FreeBSD Ports Collection) 7.0.0
+	20170115 (experimental); RB_GC_GUARD looks not worked well.
 
-Mon Feb 20 16:10:14 1995  Yukihiro Matsumoto  (matz@ix-02)
+	* include/ruby/ruby.h (RB_GC_GUARD): prevent guarded pointer from
+	  optimization by using as an input to inline asm.
 
-	* parse.y(yylex): Äê¿ô¤ò`%¼±ÊÌ»Ò'¤«¤é¡¤Âè1ʸ»ú¤¬Âçʸ»ú¤Î¼±Ê̻ҤËÊÑ
-	  ¹¹¡¥¤½¤ì¤Ë¤È¤â¤Ê¤¤¥¯¥é¥¹¤ÏÄê¿ô¤È¤Ê¤Ã¤¿¡¥
+	* ruby.h: remove comment
 
-	* eval.c: ¥¯¥é¥¹ÄêµÁÆâ¤Îself¤¬¥¯¥é¥¹ÄêµÁ³°Éô¤Îthe_class¤À¤Ã¤¿¡¥
+	* include/ruby/ruby.h (RB_GC_GUARD): remove comment unsupported by
+	  Solaris AS.
 
-	* variable.c(rb_name_class): ¥¯¥é¥¹Ì¾¤ò¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô¤Ë³ÊǼ¤¹¤ë¡¥
+	Hidden objects (klass == 0) are not visible to Ruby code invoked
+	from other threads or signal handlers, so they can never be
+	accessed from other contexts.  This makes it safe to call
+	rb_gc_force_recycle on the object slot after releasing malloc
+	memory.
 
-Thu Feb 16 15:36:17 1995  Yukihiro Matsumoto  (matz@ix-02)
+	* marshal.c (rb_marshal_dump_limited): hide dump_arg and recycle when
+	  done (rb_marshal_load_with_proc): hide load_arg and recycle when done
+	  [ruby-core:79518]
 
-	* parse.y: BLOCK¤òbrace¤Çɽ¸½¤¹¤ëʸˡ¤ËÊѹ¹¤·¤¿¤â¤Î¤òºî¤Ã¤Æ¤ß¤ë¡¥
-	  ML¤ËÄ󼨤·¤Æ¤ß¤ë¤¬È¿±þ¤¬¤Ê¤¤¡¥
+	* marshal.c (rb_marshal_dump_limited): do not free dump_arg, which
+	  may be dereferenced in check_dump_arg due to continuation, and
+	  get rid of dangling pointers.
 
-	* object.c(do,forever): ¤Ê¤¯¤·¤¿¡¥
+	* marshal.c (rb_marshal_load_with_proc): ditto for load_arg.
 
-Wed Feb 15 13:20:49 1995  Yukihiro Matsumoto  (matz@ix-02)
+Wed Aug  9 17:28:35 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* re.c(new): Âè2°ú¿ô¤¬Í¿¤¨¤é¤ì¤Æ¡¤¤«¤Änil¤Ç¤Ê¤¤¤È¤­¤À¤±ÀßÄꤹ¤ë¤è
-	  ¤¦¤Ë(°ÊÁ°¤Ïnil¤Î»þ¤Ë¤âÀßÄê¤ò¹Ô¤Ê¤Ã¤Æ¤¤¤¿)¡¥
+	* eval.c (setup_exception): make unfrozen copy of special
+	  exception before setting up a cause.
 
-	* parse.y(parse_regexp): Àµµ¬É½¸½¥ê¥Æ¥é¥ë¤ÇÂçʸ»ú¾®Ê¸»ú¤ò̵»ë¤¹¤ë
-	  ¤«¤É¤¦¤«»ØÄê¤Ç¤­¤ë¤è¤¦¤Ë¡¥
+Wed Aug  9 17:22:29 2017  TAKANO `takano32' Mitsuhiro  <tak@no32.tk>
 
-Tue Feb 14 00:55:33 1995  Yukihiro Matsumoto  (matz@dyna)
+	a64: fix crash on register stack mark/sweep pass
 
-	* parse.y: (compexpr) -> (expr).
+	* thread_pthread.c: move 'register_stack_start' earlier.
+	  [ruby-core:79928] [Bug #13284] [Fix GH-1625]
 
-Fri Feb 10 16:30:00 1995  Yukihiro Matsumoto  (matz@ix-02)
+	Author:    Sergei Trofimovich <slyfox@gentoo.org>
 
-	* ruby.c(load_file): script¤òÆɤ߹þ¤à»þ¤À¤±"#!"¤Î²òÀϤò¹Ô¤¦¤è¤¦¤Ë¡¥
+Wed Aug  9 17:10:27 2017  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* ruby.c(readin): ¥Õ¥¡¥¤¥ëÆɤ߹þ¤ß»þ¤ËÀèƬ¤Ë"#!"¤¬¤¢¤ê¡¤ruby¤Ë°ú¿ô
-	  ¤¬Í¿¤¨¤é¤ì¤Æ¤¤¤ì¤Ð¡¤¤½¤Î°ú¿ô¤âÍ­¸ú¤Ë¤Ê¤ë¡¥
+	* test/net/smtp/test_smtp.rb (test_tls_connect, test_tls_connect):
+	  use Socket.tcp_server_sockets in case localhost is resolved to ::1.
 
-	* parse.y(yylex): ¥³¥á¥ó¥È¹Ô¤Î½ª¤ê¤¬`\'¤Ç¤¢¤Ã¤¿»þ¡¤¼¡¤Î¹Ô¤Ë·Ñ³¤·
-	  ¤Æ¤¤¤ë¤È¤ß¤Ê¤¹¤è¤¦¤Ë¤·¤¿¡¥
+Wed Aug  9 17:10:27 2017  Shugo Maeda  <shugo@ruby-lang.org>
 
-Thu Feb  9 16:18:37 1995  Yukihiro Matsumoto  (matz@ix-02)
+	* lib/net/smtp.rb (tlsconnect): support timeout for TLS handshake.
+	  [ruby-core:76893] [Bug #12678]
 
-	* version 0.66
+	* lib/net/protocol.rb (ssl_socket_connect): new method to implement
+	  timeout for TLS handshake.
 
-	* parse.y: protect¤òbegin¤ËÊѹ¹¡¥begin..end¤ÏÎã³°½èÍý¤À¤±¤Ç¤Ê¤¯¡¤
-	  ʸ³ç¸Ì¤È¤·¤Æ¤âƯ¤¯¤³¤È¤Ë¤Ê¤Ã¤¿¡¥
+	* lib/net/http.rb (connect): use Net::Protocol#ssl_socket_connect.
 
-Wed Feb  1 19:48:24 1995  Yukihiro Matsumoto  (matz@ix-02)
+Wed Aug  9 17:08:01 2017  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* version 0.65
+	Zlib::GzipReader#pos underflows after calling #ungetbyte or #ungetc at start of file [Bug #13616]
 
-	* string.c(str_replace): ÃÖ¤­´¹¤¨¤ëʸ»úÎó¤ÎŤµ¤¬Åù¤·¤¤»þ¥á¥â¥ê¥³
-	  ¥Ô¡¼¤ò¤·¤Ê¤¤¡¥
+	patched by Andrew Haines <andrew@haines.org.nz> [ruby-core:81488]
+	zlib.c: fix unnormalized Fixnum
 
-	* string.c(rindex): ¥Ð¥°½¤Àµ¡¥
+	* ext/zlib/zlib.c (rb_gzfile_total_out): cast to long not to
+	  result in an unsigned long to normalized to Fixnum on LLP64
+	  platforms.  [ruby-core:81488]
 
-Mon Jan 30 11:23:05 1995  Yukihiro Matsumoto  (matz@ix-02)
+Wed Aug  9 17:03:00 2017  Eric Wong  <normalperson@yhbt.net>
 
-	* parse.y(value_expr): if¤Î¥Á¥§¥Ã¥¯¤òÄɲá¥
+	process.c: handle dynamic :rlimit_* symbols in spawn execopts
 
-	* gc.c(gc_mark): free cell¤Î°·¤¤¤Ë¥Ð¥°¡¥
+	* process.c (rb_execarg_addopt_rlimit): hoist out of rb_execarg_addopt
+	  (rlimit_type_by_sym): new wrapper for dynamic symbol
+	  (rb_execarg_addopt): check for dsym via rlimit_type_by_sym
+	* test/ruby/test_process.rb (test_execopts_rlimit): check dsym w/o pindown
+	  Add extra check for bogus rlimit args, too.
+	  [ruby-core:82033] [Bug #13744]
+	process.c: null bytes
 
-	* parse.y: ʸˡ¤ÎÊѹ¹(¤è¤ê¥·¥ó¥×¥ë¤Ë)¡¥Îã³°¤ò¸º¤é¤·¤¿¡¥
+	* process.c (rlimit_type_by_sym): prohibit null bytes in key
+	  names.  [ruby-core:82033] [Bug #13744]
 
-Thu Jan 26 00:52:55 1995  Yukihiro Matsumoto  (matz@dyna)
+Wed Aug  9 16:56:52 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* parse.y: °ú¿ô¤È¤·¤ÆÏ¢ÁÛÇÛÎó¤òÃÖ¤¯¤³¤È¤¬¤Ç¤­¤ë¤è¤¦¤Ë¡¥¤³¤Î¾ì¹ç¡¤
-	  Ï¢ÁÛÇÛÎó¥ê¥Æ¥é¥ë¤¬ºÇ½ª°ú¿ô¤È¤Ê¤ë¡¥
+	optparse.rb: get rid of eval
 
-	* parse.y: ÇÛÎ󻲾ȤÎ`[]'Æ⤬¶õ¤Ç¤â¤è¤¤¤³¤È¤Ë¤·¤¿¡¥
+	* lib/optparse.rb: try Float() and Integer() instead of eval,
+	  which does too much things.
 
-Tue Jan 24 14:45:15 1995  Yukihiro Matsumoto  (matz@ix-02)
 
-	* class.c(rb_include_module): `-v'¤ò»ØÄꤷ¤¿»þ¤Ë¤Ïinclude¤·¤¿¥â¥¸¥å¡¼
-	  ¥ë¤È¥¯¥é¥¹Äê¿ô¤¬¾×Æͤ·¤Æ¤¤¤Ê¤¤¤«¥Á¥§¥Ã¥¯¤¹¤ë¡¥
+Fri Jul  7 10:58:10 2017  Eric Wong  <e@80x24.org>
 
-Mon Jan 23 10:42:09 1995  Yukihiro Matsumoto  (matz@ix-02)
+	This backport of r58812 is necessary to ease backporting r59028,
+	which fixes a real bug.
 
-	* parse.y(rb_class2name): ¥á¥¿¥¯¥é¥¹¤Ë´Ø¤¹¤ëbug fix.
+	* thread.c (struct waiting_fd): declare
+	  (rb_thread_io_blocking_region): use on-stack list waiter
+	  (rb_notify_fd_close): walk vm->waiting_fds instead
+	  (call_without_gvl): remove old field setting
+	  (th_init): ditto
+	  [Feature #9632]
 
-	* dict.c: Dict[..]¤Ç¼­½ñ¤ÎÀ¸À®¤¬½ÐÍè¤ë¤è¤¦¤Ë¡¥
+	* vm_core.h (typedef struct rb_vm_struct): add waiting_fds list
 
-	* array.c: Array[..]¤ÇÇÛÎó¤ÎÀ¸À®¤¬½ÐÍè¤ë¤è¤¦¤Ë¡¥
+	* (typedef struct rb_thread_struct): remove waiting_fd field
+	  (rb_vm_living_threads_init): initialize waiting_fds list
 
-	* parse.y: ¼­½ñ¤Îɽ¸½¤È¤·¤Æ{a,b,..}¤È¤¤¤¦·Á¼°¤âµö¤¹¤è¤¦¤Ë¡¥
+	This should fix bad interactions with test_race_gets_and_close
+	in test/ruby/test_io.rb since we ensure rb_notify_fd_close
+	continues returning the busy flag after enqueuing the interrupt.
 
-Fri Jan 20 10:28:38 1995  Yukihiro Matsumoto  (matz@ix-02)
+	* thread.c (rb_notify_fd_close): do not enqueue multiple interrupts
+	  [ruby-core:81581] [Bug #13632]
 
-	* re.c(Regexp.quote): Àµµ¬É½¸½¤ò¥¨¥¹¥±¡¼¥×¤¹¤ë¥á¥½¥Ã¥É¡¥
+	* test/ruby/test_io.rb (test_single_exception_on_close):
+	  new test based on script from Nikolay
 
-	* ̵Â̤Êrb_intern()¤ò¸º¤é¤·¤¿¡¥
+Wed Jul  5 15:55:35 2017  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* parse.y: `!', `!=', `!~'¤òÆüì±é»»»Ò¤Ë¤¹¤ë¡¥¤è¤Ã¤Æ¤³¤ì¤é¤ÏºÆÄêµÁ
-	  ¤Ç¤­¤Ê¤¯¤Ê¤Ã¤¿¡¥
+	* ext/openssl/ossl_cipher.c: remove the encryption key initialization
+	  from Cipher#initialize. This is effectively a revert of r32723
+	  ("Avoid possible SEGV from AES encryption/decryption", 2011-07-28).
+	  the patch is derived from https://github.com/ruby/openssl/commit/8108e0a6db133f3375608303fdd2083eb5115062,
+	  written by Kazuki Yamaguchi.
+	  [Backport #8221]
 
-Wed Jan 18 13:20:41 1995  Yukihiro Matsumoto  (matz@ix-02)
+Sat Jul  1 00:28:22 2017  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
 
-	* parse.y: ʸˡ¤ÎÀ°Íý(unless,until¤ò¤Ê¤¯¤·¤¿)¡¥
+	* ext/psych/yaml: update libyaml to 0.1.7.
 
-Tue Jan 17 11:11:27 1995  Yukihiro Matsumoto  (matz@ix-02)
+	* ext/psych/psych.gemspec: bump version to 2.1.0.1.
 
-	* eval.c: def¤Ç¥á¥½¥Ã¥ÉºÆÄêµÁ»þ¤Ë¤Ï¥¹¡¼¥Ñ¡¼¥¯¥é¥¹¤Î¥á¥½¥Ã¥É¤Î²Ä»ë
-	  À­¤ò·Ñ¾µ¤¹¤ë¡¥ºÇ½é¤ÎÄêµÁ¤Î»þ¤Ïº£¤Þ¤Ç¤ÈƱ¤¸¥Ç¥Õ¥©¥ë¥È(¥È¥Ã¥×¥ì¥Ù
-	  ¥ë¤Ç´Ø¿ôŪ¡¤¥¯¥é¥¹ÄêµÁÆâ¤ÇÄ̾ï¥á¥½¥Ã¥É)¡¥
+Fri Jun 30 22:05:39 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* object.c(Class::new): ¥ª¥Ö¥¸¥§¥¯¥È¤ÎÀ¸À®»þ¤Ë´Ø¿ôŪ¥á
-	  ¥½¥Ã¥Éinit_object¤¬É¬¤º¸Æ¤Ð¤ì¤ë¤è¤¦¤ËÊѹ¹¡¥
+	* parse.y (parser_precise_mbclen): check invalid multibyte char at
+	  skipping strings following ?x literal string, not to stuck in a
+	  infinite loop. [Bug #13672]
 
-	* eval.c: ̤ÄêµÁ¤Î¥á¥½¥Ã¥É¤ËÂФ·¤Æunknown¥á¥½¥Ã¥É¤¬¸Æ¤Ð¤ì¤ë¤è¤¦¤Ë
-	  ¤Ê¤Ã¤¿¡¥¥¨¥é¡¼É½¼¨¤¬º£¤Þ¤Ç¤ÈƱ¤¸¤Ë¤Ê¤ë¤è¤¦¤Ëenv¤òÄ´Àᤷ¤Æ¤¤¤ë¡¥
+Fri Jun 30 22:00:56 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Jan 13 14:40:30 1995  Yukihiro Matsumoto  (matz@ix-02)
+	* ext/pathname/lib/pathname.rb (Pathname#plus): UNC root pathname needs
+	  a separator. File.basename returns "/" on UNC root, as well as sole
+	  drive letter, even if it does not end with a separator. [Bug #13515]
 
-	* gc.c: gc¤ò¼ã´³½ñ¤­´¹¤¨¤ÆÀ°Íý¤·¤¿¡¥¤¬¡¤¤¢¤Þ¤êÊѲ½¤Ï¤Ê¤«¤Ã¤¿¤è¤¦¤À¡¥
+Fri Jun 30 21:57:27 2017  Kouhei Sutou  <kou@cozmixng.org>
 
-	* parse.y(yylex): symbol¤ò\sym¤«¤é:sym¤ËÊѹ¹¤·¤¿¡¥
+	* lib/rexml/parsers/streamparser.rb: add close tag check on end of
+	  document to StreamParser [Bug #13636]
+	  Reported by Anton Sivakov. Thanks!!!
 
-Thu Jan 12 01:39:28 1995  Yukihiro Matsumoto  (matz@dyna)
+Fri Jun 30 21:54:01 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c: ¿·µ¬´Ø¿ô rb_eval_string()¡¥
+	* array.c (rb_ary_insert): check position to insert even if no elements
+	  to be inserted. [Bug #13558]
 
-	* gc.c: gc_mark()¤ò°ìÉôÈóºÆµ¢²½¡¥
+Fri Jun 30 21:51:40 2017  Marcus Stollsteimer  <sto.mar@web.de>
 
-	* variable.c(rb_ivar_{get,set}): ¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô¤Î¥¢¥¯¥»¥¹¼þ¤ê¤Ç
-	  ¥Á¥§¥Ã¥¯¤¬Â­¤ê¤Ê¤«¤Ã¤¿¡¥
+	* ext/date/date_core.c: [DOC] fix documentation for %Z format of
+	  {Date,DateTime}.strftime.
+	  Reported by Damon Timm. Based on a patch by nano.
+	  [Bug #13231] [Fix GH-1565]
 
-	* variable.c: ¥¯¥é¥¹Äê¿ô¤È¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô¤Ç¥Ï¥Ã¥·¥å¥Æ¡¼¥Ö¥ë¤ò¶¦Í­
-	  ¤¹¤ë¤è¤¦¤Ë¤·¤¿¡¥
+Fri Jun 30 21:46:50 2017  Kouhei Sutou  <kou@cozmixng.org>
 
-	* ruby.h: iv_tbl¤òRBasic¤«¤éRObject¤ÈRClass¤Ø°ÜÆ°¤·¤¿¡¥¤³¤ì¤Ë¤è¤ê¡¤
-	  Object¤ÈClass,Module¤·¤«¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô¤ò»ý¤Æ¤Ê¤¯¤Ê¤ë¡¥¤¬¡¤¥á¥â
-	  ¥ê¸úΨ¤Ï¼ã´³¸þ¾å¤¹¤ë¡¥
+	* lib/rss/rss.rb: Accept empty text element as valid element
+	  Parser has been accepted it but XML serializer wasn't accepted.
+	  Reported by stefano frabetti. Thanks!!!
+	  [Bug #13531]
 
-Tue Jan 10 00:58:20 1995  Yukihiro Matsumoto  (matz@dyna)
+Fri Jun 30 21:40:42 2017  Kazuki Yamaguchi <k@rhe.jp>
 
-	* 0.64 released
+	* ext/openssl/ossl_x509store.c: clear error queue after calling
+	  X509_LOOKUP_load_file()
 
-	* eval.c: ¥ì¥·¡¼¥Ð¤È°ú¿ô¤Ï¾ï¤Ëiter¤Ç¤Ï¤Ê¤¤¡¥
+	  X509_LOOKUP_load_file(), which ends up calling
+	  X509_load_cert_crl_file()
+	  internally, may leave error entries in the queue even when it returns
+	  non-zero value (which indicates success).
 
-	* cons.c(aref,aset): negative offsetÂбþ¡¥
+	  This will be fixed by OpenSSL 1.1.1, but can be worked around by
+	  clearing the error queue ourselves.
 
-Mon Jan  9 14:40:39 1995  Yukihiro Matsumoto  (matz@ix-02)
+	  Fixes: [Backport #11033]
 
-	* parse.y: foo{..}¤Î·Á¼°¤Ë¤ª¤¤¤Æ¡¤foo¤ò¥í¡¼¥«¥ëÊÑ¿ô¤ä¥¯¥é¥¹Ì¾¤Ç¤Ï
-	  ¤Ê¤¯¡¤°ú¿ô¤Ê¤·¤Î´Ø¿ô·¿¥á¥½¥Ã¥É¸Æ¤Ó½Ð¤·¤È¤ß¤Ê¤¹¤è¤¦¤Ë¤·¤¿¡¥
+Fri Jun 30 21:35:16 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* list.c -> cons.c: ̾¾ÎÊѹ¹(¥¯¥é¥¹Ì¾¤â)¡¥
+	* gc.c (heap_page_allocate): expand sorted pages before inserting
+	  allocated new page. [Bug #12670]
 
-	* list.c: a::b::c::nil¤ò¥ê¥¹¥È(a b c)¤È¤ß¤Ê¤¹lisp·Á¼°¤«¤é¡¤a::b::c
-	  ¤ò¥ê¥¹¥È(a b c)¤È¤ß¤Ê¤¹ruby·Á¼°¤ËÊѹ¹¡¥[], []=, each¤â¤½¤ì¤Ë²ñ¤ï
-	  ¤»¤¿»ÅÍͤȤ¹¤ë¡¥
+Fri Jun 30 21:33:39 2017  Koichi Sasada  <ko1@atdot.net>
 
-	* list.c: cons¥Ú¥¢¤È¤·¤Æ¤Îµ¡Ç½¤ò¶¯Ä´¡¥»ÅÍÍÊѹ¹¡¥
+	* gc.c (heap_page_resurrect): do not return tomb_pages when
+	  page->freelist == NULL.
+	  [Bug #12670]
 
-Sat Jan  7 01:26:26 1995  Yukihiro Matsumoto  (matz@dyna)
+Fri Jun 30 21:23:20 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c: ¼«¸ÊÂåÆþ¤ÎÉÔ¶ñ¹ç½¤Àµ¡¥
+	* vsnprintf.c (BSD_vfprintf): sign and hex-prefix should not be counted
+	  in precision. [Bug #8916]
 
-	* eval.c(masign): ¿½ÅÂåÆþ¤¬ÇÛÎó¤â¥ê¥¹¥È¤â¤È¤ì¤ë¤è¤¦¤Ë¤·¤¿¡¥
+Fri Jun 30 21:20:14 2017  Koichi Sasada  <ko1@atdot.net>
 
-	* list.c: assoc¤ò2Í×ÁǤÎÇÛÎ󤫤éList(CONS¥Ú¥¢)¤ËÊѹ¹¤·¤¿¡¥
+	* thread.c (ruby_thread_stack_overflow): disable VM events when stack
+	  overflow occurred; it causes another stack overflow again in making
+	  backtrace object, and crashes. [Bug #13425]
 
-Fri Jan  6 13:42:12 1995  Yukihiro Matsumoto  (matz@ix-02)
+	* vm.c (hook_before_rewind): skip rewind hooks if err is
+	  SystemStackError because rewind hooks can cause stack overflow again
+	  and again.
 
-	* parse.y: a[b]+=c¤äa.b+=c¤Ê¤É¤Î¼«¸ÊÂåÆþ·Á¼°¤Ç¡¤a¤äb¤ò2ÅÙɾ²Á¤·¤Ê
-	  ¤¯¤Ê¤Ã¤¿¡¥
+	* thread.c (ruby_thread_stack_overflow): do not disable all hooks.
+	  Additionally, clearing ruby_vm_event_flags is not suitable way
+	  to disable hooks.
 
-	* eval.c: iteratorÀßÄê¤Î¥Ð¥°¥Õ¥£¥Ã¥¯¥¹¡¥
+Fri Jun 30 21:13:25 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* list.c: List¥¯¥é¥¹¤ò¿·Àß¡¥
+	* proc.c (method_super_method): skip prepended modules and continue from
+	  the super class of the original class. [Bug #13656]
 
-Thu Jan  5 13:55:00 1995  Yukihiro Matsumoto  (matz@ix-02)
+Fri Jun 30 21:10:48 2017  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* parse.y: SCOPE¤Î¥á¥â¥ê¥ê¡¼¥¯¤ò¤Ê¤¯¤·¤¿¡¥
+	* lib/net/smtp.rb (getok, get_response): raise an ArgumentError when
+	  CR or LF is included in a line, because they are not allowed in
+	  RFC5321.  Thanks, Jeremy Daer.
 
-	* eval.c: built-in¥á¥½¥Ã¥É¤Ø¤Î°ú¿ô¤Î°ú¤­ÅϤ·Êý¤òÊѹ¹¤·¤Æ¡¤ÇÛÎó¤ÎÀ¸
-	  À®¿ô¤ò¸º¤é¤·¤¿¡¥
+Fri Jun 30 21:07:56 2017  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* re.c: match-data¤òËè²óÀ¸À®¤¹¤ë¤³¤È¤ò¤ä¤á¤¿¡¥`$~'¤ò¥¢¥¯¥»¥¹¤·¤¿»þ
-	  ¤Ëon-demand¤ÇÀ¸À®¤¹¤ë¡¥
+	* eval.c (exc_setup_cause): need to unfreeze(=dup) the exception before
+	  setting cause if its frozen.
 
-	* string.c etc: ÉÔɬÍפÊmemmove¤òmemcpy¤ËÃÖ´¹¡¥
+Fri Jun 30 21:07:14 2017  Eric Wong  <e@80x24.org>
 
-	* parse.y: =~, !~¤ÏÉûºîÍѤ¬¤¢¤ë¤Î¤Ç¥³¥ó¥Ñ¥¤¥ë»þ¤ËŸ³«¤Ç¤­¤Ê¤¤¡¥
+	thread.c: avoid busy looping on rb_thread_fd_close
 
-Tue Jan  3 02:04:36 1995  Yukihiro Matsumoto  (matz@dyna)
+	We no longer use it this function, but extensions do, and
+	we need to ensure it continues to work for them.
 
-	* eval.c: rest°ú¿ô¤Îbug fix.
+	* thread.c (rb_thread_fd_close): schedule other threads in loop
 
-	* eval.c,gc.c: scope¤ò¥ª¥Ö¥¸¥§¥¯¥È¤Ë¤·¤¿¡¥
+	* ext/-test-/thread_fd_close/thread_fd_close.c: new file
 
-	* eval.c: env¤Èscope¤Î°·¤¤¤òÊѹ¹¤·¤¿¡¥
+	* ext/-test-/thread_fd_close/depend: ditto
 
-Wed Dec 28 09:46:57 1994  Yukihiro Matsumoto  (matz@ix-02)
+	* ext/-test-/thread_fd_close/extconf.rb: ditto
 
-	* parse.y: eval¤Ç¥í¡¼¥«¥ëÊÑ¿ô¤¬Äɲ䵤줿¾ì¹ç¤ËÂбþ¤·¤¿¡¥
+	* test/-ext-/thread_fd_close/test_thread_fd_close.rb: new test
 
-	* parse.y: ±é»»»Ò¤ò´Þ¤àalias¤Îbug fix.
+Fri Jun 30 20:34:49 2017  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-Tue Dec 27 16:45:20 1994  Yukihiro Matsumoto  (matz@ix-02)
+	* sample/pty/shl.rb: update sample
+	  * Specify frozen_string_literal: true.
+	  * Fix TypeError of raise.
+	  * Use a character literal instead of Integer.
 
-	* parse.y: def A B¤òalias A B¤ËÊѹ¹¡¥
+Fri Jun 30 20:31:59 2017  Marcus Stollsteimer  <sto.mar@web.de>
 
-	* eval.c: alias´Ø·¸¤Îbug½¤Àµ¡¥node¤ò¥ª¥Ö¥¸¥§¥¯¥È²½¤·¤¿»þ¤Ëenbug¤·
-	  ¤¿¤è¤¦¤À¡¥
+	* string.c: [DOC] clarify docs for String#split when called with limit
+	  and capture groups. Reported by Cichol Tsai. [Bug #13621]
 
-	* signal.c: ¥·¥¹¥Æ¥à¥³¡¼¥ë¤ÎºÆÄêµÁ¤ò»ß¤á¤¿¡¥
+Fri Jun 30 20:23:31 2017  Takashi Kokubun  <takashikkbn@gmail.com>
 
-	* io.c(select): write/except¤Î¥Õ¥é¥°ÀßÄê¤Ë¥Ð¥°¡¥
+	* lib/erb.rb: Allow explicit trimming carriage return when trim_mode is
+	  "-", for Windows environments. [Bug #5339]
 
-	* Makefile.in: static linkÍÑ¥ª¥×¥·¥ç¥ó¤òMakeÊÑ¿ô¤È¤·¤ÆÆÈΩ¤µ¤»¤¿¡¥
+	* lib/erb.rb: Allow trimming CR in all trim_modes to unify a behavior
+	  with r58823 and r58825.
 
-Tue Dec 20 00:46:19 1994  Yukihiro Matsumoto  (matz@dyna)
+Fri Jun 30 20:16:15 2017  Takashi Kokubun  <takashikkbn@gmail.com>
 
-	* 0.63 released
+	* lib/erb.rb: Allow trimming carriage return when trim_mode is "<>", for
+	  Windows environments. [Bug #11464]
 
-	* eval.c(rb_call): super¤Î¸Æ¤Ó½Ð¤·¤ÇÍî¤Á¤ë¡¥argc, argv¤ÎÀßÄê¤ò˺¤ì
-	  ¤Æ¤¤¤¿¡¥
+Fri Jun 30 20:07:37 2017  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* parse.y(read_escape): Ÿ³«¥¨¥é¡¼¡¥
+	* util.c (ruby_strtod) Merge latest dtoa.c [Bug #13545]
+	  Apply some part of http://www.netlib.org/fp/dtoa.c with my eyes...
 
-	* variable.c: ÄêµÁºÑ¤ß¤ÎÊÑ¿ô¤Îhook¤òÊѹ¹¤·¤Ê¤¤¤è¤¦¤Ë¡¥
+Fri Jun 30 20:00:18 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Dec 19 12:01:10 1994  Yukihiro Matsumoto  (matz@ix-02)
+	* dir.c (is_case_sensitive): use getattrlist() if fgetattrlist() is
+	  unavailable, on OSX 10.5. [Bug #11054]
 
-	* parse.y(cond): ¾ò·ï¼°¤ËÂåÆþ¼°¤¬ÃÖ¤«¤ì¤¿¾ì¹ç¡¤`-v'¥ª¥×¥·¥ç¥ó¤Ç·Ù
-	  ¹ð¤¬½Ð¤ë¤è¤¦¤Ë¡¥
+Fri Jun 30 19:58:16 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* parse.y(**): ÑѾè±é»»»Ò`**'¤ÎÍ¥Àè½ç°Ì¤òñ¹à±é»»»Ò¤è¤ê¹â¤¯¤·¤¿¡¥
+	* tool/mkconfig.rb (RbConfig): prefix SDKROOT to oldincludedir
+	  not includedir, the latter is outside the ruby installation.
+	  [ruby-core:72496] [Bug #11881]
 
-	* parse.y(and,or): Í¥Àè½ç°Ì¤ÎÄ㤤±é»»»Ò`and', `or'.
+Fri Jun 30 19:56:06 2017  Eric Wong  <e@80x24.org>
 
-	* 0.62 released.
+	* variable.c (check_autoload_required): do not assume a provided feature
+	  means autoload is complete, always wait if autoload is being performed
+	  by another thread. [Bug #11384] Thanks to s.wanabe@gmail.com
 
-	* eval.c: ÉÔɬÍפˤʤä¿PUSH_ENV, POP_ENV¤ò¸º¤é¤·¤¿¡¥
+Fri Jun 30 19:53:30 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* env.h: ENVION¤«¤éself¤ò¤Ï¤º¤·¤¿¡¥PUSH_ENV¤Ïsuper¤Î½àÈ÷¤Î¤¿¤á¤À¤±
-	  ¤ËÍѤ¤¤ë¤³¤È¤Ë¤·¤¿¡¥
+	* process.c (obj2uid, obj2gid): use temporary string as the buffer
+	  instead of rb_alloc_tmp_buffer, which is NODE_ALLOCA since r51492.
+	  [Bug #13554]
 
-	* eval.c: ²¼µ­¤Î¥ª¥Ö¥¸¥§¥¯¥È²½¤ÇÃÙ¤¯¤Ê¤Ã¤¿¼Â¹Ô®ÅÙ¤ò¤â¤È¤ËÌᤷ¤¿¡¥
+Fri Jun 30 19:50:25 2017  Eric Wong  <e@80x24.org>
 
-Mon Dec 17 23:01:10 1994  Yukihiro Matsumoto  (matz@ix-02)
+	* variable.c (autoload_reset): use idempotent list_del_init
 
-	* eval.c: env.{argv,argc}¤Èscope.local_vars¤Î¥ª¥Ö¥¸¥§¥¯¥È²½¡¥
+	* variable.c (autoload_sleep): moved code from rb_autoload_load
 
-	* eval.c: 1¥¹¥³¡¼¥×Æâ¤ÇÊ£¿ôBlock¤òÀ¸À®¤·¤¿¤È¤­¤Î¥Ð¥°¤ò½¤Àµ¡¥
+	* variable.c (autoload_sleep_done): cleanup for use with rb_ensure
 
-Fri Dec 16 15:52:06 1994  Yukihiro Matsumoto  (matz@ix-02)
+	* variable.c (rb_autoload_load): ensure list delete happens in case the
+	  thread dies during sleep
 
-	* parse.y: `&&'¤È`||'¤ÎξÊդϤ¤¤Ä¤Ç¤â¾ò·ï¼°¤È¤·¤¿¡¥
+	* test/ruby/bug-13526.rb: new script for separate execution
 
-Thu Dec 15 00:16:04 1994  Yukihiro Matsumoto  (matz@dyna)
+	* test/ruby/test_autoload.rb (test_bug_13526): new test [Bug #13526]
 
-	* eval.c(Block): Block¥ª¥Ö¥¸¥§¥¯¥È¤ò¼Â¸½¡¥
+Fri Jun 30 19:46:46 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* node.h: NODE_QLIST¤Ï¤Ê¤¯¤Ê¤Ã¤¿¡¥
+	* sprintf.c (rb_str_format): while "% 2f" and "% 4f" result in " Inf"
+	  and " Inf" respectively, "% 3f" results in "Inf" (no space).
 
-	* eval.c(rb_call): °ú¿ô¤Ø¤ÎÂåÆþ¤ò̾Á°¤Ç°ì¤Ä¤º¤ÄÂåÆþ¤¹¤ë¤Î¤ò¤ä¤á¤Æ¡¤
-	  °ìÅ٤˥³¥Ô¡¼¤¹¤ë¤è¤¦¤Ë¤·¤¿¡¥
+	* sprintf.c (rb_str_format): as for non-finite float, calculate the
+	  exact needed size with the space flag.
 
-	* eval.c(rb_call): ruby¤Çµ­½Ò¤µ¤ì¤¿¥á¥½¥Ã¥É¤Ø¤Î°ú¿ôÅϤ·¤òinline²½¡¥
+Fri Jun 30 19:41:48 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* eval.c: ¥¤¥Æ¥ì¡¼¥¿È½Äê½èÍý¤ÎÁ´Ì̽ñ¤­´¹¤¨¡¥ÉÔŬÀڤʥ¤¥Æ¥ì¡¼¥¿¸Æ¤Ó
-	  ½Ð¤·¤ò¤Ê¤¯¤·¤¿¡¥Î㤨¤Ð¡Ö[foo(),bar()]{i|baz(i)}¡×¤Çfoo¤âbar¤â¥¤
-	  ¥Æ¥ì¡¼¥¿¤È¤·¤Æ¸Æ¤Ó½Ð¤µ¤ì*¤Ê¤¤*¡¥
+	* thread_win32.c (w32_wait_events): do not acquire GVL, to fix deadlock
+	  at read/close race condition. instead, just ignore interrupt_event if
+	  it is closed.
 
-	* eval.c(rb_call): SCOPE½èÍý¤òinline²½¡¥¥á¥½¥Ã¥É¸Æ¤Ó½Ð¤·¤Î¼ã´³¤Î¹â
-	  ®²½¡¥
+	* thread_win32.c (w32_wait_events): fix wait object index in the case of
+	  interrupt_event is not usable.
 
-Wed Dec 14 18:09:33 1994  Yukihiro Matsumoto  (matz@ix-02)
+Fri Jun 30 19:37:47 2017  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
 
-	* node.h: node¤â¥ª¥Ö¥¸¥§¥¯¥È¤Ë¤¹¤ë¡¥¤è¤Ã¤ÆGC¤Ç²ó¼ý¤µ¤ì¤ë¡¥
+	* io.c (nogvl_wait_for_single_fd): nogvl_wait_for_single_fd must wait
+	  as its name.
+	  poll(fds, n, 0) mean no timeout and immediately return. If you want to
+	  wait something, you need to use -1 instead.
 
-Thu Dec  8 14:17:29 1994  Yukihiro Matsumoto  (matz@ix-02)
+Fri Jun 30 19:35:31 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* 0.60 released - alpha test baseline.
+	* class.c (Init_class_hierarchy): prevent rb_cObject which is the class
+	  tree root, from GC. [Bug #12492]
+
+Fri Jun 30 19:32:52 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* class.c (Init_class_hierarchy): prevent rb_cObject which is the
+	  class tree root, from GC.  [ruby-dev:49666] [Bug #12492]
+
+Fri Jun 30 19:29:45 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/ripper/lib/ripper/lexer.rb (on_heredoc_dedent): fix for nested
+	  indedented here documents, where Elems are nested too. [Bug #13536]
+
+	* ext/ripper/lib/ripper/lexer.rb (on_heredoc_dedent): insert stripped
+	  leading spaces as on_ignored_sp elements, so that the original source
+	  can be reconsructed. [Bug #13536]
+
+Mon May  1 06:36:57 2017  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* parse.y (parser_parse_string): set the mark of term to `nd_func`
+	  because in this version `u2.id` is not used for this purpose.
+	  fixed failure of ruby/spec introduced at r58518.
+	  see also [Backport #13363]
+
+Sun Apr 30 23:01:00 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	class.c: ensure_includable
+
+	* class.c (ensure_includable): extract checks to include and
+	  prepend.
+
+	class.c: prohibit refinement module
+
+	* class.c (ensure_includable): cannot include refinement
+	  module, or the type and the class do not match.
+	  [ruby-core:79632] [Bug #13236]
+
+Sun Apr 30 22:55:41 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	keep line number after unterminated string literal
+
+	* parse.y (parser_parse_string): keep line number even after an
+	  unterminated string literal.  it does not matter in the parser,
+	  ripper needs this value after this error.
+
+	parse.y: unterminated content token
+
+	* parse.y (parser_parse_string): defer the end token to next
+	  reading, to yield tSTRING_CONTENT with the unterminated content.
+	  [Bug #13363]
+
+Sun Apr 30 22:52:38 2017  Marcus Stollsteimer  <sto.mar@web.de>
+
+	* io.c: [DOC] expand docs for IO#puts
+	  [Bug #13306]
+
+Sun Apr 30 22:38:44 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	sample/pty/shl.rb: update [ci skip]
+
+	* sample/pty/shl.rb: stop writer loop when the child exited.
+	  PTY::ChildExited no longer raises asynchronously since r20298.
+	  [ruby-dev:49974] [Bug #13191]
+
+	* sample/pty/shl.rb: use io/console instead of stty.
+	  [ruby-dev:49974] [Bug #13191]
+
+	* sample/pty/shl.rb: do not manage array length separately.
+	  [ruby-dev:49974] [Bug #13191]
+
+	* sample/pty/shl.rb: leap exited child process.
+	  [ruby-dev:49974] [Bug #13191]
+
+Sun Apr 30 22:35:10 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	configure.in: use AC_SEARCH_LIBS
+
+	* configure.in (--with-gmp, --with-jemalloc): use AC_SEARCH_LIBS
+	  to check if no library is required, instead of AC_CHECK_LIB.
+	  [ruby-core:79368] [Bug #13175]
+
+Sun Apr 30 22:24:25 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* numeric.c (flo_round): [EXPERIMENTAL] adjust the case that the
+	  receiver is close to the exact but unrepresentable middle value
+	  of two values in the given precision.
+	  http://d.hatena.ne.jp/hnw/20160702
+
+Sun Apr  9 22:21:23 2017  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	thread.c: rb_thread_fd_close [ci skip]
+
+	* thread.c (rb_thread_fd_close): re-define because of a couple of
+	  external libraries used it.
+
+Wed Mar 29 23:47:31 2017  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+
+	* hash.c (any_hash): fix CI failure on L32LLP64 architecture.
+	  The patch was provided by usa. [ruby-core:80484] [Bug #13376]
+
+Wed Mar 29 06:22:27 2017  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+
+	* hash.c (any_hash): fix Symbol#hash to be nondeterministic.
+	  The patch was provided by Eric Wong. [ruby-core:80433] [Bug #13376]
+
+	* test/ruby/test_symbol.rb: add test for above.
+
+Tue Mar 28 00:38:39 2017  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (poll_child_status): rb_w32_wait_events_blocking() sets
+	  errno internally, then should not set it here.
+
+Mon Mar 27 20:15:17 2017  Kazuki Tsujimoto  <kazuki@callcc.net>
+
+	* eval.c, method.h, proc.c, vm.c, vm_eval.c, vm_insnhelper.c, vm_method.c:
+	  TracePoint#method_id should return method_id, not callee_id.
+	  [ruby-core:77241] [Feature #12747]
+
+	* test/ruby/test_settracefunc.rb: change accordingly.
+
+Mon Mar 27 20:12:23 2017  Anton Davydov  <mail@davydovanton.com>
+
+	* lib/uri/mailto.rb: Removed needless `return` and use `.`` instead of `::`
+	  with class method.
+	* test/uri/test_mailto.rb: Added tests for coverage.
+
+Mon Mar 20 06:35:08 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ruby.c (process_options): convert -e script to the encoding
+	  given by a command line option on Windows.  assume it is the
+	  expected encoding.  [ruby-dev:49461] [Bug #11900]
+
+Mon Mar 20 05:47:49 2017  Koichi Sasada  <ko1@atdot.net>
+
+	* test/ruby/test_exception.rb: fix thread issues.
+	  * use Queue instead of a local variable for synchronization.
+	  * join created thread to soleve leaking threads warning.
+
+Mon Mar 20 05:47:49 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* thread.c (rb_threadptr_raise): set cause from the called thread,
+	  but not from the thread to be interrupted.
+	  [ruby-core:77222] [Bug #12741]
+
+Wed Feb  8 02:17:02 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/forwardable.rb (Forwardable._delegator_method): extract
+	  method generator and deal with non-module objects.
+	  [ruby-dev:49656] [Bug #12478]
+
+Wed Feb  8 02:17:02 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/forwardable.rb (def_instance_delegator): adjust backtrace of
+	  method body by tail call optimization.  adjusting the delegated
+	  target is still done by deleting backtrace.
+
+	* lib/forwardable.rb (def_single_delegator): ditto.
+
+Tue Jan 17 03:51:48 2017  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (setup_args): duplicate splatting array if more
+	  arguments present to obey left-to-right execution order.
+	  [ruby-core:77701] [Bug# 12860]
+
+Thu Nov 24 05:47:18 2016  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+
+	* test/fileutils/test_fileutils.rb (TestFileUtils#setup): Use primary
+	  group as well as supplementary groups.
+	  based on the patch by Vit Ondruch at [Bug #12910]
+
+Thu Nov 24 05:44:04 2016  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+
+	* test/ruby/test_dir_m17n.rb: Don't encode to UTF-8 if it's unnecessary.
+	  If the file system encoding is ISO-8851-1 or if the encoding of the
+	  target string is invalid, don't encode to UTF-8. [Bug#12972]
+
+Mon Nov 21 16:55:15 2016  boshan  <boshan@subsplash.com>
+
+	* lib/tempfile.rb (Tempfile#initialize): [DOC] the first parameter
+	  `basename` is optional and defaulted to an empty string since
+	  [GH-523].  [Fix GH-1225]
+
+Sat Nov 19 14:06:07 2016  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+
+	* iseq.c (proc_dup): don't duplicate sym_procs.  [Fix GH-1479]
+	  [ruby-core:78100] [Bug #12927]
+	  Based on the patch provided by Emiliano Ritiro.
+
+Sat Nov 19 11:48:47 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* iseq.c (iseqw_s_compile_file): deal with syntax error as well as
+	  compile, and should not abort when rescued.
+
+Wed Nov 16 23:40:29 2016  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+
+	* vm_eval.c (vm_call0_body): refined module should not be skipped as
+	  prepended. [Bug #12920]
+
+Tue Nov 15 03:14:02 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/-test/file/fs.c (get_atime_p): Updating of file access times
+	  is enabled or not.
+
+Tue Nov 15 03:14:02 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* test/ruby/test_file.rb (TestFile#test_stat): fix noatime case.
+	  [ruby-core:77943] [Bug #12903]
+
+Tue Nov 15 03:09:39 2016  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* test/rinda/test_rinda.rb (test_make_socket_ipv6_multicast,
+	  test_make_socket_ipv6_multicast_hops): skip if IPv6 multicast 
+	  address is not available.
+
+Tue Nov 15 02:49:30 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_eval.c (vm_call0_body): follow the original class, not to
+	  loop the prepended module.  [ruby-core:77784] [Bug #12876]
+
+Tue Nov 15 02:45:44 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/net/http.rb (transport_request): other than HTTPContinue
+	  in 1xx (HTTPInformation) also needs to continue. [Bug #12890]
+
+Sat Nov 12 01:05:45 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* object.c: Improve documentation for Float conversion.
+	  [ruby-core:71661][Bug #11736][ci skip]
+
+Sat Nov 12 00:50:35 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* proc.c (mnew_internal): follow the original class, not to loop
+	  the prepended module.  [ruby-core:77591] [Bug #12832]
+
+Sat Nov 12 00:46:50 2016  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* cont.c (cont_new): disable optimization if clang's version is
+	  3.8.0.  [ruby-core:77894] [Bug #12893]
+
+Sat Nov 12 00:27:24 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (iseq_peephole_optimize): enable tail call
+	  optimization inside a conditional block.
+
+Sat Nov  5 11:53:17 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (copy_stream_body): use IO to write to copy to duplex IO.
+	  http://twitter.com/knu/status/786505317974585344
+
+Sat Nov  5 11:49:41 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* sprintf.c (rb_str_format): format exact number more exactly.
+
+Sat Nov  5 11:45:32 2016  Kazuki Yamaguchi  <k@rhe.jp>
+
+	* ext/openssl/ossl.c (Init_openssl): register an ex_data index for
+	  X509_STORE and X509_STORE_CTX respectively. Since they don't share
+	  the ex_data index registry, we can't use the same index.
+	  (ossl_verify_cb): use the the correct index.
+
+	* ext/openssl/ossl_ssl.c (ossl_ssl_verify_callback): ditto.
+
+	* ext/openssl/ossl_x509store.c (ossl_x509store_set_vfy_cb): ditto.
+	  (ossl_x509stctx_verify): ditto.
+
+	* ext/openssl/ossl.h (void ossl_clear_error): add extern declarations
+	  of ossl_store_{ctx_,}ex_verify_cb_idx.
+
+	* ext/openssl/openssl_missing.c: remove X509_STORE_set_ex_data and
+	  X509_STORE_get_ex_data.
+
+	* ext/openssl/openssl_missing.h: implement X509_STORE_get_ex_data,
+	  X509_STORE_set_ex_data and X509_STORE_get_ex_new_index as macros.
+
+Sat Nov  5 11:35:58 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* thread.c (rb_thread_pending_interrupt_p): no pending interrupt
+	  before initialization.
+
+	* thread.c (thread_raise_m, rb_thread_kill): uninitialized thread
+	  cannot interrupt.  [ruby-core:72732] [Bug #11959]
+
+Sat Nov  5 11:16:58 2016  Kenta Murata  <mrkn@mrkn.jp>
+
+	* ext/bigdecimal/bigdecimal.c: Import changes from ruby/bigdecimal
+	  repository.
+
+Tue Oct 18 02:58:22 2016  Kazuki Yamaguchi  <k@rhe.jp>
+
+	* eval_intern.h (TH_PUSH_TAG): Initialize struct rb_vm_tag::tag with
+	  Qundef rather than 0 which is equal to Qfalse. Since Kernel#throw(obj)
+	  searches a tag with rb_vm_tag::tag == obj, throw(false) can
+	  accidentally find an unrelated tag which is not created by
+	  Kernel#catch.  [ruby-core:77229] [Bug #12743]
+
+	* test/ruby/test_exception.rb (test_throw_false): Add a test case for
+	  this.
+
+Tue Oct 18 02:24:29 2016  Aurelien Jacobs  <aurel@gnuage.org>
+
+	* lib/logger.rb (Logger::Period#next_rotate_time): fix monthly log
+	  rotate when DST is applied during a month of 31 days.
+	  [Fix GH-1458]
+
+Wed Oct 12 22:31:09 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* tool/downloader.rb: Removed verification of gem certification.
+	  Because signed gem is not working on rubygems ecosystem.
+	* tool/gem-unpack.rb: ditto.
+
+Fri Oct  7 02:48:06 2016  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+
+	* lib/rubygems/ssl_certs/GlobalSignRootCA.pem: add for RugyGems.org.
+
+Mon Sep 26 23:51:31 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* variable.c (rb_const_search): raise with the actual class/module
+	  name which defines the private constant.
+
+Mon Sep 26 23:34:09 2016  Kazuki Yamaguchi  <k@rhe.jp>
+
+	* ext/openssl/ossl_pkcs12.c (ossl_pkcs12_initialize): pop errors
+	  leaked by PKCS12_parse(). This is a bug in OpenSSL, which exists
+	  in the versions before the version 1.0.0t, 1.0.1p, 1.0.2d.
+
+Mon Sep 26 23:10:43 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* vm_dump.c (backtrace): use rip in the saved context for the case
+	  the SIGSEGV is received when the process is in userland.
+	  Note that ip in the stack should be used if the signal is received
+	  when it is in kernel (when it is calling syscall) [Bug #12711]
+
+Mon Sep 26 20:23:32 2016  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+
+	* gems/bundled_gems: update minitest to 5.8.5.
+
+	* tool/downloader.rb: revert workarounds.
+
+	* tool/gem-unpack.rb: ditto.
+
+Mon Sep 26 07:26:44 2016  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+
+	* tool/gem-unpack.rb: don't set security policy.
+	  workaround for certificate expiration of minitest-5.8.3.gem.
+
+Mon Sep 26 06:33:16 2016  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* lib/uri/generic.rb (def check_password): don't include bad password
+	  in URI exception output
+
+	* test/uri/test_generic.rb (def test_set_component): test for behavior
+
+Mon Sep 26 06:20:58 2016  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+
+	* tool/downloader.rb: comment out gem package verification.
+	  workaround for certificate expiration of minitest-5.8.3.gem.
+
+Sun Sep 25 16:37:22 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* io.c (nogvl_fsync, nogvl_fdatasync): on Windows, just ignore if the
+	  fd is associated to non-disk device.  if call fsync and/or fdatasync
+	  with such fds, it causes Errno::EBADF exception and the behavior is
+	  incompatible with ruby 2.1 and earlier unintentionally introduced.
+
+Sun Sep 25 15:09:04 2016  Kazuki Tsujimoto  <kazuki@callcc.net>
+
+	* array.c (flatten): use rb_obj_class instead of rb_class_of
+	  because rb_class_of may return a singleton class.
+	  [ruby-dev:49781] [Bug #12738]
+
+Sun Sep 25 15:07:19 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* man/irb.1: remove useless -width option.
+	  [ruby-dev:49767] [Bug #12692]
+
+Tue Aug 30 05:24:33 2016  Kazuki Yamaguchi  <k@rhe.jp>
+
+	* ext/openssl/ossl_x509ext.c: additional fix memory leak.
+	  [ruby-core:76922] [Bug #12680]
+
+	* text/openssl/test_x509ext.rb: test for above.
+
+Sun Aug 28 00:26:58 2016  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+
+	* vm_method.c: revert r55869. it breaks Integer#days with
+	  ActiveSupport-4.1.x. [ruby-core:76949] [Bug #12353]
+
+	* test/ruby/test_marshal.rb: ditto.
+
+Sat Aug 27 03:51:23 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* id_table.c (hash_table_extend): should not shrink the table than
+	  the previous capacity.  [ruby-core:76534] [Bug #12614]
+
+Sat Aug 27 03:37:49 2016  Kazuki Yamaguchi  <k@rhe.jp>
+
+	* ext/openssl/ossl_config.c: fix memory leak.
+	  [ruby-core:76922] [Bug #12680]
+
+	* ext/openssl/ossl_ocsp.c: ditto.
+
+	* ext/openssl/ossl_pkcs12.c: ditto.
+
+	* ext/openssl/ossl_pkcs7.c: ditto.
+
+	* ext/openssl/ossl_pkey_ec.c: ditto.
+
+	* ext/openssl/ossl_x509.h: ditto.
+
+	* ext/openssl/ossl_x509attr.c: ditto.
+
+	* ext/openssl/ossl_x509crl.c: ditto.
+
+	* ext/openssl/ossl_x509ext.c: ditto.
+
+	* ext/openssl/ossl_x509req.c: ditto.
+
+	* ext/openssl/ossl_x509revoked.c: ditto.
+
+Thu Aug 25 00:19:24 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/rubygems/specification.rb: `coding` is affect only first line except
+	  shebang.
+	* lib/rubygems/package.rb, lib/rubygems/package/*: ditto.
+
+Thu Aug 25 00:19:24 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/rubygems.rb, lib/rubygems/*, test/rubygems/*: Update rubygems-2.5.2.
+	  It supports to enable frozen string literal and add `--norc` option for
+	  disable to `.gemrc` configuration.
+	  See 2.5.2 release notes for other fixes and enhancements.
+	  https://github.com/rubygems/rubygems/blob/a8aa3bac723f045c52471c7b9328310a048561e0/History.txt#L3
+
+Wed Aug 24 23:54:40 2016  Charles Oliver Nutter  <headius@headius.com>
+
+	* test/ruby/test_array.rb: split out the test for no stack error
+	  on large input for test_permutation, test_repeated_permutation,
+	  and test_repeated_combination, and make them all timeout:30.
+
+Tue Aug 23 03:22:34 2016  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* test/fiddle/test_pointer.rb (test_to_str, test_to_s, test_aref_aset):
+	  Attempt to use independent strings for destructive tests that
+	  directly modify values on memory by using Fiddle::Pointer.
+	  [Bug #12537] [ruby-dev:49700]
+
+Tue Aug 23 03:14:22 2016  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* string.c (str_buf_cat): Fix capa size for embed string.
+	  Fix bug in r55547. [Bug #12536]
+
+Tue Aug 23 03:14:22 2016  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* string.c (rb_str_change_terminator_length): New function to change
+	  termlen and resize heap for the terminator. This is split from
+	  rb_str_fill_terminator (str_fill_term) because filling terminator
+	  and changing terminator length are different things. [Bug #12536]
+
+	* internal.h: declaration for rb_str_change_terminator_length.
+
+	* string.c (str_fill_term): Simplify only to zero-fill the terminator.
+	  For non-shared strings, it assumes that (capa + termlen) bytes of
+	  heap is allocated. This partially reverts r55557.
+
+	* encoding.c (rb_enc_associate_index): rb_str_change_terminator_length
+	  is used, and it should be called whenever the termlen is changed.
+
+	* string.c (str_capacity): New static function to return capacity
+	  of a string with the given termlen, because the termlen may
+	  sometimes be different from TERM_LEN(str) especially during
+	  changing termlen or filling terminator with specific termlen.
+
+	* string.c (rb_str_capacity): Use str_capacity.
+
+Tue Aug 23 03:14:22 2016  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* string.c: Partially reverts r55547 and r55555.
+	  ChangeLog about the reverted changes are also deleted in this file.
+	  [Bug #12536] [ruby-dev:49699] [ruby-dev:49702]
+
+Tue Aug 23 03:14:22 2016  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* string.c (str_fill_term): When termlen increases, re-allocation
+	  of memory for termlen should always be needed.
+	  In this fix, if possible, decrease capa instead of realloc.
+	  [Bug #12536] [ruby-dev:49699]
+
+Tue Aug 23 03:14:22 2016  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* string.c: Specify termlen as far as possible.
+	  Additional fix for [Bug #12536] [ruby-dev:49699].
+
+	* string.c (str_new_static): Specify termlen from the given encoding
+	  when creating a new String object is needed.
+
+	* string.c (rb_tainted_str_new_with_enc): New function to create a
+	  tainted String object with the given encoding. This means that
+	  the termlen is correctly specified. Currently static function.
+	  The function name might be renamed to rb_tainted_enc_str_new
+	  or rb_enc_tainted_str_new.
+
+	* string.c (rb_external_str_new_with_enc): Use encoding by using the
+	  above rb_tainted_str_new_with_enc().
+
+Tue Aug 23 03:14:22 2016  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* string.c (rb_str_subseq, str_substr): When RSTRING_EMBED_LEN_MAX
+	  is used, TERM_LEN(str) should be considered with it because
+	  embedded strings are also processed by TERM_FILL.
+	  Additional fix for [Bug #12536] [ruby-dev:49699].
+
+Tue Aug 23 03:14:22 2016  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* string.c: Fix memory corruptions when using UTF-16/32 strings.
+	  [Bug #12536] [ruby-dev:49699]
+
+	* string.c (rb_str_new_with_class): Use TERM_LEN of the "obj".
+
+	* string.c (rb_str_plus, rb_str_justify): Use str_new0 which is aware
+	  of termlen.
+
+	* string.c (str_shared_replace): Copy +termlen bytes instead of +1.
+
+	* string.c (rb_str_times): termlen should not be included in capa.
+
+	* string.c (RESIZE_CAPA_TERM): When using RSTRING_EMBED_LEN_MAX,
+	  termlen should be counted with it because embedded strings are
+	  also processed by TERM_FILL.
+
+	* string.c (rb_str_capacity, str_shared_replace, str_buf_cat): ditto.
+
+	* string.c (rb_str_drop_bytes, rb_str_setbyte, str_byte_substr): ditto.
+
+Thu Aug 18 23:43:33 2016  Eric Wong  <e@80x24.org>
+
+	* ext/openssl/ossl_ssl.c (ossl_ssl_write_internal):
+	  avoid undefined behavior
+	* test/openssl/test_pair.rb (test_write_zero): new test
+	  [ruby-core:76751] [Bug #12660]
+
+Thu Aug 18 23:18:17 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/socket/option.c, ext/socket/rubysocket.h (inet_ntop): share
+	  the fallback definition.  [ruby-core:76646] [Bug #12645]
+
+Thu Aug 18 23:07:29 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm.c (vm_set_main_stack): remove unnecessary check.  toplevel
+	  binding must be initialized.  [Bug #12611] (N1)
+
+	* win32/win32.c (w32_symlink): fix return type.  [Bug #12611] (N3)
+
+	* string.c (rb_str_split_m): simplify the condition.
+	  [Bug #12611](N4)
+
+Thu Aug 18 23:06:20 2016  Kouhei Sutou  <kou@cozmixng.org>
+
+	* lib/rexml/attribute.rb (REXML::Attribute#to_string): Fix wrong
+	  entry reference name of double quote.
+	  [Bug #12609][ruby-core:76509]
+	  Patch by Joseph Marrero. Thanks!!!
+
+Thu Aug 18 23:04:59 2016  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* thread.c (rb_wait_for_single_fd): Clean up fds.revents every time
+	  before calling ppoll(2). [Bug #12575] [ruby-dev:49725]
+
+Thu Aug 18 22:52:19 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* vm_args.c (setup_parameters_complex): don't raise ArgumentError
+	  if an array is given for instance_exec with optional argument.
+	  [ruby-core:76300] [Bug #12568]
+	  https://github.com/rails/rails/pull/25699
+
+Tue Aug 16 12:27:48 2016  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (gc_mark_roots): should mark the VM object itself to mark
+	  singleton class of the VM object.
+	  Before this patch, we only set mark bit for the VM object and
+	  invoke mark function separately.
+	  [Bug #12583]
+
+	* test/ruby/test_gc.rb: add a test.
+
+Tue Aug 16 12:01:35 2016  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* ext/digest/md5/md5ossl.h: Remove excess semicolons.
+	  Suppress warning on Solaris with Oracle Solaris Studio 12.
+	  [ruby-dev:49692] [Bug #12524]
+
+	* ext/digest/md5/md5cc.h: ditto.
+	* ext/digest/sha1/sha1cc.h: ditto.
+	* ext/digest/sha1/sha1ossl.h: ditto.
+	* ext/digest/sha2/sha2cc.h: ditto.
+	* ext/digest/sha2/sha2ossl.h: ditto.
+
+Tue Aug 16 11:51:52 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (ADD_TRACE): ignore trace instruction on non-positive
+	  line.
+
+	* parse.y (coverage): get rid of ArgumentError when the starting
+	  line number is not positive.  [ruby-core:76141] [Bug #12517]
+
+Tue Aug 16 11:51:52 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* test/coverage/test_coverage.rb: ignored test when enabled to coverage.
+	  It lead to crash with `make test-all`.
+
+Tue Aug 16 11:46:07 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/uri/mailto.rb (initialize): RFC3986_Parser#split sets opaque
+	  only if the URI has path-rootless, not path-empty.
+	  [ruby-core:76055] [Bug #12498]
+	  patched by Chris Heisterkamp <cheister@squareup.com>
+
+Tue Aug 16 04:57:28 2016  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/http/generic_request.rb (write_header): A Request-Line must
+	  not contain CR or LF.
+
+Tue Aug 16 04:54:12 2016  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/ftp.rb (putline): raise an ArgumentError when
+	  CR or LF is included in a line.
+
+Tue Aug 16 04:38:48 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/date/date_strftime.c (date_strftime_with_tmx): reject too
+	  large precision to get rid of buffer overflow.
+	  reported by Guido Vranken <guido AT guidovranken.nl>.
+
+Tue Aug 16 04:28:22 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* file.c (append_fspath): normalize directory name to be appended
+	  on OS X.  [ruby-core:75957] [Ruby trunk Bug#12483]
+	  https://github.com/rails/rails/issues/25303#issuecomment-224834804
+
+Tue Aug 16 04:16:14 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* regcomp.c (noname_disable_map): don't optimize out group 0
+	  Ruby's Regexp doesn't allow normal numbered groups if the regexp
+	  has named groups. On such case it optimizes out related NT_ENCLOSE.
+	  But even on the case it can use \g<0>.
+	  This fix not to remove NT_ENCLOSE whose regnum is 0.
+	  [ruby-core:75828] [Bug #12454]
+
+Tue Aug 16 04:06:52 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* missing/crypt.c: fix size macros to use configured values
+	  for platforms long is larger than 32bit.
+	  [ruby-core:75792] [Bug #12446]
+
+Tue Aug 16 04:03:25 2016  Kazuki Yamaguchi  <k@rhe.jp>
+
+	* ext/openssl/ossl_bn.c (try_convert_to_bnptr): Extracted from
+	  GetBNPtr(). This doesn't raise exception but returns NULL on error.
+	  (GetBNPtr): Raise TypeError if conversion fails.
+	  (ossl_bn_eq): Implement BN#==.
+	  (ossl_bn_eql): #eql? should not raise TypeError even if the argument
+	  is not compatible with BN.
+	  (ossl_bn_hash): Implement BN#hash.
+
+	* ext/openssl/ossl_bn.c (Init_ossl_bn): Define #== and #hash.
+
+	* test/openssl/test_bn.rb: Test BN#eql?, #== and #hash
+
+Tue Aug 16 03:51:59 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* transcode.c (str_transcode0): scrub in the given encoding when
+	  the source encoding is given, not in the encoding of the
+	  receiver.  [ruby-core:75732] [Bug #12431]
+
+Tue Aug 16 03:41:21 2016  Kazuki Yamaguchi  <k@rhe.jp>
+
+	* ext/openssl/ossl_pkey_dh.c (ossl_dh_compute_key): Check that the DH
+	  has 'p' (the prime) before calling DH_size(). We can create a DH with
+	  no parameter but DH_size() does not check and dereferences NULL.
+	  [ruby-core:75720] [Bug #12428]
+
+	* ext/openssl/ossl_pkey_dsa.c (ossl_dsa_sign): Ditto. DSA_size() does
+	  not check dsa->q.
+
+	* ext/openssl/ossl_pkey_rsa.c (ossl_rsa_public_encrypt,
+	  ossl_rsa_public_decrypt, ossl_rsa_private_encrypt,
+	  ossl_rsa_private_decrypt): Ditto. RSA_size() does not check rsa->n.
+
+Tue Aug 16 03:10:42 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* transcode.c (enc_arg, str_transcode_enc_args, econv_args):
+	  remove volatile, and add GC guards in callers.
+	  [ruby-core:75664] [Bug #12411]
+
+Tue Aug 16 02:45:52 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ext/psych/*, test/psych/*: Update psych 2.1.0
+	  This version fixed [Bug #11988][ruby-core:72850]
+
+Fri Aug 12 04:15:10 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* common.mk (build-ext), ext/extmk.rb: use variable EXTENCS
+	  different than ENCOBJS, to get rid of circular dependency.
+	  build libencs when linking encodings statically.
+	  [ruby-core:75618] [Bug #12401]
+
+Fri Aug 12 04:04:23 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* process.c (rb_execarg_commandline): build command line string
+	  from argument vector in rb_execarg.
+	  [ruby-core:75611] [Bug #12398]
+
+Fri Aug 12 03:30:59 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* variable.c (rb_local_constants_i): exclude private constants
+	  when excluding inherited constants too.  [Bug #12345]
+
+Fri Aug 12 03:00:05 2016  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+
+	* lib/drb/timeridconv.rb: don't use keeper thread. [Bug #12342]
+
+	* test/drb/ut_timerholder.rb: ditto.
+
+Fri Aug 12 02:46:37 2016  Kazuki Yamaguchi  <k@rhe.jp>
+
+	* ext/openssl/ossl_ssl.c (ossl_ssl_stop): Don't free the SSL struct
+	  here. Since some methods such as SSLSocket#connect releases GVL,
+	  there is a chance of use after free if we free the SSL from another
+	  thread. SSLSocket#stop was documented as "prepares it for another
+	  connection" so this is a slightly incompatible change. However when
+	  this sentence was added (r30090, Add toplevel documentation for
+	  OpenSSL, 2010-12-06), it didn't actually. The current behavior is
+	  from r40304 (Correct shutdown behavior w.r.t GC., 2013-04-15).
+	  [ruby-core:74978] [Bug #12292]
+
+	* ext/openssl/lib/openssl/ssl.rb (sysclose): Update doc.
+
+	* test/openssl/test_ssl.rb: Test this.
+
+Thu Aug 11 01:30:29 2016  Marcus Stollsteimer  <sto.mar@web.de>
+
+	* ext/json/lib/*.rb: Removed some comments. Because these are unnecessary
+	  class description. [ci skip][Bug #12255][ruby-core:74835]
+
+Thu Aug 11 01:09:43 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* pack.c (pack_pack): use union instead of bare variable to ease
+	  optimizations and avoid assigning x87 floating point number.
+	  [ruby-core:74496] [Bug #12209]
+
+	* pack.c (pack_unpack): ditto.
+
+Tue Aug  2 01:34:12 2016  Eric Wong  <e@80x24.org>
+
+	* lib/webrick/httpservlet/cgihandler.rb (do_GET): delete HTTP_PROXY
+	* test/webrick/test_cgi.rb (test_cgi_env): new test
+	* test/webrick/webrick.cgi (do_GET): new endpoint to dump env
+	  [ruby-core:76511] [Bug #12610]
+
+Tue Aug  2 01:33:11 2016  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* test/ruby/test_refinement.rb: skip
+	  test_prepend_after_refine_wb_miss on ARM or MIPS.
+	  [ruby-core:76031] [Bug #12491]
+
+Sat Jul 30 12:23:29 2016  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* vm_args.c (vm_caller_setup_arg_block): disable symbol block
+	  argument optimization when tail call optimization is enabled,
+	  in order to avoid SEGV.  [ruby-core:76288] [Bug #12565]
+
+Sat Jul 30 12:10:51 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* proc.c (passed_block): convert passed block symbol to proc.
+	  based on the patch by Daisuke Sato in [ruby-dev:49695].
+	  [Bug #12531]
+
+Sat Jul 30 10:58:49 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_insnhelper.c (vm_throw_start): check if the iseq is symbol
+	  proc, class definition should not be a symbol proc.
+	  [ruby-core:75856] [Bug #12462]
+
+Mon Jul 11 22:35:00 2016  Kenta Murata  <mrkn@mrkn.jp>
+
+	* bignum.c (rb_big_hash): make it public function to be available in
+	  other source files, and remove documentation comment for Bignum#hash.
+
+	* bignum.c (Bignum#hash): remove its definition because it is unified
+	  with Object#hash.
+
+	* include/ruby/intern.h (rb_big_hash): add a prototype declaration.
+
+	* hash.c (any_hash): treat Bignum values directly.
+
+Sat Jul  2 04:00:50 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (tr_trans): consider terminator length and fix heap
+	  overflow.  reported by Guido Vranken <guido AT guidovranken.nl>.
+
+Sat Jul  2 03:33:28 2016  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* vm.c (invoke_bmethod, invoke_block_from_c_0): revert r52104
+	  partially to avoid "self has wrong type to call super in this
+	  context" errors.
+	  [ruby-core:72724] [Bug #11954]
+
+Mon Jun 20 02:38:29 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/optparse.rb (OptionParser::Completion.candidate): get rid of
+	  nil as key names.  [ruby-core:75773] [Bug #12438]
+
+	* lib/optparse.rb (OptionParser#make_switch): char class option
+	  cannot be NoArgument, default to RequiredArgument.
+
+Mon Jun 20 02:25:44 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* re.c (unescape_nonascii): scan hex up to only 3 characters.
+	  [Bug #12420] [Bug #12423]
+
+Mon Jun 20 02:25:44 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* regparse.c (fetch_token_in_cc): raise error if given octal escaped
+	  character is too big. [Bug #12420] [Bug #12423]
+
+Sun Jun 19 04:29:13 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* include/ruby/missing.h (isfinite): move from numeric.c.
+
+Sun Jun 19 04:29:13 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ext/bigdecimal/bigdecimal.c (isfinite): get rid of a warning on
+	  cygwin. [Bug #12417][ruby-core:75691]
+
+Sun Jun 19 04:29:13 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ext/bigdecimal/bigdecimal.c (isfinite): isfinite does not always
+	  exist.  fixed build error on Windows introduced at r55123.
+
+Sun Jun 19 04:29:13 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/bigdecimal/bigdecimal.c (GetVpValueWithPrec): consider
+	  non-finite float values not to raise FloatDomainError.
+	  [ruby-core:75682] [Bug #12414]
+
+Thu Jun 16 00:42:56 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (rb_str_modify_expand): check integer overflow.
+	  [ruby-core:75592] [Bug #12390]
+
+Thu Jun 16 00:29:29 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_insnhelper.c (vm_get_ev_const): warn deprecated constant even
+	  in the class context.  [ruby-core:75505] [Bug #12382]
+
+Tue Jun 14 03:49:28 2016  Eric Wong  <e@80x24.org>
+
+	* dir.c (dir_close): update RDoc for 2.3 #close change
+	  [ruby-core:75679] [Bug #12413]
+
+Tue Jun 14 03:47:29 2016  Eric Wong  <e@80x24.org>
+
+	* proc.c: fix RDoc of Proc#===/call/yield/[]
+	  [Bug #12332]
+
+Tue Jun 14 03:34:27 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* variable.c (rb_local_constants_i): exclude hidden constants.
+	  [ruby-core:75575] [Bug #12389]
+
+Tue Jun 14 03:25:14 2016  Benoit Daloze  <eregontp@gmail.com>
+
+	* insns.def (defineclass): Also raise an error when redeclaring the
+	  superclass of a class as Object and it has another superclass.
+	  [Bug #12367] [ruby-core:75446]
+
+	* test/ruby/test_class.rb: test for above.
+
+Tue Jun 14 03:15:54 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* process.c (rb_exec_getargs): honor the expected argument types
+	  over the conversion method.  the basic language functionality
+	  should be robust.  [ruby-core:75388] [Bug #12355]
+
+Tue Jun 14 03:02:38 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c, include/ruby/win32.h (rb_w32_utruncate): implements new
+	  truncate alternative which accepts UTF-8 path.
+
+	* file.c (truncate): use above function.
+	  [Bug #12340]
+
+Tue Jun 14 02:58:41 2016  Marcus Stollsteimer  <sto.mar@web.de>
+
+	* ext/date/date_core.c (Init_date_core): [DOC] Convert DateTime
+	  documentation to RDoc from Markdown.
+	  [ruby-core:75136] [Bug #12311]
+
+Sun Jun 12 02:36:52 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* regcomp.c (compile_length_tree): return error code immediately
+	  if compile_length_tree raised error [Bug #12418]
+
+Sun Jun 12 02:27:07 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* thread.c (recursive_list_access): a object id may be a Bignum.  so,
+	  the list must be a objhash, instead of a identhash.
+	  this fixes many test errors on mswin64 CI.
+
+Sun Jun 12 01:59:33 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (new_if_gen): set newline flag to NODE_IF to trace all
+	  if/elsif statements.  [ruby-core:67720] [Bug #10763]
+
+Sun May 15 02:33:52 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/mkmf.rb (pkg_config): use xsystem consistently to set up
+	  library path environment variable as well as latter pkg-config
+	  calls.  [ruby-dev:49619] [Bug #12379]
+
+Fri May  6 02:30:32 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/optparse.rb: [DOC] fix example code.  base on the code by
+	  Semyon Gaivoronskiy in [ruby-core:75224].  [Bug #12323]
+
+Fri May  6 02:28:31 2016  Masaki Suketa <masaki.suketa@nifty.ne.jp>
+
+	* ext/win32ole/win32ole.c (ole_vstr2wc, ole_variant2val): fix blank
+	  string conversion.
+	  [Bug #11880]
+	  Thanks Akio Tajima for the patch!
+
+Fri May  6 02:24:13 2016  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+
+	* bignum.c: [DOC] Update result of 123456789 ** -2.
+	  [ruby-dev:49606] [Bug #12339]
+
+Wed May  4 02:38:08 2016  Yuichiro Kaneko  <yui-knk@ruby-lang.org>
+
+	* internal.h (RCOMPLEX_SET_IMAG): undef RCOMPLEX_SET_IMAG
+	  instead of duplicated undef RCOMPLEX_SET_REAL.
+
+Wed May  4 02:38:08 2016  Yuichiro Kaneko  <yui-knk@ruby-lang.org>
+
+	* complex.c (rb_complex_set_imag): Fix to properly set imag
+	  of complex.
+
+Tue Apr 26 23:34:45 2016  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+
+	* version.h: Bump versionto 2.3.2.
+
+Tue Apr 26 02:58:51 2016  Marcus Stollsteimer  <sto.mar@web.de>
+
+	* doc/extension.rdoc: Improvements to english grammers.
+	  [Bug #12246][ruby-core:74792][ci skip]
+
+Tue Apr 26 02:58:51 2016  craft4coder  <yooobuntu@163.com>
+
+	* doc/extension.rdoc: [DOC] `nul` should be uppercase.
+	  change 'nul' => 'NUL'.  [Fix GH-1172]
+
+Tue Apr 26 02:54:57 2016  Marcus Stollsteimer  <sto.mar@web.de>
+
+	* encoding.c: Fix return value of `Encoding::ISO8859_1.name`
+	  [Bug #12313][ruby-core:75147][ci skip]
+	* ext/bigdecimal/bigdecimal.c: Fix code sample of `BigDecimal.new`
+
+Mon Apr 25 02:29:07 2016  Rei Odaira  <Rei.Odaira@gmail.com>
+
+	* configure.in: add missing -lm for AIX.
+
+Mon Apr 25 02:29:07 2016  Rei Odaira  <Rei.Odaira@gmail.com>
+
+	* configure.in: don't use the system-provided round(3) on AIX.
+	  In AIX, round(0.49999999999999994) returns 1.0.
+	  Use round() in numeric.c instead.
+
+Sun Apr 24 03:05:47 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ruby.c: cygwin does not use w32_cmdvector, command line can be
+	  other than UTF-8.  [ruby-dev:49519] [Bug #12184]
+
+Sat Apr 23 01:01:13 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval_jump.c (exec_end_procs_chain): restore previous error info
+	  for each end procs.  [ruby-core:75038] [Bug #12302]
+
+Sat Apr 23 00:51:51 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (new_label_body): initialize bit fields, since
+	  compile_data_alloc does not clear the memory.  [Bug #12082]
+
+Sat Apr 23 00:51:51 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (iseq_optimize): disable tail call optimization in
+	  rescued, rescue, and ensure blocks.
+	  [ruby-core:73871] [Bug #12082]
+
+Sat Apr 23 00:33:04 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/nkf/nkf-utf8/nkf.c (mime_putc): fix typo.
+	  [Bug #12202] [ruby-core:74802]
+
+Sat Apr 23 00:33:04 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/nkf/nkf-utf8/nkf.c: Merge upstream 4f3edf80a0.
+	  patched by Anton Sivakov [Bug #12201] [Bug #12202]
+
+Sat Apr 23 00:29:15 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/securerandom.rb (gen_random): to avoid blocking on Windows.
+	  On Windows OpenSSL RAND_bytes (underlying implementation is
+	  RAND_poll in crypto/rand/rand_win.c) may be blocked at
+	  NetStatisticsGet.
+	  https://wiki.openssl.org/index.php/Random_Numbers#Windows_Issues
+	  Instead of this, use Random.raw_seed directly (whose implementation
+	  CryptGenRandom is one of the source of
+	  entropy of RAND_poll on Windows).
+	  https://wiki.openssl.org/index.php/Random_Numbers
+	  Note: CryptGenRandom function is PRNG and doesn't check its entropy,
+	  so it won't block. [Bug #12139]
+	  https://msdn.microsoft.com/ja-jp/library/windows/desktop/aa379942.aspx
+	  https://tools.ietf.org/html/rfc4086#section-7.1.3
+	  https://eprint.iacr.org/2007/419.pdf
+	  http://www.cs.huji.ac.il/~dolev/pubs/thesis/msc-thesis-leo.pdf
+
+Sat Apr 23 00:25:26 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* miniinit.c (Init_enc): add some common aliases of built-in
+	  encodings.  [ruby-core:72481] [Bug #11872]
+
+Sat Apr 23 00:13:50 2016  sorah (Shota Fukumori)  <her@sorah.jp>
+
+	* lib/forwardable.rb: Convert given accessors to String.
+
+	  r53381 changed to accept only Symbol or String for accessors, but
+	  there are several rubygems that pass classes (e.g. Array,
+	  Hash, ...) as accessors. Prior r53381, it was accepted because Class#to_s
+	  returns its class name. After r53381 given accessors are checked
+	  with define_method, but it accepts only Symbol or String, otherwise
+	  raises TypeError.
+
+	      def_delegator Foo, :some_method
+
+	  This change is to revert unexpected incompatibility. But this behavior
+	  may change in the future.
+
+Sat Apr 23 00:02:09 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in: check if succeeded in creating config.h.
+
+	* tool/ifchange: ignore failures when TEST_COLORS unmatched. just
+	  use the default value if expected name is not contained in it.
+	  [ruby-core:75046] [Bug #12303]
+
+Fri Apr 22 23:47:05 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* doc/regexp.rdoc (comments): [DOC] terminators cannot appear in
+	  comments.  [ruby-core:74838] [Bug #12256]
+
+Fri Apr 22 23:44:07 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* extension.rdoc, extension.ja.rdoc: [DOC] Fix some errors.
+	  Renamed files, wrong method names or argument types; the example
+	  GetDBM macro is now updated to the current version of the actual
+	  code.  patch by Marcus Stollsteimer in [ruby-core:74690].
+	  [Bug #12228]
+
+Fri Apr 22 23:32:19 2016  Tanaka Akira  <akr@fsij.org>
+
+	* test/ruby/test_time_tz.rb: Tests depends on Europe/Moscow removed
+	  to avoid test failures due to the tzdata change.
+	  https://github.com/eggert/tz/commit/8ee11a301cf173afb0c76e0315b9f9ec8ebb9d95
+	  Found by naruse.
+
+Tue Apr 19 02:32:50 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (rb_cv_lgamma_r_m0): fix the condition for
+	  lgamma_r(-0.0).  [Bug #12249]
+
+Tue Apr 19 02:32:50 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (rb_cv_lgamma_r_m0): check if lgamma_r(-0.0)
+	  returns negative infinity.  [Bug #12249]
+
+	* math.c (ruby_lgamma_r): define by the configured result.
+
+Tue Apr 19 02:32:50 2016  cremno phobia  <cremno@mail.ru>
+
+	* math.c (ruby_lgamma_r): missing/lgamma_r.c is used on Windows,
+	  since msvcrt does not provide it.
+
+	* missing/lgamma_r.c (lgamma_r): fix lgamma(-0.0).
+	  [ruby-core:74823] [Bug #12249]
+
+Tue Apr 19 02:32:50 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* math.c (ruby_lgamma_r): mswin's lgamma_r also seems to be wrong.
+	  cf. [Bug #12249]
+
+Tue Apr 19 02:32:50 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* math.c (ruby_tgamma): fix tgamma(-0.0) on mingw.
+	  [ruby-core:74817] [Bug #12249]
+
+Tue Apr 19 01:53:32 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* defs/keywords (alias, undef): symbol literals are allowed.
+
+	* parse.y (parse_percent): should parse symbol literals for alias
+	  and undef.  [ruby-dev:47681] [Bug #8851]
+
+Mon Apr 18 18:05:29 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* struct.c (struct_make_members_list, rb_struct_s_def): member
+	  names should be unique. [ruby-core:74971] [Bug #12291]
+
+	* struct.c (struct_make_members_list): extract making member name
+	  list from char* va_list, with creating symbols without
+	  intermediate IDs.
+
+Mon Apr 18 17:54:40 2016  Joe Swatosh  <joe.swatosh@gmail.com>
+
+	* ext/win32/lib/win32/registry.rb (DeleteValue, DeleteKey): fix
+	  API names.  [ruby-core:74863] [Bug #12264]
+
+Mon Apr 18 17:27:30 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (iseq_peephole_optimize): should not replace the
+	  current target INSN, not to follow the replaced dangling link in
+	  the caller.  [ruby-core:74993] [Bug #11816]
+
+Mon Apr 18 17:18:25 2016  cremno phobia  <cremno@mail.ru>
+
+	* cont.c (fiber_initialize_machine_stack_context): fix wrong
+	  _MSC_VER check, should be decimal but not hexadecimal.
+	  [ruby-core:74936] [Bug #12279]
+
+Mon Apr 18 17:18:25 2016  cremno phobia  <cremno@mail.ru>
+
+	* cont.c (fiber_initialize_machine_stack_context): fix wrong
+	  _MSC_VER check, should be decimal but not hexadecimal.
+	  [ruby-core:74936] [Bug #12279]
+
+Mon Apr 18 17:08:10 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_core.h (rb_vm_struct): make at_exit a single linked list but
+	  not RArray, not to mark the registered functions by the write
+	  barrier.  based on the patches by Evan Phoenix.
+	  [ruby-core:73908] [Bug #12095]
+
+Mon Apr 18 16:56:31 2016  Benoit Daloze  <eregontp@gmail.com>
+
+	* thread.c (update_coverage): Do not track coverage in loaded files
+	  after Coverage.result. Avoids out-of-bounds access. [Bug #12237]
+
+	* ext/coverage/coverage.c (coverage_clear_result_i): document.
+
+Mon Apr 18 16:33:50 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/date/date_core.c (Init_date_core): [DOC] fix misplaced doc
+	  of DateTime.  [ruby-core:74729] [Bug #12233]
+
+Mon Apr 18 13:48:05 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* cygwin/GNUmakefile.in (MSYS2_ARG_CONV_EXCL_PARAM):
+	  * add missing parentheses and remove double quotes.
+	  * rename to get rid of recursive references.
+	  * as --excludes-dir option is for a path name, its argument
+	    should be converted.
+	  [ruby-dev:49526] [Bug #12199]
+
+Mon Apr 18 13:48:05 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* common.mk (TEST_EXCLUDES, EXCLUDE_TESTFRAMEWORK): use full spell
+	  long option.
+
+	* cygwin/GNUmakefile.in (MSYS2_ARG_CONV_EXCL): suppress path name
+	  conversions by msys2.  [ruby-dev:49525] [Bug #12199]
+
+Mon Apr 18 13:48:05 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* test/lib/test/unit.rb (Options#non_options): make regexp name
+	  options prefixed with "!" negative filters.
+
+	* common.mk (TEST_EXCLUDES): use negative filter to exclude memory
+	  leak tests.  -x option excludes test files, not test methods.
+
+Sun Apr 17 04:30:13 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (parse_ident): allow keyword arguments just after a
+	  method where the same name local variable is defined.
+	  [ruby-core:73816] [Bug#12073]
+
+Sun Apr 17 04:20:40 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (setup_exception): set the cause only if it is explicitly
+	  given or not set yet.  [Bug #12068]
+
+Sat Apr 16 00:56:45 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* thread.c (rb_thread_setname): defer setting native thread name
+	  set in initialize until the native thread is created.
+	  [ruby-core:74963] [Bug #12290]
+
+Fri Apr 15 21:10:00 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/irb/ext/save-history.rb: Fix NoMethodError when method is not defined.
+
+Fri Apr 15 14:52:06 2016  Elliot Winkler  <elliot.winkler@gmail.com>
+
+	* lib/forwardable.rb (def_instance_delegator) fix delegating to
+	  'args' and 'block', clashing with local variables in generated
+	  methods.  [ruby-core:72579] [Bug #11916]
+
+	* lib/forwardable.rb (def_single_delegator): ditto.
+
+Fri Apr 15 14:27:48 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/irb/ext/save-history.rb: suppress warning: method redefined;
+	  discarding old save_history=.
+
+Tue Apr 12 16:15:39 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* configure.in: improve ICC (Intel C Compiler) support.
+
+	* configure.in (CXX): The name of icc's c++ compiler is `icpc`.
+
+	* configure.in (warnings): Add `-diag-disable=2259` to suppress
+	  noisy warnings: "non-pointer conversion from "..." to "..." may
+	  lose significant bits".
+
+	* configure.in (optflags): Add `-fp-model precise` like -fno-fast-math.
+
+	* lib/mkmf.rb: icc supports -Werror=division-by-zero
+	  and -Werror=deprecated-declarations, but doesn't support
+	  -Wdivision-by-zero and -Wdeprecated-declarations.
+
+Tue Apr 12 14:29:01 2016  Kazuki Yamaguchi  <k@rhe.jp>
+
+	* ext/openssl/extconf.rb: check SSL_CTX_set_next_proto_select_cb
+	  function rather than OPENSSL_NPN_NEGOTIATED macro. it exists
+	  even if it is disabled by OpenSSL configuration.
+	  [ruby-core:74384] [Bug #12182]
+
+	* ext/openssl/ossl_ssl.c: update #ifdef(s) as above.
+
+	* test/openssl/test_ssl.rb: skip NPN tests if NPN is disabled.
+
+Tue Apr 12 14:27:04 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/uri/http.rb (URI::HTTP#initialize): [DOC] fix example,
+	  missing mandatory arguments.  [ruby-core:74540] [Bug #12215]
+
+Thu Apr  7 01:07:02 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* sprintf.c (rb_str_format): fix buffer overflow, length must be
+	  greater than precision.  reported by William Bowling <will AT
+	  wbowling.info>.
+
+Wed Apr  6 00:33:45 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/rubygems/security.rb (DIGEST_ALGORITHM, KEY_ALGORITHM):
+	  should check same name as the used constants.
+	  [ruby-core:72674] [Bug #11940]
+
+Mon Apr  4 00:31:51 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (compile_massign_lhs): when index ends with splat,
+	  append rhs value to it like POSTARG, since VM_CALL_ARGS_SPLAT
+	  splats the last argument only.  [ruby-core:72777] [Bug #11970]
+
+Sat Apr  2 02:07:29 2016  Seiei Miyagi  <hanachin@gmail.com>
+
+	* ext/ripper/lib/ripper/lexer.rb (on_heredoc_dedent): Fix
+	  Ripper.lex error in dedenting squiggly heredoc.  heredoc tree is
+	  also an array of Elem in the outer tree.  [Fix GH-1234]
+
+Wed Mar 30 02:28:13 2016  Eric Wong  <e@80x24.org>
+
+	* thread_pthread.c (setup_communication_pipe): delay setting owner
+	  (rb_thread_create_timer_thread): until thread creation succeeds
+	  [ruby-core:72590] [Bug #11922]
+
+Wed Mar 30 02:20:06 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* localeinit.c (rb_locale_charmap_index): fix prototype.
+	  patched by Andreas Schwab [Bug #12218]
+
+Wed Mar 30 02:20:06 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* thread_pthread.c (reserve_stack): fix reserving position where
+	  the stack growing bottom to top. [Bug #12118]
+
+Wed Mar 30 02:17:33 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* win32/file.c (rb_readlink): drop garbage after the substitute
+	  name, as rb_w32_read_reparse_point returns the expected buffer
+	  size but "\??\" prefix is dropped from the result.
+
+	* win32/win32.c (w32_readlink): ditto, including NUL-terminator.
+
+Wed Mar 30 02:17:33 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (fileattr_to_unixmode, rb_w32_reparse_symlink_p): volume
+	  mount point should be treated as directory, not symlink.
+	  [ruby-core:72483] [Bug #11874]
+
+	* win32/win32.c (rb_w32_read_reparse_point): check the reparse point is
+	  a volume mount point or not.
+
+	* win32/file.c (rb_readlink): follow above change (but this pass won't
+	  be used).
+
+Wed Mar 30 01:32:14 2016  Rei Odaira  <Rei.Odaira@gmail.com>
+
+	* test/-ext-/time/test_new.rb (test_timespec_new): change a gmtoff
+	  test to a better one that does not depend on whether the current
+	  time is in summer time or not.
+
+Wed Mar 30 01:32:14 2016  Rei Odaira  <Rei.Odaira@gmail.com>
+
+	* test/-ext-/time/test_new.rb (test_timespec_new): Time#gmtoff values
+	  are the same only when both or neither of the Time objects are in
+	  summer time (daylight-saving time).
+
+Wed Mar 30 01:30:54 2016  Hiroshi Shirosaki  <h.shirosaki@gmail.com>
+
+	* lib/rubygems/test_case.rb: Fix test on Windows for inconsistent temp path.
+	  https://github.com/rubygems/rubygems/pull/1554
+	  [Bug #12193][ruby-core:74431]
+
+Wed Mar 30 01:25:46 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* string.c (str_new_frozen): if the given string is embeddedable
+	  but not embedded, embed a new copied string. [Bug #11946]
+
+Wed Mar 30 01:23:57 2016  Marcus Stollsteimer  <sto.mar@web.de>
+
+	* doc/extension.ja.rdoc: Fix RDoc markup in doc/extension*.rdoc.
+	  [ci skip][Bug #12143][ruby-core:74143]
+	* doc/extension.rdoc: ditto.
+
+Wed Mar 30 01:00:30 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* proc.c (proc_binding): proc from symbol can not make a binding.
+	  [ruby-core:74100] [Bug #12137]
+
+Wed Mar 30 00:54:38 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* include/ruby/win32.h (O_SHARE_DELETE): change to fit Fixnum
+	  limit.  [ruby-core:74285] [Bug #12171]
+
+Wed Mar 30 00:52:47 2016  Rei Odaira  <Rei.Odaira@gmail.com>
+
+	* test/net/imap/test_imap.rb (test_idle_timeout): Because of the
+	  timeout specified in "imap.idle(0.2)", there is no gurantee that
+	  the server thread has done all the work before the client thread
+	  performs the assertions. It depends on the thread scheduling.
+	  Add checks to avoid false positives (on AIX, particularly).
+
+Wed Mar 30 00:41:42 2016  Rei Odaira  <Rei.Odaira@gmail.com>
+
+	* test/socket/test_socket.rb (test_udp_recvmsg_truncation):
+	  AIX does not set the MSG_TRUNC flag for a message partially read
+	  by recvmsg(2) with the MSG_PEEK flag set.
+
+Wed Mar 30 00:00:47 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* doc/extension.rdoc, doc/extension.ja.rdoc: add editor local
+	  variables, with commenting out by :enddoc: directives which are
+	  just ignored unless code object mode.  [Bug #12111]
+
+Wed Mar 30 00:00:47 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* doc/extension.ja.rdoc: removed rendering error caused by editor specific
+	  configuration on http://docs.ruby-lang.org/en/trunk/extension_rdoc.html .
+	  [Bug #12111][ruby-core:73990]
+
+Tue Mar 29 23:54:31 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* object.c (rb_mod_const_get): make error message at uninterned
+	  string consistent with symbols.  [ruby-dev:49498] [Bug #12089]
+
+Tue Mar 29 23:45:24 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (push_pattern, push_glob): deal with read paths as UTF-8
+	  to stat later, on Windows as well as OS X.
+	  [ruby-core:73868] [Bug #12081]
+
+Tue Mar 29 23:36:49 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/extmk.rb: add cygwin case, nothing excluded.
+	  [ruby-core:73806] [Bug#12071]
+
+Tue Mar 29 23:10:47 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* iseq.c (rb_iseq_mark): mark parent iseq to prevent dynamically
+	  generated iseq by eval from GC.  [ruby-core:72620] [Bug #11928]
+
+Tue Mar 29 22:56:44 2016  Eric Wong  <e@80x24.org>
+
+	* lib/resolv.rb (Resolv::IPv6.create): avoid modifying frozen
+	* test/resolv/test_dns.rb (test_ipv6_create): test for above
+	  [Bug #11910] [ruby-core:72559]
+
+Tue Mar 29 22:31:48 2016  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* range.c (range_eqq): revert r11113 because rb_call_super() is
+	  called in range_include() and thus r11113 doesn't work when the
+	  receiver Range object consists of non linear objects such as Date
+	  objects.
+	  [ruby-core:72908] [Bug #12003]
+
+Tue Mar 29 22:26:55 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_eval.c (rb_check_funcall_with_hook): also should call the
+	  given hook before returning Qundef when overridden respond_to?
+	  method returned false.  [ruby-core:73556] [Bug #12030]
+
+Tue Mar 29 22:08:36 2016  Kazuki Yamaguchi  <k@rhe.jp>
+
+	* compile.c (iseq_peephole_optimize): don't apply tailcall
+	  optimization to send/invokesuper instructions with blockiseq.
+	  This is a follow-up to the changes in r51903; blockiseq is now
+	  the third operand of send/invokesuper instructions.
+	  [ruby-core:73413] [Bug #12018]
+
+Tue Mar 29 21:22:22 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (xstring): reset heredoc indent after dedenting,
+	  so that following string literal would not be dedented.
+	  [ruby-core:72857] [Bug #11990]
+
+Tue Mar 29 21:22:22 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (string1): reset heredoc indent fore each string leteral
+	  so that concatenated string would not be dedented.
+	  [ruby-core:72857] [Bug #11990]
+
+Tue Mar 29 21:18:09 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (parser_here_document): update indent for each line in
+	  indented here document with single-quotes.
+	  [ruby-core:72479] [Bug #11871]
+
+Tue Mar 29 21:03:40 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* symbol.h (is_attrset_id): ASET is an attrset ID.  fix
+	  unexpected safe call instead of an ordinary ASET.
+
+Tue Mar 29 21:01:07 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* doc/syntax/calling_methods.rdoc: fix old operator for safe navigation
+	  operator. [ci skip][fix GH-1182] Patch by @dougo
+
+Tue Mar 29 18:49:54 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/ostruct.rb (freeze): define deferred accessors before
+	  freezing to get rid of an error when just reading frozen
+	  OpenStruct.
+
+Tue Mar 29 18:49:54 2016  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+
+	* lib/ostruct.rb: Fix new_ostruct_member to correctly avoid
+	  redefinition [#11901]
+
+Tue Mar 29 17:54:17 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/ostruct.rb (OpenStruct): make respond_to? working on
+	  just-allocated objects for workaround of Psych.
+	  [ruby-core:72501] [Bug #11884]
+
+Tue Mar 29 17:04:35 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_eval.c (rb_f_catch): [DOC] fix malformed RDoc syntax, "+...+"
+	  cannot enclose non-identifier characters.
+	  a patch by Sebastian S in [ruby-core:74278].  [Bug#12170]
+
+Tue Mar 29 17:03:28 2016  Rei Odaira  <Rei.Odaira@gmail.com>
+
+	* test/-ext-/float/test_nextafter.rb: In AIX,
+	  nextafter(+0.0,-0.0)=+0.0, and nextafter(-0.0,+0.0)=-0.0,
+	  but they should return -0.0 and +0.0, respectively. This is
+	  a known bug in nextafter(3) on AIX, so skip related tests.
+
+Tue Mar 29 16:54:14 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (enc_succ_alnum_char): try to skip an invalid character
+	  gap between GREEK CAPITAL RHO and SIGMA.
+	  [ruby-core:74478] [Bug #12204]
+
+Tue Mar 29 16:45:58 2016  Victor Nawothnig  <Victor.Nawothnig@gmail.com>
+
+	* parse.y (parse_numvar): NTH_REF must be less than a half of
+	  INT_MAX, as it is left-shifted to be ORed with back-ref flag.
+	  [ruby-core:74444] [Bug#12192] [Fix GH-1296]
+
+Tue Mar 29 16:44:54 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* enc/trans/JIS: update Unicode's notice. [Bug #11844]
+
+Tue Mar 29 16:41:27 2016  Eric Hodel  <drbrain@segment7.net>
+
+	* marshal.c (r_object0):  raise ArgumentError when linking to undefined
+	  object.
+
+Tue Mar 29 16:41:27 2016  Eric Hodel  <drbrain@segment7.net>
+
+	* marshal.c (r_object0): Fix Marshal crash for corrupt extended object.
+
+Tue Mar 29 16:40:48 2016  Eric Wong  <e@80x24.org>
+
+	* ext/openssl/ossl_ssl.c (ossl_sslctx_setup): document as MT-unsafe
+	  [ruby-core:73803] [Bug #12069]
+
+Tue Mar 29 16:29:44 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* insns.def (opt_mod): show its method name on ZeroDivisionError.
+	  [Bug #12158]
+
+Tue Mar 29 16:25:27 2016  Anthony Dmitriyev  <antstorm@gmail.com>
+
+	* net/ftp.rb: add NullSocket#closed? to fix closing not opened
+	  connection.  [Fix GH-1232]
+
+Tue Mar 29 16:12:08 2016  Koichi ITO  <koic.ito@gmail.com>
+
+	* variable.c: Added documentation about order of `Module#constants`
+	  [ci skip][Bug #12121][ruby-dev:49505][fix GH-1301]
+
+Tue Mar 29 16:02:26 2016  Rei Odaira  <Rei.Odaira@gmail.com>
+
+	* test/ruby/test_process.rb (test_execopts_gid): Skip a test
+	  that is known to fail on AIX. AIX allows setgid to
+	  a supplementary group, but Ruby does not allow the "-e"
+	  option when setgid'ed, so the test does not work as intended.
+
+Tue Mar 29 15:58:18 2016  Rei Odaira  <Rei.Odaira@gmail.com>
+
+	* test/socket/test_addrinfo.rb (test_ipv6_address_predicates):
+	  IN6_IS_ADDR_V4COMPAT and IN6_IS_ADDR_V4MAPPED are broken
+	  on AIX, so skip related tests.
+
+Tue Mar 29 15:31:06 2016  Rei Odaira  <Rei.Odaira@gmail.com>
+
+	* test/rinda/test_rinda.rb (test_make_socket_ipv4_multicast):
+	  The fifth argument to getsockopt(2) should be modified to
+	  indicate the actual size of the value on return,
+	  but not in AIX. This is a know bug. Skip related tests.
+	* test/rinda/test_rinda.rb (test_ring_server_ipv4_multicast):
+	  ditto.
+	* test/rinda/test_rinda.rb (test_make_socket_unicast): ditto.
+	* test/socket/test_basicsocket.rb (test_getsockopt): ditto.
+	* test/socket/test_sockopt.rb (test_bool): ditto.
+
+Tue Mar 29 15:27:14 2016  Rei Odaira  <Rei.Odaira@gmail.com>
+
+	* test/zlib/test_zlib.rb (test_adler32_combine, test_crc32_combine):
+	  Skip two tests on AIX because zconf.h in zlib does not correctly
+	  recognize _LARGE_FILES in AIX. The problem was already reported
+	  to zlib, and skip these tests until it is fixed.
+
+Tue Mar 29 15:10:31 2016  Rei Odaira  <Rei.Odaira@gmail.com>
+
+	* thread_pthread.c (getstack): __pi_stacksize returned by
+	  pthread_getthrds_np() is wrong on AIX. Use
+	  __pi_stackend - __pi_stackaddr instead.
+
+Tue Mar 29 15:10:05 2016  Alex Boyd  <alex@opengroove.org>
+
+	* lib/irb.rb: avoid to needless truncation when using back_trace_limit option.
+	  [fix GH-1205][ruby-core:72773][Bug #11969]
+
+Tue Mar 29 15:05:16 2016  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+
+	* ext/tk/lib/tkextlib/tcllib/tablelist_tile.rb: fix method name typo.
+	  [ruby-core:72513] [Bug #11893] The patch provided by Akira Matsuda.
+
+
+Tue Mar 29 15:05:02 2016  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+
+	* ext/tk/lib/tkextlib/tcllib/toolbar.rb: fix method name typo.
+	  [ruby-core:72511] [Bug #11891] The patch provided by Akira Matsuda.
+
+
+Tue Mar 29 15:04:42 2016  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+
+	* ext/tk/lib/tkextlib/blt/tree.rb: fix method name typo.
+	  [ruby-core:72510] [Bug #11890] The patch provided by Akira Matsuda.
+
+
+Tue Mar 29 15:04:19 2016  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+
+	* ext/tk/lib/tk/menubar.rb: fix a typo in font name. [ruby-core:72505]
+	  [Bug #11886] The patch provided by Akira Matsuda.
+
+	* ext/tk/sample/*.rb: ditto.
+
+Tue Mar 29 15:03:03 2016  Kenta Murata  <mrkn@mrkn.jp>
+
+	* ruby.h: undef HAVE_BUILTIN___BUILTIN_CHOOSE_EXPR_CONSTANT_P
+	  and HAVE_BUILTIN___BUILTIN_TYPES_COMPATIBLE_P on C++.
+	  [ruby-core:72736] [Bug #11962]
+
+Tue Mar 29 14:58:56 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/socket/option.c (inspect_tcpi_msec): more accurate condition
+	  for TCPI msec member inspection function.
+	  [ruby-core:74388] [Bug #12185]
+
+Tue Mar 29 14:53:58 2016  Naotoshi Seo  <sonots@gmail.com>
+
+	* lib/logger.rb: Remove block from Logger.add as it's not needed
+	  patch provided by Daniel Lobato Garcia [fix GH-1240] [Bug #12054]
+
+Tue Mar 29 14:52:20 2016  Zachary Scott  <zzak@ruby-lang.org>
+
+	* re.c: Remove deprecated kcode argument from Regexp.new and compile
+	  patch provided by Dylan Pulliam [Bug #11495]
+
+Tue Mar 29 14:44:02 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/socket/socket.c (sock_gethostname): support unlimited size
+	  hostname.
+
+Tue Mar 29 14:35:06 2016  Kouhei Sutou  <kou@cozmixng.org>
+
+	* lib/xmlrpc/client.rb: Support SSL options in async methods of
+	  XMLRPC::Client.
+	  [Bug #11489]
+	  Reported by Aleksandar Kostadinov. Thanks!!!
+
+Tue Mar 29 14:22:57 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* marshal.c (r_object0): honor Marshal.load post proc
+	  value for TYPE_LINK.  by Hiroshi Nakamura <nahi@ruby-lang.org>
+	  https://github.com/ruby/ruby/pull/1204 fix GH-1204
+
+Tue Mar 29 14:18:26 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* .travis.yml: removed commented-out code.
+
+Tue Mar 29 14:18:26 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* .travis.yml: removed osx code. follow up with r53517
+
+Tue Mar 29 14:12:22 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/socket/option.c (sockopt_bool): relax boolean size to be one
+	  too not only sizeof(int).  Winsock getsockopt() returns a single
+	  byte as a boolean socket option.  [ruby-core:72730] [Bug #11958]
+
+Tue Mar 29 14:12:22 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/socket/option.c (check_size): extract a macro to check
+	  binary data size, with a consistent message.
+
+	* ext/socket/option.c (sockopt_byte): fix error message,
+	  sizeof(int) differs from sizeof(unsigned char) in general.
+
+Tue Mar 29 14:01:14 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* process.c (rb_execarg_parent_start1): need to convert the encoding to
+	  ospath's one.
+
+Tue Mar 29 14:01:14 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* process.c: use rb_w32_uchdir() instead of plain chdir() on Windows.
+	  reported by naruse via twitter.
+
+	* process.c (rb_execarg_addopt): need to convert the encoding to
+	  ospath's one.
+
+Tue Mar 29 13:56:36 2016  Eric Wong  <e@80x24.org>
+
+	* ext/stringio/stringio.c (strio_binmode): implement to set encoding
+	* test/stringio/test_stringio.rb (test_binmode): new test
+	  [ruby-core:72699] [Bug #11945]
+
+Tue Mar 29 13:50:30 2016  Eric Wong  <e@80x24.org>
+
+	* io.c (io_getpartial): remove unused kwarg from template
+	* test/ruby/test_io.rb (test_readpartial_bad_args): new
+	  [Bug #11885]
+
+Tue Mar 29 13:41:03 2016  Tadashi Saito  <tad.a.digger@gmail.com>
+
+	* compile.c, cont.c, doc, man: fix common misspelling.
+	  [ruby-core:72466] [Bug #11870]
+
+Tue Mar 29 13:31:34 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (regexp): set_yylval_num sets u1, should use nd_tag
+	  instead of nd_state.  [ruby-core:72638] [Bug #11932]
+
+Tue Mar 29 13:31:34 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (set_yylval_num): should be used as nd_state, set to u3.
+	  [ruby-core:72638] [Bug #11932]
+
+Tue Mar 29 13:26:15 2016  Joseph Tibbertsma  <josephtibbertsma@gmail.com>
+
+	* gc.c (RVALUE_PAGE_WB_UNPROTECTED): fix a typo of argument name.
+	  [Fix GH-1221]
+
+Thu Jan 21 16:39:55 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* Makefile.in (update-rubyspec): fix r53208 like r53451.
+
+Fri Jan 15 00:05:57 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/uri/generic.rb (URI::Generic#to_s): change encoding to
+	  UTF-8 as Ruby 2.2/ by Koichi ITO <koic.ito@gmail.com>
+	  https://github.com/ruby/ruby/pull/1188 fix GH-1188
+
+Tue Jan 12 17:23:39 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* process.c (rb_execarg_parent_start1): need to convert the encoding to
+	  ospath's one.
+
+Tue Jan 12 17:23:39 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* process.c: use rb_w32_uchdir() instead of plain chdir() on Windows.
+	  reported by naruse via twitter.
+
+	* process.c (rb_execarg_addopt): need to convert the encoding to
+	  ospath's one.
+
+Tue Jan 12 15:21:00 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* include/ruby/missing.h (explicit_bzero_by_memset_s): remove
+	  inline implementation by memset_s, which needs a macro before
+	  including headers and can cause problems in extension libraries
+	  by the order of the macro and headers.
+
+Thu Dec 24 23:01:57 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* NEWS: added entry for CGI.escapeHTML optimization.
+
+Thu Dec 24 18:43:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* error.c (rb_compile_error_with_enc, rb_compile_error),
+	  (rb_compile_bug): deprecate internal functions.
+
+	* parse.y (parser_yyerror): construct exception message with
+	  source code and caret.
+
+Thu Dec 24 17:25:42 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (append_compile_error), parse.y (compile_error):
+	  preserve encoding of source file name in exceptions.
+
+	* error.c (rb_compile_error_str, rb_compile_bug_str): add.
+
+Thu Dec 24 16:17:47 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* common.mk (fake.rb): $(arch)-fake.rb must depend on miniruby because
+	  it may depend on miniruby.
+
+Thu Dec 24 16:13:05 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* common.mk (ripper.c): r50045 wrongly replace $(PWD) with ../..
+	  It is the top of build directory, not topsrcdir.
+
+Thu Dec 24 15:02:42 2015  sorah (Shota Fukumori)  <her@sorah.jp>
+
+	* tool/vcs.rb (IO.popen): Refactor. Avoid assigning in condition.
+
+Thu Dec 24 15:01:38 2015  sorah (Shota Fukumori)  <her@sorah.jp>
+
+	* tool/file2lastrev.rb: Fix ArgumentError to work on Ruby 1.8.7.
+
+Thu Dec 24 14:44:08 2015  sorah (Shota Fukumori)  <her@sorah.jp>
+
+	* tool/vcs.rb (IO.popen): Enable on Ruby 1.9 where chdir option is not
+	  supported on IO.popen
+
+	* tool/vcs.rb (IO.popen): Fix NoMethodError. I guess r49705 was not
+	  tested... :/
+
+Thu Dec 24 14:57:03 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* NEWS: rename
+	  "Implementation changes" section to
+	  "Supported platform changes" section.
+
+	* NEWS: add "Implementation improvements" and add several entries.
+
+	* NEWS: add NEWS entries by Eric Wong. [ruby-core:72450]
+
+Thu Dec 24 00:26:05 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/io/console/extconf.rb: fix gem build failure on Windows.
+	  only win32_vk.inc is included in the gem and no dependencies for
+	  the header, so that gperf will not be mandatory.
+	  [ruby-core:72453] [Bug #11866]
+
+	* ext/io/console/io-console.gemspec: include depend file and
+	  win32_vk header.
+
+Wed Dec 23 23:58:44 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (rb_readwrite_syserr_fail): works with the given errno than
+	  thread local errno.
+
+Wed Dec 23 17:57:45 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* file.c, io.c, util.c: prefer rb_syserr_fail with saved errno
+	  over setting errno then call rb_sys_fail, not to be clobbered
+	  potentially and to reduce thread local errno accesses.
+
+Wed Dec 23 11:58:52 2015  Yuichiro Kaneko  <yui-knk@ruby-lang.org>
+
+	* string.c: Fix document. Default value of the first
+	  argument of `String#split` is not `$;` but `nil`.
+	  When `nil` is passed as first argument, `$;` is used.
+	  [ci skip] [Bug #11729] [ruby-dev:49378]
+
+Wed Dec 23 07:15:17 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/init.c (rsock_init_sock): reject reserved FDs
+	  [ruby-core:72445] [Bug #11862]
+
+Wed Dec 23 02:59:26 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (__STDC_WANT_LIB_EXT1__): necessary to use memset_s
+	  in strict C99 mode.
+
+Wed Dec 23 02:34:36 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* regexec.c (match_at): move direct threaded VM code to get rid of
+	  mixed declarations and code, and enable it only for gcc since it
+	  depends on a gcc extension.
+
+Wed Dec 23 02:23:19 2015  Yuki Nishijima  <mail@yukinishijima.net>
+
+	* gems/bundled_gems: Upgrade the did_you_mean gem to 1.0.0
+
+	* NEWS: Add news about the did_you_mean gem
+
+Wed Dec 23 02:18:57 2015  Jake Worth  <jakeworth82@gmail.com>
+
+	* doc/contributing.rdoc: [DOC] remove an extra word "here".
+	  [Fix GH-1169]
+
+Wed Dec 23 01:58:20 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* regexec.c (USE_DIRECT_THREADED_VM): enable direct threaded VM by
+	  the default.
+
+Tue Dec 22 22:15:53 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* gc.c (internal_object_p): should not expose singleton classes
+	  without a metaclass.  based on patches by ko1 and shugo.
+	  [Bug #11740]
+
+	* class.c (rb_singleton_class_object_p): added.
+
+Tue Dec 22 22:15:08 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/io/console/io-console.gemspec: bump up to 0.4.4.
+
+Tue Dec 22 22:11:06 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* NEWS: Added news entry of Psych 2.0.17
+
+Tue Dec 22 22:09:01 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* NEWS: Added news entry of RDoc 4.2.1
+
+Tue Dec 22 21:20:00 2015  Kenta Murata  <mrkn@mrkn.jp>
+
+	* ext/bigdecimal/bigdecimal.gemspec: bump version to 1.2.8.
+
+Tue Dec 22 21:08:05 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/rdoc.rb: bump version to 4.2.1. It contains following fixes.
+	  https://github.com/rdoc/rdoc/pull/340
+	  https://github.com/rdoc/rdoc/pull/341
+	  https://github.com/rdoc/rdoc/pull/367
+	  https://github.com/rdoc/rdoc/pull/368
+	* lib/rdoc/*: ditto.
+	* test/rdoc/*: ditto.
+
+Tue Dec 22 20:25:33 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ext/psych/lib/psych.rb: bump version to 2.0.17
+	* ext/psych/psych.gemspec: ditto.
+
+Tue Dec 22 20:14:47 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c: move vm_callee_setup_block_arg() (and related
+	  functions) to the latter location.
+	  This moving recovers performance a little.
+	  [Bug #11829]
+
+Tue Dec 22 15:21:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (str_compat_and_valid): as scrub does nothing for dummy
+	  encoding string now, incompatible encoding is not a matter.
+
+Tue Dec 22 14:31:28 2015  Toru Iwase  <tietew@tietew.net>
+
+	* ext/cgi/escape/escape.c (optimized_escape_html): CGI.escapeHTML
+	  should return unfrozen new string.
+	  [ruby-core:72426] [Bug #11858]
+
+Tue Dec 22 05:39:58 2015  Takashi Kokubun  <takashikkbn@gmail.com>
+
+	* ext/cgi/escape/escape.c (preserve_original_state): Preserve
+	  original state for tainted and frozen.  [Fix GH-1166]
+	  [ruby-dev:49451] [Bug #11855]
+
+Tue Dec 22 03:57:20 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/init.c (rsock_init_sock): check FD after validating
+	* test/socket/test_basicsocket.rb (test_for_fd): new
+	  [ruby-core:72418] [Bug #11854]
+
+Mon Dec 21 21:29:45 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* variable.c (struct ivar_update): rename "extended" to "iv_extended"
+	  to avoid name conflict with /usr/include/floatingpoint.h on
+	  Solaris. [Bug #11853] [ruby-dev:49448]
+
+Mon Dec 21 12:15:32 2015  Kimura Wataru  <kimuraw@i.nifty.jp>
+
+	* test/ruby/test_io.rb: handled rlimit value same as r52277
+	  [Bug #11852][ruby-dev:49446]
+
+Mon Dec 21 10:21:22 2015  Ilya Vassilevsky <vassilevsky@gmail.com>
+
+	* lib/net/http.rb (open_timeout): update default value in RDoc
+	  [ruby-core:72413]
+
+Mon Dec 21 10:18:46 2015  Kazuki Yamaguchi  <k@rhe.jp>
+
+	* vm_backtrace.c (rb_profile_frames): ignore ifunc frames as it
+	  did before.  [ruby-core:72409] [Bug #11851]
+
+Mon Dec 21 09:33:17 2015  Karol Bucek  <kares@users.noreply.github.com>
+
+	* ext/openssl/lib/openssl/ssl.rb (OpenSSL::SSL::SSLSocket): fix
+	  NotImplementedError typo.  [Fix GH-1165]
+
+Sun Dec 20 20:54:51 2015  Takashi Kokubun  <takashikkbn@gmail.com>
+
+	* cgi/escape/escape.c: Optimize CGI.escapeHTML for
+	  ASCII-compatible encodings.  [Fix GH-1164]
+
+Sun Dec 20 15:36:46 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/erb.rb: revert r53123. It breaks compatibility like thor and
+	  rspec-rails.
+	  We should try with Ruby 2.4 or 3.0.
+	  [Bug #11842][ruby-core:72374]
+	* lib/rdoc/erb_partial.rb: ditto.
+	* template/verconf.h.tmpl: ditto.
+
+Sun Dec 20 11:43:31 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (parser_yylex): allow here documents in labeled
+	  argument.  [ruby-core:72396] [Bug #11849]
+
+Sun Dec 20 11:14:11 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* proc.c (rb_mod_define_method): should check Symbol or not.
+	  [Bug #11850]
+
+	* test/ruby/test_method.rb: add a test.
+
+Sun Dec 20 11:01:57 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* proc.c (rb_mod_define_method): fix notation.
+
+Sun Dec 20 10:54:15 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* proc.c (proc_new): fix notation.
+
+Sun Dec 20 00:29:00 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* proc.c (rb_proc_get_iseq): proc made from symbol does not have
+	  iseq.  fix infinite loop.  [ruby-core:72381] [Bug #11845]
+
+Sat Dec 19 20:06:10 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* enc/windows_1250.c: Should not use C++ style comments (C99 feature).
+	  [Bug #11843]
+
+Sat Dec 19 17:17:04 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/webrick/utils.rb (WEBrick::Utils::TimeoutHandler#initialize):
+	  use WEBrick::Utils::TimeoutHandler::Thread, which is ignored by
+	  LeakChecker#find_threads, instead of ::Thread to get rid of
+	  thread leak checker.  since this TimeoutHandler is resident
+	  during tests because of Singleton, it waits for the next timeout
+	  if it has any schedules.  in the case of nested timeouts, inner
+	  timeout does not cancel outer timeouts and then those schedules
+	  still remain.
+
+Sat Dec 19 14:28:01 2015  Jake Worth  <jakeworth82@gmail.com>
+
+	* ext/zlib/zlib.c (Init_zlib): [DOC] Fix double-word typo and
+	  grammatical error.  [Fix GH-1162]
+
+Sat Dec 19 14:23:59 2015  Jake Worth  <jakeworth82@gmail.com>
+
+	* lib/csv.rb (CSV#initialize): [DOC] Fix double-word typo.
+	  [Fix GH-1161]
+
+Sat Dec 19 10:33:33 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
+
+	* enc/iso_8859_2.c, enc/windows_1250.c: separate Windows-1250
+	  from ISO-8859-2 to fix 0x80..0x9e range (from Kimihito Matsui)
+
+Fri Dec 18 21:26:54 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* lib/webrick/utils.rb (WEBrick::Utils::TimeoutHandler): To prevent
+	  potential deadlocks, Queue is used to tell update of @timeout_info
+	  instead of sleep and wakeup. [Bug #11742] [ruby-dev:49387]
+
+Fri Dec 18 17:24:09 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* compile.c (ibf_load_object_string): use fstring if frozen string.
+
+Fri Dec 18 16:54:38 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/stringio/stringio.c (strio_set_encoding): add StringIO's own
+	  encoding and separate it from the buffer string to override the
+	  encoding of string when reading.  [ruby-core:72189] [Bug #11827]
+	  note that setting the encoding of its buffer string directly
+	  without StringIO#set_encoding may cause unpredictable behavior.
+
+Fri Dec 18 16:50:35 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* compile.c (ibf_load_setup): check tainted string argument.
+
+Fri Dec 18 16:12:13 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: define USE_LAZY_LOAD if it is not defined.
+
+Fri Dec 18 15:40:06 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/stringio/stringio.c (strio_unget_bytes): extract from
+	  strio_ungetbyte to share with strio_ungetc.
+
+Fri Dec 18 12:39:42 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* doc/syntax/*.rdoc: separated modifier at sentence.
+	  [ci skip][fix GH-1121] Patch by @clandry94
+
+Fri Dec 18 12:09:21 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/stringio/stringio.c (strio_ungetbyte): pad with \000 when
+	  the current position is after the end.
+
+Fri Dec 18 11:24:48 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* vm_method.c (rb_method_entry_make, check_override_opt_method):
+	  should check whether a newly created method overrides an optimize
+	  method in case the method is defined in a prepended module of a
+	  built-in class.
+	  [ruby-core:72226] [Bug #11836]
+
+Fri Dec 18 11:09:38 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* vm.c (vm_exec): call RUBY_DTRACE_CMETHOD_RETURN_HOOK instead of
+	  RUBY_DTRACE_METHOD_RETURN_HOOK.
+
+Fri Dec 18 10:24:44 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/irb/ruby-lex.rb: fixed parse error for striped heredocument syntax.
+	  [fix GH-1127] Patch by @koic
+
+Fri Dec 18 09:44:47 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ext/pty/pty.c: fix double words typo.
+	  [ci skip][fix GH-1157] Patch by @jwworth
+
+Fri Dec 18 09:42:45 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ext/nkf/nkf-utf8/utf8tbl.c: fix a typo.
+	  [ci skip][fix GH-1159] Patch by @akshay-vishnoi
+	* ext/nkf/nkf-utf8/utf8tbl.h: ditto.
+
+Fri Dec 18 07:39:01 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* vm.c (rb_vm_check_redefinition_opt_method): should check the real
+	  class instead of the origin iclass.
+	  [ruby-core:72188] [Bug #11826]
+
+Thu Dec 17 22:13:10 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* vm_args.c (vm_caller_setup_arg_block): remove code for ifunc
+	  because it was made unnecessary by r52138.
+
+Thu Dec 17 16:13:10 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* proc.c (rb_block_arity): should not call GetProcPtr() for symbols.
+	  [ruby-core:72205] [Bug #11830]
+
+Thu Dec 17 14:16:29 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (rb_str_scrub): the result should be infected by the
+	  original string.
+
+Thu Dec 17 13:35:27 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* transcode.c (rb_econv_substr_append, econv_primitive_convert):
+	  the result should be infected by the original string.
+
+Thu Dec 17 09:46:08 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* re.c (reg_names_iter): should consider encoding of regexp.
+	  [ruby-core:72185] [Bug #11825]
+
+Thu Dec 17 03:52:10 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm.c (vm_make_env_each): should not compare with Qfalse and FALSE.
+	  Pointed at http://d.hatena.ne.jp/nagachika/20151216/ruby_trunk_changes_53128_53163
+
+Thu Dec 17 03:15:25 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c (vm_call_method_each_type): should not set fastpath
+	  with keyword arguments for VM_METHOD_TYPE_ATTRSET type methods.
+
+	  Normally, we can not use keyword arguments for this kind of methods,
+	  (obj.foo = 1), but we can set alias names for them.
+	  [Bug #11657]
+
+	* test/ruby/test_keyword.rb: add a test for this fix.
+
+Wed Dec 16 20:32:43 2015  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+
+	* ext/fiddle/handle.c: check tainted string arguments.
+	  Patch provided by tenderlove and nobu.
+
+	* test/fiddle/test_handle.rb (class TestHandle): add test for above.
+
+
+Wed Dec 16 19:30:56 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* vm.c (vm_make_proc_from_block): should convert a Symbol to a Proc.
+	  [ruby-core:72083] [Bug #11811]
+
+Wed Dec 16 16:17:34 2015  Eric Wong  <e@80x24.org>
+
+	* test/ruby/test_io.rb: fix spelling errors
+
+Wed Dec 16 16:04:49 2015  Eric Wong  <e@80x24.org>
+
+	* NEWS: note IO#advise change [ruby-core:72168]
+
+Wed Dec 16 15:35:13 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm.c: fix mark miss for proc given as passed block.
+	  [Bug #11750]
+
+	* vm.c (vm_make_proc_from_block): should return a Proc object
+	  if block is given. Previous implementation returns
+	  a Proc object only when corresponding Proc object is not
+	  available.
+
+	* vm.c (vm_make_env_each): ditto.
+
+	* test/ruby/test_proc.rb: add a test for this bug.
+
+Wed Dec 16 12:24:59 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+
+	* test_struct.rb: Test that initialize is overridable [#11708]
+
+Wed Dec 16 10:49:51 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (block_command, block_call): fix `&.` calls after
+	  block_call.  [Feature #11537]
+
+Wed Dec 16 00:53:45 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* lib/webrick/utils.rb (WEBrick::Utils::TimeoutHandler): Acquire
+	  TimeoutMutex only when accessing @timeout_info for avoiding
+	  potential deadlock. [Bug #11742] [ruby-dev:49387]
+
+Wed Dec 16 00:39:27 2015  Jake Worth  <jakeworth82@gmail.com>
+
+	* doc/extension.rdoc: [DOC] fix double-word typo.  [Fix GH-1153]
+
+Wed Dec 16 00:25:41 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* lib/webrick/utils.rb (WEBrick::Utils::TimeoutHandler#initialize):
+	  TimeoutMutex should be acquired when accessing @timeout_info.
+	  To avoid deadlock, interrupt() calls are delayed.
+	  Due to the mutex, it is safe to treat ary without ary.dup.
+	  [Bug #11742] [ruby-dev:49387]
+
+Tue Dec 15 23:13:10 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* gc.c: Delete excess semicolon after RUBY_ALIAS_FUNCTION().
+	  Suppress "syntax error:  empty declaration" warnings by
+	  Oracle Solaris Studio 12.x on Solaris. [Bug #11821]
+
+	* hash.c: ditto, after NOINSERT_UPDATE_CALLBACK().
+
+Tue Dec 15 18:04:04 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
+
+	* NEWS: added news about EBCDIC encoding
+
+Tue Dec 15 17:57:57 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
+
+	* enc/ebcdic.h, enc/trans/ebcdic.trans,
+	  test/ruby/test_transcode.rb: Fixed encoding name
+	  to the correct one in the IANA registry (IBM037)
+	  and added an alias (ebcdic-cp-us)
+
+Tue Dec 15 16:19:26 2015  Takashi Kokubun  <takashikkbn@gmail.com>
+
+	* lib/erb.rb: Render erb with array buffer for function call optimization.
+	  [fix GH-1143]
+	* lib/rdoc/erb_partial.rb: ditto.
+	* template/verconf.h.tmpl: ditto.
+
+Tue Dec 15 13:50:05 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (rb_str_oct): [DOC] mention radix indicators.
+	  [ruby-core:71310] [Bug #11648]
+
+Tue Dec 15 12:20:30 2015  Takashi Kokubun  <takashikkbn@gmail.com>
+
+	* lib/erb.rb: Simplify regexp to optimize erb scanner.
+	  [fix GH-1144]
+
+Tue Dec 15 11:56:24 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/uri/common.rb: make code block for rdoc.
+	  [ci skip][fix GH-1152] Patch by @Tonkpils
+
+Tue Dec 15 11:55:08 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ext/zlib/zlib.c: fix a typo.
+	  [ci skip][fix GH-1149] Patch by @crismali
+
+Tue Dec 15 09:14:14 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
+
+	* tool/transcode_tablegen.rb: detailed documentation
+	  for transcode_tblgen function [ci skip]
+
+Mon Dec 14 22:11:11 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
+
+	* enc/ebcdic.h: new dummy encoding EBCDIC-US
+	* enc/trans/ebcdic.trans: transcodings between EBCDIC-US
+	  and iso-8859-1 [with code from Andrea Ribuoli]
+	* test/ruby/test_transcode.rb: tests for above
+	* tool/transcode_tablegen.rb: additional argument for
+	  method transcode_tblgen
+
+Mon Dec 14 17:04:14 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ext/socket/lib/socket.rb: use safe navigation operator.
+	  [fix GH-1142] Patch by @mlarraz
+	* lib/drb/extservm.rb: ditto.
+	* lib/net/http.rb: ditto.
+	* lib/net/http/response.rb: ditto.
+	* lib/scanf.rb: ditto.
+	* lib/uri/generic.rb: ditto.
+
+Mon Dec 14 17:03:05 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* bootstraptest/runner.rb: use safe navigation operator.
+	  [fix GH-1142] Patch by @mlarraz
+	* test/openssl/test_pair.rb: ditto.
+	* test/ruby/test_econv.rb: ditto.
+	* test/ruby/test_settracefunc.rb: ditto.
+	* test/thread/test_queue.rb: ditto.
+
+Mon Dec 14 14:33:35 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/xmlrpc.rb: added documentation for parser details.
+	  [ci skip][fix GH-1124] Patch by @jrafanie
+
+Mon Dec 14 11:46:52 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* enum.c: fix a typo in documentation.
+	  [ci skip][fix GH-1140] Patch by @jutaz
+	* io.c: ditto.
+	* iseq.c: ditto.
+	* numeric.c: ditto.
+	* process.c: ditto.
+	* string.c: ditto.
+	* vm_trace.c: ditto.
+
+Mon Dec 14 11:41:59 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/cgi.rb: fix a typo in documentation.
+	  [ci skip][fix GH-1140] Patch by @jutaz
+
+Mon Dec 14 11:31:00 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* compile.c: fix typos.
+	  [ci skip][fix GH-1140] Patch by @jutaz
+	* dir.c: ditto.
+	* gc.c: ditto.
+	* io.c: ditto.
+	* node.h: ditto.
+	* thread_pthread.c: ditto.
+	* vm_insnhelper.c: ditto.
+	* vsnprintf.c: ditto.
+
+Mon Dec 14 11:27:01 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* enc/iso_2022_jp.h: fix typos.
+	  [ci skip][fix GH-1140] Patch by @jutaz
+	* enc/utf_16_32.h: ditto.
+	* enc/utf_7.h: ditto.
+
+Mon Dec 14 11:25:57 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* benchmark/bm_app_aobench.rb: fix typos.
+	  [ci skip][fix GH-1140] Patch by @jutaz
+	* benchmark/bm_vm_thread_pipe.rb: ditto.
+
+Sun Dec 13 23:46:10 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (trace_lex_state): trace lex_state changes if yydebug is
+	  set, and send the messages to rb_stdout.
+
+	* parse.y (rb_parser_printf): store YYPRINTF messages per lines
+	  so that lex_state traces do not mix.
+
+	* tool/ytab.sed: add parser argument to yy_stack_print too.
+
+Sun Dec 13 20:41:16 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (build_lex_state_name, trace_lex_state): lex_state is
+	  now bit flags and can be set 2 bits or more.
+
+Sun Dec 13 20:26:30 2015  Yuki Yugui Sonoda  <yugui@yugui.jp>
+
+	* test/ruby/test_syntax.rb: fix typo in test
+
+Sun Dec 13 20:12:14 2015  Yuki Yugui Sonoda  <yugui@yugui.jp>
+
+	* parse.y (parse_percent): Allow %-literals in labeled arg as
+	  r51624 did for parentheses.
+	  Fixes [ruby-core:72084] [Bug #11812].
+
+Sun Dec 13 20:02:15 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ChangeLog: fix a typo
+
+Sun Dec 13 19:54:26 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* test/lib/envutil.rb: move envutil's assertions under Test::Unit::Assertion.
+	* test/lib/test/unit/assertions.rb: ditto.
+
+Sun Dec 13 19:24:20 2015  Yuki Yugui Sonoda  <yugui@yugui.jp>
+
+	* parse.y (lex_state_name): Make it return the correct names.
+	  Add new names to follow r51617; Indices ffs(2) returns are 1-origin.
+
+Sun Dec 13 18:40:45 2015  Yuki Yugui Sonoda  <yugui@yugui.jp>
+
+	* parse.y: debug output of lex_state transition if PARSER_DEBUG
+
+Sun Dec 13 18:49:25 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (parse_mode_enc): preserve encoding of mode string in
+	  warnings.
+
+	* io.c (io_encname_bom_p): check BOM prefix only, not including
+	  UTF prefix.
+
+	* io.c (parse_mode_enc): warn BOM with non-UTF encoding.
+
+	* io.c (parse_mode_enc): fix buffer overflow.
+
+Sun Dec 13 18:35:57 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/fiddle/function.c (initialize): check all arguments first.
+	  reported by Marcin 'Icewall' Noga of Cisco Talos.
+
+	* ext/fiddle/conversions.h (PTR2NUM): use signed integer to make
+	  Fixnum for negative values.
+
+Sun Dec 13 18:33:41 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* pack.c (pack_pack): always check index range against the
+	  receiver array length, which can be shortened by elements
+	  conversion.  reported by Marcin 'Icewall' Noga of Cisco Talos.
+
+Sun Dec 13 18:28:52 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/psych/psych_emitter.c (start_document): should not exceed
+	  tags array range.
+
+	* ext/psych/psych_emitter.c (start_document): ensure string before
+	  encoding conversion.
+
+Sun Dec 13 18:26:31 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/tk/tkutil/tkutil.c (tk_hash_kv): check types of array
+	  argument.  reported by Marcin 'Icewall' Noga of Cisco Talos.
+
+	* ext/tk/tkutil/tkutil.c (cbsubst_table_setup): check length of
+	  argument arrays for each access, as callback methods can modify
+	  them.  reported by Marcin 'Icewall' Noga of Cisco Talos.
+
+	* ext/tk/tkutil/tkutil.c (cbsubst_table_setup): check types of
+	  argument elements.  reported by Marcin 'Icewall' Noga of Cisco
+	  Talos.
+
+Sun Dec 13 18:19:20 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/win32ole/win32ole.c (ole_vstr2wc): check argument type, vstr
+	  must be a String here.  reported by Marcin 'Icewall' Noga of
+	  Cisco Talos.
+
+Sun Dec 13 16:41:01 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (BOOTSTRAPRUBY): make BASERUBY full path before
+	  building ruby to get rid of unexpectedly invoking built ruby.
+	  [ruby-core:72065] [Bug #11807]
+
+	* configure.in (BOOTSTRAPRUBY): use MINIRUBY but not BASERUBY
+	  unless cross compiling.  [ruby-core:72065] [Bug #11807]
+
+Sun Dec 13 14:17:19 2015  Akinori MUSHA  <knu@iDaemons.org>
+
+	* test/test_shellwords.rb (TestShellwords): Add many more tests
+	  for handling whitespace characters and frozenness.
+
+Sun Dec 13 14:16:09 2015  Akinori MUSHA  <knu@iDaemons.org>
+
+	* lib/shellwords.rb (Shellwords#shellsplit): Document that this
+	  method does not treat shell metacharacters as such.
+
+Sun Dec 13 12:17:43 2015  Eric Wong  <e@80x24.org>
+
+	* lib/shellwords.rb (shellescape): duplicate frozen literal
+	* test/test_shellwords.rb (test_stringification): new test
+
+Sun Dec 13 11:47:35 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* object.c (rb_inspect): check the default internal encoding as
+	  String#inspect do.
+	  [ruby-dev:49415] [Bug #11787]
+
+Sun Dec 13 11:38:12 2015  Akinori MUSHA  <knu@iDaemons.org>
+
+	* lib/shellwords.rb: Turn on frozen-string-literal after fixing
+	  shellsplit.
+
+Sun Dec 13 10:44:44 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
+
+	* KNOWNBUGS.rb: Fixed typo, made more explicit [ci skip]
+
+Sun Dec 13 10:26:47 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/openssl/ossl_ssl.c (ssl_npn_select_cb_common): fix parsing
+	  protocol list.
+	  The protocol list from OpenSSL is not null-terminated.
+	  patched by Kazuki Yamaguchi [Bug #11810] [ruby-core:72082]
+
+Sun Dec 13 06:40:30 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+
+	* lib/ostruct.rb: Have OpenStruct#dig raise if argument is not a
+	  symbol
+	  nor a string. See [#11762]
+
+Sun Dec 13 00:05:42 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* vm_insnhelper.c (vm_call_method_missing): method_missing should
+	  not be refined.
+	  [ruby-core:72080] [Bug #11809]
+
+Sat Dec 12 23:00:17 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/nkf/nkf-utf8/nkf.c: Merge nkf 2.1.4.
+
+Sat Dec 12 18:52:26 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* object.c (rb_obj_dig): raise TypeError if an element does not
+	  have #dig method.  [ruby-core:71798] [Bug #11762]
+
+Sat Dec 12 17:59:07 2015  Yuichiro Kaneko  <yui-knk@ruby-lang.org>
+
+	* test/ruby/test_regexp.rb: Add test cases for `$KCODE` and `$=` warning
+	  [Misc #11770][ruby-dev:49398]
+
+Sat Dec 12 17:11:57 2015  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+
+	* doc/NEWS-0.2.2: add description about incompatible change in Hash
+	  duplicated key overriding policy. [Bug #10315] [Bug #11501]
+
+Sat Dec 12 07:44:38 2015  Eric Wong  <e@80x24.org>
+
+	* io.c (do_io_advise): do not raise on ENOSYS
+	* test/ruby/test_io.rb (test_advise): do not skip on Errno::ENOSYS
+	  (test_advise_pipe): ditto
+	  [ruby-core:72066] [Feature #11806]
+
+Sat Dec 12 07:05:29 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* enc/windows_1252.c: separate from ISO-8859-1 to fix 0x80..0x9e
+	  range.  [ruby-core:64049] [Bug #10097]
+
+Fri Dec 11 23:33:40 2015  Yusuke Endoh  <mame@ruby-lang.org>
+
+	* sample/trick2015/: added the award-winning entries of TRICK 2015.
+	  See https://github.com/tric/trick2015 for the contest outline.
+
+Fri Dec 11 17:59:05 2015  Eric Wong  <e@80x24.org>
+
+	* insns.def (opt_case_dispatch): avoid converting Infinity
+	* test/ruby/test_optimization.rb (test_opt_case_dispatch_inf): new
+	  [ruby-dev:49423] [Bug #11804]'
+
+Fri Dec 11 16:48:57 2015  Eric Wong  <e@80x24.org>
+
+	* hash.c (rb_num_hash_start): avoid pathological behavior
+	  [ruby-core:72028] [Feature #11405]
+
+Fri Dec 11 11:58:46 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* NEWS: Mentioned rubygems-2.5.1
+
+Fri Dec 11 11:52:39 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/rubygems: Update to RubyGems 2.5.1
+	* test/rubygems: ditto.
+
+Fri Dec 11 11:38:14 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (iseq_compile_each, ibf_load_object_hash): rehash
+	  case-dispatch hash to reduce collisions.
+	  http://d.hatena.ne.jp/ku-ma-me/20151210
+
+Fri Dec 11 03:44:43 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* object.c (rb_inspect): dump inspected result with rb_str_escape()
+	  instead of raising Encoding::CompatibilityError. [Feature #11801]
+
+	* string.c (rb_str_escape): added to dump given string like
+	  rb_str_inspect without quotes and always dump in US-ASCII
+	  like rb_str_dump.
+
+Thu Dec 10 14:59:59 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* test/ruby/test_gc.rb (test_expand_heap): relax condition (1->2).
+
+Thu Dec 10 14:15:59 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* cont.c: fix a double word typo.
+	  [Bug #11313][ruby-core:69749]
+
+Thu Dec 10 14:13:34 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ext/tk/lib/multi-tk.rb: fix typos.
+	  [Bug #11764][ruby-core:71800]
+
+Thu Dec 10 11:33:34 2015  Eric Wong  <e@80x24.org>
+
+	* compile.c (iseq_compile_each): reduce needless rb_str_dup
+	  [ruby-core:72018] <5668DB6E.8000101@ruby-lang.org>
+
+Thu Dec 10 09:32:51 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/mkmf.rb, lib/shellwords.rb: disable frozen-string-literal.
+	  [ruby-core:72011] [Bug #11800]
+
+Thu Dec 10 06:33:39 2015  Eric Wong  <e@80x24.org>
+
+	* marshal.c (memsize_dump_arg): remove NULL check
+	  (memsize_load_arg): ditto
+
+Thu Dec 10 05:53:18 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* tool/mkconfig.rb: rbconfig must not be frozen-string-literal to
+	  expand CONFIG hash.  [ruby-core:72006] [Bug #11798]
+
+Thu Dec 10 05:03:51 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/ifaddr.c (ifaddr_mark): remove empty function
+	  (ifaddr_type): pass zero to rb_data_type_t.function.dmark
+
+Thu Dec 10 04:49:16 2015  Eric Wong  <e@80x24.org>
+
+	* proc.c (bm_free): remove, use default free
+	  (method_data_type): use RUBY_TYPED_DEFAULT_FREE
+
+Thu Dec 10 02:01:41 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* compile.c (iseq_compile_each): do not add debug information
+	  without --debug or --debug=frozen-string-literal option
+	  because String#dup slows down with debug information.
+	  [Feature #11725]
+
+	* NEWS: apply about it.
+
+	* test/ruby/test_rubyoptions.rb: catch up this fix with refactoring.
+
+Thu Dec 10 00:06:56 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* iseq.c: rename methods
+	  RubyVM::InstructionSequence#to_binary_format -> #to_binary
+	  RubyVM::InstructionSequence.from_binary_format -> .load_from_binary
+	  RubyVM::InstructionSequence.from_binary_format_extra_data ->
+	                             .load_from_binary_extra_data
+
+	* iseq.c: fix document of iseq.to_binary.
+	  [Fix GH-1134]
+
+	* sample/iseq_loader.rb: catch up this change.
+
+	* test/lib/iseq_loader_checker.rb: ditto.
+
+Wed Dec  9 17:02:03 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* regparse.h (SET_NTYPE): get rid of breaking strict aliasing.
+	  patch by Zarko Todorovski in [ruby-core:71953].  [Bug #11790]
+
+Wed Dec  9 16:10:37 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm.c (rb_vm_cref_in_context): Module#define_method in non-class
+	  expression should be public.
+	  [Bug #11754]
+
+	* test/ruby/test_method.rb: add a test.
+
+Wed Dec  9 14:45:27 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (gc_mark_stacked_objects): fix typo.
+	  reported by XIE Zhibang. [Bug #11763]
+
+Wed Dec  9 14:37:51 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* doc/syntax/refinements.rdoc: remove outdated description.
+
+Wed Dec  9 09:58:09 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* ext/**/*.c (*_memsize): same as r52986 for extensions.
+
+Wed Dec  9 09:46:19 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* .gitignore: ignored ISeq binary format.
+
+Wed Dec  9 09:34:41 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* *.c (*_memsize): do not check ptr.
+	  NULL checking is finished Before call of memsize functions.
+	  See r52979.
+
+Wed Dec  9 09:25:29 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* test/net/smtp/test_response.rb: use Test::Unit. We should use Test::Unit
+	  without rubygems and rdoc.
+
+Wed Dec  9 06:26:23 2015  Colin Kelley <colindkelley@gmail.com>
+
+	* lib/uri/generic.rb: enable frozen_string_literal
+	  (split_userinfo): remove explicit .freeze for string literals
+	  (check_path): ditto
+	  (query): ditto
+	  (fragment): ditto
+	  (to_s): ditto
+	  [ruby-core:71910] [Bug #11759]
+
+Wed Dec  9 06:25:47 2015  Eric Wong  <e@80x24.org>
+
+	* test/uri/test_generic.rb (to_s): new test
+	  [ruby-core:71820]
+
+Wed Dec  9 02:18:52 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* compile.c (ibf_dump_memsize): should check NULL.
+
+Wed Dec  9 01:46:35 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* string.c (rb_str_init): now accepts new option parameter `encoding'.
+	  [Feature #11785]
+
+Wed Dec  9 00:52:37 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* file.c (rb_stat_wr, rb_stat_ww): call get_stat only once and
+	  reduce checking struct.  patch by Yuki Kurihara in
+	  [ruby-core:71949].  [Misc #11789]
+
+Wed Dec  9 00:24:33 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* compile.c (iseq_ibf_dump): dump extra data just string length.
+
+	* sample/iseq_loader.rb: add using
+	  RubyVM::InstructionSequence.from_binary_format_extra_data method
+	  (commented out).
+
+Mon Dec  9 00:21:19 2015  Yuki Nishijima  <mail@yukinishijima.net>
+
+	* gems/bundled_gems: Upgrade the did_you_mean gem to 1.0.0.rc1
+
+Wed Dec  9 00:17:49 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* compile.c (ibf_load_setup): cast to int.
+
+Wed Dec  9 00:13:09 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* compile.c (ibf_setup_load): rename to ibf_load_setup().
+
+	* compile.c (iseq_load_setup): check binary format.
+
+Tue Dec  8 23:30:07 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* test/io/console/test_io_console.rb (run_pty): Avoid waiting twice
+	  for a process. Fix Errno::ECHILD in TestIO_Console#test_close and
+	  TestIO_Console#test_sync.
+
+Tue Dec  8 23:05:47 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* compile.c (iseq_ibf_dump): fix for clang type checker.
+
+Tue Dec  8 23:04:02 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* iseq.c (iseq_s_load): fix mysterious bug.
+
+Tue Dec  8 22:31:58 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* introduce new ISeq binary format serializer/de-serializer
+	  and a pre-compilation/runtime loader sample.
+	  [Feature #11788]
+
+	* iseq.c: add new methods:
+	  * RubyVM::InstructionSequence#to_binary_format(extra_data = nil)
+	  * RubyVM::InstructionSequence.from_binary_format(binary)
+	  * RubyVM::InstructionSequence.from_binary_format_extra_data(binary)
+
+	* compile.c: implement body of this new feature.
+
+	* load.c (rb_load_internal0), iseq.c (rb_iseq_load_iseq):
+	  call RubyVM::InstructionSequence.load_iseq(fname) with
+	  loading script name if this method is defined.
+
+	  We can return any ISeq object as a result value.
+	  Otherwise loading will be continue as usual.
+
+	  This interface is not matured and is not extensible.
+	  So that we don't guarantee the future compatibility of this method.
+	  Basically, you shouldn't use this method.
+
+	* iseq.h: move ISEQ_MAJOR/MINOR_VERSION (and some definitions)
+	  from iseq.c.
+
+	* encoding.c (rb_data_is_encoding), internal.h: added.
+
+	* vm_core.h: add several supports for lazy load.
+	  * add USE_LAZY_LOAD macro to specify enable or disable of
+	    this feature.
+	  * add several fields to rb_iseq_t.
+	  * introduce new macro rb_iseq_check().
+
+	* insns.def: some check for lazy loading feature.
+
+	* vm_insnhelper.c: ditto.
+
+	* proc.c: ditto.
+
+	* vm.c: ditto.
+
+	* test/lib/iseq_loader_checker.rb: enabled iff suitable
+	  environment variables are provided.
+
+	* test/runner.rb: enable lib/iseq_loader_checker.rb.
+
+	* sample/iseq_loader.rb: add sample compiler and loader.
+
+	    $ ruby sample/iseq_loader.rb [dir]
+
+	  will compile all ruby scripts in [dir].
+	  With default setting, this compile creates *.rb.yarb files
+	  in same directory of target .rb scripts.
+
+	    $ ruby -r sample/iseq_loader.rb [app]
+
+	  will run with enable to load compiled binary data.
+
+Tue Dec  8 21:21:16 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+
+	* NEWS: mention about Enumerator::Lazy#grep_v.
+	  [ruby-core:71845] [Feature #11773]
+
+Tue Dec  8 17:36:36 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
+
+	* string.c: removed unused variable
+
+Tue Dec  8 16:23:40 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* enumerator.c (lazy_grep_v): add Enumerator::Lazy#grep_v as well
+	  as Enumerable, to enumerate lazily.
+	  [ruby-core:71845] [Feature #11773]
+
+Tue Dec  8 14:27:07 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* error.c (name_err_local_variables): new method
+	  NameError#local_variables for internal use only.
+	  [Feature #11777]
+
+Tue Dec  8 14:20:38 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* marshal.c (w_objivar): skip internal instance variables in
+	  T_OBJECT too.
+
+Tue Dec  8 12:58:04 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* test/io/console/test_io_console.rb (test_getpass): s.getpass
+	  should be tested. Narrow ensure block. This reverts r52911.
+	  [Bug #11780] [ruby-dev:49412]
+
+Tue Dec  8 10:40:21 2015  Eric Wong  <e@80x24.org>
+
+	* benchmark/bm_vm2_case_lit.rb: new benchmark
+	* compile.c (case_when_optimizable_literal): add nil/true/false
+	* insns.def (opt_case_dispatch): ditto
+	* vm.c (vm_redefinition_check_flag): ditto
+	* vm.c (vm_init_redefined_flag): ditto
+	* vm_core.h: ditto
+	* object.c (InitVM_Object): define === explicitly for nil/true/false
+	* test/ruby/test_case.rb (test_deoptimize_nil): new test
+	* test/ruby/test_optimization.rb (test_opt_case_dispatch): update
+	  (test_eqq): new test
+	  [ruby-core:71923] [Feature #11769]
+	  Original patch by Aaron Patterson <tenderlove@ruby-lang.org>
+
+Tue Dec  8 10:19:02 2015  Jake Worth  <jakeworth82@gmail.com>
+
+	* lib/optparse.rb: fix double word typo in the document.
+	  [Misc #10608] [Fix GH-1126]
+
+Tue Dec  8 09:03:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/date/date_core.c (d_lite_lshift): should check the argument
+	  before negation.
+
+Tue Dec  8 08:56:16 2015  Eric Wong  <e@80x24.org>
+
+	* insns.def (opt_case_dispatch): check Float#=== redefinition
+	* test/ruby/test_optimization.rb (test_opt_case_dispatch): new
+	  [ruby-core:71920] [Bug #11784]
+
+Tue Dec  8 03:56:05 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* test/lib/iseq_loader_checker.rb: add iseq dumper/loader checker.
+	  If you enable this checker (remove `#' in test/runner.rb),
+	  you can see comparison results between an original iseq disassembed
+	  result and dumped and loaded iseq disassembed result.
+
+	  There are several bugs around there, because of inexact stack depth
+	  calculation. Now, I leave these bugs because they are not critical
+	  and difficult to solve completely.
+
+	* test/runner.rb: require test/lib/iseq_loader_checker.rb but
+	  disabled at default (commented out).
+
+Tue Dec  8 03:45:47 2015  Eric Wong  <e@80x24.org>
+
+	* doc/extension.rdoc: warn about kwargs performance in C
+	  [Feature #11339] [ci skip]
+
+Tue Dec  8 03:44:51 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* iseq.c (iseq_load): disable peephole optimization option
+	  because apply it multiple times change the sequence.
+	  (iseq != peephole_optimize(load(iseq.to_a)))
+
+Tue Dec  8 03:43:21 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* compile.c (rb_iseq_build_from_ary): do not allocate table
+	  if table_size is 0.
+
+Tue Dec  8 03:30:34 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/unixsocket.c (unix_send_io): document args
+	  (unix_recv_io): ditto
+	* test/socket/test_unix.rb (test_fd_passing_class_mode): added
+
+Tue Dec 08 02:21:35 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* iseq.c (iseq_translate): at the end of constructing an iseq,
+	  call RubyVM::InstructionSequence.translate(iseq) if this method
+	  is defined. If the return value is also an object of
+	  RubyVM::InstructionSequence, then use it instead of created one.
+
+	  For example, this method is useful to test iseq dumper/loader
+	  such as RubyVM::InstructionSequence#to_a and rb_iseq_load().
+
+	  Because this method is for such internal experimental usage,
+	  the interface is not matured. For example, this interface has
+	  no extensibility. Two or more translators can not run
+	  simultaneously.
+
+	  So that we don't guarantee future compatibility of this method.
+	  Basically, do not use this method.
+
+Tue Dec  8 01:57:13 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/psych/*: update psych to 2.0.16
+	* test/psych/*: ditto
+
+Mon Dec  7 23:45:20 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* string.c: introduce String#+@ and String#-@ to control
+	  String mutability.
+	  [Feature #11782]
+
+Mon Dec  7 23:39:49 2015  Ben Miller  <bjmllr@gmail.com>
+
+	* parse.y: add heredoc <<~ syntax.  [Feature #9098]
+
+Mon Dec  7 23:06:16 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+
+	* prelude.rb (IO#read_nonblock): [DOC] add missing options to
+	  call-seq.  [ruby-core:71627] [Bug #11730]
+
+Mon Dec  7 15:50:50 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
+
+	* .gitignore: added cygruby*.def for Cygwin
+
+Sun Dec  6 19:52:31 2015  Eric Wong  <e@80x24.org>
+
+	* include/ruby/intern.h (rb_autoload): deprecate
+	* internal.h (rb_autoload_str): declare
+	* load.c (rb_mod_autoload): use rb_autoload_str
+	* variable.c (rb_autoload): become compatibility wrapper
+	  (rb_autoload_str): hoisted out from old rb_autoload
+	  [ruby-core:71369] [Feature #11664]
+
+Sun Dec  6 18:25:22 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/webrick/test_cgi.rb (TestWEBrickCGI#test_cgi): gave up the test
+	  of binary path info test on Windows because the test had passed
+	  occasionally as the comment said.
+
+Sun Dec  6 15:25:06 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/io/console/console.c (console_getpass): add IO#getpass
+	  method.
+
+Sun Dec  6 08:39:05 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ext/json/json.gemspec: bump version to json 1.8.3. CRuby already contained
+	  upstream changes.
+
+	  https://github.com/ruby/ruby/commit/4d059bf9f5f10f3d3088de49fc87e5555db7770d
+	  https://github.com/flori/json/commit/d4c99de78905d96c3f301f48b2c789943bb3f098
+
+	* ext/json/lib/json/version.rb: ditto.
+
+Sat Dec  5 17:48:25 2015  Lars Kanis  <lars@greiz-reinsdorf.de>
+
+	* tool/fake.rb: Fix cross build when srcdir is an absolute path.
+
+	* Makefile.in: PREP dependency is needed when cross build too, not
+	  "-r$(arch)-fake" to be  used before created.  [Fix GH-1125]
+
+Sat Dec  5 17:26:24 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* hash.c (env_str_new, env_path_str_new): make default string
+	  UTF-8 for the case conversion is not possible.  [Bug #8822]
+
+	* hash.c (get_env_cstr): convert non-ASCII string to UTF-8 string.
+
+	* hash.c (ruby_setenv): use wide char version to put environment
+	  variable to deal with non-ASCII value.
+
+Sat Dec  5 09:56:50 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ruby_atomic.h (ATOMIC_CAS): old value to be swapped should be
+	  same as the destination.  immediate value may need type
+	  promotion.
+
+	* ruby_atomic.h (ATOMIC_SIZE_CAS): fix the argument order of
+	  InterlockedCompareExchange64.  new value and then old value is
+	  the last.
+
+Sat Dec  5 09:23:34 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* random.c (fill_random_seed): fix the size to be filled, not the
+	  size of element, but the whole size of array.
+
+Sat Dec  5 06:03:54 2015  Eric Wong  <e@80x24.org>
+
+	* vm.c (ruby_vm_verbose_ptr): make static
+	  (ruby_vm_debug_ptr): ditto
+
+Sat Dec  5 00:56:29 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* include/ruby/ruby.h (RB_OBJ_TAINT): follow-up of r52881.
+	  Turn into void expression not to use unexpected result.
+	  Fix "operands have incompatible types" error with
+	  Oracle Solaris Studio 12.x on Solaris.
+
+Fri Dec  4 19:52:52 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
+
+	* enc/iso_8859_13.c: Added three missing lower/upper-case
+	  character pairs (from Kimihito Matsui)
+
+Fri Dec  4 18:57:57 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
+
+	* enc/iso_8859_4.c: Added missing lower/upper-case character
+	  pair (U+014A and U+014B, LATIN CAPITAL/SMALL LETTER ENG)
+	  (from Kimihito Matsui)
+
+Fri Dec  4 16:48:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (rb_obj_as_string): fstring should not be infected.
+	  re-apply r52872 and fix a typo.
+	  TODO: other frozen strings also may not be.
+
+Fri Dec  4 15:21:45 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/rubygems: Update to RubyGems 2.5.0+ HEAD(fdab4c4).
+	  this version includes #1396, #1397, #1398, #1399
+	* test/rubygems: ditto.
+
+Fri Dec  4 11:22:40 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* thread.c (rb_thread_setname): name must be ascii-compatible, as
+	  pthread APIs do not accept legacy wide char strings.
+
+Thu Dec  3 15:39:21 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/scanf.rb: fixed double words typo.
+	  [ci skip][fix GH-1123] Patch by @jwworth
+
+Thu Dec  3 15:37:56 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* test/ruby/test_mixed_unicode_escapes.rb: fixed typo.
+	  [fix GH-1122] Patch by @davydovanton
+	* test/ruby/test_object.rb: ditto.
+	* test/socket/test_tcp.rb: ditto.
+
+Thu Dec  3 15:33:08 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* sprintf.c (rb_str_format): fix wrong shifting position in
+	  Rational conversion when not at the beginning of the result.
+	  [ruby-core:71806] [Bug #11766]
+
+Thu Dec  3 14:22:16 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* range.c (range_to_s): should be infected by the receiver.
+	  str2 infects by appending.  [ruby-core:71811] [Bug #11767]
+
+Thu Dec  3 11:57:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in: separate SET_CURRENT_THREAD_NAME, which can set
+	  the name of current thread only, and SET_ANOTHER_THREAD_NAME,
+	  which can set the name of other threads.
+
+	* thread.c (rb_thread_setname): use SET_ANOTHER_THREAD_NAME.  OS X
+	  is not possible to set another thread name.
+
+	* thread_pthread.c (native_set_thread_name, thread_timer): use
+	  SET_CURRENT_THREAD_NAME.
+
+Wed Dec 02 22:57:46 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h, iseq.h: remove rb_iseq_t::variable_body.
+	  Fields in rb_iseq_t::variable_body are contained by
+	  rb_iseq_t::body::mark_ary (hidden Array object).
+
+	  Index 0 to 2 of mark_ary are reserved by these objects.
+
+	* iseq.c: catch up this fix.
+
+	* compile.c (rb_iseq_original_iseq): trivial rewrite.
+
+Wed Dec  2 17:19:02 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* iseq.h: introduce ISEQ_ORIGINAL_ISEQ() and
+	  ISEQ_ORIGINAL_ISEQ_ALLOC() macro.
+
+	* compile.c: use them to access original iseq buffer.
+
+	* iseq.c: ditto.
+
+	* vm_core.h: rename iseq field to support this fix.
+
+Wed Dec  2 17:10:32 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* iseq.h: introduce ISEQ_FLIP_CNT_INCREMENT() macro.
+
+	* compile.c (iseq_compile_each): use it.
+
+	* vm_core.h: rename flip_cnt field to support this fix.
+
+Wed Dec  2 17:05:15 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* iseq.h: introduce ISEQ_COVERAGE() and ISEQ_COVERAGE_SET() macro.
+
+	* compile.c: use them.
+
+	* iseq.c: ditto.
+
+	* iseq.c (rb_iseq_coverage): added.
+
+	* thread.c (update_coverage): use rb_iseq_coverage().
+
+	* vm_core.h: rename coverage field name to support this fix.
+
+Wed Dec  2 17:00:54 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* encoding.c (enc_name, rb_enc_name_list_i, rb_enc_aliases_enc_i):
+	  make fstring instead of making each copies.
+
+Wed Dec  2 16:32:08 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* iseq.h: introduce ISEQ_COMPILE_DATA() macro.
+
+	* compile.c, iseq.c: use ISEQ_COMPILE_DATA().
+
+	* vm_core.h: rename compile_data field to support this fix.
+
+Wed Dec  2 16:27:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* encoding.c (enc_m_loader): defer finding encoding object not to
+	  be infected by marshal source.  [ruby-core:71793] [Bug #11760]
+
+	* marshal.c (r_object0): enable compatible loader on USERDEF
+	  class.  the loader function is called with the class itself,
+	  instead of an allocated object, and the loaded data.
+
+	* marshal.c (compat_allocator_table): initialize
+	  compat_allocator_tbl on demand.
+
+	* object.c (rb_undefined_alloc): extract from rb_obj_alloc.
+
+Wed Dec  2 15:12:43 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* configure.in: Fixed double negative comments.
+	  [Bug #11698][ruby-core:71506]
+
+Wed Dec  2 14:55:01 2015  yui-knk  <spiketeika@gmail.com>
+
+	* test/ruby/test_string.rb: removed non executing tests.
+	  [Misc #11757][ruby-dev:49397]
+
+Wed Dec  2 11:23:06 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/csv.rb: enable frozen_string_literal.
+	  [fix GH-1116] Patch by @marshall-lee
+
+Wed Dec  2 10:36:25 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ext/bigdecimal/bigdecimal.c: Fix double word typo.
+	  [ci skip][fix GH-1120] Patch by @jwworth
+
+Wed Dec  2 07:43:51 2015  Eric Wong  <e@80x24.org>
+
+	* ext/openssl/ossl_ssl.c (mSSLExtConfig): make static
+	  (eSSLError): ditto
+	  (ID_callback_state): ditto
+	  (ossl_ssl_ex_vcb_idx): ditto
+	  (ossl_ssl_ex_store_p): ditto
+	  (ossl_ssl_ex_ptr_idx): ditto
+	* ext/openssl/ossl_ssl.h: remove extern declarations for
+	  mSSLExtConfig and eSSLError
+
+Wed Dec  2 07:41:08 2015  Eric Wong  <e@80x24.org>
+
+	* missing/explicit_bzero.c (explicit_bzero): fixup r52839
+	  for compilers with "weak" attribute
+
+Wed Dec  2 06:47:25 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* missing/explicit_bzero.c: add ruby_explicit_bzero_hook_unused
+	  for preventing optimization. Inspired from OpenBSD.
+
+Tue Dec  1 23:36:39 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* thread.c (rb_thread_setname): allow to reset thread name.
+
+Tue Dec  1 23:14:04 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* thread.c (rb_thread_setname): check the argument if valid
+	  string.  [ruby-core:71774] [Bug #11756]
+
+Tue Dec  1 17:13:41 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (rb_string_value_cstr): should not raise on frozen
+	  string.
+
+Tue Dec  1 09:35:29 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* missing/explicit_bzero.c: add a few comment.
+
+Tue Dec  1 09:31:19 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* missing/explicit_bzero.c: add disabling optimization on gcc.
+
+Tue Dec  1 07:50:33 2015  Eric Wong  <e@80x24.org>
+
+	* missing/explicit_bzero.c: new file. define explicit_bzero.
+	  Fixup r52806
+
+Thu Oct 22 12:54:43 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* thread_pthread.c (register_ubf_list): renamed from
+	  add_signal_thread_list.
+	* thread_pthread.c (unregister_ubf_list): renamed
+	  from remove_signal_thread_list.
+	* thread_pthread.c (ubf_wakeup_all_threads): renamed from
+	  ping_signal_thread_list.
+	* thread_pthread.c (ubf_wakeup_thread): renamed from
+	  ubf_select_each.
+	* thread_pthread.c (ubf_threads_empty): renamed from
+	  check_signal_thread_list().
+	* thread_pthread.c (ubf_list_lock): renamed from
+	  signal_thread_list_lock.
+
+	* thread_pthread.c (register_ubf_list): large simplification
+	  by using ccan/list.h.
+	  bonus: removed malloc() and exit(EXIT_FAILURE).
+	* thread_pthread.c (unregister_ubf_list): ditto.
+	* thread_pthread.c (ubf_threads_empty): ditto.
+	* thread_pthread.c (ubf_wakeup_all_threads): ditto.
+
+	* thread_pthread.c (print_signal_list): removed.
+
+Thu Oct 22 08:03:49 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* test/ruby/test_rand.rb (TestRand#test_default_seed): add
+	  srand case.
+
+Thu Oct 22 06:33:38 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* random.c (InitVM_Random): move Random::DEFAULT initialization
+	  bits to Init_Random_default.
+	* random.c (Init_Random_default): renamed from Init_RandomSeed2.
+	* random.c (Init_RandomSeedCore): renamed from Init_RandomSeed.
+
+Thu Oct 22 06:20:48 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* random.c (Init_RandomSeed): move all Random::DEFAULT
+	  construction bits to Init_RandomSeed2. Random::DEFAULT
+	  and Ruby internal hashes are no longer shared their seed.
+	* random.c (Init_RandomSeed2): ditto. And, kill evil
+	  rb_obj_reveal() stuff.
+
+	* random.c (init_hashseed): add MT argument.
+	* random.c: (init_siphash): ditto.
+
+	* test/ruby/test_rand.rb (TestRand#test_default_seed): new
+	  test for Random::DEFAULT::seed.
+
+Thu Oct 22 05:23:48 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* random.c (init_hashseed, init_siphash): extract initialize
+	  functions.
+
+Thu Oct 22 01:01:34 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* configure.in: sort AC_CHECK_HEADERS() by alphabetical order.
+
+Thu Oct 22 00:19:07 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* random.c (init_randomseed): remove "initial" argument. It never
+	  be used from outside of this function.
+
+Thu Oct 22 00:12:33 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* lib/securerandom.rb (SecureRandom::gen_random): use /dev/urandom
+	  for initialize OpenSSL's rand.
+
+Wed Oct 21 12:10:04 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* ext/openssl/ossl_rand.c (ossl_rand_bytes): RAND_bytes could
+	  be return -1 as an error. Therefore, added error handling.
+	* ext/openssl/ossl_pkey_dsa.c (dsa_generate): ditto.
+
+Wed Oct 21 09:04:09 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* include/ruby/util.h: remove a warning suppression C4723
+	  (potential divide by zero) for VisualC++. It's meaningless.
+	  Before r26197, there is ruby_div0() in this place and it
+	  actually made divide by zero. But now it's just garbage.
+
+Wed Oct 21 08:23:36 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* random.c: random_raw_seed don't use GRND_NONBLOCK. GRND_NONBLOCK
+	  mean the result might not have an enough cryptic strength and
+	  easy predictable. That's no good for SecureRandom.
+
+Sun Oct 18 17:26:53 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* common.mk: add a rule for explicit_bzero.o.
+	* configure.in: detect explicit_bzero and memset_s.
+	* include/ruby/missing.h: add explicit_bzero.
+	* random.c (init_randomseed): use explicit_bzero() instead of
+	  memset(). memset could be eliminated by compiler optimization.
+
+Mon Nov 30 18:46:44 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/readline/extconf.rb: call dir_config("libedit")
+	  if --enable-libedit is specified. [Bug #11751]
+	  patched by John Hein
+
+Mon Nov 30 08:44:29 2015  Eric Wong  <e@80x24.org>
+
+	* variable.c: remove spurious #define for globals
+	  [ruby-core:71735] [Feature #11749]
+
+Sun Nov 29 09:13:03 2015  Conor Landry  <clandry94@gmail.com>
+
+	* NEWS: [DOC] Various grammar corrections and clarifications to
+	  increase readability.  [Fix GH-1115]
+
+Sat Nov 28 19:33:55 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (parser_here_document): store dispatched result of
+	  on_tstring_content at the last fragment of a here document.
+
+Fri Nov 27 19:19:44 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/net/http.rb (connect): detect closed connection and reconnect
+	  If the server closes a keep-alive http connection, the client socket
+	  reaches EOF. To avoid an EOFError, detect the closed connection and
+	  reconnect.
+	  Added test to ensure HTTP#post succeeds even if the
+	  keep-alive-connection has been closed by the server.
+	  by Kristian Hanekamp <kris.hanekamp@gmail.com>
+	  https://github.com/ruby/ruby/pull/1089 fix GH-1089
+
+Thu Nov 26 21:36:40 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (iseq_peephole_optimize): enable tail call
+	  optimization for specialized indexers.
+
+	* compile.c (iseq_compile_each): blockiseq should be NULL, but not
+	  Qnil.
+
+Thu Nov 26 17:22:53 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* regcomp.c, regenc.c, regexec.c, regint.h, enc/unicode.c:
+	  Merge Onigmo 58fa099ed1a34367de67fb3d06dd48d076839692
+	  + https://github.com/k-takata/Onigmo/pull/52
+
+Thu Nov 26 09:50:02 2015  yui-knk  <spiketeika@gmail.com>
+
+	* test/coverage/test_coverage.rb: Added test-case for Coverage.restart.
+	  [Misc #11732][ruby-dev:49379]
+
+Thu Nov 26 09:46:36 2015  yui-knk  <spiketeika@gmail.com>
+
+	* test/coverage/test_coverage.rb: Added test-case for Coverage.peek_result
+	  without Coverage.start. [Misc #11726][ruby-core:71622]
+
+Thu Nov 26 07:22:55 2015  Eric Wong  <e@80x24.org>
+
+	* test/openssl/test_ssl.rb (test_copy_stream): new test
+
+Wed Nov 25 21:23:39 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (copy_stream_body): try to_io conversion before read,
+	  readpartial, and write methods.  [ruby-dev:49008] [Bug #11199]
+
+Wed Nov 25 10:55:21 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* io.c (argf_getpartial): should not resize str if the second
+	  argument is not given.
+	  [ruby-core:71668] [Bug #11738]
+
+Tue Nov 24 23:56:25 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* configure.in: On Solaris, it is safe to define _LARGEFILE_SOURCE
+	  when _FILE_OFFSET_BITS=64 is defined (= when 32-bit compile).
+
+Tue Nov 24 10:00:10 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/rubygems/installer.rb: Fix two double-word typos.
+	  [ci skip][fix GH-1108] Patch by @jwworth
+
+Tue Nov 24 09:17:02 2015  Alexander von Gluck IV  <kallisti5@unixzen.com>
+
+	* beos: Drop support for BeOS now that Haiku is stable.
+	  [Fix GH-1112]
+
+Tue Nov 24 09:16:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* internal.h (rb_gc_for_fd): move to export, as referred by
+	  ext/socket.
+
+Tue Nov 24 09:04:29 2015  David Rodriguez  <deivid.rodriguez@gmail.com>
+
+	* file.c: [DOC] add a missing period to File docs, to terminate
+	  the sentence and separate from the next sentence.  [Fix GH-1111]
+
+Tue Nov 24 08:30:06 2015  JuanitoFatas  <katehuang0320@gmail.com>
+
+	* NEWS: Fix the issue number of `Struct#dig`, which should be
+	  [Feature #11688].  [Fix GH-1110]
+
+Tue Nov 24 07:56:54 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/init.c (rsock_s_accept): handle ENOMEM
+
+Tue Nov 24 07:50:15 2015  Eric Wong  <e@80x24.org>
+
+	* dir.c (dir_initialize): use rb_gc_for_fd for ENOMEM
+	* ext/socket/init.c (rsock_socket): ditto
+	* ext/socket/socket.c (rsock_socketpair): ditto
+	* internal.h (rb_gc_for_fd): prototype
+	* io.c (rb_gc_for_fd): remove static
+	  [ruby-core:71623] [Feature #11727]
+
+Tue Nov 24 06:46:27 2015  Eric Wong  <e@80x24.org>
+
+	* io.c (rb_gc_for_fd): new helper function
+	  (ruby_dup): use rb_gc_for_fd
+	  (rb_sysopen): ditto
+	  (rb_fdopen): ditto
+	  (rb_pipe): ditto
+	  [ruby-core:71623] [Feature #11727]
+
+Tue Nov 24 05:13:35 2015  Eric Wong  <e@80x24.org>
+
+	* ext/fiddle/function.c (struct nogvl_ffi_call_args):
+	  new struct for GVL release
+	  (nogvl_ffi_call): new function
+	  (function_call): adjust for GVL release
+	  [ruby-core:71642] [Feature #11607]
+	* ext/fiddle/closure.c (struct callback_args):
+	  new struct for GVL acquire
+	  (with_gvl_callback): adjusted original callback function
+	  (callback): wrapper for conditional GVL acquire
+	* ext/fiddle/depend: add dependencies
+	* ext/fiddle/extconf.rb: include top_srcdir for internal.h
+	* internal.h (ruby_thread_has_gvl_p): expose for fiddle
+	* vm_core.h (ruby_thread_has_gvl_p): moved to internal.h
+	* test/fiddle/test_function.rb (test_nogvl_poll): new test
+
+Mon Nov 23 19:53:12 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* configure.in: On Solaris, with gcc, "-std=iso9899:1999"
+	  in $ansi_options is often also needed in CPPFLAGS,
+	  because some feature definitions vary depending on such
+	  standards options.
+
+Mon Nov 23 12:54:39 2015  Hamish Morrison  <hamishm53@gmail.com>
+
+	* configure.in: remove obsolete workarounds for Haiku.
+
+	* dln.c, file.c, io.c: remove obsolete Haiku workarounds.
+
+	* thread_pthread.c: add stack bounds detection for Haiku.
+
+	* signal.c: get stack pointer from signal context on Haiku.
+	  [ruby-core:67923] [Bug #10811] [Fix GH-1109]
+
+Mon Nov 23 11:44:11 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* gems/bundled_gems: bump version to minitest-5.8.3
+
+Mon Nov 23 08:55:00 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ChangeLog: fix wrong reference for r52714
+
+Sun Nov 22 22:23:37 2015  Rei Odaira  <Rei.Odaira@gmail.com>
+
+	* gc.c (rb_raw_obj_info): fix compile errors when USE_RGENGC
+	  is 0.
+
+Sun Nov 22 21:58:09 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* lib/cmath.rb: methods which has suffix '!' are now deprecated.
+	  Re-apply r52469 made by Kazuki Tanaka, with fixing bug about
+	  mathn.rb compatibility. [ruby-core:68528] [Feature #10974]
+
+Sun Nov 22 19:36:51 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ext/openssl/ossl.c: fix brew command for installation of openssl.
+	  [ci skip][fix GH-1107] Patch by @arthurnn
+
+Sun Nov 22 17:59:50 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* configure.in: On Solaris, add -D_XOPEN_SOURCE=n only when both
+	  AC_TRY_CPP and AC_TRY_COMPILE pass, because some options
+	  (e.g. -std=iso9899:1999) are not set when running C preprocessor
+	  or building ext.
+
+Sun Nov 22 16:53:34 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (iseq_peephole_optimize): remove unreachable code
+	  chunk after jump/leave.
+
+	* parse.y: move dead code elimination of logical operation to
+	  compile.c.  not to warn logical operation of literal constants.
+
+Sun Nov 22 16:37:10 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (iseq_peephole_optimize): eliminate always/never
+	  branches after a literal object and when the value is used after
+	  the branch.
+
+Sun Nov 22 01:23:43 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* configure.in: Add -D_XOPEN_SOURCE=500 (or 600 or 700) on Solaris
+	  if available, mainly for enabling some features in sockets.
+
+Sun Nov 22 00:17:22 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* test/socket/test_socket.rb (test/socket/test_socket.rb): skip
+	  the test when Socket::SO_TIMESTAMP is not defined. Fix error
+	  on Solaris 10. [Bug #11728] [ruby-dev:49377]
+
+Sat Nov 21 18:57:28 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ruby.c (need_argument): move frozen-string-literal-debug option
+	  from --enable to --debug.  [Feature #11725]
+
+	* ruby.c (proc_options): fix pointer overrun. do not advance argv
+	  until it is valid.
+
+Sat Nov 21 13:59:09 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/digest/sha1/extconf.rb: OpenSSL's struct name for SHA1 is
+	  SHA_CTX. http://openssl.org/docs/man0.9.8/crypto/SHA1.html
+
+Sat Nov 21 13:31:52 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/digest/*/*.[ch]: include ruby.h before digest.h to avoid
+	  including ext/digest/extconf.h. [Bug #3231]
+	  https://msdn.microsoft.com/library/36k2cdd4.aspx
+
+	* ext/digest/*/extconf.rb: remove ext/digest from include search path
+	  to avoid confusion of cl.exe.
+
+	* ext/digest/*/*.[ch]: explicitly specify def.h's path.
+
+Sat Nov 21 13:05:16 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/openssl/ossl.h: LibreSSL doesn't have and need e_os2.h.
+
+Sat Nov 21 09:18:10 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* thread_sync.c: reduce the specification of Queue#close.
+	  * Queue#close accepts no arguments.
+	  * deq'ing on closed queue returns nil, always.
+	  [Feature #10600]
+
+	* test/thread/test_queue.rb: catch up this fix.
+
+Sat Nov 21 08:44:21 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* compile.c (iseq_compile_each): add debug information to NODE_STR
+	  strings as default.
+	  [Feature #11725]
+
+	* insns.def (freezestring): add new instruction to support adding
+	  debug information for dynamically constructed strings.
+
+	* compile.c (iseq_compile_each): support adding debug information
+	  for NODE_DSTR with freezestring instruction.
+
+	* error.c (rb_error_frozen): change the debug information ID name
+	  id_debug_created_info and this field should have a 2 element array
+	  containing path and line information.
+
+	* defs/id.def: ditto.
+
+	* test/ruby/test_rubyoptions.rb: catch up this fix.
+
+	* test/ruby/test_iseq.rb: now frozen strings are not same.
+
+Sat Nov 21 04:34:16 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* symbol.c (rb_str_intern): should not freeze the receiver itself
+	  unexpectedly.  [ruby-core:71611] [Bug #11721]
+
+Fri Nov 20 23:15:18 2015  Naotoshi Seo  <sonots@gmail.com>
+
+	* lib/logger.rb: expose logger mutex
+	  [fix GH-541] Patch by @arthurnn
+
+Fri Nov 20 15:05:28 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* Added missing reference of GitHub
+
+Fri Nov 20 14:57:01 2015  Trevor Rowe  <trevorrowe@gmail.com>
+
+	* lib/net/http.rb: Fixed regression for Net::HTTP::PUT with "Expect-100"
+	  header. [fix GH-949]
+	* test/net/http/test_http.rb: added test.
+
+Fri Nov 20 14:39:56 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/net/http.rb: set hostname before call ossl_ssl_set_session.
+	  [Bug #11401][ruby-core:70152][fix GH-964] Patch by @mkarnebeek
+
+Fri Nov 20 12:53:19 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* array.c: clarify docs for take_while/drop_while samples.
+	  [ci skip][fix GH-1028] Patch by @leriksen
+
+Fri Nov 20 12:48:04 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ext/socket/socket.c: remove mention of :UNIX in getaddrinfo().
+	  It's typically not a support option.
+	  [ci skip][fix GH-990] Patch by @eam
+
+Fri Nov 20 12:44:06 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/rss/syndication.rb: Add nodoc marker for #validate_sy_updatePeriod.
+	  [ci skip][fix GH-1105] Patch by @davydovanton
+
+Fri Nov 20 09:05:21 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm.c (rb_vm_cref_replace_with_duplicated_cref): added.
+
+	  CREFs should not be shared by methods between `using'.
+	  [Bug #11247]
+
+	* vm_insnhelper.c (vm_cref_replace_with_duplicated_cref): ditto.
+
+	* vm.c (vm_cref_dup): should copy refinements correctly.
+
+	* eval.c: use rb_vm_cref_replace_with_duplicated_cref().
+
+	* eval_intern.h: add a decl. of
+	  rb_vm_cref_replace_with_duplicated_cref().
+
+	* vm_eval.c (eval_string_with_cref): do not need to pass
+	  scope's CREF because VM can find out CREF from stack frames.
+
+	* test/ruby/test_refinement.rb: add a test.
+
+Fri Nov 20 06:52:53 2015  Eric Wong  <e@80x24.org>
+
+	* .gitattributes: new file for git users
+	  [ruby-core:71578] [Feature #11713]
+
+Thu Nov 19 22:35:31 2015  Tanaka Akira  <akr@fsij.org>
+
+	* ext/socket/ancdata.c: Check buffer full and ignore MSG_TRUNC flag.
+	  buffer fullness is more robust to detect the message is too big for
+	  the buffer.
+	  AIX 7.1 recvmsg doesn't set MSG_TRUNC for rflags when MSG_PEEK is
+	  given.
+
+Thu Nov 19 21:55:11 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (gc_start): force to invoke GC by GC.start
+	  even if it is GC.disable'd.
+
+	* test/ruby/test_gc.rb: add a test.
+
+Thu Nov 19 20:08:59 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c: trivial performance improvements.
+
+	    name    modified
+	    vm1_gc_short_lived*                1.015
+	    vm1_gc_short_with_complex_long*    1.014
+	    vm1_gc_short_with_long*            1.000
+	    vm1_gc_short_with_symbol*          1.016
+	    vm1_gc_wb_ary*                     1.002
+	    vm1_gc_wb_ary_promoted*            0.996
+	    vm1_gc_wb_obj*                     1.045
+	    vm1_gc_wb_obj_promoted*            1.014
+	    vm3_gc                             1.021
+
+	* gc.c (gc_writebarrier_generational): reorder parameters to optimize
+	  register passing function call.
+
+	* gc.c (gc_writebarrier_incremental): ditto.
+
+	* gc.c (rb_gc_writebarrier): remove LIKELY().
+	  LIKELY() seems to move related functions not better places.
+
+Thu Nov 19 19:45:05 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ruby.c (ruby_prog_init): [DOC] ARGV does not contain the name of
+	  the executable.  [ruby-core:71561] [Bug #11711]
+
+Thu Nov 19 15:53:21 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* signal.c: should also clear ruby_disable_gc.
+	  [Bug #11692]
+
+Thu Nov 19 15:31:45 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* compile.c (iseq_compile_each): T_IMEMO/iseq objects should be
+	  wrap with ISeq wrappers. [Bug #11676]
+
+Thu Nov 19 15:16:12 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/rubygems: Update to RubyGems 2.5.0+ HEAD(c6b4946).
+	  this version includes #1114, #1314, #1322, #1375, #1383, #1387
+	* test/rubygems: ditto.
+
+Thu Nov 19 14:14:37 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (finish_overlapped_socket): return value of this
+	  function should be only 0 or SOCKET_ERROR.
+
+Thu Nov 19 14:12:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (iseq_tailcall_optimize): apply tail call optimization
+	  before conversion to specialized instructions.  when looking
+	  back from `leave` instruction, `send` instructions have been
+	  translated already.
+
+Thu Nov 19 13:57:58 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (finish_overlapped_socket): ignore EMSGSIZE when input,
+	  because POSIX platforms just do so.  fixes test errors revealed by
+	  r52647.
+
+Thu Nov 19 02:52:30 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ext/socket/ancdata.c (bsock_recvmsg_internal): stretch the buffer size
+	  only when vmaxdatlen is nil.
+
+Thu Nov 19 02:20:11 2015  Tanaka Akira  <akr@fsij.org>
+
+	* test/socket/test_socket.rb (test_udp_recvmsg_truncation): rflags is
+	  nil on Solaris 10 which have no HAVE_STRUCT_MSGHDR_MSG_CONTROL.
+	  Reported by Naohisa Goto. [ruby-core:71557] [Bug #11709]
+
+Thu Nov 19 01:48:05 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* configure.in: add -static-libgcc for mingw automatically if available.
+
+Thu Nov 19 00:53:26 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ext/extmk.rb (--extflags): new option to pass EXTLDFLAGS to children,
+	  especially exts.mk.
+
+	* common.mk (EXTMK_ARGS): use above option.
+
+Wed Nov 18 22:50:43 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_method.c (rb_class_clear_method_cache): should clear all
+	  RCLASS_CALLABLE_M_TBLs of all sub-classes (T_ICLASS).
+
+	  RCLASS_CALLABLE_M_TBL() caches complemented method entries.
+	  It should be cleared when the modules are cleared.
+	  On previous version clears only for direct children.
+	  It is enough for normal modules because corresponding T_ICLASSes
+	  are direct children.
+
+	  However, refinements create complex data structure. So that
+	  we need to clear all children (and descendants).
+	  [ruby-core:71423] [Bug #11672]
+
+	* vm_method.c (rb_clear_method_cache_by_class): rb_mKernel
+	  doesn't call rb_class_clear_method_cache, so that
+	  clear child T_ICLASSes.
+
+	* test/ruby/test_refinement.rb: enable disabled test.
+
+Wed Nov 18 21:09:08 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_method.c (prepare_callable_method_entry): use
+	  RCLASS_CALLABLE_M_TBL() instead of accessing a filed directly.
+
+Wed Nov 18 17:08:18 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* method.h: introduce the following field and macros.
+
+	  * rb_method_definition_t::complemented_count to count shared method
+	    entries because of complemented method entries and separate from
+	    alias_count.
+
+	    Shared `def' only by complemented method entries should not prevent
+	    method re-definition warning.
+
+	  * METHOD_ENTRY_COMPLEMENTED(me) to represent complemented method entry.
+	  * METHOD_ENTRY_COMPLEMENTED_SET(me) to check it as  complemented me.
+
+	* vm_insnhelper.c (aliased_callable_method_entry): should also
+	  check me->def->complemented_count.
+
+	* vm_method.c (method_definition_addref_complement): add to count
+	  complemented method entries number.
+
+	* vm_method.c (rb_method_definition_release): release `def' iff
+	  alias_count == 0 and complemented_count == 0.
+
+	* test/ruby/test_module.rb: add a test.
+
+Wed Nov 18 17:06:19 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (rb_raw_obj_info): fix trivial issues.
+
+	  * support SPECIAL_CONSTs.
+	  * fix IMEMO/ment outputs.
+
+Wed Nov 18 11:32:15 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (iseq_peephole_optimize): eliminate always/never
+	  branches after a literal object.  this sequence typically
+	  appears by defined? operator for a method call on a local
+	  variable.
+
+Wed Nov 18 10:33:06 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ext/socket/ancdata.c (bsock_recvmsg_internal): stretch the buffer size
+	  when EMSGSIZE occurs on non HAVE_STRUCT_MSGHDR_MSG_CONTROL platforms
+	  (such as, Windows).  fixes a test error revealed by r52625.
+
+Wed Nov 18 10:12:36 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/ancdata.c (bsock_recvmsg_internal): use 4096 as
+	  default size to match pre-r52610, which also maps to a common
+	  page size.
+
+Wed Nov 18 10:05:25 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* doc/syntax/refinements.rdoc: update documentation to reflect
+	  recent changes.
+	  [ci skip] [ruby-core:71466] [Misc #11681] Patch by James Adam
+
+Wed Nov 18 09:50:21 2015  Naotoshi Seo  <sonots@gmail.com>
+
+	* test/logger/test_logdevice.rb: Fix tests of logger to make it work on
+	  windows (windows can not remove opened file) [Bug #11702]
+
+Wed Nov 18 06:59:52 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/ancdata.c (bsock_recvmsg_internal): grow buffer
+	  on unspecified maxdatlen
+	  [ruby-core:71517] [Bug #11701]
+	* ext/socket/lib/socket.rb (Socket#recvmsg): nil default for dlen
+	  (Socket#recvmsg_nonblock): ditto
+	* test/socket/test_socket.rb (test_recvmsg_udp_no_arg): new test
+
+Tue Nov 17 19:50:06 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (fstat): declare for mingw.
+
+Tue Nov 17 19:02:59 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* configure.in (BASERUBY): use Kernel#print instead of Kernel#p because
+	  the baseruby may output CRLF as end of line.
+
+Tue Nov 17 15:34:34 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* NEWS: Added update from Unicode 7.0.0 to 8.0.0 [ci skip]
+
+Tue Nov 17 15:30:30 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* enc/unicode/casefold.h, name2ctype.h: Change Unicode
+	  Version for regular expressions from 7.0.0 to
+	  8.0.0 (with help from Kimihito Matsui) [Feature #11563]
+
+Tue Nov 17 14:36:00 2015  Kenichi Kamiya  <kachick1@gmail.com>
+
+	* lib/ostruct.rb (dig): Implement OpenStruct#dig
+	  [Feature #11688]
+
+Tue Nov 17 14:04:14 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ext/socket/lib/socket.rb (Socket#recvmsg{,_nonblock}): default values
+	  of clen must be nil.
+
+	* ext/socket/ancdata.c (bsock_sendmsg_internal): handle nil of clen.
+	  fixes test errors introduced at r52602.
+
+Tue Nov 17 13:43:46 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ext/socket/lib/socket.rb: UNIXSocket is not always exists.  fixes
+	  install error on Windows, introduced at r52601.
+
+Tue Nov 17 11:27:23 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/lib/socket.rb (Socket#recvfrom_nonblock):
+	  UDPSocket#recvfrom_nonblock):
+	  update doc for `exception: false` and destination buffer
+	  [ruby-core:69542] [Feature #11229]
+	  [ruby-core:69543] [Feature #11242]
+
+Tue Nov 17 11:25:05 2015  Eric Turner  <ericturnerdev@gmail.com>
+
+	* array.c (rb_ary_dig), hash.c (rb_hash_dig): [DOC] Update
+	  comments describing dig methods.  [Fix GH-1103]
+
+	* struct.c (rb_struct_dig): [DOC] add rdoc.
+
+Tue Nov 17 11:22:22 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* NEWS: Small grammatical fix [ci skip]
+
+Tue Nov 17 10:12:30 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/lib/socket.rb (Socket.accept_loop): avoid exceptions
+	  (Socket.udp_server_recv): ditto
+
+Tue Nov 17 09:59:00 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/ancdata.c (bsock_sendmsg_internal): avoid arg parsing
+	  [ruby-core:71439] [Feature #11339]
+	  (rsock_bsock_sendmsg): make private, adjust for above
+	  (rsock_bsock_sendmsg_nonblock): ditto
+	* ext/socket/rubysocket.h: adjust prototypes
+	  (rsock_opt_false_p): remove
+	* ext/socket/basicsocket.c (rsock_init_basicsocket):
+	  define private methods
+	* ext/socket/lib/socket.rb (BasicSocket#sendmsg): new wrapper
+	  (BasicSocket#sendmsg_nonblock): ditto
+
+Tue Nov 17 09:45:18 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/ancdata.c (bsock_recvmsg_internal): avoid arg parsing
+	  (rsock_bsock_recvmsg): adjust for above change
+	  (rsock_bsock_recvmsg_nonblock): ditto
+	  [ruby-core:71439] [Feature #11339]
+	* ext/socket/rubysocket.h: adjust prototypes for above
+	* ext/socket/basicsocket.c (rsock_init_basicsocket):
+	  adjust private methods
+	* ext/socket/lib/socket.rb (BasicSocket#recvmsg): wrapper method
+	  (BasicSocket#recvmsg_nonblock): ditto
+
+Tue Nov 17 08:36:34 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/init.c (rsock_s_accept_nonblock): avoid parsing args
+	  [ruby-core:71439] [Feature #11339]
+	* ext/socket/rubysocket.h: adjust prototype
+	* ext/socket/socket.c (sock_accept_nonblock): make private
+	* ext/socket/tcpserver.c (tcp_accept_nonblock): ditto
+	* ext/socket/unixserver.c (unix_accept_nonblock): ditto
+	* ext/socket/lib/socket.rb (Socket#accept_nonblock):
+	  implement as wrapper, move RDoc
+	  (TCPServer#accept_nonblock): ditto
+	  (UNIXServer#accept_nonblock): ditto
+
+Tue Nov 17 08:25:57 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/socket.c (sock_connect_nonblock):
+	  avoid argument parsing in C.
+	  [ruby-core:71439] [Feature #11339]
+	* ext/socket/lib/socket.rb (Socket#connect_nonblock):
+	  new wrapper for private method, move RDoc
+
+Tue Nov 17 08:16:09 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/init.c (rsock_s_recvfrom_nonblock):
+	  avoid arg parsing with C API
+	  [ruby-core:71439] [Feature #11339]
+	* ext/socket/basicsocket.c (bsock_recv_nonblock):
+	  adjust for above change, make private
+	* ext/socket/socket.c (sock_recvfrom_nonblock): ditto
+	* ext/socket/udpsocket.c (udp_recvfrom_nonblock): ditto
+	* ext/socket/lib/socket.rb (BasicSocket#recv_nonblock):
+	  new wrapper for private method, move RDoc
+	  (Socket#recvfrom_nonblock): ditto
+	  (UDPSocket#recvfrom_nonblock): ditto
+
+Mon Nov 16 21:27:54 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* test/dtrace/helper.rb (Dtrace::TestCase#trap_probe): dtrace buffer
+	  size is set as 8m on Solaris (default 4m). [Bug #11697]
+
+Mon Nov 16 20:03:14 2015  Naotoshi Seo  <sonots@gmail.com>
+
+	* lib/logger.rb: Add Logger#reopen
+
+Mon Nov 16 18:21:52 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* object.c (rb_obj_dig): dig in nested structs too.
+
+	* struct.c (rb_struct_dig): new method Struct#dig.
+	  [Feature #11688]
+
+Mon Nov 16 17:41:33 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (iseq_peephole_optimize): optimize tail calls on aref
+	  and aset specialized instructions.
+
+	* compile.c (iseq_peephole_optimize): optimize replaced leave
+	  instruction copied to jump instruction too.
+
+Mon Nov 16 16:39:38 2015  Akinori MUSHA  <knu@iDaemons.org>
+
+	* lib/set.rb: Enable frozen_string_literal.
+
+	* lib/set.rb: Move << out of the begin block that ensures pop.
+
+Mon Nov 16 16:28:30 2015  Akinori MUSHA  <knu@iDaemons.org>
+
+	* lib/set.rb (Hash#flatten!, #add?, #delete?, #collect!, #reject!,
+	  #select!, #^, #classify): Micro-optimize some methods for
+	  performance and readability.
+
+Mon Nov 16 16:17:58 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ChangeLog: fixed accidentally commit.
+
+Mon Nov 16 16:10:51 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* mkconfig.rb: Add some high-level documentation.
+	  [ci skip][fix GH-1081] Patch by @ulfalizer
+
+Mon Nov 16 15:59:14 2015  yui-knk  <spiketeika@gmail.com>
+
+	* proc.c: Add call-seq of `Method#super_method`
+	  [ci skip][fix GH-1094]
+
+Mon Nov 16 15:58:39 2015  Kenichi Kamiya  <kachick1@gmail.com>
+
+	* struct.c: Standardize a method signature of Struct#[]=.
+	  [ci skip][fix GH-1095]
+
+Mon Nov 16 15:42:36 2015  Akinori MUSHA  <knu@iDaemons.org>
+
+	* lib/set.rb (#>=, #>, #<=, #<): Make use of Hash#>=, #>, #<, and
+	  #<= when comparing against an instance of the same kind.
+
+Mon Nov 16 15:37:11 2015  Naotoshi Seo  <sonots@gmail.com>
+
+	* lib/logger.rb: Support symbol and string log level setting
+
+Mon Nov 16 15:33:11 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* tool/rbinstall.rb: fix wrong permission for gem specification without
+	  zlib runtime. [Bug #11685][ruby-dev:49343]
+
+Mon Nov 16 12:11:11 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/webrick/httpauth/basicauth.rb: fix a typo.
+	  [ci skip][fix GH-1099] Patch by @jwworth
+	* lib/webrick/httpauth/digestauth.rb: ditto.
+
+Sun Nov 15 18:28:43 2015  Kenichi Kamiya  <kachick1@gmail.com>
+
+	* vm_method.c (set_method_visibility): should fail if the receiver
+	  is frozen.  [ruby-core:71489] [Bug #11687]
+
+Sat Nov 14 22:15:07 2015  Tanaka Akira  <akr@fsij.org>
+
+	* ext/socket/lib/socket.rb: Specify frozen_string_literal: true.
+
+Sat Nov 14 21:44:56 2015  Tanaka Akira  <akr@fsij.org>
+
+	* lib/time.rb: Use "<<" to reduce string allocation.
+
+Sat Nov 14 17:45:49 2015  Tanaka Akira  <akr@fsij.org>
+
+	* lib/tsort.rb: Specify frozen_string_literal: true.
+
+Sat Nov 14 17:25:15 2015  Tanaka Akira  <akr@fsij.org>
+
+	* lib/resolv-replace.rb: Specify frozen_string_literal: true.
+
+Sat Nov 14 17:00:13 2015  Tanaka Akira  <akr@fsij.org>
+
+	* lib/time.rb: Specify frozen_string_literal: true.
+
+Sat Nov 14 16:43:02 2015  Tanaka Akira  <akr@fsij.org>
+
+	* lib/open3.rb: Specify frozen_string_literal: true.
+
+Sat Nov 14 05:04:09 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* node.h: remove old comments.
+
+Sat Nov 14 04:55:36 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* refactoring CREF related code.
+
+	* eval_intern.h: remove unused setter functions.
+	  CREF_CLASS_SET()
+	  CREF_NEXT_SET()
+	  CREF_SCOPE_VISI_COPY()
+
+	* eval_intern.h: rename flags:
+	  * NODE_FL_CREF_PUSHED_BY_EVAL_ -> CREF_FL_PUSHED_BY_EVAL
+	  * NODE_FL_CREF_OMOD_SHARED_ -> CREF_FL_OMOD_SHARED
+	  and use IMEMO_FL_USER1/2.
+
+	* vm.c (vm_cref_new): accept push_by_eval parameter.
+
+	* vm.c (vm_cref_new_use_prev): added for rb_vm_rewrite_cref().
+
+	* vm_insnhelper.c (vm_cref_push): accept pushed_by_eval parameter.
+
+	* vm_insnhelper.h: remove unused macros:
+	  COPY_CREF_OMOD() and COPY_CREF().
+
+	* vm_eval.c, insns.def: catch up this fix.
+
+Sat Nov 14 02:58:03 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm.c (vm_define_method): refactoring.
+	  * get CREF in this function.
+	  * cbase is no longer needed (CREF_CLASS(cref) is enough).
+
+	* compile.c: RubyVM::FrozenCore.define_method only accept 2 args.
+
+Sat Nov 14 02:34:43 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm.c (vm_define_method): do not use current CREF immediately,
+	  but check CREF in environment or methods. Methods defined in methods
+	  should be public.
+	  [Bug #11571]
+
+	* vm_method.c (rb_scope_module_func_check): check CREF in env or me.
+	  if CREF is contained by `me', then return FALSE.
+
+	* test/ruby/test_method.rb: add a test.
+
+Sat Nov 14 02:19:16 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* method.h: constify rb_cref_t::scope_visi;
+
+	* eval_intern.h (CREF_SCOPE_VISI_COPY): catch up this fix.
+
+	* vm_method.c: ditto.
+
+Sat Nov 14 01:53:52 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* pack.c (pack_unpack, AVOID_CC_BUG): Very ugly workaround for
+	  optimization bug of Oracle Solaris Studio 12.4 on Solaris
+	  with -xO4 optimization option. [Bug #11684]
+
+Fri Nov 13 23:00:23 2015  Hiroshi Shirosaki  <h.shirosaki@gmail.com>
+
+	* configure.in: unset LD_PRELOAD on mingw. msys2 child processes
+	  crash at make test-all with LD_PRELOAD.
+	  [ruby-core:71461] [Bug #11680]
+
+Fri Nov 13 14:00:43 2015  Zachary Scott  <zzak@ruby-lang.org>
+
+	* ext/openssl/ossl_pkey.c: Merge ruby/openssl@b9ea8ef [Bug #10735]
+
+Fri Nov 13 13:09:16 2015  Zachary Scott  <zzak@ruby-lang.org>
+
+	* ext/openssl/ossl_ssl.c: Merge ruby/openssl@81e1a30
+
+	* test/openssl/test_ssl.rb: ditto
+
+Fri Nov 13 13:05:37 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* prelude.rb (Thread.exclusive): warn as deprecated.
+
+Fri Nov 13 10:36:39 2015  Victor Nawothnig  <Victor.Nawothnig@gmail.com>
+
+	* parse.y (new_unless): optimize constant condition for `unless`
+	  as well as `if`.  [Fix GH-1092]
+
+Fri Nov 13 10:08:41 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ext/psych/psych.gemspec: bump version to 2.0.15
+
+Thu Nov 12 18:44:26 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (parser_magic_comment): should match exactly.
+	  [ruby-core:71460] [Bug #11679]
+
+Thu Nov 12 16:16:20 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* template/prelude.c.tmpl: enable tail call optimization.
+
+Thu Nov 12 14:17:01 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (parser_yylex): ANDDOT at the head of the line denote
+	  line continuation from previous one to support fluent interface,
+	  as well as single dot.
+
+Thu Nov 12 13:49:50 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/rubygems: Update to RubyGems 2.5.0+ HEAD(db78980).
+	  this version includes #1367 , #1373 , #1375
+	* test/rubygems: ditto.
+
+Thu Nov 12 10:53:41 2015  Eric Wong  <e@80x24.org>
+
+	* benchmark/bm_io_nonblock_noex2.rb: new benchmark based
+	  on bm_io_nonblock_noex.rb
+	* io.c (io_read_nonblock): move documentation to prelude.rb
+	  (io_write_nonblock): ditto
+	  (Init_io): private, internal methods for prelude.rb use only
+	* prelude.rb (IO#read_nonblock): wrapper + documentation
+	  (IO#write_nonblock): ditto
+	  [ruby-core:71439] [Feature #11339]
+
+Wed Nov 11 18:30:28 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* sprintf.c (rb_str_format): look up the key, then get default
+	  value and raise KeyError if the returned value is nil.
+	  [ruby-dev:49338] [Ruby trunk - Bug #11677]
+
+Wed Nov 11 17:38:24 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_eval.c (local_var_list_add): skip internal local variable
+	  name by its type but not if it has a name.  internal local
+	  variable names are just unique per frame, not globally.
+	  [ruby-core:71437] [Bug #11674]
+
+Wed Nov 11 14:14:33 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* transcode.c: fix a typo
+	[ci skip][fix GH-1091] Patch by @jwworth
+
+Wed Nov 11 11:58:38 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/ftp.rb (initialize): Connections are in passive mode per
+	  default now.  The default mode can be changed by
+	  Net::FTP.default_passive=.
+	  [ruby-core:71146] [Feature #11612]
+
+	* lib/net/ftp.rb (default_passive=, default_passive): new methods.
+
+Wed Nov 11 09:03:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* sprintf.c (rb_str_format): respect default value of a hash.  no
+	  longer raises KeyError unless the default value of the hash is
+	  nil.  [ruby-core:71354] [Bug #11661]
+
+Tue Nov 10 20:35:12 2015  Tanaka Akira  <akr@fsij.org>
+
+	* lib/open-uri.rb: Remove indicator for "frozen_string_literal: true".
+
+	* lib/pp.rb: Ditto.
+
+	* lib/prettyprint.rb: Ditto.
+
+	* lib/resolv.rb: Ditto.
+
+	* lib/securerandom.rb: Ditto.
+
+	* lib/tmpdir.rb: Ditto.
+
+	* lib/unicode_normalize/tables.rb: Ditto.
+
+	* test/net/ftp/test_buffered_socket.rb: Ditto.
+
+	* test/net/ftp/test_mlsx_entry.rb: Ditto.
+
+	* test/open-uri/test_open-uri.rb: Ditto.
+
+	* test/open-uri/test_ssl.rb: Ditto.
+
+	* test/pathname/test_pathname.rb: Ditto.
+
+	* test/test_pp.rb: Ditto.
+
+	* test/test_prettyprint.rb: Ditto.
+
+	* tool/transcode-tblgen.rb: Ditto.
+
+	* ext/pathname/lib/pathname.rb: Ditto.
+
+Tue Nov 10 18:42:24 2015  Aleksandrs Ledovskis  <aleksandrs@ledovskis.lv>
+
+	* defs/id.def, parse.y: Switch internal token name to reflect
+	  current form of safe-call operator.  [Fix GH-1090]
+
+Tue Nov 10 18:25:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* hash.c (rb_hash_to_proc): use rb_func_proc_new to make light
+	  weight proc.  [Feature #11653]
+
+Tue Nov 10 18:23:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* proc.c (cfunc_proc_t): add room for me.
+
+	* proc.c (cfunc_proc_new): generalise for cfunc proc without env.
+
+	* proc.c (rb_func_proc_new, rb_func_lambda_new): new functions to
+	  make proc/lambda without env from cfunc.
+
+Tue Nov 10 17:32:35 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* bootstraptest/test_fork.rb ([ruby-dev:37934]): :NPROC (RLIMIT_NPROC)
+	  is not supported on some platforms (e.g. Solaris 10).
+
+Tue Nov 10 16:57:14 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* hash.c (rb_hash_to_proc): new method Hash#to_proc.
+	  [Feature #11653]
+
+Tue Nov 10 14:34:09 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* time.c (rb_time_timespec_new): swap utc and localtime
+	  to generate gmt flag by INT_MAX - gmtoff.
+
+Tue Nov 10 14:01:59 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* hash.c (rb_hash_{le,lt,ge,gt}): new methods, Hash#<=, Hash#<,
+	  Hash#>=, Hash#>, to test if all elements of a hash are also
+	  included in another hash, and vice versa.
+	  [ruby-core:68561] [Feature #10984]
+
+Tue Nov 10 11:25:29 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* time.c (rb_timespec_now): added.  [Feature #11558]
+
+	* time.c (rb_time_timespec_new): added.  [Feature #11558]
+
+Tue Nov 10 06:17:17 2015  Eric Wong  <e@80x24.org>
+
+	* variable.c (rb_autoload_load): allow recursive calls
+	  [ruby-core:71345] [Bug #11658]
+	* test/ruby/test_autoload.rb (test_autoload_while_autoloading):
+	  new test by: Hiroshi Shirosaki <h.shirosaki@gmail.com>
+	  [ruby-core:71390]
+
+Tue Nov 10 00:36:46 2015  Tanaka Akira  <akr@fsij.org>
+
+	* lib/resolv.rb (Resolv::DNS::Message::MessageEncoder#put_labels):
+	  Prevent overflow of pointer to labels.
+	  Patch by Hannes Georg.  [ruby-core:71248] [Bug #11632]
+
+Tue Nov 10 00:25:41 2015  Kazuki Tsujimoto  <kazuki@callcc.net>
+
+	* gems/bundled_gems: update to power_assert 0.2.6.
+
+Mon Nov  9 21:48:17 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_eval.c (rb_check_funcall_default): split from
+	  rb_check_funcall to return the given fallback value.
+
+	* object.c (rb_obj_dig): use rb_check_funcall_default so that tail
+	  call optimization will be possible.  [Feature #11643]
+
+Mon Nov  9 21:27:23 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* array.c (rb_ary_dig): new method Array#dig.
+
+	* hash.c (rb_hash_dig): new method Hash#dig.
+
+	* object.c (rb_obj_dig): dig in nested arrays/hashes.
+	  [Feature #11643]
+
+Mon Nov  9 18:00:47 2015  Yuki Nishijima  <mail@yukinishijima.net>
+
+	* gems/bundled_gems: Upgrade the did_you_mean gem to 1.0.0.beta3
+
+Mon Nov  9 17:38:14 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* test/runner.rb: use official repository for coverage tool.
+	* Makefile.in: ditto.
+	* common.mk: ditto.
+	* .gitignore: ignored third party repositories.
+
+Mon Nov  9 17:29:09 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* compile.c (iseq_compile_each): Dynamic string literals should be
+	  frozen.
+	  [ruby-core:57574] [Feature #8976]
+
+Mon Nov  9 15:56:07 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* common.mk: Use ruby organization url for simplecov repository.
+
+Sun Nov  8 16:24:09 2015  Masaki Matsushita <glass.saga@gmail.com>
+
+	* NEWS: describe addition of File::TMPFILE
+
+Sun Nov  8 15:19:17 2015  Masaki Matsushita <glass.saga@gmail.com>
+
+	* file.c: Add O_TMPFILE.
+
+Sun Nov  8 14:24:43 2015  windwiny  <windwiny.ubt@gmail.com>
+
+	* method.h (METHOD_ENTRY_{VISI,BASIC,FLAGS}_SET): suppress
+	  shift-op-parentheses warnings.  [Fix GH-1082]
+
+Sun Nov  8 14:01:22 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ext/psych/psych_emitter.c: backport 5bd7744 from tenderlove/psych.
+	  support backward compatibility of Ruby 2.0
+
+Sun Nov  8 10:55:10 2015  Anton Davydov  <antondavydov.o@gmail.com>
+
+	* io.c (rb_io_gets_m): Update IO#gets doc for characters more than
+	  1 byte.  [Fix GH-1085]
+
+Sun Nov  8 10:37:58 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/uri/ftp.rb: fix a typo.
+	  [fix GH-1084][ci skip] Patch by @windwiny
+
+Sun Nov  8 08:10:31 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_trace.c (exec_hooks_precheck): check need_clean everytime
+	  to clean-up unused hooks.
+
+	* vm_trace.c (list->need_clean): use as boolean value.
+
+Sun Nov  8 01:31:27 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/net/http.rb (Net::HTTP#initialize):
+	  default value of Net::HTTP#open_timeout is now 60 (was nil).
+
+Sat Nov  7 12:18:05 2015  Eric Wong  <e@80x24.org>
+
+	* string.c (id_to_s): remove redundant variable
+	  (rb_obj_as_string): trade id_to_s for idTo_s
+	  (rb_str_equal): replace rb_intern(...) with pre-defined ID
+	  (rb_str_cmp_m): ditto
+	  (rb_str_match): ditto
+	  (str_upto_each): ditto
+	  (rb_str_sum): ditto
+	  (Init_String): remove id_to_s initialization
+
+Sat Nov  7 11:40:05 2015  Eric Wong  <e@80x24.org>
+
+	* thread.c (rb_cThreadShield): make static
+
+Sat Nov  7 09:51:38 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_trace.c (rb_threadptr_exec_event_hooks_orig):
+	  maintain trace_running counter on internal events.
+
+	  This patch is made by Takashi Kokubun <takashikkbn@gmail.com>.
+	  [Bug #11603] https://github.com/ruby/ruby/pull/1059
+
+Sat Nov  7 03:32:27 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* include/ruby/ruby.h (RSTRUCT_PTR): need a close parenthesis.
+
+Sat Nov  7 01:32:06 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* dir.c (dir_fileno, dirfd): support of Dir#fileno on Solaris 10.
+	  Solaris 10 does not have dirfd, but the file descriptor of a
+	  directory is stored in the d_fd or dd_fd member in the DIR struct.
+	  Note that Solaris 11 has dirfd(3C).
+
+	* configure.in: checks for DIR.d_fd and DIR.dd_fd on Solaris 10.
+
+Fri Nov  6 23:13:53 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
+
+	* array.c: clarifies Array#reject! documentation.
+	  [fix GH-894][ci skip] Patch by @GxSplinter
+
+Fri Nov  6 20:18:25 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* test/runner.rb: extracted test helper.
+	* test/lib/zombie_hunter.rb: ditto.
+
+Fri Nov  6 18:07:47 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* include/ruby/ruby.h (rb_array_const_ptr, rb_struct_const_ptr):
+	  Suppress pointer type mismatch warnings occurred with old version
+	  of Fujitsu C Compiler (fcc) on Solaris 10. The warnings cause
+	  failure of TestMkmf::TestConvertible. [Bug #11644] [ruby-dev:49326]
+	* include/ruby/ruby.h (FIX_CONST_VALUE_PTR): macro for the above,
+	  only effective with fcc.
+
+Fri Nov  6 12:39:21 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* defs/id.def (token_ops), parse.y (parser_yylex): change DOTQ
+	  from ".?" to "&.".  [ruby-core:71363] [Feature #11537]
+
+Fri Nov  6 09:01:26 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (kwd_append): fix segv after invalid keyword argument,
+	  preceding keyword list is NULL when syntax error is there.
+	  [ruby-core:71356] [Bug #11663]
+
+Fri Nov  6 06:59:37 2015  Eric Wong  <e@80x24.org>
+
+	* test/ruby/test_autoload: hoist out ruby_impl_require
+
+Thu Nov  5 13:03:58 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* defs/id.def (token_ops): gather associations between IDs,
+	  operators, and parser tokens.
+
+Thu Nov  5 10:17:17 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/socket/socket.c (make_addrinfo): use RARRAY_ASET for
+	  write-barrier.
+
+	* ext/tk/tcltklib.c ({call,eval,invoke}_queue_handler): ditto.
+
+	* ext/tk/tkutil/tkutil.c (ary2list, ary2list2): ditto.
+
+Thu Nov  5 10:09:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/**/*.c: prefer RARRAY_AREF to indexing RARRAY_CONST_PTR.
+	  pointed out by hanmac.
+	  https://github.com/ruby/ruby/commit/3553a86#commitcomment-14187670
+
+Wed Nov  4 17:33:24 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/debug.rb: Add documentation for #thread_list_all.
+	  [Misc #11580][ci skip]
+
+Wed Nov  4 15:45:59 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* class.c: fix documentation for rb_define_class{_id}_under.
+	  [fix GH-991][ci skip] Patch by @kachick
+
+Wed Nov  4 15:40:45 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* method.h: fix typo. Patch by @davydovanton
+	  [fix GH-1076][ci skip]
+
+Wed Nov  4 15:39:32 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* hash.c: use correct grammar. Patch by @tveastman
+	  [fix GH-1079][ci skip]
+
+Wed Nov  4 11:38:23 2015  Jake Worth  <jakeworth82@gmail.com>
+
+	* process.c (proc_getsid): [DOC] Fix double word 'for' and typo.
+	  [Fix GH-1080]
+
+Wed Nov  4 06:01:52 2015  Eric Wong  <e@80x24.org>
+
+	* include/ruby/ruby.h (struct RObject): hide iv_index_tbl type
+	  [ruby-core:71306] [Feature #11647]
+
+Tue Nov  3 06:48:58 2015  Eric Wong  <e@80x24.org>
+
+	* variable.c (find_class_path): remove cast for rb_class_ivar_set
+	  (rb_ivar_set): ditto
+	  (rb_cvar_set): ditto
+
+Tue Nov  3 06:18:21 2015  Eric Wong  <e@80x24.org>
+
+	* variable.c (rb_global_tbl): convert to id_table
+
+Tue Nov  3 01:58:46 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* parse.y (NO_QCALL): fix type mismatch of operands that causes
+	  compile error with Oracle Solaris Studio on Solaris.
+	  [Bug #11645] [ruby-dev:49327]
+
+Sun Nov  1 17:14:36 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* id_table.c (mix_id_table_insert): do not touch list during
+	  list->hash transition because GC can run during transition.
+
+Sun Nov  1 11:07:31 2015  Eric Wong  <e@80x24.org>
+
+	* iseq.c (iseq_memsize): account for rb_call_cache entries
+
+Sun Nov  1 09:12:10 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (parser_yylex): ':' separated by a comment and a newline
+	  is not valid as symbol.
+
+Sat Oct 31 20:15:48 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* test/openssl/test_pair.rb: skipped tests if openssl doesn't support
+	  ECDH cipher.
+
+Sat Oct 31 14:58:10 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* man/ruby.1 (SYNOPSIS): remove extraneous space for -F option as
+	  it does not allow spaces before its argument.
+	  [ruby-core:71283] [Bug #11641]
+
+Sat Oct 31 14:58:01 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* man/ruby.1 (SYNOPSIS): remove extraneous space for -F option as
+	  it does not allow spaces before its argument.
+	  [ruby-core:71283] [Bug #11641]
+
+Sat Oct 31 10:22:49 2015  yui-knk  <spiketeika@gmail.com>
+
+	* eval_error.c (undef_mesg_for): fix typo.  Before this commit
+	  `ArgumentError: malformed format string - %$` was raised when
+	  `NameError#message` is called.  [ruby-core:71282] [Bug #11640]
+	  [Fix GH-1077]
+
+Fri Oct 30 21:12:45 2015  Kazuki Tsujimoto  <kazuki@callcc.net>
+
+	* gems/bundled_gems: update to power_assert 0.2.5.
+
+Fri Oct 30 19:29:52 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (newobj_slowpath): do not need to use flags hack (commit miss).
+
+Fri Oct 30 19:08:48 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (heap_get_freeobj_from_next_freepage): not so UNLIKELY.
+
+Fri Oct 30 18:09:51 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (newobj_slowpath): reduce 1 parameter to use only registers
+	  for performance.
+
+	  On my laptop, 'N.times{x = []}' (where N = 29_000_000) is
+	  1.86 sec -> 1.74 sec.
+
+Fri Oct 30 12:53:21 2015  yui-knk  <spiketeika@gmail.com>
+
+	* test/ruby/test_call.rb: added test for safe navigation operator.
+	  [fix GH-1066]
+
+Fri Oct 30 12:47:34 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ChangeLog: fix wrong commit name.
+
+Fri Oct 30 12:36:16 2015  yui-knk  <spiketeika@gmail.com>
+
+	* vm_method.c: added documentation of protected/private methods.
+	  [fix GH-1072]
+	* test/ruby/test_module.rb: added testcase for method_defined?
+	  [fix GH-1071]
+
+Fri Oct 30 12:06:59 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* variable.c (rb_class_ivar_set): rename as class specific ivar
+	  setter, and st_table is no longer involved.
+
+Fri Oct 30 11:36:33 2015  Eric Wong  <e@80x24.org>
+
+	* variable.c (generic_ivar_remove): adjust type, set valp
+	  (rb_obj_remove_instance_variable): simplify call
+	* test/ruby/test_object.rb (test_remove_instance_variable):
+	  expand for implementation details
+
+Fri Oct 30 10:37:56 2015  Eric Wong  <e@80x24.org>
+
+	* internal.h (rb_st_insert_id_and_value): update prototype
+	* variable.c (rb_st_insert_id_and_value): reduce args
+	  (find_class_path): adjust call for less args
+	  (rb_ivar_set): ditto
+	  (rb_cvar_set): ditto
+	* class.c (rb_singleton_class_attached): ditto
+
+Fri Oct 30 09:57:22 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* gems/bundled_gems: update latest gems.
+	  test-unit-3.1.5 and minitest-5.8.2
+
+Fri Oct 30 09:54:05 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/rubygems: Update to RubyGems HEAD(60d7972).
+	  this version contains pull requests number of #1343, #1356, #1357, #1363
+	  at https://github.com/rubygems/rubygems/pulls
+	* test/rubygems: ditto.
+
+Fri Oct 30 07:38:29 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* insns.def (getinlinecache/setinlinecache): compare ic->ic_cref and
+	  current cref only when cached CREF list includes singleton class.
+
+	  Singleton classes have own namespaces, so that we need to check
+	  cref as a key (#10943).
+
+	  However, if current CREF list does not include singleton class,
+	  no need to check CREF because it should be same name space.
+
+	* vm_insnhelper.c (vm_get_const_key_cref): add a function returns
+	  CREF only when it includes singleton class.
+
+	* vm_core.h: constify iseq_inline_cache_entry::ic_cref.
+
+Fri Oct 30 06:43:50 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c (vm_env_cref): make it inline for performance.
+
+	* vm_insnhelper.c (rb_vm_get_cref): use NULL instead of 0.
+
+Fri Oct 30 06:20:40 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* insns.def: nobody set ic->ic_value.value to Qundef.
+
+Fri Oct 30 06:15:50 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm.c: add ifndef guard for VM_CHECK_MODE.
+
+Fri Oct 30 06:13:10 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c (vm_check_frame_detail): should require me for
+	  VM_FRAME_FLAG_BMETHOD type frame.
+
+Thu Oct 29 18:42:30 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (gc_mark_ptr): specify NOINLINE so that gc_mark() can return
+	  immediately when obj is not a markable object.
+
+Thu Oct 29 18:05:22 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* encoding.c (rb_enc_check_str): add for performance.
+	  This function only accepts T_STRING (and T_REGEXP).
+
+	  This patch improves performance of a tiny_segmenter benchmark
+	  (num=2) 2.54sec -> 2.42sec on my machine.
+	  https://github.com/chezou/TinySegmenter.jl/blob/master/benchmark/benchmark.rb
+
+	* encoding.c: add ENC_DEBUG and ENC_ASSERT() macros.
+
+	* internal.h: add a decl. of rb_enc_check_str().
+
+	* string.c (rb_str_plus): use rb_enc_check_str().
+
+	* string.c (rb_str_subpat_set): ditto.
+
+Thu Oct 29 17:16:40 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* internal.h: export rb_wb_(un)protected_newobj_of()
+	  because some extensions include internal.h.
+
+Thu Oct 29 16:42:19 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (rb_imemo_new): should not pass FL_WB_PROTECTED flag.
+
+	* gc.c (rb_wb_protected_newobj_of): add more assertions.
+
+	* gc.c (rb_wb_unprotected_newobj_of): ditto.
+
+Thu Oct 29 16:20:26 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c: introduce rb_wb_unprotected_newobj_of() and
+	  rb_wb_protected_newobj_of(), pass the WB_PROTECTED
+	  information explicitly.
+
+	* internal.h: use introduced functions by NEWOBJ_OF().
+	  `flag' is immediate value, so that C compilers can
+	  solve them at compile time.
+
+	* include/ruby/ruby.h: add a comment about that.
+
+Thu Oct 29 14:52:03 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c: add rb_objspace::flags::has_hook to represent hook availability.
+
+	* gc.c: add gc_event_hook_available_p(objspace) to check that flag.
+
+	* gc.c (newobj_of): use gc_event_hook_available_p() instead of
+	  checking gc_event_hook_needed_p(objspace, RUBY_INTERNAL_EVENT_NEWOBJ).
+	  for performance.
+
+	* gc.c (newobj_init): add UNLIKELY() for FL_WB_PROTECTED flag.
+
+	* gc.c (newobj_init): change parameters order (trivial change).
+
+Thu Oct 29 14:45:15 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_core.h (rb_thread_struct): move forward declarations before
+	  used.
+
+Thu Oct 29 14:07:54 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (gc_mark_ptr): remove debug code for #11244.
+
+Thu Oct 29 10:08:33 2015  Eric Wong  <e@80x24.org>
+
+	* variable.c (struct autoload_state): usable as wait-queue head
+	  (struct autoload_data_i): remove 2 words of overhead
+	  (autoload_i_mark): remove marking for thread
+	  (autoload_reset): adjust for struct changes
+	  (rb_autoload): ditto
+	  (rb_autoloading_value): ditto
+	  (rb_autoload_load): ditto
+	  (const_update): ditto
+
+Thu Oct 29 08:48:05 2015  Eric Wong  <e@80x24.org>
+
+	* variable.c (struct autoload_data_i): add waitq_head
+	  (struct autoload_state): new struct
+	  (autoload_require): save result in autoload_state for use
+	    in autoload_reset
+	  (autoload_reset): wake up other waiters with open-coded
+	    wait-queues
+	  (rb_autoload_load): add ensure autoload_const_set happens
+	    atomically w.r.t. autoload-triggered "require"
+	  [ruby-core:70075] [ruby-core:71239] [Bug #11384]
+
+Wed Oct 29 00:39:50 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* test/rubygems/test_gem_commands_server_command.rb
+	  (test_handle_options_port): change port from http to discard.
+	  Solaris does not include "http 80/tcp" in its default
+	  /etc/inet/services. AFAIK, discard (9/tcp) is older than http
+	  and it is expected that all OS can resolve the service name.
+	  [Bug #10004] [ruby-core:63518]
+
+Wed Oct 28 23:52:48 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* probes_helper.h (RUBY_DTRACE_HOOK): add RB_GC_GUARD, though paranoic.
+
+Wed Oct 28 15:36:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* error.c (rb_name_err_new): store the receiver directly.
+
+	* error.c (name_err_receiver): return directly stored receiver.
+	  [Feature #10881]
+
+	* error.c (name_err_mesg_to_str): quote the name if unprintable.
+
+	* object.c (check_setter_id): use rb_check_id to convert names.
+
+	* variable.c (uninitialized_constant): use NameError::message to
+	  keep the receiver of uninitialized constant.  [Feature #10881]
+
+	* error.c (rb_name_err_new): new function to create NameError
+	  exception instance.  [Feature #10881]
+
+Wed Oct 28 13:29:39 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (new_attr_op_assign): fix op_assign type, which is
+	  already an ID since r52284.  [Feature #11537]
+
+Tue Oct 27 23:14:14 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* defs/id.def: enable anonymous IDs not to expose internal IDs for
+	  frozen-string-literal-debug by Marshal.dump.
+
+Tue Oct 27 17:06:55 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* defs/id.def: move internal IDs for frozen-string-literal-debug.
+
+Tue Oct 27 16:41:05 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* error.c (rb_error_frozen_object): use rb_attr_get instead of
+	  rb_ivar_get to get rid of warnings for string objects created
+	  when frozen-string-literal-debug is disabled.
+
+Tue Oct 27 16:18:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/logger.rb (Logger::Period#previous_period_end): as weekly
+	  rotation shifts the log file on Sundays, the end date of the
+	  previous period should be Saturdays.  fix r45072.
+	  [ruby-dev:49314] [Bug #11622]
+
+Tue Oct 27 16:12:37 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* vm_dump.c (rb_print_backtrace): our addr2line doesn't work on sparc.
+	  http://rubyci.s3.amazonaws.com/unstable11s/ruby-trunk/log/20151027T043311Z.log.html.gz
+
+Tue Oct 27 12:00:33 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/logger.rb (Logger::Period#next_rotate_time): get rid of
+	  adding to mday not to exceed the days of the month.
+	  [ruby-core:71185] [Bug #11620]
+
+Mon Oct 26 22:43:03 2015  yui-knk  <spiketeika@gmail.com>
+
+	* test/ruby/test_module.rb (test_method_defined): Add test cases
+	  for `public/protected/private _method_defined?`
+	  These methods accept string as argument, so add string argument
+	  cases.  [Fix GH-1067]
+
+Mon Oct 26 22:23:30 2015  SimonDKnight  <simondknight@hotmail.com>
+
+	* lib/racc/rdoc/grammar.en.rdoc: Grammatical errors fixed.
+	  [Fix GH-1070]
+
+Mon Oct 26 18:36:43 2015  Shota Fukumori (sora_h) <her@sorah.jp>
+
+	* vm_method.c(rb_method_entry_make):
+	  [DOC] [ci skip] Remove a needless space from comment
+	  [Fixes GH-1069] Patch by @yui-knk
+
+Mon Oct 26 17:30:13 2015  Ryan Hosford  <tad.hosford@gmail.com>
+
+	* lib/fileutils.rb: rename tailing to trailing.
+	  [Misc #11548]
+
+Mon Oct 26 17:11:53 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (call_op, call_op2): fix values on ripper.  [Feature #11537]
+
+Mon Oct 26 12:55:06 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (call_op2): separate from call_op and also allow "::",
+	  while dot_or_colon should not allow ".?".  [Feature #11537]
+
+Mon Oct 26 01:03:23 2015  Rei Odaira  <Rei.Odaira@gmail.com>
+
+	* thread_pthread.c: fix compile errors when
+	  USE_SLEEPY_TIMER_THREAD is disabled.
+
+Sun Oct 25 10:12:05 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* symbol.c (op_tbl): add DOTQ for ripper.  [Feature #11537]
+
+Sat Oct 24 22:51:18 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* configure.in: fixed build failure of Haiku.
+	  [fix GH-984] Patch by @kallisti5
+	* ext/socket/getaddrinfo.c: ditto.
+	* ext/socket/getnameinfo.c: ditto.
+	* ext/socket/rubysocket.h: ditto.
+
+Sat Oct 24 21:16:53 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* test/fileutils/test_fileutils.rb (test_uptodate): relax error
+	  message format.  [Feature #9025], [ruby-core:71178] [Bug #11617]
+
+Sat Oct 24 21:06:43 2015  Shota Fukumori (sora_h)  <her@sorah.jp>
+
+	* lib/mkmf.rb: Revert r45640 because it may lead to link
+	  with different libruby. [Bug #9760]
+
+Sat Oct 24 15:42:20 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* bootstraptest/test_method.rb: relax error message format.
+
+	* test/ruby/test_arity.rb (err_mess): ditto.
+	  [Feature #9025], [ruby-core:71178] [Bug #11617]
+
+Sat Oct 24 12:47:47 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
+
+	* vm_insnhelper.c: improved error message for "wrong number
+	  of arguments", distinguishing given and expected argument
+	  numbers clearly. [Feature #9025]
+
+Sat Oct 24 11:57:59 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* vm_insnhelper.c: remove the typedef redeclaration of
+	  vm_call_handler.
+
+Sat Oct 24 07:29:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/forwardable.rb (def_instance_delegator, def_single_delegator):
+	  match backtraces against ::Forwardable in case the target class
+	  is a subclass of BasicObject and does not include Kernel.
+	  [ruby-core:71176] [Bug #11616]
+
+Sat Oct 24 04:10:13 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* iseq.c (make_compile_option_value): include frozen_string_literal*
+	  in a made option value.
+
+	* vm_opts.h: forgot to add OPT_FROZEN_STRING_LITERAL_DEBUG
+	  at last commit.
+
+Sat Oct 24 03:58:02 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* ruby.c: introduce --enable-frozen-string-literal-debug option.
+	  If this option is enabled, the modify error will be:
+	    can't modify frozen String (RuntimeError) =>
+	    can't modify frozen String, created at test.rb:3 (RuntimeError)
+
+	* iseq.h: add compile option frozen_string_literal_debug.
+
+	* compile.c: catch up this fix.
+
+	* error.c (rb_error_frozen): ditto.
+
+	* iseq.c (set_compile_option_from_hash): ditto.
+
+	* test/ruby/test_rubyoptions.rb: add a test for this fix.
+
+Sat Oct 24 02:02:24 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c: introduce new call handler for simple ISeqs.
+
+	  vm_call_iseq_setup_normal_0start() is simple, however it has
+	  some loops/conditions depends on ISeq::param.size and
+	  ISeq::local_size (in vm_push_frame(), inlined into this function).
+
+	  There are many simple methods which has a few parameters and local
+	  variables. So that this patch introduces several special functions
+	  generated in vm_call_iseq_optimized.inc by
+	  tool/mk_call_iseq_optimized.rb.
+
+	  This script makes
+	    vm_call_iseq_setup_normal_0start_Xparams_Ylocals()
+	  where X is 0 to 3 and Y is 1 to 6 (as current setting).
+	  In this case, X * Y = 24 functions are created.
+
+	  These functions creates fast method dispatch by inlining
+	  vm_push_frame() with immediate params/locals sizes.
+
+	  On my laptop, we can have the following results.
+
+	  vm2_method*       1.083 (8.3% faster)
+	  vm2_poly_method*  0.961 (3.4% slower)
+
+	  It shows 8.3% faster for inner loop method dispatch (hit inline
+	  cache), but 3.4% slower when inline cache miss because we need
+	  to find a suitable call handler.
+
+	* common.mk: add a rule for vm_call_iseq_optimized.inc.
+
+	* tool/mk_call_iseq_optimized.rb: added.
+
+	* vm.c: include vm_call_iseq_optimized.inc.
+
+Sat Oct 24 01:58:50 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: define vm_call_handler.
+
+Sat Oct 24 01:56:01 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h, vm_insnhelper.h: move definition of VMDEBUG
+	  from vm_insnhelper.h to vm_core.h.
+
+Sat Oct 24 01:51:01 2015  Akinori MUSHA  <knu@iDaemons.org>
+
+	* NEWS: [DOC] In the new safe call syntax, arguments are evaluated
+	  only if a call is made.
+
+	* doc/syntax/calling_methods.rdoc: Fix a typo.
+
+Sat Oct 24 00:38:34 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/forwardable (def_instance_delegator, def_single_delegator):
+	  rescue ::Exception instead of Exception in case Exception is
+	  defined under the target class.
+	  [ruby-core:71175] [Ruby trunk - Bug #11615]
+
+Fri Oct 23 21:10:37 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* error.c (name_err_mesg_to_str): separate class names from the
+	  receiver description.
+
+	* vm_eval.c (make_no_method_exception, raise_method_missing): add
+	  format specifiers for class names.
+
+Fri Oct 23 18:10:32 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* .gitignore: ignored environmental wrapper files.
+
+Fri Oct 23 17:55:29 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/irb.rb: Ignored assignment of STDOUT.sync = true
+	  when irb.rb loaded. It's affected to IDE such as Jetbrain.
+	  [fix GH-864] Patch by @os97673
+
+Fri Oct 23 16:35:08 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/ipaddr.rb, test/test_ipaddr.rb: Reject invalid address contained
+	  EOL string. Patch by @kachick [fix GH-942][Bug #11513]
+
+Fri Oct 23 16:03:26 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* file.c: fix indent style. [fix GH-977]
+	* test/ruby/test_string.rb: indent. [fix GH-975]
+	  [ci skip] These patches are contributed from @yui-knk
+
+Fri Oct 23 15:46:09 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* string.c: Added method signature to include hash. It's inconsistency
+	  with `gsub` method signature.
+	  [ci skip][fix GH-1023] Patch by @danielevans
+
+Fri Oct 23 15:25:51 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/imap.rb: remove an empty comment line and -*-.
+
+Fri Oct 23 15:20:02 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/ftp.rb (gettextfile, getbinaryfile): use the safe
+	  navigation operator.
+
+Fri Oct 23 13:51:33 2015  yui-knk  <spiketeika@gmail.com>
+
+	* test_call.rb (test_safe_call): Add test cases for safe
+	  navigation operator assignment.  [Fix GH-1064]
+	  Validate:
+	  * can assign an attribute which is `nil`
+	  * can "or assign" an attribute which is `nil`
+
+Fri Oct 23 11:58:21 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (iseq_peephole_optimize): optimize lengthy safe
+	  navigation method chain.  [Feature #11537]
+
+Fri Oct 23 10:58:41 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/matrix/eigenvalue_decomposition.rb (tridiagonalize): fix
+	  indentation to avoid a warning when the command line option -w of
+	  ruby is specified.
+
+	* lib/matrix/eigenvalue_decomposition.rb (hessenberg_to_real_schur):
+	  change the name of a block parameter to avoid a warning when the
+	  command line option -w of ruby is specified.
+
+Fri Oct 23 10:49:36 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (iseq_compile_each): support safe navigation of simple
+	  attribute assignment.  [Feature #11537]
+
+	* parse.y (mlhs_node, lhs, attrset_gen): ditto.  keep mid
+	  non-attrset as the sign of safe navigation.
+
+Fri Oct 23 07:17:11 2015  Eric Wong  <e@80x24.org>
+
+	* test/io/wait/test_io_wait.rb (test_wait_eof): test return value
+
+Fri Oct 23 00:32:02 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/openssl/ossl_ssl.c (ssl_npn_select_cb): explicitly raise error
+	  in ext/openssl instead of OpenSSL itself because LibreSSL
+	  silently truncate the selected protocol name by casting the length
+	  from int to unsigned char. [Bug #11369]
+	  Patch by Jeremy Evans <merch-redmine@jeremyevans.net>
+
+Fri Oct 23 00:49:45 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/un.rb (help): change the name of a block parameter to avoid
+	  a warning when the command line option -w of ruby is specified.
+
+Fri Oct 23 00:22:20 2015  Josef Simanek  <josef.simanek@gmail.com>
+
+	* string.c (rb_str_tr): [DOC] Escape backslash in String#tr
+	  documentation.  [Fix GH-1063]
+
+Fri Oct 23 00:19:04 2015  yui-knk  <spiketeika@gmail.com>
+
+	* array.c (rb_ary_collect): [DOC] Fix space of code example of
+	  Array#map.  [Fix GH-1062]
+
+Thu Oct 22 18:52:53 2015  Akinori MUSHA  <knu@iDaemons.org>
+
+	* vm_eval.c (rb_f_loop): When a loop is stopped by a StopIteration
+	  exception, return what the enumerator has returned instead of
+	  nil. [ruby-core:71133] [Feature #11498]
+
+Thu Oct 22 18:25:10 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/imap.rb (idle): add a new argument timeout for keep-alive.
+	  [ruby-core:63693] [Bug #10031]
+
+Thu Oct 22 15:30:08 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (iseq_peephole_optimize): peephole optimization for
+	  branchnil jumps.
+
+	* compile.c (iseq_compile_each): generate save navigation operator
+	  code.
+
+	* insns.def (branchnil): new opcode to pop the tos and branch if
+	  it is nil.
+
+	* parse.y (NEW_QCALL, call_op, parser_yylex): parse token '.?'.
+	  [Feature #11537]
+
+Thu Oct 22 13:16:19 2015  Guilherme Reis Campos  <guilhermekbsa@gmail.com>
+
+	* dir.c (ruby_brace_expand): glob brace expansion edge case fix.
+	  When there are closing braces '}' before a open brace '{' it
+	  must be ignored and considered as literal.
+	  [ruby-core:71138] [Bug #11609]
+
+Thu Oct 22 13:13:49 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (argf_next_argv): check ARGV element type, and try
+	  conversion if necessary.  [ruby-core:71140] [Bug #11610]
+
+Thu Oct 22 11:11:16 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* test/net/ftp/test_ftp.rb: add tests for getbinaryfile and
+	  gettextfile.
+
+Wed Oct 21 18:34:06 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (parser_magic_comment): allow a sole magic comment without
+	  indicators, neither other non-space comments.  [Feature #8976]
+
+Tue Oct 20 12:17:56 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+
+	* lib/prime.rb: Add basic argument checking to Prime.prime?
+	  [Bug #11606]
+
+Tue Oct 20 12:17:50 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+
+	* lib/prime.rb: Optimize Integer#prime?
+	  Patch by Nick Slocum [Bug #10354]
+
+Tue Oct 20 08:12:47 2015  Rei Odaira  <Rei.Odaira@gmail.com>
+
+	* configure.in: pthread_getattr_np is broken on AIX.
+	  More specifically, the stack address and size returned are
+	  not correct.
+
+Tue Oct 20 05:54:46 2015  Eric Wong  <e@80x24.org>
+
+	* ext/fiddle/closure.c (callback): static function
+
+Mon Oct 19 10:33:46 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/socket/init.c (rsock_raise_socket_error): get rid of a glibc
+	  bug.  [ruby-core:71100] [Bug #11600]
+
+Mon Oct 19 01:26:26 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* file.c (rb_file_identical_p): not necessary to compare the paths after
+	  comparing the file indexes on Windows.  designate by kosaki.
+
+Sun Oct 18 21:17:27 2015  Tanaka Akira  <akr@fsij.org>
+
+	* lib/open-uri.rb: Specify frozen_string_literal: true.
+
+Sun Oct 18 14:37:56 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* random.c (fill_random_bytes_urandom): add a comment why using
+	  O_NONBLOCK and O_NOCTTY.
+
+Sun Oct 18 13:24:17 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* random.c (fill_random_bytes_syscall): use ATOMIC_SET() for
+	  updating try_syscall.
+
+Sun Oct 18 13:03:52 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* include/ruby/backward/util.h: Good-by Borland-C.
+
+Sun Oct 18 13:03:09 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* common.mk: add a comment how to use "make test-all"
+
+Sun Oct 18 12:59:22 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* common.mk: add comments how to use "make benchmark"
+
+Sun Oct 18 12:58:15 2015  Tanaka Akira  <akr@fsij.org>
+
+	* lib/securerandom.rb: Specify frozen_string_literal: true.
+
+Sun Oct 18 11:22:52 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* dln.c: remove defined(__WATCOMC__).
+
+Sun Oct 18 11:16:33 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* lib/mkmf.rb: Good-by Borland-C.
+
+Sun Oct 18 11:04:36 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* numeric.c: Good-by Borland-C.
+	* include/ruby/backward/rubyio.h: ditto.
+	* include/ruby/backward/st.h: ditto.
+	* include/ruby/backward/util.h: ditto.
+	* include/ruby/backward/rubysig.h: ditto.
+	* include/ruby/backward/classext.h: ditto.
+	* dln.c: ditto.
+	* gc.c: ditto.
+	* win32/resource.rb: ditto.
+	* win32/dir.h: ditto.
+	* ext/tk/tcltklib.c: ditto.
+	* NEWS: announce that Borland-C is no longer supported.
+
+Sun Oct 18 10:54:52 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* dln.c: simplify #ifdef. _WIN32 and __CYGWIN__ are exclusive.
+	  see include/ruby/defines.h
+	* gc.c: ditto.
+	* ext/sdbm/_sdbm.c: ditto.
+
+Sun Oct 18 10:42:19 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* ruby.c (open_load_file): add a comment.
+
+Sun Oct 18 10:12:46 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* file.c (rb_file_identical_p): simplify ifdefs
+
+Sun Oct 18 10:01:40 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* ChangeLog: Good-bye OS/2.
+	* common.mk: ditto.
+	* configure.in: ditto.
+	* dln_find.c: ditto.
+	* ext/Setup.emx: ditto.
+	* ext/extmk.rb: ditto.
+	* ext/socket/extconf.rb: ditto.
+	* ext/zlib/extconf.rb: ditto.
+	* file.c: ditto.
+	* include/ruby/defines.h: ditto.
+	* io.c: ditto.
+	* lib/mkmf.rb: ditto.
+	* missing/os2.c: ditto.
+	* process.c: ditto.
+	* ruby.c: ditto.
+	* NEWS: announce OS/2 is no longer supported.
+
+Sun Oct 18 08:50:15 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* include/ruby/defines.h (DOSISH): add comments.
+
+Sun Oct 18 08:26:51 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* io.c (fptr_finalize): don't release gvl if fptr is not writable.
+	  writable fd may block on close(2) when it's on NFS. But readonly
+	  fd doesn't. [Bug #11559]
+	  result: make benchmark OPTS="-p bm_require_t -e ruby-trunk -e ruby-2.2.2"
+	    build-ruby:             0.171
+	    ruby 2.3.0dev(r52151):  0.659
+	    ruby 2.2.0p95 (r50295): 0.834
+
+Sun Oct 18 09:32:58 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* file.c (ruby_is_fd_loadable): this should be fail if st_mode is
+	  not regular file nor FIFO.
+
+Sun Oct 18 09:20:17 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* ruby.c (open_load_file): use rb_thread_wait_fd() instead of reopen.
+
+Sun Oct 18 05:11:22 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* ruby.c (open_load_file): reset O_NONBLOCK after open.
+	  Even if S_ISREG() is true, the file may be file on FUSE filesystem
+	  or something. We can't assume O_NONBLOCK is safe.
+	  Moreover, we should wait if the path is point to FIFO. That's
+	  FIFO semantics. GVL should be transparent from ruby script.
+	  Thus, just reopen without O_NONBLOCK for filling the requirements.
+	  [Bug #11060][Bug #11559]
+
+	* ruby.c (loadopen_func): new for the above.
+
+	* file.c (ruby_is_fd_loadable): new. for checks loadable file type
+	  of not.
+	* file.c (rb_file_load_ok): use ruby_is_fd_loadble()
+	* internal.h: add ruby_is_fd_loadble()
+
+	* common.mk: now, ruby.o depend on thread.h.
+
+	* test/ruby/test_require.rb
+	(TestRequire#test_loading_fifo_threading_success): new test.
+	  This test successful case that loading from FIFO.
+
+	* test/ruby/test_require.rb
+	(TestRequire#test_loading_fifo_threading_raise): rename from
+	  test_loading_fifo_threading. You shouldn't rescue an exception
+	  if you test raise or not.
+	  Moreover, this case should be caught IOError because load(FIFO)
+	  should be blocked until given any input.
+
+Sat Oct 17 13:55:32 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* file.c (rb_file_expand_path_internal): concatenate converted
+	  string to the result instead of making converted string and
+	  append it.
+
+	* string.c (rb_str_cat_conv_enc_opts): from rb_str_conv_enc_opts,
+	  separate function to concatenate with transcoding.
+
+Sat Oct 17 13:19:10 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ruby.c (load_file): unify each preparations and clean-ups by
+	  merging load_file_internal and load_file_internal2, and remove
+	  nested rb_protect and rb_ensure.
+
+Sat Oct 17 05:28:32 2015  Rei Odaira  <Rei.Odaira@gmail.com>
+
+	* test/ruby/test_symbol.rb (test_symbol_fstr_leak): add a warm-up
+	  code and check RSS to avoid false positive on AIX and false
+	  negative on Mac OS X. [Bug #10686]
+
+Fri Oct 16 15:54:37 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* file.c (rb_file_load_ok): open in non-blocking mode withoout
+	  releasing GVL.  don't care about others than regular files and
+	  directories.  [ruby-dev:49272] [Bug #11559]
+
+	* ruby.c (load_file_internal): ditto.
+
+Thu Oct 15 23:56:03 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* proc.c (rb_sym_to_proc): make void env.
+
+Thu Oct 15 13:37:23 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* proc.c (rb_sym_to_proc): move from string.c and create a Proc
+	  with no environments.  [ruby-core:71088] [Bug #11594]
+
+Thu Oct 15 01:57:03 2015  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+
+	* test/objspace/test_objspace.rb
+	  (test_trace_object_allocations_start_stop_clear): clear object
+	  allocation table first to get rid of erroneous detection for obj3.
+	  [ruby-dev:49095] [Bug #11271]
+
+Thu Oct 15 01:53:38 2015  Benoit Daloze  <eregontp@gmail.com>
+
+	* test/ostruct/test_ostruct.rb: Add tests for OpenStruct#respond_to.
+	  Patch by @jeremy in [GH-1041]: https://github.com/ruby/ruby/pull/1041
+
+Thu Oct 15 01:49:25 2015  Benoit Daloze  <eregontp@gmail.com>
+
+	* lib/ostruct.rb: Finish defining OpenStruct attributes lazily.
+	  Patch by @sferik in [GH-1037]: https://github.com/ruby/ruby/pull/1037
+	  This commit is an addendum to https://github.com/ruby/ruby/pull/1033.
+	  It:
+	  1. lazily defines attribute accessors for copied and marshaled objects,
+	  2. returns nil when an attribute reader is not defined, and
+	  3. defines respond_to_missing? to maintain the same respond_to? behavior
+
+Wed Oct 14 16:56:50 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in: check for libunwind.h, which is not available in
+	  very old OS X SDK.  [ruby-core:71080] [Bug #11591]
+
+Wed Oct 14 14:11:42 2015  Brian Black  <bblack@veracode.com>
+
+	* iseq.c (rb_insn_operand_intern): change kw in callinfo disasm from the
+	  number of keyword arguments to an ordered list of the keywords used.
+	  [Feature #11589]
+
+Wed Oct 14 13:58:44 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (parser_nextc): send a warning to ripper, not to STDERR
+	  always.
+
+	* parse.y (rb_warn1, rb_warning1): move argument conversions to
+	  callers.  PRIsVALUE is not valid in String#%.
+
+Wed Oct 14 13:37:23 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/racc/rdoc/grammar.en.rdoc: fix spell error.
+	  [fix GH-1053][ci skip] Patch by @Matrixbirds
+
+Tue Oct 13 22:06:50 2015  Tanaka Akira  <akr@fsij.org>
+
+	* ext/socket/raddrinfo.c (rsock_fd_family): Check sa_len.
+
+Tue Oct 13 12:14:10 2015  Craig Davison  <craig65535@gmail.com>
+
+	* ext/socket/rsock_addrinfo (rsock_addrinfo): specify address
+	  family.  [Fix GH-1052]
+
+	* ext/socket/udpsocket.c (udp_connect, udp_bind, udp_send):
+	  address family by the receiver.
+
+Sun Oct 11 07:09:19 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c (vm_push_frame): initialize other than sp (and ep)
+	  first for performance.
+
+Sun Oct 11 06:21:50 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_eval.c, internal.h (rb_yield_1): added for performance which
+	  doesn't check Qundef.
+
+	* numeric.c (int_dotimes): use rb_yield_1.
+
+Sun Oct 11 06:19:49 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c (vm_call_iseq_setup_normal): setup sp first
+	  for performance.
+
+Sun Oct 11 05:29:51 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm.c (invoke_block_from_c): split this function into several
+	  functions.
+
+	* vm_insnhelper.c (vm_yield_callee_setup_arg): remove this function
+	  because it is only delegation function.
+
+Sun Oct 11 03:48:46 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (newobj_of_slowpass): fix typo (pass -> path).
+	  Pointed out by Yukihiro Matsumoto  <matz@ruby-lang.org>.
+
+	* gc.c (newobj_of_...): `of' is unnecessary.
+
+Sat Oct 10 19:04:42 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/socket/udpsocket.c (udp_connect, udp_bind): get open files
+	  inside ensure functions.
+
+Sat Oct 10 18:35:12 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c (vm_call_method0): do not propagate enable_fastpath,
+	  but pass dummy CC to prevent wrong caching.
+
+Sat Oct 10 15:28:45 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* import a github pull request
+	  https://github.com/ruby/ruby/pull/1050
+	  by Kazuho Oku <kazuho@natadeco.co>.
+
+	  This pull request has the following commits.
+
+	* gc.c: reduce # of args to 6 (max. of register args on x86-64) so
+	  that the `newobj_of_slowpass` can be called via TCO.
+
+	* gc.c (newobj_of), string.c (str_duplicate): for performance,
+	  the hot functions must be inlined.
+
+	* gc.c: for performance, preceding arguments of `.*newobj_of.*`
+	  must be same, so that the arg registers can be reused in case of
+	  TCO.
+
+Sat Oct 10 08:52:21 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/socket/udpsocket.c (udp_connect, udp_bind, udp_send): fix
+	  memory leaks at closed socket.
+
+Fri Oct  9 17:29:07 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/ftp.rb (parse257): refactor.
+
+Fri Oct  9 16:42:26 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/imap.rb: use frozen_string_literal: true.
+
+	* test/net/imap/test_imap.rb: ditto.
+
+	* test/net/imap/test_imap_response_parser.rb: ditto.
+
+Fri Oct  9 15:52:28 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/ftp.rb: use frozen_string_literal: true.
+
+	* test/net/ftp/test_buffered_socket.rb: ditto.
+
+	* test/net/ftp/test_ftp.rb: ditto.
+
+	* test/net/ftp/test_mlsx_entry.rb: ditto.
+
+Fri Oct  9 14:12:35 2015  Shota Fukumori (sora_h)  <her@sorah.jp>
+
+	* ext/openssl/lib/openssl/ssl.rb: Revert r52082 because it was
+	  dropping TLS v1.1 support too. Supporting only TLS v1.2 is too
+	  early, because many popular websites still don't support it.
+
+	  For instance, Servers where aws-sdk connects to still don't support
+	  TLS v1.2 and it became broken.
+
+	  We should consider more carefully about this.
+
+	  [Fix GH-873] [Feature #11524]
+
+Fri Oct  9 12:52:08 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* compile.c (iseq_compile_each): Dynamic string literals (e.g.,
+	  "#{x}") should not be frozen because they don't literally
+	  represent strings.
+	  https://twitter.com/shugomaeda/status/651937650027401216
+	  https://twitter.com/yukihiro_matz/status/651942882312482817
+	  https://twitter.com/yukihiro_matz/status/651980835181096960
+
+Fri Oct  9 06:52:49 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* benchmark/prepare_require.rb: skip file creation if it already
+	  exist. Suggested by ko1.
+
+Fri Oct  9 06:18:04 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+	* benchmark/bm_require.rb: new benchmark for require.
+	* benchmark/bm_require_thread.rb: new benchmark for conflicting
+	  require vs thread. like [Bug #11559]
+	* prepare_require.rb: new file for preparing above tests.
+	* prepare_require.rb: ditto.
+
+Thu Oct  8 14:10:45 2015  Zachary Scott  <zzak@ruby-lang.org>
+
+	* ext/openssl/lib/openssl/ssl.rb: Default to TLSv1.2 and drop TLS v1
+	  Patch provided by @claudijd [Fixes GH-873] [Feature #11524]:
+	  https://github.com/ruby/ruby/pull/873
+
+Wed Oct  7 22:55:02 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* test/minitest/metametameta.rb (with_output): restore output to
+	  fix mixing test result output in worker responses.
+
+Wed Oct  7 21:32:51 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (str_duplicate): move from rb_str_resurrect to short
+	  circuit initialization.
+
+Wed Oct  7 20:43:14 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (rb_str_resurrect): fix resurrection of short enough to
+	  be embedded but not embedded string.
+
+Wed Oct  7 20:17:29 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (newobj_of): divide fast path and slow path
+	  to avoid register savings for fast path.
+
+	  This idea is given by Kazuho Oku <kazuho@natadeco.co>.
+
+Wed Oct  7 17:30:50 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (rb_str_times): optimize for the argument 0 and 1.
+
+Wed Oct  7 01:20:46 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.h, gc.c: introduce new debug function rb_obj_info_dump(VALUE obj)
+	  which prints the result of rb_raw_obj_info(..., obj).
+
+Wed Oct  7 01:16:11 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_args.c: remove an unused field args_info::calling.
+
+Tue Oct  6 23:43:10 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* proc.c (rb_method_entry_min_max_arity): should support
+	  OPTIMIZED_METHOD_TYPE_CALL.
+
+Tue Oct  6 21:29:08 2015  Tanaka Akira  <akr@fsij.org>
+
+	* lib/tmpdir.rb (Dir.tmpdir): return duplicated string to be
+	  modify safely even when $SAFE > 0.
+
+Tue Oct  6 19:24:38 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c (vm_call_method0): use switch() for visibilities
+	  (for readability).
+
+Tue Oct  6 19:23:58 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* proc.c (Init_Proc): Proc#call and others should be public.
+
+Tue Oct  6 18:51:51 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* method.h: IMEMO_FL_USER3 and IMEMO_FL_USER4 is not needed any more.
+
+Tue Oct  6 18:47:45 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* method.h: remove METHOD_ENTRY_SAFE(me) and related code
+	  because $SAFE = 3 and 4 is not available.
+	  Now, $SAFE is not checked on method dispatch at all.
+
+	* vm_eval.c, vm_insnhelper.c, vm_method.c: ditto.
+
+Tue Oct  6 13:56:14 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* include/ruby/ruby.h: turn function macros into inline functions,
+	  for debuggers.
+
+	* include/ruby/ruby.h: turn constant macros into enums, for
+	  debuggers.
+
+Tue Oct  6 13:48:05 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* method.h: typo fix. Patch by @davydovanton [fix GH-1032][ci skip]
+
+Tue Oct  6 06:54:34 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* iseq.c (rb_iseq_free): free iseq::variable_body to avoid memory
+	  leak.
+
+Tue Oct  6 06:32:52 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* proc.c: enable optimization of Proc#call.
+	  [Feature #11569]
+
+	* NEWS: write about this optimization and incompatibilities.
+
+	* test/ruby/test_backtrace.rb: catch up this fix.
+
+Tue Oct  6 04:41:03 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c: solve goto spaghetti.
+
+	  Change all goto statement across blocks to tail call functions.
+
+Tue Oct  6 02:29:38 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (rb_str_resurrect): optimize by short circuit to copy
+	  hidden string without checking length, encoding and so on.
+
+Mon Oct  5 23:08:17 2015  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+
+	* test/ruby/test_thread.rb (test_handle_interrupt_blocking): check if
+	  exception handling was postponed until sleep.
+
+Mon Oct  5 22:25:49 2015  Tanaka Akira  <akr@fsij.org>
+
+	* lib/pp.rb: Use frozen_string_literal: true.
+
+	* lib/prettyprint.rb: Ditto.
+
+	* lib/resolv.rb: Ditto.
+
+	* lib/tmpdir.rb: Ditto.
+
+	* test/test_pp.rb: Ditto.
+
+	* test/test_prettyprint.rb: Ditto.
+
+	* tool/transcode-tblgen.rb: Ditto.
+
+Mon Oct  5 20:39:32 2015  Benoit Daloze  <eregontp@gmail.com>
+
+	* test/ruby/test_thread.rb: fix potential race condition.
+	  The thread could have a "sleep" status because it tries
+	  to acquire the mutex, but does not have it yet.
+
+Mon Oct  5 15:39:30 2015  Zachary Scott  <zzak@ruby-lang.org>
+
+	* numeric.c: [DOC] Overview for Numeric class by Joe Corcoran
+	  This patch was created at ROSSConf Berlin 2015 [Bug #11555]
+
+Mon Oct  5 15:34:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* proc.c (proc_new): link ep to calling block.
+	  [ruby-core:70980] [Bug #11566]
+
+Mon Oct  5 00:53:51 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (rb_dir_getwd): make ASCII-8BIT if filesystem encoding is
+	  US-ASCII, like as Dir.glob.
+
+Sun Oct  4 23:39:09 2015  Tanaka Akira  <akr@fsij.org>
+
+	* enum.c (nmin_filter): Fix limit value.
+	  patch by Helder Pereira.
+	  [Bug #11471] [ruby-core:70477]
+
+Sun Oct  4 15:11:48 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* enc/euc_jp.c (mbc_case_fold): check given string is valid or not,
+	  and if invalid, return 1. [Bug #11486]
+
+Sun Oct  4 10:09:57 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (rb_dir_getwd): normalize OS path to UTF-8 on OS X.
+
+Sun Oct  4 00:09:45 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* template/ruby-runner.c.in: wrapper to set dynamic loading path
+	  environment variable.  /bin/sh on Mac OS X 10.11 (El Capitan)
+	  clears DYLD_LIBRARY_PATH.
+
+	  it must:
+	  - do nothing even if current directory is not present
+	  - do not set other environment variables, e.g. PWD, SHLVL, etc
+	  - do not open other FDs, e.g. pipes for timer thread
+
+Sun Oct 2 10:59:00 2015  schneems  <richard.schneeman@gmail.com>
+
+	* ext/pathname/lib/pathname.rb: freeze string literals for
+	  reduced object allocation.
+	  [Feature #11375] [ruby-core:70043]
+
+Fri Oct  2 09:20:20 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
+
+	* common.mk, lib/unicode_normalize/tables.rb: Change Unicode
+	  Version for character normalization data from 7.0.0 to
+	  8.0.0.
+
+Fri Oct  2 00:18:39 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* proc.c (proc_mark): block.ep of Proc from Symbol is now NULL.
+	  [ruby-core:70961] [Bug #11560]
+
+Wed Sep 30 15:47:13 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_args.c (vm_caller_setup_arg_block): bypass Symbol#to_proc
+	  call to optimize symbol block passing.
+
+Wed Sep 30 01:34:34 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (parser_free): fix memory leak at syntax error when
+	  warn-indent is enabled.
+
+Tue Sep 29 22:27:50 2015  Benoit Daloze  <eregontp@gmail.com>
+
+	* parse.y: fix minor typo. [ci skip][fix GH-1038].
+	  Patch by @ltratt.
+
+Tue Sep 29 16:53:53 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
+
+	* tool/unicode_norm_gen.tmpl, lib/unicode_normalize/tables.rb:
+	  get rid of many .freeze commands by using frozen_string_literal
+	  pragma.
+
+Tue Sep 29 16:37:29 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (compile_dstr_fragments): fix performance by omitting
+	  the first empty string only for keeping literal encoding if
+	  other literals are too.  [ruby-core:70930] [Bug #11556]
+
+	* string.c (rb_str_append_literal): append but keep encoding non
+	  US-ASCII.
+
+Mon Sep 28 17:40:17 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/ftp.rb (mtime): use usec instead of fractions to parse
+	  decimal fractions of a second correctly when the number of digits
+	  is not 6.
+
+Mon Sep 28 16:07:08 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/ftp.rb (mtime): parse decimal fractions of a second as
+	  specified in RFC 3659.
+
+Mon Sep 28 10:31:12 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* test/test_forwardable.rb: Write basic tests for lib/forwardable.
+	  [fix GH-1035] Patch by @kachick
+
+Sun Sep 27 23:32:46 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* class.c (rb_define_class, rb_define_class_id_under): refine
+	  error messages.
+
+	* class.c (rb_define_module, rb_define_module_id_under): ditto,
+	  and make consistent with class.
+
+Sun Sep 27 18:44:43 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ChangeLog: removed duplicated message.
+
+Sun Sep 27 15:46:58 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ruby.c (process_options): add an option to enable/disable
+	  frozen-string-literal.  [Feature #8976]
+
+	* compile.c (iseq_compile_each): override compile option by option
+	  given by pragma.
+
+	* iseq.c (rb_iseq_make_compile_option): extract a function to
+	  overwrite rb_compile_option_t.
+
+	* parse.y (parser_set_compile_option_flag): introduce pragma to
+	  override compile options.
+
+	* parse.y (magic_comments): new pragma "frozen-string-literal".
+	  [Feature #8976]
+
+Sun Sep 27 08:16:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/ostruct.rb (delete_field): do not raise NameError for
+	  existing keys.  [Fix GH-1033]
+
+Sun Sep 27 00:34:31 2015  Zachary Scott  <zzak@ruby-lang.org>
+
+	* lib/ostruct.rb: Move method definitions for getter/setter to be lazy
+	  Patch by @sferik in [GH-1033]: https://github.com/ruby/ruby/pull/1033
+
+Fri Sep 25 10:07:25 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/net/http.rb: removed unused variable. It's removed at r13648.
+	  [fix GH-1022] Patch by @nkondratyev
+
+Fri Sep 25 09:48:27 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* gems/bundled_gems: upgrade to minitest-5.8.1
+
+Fri Sep 25 09:47:12 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* id_table.c: fix typo. [ci skip][fix GH-1031] Patch @davydovanton
+
+Fri Sep 25 07:54:05 2015  Rei Odaira  <Rei.Odaira@gmail.com>
+
+	* test/gdbm/test_gdbm.rb (TestGDBM#test_s_open_lock): skip
+	  this test on AIX. The issue is the same as on Solaris.
+	  [ruby-dev:47631]
+
+Thu Sep 24 17:25:09 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (paren_args): fix separator token at `foo::bar()` in
+	  ripper.
+
+Thu Sep 24 00:00:17 2015  Rei Odaira  <Rei.Odaira@gmail.com>
+
+	* complex.c: ruby/config.h must be included before math.h
+	  because it defines _LARGE_FILES on AIX and _LARGE_FILES
+	  must be defined before sys/types.h is included from math.h.
+	  [Bug #11483]
+
+Wed Sep 23 22:22:38 2015  Zachary Scott  <zzak@ruby-lang.org>
+
+	* ext/openssl/ossl_pkcs12*: Remove svn commit id macro
+
+Wed Sep 23 01:11:28 2015  Zachary Scott  <zzak@ruby-lang.org>
+
+	* ext/openssl/*: Remove svn commit id macros to make sync easier
+
+Tue Sep 22 04:20:01 2015  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+
+	* test/drb/test_drb.rb: Run Rinda/DRb tests on localhost. [Fix GH-1027]
+	  patch by voxik.
+
+	* test/rinda/test_rinda.rb: ditto
+
+Mon Sep 21 20:53:39 2015  tbpgr  <tbpgr@tbpgr.jp>
+
+	* test/win32ole/test_win32ole_event.rb: fix typo.
+	  swbemsink_avairable? => swbemsink_available?  [Fix GH-1025]
+
+Sun Sep 20 10:07:35 2015  Anton Davydov  <antondavydov.o@gmail.com>
+
+	* cont.c (rb_callcc): [DOC] append continuations example accros
+	  methods.  [Fix GH-1026]
+
+Sun Sep 20 03:20:21 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* iseq.c (rb_iseq_free): free rb_iseq_t::body::cc_entries.
+
+Sun Sep 20 02:46:34 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: split rb_call_info_t into several structs.
+	  * rb_call_info (ci) has compiled fixed information.
+	  * if ci->flag & VM_CALL_KWARG, then rb_call_info is
+	    also rb_call_info_with_kwarg. This technique reduce one word
+	    for major rb_call_info data.
+	  * rb_calling_info has temporary data (argc, blockptr, recv).
+	    for each method dispatch. This data is allocated only on
+	    machine stack.
+	  * rb_call_cache is for inline method cache.
+
+	  Before this patch, only rb_call_info_t data is passed.
+	  After this patch, above three structs are passed.
+
+	  This patch improves:
+	  * data locality (rb_call_info is now read-only data).
+	  * reduce memory consumption (rb_call_info_with_kwarg,
+	    rb_calling_info).
+
+	* compile.c: use above data.
+
+	* insns.def: ditto.
+
+	* iseq.c: ditto.
+
+	* vm_args.c: ditto.
+
+	* vm_eval.c: ditto.
+
+	* vm_insnhelper.c: ditto.
+
+	* vm_insnhelper.h: ditto.
+
+	* iseq.h: add iseq_compile_data::ci_index and
+	  iseq_compile_data::ci_kw_index.
+
+	* tool/instruction.rb: introduce TS_CALLCACHE operand type.
+
+Sun Sep 20 02:18:10 2015  Tanaka Akira  <akr@fsij.org>
+
+	* test/lib/envutil.rb: mkfifo command based File.mkfifo method
+	  definition removed.
+
+Fri Sep 18 20:11:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* file.c (rb_file_s_mkfifo): implement File.mkfifo.
+	  [Feature #11536]
+
+Fri Sep 18 16:56:19 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* NEWS: add Net::FTP#mlst and Net::FTP#mlsd.
+
+Fri Sep 18 07:39:22 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/objspace/objspace_dump.c (obj_type): add IMEMO types to the heap
+	  dump information.
+
+Thu Sep 17 22:33:07 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* common.mk: fix command error with outside builddir.
+
+Thu Sep 17 17:42:09 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* common.mk: separated test for test-framework from test-all task.
+	  They should be invoke at first before tests of test-all.
+
+Thu Sep 17 12:05:54 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* test/ruby/test_dir.rb (TestDir#test_fileno): s/?x/"x"/. Don't
+	  use tricky code, please.
+
+Wed Sep 16 20:49:56 2015  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
+
+	* encindex.h: fix typo of last #endif comment. [ci skip]
+
+Wed Sep 16 20:39:26 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* variable.c (set_const_visibility): fail if the class/module is
+	  frozen.  [ruby-core:70828] [Bug #11532]
+
+Wed Sep 16 17:16:43 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_core.h (ENABLE_VM_OBJSPACE): enable per-VM object space on
+	  Windows by default, as rb_w32_sysinit() no longer depends on
+	  ruby_xmalloc.
+
+Wed Sep 16 15:08:17 2015  Akinori MUSHA  <knu@iDaemons.org>
+
+	* doc/syntax/literals.rdoc (Strings): [DOC] Revise the character
+	  literal part.
+
+Wed Sep 16 14:55:33 2015  Akinori MUSHA  <knu@iDaemons.org>
+
+	* doc/syntax/literals.rdoc (Strings): [DOC] Document the full list
+	  of supported escape sequences in string literals.
+
+Wed Sep 16 14:49:58 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (rb_str_setbyte): keep the code range as possible.
+
+Wed Sep 16 13:23:48 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* doc/syntax/literals.rdoc (Strings): mention about ?a literal.
+
+Wed Sep 16 12:06:53 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* dir.c (glob_helper): check pathtype once again by lstat(2) if
+	  dp->d_type is DT_UNKNOWN. XFS may return DT_UNKNOWN.
+
+Wed Sep 16 03:49:19 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* test/ruby/test_thread.rb (TestThread#test_mutex_synchronize):
+	  insert waste loop for invoking preemptive thread context switch.
+	  [Bug #11496]
+
+Tue Sep 15 19:38:55 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* gc.c (rb_objspace_alloc, rb_objspace_free): define always
+	  regardless ENABLE_VM_OBJSPACE, and free heap pages.
+
+Tue Sep 15 15:15:41 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* win32/win32.c (rb_w32_sysinit, rb_w32_readdir): compare by
+	  encoding index to get rid of encoding initialization before VM
+	  object space allocation.
+
+	* dir.c (fundamental_encoding_p, push_glob): compare by encoding
+	  index immediately.
+
+	* enc/{ascii,us_ascii,utf_8}.c: set encoding indexes of
+	  fundamental built-in encodings so that usable as well as
+	  allocated rb_encoding before rb_enc_init().
+
+	* encindex.h: separate encoding index constants from internal.h.
+
+Tue Sep 15 13:13:13 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* array.c (rb_ary_sort_bang, rb_ary_sort): [DOC] correct block
+	  return values, which may be a negative or positive integer, not
+	  only -1 or +1.
+
+Tue Sep 15 12:49:10 2015  Jason Barnabe  <jason.barnabe@gmail.com>
+
+	* array.c (rb_ary_sort_bang, rb_ary_sort): [DOC] Correct
+	  description of array sort block return values.  And also fix up
+	  the grammar a bit.  [Fix GH-1020]
+
+Tue Sep 15 12:44:32 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* util.c (ruby_qsort): use BSD-style qsort_r if available.
+
+Mon Sep 14 19:26:34 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/ftp.rb (parse_mlsx_entry): parse pathnames including
+	  space correctly.
+
+Mon Sep 14 11:12:10 2015  Anton Davydov  <antondavydov.o@gmail.com>
+
+	* lib/racc/rdoc/grammar.en.rdoc: [DOC] fix typo, "convertion" to
+	  "conversion".  [Fix GH-1016]
+
+Sun Sep 13 11:03:13 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* include/ruby/ruby.h: prefix RUBY or RB to global symbols to get
+	  rid of name conflicts with other headers.
+
+	* include/ruby/encoding.h, include/ruby/intern.h: ditto.
+
+Sun Sep 13 09:38:51 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/ftp.rb (size, modify, create, type, unique, perm, lang,
+	  media_type, charset): new methods to return standard facts.
+
+Sat Sep 12 19:43:49 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c (vm_call_iseq_setup_normal): do not clear local
+	  variables here. vm_push_frame() clears.
+
+	* vm_insnhelper.c (vm_call_iseq_setup_tailcall): ditto.
+
+	* vm_insnhelper.c (vm_push_frame): move check code to
+	  vm_check_frame().
+
+	  Reorder initialization timing to reuse same values (sp).
+
+	* compile.c (rb_iseq_compile_node): use
+	  iseq_set_exception_local_table() for ISEQ_TYPE_DEFINED_GUARD.
+
+Sat Sep 12 23:06:51 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/ftp.rb (file?, directory?, appendable?, creatable?,
+	  deletable?, enterable?, renamable?, listable?, directory_makable?,
+	  purgeable?, readable?, writable?): new methods.
+
+Sat Sep 12 21:27:22 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/ftp.rb (FACT_PARSERS): support system dependent facts
+	  UNIX.mode, UNIX.owner, UNIX.group, UNIX.ctime, and UNIX.atime.
+
+Sat Sep 12 19:08:58 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* win32/win32.c (rb_w32_dup2): should return the new fd on
+	  success, while msvcrt returns 0 wrongly.
+
+Sat Sep 12 18:14:11 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/ftp.rb (parse_mlsx_entry, mlst) raise an FTPProtoError
+	  when parsing failed.
+
+Sat Sep 12 18:00:35 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/ftp.rb (TIME_PARSER): use "Z" instead of "+00:00" to
+	  get UTC time.  Thanks, Wilson Bilkovich.
+
+Sat Sep 12 17:55:24 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/ftp.rb (mlst, mlsd): support new commands MLST and MLSD
+	  specified in RFC 3659.
+
+Sat Sep 12 16:14:31 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* file.c: access()/eaccess() wrapping methods check more than just uid.
+	  [fix GH-1007][ci skip] Patch by @eam
+
+Sat Sep 12 16:07:01 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* README.md: improve markdown rendering for readability.
+	  [fix GH-1015][ci skip] Patch by @Matrixbirds
+
+Sat Sep 12 14:30:03 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* process.c (save_redirect_fd): make saved FDs close-on-exec not
+	  to be inherited.
+
+	* process.c (run_exec_dup2): restore close-on-exec flags too.
+
+	* win32/win32.c (fcntl): implement F_GETFD, F_SETFD, and
+	  F_DUPFD_CLOEXEC.
+
+Sat Sep 12 05:35:24 2015  Eric Wong  <e@80x24.org>
+
+	* rational.c (string_to_r_strict): preserve encoding in exception
+
+Fri Sep 11 20:23:35 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: remove rb_call_info_t::aux.opt_pc.
+
+	* vm_insnhelper.c: introduce shortcut functions for opt_pc == 0
+	  because opt_pc is always 0 on shortcut function.
+
+Fri Sep 11 17:49:36 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* iseq.c: disable ISeq.load. It enabled accidentally at r51794.
+
+Fri Sep 11 11:15:12 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/ftp.rb (size, mdtm, system): parse responses according to
+	  RFC 959 and 3659, where reply codes must be followed by SP.
+
+	* lib/net/ftp.rb (system): remove LF from the return value.
+
+Thu Sep 10 22:48:49 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (literal_concat_gen, evstr2dstr_gen): keep literal
+	  encoding beginning with an interpolation same as the source file
+	  encoding.  [ruby-core:70703] [Bug #11519]
+
+Thu Sep 10 22:15:51 2015  Joe Rafaniello  <jrafanie@redhat.com>
+
+	* process.c (rb_f_spawn): Be more specific regarding "other
+	  values" by having "non-zero positive integers" Add nil, the
+	  default value, as a possible value and what it means.
+
+	  Try to use more consistent language.
+	  [Fix GH-1008]
+
+Thu Sep 10 15:16:02 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/ftp.rb (getmultiline): refactor.
+
+Thu Sep 10 12:17:28 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (iseq_build_from_ary_body): register cdhash to the
+	  iseq constant body instead of compile time mark array, not to
+	  get GCed.  [ruby-core:70708] [Feature #8543]
+
+Wed Sep  9 18:16:14 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* lib/rubygems/stub_specification.rb (Gem::StubSpecification#data):
+	  should not change the value of $. when `require`ing gems.
+	  this fixed test failures introduced by r51813.
+
+Wed Sep  9 16:55:45 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ruby.c (usage, enable_option, disable_option, process_options): new
+	  option `--disable-did_you_mean`.
+
+	* gem_prelude.rb: now requires did_you_mean gem by default if available.
+
+Wed Sep  9 13:38:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* tool/extlibs.rb (do_patch): let "patch" command change the
+	  working directory and open the patch file there, instead of
+	  spawn options, so that proper error message will be shown by the
+	  command not just "chdir" or "open".
+
+Wed Sep  9 11:33:05 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* common.mk (update-gems): use BASERUBY instead of RUNRUBY.
+
+Wed Sep  9 11:08:59 2015  Zachary Scott  <zzak@ruby-lang.org>
+
+	* lib/delegate.rb: Remove backtrace cleaning for delegated methods
+	  This patch was provided by Rafael Franca and greatly improves
+	  performance when an exception is raised. [Bug #11461]
+
+Wed Sep  9 10:05:41 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* test/rubygems/test_config.rb: fix broken tests for Windows platform.
+
+Wed Sep  9 07:46:32 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/rubygems: Update to RubyGems HEAD(fe61e4c112).
+	  this version contains new feature that warn invalid SPDX license
+	  identifiers. https://github.com/rubygems/rubygems/pull/1249
+	  and #1032, #1023, #1332, #1328, #1306, #1321, #1324
+	* test/rubygems: ditto.
+
+Tue Sep  8 23:17:36 2015  Yuki Nishijima  <mail@yukinishijima.net>
+
+	* gems/bundled_gems: Upgrade the did_you_mean gem to 1.0.0.beta2.
+
+Tue Sep  8 23:09:28 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (rb_io_s_popen): do not wait the child process during being
+	  killed.  [ruby-core:70671] [Bug #11510]
+
+Tue Sep  8 22:18:04 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* gems/bundled_gems: revert because ruby trunk never be able to install
+	  the did_you_mean gem.  retry after enough test.
+
+Tue Sep  8 21:48:22 2015  Yuki Nishijima  <mail@yukinishijima.net>
+
+	* gems/bundled_gems: Automatically install the did_you_mean gem
+	  as a bundled gem.  [Feature #11252]
+
+Tue Sep  8 17:17:48 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: remove rb_call_info_t::blockiseq.
+
+	* insns.def (send, invokesuper): pass blockiseq explicitly.
+
+	* compile.c: catch up this fix.
+
+	* iseq.c: ditto.
+
+	* vm_args.c: ditto.
+
+	* iseq.c (ISEQ_MINOR_VERSION): 2->3 because instruction spec was
+	  changed.
+
+Tue Sep  8 15:01:19 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/ftp.rb (list): fetch all the lines before yielding a block
+	  to allow other commands in the block.  [Feature #11454]
+	  Patched by Srikanth Shreenivas.
+
+Tue Sep  8 12:05:00 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (rb_w32_read_reparse_point): return correct required
+	  buffer size for IO_REPARSE_TAG_MOUNT_POINT.
+
+Tue Sep  8 00:14:43 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* process.c (rb_execarg_parent_start1): raise with the target path
+	  name when open() failed.
+
+Mon Sep  7 23:45:28 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* process.c (rb_exec_fail): raise with the target directory name
+	  when chdir() failed.  pointed out by sorah.
+
+Mon Sep  7 22:05:28 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* win32/win32.c (insert): should use plain strdup() instead of
+	  ruby_strdup() at startup time, and plain free()ed in cmdglob().
+
+Mon Sep  7 16:49:30 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_core.h (rb_vm_struct): define objspace always regardless
+	  ENABLE_VM_OBJSPACE.
+
+Mon Sep  7 15:54:58 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ruby_atomic.h (ATOMIC_VALUE_CAS): fix typo.
+	  TODO: make arguments of all CAS macros consistent.
+
+Sun Sep  6 16:07:22 2015  Eric Wong  <e@80x24.org>
+
+	* ccan/list/list.h: suppress unused argument warnings
+	  [ccan commit 6aaca17e07588997417a73fac19dcf0ff17ed81b]
+
+Sat Sep  5 11:39:52 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/rss/rss.rb (Time#w3cdtf): fix zero-trimmed width of fraction
+	  digits.  [ruby-core:70667] [Bug #11509]
+
+Sat Sep  5 08:28:58 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* hash.c (rb_hash_equal, rb_hash_eql): [DOC] the orders of each
+	  hashes are not compared.  [Bug #11508]
+
+Fri Sep  4 23:26:22 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* include/ruby/win32.h: fix macro name for VC runtime version,
+	  RT_VER is only in Makefile.
+
+Fri Sep  4 17:46:17 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* doc/contributing.rdoc: fix configuration option.
+	  [ci skip] [fix GH-1009]
+
+Fri Sep  4 04:46:54 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* iseq.c (iseq_memsize): functions for wrapper object should have
+	  iseqw_ prefix.
+
+Thu Sep  3 21:12:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/cgi/session.rb (create_new_id): use SHA512 instead of MD5.
+	  pointed out by SARWAR JAHAN.
+
+Thu Sep  3 20:29:18 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (rb_raw_obj_info): iseq->body->location.first_lineno is Fixnum.
+
+Thu Sep  3 17:54:26 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_eval.c (raise_method_missing): "names" should be singular.
+	  pointed out by Filip Bartuzi.
+
+Thu Sep  3 17:50:09 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (rb_raw_obj_info): should support IMEMO/iseq.
+
+Thu Sep  3 10:07:49 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_eval.c (raise_method_missing): refine error messages when a
+	  symbol is not given.  [Fix GH-1013]
+
+Wed Sep  2 18:49:55 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ext/psych/*: merge psych master(8737e5b). It contains following fixes.
+	  https://github.com/tenderlove/psych/pull/242
+	  https://github.com/tenderlove/psych/pull/246 [ruby-list:50219]
+	* test/psych/*: ditto.
+
+Wed Sep  2 18:04:13 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.h (GET_PC_COUNT): remove unused macro.
+
+Wed Sep  2 17:18:37 2015  Chris Schneider  <chris@christopher-schneider.com>
+
+	* process.c (proc_detach): [DOC] fix typo "intent" as "intend" in
+	  rdoc.  [Fix GH-1011]
+
+Wed Sep  2 16:58:21 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* file.c (rb_realpath_internal): use filesystem encoding if the
+	  argument is in ASCII encodings.
+
+	* win32/file.c (rb_readlink): needs the result encoding.
+
+Tue Sep  1 18:37:15 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* test/thread/test_queue.rb: catch up last commit.
+
+Tue Sep  1 18:16:32 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* thread_sync.c (queue_do_close): ignore multiple close to allow
+	  multiple producers.
+	  https://bugs.ruby-lang.org/issues/10600#note-14
+
+Tue Sep  1 18:06:26 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* thread_tools.c: rename thread_tools.c to thread_sync.c.
+
+Mon Aug 31 17:04:45 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* class.c (move_refined_method): should insert a write barrier
+	  from an original class to a created (cloned) method entry.
+
+	* test/ruby/test_refinement.rb: add a test.
+
+Sun Aug 30 02:42:22 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/openssl/ossl_ssl.c (ossl_ssl_method_tab): Only add SSLv3 support
+	  if the SSL library supports it.  Thanks Kurt Roeckx <kurt@roeckx.be>
+	  [Bug #11376]
+
+	* ext/openssl/extconf.rb: check for SSLv3 support in the SSL
+	  implementation.
+
+	* test/openssl/test_ssl.rb (class OpenSSL): Skip tests that need SSLv3
+	  if there is no support.
+
+Fri Aug 28 16:05:09 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/rdoc/*: Update rdoc master(cfffed5)
+	  https://github.com/rdoc/rdoc/pull/337
+	  https://github.com/rdoc/rdoc/pull/367
+
+Fri Aug 28 10:16:20 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm.c (hook_before_rewind): prevent kicking :return event while
+	  finishing vm_exec func because invoke_block_from_c() kick a :return
+	  event for bmethods.
+	  [Bug #11492]
+
+	* test/ruby/test_settracefunc.rb: add a test.
+
+Thu Aug 27 18:05:42 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/webrick/server.rb: use IO::NULL instead of '/dev/null'
+	* test/ruby/test_string.rb: ditto.
+
+Thu Aug 27 15:24:57 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* compile.c (iseq_set_sequence): rename variable names
+	  to make it readable.
+
+Thu Aug 27 07:45:34 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* thread_tools.c: add Queue#close(exception=false) and
+	  SizedQueue#close(exception=false).
+	  [Feature #10600]
+
+	  Trying to deq from a closed empty queue return nil
+	  if exception parameter equals to false (default).
+
+	  If exception parameter is truthy, it raises
+	  ClosedQueueError (< StopIteration).
+	  ClosedQueueError inherits StopIteration so that you can write:
+
+	    loop{ e = q.deq; (using e) }
+
+	  Trying to close a closed queue raises ClosedQueueError.
+
+	  Blocking threads to wait deq for Queue and SizedQueue will be
+	  restarted immediately by returning nil (exception=false) or
+	  raising a ClosedQueueError (exception=true).
+
+	  Blocking threads to wait enq for SizedQueue will be
+	  restarted by raising a ClosedQueueError immediately.
+
+	  The above specification is not proposed specification, so that
+	  we need to continue discussion to conclude specification this
+	  method.
+
+	* test/thread/test_queue.rb: add tests originally written by
+	  John Anderson and modify detailed behavior.
+
+Wed Aug 26 10:52:02 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* re.c (rb_memsearch_wchar, rb_memsearch_qchar): test matching
+	  till the end of string.  [ruby-core:70592] [Bug #11488]
+
+	* test/ruby/test_m17n.rb (test_include?, test_index): add tests by
+	  Tom Stuart.
+
+Wed Aug 26 09:26:00 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* id_table.c (list_table_extend, hash_table_extend): remove C99
+	  features.  [ruby-dev:49239] [Bug #11487]
+
+Tue Aug 25 06:34:43 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* win32/win32.c (w32_symlink): implement symlink().
+
+Mon Aug 24 16:01:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* encoding.c (rb_locale_encindex): find encoding index without
+	  making a string object every time.  [ruby-core:58160] [Bug #9080]
+
+Sat Aug 22 15:43:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_eval.c (check_funcall_failed, check_funcall_missing): cache
+	  results of respond_to? and respond_to_missing?, and search a
+	  public method only for compatibility with rb_respond_to.
+
+Sat Aug 22 08:23:32 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* ext/thread/thread.c: move definitions of Queue, SizedQueue
+	  and ConditionalVariables to thread_tools.c. In other words,
+	  such classes are built-in.
+	  [Feature #8919]
+
+	  At first, I planned to embed only a Queue class.
+	  However, rubygems requires 'thread.rb' (rubygems are
+	  required at first, when launch MRI without --disable-gems).
+	  So most of people require 'thread.rb' as an embedded library.
+
+	  Now, ext/thread/thread.c is empty, only for a dummy for
+	  compatibility.
+
+	* thread.c: move a definition of Mutex class to thread_tools.c.
+
+	  And define Mutex class under Thread (so now Mutex is Thread::Mutex).
+	  Because other thread related classes are also defined under Thread.
+	  We remain ::Mutex as Thread::Mutex. Only an inspect result is changed.
+
+	* common.mk: add dependency from thread.o to thread_tools.c.
+
+Sat Aug 22 05:31:37 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_opts.h, iseq.c, iseq.h: add compile option to force frozen
+	  string literals.
+	  [Feature #11473]
+
+	  This addition is not specification change, but to try frozen
+	  string literal world discussed on [Feature #11473].
+
+	  You can try frozen string literal world using this magical line:
+
+	    RubyVM::InstructionSequence.compile_option =
+	      {frozen_string_literal: true}
+
+	  Note that this is a global compilation option, so that you need to
+	  compile another script like that:
+
+	    p 'foo'.frozen? #=> false
+	    RubyVM::InstructionSequence.compile_option =
+	      {frozen_string_literal: true}
+	    p 'foo'.frozen? #=> false, because this line is already compiled.
+	    p eval("'foo'.frozen?") #=> true
+
+	  Details:
+	    * String literals are deduped by rb_fstring().
+	    * Dynamic string literals ("...#{xyz}...") is now only frozen,
+	      not deduped. Maybe you have other ideas.
+
+	  Now, please do not use this option on your productions :)
+	  Of course, current specification can be changed.
+
+	* compile.c: ditto.
+
+	* test/ruby/test_iseq.rb: add a test.
+
+Sat Aug 22 02:53:12 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/psych/*: update to Psych 2.0.14
+
+	* test/psych/*: ditto
+
+Fri Aug 21 19:58:48 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* ext/objspace/objspace.c: add a new method ObjectSpace.count_symbols.
+	  [Feature #11158]
+
+	* symbol.c (rb_sym_immortal_count): added to count immortal symbols.
+
+	* symbol.h: ditto.
+
+	* test/objspace/test_objspace.rb: add a test for this method.
+
+	* NEWS: describe about this method.
+
+Fri Aug 21 19:48:17 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* win32/Makefile.sub ($(LIBRUBY_SO)): needs additional libraries
+	  for extension libraries to link statically.
+	  [ruby-core:70499] [Feature #9018]
+
+Fri Aug 21 18:49:22 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* include/ruby/ruby.h, cont.c, vm_trace.c: add a new event
+	  fiber_switch. We need more discussion about this feature
+	  so that I don't write it on NEWS.
+	  [Feature #11348]
+
+	* test/ruby/test_settracefunc.rb: add tests.
+
+Fri Aug 21 17:32:42 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c (vm_invoke_block): we should not expect ci->argc is
+	  stable after invoking a block. [Bug #11451]
+
+	* test/ruby/test_yield.rb: add a test. This test script is given by
+	  Alex Dowad.
+
+Fri Aug 21 06:35:50 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* test/openssl/test_ssl_session.rb: Fix tests so that they take in to
+	  account OpenSSL installations that have SSLv3 disabled by default.
+	  Thanks Jeremy Evans <code@jeremyevans.net> for the patches.
+	  [Bug #11366] [Bug #11367]
+
+Thu Aug 20 22:19:17 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_method.c (basic_obj_respond_to): call respond_to_missing?
+	  only when redefined.  [ruby-core:70460] [Bug #11465]
+
+Thu Aug 20 14:13:27 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_eval.c (check_funcall_respond_to): share the behavior with
+	  rb_obj_respond_to.  [ruby-core:70460] [Bug #11465]
+
+	* vm_method.c (vm_respond_to): extract from rb_obj_respond_to and
+	  merge r39881.
+
+Thu Aug 20 08:53:09 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_method.c (rb_obj_respond_to): reuse found method entry
+	  instead of searching same entry repeatedly.
+
+Thu Aug 20 08:31:17 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (replace_real_basename), win32/win32.c (opendir_internal):
+	  check reparse point tags and treat supported tags only as
+	  symbolic links.  [ruby-core:70454] [Bug #11462]
+
+Wed Aug 19 23:59:28 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): add OP_ALL to
+	  existing options rather than just setting it.  Some vendors apply
+	  custom patches to their versions of OpenSSL that set default values
+	  for options.  This commit respects the custom patches they've
+	  applied.
+
+	* test/openssl/test_ssl.rb (class OpenSSL): check that OP_ALL has been
+	  added to the options.
+
+Wed Aug 19 23:55:29 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* process.c (rb_f_spawn): [DOC] elaborate environment variable
+	  values.  [ruby-core:70456] [Bug #11463]
+
+Wed Aug 19 23:48:06 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* win32/win32.c (winnt_lstat): check reparse point tags and treat
+	  supported tags only as symbolic links.
+	  [ruby-core:70454] [Bug #11462]
+
+Tue Aug 18 20:05:49 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* thread_pthread.c (reserve_stack): ensure the memory is really
+	  allocated. [Bug #11457]
+
+Tue Aug 18 17:19:21 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (IS_BEG): include labeled argument state, which was
+	  EXPR_LABELARG.  [ruby-dev:49221] [Bug #11456]
+
+Tue Aug 18 16:16:21 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* include/ruby/ruby.h (RClass): define only in C, `__attribute__`
+	  between `struct` and the name can't compile with g++.
+	  [ruby-core:70297] [Bug #11426]
+
+Mon Aug 17 20:56:36 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y: fix syntax error at do-block after a conditional
+	  operator.  separate label-allowed and after-a-label states from
+	  others as bit flags.  [ruby-dev:48790] [Bug #10653]
+
+Mon Aug 17 11:57:36 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (rb_io_each_codepoint): raise an exception at incomplete
+	  character before EOF when conversion takes place.  [Bug #11444]
+
+Sun Aug 16 17:33:45 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* gems/bundled_gems: update latest version of bundled gems.
+	  It includes minitest-5.8.0 and test-unit 3.1.3.
+
+Sun Aug 16 17:24:10 2015  Kazuki Tsujimoto  <kazuki@callcc.net>
+
+	* gc.c (gc_mark_children): check if RCLASS_EXT is valid
+	  before marking. This fixes the following test failure
+	  introduced in r51126:
+
+	    make test-all TESTOPTS='--gc-stress ruby/test_refinement.rb'
+
+Sat Aug 15 10:51:08 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/win32/lib/win32/registry.rb (API#SetValue): data size should
+	  be in bytes, not in chars.  [ruby-core:70365] [Bug #11439]
+
+Sat Aug 15 10:15:20 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (rb_io_each_codepoint): read more data when read partially.
+	  [ruby-core:70379] [Bug #11444]
+
+Sat Aug 15 04:33:39 2015  Eric Wong  <e@80x24.org>
+
+	* hash.c (any_hash): skip rb_objid_hash for static syms
+	  (rb_num_hash_start): extract from rb_ident_hash
+	  (rb_objid_hash): call rb_num_hash_start
+	  (rb_ident_hash): ditto
+	  [ruby-core:70181] [Feature #11405]
+
+Sat Aug 15 04:16:13 2015  Eric Wong  <e@80x24.org>
+
+	* iseq.c (rb_iseq_mark): reduce NULL checks
+
+Fri Aug 14 18:50:57 2015  Eric Wong  <e@80x24.org>
+
+	* method.h (METHOD_ENTRY_VISI_SET): cast visi to int
+	  (METHOD_ENTRY_FLAGS_SET): ditto
+
+Fri Aug 14 18:43:11 2015  Eric Wong  <e@80x24.org>
+
+	* process.c (close_unless_reserved): add extra check
+	  (dup2_with_divert): remove
+	  (redirect_dup2): use dup2 without divert
+	  (before_exec_non_async_signal_safe): adjust call + comment
+	  (rb_f_exec): stop timer thread for all OSes
+	  (rb_exec_without_timer_thread): remove
+	* eval.c (ruby_cleanup): adjust call
+	* thread.c (rb_thread_stop_timer_thread): always close pipes
+	* thread_pthread.c (struct timer_thread_pipe): add writing field,
+	  mark owner_process volatile for signal handlers
+	  (rb_thread_wakeup_timer_thread_fd): check valid FD
+	  (rb_thread_wakeup_timer_thread): set writing flag to prevent close
+	  (rb_thread_wakeup_timer_thread_low): ditto
+	  (CLOSE_INVALIDATE): new macro
+	  (close_invalidate): new function
+	  (close_communication_pipe): removed
+	  (setup_communication_pipe_internal): make errors non-fatal
+	  (setup_communication_pipe): ditto
+	  (thread_timer): close reading ends inside timer thread
+	  (rb_thread_create_timer_thread): make errors non-fatal
+	  (native_stop_timer_thread): close write ends only, always,
+	   wait for signal handlers to finish
+	  (rb_divert_reserved_fd): remove
+	* thread_win32.c (native_stop_timer_thread): adjust (untested)
+	  (rb_divert_reserved_fd): remove
+	* vm_core.h: adjust prototype
+	  [ruby-core:70386] [Bug #11336]
+
+Fri Aug 14 18:40:43 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/win32/lib/win32/registry.rb (API#SetValue): add terminator
+	  size, not 1 byte.  [ruby-core:70365] [Bug #11439]
+
+Thu Aug 13 22:49:42 2015  Juanito Fatas  <katehuang0320@gmail.com>
+
+	* lib/timeout.rb (Timeout#timeout): freeze a string message to
+	  reduce string allocations.  [Fix GH-996]
+
+Thu Aug 13 17:42:34 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h (rb_call_info_kw_arg_bytes): move the definition
+	  to iseq.h because this function is shared with iseq.c and compile.c.
+
+Thu Aug 13 14:36:31 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* object.c (rb_num_to_dbl): move from num2dbl_with_to_f in math.c.
+
+Thu Aug 13 09:01:25 2015  Eric Wong  <e@80x24.org>
+
+	* load.c (features_index_add): avoid repeat calculation
+
+Wed Aug 12 21:57:31 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* id_table.c: IMPL() macro accept op as _opname instead of opname
+	  because jemalloc seems to replace the word `free' to `je_free'.
+
+Wed Aug 12 21:51:11 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* id_table.c (mix_id_table_insert): fix memory leak.
+
+Wed Aug 12 21:17:38 2015  Eric Wong  <e@80x24.org>
+
+	* iseq.c (iseq_memsize): reimplement for wrapper
+	  (param_keyword_size): extracted from iseq_memsize
+	  (iseqw_mark): new mark function
+	  (iseqw_data_type): new data type
+	  (iseqw_new): wrap as iseqw_data_type
+	  (iseqw_check): adjust for wrapper
+	  (Init_ISeq): remove iseqw_iseq_key initialization
+	* test/objspace/test_objspace.rb: new test
+	  [ruby-core:70344] [Feature #11435]
+
+Wed Aug 12 21:15:27 2015  Eric Wong  <e@80x24.org>
+
+	* vm_core.h (rb_call_info_kw_arg_bytes): extract from compile.c
+	* compile.c (iseq_build_callinfo_from_hash): use above function
+
+Wed Aug 12 18:00:17 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* class.c (move_refined_method): same as the last commit.
+
+Wed Aug 12 17:57:53 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* class.c, gc.c vm.c: use ID_TABLE_* instead of ST_*
+	  (such as ST_CONTINUE) for enum rb_id_table_iterator_result.
+
+Wed Aug 12 17:05:36 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* id_table.h: introduce ID key table.
+	  [Feature #11420]
+
+	  This table only manage ID->VALUE table to reduce overhead of st.
+
+	  Some functions prefixed rb_id_table_* are provided.
+
+	* id_table.c: implement rb_id_table_*.
+
+	  There are several algorithms to implement it.
+
+	  Now, there are roughly 4 types:
+
+	    * st
+	    * array
+	    * hash (implemented by  Yura Sokolov)
+	    * mix of array and hash
+
+	  The macro ID_TABLE_IMPL can choose implementation.
+	  You can see detailes about them at the head of id_table.c.
+
+	  At the default, I choose 34 (mix of list and hash).
+	  This is not final decision.
+	  Please report your suitable parameters or
+	  your data structure.
+
+	  * symbol.c: introduce rb_id_serial_t and rb_id_to_serial()
+	    to represent ID by serial number.
+
+	  * internal.h: use id_table for method tables.
+
+	  * class.c, gc.c, marshal.c, vm.c, vm_method.c: ditto.
+
+Wed Aug 12 05:19:11 2015  Eric Wong  <e@80x24.org>
+
+	* parse.y (rb_parser_compile_cstr): remove volatile arg
+	  (rb_parser_compile_string): ditto
+	  (rb_parser_compile_file): ditto
+	  (rb_parser_compile_string_path): ditto
+	  (rb_parser_compile_file_path): ditto
+	  [ruby-core:70323] [Misc #11431]
+
+Tue Aug 11 22:59:57 2015  Tanaka Akira  <akr@fsij.org>
+
+	* numeric.c (Init_Numeric): Fix document for Float::MIN and
+	  Float::EPSILON.
+
+Tue Aug 11 15:22:31 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* include/ruby/ruby.h (ALLOCV_N): check integer overflow, as well
+	  as ruby_xmalloc2.  pointed out by Paul <pawlkt AT gmail.com>.
+
+Tue Aug 11 14:57:09 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* array.c (rb_ary_repeated_permutation): fix buffer size, ALLOCV_N
+	  already multiplies element size.
+
+Tue Aug 11 12:13:20 2015  Jeremy Evans  <merch-redmine@jeremyevans.net>
+
+	* test/openssl/test_ssl.rb: Fix LocalJumpErrors being raised
+	  in OpenSSL tests. [ruby-core:70020][Bug #11368]
+
+Tue Aug 11 11:54:13 2015  Alexey Lipnyagov  <liptonshmidt@gmail.com>
+
+	* string.c: Fix documentation for String#slice
+	  [ruby-core:70298][Bug #11427]
+
+Tue Aug 11 11:53:28 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (superclass): make superclass rule optional and allow
+	  any contents without a terminator.  [EXPERIMENTAL]
+
+Tue Aug 11 10:58:42 2015  Juanito Fatas  <juanitofatas@gmail.com>
+
+	* string.c: [DOC] Make #end_with? example doc symmetry
+	  with #start_with? [fix GH-992][ci skip]
+
+Tue Aug 11 10:51:19 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* test/ruby/test_array.rb: Add test for `Array#flatten` with level 1
+	  [fix GH-986] Patch @yui-knk
+
+Tue Aug 11 10:48:16 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* enum.c: added doc for Enumerable#zip
+	  [fix GH-985] Patch by @yui-knk
+	* test/ruby/test_enum.rb: added tests for Enumerable#zip
+	  [fix GH-985] Patch @yui-knk
+
+Tue Aug 11 10:33:26 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* vm_method.c: typo fix [fix GH-993][ci skip] Patch by @0x0dea
+	* test/ruby/test_refinement.rb: ditto.
+
+Sun Aug  9 14:15:54 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm.c (Init_vm_objects, rb_vm_fstring_table): use frozen_strings
+	  table in rb_vm_t.  [ruby-core:70274] [Bug #11423]
+
+Sat Aug  8 03:59:51 2015  Zachary Scott  <zzak@ruby-lang.org>
+
+	* object.c: [DOC] Improve grammar for Module#===
+	  Patch by @SkyBirdSoar in documenting-ruby/ruby#52:
+	  https://github.com/documenting-ruby/ruby/pull/52
+
+Sat Aug  8 03:39:33 2015  Zachary Scott  <zzak@ruby-lang.org>
+
+	* hash.c: [DOC] Improve description of symbol key syntax
+	  Patch by Raphael Das Gupta in documenting-ruby/ruby#51:
+	  https://github.com/documenting-ruby/ruby/pull/51
+
+Fri Aug  7 21:04:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (parser_params): turn in_def and in_single into bit
+	  flags and reduce the size by 2-words.
+
+	* parse.y (parser_params): remove redundant prefixes.
+
+	* parse.y (yylex): non-pure parser has not been supported since
+	  merger of ripper.  change argument types from void pointers.
+
+Fri Aug  7 17:07:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* proc.c (method_super_method): uncallable method entry does not
+	  have the defined class, use the owner instead.
+	  [ruby-core:70254] [Bug #11419]
+
+	* test/ruby/test_method.rb (test_super_method_unbound): add test
+	  by Akira Matsuda.
+
+Thu Aug  6 10:49:57 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* node.c (rb_alloc_tmp_buffer): round up the size and check the
+	  range.
+
+	* ruby_atomic.h (ATOMIC_VALUE_EXCHANGE, ATOMIC_VALUE_CAS): add
+	  atomic operations for VALUE.
+
+Thu Aug  6 08:15:49 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): move
+	  SSLSocket#sysclose to Ruby.
+
+	* ext/openssl/ossl_ssl.c (ossl_ssl_close): ditto
+
+Thu Aug  6 07:57:21 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): move nonblock
+	  enable to SSLSocket#initialize and remove Nonblock module.
+
+Thu Aug  6 07:53:47 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): move
+	  OpenSSL::SSL::SSLSocket#initialize to Ruby.
+
+	* ext/openssl/ossl_ssl.c: ditto
+
+Thu Aug  6 02:25:31 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* node.c (rb_alloc_tmp_buffer): use NODE_ALLOCA to mark locations
+	  like as builtin alloca.  [ruby-core:70251] [Bug #11418]
+
+Wed Aug  5 14:37:55 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* transcode.c (rb_econv_open0): rb_econv_t::source_encoding_name
+	  and rb_econv_t::destination_encoding_name should refer static
+	  strings always or NULL.  [ruby-core:70247] [Bug #11416]
+
+Tue Aug  4 16:53:43 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): extract callback
+	  lookup to private Ruby methods. This means we can keep the default
+	  DH callback logic hidden from consumers.  Also, since the SSLSocket
+	  always has a context, we can remove conditionals about that
+	  instance.
+
+	* ext/openssl/ossl_ssl.c: move callback lookup methods to private Ruby
+	  methods.
+
+Tue Aug  4 16:40:26 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* test/ruby/test_module.rb: should not expect a method table ordering.
+	  [Feature #11414]
+
+Tue Aug 04 15:30:04 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* proc.c (rb_block_clear_env_self): clear by Qfalse instead of Qnil.
+	  [Bug #11409]
+
+	* test/ruby/test_eval.rb: add tests for this issue,
+	  written by @0x0dea.
+	  https://github.com/ruby/ruby/pull/988
+
+Tue Aug  4 12:12:14 2015  Eric Wong  <e@80x24.org>
+
+	* variable.c: wrap long lines
+
+Tue Aug  4 09:32:30 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* proc.c: Removing duplicate doc [fix GH-987][ci skip]
+	  Patch by @ronakjangir47
+
+Tue Aug  4 09:21:58 2015  Richard Schneeman  <richard.schneeman+foo@gmail.com>
+
+	* doc/contributing.rdoc: fixed wrong instructions with OS X
+	  [fix GH-989][ci skip] Patch by @schneems
+
+Mon Aug  3 10:08:33 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* re.c (rb_memsearch): should match only char boundaries in wide
+	  character encodings.  [ruby-core:70220] [Bug #11413]
+
+Sun Aug  2 07:01:17 2015  Eric Wong  <e@80x24.org>
+
+	* ext/openssl/lib/openssl/buffering.rb (gets):
+	  avoid comparing fixnum with nil
+	* test/openssl/test_pair.rb: test gets with limit when EOF is hit
+	  Thanks to Bar Hofesh <bar.hofesh@safe-t.com> for the bug report
+	  and testing.
+	  [ruby-core:70149] [Bug #11400]
+
+Sat Aug  1 17:13:15 2015  Kazuki Tsujimoto  <kazuki@callcc.net>
+
+	* lib/net/http/response.rb (Net::HTTPResponse::Inflater#finish):
+	  fix a bug that empty gzipped response body causes Zlib::BufError.
+	  [ruby-core:68846] [Bug #11058]
+
+	* test/net/http/test_httpresponse.rb: tests for the above.
+
+Sat Aug  1 17:05:18 2015  Kazuki Tsujimoto  <kazuki@callcc.net>
+
+	* lib/net/http/response.rb (Net::HTTPResponse#inflater):
+	  fix TypeError. An exception object might be nil.
+	  [ruby-core:68846] [Bug #11058]
+
+Sat Aug  1 09:09:46 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/openssl/ossl_ssl.c (ossl_sslctx_setup): Implement
+	  SSLContext#options and options= using SSL_CTX_set_options and
+	  SSL_CTX_get_options. This reduces the number of ivars we need and
+	  simplifies `ossl_sslctx_setup`.
+
+	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): Default `options`
+	  to SSL_OP_ALL
+
+Sat Aug  1 06:54:36 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/openssl/ossl_ssl.c (Init_ossl_ssl): OpenSSL declares these
+	  constants as longs, so we should follow that and use LONG2NUM.
+	  http://git.io/vOqxD
+
+Sat Aug  1 04:06:29 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/openssl/ossl_ssl.c (ossl_call_tmp_dh_callback): change callback
+	  to return the Ruby dh (or ecdh) object that the caller cares about
+	  instead of doing rb_iv_get / set to communicate.  This means we can
+	  remove an rb_iv_get call, and only use the set calls for their
+	  intended purpose (to prevent the object from being GC'd).
+
+	* ext/openssl/ossl_ssl.c (ossl_tmp_dh_callback): ditto
+	* ext/openssl/ossl_ssl.c (ossl_call_tmp_ecdh_callback): ditto
+	* ext/openssl/ossl_ssl.c (ossl_tmp_ecdh_callback): ditto
+
+Sat Aug  1 03:49:31 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/openssl/ossl_ssl.c (ossl_call_tmp_dh_callback): Similarly to the
+	  tmp_ecdh_callback, the SSLSocket instance always holds a reference
+	  to the SSLContext object (it's always set in `initialize`).  The
+	  SSLContext holds a reference to the tmp_dh_callback.  Ask the
+	  context for the callback instead of storing the callback in two
+	  places.
+
+Sat Aug  1 03:43:10 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/openssl/ossl_ssl.c (ossl_call_tmp_dh_callback): create an array
+	  and use `rb_apply` to clean up calls to `rb_protect`.
+
+	* ext/openssl/ossl_ssl.c (ossl_tmp_dh_callback): ditto
+
+Sat Aug  1 03:27:12 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/openssl/ossl_ssl.c (ossl_call_tmp_ecdh_callback): The SSL socket
+	  always holds a reference to the SSLContext object, which will have
+	  the callback object.  Ask the context for the callback instead of
+	  storing the callback in two places.
+
+Sat Aug  1 03:14:07 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): convert
+	  `tmp_dh_callback` to Ruby, and call it when setting up an SSL
+	  connection.  This allows us to move the "default" behavior to the
+	  reader method.
+
+	* ext/openssl/ossl_ssl.c: call the tmp_dh_callback instead of
+	  accessing the SSLContext's internals.
+
+Fri Jul 31 23:34:27 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* .travis.yml: update libssl before running tests.
+	  Thanks to Chris Sinjakli <chris@sinjakli.co.uk> for figuring out the
+	  travis settings!
+
+Fri Jul 31 21:34:49 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* load.c (rb_require_internal): use rb_load_internal0 not to raise
+	  a exception to be caught.
+
+Thu Jul 30 13:19:54 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* variable.c (rb_const_get_0): warn deprecated constant reference.
+
+	* variable.c (rb_mod_deprecate_constant): mark constants to be
+	  warned as deprecated.  [Feature #11398]
+
+Thu Jul 30 11:53:54 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* thread.c (rb_thread_s_handle_interrupt): make identity hash, to
+	  compare masking classes just by their IDs.
+
+Thu Jul 30 11:52:55 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* load.c (rb_load_internal0): stop separating exits at loading
+	  from exits from execution.  TAG_FATAL is the only case that
+	  `errinfo` is a Fixnum, and should continue to exit by JUMP_TAG
+	  but not raising as an ordinary exception.
+	  [ruby-core:70169] [Bug #11404]
+
+Thu Jul 30 10:42:27 2015  Alex Dowad  <alexinbeijing@gmail.com>
+
+	* load.c (rb_load_internal0): extra check before returning
+	  TAG_RAISE when a non-local transfer of control happens while
+	  loading and parsing a Ruby source file.
+	  [ruby-core:70169] [Bug #11404]
+
+Thu Jul 30 08:48:42 2015  Eric Wong  <e@80x24.org>
+
+	* st.c (find_entry): constify st_table*
+	  (find_packed_index_from): ditto
+	  (find_packed_index): ditto
+	  (get_keys): ditto
+	  (get_values): ditto
+
+Thu Jul 30 04:29:25 2015  Eric Wong  <e@80x24.org>
+
+	* benchmark/bm_hash_aref_dsym.rb: new benchmark
+	* benchmark/bm_hash_aref_dsym_long.rb: ditto
+	* benchmark/bm_hash_aref_fix.rb: ditto
+
+Wed Jul 29 21:38:41 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* hash.c (any_hash), symbol.c (dsymbol_alloc): fix dynamic symbol
+	  hash value by restricting in Fixnum range, that is `long`.
+
+Wed Jul 29 17:25:46 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* hash.c (rb_obj_hash): move in order to share with rb_any_hash.
+
+Wed Jul 29 16:00:22 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (str_buf_cat): consider empty non-embed string case,
+	  not to loop infinitely.  [ruby-core:70074] [Bug #11383]
+
+Wed Jul 29 15:25:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_eval.c (send_internal): set method_missing_reason before
+	  invoking overriding method_missing method so that the default
+	  method_missing can achieve it properly.
+	  [ruby-core:68515] [Bug #10969]
+
+Wed Jul 29 14:54:16 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* hash.c (rb_sym_hash): return same value as rb_any_hash() of
+	  Symbol.  [Bug #9381]
+
+	* hash.c (rb_any_hash): fix Float hash.  rb_dbl_hash() returns a
+	  Fixnum, but not a long.  [Bug #9381]
+
+Wed Jul 29 11:07:10 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* internal.h (LIKELY, UNLIKELY): make a boolean to enforce 1 or 0.
+
+Wed Jul 29 10:44:43 2015  Alex Dowad  <alexinbeijing@gmail.com>
+
+	* gc.c: document argument passed to finalizer proc.
+	  [fix GH-976][ci skip] Patch by @alexdowad
+
+Wed Jul 29 10:36:58 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* io.c (rb_io_extract_modeenc): add option parameter `flags'
+	  to append extra oflags to normal mode.
+	  [Feature #11253] [ruby-core:69539]
+
+Wed Jul 29 04:54:47 2015  Eric Wong  <e@80x24.org>
+
+	* test/rubygems/test_gem_remote_fetcher.rb: pre-generate test key
+	  [ruby-core:70151] [Bug #11397]
+
+Tue Jul 28 10:32:09 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* internal.h (struct RClass): moved from ruby/ruby.h to hide the
+	  internals.
+
+Tue Jul 28 08:48:29 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (RUBY_TYPE_ATTRIBUTE): attribute declaration for
+	  types.
+
+Tue Jul 28 07:23:03 2015  Eric Wong  <e@80x24.org>
+
+	* symbol.h (struct RSymbol): add hashval field
+	* symbol.c (dsymbol_alloc): setup hashval field once
+	* hash.c (rb_any_hash): return RSymbol->hashval directly
+	* common.mk: hash.o depends on symbol.h
+	  Thanks to Bruno Escherl <bruno@escherl.net> for the bug report
+	  [ruby-core:70129] [Bug #11396]
+
+Tue Jul 28 03:26:15 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): raise a more
+	  helpful exception when verifying the peer connection and an
+	  anonymous cipher has been selected. [ruby-core:68330] [Bug #10910]
+	  Thanks to Chris Sinjakli <chris@sinjakli.co.uk> for the patch.
+
+	* test/openssl/test_ssl.rb (class OpenSSL): test for change
+
+Mon Jul 27 13:24:11 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* template/id.h.tmpl (ID2ATTRSET): remove an unused macro.
+
+Mon Jul 27 12:21:15 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/openssl/test_ssl.rb: run tests on non-Unix platforms.
+
+Sun Jul 26 19:21:31 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/openssl/ossl_ssl.c (ossl_ssl_alpn_protocol): fix condition
+	  to compile, needs ALPN to be available.  [Feature #9390]
+
+Sun Jul 26 11:29:01 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* signal.c (default_handler, Init_signal): discard SIGSYS, ENOSYS
+	  should raise a SystemCallError always instead.
+
+Sun Jul 26 10:26:35 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/openssl/ossl_ssl.c (ossl_call_servername_cb): set the ssl context
+	  object returned by the servername callback on to the socket as an
+	  instance variable.  If the callback allocated a new context object
+	  and didn't keep a reference to it, it could be GC'd out from under
+	  the socket object.
+
+	* test/openssl/test_ssl.rb (class OpenSSL): test for change.
+
+Sun Jul 26 10:07:26 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* test/openssl/test_ssl.rb (class OpenSSL): add test coverage around
+	  OpenSSL::SSL::SSLContext#servername_cb
+
+Sun Jul 26 09:10:32 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* gems/bundled_gems: update latest version of bundled power_assert.
+
+Sun Jul 26 08:49:28 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* test/rubygems/test_gem_remote_fetcher.rb: backport rubygems upstream
+	  change for OpenSSL key length. see detail to
+	  https://github.com/rubygems/rubygems/pull/1290
+
+Sun Jul 26 08:33:03 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/openssl/lib/openssl/pkey.rb: implement DEFAULT_512 and
+	  DEFAULT_1024 constants in Ruby.
+
+	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): Ask PKey for the
+	  default DH callback since it already must check whether openssl has
+	  been compiled with DH support.
+
+	* ext/openssl/ossl_pkey_dh.c (OSSL_PKEY_BN): Remove C definitions of
+	  DEFAULT_512 and DEFAULT_1024
+
+	* ext/openssl/ossl_pkey_dh.c (Init_ossl_dh): ditto
+
+	* test/openssl/test_pkey_dh.rb (class OpenSSL): add test to ensure the
+	  Ruby definitions are the same as the C definitions were.
+
+Sun Jul 26 08:14:59 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): support
+	  specifically setting the tmp_dh_callback to nil.
+
+	* ext/openssl/ossl_ssl.c (Init_ossl_ssl): ditto
+
+	* test/openssl/test_pair.rb (module OpenSSL): add a test
+
+Sun Jul 26 07:47:14 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): move the default
+	  tmp_dh_callback Ruby code and set it as a default in `initialize`.
+
+	* ext/openssl/ossl_pkey_dh.c (static unsigned char DEFAULT_DH_512_GEN):
+	  move this constant to Ruby.
+
+	* ext/openssl/ossl_pkey_dh.c (static unsigned char DEFAULT_DH_1024_GEN):
+	  ditto
+
+	* ext/openssl/ossl_pkey_dh.c (Init_ossl_dh): ditto
+
+	* ext/openssl/ossl_ssl.c (ossl_tmp_dh_callback): ditto
+
+	* ext/openssl/ossl_ssl.c (ossl_sslctx_setup): tmp_dh_callback should
+	  always be set, so we can remove this conditional
+
+Sun Jul 26 06:22:24 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* test/openssl/test_pair.rb: add a test ensuring that the default DH
+	  callback is used when no DH callback is specified.
+
+Sun Jul 26 04:08:27 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): add missing
+	  instance variables to squash warnings with alpn.
+
+Sun Jul 26 03:42:19 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): move
+	  OpenSSL::SSL::SSLContext#initialize implementation to pure Ruby.
+
+	* ext/openssl/ossl_ssl.c (ossl_sslctx_initialize): ditto
+
+	* ext/openssl/ossl_ssl.c (Init_ossl_ssl): ditto
+
+Sat Jul 25 21:03:45 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* random.c (fill_random_bytes_syscall): get rid of blocking when
+	  no entropy is available.  based on the patch by mame in
+	  [ruby-core:70114].  [Bug #11395]
+
+Sat Jul 25 11:05:31 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (str_replace_shared_without_enc): fill the terminator
+	  of embedded strings in wide char encodings.
+
+Sat Jul 25 06:38:36 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: size should be unsigned.
+	  * rb_call_info_t::index
+	  * rb_iseq_constant_body::stack_max
+	  * rb_iseq_constant_body::local_size
+	  * rb_iseq_constant_body::param::size
+	  * rb_iseq_constant_body::local_table_size
+	  * rb_iseq_constant_body::is_size
+	  * rb_iseq_constant_body::callinfo_size
+
+	* iseq.h: same for iseq_catch_table::size.
+
+	* compile.c: catch up these fix.
+
+	* iseq.c: ditto.
+
+	* proc.c: ditto.
+
+	* vm.c: ditto.
+
+	* vm_args.c: ditto.
+
+	* vm_eval.c: ditto.
+
+	* vm_insnhelper.c: ditto.
+
+Sat Jul 25 06:00:09 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: constify rb_iseq_constant_body::line_info_table.
+
+	* iseq.c: catch up this fix.
+
+Sat Jul 25 05:56:43 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: constify rb_iseq_constant_body::param::opt_table and
+	  rb_iseq_constant_body::param::keyword.
+
+	* compile.c: catch up this fix.
+
+Sat Jul 25 04:47:01 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: constify rb_iseq_constant_body::catch_table.
+
+	* compile.c (iseq_set_exception_table): catch up this fix.
+
+	* iseq.c: ditto.
+
+	* vm.c (vm_exec): ditto.
+
+Fri Jul 24 21:29:54 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* st.c (EQUAL, st_delete_safe): fix arguments order to compare
+	  function, searching key is the first and stored key is the
+	  second always.
+
+Fri Jul 24 21:27:29 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (fstr_update_callback): fstring must not be a shared
+	  string, or the content without RSTRING_FSTR may be freed.
+	  [ruby-dev:49188] [Bug #11386]
+
+Fri Jul 24 20:09:43 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* test/rinda/test_rinda.rb (RingIPv6#prepare_ipv6): prevent to use
+	  IPv6 loopback interface for
+	  Rinda::TestRingFinger#test_make_socket_ipv6_multicast and
+	  Rinda::TestRingFinger#test_make_socket_ipv6_multicast_hops.
+	  The tests are skipped if there are no IPv6 devices other than the
+	  loopback device. [Bug #11394] [ruby-dev:49199]
+
+	* test/rinda/test_rinda.rb (test_make_socket_ipv6_multicast): ditto
+	  for Rinda::TestRingServer#test_make_socket_ipv6_multicast.
+
+	* test/rinda/test_rinda.rb (test_ring_server_ipv6_multicast): ditto
+	  for Rinda::TestRingServer#test_ring_server_ipv6_multicast.
+
+Fri Jul 24 16:35:55 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (fstr_update_callback): pool bare strings only.
+
+	* string.c (rb_fstring): return the original string with sharing a
+	  fstring if it has extra attributes, not the fstring itself.
+	  [ruby-dev:49188] [Bug #11386]
+
+Fri Jul 24 16:35:34 2015  yui-knk  <spiketeika@gmail.com>
+
+	* file.c (rb_file_s_extname): [DOC] add an example.
+
+	* test/ruby/test_path.rb (test_extname): add tests.  [Fix GH-978]
+	  * path starts with dot ('.a.rb')
+	  * path includes dir name ('a/b/d/test.rb')
+	  * path includes dir name and dir name starts with dot
+	    ('.a/b/d/test.rb')
+
+Thu Jul 23 18:50:43 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: constify rb_iseq_constant_body::local_table and
+	  rb_iseq_param_keyword::table and
+	  rb_iseq_param_keyword::default_values.
+
+	* compile.c: catch up this fix.
+
+	* iseq.c: ditto.
+
+Thu Jul 23 17:30:43 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: constify rb_iseq_constant_body::iseq_encoded and
+	  rb_control_frame_t::pc.
+
+	* compile.c (rb_iseq_translate_threaded_code): catch up this fix.
+
+	* iseq.c: ditto.
+
+	* vm_exec.c (vm_exec_core): ditto.
+
+Thu Jul 23 10:25:46 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* include/ruby/ruby.h: add raw FL macros, which assume always the
+	  argument object is not a special constant.
+
+	* internal.h (STR_EMBED_P, STR_SHARED_P): valid only for T_STRING.
+
+	* string.c: deal with taint flags directly across String instances.
+
+Thu Jul 23 09:05:28 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (lambda_body): pop cmdarg stack for lookahead
+	  token.  [ruby-core:70067] [Bug #11380]
+
+Thu Jul 23 04:03:03 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/openssl/ossl_ssl.c: fix tests by not setting the instance
+	  variable on the frozen ssl instance.
+
+Thu Jul 23 03:32:26 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/openssl/ossl_ssl.c: add ECDH callback support. [Feature #11356]
+
+	* test/openssl/test_pair.rb: test for ECDH callback support
+
+Thu Jul 23 03:29:49 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* ext/openssl/ossl_ssl.c: add ALPN support. [Feature #9390]
+
+	* ext/openssl/extconf.rb: detect ALPN support in OpenSSL
+
+	* test/openssl/test_ssl.rb: test for ALPN
+
+Wed Jul 22 23:44:17 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (rb_str_reverse): reversed string is not a substring,
+	  and should not set coderange of the original string.
+	  [ruby-dev:49189] [Bug #11387]
+
+Wed Jul 22 20:17:51 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: modify layout of rb_iseq_constant_body.
+
+	  Move frequent accessing fields to upper part.
+
+Wed Jul 22 19:57:47 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: remove unused declaration of
+	  iseq_compile_data_ensure_node_stack.
+
+Wed Jul 22 19:52:45 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: separate rb_iseq_body into rb_iseq_constant_body and
+	  rb_iseq_variable_body (rb_iseq_t::variable_body).
+
+	  rb_iseq_variable_body can be modified after compilation.
+
+	* compile.c: use rb_iseq_t::variable_body.
+
+	* iseq.c: ditto.
+
+	* thread.c: ditto.
+
+Wed Jul 22 17:50:35 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/matrix/eigenvalue_decomposition.rb: refine code style.
+	  [fix GH-959][ci skip] Patch by @bogdanvlviv
+
+Wed Jul 22 15:48:47 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* test/ruby/test_range.rb: Add test case for Range#end with
+	  exclude_end true case. [fix GH-968] Patch by @yui-knk
+
+Wed Jul 22 09:45:31 2015  Maksim Sitnikov  <sitnikovme@undev.ru>
+
+	* numeric.c (num_coerce): [DOC] fix doc for Numeric#coerce,
+	  missing '+'.  [Fix GH-974]
+
+Wed Jul 22 07:24:18 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* make rb_iseq_t T_IMEMO object (type is imemo_iseq).
+
+	  All contents of previous rb_iseq_t is in rb_iseq_t::body.
+	  Remove rb_iseq_t::self because rb_iseq_t is an object.
+
+	  RubyVM::InstructionSequence is wrapper object points T_IMEMO/iseq.
+	  So RubyVM::ISeq.of(something) method returns different wrapper
+	  objects but they point the same T_IMEMO/iseq object.
+
+	  This patch is big, but most of difference is replacement of
+	  iseq->xxx to iseq->body->xxx.
+
+	  (previous) rb_iseq_t::compile_data is also located to
+	  rb_iseq_t::compile_data.
+	  It was moved from rb_iseq_body::compile_data.
+
+	  Now rb_iseq_t has empty two pointers.
+	  I will split rb_iseq_body data into static data and dynamic data.
+
+	* compile.c: rename some functions/macros.
+	  Now, we don't need to separate iseq and iseqval (only VALUE).
+
+	* eval.c (ruby_exec_internal): `n' is rb_iseq_t (T_IMEMO/iseq).
+
+	* ext/objspace/objspace.c (count_imemo_objects): count T_IMEMO/iseq.
+
+	* gc.c: check T_IMEMO/iseq.
+
+	* internal.h: add imemo_type::imemo_iseq.
+
+	* iseq.c: define RubyVM::InstructionSequence as T_OBJECT.
+	  Methods are implemented by functions named iseqw_....
+
+	* load.c (rb_load_internal0): rb_iseq_new_top() returns
+	  rb_iseq_t (T_IMEMO/iesq).
+
+	* method.h (rb_add_method_iseq): accept rb_iseq_t (T_IMEMO/iseq).
+
+	* vm_core.h (GetISeqPtr): removed because it is not T_DATA now.
+
+	* vm_core.h (struct rb_iseq_body): remove padding for
+	  [Bug #10037][ruby-core:63721].
+
+Wed Jul 22 07:15:33 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* ext/objspace/objspace.c (total_i): no need to skip singleton classes.
+
+Wed Jul 22 06:37:54 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: constify rb_call_info_t::kw_arg,
+	  rb_control_frame_t::iseq and rb_control_frame_t::block_iseq.
+
+	* iseq.c (iseq_free): catch up this fix.
+
+	* vm.c: ditto.
+
+	* vm_dump.c: ditto.
+
+Wed Jul 22 06:25:45 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: constify rb_call_info_t::blockiseq and rb_block_t::iseq.
+
+	* vm.c, vm_insnhelper.c: catch up this fix.
+
+	* iseq.c (iseq_data_to_ary): constify the first iseq parameter.
+
+	* vm_insnhelper.c (vm_make_proc_with_iseq): ditto.
+
+Wed Jul 22 06:17:35 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* method.h: constify rb_method_iseq_t::iseqptr.
+
+	* proc.c (rb_method_entry_min_max_arity): catch up this fix.
+
+	* vm_insnhelper.c (def_iseq_ptr): constify.
+
+Wed Jul 22 03:37:39 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (internal_object_p): Now a singleton classes appear by
+	  ObjectSpace.each_object. [Bug #11360]
+
+	* test/ruby/test_objectspace.rb: add a test about it.
+
+Tue Jul 21 21:21:33 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* thread.c (do_select): replace switch and goto with a loop to
+	  suppress maybe-uninitialized warnings by gcc6.
+
+	* thread.c (set_unblock_function, rb_wait_for_single_fd): ditto.
+
+Tue Jul 21 20:32:33 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* test/ruby/test_range.rb: Add test for Range#hash
+	  [fix GH-969] Patch by @yui-knk
+
+Tue Jul 21 19:43:20 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* compile.c: constify the first parameter (iseq).
+	  * iseq_add_mark_object()
+	  * iseq_add_mark_object_compile_time()
+
+	* iseq.c, iseq.h (rb_iseq_add_mark_object): ditto.
+
+Tue Jul 21 16:18:48 2015  Eric Wong  <e@80x24.org>
+
+	* test/socket/test_nonblock.rb: increase buffer sizes
+	  to OpenBSD limits. Thanks to Jeremy Evans <code@jeremyevans.net>
+	  [ruby-core:70058]
+
+Tue Jul 21 16:08:53 2015  Eric Wong  <e@80x24.org>
+
+	* load.c (ruby_dln_librefs): make static
+
+Tue Jul 21 13:36:54 2015  yuuji.yaginuma  <yuuji.yaginuma@gmail.com>
+
+	* lib/optparse.rb (complete): [DOC] fix typo.  [Fix GH-973]
+
+Tue Jul 21 05:20:21 2015  Eric Wong  <e@80x24.org>
+
+	* io.c (nogvl_wait_for_single_fd): new function for Linux
+	  (maygvl_copy_stream_wait_read): Linux-specific version
+	  (nogvl_copy_stream_wait_write): use nogvl_wait_for_single_fd
+	  [ruby-core:70051] [Feature #11377]
+
+Mon Jul 20 15:04:30 2015  Eric Wong  <e@80x24.org>
+
+	* parse.y (parser_initialize): avoid redundant zero-ing
+
+Mon Jul 20 12:12:05 2015  Eric Wong  <e@80x24.org>
+
+	* parse.y (struct parser_params): pack: 88 => 256 bytes on 64-bit
+	  [ruby-core:70034] [Feature #11371]
+
+Sun Jul 19 14:29:18 2015  windwiny  <windwiny.ubt@gmail.com>
+
+	* ext/pty/pty.c: [DOC] fix example typo, an old name at move from
+	  PTY.open.  [Fix GH-972]
+
+Sat Jul 18 21:29:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* thread.c (vm_check_ints_blocking): gather common statements at
+	  the end, and prefer LIKELY for Visual C optimization.
+
+Sat Jul 18 20:44:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* load.c (rb_load_internal0): do not raise any exceptions but
+	  return the result tag state.
+
+	* load.c (rb_load_protect): reduce nested EXEC_TAGs.
+
+Sat Jul 18 19:52:17 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* gc.c (run_finalizer): set and restore safe level here to reduce
+	  nested EXEC_TAGs.
+
+Sat Jul 18 18:45:22 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (ruby_cleanup): error_handle() returns exit status to the
+	  system, not internal error state, do not convert the exit status
+	  again.
+
+Sat Jul 18 10:29:03 2015  Eric Wong  <e@80x24.org>
+
+	* test/ruby/test_process.rb: test thread+sigs work after failed exec
+
+Sat Jul 18 07:20:18 2015  Jeremy Evans  <code@jeremyevans.net>
+
+	* test/socket/test_nonblock: use smaller buffer for sendmsg
+	  [ruby-core:70016] [Bug #11364]
+
+Sat Jul 18 07:04:24 2015  Eric Wong  <e@80x24.org>
+
+	* signal.c (trap_handler): cleanup to use RSTRING_GETMEM + memcmp
+
+Sat Jul 18 02:53:06 2015  Eric Wong  <e@80x24.org>
+
+	* io.c (argf_read_nonblock): support `exception: false'
+	  (io_nonblock_eof): new function
+	  (io_read_nonblock): use io_nonblock_eof
+	  (argf_getpartial): accept kwargs hash for `exception: false'
+	* test/ruby/test_argf.rb (test_read_nonblock): new test
+	* NEWS: add item for ARGF.read_nonblock
+	  [ruby-core:70000] [Feature #11358]
+
+Fri Jul 17 23:51:31 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_eval.c (rb_eval_cmd): $SAFE=4 has been deprecated.
+
+Fri Jul 17 22:18:09 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (iseq_compile_each): use enum ruby_tag_type names.
+
+	* vm_core.h (ruby_tag_type): move from eval_intern.h for compiling
+	  break/next/redo/return.
+
+Fri Jul 17 15:39:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* include/ruby/encoding.h (ENC_CODERANGE_CLEAN_P): predicate that
+	  tells if the coderange is clean, that is 7bit or valid, and no
+	  needs to scrub.
+
+	* re.c (rb_reg_expr_str): use ENC_CODERANGE_CLEAN_P.
+
+	* string.c (enc_strlen, rb_enc_cr_str_buf_cat, rb_str_scrub):
+	  ditto.
+
+	* string.c (rb_str_enumerate_chars): ditto, and suppress a warning
+	  by gcc6.
+
+Fri Jul 17 15:36:52 2015  yui-knk  <spiketeika@gmail.com>
+
+	* test/ruby/test_range.rb (test_first_last): Add test for
+	  `Range.new`.  [Fix GH-971]
+
+Fri Jul 17 15:36:40 2015  yui-knk  <spiketeika@gmail.com>
+
+	* test/ruby/test_range.rb (test_first_last): Add assertions to
+	  test of `Range#last` with exclude_end true case.  [Fix GH-970]
+
+Fri Jul 17 09:59:14 2015  Eric Wong  <e@80x24.org>
+
+	* thread.c (rb_thread_alone): simplify
+
+Fri Jul 17 09:58:32 2015  Eric Wong  <e@80x24.org>
+
+	* lib/rinda/tuplespace.rb: remove enumerator require
+	* test/pathname/test_pathname.rb: ditto
+
+Fri Jul 17 05:33:58 2015  Eric Wong  <e@80x24.org>
+
+	* iseq.c (rb_iseq_compile_with_option): reuse result of previous
+	  GET_THREAD() call
+	* thread.c (thread_create_core): ditto
+	  (rb_mutex_trylock): ditto
+	  (rb_mutex_lock): ditto
+	* process.c (rb_waitpid): avoid multiple eval from RUBY_VM_CHECK_INTS
+	* thread.c (rb_thread_check_ints): ditto
+
+Thu Jul 16 19:12:30 2015  Eric Wong  <e@80x24.org>
+
+	* thread.c (mutex_alloc): remove needless volatile
+
+Thu Jul 16 22:05:29 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: constify rb_iseq_t::parent_iseq.
+
+	  rb_iseq_t::local_iseq is not constant data because
+	  local_iseq::flip_cnt can be modified (commented).
+
+	* compile.c: catch up this fix.
+
+	* iseq.c: ditto.
+
+	* vm_insnhelper.c: ditto.
+
+Thu Jul 16 21:47:47 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* process.c (redirect_dup2): when the new FD of dup2() conflicts
+	  with one of the timer thread FDs, the internal FD is diverted.
+	  [Bug #11336] [ruby-core:69886] [Bug #11350] [ruby-core:69961]
+
+	* process.c (dup2_with_divert): new function for the above purpose.
+
+	* thread_pthread.c (rb_divert_reserved_fd): new function for
+	  diverting reserved FD. If the given FD is the same as one of the
+	  reserved FDs, the reserved FD number is internally changed.
+	  It returns -1 when error. Otherwise, returns 0. It also returns
+	  0 if there is no need to change reserved FD number.
+
+	* thread_win32.c (rb_divert_reserved_fd): always returns 0 because
+	  of no reserved FDs.
+
+	* internal.h (rb_divert_reserved_fd): prototype declaration.
+	  It is Ruby internal use only.
+
+Thu Jul 16 21:47:46 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* iseq.c (rb_iseq_disasm): rename rb_iseq_t *iseqdat to iseq
+	  and VALUE *iseq to code.
+
+	* iseq.c (rb_iseq_disasm_insn): ditto.
+
+Thu Jul 16 14:34:24 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm.c (REWIND_CFP): keep the arguments region inside the valid
+	  value stack.  [ruby-core:69969] [Bug #11352]
+
+Thu Jul 16 11:38:21 2015  Eric Wong  <e@80x24.org>
+
+	* process.c (close_unless_reserved): declare type of `fd' arg
+
+Thu Jul 16 08:47:29 2015  Eric Wong  <e@80x24.org>
+
+	* load.c (rb_construct_expanded_load_path): fstring expanded path
+	  (get_loaded_features_index): fstring feature path
+	  (rb_provide_feature): ditto
+	  [ruby-core:69871] [Feature #11331]
+
+Thu Jul 16 02:56:14 2015  Eric Wong  <e@80x24.org>
+
+	* thread.c (thread_initialize): avoid RSTRING_PTR and NUMT2INT
+
+Thu Jul 16 01:00:46 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* test/ruby/test_process.rb (test_exec_close_reserved_fd): test for
+	  [Bug #11353]
+
+Thu Jul 16 00:35:42 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+
+	* .gitignore: ignore version.i.
+
+Wed Jul 15 23:40:32 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* test/ruby/test_process.rb (test_deadlock_by_signal_at_forking):
+	  use RUBY (= EnvUtil.rubybin)
+
+Wed Jul 15 23:01:22 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* process.c (redirect_close, parent_redirect_close): should not close
+	  reserved FD. It should be closed in the exec system call due to the
+	  O_CLOEXEC or FD_CLOEXEC flag. [Bug #11353] [ruby-core:69977]
+
+	* process.c (close_unless_reserved): new function to close FD unless
+	  it is reserved for internal communication.
+
+	* thread_pthread.c (rb_reserved_fd_p): should check owner_process pid
+	  to avoid false positive in forked child process.
+
+Wed Jul 15 18:31:18 2015  Eric Wong  <e@80x24.org>
+
+	* proc.c (proc_mark): remove redundant check
+	* vm.c (env_mark): ditto
+
+Wed Jul 15 17:27:40 2015  Eric Wong  <e@80x24.org>
+
+	* iseq.c (iseq_mark): remove check for data pointer
+	* proc.c (binding_mark): ditto
+	* vm.c (rb_thread_mark): ditto
+	* vm_trace.c (tp_mark): ditto
+
+Wed Jul 15 16:55:04 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* encoding.c (enc_autoload): drop dummy encoding flag from
+	  the loaded encoding index.  this flag is used only in this
+	  source.
+
+Wed Jul 15 14:39:29 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm.c (vm_make_env_each): add comments about env layout.
+	  Do not use `i' to specify `new_ep'.
+
+	* vm.c (rb_proc_create, rb_vm_make_proc_lambda): envval is not used.
+
+Wed Jul 15 08:59:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* gc.h (RUBY_MARK_UNLESS_NULL): evaluate the argument only once
+	  to get rid of inadvertent side effects.
+
+Wed Jul 15 02:53:11 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h, vm.c: remove rb_proc_t::envval because we can know it via
+	  rb_proc_t::block::ep.
+
+	  rb_vm_proc_envval(const rb_proc_t *proc) returns an Env object which
+	  the Proc object use.
+
+	* proc.c: catch up this fix.
+
+	* vm_dump.c (rb_vmdebug_proc_dump_raw): ditto.
+
+Wed Jul 15 02:27:22 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h, vm.c: remove rb_env_t::prev_envval because we can know it
+	  via env->ep.
+
+	  rb_vm_env_prev_envval(env) returns prev_envval via env->ep.
+
+	* vm_core.h (rb_vm_env_local_variables): change parameter type
+	  from VALUE (T_DATA/env) to `const rb_env_t *' to make same as
+	  rb_vm_env_prev_envval().
+
+	* proc.c: catch up these changes.
+
+	* vm_dump.c: ditto.
+
+	* vm.c: rename macros.
+
+	  * ENV_IN_HEAP_P() to VM_EP_IN_HEAP_P() because it uses ep.
+	  * ENV_VAL() to VM_ENV_EP_ENVVAL() because it is too short.
+
+Wed Jul 15 01:09:09 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm.c: refactoring Proc/Env related code.
+
+	* vm_core.h: remove blockprocval field from rb_proc_t and rb_binding_t.
+	  Instead of this field, mark given block in Proc at rb_env_t::env.
+
+	* vm.c (vm_make_env_each): make an Env object with this layout.
+	  And also simplify parameters.
+
+	* proc.c: catch up this fix.
+
+	* vm_core.h: remove rb_env_t::local_size because it is not used.
+
+	* vm_dump.c (rb_vmdebug_env_dump_raw): catch up this fix.
+
+	* vm_core.h (rb_vm_make_env_object): remove rb_vm_make_env_object()
+	  because it is only referred from vm.c.
+
+	* vm_eval.c (eval_string_with_cref): catch up this fix.
+
+Wed Jul 15 00:03:36 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+
+	* gc.c (__has_feature): move into internal.h.
+
+	* internal.h (__has_feature): ditto.
+
+	* internal.h (__has_extension): new macro.
+
+	* internal.h (STATIC_ASSERT): use _Static_assert with
+	  clang. [ruby-core:69931] [Bug #11343]
+
+Wed Jul 15 00:00:00 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+
+	* random.c (fill_random_bytes_syscall): fix compile error with
+	  clang. [ruby-core:69931] [Bug #11343]
+
+Tue Jul 14 11:22:42 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/webrick/utils.rb (WEBrick::Utils::TimeoutHandler#register):
+	  notify the handler thread of new timeout registration.
+
+	* lib/webrick/utils.rb (WEBrick::Utils::TimeoutHandler#initialize):
+	  make sleep intervals adaptive than fixed period intervals.
+
+	* lib/webrick/server.rb (WEBrick::GenericServer#start): flush
+	  shutdown pipe.
+
+	* lib/webrick/server.rb (WEBrick::GenericServer#stop): request the
+	  server to stop immediately by sending data via shutdown pipe.
+
+Mon Jul 13 23:58:08 2015  Stefano Tortarolo  <stefano.tortarolo@gmail.com>
+
+	* lib/webrick/httpproxy.rb (WEBrick::HTTPProxyServer#do_CONNECT):
+	  fix typos in debugger statements.  [Fix GH-967]
+
+Mon Jul 13 19:11:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/timeout.rb (timeout): warn as deprecated for a long time.
+
+Mon Jul 13 01:37:27 2015  Zachary Scott  <zzak@ruby-lang.org>
+
+	* ext/openssl/ossl.c: [DOC] Backport ruby/openssl@dbb3fdb [Bug #11345]
+	  Thanks to Tomoya Chiba for the report and help with patch.
+
+Sun Jul 12 09:20:02 2015  Shota Fukumori  <her@sorah.jp>
+
+	* ext/socket/basicsocket.c: [DOC] typo (Errno::AGAIN -> Errno::EAGAIN)
+
+	* ext/socket/socket.c: ditto
+
+	* ext/socket/tcpserver.c: ditto
+
+	* ext/socket/udpsocket.c: ditto
+
+	* ext/socket/unixserver.c: ditto
+
+	* io.c: ditto
+
+Sun Jul 12 06:42:23 2015  ksss  <co000ri@gmail.com>
+
+	* test/stringio/test_stringio.rb (test_sysread): add a test for
+	  StringIO#sysread.  [Fix GH-966]
+
+Sat Jul 11 21:16:34 2015  ksss  <co000ri@gmail.com>
+
+	* ext/stringio/stringio.c (Init_stringio): [DOC] Fix an example,
+	  StringIO#puts should be set "\n" at last.  [Fix GH-965]
+
+Sat Jul 11 12:45:51 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/timeout.rb (Timeout#timeout): remove regexp with wrong line
+	  number and fix caller depth.
+
+Fri Jul 10 22:05:50 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/timeout.rb (ExitException): removed internal exception class
+	  and use Timeout::Error instead, as using throw/catch to isolate
+	  each timeouts now.  [ruby-dev:49179] [Bug #11344]
+
+Fri Jul 10 17:41:54 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (is_case_sensitive): get attributes by the file descriptor
+	  of open directory, instead of using mount point name.
+
+Fri Jul 10 10:46:02 2015  ksss  <co000ri@gmail.com>
+
+	* ext/stringio/stringio.c (writable): remove unnecessary check for
+	  deprecated safe level 4.  [Fix GH-963]
+
+Thu Jul  9 15:07:12 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (waitpid): return immediately if interrupted.
+	  reported by <takkanm AT gmail.com> [ruby-dev:49176] [Bug #11340]
+
+Thu Jul  9 13:03:46 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c (vm_search_super_method): use CI_SET_FASTPATH().
+
+Thu Jul  9 11:07:06 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: remove rb_call_info_t::klass because
+	  rb_callable_method_entry_t has information about defined class.
+
+	* vm_insnhelper.c (vm_search_method): don't set ci->klass because
+	  it is removed.
+
+	* vm_insnhelper.c (rb_equal_opt): ditto.
+
+	* vm_insnhelper.c (vm_search_superclass): removed because it is too
+	  simple to write code directly.
+
+	* vm_insnhelper.c (vm_defined): don't use vm_search_superclass().
+	  This fix avoid searching current callable `me' twice.
+
+	* vm_insnhelper.c (vm_search_super_method): ditto.
+
+Thu Jul  9 10:03:10 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/net/http/responses.rb: Added 308 status to CODE_TO_OBJ list.
+	  [fix GH-961] Patch by @billinghamj
+
+Thu Jul  9 09:34:14 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h (rb_control_frame_t): fix comments (layout index).
+
+Thu Jul  9 09:25:50 2015  Zachary Scott  <e@zzak.io>
+
+	* parse.y: Improve duplicate key warning with patch by @andremedeiros
+	  [Fix GH-938] https://github.com/ruby/ruby/pull/938 [Bug #11327]
+
+Wed Jul  8 07:43:01 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/csv.rb: typo fix [ci skip][fix GH-958] Patch by @henrik
+
+Wed Jul  8 04:42:27 2015  Eric Wong  <e@80x24.org>
+
+	* iseq.c (iseq_data_to_ary): dump kw_arg as symbol
+	* test/-ext-/iseq_load/test_iseq_load.rb: test kw_arg roundtrip
+	  [ruby-core:69891] [Bug #11338]
+
+Tue Jul  7 18:18:41 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+
+	* random.c (fill_random_bytes_syscall): fix compile error.
+
+Tue Jul  7 16:47:30 2015  Eric Wong  <e@80x24.org>
+
+	* compile.c (COMPILE_ERROR): reduce GET_THREAD() calls
+
+Tue Jul  7 16:39:04 2015  Eric Wong  <e@80x24.org>
+
+	* random.c (fill_random_bytes_syscall): return -1 for error
+	* random.c (fill_random_bytes): try urandom on syscall failure
+
+Tue Jul  7 15:02:18 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* file.c (rb_str_normalize_ospath): skip invalid byte sequence not
+	  to loop infinitely.  this case usually does not happen as the
+	  input name should come from real file systems.
+
+Tue Jul  7 14:40:08 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_backtrace.c: remove debug flag introduced accidentally.
+
+Tue Jul  7 12:05:37 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* cont.c (cont_free): remove mysterious fflush()
+	  introduced at r19890, maybe accidentally.
+
+Tue Jul  7 11:45:14 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* proc.c (rb_method_call): because data->me should be non-NULL,
+	  do not check data->me
+
+	* proc.c (method_inspect): ditto.
+
+Tue Jul  7 11:37:25 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: remove rb_iseq_t::orig because rb_iseq_clone()
+	  no longer exists.
+
+	* iseq.c: don't use rb_iseq_t::orig.
+
+Tue Jul 07 11:25:57 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* iseq.c, internal.h (rb_iseq_clone): removed because we don't need to
+	  clone iseq any more.
+
+	* class.c (clone_method): share iseq between cloned methods. All of
+	  method dependent information are able to refer from method entry.
+
+Tue Jul  7 04:42:25 2015  Eric Wong  <e@80x24.org>
+
+	* string.c (Init_String): use rb_str_freeze for String#freeze
+	  to resize internal buffer
+	  [ruby-core:69870] [Feature #11330]
+
+Tue Jul  7 04:12:32 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm.c (vm_define_method): remove an unused local variable.
+
+Tue Jul  7 03:57:28 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: remove rb_iseq_t::defined_method_id because it is not
+	  needed.
+
+	* eval.c (frame_func_id): simplify. rb_callable_method_entry_t
+	  has enough information.
+
+	* eval.c (frame_called_id): ditto.
+
+	* iseq.c (prepare_iseq_build): catch up this fix.
+
+	* proc.c (rb_mod_define_method): ditto.
+
+	* vm.c (vm_define_method): ditto.
+
+Tue Jul  7 03:47:26 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: remove a useless declaration.
+
+Tue Jul  7 03:33:20 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: remove rb_iseq_t::klass to reduce dynamic data.
+
+	* internal.h, iseq.c (rb_iseq_klass): remove it because
+	  rb_iseq_t::klass is removed.
+
+	* vm_insnhelper.c (vm_super_outside): do not see cfp->iseq, but
+	  check callable method entry on a frame.
+	  This fix simplify the logic to search super class.
+
+	* test/ruby/test_method.rb: support super() from Proc.
+	  Now, [Bug #4881] and [Bug #3136] was solved.
+
+	* proc.c (rb_mod_define_method): catch up this change.
+
+	* vm.c (vm_define_method): ditto.
+
+	* vm_backtrace.c (rb_profile_frames): now, each `frame' objects
+	  are rb_callable_method_entry_t data or iseq VALUEs.
+
+	  This fix introduce minor compatibility issue that
+	  rb_profile_frame_label() always returns
+	  rb_profile_frame_base_label().
+
+	* test/-ext-/debug/test_profile_frames.rb: catch up this change.
+
+Tue Jul  7 01:52:14 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* cont.c (fiber_init): initialize control frame correctly.
+	  This fix does not affect any ordinal execution, but
+	  affects debug prints.
+
+Mon Jul  6 17:59:05 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c (vm_search_super_method): do not skip calling
+	  same methods in super.
+	  [Bug #3351]
+
+	* test/ruby/test_super.rb: fix a test.
+
+Mon Jul  6 17:59:11 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ext/tk/tcltklib.c: removed deprecated safe level.
+
+Mon Jul  6 17:16:37 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* method.h, proc.c (rb_method_entry_location): make it static
+	  and remove prefix `rb_' because it is used only in proc.c.
+
+Mon Jul  6 16:42:10 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* test/lib/memory_status.rb: removed redundant path.
+
+Mon Jul  6 01:18:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* test/lib/test/unit/parallel.rb: make @@project_dir one level
+	  upper as this file had moved one level deeper.
+
+Sun Jul  5 23:54:10 2015  mizokami  <suzunatsu@yahoo.com>
+
+	* lib/optparse.rb: [DOC] Fix typo.
+
+Sun Jul  5 18:25:37 2015  Eric Wong  <e@80x24.org>
+
+	* gc.c (gc_profile_record_get): fix spelling error in keys
+
+Sun Jul  5 14:49:01 2015  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+
+	* README.md: fix a typo pointed out by raoulvdberge.
+	  https://github.com/ruby/ruby/pull/953#commitcomment-11998186
+
+Sun Jul  5 12:56:20 2015  Irvi Firqotul Aini  <viarc7@gmail.com>
+
+	* README.md: Added link HowToReport bugs.
+
+Sun Jul  5 10:51:48 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* array.c (rb_ary_sort_bang): the original array may not be
+	  embedded even if a substitution array is embedded, as it is
+	  embedded when the original array is short enough but not
+	  embedded.  [ruby-dev:49166] [Bug #11332]
+
+Sun Jul  5 09:31:40 2015  Eric Wong  <e@80x24.org>
+
+	* test/ruby/test_process.rb: test for fd=3 usability in child
+
+Sat Jul  4 19:43:31 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* Add test case for empty array and first method with args.
+	  Patch by @yui-knk [fix GH-955]
+
+Sat Jul  4 19:39:08 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* Add test for `Enumerable#sort` with block. Patch by @yui-knk
+	  [fix GH-954]
+
+Sat Jul  4 14:38:43 2015  Eric Wong  <e@80x24.org>
+
+	* enum.c (zip_ary): remove volatile, use RB_GC_GUARD
+	  (zip_i): ditto
+
+Sat Jul  4 10:42:57 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/rubygems/test_case.rb (teardown): do not delete features
+	  loaded from the original load paths, the same libraries should
+	  be loaded again when the same features are required.
+	  [ruby-dev:49031] [Bug #11222]
+
+Sat Jul  4 09:38:52 2015  Eric Wong  <e@80x24.org>
+
+	* vm.c (rb_vm_mark): reduce branches for always-set VM fields
+	  (rb_vm_add_root_module): ditto
+
+Fri Jul 03 20:05:10 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* method.h: introduce rb_callable_method_entry_t to remove
+	  rb_control_frame_t::klass.
+	  [Bug #11278], [Bug #11279]
+
+	  rb_method_entry_t data belong to modules/classes.
+	  rb_method_entry_t::owner points defined module or class.
+
+	    module M
+	      def foo; end
+	    end
+
+	  In this case, owner is M.
+
+	  rb_callable_method_entry_t data belong to only classes.
+	  For modules, MRI creates corresponding T_ICLASS internally.
+	  rb_callable_method_entry_t can also belong to T_ICLASS.
+
+	  rb_callable_method_entry_t::defined_class points T_CLASS or
+	  T_ICLASS.
+	  rb_method_entry_t data for classes (not for modules) are also
+	  rb_callable_method_entry_t data because it is completely same data.
+	  In this case, rb_method_entry_t::owner == rb_method_entry_t::defined_class.
+
+	  For example, there are classes C and D, and includes M,
+
+	    class C; include M; end
+	    class D; include M; end
+
+	  then, two T_ICLASS objects for C's super class and D's super class
+	  will be created.
+
+	  When C.new.foo is called, then M#foo is searched and
+	  rb_callable_method_t data is used by VM to invoke M#foo.
+
+	  rb_method_entry_t data is only one for M#foo.
+	  However, rb_callable_method_entry_t data are two (and can be more).
+	  It is proportional to the number of including (and prepending)
+	  classes (the number of T_ICLASS which point to the module).
+
+	  Now, created rb_callable_method_entry_t are collected when
+	  the original module M was modified. We can think it is a cache.
+
+	  We need to select what kind of method entry data is needed.
+	  To operate definition, then you need to use rb_method_entry_t.
+
+	  You can access them by the following functions.
+
+	  * rb_method_entry(VALUE klass, ID id);
+	  * rb_method_entry_with_refinements(VALUE klass, ID id);
+	  * rb_method_entry_without_refinements(VALUE klass, ID id);
+	  * rb_resolve_refined_method(VALUE refinements, const rb_method_entry_t *me);
+
+	  To invoke methods, then you need to use rb_callable_method_entry_t
+	  which you can get by the following APIs corresponding to the
+	  above listed functions.
+
+	  * rb_callable_method_entry(VALUE klass, ID id);
+	  * rb_callable_method_entry_with_refinements(VALUE klass, ID id);
+	  * rb_callable_method_entry_without_refinements(VALUE klass, ID id);
+	  * rb_resolve_refined_method_callable(VALUE refinements, const rb_callable_method_entry_t *me);
+
+	  VM pushes rb_callable_method_entry_t, so that rb_vm_frame_method_entry()
+	  returns rb_callable_method_entry_t.
+	  You can check a super class of current method by
+	  rb_callable_method_entry_t::defined_class.
+
+	* method.h: renamed from rb_method_entry_t::klass to
+	  rb_method_entry_t::owner.
+
+	* internal.h: add rb_classext_struct::callable_m_tbl to cache
+	  rb_callable_method_entry_t data.
+
+	  We need to consider about this field again because it is only
+	  active for T_ICLASS.
+
+	* class.c (method_entry_i): ditto.
+
+	* class.c (rb_define_attr): rb_method_entry() does not takes
+	  defined_class_ptr.
+
+	* gc.c (mark_method_entry): mark RCLASS_CALLABLE_M_TBL() for T_ICLASS.
+
+	* cont.c (fiber_init): rb_control_frame_t::klass is removed.
+
+	* proc.c: fix `struct METHOD' data structure because
+	  rb_callable_method_t has all information.
+
+	* vm_core.h: remove several fields.
+	  * rb_control_frame_t::klass.
+	  * rb_block_t::klass.
+
+	  And catch up changes.
+
+	* eval.c: catch up changes.
+
+	* gc.c: ditto.
+
+	* insns.def: ditto.
+
+	* vm.c: ditto.
+
+	* vm_args.c: ditto.
+
+	* vm_backtrace.c: ditto.
+
+	* vm_dump.c: ditto.
+
+	* vm_eval.c: ditto.
+
+	* vm_insnhelper.c: ditto.
+
+	* vm_method.c: ditto.
+
+Fri Jul  3 14:30:18 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* win32/file.c: some mingw compilers need a tweek for the
+	  declarations of _wfreopen_s.  [Bug #11320]
+
+Fri Jul  3 12:25:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* transcode.c (rb_econv_set_replacement): target encoding name can
+	  be empty now.  [ruby-core:69841] [Bug #11324]
+
+Fri Jul  3 07:21:06 2015  Eric Wong  <e@80x24.org>
+
+	* benchmark/bm_io_nonblock_noex.rb: new benchmark
+	* ext/openssl/ossl_ssl.c (no_exception_p): new function
+	  (ossl_start_ssl): adjust for no_exception_p
+	  (ossl_ssl_connect): adjust ossl_start_ssl call
+	  (ossl_ssl_connect_nonblock): ditto
+	  (ossl_ssl_accept): ditto
+	  (ossl_ssl_accept_nonblock): ditto
+	  (ossl_ssl_read_internal): adjust for no_exception_p
+	  (ossl_ssl_write_internal): ditto
+	  (ossl_ssl_write): adjust ossl_write_internal call
+	  (ossl_ssl_write_nonblock): ditto
+	* ext/stringio/stringio.c (strio_read_nonblock):
+	  delay exception check
+	* io.c (no_exception_p): new function
+	  (io_getpartial): call no_exception_p
+	  (io_readpartial): adjust for io_getpartial
+	  (get_kwargs_exception): remove
+	  (io_read_nonblock): adjust for io_getpartial,
+	  check no_exception_p on EOF
+	  (io_write_nonblock): call no_exception_p
+	  (rb_io_write_nonblock): do not check `exception: false'
+	  (argf_getpartial): adjust for io_getpartial
+	  [ruby-core:69778] [Feature #11318]
+
+Fri Jul  3 07:13:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (replace_real_basename): Win32 API does not set errno, get
+	  the last error by GetLastError() and map to errno.  [Bug #10015]
+
+Thu Jul  2 21:32:06 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (replace_real_basename): show warnings at errors.
+	  [Bug #10015]
+
+Thu Jul  2 18:39:20 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c: remove `#define RGENGC_OBJ_INFO 1' line introduced to
+	  debug Bug #11244.
+
+Thu Jul  2 18:34:26 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (rb_raw_obj_info): separated from rb_obj_info().
+	  Fill internal object information into passed buffer.
+
+	* gc.h: declare rb_raw_obj_info().
+
+Thu Jul  2 16:15:04 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (replace_real_basename): update path type by the target
+	  attributes if possible, to improve the performance.  [Bug #10015]
+
+Thu Jul  2 14:45:53 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* st.c: get rid of VC++'s warnings of C4700 (uninitialized local
+	  variable used).  I think that these are wrong, but should shut them
+	  up.
+
+Thu Jul  2 14:15:50 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/rubygems.rb (Gem.load_path_insert_index): search
+	  @gem_prelude_index first.
+
+	* lib/rubygems/test_case.rb (Gem::TestCase#setup): keep already
+	  expanded paths to preserve instance variables.
+
+Thu Jul  2 14:12:01 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ruby.c (process_options): also copy initial load path marks at
+	  setting load paths encoding.
+
+Thu Jul  2 12:26:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* test/rubygems/test_gem_server.rb (process_based_port): use
+	  dynamically chosen port numbers to get rid of conflicts.
+
+Thu Jul  2 11:58:59 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/rubygems/test_gem_specification.rb: skip tests which the
+	  platform does not permit the filename of its test file.
+
+Thu Jul  2 11:36:20 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* test/rubygems/test_gem_resolver_git_specification.rb: require
+	  rubygems/installer.rb before Gem::TestCase#setup runs, otherwise
+	  as Gem::TestCase#teardown restores $LOADED_FEATURES to the state
+	  at that time, the requiring the file in GitSpecification#install
+	  method causes a lot of constant redefinitions.
+
+Thu Jul  2 10:43:36 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/rubysocket.h: flags for common socket families
+	  (rsock_getfamily): update signature
+	* include/ruby/io.h: comment socket FMODE flags
+	* ext/socket/init.c (rsock_getfamily): memoize family
+	* ext/socket/basicsocket.c: adjust rsock_getfamily calls
+	* ext/socket/ancdata.c: ditto
+	  [ruby-core:69713] [Feature #11298]
+
+Thu Jul  2 10:30:01 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/rubygems/resolver.rb: fixed NameError of Gem::Util::NULL_DEVICE.
+
+Thu Jul  2 09:51:44 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/rubygems/resolver.rb: fix error of null device reference with DOSISH
+	  platform.
+
+Thu Jul  2 06:49:44 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/rubygems: Update to RubyGems HEAD(c202db2).
+	  this version contains many enhancements see http://git.io/vtNwF
+	* test/rubygems: ditto.
+
+Wed Jul  1 23:50:34 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+
+	* test/net/http/test_httpresponse.rb
+	(HTTPResponseTest#test_read_body_content_encoding_deflate_uppercase):
+	fix a failure without zlib.
+
+Wed Jul  1 10:54:56 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* Add test for Enumerable#none? [fix GH-950] Patch by @yui-knk
+
+Wed Jul  1 09:30:36 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* struct.c (struct_set_members): hide internal back_members
+	  object, and members object does not need to be duped as it
+	  should be frozen and hidden.
+
+Wed Jul  1 09:28:47 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* struct.c (struct_member_pos): revert r51080 to fix other
+	  implicit conversions but cast the return value to fix the
+	  previous implicit conversion.
+
+Wed Jul  1 08:47:24 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* struct.c (struct_member_pos): avoid implicit conversion loses
+	  integer precision: 'long' to 'int'.
+
+Wed Jul  1 05:57:03 2015  Eric Wong  <e@80x24.org>
+
+	* vm_method.c (rb_add_method_iseq): add RB_GC_GUARD
+	* class.c (clone_method): remove RB_GC_GUARD
+	* struct.c (define_aref_method): ditto
+	  (define_aset_method): ditto
+	* vm.c (vm_define_method):
+	* iseq.c (rb_iseq_clone): add RB_GC_GUARD
+
+Wed Jul  1 05:43:58 2015  Eric Wong  <e@80x24.org>
+
+	* struct.c (AREF_HASH_THRESHOLD): new macro
+	  (id_back_members): new ID
+	  (struct_member_pos_ideal): new function
+	  (struct_member_pos_probe): ditto
+	  (struct_set_members): ditto
+	  (struct_member_pos): ditto
+	  (rb_struct_getmember): use struct_member_pos for O(1) access
+	  (rb_struct_aref_sym): ditto
+	  (rb_struct_aset_sym): ditto
+	  (setup_struct): call struct_set_members
+	  (struct_define_without_accessor): ditto
+	  (Init_Struct): initialize __members_back__
+	  [ruby-core:66851] [ruby-core:69705] [ruby-core:69821]
+
+Tue Jun 30 23:12:08 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (rb_io_reopen): FilePathValue() ensures the path
+	  NUL-terminated and frozen, so it is unnecessary to make it shared.
+
+Tue Jun 30 23:11:53 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (check_dirname): ensure path name NUL-terminated for
+	  SHARABLE_MIDDLE_SUBSTRING.
+
+	* io.c (rb_sysopen): ditto.
+
+Tue Jun 30 18:38:16 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/file.c (rb_freopen): need to terminate by NUL.
+
+Tue Jun 30 17:28:25 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (rb_io_reopen): freopen(3) with OS encoding path.
+	  [ruby-core:69780] [Bug #11320]
+
+	* win32/file.c (rb_freopen): wrapper of wchar version freopen(3).
+	  use _wfreopen_s() if available.
+
+Tue Jun 30 08:24:08 2015  Eric Wong  <e@80x24.org>
+
+	* io.c (rb_io_oflags_modestr): handle O_TRUNC correctly
+	* test/ruby/test_io.rb (test_reopen_stdio): new test
+	  Patch-by: cremno phobia <cremno@mail.ru>
+	  [ruby-core:69779] [Bug #11319]
+
+Tue Jun 30 02:47:02 2015  Eric Wong  <e@80x24.org>
+
+	* include/ruby/st.h (struct st_table): hide struct list_head
+	* st.c (struct st_table_entry): adjust struct
+	  (head, tail): remove shortcut macros
+	  (st_head): new wrapper function
+	  (st_init_table_with_size): adjust to new struct and API
+	  (st_clear): ditto
+	  (add_direct): ditto
+	  (unpack_entries): ditto
+	  (rehash): ditto
+	  (st_copy): ditto
+	  (remove_entry): ditto
+	  (st_shift): ditto
+	  (st_foreach_check): ditto
+	  (st_foreach): ditto
+	  (get_keys): ditto
+	  (get_values): ditto
+	  (st_values_check): ditto
+	  (st_reverse_foreach_check): ditto (unused)
+	  (st_reverse_foreach): ditto (unused)
+	  [ruby-core:69726] [Misc #10278]
+
+Mon Jun 29 17:38:01 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* insns.def (defineclass): do not quote unprintable characters at
+	  raising an exception.
+
+Mon Jun 29 16:01:24 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/net/http/response.rb (inflater): CONTENT_ENCODING can be upper
+	  case. [ruby-core:69670] [Bug #11285] patched by Andy Chu
+
+Mon Jun 29 14:50:08 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* eval.c (add_activated_refinement): should not include the original
+	  class.
+
+Mon Jun 29 12:09:10 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* README.md: tweak styles. [fix GH-945][ci skip] Patch by @bryndyment
+
+Mon Jun 29 07:23:55 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* template/sizes.c.tmpl: extract RUBY_DEFINT to define sizes of
+	  types checked by configure.in, and fix size of intptr_t in
+	  universal binary.
+
+Mon Jun 29 02:10:10 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* insns.def (defineclass): preserve encoding of name in error
+	  messages for super class mismatch.
+
+	* insns.def (defineclass): preserve encoding of name in error
+	  messages for non-class super.
+
+	* insns.def (defineclass): preserve encoding of name in error
+	  messages when already defined but type mismatch.
+
+Sun Jun 28 12:07:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* class.c (rb_define_class_id_under): raise TypeError exception
+	  same as ruby level class definition when superclass mismatch.
+
+Sun Jun 14 19:02:03 2015  Benoit Daloze  <eregontp@gmail.com>
+
+	* lib/net/ftp.rb (makeport): close the TCPServer
+	  when sending the port fails.
+
+	* test/net/ftp/test_ftp.rb: test for above.
+
+Fri Jun 26 12:48:37 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* transcode.c (load_transcoder_entry): fix transcoder loading race
+	  condition, by waiting in require.  [ruby-dev:49106] [Bug #11277]
+
+Fri Jun 26 07:53:56 2015  Eric Wong  <e@80x24.org>
+
+	* enum.c (enum_minmax): simplify return value creation
+	* test/ruby/test_enum.rb: test behavior on empty
+	* hash.c (rb_hash_fetch_m): remove unnecessary volatile since r41597
+	  (env_reject_bang): trade volatile for GC guard
+	  (env_select): ditto
+	  (env_select_bang): ditto
+	  (env_keep_if): ditto
+	  (rb_env_clear): ditto
+
+Thu Jun 25 21:24:28 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* test/-ext-/popen_deadlock/test_popen_deadlock.rb: test [Bug #11265]
+
+	* ext/-test-/popen_deadlock/infinite_loop_dlsym.c: new ext to call
+	  dlsym(3) infinitely without GVL, used in the above test.
+
+	* ext/-test-/popen_deadlock/extconf.rb: extconf.rb for the above
+	  ext. Currently, only enabled on Solaris (main target) and Linux
+	  (as a reference platform and for debugging the ext).
+
+Thu Jun 25 19:24:25 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* configure.in: not to use vfork on Solaris to avoid deadlock
+	  occurred in vfork(2) with multi-threading and dynamic linker
+	  on Solaris. [Bug #11265] [ruby-dev:49089]
+
+Thu Jun 25 18:25:41 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* test/lib/envutil.rb (Test::Unit::Assertions#assert_no_memory_leak):
+	  NO_MEMORY_LEAK_ENVS is moved to Memory::NO_MEMORY_LEAK_ENVS
+	  to reduce child executions during test-all on Solaris.
+
+	* test/lib/memory_status.rb (Memory::NO_MEMORY_LEAK_ENVS): ditto.
+
+Thu Jun 25 17:32:33 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_method.c (rb_method_entry_create): need to call
+	  method_definition_reset() if def is given.
+
+	  Actually, `me' is a new object, so we don't need to call it.
+	  It is just to make sure.
+
+	* vm_method.c (method_definition_reset): remove duplicated insertion.
+
+	* vm_method.c (rb_method_entry_clone): assign dst->def here,
+	  not in method_definition_reset().
+
+Thu Jun 25 16:44:54 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_method.c: make a rb_method_definition_t data (def) *after* making
+	  a rb_method_entry_t data (me).
+
+	  Normally, `me' points `def'. Some Ruby objects pointed from `def'
+	  and objects are marked by `me' (mark_method_entry() in gc.c).
+	  However, `def' is built before making a `me', then nobody can mark
+	  objects pointed from `def' before making (and pointing from) `me'.
+
+	  I hope this patch solve #11244.
+
+	* vm_method.c: remove `rb_' prefix from some static functions.
+
+	* method.h (rb_method_entry_create): constify
+
+	* gc.c (mark_method_entry): add checking `def' and
+	  `def->body.iseq.iseqptr' availability because they can be NULL.
+
+Thu Jun 25 14:14:16 2015  takiy33  <takiy33@gmail.com>
+
+	* test/test_prime.rb (test_eratosthenes_works_fine_after_timeout):
+	  use spaces instead of TABs in ruby codes.  [Fix GH-944]
+
+Thu Jun 25 07:08:35 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (obj_info, method_type_name): show method type name in a string
+	  instead of a number.
+
+Thu Jun 25 06:49:25 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (obj_info): show more details for T_IMEMO/imemo_ment.
+
+Thu Jun 25 06:40:46 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_method.c (rb_method_definition_reset): need a WB for
+	  VM_METHOD_TYPE_ATTRSET.
+
+Thu Jun 25 03:33:21 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (RGENGC_OBJ_INFO, obj_info): add a macro to enable/disable
+	  rich obj_info() output.
+
+	  At the default, the value of RGENGC_OBJ_INFO is
+	  (RGENGC_DEBUG | RGENGC_CHECK_MODE).
+
+	* gc.c (RGENGC_OBJ_INFO): force enable it to debug #11244.
+
+	* gc.c (gc_mark_ptr): print more details with obj_info().
+
+	* gc.c (gc_mark_children): remove useless debug prints.
+
+Thu Jun 25 02:40:33 2015  Eric Wong  <e@80x24.org>
+
+	* ext/openssl/ossl_ssl.c (ossl_ssl_read_internal):
+	  do not process kwargs in blocking mode
+	* test/openssl/test_ssl.rb: test sysread
+
+Wed Jun 24 16:54:11 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (gc_mark_children): add additional debug code for #11244.
+
+Wed Jun 24 16:05:42 2015  Eric Wong  <e@80x24.org>
+
+	* string.c (rb_str_justify): use RB_GC_GUARD
+
+Wed Jun 24 14:25:17 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (gc_mark_ptr): add a check code for #11244.
+
+	  It should be removed later. But we can remain this check
+	  because it is only a branch.
+
+Wed Jun 24 12:49:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (rb_fstring_cstr): new function to make a fstring from
+	  a string literal.
+
+	* internal.h (rb_fstring_lit): new macro to make a fstring from a
+	  string literal.
+
+	* include/ruby/intern.h (rb_strlen_lit): new macro to get the
+	  length of a string literal, borrowed from mruby/mruby@e4afd53.
+
+Wed Jun 24 12:21:16 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* re.c: Update documentation for Regexp class.
+	  [fix GH-937][ci skip] Patch by @davydovanton
+
+Wed Jun 24 09:23:03 2015  Eric Wong  <e@80x24.org>
+
+	* variable.c (generic_ivar_set): remove FL_ABLE check
+	  (gen_ivar_copy): ditto
+	  [ruby-core:69715]
+
+Wed Jun 24 08:28:15 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/ancdata.c (bsock_recvmsg_internal): reduce stack use
+	  [ruby-core:69595] [Feature #11263]
+
+Tue Jun 23 14:32:42 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* error.c (name_err_receiver): raise ArgumentError if no receiver
+	  is available on this exception object.  [Feature #10881]
+
+Tue Jun 23 09:48:34 2015  Eric Wong  <e@80x24.org>
+
+	* dir.c (check_dirname): avoid volatile, use return value
+	  (dir_s_chroot, dir_s_mkdir, dir_s_rmdir): adjust callers
+
+Tue Jun 23 06:37:10 2015  Eric Wong  <e@80x24.org>
+
+	* struct.c (struct_ivar_get): cache member definition in a subclass
+	  Thanks to Sokolov Yura aka funny_falcon <funny.falcon@gmail.com>
+	  in https://bugs.ruby-lang.org/issues/10585
+
+Tue Jun 23 04:58:06 2015  Eric Wong  <e@80x24.org>
+
+	* benchmark/bm_vm2_struct_big_href_hi.rb: new benchmark
+	* benchmark/bm_vm2_struct_big_href_lo.rb: ditto
+	* benchmark/bm_vm2_struct_big_hset.rb: ditto
+	* benchmark/bm_vm2_struct_small_href.rb: ditto
+	* benchmark/bm_vm2_struct_small_hset.rb: ditto
+	  Thanks to Sokolov Yura aka funny_falcon <funny.falcon@gmail.com>
+	  in https://bugs.ruby-lang.org/issues/10585
+
+Mon Jun 22 18:08:48 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* test/lib/test/unit.rb (Test::Unit::Parallel#start_watchdog): removed
+	  because it has been meaningless since r36385. [Bug #11288]
+
+	* test/lib/test/unit.rb (Test::Unit::Parallel#_run_parallel): delete
+	  lines related to the removed start_watchdog method
+
+Sun Jun 21 23:52:46 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+
+	* NEWS: mention about Array#bsearch_index and Hash#fetch_values.
+
+Sun Jun 21 23:46:27 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+
+	* NEWS: add a reference to a ticket.
+
+Sun Jun 21 20:28:09 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* internal.h (roomof): extract from type_roomof, and move from
+	  bignum.c.
+
+Sun Jun 21 18:32:37 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ruby_atomic.h (ATOMIC_PTR_CAS): define by generic CAS macro, not
+	  via size_t, to suppress a warning by mingw gcc.
+
+Sun Jun 21 05:31:41 2015  Shota Fukumori  <her@sorah.jp>
+
+	* ext/objspace/objspace_dump.c(dump_object): Return empty JSON object when
+	  passed object is a special const, instead of SEGV.
+	  Based patch by Kohei Suzuki (eagletmt). [ruby-core:69692] [Bug #11291]
+
+	* test/objspace/test_objspace.rb(test_dump_special_consts): Test for above fix.
+
+
+Sat Jun 20 03:56:58 2015  Yusuke Endoh  <mame@ruby-lang.org>
+
+	* enc/make_encmake.rb: the list of encoding extension libraries must
+	  not include encinit.c itself.  It caused "undefined reference to
+	  Init_encinit".
+
+Sat Jun 20 02:03:53 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* process.c (rb_execarg_parent_start1): new macro ALWAYS_NEED_ENVP
+	  to generate envp_str anytime on Solaris 10 (or earlier version
+	  of Solaris) to avoid calling execv() which is async-signal unsafe
+	  on Solaris 10. [Bug #11265] [ruby-dev:49089]
+
+	* process.c (exec_with_sh, proc_exec_cmd): On Solaris 10,
+	  because ALWAYS_NEED_ENVP is 1 and envp_str is always generated,
+	  execv() in exec_with_sh() and proc_exec_cmd() are never called.
+	  To guarantee this, execv() is replaced by a macro to print
+	  out error message on Solaris 10.
+
+	* process.c (proc_exec_sh): Because proc_exec_sh() may be called
+	  by rb_proc_exec() with envp_str = Qfalse, execl() is replaced
+	  by a macro that calls execle() with "extern char **environ"
+	  traditional global variable on Solaris 10.
+	  TODO: This may be unsafe and should be changed in the future.
+	  Although rb_proc_exec() is not used from inside current version
+	  of ruby, it may be called by third-party extensions.
+
+Sat Jun 20 01:10:13 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+
+	* NEWS: mention about $SAFE.
+
+Fri Jun 19 14:53:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* proc.c (rb_mod_define_method): now requires a block direct to
+	  this method call.  [ruby-core:69655] [Bug #11283]
+
+Fri Jun 19 13:54:43 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* proc.c (rb_mod_define_method): get rid of inadvertent ID
+	  creations at error.
+
+Fri Jun 19 07:58:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/extmk.rb: if no with-ext option is given, default to
+	  enable everything.  [ruby-dev:49108] [Bug #11280]
+
+Fri Jun 19 06:30:07 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* bootstraptest/test_method.rb: remove a test because $SAFE=2 was
+	  obsolete.
+
+	  Please check btest, too.
+
+Thu Jun 18 23:51:51 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+
+	* bin/erb: $SAFE=3 is obsolete.
+
+Thu Jun 18 23:45:11 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+
+	* safe.c: removed needless doc related $SAFE=2
+
+Thu Jun 18 23:38:07 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* thread.c (rb_thread_safe_level): fix document.  $SAFE=3 is obsolete.
+	  [ci skip]
+
+Thu Jun 18 23:25:51 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/extmk.rb: configure intersection of with-ext and not
+	  without-ext, as withouts is no longer true by default if
+	  with-ext option is given.  [ruby-dev:49108] [Bug #11280]
+
+Thu Jun 18 23:20:46 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* include/ruby/ruby.h: $SAFE=2 is now obsolete.
+
+	* dir.c, ext/fiddle/handle.c, ext/socket/basicsocket.c, file.c
+	  gc.c, io.c, process.c, safe.c, signal.c, win32/file.c:
+	  removed code for $SAFE=2
+
+	* test/erb/test_erb.rb, test/fiddle/test_handle.rb
+	  test/ruby/test_env.rb: removed tests for $SAFE=2.
+
+Thu Jun 18 22:50:07 2015  Yusuke Endoh  <mame@ruby-lang.org>
+
+	* enc/make_encmake.rb: added --transes and --no-transes options.
+
+Thu Jun 18 18:24:12 2015  Eric Wong  <e@80x24.org>
+
+	* test/socket/test_unix.rb: replace sleep with select
+
+Thu Jun 18 17:59:06 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm.c (rb_vm_control_frame_id_and_class): remove useless codes.
+	  `me' knows ID and owner class.
+
+Thu Jun 18 16:58:35 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* method.h: constify rb_method_alias_struct::original_me and
+	  rb_method_refined_struct::orig_me.
+
+	* class.c (move_refined_method): use RB_OBJ_WRITE() for
+	  me->def->body.refined.orig_me.
+
+Thu Jun 18 14:35:28 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* ext/objspace/objspace.c (count_imemo_objects): support imemo_ment.
+
+Thu Jun 18 13:32:46 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* error.c (name_err_receiver): add NameError#receiver method.
+	  [Feature #10881]
+
+Thu Jun 18 10:00:06 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* safe.c: removed needless doc related $SAFE=3
+
+Thu Jun 18 09:59:23 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* safe.c: rename old method name for $SAFE=3
+
+Thu Jun 18 06:02:42 2015  Eric Wong  <e@80x24.org>
+
+	* compile.c (get_exception_sym2type, iseq_build_from_ary_body):
+	  rely on %+PRIsVALUE instead of calling rb_inspect directly
+
+Wed Jun 17 20:59:25 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* common.mk (ENC_MK): needs fake.rb if cross compilation.
+	  [ruby-dev:49098] [Bug #11272]
+
+Wed Jun 17 20:23:29 2015  Tanaka Akira  <akr@fsij.org>
+
+	* ext/rbconfig/sizeof/extconf.rb: Check __float80.
+
+Wed Jun 17 15:15:53 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* safe.c (safe_setter): of course, don't have to warn the limitation of
+	  $SAFE=3 after it's removed.
+
+Wed Jun 17 14:29:43 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* include/ruby/ruby.h: $SAFE=3 is now obsolete.
+
+	* ext/socket/init.c, ext/socket/socket.c, ext/socket/tcpsocket.c
+	  ext/socket/udpsocket.c, gc.c, object.c, re.c, safe.c: removed code
+	  for $SAFE=3
+
+	* bootstraptest/test_method.rb, test/erb/test_erb.rb, test/ruby/test_dir.rb
+	  test/ruby/test_file.rb, test/ruby/test_method.rb, test/ruby/test_regexp.rb
+	  test/ruby/test_thread.rb: remove tests for $SAFE=3
+
+Wed Jun 17 12:13:33 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ChangeLog: added contributor name.
+
+Wed Jun 17 10:57:28 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/csv.rb: accept to use Range object for row selection.
+	  contributed by Mitsutaka Mimura.
+	  [Feature #11267][ruby-dev:49091]
+
+Wed Jun 17 09:50:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/rdoc/servlet.rb (documentation_search, root_search):
+	  requires json for JSON.dump and fix sporadic failures due to
+	  the loading order.
+
+Tue Jun 16 19:19:53 2015  Tanaka Akira  <akr@fsij.org>
+
+	* ext/rbconfig/sizeof/extconf.rb: Check several types defined in C99
+	  and x86_64 ABI.
+
+	* template/sizes.c.tmpl: Relax a pattern for types.
+
+Tue Jun 16 17:37:01 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* test/objspace/test_objspace.rb: relax pattern because uncollectible
+	  flag and marked flag can be false at major GC.
+	  [Bug #10852]
+
+Tue Jun 16 04:50:44 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/basicsocket.c (bsock_recv): document outbuf
+	* ext/socket/unixsocket.c (unix_recvfrom): ditto
+	* ext/socket/init.c (rsock_strbuf, recvfrom_locktmp): new functions
+	  (rsock_s_recvfrom): support destination buffer as 3rd arg
+	  (rsock_s_recvfrom_nonblock): ditto
+	* string.c (rb_str_locktmp_ensure): export for internal ext
+	* test/socket/test_nonblock.rb: test recv_nonblock
+	* test/socket/test_unix.rb: test recv
+	  [ruby-core:69543] [Feature #11242]
+
+Tue Jun 16 04:38:02 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/ancdata.c (bsock_sendmsg_internal,
+	  bsock_recvmsg_internal):
+	  support "exception: false" kwarg
+	* ext/socket/init.c (rsock_s_recvfrom_nonblock):
+	  ditto
+	* ext/socket/init.c (rsock_s_recvfrom_nonblock): use rsock_opt_false_p
+	* ext/socket/socket.c (sock_connect_nonblock): ditto
+	* ext/socket/rubysocket.h (rsock_opt_false_p): new function
+	* ext/socket/basicsocket.c (bsock_recv_nonblock): update rdoc
+	* ext/socket/udpsocket.c (udp_recvfrom_nonblock): ditto
+	* test/socket/test_nonblock.rb: new tests
+	  [ruby-core:69542] [Feature #11229]
+
+Mon Jun 15 14:33:02 2015  Akinori MUSHA  <knu@iDaemons.org>
+
+	* lib/set.rb: Make Set#each and SortedSet#each generate a sized
+	  enumerator. [GH-931] by kachick (Kenichi Kamiya)
+
+	* test/test_set.rb: Import tests from Set into SortedSet. [GH-931]
+	  by kachick (Kenichi Kamiya)
+
+Mon Jun 15 02:26:34 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/net/http.rb (Net::HTTP#connect): use connect_nonblock and
+	  io/wait to eliminate timeout use. fix GH-899
+
+Sat Jun 13 07:21:18 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+
+	* thread.c (thread_start_func_2): don't interrupt when last thread
+	  exit unless main thread is already exited. Otherwise main thread
+	  could be wrongly interrupted when it uses rb_thread_call_without_gvl().
+	  Patch by Takehiro Kubo. [Bug #11237][ruby-dev:49044][GH-898]
+
+	* test/-ext-/gvl/test_last_thread.rb: new test for the above fix.
+
+	* ext/-test-/gvl/call_without_gvl/call_without_gvl.c: new ext for
+	  the above test.
+	* ext/-test-/gvl/call_without_gvl/extconf.rb: ditto.
+
+Mon Jun 15 00:14:33 2015  Tanaka Akira  <akr@fsij.org>
+
+	* ext/pathname/lib/pathname.rb (descend): Blockless form supported.
+	  (ascend): Ditto.
+	  [ruby-core:68820] [Feature #11052] Patch by Piotr Szotkowski.
+
+Sun Jun 14 20:09:25 2015  Tanaka Akira  <akr@fsij.org>
+
+	* time.c (time_getlocaltime): [DOC] Add examples of valid utc_offset
+	  formats.
+	  [ruby-core:68306] [Misc #10905] Patch by Charles Korn.
+
+Sun Jun 14 18:49:56 2015  Tanaka Akira  <akr@fsij.org>
+
+	* ext/socket/raddrinfo.c (parse_numeric_port): Detect
+	  port overflow.
+	  (numeric_getaddrinfo): Use parse_numeric_port.
+	  numeric_getaddrinfo fails if port is too big now.
+	  This makes rb_getaddrinfo invokes the real getaddrinfo()
+	  on such condition.
+	  This change is related to [ruby-core:69355] [Bug #11179].
+
+Sun Jun 14 17:26:03 2015  Tanaka Akira  <akr@fsij.org>
+
+	* enum.c (enum_chunk_while): New method Enumerable#chunk_while.
+	  [ruby-core:67738] [Feature #10769] proposed by Tsuyoshi Sawada.
+
+Sun Jun 14 17:20:40 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* file.c (rb_file_load_ok): try opening file without gvl not to
+	  lock entire process.  [Bug #11060]
+
+Sun Jun 14 10:43:50 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* tool/runruby.rb: just remove the lines of RUBY_VERSION check and raise
+	  instead of replacing the check to `true`, for getting rid of a
+	  warning `possibly useless use of true in void context`.
+
+Sun Jun 14 10:13:55 2015  Kouhei Sutou  <kou@cozmixng.org>
+
+	* lib/rexml/source.rb (REXML::IOSource#scan): Fix a typo in
+	  document. [fix GH-934]
+	  Patch by Anton Davydov. Thanks!!!
+
+Sun Jun 14 10:09:48 2015  Kouhei Sutou  <kou@cozmixng.org>
+
+	* lib/rexml/attlistdecl.rb (REXML::AttlistDecl): Fix a typo in
+	  document. [fix GH-934]
+	  Patch by Anton Davydov. Thanks!!!
+
+Sun Jun 14 06:24:57 2015  Benoit Daloze  <eregontp@gmail.com>
+
+	* test/ruby/test_io.rb: add test for IO.binread fd leak.
+	  See r50881.
+
+Sun Jun 14 05:23:51 2015  Benoit Daloze  <eregontp@gmail.com>
+
+	* io.c (rb_io_s_binread): close fd if seek offset is invalid.
+
+Sun Jun 14 04:40:32 2015  Benoit Daloze  <eregontp@gmail.com>
+
+	* test/lib/leakchecker.rb (check): refactor.
+
+Sun Jun 14 04:34:14 2015  Benoit Daloze  <eregontp@gmail.com>
+
+	* test/lib/leakchecker.rb: Return false for no leaks.
+	  Otherwise the GC could run for nothing.
+
+Sun Jun 14 04:15:40 2015  Benoit Daloze  <eregontp@gmail.com>
+
+	* lib/delegate.rb: [DOC] Update SimpleDelegator example. [ci skip]
+
+Sat Jun 13 20:28:14 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* file.c (rb_stat_ino): get inode from the interval of struct st.
+
+	* win32/win32.c (stati64_set_inode): get nFileIndexHigh/Low, and set it
+	  to the interval of struct st as inode.
+	  [Feature #11216]
+
+	* win32/win32.c (stati64_set_inode_handle): call stati64_set_inode.
+
+	* win32/win32.c (rb_w32_fstati64): call stati64_set_inode_handle.
+
+	* win32/win32.c (stati64_handle): call stati64_set_inode.
+
+Sat Jun 13 19:44:53 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ext/io/console/depend (.list.chksum): revert a part of r50859, because
+	  it was not mentioned at its commit log and it caused a build error on
+	  Windows ($(MAKE) is already quoted).
+
+Sat Jun 13 17:35:11 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* vm_core.h (rb_thread_t): add th->name.
+
+	* vm.c (th_init): initialize th->name.
+
+	* thread.c (Init_Thread): add Thread.name and name=. [Feature #11251]
+
+	* thread.c (rb_thread_inspect): show thread's name if set.
+
+	* thread.c (rb_thread_getname): defined.
+
+	* thread.c (rb_thread_setname): ditto.
+
+Sat Jun 13 11:39:43 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/tempfile.rb: Fix typo. [fix GH-933] Patch by @Zorbash
+
+Sat Jun 13 11:38:00 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ext/openssl/ossl_ocsp.c: fix documentation on ocsp response cert status.
+	  [fix GH-932] Patch by @chrisholmes
+
+Sat Jun 13 11:35:19 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ext/bigdecimal/bigdecimal.gemspec: Fix require paths for released gem.
+	  [fix GH-929] Patch by @voxik
+	* ext/io/console/io-console.gemspec: ditto.
+
+Sat Jun 13 00:45:08 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+
+	* lib/prime.rb: Return sized enumerators.
+	  Patch by Kenichi Kamiya [GH-931]
+
+Sat Jun 13 00:45:06 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+
+	* lib/prime.rb: Fix with_object with no block given
+
+Sat Jun 13 00:44:59 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+
+	* lib/prime.rb: Have with_index accept an offset parameter.
+	  Based on patch by T Yamada. [#11007]
+
+Fri Jun 12 22:21:12 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+
+	* test/ruby/test_extlibs.rb (TestExtLibs::check_existence): fix
+	  error. [Bug #11255] [ruby-dev:49079]
+
+Fri Jun 12 21:17:46 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* pack.c (pack_{un,}pack): new template character `j` and `J`, pointer
+	  with signed and unsigned integers.
+
+	* NEWS: mention about this feature.
+	  [Feature #11215] [ruby-dev:49015]
+
+Fri Jun 12 21:01:44 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* file.c (File::SHARE_DELETE): new flag to be able to delete opened file
+	  on Windows.
+
+	* include/win32/win32.c (O_SHARE_DELETE): new pseudo file mode flag.
+
+	* win32/win32.c (rb_w32_{w,}open): support above flag.  [EXPERIMENTAL]
+
+	* NEWS: mention about this feature.
+	  [Feature #11218] [ruby-dev:49022]
+
+Fri Jun 12 18:21:45 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ChangeLog: added missing commit message.
+
+Fri Jun 12 18:20:37 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* sample/exyacc.rb: Fix some typos. [fix GH-927] Patch by @davydovanton
+	* sample/list.rb: ditto.
+	* sample/trick2013/kinaba/remarks.markdown: ditto.
+
+Fri Jun 12 17:34:14 2015  Wojciech Mach  <wojtek@wojtekmach.pl>
+
+	* hash.c (rb_hash_fetch_values): add `Hash#fetch_values`.
+	  [Feature #10017] [Fix GH-776]
+
+Fri Jun 12 16:28:17 2015  Radan Skoric  <radan.skoric@gmail.com>
+
+	* array.c (rb_ary_bsearch_index): Implement Array#bsearch_index
+	  method, which is similar to bsearch and returns the index or
+	  nil.  [Feature #10730]
+
+Thu Jun 11 19:11:22 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ext/zlib/zlib.c: Fix indentation for rdoc.
+	  [Bug #11221][ruby-core:69465]
+
+Thu Jun 11 16:23:37 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* method.h (METHOD_ENTRY_BASIC_SET): fix last commit (unbalanced parens).
+
+Thu Jun 11 15:14:16 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* configure.in: define SET_THREAD_NAME if it has pthread_set_name_np
+	  for FreeBSD, and don't define it if both pthread_setname_np
+	  and pthread_set_name_np don't exist.
+
+	* thread_pthread.c (SET_THREAD_NAME): don't define if they don't exist.
+
+	* thread_pthread.c (native_set_thread_name): run if SET_THREAD_NAME
+	  is defined.
+
+Thu Jun 11 15:53:31 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* method.h (METHOD_ENTRY_BASIC_SET): should clear last bit.
+
+Thu Jun 11 14:34:45 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/rubygems.rb: bump version to 2.4.7 and 2.4.8. these versions fixed
+	  CVE-2015-3900.
+	* lib/rubygems/remote_fetcher.rb: ditto.
+	* test/rubygems/test_gem_remote_fetcher.rb: added testcase for CVE-2015-3900
+
+Thu Jun 11 14:18:51 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/rubygems.rb: bump version to 2.4.6. It's missing change at r49774.
+
+Thu Jun 11 13:50:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* array.c (ary_ensure_room_for_push): check if array size will
+	  exceed maximum size to get rid of buffer overflow.
+	  [ruby-dev:49043] [Bug #11235]
+
+	* array.c (ary_ensure_room_for_unshift, rb_ary_splice): ditto.
+
+Thu Jun 11 13:17:34 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/test_cmath.rb (TestCMath#test_trigonometric_functions): should
+	  not compare float values (in complex values) by `==`.
+
+Thu Jun 11 08:52:01 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* method.h: embed rb_method_entry_t::attr::flags (5 bits) into
+	  rb_method_entry_t::flags to make one word spare space.
+
+	  Add some macros to access these flags.
+
+	* vm_method.c: use these macros.
+
+	* internal.h: define IMEMO_FL_USHIFT and IMEMO_FL_USER[0-4]
+	  for T_IMEMO local flags.
+
+Thu Jun 11 08:27:06 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm.c: use VM_ASSERT instead of assert().
+
+	* vm_args.c: ditto.
+
+	* vm_insnhelper.c: ditto.
+
+	* vm_method.c: ditto.
+
+Thu Jun 11 08:16:48 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: define VM_ASSERT() for assertion
+	  enabled only when (VM_CHECK_MODE > 0).
+
+	* vm_insnhelper.c: move definition VM_CHECK_MODE
+	  from vm_insnhelper.c to vm_core.h.
+
+	* vm.c: remove <assert.h>
+
+Thu Jun 11 06:46:07 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c (check_frame): check type of cref_or_me first.
+
+Thu Jun 11 04:34:39 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
+
+	* test/test_cmath.rb: Add some assertions.
+
+Thu Jun 11 00:34:39 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* template/fake.rb.in: expanded macro result may have spaces
+	  between tokens.  [ruby-dev:49047] [Bug #11243]
+
+Wed Jun 10 22:27:32 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* lib/mkmf.rb: revert r50804 because of build failure when specifying
+	  LDFLAGS during configure, observed on Solaris with GCC 4.6.
+	  [Bug #11245]
+
+Wed Jun 10 21:59:51 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+
+	* README.ja.md: fix markup miss.
+
+Wed Jun 10 11:06:25 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* template/fake.rb.in: turn into erb template from autoconf
+	  template to fake more accurately.
+
+	* common.mk (fake.rb): needs preprocessed file now.
+
+	* version.c (Init_version): add dummy expression to
+	  RUBY_ENGINE_VERSION.
+
+Tue Jun  9 12:31:25 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+
+	* lib/prime.rb: Simplify and optimize EratosthenesSieve
+
+Tue Jun  9 11:45:00 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+
+	* lib/prime.rb: Simplify and optimize EratosthenesSieve
+	  based on patch by Ajay Kumar. [Fixes GH-921]
+
+Mon Jun  8 05:09:58 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (obj_info): print method id for T_IMEMO/ment.
+
+Sun Jun  7 07:05:43 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
+
+	* Move test cases from test/ruby/test_complex.rb to test/test_cmath.rb
+
+Sat Jun  6 18:23:41 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* method.h: back to share rb_method_definition_t by
+	  rb_method_entry_t.
+
+	  r50728 changed sharing `def's to isolating `def's
+	  on alias and so on. However, this change conflicts
+	  future improvement plan. So I change back to sharing approach.
+
+	* method.h: move rb_method_definition_t::flags to
+	  rb_method_entry_t::attr::flags.
+
+	  rb_method_entry_t::attr is union with VALUE because this field
+	  should have same size of VALUE. rb_method_entry_t is T_IMEMO).
+
+	  And also add the following access macros to it's fields.
+
+	  * METHOD_ENTRY_VISI(me)
+	  * METHOD_ENTRY_BASIC(me)
+	  * METHOD_ENTRY_SAFE(me)
+
+	* vm_method.c (rb_method_definition_addref): added instead of
+	  rb_method_definition_clone().
+
+	  Do not create new definition, but increment alias_count.
+
+	* class.c (clone_method): catch up this fix.
+
+	* class.c (method_entry_i): ditto.
+
+	* proc.c (mnew_internal): ditto.
+
+	* proc.c (mnew_missing): ditto.
+
+	* vm_eval.c: ditto.
+
+	* vm_insnhelper.c: ditto.
+
+	* vm_method.c: ditto.
+
+Sat Jun  6 15:59:38 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* class.c: ins_methods_push() needs rb_method_visibility_t type on
+	  2nd arg.
+
+Sat Jun  6 15:05:47 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* class.c (ins_methods_push): Change type and name of parameters
+	  to make more clear.
+
+Sat Jun  6 08:52:13 2015  Eric Wong  <e@80x24.org>
+
+	* test/socket/test_nonblock.rb: try to avoid EMSGSIZE
+	  [ruby-core:69466]
+
+Sat Jun  6 07:58:30 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c: remove struct mark_tbl_arg and pass objspace directly
+	  to avoid indirect access overhead.
+
+Sat Jun  6 07:08:45 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/ancdata.c (bsock_sendmsg_internal): drop redundant assignment
+
+Sat Jun  6 01:00:06 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* ext/socket/ancdata.c (bsock_sendmsg_internal): all arguments are
+	  parsed even on systems without HAVE_STRUCT_MSGHDR_MSG_CONTROL
+	  to prevent SEGV caused by passing Qnil to RARRAY_LENINT and
+	  to preserve behavior before r50776.
+	  [Bug #11224] [ruby-core:69468] [Bug #11225] [ruby-core:69469]
+
+Fri Jun  5 22:37:42 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* class.c (ins_methods_push): change 3rd parameter's type
+	  from long to rb_method_visibility_t.
+
+	* class.c (ins_methods_i): catch up this fix.
+
+	* class.c (method_entry_i): cast to st_data_t instead of `long'.
+
+Fri Jun  5 20:37:10 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* internal.h: move definition of rb_cref_t to method.h.
+
+	* eval_intern.h: move definition of rb_scope_visibility_t
+	  to method.h.
+
+	* method.h: change rb_cref_t::scope_visi from VALUE to
+	  rb_scope_visibility_t.
+	  [Bug #11219]
+
+	* vm.c (vm_cref_new): accept rb_method_visibility_t directly.
+
+	* vm_insnhelper.c (rb_vm_rewrite_cref): don't use 0,
+	  but METHOD_VISI_UNDEF.
+
+	* vm_method.c (rb_scope_visibility_set): don't need to use cast.
+
+	* vm_method.c (rb_scope_module_func_set): ditto.
+
+Fri Jun  5 17:27:30 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/ancdata.c (bsock_sendmsg_internal): avoid msg_control
+	  ptr if msg_controllen is zero to fix portability problems.
+
+Fri Jun  5 09:17:45 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/ancdata.c (bsock_sendmsg_internal): fix build error
+	  from r50776
+
+Fri Jun  5 07:05:58 2015  Eric Wong  <e@80x24.org>
+
+	* io.c (sym_wait_readable, sym_wait_writable): declare
+	  (io_getpartial): use sym_wait_readable
+	  (io_write_nonblock): use sym_wait_writable
+	  (Init_IO): initialize sym_wait_*able
+
+Fri Jun  5 06:43:00 2015  Eric Wong  <e@80x24.org>
+
+	* doc/extension.rdoc: note rb_get_kwargs changes keywords_hash
+	  [ruby-core:68507]
+
+Fri Jun  5 05:50:29 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/ancdata.c (bsock_sendmsg_internal): use rb_scan_args
+	  [ruby-core:69439] [Feature #11207]
+
+Fri Jun  5 02:20:06 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* test/lib/envutil.rb (assert_no_memory_leak): change default value
+	  of limit from 1.5 to 2.0. It is ad-hoc fix to solve test failure
+	  in travis-ci.
+
+Fri Jun  5 01:17:21 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c (vm_defined): no need to use cast.
+
+Fri Jun  5 01:14:02 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c (vm_defined): show additional messages on rb_bug().
+
+Fri Jun  5 01:06:02 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_method.c (rb_add_method_iseq): use intermediate struct to
+	  avoid initializing struct with variables.
+	  [Bug #11217]
+
+	* method.h: add a comment about it.
+
+Fri Jun  5 00:55:21 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* method.h: constify rb_method_refined_t::orig_me.
+
+	  Also constify the following functions.
+
+	  * rb_resolve_refined_method()
+	  * rb_method_entry_with_refinements()
+	  * rb_method_entry_without_refinements()
+	  * rb_method_entry_copy()'s parameter.
+
+	* class.c: catch up this fix.
+
+	* vm_insnhelper.c: ditto.
+
+	* vm_method.c: ditto.
+
+Thu Jun  4 12:47:54 SGT 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* array.c: Revert r50763. because "reentered" is not typo.
+
+Thu Jun  4 11:12:29 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ext/win32ole/win32ole.c: fix a typo. Patch by @davydovanton
+	  [fix GH-923]
+	* include/ruby/st.h: ditto.
+	* include/ruby/util.h: ditto.
+
+Thu Jun  4 10:54:30 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* array.c: fix a typo. Patch by @manish-shrivastava
+	  [fix GH-922]
+
+Thu Jun  4 09:52:02 2015  Eric Wong  <e@80x24.org>
+
+	* ext/openssl/lib/openssl/ssl.rb: use io/nonblock instead of fcntl
+	  [ruby-core:69382] [Feature #11190]
+
+Thu Jun  4 07:22:45 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* method.h: introduce rb_method_refined_t for refined method entry.
+
+	* class.c (move_refined_method): catch up this fix.
+
+	* gc.c (mark_method_entry): ditto.
+
+	* vm_eval.c (vm_call0_body): ditto.
+
+	* vm_insnhelper.c (vm_call_method): ditto.
+
+	* vm_method.c: ditto.
+
+Thu Jun  4 07:12:20 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (dirent_match): match short names only when FNM_SHORTNAME
+	  flag is given, for the backward compatibility, and the new
+	  behavior is often dangerous.  [ruby-core:69435] [Bug #11206]
+
+Thu Jun  4 05:44:01 2015  Eric Wong  <e@80x24.org>
+
+	* variable.c (special_generic_ivar): remove flag
+	  (givar_i, rb_mark_generic_ivar_tbl): remove functions
+	  (rb_free_generic_ivar, rb_ivar_lookup, rb_ivar_delete,
+	   generic_ivar_set, rb_ivar_set, rb_ivar_defined,
+	   rb_copy_generic_ivar, rb_ivar_foreach, rb_ivar_count,
+	   rb_obj_remove_instance_variable):
+	   adjust for lack of ivar support in special constants
+	* test/ruby/test_variable.rb: test ivars for special consts
+	* internal.h: remove rb_mark_generic_ivar_tbl decl
+	* gc.c (gc_mark_roots): remove rb_mark_generic_ivar_tbl call
+	  [ruby-core:69441] [Feature #11208]
+
+Thu Jun  4 05:13:34 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c (def_iseq_ptr): `iseqval' is not available any more.
+
+Thu Jun  4 04:50:12 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* class.c (method_entry_i): mtbl should not have `me' as NULL.
+
+Thu Jun  4 04:28:45 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* class.c (clone_method): do not use me->klass, but use explicitly
+	  passed argument.
+
+Thu Jun  4 04:10:43 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h (rb_vm_rewrite_cref_stack): rename to rb_vm_rewrite_cref().
+
+	* class.c (clone_method): use renamed name.
+
+	* vm_insnhelper.c (rb_vm_rewrite_cref): do not use `node' in variable
+	  names.
+
+Wed Jun  3 23:03:50 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_method.c: rename `rb_frame_...' to `rb_scope_...'.
+
+	* eval_intern.h: move decl. of rb_scope_visibility_set() to method.h.
+
+	* load.c: catch up this fix.
+
+Wed Jun  3 21:14:20 2015  Tanaka Akira  <akr@fsij.org>
+
+	* ext/rbconfig/sizeof/extconf.rb: Check C99 standard integer types.
+
+Wed Jun  3 21:00:47 2015  Tanaka Akira  <akr@fsij.org>
+
+	* configure.in: Don't check __int128.
+
+	* ext/rbconfig/sizeof/extconf.rb: Check __int128.
+
+	* ext/rbconfig/sizeof/depend: sizes.c depends on
+	  ext/rbconfig/sizeof/extconf.rb.
+
+	* template/sizes.c.tmpl: Detect check_sizeof.
+
+Wed Jun  3 20:07:07 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* class.c (clone_method): remove redundant check for me->def != NULL.
+	  Now, all `me` have `me->def`.
+
+	* proc.c (rb_method_entry_location): ditto.
+
+	* vm.c (rb_vm_check_redefinition_opt_method): ditto.
+
+	* vm.c (add_opt_method): ditto.
+
+	* vm_eval.c (vm_call0_body): ditto.
+
+Wed Jun  3 19:24:12 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: rename enum missing_reason to enum method_missing_reason.
+
+	* vm_core.h: use enum method_missing_reason for
+	  rb_thread_t::method_missing_reason.
+
+	* vm_eval.c: catch up this fix.
+
+	* vm_insnhelper.c: ditto.
+
+Wed Jun  3 16:17:21 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* vm.c: eagerly allocate `loading_table`.  This eliminates the need to
+	  do NULL checks when looking up the `loading_table` hash.
+	  https://github.com/ruby/ruby/pull/918
+
+	* load.c: remove various NULL checks
+
+Wed Jun  3 11:47:15 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* method.h: change fields order to gather frequent access fields.
+
+	* vm_insnhelper.c (vm_call_method): add LIKELY().
+
+Wed Jun 03 10:35:45 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* method.h: split rb_method_definition_t::flag to several flags.
+
+	  `flag' contains several categories of attributes and it makes us
+	  confusion (at least, I had confused).
+
+	  * rb_method_visibility_t (flags::visi)
+	    * NOEX_UNDEF     -> METHOD_VISI_UNDEF     = 0
+	    * NOEX_PUBLIC    -> METHOD_VISI_PUBLIC    = 1
+	    * NOEX_PRIVATE   -> METHOD_VISI_PRIVATE   = 2
+	    * NOEX_PROTECTED -> METHOD_VISI_PROTECTED = 3
+	  * NOEX_SAFE(flag)  -> safe (flags::safe, 3 bits)
+	  * NOEX_BASIC       -> basic (flags::basic, 1 bit)
+	  * NOEX_MODFUNC     -> rb_scope_visibility_t in CREF
+	  * NOEX_SUPER       -> MISSING_SUPER (enum missing_reason)
+	  * NOEX_VCALL       -> MISSING_VCALL (enum missing_reason)
+	  * NOEX_RESPONDS    -> BOUND_RESPONDS (macro)
+
+	  Now, NOEX_NOREDEF is not supported (I'm not sure it is needed).
+
+	  Background:
+	    I did not know what "NOEX" stands for.
+	    I asked Matz (who made this name) and his answer was "Nothing".
+	    "At first, it meant NO EXport (private), but the original
+	    meaning was gone."
+	    This is why I remove the mysterious word "NOEX" from MRI.
+
+	* vm_core.h: introduce `enum missing_reason' to represent
+	  method_missing (NoMethodError) reason.
+
+	* eval_intern.h: introduce rb_scope_visibility_t to represent
+	  scope visibility.
+	  It has 3 method visibilities (public/private/protected)
+	  and `module_function`.
+
+Wed Jun  3 08:06:30 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* gem/bundled_gems: updated to test-unit 3.1.1 and minitest 5.7.0.
+
+Wed Jun  3 04:48:05 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c (vm_defined): check respond_to_missing?
+	  at defined?(func()).
+	  [Bug #11212]
+
+	* test/ruby/test_defined.rb: add a test for this fix.
+
+Wed Jun  3 04:34:39 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c (vm_defined): skip respond_to_missing? when
+	  a method is available.
+	  [Bug #11211]
+
+	* test/ruby/test_defined.rb: add a test for this fix.
+
+Wed Jun  3 04:14:13 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* insns.def (defined), vm_insnhelper.c (vm_defined):
+	  move instruction body to the vm_defined() function.
+
+Wed Jun  3 02:29:25 2015  Benoit Daloze  <eregontp@gmail.com>
+
+	* test/ruby/test_module.rb: Do not assume class variable order.
+	  Patch by @enebo.
+
+Wed Jun  3 01:10:38 2015  Yusuke Endoh  <mame@tsg.ne.jp>
+
+	* vm_method.c (rb_method_definition_set): remove a double assignment.
+	  Coverity Scan found this bug.
+
+Wed Jun  3 00:04:51 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_method.c (rb_alias): rename parameter names.
+
+Tue Jun  2 23:27:18 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* method.h: remove rb_method_iseq_t::iseqval.
+	  While making a r50728, iseqval is needed (to mark correctly),
+	  but now just iseqptr is enough.
+
+	* class.c: catch up this fix.
+
+	* gc.c: ditto.
+
+	* proc.c: ditto.
+
+	* vm_method.c: ditto.
+
+Tue Jun  2 21:29:28 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* proc.c (proc_curry): remove a debug line.
+
+Tue Jun  2 12:43:46 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* method.h: make rb_method_entry_t a VALUE.
+	  Motivation and new data structure are described in [Bug #11203].
+
+	  This patch also solve the following issues.
+
+	  * [Bug #11200] Memory leak of method entries
+	  * [Bug #11046] __callee__ returns incorrect method name in orphan
+	                 proc
+
+	* test/ruby/test_method.rb: add a test for [Bug #11046].
+
+	* vm_core.h: remove rb_control_frame_t::me. me is located at value
+	  stack.
+
+	* vm_core.h, gc.c, vm_method.c: remove unlinked_method... codes
+	  because method entries are simple VALUEs.
+
+	* method.h: Now, all method entries has own independent method
+	  definitions. Strictly speaking, this change is not essential,
+	  but for future changes.
+
+	  * rb_method_entry_t::flag is move to rb_method_definition_t::flag.
+	  * rb_method_definition_t::alias_count is now
+	    rb_method_definition_t::alias_count_ptr, a pointer to the counter.
+
+	* vm_core.h, vm_insnhelper.c (rb_vm_frame_method_entry) added to
+	  search the current method entry from value stack.
+
+	* vm_insnhelper.c (VM_CHECK_MODE): introduced to enable/disable
+	  assertions.
+
+Tue Jun  2 10:46:36 2015  Eric Wong  <e@80x24.org>
+
+	* test/socket/test_nonblock.rb: new test for sendmsg_nonblock
+
+Tue Jun  2 09:04:14 2015  Eric Wong  <e@80x24.org>
+
+	* lib/benchmark.rb: just use Process::CLOCK_MONOTONIC
+	  [ruby-core:69390]
+
+Mon Jun  1 22:01:27 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/mkmf.rb (pkg_config): split --libs if --libs-only-l option
+	  is not available.  patch in [ruby-core:69428] by Hans Mackowiak.
+	  [ruby-core:69421] [Bug #11201]
+
+Mon Jun  1 21:18:24 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (gc_mark_children): remove a garbage character
+	  introduced at the last commit.
+
+Mon Jun  1 19:24:42 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_method.c (rb_method_entry_make): do not show warning message
+	  when method_entry is an alias.
+
+Mon Jun  1 15:47:16 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* internal.h: move class related definitions.
+
+Mon Jun  1 15:43:03 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* class.c: remove needless include pragma for method.h.
+
+	* struct.c: ditto.
+
+	* vm_method.c: ditto.
+
+Mon Jun  1 05:42:00 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* eval_intern.h, vm_method.c: move macros to functions.
+	  * SCOPE_TEST(f)  -> rb_frame_visibility_test(flag).
+	  * SCOPE_CHECK(f) -> rb_frame_visibility_check(flag).
+	  * SCOPE_SET(f)   -> rb_frame_visibility_set(flag).
+
+	* load.c (load_ext): use it.
+
+Mon Jun  1 04:47:37 2015  Zachary Scott  <e@zzak.io>
+
+	* ext/date/date_core.c: [DOC] Add comparison of Time and DateTime
+	  Patch provided by @pixeltrix
+
+Mon Jun  1 04:22:09 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h (VM_FRAME_MAGIC_DUMMY): introduce new frame type to
+	  recognize dummy frame.
+
+	* vm.c (th_init): use new frame type.
+
+	* vm_args.c (raise_argument_error): ditto.
+
+Mon Jun  1 04:15:42 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* class.c (rb_class_has_methods): added to reduce dependency
+	  to internal class data structure.
+
+	* internal.h: ditto.
+
+	* hash.c (has_extra_methods): use added function.
+
+Mon Jun  1 04:11:48 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c , gc.h (rb_obj_info): export obj_info(VALUE) for debugging.
+
+Mon Jun  1 03:52:55 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* test/ruby/test_gc.rb: increase timeout seconds for GC stressful
+	  debugging.
+
+Sun May 31 04:18:06 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* method.h: fix typo of comments.
+
+Sun May 31 03:36:42 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* method.h: add VM_METHOD_TYPE_ALIAS rb_method_definition_t::type
+	  to fix [Bug #11173].
+
+	  Now, inter class/method alias creates new method entry
+	  VM_METHOD_TYPE_ALIAS, which has an original method entry.
+
+	* vm_insnhelper.c (find_defined_class_by_owner): added.
+	  Search corresponding defined_class from owner class/module.
+
+	* vm_method.c (rb_method_entry_get_without_cache): return me->klass
+	  directly for defined_class.
+
+	  Now, no need to check me->klass any more.
+
+	* vm_method.c (method_entry_set0): separated from method_entry_set().
+
+	* vm_method.c (rb_alias): make method entry has VM_METHOD_TYPE_ALIAS.
+
+	* vm_method.c (release_method_definition): support VM_METHOD_TYPE_ALIAS.
+
+	* vm_method.c (rb_hash_method_definition): ditto.
+
+	* vm_method.c (rb_method_definition_eq): ditto.
+
+	* vm_method.c (release_method_definition): ditto.
+
+	* vm_insnhelper.c (vm_call_method): ditto.
+
+	* vm_insnhelper.c (vm_method_cfunc_entry): ditto.
+
+	* vm_eval.c (vm_call0_body): ditto.
+
+	* gc.c (mark_method_entry): ditto.
+
+	* proc.c (method_def_iseq): ditto.
+
+	* proc.c (method_cref): ditto.
+
+	* proc.c (rb_method_entry_min_max_arity): ditto.
+
+	* test/ruby/test_alias.rb: add tests.
+
+	* test/ruby/test_module.rb: fix a test to catch up current behavior.
+
+Sun May 31 03:34:25 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_method.c (rb_unlink_method_entry): make it static.
+
+Sun May 31 03:26:58 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* method.h, vm_method.c (rb_free_method_entry): constify a parameter.
+
+	* vm_core.h: remove useless declaration about rb_unlink_method_entry().
+
+Sat May 30 18:05:02 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* lib/tempfile.rb (Remover#call): fixed wrong condition.  introduced at
+	  r50682.
+
+Sat May 30 16:12:35 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/ancdata.c: use RB_GC_GUARD instead of volatile
+	  [ruby-core:69419] [Feature #11198]
+
+Sat May 30 15:59:10 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* lib/tempfile.rb (Tempfile#initialize): initialize @unlinked to fix
+	  test failures introduced at r50682.  I hope that check the results of
+	  tests before committing, at least the tests about the changed feature.
+
+Sat May 30 11:02:55 2015  Martin Englund <martin@englund.nu>
+
+	* doc/dtrace_probes.rdoc: change lingering dtrace probe documentation
+	  from function- to method-
+
+Sat May 30 10:26:09 2015  Masaki Matsushita <glass.saga@gmail.com>
+
+	* lib/tempfile.rb: refactoring.
+	  * use warn instead of STDERR.print
+	  * remove @tmpname and use @tmpfile.path
+	  * introduce @unlinked flag
+	  * Remover takes only @tmpfile
+	  * mode will be modified just before file reopen
+
+Sat May 30 09:02:51 2015  Eric Wong  <e@80x24.org>
+
+	* include/ruby/intern.h (rb_generic_ivar_table): deprecate
+	* internal.h (rb_attr_delete): declare
+	* marshal.c (has_ivars): use rb_ivar_foreach
+	  (w_ivar): ditto
+	  (w_object): update for new interface
+	* time.c (time_mload): use rb_attr_delete
+	* variable.c (generic_ivar_delete): implement
+	  (rb_ivar_delete): ditto
+	  (rb_attr_delete): ditto
+	  [ruby-core:69323] [Feature #11170]
+
+Sat May 30 09:14:28 2015  Scott Francis  <scott.francis@shopify.com>
+
+	* cont.c (cont_free): check if ruby_current_thread is still valid.
+	  [Fix GH-914]
+
+Sat May 30 08:36:04 2015  Eric Wong  <e@80x24.org>
+
+	* variable.c (static int special_generic_ivar): move
+	  (rb_generic_ivar_table): rewrite for compatibility
+	  (gen_ivtbl_bytes): new function
+	  (generic_ivar_get): update to use ivar index
+	  (generic_ivar_update): ditto
+	  (generic_ivar_set): ditto
+	  (generic_ivar_defined): ditto
+	  (generic_ivar_remove): ditto
+	  (rb_mark_generic_ivar): ditto
+	  (givar_i): ditto
+	  (rb_free_generic_ivar): ditto
+	  (rb_mark_generic_ivar_tbl): ditto
+	  (rb_generic_ivar_memsize): ditto
+	  (rb_copy_generic_ivar): ditto
+	  (rb_ivar_set): ditto
+	  (rb_ivar_foreach): ditto
+	  (rb_ivar_count): ditto
+	  (givar_mark_i): remove
+	  (gen_ivtbl_mark): new function
+	  (gen_ivar_each): ditto
+	  (iv_index_tbl_extend): update for struct ivar_update
+	  (iv_index_tbl_newsize): ditto
+	  [ruby-core:69323] [Feature #11170]
+
+Sat May 30 08:10:46 2015  Eric Wong  <e@80x24.org>
+
+	* variable.c (iv_index_tbl_make): extract from rb_ivar_set
+	  (iv_index_tbl_extend): ditto
+	  (iv_index_tbl_newsize): ditto
+	  (rb_ivar_set): use extracted functions
+	  [ruby-core:69323] (Part 1)
+
+Fri May 29 17:39:14 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* tool/make_hgraph.rb: added.
+
+Fri May 29 14:39:00 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (iseq_compile_each): out of range NTH_REF is always
+	  nil.
+
+	* parse.y (parse_numvar): check overflow of NTH_REF and range.
+	  [ruby-core:69393] [Bug #11192]
+
+	* util.c (ruby_scan_digits): make public and add length parameter.
+
+Fri May 29 11:18:58 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/ancdata.c (bsock_sendmsg_internal,
+	  bsock_recvmsg_internal):
+	  avoid redundant fcntl on Linux
+	  [ruby-core:69154] [Feature #11145]
+	* ext/socket/init.c (rsock_s_recvfrom_nonblock): ditto
+	* ext/socket/rubysocket.h (MSG_DONTWAIT_RELIABLE): new macro
+
+Fri May 29 10:30:34 2015  Eric Wong  <e@80x24.org>
+
+	* lib/net/resolv.rb (request): use monotonic clock
+	* lib/net/http.rb (begin_transport, end_transport): ditto
+	  [ruby-core:69384] [Feature #11124]
+
+Fri May 29 04:37:38 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* ext/objspace/objspace.c: add two methods to debug internals.
+
+	  * ObjectSpace.internal_class_of: return RBASIC_CLASS(obj).
+	  * ObjectSpace.internal_super_of: return RCLASS_SUPER(cls).
+
+	* NEWS: add information about both methods.
+
+	* test/objspace/test_objspace.rb: add tests for both methods.
+
+Thu May 28 06:55:53 2015  Anton Davydov  <antondavydov.o@gmail.com>
+
+	* ext/tk/sample/figmemo_sample.rb (open_file),
+	  ext/tk/sample/tktextio.rb (TkTextIO): fix typo in messages.
+	  [Fix GH-916]
+
+Wed May 27 09:50:51 2015  Eric Wong  <e@80x24.org>
+
+	* ext/openssl/ossl_asn1.c (ossl_asn1_traverse, ossl_asn1_decode,
+	  ossl_asn1_decode_all): use RB_GC_GUARD instead of volatile
+	  [ruby-core:69371] [Bug #11185]
+
+Wed May 27 09:27:30 2015  Eric Wong  <e@80x24.org>
+
+	* lib/drb/drb.rb (set_sockopt): remove redundant fcntl call
+	* lib/drb/unix.rb (set_sockopt): ditto
+	  [ruby-core:69128] [Feature #11137]
+
+Tue May 26 22:10:43 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* vm_method.c (rb_alias): should resolve refined methods.
+	  [ruby-core:69360] [Bug #11182]
+
+Tue May 26 21:35:13 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+
+	* include/ruby/defines.h (RUBY_ATTR_ALLOC_SIZE): fix condition.
+
+Mon May 25 22:35:58 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* tool/redmine-backporter.rb (rel): after the relations is changed,
+	  @changesets is no longer right.
+
+Mon May 25 11:27:14 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* win32/win32.c (setup_overlapped): seek to the file end only when
+	  writing (mode:a), not reading (mode:a+, read).
+
+Mon May 25 00:27:37 2015  Benoit Daloze  <eregontp@gmail.com>
+
+	* numeric.c (Numeric#negative?): [DOC] Fix call-seq.
+	  Patch by @yui-knk. [Fixes GH-908]
+
+Sun May 24 01:35:22 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* debug.c (ruby_debug_print_id): use rb_id2name() for fprintf().
+
+Sat May 23 18:38:46 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* man/*.1: updated dates in man pages.
+	  [ruby-dev:48988] [Bug #11171]
+
+Sat May 23 03:10:58 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (rb_w32_write_console): should return the count of
+	  actually eaten characters, include escape sequences.
+
+Fri May 22 22:36:14 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+
+	* lib/prime.rb: Remove obsolete Prime.new
+	  patch by Ajay Kumar. [Fixes GH-891]
+
+Fri May 22 21:13:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* include/ruby/intern.h (rb_sym_count): move `rb_sym_all_symbols`
+	  to a symbol.c specific section.  a part of patch by Lourens
+	  Naude.
+
+Fri May 22 20:56:33 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* complex.c (f_complex_polar): simple bug reproduced only when y is
+	  a float but x is not a float.
+
+Fri May 22 19:42:06 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* process.c (rb_spawn_process): do not discard global escape
+	  status.  [ruby-core:69304] [Bug #11166]
+
+	* process.c (rb_execarg_spawn): extract the start procedure in a
+	  parent process with ensuring the end procedure.
+
+Fri May 22 16:48:32 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* NEWS: added news for net-telnet and rake
+
+Thu May 21 20:27:07 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* configure.in (RUBY_DTRACE_POSTPROCESS): cmp -b is GNU extension.
+	  darwin uses GNU cmp, and FreeBSD and Solaris are not.
+	  Note that accidentally equals to expected result.
+
+Thu May 21 18:00:19 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* iseq.c: constify.
+
+	* iseq.h: ditto.
+
+	* method.h: ditto.
+
+	* proc.c: ditto.
+
+	* vm_method.c: ditto.
+
+Thu May 21 17:44:53 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* proc.c: fix issues caused by binding created from Method#to_proc.
+	  [Bug #11163]
+
+	* vm.c (vm_cref_new_toplevel): export as rb_vm_cref_new_toplevel().
+
+	* test/ruby/test_method.rb: add some assertions.
+
+Thu May 21 17:29:26 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/matrix.rb: added documentation for Matrix#empty and Matrix#/
+	  [Feature #10070][ruby-dev:48433] Patch by @gogotanaka
+
+Thu May 21 17:02:43 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* proc.c: rename functions.
+	  * method_get_def() -> method_def()
+	  * method_get_iseq() -> method_def_iseq()
+	  * method_get_cref() -> method_cref()
+
+Thu May 21 16:52:44 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* proc.c (rb_method_get_iseq): rename to rb_method_iseq.
+
+	* iseq.c: catch up this fix.
+
+	* iseq.h: commit ditto.
+
+Thu May 21 15:41:45 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/net/telnet.rb: gemify net-telnet.
+	  [Feature #11083]
+	* gems/bundled_gems: added net-telnet to bundled gems.
+
+Thu May 21 15:37:32 2015  Zachary Scott  <e@zzak.io>
+
+	* vm_method.c: Remove private attribute warning [Bug #10967]
+	  Patch by @spastorino [Fixes GH-849]
+	  https://github.com/ruby/ruby/pull/849
+
+	* test/ruby/test_module.rb: Update test for changes
+
+Thu May 21 10:59:43 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* proc.c (method_proc): rename to method_to_proc.
+
+Thu May 21 10:51:54 2015  Jake Worth  <jakeworth82@gmail.com>
+
+	* io.c (rb_f_select): [DOC] Fixes for grammar and style.
+	  [Fix GH-906]
+
+Thu May 21 08:25:19 2015  Eric Wong  <e@80x24.org>
+
+	* variable.c (Init_var_tables): init generic_iv_tbl
+	  (rb_generic_ivar_table, generic_ivar_get, generic_ivar_set,
+	   generic_ivar_defined, generic_ivar_remove,
+	   rb_mark_generic_ivar, givar_i, rb_mark_generic_ivar_tbl,
+	   rb_free_generic_ivar, rb_copy_generic_ivar, rb_ivar_foreach,
+	   rb_ivar_count): remove checks for uninitialize generic_iv_tbl
+	[ruby-core:69155] [Feature #11146]
+
+Thu May 21 04:11:03 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* iseq.c (exception_type2symbol): show correct bug message.
+
+Wed May 20 23:19:05 2015  Yusuke Endoh  <mame@ruby-lang.org>
+
+	* lib/base64.rb: Fix rdoc-formatting for padding argument.
+	  [fix GH-905][ci skip] Patch by @davydovanton
+
+Wed May 20 13:16:23 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (DEPRECATED_BY): deprecate warning with preferable
+	  alternative.
+
+	* configure.in (RUBY_FUNC_ATTRIBUTE): allow attribute arguments in
+	  the macro.
+
+Wed May 20 11:23:24 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* vm_dump.c (rb_print_backtrace): return value of libexec's backtrace
+	  is size_t, so simply cast as int.
+
+Tue May 19 18:54:41 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* iseq.c (rb_iseq_compile_with_option): check source type, must be
+	  an IO or a String.  [ruby-core:69219] [Bug #11159]
+
+Tue May 19 17:15:03 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/benchmark.rb: Update Benchmark documentation and formatting.
+	  [fix GH-903][ci skip] Patch by @davydovanton
+
+Tue May 19 13:10:08 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* numeric.c (num_positive_p): should false on Bignum 0.
+	  http://twitter.com/rafaelfranca/status/600509783427391488
+	  [ruby-core:69173] [Feature #11151]
+
+Tue May 19 11:22:28 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/uri/rfc2396_parser.rb (initialize_pattern):
+	  URI::Generic.build should accept port as a string.
+	  pattern[:PORT] is not defined for long.
+	  by Dave Slutzkin <daveslutzkin@fastmail.fm>
+	  https://github.com/ruby/ruby/pull/804 fix GH-804
+
+Tue May 19 11:18:46 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* include/ruby/ruby.h (rb_data_typed_object_alloc),
+	  (rb_data_object_alloc): add old names for source level backward
+	  compatibilities.
+
+	* gc.c (rb_data_object_alloc, rb_data_typed_object_alloc): add
+	  aliases for binary level backward compatibilities.
+
+Tue May 19 09:54:44 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* include/ruby/ruby.h (Data_Make_Struct0): needs function pointer
+	  casts to fix function overloading in C++.
+
+Tue May 19 09:43:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* include/ruby/ruby.h (Data_Make_Struct0, TypedData_Make_Struct0):
+	  explicit cast from void* is necessary as implicit cast is
+	  disallowed in C++.
+
+Mon May 18 15:31:31 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* include/ruby/intern.h (rb_f_notimplement): should not respond to
+	  not-implemented methods.  as the address inside a DLL and the
+	  imported address are different on Windows, use an exported
+	  variable to share the same address.
+
+Mon May 18 13:55:01 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/monitor.rb (mon_try_enter, mon_enter): should reset @mon_count
+	  just in case the previous owner thread dies without mon_exit.
+	  [fix GH-874] Patch by @chrisberkhout
+
+Sun May 17 17:21:29 2015  Eric Wong  <e@80x24.org>
+
+	* lib/webrick/utils.rb (set_non_blocking): use IO#nonblock=
+	* (set_close_on_exec): use IO#close_on_exec=
+	  [Feature #11136]
+
+Sun May 17 15:01:26 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* numeric.c (num_positive_p, num_negative_p): add methods
+	  Numeric#positive? and Numeric#negative?.
+	  [ruby-core:69173] [Feature #11151]
+
+	* numeric.c (flo_positive_p, flo_negative_p): specialized
+	  functions for Float.
+
+	* complex.c (Init_Complex): Complex do not have positive? and
+	  negative? methods
+
+Sun May 17 14:57:42 2015  Eric Wong  <e@80x24.org>
+
+	* lib/webrick/server.rb (accept_client): avoid redundant fcntl call
+	  [Feature #11137]
+
+Sun May 17 12:13:33 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/init.c (cloexec_accept): support nonblock flag and
+	  use SOCK_NONBLOCK if possible
+	* ext/socket/init.c (rsock_s_accept_nonblock):
+	  update cloexec_accept call
+	* ext/socket/init.c (accept_blocking): ditto for blocking
+	* test/socket/test_nonblock.rb: check nonblock? on accepted socket
+	  [Feature #11138]
+
+Sun May 17 03:58:59 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* load.c (loaded_feature_path): stop returning false negatives for
+	  filenames which are trailing substrings of file extensions.  For
+	  example, 'b', which a trailing substring of ".rb" should not return
+	  false. [Bug #11155][ruby-core:69206]
+
+	* test/ruby/test_autoload.rb: test for fix
+
+Sat May 16 21:41:24 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* string.c: added documentation for character sequence \' with String#sub
+	  [Bug #11132][ruby-core:69121][fix GH-900][ci skip] Patch by @shishir127
+
+Sat May 16 21:38:05 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* enum.c: fix a sample code. Patch by @eagletmt
+	  [fix GH-901][ci skip]
+
+Sat May 16 21:17:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* gc.c (rb_data_object_wrap, rb_data_typed_object_wrap): rename
+	  alloc as wrap.  these functions do not allocate data pointers
+	  but just wrap the given pointers.
+
+Sat May 16 19:59:24 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (rb_w32_accept): simplified.
+
+Fri May 15 18:28:20 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* array.c (rb_ary_assoc, rb_ary_rassoc): [DOC] the result when key
+	  was found is the existing element, not a new array.  reported by
+	  Giau Nguyen <giaunv AT nustechnology.com>.
+
+Fri May 15 08:24:28 2015  Takeyuki FUJIOKA  <xibbar@ruby-lang.org>
+
+	* lib/cgi/cookie.rb: Implement HttpOnly flag for cookies.
+	  [fix GH-887] Patch by @martinpovolny
+
+Fri May 15 06:54:19 2015  Aaron Patterson <tenderlove@ruby-lang.org>
+
+	* variable.c: Change autoload to call `require` through Ruby rather
+	  than directly calling `rb_require_safe`.  This allows things like
+	  RubyGems to intercept file loading done though `autoload`.
+	  [Feature #11140]
+
+	* test/ruby/test_autoload.rb: Test for change.
+
+Wed Apr  8 19:18:02 2015  Shota Fukumori (sora_h)  <her@sorah.jp>
+
+	* enum.c (enum_grep_v, grep_i, grep_iter_i, Init_enum):
+	  Implement Enumerable#grep_v. [Feature #11049]
+
+Thu May 14 15:54:13 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ext/pathname/lib/pathname.rb: Remove condition of RUBY_VERSION <= 1.9.
+	  [Feature #11082]
+
+Wed May 13 17:10:37 2015  Masaki Matsushita <glass.saga@gmail.com>
+
+	* enum.c (enum_to_a): revert r50457.
+	  it requires recursion check.
+	  then, it doesn't make performance improvement.
+	  [Bug #11130] [Feature #9118]
+
+Wed May 13 11:13:40 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (parse_gvar): separate message for gvar without
+	  non-space characters from message for invalid identifiers.
+
+Tue May 12 22:18:27 2015  Masaki Matsushita <glass.saga@gmail.com>
+
+	* enum.c (enum_to_a): fix incompatibility introduced in r50457.
+	  [Bug #11130]
+
+	* test/ruby/test_enum.rb: test for above.
+
+Tue May 12 17:08:03 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* method.h: remove unused declaration.
+
+Mon May 11 10:58:45 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* gems/bundled_gems: Update minitest-5.6.1 and power_assert-0.2.3.
+
+Mon May 11 00:20:31 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* include/ruby/ruby.h (Data_Make_Struct, TypedData_Make_Struct):
+	  allocate wrapper data object before allocating DATA_PTR to get
+	  rid of possible memory leak when the former failed.
+
+Sun May 10 21:32:45 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* gc.c (gc_mark_children): call dmark function for non-NULL
+	  pointers only, so that DATA_PTR can be NULL safely now.
+
+Sun May 10 16:23:58 2015  Kazuki Tsujimoto  <kazuki@callcc.net>
+
+	* proc.c (proc_binding): fix segmentation fault on marking phase.
+	  envptr of newenvval should not be NULL.
+
+	  You can reproduce by
+	   make test-all TESTS='--gc-stress -n test_to_proc_binding ruby/test_method.rb'
+
+Sun May 10 12:41:18 2015  Masaki Matsushita <glass.saga@gmail.com>
+
+	* ext/zlib/zlib.c (rb_gzreader_external_encoding):
+	  define GzipReader#external_encoding.
+	  [Bug #10900]
+
+	* test/zlib/test_zlib.rb: test for above.
+
+Sun May 10 11:57:48 2015  Masaki Matsushita <glass.saga@gmail.com>
+
+	* ext/win32ole/win32ole_variant.c: fix typo "indicies".
+	  the patch is from davydovanton <antondavydov.o at gmail.com>.
+	  [fix GH-892]
+
+	* lib/rubygems/indexer.rb: ditto.
+
+	* test/rubygems/test_gem_indexer.rb: ditto.
+
+Sun May 10 11:44:37 2015  Masaki Matsushita <glass.saga@gmail.com>
+
+	* string.c (rb_str_crypt): Raise ArgumentError when
+	  string passed to String#crypt contains null.
+	  the patch is from jrusnack <jrusnack at redhat.com>.
+	  [Bug #10988] [fix GH-853]
+
+	* test/ruby/test_string.rb: test for above.
+
+Sun May 10 11:23:03 2015  Masaki Matsushita <glass.saga@gmail.com>
+
+	* enum.c (enum_to_a): Use size to set array capa when possible.
+	  the patch is from HonoreDB <aweiner at mdsol.com>.
+	  [fix GH-444]
+
+Sat May  9 06:48:36 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/ancdata.c (bsock_recvmsg_internal): GC guard
+	  [Bug #11123]
+
+Fri May  8 22:57:24 2015  takiy33  <takiy33@gmail.com>
+
+	* test/matrix/test_matrix.rb (test_determinant): refactor test on
+	  Matrix#determinant, by merging with test_det for an alias method
+	  det.  [Fix GH-897]
+
+Fri May  8 15:43:11 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/imap.rb (body_ext_mpart): should work even if body-fld-dsp
+	  is omitted.  [ruby-core:69093] [Bug #11128]
+
+Fri May  8 15:05:57 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* doc/syntax/control_expressions.rdoc: fix a missing "a"
+	  [fix GH-888][ci skip] Patch by @riffraff
+
+Fri May  8 12:11:33 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_eval.c (rb_method_call_status): resolve refined method entry
+	  to check if undefined.  [ruby-core:69064] [Bug #11117]
+
+Thu May  7 22:22:59 2015  Sho Hashimoto  <sho-h@ruby-lang.org>
+
+	* proc.c: [DOC] fix Binding#local_variable_set example. [ci skip]
+
+Thu May  7 11:32:57 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* Makefile.in (rbconfig.rb): add rule to make.
+
+Thu May  7 05:14:39 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/lib/socket.rb (connect_nonblock): use IO#wait_writable
+	* lib/drb/drb.rb (DRB::DRbTCPSocket#alive?): use IO#wait_readable
+	* lib/webrick/httpserver.rb (run): ditto
+	* lib/resolv.rb (request): ditto for single socket case
+	  [ruby-core:68943] [Feature #11081]
+
+Wed May  6 22:49:54 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_eval.c (rb_method_call_status): undefined refined method is
+	  not callable unless using.  [ruby-core:69064] [Bug #11117]
+
+Sun May  3 22:40:06 2015  Rei Odaira  <Rei.Odaira@gmail.com>
+
+	* ext/-test-/file/fs.c: need to include sys/statvfs.h
+	  to use statvfs().
+
+	* ext/-test-/file/extconf.rb: check the existence of
+	  sys/statvfs.h
+
+Sun May  3 21:59:48 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/yaml.rb: fix typo. [ci skip][fix GH-890]
+	  Patch by @miketheman
+
+Sun May  3 10:02:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* range.c (linear_object_p, range_include): test if covered for
+	  linear objects.  [ruby-core:69052] [Bug #11113]
+
+Fri May  1 13:30:24 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dln.c (dln_load): check if a different libruby is loaded by the
+	  extension library, and then bail out to get rid of very
+	  frequently reported stale bug reports.
+
+Thu Apr 30 19:51:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (iseq_compile_each): revert r46873 and r46875, not to
+	  allow to execute private readers by pretending op assign.
+	  [ruby-core:68984] [Bug #11096]
+
+Thu Apr 30 17:02:33 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* rational.c: Added documentation for rational literal.
+	  [Bug #11075][fix GH-885][ci skip] Patch by @shishir127
+
+Thu Apr 30 16:39:44 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/socket/ipsocket.c (init_inetsock_internal): preserve errno
+	  before other library calls and use rb_syserr_fail.
+	  [ruby-core:68531] [Bug #10975]
+
+Thu Apr 30 16:22:16 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (lambda): push and reset cmdarg_stack in lambda body.
+	  [ruby-core:69017] [Bug #11107]
+
+Sun Apr 26 07:36:48 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* enc/utf_8.c (code_to_mbclen, code_to_mbc): reject values larger
+	  than UTF-8 max codepoints.  [Feature #11094]
+
+Sat Apr 25 14:26:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (str_buf_cat): expand later so that the buffer can be
+	  larger for further use.  [Bug #11080] [Bug #11095]
+
+Fri Apr 24 23:48:45 2015  Akinori MUSHA  <knu@iDaemons.org>
+
+	* misc/ruby-electric.el: Import version 2.2.3 from
+	  https://github.com/knu/ruby-electric.el.
+
+Fri Apr 24 10:40:02 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (rb_w32_{getc,putc}): removed.  they are needed for old
+	  ruby (before 1.8), but not now.
+
+Fri Apr 24 08:40:13 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* win32/win32.c: remove bcc related code.
+
+	* include/ruby/win32.h: ditto.
+
+Fri Apr 24 08:21:07 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* win32/win32.c (rb_acrt_lowio_lock_fh): wrap _pioinfo(i)->lock.
+
+	* win32/win32.c (rb_acrt_lowio_unlock_fh): ditto.
+
+Fri Apr 24 06:47:19 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* win32/win32.c (_filbuf): msvc14 doesn't have it, use _fgetc_nolock.
+
+	* win32/win32.c (_flsbuf): msvc14 doesn't have it, use _fputc_nolock.
+
+	* win32/win32.c (vcruntime_file): define vcruntime_file on msvc14
+	  because it doesn't export FILE's internal structure.
+
+	* win32/win32.c (FILE_COUNT): added to abstract FILE->_cnt.
+
+	* win32/win32.c (FILE_READPTR): added to abstract FILE->_ptr.
+
+	* win32/win32.c (FILE_FILENO): added to abstract FILE->_file.
+
+	* win32/win32.c (init_stdhandle): use FILE_FILENO.
+
+	* win32/win32.c (rb_w32_getc): use FILE_COUNT and FILE_READPTR.
+
+	* win32/win32.c (rb_w32_putc): ditto.
+
+Fri Apr 24 06:37:07 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* win32/win32.c (dupfd): use _set_osfhnd.
+
+	* win32/win32.c (rb_w32_wopen): use _set_osflags.
+
+Thu Apr 24 05:38:01 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (gc_mark_roots): fox to work PRINT_ROOT_TICKS.
+
+Fri Apr 24 04:49:05 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* win32/Makefile.sub: MSVC14 have struct timespec.
+
+	* win32/rtname.cmd: support vcruntime140.dll.
+
+	* time.c (localtime_with_gmtoff_zone): MSVC14 doesn't have tzname and
+	  daylight but have _tzname and _daylight.
+
+Thu Apr 23 11:35:55 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_eval.c (rb_obj_instance_eval, rb_obj_instance_exec): allow
+	  symbols to just instance_eval/exec, except for definition of
+	  singletons.  [ruby-core:68961] [Bug #11086]
+
+Thu Apr 23 10:01:36 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* lib/delegate.rb: fix a typo.
+	  [fix GH-881][ci skip] Patch by @Zorbash
+
+Wed Apr 22 18:36:50 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/imap.rb (move, uid_move): support the MOVE command defined
+	  in RFC6851.  Patch by ojab ojab.
+	  [ruby-core:68960] [Feature #11077]
+
+Tue Apr 22 12:42:12 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
+
+	* test/ruby/test_object.rb: add tests for Kernel#String and Kernel#Array.
+	  [fix GH-879][fix GH-880] Patch by @yui-knk
+
+Tue Apr 21 20:46:02 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* test/ruby/test_object.rb: renamed tests to explicitly class name.
+	  [fix GH-877] Patch by @yui-knk
+
+Tue Apr 21 05:31:00 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/lib/socket.rb (connect_internal): avoid common exceptions
+	  from connect_nonblock. [ruby-core:68909]
+
+Mon Apr 20 23:46:53 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (rb_w32_wreadlink): follow the official format of
+	  REPARSE_DATA_BUFFER structure.
+
+Mon Apr 20 20:23:04 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* common.mk ($(arch)-fake.rb): revert r50354 because bsdmake seems not
+	  to handle such substitution.
+
+	* tool/expand-config.rb: convert path separators here.
+
+Mon Apr 20 16:52:20 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* tool/fake.rb: don't fake libdir.  use libdirname instead.
+
+Mon Apr 20 16:49:52 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* lib/mkmf.rb (MakeMakefile#configuration): DESTDIR should never affect
+	  top_srcdir and builddir.
+
+Mon Apr 20 16:18:17 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* common.mk ($(arch)-fake.rb): fix the path separator up for Windows.
+
+Mon Apr 20 15:02:47 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (rb_w32_wreadlink): fixed a bug that a junction misses
+	  its drive letter.
+
+Mon Apr 20 12:54:56 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* ext/openssl/*: use license instead of licence.
+	  [fix GH-876][ci skip] Patch by @davydovanton
+	* lib/net/https.rb: ditto.
+
+Mon Apr 20 12:42:40 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* benchmark/bm_so_meteor_contest.rb: fix a typo.
+	  [fix GH-876][ci skip] Patch by @davydovanton
+	* tool/bisect.sh: ditto.
+	* tool/update-deps: ditto.
+
+Mon Apr 20 11:10:46 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/socket.c (sock_connect_nonblock): do not raise EISCONN
+	  [ruby-core:68926] [Feature #11072]
+	* test/socket/test_nonblock.rb: check non-EISCONN on 2nd connect
+
+Sun Apr 19 12:19:17 2015  Chad Brewbaker  <crb002@gmail.com>
+
+	* ext/{etc,openssl,tk}: Adding parens and comparisons around
+	  assignments to get rid of Wparentheses warnings.  [Fix GH-875]
+
+Sun Apr 19 10:42:54 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* hash.c (get_env_cstr): environment variables must be ASCII
+	  compatible, as dummy encodings and wide char encodings are
+	  unsupported now.
+
+Sat Apr 18 15:18:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/json/parser/parser.rl: raise with messages in UTF-8
+	  encoding.  [ruby-core:67386] [Bug #10705]
+
+Fri Apr 17 11:58:34 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (STR_SET_EMBED): clear NOFREE flag at embedding as
+	  embedded strings no longer refer static strings.
+	  [ruby-core:68436] [Bug #10942]
+
+Thu Apr 16 05:15:50 2015  Eric Wong  <e@80x24.org>
+
+	* NEWS: note IO#wait_readable change in r50263
+
+Thu Apr 16 05:09:36 2015  Eric Wong  <e@80x24.org>
+
+	* lib/net/protocol.rb (rbuf_fill): use IO#wait_*able
+	* lib/net/http/generic_request.rb (wait_for_continue): ditto
+	  [ruby-core:68891] [Feature #11056]
+
+Wed Apr 15 18:43:43 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_trace.c (rb_tracepoint_new): fix documentation.
+	  Commented by @emilsoman.
+
+Wed Apr 15 17:36:51 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_trace.c (rb_tracepoint_new): Add documentation for
+	  rb_tracepoint_new C level API [ci skip]
+	  Provided by @emilsoman. [fix GH-869]
+
+Wed Apr 15 10:37:40 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+
+	* doc/contributors.rdoc: fix a typo. Patch by @davydovanton
+	  [fix GH-872][ci skip]
+	* doc/syntax/methods.rdoc: ditto.
+	* ext/digest/sha2/sha2.c: ditto.
+	* ext/socket/ipsocket.c: ditto.
+	* ext/tk/*: ditto.
+
+Wed Apr 15 07:51:23 2015  Yuki Yugui Sonoda  <yugui@yugui.jp>
+
+	* doc/extension.ja.rdoc: Added description of TypedData_XXX.
+	  Deprecated the old DATA_XXX.
+	  Reviewed by ko1 and nobu.
+	  Fixes [ruby-dev:40881] #3064
+
+	* doc/extension.rdoc: ditto.
+
+Wed Apr 15 07:34:49 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* thread_pthread.c (reserve_stack): keep sp safe zone to get rid
+	  of crash by -fstack-check.  [ruby-core:68740] [Bug #11030]
+
+Tue Apr 14 16:03:49 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* tool/merger.rb (versionup): should also increment revision when
+	  changing teeny.
+
+Tue Apr 14 11:24:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/-test-/printf/printf.c (uint_to_str): renamed to get rid of
+	  conflict on cygwin.  [ruby-core:68877] [Bug #11065]
+
+Tue Apr 14 08:59:04 2015  Zachary Scott  <e@zzak.io>
+
+	* gc.c: [DOC] Improve documentation for ObjectSpace.count_objects
+	  with regards to `:TOTAL` key, with patch by @schneems [Fixes GH-871]
+	  https://github.com/ruby/ruby/pull/871 [Bug #11067]
+
+Mon Apr 13 22:44:07 2015  Tanaka Akira  <akr@fsij.org>
+
+	* test/lib/envutil.rb (File.mkfifo): Defined using mkfifo command.
+
+	* test/ruby/test_io.rb: Use File.mkfifo.
+
+	* test/ruby/test_file_exhaustive.rb: Ditto.
+
+	* test/ruby/test_process.rb: Ditto.
+
+Mon Apr 13 21:20:20 2015  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+
+	* ext/openssl/lib/openssl/ssl.rb: stricter hostname verification
+	  following RFC 6125. with the patch provided by Tony Arcieri and
+	  Hiroshi Nakamura [ruby-core:61545] [Bug #9644]
+	* test/openssl/test_ssl.rb: add tests for above.
+
+Sun Apr 12 18:40:04 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* ext/json/json.gemspec: bump version to 1.8.2.
+	* ext/json/lib/json/version.rb: ditto.
+
+Sun Apr 12 18:12:07 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* ext/json/json.gemspec, lib/rdoc/rdoc.gemspec: added gemspec directly.
+	* defs/default_gems, tool/rbinstall.rb: removed default_gems definition.
+	  it make simple installation for default gems.
+
+Sun Apr 12 17:35:17 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* ext/json/*, test/json/*: Reverted r50231.  Because it's not
+	  working with cross-compile environment.
+
+Sun Apr 12 15:34:59 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (arg): fix segfault by null caused by syntax error.
+	  [ruby-core:68851] [Bug #10957]
+
+Sun Apr 12 15:11:16 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* lib/rubygems/test_case.rb: use explicitly exception class and reverted
+	  to require JSON library for rubygems tests with Ruby 2.2.0 or earlier.
+
+Sun Apr 12 15:10:18 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/io/wait/wait.c (io_wait_readable): simply returns that IO is
+	  readable without blocking, but no longer returns EOF.
+
+	* ext/io/wait/wait.c (io_ready_p, io_wait_readable): try polling
+	  first and check FIONREAD optionally to see if EOF.
+	  [ruby-core:36805] [Feature #4849]
+
+Sun Apr 12 14:53:23 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* lib/rubygems/test_case.rb: fixed json load error for rubygems tests.
+
+Sun Apr 12 14:13:28 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* gc.c: Document require name for ObjectSpace methods.
+	  [ci skip][fix GH-860] Patch by @schneems
+
+Sun Apr 12 13:54:05 2015  Tanaka Akira  <akr@fsij.org>
+
+	* test/ruby/test_io.rb: New test that open(fifo) doesn't block other
+	  threads.
+
+Sun Apr 12 13:52:18 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* ext/coverage/coverage.c: Remove extension from require argument.
+	  [ci skip][fix GH-870] Patch by @yui-knk
+
+Sun Apr 12 10:29:14 2015  Eric Wong  <e@80x24.org>
+
+	* ext/openssl/ossl_ssl.c (ossl_ssl_connect_nonblock):
+	  support `exception: false'
+	* (get_no_exception): move function location
+	* ext/socket/socket.c (sock_connect_nonblock):
+	  support `exception: false'
+	* test/openssl/test_pair.rb (test_connect_accept_nonblock_no_exception):
+	  test `exception: false' on connect,
+	  rename from `test_accept_nonblock_no_exception'
+	* test/socket/test_nonblock.rb (test_connect_nonblock_no_exception):
+	  new test
+
+Sun Apr 12 09:57:16 2015  Tanaka Akira  <akr@fsij.org>
+
+	* test/ruby/test_file_exhaustive.rb: Test a block device on GNU/Linux.
+
+Sun Apr 12 09:24:03 2015  Tanaka Akira  <akr@fsij.org>
+
+	* test/ruby/test_file_exhaustive.rb: Test a file not owned.
+
+Sun Apr 12 09:05:44 2015  Tanaka Akira  <akr@fsij.org>
+
+	* ext/fiddle/depend: Fix "Wrong mix of special targets" error with
+	  OpenBSD make.
+
+Sun Apr 12 09:04:37 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/ruby/test_file_exhaustive.rb: Windows doesn't support Unix file
+	  modes.
+
+Sun Apr 12 08:56:44 2015  Tanaka Akira  <akr@fsij.org>
+
+	* ext/-test-/file/fs.c: OpenBSD needs sys/param.h before sys/mount.h.
+
+Sun Apr 12 08:52:01 2015  Tanaka Akira  <akr@fsij.org>
+
+	* test/ruby/test_file_exhaustive.rb: Test suid, sgid and sticky file.
+
+Sat Apr 11 23:48:30 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* template/fake.rb.in: Don't assign baseruby, Because it's affect to
+	  Makefile of native gem like json on bundled gems.
+
+Sat Apr 11 23:33:22 2015  Tanaka Akira  <akr@fsij.org>
+
+	* file.c (rb_f_test): Consider nsec for "=", "<" and ">" for "test"
+	  method.
+
+Sat Apr 11 23:26:05 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* tool/rbinstall.rb: support destdir for native extension gem.
+
+Sat Apr 11 21:02:06 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/ruby/test_file_exhaustive.rb
+	  (TestFileExhaustive#test_stat_socket_p): r50226 accidentally missed
+	  the guard for non-unix environments.
+
+Sat Apr 11 20:14:21 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* ext/json/*, test/json/*, defs/default_gems: Gemify JSON library.
+	  [fix GH-867][Feature #11057]
+	* test/ruby/test_extlibs.rb: removed json gem from existence extensions.
+	* gems/bundled_gems: added json gem into bundled gem.
+	* lib/rdoc/rubygems_hook.rb: ignored no json environment.
+	* lib/rubygems/test_case.rb, test/rubygems/*: ditto.
+	* lib/rdoc/test_case.rb, test/rdoc/*: ditto.
+
+Sat Apr 11 15:56:58 2015  Tanaka Akira  <akr@fsij.org>
+
+	* test/ruby/test_file_exhaustive.rb: Create sample files lazily.
+
+Sat Apr 11 14:03:47 2015  Tanaka Akira  <akr@fsij.org>
+
+	* test/ruby/test_file_exhaustive.rb: Test character device using
+	  /dev/null.
+
+Sat Apr 11 10:59:58 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/mkmf.rb (append_cppflags, append_cflags, append_ldflags):
+	  utility methods to append compiler options.
+
+Sat Apr 11 08:22:24 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* lib/rdoc/text.rb: removed duplicated code.
+
+Sat Apr 11 04:46:42 2015  Eric Wong  <e@80x24.org>
+
+	* lib/net/protocol.rb (rbuf_fill): avoid exception with read_nonblock
+	  [ruby-core:68787] [Feature #11044]
+
+Fri Apr 10 23:57:44 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (need_normalization): use getattrlist() if fgetattrlist()
+	  is unavailable, on OSX 10.5.  [ruby-core:68829] [Bug #11054]
+
+Fri Apr 10 22:29:21 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/mkmf.rb (try_compile): pass the given werror flag to try_do
+	  to check if stderr is empty.
+
+	* lib/mkmf.rb (try_cflags, try_ldflags): default werror to true.
+
+	* win32/Makefile.sub (WERRORFLAG): remove useless option.  VC does
+	  not make warnings of unknown command option an error.
+
+Fri Apr 10 19:34:24 2015  Tanaka Akira  <akr@fsij.org>
+
+	* test/ruby/test_file_exhaustive.rb: Test socket.
+
+Fri Apr 10 19:38:46 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* test/objspace/test_objspace.rb: remove debug prints.
+
+Fri Apr 10 19:35:51 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* ext/objspace/objspace.c: add ObjectSpace.count_imemo_objects method
+	  to count imemo objects for each type.
+
+	* test/objspace/test_objspace.rb: add a test.
+
+	* NEWS: describe about this addition.
+
+Fri Apr 10 19:34:24 2015  Tanaka Akira  <akr@fsij.org>
+
+	* test/ruby/test_file_exhaustive.rb: Test anonymous pipe.
+
+Fri Apr 10 19:31:56 2015  Tanaka Akira  <akr@fsij.org>
+
+	* test/ruby/test_file_exhaustive.rb: Test named pipe.
+
+Fri Apr 10 19:10:34 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* ext/objspace/objspace.c (setup_hash): unify common routine.
+
+Fri Apr 10 18:29:49 2015  Tanaka Akira  <akr@fsij.org>
+
+	* process.c (rb_execarg_parent_start1): Handle EINTR.
+
+Fri Apr 10 17:27:58 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm.c (vm_exec): check other events when RETURN is thrown.
+	  [Bug #10724]
+
+	* test/ruby/test_settracefunc.rb: add a test.
+
+Fri Apr 10 11:44:09 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/date/extconf.rb: check warnings.
+
+	* lib/mkmf.rb (try_cflags): pass options to try_compile.
+
+	* win32/Makefile.sub (WERRORFLAG): make unknown command line
+	  options an error.
+
+Fri Apr 10 08:00:17 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/ruby/test_process.rb: unfortunately, windows is not POSIX...
+	  cygwin has mkfifo command, but it does not affect system-wide.
+
+Fri Apr 10 02:18:53 2015  Tanaka Akira  <akr@fsij.org>
+
+	* test/ruby/test_process.rb: Use mkfifo command instead of mknod
+	  command to create a named pipe.  mkfifo command is defined by POSIX.
+
+Fri Apr 10 01:29:05 2015  Tanaka Akira  <akr@fsij.org>
+
+	* process.c: Release GVL when opening a file in spawn() to avoid whole
+	  process blocking when opening a named pipe.
+	  (open_func): New function.
+	  (rb_execarg_parent_start1): Extracted from rb_execarg_parent_start and
+	  use rb_thread_call_without_gvl2 to release GVL when opening a file.
+	  (rb_execarg_parent_start): Invoke rb_execarg_parent_start1 via
+	  rb_protect and invoke rb_execarg_parent_end when error.
+
+Thu Apr  9 22:19:19 2015  Tanaka Akira  <akr@fsij.org>
+
+	* process.c (redirect_open): Removed.
+
+Thu Apr  9 21:38:20 2015  Tanaka Akira  <akr@fsij.org>
+
+	* internal.h (rb_execarg_parent_end): Declared.
+
+	* process.c: "spawn" opens files in the parent process.
+	  (check_exec_redirect): Add an placeholder for fd in parameters
+	  for fd_open.
+	  (check_exec_fds_1): Delete fd_open condition.
+	  (check_exec_fds): Don't call check_exec_fds_1 with fd_open.
+	  (rb_execarg_parent_start): Open files specified as "spawn" options
+	  and add "dup2" options.
+	  (rb_execarg_parent_end): New function to close opened fds.
+	  (run_exec_open): Removed.
+	  (rb_execarg_run_options): Don't call run_exec_open.
+	  (rb_spawn_internal): Call rb_execarg_parent_end.
+
+	* io.c (pipe_open): Call rb_execarg_parent_end.
+
+	* ext/pty/pty.c (establishShell): Call rb_execarg_parent_end.
+
+Thu Apr  9 20:52:31 2015  Tanaka Akira  <akr@fsij.org>
+
+	* internal.h (rb_execarg_parent_start): Renamed from rb_execarg_fixup.
+
+	* process.c: Follows the above change.
+
+	* io.c: Ditto.
+
+	* ext/pty/pty.c: Ditto.
+
+Thu Apr  9 20:35:12 2015  Tanaka Akira  <akr@fsij.org>
+
+	* process.c (fd_clear_cloexec): Extracted from run_exec_dup2.
+
+Thu Apr  9 09:26:47 2015  Eric Wong  <e@80x24.org>
+
+	* ccan/list/list.h: sync with ccan upstream
+	  [ccan commit c2fbfe5282ba264f3485586e7efa8a5967f2d386]
+
+Thu Apr  9 08:24:03 2015  Masahiro Tomita  <tommy@tmtm.org>
+
+	* ext/socket/raddrinfo.c (addrinfo_mload): fix memory leak of
+	  addrinfo.  [ruby-dev:48923] [Bug #11051]
+
+Wed Apr  8 17:45:02 2015  Shannon Skipper  <shannonskipper@gmail.com>
+
+	* version.c (Init_version): the version of the engine or
+	  interpreter.  [Fix GH-858]
+
+Wed Apr  8 16:15:30 2015  Kenta Murata  <mrkn@cookpad.com>
+
+	* bigdecimal: conform to ruby's license.  [ruby-core:68466] [Bug #10952]
+
+Wed Apr  8 14:57:06 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (rb_w32_wreadlink): should treat junctions like as
+	  symlinks.
+
+Wed Apr  8 14:03:47 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* test/ruby/test_symbol.rb: fix syntax error.
+
+Wed Apr  8 13:01:06 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* hash.c (rb_any_hash): Symbols are compared by the identities
+	  always.  [ruby-core:68767] [Bug #11035]
+
+Tue Apr  7 10:22:51 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* internal.h: fix typo. Patch by @sferik [fix GH-865]
+
+Mon Apr  6 22:52:35 2015  Tanaka Akira  <akr@fsij.org>
+
+	* enum.c: Enumerable#chunk and Enumerable#slice_before no longer takes
+	  the initial_state argument.  [Feature #10958]
+
+Mon Apr  6 16:09:58 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_args.c: protect value stack from calling other methods
+	  during complex parameter setting process (splat, kw, and so on).
+	  [Bug #11027]
+
+	* vm_core.h: remove rb_thread_t::mark_stack_len.
+	  With this modification, we don't need to use th->mark_stack_len.
+
+	* test/ruby/test_keyword.rb: add a test.
+
+	* cont.c (cont_capture): catch up this fix.
+
+	* vm.c (rb_thread_mark): ditto.
+
+Mon Apr  6 11:26:42 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* tool/downloader.rb (http_options): prevent content auto decoding
+	  because this is a downloader.
+
+Sun Apr  5 09:55:18 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* doc/contributing.rdoc: update Maintainers list.
+
+Sun Apr  5 09:11:00 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* tool/rbinstall.rb: fix bin script permission of bundled gems.
+
+Sun Apr  5 08:46:08 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* tool/rbinstall.rb: support --program-suffix option.
+
+Sat Apr  4 21:31:18 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* lib/rake/*: Gemify rake [fix GH-862][Feature #11025]
+	* test/rake/*: ditto.
+	* tool/rbinstall.rb: ditto.
+
+Sat Apr  4 11:30:24 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (rb_str_setbyte): check the argument first not to
+	  discard shared string and code range unnecessarily until
+	  actually changing the contents.  pointed out by headius.
+
+Sat Apr  4 08:16:43 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* lib/net/http.rb (edit_path): use path which is absolute ftp url
+	  on using ftp_proxy.
+
+Fri Apr  3 11:43:17 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_eval.c (vm_call0_cfunc): update invoker arguments.
+
+	* vm_insnhelper.c (vm_call_cfunc_latter): ditto.
+
+	* vm_insnhelper.c (rb_vm_call_cfunc_push_frame): ditto, and prefix
+	  with rb_.
+
+Thu Apr  2 16:26:59 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* common.mk, tool/mkconfig.rb: check the running ruby version in
+	  rbconfig.rb with the program version, as RUBY_VERSION has never
+	  been affected by --with-ruby-version option.
+	  [ruby-core:68639] [Bug #11002]
+
+	* configure.in (LIBRUBY_DLDFLAGS): compatibility_version must be
+	  valid version numbers, not an arbitrary string.
+
+Wed Apr  1 11:09:15 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (push_glob): remove indirect links of arguments for
+	  trampoline.
+
+Wed Apr  1 09:59:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/fileutils.rb (FileUtils#mv): show the exact target path in
+	  the error message instead of the destination parent directory
+	  name.  patched by Joao Britto <jabcalves AT gmail.com> at
+	  [ruby-core:68706].  [Bug #11021]
+
+Tue Mar 31 15:25:07 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* doc/ChangeLog-0.06_to_0.52: added archived Changelog.
+	  [ruby-list:50105]
+	* doc/ChangeLog-0.50_to_0.60: ditto.
+	* doc/ChangeLog-0.60_to_1.1: ditto.
+
+Mon Mar 30 22:02:55 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+
+	* README.EXT.ja: add redirect [ruby-core:68631]
+
+Mon Mar 30 14:42:41 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* win32/win32.c (fileattr_to_unixmode, winnt_lstat): deal with
+	  symbolic link than directory, and set executable bits.
+
+Mon Mar 30 11:27:54 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (copy_stream_body): use the arguments without conversion if
+	  having read, readpartial, and write methods, than conversion by
+	  to_path method.  [ruby-core:68676] [Bug #11015]
+
+Sun Mar 29 21:08:37 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* gc.c (objspace_allrefs_destruct_i): fix a typo.
+	  [Bug #11013]
+
+Sun Mar 29 11:51:32 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* proc.c (proc_binding): replicate env from method object, and
+	  allocate the local variable area for the iseq local table.
+	  [ruby-core:68673] [Bug #11012]
+
+Sat Mar 28 09:19:41 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/date/extconf.rb: try_cflags("-std=iso9899:1999") [Bug #10906]
+	  ruby itself (including numeric.c) is built with strict compile
+	  options including -std=iso9899:1999, but ext/date is not.
+	  By the way -std=iso9899:1999 is not only a warning option but also
+	  changes behavior like MACRO definitions for example INFINITY.
+	  gcc on Solaris affect this.
+
+Fri Mar 27 16:34:16 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* common.mk: revert using BOOTSTRAPRUBY for enc.mk, as
+	  enc/depend uses CONFIG.  [ruby-core:68647] [Bug #11004]
+
+Thu Mar 26 10:05:13 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* test/test_observer.rb: add tests for Observable module.
+	  [fix GH-859] Patch by @brightbits
+
+Thu Mar 26 06:35:10 2015  Eric Wong  <e@80x24.org>
+
+	* README.EXT: add redirect [ruby-core:68631]
+
+Wed Mar 25 16:46:49 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/socket/extconf.rb: Solaris 11 has struct tcp_info.tcpi_ca_state,
+	  but it is a dummy.
+
+	* ext/socket/option.c: Solaris 11 doesn't have u_intN_t.
+
+	* ext/socket/option.c: Solaris 11 needs inspect_tcpi_msec.
+
+	* ext/socket/raddrinfo.c: Solaris 11 has AF_PACKET but doesn't have
+	  related macros.
+
+Wed Mar 25 17:03:08 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/-test-/file/fs.c (get_fsname): try magic number only if
+	  f_type is included.  [ruby-dev:48913] [Bug #11000]
+
+Wed Mar 25 11:20:40 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* benchmark/bm_hash_aref_flo.rb: make more realistic data.
+	  [ruby-core:68632] [[Bug #10999]
+
+Wed Mar 25 10:39:06 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* .document: removed needless entries.
+
+Wed Mar 25 08:07:28 2015  Eric Wong  <e@80x24.org>
+
+	* doc/extension.rdoc: fix spelling of filename
+	* doc/extension.ja.rdoc: ditto.
+
+Tue Mar 25 06:55:43 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
+
+	* complex.c (k_inexact_p, k_exact_zero_p): use k_exact_zero_p macro
+	  to remove k_inexact_p macro.
+
+	* complex.c (k_exact_one_p): remove unused macro k_exact_one_p.
+
+Tue Mar 24 22:23:33 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* doc/extension.rdoc: move from toplevel document and added extname.
+	* doc/extension.ja.rdoc: ditto.
+
+Tue Mar 24 22:06:58 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* doc/standard_library.rdoc: strip.
+
+Tue Mar 24 22:06:27 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* doc/standard_library.rdoc: move Thread to Extensions.
+
+Tue Mar 24 21:59:10 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* doc/contributing.rdoc: update Maintainers list.
+
+Tue Mar 24 19:10:24 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (gc_writebarrier_generational): fix messages for rb_bug().
+	  Remove `rb_' prefix.
+
+	* gc.c (gc_writebarrier_incremental): ditto.
+
+Tue Mar 24 17:34:01 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* README.ja.md: should be chunibyo.
+
+Tue Mar 24 17:30:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/-test-/file/fs.c (get_fsname): return filesystem name by
+	  statfs/statvfs.  [ruby-core:68624] [Bug #10998]
+
+Tue Mar 24 16:46:02 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* tool/redmine-backporter.rb: now doesn't required spaces just after
+	  `!`.
+
+Mon Mar 23 23:18:27 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (dir_close): don't raise on double close for consistent to
+	  IO#close.  [Feature #10950]
+
+Mon Mar 23 21:22:07 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* win32/file.c (rb_readlink): move from file.c for better buffer
+	  allocation and the result encoding.
+
+	* win32/win32.c (wreadlink, rb_w32_ureadlink): implement readlink().
+
+Mon Mar 23 14:40:45 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* win32/win32.c (winnt_stat): stat with following symbolic links.
+
+	* win32/win32.c (winnt_lstat): rename old winnt_stat, which does
+	  not follow symbolic links.
+
+Mon Mar 23 01:44:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* marshal.c (r_symreal): register symbol names as strings first so
+	  that r_symlink always returns valid names.
+	  [ruby-core:68587] [Bug #10991]
+
+	* marshal.c (r_ivar, r_object0): now need to intern symbol names.
+
+	* marshal.c (r_object0): compare with symbol names.
+
+Sun Mar 22 22:07:40 2015  Kouhei Sutou  <kou@cozmixng.org>
+
+	* doc/etc.rd.ja: Fix wrong coding for Emacs.
+
+Sun Mar 22 09:53:15 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* tool/make-snapshot (package): add default CONFIGURE name to
+	  follow r50039.
+
+	* tool/make-snapshot (package): substitute configuration variables
+	  in Makefile.in instead of passing by the command line, and make
+	  temporary Makefile instead of a pipe.
+
+Sun Mar 22 08:09:47 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* common.mk (ext/ripper/ripper.c, ext/rbconfig/sizeof/sizes.c):
+	  strip autogenerated dependencies which have invalid syntax in
+	  other than nmake.
+
+Sat Mar 21 15:01:26 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/io/console/console.c (console_set_winsize): use handle for
+	  writing.  GetConsoleScreenBufferInfo seems failing on a handle
+	  for reading.
+
+	* io.c: [DOC] update the example of IO#winsize to use $stdout
+	  instead of $stdin, which does not work on Windows.  a patch by
+	  Jan Lelis <mail AT janlelis.de> at [ruby-core:68574].
+	  [Bug #10986]
+
+Fri Mar 20 18:41:03 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* proc.c (respond_to_missing_p): check if the receiver responds to
+	  the given method by respond_to_missing?.
+
+	* proc.c (mnew_missing): create Method object for method_missing.
+	  [ruby-core:68564] [Bug #10985]
+
+Fri Mar 20 17:43:18 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* .travis.yml: enabled email notification.
+
+Fri Mar 20 17:39:52 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* .travis.yml: removed Ruby 1.9.3 build on Travis CI
+
+Fri Mar 20 12:38:36 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (obj_info): obj_info() can receive internal objects.
+
+	* gc.c (check_rvalue_consistency): obj_info() returns const char *.
+
+Fri Mar 20 12:14:37 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (obj_info): show class name and T_DATA type_name.
+
+Thu Mar 19 22:12:46 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (rb_copy_wb_protected_attribute): `dest' can be WB unprotected.
+
+Thu Mar 19 21:25:25 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (rb_copy_wb_protected_attribute): demote `dest' object.
+
+Thu Mar 19 16:18:00 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c, internal.h: export rb_gc_verify_internal_consistency().
+
+Thu Mar 19 16:15:24 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (obj_info): show allocation site if GC_DEBUG is not 0.
+
+Thu Mar 19 16:12:01 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (newobj_of): fix RGENGC_OLD_NEWOBJ_CHECK logics.
+	  * skip on incremental marking because not sure what happen :p
+	  * rb_gc_writebarrier_remember() is enough to mark children.
+
+Thu Mar 19 16:08:42 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (rb_copy_wb_protected_attribute): need demote for old objects.
+
+Thu Mar 19 10:31:00 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* random.c (fill_random_bytes): release the handle in the static
+	  variable, not a local variable.
+
+Thu Mar 19 06:30:35 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* object.c (rb_obj_clone): do not touch age (FL_PROMOTED[01]) because
+	  rb_obj_alloc() can return old object in debug.
+
+Thu Mar 19 06:29:28 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* test/objspace/test_objspace.rb: flag name was changed
+	  (long_lived -> uncollectible).
+
+Thu Mar 19 05:30:13 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* iseq.c (iseq_mark): skip some marking if iseq->orig is available.
+
+	* iseq.c (rb_iseq_clone): need WB for iseq1->klass = iseq0->klass
+	  (done in MEMCPY).
+
+Thu Mar 19 04:55:53 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* internal.h (IMEMO_DEBUG): added.
+
+	* internal.h: remove unused FL_IMEMO_MARK_V[0-3].
+
+	* gc.c (rb_imemo_new_debug): added.
+
+	* gc.c (obj_info): show imemo type name.
+
+Thu Mar 19 04:52:26 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (RGENGC_OLD_NEWOBJ_CHECK): add check mechanism.
+
+	  If RGENGC_OLD_NEWOBJ_CHECK > 0, then create old objects
+	  (not new objects) periodically.
+
+	  Create one old objects per RGENGC_OLD_NEWOBJ_CHECK objects are
+	  created.
+
+Thu Mar 19 04:46:36 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* enum.c (enum_sort_by): add WBs.
+
+Thu Mar 19 03:37:52 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (check_rvalue_consistency): refactoring.
+	  * not inline on RGENGC_CHECK_MODE > 0.
+	  * check SPECIAL_CONST_P(obj) first.
+	  * add a check that remembered_bit is only TRUE when old (age == 3).
+
+	* gc.c (RVALUE_DEMOTE): should clear RVALUE_REMEMBERED bit.
+
+	  remembered_bit should be TRUE only for old (age == 3) objects.
+
+	  Actually there are no effect because demoted objects will be
+	  uncollectible WB unprotected objects (marked at the beginning of
+	  every minor GC).
+
+Thu Mar 19 02:52:48 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c: rename terminologies.
+	  * long_lived -> uncollectible:
+	    because this bitmap does not mean "long lived objects in past",
+	    but means "prohibit collection these objects until next major GC".
+
+	    Uncollectible objects consist of two types objects, one is old
+	    objects (WB protected objects which age == 3) and another is
+	    uncollectible WB unprotected objects which are referred from old
+	    objects
+
+	  * remembered_wb_unprotected_objects ->
+	    uncollectible_wb_unprotected_objects:
+	    because uncollectible objects does not mean remembered objects.
+
+Wed Mar 18 17:21:12 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (gc_writebarrier_generational): add an alternative write
+	  barrier (WB) implementation.
+	  When finding reference from [Old obj] to [New obj] by WB, current
+	  implementation marks [Old obj] as remembered old objects and marks
+	  children of [Old obj] at the beginning of marking.
+
+	  Added (but disabled) code changes current behaviour. This fix promote
+	  [New obj] to old and marks as a remembered old object. We can assume
+	  "new objects referred from old objects are maybe long-lived old
+	  objects".
+
+	  Disadvantage of added algorithm is we may promote unwilling
+	  short-lived objects. For example, consider many new objects push and
+	  pop to an old stack object. All of new objects (short-lived objects)
+	  promote to old objects unexpectedly.
+
+	  To compare these behaviour, I add this new code (but disabled it).
+
+Wed Mar 18 17:14:39 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (RVALUE_PROMOTE_RAW): rename to RVALUE_OLD_LONG_LIVED_SET()
+	  to make clear.
+
+Wed Mar 18 17:10:01 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (check_rvalue_consistency): do not need to check is_sweeping().
+
+Wed Mar 18 14:13:22 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* benchmark/bm_vm1_gc_wb_ary.rb: run GC to finish "marking" phase.
+
+	* benchmark/bm_vm1_gc_wb_obj.rb: ditto.
+
+	* benchmark/bm_vm1_gc_wb_ary_promoted.rb: add parameter
+	  full_mark: false to invoke only minor GC.
+
+	* benchmark/bm_vm1_gc_wb_obj_promoted.rb: ditto.
+
+Wed Mar 18 12:07:36 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* string.c: add a comment about RSTRING_FSTR.
+
+Wed Mar 18 12:01:53 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* hash.c (rb_any_hash): use same hash values with Float#hash so
+	  that -0.0 and +0.0 will be identical.
+	  [ruby-core:68541] [Bug #10979]
+
+Wed Mar 18 05:34:32 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* string.c: introduce STR_FAKESTR to show string is FAKESTR or not.
+
+	* string.c (STR_SET_SHARED): ignore FAKESTR because only Ruby objects
+	  can use write barrier.
+
+Tue Mar 17 18:59:16 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* include/ruby/ruby.h: use rb_gc_writebrrier() simply.
+	  For incremental GC, we need to get a pointer to the objspace.
+	  We can share this pointer for the following WB process.
+	  And considering icache hit ratio, process in the GC.
+
+	* gc.c (rb_gc_writebarrier): added.
+
+	* gc.c (gc_writebarrier_generational, gc_writebarrier_incremental):
+	  make them NOINLINE because inlining them into rb_gc_writebarrier()
+	  makes a prologue code of rb_gc_writebarrier() longer (storing callee
+	  save registers).
+
+	  This patch improve the performance of WB on micro-benchmarks.
+
+	  name                   ruby 2.1   trunk   modified
+	  vm1_gc_wb_ary*            0.511   0.632      0.532
+	  vm1_gc_wb_ary_promoted*   0.578   0.701      0.674
+	  vm1_gc_wb_obj*            0.419   0.575      0.492
+	  vm1_gc_wb_obj_promoted*   0.537   0.664      0.618
+	                                                 (sec)
+
+Tue Mar 17 18:51:43 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* benchmark/bm_vm1_gc_wb_ary(_promoted).rb: separate fastpath and
+	  slowpath for WB.
+
+	  Before this change bm_vm1_gc_wb_ary.rb tried to check the performance
+	  for WB slowpath (making a reference from oldobj to newobj). However,
+	  from Ruby 2.2, 3 GCs are needed to promote new objects because
+	  only 3 age objects are promoted objects.
+
+	  To compare fastpath and slowpath, introduce new "promoted" version
+	  benchmark.
+
+	  bm_vm1_gc_wb_ary.rb is for fastpath and
+	  bm_vm1_gc_wb_ary_promoted.rb is for slowpath.
+
+	* benchmark/bm_vm1_gc_wb_obj(_promoted).rb: ditto.
+
+Tue Mar 17 17:23:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (glob_helper): distinguish not-yet-stated and DT_UNKNOWN
+	  by readdir, and traverse recursively for the former.  Linux
+	  readdir returns DT_UNKNOWN on some filesystems, e.g., smbfs,
+	  iso9660.
+
+Mon Mar 16 17:43:21 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* lib/webrick/server.rb: Fix regression bug in WEBrick's
+	  :DoNotReverseLookup config option implementation.
+	  [fix GH-731] Patch by @vais
+	* test/webrick/test_do_not_reverse_lookup.rb: ditto.
+
+Sat Mar 14 20:05:23 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
+
+	* math.c (math_gamma): optimization for passed small integer.
+
+Sat Mar 14 18:07:23 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
+
+	* enum.c: [DOC] Fixes Enumerable#member? documentation
+	  [fix GH-756][ci skip] Patch by @shamanime
+
+Sat Mar 14 12:23:53 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (glob_helper): use d_type to reduce lstat system calls.
+
+	* win32/dir.h (struct direct): add d_type instead of d_isdir and
+	  d_isrep.  SYMLINKD is unreliable, since the target can be
+	  replaced after a link was created.
+
+	* win32/win32.c (readdir_internal): set d_type.
+
+Sat Mar 14 02:14:50 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (primary): empty parentheses at cmdarg can be null.
+	  [ruby-core:68477] [Bug #10957]
+
+Fri Mar 13 15:04:36 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/stringio/stringio.c (strio_close): don't raise on double
+	  close for consistent to IO#close.
+
+Fri Mar 13 15:03:20 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (rb_io_close_read, rb_io_close_write): don't raise after
+	  close same as IO#close.
+
+Fri Mar 13 12:29:07 2015  Tanaka Akira  <akr@fsij.org>
+
+	* test/readline/test_readline.rb: Restore environment variables:
+	  COLUMNS LINES
+
+Fri Mar 13 11:37:46 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/fiddle/extconf.rb: needs --enable-shared when linked to
+	  libruby or fiddle.so.  since --with-static-linked-ext does no
+	  longer link extensions to ruby program with --enable-shared, the
+	  only combination needs --enable-static is --disable-shared and
+	  --with-static-linked-ext.  [ruby-dev:48901] [Bug #10960]
+
+Fri Mar 13 07:02:20 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/init.c (rsock_s_accept_nonblock): use rb_hash_lookup2
+	* ext/openssl/ossl_ssl.c (get_no_exception): new function
+	  (ossl_ssl_accept_nonblock): use get_no_exception
+	  (ossl_ssl_read_internal): ditto
+	  (ossl_ssl_write_nonblock): ditto
+	  [ruby-core:68511]
+
+Fri Mar 13 07:01:38 2015  Eric Wong  <e@80x24.org>
+
+	* ext/openssl/ossl_ssl.c: predefine wait_*able symbols
+
+Thu Mar 12 22:59:53 2015  Tanaka Akira  <akr@fsij.org>
+
+	* test/lib/leakchecker.rb: Check environment variables.
+
+Thu Mar 12 05:54:27 2015  Eric Wong  <e@80x24.org>
+
+	* ext/socket/init.c (rsock_s_accept_nonblock):
+	  support exception: false
+	  [ruby-core:66385] [Feature #10532]
+	* ext/socket/init.c (rsock_init_socket_init): define new symbols
+	* ext/socket/rubysocket.h: adjust prototype
+	* ext/socket/socket.c (sock_accept_nonblock): support exception: false
+	* ext/openssl/ossl_ssl.c (ossl_ssl_accept_nonblock): ditto
+	* ext/socket/socket.c (Init_socket): adjust accept_nonblock definition
+	* ext/openssl/ossl_ssl.c (Init_ossl_ssl): ditto
+	* ext/socket/tcpserver.c (rsock_init_tcpserver): ditto
+	* ext/socket/unixserver.c (rsock_init_unixserver): ditto
+	* ext/socket/tcpserver.c (tcp_accept_nonblock): adjust
+	  rsock_s_accept_nonblock call
+	* ext/socket/unixserver.c (unix_accept_nonblock): ditto
+	* ext/openssl/ossl_ssl.c (ossl_start_ssl): support no_exception
+	* ext/openssl/ossl_ssl.c (ossl_ssl_connect): adjust ossl_start_ssl call
+	* ext/openssl/ossl_ssl.c (ossl_ssl_connect_nonblock): ditto
+	* ext/openssl/ossl_ssl.c (ossl_ssl_accept): ditto
+	* test/socket/test_nonblock.rb (test_accept_nonblock): test for
+	  "exception :false"
+	* test/socket/test_tcp.rb (test_accept_nonblock): new test
+	* test/socket/test_unix.rb (test_accept_nonblock): ditto
+	* test/openssl/test_pair.rb (test_accept_nonblock_no_exception): ditto
+
+Thu Mar 12 10:53:06 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* internal.h, node.h: move a definition of `struct rb_global_entry'
+	  and related functions from node.h to internal.h.
+
+	* variable.c: remove unused include pragma.
+
+	* common.mk: remove unused dependency.
+
+Thu Mar 12 10:32:39 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* common.mk: remove unused dependency.
+
+Thu Mar 12 08:20:14 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* load.c: removed unused header file "node.h".
+
+	* method.h: ditto.
+
+	* symbol.c: ditto.
+
+Thu Mar 12 08:14:48 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c: RGENGC_CHECK_MODE should be 0.
+
+Thu Mar 12 07:44:17 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* internal.h: use T_IMEMO to represent `struct MEMO' value.
+	  memo->v1 and memo->v2 is WB protected values.
+	  So use MEMO_V1/V2_SET() macros to set these values.
+	  memo->u3 is ambiguous (sometimes a VALUE, sometimes an integer
+	  value), so use gc_mark_maybe() in gc.c to mark it.
+
+	  Rename NEW_MEMO() to MEMO_NEW().
+
+	  Move MEMO_FOR and NEW_MEMO_FOR macros from node.h.
+
+	  Export a rb_imemo_new() function for ext/ripper.
+
+	* node.h: remove NODE_MEMO.
+
+	* enum.c: catch up these change.
+
+	* enumerator.c: ditto.
+
+	* load.c: ditto.
+
+	* ext/objspace/objspace.c (count_nodes): ditto.
+
+	* gc.c (gc_mark_children): mark imemo_memo type.
+
+	* parse.y (new_args_gen): use T_IMEMO.
+	  (I'm not sure it is working correctly...)
+
+Wed Mar 11 22:36:34 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* eval.c (frame_called_id): it should use vm_ifunc type.
+
+	* eval.c (frame_func_id): ditto.
+
+Wed Mar 11 22:27:05 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* node.h: remove NODE_IFUNC, NEW_IFUNC.
+
+	* internal.h: use T_IMEMO for IFUNC.
+
+	  rename `struct IFUNC' to `struct vm_ifunc' and move the definition
+	  from vm_insnhelper.h. Add imemo_ifunc.
+
+	* gc.c (gc_mark_children): mark imemo_ifunc type T_IMEMO object.
+
+	* compile.c: catch up these changes.
+
+	* proc.c: ditto.
+
+	* vm_core.h (RUBY_VM_IFUNC_P): ditto.
+
+	* vm_eval.c (rb_iterate): ditto.
+
+	* vm_insnhelper.c: ditto.
+
+	* ext/objspace/objspace.c: ditto.
+
+Wed Mar 11 21:53:43 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* internal.h, eval_intern.h: move CREF accessors.
+
+	  List IMEMO supported types in internal.h.
+
+Wed Mar 11 21:45:36 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.h: use T_IMEMO to create THROW_DATA.
+
+	  Add THROW_DATA_NEW().
+
+	* internal.h: move definition of `struct THROW_DATA'
+	  from vm_insnhelper.h to internal.h.
+
+	  Rename `THROW_DATA' to `vm_throw_data'.
+
+	* eval_intern.h (THROW_DATA_P): move to internal.h.
+	  THROW_DATA is no longer T_NODE, so check T_IMEMO.
+
+	* gc.c (gc_mark_children): mark THROW_DATA.
+
+	* vm.c: catch up these changes.
+
+	* vm_eval.c: ditto.
+
+	* vm_insnhelper.c: ditto.
+
+Wed Mar 11 21:21:56 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c: use T_IMEMO to create SVAR.
+
+	* internal.h, vm_insnhelper.h: move definition `struct SVAR'
+	  from vm_insnhelper.h to internal.h. And rename it to struct vm_svar.
+
+	  new imemo_type imemo_svar is added.
+
+	* gc.c (gc_mark_children): mark imemo_svar.
+
+	* node.c (rb_gc_mark_node): remove useless marking.
+
+Wed Mar 11 19:35:46 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* include/ruby/ruby.h: introduce new type T_IMEMO.
+	  T_IMEMO is Internal Memo type, internal use only.
+	  T_IMEMO has same purpose of NODE_MEMO.
+
+	  To insert T_IMEMO, type numbers are modified a little.
+
+	* internal.h: define struct RIMemo. Each RIMemo objects
+	  has imemo_type. We can observe it by the imemo_type() function.
+
+	* gc.c (rb_imemo_new): added.
+
+	* node.h: remove NODE_CREF and NEW_CREF().
+
+	* node.c (rb_gc_mark_node): ditto.
+
+	* vm.c (vm_cref_new): use rb_imem_new().
+
+	* vm_eval.c: ditto.
+
+	* vm_insnhelper.c: use RIMemo objects for CREF.
+
+	* ext/objspace/objspace.c: support T_IMEMO.
+
+Wed Mar 11 17:03:20 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c: fix memory leak by prepend method.
+
+	  It is easy to reproduce with such script:
+
+	    module M; def bar; end; end
+	    loop{
+	      Class.new do
+	        def foo; end
+	        prepend M
+	      end
+	    }
+
+	* gc.c (obj_free): free T_ICLASS::m_tbl if it is created by prepend.
+	  To recognize it, check RICLASS_IS_ORIGIN flag.
+
+	* gc.c (gc_mark_children): T_ICLASS objects only need to mark
+	  T_ICLASS::m_tbl if RICLASS_IS_ORIGIN is set.
+
+	* gc.c (obj_memsize_of): count T_ICLASS if RICLASS_IS_ORIGIN is set.
+
+	* internal.h (RCLASS_SET_ORIGIN): add to set RCLASS_SET_ORIGIN.
+
+	  TODO: The word `origin' seems not good name. We need to invent
+	  another good name.
+
+	* class.c: use RCLASS_SET_ORIGIN().
+
+	* class.c (class_alloc): zero clear rb_classext_t.
+
+Wed Mar 11 13:28:49 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in: check also procstat_getvmmap, which is not
+	  available on FreeBSD 9.  [ruby-core:68468] [Bug #10954]
+
+	* vm_dump.c (procstat_vm): use kinfo_getvmmap instead if
+	  procstat_getvmmap is not available.
+
+Wed Mar 11 09:15:21 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* internal.h: define struct MEMO.
+
+	* enum.c: use MEMO.
+
+	* enumerator.c: ditto.
+
+	* load.c: ditto.
+
+	* node.h: return (struct MEMO *) pointer.
+
+Wed Mar 11 06:26:21 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.h (THROW_DATA_STATE): return int, not VALUE.
+
+	* vm_insnhelper.h (THROW_DATA_STATE_SET): accept int value.
+
+Wed Mar 11 05:06:46 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_eval.c (rb_catch_protect): use THROW_DATA_VAL().
+
+Wed Mar 11 04:56:04 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.h: define struct IFUNC.
+
+	* vm_eval.c (rb_iterate): use it.
+
+	* vm_insnhelper.c (vm_yield_with_cfunc): ditto.
+
+Wed Mar 11 03:52:12 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* eval_intern.h (THROW_DATA_P): use RB_TYPE_P() instead of
+	  BUILTIN_TYPE().
+
+	* thread.c (thread_join): use THROW_DATA_P().
+
+Wed Mar 11 03:48:01 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* proc.c: use RUBY_VM_IFUNC_P() to recognize IFUNC or not.
+
+	* vm.c: ditto.
+
+	* vm_dump.c: ditto.
+
+	* vm_insnhelper.c: ditto.
+
+	* vm_core.h (RUBY_VM_IFUNC_P): use RB_TYPE_P() instead of
+	  BUILTIN_TYPE().
+
+Wed Mar 11 03:21:37 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.h: define struct THROW_DATA to represent
+	  throwing data. Also define accessor functions.
+
+	* eval_intern.h: move related changes into vm_insnhelper.h.
+	  Now these MACROs (functions) are only used in vm*.c.
+
+	  There is only THROW_DATA_P(err) to check this data type or not.
+
+	* vm.c: catch up these changes.
+
+	* vm_eval.c: ditto.
+
+	* vm_insnhelper.c: ditto.
+
+Wed Mar 11 00:57:00 2015  Rei Odaira  <Rei.Odaira@gmail.com>
+
+	* test/rubygems/test_gem_security_trust_dir.rb: The return value of
+	  File::Stat#mode is OS dependent. In AIX, 0200000 is set.
+
+Tue Mar 10 20:03:41 2015  Tanaka Akira  <akr@fsij.org>
+
+	* lib/webrick/server.rb: Invoke setup_shutdown_pipe in start method
+	  instead of listen method.
+	  [ruby-core:68476] [Bug #10956] Reported by Shintaro Kojima.
+
+Tue Mar 10 17:27:27 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* thread.c (thread_join): Fixnum (except TAG_FATAL) and
+	  NODE should not be reached here.
+
+Mon Mar  9 21:42:10 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c (ep_cref): rename to lep_cref() because it should be
+	  local ep.
+
+Mon Mar  9 16:34:36 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/stringio/stringio.c (strio_close): don't raise on double
+	  close for consistent to IO#close.
+
+Mon Mar 09 06:44:48 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.h: define struct SVAR for SVAR.
+	  This data type is also same layout of NODE (NODE_IF).
+
+	* vm_insnhelper.c: catch up this change.
+
+Mon Mar  9 06:43:21 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c (lep_svar_set): add WBs.
+
+Mon Mar  9 06:19:06 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* internal.h: define rb_cref_t and change to use it.
+
+	  rb_cref_t is data type of CREF. Now, the body is still NODE.
+	  It is easy to understand what is CREF and what is pure NODE.
+
+Mon Mar  9 06:00:37 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.h (COPY_CREF_OMOD): fix translation miss.
+
+Mon Mar  9 04:47:58 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* internal.h: define CREF accessor macros.
+	  * CREF_CLASS(cref)
+	  * CREF_NEXT(cref)
+	  * CREF_VISI(cref)
+	  * CREF_VISI_SET(cref, v)
+	  * CREF_REFINEMENTS(cref)
+	  * CREF_PUSHED_BY_EVAL(cref)
+	  * CREF_PUSHED_BY_EVAL_SET(cref)
+	  * CREF_OMOD_SHARED(cref)
+	  * CREF_OMOD_SHARED_SET(cref)
+	  * CREF_OMOD_SHARED_UNSET(cref)
+
+	  This is process to change CREF data type from NODE.
+
+Sun Mar  8 22:50:57 2015  Tanaka Akira  <akr@fsij.org>
+
+	* ext/zlib/zlib.c (rb_gzfile_close): Don't raise on double
+	  close for consistent to IO#close.
+
+Sun Mar  8 16:57:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (glob_helper): match patterns against legacy short names
+	  too, not only ordinary names.  [ruby-core:67954] [Bug #10819]
+
+	* win32/dir.h (struct direct): add short name members.
+
+	* win32/win32.c (opendir_internal, readdir_internal): ditto.
+
+Sat Mar  7 09:36:05 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* array.c: document that first element is kept when using
+	  Array#uniq and #uniq! [fix GH-845][ci skip]
+	  Patch by @riffraff
+
+Sat Mar  7 09:28:02 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* thread.c: Mutex#owned? is no longer experimental since 2.1.0
+	  [fix GH-839][ci skip] Patch by @takiy33
+
+Sat Mar  7 09:18:42 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* tool/merger.rb: Added documentation to version method.
+	  [fix GH-847][ci skip] Patch by @magikid
+
+Fri Mar  6 22:50:36 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* class.c (rb_prepend_module): need a WB for klass -> origin.
+
+Fri Mar  6 20:18:38 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* fix namespace issue on singleton class expressions. [Bug #10943]
+
+	* vm_core.h, method.h: remove rb_iseq_t::cref_stack. CREF is stored
+	  to rb_method_definition_t::body.iseq_body.cref.
+
+	* vm_insnhelper.c: modify SVAR usage.
+	  When calling ISEQ type method, push CREF information onto method
+	  frame, SVAR located place. Before this fix, SVAR is simply nil.
+	  After this patch, CREF (or NULL == Qfalse for not iseq methods)
+	  is stored at the method invocation.
+
+	  When SVAR is required, then put NODE_IF onto SVAR location,
+	  and NDOE_IF::nd_reserved points CREF itself.
+
+	* vm.c (vm_cref_new, vm_cref_dump, vm_cref_new_toplevel): added.
+
+	* vm_insnhelper.c (vm_push_frame): accept CREF.
+
+	* method.h, vm_method.c (rb_add_method_iseq): added. This function
+	  accepts iseq and CREF.
+
+	* class.c (clone_method): use rb_add_method_iseq().
+
+	* gc.c (mark_method_entry): mark method_entry::body.iseq_body.cref.
+
+	* iseq.c: remove CREF related codes.
+
+	* insns.def (getinlinecache/setinlinecache): CREF should be cache key
+	  because a different CREF has a different namespace.
+
+	* node.c (rb_gc_mark_node): mark NODE_IF::nd_reserved for SVAR.
+
+	* proc.c: catch up changes.
+
+	* struct.c: ditto.
+
+	* insns.def: ditto.
+
+	* vm_args.c (raise_argument_error): ditto.
+
+	* vm_eval.c: ditto.
+
+	* test/ruby/test_class.rb: add a test.
+
+Fri Mar  6 18:19:13 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* test/webrick/test_filehandler.rb: on vboxsf (on VirtualBox
+	  on Windows 7), file name and permissions are strange (can access
+	  by short file name and so on).
+
+	  Simply skip on such tests on such FS. To detect strange FS, this
+	  patch use a part of code `File.executable?(__FILE__)`.
+	  Please correct them if there are better ways.
+
+Fri Mar  6 17:31:29 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* test/ruby/test_beginendblock.rb: do not change directory.
+
+	  Run system command in the directory mounted by vboxsf on Windows 7
+	  and get warning like that "warning: Insecure world writable dir...".
+
+Fri Mar  6 10:31:00 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_eval.c (vm_call_super): search next super class from the
+	  original class, to get rid of infinite recursion with
+	  prepending.  a patch by Seiei Higa <hanachin AT gmail.com> at
+	  [ruby-core:68434].  [ruby-core:68093] [Bug #10847]
+
+Fri Mar  6 08:45:26 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+
+	* lib/matrix.rb: Add Vector#round. Patch by Jordan Stephens.
+	  [Fixes GH-802]
+
+Fri Mar  6 07:33:03 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (obj_info): show node name too.
+
+Fri Mar  6 07:00:44 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* internal.h: remove struct method_table_wrapper.
+	  struct method_table_wrapper was introduced to avoid duplicate marking
+	  for method tables.
+
+	  For example, `module M1; def foo; end; end` make one method table
+	  (mtbl) contains a method `foo`. M1 (T_MODULE) points mtbl.
+	  Classes C1 and C2 includes M1, then two T_ICLASS objects are created
+	  and they points mtbl too. In this case, three objects (one T_MODULE
+	  and two T_ICLASS objects) points same mtbl. On marking phase, these
+	  three objects mark same mtbl. To avoid such duplication, struct
+	  method_table_wrapper was introduced.
+
+	  However, created two T_ICLASS objects have same or shorter lifetime
+	  than M1 (T_MODULE) object. So that we only need to mark mtbl from M1,
+	  not from T_ICLASS objects. This patch tries marking only from M1.
+	  In other words, original module (M1) has responsibility to mark mtbl.
+	  Because of no duplicate marking, we don't need method_table_wrapper
+	  any more.
+
+	  Note that one `Module#prepend` call creates two T_ICLASS objects.
+	  One for referring to a prepending Module object, same as
+	  `Module#include`. We don't need to care this T_ICLASS.
+	  One for moving original mtbl from a prepending class. We need to
+	  mark such mtbl from this T_ICLASS object. To mark the mtbl,
+	  we need to use `RCLASS_ORIGIN(klass)` on marking from a prepended
+	  class `klass`.
+
+	* class.c: ditto.
+
+	* eval.c (rb_using_refinement): ditto.
+
+	* gc.c: ditto.
+
+	* include/ruby/ruby.h: define m_tbl directly. The definition of
+	  struct RClass should be moved to (srcdir)/internal.h.
+
+	* method.h: remove decl of rb_free_m_tbl_wrapper().
+
+	* object.c: use RCLASS_M_TBL() directly.
+
+Fri Mar  6 02:50:12 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* dir.c (replace_real_basename): need to check the return value of
+	  GLOB_REALLOC().
+
+Fri Mar  6 02:26:03 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* dir.c (replace_real_basename): shouldn't create Ruby object before
+	  the object system is loaded.
+	  [ruby-core:68430] [Bug #10941]
+
+Wed Mar  5 16:58:43 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
+
+	* hash.c: [DOC] #delete method actually returns nil, if the key
+	  is not found. [fix GH-844][ci skip] Patch by @ivdma
+
+Wed Mar  5 12:22:23 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
+
+	* math.c: refactoring: remove unnecessary variable d0 to unify code
+	  appearance.
+
+Thu Mar  5 11:50:54 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* vm_eval.c (eval_string_with_cref): A binding should keep
+	  refinements activation information and the refinements should be
+	  activated in subsequent eval calls with the binding.
+	  [ruby-core:67945] [Bug #10818]
+
+Thu Mar  5 11:16:55 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* test/ruby/test_refinement.rb: There is no need anymore to suppress
+	  warnings.
+
+Thu Mar  5 08:31:02 2015  Rei Odaira  <Rei.Odaira@gmail.com>
+
+	* random.c (random_raw_seed): Avoid calling fill_random_bytes()
+	  if the requested size is 0. AIX returns -1 for 0-byte read from
+	  /dev/urandom, while other UNIX returns 0. With this change,
+	  Random.raw_seed(0) consistently returns "" in any UNIX.
+
+Wed Mar  4 12:43:32 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
+
+	* test/ruby/test_math.rb (assert_float_and_int): Refactor test cases
+	  by introducing assert_float_and_int. [misc #10810]
+
+Wed Mar  4 11:52:30 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* symbol.c (Init_sym): make dsym_fstrs a hash compared by identity
+	  as the keys are unique fstrings, to get rid of running hash and
+	  compare methods and causing new object allocation during garbage
+	  collection phase.  [ruby-dev:48891] [Bug #10933]
+
+Wed Mar  4 10:16:57 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* enum.c: Fix typo in slice_after's exception message.
+	  [fix GH-842][ci skip] Patch by @jsyeo
+
+Wed Mar  4 10:15:37 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* doc/syntax/methods.rdoc: add some missing spaces and
+	  fix a grammatical error in method docs.
+	  [fix GH-843][ci skip] Patch by @nikolas
+
+Wed Mar  4 02:13:06 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* tool/redmine-backporter.rb (backport_command_string): pick up only
+	  when the revision exists in trunk.
+
+Wed Mar  4 00:44:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* thread.c (rb_thread_io_blocking_region): assigned variables
+	  inside EXEC_TAG() should be volatile.
+
+	* thread.c (rb_thread_s_handle_interrupt): ditto.
+
+	* thread.c (exec_recursive): ditto.
+
+Wed Mar  4 00:29:18 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* tool/redmine-backporter.rb: now can specify shorten form of commands.
+
+Tue Mar  3 23:41:42 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* tool/redmine-backporter.rb (Readline.readline): drop untreated control
+	  characters.
+
+Tue Mar  3 22:25:24 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/lib/envutil.rb (EnvUtil.invoke_ruby): need to rescue because
+	  Signal.signame may raise exception.
+
+Tue Mar  3 16:57:39 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* tool/redmine-backporter.rb: use 'b' instead of 's' for showing
+	  Backport options for merger.rb.
+
+Tue Mar  3 16:55:23 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* tool/redmine-backporter.rb: show selected ticket number at prompt.
+
+Tue Mar  3 14:47:30 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
+
+	* math.c (num2dbl_with_to_f): direct casting from Rational to double.
+	  [Feature #10909]
+
+	* test/ruby/test_math.rb: add tests for the above change.
+
+Tue Mar  3 07:52:20 2015  Rei Odaira  <Rei.Odaira@gmail.com>
+
+	* test/ruby/test_symbol.rb: avoid a false positive in AIX.
+
+Tue Mar  3 00:59:39 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* configure.in: set PRELOADENV in Solaris to avoid "wrong ELF class"
+	  error. [Bug #10926] [ruby-dev:48888]
+	* configure.in: set LIBPATHENV for 32-bit compile in Solaris
+	  in addition to 64-bit.
+
+Mon Mar  2 15:36:10 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in: do not check _setjmp unless _longjmp is available,
+	  so that configure results will not be changed by cache.
+
+Mon Mar  2 14:44:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (RUBY_REPLACE_TYPE): restore unsigned type from
+	  cached variable only if the target type is not available.
+
+Mon Mar  2 13:04:27 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* signal.c (sig_signame): return nil if the argument is a valid
+	  signal number.
+
+Mon Mar  2 12:05:04 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* test/net/ftp/test_ftp.rb (create_ftp_server): set SO_OOBINLINE
+	  for receiving OOB data which is sent with MSG_OOB flag in
+	  portable way. [Bug #10915] [ruby-dev:48885]
+	* test/net/ftp/test_ftp.rb (test_abort, test_status): use gets
+	  for receiving OOB data in portable way.
+
+Mon Mar  2 11:43:07 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (RUBY_REPLACE_TYPE): restore unsigned type from
+	  cached variable.
+
+Mon Mar  2 06:01:41 2015  Eric Wong  <e@80x24.org>
+
+	* ext/io/wait/wait.c (io_nread): wrap return value with INT2FIX
+	  Thanks to Yura Sokolov <funny.falcon@gmail.com>
+	  [ruby-core:68369] [Bug#10923]
+	* test/io/wait/test_io_wait.rb (test_nread_buffered):
+	  fix broken test
+
+Sun Mar  1 20:21:16 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (RUBY_REPLACE_TYPE): restore convertible type from
+	  cached variable, so that configured results will be stable.
+
+Sun Mar  1 18:10:34 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (rb_cv_broken_memmem): check before adding the
+	  result HAVE_MEMMEM macro to confdefs.h, so that configured
+	  results will be stable.
+
+Sun Mar  1 11:17:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* gc.c (id2ref): prohibit from accessing internal objects.
+	  [ruby-core:68348] [Bug #10918]
+
+Sun Mar  1 09:06:11 2015  Tanaka Akira  <akr@fsij.org>
+
+	* lib/time.rb (strptime): Support %s.%N.
+	  [ruby-core:68301] [Bug #10904] Patch by Sadayuki Furuhashi.
+
+Sat Feb 28 17:18:39 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* enum.c (enum_each_slice, enum_each_cons): limit elements size by
+	  the enumerator size.  suggested by Hans Mackowiak <hanmac AT
+	  gmx.de> at [ruby-core:68335]
+
+Sat Feb 28 15:44:20 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_dump.c (rb_vm_bugreport): get rid of making new strings
+	  inside signal context.
+
+	* variable.c (rb_tmp_class_path): defer making temporary class
+	  path string.
+
+	* variable.c (rb_search_class_path): search class path or return
+	  Qnil or Qfalse if unnamed, not creating a temporary path.
+
+Sat Feb 28 15:02:02 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* variable.c (rb_tmp_class_path): preserve name encoding of an
+	  anonymous instance of module/class subclass.
+
+Sat Feb 28 08:24:30 2015  Rei Odaira  <Rei.Odaira@gmail.com>
+
+	* ext/pty/pty.c: AIX supports autopush.
+	  Patch by Perry Smith [ruby-core:58539] [Bug #9144]
+
+Fri Feb 27 22:00:05 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* lib/rubygems: Update to RubyGems 2.4.6 and HEAD(800f2e6).
+	  Fixed #1159, #1171, #1173 on rubygems/rubygems
+	* test/rubygems: ditto.
+
+Fri Feb 27 20:55:42 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* lib/rake: Update to rake (9237e74), typo fix and remove needless
+	  private syntax.
+	* test/rake: ditto.
+
+Fri Feb 27 17:06:44 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_core.h: define vm_svar_index.
+
+	* vm_insnhelper.c, vm.c, compile.c: use vm_svar_index names.
+
+	* iseq.h: remove DEFAULT_SPECIAL_VAR_COUNT.
+	  use VM_SVAR_FLIPFLOP_START instead.
+
+Fri Feb 27 13:57:48 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (setup_narg): wipe away expanded part of buffer to get rid
+	  of revealing uncleaned data.  reported by Dongkwan Kim <dkay AT
+	  kaist.ac.kr>.
+
+Wed Feb 25 22:25:07 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* spec/default.mspec: use default configuration file name.
+	  https://github.com/ruby/rubyspec/commit/cc69f337b06362e5607ffa3e3ad40ef7494960cf
+
+Wed Feb 25 22:21:56 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* spec/default.mspec: remove specific version number.
+	  https://github.com/ruby/rubyspec/commit/7a909e925c1baa9c700bd44af9241aef6e596714
+
+Wed Feb 25 22:04:04 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ext/win32/Win32API.rb (initialize): accept both a string and an array
+	  for the arguments of the imported function.
+	  reported by Aaron Stone [ruby-core:68208] [Bug #10876] [Fixes GH-835]
+
+Wed Feb 25 18:12:11 2015  Eric Wong  <e@80x24.org>
+
+	* signal.c (sighandler): preserve errno
+	  Patch by Steven Stewart-Gallus <sstewartgallus00@mylangara.bc.ca>
+	  [ruby-core:68172] [Bug #10866]
+
+Wed Feb 25 15:59:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (push_pattern, push_glob): make globbed file names same
+	  encoding to the given pattern.
+
+Wed Feb 25 15:27:16 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* tool/merger.rb: support 2.1+ versioning scheme.
+
+Tue Feb 25 08:49:12 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
+
+	* lib/cmath.rb (log): raise ArgumentError when more than 2 arguments
+	  are passed. [ruby-core:66143] [Bug #10487]
+
+Tue Feb 25 02:15:17 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
+
+	* test/ruby/test_math.rb: Use assert_infinity instead of assert_equal(1.0/0, ...).
+
+	* test/ruby/test_math.rb: Add tests for overriding Integer#to_f.
+	  [ruby-core:67919] [Misc #10809]
+
+Tue Feb 24 22:58:48 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* complex.c (nucomp_mul): calculate as rotation in complex plane
+	  if matrix calculation resulted in NaN.
+
+Tue Feb 24 21:45:39 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
+
+	* test/ruby/test_math.rb(test_cbrt): Add an assertion for Math.cbrt(1.0/0)
+	  and move #test_cbrt to more proper place.
+
+Tue Feb 24 19:09:25 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* vm_insnhelper.c (lep_svar_place, lep_svar_get): do not create
+	  additional T_NODE object (svars holder) when only getting
+	  svars.
+
+Tue Feb 24 11:49:48 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* time.c (time_zone_name): should be US-ASCII only if all 7-bits,
+	  otherwise locale encoding.  [ruby-core:68230] [Bug #10887]
+
+Tue Feb 24 09:47:07 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (chompped_length): enable smart chomp for all non-dummy
+	  encoding strings, not only default_rs.
+	  [ruby-core:68258] [Bug #10893]
+
+Mon Feb 23 23:19:42 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* tool/vcs.rb (IO.popen): support :chdir option.
+
+	* tool/vcs.rb (VCS::GIT.get_revisions): use :chdir option instead
+	  of -C option which is not supported by older git.
+	  [ruby-dev:48880] [Bug #10890]
+
+Mon Feb 23 15:26:39 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (rb_str_split_m): raise ArgumentError at broken string
+	  not RegexpError, as Regexp is not involved in.
+	  [ruby-core:68229] [Bug #10886]
+
+Mon Feb 23 07:25:29 2015  Benoit Daloze  <eregontp@gmail.com>
+
+	* time.c: Zone encoding should be US-ASCII if all 7-bits. Fix r46907.
+
+	* test/ruby/test_time.rb, test/ruby/test_time_tz.rb: Update tests.
+
+Sun Feb 22 18:33:42 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* common.mk: use ruby organization for rubyspec.
+
+Sun Feb 22 15:56:06 2015  Kazuki Tsujimoto  <kazuki@callcc.net>
+
+	* vm_insnhelper.c (rb_vm_rewrite_cref_stack): copy nd_refinements
+	  of original crefs. It fixes segmentation fault when calling
+	  refined method in duplicate module. [ruby-dev:48878] [Bug #10885]
+
+	* vm_core.h, class.c: change accordingly.
+
+	* test/ruby/test_refinement.rb: add a test for above.
+
+Sun Feb 22 10:43:37 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* gc.c (rb_objspace_call_finalizer): control GC execution during
+	  force firnalizations at the end of interpreter process.
+	  [Bug #10768]
+
+	  1) Prohibit incremental GC while running Ruby-level finalizers
+	     to avoid any danger.
+	  2) Prohibit GC while invoking T_DATA/T_FILE data structure
+	     because these operations break object relations consistency.
+
+	  This patch can introduce another memory consuming issue because
+	  Ruby-level finalizers can run after (2), GC is disabled.
+	  However, basically object consistency was broken at (2) as I
+	  described above. So that running Ruby-level finalizers contains
+	  danger originally. Because of this point, I need to suggest to
+	  remove these 3 lines (invoking remaining finalizers). And add a
+	  rule to add that finalizers should not add new finalizers, or
+	  say there is no guarantee to invoke finalizers that added by
+	  another finalizer.
+
+Sun Feb 22 04:07:05 2015  Zachary Scott  <e@zzak.io>
+
+	* ext/openssl/ossl_asn1.c: [DOC] RDoc formatting fixes for
+	  ASN1::ObjectId with patch from @vbatts [Fixes GH-834]
+
+	* ext/openssl/ossl_bn.c: ditto.
+
+Sat Feb 21 19:51:49 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* re.c (match_aref): RMatch::regexp is Qnil after matching by a
+	  string since r45451.  [ruby-core:68209] [Bug #10877]
+
+Sat Feb 21 16:18:42 2015  Stefan Schuler  <mail@stefanschuessler.de>
+
+	* compar.c (Init_Comparable): [DOC] Replace camelcase variable name.
+	  [Fix GH-833]
+
+Fri Feb 20 17:27:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* file.c (rb_file_identical_p): fix handle leak, ensure to close
+	  the handle of the first argument.
+
+Fri Feb 20 17:19:23 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* win32/win32.c (different_device_p): compare by volume serial
+	  numbers, not by path names.  [ruby-core:68162] [Bug #10865]
+
+Thu Feb 19 01:58:10 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* win32/file.c (rb_file_expand_path_internal): neither the drive
+	  of base directory nor the current drive are involved in the
+	  result if different than the drive of path.
+	  [ruby-core:68130] [Bug #10858]
+
+Wed Feb 18 10:48:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* win32/win32.c (wrename): return EXDEV if moving a directory to
+	  another drive, since MoveFileExW does not set proper error code.
+	  [ruby-core:68162] [Bug #10865]
+
+Wed Feb 18 03:13:52 2015  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych.rb: bump psych version.
+	* ext/psych/psych.gemspec: ditto
+	* ext/psych/yaml/scanner.c: add latest libyaml change.
+	* test/psych/helper.rb: support newer minitest
+	* test/psych/test_to_yaml_properties.rb: ditto
+
+Tue Feb 17 11:47:17 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/resolv.rb (Resolv::DNS::Resource#==, #hash): elements
+	  returned by Kernel#instance_variables are Symbols now.
+	  [ruby-core:68128] [Bug #10857]
+
+Tue Feb 17 10:59:10 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* doc/syntax/calling_methods.rdoc: Fix documentation for "calling_methods"
+	  Patch by @sos4nt [fix GH-830][ci skip]
+
+Tue Feb 17 10:53:29 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* win32/file.c (rb_file_expand_path_internal): do not make invalid
+	  (or ADS) path if the path has a drive letter, the result also
+	  should have be under it.  [ruby-core:68130] [Bug #10858]
+
+Tue Feb 17 10:47:20 2015  Iain Beeston  <iain.beeston@gmail.com>
+
+	* hash.c: Added docs to explain that #include? and #member? do not
+	  check member equality
+	* lib/set.rb: ditto
+
+Mon Feb 16 20:58:49 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* compile.c (compile_massign): optimization for special case,
+	  assignments by aset or attrset.
+	  http://kokizzu.blogspot.jp/2015/02/c-java-hhvm-ruby-nodejsrhinojscspidermo.html
+	  http://www.atdot.net/~ko1/diary/201502.html#d16
+
+Sun Feb 15 10:41:23 2015  Sho Hashimoto  <sho-h@ruby-lang.org>
+
+	* doc/standard_library.rdoc: [DOC] delete removed libraries.
+	  [misc #10843] [ci skip]
+
+Sat Feb 14 12:20:01 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* random.c (rand_random_number): add a method to return a random
+	  number like SecureRandom to Random::Formatter.
+
+	* lib/securerandom.rb (random_bytes): move to Random::Formatter,
+	  the base method of the module.
+
+Sat Feb 14 12:01:32 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* random.c (random_raw_seed): extract platform dependent random
+	  seed initialization function as a new method Random.raw_seed.
+
+	* lib/securerandom.rb (SecureRandom): use Random.raw_seed.
+
+Sat Feb 14 00:49:37 2015  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/coverage/coverage.c: Add Coverage.peek_result.  Allows you to
+	  capture coverage information without stopping the coverage tool.
+	  [ruby-core:67940] [Feature #10816]
+
+	* test/coverage/test_coverage.rb: test for change.
+
+Fri Feb 13 21:52:05 2015  Yusuke Endoh  <mame@tsg.ne.jp>
+
+	* string.c (str_discard): does not free for STR_NOFREE string.
+	  [Bug #10853][ruby-core:68110]
+
+	* bootstraptest/test_string.rb: test for above.
+
+Fri Feb 13 21:16:00 2015  Yusuke Endoh  <mame@tsg.ne.jp>
+
+	* lib/base64.rb: make urlsafe mode user-friendly.
+
+	* lib/base64.rb (Base64.urlsafe_encode64): a new option "padding" to
+	  suppress the padding character ("=").
+
+	* lib/base64.rb (Base64.urlsafe_decode64): now it accepts not only
+	  correctly-padded input but also unpadded input.
+	  [Feature #10740][ruby-core:67570]
+
+	* test/base64/test_base64.rb: Test for above
+
+Fri Feb 13 14:19:06 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* ext/json: merge upstream from flori/json
+	  change usage of TypedData. [Feature #10739][ruby-core:67564]
+
+Thu Feb 12 18:34:01 2015  multisnow  <infinity.blick.winkel@gmail.com>
+
+	* ext/openssl/extconf.rb: check RAND_edg to support libressl.
+
+	* ext/openssl/ossl_rand.c (ossl_rand_egd): define only if RAND_edg
+	  is available.  [Fix GH-829]
+
+Thu Feb 12 10:46:14 2015  Eric Hodel  <drbrain@segment7.net>
+
+	* proc.c (proc_call):  Improve Proc#call documentation.  Patch by
+	  Hsing-Hui Hsu.  [fix GH-761]
+
+Thu Feb 12 04:33:02 2015  Benoit Daloze  <eregontp@gmail.com>
+
+	* compar.c (cmp_equal): no more error hiding for Comparable#==.
+	  It now behaves as other Comparable methods. See #7688.
+
+	* test/ruby/test_comparable.rb: update related test.
+
+Thu Feb 12 03:28:05 2015  Eric Wong  <e@80x24.org>
+
+	* lib/set.rb (initialize): internal hash defaults to false
+
+	* lib/set.rb (include?): use Hash#[] for optimized dispatch.
+	  Patch by Ismael Abreu <ismaelga@gmail.com>
+	  [ruby-core:67664] [Misc #10754]
+
+Wed Feb 11 11:09:52 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/digest/digest_conf.rb (digest_conf): check for CommonDigest.
+
+	* ext/digest/*/*cc.h: for Apple CommonCrypto/CommonDigest.h.
+
+	* ext/digest/digest.h (DEFINE_FINISH_FUNC_FROM_FINAL): macro for
+	  finish functions, by inverting arguments order.
+
+	* ext/digest/digest_conf.rb (digest_conf): extract common
+	  configurations.
+
+Wed Feb 11 11:01:33 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/json/generator/generator.c (generate_json): get rid of
+	  unnecessary recursive calls which can cause infinite recursion.
+	  T_STRING may not have rb_cString.
+
+Wed Feb 11 07:53:35 2015  Masaki Suketa <masaki.suketa@nifty.ne.jp>
+
+	* test/win32ole/test_word.rb: use skip method to skip test.
+
+Tue Feb 10 11:38:28 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* vm_insnhelper.c (vm_call_method): stop method search when a method
+	  is not found in a refinement, to support undef in refinements.
+	  [ruby-core:66741] [Bug #10578]
+
+Tue Feb 10 11:19:11 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/ftp.rb (chdir, delete, gettextfile, mdtm, mkdir, nlst,
+	  putbinaryfile, puttextfile, rename, rmdir, size): support
+	  Pathname. Patch by Joe Rafaniello. [fix GH-828]
+
+Mon Feb  9 16:36:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* tool/make-snapshot (package): get rid of loading unbundled and
+	  unexpected libraries.  [ruby-core:67977] [Bug #10822]
+
+Sun Feb  8 20:09:37 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* lib/net/http/header.rb: pass header names as symbols.
+	  Patch by @DamirSvrtan [fix GH-805]
+	* test/net/http/test_httpheader.rb: added test.
+
+Sun Feb  8 13:04:25 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/socket/getaddrinfo.c (get_addr): reject too long hostname to
+	  get rid of GHOST vulnerability on very old platforms.
+
+	* ext/socket/raddrinfo.c (make_hostent_internal): ditto, paranoic
+	  check for the canonical name.
+
+Sun Feb  8 12:48:38 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/win32/lib/win32/registry.rb (Win32::Registry::API): use wide
+	  versions of RegDeleteValue and RegDeleteKey.
+	  [ruby-core:67958] [Bug #10820]
+
+Sat Feb  7 22:13:08 2015  Masaki Suketa <masaki.suketa@nifty.ne.jp>
+
+	* test/win32ole/test_win32ole_record.rb: remove test using .NET
+	  Framework 3.5 because it is not included in Windows 8/8.1.
+
+Sat Feb  7 19:25:25 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (has_magic): always get long path name on Windows even if
+	  no tilde is there.  [ruby-core:68011] [Bug #10819]
+
+	* dir.c (replace_real_basename): FindFirstFile ignore redirection
+	  character, check if exists before call it.  cf. [Bug #8597]
+
+Sat Feb  7 13:30:11 2015  Masaki Suketa <masaki.suketa@nifty.ne.jp>
+
+	* test/win32ole/test_win32ole_record.rb
+	  (test_ole_instance_variable_get): correct VT_RECORD type and
+	  instance variables.
+
+Fri Feb  6 17:47:05 2015  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/visitors/yaml_tree.rb: register nodes when
+	  dumping objects with custom coders. [ruby-core:66215] [Bug #10496]
+
+	* test/psych/test_coder.rb: test for fix
+
+Fri Feb  6 16:58:31 2015  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/visitors/to_ruby.rb: fix support for regular
+	  expressions with newlines. tenderlove/psych#222
+
+	* test/psych/test_yaml.rb: test for change.
+
+Fri Feb  6 10:31:50 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_core.h (rb_call_info_kw_arg_struct): make keywords a symbols
+	  list to get rid of inadvertent creation by variable keyword
+	  arguments.  [ruby-core:68031] [Bug #10831]
+
+Thu Feb  5 22:42:34 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* lib/rubygems:  Update to RubyGems HEAD(5c3b6f3).
+	  Fixed #1156, #1142, #1115, #1142, #1139 on rubygems/rubygems
+	* test/rubygems:  ditto.
+
+Thu Feb  5 13:41:01 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_eval.c (send_internal), vm_insnhelper.c (vm_call_opt_send):
+	  convert String method name into a Symbol, as method_missing
+	  method expects its first argument to be a Symbol.  [Bug #10828]
+
+	* vm_insnhelper.c (ci_missing_reason): return the reason of method
+	  missing in call info.
+
+	* vm_insnhelper.c (vm_call_opt_send): re-apply r49500 with the
+	  proper missing reason.  [Bug #10828]
+
+Thu Feb  5 10:31:46 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* class.c (rb_obj_singleton_methods): should use RTEST() to convert
+	  VALUE to int.
+
+Thu Feb  5 03:59:33 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+
+	* vm_insnhelper.c: Fix symbol leak with +send+ [Bug #10828]
+
+Wed Feb  4 20:26:54 2015  Masaki Suketa <masaki.suketa@nifty.ne.jp>
+
+	* ext/win32ole/win32ole.c (Init_win32ole): should not use atexit to
+	  free allocated hash table to avoid error on Cygwin.
+
+Wed Feb  4 15:34:25 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* class.c (method_entry_i, class_instance_method_list,
+	  rb_obj_singleton_methods): should not include methods of
+	  superclasses if recur is false. [ruby-dev:48854] [Bug #10826]
+
+Wed Feb  4 16:32:40 2015  Matt Hoyle  <matt@deployable.co>
+
+	* ext/bigdecimal/bigdecimal.c (VpSetPTR): fix a typo, 'expoennt'
+	  to 'exponent'.  [ruby-core:67980] [Bug #10823] [Fix GH-825]
+
+Wed Feb  4 15:55:38 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/sdbm/_sdbm.c: include ruby/ruby.h for PRIdPTRDIFF when a
+	  macro `DEBUG` is defined.  based on the patch by Owen Rodley in
+	  [ruby-core:67987]. [Bug #10825]
+
+Wed Feb  4 11:12:43 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* Makefile.in (probes.stamp): rebuild dtrace dependent objects
+	  only when `dtrace -G` modifies its input files.
+
+Tue Feb  3 19:27:16 2015  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* common.mk (ruby-glommed.o): dependency on $(OBJ) should be written
+	  in common.mk (in which OBJ is defined) because of Makefile include
+	  and parse order. This partly reverts r49419.
+	  [ruby-dev:48849] [Bug #10808]
+
+	* Makefile.in (ruby-glommed.o): ditto.
+
+	* Makefile.in (ruby-glommed.o): remove excess $(DTRACE_OBJ) because
+	  it is included in $(OBJS) since r49451.
+
+	* Makefile.in (probes.o): should depend on $(DTRACE_DEPENDENT_OBJS)
+
+Tue Feb  3 17:15:45 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/mkmf.rb (try_cppflags, try_cflags, try_ldflags): get rid of
+	  interference by modifying global variables in have_devel? method.
+	  [ruby-core:67962] [Bug #10821]
+
+Tue Feb  3 15:23:58 2015  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* vm_method.c (remove_method): When remove refined
+	  method, raise a NameError if the method is not
+	  defined in refined class.
+
+	  But if the method is defined in refined class,
+	  it should keep refined method and remove original
+	  method.
+
+	  Patch by Seiei Higa. [ruby-core:67722] [Bug #10765]
+
+Tue Feb  3 14:04:47 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (glob_helper): obtain real name with FindFirstFile API
+	  instead of matching all entries, on Windows.
+	  [ruby-core:67954] [Bug #10819]
+
+Tue Feb  3 12:26:35 2015  Katsuhiko Nishimra  <ktns.87@gmail.com>
+
+	* lib/mkmf.rb (configuration): set the default cxxflags, which is
+	  referred from the default CXXFLAGS, for extension libraries.
+	  [Fix GH-823]
+
+Tue Feb  3 05:52:00 2015  Aman Gupta <ruby@tmm1.net>
+
+	* gc.c (rb_objspace_free): cause rb_bug if lazy sweep is in progress
+	  during rb_objspace_free. Adds extra protection for r46340.
+	  Patch by Vicent Marti. [Bug #10768] [ruby-core:67734]
+	* gc.c (rb_objspace_call_finalizer): Ensure GC is completed after
+	  finalizers have run. We already call gc_rest() before invoking
+	  finalizers, but finalizer can allocate new objects and start new GC
+	  cycle, so we call gc_rest() again after finalizers are complete.
+
+Mon Feb  2 10:51:34 2015  Ari Pollak  <ajp@aripollak.com>
+
+	* doc/security.rdoc (Symbols): update about Symbol GC.  Symbols
+	  explicitly converted from Strings now can be collected, but
+	  reflection/metaprogramming still can cause memory flooding.
+	  [Fix GH-725]
+
+Sun Feb  1 13:46:52 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* tool/rbinstall.rb (bin-comm): drop batch file installation.
+	  Windows 95 support has not been supported already.
+	  [Feature #10806]
+
+Sat Jan 31 12:06:23 2015  Scott Francis  <scott.francis@shopify.com>
+
+	* thread_pthread.c (reserve_stack): fix intermittent SIGBUS on
+	  Linux, by reserving the stack virtual address space at process
+	  start up so that it will not clash with the heap space.
+	  [Fix GH-822]
+
+Fri Jan 30 17:28:29 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
+
+	* math.c (num2dbl_with_to_f): make faster when Bignum passed by
+	  direct conversion using rb_big2dbl().  [Feature #10800]
+
+Thu Jan 29 23:30:00 2015  Kenta Murata  <mrkn@mrkn.jp>
+
+	* ext/bigdecimal/bigdecimal.c (rb_rational_num): add fallback function
+	  for rubies lower than 2.2.0.
+
+	* ext/bigdecimal/bigdecimal.c (rb_rational_den): ditto.
+
+	* ext/bigdecimal/extconf.rb: check the existences of struct RRational,
+	  rb_rational_num, and rb_rational_den.
+
+	* ext/bigdecimal/bigdecimal.bundle: bump version.
+
+Thu Jan 29 20:28:25 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* tool/make-snapshot: removed md5 digest with package information
+
+Thu Jan 29 10:41:52 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
+
+	* math.c (Get_Double): direct casting from Fixnum to double.
+	  [Feature #10785]
+
+Thu Jan 29 02:34:27 2015  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/visitors/to_ruby.rb: fix parsing hashes with
+	  instance variables when it is referenced multiple times.
+	* ext/psych/lib/psych.rb: bump version
+	* ext/psych/psych.gemspec: bump version
+	* test/psych/test_hash.rb: test for fix
+
+Thu Jan 29 02:06:09 2015  Eric Wong  <e@80x24.org>
+
+	* thread.c (struct join_arg): restructure and make smaller
+	  (thread_join_sleep): avoid timeofday() call if forever
+	  (thread_join): pass join_arg.delay directly
+	  (rb_thread_inspect_msg): remove, inline into rb_thread_inspect
+	  (rb_thread_inspect): reduce branching and string creation
+	* thread_pthread.c (native_set_thread_name): create string directly
+	  to avoid reparsing. [Misc #10723]
+
+Wed Jan 28 21:32:24 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* thread.c: Improve documentation for Thread#value
+	  [Bug #10694][ruby-core:67324][ci skip]
+
+Tue Jan 27 16:04:19 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* tool/redmine-backporter.rb: added `!` command.
+
+Tue Jan 27 15:58:23 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* tool/redmine-backporter.rb: added history feature for platforms which
+	  lack readline.
+
+Mon Jan 26 22:09:35 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* .gitignore: ignored temporary file with git.
+
+Mon Jan 26 18:06:03 2015  Akinori MUSHA  <knu@iDaemons.org>
+
+	* misc/ruby-electric.el: Import version 2.2.2 from
+	  https://github.com/knu/ruby-electric.el.
+
+Mon Jan 26 11:37:49 2015  Dave Stevens  <dave@crowdlab.com>
+
+	* string.c (str_make_independent_expand): terminate String when
+	  moved from heap to embedded.  [Fix GH-821].
+
+Sun Jan 25 12:04:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* array.c (flatten): no need to call to_ary method on elements
+	  beyond the given level.  [ruby-core:67637] [Bug #10748]
+
+Sun Jan 25 00:42:24 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/fiddle/win32/libffi.mk.tmpl: assemble without directory prefix.
+	  workaround of a bug of VC12 ml, by unak at [ruby-core:67792].
+	  [ruby-core:67789] [Bug #10780]
+
+Sat Jan 24 19:56:25 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dln_find.c (dln_find_1): search regular files only.  based on
+	  the patch by Alex Coomans in [ruby-core:67766].  [Bug #10776]
+
+Fri Jan 23 23:57:05 2015  Misumi Rize  <r@ayase-e.li>
+
+	* vm_insnhelper.c (vm_throw_start): search the target to break
+	  from a block with nested rescue, from the nested blocks.
+	  [ruby-core:67765] [Bug #10775] [Fix GH-820]
+
+Fri Jan 23 20:00:59 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* marshal.c (w_object, marshal_dump): use identity tables for
+	  arbitrary VALUE keys, because of performance of FLONUM.
+	  [Bug #10761]
+
+	* marshal.c (obj_alloc_by_klass, marshal_load): ditto.
+
+Fri Jan 23 17:12:33 2015  Eric Wong  <e@80x24.org>
+
+	* benchmark/bm_marshal_dump_flo.rb: new benchmark for [Bug #10761]
+
+Thu Jan 22 18:03:19 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* tool/redmine-backporter.rb (find_svn_log): use double quotes instead
+	  of single quotes because cmd.exe doesn't handle them.
+
+	* tool/redmine-backporter.rb (done): the 2nd element of matched data
+	  is the offset of the end of matched string, not length.
+
+Thu Jan 22 16:45:24 2015  Eric Wong  <e@80x24.org>
+
+	* st.c (st_numhash): mix float value for flonum
+	* hash.c (rb_any_hash): ditto
+	* benchmark/bm_hash_aref_flo.rb: new benchmark
+	* benchmark/bm_hash_ident_flo.rb: ditto
+	  [Bug #10761]
+
+Wed Jan 21 22:33:51 2015  Akinori MUSHA  <knu@iDaemons.org>
+
+	* misc/ruby-electric.el: Import version 2.2.1 from
+	  https://github.com/knu/ruby-electric.el.  Improve compatibility
+	  with and optimize for Emacs 24.4.
+
+Wed Jan 21 09:40:52 2015  Zachary Scott  <e@zzak.io>
+
+	* file.c: Document other cases of missing birthtime on OS with patch
+	  provided by @sho-h similar to GH-817. [ci skip] [DOC]
+
+Wed Jan 21 09:09:19 2015  Tanaka Akira  <akr@fsij.org>
+
+	* NEWS: References to tickets added.
+	  [ruby-core:67701] [Bug #10760] Suggested by Zachary Scott.
+
+Tue Jan 20 22:59:54 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* tool/vcs.rb: fix the exception given remote-url of svn.
+
+Tue Jan 20 12:58:33 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* tool/redmine-backporter.rb: now can change the page of `ls`.
+
+Tue Jan 20 12:28:37 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* tool/redmine-backporter.rb (readline): fallback to normal gets on
+	  Windows because IO.console.getch is not always do as expected.
+
+Tue Jan 20 11:31:07 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* tool/redmine-backporter.rb: update usage.
+
+Tue Jan 20 11:23:47 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* tool/redmine-backporter.rb (mygets): to support Backspace
+	  implement gets by itself.
+
+Tue Jan 20 02:54:11 2015  Zachary Scott  <e@zzak.io>
+
+	* file.c: NotImplementedError is raised if birthtime is unavailable.
+	  Patch by @y-yagi san and [Fixes GH-817] [ci skip] [DOC]
+
+	* ext/pathname/pathname.c: ditto.
+
+Mon Jan 19 22:08:26 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* class.c (include_modules_at): allow to prepend each module up to
+	  once for each classe.  [EXPERIMENTAL]
+
+Sun Jan 18 18:32:20 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* math.c (math_atan2): revive documentation before r49220.
+	  http://d.hatena.ne.jp/nagachika/20150112/ruby_trunk_changes_49213_49226
+
+Sun Jan 18 15:57:32 2015  Seiei Higa  <hanachin@gmail.com>
+
+	* vm_method.c (check_definition): Module#public_method_defined?,
+	  Module#private_method_defined?, Module#protected_method_defined?
+	  should not use refinements. [ruby-core:67656] [Bug #10753]
+
+Sun Jan 18 15:50:39 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_dump.c (rb_vm_bugreport): check by configured result instead
+	  of system name for old FreeBSD.  based on a patch by Steve Wills
+	  at [ruby-core:67655].  [Bug #10752]
+
+Sun Jan 18 12:56:49 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* Makefile.in (VPATH, NEWLINE_C), common.mk (common-srcs): make
+	  and use newline.c under enc/trans directory, not toplevel.  no
+	  longer search enc directory implicitly.
+
+	* configure.in, enc/Makefile.in (BUILTIN_ENCS, BUILTIN_TRANSES):
+	  prefix respective directory names to builtin encodings and
+	  transcoder source names.
+
+Sun Jan 18 11:49:46 2015  Masaki Suketa <masaki.suketa@nifty.ne.jp>
+
+	* ext/win32ole/win32ole.c (ole_invoke): avoid SEGV when VT_RECORD
+	  variable is passed by reference. [ruby-dev:48803] [Bug #10697]
+
+Sat Jan 17 23:59:15 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/psych/lib/psych/visitors/yaml_tree.rb (visit_String):
+	  anchors like `\Z` are not valid inside character class.  use
+	  negative-lookahead instead.
+	  Fixes: https://github.com/tenderlove/psych/issues/221
+
+Sat Jan 17 23:42:27 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in: get rid of pattern substitution, which is not
+	  supported by ash, and ash on NetBSD parses whole source first
+	  and fails to start.  [ruby-dev:48823] [Bug #10750]
+
+Fri Jan 16 18:42:58 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* tool/redmine-backporter.rb: support adding related revisions
+	  to issues.
+
+Fri Jan 16 17:20:33 2015  Koichi Sasada  <ko1@atdot.net>
+
+	vm.c, vm_core.h: constify VM_CF_LEP, VM_CF_PREV_EP, VM_CF_BLOCK_PTR
+	and rb_vm_control_frame_block_ptr.
+
+Fri Jan 16 15:41:21 2015  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych.rb: bump version
+
+	* ext/psych/psych.gemspec: ditto
+
+Fri Jan 16 15:37:49 2015  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/visitors/yaml_tree.rb: only dump hash
+	  subclasses. Thanks Joe Eli McIlvain <joe.eli.mac@gmail.com>
+
+	* test/psych/test_hash.rb: test for change
+
+Fri Jan 16 15:35:21 2015  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych.rb: bump version
+
+	* ext/psych/lib/psych/visitors/yaml_tree.rb: fix line width wrapping
+	  for long strings.  Thanks Jakub Jirutka <jakub@jirutka.cz>
+
+	* test/psych/test_string.rb: test for change
+
+Fri Jan 16 11:44:44 2015  Kazuki Tsujimoto  <kazuki@callcc.net>
+
+	* eval_intern.h, vm.c, vm_eval.c, vm_insnhelper.c:
+	  change throw mechanism (not save target ep, but save target cfp).
+	  It fixes `unexpected break' bug that occurs when
+	  TracePoint#binding is called.
+	  [ruby-dev:48797] [Bug #10689]
+
+	* test/ruby/test_settracefunc.rb: add a test.
+
+Thu Jan 15 23:55:15 2015  Tanaka Akira  <akr@fsij.org>
+
+	* io.c (rb_io_close_m): Don't raise when the IO object is closed.
+	  [ruby-core:67444] [Feature #10718]
+
+Thu Jan 15 21:34:57 2015  Seiei Higa  <hanachin@gmail.com>
+
+	* proc.c (rb_obj_singleton_method): Kernel#singleton_method should
+	  not use refinements, as well as Kernel#method.
+	  [ruby-core:67603] [Bug #10744]
+
+Thu Jan 15 10:45:04 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* array.c (rb_ary_select_bang, ary_reject_bang): linear
+	  performance.  [ruby-core:67418] [Feature #10714]
+
+Wed Jan 14 18:06:06 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
+
+	* lib/uri/mailto.rb: raising URI::InvalidComponentError instead
+	  of failing with undefined method `split' for nil:NilClass for
+	  mailto: URIs without opaque part. [Bug #10738]
+	* test/uri/testuri.rb: Test for above
+
+Wed Jan 14 16:45:24 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* tool/downloader.rb (RubyGems.download): verify downloaded gem
+	  packages.  LowSecurity to allow untrusted certificates now.
+
+Wed Jan 14 15:43:48 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/readline/readline.c (readline_s_refresh_line): initialize
+	  before rl_refresh_line(), as some function make the internal
+	  state non-clean but rl_refresh_line() does not re-initialize it.
+	  [ruby-core:43957] [Bug #6232]
+
+Tue Jan 13 21:59:24 2015  Michal Papis  <mpapis@gmail.com>
+
+	* tool/rbinstall.rb (gem): fix changing permissions of installed
+	  bundled gems.  [Fix GH-812]
+
+Tue Jan 13 21:57:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* common.mk (distclean-local): remove autom4te.cache generated by
+	  autoconf.
+
+	* common.mk (realclean-local): remove id sources and dummy header
+	  for dtrace.  [ruby-core:67562] [Bug #10737]
+
+Tue Jan 13 21:08:22 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* ext/json, test/json: merge JSON HEAD(259dee6)
+	  separate implementation of Typed_Data macro.
+	  https://github.com/flori/json/compare/v1.8.1...v1.8.2
+
+Tue Jan 13 14:16:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* test/net/http/test_http.rb: get rid of accessing DNS actually
+	  for some servers returning wrong results.
+	  [ruby-core:67454] [Bug #10721]
+
+Mon Jan 12 23:21:57 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* gems/bundled_gems: update test-unit to 3.0.9.
+
+Mon Jan 12 18:35:44 2015  Eric Wong  <e@80x24.org>
+
+	* numeric.c (bit_coerce): use original value for error message
+	  [ruby-core:67405] [Bug #10711]
+	* test/ruby/test_numeric.rb (test_coerce): check error message
+
+Mon Jan 12 18:01:24 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/rdoc/text.rb (expand_tabs): get rid of infinite loop with
+	  CR.  should check if substitution occurred too.
+	  [ruby-dev:48813] [Bug #10732]
+
+Mon Jan 12 16:45:46 2015  Seiei Higa  <hanachin@gmail.com>
+
+	* vm_method.c (rb_alias): raise a NameError when creating alias to
+	  a refined method if the original method of the refined method is
+	  not defined.  [ruby-core:67523] [Bug #10731]
+
+Mon Jan 12 13:53:17 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* math.c (math_atan2): improve documentation.
+	  [Feature #10323][ruby-core:65400][ci skip]
+
+Mon Jan 12 13:50:49 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* ext/bigdecimal/bigdecimal.c: fixes documentation like labeled lists,
+	  code examples etc. [ruby-core:66730][Bug #10576][ci skip]
+
+Mon Jan 12 13:36:44 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* lib/optparse.rb: improvements for OptionParser documentation.
+	  [misc #10608][ruby-core:66901][ci skip]
+
+Mon Jan 12 13:33:52 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* array.c (rb_ary_each): documented return value.
+	  [misc #10469][ruby-core:66063]
+
+Sun Jan 11 15:11:38 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* test/webrick/test_utils.rb (test_create_listeners): use
+	  dynamically chosen port number, not hardcoded port number.
+	  [ruby-core:67508]
+
+Sat Jan 10 12:57:12 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* ext/zlib/zlib.c: fix document of method signatures.
+	  [Bug #10668][ruby-core:67186][ci skip]
+
+Sat Jan 10 12:32:44 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* eval_error.c (error_print): pos and len parameters of rb_str_substr()
+	  are counted by characters, not bytes.  use rb_str_subseq() instead.
+	  [Bug #10727] [ruby-core:67473]
+
+Sat Jan 10 10:58:55 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* complex.c: removed commented-out code.
+
+Sat Jan 10 10:57:19 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* rational.c: removed commented-out code.
+	  [Feature #10376][ruby-core:65643]
+
+Sat Jan 10 10:12:15 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* array.c (rb_ary_select_bang): keep the array consistent by
+	  removing unselected values soon.  [ruby-dev:48805] [Bug #10722]
+
+Fri Jan  9 23:20:04 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* lib/rubygems:  Update to RubyGems HEAD(e53c54a).
+	* test/rubygems:  ditto.
+
+Fri Jan  9 11:13:01 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (assocs, assoc): eliminate splatting empty literal
+	  hashes.  [ruby-core:67446] [Bug #10719]
+
+	* compile.c (compile_array_): support splatted hash in hash type.
+
+Fri Jan  9 10:57:09 2015  Vit Ondruch  <vondruch@redhat.com>
+
+	* configure.in (RUBY_SETJMP_TYPE): Remove superfluous semicolon
+	  which causes a syntax error with autoconf 2.63.
+	  [ruby-core:67429] [Bug #10716]
+
+Fri Jan  9 07:23:32 2015  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/visitors/yaml_tree.rb: correctly quote non-ascii
+	  letters. Thanks @jirutka for the patch.
+
+	* test/psych/test_string.rb: test for change
+
+Fri Jan  9 07:13:55 2015  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/visitors/to_ruby.rb: call `allocate` on hash
+	  subclasses.  Fixes github.com/tenderlove/psych/issues/196
+
+	* test/psych/test_hash.rb: test for change
+
+Fri Jan  9 06:58:43 2015  Aaron Patterson <aaron@tenderlovemaking.com>
+
+	* ext/psych/lib/psych/visitors/to_ruby.rb: revive hashes with ivars
+
+	* ext/psych/lib/psych/visitors/yaml_tree.rb: dump hashes with ivars.
+	  Fixes github.com/psych/issues/43
+
+	* test/psych/test_hash.rb: test for change
+
+Thu Jan  8 17:05:00 2015  Seiei Higa  <hanachin@gmail.com>
+
+	* vm_method.c (rb_method_entry): if no super class, no original
+	  method entry.  [ruby-core:67389] [Bug #10707]
+
+Thu Jan  8 16:31:43 2015  Seiei Higa  <hanachin@gmail.com>
+
+	* vm_method.c (rb_export_method): bail out if the original method
+	  is undefined when the method is refined.
+	  [ruby-core:67387] [Bug #10706]
+
+Thu Jan  8 12:53:44 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (glob_helper): match in case-folding only if the directory
+	  resides on a case-insensitive file system, on OSX.
+	  [ruby-core:67364] [Bug #10700]
+
+Thu Jan  8 11:39:18 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* .travis.yml: Remove redundant configuration option.
+	  [fix GH-809] Patch by @gxworld
+
+Thu Jan  8 07:17:14 2015  Eric Wong  <e@80x24.org>
+
+	* lib/resolv.rb: consider ENETUNREACH as ResolvTimeout
+	  [ruby-core:67411] [Bug #10712]
+
+Thu Jan  8 00:13:52 2015  Tanaka Akira  <akr@fsij.org>
+
+	* lib/open3.rb: Open3 properly passes non-keyword hash args to spawn.
+	  Fixed by Josh Cheek.  [Fix GH-808]
+	  Related to [ruby-core:67347] [Bug #10699]
+
+Wed Jan  7 19:19:26 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (dir_initialize): workaround of opendir failure at symlink
+	  directories on Windows via CIFS.
+
+Wed Jan  7 18:52:50 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (need_normalization): not only HFS+, CIFS (SMB) is also
+	  decomposed.  [Bug #10704]
+
+	* dir.c (NORMALIZE_UTF8PATH): Unicode decomposition seems to
+	  perform in an upper layer than file systems on OSX, as all path
+	  names are always decomposed regardless of file system types.
+
+Tue Jan  6 21:41:04 2015  Tanaka Akira  <akr@fsij.org>
+
+	* time.c (timelocalw): Set tm_isdst field -1 if vtm->isdst is
+	  VTM_ISDST_INITVAL.  This bug is introduced at packing struct
+	  vtm (r45155).
+	  [ruby-core:67345] [Bug #10698] Reported by Boris Ruf.
+
+Tue Jan  6 03:10:54 2015  Koichi Sasada  <ko1@atdot.net>
+
+	* test/fiddle/test_handle.rb: fix syntax.
+
+Tue Jan  6 00:16:10 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* test/fiddle/test_handle.rb (test_NEXT): use -test-/dln/empty
+	  which is always a shared object and is not used by others.
+	  [ruby-dev:48629] [Bug #10384]
+
+Mon Jan  5 14:58:01 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* test/ruby/test_io.rb: added timeout for AIX environment.
+	  [ruby-core:62983][Bug #9917]
+
+Sun Jan  4 22:33:33 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* test/lib/test/unit.rb (ExcludesOption): add "excludes" support
+	  to test suite, for alternative implementations and platforms.
+	  [Feature #10682]
+
+Sun Jan  4 22:32:42 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* test/lib/test/unit.rb (Test::Unit): reorder modules and merge
+	  each modules.
+
+	* test/lib/test/unit.rb (Test::Unit): split the large class into
+	  each modules.
+
+Sun Jan  4 21:32:52 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (f_label): return tLABEL value as it is.
+	  [ruby-core:67315] [Bug #10693]
+
+Sun Jan  4 14:02:37 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* test/lib/test/unit/parallel.rb (run): expand the file name to be
+	  loaded, so that relative paths work in parallel mode.
+
+Sun Jan  4 13:36:56 2015  Ayumu AIZAWA  <ayumu.aizawa@gmail.com>
+
+	* test/test_tempfile.rb: use assert_file for more descriptive message.
+	  following r49131.
+
+Sun Jan  4 13:05:09 2015  Ayumu AIZAWA  <ayumu.aizawa@gmail.com>
+
+	* string.c: improve docs for String#<=>. [ruby-core:65399][Feature #10322]
+	  Patch by gogo tanaka.
+
+Sun Jan  4 12:42:24 2015  Ayumu AIZAWA  <ayumu.aizawa@gmail.com>
+
+	* array.c: improve docs for Array#reject. [ruby-core:65324][misc #10307]
+	  Patched by Nebu Pookins.
+
+Sun Jan  4 12:24:11 2015  Ayumu AIZAWA  <ayumu.aizawa@gmail.com>
+
+	* string.c: improve docs for String#strip and variations.
+	  [ruby-core:66081][Bug #10476]
+
+Sun Jan  4 09:21:04 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* lib/drb/drb.rb: removed unused argument. Patch by @vipulnsward
+	  [fix GH-515]
+
+Sun Jan  4 09:18:31 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* lib/tempfile.rb: provide default basename parameter.
+	  [fix GH-523] Patch by @dissolved
+	* test/test_tempfile.rb: ditto.
+
+Sun Jan  4 00:43:41 2015  Ayumu AIZAWA  <ayumu.aizawa@gmail.com>
+
+	* README.ja.md: add guidance of mailing list and bugs.r-l.o.
+
+Sat Jan  3 23:56:28 2015  Ayumu AIZAWA  <ayumu.aizawa@gmail.com>
+
+	* hash.c: fix docs for Hash#invert. [ruby-core:66917] [Bug #10612]
+
+Sat Jan  3 19:52:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* include/ruby/intern.h (rb_str_new_literal): define on all
+	  platforms, not only gcc.
+
+Sat Jan  3 18:53:28 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/fiddle/lib/fiddle/cparser.rb (parse_ctype): limit split word
+	  number as the rest are not used.
+
+Sat Jan  3 18:19:50 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* ext/fiddle/lib/fiddle/cparser.rb: r49110 broke Fiddle::Import with
+	  type_alias.
+	* test/fiddle/test_cparser.rb: added type_alias test for parse_ctype
+	  and parse_struct_signature.
+
+Sat Jan  3 11:50:16 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* ext/openssl/ossl.h: avoid to build failure of Windows environment.
+	* ext/openssl/ossl_ssl_session.c: ditto.
+
+Sat Jan  3 11:27:46 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* array.c: Improve performance of Array#shift. use shared instead of
+	  MEMMOVE if with arguments. Patch by @ksss [fix GH-537]
+	* test/ruby/test_array.rb: ditto.
+	* benchmark/bm_array_shift.rb: Added benchmark of GH-537 issue.
+
+Sat Jan  3 10:38:52 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* lib/net/http.rb: More descriptive error message when net/http fails
+	  to connect to a server. Patch by @xaviershay [fix GH-700]
+	* test/net/http/test_http.rb: ditto.
+
+Sat Jan  3 10:14:51 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* ext/openssl/ossl.h: Make `SSL_SESSION_cmp` use `CRYPTO_memcmp`
+	  [fix GH-591] Patch by @PiPeep
+	* ext/openssl/ossl_ssl_session.c: ditto.
+
+Sat Jan  3 09:54:32 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* ext/fiddle/lib/fiddle/cparser.rb: Support for Fiddle::CParser
+	  to handle rich signatures including parameter names and function
+	  pointer types. Patch by @theryan [fix GH-590]
+	* test/fiddle/test_cparser.rb: ditto.
+
+Sat Jan  3 09:01:43 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* NEWS: added compatibility entry of r49101.
+
+Fri Jan  2 21:06:59 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* lib/net/http.rb (Net::HTTP#send_request): there is no response body
+	  with HEAD request. Patch by @rodrigosaito [fix GH-520]
+
+Fri Jan  2 21:04:36 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* test/net/http/test_http.rb (_test_send_request__HEAD): Added
+	  failing test for send_request with HEAD method.
+
+Fri Jan  2 18:41:20 2015  Tanaka Akira  <akr@fsij.org>
+
+	* eval.c (ruby_init): Print ruby_setup() error only in debug mode.
+	  Unsuppressable error message is not a good idea.
+	  Note that the message is printed sometimes with following
+	  code (highly timing dependent, though):
+	  pid = spawn("ruby -e ''"); Process.kill(:TERM, pid)
+
+Fri Jan  2 16:18:44 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* test/ruby/test_module.rb: Refactor invalid testcase.
+	  [fix GH-472][ruby-core:59035][Bug #9240]
+
+Fri Jan  2 15:53:00 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* lib/webrick/utils.rb: removed unused argument variable.
+	  [fix GH-356] Patch by @vipulnsward
+	* lib/webrick/server.rb: ditto.
+	* lib/webrick/ssl.rb: ditto.
+	* test/webrick/test_utils.rb: added test for WEBrick::Utils#create_listeners.
+
+Fri Jan  2 15:35:53 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* lib/securerandom.rb: improve syntax and grammar of documentation.
+	  [fix GH-796][ci skip] Patch by @Erol
+
+Fri Jan  2 15:10:01 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* test/openssl/test_ssl_session.rb (OpenSSL#test_ctx_client_session_cb):
+	  fix test failure with OpenSSL disabled SSLv3 protocol.
+	  [ruby-core:63772] [Bug #10046]
+
+Fri Jan  2 09:08:31 2015  Tanaka Akira  <akr@fsij.org>
+
+	* lib/resolv.rb (Resolv::DNS::Label::Str#==): Check class equality.
+	  (Resolv::DNS::Name#initialize): Normalize labels as
+	  Resolv::DNS::Label::Str objects.
+
+Thu Jan  1 21:41:49 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* doc/regexp.rdoc: fix regexp docs for whitespace character.
+	  [ruby-dev:48765] [Bug #10624]
+
+Thu Jan  1 17:50:52 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* test/ruby/test_rubyoptions.rb: try locale encoding name.
+	  [ruby-core:67109] [Bug #10643]
+
+Thu Jan  1 11:07:12 2015  Eric Wong  <e@80x24.org>
+
+	* symbol.c (rb_gc_free_dsymbol): delete from global fstr hash
+	* test/ruby/test_symbol.rb (test_symbol_fstr_leak): test for bug
+	  [ruby-core:67268] [Bug #10686]
+
+Thu Jan  1 09:14:21 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* vm_args.c (keyword_hash_p): fix non-symbol keys hash.
+	  rb_extract_keywords() returns 0 not Qnil when no symbol keys is
+	  included.  [ruby-core:67264] [Bug #10685]
+
+Wed Dec 31 17:48:43 2014  Tanaka Akira  <akr@fsij.org>
+
+	* lib/resolv.rb (Resolv::DNS::Label::Str#initialize): Set encoding
+	  ASCII-8BIT before downcase.  case insensitivity of DNS labels doesn't
+	  apply non-ASCII characters.  [RFC 4343]
+
+Wed Dec 31 16:48:44 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (gettable_gen): disable warnings of possible reference
+	  to a local variable defined in a past scope.
+	  [ruby-core:67162] [Bug #10661]
+
+Wed Dec 31 13:43:48 2014  Tanaka Akira  <akr@fsij.org>
+
+	* lib/resolv.rb (Resolv::DNS::Name#==): Compare an array of Label:Str
+	  objects.  Label#Str#== is case-insensitive.
+
+Tue Dec 30 16:16:12 2014  Ben Miller  <bmiller@rackspace.com>
+
+	* lib/resolv.rb (Resolv::DNS::Name#==): DNS is case-insensitive, so the
+	  comparison should be case-insensitive as well.
+	  [ruby-core:66498] [Bug #10550]
+
+Tue Dec 30 16:03:45 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/resolv.rb (Resolv::DNS::Name): names with different dots
+	  should be different.
+
+Tue Dec 30 13:16:56 2014  Martin Duerst  <bernhard+git@lsmod.de>
+
+	* lib/uri/common.rb: Initialize HTML5ASCIIINCOMPAT to empty Array
+	  to avoid error during bootstrap when encodings are not yet defined.
+	  [Bug #10678]
+
+Tue Dec 30 09:29:26 2014  Bernhard M. Wiedemann  <bernhard+git@lsmod.de>
+
+	* ext/dbm/dbm.c (Init_dbm): [DOC] as UNIX permissions are octal
+	  numbers, needs to be prefixed by 0.  [Fix GH-800]
+
+Tue Dec 30 08:57:39 2014  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* lib/unicode_normalize.rb: typo fix. [ci skip]
+	  [ruby-dev:48794][misc #10675]
+
+Mon Dec 29 19:38:01 2014  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* version.h (RUBY_VERSION): 2.3.0 development has started.
+
+Mon Dec 29 18:58:46 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* re.c (unescape_nonascii): append escape sequence as-is not
+	  unescaped character, to get rid of unexpected meta-character.
+	  [ruby-core:67193] [Bug #10670]
+
+Mon Dec 29 14:27:33 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* doc/syntax/literals.rdoc (Symbols): now Symbols created by
+	  interpolation can be garbage collected.  patch by Yihang Ho in
+	  [ruby-core:67194].  [Bug #10671]
+
+Mon Dec 29 11:18:17 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* thread.c (rb_thread_variable_get): fix dynamic symbol keys.
+	  rb_check_id() returns non-zero only for static symbols, whereas
+	  thread local variable keys can be dynamic symbols.
+	  [ruby-core:67185] [Bug #10667]
+
+Mon Dec 29 10:37:27 2014  Thiago Lewin  <thiago_lewin@yahoo.com.br>
+
+	* io.c (rb_f_select): [DOC] workaround for YARD doc.  [Fix GH-799]
+
+	* process.c (proc_detach): [DOC] fix missing closing parenthesis.
+	  [Fix GH-799]
+
+Mon Dec 29 07:27:23 2014  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* ext/json, test/json: merge JSON HEAD(17fe8e7)
+	  https://github.com/flori/json/compare/v1.8.1...17fe8e7
+
+Sun Dec 28 23:49:37 2014  Michal Papis  <mpapis@gmail.com>
+
+	* rbinstall.rb: fix target location for installing bundled gems.
+	  install to the prepared directory instead of default Gem.dir,
+	  not to be affected GEM_HOME environment variable.  [Fix GH-798]
+
+Sun Dec 28 18:19:28 2014  Eric Wong  <e@80x24.org>
+
+	* test/-ext-/iseq_load/test_iseq_load.rb
+	  (test_next_in_block_in_block): test using ISeq#eval
+	  (test_break_ensure): ditto
+	  [ruby-core:66988]
+
+Sun Dec 28 16:25:12 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* cygwin/GNUmakefile.in (EXTOBJS): override to add resource files
+	  always.  [ruby-core:67153] [Bug #10657]
+
+Sun Dec 28 13:54:26 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (f_kwrest, new_args_tail_gen): unnamed rest keyword and
+	  keywords bits arguments should be unique.  since internal IDs
+	  depend on the local variable index in the current scope, new ID
+	  should be made before popping those vtables.
+	  [ruby-core:67157] [Bug #10659]
+
+Sat Dec 27 20:12:55 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/json/generator/generator.c (JSON_Generator_State_type): add
+	  #ifdef for backward compatibility.
+
+	* ext/json/parser/parser.rl (JSON_Parser_type): ditto.
+
+	* ext/json/generator/generator.h (ZALLOC): add fallback definition.
+
+	* ext/json/parser/parser.h (ZALLOC): ditto.
+
+Sat Dec 27 16:54:05 2014  Tanaka Akira  <akr@fsij.org>
+
+	* process.c: Unused code removed.
+	  It seems waitpid() is universally available on POSIX platforms.
+
+Sat Dec 27 15:08:27 2014  Eric Wong  <e@80x24.org>
+
+	* vm_core.h (rb_vm_living_threads_insert): preserve order
+	  [Bug #10660] [ruby-core:67154] [ruby-core:67159]
+
+Sat Dec 27 13:08:20 2014  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* ext/socket/socket.c: improved document for YARD doc.
+	  [fix GH-795][ci skip] Patch by @tlewin
+
+Sat Dec 27 10:11:21 2014  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* ext/tk/lib/tkextlib/tcllib/plotchart.rb: fix to invoke correct function
+	  of tcllib. Patch by @zalt50 [fix GH-787]
+
+Sat Dec 27 10:03:41 2014  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+
+	* tool/make-snapshot: show sha1 digest when making packages.
+	  it's request from https://github.com/ruby/www.ruby-lang.org/issues/921
+	  [fix GH-794]
+
+Fri Dec 26 15:32:16 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/tk/tcltklib.c (ip_invoke_core): remove probably duplicate
+	  dead code.
+
+Fri Dec 26 15:28:27 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/tk/tcltklib.c (ip_ruby_cmd_receiver_const_get): simply use
+	  rb_path2class() to get a class/module from its name.
+
+Fri Dec 26 15:20:54 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* marshal.c (w_long): append at once by w_nbyte() instead of
+	  appending byte by byte.
+
+Fri Dec 26 15:13:13 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/json/parser/parser.rl (unescape_unicode): check if valid
+	  before bit-or assignments.
+	  reported by Denis Denisov <denji0k AT gmail.com>.
+
+	* ext/nkf/nkf-utf8/nkf.c (nkf_iconv_t): fix a missing semicolon.
+	  reported by Denis Denisov <denji0k AT gmail.com>.
+
+	* process.c (rb_spawn_process): get rid of usage of uninitialized
+	  variable.
+	  reported by Denis Denisov <denji0k AT gmail.com>.
+
+	* regexec.c (match_at): ditto.
+
+	* ext/win32ole/win32ole.c (ole_wc2mb_alloc, ole_vstr2wc, ole_mb2wc):
+	  ditto.
+
+	* dir.c (ruby_glob0): no need to check never-NULL pointer.
+	  reported by Denis Denisov <denji0k AT gmail.com>.
+
+	* win32/file.c (rb_file_expand_path_internal): ditto.
+
+	* win32/file.c (code_page_i): handle realloc failure.
+	  reported by Denis Denisov <denji0k AT gmail.com>.
+
+	* win32/stub.c (stub_sysinit): ditto.
+
+	* fix printf format conversion specifiers.
+	  reported by Denis Denisov <denji0k AT gmail.com>.
+
+Fri Dec 26 01:41:40 2014  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* tool/rbinstall.rb: skip installing bundle gems if zlib is unavailable.
+	  [Bug #10647] [ruby-dev:48787]
+
+Fri Dec 26 01:24:42 2014  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* tool/downloader.rb: support old versions of ruby.
+
+	* tool/downloader.rb: now can download gems by http if openssl is not
+	  available (this may be danger!)
+
+Fri Dec 26 00:13:48 2014  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/ruby/test_extlibs.rb: check existence of extension libraries
+	  which not depend on outer libraries. (experimental)
+
+Thu Dec 25 21:58:15 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/fiddle/extconf.rb: make PIC objects if it will be linked as
+	  a shared object eventually.  [ruby-core:67128]
+
+Thu Dec 25 19:01:13 2014  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ext/fiddle/win32/libffi-3.2.1-mswin.patch: support mswin32.
+
+Thu Dec 25 17:30:40 2014  Naohisa Goto  <ngotogenome@gmail.com>
+
+	* gc.c (wmap_final_func): fix memory size shortage when realloc wmap.
+	  Fix SEGV during finalize of WeakRef on Solaris (though the SEGV
+	  could occur on all OS/platforms). [ruby-dev:48779] [Bug #10646]
+
+Thu Dec 25 17:27:06 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (NET_LUID): include winsock2.h instead of windows.h.
+	  patch by Jon Forums in [ruby-core:67125].  [Bug #10640]
+
+Thu Dec 25 16:14:10 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/io/console/console.c (console_dev): send the given arguments
+	  to the opened console.  as a special case, do nothing if :close
+	  is given.
+
+	* test/lib/leakchecker.rb (LeakChecker#check_fd_leak): close if
+	  console.
+
+For the changes before 2.2.0, see doc/ChangeLog-2.2.0
+For the changes before 2.1.0, see doc/ChangeLog-2.1.0
+For the changes before 2.0.0, see doc/ChangeLog-2.0.0
+For the changes before 1.9.3, see doc/ChangeLog-1.9.3
+For the changes before 1.8.0, see doc/ChangeLog-1.8.0
+
+Local variables:
+coding: us-ascii
+add-log-time-format: (lambda ()
+  (let* ((time (current-time))
+	 (system-time-locale "C")
+	 (diff (+ (cadr time) 32400))
+	 (lo (% diff 65536))
+	 (hi (+ (car time) (/ diff 65536))))
+  (format-time-string "%a %b %e %H:%M:%S %Y" (list hi lo) t)))
+indent-tabs-mode: t
+tab-width: 8
+change-log-indent-text: 2
+end:
+vim: tabstop=8 shiftwidth=2
diff --git a/FAQ b/FAQ
deleted file mode 100644
index eaa9c86056..0000000000
--- a/FAQ
+++ /dev/null
@@ -1,65 +0,0 @@
-.\" FAQ -  -*- Indented-Text -*- created at: Tue Jan  4 12:48:12 JST 1994
-¤³¤ì¤ÏRuby¤Ë´Ø¤¹¤ëFAQ(Frequently Asked Question)¤ò¤Þ¤È¤á¤¿¤â¤Î¤Ç¤¹.
-Emacs¤Ç¤³¤Î¥Õ¥¡¥¤¥ë¤ò¸«¤Æ¤¤¤ë¾ì¹ç¤Ë¤ÏM-2 C-x $¤Ç¼ÁÌä¤ÎÉôʬ¤À¤±¤òÆɤळ
-¤È¤¬¤Ç¤­¤Þ¤¹. C-x $¤ÇÁ´¤Æ¤òÆɤà¾õÂÖ¤ËÌ᤻¤Þ¤¹.
-------------------------------
-1) Ruby¤Î̾¾Î¤ÎͳÍè¤Ï
-    
-    Ruby¤Ï²¿¤«¤Îά¾Î¤Ç¤Ï¤Ê¤¯, ÀÖ¤¤ÊõÀФÎ̾Á°¤ò¤È¤Ã¤Æ̾ÉÕ¤±¤é¤ì¤Þ¤·¤¿. 
-    perl(pearl¤Ï6·î¤ÎÃÂÀ¸ÀÐ)¤Î¼¡¤òÌܻؤ¹(Ruby¤Ï7·î¤ÎÃÂÀ¸ÀÐ)¤È¤¤¤¦°ÕÌ£
-    ¤¬¤¢¤ê¤Þ¤¹. ¹¹¤ËÈþ¤·¤¯²ÁÃͤ¢¤ë¤â¤Î¤Ç¤¢¤Ã¤ÆÍߤ·¤¤¤È¤¤¤¦´ê¤¤¤â´Þ¤Þ¤ì
-    ¤Æ¤¤¤Þ¤¹.
-------------------------------
-2) Ruby¤¬±Æ¶Á¤ò¼õ¤±¤¿¸À¸ì¤Ï?
-   
-    Ruby¤Î¸À¸ì»ÅÍͤÏC, Perl, Eiffel¤Î³Æ¸À¸ì¤Ë¤³¤Î½ç¤Ë±Æ¶Á¤ò¼õ¤±¤Æ¤¤¤Þ
-    ¤¹. ¤½¤Î¾¤Ë±Æ¶Á¤ò¼õ¤±¤¿¸À¸ì¤È¤·¤Æ¤Ïtcl, AWK, bourne shell, CLU,
-    Icon, Sather, Smalltalk, Emacs Lisp¤Ê¤É¤¬¤¢¤ê¤Þ¤¹.
-------------------------------
-3) Ruby¤ÎÆÃħ¤Ï?
-    
-    °Ê²¼¤Ë²Õ¾ò½ñ¤Ë¤·¤Þ¤¹.
-    
-      + ¥¤¥ó¥¿¥×¥ê¥¿¤Ç¤¢¤ê, ¼ê·Ú¤Ë¥×¥í¥°¥é¥à¤Ç¤­¤ë.
-      + ÊÑ¿ôÀë¸À¤¬Íפé¤Ê¤¤.
-      + ¥Õ¥¡¥¤¥ë¤ä¥¹¥È¥ê¡¼¥à¤Ê¤É¤Ø¤ÎUNIXŪ¤ÊÁàºî¤¬´Êñ¤Ë¤Ç¤­¤ë.
-      + ¥Ð¥¤¥Ê¥ê¥Õ¥¡¥¤¥ë¤â°·¤¨¤ë.
-      + ¤­¤Á¤ó¤È¤·¤¿¥ª¥Ö¥¸¥§¥¯¥È»Ø¸þ¸À¸ì¤Ç¤¢¤ë.
-      + Æðۥ᥽¥Ã¥É¤Îµ¡Ç½¤¬Ä󶡤µ¤ì¤Æ¤¤¤ë.
-      + ¥â¥¸¥å¡¼¥ë¤Ë¤è¤ëµ¡Ç½¤Î¶¦Í­¤¬¤Ç¤­¤ë.
-      + Îã³°½èÍýµ¡Ç½¤¬¤¢¤ë.
-      + GC¤¬¤¢¤ë¤Î¤Ç¥á¥â¥ê´ÉÍý¤òµ¤¤Ë¤·¤Ê¤¯¤ÆºÑ¤à.
-      + °ì´ÓÀ­¤Î¤¢¤ë¸À¸ì»ÅÍÍ.
-      + Ê£»¨¤Ê¥Ç¡¼¥¿¹½Â¤¤â°·¤¨¤ë.
-      + ¥À¥¤¥Ê¥ß¥Ã¥¯¥í¡¼¥É¤ò¥µ¥Ý¡¼¥È¤¹¤ë(¥·¥¹¥Æ¥à¤Ë¤è¤ë).
-    
-    µÕ¤Ë·çÅÀ¤Ï
-    
-      - ȯŸÅÓ¾å¤Çµ¡Ç½¤¬¾¯¤Ê¤¤.
-      - ¥Ç¥Ð¥Ã¥¬¤¬(¤Þ¤À)¤Ê¤¤.
-      - ÃÙ¤¤.
-      
-    ¤³¤È¤Ç¤·¤ç¤¦¤«.
-------------------------------
-4) Ruby¤ËÊÑ¿ôÀë¸À¤¬¤Ê¤¤¤³¤È¤Î¥á¥ê¥Ã¥È¤Ï?
-    
-    ¤¢¤ëÊÑ¿ô¤¬¤É¤Î¥¹¥³¡¼¥×¤Ë°¤¹¤ë¤«¤¬°ìÌܤÇʬ¤«¤ë¤Î¤Ç, ¥×¥í¥°¥é¥à¤ÎÆɤß
-    °×¤µ, Íý²ò¤·°×¤µ¤¬Áý¤¹¤³¤È¤¬ºÇÂç¤Î¥á¥ê¥Ã¥È¤Ç¤¹. ¤Þ¤¿¥È¡¼¥¿¥ë¤Î¥¿¥¤¥×
-    Î̤¬¸º¤ë¤Î¤Ç½ñ¤­°×¤µ, ¼ê·Ú¤µ¤Ë¤â¹×¸¥¤·¤Þ¤¹.
-------------------------------
-5) Ruby¤ÈPerl¤Î°ã¤¤¤Ï?
-    
-    Ruby¤ÈPerl¤Ï¥Æ¥­¥¹¥ÈÁàºî¤ËÍ¥¤ì¤¿¥¹¥¯¥ê¥×¥È¸À¸ì¤Ç¤¢¤ë¤È¤¤¤¦ÅÀ¤Ç, ¥«
-    ¥Ð¡¼¤¹¤ëÈϰϤ¬¶á¤¯, °ì¸«¤¹¤ë¤È¥é¥¤¥Ð¥ë¤Ë¸«¤¨¤Þ¤¹. ³Î¤«¤ËRuby¤ÎÀß·×
-    ¤Ë¤ª¤¤¤Æ¡ÖPerl¤Ë¤Ç¤­¤ë¤³¤È¤Ï¤Ç¤­¤ë¤è¤¦¤Ë¡×¤È¤¤¤¦¤³¤È¤Ï, °ì¤Ä¤Î½ÅÍ×
-    ¤ÊÌÜɸ¤Ç¤·¤¿. ¤·¤«¤·, Ruby¤Î¿¿¤ÎÌÜŪ¤Ï¤¢¤¯¤Þ¤Ç¤â¡Ö¼ê·Ú¤Ê¥ª¥Ö¥¸¥§¥¯
-    ¥È»Ø¸þ¸À¸ì¡×¤Ç¤¢¤ê, ¤Þ¤¿, RubyÀ߷פÎ3ÂçÌÜɸ¤Ç¤¢¤ë, µ¡Ç½À­¡¦°ì´ÓÀ­¡¦
-    ³ÈÄ¥À­¤Î·ë²Ì¤È¤·¤Æ, Ruby¤ÏPerl¤È¤Ï°Û¤Ê¤ë¸À¸ì¤Ë¤Ê¤ê¤Þ¤·¤¿.
-    
-    Ruby¤ÏPerl¤Û¤É¡Ö²¿¤Ç¤â¤¢¤ê¡×¤Ç¤Ï¤¢¤ê¤Þ¤»¤ó¤·, ¤Û¤È¤ó¤É¤Î¾ì¹çPerl¤è
-    ¤ê½èÍý®ÅÙ¤¬ÃÙ¤¤¤Ç¤¹. ¤·¤«¤·, Ruby¤Î¥ª¥Ö¥¸¥§¥¯¥È»Ø¸þµ¡Ç½¤ÏPerl¤Ç¤Ï
-    Ëþ­¤Ç¤­¤Ê¤¤¿Í¤¿¤Á¤Ë¥¢¥Ô¡¼¥ë¤¹¤ë¤È»×¤¤¤Þ¤¹.
-------------------------------
-Local variables:
-fill-column: 70
-end:
diff --git a/GPL b/GPL
new file mode 100644
index 0000000000..d159169d10
--- /dev/null
+++ b/GPL
@@ -0,0 +1,339 @@
+                    GNU GENERAL PUBLIC LICENSE
+                       Version 2, June 1991
+
+ Copyright (C) 1989, 1991 Free Software Foundation, Inc.,
+ 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA
+ Everyone is permitted to copy and distribute verbatim copies
+ of this license document, but changing it is not allowed.
+
+                            Preamble
+
+  The licenses for most software are designed to take away your
+freedom to share and change it.  By contrast, the GNU General Public
+License is intended to guarantee your freedom to share and change free
+software--to make sure the software is free for all its users.  This
+General Public License applies to most of the Free Software
+Foundation's software and to any other program whose authors commit to
+using it.  (Some other Free Software Foundation software is covered by
+the GNU Lesser General Public License instead.)  You can apply it to
+your programs, too.
+
+  When we speak of free software, we are referring to freedom, not
+price.  Our General Public Licenses are designed to make sure that you
+have the freedom to distribute copies of free software (and charge for
+this service if you wish), that you receive source code or can get it
+if you want it, that you can change the software or use pieces of it
+in new free programs; and that you know you can do these things.
+
+  To protect your rights, we need to make restrictions that forbid
+anyone to deny you these rights or to ask you to surrender the rights.
+These restrictions translate to certain responsibilities for you if you
+distribute copies of the software, or if you modify it.
+
+  For example, if you distribute copies of such a program, whether
+gratis or for a fee, you must give the recipients all the rights that
+you have.  You must make sure that they, too, receive or can get the
+source code.  And you must show them these terms so they know their
+rights.
+
+  We protect your rights with two steps: (1) copyright the software, and
+(2) offer you this license which gives you legal permission to copy,
+distribute and/or modify the software.
+
+  Also, for each author's protection and ours, we want to make certain
+that everyone understands that there is no warranty for this free
+software.  If the software is modified by someone else and passed on, we
+want its recipients to know that what they have is not the original, so
+that any problems introduced by others will not reflect on the original
+authors' reputations.
+
+  Finally, any free program is threatened constantly by software
+patents.  We wish to avoid the danger that redistributors of a free
+program will individually obtain patent licenses, in effect making the
+program proprietary.  To prevent this, we have made it clear that any
+patent must be licensed for everyone's free use or not licensed at all.
+
+  The precise terms and conditions for copying, distribution and
+modification follow.
+
+                    GNU GENERAL PUBLIC LICENSE
+   TERMS AND CONDITIONS FOR COPYING, DISTRIBUTION AND MODIFICATION
+
+  0. This License applies to any program or other work which contains
+a notice placed by the copyright holder saying it may be distributed
+under the terms of this General Public License.  The "Program", below,
+refers to any such program or work, and a "work based on the Program"
+means either the Program or any derivative work under copyright law:
+that is to say, a work containing the Program or a portion of it,
+either verbatim or with modifications and/or translated into another
+language.  (Hereinafter, translation is included without limitation in
+the term "modification".)  Each licensee is addressed as "you".
+
+Activities other than copying, distribution and modification are not
+covered by this License; they are outside its scope.  The act of
+running the Program is not restricted, and the output from the Program
+is covered only if its contents constitute a work based on the
+Program (independent of having been made by running the Program).
+Whether that is true depends on what the Program does.
+
+  1. You may copy and distribute verbatim copies of the Program's
+source code as you receive it, in any medium, provided that you
+conspicuously and appropriately publish on each copy an appropriate
+copyright notice and disclaimer of warranty; keep intact all the
+notices that refer to this License and to the absence of any warranty;
+and give any other recipients of the Program a copy of this License
+along with the Program.
+
+You may charge a fee for the physical act of transferring a copy, and
+you may at your option offer warranty protection in exchange for a fee.
+
+  2. You may modify your copy or copies of the Program or any portion
+of it, thus forming a work based on the Program, and copy and
+distribute such modifications or work under the terms of Section 1
+above, provided that you also meet all of these conditions:
+
+    a) You must cause the modified files to carry prominent notices
+    stating that you changed the files and the date of any change.
+
+    b) You must cause any work that you distribute or publish, that in
+    whole or in part contains or is derived from the Program or any
+    part thereof, to be licensed as a whole at no charge to all third
+    parties under the terms of this License.
+
+    c) If the modified program normally reads commands interactively
+    when run, you must cause it, when started running for such
+    interactive use in the most ordinary way, to print or display an
+    announcement including an appropriate copyright notice and a
+    notice that there is no warranty (or else, saying that you provide
+    a warranty) and that users may redistribute the program under
+    these conditions, and telling the user how to view a copy of this
+    License.  (Exception: if the Program itself is interactive but
+    does not normally print such an announcement, your work based on
+    the Program is not required to print an announcement.)
+
+These requirements apply to the modified work as a whole.  If
+identifiable sections of that work are not derived from the Program,
+and can be reasonably considered independent and separate works in
+themselves, then this License, and its terms, do not apply to those
+sections when you distribute them as separate works.  But when you
+distribute the same sections as part of a whole which is a work based
+on the Program, the distribution of the whole must be on the terms of
+this License, whose permissions for other licensees extend to the
+entire whole, and thus to each and every part regardless of who wrote it.
+
+Thus, it is not the intent of this section to claim rights or contest
+your rights to work written entirely by you; rather, the intent is to
+exercise the right to control the distribution of derivative or
+collective works based on the Program.
+
+In addition, mere aggregation of another work not based on the Program
+with the Program (or with a work based on the Program) on a volume of
+a storage or distribution medium does not bring the other work under
+the scope of this License.
+
+  3. You may copy and distribute the Program (or a work based on it,
+under Section 2) in object code or executable form under the terms of
+Sections 1 and 2 above provided that you also do one of the following:
+
+    a) Accompany it with the complete corresponding machine-readable
+    source code, which must be distributed under the terms of Sections
+    1 and 2 above on a medium customarily used for software interchange; or,
+
+    b) Accompany it with a written offer, valid for at least three
+    years, to give any third party, for a charge no more than your
+    cost of physically performing source distribution, a complete
+    machine-readable copy of the corresponding source code, to be
+    distributed under the terms of Sections 1 and 2 above on a medium
+    customarily used for software interchange; or,
+
+    c) Accompany it with the information you received as to the offer
+    to distribute corresponding source code.  (This alternative is
+    allowed only for noncommercial distribution and only if you
+    received the program in object code or executable form with such
+    an offer, in accord with Subsection b above.)
+
+The source code for a work means the preferred form of the work for
+making modifications to it.  For an executable work, complete source
+code means all the source code for all modules it contains, plus any
+associated interface definition files, plus the scripts used to
+control compilation and installation of the executable.  However, as a
+special exception, the source code distributed need not include
+anything that is normally distributed (in either source or binary
+form) with the major components (compiler, kernel, and so on) of the
+operating system on which the executable runs, unless that component
+itself accompanies the executable.
+
+If distribution of executable or object code is made by offering
+access to copy from a designated place, then offering equivalent
+access to copy the source code from the same place counts as
+distribution of the source code, even though third parties are not
+compelled to copy the source along with the object code.
+
+  4. You may not copy, modify, sublicense, or distribute the Program
+except as expressly provided under this License.  Any attempt
+otherwise to copy, modify, sublicense or distribute the Program is
+void, and will automatically terminate your rights under this License.
+However, parties who have received copies, or rights, from you under
+this License will not have their licenses terminated so long as such
+parties remain in full compliance.
+
+  5. You are not required to accept this License, since you have not
+signed it.  However, nothing else grants you permission to modify or
+distribute the Program or its derivative works.  These actions are
+prohibited by law if you do not accept this License.  Therefore, by
+modifying or distributing the Program (or any work based on the
+Program), you indicate your acceptance of this License to do so, and
+all its terms and conditions for copying, distributing or modifying
+the Program or works based on it.
+
+  6. Each time you redistribute the Program (or any work based on the
+Program), the recipient automatically receives a license from the
+original licensor to copy, distribute or modify the Program subject to
+these terms and conditions.  You may not impose any further
+restrictions on the recipients' exercise of the rights granted herein.
+You are not responsible for enforcing compliance by third parties to
+this License.
+
+  7. If, as a consequence of a court judgment or allegation of patent
+infringement or for any other reason (not limited to patent issues),
+conditions are imposed on you (whether by court order, agreement or
+otherwise) that contradict the conditions of this License, they do not
+excuse you from the conditions of this License.  If you cannot
+distribute so as to satisfy simultaneously your obligations under this
+License and any other pertinent obligations, then as a consequence you
+may not distribute the Program at all.  For example, if a patent
+license would not permit royalty-free redistribution of the Program by
+all those who receive copies directly or indirectly through you, then
+the only way you could satisfy both it and this License would be to
+refrain entirely from distribution of the Program.
+
+If any portion of this section is held invalid or unenforceable under
+any particular circumstance, the balance of the section is intended to
+apply and the section as a whole is intended to apply in other
+circumstances.
+
+It is not the purpose of this section to induce you to infringe any
+patents or other property right claims or to contest validity of any
+such claims; this section has the sole purpose of protecting the
+integrity of the free software distribution system, which is
+implemented by public license practices.  Many people have made
+generous contributions to the wide range of software distributed
+through that system in reliance on consistent application of that
+system; it is up to the author/donor to decide if he or she is willing
+to distribute software through any other system and a licensee cannot
+impose that choice.
+
+This section is intended to make thoroughly clear what is believed to
+be a consequence of the rest of this License.
+
+  8. If the distribution and/or use of the Program is restricted in
+certain countries either by patents or by copyrighted interfaces, the
+original copyright holder who places the Program under this License
+may add an explicit geographical distribution limitation excluding
+those countries, so that distribution is permitted only in or among
+countries not thus excluded.  In such case, this License incorporates
+the limitation as if written in the body of this License.
+
+  9. The Free Software Foundation may publish revised and/or new versions
+of the General Public License from time to time.  Such new versions will
+be similar in spirit to the present version, but may differ in detail to
+address new problems or concerns.
+
+Each version is given a distinguishing version number.  If the Program
+specifies a version number of this License which applies to it and "any
+later version", you have the option of following the terms and conditions
+either of that version or of any later version published by the Free
+Software Foundation.  If the Program does not specify a version number of
+this License, you may choose any version ever published by the Free Software
+Foundation.
+
+  10. If you wish to incorporate parts of the Program into other free
+programs whose distribution conditions are different, write to the author
+to ask for permission.  For software which is copyrighted by the Free
+Software Foundation, write to the Free Software Foundation; we sometimes
+make exceptions for this.  Our decision will be guided by the two goals
+of preserving the free status of all derivatives of our free software and
+of promoting the sharing and reuse of software generally.
+
+                            NO WARRANTY
+
+  11. BECAUSE THE PROGRAM IS LICENSED FREE OF CHARGE, THERE IS NO WARRANTY
+FOR THE PROGRAM, TO THE EXTENT PERMITTED BY APPLICABLE LAW.  EXCEPT WHEN
+OTHERWISE STATED IN WRITING THE COPYRIGHT HOLDERS AND/OR OTHER PARTIES
+PROVIDE THE PROGRAM "AS IS" WITHOUT WARRANTY OF ANY KIND, EITHER EXPRESSED
+OR IMPLIED, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF
+MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE.  THE ENTIRE RISK AS
+TO THE QUALITY AND PERFORMANCE OF THE PROGRAM IS WITH YOU.  SHOULD THE
+PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF ALL NECESSARY SERVICING,
+REPAIR OR CORRECTION.
+
+  12. IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN WRITING
+WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MAY MODIFY AND/OR
+REDISTRIBUTE THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU FOR DAMAGES,
+INCLUDING ANY GENERAL, SPECIAL, INCIDENTAL OR CONSEQUENTIAL DAMAGES ARISING
+OUT OF THE USE OR INABILITY TO USE THE PROGRAM (INCLUDING BUT NOT LIMITED
+TO LOSS OF DATA OR DATA BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY
+YOU OR THIRD PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER
+PROGRAMS), EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE
+POSSIBILITY OF SUCH DAMAGES.
+
+                     END OF TERMS AND CONDITIONS
+
+            How to Apply These Terms to Your New Programs
+
+  If you develop a new program, and you want it to be of the greatest
+possible use to the public, the best way to achieve this is to make it
+free software which everyone can redistribute and change under these terms.
+
+  To do so, attach the following notices to the program.  It is safest
+to attach them to the start of each source file to most effectively
+convey the exclusion of warranty; and each file should have at least
+the "copyright" line and a pointer to where the full notice is found.
+
+    <one line to give the program's name and a brief idea of what it does.>
+    Copyright (C) <year>  <name of author>
+
+    This program is free software; you can redistribute it and/or modify
+    it under the terms of the GNU General Public License as published by
+    the Free Software Foundation; either version 2 of the License, or
+    (at your option) any later version.
+
+    This program is distributed in the hope that it will be useful,
+    but WITHOUT ANY WARRANTY; without even the implied warranty of
+    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+    GNU General Public License for more details.
+
+    You should have received a copy of the GNU General Public License along
+    with this program; if not, write to the Free Software Foundation, Inc.,
+    51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA.
+
+Also add information on how to contact you by electronic and paper mail.
+
+If the program is interactive, make it output a short notice like this
+when it starts in an interactive mode:
+
+    Gnomovision version 69, Copyright (C) year name of author
+    Gnomovision comes with ABSOLUTELY NO WARRANTY; for details type `show w'.
+    This is free software, and you are welcome to redistribute it
+    under certain conditions; type `show c' for details.
+
+The hypothetical commands `show w' and `show c' should show the appropriate
+parts of the General Public License.  Of course, the commands you use may
+be called something other than `show w' and `show c'; they could even be
+mouse-clicks or menu items--whatever suits your program.
+
+You should also get your employer (if you work as a programmer) or your
+school, if any, to sign a "copyright disclaimer" for the program, if
+necessary.  Here is a sample; alter the names:
+
+  Yoyodyne, Inc., hereby disclaims all copyright interest in the program
+  `Gnomovision' (which makes passes at compilers) written by James Hacker.
+
+  <signature of Ty Coon>, 1 April 1989
+  Ty Coon, President of Vice
+
+This General Public License does not permit incorporating your program into
+proprietary programs.  If your program is a subroutine library, you may
+consider it more useful to permit linking proprietary applications with the
+library.  If this is what you want to do, use the GNU Lesser General
+Public License instead of this License.
diff --git a/KNOWNBUGS.rb b/KNOWNBUGS.rb
new file mode 100644
index 0000000000..35a8e75876
--- /dev/null
+++ b/KNOWNBUGS.rb
@@ -0,0 +1,7 @@
+#
+# IMPORTANT: Always keep the first 7 lines (comments),
+# even if this file is otherwise empty.
+#
+# This test file includes tests which point out known bugs.
+# So all tests will cause failure.
+#
diff --git a/LEGAL b/LEGAL
new file mode 100644
index 0000000000..2607f0082a
--- /dev/null
+++ b/LEGAL
@@ -0,0 +1,594 @@
+LEGAL NOTICE INFORMATION
+------------------------
+
+All the files in this distribution are covered under either the Ruby's
+license (see the file COPYING) or public-domain except some files
+mentioned below.
+
+ccan/build_assert/build_assert.h
+ccan/check_type/check_type.h
+ccan/container_of/container_of.h
+ccan/str/str.h
+
+  These files are licensed under the CC0.
+
+    http://creativecommons.org/choose/zero/
+
+ccan/list/list.h
+
+  This file is licensed under the MIT License.
+
+    Permission is hereby granted, free of charge, to any person obtaining a copy
+    of this software and associated documentation files (the "Software"), to deal
+    in the Software without restriction, including without limitation the rights
+    to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
+    copies of the Software, and to permit persons to whom the Software is
+    furnished to do so, subject to the following conditions:
+
+    The above copyright notice and this permission notice shall be included in
+    all copies or substantial portions of the Software.
+
+    THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
+    IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
+    FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
+    AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
+    LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
+    OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN
+    THE SOFTWARE.
+
+include/ruby/oniguruma.h:
+regcomp.c:
+regenc.[ch]:
+regerror.c:
+regexec.c:
+regint.h:
+regparse.[ch]:
+enc/ascii.c
+enc/big5.c
+enc/cp949.c
+enc/emacs_mule.c
+enc/encdb.c
+enc/euc_jp.c
+enc/euc_kr.c
+enc/euc_tw.c
+enc/gb18030.c
+enc/gb2312.c
+enc/gbk.c
+enc/iso_8859_1.c
+enc/iso_8859_10.c
+enc/iso_8859_11.c
+enc/iso_8859_13.c
+enc/iso_8859_14.c
+enc/iso_8859_15.c
+enc/iso_8859_16.c
+enc/iso_8859_2.c
+enc/iso_8859_3.c
+enc/iso_8859_4.c
+enc/iso_8859_5.c
+enc/iso_8859_6.c
+enc/iso_8859_7.c
+enc/iso_8859_8.c
+enc/iso_8859_9.c
+enc/koi8_r.c
+enc/koi8_u.c
+enc/shift_jis.c
+enc/unicode.c
+enc/us_ascii.c
+enc/utf_16be.c
+enc/utf_16le.c
+enc/utf_32be.c
+enc/utf_32le.c
+enc/utf_8.c
+enc/windows_1251.c
+
+Oniguruma  ----   (C) K.Kosako <sndgk393 AT ybb DOT ne DOT jp>
+
+http://www.geocities.jp/kosako3/oniguruma/
+http://www.ruby-lang.org/cgi-bin/cvsweb.cgi/oniguruma/
+http://www.freebsd.org/cgi/cvsweb.cgi/ports/devel/oniguruma/
+
+   When this software is partly used or it is distributed with Ruby,
+   this of Ruby follows the license of Ruby.
+
+configure:
+
+  This file is free software.
+
+    Copyright (C) 1992, 93, 94, 95, 96 Free Software Foundation, Inc.
+
+    This configure script is free software; the Free Software Foundation
+    gives unlimited permission to copy, distribute and modify it.
+
+tool/config.guess:
+tool/config.sub:
+
+  As long as you distribute these files with the file configure, they
+  are covered under the Ruby's license.
+
+      Copyright (C) 1992, 1993, 1994, 1995, 1996, 1997, 1998, 1999
+      Free Software Foundation, Inc.
+
+    This file is free software; you can redistribute it and/or modify it
+    under the terms of the GNU General Public License as published by
+    the Free Software Foundation; either version 2 of the License, or
+    (at your option) any later version.
+
+    This program is distributed in the hope that it will be useful, but
+    WITHOUT ANY WARRANTY; without even the implied warranty of
+    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the GNU
+    General Public License for more details.
+
+    You should have received a copy of the GNU General Public License
+    along with this program; if not, write to the Free Software
+    Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+
+    As a special exception to the GNU General Public License, if you
+    distribute this file as part of a program that contains a
+    configuration script generated by Autoconf, you may include it under
+    the same distribution terms that you use for the rest of that program.
+
+parse.c:
+
+  This file is licensed under the GPL, but is incorporated into Ruby and
+  redistributed under the terms of the Ruby license, as permitted by the
+  exception to the GPL below.
+
+     Copyright (C) 1984, 1989, 1990, 2000, 2001, 2002, 2003, 2004, 2005, 2006
+     Free Software Foundation, Inc.
+
+     This program is free software; you can redistribute it and/or modify
+     it under the terms of the GNU General Public License as published by
+     the Free Software Foundation; either version 2, or (at your option)
+     any later version.
+
+     This program is distributed in the hope that it will be useful,
+     but WITHOUT ANY WARRANTY; without even the implied warranty of
+     MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+     GNU General Public License for more details.
+
+     You should have received a copy of the GNU General Public License
+     along with this program; if not, write to the Free Software
+     Foundation, Inc., 51 Franklin Street, Fifth Floor,
+     Boston, MA 02110-1301, USA.  */
+
+  /* As a special exception, you may create a larger work that contains
+     part or all of the Bison parser skeleton and distribute that work
+     under terms of your choice, so long as that work isn't itself a
+     parser generator using the skeleton or a modified version thereof
+     as a parser skeleton.  Alternatively, if you modify or redistribute
+     the parser skeleton itself, you may (at your option) remove this
+     special exception, which will cause the skeleton and the resulting
+     Bison output files to be licensed under the GNU General Public
+     License without this special exception.
+
+     This special exception was added by the Free Software Foundation in
+     version 2.2 of Bison.  */
+
+util.c (partly):
+
+    Copyright (c) 1991, 2000, 2001 by Lucent Technologies.
+
+    Permission to use, copy, modify, and distribute this software for any
+    purpose without fee is hereby granted, provided that this entire notice
+    is included in all copies of any software which is or includes a copy
+    or modification of this software and in all copies of the supporting
+    documentation for such software.
+
+    THIS SOFTWARE IS BEING PROVIDED "AS IS", WITHOUT ANY EXPRESS OR IMPLIED
+    WARRANTY.  IN PARTICULAR, NEITHER THE AUTHOR NOR LUCENT MAKES ANY
+    REPRESENTATION OR WARRANTY OF ANY KIND CONCERNING THE MERCHANTABILITY
+    OF THIS SOFTWARE OR ITS FITNESS FOR ANY PARTICULAR PURPOSE.
+
+win32/win32.[ch]:
+
+  You can apply the Artistic License to these files. (or GPL,
+  alternatively)
+
+    Copyright (c) 1993, Intergraph Corporation
+
+    You may distribute under the terms of either the GNU General Public
+    License or the Artistic License, as specified in the perl README file.
+
+util.c (partly):
+
+   Copyright (c) 2004-2008 David Schultz <das@FreeBSD.ORG>
+   All rights reserved.
+
+   Redistribution and use in source and binary forms, with or without
+   modification, are permitted provided that the following conditions
+   are met:
+   1. Redistributions of source code must retain the above copyright
+      notice, this list of conditions and the following disclaimer.
+   2. Redistributions in binary form must reproduce the above copyright
+      notice, this list of conditions and the following disclaimer in the
+      documentation and/or other materials provided with the distribution.
+
+   THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+   ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+   IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+   ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+   FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+   DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+   OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+   HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+   LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+   OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+   SUCH DAMAGE.
+
+random.c
+
+  This file is under the new-style BSD license.
+
+    A C-program for MT19937, with initialization improved 2002/2/10.
+    Coded by Takuji Nishimura and Makoto Matsumoto.
+    This is a faster version by taking Shawn Cokus's optimization,
+    Matthe Bellew's simplification, Isaku Wada's real version.
+
+    Before using, initialize the state by using init_genrand(seed)
+    or init_by_array(init_key, key_length).
+
+    Copyright (C) 1997 - 2002, Makoto Matsumoto and Takuji Nishimura,
+    All rights reserved.
+
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+
+      1. Redistributions of source code must retain the above copyright
+	 notice, this list of conditions and the following disclaimer.
+
+      2. Redistributions in binary form must reproduce the above copyright
+	 notice, this list of conditions and the following disclaimer in the
+	 documentation and/or other materials provided with the distribution.
+
+      3. The names of its contributors may not be used to endorse or promote
+	 products derived from this software without specific prior written
+	 permission.
+
+    THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS
+    "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
+    LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR
+    A PARTICULAR PURPOSE ARE DISCLAIMED.  IN NO EVENT SHALL THE COPYRIGHT OWNER OR
+    CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
+    EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
+    PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR
+    PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF
+    LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING
+    NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS
+    SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.
+
+
+    Any feedback is very welcome.
+    http://www.math.keio.ac.jp/matumoto/emt.html
+    email: matumoto@math.keio.ac.jp
+
+vm_dump.c:procstat_vm
+
+  This file is under the new-style BSD license.
+
+    Copyright (c) 2007 Robert N. M. Watson
+    All rights reserved.
+
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+
+    THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
+
+    $FreeBSD: head/usr.bin/procstat/procstat_vm.c 261780 2014-02-11 21:57:37Z jhb $
+
+vsnprintf.c:
+
+  This file is under the old-style BSD license.  Note that the
+  paragraph 3 below is now null and void.
+
+    Copyright (c) 1990, 1993
+         The Regents of the University of California.  All rights reserved.
+
+    This code is derived from software contributed to Berkeley by
+    Chris Torek.
+
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+    3. Neither the name of the University nor the names of its contributors
+       may be used to endorse or promote products derived from this software
+       without specific prior written permission.
+
+    THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
+
+    IMPORTANT NOTE:
+    --------------
+    From ftp://ftp.cs.berkeley.edu/pub/4bsd/README.Impt.License.Change
+    paragraph 3 above is now null and void.
+
+st.[ch]:
+missing/alloca.c:
+missing/dup2.c:
+missing/erf.c:
+missing/finite.c:
+missing/hypot.c:
+missing/isinf.c:
+missing/isnan.c:
+missing/lgamma_r.c:
+missing/memcmp.c:
+missing/memmove.c:
+missing/strchr.c:
+missing/strstr.c:
+missing/strtol.c:
+missing/tgamma.c:
+ext/digest/sha1/sha1.[ch]:
+
+  These files are all under public domain.
+
+missing/crypt.c:
+
+  This file is under the old-style BSD license.  Note that the
+  paragraph 3 below is now null and void.
+
+    Copyright (c) 1989, 1993
+    	The Regents of the University of California.  All rights reserved.
+
+    This code is derived from software contributed to Berkeley by
+    Tom Truscott.
+
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+    3. Neither the name of the University nor the names of its contributors
+       may be used to endorse or promote products derived from this software
+       without specific prior written permission.
+
+    THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
+
+missing/setproctitle.c
+
+  This file is under the old-style BSD license.  Note that the
+  paragraph 3 below is now null and void.
+
+    Copyright 2003 Damien Miller
+    Copyright (c) 1983, 1995-1997 Eric P. Allman
+    Copyright (c) 1988, 1993
+    	The Regents of the University of California.  All rights reserved.
+
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+    3. Neither the name of the University nor the names of its contributors
+       may be used to endorse or promote products derived from this software
+       without specific prior written permission.
+
+    THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
+
+missing/strlcat.c
+missing/strlcpy.c
+
+  These files are under the new-style BSD license.
+
+    Copyright (c) 1998 Todd C. Miller <Todd.Miller@courtesan.com>
+    All rights reserved.
+
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+    3. The name of the author may not be used to endorse or promote products
+       derived from this software without specific prior written permission.
+
+    THIS SOFTWARE IS PROVIDED ``AS IS'' AND ANY EXPRESS OR IMPLIED WARRANTIES,
+    INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY
+    AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED.  IN NO EVENT SHALL
+    THE AUTHOR BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
+    EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
+    PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS;
+    OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY,
+    WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR
+    OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF
+    ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.
+
+missing/langinfo.c
+
+  This file is from http://www.cl.cam.ac.uk/~mgk25/ucs/langinfo.c.
+  Ruby uses a modified version. The file contains the following
+  author/copyright notice:
+
+  Markus.Kuhn@cl.cam.ac.uk -- 2002-03-11
+  Permission to use, copy, modify, and distribute this software
+  for any purpose and without fee is hereby granted. The author
+  disclaims all warranties with regard to this software.
+
+ext/digest/md5/md5.[ch]:
+
+  These files are under the following license.  Ruby uses modified
+  versions of them.
+
+    Copyright (C) 1999, 2000 Aladdin Enterprises.  All rights reserved.
+
+    This software is provided 'as-is', without any express or implied
+    warranty.  In no event will the authors be held liable for any damages
+    arising from the use of this software.
+
+    Permission is granted to anyone to use this software for any purpose,
+    including commercial applications, and to alter it and redistribute it
+    freely, subject to the following restrictions:
+
+    1. The origin of this software must not be misrepresented; you must not
+       claim that you wrote the original software. If you use this software
+       in a product, an acknowledgment in the product documentation would be
+       appreciated but is not required.
+    2. Altered source versions must be plainly marked as such, and must not be
+       misrepresented as being the original software.
+    3. This notice may not be removed or altered from any source distribution.
+
+    L. Peter Deutsch
+    ghost@aladdin.com
+
+ext/digest/rmd160/rmd160.[ch]:
+
+  These files have the following copyright information, and by the
+  author we are allowed to use it under the new-style BSD license.
+
+    AUTHOR:   Antoon Bosselaers, ESAT-COSIC
+              (Arranged for libc by Todd C. Miller)
+    DATE:     1 March 1996
+
+    Copyright (c) Katholieke Universiteit Leuven
+    1996, All Rights Reserved
+
+ext/digest/sha2/sha2.[ch]:
+
+  These files are under the new-style BSD license.
+
+    Copyright 2000 Aaron D. Gifford.  All rights reserved.
+
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+    3. Neither the name of the copyright holder nor the names of contributors
+       may be used to endorse or promote products derived from this software
+       without specific prior written permission.
+
+    THIS SOFTWARE IS PROVIDED BY THE AUTHOR(S) AND CONTRIBUTOR(S) ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR(S) OR CONTRIBUTOR(S) BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
+
+ext/nkf/nkf-utf8/config.h:
+ext/nkf/nkf-utf8/nkf.c:
+ext/nkf/nkf-utf8/utf8tbl.c:
+
+  These files are under the following license.  So to speak, it is
+  copyrighted semi-public-domain software.
+
+    Copyright (C) 1987, Fujitsu LTD. (Itaru ICHIKAWA)
+       Everyone is permitted to do anything on this program
+       including copying, modifying, improving,
+       as long as you don't try to pretend that you wrote it.
+       i.e., the above copyright notice has to appear in all copies.
+       Binary distribution requires original version messages.
+       You don't have to ask before copying, redistribution or publishing.
+       THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE.
+
+ext/socket/addrinfo.h:
+ext/socket/getaddrinfo.c:
+ext/socket/getnameinfo.c:
+
+  These files are under the new-style BSD license.
+
+    Copyright (C) 1995, 1996, 1997, 1998, and 1999 WIDE Project.
+    All rights reserved.
+
+    Redistribution and use in source and binary forms, with or without
+    modification, are permitted provided that the following conditions
+    are met:
+    1. Redistributions of source code must retain the above copyright
+       notice, this list of conditions and the following disclaimer.
+    2. Redistributions in binary form must reproduce the above copyright
+       notice, this list of conditions and the following disclaimer in the
+       documentation and/or other materials provided with the distribution.
+    3. Neither the name of the project nor the names of its contributors
+       may be used to endorse or promote products derived from this software
+       without specific prior written permission.
+
+    THIS SOFTWARE IS PROVIDED BY THE PROJECT AND CONTRIBUTORS ``AS IS'' AND
+    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+    ARE DISCLAIMED.  IN NO EVENT SHALL THE PROJECT OR CONTRIBUTORS BE LIABLE
+    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+    SUCH DAMAGE.
+
+ext/win32ole/win32ole.c:
+
+  You can apply the Artistic License to this file. (or GPL,
+  alternatively)
+
+    (c) 1995 Microsoft Corporation. All rights reserved.
+    Developed by ActiveWare Internet Corp., http://www.ActiveWare.com
+
+    Other modifications Copyright (c) 1997, 1998 by Gurusamy Sarathy
+    <gsar@umich.edu> and Jan Dubois <jan.dubois@ibm.net>
+
+    You may distribute under the terms of either the GNU General Public
+    License or the Artistic License, as specified in the README file
+    of the Perl distribution.
diff --git a/MANIFEST b/MANIFEST
deleted file mode 100644
index fa904ff5d9..0000000000
--- a/MANIFEST
+++ /dev/null
@@ -1,66 +0,0 @@
-C-IF
-ChangeLog
-FAQ
-MANIFEST
-Makefile.in
-README
-ToDo
-array.c
-assoc.c
-bignum.c
-class.c
-compar.c
-configure
-configure.in
-config.guess
-config.sub
-defines.h
-dir.c
-dln.c
-dln.h
-enum.c
-env.h
-error.c
-etc.c
-eval.c
-file.c
-fnmatch.c
-fnmatch.h
-gc.c
-glob.c
-hash.c
-ident.h
-inits.c
-install-sh
-io.c
-io.h
-main.c
-math.c
-node.h
-numeric.c
-object.c
-pack.c
-parse.y
-process.c
-random.c
-range.c
-re.c
-re.h
-regex.c
-regex.h
-ruby.1
-ruby.c
-ruby.h
-signal.c
-spec
-sprintf.c
-st.c
-st.h
-string.c
-struct.c
-time.c
-util.h
-util.c
-variable.c
-version.c
-version.h
diff --git a/Makefile.in b/Makefile.in
index 9f804f1706..ff475091ab 100644
--- a/Makefile.in
+++ b/Makefile.in
@@ -1,177 +1,554 @@
 SHELL = /bin/sh
+NULLCMD = @NULLCMD@
+n=$(NULLCMD)
+ECHO1 = $(V:1=$n)
+RUNCMD = $(SHELL)
+CDPATH = .
+CHDIR = @CHDIR@
+exec = exec
+NULL = /dev/null
+PATH_SEPARATOR = @PATH_SEPARATOR@
 
 #### Start of system configuration section. ####
 
 srcdir = @srcdir@
-VPATH = @srcdir@
+top_srcdir = $(srcdir)
+hdrdir = $(srcdir)/include
+PLATFORM_DIR = @PLATFORM_DIR@
 
 CC = @CC@
-YACC = @YACC@
-INSTALL = @INSTALL@
-INSTALL_PROGRAM = @INSTALL_PROGRAM@
-INSTALL_DATA = @INSTALL_DATA@
-PURIFY=
+CPP = @CPP@
+LD = @LD@
+YACC = bison
+PURIFY =
+AUTOCONF = autoconf
+CONFIGURE = @CONFIGURE@
 @SET_MAKE@
-
-CFLAGS = @CFLAGS@
-STATIC = @STATIC@
-LDFLAGS = $(CFLAGS) @LDFLAGS@
-LIBS = @LIBS@
-MISSING = @LIBOBJS@ @ALLOCA@
+MKFILES = @MAKEFILES@
+BASERUBY = @BASERUBY@
+HAVE_BASERUBY = @HAVE_BASERUBY@
+TEST_RUNNABLE = @TEST_RUNNABLE@
+CROSS_COMPILING = @CROSS_COMPILING@
+DOXYGEN = @DOXYGEN@
 
 prefix = @prefix@
-binprefix = 
 exec_prefix = @exec_prefix@
-bindir = $(exec_prefix)/bin
+bindir = @bindir@
+sbindir = @sbindir@
+libdir = @libdir@
+libexecdir = @libexecdir@
+datarootdir = @datarootdir@
+datadir = @datadir@
+arch = @arch@
+sitearch = @sitearch@
+sitedir = @sitedir@
+archlibdir = @archlibdir@
+ruby_version = @ruby_version@
+
+TESTUI = console
+TESTS =
+INSTALLDOC = @INSTALLDOC@
+DOCTARGETS = @RDOCTARGET@ @CAPITARGET@
+
+EXTOUT = @EXTOUT@
+arch_hdrdir = $(EXTOUT)/include/$(arch)
+VPATH = $(arch_hdrdir)/ruby:$(hdrdir)/ruby:$(srcdir):$(srcdir)/missing
+
+empty =
+CC_VERSION = @CC_VERSION@
+OUTFLAG = @OUTFLAG@$(empty)
+COUTFLAG = @COUTFLAG@$(empty)
+ARCH_FLAG = @ARCH_FLAG@
+CFLAGS_NO_ARCH = @CFLAGS@
+CFLAGS = $(CFLAGS_NO_ARCH) $(ARCH_FLAG)
+cflags = @cflags@
+optflags = @optflags@
+debugflags = @debugflags@
+warnflags = @warnflags@ @strict_warnflags@
+cppflags = @cppflags@
+INCFLAGS = -I. -I$(arch_hdrdir) -I$(hdrdir) -I$(srcdir)
+XCFLAGS = @XCFLAGS@
+CPPFLAGS = @CPPFLAGS@ $(INCFLAGS)
+LDFLAGS = @STATIC@ $(CFLAGS) @LDFLAGS@
+EXTLDFLAGS = @EXTLDFLAGS@
+XLDFLAGS = @XLDFLAGS@ $(EXTLDFLAGS)
+EXTLIBS =
+LIBS = @LIBS@ $(EXTLIBS)
+MISSING = @LIBOBJS@ @ALLOCA@
+LDSHARED = @LIBRUBY_LDSHARED@
+DLDFLAGS = @LIBRUBY_DLDFLAGS@ $(XLDFLAGS) $(ARCH_FLAG)
+SOLIBS = @SOLIBS@
+MAINLIBS = @MAINLIBS@
+ARCHMINIOBJS = @MINIOBJS@
+DLNOBJ = @DLNOBJ@
+ENCOBJS = @ENCOBJS@
+EXTOBJS = @EXTOBJS@
+BUILTIN_ENCOBJS = @BUILTIN_ENCOBJS@
+BUILTIN_TRANSSRCS = @BUILTIN_TRANSSRCS@
+BUILTIN_TRANSOBJS = @BUILTIN_TRANSOBJS@
+POSTLINK = @POSTLINK@
+
+RUBY_BASE_NAME=@RUBY_BASE_NAME@
+RUBY_PROGRAM_VERSION=@RUBY_PROGRAM_VERSION@
+RUBY_INSTALL_NAME=@RUBY_INSTALL_NAME@
+RUBY_SO_NAME=@RUBY_SO_NAME@
+EXEEXT = @EXEEXT@
+LIBEXT = @LIBEXT@
+PROGRAM=$(RUBY_INSTALL_NAME)$(EXEEXT)
+RUBY = $(RUBY_INSTALL_NAME)
+MINIRUBY = @MINIRUBY@\
+	$(MINIRUBYOPT)
+# RUNRUBY_COMMAND:: runruby.rb or baseruby. do not append options directly
+RUNRUBY_COMMAND = @RUNRUBY_COMMAND@
+# RUNRUBY:: run ruby with RUN_OPTS which is passed to ruby
+RUNRUBY = @RUNRUBY@ $(RUN_OPTS)
+# RUNRUBY_DEBUGGER:: debugging option for runruby.rb
+RUNRUBY_DEBUGGER = --debugger='gdb -x run.gdb --quiet --args'
+XRUBY = @XRUBY@
+BTESTRUBY = @BTESTRUBY@\
+	$(MINIRUBYOPT)
+INSTALL = @INSTALL@
+INSTALL_DATA = @INSTALL_DATA@
+INSTALL_SCRIPT = @INSTALL_SCRIPT@
+INSTALL_PROGRAM = @INSTALL_PROGRAM@
+XRUBY_LIBDIR = @XRUBY_LIBDIR@
+XRUBY_RUBYLIBDIR = @XRUBY_RUBYLIBDIR@
+XRUBY_RUBYHDRDIR = @XRUBY_RUBYHDRDIR@
+BOOTSTRAPRUBY = @BOOTSTRAPRUBY@
 
 #### End of system configuration section. ####
 
-OBJS	      = array.o \
-		assoc.o \
-		bignum.o \
-		class.o \
-		compar.o \
-		dir.o \
-		dln.o \
-		enum.o \
-		error.o \
-		etc.o \
-		eval.o \
-		file.o \
-		fnmatch.o \
-		gc.o \
-		glob.o \
-		hash.o \
-		inits.o \
-		io.o \
-		main.o \
-		math.o \
-		numeric.o \
-		object.o \
-		pack.o \
-		parse.o \
-		process.o \
-		random.o \
-		range.o \
-		re.o \
-		regex.o \
-		ruby.o \
-		signal.o \
-		sprintf.o \
-		st.o \
-		string.o \
-		struct.o \
-		time.o \
-		util.o \
-		variable.o \
-		version.o \
-		$(MISSING)
-
-PROGRAM	      = ruby
-
-all:		$(PROGRAM) @EXTMAKE@
-
-$(PROGRAM):     $(OBJS)
-		@rm -f $(PROGRAM)
-		$(PURIFY) $(CC) $(STATIC) $(LDFLAGS) $(OBJS) $(LIBS) -o $(PROGRAM)
-
-extmake:;	@echo "Compiling ext modules"; \
-		for extdir in ext/*; do \
-		  test -d $$extdir || continue; \
-		  test -f $$extdir/MANIFEST || continue; \
-		  echo `basename $$extdir`; \
-		  ( cd $$extdir; ../../ruby ../extmk.rb; );\
-		done
-
-$(bindir)/$(PROGRAM): $(PROGRAM)
-	$(INSTALL_PROGRAM) $(PROGRAM) $(bindir)/$(PROGRAM)
-
-install: $(bindir)/$(PROGRAM)
-
-clean:;		@rm -f $(OBJS)
-		@for extdir in ext/*; do \
-		  test -d $$extdir || continue; \
-		  test -f $$extdir/MANIFEST || continue; \
-		  if test -f $$extdir/Makefile; then \
-		    ( cd $$extdir; make clean ); \
-		  fi; \
-		done
-
-realclean:	clean
-		@rm -f ext/extmk.rb
-		@rm -f core ruby *~ config.* Makefile
-
-.c.o:
-	$(CC) $(CFLAGS) $(CPPFLAGS) -c $<
-
-alloca.o: missing/alloca.c
-	$(CC) -I. $(CFLAGS) $(CPPFLAGS) -c missing/alloca.c
-
-memmove.o: missing/memmove.c
-	$(CC) $(CFLAGS) $(CPPFLAGS) -c missing/memmove.c
-
-mkdir.o: missing/mkdir.c
-	$(CC) $(CFLAGS) $(CPPFLAGS) -c missing/mkdir.c
-
-strerror.o: missing/strerror.c
-	$(CC) $(CFLAGS) $(CPPFLAGS) -c missing/strerror.c
-
-strdup.o: missing/strdup.c
-	$(CC) $(CFLAGS) $(CPPFLAGS) -c missing/strdup.c
-
-strftime.o: missing/strftime.c
-	$(CC) -I. $(CFLAGS) $(CPPFLAGS) -c missing/strftime.c
-
-strstr.o: missing/strstr.c
-	$(CC) $(CFLAGS) $(CPPFLAGS) -c missing/strstr.c
-
-strtol.o: missing/strtol.c
-	$(CC) $(CFLAGS) $(CPPFLAGS) -c missing/strtol.c
-
-strtoul.o: missing/strtoul.c
-	$(CC) $(CFLAGS) $(CPPFLAGS) -c missing/strtoul.c
+MAJOR=	@MAJOR@
+MINOR=	@MINOR@
+TEENY=	@TEENY@
+
+LIBRUBY_A     = @LIBRUBY_A@
+LIBRUBY_SO    = @LIBRUBY_SO@
+LIBRUBY_ALIASES= @LIBRUBY_ALIASES@
+LIBRUBY	      = @LIBRUBY@
+LIBRUBYARG    = @LIBRUBYARG@
+LIBRUBYARG_STATIC = @LIBRUBYARG_STATIC@
+LIBRUBYARG_SHARED = @LIBRUBYARG_SHARED@
+LIBRUBY_RELATIVE = @LIBRUBY_RELATIVE@
+LIBRUBY_A_OBJS = @LIBRUBY_A_OBJS@
+
+DTRACE_REBUILD_OBJS = $(DTRACE_REBUILD:yes=$(DTRACE_DEPENDENT_OBJS))
+
+DTRACE_DEPENDENT_OBJS = array.$(OBJEXT) \
+			eval.$(OBJEXT) \
+			gc.$(OBJEXT) \
+			hash.$(OBJEXT) \
+			load.$(OBJEXT) \
+			object.$(OBJEXT) \
+			parse.$(OBJEXT) \
+			string.$(OBJEXT) \
+			symbol.$(OBJEXT) \
+			vm.$(OBJEXT)
+
+THREAD_MODEL  = @THREAD_MODEL@
+
+PREP          = @PREP@
+ARCHFILE      = @ARCHFILE@
+SETUP         =
+EXTSTATIC     = @EXTSTATIC@
+ENCSTATIC     = @ENCSTATIC@
+SET_LC_MESSAGES = env LC_MESSAGES=C
+
+MAKEDIRS      = @MKDIR_P@
+CP            = cp
+MV            = mv
+RM            = rm -f
+RMDIR         = @RMDIR@
+RMDIRS        = @RMDIRS@
+RMALL         = @RMALL@
+NM            = @NM@
+AR            = @AR@
+ARFLAGS       = rcu
+RANLIB        = @RANLIB@
+AS            = @AS@
+ASFLAGS       = @ASFLAGS@ $(INCFLAGS)
+IFCHANGE      = $(srcdir)/tool/ifchange
+SET_LC_MESSAGES = env LC_MESSAGES=C
+OBJDUMP       = @OBJDUMP@
+OBJCOPY       = @OBJCOPY@
+VCS           = @VCS@
+VCSUP         = @VCSUP@
+DTRACE        = @DTRACE@
+DTRACE_EXT    = @DTRACE_EXT@
+DTRACE_OBJ    = @DTRACE_OBJ@
+DTRACE_REBUILD= @DTRACE_REBUILD@
+DTRACE_GLOMMED_OBJ = $(DTRACE_REBUILD:yes=ruby-glommed.$(OBJEXT))
+
+OBJEXT        = @OBJEXT@
+ASMEXT        = S
+DLEXT         = @DLEXT@
+MANTYPE	      = @MANTYPE@
+SYMBOL_PREFIX = @SYMBOL_PREFIX@
+
+INSTALLED_LIST= .installed.list
+
+NEWLINE_C     = enc/trans/newline.c
+MINIPRELUDE_C = miniprelude.c
+PRELUDE_C     = prelude.c
+RBCONFIG      = .rbconfig.time
+
+SRC_FILE      = $<
+OS_SRC_FILE   = $<
+DEST_FILE     = $@
+OS_DEST_FILE  = $@
+
+MESSAGE_BEGIN = @for line in
+MESSAGE_END = ; do echo "$$line"; done
+ECHO_BEGIN = @sep=''; for word in
+ECHO_END = ; do echo @ECHO_N@ "$$sep'$$word'@ECHO_C@"; sep=' '; done; echo
+
+DESTDIR       = @DESTDIR@
+
+configure_args = @configure_args@
+#### End of variables
+
+.SUFFIXES: .inc .h .c .y .i .$(DTRACE_EXT)
+
+all:
 
 # Prevent GNU make v3 from overflowing arg limit on SysV.
 .NOEXPORT:
-###
-parse.o : parse.y ruby.h defines.h config.h env.h node.h st.h ident.h regex.h 
-###
-array.o: array.c ruby.h config.h defines.h
-bignum.o: bignum.c ruby.h config.h defines.h
-class.o: class.c ruby.h config.h defines.h env.h node.h st.h
-compar.o: compar.c ruby.h config.h defines.h
-cons.o: cons.c ruby.h config.h defines.h
-dir.o: dir.c ruby.h config.h defines.h
-dln.o: dln.c config.h defines.h dln.h
-enum.o: enum.c ruby.h config.h defines.h
-error.o: error.c ruby.h config.h defines.h env.h
-etc.o: etc.c ruby.h config.h defines.h
-eval.o: eval.c ruby.h config.h defines.h ident.h env.h node.h st.h dln.h
-file.o: file.c ruby.h config.h defines.h io.h
-fnmatch.o: fnmatch.c config.h fnmatch.h
-gc.o: gc.c ruby.h config.h defines.h env.h st.h node.h
-glob.o: glob.c config.h fnmatch.h
-hash.o: hash.c ruby.h config.h defines.h st.h
-inits.o: inits.c ruby.h config.h defines.h
-io.o: io.c ruby.h config.h defines.h io.h
-main.o: main.c
-math.o: math.c ruby.h config.h defines.h
-numeric.o: numeric.c ruby.h config.h defines.h env.h
-object.o: object.c ruby.h config.h defines.h env.h st.h
-pack.o: pack.c ruby.h config.h defines.h
-process.o: process.c ruby.h config.h defines.h st.h
-random.o: random.c ruby.h config.h defines.h
-range.o: range.c ruby.h config.h defines.h
-re.o: re.c ruby.h config.h defines.h re.h regex.h
-regex.o: regex.c config.h defines.h regex.h util.h
-ruby.o: ruby.c ruby.h config.h defines.h re.h regex.h dln.h
-signal.o: signal.c ruby.h config.h defines.h
-sprintf.o: sprintf.c ruby.h config.h defines.h
-st.o: st.c config.h st.h
-string.o: string.c ruby.h config.h defines.h re.h regex.h
-struct.o: struct.c ruby.h config.h defines.h env.h
-tclglob.o: tclglob.c
-time.o: time.c ruby.h config.h defines.h
-util.o: util.c defines.h config.h util.h
-variable.o: variable.c ruby.h config.h defines.h env.h ident.h st.h
-version.o: version.c ruby.h config.h defines.h version.h
+
+miniruby$(EXEEXT):
+		@-if test -f $@; then $(MV) -f $@ $@.old; $(RM) $@.old; fi
+		$(ECHO) linking $@
+		$(Q) $(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(NORMALMAINOBJ) $(MINIOBJS) $(COMMONOBJS) $(MAINLIBS) $(LIBS) $(OUTFLAG)$@
+
+$(PROGRAM):
+		@$(RM) $@
+		$(ECHO) linking $@
+		$(Q) $(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ) $(EXTOBJS) $(LIBRUBYARG) $(MAINLIBS) $(LIBS) $(EXTLIBS) $(OUTFLAG)$@
+		$(Q) $(POSTLINK)
+
+# We must `rm' the library each time this rule is invoked because "updating" a
+# MAB library on Apple/NeXT (see --enable-fat-binary in configure) is not
+# supported.
+$(LIBRUBY_A):
+		@$(RM) $@
+		$(ECHO) linking static-library $@
+		$(Q) $(AR) $(ARFLAGS) $@ $(LIBRUBY_A_OBJS) $(INITOBJS)
+		@-$(RANLIB) $@ 2> /dev/null || true
+		$(ECHO) verifying static-library $@
+		@$(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ) $(LIBRUBY_A) $(MAINLIBS) $(EXTLIBS) $(LIBS) $(OUTFLAG)conftest$(EXEEXT)
+		@$(RM) conftest$(EXEEXT) conftest.c
+
+$(LIBRUBY_SO):
+		@-$(PRE_LIBRUBY_UPDATE)
+		$(ECHO) linking shared-library $@
+		$(Q) $(LDSHARED) $(DLDFLAGS) $(OBJS) $(DLDOBJS) $(SOLIBS) $(EXTSOLIBS) $(OUTFLAG)$@
+		-$(Q) $(OBJCOPY) -w -L '$(SYMBOL_PREFIX)Init_*' -L '$(SYMBOL_PREFIX)ruby_static_id_*' \
+			-L '$(SYMBOL_PREFIX)*_threadptr_*' $@
+		$(Q) $(POSTLINK)
+		@-$(MINIRUBY) -e 'ARGV.each{|link| File.delete link rescue nil; \
+						  File.symlink "$(LIBRUBY_SO)", link}' \
+				$(LIBRUBY_ALIASES) || true
+
+ruby_pc = @ruby_pc@
+$(ruby_pc):
+		@./config.status --file=$@:$(srcdir)/template/ruby.pc.in
+
+ruby-runner.c: template/ruby-runner.c.in
+		@./config.status --file=$@:$(srcdir)/template/$(@F).in
+
+ruby-runner$(EXEEXT): ruby-runner.c
+	$(Q) $(PURIFY) $(CC) $(CFLAGS) $(CPPFLAGS) -DRUBY_INSTALL_NAME=$(RUBY_INSTALL_NAME) $(LDFLAGS) $(LIBS) $(OUTFLAG)$@ ruby-runner.c
+
+$(RBCONFIG): $(PREP)
+
+rbconfig.rb: $(RBCONFIG)
+
+install-cross: $(arch)-fake.rb $(RBCONFIG) rbconfig.rb $(arch_hdrdir)/ruby/config.h \
+	$(LIBRUBY_A) $(LIBRUBY_SO) $(ARCHFILE)
+	$(ECHO) installing cross-compiling stuff
+	$(Q) $(MAKEDIRS) $(XRUBY_RUBYLIBDIR)/$(arch) $(XRUBY_RUBYHDRDIR)/$(arch)/ruby
+	$(Q) sed '/^\$$:\.unshift/q' $(arch)-fake.rb > fake.rb
+	$(Q) $(BASERUBY) -p \
+	-e '~/^\s*CONFIG\["LDFLAGS"\]/ and' \
+	-e '$$_[/(?=\s*"$$)/] = %q[ #{(CONFIG["LIBPATHFLAG"]%File.dirname(__FILE__)).strip}]' \
+	rbconfig.rb > fake-rbconfig.rb
+	$(INSTALL_SCRIPT) fake.rb $(XRUBY_RUBYLIBDIR)/$(arch)/fake.rb
+	$(INSTALL_SCRIPT) fake-rbconfig.rb $(XRUBY_RUBYLIBDIR)/$(arch)/rbconfig.rb
+	@$(RM) fake.rb fake-rbconfig.rb
+	$(INSTALL_DATA) $(arch_hdrdir)/ruby/config.h $(XRUBY_RUBYHDRDIR)/$(arch)/ruby
+	$(INSTALL_DATA) $(top_srcdir)/include/ruby/win32.h $(XRUBY_RUBYHDRDIR)/ruby
+	$(INSTALL_DATA) $(LIBRUBY) $(LIBRUBY_A) $(XRUBY_RUBYLIBDIR)/$(arch)
+	$(INSTALL_PROGRAM) $(LIBRUBY_SO) $(XRUBY_RUBYLIBDIR)/$(arch)
+
+Makefile:	$(srcdir)/Makefile.in $(srcdir)/enc/Makefile.in
+
+$(MKFILES): config.status $(srcdir)/version.h
+		@[ -f $@ ] && mv $@ $@.old
+		MAKE=$(MAKE) $(SHELL) ./config.status $@
+		@cmp $@ $@.old > /dev/null 2>&1 && echo $@ unchanged && exit 0; \
+		{ \
+		    echo "all:; -@rm -f conftest.mk"; \
+		    echo "conftest.mk: .force; @echo AUTO_REMAKE"; \
+		    echo ".force:"; \
+		} > conftest.mk || exit 1; \
+		$(MAKE) -f conftest.mk | grep '^AUTO_REMAKE$$' >/dev/null 2>&1 || \
+		{ echo "$@ updated, restart."; exit 1; }
+
+uncommon.mk: $(srcdir)/common.mk
+		sed 's/{\$$([^(){}]*)[^{}]*}//g' $< > $@
+
+.PHONY: reconfig
+reconfig-args = $(srcdir)/$(CONFIGURE) $(configure_args)
+config.status-args = ./config.status --recheck
+reconfig-exec-0 = test -t 1 && { CONFIGURE_TTY=yes; export CONFIGURE_TTY; }; exec 3>&1; exit `exec 4>&1; { "$$@" 3>&- 4>&-; echo $$? 1>&4; } | fgrep -v '(cached)' 1>&3 3>&- 4>&-`
+reconfig-exec-1 = set -x; "$$@"
+
+reconfig config.status:	$(srcdir)/$(CONFIGURE) $(srcdir)/enc/Makefile.in \
+			$(srcdir)/include/ruby/version.h
+	@PWD= MINIRUBY="$(MINIRUBY)"; export MINIRUBY; \
+	set $(SHELL) $($@-args); $(reconfig-exec-$(V))
+
+$(srcdir)/$(CONFIGURE): $(srcdir)/configure.in $(srcdir)/aclocal.m4
+	$(CHDIR) $(srcdir) && exec $(AUTOCONF) -o $(@F)
+
+incs: id.h
+all-incs: probes.h
+
+# Things which should be considered:
+# * with gperf v.s. without gperf
+# * committers may have various versions of gperf
+# * ./configure v.s. ../ruby/configure
+# * GNU make v.s. HP-UX make	# HP-UX make invokes the action if lex.c and keywords has same mtime.
+# * svn checkout generate a file with mtime as current time
+# * ext4 and XFS has a mtime with fractional part
+lex.c: defs/keywords
+	@\
+	if cmp -s $(srcdir)/defs/lex.c.src $?; then \
+	  [ $(Q) ] && echo copying $@ || set -x; \
+	  $(CP) $(srcdir)/lex.c.blt $@; \
+	else \
+	  [ $(Q) ] && echo generating $@ || set -x; \
+	  gperf -C -P -p -j1 -i 1 -g -o -t -N rb_reserved_word -k1,3,$$ $? \
+	  | sed 's/(long)&((\(struct stringpool_t\) *\*)0)->\(stringpool_[a-z0-9]*\)/offsetof(\1, \2)/g' \
+	  > $@.tmp && \
+	  $(MV) $@.tmp $@ && \
+	  $(CP) $? $(srcdir)/defs/lex.c.src && \
+	  $(CP) $@ $(srcdir)/lex.c.blt; \
+	fi
+
+NAME2CTYPE_OPTIONS = -7 -c -j1 -i1 -t -C -P -T -H uniname2ctype_hash -Q uniname2ctype_pool -N uniname2ctype_p
+
+enc/unicode/name2ctype.h: enc/unicode/name2ctype.kwd
+	$(MAKEDIRS) $(@D)
+	@set +e; \
+	if cmp -s $(?:.kwd=.src) $?; then \
+	  set -x; \
+	  $(CP) $(?:.kwd=.h.blt) $@; \
+	else \
+	  trap '$(RM) $@-1.h $@-2.h' 0 && \
+	  set -x; \
+	  sed '/^#ifdef USE_UNICODE_PROPERTIES/,/^#endif/d' $? | gperf $(NAME2CTYPE_OPTIONS) > $@-1.h && \
+	  sed '/^#ifdef USE_UNICODE_PROPERTIES/d;/^#endif/d' $? | gperf $(NAME2CTYPE_OPTIONS) > $@-2.h && \
+	  diff -DUSE_UNICODE_PROPERTIES $@-1.h $@-2.h > $@.tmp || :; \
+	  $(MV) $@.tmp $@ && \
+	  $(CP) $? $(?:.kwd=.src) && \
+	  $(CP) $@ $(?:.kwd=.h.blt); \
+	fi
+
+JIS_PROPS_OPTIONS = -k1,3 -7 -c -j1 -i1 -t -C -P -t --ignore-case -H onig_jis_property_hash -Q onig_jis_property_pool -N onig_jis_property
+
+enc/jis/props.h: enc/jis/props.kwd
+	$(MAKEDIRS) $(@D)
+	@set +e; \
+	if cmp -s $(?:.kwd=.src) $?; then \
+	  set -x; \
+	  $(CP) $(?:.kwd=.h.blt) $@; \
+	else \
+	  set -x; \
+	  gperf $(JIS_PROPS_OPTIONS) $? | \
+	  sed 's/(int)(long)&((\([a-zA-Z_0-9 ]*[a-zA-Z_0-9]\) *\*)0)->\([a-zA-Z0-9_]*\),/(char)offsetof(\1, \2),/g' > $@ && \
+	  $(CP) $? $(?:.kwd=.src) && \
+	  $(CP) $@ $(?:.kwd=.h.blt); \
+	fi
+
+.c.@OBJEXT@:
+	@$(ECHO) compiling $<
+	$(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -c $<
+
+.s.@OBJEXT@:
+	@$(ECHO) assembling $<
+	$(Q) $(AS) $(ASFLAGS) -o $@ $<
+
+.c.S:
+	@$(ECHO) translating $<
+	$(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -S $<
+
+.c.i:
+	@$(ECHO) preprocessing $<
+	$(Q) $(CPP) $(warnflags) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -E $< > $@
+
+.d.h:
+	@$(ECHO) translating probes $<
+	$(Q) $(DTRACE) -o $@.tmp -h -C $(INCFLAGS) -s $<
+	$(Q) sed -e 's/RUBY_/RUBY_DTRACE_/g' -e 's/PROBES_H_TMP/RUBY_PROBES_H/' -e 's/(char \*/(const char */g' -e 's/, char \*/, const char */g' $@.tmp > $@
+	$(Q) $(RM) $@.tmp
+
+.dmyh.h:
+	@$(ECHO) copying dummy $(DEST_FILE)
+	$(Q) $(CP) $(OS_SRC_FILE) $(OS_DEST_FILE)
+
+probes.stamp: $(DTRACE_REBUILD_OBJS)
+	$(Q) if test -f $@ -o -f probes.$(OBJEXT); then \
+	  $(RM) $(DTRACE_REBUILD_OBJS) $@; \
+	  $(ECHO0) "rebuilding objects which were modified by \"dtrace -G\""; \
+	  $(MAKE) $(DTRACE_REBUILD_OBJS); \
+	fi
+	$(Q) touch $@
+
+probes.@OBJEXT@: $(srcdir)/probes.d $(DTRACE_REBUILD:yes=probes.stamp)
+	@$(ECHO) processing probes in object files
+	$(Q) $(RM) $@
+	$(Q) $(DTRACE) -G -C $(INCFLAGS) -s $(srcdir)/probes.d -o $@ $(DTRACE_REBUILD_OBJS)
+
+# DTrace static library hacks described here:
+# http://mail.opensolaris.org/pipermail/dtrace-discuss/2005-August/000207.html
+ruby-glommed.$(OBJEXT):
+	@$(ECHO) generating a glommed object with DTrace probes for static library
+	$(Q) $(LD) -r -o $@ $(OBJS)
+
+clean-local::
+	$(Q)$(RM) ext/extinit.c ext/extinit.$(OBJEXT) ext/ripper/y.output \
+		enc/encinit.c enc/encinit.$(OBJEXT)
+	-$(Q)$(RM) $(pkgconfig_DATA)
+
+distclean-local::
+	$(Q)$(RM) ext/config.cache $(RBCONFIG) Doxyfile
+	-$(Q)$(RM) run.gdb
+	-$(Q)$(RM) $(INSTALLED_LIST) $(arch_hdrdir)/ruby/config.h verconf.h
+	-$(Q)$(RMDIRS) $(arch_hdrdir)/ruby 2> /dev/null || true
+
+clean-ext distclean-ext realclean-ext::
+	@cd ext 2>/dev/null || exit 0; set dummy `echo "${EXTS}" | tr , ' '`; shift; \
+	test "$$#" = 0 && set .; \
+	set dummy `\
+	    find "$$@" -name Makefile -print | sed 's:^\./::;s:/Makefile$$::' | sort; \
+	`; shift; \
+	cd ..; \
+	for dir do \
+	    echo $(@:-ext=)ing "$$dir"; \
+	    (cd "ext/$$dir" && exec $(MAKE) $(MFLAGS) $(@:-ext=)) && \
+	    case "$@" in \
+	    *distclean-ext*|*realclean-ext*) \
+		$(RMDIRS) "ext/$$dir" 2> /dev/null || true;; \
+	    esac; \
+	done
+	-$(Q)$(RM) ext/extinit.$(OBJEXT)
+
+distclean-ext realclean-ext::
+	-$(Q)$(RM) ext/extinit.c
+	-$(Q)$(RMDIR) ext 2> /dev/null || true
+
+clean-extout:
+
+clean-enc distclean-enc realclean-enc:
+	@test -f "$(ENC_MK)" || exit 0; \
+	echo $(@:-enc=ing) encodings; \
+	exec $(MAKE) -f $(ENC_MK) $(MFLAGS) $(@:-enc=)
+
+ext/extinit.$(OBJEXT): ext/extinit.c $(SETUP)
+	$(ECHO) compiling $@
+	$(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -c ext/extinit.c
+
+enc/encinit.$(OBJEXT): enc/encinit.c $(SETUP)
+
+up::
+	@$(CHDIR) "$(srcdir)" && LC_TIME=C exec $(VCSUP)
+
+after-update:: update-config_files common-srcs
+
+update-mspec:
+	@$(CHDIR) $(srcdir); \
+	if [ -d spec/mspec ]; then \
+	  echo updating mspec ...; \
+	  $(Q1:0=:) set -x; \
+	  cd spec/mspec && \
+	  exec git pull; \
+	else \
+	  echo retrieving mspec ...; \
+	  $(Q1:0=:) set -x; \
+	  exec git clone $(MSPEC_GIT_URL) spec/mspec; \
+	fi
+
+update-rubyspec: update-mspec
+	@$(CHDIR) $(srcdir); \
+	if [ -d spec/rubyspec ]; then \
+	  echo updating rubyspec ...; \
+	  $(Q1:0=:) set -x; \
+	  cd spec/rubyspec && \
+	  exec git pull; \
+	else \
+	  echo retrieving rubyspec ...; \
+	  $(Q1:0=:) set -x; \
+	  exec git clone $(RUBYSPEC_GIT_URL) spec/rubyspec; \
+	fi
+
+test-rubyspec-precheck:
+	@if [ ! -d $(srcdir)/spec/rubyspec ]; then echo No rubyspec here.  make update-rubyspec first.; exit 1; fi
+
+update-doclie:
+	@$(CHDIR) $(srcdir); \
+	if [ -d coverage/doclie ]; then \
+	  echo updating doclie ...; \
+	  $(Q1:0=:) set -x; \
+	  cd coverage/doclie && \
+	  git fetch && \
+	  exec git checkout $(DOCLIE_GIT_REF); \
+	else \
+	  echo retrieving doclie ...; \
+	  $(Q1:0=:) set -x; \
+	  exec git clone --branch $(DOCLIE_GIT_REF) $(DOCLIE_GIT_URL) coverage/doclie; \
+	fi
+
+update-simplecov-html:
+	@$(CHDIR) $(srcdir); \
+	if [ -d coverage/simplecov-html ]; then \
+	  echo updating simplecov-html ...; \
+	  $(Q1:0=:) set -x; \
+	  cd coverage/simplecov-html && \
+	  git fetch && \
+	  exec git checkout $(SIMPLECOV_HTML_GIT_REF); \
+	else \
+	  echo retrieving simplecov-html ...; \
+	  exec git clone --branch $(SIMPLECOV_HTML_GIT_REF) $(SIMPLECOV_HTML_GIT_URL) coverage/simplecov-html; \
+	fi
+
+update-simplecov:
+	@$(CHDIR) $(srcdir); \
+	if [ -d coverage/simplecov ]; then \
+	  echo updating simplecov ...; \
+	  $(Q1:0=:) set -x; \
+	  cd coverage/simplecov && \
+	  git fetch && \
+	  exec git checkout $(SIMPLECOV_GIT_REF); \
+	else \
+	  echo retrieving simplecov ...; \
+	  $(Q1:0=:) set -x; \
+	  exec git clone --branch $(SIMPLECOV_GIT_REF) $(SIMPLECOV_GIT_URL) coverage/simplecov; \
+	fi
+
+update-coverage: update-simplecov update-simplecov-html update-doclie
+
+INSNS	= opt_sc.inc optinsn.inc optunifs.inc insns.inc insns_info.inc \
+	  vmtc.inc vm.inc
+
+$(INSNS): $(srcdir)/insns.def vm_opts.h \
+	  $(srcdir)/defs/opt_operand.def $(srcdir)/defs/opt_insn_unif.def \
+	  $(srcdir)/tool/instruction.rb $(srcdir)/tool/insns2vm.rb
+	$(ECHO) generating $@
+	$(Q) $(BASERUBY) -Ku $(srcdir)/tool/insns2vm.rb $(INSNS2VMOPT) $@
+
+verconf.h: $(RBCONFIG)
+
+loadpath: verconf.h
+	@$(CPP) $(XCFLAGS) $(CPPFLAGS) $(srcdir)/loadpath.c | \
+	sed -e '1,/^const char ruby_initial_load_paths/d;/;/,$$d' \
+	    -e '/^ /!d;s/ *"\\0"$$//;s/" *"//g'
diff --git a/NEWS b/NEWS
new file mode 100644
index 0000000000..be722bc9de
--- /dev/null
+++ b/NEWS
@@ -0,0 +1,404 @@
+# -*- rdoc -*-
+
+= NEWS for Ruby 2.3.0
+
+This document is a list of user visible feature changes made between
+releases except for bug fixes.
+
+Note that each entry is kept so brief that no reason behind or
+reference information is supplied with.  For a full list of changes
+with all sufficient information, see the ChangeLog file or Redmine
+(e.g. <tt>https://bugs.ruby-lang.org/issues/$FEATURE_OR_BUG_NUMBER</tt>)
+
+== Changes since the 2.2.0 release
+
+=== Language changes
+
+* frozen-string-literal pragma:
+
+  * new pragma, frozen-string-literal has been experimentally introduced.
+    [Feature #8976]
+  * besides, --enable/--disable=frozen-string-literal options also have
+    been introduced. [Feature #8976]
+  * command line options --debug or --debug=frozen-string-literal enable
+    additional debugging mode which shows created location with at frozen
+    object error (RuntimeError).
+    [Feature #11725]
+
+* safe navigation operator:
+
+  * new method call syntax, `object&.foo', method #foo is called on
+    `object' if it is not nil.
+    this is similar to `try!' in Active Support, except:
+    * method name is syntactically required
+          obj.try! {} # valid
+          obj&. {}    # syntax error
+    * arguments are evaluated only if a call is made:
+          obj.try!(:foo, bar())  # bar() is always evaluated
+          obj&.foo(bar())        # bar() is conditionally evaluated
+    * attribute assignment is valid
+          obj&.attr += 1
+    [Feature #11537]
+
+* the did_you_mean gem:
+
+  * When a NameError or NoMethodError occurs because of a typo in the name,
+    the did_you_mean gem automatically suggests other names similar to the
+    method name.
+
+      "Yuki".starts_with?("Y")
+      # => NoMethodError: undefined method `starts_with?' for "Yuki":String
+      #    Did you mean?  start_with?
+
+* indented here document:
+
+  * new string literal, here document starts with `<<~`.
+    refer doc/syntax/literals.rdoc for more details.
+    [Feature #9098]
+
+=== Core classes updates (outstanding ones only)
+
+* ARGF
+
+  * ARGF.read_nonblock supports `exception: false' like IO#read_nonblock.
+    [Feature #11358]
+
+* Array
+
+  * Array#bsearch_index [Feature #10730]
+  * Array#dig [Feature #11643]
+
+* Comparable
+
+  * Comparable#== no longer rescues exceptions [Feature #7688]
+
+* Encoding
+
+  * new Encoding::IBM037 (alias ebcdic-cp-us; dummy)
+
+* Enumerable
+
+  * Enumerable#grep_v is added as inverse version of Enumerable#grep.
+    [Feature #11049]
+  * Enumerable#chunk_while [Feature #10769]
+
+* Enumerator::Lazy
+
+  * Enumerator::Lazy#grep_v [Feature #11773]
+
+* File
+
+  * File.mkfifo [Feature #11536]
+  * Add File::TMPFILE corresponding to O_TMPFILE
+
+* Hash
+
+  * Hash#fetch_values [Feature #10017]
+  * Hash#dig [Feature #11643]
+  * Hash#<=, Hash#<, Hash#>=, Hash#> [Feature #10984]
+  * Hash#to_proc [Feature #11653]
+
+* IO
+
+  * new mode flag File::SHARE_DELETE is available.
+    this flag means to permit deleting opened file on Windows, but currently
+    this affect only files opened as binary.  [Feature #11218]
+
+  * new option parameter `flags' is added.
+    this parameter is bitwise-ORed to oflags generated by normal mode argument.
+    [Feature #11253]
+
+  * IO#advise no longer raises Errno::ENOSYS in cases where it was
+    detected at build time but not available at runtime.  [Feature #11806]
+
+* Kernel
+
+  * Kernel#loop, when stopped by a StopIteration exception, returns
+    what the enumerator has returned instead of nil. [Feature #11498]
+
+* Module
+  * Module#deprecate_constant [Feature #11398]
+
+* NameError
+  * NameError#receiver is added to take the receiver object. [Feature #10881]
+
+* Numeric
+
+  * Numeric#positive? and Numeric#negative? are added, which return
+    true when the receiver is positive and negative respectively.
+    [Feature #11151]
+
+* Proc
+
+  * Proc#call (and also #[], #===, #yield) are optimized.
+    Backtrace doesn't show each method (show block lines directly).
+    TracePoint also ignores these calls. [Feature #11569]
+
+* Queue (Thread::Queue)
+
+  * Queue#close is added to notice a termination. [Feature #10600]
+
+* Regexp/String: Updated Unicode version from 7.0.0 to 8.0.0
+
+* RubyVM::InstructionSequence
+  * add the following methods as a primitive tool of iseq loader.
+    See sample/iseq_loader.rb for usage.
+    Note that loader does not have verifier so it is easy to cause
+    critical problem by loading modified/broken binary data.
+    See [Feature #11788] for more details. (experimental feature)
+    * RubyVM::InstructionSequence#to_binary(extra_data = nil)
+    * RubyVM::InstructionSequence.load_from_binary(binary)
+    * RubyVM::InstructionSequence.load_from_binary_extra_data(binary)
+
+* String
+
+  * String#+@ and String#-@ are added to get mutable/frozen strings.
+    [Feature #11782]
+
+  * String.new now accepts new option parameter `encoding'.
+    [Feature #11785]
+
+* Struct
+  * Struct#dig [Feature #11688]
+
+* Thread
+  * Thread#name, Thread#name= are added to handle thread names [Feature #11251]
+
+=== Core classes compatibility issues (excluding feature bug fixes)
+
+* Array
+  * Array#select!, Array#keep_if, Array#reject!, and Array#delete_if
+    no longer changes the receiver array instantly every time the
+    block is called.  [Feature #10714]
+
+  * Array#flatten and Array#flatten! no longer try to call #to_ary
+    method on elements beyond the given level.  [Bug #10748]
+
+  * Array#inspect doesn't raise error even if its content returns
+    a string which is not compatible with Encoding.default_external
+    as inspected result. [Feature #11801]
+
+* Enumerable
+  * Enumerable#chunk and Enumerable#slice_before no longer takes the
+    initial_state argument.  [Feature #10958]
+    Use a local variable instead to maintain a state.
+
+* File::Stat
+  * On Windows File::Stat#ino always returned 0, but now returns
+    BY_HANDLE_FILE_INFORMATION.nFileIndexHigh/Low.  [Feature #11216]
+
+* Hash
+  * Hash#inspect doesn't raise error even if its content returns
+    a string which is not compatible with Encoding.default_external
+    as inspected result. [Feature #11801]
+
+* IO
+  * IO#close doesn't raise when the IO object is closed.  [Feature #10718]
+  * IO#each_codepoint raises an exception at incomplete character
+    before EOF when conversion takes place.  [Bug #11444]
+
+* Module
+  * Module#define_method and Object.define_singleton_method now
+    require method body, Proc, Method, or a block, and raise
+    ArgumentError if no block is given directly.  [Bug #11283]
+
+* pack/unpack (Array/String)
+  * j and J directives for pointer width integer type.  [Feature #11215]
+
+
+=== Stdlib updates (outstanding ones only)
+
+* Logger
+
+  * Logger#level= now supports symbol and string levels such as :debug, :info,
+    :warn, :error, :fatal (case insensitive) [Feature #11695]
+  * Logger#reopen is added to reopen a log device. [Feature #11696]
+
+* io/wait
+  * IO#wait_readable no longer checks FIONREAD, it may be used for
+    non-bytestream IO such as listen sockets.
+
+* Net::FTP
+  * Net::FTP#mlst is added.
+  * Net::FTP#mlsd is added.
+
+* nkf
+  * Merge nkf 2.1.4.
+
+* ObjectSpace (objspace)
+  * ObjectSpace.count_symbols is added.
+  * ObjectSpace.count_imemo_objects is added.
+  * ObjectSpace.internal_class_of is added.
+  * ObjectSpace.internal_super_of is added.
+
+* OpenSSL
+  * OpenSSL::SSL::SSLSocket#accept_nonblock and
+    OpenSSL::SSL::SSLSocket#connect_nonblock supports `exception: false`.
+    [Feature #10532]
+
+* Pathname
+  * Pathname#descend and Pathname#ascend supported blockless form.
+    [Feature #11052]
+
+* Socket
+  * Socket#connect_nonblock, Socket#accept_nonblock,
+    TCPServer#accept_nonblock, UNIXServer#accept_nonblock,
+    BasicSocket#recv_nonblock, BasicSocket#recvmsg_nonblock,
+    BasicSocket#sendmsg_nonblock all support `exception: false` to return
+    :wait_readable or :wait_writable symbols instead of raising
+    IO::WaitReadable or IO::WaitWritable exceptions
+    [Feature #10532] [Feature #11229]
+  * BasicSocket#recv and BasicSocket#recv_nonblock allow an output
+    String buffer argument like IO#read and IO#read_nonblock to reduce
+    GC overhead [Feature #11242]
+
+* StringIO
+  * In read-only mode, StringIO#set_encoding no longer sets the encoding
+    of its buffer string.  Setting the encoding of the string directly
+    without StringIO#set_encoding may cause unpredictable behavior now.
+    [Bug #11827]
+
+* timeout
+  * Object#timeout is now warned as deprecated when called.
+
+=== Stdlib compatibility issues (excluding feature bug fixes)
+
+* ext/coverage/coverage.c
+  * Coverage.peek_result: new method to allow coverage to be captured without
+    stopping the coverage tool.  [Feature #10816]
+
+* Fiddle
+  * Fiddle::Function#call releases the GVL.  [Feature #11607]
+
+* io-console
+  * Update to io-console 0.4.5, and change the license to BSD 2-clause
+    "Simplified" License.
+
+* lib/base64.rb
+  * Base64.urlsafe_encode64: added a "padding" option to suppress
+    the padding character ("=").  [Feature #10740]
+  * Base64.urlsafe_decode64: now it accepts not only correctly-padded
+    input but also unpadded input.  [Feature #10740]
+
+* lib/drb/drb.rb
+  * removed unused argument. https://github.com/ruby/ruby/pull/515
+
+* lib/matrix.rb
+  * Add Vector#round. https://github.com/ruby/ruby/pull/802
+
+* lib/webrick/utils.rb
+  * removed unused argument. https://github.com/ruby/ruby/pull/356
+
+* Net::FTP
+  * Connections are in passive mode per default now.  The default mode can
+    be changed by Net::FTP.default_passive=.  [Feature #11612]
+
+* Net::HTTP
+  * default value of Net::HTTP#open_timeout is now 60 (was nil).
+
+* Net::Telnet
+  * Net::Telnet is extracted to net-telnet gem. It's unmaintain code.
+    [Feature #11083]
+
+* Psych
+  * Updated to Psych 2.0.17
+
+* Rake
+  * Rake is removed from stdlib.  [Feature #11025]
+
+* RDoc
+  * Updated to RDoc 4.2.1.  For full release notes see:
+
+    https://github.com/rdoc/rdoc/blob/master/History.rdoc#421--2015-12-22
+
+* RubyGems
+  * Updated to RubyGems 2.5.1.  For full release notes see:
+
+    http://docs.seattlerb.org/rubygems/History_txt.html#label-2.5.0+-2F+2015-11-03
+    and
+    http://docs.seattlerb.org/rubygems/History_txt.html#label-2.5.1+-2F+2015-12-10
+
+=== Built-in global variables compatibility issues
+
+* $SAFE
+  * $SAFE=2 and $SAFE=3 are obsolete.  If $SAFE is set to 2 or larger,
+    an ArgumentError is raised.  [Feature #5455]
+
+=== C API updates
+
+* rb_define_class_id_under() now raises a TypeError exception when the
+  class is already defined but its superclass does not match the given
+  superclass, as well as definitions in ruby level.
+
+* rb_timespec_now() is added to fetch current datetime as struct timespec.
+  [Feature #11558]
+
+* rb_time_timespec_new() is added to create a time object with epoch,
+  nanosecond, and UTC/localtime/time offset arguments.  [Feature #11558]
+
+* rb_autoload() deprecated, use rb_funcall() instead.  [Feature #11664]
+
+* rb_compile_error_with_enc(), rb_compile_error(), and rb_compile_bug()
+  deprecated.  these functions are exposed but only for internal use.
+  external libraries should not use them.
+
+=== Supported platform changes
+
+* OS/2 is no longer supported
+
+* BeOS is no longer supported
+
+* Borland-C is no longer supported
+
+* Haiku now stable and best effort
+
+=== Implementation improvements
+
+* Optimize Proc#call to eliminate method frame construction.
+  [Feature #11569]
+
+* Reconsidering method entry data structure.
+  [Bug #11278]
+
+* Introducing new table data structure for ID keys tables used by
+  method table and so on. New table structure is simple and fast
+  than st_table. [Feature #11420]
+
+* Machine code level tuning for object allocation and method calling
+  code. r52099, r52254
+
+* RubyVM::InstructionSequence is extended for future improvement.
+  [Feature #11788]
+
+* Case dispatch is now optimized for all special constant literals
+  including nil, true, and false.  Previously, only literal strings,
+  symbols, integers and floats compiled to optimized case dispatch.
+  [Feature #11769]
+
+* Instance variables on non-pure Ruby classes (T_DATA, T_FILE,
+  etc..) is less expensive to store than before. [Feature #11170]
+
+* All accesses to members of big Struct objects are performed in
+  constant-time.  Previously, Struct elements beyond the first 10
+  10 elements used a linear scan. [Feature #10585]
+
+* The Set class got several speed up.
+  [Misc #10754], [r52591]
+
+* Socket and I/O-related improvements
+
+  * Calling overhead of most of new keyword-using I/O methods in
+    [Feature #11229] is reduced by avoiding the inefficient C API
+    to parse keywords.  [Feature #11339]
+
+  * The standard library is updated to use the improved
+    exception-free non-blocking I/O from [Feature #11229].
+    This has the additional benefit of quieter $DEBUG output in
+    addition to reducing expensive exceptions. [Feature #11044]
+
+  * (Linux-only) waiting on a single FD anywhere in the stdlib no longer
+    uses select(2), making it immune to slowdowns with high-numbered FDs.
+    [Feature #11081] [Feature #11377]
+
+* CGI.escapeHTML is optimized with C extention.
+  https://github.com/ruby/ruby/pull/1164
diff --git a/README b/README
deleted file mode 100644
index 9dc79e8e26..0000000000
--- a/README
+++ /dev/null
@@ -1,73 +0,0 @@
-.\" README -  -*- Text -*- created at: Wed Aug  3 11:57:36 JST 1994
-
-¥³¥ó¥Ñ¥¤¥ë¡¦¥¤¥ó¥¹¥È¡¼¥ë
-
-  1. configure¤ò¼Â¹Ô¤·¤ÆMakefile¤òÀ¸À®¤¹¤ë.
-  2. (ɬÍפʤé¤Ð)defines.h¤òÊÔ½¸¤¹¤ë.
-  3. make¤ò¼Â¹Ô¤·¤Æ¥³¥ó¥Ñ¥¤¥ë¤¹¤ë
-  4. make install
-
-  ¤â¤·, ¥³¥ó¥Ñ¥¤¥ë»þ¤Ë¥¨¥é¡¼¤¬È¯À¸¤·¤¿¾ì¹ç¤Ë¤Ï¥¨¥é¡¼¤Î¥í¥°¤È¥Þ
-  ¥·¥ó, OS¤Î¼ïÎà¤ò´Þ¤à¤Ç¤­¤ë¤À¤±¾Ü¤·¤¤¥ì¥Ý¡¼¥È¤òºî¼Ô¤ËÁ÷¤Ã¤Æ¤¤
-  ¤¿¤À¤­¤¿¤¤.
-
-µ¡Ç½ÄɲÃ
-
-  C¥³¡¼¥É¤ò½ñ¤¯¤³¤È¤Ë¤è¤Ã¤Æ, ´Êñ¤Ëruby¤Ëµ¡Ç½¤òÄɲäǤ­¤ë. 
-  ¤½¤Î¤ª¤ª¤Þ¤«¤Ê¼ê½ç¤Ï°Ê²¼¤ÎÄ̤ê¤Ç¤¢¤ë.
-
-  * ´Ø¿ôŪ¥á¥½¥Ã¥É¤òÄɲ乤ë¾ì¹ç
-
-    (1) C¤Ç´Ø¿ô¤ò½ñ¤¯
-    (2) rb_define_method()¤Ç¥«¡¼¥Í¥ë¥¯¥é¥¹¤Î¥á¥½¥Ã¥É¤È¤·¤Æ´Ø
-	¿ô¤òruby¤ËÅÐÏ¿¤¹¤ë´Ø¿ô¤ò½ñ¤¯
-    (3) init.c¤òÊÔ½¸¤·¤Æ, ÅÐÏ¿¤¹¤ë´Ø¿ô¤ò¸Æ¤Ó½Ð¤¹
-
-  * ¥¯¥é¥¹¤òÄɲ乤ë¾ì¹ç
-
-    (1) ¥¯¥é¥¹¤òÀ߷פ¹¤ë
-    (2) ¥á¥½¥Ã¥É¤òC¤Çµ­½Ò¤¹¤ë
-    (3) rb_define_class()¤Ç¥¯¥é¥¹¤òÀ¸À®¤¹¤ë¥³¡¼¥É¤ò½ñ¤¯
-    (4) rb_define_method()¤Ç¥á¥½¥Ã¥É¤òÅÐÏ¿¤¹¤ë¥³¡¼¥É¤ò½ñ¤¯
-    (5) init.c¤òÊÔ½¸¤·¤Æ, ½é´ü²½¤¹¤ë´Ø¿ô¤ò¸Æ¤Ó½Ð¤¹
-
-  ¾Ü¤·¤¯¤ÏC-IF¤ò»²¾È.
-
-°Ü¿¢
-
-  UNIX¤Ç¤¢¤ì¤Ðconfigure¤¬¤Û¤È¤ó¤É¤Îº¹°Û¤òµÛ¼ý¤·¤Æ¤¯¤ì¤ë¤Ï¤º
-  ¤À¤¬, »×¤ï¤Ì¸«Íî¤È¤·¤¬¤¢¤Ã¤¿¾ì¹ç(¤¢¤ë¤Ë°ã¤¤¤Ê¤¤), ºî¼Ô¤Ë¥ì
-  ¥Ý¡¼¥È¤¹¤ì¤Ð, ²ò·è¤Ç¤­¤ë¤«¤âÃΤì¤Ê¤¤.
-
-  ¥¢¡¼¥¯¥Æ¥¯¥Á¥ã¤Ë¤â¤Ã¤È¤â°Í¸¤¹¤ë¤Î¤ÏGCÉô¤Ç¤¢¤ë. ruby¤ÎGC¤Ï
-  ÂоݤΥ¢¡¼¥­¥Æ¥¯¥Á¥ã¤¬setjmp()¤Ë¤è¤Ã¤Æ, Á´¤Æ¤Î¥ì¥¸¥¹¥¿¤ò 
-  jmp_buf¤Ë³ÊǼ¤¹¤ë¤³¤È¤È, jmp_buf¤È¥¹¥¿¥Ã¥¯¤¬32bit¥¢¥é¥¤¥ó
-  ¥á¥ó¥È¤µ¤ì¤Æ¤¤¤ë¤³¤È¤ò²¾Äꤷ¤Æ¤¤¤ë. Á°¼Ô¤¬¿¿¼Â¤Ç¤Ê¤¤¾ì¹ç¤Î
-  °Ü¿¢¤Ïº¤Æñ¤ò¶Ë¤á¤ë¤À¤í¤¦. ¸å¼Ô¤Ï³ä¤È´Êñ¤Ë²ò·è¤Ç¤­¤ë. gc.c
-  ¤Î¥¹¥¿¥Ã¥¯¤ò¥Þ¡¼¥¯¤¹¤ëÉôʬ¤Ë¥¢¥é¥¤¥ó¥á¥ó¥È¤Î¥Ð¥¤¥È¿ô¤À¤±¤º
-  ¤é¤·¤Æ¥Þ¡¼¥¯¤¹¤ë¥³¡¼¥É¤òÄɲ乤ë¤À¤±¤ÇºÑ¤à.
-
-  sparc°Ê³°¤Î¥ì¥¸¥¹¥¿¥¦¥£¥ó¥É¥¦¤ò»ý¤ÄCPU¤Ç¤Ï, ¥ì¥¸¥¹¥¿¥¦¥£¥ó
-  ¥É¥¦¤ò¥Õ¥é¥Ã¥·¥å¤¹¤ë¥³¡¼¥É¤òÄɲ乤ëɬÍפ¬¤¢¤ë¤«¤âÃΤì¤Ê¤¤.
-
-ÇÛÉÛ¾ò·ï
-
-  Ruby¤ÏºÇ½ªÅª¤Ë¤ÏGNU Public License¤Ë¤·¤¿¤¬¤Ã¤¿¾ò·ï¤ÇÇÛÉÛ¤µ
-  ¤ì¤ëͽÄê¤À¤¬, ¸½»þÅÀ¤Ç¤Ï°Ê²¼¤Î¾ò·ï¤ÇÇÛÉÛ¤¹¤ë.
-
-  * ¹¹¿·
-
-    ¤¤¤«¤Ê¤ëÌÜŪ¤Ç¤¢¤ì¼«Í³¤Ç¤¢¤ë. ¤¿¤À¤·, ¥Ð¥°½¤Àµ¤Ïºî¼Ô¤Ø¤Î
-    ¥Õ¥£¡¼¥É¥Ð¥Ã¥¯¤ò´üÂÔ¤¹¤ë(¶¯À©¤Ç¤Ï¤Ê¤¤)
-
-  * ¾¤Î¥×¥í¥°¥é¥à¤Ø¤Î°úÍÑ
-
-    ¤¤¤«¤Ê¤ëÌÜŪ¤Ç¤¢¤ì¼«Í³¤Ç¤¢¤ë. ¤¿¤À¤·, ÇÛÉÛ¤·¤¿¥³¡¼¥É¤Ë´Þ
-    ¤Þ¤ì¤ë¾¤Îºî¼Ô¤Ë¤è¤ë¥³¡¼¥É¤Ï, ¤½¤ì¤¾¤ì¤Îºî¼Ô¤Î°Õ¸þ¤Ë¤è¤ë
-    À©¸Â¤¬²Ã¤¨¤é¤ì¤ë.
-
-  * ºÆÇÛÉÛ
-
-    ¶Ø»ß¤¹¤ë. Æþ¼ê¤·¤¿¤¤¿Í¤Ïºî¼Ô¤ËľÀÜÏ¢Íí¤ò¤È¤ë¤³¤È. ¤³¤ì¤Ï
-    Ruby¤Î¸À¸ì»ÅÍͤ¬ÉÔ°ÂÄê¤Ê¾õÂ֤Τޤ޹­¤¯Î®ÉÛ¤¹¤ë¤Î¤òÀ©¸Â¤¹
-    ¤ë¤¿¤á¤Ç¤¢¤ê, ¸À¸ì»ÅÍͤ¬°ÂÄꤷ¤¿»þÅÀ¤ÇºÆÇÛÉÛ¼«Í³¤È¤¹¤ë.
diff --git a/README.EXT b/README.EXT
new file mode 100644
index 0000000000..48b8d964c4
--- /dev/null
+++ b/README.EXT
@@ -0,0 +1 @@
+Moved to doc/extension.rdoc
diff --git a/README.EXT.ja b/README.EXT.ja
new file mode 100644
index 0000000000..f884ecbb0e
--- /dev/null
+++ b/README.EXT.ja
@@ -0,0 +1 @@
+doc/extension.ja.rdoc�移動����
diff --git a/README.ja.md b/README.ja.md
new file mode 100644
index 0000000000..eee54a9171
--- /dev/null
+++ b/README.ja.md
@@ -0,0 +1,171 @@
+# Ruby��
+
+Ruby�シンプル��強力�オブジェクト指�スクリプト言語��． Ruby�純粋�オブジェクト指�言語���設計�れ��る��，
+オブジェクト指�プログラミングを手軽�行�事�出���．も��ん普通�手続�型�プログラミングも�能��．
+
+Ruby�テキスト処�関係�能力���優れ，Perl����ら�強力��．�ら�シンプル�文法�，
+例外処�やイテレータ���機構�よ��，より分�りや��プログラミング�出���．
+
+## Ruby�特長
+
+*   シンプル�文法
+*   普通�オブジェクト指�機能(クラス，メソッドコール��)
+*   特殊�オブジェクト指�機能(Mixin, 特異メソッド��)
+*   演算�オー�ーロード
+*   例外処�機能
+*   イテレータ�クロージャ
+*   ガーベージコレクタ
+*   ダイナミックローディング (アーキテク�ャ�よる)
+*   移�性�高�．多��Unix-like/POSIX互�プラットフォーム上�動������，Windows， Mac OS
+    X，BeOS���上�も動� cf.
+    http://bugs.ruby-lang.org/projects/ruby-trunk/wiki/SupportedPlatformsJa
+
+
+## 入手法
+
+### FTP�
+
+以下�場所�����り��．
+
+ftp://ftp.ruby-lang.org/pub/ruby/
+
+### Subversion�
+
+開発先端�ソースコード�次�コマンド��得����．
+
+    $ svn co http://svn.ruby-lang.org/repos/ruby/trunk/ ruby
+
+他�開発中�ブラン��一覧�次�コマンド�見られ��．
+
+    $ svn ls http://svn.ruby-lang.org/repos/ruby/branches/
+
+### Git�
+
+Subversion�ミラーをGitHub�公開�����． 以下�コマンド�リ�ジトリを�得����．
+
+    $ git clone git://github.com/ruby/ruby.git
+
+## ホームページ
+
+Ruby�ホームページ�URL�
+
+http://www.ruby-lang.org/
+
+��．
+
+## メーリングリスト
+
+Ruby�メーリングリスト��り��．�加希望�方�
+
+mailto:ruby-list-request@ruby-lang.org
+
+��本文�
+
+    subscribe
+
+�書�����下��．
+
+Ruby開発者��メーリングリストも�り��．��ら��ruby��グ，将��仕様拡張��実装上��題����議論�れ����． �加希望�方�
+
+mailto:ruby-dev-request@ruby-lang.org
+
+��ruby-list��様�方法�メール������．
+
+Ruby拡張モジュール����話���ruby-extメーリングリスト�数学関係�話題����話���ruby-mathメーリングリスト�
+英語�ruby����話���ruby-talkメーリングリストも�り��．�加方法��れも����．
+
+## コンパイル・インストール
+
+以下�手順�行������．
+
+1.  も� `configure` ファイル�見��ら��，も��� `configure.in` より��よ��ら， `autoconf` を実行��
+    新�� `configure` を生��る
+
+2.  `configure` を実行�� `Makefile` ��を生��る
+
+    環境�よ���デフォルト�Cコンパイラ用オプション�付���． `configure` オプション� `optflags=..`
+    `warnflags=..` 等�上書�����．
+
+3.  (必��ら�)`defines.h` を編集�る
+
+    多分，必�無������．
+
+4.  (必��ら�)`ext/Setup` ��的�リンク�る拡張モジュールを指定�る
+
+    `ext/Setup` �記述��モジュール��的�リンク�れ��．
+
+    ダイナミックローディングをサ�ート�����アーキテク�ャ�� `Setup` �1行目�「`option nodynamic`����行�コ
+    メントを外�必���り��．��，��アーキテク�ャ�拡張モジュールを利用�る����，�ら����的�リンクを����必���り��．
+
+5.  `make` を実行��コンパイル�る
+
+6.  `make check`�テストを行�．
+
+    「`check succeeded`��表示�れれ��功��．���テスト��功��も完璧���証�れ��る訳���り��ん．
+
+7.  `make install`
+
+    以下�ディレクトリを作��，���ファイルをインストー ル���．
+
+    *   `${DESTDIR}${prefix}/bin`
+    *   `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}`
+    *   `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
+    *   `${DESTDIR}${prefix}/lib`
+    *   `${DESTDIR}${prefix}/lib/ruby`
+    *   `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}`
+    *   `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
+    *   `${DESTDIR}${prefix}/lib/ruby/site_ruby`
+    *   `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}`
+    *   `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
+    *   `${DESTDIR}${prefix}/lib/ruby/vendor_ruby`
+    *   `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}`
+    *   `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
+    *   `${DESTDIR}${prefix}/lib/ruby/gems/${MAJOR}.${MINOR}.${TEENY}`
+    *   `${DESTDIR}${prefix}/share/man/man1`
+    *   `${DESTDIR}${prefix}/share/ri/${MAJOR}.${MINOR}.${TEENY}/system`
+
+
+    Ruby�API�ージョン�'*x.y.z*'��れ�，`${MAJOR}`�
+    '*x*'�，`${MINOR}`�'*y*'，`${TEENY}`�'*z*'��．
+
+    **注�**: API�ージョン� `teeny` �，Rubyプログラム��ージョン��異�る����り��．
+
+    `root` �作業�る必���る�も�れ��ん．
+
+
+も�，コンパイル時�エラー�発生��場���エラー�ログ�マシン，OS�種類を�む��る��詳��レ�ートを作者����下�る�他�方����も�り��．
+
+## 移�
+
+UNIX��れ� `configure` ���ん��差異を�����れる�����，���見�������場�(�る事�多�)，作者���
+��を報告�れ�，解決��る�能性��り��．
+
+アーキテク�ャ�も��も�存�る��GC部��．Ruby�GC�対象
+�アーキテク�ャ�`setjmp()`���`getcontext()`�よ��全��レジスタを `jmp_buf` や `ucontext_t`
+�格��る���， `jmp_buf` や `ucontext_t` �スタック�32bitアラインメント�れ��る��を仮定
+�����．特��者��立���場��対応��常�困難��ょ�． 後者�解決�比較的簡��， `gc.c` �スタックをマーク���る
+部分�アラインメント��イト数���ら��マーク�るコードを追加�る���済���．`defined(__mc68000__)`�括られ��
+る部分を�考�������．
+
+レジスタウィンドウを��CPU��，レジスタウィンドウをスタック�フラッシュ�るアセンブラコードを追加�る必���る�も�れ��ん．
+
+## �布�件
+
+`COPYING.ja` ファイルを�照������．
+
+## フィード�ック
+
+Ruby�関�る質�� Ruby-Talk（英語）や Ruby-List（日本語） (https://www.ruby-lang.org/ja/community/mailing-lists) や，
+stackoverflow (http://ja.stackoverflow.com/) ���Webサイト�投稿������．
+
+�グ報告� http://bugs.ruby-lang.org ���付�����．
+
+
+## 著者
+
+Ruby�オリジナル版�，1995年���も�ゆ�����よ��設計・開発�れ���．
+
+<mailto:matz@ruby-lang.org>
+
+---
+created at: Thu Aug  3 11:57:36 JST 1995
diff --git a/README.md b/README.md
new file mode 100644
index 0000000000..14fb7aa213
--- /dev/null
+++ b/README.md
@@ -0,0 +1,164 @@
+# What's Ruby
+
+Ruby is the interpreted scripting language for quick and easy object-oriented
+programming.  It has many features to process text files and to do system
+management tasks (as in Perl).  It is simple, straight-forward, and
+extensible.
+
+## Features of Ruby
+
+*   Simple Syntax
+*   **Normal** Object-oriented Features (e.g. class, method calls)
+*   **Advanced** Object-oriented Features (e.g. Mix-in, Singleton-method)
+*   Operator Overloading
+*   Exception Handling
+*   Iterators and Closures
+*   Garbage Collection
+*   Dynamic Loading of Object Files (on some architectures)
+*   Highly Portable (works on many Unix-like/POSIX compatible platforms as
+    well as Windows, Mac OS X, BeOS, etc.) cf.
+    http://bugs.ruby-lang.org/projects/ruby-trunk/wiki/SupportedPlatforms
+
+
+## How to get Ruby
+
+For a complete list of ways to install Ruby, including using third-party tools
+like rvm, see:
+
+http://www.ruby-lang.org/en/downloads/
+
+The Ruby distribution files can be found on the following FTP site:
+
+ftp://ftp.ruby-lang.org/pub/ruby/
+
+The trunk of the Ruby source tree can be checked out with the following
+command:
+
+    $ svn co http://svn.ruby-lang.org/repos/ruby/trunk/ ruby
+
+Or if you are using git then use the following command:
+
+    $ git clone git://github.com/ruby/ruby.git
+
+There are some other branches under development.  Try the following command
+to see the list of branches:
+
+    $ svn ls http://svn.ruby-lang.org/repos/ruby/branches/
+
+Or if you are using git then use the following command:
+
+    $ git ls-remote git://github.com/ruby/ruby.git
+
+## Ruby home page
+
+The URL of the Ruby home page is:
+
+http://www.ruby-lang.org/
+
+## Mailing list
+
+There is a mailing list to talk about Ruby. To subscribe this list, please
+send the following phrase:
+
+    subscribe
+
+in the mail body (not subject) to the address
+<mailto:ruby-talk-request@ruby-lang.org>.
+
+## How to compile and install
+
+This is what you need to do to compile and install Ruby:
+
+1.  If you want to use Microsoft Visual C++ to compile ruby, read
+    win32/README.win32 instead of this document.
+
+2.  If `./configure` does not exist or is older than configure.in, run
+    `autoconf` to (re)generate configure.
+
+3.  Run `./configure`, which will generate `config.h` and `Makefile`.
+
+    Some C compiler flags may be added by default depending on your
+    environment.  Specify `optflags=..` and `warnflags=..` as necessary to
+    override them.
+
+4.  Edit `defines.h` if you need. Usually this step will not be needed.
+
+5.  Remove comment mark(`#`) before the module names from `ext/Setup` (or add
+    module names if not present), if you want to link modules statically.
+
+    If you don't want to compile non static extension modules (probably on
+    architectures which do not allow dynamic loading), remove comment mark
+    from the line "`#option nodynamic`" in `ext/Setup`.
+
+    Usually this step will not be needed.
+
+6.  Run `make`.
+
+7.  Optionally, run '`make check`' to check whether the compiled Ruby
+    interpreter works well. If you see the message "`check succeeded`", your
+    ruby works as it should (hopefully).
+
+8.  Run '`make install`'
+
+    This command will create following directories and install files onto
+    them.
+
+    *   `${DESTDIR}${prefix}/bin`
+    *   `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}`
+    *   `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
+    *   `${DESTDIR}${prefix}/lib`
+    *   `${DESTDIR}${prefix}/lib/ruby`
+    *   `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}`
+    *   `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
+    *   `${DESTDIR}${prefix}/lib/ruby/site_ruby`
+    *   `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}`
+    *   `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
+    *   `${DESTDIR}${prefix}/lib/ruby/vendor_ruby`
+    *   `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}`
+    *   `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
+    *   `${DESTDIR}${prefix}/lib/ruby/gems/${MAJOR}.${MINOR}.${TEENY}`
+    *   `${DESTDIR}${prefix}/share/man/man1`
+    *   `${DESTDIR}${prefix}/share/ri/${MAJOR}.${MINOR}.${TEENY}/system`
+
+
+    If Ruby's API version is '*x.y.z*', the `${MAJOR}` is '*x*', the
+    `${MINOR}` is '*y*', and the `${TEENY}` is '*z*'.
+
+    **NOTE**: teeny of the API version may be different from one of Ruby's
+    program version
+
+    You may have to be a super user to install ruby.
+
+
+If you fail to compile ruby, please send the detailed error report with the
+error log and machine/OS type, to help others.
+
+Some extension libraries may not get compiled because of lack of necessary
+external libraries and/or headers, then you will need to run '`make distclean-ext`'
+to remove old configuration after installing them in such case.
+
+## Copying
+
+See the file `COPYING`.
+
+## Feedback
+
+Questions about the Ruby language can be asked on the Ruby-Talk mailing list
+(http://www.ruby-lang.org/en/community/mailing-lists) or on websites like
+(http://stackoverflow.com).
+
+Bug reports should be filed at http://bugs.ruby-lang.org. Read [HowToReport] for more information.
+
+[HowToReport]: https://bugs.ruby-lang.org/projects/ruby/wiki/HowToReport
+
+##Contributing
+
+See the file `CONTRIBUTING.md`
+
+
+## The Author
+
+Ruby was originally designed and developed by Yukihiro Matsumoto (Matz) in
+1995.
+
+<mailto:matz@ruby-lang.org>
diff --git a/ToDo b/ToDo
deleted file mode 100644
index 1f18bb9241..0000000000
--- a/ToDo
+++ /dev/null
@@ -1,10 +0,0 @@
-* Process Class
-* ¥¯¥é¥¹¥é¥¤¥Ö¥é¥ê¤Î¸«Ä¾¤·(UNIX°Í¸¤ò¸º¤é¤¹)
-* formatµ¡Ç½
-* here document
-* perl¤Î¤è¤¦¤Êsetuid check
-* ŬÀÚ¤Êsignal handling
-* ruby¤ÇÄêµÁ¤¹¤ëÊÑ¿ôhook¤Î¼Â¸½
-* write debugger for ruby
-* re-write regex code for speed
-* byte code interpretor
diff --git a/aclocal.m4 b/aclocal.m4
new file mode 100644
index 0000000000..30fccd52fe
--- /dev/null
+++ b/aclocal.m4
@@ -0,0 +1,46 @@
+# -*- autoconf -*-
+
+AC_DEFUN([_COLORIZE_RESULT_PREPARE], [
+    msg_checking= msg_result_yes= msg_result_no= msg_result_other= msg_reset=
+    AS_IF([test "x${CONFIGURE_TTY}" = xyes -o -t 1], [
+	msg_begin="`tput smso 2>/dev/null`"
+    	AS_CASE(["$msg_begin"], ['@<:@'*m],
+	    [msg_begin="`echo "$msg_begin" | sed ['s/[0-9]*m$//']`"
+	    msg_checking="${msg_begin}33m"
+	    AS_IF([test ${TEST_COLORS:+set}], [
+		msg_result_yes=[`expr ":$TEST_COLORS:" : ".*:pass=\([^:]*\):"`]
+		msg_result_no=[`expr ":$TEST_COLORS:" : ".*:fail=\([^:]*\):"`]
+		msg_result_other=[`expr ":$TEST_COLORS:" : ".*:skip=\([^:]*\):"`]
+	    ])
+	    msg_result_yes="${msg_begin}${msg_result_yes:-32;1}m"
+	    msg_result_no="${msg_begin}${msg_result_no:-31;1}m"
+	    msg_result_other="${msg_begin}${msg_result_other:-33;1}m"
+	    msg_reset="${msg_begin}m"
+	    ])
+	AS_UNSET(msg_begin)
+	])
+    AS_REQUIRE_SHELL_FN([colorize_result],
+	[AS_FUNCTION_DESCRIBE([colorize_result], [MSG], [Colorize result])],
+        [AS_CASE(["$[]1"],
+            [yes], [AS_ECHO(["${msg_result_yes}$[]1${msg_reset}]")],
+            [no], [AS_ECHO(["${msg_result_no}$[]1${msg_reset}]")],
+            [AS_ECHO(["${msg_result_other}$[]1${msg_reset}]")])])
+])
+
+AC_DEFUN([COLORIZE_RESULT], [AC_REQUIRE([_COLORIZE_RESULT_PREPARE])dnl
+    AS_LITERAL_IF([$1],
+	[m4_case([$1],
+		[yes], [AS_ECHO(["${msg_result_yes}$1${msg_reset}"])],
+		[no], [AS_ECHO(["${msg_result_no}$1${msg_reset}"])],
+		[AS_ECHO(["${msg_result_other}$1${msg_reset}"])])],
+	[colorize_result "$1"]) dnl
+])
+
+AC_DEFUN([AC_CHECKING],[dnl
+AC_REQUIRE([_COLORIZE_RESULT_PREPARE])dnl
+AS_MESSAGE([checking ${msg_checking}$1${msg_reset}...])])
+
+AC_DEFUN([AC_MSG_RESULT], [dnl
+{ _AS_ECHO_LOG([result: $1])
+COLORIZE_RESULT([$1]); dnl
+}])
diff --git a/addr2line.c b/addr2line.c
new file mode 100644
index 0000000000..c8faf48d62
--- /dev/null
+++ b/addr2line.c
@@ -0,0 +1,1208 @@
+/**********************************************************************
+
+  addr2line.c -
+
+  $Author$
+
+  Copyright (C) 2010 Shinichiro Hamaji
+
+**********************************************************************/
+
+#include "ruby/config.h"
+#include "ruby/missing.h"
+#include "addr2line.h"
+
+#include <stdio.h>
+#include <errno.h>
+
+#ifdef USE_ELF
+
+#include <fcntl.h>
+#include <limits.h>
+#include <stdio.h>
+#include <stdint.h>
+#include <stdlib.h>
+#include <string.h>
+#include <sys/mman.h>
+#include <sys/types.h>
+#include <sys/stat.h>
+#include <unistd.h>
+
+#ifdef __OpenBSD__
+#include <elf_abi.h>
+#else
+#include <elf.h>
+#endif
+
+/* Make alloca work the best possible way.  */
+#ifdef __GNUC__
+# ifndef atarist
+#  ifndef alloca
+#   define alloca __builtin_alloca
+#  endif
+# endif	/* atarist */
+#else
+# ifdef HAVE_ALLOCA_H
+#  include <alloca.h>
+# else
+#  ifdef _AIX
+#pragma alloca
+#  else
+#   ifndef alloca		/* predefined by HP cc +Olibcalls */
+void *alloca();
+#   endif
+#  endif /* AIX */
+# endif	/* HAVE_ALLOCA_H */
+#endif /* __GNUC__ */
+
+#ifdef HAVE_DLADDR
+# include <dlfcn.h>
+#endif
+
+#define DW_LNS_copy                     0x01
+#define DW_LNS_advance_pc               0x02
+#define DW_LNS_advance_line             0x03
+#define DW_LNS_set_file                 0x04
+#define DW_LNS_set_column               0x05
+#define DW_LNS_negate_stmt              0x06
+#define DW_LNS_set_basic_block          0x07
+#define DW_LNS_const_add_pc             0x08
+#define DW_LNS_fixed_advance_pc         0x09
+#define DW_LNS_set_prologue_end         0x0a /* DWARF3 */
+#define DW_LNS_set_epilogue_begin       0x0b /* DWARF3 */
+#define DW_LNS_set_isa                  0x0c /* DWARF3 */
+
+/* Line number extended opcode name. */
+#define DW_LNE_end_sequence             0x01
+#define DW_LNE_set_address              0x02
+#define DW_LNE_define_file              0x03
+#define DW_LNE_set_discriminator        0x04  /* DWARF4 */
+
+#ifndef ElfW
+# if SIZEOF_VOIDP == 8
+#  define ElfW(x) Elf64##_##x
+# else
+#  define ElfW(x) Elf32##_##x
+# endif
+#endif
+#ifndef ELF_ST_TYPE
+# if SIZEOF_VOIDP == 8
+#  define ELF_ST_TYPE ELF64_ST_TYPE
+# else
+#  define ELF_ST_TYPE ELF32_ST_TYPE
+# endif
+#endif
+#ifndef PATH_MAX
+#define PATH_MAX 4096
+#endif
+
+int kprintf(const char *fmt, ...);
+
+typedef struct {
+    const char *dirname;
+    const char *filename;
+    const char *path; /* object path */
+    int line;
+
+    uintptr_t base_addr;
+    uintptr_t saddr;
+    const char *sname; /* function name */
+} line_info_t;
+typedef struct obj_info obj_info_t;
+struct obj_info {
+    const char *path; /* object path */
+    int fd;
+    void *mapped;
+    size_t mapped_size;
+    uintptr_t base_addr;
+    obj_info_t *next;
+};
+
+/* Avoid consuming stack as this module may be used from signal handler */
+static char binary_filename[PATH_MAX];
+
+static unsigned long
+uleb128(char **p)
+{
+    unsigned long r = 0;
+    int s = 0;
+    for (;;) {
+	unsigned char b = *(unsigned char *)(*p)++;
+	if (b < 0x80) {
+	    r += (unsigned long)b << s;
+	    break;
+	}
+	r += (b & 0x7f) << s;
+	s += 7;
+    }
+    return r;
+}
+
+static long
+sleb128(char **p)
+{
+    long r = 0;
+    int s = 0;
+    for (;;) {
+	unsigned char b = *(unsigned char *)(*p)++;
+	if (b < 0x80) {
+	    if (b & 0x40) {
+		r -= (0x80 - b) << s;
+	    }
+	    else {
+		r += (b & 0x3f) << s;
+	    }
+	    break;
+	}
+	r += (b & 0x7f) << s;
+	s += 7;
+    }
+    return r;
+}
+
+static const char *
+get_nth_dirname(unsigned long dir, char *p)
+{
+    if (!dir--) {
+	return "";
+    }
+    while (dir--) {
+	while (*p) p++;
+	p++;
+	if (!*p) {
+	    kprintf("Unexpected directory number %lu in %s\n",
+		    dir, binary_filename);
+	    return "";
+	}
+    }
+    return p;
+}
+
+static void
+fill_filename(int file, char *include_directories, char *filenames,
+	      line_info_t *line)
+{
+    int i;
+    char *p = filenames;
+    char *filename;
+    unsigned long dir;
+    for (i = 1; i <= file; i++) {
+	filename = p;
+	if (!*p) {
+	    /* Need to output binary file name? */
+	    kprintf("Unexpected file number %d in %s\n",
+		    file, binary_filename);
+	    return;
+	}
+	while (*p) p++;
+	p++;
+	dir = uleb128(&p);
+	/* last modified. */
+	uleb128(&p);
+	/* size of the file. */
+	uleb128(&p);
+
+	if (i == file) {
+	    line->filename = filename;
+	    line->dirname = get_nth_dirname(dir, include_directories);
+	}
+    }
+}
+
+static void
+fill_line(int num_traces, void **traces, uintptr_t addr, int file, int line,
+	  char *include_directories, char *filenames,
+	  obj_info_t *obj, line_info_t *lines, int offset)
+{
+    int i;
+    addr += obj->base_addr;
+    for (i = offset; i < num_traces; i++) {
+	uintptr_t a = (uintptr_t)traces[i];
+	/* We assume one line code doesn't result >100 bytes of native code.
+       We may want more reliable way eventually... */
+	if (addr < a && a < addr + 100) {
+	    fill_filename(file, include_directories, filenames, &lines[i]);
+	    lines[i].line = line;
+	}
+    }
+}
+
+static void
+parse_debug_line_cu(int num_traces, void **traces, char **debug_line,
+		obj_info_t *obj, line_info_t *lines, int offset)
+{
+    char *p, *cu_end, *cu_start, *include_directories, *filenames;
+    unsigned long unit_length;
+    int default_is_stmt, line_base;
+    unsigned int header_length, minimum_instruction_length, line_range,
+		 opcode_base;
+    /* unsigned char *standard_opcode_lengths; */
+
+    /* The registers. */
+    unsigned long addr = 0;
+    unsigned int file = 1;
+    unsigned int line = 1;
+    /* unsigned int column = 0; */
+    int is_stmt;
+    /* int basic_block = 0; */
+    /* int end_sequence = 0; */
+    /* int prologue_end = 0; */
+    /* int epilogue_begin = 0; */
+    /* unsigned int isa = 0; */
+
+    p = *debug_line;
+
+    unit_length = *(unsigned int *)p;
+    p += sizeof(unsigned int);
+    if (unit_length == 0xffffffff) {
+	unit_length = *(unsigned long *)p;
+	p += sizeof(unsigned long);
+    }
+
+    cu_end = p + unit_length;
+
+    /*dwarf_version = *(unsigned short *)p;*/
+    p += 2;
+
+    header_length = *(unsigned int *)p;
+    p += sizeof(unsigned int);
+
+    cu_start = p + header_length;
+
+    minimum_instruction_length = *(unsigned char *)p;
+    p++;
+
+    is_stmt = default_is_stmt = *(unsigned char *)p;
+    p++;
+
+    line_base = *(signed char *)p;
+    p++;
+
+    line_range = *(unsigned char *)p;
+    p++;
+
+    opcode_base = *(unsigned char *)p;
+    p++;
+
+    /* standard_opcode_lengths = (unsigned char *)p - 1; */
+    p += opcode_base - 1;
+
+    include_directories = p;
+
+    /* skip include directories */
+    while (*p) {
+	while (*p) p++;
+	p++;
+    }
+    p++;
+
+    filenames = p;
+
+    p = cu_start;
+
+#define FILL_LINE()						    \
+    do {							    \
+	fill_line(num_traces, traces, addr, file, line,		    \
+		  include_directories, filenames,		    \
+		  obj, lines, offset);				    \
+	/*basic_block = prologue_end = epilogue_begin = 0;*/	    \
+    } while (0)
+
+    while (p < cu_end) {
+	unsigned long a;
+	unsigned char op = *p++;
+	switch (op) {
+	case DW_LNS_copy:
+	    FILL_LINE();
+	    break;
+	case DW_LNS_advance_pc:
+	    a = uleb128(&p);
+	    addr += a;
+	    break;
+	case DW_LNS_advance_line: {
+	    long a = sleb128(&p);
+	    line += a;
+	    break;
+	}
+	case DW_LNS_set_file:
+	    file = (unsigned int)uleb128(&p);
+	    break;
+	case DW_LNS_set_column:
+	    /*column = (unsigned int)*/(void)uleb128(&p);
+	    break;
+	case DW_LNS_negate_stmt:
+	    is_stmt = !is_stmt;
+	    break;
+	case DW_LNS_set_basic_block:
+	    /*basic_block = 1; */
+	    break;
+	case DW_LNS_const_add_pc:
+	    a = ((255 - opcode_base) / line_range) *
+		minimum_instruction_length;
+	    addr += a;
+	    break;
+	case DW_LNS_fixed_advance_pc:
+	    a = *(unsigned char *)p++;
+	    addr += a;
+	    break;
+	case DW_LNS_set_prologue_end:
+	    /* prologue_end = 1; */
+	    break;
+	case DW_LNS_set_epilogue_begin:
+	    /* epilogue_begin = 1; */
+	    break;
+	case DW_LNS_set_isa:
+	    /* isa = (unsigned int)*/(void)uleb128(&p);
+	    break;
+	case 0:
+	    a = *(unsigned char *)p++;
+	    op = *p++;
+	    switch (op) {
+	    case DW_LNE_end_sequence:
+		/* end_sequence = 1; */
+		FILL_LINE();
+		addr = 0;
+		file = 1;
+		line = 1;
+		/* column = 0; */
+		is_stmt = default_is_stmt;
+		/* end_sequence = 0; */
+		/* isa = 0; */
+		break;
+	    case DW_LNE_set_address:
+		addr = *(unsigned long *)p;
+		p += sizeof(unsigned long);
+		break;
+	    case DW_LNE_define_file:
+		kprintf("Unsupported operation in %s\n",
+			binary_filename);
+		break;
+	    case DW_LNE_set_discriminator:
+		/* TODO:currently ignore */
+		uleb128(&p);
+		break;
+	    default:
+		kprintf("Unknown extended opcode: %d in %s\n",
+			op, binary_filename);
+	    }
+	    break;
+	default: {
+	    unsigned long addr_incr;
+	    unsigned long line_incr;
+	    a = op - opcode_base;
+	    addr_incr = (a / line_range) * minimum_instruction_length;
+	    line_incr = line_base + (a % line_range);
+	    addr += (unsigned int)addr_incr;
+	    line += (unsigned int)line_incr;
+	    FILL_LINE();
+	}
+	}
+    }
+    *debug_line = p;
+}
+
+static void
+parse_debug_line(int num_traces, void **traces,
+		 char *debug_line, unsigned long size,
+		 obj_info_t *obj, line_info_t *lines, int offset)
+{
+    char *debug_line_end = debug_line + size;
+    while (debug_line < debug_line_end) {
+	parse_debug_line_cu(num_traces, traces, &debug_line, obj, lines, offset);
+    }
+    if (debug_line != debug_line_end) {
+	kprintf("Unexpected size of .debug_line in %s\n",
+		binary_filename);
+    }
+}
+
+/* read file and fill lines */
+static uintptr_t
+fill_lines(int num_traces, void **traces, int check_debuglink,
+	   obj_info_t **objp, line_info_t *lines, int offset);
+
+static void
+append_obj(obj_info_t **objp) {
+    obj_info_t *newobj = calloc(1, sizeof(obj_info_t));
+    if (*objp) (*objp)->next = newobj;
+    *objp = newobj;
+}
+
+static void
+follow_debuglink(char *debuglink, int num_traces, void **traces,
+		 obj_info_t **objp, line_info_t *lines, int offset)
+{
+    /* Ideally we should check 4 paths to follow gnu_debuglink,
+       but we handle only one case for now as this format is used
+       by some linux distributions. See GDB's info for detail. */
+    static const char global_debug_dir[] = "/usr/lib/debug";
+    char *p, *subdir;
+    obj_info_t *o1 = *objp, *o2;
+
+    p = strrchr(binary_filename, '/');
+    if (!p) {
+	return;
+    }
+    p[1] = '\0';
+
+    subdir = (char *)alloca(strlen(binary_filename) + 1);
+    strcpy(subdir, binary_filename);
+    strcpy(binary_filename, global_debug_dir);
+    strlcat(binary_filename, subdir, PATH_MAX);
+    strlcat(binary_filename, debuglink, PATH_MAX);
+
+    append_obj(objp);
+    o2 = *objp;
+    o2->base_addr = o1->base_addr;
+    o2->path = o1->path;
+    fill_lines(num_traces, traces, 0, objp, lines, offset);
+}
+
+/* read file and fill lines */
+static uintptr_t
+fill_lines(int num_traces, void **traces, int check_debuglink,
+	   obj_info_t **objp, line_info_t *lines, int offset)
+{
+    int i, j;
+    char *shstr;
+    char *section_name;
+    ElfW(Ehdr) *ehdr;
+    ElfW(Shdr) *shdr, *shstr_shdr;
+    ElfW(Shdr) *debug_line_shdr = NULL, *gnu_debuglink_shdr = NULL;
+    int fd;
+    off_t filesize;
+    char *file;
+    ElfW(Shdr) *symtab_shdr = NULL, *strtab_shdr = NULL;
+    ElfW(Shdr) *dynsym_shdr = NULL, *dynstr_shdr = NULL;
+    obj_info_t *obj = *objp;
+    uintptr_t dladdr_fbase = 0;
+
+    fd = open(binary_filename, O_RDONLY);
+    if (fd < 0) {
+	goto fail;
+    }
+    filesize = lseek(fd, 0, SEEK_END);
+    if (filesize < 0) {
+	int e = errno;
+	close(fd);
+	kprintf("lseek: %s\n", strerror(e));
+	goto fail;
+    }
+#if SIZEOF_OFF_T > SIZEOF_SIZE_T
+    if (filesize > (off_t)SIZE_MAX) {
+	close(fd);
+	kprintf("Too large file %s\n", binary_filename);
+	goto fail;
+    }
+#endif
+    lseek(fd, 0, SEEK_SET);
+    /* async-signal unsafe */
+    file = (char *)mmap(NULL, (size_t)filesize, PROT_READ, MAP_SHARED, fd, 0);
+    if (file == MAP_FAILED) {
+	int e = errno;
+	close(fd);
+	kprintf("mmap: %s\n", strerror(e));
+	goto fail;
+    }
+
+    ehdr = (ElfW(Ehdr) *)file;
+    if (memcmp(ehdr->e_ident, "\177ELF", 4) != 0) {
+	/*
+	 * Huh? Maybe filename was overridden by setproctitle() and
+	 * it match non-elf file.
+	 */
+	close(fd);
+	goto fail;
+    }
+
+    obj->fd = fd;
+    obj->mapped = file;
+    obj->mapped_size = (size_t)filesize;
+
+    shdr = (ElfW(Shdr) *)(file + ehdr->e_shoff);
+
+    shstr_shdr = shdr + ehdr->e_shstrndx;
+    shstr = file + shstr_shdr->sh_offset;
+
+    for (i = 0; i < ehdr->e_shnum; i++) {
+	section_name = shstr + shdr[i].sh_name;
+	switch (shdr[i].sh_type) {
+	  case SHT_STRTAB:
+	    if (!strcmp(section_name, ".strtab")) {
+		strtab_shdr = shdr + i;
+	    }
+	    else if (!strcmp(section_name, ".dynstr")) {
+		dynstr_shdr = shdr + i;
+	    }
+	    break;
+	  case SHT_SYMTAB:
+	    /* if (!strcmp(section_name, ".symtab")) */
+	    symtab_shdr = shdr + i;
+	    break;
+	  case SHT_DYNSYM:
+	    /* if (!strcmp(section_name, ".dynsym")) */
+	    dynsym_shdr = shdr + i;
+	    break;
+	  case SHT_PROGBITS:
+	    if (!strcmp(section_name, ".debug_line")) {
+		debug_line_shdr = shdr + i;
+	    }
+	    else if (!strcmp(section_name, ".gnu_debuglink")) {
+		gnu_debuglink_shdr = shdr + i;
+	    }
+	    break;
+	}
+    }
+
+    if (offset == -1) {
+	/* main executable */
+	offset = 0;
+	if (dynsym_shdr && dynstr_shdr) {
+	    char *strtab = file + dynstr_shdr->sh_offset;
+	    ElfW(Sym) *symtab = (ElfW(Sym) *)(file + dynsym_shdr->sh_offset);
+	    int symtab_count = (int)(dynsym_shdr->sh_size / sizeof(ElfW(Sym)));
+	    for (j = 0; j < symtab_count; j++) {
+		ElfW(Sym) *sym = &symtab[j];
+		Dl_info info;
+		void *h, *s;
+		if (ELF_ST_TYPE(sym->st_info) != STT_FUNC || sym->st_size <= 0) continue;
+		h = dlopen(NULL, RTLD_NOW|RTLD_LOCAL);
+		if (!h) continue;
+		s = dlsym(h, strtab + sym->st_name);
+		if (!s) continue;
+		if (dladdr(s, &info)) {
+		    dladdr_fbase = (uintptr_t)info.dli_fbase;
+		    break;
+		}
+	    }
+	    if (ehdr->e_type == ET_EXEC) {
+		obj->base_addr = 0;
+	    }
+	    else {
+		/* PIE (position-independent executable) */
+		obj->base_addr = dladdr_fbase;
+	    }
+	}
+    }
+
+    if (!symtab_shdr) {
+	symtab_shdr = dynsym_shdr;
+	strtab_shdr = dynstr_shdr;
+    }
+
+    if (symtab_shdr && strtab_shdr) {
+	char *strtab = file + strtab_shdr->sh_offset;
+	ElfW(Sym) *symtab = (ElfW(Sym) *)(file + symtab_shdr->sh_offset);
+	int symtab_count = (int)(symtab_shdr->sh_size / sizeof(ElfW(Sym)));
+	for (j = 0; j < symtab_count; j++) {
+	    ElfW(Sym) *sym = &symtab[j];
+	    uintptr_t saddr = (uintptr_t)sym->st_value + obj->base_addr;
+	    if (ELF_ST_TYPE(sym->st_info) != STT_FUNC || sym->st_size <= 0) continue;
+	    for (i = offset; i < num_traces; i++) {
+		uintptr_t d = (uintptr_t)traces[i] - saddr;
+		if (lines[i].line > 0 || d <= 0 || d > (uintptr_t)sym->st_size)
+		    continue;
+		/* fill symbol name and addr from .symtab */
+		lines[i].sname = strtab + sym->st_name;
+		lines[i].saddr = saddr;
+		lines[i].path  = obj->path;
+		lines[i].base_addr = obj->base_addr;
+	    }
+	}
+    }
+
+    if (!debug_line_shdr) {
+	/* This file doesn't have .debug_line section,
+	   let's check .gnu_debuglink section instead. */
+	if (gnu_debuglink_shdr && check_debuglink) {
+	    follow_debuglink(file + gnu_debuglink_shdr->sh_offset,
+			     num_traces, traces,
+			     objp, lines, offset);
+	}
+	goto finish;
+    }
+
+    parse_debug_line(num_traces, traces,
+		     file + debug_line_shdr->sh_offset,
+		     debug_line_shdr->sh_size,
+		     obj, lines, offset);
+finish:
+    return dladdr_fbase;
+fail:
+    return (uintptr_t)-1;
+}
+
+#define HAVE_MAIN_EXE_PATH
+#if defined(__FreeBSD__)
+# include <sys/sysctl.h>
+#endif
+/* ssize_t main_exe_path(void)
+ *
+ * store the path of the main executable to `binary_filename`,
+ * and returns strlen(binary_filename).
+ * it is NUL terminated.
+ */
+#if defined(__linux__)
+ssize_t
+main_exe_path(void)
+{
+# define PROC_SELF_EXE "/proc/self/exe"
+    ssize_t len = readlink(PROC_SELF_EXE, binary_filename, PATH_MAX);
+    binary_filename[len] = 0;
+    return len;
+}
+#elif defined(__FreeBSD__)
+ssize_t
+main_exe_path(void)
+{
+    int mib[4] = {CTL_KERN, KERN_PROC, KERN_PROC_PATHNAME, -1};
+    size_t len = PATH_MAX;
+    int err = sysctl(mib, 4, binary_filename, &len, NULL, 0);
+    if (err) {
+	kprintf("Can't get the path of ruby");
+	return -1;
+    }
+    len--; /* sysctl sets strlen+1 */
+    return len;
+}
+#else
+#undef HAVE_MAIN_EXE_PATH
+#endif
+
+void
+rb_dump_backtrace_with_lines(int num_traces, void **traces)
+{
+    int i;
+    /* async-signal unsafe */
+    line_info_t *lines = (line_info_t *)calloc(num_traces, sizeof(line_info_t));
+    obj_info_t *obj = NULL;
+    /* 2 is NULL + main executable */
+    void **dladdr_fbases = (void **)calloc(num_traces+2, sizeof(void *));
+#ifdef HAVE_MAIN_EXE_PATH
+    char *main_path = NULL; /* used on printing backtrace */
+    ssize_t len;
+    if ((len = main_exe_path()) > 0) {
+	main_path = (char *)alloca(len + 1);
+	if (main_path) {
+	    uintptr_t addr;
+	    memcpy(main_path, binary_filename, len+1);
+	    append_obj(&obj);
+	    obj->path = main_path;
+	    addr = fill_lines(num_traces, traces, 1, &obj, lines, -1);
+	    if (addr != (uintptr_t)-1) {
+		dladdr_fbases[0] = (void *)addr;
+	    }
+	}
+    }
+#endif
+
+    /* fill source lines by reading dwarf */
+    for (i = 0; i < num_traces; i++) {
+	Dl_info info;
+	if (lines[i].line) continue;
+	if (dladdr(traces[i], &info)) {
+	    const char *path;
+	    void **p;
+
+	    /* skip symbols which is in already checked objects */
+	    /* if the binary is strip-ed, this may effect */
+	    for (p=dladdr_fbases; *p; p++) {
+		if (*p == info.dli_fbase) {
+		    lines[i].path = info.dli_fname;
+		    lines[i].sname = info.dli_sname;
+		    goto next_line;
+		}
+	    }
+	    *p = info.dli_fbase;
+
+	    append_obj(&obj);
+	    obj->base_addr = (uintptr_t)info.dli_fbase;
+	    path = info.dli_fname;
+	    obj->path = path;
+	    lines[i].path = path;
+	    strcpy(binary_filename, path);
+	    fill_lines(num_traces, traces, 1, &obj, lines, i);
+	}
+next_line:
+	continue;
+    }
+
+    /* output */
+    for (i = 0; i < num_traces; i++) {
+	line_info_t *line = &lines[i];
+	uintptr_t addr = (uintptr_t)traces[i];
+	uintptr_t d = addr - line->saddr;
+	if (!line->path) {
+	    kprintf("[0x%lx]\n", addr);
+	}
+	else if (!line->saddr || !line->sname) {
+	    kprintf("%s [0x%lx]\n", line->path, addr);
+	}
+	else if (line->line <= 0) {
+	    kprintf("%s(%s+0x%lx) [0x%lx]\n", line->path, line->sname,
+		    d, addr);
+	}
+	else if (!line->filename) {
+	    kprintf("%s(%s+0x%lx) [0x%lx] ???:%d\n", line->path, line->sname,
+		    d, addr, line->line);
+	}
+	else if (line->dirname && line->dirname[0]) {
+	    kprintf("%s(%s+0x%lx) [0x%lx] %s/%s:%d\n", line->path, line->sname,
+		    d, addr, line->dirname, line->filename, line->line);
+	}
+	else {
+	    kprintf("%s(%s+0x%lx) [0x%lx] %s:%d\n", line->path, line->sname,
+		    d, addr, line->filename, line->line);
+	}
+	/* FreeBSD's backtrace may show _start and so on */
+	if (line->sname && strcmp("main", line->sname) == 0)
+	    break;
+    }
+
+    /* free */
+    while (obj) {
+	obj_info_t *o = obj;
+	obj = o->next;
+	if (o->fd) {
+	    munmap(o->mapped, o->mapped_size);
+	    close(o->fd);
+	}
+	free(o);
+    }
+    free(lines);
+    free(dladdr_fbases);
+}
+
+/* From FreeBSD's lib/libstand/printf.c */
+/*-
+ * Copyright (c) 1986, 1988, 1991, 1993
+ *	The Regents of the University of California.  All rights reserved.
+ * (c) UNIX System Laboratories, Inc.
+ * All or some portions of this file are derived from material licensed
+ * to the University of California by American Telephone and Telegraph
+ * Co. or Unix System Laboratories, Inc. and are reproduced herein with
+ * the permission of UNIX System Laboratories, Inc.
+ *
+ * Redistribution and use in source and binary forms, with or without
+ * modification, are permitted provided that the following conditions
+ * are met:
+ * 1. Redistributions of source code must retain the above copyright
+ *    notice, this list of conditions and the following disclaimer.
+ * 2. Redistributions in binary form must reproduce the above copyright
+ *    notice, this list of conditions and the following disclaimer in the
+ *    documentation and/or other materials provided with the distribution.
+ * 4. Neither the name of the University nor the names of its contributors
+ *    may be used to endorse or promote products derived from this software
+ *    without specific prior written permission.
+ *
+ * THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
+ * ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ * ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
+ * FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
+ * DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
+ * OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
+ * HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
+ * LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
+ * OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
+ * SUCH DAMAGE.
+ *
+ *	@(#)subr_prf.c	8.3 (Berkeley) 1/21/94
+ */
+
+#include <stdarg.h>
+#define MAXNBUF (sizeof(intmax_t) * CHAR_BIT + 1)
+extern int rb_toupper(int c);
+#define    toupper(c)  rb_toupper(c)
+#define    hex2ascii(hex)  (hex2ascii_data[hex])
+char const hex2ascii_data[] = "0123456789abcdefghijklmnopqrstuvwxyz";
+static inline int imax(int a, int b) { return (a > b ? a : b); }
+static int kvprintf(char const *fmt, void (*func)(int), void *arg, int radix, va_list ap);
+
+static void putce(int c)
+{
+    char s[1];
+    ssize_t ret;
+
+    s[0] = (char)c;
+    ret = write(2, s, 1);
+    (void)ret;
+}
+
+int
+kprintf(const char *fmt, ...)
+{
+	va_list ap;
+	int retval;
+
+	va_start(ap, fmt);
+	retval = kvprintf(fmt, putce, NULL, 10, ap);
+	va_end(ap);
+	return retval;
+}
+
+/*
+ * Put a NUL-terminated ASCII number (base <= 36) in a buffer in reverse
+ * order; return an optional length and a pointer to the last character
+ * written in the buffer (i.e., the first character of the string).
+ * The buffer pointed to by `nbuf' must have length >= MAXNBUF.
+ */
+static char *
+ksprintn(char *nbuf, uintmax_t num, int base, int *lenp, int upper)
+{
+	char *p, c;
+
+	p = nbuf;
+	*p = '\0';
+	do {
+		c = hex2ascii(num % base);
+		*++p = upper ? toupper(c) : c;
+	} while (num /= base);
+	if (lenp)
+		*lenp = (int)(p - nbuf);
+	return (p);
+}
+
+/*
+ * Scaled down version of printf(3).
+ *
+ * Two additional formats:
+ *
+ * The format %b is supported to decode error registers.
+ * Its usage is:
+ *
+ *	printf("reg=%b\n", regval, "<base><arg>*");
+ *
+ * where <base> is the output base expressed as a control character, e.g.
+ * \10 gives octal; \20 gives hex.  Each arg is a sequence of characters,
+ * the first of which gives the bit number to be inspected (origin 1), and
+ * the next characters (up to a control character, i.e. a character <= 32),
+ * give the name of the register.  Thus:
+ *
+ *	kvprintf("reg=%b\n", 3, "\10\2BITTWO\1BITONE\n");
+ *
+ * would produce output:
+ *
+ *	reg=3<BITTWO,BITONE>
+ *
+ * XXX:  %D  -- Hexdump, takes pointer and separator string:
+ *		("%6D", ptr, ":")   -> XX:XX:XX:XX:XX:XX
+ *		("%*D", len, ptr, " " -> XX XX XX XX ...
+ */
+static int
+kvprintf(char const *fmt, void (*func)(int), void *arg, int radix, va_list ap)
+{
+#define PCHAR(c) {int cc=(c); if (func) (*func)(cc); else *d++ = cc; retval++; }
+	char nbuf[MAXNBUF];
+	char *d;
+	const char *p, *percent, *q;
+	unsigned char *up;
+	int ch, n;
+	uintmax_t num;
+	int base, lflag, qflag, tmp, width, ladjust, sharpflag, neg, sign, dot;
+	int cflag, hflag, jflag, tflag, zflag;
+	int dwidth, upper;
+	char padc;
+	int stop = 0, retval = 0;
+
+	num = 0;
+	if (!func)
+		d = (char *) arg;
+	else
+		d = NULL;
+
+	if (fmt == NULL)
+		fmt = "(fmt null)\n";
+
+	if (radix < 2 || radix > 36)
+		radix = 10;
+
+	for (;;) {
+		padc = ' ';
+		width = 0;
+		while ((ch = (unsigned char)*fmt++) != '%' || stop) {
+			if (ch == '\0')
+				return (retval);
+			PCHAR(ch);
+		}
+		percent = fmt - 1;
+		qflag = 0; lflag = 0; ladjust = 0; sharpflag = 0; neg = 0;
+		sign = 0; dot = 0; dwidth = 0; upper = 0;
+		cflag = 0; hflag = 0; jflag = 0; tflag = 0; zflag = 0;
+reswitch:	switch (ch = (unsigned char)*fmt++) {
+		case '.':
+			dot = 1;
+			goto reswitch;
+		case '#':
+			sharpflag = 1;
+			goto reswitch;
+		case '+':
+			sign = 1;
+			goto reswitch;
+		case '-':
+			ladjust = 1;
+			goto reswitch;
+		case '%':
+			PCHAR(ch);
+			break;
+		case '*':
+			if (!dot) {
+				width = va_arg(ap, int);
+				if (width < 0) {
+					ladjust = !ladjust;
+					width = -width;
+				}
+			} else {
+				dwidth = va_arg(ap, int);
+			}
+			goto reswitch;
+		case '0':
+			if (!dot) {
+				padc = '0';
+				goto reswitch;
+			}
+		case '1': case '2': case '3': case '4':
+		case '5': case '6': case '7': case '8': case '9':
+				for (n = 0;; ++fmt) {
+					n = n * 10 + ch - '0';
+					ch = *fmt;
+					if (ch < '0' || ch > '9')
+						break;
+				}
+			if (dot)
+				dwidth = n;
+			else
+				width = n;
+			goto reswitch;
+		case 'b':
+			num = (unsigned int)va_arg(ap, int);
+			p = va_arg(ap, char *);
+			for (q = ksprintn(nbuf, num, *p++, NULL, 0); *q;)
+				PCHAR(*q--);
+
+			if (num == 0)
+				break;
+
+			for (tmp = 0; *p;) {
+				n = *p++;
+				if (num & (1 << (n - 1))) {
+					PCHAR(tmp ? ',' : '<');
+					for (; (n = *p) > ' '; ++p)
+						PCHAR(n);
+					tmp = 1;
+				} else
+					for (; *p > ' '; ++p)
+						continue;
+			}
+			if (tmp)
+				PCHAR('>');
+			break;
+		case 'c':
+			PCHAR(va_arg(ap, int));
+			break;
+		case 'D':
+			up = va_arg(ap, unsigned char *);
+			p = va_arg(ap, char *);
+			if (!width)
+				width = 16;
+			while(width--) {
+				PCHAR(hex2ascii(*up >> 4));
+				PCHAR(hex2ascii(*up & 0x0f));
+				up++;
+				if (width)
+					for (q=p;*q;q++)
+						PCHAR(*q);
+			}
+			break;
+		case 'd':
+		case 'i':
+			base = 10;
+			sign = 1;
+			goto handle_sign;
+		case 'h':
+			if (hflag) {
+				hflag = 0;
+				cflag = 1;
+			} else
+				hflag = 1;
+			goto reswitch;
+		case 'j':
+			jflag = 1;
+			goto reswitch;
+		case 'l':
+			if (lflag) {
+				lflag = 0;
+				qflag = 1;
+			} else
+				lflag = 1;
+			goto reswitch;
+		case 'n':
+			if (jflag)
+				*(va_arg(ap, intmax_t *)) = retval;
+			else if (qflag)
+				*(va_arg(ap, int64_t *)) = retval;
+			else if (lflag)
+				*(va_arg(ap, long *)) = retval;
+			else if (zflag)
+				*(va_arg(ap, size_t *)) = retval;
+			else if (hflag)
+				*(va_arg(ap, short *)) = retval;
+			else if (cflag)
+				*(va_arg(ap, char *)) = retval;
+			else
+				*(va_arg(ap, int *)) = retval;
+			break;
+		case 'o':
+			base = 8;
+			goto handle_nosign;
+		case 'p':
+			base = 16;
+			sharpflag = (width == 0);
+			sign = 0;
+			num = (uintptr_t)va_arg(ap, void *);
+			goto number;
+		case 'q':
+			qflag = 1;
+			goto reswitch;
+		case 'r':
+			base = radix;
+			if (sign)
+				goto handle_sign;
+			goto handle_nosign;
+		case 's':
+			p = va_arg(ap, char *);
+			if (p == NULL)
+				p = "(null)";
+			if (!dot)
+				n = (int)strlen (p);
+			else
+				for (n = 0; n < dwidth && p[n]; n++)
+					continue;
+
+			width -= n;
+
+			if (!ladjust && width > 0)
+				while (width--)
+					PCHAR(padc);
+			while (n--)
+				PCHAR(*p++);
+			if (ladjust && width > 0)
+				while (width--)
+					PCHAR(padc);
+			break;
+		case 't':
+			tflag = 1;
+			goto reswitch;
+		case 'u':
+			base = 10;
+			goto handle_nosign;
+		case 'X':
+			upper = 1;
+		case 'x':
+			base = 16;
+			goto handle_nosign;
+		case 'y':
+			base = 16;
+			sign = 1;
+			goto handle_sign;
+		case 'z':
+			zflag = 1;
+			goto reswitch;
+handle_nosign:
+			sign = 0;
+			if (jflag)
+				num = va_arg(ap, uintmax_t);
+			else if (qflag)
+				num = va_arg(ap, uint64_t);
+			else if (tflag)
+				num = va_arg(ap, ptrdiff_t);
+			else if (lflag)
+				num = va_arg(ap, unsigned long);
+			else if (zflag)
+				num = va_arg(ap, size_t);
+			else if (hflag)
+				num = (unsigned short)va_arg(ap, int);
+			else if (cflag)
+				num = (unsigned char)va_arg(ap, int);
+			else
+				num = va_arg(ap, unsigned int);
+			goto number;
+handle_sign:
+			if (jflag)
+				num = va_arg(ap, intmax_t);
+			else if (qflag)
+				num = va_arg(ap, int64_t);
+			else if (tflag)
+				num = va_arg(ap, ptrdiff_t);
+			else if (lflag)
+				num = va_arg(ap, long);
+			else if (zflag)
+				num = va_arg(ap, ssize_t);
+			else if (hflag)
+				num = (short)va_arg(ap, int);
+			else if (cflag)
+				num = (char)va_arg(ap, int);
+			else
+				num = va_arg(ap, int);
+number:
+			if (sign && (intmax_t)num < 0) {
+				neg = 1;
+				num = -(intmax_t)num;
+			}
+			p = ksprintn(nbuf, num, base, &n, upper);
+			tmp = 0;
+			if (sharpflag && num != 0) {
+				if (base == 8)
+					tmp++;
+				else if (base == 16)
+					tmp += 2;
+			}
+			if (neg)
+				tmp++;
+
+			if (!ladjust && padc == '0')
+				dwidth = width - tmp;
+			width -= tmp + imax(dwidth, n);
+			dwidth -= n;
+			if (!ladjust)
+				while (width-- > 0)
+					PCHAR(' ');
+			if (neg)
+				PCHAR('-');
+			if (sharpflag && num != 0) {
+				if (base == 8) {
+					PCHAR('0');
+				} else if (base == 16) {
+					PCHAR('0');
+					PCHAR('x');
+				}
+			}
+			while (dwidth-- > 0)
+				PCHAR('0');
+
+			while (*p)
+				PCHAR(*p--);
+
+			if (ladjust)
+				while (width-- > 0)
+					PCHAR(' ');
+
+			break;
+		default:
+			while (percent < fmt)
+				PCHAR(*percent++);
+			/*
+			 * Since we ignore an formatting argument it is no
+			 * longer safe to obey the remaining formatting
+			 * arguments as the arguments will no longer match
+			 * the format specs.
+			 */
+			stop = 1;
+			break;
+		}
+	}
+#undef PCHAR
+}
+#else /* defined(USE_ELF) */
+#error not supported
+#endif
diff --git a/addr2line.h b/addr2line.h
new file mode 100644
index 0000000000..d99f010934
--- /dev/null
+++ b/addr2line.h
@@ -0,0 +1,21 @@
+/**********************************************************************
+
+  addr2line.h -
+
+  $Author$
+
+  Copyright (C) 2010 Shinichiro Hamaji
+
+**********************************************************************/
+
+#ifndef RUBY_ADDR2LINE_H
+#define RUBY_ADDR2LINE_H
+
+#ifdef USE_ELF
+
+void
+rb_dump_backtrace_with_lines(int num_traces, void **traces);
+
+#endif /* USE_ELF */
+
+#endif /* RUBY_ADDR2LINE_H */
diff --git a/array.c b/array.c
index 05bb79704d..de81ee7fab 100644
--- a/array.c
+++ b/array.c
@@ -1,990 +1,5920 @@
-/************************************************
+/**********************************************************************
 
   array.c -
 
-  $Author: matz $
-  $Date: 1995/01/10 10:42:18 $
+  $Author$
   created at: Fri Aug  6 09:46:12 JST 1993
 
-  Copyright (C) 1993-1995 Yukihiro Matsumoto
+  Copyright (C) 1993-2007 Yukihiro Matsumoto
+  Copyright (C) 2000  Network Applied Communication Laboratory, Inc.
+  Copyright (C) 2000  Information-technology Promotion Agency, Japan
 
-************************************************/
+**********************************************************************/
 
-#include "ruby.h"
+#include "internal.h"
+#include "ruby/util.h"
+#include "ruby/st.h"
+#include "probes.h"
+#include "id.h"
 
-VALUE C_Array;
+#ifndef ARRAY_DEBUG
+# define NDEBUG
+#endif
+#include <assert.h>
 
-VALUE rb_to_a();
+VALUE rb_cArray;
+
+static ID id_cmp, id_div, id_power;
 
 #define ARY_DEFAULT_SIZE 16
+#define ARY_MAX_SIZE (LONG_MAX / (int)sizeof(VALUE))
+
+# define ARY_SHARED_P(ary) \
+    (assert(!FL_TEST((ary), ELTS_SHARED) || !FL_TEST((ary), RARRAY_EMBED_FLAG)), \
+     FL_TEST((ary),ELTS_SHARED)!=0)
+# define ARY_EMBED_P(ary) \
+    (assert(!FL_TEST((ary), ELTS_SHARED) || !FL_TEST((ary), RARRAY_EMBED_FLAG)), \
+     FL_TEST((ary), RARRAY_EMBED_FLAG)!=0)
+
+#define ARY_HEAP_PTR(a) (assert(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.ptr)
+#define ARY_HEAP_LEN(a) (assert(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.len)
+#define ARY_EMBED_PTR(a) (assert(ARY_EMBED_P(a)), RARRAY(a)->as.ary)
+#define ARY_EMBED_LEN(a) \
+    (assert(ARY_EMBED_P(a)), \
+     (long)((RBASIC(a)->flags >> RARRAY_EMBED_LEN_SHIFT) & \
+	 (RARRAY_EMBED_LEN_MASK >> RARRAY_EMBED_LEN_SHIFT)))
+#define ARY_HEAP_SIZE(a) (assert(!ARY_EMBED_P(a)), assert(ARY_OWNS_HEAP_P(a)), RARRAY(a)->as.heap.aux.capa * sizeof(VALUE))
+
+#define ARY_OWNS_HEAP_P(a) (!FL_TEST((a), ELTS_SHARED|RARRAY_EMBED_FLAG))
+#define FL_SET_EMBED(a) do { \
+    assert(!ARY_SHARED_P(a)); \
+    FL_SET((a), RARRAY_EMBED_FLAG); \
+} while (0)
+#define FL_UNSET_EMBED(ary) FL_UNSET((ary), RARRAY_EMBED_FLAG|RARRAY_EMBED_LEN_MASK)
+#define FL_SET_SHARED(ary) do { \
+    assert(!ARY_EMBED_P(ary)); \
+    FL_SET((ary), ELTS_SHARED); \
+} while (0)
+#define FL_UNSET_SHARED(ary) FL_UNSET((ary), ELTS_SHARED)
+
+#define ARY_SET_PTR(ary, p) do { \
+    assert(!ARY_EMBED_P(ary)); \
+    assert(!OBJ_FROZEN(ary)); \
+    RARRAY(ary)->as.heap.ptr = (p); \
+} while (0)
+#define ARY_SET_EMBED_LEN(ary, n) do { \
+    long tmp_n = (n); \
+    assert(ARY_EMBED_P(ary)); \
+    assert(!OBJ_FROZEN(ary)); \
+    RBASIC(ary)->flags &= ~RARRAY_EMBED_LEN_MASK; \
+    RBASIC(ary)->flags |= (tmp_n) << RARRAY_EMBED_LEN_SHIFT; \
+} while (0)
+#define ARY_SET_HEAP_LEN(ary, n) do { \
+    assert(!ARY_EMBED_P(ary)); \
+    RARRAY(ary)->as.heap.len = (n); \
+} while (0)
+#define ARY_SET_LEN(ary, n) do { \
+    if (ARY_EMBED_P(ary)) { \
+        ARY_SET_EMBED_LEN((ary), (n)); \
+    } \
+    else { \
+        ARY_SET_HEAP_LEN((ary), (n)); \
+    } \
+    assert(RARRAY_LEN(ary) == (n)); \
+} while (0)
+#define ARY_INCREASE_PTR(ary, n) do  { \
+    assert(!ARY_EMBED_P(ary)); \
+    assert(!OBJ_FROZEN(ary)); \
+    RARRAY(ary)->as.heap.ptr += (n); \
+} while (0)
+#define ARY_INCREASE_LEN(ary, n) do  { \
+    assert(!OBJ_FROZEN(ary)); \
+    if (ARY_EMBED_P(ary)) { \
+        ARY_SET_EMBED_LEN((ary), RARRAY_LEN(ary)+(n)); \
+    } \
+    else { \
+        RARRAY(ary)->as.heap.len += (n); \
+    } \
+} while (0)
+
+#define ARY_CAPA(ary) (ARY_EMBED_P(ary) ? RARRAY_EMBED_LEN_MAX : \
+		       ARY_SHARED_ROOT_P(ary) ? RARRAY_LEN(ary) : RARRAY(ary)->as.heap.aux.capa)
+#define ARY_SET_CAPA(ary, n) do { \
+    assert(!ARY_EMBED_P(ary)); \
+    assert(!ARY_SHARED_P(ary)); \
+    assert(!OBJ_FROZEN(ary)); \
+    RARRAY(ary)->as.heap.aux.capa = (n); \
+} while (0)
+
+#define ARY_SHARED(ary) (assert(ARY_SHARED_P(ary)), RARRAY(ary)->as.heap.aux.shared)
+#define ARY_SET_SHARED(ary, value) do { \
+    const VALUE _ary_ = (ary); \
+    const VALUE _value_ = (value); \
+    assert(!ARY_EMBED_P(_ary_)); \
+    assert(ARY_SHARED_P(_ary_)); \
+    assert(ARY_SHARED_ROOT_P(_value_)); \
+    RB_OBJ_WRITE(_ary_, &RARRAY(_ary_)->as.heap.aux.shared, _value_); \
+} while (0)
+#define RARRAY_SHARED_ROOT_FLAG FL_USER5
+#define ARY_SHARED_ROOT_P(ary) (FL_TEST((ary), RARRAY_SHARED_ROOT_FLAG))
+#define ARY_SHARED_NUM(ary) \
+    (assert(ARY_SHARED_ROOT_P(ary)), RARRAY(ary)->as.heap.aux.capa)
+#define ARY_SHARED_OCCUPIED(ary) (ARY_SHARED_NUM(ary) == 1)
+#define ARY_SET_SHARED_NUM(ary, value) do { \
+    assert(ARY_SHARED_ROOT_P(ary)); \
+    RARRAY(ary)->as.heap.aux.capa = (value); \
+} while (0)
+#define FL_SET_SHARED_ROOT(ary) do { \
+    assert(!ARY_EMBED_P(ary)); \
+    FL_SET((ary), RARRAY_SHARED_ROOT_FLAG); \
+} while (0)
+
+#define ARY_SET(a, i, v) RARRAY_ASET((assert(!ARY_SHARED_P(a)), (a)), (i), (v))
+
+void
+rb_mem_clear(register VALUE *mem, register long size)
+{
+    while (size--) {
+	*mem++ = Qnil;
+    }
+}
+
+static void
+ary_mem_clear(VALUE ary, long beg, long size)
+{
+    RARRAY_PTR_USE(ary, ptr, {
+	rb_mem_clear(ptr + beg, size);
+    });
+}
+
+static inline void
+memfill(register VALUE *mem, register long size, register VALUE val)
+{
+    while (size--) {
+	*mem++ = val;
+    }
+}
+
+static void
+ary_memfill(VALUE ary, long beg, long size, VALUE val)
+{
+    RARRAY_PTR_USE(ary, ptr, {
+	memfill(ptr + beg, size, val);
+	RB_OBJ_WRITTEN(ary, Qundef, val);
+    });
+}
+
+static void
+ary_memcpy0(VALUE ary, long beg, long argc, const VALUE *argv, VALUE buff_owner_ary)
+{
+#if 1
+    assert(!ARY_SHARED_P(buff_owner_ary));
+
+    if (argc > (int)(128/sizeof(VALUE)) /* is magic number (cache line size) */) {
+	rb_gc_writebarrier_remember(buff_owner_ary);
+	RARRAY_PTR_USE(ary, ptr, {
+	    MEMCPY(ptr+beg, argv, VALUE, argc);
+	});
+    }
+    else {
+	int i;
+	RARRAY_PTR_USE(ary, ptr, {
+	    for (i=0; i<argc; i++) {
+		RB_OBJ_WRITE(buff_owner_ary, &ptr[i+beg], argv[i]);
+	    }
+	});
+    }
+#else
+    /* giveup write barrier (traditional way) */
+    RARRAY_PTR(buff_owner_ary);
+    MEMCPY(RARRAY_PTR(ary)+beg, argv, VALUE, argc);
+#endif
+}
+
+static void
+ary_memcpy(VALUE ary, long beg, long argc, const VALUE *argv)
+{
+    ary_memcpy0(ary, beg, argc, argv, ary);
+}
+
+static void
+ary_resize_capa(VALUE ary, long capacity)
+{
+    assert(RARRAY_LEN(ary) <= capacity);
+    assert(!OBJ_FROZEN(ary));
+    assert(!ARY_SHARED_P(ary));
+    if (capacity > RARRAY_EMBED_LEN_MAX) {
+        if (ARY_EMBED_P(ary)) {
+            long len = ARY_EMBED_LEN(ary);
+            VALUE *ptr = ALLOC_N(VALUE, (capacity));
+            MEMCPY(ptr, ARY_EMBED_PTR(ary), VALUE, len);
+            FL_UNSET_EMBED(ary);
+            ARY_SET_PTR(ary, ptr);
+            ARY_SET_HEAP_LEN(ary, len);
+        }
+        else {
+	    SIZED_REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, capacity, RARRAY(ary)->as.heap.aux.capa);
+        }
+        ARY_SET_CAPA(ary, (capacity));
+    }
+    else {
+        if (!ARY_EMBED_P(ary)) {
+            long len = RARRAY_LEN(ary);
+	    const VALUE *ptr = RARRAY_CONST_PTR(ary);
+
+	    if (len > capacity) len = capacity;
+            MEMCPY((VALUE *)RARRAY(ary)->as.ary, ptr, VALUE, len);
+            FL_SET_EMBED(ary);
+            ARY_SET_LEN(ary, len);
+	    ruby_xfree((VALUE *)ptr);
+        }
+    }
+}
+
+static inline void
+ary_shrink_capa(VALUE ary)
+{
+    long capacity = ARY_HEAP_LEN(ary);
+    long old_capa = RARRAY(ary)->as.heap.aux.capa;
+    assert(!ARY_SHARED_P(ary));
+    assert(old_capa >= capacity);
+    if (old_capa > capacity)
+	REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, capacity);
+}
+
+static void
+ary_double_capa(VALUE ary, long min)
+{
+    long new_capa = ARY_CAPA(ary) / 2;
+
+    if (new_capa < ARY_DEFAULT_SIZE) {
+	new_capa = ARY_DEFAULT_SIZE;
+    }
+    if (new_capa >= ARY_MAX_SIZE - min) {
+	new_capa = (ARY_MAX_SIZE - min) / 2;
+    }
+    new_capa += min;
+    ary_resize_capa(ary, new_capa);
+}
+
+static void
+rb_ary_decrement_share(VALUE shared)
+{
+    if (shared) {
+	long num = ARY_SHARED_NUM(shared) - 1;
+	if (num == 0) {
+	    rb_ary_free(shared);
+	    rb_gc_force_recycle(shared);
+	}
+	else if (num > 0) {
+	    ARY_SET_SHARED_NUM(shared, num);
+	}
+    }
+}
+
+static void
+rb_ary_unshare(VALUE ary)
+{
+    VALUE shared = RARRAY(ary)->as.heap.aux.shared;
+    rb_ary_decrement_share(shared);
+    FL_UNSET_SHARED(ary);
+}
+
+static inline void
+rb_ary_unshare_safe(VALUE ary)
+{
+    if (ARY_SHARED_P(ary) && !ARY_EMBED_P(ary)) {
+	rb_ary_unshare(ary);
+    }
+}
+
+static VALUE
+rb_ary_increment_share(VALUE shared)
+{
+    long num = ARY_SHARED_NUM(shared);
+    if (num >= 0) {
+	ARY_SET_SHARED_NUM(shared, num + 1);
+    }
+    return shared;
+}
+
+static void
+rb_ary_set_shared(VALUE ary, VALUE shared)
+{
+    rb_ary_increment_share(shared);
+    FL_SET_SHARED(ary);
+    ARY_SET_SHARED(ary, shared);
+}
+
+static inline void
+rb_ary_modify_check(VALUE ary)
+{
+    rb_check_frozen(ary);
+}
+
+void
+rb_ary_modify(VALUE ary)
+{
+    rb_ary_modify_check(ary);
+    if (ARY_SHARED_P(ary)) {
+	long shared_len, len = RARRAY_LEN(ary);
+	VALUE shared = ARY_SHARED(ary);
+        if (len <= RARRAY_EMBED_LEN_MAX) {
+	    const VALUE *ptr = ARY_HEAP_PTR(ary);
+            FL_UNSET_SHARED(ary);
+            FL_SET_EMBED(ary);
+	    MEMCPY((VALUE *)ARY_EMBED_PTR(ary), ptr, VALUE, len);
+            rb_ary_decrement_share(shared);
+            ARY_SET_EMBED_LEN(ary, len);
+        }
+	else if (ARY_SHARED_OCCUPIED(shared) && len > ((shared_len = RARRAY_LEN(shared))>>1)) {
+	    long shift = RARRAY_CONST_PTR(ary) - RARRAY_CONST_PTR(shared);
+	    FL_UNSET_SHARED(ary);
+	    ARY_SET_PTR(ary, RARRAY_CONST_PTR(shared));
+	    ARY_SET_CAPA(ary, shared_len);
+	    RARRAY_PTR_USE(ary, ptr, {
+		MEMMOVE(ptr, ptr+shift, VALUE, len);
+	    });
+	    FL_SET_EMBED(shared);
+	    rb_ary_decrement_share(shared);
+	}
+        else {
+            VALUE *ptr = ALLOC_N(VALUE, len);
+            MEMCPY(ptr, RARRAY_CONST_PTR(ary), VALUE, len);
+            rb_ary_unshare(ary);
+            ARY_SET_CAPA(ary, len);
+            ARY_SET_PTR(ary, ptr);
+        }
+
+	rb_gc_writebarrier_remember(ary);
+    }
+}
+
+static VALUE
+ary_ensure_room_for_push(VALUE ary, long add_len)
+{
+    long old_len = RARRAY_LEN(ary);
+    long new_len = old_len + add_len;
+    long capa;
+
+    if (old_len > ARY_MAX_SIZE - add_len) {
+	rb_raise(rb_eIndexError, "index %ld too big", new_len);
+    }
+    if (ARY_SHARED_P(ary)) {
+	if (new_len > RARRAY_EMBED_LEN_MAX) {
+	    VALUE shared = ARY_SHARED(ary);
+	    if (ARY_SHARED_OCCUPIED(shared)) {
+		if (RARRAY_CONST_PTR(ary) - RARRAY_CONST_PTR(shared) + new_len <= RARRAY_LEN(shared)) {
+		    rb_ary_modify_check(ary);
+		    return shared;
+		}
+		else {
+		    /* if array is shared, then it is likely it participate in push/shift pattern */
+		    rb_ary_modify(ary);
+		    capa = ARY_CAPA(ary);
+		    if (new_len > capa - (capa >> 6)) {
+			ary_double_capa(ary, new_len);
+		    }
+		    return ary;
+		}
+	    }
+	}
+    }
+    rb_ary_modify(ary);
+    capa = ARY_CAPA(ary);
+    if (new_len > capa) {
+	ary_double_capa(ary, new_len);
+    }
+
+    return ary;
+}
+
+/*
+ *  call-seq:
+ *      ary.freeze -> ary
+ *
+ *  Calls Object#freeze on +ary+ to prevent any further
+ *  modification. A RuntimeError will be raised if a modification
+ *  attempt is made.
+ *
+ */
 
 VALUE
-ary_new2(len)
+rb_ary_freeze(VALUE ary)
 {
-    NEWOBJ(ary, struct RArray);
-    OBJSETUP(ary, C_Array, T_ARRAY);
+    return rb_obj_freeze(ary);
+}
 
-    ary->len = 0;
-    ary->capa = len;
-    if (len == 0)
-	ary->ptr = Qnil;
-    else
-	ary->ptr = ALLOC_N(VALUE, len);
+/*
+ *  call-seq:
+ *     ary.frozen?  -> true or false
+ *
+ *  Return +true+ if this array is frozen (or temporarily frozen
+ *  while being sorted). See also Object#frozen?
+ */
 
+static VALUE
+rb_ary_frozen_p(VALUE ary)
+{
+    if (OBJ_FROZEN(ary)) return Qtrue;
+    return Qfalse;
+}
+
+/* This can be used to take a snapshot of an array (with
+   e.g. rb_ary_replace) and check later whether the array has been
+   modified from the snapshot.  The snapshot is cheap, though if
+   something does modify the array it will pay the cost of copying
+   it.  If Array#pop or Array#shift has been called, the array will
+   be still shared with the snapshot, but the array length will
+   differ. */
+VALUE
+rb_ary_shared_with_p(VALUE ary1, VALUE ary2)
+{
+    if (!ARY_EMBED_P(ary1) && ARY_SHARED_P(ary1) &&
+	!ARY_EMBED_P(ary2) && ARY_SHARED_P(ary2) &&
+	RARRAY(ary1)->as.heap.aux.shared == RARRAY(ary2)->as.heap.aux.shared &&
+	RARRAY(ary1)->as.heap.len == RARRAY(ary2)->as.heap.len) {
+	return Qtrue;
+    }
+    return Qfalse;
+}
+
+static VALUE
+ary_alloc(VALUE klass)
+{
+    NEWOBJ_OF(ary, struct RArray, klass, T_ARRAY | RARRAY_EMBED_FLAG | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0));
+    /* Created array is:
+     *   FL_SET_EMBED((VALUE)ary);
+     *   ARY_SET_EMBED_LEN((VALUE)ary, 0);
+     */
     return (VALUE)ary;
 }
 
+static VALUE
+empty_ary_alloc(VALUE klass)
+{
+    RUBY_DTRACE_CREATE_HOOK(ARRAY, 0);
+    return ary_alloc(klass);
+}
+
+static VALUE
+ary_new(VALUE klass, long capa)
+{
+    VALUE ary,*ptr;
+
+    if (capa < 0) {
+	rb_raise(rb_eArgError, "negative array size (or size too big)");
+    }
+    if (capa > ARY_MAX_SIZE) {
+	rb_raise(rb_eArgError, "array size too big");
+    }
+
+    RUBY_DTRACE_CREATE_HOOK(ARRAY, capa);
+
+    ary = ary_alloc(klass);
+    if (capa > RARRAY_EMBED_LEN_MAX) {
+	ptr = ALLOC_N(VALUE, capa);
+        FL_UNSET_EMBED(ary);
+        ARY_SET_PTR(ary, ptr);
+        ARY_SET_CAPA(ary, capa);
+        ARY_SET_HEAP_LEN(ary, 0);
+    }
+
+    return ary;
+}
+
 VALUE
-ary_new()
+rb_ary_new_capa(long capa)
 {
-    return ary_new2(ARY_DEFAULT_SIZE);
+    return ary_new(rb_cArray, capa);
 }
 
-#include <varargs.h>
+VALUE
+rb_ary_new(void)
+{
+    return rb_ary_new2(RARRAY_EMBED_LEN_MAX);
+}
 
 VALUE
-ary_new3(n, va_alist)
-    int n;
-    va_dcl
+(rb_ary_new_from_args)(long n, ...)
 {
     va_list ar;
-    struct RArray* ary;
-    int len, i;
+    VALUE ary;
+    long i;
 
-    if (n < 0) {
-	Fail("Negative number of items(%d)", n);
-    }
-    ary = (struct RArray*)ary_new2(n<ARY_DEFAULT_SIZE?ARY_DEFAULT_SIZE:n);
+    ary = rb_ary_new2(n);
 
-    va_start(ar);
+    va_start(ar, n);
     for (i=0; i<n; i++) {
-	ary->ptr[i] = va_arg(ar, VALUE);
+	ARY_SET(ary, i, va_arg(ar, VALUE));
     }
     va_end(ar);
 
-    ary->len = n;
-    return (VALUE)ary;
+    ARY_SET_LEN(ary, n);
+    return ary;
 }
 
 VALUE
-ary_new4(n, elts)
-    int n;
-    VALUE *elts;
+rb_ary_new_from_values(long n, const VALUE *elts)
 {
-    struct RArray* ary;
+    VALUE ary;
 
-    ary = (struct RArray*)ary_new2(n);
-    MEMCPY(ary->ptr, elts, VALUE, n);
-    ary->len = n;
+    ary = rb_ary_new2(n);
+    if (n > 0 && elts) {
+	ary_memcpy(ary, 0, n, elts);
+	ARY_SET_LEN(ary, n);
+    }
 
-    return (VALUE)ary;
+    return ary;
+}
+
+VALUE
+rb_ary_tmp_new(long capa)
+{
+    return ary_new(0, capa);
+}
+
+VALUE
+rb_ary_tmp_new_fill(long capa)
+{
+    VALUE ary = ary_new(0, capa);
+    ary_memfill(ary, 0, capa, Qnil);
+    ARY_SET_LEN(ary, capa);
+    return ary;
+}
+
+void
+rb_ary_free(VALUE ary)
+{
+    if (ARY_OWNS_HEAP_P(ary)) {
+	ruby_sized_xfree((void *)ARY_HEAP_PTR(ary), ARY_HEAP_SIZE(ary));
+    }
+}
+
+RUBY_FUNC_EXPORTED size_t
+rb_ary_memsize(VALUE ary)
+{
+    if (ARY_OWNS_HEAP_P(ary)) {
+	return RARRAY(ary)->as.heap.aux.capa * sizeof(VALUE);
+    }
+    else {
+	return 0;
+    }
+}
+
+static inline void
+ary_discard(VALUE ary)
+{
+    rb_ary_free(ary);
+    RBASIC(ary)->flags |= RARRAY_EMBED_FLAG;
+    RBASIC(ary)->flags &= ~RARRAY_EMBED_LEN_MASK;
 }
 
 static VALUE
-Sary_new(class)
-    VALUE class;
+ary_make_shared(VALUE ary)
 {
-    NEWOBJ(ary, struct RArray);
-    OBJSETUP(ary, class, T_ARRAY);
+    assert(!ARY_EMBED_P(ary));
+    if (ARY_SHARED_P(ary)) {
+	return ARY_SHARED(ary);
+    }
+    else if (ARY_SHARED_ROOT_P(ary)) {
+	return ary;
+    }
+    else if (OBJ_FROZEN(ary)) {
+	ary_shrink_capa(ary);
+	FL_SET_SHARED_ROOT(ary);
+	ARY_SET_SHARED_NUM(ary, 1);
+	return ary;
+    }
+    else {
+	long capa = ARY_CAPA(ary), len = RARRAY_LEN(ary);
+	NEWOBJ_OF(shared, struct RArray, 0, T_ARRAY | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0));
+        FL_UNSET_EMBED(shared);
+
+	ARY_SET_LEN((VALUE)shared, capa);
+	ARY_SET_PTR((VALUE)shared, RARRAY_CONST_PTR(ary));
+	ary_mem_clear((VALUE)shared, len, capa - len);
+	FL_SET_SHARED_ROOT(shared);
+	ARY_SET_SHARED_NUM((VALUE)shared, 1);
+	FL_SET_SHARED(ary);
+	ARY_SET_SHARED(ary, (VALUE)shared);
+	OBJ_FREEZE(shared);
+	return (VALUE)shared;
+    }
+}
 
-    ary->len = 0;
-    ary->capa = ARY_DEFAULT_SIZE;
-    ary->ptr = ALLOC_N(VALUE, ARY_DEFAULT_SIZE);
+static VALUE
+ary_make_substitution(VALUE ary)
+{
+    long len = RARRAY_LEN(ary);
 
-    return (VALUE)ary;
+    if (len <= RARRAY_EMBED_LEN_MAX) {
+	VALUE subst = rb_ary_new2(len);
+	ary_memcpy(subst, 0, len, RARRAY_CONST_PTR(ary));
+        ARY_SET_EMBED_LEN(subst, len);
+        return subst;
+    }
+    else {
+        return rb_ary_increment_share(ary_make_shared(ary));
+    }
+}
+
+VALUE
+rb_assoc_new(VALUE car, VALUE cdr)
+{
+    return rb_ary_new3(2, car, cdr);
+}
+
+static VALUE
+to_ary(VALUE ary)
+{
+    return rb_convert_type(ary, T_ARRAY, "Array", "to_ary");
 }
 
+VALUE
+rb_check_array_type(VALUE ary)
+{
+    return rb_check_convert_type(ary, T_ARRAY, "Array", "to_ary");
+}
+
+/*
+ *  call-seq:
+ *     Array.try_convert(obj) -> array or nil
+ *
+ *  Tries to convert +obj+ into an array, using +to_ary+ method.  Returns the
+ *  converted array or +nil+ if +obj+ cannot be converted for any reason.
+ *  This method can be used to check if an argument is an array.
+ *
+ *     Array.try_convert([1])   #=> [1]
+ *     Array.try_convert("1")   #=> nil
+ *
+ *     if tmp = Array.try_convert(arg)
+ *       # the argument is an array
+ *     elsif tmp = String.try_convert(arg)
+ *       # the argument is a string
+ *     end
+ *
+ */
+
+static VALUE
+rb_ary_s_try_convert(VALUE dummy, VALUE ary)
+{
+    return rb_check_array_type(ary);
+}
+
+/*
+ *  call-seq:
+ *     Array.new(size=0, default=nil)
+ *     Array.new(array)
+ *     Array.new(size) {|index| block }
+ *
+ *  Returns a new array.
+ *
+ *  In the first form, if no arguments are sent, the new array will be empty.
+ *  When a +size+ and an optional +default+ are sent, an array is created with
+ *  +size+ copies of +default+.  Take notice that all elements will reference the
+ *  same object +default+.
+ *
+ *  The second form creates a copy of the array passed as a parameter (the
+ *  array is generated by calling to_ary on the parameter).
+ *
+ *    first_array = ["Matz", "Guido"]
+ *
+ *    second_array = Array.new(first_array) #=> ["Matz", "Guido"]
+ *
+ *    first_array.equal? second_array       #=> false
+ *
+ *  In the last form, an array of the given size is created.  Each element in
+ *  this array is created by passing the element's index to the given block
+ *  and storing the return value.
+ *
+ *    Array.new(3){ |index| index ** 2 }
+ *    # => [0, 1, 4]
+ *
+ *  == Common gotchas
+ *
+ *  When sending the second parameter, the same object will be used as the
+ *  value for all the array elements:
+ *
+ *     a = Array.new(2, Hash.new)
+ *     # => [{}, {}]
+ *
+ *     a[0]['cat'] = 'feline'
+ *     a # => [{"cat"=>"feline"}, {"cat"=>"feline"}]
+ *
+ *     a[1]['cat'] = 'Felix'
+ *     a # => [{"cat"=>"Felix"}, {"cat"=>"Felix"}]
+ *
+ *  Since all the Array elements store the same hash, changes to one of them
+ *  will affect them all.
+ *
+ *  If multiple copies are what you want, you should use the block
+ *  version which uses the result of that block each time an element
+ *  of the array needs to be initialized:
+ *
+ *     a = Array.new(2) { Hash.new }
+ *     a[0]['cat'] = 'feline'
+ *     a # => [{"cat"=>"feline"}, {}]
+ *
+ */
+
 static VALUE
-Sary_create(argc, argv, class)
-    int argc;
-    VALUE *argv;
-    VALUE class;
+rb_ary_initialize(int argc, VALUE *argv, VALUE ary)
 {
-    NEWOBJ(ary, struct RArray);
-    OBJSETUP(ary, class, T_ARRAY);
+    long len;
+    VALUE size, val;
 
-    ary->len = argc;
-    ary->capa = argc;
+    rb_ary_modify(ary);
     if (argc == 0) {
-	ary->ptr = Qnil;
+	if (ARY_OWNS_HEAP_P(ary) && RARRAY_CONST_PTR(ary) != 0) {
+	    ruby_sized_xfree((void *)RARRAY_CONST_PTR(ary), ARY_HEAP_SIZE(ary));
+	}
+        rb_ary_unshare_safe(ary);
+        FL_SET_EMBED(ary);
+	ARY_SET_EMBED_LEN(ary, 0);
+	if (rb_block_given_p()) {
+	    rb_warning("given block not used");
+	}
+	return ary;
+    }
+    rb_scan_args(argc, argv, "02", &size, &val);
+    if (argc == 1 && !FIXNUM_P(size)) {
+	val = rb_check_array_type(size);
+	if (!NIL_P(val)) {
+	    rb_ary_replace(ary, val);
+	    return ary;
+	}
+    }
+
+    len = NUM2LONG(size);
+    /* NUM2LONG() may call size.to_int, ary can be frozen, modified, etc */
+    if (len < 0) {
+	rb_raise(rb_eArgError, "negative array size");
+    }
+    if (len > ARY_MAX_SIZE) {
+	rb_raise(rb_eArgError, "array size too big");
+    }
+    /* recheck after argument conversion */
+    rb_ary_modify(ary);
+    ary_resize_capa(ary, len);
+    if (rb_block_given_p()) {
+	long i;
+
+	if (argc == 2) {
+	    rb_warn("block supersedes default value argument");
+	}
+	for (i=0; i<len; i++) {
+	    rb_ary_store(ary, i, rb_yield(LONG2NUM(i)));
+	    ARY_SET_LEN(ary, i + 1);
+	}
     }
     else {
-	ary->ptr = ALLOC_N(VALUE, argc);
-	MEMCPY(ary->ptr, argv, VALUE, argc);
+	ary_memfill(ary, 0, len, val);
+	ARY_SET_LEN(ary, len);
     }
+    return ary;
+}
 
-    return (VALUE)ary;
+/*
+ * Returns a new array populated with the given objects.
+ *
+ *   Array.[]( 1, 'a', /^A/ ) # => [1, "a", /^A/]
+ *   Array[ 1, 'a', /^A/ ]    # => [1, "a", /^A/]
+ *   [ 1, 'a', /^A/ ]         # => [1, "a", /^A/]
+ */
+
+static VALUE
+rb_ary_s_create(int argc, VALUE *argv, VALUE klass)
+{
+    VALUE ary = ary_new(klass, argc);
+    if (argc > 0 && argv) {
+        ary_memcpy(ary, 0, argc, argv);
+        ARY_SET_LEN(ary, argc);
+    }
+
+    return ary;
 }
 
-static void
-astore(ary, idx, val)
-    struct RArray *ary;
-    int idx;
-    VALUE val;
+void
+rb_ary_store(VALUE ary, long idx, VALUE val)
 {
+    long len = RARRAY_LEN(ary);
+
     if (idx < 0) {
-	Fail("negative index for array");
+	idx += len;
+	if (idx < 0) {
+	    rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
+		     idx - len, -len);
+	}
+    }
+    else if (idx >= ARY_MAX_SIZE) {
+	rb_raise(rb_eIndexError, "index %ld too big", idx);
     }
 
-    if (idx >= ary->capa) {
-	ary->capa = idx + ARY_DEFAULT_SIZE;
-	REALLOC_N(ary->ptr, VALUE, ary->capa);
+    rb_ary_modify(ary);
+    if (idx >= ARY_CAPA(ary)) {
+	ary_double_capa(ary, idx);
     }
-    if (idx > ary->len) {
-	MEMZERO(ary->ptr+ary->len, VALUE, idx-ary->len+1);
+    if (idx > len) {
+	ary_mem_clear(ary, len, idx - len + 1);
     }
 
-    if (idx >= ary->len) {
-	ary->len = idx + 1;
+    if (idx >= len) {
+	ARY_SET_LEN(ary, idx + 1);
     }
-    ary->ptr[idx] = val;
+    ARY_SET(ary, idx, val);
 }
 
-VALUE
-ary_push(ary, item)
-    struct RArray *ary;
-    VALUE item;
+static VALUE
+ary_make_partial(VALUE ary, VALUE klass, long offset, long len)
 {
-    astore(ary, ary->len, item);
-    return (VALUE)ary;
+    assert(offset >= 0);
+    assert(len >= 0);
+    assert(offset+len <= RARRAY_LEN(ary));
+
+    if (len <= RARRAY_EMBED_LEN_MAX) {
+        VALUE result = ary_alloc(klass);
+	ary_memcpy(result, 0, len, RARRAY_CONST_PTR(ary) + offset);
+        ARY_SET_EMBED_LEN(result, len);
+        return result;
+    }
+    else {
+        VALUE shared, result = ary_alloc(klass);
+        FL_UNSET_EMBED(result);
+
+        shared = ary_make_shared(ary);
+        ARY_SET_PTR(result, RARRAY_CONST_PTR(ary));
+        ARY_SET_LEN(result, RARRAY_LEN(ary));
+        rb_ary_set_shared(result, shared);
+
+        ARY_INCREASE_PTR(result, offset);
+        ARY_SET_LEN(result, len);
+        return result;
+    }
 }
 
 static VALUE
-Fary_append(ary, item)
-    struct RArray *ary;
-    VALUE item;
+ary_make_shared_copy(VALUE ary)
 {
-    astore(ary, ary->len, item);
-    return (VALUE)ary;
+    return ary_make_partial(ary, rb_obj_class(ary), 0, RARRAY_LEN(ary));
 }
 
+enum ary_take_pos_flags
+{
+    ARY_TAKE_FIRST = 0,
+    ARY_TAKE_LAST = 1
+};
+
+static VALUE
+ary_take_first_or_last(int argc, const VALUE *argv, VALUE ary, enum ary_take_pos_flags last)
+{
+    VALUE nv;
+    long n;
+    long len;
+    long offset = 0;
+
+    rb_scan_args(argc, argv, "1", &nv);
+    n = NUM2LONG(nv);
+    len = RARRAY_LEN(ary);
+    if (n > len) {
+	n = len;
+    }
+    else if (n < 0) {
+	rb_raise(rb_eArgError, "negative array size");
+    }
+    if (last) {
+	offset = len - n;
+    }
+    return ary_make_partial(ary, rb_cArray, offset, n);
+}
+
+/*
+ *  call-seq:
+ *     ary << obj            -> ary
+ *
+ *  Append---Pushes the given object on to the end of this array. This
+ *  expression returns the array itself, so several appends
+ *  may be chained together.
+ *
+ *     [ 1, 2 ] << "c" << "d" << [ 3, 4 ]
+ *             #=>  [ 1, 2, "c", "d", [ 3, 4 ] ]
+ *
+ */
+
 VALUE
-ary_pop(ary)
-    struct RArray *ary;
+rb_ary_push(VALUE ary, VALUE item)
 {
-    if (ary->len == 0) return Qnil;
-    return ary->ptr[--ary->len];
+    long idx = RARRAY_LEN(ary);
+    VALUE target_ary = ary_ensure_room_for_push(ary, 1);
+    RARRAY_PTR_USE(ary, ptr, {
+	RB_OBJ_WRITE(target_ary, &ptr[idx], item);
+    });
+    ARY_SET_LEN(ary, idx + 1);
+    return ary;
 }
 
 VALUE
-ary_shift(ary)
-    struct RArray *ary;
+rb_ary_cat(VALUE ary, const VALUE *argv, long len)
 {
-    VALUE top;
+    long oldlen = RARRAY_LEN(ary);
+    VALUE target_ary = ary_ensure_room_for_push(ary, len);
+    ary_memcpy0(ary, oldlen, len, argv, target_ary);
+    ARY_SET_LEN(ary, oldlen + len);
+    return ary;
+}
+
+/*
+ *  call-seq:
+ *     ary.push(obj, ... )   -> ary
+ *
+ *  Append --- Pushes the given object(s) on to the end of this array. This
+ *  expression returns the array itself, so several appends
+ *  may be chained together. See also Array#pop for the opposite
+ *  effect.
+ *
+ *     a = [ "a", "b", "c" ]
+ *     a.push("d", "e", "f")
+ *             #=> ["a", "b", "c", "d", "e", "f"]
+ *     [1, 2, 3,].push(4).push(5)
+ *             #=> [1, 2, 3, 4, 5]
+ */
+
+static VALUE
+rb_ary_push_m(int argc, VALUE *argv, VALUE ary)
+{
+    return rb_ary_cat(ary, argv, argc);
+}
 
-    if (ary->len == 0) return Qnil;
+VALUE
+rb_ary_pop(VALUE ary)
+{
+    long n;
+    rb_ary_modify_check(ary);
+    n = RARRAY_LEN(ary);
+    if (n == 0) return Qnil;
+    if (ARY_OWNS_HEAP_P(ary) &&
+	n * 3 < ARY_CAPA(ary) &&
+	ARY_CAPA(ary) > ARY_DEFAULT_SIZE)
+    {
+	ary_resize_capa(ary, n * 2);
+    }
+    --n;
+    ARY_SET_LEN(ary, n);
+    return RARRAY_AREF(ary, n);
+}
 
-    top = ary->ptr[0];
-    ary->len--;
+/*
+ *  call-seq:
+ *     ary.pop    -> obj or nil
+ *     ary.pop(n) -> new_ary
+ *
+ *  Removes the last element from +self+ and returns it, or
+ *  +nil+ if the array is empty.
+ *
+ *  If a number +n+ is given, returns an array of the last +n+ elements
+ *  (or less) just like <code>array.slice!(-n, n)</code> does. See also
+ *  Array#push for the opposite effect.
+ *
+ *     a = [ "a", "b", "c", "d" ]
+ *     a.pop     #=> "d"
+ *     a.pop(2)  #=> ["b", "c"]
+ *     a         #=> ["a"]
+ */
 
-    /* sliding items */
-    memmove(ary->ptr, ary->ptr+1, sizeof(VALUE)*(ary->len));
+static VALUE
+rb_ary_pop_m(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE result;
 
-    return top;
+    if (argc == 0) {
+	return rb_ary_pop(ary);
+    }
+
+    rb_ary_modify_check(ary);
+    result = ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
+    ARY_INCREASE_LEN(ary, -RARRAY_LEN(result));
+    return result;
 }
 
 VALUE
-ary_unshift(ary, item)
-    struct RArray *ary;
+rb_ary_shift(VALUE ary)
 {
     VALUE top;
+    long len = RARRAY_LEN(ary);
+
+    rb_ary_modify_check(ary);
+    if (len == 0) return Qnil;
+    top = RARRAY_AREF(ary, 0);
+    if (!ARY_SHARED_P(ary)) {
+	if (len < ARY_DEFAULT_SIZE) {
+	    RARRAY_PTR_USE(ary, ptr, {
+		MEMMOVE(ptr, ptr+1, VALUE, len-1);
+	    }); /* WB: no new reference */
+            ARY_INCREASE_LEN(ary, -1);
+	    return top;
+	}
+        assert(!ARY_EMBED_P(ary)); /* ARY_EMBED_LEN_MAX < ARY_DEFAULT_SIZE */
+
+	ARY_SET(ary, 0, Qnil);
+	ary_make_shared(ary);
+    }
+    else if (ARY_SHARED_OCCUPIED(ARY_SHARED(ary))) {
+	RARRAY_PTR_USE(ary, ptr, ptr[0] = Qnil);
+    }
+    ARY_INCREASE_PTR(ary, 1);		/* shift ptr */
+    ARY_INCREASE_LEN(ary, -1);
+
+    return top;
+}
+
+/*
+ *  call-seq:
+ *     ary.shift    -> obj or nil
+ *     ary.shift(n) -> new_ary
+ *
+ *  Removes the first element of +self+ and returns it (shifting all
+ *  other elements down by one). Returns +nil+ if the array
+ *  is empty.
+ *
+ *  If a number +n+ is given, returns an array of the first +n+ elements
+ *  (or less) just like <code>array.slice!(0, n)</code> does. With +ary+
+ *  containing only the remainder elements, not including what was shifted to
+ *  +new_ary+. See also Array#unshift for the opposite effect.
+ *
+ *     args = [ "-m", "-q", "filename" ]
+ *     args.shift     #=> "-m"
+ *     args           #=> ["-q", "filename"]
+ *
+ *     args = [ "-m", "-q", "filename" ]
+ *     args.shift(2)  #=> ["-m", "-q"]
+ *     args           #=> ["filename"]
+ */
+
+static VALUE
+rb_ary_shift_m(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE result;
+    long n;
+
+    if (argc == 0) {
+	return rb_ary_shift(ary);
+    }
+
+    rb_ary_modify_check(ary);
+    result = ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
+    n = RARRAY_LEN(result);
+    if (ARY_SHARED_P(ary)) {
+	if (ARY_SHARED_OCCUPIED(ARY_SHARED(ary))) {
+	  setup_occupied_shared:
+	    ary_mem_clear(ary, 0, n);
+	}
+        ARY_INCREASE_PTR(ary, n);
+    }
+    else {
+	if (RARRAY_LEN(ary) < ARY_DEFAULT_SIZE) {
+	    RARRAY_PTR_USE(ary, ptr, {
+		MEMMOVE(ptr, ptr+n, VALUE, RARRAY_LEN(ary)-n);
+	    }); /* WB: no new reference */
+	}
+	else {
+	    ary_make_shared(ary);
+	    goto setup_occupied_shared;
+	}
+    }
+    ARY_INCREASE_LEN(ary, -n);
+
+    return result;
+}
+
+static VALUE
+ary_ensure_room_for_unshift(VALUE ary, int argc)
+{
+    long len = RARRAY_LEN(ary);
+    long new_len = len + argc;
+    long capa;
+    const VALUE *head, *sharedp;
+
+    if (len > ARY_MAX_SIZE - argc) {
+	rb_raise(rb_eIndexError, "index %ld too big", new_len);
+    }
+
+    if (ARY_SHARED_P(ary)) {
+	VALUE shared = ARY_SHARED(ary);
+	capa = RARRAY_LEN(shared);
+	if (ARY_SHARED_OCCUPIED(shared) && capa > new_len) {
+	    head = RARRAY_CONST_PTR(ary);
+	    sharedp = RARRAY_CONST_PTR(shared);
+	    goto makeroom_if_need;
+	}
+    }
+
+    rb_ary_modify(ary);
+    capa = ARY_CAPA(ary);
+    if (capa - (capa >> 6) <= new_len) {
+	ary_double_capa(ary, new_len);
+    }
+
+    /* use shared array for big "queues" */
+    if (new_len > ARY_DEFAULT_SIZE * 4) {
+	/* make a room for unshifted items */
+	capa = ARY_CAPA(ary);
+	ary_make_shared(ary);
+
+	head = sharedp = RARRAY_CONST_PTR(ary);
+	goto makeroom;
+      makeroom_if_need:
+	if (head - sharedp < argc) {
+	    long room;
+	  makeroom:
+	    room = capa - new_len;
+	    room -= room >> 4;
+	    MEMMOVE((VALUE *)sharedp + argc + room, head, VALUE, len);
+	    head = sharedp + argc + room;
+	}
+	ARY_SET_PTR(ary, head - argc);
+	assert(ARY_SHARED_OCCUPIED(ARY_SHARED(ary)));
+	return ARY_SHARED(ary);
+    }
+    else {
+	/* sliding items */
+	RARRAY_PTR_USE(ary, ptr, {
+	    MEMMOVE(ptr + argc, ptr, VALUE, len);
+	});
 
-    if (ary->len >= ary->capa) {
-	ary->capa+=ARY_DEFAULT_SIZE;
-	REALLOC_N(ary->ptr, VALUE, ary->capa);
+	return ary;
     }
+}
+
+/*
+ *  call-seq:
+ *     ary.unshift(obj, ...)  -> ary
+ *
+ *  Prepends objects to the front of +self+, moving other elements upwards.
+ *  See also Array#shift for the opposite effect.
+ *
+ *     a = [ "b", "c", "d" ]
+ *     a.unshift("a")   #=> ["a", "b", "c", "d"]
+ *     a.unshift(1, 2)  #=> [ 1, 2, "a", "b", "c", "d"]
+ */
 
-    /* sliding items */
-    memmove(ary->ptr+1, ary->ptr, sizeof(VALUE)*(ary->len));
+static VALUE
+rb_ary_unshift_m(int argc, VALUE *argv, VALUE ary)
+{
+    long len = RARRAY_LEN(ary);
+    VALUE target_ary;
 
-    ary->len++;
-    return ary->ptr[0] = item;
+    if (argc == 0) {
+	rb_ary_modify_check(ary);
+	return ary;
+    }
+
+    target_ary = ary_ensure_room_for_unshift(ary, argc);
+    ary_memcpy0(ary, 0, argc, argv, target_ary);
+    ARY_SET_LEN(ary, len + argc);
+    return ary;
 }
 
 VALUE
-ary_entry(ary, offset)
-    struct RArray *ary;
-    int offset;
+rb_ary_unshift(VALUE ary, VALUE item)
 {
-    if (ary->len == 0) return Qnil;
+    return rb_ary_unshift_m(1,&item,ary);
+}
 
+/* faster version - use this if you don't need to treat negative offset */
+static inline VALUE
+rb_ary_elt(VALUE ary, long offset)
+{
+    long len = RARRAY_LEN(ary);
+    if (len == 0) return Qnil;
+    if (offset < 0 || len <= offset) {
+	return Qnil;
+    }
+    return RARRAY_AREF(ary, offset);
+}
+
+VALUE
+rb_ary_entry(VALUE ary, long offset)
+{
     if (offset < 0) {
-	offset = ary->len + offset;
+	offset += RARRAY_LEN(ary);
     }
-    if (offset < 0 || ary->len <= offset) {
+    return rb_ary_elt(ary, offset);
+}
+
+VALUE
+rb_ary_subseq(VALUE ary, long beg, long len)
+{
+    VALUE klass;
+    long alen = RARRAY_LEN(ary);
+
+    if (beg > alen) return Qnil;
+    if (beg < 0 || len < 0) return Qnil;
+
+    if (alen < len || alen < beg + len) {
+	len = alen - beg;
+    }
+    klass = rb_obj_class(ary);
+    if (len == 0) return ary_new(klass, 0);
+
+    return ary_make_partial(ary, klass, beg, len);
+}
+
+/*
+ *  call-seq:
+ *     ary[index]                -> obj     or nil
+ *     ary[start, length]        -> new_ary or nil
+ *     ary[range]                -> new_ary or nil
+ *     ary.slice(index)          -> obj     or nil
+ *     ary.slice(start, length)  -> new_ary or nil
+ *     ary.slice(range)          -> new_ary or nil
+ *
+ *  Element Reference --- Returns the element at +index+, or returns a
+ *  subarray starting at the +start+ index and continuing for +length+
+ *  elements, or returns a subarray specified by +range+ of indices.
+ *
+ *  Negative indices count backward from the end of the array (-1 is the last
+ *  element).  For +start+ and +range+ cases the starting index is just before
+ *  an element.  Additionally, an empty array is returned when the starting
+ *  index for an element range is at the end of the array.
+ *
+ *  Returns +nil+ if the index (or starting index) are out of range.
+ *
+ *     a = [ "a", "b", "c", "d", "e" ]
+ *     a[2] +  a[0] + a[1]    #=> "cab"
+ *     a[6]                   #=> nil
+ *     a[1, 2]                #=> [ "b", "c" ]
+ *     a[1..3]                #=> [ "b", "c", "d" ]
+ *     a[4..7]                #=> [ "e" ]
+ *     a[6..10]               #=> nil
+ *     a[-3, 3]               #=> [ "c", "d", "e" ]
+ *     # special cases
+ *     a[5]                   #=> nil
+ *     a[6, 1]                #=> nil
+ *     a[5, 1]                #=> []
+ *     a[5..10]               #=> []
+ *
+ */
+
+VALUE
+rb_ary_aref(int argc, const VALUE *argv, VALUE ary)
+{
+    VALUE arg;
+    long beg, len;
+
+    if (argc == 2) {
+	beg = NUM2LONG(argv[0]);
+	len = NUM2LONG(argv[1]);
+	if (beg < 0) {
+	    beg += RARRAY_LEN(ary);
+	}
+	return rb_ary_subseq(ary, beg, len);
+    }
+    if (argc != 1) {
+	rb_scan_args(argc, argv, "11", NULL, NULL);
+    }
+    arg = argv[0];
+    /* special case - speeding up */
+    if (FIXNUM_P(arg)) {
+	return rb_ary_entry(ary, FIX2LONG(arg));
+    }
+    /* check if idx is Range */
+    switch (rb_range_beg_len(arg, &beg, &len, RARRAY_LEN(ary), 0)) {
+      case Qfalse:
+	break;
+      case Qnil:
 	return Qnil;
+      default:
+	return rb_ary_subseq(ary, beg, len);
     }
+    return rb_ary_entry(ary, NUM2LONG(arg));
+}
 
-    return ary->ptr[offset];
+/*
+ *  call-seq:
+ *     ary.at(index)   ->   obj  or nil
+ *
+ *  Returns the element at +index+. A negative index counts from the end of
+ *  +self+. Returns +nil+ if the index is out of range. See also
+ *  Array#[].
+ *
+ *     a = [ "a", "b", "c", "d", "e" ]
+ *     a.at(0)     #=> "a"
+ *     a.at(-1)    #=> "e"
+ */
+
+VALUE
+rb_ary_at(VALUE ary, VALUE pos)
+{
+    return rb_ary_entry(ary, NUM2LONG(pos));
 }
 
+/*
+ *  call-seq:
+ *     ary.first     ->   obj or nil
+ *     ary.first(n)  ->   new_ary
+ *
+ *  Returns the first element, or the first +n+ elements, of the array.
+ *  If the array is empty, the first form returns +nil+, and the
+ *  second form returns an empty array. See also Array#last for
+ *  the opposite effect.
+ *
+ *     a = [ "q", "r", "s", "t" ]
+ *     a.first     #=> "q"
+ *     a.first(2)  #=> ["q", "r"]
+ */
+
 static VALUE
-ary_subseq(ary, beg, len)
-    struct RArray *ary;
-    int beg, len;
+rb_ary_first(int argc, VALUE *argv, VALUE ary)
 {
-    struct RArray *ary2;
-    VALUE *ptr;
+    if (argc == 0) {
+	if (RARRAY_LEN(ary) == 0) return Qnil;
+	return RARRAY_AREF(ary, 0);
+    }
+    else {
+	return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
+    }
+}
 
-    if (beg < 0) {
-	beg = ary->len + beg;
-	if (beg < 0) beg = 0;
+/*
+ *  call-seq:
+ *     ary.last     ->  obj or nil
+ *     ary.last(n)  ->  new_ary
+ *
+ *  Returns the last element(s) of +self+. If the array is empty,
+ *  the first form returns +nil+.
+ *
+ *  See also Array#first for the opposite effect.
+ *
+ *     a = [ "w", "x", "y", "z" ]
+ *     a.last     #=> "z"
+ *     a.last(2)  #=> ["y", "z"]
+ */
+
+VALUE
+rb_ary_last(int argc, const VALUE *argv, VALUE ary)
+{
+    if (argc == 0) {
+	long len = RARRAY_LEN(ary);
+	if (len == 0) return Qnil;
+	return RARRAY_AREF(ary, len-1);
     }
-    if (len < 0) {
-	Fail("negative length for sub-array(size: %d)", ary->len);
+    else {
+	return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
     }
-    if (len == 0) {
-	return ary_new();
+}
+
+/*
+ *  call-seq:
+ *     ary.fetch(index)                    -> obj
+ *     ary.fetch(index, default)           -> obj
+ *     ary.fetch(index) { |index| block }  -> obj
+ *
+ *  Tries to return the element at position +index+, but throws an IndexError
+ *  exception if the referenced +index+ lies outside of the array bounds.  This
+ *  error can be prevented by supplying a second argument, which will act as a
+ *  +default+ value.
+ *
+ *  Alternatively, if a block is given it will only be executed when an
+ *  invalid +index+ is referenced.  Negative values of +index+ count from the
+ *  end of the array.
+ *
+ *     a = [ 11, 22, 33, 44 ]
+ *     a.fetch(1)               #=> 22
+ *     a.fetch(-1)              #=> 44
+ *     a.fetch(4, 'cat')        #=> "cat"
+ *     a.fetch(100) { |i| puts "#{i} is out of bounds" }
+ *                              #=> "100 is out of bounds"
+ */
+
+static VALUE
+rb_ary_fetch(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE pos, ifnone;
+    long block_given;
+    long idx;
+
+    rb_scan_args(argc, argv, "11", &pos, &ifnone);
+    block_given = rb_block_given_p();
+    if (block_given && argc == 2) {
+	rb_warn("block supersedes default value argument");
+    }
+    idx = NUM2LONG(pos);
+
+    if (idx < 0) {
+	idx +=  RARRAY_LEN(ary);
+    }
+    if (idx < 0 || RARRAY_LEN(ary) <= idx) {
+	if (block_given) return rb_yield(pos);
+	if (argc == 1) {
+	    rb_raise(rb_eIndexError, "index %ld outside of array bounds: %ld...%ld",
+			idx - (idx < 0 ? RARRAY_LEN(ary) : 0), -RARRAY_LEN(ary), RARRAY_LEN(ary));
+	}
+	return ifnone;
+    }
+    return RARRAY_AREF(ary, idx);
+}
+
+/*
+ *  call-seq:
+ *     ary.find_index(obj)             ->  int or nil
+ *     ary.find_index { |item| block } ->  int or nil
+ *     ary.find_index                  ->  Enumerator
+ *     ary.index(obj)             ->  int or nil
+ *     ary.index { |item| block } ->  int or nil
+ *     ary.index                  ->  Enumerator
+ *
+ *  Returns the _index_ of the first object in +ary+ such that the object is
+ *  <code>==</code> to +obj+.
+ *
+ *  If a block is given instead of an argument, returns the _index_ of the
+ *  first object for which the block returns +true+.  Returns +nil+ if no
+ *  match is found.
+ *
+ *  See also Array#rindex.
+ *
+ *  An Enumerator is returned if neither a block nor argument is given.
+ *
+ *     a = [ "a", "b", "c" ]
+ *     a.index("b")              #=> 1
+ *     a.index("z")              #=> nil
+ *     a.index { |x| x == "b" }  #=> 1
+ */
+
+static VALUE
+rb_ary_index(int argc, VALUE *argv, VALUE ary)
+{
+    const VALUE *ptr;
+    VALUE val;
+    long i, len;
+
+    if (argc == 0) {
+	RETURN_ENUMERATOR(ary, 0, 0);
+	for (i=0; i<RARRAY_LEN(ary); i++) {
+	    if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
+		return LONG2NUM(i);
+	    }
+	}
+	return Qnil;
     }
-    if (beg + len > ary->len) {
-	len = ary->len - beg;
+    rb_check_arity(argc, 0, 1);
+    val = argv[0];
+    if (rb_block_given_p())
+	rb_warn("given block not used");
+    len = RARRAY_LEN(ary);
+    ptr = RARRAY_CONST_PTR(ary);
+    for (i=0; i<len; i++) {
+	VALUE e = ptr[i];
+	switch (rb_equal_opt(e, val)) {
+	  case Qundef:
+	    if (!rb_equal(e, val)) break;
+	  case Qtrue:
+	    return LONG2NUM(i);
+	  case Qfalse:
+	    continue;
+	}
+	len = RARRAY_LEN(ary);
+	ptr = RARRAY_CONST_PTR(ary);
     }
+    return Qnil;
+}
+
+/*
+ *  call-seq:
+ *     ary.rindex(obj)             ->  int or nil
+ *     ary.rindex { |item| block } ->  int or nil
+ *     ary.rindex                  ->  Enumerator
+ *
+ *  Returns the _index_ of the last object in +self+ <code>==</code> to +obj+.
+ *
+ *  If a block is given instead of an argument, returns the _index_ of the
+ *  first object for which the block returns +true+, starting from the last
+ *  object.
+ *
+ *  Returns +nil+ if no match is found.
+ *
+ *  See also Array#index.
+ *
+ *  If neither block nor argument is given, an Enumerator is returned instead.
+ *
+ *     a = [ "a", "b", "b", "b", "c" ]
+ *     a.rindex("b")             #=> 3
+ *     a.rindex("z")             #=> nil
+ *     a.rindex { |x| x == "b" } #=> 3
+ */
 
-    ary2 = (struct RArray*)ary_new2(len);
-    MEMCPY(ary2->ptr, ary->ptr+beg, VALUE, len);
-    ary2->len = len;
+static VALUE
+rb_ary_rindex(int argc, VALUE *argv, VALUE ary)
+{
+    const VALUE *ptr;
+    VALUE val;
+    long i = RARRAY_LEN(ary), len;
 
-    return (VALUE)ary2;
+    if (argc == 0) {
+	RETURN_ENUMERATOR(ary, 0, 0);
+	while (i--) {
+	    if (RTEST(rb_yield(RARRAY_AREF(ary, i))))
+		return LONG2NUM(i);
+	    if (i > (len = RARRAY_LEN(ary))) {
+		i = len;
+	    }
+	}
+	return Qnil;
+    }
+    rb_check_arity(argc, 0, 1);
+    val = argv[0];
+    if (rb_block_given_p())
+	rb_warn("given block not used");
+    ptr = RARRAY_CONST_PTR(ary);
+    while (i--) {
+	VALUE e = ptr[i];
+	switch (rb_equal_opt(e, val)) {
+	  case Qundef:
+	    if (!rb_equal(e, val)) break;
+	  case Qtrue:
+	    return LONG2NUM(i);
+	  case Qfalse:
+	    continue;
+	}
+	if (i > (len = RARRAY_LEN(ary))) {
+	    i = len;
+	}
+	ptr = RARRAY_CONST_PTR(ary);
+    }
+    return Qnil;
 }
 
-extern VALUE C_Range;
+VALUE
+rb_ary_to_ary(VALUE obj)
+{
+    VALUE tmp = rb_check_array_type(obj);
+
+    if (!NIL_P(tmp)) return tmp;
+    return rb_ary_new3(1, obj);
+}
 
 static void
-range_beg_end(range, begp, lenp, len)
-    VALUE range;
-    int *begp, *lenp;
-    int len;
+rb_ary_splice(VALUE ary, long beg, long len, VALUE rpl)
 {
-    int beg, end;
+    long rlen;
+    long olen;
 
-    beg = rb_iv_get(range, "start"); beg = NUM2INT(beg);
-    end = rb_iv_get(range, "end");   end = NUM2INT(end);
+    if (len < 0) rb_raise(rb_eIndexError, "negative length (%ld)", len);
+    olen = RARRAY_LEN(ary);
     if (beg < 0) {
-	beg = len + beg;
-	if (beg < 0) beg = 0;
+	beg += olen;
+	if (beg < 0) {
+	    rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
+		     beg - olen, -olen);
+	}
     }
-    if (end < 0) {
-	end = len + end;
-	if (end < 0) end = 0;
+    if (olen < len || olen < beg + len) {
+	len = olen - beg;
     }
-    if (beg > end) {
-	int tmp;
 
-	Warning("start %d is bigger than end %d", beg, end);
-	tmp = beg; beg = end; end = tmp;
+    if (rpl == Qundef) {
+	rlen = 0;
     }
-    *begp = beg; *lenp = end - beg + 1;
+    else {
+	rpl = rb_ary_to_ary(rpl);
+	rlen = RARRAY_LEN(rpl);
+	olen = RARRAY_LEN(ary);	/* ary may be resized in rpl.to_ary too */
+    }
+    if (beg >= olen) {
+	VALUE target_ary;
+	if (beg > ARY_MAX_SIZE - rlen) {
+	    rb_raise(rb_eIndexError, "index %ld too big", beg);
+	}
+	target_ary = ary_ensure_room_for_push(ary, rlen-len); /* len is 0 or negative */
+	len = beg + rlen;
+	ary_mem_clear(ary, olen, beg - olen);
+	if (rlen > 0) {
+	    ary_memcpy0(ary, beg, rlen, RARRAY_CONST_PTR(rpl), target_ary);
+	}
+	ARY_SET_LEN(ary, len);
+    }
+    else {
+	long alen;
+
+	if (olen - len > ARY_MAX_SIZE - rlen) {
+	    rb_raise(rb_eIndexError, "index %ld too big", olen + rlen - len);
+	}
+	rb_ary_modify(ary);
+	alen = olen + rlen - len;
+	if (alen >= ARY_CAPA(ary)) {
+	    ary_double_capa(ary, alen);
+	}
+
+	if (len != rlen) {
+	    RARRAY_PTR_USE(ary, ptr,
+			   MEMMOVE(ptr + beg + rlen, ptr + beg + len,
+				   VALUE, olen - (beg + len)));
+	    ARY_SET_LEN(ary, alen);
+	}
+	if (rlen > 0) {
+	    MEMMOVE(RARRAY_PTR(ary) + beg, RARRAY_CONST_PTR(rpl), VALUE, rlen);
+	}
+    }
+    RB_GC_GUARD(rpl);
 }
 
-static VALUE
-Fary_aref(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    struct RArray *ary;
+void
+rb_ary_set_len(VALUE ary, long len)
 {
-    VALUE arg1, arg2;
+    long capa;
 
-    if (rb_scan_args(argc, argv, "11", &arg1, &arg2) == 2) {
-	int beg, len;
+    rb_ary_modify_check(ary);
+    if (ARY_SHARED_P(ary)) {
+	rb_raise(rb_eRuntimeError, "can't set length of shared ");
+    }
+    if (len > (capa = (long)ARY_CAPA(ary))) {
+	rb_bug("probable buffer overflow: %ld for %ld", len, capa);
+    }
+    ARY_SET_LEN(ary, len);
+}
+
+/*!
+ * expands or shrinks \a ary to \a len elements.
+ * expanded region will be filled with Qnil.
+ * \param ary  an array
+ * \param len  new size
+ * \return     \a ary
+ * \post       the size of \a ary is \a len.
+ */
+VALUE
+rb_ary_resize(VALUE ary, long len)
+{
+    long olen;
 
-	beg = NUM2INT(arg1);
-	len = NUM2INT(arg2);
-	if (len <= 0) {
-	    return ary_new();
+    rb_ary_modify(ary);
+    olen = RARRAY_LEN(ary);
+    if (len == olen) return ary;
+    if (len > ARY_MAX_SIZE) {
+	rb_raise(rb_eIndexError, "index %ld too big", len);
+    }
+    if (len > olen) {
+	if (len >= ARY_CAPA(ary)) {
+	    ary_double_capa(ary, len);
 	}
-	return ary_subseq(ary, beg, len);
+	ary_mem_clear(ary, olen, len - olen);
+	ARY_SET_LEN(ary, len);
     }
-
-    /* special case - speeding up */
-    if (FIXNUM_P(arg1)) {
-	return ary_entry(ary, NUM2INT(arg1));
+    else if (ARY_EMBED_P(ary)) {
+        ARY_SET_EMBED_LEN(ary, len);
+    }
+    else if (len <= RARRAY_EMBED_LEN_MAX) {
+	VALUE tmp[RARRAY_EMBED_LEN_MAX];
+	MEMCPY(tmp, ARY_HEAP_PTR(ary), VALUE, len);
+	ary_discard(ary);
+	MEMCPY((VALUE *)ARY_EMBED_PTR(ary), tmp, VALUE, len); /* WB: no new reference */
+        ARY_SET_EMBED_LEN(ary, len);
     }
+    else {
+	if (olen > len + ARY_DEFAULT_SIZE) {
+	    SIZED_REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, len, RARRAY(ary)->as.heap.aux.capa);
+	    ARY_SET_CAPA(ary, len);
+	}
+	ARY_SET_HEAP_LEN(ary, len);
+    }
+    return ary;
+}
 
-    /* check if idx is Range */
-    if (obj_is_kind_of(arg1, C_Range)) {
-	int beg, len;
+/*
+ *  call-seq:
+ *     ary[index]         = obj                      ->  obj
+ *     ary[start, length] = obj or other_ary or nil  ->  obj or other_ary or nil
+ *     ary[range]         = obj or other_ary or nil  ->  obj or other_ary or nil
+ *
+ *  Element Assignment --- Sets the element at +index+, or replaces a subarray
+ *  from the +start+ index for +length+ elements, or replaces a subarray
+ *  specified by the +range+ of indices.
+ *
+ *  If indices are greater than the current capacity of the array, the array
+ *  grows automatically.  Elements are inserted into the array at +start+ if
+ *  +length+ is zero.
+ *
+ *  Negative indices will count backward from the end of the array.  For
+ *  +start+ and +range+ cases the starting index is just before an element.
+ *
+ *  An IndexError is raised if a negative index points past the beginning of
+ *  the array.
+ *
+ *  See also Array#push, and Array#unshift.
+ *
+ *     a = Array.new
+ *     a[4] = "4";                 #=> [nil, nil, nil, nil, "4"]
+ *     a[0, 3] = [ 'a', 'b', 'c' ] #=> ["a", "b", "c", nil, "4"]
+ *     a[1..2] = [ 1, 2 ]          #=> ["a", 1, 2, nil, "4"]
+ *     a[0, 2] = "?"               #=> ["?", 2, nil, "4"]
+ *     a[0..2] = "A"               #=> ["A", "4"]
+ *     a[-1]   = "Z"               #=> ["A", "Z"]
+ *     a[1..-1] = nil              #=> ["A", nil]
+ *     a[1..-1] = []               #=> ["A"]
+ *     a[0, 0] = [ 1, 2 ]          #=> [1, 2, "A"]
+ *     a[3, 0] = "B"               #=> [1, 2, "A", "B"]
+ */
 
-	range_beg_end(arg1, &beg, &len, ary->len);
-	return ary_subseq(ary, beg, len);
+static VALUE
+rb_ary_aset(int argc, VALUE *argv, VALUE ary)
+{
+    long offset, beg, len;
+
+    if (argc == 3) {
+	rb_ary_modify_check(ary);
+	beg = NUM2LONG(argv[0]);
+	len = NUM2LONG(argv[1]);
+	rb_ary_splice(ary, beg, len, argv[2]);
+	return argv[2];
+    }
+    rb_check_arity(argc, 2, 2);
+    rb_ary_modify_check(ary);
+    if (FIXNUM_P(argv[0])) {
+	offset = FIX2LONG(argv[0]);
+	goto fixnum;
+    }
+    if (rb_range_beg_len(argv[0], &beg, &len, RARRAY_LEN(ary), 1)) {
+	/* check if idx is Range */
+	rb_ary_splice(ary, beg, len, argv[1]);
+	return argv[1];
     }
 
-    return ary_entry(ary, NUM2INT(arg1));
+    offset = NUM2LONG(argv[0]);
+fixnum:
+    rb_ary_store(ary, offset, argv[1]);
+    return argv[1];
 }
 
+/*
+ *  call-seq:
+ *     ary.insert(index, obj...)  -> ary
+ *
+ *  Inserts the given values before the element with the given +index+.
+ *
+ *  Negative indices count backwards from the end of the array, where +-1+ is
+ *  the last element. If a negative index is used, the given values will be
+ *  inserted after that element, so using an index of +-1+ will insert the
+ *  values at the end of the array.
+ *
+ *     a = %w{ a b c d }
+ *     a.insert(2, 99)         #=> ["a", "b", 99, "c", "d"]
+ *     a.insert(-2, 1, 2, 3)   #=> ["a", "b", 99, "c", 1, 2, 3, "d"]
+ */
+
 static VALUE
-Fary_index(ary, val)
-    struct RArray *ary;
-    VALUE val;
+rb_ary_insert(int argc, VALUE *argv, VALUE ary)
 {
-    int i;
+    long pos;
+
+    rb_check_arity(argc, 1, UNLIMITED_ARGUMENTS);
+    rb_ary_modify_check(ary);
+    pos = NUM2LONG(argv[0]);
+    if (argc == 1) return ary;
+    if (pos == -1) {
+	pos = RARRAY_LEN(ary);
+    }
+    if (pos < 0) {
+	pos++;
+    }
+    rb_ary_splice(ary, pos, 0, rb_ary_new4(argc - 1, argv + 1));
+    return ary;
+}
 
-    for (i=0; i<ary->len; i++) {
-	if (rb_equal(ary->ptr[i], val))
-	    return INT2FIX(i);
+static VALUE
+rb_ary_length(VALUE ary);
+
+static VALUE
+ary_enum_length(VALUE ary, VALUE args, VALUE eobj)
+{
+    return rb_ary_length(ary);
+}
+
+/*
+ *  call-seq:
+ *     ary.each { |item| block }  -> ary
+ *     ary.each                   -> Enumerator
+ *
+ *  Calls the given block once for each element in +self+, passing that element
+ *  as a parameter.  Returns the array itself.
+ *
+ *  If no block is given, an Enumerator is returned.
+ *
+ *     a = [ "a", "b", "c" ]
+ *     a.each {|x| print x, " -- " }
+ *
+ *  produces:
+ *
+ *     a -- b -- c --
+ */
+
+VALUE
+rb_ary_each(VALUE ary)
+{
+    long i;
+
+    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+	rb_yield(RARRAY_AREF(ary, i));
     }
-    return Qnil;
+    return ary;
 }
 
+/*
+ *  call-seq:
+ *     ary.each_index { |index| block }  -> ary
+ *     ary.each_index                    -> Enumerator
+ *
+ *  Same as Array#each, but passes the +index+ of the element instead of the
+ *  element itself.
+ *
+ *  An Enumerator is returned if no block is given.
+ *
+ *     a = [ "a", "b", "c" ]
+ *     a.each_index {|x| print x, " -- " }
+ *
+ *  produces:
+ *
+ *     0 -- 1 -- 2 --
+ */
+
 static VALUE
-Fary_indexes(ary, args)
-    struct RArray *ary, *args;
+rb_ary_each_index(VALUE ary)
 {
-    VALUE *p, *pend;
-    VALUE new_ary;
-    int i = 0;
+    long i;
+    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
 
-    if (!args || args->len == 1) {
-	args = (struct RArray*)rb_to_a(args->ptr[0]);
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+	rb_yield(LONG2NUM(i));
     }
+    return ary;
+}
 
-    new_ary = ary_new2(args->len);
+/*
+ *  call-seq:
+ *     ary.reverse_each { |item| block }  -> ary
+ *     ary.reverse_each                   -> Enumerator
+ *
+ *  Same as Array#each, but traverses +self+ in reverse order.
+ *
+ *     a = [ "a", "b", "c" ]
+ *     a.reverse_each {|x| print x, " " }
+ *
+ *  produces:
+ *
+ *     c b a
+ */
 
-    p = args->ptr; pend = p + args->len;
-    while (p < pend) {
-	astore(new_ary, i++, ary_entry(ary, NUM2INT(*p)));
-	p++;
+static VALUE
+rb_ary_reverse_each(VALUE ary)
+{
+    long len;
+
+    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+    len = RARRAY_LEN(ary);
+    while (len--) {
+	long nlen;
+	rb_yield(RARRAY_AREF(ary, len));
+	nlen = RARRAY_LEN(ary);
+	if (nlen < len) {
+	    len = nlen;
+	}
     }
-    return new_ary;
+    return ary;
+}
+
+/*
+ *  call-seq:
+ *     ary.length -> int
+ *
+ *  Returns the number of elements in +self+. May be zero.
+ *
+ *     [ 1, 2, 3, 4, 5 ].length   #=> 5
+ *     [].length                  #=> 0
+ */
+
+static VALUE
+rb_ary_length(VALUE ary)
+{
+    long len = RARRAY_LEN(ary);
+    return LONG2NUM(len);
 }
 
+/*
+ *  call-seq:
+ *     ary.empty?   -> true or false
+ *
+ *  Returns +true+ if +self+ contains no elements.
+ *
+ *     [].empty?   #=> true
+ */
+
 static VALUE
-Fary_aset(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    struct RArray *ary;
+rb_ary_empty_p(VALUE ary)
 {
-    VALUE arg1, arg2;
-    struct RArray *arg3;
-    int offset;
+    if (RARRAY_LEN(ary) == 0)
+	return Qtrue;
+    return Qfalse;
+}
 
-    if (rb_scan_args(argc, argv, "21", &arg1, &arg2, &arg3) == 3) {
-	int beg, len;
+VALUE
+rb_ary_dup(VALUE ary)
+{
+    long len = RARRAY_LEN(ary);
+    VALUE dup = rb_ary_new2(len);
+    ary_memcpy(dup, 0, len, RARRAY_CONST_PTR(ary));
+    ARY_SET_LEN(dup, len);
+    return dup;
+}
 
-	beg = NUM2INT(arg1);
-	if (TYPE(arg3) != T_ARRAY) {
-	    arg3 = (struct RArray*)rb_to_a(arg3);
+VALUE
+rb_ary_resurrect(VALUE ary)
+{
+    return rb_ary_new4(RARRAY_LEN(ary), RARRAY_CONST_PTR(ary));
+}
+
+extern VALUE rb_output_fs;
+
+static void ary_join_1(VALUE obj, VALUE ary, VALUE sep, long i, VALUE result, int *first);
+
+static VALUE
+recursive_join(VALUE obj, VALUE argp, int recur)
+{
+    VALUE *arg = (VALUE *)argp;
+    VALUE ary = arg[0];
+    VALUE sep = arg[1];
+    VALUE result = arg[2];
+    int *first = (int *)arg[3];
+
+    if (recur) {
+	rb_raise(rb_eArgError, "recursive array join");
+    }
+    else {
+	ary_join_1(obj, ary, sep, 0, result, first);
+    }
+    return Qnil;
+}
+
+static void
+ary_join_0(VALUE ary, VALUE sep, long max, VALUE result)
+{
+    long i;
+    VALUE val;
+
+    if (max > 0) rb_enc_copy(result, RARRAY_AREF(ary, 0));
+    for (i=0; i<max; i++) {
+	val = RARRAY_AREF(ary, i);
+	if (i > 0 && !NIL_P(sep))
+	    rb_str_buf_append(result, sep);
+	rb_str_buf_append(result, val);
+	if (OBJ_TAINTED(val)) OBJ_TAINT(result);
+    }
+}
+
+static void
+ary_join_1(VALUE obj, VALUE ary, VALUE sep, long i, VALUE result, int *first)
+{
+    VALUE val, tmp;
+
+    for (; i<RARRAY_LEN(ary); i++) {
+	if (i > 0 && !NIL_P(sep))
+	    rb_str_buf_append(result, sep);
+
+	val = RARRAY_AREF(ary, i);
+	if (RB_TYPE_P(val, T_STRING)) {
+	  str_join:
+	    rb_str_buf_append(result, val);
+	    *first = FALSE;
 	}
-	if (beg < 0) {
-	    beg = ary->len + beg;
-	    if (beg < 0) {
-		Fail("negative index for array(size: %d)", ary->len);
+	else if (RB_TYPE_P(val, T_ARRAY)) {
+	    obj = val;
+	  ary_join:
+	    if (val == ary) {
+		rb_raise(rb_eArgError, "recursive array join");
 	    }
-	}
-	if (beg >= ary->len) {
-	    len = beg + arg3->len;
-	    if (len >= ary->capa) {
-		ary->capa=len;
-		REALLOC_N(ary->ptr, VALUE, ary->capa);
+	    else {
+		VALUE args[4];
+
+		args[0] = val;
+		args[1] = sep;
+		args[2] = result;
+		args[3] = (VALUE)first;
+		rb_exec_recursive(recursive_join, obj, (VALUE)args);
 	    }
-	    MEMZERO(ary->ptr+ary->len, VALUE, beg-ary->len);
-	    MEMCPY(ary->ptr+beg, arg3->ptr, VALUE, arg3->len);
-	    ary->len = len;
 	}
 	else {
-	    int alen;
-
-	    len = NUM2INT(arg2);
-	    if (beg + len > ary->len) {
-		len = ary->len - beg;
+	    tmp = rb_check_string_type(val);
+	    if (!NIL_P(tmp)) {
+		val = tmp;
+		goto str_join;
 	    }
-	    if (len < 0) {
-		Fail("negative length for sub-array(size: %d)", ary->len);
+	    tmp = rb_check_convert_type(val, T_ARRAY, "Array", "to_ary");
+	    if (!NIL_P(tmp)) {
+		obj = val;
+		val = tmp;
+		goto ary_join;
 	    }
-
-	    alen = ary->len + arg3->len - len;
-	    if (alen >= ary->capa) {
-		ary->capa=alen;
-		REALLOC_N(ary->ptr, VALUE, ary->capa);
+	    val = rb_obj_as_string(val);
+	    if (*first) {
+		rb_enc_copy(result, val);
+		*first = FALSE;
 	    }
+	    goto str_join;
+	}
+    }
+}
+
+VALUE
+rb_ary_join(VALUE ary, VALUE sep)
+{
+    long len = 1, i;
+    int taint = FALSE;
+    VALUE val, tmp, result;
+
+    if (RARRAY_LEN(ary) == 0) return rb_usascii_str_new(0, 0);
+    if (OBJ_TAINTED(ary)) taint = TRUE;
 
-	    memmove(ary->ptr+beg+arg3->len, ary->ptr+beg+len,
-		    sizeof(VALUE)*(ary->len-(beg+len)));
-	    memcpy(ary->ptr+beg, arg3->ptr, sizeof(VALUE)*arg3->len);
-	    ary->len = alen;
+    if (!NIL_P(sep)) {
+	StringValue(sep);
+	len += RSTRING_LEN(sep) * (RARRAY_LEN(ary) - 1);
+    }
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+	val = RARRAY_AREF(ary, i);
+	tmp = rb_check_string_type(val);
+
+	if (NIL_P(tmp) || tmp != val) {
+	    int first;
+	    result = rb_str_buf_new(len + (RARRAY_LEN(ary)-i)*10);
+	    rb_enc_associate(result, rb_usascii_encoding());
+	    if (taint) OBJ_TAINT(result);
+	    ary_join_0(ary, sep, i, result);
+	    first = i == 0;
+	    ary_join_1(ary, ary, sep, i, result, &first);
+	    return result;
 	}
-	return (VALUE)arg3;
+
+	len += RSTRING_LEN(tmp);
     }
 
-    /* check if idx is Range */
-    if (obj_is_kind_of(arg1, C_Range)) {
-	int beg, len;
+    result = rb_str_buf_new(len);
+    if (taint) OBJ_TAINT(result);
+    ary_join_0(ary, sep, RARRAY_LEN(ary), result);
+
+    return result;
+}
+
+/*
+ *  call-seq:
+ *     ary.join(separator=$,)    -> str
+ *
+ *  Returns a string created by converting each element of the array to
+ *  a string, separated by the given +separator+.
+ *  If the +separator+ is +nil+, it uses current $,.
+ *  If both the +separator+ and $, are nil, it uses empty string.
+ *
+ *     [ "a", "b", "c" ].join        #=> "abc"
+ *     [ "a", "b", "c" ].join("-")   #=> "a-b-c"
+ */
+
+static VALUE
+rb_ary_join_m(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE sep;
+
+    rb_scan_args(argc, argv, "01", &sep);
+    if (NIL_P(sep)) sep = rb_output_fs;
+
+    return rb_ary_join(ary, sep);
+}
+
+static VALUE
+inspect_ary(VALUE ary, VALUE dummy, int recur)
+{
+    int tainted = OBJ_TAINTED(ary);
+    long i;
+    VALUE s, str;
+
+    if (recur) return rb_usascii_str_new_cstr("[...]");
+    str = rb_str_buf_new2("[");
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+	s = rb_inspect(RARRAY_AREF(ary, i));
+	if (OBJ_TAINTED(s)) tainted = TRUE;
+	if (i > 0) rb_str_buf_cat2(str, ", ");
+	else rb_enc_copy(str, s);
+	rb_str_buf_append(str, s);
+    }
+    rb_str_buf_cat2(str, "]");
+    if (tainted) OBJ_TAINT(str);
+    return str;
+}
+
+/*
+ *  call-seq:
+ *     ary.inspect  -> string
+ *     ary.to_s     -> string
+ *
+ *  Creates a string representation of +self+.
+ *
+ *     [ "a", "b", "c" ].to_s     #=> "[\"a\", \"b\", \"c\"]"
+ */
+
+static VALUE
+rb_ary_inspect(VALUE ary)
+{
+    if (RARRAY_LEN(ary) == 0) return rb_usascii_str_new2("[]");
+    return rb_exec_recursive(inspect_ary, ary, 0);
+}
+
+VALUE
+rb_ary_to_s(VALUE ary)
+{
+    return rb_ary_inspect(ary);
+}
+
+/*
+ *  call-seq:
+ *     ary.to_a     -> ary
+ *
+ *  Returns +self+.
+ *
+ *  If called on a subclass of Array, converts the receiver to an Array object.
+ */
+
+static VALUE
+rb_ary_to_a(VALUE ary)
+{
+    if (rb_obj_class(ary) != rb_cArray) {
+	VALUE dup = rb_ary_new2(RARRAY_LEN(ary));
+	rb_ary_replace(dup, ary);
+	return dup;
+    }
+    return ary;
+}
+
+/*
+ *  call-seq:
+ *     ary.to_h     -> hash
+ *
+ *  Returns the result of interpreting <i>ary</i> as an array of
+ *  <tt>[key, value]</tt> pairs.
+ *
+ *     [[:foo, :bar], [1, 2]].to_h
+ *       # => {:foo => :bar, 1 => 2}
+ */
+
+static VALUE
+rb_ary_to_h(VALUE ary)
+{
+    long i;
+    VALUE hash = rb_hash_new();
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+	const VALUE elt = rb_ary_elt(ary, i);
+	const VALUE key_value_pair = rb_check_array_type(elt);
+	if (NIL_P(key_value_pair)) {
+	    rb_raise(rb_eTypeError, "wrong element type %"PRIsVALUE" at %ld (expected array)",
+		     rb_obj_class(elt), i);
+	}
+	if (RARRAY_LEN(key_value_pair) != 2) {
+	    rb_raise(rb_eArgError, "wrong array length at %ld (expected 2, was %ld)",
+		i, RARRAY_LEN(key_value_pair));
+	}
+	rb_hash_aset(hash, RARRAY_AREF(key_value_pair, 0), RARRAY_AREF(key_value_pair, 1));
+    }
+    return hash;
+}
+
+/*
+ *  call-seq:
+ *     ary.to_ary -> ary
+ *
+ *  Returns +self+.
+ */
+
+static VALUE
+rb_ary_to_ary_m(VALUE ary)
+{
+    return ary;
+}
+
+static void
+ary_reverse(VALUE *p1, VALUE *p2)
+{
+    while (p1 < p2) {
+	VALUE tmp = *p1;
+	*p1++ = *p2;
+	*p2-- = tmp;
+    }
+}
+
+VALUE
+rb_ary_reverse(VALUE ary)
+{
+    VALUE *p2;
+    long len = RARRAY_LEN(ary);
+
+    rb_ary_modify(ary);
+    if (len > 1) {
+	RARRAY_PTR_USE(ary, p1, {
+	    p2 = p1 + len - 1;	/* points last item */
+	    ary_reverse(p1, p2);
+	}); /* WB: no new reference */
+    }
+    return ary;
+}
+
+/*
+ *  call-seq:
+ *     ary.reverse!   -> ary
+ *
+ *  Reverses +self+ in place.
+ *
+ *     a = [ "a", "b", "c" ]
+ *     a.reverse!       #=> ["c", "b", "a"]
+ *     a                #=> ["c", "b", "a"]
+ */
+
+static VALUE
+rb_ary_reverse_bang(VALUE ary)
+{
+    return rb_ary_reverse(ary);
+}
+
+/*
+ *  call-seq:
+ *     ary.reverse    -> new_ary
+ *
+ *  Returns a new array containing +self+'s elements in reverse order.
+ *
+ *     [ "a", "b", "c" ].reverse   #=> ["c", "b", "a"]
+ *     [ 1 ].reverse               #=> [1]
+ */
+
+static VALUE
+rb_ary_reverse_m(VALUE ary)
+{
+    long len = RARRAY_LEN(ary);
+    VALUE dup = rb_ary_new2(len);
+
+    if (len > 0) {
+	const VALUE *p1 = RARRAY_CONST_PTR(ary);
+	VALUE *p2 = (VALUE *)RARRAY_CONST_PTR(dup) + len - 1;
+	do *p2-- = *p1++; while (--len > 0);
+    }
+    ARY_SET_LEN(dup, RARRAY_LEN(ary));
+    return dup;
+}
+
+static inline long
+rotate_count(long cnt, long len)
+{
+    return (cnt < 0) ? (len - (~cnt % len) - 1) : (cnt % len);
+}
 
-	Check_Type(arg2, T_ARRAY);
-	range_beg_end(arg1, &beg, &len, ary->len);
-	if (ary->len < beg) {
-	    len = beg + RARRAY(arg2)->len;
-	    if (len >= ary->capa) {
-		ary->capa=len;
-		REALLOC_N(ary->ptr, VALUE, ary->capa);
+VALUE
+rb_ary_rotate(VALUE ary, long cnt)
+{
+    rb_ary_modify(ary);
+
+    if (cnt != 0) {
+	VALUE *ptr = RARRAY_PTR(ary);
+	long len = RARRAY_LEN(ary);
+
+	if (len > 0 && (cnt = rotate_count(cnt, len)) > 0) {
+	    --len;
+	    if (cnt < len) ary_reverse(ptr + cnt, ptr + len);
+	    if (--cnt > 0) ary_reverse(ptr, ptr + cnt);
+	    if (len > 0) ary_reverse(ptr, ptr + len);
+	    return ary;
+	}
+    }
+
+    return Qnil;
+}
+
+/*
+ *  call-seq:
+ *     ary.rotate!(count=1)   -> ary
+ *
+ *  Rotates +self+ in place so that the element at +count+ comes first, and
+ *  returns +self+.
+ *
+ *  If +count+ is negative then it rotates in the opposite direction, starting
+ *  from the end of the array where +-1+ is the last element.
+ *
+ *     a = [ "a", "b", "c", "d" ]
+ *     a.rotate!        #=> ["b", "c", "d", "a"]
+ *     a                #=> ["b", "c", "d", "a"]
+ *     a.rotate!(2)     #=> ["d", "a", "b", "c"]
+ *     a.rotate!(-3)    #=> ["a", "b", "c", "d"]
+ */
+
+static VALUE
+rb_ary_rotate_bang(int argc, VALUE *argv, VALUE ary)
+{
+    long n = 1;
+
+    switch (argc) {
+      case 1: n = NUM2LONG(argv[0]);
+      case 0: break;
+      default: rb_scan_args(argc, argv, "01", NULL);
+    }
+    rb_ary_rotate(ary, n);
+    return ary;
+}
+
+/*
+ *  call-seq:
+ *     ary.rotate(count=1)    -> new_ary
+ *
+ *  Returns a new array by rotating +self+ so that the element at +count+ is
+ *  the first element of the new array.
+ *
+ *  If +count+ is negative then it rotates in the opposite direction, starting
+ *  from the end of +self+ where +-1+ is the last element.
+ *
+ *     a = [ "a", "b", "c", "d" ]
+ *     a.rotate         #=> ["b", "c", "d", "a"]
+ *     a                #=> ["a", "b", "c", "d"]
+ *     a.rotate(2)      #=> ["c", "d", "a", "b"]
+ *     a.rotate(-3)     #=> ["b", "c", "d", "a"]
+ */
+
+static VALUE
+rb_ary_rotate_m(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE rotated;
+    const VALUE *ptr;
+    long len, cnt = 1;
+
+    switch (argc) {
+      case 1: cnt = NUM2LONG(argv[0]);
+      case 0: break;
+      default: rb_scan_args(argc, argv, "01", NULL);
+    }
+
+    len = RARRAY_LEN(ary);
+    rotated = rb_ary_new2(len);
+    if (len > 0) {
+	cnt = rotate_count(cnt, len);
+	ptr = RARRAY_CONST_PTR(ary);
+	len -= cnt;
+	ary_memcpy(rotated, 0, len, ptr + cnt);
+	ary_memcpy(rotated, len, cnt, ptr);
+    }
+    ARY_SET_LEN(rotated, RARRAY_LEN(ary));
+    return rotated;
+}
+
+struct ary_sort_data {
+    VALUE ary;
+    int opt_methods;
+    int opt_inited;
+};
+
+enum {
+    sort_opt_Fixnum,
+    sort_opt_String,
+    sort_optimizable_count
+};
+
+#define STRING_P(s) (RB_TYPE_P((s), T_STRING) && CLASS_OF(s) == rb_cString)
+
+#define SORT_OPTIMIZABLE_BIT(type) (1U << TOKEN_PASTE(sort_opt_,type))
+#define SORT_OPTIMIZABLE(data, type) \
+    (((data)->opt_inited & SORT_OPTIMIZABLE_BIT(type)) ? \
+     ((data)->opt_methods & SORT_OPTIMIZABLE_BIT(type)) : \
+     (((data)->opt_inited |= SORT_OPTIMIZABLE_BIT(type)), \
+      rb_method_basic_definition_p(TOKEN_PASTE(rb_c,type), id_cmp) && \
+      ((data)->opt_methods |= SORT_OPTIMIZABLE_BIT(type))))
+
+static VALUE
+sort_reentered(VALUE ary)
+{
+    if (RBASIC(ary)->klass) {
+	rb_raise(rb_eRuntimeError, "sort reentered");
+    }
+    return Qnil;
+}
+
+static int
+sort_1(const void *ap, const void *bp, void *dummy)
+{
+    struct ary_sort_data *data = dummy;
+    VALUE retval = sort_reentered(data->ary);
+    VALUE a = *(const VALUE *)ap, b = *(const VALUE *)bp;
+    int n;
+
+    retval = rb_yield_values(2, a, b);
+    n = rb_cmpint(retval, a, b);
+    sort_reentered(data->ary);
+    return n;
+}
+
+static int
+sort_2(const void *ap, const void *bp, void *dummy)
+{
+    struct ary_sort_data *data = dummy;
+    VALUE retval = sort_reentered(data->ary);
+    VALUE a = *(const VALUE *)ap, b = *(const VALUE *)bp;
+    int n;
+
+    if (FIXNUM_P(a) && FIXNUM_P(b) && SORT_OPTIMIZABLE(data, Fixnum)) {
+	if ((long)a > (long)b) return 1;
+	if ((long)a < (long)b) return -1;
+	return 0;
+    }
+    if (STRING_P(a) && STRING_P(b) && SORT_OPTIMIZABLE(data, String)) {
+	return rb_str_cmp(a, b);
+    }
+
+    retval = rb_funcallv(a, id_cmp, 1, &b);
+    n = rb_cmpint(retval, a, b);
+    sort_reentered(data->ary);
+
+    return n;
+}
+
+/*
+ *  call-seq:
+ *     ary.sort!                   -> ary
+ *     ary.sort! { |a, b| block }  -> ary
+ *
+ *  Sorts +self+ in place.
+ *
+ *  Comparisons for the sort will be done using the <code><=></code> operator
+ *  or using an optional code block.
+ *
+ *  The block must implement a comparison between +a+ and +b+ and return
+ *  an integer less than 0 when +b+ follows +a+, +0+ when +a+ and +b+
+ *  are equivalent, or an integer greater than 0 when +a+ follows +b+.
+ *
+ *  See also Enumerable#sort_by.
+ *
+ *     a = [ "d", "a", "e", "c", "b" ]
+ *     a.sort!                    #=> ["a", "b", "c", "d", "e"]
+ *     a.sort! { |x,y| y <=> x }  #=> ["e", "d", "c", "b", "a"]
+ */
+
+VALUE
+rb_ary_sort_bang(VALUE ary)
+{
+    rb_ary_modify(ary);
+    assert(!ARY_SHARED_P(ary));
+    if (RARRAY_LEN(ary) > 1) {
+	VALUE tmp = ary_make_substitution(ary); /* only ary refers tmp */
+	struct ary_sort_data data;
+	long len = RARRAY_LEN(ary);
+
+	RBASIC_CLEAR_CLASS(tmp);
+	data.ary = tmp;
+	data.opt_methods = 0;
+	data.opt_inited = 0;
+	RARRAY_PTR_USE(tmp, ptr, {
+	    ruby_qsort(ptr, len, sizeof(VALUE),
+		       rb_block_given_p()?sort_1:sort_2, &data);
+	}); /* WB: no new reference */
+	rb_ary_modify(ary);
+        if (ARY_EMBED_P(tmp)) {
+            if (ARY_SHARED_P(ary)) { /* ary might be destructively operated in the given block */
+                rb_ary_unshare(ary);
+		FL_SET_EMBED(ary);
+            }
+	    ary_memcpy(ary, 0, ARY_EMBED_LEN(tmp), ARY_EMBED_PTR(tmp));
+            ARY_SET_LEN(ary, ARY_EMBED_LEN(tmp));
+        }
+        else {
+            if (!ARY_EMBED_P(ary) && ARY_HEAP_PTR(ary) == ARY_HEAP_PTR(tmp)) {
+                FL_UNSET_SHARED(ary);
+                ARY_SET_CAPA(ary, RARRAY_LEN(tmp));
+            }
+            else {
+                assert(!ARY_SHARED_P(tmp));
+                if (ARY_EMBED_P(ary)) {
+                    FL_UNSET_EMBED(ary);
+                }
+                else if (ARY_SHARED_P(ary)) {
+                    /* ary might be destructively operated in the given block */
+                    rb_ary_unshare(ary);
+                }
+                else {
+		    ruby_sized_xfree((void *)ARY_HEAP_PTR(ary), ARY_HEAP_SIZE(ary));
+                }
+                ARY_SET_PTR(ary, RARRAY_CONST_PTR(tmp));
+                ARY_SET_HEAP_LEN(ary, len);
+                ARY_SET_CAPA(ary, RARRAY_LEN(tmp));
+            }
+            /* tmp was lost ownership for the ptr */
+            FL_UNSET(tmp, FL_FREEZE);
+            FL_SET_EMBED(tmp);
+            ARY_SET_EMBED_LEN(tmp, 0);
+            FL_SET(tmp, FL_FREEZE);
+	}
+        /* tmp will be GC'ed. */
+        RBASIC_SET_CLASS_RAW(tmp, rb_cArray); /* rb_cArray must be marked */
+    }
+    return ary;
+}
+
+/*
+ *  call-seq:
+ *     ary.sort                   -> new_ary
+ *     ary.sort { |a, b| block }  -> new_ary
+ *
+ *  Returns a new array created by sorting +self+.
+ *
+ *  Comparisons for the sort will be done using the <code><=></code> operator
+ *  or using an optional code block.
+ *
+ *  The block must implement a comparison between +a+ and +b+ and return
+ *  an integer less than 0 when +b+ follows +a+, +0+ when +a+ and +b+
+ *  are equivalent, or an integer greater than 0 when +a+ follows +b+.
+ *
+ *
+ *  See also Enumerable#sort_by.
+ *
+ *     a = [ "d", "a", "e", "c", "b" ]
+ *     a.sort                    #=> ["a", "b", "c", "d", "e"]
+ *     a.sort { |x,y| y <=> x }  #=> ["e", "d", "c", "b", "a"]
+ */
+
+VALUE
+rb_ary_sort(VALUE ary)
+{
+    ary = rb_ary_dup(ary);
+    rb_ary_sort_bang(ary);
+    return ary;
+}
+
+static VALUE rb_ary_bsearch_index(VALUE ary);
+
+/*
+ *  call-seq:
+ *     ary.bsearch {|x| block }  -> elem
+ *
+ *  By using binary search, finds a value from this array which meets
+ *  the given condition in O(log n) where n is the size of the array.
+ *
+ *  You can use this method in two use cases: a find-minimum mode and
+ *  a find-any mode.  In either case, the elements of the array must be
+ *  monotone (or sorted) with respect to the block.
+ *
+ *  In find-minimum mode (this is a good choice for typical use case),
+ *  the block must return true or false, and there must be an index i
+ *  (0 <= i <= ary.size) so that:
+ *
+ *  - the block returns false for any element whose index is less than
+ *    i, and
+ *  - the block returns true for any element whose index is greater
+ *    than or equal to i.
+ *
+ *  This method returns the i-th element.  If i is equal to ary.size,
+ *  it returns nil.
+ *
+ *     ary = [0, 4, 7, 10, 12]
+ *     ary.bsearch {|x| x >=   4 } #=> 4
+ *     ary.bsearch {|x| x >=   6 } #=> 7
+ *     ary.bsearch {|x| x >=  -1 } #=> 0
+ *     ary.bsearch {|x| x >= 100 } #=> nil
+ *
+ *  In find-any mode (this behaves like libc's bsearch(3)), the block
+ *  must return a number, and there must be two indices i and j
+ *  (0 <= i <= j <= ary.size) so that:
+ *
+ *  - the block returns a positive number for ary[k] if 0 <= k < i,
+ *  - the block returns zero for ary[k] if i <= k < j, and
+ *  - the block returns a negative number for ary[k] if
+ *    j <= k < ary.size.
+ *
+ *  Under this condition, this method returns any element whose index
+ *  is within i...j.  If i is equal to j (i.e., there is no element
+ *  that satisfies the block), this method returns nil.
+ *
+ *     ary = [0, 4, 7, 10, 12]
+ *     # try to find v such that 4 <= v < 8
+ *     ary.bsearch {|x| 1 - x / 4 } #=> 4 or 7
+ *     # try to find v such that 8 <= v < 10
+ *     ary.bsearch {|x| 4 - x / 2 } #=> nil
+ *
+ *  You must not mix the two modes at a time; the block must always
+ *  return either true/false, or always return a number.  It is
+ *  undefined which value is actually picked up at each iteration.
+ */
+
+static VALUE
+rb_ary_bsearch(VALUE ary)
+{
+    VALUE index_result = rb_ary_bsearch_index(ary);
+
+    if (FIXNUM_P(index_result)) {
+	return rb_ary_entry(ary, FIX2LONG(index_result));
+    }
+    return index_result;
+}
+
+/*
+ *  call-seq:
+ *     ary.bsearch_index {|x| block }  -> int or nil
+ *
+ *  By using binary search, finds an index of a value from this array which
+ *  meets the given condition in O(log n) where n is the size of the array.
+ *
+ *  It supports two modes, depending on the nature of the block and they are
+ *  exactly the same as in the case of #bsearch method with the only difference
+ *  being that this method returns the index of the element instead of the
+ *  element itself. For more details consult the documentation for #bsearch.
+ */
+
+static VALUE
+rb_ary_bsearch_index(VALUE ary)
+{
+    long low = 0, high = RARRAY_LEN(ary), mid;
+    int smaller = 0, satisfied = 0;
+    VALUE v, val;
+
+    RETURN_ENUMERATOR(ary, 0, 0);
+    while (low < high) {
+	mid = low + ((high - low) / 2);
+	val = rb_ary_entry(ary, mid);
+	v = rb_yield(val);
+	if (FIXNUM_P(v)) {
+	    if (v == INT2FIX(0)) return INT2FIX(mid);
+	    smaller = (SIGNED_VALUE)v < 0; /* Fixnum preserves its sign-bit */
+	}
+	else if (v == Qtrue) {
+	    satisfied = 1;
+	    smaller = 1;
+	}
+	else if (v == Qfalse || v == Qnil) {
+	    smaller = 0;
+	}
+	else if (rb_obj_is_kind_of(v, rb_cNumeric)) {
+	    const VALUE zero = INT2FIX(0);
+	    switch (rb_cmpint(rb_funcallv(v, id_cmp, 1, &zero), v, zero)) {
+	      case 0: return INT2FIX(mid);
+	      case 1: smaller = 1; break;
+	      case -1: smaller = 0;
 	    }
-	    MEMZERO(ary->ptr+ary->len, VALUE, beg-ary->len);
-	    MEMCPY(ary->ptr+beg, RARRAY(arg2)->ptr, VALUE, RARRAY(arg2)->len);
-	    ary->len = len;
 	}
 	else {
-	    int alen;
+	    rb_raise(rb_eTypeError, "wrong argument type %"PRIsVALUE
+		     " (must be numeric, true, false or nil)",
+		     rb_obj_class(v));
+	}
+	if (smaller) {
+	    high = mid;
+	}
+	else {
+	    low = mid + 1;
+	}
+    }
+    if (!satisfied) return Qnil;
+    return INT2FIX(low);
+}
 
-	    alen = ary->len + RARRAY(arg2)->len - len;
-	    if (alen >= ary->capa) {
-		ary->capa=alen;
-		REALLOC_N(ary->ptr, VALUE, ary->capa);
+
+static VALUE
+sort_by_i(RB_BLOCK_CALL_FUNC_ARGLIST(i, dummy))
+{
+    return rb_yield(i);
+}
+
+/*
+ *  call-seq:
+ *     ary.sort_by! { |obj| block }    -> ary
+ *     ary.sort_by!                    -> Enumerator
+ *
+ *  Sorts +self+ in place using a set of keys generated by mapping the
+ *  values in +self+ through the given block.
+ *
+ *  If no block is given, an Enumerator is returned instead.
+ *
+ */
+
+static VALUE
+rb_ary_sort_by_bang(VALUE ary)
+{
+    VALUE sorted;
+
+    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+    rb_ary_modify(ary);
+    sorted = rb_block_call(ary, rb_intern("sort_by"), 0, 0, sort_by_i, 0);
+    rb_ary_replace(ary, sorted);
+    return ary;
+}
+
+
+/*
+ *  call-seq:
+ *     ary.collect { |item| block }  -> new_ary
+ *     ary.map     { |item| block }  -> new_ary
+ *     ary.collect                   -> Enumerator
+ *     ary.map                       -> Enumerator
+ *
+ *  Invokes the given block once for each element of +self+.
+ *
+ *  Creates a new array containing the values returned by the block.
+ *
+ *  See also Enumerable#collect.
+ *
+ *  If no block is given, an Enumerator is returned instead.
+ *
+ *     a = [ "a", "b", "c", "d" ]
+ *     a.collect { |x| x + "!" }         #=> ["a!", "b!", "c!", "d!"]
+ *     a.map.with_index { |x, i| x * i } #=> ["", "b", "cc", "ddd"]
+ *     a                                 #=> ["a", "b", "c", "d"]
+ */
+
+static VALUE
+rb_ary_collect(VALUE ary)
+{
+    long i;
+    VALUE collect;
+
+    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+    collect = rb_ary_new2(RARRAY_LEN(ary));
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+	rb_ary_push(collect, rb_yield(RARRAY_AREF(ary, i)));
+    }
+    return collect;
+}
+
+
+/*
+ *  call-seq:
+ *     ary.collect! {|item| block }   -> ary
+ *     ary.map!     {|item| block }   -> ary
+ *     ary.collect!                   -> Enumerator
+ *     ary.map!                       -> Enumerator
+ *
+ *  Invokes the given block once for each element of +self+, replacing the
+ *  element with the value returned by the block.
+ *
+ *  See also Enumerable#collect.
+ *
+ *  If no block is given, an Enumerator is returned instead.
+ *
+ *     a = [ "a", "b", "c", "d" ]
+ *     a.map! {|x| x + "!" }
+ *     a #=>  [ "a!", "b!", "c!", "d!" ]
+ *     a.collect!.with_index {|x, i| x[0...i] }
+ *     a #=>  ["", "b", "c!", "d!"]
+ */
+
+static VALUE
+rb_ary_collect_bang(VALUE ary)
+{
+    long i;
+
+    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+    rb_ary_modify(ary);
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+	rb_ary_store(ary, i, rb_yield(RARRAY_AREF(ary, i)));
+    }
+    return ary;
+}
+
+VALUE
+rb_get_values_at(VALUE obj, long olen, int argc, const VALUE *argv, VALUE (*func) (VALUE, long))
+{
+    VALUE result = rb_ary_new2(argc);
+    long beg, len, i, j;
+
+    for (i=0; i<argc; i++) {
+	if (FIXNUM_P(argv[i])) {
+	    rb_ary_push(result, (*func)(obj, FIX2LONG(argv[i])));
+	    continue;
+	}
+	/* check if idx is Range */
+	if (rb_range_beg_len(argv[i], &beg, &len, olen, 1)) {
+	    long end = olen < beg+len ? olen : beg+len;
+	    for (j = beg; j < end; j++) {
+		rb_ary_push(result, (*func)(obj, j));
 	    }
+	    if (beg + len > j)
+		rb_ary_resize(result, RARRAY_LEN(result) + (beg + len) - j);
+	    continue;
+	}
+	rb_ary_push(result, (*func)(obj, NUM2LONG(argv[i])));
+    }
+    return result;
+}
+
+/*
+ *  call-seq:
+ *     ary.values_at(selector, ...)  -> new_ary
+ *
+ *  Returns an array containing the elements in +self+ corresponding to the
+ *  given +selector+(s).
+ *
+ *  The selectors may be either integer indices or ranges.
+ *
+ *  See also Array#select.
+ *
+ *     a = %w{ a b c d e f }
+ *     a.values_at(1, 3, 5)          # => ["b", "d", "f"]
+ *     a.values_at(1, 3, 5, 7)       # => ["b", "d", "f", nil]
+ *     a.values_at(-1, -2, -2, -7)   # => ["f", "e", "e", nil]
+ *     a.values_at(4..6, 3...6)      # => ["e", "f", nil, "d", "e", "f"]
+ */
+
+static VALUE
+rb_ary_values_at(int argc, VALUE *argv, VALUE ary)
+{
+    return rb_get_values_at(ary, RARRAY_LEN(ary), argc, argv, rb_ary_entry);
+}
+
+
+/*
+ *  call-seq:
+ *     ary.select { |item| block } -> new_ary
+ *     ary.select                  -> Enumerator
+ *
+ *  Returns a new array containing all elements of +ary+
+ *  for which the given +block+ returns a true value.
+ *
+ *  If no block is given, an Enumerator is returned instead.
+ *
+ *     [1,2,3,4,5].select { |num|  num.even?  }   #=> [2, 4]
+ *
+ *     a = %w{ a b c d e f }
+ *     a.select { |v| v =~ /[aeiou]/ }  #=> ["a", "e"]
+ *
+ *  See also Enumerable#select.
+ */
 
-	    memmove(ary->ptr+beg+RARRAY(arg2)->len, ary->ptr+beg+len,
-		    sizeof(VALUE)*(ary->len-(beg+len)));
-	    memcpy(ary->ptr+beg, RARRAY(arg2)->ptr,
-		    sizeof(VALUE)*RARRAY(arg2)->len);
-	    ary->len = alen;
+static VALUE
+rb_ary_select(VALUE ary)
+{
+    VALUE result;
+    long i;
+
+    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+    result = rb_ary_new2(RARRAY_LEN(ary));
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+	if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
+	    rb_ary_push(result, rb_ary_elt(ary, i));
 	}
-	return arg2;
     }
+    return result;
+}
 
-    offset = NUM2INT(arg1);
-    if (offset < 0) {
-	offset = ary->len + offset;
+struct select_bang_arg {
+    VALUE ary;
+    long len[2];
+};
+
+static VALUE
+select_bang_i(VALUE a)
+{
+    volatile struct select_bang_arg *arg = (void *)a;
+    VALUE ary = arg->ary;
+    long i1, i2;
+
+    for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); arg->len[0] = ++i1) {
+	VALUE v = RARRAY_AREF(ary, i1);
+	if (!RTEST(rb_yield(v))) continue;
+	if (i1 != i2) {
+	    rb_ary_store(ary, i2, v);
+	}
+	arg->len[1] = ++i2;
     }
-    astore(ary, offset, arg2);
-    return arg2;
+    return (i1 == i2) ? Qnil : ary;
 }
 
 static VALUE
-Fary_each(ary)
-    struct RArray *ary;
+select_bang_ensure(VALUE a)
 {
-    int i;
+    volatile struct select_bang_arg *arg = (void *)a;
+    VALUE ary = arg->ary;
+    long len = RARRAY_LEN(ary);
+    long i1 = arg->len[0], i2 = arg->len[1];
+
+    if (i2 < len && i2 < i1) {
+	long tail = 0;
+	if (i1 < len) {
+	    tail = len - i1;
+	    RARRAY_PTR_USE(ary, ptr, {
+		    MEMMOVE(ptr + i2, ptr + i1, VALUE, tail);
+		});
+	}
+	ARY_SET_LEN(ary, i2 + tail);
+    }
+    return ary;
+}
+
+/*
+ *  call-seq:
+ *     ary.select!  {|item| block } -> ary or nil
+ *     ary.select!                  -> Enumerator
+ *
+ *  Invokes the given block passing in successive elements from +self+,
+ *  deleting elements for which the block returns a +false+ value.
+ *
+ *  The array may not be changed instantly every time the block is called.
+ *
+ *  If changes were made, it will return +self+, otherwise it returns +nil+.
+ *
+ *  See also Array#keep_if
+ *
+ *  If no block is given, an Enumerator is returned instead.
+ *
+ */
 
-    if (iterator_p()) {
-	for (i=0; i<ary->len; i++) {
-	    rb_yield(ary->ptr[i]);
+static VALUE
+rb_ary_select_bang(VALUE ary)
+{
+    struct select_bang_arg args;
+
+    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+    rb_ary_modify(ary);
+
+    args.ary = ary;
+    args.len[0] = args.len[1] = 0;
+    return rb_ensure(select_bang_i, (VALUE)&args, select_bang_ensure, (VALUE)&args);
+}
+
+/*
+ *  call-seq:
+ *     ary.keep_if { |item| block } -> ary
+ *     ary.keep_if                  -> Enumerator
+ *
+ *  Deletes every element of +self+ for which the given block evaluates to
+ *  +false+.
+ *
+ *  See also Array#select!
+ *
+ *  If no block is given, an Enumerator is returned instead.
+ *
+ *     a = %w{ a b c d e f }
+ *     a.keep_if { |v| v =~ /[aeiou]/ }  #=> ["a", "e"]
+ */
+
+static VALUE
+rb_ary_keep_if(VALUE ary)
+{
+    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+    rb_ary_select_bang(ary);
+    return ary;
+}
+
+static void
+ary_resize_smaller(VALUE ary, long len)
+{
+    rb_ary_modify(ary);
+    if (RARRAY_LEN(ary) > len) {
+	ARY_SET_LEN(ary, len);
+	if (len * 2 < ARY_CAPA(ary) &&
+	    ARY_CAPA(ary) > ARY_DEFAULT_SIZE) {
+	    ary_resize_capa(ary, len * 2);
 	}
     }
-    else {
-	return (VALUE)ary;
+}
+
+/*
+ *  call-seq:
+ *     ary.delete(obj)            -> item or nil
+ *     ary.delete(obj) { block }  -> item or result of block
+ *
+ *  Deletes all items from +self+ that are equal to +obj+.
+ *
+ *  Returns the last deleted item, or +nil+ if no matching item is found.
+ *
+ *  If the optional code block is given, the result of the block is returned if
+ *  the item is not found.  (To remove +nil+ elements and get an informative
+ *  return value, use Array#compact!)
+ *
+ *     a = [ "a", "b", "b", "b", "c" ]
+ *     a.delete("b")                   #=> "b"
+ *     a                               #=> ["a", "c"]
+ *     a.delete("z")                   #=> nil
+ *     a.delete("z") { "not found" }   #=> "not found"
+ */
+
+VALUE
+rb_ary_delete(VALUE ary, VALUE item)
+{
+    VALUE v = item;
+    long i1, i2;
+
+    for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); i1++) {
+	VALUE e = RARRAY_AREF(ary, i1);
+
+	if (rb_equal(e, item)) {
+	    v = e;
+	    continue;
+	}
+	if (i1 != i2) {
+	    rb_ary_store(ary, i2, e);
+	}
+	i2++;
+    }
+    if (RARRAY_LEN(ary) == i2) {
+	if (rb_block_given_p()) {
+	    return rb_yield(item);
+	}
+	return Qnil;
+    }
+
+    ary_resize_smaller(ary, i2);
+
+    return v;
+}
+
+void
+rb_ary_delete_same(VALUE ary, VALUE item)
+{
+    long i1, i2;
+
+    for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); i1++) {
+	VALUE e = RARRAY_AREF(ary, i1);
+
+	if (e == item) {
+	    continue;
+	}
+	if (i1 != i2) {
+	    rb_ary_store(ary, i2, e);
+	}
+	i2++;
+    }
+    if (RARRAY_LEN(ary) == i2) {
+	return;
+    }
+
+    ary_resize_smaller(ary, i2);
+}
+
+VALUE
+rb_ary_delete_at(VALUE ary, long pos)
+{
+    long len = RARRAY_LEN(ary);
+    VALUE del;
+
+    if (pos >= len) return Qnil;
+    if (pos < 0) {
+	pos += len;
+	if (pos < 0) return Qnil;
+    }
+
+    rb_ary_modify(ary);
+    del = RARRAY_AREF(ary, pos);
+    RARRAY_PTR_USE(ary, ptr, {
+	MEMMOVE(ptr+pos, ptr+pos+1, VALUE, len-pos-1);
+    });
+    ARY_INCREASE_LEN(ary, -1);
+
+    return del;
+}
+
+/*
+ *  call-seq:
+ *     ary.delete_at(index)  -> obj or nil
+ *
+ *  Deletes the element at the specified +index+, returning that element, or
+ *  +nil+ if the +index+ is out of range.
+ *
+ *  See also Array#slice!
+ *
+ *     a = ["ant", "bat", "cat", "dog"]
+ *     a.delete_at(2)    #=> "cat"
+ *     a                 #=> ["ant", "bat", "dog"]
+ *     a.delete_at(99)   #=> nil
+ */
+
+static VALUE
+rb_ary_delete_at_m(VALUE ary, VALUE pos)
+{
+    return rb_ary_delete_at(ary, NUM2LONG(pos));
+}
+
+/*
+ *  call-seq:
+ *     ary.slice!(index)         -> obj or nil
+ *     ary.slice!(start, length) -> new_ary or nil
+ *     ary.slice!(range)         -> new_ary or nil
+ *
+ *  Deletes the element(s) given by an +index+ (optionally up to +length+
+ *  elements) or by a +range+.
+ *
+ *  Returns the deleted object (or objects), or +nil+ if the +index+ is out of
+ *  range.
+ *
+ *     a = [ "a", "b", "c" ]
+ *     a.slice!(1)     #=> "b"
+ *     a               #=> ["a", "c"]
+ *     a.slice!(-1)    #=> "c"
+ *     a               #=> ["a"]
+ *     a.slice!(100)   #=> nil
+ *     a               #=> ["a"]
+ */
+
+static VALUE
+rb_ary_slice_bang(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE arg1, arg2;
+    long pos, len, orig_len;
+
+    rb_ary_modify_check(ary);
+    if (argc == 2) {
+	pos = NUM2LONG(argv[0]);
+	len = NUM2LONG(argv[1]);
+      delete_pos_len:
+	if (len < 0) return Qnil;
+	orig_len = RARRAY_LEN(ary);
+	if (pos < 0) {
+	    pos += orig_len;
+	    if (pos < 0) return Qnil;
+	}
+	else if (orig_len < pos) return Qnil;
+	if (orig_len < pos + len) {
+	    len = orig_len - pos;
+	}
+	if (len == 0) return rb_ary_new2(0);
+	arg2 = rb_ary_new4(len, RARRAY_CONST_PTR(ary)+pos);
+	RBASIC_SET_CLASS(arg2, rb_obj_class(ary));
+	rb_ary_splice(ary, pos, len, Qundef);
+	return arg2;
+    }
+
+    if (argc != 1) {
+	/* error report */
+	rb_scan_args(argc, argv, "11", NULL, NULL);
+    }
+    arg1 = argv[0];
+
+    if (!FIXNUM_P(arg1)) {
+	switch (rb_range_beg_len(arg1, &pos, &len, RARRAY_LEN(ary), 0)) {
+	  case Qtrue:
+	    /* valid range */
+	    goto delete_pos_len;
+	  case Qnil:
+	    /* invalid range */
+	    return Qnil;
+	  default:
+	    /* not a range */
+	    break;
+	}
     }
+
+    return rb_ary_delete_at(ary, NUM2LONG(arg1));
 }
 
 static VALUE
-Fary_each_index(ary)
-    struct RArray *ary;
+ary_reject(VALUE orig, VALUE result)
 {
-    int i;
+    long i;
 
-    for (i=0; i<ary->len; i++) {
-	rb_yield(INT2FIX(i));
+    for (i = 0; i < RARRAY_LEN(orig); i++) {
+	VALUE v = RARRAY_AREF(orig, i);
+	if (!RTEST(rb_yield(v))) {
+	    rb_ary_push(result, v);
+	}
     }
+    return result;
 }
 
 static VALUE
-Fary_length(ary)
-    struct RArray *ary;
+reject_bang_i(VALUE a)
 {
-    return INT2FIX(ary->len);
+    volatile struct select_bang_arg *arg = (void *)a;
+    VALUE ary = arg->ary;
+    long i1, i2;
+
+    for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); arg->len[0] = ++i1) {
+	VALUE v = RARRAY_AREF(ary, i1);
+	if (RTEST(rb_yield(v))) continue;
+	if (i1 != i2) {
+	    rb_ary_store(ary, i2, v);
+	}
+	arg->len[1] = ++i2;
+    }
+    return (i1 == i2) ? Qnil : ary;
 }
 
 static VALUE
-ary_clone(ary)
-    struct RArray *ary;
+ary_reject_bang(VALUE ary)
 {
-    VALUE ary2 = ary_new2(ary->len);
+    struct select_bang_arg args;
 
-    CLONESETUP(ary2, ary);
-    MEMCPY(RARRAY(ary2)->ptr, ary->ptr, VALUE, ary->len);
-    RARRAY(ary2)->len = ary->len;
-    return ary2;
+    rb_ary_modify_check(ary);
+    args.ary = ary;
+    args.len[0] = args.len[1] = 0;
+    return rb_ensure(reject_bang_i, (VALUE)&args, select_bang_ensure, (VALUE)&args);
+}
+
+/*
+ *  call-seq:
+ *     ary.reject! { |item| block }  -> ary or nil
+ *     ary.reject!                   -> Enumerator
+ *
+ *  Deletes every element of +self+ for which the block evaluates to +true+,
+ *  if no changes were made returns +nil+.
+ *
+ *  The array may not be changed instantly every time the block is called.
+ *
+ *  See also Enumerable#reject and Array#delete_if.
+ *
+ *  If no block is given, an Enumerator is returned instead.
+ */
+
+static VALUE
+rb_ary_reject_bang(VALUE ary)
+{
+    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+    return ary_reject_bang(ary);
+}
+
+/*
+ *  call-seq:
+ *     ary.reject  {|item| block }  -> new_ary
+ *     ary.reject                   -> Enumerator
+ *
+ *  Returns a new array containing the items in +self+ for which the given
+ *  block is not +true+. The ordering of non-rejected elements is maintained.
+ *
+ *  See also Array#delete_if
+ *
+ *  If no block is given, an Enumerator is returned instead.
+ */
+
+static VALUE
+rb_ary_reject(VALUE ary)
+{
+    VALUE rejected_ary;
+
+    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+    rejected_ary = rb_ary_new();
+    ary_reject(ary, rejected_ary);
+    return rejected_ary;
+}
+
+/*
+ *  call-seq:
+ *     ary.delete_if { |item| block }  -> ary
+ *     ary.delete_if                   -> Enumerator
+ *
+ *  Deletes every element of +self+ for which block evaluates to +true+.
+ *
+ *  The array is changed instantly every time the block is called, not after
+ *  the iteration is over.
+ *
+ *  See also Array#reject!
+ *
+ *  If no block is given, an Enumerator is returned instead.
+ *
+ *     scores = [ 97, 42, 75 ]
+ *     scores.delete_if {|score| score < 80 }   #=> [97]
+ */
+
+static VALUE
+rb_ary_delete_if(VALUE ary)
+{
+    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+    ary_reject_bang(ary);
+    return ary;
+}
+
+static VALUE
+take_i(RB_BLOCK_CALL_FUNC_ARGLIST(val, cbarg))
+{
+    VALUE *args = (VALUE *)cbarg;
+    if (args[1]-- == 0) rb_iter_break();
+    if (argc > 1) val = rb_ary_new4(argc, argv);
+    rb_ary_push(args[0], val);
+    return Qnil;
 }
 
-extern VALUE OFS;
+static VALUE
+take_items(VALUE obj, long n)
+{
+    VALUE result = rb_check_array_type(obj);
+    VALUE args[2];
+
+    if (!NIL_P(result)) return rb_ary_subseq(result, 0, n);
+    result = rb_ary_new2(n);
+    args[0] = result; args[1] = (VALUE)n;
+    if (rb_check_block_call(obj, idEach, 0, 0, take_i, (VALUE)args) == Qundef)
+	rb_raise(rb_eTypeError, "wrong argument type %"PRIsVALUE" (must respond to :each)",
+		 rb_obj_class(obj));
+    return result;
+}
+
+
+/*
+ *  call-seq:
+ *     ary.zip(arg, ...)                  -> new_ary
+ *     ary.zip(arg, ...) { |arr| block }  -> nil
+ *
+ *  Converts any arguments to arrays, then merges elements of +self+ with
+ *  corresponding elements from each argument.
+ *
+ *  This generates a sequence of <code>ary.size</code> _n_-element arrays,
+ *  where _n_ is one more than the count of arguments.
+ *
+ *  If the size of any argument is less than the size of the initial array,
+ *  +nil+ values are supplied.
+ *
+ *  If a block is given, it is invoked for each output +array+, otherwise an
+ *  array of arrays is returned.
+ *
+ *     a = [ 4, 5, 6 ]
+ *     b = [ 7, 8, 9 ]
+ *     [1, 2, 3].zip(a, b)   #=> [[1, 4, 7], [2, 5, 8], [3, 6, 9]]
+ *     [1, 2].zip(a, b)      #=> [[1, 4, 7], [2, 5, 8]]
+ *     a.zip([1, 2], [8])    #=> [[4, 1, 8], [5, 2, nil], [6, nil, nil]]
+ */
+
+static VALUE
+rb_ary_zip(int argc, VALUE *argv, VALUE ary)
+{
+    int i, j;
+    long len = RARRAY_LEN(ary);
+    VALUE result = Qnil;
+
+    for (i=0; i<argc; i++) {
+	argv[i] = take_items(argv[i], len);
+    }
+
+    if (rb_block_given_p()) {
+	int arity = rb_block_arity();
+
+	if (arity > 1) {
+	    VALUE work, *tmp;
+
+	    tmp = ALLOCV_N(VALUE, work, argc+1);
+
+	    for (i=0; i<RARRAY_LEN(ary); i++) {
+		tmp[0] = RARRAY_AREF(ary, i);
+		for (j=0; j<argc; j++) {
+		    tmp[j+1] = rb_ary_elt(argv[j], i);
+		}
+		rb_yield_values2(argc+1, tmp);
+	    }
+
+	    if (work) ALLOCV_END(work);
+	}
+	else {
+	    for (i=0; i<RARRAY_LEN(ary); i++) {
+		VALUE tmp = rb_ary_new2(argc+1);
+
+		rb_ary_push(tmp, RARRAY_AREF(ary, i));
+		for (j=0; j<argc; j++) {
+		    rb_ary_push(tmp, rb_ary_elt(argv[j], i));
+		}
+		rb_yield(tmp);
+	    }
+	}
+    }
+    else {
+	result = rb_ary_new_capa(len);
+
+	for (i=0; i<len; i++) {
+	    VALUE tmp = rb_ary_new_capa(argc+1);
+
+	    rb_ary_push(tmp, RARRAY_AREF(ary, i));
+	    for (j=0; j<argc; j++) {
+		rb_ary_push(tmp, rb_ary_elt(argv[j], i));
+	    }
+	    rb_ary_push(result, tmp);
+	}
+    }
+
+    return result;
+}
+
+/*
+ *  call-seq:
+ *     ary.transpose -> new_ary
+ *
+ *  Assumes that +self+ is an array of arrays and transposes the rows and
+ *  columns.
+ *
+ *     a = [[1,2], [3,4], [5,6]]
+ *     a.transpose   #=> [[1, 3, 5], [2, 4, 6]]
+ *
+ *  If the length of the subarrays don't match, an IndexError is raised.
+ */
+
+static VALUE
+rb_ary_transpose(VALUE ary)
+{
+    long elen = -1, alen, i, j;
+    VALUE tmp, result = 0;
+
+    alen = RARRAY_LEN(ary);
+    if (alen == 0) return rb_ary_dup(ary);
+    for (i=0; i<alen; i++) {
+	tmp = to_ary(rb_ary_elt(ary, i));
+	if (elen < 0) {		/* first element */
+	    elen = RARRAY_LEN(tmp);
+	    result = rb_ary_new2(elen);
+	    for (j=0; j<elen; j++) {
+		rb_ary_store(result, j, rb_ary_new2(alen));
+	    }
+	}
+	else if (elen != RARRAY_LEN(tmp)) {
+	    rb_raise(rb_eIndexError, "element size differs (%ld should be %ld)",
+		     RARRAY_LEN(tmp), elen);
+	}
+	for (j=0; j<elen; j++) {
+	    rb_ary_store(rb_ary_elt(result, j), i, rb_ary_elt(tmp, j));
+	}
+    }
+    return result;
+}
+
+/*
+ *  call-seq:
+ *     ary.replace(other_ary)  -> ary
+ *     ary.initialize_copy(other_ary)	-> ary
+ *
+ *  Replaces the contents of +self+ with the contents of +other_ary+,
+ *  truncating or expanding if necessary.
+ *
+ *     a = [ "a", "b", "c", "d", "e" ]
+ *     a.replace([ "x", "y", "z" ])   #=> ["x", "y", "z"]
+ *     a                              #=> ["x", "y", "z"]
+ */
 
 VALUE
-ary_join(ary, sep)
-    struct RArray *ary;
-    struct RString *sep;
+rb_ary_replace(VALUE copy, VALUE orig)
 {
-    int i;
-    VALUE result, tmp;
-    if (ary->len == 0) return str_new(0, 0);
+    rb_ary_modify_check(copy);
+    orig = to_ary(orig);
+    if (copy == orig) return copy;
 
-    if (TYPE(ary->ptr[0]) == T_STRING)
-	result = str_clone(ary->ptr[0]);
-    else
-	result = obj_as_string(ary->ptr[0]);
+    if (RARRAY_LEN(orig) <= RARRAY_EMBED_LEN_MAX) {
+        VALUE shared = 0;
 
-    for (i=1; i<ary->len; i++) {
-	tmp = ary->ptr[i];
-	switch (TYPE(tmp)) {
-	  case T_STRING:
-	    break;
-	  case T_ARRAY:
-	    tmp = ary_join(tmp, sep);
+        if (ARY_OWNS_HEAP_P(copy)) {
+	    RARRAY_PTR_USE(copy, ptr, ruby_sized_xfree(ptr, ARY_HEAP_SIZE(copy)));
+	}
+        else if (ARY_SHARED_P(copy)) {
+            shared = ARY_SHARED(copy);
+            FL_UNSET_SHARED(copy);
+        }
+        FL_SET_EMBED(copy);
+	ary_memcpy(copy, 0, RARRAY_LEN(orig), RARRAY_CONST_PTR(orig));
+        if (shared) {
+            rb_ary_decrement_share(shared);
+        }
+        ARY_SET_LEN(copy, RARRAY_LEN(orig));
+    }
+    else {
+        VALUE shared = ary_make_shared(orig);
+        if (ARY_OWNS_HEAP_P(copy)) {
+	    RARRAY_PTR_USE(copy, ptr, ruby_sized_xfree(ptr, ARY_HEAP_SIZE(copy)));
+        }
+        else {
+            rb_ary_unshare_safe(copy);
+        }
+        FL_UNSET_EMBED(copy);
+        ARY_SET_PTR(copy, RARRAY_CONST_PTR(orig));
+        ARY_SET_LEN(copy, RARRAY_LEN(orig));
+        rb_ary_set_shared(copy, shared);
+    }
+    return copy;
+}
+
+/*
+ *  call-seq:
+ *     ary.clear    -> ary
+ *
+ *  Removes all elements from +self+.
+ *
+ *     a = [ "a", "b", "c", "d", "e" ]
+ *     a.clear    #=> [ ]
+ */
+
+VALUE
+rb_ary_clear(VALUE ary)
+{
+    rb_ary_modify_check(ary);
+    ARY_SET_LEN(ary, 0);
+    if (ARY_SHARED_P(ary)) {
+	if (!ARY_EMBED_P(ary)) {
+	    rb_ary_unshare(ary);
+	    FL_SET_EMBED(ary);
+	}
+    }
+    else if (ARY_DEFAULT_SIZE * 2 < ARY_CAPA(ary)) {
+	ary_resize_capa(ary, ARY_DEFAULT_SIZE * 2);
+    }
+    return ary;
+}
+
+/*
+ *  call-seq:
+ *     ary.fill(obj)                                 -> ary
+ *     ary.fill(obj, start [, length])               -> ary
+ *     ary.fill(obj, range )                         -> ary
+ *     ary.fill { |index| block }                    -> ary
+ *     ary.fill(start [, length] ) { |index| block } -> ary
+ *     ary.fill(range) { |index| block }             -> ary
+ *
+ *  The first three forms set the selected elements of +self+ (which
+ *  may be the entire array) to +obj+.
+ *
+ *  A +start+ of +nil+ is equivalent to zero.
+ *
+ *  A +length+ of +nil+ is equivalent to the length of the array.
+ *
+ *  The last three forms fill the array with the value of the given block,
+ *  which is passed the absolute index of each element to be filled.
+ *
+ *  Negative values of +start+ count from the end of the array, where +-1+ is
+ *  the last element.
+ *
+ *     a = [ "a", "b", "c", "d" ]
+ *     a.fill("x")              #=> ["x", "x", "x", "x"]
+ *     a.fill("z", 2, 2)        #=> ["x", "x", "z", "z"]
+ *     a.fill("y", 0..1)        #=> ["y", "y", "z", "z"]
+ *     a.fill { |i| i*i }       #=> [0, 1, 4, 9]
+ *     a.fill(-2) { |i| i*i*i } #=> [0, 1, 8, 27]
+ */
+
+static VALUE
+rb_ary_fill(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE item, arg1, arg2;
+    long beg = 0, end = 0, len = 0;
+    int block_p = FALSE;
+
+    if (rb_block_given_p()) {
+	block_p = TRUE;
+	rb_scan_args(argc, argv, "02", &arg1, &arg2);
+	argc += 1;		/* hackish */
+    }
+    else {
+	rb_scan_args(argc, argv, "12", &item, &arg1, &arg2);
+    }
+    switch (argc) {
+      case 1:
+	beg = 0;
+	len = RARRAY_LEN(ary);
+	break;
+      case 2:
+	if (rb_range_beg_len(arg1, &beg, &len, RARRAY_LEN(ary), 1)) {
 	    break;
-	  default:
-	    tmp = obj_as_string(tmp);
 	}
-	if (sep) str_cat(result, sep->ptr, sep->len);
-	str_cat(result, RSTRING(tmp)->ptr, RSTRING(tmp)->len);
+	/* fall through */
+      case 3:
+	beg = NIL_P(arg1) ? 0 : NUM2LONG(arg1);
+	if (beg < 0) {
+	    beg = RARRAY_LEN(ary) + beg;
+	    if (beg < 0) beg = 0;
+	}
+	len = NIL_P(arg2) ? RARRAY_LEN(ary) - beg : NUM2LONG(arg2);
+	break;
+    }
+    rb_ary_modify(ary);
+    if (len < 0) {
+        return ary;
+    }
+    if (beg >= ARY_MAX_SIZE || len > ARY_MAX_SIZE - beg) {
+	rb_raise(rb_eArgError, "argument too big");
+    }
+    end = beg + len;
+    if (RARRAY_LEN(ary) < end) {
+	if (end >= ARY_CAPA(ary)) {
+	    ary_resize_capa(ary, end);
+	}
+	ary_mem_clear(ary, RARRAY_LEN(ary), end - RARRAY_LEN(ary));
+	ARY_SET_LEN(ary, end);
     }
 
-    return result;
+    if (block_p) {
+	VALUE v;
+	long i;
+
+	for (i=beg; i<end; i++) {
+	    v = rb_yield(LONG2NUM(i));
+	    if (i>=RARRAY_LEN(ary)) break;
+	    ARY_SET(ary, i, v);
+	}
+    }
+    else {
+	ary_memfill(ary, beg, len, item);
+    }
+    return ary;
+}
+
+/*
+ *  call-seq:
+ *     ary + other_ary   -> new_ary
+ *
+ *  Concatenation --- Returns a new array built by concatenating the
+ *  two arrays together to produce a third array.
+ *
+ *     [ 1, 2, 3 ] + [ 4, 5 ]    #=> [ 1, 2, 3, 4, 5 ]
+ *     a = [ "a", "b", "c" ]
+ *     c = a + [ "d", "e", "f" ]
+ *     c                         #=> [ "a", "b", "c", "d", "e", "f" ]
+ *     a                         #=> [ "a", "b", "c" ]
+ *
+ *  Note that
+ *     x += y
+ *  is the same as
+ *     x = x + y
+ *  This means that it produces a new array. As a consequence,
+ *  repeated use of <code>+=</code> on arrays can be quite inefficient.
+ *
+ *  See also Array#concat.
+ */
+
+VALUE
+rb_ary_plus(VALUE x, VALUE y)
+{
+    VALUE z;
+    long len, xlen, ylen;
+
+    y = to_ary(y);
+    xlen = RARRAY_LEN(x);
+    ylen = RARRAY_LEN(y);
+    len = xlen + ylen;
+    z = rb_ary_new2(len);
+
+    ary_memcpy(z, 0, xlen, RARRAY_CONST_PTR(x));
+    ary_memcpy(z, xlen, ylen, RARRAY_CONST_PTR(y));
+    ARY_SET_LEN(z, len);
+    return z;
 }
 
+/*
+ *  call-seq:
+ *     ary.concat(other_ary)   -> ary
+ *
+ *  Appends the elements of +other_ary+ to +self+.
+ *
+ *     [ "a", "b" ].concat( ["c", "d"] ) #=> [ "a", "b", "c", "d" ]
+ *     a = [ 1, 2, 3 ]
+ *     a.concat( [ 4, 5 ] )
+ *     a                                 #=> [ 1, 2, 3, 4, 5 ]
+ *
+ *  See also Array#+.
+ */
+
+VALUE
+rb_ary_concat(VALUE x, VALUE y)
+{
+    rb_ary_modify_check(x);
+    y = to_ary(y);
+    if (RARRAY_LEN(y) > 0) {
+	rb_ary_splice(x, RARRAY_LEN(x), 0, y);
+    }
+    return x;
+}
+
+
+/*
+ *  call-seq:
+ *     ary * int     -> new_ary
+ *     ary * str     -> new_string
+ *
+ *  Repetition --- With a String argument, equivalent to
+ *  <code>ary.join(str)</code>.
+ *
+ *  Otherwise, returns a new array built by concatenating the +int+ copies of
+ *  +self+.
+ *
+ *
+ *     [ 1, 2, 3 ] * 3    #=> [ 1, 2, 3, 1, 2, 3, 1, 2, 3 ]
+ *     [ 1, 2, 3 ] * ","  #=> "1,2,3"
+ *
+ */
+
 static VALUE
-Fary_join(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    struct RArray *ary;
+rb_ary_times(VALUE ary, VALUE times)
 {
-    VALUE sep;
+    VALUE ary2, tmp;
+    const VALUE *ptr;
+    long t, len;
 
-    rb_scan_args(argc, argv, "01", &sep);
-    if (sep == Qnil) sep = OFS;
+    tmp = rb_check_string_type(times);
+    if (!NIL_P(tmp)) {
+	return rb_ary_join(ary, tmp);
+    }
 
-    if (sep != Qnil)
-	Check_Type(sep, T_STRING);
+    len = NUM2LONG(times);
+    if (len == 0) {
+	ary2 = ary_new(rb_obj_class(ary), 0);
+	goto out;
+    }
+    if (len < 0) {
+	rb_raise(rb_eArgError, "negative argument");
+    }
+    if (ARY_MAX_SIZE/len < RARRAY_LEN(ary)) {
+	rb_raise(rb_eArgError, "argument too big");
+    }
+    len *= RARRAY_LEN(ary);
+
+    ary2 = ary_new(rb_obj_class(ary), len);
+    ARY_SET_LEN(ary2, len);
+
+    ptr = RARRAY_CONST_PTR(ary);
+    t = RARRAY_LEN(ary);
+    if (0 < t) {
+	ary_memcpy(ary2, 0, t, ptr);
+	while (t <= len/2) {
+	    ary_memcpy(ary2, t, t, RARRAY_CONST_PTR(ary2));
+            t *= 2;
+        }
+        if (t < len) {
+	    ary_memcpy(ary2, t, len-t, RARRAY_CONST_PTR(ary2));
+        }
+    }
+  out:
+    OBJ_INFECT(ary2, ary);
 
-    return ary_join(ary, sep);
+    return ary2;
 }
 
+/*
+ *  call-seq:
+ *     ary.assoc(obj)   -> element_ary  or  nil
+ *
+ *  Searches through an array whose elements are also arrays comparing +obj+
+ *  with the first element of each contained array using <code>obj.==</code>.
+ *
+ *  Returns the first contained array that matches (that is, the first
+ *  associated array), or +nil+ if no match is found.
+ *
+ *  See also Array#rassoc
+ *
+ *     s1 = [ "colors", "red", "blue", "green" ]
+ *     s2 = [ "letters", "a", "b", "c" ]
+ *     s3 = "foo"
+ *     a  = [ s1, s2, s3 ]
+ *     a.assoc("letters")  #=> [ "letters", "a", "b", "c" ]
+ *     a.assoc("foo")      #=> nil
+ */
+
 VALUE
-Fary_to_s(ary)
-    VALUE ary;
+rb_ary_assoc(VALUE ary, VALUE key)
 {
-    VALUE str = ary_join(ary, OFS);
-    if (str == Qnil) return str_new(0, 0);
-    return str;
+    long i;
+    VALUE v;
+
+    for (i = 0; i < RARRAY_LEN(ary); ++i) {
+	v = rb_check_array_type(RARRAY_AREF(ary, i));
+	if (!NIL_P(v) && RARRAY_LEN(v) > 0 &&
+	    rb_equal(RARRAY_AREF(v, 0), key))
+	    return v;
+    }
+    return Qnil;
 }
 
+/*
+ *  call-seq:
+ *     ary.rassoc(obj) -> element_ary or nil
+ *
+ *  Searches through the array whose elements are also arrays.
+ *
+ *  Compares +obj+ with the second element of each contained array using
+ *  <code>obj.==</code>.
+ *
+ *  Returns the first contained array that matches +obj+.
+ *
+ *  See also Array#assoc.
+ *
+ *     a = [ [ 1, "one"], [2, "two"], [3, "three"], ["ii", "two"] ]
+ *     a.rassoc("two")    #=> [2, "two"]
+ *     a.rassoc("four")   #=> nil
+ */
+
 VALUE
-Fary_print_on(ary, port)
-    struct RArray *ary;
-    VALUE port;
+rb_ary_rassoc(VALUE ary, VALUE value)
 {
-    int i;
+    long i;
+    VALUE v;
+
+    for (i = 0; i < RARRAY_LEN(ary); ++i) {
+	v = RARRAY_AREF(ary, i);
+	if (RB_TYPE_P(v, T_ARRAY) &&
+	    RARRAY_LEN(v) > 1 &&
+	    rb_equal(RARRAY_AREF(v, 1), value))
+	    return v;
+    }
+    return Qnil;
+}
 
-    for (i=0; i<ary->len; i++) {
-	if (OFS && i>1) {
-	    io_write(port, OFS);
+static VALUE
+recursive_equal(VALUE ary1, VALUE ary2, int recur)
+{
+    long i, len1;
+    const VALUE *p1, *p2;
+
+    if (recur) return Qtrue; /* Subtle! */
+
+    p1 = RARRAY_CONST_PTR(ary1);
+    p2 = RARRAY_CONST_PTR(ary2);
+    len1 = RARRAY_LEN(ary1);
+
+    for (i = 0; i < len1; i++) {
+	if (*p1 != *p2) {
+	    if (rb_equal(*p1, *p2)) {
+		len1 = RARRAY_LEN(ary1);
+		if (len1 != RARRAY_LEN(ary2))
+		    return Qfalse;
+		if (len1 < i)
+		    return Qtrue;
+		p1 = RARRAY_CONST_PTR(ary1) + i;
+		p2 = RARRAY_CONST_PTR(ary2) + i;
+	    }
+	    else {
+		return Qfalse;
+	    }
 	}
-	io_write(port, ary->ptr[i]);
+	p1++;
+	p2++;
     }
-    return port;
+    return Qtrue;
 }
 
-#define INSPECT_MAX 10
+/*
+ *  call-seq:
+ *     ary == other_ary   ->   bool
+ *
+ *  Equality --- Two arrays are equal if they contain the same number of
+ *  elements and if each element is equal to (according to Object#==) the
+ *  corresponding element in +other_ary+.
+ *
+ *     [ "a", "c" ]    == [ "a", "c", 7 ]     #=> false
+ *     [ "a", "c", 7 ] == [ "a", "c", 7 ]     #=> true
+ *     [ "a", "c", 7 ] == [ "a", "d", "f" ]   #=> false
+ *
+ */
 
 static VALUE
-Fary_inspect(ary)
-    struct RArray *ary;
+rb_ary_equal(VALUE ary1, VALUE ary2)
 {
-    int i, len;
-    VALUE str;
-    char *p;
+    if (ary1 == ary2) return Qtrue;
+    if (!RB_TYPE_P(ary2, T_ARRAY)) {
+	if (!rb_respond_to(ary2, idTo_ary)) {
+	    return Qfalse;
+	}
+	return rb_equal(ary2, ary1);
+    }
+    if (RARRAY_LEN(ary1) != RARRAY_LEN(ary2)) return Qfalse;
+    if (RARRAY_CONST_PTR(ary1) == RARRAY_CONST_PTR(ary2)) return Qtrue;
+    return rb_exec_recursive_paired(recursive_equal, ary1, ary2, ary2);
+}
 
-    ary = (struct RArray*)ary_clone(ary);
+static VALUE
+recursive_eql(VALUE ary1, VALUE ary2, int recur)
+{
+    long i;
 
-    len = ary->len;
-    for (i=0; i<len; i++) {
-	if (i > INSPECT_MAX) break;
-	ary->ptr[i] = rb_funcall(ary->ptr[i], rb_intern("_inspect"), 0, Qnil);
+    if (recur) return Qtrue; /* Subtle! */
+    for (i=0; i<RARRAY_LEN(ary1); i++) {
+	if (!rb_eql(rb_ary_elt(ary1, i), rb_ary_elt(ary2, i)))
+	    return Qfalse;
     }
+    return Qtrue;
+}
 
-    str = str_new2(", ");
-    str = ary_join(ary, str);
-    if (str == Qnil) return str_new2("[]");
-    len = RSTRING(str)->len;
-    if (ary->len > INSPECT_MAX)
-	str_grow(str, len+5);
-    else
-	str_grow(str, len+2);
-
-    p = RSTRING(str)->ptr;
-    memmove(p+1, p, len);
-    p[0] = '[';
-    if (ary->len > INSPECT_MAX)
-	strcpy(p+len, "...]");
-    else
-	p[len+1] = ']';
+/*
+ *  call-seq:
+ *     ary.eql?(other)  -> true or false
+ *
+ *  Returns +true+ if +self+ and +other+ are the same object,
+ *  or are both arrays with the same content (according to Object#eql?).
+ */
 
-    return str;
+static VALUE
+rb_ary_eql(VALUE ary1, VALUE ary2)
+{
+    if (ary1 == ary2) return Qtrue;
+    if (!RB_TYPE_P(ary2, T_ARRAY)) return Qfalse;
+    if (RARRAY_LEN(ary1) != RARRAY_LEN(ary2)) return Qfalse;
+    if (RARRAY_CONST_PTR(ary1) == RARRAY_CONST_PTR(ary2)) return Qtrue;
+    return rb_exec_recursive_paired(recursive_eql, ary1, ary2, ary2);
 }
 
+/*
+ *  call-seq:
+ *     ary.hash   -> fixnum
+ *
+ *  Compute a hash-code for this array.
+ *
+ *  Two arrays with the same content will have the same hash code (and will
+ *  compare using #eql?).
+ *
+ *  See also Object#hash.
+ */
+
 static VALUE
-Fary_to_a(ary)
-    VALUE ary;
+rb_ary_hash(VALUE ary)
 {
-    return ary;
+    long i;
+    st_index_t h;
+    VALUE n;
+
+    h = rb_hash_start(RARRAY_LEN(ary));
+    h = rb_hash_uint(h, (st_index_t)rb_ary_hash);
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+	n = rb_hash(RARRAY_AREF(ary, i));
+	h = rb_hash_uint(h, NUM2LONG(n));
+    }
+    h = rb_hash_end(h);
+    return LONG2FIX(h);
 }
 
+/*
+ *  call-seq:
+ *     ary.include?(object)   -> true or false
+ *
+ *  Returns +true+ if the given +object+ is present in +self+ (that is, if any
+ *  element <code>==</code> +object+), otherwise returns +false+.
+ *
+ *     a = [ "a", "b", "c" ]
+ *     a.include?("b")   #=> true
+ *     a.include?("z")   #=> false
+ */
+
 VALUE
-rb_to_a(obj)
-    VALUE obj;
+rb_ary_includes(VALUE ary, VALUE item)
 {
-    if (TYPE(obj) == T_ARRAY) return obj;
-    obj = rb_funcall(obj, rb_intern("to_a"), 0);
-    if (TYPE(obj) != T_ARRAY) {
-	Bug("`to_a' did not return Array");
+    long i;
+    VALUE e;
+
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+	e = RARRAY_AREF(ary, i);
+	switch (rb_equal_opt(e, item)) {
+	  case Qundef:
+	    if (rb_equal(e, item)) return Qtrue;
+	    break;
+	  case Qtrue:
+	    return Qtrue;
+	}
     }
-    return obj;
+    return Qfalse;
 }
 
+
 static VALUE
-Fary_reverse(ary)
-    struct RArray *ary;
+recursive_cmp(VALUE ary1, VALUE ary2, int recur)
 {
-    VALUE ary2 = ary_new2(ary->len);
-    int i, j;
+    long i, len;
 
-    for (i=ary->len-1, j=0; i >=0; i--, j++) {
-	RARRAY(ary2)->ptr[j] = ary->ptr[i];
+    if (recur) return Qundef;	/* Subtle! */
+    len = RARRAY_LEN(ary1);
+    if (len > RARRAY_LEN(ary2)) {
+	len = RARRAY_LEN(ary2);
+    }
+    for (i=0; i<len; i++) {
+	VALUE e1 = rb_ary_elt(ary1, i), e2 = rb_ary_elt(ary2, i);
+	VALUE v = rb_funcallv(e1, id_cmp, 1, &e2);
+	if (v != INT2FIX(0)) {
+	    return v;
+	}
     }
-    RARRAY(ary2)->len = ary->len;
+    return Qundef;
+}
 
-    return ary2;
+/*
+ *  call-seq:
+ *     ary <=> other_ary   ->  -1, 0, +1 or nil
+ *
+ *  Comparison --- Returns an integer (+-1+, +0+, or <code>+1</code>) if this
+ *  array is less than, equal to, or greater than +other_ary+.
+ *
+ *  Each object in each array is compared (using the <=> operator).
+ *
+ *  Arrays are compared in an "element-wise" manner; the first element of +ary+
+ *  is compared with the first one of +other_ary+ using the <=> operator, then
+ *  each of the second elements, etc...
+ *  As soon as the result of any such comparison is non zero (i.e. the two
+ *  corresponding elements are not equal), that result is returned for the
+ *  whole array comparison.
+ *
+ *  If all the elements are equal, then the result is based on a comparison of
+ *  the array lengths. Thus, two arrays are "equal" according to Array#<=> if,
+ *  and only if, they have the same length and the value of each element is
+ *  equal to the value of the corresponding element in the other array.
+ *
+ *  +nil+ is returned if the +other_ary+ is not an array or if the comparison
+ *  of two elements returned +nil+.
+ *
+ *     [ "a", "a", "c" ]    <=> [ "a", "b", "c" ]   #=> -1
+ *     [ 1, 2, 3, 4, 5, 6 ] <=> [ 1, 2 ]            #=> +1
+ *     [ 1, 2 ]             <=> [ 1, :two ]         #=> nil
+ *
+ */
+
+VALUE
+rb_ary_cmp(VALUE ary1, VALUE ary2)
+{
+    long len;
+    VALUE v;
+
+    ary2 = rb_check_array_type(ary2);
+    if (NIL_P(ary2)) return Qnil;
+    if (ary1 == ary2) return INT2FIX(0);
+    v = rb_exec_recursive_paired(recursive_cmp, ary1, ary2, ary2);
+    if (v != Qundef) return v;
+    len = RARRAY_LEN(ary1) - RARRAY_LEN(ary2);
+    if (len == 0) return INT2FIX(0);
+    if (len > 0) return INT2FIX(1);
+    return INT2FIX(-1);
 }
 
-static ID cmp;
+static VALUE
+ary_add_hash(VALUE hash, VALUE ary)
+{
+    long i;
 
-static int
-sort_1(a, b)
-    VALUE *a, *b;
+    for (i=0; i<RARRAY_LEN(ary); i++) {
+	VALUE elt = RARRAY_AREF(ary, i);
+	if (rb_hash_lookup2(hash, elt, Qundef) == Qundef) {
+	    rb_hash_aset(hash, elt, elt);
+	}
+    }
+    return hash;
+}
+
+static inline VALUE
+ary_tmp_hash_new(void)
 {
-    VALUE retval = rb_yield(assoc_new(*a, *b));
-    return NUM2INT(retval);
+    VALUE hash = rb_hash_new();
+
+    RBASIC_CLEAR_CLASS(hash);
+    return hash;
 }
 
-static int
-sort_2(a, b)
-    VALUE *a, *b;
+static VALUE
+ary_make_hash(VALUE ary)
 {
-    VALUE retval;
+    VALUE hash = ary_tmp_hash_new();
+    return ary_add_hash(hash, ary);
+}
+
+static VALUE
+ary_add_hash_by(VALUE hash, VALUE ary)
+{
+    long i;
 
-    if (!cmp) cmp = rb_intern("<=>");
-    retval = rb_funcall(*a, cmp, 1, *b);
-    return NUM2INT(retval);
+    for (i = 0; i < RARRAY_LEN(ary); ++i) {
+	VALUE v = rb_ary_elt(ary, i), k = rb_yield(v);
+	if (rb_hash_lookup2(hash, k, Qundef) == Qundef) {
+	    rb_hash_aset(hash, k, v);
+	}
+    }
+    return hash;
 }
 
-VALUE
-Fary_sort(ary)
-    struct RArray *ary;
+static VALUE
+ary_make_hash_by(VALUE ary)
 {
-    qsort(ary->ptr, ary->len, sizeof(VALUE), iterator_p()?sort_1:sort_2);
-    return (VALUE)ary;
+    VALUE hash = ary_tmp_hash_new();
+    return ary_add_hash_by(hash, ary);
 }
 
+static inline void
+ary_recycle_hash(VALUE hash)
+{
+    if (RHASH(hash)->ntbl) {
+	st_table *tbl = RHASH(hash)->ntbl;
+	RHASH(hash)->ntbl = 0;
+	st_free_table(tbl);
+    }
+    RB_GC_GUARD(hash);
+}
+
+/*
+ *  call-seq:
+ *     ary - other_ary    -> new_ary
+ *
+ *  Array Difference
+ *
+ *  Returns a new array that is a copy of the original array, removing any
+ *  items that also appear in +other_ary+. The order is preserved from the
+ *  original array.
+ *
+ *  It compares elements using their #hash and #eql? methods for efficiency.
+ *
+ *     [ 1, 1, 2, 2, 3, 3, 4, 5 ] - [ 1, 2, 4 ]  #=>  [ 3, 3, 5 ]
+ *
+ *  If you need set-like behavior, see the library class Set.
+ */
+
 static VALUE
-Fary_delete(ary, item)
-    struct RArray *ary;
-    VALUE item;
+rb_ary_diff(VALUE ary1, VALUE ary2)
 {
-    int i1, i2;
+    VALUE ary3;
+    VALUE hash;
+    long i;
 
-    for (i1 = i2 = 0; i1 < ary->len; i1++) {
-	if (rb_equal(ary->ptr[i1], item)) continue;
-	if (i1 != i2) {
-	    ary->ptr[i2] = ary->ptr[i1];
+    hash = ary_make_hash(to_ary(ary2));
+    ary3 = rb_ary_new();
+
+    for (i=0; i<RARRAY_LEN(ary1); i++) {
+	if (st_lookup(rb_hash_tbl_raw(hash), RARRAY_AREF(ary1, i), 0)) continue;
+	rb_ary_push(ary3, rb_ary_elt(ary1, i));
+    }
+    ary_recycle_hash(hash);
+    return ary3;
+}
+
+/*
+ *  call-seq:
+ *     ary & other_ary      -> new_ary
+ *
+ *  Set Intersection --- Returns a new array containing elements common to the
+ *  two arrays, excluding any duplicates. The order is preserved from the
+ *  original array.
+ *
+ *  It compares elements using their #hash and #eql? methods for efficiency.
+ *
+ *     [ 1, 1, 3, 5 ] & [ 1, 2, 3 ]                 #=> [ 1, 3 ]
+ *     [ 'a', 'b', 'b', 'z' ] & [ 'a', 'b', 'c' ]   #=> [ 'a', 'b' ]
+ *
+ *  See also Array#uniq.
+ */
+
+
+static VALUE
+rb_ary_and(VALUE ary1, VALUE ary2)
+{
+    VALUE hash, ary3, v;
+    st_table *table;
+    st_data_t vv;
+    long i;
+
+    ary2 = to_ary(ary2);
+    ary3 = rb_ary_new();
+    if (RARRAY_LEN(ary2) == 0) return ary3;
+    hash = ary_make_hash(ary2);
+    table = rb_hash_tbl_raw(hash);
+
+    for (i=0; i<RARRAY_LEN(ary1); i++) {
+	v = RARRAY_AREF(ary1, i);
+	vv = (st_data_t)v;
+	if (st_delete(table, &vv, 0)) {
+	    rb_ary_push(ary3, v);
 	}
-	i2++;
     }
-    ary->len = i2;
+    ary_recycle_hash(hash);
 
-    return (VALUE)ary;
+    return ary3;
+}
+
+static int
+ary_hash_orset(st_data_t *key, st_data_t *value, st_data_t arg, int existing)
+{
+    if (existing) return ST_STOP;
+    *key = *value = (VALUE)arg;
+    return ST_CONTINUE;
 }
 
+/*
+ *  call-seq:
+ *     ary | other_ary     -> new_ary
+ *
+ *  Set Union --- Returns a new array by joining +ary+ with +other_ary+,
+ *  excluding any duplicates and preserving the order from the original array.
+ *
+ *  It compares elements using their #hash and #eql? methods for efficiency.
+ *
+ *     [ "a", "b", "c" ] | [ "c", "d", "a" ]    #=> [ "a", "b", "c", "d" ]
+ *
+ *  See also Array#uniq.
+ */
+
 static VALUE
-Fary_delete_if(ary)
-    struct RArray *ary;
+rb_ary_or(VALUE ary1, VALUE ary2)
 {
-    int i1, i2;
+    VALUE hash, ary3;
+    long i;
 
-    for (i1 = i2 = 0; i1 < ary->len; i1++) {
-	if (rb_yield(ary->ptr[i1])) continue;
-	if (i1 != i2) {
-	    ary->ptr[i2] = ary->ptr[i1];
+    ary2 = to_ary(ary2);
+    hash = ary_make_hash(ary1);
+
+    for (i=0; i<RARRAY_LEN(ary2); i++) {
+	VALUE elt = RARRAY_AREF(ary2, i);
+	if (!st_update(RHASH_TBL_RAW(hash), (st_data_t)elt, ary_hash_orset, (st_data_t)elt)) {
+	    RB_OBJ_WRITTEN(hash, Qundef, elt);
 	}
-	i2++;
     }
-    ary->len = i2;
+    ary3 = rb_hash_values(hash);
+    ary_recycle_hash(hash);
+    return ary3;
+}
 
-    return (VALUE)ary;
+static int
+push_value(st_data_t key, st_data_t val, st_data_t ary)
+{
+    rb_ary_push((VALUE)ary, (VALUE)val);
+    return ST_CONTINUE;
 }
 
+/*
+ *  call-seq:
+ *     ary.uniq!                -> ary or nil
+ *     ary.uniq! { |item| ... } -> ary or nil
+ *
+ *  Removes duplicate elements from +self+.
+ *
+ *  If a block is given, it will use the return value of the block for
+ *  comparison.
+ *
+ *  It compares values using their #hash and #eql? methods for efficiency.
+ *
+ *  +self+ is traversed in order, and the first occurrence is kept.
+ *
+ *  Returns +nil+ if no changes are made (that is, no duplicates are found).
+ *
+ *     a = [ "a", "a", "b", "b", "c" ]
+ *     a.uniq!   # => ["a", "b", "c"]
+ *
+ *     b = [ "a", "b", "c" ]
+ *     b.uniq!   # => nil
+ *
+ *     c = [["student","sam"], ["student","george"], ["teacher","matz"]]
+ *     c.uniq! { |s| s.first } # => [["student", "sam"], ["teacher", "matz"]]
+ *
+ */
+
 static VALUE
-Fary_clear(ary)
-    struct RArray *ary;
+rb_ary_uniq_bang(VALUE ary)
 {
-    ary->len = 0;
-    return (VALUE)ary;
+    VALUE hash;
+    long hash_size;
+
+    rb_ary_modify_check(ary);
+    if (RARRAY_LEN(ary) <= 1)
+        return Qnil;
+    if (rb_block_given_p())
+	hash = ary_make_hash_by(ary);
+    else
+	hash = ary_make_hash(ary);
+
+    hash_size = RHASH_SIZE(hash);
+    if (RARRAY_LEN(ary) == hash_size) {
+	return Qnil;
+    }
+    rb_ary_modify_check(ary);
+    ARY_SET_LEN(ary, 0);
+    if (ARY_SHARED_P(ary) && !ARY_EMBED_P(ary)) {
+	rb_ary_unshare(ary);
+	FL_SET_EMBED(ary);
+    }
+    ary_resize_capa(ary, hash_size);
+    st_foreach(rb_hash_tbl_raw(hash), push_value, ary);
+    ary_recycle_hash(hash);
+
+    return ary;
 }
 
+/*
+ *  call-seq:
+ *     ary.uniq                -> new_ary
+ *     ary.uniq { |item| ... } -> new_ary
+ *
+ *  Returns a new array by removing duplicate values in +self+.
+ *
+ *  If a block is given, it will use the return value of the block for comparison.
+ *
+ *  It compares values using their #hash and #eql? methods for efficiency.
+ *
+ *  +self+ is traversed in order, and the first occurrence is kept.
+ *
+ *     a = [ "a", "a", "b", "b", "c" ]
+ *     a.uniq   # => ["a", "b", "c"]
+ *
+ *     b = [["student","sam"], ["student","george"], ["teacher","matz"]]
+ *     b.uniq { |s| s.first } # => [["student", "sam"], ["teacher", "matz"]]
+ *
+ */
+
 static VALUE
-Fary_fill(argc, argv, ary)
-    int argc;
-    VALUE *argv;
-    struct RArray *ary;
+rb_ary_uniq(VALUE ary)
 {
-    VALUE item, arg1, arg2;
-    int beg, len, end;
-    VALUE *p, *pend;
+    VALUE hash, uniq;
 
-    rb_scan_args(argc, argv, "12", &item, &arg1, &arg2);
-    if (arg2 == Qnil && obj_is_kind_of(arg1, C_Range)) {
-	range_beg_end(arg1, &beg, &len, ary->len);
+    if (RARRAY_LEN(ary) <= 1)
+        return rb_ary_dup(ary);
+    if (rb_block_given_p()) {
+	hash = ary_make_hash_by(ary);
+	uniq = rb_hash_values(hash);
     }
     else {
-	beg = NUM2INT(arg1);
-	if (beg < 0) {
-	    beg = ary->len + beg;
-	    if (beg < 0) beg = 0;
+	hash = ary_make_hash(ary);
+	uniq = rb_hash_values(hash);
+    }
+    RBASIC_SET_CLASS(uniq, rb_obj_class(ary));
+    ary_recycle_hash(hash);
+
+    return uniq;
+}
+
+/*
+ *  call-seq:
+ *     ary.compact!    -> ary  or  nil
+ *
+ *  Removes +nil+ elements from the array.
+ *
+ *  Returns +nil+ if no changes were made, otherwise returns the array.
+ *
+ *     [ "a", nil, "b", nil, "c" ].compact! #=> [ "a", "b", "c" ]
+ *     [ "a", "b", "c" ].compact!           #=> nil
+ */
+
+static VALUE
+rb_ary_compact_bang(VALUE ary)
+{
+    VALUE *p, *t, *end;
+    long n;
+
+    rb_ary_modify(ary);
+    p = t = (VALUE *)RARRAY_CONST_PTR(ary); /* WB: no new reference */
+    end = p + RARRAY_LEN(ary);
+
+    while (t < end) {
+	if (NIL_P(*t)) t++;
+	else *p++ = *t++;
+    }
+    n = p - RARRAY_CONST_PTR(ary);
+    if (RARRAY_LEN(ary) == n) {
+	return Qnil;
+    }
+    ary_resize_smaller(ary, n);
+
+    return ary;
+}
+
+/*
+ *  call-seq:
+ *     ary.compact     -> new_ary
+ *
+ *  Returns a copy of +self+ with all +nil+ elements removed.
+ *
+ *     [ "a", nil, "b", nil, "c", nil ].compact
+ *                       #=> [ "a", "b", "c" ]
+ */
+
+static VALUE
+rb_ary_compact(VALUE ary)
+{
+    ary = rb_ary_dup(ary);
+    rb_ary_compact_bang(ary);
+    return ary;
+}
+
+/*
+ *  call-seq:
+ *     ary.count                   -> int
+ *     ary.count(obj)              -> int
+ *     ary.count { |item| block }  -> int
+ *
+ *  Returns the number of elements.
+ *
+ *  If an argument is given, counts the number of elements which equal +obj+
+ *  using <code>==</code>.
+ *
+ *  If a block is given, counts the number of elements for which the block
+ *  returns a true value.
+ *
+ *     ary = [1, 2, 4, 2]
+ *     ary.count                  #=> 4
+ *     ary.count(2)               #=> 2
+ *     ary.count { |x| x%2 == 0 } #=> 3
+ *
+ */
+
+static VALUE
+rb_ary_count(int argc, VALUE *argv, VALUE ary)
+{
+    long i, n = 0;
+
+    if (argc == 0) {
+	VALUE v;
+
+	if (!rb_block_given_p())
+	    return LONG2NUM(RARRAY_LEN(ary));
+
+	for (i = 0; i < RARRAY_LEN(ary); i++) {
+	    v = RARRAY_AREF(ary, i);
+	    if (RTEST(rb_yield(v))) n++;
 	}
-	if (arg2) {
-	    len = NUM2INT(arg2);
+    }
+    else {
+	VALUE obj;
+
+	rb_scan_args(argc, argv, "1", &obj);
+	if (rb_block_given_p()) {
+	    rb_warn("given block not used");
 	}
-	else {
-	    len = ary->len - beg;
+	for (i = 0; i < RARRAY_LEN(ary); i++) {
+	    if (rb_equal(RARRAY_AREF(ary, i), obj)) n++;
 	}
     }
-    end = beg + len;
-    if (end > ary->len) {
-	if (end >= ary->capa) {
-	    ary->capa=end;
-	    REALLOC_N(ary->ptr, VALUE, ary->capa);
+
+    return LONG2NUM(n);
+}
+
+static VALUE
+flatten(VALUE ary, int level, int *modified)
+{
+    long i = 0;
+    VALUE stack, result, tmp, elt;
+    st_table *memo;
+    st_data_t id;
+
+    stack = ary_new(0, ARY_DEFAULT_SIZE);
+    result = ary_new(0, RARRAY_LEN(ary));
+    memo = st_init_numtable();
+    st_insert(memo, (st_data_t)ary, (st_data_t)Qtrue);
+    *modified = 0;
+
+    while (1) {
+	while (i < RARRAY_LEN(ary)) {
+	    elt = RARRAY_AREF(ary, i++);
+	    if (level >= 0 && RARRAY_LEN(stack) / 2 >= level) {
+		rb_ary_push(result, elt);
+		continue;
+	    }
+	    tmp = rb_check_array_type(elt);
+	    if (RBASIC(result)->klass) {
+		rb_raise(rb_eRuntimeError, "flatten reentered");
+	    }
+	    if (NIL_P(tmp)) {
+		rb_ary_push(result, elt);
+	    }
+	    else {
+		*modified = 1;
+		id = (st_data_t)tmp;
+		if (st_lookup(memo, id, 0)) {
+		    st_free_table(memo);
+		    rb_raise(rb_eArgError, "tried to flatten recursive array");
+		}
+		st_insert(memo, id, (st_data_t)Qtrue);
+		rb_ary_push(stack, ary);
+		rb_ary_push(stack, LONG2NUM(i));
+		ary = tmp;
+		i = 0;
+	    }
 	}
-	if (beg > ary->len) {
-	    MEMZERO(ary->ptr+ary->len, VALUE, end-ary->len);
+	if (RARRAY_LEN(stack) == 0) {
+	    break;
 	}
-	ary->len = end;
+	id = (st_data_t)ary;
+	st_delete(memo, &id, 0);
+	tmp = rb_ary_pop(stack);
+	i = NUM2LONG(tmp);
+	ary = rb_ary_pop(stack);
     }
-    p = ary->ptr + beg; pend = p + len;
 
-    while (p < pend) {
-	*p++ = item;
+    st_free_table(memo);
+
+    RBASIC_SET_CLASS(result, rb_obj_class(ary));
+    return result;
+}
+
+/*
+ *  call-seq:
+ *     ary.flatten!        -> ary or nil
+ *     ary.flatten!(level) -> ary or nil
+ *
+ *  Flattens +self+ in place.
+ *
+ *  Returns +nil+ if no modifications were made (i.e., the array contains no
+ *  subarrays.)
+ *
+ *  The optional +level+ argument determines the level of recursion to flatten.
+ *
+ *     a = [ 1, 2, [3, [4, 5] ] ]
+ *     a.flatten!   #=> [1, 2, 3, 4, 5]
+ *     a.flatten!   #=> nil
+ *     a            #=> [1, 2, 3, 4, 5]
+ *     a = [ 1, 2, [3, [4, 5] ] ]
+ *     a.flatten!(1) #=> [1, 2, 3, [4, 5]]
+ */
+
+static VALUE
+rb_ary_flatten_bang(int argc, VALUE *argv, VALUE ary)
+{
+    int mod = 0, level = -1;
+    VALUE result, lv;
+
+    rb_scan_args(argc, argv, "01", &lv);
+    rb_ary_modify_check(ary);
+    if (!NIL_P(lv)) level = NUM2INT(lv);
+    if (level == 0) return Qnil;
+
+    result = flatten(ary, level, &mod);
+    if (mod == 0) {
+	ary_discard(result);
+	return Qnil;
     }
-    return (VALUE)ary;
+    if (!(mod = ARY_EMBED_P(result))) rb_obj_freeze(result);
+    rb_ary_replace(ary, result);
+    if (mod) ARY_SET_EMBED_LEN(result, 0);
+
+    return ary;
 }
 
+/*
+ *  call-seq:
+ *     ary.flatten -> new_ary
+ *     ary.flatten(level) -> new_ary
+ *
+ *  Returns a new array that is a one-dimensional flattening of +self+
+ *  (recursively).
+ *
+ *  That is, for every element that is an array, extract its elements into
+ *  the new array.
+ *
+ *  The optional +level+ argument determines the level of recursion to
+ *  flatten.
+ *
+ *     s = [ 1, 2, 3 ]           #=> [1, 2, 3]
+ *     t = [ 4, 5, 6, [7, 8] ]   #=> [4, 5, 6, [7, 8]]
+ *     a = [ s, t, 9, 10 ]       #=> [[1, 2, 3], [4, 5, 6, [7, 8]], 9, 10]
+ *     a.flatten                 #=> [1, 2, 3, 4, 5, 6, 7, 8, 9, 10]
+ *     a = [ 1, 2, [3, [4, 5] ] ]
+ *     a.flatten(1)              #=> [1, 2, 3, [4, 5]]
+ */
+
 static VALUE
-Fary_plus(x, y)
-    struct RArray *x, *y;
+rb_ary_flatten(int argc, VALUE *argv, VALUE ary)
 {
-    struct RArray *z;
+    int mod = 0, level = -1;
+    VALUE result, lv;
 
-    switch (TYPE(y)) {
-      case T_ARRAY:
-	z = (struct RArray*)ary_new2(x->len + y->len);
-	MEMCPY(z->ptr, x->ptr, VALUE, x->len);
-	MEMCPY(z->ptr+x->len, y->ptr, VALUE, y->len);
-	z->len = x->len + RARRAY(y)->len;
-	break;
+    rb_scan_args(argc, argv, "01", &lv);
+    if (!NIL_P(lv)) level = NUM2INT(lv);
+    if (level == 0) return ary_make_shared_copy(ary);
 
-      default:
-	z = (struct RArray*)ary_clone(x);
-	ary_push(z, y);
-	break;
+    result = flatten(ary, level, &mod);
+    OBJ_INFECT(result, ary);
+
+    return result;
+}
+
+#define OPTHASH_GIVEN_P(opts) \
+    (argc > 0 && !NIL_P((opts) = rb_check_hash_type(argv[argc-1])) && (--argc, 1))
+static ID id_random;
+
+#define RAND_UPTO(max) (long)rb_random_ulong_limited((randgen), (max)-1)
+
+/*
+ *  call-seq:
+ *     ary.shuffle!              -> ary
+ *     ary.shuffle!(random: rng) -> ary
+ *
+ *  Shuffles elements in +self+ in place.
+ *
+ *     a = [ 1, 2, 3 ]           #=> [1, 2, 3]
+ *     a.shuffle!                #=> [2, 3, 1]
+ *     a                         #=> [2, 3, 1]
+ *
+ *  The optional +rng+ argument will be used as the random number generator.
+ *
+ *     a.shuffle!(random: Random.new(1))  #=> [1, 3, 2]
+ */
+
+static VALUE
+rb_ary_shuffle_bang(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE opts, randgen = rb_cRandom;
+    long i, len;
+
+    if (OPTHASH_GIVEN_P(opts)) {
+	VALUE rnd;
+	ID keyword_ids[1];
+
+	keyword_ids[0] = id_random;
+	rb_get_kwargs(opts, keyword_ids, 0, 1, &rnd);
+	if (rnd != Qundef) {
+	    randgen = rnd;
+	}
     }
-    return (VALUE)z;
+    rb_check_arity(argc, 0, 0);
+    rb_ary_modify(ary);
+    i = len = RARRAY_LEN(ary);
+    RARRAY_PTR_USE(ary, ptr, {
+	while (i) {
+	    long j = RAND_UPTO(i);
+	    VALUE tmp;
+	    if (len != RARRAY_LEN(ary) || ptr != RARRAY_CONST_PTR(ary)) {
+		rb_raise(rb_eRuntimeError, "modified during shuffle");
+	    }
+	    tmp = ptr[--i];
+	    ptr[i] = ptr[j];
+	    ptr[j] = tmp;
+	}
+    }); /* WB: no new reference */
+    return ary;
 }
 
+
+/*
+ *  call-seq:
+ *     ary.shuffle              -> new_ary
+ *     ary.shuffle(random: rng) -> new_ary
+ *
+ *  Returns a new array with elements of +self+ shuffled.
+ *
+ *     a = [ 1, 2, 3 ]           #=> [1, 2, 3]
+ *     a.shuffle                 #=> [2, 3, 1]
+ *     a                         #=> [1, 2, 3]
+ *
+ *  The optional +rng+ argument will be used as the random number generator.
+ *
+ *     a.shuffle(random: Random.new(1))  #=> [1, 3, 2]
+ */
+
 static VALUE
-Fary_times(ary, times)
-    struct RArray *ary;
-    VALUE times;
+rb_ary_shuffle(int argc, VALUE *argv, VALUE ary)
 {
-    struct RArray *ary2;
-    int i, len;
+    ary = rb_ary_dup(ary);
+    rb_ary_shuffle_bang(argc, argv, ary);
+    return ary;
+}
+
+
+/*
+ *  call-seq:
+ *     ary.sample                  -> obj
+ *     ary.sample(random: rng)     -> obj
+ *     ary.sample(n)               -> new_ary
+ *     ary.sample(n, random: rng)  -> new_ary
+ *
+ *  Choose a random element or +n+ random elements from the array.
+ *
+ *  The elements are chosen by using random and unique indices into the array
+ *  in order to ensure that an element doesn't repeat itself unless the array
+ *  already contained duplicate elements.
+ *
+ *  If the array is empty the first form returns +nil+ and the second form
+ *  returns an empty array.
+ *
+ *  The optional +rng+ argument will be used as the random number generator.
+ *
+ *     a = [ 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 ]
+ *     a.sample         #=> 7
+ *     a.sample(4)      #=> [6, 4, 2, 5]
+ */
 
-    len = NUM2INT(times) * ary->len;
-    ary2 = (struct RArray*)ary_new2(len);
-    ary2->len = len;
 
-    for (i=0; i<len; i+=ary->len) {
-	MEMCPY(ary2->ptr+i, ary->ptr, VALUE, ary->len);
+static VALUE
+rb_ary_sample(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE nv, result;
+    VALUE opts, randgen = rb_cRandom;
+    long n, len, i, j, k, idx[10];
+    long rnds[numberof(idx)];
+
+    if (OPTHASH_GIVEN_P(opts)) {
+	VALUE rnd;
+	ID keyword_ids[1];
+
+	keyword_ids[0] = id_random;
+	rb_get_kwargs(opts, keyword_ids, 0, 1, &rnd);
+	if (rnd != Qundef) {
+	    randgen = rnd;
+	}
     }
+    len = RARRAY_LEN(ary);
+    if (argc == 0) {
+	if (len < 2)
+	    i = 0;
+	else
+	    i = RAND_UPTO(len);
 
-    return (VALUE)ary2;
+	return rb_ary_elt(ary, i);
+    }
+    rb_scan_args(argc, argv, "1", &nv);
+    n = NUM2LONG(nv);
+    if (n < 0) rb_raise(rb_eArgError, "negative sample number");
+    if (n > len) n = len;
+    if (n <= numberof(idx)) {
+	for (i = 0; i < n; ++i) {
+	    rnds[i] = RAND_UPTO(len - i);
+	}
+    }
+    k = len;
+    len = RARRAY_LEN(ary);
+    if (len < k && n <= numberof(idx)) {
+	for (i = 0; i < n; ++i) {
+	    if (rnds[i] >= len) return rb_ary_new_capa(0);
+	}
+    }
+    if (n > len) n = len;
+    switch (n) {
+      case 0:
+	return rb_ary_new_capa(0);
+      case 1:
+	i = rnds[0];
+	return rb_ary_new_from_values(1, &RARRAY_AREF(ary, i));
+      case 2:
+	i = rnds[0];
+	j = rnds[1];
+	if (j >= i) j++;
+	return rb_ary_new_from_args(2, RARRAY_AREF(ary, i), RARRAY_AREF(ary, j));
+      case 3:
+	i = rnds[0];
+	j = rnds[1];
+	k = rnds[2];
+	{
+	    long l = j, g = i;
+	    if (j >= i) l = i, g = ++j;
+	    if (k >= l && (++k >= g)) ++k;
+	}
+	return rb_ary_new_from_args(3, RARRAY_AREF(ary, i), RARRAY_AREF(ary, j), RARRAY_AREF(ary, k));
+    }
+    if (n <= numberof(idx)) {
+	long sorted[numberof(idx)];
+	sorted[0] = idx[0] = rnds[0];
+	for (i=1; i<n; i++) {
+	    k = rnds[i];
+	    for (j = 0; j < i; ++j) {
+		if (k < sorted[j]) break;
+		++k;
+	    }
+	    memmove(&sorted[j+1], &sorted[j], sizeof(sorted[0])*(i-j));
+	    sorted[j] = idx[i] = k;
+	}
+	result = rb_ary_new_capa(n);
+	RARRAY_PTR_USE(result, ptr_result, {
+	    for (i=0; i<n; i++) {
+		ptr_result[i] = RARRAY_AREF(ary, idx[i]);
+	    }
+	});
+    }
+    else {
+	result = rb_ary_dup(ary);
+	RBASIC_CLEAR_CLASS(result);
+	RB_GC_GUARD(ary);
+	RARRAY_PTR_USE(result, ptr_result, {
+	    for (i=0; i<n; i++) {
+		j = RAND_UPTO(len-i) + i;
+		nv = ptr_result[j];
+		ptr_result[j] = ptr_result[i];
+		ptr_result[i] = nv;
+	    }
+	});
+	RBASIC_SET_CLASS_RAW(result, rb_cArray);
+    }
+    ARY_SET_LEN(result, n);
+
+    return result;
 }
 
-VALUE
-Fary_assoc(ary, key)
-    struct RArray *ary;
-    VALUE key;
+static VALUE
+rb_ary_cycle_size(VALUE self, VALUE args, VALUE eobj)
+{
+    long mul;
+    VALUE n = Qnil;
+    if (args && (RARRAY_LEN(args) > 0)) {
+	n = RARRAY_AREF(args, 0);
+    }
+    if (RARRAY_LEN(self) == 0) return INT2FIX(0);
+    if (n == Qnil) return DBL2NUM(INFINITY);
+    mul = NUM2LONG(n);
+    if (mul <= 0) return INT2FIX(0);
+    n = LONG2FIX(mul);
+    return rb_funcallv(rb_ary_length(self), '*', 1, &n);
+}
+
+/*
+ *  call-seq:
+ *     ary.cycle(n=nil) { |obj| block }  -> nil
+ *     ary.cycle(n=nil)                  -> Enumerator
+ *
+ *  Calls the given block for each element +n+ times or forever if +nil+ is
+ *  given.
+ *
+ *  Does nothing if a non-positive number is given or the array is empty.
+ *
+ *  Returns +nil+ if the loop has finished without getting interrupted.
+ *
+ *  If no block is given, an Enumerator is returned instead.
+ *
+ *     a = ["a", "b", "c"]
+ *     a.cycle { |x| puts x }     # print, a, b, c, a, b, c,.. forever.
+ *     a.cycle(2) { |x| puts x }  # print, a, b, c, a, b, c.
+ *
+ */
+
+static VALUE
+rb_ary_cycle(int argc, VALUE *argv, VALUE ary)
 {
-    VALUE *p, *pend;
+    long n, i;
+    VALUE nv = Qnil;
 
-    p = ary->ptr; pend = p + ary->len;
-    while (p < pend) {
-	if (TYPE(*p) == T_ASSOC
-	    && rb_equal(RASSOC(*p)->car, key))
-	    return *p;
+    rb_scan_args(argc, argv, "01", &nv);
+
+    RETURN_SIZED_ENUMERATOR(ary, argc, argv, rb_ary_cycle_size);
+    if (NIL_P(nv)) {
+        n = -1;
+    }
+    else {
+        n = NUM2LONG(nv);
+        if (n <= 0) return Qnil;
+    }
+
+    while (RARRAY_LEN(ary) > 0 && (n < 0 || 0 < n--)) {
+        for (i=0; i<RARRAY_LEN(ary); i++) {
+            rb_yield(RARRAY_AREF(ary, i));
+        }
     }
     return Qnil;
 }
 
-VALUE
-Fary_rassoc(ary, value)
-    struct RArray *ary;
-    VALUE value;
+#define tmpbuf(n, size) rb_str_tmp_new((n)*(size))
+#define tmpbuf_discard(s) (rb_str_resize((s), 0L), RBASIC_SET_CLASS_RAW(s, rb_cString))
+#define tmpary(n) rb_ary_tmp_new(n)
+#define tmpary_discard(a) (ary_discard(a), RBASIC_SET_CLASS_RAW(a, rb_cArray))
+
+/*
+ * Build a ruby array of the corresponding values and yield it to the
+ * associated block.
+ * Return the class of +values+ for reentry check.
+ */
+static int
+yield_indexed_values(const VALUE values, const long r, const long *const p)
 {
-    VALUE *p, *pend;
+    const VALUE result = rb_ary_new2(r);
+    VALUE *const result_array = RARRAY_PTR(result);
+    const VALUE *const values_array = RARRAY_CONST_PTR(values);
+    long i;
+
+    for (i = 0; i < r; i++) result_array[i] = values_array[p[i]];
+    ARY_SET_LEN(result, r);
+    rb_yield(result);
+    return !RBASIC(values)->klass;
+}
 
-    p = ary->ptr; pend = p + ary->len;
-    while (p < pend) {
-	if (TYPE(*p) == T_ASSOC
-	    && rb_equal(RASSOC(*p)->cdr, value))
-	    return *p;
+/*
+ * Compute permutations of +r+ elements of the set <code>[0..n-1]</code>.
+ *
+ * When we have a complete permutation of array indexes, copy the values
+ * at those indexes into a new array and yield that array.
+ *
+ * n: the size of the set
+ * r: the number of elements in each permutation
+ * p: the array (of size r) that we're filling in
+ * used: an array of booleans: whether a given index is already used
+ * values: the Ruby array that holds the actual values to permute
+ */
+static void
+permute0(const long n, const long r, long *const p, char *const used, const VALUE values)
+{
+    long i = 0, index = 0;
+
+    for (;;) {
+	const char *const unused = memchr(&used[i], 0, n-i);
+	if (!unused) {
+	    if (!index) break;
+	    i = p[--index];                /* pop index */
+	    used[i++] = 0;                 /* index unused */
+	}
+	else {
+	    i = unused - used;
+	    p[index] = i;
+	    used[i] = 1;                   /* mark index used */
+	    ++index;
+	    if (index < r-1) {             /* if not done yet */
+		p[index] = i = 0;
+		continue;
+	    }
+	    for (i = 0; i < n; ++i) {
+		if (used[i]) continue;
+		p[index] = i;
+		if (!yield_indexed_values(values, r, p)) {
+		    rb_raise(rb_eRuntimeError, "permute reentered");
+		}
+	    }
+	    i = p[--index];                /* pop index */
+	    used[i] = 0;                   /* index unused */
+	    p[index] = ++i;
+	}
     }
-    return Qnil;
 }
 
+/*
+ * Returns the product of from, from-1, ..., from - how_many + 1.
+ * http://en.wikipedia.org/wiki/Pochhammer_symbol
+ */
 static VALUE
-Fary_equal(ary1, ary2)
-    struct RArray *ary1, *ary2;
+descending_factorial(long from, long how_many)
 {
-    int i;
+    VALUE cnt = LONG2FIX(how_many >= 0);
+    while (how_many-- > 0) {
+	VALUE v = LONG2FIX(from--);
+	cnt = rb_funcallv(cnt, '*', 1, &v);
+    }
+    return cnt;
+}
 
-    if (TYPE(ary2) != T_ARRAY) return FALSE;
-    if (ary1->len != ary2->len) return FALSE;
-    for (i=0; i<ary1->len; i++) {
-	if (!rb_equal(ary1->ptr[i], ary2->ptr[i]))
-	    return FALSE;
+static VALUE
+binomial_coefficient(long comb, long size)
+{
+    VALUE r, v;
+    if (comb > size-comb) {
+	comb = size-comb;
     }
-    return TRUE;
+    if (comb < 0) {
+	return LONG2FIX(0);
+    }
+    r = descending_factorial(size, comb);
+    v = descending_factorial(comb, comb);
+    return rb_funcallv(r, id_div, 1, &v);
 }
 
 static VALUE
-Fary_hash(ary)
-    struct RArray *ary;
+rb_ary_permutation_size(VALUE ary, VALUE args, VALUE eobj)
 {
-    int i, h;
-    ID hash = rb_intern("hash");
+    long n = RARRAY_LEN(ary);
+    long k = (args && (RARRAY_LEN(args) > 0)) ? NUM2LONG(RARRAY_AREF(args, 0)) : n;
 
-    h = 0;
-    for (i=0; i<ary->len; i++) {
-	h += rb_funcall(ary->ptr[i], hash, 0);
+    return descending_factorial(n, k);
+}
+
+/*
+ *  call-seq:
+ *     ary.permutation { |p| block }          -> ary
+ *     ary.permutation                        -> Enumerator
+ *     ary.permutation(n) { |p| block }       -> ary
+ *     ary.permutation(n)                     -> Enumerator
+ *
+ * When invoked with a block, yield all permutations of length +n+ of the
+ * elements of the array, then return the array itself.
+ *
+ * If +n+ is not specified, yield all permutations of all elements.
+ *
+ * The implementation makes no guarantees about the order in which the
+ * permutations are yielded.
+ *
+ * If no block is given, an Enumerator is returned instead.
+ *
+ * Examples:
+ *
+ *   a = [1, 2, 3]
+ *   a.permutation.to_a    #=> [[1,2,3],[1,3,2],[2,1,3],[2,3,1],[3,1,2],[3,2,1]]
+ *   a.permutation(1).to_a #=> [[1],[2],[3]]
+ *   a.permutation(2).to_a #=> [[1,2],[1,3],[2,1],[2,3],[3,1],[3,2]]
+ *   a.permutation(3).to_a #=> [[1,2,3],[1,3,2],[2,1,3],[2,3,1],[3,1,2],[3,2,1]]
+ *   a.permutation(0).to_a #=> [[]] # one permutation of length 0
+ *   a.permutation(4).to_a #=> []   # no permutations of length 4
+ */
+
+static VALUE
+rb_ary_permutation(int argc, VALUE *argv, VALUE ary)
+{
+    VALUE num;
+    long r, n, i;
+
+    n = RARRAY_LEN(ary);                  /* Array length */
+    RETURN_SIZED_ENUMERATOR(ary, argc, argv, rb_ary_permutation_size);   /* Return enumerator if no block */
+    rb_scan_args(argc, argv, "01", &num);
+    r = NIL_P(num) ? n : NUM2LONG(num);   /* Permutation size from argument */
+
+    if (r < 0 || n < r) {
+	/* no permutations: yield nothing */
+    }
+    else if (r == 0) { /* exactly one permutation: the zero-length array */
+	rb_yield(rb_ary_new2(0));
+    }
+    else if (r == 1) { /* this is a special, easy case */
+	for (i = 0; i < RARRAY_LEN(ary); i++) {
+	    rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+	}
+    }
+    else {             /* this is the general case */
+	volatile VALUE t0;
+	long *p = ALLOCV_N(long, t0, r+roomof(n, sizeof(long)));
+	char *used = (char*)(p + r);
+	VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+	RBASIC_CLEAR_CLASS(ary0);
+
+	MEMZERO(used, char, n); /* initialize array */
+
+	permute0(n, r, p, used, ary0); /* compute and yield permutations */
+	ALLOCV_END(t0);
+	RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
     }
-    h += ary->len;
-    return INT2FIX(h);
+    return ary;
+}
+
+static void
+combinate0(const long len, const long n, long *const stack, const VALUE values)
+{
+    long lev = 0;
+
+    MEMZERO(stack+1, long, n);
+    stack[0] = -1;
+    for (;;) {
+	for (lev++; lev < n; lev++) {
+	    stack[lev+1] = stack[lev]+1;
+	}
+	if (!yield_indexed_values(values, n, stack+1)) {
+	    rb_raise(rb_eRuntimeError, "combination reentered");
+	}
+	do {
+	    if (lev == 0) return;
+	    stack[lev--]++;
+	} while (stack[lev+1]+n == len+lev+1);
+    }
+}
+
+static VALUE
+rb_ary_combination_size(VALUE ary, VALUE args, VALUE eobj)
+{
+    long n = RARRAY_LEN(ary);
+    long k = NUM2LONG(RARRAY_AREF(args, 0));
+
+    return binomial_coefficient(k, n);
 }
 
+/*
+ *  call-seq:
+ *     ary.combination(n) { |c| block }    -> ary
+ *     ary.combination(n)                  -> Enumerator
+ *
+ * When invoked with a block, yields all combinations of length +n+ of elements
+ * from the array and then returns the array itself.
+ *
+ * The implementation makes no guarantees about the order in which the
+ * combinations are yielded.
+ *
+ * If no block is given, an Enumerator is returned instead.
+ *
+ * Examples:
+ *
+ *     a = [1, 2, 3, 4]
+ *     a.combination(1).to_a  #=> [[1],[2],[3],[4]]
+ *     a.combination(2).to_a  #=> [[1,2],[1,3],[1,4],[2,3],[2,4],[3,4]]
+ *     a.combination(3).to_a  #=> [[1,2,3],[1,2,4],[1,3,4],[2,3,4]]
+ *     a.combination(4).to_a  #=> [[1,2,3,4]]
+ *     a.combination(0).to_a  #=> [[]] # one combination of length 0
+ *     a.combination(5).to_a  #=> []   # no combinations of length 5
+ *
+ */
+
 static VALUE
-Fary_includes(ary, item)
-    struct RArray *ary;
-    VALUE item;
+rb_ary_combination(VALUE ary, VALUE num)
 {
-    int i;
-    for (i=0; i<ary->len; i++) {
-	if (rb_equal(ary->ptr[i], item)) {
-	    return TRUE;
+    long i, n, len;
+
+    n = NUM2LONG(num);
+    RETURN_SIZED_ENUMERATOR(ary, 1, &num, rb_ary_combination_size);
+    len = RARRAY_LEN(ary);
+    if (n < 0 || len < n) {
+	/* yield nothing */
+    }
+    else if (n == 0) {
+	rb_yield(rb_ary_new2(0));
+    }
+    else if (n == 1) {
+	for (i = 0; i < RARRAY_LEN(ary); i++) {
+	    rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
 	}
     }
-    return FALSE;
+    else {
+	VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+	volatile VALUE t0;
+	long *stack = ALLOCV_N(long, t0, n+1);
+
+	RBASIC_CLEAR_CLASS(ary0);
+	combinate0(len, n, stack, ary0);
+	ALLOCV_END(t0);
+	RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
+    }
+    return ary;
+}
+
+/*
+ * Compute repeated permutations of +r+ elements of the set
+ * <code>[0..n-1]</code>.
+ *
+ * When we have a complete repeated permutation of array indexes, copy the
+ * values at those indexes into a new array and yield that array.
+ *
+ * n: the size of the set
+ * r: the number of elements in each permutation
+ * p: the array (of size r) that we're filling in
+ * values: the Ruby array that holds the actual values to permute
+ */
+static void
+rpermute0(const long n, const long r, long *const p, const VALUE values)
+{
+    long i = 0, index = 0;
+
+    p[index] = i;
+    for (;;) {
+	if (++index < r-1) {
+	    p[index] = i = 0;
+	    continue;
+	}
+	for (i = 0; i < n; ++i) {
+	    p[index] = i;
+	    if (!yield_indexed_values(values, r, p)) {
+		rb_raise(rb_eRuntimeError, "repeated permute reentered");
+	    }
+	}
+	do {
+	    if (index <= 0) return;
+	} while ((i = ++p[--index]) >= n);
+    }
 }
 
 static VALUE
-Fary_diff(ary1, ary2)
-    struct RArray *ary1, *ary2;
+rb_ary_repeated_permutation_size(VALUE ary, VALUE args, VALUE eobj)
 {
-    VALUE ary3;
-    int i, j;
+    long n = RARRAY_LEN(ary);
+    long k = NUM2LONG(RARRAY_AREF(args, 0));
+    VALUE v;
 
-    Check_Type(ary2, T_ARRAY);
-    ary3 = ary_new();
-    for (i=0; i<ary1->len; i++) {
-	if (Fary_includes(ary2, ary1->ptr[i])) continue;
-	if (Fary_includes(ary3, ary1->ptr[i])) continue;
-	ary_push(ary3, ary1->ptr[i]);
+    if (k < 0) {
+	return LONG2FIX(0);
     }
-    return ary3;
+
+    v = LONG2NUM(k);
+    return rb_funcallv(LONG2NUM(n), id_power, 1, &v);
 }
 
+/*
+ *  call-seq:
+ *     ary.repeated_permutation(n) { |p| block } -> ary
+ *     ary.repeated_permutation(n)               -> Enumerator
+ *
+ * When invoked with a block, yield all repeated permutations of length +n+ of
+ * the elements of the array, then return the array itself.
+ *
+ * The implementation makes no guarantees about the order in which the repeated
+ * permutations are yielded.
+ *
+ * If no block is given, an Enumerator is returned instead.
+ *
+ * Examples:
+ *
+ *     a = [1, 2]
+ *     a.repeated_permutation(1).to_a  #=> [[1], [2]]
+ *     a.repeated_permutation(2).to_a  #=> [[1,1],[1,2],[2,1],[2,2]]
+ *     a.repeated_permutation(3).to_a  #=> [[1,1,1],[1,1,2],[1,2,1],[1,2,2],
+ *                                     #    [2,1,1],[2,1,2],[2,2,1],[2,2,2]]
+ *     a.repeated_permutation(0).to_a  #=> [[]] # one permutation of length 0
+ */
+
 static VALUE
-Fary_and(ary1, ary2)
-    struct RArray *ary1, *ary2;
+rb_ary_repeated_permutation(VALUE ary, VALUE num)
 {
-    VALUE ary3;
-    int i, j;
+    long r, n, i;
+
+    n = RARRAY_LEN(ary);                  /* Array length */
+    RETURN_SIZED_ENUMERATOR(ary, 1, &num, rb_ary_repeated_permutation_size);      /* Return Enumerator if no block */
+    r = NUM2LONG(num);                    /* Permutation size from argument */
 
-    Check_Type(ary2, T_ARRAY);
-    ary3 = ary_new();
-    for (i=0; i<ary1->len; i++) {
-	if (Fary_includes(ary2, ary1->ptr[i])
-	    && !Fary_includes(ary3, ary1->ptr[i])) {
-	    ary_push(ary3, ary1->ptr[i]);
+    if (r < 0) {
+	/* no permutations: yield nothing */
+    }
+    else if (r == 0) { /* exactly one permutation: the zero-length array */
+	rb_yield(rb_ary_new2(0));
+    }
+    else if (r == 1) { /* this is a special, easy case */
+	for (i = 0; i < RARRAY_LEN(ary); i++) {
+	    rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
 	}
     }
-    return ary3;
+    else {             /* this is the general case */
+	volatile VALUE t0;
+	long *p = ALLOCV_N(long, t0, r);
+	VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+	RBASIC_CLEAR_CLASS(ary0);
+
+	rpermute0(n, r, p, ary0); /* compute and yield repeated permutations */
+	ALLOCV_END(t0);
+	RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
+    }
+    return ary;
+}
+
+static void
+rcombinate0(const long n, const long r, long *const p, const long rest, const VALUE values)
+{
+    long i = 0, index = 0;
+
+    p[index] = i;
+    for (;;) {
+	if (++index < r-1) {
+	    p[index] = i;
+	    continue;
+	}
+	for (; i < n; ++i) {
+	    p[index] = i;
+	    if (!yield_indexed_values(values, r, p)) {
+		rb_raise(rb_eRuntimeError, "repeated combination reentered");
+	    }
+	}
+	do {
+	    if (index <= 0) return;
+	} while ((i = ++p[--index]) >= n);
+    }
 }
 
 static VALUE
-Fary_or(ary1, ary2)
-    struct RArray *ary1, *ary2;
+rb_ary_repeated_combination_size(VALUE ary, VALUE args, VALUE eobj)
 {
-    VALUE ary3;
-    int i;
+    long n = RARRAY_LEN(ary);
+    long k = NUM2LONG(RARRAY_AREF(args, 0));
+    if (k == 0) {
+	return LONG2FIX(1);
+    }
+    return binomial_coefficient(k, n + k - 1);
+}
+
+/*
+ *  call-seq:
+ *     ary.repeated_combination(n) { |c| block } -> ary
+ *     ary.repeated_combination(n)               -> Enumerator
+ *
+ * When invoked with a block, yields all repeated combinations of length +n+ of
+ * elements from the array and then returns the array itself.
+ *
+ * The implementation makes no guarantees about the order in which the repeated
+ * combinations are yielded.
+ *
+ * If no block is given, an Enumerator is returned instead.
+ *
+ * Examples:
+ *
+ *   a = [1, 2, 3]
+ *   a.repeated_combination(1).to_a  #=> [[1], [2], [3]]
+ *   a.repeated_combination(2).to_a  #=> [[1,1],[1,2],[1,3],[2,2],[2,3],[3,3]]
+ *   a.repeated_combination(3).to_a  #=> [[1,1,1],[1,1,2],[1,1,3],[1,2,2],[1,2,3],
+ *                                   #    [1,3,3],[2,2,2],[2,2,3],[2,3,3],[3,3,3]]
+ *   a.repeated_combination(4).to_a  #=> [[1,1,1,1],[1,1,1,2],[1,1,1,3],[1,1,2,2],[1,1,2,3],
+ *                                   #    [1,1,3,3],[1,2,2,2],[1,2,2,3],[1,2,3,3],[1,3,3,3],
+ *                                   #    [2,2,2,2],[2,2,2,3],[2,2,3,3],[2,3,3,3],[3,3,3,3]]
+ *   a.repeated_combination(0).to_a  #=> [[]] # one combination of length 0
+ *
+ */
 
-    if (TYPE(ary2) != T_ARRAY) {
-	if (Fary_includes(ary1, ary2)) return (VALUE)ary1;
-	else return Fary_plus(ary1, ary2);
+static VALUE
+rb_ary_repeated_combination(VALUE ary, VALUE num)
+{
+    long n, i, len;
+
+    n = NUM2LONG(num);                 /* Combination size from argument */
+    RETURN_SIZED_ENUMERATOR(ary, 1, &num, rb_ary_repeated_combination_size);   /* Return enumerator if no block */
+    len = RARRAY_LEN(ary);
+    if (n < 0) {
+	/* yield nothing */
     }
+    else if (n == 0) {
+	rb_yield(rb_ary_new2(0));
+    }
+    else if (n == 1) {
+	for (i = 0; i < RARRAY_LEN(ary); i++) {
+	    rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+	}
+    }
+    else if (len == 0) {
+	/* yield nothing */
+    }
+    else {
+	volatile VALUE t0;
+	long *p = ALLOCV_N(long, t0, n);
+	VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
+	RBASIC_CLEAR_CLASS(ary0);
+
+	rcombinate0(len, n, p, n, ary0); /* compute and yield repeated combinations */
+	ALLOCV_END(t0);
+	RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
+    }
+    return ary;
+}
+
+/*
+ *  call-seq:
+ *     ary.product(other_ary, ...)                -> new_ary
+ *     ary.product(other_ary, ...) { |p| block }  -> ary
+ *
+ *  Returns an array of all combinations of elements from all arrays.
+ *
+ *  The length of the returned array is the product of the length of +self+ and
+ *  the argument arrays.
+ *
+ *  If given a block, #product will yield all combinations and return +self+
+ *  instead.
+ *
+ *     [1,2,3].product([4,5])     #=> [[1,4],[1,5],[2,4],[2,5],[3,4],[3,5]]
+ *     [1,2].product([1,2])       #=> [[1,1],[1,2],[2,1],[2,2]]
+ *     [1,2].product([3,4],[5,6]) #=> [[1,3,5],[1,3,6],[1,4,5],[1,4,6],
+ *                                #     [2,3,5],[2,3,6],[2,4,5],[2,4,6]]
+ *     [1,2].product()            #=> [[1],[2]]
+ *     [1,2].product([])          #=> []
+ */
 
-    ary3 = ary_new();
-    for (i=0; i<ary1->len; i++) {
-	if (!Fary_includes(ary3, ary1->ptr[i]))
-		ary_push(ary3, ary1->ptr[i]);
+static VALUE
+rb_ary_product(int argc, VALUE *argv, VALUE ary)
+{
+    int n = argc+1;    /* How many arrays we're operating on */
+    volatile VALUE t0 = tmpary(n);
+    volatile VALUE t1 = tmpbuf(n, sizeof(int));
+    VALUE *arrays = RARRAY_PTR(t0); /* The arrays we're computing the product of */
+    int *counters = (int*)RSTRING_PTR(t1); /* The current position in each one */
+    VALUE result = Qnil;      /* The array we'll be returning, when no block given */
+    long i,j;
+    long resultlen = 1;
+
+    RBASIC_CLEAR_CLASS(t0);
+    RBASIC_CLEAR_CLASS(t1);
+
+    /* initialize the arrays of arrays */
+    ARY_SET_LEN(t0, n);
+    arrays[0] = ary;
+    for (i = 1; i < n; i++) arrays[i] = Qnil;
+    for (i = 1; i < n; i++) arrays[i] = to_ary(argv[i-1]);
+
+    /* initialize the counters for the arrays */
+    for (i = 0; i < n; i++) counters[i] = 0;
+
+    /* Otherwise, allocate and fill in an array of results */
+    if (rb_block_given_p()) {
+	/* Make defensive copies of arrays; exit if any is empty */
+	for (i = 0; i < n; i++) {
+	    if (RARRAY_LEN(arrays[i]) == 0) goto done;
+	    arrays[i] = ary_make_shared_copy(arrays[i]);
+	}
     }
-    for (i=0; i<ary2->len; i++) {
-	if (!Fary_includes(ary3, ary2->ptr[i]))
-		ary_push(ary3, ary2->ptr[i]);
+    else {
+	/* Compute the length of the result array; return [] if any is empty */
+	for (i = 0; i < n; i++) {
+	    long k = RARRAY_LEN(arrays[i]);
+	    if (k == 0) {
+		result = rb_ary_new2(0);
+		goto done;
+	    }
+            if (MUL_OVERFLOW_LONG_P(resultlen, k))
+		rb_raise(rb_eRangeError, "too big to product");
+	    resultlen *= k;
+	}
+	result = rb_ary_new2(resultlen);
     }
-    return ary3;
+    for (;;) {
+	int m;
+	/* fill in one subarray */
+	VALUE subarray = rb_ary_new2(n);
+	for (j = 0; j < n; j++) {
+	    rb_ary_push(subarray, rb_ary_entry(arrays[j], counters[j]));
+	}
+
+	/* put it on the result array */
+	if (NIL_P(result)) {
+	    FL_SET(t0, FL_USER5);
+	    rb_yield(subarray);
+	    if (! FL_TEST(t0, FL_USER5)) {
+		rb_raise(rb_eRuntimeError, "product reentered");
+	    }
+	    else {
+		FL_UNSET(t0, FL_USER5);
+	    }
+	}
+	else {
+	    rb_ary_push(result, subarray);
+	}
+
+	/*
+	 * Increment the last counter.  If it overflows, reset to 0
+	 * and increment the one before it.
+	 */
+	m = n-1;
+	counters[m]++;
+	while (counters[m] == RARRAY_LEN(arrays[m])) {
+	    counters[m] = 0;
+	    /* If the first counter overflows, we are done */
+	    if (--m < 0) goto done;
+	    counters[m]++;
+	}
+    }
+done:
+    tmpary_discard(t0);
+    tmpbuf_discard(t1);
+
+    return NIL_P(result) ? ary : result;
 }
 
-extern VALUE C_Kernel;
-extern VALUE M_Enumerable;
-
-Init_Array()
-{
-    C_Array  = rb_define_class("Array", C_Object);
-    rb_include_module(C_Array, M_Enumerable);
-
-    rb_define_single_method(C_Array, "new", Sary_new, 0);
-    rb_define_single_method(C_Array, "[]", Sary_create, -1);
-    rb_define_method(C_Array, "to_s", Fary_to_s, 0);
-    rb_define_method(C_Array, "_inspect", Fary_inspect, 0);
-    rb_define_method(C_Array, "to_a", Fary_to_a, 0);
-
-    rb_define_method(C_Array, "print_on", Fary_print_on, 1);
-
-    rb_define_method(C_Array, "==", Fary_equal, 1);
-    rb_define_method(C_Array, "hash", Fary_hash, 0);
-    rb_define_method(C_Array, "[]", Fary_aref, -1);
-    rb_define_method(C_Array, "[]=", Fary_aset, -1);
-    rb_define_method(C_Array, "<<", Fary_append, 1);
-    rb_define_method(C_Array, "push", ary_push, 1);
-    rb_define_method(C_Array, "pop", ary_pop, 0);
-    rb_define_method(C_Array, "shift", ary_shift, 0);
-    rb_define_method(C_Array, "unshift", ary_unshift, 1);
-    rb_define_method(C_Array, "each", Fary_each, 0);
-    rb_define_method(C_Array, "each_index", Fary_each_index, 0);
-    rb_define_method(C_Array, "length", Fary_length, 0);
-    rb_define_alias(C_Array,  "size", "length");
-    rb_define_method(C_Array, "index", Fary_index, 1);
-    rb_define_method(C_Array, "indexes", Fary_indexes, -2);
-    rb_define_method(C_Array, "clone", ary_clone, 0);
-    rb_define_method(C_Array, "join", Fary_join, -1);
-    rb_define_method(C_Array, "reverse", Fary_reverse, 0);
-    rb_define_method(C_Array, "sort", Fary_sort, 0);
-    rb_define_method(C_Array, "delete", Fary_delete, 1);
-    rb_define_method(C_Array, "delete_if", Fary_delete_if, 0);
-    rb_define_method(C_Array, "clear", Fary_clear, 0);
-    rb_define_method(C_Array, "fill", Fary_fill, -1);
-    rb_define_method(C_Array, "includes", Fary_includes, 1);
-
-    rb_define_method(C_Array, "assoc", Fary_assoc, 1);
-    rb_define_method(C_Array, "rassoc", Fary_rassoc, 1);
-
-    rb_define_method(C_Array, "+", Fary_plus, 1);
-    rb_define_method(C_Array, "*", Fary_times, 1);
-
-    rb_define_method(C_Array, "-", Fary_diff, 1);
-    rb_define_method(C_Array, "&", Fary_and, 1);
-    rb_define_method(C_Array, "|", Fary_or, 1);
+/*
+ *  call-seq:
+ *     ary.take(n)               -> new_ary
+ *
+ *  Returns first +n+ elements from the array.
+ *
+ *  If a negative number is given, raises an ArgumentError.
+ *
+ *  See also Array#drop
+ *
+ *     a = [1, 2, 3, 4, 5, 0]
+ *     a.take(3)             #=> [1, 2, 3]
+ *
+ */
+
+static VALUE
+rb_ary_take(VALUE obj, VALUE n)
+{
+    long len = NUM2LONG(n);
+    if (len < 0) {
+	rb_raise(rb_eArgError, "attempt to take negative size");
+    }
+    return rb_ary_subseq(obj, 0, len);
+}
+
+/*
+ *  call-seq:
+ *     ary.take_while { |obj| block }  -> new_ary
+ *     ary.take_while                  -> Enumerator
+ *
+ *  Passes elements to the block until the block returns +nil+ or +false+, then
+ *  stops iterating and returns an array of all prior elements.
+ *
+ *  If no block is given, an Enumerator is returned instead.
+ *
+ *  See also Array#drop_while
+ *
+ *     a = [1, 2, 3, 4, 5, 0]
+ *     a.take_while { |i| i < 3 }  #=> [1, 2]
+ *
+ */
+
+static VALUE
+rb_ary_take_while(VALUE ary)
+{
+    long i;
+
+    RETURN_ENUMERATOR(ary, 0, 0);
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+	if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) break;
+    }
+    return rb_ary_take(ary, LONG2FIX(i));
+}
+
+/*
+ *  call-seq:
+ *     ary.drop(n)               -> new_ary
+ *
+ *  Drops first +n+ elements from +ary+ and returns the rest of the elements in
+ *  an array.
+ *
+ *  If a negative number is given, raises an ArgumentError.
+ *
+ *  See also Array#take
+ *
+ *     a = [1, 2, 3, 4, 5, 0]
+ *     a.drop(3)             #=> [4, 5, 0]
+ *
+ */
+
+static VALUE
+rb_ary_drop(VALUE ary, VALUE n)
+{
+    VALUE result;
+    long pos = NUM2LONG(n);
+    if (pos < 0) {
+	rb_raise(rb_eArgError, "attempt to drop negative size");
+    }
+
+    result = rb_ary_subseq(ary, pos, RARRAY_LEN(ary));
+    if (result == Qnil) result = rb_ary_new();
+    return result;
+}
+
+/*
+ *  call-seq:
+ *     ary.drop_while { |obj| block }   -> new_ary
+ *     ary.drop_while                  -> Enumerator
+ *
+ *  Drops elements up to, but not including, the first element for which the
+ *  block returns +nil+ or +false+ and returns an array containing the
+ *  remaining elements.
+ *
+ *  If no block is given, an Enumerator is returned instead.
+ *
+ *  See also Array#take_while
+ *
+ *     a = [1, 2, 3, 4, 5, 0]
+ *     a.drop_while {|i| i < 3 }   #=> [3, 4, 5, 0]
+ *
+ */
+
+static VALUE
+rb_ary_drop_while(VALUE ary)
+{
+    long i;
+
+    RETURN_ENUMERATOR(ary, 0, 0);
+    for (i = 0; i < RARRAY_LEN(ary); i++) {
+	if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) break;
+    }
+    return rb_ary_drop(ary, LONG2FIX(i));
+}
+
+/*
+ *  call-seq:
+ *     ary.any? [{ |obj| block }]   -> true or false
+ *
+ *  See also Enumerable#any?
+ */
+
+static VALUE
+rb_ary_any_p(VALUE ary)
+{
+    long i, len = RARRAY_LEN(ary);
+    const VALUE *ptr = RARRAY_CONST_PTR(ary);
+
+    if (!len) return Qfalse;
+    if (!rb_block_given_p()) {
+	for (i = 0; i < len; ++i) if (RTEST(ptr[i])) return Qtrue;
+    }
+    else {
+	for (i = 0; i < RARRAY_LEN(ary); ++i) {
+	    if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) return Qtrue;
+	}
+    }
+    return Qfalse;
+}
+
+/*
+ * call-seq:
+ *   ary.dig(idx, ...)                 -> object
+ *
+ * Extracts the nested value specified by the sequence of <i>idx</i>
+ * objects by calling +dig+ at each step, returning +nil+ if any
+ * intermediate step is +nil+.
+ *
+ *   a = [[1, [2, 3]]]
+ *
+ *   a.dig(0, 1, 1)                    #=> 3
+ *   a.dig(1, 2, 3)                    #=> nil
+ *   a.dig(0, 0, 0)                    #=> NoMethodError, undefined method `dig' for 1:Fixnum
+ *   [42, {foo: :bar}].dig(1, :foo)    #=> :bar
+ */
+
+VALUE
+rb_ary_dig(int argc, VALUE *argv, VALUE self)
+{
+    rb_check_arity(argc, 1, UNLIMITED_ARGUMENTS);
+    self = rb_ary_at(self, *argv);
+    if (!--argc) return self;
+    ++argv;
+    return rb_obj_dig(argc, argv, self, Qnil);
+}
+
+/*
+ *  Arrays are ordered, integer-indexed collections of any object.
+ *
+ *  Array indexing starts at 0, as in C or Java.  A negative index is assumed
+ *  to be relative to the end of the array---that is, an index of -1 indicates
+ *  the last element of the array, -2 is the next to last element in the
+ *  array, and so on.
+ *
+ *  == Creating Arrays
+ *
+ *  A new array can be created by using the literal constructor
+ *  <code>[]</code>.  Arrays can contain different types of objects.  For
+ *  example, the array below contains an Integer, a String and a Float:
+ *
+ *     ary = [1, "two", 3.0] #=> [1, "two", 3.0]
+ *
+ *  An array can also be created by explicitly calling Array.new with zero, one
+ *  (the initial size of the Array) or two arguments (the initial size and a
+ *  default object).
+ *
+ *     ary = Array.new    #=> []
+ *     Array.new(3)       #=> [nil, nil, nil]
+ *     Array.new(3, true) #=> [true, true, true]
+ *
+ *  Note that the second argument populates the array with references to the
+ *  same object.  Therefore, it is only recommended in cases when you need to
+ *  instantiate arrays with natively immutable objects such as Symbols,
+ *  numbers, true or false.
+ *
+ *  To create an array with separate objects a block can be passed instead.
+ *  This method is safe to use with mutable objects such as hashes, strings or
+ *  other arrays:
+ *
+ *     Array.new(4) { Hash.new }  #=> [{}, {}, {}, {}]
+ *     Array.new(4) {|i| i.to_s } #=> ["0", "1", "2", "3"]
+ *
+ *  This is also a quick way to build up multi-dimensional arrays:
+ *
+ *     empty_table = Array.new(3) { Array.new(3) }
+ *     #=> [[nil, nil, nil], [nil, nil, nil], [nil, nil, nil]]
+ *
+ *  An array can also be created by using the Array() method, provided by
+ *  Kernel, which tries to call #to_ary, then #to_a on its argument.
+ *
+ *	Array({:a => "a", :b => "b"}) #=> [[:a, "a"], [:b, "b"]]
+ *
+ *  == Example Usage
+ *
+ *  In addition to the methods it mixes in through the Enumerable module, the
+ *  Array class has proprietary methods for accessing, searching and otherwise
+ *  manipulating arrays.
+ *
+ *  Some of the more common ones are illustrated below.
+ *
+ *  == Accessing Elements
+ *
+ *  Elements in an array can be retrieved using the Array#[] method.  It can
+ *  take a single integer argument (a numeric index), a pair of arguments
+ *  (start and length) or a range. Negative indices start counting from the end,
+ *  with -1 being the last element.
+ *
+ *     arr = [1, 2, 3, 4, 5, 6]
+ *     arr[2]    #=> 3
+ *     arr[100]  #=> nil
+ *     arr[-3]   #=> 4
+ *     arr[2, 3] #=> [3, 4, 5]
+ *     arr[1..4] #=> [2, 3, 4, 5]
+ *     arr[1..-3] #=> [2, 3, 4]
+ *
+ *  Another way to access a particular array element is by using the #at method
+ *
+ *     arr.at(0) #=> 1
+ *
+ *  The #slice method works in an identical manner to Array#[].
+ *
+ *  To raise an error for indices outside of the array bounds or else to
+ *  provide a default value when that happens, you can use #fetch.
+ *
+ *     arr = ['a', 'b', 'c', 'd', 'e', 'f']
+ *     arr.fetch(100) #=> IndexError: index 100 outside of array bounds: -6...6
+ *     arr.fetch(100, "oops") #=> "oops"
+ *
+ *  The special methods #first and #last will return the first and last
+ *  elements of an array, respectively.
+ *
+ *     arr.first #=> 1
+ *     arr.last  #=> 6
+ *
+ *  To return the first +n+ elements of an array, use #take
+ *
+ *     arr.take(3) #=> [1, 2, 3]
+ *
+ *  #drop does the opposite of #take, by returning the elements after +n+
+ *  elements have been dropped:
+ *
+ *     arr.drop(3) #=> [4, 5, 6]
+ *
+ *  == Obtaining Information about an Array
+ *
+ *  Arrays keep track of their own length at all times.  To query an array
+ *  about the number of elements it contains, use #length, #count or #size.
+ *
+ *    browsers = ['Chrome', 'Firefox', 'Safari', 'Opera', 'IE']
+ *    browsers.length #=> 5
+ *    browsers.count #=> 5
+ *
+ *  To check whether an array contains any elements at all
+ *
+ *    browsers.empty? #=> false
+ *
+ *  To check whether a particular item is included in the array
+ *
+ *    browsers.include?('Konqueror') #=> false
+ *
+ *  == Adding Items to Arrays
+ *
+ *  Items can be added to the end of an array by using either #push or #<<
+ *
+ *    arr = [1, 2, 3, 4]
+ *    arr.push(5) #=> [1, 2, 3, 4, 5]
+ *    arr << 6    #=> [1, 2, 3, 4, 5, 6]
+ *
+ *  #unshift will add a new item to the beginning of an array.
+ *
+ *     arr.unshift(0) #=> [0, 1, 2, 3, 4, 5, 6]
+ *
+ *  With #insert you can add a new element to an array at any position.
+ *
+ *     arr.insert(3, 'apple')  #=> [0, 1, 2, 'apple', 3, 4, 5, 6]
+ *
+ *  Using the #insert method, you can also insert multiple values at once:
+ *
+ *     arr.insert(3, 'orange', 'pear', 'grapefruit')
+ *     #=> [0, 1, 2, "orange", "pear", "grapefruit", "apple", 3, 4, 5, 6]
+ *
+ *  == Removing Items from an Array
+ *
+ *  The method #pop removes the last element in an array and returns it:
+ *
+ *     arr =  [1, 2, 3, 4, 5, 6]
+ *     arr.pop #=> 6
+ *     arr #=> [1, 2, 3, 4, 5]
+ *
+ *  To retrieve and at the same time remove the first item, use #shift:
+ *
+ *     arr.shift #=> 1
+ *     arr #=> [2, 3, 4, 5]
+ *
+ *  To delete an element at a particular index:
+ *
+ *     arr.delete_at(2) #=> 4
+ *     arr #=> [2, 3, 5]
+ *
+ *  To delete a particular element anywhere in an array, use #delete:
+ *
+ *     arr = [1, 2, 2, 3]
+ *     arr.delete(2) #=> 2
+ *     arr #=> [1,3]
+ *
+ *  A useful method if you need to remove +nil+ values from an array is
+ *  #compact:
+ *
+ *     arr = ['foo', 0, nil, 'bar', 7, 'baz', nil]
+ *     arr.compact  #=> ['foo', 0, 'bar', 7, 'baz']
+ *     arr          #=> ['foo', 0, nil, 'bar', 7, 'baz', nil]
+ *     arr.compact! #=> ['foo', 0, 'bar', 7, 'baz']
+ *     arr          #=> ['foo', 0, 'bar', 7, 'baz']
+ *
+ *  Another common need is to remove duplicate elements from an array.
+ *
+ *  It has the non-destructive #uniq, and destructive method #uniq!
+ *
+ *     arr = [2, 5, 6, 556, 6, 6, 8, 9, 0, 123, 556]
+ *     arr.uniq #=> [2, 5, 6, 556, 8, 9, 0, 123]
+ *
+ *  == Iterating over Arrays
+ *
+ *  Like all classes that include the Enumerable module, Array has an each
+ *  method, which defines what elements should be iterated over and how.  In
+ *  case of Array's #each, all elements in the Array instance are yielded to
+ *  the supplied block in sequence.
+ *
+ *  Note that this operation leaves the array unchanged.
+ *
+ *     arr = [1, 2, 3, 4, 5]
+ *     arr.each { |a| print a -= 10, " " }
+ *     # prints: -9 -8 -7 -6 -5
+ *     #=> [1, 2, 3, 4, 5]
+ *
+ *  Another sometimes useful iterator is #reverse_each which will iterate over
+ *  the elements in the array in reverse order.
+ *
+ *     words = %w[first second third fourth fifth sixth]
+ *     str = ""
+ *     words.reverse_each { |word| str += "#{word} " }
+ *     p str #=> "sixth fifth fourth third second first "
+ *
+ *  The #map method can be used to create a new array based on the original
+ *  array, but with the values modified by the supplied block:
+ *
+ *     arr.map { |a| 2*a }   #=> [2, 4, 6, 8, 10]
+ *     arr                   #=> [1, 2, 3, 4, 5]
+ *     arr.map! { |a| a**2 } #=> [1, 4, 9, 16, 25]
+ *     arr                   #=> [1, 4, 9, 16, 25]
+ *
+ *  == Selecting Items from an Array
+ *
+ *  Elements can be selected from an array according to criteria defined in a
+ *  block.  The selection can happen in a destructive or a non-destructive
+ *  manner.  While the destructive operations will modify the array they were
+ *  called on, the non-destructive methods usually return a new array with the
+ *  selected elements, but leave the original array unchanged.
+ *
+ *  === Non-destructive Selection
+ *
+ *     arr = [1, 2, 3, 4, 5, 6]
+ *     arr.select { |a| a > 3 }     #=> [4, 5, 6]
+ *     arr.reject { |a| a < 3 }     #=> [3, 4, 5, 6]
+ *     arr.drop_while { |a| a < 4 } #=> [4, 5, 6]
+ *     arr                          #=> [1, 2, 3, 4, 5, 6]
+ *
+ *  === Destructive Selection
+ *
+ *  #select! and #reject! are the corresponding destructive methods to #select
+ *  and #reject
+ *
+ *  Similar to #select vs. #reject, #delete_if and #keep_if have the exact
+ *  opposite result when supplied with the same block:
+ *
+ *     arr.delete_if { |a| a < 4 } #=> [4, 5, 6]
+ *     arr                         #=> [4, 5, 6]
+ *
+ *     arr = [1, 2, 3, 4, 5, 6]
+ *     arr.keep_if { |a| a < 4 } #=> [1, 2, 3]
+ *     arr                       #=> [1, 2, 3]
+ *
+ */
+
+void
+Init_Array(void)
+{
+#undef rb_intern
+#define rb_intern(str) rb_intern_const(str)
+
+    rb_cArray  = rb_define_class("Array", rb_cObject);
+    rb_include_module(rb_cArray, rb_mEnumerable);
+
+    rb_define_alloc_func(rb_cArray, empty_ary_alloc);
+    rb_define_singleton_method(rb_cArray, "[]", rb_ary_s_create, -1);
+    rb_define_singleton_method(rb_cArray, "try_convert", rb_ary_s_try_convert, 1);
+    rb_define_method(rb_cArray, "initialize", rb_ary_initialize, -1);
+    rb_define_method(rb_cArray, "initialize_copy", rb_ary_replace, 1);
+
+    rb_define_method(rb_cArray, "inspect", rb_ary_inspect, 0);
+    rb_define_alias(rb_cArray,  "to_s", "inspect");
+    rb_define_method(rb_cArray, "to_a", rb_ary_to_a, 0);
+    rb_define_method(rb_cArray, "to_h", rb_ary_to_h, 0);
+    rb_define_method(rb_cArray, "to_ary", rb_ary_to_ary_m, 0);
+    rb_define_method(rb_cArray, "frozen?",  rb_ary_frozen_p, 0);
+
+    rb_define_method(rb_cArray, "==", rb_ary_equal, 1);
+    rb_define_method(rb_cArray, "eql?", rb_ary_eql, 1);
+    rb_define_method(rb_cArray, "hash", rb_ary_hash, 0);
+
+    rb_define_method(rb_cArray, "[]", rb_ary_aref, -1);
+    rb_define_method(rb_cArray, "[]=", rb_ary_aset, -1);
+    rb_define_method(rb_cArray, "at", rb_ary_at, 1);
+    rb_define_method(rb_cArray, "fetch", rb_ary_fetch, -1);
+    rb_define_method(rb_cArray, "first", rb_ary_first, -1);
+    rb_define_method(rb_cArray, "last", rb_ary_last, -1);
+    rb_define_method(rb_cArray, "concat", rb_ary_concat, 1);
+    rb_define_method(rb_cArray, "<<", rb_ary_push, 1);
+    rb_define_method(rb_cArray, "push", rb_ary_push_m, -1);
+    rb_define_method(rb_cArray, "pop", rb_ary_pop_m, -1);
+    rb_define_method(rb_cArray, "shift", rb_ary_shift_m, -1);
+    rb_define_method(rb_cArray, "unshift", rb_ary_unshift_m, -1);
+    rb_define_method(rb_cArray, "insert", rb_ary_insert, -1);
+    rb_define_method(rb_cArray, "each", rb_ary_each, 0);
+    rb_define_method(rb_cArray, "each_index", rb_ary_each_index, 0);
+    rb_define_method(rb_cArray, "reverse_each", rb_ary_reverse_each, 0);
+    rb_define_method(rb_cArray, "length", rb_ary_length, 0);
+    rb_define_alias(rb_cArray,  "size", "length");
+    rb_define_method(rb_cArray, "empty?", rb_ary_empty_p, 0);
+    rb_define_method(rb_cArray, "find_index", rb_ary_index, -1);
+    rb_define_method(rb_cArray, "index", rb_ary_index, -1);
+    rb_define_method(rb_cArray, "rindex", rb_ary_rindex, -1);
+    rb_define_method(rb_cArray, "join", rb_ary_join_m, -1);
+    rb_define_method(rb_cArray, "reverse", rb_ary_reverse_m, 0);
+    rb_define_method(rb_cArray, "reverse!", rb_ary_reverse_bang, 0);
+    rb_define_method(rb_cArray, "rotate", rb_ary_rotate_m, -1);
+    rb_define_method(rb_cArray, "rotate!", rb_ary_rotate_bang, -1);
+    rb_define_method(rb_cArray, "sort", rb_ary_sort, 0);
+    rb_define_method(rb_cArray, "sort!", rb_ary_sort_bang, 0);
+    rb_define_method(rb_cArray, "sort_by!", rb_ary_sort_by_bang, 0);
+    rb_define_method(rb_cArray, "collect", rb_ary_collect, 0);
+    rb_define_method(rb_cArray, "collect!", rb_ary_collect_bang, 0);
+    rb_define_method(rb_cArray, "map", rb_ary_collect, 0);
+    rb_define_method(rb_cArray, "map!", rb_ary_collect_bang, 0);
+    rb_define_method(rb_cArray, "select", rb_ary_select, 0);
+    rb_define_method(rb_cArray, "select!", rb_ary_select_bang, 0);
+    rb_define_method(rb_cArray, "keep_if", rb_ary_keep_if, 0);
+    rb_define_method(rb_cArray, "values_at", rb_ary_values_at, -1);
+    rb_define_method(rb_cArray, "delete", rb_ary_delete, 1);
+    rb_define_method(rb_cArray, "delete_at", rb_ary_delete_at_m, 1);
+    rb_define_method(rb_cArray, "delete_if", rb_ary_delete_if, 0);
+    rb_define_method(rb_cArray, "reject", rb_ary_reject, 0);
+    rb_define_method(rb_cArray, "reject!", rb_ary_reject_bang, 0);
+    rb_define_method(rb_cArray, "zip", rb_ary_zip, -1);
+    rb_define_method(rb_cArray, "transpose", rb_ary_transpose, 0);
+    rb_define_method(rb_cArray, "replace", rb_ary_replace, 1);
+    rb_define_method(rb_cArray, "clear", rb_ary_clear, 0);
+    rb_define_method(rb_cArray, "fill", rb_ary_fill, -1);
+    rb_define_method(rb_cArray, "include?", rb_ary_includes, 1);
+    rb_define_method(rb_cArray, "<=>", rb_ary_cmp, 1);
+
+    rb_define_method(rb_cArray, "slice", rb_ary_aref, -1);
+    rb_define_method(rb_cArray, "slice!", rb_ary_slice_bang, -1);
+
+    rb_define_method(rb_cArray, "assoc", rb_ary_assoc, 1);
+    rb_define_method(rb_cArray, "rassoc", rb_ary_rassoc, 1);
+
+    rb_define_method(rb_cArray, "+", rb_ary_plus, 1);
+    rb_define_method(rb_cArray, "*", rb_ary_times, 1);
+
+    rb_define_method(rb_cArray, "-", rb_ary_diff, 1);
+    rb_define_method(rb_cArray, "&", rb_ary_and, 1);
+    rb_define_method(rb_cArray, "|", rb_ary_or, 1);
+
+    rb_define_method(rb_cArray, "uniq", rb_ary_uniq, 0);
+    rb_define_method(rb_cArray, "uniq!", rb_ary_uniq_bang, 0);
+    rb_define_method(rb_cArray, "compact", rb_ary_compact, 0);
+    rb_define_method(rb_cArray, "compact!", rb_ary_compact_bang, 0);
+    rb_define_method(rb_cArray, "flatten", rb_ary_flatten, -1);
+    rb_define_method(rb_cArray, "flatten!", rb_ary_flatten_bang, -1);
+    rb_define_method(rb_cArray, "count", rb_ary_count, -1);
+    rb_define_method(rb_cArray, "shuffle!", rb_ary_shuffle_bang, -1);
+    rb_define_method(rb_cArray, "shuffle", rb_ary_shuffle, -1);
+    rb_define_method(rb_cArray, "sample", rb_ary_sample, -1);
+    rb_define_method(rb_cArray, "cycle", rb_ary_cycle, -1);
+    rb_define_method(rb_cArray, "permutation", rb_ary_permutation, -1);
+    rb_define_method(rb_cArray, "combination", rb_ary_combination, 1);
+    rb_define_method(rb_cArray, "repeated_permutation", rb_ary_repeated_permutation, 1);
+    rb_define_method(rb_cArray, "repeated_combination", rb_ary_repeated_combination, 1);
+    rb_define_method(rb_cArray, "product", rb_ary_product, -1);
+
+    rb_define_method(rb_cArray, "take", rb_ary_take, 1);
+    rb_define_method(rb_cArray, "take_while", rb_ary_take_while, 0);
+    rb_define_method(rb_cArray, "drop", rb_ary_drop, 1);
+    rb_define_method(rb_cArray, "drop_while", rb_ary_drop_while, 0);
+    rb_define_method(rb_cArray, "bsearch", rb_ary_bsearch, 0);
+    rb_define_method(rb_cArray, "bsearch_index", rb_ary_bsearch_index, 0);
+    rb_define_method(rb_cArray, "any?", rb_ary_any_p, 0);
+    rb_define_method(rb_cArray, "dig", rb_ary_dig, -1);
+
+    id_cmp = rb_intern("<=>");
+    id_random = rb_intern("random");
+    id_div = rb_intern("div");
+    id_power = rb_intern("**");
 }
diff --git a/assoc.c b/assoc.c
deleted file mode 100644
index f3172b3ca0..0000000000
--- a/assoc.c
+++ /dev/null
@@ -1,150 +0,0 @@
-/************************************************
-
-  assoc.c -
-
-  $Author: matz $
-  $Date: 1995/01/10 10:30:37 $
-  created at: Fri Jan  6 10:10:36 JST 1995
-
-  Copyright (C) 1993-1995 Yukihiro Matsumoto
-
-************************************************/
-
-#include "ruby.h"
-
-static VALUE C_Assoc;
-
-static ID eq;
-
-VALUE rb_to_a();
-
-VALUE
-assoc_new(car, cdr)
-    VALUE car, cdr;
-{
-    NEWOBJ(assoc, struct RAssoc);
-    OBJSETUP(assoc, C_Assoc, T_ASSOC);
-
-    assoc->car = car;
-    assoc->cdr = cdr;
-
-    return (VALUE)assoc;
-}
-
-static VALUE
-Fassoc_car(assoc)
-    struct RAssoc *assoc;
-{
-    return assoc->car;
-}
-
-static VALUE
-Fassoc_cdr(assoc)
-    struct RAssoc *assoc;
-{
-    return assoc->cdr;
-}
-
-static VALUE
-Fassoc_set_car(assoc, val)
-    struct RAssoc *assoc;
-    VALUE val;
-{
-    return assoc->car = val;
-}
-
-static VALUE
-Fassoc_set_cdr(assoc, val)
-    struct RAssoc *assoc;
-    VALUE val;
-{
-    return assoc->cdr = val;
-}
-
-static VALUE
-Fassoc_equal(assoc1, assoc2)
-    struct RAssoc *assoc1, *assoc2;
-{
-    if (TYPE(assoc2) != T_ASSOC) return FALSE;
-    if (!rb_equal(assoc1->car, assoc2->car)) return FALSE;
-    return rb_equal(assoc1->cdr, assoc2->cdr);
-}
-
-static VALUE
-Fassoc_hash(assoc)
-    struct RAssoc *assoc;
-{
-    static ID hash;
-    int key;
-
-    if (!hash) hash = rb_intern("hash");
-    key = rb_funcall(assoc->car, hash, 0, 0);
-    key ^= rb_funcall(assoc->cdr, hash, 0, 0);
-    return INT2FIX(key);
-}
-
-static VALUE
-Fassoc_to_s(assoc)
-    struct RAssoc *assoc;
-{
-    VALUE str1, str2;
-    static ID to_s;
-
-    if (!to_s) to_s = rb_intern("to_s");
-
-    str1 = rb_funcall(assoc->car, to_s, 0);
-    assoc = RASSOC(assoc->cdr);
-    while (assoc) {
-	if (TYPE(assoc) != T_ASSOC) {
-	    str2 = rb_funcall(assoc, to_s, 0);
-	    str_cat(str1, RSTRING(str2)->ptr, RSTRING(str2)->len);
-	    break;
-	}
-	str2 = rb_funcall(assoc->car, to_s, 0);
-	str_cat(str1, RSTRING(str2)->ptr, RSTRING(str2)->len);
-	assoc = RASSOC(assoc->cdr);
-    }
-
-    return str1;
-}
-
-static VALUE
-Fassoc_inspect(assoc)
-    struct RAssoc *assoc;
-{
-    VALUE str1, str2;
-    static ID inspect;
-
-    if (!inspect) inspect = rb_intern("_inspect");
-
-    str1 = rb_funcall(assoc->car, inspect, 0, 0);
-    str2 = rb_funcall(assoc->cdr, inspect, 0, 0);
-    str_cat(str1, "::", 2);
-    str_cat(str1, RSTRING(str2)->ptr, RSTRING(str2)->len);
-
-    return str1;
-}
-
-extern VALUE C_Kernel;
-
-Init_Assoc()
-{
-    C_Assoc  = rb_define_class("Assoc", C_Object);
-
-    rb_undef_method(CLASS_OF(C_Assoc), "new");
-    rb_undef_method(C_Assoc, "clone");
-
-    rb_define_method(C_Assoc, "car", Fassoc_car, 0);
-    rb_define_method(C_Assoc, "cdr", Fassoc_cdr, 0);
-
-    rb_define_method(C_Assoc, "car=", Fassoc_set_car, 1);
-    rb_define_method(C_Assoc, "cdr=", Fassoc_set_cdr, 1);
-
-    rb_define_method(C_Assoc, "==", Fassoc_equal, 1);
-    rb_define_method(C_Assoc, "hash", Fassoc_hash, 0);
-
-    rb_define_method(C_Assoc, "to_s", Fassoc_to_s, 0);
-    rb_define_method(C_Assoc, "_inspect", Fassoc_inspect, 0);
-
-    rb_define_method(C_Kernel, "::", assoc_new, 1);
-}
diff --git a/benchmark/bm_app_answer.rb b/benchmark/bm_app_answer.rb
new file mode 100644
index 0000000000..3cd8a8fd37
--- /dev/null
+++ b/benchmark/bm_app_answer.rb
@@ -0,0 +1,15 @@
+def ack(m, n)
+  if m == 0 then
+    n + 1
+  elsif n == 0 then
+    ack(m - 1, 1)
+  else
+    ack(m - 1, ack(m, n - 1))
+  end
+end
+
+def the_answer_to_life_the_universe_and_everything
+  (ack(3,7).to_s.split(//).inject(0){|s,x| s+x.to_i}.to_s + "2" ).to_i
+end
+
+answer = the_answer_to_life_the_universe_and_everything
diff --git a/benchmark/bm_app_aobench.rb b/benchmark/bm_app_aobench.rb
new file mode 100644
index 0000000000..2bd6acfaf8
--- /dev/null
+++ b/benchmark/bm_app_aobench.rb
@@ -0,0 +1,291 @@
+# AO render benchmark
+# Original program (C) Syoyo Fujita in Javascript (and other languages)
+#      https://code.google.com/p/aobench/
+# Ruby(yarv2llvm) version by Hideki Miura
+#
+
+IMAGE_WIDTH = 256
+IMAGE_HEIGHT = 256
+NSUBSAMPLES = 2
+NAO_SAMPLES = 8
+
+class Vec
+  def initialize(x, y, z)
+    @x = x
+    @y = y
+    @z = z
+  end
+
+  attr_accessor :x, :y, :z
+
+  def vadd(b)
+    Vec.new(@x + b.x, @y + b.y, @z + b.z)
+  end
+
+  def vsub(b)
+    Vec.new(@x - b.x, @y - b.y, @z - b.z)
+  end
+
+  def vcross(b)
+    Vec.new(@y * b.z - @z * b.y,
+            @z * b.x - @x * b.z,
+            @x * b.y - @y * b.x)
+  end
+
+  def vdot(b)
+    @x * b.x + @y * b.y + @z * b.z
+  end
+
+  def vlength
+    Math.sqrt(@x * @x + @y * @y + @z * @z)
+  end
+
+  def vnormalize
+    len = vlength
+    v = Vec.new(@x, @y, @z)
+    if len > 1.0e-17 then
+      v.x = v.x / len
+      v.y = v.y / len
+      v.z = v.z / len
+    end
+    v
+  end
+end
+
+
+class Sphere
+  def initialize(center, radius)
+    @center = center
+    @radius = radius
+  end
+
+  attr_reader :center, :radius
+
+  def intersect(ray, isect)
+    rs = ray.org.vsub(@center)
+    b = rs.vdot(ray.dir)
+    c = rs.vdot(rs) - (@radius * @radius)
+    d = b * b - c
+    if d > 0.0 then
+      t = - b - Math.sqrt(d)
+
+      if t > 0.0 and t < isect.t then
+        isect.t = t
+        isect.hit = true
+        isect.pl = Vec.new(ray.org.x + ray.dir.x * t,
+                          ray.org.y + ray.dir.y * t,
+                          ray.org.z + ray.dir.z * t)
+        n = isect.pl.vsub(@center)
+        isect.n = n.vnormalize
+      else
+        0.0
+      end
+    end
+    nil
+  end
+end
+
+class Plane
+  def initialize(p, n)
+    @p = p
+    @n = n
+  end
+
+  def intersect(ray, isect)
+    d = -@p.vdot(@n)
+    v = ray.dir.vdot(@n)
+    v0 = v
+    if v < 0.0 then
+      v0 = -v
+    end
+    if v0 < 1.0e-17 then
+      return
+    end
+
+    t = -(ray.org.vdot(@n) + d) / v
+
+    if t > 0.0 and t < isect.t then
+      isect.hit = true
+      isect.t = t
+      isect.n = @n
+      isect.pl = Vec.new(ray.org.x + t * ray.dir.x,
+                        ray.org.y + t * ray.dir.y,
+                        ray.org.z + t * ray.dir.z)
+    end
+    nil
+  end
+end
+
+class Ray
+  def initialize(org, dir)
+    @org = org
+    @dir = dir
+  end
+
+  attr_accessor :org, :dir
+end
+
+class Isect
+  def initialize
+    @t = 10000000.0
+    @hit = false
+    @pl = Vec.new(0.0, 0.0, 0.0)
+    @n = Vec.new(0.0, 0.0, 0.0)
+  end
+
+  attr_accessor :t, :hit, :pl, :n
+end
+
+def clamp(f)
+  i = f * 255.5
+  if i > 255.0 then
+    i = 255.0
+  end
+  if i < 0.0 then
+    i = 0.0
+  end
+  i.to_i
+end
+
+def otherBasis(basis, n)
+  basis[2] = Vec.new(n.x, n.y, n.z)
+  basis[1] = Vec.new(0.0, 0.0, 0.0)
+
+  if n.x < 0.6 and n.x > -0.6 then
+    basis[1].x = 1.0
+  elsif n.y < 0.6 and n.y > -0.6 then
+    basis[1].y = 1.0
+  elsif n.z < 0.6 and n.z > -0.6 then
+    basis[1].z = 1.0
+  else
+    basis[1].x = 1.0
+  end
+
+  basis[0] = basis[1].vcross(basis[2])
+  basis[0] = basis[0].vnormalize
+
+  basis[1] = basis[2].vcross(basis[0])
+  basis[1] = basis[1].vnormalize
+end
+
+class Scene
+  def initialize
+    @spheres = Array.new
+    @spheres[0] = Sphere.new(Vec.new(-2.0, 0.0, -3.5), 0.5)
+    @spheres[1] = Sphere.new(Vec.new(-0.5, 0.0, -3.0), 0.5)
+    @spheres[2] = Sphere.new(Vec.new(1.0, 0.0, -2.2), 0.5)
+    @plane = Plane.new(Vec.new(0.0, -0.5, 0.0), Vec.new(0.0, 1.0, 0.0))
+  end
+
+  def ambient_occlusion(isect)
+    basis = Array.new
+    otherBasis(basis, isect.n)
+
+    ntheta    = NAO_SAMPLES
+    nphi      = NAO_SAMPLES
+    eps       = 0.0001
+    occlusion = 0.0
+
+    p0 = Vec.new(isect.pl.x + eps * isect.n.x,
+                isect.pl.y + eps * isect.n.y,
+                isect.pl.z + eps * isect.n.z)
+    nphi.times do |j|
+      ntheta.times do |i|
+        r = rand
+        phi = 2.0 * 3.14159265 * rand
+        x = Math.cos(phi) * Math.sqrt(1.0 - r)
+        y = Math.sin(phi) * Math.sqrt(1.0 - r)
+        z = Math.sqrt(r)
+
+        rx = x * basis[0].x + y * basis[1].x + z * basis[2].x
+        ry = x * basis[0].y + y * basis[1].y + z * basis[2].y
+        rz = x * basis[0].z + y * basis[1].z + z * basis[2].z
+
+        raydir = Vec.new(rx, ry, rz)
+        ray = Ray.new(p0, raydir)
+
+        occisect = Isect.new
+        @spheres[0].intersect(ray, occisect)
+        @spheres[1].intersect(ray, occisect)
+        @spheres[2].intersect(ray, occisect)
+        @plane.intersect(ray, occisect)
+        if occisect.hit then
+          occlusion = occlusion + 1.0
+        else
+          0.0
+        end
+      end
+    end
+
+    occlusion = (ntheta.to_f * nphi.to_f - occlusion) / (ntheta.to_f * nphi.to_f)
+
+    Vec.new(occlusion, occlusion, occlusion)
+  end
+
+  def render(w, h, nsubsamples)
+    cnt = 0
+    nsf = nsubsamples.to_f
+    h.times do |y|
+      w.times do |x|
+        rad = Vec.new(0.0, 0.0, 0.0)
+
+        # Subsampling
+        nsubsamples.times do |v|
+          nsubsamples.times do |u|
+
+            cnt = cnt + 1
+            wf = w.to_f
+            hf = h.to_f
+            xf = x.to_f
+            yf = y.to_f
+            uf = u.to_f
+            vf = v.to_f
+
+            px = (xf + (uf / nsf) - (wf / 2.0)) / (wf / 2.0)
+            py = -(yf + (vf / nsf) - (hf / 2.0)) / (hf / 2.0)
+
+            eye = Vec.new(px, py, -1.0).vnormalize
+
+            ray = Ray.new(Vec.new(0.0, 0.0, 0.0), eye)
+
+            isect = Isect.new
+            @spheres[0].intersect(ray, isect)
+            @spheres[1].intersect(ray, isect)
+            @spheres[2].intersect(ray, isect)
+            @plane.intersect(ray, isect)
+            if isect.hit then
+              col = ambient_occlusion(isect)
+              rad.x = rad.x + col.x
+              rad.y = rad.y + col.y
+              rad.z = rad.z + col.z
+            end
+          end
+        end
+
+        r = rad.x / (nsf * nsf)
+        g = rad.y / (nsf * nsf)
+        b = rad.z / (nsf * nsf)
+        printf("%c", clamp(r))
+        printf("%c", clamp(g))
+        printf("%c", clamp(b))
+      end
+      nil
+    end
+
+    nil
+  end
+end
+
+alias printf_orig printf
+def printf *args
+end
+
+# File.open("ao.ppm", "w") do |fp|
+  printf("P6\n")
+  printf("%d %d\n", IMAGE_WIDTH, IMAGE_HEIGHT)
+  printf("255\n", IMAGE_WIDTH, IMAGE_HEIGHT)
+  Scene.new.render(IMAGE_WIDTH, IMAGE_HEIGHT, NSUBSAMPLES)
+# end
+
+undef printf
+alias printf printf_orig
diff --git a/benchmark/bm_app_erb.rb b/benchmark/bm_app_erb.rb
new file mode 100644
index 0000000000..77c66a7949
--- /dev/null
+++ b/benchmark/bm_app_erb.rb
@@ -0,0 +1,26 @@
+#
+# Create many HTML strings with ERB.
+#
+
+require 'erb'
+
+data = DATA.read
+max = 15_000
+title = "hello world!"
+content = "hello world!\n" * 10
+
+max.times{
+  ERB.new(data).result(binding)
+}
+
+__END__
+
+<html>
+  <head> <%= title %> </head>
+  <body>
+    <h1> <%= title %> </h1>
+    <p>
+      <%= content %>
+    </p>
+  </body>
+</html>
diff --git a/benchmark/bm_app_factorial.rb b/benchmark/bm_app_factorial.rb
new file mode 100644
index 0000000000..45f471dfdb
--- /dev/null
+++ b/benchmark/bm_app_factorial.rb
@@ -0,0 +1,11 @@
+def fact(n)
+  if(n > 1)
+    n * fact(n-1)
+  else
+    1
+  end
+end
+
+100.times {
+  fact(5000)
+}
diff --git a/benchmark/bm_app_fib.rb b/benchmark/bm_app_fib.rb
new file mode 100644
index 0000000000..34a7b2e725
--- /dev/null
+++ b/benchmark/bm_app_fib.rb
@@ -0,0 +1,10 @@
+def fib n
+  if n < 3
+    1
+  else
+    fib(n-1) + fib(n-2)
+  end
+end
+
+fib(34)
+
diff --git a/benchmark/bm_app_lc_fizzbuzz.rb b/benchmark/bm_app_lc_fizzbuzz.rb
new file mode 100644
index 0000000000..f09574bbeb
--- /dev/null
+++ b/benchmark/bm_app_lc_fizzbuzz.rb
@@ -0,0 +1,52 @@
+#
+# FizzBuzz program using only lambda calculus
+#
+# This program is quoted from
+#   "Understanding Computation" by Tom Stuart
+#   http://computationbook.com/
+#
+# You can understand why this program works fine by reading this book.
+#
+
+solution = -> k { -> f { -> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> l { -> x { -> g { -> b { b }[-> p { p[-> x { -> y { x } }] }[l]][x][-> y { g[f[-> l { -> p { p[-> x { -> y { y } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][x][g]][-> l { -> p { p[-> x { -> y { x } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][y] }] } } } }][k][-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> l { -> x { -> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[l][f[x]] } }] } }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[m][n]][-> x { -> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[f[-> n { -> p { -> x { p[n[p][x]] } } }[m]][n]][m][x] }][-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]] } } }][-> p { -> x { p[x] } }][-> p { -> x { p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[x]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]] } }]][-> n { -> b { b }[-> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> p { -> x { p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[x]]]]]]]]]]]]]]] } }]]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]][-> b { b }[-> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> p { -> x { p[p[p[x]]] } }]]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]][-> b { b }[-> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> n { -> l { -> x { -> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> l { -> x { -> g { -> b { b }[-> p { p[-> x { -> y { x } }] }[l]][x][-> y { g[f[-> l { -> p { p[-> x { -> y { y } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][x][g]][-> l { -> p { p[-> x { -> y { x } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][y] }] } } } }][l][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][x]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }] } }[-> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]][-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> x { f[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { -> n { -> p { -> x { p[n[p][x]] } } }[f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n]][x] }][-> p { -> x { x } }] } } }][n][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][x] }]][-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]] } }][n]]]] }]
+
+FIRST     = -> l { LEFT[RIGHT[l]] }
+IF        = -> b { b }
+LEFT      = -> p { p[-> x { -> y { x } } ] }
+RIGHT     = -> p { p[-> x { -> y { y } } ] }
+IS_EMPTY  = LEFT
+REST      = -> l { RIGHT[RIGHT[l]] }
+
+def to_integer(proc)
+  proc[-> n { n + 1 }][0]
+end
+
+def to_boolean(proc)
+  IF[proc][true][false]
+end
+
+def to_array(proc)
+  array = []
+
+  until to_boolean(IS_EMPTY[proc])
+    array.push(FIRST[proc])
+    proc = REST[proc]
+  end
+
+  array
+end
+
+def to_char(c)
+  '0123456789BFiuz'.slice(to_integer(c))
+end
+
+def to_string(s)
+  to_array(s).map { |c| to_char(c) }.join
+end
+
+answer = to_array(solution).map do |p|
+  to_string(p)
+end
+
+answer_ary = answer.to_a
+# puts answer_ary
diff --git a/benchmark/bm_app_mandelbrot.rb b/benchmark/bm_app_mandelbrot.rb
new file mode 100644
index 0000000000..801b75e8e2
--- /dev/null
+++ b/benchmark/bm_app_mandelbrot.rb
@@ -0,0 +1,23 @@
+require 'complex'
+
+def mandelbrot? z
+  i = 0
+  while i<100
+    i += 1
+    z = z * z
+    return false if z.abs > 2
+  end
+  true
+end
+
+ary = []
+
+(0..1000).each{|dx|
+  (0..1000).each{|dy|
+    x = dx / 50.0
+    y = dy / 50.0
+    c = Complex(x, y)
+    ary << c if mandelbrot?(c)
+  }
+}
+
diff --git a/benchmark/bm_app_pentomino.rb b/benchmark/bm_app_pentomino.rb
new file mode 100644
index 0000000000..59c63f358e
--- /dev/null
+++ b/benchmark/bm_app_pentomino.rb
@@ -0,0 +1,259 @@
+#!/usr/local/bin/ruby
+# This program is contributed by Shin Nishiyama
+
+
+# modified by K.Sasada
+
+NP = 5
+ROW = 8 + NP
+COL = 8
+
+$p = []
+$b = []
+$no = 0
+
+def piece(n, a, nb)
+  nb.each{|x|
+    a[n] = x
+    if n == NP-1
+      $p << [a.sort]
+    else
+      nbc=nb.dup
+      [-ROW, -1, 1, ROW].each{|d|
+        if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
+          nbc << x+d
+        end
+      }
+      nbc.delete x
+      piece(n+1,a[0..n],nbc)
+    end
+  }
+end
+
+def kikaku(a)
+  a.collect {|x| x - a[0]}
+end
+def ud(a)
+  kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
+end
+def rl(a)
+  kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
+end
+def xy(a)
+  kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
+end
+
+def mkpieces
+  piece(0,[],[0])
+  $p.each do |a|
+    a0 = a[0]
+    a[1] = ud(a0)
+    a[2] = rl(a0)
+    a[3] = ud(rl(a0))
+    a[4] = xy(a0)
+    a[5] = ud(xy(a0))
+    a[6] = rl(xy(a0))
+    a[7] = ud(rl(xy(a0)))
+    a.sort!
+    a.uniq!
+  end
+  $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
+end
+
+def mkboard
+  (0...ROW*COL).each{|i|
+    if i % ROW >= ROW-NP
+      $b[i] = -2
+    else
+      $b[i] = -1
+    end
+    $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
+  }
+end
+
+def pboard
+  return # skip print
+  print "No. #$no\n"
+  (0...COL).each{|i|
+    print "|"
+    (0...ROW-NP).each{|j|
+      x = $b[i*ROW+j]
+      if x < 0
+        print "..|"
+      else
+        printf "%2d|",x+1
+      end
+    }
+    print "\n"
+  }
+  print "\n"
+end
+
+$pnum=[]
+def setpiece(a,pos)
+  if a.length == $p.length then
+    $no += 1
+    pboard
+    return
+  end
+  while $b[pos] != -1
+    pos += 1
+  end
+  ($pnum - a).each do |i|
+    $p[i].each do |x|
+      f = 0
+      x.each{|s|
+        if $b[pos+s] != -1
+          f=1
+          break
+        end
+      }
+      if f == 0 then
+        x.each{|s|
+          $b[pos+s] = i
+        }
+        a << i
+        setpiece(a.dup, pos)
+        a.pop
+        x.each{|s|
+          $b[pos+s] = -1
+        }
+      end
+    end
+  end
+end
+
+mkpieces
+mkboard
+$p[4] = [$p[4][0]]
+$pnum = (0...$p.length).to_a
+setpiece([],0)
+
+
+__END__
+
+# original
+
+NP = 5
+ROW = 8 + NP
+COL = 8
+
+$p = []
+$b = []
+$no = 0
+
+def piece(n,a,nb)
+  for x in nb
+    a[n] = x
+    if n == NP-1
+      $p << [a.sort]
+    else
+      nbc=nb.dup
+      for d in [-ROW, -1, 1, ROW]
+        if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
+          nbc << x+d
+        end
+      end
+      nbc.delete x
+      piece(n+1,a[0..n],nbc)
+    end
+  end
+end
+
+def kikaku(a)
+  a.collect {|x| x - a[0]}
+end
+def ud(a)
+  kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
+end
+def rl(a)
+  kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
+end
+def xy(a)
+  kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
+end
+
+def mkpieces
+  piece(0,[],[0])
+  $p.each do |a|
+    a0 = a[0]
+    a[1] = ud(a0)
+    a[2] = rl(a0)
+    a[3] = ud(rl(a0))
+    a[4] = xy(a0)
+    a[5] = ud(xy(a0))
+    a[6] = rl(xy(a0))
+    a[7] = ud(rl(xy(a0)))
+    a.sort!
+    a.uniq!
+  end
+  $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
+end
+
+def mkboard
+  for i in 0...ROW*COL
+    if i % ROW >= ROW-NP
+      $b[i] = -2
+    else
+      $b[i] = -1
+    end
+    $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
+  end
+end
+
+def pboard
+  print "No. #$no\n"
+  for i in 0...COL
+    print "|"
+    for j in 0...ROW-NP
+      x = $b[i*ROW+j]
+      if x < 0
+        print "..|"
+      else
+        printf "%2d|",x+1
+      end
+    end
+    print "\n"
+  end
+  print "\n"
+end
+
+$pnum=[]
+def setpiece(a,pos)
+  if a.length == $p.length then
+    $no += 1
+    pboard
+    return
+  end
+  while $b[pos] != -1
+    pos += 1
+  end
+  ($pnum - a).each do |i|
+    $p[i].each do |x|
+      f = 0
+      for s in x do
+        if $b[pos+s] != -1
+          f=1
+          break
+        end
+      end
+      if f == 0 then
+        for s in x do
+          $b[pos+s] = i
+        end
+        a << i
+        setpiece(a.dup, pos)
+        a.pop
+        for s in x do
+          $b[pos+s] = -1
+        end
+      end
+    end
+  end
+end
+
+mkpieces
+mkboard
+$p[4] = [$p[4][0]]
+$pnum = (0...$p.length).to_a
+setpiece([],0)
diff --git a/benchmark/bm_app_raise.rb b/benchmark/bm_app_raise.rb
new file mode 100644
index 0000000000..5db8f95d50
--- /dev/null
+++ b/benchmark/bm_app_raise.rb
@@ -0,0 +1,8 @@
+i = 0
+while i<300000
+  i += 1
+  begin
+    raise
+  rescue
+  end
+end
diff --git a/benchmark/bm_app_strconcat.rb b/benchmark/bm_app_strconcat.rb
new file mode 100644
index 0000000000..7eed7c1aed
--- /dev/null
+++ b/benchmark/bm_app_strconcat.rb
@@ -0,0 +1,5 @@
+i = 0
+while i<2_000_000
+  "#{1+1} #{1+1} #{1+1}"
+  i += 1
+end
diff --git a/benchmark/bm_app_tak.rb b/benchmark/bm_app_tak.rb
new file mode 100644
index 0000000000..efe5380f4e
--- /dev/null
+++ b/benchmark/bm_app_tak.rb
@@ -0,0 +1,13 @@
+
+def tak x, y, z
+  unless y < x
+    z
+  else
+    tak( tak(x-1, y, z),
+         tak(y-1, z, x),
+         tak(z-1, x, y))
+  end
+end
+
+tak(18, 9, 0)
+
diff --git a/benchmark/bm_app_tarai.rb b/benchmark/bm_app_tarai.rb
new file mode 100644
index 0000000000..4c146f5ccf
--- /dev/null
+++ b/benchmark/bm_app_tarai.rb
@@ -0,0 +1,10 @@
+def tarai( x, y, z )
+  if x <= y
+  then y
+  else tarai(tarai(x-1, y, z),
+             tarai(y-1, z, x),
+             tarai(z-1, x, y))
+  end
+end
+
+tarai(12, 6, 0)
diff --git a/benchmark/bm_app_uri.rb b/benchmark/bm_app_uri.rb
new file mode 100644
index 0000000000..586edfd5dc
--- /dev/null
+++ b/benchmark/bm_app_uri.rb
@@ -0,0 +1,8 @@
+require 'uri'
+
+100_000.times{
+  uri = URI.parse('http://www.ruby-lang.org')
+  uri.scheme
+  uri.host
+  uri.port
+}
diff --git a/benchmark/bm_array_shift.rb b/benchmark/bm_array_shift.rb
new file mode 100644
index 0000000000..798bb9e3f4
--- /dev/null
+++ b/benchmark/bm_array_shift.rb
@@ -0,0 +1,14 @@
+require 'benchmark'
+
+Benchmark.bm do |x|
+  [10_000,1_000_000,100_000_000].each do |n|
+    ary = Array.new(n,0)
+    GC.start
+    x.report("#{n}:shift"){ ary.shift }
+    (0..4).each do |i|
+      ary = Array.new(n,0)
+      GC.start
+      x.report("#{n}:shift(#{i})"){ ary.shift(i) }
+    end
+  end
+end
diff --git a/benchmark/bm_hash_aref_dsym.rb b/benchmark/bm_hash_aref_dsym.rb
new file mode 100644
index 0000000000..af4f8c36d4
--- /dev/null
+++ b/benchmark/bm_hash_aref_dsym.rb
@@ -0,0 +1,4 @@
+h = {}
+syms = ('a'..'z').map { |s| s.to_sym }
+syms.each { |s| h[s] = 1 }
+200_000.times { syms.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_aref_dsym_long.rb b/benchmark/bm_hash_aref_dsym_long.rb
new file mode 100644
index 0000000000..9d7759379e
--- /dev/null
+++ b/benchmark/bm_hash_aref_dsym_long.rb
@@ -0,0 +1,21 @@
+# [ruby-core:70129] [Bug #11396]
+collection_size = 200000
+sample_size = 10000
+
+values = (1..collection_size).to_a.map do |x|
+  "THIS IS A LONGER STRING THAT IS ALSO UNIQUE #{x}"
+end
+
+symbol_hash = {}
+
+values.each do |x|
+  symbol_hash[x.to_sym] = 1
+end
+
+# use the same samples each time to minimize deviations
+rng = Random.new(0)
+symbol_sample_array = values.sample(sample_size, random: rng).map(&:to_sym)
+
+3000.times do
+  symbol_sample_array.each { |x| symbol_hash[x] }
+end
diff --git a/benchmark/bm_hash_aref_fix.rb b/benchmark/bm_hash_aref_fix.rb
new file mode 100644
index 0000000000..1346890582
--- /dev/null
+++ b/benchmark/bm_hash_aref_fix.rb
@@ -0,0 +1,4 @@
+h = {}
+nums = (1..26).to_a
+nums.each { |i| h[i] = i }
+200_000.times { nums.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_aref_flo.rb b/benchmark/bm_hash_aref_flo.rb
new file mode 100644
index 0000000000..2217274c82
--- /dev/null
+++ b/benchmark/bm_hash_aref_flo.rb
@@ -0,0 +1,4 @@
+h = {}
+strs = [*1..10000].map! {|i| i.fdiv(10)}
+strs.each { |s| h[s] = s }
+50.times { strs.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_aref_miss.rb b/benchmark/bm_hash_aref_miss.rb
new file mode 100644
index 0000000000..b0913dd4bb
--- /dev/null
+++ b/benchmark/bm_hash_aref_miss.rb
@@ -0,0 +1,5 @@
+h = {}
+strs = ('a'..'z').to_a.map!(&:freeze)
+strs.each { |s| h[s] = s }
+strs = ('A'..'Z').to_a
+200_000.times { strs.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_aref_str.rb b/benchmark/bm_hash_aref_str.rb
new file mode 100644
index 0000000000..19439b061b
--- /dev/null
+++ b/benchmark/bm_hash_aref_str.rb
@@ -0,0 +1,4 @@
+h = {}
+strs = ('a'..'z').to_a.map!(&:freeze)
+strs.each { |s| h[s] = s }
+200_000.times { strs.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_aref_sym.rb b/benchmark/bm_hash_aref_sym.rb
new file mode 100644
index 0000000000..f75d163fe6
--- /dev/null
+++ b/benchmark/bm_hash_aref_sym.rb
@@ -0,0 +1,9 @@
+h = {}
+syms = ('a'..'z').to_a
+begin
+  syms = eval("%i[#{syms.join(' ')}]")
+rescue SyntaxError # <= 1.9.3
+  syms.map!(&:to_sym)
+end
+syms.each { |s| h[s] = s }
+200_000.times { syms.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_aref_sym_long.rb b/benchmark/bm_hash_aref_sym_long.rb
new file mode 100644
index 0000000000..9dab8df7be
--- /dev/null
+++ b/benchmark/bm_hash_aref_sym_long.rb
@@ -0,0 +1,13 @@
+h = {}
+syms = %w[puts warn syswrite write stat bacon lettuce tomato
+some symbols in this array may already be interned  others should not be
+hash browns make good breakfast but not cooked using prime numbers
+shift for division entries delete_if keys exist?
+]
+begin
+  syms = eval("%i[#{syms.join(' ')}]")
+rescue SyntaxError # <= 1.9.3
+  syms.map!(&:to_sym)
+end
+syms.each { |s| h[s] = s }
+200_000.times { syms.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_flatten.rb b/benchmark/bm_hash_flatten.rb
new file mode 100644
index 0000000000..e944aae9f2
--- /dev/null
+++ b/benchmark/bm_hash_flatten.rb
@@ -0,0 +1,9 @@
+h = {}
+
+10000.times do |i|
+  h[i] = nil
+end
+
+1000.times do
+  h.flatten
+end
diff --git a/benchmark/bm_hash_ident_flo.rb b/benchmark/bm_hash_ident_flo.rb
new file mode 100644
index 0000000000..0c7edfed3e
--- /dev/null
+++ b/benchmark/bm_hash_ident_flo.rb
@@ -0,0 +1,4 @@
+h = {}.compare_by_identity
+strs = (1..10000).to_a.map!(&:to_f)
+strs.each { |s| h[s] = s }
+50.times { strs.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_ident_num.rb b/benchmark/bm_hash_ident_num.rb
new file mode 100644
index 0000000000..b226736c6f
--- /dev/null
+++ b/benchmark/bm_hash_ident_num.rb
@@ -0,0 +1,4 @@
+h = {}.compare_by_identity
+nums = (1..26).to_a
+nums.each { |n| h[n] = n }
+200_000.times { nums.each { |n| h[n] } }
diff --git a/benchmark/bm_hash_ident_obj.rb b/benchmark/bm_hash_ident_obj.rb
new file mode 100644
index 0000000000..4b3b58edec
--- /dev/null
+++ b/benchmark/bm_hash_ident_obj.rb
@@ -0,0 +1,4 @@
+h = {}.compare_by_identity
+objs = 26.times.map { Object.new }
+objs.each { |o| h[o] = o }
+200_000.times { objs.each { |o| h[o] } }
diff --git a/benchmark/bm_hash_ident_str.rb b/benchmark/bm_hash_ident_str.rb
new file mode 100644
index 0000000000..8582b38e31
--- /dev/null
+++ b/benchmark/bm_hash_ident_str.rb
@@ -0,0 +1,4 @@
+h = {}.compare_by_identity
+strs = ('a'..'z').to_a
+strs.each { |s| h[s] = s }
+200_000.times { strs.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_ident_sym.rb b/benchmark/bm_hash_ident_sym.rb
new file mode 100644
index 0000000000..4c81e3d28e
--- /dev/null
+++ b/benchmark/bm_hash_ident_sym.rb
@@ -0,0 +1,4 @@
+h = {}.compare_by_identity
+syms = ('a'..'z').to_a.map(&:to_sym)
+syms.each { |s| h[s] = s }
+200_000.times { syms.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_keys.rb b/benchmark/bm_hash_keys.rb
new file mode 100644
index 0000000000..6863cd01f9
--- /dev/null
+++ b/benchmark/bm_hash_keys.rb
@@ -0,0 +1,9 @@
+h = {}
+
+10000.times do |i|
+  h[i] = nil
+end
+
+5000.times do
+  h.keys
+end
diff --git a/benchmark/bm_hash_shift.rb b/benchmark/bm_hash_shift.rb
new file mode 100644
index 0000000000..a645671a5b
--- /dev/null
+++ b/benchmark/bm_hash_shift.rb
@@ -0,0 +1,10 @@
+h = {}
+
+10000.times do |i|
+  h[i] = nil
+end
+
+50000.times do
+  k, v = h.shift
+  h[k] = v
+end
diff --git a/benchmark/bm_hash_shift_u16.rb b/benchmark/bm_hash_shift_u16.rb
new file mode 100644
index 0000000000..ec800d0342
--- /dev/null
+++ b/benchmark/bm_hash_shift_u16.rb
@@ -0,0 +1,10 @@
+h = {}
+
+(16384..65536).each do |i|
+  h[i] = nil
+end
+
+300000.times do
+  k, v = h.shift
+  h[k] = v
+end
diff --git a/benchmark/bm_hash_shift_u24.rb b/benchmark/bm_hash_shift_u24.rb
new file mode 100644
index 0000000000..de4e0fa696
--- /dev/null
+++ b/benchmark/bm_hash_shift_u24.rb
@@ -0,0 +1,10 @@
+h = {}
+
+(0xff4000..0xffffff).each do |i|
+  h[i] = nil
+end
+
+300000.times do
+  k, v = h.shift
+  h[k] = v
+end
diff --git a/benchmark/bm_hash_shift_u32.rb b/benchmark/bm_hash_shift_u32.rb
new file mode 100644
index 0000000000..656aa55583
--- /dev/null
+++ b/benchmark/bm_hash_shift_u32.rb
@@ -0,0 +1,10 @@
+h = {}
+
+(0xffff4000..0xffffffff).each do |i|
+  h[i] = nil
+end
+
+300000.times do
+  k, v = h.shift
+  h[k] = v
+end
diff --git a/benchmark/bm_hash_to_proc.rb b/benchmark/bm_hash_to_proc.rb
new file mode 100644
index 0000000000..2b675bf509
--- /dev/null
+++ b/benchmark/bm_hash_to_proc.rb
@@ -0,0 +1,9 @@
+h = {}
+
+10000.times do |i|
+  h[i] = nil
+end
+
+5000.times do |i|
+  [i].map(&h)
+end
diff --git a/benchmark/bm_hash_values.rb b/benchmark/bm_hash_values.rb
new file mode 100644
index 0000000000..069441302f
--- /dev/null
+++ b/benchmark/bm_hash_values.rb
@@ -0,0 +1,9 @@
+h = {}
+
+10000.times do |i|
+  h[i] = nil
+end
+
+5000.times do
+  h.values
+end
diff --git a/benchmark/bm_io_file_create.rb b/benchmark/bm_io_file_create.rb
new file mode 100644
index 0000000000..2f205c1333
--- /dev/null
+++ b/benchmark/bm_io_file_create.rb
@@ -0,0 +1,13 @@
+#
+# Create files
+#
+
+max = 200_000
+file = './tmpfile_of_bm_io_file_create'
+
+max.times{
+  f = open(file, 'w')
+  f.close#(true)
+}
+File.unlink(file)
+
diff --git a/benchmark/bm_io_file_read.rb b/benchmark/bm_io_file_read.rb
new file mode 100644
index 0000000000..b9e796ed30
--- /dev/null
+++ b/benchmark/bm_io_file_read.rb
@@ -0,0 +1,15 @@
+#
+# Seek and Read file.
+#
+
+require 'tempfile'
+
+max = 200_000
+str = "Hello world!  " * 1000
+f = Tempfile.new('yarv-benchmark')
+f.write str
+
+max.times{
+  f.seek 0
+  f.read
+}
diff --git a/benchmark/bm_io_file_write.rb b/benchmark/bm_io_file_write.rb
new file mode 100644
index 0000000000..aa1be0e5fe
--- /dev/null
+++ b/benchmark/bm_io_file_write.rb
@@ -0,0 +1,14 @@
+#
+# Seek and Write file.
+#
+
+require 'tempfile'
+
+max = 200_000
+str = "Hello world!  " * 1000
+f = Tempfile.new('yarv-benchmark')
+
+max.times{
+  f.seek 0
+  f.write str
+}
diff --git a/benchmark/bm_io_nonblock_noex.rb b/benchmark/bm_io_nonblock_noex.rb
new file mode 100644
index 0000000000..da9357fdc6
--- /dev/null
+++ b/benchmark/bm_io_nonblock_noex.rb
@@ -0,0 +1,22 @@
+nr = 1_000_000
+i = 0
+msg = '.'
+buf = '.'
+noex = { exception: false }
+begin
+  r, w = IO.pipe
+  while i < nr
+    i += 1
+    w.write_nonblock(msg, noex)
+    r.read_nonblock(1, buf, noex)
+  end
+rescue ArgumentError # old Rubies
+  while i < nr
+    i += 1
+    w.write_nonblock(msg)
+    r.read_nonblock(1, buf)
+  end
+ensure
+  r.close
+  w.close
+end
diff --git a/benchmark/bm_io_nonblock_noex2.rb b/benchmark/bm_io_nonblock_noex2.rb
new file mode 100644
index 0000000000..56819d049b
--- /dev/null
+++ b/benchmark/bm_io_nonblock_noex2.rb
@@ -0,0 +1,21 @@
+nr = 1_000_000
+i = 0
+msg = '.'
+buf = '.'
+begin
+  r, w = IO.pipe
+  while i < nr
+    i += 1
+    w.write_nonblock(msg, exception: false)
+    r.read_nonblock(1, buf, exception: false)
+  end
+rescue ArgumentError # old Rubies
+  while i < nr
+    i += 1
+    w.write_nonblock(msg)
+    r.read_nonblock(1, buf)
+  end
+ensure
+  r.close
+  w.close
+end
diff --git a/benchmark/bm_io_select.rb b/benchmark/bm_io_select.rb
new file mode 100644
index 0000000000..19248daeb1
--- /dev/null
+++ b/benchmark/bm_io_select.rb
@@ -0,0 +1,9 @@
+# IO.select performance
+
+w = [ IO.pipe[1] ];
+
+nr = 1000000
+nr.times {
+  IO.select nil, w
+}
+
diff --git a/benchmark/bm_io_select2.rb b/benchmark/bm_io_select2.rb
new file mode 100644
index 0000000000..10e37d71b2
--- /dev/null
+++ b/benchmark/bm_io_select2.rb
@@ -0,0 +1,22 @@
+# IO.select performance. worst case of single fd.
+
+ios = []
+nr = 1000000
+if defined?(Process::RLIMIT_NOFILE)
+  max = Process.getrlimit(Process::RLIMIT_NOFILE)[0]
+else
+  max = 64
+end
+puts "max fd: #{max} (results not apparent with <= 1024 max fd)"
+
+((max / 2) - 10).times do
+  ios.concat IO.pipe
+end
+
+last = [ ios[-1] ]
+puts "last IO: #{last[0].inspect}"
+
+nr.times do
+  IO.select nil, last
+end
+
diff --git a/benchmark/bm_io_select3.rb b/benchmark/bm_io_select3.rb
new file mode 100644
index 0000000000..7d0ba1f092
--- /dev/null
+++ b/benchmark/bm_io_select3.rb
@@ -0,0 +1,21 @@
+# IO.select performance. a lot of fd
+
+ios = []
+nr = 100
+if defined?(Process::RLIMIT_NOFILE)
+  max = Process.getrlimit(Process::RLIMIT_NOFILE)[0]
+else
+  max = 64
+end
+puts "max fd: #{max} (results not apparent with <= 1024 max fd)"
+
+(max - 10).times do
+  r, w = IO.pipe
+  r.close
+  ios.push w
+end
+
+nr.times do
+  IO.select nil, ios
+end
+
diff --git a/benchmark/bm_loop_for.rb b/benchmark/bm_loop_for.rb
new file mode 100644
index 0000000000..0fc4cc1511
--- /dev/null
+++ b/benchmark/bm_loop_for.rb
@@ -0,0 +1,3 @@
+for i in 1..30_000_000
+  #
+end
diff --git a/benchmark/bm_loop_generator.rb b/benchmark/bm_loop_generator.rb
new file mode 100644
index 0000000000..d3375c744c
--- /dev/null
+++ b/benchmark/bm_loop_generator.rb
@@ -0,0 +1,14 @@
+max = 600000
+
+if defined? Fiber
+  gen = (1..max).each
+  loop do
+    gen.next
+  end
+else
+  require 'generator'
+  gen = Generator.new((0..max))
+  while gen.next?
+    gen.next
+  end
+end
diff --git a/benchmark/bm_loop_times.rb b/benchmark/bm_loop_times.rb
new file mode 100644
index 0000000000..521f72ad1a
--- /dev/null
+++ b/benchmark/bm_loop_times.rb
@@ -0,0 +1 @@
+30_000_000.times{|e|}
diff --git a/benchmark/bm_loop_whileloop.rb b/benchmark/bm_loop_whileloop.rb
new file mode 100644
index 0000000000..0072822c06
--- /dev/null
+++ b/benchmark/bm_loop_whileloop.rb
@@ -0,0 +1,4 @@
+i = 0
+while i<30_000_000 # benchmark loop 1
+  i += 1
+end
diff --git a/benchmark/bm_loop_whileloop2.rb b/benchmark/bm_loop_whileloop2.rb
new file mode 100644
index 0000000000..47d02dffc4
--- /dev/null
+++ b/benchmark/bm_loop_whileloop2.rb
@@ -0,0 +1,4 @@
+i = 0
+while i< 6_000_000 # benchmark loop 2
+  i += 1
+end
diff --git a/benchmark/bm_marshal_dump_flo.rb b/benchmark/bm_marshal_dump_flo.rb
new file mode 100644
index 0000000000..9b8d0c6afb
--- /dev/null
+++ b/benchmark/bm_marshal_dump_flo.rb
@@ -0,0 +1,2 @@
+bug10761 = 10000.times.map { |x| x.to_f }
+100.times { Marshal.dump(bug10761) }
diff --git a/benchmark/bm_marshal_dump_load_geniv.rb b/benchmark/bm_marshal_dump_load_geniv.rb
new file mode 100644
index 0000000000..8252ad90fa
--- /dev/null
+++ b/benchmark/bm_marshal_dump_load_geniv.rb
@@ -0,0 +1,10 @@
+a = ''
+a.instance_eval do
+  @a = :a
+  @b = :b
+  @c = :c
+end
+100000.times do
+  a = Marshal.load(Marshal.dump(a))
+end
+#p(a.instance_eval { @a == :a && @b == :b && @c == :c })
diff --git a/benchmark/bm_marshal_dump_load_time.rb b/benchmark/bm_marshal_dump_load_time.rb
new file mode 100644
index 0000000000..e29743b791
--- /dev/null
+++ b/benchmark/bm_marshal_dump_load_time.rb
@@ -0,0 +1 @@
+100000.times { Marshal.load(Marshal.dump(Time.now)) }
diff --git a/benchmark/bm_require.rb b/benchmark/bm_require.rb
new file mode 100644
index 0000000000..b8abc88f41
--- /dev/null
+++ b/benchmark/bm_require.rb
@@ -0,0 +1,7 @@
+$:.push File.join(File.dirname(__FILE__), "bm_require.data")
+
+1.upto(10000) do |i|
+  require "c#{i}"
+end
+
+$:.pop
diff --git a/benchmark/bm_require_thread.rb b/benchmark/bm_require_thread.rb
new file mode 100644
index 0000000000..e54db6c6e5
--- /dev/null
+++ b/benchmark/bm_require_thread.rb
@@ -0,0 +1,15 @@
+$:.push File.join(File.dirname(__FILE__), "bm_require.data")
+
+i=0
+t = Thread.new do
+  while true
+    i = i+1 # dummy loop
+  end
+end
+
+1.upto(100) do |i|
+  require "c#{i}"
+end
+
+$:.pop
+t.kill
diff --git a/benchmark/bm_securerandom.rb b/benchmark/bm_securerandom.rb
new file mode 100644
index 0000000000..a082ea6d5b
--- /dev/null
+++ b/benchmark/bm_securerandom.rb
@@ -0,0 +1,5 @@
+require "securerandom"
+
+20_0000.times do
+  SecureRandom.random_number(100)
+end
diff --git a/benchmark/bm_so_ackermann.rb b/benchmark/bm_so_ackermann.rb
new file mode 100644
index 0000000000..7db5be9050
--- /dev/null
+++ b/benchmark/bm_so_ackermann.rb
@@ -0,0 +1,19 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: ackermann-ruby.code,v 1.4 2004/11/13 07:40:41 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+def ack(m, n)
+    if m == 0 then
+        n + 1
+    elsif n == 0 then
+        ack(m - 1, 1)
+    else
+        ack(m - 1, ack(m, n - 1))
+    end
+end
+
+NUM = 9
+ack(3, NUM)
+
+
diff --git a/benchmark/bm_so_array.rb b/benchmark/bm_so_array.rb
new file mode 100644
index 0000000000..2b8fce8f99
--- /dev/null
+++ b/benchmark/bm_so_array.rb
@@ -0,0 +1,23 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: ary-ruby.code,v 1.4 2004/11/13 07:41:27 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# with help from Paul Brannan and Mark Hubbart
+
+n = 9000 # Integer(ARGV.shift || 1)
+
+x = Array.new(n)
+y = Array.new(n, 0)
+
+n.times{|bi|
+  x[bi] = bi + 1
+}
+
+(0 .. 999).each do |e|
+  (n-1).step(0,-1) do |bi|
+    y[bi] += x.at(bi)
+  end
+end
+# puts "#{y.first} #{y.last}"
+
+
diff --git a/benchmark/bm_so_binary_trees.rb b/benchmark/bm_so_binary_trees.rb
new file mode 100644
index 0000000000..b1693e4109
--- /dev/null
+++ b/benchmark/bm_so_binary_trees.rb
@@ -0,0 +1,62 @@
+# The Computer Language Shootout Benchmarks
+# http://shootout.alioth.debian.org
+#
+# contributed by Jesse Millikan
+
+# disable output
+alias puts_orig puts
+def puts str
+  # disable puts
+end
+
+def item_check(tree)
+ if tree[0] == nil
+  tree[1]
+ else
+  tree[1] + item_check(tree[0]) - item_check(tree[2])
+ end
+end
+
+def bottom_up_tree(item, depth)
+ if depth > 0
+  item_item = 2 * item
+  depth -= 1
+  [bottom_up_tree(item_item - 1, depth), item, bottom_up_tree(item_item, depth)]
+ else
+  [nil, item, nil]
+ end
+end
+
+max_depth = 16 # ARGV[0].to_i
+min_depth = 4
+
+max_depth = min_depth + 2 if min_depth + 2 > max_depth
+
+stretch_depth = max_depth + 1
+stretch_tree = bottom_up_tree(0, stretch_depth)
+
+puts "stretch tree of depth #{stretch_depth}\t check: #{item_check(stretch_tree)}"
+stretch_tree = nil
+
+long_lived_tree = bottom_up_tree(0, max_depth)
+
+min_depth.step(max_depth + 1, 2) do |depth|
+ iterations = 2**(max_depth - depth + min_depth)
+
+ check = 0
+
+ for i in 1..iterations
+  temp_tree = bottom_up_tree(i, depth)
+  check += item_check(temp_tree)
+
+  temp_tree = bottom_up_tree(-i, depth)
+  check += item_check(temp_tree)
+ end
+
+ puts "#{iterations * 2}\t trees of depth #{depth}\t check: #{check}"
+end
+
+puts "long lived tree of depth #{max_depth}\t check: #{item_check(long_lived_tree)}"
+
+undef puts
+alias puts puts_orig
diff --git a/benchmark/bm_so_concatenate.rb b/benchmark/bm_so_concatenate.rb
new file mode 100644
index 0000000000..873214de7c
--- /dev/null
+++ b/benchmark/bm_so_concatenate.rb
@@ -0,0 +1,18 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: strcat-ruby.code,v 1.4 2004/11/13 07:43:28 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# based on code from Aristarkh A Zagorodnikov and Dat Nguyen
+
+STUFF = "hello\n"
+i = 0
+while i<10
+  i += 1
+  hello = ''
+  4_000_000.times do |e|
+    hello << STUFF
+  end
+end
+# puts hello.length
+
+
diff --git a/benchmark/bm_so_count_words.rb b/benchmark/bm_so_count_words.rb
new file mode 100644
index 0000000000..65f6337a4a
--- /dev/null
+++ b/benchmark/bm_so_count_words.rb
@@ -0,0 +1,19 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: wc-ruby.code,v 1.4 2004/11/13 07:43:32 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# with help from Paul Brannan
+
+input = open(File.join(File.dirname($0), 'wc.input'), 'rb')
+
+nl = nw = nc = 0
+while true
+  tmp = input.read(4096) or break
+  data = tmp << (input.gets || "")
+  nc += data.length
+  nl += data.count("\n")
+  ((data.strip! || data).tr!("\n", " ") || data).squeeze!
+  nw += data.count(" ") + 1
+end
+# STDERR.puts "#{nl} #{nw} #{nc}"
+
diff --git a/benchmark/bm_so_exception.rb b/benchmark/bm_so_exception.rb
new file mode 100644
index 0000000000..deb003a594
--- /dev/null
+++ b/benchmark/bm_so_exception.rb
@@ -0,0 +1,61 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: except-ruby.code,v 1.4 2004/11/13 07:41:33 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+$HI = 0
+$LO = 0
+NUM = 250000 # Integer(ARGV[0] || 1)
+
+
+class Lo_Exception < Exception
+  def initialize(num)
+    @value = num
+  end
+end
+
+class Hi_Exception < Exception
+  def initialize(num)
+    @value = num
+  end
+end
+
+def some_function(num)
+  begin
+    hi_function(num)
+  rescue
+    print "We shouldn't get here, exception is: #{$!.type}\n"
+  end
+end
+
+def hi_function(num)
+  begin
+    lo_function(num)
+  rescue Hi_Exception
+    $HI = $HI + 1
+  end
+end
+
+def lo_function(num)
+  begin
+    blowup(num)
+  rescue Lo_Exception
+    $LO = $LO + 1
+  end
+end
+
+def blowup(num)
+  if num % 2 == 0
+    raise Lo_Exception.new(num)
+  else
+    raise Hi_Exception.new(num)
+  end
+end
+
+
+i = 1
+max = NUM+1
+while i < max
+  i += 1
+  some_function(i+1)
+end
diff --git a/benchmark/bm_so_fannkuch.rb b/benchmark/bm_so_fannkuch.rb
new file mode 100644
index 0000000000..bac5ecd44c
--- /dev/null
+++ b/benchmark/bm_so_fannkuch.rb
@@ -0,0 +1,45 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+# Contributed by Sokolov Yura
+# Modified by Ryan Williams
+
+def fannkuch(n)
+   maxFlips, m, r, check = 0, n-1, n, 0
+   count = (1..n).to_a
+   perm = (1..n).to_a
+
+   while true
+      if check < 30
+         puts "#{perm}"
+         check += 1
+      end
+
+      while r != 1
+         count[r-1] = r
+         r -= 1
+      end
+
+      if perm[0] != 1 and perm[m] != n
+         perml = perm.clone #.dup
+         flips = 0
+         while (k = perml.first ) != 1
+            perml = perml.slice!(0, k).reverse + perml
+            flips += 1
+         end
+         maxFlips = flips if flips > maxFlips
+      end
+      while true
+         if r==n then return maxFlips end
+         perm.insert r,perm.shift
+         break if (count[r] -= 1) > 0
+         r += 1
+      end
+   end
+end
+
+def puts *args
+end
+
+N = 9 # (ARGV[0] || 1).to_i
+puts "Pfannkuchen(#{N}) = #{fannkuch(N)}"
+
diff --git a/benchmark/bm_so_fasta.rb b/benchmark/bm_so_fasta.rb
new file mode 100644
index 0000000000..3f759ba7ae
--- /dev/null
+++ b/benchmark/bm_so_fasta.rb
@@ -0,0 +1,81 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+# Contributed by Sokolov Yura
+
+$last = 42.0
+def gen_random (max,im=139968,ia=3877,ic=29573)
+    (max * ($last = ($last * ia + ic) % im)) / im
+end
+
+alu =
+   "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
+   "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
+   "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
+   "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
+   "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
+   "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
+   "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
+
+iub = [
+    ["a", 0.27],
+    ["c", 0.12],
+    ["g", 0.12],
+    ["t", 0.27],
+
+    ["B", 0.02],
+    ["D", 0.02],
+    ["H", 0.02],
+    ["K", 0.02],
+    ["M", 0.02],
+    ["N", 0.02],
+    ["R", 0.02],
+    ["S", 0.02],
+    ["V", 0.02],
+    ["W", 0.02],
+    ["Y", 0.02],
+]
+homosapiens = [
+    ["a", 0.3029549426680],
+    ["c", 0.1979883004921],
+    ["g", 0.1975473066391],
+    ["t", 0.3015094502008],
+]
+
+def make_repeat_fasta(id, desc, src, n)
+    puts ">#{id} #{desc}"
+    v = nil
+    width = 60
+    l = src.length
+    s = src * ((n / l) + 1)
+    s.slice!(n, l)
+    puts(s.scan(/.{1,#{width}}/).join("\n"))
+end
+
+def make_random_fasta(id, desc, table, n)
+    puts ">#{id} #{desc}"
+    rand, v = nil,nil
+    width = 60
+    chunk = 1 * width
+    prob = 0.0
+    table.each{|v| v[1]= (prob += v[1])}
+    for i in 1..(n/width)
+        puts((1..width).collect{
+            rand = gen_random(1.0)
+            table.find{|v| v[1]>rand}[0]
+        }.join)
+    end
+    if n%width != 0
+        puts((1..(n%width)).collect{
+            rand = gen_random(1.0)
+            table.find{|v| v[1]>rand}[0]
+        }.join)
+    end
+end
+
+
+n = (ARGV[0] or 250_000).to_i
+
+make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
+make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
+make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
+
diff --git a/benchmark/bm_so_k_nucleotide.rb b/benchmark/bm_so_k_nucleotide.rb
new file mode 100644
index 0000000000..dadab3e79c
--- /dev/null
+++ b/benchmark/bm_so_k_nucleotide.rb
@@ -0,0 +1,48 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org
+#
+# contributed by jose fco. gonzalez
+# modified by Sokolov Yura
+
+seq = String.new
+
+def frecuency( seq,length )
+    n, table = seq.length - length + 1, Hash.new(0)
+    f, i = nil, nil
+    (0 ... length).each do |f|
+        (f ... n).step(length) do |i|
+            table[seq[i,length]] += 1
+        end
+    end
+    [n,table]
+
+end
+
+def sort_by_freq( seq,length )
+    n,table = frecuency( seq,length )
+    a, b, v = nil, nil, nil
+    table.sort{|a,b| b[1] <=> a[1]}.each do |v|
+        puts "%s %.3f" % [v[0].upcase,((v[1]*100).to_f/n)]
+    end
+    puts
+end
+
+def find_seq( seq,s )
+    n,table = frecuency( seq,s.length )
+    puts "#{table[s].to_s}\t#{s.upcase}"
+end
+
+input = open(File.join(File.dirname($0), 'fasta.output.100000'), 'rb')
+
+line = input.gets while line !~ /^>THREE/
+line = input.gets
+
+while (line !~ /^>/) & line do
+    seq << line.chomp
+    line = input.gets
+end
+
+[1,2].each {|i| sort_by_freq( seq,i ) }
+
+%w(ggt ggta ggtatt ggtattttaatt ggtattttaatttatagt).each{|s| find_seq( seq,s) }
+
diff --git a/benchmark/bm_so_lists.rb b/benchmark/bm_so_lists.rb
new file mode 100644
index 0000000000..e8f4a2a5f7
--- /dev/null
+++ b/benchmark/bm_so_lists.rb
@@ -0,0 +1,47 @@
+#from http://www.bagley.org/~doug/shootout/bench/lists/lists.ruby
+
+NUM = 300
+SIZE = 10000
+
+def test_lists()
+  # create a list of integers (Li1) from 1 to SIZE
+  li1 = (1..SIZE).to_a
+  # copy the list to li2 (not by individual items)
+  li2 = li1.dup
+  # remove each individual item from left side of li2 and
+  # append to right side of li3 (preserving order)
+  li3 = Array.new
+  while (not li2.empty?)
+    li3.push(li2.shift)
+  end
+  # li2 must now be empty
+  # remove each individual item from right side of li3 and
+  # append to right side of li2 (reversing list)
+  while (not li3.empty?)
+    li2.push(li3.pop)
+  end
+  # li3 must now be empty
+  # reverse li1 in place
+  li1.reverse!
+  # check that first item is now SIZE
+  if li1[0] != SIZE then
+    p "not SIZE"
+    0
+  else
+    # compare li1 and li2 for equality
+    if li1 != li2 then
+      return(0)
+    else
+      # return the length of the list
+      li1.length
+    end
+  end
+end
+
+i = 0
+while i<NUM
+  i += 1
+  result = test_lists()
+end
+
+result
diff --git a/benchmark/bm_so_mandelbrot.rb b/benchmark/bm_so_mandelbrot.rb
new file mode 100644
index 0000000000..76331c64b8
--- /dev/null
+++ b/benchmark/bm_so_mandelbrot.rb
@@ -0,0 +1,57 @@
+#  The Computer Language Benchmarks Game
+#  http://shootout.alioth.debian.org/
+#
+#  contributed by Karl von Laudermann
+#  modified by Jeremy Echols
+
+size = 600 # ARGV[0].to_i
+
+puts "P4\n#{size} #{size}"
+
+ITER = 49                           # Iterations - 1 for easy for..in looping
+LIMIT_SQUARED = 4.0                 # Presquared limit
+
+byte_acc = 0
+bit_num = 0
+
+count_size = size - 1               # Precomputed size for easy for..in looping
+
+# For..in loops are faster than .upto, .downto, .times, etc.
+for y in 0..count_size
+  for x in 0..count_size
+    zr = 0.0
+    zi = 0.0
+    cr = (2.0*x/size)-1.5
+    ci = (2.0*y/size)-1.0
+    escape = false
+
+    # To make use of the for..in code, we use a dummy variable,
+    # like one would in C
+    for dummy in 0..ITER
+      tr = zr*zr - zi*zi + cr
+      ti = 2*zr*zi + ci
+      zr, zi = tr, ti
+
+      if (zr*zr+zi*zi) > LIMIT_SQUARED
+        escape = true
+        break
+      end
+    end
+
+    byte_acc = (byte_acc << 1) | (escape ? 0b0 : 0b1)
+    bit_num += 1
+
+    # Code is very similar for these cases, but using separate blocks
+    # ensures we skip the shifting when it's unnecessary, which is most cases.
+    if (bit_num == 8)
+      print byte_acc.chr
+      byte_acc = 0
+      bit_num = 0
+    elsif (x == count_size)
+      byte_acc <<= (8 - bit_num)
+      print byte_acc.chr
+      byte_acc = 0
+      bit_num = 0
+    end
+  end
+end
diff --git a/benchmark/bm_so_matrix.rb b/benchmark/bm_so_matrix.rb
new file mode 100644
index 0000000000..e2c5c8e559
--- /dev/null
+++ b/benchmark/bm_so_matrix.rb
@@ -0,0 +1,48 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: matrix-ruby.code,v 1.4 2004/11/13 07:42:14 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+
+n = 60 #Integer(ARGV.shift || 1)
+
+size = 40
+
+def mkmatrix(rows, cols)
+    count = 1
+    mx = Array.new(rows)
+    (0 .. (rows - 1)).each do |bi|
+        row = Array.new(cols, 0)
+        (0 .. (cols - 1)).each do |j|
+            row[j] = count
+            count += 1
+        end
+        mx[bi] = row
+    end
+    mx
+end
+
+def mmult(rows, cols, m1, m2)
+    m3 = Array.new(rows)
+    (0 .. (rows - 1)).each do |bi|
+        row = Array.new(cols, 0)
+        (0 .. (cols - 1)).each do |j|
+            val = 0
+            (0 .. (cols - 1)).each do |k|
+                val += m1.at(bi).at(k) * m2.at(k).at(j)
+            end
+            row[j] = val
+        end
+        m3[bi] = row
+    end
+    m3
+end
+
+m1 = mkmatrix(size, size)
+m2 = mkmatrix(size, size)
+mm = Array.new
+n.times do
+    mm = mmult(size, size, m1, m2)
+end
+# puts "#{mm[0][0]} #{mm[2][3]} #{mm[3][2]} #{mm[4][4]}"
+
+
diff --git a/benchmark/bm_so_meteor_contest.rb b/benchmark/bm_so_meteor_contest.rb
new file mode 100644
index 0000000000..17e9c046a8
--- /dev/null
+++ b/benchmark/bm_so_meteor_contest.rb
@@ -0,0 +1,564 @@
+#!/usr/bin/env ruby
+#
+# The Computer Language Shootout
+#   http://shootout.alioth.debian.org
+#   contributed by Kevin Barnes (Ruby novice)
+
+# PROGRAM:  the main body is at the bottom.
+#   1) read about the problem here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
+#   2) see how I represent a board as a bitmask by reading the blank_board comments
+#   3) read as your mental paths take you
+
+def print *args
+end
+
+# class to represent all information about a particular rotation of a particular piece
+class Rotation
+  # an array (by location) containing a bit mask for how the piece maps at the given location.
+  # if the rotation is invalid at that location the mask will contain false
+  attr_reader :start_masks
+
+  # maps a direction to a relative location.  these differ depending on whether it is an even or
+  # odd row being mapped from
+  @@rotation_even_adder = { :west => -1, :east => 1, :nw => -7, :ne => -6, :sw => 5, :se => 6 }
+  @@rotation_odd_adder = { :west => -1, :east => 1, :nw => -6, :ne => -5, :sw => 6, :se => 7 }
+
+  def initialize( directions )
+    @even_offsets, @odd_offsets = normalize_offsets( get_values( directions ))
+
+    @even_mask = mask_for_offsets( @even_offsets)
+    @odd_mask = mask_for_offsets( @odd_offsets)
+
+    @start_masks = Array.new(60)
+
+    # create the rotational masks by placing the base mask at the location and seeing if
+    # 1) it overlaps the boundaries and 2) it produces a prunable board.  if either of these
+    # is true the piece cannot be placed
+    0.upto(59) do | offset |
+      mask = is_even(offset) ? (@even_mask << offset) : (@odd_mask << offset)
+      if (blank_board & mask == 0 && !prunable(blank_board | mask, 0, true)) then
+        imask = compute_required( mask, offset)
+        @start_masks[offset] = [ mask, imask, imask | mask ]
+      else
+        @start_masks[offset] = false
+      end
+    end
+  end
+
+  def compute_required( mask, offset )
+    board = blank_board
+    0.upto(offset) { | i | board |= 1 << i }
+    board |= mask
+    return 0 if (!prunable(board | mask, offset))
+    board = flood_fill(board,58)
+    count = 0
+    imask = 0
+    0.upto(59) do | i |
+      if (board[i] == 0) then
+        imask |= (1 << i)
+        count += 1
+      end
+    end
+    (count > 0 && count < 5) ? imask : 0
+  end
+
+  def flood_fill( board, location)
+    return board if (board[location] == 1)
+    board |= 1 << location
+    row, col = location.divmod(6)
+    board = flood_fill( board, location - 1) if (col > 0)
+    board = flood_fill( board, location + 1) if (col < 4)
+    if (row % 2 == 0) then
+      board = flood_fill( board, location - 7) if (col > 0 && row > 0)
+      board = flood_fill( board, location - 6) if (row > 0)
+      board = flood_fill( board, location + 6) if (row < 9)
+      board = flood_fill( board, location + 5) if (col > 0 && row < 9)
+    else
+      board = flood_fill( board, location - 5) if (col < 4 && row > 0)
+      board = flood_fill( board, location - 6) if (row > 0)
+      board = flood_fill( board, location + 6) if (row < 9)
+      board = flood_fill( board, location + 7) if (col < 4 && row < 9)
+    end
+    board
+  end
+
+  # given a location, produces a list of relative locations covered by the piece at this rotation
+  def offsets( location)
+    if is_even( location) then
+      @even_offsets.collect { | value | value + location }
+    else
+      @odd_offsets.collect { | value | value + location }
+    end
+  end
+
+  # returns a set of offsets relative to the top-left most piece of the rotation (by even or odd rows)
+  # this is hard to explain. imagine we have this partial board:
+  #   0 0 0 0 0 x        [positions 0-5]
+  #    0 0 1 1 0 x       [positions 6-11]
+  #   0 0 1 0 0 x        [positions 12-17]
+  #    0 1 0 0 0 x       [positions 18-23]
+  #   0 1 0 0 0 x        [positions 24-29]
+  #    0 0 0 0 0 x       [positions 30-35]
+  #       ...
+  # The top-left of the piece is at position 8, the
+  # board would be passed as a set of positions (values array) containing [8,9,14,19,25] not necessarily in that
+  # sorted order.  Since that array starts on an odd row, the offsets for an odd row are: [0,1,6,11,17] obtained
+  # by subtracting 8 from everything.  Now imagine the piece shifted up and to the right so it's on an even row:
+  #   0 0 0 1 1 x        [positions 0-5]
+  #    0 0 1 0 0 x       [positions 6-11]
+  #   0 0 1 0 0 x        [positions 12-17]
+  #    0 1 0 0 0 x       [positions 18-23]
+  #   0 0 0 0 0 x        [positions 24-29]
+  #    0 0 0 0 0 x       [positions 30-35]
+  #       ...
+  # Now the positions are [3,4,8,14,19] which after subtracting the lowest value (3) gives [0,1,5,11,16] thus, the
+  # offsets for this particular piece are (in even, odd order) [0,1,5,11,16],[0,1,6,11,17] which is what
+  # this function would return
+  def normalize_offsets( values)
+    min = values.min
+    even_min = is_even(min)
+    other_min = even_min ? min + 6 : min + 7
+    other_values = values.collect do | value |
+      if is_even(value) then
+        value + 6 - other_min
+      else
+        value + 7 - other_min
+      end
+    end
+    values.collect! { | value | value - min }
+
+    if even_min then
+      [values, other_values]
+    else
+      [other_values, values]
+    end
+  end
+
+  # produce a bitmask representation of an array of offset locations
+  def mask_for_offsets( offsets )
+    mask = 0
+    offsets.each { | value | mask = mask + ( 1 << value ) }
+    mask
+  end
+
+  # finds a "safe" position that a position as described by a list of directions can be placed
+  # without falling off any edge of the board.  the values returned a location to place the first piece
+  # at so it will fit after making the described moves
+  def start_adjust( directions )
+    south = east = 0;
+    directions.each do | direction |
+      east += 1 if ( direction == :sw || direction == :nw || direction == :west )
+      south += 1 if ( direction == :nw || direction == :ne )
+    end
+    south * 6 + east
+  end
+
+  # given a set of directions places the piece (as defined by a set of directions) on the board at
+  # a location that will not take it off the edge
+  def get_values ( directions )
+    start = start_adjust(directions)
+    values = [ start ]
+    directions.each do | direction |
+      if (start % 12 >= 6) then
+        start += @@rotation_odd_adder[direction]
+      else
+        start += @@rotation_even_adder[direction]
+      end
+      values += [ start ]
+    end
+
+    # some moves take you back to an existing location, we'll strip duplicates
+    values.uniq
+  end
+end
+
+# describes a piece and caches information about its rotations to as to be efficient for iteration
+# ATTRIBUTES:
+#   rotations -- all the rotations of the piece
+#   type -- a numeic "name" of the piece
+#   masks -- an array by location of all legal rotational masks (a n inner array) for that location
+#   placed -- the mask that this piece was last placed at (not a location, but the actual mask used)
+class Piece
+  attr_reader :rotations, :type, :masks
+  attr_accessor :placed
+
+  # transform hashes that change one direction into another when you either flip or rotate a set of directions
+  @@flip_converter = { :west => :west, :east => :east, :nw => :sw, :ne => :se, :sw => :nw, :se => :ne }
+  @@rotate_converter = { :west => :nw, :east => :se, :nw => :ne, :ne => :east, :sw => :west, :se => :sw }
+
+  def initialize( directions, type )
+    @type = type
+    @rotations = Array.new();
+    @map = {}
+
+    generate_rotations( directions )
+    directions.collect! { | value | @@flip_converter[value] }
+    generate_rotations( directions )
+
+    # creates the masks AND a map that returns [location, rotation] for any given mask
+    # this is used when a board is found and we want to draw it, otherwise the map is unused
+    @masks = Array.new();
+    0.upto(59) do | i |
+      even = true
+      @masks[i] = @rotations.collect do | rotation |
+        mask = rotation.start_masks[i]
+        @map[mask[0]] = [ i, rotation ] if (mask)
+        mask || nil
+      end
+      @masks[i].compact!
+    end
+  end
+
+  # rotates a set of directions through all six angles and adds a Rotation to the list for each one
+  def generate_rotations( directions )
+    6.times do
+      rotations.push( Rotation.new(directions))
+      directions.collect! { | value | @@rotate_converter[value] }
+    end
+  end
+
+  # given a board string, adds this piece to the board at whatever location/rotation
+  # important: the outbound board string is 5 wide, the normal location notation is six wide (padded)
+  def fill_string( board_string)
+    location, rotation = @map[@placed]
+    rotation.offsets(location).each do | offset |
+      row, col = offset.divmod(6)
+      board_string[ row*5 + col, 1 ] = @type.to_s
+    end
+  end
+end
+
+# a blank bit board having this form:
+#
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    0 0 0 0 0 1
+#     0 0 0 0 0 1
+#    1 1 1 1 1 1
+#
+# where left lest significant bit is the top left and the most significant is the lower right
+# the actual board only consists of the 0 places, the 1 places are blockers to keep things from running
+# off the edges or bottom
+def blank_board
+  0b111111100000100000100000100000100000100000100000100000100000100000
+end
+
+def full_board
+  0b111111111111111111111111111111111111111111111111111111111111111111
+end
+
+# determines if a location (bit position) is in an even row
+def is_even( location)
+  (location % 12) < 6
+end
+
+# support function that create three utility maps:
+#  $converter -- for each row an array that maps a five bit row (via array mapping)
+#                to the a a five bit representation of the bits below it
+#  $bit_count -- maps a five bit row (via array mapping) to the number of 1s in the row
+#  @@new_regions -- maps a five bit row (via array mapping) to an array of "region" arrays
+#                   a region array has three values the first is a mask of bits in the region,
+#                   the second is the count of those bits and the third is identical to the first
+#                   examples:
+#                           0b10010 => [ 0b01100, 2, 0b01100 ], [ 0b00001, 1, 0b00001]
+#                           0b01010 => [ 0b10000, 1, 0b10000 ], [ 0b00100, 1, 0b00100 ], [ 0b00001, 1, 0b00001]
+#                           0b10001 => [ 0b01110, 3, 0b01110 ]
+def create_collector_support
+  odd_map = [0b11, 0b110, 0b1100, 0b11000, 0b10000]
+  even_map = [0b1, 0b11, 0b110, 0b1100, 0b11000]
+
+  all_odds = Array.new(0b100000)
+  all_evens = Array.new(0b100000)
+  bit_counts = Array.new(0b100000)
+  new_regions = Array.new(0b100000)
+  0.upto(0b11111) do | i |
+    bit_count = odd = even = 0
+    0.upto(4) do | bit |
+      if (i[bit] == 1) then
+        bit_count += 1
+        odd |= odd_map[bit]
+        even |= even_map[bit]
+      end
+    end
+    all_odds[i] = odd
+    all_evens[i] = even
+    bit_counts[i] = bit_count
+    new_regions[i] = create_regions( i)
+  end
+
+  $converter = []
+  10.times { | row | $converter.push((row % 2 == 0) ? all_evens : all_odds) }
+  $bit_counts = bit_counts
+  $regions = new_regions.collect { | set | set.collect { | value | [ value, bit_counts[value], value] } }
+end
+
+# determines if a board is punable, meaning that there is no possibility that it
+# can be filled up with pieces.  A board is prunable if there is a grouping of unfilled spaces
+# that are not a multiple of five.  The following board is an example of a prunable board:
+#    0 0 1 0 0
+#     0 1 0 0 0
+#    1 1 0 0 0
+#     0 1 0 0 0
+#    0 0 0 0 0
+#       ...
+#
+# This board is prunable because the top left corner is only 3 bits in area, no piece will ever fit it
+# parameters:
+#   board -- an initial bit board (6 bit padded rows, see blank_board for format)
+#   location -- starting location, everything above and to the left is already full
+#   slotting -- set to true only when testing initial pieces, when filling normally
+#               additional assumptions are possible
+#
+# Algorithm:
+#    The algorithm starts at the top row (as determined by location) and iterates a row at a time
+#    maintainng counts of active open areas (kept in the collector array) each collector contains
+#    three values at the start of an iteration:
+#          0: mask of bits that would be adjacent to the collector in this row
+#          1: the number of bits collected so far
+#          2: a scratch space starting as zero, but used during the computation to represent
+#             the empty bits in the new row that are adjacent (position 0)
+#  The exact procedure is described in-code
+def prunable( board, location, slotting = false)
+  collectors = []
+  # loop across the rows
+  (location / 6).to_i.upto(9) do | row_on |
+    # obtain a set of regions representing the bits of the current row.
+    regions = $regions[(board >> (row_on * 6)) & 0b11111]
+    converter = $converter[row_on]
+
+    # track the number of collectors at the start of the cycle so that
+    # we don't compute against newly created collectors, only existing collectors
+    initial_collector_count = collectors.length
+
+    # loop against the regions.  For each region of the row
+    # we will see if it connects to one or more existing collectors.
+    # if it connects to 1 collector, the bits from the region are added to the
+    # bits of the collector and the mask is placed in collector[2]
+    # If the region overlaps more than one collector then all the collectors
+    # it overlaps with are merged into the first one (the others are set to nil in the array)
+    # if NO collectors are found then the region is copied as a new collector
+    regions.each do | region |
+      collector_found = nil
+      region_mask = region[2]
+      initial_collector_count.times do | collector_num |
+        collector = collectors[collector_num]
+        if (collector) then
+          collector_mask = collector[0]
+          if (collector_mask & region_mask != 0) then
+            if (collector_found) then
+              collector_found[0] |= collector_mask
+              collector_found[1] += collector[1]
+              collector_found[2] |= collector[2]
+              collectors[collector_num] = nil
+            else
+              collector_found = collector
+              collector[1] += region[1]
+              collector[2] |= region_mask
+            end
+          end
+        end
+      end
+      if (collector_found == nil) then
+        collectors.push(Array.new(region))
+      end
+    end
+
+    # check the existing collectors, if any collector overlapped no bits in the region its [2] value will
+    # be zero.  The size of any such reaason is tested if it is not a multiple of five true is returned since
+    # the board is prunable.  if it is a multiple of five it is removed.
+    # Collector that are still active have a new adjacent value [0] set based n the matched bits
+    # and have [2] cleared out for the next cycle.
+    collectors.length.times do | collector_num |
+      collector = collectors[collector_num]
+      if (collector) then
+        if (collector[2] == 0) then
+          return true if (collector[1] % 5 != 0)
+          collectors[collector_num] = nil
+        else
+          # if a collector matches all bits in the row then we can return unprunable early for the
+          # following reasons:
+          #    1) there can be no more unavailable bits bince we fill from the top left downward
+          #    2) all previous regions have been closed or joined so only this region can fail
+          #    3) this region must be good since there can never be only 1 region that is nuot
+          #       a multiple of five
+          # this rule only applies when filling normally, so we ignore the rule if we are "slotting"
+          # in pieces to see what configurations work for them (the only other time this algorithm is used).
+          return false if (collector[2] == 0b11111 && !slotting)
+          collector[0] = converter[collector[2]]
+          collector[2] = 0
+        end
+      end
+    end
+
+    # get rid of all the empty converters for the next round
+    collectors.compact!
+  end
+  return false if (collectors.length <= 1) # 1 collector or less and the region is fine
+  collectors.any? { | collector | (collector[1] % 5) != 0 } # more than 1 and we test them all for bad size
+end
+
+# creates a region given a row mask.  see prunable for what a "region" is
+def create_regions( value )
+  regions = []
+  cur_region = 0
+  5.times do | bit |
+    if (value[bit] == 0) then
+      cur_region |= 1 << bit
+    else
+      if (cur_region != 0 ) then
+        regions.push( cur_region)
+        cur_region = 0;
+      end
+    end
+  end
+  regions.push(cur_region) if (cur_region != 0)
+  regions
+end
+
+# find up to the counted number of solutions (or all solutions) and prints the final result
+def find_all
+  find_top( 1)
+  find_top( 0)
+  print_results
+end
+
+# show the board
+def print_results
+  print "#{@boards_found} solutions found\n\n"
+  print_full_board( @min_board)
+  print "\n"
+  print_full_board( @max_board)
+  print "\n"
+end
+
+# finds solutions.  This special version of the main function is only used for the top level
+# the reason for it is basically to force a particular ordering on how the rotations are tested for
+# the first piece.  It is called twice, first looking for placements of the odd rotations and then
+# looking for placements of the even locations.
+#
+# WHY?
+#   Since any found solution has an inverse we want to maximize finding solutions that are not already found
+#   as an inverse.  The inverse will ALWAYS be 3 one of the piece configurations that is exactly 3 rotations away
+#   (an odd number).  Checking even vs odd then produces a higher probability of finding more pieces earlier
+#   in the cycle.  We still need to keep checking all the permutations, but our probability of finding one will
+#   diminsh over time.  Since we are TOLD how many to search for this lets us exit before checking all pieces
+#   this bennifit is very great when seeking small numbers of solutions and is 0 when looking for more than the
+#   maximum number
+def find_top( rotation_skip)
+  board = blank_board
+  (@pieces.length-1).times do
+    piece = @pieces.shift
+    piece.masks[0].each do | mask, imask, cmask |
+      if ((rotation_skip += 1) % 2 == 0) then
+        piece.placed = mask
+        find( 1, 1, board | mask)
+      end
+    end
+    @pieces.push(piece)
+  end
+  piece = @pieces.shift
+  @pieces.push(piece)
+end
+
+# the normail find routine, iterates through the available pieces, checks all rotations at the current location
+# and adds any boards found.  depth is achieved via recursion.  the overall approach is described
+# here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
+# parameters:
+#  start_location -- where to start looking for place for the next piece at
+#  placed -- number of pieces placed
+#  board -- current state of the board
+#
+# see in-code comments
+def find( start_location, placed, board)
+  # find the next location to place a piece by looking for an empty bit
+  while board[start_location] == 1
+    start_location += 1
+  end
+
+  @pieces.length.times do
+    piece = @pieces.shift
+    piece.masks[start_location].each do | mask, imask, cmask |
+      if ( board & cmask == imask) then
+        piece.placed = mask
+        if (placed == 9) then
+          add_board
+        else
+          find( start_location + 1, placed + 1, board | mask)
+        end
+      end
+    end
+    @pieces.push(piece)
+  end
+end
+
+# print the board
+def print_full_board( board_string)
+  10.times do | row |
+    print " " if (row % 2 == 1)
+    5.times do | col |
+      print "#{board_string[row*5 + col,1]} "
+    end
+    print "\n"
+  end
+end
+
+# when a board is found we "draw it" into a string and then flip that string, adding both to
+# the list (hash) of solutions if they are unique.
+def add_board
+  board_string = "99999999999999999999999999999999999999999999999999"
+  @all_pieces.each {  | piece | piece.fill_string( board_string ) }
+  save( board_string)
+  save( board_string.reverse)
+end
+
+# adds a board string to the list (if new) and updates the current best/worst board
+def save( board_string)
+  if (@all_boards[board_string] == nil) then
+    @min_board = board_string if (board_string < @min_board)
+    @max_board = board_string if (board_string > @max_board)
+    @all_boards.store(board_string,true)
+    @boards_found += 1
+
+    # the exit motif is a time saver.  Ideally the function should return, but those tests
+    # take noticeable time (performance).
+    if (@boards_found == @stop_count) then
+      print_results
+      exit(0)
+    end
+  end
+end
+
+
+##
+## MAIN BODY :)
+##
+create_collector_support
+@pieces = [
+  Piece.new( [ :nw, :ne, :east, :east ], 2),
+  Piece.new( [ :ne, :se, :east, :ne ], 7),
+  Piece.new( [ :ne, :east, :ne, :nw ], 1),
+  Piece.new( [ :east, :sw, :sw, :se ], 6),
+  Piece.new( [ :east, :ne, :se, :ne ], 5),
+  Piece.new( [ :east, :east, :east, :se ], 0),
+  Piece.new( [ :ne, :nw, :se, :east, :se ], 4),
+  Piece.new( [ :se, :se, :se, :west ], 9),
+  Piece.new( [ :se, :se, :east, :se ], 8),
+  Piece.new( [ :east, :east, :sw, :se ], 3)
+  ];
+
+@all_pieces = Array.new( @pieces)
+
+@min_board = "99999999999999999999999999999999999999999999999999"
+@max_board = "00000000000000000000000000000000000000000000000000"
+@stop_count = ARGV[0].to_i || 2089
+@all_boards = {}
+@boards_found = 0
+
+find_all ######## DO IT!!!
+
diff --git a/benchmark/bm_so_nbody.rb b/benchmark/bm_so_nbody.rb
new file mode 100644
index 0000000000..d6c5bb9e61
--- /dev/null
+++ b/benchmark/bm_so_nbody.rb
@@ -0,0 +1,148 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org
+#
+# Optimized for Ruby by Jesse Millikan
+# From version ported by Michael Neumann from the C gcc version,
+# which was written by Christoph Bauer.
+
+SOLAR_MASS = 4 * Math::PI**2
+DAYS_PER_YEAR = 365.24
+
+def _puts *args
+end
+
+class Planet
+ attr_accessor :x, :y, :z, :vx, :vy, :vz, :mass
+
+ def initialize(x, y, z, vx, vy, vz, mass)
+  @x, @y, @z = x, y, z
+  @vx, @vy, @vz = vx * DAYS_PER_YEAR, vy * DAYS_PER_YEAR, vz * DAYS_PER_YEAR
+  @mass = mass * SOLAR_MASS
+ end
+
+ def move_from_i(bodies, nbodies, dt, i)
+  while i < nbodies
+   b2 = bodies[i]
+   dx = @x - b2.x
+   dy = @y - b2.y
+   dz = @z - b2.z
+
+   distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
+   mag = dt / (distance * distance * distance)
+   b_mass_mag, b2_mass_mag = @mass * mag, b2.mass * mag
+
+   @vx -= dx * b2_mass_mag
+   @vy -= dy * b2_mass_mag
+   @vz -= dz * b2_mass_mag
+   b2.vx += dx * b_mass_mag
+   b2.vy += dy * b_mass_mag
+   b2.vz += dz * b_mass_mag
+   i += 1
+  end
+
+  @x += dt * @vx
+  @y += dt * @vy
+  @z += dt * @vz
+ end
+end
+
+def energy(bodies)
+  e = 0.0
+  nbodies = bodies.size
+
+  for i in 0 ... nbodies
+    b = bodies[i]
+    e += 0.5 * b.mass * (b.vx * b.vx + b.vy * b.vy + b.vz * b.vz)
+    for j in (i + 1) ... nbodies
+      b2 = bodies[j]
+      dx = b.x - b2.x
+      dy = b.y - b2.y
+      dz = b.z - b2.z
+      distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
+      e -= (b.mass * b2.mass) / distance
+    end
+  end
+  e
+end
+
+def offset_momentum(bodies)
+  px, py, pz = 0.0, 0.0, 0.0
+
+  for b in bodies
+    m = b.mass
+    px += b.vx * m
+    py += b.vy * m
+    pz += b.vz * m
+  end
+
+  b = bodies[0]
+  b.vx = - px / SOLAR_MASS
+  b.vy = - py / SOLAR_MASS
+  b.vz = - pz / SOLAR_MASS
+end
+
+BODIES = [
+  # sun
+  Planet.new(0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0),
+
+  # jupiter
+  Planet.new(
+    4.84143144246472090e+00,
+    -1.16032004402742839e+00,
+    -1.03622044471123109e-01,
+    1.66007664274403694e-03,
+    7.69901118419740425e-03,
+    -6.90460016972063023e-05,
+    9.54791938424326609e-04),
+
+  # saturn
+  Planet.new(
+    8.34336671824457987e+00,
+    4.12479856412430479e+00,
+    -4.03523417114321381e-01,
+    -2.76742510726862411e-03,
+    4.99852801234917238e-03,
+    2.30417297573763929e-05,
+    2.85885980666130812e-04),
+
+  # uranus
+  Planet.new(
+    1.28943695621391310e+01,
+    -1.51111514016986312e+01,
+    -2.23307578892655734e-01,
+    2.96460137564761618e-03,
+    2.37847173959480950e-03,
+    -2.96589568540237556e-05,
+    4.36624404335156298e-05),
+
+  # neptune
+  Planet.new(
+    1.53796971148509165e+01,
+    -2.59193146099879641e+01,
+    1.79258772950371181e-01,
+    2.68067772490389322e-03,
+    1.62824170038242295e-03,
+    -9.51592254519715870e-05,
+    5.15138902046611451e-05)
+]
+
+init = 200_000 # ARGV[0]
+n = Integer(init)
+
+offset_momentum(BODIES)
+
+puts "%.9f" % energy(BODIES)
+
+nbodies = BODIES.size
+dt = 0.01
+
+n.times do
+  i = 0
+  while i < nbodies
+    b = BODIES[i]
+    b.move_from_i(BODIES, nbodies, dt, i + 1)
+    i += 1
+  end
+end
+
+puts "%.9f" % energy(BODIES)
diff --git a/benchmark/bm_so_nested_loop.rb b/benchmark/bm_so_nested_loop.rb
new file mode 100644
index 0000000000..a0513f8c47
--- /dev/null
+++ b/benchmark/bm_so_nested_loop.rb
@@ -0,0 +1,24 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: nestedloop-ruby.code,v 1.4 2004/11/13 07:42:22 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# from Avi Bryant
+
+n = 16 # Integer(ARGV.shift || 1)
+x = 0
+n.times do
+    n.times do
+        n.times do
+            n.times do
+                n.times do
+                    n.times do
+                        x += 1
+                    end
+                end
+            end
+        end
+    end
+end
+# puts x
+
+
diff --git a/benchmark/bm_so_nsieve.rb b/benchmark/bm_so_nsieve.rb
new file mode 100644
index 0000000000..a65cc78233
--- /dev/null
+++ b/benchmark/bm_so_nsieve.rb
@@ -0,0 +1,35 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+#
+# contributed by Glenn Parker, March 2005
+# modified by Evan Phoenix, Sept 2006
+
+def sieve(m)
+  flags = Flags.dup[0,m]
+  count = 0
+  pmax = m - 1
+  p = 2
+  while p <= pmax
+    unless flags[p].zero?
+      count += 1
+      mult = p
+      while mult <= pmax
+        flags[mult] = 0
+        mult += p
+      end
+    end
+    p += 1
+  end
+  count
+end
+
+n = 9 # (ARGV[0] || 2).to_i
+Flags = ("\x1" * ( 2 ** n * 10_000)).unpack("c*")
+
+n.downto(n-2) do |exponent|
+  break if exponent < 0
+  m = (1 << exponent) * 10_000
+  # m = (2 ** exponent) * 10_000
+  count = sieve(m)
+  printf "Primes up to %8d %8d\n", m, count
+end
diff --git a/benchmark/bm_so_nsieve_bits.rb b/benchmark/bm_so_nsieve_bits.rb
new file mode 100644
index 0000000000..6f958ee44e
--- /dev/null
+++ b/benchmark/bm_so_nsieve_bits.rb
@@ -0,0 +1,43 @@
+#!/usr/bin/ruby
+#coding: us-ascii
+#
+# The Great Computer Language Shootout
+# http://shootout.alioth.debian.org/
+#
+# nsieve-bits in Ruby
+# Contributed by Glenn Parker, March 2005
+
+CharExponent = 3
+BitsPerChar = 1 << CharExponent
+LowMask = BitsPerChar - 1
+
+def sieve(m)
+  items = "\xFF" * ((m / BitsPerChar) + 1)
+  masks = ""
+  BitsPerChar.times do |b|
+    masks << (1 << b).chr
+  end
+
+  count = 0
+  pmax = m - 1
+  2.step(pmax, 1) do |p|
+    if items[p >> CharExponent][p & LowMask] == 1
+      count += 1
+      p.step(pmax, p) do |mult|
+	a = mult >> CharExponent
+	b = mult & LowMask
+	items[a] -= masks[b] if items[a][b] != 0
+      end
+    end
+  end
+  count
+end
+
+n = 9 # (ARGV[0] || 2).to_i
+n.step(n - 2, -1) do |exponent|
+  break if exponent < 0
+  m = 2 ** exponent * 10_000
+  count = sieve(m)
+  printf "Primes up to %8d %8d\n", m, count
+end
+
diff --git a/benchmark/bm_so_object.rb b/benchmark/bm_so_object.rb
new file mode 100644
index 0000000000..e8607c7199
--- /dev/null
+++ b/benchmark/bm_so_object.rb
@@ -0,0 +1,56 @@
+#!/usr/bin/ruby
+# -*- mode: ruby -*-
+# $Id: objinst-ruby.code,v 1.4 2004/11/13 07:42:25 bfulgham Exp $
+# http://www.bagley.org/~doug/shootout/
+# with help from Aristarkh Zagorodnikov
+
+class Toggle
+    def initialize(start_state)
+        @bool = start_state
+    end
+
+    def value
+        @bool
+    end
+
+    def activate
+        @bool = !@bool
+        self
+    end
+end
+
+class NthToggle < Toggle
+    def initialize(start_state, max_counter)
+        super start_state
+        @count_max = max_counter
+        @counter = 0
+    end
+
+    def activate
+        @counter += 1
+        if @counter >= @count_max
+            @bool = !@bool
+            @counter = 0
+        end
+        self
+    end
+end
+
+n = 1500000 # (ARGV.shift || 1).to_i
+
+toggle = Toggle.new 1
+5.times do
+    toggle.activate.value ? 'true' : 'false'
+end
+n.times do
+    toggle = Toggle.new 1
+end
+
+ntoggle = NthToggle.new 1, 3
+8.times do
+    ntoggle.activate.value ? 'true' : 'false'
+end
+n.times do
+    ntoggle = NthToggle.new 1, 3
+end
+
diff --git a/benchmark/bm_so_partial_sums.rb b/benchmark/bm_so_partial_sums.rb
new file mode 100644
index 0000000000..630b45cb8d
--- /dev/null
+++ b/benchmark/bm_so_partial_sums.rb
@@ -0,0 +1,31 @@
+n = 2_500_000 # (ARGV.shift || 1).to_i
+
+alt = 1.0 ; s0 = s1 = s2 = s3 = s4 = s5 = s6 = s7 = s8 = 0.0
+
+1.upto(n) do |d|
+  d = d.to_f ; d2 = d * d ; d3 = d2 * d ; ds = Math.sin(d) ; dc = Math.cos(d)
+
+  s0 += (2.0 / 3.0) ** (d - 1.0)
+  s1 += 1.0 / Math.sqrt(d)
+  s2 += 1.0 / (d * (d + 1.0))
+  s3 += 1.0 / (d3 * ds * ds)
+  s4 += 1.0 / (d3 * dc * dc)
+  s5 += 1.0 / d
+  s6 += 1.0 / d2
+  s7 += alt / d
+  s8 += alt / (2.0 * d - 1.0)
+
+  alt = -alt
+end
+
+if false
+  printf("%.9f\t(2/3)^k\n", s0)
+  printf("%.9f\tk^-0.5\n", s1)
+  printf("%.9f\t1/k(k+1)\n", s2)
+  printf("%.9f\tFlint Hills\n", s3)
+  printf("%.9f\tCookson Hills\n", s4)
+  printf("%.9f\tHarmonic\n", s5)
+  printf("%.9f\tRiemann Zeta\n", s6)
+  printf("%.9f\tAlternating Harmonic\n", s7)
+  printf("%.9f\tGregory\n", s8)
+end
diff --git a/benchmark/bm_so_pidigits.rb b/benchmark/bm_so_pidigits.rb
new file mode 100644
index 0000000000..c7d6fbfb4d
--- /dev/null
+++ b/benchmark/bm_so_pidigits.rb
@@ -0,0 +1,92 @@
+# The Great Computer Language Shootout
+# http://shootout.alioth.debian.org/
+#
+# contributed by Gabriele Renzi
+
+class PiDigitSpigot
+
+    def initialize()
+        @z = Transformation.new 1,0,0,1
+        @x = Transformation.new 0,0,0,0
+        @inverse = Transformation.new 0,0,0,0
+    end
+
+    def next!
+        @y = @z.extract(3)
+        if safe? @y
+            @z = produce(@y)
+            @y
+        else
+            @z = consume @x.next!()
+            next!()
+        end
+    end
+
+    def safe?(digit)
+        digit == @z.extract(4)
+    end
+
+    def produce(i)
+        @inverse.qrst(10,-10*i,0,1).compose(@z)
+    end
+
+    def consume(a)
+        @z.compose(a)
+    end
+end
+
+
+class Transformation
+    attr_reader :q, :r, :s, :t
+    def initialize (q, r, s, t)
+        @q,@r,@s,@t,@k = q,r,s,t,0
+    end
+
+    def next!()
+        @q = @k = @k + 1
+        @r = 4 * @k + 2
+        @s = 0
+        @t = 2 * @k + 1
+        self
+    end
+
+    def extract(j)
+        (@q * j + @r) / (@s * j + @t)
+    end
+
+    def compose(a)
+        self.class.new( @q * a.q,
+                        @q * a.r + r * a.t,
+                        @s * a.q + t * a.s,
+                        @s * a.r + t * a.t
+                    )
+    end
+
+    def qrst *args
+        initialize *args
+        self
+    end
+
+
+end
+
+
+WIDTH = 10
+n = 2_500 # Integer(ARGV[0])
+j = 0
+
+digits = PiDigitSpigot.new
+
+while n > 0
+    if n >= WIDTH
+        WIDTH.times {print digits.next!}
+        j += WIDTH
+    else
+        n.times {print digits.next!}
+        (WIDTH-n).times {print " "}
+        j += n
+    end
+    puts "\t:"+j.to_s
+    n -= WIDTH
+end
+
diff --git a/benchmark/bm_so_random.rb b/benchmark/bm_so_random.rb
new file mode 100644
index 0000000000..a66b9e8e63
--- /dev/null
+++ b/benchmark/bm_so_random.rb
@@ -0,0 +1,20 @@
+# from http://www.bagley.org/~doug/shootout/bench/random/random.ruby
+
+IM = 139968.0
+IA = 3877.0
+IC = 29573.0
+
+$last = 42.0
+
+def gen_random(max)
+  (max * ($last = ($last * IA + IC) % IM)) / IM
+end
+
+N = 3_000_000
+
+i = 0
+while i<N
+  i +=1
+  gen_random(100.0)
+end
+# "%.9f" % gen_random(100.0)
diff --git a/benchmark/bm_so_reverse_complement.rb b/benchmark/bm_so_reverse_complement.rb
new file mode 100644
index 0000000000..82ea666994
--- /dev/null
+++ b/benchmark/bm_so_reverse_complement.rb
@@ -0,0 +1,30 @@
+#!/usr/bin/ruby
+# The Great Computer Language Shootout
+# http://shootout.alioth.debian.org/
+#
+# Contributed by Peter Bjarke Olsen
+# Modified by Doug King
+
+seq=Array.new
+
+def revcomp(seq)
+  seq.reverse!.tr!('wsatugcyrkmbdhvnATUGCYRKMBDHVN','WSTAACGRYMKVHDBNTAACGRYMKVHDBN')
+  stringlen=seq.length
+  0.step(stringlen-1,60) {|x| print seq.slice(x,60) , "\n"}
+end
+
+input = open(File.join(File.dirname($0), 'fasta.output.2500000'), 'rb')
+
+while input.gets
+  if $_ =~ />/
+    if seq.length != 0
+      revcomp(seq.join)
+      seq=Array.new
+    end
+    puts $_
+  else
+    $_.sub(/\n/,'')
+    seq.push $_
+  end
+end
+revcomp(seq.join)
diff --git a/benchmark/bm_so_sieve.rb b/benchmark/bm_so_sieve.rb
new file mode 100644
index 0000000000..43dc302648
--- /dev/null
+++ b/benchmark/bm_so_sieve.rb
@@ -0,0 +1,24 @@
+# from http://www.bagley.org/~doug/shootout/bench/sieve/sieve.ruby
+num = 500
+count = i = j = 0
+flags0 = Array.new(8192,1)
+k = 0
+while k < num
+  k += 1
+  count = 0
+  flags = flags0.dup
+  i = 2
+  while i<8192
+    i += 1
+    if flags[i]
+      # remove all multiples of prime: i
+      j = i*i
+      while j < 8192
+        j += i
+        flags[j] = nil
+      end
+      count += 1
+    end
+  end
+end
+count
diff --git a/benchmark/bm_so_spectralnorm.rb b/benchmark/bm_so_spectralnorm.rb
new file mode 100644
index 0000000000..6b97206689
--- /dev/null
+++ b/benchmark/bm_so_spectralnorm.rb
@@ -0,0 +1,50 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+# Contributed by Sokolov Yura
+
+def eval_A(i,j)
+	return 1.0/((i+j)*(i+j+1)/2+i+1)
+end
+
+def eval_A_times_u(u)
+        v, i = nil, nil
+	(0..u.length-1).collect { |i|
+                v = 0
+		for j in 0..u.length-1
+			v += eval_A(i,j)*u[j]
+                end
+                v
+        }
+end
+
+def eval_At_times_u(u)
+	v, i = nil, nil
+	(0..u.length-1).collect{|i|
+                v = 0
+		for j in 0..u.length-1
+			v += eval_A(j,i)*u[j]
+                end
+                v
+        }
+end
+
+def eval_AtA_times_u(u)
+	return eval_At_times_u(eval_A_times_u(u))
+end
+
+n = 500 # ARGV[0].to_i
+
+u=[1]*n
+for i in 1..10
+        v=eval_AtA_times_u(u)
+        u=eval_AtA_times_u(v)
+end
+vBv=0
+vv=0
+for i in 0..n-1
+        vBv += u[i]*v[i]
+        vv += v[i]*v[i]
+end
+
+str = "%0.9f" % (Math.sqrt(vBv/vv)), "\n"
+# print str
diff --git a/benchmark/bm_vm1_attr_ivar.rb b/benchmark/bm_vm1_attr_ivar.rb
new file mode 100644
index 0000000000..16906f3605
--- /dev/null
+++ b/benchmark/bm_vm1_attr_ivar.rb
@@ -0,0 +1,14 @@
+class C
+  attr_reader :a, :b
+  def initialize
+    @a = nil
+    @b = nil
+  end
+end
+obj = C.new
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  j = obj.a
+  k = obj.b
+end
diff --git a/benchmark/bm_vm1_attr_ivar_set.rb b/benchmark/bm_vm1_attr_ivar_set.rb
new file mode 100644
index 0000000000..7e7a6b48c0
--- /dev/null
+++ b/benchmark/bm_vm1_attr_ivar_set.rb
@@ -0,0 +1,14 @@
+class C
+  attr_accessor :a, :b
+  def initialize
+    @a = nil
+    @b = nil
+  end
+end
+obj = C.new
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  obj.a = 1
+  obj.b = 2
+end
diff --git a/benchmark/bm_vm1_block.rb b/benchmark/bm_vm1_block.rb
new file mode 100644
index 0000000000..a9f56b15ea
--- /dev/null
+++ b/benchmark/bm_vm1_block.rb
@@ -0,0 +1,10 @@
+def m
+  yield
+end
+
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  m{
+  }
+end
diff --git a/benchmark/bm_vm1_const.rb b/benchmark/bm_vm1_const.rb
new file mode 100644
index 0000000000..ac59ebccf1
--- /dev/null
+++ b/benchmark/bm_vm1_const.rb
@@ -0,0 +1,8 @@
+Const = 1
+
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  j = Const
+  k = Const
+end
diff --git a/benchmark/bm_vm1_ensure.rb b/benchmark/bm_vm1_ensure.rb
new file mode 100644
index 0000000000..a1596145f2
--- /dev/null
+++ b/benchmark/bm_vm1_ensure.rb
@@ -0,0 +1,11 @@
+i = 0
+while i<30_000_000 # benchmark loop 1
+  i += 1
+  begin
+    begin
+    ensure
+    end
+  ensure
+  end
+end
+
diff --git a/benchmark/bm_vm1_float_simple.rb b/benchmark/bm_vm1_float_simple.rb
new file mode 100644
index 0000000000..d4581439ff
--- /dev/null
+++ b/benchmark/bm_vm1_float_simple.rb
@@ -0,0 +1,7 @@
+i = 0.0; f = 0.0
+while i<30_000_000
+  i += 1
+  f += 0.1; f -= 0.1
+  f += 0.1; f -= 0.1
+  f += 0.1; f -= 0.1
+end
diff --git a/benchmark/bm_vm1_gc_short_lived.rb b/benchmark/bm_vm1_gc_short_lived.rb
new file mode 100644
index 0000000000..e78bca5668
--- /dev/null
+++ b/benchmark/bm_vm1_gc_short_lived.rb
@@ -0,0 +1,10 @@
+i = 0
+while i<30_000_000 # while loop 1
+  a = '' # short-lived String
+  b = ''
+  c = ''
+  d = ''
+  e = ''
+  f = ''
+  i+=1
+end
diff --git a/benchmark/bm_vm1_gc_short_with_complex_long.rb b/benchmark/bm_vm1_gc_short_with_complex_long.rb
new file mode 100644
index 0000000000..b66052dee0
--- /dev/null
+++ b/benchmark/bm_vm1_gc_short_with_complex_long.rb
@@ -0,0 +1,27 @@
+def nested_hash h, n
+  if n == 0
+    ''
+  else
+    10.times{
+      h[Object.new] = nested_hash(h, n-1)
+    }
+  end
+end
+
+long_lived = Hash.new
+nested_hash long_lived, 6
+
+GC.start
+GC.start
+
+i = 0
+while i<30_000_000 # while loop 1
+  a = '' # short-lived String
+  b = ''
+  c = ''
+  d = ''
+  e = ''
+  f = ''
+  i+=1
+end
+
diff --git a/benchmark/bm_vm1_gc_short_with_long.rb b/benchmark/bm_vm1_gc_short_with_long.rb
new file mode 100644
index 0000000000..298dbc845b
--- /dev/null
+++ b/benchmark/bm_vm1_gc_short_with_long.rb
@@ -0,0 +1,13 @@
+long_lived = Array.new(1_000_000){|i| "#{i}"}
+GC.start
+GC.start
+i = 0
+while i<30_000_000 # while loop 1
+  a = '' # short-lived String
+  b = ''
+  c = ''
+  d = ''
+  e = ''
+  f = ''
+  i+=1
+end
diff --git a/benchmark/bm_vm1_gc_short_with_symbol.rb b/benchmark/bm_vm1_gc_short_with_symbol.rb
new file mode 100644
index 0000000000..6b15c1b7bf
--- /dev/null
+++ b/benchmark/bm_vm1_gc_short_with_symbol.rb
@@ -0,0 +1,15 @@
+# make many symbols
+50_000.times{|i| sym = "sym#{i}".to_sym}
+GC.start
+GC.start
+
+i = 0
+while i<30_000_000 # while loop 1
+  a = '' # short-lived String
+  b = ''
+  c = ''
+  d = ''
+  e = ''
+  f = ''
+  i+=1
+end
diff --git a/benchmark/bm_vm1_gc_wb_ary.rb b/benchmark/bm_vm1_gc_wb_ary.rb
new file mode 100644
index 0000000000..881528845b
--- /dev/null
+++ b/benchmark/bm_vm1_gc_wb_ary.rb
@@ -0,0 +1,12 @@
+short_lived_ary = []
+
+if RUBY_VERSION >= "2.2.0"
+  GC.start(full_mark: false, immediate_mark: true, lazy_sweep: false)
+end
+
+i = 0
+short_lived = ''
+while i<30_000_000 # while loop 1
+  short_lived_ary[0] = short_lived # write barrier
+  i+=1
+end
diff --git a/benchmark/bm_vm1_gc_wb_ary_promoted.rb b/benchmark/bm_vm1_gc_wb_ary_promoted.rb
new file mode 100644
index 0000000000..3c8279c956
--- /dev/null
+++ b/benchmark/bm_vm1_gc_wb_ary_promoted.rb
@@ -0,0 +1,14 @@
+long_lived = []
+
+if RUBY_VERSION > "2.2.0"
+  3.times{ GC.start(full_mark: false, immediate_mark: true, lazy_sweep: false) }
+elsif
+  GC.start
+end
+
+i = 0
+short_lived = ''
+while i<30_000_000 # while loop 1
+  long_lived[0] = short_lived # write barrier
+  i+=1
+end
diff --git a/benchmark/bm_vm1_gc_wb_obj.rb b/benchmark/bm_vm1_gc_wb_obj.rb
new file mode 100644
index 0000000000..a4067af36b
--- /dev/null
+++ b/benchmark/bm_vm1_gc_wb_obj.rb
@@ -0,0 +1,15 @@
+class C
+  attr_accessor :foo
+end
+short_lived_obj = C.new
+
+if RUBY_VERSION >= "2.2.0"
+  GC.start(full_mark: false, immediate_mark: true, lazy_sweep: false)
+end
+
+i = 0
+short_lived = ''
+while i<30_000_000 # while loop 1
+  short_lived_obj.foo = short_lived # write barrier
+  i+=1
+end
diff --git a/benchmark/bm_vm1_gc_wb_obj_promoted.rb b/benchmark/bm_vm1_gc_wb_obj_promoted.rb
new file mode 100644
index 0000000000..eee07a0248
--- /dev/null
+++ b/benchmark/bm_vm1_gc_wb_obj_promoted.rb
@@ -0,0 +1,17 @@
+class C
+  attr_accessor :foo
+end
+long_lived = C.new
+
+if RUBY_VERSION >= "2.2.0"
+  3.times{ GC.start(full_mark: false, immediate_mark: true, lazy_sweep: false) }
+elsif
+  GC.start
+end
+
+i = 0
+short_lived = ''
+while i<30_000_000 # while loop 1
+  long_lived.foo = short_lived # write barrier
+  i+=1
+end
diff --git a/benchmark/bm_vm1_ivar.rb b/benchmark/bm_vm1_ivar.rb
new file mode 100644
index 0000000000..68a73cf92f
--- /dev/null
+++ b/benchmark/bm_vm1_ivar.rb
@@ -0,0 +1,8 @@
+@a = 1
+
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  j = @a
+  k = @a
+end
diff --git a/benchmark/bm_vm1_ivar_set.rb b/benchmark/bm_vm1_ivar_set.rb
new file mode 100644
index 0000000000..bd81b06c34
--- /dev/null
+++ b/benchmark/bm_vm1_ivar_set.rb
@@ -0,0 +1,6 @@
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  @a = 1
+  @b = 2
+end
diff --git a/benchmark/bm_vm1_length.rb b/benchmark/bm_vm1_length.rb
new file mode 100644
index 0000000000..353de3ab0e
--- /dev/null
+++ b/benchmark/bm_vm1_length.rb
@@ -0,0 +1,9 @@
+a = 'abc'
+b = [1, 2, 3]
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  a.length
+  b.length
+end
+
diff --git a/benchmark/bm_vm1_lvar_init.rb b/benchmark/bm_vm1_lvar_init.rb
new file mode 100644
index 0000000000..36f2068811
--- /dev/null
+++ b/benchmark/bm_vm1_lvar_init.rb
@@ -0,0 +1,18 @@
+def m v
+  unless v
+    # unreachable code
+    v1 = v2 = v3 = v4 = v5 = v6 = v7 = v8 = v9 = v10 =
+    v11 = v12 = v13 = v14 = v15 = v16 = v17 = v18 = v19 = v20 =
+    v21 = v22 = v23 = v24 = v25 = v26 = v27 = v28 = v29 = v30 =
+    v31 = v32 = v33 = v34 = v35 = v36 = v37 = v38 = v39 = v40 =
+    v41 = v42 = v43 = v44 = v45 = v46 = v47 = v48 = v49 = v50 = 1
+  end
+end
+
+i = 0
+
+while i<30_000_000 # while loop 1
+  i += 1
+  m i
+end
+
diff --git a/benchmark/bm_vm1_lvar_set.rb b/benchmark/bm_vm1_lvar_set.rb
new file mode 100644
index 0000000000..222e864134
--- /dev/null
+++ b/benchmark/bm_vm1_lvar_set.rb
@@ -0,0 +1,5 @@
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  a = b = c = d = e = f = g = h = j = k = l = m = n = o = p = q = r = 1
+end
diff --git a/benchmark/bm_vm1_neq.rb b/benchmark/bm_vm1_neq.rb
new file mode 100644
index 0000000000..bbb4ae07a4
--- /dev/null
+++ b/benchmark/bm_vm1_neq.rb
@@ -0,0 +1,8 @@
+i = 0
+obj1 = Object.new
+obj2 = Object.new
+
+while i<30_000_000 # while loop 1
+  i += 1
+  obj1 != obj2
+end
diff --git a/benchmark/bm_vm1_not.rb b/benchmark/bm_vm1_not.rb
new file mode 100644
index 0000000000..b09ecdcc21
--- /dev/null
+++ b/benchmark/bm_vm1_not.rb
@@ -0,0 +1,7 @@
+i = 0
+obj = Object.new
+
+while i<30_000_000 # while loop 1
+  i += 1
+  !obj
+end
diff --git a/benchmark/bm_vm1_rescue.rb b/benchmark/bm_vm1_rescue.rb
new file mode 100644
index 0000000000..b0d3e2bdfa
--- /dev/null
+++ b/benchmark/bm_vm1_rescue.rb
@@ -0,0 +1,7 @@
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  begin
+  rescue
+  end
+end
diff --git a/benchmark/bm_vm1_simplereturn.rb b/benchmark/bm_vm1_simplereturn.rb
new file mode 100644
index 0000000000..63f9f21675
--- /dev/null
+++ b/benchmark/bm_vm1_simplereturn.rb
@@ -0,0 +1,9 @@
+def m
+  return 1
+end
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  m
+end
+
diff --git a/benchmark/bm_vm1_swap.rb b/benchmark/bm_vm1_swap.rb
new file mode 100644
index 0000000000..918f8b2112
--- /dev/null
+++ b/benchmark/bm_vm1_swap.rb
@@ -0,0 +1,8 @@
+a = 1
+b = 2
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  a, b = b, a
+end
+
diff --git a/benchmark/bm_vm1_yield.rb b/benchmark/bm_vm1_yield.rb
new file mode 100644
index 0000000000..775597cea6
--- /dev/null
+++ b/benchmark/bm_vm1_yield.rb
@@ -0,0 +1,10 @@
+def m
+  i = 0
+  while i<30_000_000 # while loop 1
+    i += 1
+    yield
+  end
+end
+
+m{}
+
diff --git a/benchmark/bm_vm2_array.rb b/benchmark/bm_vm2_array.rb
new file mode 100644
index 0000000000..df9037c83c
--- /dev/null
+++ b/benchmark/bm_vm2_array.rb
@@ -0,0 +1,5 @@
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  a = [1,2,3,4,5,6,7,8,9,10]
+end
diff --git a/benchmark/bm_vm2_bigarray.rb b/benchmark/bm_vm2_bigarray.rb
new file mode 100644
index 0000000000..b02509d6a2
--- /dev/null
+++ b/benchmark/bm_vm2_bigarray.rb
@@ -0,0 +1,106 @@
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  a = [
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+  ]
+end
diff --git a/benchmark/bm_vm2_bighash.rb b/benchmark/bm_vm2_bighash.rb
new file mode 100644
index 0000000000..5e3f437bb8
--- /dev/null
+++ b/benchmark/bm_vm2_bighash.rb
@@ -0,0 +1,5 @@
+i = 0
+while i<60_000 # benchmark loop 2
+  i += 1
+  a = {0=>0, 1=>1, 2=>2, 3=>3, 4=>4, 5=>5, 6=>6, 7=>7, 8=>8, 9=>9, 10=>10, 11=>11, 12=>12, 13=>13, 14=>14, 15=>15, 16=>16, 17=>17, 18=>18, 19=>19, 20=>20, 21=>21, 22=>22, 23=>23, 24=>24, 25=>25, 26=>26, 27=>27, 28=>28, 29=>29, 30=>30, 31=>31, 32=>32, 33=>33, 34=>34, 35=>35, 36=>36, 37=>37, 38=>38, 39=>39, 40=>40, 41=>41, 42=>42, 43=>43, 44=>44, 45=>45, 46=>46, 47=>47, 48=>48, 49=>49, 50=>50, 51=>51, 52=>52, 53=>53, 54=>54, 55=>55, 56=>56, 57=>57, 58=>58, 59=>59, 60=>60, 61=>61, 62=>62, 63=>63, 64=>64, 65=>65, 66=>66, 67=>67, 68=>68, 69=>69, 70=>70, 71=>71, 72=>72, 73=>73, 74=>74, 75=>75, 76=>76, 77=>77, 78=>78, 79=>79, 80=>80, 81=>81, 82=>82, 83=>83, 84=>84, 85=>85, 86=>86, 87=>87, 88=>88, 89=>89, 90=>90, 91=>91, 92=>92, 93=>93, 94=>94, 95=>95, 96=>96, 97=>97, 98=>98, 99=>99, 100=>100, 101=>101, 102=>102, 103=>103, 104=>104, 105=>105, 106=>106, 107=>107, 108=>108, 109=>109, 110=>110, 111=>111, 112=>112, 113=>113, 114=>114, 115=>115, 116=>116, 117=>117, 118=>118, 119=>119, 120=>120, 121=>121, 122=>122, 123=>123, 124=>124, 125=>125, 126=>126, 127=>127, 128=>128, 129=>129, 130=>130, 131=>131, 132=>132, 133=>133, 134=>134, 135=>135, 136=>136, 137=>137, 138=>138, 139=>139, 140=>140, 141=>141, 142=>142, 143=>143, 144=>144, 145=>145, 146=>146, 147=>147, 148=>148, 149=>149, 150=>150, 151=>151, 152=>152, 153=>153, 154=>154, 155=>155, 156=>156, 157=>157, 158=>158, 159=>159, 160=>160, 161=>161, 162=>162, 163=>163, 164=>164, 165=>165, 166=>166, 167=>167, 168=>168, 169=>169, 170=>170, 171=>171, 172=>172, 173=>173, 174=>174, 175=>175, 176=>176, 177=>177, 178=>178, 179=>179, 180=>180, 181=>181, 182=>182, 183=>183, 184=>184, 185=>185, 186=>186, 187=>187, 188=>188, 189=>189, 190=>190, 191=>191, 192=>192, 193=>193, 194=>194, 195=>195, 196=>196, 197=>197, 198=>198, 199=>199, 200=>200, 201=>201, 202=>202, 203=>203, 204=>204, 205=>205, 206=>206, 207=>207, 208=>208, 209=>209, 210=>210, 211=>211, 212=>212, 213=>213, 214=>214, 215=>215, 216=>216, 217=>217, 218=>218, 219=>219, 220=>220, 221=>221, 222=>222, 223=>223, 224=>224, 225=>225, 226=>226, 227=>227, 228=>228, 229=>229, 230=>230, 231=>231, 232=>232, 233=>233, 234=>234, 235=>235, 236=>236, 237=>237, 238=>238, 239=>239, 240=>240, 241=>241, 242=>242, 243=>243, 244=>244, 245=>245, 246=>246, 247=>247, 248=>248, 249=>249, 250=>250, 251=>251, 252=>252, 253=>253, 254=>254, 255=>255, 256=>256, 257=>257, 258=>258, 259=>259, 260=>260, 261=>261, 262=>262, 263=>263, 264=>264, 265=>265, 266=>266, 267=>267, 268=>268, 269=>269, 270=>270, 271=>271, 272=>272, 273=>273, 274=>274, 275=>275, 276=>276, 277=>277, 278=>278, 279=>279, 280=>280, 281=>281, 282=>282, 283=>283, 284=>284, 285=>285, 286=>286, 287=>287, 288=>288, 289=>289, 290=>290, 291=>291, 292=>292, 293=>293, 294=>294, 295=>295, 296=>296, 297=>297, 298=>298, 299=>299, 300=>300, 301=>301, 302=>302, 303=>303, 304=>304, 305=>305, 306=>306, 307=>307, 308=>308, 309=>309, 310=>310, 311=>311, 312=>312, 313=>313, 314=>314, 315=>315, 316=>316, 317=>317, 318=>318, 319=>319, 320=>320, 321=>321, 322=>322, 323=>323, 324=>324, 325=>325, 326=>326, 327=>327, 328=>328, 329=>329, 330=>330, 331=>331, 332=>332, 333=>333, 334=>334, 335=>335, 336=>336, 337=>337, 338=>338, 339=>339, 340=>340, 341=>341, 342=>342, 343=>343, 344=>344, 345=>345, 346=>346, 347=>347, 348=>348, 349=>349, 350=>350, 351=>351, 352=>352, 353=>353, 354=>354, 355=>355, 356=>356, 357=>357, 358=>358, 359=>359, 360=>360, 361=>361, 362=>362, 363=>363, 364=>364, 365=>365, 366=>366, 367=>367, 368=>368, 369=>369, 370=>370, 371=>371, 372=>372, 373=>373, 374=>374, 375=>375, 376=>376, 377=>377, 378=>378, 379=>379, 380=>380, 381=>381, 382=>382, 383=>383, 384=>384, 385=>385, 386=>386, 387=>387, 388=>388, 389=>389, 390=>390, 391=>391, 392=>392, 393=>393, 394=>394, 395=>395, 396=>396, 397=>397, 398=>398, 399=>399, 400=>400, 401=>401, 402=>402, 403=>403, 404=>404, 405=>405, 406=>406, 407=>407, 408=>408, 409=>409, 410=>410, 411=>411, 412=>412, 413=>413, 414=>414, 415=>415, 416=>416, 417=>417, 418=>418, 419=>419, 420=>420, 421=>421, 422=>422, 423=>423, 424=>424, 425=>425, 426=>426, 427=>427, 428=>428, 429=>429, 430=>430, 431=>431, 432=>432, 433=>433, 434=>434, 435=>435, 436=>436, 437=>437, 438=>438, 439=>439, 440=>440, 441=>441, 442=>442, 443=>443, 444=>444, 445=>445, 446=>446, 447=>447, 448=>448, 449=>449, 450=>450, 451=>451, 452=>452, 453=>453, 454=>454, 455=>455, 456=>456, 457=>457, 458=>458, 459=>459, 460=>460, 461=>461, 462=>462, 463=>463, 464=>464, 465=>465, 466=>466, 467=>467, 468=>468, 469=>469, 470=>470, 471=>471, 472=>472, 473=>473, 474=>474, 475=>475, 476=>476, 477=>477, 478=>478, 479=>479, 480=>480, 481=>481, 482=>482, 483=>483, 484=>484, 485=>485, 486=>486, 487=>487, 488=>488, 489=>489, 490=>490, 491=>491, 492=>492, 493=>493, 494=>494, 495=>495, 496=>496, 497=>497, 498=>498, 499=>499, 500=>500,}
+end
diff --git a/benchmark/bm_vm2_case.rb b/benchmark/bm_vm2_case.rb
new file mode 100644
index 0000000000..adc6e4df0a
--- /dev/null
+++ b/benchmark/bm_vm2_case.rb
@@ -0,0 +1,14 @@
+i = 0
+while i<6_000_000 # while loop 2
+  case :foo
+  when :bar
+    raise
+  when :baz
+    raise
+  when :boo
+    raise
+  when :foo
+    i += 1
+  end
+end
+
diff --git a/benchmark/bm_vm2_case_lit.rb b/benchmark/bm_vm2_case_lit.rb
new file mode 100644
index 0000000000..c62b294e0e
--- /dev/null
+++ b/benchmark/bm_vm2_case_lit.rb
@@ -0,0 +1,19 @@
+i = 0
+@ret = [ "foo", true, false, :sym, 6, nil, 0.1, 0xffffffffffffffff ]
+def foo(i)
+  @ret[i % @ret.size]
+end
+
+while i<6_000_000 # while loop 2
+  case foo(i)
+  when "foo" then :foo
+  when true then true
+  when false then false
+  when :sym then :sym
+  when 6 then :fix
+  when nil then nil
+  when 0.1 then :float
+  when 0xffffffffffffffff then :big
+  end
+  i += 1
+end
diff --git a/benchmark/bm_vm2_defined_method.rb b/benchmark/bm_vm2_defined_method.rb
new file mode 100644
index 0000000000..053ed6c912
--- /dev/null
+++ b/benchmark/bm_vm2_defined_method.rb
@@ -0,0 +1,9 @@
+class Object
+  define_method(:m){}
+end
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  m; m; m; m; m; m; m; m;
+end
diff --git a/benchmark/bm_vm2_dstr.rb b/benchmark/bm_vm2_dstr.rb
new file mode 100644
index 0000000000..58c0f7bbc3
--- /dev/null
+++ b/benchmark/bm_vm2_dstr.rb
@@ -0,0 +1,6 @@
+i = 0
+x = y = 'z'
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  str = "foo#{x}bar#{y}baz"
+end
diff --git a/benchmark/bm_vm2_eval.rb b/benchmark/bm_vm2_eval.rb
new file mode 100644
index 0000000000..307cfc28ef
--- /dev/null
+++ b/benchmark/bm_vm2_eval.rb
@@ -0,0 +1,6 @@
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  eval("1")
+end
+
diff --git a/benchmark/bm_vm2_method.rb b/benchmark/bm_vm2_method.rb
new file mode 100644
index 0000000000..a8ccff7138
--- /dev/null
+++ b/benchmark/bm_vm2_method.rb
@@ -0,0 +1,9 @@
+def m
+  nil
+end
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  m; m; m; m; m; m; m; m;
+end
diff --git a/benchmark/bm_vm2_method_missing.rb b/benchmark/bm_vm2_method_missing.rb
new file mode 100644
index 0000000000..2badc73101
--- /dev/null
+++ b/benchmark/bm_vm2_method_missing.rb
@@ -0,0 +1,12 @@
+class C
+  def method_missing mid
+  end
+end
+
+obj = C.new
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m;
+end
diff --git a/benchmark/bm_vm2_method_with_block.rb b/benchmark/bm_vm2_method_with_block.rb
new file mode 100644
index 0000000000..b4efb4f520
--- /dev/null
+++ b/benchmark/bm_vm2_method_with_block.rb
@@ -0,0 +1,9 @@
+def m
+  nil
+end
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  m{}; m{}; m{}; m{}; m{}; m{}; m{}; m{};
+end
diff --git a/benchmark/bm_vm2_mutex.rb b/benchmark/bm_vm2_mutex.rb
new file mode 100644
index 0000000000..7362f738c5
--- /dev/null
+++ b/benchmark/bm_vm2_mutex.rb
@@ -0,0 +1,9 @@
+require 'thread'
+
+m = Mutex.new
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  m.synchronize{}
+end
diff --git a/benchmark/bm_vm2_newlambda.rb b/benchmark/bm_vm2_newlambda.rb
new file mode 100644
index 0000000000..6422c9b0d0
--- /dev/null
+++ b/benchmark/bm_vm2_newlambda.rb
@@ -0,0 +1,5 @@
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  lambda {}
+end
diff --git a/benchmark/bm_vm2_poly_method.rb b/benchmark/bm_vm2_poly_method.rb
new file mode 100644
index 0000000000..c82c0e4bce
--- /dev/null
+++ b/benchmark/bm_vm2_poly_method.rb
@@ -0,0 +1,20 @@
+class C1
+  def m
+    1
+  end
+end
+class C2
+  def m
+    2
+  end
+end
+
+o1 = C1.new
+o2 = C2.new
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  o = (i % 2 == 0) ? o1 : o2
+  o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
+  i += 1
+end
diff --git a/benchmark/bm_vm2_poly_method_ov.rb b/benchmark/bm_vm2_poly_method_ov.rb
new file mode 100644
index 0000000000..aa5fd1dd38
--- /dev/null
+++ b/benchmark/bm_vm2_poly_method_ov.rb
@@ -0,0 +1,20 @@
+class C1
+  def m
+    1
+  end
+end
+class C2
+  def m
+    2
+  end
+end
+
+o1 = C1.new
+o2 = C2.new
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  o = (i % 2 == 0) ? o1 : o2
+#  o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
+  i += 1
+end
diff --git a/benchmark/bm_vm2_proc.rb b/benchmark/bm_vm2_proc.rb
new file mode 100644
index 0000000000..65e5217371
--- /dev/null
+++ b/benchmark/bm_vm2_proc.rb
@@ -0,0 +1,14 @@
+def m &b
+  b
+end
+
+pr = m{
+  a = 1
+}
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  pr.call
+end
+
diff --git a/benchmark/bm_vm2_raise1.rb b/benchmark/bm_vm2_raise1.rb
new file mode 100644
index 0000000000..aa5387987f
--- /dev/null
+++ b/benchmark/bm_vm2_raise1.rb
@@ -0,0 +1,18 @@
+def rec n
+  if n > 0
+    rec n-1
+  else
+    raise
+  end
+end
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+
+  begin
+    rec 1
+  rescue
+    # ignore
+  end
+end
diff --git a/benchmark/bm_vm2_raise2.rb b/benchmark/bm_vm2_raise2.rb
new file mode 100644
index 0000000000..1f61c63157
--- /dev/null
+++ b/benchmark/bm_vm2_raise2.rb
@@ -0,0 +1,18 @@
+def rec n
+  if n > 0
+    rec n-1
+  else
+    raise
+  end
+end
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+
+  begin
+    rec 10
+  rescue
+    # ignore
+  end
+end
diff --git a/benchmark/bm_vm2_regexp.rb b/benchmark/bm_vm2_regexp.rb
new file mode 100644
index 0000000000..55f9e957a3
--- /dev/null
+++ b/benchmark/bm_vm2_regexp.rb
@@ -0,0 +1,6 @@
+i = 0
+str = 'xxxhogexxx'
+while i<6_000_000 # benchmark loop 2
+  /hoge/ =~ str
+  i += 1
+end
diff --git a/benchmark/bm_vm2_send.rb b/benchmark/bm_vm2_send.rb
new file mode 100644
index 0000000000..6a3ab6fdab
--- /dev/null
+++ b/benchmark/bm_vm2_send.rb
@@ -0,0 +1,12 @@
+class C
+  def m
+  end
+end
+
+o = C.new
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  o.__send__ :m
+end
diff --git a/benchmark/bm_vm2_string_literal.rb b/benchmark/bm_vm2_string_literal.rb
new file mode 100644
index 0000000000..1d73036849
--- /dev/null
+++ b/benchmark/bm_vm2_string_literal.rb
@@ -0,0 +1,5 @@
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  x = "xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx"
+end
diff --git a/benchmark/bm_vm2_struct_big_aref_hi.rb b/benchmark/bm_vm2_struct_big_aref_hi.rb
new file mode 100644
index 0000000000..22cb26b0a5
--- /dev/null
+++ b/benchmark/bm_vm2_struct_big_aref_hi.rb
@@ -0,0 +1,7 @@
+s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+x = s.new
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  x.z # x[25]
+end
diff --git a/benchmark/bm_vm2_struct_big_aref_lo.rb b/benchmark/bm_vm2_struct_big_aref_lo.rb
new file mode 100644
index 0000000000..5e61a7087e
--- /dev/null
+++ b/benchmark/bm_vm2_struct_big_aref_lo.rb
@@ -0,0 +1,7 @@
+s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+x = s.new
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  x.k # x[10]
+end
diff --git a/benchmark/bm_vm2_struct_big_aset.rb b/benchmark/bm_vm2_struct_big_aset.rb
new file mode 100644
index 0000000000..5a1c3d16f3
--- /dev/null
+++ b/benchmark/bm_vm2_struct_big_aset.rb
@@ -0,0 +1,7 @@
+s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+x = s.new
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  x.k = i # x[10] = i
+end
diff --git a/benchmark/bm_vm2_struct_big_href_hi.rb b/benchmark/bm_vm2_struct_big_href_hi.rb
new file mode 100644
index 0000000000..fff940a80a
--- /dev/null
+++ b/benchmark/bm_vm2_struct_big_href_hi.rb
@@ -0,0 +1,7 @@
+s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+x = s.new
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  x[:z]
+end
diff --git a/benchmark/bm_vm2_struct_big_href_lo.rb b/benchmark/bm_vm2_struct_big_href_lo.rb
new file mode 100644
index 0000000000..5e4085d59d
--- /dev/null
+++ b/benchmark/bm_vm2_struct_big_href_lo.rb
@@ -0,0 +1,7 @@
+s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+x = s.new
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  x[:k]
+end
diff --git a/benchmark/bm_vm2_struct_big_hset.rb b/benchmark/bm_vm2_struct_big_hset.rb
new file mode 100644
index 0000000000..9c0cee4141
--- /dev/null
+++ b/benchmark/bm_vm2_struct_big_hset.rb
@@ -0,0 +1,7 @@
+s = Struct.new(*('a'..'z').map { |x| x.to_sym })
+x = s.new
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  x[:k] = i
+end
diff --git a/benchmark/bm_vm2_struct_small_aref.rb b/benchmark/bm_vm2_struct_small_aref.rb
new file mode 100644
index 0000000000..8eaa555b41
--- /dev/null
+++ b/benchmark/bm_vm2_struct_small_aref.rb
@@ -0,0 +1,7 @@
+s = Struct.new(:a, :b, :c)
+x = s.new
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  x.a
+end
diff --git a/benchmark/bm_vm2_struct_small_aset.rb b/benchmark/bm_vm2_struct_small_aset.rb
new file mode 100644
index 0000000000..ecd0f95669
--- /dev/null
+++ b/benchmark/bm_vm2_struct_small_aset.rb
@@ -0,0 +1,7 @@
+s = Struct.new(:a, :b, :c)
+x = s.new
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  x.a = i
+end
diff --git a/benchmark/bm_vm2_struct_small_href.rb b/benchmark/bm_vm2_struct_small_href.rb
new file mode 100644
index 0000000000..2c88fee6bf
--- /dev/null
+++ b/benchmark/bm_vm2_struct_small_href.rb
@@ -0,0 +1,7 @@
+s = Struct.new(:a, :b, :c)
+x = s.new
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  x[:a]
+end
diff --git a/benchmark/bm_vm2_struct_small_hset.rb b/benchmark/bm_vm2_struct_small_hset.rb
new file mode 100644
index 0000000000..33c36d20f1
--- /dev/null
+++ b/benchmark/bm_vm2_struct_small_hset.rb
@@ -0,0 +1,7 @@
+s = Struct.new(:a, :b, :c)
+x = s.new
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  x[:a] = 1
+end
diff --git a/benchmark/bm_vm2_super.rb b/benchmark/bm_vm2_super.rb
new file mode 100644
index 0000000000..afd8579e7b
--- /dev/null
+++ b/benchmark/bm_vm2_super.rb
@@ -0,0 +1,20 @@
+
+class C
+  def m
+    1
+  end
+end
+
+class CC < C
+  def m
+    super()
+  end
+end
+
+obj = CC.new
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  obj.m
+  i += 1
+end
diff --git a/benchmark/bm_vm2_unif1.rb b/benchmark/bm_vm2_unif1.rb
new file mode 100644
index 0000000000..1774625942
--- /dev/null
+++ b/benchmark/bm_vm2_unif1.rb
@@ -0,0 +1,8 @@
+i = 0
+def m a, b
+end
+
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  m 100, 200
+end
diff --git a/benchmark/bm_vm2_zsuper.rb b/benchmark/bm_vm2_zsuper.rb
new file mode 100644
index 0000000000..2a43e62217
--- /dev/null
+++ b/benchmark/bm_vm2_zsuper.rb
@@ -0,0 +1,20 @@
+i = 0
+
+class C
+  def m a
+    1
+  end
+end
+
+class CC < C
+  def m a
+    super
+  end
+end
+
+obj = CC.new
+
+while i<6_000_000 # benchmark loop 2
+  obj.m 10
+  i += 1
+end
diff --git a/benchmark/bm_vm3_backtrace.rb b/benchmark/bm_vm3_backtrace.rb
new file mode 100644
index 0000000000..0fbf73e1ca
--- /dev/null
+++ b/benchmark/bm_vm3_backtrace.rb
@@ -0,0 +1,22 @@
+# get last backtrace
+
+begin
+  caller(0, 0)
+rescue ArgumentError
+  alias caller_orig caller
+  def caller lev, n
+    caller_orig(lev)[0..n]
+  end
+end
+
+def rec n
+  if n < 0
+    100_000.times{
+      caller(0, 1)
+    }
+  else
+    rec(n-1)
+  end
+end
+
+rec 50
diff --git a/benchmark/bm_vm3_clearmethodcache.rb b/benchmark/bm_vm3_clearmethodcache.rb
new file mode 100644
index 0000000000..9661323cd2
--- /dev/null
+++ b/benchmark/bm_vm3_clearmethodcache.rb
@@ -0,0 +1,8 @@
+i = 0
+while i<200_000
+  i += 1
+
+  Class.new{
+    def m; end
+  }
+end
diff --git a/benchmark/bm_vm3_gc.rb b/benchmark/bm_vm3_gc.rb
new file mode 100644
index 0000000000..e668026915
--- /dev/null
+++ b/benchmark/bm_vm3_gc.rb
@@ -0,0 +1,6 @@
+5000.times do
+  100.times do
+    {"xxxx"=>"yyyy"}
+  end
+  GC.start
+end
diff --git a/benchmark/bm_vm_symbol_block_pass.rb b/benchmark/bm_vm_symbol_block_pass.rb
new file mode 100644
index 0000000000..1d433353e1
--- /dev/null
+++ b/benchmark/bm_vm_symbol_block_pass.rb
@@ -0,0 +1,13 @@
+class C
+  1000.times {|i|
+    eval("def i#{i};end")
+  }
+end
+
+c = C.new
+m = C.instance_methods(false)
+5_000.times do
+  m.each do |n|
+    c.tap(&n)
+  end
+end
diff --git a/benchmark/bm_vm_thread_alive_check1.rb b/benchmark/bm_vm_thread_alive_check1.rb
new file mode 100644
index 0000000000..c993accdda
--- /dev/null
+++ b/benchmark/bm_vm_thread_alive_check1.rb
@@ -0,0 +1,6 @@
+5_000.times{
+  t = Thread.new{}
+  while t.alive?
+    Thread.pass
+  end
+}
diff --git a/benchmark/bm_vm_thread_close.rb b/benchmark/bm_vm_thread_close.rb
new file mode 100644
index 0000000000..3e9a265ce8
--- /dev/null
+++ b/benchmark/bm_vm_thread_close.rb
@@ -0,0 +1,6 @@
+1000.times { Thread.new { sleep } }
+i = 0
+while i<100_000 # benchmark loop 3
+  i += 1
+  IO.pipe.each(&:close)
+end
diff --git a/benchmark/bm_vm_thread_create_join.rb b/benchmark/bm_vm_thread_create_join.rb
new file mode 100644
index 0000000000..393cd45df9
--- /dev/null
+++ b/benchmark/bm_vm_thread_create_join.rb
@@ -0,0 +1,6 @@
+i = 0
+while i<100_000 # benchmark loop 3
+  i += 1
+  Thread.new{
+  }.join
+end
diff --git a/benchmark/bm_vm_thread_mutex1.rb b/benchmark/bm_vm_thread_mutex1.rb
new file mode 100644
index 0000000000..5c9f85dfb7
--- /dev/null
+++ b/benchmark/bm_vm_thread_mutex1.rb
@@ -0,0 +1,21 @@
+# one thread, one mutex (no contention)
+
+require 'thread'
+m = Mutex.new
+r = 0
+max = 2000
+lmax = max * max
+(1..1).map{
+  Thread.new{
+    i = 0
+    while i<lmax
+      i += 1
+      m.synchronize{
+        r += 1
+      }
+    end
+  }
+}.each{|e|
+  e.join
+}
+raise r.to_s if r != max * max
diff --git a/benchmark/bm_vm_thread_mutex2.rb b/benchmark/bm_vm_thread_mutex2.rb
new file mode 100644
index 0000000000..10de59054f
--- /dev/null
+++ b/benchmark/bm_vm_thread_mutex2.rb
@@ -0,0 +1,21 @@
+# two threads, one mutex
+
+require 'thread'
+m = Mutex.new
+r = 0
+max = 2000
+lmax = (max * max)/2
+(1..2).map{
+  Thread.new{
+    i = 0
+    while i<lmax
+      i += 1
+      m.synchronize{
+        r += 1
+      }
+    end
+  }
+}.each{|e|
+  e.join
+}
+raise r.to_s if r != max * max
diff --git a/benchmark/bm_vm_thread_mutex3.rb b/benchmark/bm_vm_thread_mutex3.rb
new file mode 100644
index 0000000000..7f9a44b39d
--- /dev/null
+++ b/benchmark/bm_vm_thread_mutex3.rb
@@ -0,0 +1,20 @@
+# 1000 threads, one mutex
+
+require 'thread'
+m = Mutex.new
+r = 0
+max = 2000
+(1..max).map{
+  Thread.new{
+    i = 0
+    while i<max
+      i += 1
+      m.synchronize{
+        r += 1
+      }
+    end
+  }
+}.each{|e|
+  e.join
+}
+raise r.to_s if r != max * max
diff --git a/benchmark/bm_vm_thread_pass.rb b/benchmark/bm_vm_thread_pass.rb
new file mode 100644
index 0000000000..b5b3c0bc85
--- /dev/null
+++ b/benchmark/bm_vm_thread_pass.rb
@@ -0,0 +1,15 @@
+# Plenty Thtread.pass
+# A performance may depend on GVL implementation.
+
+tmax = (ARGV.shift || 2).to_i
+lmax = 200_000 / tmax
+
+(1..tmax).map{
+  Thread.new{
+    lmax.times{
+      Thread.pass
+    }
+  }
+}.each{|t| t.join}
+
+
diff --git a/benchmark/bm_vm_thread_pass_flood.rb b/benchmark/bm_vm_thread_pass_flood.rb
new file mode 100644
index 0000000000..27157d1a6f
--- /dev/null
+++ b/benchmark/bm_vm_thread_pass_flood.rb
@@ -0,0 +1,8 @@
+1000.times{
+  Thread.new{loop{Thread.pass}}
+}
+
+i = 0
+while i<10000
+  i += 1
+end
diff --git a/benchmark/bm_vm_thread_pipe.rb b/benchmark/bm_vm_thread_pipe.rb
new file mode 100644
index 0000000000..112a621905
--- /dev/null
+++ b/benchmark/bm_vm_thread_pipe.rb
@@ -0,0 +1,17 @@
+# Measure small and plenty pipe read/write.
+# A performance may depend on GVL implementation.
+
+lmax = 100_000
+r, w = IO.pipe
+[Thread.new{
+  lmax.times{
+    w.write('a')
+  }
+  p "w:exit"
+}, Thread.new{
+  lmax.times{
+    r.read(1)
+  }
+  p "r:exit"
+}].each{|t| t.join}
+
diff --git a/benchmark/bm_vm_thread_queue.rb b/benchmark/bm_vm_thread_queue.rb
new file mode 100644
index 0000000000..37381ae62b
--- /dev/null
+++ b/benchmark/bm_vm_thread_queue.rb
@@ -0,0 +1,18 @@
+require 'thread'
+
+n = 1_000_000
+q = Queue.new
+consumer = Thread.new{
+  while q.pop
+    # consuming
+  end
+}
+
+producer = Thread.new{
+  n.times{
+    q.push true
+  }
+  q.push nil
+}
+
+consumer.join
diff --git a/benchmark/driver.rb b/benchmark/driver.rb
new file mode 100644
index 0000000000..defe3c30be
--- /dev/null
+++ b/benchmark/driver.rb
@@ -0,0 +1,400 @@
+#
+# Ruby Benchmark driver
+#
+
+first = true
+
+begin
+  require 'optparse'
+rescue LoadError
+  if first
+    first = false
+    $:.unshift File.join(File.dirname(__FILE__), '../lib')
+    retry
+  else
+    raise
+  end
+end
+
+require 'benchmark'
+require 'pp'
+
+class BenchmarkDriver
+  def self.benchmark(opt)
+    driver = self.new(opt[:execs], opt[:dir], opt)
+    begin
+      driver.run
+    ensure
+      driver.show_results
+    end
+  end
+
+  def self.load(input, type, opt)
+    attrs = [:executables, :results]
+    case type
+    when 'yaml'
+      require 'yaml'
+      h = YAML.load(input)
+    when 'json'
+      require 'json'
+      h = JSON.load(input)
+    else
+      h = eval(input.read)
+    end
+    obj = allocate
+    obj.instance_variable_set("@execs", h[:executables] || h["executables"])
+    obj.instance_variable_set("@results", h[:results] || h["results"])
+    obj.instance_variable_set("@opt", opt)
+    obj
+  end
+
+  def output *args
+    puts(*args)
+    @output and @output.puts(*args)
+  end
+
+  def message *args
+    output(*args) if @verbose
+  end
+
+  def message_print *args
+    if @verbose
+      print(*args)
+      STDOUT.flush
+      @output and @output.print(*args)
+    end
+  end
+
+  def progress_message *args
+    unless STDOUT.tty?
+      STDERR.print(*args)
+      STDERR.flush
+    end
+  end
+
+  def initialize execs, dir, opt = {}
+    @execs = execs.map{|e|
+      e.strip!
+      next if e.empty?
+
+      if /(.+)::(.+)/ =~ e
+        # ex) ruby-a::/path/to/ruby-a
+        label = $1.strip
+        path = $2
+        version = `#{path} -v`.chomp
+      else
+        path = e
+        version = label = `#{path} -v`.chomp
+      end
+      [path, label, version]
+    }.compact
+
+    @dir = dir
+    @repeat = opt[:repeat] || 1
+    @repeat = 1 if @repeat < 1
+    @pattern = opt[:pattern] || nil
+    @exclude = opt[:exclude] || nil
+    @verbose = opt[:quiet] ? false : (opt[:verbose] || false)
+    @output = opt[:output] ? open(opt[:output], 'w') : nil
+    @loop_wl1 = @loop_wl2 = nil
+    @ruby_arg = opt[:ruby_arg] || nil
+    @opt = opt
+
+    # [[name, [[r-1-1, r-1-2, ...], [r-2-1, r-2-2, ...]]], ...]
+    @results = []
+
+    if @verbose
+      @start_time = Time.now
+      message @start_time
+      @execs.each_with_index{|(path, label, version), i|
+        message "target #{i}: " + (label == version ? "#{label}" : "#{label} (#{version})") + " at \"#{path}\""
+      }
+    end
+  end
+
+  def adjusted_results name, results
+    s = nil
+    results.each_with_index{|e, i|
+      r = e.min
+      case name
+      when /^vm1_/
+        if @loop_wl1
+          r -= @loop_wl1[i]
+          r = 0 if r < 0
+          s = '*'
+        end
+      when /^vm2_/
+        if @loop_wl2
+          r -= @loop_wl2[i]
+          r = 0 if r < 0
+          s = '*'
+        end
+      end
+      yield r
+    }
+    s
+  end
+
+  def show_results
+    case @opt[:format]
+    when :tsv
+      strformat = "\t%1$s"
+      numformat = "\t%1$*2$.3f"
+      minwidth = 0
+      name_width = 0
+    when :markdown
+      markdown = true
+      strformat = "|%1$-*2$s"
+      numformat = "|%1$*2$.3f"
+    when :plain
+      strformat = " %1$-*2$s"
+      numformat = " %1$*2$.3f"
+    end
+
+    name_width ||= @results.map {|v,*| v.size}.max
+    minwidth ||= 7
+    width = @execs.map{|(_, v)| [v.size, minwidth].max}
+
+    output
+
+    if @verbose
+      message '-----------------------------------------------------------'
+      message 'raw data:'
+      message
+      message PP.pp(@results, "", 79)
+      message
+      message "Elapsed time: #{Time.now - @start_time} (sec)"
+    end
+
+    if rawdata_output = @opt[:rawdata_output]
+      h = {}
+      h[:cpuinfo] = File.read('/proc/cpuinfo') if File.exist?('/proc/cpuinfo')
+      h[:executables] = @execs
+      h[:results] = @results
+      if (type = File.extname(rawdata_output)).empty?
+        type = rawdata_output
+        rawdata_output = @output.path.sub(/\.[^.\/]+\z/, '') << '.' << rawdata_output
+      end
+      case type
+      when 'yaml'
+        require 'yaml'
+        h = YAML.dump(h)
+      when 'json'
+        require 'json'
+        h = JSON.pretty_generate(h)
+      else
+        require 'pp'
+        h = h.pretty_inspect
+      end
+      open(rawdata_output, 'w') {|f| f.puts h}
+    end
+
+    output '-----------------------------------------------------------'
+    output 'benchmark results:'
+
+    if @verbose and @repeat > 1
+      output "minimum results in each #{@repeat} measurements."
+    end
+
+    output "Execution time (sec)"
+    output if markdown
+    output ["name".ljust(name_width), @execs.map.with_index{|(_, v), i| sprintf(strformat, v, width[i])}].join("").rstrip
+    output ["-"*name_width, width.map{|n|":".rjust(n, "-")}].join("|") if markdown
+    @results.each{|v, result|
+      rets = []
+      s = adjusted_results(v, result){|r|
+        rets << sprintf(numformat, r, width[rets.size])
+      }
+      v += s if s
+      output [v.ljust(name_width), rets].join("")
+    }
+
+    if @execs.size > 1
+      output
+      output "Speedup ratio: compare with the result of `#{@execs[0][1]}' (greater is better)"
+      output if markdown
+      output ["name".ljust(name_width), @execs[1..-1].map.with_index{|(_, v), i| sprintf(strformat, v, width[i])}].join("").rstrip
+      output ["-"*name_width, width[1..-1].map{|n|":".rjust(n, "-")}].join("|") if markdown
+      @results.each{|v, result|
+        rets = []
+        first_value = nil
+        s = adjusted_results(v, result){|r|
+          if first_value
+            if r == 0
+              rets << "Error"
+            else
+              rets << sprintf(numformat, first_value/r, width[rets.size+1])
+            end
+          else
+            first_value = r
+          end
+        }
+        v += s if s
+        output [v.ljust(name_width), rets].join("")
+      }
+    end
+
+    if @opt[:output]
+      output
+      output "Log file: #{@opt[:output]}"
+    end
+  end
+
+  def files
+    flag = {}
+    @files = Dir.glob(File.join(@dir, 'bm*.rb')).map{|file|
+      next if @pattern && /#{@pattern}/ !~ File.basename(file)
+      next if @exclude && /#{@exclude}/ =~ File.basename(file)
+      case file
+      when /bm_(vm[12])_/, /bm_loop_(whileloop2?).rb/
+        flag[$1] = true
+      end
+      file
+    }.compact
+
+    if flag['vm1'] && !flag['whileloop']
+      @files << File.join(@dir, 'bm_loop_whileloop.rb')
+    elsif flag['vm2'] && !flag['whileloop2']
+      @files << File.join(@dir, 'bm_loop_whileloop2.rb')
+    end
+
+    @files.sort!
+    progress_message "total: #{@files.size * @repeat} trial(s) (#{@repeat} trial(s) for #{@files.size} benchmark(s))\n"
+    @files
+  end
+
+  def run
+    files.each_with_index{|file, i|
+      @i = i
+      r = measure_file(file)
+
+      if /bm_loop_whileloop.rb/ =~ file
+        @loop_wl1 = r[1].map{|e| e.min}
+      elsif /bm_loop_whileloop2.rb/ =~ file
+        @loop_wl2 = r[1].map{|e| e.min}
+      end
+    }
+  end
+
+  def measure_file file
+    name = File.basename(file, '.rb').sub(/^bm_/, '')
+    prepare_file = File.join(File.dirname(file), "prepare_#{name}.rb")
+    load prepare_file if FileTest.exist?(prepare_file)
+
+    if @verbose
+      output
+      output '-----------------------------------------------------------'
+      output name
+      output
+      output File.read(file)
+      output
+    end
+
+    result = [name]
+    result << @execs.map{|(e, v)|
+      (0...@repeat).map{
+        message_print "#{v}\t"
+        progress_message '.'
+
+        m = measure(e, file)
+        message "#{m}"
+        m
+      }
+    }
+    @results << result
+    result
+  end
+
+  unless defined?(File::NULL)
+    if File.exist?('/dev/null')
+      File::NULL = '/dev/null'
+    end
+  end
+
+  def measure executable, file
+    cmd = "#{executable} #{@ruby_arg} #{file}"
+
+    m = Benchmark.measure{
+      system(cmd, out: File::NULL)
+    }
+
+    if $? != 0
+      output "\`#{cmd}\' exited with abnormal status (#{$?})"
+      0
+    else
+      m.real
+    end
+  end
+end
+
+if __FILE__ == $0
+  opt = {
+    :execs => [],
+    :dir => File.dirname(__FILE__),
+    :repeat => 1,
+    :output => nil,
+    :raw_output => nil,
+    :format => :tsv,
+  }
+  formats = {
+    :tsv => ".tsv",
+    :markdown => ".md",
+    :plain => ".txt",
+  }
+
+  parser = OptionParser.new{|o|
+    o.on('-e', '--executables [EXECS]',
+      "Specify benchmark one or more targets (e1::path1; e2::path2; e3::path3;...)"){|e|
+       e.split(/;/).each{|path|
+         opt[:execs] << path
+       }
+    }
+    o.on('-d', '--directory [DIRECTORY]', "Benchmark suites directory"){|d|
+      opt[:dir] = d
+    }
+    o.on('-p', '--pattern [PATTERN]', "Benchmark name pattern"){|p|
+      opt[:pattern] = p
+    }
+    o.on('-x', '--exclude [PATTERN]', "Benchmark exclude pattern"){|e|
+      opt[:exclude] = e
+    }
+    o.on('-r', '--repeat-count [NUM]', "Repeat count"){|n|
+      opt[:repeat] = n.to_i
+    }
+    o.on('-o', '--output-file [FILE]', "Output file"){|f|
+      opt[:output] = f
+    }
+    o.on('--ruby-arg [ARG]', "Optional argument for ruby"){|a|
+      opt[:ruby_arg] = a
+    }
+    o.on('--rawdata-output [FILE]', 'output rawdata'){|r|
+      opt[:rawdata_output] = r
+    }
+    o.on('--load-rawdata=FILE', 'input rawdata'){|r|
+      opt[:rawdata_input] = r
+    }
+    o.on('-f', "--format=FORMAT", "output format (#{formats.keys.join(",")})", formats.keys){|r|
+      opt[:format] = r
+    }
+    o.on('-v', '--verbose'){|v|
+      opt[:verbose] = v
+    }
+    o.on('-q', '--quiet', "Run without notify information except result table."){|q|
+      opt[:quiet] = q
+      opt[:verbose] = false
+    }
+  }
+
+  parser.parse!(ARGV)
+  opt[:output] ||= "bmlog-#{Time.now.strftime('%Y%m%d-%H%M%S')}.#{$$}#{formats[opt[:format]]}"
+
+  if input = opt[:rawdata_input]
+    b = open(input) {|f|
+      BenchmarkDriver.load(f, File.extname(input)[1..-1], opt)
+    }
+    b.show_results
+  else
+    BenchmarkDriver.benchmark(opt)
+  end
+end
+
diff --git a/benchmark/gc/aobench.rb b/benchmark/gc/aobench.rb
new file mode 100644
index 0000000000..2eed7abc83
--- /dev/null
+++ b/benchmark/gc/aobench.rb
@@ -0,0 +1 @@
+require_relative '../bm_app_aobench.rb'
diff --git a/benchmark/gc/binary_trees.rb b/benchmark/gc/binary_trees.rb
new file mode 100644
index 0000000000..af8ea722aa
--- /dev/null
+++ b/benchmark/gc/binary_trees.rb
@@ -0,0 +1 @@
+require_relative '../bm_so_binary_trees.rb'
diff --git a/benchmark/gc/gcbench.rb b/benchmark/gc/gcbench.rb
new file mode 100644
index 0000000000..09a404466a
--- /dev/null
+++ b/benchmark/gc/gcbench.rb
@@ -0,0 +1,56 @@
+require 'benchmark'
+require 'pp'
+require 'optparse'
+
+$list = true
+$gcprof = true
+
+opt = OptionParser.new
+opt.on('-q'){$list = false}
+opt.on('-d'){$gcprof = false}
+opt.parse!(ARGV)
+
+script = File.join(File.dirname(__FILE__), ARGV.shift)
+script += '.rb' unless FileTest.exist?(script)
+raise "#{script} not found" unless FileTest.exist?(script)
+
+puts "Script: #{script}"
+
+if $gcprof
+  GC::Profiler.enable
+end
+
+tms = Benchmark.measure{|x|
+  load script
+}
+
+gc_time = 0
+
+if $gcprof
+  gc_time = GC::Profiler.total_time
+  GC::Profiler.report if $list and RUBY_VERSION >= '2.0.0' # before 1.9.3, report() may run infinite loop
+  GC::Profiler.disable
+end
+
+pp GC.stat
+
+puts "#{RUBY_DESCRIPTION} #{GC::OPTS.inspect}" if defined?(GC::OPTS)
+
+desc = "#{RUBY_VERSION}#{RUBY_PATCHLEVEL >= 0 ? "p#{RUBY_PATCHLEVEL}" : "dev"}"
+name = File.basename(script, '.rb')
+
+puts
+puts script
+puts Benchmark::CAPTION
+puts tms
+puts "GC total time (sec): #{gc_time}"
+
+# show High-Water Mark on Linux
+if File.exist?('/proc/self/status') && /VmHWM:\s*(\d+.+)/ =~ File.read('/proc/self/status')
+  puts
+  puts "VmHWM: #{$1.chomp}"
+end
+
+puts
+puts "Summary of #{name} on #{desc}\t#{tms.real}\t#{gc_time}\t#{GC.count}"
+puts "         (real time in sec, GC time in sec, GC count)"
diff --git a/benchmark/gc/hash1.rb b/benchmark/gc/hash1.rb
new file mode 100644
index 0000000000..cb030d458d
--- /dev/null
+++ b/benchmark/gc/hash1.rb
@@ -0,0 +1,11 @@
+value = 0.01
+h = {}
+n = 50_000
+
+1.upto(n){|i|
+  h["%020d" % i] = "v-#{i}"
+}
+
+(n * 1_000).times{
+  ''
+}
diff --git a/benchmark/gc/hash2.rb b/benchmark/gc/hash2.rb
new file mode 100644
index 0000000000..e8c943fb21
--- /dev/null
+++ b/benchmark/gc/hash2.rb
@@ -0,0 +1,7 @@
+value = 0.01
+h = {}
+n = 4*(10**6)
+
+1.upto(n){|i|
+  h["%020d" % i] = value * i
+}
diff --git a/benchmark/gc/null.rb b/benchmark/gc/null.rb
new file mode 100644
index 0000000000..c05a79f561
--- /dev/null
+++ b/benchmark/gc/null.rb
@@ -0,0 +1 @@
+# null
diff --git a/benchmark/gc/pentomino.rb b/benchmark/gc/pentomino.rb
new file mode 100644
index 0000000000..94ba74be89
--- /dev/null
+++ b/benchmark/gc/pentomino.rb
@@ -0,0 +1 @@
+require_relative '../bm_app_pentomino.rb'
diff --git a/benchmark/gc/rdoc.rb b/benchmark/gc/rdoc.rb
new file mode 100644
index 0000000000..14c89f5611
--- /dev/null
+++ b/benchmark/gc/rdoc.rb
@@ -0,0 +1,13 @@
+require 'rdoc/rdoc'
+require 'tmpdir'
+
+srcdir = File.expand_path('../..', __dir__)
+
+Dir.mktmpdir('rdocbench-'){|d|
+  dir = File.join(d, 'rdocbench')
+  args = %W(--root #{srcdir} --page-dir #{srcdir}/doc --encoding=UTF-8 --no-force-update --all --ri --debug --quiet #{srcdir})
+  args << '--op' << dir
+
+  r = RDoc::RDoc.new
+  r.document args
+}
diff --git a/benchmark/gc/redblack.rb b/benchmark/gc/redblack.rb
new file mode 100644
index 0000000000..c66290140a
--- /dev/null
+++ b/benchmark/gc/redblack.rb
@@ -0,0 +1,366 @@
+# This benchmark is imported from https://github.com/jruby/rubybench/blob/master/time/bench_red_black.rb
+# License is License is Apache-2
+
+require 'benchmark'
+
+# Algorithm based on "Introduction to Algorithms" by Cormen and others
+class RedBlackTree
+  class Node
+    attr_accessor :color
+    attr_accessor :key
+    attr_accessor :left
+    attr_accessor :right
+    attr_accessor :parent
+
+    RED = :red
+    BLACK = :black
+    COLORS = [RED, BLACK].freeze
+
+    def initialize(key, color = RED)
+      raise ArgumentError, "Bad value for color parameter" unless COLORS.include?(color)
+      @color = color
+      @key = key
+      @left = @right = @parent = NilNode.instance
+    end
+
+    def black?
+      return color == BLACK
+    end
+
+    def red?
+      return color == RED
+    end
+  end
+
+  class NilNode < Node
+    class << self
+      private :new
+
+      # it's not thread safe
+      def instance
+        @instance ||= begin
+          def instance
+            return @instance
+          end
+
+          new
+        end
+      end
+    end
+
+    def initialize
+      self.color = BLACK
+      self.key = 0
+      self.left = nil
+      self.right = nil
+      self.parent = nil
+    end
+
+    def nil?
+      return true
+    end
+  end
+
+  include Enumerable
+
+  attr_accessor :root
+  attr_accessor :size
+
+  def initialize
+    self.root = NilNode.instance
+    self.size = 0
+  end
+
+  def add(key)
+    insert(Node.new(key))
+  end
+
+  def insert(x)
+    insert_helper(x)
+
+    x.color = Node::RED
+    while x != root && x.parent.color == Node::RED
+      if x.parent == x.parent.parent.left
+        y = x.parent.parent.right
+        if !y.nil? && y.color == Node::RED
+          x.parent.color = Node::BLACK
+          y.color = Node::BLACK
+          x.parent.parent.color = Node::RED
+          x = x.parent.parent
+        else
+          if x == x.parent.right
+            x = x.parent
+            left_rotate(x)
+          end
+          x.parent.color = Node::BLACK
+          x.parent.parent.color = Node::RED
+          right_rotate(x.parent.parent)
+        end
+      else
+        y = x.parent.parent.left
+        if !y.nil? && y.color == Node::RED
+          x.parent.color = Node::BLACK
+          y.color = Node::BLACK
+          x.parent.parent.color = Node::RED
+          x = x.parent.parent
+        else
+          if x == x.parent.left
+            x = x.parent
+            right_rotate(x)
+          end
+          x.parent.color = Node::BLACK
+          x.parent.parent.color = Node::RED
+          left_rotate(x.parent.parent)
+        end
+      end
+    end
+    root.color = Node::BLACK
+  end
+
+  alias << insert
+
+  def delete(z)
+    y = (z.left.nil? || z.right.nil?) ? z : successor(z)
+    x = y.left.nil? ? y.right : y.left
+    x.parent = y.parent
+
+    if y.parent.nil?
+      self.root = x
+    else
+      if y == y.parent.left
+        y.parent.left = x
+      else
+        y.parent.right = x
+      end
+    end
+
+    z.key = y.key if y != z
+
+    if y.color == Node::BLACK
+      delete_fixup(x)
+    end
+
+    self.size -= 1
+    return y
+  end
+
+  def minimum(x = root)
+    while !x.left.nil?
+      x = x.left
+    end
+    return x
+  end
+
+  def maximum(x = root)
+    while !x.right.nil?
+      x = x.right
+    end
+    return x
+  end
+
+  def successor(x)
+    if !x.right.nil?
+      return minimum(x.right)
+    end
+    y = x.parent
+    while !y.nil? && x == y.right
+      x = y
+      y = y.parent
+    end
+    return y
+  end
+
+  def predecessor(x)
+    if !x.left.nil?
+      return maximum(x.left)
+    end
+    y = x.parent
+    while !y.nil? && x == y.left
+      x = y
+      y = y.parent
+    end
+    return y
+  end
+
+  def inorder_walk(x = root)
+    x = self.minimum
+    while !x.nil?
+      yield x.key
+      x = successor(x)
+    end
+  end
+
+  alias each inorder_walk
+
+  def reverse_inorder_walk(x = root)
+    x = self.maximum
+    while !x.nil?
+      yield x.key
+      x = predecessor(x)
+    end
+  end
+
+  alias reverse_each reverse_inorder_walk
+
+  def search(key, x = root)
+    while !x.nil? && x.key != key
+      key < x.key ? x = x.left : x = x.right
+    end
+    return x
+  end
+
+  def empty?
+    return self.root.nil?
+  end
+
+  def black_height(x = root)
+    height = 0
+    while !x.nil?
+      x = x.left
+      height +=1 if x.nil? || x.black?
+    end
+    return height
+  end
+
+private
+
+  def left_rotate(x)
+    raise "x.right is nil!" if x.right.nil?
+    y = x.right
+    x.right = y.left
+    y.left.parent = x if !y.left.nil?
+    y.parent = x.parent
+    if x.parent.nil?
+      self.root = y
+    else
+      if x == x.parent.left
+        x.parent.left = y
+      else
+        x.parent.right = y
+      end
+    end
+    y.left = x
+    x.parent = y
+  end
+
+  def right_rotate(x)
+    raise "x.left is nil!" if x.left.nil?
+    y = x.left
+    x.left = y.right
+    y.right.parent = x if !y.right.nil?
+    y.parent = x.parent
+    if x.parent.nil?
+      self.root = y
+    else
+      if x == x.parent.left
+        x.parent.left = y
+      else
+        x.parent.right = y
+      end
+    end
+    y.right = x
+    x.parent = y
+  end
+
+  def insert_helper(z)
+    y = NilNode.instance
+    x = root
+    while !x.nil?
+      y = x
+      z.key < x.key ? x = x.left : x = x.right
+    end
+    z.parent = y
+    if y.nil?
+      self.root = z
+    else
+      z.key < y.key ? y.left = z : y.right = z
+    end
+    self.size += 1
+  end
+
+  def delete_fixup(x)
+    while x != root && x.color == Node::BLACK
+      if x == x.parent.left
+        w = x.parent.right
+        if w.color == Node::RED
+          w.color = Node::BLACK
+          x.parent.color = Node::RED
+          left_rotate(x.parent)
+          w = x.parent.right
+        end
+        if w.left.color == Node::BLACK && w.right.color == Node::BLACK
+          w.color = Node::RED
+          x = x.parent
+        else
+          if w.right.color == Node::BLACK
+            w.left.color = Node::BLACK
+            w.color = Node::RED
+            right_rotate(w)
+            w = x.parent.right
+          end
+          w.color = x.parent.color
+          x.parent.color = Node::BLACK
+          w.right.color = Node::BLACK
+          left_rotate(x.parent)
+          x = root
+        end
+      else
+        w = x.parent.left
+        if w.color == Node::RED
+          w.color = Node::BLACK
+          x.parent.color = Node::RED
+          right_rotate(x.parent)
+          w = x.parent.left
+        end
+        if w.right.color == Node::BLACK && w.left.color == Node::BLACK
+          w.color = Node::RED
+          x = x.parent
+        else
+          if w.left.color == Node::BLACK
+            w.right.color = Node::BLACK
+            w.color = Node::RED
+            left_rotate(w)
+            w = x.parent.left
+          end
+          w.color = x.parent.color
+          x.parent.color = Node::BLACK
+          w.left.color = Node::BLACK
+          right_rotate(x.parent)
+          x = root
+        end
+      end
+    end
+    x.color = Node::BLACK
+  end
+end
+
+def rbt_bm
+  n = 100_000
+  a1 = []; n.times { a1 << rand(999_999) }
+  a2 = []; n.times { a2 << rand(999_999) }
+
+  start = Time.now
+
+  tree = RedBlackTree.new
+
+  n.times {|i| tree.add(i) }
+  n.times { tree.delete(tree.root) }
+
+  tree = RedBlackTree.new
+  a1.each {|e| tree.add(e) }
+  a2.each {|e| tree.search(e) }
+  tree.inorder_walk {|key| key + 1 }
+  tree.reverse_inorder_walk {|key| key + 1 }
+  n.times { tree.minimum }
+  n.times { tree.maximum }
+
+  return Time.now - start
+end
+
+N = (ARGV[0] || 10).to_i
+
+N.times do
+  # puts rbt_bm.to_f
+  rbt_bm.to_f
+  # puts "GC.count = #{GC.count}" if GC.respond_to?(:count)
+end
diff --git a/benchmark/gc/ring.rb b/benchmark/gc/ring.rb
new file mode 100644
index 0000000000..be2c7b7250
--- /dev/null
+++ b/benchmark/gc/ring.rb
@@ -0,0 +1,29 @@
+# create many old objects
+
+max = 30_000_000
+
+class Ring
+  attr_reader :next_ring
+  def initialize n = nil
+    @next_ring = n
+  end
+
+
+  def size
+    s = 1
+    ring = self
+    while ring.next_ring
+      s += 1
+      ring = ring.next_ring
+    end
+    s
+  end
+end
+
+ring = Ring.new
+
+max.times{
+  ring = Ring.new(ring)
+}
+
+# p ring.size
diff --git a/benchmark/make_fasta_output.rb b/benchmark/make_fasta_output.rb
new file mode 100644
index 0000000000..b6d787ae27
--- /dev/null
+++ b/benchmark/make_fasta_output.rb
@@ -0,0 +1,19 @@
+# prepare 'fasta.output'
+
+def prepare_fasta_output n
+  filebase = File.join(File.dirname($0), 'fasta.output')
+  script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+  file = "#{filebase}.#{n}"
+
+  unless FileTest.exist?(file)
+    STDERR.puts "preparing #{file}"
+
+    open(file, 'w'){|f|
+      ARGV[0] = n
+      $stdout = f
+      load script
+      $stdout = STDOUT
+    }
+  end
+end
+
diff --git a/benchmark/other-lang/ack.pl b/benchmark/other-lang/ack.pl
new file mode 100644
index 0000000000..201e22ddfa
--- /dev/null
+++ b/benchmark/other-lang/ack.pl
@@ -0,0 +1,11 @@
+use integer;
+
+sub Ack {
+    return $_[0] ? ($_[1] ? Ack($_[0]-1, Ack($_[0], $_[1]-1))
+		    : Ack($_[0]-1, 1))
+	: $_[1]+1;
+}
+
+my $NUM = 9;
+$NUM = 1 if ($NUM < 1);
+my $ack = Ack(3, $NUM);
diff --git a/benchmark/other-lang/ack.py b/benchmark/other-lang/ack.py
new file mode 100644
index 0000000000..9968e7cfcf
--- /dev/null
+++ b/benchmark/other-lang/ack.py
@@ -0,0 +1,16 @@
+import sys
+sys.setrecursionlimit(5000000)
+
+def Ack(M, N):
+    if (not M):
+        return( N + 1 )
+    if (not N):
+        return( Ack(M-1, 1) )
+    return( Ack(M-1, Ack(M, N-1)) )
+
+def main():
+    NUM = 9
+    sys.setrecursionlimit(10000)
+    Ack(3, NUM)
+
+main()
diff --git a/benchmark/other-lang/ack.rb b/benchmark/other-lang/ack.rb
new file mode 100644
index 0000000000..7451bed6c4
--- /dev/null
+++ b/benchmark/other-lang/ack.rb
@@ -0,0 +1,12 @@
+def ack(m, n)
+    if m == 0 then
+        n + 1
+    elsif n == 0 then
+        ack(m - 1, 1)
+    else
+        ack(m - 1, ack(m, n - 1))
+    end
+end
+
+NUM = 9
+ack(3, NUM)
diff --git a/benchmark/other-lang/ack.scm b/benchmark/other-lang/ack.scm
new file mode 100644
index 0000000000..a80b73ba55
--- /dev/null
+++ b/benchmark/other-lang/ack.scm
@@ -0,0 +1,7 @@
+(define (ack m n)
+  (cond ((zero? m) (+ n 1))
+	((zero? n) (ack (- m 1) 1))
+	(else      (ack (- m 1) (ack m (- n 1))))))
+
+(ack 3 9)
+
diff --git a/benchmark/other-lang/eval.rb b/benchmark/other-lang/eval.rb
new file mode 100644
index 0000000000..48a2cea019
--- /dev/null
+++ b/benchmark/other-lang/eval.rb
@@ -0,0 +1,66 @@
+
+Bench = %w(
+  loop
+  ack
+  fib
+  tak
+  fact
+)
+
+Lang = <<EOP.map{|l| l.strip}
+  ruby-cyg
+  ../../../test6/miniruby
+  perl
+  python
+  gosh
+EOP
+
+Bench.replace ['loop2']
+Lang.replace ['ruby-cyg']
+
+Ext = %w(
+  .rb
+  .rb
+  .pl
+  .py
+  .scm
+)
+
+p Bench
+p Lang
+
+require 'benchmark'
+
+def bench cmd
+  m = Benchmark.measure{
+    #p cmd
+    system(cmd)
+  }
+  [m.utime, m.real]
+end
+
+Result = []
+Bench.each{|b|
+  r = []
+  Lang.each_with_index{|l, idx|
+    cmd = "#{l} #{b}#{Ext[idx]}"
+    r << bench(cmd)
+  }
+  Result << r
+}
+
+require 'pp'
+# utime
+puts Lang.join("\t")
+Bench.each_with_index{|b, bi|
+  print b, "\t"
+  puts Result[bi].map{|e| e[0]}.join("\t")
+}
+
+# rtime
+puts Lang.join("\t")
+Bench.each_with_index{|b, bi|
+  print b, "\t"
+  puts Result[bi].map{|e| e[1]}.join("\t")
+}
+
diff --git a/benchmark/other-lang/fact.pl b/benchmark/other-lang/fact.pl
new file mode 100644
index 0000000000..a9b0b69cdf
--- /dev/null
+++ b/benchmark/other-lang/fact.pl
@@ -0,0 +1,13 @@
+sub fact{
+  my $n = @_[0];
+  if($n < 2){
+    return 1;
+  }
+  else{
+    return $n * fact($n-1);
+  }
+}
+
+for($i=0; $i<10000; $i++){
+  &fact(100);
+}
diff --git a/benchmark/other-lang/fact.py b/benchmark/other-lang/fact.py
new file mode 100644
index 0000000000..01593965d9
--- /dev/null
+++ b/benchmark/other-lang/fact.py
@@ -0,0 +1,18 @@
+#import sys
+#sys.setrecursionlimit(1000)
+
+def factL(n):
+	r = 1
+	for x in range(2, n):
+		r *= x
+	return r
+
+def factR(n):
+	if n < 2:
+		return 1
+	else:
+		return n * factR(n-1)
+
+for i in range(10000):
+	factR(100)
+
diff --git a/benchmark/other-lang/fact.rb b/benchmark/other-lang/fact.rb
new file mode 100644
index 0000000000..6cedc752cd
--- /dev/null
+++ b/benchmark/other-lang/fact.rb
@@ -0,0 +1,13 @@
+def fact(n)
+  if n < 2
+    1
+  else
+    n * fact(n-1)
+  end
+end
+
+i = 0
+while i<10000
+  i += 1
+  fact(100)
+end
diff --git a/benchmark/other-lang/fact.scm b/benchmark/other-lang/fact.scm
new file mode 100644
index 0000000000..c98a7fedd3
--- /dev/null
+++ b/benchmark/other-lang/fact.scm
@@ -0,0 +1,8 @@
+(define (fact n)
+        (if (< n 2)
+            1
+          (* n (fact (- n 1)))))
+
+(dotimes (i 10000)
+  (fact 100))
+
diff --git a/benchmark/other-lang/fib.pl b/benchmark/other-lang/fib.pl
new file mode 100644
index 0000000000..a46f666d1e
--- /dev/null
+++ b/benchmark/other-lang/fib.pl
@@ -0,0 +1,11 @@
+sub fib{
+  my $n = $_[0];
+  if($n < 3){
+    return 1;
+  }
+  else{
+    return fib($n-1) + fib($n-2);
+  }
+};
+
+&fib(34);
diff --git a/benchmark/other-lang/fib.py b/benchmark/other-lang/fib.py
new file mode 100644
index 0000000000..45f2bceb8d
--- /dev/null
+++ b/benchmark/other-lang/fib.py
@@ -0,0 +1,7 @@
+def fib(n):
+  if n < 3:
+    return 1
+  else:
+    return fib(n-1) + fib(n-2)
+
+fib(34)
diff --git a/benchmark/other-lang/fib.rb b/benchmark/other-lang/fib.rb
new file mode 100644
index 0000000000..ec587eabe0
--- /dev/null
+++ b/benchmark/other-lang/fib.rb
@@ -0,0 +1,9 @@
+def fib n
+  if n < 3
+    1
+  else
+    fib(n-1) + fib(n-2)
+  end
+end
+
+fib(34)
diff --git a/benchmark/other-lang/fib.scm b/benchmark/other-lang/fib.scm
new file mode 100644
index 0000000000..2fc4e225bd
--- /dev/null
+++ b/benchmark/other-lang/fib.scm
@@ -0,0 +1,7 @@
+(define (fib n)
+        (if (< n 3)
+            1
+          (+ (fib (- n 1)) (fib (- n 2)))))
+
+(fib 34)
+
diff --git a/benchmark/other-lang/loop.pl b/benchmark/other-lang/loop.pl
new file mode 100644
index 0000000000..2777490aaa
--- /dev/null
+++ b/benchmark/other-lang/loop.pl
@@ -0,0 +1,3 @@
+for($i=0; $i<30000000; $i++){
+}
+
diff --git a/benchmark/other-lang/loop.py b/benchmark/other-lang/loop.py
new file mode 100644
index 0000000000..003749bf3a
--- /dev/null
+++ b/benchmark/other-lang/loop.py
@@ -0,0 +1,2 @@
+for i in xrange(30000000):
+	pass
diff --git a/benchmark/other-lang/loop.rb b/benchmark/other-lang/loop.rb
new file mode 100644
index 0000000000..b367b9dbf3
--- /dev/null
+++ b/benchmark/other-lang/loop.rb
@@ -0,0 +1,4 @@
+i = 0
+while i<30000000
+  i += 1
+end
diff --git a/benchmark/other-lang/loop.scm b/benchmark/other-lang/loop.scm
new file mode 100644
index 0000000000..3364f7e679
--- /dev/null
+++ b/benchmark/other-lang/loop.scm
@@ -0,0 +1 @@
+(dotimes (x 30000000))
diff --git a/benchmark/other-lang/loop2.rb b/benchmark/other-lang/loop2.rb
new file mode 100644
index 0000000000..df8fffc1ff
--- /dev/null
+++ b/benchmark/other-lang/loop2.rb
@@ -0,0 +1 @@
+30000000.times{}
diff --git a/benchmark/other-lang/tak.pl b/benchmark/other-lang/tak.pl
new file mode 100644
index 0000000000..7e748a67c6
--- /dev/null
+++ b/benchmark/other-lang/tak.pl
@@ -0,0 +1,11 @@
+sub tak {
+    local($x, $y, $z) = @_;
+    if (!($y < $x)) {
+	return $z;
+    } else {
+	return &tak(&tak($x - 1, $y, $z),
+		    &tak($y - 1, $z, $x),
+		    &tak($z - 1, $x, $y));
+    }
+}
+&tak(18, 9, 0);
diff --git a/benchmark/other-lang/tak.py b/benchmark/other-lang/tak.py
new file mode 100644
index 0000000000..04f3f6829c
--- /dev/null
+++ b/benchmark/other-lang/tak.py
@@ -0,0 +1,8 @@
+def tak(x, y, z):
+	if not(y<x):
+		return z
+	else:
+		return tak(tak(x-1, y, z),
+		           tak(y-1, z, x),
+		           tak(z-1, x, y))
+tak(18, 9, 0)
diff --git a/benchmark/other-lang/tak.rb b/benchmark/other-lang/tak.rb
new file mode 100644
index 0000000000..efe5380f4e
--- /dev/null
+++ b/benchmark/other-lang/tak.rb
@@ -0,0 +1,13 @@
+
+def tak x, y, z
+  unless y < x
+    z
+  else
+    tak( tak(x-1, y, z),
+         tak(y-1, z, x),
+         tak(z-1, x, y))
+  end
+end
+
+tak(18, 9, 0)
+
diff --git a/benchmark/other-lang/tak.scm b/benchmark/other-lang/tak.scm
new file mode 100644
index 0000000000..52a7629ee5
--- /dev/null
+++ b/benchmark/other-lang/tak.scm
@@ -0,0 +1,10 @@
+(define (tak x y z)
+        (if (not (< y x))
+            z
+          (tak (tak (- x 1) y z)
+               (tak (- y 1) z x)
+               (tak (- z 1) x y))))
+
+(tak 18 9 0)
+
+
diff --git a/benchmark/prepare_require.rb b/benchmark/prepare_require.rb
new file mode 100644
index 0000000000..c4786f04ad
--- /dev/null
+++ b/benchmark/prepare_require.rb
@@ -0,0 +1,25 @@
+require "fileutils"
+
+def prepare
+  num_files = 10000
+
+  basename = File.dirname($0)
+  data_dir = File.join(basename, "bm_require.data")
+
+  # skip if all of files exists
+  if File.exist?(File.join(data_dir, "c#{num_files}.rb"))
+    return
+  end
+
+  FileUtils.mkdir_p(data_dir)
+
+  1.upto(num_files) do |i|
+    f = File.open("#{data_dir}/c#{i}.rb", "w")
+    f.puts <<-END
+      class C#{i}
+      end
+    END
+  end
+end
+
+prepare
diff --git a/benchmark/prepare_require_thread.rb b/benchmark/prepare_require_thread.rb
new file mode 100644
index 0000000000..339ecb8b39
--- /dev/null
+++ b/benchmark/prepare_require_thread.rb
@@ -0,0 +1,2 @@
+load File.join(File.dirname(__FILE__), "prepare_require.rb")
+
diff --git a/benchmark/prepare_so_count_words.rb b/benchmark/prepare_so_count_words.rb
new file mode 100644
index 0000000000..ee2138cdb2
--- /dev/null
+++ b/benchmark/prepare_so_count_words.rb
@@ -0,0 +1,15 @@
+# prepare 'wc.input'
+
+def prepare_wc_input
+  wcinput = File.join(File.dirname($0), 'wc.input')
+  wcbase  = File.join(File.dirname($0), 'wc.input.base')
+  unless FileTest.exist?(wcinput)
+    data = File.read(wcbase)
+    13.times{
+      data << data
+    }
+    open(wcinput, 'w'){|f| f.write data}
+  end
+end
+
+prepare_wc_input
diff --git a/benchmark/prepare_so_k_nucleotide.rb b/benchmark/prepare_so_k_nucleotide.rb
new file mode 100644
index 0000000000..d83aeb7a7e
--- /dev/null
+++ b/benchmark/prepare_so_k_nucleotide.rb
@@ -0,0 +1,2 @@
+require_relative 'make_fasta_output'
+prepare_fasta_output(100_000)
diff --git a/benchmark/prepare_so_reverse_complement.rb b/benchmark/prepare_so_reverse_complement.rb
new file mode 100644
index 0000000000..da3ec2df14
--- /dev/null
+++ b/benchmark/prepare_so_reverse_complement.rb
@@ -0,0 +1,2 @@
+require_relative 'make_fasta_output'
+prepare_fasta_output(2_500_000)
diff --git a/benchmark/report.rb b/benchmark/report.rb
new file mode 100644
index 0000000000..d2dc56b1e1
--- /dev/null
+++ b/benchmark/report.rb
@@ -0,0 +1,79 @@
+#
+# YARV benchmark driver
+#
+
+require 'yarvutil'
+require 'benchmark'
+require 'rbconfig'
+
+def exec_command type, file, w
+  <<-EOP
+  $DRIVER_PATH = '#{File.dirname($0)}'
+  $LOAD_PATH.replace $LOAD_PATH | #{$LOAD_PATH.inspect}
+  require 'benchmark'
+  require 'yarvutil'
+#  print '#{type}'
+  begin
+    puts Benchmark.measure{
+      #{w}('#{file}')
+    }.utime
+  rescue Exception => exec_command_error_variable
+    puts "\t" + exec_command_error_variable.message
+  end
+  EOP
+end
+
+def benchmark cmd
+  rubybin = ENV['RUBY'] || RbConfig.ruby
+
+  IO.popen(rubybin, 'r+'){|io|
+    io.write cmd
+    io.close_write
+    return io.gets
+  }
+end
+
+def ruby_exec file
+  prog = exec_command 'ruby', file, 'load'
+  benchmark prog
+end
+
+def yarv_exec file
+  prog = exec_command 'yarv', file, 'YARVUtil.load_bm'
+  benchmark prog
+end
+
+$wr = $wy = nil
+
+def measure bench
+  file = File.dirname($0) + "/bm_#{bench}.rb"
+  r = ruby_exec(file).to_f
+  y = yarv_exec(file).to_f
+  puts "#{bench}\t#{r}\t#{y}"
+end
+
+def measure2
+  r = ruby_exec.to_f
+  y = yarv_exec.to_f
+  puts r/y
+end
+
+if $0 == __FILE__
+  %w{
+    whileloop
+    whileloop2
+    times
+    const
+    method
+    poly_method
+    block
+    rescue
+    rescue2
+  }.each{|bench|
+    measure bench
+  }
+end
+
+
+
+
diff --git a/benchmark/run.rb b/benchmark/run.rb
new file mode 100644
index 0000000000..0cd2363849
--- /dev/null
+++ b/benchmark/run.rb
@@ -0,0 +1,127 @@
+#
+# Ruby benchmark driver
+#
+
+require 'benchmark'
+require 'rbconfig'
+
+$matzrubyonly = false
+$rubyonly = false
+
+$results  = []
+
+# prepare 'wc.input'
+def prepare_wc_input
+  wcinput = File.join(File.dirname($0), 'wc.input')
+  wcbase  = File.join(File.dirname($0), 'wc.input.base')
+  unless FileTest.exist?(wcinput)
+    data = File.read(wcbase)
+    13.times{
+      data << data
+    }
+    open(wcinput, 'w'){|f| f.write data}
+  end
+end
+
+prepare_wc_input
+
+def bm file
+  prog = File.readlines(file).map{|e| e.rstrip}.join("\n")
+  return if prog.empty?
+
+  /[a-z]+_(.+)\.rb/ =~ file
+  bm_name = $1
+  puts '-----------------------------------------------------------' unless $rubyonly || $matzrubyonly
+  puts "#{bm_name}: "
+
+
+puts <<EOS unless $matzrubyonly || $rubyonly
+#{prog}
+--
+EOS
+  begin
+    result = [bm_name]
+    result << matzruby_exec(file) unless $rubyonly
+    result << ruby_exec(file) unless $matzrubyonly
+    $results << result
+
+  rescue Exception => e
+    puts
+    puts "** benchmark failure: #{e}"
+    puts e.backtrace
+  end
+end
+
+def benchmark file, bin
+  m = Benchmark.measure{
+    `#{bin} #{$opts} #{file}`
+  }
+  sec = '%.3f' % m.real
+  puts " #{sec}"
+  sec
+end
+
+def ruby_exec file
+  print 'ruby'
+  benchmark file, $ruby_program
+end
+
+def matzruby_exec file
+  print 'matz'
+  rubylib = ENV['RUBYLIB']
+  ENV['RUBYLIB'] = ''
+  r = benchmark file, $matzruby_program
+  ENV['RUBYLIB'] = rubylib
+  r
+end
+
+if $0 == __FILE__
+  ARGV.each{|arg|
+    case arg
+    when /\A--ruby=(.+)/
+      $ruby_program = $1
+    when /\A--matzruby=(.+)/
+      $matzruby_program = $1
+    when /\A--opts=(.+)/
+      $opts = $1
+    when /\A(-r|--only-ruby)\z/
+      $rubyonly = true
+    when /\A(-m|--only-matzruby)\z/
+      $matzrubyonly = true
+    end
+  }
+  ARGV.delete_if{|arg|
+    /\A-/ =~ arg
+  }
+
+  puts "MatzRuby:"
+  system("#{$matzruby_program} -v")
+  puts "Ruby:"
+  system("#{$ruby_program} -v")
+  puts
+
+  if ARGV.empty?
+    Dir.glob(File.dirname(__FILE__) + '/bm_*.rb').sort.each{|file|
+      bm file
+    }
+  else
+    ARGV.each{|file|
+      Dir.glob(File.join(File.dirname(__FILE__), file + '*')){|ef|
+        # file = "#{File.dirname(__FILE__)}/#{file}.rb"
+        bm ef
+      }
+    }
+  end
+
+  puts
+  puts "-- benchmark summary ---------------------------"
+  $results.each{|res|
+    print res.shift, "\t"
+    (res||[]).each{|result|
+      /([\d\.]+)/ =~ result
+      print $1 + "\t" if $1
+    }
+    puts
+  }
+end
+
diff --git a/benchmark/runc.rb b/benchmark/runc.rb
new file mode 100644
index 0000000000..97c5cef045
--- /dev/null
+++ b/benchmark/runc.rb
@@ -0,0 +1,27 @@
+#
+#
+#
+
+require 'benchmark'
+require 'rbconfig'
+
+$rubybin = ENV['RUBY'] || RbConfig.ruby
+
+def runfile file
+  puts file
+  file = File.join(File.dirname($0), 'contrib', file)
+  Benchmark.bm{|x|
+    x.report('ruby'){
+      system("#{$rubybin} #{file}")
+    }
+    x.report('yarv'){
+      system("#{$rubybin} -rite -I.. #{file}")
+    }
+  }
+end
+
+ARGV.each{|file|
+  runfile file
+}
+
+
diff --git a/benchmark/wc.input.base b/benchmark/wc.input.base
new file mode 100644
index 0000000000..41143fbac0
--- /dev/null
+++ b/benchmark/wc.input.base
@@ -0,0 +1,25 @@
+Subject:      Re: Who was Izchak Miller?
+From:         "Jane D. Anonymous" <nobody@yale.edu>
+Date:         1996/04/28
+Message-Id:   <4lv7bc$oh@news.ycc.yale.edu>
+References:   <317C405E.5DFA@panix.com> <4lk6vl$gde@ns.oar.net>
+To:           75176.2330@compuserve.com
+Content-Type: text/plain; charset=us-ascii
+Organization: Yale University
+X-Url:        news:4lk6vl$gde@ns.oar.net
+Mime-Version: 1.0
+Newsgroups:   rec.games.roguelike.nethack
+X-Mailer:     Mozilla 1.1N (Macintosh; I; 68K)
+
+Hello there, Izchak Miller was my father.  When I was younger I spent 
+many a night, hunched over the keyboard with a cup of tea, playing 
+nethack with him and my brother.  my dad was a philosopher with a strong 
+weakness for fantasy/sci fi.  I remember when he started to get involved 
+with the Nethack team- my brother's Dungeons and Dragons monster book 
+found a regular place beside my dad's desk. it's nice to see him living 
+on in the game he loved so much :-).  
+                                                                  Tamar Miller
+
+The following is a really long word of 5000 characters:
+
+wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww
diff --git a/bignum.c b/bignum.c
index 84bda92821..38380f6c4e 100644
--- a/bignum.c
+++ b/bignum.c
@@ -1,372 +1,5097 @@
-/************************************************
+/**********************************************************************
 
   bignum.c -
 
-  $Author: matz $
-  $Date: 1995/01/10 10:42:19 $
+  $Author$
   created at: Fri Jun 10 00:48:55 JST 1994
 
-************************************************/
+  Copyright (C) 1993-2007 Yukihiro Matsumoto
 
-#include "ruby.h"
-#include <ctype.h>
+**********************************************************************/
+
+#include "internal.h"
+#include "ruby/thread.h"
+#include "ruby/util.h"
+
+#ifdef HAVE_STRINGS_H
+#include <strings.h>
+#endif
 #include <math.h>
+#include <float.h>
+#include <ctype.h>
+#ifdef HAVE_IEEEFP_H
+#include <ieeefp.h>
+#endif
+#include <assert.h>
 
-extern VALUE C_Integer;
-VALUE C_Bignum;
+#if defined(HAVE_LIBGMP) && defined(HAVE_GMP_H)
+#define USE_GMP
+#include <gmp.h>
+#endif
 
-#define BDIGITS(x) RBIGNUM(x)->digits
-#define BITSPERDIG (sizeof(USHORT)*CHAR_BIT)
-#define BIGRAD (1L << BITSPERDIG)
-#define DIGSPERLONG ((UINT)(sizeof(long)/sizeof(USHORT)))
-#define BIGUP(x) ((unsigned long)(x) << BITSPERDIG)
-#define BIGDN(x) ((x) >> BITSPERDIG)
-#define BIGLO(x) ((x) & (BIGRAD-1))
+#define RB_BIGNUM_TYPE_P(x) RB_TYPE_P((x), T_BIGNUM)
 
-#define MAX(a,b) ((a)>(b)?(a):(b))
-#define MIN(a,b) ((a)<(b)?(a):(b))
+VALUE rb_cBignum;
+const char ruby_digitmap[] = "0123456789abcdefghijklmnopqrstuvwxyz";
 
-static VALUE
-bignew_1(class, len, sign)
-    VALUE class;
-    UINT len;
-    char sign;
+#ifndef SIZEOF_BDIGIT_DBL
+# if SIZEOF_INT*2 <= SIZEOF_LONG_LONG
+#  define SIZEOF_BDIGIT_DBL SIZEOF_LONG_LONG
+# else
+#  define SIZEOF_BDIGIT_DBL SIZEOF_LONG
+# endif
+#endif
+
+STATIC_ASSERT(sizeof_bdigit_dbl, sizeof(BDIGIT_DBL) == SIZEOF_BDIGIT_DBL);
+STATIC_ASSERT(sizeof_bdigit_dbl_signed, sizeof(BDIGIT_DBL_SIGNED) == SIZEOF_BDIGIT_DBL);
+STATIC_ASSERT(sizeof_bdigit, SIZEOF_BDIGIT <= sizeof(BDIGIT));
+STATIC_ASSERT(sizeof_bdigit_and_dbl, SIZEOF_BDIGIT*2 <= SIZEOF_BDIGIT_DBL);
+STATIC_ASSERT(bdigit_signedness, 0 < (BDIGIT)-1);
+STATIC_ASSERT(bdigit_dbl_signedness, 0 < (BDIGIT_DBL)-1);
+STATIC_ASSERT(bdigit_dbl_signed_signedness, 0 > (BDIGIT_DBL_SIGNED)-1);
+STATIC_ASSERT(rbignum_embed_len_max, BIGNUM_EMBED_LEN_MAX <= (BIGNUM_EMBED_LEN_MASK >> BIGNUM_EMBED_LEN_SHIFT));
+
+#if SIZEOF_BDIGIT < SIZEOF_LONG
+STATIC_ASSERT(sizeof_long_and_sizeof_bdigit, SIZEOF_LONG % SIZEOF_BDIGIT == 0);
+#else
+STATIC_ASSERT(sizeof_long_and_sizeof_bdigit, SIZEOF_BDIGIT % SIZEOF_LONG == 0);
+#endif
+
+#ifdef WORDS_BIGENDIAN
+#   define HOST_BIGENDIAN_P 1
+#else
+#   define HOST_BIGENDIAN_P 0
+#endif
+#define ALIGNOF(type) ((int)offsetof(struct { char f1; type f2; }, f2))
+/* (!LSHIFTABLE(d, n) ? 0 : (n)) is same as n but suppress a warning, C4293, by Visual Studio.  */
+#define LSHIFTABLE(d, n) ((n) < sizeof(d) * CHAR_BIT)
+#define LSHIFTX(d, n) (!LSHIFTABLE(d, n) ? 0 : ((d) << (!LSHIFTABLE(d, n) ? 0 : (n))))
+#define CLEAR_LOWBITS(d, numbits) ((d) & LSHIFTX(~((d)*0), (numbits)))
+#define FILL_LOWBITS(d, numbits) ((d) | (LSHIFTX(((d)*0+1), (numbits))-1))
+#define POW2_P(x) (((x)&((x)-1))==0)
+
+#define BDIGITS(x) (BIGNUM_DIGITS(x))
+#define BITSPERDIG (SIZEOF_BDIGIT*CHAR_BIT)
+#define BIGRAD ((BDIGIT_DBL)1 << BITSPERDIG)
+#define BIGRAD_HALF ((BDIGIT)(BIGRAD >> 1))
+#define BDIGIT_MSB(d) (((d) & BIGRAD_HALF) != 0)
+#define BIGUP(x) LSHIFTX(((x) + (BDIGIT_DBL)0), BITSPERDIG)
+#define BIGDN(x) RSHIFT((x),BITSPERDIG)
+#define BIGLO(x) ((BDIGIT)((x) & BDIGMAX))
+#define BDIGMAX ((BDIGIT)(BIGRAD-1))
+#define BDIGIT_DBL_MAX (~(BDIGIT_DBL)0)
+
+#if SIZEOF_BDIGIT == 2
+#   define swap_bdigit(x) swap16(x)
+#elif SIZEOF_BDIGIT == 4
+#   define swap_bdigit(x) swap32(x)
+#elif SIZEOF_BDIGIT == 8
+#   define swap_bdigit(x) swap64(x)
+#endif
+
+#define BIGZEROP(x) (BIGNUM_LEN(x) == 0 || \
+		     (BDIGITS(x)[0] == 0 && \
+		      (BIGNUM_LEN(x) == 1 || bigzero_p(x))))
+#define BIGSIZE(x) (BIGNUM_LEN(x) == 0 ? (size_t)0 : \
+    BDIGITS(x)[BIGNUM_LEN(x)-1] ? \
+        (size_t)(BIGNUM_LEN(x)*SIZEOF_BDIGIT - nlz(BDIGITS(x)[BIGNUM_LEN(x)-1])/CHAR_BIT) : \
+    rb_absint_size(x, NULL))
+
+#define BIGDIVREM_EXTRA_WORDS 1
+#define bdigit_roomof(n) roomof(n, SIZEOF_BDIGIT)
+#define BARY_ARGS(ary) ary, numberof(ary)
+
+#define BARY_ADD(z, x, y) bary_add(BARY_ARGS(z), BARY_ARGS(x), BARY_ARGS(y))
+#define BARY_SUB(z, x, y) bary_sub(BARY_ARGS(z), BARY_ARGS(x), BARY_ARGS(y))
+#define BARY_SHORT_MUL(z, x, y) bary_short_mul(BARY_ARGS(z), BARY_ARGS(x), BARY_ARGS(y))
+#define BARY_DIVMOD(q, r, x, y) bary_divmod(BARY_ARGS(q), BARY_ARGS(r), BARY_ARGS(x), BARY_ARGS(y))
+#define BARY_ZERO_P(x) bary_zero_p(BARY_ARGS(x))
+
+#define BIGNUM_SET_NEGATIVE_SIGN(b) BIGNUM_SET_SIGN(b, 0)
+#define BIGNUM_SET_POSITIVE_SIGN(b) BIGNUM_SET_SIGN(b, 1)
+
+#define bignew(len,sign) bignew_1(rb_cBignum,(len),(sign))
+
+#define BDIGITS_ZERO(ptr, n) do { \
+  BDIGIT *bdigitz_zero_ptr = (ptr); \
+  size_t bdigitz_zero_n = (n); \
+  while (bdigitz_zero_n) { \
+    *bdigitz_zero_ptr++ = 0; \
+    bdigitz_zero_n--; \
+  } \
+} while (0)
+
+#define BARY_TRUNC(ds, n) do { \
+        while (0 < (n) && (ds)[(n)-1] == 0) \
+            (n)--; \
+    } while (0)
+
+#define KARATSUBA_BALANCED(xn, yn) ((yn)/2 < (xn))
+#define TOOM3_BALANCED(xn, yn) (((yn)+2)/3 * 2 < (xn))
+
+#define GMP_MUL_DIGITS 20
+#define KARATSUBA_MUL_DIGITS 70
+#define TOOM3_MUL_DIGITS 150
+
+#define GMP_DIV_DIGITS 20
+#define GMP_BIG2STR_DIGITS 20
+#define GMP_STR2BIG_DIGITS 20
+
+typedef void (mulfunc_t)(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn, BDIGIT *wds, size_t wn);
+
+static mulfunc_t bary_mul_toom3_start;
+static mulfunc_t bary_mul_karatsuba_start;
+static BDIGIT bigdivrem_single(BDIGIT *qds, const BDIGIT *xds, size_t xn, BDIGIT y);
+static void bary_divmod(BDIGIT *qds, size_t qn, BDIGIT *rds, size_t rn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn);
+
+static VALUE bigmul0(VALUE x, VALUE y);
+static void bary_mul_toom3(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn, BDIGIT *wds, size_t wn);
+static VALUE bignew_1(VALUE klass, size_t len, int sign);
+static inline VALUE bigtrunc(VALUE x);
+
+static VALUE bigsq(VALUE x);
+static void bigdivmod(VALUE x, VALUE y, volatile VALUE *divp, volatile VALUE *modp);
+static inline VALUE power_cache_get_power(int base, int power_level, size_t *numdigits_ret);
+
+#if SIZEOF_BDIGIT <= SIZEOF_INT
+static int nlz(BDIGIT x) { return nlz_int((unsigned int)x) - (SIZEOF_INT-SIZEOF_BDIGIT) * CHAR_BIT; }
+#elif SIZEOF_BDIGIT <= SIZEOF_LONG
+static int nlz(BDIGIT x) { return nlz_long((unsigned long)x) - (SIZEOF_LONG-SIZEOF_BDIGIT) * CHAR_BIT; }
+#elif SIZEOF_BDIGIT <= SIZEOF_LONG_LONG
+static int nlz(BDIGIT x) { return nlz_long_long((unsigned LONG_LONG)x) - (SIZEOF_LONG_LONG-SIZEOF_BDIGIT) * CHAR_BIT; }
+#elif SIZEOF_BDIGIT <= SIZEOF_INT128_T
+static int nlz(BDIGIT x) { return nlz_int128((uint128_t)x) - (SIZEOF_INT128_T-SIZEOF_BDIGIT) * CHAR_BIT; }
+#endif
+
+#define U16(a) ((uint16_t)(a))
+#define U32(a) ((uint32_t)(a))
+#ifdef HAVE_UINT64_T
+#define U64(a,b) (((uint64_t)(a) << 32) | (b))
+#endif
+#ifdef HAVE_UINT128_T
+#define U128(a,b,c,d) (((uint128_t)U64(a,b) << 64) | U64(c,d))
+#endif
+
+/* The following script, maxpow.rb, generates the tables follows.
+
+def big(n, bits)
+  ns = []
+  ((bits+31)/32).times {
+    ns << sprintf("0x%08x", n & 0xffff_ffff)
+    n >>= 32
+  }
+  "U#{bits}(" + ns.reverse.join(",") + ")"
+end
+def values(ary, width, indent)
+  lines = [""]
+  ary.each {|e|
+    lines << "" if !ary.last.empty? && width < (lines.last + e + ", ").length
+    lines.last << e + ", "
+  }
+  lines.map {|line| " " * indent + line.chomp(" ") + "\n" }.join
+end
+[16,32,64,128].each {|bits|
+  max = 2**bits-1
+  exps = []
+  nums = []
+  2.upto(36) {|base|
+    exp = 0
+    n = 1
+    while n * base <= max
+      exp += 1
+      n *= base
+    end
+    exps << exp.to_s
+    nums << big(n, bits)
+  }
+  puts "#ifdef HAVE_UINT#{bits}_T"
+  puts "static const int maxpow#{bits}_exp[35] = {"
+  print values(exps, 70, 4)
+  puts "};"
+  puts "static const uint#{bits}_t maxpow#{bits}_num[35] = {"
+  print values(nums, 70, 4)
+  puts "};"
+  puts "#endif"
+}
+
+ */
+
+#if SIZEOF_BDIGIT_DBL == 2
+static const int maxpow16_exp[35] = {
+    15, 10, 7, 6, 6, 5, 5, 5, 4, 4, 4, 4, 4, 4, 3, 3, 3, 3, 3, 3, 3, 3,
+    3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3,
+};
+static const uint16_t maxpow16_num[35] = {
+    U16(0x00008000), U16(0x0000e6a9), U16(0x00004000), U16(0x00003d09),
+    U16(0x0000b640), U16(0x000041a7), U16(0x00008000), U16(0x0000e6a9),
+    U16(0x00002710), U16(0x00003931), U16(0x00005100), U16(0x00006f91),
+    U16(0x00009610), U16(0x0000c5c1), U16(0x00001000), U16(0x00001331),
+    U16(0x000016c8), U16(0x00001acb), U16(0x00001f40), U16(0x0000242d),
+    U16(0x00002998), U16(0x00002f87), U16(0x00003600), U16(0x00003d09),
+    U16(0x000044a8), U16(0x00004ce3), U16(0x000055c0), U16(0x00005f45),
+    U16(0x00006978), U16(0x0000745f), U16(0x00008000), U16(0x00008c61),
+    U16(0x00009988), U16(0x0000a77b), U16(0x0000b640),
+};
+#elif SIZEOF_BDIGIT_DBL == 4
+static const int maxpow32_exp[35] = {
+    31, 20, 15, 13, 12, 11, 10, 10, 9, 9, 8, 8, 8, 8, 7, 7, 7, 7, 7, 7,
+    7, 7, 6, 6, 6, 6, 6, 6, 6, 6, 6, 6, 6, 6, 6,
+};
+static const uint32_t maxpow32_num[35] = {
+    U32(0x80000000), U32(0xcfd41b91), U32(0x40000000), U32(0x48c27395),
+    U32(0x81bf1000), U32(0x75db9c97), U32(0x40000000), U32(0xcfd41b91),
+    U32(0x3b9aca00), U32(0x8c8b6d2b), U32(0x19a10000), U32(0x309f1021),
+    U32(0x57f6c100), U32(0x98c29b81), U32(0x10000000), U32(0x18754571),
+    U32(0x247dbc80), U32(0x3547667b), U32(0x4c4b4000), U32(0x6b5a6e1d),
+    U32(0x94ace180), U32(0xcaf18367), U32(0x0b640000), U32(0x0e8d4a51),
+    U32(0x1269ae40), U32(0x17179149), U32(0x1cb91000), U32(0x23744899),
+    U32(0x2b73a840), U32(0x34e63b41), U32(0x40000000), U32(0x4cfa3cc1),
+    U32(0x5c13d840), U32(0x6d91b519), U32(0x81bf1000),
+};
+#elif SIZEOF_BDIGIT_DBL == 8 && defined HAVE_UINT64_T
+static const int maxpow64_exp[35] = {
+    63, 40, 31, 27, 24, 22, 21, 20, 19, 18, 17, 17, 16, 16, 15, 15, 15,
+    15, 14, 14, 14, 14, 13, 13, 13, 13, 13, 13, 13, 12, 12, 12, 12, 12,
+    12,
+};
+static const uint64_t maxpow64_num[35] = {
+    U64(0x80000000,0x00000000), U64(0xa8b8b452,0x291fe821),
+    U64(0x40000000,0x00000000), U64(0x6765c793,0xfa10079d),
+    U64(0x41c21cb8,0xe1000000), U64(0x36427987,0x50226111),
+    U64(0x80000000,0x00000000), U64(0xa8b8b452,0x291fe821),
+    U64(0x8ac72304,0x89e80000), U64(0x4d28cb56,0xc33fa539),
+    U64(0x1eca170c,0x00000000), U64(0x780c7372,0x621bd74d),
+    U64(0x1e39a505,0x7d810000), U64(0x5b27ac99,0x3df97701),
+    U64(0x10000000,0x00000000), U64(0x27b95e99,0x7e21d9f1),
+    U64(0x5da0e1e5,0x3c5c8000), U64(0xd2ae3299,0xc1c4aedb),
+    U64(0x16bcc41e,0x90000000), U64(0x2d04b7fd,0xd9c0ef49),
+    U64(0x5658597b,0xcaa24000), U64(0xa0e20737,0x37609371),
+    U64(0x0c29e980,0x00000000), U64(0x14adf4b7,0x320334b9),
+    U64(0x226ed364,0x78bfa000), U64(0x383d9170,0xb85ff80b),
+    U64(0x5a3c23e3,0x9c000000), U64(0x8e651373,0x88122bcd),
+    U64(0xdd41bb36,0xd259e000), U64(0x0aee5720,0xee830681),
+    U64(0x10000000,0x00000000), U64(0x172588ad,0x4f5f0981),
+    U64(0x211e44f7,0xd02c1000), U64(0x2ee56725,0xf06e5c71),
+    U64(0x41c21cb8,0xe1000000),
+};
+#elif SIZEOF_BDIGIT_DBL == 16 && defined HAVE_UINT128_T
+static const int maxpow128_exp[35] = {
+    127, 80, 63, 55, 49, 45, 42, 40, 38, 37, 35, 34, 33, 32, 31, 31, 30,
+    30, 29, 29, 28, 28, 27, 27, 27, 26, 26, 26, 26, 25, 25, 25, 25, 24,
+    24,
+};
+static const uint128_t maxpow128_num[35] = {
+    U128(0x80000000,0x00000000,0x00000000,0x00000000),
+    U128(0x6f32f1ef,0x8b18a2bc,0x3cea5978,0x9c79d441),
+    U128(0x40000000,0x00000000,0x00000000,0x00000000),
+    U128(0xd0cf4b50,0xcfe20765,0xfff4b4e3,0xf741cf6d),
+    U128(0x6558e2a0,0x921fe069,0x42860000,0x00000000),
+    U128(0x5080c7b7,0xd0e31ba7,0x5911a67d,0xdd3d35e7),
+    U128(0x40000000,0x00000000,0x00000000,0x00000000),
+    U128(0x6f32f1ef,0x8b18a2bc,0x3cea5978,0x9c79d441),
+    U128(0x4b3b4ca8,0x5a86c47a,0x098a2240,0x00000000),
+    U128(0xffd1390a,0x0adc2fb8,0xdabbb817,0x4d95c99b),
+    U128(0x2c6fdb36,0x4c25e6c0,0x00000000,0x00000000),
+    U128(0x384bacd6,0x42c343b4,0xe90c4272,0x13506d29),
+    U128(0x31f5db32,0xa34aced6,0x0bf13a0e,0x00000000),
+    U128(0x20753ada,0xfd1e839f,0x53686d01,0x3143ee01),
+    U128(0x10000000,0x00000000,0x00000000,0x00000000),
+    U128(0x68ca11d6,0xb4f6d1d1,0xfaa82667,0x8073c2f1),
+    U128(0x223e493b,0xb3bb69ff,0xa4b87d6c,0x40000000),
+    U128(0xad62418d,0x14ea8247,0x01c4b488,0x6cc66f59),
+    U128(0x2863c1f5,0xcdae42f9,0x54000000,0x00000000),
+    U128(0xa63fd833,0xb9386b07,0x36039e82,0xbe651b25),
+    U128(0x1d1f7a9c,0xd087a14d,0x28cdf3d5,0x10000000),
+    U128(0x651b5095,0xc2ea8fc1,0xb30e2c57,0x77aaf7e1),
+    U128(0x0ddef20e,0xff760000,0x00000000,0x00000000),
+    U128(0x29c30f10,0x29939b14,0x6664242d,0x97d9f649),
+    U128(0x786a435a,0xe9558b0e,0x6aaf6d63,0xa8000000),
+    U128(0x0c5afe6f,0xf302bcbf,0x94fd9829,0xd87f5079),
+    U128(0x1fce575c,0xe1692706,0x07100000,0x00000000),
+    U128(0x4f34497c,0x8597e144,0x36e91802,0x00528229),
+    U128(0xbf3a8e1d,0x41ef2170,0x7802130d,0x84000000),
+    U128(0x0e7819e1,0x7f1eb0fb,0x6ee4fb89,0x01d9531f),
+    U128(0x20000000,0x00000000,0x00000000,0x00000000),
+    U128(0x4510460d,0xd9e879c0,0x14a82375,0x2f22b321),
+    U128(0x91abce3c,0x4b4117ad,0xe76d35db,0x22000000),
+    U128(0x08973ea3,0x55d75bc2,0x2e42c391,0x727d69e1),
+    U128(0x10e425c5,0x6daffabc,0x35c10000,0x00000000),
+};
+#endif
+
+static BDIGIT_DBL
+maxpow_in_bdigit_dbl(int base, int *exp_ret)
 {
-    NEWOBJ(big, struct RBignum);
-    OBJSETUP(big, C_Bignum, T_BIGNUM);
-    big->sign = sign;
-    big->len = len;
-    BDIGITS(big) = ALLOC_N(USHORT, len);
+    BDIGIT_DBL maxpow;
+    int exponent;
 
-    return (VALUE)big;
+    assert(2 <= base && base <= 36);
+
+    {
+#if SIZEOF_BDIGIT_DBL == 2
+        maxpow = maxpow16_num[base-2];
+        exponent = maxpow16_exp[base-2];
+#elif SIZEOF_BDIGIT_DBL == 4
+        maxpow = maxpow32_num[base-2];
+        exponent = maxpow32_exp[base-2];
+#elif SIZEOF_BDIGIT_DBL == 8 && defined HAVE_UINT64_T
+        maxpow = maxpow64_num[base-2];
+        exponent = maxpow64_exp[base-2];
+#elif SIZEOF_BDIGIT_DBL == 16 && defined HAVE_UINT128_T
+        maxpow = maxpow128_num[base-2];
+        exponent = maxpow128_exp[base-2];
+#else
+        maxpow = base;
+        exponent = 1;
+        while (maxpow <= BDIGIT_DBL_MAX / base) {
+            maxpow *= base;
+            exponent++;
+        }
+#endif
+    }
+
+    *exp_ret = exponent;
+    return maxpow;
 }
 
-#define bignew(len,sign) bignew_1(C_Bignum,len,sign)
+static inline BDIGIT_DBL
+bary2bdigitdbl(const BDIGIT *ds, size_t n)
+{
+    assert(n <= 2);
 
-static VALUE
-Sbig_new(class, y)
-    VALUE class;
-    struct RBignum *y;
+    if (n == 2)
+        return ds[0] | BIGUP(ds[1]);
+    if (n == 1)
+        return ds[0];
+    return 0;
+}
+
+static inline void
+bdigitdbl2bary(BDIGIT *ds, size_t n, BDIGIT_DBL num)
 {
-    Check_Type(y, T_BIGNUM);
-    return bignew_1(class, y->len, y->sign);
+    assert(n == 2);
+
+    ds[0] = BIGLO(num);
+    ds[1] = (BDIGIT)BIGDN(num);
 }
 
-VALUE
-big_clone(x)
-    struct RBignum *x;
+static int
+bary_cmp(const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
 {
-    VALUE z = bignew_1(CLASS_OF(x), x->len, x->sign);
+    BARY_TRUNC(xds, xn);
+    BARY_TRUNC(yds, yn);
+
+    if (xn < yn)
+        return -1;
+    if (xn > yn)
+        return 1;
 
-    MEMCPY(BDIGITS(z), BDIGITS(x), USHORT, x->len);
-    return (VALUE)z;
+    while (xn-- && xds[xn] == yds[xn])
+        ;
+    if (xn == (size_t)-1)
+        return 0;
+    return xds[xn] < yds[xn] ? -1 : 1;
 }
 
-void
-big_2comp(x)			/* get 2's complement */
-    struct RBignum *x;
+static BDIGIT
+bary_small_lshift(BDIGIT *zds, const BDIGIT *xds, size_t n, int shift)
 {
-    UINT i = x->len;
-    USHORT *ds = BDIGITS(x);
-    long num;
+    size_t i;
+    BDIGIT_DBL num = 0;
+    assert(0 <= shift && shift < BITSPERDIG);
 
-    while (i--) ds[i] = ~ds[i];
-    i = 0; num = 1;
+    for (i=0; i<n; i++) {
+	num = num | (BDIGIT_DBL)*xds++ << shift;
+	*zds++ = BIGLO(num);
+	num = BIGDN(num);
+    }
+    return BIGLO(num);
+}
+
+static void
+bary_small_rshift(BDIGIT *zds, const BDIGIT *xds, size_t n, int shift, BDIGIT higher_bdigit)
+{
+    BDIGIT_DBL num = 0;
+    BDIGIT x;
+
+    assert(0 <= shift && shift < BITSPERDIG);
+
+    num = BIGUP(higher_bdigit);
+    while (n--) {
+	num = (num | xds[n]) >> shift;
+        x = xds[n];
+	zds[n] = BIGLO(num);
+	num = BIGUP(x);
+    }
+}
+
+static int
+bary_zero_p(BDIGIT *xds, size_t xn)
+{
+    if (xn == 0)
+        return 1;
     do {
-	num += (long)ds[i];
-	ds[i++] = BIGLO(num);
+	if (xds[--xn]) return 0;
+    } while (xn);
+    return 1;
+}
+
+static void
+bary_neg(BDIGIT *ds, size_t n)
+{
+    while (n--)
+        ds[n] = BIGLO(~ds[n]);
+}
+
+static int
+bary_2comp(BDIGIT *ds, size_t n)
+{
+    size_t i;
+    i = 0;
+    for (i = 0; i < n; i++) {
+        if (ds[i] != 0) {
+            goto non_zero;
+        }
+    }
+    return 1;
+
+  non_zero:
+    ds[i] = BIGLO(~ds[i] + 1);
+    i++;
+    for (; i < n; i++) {
+        ds[i] = BIGLO(~ds[i]);
+    }
+    return 0;
+}
+
+static void
+bary_swap(BDIGIT *ds, size_t num_bdigits)
+{
+    BDIGIT *p1 = ds;
+    BDIGIT *p2 = ds + num_bdigits - 1;
+    for (; p1 < p2; p1++, p2--) {
+        BDIGIT tmp = *p1;
+        *p1 = *p2;
+        *p2 = tmp;
+    }
+}
+
+#define INTEGER_PACK_WORDORDER_MASK \
+    (INTEGER_PACK_MSWORD_FIRST | \
+     INTEGER_PACK_LSWORD_FIRST)
+#define INTEGER_PACK_BYTEORDER_MASK \
+    (INTEGER_PACK_MSBYTE_FIRST | \
+     INTEGER_PACK_LSBYTE_FIRST | \
+     INTEGER_PACK_NATIVE_BYTE_ORDER)
+
+static void
+validate_integer_pack_format(size_t numwords, size_t wordsize, size_t nails, int flags, int supported_flags)
+{
+    int wordorder_bits = flags & INTEGER_PACK_WORDORDER_MASK;
+    int byteorder_bits = flags & INTEGER_PACK_BYTEORDER_MASK;
+
+    if (flags & ~supported_flags) {
+        rb_raise(rb_eArgError, "unsupported flags specified");
+    }
+    if (wordorder_bits == 0) {
+        if (1 < numwords)
+            rb_raise(rb_eArgError, "word order not specified");
+    }
+    else if (wordorder_bits != INTEGER_PACK_MSWORD_FIRST &&
+        wordorder_bits != INTEGER_PACK_LSWORD_FIRST)
+        rb_raise(rb_eArgError, "unexpected word order");
+    if (byteorder_bits == 0) {
+        rb_raise(rb_eArgError, "byte order not specified");
+    }
+    else if (byteorder_bits != INTEGER_PACK_MSBYTE_FIRST &&
+        byteorder_bits != INTEGER_PACK_LSBYTE_FIRST &&
+        byteorder_bits != INTEGER_PACK_NATIVE_BYTE_ORDER)
+        rb_raise(rb_eArgError, "unexpected byte order");
+    if (wordsize == 0)
+        rb_raise(rb_eArgError, "invalid wordsize: %"PRI_SIZE_PREFIX"u", wordsize);
+    if (SSIZE_MAX < wordsize)
+        rb_raise(rb_eArgError, "too big wordsize: %"PRI_SIZE_PREFIX"u", wordsize);
+    if (wordsize <= nails / CHAR_BIT)
+        rb_raise(rb_eArgError, "too big nails: %"PRI_SIZE_PREFIX"u", nails);
+    if (SIZE_MAX / wordsize < numwords)
+        rb_raise(rb_eArgError, "too big numwords * wordsize: %"PRI_SIZE_PREFIX"u * %"PRI_SIZE_PREFIX"u", numwords, wordsize);
+}
+
+static void
+integer_pack_loop_setup(
+    size_t numwords, size_t wordsize, size_t nails, int flags,
+    size_t *word_num_fullbytes_ret,
+    int *word_num_partialbits_ret,
+    size_t *word_start_ret,
+    ssize_t *word_step_ret,
+    size_t *word_last_ret,
+    size_t *byte_start_ret,
+    int *byte_step_ret)
+{
+    int wordorder_bits = flags & INTEGER_PACK_WORDORDER_MASK;
+    int byteorder_bits = flags & INTEGER_PACK_BYTEORDER_MASK;
+    size_t word_num_fullbytes;
+    int word_num_partialbits;
+    size_t word_start;
+    ssize_t word_step;
+    size_t word_last;
+    size_t byte_start;
+    int byte_step;
+
+    word_num_partialbits = CHAR_BIT - (int)(nails % CHAR_BIT);
+    if (word_num_partialbits == CHAR_BIT)
+        word_num_partialbits = 0;
+    word_num_fullbytes = wordsize - (nails / CHAR_BIT);
+    if (word_num_partialbits != 0) {
+        word_num_fullbytes--;
+    }
+
+    if (wordorder_bits == INTEGER_PACK_MSWORD_FIRST) {
+        word_start = wordsize*(numwords-1);
+        word_step = -(ssize_t)wordsize;
+        word_last = 0;
+    }
+    else {
+        word_start = 0;
+        word_step = wordsize;
+        word_last = wordsize*(numwords-1);
+    }
+
+    if (byteorder_bits == INTEGER_PACK_NATIVE_BYTE_ORDER) {
+#ifdef WORDS_BIGENDIAN
+        byteorder_bits = INTEGER_PACK_MSBYTE_FIRST;
+#else
+        byteorder_bits = INTEGER_PACK_LSBYTE_FIRST;
+#endif
+    }
+    if (byteorder_bits == INTEGER_PACK_MSBYTE_FIRST) {
+        byte_start = wordsize-1;
+        byte_step = -1;
+    }
+    else {
+        byte_start = 0;
+        byte_step = 1;
+    }
+
+    *word_num_partialbits_ret = word_num_partialbits;
+    *word_num_fullbytes_ret = word_num_fullbytes;
+    *word_start_ret = word_start;
+    *word_step_ret = word_step;
+    *word_last_ret = word_last;
+    *byte_start_ret = byte_start;
+    *byte_step_ret = byte_step;
+}
+
+static inline void
+integer_pack_fill_dd(BDIGIT **dpp, BDIGIT **dep, BDIGIT_DBL *ddp, int *numbits_in_dd_p)
+{
+    if (*dpp < *dep && BITSPERDIG <= (int)sizeof(*ddp) * CHAR_BIT - *numbits_in_dd_p) {
+        *ddp |= (BDIGIT_DBL)(*(*dpp)++) << *numbits_in_dd_p;
+        *numbits_in_dd_p += BITSPERDIG;
+    }
+    else if (*dpp == *dep) {
+        /* higher bits are infinity zeros */
+        *numbits_in_dd_p = (int)sizeof(*ddp) * CHAR_BIT;
+    }
+}
+
+static inline BDIGIT_DBL
+integer_pack_take_lowbits(int n, BDIGIT_DBL *ddp, int *numbits_in_dd_p)
+{
+    BDIGIT_DBL ret;
+    ret = (*ddp) & (((BDIGIT_DBL)1 << n) - 1);
+    *ddp >>= n;
+    *numbits_in_dd_p -= n;
+    return ret;
+}
+
+#if !defined(WORDS_BIGENDIAN)
+static int
+bytes_2comp(unsigned char *buf, size_t len)
+{
+    size_t i;
+    for (i = 0; i < len; i++)
+        buf[i] = ~buf[i];
+    for (i = 0; i < len; i++) {
+        buf[i]++;
+        if (buf[i] != 0)
+            return 0;
+    }
+    return 1;
+}
+#endif
+
+static int
+bary_pack(int sign, BDIGIT *ds, size_t num_bdigits, void *words, size_t numwords, size_t wordsize, size_t nails, int flags)
+{
+    BDIGIT *dp, *de;
+    unsigned char *buf, *bufend;
+
+    dp = ds;
+    de = ds + num_bdigits;
+
+    validate_integer_pack_format(numwords, wordsize, nails, flags,
+            INTEGER_PACK_MSWORD_FIRST|
+            INTEGER_PACK_LSWORD_FIRST|
+            INTEGER_PACK_MSBYTE_FIRST|
+            INTEGER_PACK_LSBYTE_FIRST|
+            INTEGER_PACK_NATIVE_BYTE_ORDER|
+            INTEGER_PACK_2COMP|
+            INTEGER_PACK_FORCE_GENERIC_IMPLEMENTATION);
+
+    while (dp < de && de[-1] == 0)
+        de--;
+    if (dp == de) {
+        sign = 0;
+    }
+
+    if (!(flags & INTEGER_PACK_FORCE_GENERIC_IMPLEMENTATION)) {
+        if (sign == 0) {
+            MEMZERO(words, unsigned char, numwords * wordsize);
+            return 0;
+        }
+        if (nails == 0 && numwords == 1) {
+            int need_swap = wordsize != 1 &&
+                (flags & INTEGER_PACK_BYTEORDER_MASK) != INTEGER_PACK_NATIVE_BYTE_ORDER &&
+                ((flags & INTEGER_PACK_MSBYTE_FIRST) ? !HOST_BIGENDIAN_P : HOST_BIGENDIAN_P);
+            if (0 < sign || !(flags & INTEGER_PACK_2COMP)) {
+                BDIGIT d;
+                if (wordsize == 1) {
+                    *((unsigned char *)words) = (unsigned char)(d = dp[0]);
+                    return ((1 < de - dp || CLEAR_LOWBITS(d, 8) != 0) ? 2 : 1) * sign;
+                }
+#if defined(HAVE_UINT16_T) && 2 <= SIZEOF_BDIGIT
+                if (wordsize == 2 && (uintptr_t)words % ALIGNOF(uint16_t) == 0) {
+                    uint16_t u = (uint16_t)(d = dp[0]);
+                    if (need_swap) u = swap16(u);
+                    *((uint16_t *)words) = u;
+                    return ((1 < de - dp || CLEAR_LOWBITS(d, 16) != 0) ? 2 : 1) * sign;
+                }
+#endif
+#if defined(HAVE_UINT32_T) && 4 <= SIZEOF_BDIGIT
+                if (wordsize == 4 && (uintptr_t)words % ALIGNOF(uint32_t) == 0) {
+                    uint32_t u = (uint32_t)(d = dp[0]);
+                    if (need_swap) u = swap32(u);
+                    *((uint32_t *)words) = u;
+                    return ((1 < de - dp || CLEAR_LOWBITS(d, 32) != 0) ? 2 : 1) * sign;
+                }
+#endif
+#if defined(HAVE_UINT64_T) && 8 <= SIZEOF_BDIGIT
+                if (wordsize == 8 && (uintptr_t)words % ALIGNOF(uint64_t) == 0) {
+                    uint64_t u = (uint64_t)(d = dp[0]);
+                    if (need_swap) u = swap64(u);
+                    *((uint64_t *)words) = u;
+                    return ((1 < de - dp || CLEAR_LOWBITS(d, 64) != 0) ? 2 : 1) * sign;
+                }
+#endif
+            }
+            else { /* sign < 0 && (flags & INTEGER_PACK_2COMP) */
+                BDIGIT_DBL_SIGNED d;
+                if (wordsize == 1) {
+                    *((unsigned char *)words) = (unsigned char)(d = -(BDIGIT_DBL_SIGNED)dp[0]);
+                    return (1 < de - dp || FILL_LOWBITS(d, 8) != -1) ? -2 : -1;
+                }
+#if defined(HAVE_UINT16_T) && 2 <= SIZEOF_BDIGIT
+                if (wordsize == 2 && (uintptr_t)words % ALIGNOF(uint16_t) == 0) {
+                    uint16_t u = (uint16_t)(d = -(BDIGIT_DBL_SIGNED)dp[0]);
+                    if (need_swap) u = swap16(u);
+                    *((uint16_t *)words) = u;
+                    return (wordsize == SIZEOF_BDIGIT && de - dp == 2 && dp[1] == 1 && dp[0] == 0) ? -1 :
+                        (1 < de - dp || FILL_LOWBITS(d, 16) != -1) ? -2 : -1;
+                }
+#endif
+#if defined(HAVE_UINT32_T) && 4 <= SIZEOF_BDIGIT
+                if (wordsize == 4 && (uintptr_t)words % ALIGNOF(uint32_t) == 0) {
+                    uint32_t u = (uint32_t)(d = -(BDIGIT_DBL_SIGNED)dp[0]);
+                    if (need_swap) u = swap32(u);
+                    *((uint32_t *)words) = u;
+                    return (wordsize == SIZEOF_BDIGIT && de - dp == 2 && dp[1] == 1 && dp[0] == 0) ? -1 :
+                        (1 < de - dp || FILL_LOWBITS(d, 32) != -1) ? -2 : -1;
+                }
+#endif
+#if defined(HAVE_UINT64_T) && 8 <= SIZEOF_BDIGIT
+                if (wordsize == 8 && (uintptr_t)words % ALIGNOF(uint64_t) == 0) {
+                    uint64_t u = (uint64_t)(d = -(BDIGIT_DBL_SIGNED)dp[0]);
+                    if (need_swap) u = swap64(u);
+                    *((uint64_t *)words) = u;
+                    return (wordsize == SIZEOF_BDIGIT && de - dp == 2 && dp[1] == 1 && dp[0] == 0) ? -1 :
+                        (1 < de - dp || FILL_LOWBITS(d, 64) != -1) ? -2 : -1;
+                }
+#endif
+            }
+        }
+#if !defined(WORDS_BIGENDIAN)
+        if (nails == 0 && SIZEOF_BDIGIT == sizeof(BDIGIT) &&
+            (flags & INTEGER_PACK_WORDORDER_MASK) == INTEGER_PACK_LSWORD_FIRST &&
+            (flags & INTEGER_PACK_BYTEORDER_MASK) != INTEGER_PACK_MSBYTE_FIRST) {
+            size_t src_size = (de - dp) * SIZEOF_BDIGIT;
+            size_t dst_size = numwords * wordsize;
+            int overflow = 0;
+            while (0 < src_size && ((unsigned char *)ds)[src_size-1] == 0)
+                src_size--;
+            if (src_size <= dst_size) {
+                MEMCPY(words, dp, char, src_size);
+                MEMZERO((char*)words + src_size, char, dst_size - src_size);
+            }
+            else {
+                MEMCPY(words, dp, char, dst_size);
+                overflow = 1;
+            }
+            if (sign < 0 && (flags & INTEGER_PACK_2COMP)) {
+                int zero_p = bytes_2comp(words, dst_size);
+                if (zero_p && overflow) {
+                    unsigned char *p = (unsigned char *)dp;
+                    if (dst_size == src_size-1 &&
+                        p[dst_size] == 1) {
+                        overflow = 0;
+                    }
+                }
+            }
+            if (overflow)
+                sign *= 2;
+            return sign;
+        }
+#endif
+        if (nails == 0 && SIZEOF_BDIGIT == sizeof(BDIGIT) &&
+            wordsize % SIZEOF_BDIGIT == 0 && (uintptr_t)words % ALIGNOF(BDIGIT) == 0) {
+            size_t bdigits_per_word = wordsize / SIZEOF_BDIGIT;
+            size_t src_num_bdigits = de - dp;
+            size_t dst_num_bdigits = numwords * bdigits_per_word;
+            int overflow = 0;
+            int mswordfirst_p = (flags & INTEGER_PACK_MSWORD_FIRST) != 0;
+            int msbytefirst_p = (flags & INTEGER_PACK_NATIVE_BYTE_ORDER) ? HOST_BIGENDIAN_P :
+                (flags & INTEGER_PACK_MSBYTE_FIRST) != 0;
+            if (src_num_bdigits <= dst_num_bdigits) {
+                MEMCPY(words, dp, BDIGIT, src_num_bdigits);
+                BDIGITS_ZERO((BDIGIT*)words + src_num_bdigits, dst_num_bdigits - src_num_bdigits);
+            }
+            else {
+                MEMCPY(words, dp, BDIGIT, dst_num_bdigits);
+                overflow = 1;
+            }
+            if (sign < 0 && (flags & INTEGER_PACK_2COMP)) {
+                int zero_p = bary_2comp(words, dst_num_bdigits);
+                if (zero_p && overflow &&
+                    dst_num_bdigits == src_num_bdigits-1 &&
+                    dp[dst_num_bdigits] == 1)
+                    overflow = 0;
+            }
+            if (msbytefirst_p != HOST_BIGENDIAN_P) {
+                size_t i;
+                for (i = 0; i < dst_num_bdigits; i++) {
+                    BDIGIT d = ((BDIGIT*)words)[i];
+                    ((BDIGIT*)words)[i] = swap_bdigit(d);
+                }
+            }
+            if (mswordfirst_p ? !msbytefirst_p : msbytefirst_p) {
+                size_t i;
+                BDIGIT *p = words;
+                for (i = 0; i < numwords; i++) {
+                    bary_swap(p, bdigits_per_word);
+                    p += bdigits_per_word;
+                }
+            }
+            if (mswordfirst_p) {
+                bary_swap(words, dst_num_bdigits);
+            }
+            if (overflow)
+                sign *= 2;
+            return sign;
+        }
+    }
+
+    buf = words;
+    bufend = buf + numwords * wordsize;
+
+    if (buf == bufend) {
+        /* overflow if non-zero*/
+        if (!(flags & INTEGER_PACK_2COMP) || 0 <= sign)
+            sign *= 2;
+        else {
+            if (de - dp == 1 && dp[0] == 1)
+                sign = -1; /* val == -1 == -2**(numwords*(wordsize*CHAR_BIT-nails)) */
+            else
+                sign = -2; /* val < -1 == -2**(numwords*(wordsize*CHAR_BIT-nails)) */
+        }
+    }
+    else if (dp == de) {
+        memset(buf, '\0', bufend - buf);
+    }
+    else if (dp < de && buf < bufend) {
+        int word_num_partialbits;
+        size_t word_num_fullbytes;
+
+        ssize_t word_step;
+        size_t byte_start;
+        int byte_step;
+
+        size_t word_start, word_last;
+        unsigned char *wordp, *last_wordp;
+        BDIGIT_DBL dd;
+        int numbits_in_dd;
+
+        integer_pack_loop_setup(numwords, wordsize, nails, flags,
+            &word_num_fullbytes, &word_num_partialbits,
+            &word_start, &word_step, &word_last, &byte_start, &byte_step);
+
+        wordp = buf + word_start;
+        last_wordp = buf + word_last;
+
+        dd = 0;
+        numbits_in_dd = 0;
+
+#define FILL_DD \
+    integer_pack_fill_dd(&dp, &de, &dd, &numbits_in_dd)
+#define TAKE_LOWBITS(n) \
+    integer_pack_take_lowbits(n, &dd, &numbits_in_dd)
+
+        while (1) {
+            size_t index_in_word = 0;
+            unsigned char *bytep = wordp + byte_start;
+            while (index_in_word < word_num_fullbytes) {
+                FILL_DD;
+                *bytep = TAKE_LOWBITS(CHAR_BIT);
+                bytep += byte_step;
+                index_in_word++;
+            }
+            if (word_num_partialbits) {
+                FILL_DD;
+                *bytep = TAKE_LOWBITS(word_num_partialbits);
+                bytep += byte_step;
+                index_in_word++;
+            }
+            while (index_in_word < wordsize) {
+                *bytep = 0;
+                bytep += byte_step;
+                index_in_word++;
+            }
+
+            if (wordp == last_wordp)
+                break;
+
+            wordp += word_step;
+        }
+        FILL_DD;
+        /* overflow tests */
+        if (dp != de || 1 < dd) {
+            /* 2**(numwords*(wordsize*CHAR_BIT-nails)+1) <= abs(val) */
+            sign *= 2;
+        }
+        else if (dd == 1) {
+            /* 2**(numwords*(wordsize*CHAR_BIT-nails)) <= abs(val) < 2**(numwords*(wordsize*CHAR_BIT-nails)+1) */
+            if (!(flags & INTEGER_PACK_2COMP) || 0 <= sign)
+                sign *= 2;
+            else { /* overflow_2comp && sign == -1 */
+                /* test lower bits are all zero. */
+                dp = ds;
+                while (dp < de && *dp == 0)
+                    dp++;
+                if (de - dp == 1 && /* only one non-zero word. */
+                    POW2_P(*dp)) /* *dp contains only one bit set. */
+                    sign = -1; /* val == -2**(numwords*(wordsize*CHAR_BIT-nails)) */
+                else
+                    sign = -2; /* val < -2**(numwords*(wordsize*CHAR_BIT-nails)) */
+            }
+        }
+    }
+
+    if ((flags & INTEGER_PACK_2COMP) && (sign < 0 && numwords != 0)) {
+        unsigned char *buf;
+
+        int word_num_partialbits;
+        size_t word_num_fullbytes;
+
+        ssize_t word_step;
+        size_t byte_start;
+        int byte_step;
+
+        size_t word_start, word_last;
+        unsigned char *wordp, *last_wordp;
+
+        unsigned int partialbits_mask;
+        int carry;
+
+        integer_pack_loop_setup(numwords, wordsize, nails, flags,
+            &word_num_fullbytes, &word_num_partialbits,
+            &word_start, &word_step, &word_last, &byte_start, &byte_step);
+
+        partialbits_mask = (1 << word_num_partialbits) - 1;
+
+        buf = words;
+        wordp = buf + word_start;
+        last_wordp = buf + word_last;
+
+        carry = 1;
+        while (1) {
+            size_t index_in_word = 0;
+            unsigned char *bytep = wordp + byte_start;
+            while (index_in_word < word_num_fullbytes) {
+                carry += (unsigned char)~*bytep;
+                *bytep = (unsigned char)carry;
+                carry >>= CHAR_BIT;
+                bytep += byte_step;
+                index_in_word++;
+            }
+            if (word_num_partialbits) {
+                carry += (*bytep & partialbits_mask) ^ partialbits_mask;
+                *bytep = carry & partialbits_mask;
+                carry >>= word_num_partialbits;
+                bytep += byte_step;
+                index_in_word++;
+            }
+
+            if (wordp == last_wordp)
+                break;
+
+            wordp += word_step;
+        }
+    }
+
+    return sign;
+#undef FILL_DD
+#undef TAKE_LOWBITS
+}
+
+static size_t
+integer_unpack_num_bdigits_small(size_t numwords, size_t wordsize, size_t nails, int *nlp_bits_ret)
+{
+    /* nlp_bits stands for number of leading padding bits */
+    size_t num_bits = (wordsize * CHAR_BIT - nails) * numwords;
+    size_t num_bdigits = (num_bits + BITSPERDIG - 1) / BITSPERDIG;
+    *nlp_bits_ret = (int)(num_bdigits * BITSPERDIG - num_bits);
+    return num_bdigits;
+}
+
+static size_t
+integer_unpack_num_bdigits_generic(size_t numwords, size_t wordsize, size_t nails, int *nlp_bits_ret)
+{
+    /* BITSPERDIG = SIZEOF_BDIGIT * CHAR_BIT */
+    /* num_bits = (wordsize * CHAR_BIT - nails) * numwords */
+    /* num_bdigits = (num_bits + BITSPERDIG - 1) / BITSPERDIG */
+
+    /* num_bits = CHAR_BIT * (wordsize * numwords) - nails * numwords = CHAR_BIT * num_bytes1 - nails * numwords */
+    size_t num_bytes1 = wordsize * numwords;
+
+    /* q1 * CHAR_BIT + r1 = numwords */
+    size_t q1 = numwords / CHAR_BIT;
+    size_t r1 = numwords % CHAR_BIT;
+
+    /* num_bits = CHAR_BIT * num_bytes1 - nails * (q1 * CHAR_BIT + r1) = CHAR_BIT * num_bytes2 - nails * r1 */
+    size_t num_bytes2 = num_bytes1 - nails * q1;
+
+    /* q2 * CHAR_BIT + r2 = nails */
+    size_t q2 = nails / CHAR_BIT;
+    size_t r2 = nails % CHAR_BIT;
+
+    /* num_bits = CHAR_BIT * num_bytes2 - (q2 * CHAR_BIT + r2) * r1 = CHAR_BIT * num_bytes3 - r1 * r2 */
+    size_t num_bytes3 = num_bytes2 - q2 * r1;
+
+    /* q3 * BITSPERDIG + r3 = num_bytes3 */
+    size_t q3 = num_bytes3 / BITSPERDIG;
+    size_t r3 = num_bytes3 % BITSPERDIG;
+
+    /* num_bits = CHAR_BIT * (q3 * BITSPERDIG + r3) - r1 * r2 = BITSPERDIG * num_digits1 + CHAR_BIT * r3 - r1 * r2 */
+    size_t num_digits1 = CHAR_BIT * q3;
+
+    /*
+     * if CHAR_BIT * r3 >= r1 * r2
+     *   CHAR_BIT * r3 - r1 * r2 = CHAR_BIT * BITSPERDIG - (CHAR_BIT * BITSPERDIG - (CHAR_BIT * r3 - r1 * r2))
+     *   q4 * BITSPERDIG + r4 = CHAR_BIT * BITSPERDIG - (CHAR_BIT * r3 - r1 * r2)
+     *   num_bits = BITSPERDIG * num_digits1 + CHAR_BIT * BITSPERDIG - (q4 * BITSPERDIG + r4) = BITSPERDIG * num_digits2 - r4
+     * else
+     *   q4 * BITSPERDIG + r4 = -(CHAR_BIT * r3 - r1 * r2)
+     *   num_bits = BITSPERDIG * num_digits1 - (q4 * BITSPERDIG + r4) = BITSPERDIG * num_digits2 - r4
+     * end
+     */
+
+    if (CHAR_BIT * r3 >= r1 * r2) {
+        size_t tmp1 = CHAR_BIT * BITSPERDIG - (CHAR_BIT * r3 - r1 * r2);
+        size_t q4 = tmp1 / BITSPERDIG;
+        int r4 = (int)(tmp1 % BITSPERDIG);
+        size_t num_digits2 = num_digits1 + CHAR_BIT - q4;
+        *nlp_bits_ret = r4;
+        return num_digits2;
+    }
+    else {
+        size_t tmp1 = r1 * r2 - CHAR_BIT * r3;
+        size_t q4 = tmp1 / BITSPERDIG;
+        int r4 = (int)(tmp1 % BITSPERDIG);
+        size_t num_digits2 = num_digits1 - q4;
+        *nlp_bits_ret = r4;
+        return num_digits2;
+    }
+}
+
+static size_t
+integer_unpack_num_bdigits(size_t numwords, size_t wordsize, size_t nails, int *nlp_bits_ret)
+{
+    size_t num_bdigits;
+
+    if (numwords <= (SIZE_MAX - (BITSPERDIG-1)) / CHAR_BIT / wordsize) {
+        num_bdigits = integer_unpack_num_bdigits_small(numwords, wordsize, nails, nlp_bits_ret);
+#ifdef DEBUG_INTEGER_PACK
+        {
+            int nlp_bits1;
+            size_t num_bdigits1 = integer_unpack_num_bdigits_generic(numwords, wordsize, nails, &nlp_bits1);
+            assert(num_bdigits == num_bdigits1);
+            assert(*nlp_bits_ret == nlp_bits1);
+        }
+#endif
+    }
+    else {
+        num_bdigits = integer_unpack_num_bdigits_generic(numwords, wordsize, nails, nlp_bits_ret);
+    }
+    return num_bdigits;
+}
+
+static inline void
+integer_unpack_push_bits(int data, int numbits, BDIGIT_DBL *ddp, int *numbits_in_dd_p, BDIGIT **dpp)
+{
+    (*ddp) |= ((BDIGIT_DBL)data) << (*numbits_in_dd_p);
+    *numbits_in_dd_p += numbits;
+    while (BITSPERDIG <= *numbits_in_dd_p) {
+        *(*dpp)++ = BIGLO(*ddp);
+        *ddp = BIGDN(*ddp);
+        *numbits_in_dd_p -= BITSPERDIG;
+    }
+}
+
+static int
+integer_unpack_single_bdigit(BDIGIT u, size_t size, int flags, BDIGIT *dp)
+{
+    int sign;
+    if (flags & INTEGER_PACK_2COMP) {
+        sign = (flags & INTEGER_PACK_NEGATIVE) ?
+            ((size == SIZEOF_BDIGIT && u == 0) ? -2 : -1) :
+            ((u >> (size * CHAR_BIT - 1)) ? -1 : 1);
+        if (sign < 0) {
+            u |= LSHIFTX(BDIGMAX, size * CHAR_BIT);
+            u = BIGLO(1 + ~u);
+        }
+    }
+    else
+        sign = (flags & INTEGER_PACK_NEGATIVE) ? -1 : 1;
+    *dp = u;
+    return sign;
+}
+
+static int
+bary_unpack_internal(BDIGIT *bdigits, size_t num_bdigits, const void *words, size_t numwords, size_t wordsize, size_t nails, int flags, int nlp_bits)
+{
+    int sign;
+    const unsigned char *buf = words;
+    BDIGIT *dp;
+    BDIGIT *de;
+
+    dp = bdigits;
+    de = dp + num_bdigits;
+
+    if (!(flags & INTEGER_PACK_FORCE_GENERIC_IMPLEMENTATION)) {
+        if (nails == 0 && numwords == 1) {
+            int need_swap = wordsize != 1 &&
+                (flags & INTEGER_PACK_BYTEORDER_MASK) != INTEGER_PACK_NATIVE_BYTE_ORDER &&
+                ((flags & INTEGER_PACK_MSBYTE_FIRST) ? !HOST_BIGENDIAN_P : HOST_BIGENDIAN_P);
+            if (wordsize == 1) {
+                return integer_unpack_single_bdigit(*(uint8_t *)buf, sizeof(uint8_t), flags, dp);
+            }
+#if defined(HAVE_UINT16_T) && 2 <= SIZEOF_BDIGIT
+            if (wordsize == 2 && (uintptr_t)words % ALIGNOF(uint16_t) == 0) {
+                uint16_t u = *(uint16_t *)buf;
+                return integer_unpack_single_bdigit(need_swap ? swap16(u) : u, sizeof(uint16_t), flags, dp);
+            }
+#endif
+#if defined(HAVE_UINT32_T) && 4 <= SIZEOF_BDIGIT
+            if (wordsize == 4 && (uintptr_t)words % ALIGNOF(uint32_t) == 0) {
+                uint32_t u = *(uint32_t *)buf;
+                return integer_unpack_single_bdigit(need_swap ? swap32(u) : u, sizeof(uint32_t), flags, dp);
+            }
+#endif
+#if defined(HAVE_UINT64_T) && 8 <= SIZEOF_BDIGIT
+            if (wordsize == 8 && (uintptr_t)words % ALIGNOF(uint64_t) == 0) {
+                uint64_t u = *(uint64_t *)buf;
+                return integer_unpack_single_bdigit(need_swap ? swap64(u) : u, sizeof(uint64_t), flags, dp);
+            }
+#endif
+        }
+#if !defined(WORDS_BIGENDIAN)
+        if (nails == 0 && SIZEOF_BDIGIT == sizeof(BDIGIT) &&
+            (flags & INTEGER_PACK_WORDORDER_MASK) == INTEGER_PACK_LSWORD_FIRST &&
+            (flags & INTEGER_PACK_BYTEORDER_MASK) != INTEGER_PACK_MSBYTE_FIRST) {
+            size_t src_size = numwords * wordsize;
+            size_t dst_size = num_bdigits * SIZEOF_BDIGIT;
+            MEMCPY(dp, words, char, src_size);
+            if (flags & INTEGER_PACK_2COMP) {
+                if (flags & INTEGER_PACK_NEGATIVE) {
+                    int zero_p;
+                    memset((char*)dp + src_size, 0xff, dst_size - src_size);
+                    zero_p = bary_2comp(dp, num_bdigits);
+                    sign = zero_p ? -2 : -1;
+                }
+                else if (buf[src_size-1] >> (CHAR_BIT-1)) {
+                    memset((char*)dp + src_size, 0xff, dst_size - src_size);
+                    bary_2comp(dp, num_bdigits);
+                    sign = -1;
+                }
+                else {
+                    MEMZERO((char*)dp + src_size, char, dst_size - src_size);
+                    sign = 1;
+                }
+            }
+            else {
+                MEMZERO((char*)dp + src_size, char, dst_size - src_size);
+                sign = (flags & INTEGER_PACK_NEGATIVE) ? -1 : 1;
+            }
+            return sign;
+        }
+#endif
+        if (nails == 0 && SIZEOF_BDIGIT == sizeof(BDIGIT) &&
+            wordsize % SIZEOF_BDIGIT == 0) {
+            size_t bdigits_per_word = wordsize / SIZEOF_BDIGIT;
+            int mswordfirst_p = (flags & INTEGER_PACK_MSWORD_FIRST) != 0;
+            int msbytefirst_p = (flags & INTEGER_PACK_NATIVE_BYTE_ORDER) ? HOST_BIGENDIAN_P :
+                (flags & INTEGER_PACK_MSBYTE_FIRST) != 0;
+            MEMCPY(dp, words, BDIGIT, numwords*bdigits_per_word);
+            if (mswordfirst_p) {
+                bary_swap(dp, num_bdigits);
+            }
+            if (mswordfirst_p ? !msbytefirst_p : msbytefirst_p) {
+                size_t i;
+                BDIGIT *p = dp;
+                for (i = 0; i < numwords; i++) {
+                    bary_swap(p, bdigits_per_word);
+                    p += bdigits_per_word;
+                }
+            }
+            if (msbytefirst_p != HOST_BIGENDIAN_P) {
+                BDIGIT *p;
+                for (p = dp; p < de; p++) {
+                    BDIGIT d = *p;
+                    *p = swap_bdigit(d);
+                }
+            }
+            if (flags & INTEGER_PACK_2COMP) {
+                if (flags & INTEGER_PACK_NEGATIVE) {
+                    int zero_p = bary_2comp(dp, num_bdigits);
+                    sign = zero_p ? -2 : -1;
+                }
+                else if (BDIGIT_MSB(de[-1])) {
+                    bary_2comp(dp, num_bdigits);
+                    sign = -1;
+                }
+                else {
+                    sign = 1;
+                }
+            }
+            else {
+                sign = (flags & INTEGER_PACK_NEGATIVE) ? -1 : 1;
+            }
+            return sign;
+        }
+    }
+
+    if (num_bdigits != 0) {
+        int word_num_partialbits;
+        size_t word_num_fullbytes;
+
+        ssize_t word_step;
+        size_t byte_start;
+        int byte_step;
+
+        size_t word_start, word_last;
+        const unsigned char *wordp, *last_wordp;
+        BDIGIT_DBL dd;
+        int numbits_in_dd;
+
+        integer_pack_loop_setup(numwords, wordsize, nails, flags,
+            &word_num_fullbytes, &word_num_partialbits,
+            &word_start, &word_step, &word_last, &byte_start, &byte_step);
+
+        wordp = buf + word_start;
+        last_wordp = buf + word_last;
+
+        dd = 0;
+        numbits_in_dd = 0;
+
+#define PUSH_BITS(data, numbits) \
+        integer_unpack_push_bits(data, numbits, &dd, &numbits_in_dd, &dp)
+
+        while (1) {
+            size_t index_in_word = 0;
+            const unsigned char *bytep = wordp + byte_start;
+            while (index_in_word < word_num_fullbytes) {
+                PUSH_BITS(*bytep, CHAR_BIT);
+                bytep += byte_step;
+                index_in_word++;
+            }
+            if (word_num_partialbits) {
+                PUSH_BITS(*bytep & ((1 << word_num_partialbits) - 1), word_num_partialbits);
+                bytep += byte_step;
+                index_in_word++;
+            }
+
+            if (wordp == last_wordp)
+                break;
+
+            wordp += word_step;
+        }
+        if (dd)
+            *dp++ = (BDIGIT)dd;
+        assert(dp <= de);
+        while (dp < de)
+            *dp++ = 0;
+#undef PUSH_BITS
+    }
+
+    if (!(flags & INTEGER_PACK_2COMP)) {
+        sign = (flags & INTEGER_PACK_NEGATIVE) ? -1 : 1;
+    }
+    else {
+        if (nlp_bits) {
+            if ((flags & INTEGER_PACK_NEGATIVE) ||
+                (bdigits[num_bdigits-1] >> (BITSPERDIG - nlp_bits - 1))) {
+                bdigits[num_bdigits-1] |= BIGLO(BDIGMAX << (BITSPERDIG - nlp_bits));
+                sign = -1;
+            }
+            else {
+                sign = 1;
+            }
+        }
+        else {
+            if (flags & INTEGER_PACK_NEGATIVE) {
+                sign = bary_zero_p(bdigits, num_bdigits) ? -2 : -1;
+            }
+            else {
+                if (num_bdigits != 0 && BDIGIT_MSB(bdigits[num_bdigits-1]))
+                    sign = -1;
+                else
+                    sign = 1;
+            }
+        }
+        if (sign == -1 && num_bdigits != 0) {
+            bary_2comp(bdigits, num_bdigits);
+        }
+    }
+
+    return sign;
+}
+
+static void
+bary_unpack(BDIGIT *bdigits, size_t num_bdigits, const void *words, size_t numwords, size_t wordsize, size_t nails, int flags)
+{
+    size_t num_bdigits0;
+    int nlp_bits;
+    int sign;
+
+    validate_integer_pack_format(numwords, wordsize, nails, flags,
+            INTEGER_PACK_MSWORD_FIRST|
+            INTEGER_PACK_LSWORD_FIRST|
+            INTEGER_PACK_MSBYTE_FIRST|
+            INTEGER_PACK_LSBYTE_FIRST|
+            INTEGER_PACK_NATIVE_BYTE_ORDER|
+            INTEGER_PACK_2COMP|
+            INTEGER_PACK_FORCE_BIGNUM|
+            INTEGER_PACK_NEGATIVE|
+            INTEGER_PACK_FORCE_GENERIC_IMPLEMENTATION);
+
+    num_bdigits0 = integer_unpack_num_bdigits(numwords, wordsize, nails, &nlp_bits);
+
+    assert(num_bdigits0 <= num_bdigits);
+
+    sign = bary_unpack_internal(bdigits, num_bdigits0, words, numwords, wordsize, nails, flags, nlp_bits);
+
+    if (num_bdigits0 < num_bdigits) {
+        BDIGITS_ZERO(bdigits + num_bdigits0, num_bdigits - num_bdigits0);
+        if (sign == -2) {
+            bdigits[num_bdigits0] = 1;
+        }
+    }
+}
+
+static int
+bary_subb(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn, int borrow)
+{
+    BDIGIT_DBL_SIGNED num;
+    size_t i;
+    size_t sn;
+
+    assert(xn <= zn);
+    assert(yn <= zn);
+
+    sn = xn < yn ? xn : yn;
+
+    num = borrow ? -1 : 0;
+    for (i = 0; i < sn; i++) {
+	num += (BDIGIT_DBL_SIGNED)xds[i] - yds[i];
+	zds[i] = BIGLO(num);
 	num = BIGDN(num);
-    } while (i < x->len);
+    }
+    if (yn <= xn) {
+        for (; i < xn; i++) {
+            if (num == 0) goto num_is_zero;
+            num += xds[i];
+            zds[i] = BIGLO(num);
+            num = BIGDN(num);
+        }
+    }
+    else {
+        for (; i < yn; i++) {
+            num -= yds[i];
+            zds[i] = BIGLO(num);
+            num = BIGDN(num);
+        }
+    }
+    if (num == 0) goto num_is_zero;
+    for (; i < zn; i++) {
+	zds[i] = BDIGMAX;
+    }
+    return 1;
+
+  num_is_zero:
+    if (xds == zds && xn == zn)
+        return 0;
+    for (; i < xn; i++) {
+	zds[i] = xds[i];
+    }
+    for (; i < zn; i++) {
+	zds[i] = 0;
+    }
+    return 0;
+}
+
+static int
+bary_sub(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
+{
+    return bary_subb(zds, zn, xds, xn, yds, yn, 0);
+}
+
+static int
+bary_sub_one(BDIGIT *zds, size_t zn)
+{
+    return bary_subb(zds, zn, zds, zn, NULL, 0, 1);
+}
+
+static int
+bary_addc(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn, int carry)
+{
+    BDIGIT_DBL num;
+    size_t i;
+
+    assert(xn <= zn);
+    assert(yn <= zn);
+
+    if (xn > yn) {
+	const BDIGIT *tds;
+	tds = xds; xds = yds; yds = tds;
+	i = xn; xn = yn; yn = i;
+    }
+
+    num = carry ? 1 : 0;
+    for (i = 0; i < xn; i++) {
+	num += (BDIGIT_DBL)xds[i] + yds[i];
+	zds[i] = BIGLO(num);
+	num = BIGDN(num);
+    }
+    for (; i < yn; i++) {
+        if (num == 0) goto num_is_zero;
+	num += yds[i];
+	zds[i] = BIGLO(num);
+	num = BIGDN(num);
+    }
+    for (; i < zn; i++) {
+        if (num == 0) goto num_is_zero;
+	zds[i] = BIGLO(num);
+	num = BIGDN(num);
+    }
+    return num != 0;
+
+  num_is_zero:
+    if (yds == zds && yn == zn)
+        return 0;
+    for (; i < yn; i++) {
+	zds[i] = yds[i];
+    }
+    for (; i < zn; i++) {
+	zds[i] = 0;
+    }
+    return 0;
+}
+
+static int
+bary_add(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
+{
+    return bary_addc(zds, zn, xds, xn, yds, yn, 0);
+}
+
+static int
+bary_add_one(BDIGIT *ds, size_t n)
+{
+    size_t i;
+    for (i = 0; i < n; i++) {
+	ds[i] = BIGLO(ds[i]+1);
+        if (ds[i] != 0)
+            return 0;
+    }
+    return 1;
+}
+
+static void
+bary_mul_single(BDIGIT *zds, size_t zn, BDIGIT x, BDIGIT y)
+{
+    BDIGIT_DBL n;
+
+    assert(2 <= zn);
+
+    n = (BDIGIT_DBL)x * y;
+    bdigitdbl2bary(zds, 2, n);
+    BDIGITS_ZERO(zds + 2, zn - 2);
+}
+
+static int
+bary_muladd_1xN(BDIGIT *zds, size_t zn, BDIGIT x, const BDIGIT *yds, size_t yn)
+{
+    BDIGIT_DBL n;
+    BDIGIT_DBL dd;
+    size_t j;
+
+    assert(zn > yn);
+
+    if (x == 0)
+        return 0;
+    dd = x;
+    n = 0;
+    for (j = 0; j < yn; j++) {
+        BDIGIT_DBL ee = n + dd * yds[j];
+        if (ee) {
+            n = zds[j] + ee;
+            zds[j] = BIGLO(n);
+            n = BIGDN(n);
+        }
+        else {
+            n = 0;
+        }
+
+    }
+    for (; j < zn; j++) {
+        if (n == 0)
+            break;
+        n += zds[j];
+        zds[j] = BIGLO(n);
+        n = BIGDN(n);
+    }
+    return n != 0;
+}
+
+static BDIGIT_DBL_SIGNED
+bigdivrem_mulsub(BDIGIT *zds, size_t zn, BDIGIT x, const BDIGIT *yds, size_t yn)
+{
+    size_t i;
+    BDIGIT_DBL t2;
+    BDIGIT_DBL_SIGNED num;
+
+    assert(zn == yn + 1);
+
+    num = 0;
+    t2 = 0;
+    i = 0;
+
+    do {
+        BDIGIT_DBL ee;
+        t2 += (BDIGIT_DBL)yds[i] * x;
+        ee = num - BIGLO(t2);
+        num = (BDIGIT_DBL)zds[i] + ee;
+        if (ee) zds[i] = BIGLO(num);
+        num = BIGDN(num);
+        t2 = BIGDN(t2);
+    } while (++i < yn);
+    num += zds[i] - t2; /* borrow from high digit; don't update */
+    return num;
+}
+
+static int
+bary_mulsub_1xN(BDIGIT *zds, size_t zn, BDIGIT x, const BDIGIT *yds, size_t yn)
+{
+    BDIGIT_DBL_SIGNED num;
+
+    assert(zn == yn + 1);
+
+    num = bigdivrem_mulsub(zds, zn, x, yds, yn);
+    zds[yn] = BIGLO(num);
+    if (BIGDN(num))
+        return 1;
+    return 0;
+}
+
+static void
+bary_mul_normal(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
+{
+    size_t i;
+
+    assert(xn + yn <= zn);
+
+    BDIGITS_ZERO(zds, zn);
+    for (i = 0; i < xn; i++) {
+        bary_muladd_1xN(zds+i, zn-i, xds[i], yds, yn);
+    }
 }
 
 VALUE
-bignorm(x)
-    struct RBignum *x;
+rb_big_mul_normal(VALUE x, VALUE y)
 {
-    UINT len = x->len;
-    USHORT *ds = BDIGITS(x);
+    size_t xn = BIGNUM_LEN(x), yn = BIGNUM_LEN(y), zn = xn + yn;
+    VALUE z = bignew(zn, BIGNUM_SIGN(x)==BIGNUM_SIGN(y));
+    bary_mul_normal(BDIGITS(z), zn, BDIGITS(x), xn, BDIGITS(y), yn);
+    RB_GC_GUARD(x);
+    RB_GC_GUARD(y);
+    return z;
+}
 
-    while (len-- && !ds[len]) ;
-    x->len = ++len;
+/* efficient squaring (2 times faster than normal multiplication)
+ * ref: Handbook of Applied Cryptography, Algorithm 14.16
+ *      http://www.cacr.math.uwaterloo.ca/hac/about/chap14.pdf
+ */
+static void
+bary_sq_fast(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn)
+{
+    size_t i, j;
+    BDIGIT_DBL c, v, w;
+    BDIGIT vl;
+    int vh;
 
-    if (len*sizeof(USHORT) < sizeof(VALUE) ||
-	(len*sizeof(USHORT) == sizeof(VALUE) &&
-	 ds[sizeof(VALUE)/sizeof(USHORT)-1] <= 0x3fff)) {
-	long num = 0;
-	while (len--) {
-	    num = BIGUP(num) + ds[len];
+    assert(xn * 2 <= zn);
+
+    BDIGITS_ZERO(zds, zn);
+
+    if (xn == 0)
+        return;
+
+    for (i = 0; i < xn-1; i++) {
+	v = (BDIGIT_DBL)xds[i];
+	if (!v)
+            continue;
+	c = (BDIGIT_DBL)zds[i + i] + v * v;
+	zds[i + i] = BIGLO(c);
+	c = BIGDN(c);
+	v *= 2;
+        vl = BIGLO(v);
+        vh = (int)BIGDN(v);
+	for (j = i + 1; j < xn; j++) {
+	    w = (BDIGIT_DBL)xds[j];
+	    c += (BDIGIT_DBL)zds[i + j] + vl * w;
+	    zds[i + j] = BIGLO(c);
+	    c = BIGDN(c);
+	    if (vh)
+                c += w;
 	}
-	if (x->sign) {
-	    if (POSFIXABLE(num)) return INT2FIX(num);
+	if (c) {
+	    c += (BDIGIT_DBL)zds[i + xn];
+	    zds[i + xn] = BIGLO(c);
+	    c = BIGDN(c);
+            if (c)
+                zds[i + xn + 1] += (BDIGIT)c;
 	}
-	else if (NEGFIXABLE(-num)) return INT2FIX(-num);
     }
-    return (VALUE)x;
+
+    /* i == xn-1 */
+    v = (BDIGIT_DBL)xds[i];
+    if (!v)
+        return;
+    c = (BDIGIT_DBL)zds[i + i] + v * v;
+    zds[i + i] = BIGLO(c);
+    c = BIGDN(c);
+    if (c) {
+        zds[i + xn] += BIGLO(c);
+    }
 }
 
 VALUE
-uint2big(n)
-    UINT n;
+rb_big_sq_fast(VALUE x)
 {
-    UINT i = 0;
-    USHORT *digits;
-    struct RBignum *big;
+    size_t xn = BIGNUM_LEN(x), zn = 2 * xn;
+    VALUE z = bignew(zn, 1);
+    bary_sq_fast(BDIGITS(z), zn, BDIGITS(x), xn);
+    RB_GC_GUARD(x);
+    return z;
+}
 
-    i = 0;
-    big = (struct RBignum*)bignew(DIGSPERLONG, 1);
-    digits = BDIGITS(big);
-    while (i < DIGSPERLONG) {
-	digits[i++] = BIGLO(n);
-	n = BIGDN(n);
+/* balancing multiplication by slicing larger argument */
+static void
+bary_mul_balance_with_mulfunc(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn, BDIGIT *wds, size_t wn, mulfunc_t *mulfunc)
+{
+    VALUE work = 0;
+    size_t yn0 = yn;
+    size_t r, n;
+
+    assert(xn + yn <= zn);
+    assert(xn <= yn);
+    assert(!KARATSUBA_BALANCED(xn, yn) || !TOOM3_BALANCED(xn, yn));
+
+    BDIGITS_ZERO(zds, xn);
+
+    n = 0;
+    while (yn > 0) {
+        BDIGIT *tds;
+        size_t tn;
+	r = xn > yn ? yn : xn;
+        tn = xn + r;
+        if (2 * (xn + r) <= zn - n) {
+            tds = zds + n + xn + r;
+            mulfunc(tds, tn, xds, xn, yds + n, r, wds, wn);
+            BDIGITS_ZERO(zds + n + xn, r);
+            bary_add(zds + n, tn,
+                     zds + n, tn,
+                     tds, tn);
+        }
+        else {
+            if (wn < xn) {
+                wn = xn;
+                wds = ALLOCV_N(BDIGIT, work, wn);
+            }
+            tds = zds + n;
+            MEMCPY(wds, zds + n, BDIGIT, xn);
+            mulfunc(tds, tn, xds, xn, yds + n, r, wds+xn, wn-xn);
+            bary_add(zds + n, tn,
+                     zds + n, tn,
+                     wds, xn);
+        }
+	yn -= r;
+	n += r;
     }
+    BDIGITS_ZERO(zds+xn+yn0, zn - (xn+yn0));
 
-    i = DIGSPERLONG;
-    while (i-- && !digits[i]) ;
-    big->len = i+1;
+    if (work)
+        ALLOCV_END(work);
+}
+
+VALUE
+rb_big_mul_balance(VALUE x, VALUE y)
+{
+    size_t xn = BIGNUM_LEN(x), yn = BIGNUM_LEN(y), zn = xn + yn;
+    VALUE z = bignew(zn, BIGNUM_SIGN(x)==BIGNUM_SIGN(y));
+    bary_mul_balance_with_mulfunc(BDIGITS(z), zn, BDIGITS(x), xn, BDIGITS(y), yn, NULL, 0, bary_mul_toom3_start);
+    RB_GC_GUARD(x);
+    RB_GC_GUARD(y);
+    return z;
+}
+
+/* multiplication by karatsuba method */
+static void
+bary_mul_karatsuba(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn, BDIGIT *wds, size_t wn)
+{
+    VALUE work = 0;
+
+    size_t n;
+    int sub_p, borrow, carry1, carry2, carry3;
+
+    int odd_y = 0;
+    int odd_xy = 0;
+    int sq;
+
+    const BDIGIT *xds0, *xds1, *yds0, *yds1;
+    BDIGIT *zds0, *zds1, *zds2, *zds3;
+
+    assert(xn + yn <= zn);
+    assert(xn <= yn);
+    assert(yn < 2 * xn);
+
+    sq = xds == yds && xn == yn;
+
+    if (yn & 1) {
+        odd_y = 1;
+        yn--;
+        if (yn < xn) {
+            odd_xy = 1;
+            xn--;
+        }
+    }
+
+    n = yn / 2;
+
+    assert(n < xn);
+
+    if (wn < n) {
+        /* This function itself needs only n BDIGITs for work area.
+         * However this function calls bary_mul_karatsuba and
+         * bary_mul_balance recursively.
+         * 2n BDIGITs are enough to avoid allocations in
+         * the recursively called functions.
+         */
+        wn = 2*n;
+        wds = ALLOCV_N(BDIGIT, work, wn);
+    }
+
+    /* Karatsuba algorithm:
+     *
+     * x = x0 + r*x1
+     * y = y0 + r*y1
+     * z = x*y
+     *   = (x0 + r*x1) * (y0 + r*y1)
+     *   = x0*y0 + r*(x1*y0 + x0*y1) + r*r*x1*y1
+     *   = x0*y0 + r*(x0*y0 + x1*y1 - (x1-x0)*(y1-y0)) + r*r*x1*y1
+     *   = x0*y0 + r*(x0*y0 + x1*y1 - (x0-x1)*(y0-y1)) + r*r*x1*y1
+     */
+
+    xds0 = xds;
+    xds1 = xds + n;
+    yds0 = yds;
+    yds1 = yds + n;
+    zds0 = zds;
+    zds1 = zds + n;
+    zds2 = zds + 2*n;
+    zds3 = zds + 3*n;
+
+    sub_p = 1;
+
+    /* zds0:? zds1:? zds2:? zds3:? wds:? */
+
+    if (bary_sub(zds0, n, xds, n, xds+n, xn-n)) {
+        bary_2comp(zds0, n);
+        sub_p = !sub_p;
+    }
+
+    /* zds0:|x1-x0| zds1:? zds2:? zds3:? wds:? */
+
+    if (sq) {
+        sub_p = 1;
+        bary_mul_karatsuba_start(zds1, 2*n, zds0, n, zds0, n, wds, wn);
+    }
+    else {
+        if (bary_sub(wds, n, yds, n, yds+n, n)) {
+            bary_2comp(wds, n);
+            sub_p = !sub_p;
+        }
+
+        /* zds0:|x1-x0| zds1:? zds2:? zds3:? wds:|y1-y0| */
+
+        bary_mul_karatsuba_start(zds1, 2*n, zds0, n, wds, n, wds+n, wn-n);
+    }
+
+    /* zds0:|x1-x0| zds1,zds2:|x1-x0|*|y1-y0| zds3:? wds:|y1-y0| */
+
+    borrow = 0;
+    if (sub_p) {
+        borrow = !bary_2comp(zds1, 2*n);
+    }
+    /* zds0:|x1-x0| zds1,zds2:-?|x1-x0|*|y1-y0| zds3:? wds:|y1-y0| */
+
+    MEMCPY(wds, zds1, BDIGIT, n);
+
+    /* zds0:|x1-x0| zds1,zds2:-?|x1-x0|*|y1-y0| zds3:? wds:lo(-?|x1-x0|*|y1-y0|) */
+
+    bary_mul_karatsuba_start(zds0, 2*n, xds0, n, yds0, n, wds+n, wn-n);
+
+    /* zds0,zds1:x0*y0 zds2:hi(-?|x1-x0|*|y1-y0|) zds3:? wds:lo(-?|x1-x0|*|y1-y0|) */
+
+    carry1 = bary_add(wds, n, wds, n, zds0, n);
+    carry1 = bary_addc(zds2, n, zds2, n, zds1, n, carry1);
+
+    /* zds0,zds1:x0*y0 zds2:hi(x0*y0-?|x1-x0|*|y1-y0|) zds3:? wds:lo(x0*y0-?|x1-x0|*|y1-y0|) */
+
+    carry2 = bary_add(zds1, n, zds1, n, wds, n);
+
+    /* zds0:lo(x0*y0) zds1:hi(x0*y0)+lo(x0*y0-?|x1-x0|*|y1-y0|) zds2:hi(x0*y0-?|x1-x0|*|y1-y0|) zds3:? wds:lo(x0*y0-?|x1-x0|*|y1-y0|) */
+
+    MEMCPY(wds, zds2, BDIGIT, n);
+
+    /* zds0:lo(x0*y0) zds1:hi(x0*y0)+lo(x0*y0-?|x1-x0|*|y1-y0|) zds2:_ zds3:? wds:hi(x0*y0-?|x1-x0|*|y1-y0|) */
+
+    bary_mul_karatsuba_start(zds2, zn-2*n, xds1, xn-n, yds1, n, wds+n, wn-n);
+
+    /* zds0:lo(x0*y0) zds1:hi(x0*y0)+lo(x0*y0-?|x1-x0|*|y1-y0|) zds2,zds3:x1*y1 wds:hi(x0*y0-?|x1-x0|*|y1-y0|) */
+
+    carry3 = bary_add(zds1, n, zds1, n, zds2, n);
+
+    /* zds0:lo(x0*y0) zds1:hi(x0*y0)+lo(x0*y0-?|x1-x0|*|y1-y0|)+lo(x1*y1) zds2,zds3:x1*y1 wds:hi(x0*y0-?|x1-x0|*|y1-y0|) */
+
+    carry3 = bary_addc(zds2, n, zds2, n, zds3, (4*n < zn ? n : zn-3*n), carry3);
+
+    /* zds0:lo(x0*y0) zds1:hi(x0*y0)+lo(x0*y0-?|x1-x0|*|y1-y0|)+lo(x1*y1) zds2,zds3:x1*y1+hi(x1*y1) wds:hi(x0*y0-?|x1-x0|*|y1-y0|) */
+
+    bary_add(zds2, zn-2*n, zds2, zn-2*n, wds, n);
+
+    /* zds0:lo(x0*y0) zds1:hi(x0*y0)+lo(x0*y0-?|x1-x0|*|y1-y0|)+lo(x1*y1) zds2,zds3:x1*y1+hi(x1*y1)+hi(x0*y0-?|x1-x0|*|y1-y0|) wds:_ */
+
+    if (carry2)
+        bary_add_one(zds2, zn-2*n);
+
+    if (carry1 + carry3 - borrow < 0)
+        bary_sub_one(zds3, zn-3*n);
+    else if (carry1 + carry3 - borrow > 0) {
+        BDIGIT c = carry1 + carry3 - borrow;
+        bary_add(zds3, zn-3*n, zds3, zn-3*n, &c, 1);
+    }
+
+    /*
+    if (SIZEOF_BDIGIT * zn <= 16) {
+        uint128_t z, x, y;
+        ssize_t i;
+        for (x = 0, i = xn-1; 0 <= i; i--) { x <<= SIZEOF_BDIGIT*CHAR_BIT; x |= xds[i]; }
+        for (y = 0, i = yn-1; 0 <= i; i--) { y <<= SIZEOF_BDIGIT*CHAR_BIT; y |= yds[i]; }
+        for (z = 0, i = zn-1; 0 <= i; i--) { z <<= SIZEOF_BDIGIT*CHAR_BIT; z |= zds[i]; }
+        assert(z == x * y);
+    }
+    */
+
+    if (odd_xy) {
+        bary_muladd_1xN(zds+yn, zn-yn, yds[yn], xds, xn);
+        bary_muladd_1xN(zds+xn, zn-xn, xds[xn], yds, yn+1);
+    }
+    else if (odd_y) {
+        bary_muladd_1xN(zds+yn, zn-yn, yds[yn], xds, xn);
+    }
+
+    if (work)
+        ALLOCV_END(work);
+}
+
+VALUE
+rb_big_mul_karatsuba(VALUE x, VALUE y)
+{
+    size_t xn = BIGNUM_LEN(x), yn = BIGNUM_LEN(y), zn = xn + yn;
+    VALUE z = bignew(zn, BIGNUM_SIGN(x)==BIGNUM_SIGN(y));
+    if (!((xn <= yn && yn < 2) || KARATSUBA_BALANCED(xn, yn)))
+        rb_raise(rb_eArgError, "unexpected bignum length for karatsuba");
+    bary_mul_karatsuba(BDIGITS(z), zn, BDIGITS(x), xn, BDIGITS(y), yn, NULL, 0);
+    RB_GC_GUARD(x);
+    RB_GC_GUARD(y);
+    return z;
+}
+
+static void
+bary_mul_toom3(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn, BDIGIT *wds, size_t wn)
+{
+    size_t n;
+    size_t wnc;
+    VALUE work = 0;
+
+    /* "p" stands for "positive".  Actually it means "non-negative", though. */
+    size_t x0n; const BDIGIT *x0ds;
+    size_t x1n; const BDIGIT *x1ds;
+    size_t x2n; const BDIGIT *x2ds;
+    size_t y0n; const BDIGIT *y0ds;
+    size_t y1n; const BDIGIT *y1ds;
+    size_t y2n; const BDIGIT *y2ds;
+
+    size_t u1n; BDIGIT *u1ds; int u1p;
+    size_t u2n; BDIGIT *u2ds; int u2p;
+    size_t u3n; BDIGIT *u3ds; int u3p;
+
+    size_t v1n; BDIGIT *v1ds; int v1p;
+    size_t v2n; BDIGIT *v2ds; int v2p;
+    size_t v3n; BDIGIT *v3ds; int v3p;
+
+    size_t t0n; BDIGIT *t0ds; int t0p;
+    size_t t1n; BDIGIT *t1ds; int t1p;
+    size_t t2n; BDIGIT *t2ds; int t2p;
+    size_t t3n; BDIGIT *t3ds; int t3p;
+    size_t t4n; BDIGIT *t4ds; int t4p;
+
+    size_t z0n; BDIGIT *z0ds;
+    size_t z1n; BDIGIT *z1ds; int z1p;
+    size_t z2n; BDIGIT *z2ds; int z2p;
+    size_t z3n; BDIGIT *z3ds; int z3p;
+    size_t z4n; BDIGIT *z4ds;
+
+    size_t zzn; BDIGIT *zzds;
+
+    int sq = xds == yds && xn == yn;
+
+    assert(xn <= yn);  /* assume y >= x */
+    assert(xn + yn <= zn);
+
+    n = (yn + 2) / 3;
+    assert(2*n < xn);
+
+    wnc = 0;
+
+    wnc += (u1n = n+1); /* BITSPERDIG*n+2 bits */
+    wnc += (u2n = n+1); /* BITSPERDIG*n+1 bits */
+    wnc += (u3n = n+1); /* BITSPERDIG*n+3 bits */
+    wnc += (v1n = n+1); /* BITSPERDIG*n+2 bits */
+    wnc += (v2n = n+1); /* BITSPERDIG*n+1 bits */
+    wnc += (v3n = n+1); /* BITSPERDIG*n+3 bits */
+
+    wnc += (t0n = 2*n); /* BITSPERDIG*2*n bits */
+    wnc += (t1n = 2*n+2); /* BITSPERDIG*2*n+4 bits but bary_mul needs u1n+v1n */
+    wnc += (t2n = 2*n+2); /* BITSPERDIG*2*n+2 bits but bary_mul needs u2n+v2n */
+    wnc += (t3n = 2*n+2); /* BITSPERDIG*2*n+6 bits but bary_mul needs u3n+v3n */
+    wnc += (t4n = 2*n); /* BITSPERDIG*2*n bits */
+
+    wnc += (z1n = 2*n+1); /* BITSPERDIG*2*n+5 bits */
+    wnc += (z2n = 2*n+1); /* BITSPERDIG*2*n+6 bits */
+    wnc += (z3n = 2*n+1); /* BITSPERDIG*2*n+8 bits */
+
+    if (wn < wnc) {
+        wn = wnc * 3 / 2; /* Allocate working memory for whole recursion at once. */
+        wds = ALLOCV_N(BDIGIT, work, wn);
+    }
+
+    u1ds = wds; wds += u1n;
+    u2ds = wds; wds += u2n;
+    u3ds = wds; wds += u3n;
+
+    v1ds = wds; wds += v1n;
+    v2ds = wds; wds += v2n;
+    v3ds = wds; wds += v3n;
+
+    t0ds = wds; wds += t0n;
+    t1ds = wds; wds += t1n;
+    t2ds = wds; wds += t2n;
+    t3ds = wds; wds += t3n;
+    t4ds = wds; wds += t4n;
+
+    z1ds = wds; wds += z1n;
+    z2ds = wds; wds += z2n;
+    z3ds = wds; wds += z3n;
+
+    wn -= wnc;
+
+    zzds = u1ds;
+    zzn = 6*n+1;
+
+    x0n = n;
+    x1n = n;
+    x2n = xn - 2*n;
+    x0ds = xds;
+    x1ds = xds + n;
+    x2ds = xds + 2*n;
+
+    if (sq) {
+        y0n = x0n;
+        y1n = x1n;
+        y2n = x2n;
+        y0ds = x0ds;
+        y1ds = x1ds;
+        y2ds = x2ds;
+    }
+    else {
+        y0n = n;
+        y1n = n;
+        y2n = yn - 2*n;
+        y0ds = yds;
+        y1ds = yds + n;
+        y2ds = yds + 2*n;
+    }
+
+    /*
+     * ref. http://en.wikipedia.org/wiki/Toom%E2%80%93Cook_multiplication
+     *
+     * x(b) = x0 * b^0 + x1 * b^1 + x2 * b^2
+     * y(b) = y0 * b^0 + y1 * b^1 + y2 * b^2
+     *
+     * z(b) = x(b) * y(b)
+     * z(b) = z0 * b^0 + z1 * b^1 + z2 * b^2 + z3 * b^3 + z4 * b^4
+     * where:
+     *   z0 = x0 * y0
+     *   z1 = x0 * y1 + x1 * y0
+     *   z2 = x0 * y2 + x1 * y1 + x2 * y0
+     *   z3 = x1 * y2 + x2 * y1
+     *   z4 = x2 * y2
+     *
+     * Toom3 method (a.k.a. Toom-Cook method):
+     * (Step1) calculating 5 points z(b0), z(b1), z(b2), z(b3), z(b4),
+     * where:
+     *   b0 = 0, b1 = 1, b2 = -1, b3 = -2, b4 = inf,
+     *   z(0)   = x(0)   * y(0)   = x0 * y0
+     *   z(1)   = x(1)   * y(1)   = (x0 + x1 + x2) * (y0 + y1 + y2)
+     *   z(-1)  = x(-1)  * y(-1)  = (x0 - x1 + x2) * (y0 - y1 + y2)
+     *   z(-2)  = x(-2)  * y(-2)  = (x0 - 2 * (x1 - 2 * x2)) * (y0 - 2 * (y1 - 2 * y2))
+     *   z(inf) = x(inf) * y(inf) = x2 * y2
+     *
+     * (Step2) interpolating z0, z1, z2, z3 and z4.
+     *
+     * (Step3) Substituting base value into b of the polynomial z(b),
+     */
+
+    /*
+     * [Step1] calculating 5 points z(b0), z(b1), z(b2), z(b3), z(b4)
+     */
+
+    /* u1 <- x0 + x2 */
+    bary_add(u1ds, u1n, x0ds, x0n, x2ds, x2n);
+    u1p = 1;
+
+    /* x(-1) : u2 <- u1 - x1 = x0 - x1 + x2 */
+    if (bary_sub(u2ds, u2n, u1ds, u1n, x1ds, x1n)) {
+        bary_2comp(u2ds, u2n);
+        u2p = 0;
+    }
+    else {
+        u2p = 1;
+    }
+
+    /* x(1) : u1 <- u1 + x1 = x0 + x1 + x2 */
+    bary_add(u1ds, u1n, u1ds, u1n, x1ds, x1n);
+
+    /* x(-2) : u3 <- 2 * (u2 + x2) - x0 = x0 - 2 * (x1 - 2 * x2) */
+    u3p = 1;
+    if (u2p) {
+        bary_add(u3ds, u3n, u2ds, u2n, x2ds, x2n);
+    }
+    else if (bary_sub(u3ds, u3n, x2ds, x2n, u2ds, u2n)) {
+        bary_2comp(u3ds, u3n);
+        u3p = 0;
+    }
+    bary_small_lshift(u3ds, u3ds, u3n, 1);
+    if (!u3p) {
+        bary_add(u3ds, u3n, u3ds, u3n, x0ds, x0n);
+    }
+    else if (bary_sub(u3ds, u3n, u3ds, u3n, x0ds, x0n)) {
+        bary_2comp(u3ds, u3n);
+        u3p = 0;
+    }
+
+    if (sq) {
+        v1n = u1n; v1ds = u1ds; v1p = u1p;
+        v2n = u2n; v2ds = u2ds; v2p = u2p;
+        v3n = u3n; v3ds = u3ds; v3p = u3p;
+    }
+    else {
+	/* v1 <- y0 + y2 */
+        bary_add(v1ds, v1n, y0ds, y0n, y2ds, y2n);
+        v1p = 1;
+
+	/* y(-1) : v2 <- v1 - y1 = y0 - y1 + y2 */
+        v2p = 1;
+        if (bary_sub(v2ds, v2n, v1ds, v1n, y1ds, y1n)) {
+            bary_2comp(v2ds, v2n);
+            v2p = 0;
+        }
+
+	/* y(1) : v1 <- v1 + y1 = y0 + y1 + y2 */
+        bary_add(v1ds, v1n, v1ds, v1n, y1ds, y1n);
+
+	/* y(-2) : v3 <- 2 * (v2 + y2) - y0 = y0 - 2 * (y1 - 2 * y2) */
+        v3p = 1;
+        if (v2p) {
+            bary_add(v3ds, v3n, v2ds, v2n, y2ds, y2n);
+        }
+        else if (bary_sub(v3ds, v3n, y2ds, y2n, v2ds, v2n)) {
+            bary_2comp(v3ds, v3n);
+            v3p = 0;
+        }
+        bary_small_lshift(v3ds, v3ds, v3n, 1);
+        if (!v3p) {
+            bary_add(v3ds, v3n, v3ds, v3n, y0ds, y0n);
+        }
+        else if (bary_sub(v3ds, v3n, v3ds, v3n, y0ds, y0n)) {
+            bary_2comp(v3ds, v3n);
+            v3p = 0;
+        }
+    }
+
+    /* z(0) : t0 <- x0 * y0 */
+    bary_mul_toom3_start(t0ds, t0n, x0ds, x0n, y0ds, y0n, wds, wn);
+    t0p = 1;
+
+    /* z(1) : t1 <- u1 * v1 */
+    bary_mul_toom3_start(t1ds, t1n, u1ds, u1n, v1ds, v1n, wds, wn);
+    t1p = u1p == v1p;
+    assert(t1ds[t1n-1] == 0);
+    t1n--;
+
+    /* z(-1) : t2 <- u2 * v2 */
+    bary_mul_toom3_start(t2ds, t2n, u2ds, u2n, v2ds, v2n, wds, wn);
+    t2p = u2p == v2p;
+    assert(t2ds[t2n-1] == 0);
+    t2n--;
+
+    /* z(-2) : t3 <- u3 * v3 */
+    bary_mul_toom3_start(t3ds, t3n, u3ds, u3n, v3ds, v3n, wds, wn);
+    t3p = u3p == v3p;
+    assert(t3ds[t3n-1] == 0);
+    t3n--;
+
+    /* z(inf) : t4 <- x2 * y2 */
+    bary_mul_toom3_start(t4ds, t4n, x2ds, x2n, y2ds, y2n, wds, wn);
+    t4p = 1;
+
+    /*
+     * [Step2] interpolating z0, z1, z2, z3 and z4.
+     */
+
+    /* z0 <- z(0) == t0 */
+    z0n = t0n; z0ds = t0ds;
+
+    /* z4 <- z(inf) == t4 */
+    z4n = t4n; z4ds = t4ds;
+
+    /* z3 <- (z(-2) - z(1)) / 3 == (t3 - t1) / 3 */
+    if (t3p == t1p) {
+        z3p = t3p;
+        if (bary_sub(z3ds, z3n, t3ds, t3n, t1ds, t1n)) {
+            bary_2comp(z3ds, z3n);
+            z3p = !z3p;
+        }
+    }
+    else {
+        z3p = t3p;
+        bary_add(z3ds, z3n, t3ds, t3n, t1ds, t1n);
+    }
+    bigdivrem_single(z3ds, z3ds, z3n, 3);
+
+    /* z1 <- (z(1) - z(-1)) / 2 == (t1 - t2) / 2 */
+    if (t1p == t2p) {
+        z1p = t1p;
+        if (bary_sub(z1ds, z1n, t1ds, t1n, t2ds, t2n)) {
+            bary_2comp(z1ds, z1n);
+            z1p = !z1p;
+        }
+    }
+    else {
+        z1p = t1p;
+        bary_add(z1ds, z1n, t1ds, t1n, t2ds, t2n);
+    }
+    bary_small_rshift(z1ds, z1ds, z1n, 1, 0);
+
+    /* z2 <- z(-1) - z(0) == t2 - t0 */
+    if (t2p == t0p) {
+        z2p = t2p;
+        if (bary_sub(z2ds, z2n, t2ds, t2n, t0ds, t0n)) {
+            bary_2comp(z2ds, z2n);
+            z2p = !z2p;
+        }
+    }
+    else {
+        z2p = t2p;
+        bary_add(z2ds, z2n, t2ds, t2n, t0ds, t0n);
+    }
+
+    /* z3 <- (z2 - z3) / 2 + 2 * z(inf) == (z2 - z3) / 2 + 2 * t4 */
+    if (z2p == z3p) {
+        z3p = z2p;
+        if (bary_sub(z3ds, z3n, z2ds, z2n, z3ds, z3n)) {
+            bary_2comp(z3ds, z3n);
+            z3p = !z3p;
+        }
+    }
+    else {
+        z3p = z2p;
+        bary_add(z3ds, z3n, z2ds, z2n, z3ds, z3n);
+    }
+    bary_small_rshift(z3ds, z3ds, z3n, 1, 0);
+    if (z3p == t4p) {
+        bary_muladd_1xN(z3ds, z3n, 2, t4ds, t4n);
+    }
+    else {
+        if (bary_mulsub_1xN(z3ds, z3n, 2, t4ds, t4n)) {
+            bary_2comp(z3ds, z3n);
+            z3p = !z3p;
+        }
+    }
+
+    /* z2 <- z2 + z1 - z(inf) == z2 + z1 - t4 */
+    if (z2p == z1p) {
+        bary_add(z2ds, z2n, z2ds, z2n, z1ds, z1n);
+    }
+    else {
+        if (bary_sub(z2ds, z2n, z2ds, z2n, z1ds, z1n)) {
+            bary_2comp(z2ds, z2n);
+            z2p = !z2p;
+        }
+    }
+
+    if (z2p == t4p) {
+        if (bary_sub(z2ds, z2n, z2ds, z2n, t4ds, t4n)) {
+            bary_2comp(z2ds, z2n);
+            z2p = !z2p;
+        }
+    }
+    else {
+        bary_add(z2ds, z2n, z2ds, z2n, t4ds, t4n);
+    }
+
+    /* z1 <- z1 - z3 */
+    if (z1p == z3p) {
+        if (bary_sub(z1ds, z1n, z1ds, z1n, z3ds, z3n)) {
+            bary_2comp(z1ds, z1n);
+            z1p = !z1p;
+        }
+    }
+    else {
+        bary_add(z1ds, z1n, z1ds, z1n, z3ds, z3n);
+    }
+
+    /*
+     * [Step3] Substituting base value into b of the polynomial z(b),
+     */
+
+    MEMCPY(zzds, z0ds, BDIGIT, z0n);
+    BDIGITS_ZERO(zzds + z0n, 4*n - z0n);
+    MEMCPY(zzds + 4*n, z4ds, BDIGIT, z4n);
+    BDIGITS_ZERO(zzds + 4*n + z4n, zzn - (4*n + z4n));
+    if (z1p)
+        bary_add(zzds +   n, zzn -   n, zzds +   n, zzn -   n, z1ds, z1n);
+    else
+        bary_sub(zzds +   n, zzn -   n, zzds +   n, zzn -   n, z1ds, z1n);
+    if (z2p)
+        bary_add(zzds + 2*n, zzn - 2*n, zzds + 2*n, zzn - 2*n, z2ds, z2n);
+    else
+        bary_sub(zzds + 2*n, zzn - 2*n, zzds + 2*n, zzn - 2*n, z2ds, z2n);
+    if (z3p)
+        bary_add(zzds + 3*n, zzn - 3*n, zzds + 3*n, zzn - 3*n, z3ds, z3n);
+    else
+        bary_sub(zzds + 3*n, zzn - 3*n, zzds + 3*n, zzn - 3*n, z3ds, z3n);
+
+    BARY_TRUNC(zzds, zzn);
+    MEMCPY(zds, zzds, BDIGIT, zzn);
+    BDIGITS_ZERO(zds + zzn, zn - zzn);
+
+    if (work)
+        ALLOCV_END(work);
+}
+
+VALUE
+rb_big_mul_toom3(VALUE x, VALUE y)
+{
+    size_t xn = BIGNUM_LEN(x), yn = BIGNUM_LEN(y), zn = xn + yn;
+    VALUE z = bignew(zn, BIGNUM_SIGN(x)==BIGNUM_SIGN(y));
+    if (xn > yn || yn < 3 || !TOOM3_BALANCED(xn,yn))
+        rb_raise(rb_eArgError, "unexpected bignum length for toom3");
+    bary_mul_toom3(BDIGITS(z), zn, BDIGITS(x), xn, BDIGITS(y), yn, NULL, 0);
+    RB_GC_GUARD(x);
+    RB_GC_GUARD(y);
+    return z;
+}
+
+#ifdef USE_GMP
+static void
+bary_mul_gmp(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
+{
+    const size_t nails = (sizeof(BDIGIT)-SIZEOF_BDIGIT)*CHAR_BIT;
+    mpz_t x, y, z;
+    size_t count;
+
+    assert(xn + yn <= zn);
+
+    mpz_init(x);
+    mpz_init(y);
+    mpz_init(z);
+    mpz_import(x, xn, -1, sizeof(BDIGIT), 0, nails, xds);
+    if (xds == yds && xn == yn) {
+        mpz_mul(z, x, x);
+    }
+    else {
+        mpz_import(y, yn, -1, sizeof(BDIGIT), 0, nails, yds);
+        mpz_mul(z, x, y);
+    }
+    mpz_export(zds, &count, -1, sizeof(BDIGIT), 0, nails, z);
+    BDIGITS_ZERO(zds+count, zn-count);
+    mpz_clear(x);
+    mpz_clear(y);
+    mpz_clear(z);
+}
+
+VALUE
+rb_big_mul_gmp(VALUE x, VALUE y)
+{
+    size_t xn = BIGNUM_LEN(x), yn = BIGNUM_LEN(y), zn = xn + yn;
+    VALUE z = bignew(zn, BIGNUM_SIGN(x)==BIGNUM_SIGN(y));
+    bary_mul_gmp(BDIGITS(z), zn, BDIGITS(x), xn, BDIGITS(y), yn);
+    RB_GC_GUARD(x);
+    RB_GC_GUARD(y);
+    return z;
+}
+#endif
+
+static void
+bary_short_mul(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
+{
+    assert(xn + yn <= zn);
+
+    if (xn == 1 && yn == 1) {
+        bary_mul_single(zds, zn, xds[0], yds[0]);
+    }
+    else {
+        bary_mul_normal(zds, zn, xds, xn, yds, yn);
+        rb_thread_check_ints();
+    }
+}
+
+/* determine whether a bignum is sparse or not by random sampling */
+static inline int
+bary_sparse_p(const BDIGIT *ds, size_t n)
+{
+    long c = 0;
+
+    if (          ds[rb_genrand_ulong_limited(n / 2) + n / 4]) c++;
+    if (c <= 1 && ds[rb_genrand_ulong_limited(n / 2) + n / 4]) c++;
+    if (c <= 1 && ds[rb_genrand_ulong_limited(n / 2) + n / 4]) c++;
+
+    return (c <= 1) ? 1 : 0;
+}
+
+static int
+bary_mul_precheck(BDIGIT **zdsp, size_t *znp, const BDIGIT **xdsp, size_t *xnp, const BDIGIT **ydsp, size_t *ynp)
+{
+    size_t nlsz; /* number of least significant zero BDIGITs */
+
+    BDIGIT *zds = *zdsp;
+    size_t zn = *znp;
+    const BDIGIT *xds = *xdsp;
+    size_t xn = *xnp;
+    const BDIGIT *yds = *ydsp;
+    size_t yn = *ynp;
+
+    assert(xn + yn <= zn);
+
+    nlsz = 0;
+
+    while (0 < xn) {
+        if (xds[xn-1] == 0) {
+            xn--;
+        }
+        else {
+            do {
+                if (xds[0] != 0)
+                    break;
+                xds++;
+                xn--;
+                nlsz++;
+            } while (0 < xn);
+            break;
+        }
+    }
+
+    while (0 < yn) {
+        if (yds[yn-1] == 0) {
+            yn--;
+        }
+        else {
+            do {
+                if (yds[0] != 0)
+                    break;
+                yds++;
+                yn--;
+                nlsz++;
+            } while (0 < yn);
+            break;
+        }
+    }
+
+    if (nlsz) {
+        BDIGITS_ZERO(zds, nlsz);
+        zds += nlsz;
+        zn -= nlsz;
+    }
+
+    /* make sure that y is longer than x */
+    if (xn > yn) {
+        const BDIGIT *tds;
+        size_t tn;
+	tds = xds; xds = yds; yds = tds;
+	tn = xn; xn = yn; yn = tn;
+    }
+    assert(xn <= yn);
+
+    if (xn <= 1) {
+        if (xn == 0) {
+            BDIGITS_ZERO(zds, zn);
+            return 1;
+        }
+
+        if (xds[0] == 1) {
+            MEMCPY(zds, yds, BDIGIT, yn);
+            BDIGITS_ZERO(zds+yn, zn-yn);
+            return 1;
+        }
+        if (POW2_P(xds[0])) {
+            zds[yn] = bary_small_lshift(zds, yds, yn, bit_length(xds[0])-1);
+            BDIGITS_ZERO(zds+yn+1, zn-yn-1);
+            return 1;
+        }
+        if (yn == 1 && yds[0] == 1) {
+            zds[0] = xds[0];
+            BDIGITS_ZERO(zds+1, zn-1);
+            return 1;
+        }
+        bary_mul_normal(zds, zn, xds, xn, yds, yn);
+        return 1;
+    }
+
+    *zdsp = zds;
+    *znp = zn;
+    *xdsp = xds;
+    *xnp = xn;
+    *ydsp = yds;
+    *ynp = yn;
+
+    return 0;
+}
+
+static void
+bary_mul_karatsuba_branch(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn, BDIGIT *wds, size_t wn)
+{
+    /* normal multiplication when x is small */
+    if (xn < KARATSUBA_MUL_DIGITS) {
+      normal:
+        if (xds == yds && xn == yn)
+            bary_sq_fast(zds, zn, xds, xn);
+        else
+            bary_short_mul(zds, zn, xds, xn, yds, yn);
+        return;
+    }
+
+    /* normal multiplication when x or y is a sparse bignum */
+    if (bary_sparse_p(xds, xn)) goto normal;
+    if (bary_sparse_p(yds, yn)) {
+        bary_short_mul(zds, zn, yds, yn, xds, xn);
+        return;
+    }
+
+    /* balance multiplication by slicing y when x is much smaller than y */
+    if (!KARATSUBA_BALANCED(xn, yn)) {
+        bary_mul_balance_with_mulfunc(zds, zn, xds, xn, yds, yn, wds, wn, bary_mul_karatsuba_start);
+        return;
+    }
+
+    /* multiplication by karatsuba method */
+    bary_mul_karatsuba(zds, zn, xds, xn, yds, yn, wds, wn);
+}
+
+static void
+bary_mul_karatsuba_start(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn, BDIGIT *wds, size_t wn)
+{
+    if (bary_mul_precheck(&zds, &zn, &xds, &xn, &yds, &yn))
+        return;
+
+    bary_mul_karatsuba_branch(zds, zn, xds, xn, yds, yn, wds, wn);
+}
+
+static void
+bary_mul_toom3_branch(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn, BDIGIT *wds, size_t wn)
+{
+    if (xn < TOOM3_MUL_DIGITS) {
+        bary_mul_karatsuba_branch(zds, zn, xds, xn, yds, yn, wds, wn);
+        return;
+    }
+
+    if (!TOOM3_BALANCED(xn, yn)) {
+        bary_mul_balance_with_mulfunc(zds, zn, xds, xn, yds, yn, wds, wn, bary_mul_toom3_start);
+        return;
+    }
+
+    bary_mul_toom3(zds, zn, xds, xn, yds, yn, wds, wn);
+}
+
+static void
+bary_mul_toom3_start(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn, BDIGIT *wds, size_t wn)
+{
+    if (bary_mul_precheck(&zds, &zn, &xds, &xn, &yds, &yn))
+        return;
+
+    bary_mul_toom3_branch(zds, zn, xds, xn, yds, yn, wds, wn);
+}
+
+static void
+bary_mul(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
+{
+#ifdef USE_GMP
+    const size_t naive_threshold = GMP_MUL_DIGITS;
+#else
+    const size_t naive_threshold = KARATSUBA_MUL_DIGITS;
+#endif
+    if (xn <= yn) {
+        if (xn < naive_threshold) {
+            if (xds == yds && xn == yn)
+                bary_sq_fast(zds, zn, xds, xn);
+            else
+                bary_short_mul(zds, zn, xds, xn, yds, yn);
+            return;
+        }
+    }
+    else {
+        if (yn < naive_threshold) {
+            bary_short_mul(zds, zn, yds, yn, xds, xn);
+            return;
+        }
+    }
+
+#ifdef USE_GMP
+    bary_mul_gmp(zds, zn, xds, xn, yds, yn);
+#else
+    bary_mul_toom3_start(zds, zn, xds, xn, yds, yn, NULL, 0);
+#endif
+}
+
+struct big_div_struct {
+    size_t yn, zn;
+    BDIGIT *yds, *zds;
+    volatile VALUE stop;
+};
+
+static void *
+bigdivrem1(void *ptr)
+{
+    struct big_div_struct *bds = (struct big_div_struct*)ptr;
+    size_t yn = bds->yn;
+    size_t zn = bds->zn;
+    BDIGIT *yds = bds->yds, *zds = bds->zds;
+    BDIGIT_DBL_SIGNED num;
+    BDIGIT q;
+
+    do {
+	if (bds->stop) {
+	    bds->zn = zn;
+	    return 0;
+        }
+	if (zds[zn-1] == yds[yn-1]) q = BDIGMAX;
+	else q = (BDIGIT)((BIGUP(zds[zn-1]) + zds[zn-2])/yds[yn-1]);
+	if (q) {
+            num = bigdivrem_mulsub(zds+zn-(yn+1), yn+1,
+                                   q,
+                                   yds, yn);
+	    while (num) { /* "add back" required */
+		q--;
+                num = bary_add(zds+zn-(yn+1), yn,
+                               zds+zn-(yn+1), yn,
+                               yds, yn);
+                num--;
+	    }
+	}
+        zn--;
+	zds[zn] = q;
+    } while (zn > yn);
+    return 0;
+}
+
+static void
+rb_big_stop(void *ptr)
+{
+    struct big_div_struct *bds = ptr;
+    bds->stop = Qtrue;
+}
+
+static BDIGIT
+bigdivrem_single1(BDIGIT *qds, const BDIGIT *xds, size_t xn, BDIGIT x_higher_bdigit, BDIGIT y)
+{
+    assert(0 < xn);
+    assert(x_higher_bdigit < y);
+    if (POW2_P(y)) {
+        BDIGIT r;
+        r = xds[0] & (y-1);
+        bary_small_rshift(qds, xds, xn, bit_length(y)-1, x_higher_bdigit);
+        return r;
+    }
+    else {
+        size_t i;
+        BDIGIT_DBL t2;
+        t2 = x_higher_bdigit;
+        i = xn;
+        while (i--) {
+            t2 = BIGUP(t2) + xds[i];
+            qds[i] = (BDIGIT)(t2 / y);
+            t2 %= y;
+        }
+        return (BDIGIT)t2;
+    }
+}
+
+static BDIGIT
+bigdivrem_single(BDIGIT *qds, const BDIGIT *xds, size_t xn, BDIGIT y)
+{
+    return bigdivrem_single1(qds, xds, xn, 0, y);
+}
+
+static void
+bigdivrem_restoring(BDIGIT *zds, size_t zn, BDIGIT *yds, size_t yn)
+{
+    struct big_div_struct bds;
+    size_t ynzero;
+
+    assert(yn < zn);
+    assert(BDIGIT_MSB(yds[yn-1]));
+    assert(zds[zn-1] < yds[yn-1]);
+
+    for (ynzero = 0; !yds[ynzero]; ynzero++);
+
+    if (ynzero+1 == yn) {
+        BDIGIT r;
+        r = bigdivrem_single1(zds+yn, zds+ynzero, zn-yn, zds[zn-1], yds[ynzero]);
+        zds[ynzero] = r;
+        return;
+    }
+
+    bds.yn = yn - ynzero;
+    bds.zds = zds + ynzero;
+    bds.yds = yds + ynzero;
+    bds.stop = Qfalse;
+    bds.zn = zn - ynzero;
+    if (bds.zn > 10000 || bds.yn > 10000) {
+      retry:
+	bds.stop = Qfalse;
+	rb_thread_call_without_gvl(bigdivrem1, &bds, rb_big_stop, &bds);
+
+	if (bds.stop == Qtrue) {
+	    /* execute trap handler, but exception was not raised. */
+	    goto retry;
+	}
+    }
+    else {
+	bigdivrem1(&bds);
+    }
+}
+
+static void
+bary_divmod_normal(BDIGIT *qds, size_t qn, BDIGIT *rds, size_t rn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
+{
+    int shift;
+    BDIGIT *zds, *yyds;
+    size_t zn;
+    VALUE tmpyz = 0;
+
+    assert(yn < xn || (xn == yn && yds[yn - 1] <= xds[xn - 1]));
+    assert(qds ? (xn - yn + 1) <= qn : 1);
+    assert(rds ? yn <= rn : 1);
+
+    zn = xn + BIGDIVREM_EXTRA_WORDS;
+
+    shift = nlz(yds[yn-1]);
+    if (shift) {
+        int alloc_y = !rds;
+        int alloc_z = !qds || qn < zn;
+        if (alloc_y && alloc_z) {
+            yyds = ALLOCV_N(BDIGIT, tmpyz, yn+zn);
+            zds = yyds + yn;
+        }
+        else {
+            yyds = alloc_y ? ALLOCV_N(BDIGIT, tmpyz, yn) : rds;
+            zds = alloc_z ? ALLOCV_N(BDIGIT, tmpyz, zn) : qds;
+        }
+        zds[xn] = bary_small_lshift(zds, xds, xn, shift);
+        bary_small_lshift(yyds, yds, yn, shift);
+    }
+    else {
+        if (qds && zn <= qn)
+            zds = qds;
+        else
+            zds = ALLOCV_N(BDIGIT, tmpyz, zn);
+        MEMCPY(zds, xds, BDIGIT, xn);
+        zds[xn] = 0;
+        /* bigdivrem_restoring will not modify y.
+         * So use yds directly.  */
+        yyds = (BDIGIT *)yds;
+    }
+
+    bigdivrem_restoring(zds, zn, yyds, yn);
+
+    if (rds) {
+        if (shift)
+            bary_small_rshift(rds, zds, yn, shift, 0);
+        else
+            MEMCPY(rds, zds, BDIGIT, yn);
+        BDIGITS_ZERO(rds+yn, rn-yn);
+    }
+
+    if (qds) {
+        size_t j = zn - yn;
+        MEMMOVE(qds, zds+yn, BDIGIT, j);
+        BDIGITS_ZERO(qds+j, qn-j);
+    }
+
+    if (tmpyz)
+        ALLOCV_END(tmpyz);
+}
+
+VALUE
+rb_big_divrem_normal(VALUE x, VALUE y)
+{
+    size_t xn = BIGNUM_LEN(x), yn = BIGNUM_LEN(y), qn, rn;
+    BDIGIT *xds = BDIGITS(x), *yds = BDIGITS(y), *qds, *rds;
+    VALUE q, r;
+
+    BARY_TRUNC(yds, yn);
+    if (yn == 0)
+        rb_num_zerodiv();
+    BARY_TRUNC(xds, xn);
+
+    if (xn < yn || (xn == yn && xds[xn - 1] < yds[yn - 1]))
+        return rb_assoc_new(LONG2FIX(0), x);
+
+    qn = xn + BIGDIVREM_EXTRA_WORDS;
+    q = bignew(qn, BIGNUM_SIGN(x)==BIGNUM_SIGN(y));
+    qds = BDIGITS(q);
+
+    rn = yn;
+    r = bignew(rn, BIGNUM_SIGN(x));
+    rds = BDIGITS(r);
+
+    bary_divmod_normal(qds, qn, rds, rn, xds, xn, yds, yn);
+
+    bigtrunc(q);
+    bigtrunc(r);
+
+    RB_GC_GUARD(x);
+    RB_GC_GUARD(y);
+
+    return rb_assoc_new(q, r);
+}
+
+#ifdef USE_GMP
+static void
+bary_divmod_gmp(BDIGIT *qds, size_t qn, BDIGIT *rds, size_t rn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
+{
+    const size_t nails = (sizeof(BDIGIT)-SIZEOF_BDIGIT)*CHAR_BIT;
+    mpz_t x, y, q, r;
+    size_t count;
+
+    assert(yn < xn || (xn == yn && yds[yn - 1] <= xds[xn - 1]));
+    assert(qds ? (xn - yn + 1) <= qn : 1);
+    assert(rds ? yn <= rn : 1);
+    assert(qds || rds);
+
+    mpz_init(x);
+    mpz_init(y);
+    if (qds) mpz_init(q);
+    if (rds) mpz_init(r);
+
+    mpz_import(x, xn, -1, sizeof(BDIGIT), 0, nails, xds);
+    mpz_import(y, yn, -1, sizeof(BDIGIT), 0, nails, yds);
+
+    if (!rds) {
+        mpz_fdiv_q(q, x, y);
+    }
+    else if (!qds) {
+        mpz_fdiv_r(r, x, y);
+    }
+    else {
+        mpz_fdiv_qr(q, r, x, y);
+    }
+
+    mpz_clear(x);
+    mpz_clear(y);
+
+    if (qds) {
+        mpz_export(qds, &count, -1, sizeof(BDIGIT), 0, nails, q);
+        BDIGITS_ZERO(qds+count, qn-count);
+        mpz_clear(q);
+    }
+
+    if (rds) {
+        mpz_export(rds, &count, -1, sizeof(BDIGIT), 0, nails, r);
+        BDIGITS_ZERO(rds+count, rn-count);
+        mpz_clear(r);
+    }
+}
+
+VALUE
+rb_big_divrem_gmp(VALUE x, VALUE y)
+{
+    size_t xn = BIGNUM_LEN(x), yn = BIGNUM_LEN(y), qn, rn;
+    BDIGIT *xds = BDIGITS(x), *yds = BDIGITS(y), *qds, *rds;
+    VALUE q, r;
+
+    BARY_TRUNC(yds, yn);
+    if (yn == 0)
+        rb_num_zerodiv();
+    BARY_TRUNC(xds, xn);
+
+    if (xn < yn || (xn == yn && xds[xn - 1] < yds[yn - 1]))
+        return rb_assoc_new(LONG2FIX(0), x);
+
+    qn = xn - yn + 1;
+    q = bignew(qn, BIGNUM_SIGN(x)==BIGNUM_SIGN(y));
+    qds = BDIGITS(q);
+
+    rn = yn;
+    r = bignew(rn, BIGNUM_SIGN(x));
+    rds = BDIGITS(r);
+
+    bary_divmod_gmp(qds, qn, rds, rn, xds, xn, yds, yn);
+
+    bigtrunc(q);
+    bigtrunc(r);
+
+    RB_GC_GUARD(x);
+    RB_GC_GUARD(y);
+
+    return rb_assoc_new(q, r);
+}
+#endif
+
+static void
+bary_divmod_branch(BDIGIT *qds, size_t qn, BDIGIT *rds, size_t rn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
+{
+#ifdef USE_GMP
+    if (GMP_DIV_DIGITS < xn) {
+        bary_divmod_gmp(qds, qn, rds, rn, xds, xn, yds, yn);
+        return;
+    }
+#endif
+    bary_divmod_normal(qds, qn, rds, rn, xds, xn, yds, yn);
+}
+
+static void
+bary_divmod(BDIGIT *qds, size_t qn, BDIGIT *rds, size_t rn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
+{
+    assert(xn <= qn);
+    assert(yn <= rn);
+
+    BARY_TRUNC(yds, yn);
+    if (yn == 0)
+        rb_num_zerodiv();
+
+    BARY_TRUNC(xds, xn);
+    if (xn == 0) {
+        BDIGITS_ZERO(qds, qn);
+        BDIGITS_ZERO(rds, rn);
+        return;
+    }
+
+    if (xn < yn || (xn == yn && xds[xn - 1] < yds[yn - 1])) {
+        MEMCPY(rds, xds, BDIGIT, xn);
+        BDIGITS_ZERO(rds+xn, rn-xn);
+        BDIGITS_ZERO(qds, qn);
+    }
+    else if (yn == 1) {
+        MEMCPY(qds, xds, BDIGIT, xn);
+        BDIGITS_ZERO(qds+xn, qn-xn);
+        rds[0] = bigdivrem_single(qds, xds, xn, yds[0]);
+        BDIGITS_ZERO(rds+1, rn-1);
+    }
+    else if (xn == 2 && yn == 2) {
+        BDIGIT_DBL x = bary2bdigitdbl(xds, 2);
+        BDIGIT_DBL y = bary2bdigitdbl(yds, 2);
+        BDIGIT_DBL q = x / y;
+        BDIGIT_DBL r = x % y;
+        qds[0] = BIGLO(q);
+        qds[1] = BIGLO(BIGDN(q));
+        BDIGITS_ZERO(qds+2, qn-2);
+        rds[0] = BIGLO(r);
+        rds[1] = BIGLO(BIGDN(r));
+        BDIGITS_ZERO(rds+2, rn-2);
+    }
+    else {
+        bary_divmod_branch(qds, qn, rds, rn, xds, xn, yds, yn);
+    }
+}
+
+
+#define BIGNUM_DEBUG 0
+#if BIGNUM_DEBUG
+#define ON_DEBUG(x) do { x; } while (0)
+static void
+dump_bignum(VALUE x)
+{
+    long i;
+    printf("%c0x0", BIGNUM_SIGN(x) ? '+' : '-');
+    for (i = BIGNUM_LEN(x); i--; ) {
+        printf("_%0*"PRIxBDIGIT, SIZEOF_BDIGIT*2, BDIGITS(x)[i]);
+    }
+    printf(", len=%"PRIuSIZE, BIGNUM_LEN(x));
+    puts("");
+}
+
+static VALUE
+rb_big_dump(VALUE x)
+{
+    dump_bignum(x);
+    return x;
+}
+#else
+#define ON_DEBUG(x)
+#endif
+
+static int
+bigzero_p(VALUE x)
+{
+    return bary_zero_p(BDIGITS(x), BIGNUM_LEN(x));
+}
+
+int
+rb_bigzero_p(VALUE x)
+{
+    return BIGZEROP(x);
+}
+
+int
+rb_cmpint(VALUE val, VALUE a, VALUE b)
+{
+    if (NIL_P(val)) {
+	rb_cmperr(a, b);
+    }
+    if (FIXNUM_P(val)) {
+        long l = FIX2LONG(val);
+        if (l > 0) return 1;
+        if (l < 0) return -1;
+        return 0;
+    }
+    if (RB_BIGNUM_TYPE_P(val)) {
+	if (BIGZEROP(val)) return 0;
+	if (BIGNUM_SIGN(val)) return 1;
+	return -1;
+    }
+    if (RTEST(rb_funcall(val, '>', 1, INT2FIX(0)))) return 1;
+    if (RTEST(rb_funcall(val, '<', 1, INT2FIX(0)))) return -1;
+    return 0;
+}
+
+#define BIGNUM_SET_LEN(b,l) \
+    ((RBASIC(b)->flags & BIGNUM_EMBED_FLAG) ? \
+     (void)(RBASIC(b)->flags = \
+	    (RBASIC(b)->flags & ~BIGNUM_EMBED_LEN_MASK) | \
+	    ((l) << BIGNUM_EMBED_LEN_SHIFT)) : \
+     (void)(RBIGNUM(b)->as.heap.len = (l)))
+
+static void
+rb_big_realloc(VALUE big, size_t len)
+{
+    BDIGIT *ds;
+    if (RBASIC(big)->flags & BIGNUM_EMBED_FLAG) {
+	if (BIGNUM_EMBED_LEN_MAX < len) {
+	    ds = ALLOC_N(BDIGIT, len);
+	    MEMCPY(ds, RBIGNUM(big)->as.ary, BDIGIT, BIGNUM_EMBED_LEN_MAX);
+	    RBIGNUM(big)->as.heap.len = BIGNUM_LEN(big);
+	    RBIGNUM(big)->as.heap.digits = ds;
+	    RBASIC(big)->flags &= ~BIGNUM_EMBED_FLAG;
+	}
+    }
+    else {
+	if (len <= BIGNUM_EMBED_LEN_MAX) {
+	    ds = RBIGNUM(big)->as.heap.digits;
+	    RBASIC(big)->flags |= BIGNUM_EMBED_FLAG;
+	    BIGNUM_SET_LEN(big, len);
+            (void)VALGRIND_MAKE_MEM_UNDEFINED((void*)RBIGNUM(big)->as.ary, sizeof(RBIGNUM(big)->as.ary));
+	    if (ds) {
+		MEMCPY(RBIGNUM(big)->as.ary, ds, BDIGIT, len);
+		xfree(ds);
+	    }
+	}
+	else {
+	    if (BIGNUM_LEN(big) == 0) {
+		RBIGNUM(big)->as.heap.digits = ALLOC_N(BDIGIT, len);
+	    }
+	    else {
+		REALLOC_N(RBIGNUM(big)->as.heap.digits, BDIGIT, len);
+	    }
+	}
+    }
+}
+
+void
+rb_big_resize(VALUE big, size_t len)
+{
+    rb_big_realloc(big, len);
+    BIGNUM_SET_LEN(big, len);
+}
+
+static VALUE
+bignew_1(VALUE klass, size_t len, int sign)
+{
+    NEWOBJ_OF(big, struct RBignum, klass, T_BIGNUM | (RGENGC_WB_PROTECTED_BIGNUM ? FL_WB_PROTECTED : 0));
+    BIGNUM_SET_SIGN(big, sign?1:0);
+    if (len <= BIGNUM_EMBED_LEN_MAX) {
+	RBASIC(big)->flags |= BIGNUM_EMBED_FLAG;
+	BIGNUM_SET_LEN(big, len);
+        (void)VALGRIND_MAKE_MEM_UNDEFINED((void*)RBIGNUM(big)->as.ary, sizeof(RBIGNUM(big)->as.ary));
+    }
+    else {
+	RBIGNUM(big)->as.heap.digits = ALLOC_N(BDIGIT, len);
+	RBIGNUM(big)->as.heap.len = len;
+    }
+    OBJ_FREEZE(big);
     return (VALUE)big;
 }
 
 VALUE
-int2big(n)
-    int n;
+rb_big_new(size_t len, int sign)
+{
+    return bignew(len, sign != 0);
+}
+
+VALUE
+rb_big_clone(VALUE x)
+{
+    size_t len = BIGNUM_LEN(x);
+    VALUE z = bignew_1(CLASS_OF(x), len, BIGNUM_SIGN(x));
+
+    MEMCPY(BDIGITS(z), BDIGITS(x), BDIGIT, len);
+    return z;
+}
+
+static void
+big_extend_carry(VALUE x)
+{
+    rb_big_resize(x, BIGNUM_LEN(x)+1);
+    BDIGITS(x)[BIGNUM_LEN(x)-1] = 1;
+}
+
+/* modify a bignum by 2's complement */
+static void
+get2comp(VALUE x)
+{
+    long i = BIGNUM_LEN(x);
+    BDIGIT *ds = BDIGITS(x);
+
+    if (bary_2comp(ds, i)) {
+        big_extend_carry(x);
+    }
+}
+
+void
+rb_big_2comp(VALUE x)			/* get 2's complement */
+{
+    get2comp(x);
+}
+
+static BDIGIT
+abs2twocomp(VALUE *xp, long *n_ret)
 {
-    int neg = 0;
-    struct RBignum *big;
+    VALUE x = *xp;
+    long n = BIGNUM_LEN(x);
+    BDIGIT *ds = BDIGITS(x);
+    BDIGIT hibits = 0;
+
+    BARY_TRUNC(ds, n);
+
+    if (n != 0 && BIGNUM_NEGATIVE_P(x)) {
+        VALUE z = bignew_1(CLASS_OF(x), n, 0);
+        MEMCPY(BDIGITS(z), ds, BDIGIT, n);
+        bary_2comp(BDIGITS(z), n);
+        hibits = BDIGMAX;
+	*xp = z;
+    }
+    *n_ret = n;
+    return hibits;
+}
+
+static void
+twocomp2abs_bang(VALUE x, int hibits)
+{
+    BIGNUM_SET_SIGN(x, !hibits);
+    if (hibits) {
+        get2comp(x);
+    }
+}
+
+static inline VALUE
+bigtrunc(VALUE x)
+{
+    size_t len = BIGNUM_LEN(x);
+    BDIGIT *ds = BDIGITS(x);
+
+    if (len == 0) return x;
+    while (--len && !ds[len]);
+    if (BIGNUM_LEN(x) > len+1) {
+	rb_big_resize(x, len+1);
+    }
+    return x;
+}
+
+static inline VALUE
+bigfixize(VALUE x)
+{
+    size_t n = BIGNUM_LEN(x);
+    BDIGIT *ds = BDIGITS(x);
+#if SIZEOF_BDIGIT < SIZEOF_LONG
+    unsigned long u;
+#else
+    BDIGIT u;
+#endif
+
+    BARY_TRUNC(ds, n);
+
+    if (n == 0) return INT2FIX(0);
+
+#if SIZEOF_BDIGIT < SIZEOF_LONG
+    if (sizeof(long)/SIZEOF_BDIGIT < n)
+        goto return_big;
+    else {
+        int i = (int)n;
+        u = 0;
+        while (i--) {
+            u = (unsigned long)(BIGUP(u) + ds[i]);
+        }
+    }
+#else /* SIZEOF_BDIGIT >= SIZEOF_LONG */
+    if (1 < n)
+        goto return_big;
+    else
+        u = ds[0];
+#endif
+
+    if (BIGNUM_POSITIVE_P(x)) {
+        if (POSFIXABLE(u)) return LONG2FIX((long)u);
+    }
+    else {
+        if (u <= -FIXNUM_MIN) return LONG2FIX(-(long)u);
+    }
+
+  return_big:
+    rb_big_resize(x, n);
+    return x;
+}
+
+static VALUE
+bignorm(VALUE x)
+{
+    if (RB_BIGNUM_TYPE_P(x)) {
+	x = bigfixize(x);
+    }
+    return x;
+}
+
+VALUE
+rb_big_norm(VALUE x)
+{
+    return bignorm(x);
+}
+
+VALUE
+rb_uint2big(VALUE n)
+{
+    long i;
+    VALUE big = bignew(bdigit_roomof(SIZEOF_VALUE), 1);
+    BDIGIT *digits = BDIGITS(big);
+
+#if SIZEOF_BDIGIT >= SIZEOF_VALUE
+    digits[0] = n;
+#else
+    for (i = 0; i < bdigit_roomof(SIZEOF_VALUE); i++) {
+	digits[i] = BIGLO(n);
+	n = BIGDN(n);
+    }
+#endif
+
+    i = bdigit_roomof(SIZEOF_VALUE);
+    while (--i && !digits[i]) ;
+    BIGNUM_SET_LEN(big, i+1);
+    return big;
+}
+
+VALUE
+rb_int2big(SIGNED_VALUE n)
+{
+    long neg = 0;
+    VALUE u;
+    VALUE big;
 
     if (n < 0) {
-	n = -n;
+        u = 1 + (VALUE)(-(n + 1)); /* u = -n avoiding overflow */
 	neg = 1;
     }
-    big = (struct RBignum*)uint2big(n);
+    else {
+        u = n;
+    }
+    big = rb_uint2big(u);
     if (neg) {
-	big->sign = FALSE;
+	BIGNUM_SET_SIGN(big, 0);
     }
-    return (VALUE)big;
+    return big;
 }
 
 VALUE
-uint2inum(n)
-    UINT n;
+rb_uint2inum(VALUE n)
 {
-    if (POSFIXABLE(n)) return INT2FIX(n);
-    return uint2big(n);
+    if (POSFIXABLE(n)) return LONG2FIX(n);
+    return rb_uint2big(n);
 }
 
 VALUE
-int2inum(n)
-    int n;
+rb_int2inum(SIGNED_VALUE n)
+{
+    if (FIXABLE(n)) return LONG2FIX(n);
+    return rb_int2big(n);
+}
+
+void
+rb_big_pack(VALUE val, unsigned long *buf, long num_longs)
 {
-    if (FIXABLE(n)) return INT2FIX(n);
-    return int2big(n);
+    rb_integer_pack(val, buf, num_longs, sizeof(long), 0,
+            INTEGER_PACK_LSWORD_FIRST|INTEGER_PACK_NATIVE_BYTE_ORDER|
+            INTEGER_PACK_2COMP);
 }
 
 VALUE
-str2inum(str, base)
-    char *str;
-    int base;
+rb_big_unpack(unsigned long *buf, long num_longs)
 {
-    char sign = 1, c;
-    unsigned long num;
-    UINT len, blen = 1, i;
+    return rb_integer_unpack(buf, num_longs, sizeof(long), 0,
+            INTEGER_PACK_LSWORD_FIRST|INTEGER_PACK_NATIVE_BYTE_ORDER|
+            INTEGER_PACK_2COMP);
+}
+
+/*
+ * Calculate the number of bytes to be required to represent
+ * the absolute value of the integer given as _val_.
+ *
+ * [val] an integer.
+ * [nlz_bits_ret] number of leading zero bits in the most significant byte is returned if not NULL.
+ *
+ * This function returns ((val_numbits * CHAR_BIT + CHAR_BIT - 1) / CHAR_BIT)
+ * where val_numbits is the number of bits of abs(val).
+ * This function should not overflow.
+ *
+ * If nlz_bits_ret is not NULL,
+ * (return_value * CHAR_BIT - val_numbits) is stored in *nlz_bits_ret.
+ * In this case, 0 <= *nlz_bits_ret < CHAR_BIT.
+ *
+ */
+size_t
+rb_absint_size(VALUE val, int *nlz_bits_ret)
+{
+    BDIGIT *dp;
+    BDIGIT *de;
+    BDIGIT fixbuf[bdigit_roomof(sizeof(long))];
+
+    int num_leading_zeros;
+
+    val = rb_to_int(val);
+
+    if (FIXNUM_P(val)) {
+        long v = FIX2LONG(val);
+        if (v < 0) {
+            v = -v;
+        }
+#if SIZEOF_BDIGIT >= SIZEOF_LONG
+        fixbuf[0] = v;
+#else
+        {
+            int i;
+            for (i = 0; i < numberof(fixbuf); i++) {
+                fixbuf[i] = BIGLO(v);
+                v = BIGDN(v);
+            }
+        }
+#endif
+        dp = fixbuf;
+        de = fixbuf + numberof(fixbuf);
+    }
+    else {
+        dp = BDIGITS(val);
+        de = dp + BIGNUM_LEN(val);
+    }
+    while (dp < de && de[-1] == 0)
+        de--;
+    if (dp == de) {
+        if (nlz_bits_ret)
+            *nlz_bits_ret = 0;
+        return 0;
+    }
+    num_leading_zeros = nlz(de[-1]);
+    if (nlz_bits_ret)
+        *nlz_bits_ret = num_leading_zeros % CHAR_BIT;
+    return (de - dp) * SIZEOF_BDIGIT - num_leading_zeros / CHAR_BIT;
+}
+
+static size_t
+absint_numwords_small(size_t numbytes, int nlz_bits_in_msbyte, size_t word_numbits, size_t *nlz_bits_ret)
+{
+    size_t val_numbits = numbytes * CHAR_BIT - nlz_bits_in_msbyte;
+    size_t div = val_numbits / word_numbits;
+    size_t mod = val_numbits % word_numbits;
+    size_t numwords;
+    size_t nlz_bits;
+    numwords = mod == 0 ? div : div + 1;
+    nlz_bits = mod == 0 ? 0 : word_numbits - mod;
+    *nlz_bits_ret = nlz_bits;
+    return numwords;
+}
+
+static size_t
+absint_numwords_generic(size_t numbytes, int nlz_bits_in_msbyte, size_t word_numbits, size_t *nlz_bits_ret)
+{
+    static const BDIGIT char_bit[1] = { CHAR_BIT };
+    BDIGIT numbytes_bary[bdigit_roomof(sizeof(numbytes))];
+    BDIGIT val_numbits_bary[bdigit_roomof(sizeof(numbytes) + 1)];
+    BDIGIT nlz_bits_in_msbyte_bary[1];
+    BDIGIT word_numbits_bary[bdigit_roomof(sizeof(word_numbits))];
+    BDIGIT div_bary[numberof(val_numbits_bary) + BIGDIVREM_EXTRA_WORDS];
+    BDIGIT mod_bary[numberof(word_numbits_bary)];
+    BDIGIT one[1] = { 1 };
+    size_t nlz_bits;
+    size_t mod;
+    int sign;
+    size_t numwords;
+
+    nlz_bits_in_msbyte_bary[0] = nlz_bits_in_msbyte;
+
+    /*
+     * val_numbits = numbytes * CHAR_BIT - nlz_bits_in_msbyte
+     * div, mod = val_numbits.divmod(word_numbits)
+     * numwords = mod == 0 ? div : div + 1
+     * nlz_bits = mod == 0 ? 0 : word_numbits - mod
+     */
+
+    bary_unpack(BARY_ARGS(numbytes_bary), &numbytes, 1, sizeof(numbytes), 0,
+        INTEGER_PACK_NATIVE_BYTE_ORDER);
+    BARY_SHORT_MUL(val_numbits_bary, numbytes_bary, char_bit);
+    if (nlz_bits_in_msbyte)
+        BARY_SUB(val_numbits_bary, val_numbits_bary, nlz_bits_in_msbyte_bary);
+    bary_unpack(BARY_ARGS(word_numbits_bary), &word_numbits, 1, sizeof(word_numbits), 0,
+        INTEGER_PACK_NATIVE_BYTE_ORDER);
+    BARY_DIVMOD(div_bary, mod_bary, val_numbits_bary, word_numbits_bary);
+    if (BARY_ZERO_P(mod_bary)) {
+        nlz_bits = 0;
+    }
+    else {
+        BARY_ADD(div_bary, div_bary, one);
+        bary_pack(+1, BARY_ARGS(mod_bary), &mod, 1, sizeof(mod), 0,
+            INTEGER_PACK_NATIVE_BYTE_ORDER);
+        nlz_bits = word_numbits - mod;
+    }
+    sign = bary_pack(+1, BARY_ARGS(div_bary), &numwords, 1, sizeof(numwords), 0,
+        INTEGER_PACK_NATIVE_BYTE_ORDER);
+
+    if (sign == 2) {
+#if defined __GNUC__ && (__GNUC__ == 4 && __GNUC_MINOR__ == 4)
+	*nlz_bits_ret = 0;
+#endif
+        return (size_t)-1;
+    }
+    *nlz_bits_ret = nlz_bits;
+    return numwords;
+}
+
+/*
+ * Calculate the number of words to be required to represent
+ * the absolute value of the integer given as _val_.
+ *
+ * [val] an integer.
+ * [word_numbits] number of bits in a word.
+ * [nlz_bits_ret] number of leading zero bits in the most significant word is returned if not NULL.
+ *
+ * This function returns ((val_numbits * CHAR_BIT + word_numbits - 1) / word_numbits)
+ * where val_numbits is the number of bits of abs(val).
+ *
+ * This function can overflow.
+ * When overflow occur, (size_t)-1 is returned.
+ *
+ * If nlz_bits_ret is not NULL and overflow is not occur,
+ * (return_value * word_numbits - val_numbits) is stored in *nlz_bits_ret.
+ * In this case, 0 <= *nlz_bits_ret < word_numbits.
+ *
+ */
+size_t
+rb_absint_numwords(VALUE val, size_t word_numbits, size_t *nlz_bits_ret)
+{
+    size_t numbytes;
+    int nlz_bits_in_msbyte;
+    size_t numwords;
+    size_t nlz_bits;
+
+    if (word_numbits == 0)
+        return (size_t)-1;
+
+    numbytes = rb_absint_size(val, &nlz_bits_in_msbyte);
+
+    if (numbytes <= SIZE_MAX / CHAR_BIT) {
+        numwords = absint_numwords_small(numbytes, nlz_bits_in_msbyte, word_numbits, &nlz_bits);
+#ifdef DEBUG_INTEGER_PACK
+        {
+            size_t numwords0, nlz_bits0;
+            numwords0 = absint_numwords_generic(numbytes, nlz_bits_in_msbyte, word_numbits, &nlz_bits0);
+            assert(numwords0 == numwords);
+            assert(nlz_bits0 == nlz_bits);
+        }
+#endif
+    }
+    else {
+        numwords = absint_numwords_generic(numbytes, nlz_bits_in_msbyte, word_numbits, &nlz_bits);
+    }
+    if (numwords == (size_t)-1)
+        return numwords;
+
+    if (nlz_bits_ret)
+        *nlz_bits_ret = nlz_bits;
+
+    return numwords;
+}
+
+/* Test abs(val) consists only a bit or not.
+ *
+ * Returns 1 if abs(val) == 1 << n for some n >= 0.
+ * Returns 0 otherwise.
+ *
+ * rb_absint_singlebit_p can be used to determine required buffer size
+ * for rb_integer_pack used with INTEGER_PACK_2COMP (two's complement).
+ *
+ * Following example calculates number of bits required to
+ * represent val in two's complement number, without sign bit.
+ *
+ *   size_t size;
+ *   int neg = FIXNUM_P(val) ? FIX2LONG(val) < 0 : BIGNUM_NEGATIVE_P(val);
+ *   size = rb_absint_numwords(val, 1, NULL)
+ *   if (size == (size_t)-1) ...overflow...
+ *   if (neg && rb_absint_singlebit_p(val))
+ *     size--;
+ *
+ * Following example calculates number of bytes required to
+ * represent val in two's complement number, with sign bit.
+ *
+ *   size_t size;
+ *   int neg = FIXNUM_P(val) ? FIX2LONG(val) < 0 : BIGNUM_NEGATIVE_P(val);
+ *   int nlz_bits;
+ *   size = rb_absint_size(val, &nlz_bits);
+ *   if (nlz_bits == 0 && !(neg && rb_absint_singlebit_p(val)))
+ *     size++;
+ */
+int
+rb_absint_singlebit_p(VALUE val)
+{
+    BDIGIT *dp;
+    BDIGIT *de;
+    BDIGIT fixbuf[bdigit_roomof(sizeof(long))];
+    BDIGIT d;
+
+    val = rb_to_int(val);
+
+    if (FIXNUM_P(val)) {
+        long v = FIX2LONG(val);
+        if (v < 0) {
+            v = -v;
+        }
+#if SIZEOF_BDIGIT >= SIZEOF_LONG
+        fixbuf[0] = v;
+#else
+        {
+            int i;
+            for (i = 0; i < numberof(fixbuf); i++) {
+                fixbuf[i] = BIGLO(v);
+                v = BIGDN(v);
+            }
+        }
+#endif
+        dp = fixbuf;
+        de = fixbuf + numberof(fixbuf);
+    }
+    else {
+        dp = BDIGITS(val);
+        de = dp + BIGNUM_LEN(val);
+    }
+    while (dp < de && de[-1] == 0)
+        de--;
+    while (dp < de && dp[0] == 0)
+        dp++;
+    if (dp == de) /* no bit set. */
+        return 0;
+    if (dp != de-1) /* two non-zero words. two bits set, at least. */
+        return 0;
+    d = *dp;
+    return POW2_P(d);
+}
+
+
+/*
+ * Export an integer into a buffer.
+ *
+ * This function fills the buffer specified by _words_ and _numwords_ as
+ * val in the format specified by _wordsize_, _nails_ and _flags_.
+ *
+ * [val] Fixnum, Bignum or another integer like object which has to_int method.
+ * [words] buffer to export abs(val).
+ * [numwords] the size of given buffer as number of words.
+ * [wordsize] the size of word as number of bytes.
+ * [nails] number of padding bits in a word.
+ *   Most significant nails bits of each word are filled by zero.
+ * [flags] bitwise or of constants which name starts "INTEGER_PACK_".
+ *
+ * flags:
+ * [INTEGER_PACK_MSWORD_FIRST] Store the most significant word as the first word.
+ * [INTEGER_PACK_LSWORD_FIRST] Store the least significant word as the first word.
+ * [INTEGER_PACK_MSBYTE_FIRST] Store the most significant byte in a word as the first byte in the word.
+ * [INTEGER_PACK_LSBYTE_FIRST] Store the least significant byte in a word as the first byte in the word.
+ * [INTEGER_PACK_NATIVE_BYTE_ORDER] INTEGER_PACK_MSBYTE_FIRST or INTEGER_PACK_LSBYTE_FIRST corresponding to the host's endian.
+ * [INTEGER_PACK_2COMP] Use 2's complement representation.
+ * [INTEGER_PACK_LITTLE_ENDIAN] Same as INTEGER_PACK_LSWORD_FIRST|INTEGER_PACK_LSBYTE_FIRST
+ * [INTEGER_PACK_BIG_ENDIAN] Same as INTEGER_PACK_MSWORD_FIRST|INTEGER_PACK_MSBYTE_FIRST
+ * [INTEGER_PACK_FORCE_GENERIC_IMPLEMENTATION] Use generic implementation (for test and debug).
+ *
+ * This function fills the buffer specified by _words_
+ * as abs(val) if INTEGER_PACK_2COMP is not specified in _flags_.
+ * If INTEGER_PACK_2COMP is specified, 2's complement representation of val is
+ * filled in the buffer.
+ *
+ * This function returns the signedness and overflow condition.
+ * The overflow condition depends on INTEGER_PACK_2COMP.
+ *
+ * INTEGER_PACK_2COMP is not specified:
+ *   -2 : negative overflow.  val <= -2**(numwords*(wordsize*CHAR_BIT-nails))
+ *   -1 : negative without overflow.  -2**(numwords*(wordsize*CHAR_BIT-nails)) < val < 0
+ *   0 : zero.  val == 0
+ *   1 : positive without overflow.  0 < val < 2**(numwords*(wordsize*CHAR_BIT-nails))
+ *   2 : positive overflow.  2**(numwords*(wordsize*CHAR_BIT-nails)) <= val
+ *
+ * INTEGER_PACK_2COMP is specified:
+ *   -2 : negative overflow.  val < -2**(numwords*(wordsize*CHAR_BIT-nails))
+ *   -1 : negative without overflow.  -2**(numwords*(wordsize*CHAR_BIT-nails)) <= val < 0
+ *   0 : zero.  val == 0
+ *   1 : positive without overflow.  0 < val < 2**(numwords*(wordsize*CHAR_BIT-nails))
+ *   2 : positive overflow.  2**(numwords*(wordsize*CHAR_BIT-nails)) <= val
+ *
+ * The value, -2**(numwords*(wordsize*CHAR_BIT-nails)), is representable
+ * in 2's complement representation but not representable in absolute value.
+ * So -1 is returned for the value if INTEGER_PACK_2COMP is specified
+ * but returns -2 if INTEGER_PACK_2COMP is not specified.
+ *
+ * The least significant words are filled in the buffer when overflow occur.
+ */
+
+int
+rb_integer_pack(VALUE val, void *words, size_t numwords, size_t wordsize, size_t nails, int flags)
+{
+    int sign;
+    BDIGIT *ds;
+    size_t num_bdigits;
+    BDIGIT fixbuf[bdigit_roomof(sizeof(long))];
+
+    RB_GC_GUARD(val) = rb_to_int(val);
+
+    if (FIXNUM_P(val)) {
+        long v = FIX2LONG(val);
+        if (v < 0) {
+            sign = -1;
+            v = -v;
+        }
+        else {
+            sign = 1;
+        }
+#if SIZEOF_BDIGIT >= SIZEOF_LONG
+        fixbuf[0] = v;
+#else
+        {
+            int i;
+            for (i = 0; i < numberof(fixbuf); i++) {
+                fixbuf[i] = BIGLO(v);
+                v = BIGDN(v);
+            }
+        }
+#endif
+        ds = fixbuf;
+        num_bdigits = numberof(fixbuf);
+    }
+    else {
+        sign = BIGNUM_POSITIVE_P(val) ? 1 : -1;
+        ds = BDIGITS(val);
+        num_bdigits = BIGNUM_LEN(val);
+    }
+
+    return bary_pack(sign, ds, num_bdigits, words, numwords, wordsize, nails, flags);
+}
+
+/*
+ * Import an integer into a buffer.
+ *
+ * [words] buffer to import.
+ * [numwords] the size of given buffer as number of words.
+ * [wordsize] the size of word as number of bytes.
+ * [nails] number of padding bits in a word.
+ *   Most significant nails bits of each word are ignored.
+ * [flags] bitwise or of constants which name starts "INTEGER_PACK_".
+ *
+ * flags:
+ * [INTEGER_PACK_MSWORD_FIRST] Interpret the first word as the most significant word.
+ * [INTEGER_PACK_LSWORD_FIRST] Interpret the first word as the least significant word.
+ * [INTEGER_PACK_MSBYTE_FIRST] Interpret the first byte in a word as the most significant byte in the word.
+ * [INTEGER_PACK_LSBYTE_FIRST] Interpret the first byte in a word as the least significant byte in the word.
+ * [INTEGER_PACK_NATIVE_BYTE_ORDER] INTEGER_PACK_MSBYTE_FIRST or INTEGER_PACK_LSBYTE_FIRST corresponding to the host's endian.
+ * [INTEGER_PACK_2COMP] Use 2's complement representation.
+ * [INTEGER_PACK_LITTLE_ENDIAN] Same as INTEGER_PACK_LSWORD_FIRST|INTEGER_PACK_LSBYTE_FIRST
+ * [INTEGER_PACK_BIG_ENDIAN] Same as INTEGER_PACK_MSWORD_FIRST|INTEGER_PACK_MSBYTE_FIRST
+ * [INTEGER_PACK_FORCE_BIGNUM] the result will be a Bignum
+ *   even if it is representable as a Fixnum.
+ * [INTEGER_PACK_NEGATIVE] Returns non-positive value.
+ *   (Returns non-negative value if not specified.)
+ * [INTEGER_PACK_FORCE_GENERIC_IMPLEMENTATION] Use generic implementation (for test and debug).
+ *
+ * This function returns the imported integer as Fixnum or Bignum.
+ *
+ * The range of the result value depends on INTEGER_PACK_2COMP and INTEGER_PACK_NEGATIVE.
+ *
+ * INTEGER_PACK_2COMP is not set:
+ *   0 <= val < 2**(numwords*(wordsize*CHAR_BIT-nails)) if !INTEGER_PACK_NEGATIVE
+ *   -2**(numwords*(wordsize*CHAR_BIT-nails)) < val <= 0 if INTEGER_PACK_NEGATIVE
+ *
+ * INTEGER_PACK_2COMP is set:
+ *   -2**(numwords*(wordsize*CHAR_BIT-nails)-1) <= val <= 2**(numwords*(wordsize*CHAR_BIT-nails)-1)-1 if !INTEGER_PACK_NEGATIVE
+ *   -2**(numwords*(wordsize*CHAR_BIT-nails)) <= val <= -1 if INTEGER_PACK_NEGATIVE
+ *
+ * INTEGER_PACK_2COMP without INTEGER_PACK_NEGATIVE means sign extension.
+ * INTEGER_PACK_2COMP with INTEGER_PACK_NEGATIVE mean assuming the higher bits are 1.
+ *
+ * Note that this function returns 0 when numwords is zero and
+ * INTEGER_PACK_2COMP is set but INTEGER_PACK_NEGATIVE is not set.
+ */
+
+VALUE
+rb_integer_unpack(const void *words, size_t numwords, size_t wordsize, size_t nails, int flags)
+{
+    VALUE val;
+    size_t num_bdigits;
+    int sign;
+    int nlp_bits;
+    BDIGIT *ds;
+    BDIGIT fixbuf[2] = { 0, 0 };
+
+    validate_integer_pack_format(numwords, wordsize, nails, flags,
+            INTEGER_PACK_MSWORD_FIRST|
+            INTEGER_PACK_LSWORD_FIRST|
+            INTEGER_PACK_MSBYTE_FIRST|
+            INTEGER_PACK_LSBYTE_FIRST|
+            INTEGER_PACK_NATIVE_BYTE_ORDER|
+            INTEGER_PACK_2COMP|
+            INTEGER_PACK_FORCE_BIGNUM|
+            INTEGER_PACK_NEGATIVE|
+            INTEGER_PACK_FORCE_GENERIC_IMPLEMENTATION);
+
+    num_bdigits = integer_unpack_num_bdigits(numwords, wordsize, nails, &nlp_bits);
+
+    if (LONG_MAX-1 < num_bdigits)
+        rb_raise(rb_eArgError, "too big to unpack as an integer");
+    if (num_bdigits <= numberof(fixbuf) && !(flags & INTEGER_PACK_FORCE_BIGNUM)) {
+        val = Qfalse;
+        ds = fixbuf;
+    }
+    else {
+        val = bignew((long)num_bdigits, 0);
+        ds = BDIGITS(val);
+    }
+    sign = bary_unpack_internal(ds, num_bdigits, words, numwords, wordsize, nails, flags, nlp_bits);
+
+    if (sign == -2) {
+        if (val) {
+            big_extend_carry(val);
+        }
+        else if (num_bdigits == numberof(fixbuf)) {
+            val = bignew((long)num_bdigits+1, 0);
+	    MEMCPY(BDIGITS(val), fixbuf, BDIGIT, num_bdigits);
+            BDIGITS(val)[num_bdigits++] = 1;
+        }
+        else {
+            ds[num_bdigits++] = 1;
+        }
+    }
+
+    if (!val) {
+        BDIGIT_DBL u = fixbuf[0] + BIGUP(fixbuf[1]);
+        if (u == 0)
+            return LONG2FIX(0);
+	if (0 < sign && POSFIXABLE(u))
+            return LONG2FIX(u);
+	if (sign < 0 && BDIGIT_MSB(fixbuf[1]) == 0 &&
+                NEGFIXABLE(-(BDIGIT_DBL_SIGNED)u))
+            return LONG2FIX(-(BDIGIT_DBL_SIGNED)u);
+        val = bignew((long)num_bdigits, 0 <= sign);
+        MEMCPY(BDIGITS(val), fixbuf, BDIGIT, num_bdigits);
+    }
+
+    if ((flags & INTEGER_PACK_FORCE_BIGNUM) && sign != 0 &&
+        bary_zero_p(BDIGITS(val), BIGNUM_LEN(val)))
+        sign = 0;
+    BIGNUM_SET_SIGN(val, 0 <= sign);
+
+    if (flags & INTEGER_PACK_FORCE_BIGNUM)
+        return bigtrunc(val);
+    return bignorm(val);
+}
+
+#define conv_digit(c) (ruby_digit36_to_number_table[(unsigned char)(c)])
+
+static void
+str2big_scan_digits(const char *s, const char *str, int base, int badcheck, size_t *num_digits_p, size_t *len_p)
+{
+    char nondigit = 0;
+    size_t num_digits = 0;
+    const char *digits_start = str;
+    const char *digits_end = str;
+
+    int c;
+
+    if (badcheck && *str == '_') goto bad;
+
+    while ((c = *str++) != 0) {
+	if (c == '_') {
+	    if (nondigit) {
+		if (badcheck) goto bad;
+		break;
+	    }
+	    nondigit = (char) c;
+	    continue;
+	}
+	else if ((c = conv_digit(c)) < 0) {
+	    break;
+	}
+	if (c >= base) break;
+	nondigit = 0;
+        num_digits++;
+        digits_end = str;
+    }
+    if (badcheck) {
+	str--;
+	if (s+1 < str && str[-1] == '_') goto bad;
+	while (*str && ISSPACE(*str)) str++;
+	if (*str) {
+	  bad:
+	    rb_invalid_str(s, "Integer()");
+	}
+    }
+    *num_digits_p = num_digits;
+    *len_p = digits_end - digits_start;
+}
+
+static VALUE
+str2big_poweroftwo(
+    int sign,
+    const char *digits_start,
+    const char *digits_end,
+    size_t num_digits,
+    int bits_per_digit)
+{
+    BDIGIT *dp;
+    BDIGIT_DBL dd;
+    int numbits;
+
+    size_t num_bdigits;
+    const char *p;
+    int c;
     VALUE z;
-    USHORT *zds;
 
-    while (isspace(*str)) str++;
-    if (*str == '-') {
+    num_bdigits = (num_digits / BITSPERDIG) * bits_per_digit + roomof((num_digits % BITSPERDIG) * bits_per_digit, BITSPERDIG);
+    z = bignew(num_bdigits, sign);
+    dp = BDIGITS(z);
+    dd = 0;
+    numbits = 0;
+    for (p = digits_end; digits_start < p; p--) {
+        if ((c = conv_digit(p[-1])) < 0)
+            continue;
+        dd |= (BDIGIT_DBL)c << numbits;
+        numbits += bits_per_digit;
+        if (BITSPERDIG <= numbits) {
+            *dp++ = BIGLO(dd);
+            dd = BIGDN(dd);
+            numbits -= BITSPERDIG;
+        }
+    }
+    if (numbits) {
+        *dp++ = BIGLO(dd);
+    }
+    assert((size_t)(dp - BDIGITS(z)) == num_bdigits);
+
+    return z;
+}
+
+static VALUE
+str2big_normal(
+    int sign,
+    const char *digits_start,
+    const char *digits_end,
+    size_t num_bdigits,
+    int base)
+{
+    size_t blen = 1;
+    BDIGIT *zds;
+    BDIGIT_DBL num;
+
+    size_t i;
+    const char *p;
+    int c;
+    VALUE z;
+
+    z = bignew(num_bdigits, sign);
+    zds = BDIGITS(z);
+    BDIGITS_ZERO(zds, num_bdigits);
+
+    for (p = digits_start; p < digits_end; p++) {
+        if ((c = conv_digit(*p)) < 0)
+            continue;
+        num = c;
+        i = 0;
+        for (;;) {
+            while (i<blen) {
+                num += (BDIGIT_DBL)zds[i]*base;
+                zds[i++] = BIGLO(num);
+                num = BIGDN(num);
+            }
+            if (num) {
+                blen++;
+                continue;
+            }
+            break;
+        }
+        assert(blen <= num_bdigits);
+    }
+
+    return z;
+}
+
+static VALUE
+str2big_karatsuba(
+    int sign,
+    const char *digits_start,
+    const char *digits_end,
+    size_t num_digits,
+    size_t num_bdigits,
+    int digits_per_bdigits_dbl,
+    int base)
+{
+    VALUE powerv;
+    size_t unit;
+    VALUE tmpuv = 0;
+    BDIGIT *uds, *vds, *tds;
+    BDIGIT_DBL dd;
+    BDIGIT_DBL current_base;
+    int m;
+    int power_level = 0;
+
+    size_t i;
+    const char *p;
+    int c;
+    VALUE z;
+
+    uds = ALLOCV_N(BDIGIT, tmpuv, 2*num_bdigits);
+    vds = uds + num_bdigits;
+
+    powerv = power_cache_get_power(base, power_level, NULL);
+
+    i = 0;
+    dd = 0;
+    current_base = 1;
+    m = digits_per_bdigits_dbl;
+    if (num_digits < (size_t)m)
+        m = (int)num_digits;
+    for (p = digits_end; digits_start < p; p--) {
+        if ((c = conv_digit(p[-1])) < 0)
+            continue;
+        dd = dd + c * current_base;
+        current_base *= base;
+        num_digits--;
+        m--;
+        if (m == 0) {
+            uds[i++] = BIGLO(dd);
+            uds[i++] = (BDIGIT)BIGDN(dd);
+            dd = 0;
+            m = digits_per_bdigits_dbl;
+            if (num_digits < (size_t)m)
+                m = (int)num_digits;
+            current_base = 1;
+        }
+    }
+    assert(i == num_bdigits);
+    for (unit = 2; unit < num_bdigits; unit *= 2) {
+        for (i = 0; i < num_bdigits; i += unit*2) {
+            if (2*unit <= num_bdigits - i) {
+                bary_mul(vds+i, unit*2, BDIGITS(powerv), BIGNUM_LEN(powerv), uds+i+unit, unit);
+                bary_add(vds+i, unit*2, vds+i, unit*2, uds+i, unit);
+            }
+            else if (unit <= num_bdigits - i) {
+                bary_mul(vds+i, num_bdigits-i, BDIGITS(powerv), BIGNUM_LEN(powerv), uds+i+unit, num_bdigits-(i+unit));
+                bary_add(vds+i, num_bdigits-i, vds+i, num_bdigits-i, uds+i, unit);
+            }
+            else {
+                MEMCPY(vds+i, uds+i, BDIGIT, num_bdigits-i);
+            }
+        }
+        power_level++;
+        powerv = power_cache_get_power(base, power_level, NULL);
+        tds = vds;
+        vds = uds;
+        uds = tds;
+    }
+    BARY_TRUNC(uds, num_bdigits);
+    z = bignew(num_bdigits, sign);
+    MEMCPY(BDIGITS(z), uds, BDIGIT, num_bdigits);
+
+    if (tmpuv)
+        ALLOCV_END(tmpuv);
+
+    return z;
+}
+
+#ifdef USE_GMP
+static VALUE
+str2big_gmp(
+    int sign,
+    const char *digits_start,
+    const char *digits_end,
+    size_t num_digits,
+    size_t num_bdigits,
+    int base)
+{
+    const size_t nails = (sizeof(BDIGIT)-SIZEOF_BDIGIT)*CHAR_BIT;
+    char *buf, *p;
+    const char *q;
+    VALUE tmps;
+    mpz_t mz;
+    VALUE z;
+    BDIGIT *zds;
+    size_t zn, count;
+
+    buf = ALLOCV_N(char, tmps, num_digits+1);
+    p = buf;
+    for (q = digits_start; q < digits_end; q++) {
+        if (conv_digit(*q) < 0)
+            continue;
+        *p++ = *q;
+    }
+    *p = '\0';
+
+    mpz_init(mz);
+    mpz_set_str(mz, buf, base);
+    zn = num_bdigits;
+    z = bignew(zn, sign);
+    zds = BDIGITS(z);
+    mpz_export(BDIGITS(z), &count, -1, sizeof(BDIGIT), 0, nails, mz);
+    BDIGITS_ZERO(zds+count, zn-count);
+    mpz_clear(mz);
+
+    if (tmps)
+        ALLOCV_END(tmps);
+
+    return z;
+}
+#endif
+
+/*
+ * Parse +str+ as Ruby Integer, i.e., underscores, 0d and 0b prefixes.
+ *
+ * str:      pointer to the string to be parsed.
+ *	     should be NUL-terminated.
+ * base:     base of conversion, must be 2..36, or -36..0.
+ *           if +base+ > 0, the conversion is done according to the +base+
+ *           and unmatched prefix is parsed as a part of the result if
+ *           present.
+ *           if +base+ <= 0, the conversion is done according to the
+ *           prefix if present, in base <code>-base</code> if +base+ < -1,
+ *           or in base 10.
+ * badcheck: if non-zero, +ArgumentError+ is raised when +str+ is not
+ *           valid as an Integer.  if zero, Fixnum 0 is returned in
+ *           that case.
+ */
+VALUE
+rb_cstr_to_inum(const char *str, int base, int badcheck)
+{
+    const char *s = str;
+    char sign = 1;
+    int c;
+    VALUE z;
+
+    int bits_per_digit;
+
+    const char *digits_start, *digits_end;
+    size_t num_digits;
+    size_t num_bdigits;
+    size_t len;
+
+    if (!str) {
+	if (badcheck) {
+          bad:
+            rb_invalid_str(s, "Integer()");
+        }
+	return INT2FIX(0);
+    }
+    while (ISSPACE(*str)) str++;
+
+    if (str[0] == '+') {
+	str++;
+    }
+    else if (str[0] == '-') {
 	str++;
 	sign = 0;
     }
-    if (base == 0) {
-	if (*str == '0') {
-	    str++;
-	    if (*str == 'x' || *str == 'X') {
-		str++;
+    if (str[0] == '+' || str[0] == '-') {
+	if (badcheck) goto bad;
+	return INT2FIX(0);
+    }
+    if (base <= 0) {
+	if (str[0] == '0') {
+	    switch (str[1]) {
+	      case 'x': case 'X':
 		base = 16;
-	    }
-	    else {
+                str += 2;
+		break;
+	      case 'b': case 'B':
+		base = 2;
+                str += 2;
+		break;
+	      case 'o': case 'O':
+		base = 8;
+                str += 2;
+		break;
+	      case 'd': case 'D':
+		base = 10;
+                str += 2;
+		break;
+	      default:
 		base = 8;
 	    }
-	    if (*str == '\0') return INT2FIX(0);
+	}
+	else if (base < -1) {
+	    base = -base;
 	}
 	else {
 	    base = 10;
 	}
     }
-    len = strlen(str);
-    if (base == 8) {
-	len = 3*len*sizeof(char);
+    else if (base == 2) {
+	if (str[0] == '0' && (str[1] == 'b'||str[1] == 'B')) {
+	    str += 2;
+	}
     }
-    else {			/* base == 10 or 16 */
-	len = 4*len*sizeof(char);
+    else if (base == 8) {
+	if (str[0] == '0' && (str[1] == 'o'||str[1] == 'O')) {
+	    str += 2;
+	}
     }
-
-    if (len <= (sizeof(VALUE)*CHAR_BIT)) {
-	int result = strtoul(str, Qnil, base);
-
-	if (!sign) result = -result;
-	if (FIXABLE(result)) return INT2FIX(result);
-	return int2big(result);
+    else if (base == 10) {
+	if (str[0] == '0' && (str[1] == 'd'||str[1] == 'D')) {
+	    str += 2;
+	}
     }
-    len = (len/(sizeof(USHORT)*CHAR_BIT))+1;
-
-    z = bignew(len, sign);
-    zds = BDIGITS(z);
-    for (i=len;i--;) zds[i]=0;
-    while (c = *str++) {
-	switch (c) {
-	  case '0': case '1': case '2': case '3': case '4':
-	  case '5': case '6': case '7': case '8': case '9':
-	    c = c - '0';
-	    break;
-	  case 'a': case 'b': case 'c':
-	  case 'd': case 'e': case 'f':
-	    c = c - 'a' + 10;
-	    break;
-	  case 'A': case 'B': case 'C':
-	  case 'D': case 'E': case 'F':
-	    c = c - 'A' + 10;
-	    break;
-	  default:
-	    c = base;
-	    break;
+    else if (base == 16) {
+	if (str[0] == '0' && (str[1] == 'x'||str[1] == 'X')) {
+	    str += 2;
 	}
-	if (c >= base) break;
-	i = 0;
-	num = c;
-	for (;;) {
-	    while (i<blen) {
-		num += zds[i]*base;
-		zds[i++] = BIGLO(num);
-		num = BIGDN(num);
+    }
+    if (base < 2 || 36 < base) {
+        rb_raise(rb_eArgError, "invalid radix %d", base);
+    }
+    if (*str == '0') {		/* squeeze preceding 0s */
+	int us = 0;
+	while ((c = *++str) == '0' || c == '_') {
+	    if (c == '_') {
+		if (++us >= 2)
+		    break;
 	    }
-	    if (num) {
-		blen++;
-		continue;
+	    else {
+		us = 0;
 	    }
-	    break;
 	}
+	if (!(c = *str) || ISSPACE(c)) --str;
+    }
+    c = *str;
+    c = conv_digit(c);
+    if (c < 0 || c >= base) {
+	if (badcheck) goto bad;
+	return INT2FIX(0);
     }
+
+    bits_per_digit = bit_length(base-1);
+    if (bits_per_digit * strlen(str) <= sizeof(long) * CHAR_BIT) {
+        char *end;
+	unsigned long val = STRTOUL(str, &end, base);
+
+	if (str < end && *end == '_') goto bigparse;
+	if (badcheck) {
+	    if (end == str) goto bad; /* no number */
+	    while (*end && ISSPACE(*end)) end++;
+	    if (*end) goto bad;	      /* trailing garbage */
+	}
+
+	if (POSFIXABLE(val)) {
+	    if (sign) return LONG2FIX(val);
+	    else {
+		long result = -(long)val;
+		return LONG2FIX(result);
+	    }
+	}
+	else {
+	    VALUE big = rb_uint2big(val);
+	    BIGNUM_SET_SIGN(big, sign);
+	    return bignorm(big);
+	}
+    }
+
+  bigparse:
+    digits_start = str;
+    str2big_scan_digits(s, str, base, badcheck, &num_digits, &len);
+    digits_end = digits_start + len;
+
+    if (POW2_P(base)) {
+        z = str2big_poweroftwo(sign, digits_start, digits_end, num_digits,
+                bits_per_digit);
+    }
+    else {
+        int digits_per_bdigits_dbl;
+        maxpow_in_bdigit_dbl(base, &digits_per_bdigits_dbl);
+        num_bdigits = roomof(num_digits, digits_per_bdigits_dbl)*2;
+
+#ifdef USE_GMP
+        if (GMP_STR2BIG_DIGITS < num_bdigits) {
+            z = str2big_gmp(sign, digits_start, digits_end, num_digits,
+                    num_bdigits, base);
+        }
+        else
+#endif
+        if (num_bdigits < KARATSUBA_MUL_DIGITS) {
+            z = str2big_normal(sign, digits_start, digits_end,
+                    num_bdigits, base);
+        }
+        else {
+            z = str2big_karatsuba(sign, digits_start, digits_end, num_digits,
+                    num_bdigits, digits_per_bdigits_dbl, base);
+        }
+    }
+
     return bignorm(z);
 }
 
-static char hexmap[] = "0123456789abcdef";
 VALUE
-big2str(x, base)
-    struct RBignum *x;
-    int base;
+rb_str_to_inum(VALUE str, int base, int badcheck)
 {
-    VALUE t;
-    USHORT *ds;
-    UINT i, j, hbase;
-    VALUE ss;
-    char *s, c;
+    char *s;
+    long len;
+    VALUE v = 0;
+    VALUE ret;
 
-    if (FIXNUM_P(x)) {
-	return fix2str(x, base);
+    StringValue(str);
+    rb_must_asciicompat(str);
+    if (badcheck) {
+	s = StringValueCStr(str);
     }
-    i = x->len;
-    if (x->len == 0) return str_new2("0");
-    if (base == 10) {
-	j = (sizeof(USHORT)/sizeof(char)*CHAR_BIT*i*241L)/800+2;
-	hbase = 10000;
+    else {
+	s = RSTRING_PTR(str);
     }
-    else if (base == 16) {
-	j = (sizeof(USHORT)/sizeof(char)*CHAR_BIT*i)/4+2;
-	hbase = 0x10000;
+    if (s) {
+	len = RSTRING_LEN(str);
+	if (s[len]) {		/* no sentinel somehow */
+	    char *p = ALLOCV(v, len+1);
+
+	    MEMCPY(p, s, char, len);
+	    p[len] = '\0';
+	    s = p;
+	}
     }
-    else if (base == 8) {
-	j = (sizeof(USHORT)/sizeof(char)*CHAR_BIT*i)+2;
-	hbase = 010000;
+    ret = rb_cstr_to_inum(s, base, badcheck);
+    if (v)
+	ALLOCV_END(v);
+    return ret;
+}
+
+VALUE
+rb_str2big_poweroftwo(VALUE arg, int base, int badcheck)
+{
+    int positive_p = 1;
+    const char *s, *str;
+    const char *digits_start, *digits_end;
+    size_t num_digits;
+    size_t len;
+    VALUE z;
+
+    if (base < 2 || 36 < base || !POW2_P(base)) {
+        rb_raise(rb_eArgError, "invalid radix %d", base);
     }
-    else if (base == 2) {
-	j = (sizeof(USHORT)*CHAR_BIT*i)+2;
-	hbase = 020;
+
+    rb_must_asciicompat(arg);
+    s = str = StringValueCStr(arg);
+    if (*str == '-') {
+        str++;
+        positive_p = 0;
+    }
+
+    digits_start = str;
+    str2big_scan_digits(s, str, base, badcheck, &num_digits, &len);
+    digits_end = digits_start + len;
+
+    z = str2big_poweroftwo(positive_p, digits_start, digits_end, num_digits,
+            bit_length(base-1));
+
+    RB_GC_GUARD(arg);
+
+    return bignorm(z);
+}
+
+VALUE
+rb_str2big_normal(VALUE arg, int base, int badcheck)
+{
+    int positive_p = 1;
+    const char *s, *str;
+    const char *digits_start, *digits_end;
+    size_t num_digits;
+    size_t len;
+    VALUE z;
+
+    int digits_per_bdigits_dbl;
+    size_t num_bdigits;
+
+    if (base < 2 || 36 < base) {
+        rb_raise(rb_eArgError, "invalid radix %d", base);
+    }
+
+    rb_must_asciicompat(arg);
+    s = str = StringValueCStr(arg);
+    if (*str == '-') {
+        str++;
+        positive_p = 0;
+    }
+
+    digits_start = str;
+    str2big_scan_digits(s, str, base, badcheck, &num_digits, &len);
+    digits_end = digits_start + len;
+
+    maxpow_in_bdigit_dbl(base, &digits_per_bdigits_dbl);
+    num_bdigits = roomof(num_digits, digits_per_bdigits_dbl)*2;
+
+    z = str2big_normal(positive_p, digits_start, digits_end,
+            num_bdigits, base);
+
+    RB_GC_GUARD(arg);
+
+    return bignorm(z);
+}
+
+VALUE
+rb_str2big_karatsuba(VALUE arg, int base, int badcheck)
+{
+    int positive_p = 1;
+    const char *s, *str;
+    const char *digits_start, *digits_end;
+    size_t num_digits;
+    size_t len;
+    VALUE z;
+
+    int digits_per_bdigits_dbl;
+    size_t num_bdigits;
+
+    if (base < 2 || 36 < base) {
+        rb_raise(rb_eArgError, "invalid radix %d", base);
+    }
+
+    rb_must_asciicompat(arg);
+    s = str = StringValueCStr(arg);
+    if (*str == '-') {
+        str++;
+        positive_p = 0;
+    }
+
+    digits_start = str;
+    str2big_scan_digits(s, str, base, badcheck, &num_digits, &len);
+    digits_end = digits_start + len;
+
+    maxpow_in_bdigit_dbl(base, &digits_per_bdigits_dbl);
+    num_bdigits = roomof(num_digits, digits_per_bdigits_dbl)*2;
+
+    z = str2big_karatsuba(positive_p, digits_start, digits_end, num_digits,
+            num_bdigits, digits_per_bdigits_dbl, base);
+
+    RB_GC_GUARD(arg);
+
+    return bignorm(z);
+}
+
+#ifdef USE_GMP
+VALUE
+rb_str2big_gmp(VALUE arg, int base, int badcheck)
+{
+    int positive_p = 1;
+    const char *s, *str;
+    const char *digits_start, *digits_end;
+    size_t num_digits;
+    size_t len;
+    VALUE z;
+
+    int digits_per_bdigits_dbl;
+    size_t num_bdigits;
+
+    if (base < 2 || 36 < base) {
+        rb_raise(rb_eArgError, "invalid radix %d", base);
+    }
+
+    rb_must_asciicompat(arg);
+    s = str = StringValueCStr(arg);
+    if (*str == '-') {
+        str++;
+        positive_p = 0;
+    }
+
+    digits_start = str;
+    str2big_scan_digits(s, str, base, badcheck, &num_digits, &len);
+    digits_end = digits_start + len;
+
+    maxpow_in_bdigit_dbl(base, &digits_per_bdigits_dbl);
+    num_bdigits = roomof(num_digits, digits_per_bdigits_dbl)*2;
+
+    z = str2big_gmp(positive_p, digits_start, digits_end, num_digits, num_bdigits, base);
+
+    RB_GC_GUARD(arg);
+
+    return bignorm(z);
+}
+#endif
+
+#if HAVE_LONG_LONG
+
+static VALUE
+rb_ull2big(unsigned LONG_LONG n)
+{
+    long i;
+    VALUE big = bignew(bdigit_roomof(SIZEOF_LONG_LONG), 1);
+    BDIGIT *digits = BDIGITS(big);
+
+#if SIZEOF_BDIGIT >= SIZEOF_LONG_LONG
+    digits[0] = n;
+#else
+    for (i = 0; i < bdigit_roomof(SIZEOF_LONG_LONG); i++) {
+	digits[i] = BIGLO(n);
+	n = BIGDN(n);
+    }
+#endif
+
+    i = bdigit_roomof(SIZEOF_LONG_LONG);
+    while (i-- && !digits[i]) ;
+    BIGNUM_SET_LEN(big, i+1);
+    return big;
+}
+
+static VALUE
+rb_ll2big(LONG_LONG n)
+{
+    long neg = 0;
+    unsigned LONG_LONG u;
+    VALUE big;
+
+    if (n < 0) {
+        u = 1 + (unsigned LONG_LONG)(-(n + 1)); /* u = -n avoiding overflow */
+	neg = 1;
     }
     else {
-	Fail("bignum cannot treat base %d", base);
+        u = n;
+    }
+    big = rb_ull2big(u);
+    if (neg) {
+	BIGNUM_SET_SIGN(big, 0);
     }
+    return big;
+}
 
-    t = big_clone(x);
-    ds = BDIGITS(t);
-    ss = str_new(0, j);
-    s = RSTRING(ss)->ptr;
+VALUE
+rb_ull2inum(unsigned LONG_LONG n)
+{
+    if (POSFIXABLE(n)) return LONG2FIX(n);
+    return rb_ull2big(n);
+}
 
-    s[0] = x->sign ? '+' : '-';
-    while (i && j) {
-	int k = i;
-	unsigned long num = 0;
-	while (k--) {
-	    num = BIGUP(num) + ds[k];
-	    ds[k] = num / hbase;
-	    num %= hbase;
+VALUE
+rb_ll2inum(LONG_LONG n)
+{
+    if (FIXABLE(n)) return LONG2FIX(n);
+    return rb_ll2big(n);
+}
+
+#endif  /* HAVE_LONG_LONG */
+
+VALUE
+rb_cstr2inum(const char *str, int base)
+{
+    return rb_cstr_to_inum(str, base, base==0);
+}
+
+VALUE
+rb_str2inum(VALUE str, int base)
+{
+    return rb_str_to_inum(str, base, base==0);
+}
+
+static VALUE
+big_shift3(VALUE x, int lshift_p, size_t shift_numdigits, int shift_numbits)
+{
+    BDIGIT *xds, *zds;
+    long s1;
+    int s2;
+    VALUE z;
+    long xn;
+
+    if (lshift_p) {
+        if (LONG_MAX < shift_numdigits) {
+            rb_raise(rb_eArgError, "too big number");
+        }
+        s1 = shift_numdigits;
+        s2 = shift_numbits;
+        xn = BIGNUM_LEN(x);
+        z = bignew(xn+s1+1, BIGNUM_SIGN(x));
+        zds = BDIGITS(z);
+        BDIGITS_ZERO(zds, s1);
+        xds = BDIGITS(x);
+        zds[xn+s1] = bary_small_lshift(zds+s1, xds, xn, s2);
+    }
+    else {
+        long zn;
+        BDIGIT hibitsx;
+        if (LONG_MAX < shift_numdigits || (size_t)BIGNUM_LEN(x) <= shift_numdigits) {
+            if (BIGNUM_POSITIVE_P(x) ||
+                bary_zero_p(BDIGITS(x), BIGNUM_LEN(x)))
+                return INT2FIX(0);
+            else
+                return INT2FIX(-1);
+        }
+        s1 = shift_numdigits;
+        s2 = shift_numbits;
+        hibitsx = abs2twocomp(&x, &xn);
+        xds = BDIGITS(x);
+        if (xn <= s1) {
+            return hibitsx ? INT2FIX(-1) : INT2FIX(0);
+        }
+        zn = xn - s1;
+        z = bignew(zn, 0);
+        zds = BDIGITS(z);
+        bary_small_rshift(zds, xds+s1, zn, s2, hibitsx != 0 ? BDIGMAX : 0);
+        twocomp2abs_bang(z, hibitsx != 0);
+    }
+    RB_GC_GUARD(x);
+    return z;
+}
+
+static VALUE
+big_shift2(VALUE x, int lshift_p, VALUE y)
+{
+    int sign;
+    size_t lens[2];
+    size_t shift_numdigits;
+    int shift_numbits;
+
+    assert(POW2_P(CHAR_BIT));
+    assert(POW2_P(BITSPERDIG));
+
+    if (BIGZEROP(x))
+        return INT2FIX(0);
+    sign = rb_integer_pack(y, lens, numberof(lens), sizeof(size_t), 0,
+        INTEGER_PACK_LSWORD_FIRST|INTEGER_PACK_NATIVE_BYTE_ORDER);
+    if (sign < 0) {
+        lshift_p = !lshift_p;
+        sign = -sign;
+    }
+    if (lshift_p) {
+        if (1 < sign || CHAR_BIT <= lens[1])
+            rb_raise(rb_eRangeError, "shift width too big");
+    }
+    else {
+        if (1 < sign || CHAR_BIT <= lens[1])
+            return BIGNUM_POSITIVE_P(x) ? INT2FIX(0) : INT2FIX(-1);
+    }
+    shift_numbits = (int)(lens[0] & (BITSPERDIG-1));
+    shift_numdigits = (lens[0] >> bit_length(BITSPERDIG-1)) |
+      (lens[1] << (CHAR_BIT*SIZEOF_SIZE_T - bit_length(BITSPERDIG-1)));
+    return big_shift3(x, lshift_p, shift_numdigits, shift_numbits);
+}
+
+static VALUE
+big_lshift(VALUE x, unsigned long shift)
+{
+    long s1 = shift/BITSPERDIG;
+    int s2 = (int)(shift%BITSPERDIG);
+    return big_shift3(x, 1, s1, s2);
+}
+
+static VALUE
+big_rshift(VALUE x, unsigned long shift)
+{
+    long s1 = shift/BITSPERDIG;
+    int s2 = (int)(shift%BITSPERDIG);
+    return big_shift3(x, 0, s1, s2);
+}
+
+#define MAX_BASE36_POWER_TABLE_ENTRIES (SIZEOF_SIZE_T * CHAR_BIT + 1)
+
+static VALUE base36_power_cache[35][MAX_BASE36_POWER_TABLE_ENTRIES];
+static size_t base36_numdigits_cache[35][MAX_BASE36_POWER_TABLE_ENTRIES];
+
+static void
+power_cache_init(void)
+{
+    int i, j;
+    for (i = 0; i < 35; ++i) {
+	for (j = 0; j < MAX_BASE36_POWER_TABLE_ENTRIES; ++j) {
+	    base36_power_cache[i][j] = Qnil;
 	}
-	if (ds[i-1] == 0) i--;
-	k = 4;
-	while (k--) {
-	    c = num % base;
-	    s[--j] = hexmap[(int)c];
-	    num /= base;
-	    if (i == 0 && num == 0) break;
+    }
+}
+
+static inline VALUE
+power_cache_get_power(int base, int power_level, size_t *numdigits_ret)
+{
+    /*
+     * MAX_BASE36_POWER_TABLE_ENTRIES is big enough to that
+     * base36_power_cache[base][MAX_BASE36_POWER_TABLE_ENTRIES-1] fills whole memory.
+     * So MAX_BASE36_POWER_TABLE_ENTRIES <= power_level is not possible to calculate.
+     *
+     * number-of-bytes =
+     * log256(base36_power_cache[base][MAX_BASE36_POWER_TABLE_ENTRIES-1]) =
+     * log256(maxpow_in_bdigit_dbl(base)**(2**(MAX_BASE36_POWER_TABLE_ENTRIES-1))) =
+     * log256(maxpow_in_bdigit_dbl(base)**(2**(SIZEOF_SIZE_T*CHAR_BIT))) =
+     * (2**(SIZEOF_SIZE_T*CHAR_BIT))*log256(maxpow_in_bdigit_dbl(base)) =
+     * (256**SIZEOF_SIZE_T)*log256(maxpow_in_bdigit_dbl(base)) >
+     * (256**SIZEOF_SIZE_T)*(sizeof(BDIGIT_DBL)-1) >
+     * 256**SIZEOF_SIZE_T
+     */
+    if (MAX_BASE36_POWER_TABLE_ENTRIES <= power_level)
+        rb_bug("too big power number requested: maxpow_in_bdigit_dbl(%d)**(2**%d)", base, power_level);
+
+    if (NIL_P(base36_power_cache[base - 2][power_level])) {
+        VALUE power;
+        size_t numdigits;
+        if (power_level == 0) {
+            int numdigits0;
+            BDIGIT_DBL dd = maxpow_in_bdigit_dbl(base, &numdigits0);
+            power = bignew(2, 1);
+            bdigitdbl2bary(BDIGITS(power), 2, dd);
+            numdigits = numdigits0;
+        }
+        else {
+            power = bigtrunc(bigsq(power_cache_get_power(base, power_level - 1, &numdigits)));
+            numdigits *= 2;
+        }
+        rb_obj_hide(power);
+        base36_power_cache[base - 2][power_level] = power;
+        base36_numdigits_cache[base - 2][power_level] = numdigits;
+	rb_gc_register_mark_object(power);
+    }
+    if (numdigits_ret)
+        *numdigits_ret = base36_numdigits_cache[base - 2][power_level];
+    return base36_power_cache[base - 2][power_level];
+}
+
+struct big2str_struct {
+    int negative;
+    int base;
+    BDIGIT_DBL hbase2;
+    int hbase2_numdigits;
+    VALUE result;
+    char *ptr;
+};
+
+static void
+big2str_alloc(struct big2str_struct *b2s, size_t len)
+{
+    if (LONG_MAX-1 < len)
+        rb_raise(rb_eArgError, "too big number");
+    b2s->result = rb_usascii_str_new(0, (long)(len + 1)); /* plus one for sign */
+    b2s->ptr = RSTRING_PTR(b2s->result);
+    if (b2s->negative)
+        *b2s->ptr++ = '-';
+}
+
+static void
+big2str_2bdigits(struct big2str_struct *b2s, BDIGIT *xds, size_t xn, size_t taillen)
+{
+    size_t j;
+    BDIGIT_DBL num;
+    char buf[SIZEOF_BDIGIT_DBL*CHAR_BIT], *p;
+    int beginning = !b2s->ptr;
+    size_t len = 0;
+
+    assert(xn <= 2);
+    num = bary2bdigitdbl(xds, xn);
+
+    if (beginning) {
+        if (num == 0)
+            return;
+        p = buf;
+        j = sizeof(buf);
+        do {
+            p[--j] = ruby_digitmap[num % b2s->base];
+            num /= b2s->base;
+        } while (num);
+        len = sizeof(buf) - j;
+        big2str_alloc(b2s, len + taillen);
+	MEMCPY(b2s->ptr, buf + j, char, len);
+    }
+    else {
+        p = b2s->ptr;
+        j = b2s->hbase2_numdigits;
+        do {
+            p[--j] = ruby_digitmap[num % b2s->base];
+            num /= b2s->base;
+        } while (j);
+        len = b2s->hbase2_numdigits;
+    }
+    b2s->ptr += len;
+}
+
+static void
+big2str_karatsuba(struct big2str_struct *b2s, BDIGIT *xds, size_t xn, size_t wn,
+		  int power_level, size_t taillen)
+{
+    VALUE b;
+    size_t half_numdigits, lower_numdigits;
+    int lower_power_level;
+    size_t bn;
+    const BDIGIT *bds;
+    size_t len;
+
+    /*
+     * Precondition:
+     * abs(x) < maxpow**(2**power_level)
+     * where
+     *   maxpow = maxpow_in_bdigit_dbl(base, &numdigits)
+     *
+     * This function generates sequence of zeros, and then stringized abs(x) into b2s->ptr.
+     *
+     * b2s->ptr can be NULL.
+     * It is allocated when the first character is generated via big2str_alloc.
+     *
+     * The prefix zeros should be generated if and only if b2s->ptr is not NULL.
+     * When the zeros are generated, the zeros and abs(x) consists
+     * numdigits*(2**power_level) characters at total.
+     *
+     * Note:
+     * power_cache_get_power(base, power_level, &len) may not be cached yet. It should not be called.
+     * power_cache_get_power(base, power_level-1, &len) should be cached already if 0 <= power_level-1.
+     */
+
+    if (xn == 0 || bary_zero_p(xds, xn)) {
+	if (b2s->ptr) {
+            /* When x is zero, power_cache_get_power(base, power_level) should be cached already. */
+            power_cache_get_power(b2s->base, power_level, &len);
+	    memset(b2s->ptr, '0', len);
+            b2s->ptr += len;
 	}
+        return;
+    }
+
+    if (power_level == 0) {
+	big2str_2bdigits(b2s, xds, xn, taillen);
+        return;
     }
-    while (s[j] == '0') j++;
-    RSTRING(ss)->len -= x->sign?j:j-1;
-    memmove(x->sign?s:s+1, s+j, RSTRING(ss)->len);
-    s[RSTRING(ss)->len] = '\0';
 
-    return ss;
+    lower_power_level = power_level-1;
+    b = power_cache_get_power(b2s->base, lower_power_level, &lower_numdigits);
+    bn = BIGNUM_LEN(b);
+    bds = BDIGITS(b);
+
+    half_numdigits = lower_numdigits;
+
+    while (0 < lower_power_level &&
+            (xn < bn ||
+             (xn == bn && bary_cmp(xds, xn, bds, bn) < 0))) {
+        lower_power_level--;
+        b = power_cache_get_power(b2s->base, lower_power_level, &lower_numdigits);
+        bn = BIGNUM_LEN(b);
+        bds = BDIGITS(b);
+    }
+
+    if (lower_power_level == 0 &&
+            (xn < bn ||
+             (xn == bn && bary_cmp(xds, xn, bds, bn) < 0))) {
+        if (b2s->ptr) {
+            len = half_numdigits * 2 - lower_numdigits;
+            memset(b2s->ptr, '0', len);
+            b2s->ptr += len;
+        }
+	big2str_2bdigits(b2s, xds, xn, taillen);
+    }
+    else {
+        BDIGIT *qds, *rds;
+        size_t qn, rn;
+        BDIGIT *tds;
+        int shift;
+
+        if (lower_power_level != power_level-1 && b2s->ptr) {
+            len = (half_numdigits - lower_numdigits) * 2;
+            memset(b2s->ptr, '0', len);
+            b2s->ptr += len;
+        }
+
+        shift = nlz(bds[bn-1]);
+
+        qn = xn + BIGDIVREM_EXTRA_WORDS;
+
+        if (shift == 0) {
+            /* bigdivrem_restoring will not modify y.
+             * So use bds directly.  */
+            tds = (BDIGIT *)bds;
+            xds[xn] = 0;
+        }
+        else {
+            /* bigdivrem_restoring will modify y.
+             * So use temporary buffer.  */
+            tds = xds + qn;
+            assert(qn + bn <= xn + wn);
+            bary_small_lshift(tds, bds, bn, shift);
+            xds[xn] = bary_small_lshift(xds, xds, xn, shift);
+        }
+
+        bigdivrem_restoring(xds, qn, tds, bn);
+
+        rds = xds;
+        rn = bn;
+
+        qds = xds + bn;
+        qn = qn - bn;
+
+        if (shift) {
+            bary_small_rshift(rds, rds, rn, shift, 0);
+        }
+
+        BARY_TRUNC(qds, qn);
+        assert(qn <= bn);
+        big2str_karatsuba(b2s, qds, qn, xn+wn - (rn+qn), lower_power_level, lower_numdigits+taillen);
+        BARY_TRUNC(rds, rn);
+        big2str_karatsuba(b2s, rds, rn, xn+wn - rn, lower_power_level, taillen);
+    }
 }
 
 static VALUE
-Fbig_to_s(x)
-    struct RBignum *x;
+big2str_base_poweroftwo(VALUE x, int base)
+{
+    int word_numbits = ffs(base) - 1;
+    size_t numwords;
+    VALUE result;
+    char *ptr;
+    numwords = rb_absint_numwords(x, word_numbits, NULL);
+    if (BIGNUM_NEGATIVE_P(x)) {
+        if (LONG_MAX-1 < numwords)
+            rb_raise(rb_eArgError, "too big number");
+        result = rb_usascii_str_new(0, 1+numwords);
+        ptr = RSTRING_PTR(result);
+        *ptr++ = BIGNUM_POSITIVE_P(x) ? '+' : '-';
+    }
+    else {
+        if (LONG_MAX < numwords)
+            rb_raise(rb_eArgError, "too big number");
+        result = rb_usascii_str_new(0, numwords);
+        ptr = RSTRING_PTR(result);
+    }
+    rb_integer_pack(x, ptr, numwords, 1, CHAR_BIT-word_numbits,
+                    INTEGER_PACK_BIG_ENDIAN);
+    while (0 < numwords) {
+        *ptr = ruby_digitmap[*(unsigned char *)ptr];
+        ptr++;
+        numwords--;
+    }
+    return result;
+}
+
+VALUE
+rb_big2str_poweroftwo(VALUE x, int base)
 {
-    return big2str(x, 10);
+    return big2str_base_poweroftwo(x, base);
 }
 
-int
-big2int(x)
-    struct RBignum *x;
+static VALUE
+big2str_generic(VALUE x, int base)
+{
+    BDIGIT *xds;
+    size_t xn;
+    struct big2str_struct b2s_data;
+    int power_level;
+    VALUE power;
+
+    xds = BDIGITS(x);
+    xn = BIGNUM_LEN(x);
+    BARY_TRUNC(xds, xn);
+
+    if (xn == 0) {
+	return rb_usascii_str_new2("0");
+    }
+
+    if (base < 2 || 36 < base)
+	rb_raise(rb_eArgError, "invalid radix %d", base);
+
+    if (xn >= LONG_MAX/BITSPERDIG) {
+        rb_raise(rb_eRangeError, "bignum too big to convert into `string'");
+    }
+
+    power_level = 0;
+    power = power_cache_get_power(base, power_level, NULL);
+    while (power_level < MAX_BASE36_POWER_TABLE_ENTRIES &&
+           (size_t)BIGNUM_LEN(power) <= (xn+1)/2) {
+        power_level++;
+        power = power_cache_get_power(base, power_level, NULL);
+    }
+    assert(power_level != MAX_BASE36_POWER_TABLE_ENTRIES);
+
+    if ((size_t)BIGNUM_LEN(power) <= xn) {
+        /*
+         * This increment guarantees x < power_cache_get_power(base, power_level)
+         * without invoking it actually.
+         * (power_cache_get_power(base, power_level) can be slow and not used
+         * in big2str_karatsuba.)
+         *
+         * Although it is possible that x < power_cache_get_power(base, power_level-1),
+         * it is no problem because big2str_karatsuba checks it and
+         * doesn't affect the result when b2s_data.ptr is NULL.
+         */
+        power_level++;
+    }
+
+    b2s_data.negative = BIGNUM_NEGATIVE_P(x);
+    b2s_data.base = base;
+    b2s_data.hbase2 = maxpow_in_bdigit_dbl(base, &b2s_data.hbase2_numdigits);
+
+    b2s_data.result = Qnil;
+    b2s_data.ptr = NULL;
+
+    if (power_level == 0) {
+	big2str_2bdigits(&b2s_data, xds, xn, 0);
+    }
+    else {
+        VALUE tmpw = 0;
+        BDIGIT *wds;
+        size_t wn;
+        wn = power_level * BIGDIVREM_EXTRA_WORDS + BIGNUM_LEN(power);
+        wds = ALLOCV_N(BDIGIT, tmpw, xn + wn);
+        MEMCPY(wds, xds, BDIGIT, xn);
+	big2str_karatsuba(&b2s_data, wds, xn, wn, power_level, 0);
+        if (tmpw)
+            ALLOCV_END(tmpw);
+    }
+    RB_GC_GUARD(x);
+
+    *b2s_data.ptr = '\0';
+    rb_str_resize(b2s_data.result, (long)(b2s_data.ptr - RSTRING_PTR(b2s_data.result)));
+
+    RB_GC_GUARD(x);
+    return b2s_data.result;
+}
+
+VALUE
+rb_big2str_generic(VALUE x, int base)
+{
+    return big2str_generic(x, base);
+}
+
+#ifdef USE_GMP
+static VALUE
+big2str_gmp(VALUE x, int base)
+{
+    const size_t nails = (sizeof(BDIGIT)-SIZEOF_BDIGIT)*CHAR_BIT;
+    mpz_t mx;
+    size_t size;
+    VALUE str;
+    BDIGIT *xds = BDIGITS(x);
+    size_t xn = BIGNUM_LEN(x);
+
+    mpz_init(mx);
+    mpz_import(mx, xn, -1, sizeof(BDIGIT), 0, nails, xds);
+
+    size = mpz_sizeinbase(mx, base);
+
+    if (BIGNUM_NEGATIVE_P(x)) {
+        mpz_neg(mx, mx);
+        str = rb_usascii_str_new(0, size+1);
+    }
+    else {
+        str = rb_usascii_str_new(0, size);
+    }
+    mpz_get_str(RSTRING_PTR(str), base, mx);
+    mpz_clear(mx);
+
+    if (RSTRING_PTR(str)[RSTRING_LEN(str)-1] == '\0') {
+        rb_str_set_len(str, RSTRING_LEN(str)-1);
+    }
+
+    RB_GC_GUARD(x);
+    return str;
+}
+
+VALUE
+rb_big2str_gmp(VALUE x, int base)
+{
+    return big2str_gmp(x, base);
+}
+#endif
+
+static VALUE
+rb_big2str1(VALUE x, int base)
+{
+    BDIGIT *xds;
+    size_t xn;
+
+    if (FIXNUM_P(x)) {
+	return rb_fix2str(x, base);
+    }
+
+    bigtrunc(x);
+    xds = BDIGITS(x);
+    xn = BIGNUM_LEN(x);
+    BARY_TRUNC(xds, xn);
+
+    if (xn == 0) {
+	return rb_usascii_str_new2("0");
+    }
+
+    if (base < 2 || 36 < base)
+	rb_raise(rb_eArgError, "invalid radix %d", base);
+
+    if (xn >= LONG_MAX/BITSPERDIG) {
+        rb_raise(rb_eRangeError, "bignum too big to convert into `string'");
+    }
+
+    if (POW2_P(base)) {
+        /* base == 2 || base == 4 || base == 8 || base == 16 || base == 32 */
+        return big2str_base_poweroftwo(x, base);
+    }
+
+#ifdef USE_GMP
+    if (GMP_BIG2STR_DIGITS < xn) {
+        return big2str_gmp(x, base);
+    }
+#endif
+
+    return big2str_generic(x, base);
+}
+
+VALUE
+rb_big2str(VALUE x, int base)
+{
+    return rb_big2str1(x, base);
+}
+
+/*
+ *  call-seq:
+ *     big.to_s(base=10)   ->  string
+ *
+ *  Returns a string containing the representation of <i>big</i> radix
+ *  <i>base</i> (2 through 36).
+ *
+ *     12345654321.to_s         #=> "12345654321"
+ *     12345654321.to_s(2)      #=> "1011011111110110111011110000110001"
+ *     12345654321.to_s(8)      #=> "133766736061"
+ *     12345654321.to_s(16)     #=> "2dfdbbc31"
+ *     78546939656932.to_s(36)  #=> "rubyrules"
+ */
+
+static VALUE
+rb_big_to_s(int argc, VALUE *argv, VALUE x)
 {
+    int base;
+
+    if (argc == 0) base = 10;
+    else {
+	VALUE b;
+
+	rb_scan_args(argc, argv, "01", &b);
+	base = NUM2INT(b);
+    }
+    return rb_big2str(x, base);
+}
+
+static unsigned long
+big2ulong(VALUE x, const char *type)
+{
+    size_t len = BIGNUM_LEN(x);
     unsigned long num;
-    UINT len = x->len;
-    USHORT *ds;
+    BDIGIT *ds;
 
-    if (len > sizeof(long)/sizeof(USHORT))
-	Fail("Bignum too big to convert into fixnum");
+    if (len == 0)
+        return 0;
+    if (BIGSIZE(x) > sizeof(long)) {
+        rb_raise(rb_eRangeError, "bignum too big to convert into `%s'", type);
+    }
     ds = BDIGITS(x);
+#if SIZEOF_LONG <= SIZEOF_BDIGIT
+    num = (unsigned long)ds[0];
+#else
+    num = 0;
+    while (len--) {
+	num <<= BITSPERDIG;
+	num += (unsigned long)ds[len]; /* overflow is already checked */
+    }
+#endif
+    return num;
+}
+
+unsigned long
+rb_big2ulong(VALUE x)
+{
+    unsigned long num = big2ulong(x, "unsigned long");
+
+    if (BIGNUM_POSITIVE_P(x)) {
+        return num;
+    }
+    else {
+        if (num <= LONG_MAX)
+            return -(long)num;
+        if (num == 1+(unsigned long)(-(LONG_MIN+1)))
+            return LONG_MIN;
+    }
+    rb_raise(rb_eRangeError, "bignum out of range of unsigned long");
+}
+
+long
+rb_big2long(VALUE x)
+{
+    unsigned long num = big2ulong(x, "long");
+
+    if (BIGNUM_POSITIVE_P(x)) {
+        if (num <= LONG_MAX)
+            return num;
+    }
+    else {
+        if (num <= LONG_MAX)
+            return -(long)num;
+        if (num == 1+(unsigned long)(-(LONG_MIN+1)))
+            return LONG_MIN;
+    }
+    rb_raise(rb_eRangeError, "bignum too big to convert into `long'");
+}
+
+#if HAVE_LONG_LONG
+
+static unsigned LONG_LONG
+big2ull(VALUE x, const char *type)
+{
+    size_t len = BIGNUM_LEN(x);
+    unsigned LONG_LONG num;
+    BDIGIT *ds = BDIGITS(x);
+
+    if (len == 0)
+        return 0;
+    if (BIGSIZE(x) > SIZEOF_LONG_LONG)
+	rb_raise(rb_eRangeError, "bignum too big to convert into `%s'", type);
+#if SIZEOF_LONG_LONG <= SIZEOF_BDIGIT
+    num = (unsigned LONG_LONG)ds[0];
+#else
     num = 0;
     while (len--) {
 	num = BIGUP(num);
 	num += ds[len];
     }
-    if (!x->sign) return -num;
+#endif
     return num;
 }
 
-VALUE
-Fbig_to_i(x)
-    VALUE x;
+unsigned LONG_LONG
+rb_big2ull(VALUE x)
 {
-    int v = big2int(x);
+    unsigned LONG_LONG num = big2ull(x, "unsigned long long");
 
-    if (FIXABLE(v)) {
-	return INT2FIX(v);
+    if (BIGNUM_POSITIVE_P(x)) {
+        return num;
     }
-    return x;
+    else {
+        if (num <= LLONG_MAX)
+            return -(LONG_LONG)num;
+        if (num == 1+(unsigned LONG_LONG)(-(LLONG_MIN+1)))
+            return LLONG_MIN;
+    }
+    rb_raise(rb_eRangeError, "bignum out of range of unsigned long long");
 }
 
-VALUE
-dbl2big(d)
-    double d;
+LONG_LONG
+rb_big2ll(VALUE x)
+{
+    unsigned LONG_LONG num = big2ull(x, "long long");
+
+    if (BIGNUM_POSITIVE_P(x)) {
+        if (num <= LLONG_MAX)
+            return num;
+    }
+    else {
+        if (num <= LLONG_MAX)
+            return -(LONG_LONG)num;
+        if (num == 1+(unsigned LONG_LONG)(-(LLONG_MIN+1)))
+            return LLONG_MIN;
+    }
+    rb_raise(rb_eRangeError, "bignum too big to convert into `long long'");
+}
+
+#endif  /* HAVE_LONG_LONG */
+
+static VALUE
+dbl2big(double d)
 {
-    UINT i = 0;
-    long c;
-    USHORT *digits;
+    long i = 0;
+    BDIGIT c;
+    BDIGIT *digits;
     VALUE z;
     double u = (d < 0)?-d:d;
 
-    while (0 != (long)u) {
+    if (isinf(d)) {
+	rb_raise(rb_eFloatDomainError, d < 0 ? "-Infinity" : "Infinity");
+    }
+    if (isnan(d)) {
+	rb_raise(rb_eFloatDomainError, "NaN");
+    }
+
+    while (1.0 <= u) {
 	u /= (double)(BIGRAD);
 	i++;
     }
@@ -374,729 +5099,1963 @@ dbl2big(d)
     digits = BDIGITS(z);
     while (i--) {
 	u *= BIGRAD;
-	c = (long)u;
+	c = (BDIGIT)u;
 	u -= c;
 	digits[i] = c;
     }
 
-    return bignorm(z);
+    return z;
 }
 
-double
-big2dbl(x)
-    struct RBignum *x;
+VALUE
+rb_dbl2big(double d)
+{
+    return bignorm(dbl2big(d));
+}
+
+static double
+big2dbl(VALUE x)
 {
     double d = 0.0;
-    UINT i = x->len;
-    USHORT *ds = BDIGITS(x);
+    long i = (bigtrunc(x), BIGNUM_LEN(x)), lo = 0, bits;
+    BDIGIT *ds = BDIGITS(x), dl;
 
-    while (i--) d = ds[i] + BIGRAD*d;
-    if (!x->sign) d = -d;
+    if (i) {
+	bits = i * BITSPERDIG - nlz(ds[i-1]);
+	if (bits > DBL_MANT_DIG+DBL_MAX_EXP) {
+	    d = HUGE_VAL;
+	}
+	else {
+	    if (bits > DBL_MANT_DIG+1)
+		lo = (bits -= DBL_MANT_DIG+1) / BITSPERDIG;
+	    else
+		bits = 0;
+	    while (--i > lo) {
+		d = ds[i] + BIGRAD*d;
+	    }
+	    dl = ds[i];
+	    if (bits && (dl & ((BDIGIT)1 << (bits %= BITSPERDIG)))) {
+		int carry = (dl & ~(BDIGMAX << bits)) != 0;
+		if (!carry) {
+		    while (i-- > 0) {
+			carry = ds[i] != 0;
+			if (carry) break;
+		    }
+		}
+		if (carry) {
+		    dl &= BDIGMAX << bits;
+		    dl = BIGLO(dl + ((BDIGIT)1 << bits));
+		    if (!dl) d += 1;
+		}
+	    }
+	    d = dl + BIGRAD*d;
+	    if (lo) {
+		if (lo > INT_MAX / BITSPERDIG)
+		    d = HUGE_VAL;
+		else if (lo < INT_MIN / BITSPERDIG)
+		    d = 0.0;
+		else
+		    d = ldexp(d, (int)(lo * BITSPERDIG));
+	    }
+	}
+    }
+    if (!BIGNUM_SIGN(x)) d = -d;
     return d;
 }
 
-VALUE
-Fbig_to_f(x)
-    VALUE x;
+double
+rb_big2dbl(VALUE x)
 {
-    return float_new(big2dbl(x));
+    double d = big2dbl(x);
+
+    if (isinf(d)) {
+	rb_warning("Bignum out of Float range");
+	if (d < 0.0)
+	    d = -HUGE_VAL;
+	else
+	    d = HUGE_VAL;
+    }
+    return d;
 }
 
+/*
+ *  call-seq:
+ *     big.to_f -> float
+ *
+ *  Converts <i>big</i> to a <code>Float</code>. If <i>big</i> doesn't
+ *  fit in a <code>Float</code>, the result is infinity.
+ *
+ */
+
 static VALUE
-Fbig_uminus(x)
-    struct RBignum *x;
+rb_big_to_f(VALUE x)
 {
-    VALUE z = big_clone(x);
+    return DBL2NUM(rb_big2dbl(x));
+}
 
-    RBIGNUM(z)->sign = !x->sign;
+VALUE
+rb_integer_float_cmp(VALUE x, VALUE y)
+{
+    double yd = RFLOAT_VALUE(y);
+    double yi, yf;
+    VALUE rel;
 
-    return bignorm(z);
+    if (isnan(yd))
+        return Qnil;
+    if (isinf(yd)) {
+        if (yd > 0.0) return INT2FIX(-1);
+        else return INT2FIX(1);
+    }
+    yf = modf(yd, &yi);
+    if (FIXNUM_P(x)) {
+#if SIZEOF_LONG * CHAR_BIT < DBL_MANT_DIG /* assume FLT_RADIX == 2 */
+        double xd = (double)FIX2LONG(x);
+        if (xd < yd)
+            return INT2FIX(-1);
+        if (xd > yd)
+            return INT2FIX(1);
+        return INT2FIX(0);
+#else
+        long xn, yn;
+        if (yi < FIXNUM_MIN)
+            return INT2FIX(1);
+        if (FIXNUM_MAX+1 <= yi)
+            return INT2FIX(-1);
+        xn = FIX2LONG(x);
+        yn = (long)yi;
+        if (xn < yn)
+            return INT2FIX(-1);
+        if (xn > yn)
+            return INT2FIX(1);
+        if (yf < 0.0)
+            return INT2FIX(1);
+        if (0.0 < yf)
+            return INT2FIX(-1);
+        return INT2FIX(0);
+#endif
+    }
+    y = rb_dbl2big(yi);
+    rel = rb_big_cmp(x, y);
+    if (yf == 0.0 || rel != INT2FIX(0))
+        return rel;
+    if (yf < 0.0)
+        return INT2FIX(1);
+    return INT2FIX(-1);
 }
 
-static VALUE
-bigadd(x, y, sign)
-    struct RBignum *x, *y;
-    char sign;
+VALUE
+rb_integer_float_eq(VALUE x, VALUE y)
 {
-    struct RBignum *z;
-    USHORT *zds;
-    long num;
-    UINT i, len;
+    double yd = RFLOAT_VALUE(y);
+    double yi, yf;
 
-    len = MAX(x->len, y->len) + 1;
-    z = (struct RBignum*)bignew(len, sign==y->sign);
-    zds = BDIGITS(z);
+    if (isnan(yd) || isinf(yd))
+        return Qfalse;
+    yf = modf(yd, &yi);
+    if (yf != 0)
+        return Qfalse;
+    if (FIXNUM_P(x)) {
+#if SIZEOF_LONG * CHAR_BIT < DBL_MANT_DIG /* assume FLT_RADIX == 2 */
+        double xd = (double)FIX2LONG(x);
+        if (xd != yd)
+            return Qfalse;
+        return Qtrue;
+#else
+        long xn, yn;
+        if (yi < LONG_MIN || LONG_MAX < yi)
+            return Qfalse;
+        xn = FIX2LONG(x);
+        yn = (long)yi;
+        if (xn != yn)
+            return Qfalse;
+        return Qtrue;
+#endif
+    }
+    y = rb_dbl2big(yi);
+    return rb_big_eq(x, y);
+}
 
-    i = len;
-    while (i--) zds[i] = 0;
-    i = y->len;
-    while (i--) zds[i] = BDIGITS(y)[i];
-
-    i = 0; num = 0;
-    if (x->sign == z->sign) {
-	do {
-	    num += (long)zds[i] + BDIGITS(x)[i];
-	    zds[i++] = BIGLO(num);
-	    num = BIGDN(num);
-	} while (i < x->len);
-	if (num) {
-	    while (i < y->len) {
-		num += zds[i];
-		zds[i++] = BIGLO(num);
-		num = BIGDN(num);
-	    }
-	    BDIGITS(z)[i] = num;
-	}
+/*
+ *  call-seq:
+ *     big <=> numeric   -> -1, 0, +1 or nil
+ *
+ *  Comparison---Returns -1, 0, or +1 depending on whether +big+ is
+ *  less than, equal to, or greater than +numeric+. This is the
+ *  basis for the tests in Comparable.
+ *
+ *  +nil+ is returned if the two values are incomparable.
+ *
+ */
+
+VALUE
+rb_big_cmp(VALUE x, VALUE y)
+{
+    int cmp;
+
+    if (FIXNUM_P(y)) {
+        x = bignorm(x);
+        if (FIXNUM_P(x)) {
+            if (FIX2LONG(x) > FIX2LONG(y)) return INT2FIX(1);
+            if (FIX2LONG(x) < FIX2LONG(y)) return INT2FIX(-1);
+            return INT2FIX(0);
+        }
+        else {
+            if (BIGNUM_NEGATIVE_P(x)) return INT2FIX(-1);
+            return INT2FIX(1);
+        }
+    }
+    else if (RB_BIGNUM_TYPE_P(y)) {
+    }
+    else if (RB_FLOAT_TYPE_P(y)) {
+        return rb_integer_float_cmp(x, y);
     }
     else {
-	do {
-	    num += (long)zds[i] - BDIGITS(x)[i];
-	    if (num < 0) {
-		zds[i] = num + BIGRAD;
-		num = -1;
-	    }
-	    else {
-		zds[i] = BIGLO(num);
-		num = 0;
-	    }
-	} while (++i < x->len);
-	if (num && x->len == y->len) {
-	    num = 1; i = 0;
-	    z->sign = 1;
-	    do {
-		num += (BIGRAD-1) - zds[i];
-		zds[i++] = BIGLO(num);
-		num = BIGDN(num);
-	    } while (i < y->len);
-	}
-	else while (i < y->len) {
-	    num += zds[i];
-	    if (num < 0) {
-		zds[i++] = num + BIGRAD;
-		num = -1;
-	    }
-	    else {
-		zds[i++] = BIGLO(num);
-		num = 0;
-	    }
-	}
+	return rb_num_coerce_cmp(x, y, rb_intern("<=>"));
     }
 
-    return bignorm(z);
+    if (BIGNUM_SIGN(x) > BIGNUM_SIGN(y)) return INT2FIX(1);
+    if (BIGNUM_SIGN(x) < BIGNUM_SIGN(y)) return INT2FIX(-1);
+
+    cmp = bary_cmp(BDIGITS(x), BIGNUM_LEN(x), BDIGITS(y), BIGNUM_LEN(y));
+    if (BIGNUM_SIGN(x))
+        return INT2FIX(cmp);
+    else
+        return INT2FIX(-cmp);
 }
 
-VALUE
-Fbig_plus(x, y)
-    VALUE x, y;
+enum big_op_t {
+    big_op_gt,
+    big_op_ge,
+    big_op_lt,
+    big_op_le
+};
+
+static VALUE
+big_op(VALUE x, VALUE y, enum big_op_t op)
 {
-    VALUE z;
+    VALUE rel;
+    int n;
 
-    if (FIXNUM_P(y)) y = int2big(FIX2INT(y));
+    if (FIXNUM_P(y) || RB_BIGNUM_TYPE_P(y)) {
+	rel = rb_big_cmp(x, y);
+    }
+    else if (RB_FLOAT_TYPE_P(y)) {
+        rel = rb_integer_float_cmp(x, y);
+    }
     else {
-	Check_Type(x, T_BIGNUM);
+	ID id = 0;
+	switch (op) {
+	  case big_op_gt: id = '>'; break;
+	  case big_op_ge: id = rb_intern(">="); break;
+	  case big_op_lt: id = '<'; break;
+	  case big_op_le: id = rb_intern("<="); break;
+	}
+	return rb_num_coerce_relop(x, y, id);
     }
-    z = bigadd(x, y, 1);
 
-    return z;
+    if (NIL_P(rel)) return Qfalse;
+    n = FIX2INT(rel);
+
+    switch (op) {
+	case big_op_gt: return n >  0 ? Qtrue : Qfalse;
+	case big_op_ge: return n >= 0 ? Qtrue : Qfalse;
+	case big_op_lt: return n <  0 ? Qtrue : Qfalse;
+	case big_op_le: return n <= 0 ? Qtrue : Qfalse;
+    }
+    return Qundef;
 }
 
+/*
+ * call-seq:
+ *   big > real  ->  true or false
+ *
+ * Returns <code>true</code> if the value of <code>big</code> is
+ * greater than that of <code>real</code>.
+ */
+
+static VALUE
+big_gt(VALUE x, VALUE y)
+{
+    return big_op(x, y, big_op_gt);
+}
+
+/*
+ * call-seq:
+ *   big >= real  ->  true or false
+ *
+ * Returns <code>true</code> if the value of <code>big</code> is
+ * greater than or equal to that of <code>real</code>.
+ */
+
+static VALUE
+big_ge(VALUE x, VALUE y)
+{
+    return big_op(x, y, big_op_ge);
+}
+
+/*
+ * call-seq:
+ *   big < real  ->  true or false
+ *
+ * Returns <code>true</code> if the value of <code>big</code> is
+ * less than that of <code>real</code>.
+ */
+
+static VALUE
+big_lt(VALUE x, VALUE y)
+{
+    return big_op(x, y, big_op_lt);
+}
+
+/*
+ * call-seq:
+ *   big <= real  ->  true or false
+ *
+ * Returns <code>true</code> if the value of <code>big</code> is
+ * less than or equal to that of <code>real</code>.
+ */
+
+static VALUE
+big_le(VALUE x, VALUE y)
+{
+    return big_op(x, y, big_op_le);
+}
+
+/*
+ *  call-seq:
+ *     big == obj  -> true or false
+ *
+ *  Returns <code>true</code> only if <i>obj</i> has the same value
+ *  as <i>big</i>. Contrast this with <code>Bignum#eql?</code>, which
+ *  requires <i>obj</i> to be a <code>Bignum</code>.
+ *
+ *     68719476736 == 68719476736.0   #=> true
+ */
+
 VALUE
-Fbig_minus(x, y)
-    VALUE x, y;
+rb_big_eq(VALUE x, VALUE y)
 {
-    if (FIXNUM_P(y)) y = int2big(FIX2INT(y));
+    if (FIXNUM_P(y)) {
+	if (bignorm(x) == y) return Qtrue;
+	y = rb_int2big(FIX2LONG(y));
+    }
+    else if (RB_BIGNUM_TYPE_P(y)) {
+    }
+    else if (RB_FLOAT_TYPE_P(y)) {
+        return rb_integer_float_eq(x, y);
+    }
     else {
-	Check_Type(y, T_BIGNUM);
+	return rb_equal(y, x);
     }
-    x = bigadd(x, y, 0);
+    if (BIGNUM_SIGN(x) != BIGNUM_SIGN(y)) return Qfalse;
+    if (BIGNUM_LEN(x) != BIGNUM_LEN(y)) return Qfalse;
+    if (MEMCMP(BDIGITS(x),BDIGITS(y),BDIGIT,BIGNUM_LEN(y)) != 0) return Qfalse;
+    return Qtrue;
+}
 
-    return x;
+/*
+ *  call-seq:
+ *     big.eql?(obj)   -> true or false
+ *
+ *  Returns <code>true</code> only if <i>obj</i> is a
+ *  <code>Bignum</code> with the same value as <i>big</i>. Contrast this
+ *  with <code>Bignum#==</code>, which performs type conversions.
+ *
+ *     68719476736.eql?(68719476736.0)   #=> false
+ */
+
+VALUE
+rb_big_eql(VALUE x, VALUE y)
+{
+    if (!RB_BIGNUM_TYPE_P(y)) return Qfalse;
+    if (BIGNUM_SIGN(x) != BIGNUM_SIGN(y)) return Qfalse;
+    if (BIGNUM_LEN(x) != BIGNUM_LEN(y)) return Qfalse;
+    if (MEMCMP(BDIGITS(x),BDIGITS(y),BDIGIT,BIGNUM_LEN(y)) != 0) return Qfalse;
+    return Qtrue;
 }
 
+/*
+ * call-seq:
+ *    -big   ->  integer
+ *
+ * Unary minus (returns an integer whose value is 0-big)
+ */
+
 VALUE
-Fbig_mul(x, y)
-    struct RBignum *x, *y;
+rb_big_uminus(VALUE x)
 {
-    UINT i = 0, j;
-    unsigned long n = 0;
-    VALUE z;
-    USHORT *zds;
+    VALUE z = rb_big_clone(x);
+
+    BIGNUM_SET_SIGN(z, !BIGNUM_SIGN(x));
+
+    return bignorm(z);
+}
+
+/*
+ * call-seq:
+ *     ~big  ->  integer
+ *
+ * Inverts the bits in big. As Bignums are conceptually infinite
+ * length, the result acts as if it had an infinite number of one
+ * bits to the left. In hex representations, this is displayed
+ * as two periods to the left of the digits.
+ *
+ *   sprintf("%X", ~0x1122334455)    #=> "..FEEDDCCBBAA"
+ */
 
-    if (FIXNUM_P(x)) x = (struct RBignum*)int2big(FIX2INT(x));
-    if (FIXNUM_P(y)) y = (struct RBignum*)int2big(FIX2INT(y));
+static VALUE
+rb_big_neg(VALUE x)
+{
+    VALUE z = rb_big_clone(x);
+    BDIGIT *ds = BDIGITS(z);
+    long n = BIGNUM_LEN(z);
+
+    if (!n) return INT2FIX(-1);
+
+    if (BIGNUM_POSITIVE_P(z)) {
+        if (bary_add_one(ds, n)) {
+            big_extend_carry(z);
+        }
+        BIGNUM_SET_NEGATIVE_SIGN(z);
+    }
     else {
-	Check_Type(y, T_BIGNUM);
+        bary_neg(ds, n);
+        if (bary_add_one(ds, n))
+            return INT2FIX(-1);
+        bary_neg(ds, n);
+        BIGNUM_SET_POSITIVE_SIGN(z);
     }
 
-    j = x->len + y->len + 1;
-    z = bignew(j, x->sign==y->sign);
-    zds = BDIGITS(z);
-    while (j--) zds[j] = 0;
-    do {
-	j = 0;
-	if (BDIGITS(x)[i]) {
-	    do {
-		n += zds[i + j] + ((unsigned long)BDIGITS(x)[i]*BDIGITS(y)[j]);
-		zds[i + j++] = BIGLO(n);
-		n = BIGDN(n);
-	    } while (j < y->len);
-	    if (n) {
-		zds[i + j] = n;
-		n = 0;
-	    }
-	}
-    } while (++i < x->len);
-
     return bignorm(z);
 }
 
-static void
-bigdivmod(x, y, div, mod)
-    struct RBignum *x, *y;
-    VALUE *div, *mod;
+static VALUE
+bigsub(VALUE x, VALUE y)
 {
-    UINT nx = x->len, ny = y->len, i, j;
     VALUE z;
-    USHORT *xds, *yds, *zds, *tds;
-    unsigned long t2;
-    long num;
-    USHORT dd, q;
+    BDIGIT *xds, *yds, *zds;
+    long xn, yn, zn;
 
+    xn = BIGNUM_LEN(x);
+    yn = BIGNUM_LEN(y);
+    zn = xn < yn ? yn : xn;
+
+    z = bignew(zn, 1);
+
+    xds = BDIGITS(x);
     yds = BDIGITS(y);
-    if (ny == 0 && yds[0] == 0) Fail("divided by 0");
-    if (nx < ny) {
-	if (div) *div = INT2FIX(0);
-	if (mod) *mod = bignorm(x);
-	return;
+    zds = BDIGITS(z);
+
+    if (bary_sub(zds, zn, xds, xn, yds, yn)) {
+        bary_2comp(zds, zn);
+        BIGNUM_SET_NEGATIVE_SIGN(z);
     }
+
+    return z;
+}
+
+static VALUE bigadd_int(VALUE x, long y);
+
+static VALUE
+bigsub_int(VALUE x, long y0)
+{
+    VALUE z;
+    BDIGIT *xds, *zds;
+    long xn, zn;
+    BDIGIT_DBL_SIGNED num;
+    long i, y;
+
+    y = y0;
     xds = BDIGITS(x);
-    if (ny == 1) {
-	dd = yds[0];
-	z = big_clone(x);
-	zds = BDIGITS(z);
-	t2 = 0; i = nx;
-	while(i--) {
-	    t2 = BIGUP(t2) + zds[i];
-	    zds[i] = t2 / dd;
-	    t2 %= dd;
-	}
-	if (div) *div = bignorm(z);
-	if (mod) {
-	    if (!y->sign) t2 = -t2;
-	    *mod = FIX2INT(t2);
-	}
-	return;
+    xn = BIGNUM_LEN(x);
+
+    if (xn == 0)
+        return LONG2NUM(-y0);
+
+    zn = xn;
+#if SIZEOF_BDIGIT < SIZEOF_LONG
+    if (zn < bdigit_roomof(SIZEOF_LONG))
+        zn = bdigit_roomof(SIZEOF_LONG);
+#endif
+    z = bignew(zn, BIGNUM_SIGN(x));
+    zds = BDIGITS(z);
+
+#if SIZEOF_BDIGIT >= SIZEOF_LONG
+    assert(xn == zn);
+    num = (BDIGIT_DBL_SIGNED)xds[0] - y;
+    if (xn == 1 && num < 0) {
+	BIGNUM_SET_SIGN(z, !BIGNUM_SIGN(x));
+	zds[0] = (BDIGIT)-num;
+	RB_GC_GUARD(x);
+	return bignorm(z);
+    }
+    zds[0] = BIGLO(num);
+    num = BIGDN(num);
+    i = 1;
+    if (i < xn)
+        goto y_is_zero_x;
+    goto finish;
+#else
+    num = 0;
+    for (i=0; i < xn; i++) {
+        if (y == 0) goto y_is_zero_x;
+	num += (BDIGIT_DBL_SIGNED)xds[i] - BIGLO(y);
+	zds[i] = BIGLO(num);
+	num = BIGDN(num);
+	y = BIGDN(y);
+    }
+    for (; i < zn; i++) {
+        if (y == 0) goto y_is_zero_z;
+        num -= BIGLO(y);
+        zds[i] = BIGLO(num);
+        num = BIGDN(num);
+        y = BIGDN(y);
+    }
+    goto finish;
+#endif
+
+    for (; i < xn; i++) {
+      y_is_zero_x:
+        if (num == 0) goto num_is_zero_x;
+	num += xds[i];
+	zds[i] = BIGLO(num);
+	num = BIGDN(num);
     }
-    z = bignew(nx==ny?nx+2:nx+1, x->sign==y->sign);
+#if SIZEOF_BDIGIT < SIZEOF_LONG
+    for (; i < zn; i++) {
+      y_is_zero_z:
+        if (num == 0) goto num_is_zero_z;
+        zds[i] = BIGLO(num);
+        num = BIGDN(num);
+    }
+#endif
+    goto finish;
+
+    for (; i < xn; i++) {
+      num_is_zero_x:
+	zds[i] = xds[i];
+    }
+#if SIZEOF_BDIGIT < SIZEOF_LONG
+    for (; i < zn; i++) {
+      num_is_zero_z:
+        zds[i] = 0;
+    }
+#endif
+    goto finish;
+
+  finish:
+    assert(num == 0 || num == -1);
+    if (num < 0) {
+        get2comp(z);
+	BIGNUM_SET_SIGN(z, !BIGNUM_SIGN(x));
+    }
+    RB_GC_GUARD(x);
+    return bignorm(z);
+}
+
+static VALUE
+bigadd_int(VALUE x, long y)
+{
+    VALUE z;
+    BDIGIT *xds, *zds;
+    long xn, zn;
+    BDIGIT_DBL num;
+    long i;
+
+    xds = BDIGITS(x);
+    xn = BIGNUM_LEN(x);
+
+    if (xn == 0)
+        return LONG2NUM(y);
+
+    zn = xn;
+#if SIZEOF_BDIGIT < SIZEOF_LONG
+    if (zn < bdigit_roomof(SIZEOF_LONG))
+        zn = bdigit_roomof(SIZEOF_LONG);
+#endif
+    zn++;
+
+    z = bignew(zn, BIGNUM_SIGN(x));
     zds = BDIGITS(z);
-    if (nx==ny) zds[nx+1] = 0;
-    while (!yds[ny-1]) ny--;
-    if ((dd = BIGRAD/(int)(yds[ny-1]+1)) != 1) {
-	y = (struct RBignum*)big_clone(y);
-	tds = BDIGITS(y);
-	j = 0;
-	num = 0;
-	while (j<ny) {
-	    num += (unsigned long)yds[j]*dd;
-	    tds[j++] = BIGLO(num);
-	    num = BIGDN(num);
+
+#if SIZEOF_BDIGIT >= SIZEOF_LONG
+    num = (BDIGIT_DBL)xds[0] + y;
+    zds[0] = BIGLO(num);
+    num = BIGDN(num);
+    i = 1;
+    if (i < xn)
+        goto y_is_zero_x;
+    goto y_is_zero_z;
+#else
+    num = 0;
+    for (i=0; i < xn; i++) {
+        if (y == 0) goto y_is_zero_x;
+	num += (BDIGIT_DBL)xds[i] + BIGLO(y);
+	zds[i] = BIGLO(num);
+	num = BIGDN(num);
+	y = BIGDN(y);
+    }
+    for (; i < zn; i++) {
+        if (y == 0) goto y_is_zero_z;
+	num += BIGLO(y);
+	zds[i] = BIGLO(num);
+	num = BIGDN(num);
+	y = BIGDN(y);
+    }
+    goto finish;
+
+#endif
+
+    for (;i < xn; i++) {
+      y_is_zero_x:
+        if (num == 0) goto num_is_zero_x;
+	num += (BDIGIT_DBL)xds[i];
+	zds[i] = BIGLO(num);
+	num = BIGDN(num);
+    }
+    for (; i < zn; i++) {
+      y_is_zero_z:
+        if (num == 0) goto num_is_zero_z;
+	zds[i] = BIGLO(num);
+	num = BIGDN(num);
+    }
+    goto finish;
+
+    for (;i < xn; i++) {
+      num_is_zero_x:
+	zds[i] = xds[i];
+    }
+    for (; i < zn; i++) {
+      num_is_zero_z:
+	zds[i] = 0;
+    }
+    goto finish;
+
+  finish:
+    RB_GC_GUARD(x);
+    return bignorm(z);
+}
+
+static VALUE
+bigadd(VALUE x, VALUE y, int sign)
+{
+    VALUE z;
+    size_t len;
+
+    sign = (sign == BIGNUM_SIGN(y));
+    if (BIGNUM_SIGN(x) != sign) {
+	if (sign) return bigsub(y, x);
+	return bigsub(x, y);
+    }
+
+    if (BIGNUM_LEN(x) > BIGNUM_LEN(y)) {
+	len = BIGNUM_LEN(x) + 1;
+    }
+    else {
+	len = BIGNUM_LEN(y) + 1;
+    }
+    z = bignew(len, sign);
+
+    bary_add(BDIGITS(z), BIGNUM_LEN(z),
+             BDIGITS(x), BIGNUM_LEN(x),
+             BDIGITS(y), BIGNUM_LEN(y));
+
+    return z;
+}
+
+/*
+ *  call-seq:
+ *     big + other  -> Numeric
+ *
+ *  Adds big and other, returning the result.
+ */
+
+VALUE
+rb_big_plus(VALUE x, VALUE y)
+{
+    long n;
+
+    if (FIXNUM_P(y)) {
+	n = FIX2LONG(y);
+	if ((n > 0) != BIGNUM_SIGN(x)) {
+	    if (n < 0) {
+		n = -n;
+	    }
+	    return bigsub_int(x, n);
 	}
-	yds = tds;
-	j = 0;
-	num = 0;
-	while (j<nx) {
-	    num += (unsigned long)xds[j]*dd;
-	    zds[j++] = BIGLO(num);
-	    num = BIGDN(num);
+	if (n < 0) {
+	    n = -n;
 	}
-	zds[j] = num;
+	return bigadd_int(x, n);
+    }
+    else if (RB_BIGNUM_TYPE_P(y)) {
+	return bignorm(bigadd(x, y, 1));
+    }
+    else if (RB_FLOAT_TYPE_P(y)) {
+	return DBL2NUM(rb_big2dbl(x) + RFLOAT_VALUE(y));
     }
     else {
-	zds[nx] = 0;
-	j = nx;
-	while (j--) zds[j] = xds[j];
+	return rb_num_coerce_bin(x, y, '+');
     }
-    j = nx==ny?nx+1:nx;
-    do {
-	if (zds[j] ==  yds[ny-1]) q = BIGRAD-1;
-	else q = (BIGUP(zds[j]) + zds[j-1])/yds[ny-1];
-	if (q) {
-	    i = 0; num = 0; t2 = 0;
-	    do {			/* multiply and subtract */
-		t2 += (unsigned long)yds[i] * q;
-		num += zds[j - ny + i] - BIGLO(t2);
-		if (num < 0) {
-		    zds[j - ny + i] = num + BIGRAD;
-		    num = -1;
-		}
-		else {
-		    zds[j - ny + i] = num;
-		    num = 0;
-		}
-		t2 = BIGDN(t2);
-	    } while (++i < ny);
-	    num += zds[j - ny + i] - t2; /* borrow from high digit; don't update */
-	    while (num) {		/* "add back" required */
-		i = 0; num = 0; q--;
-		do {
-		    num += (long) zds[j - ny + i] + yds[i];
-		    zds[j - ny + i] = BIGLO(num);
-		    num = BIGDN(num);
-		} while (++i < ny);
-		num--;
+}
+
+/*
+ *  call-seq:
+ *     big - other  -> Numeric
+ *
+ *  Subtracts other from big, returning the result.
+ */
+
+VALUE
+rb_big_minus(VALUE x, VALUE y)
+{
+    long n;
+
+    if (FIXNUM_P(y)) {
+	n = FIX2LONG(y);
+	if ((n > 0) != BIGNUM_SIGN(x)) {
+	    if (n < 0) {
+		n = -n;
 	    }
+	    return bigadd_int(x, n);
 	}
-	zds[j] = q;
-    } while (--j >= ny);
-    if (div) {			/* move quotient down in z */
-	*div = big_clone(z);
-	zds = BDIGITS(*div);
-	j = (nx==ny ? nx+2 : nx+1) - ny;
-	for (i = 0;i < j;i++) zds[i] = zds[i+ny];
-	RBIGNUM(*div)->len = i;
-	*div = bignorm(*div);
-    }
-    if (mod) {			/* just normalize remainder */
-	*mod = big_clone(z);
-	if (dd) {
-	    zds = BDIGITS(*mod);
-	    t2 = 0; i = ny;
-	    while(i--) {
-		t2 = BIGUP(t2) + zds[i];
-		zds[i] = t2 / dd;
-		t2 %= dd;
-	    }
+	if (n < 0) {
+	    n = -n;
 	}
-	RBIGNUM(*mod)->len = ny;
-	RBIGNUM(*mod)->sign = y->sign;
-	*mod = bignorm(*mod);
+	return bigsub_int(x, n);
+    }
+    else if (RB_BIGNUM_TYPE_P(y)) {
+	return bignorm(bigadd(x, y, 0));
+    }
+    else if (RB_FLOAT_TYPE_P(y)) {
+	return DBL2NUM(rb_big2dbl(x) - RFLOAT_VALUE(y));
+    }
+    else {
+	return rb_num_coerce_bin(x, y, '-');
     }
 }
 
 static VALUE
-Fbig_div(x, y)
-    VALUE x, y;
+bigsq(VALUE x)
 {
+    long xn, zn;
     VALUE z;
+    BDIGIT *xds, *zds;
 
-    if (FIXNUM_P(y)) y = int2big(FIX2INT(y));
-    else {
-	Check_Type(y, T_BIGNUM);
-    }
-    bigdivmod(x, y, &z, Qnil);
+    xn = BIGNUM_LEN(x);
+    zn = 2 * xn;
+
+    z = bignew(zn, 1);
 
+    xds = BDIGITS(x);
+    zds = BDIGITS(z);
+
+#ifdef USE_GMP
+    if (xn < GMP_MUL_DIGITS)
+        bary_sq_fast(zds, zn, xds, xn);
+    else
+        bary_mul(zds, zn, xds, xn, xds, xn);
+#else
+    if (xn < KARATSUBA_MUL_DIGITS)
+        bary_sq_fast(zds, zn, xds, xn);
+    else
+        bary_mul(zds, zn, xds, xn, xds, xn);
+#endif
+
+    RB_GC_GUARD(x);
     return z;
 }
 
 static VALUE
-Fbig_mod(x, y)
-    VALUE x, y;
+bigmul0(VALUE x, VALUE y)
 {
+    long xn, yn, zn;
     VALUE z;
+    BDIGIT *xds, *yds, *zds;
+
+    if (x == y)
+        return bigsq(x);
+
+    xn = BIGNUM_LEN(x);
+    yn = BIGNUM_LEN(y);
+    zn = xn + yn;
+
+    z = bignew(zn, BIGNUM_SIGN(x)==BIGNUM_SIGN(y));
 
-    if (FIXNUM_P(y)) y = int2big(FIX2INT(y));
+    xds = BDIGITS(x);
+    yds = BDIGITS(y);
+    zds = BDIGITS(z);
+
+    bary_mul(zds, zn, xds, xn, yds, yn);
+
+    RB_GC_GUARD(x);
+    RB_GC_GUARD(y);
+    return z;
+}
+
+/*
+ *  call-seq:
+ *     big * other  -> Numeric
+ *
+ *  Multiplies big and other, returning the result.
+ */
+
+VALUE
+rb_big_mul(VALUE x, VALUE y)
+{
+    if (FIXNUM_P(y)) {
+	y = rb_int2big(FIX2LONG(y));
+    }
+    else if (RB_BIGNUM_TYPE_P(y)) {
+    }
+    else if (RB_FLOAT_TYPE_P(y)) {
+	return DBL2NUM(rb_big2dbl(x) * RFLOAT_VALUE(y));
+    }
     else {
-	Check_Type(y, T_BIGNUM);
+	return rb_num_coerce_bin(x, y, '*');
     }
-    bigdivmod(x, y, Qnil, &z);
 
-    return z;
+    return bignorm(bigmul0(x, y));
 }
 
 static VALUE
-Fbig_divmod(x, y)
-    VALUE x, y;
+bigdivrem(VALUE x, VALUE y, volatile VALUE *divp, volatile VALUE *modp)
 {
-    VALUE div, mod;
+    long xn = BIGNUM_LEN(x), yn = BIGNUM_LEN(y);
+    VALUE z;
+    BDIGIT *xds, *yds, *zds;
+    BDIGIT dd;
+
+    VALUE q = Qnil, r = Qnil;
+    BDIGIT *qds, *rds;
+    long qn, rn;
+
+    yds = BDIGITS(y);
+    BARY_TRUNC(yds, yn);
+    if (yn == 0)
+        rb_num_zerodiv();
+
+    xds = BDIGITS(x);
+    BARY_TRUNC(xds, xn);
 
-    if (FIXNUM_P(y)) y = int2big(FIX2INT(y));
+    if (xn < yn || (xn == yn && xds[xn - 1] < yds[yn - 1])) {
+	if (divp) *divp = rb_int2big(0);
+	if (modp) *modp = x;
+	return Qnil;
+    }
+    if (yn == 1) {
+	dd = yds[0];
+	z = bignew(xn, BIGNUM_SIGN(x)==BIGNUM_SIGN(y));
+	zds = BDIGITS(z);
+        dd = bigdivrem_single(zds, xds, xn, dd);
+	if (modp) {
+	    *modp = rb_uint2big((VALUE)dd);
+	    BIGNUM_SET_SIGN(*modp, BIGNUM_SIGN(x));
+	}
+	if (divp) *divp = z;
+	return Qnil;
+    }
+    if (xn == 2 && yn == 2) {
+        BDIGIT_DBL x0 = bary2bdigitdbl(xds, 2);
+        BDIGIT_DBL y0 = bary2bdigitdbl(yds, 2);
+        BDIGIT_DBL q0 = x0 / y0;
+        BDIGIT_DBL r0 = x0 % y0;
+        if (divp) {
+            z = bignew(bdigit_roomof(sizeof(BDIGIT_DBL)), BIGNUM_SIGN(x)==BIGNUM_SIGN(y));
+            zds = BDIGITS(z);
+            zds[0] = BIGLO(q0);
+            zds[1] = BIGLO(BIGDN(q0));
+            *divp = z;
+        }
+        if (modp) {
+            z = bignew(bdigit_roomof(sizeof(BDIGIT_DBL)), BIGNUM_SIGN(x));
+            zds = BDIGITS(z);
+            zds[0] = BIGLO(r0);
+            zds[1] = BIGLO(BIGDN(r0));
+            *modp = z;
+        }
+        return Qnil;
+    }
+
+    if (divp) {
+        qn = xn + BIGDIVREM_EXTRA_WORDS;
+        q = bignew(qn, BIGNUM_SIGN(x)==BIGNUM_SIGN(y));
+        qds = BDIGITS(q);
+    }
     else {
-	Check_Type(y, T_BIGNUM);
+        qn = 0;
+        qds = NULL;
+    }
+
+    if (modp) {
+        rn = yn;
+        r = bignew(rn, BIGNUM_SIGN(x));
+        rds = BDIGITS(r);
+    }
+    else {
+        rn = 0;
+        rds = NULL;
     }
-    bigdivmod(x, y, &div, &mod);
 
-    return assoc_new(div, mod);;
+    bary_divmod_branch(qds, qn, rds, rn, xds, xn, yds, yn);
+
+    if (divp) {
+        bigtrunc(q);
+        *divp = q;
+    }
+    if (modp) {
+        bigtrunc(r);
+        *modp = r;
+    }
+
+    return Qnil;
 }
 
-VALUE
-Fbig_pow(x, y)
-    VALUE x, y;
+static void
+bigdivmod(VALUE x, VALUE y, volatile VALUE *divp, volatile VALUE *modp)
 {
-    double d1, d2;
-    VALUE z;
-    int n;
+    VALUE mod;
 
-    if (TYPE(y) == T_FLOAT) {
-	return float_new(pow(big2dbl(x), RFLOAT(y)->value));
+    bigdivrem(x, y, divp, &mod);
+    if (BIGNUM_SIGN(x) != BIGNUM_SIGN(y) && !BIGZEROP(mod)) {
+	if (divp) *divp = bigadd(*divp, rb_int2big(1), 0);
+	if (modp) *modp = bigadd(mod, y, 1);
     }
-    n = NUM2INT(y);
-    if (n == 0) return INT2FIX(1);
-    if (n < 0) {
-	return float_new(pow(big2dbl(x), (double)n));
+    else if (modp) {
+	*modp = mod;
     }
+}
+
+
+static VALUE
+rb_big_divide(VALUE x, VALUE y, ID op)
+{
+    VALUE z;
 
-    z = x;
-    while (--n) {
-	while (!(n % 2)) {
-	    n = n /2;
-	    x = Fbig_mul(x, x);
+    if (FIXNUM_P(y)) {
+	y = rb_int2big(FIX2LONG(y));
+    }
+    else if (RB_BIGNUM_TYPE_P(y)) {
+    }
+    else if (RB_FLOAT_TYPE_P(y)) {
+	if (op == '/') {
+	    return DBL2NUM(rb_big2dbl(x) / RFLOAT_VALUE(y));
+	}
+	else {
+	    double dy = RFLOAT_VALUE(y);
+	    if (dy == 0.0) rb_num_zerodiv();
+	    return rb_dbl2big(rb_big2dbl(x) / dy);
 	}
-	z = Fbig_mul(z, x);
     }
-    return z;
+    else {
+	return rb_num_coerce_bin(x, y, op);
+    }
+    bigdivmod(x, y, &z, 0);
+
+    return bignorm(z);
 }
 
+/*
+ *  call-seq:
+ *     big / other     -> Numeric
+ *
+ * Performs division: the class of the resulting object depends on
+ * the class of <code>numeric</code> and on the magnitude of the
+ * result.
+ */
+
 VALUE
-Fbig_and(x, y)
-    struct RBignum *x, *y;
+rb_big_div(VALUE x, VALUE y)
+{
+    return rb_big_divide(x, y, '/');
+}
+
+/*
+ *  call-seq:
+ *     big.div(other)  -> integer
+ *
+ * Performs integer division: returns integer value.
+ */
+
+VALUE
+rb_big_idiv(VALUE x, VALUE y)
+{
+    return rb_big_divide(x, y, rb_intern("div"));
+}
+
+/*
+ *  call-seq:
+ *     big % other         -> Numeric
+ *     big.modulo(other)   -> Numeric
+ *
+ *  Returns big modulo other. See Numeric.divmod for more
+ *  information.
+ */
+
+VALUE
+rb_big_modulo(VALUE x, VALUE y)
 {
     VALUE z;
-    USHORT *ds1, *ds2, *zds;
-    UINT i, l1, l2;
-    char sign;
 
     if (FIXNUM_P(y)) {
-	y = (struct RBignum*)int2big(FIX2INT(y));
+	y = rb_int2big(FIX2LONG(y));
     }
-    else {
-	Check_Type(y, T_BIGNUM);
+    else if (!RB_BIGNUM_TYPE_P(y)) {
+	return rb_num_coerce_bin(x, y, '%');
     }
+    bigdivmod(x, y, 0, &z);
+
+    return bignorm(z);
+}
+
+/*
+ *  call-seq:
+ *     big.remainder(numeric)    -> number
+ *
+ *  Returns the remainder after dividing <i>big</i> by <i>numeric</i>.
+ *
+ *     -1234567890987654321.remainder(13731)      #=> -6966
+ *     -1234567890987654321.remainder(13731.24)   #=> -9906.22531493148
+ */
+static VALUE
+rb_big_remainder(VALUE x, VALUE y)
+{
+    VALUE z;
 
-    if (!y->sign) {
-	y = (struct RBignum*)big_clone(y);
-	big_2comp(y);
+    if (FIXNUM_P(y)) {
+	y = rb_int2big(FIX2LONG(y));
     }
-    if (!x->sign) {
-	x = (struct RBignum*)big_clone(x);
-	big_2comp(x);
+    else if (!RB_BIGNUM_TYPE_P(y)) {
+	return rb_num_coerce_bin(x, y, rb_intern("remainder"));
     }
-    if (x->len > y->len) {
-	l1 = y->len;
-	l2 = x->len;
-	ds1 = BDIGITS(y);
-	ds2 = BDIGITS(x);
-	sign = y->sign;
+    bigdivrem(x, y, 0, &z);
+
+    return bignorm(z);
+}
+
+/*
+ *  call-seq:
+ *     big.divmod(numeric)   -> array
+ *
+ *  See <code>Numeric#divmod</code>.
+ *
+ */
+VALUE
+rb_big_divmod(VALUE x, VALUE y)
+{
+    VALUE div, mod;
+
+    if (FIXNUM_P(y)) {
+	y = rb_int2big(FIX2LONG(y));
     }
-    else {
-	l1 = x->len;
-	l2 = y->len;
-	ds1 = BDIGITS(x);
-	ds2 = BDIGITS(y);
-	sign = x->sign;
+    else if (!RB_BIGNUM_TYPE_P(y)) {
+	return rb_num_coerce_bin(x, y, rb_intern("divmod"));
     }
-    z = bignew(l2, x->sign && y->sign);
-    zds = BDIGITS(z);
+    bigdivmod(x, y, &div, &mod);
 
-    for (i=0; i<l1; i++) {
-	zds[i] = ds1[i] & ds2[i];
-    }
-    for (; i<l2; i++) {
-	zds[i] = sign?0:ds2[i];
+    return rb_assoc_new(bignorm(div), bignorm(mod));
+}
+
+static VALUE
+big_shift(VALUE x, long n)
+{
+    if (n < 0)
+	return big_lshift(x, 1+(unsigned long)(-(n+1)));
+    else if (n > 0)
+	return big_rshift(x, (unsigned long)n);
+    return x;
+}
+
+static VALUE
+big_fdiv(VALUE x, VALUE y, long ey)
+{
+#define DBL_BIGDIG ((DBL_MANT_DIG + BITSPERDIG) / BITSPERDIG)
+    VALUE z;
+    long l, ex;
+
+    bigtrunc(x);
+    l = BIGNUM_LEN(x);
+    ex = l * BITSPERDIG - nlz(BDIGITS(x)[l-1]);
+    ex -= 2 * DBL_BIGDIG * BITSPERDIG;
+    if (ex) x = big_shift(x, ex);
+
+    bigdivrem(x, y, &z, 0);
+    l = ex - ey;
+#if SIZEOF_LONG > SIZEOF_INT
+    {
+	/* Visual C++ can't be here */
+	if (l > INT_MAX) return DBL2NUM(INFINITY);
+	if (l < INT_MIN) return DBL2NUM(0.0);
     }
-    if (!RBIGNUM(z)->sign) big_2comp(z);
-    return bignorm(z);
+#endif
+    return DBL2NUM(ldexp(big2dbl(z), (int)l));
+}
+
+static VALUE
+big_fdiv_int(VALUE x, VALUE y)
+{
+    long l, ey;
+    bigtrunc(y);
+    l = BIGNUM_LEN(y);
+    ey = l * BITSPERDIG - nlz(BDIGITS(y)[l-1]);
+    ey -= DBL_BIGDIG * BITSPERDIG;
+    if (ey) y = big_shift(y, ey);
+    return big_fdiv(x, y, ey);
+}
+
+static VALUE
+big_fdiv_float(VALUE x, VALUE y)
+{
+    int i;
+    y = dbl2big(ldexp(frexp(RFLOAT_VALUE(y), &i), DBL_MANT_DIG));
+    return big_fdiv(x, y, i - DBL_MANT_DIG);
 }
 
+/*
+ *  call-seq:
+  *     big.fdiv(numeric) -> float
+ *
+ *  Returns the floating point result of dividing <i>big</i> by
+ *  <i>numeric</i>.
+ *
+ *     -1234567890987654321.fdiv(13731)      #=> -89910996357705.5
+ *     -1234567890987654321.fdiv(13731.24)   #=> -89909424858035.7
+ *
+ */
+
+
 VALUE
-Fbig_or(x, y)
-    struct RBignum *x, *y;
+rb_big_fdiv(VALUE x, VALUE y)
 {
-    VALUE z;
-    USHORT *ds1, *ds2, *zds;
-    UINT i, l1, l2;
-    char sign;
+    double dx, dy;
 
+    dx = big2dbl(x);
     if (FIXNUM_P(y)) {
-	y = (struct RBignum*)int2big(FIX2INT(y));
+	dy = (double)FIX2LONG(y);
+	if (isinf(dx))
+	    return big_fdiv_int(x, rb_int2big(FIX2LONG(y)));
+    }
+    else if (RB_BIGNUM_TYPE_P(y)) {
+	dy = rb_big2dbl(y);
+	if (isinf(dx) || isinf(dy))
+	    return big_fdiv_int(x, y);
+    }
+    else if (RB_FLOAT_TYPE_P(y)) {
+	dy = RFLOAT_VALUE(y);
+	if (isnan(dy))
+	    return y;
+	if (isinf(dx))
+	    return big_fdiv_float(x, y);
     }
     else {
-	Check_Type(y, T_BIGNUM);
+	return rb_num_coerce_bin(x, y, rb_intern("fdiv"));
     }
+    return DBL2NUM(dx / dy);
+}
+
+/*
+ *  call-seq:
+ *     big ** exponent   -> numeric
+ *
+ *  Raises _big_ to the _exponent_ power (which may be an integer, float,
+ *  or anything that will coerce to a number). The result may be
+ *  a Fixnum, Bignum, or Float
+ *
+ *    123456789 ** 2      #=> 15241578750190521
+ *    123456789 ** 1.2    #=> 5126464716.09932
+ *    123456789 ** -2     #=> (1/15241578750190521)
+ */
 
-    if (!y->sign) {
-	y = (struct RBignum*)big_clone(y);
-	big_2comp(y);
+VALUE
+rb_big_pow(VALUE x, VALUE y)
+{
+    double d;
+    SIGNED_VALUE yy;
+
+  again:
+    if (y == INT2FIX(0)) return INT2FIX(1);
+    if (RB_FLOAT_TYPE_P(y)) {
+	d = RFLOAT_VALUE(y);
+	if ((!BIGNUM_SIGN(x) && !BIGZEROP(x)) && d != round(d))
+	    return rb_funcall(rb_complex_raw1(x), rb_intern("**"), 1, y);
     }
-    if (!x->sign) {
-	x = (struct RBignum*)big_clone(x);
-	big_2comp(x);
+    else if (RB_BIGNUM_TYPE_P(y)) {
+	y = bignorm(y);
+	if (FIXNUM_P(y))
+	    goto again;
+	rb_warn("in a**b, b may be too big");
+	d = rb_big2dbl(y);
     }
-    if (x->len > y->len) {
-	l1 = y->len;
-	l2 = x->len;
-	ds1 = BDIGITS(y);
-	ds2 = BDIGITS(x);
-	sign = y->sign;
+    else if (FIXNUM_P(y)) {
+	yy = FIX2LONG(y);
+
+	if (yy < 0)
+	    return rb_funcall(rb_rational_raw1(x), rb_intern("**"), 1, y);
+	else {
+	    VALUE z = 0;
+	    SIGNED_VALUE mask;
+            const size_t xbits = rb_absint_numwords(x, 1, NULL);
+	    const size_t BIGLEN_LIMIT = 32*1024*1024;
+
+	    if (xbits == (size_t)-1 ||
+                (xbits > BIGLEN_LIMIT) ||
+                (xbits * yy > BIGLEN_LIMIT)) {
+		rb_warn("in a**b, b may be too big");
+		d = (double)yy;
+	    }
+	    else {
+		for (mask = FIXNUM_MAX + 1; mask; mask >>= 1) {
+		    if (z) z = bigsq(z);
+		    if (yy & mask) {
+			z = z ? bigtrunc(bigmul0(z, x)) : x;
+		    }
+		}
+		return bignorm(z);
+	    }
+	}
     }
     else {
-	l1 = x->len;
-	l2 = y->len;
-	ds1 = BDIGITS(x);
-	ds2 = BDIGITS(y);
-	sign = x->sign;
+	return rb_num_coerce_bin(x, y, rb_intern("**"));
     }
-    z = bignew(l2, x->sign || y->sign);
+    return DBL2NUM(pow(rb_big2dbl(x), d));
+}
+
+static VALUE
+bigand_int(VALUE x, long xn, BDIGIT hibitsx, long y)
+{
+    VALUE z;
+    BDIGIT *xds, *zds;
+    long zn;
+    long i;
+    BDIGIT hibitsy;
+
+    if (y == 0) return INT2FIX(0);
+    if (xn == 0) return hibitsx ? LONG2NUM(y) : 0;
+    hibitsy = 0 <= y ? 0 : BDIGMAX;
+    xds = BDIGITS(x);
+#if SIZEOF_BDIGIT >= SIZEOF_LONG
+    if (!hibitsy) {
+	y &= xds[0];
+	return LONG2NUM(y);
+    }
+#endif
+
+    zn = xn;
+#if SIZEOF_BDIGIT < SIZEOF_LONG
+    if (hibitsx && zn < bdigit_roomof(SIZEOF_LONG))
+        zn = bdigit_roomof(SIZEOF_LONG);
+#endif
+
+    z = bignew(zn, 0);
     zds = BDIGITS(z);
 
-    for (i=0; i<l1; i++) {
-	zds[i] = ds1[i] | ds2[i];
+#if SIZEOF_BDIGIT >= SIZEOF_LONG
+    i = 1;
+    zds[0] = xds[0] & BIGLO(y);
+#else
+    for (i=0; i < xn; i++) {
+        if (y == 0 || y == -1) break;
+        zds[i] = xds[i] & BIGLO(y);
+        y = BIGDN(y);
     }
-    for (; i<l2; i++) {
-	zds[i] = sign?ds2[i]:(BIGRAD-1);
+    for (; i < zn; i++) {
+        if (y == 0 || y == -1) break;
+        zds[i] = hibitsx & BIGLO(y);
+        y = BIGDN(y);
     }
-    if (!RBIGNUM(z)->sign) big_2comp(z);
-
+#endif
+    for (;i < xn; i++) {
+	zds[i] = xds[i] & hibitsy;
+    }
+    for (;i < zn; i++) {
+	zds[i] = hibitsx & hibitsy;
+    }
+    twocomp2abs_bang(z, hibitsx && hibitsy);
+    RB_GC_GUARD(x);
     return bignorm(z);
 }
 
+/*
+ * call-seq:
+ *     big & numeric   ->  integer
+ *
+ * Performs bitwise +and+ between _big_ and _numeric_.
+ */
+
 VALUE
-Fbig_xor(x, y)
-    struct RBignum *x, *y;
+rb_big_and(VALUE x, VALUE y)
 {
     VALUE z;
-    USHORT *ds1, *ds2, *zds;
-    UINT i, l1, l2;
-    char sign;
+    BDIGIT *ds1, *ds2, *zds;
+    long i, xn, yn, n1, n2;
+    BDIGIT hibitsx, hibitsy;
+    BDIGIT hibits1, hibits2;
+    VALUE tmpv;
+    BDIGIT tmph;
+    long tmpn;
+
+    if (!FIXNUM_P(y) && !RB_BIGNUM_TYPE_P(y)) {
+	return rb_num_coerce_bit(x, y, '&');
+    }
 
+    hibitsx = abs2twocomp(&x, &xn);
     if (FIXNUM_P(y)) {
-	y = (struct RBignum*)int2big(FIX2INT(y));
+	return bigand_int(x, xn, hibitsx, FIX2LONG(y));
     }
-    else {
-	Check_Type(y, T_BIGNUM);
+    hibitsy = abs2twocomp(&y, &yn);
+    if (xn > yn) {
+        tmpv = x; x = y; y = tmpv;
+        tmpn = xn; xn = yn; yn = tmpn;
+        tmph = hibitsx; hibitsx = hibitsy; hibitsy = tmph;
     }
+    n1 = xn;
+    n2 = yn;
+    ds1 = BDIGITS(x);
+    ds2 = BDIGITS(y);
+    hibits1 = hibitsx;
+    hibits2 = hibitsy;
+
+    if (!hibits1)
+        n2 = n1;
+
+    z = bignew(n2, 0);
+    zds = BDIGITS(z);
 
-    if (!y->sign) {
-	y = (struct RBignum*)big_clone(y);
-	big_2comp(y);
+    for (i=0; i<n1; i++) {
+	zds[i] = ds1[i] & ds2[i];
     }
-    if (!x->sign) {
-	x = (struct RBignum*)big_clone(x);
-	big_2comp(x);
+    for (; i<n2; i++) {
+	zds[i] = hibits1 & ds2[i];
     }
-    if (x->len > y->len) {
-	l1 = y->len;
-	l2 = x->len;
-	ds1 = BDIGITS(y);
-	ds2 = BDIGITS(x);
-	sign = y->sign;
+    twocomp2abs_bang(z, hibits1 && hibits2);
+    RB_GC_GUARD(x);
+    RB_GC_GUARD(y);
+    return bignorm(z);
+}
+
+static VALUE
+bigor_int(VALUE x, long xn, BDIGIT hibitsx, long y)
+{
+    VALUE z;
+    BDIGIT *xds, *zds;
+    long zn;
+    long i;
+    BDIGIT hibitsy;
+
+    if (y == -1) return INT2FIX(-1);
+    if (xn == 0) return hibitsx ? INT2FIX(-1) : LONG2FIX(y);
+    hibitsy = 0 <= y ? 0 : BDIGMAX;
+    xds = BDIGITS(x);
+
+    zn = BIGNUM_LEN(x);
+#if SIZEOF_BDIGIT < SIZEOF_LONG
+    if (zn < bdigit_roomof(SIZEOF_LONG))
+        zn = bdigit_roomof(SIZEOF_LONG);
+#endif
+    z = bignew(zn, 0);
+    zds = BDIGITS(z);
+
+#if SIZEOF_BDIGIT >= SIZEOF_LONG
+    i = 1;
+    zds[0] = xds[0] | BIGLO(y);
+    if (i < zn)
+        goto y_is_fixed_point;
+    goto finish;
+#else
+    for (i=0; i < xn; i++) {
+        if (y == 0 || y == -1) goto y_is_fixed_point;
+        zds[i] = xds[i] | BIGLO(y);
+        y = BIGDN(y);
     }
-    else {
-	l1 = x->len;
-	l2 = y->len;
-	ds1 = BDIGITS(x);
-	ds2 = BDIGITS(y);
-	sign = x->sign;
+    if (hibitsx)
+        goto fill_hibits;
+    for (; i < zn; i++) {
+        if (y == 0 || y == -1) goto y_is_fixed_point;
+        zds[i] = BIGLO(y);
+        y = BIGDN(y);
     }
-    x->sign = x->sign?1:0;
-    y->sign = y->sign?1:0;
-    z = bignew(l2, !(x->sign ^ y->sign));
-    zds = BDIGITS(z);
+  goto finish;
+#endif
 
-    for (i=0; i<l1; i++) {
-	zds[i] = ds1[i] ^ ds2[i];
+  y_is_fixed_point:
+    if (hibitsy)
+        goto fill_hibits;
+    for (; i < xn; i++) {
+        zds[i] = xds[i];
+    }
+    if (hibitsx)
+        goto fill_hibits;
+    for (; i < zn; i++) {
+        zds[i] = 0;
     }
-    for (; i<l2; i++) {
-	zds[i] = sign?ds2[i]:~ds2[i];
+  goto finish;
+
+  fill_hibits:
+    for (; i < zn; i++) {
+        zds[i] = BDIGMAX;
     }
-    if (!RBIGNUM(z)->sign) big_2comp(z);
 
+  finish:
+    twocomp2abs_bang(z, hibitsx || hibitsy);
+    RB_GC_GUARD(x);
     return bignorm(z);
 }
 
-static VALUE
-Fbig_neg(x)
-    struct RBignum *x;
+/*
+ * call-seq:
+ *     big | numeric   ->  integer
+ *
+ * Performs bitwise +or+ between _big_ and _numeric_.
+ */
+
+VALUE
+rb_big_or(VALUE x, VALUE y)
 {
-    VALUE z = big_clone(x);
-    UINT i = x->len;
-    USHORT *ds = BDIGITS(z);
+    VALUE z;
+    BDIGIT *ds1, *ds2, *zds;
+    long i, xn, yn, n1, n2;
+    BDIGIT hibitsx, hibitsy;
+    BDIGIT hibits1, hibits2;
+    VALUE tmpv;
+    BDIGIT tmph;
+    long tmpn;
 
-    if (!x->sign) big_2comp(z);
-    while (i--) ds[i] = ~ds[i];
-    if (x->sign) big_2comp(z);
-    RBIGNUM(z)->sign = !RBIGNUM(z)->sign;
+    if (!FIXNUM_P(y) && !RB_BIGNUM_TYPE_P(y)) {
+	return rb_num_coerce_bit(x, y, '|');
+    }
+
+    hibitsx = abs2twocomp(&x, &xn);
+    if (FIXNUM_P(y)) {
+	return bigor_int(x, xn, hibitsx, FIX2LONG(y));
+    }
+    hibitsy = abs2twocomp(&y, &yn);
+    if (xn > yn) {
+        tmpv = x; x = y; y = tmpv;
+        tmpn = xn; xn = yn; yn = tmpn;
+        tmph = hibitsx; hibitsx = hibitsy; hibitsy = tmph;
+    }
+    n1 = xn;
+    n2 = yn;
+    ds1 = BDIGITS(x);
+    ds2 = BDIGITS(y);
+    hibits1 = hibitsx;
+    hibits2 = hibitsy;
+
+    if (hibits1)
+        n2 = n1;
+
+    z = bignew(n2, 0);
+    zds = BDIGITS(z);
 
+    for (i=0; i<n1; i++) {
+	zds[i] = ds1[i] | ds2[i];
+    }
+    for (; i<n2; i++) {
+	zds[i] = hibits1 | ds2[i];
+    }
+    twocomp2abs_bang(z, hibits1 || hibits2);
+    RB_GC_GUARD(x);
+    RB_GC_GUARD(y);
     return bignorm(z);
 }
 
-static VALUE Fbig_rshift();
-
-VALUE
-Fbig_lshift(x, y)
-    struct RBignum *x;
-    VALUE y;
-{
-    USHORT *xds, *zds;
-    UINT shift = NUM2INT(y);
-    UINT s1 = shift/(sizeof(USHORT)*CHAR_BIT);
-    UINT s2 = shift%(sizeof(USHORT)*CHAR_BIT);
+static VALUE
+bigxor_int(VALUE x, long xn, BDIGIT hibitsx, long y)
+{
     VALUE z;
-    unsigned long num = 0;
-    UINT len, i;
+    BDIGIT *xds, *zds;
+    long zn;
+    long i;
+    BDIGIT hibitsy;
 
-    if (shift < 0) return Fbig_rshift(x, INT2FIX(-shift));
+    hibitsy = 0 <= y ? 0 : BDIGMAX;
     xds = BDIGITS(x);
-    len = x->len;
-    z = bignew(len+s1+1, x->sign);
+    zn = BIGNUM_LEN(x);
+#if SIZEOF_BDIGIT < SIZEOF_LONG
+    if (zn < bdigit_roomof(SIZEOF_LONG))
+        zn = bdigit_roomof(SIZEOF_LONG);
+#endif
+    z = bignew(zn, 0);
     zds = BDIGITS(z);
-    for (i=0; i<s1; i++) {
-	*zds++ = 0;
+
+#if SIZEOF_BDIGIT >= SIZEOF_LONG
+    i = 1;
+    zds[0] = xds[0] ^ BIGLO(y);
+#else
+    for (i = 0; i < xn; i++) {
+        zds[i] = xds[i] ^ BIGLO(y);
+        y = BIGDN(y);
     }
-    for (i=0; i<len; i++) {
-	num = num | *xds++<<s2;
-	*zds++ = BIGLO(num);
-	num = BIGDN(num);
+    for (; i < zn; i++) {
+        zds[i] = hibitsx ^ BIGLO(y);
+        y = BIGDN(y);
+    }
+#endif
+    for (; i < xn; i++) {
+        zds[i] = xds[i] ^ hibitsy;
     }
-    *zds = BIGLO(num);
+    for (; i < zn; i++) {
+        zds[i] = hibitsx ^ hibitsy;
+    }
+    twocomp2abs_bang(z, (hibitsx ^ hibitsy) != 0);
+    RB_GC_GUARD(x);
     return bignorm(z);
 }
+/*
+ * call-seq:
+ *     big ^ numeric   ->  integer
+ *
+ * Performs bitwise +exclusive or+ between _big_ and _numeric_.
+ */
 
-static VALUE
-Fbig_rshift(x, y)
-    struct RBignum *x;
-    VALUE y;
-{
-    USHORT *xds, *zds;
-    UINT shift = NUM2INT(y);
-    UINT s1 = shift/(sizeof(USHORT)*CHAR_BIT);
-    UINT s2 = shift%(sizeof(USHORT)*CHAR_BIT);
+VALUE
+rb_big_xor(VALUE x, VALUE y)
+{
     VALUE z;
-    unsigned long num = 0;
-    UINT i = x->len, j;
+    BDIGIT *ds1, *ds2, *zds;
+    long i, xn, yn, n1, n2;
+    BDIGIT hibitsx, hibitsy;
+    BDIGIT hibits1, hibits2;
+    VALUE tmpv;
+    BDIGIT tmph;
+    long tmpn;
 
-    if (shift < 0) return Fbig_lshift(x, INT2FIX(-shift));
-    if (s1 > x->len) {
-	if (x->sign)
-	    return INT2FIX(0);
-	else
-	    return INT2FIX(-1);
+    if (!FIXNUM_P(y) && !RB_BIGNUM_TYPE_P(y)) {
+	return rb_num_coerce_bit(x, y, '^');
     }
-    xds = BDIGITS(x);
-    i = x->len; j = i - s1;
-    z = bignew(j, x->sign);
+
+    hibitsx = abs2twocomp(&x, &xn);
+    if (FIXNUM_P(y)) {
+	return bigxor_int(x, xn, hibitsx, FIX2LONG(y));
+    }
+    hibitsy = abs2twocomp(&y, &yn);
+    if (xn > yn) {
+        tmpv = x; x = y; y = tmpv;
+        tmpn = xn; xn = yn; yn = tmpn;
+        tmph = hibitsx; hibitsx = hibitsy; hibitsy = tmph;
+    }
+    n1 = xn;
+    n2 = yn;
+    ds1 = BDIGITS(x);
+    ds2 = BDIGITS(y);
+    hibits1 = hibitsx;
+    hibits2 = hibitsy;
+
+    z = bignew(n2, 0);
     zds = BDIGITS(z);
-    while (i--, j--) {
-	num = (num | xds[i]) >> s2;
-	zds[j] = BIGLO(num);
-	num = BIGUP(xds[i]);
+
+    for (i=0; i<n1; i++) {
+	zds[i] = ds1[i] ^ ds2[i];
     }
+    for (; i<n2; i++) {
+	zds[i] = hibitsx ^ ds2[i];
+    }
+    twocomp2abs_bang(z, (hibits1 ^ hibits2) != 0);
+    RB_GC_GUARD(x);
+    RB_GC_GUARD(y);
     return bignorm(z);
 }
 
-static VALUE
-Fbig_aref(x, y)
-    struct RBignum *x;
-    VALUE y;
+/*
+ * call-seq:
+ *     big << numeric   ->  integer
+ *
+ * Shifts big left _numeric_ positions (right if _numeric_ is negative).
+ */
+
+VALUE
+rb_big_lshift(VALUE x, VALUE y)
+{
+    int lshift_p;
+    size_t shift_numdigits;
+    int shift_numbits;
+
+    for (;;) {
+	if (FIXNUM_P(y)) {
+	    long l = FIX2LONG(y);
+            unsigned long shift;
+	    if (0 <= l) {
+		lshift_p = 1;
+                shift = l;
+            }
+            else {
+		lshift_p = 0;
+		shift = 1+(unsigned long)(-(l+1));
+	    }
+            shift_numbits = (int)(shift & (BITSPERDIG-1));
+            shift_numdigits = shift >> bit_length(BITSPERDIG-1);
+            return bignorm(big_shift3(x, lshift_p, shift_numdigits, shift_numbits));
+	}
+	else if (RB_BIGNUM_TYPE_P(y)) {
+            return bignorm(big_shift2(x, 1, y));
+	}
+	y = rb_to_int(y);
+    }
+}
+
+
+/*
+ * call-seq:
+ *     big >> numeric   ->  integer
+ *
+ * Shifts big right _numeric_ positions (left if _numeric_ is negative).
+ */
+
+VALUE
+rb_big_rshift(VALUE x, VALUE y)
 {
-    USHORT *xds;
-    int shift = NUM2INT(y);
-    UINT s1, s2;
+    int lshift_p;
+    size_t shift_numdigits;
+    int shift_numbits;
+
+    for (;;) {
+	if (FIXNUM_P(y)) {
+	    long l = FIX2LONG(y);
+            unsigned long shift;
+            if (0 <= l) {
+                lshift_p = 0;
+                shift = l;
+            }
+            else {
+                lshift_p = 1;
+		shift = 1+(unsigned long)(-(l+1));
+	    }
+            shift_numbits = (int)(shift & (BITSPERDIG-1));
+            shift_numdigits = shift >> bit_length(BITSPERDIG-1);
+            return bignorm(big_shift3(x, lshift_p, shift_numdigits, shift_numbits));
+	}
+	else if (RB_BIGNUM_TYPE_P(y)) {
+            return bignorm(big_shift2(x, 0, y));
+	}
+	y = rb_to_int(y);
+    }
+}
 
-    if (shift < 0) return INT2FIX(0);
-    s1 = shift/(sizeof(USHORT)*CHAR_BIT);
-    s2 = shift%(sizeof(USHORT)*CHAR_BIT);
+/*
+ *  call-seq:
+ *     big[n] -> 0, 1
+ *
+ *  Bit Reference---Returns the <em>n</em>th bit in the (assumed) binary
+ *  representation of <i>big</i>, where <i>big</i>[0] is the least
+ *  significant bit.
+ *
+ *     a = 9**15
+ *     50.downto(0) do |n|
+ *       print a[n]
+ *     end
+ *
+ *  <em>produces:</em>
+ *
+ *     000101110110100000111000011110010100111100010111001
+ *
+ */
 
-    if (!x->sign) {
-	if (s1 >= x->len) return INT2FIX(1);
-	x = (struct RBignum*)big_clone(x);
-	big_2comp(x);
+static VALUE
+rb_big_aref(VALUE x, VALUE y)
+{
+    BDIGIT *xds;
+    size_t shift;
+    size_t i, s1, s2;
+    long l;
+    BDIGIT bit;
+
+    if (RB_BIGNUM_TYPE_P(y)) {
+	if (!BIGNUM_SIGN(y))
+	    return INT2FIX(0);
+	bigtrunc(y);
+	if (BIGSIZE(y) > sizeof(size_t)) {
+	  out_of_range:
+	    return BIGNUM_SIGN(x) ? INT2FIX(0) : INT2FIX(1);
+	}
+#if SIZEOF_SIZE_T <= SIZEOF_LONG
+	shift = big2ulong(y, "long");
+#else
+	shift = big2ull(y, "long long");
+#endif
     }
     else {
-	if (s1 >= x->len) return INT2FIX(0);
+	l = NUM2LONG(y);
+	if (l < 0) return INT2FIX(0);
+	shift = (size_t)l;
     }
+    s1 = shift/BITSPERDIG;
+    s2 = shift%BITSPERDIG;
+    bit = (BDIGIT)1 << s2;
+
+    if (s1 >= BIGNUM_LEN(x)) goto out_of_range;
+
     xds = BDIGITS(x);
-    if (xds[s1] & (1<<s2))
-	return INT2FIX(1);
-    return INT2FIX(0);
+    if (BIGNUM_POSITIVE_P(x))
+        return (xds[s1] & bit) ? INT2FIX(1) : INT2FIX(0);
+    if (xds[s1] & (bit-1))
+        return (xds[s1] & bit) ? INT2FIX(0) : INT2FIX(1);
+    for (i = 0; i < s1; i++)
+        if (xds[i])
+            return (xds[s1] & bit) ? INT2FIX(0) : INT2FIX(1);
+    return (xds[s1] & bit) ? INT2FIX(1) : INT2FIX(0);
 }
 
+/*
+ * call-seq:
+ *   big.hash   -> fixnum
+ *
+ * Compute a hash based on the value of _big_.
+ *
+ * See also Object#hash.
+ */
+
+VALUE
+rb_big_hash(VALUE x)
+{
+    st_index_t hash;
+
+    hash = rb_memhash(BDIGITS(x), sizeof(BDIGIT)*BIGNUM_LEN(x)) ^ BIGNUM_SIGN(x);
+    return INT2FIX(hash);
+}
+
+/*
+ * call-seq:
+ *   big.coerce(numeric)  ->  array
+ *
+ * Returns an array with both a +numeric+ and a +big+ represented as Bignum
+ * objects.
+ *
+ * This is achieved by converting +numeric+ to a Bignum.
+ *
+ * A TypeError is raised if the +numeric+ is not a Fixnum or Bignum type.
+ *
+ *     (0x3FFFFFFFFFFFFFFF+1).coerce(42)   #=> [42, 4611686018427387904]
+ */
+
 static VALUE
-Fbig_cmp(x, y)
-    struct RBignum *x, *y;
+rb_big_coerce(VALUE x, VALUE y)
 {
-    int xlen = x->len;
+    if (FIXNUM_P(y)) {
+	y = rb_int2big(FIX2LONG(y));
+    }
+    else if (!RB_BIGNUM_TYPE_P(y)) {
+	rb_raise(rb_eTypeError, "can't coerce %"PRIsVALUE" to Bignum",
+		 rb_obj_class(y));
+    }
+    return rb_assoc_new(y, x);
+}
 
-    Check_Type(x, T_BIGNUM);
-    if (x->sign > y->sign) return INT2FIX(1);
-    if (x->sign < y->sign) return INT2FIX(-1);
-    if (xlen < y->len)
-	return (x->sign) ? INT2FIX(-1) : INT2FIX(1);
-    if (xlen > y->len)
-	return (x->sign) ? INT2FIX(1) : INT2FIX(-1);
+/*
+ *  call-seq:
+ *     big.abs -> aBignum
+ *     big.magnitude -> aBignum
+ *
+ *  Returns the absolute value of <i>big</i>.
+ *
+ *     -1234567890987654321.abs   #=> 1234567890987654321
+ */
 
-    while(xlen-- && (BDIGITS(x)[xlen]==BDIGITS(y)[xlen]));
-    if (-1 == xlen) return INT2FIX(0);
-    return (BDIGITS(x)[xlen] < BDIGITS(y)[xlen]) ?
-	(x->sign ? INT2FIX(1) : INT2FIX(-1)) :
-	    (x->sign ? INT2FIX(-1) : INT2FIX(1));
+static VALUE
+rb_big_abs(VALUE x)
+{
+    if (!BIGNUM_SIGN(x)) {
+	x = rb_big_clone(x);
+	BIGNUM_SET_SIGN(x, 1);
+    }
+    return x;
 }
 
+/*
+ *  call-seq:
+ *     big.size -> integer
+ *
+ *  Returns the number of bytes in the machine representation of
+ *  <i>big</i>.
+ *
+ *     (256**10 - 1).size   #=> 12
+ *     (256**20 - 1).size   #=> 20
+ *     (256**40 - 1).size   #=> 40
+ */
+
 static VALUE
-Fbig_hash(x)
-    struct RBignum *x;
+rb_big_size(VALUE big)
 {
-    int i, len, key;
-    USHORT *digits;
+    return SIZET2NUM(BIGSIZE(big));
+}
+
+/*
+ *  call-seq:
+ *     int.bit_length -> integer
+ *
+ *  Returns the number of bits of the value of <i>int</i>.
+ *
+ *  "the number of bits" means that
+ *  the bit position of the highest bit which is different to the sign bit.
+ *  (The bit position of the bit 2**n is n+1.)
+ *  If there is no such bit (zero or minus one), zero is returned.
+ *
+ *  I.e. This method returns ceil(log2(int < 0 ? -int : int+1)).
+ *
+ *     (-2**10000-1).bit_length  #=> 10001
+ *     (-2**10000).bit_length    #=> 10000
+ *     (-2**10000+1).bit_length  #=> 10000
+ *
+ *     (-2**1000-1).bit_length   #=> 1001
+ *     (-2**1000).bit_length     #=> 1000
+ *     (-2**1000+1).bit_length   #=> 1000
+ *
+ *     (2**1000-1).bit_length    #=> 1000
+ *     (2**1000).bit_length      #=> 1001
+ *     (2**1000+1).bit_length    #=> 1001
+ *
+ *     (2**10000-1).bit_length   #=> 10000
+ *     (2**10000).bit_length     #=> 10001
+ *     (2**10000+1).bit_length   #=> 10001
+ *
+ *  This method can be used to detect overflow in Array#pack as follows.
+ *
+ *     if n.bit_length < 32
+ *       [n].pack("l") # no overflow
+ *     else
+ *       raise "overflow"
+ *     end
+ */
 
-    key = 0; digits = BDIGITS(x);
-    for (i=0,len=x->len; i<x->len; i++) {
-	key ^= *digits++;
+static VALUE
+rb_big_bit_length(VALUE big)
+{
+    int nlz_bits;
+    size_t numbytes;
+
+    static const BDIGIT char_bit[1] = { CHAR_BIT };
+    BDIGIT numbytes_bary[bdigit_roomof(sizeof(size_t))];
+    BDIGIT nlz_bary[1];
+    BDIGIT result_bary[bdigit_roomof(sizeof(size_t)+1)];
+
+    numbytes = rb_absint_size(big, &nlz_bits);
+
+    if (numbytes == 0)
+        return LONG2FIX(0);
+
+    if (BIGNUM_NEGATIVE_P(big) && rb_absint_singlebit_p(big)) {
+        if (nlz_bits != CHAR_BIT-1) {
+            nlz_bits++;
+        }
+        else {
+            nlz_bits = 0;
+            numbytes--;
+        }
+    }
+
+    if (numbytes <= SIZE_MAX / CHAR_BIT) {
+        return SIZET2NUM(numbytes * CHAR_BIT - nlz_bits);
     }
-    return INT2FIX(key);
+
+    nlz_bary[0] = nlz_bits;
+
+    bary_unpack(BARY_ARGS(numbytes_bary), &numbytes, 1, sizeof(numbytes), 0,
+            INTEGER_PACK_NATIVE_BYTE_ORDER);
+    BARY_SHORT_MUL(result_bary, numbytes_bary, char_bit);
+    BARY_SUB(result_bary, result_bary, nlz_bary);
+
+    return rb_integer_unpack(result_bary, numberof(result_bary), sizeof(BDIGIT), 0,
+            INTEGER_PACK_LSWORD_FIRST|INTEGER_PACK_NATIVE_BYTE_ORDER);
 }
 
+/*
+ *  call-seq:
+ *     big.odd? -> true or false
+ *
+ *  Returns <code>true</code> if <i>big</i> is an odd number.
+ */
+
 static VALUE
-Fbig_coerce(x, y)
-    struct RBignum *x;
-    VALUE y;
+rb_big_odd_p(VALUE num)
 {
-    if (FIXNUM_P(y)) {
-	return int2big(FIX2INT(y));
-    }
-    else {
-	Fail("can't coerce %s to Bignum", rb_class2name(CLASS_OF(y)));
+    if (BIGNUM_LEN(num) != 0 && BDIGITS(num)[0] & 1) {
+	return Qtrue;
     }
-    /* not reached */
-    return Qnil;
+    return Qfalse;
 }
 
+/*
+ *  call-seq:
+ *     big.even? -> true or false
+ *
+ *  Returns <code>true</code> if <i>big</i> is an even number.
+ */
+
 static VALUE
-Fbig_abs(x)
-    struct RBignum *x;
-{
-    if (!x->sign) {
-	x = (struct RBignum*)big_clone(x);
-	x->sign = 1;
-    }
-    return (VALUE)x;
-}
-
-Init_Bignum()
-{
-    C_Bignum = rb_define_class("Bignum", C_Integer);
-    rb_define_single_method(C_Bignum, "new", Sbig_new, 1);
-
-    rb_define_method(C_Bignum, "to_s", Fbig_to_s, 0);
-    rb_define_method(C_Bignum, "coerce", Fbig_coerce, 1);
-    rb_define_method(C_Bignum, "-@", Fbig_uminus, 0);
-    rb_define_method(C_Bignum, "+", Fbig_plus, 1);
-    rb_define_method(C_Bignum, "-", Fbig_minus, 1);
-    rb_define_method(C_Bignum, "*", Fbig_mul, 1);
-    rb_define_method(C_Bignum, "/", Fbig_div, 1);
-    rb_define_method(C_Bignum, "%", Fbig_mod, 1);
-    rb_define_method(C_Bignum, "divmod", Fbig_divmod, 1);
-    rb_define_method(C_Bignum, "**", Fbig_pow, 1);
-    rb_define_method(C_Bignum, "&", Fbig_and, 1);
-    rb_define_method(C_Bignum, "|", Fbig_or, 1);
-    rb_define_method(C_Bignum, "^", Fbig_xor, 1);
-    rb_define_method(C_Bignum, "~", Fbig_neg, 0);
-    rb_define_method(C_Bignum, "<<", Fbig_lshift, 1);
-    rb_define_method(C_Bignum, ">>", Fbig_rshift, 1);
-    rb_define_method(C_Bignum, "[]", Fbig_aref, 1);
-
-    rb_define_method(C_Bignum, "<=>", Fbig_cmp, 1);
-    rb_define_method(C_Bignum, "hash", Fbig_hash, 0);
-    rb_define_method(C_Bignum, "to_i", Fbig_to_i, 0);
-    rb_define_method(C_Bignum, "to_f", Fbig_to_f, 0);
-    rb_define_method(C_Bignum, "abs_f", Fbig_abs, 0);
+rb_big_even_p(VALUE num)
+{
+    if (BIGNUM_LEN(num) != 0 && BDIGITS(num)[0] & 1) {
+	return Qfalse;
+    }
+    return Qtrue;
+}
+
+/*
+ *  Bignum objects hold integers outside the range of
+ *  Fixnum. Bignum objects are created
+ *  automatically when integer calculations would otherwise overflow a
+ *  Fixnum. When a calculation involving
+ *  Bignum objects returns a result that will fit in a
+ *  Fixnum, the result is automatically converted.
+ *
+ *  For the purposes of the bitwise operations and <code>[]</code>, a
+ *  Bignum is treated as if it were an infinite-length
+ *  bitstring with 2's complement representation.
+ *
+ *  While Fixnum values are immediate, Bignum
+ *  objects are not---assignment and parameter passing work with
+ *  references to objects, not the objects themselves.
+ *
+ */
+
+void
+Init_Bignum(void)
+{
+    rb_cBignum = rb_define_class("Bignum", rb_cInteger);
+
+    rb_define_method(rb_cBignum, "to_s", rb_big_to_s, -1);
+    rb_define_alias(rb_cBignum, "inspect", "to_s");
+    rb_define_method(rb_cBignum, "coerce", rb_big_coerce, 1);
+    rb_define_method(rb_cBignum, "-@", rb_big_uminus, 0);
+    rb_define_method(rb_cBignum, "+", rb_big_plus, 1);
+    rb_define_method(rb_cBignum, "-", rb_big_minus, 1);
+    rb_define_method(rb_cBignum, "*", rb_big_mul, 1);
+    rb_define_method(rb_cBignum, "/", rb_big_div, 1);
+    rb_define_method(rb_cBignum, "%", rb_big_modulo, 1);
+    rb_define_method(rb_cBignum, "div", rb_big_idiv, 1);
+    rb_define_method(rb_cBignum, "divmod", rb_big_divmod, 1);
+    rb_define_method(rb_cBignum, "modulo", rb_big_modulo, 1);
+    rb_define_method(rb_cBignum, "remainder", rb_big_remainder, 1);
+    rb_define_method(rb_cBignum, "fdiv", rb_big_fdiv, 1);
+    rb_define_method(rb_cBignum, "**", rb_big_pow, 1);
+    rb_define_method(rb_cBignum, "&", rb_big_and, 1);
+    rb_define_method(rb_cBignum, "|", rb_big_or, 1);
+    rb_define_method(rb_cBignum, "^", rb_big_xor, 1);
+    rb_define_method(rb_cBignum, "~", rb_big_neg, 0);
+    rb_define_method(rb_cBignum, "<<", rb_big_lshift, 1);
+    rb_define_method(rb_cBignum, ">>", rb_big_rshift, 1);
+    rb_define_method(rb_cBignum, "[]", rb_big_aref, 1);
+
+    rb_define_method(rb_cBignum, "<=>", rb_big_cmp, 1);
+    rb_define_method(rb_cBignum, "==", rb_big_eq, 1);
+    rb_define_method(rb_cBignum, ">", big_gt, 1);
+    rb_define_method(rb_cBignum, ">=", big_ge, 1);
+    rb_define_method(rb_cBignum, "<", big_lt, 1);
+    rb_define_method(rb_cBignum, "<=", big_le, 1);
+    rb_define_method(rb_cBignum, "===", rb_big_eq, 1);
+    rb_define_method(rb_cBignum, "eql?", rb_big_eql, 1);
+    rb_define_method(rb_cBignum, "hash", rb_big_hash, 0);
+    rb_define_method(rb_cBignum, "to_f", rb_big_to_f, 0);
+    rb_define_method(rb_cBignum, "abs", rb_big_abs, 0);
+    rb_define_method(rb_cBignum, "magnitude", rb_big_abs, 0);
+    rb_define_method(rb_cBignum, "size", rb_big_size, 0);
+    rb_define_method(rb_cBignum, "bit_length", rb_big_bit_length, 0);
+    rb_define_method(rb_cBignum, "odd?", rb_big_odd_p, 0);
+    rb_define_method(rb_cBignum, "even?", rb_big_even_p, 0);
+
+#ifdef USE_GMP
+    /* The version of loaded GMP. */
+    rb_define_const(rb_cBignum, "GMP_VERSION", rb_sprintf("GMP %s", gmp_version));
+#endif
+
+    power_cache_init();
 }
diff --git a/bin/erb b/bin/erb
new file mode 100755
index 0000000000..6a88c3b26a
--- /dev/null
+++ b/bin/erb
@@ -0,0 +1,171 @@
+#!/usr/bin/env ruby
+# Tiny eRuby --- ERB2
+# Copyright (c) 1999-2000,2002 Masatoshi SEKI
+# You can redistribute it and/or modify it under the same terms as Ruby.
+
+require 'erb'
+
+class ERB
+  module Main
+    def ARGV.switch
+      return nil if self.empty?
+      arg = self.shift
+      return nil if arg == '--'
+      case arg
+      when /\A-(.)(.*)/
+        if $1 == '-'
+          arg, @maybe_arg = arg.split(/=/, 2)
+          return arg
+        end
+        raise 'unknown switch "-"' if $2[0] == ?- and $1 != 'T'
+        if $2.size > 0
+          self.unshift "-#{$2}"
+          @maybe_arg = $2
+        else
+          @maybe_arg = nil
+        end
+        "-#{$1}"
+      when /\A(\w+)=/
+        arg
+      else
+        self.unshift arg
+        nil
+      end
+    end
+
+    def ARGV.req_arg
+      (@maybe_arg || self.shift || raise('missing argument')).tap {
+        @maybe_arg = nil
+      }
+    end
+
+    def trim_mode_opt(trim_mode, disable_percent)
+      return trim_mode if disable_percent
+      case trim_mode
+      when 0
+        return '%'
+      when 1
+        return '%>'
+      when 2
+        return '%<>'
+      when '-'
+        return '%-'
+      end
+    end
+    module_function :trim_mode_opt
+
+    def run(factory=ERB)
+      trim_mode = 0
+      disable_percent = false
+      variables = {}
+      begin
+        while switch = ARGV.switch
+          case switch
+          when '-x'                        # ruby source
+            output = true
+          when '-n'                        # line number
+            number = true
+          when '-v'                        # verbose
+            $VERBOSE = true
+          when '--version'                 # version
+            STDERR.puts factory.version
+            exit
+          when '-d', '--debug'             # debug
+            $DEBUG = true
+          when '-r'                        # require
+            require ARGV.req_arg
+          when '-S'                        # security level
+            arg = ARGV.req_arg
+            raise "invalid safe_level #{arg.dump}" unless arg =~ /\A[0-1]\z/
+            safe_level = arg.to_i
+          when '-T'                        # trim mode
+            arg = ARGV.req_arg
+            if arg == '-'
+              trim_mode = arg
+              next
+            end
+            raise "invalid trim mode #{arg.dump}" unless arg =~ /\A[0-2]\z/
+            trim_mode = arg.to_i
+          when '-E', '--encoding'
+            arg = ARGV.req_arg
+            set_encoding(*arg.split(/:/, 2))
+          when '-U'
+            set_encoding(Encoding::UTF_8, Encoding::UTF_8)
+          when '-P'
+            disable_percent = true
+          when '--help'
+            raise "print this help"
+          when /\A-/
+            raise "unknown switch #{switch.dump}"
+          else
+            var, val = *switch.split('=', 2)
+            (variables ||= {})[var] = val
+          end
+        end
+      rescue                               # usage
+        STDERR.puts $!.to_s
+        STDERR.puts File.basename($0) +
+          " [switches] [var=value...] [inputfile]"
+        STDERR.puts <<EOU
+  -x               print ruby script
+  -n               print ruby script with line number
+  -v               enable verbose mode
+  -d               set $DEBUG to true
+  -r library       load a library
+  -S safe_level    set $SAFE (0..1)
+  -E ex[:in]       set default external/internal encodings
+  -U               set default encoding to UTF-8.
+  -T trim_mode     specify trim_mode (0..2, -)
+  -P               ignore lines which start with "%"
+  var=value        set variable
+EOU
+        exit 1
+      end
+
+      $<.set_encoding(Encoding::ASCII_8BIT, nil)
+      src = $<.read
+      filename = $FILENAME
+      exit 2 unless src
+      trim = trim_mode_opt(trim_mode, disable_percent)
+      erb = factory.new(src.untaint, safe_level, trim)
+      erb.filename = filename
+      if output
+        if number
+          erb.src.each_line.with_index do |line, l|
+            puts "%3d %s"%[l+1, line]
+          end
+        else
+          puts erb.src
+        end
+      else
+        bind = TOPLEVEL_BINDING.taint
+        if variables
+          enc = erb.encoding
+          for var, val in variables do
+            val = val.encode(enc) if val
+            bind.local_variable_set(var, val)
+          end
+        end
+        erb.run(bind)
+      end
+    end
+    module_function :run
+
+    def set_encoding(extern, intern = nil)
+      verbose, $VERBOSE = $VERBOSE, nil
+      Encoding.default_external = extern unless extern.nil? || extern == ""
+      Encoding.default_internal = intern unless intern.nil? || intern == ""
+      [$stdin, $stdout, $stderr].each do |io|
+        io.set_encoding(extern, intern)
+      end
+    ensure
+      $VERBOSE = verbose
+    end
+    module_function :set_encoding
+    class << self; private :set_encoding; end
+  end
+end
+
+if __FILE__ == $0
+  ERB::Main.run
+end
diff --git a/bin/gem b/bin/gem
new file mode 100755
index 0000000000..a4ec754abb
--- /dev/null
+++ b/bin/gem
@@ -0,0 +1,25 @@
+#!/usr/bin/env ruby
+#--
+# Copyright 2006 by Chad Fowler, Rich Kilmer, Jim Weirich and others.
+# All rights reserved.
+# See LICENSE.txt for permissions.
+#++
+
+require 'rubygems'
+require 'rubygems/gem_runner'
+require 'rubygems/exceptions'
+
+required_version = Gem::Requirement.new ">= 1.8.7"
+
+unless required_version.satisfied_by? Gem.ruby_version then
+  abort "Expected Ruby Version #{required_version}, is #{Gem.ruby_version}"
+end
+
+args = ARGV.clone
+
+begin
+  Gem::GemRunner.new.run args
+rescue Gem::SystemExitException => e
+  exit e.exit_code
+end
+
diff --git a/bin/irb b/bin/irb
new file mode 100755
index 0000000000..c64ee85fbd
--- /dev/null
+++ b/bin/irb
@@ -0,0 +1,11 @@
+#!/usr/bin/env ruby
+#
+#   irb.rb - interactive ruby
+#   	$Release Version: 0.9.6 $
+#   	$Revision$
+#   	by Keiju ISHITSUKA(keiju@ruby-lang.org)
+#
+
+require "irb"
+
+IRB.start(__FILE__)
diff --git a/bin/rdoc b/bin/rdoc
new file mode 100755
index 0000000000..aaa23292df
--- /dev/null
+++ b/bin/rdoc
@@ -0,0 +1,44 @@
+#!/usr/bin/env ruby
+#
+#  RDoc: Documentation tool for source code
+#        (see lib/rdoc/rdoc.rb for more information)
+#
+#  Copyright (c) 2003 Dave Thomas
+#  Released under the same terms as Ruby
+
+begin
+  gem 'rdoc'
+rescue NameError => e # --disable-gems
+  raise unless e.name == :gem
+rescue Gem::LoadError
+end
+
+require 'rdoc/rdoc'
+
+begin
+  r = RDoc::RDoc.new
+  r.document ARGV
+rescue Errno::ENOSPC
+  $stderr.puts 'Ran out of space creating documentation'
+  $stderr.puts
+  $stderr.puts 'Please free up some space and try again'
+rescue SystemExit
+  raise
+rescue Exception => e
+  if $DEBUG_RDOC then
+    $stderr.puts e.message
+    $stderr.puts "#{e.backtrace.join "\n\t"}"
+    $stderr.puts
+  elsif Interrupt === e then
+    $stderr.puts
+    $stderr.puts 'Interrupted'
+  else
+    $stderr.puts "uh-oh! RDoc had a problem:"
+    $stderr.puts e.message
+    $stderr.puts
+    $stderr.puts "run with --debug for full backtrace"
+  end
+
+  exit 1
+end
+
diff --git a/bin/ri b/bin/ri
new file mode 100755
index 0000000000..7fbed0c099
--- /dev/null
+++ b/bin/ri
@@ -0,0 +1,12 @@
+#!/usr/bin/env ruby
+
+begin
+  gem 'rdoc'
+rescue NameError => e # --disable-gems
+  raise unless e.name == :gem
+rescue Gem::LoadError
+end
+
+require 'rdoc/ri/driver'
+
+RDoc::RI::Driver.run ARGV
diff --git a/bootstraptest/pending.rb b/bootstraptest/pending.rb
new file mode 100644
index 0000000000..744c0adac1
--- /dev/null
+++ b/bootstraptest/pending.rb
@@ -0,0 +1,39 @@
+assert_equal 'A', %q{
+  class A
+    @@a = 'A'
+    def a=(x)
+      @@a = x
+    end
+    def a
+      @@a
+    end
+  end
+
+  B = A.dup
+  B.new.a = 'B'
+  A.new.a
+}, '[ruby-core:17019]'
+
+assert_equal 'ok', %q{
+  def m
+    lambda{
+      proc{
+        return :ng1
+      }
+    }.call.call
+    :ng2
+  end
+
+  begin
+    m()
+  rescue LocalJumpError
+    :ok
+  end
+}
+
+assert_normal_exit %q{
+  r = Range.allocate
+  def r.<=>(o) true end
+  r.instance_eval { initialize r, r }
+  r.inspect
+}
diff --git a/bootstraptest/runner.rb b/bootstraptest/runner.rb
new file mode 100755
index 0000000000..5eb468a338
--- /dev/null
+++ b/bootstraptest/runner.rb
@@ -0,0 +1,511 @@
+"exec" "${RUBY-ruby}" "-x" "$0" "$@" || true # -*- mode: ruby; coding: utf-8 -*-
+#!./ruby
+# $Id$
+
+# NOTE:
+# Never use optparse in this file.
+# Never use test/unit in this file.
+# Never use Ruby extensions in this file.
+
+begin
+  require 'fileutils'
+  require 'tmpdir'
+rescue LoadError
+  $:.unshift File.join(File.dirname(__FILE__), '../lib')
+  retry
+end
+
+if !Dir.respond_to?(:mktmpdir)
+  # copied from lib/tmpdir.rb
+  def Dir.mktmpdir(prefix_suffix=nil, tmpdir=nil)
+    case prefix_suffix
+    when nil
+      prefix = "d"
+      suffix = ""
+    when String
+      prefix = prefix_suffix
+      suffix = ""
+    when Array
+      prefix = prefix_suffix[0]
+      suffix = prefix_suffix[1]
+    else
+      raise ArgumentError, "unexpected prefix_suffix: #{prefix_suffix.inspect}"
+    end
+    tmpdir ||= Dir.tmpdir
+    t = Time.now.strftime("%Y%m%d")
+    n = nil
+    begin
+      path = "#{tmpdir}/#{prefix}#{t}-#{$$}-#{rand(0x100000000).to_s(36)}"
+      path << "-#{n}" if n
+      path << suffix
+      Dir.mkdir(path, 0700)
+    rescue Errno::EEXIST
+      n ||= 0
+      n += 1
+      retry
+    end
+
+    if block_given?
+      begin
+        yield path
+      ensure
+        FileUtils.remove_entry_secure path
+      end
+    else
+      path
+    end
+  end
+end
+
+def main
+  @ruby = File.expand_path('miniruby')
+  @verbose = false
+  $stress = false
+  @color = nil
+  @tty = nil
+  @quiet = false
+  dir = nil
+  quiet = false
+  tests = nil
+  ARGV.delete_if {|arg|
+    case arg
+    when /\A--ruby=(.*)/
+      @ruby = $1
+      @ruby.gsub!(/^([^ ]*)/){File.expand_path($1)}
+      @ruby.gsub!(/(\s+-I\s*)((?!(?:\.\/)*-(?:\s|\z))\S+)/){$1+File.expand_path($2)}
+      @ruby.gsub!(/(\s+-r\s*)(\.\.?\/\S+)/){$1+File.expand_path($2)}
+      true
+    when /\A--sets=(.*)/
+      tests = Dir.glob("#{File.dirname($0)}/test_{#{$1}}*.rb").sort
+      puts tests.map {|path| File.basename(path) }.inspect
+      true
+    when /\A--dir=(.*)/
+      dir = $1
+      true
+    when /\A(--stress|-s)/
+      $stress = true
+    when /\A--color(?:=(?:always|(auto)|(never)|(.*)))?\z/
+      warn "unknown --color argument: #$3" if $3
+      @color = $1 ? nil : !$2
+      true
+    when /\A--tty(=(?:yes|(no)|(.*)))?\z/
+      warn "unknown --tty argument: #$3" if $3
+      @tty = !$1 || !$2
+      true
+    when /\A(-q|--q(uiet))\z/
+      quiet = true
+      @quiet = true
+      true
+    when /\A(-v|--v(erbose))\z/
+      @verbose = true
+    when /\A(-h|--h(elp)?)\z/
+      puts(<<-End)
+Usage: #{File.basename($0, '.*')} --ruby=PATH [--sets=NAME,NAME,...]
+        --sets=NAME,NAME,...        Name of test sets.
+        --dir=DIRECTORY             Working directory.
+                                    default: /tmp/bootstraptestXXXXX.tmpwd
+        --color[=WHEN]              Colorize the output.  WHEN defaults to 'always'
+                                    or can be 'never' or 'auto'.
+    -s, --stress                    stress test.
+    -v, --verbose                   Output test name before exec.
+    -q, --quiet                     Don\'t print header message.
+    -h, --help                      Print this message and quit.
+End
+      exit true
+    when /\A-j/
+      true
+    else
+      false
+    end
+  }
+  if tests and not ARGV.empty?
+    $stderr.puts "--tests and arguments are exclusive"
+    exit false
+  end
+  tests ||= ARGV
+  tests = Dir.glob("#{File.dirname($0)}/test_*.rb").sort if tests.empty?
+  pathes = tests.map {|path| File.expand_path(path) }
+
+  @progress = %w[- \\ | /]
+  @progress_bs = "\b" * @progress[0].size
+  @tty = $stderr.tty? if @tty.nil?
+  case @color
+  when nil
+    @color = @tty && /dumb/ !~ ENV["TERM"]
+  end
+  @tty &&= !@verbose
+  if @color
+    # dircolors-like style
+    colors = (colors = ENV['TEST_COLORS']) ? Hash[colors.scan(/(\w+)=([^:\n]*)/)] : {}
+    begin
+      File.read(File.join(__dir__, "../test/colors")).scan(/(\w+)=([^:\n]*)/) do |n, c|
+        colors[n] ||= c
+      end
+    rescue
+    end
+    @passed = "\e[;#{colors["pass"] || "32"}m"
+    @failed = "\e[;#{colors["fail"] || "31"}m"
+    @reset = "\e[m"
+  else
+    @passed = @failed = @reset = ""
+  end
+  unless quiet
+    puts Time.now
+    if defined?(RUBY_DESCRIPTION)
+      puts "Driver is #{RUBY_DESCRIPTION}"
+    elsif defined?(RUBY_PATCHLEVEL)
+      puts "Driver is ruby #{RUBY_VERSION} (#{RUBY_RELEASE_DATE}#{RUBY_PLATFORM}) [#{RUBY_PLATFORM}]"
+    else
+      puts "Driver is ruby #{RUBY_VERSION} (#{RUBY_RELEASE_DATE}) [#{RUBY_PLATFORM}]"
+    end
+    puts "Target is #{`#{@ruby} -v`.chomp}"
+    puts
+    $stdout.flush
+  end
+
+  in_temporary_working_directory(dir) {
+    exec_test pathes
+  }
+end
+
+def erase(e = true)
+  if e and @columns > 0 and !@verbose
+    "\r#{" "*@columns}\r"
+  else
+    ""
+  end
+end
+
+def exec_test(pathes)
+  @count = 0
+  @error = 0
+  @errbuf = []
+  @location = nil
+  @columns = 0
+  @width = pathes.map {|path| File.basename(path).size}.max + 2
+  pathes.each do |path|
+    @basename = File.basename(path)
+    $stderr.printf("%s%-*s ", erase(@quiet), @width, @basename)
+    $stderr.flush
+    @columns = @width + 1
+    $stderr.puts if @verbose
+    count = @count
+    error = @error
+    load File.expand_path(path)
+    if @tty
+      if @error == error
+        msg = "PASS #{@count-count}"
+        @columns += msg.size - 1
+        $stderr.print "#{@progress_bs}#{@passed}#{msg}#{@reset}"
+      else
+        msg = "FAIL #{@error-error}/#{@count-count}"
+        $stderr.print "#{@progress_bs}#{@failed}#{msg}#{@reset}"
+        @columns = 0
+      end
+    end
+    $stderr.puts unless @quiet and @tty and @error == error
+  end
+  $stderr.print(erase) if @quiet
+  if @error == 0
+    if @count == 0
+      $stderr.puts "No tests, no problem"
+    else
+      $stderr.puts "#{@passed}PASS#{@reset} all #{@count} tests"
+    end
+    exit true
+  else
+    @errbuf.each do |msg|
+      $stderr.puts msg
+    end
+    $stderr.puts "#{@failed}FAIL#{@reset} #{@error}/#{@count} tests failed"
+    exit false
+  end
+end
+
+def show_progress(message = '')
+  if @verbose
+    $stderr.print "\##{@count} #{@location} "
+  elsif @tty
+    $stderr.print "#{@progress_bs}#{@progress[@count % @progress.size]}"
+  end
+  t = Time.now if @verbose
+  faildesc, errout = with_stderr {yield}
+  t = Time.now - t if @verbose
+  if !faildesc
+    if @tty
+      $stderr.print "#{@progress_bs}#{@progress[@count % @progress.size]}"
+    elsif @verbose
+      $stderr.printf(". %.3f\n", t)
+    else
+      $stderr.print '.'
+    end
+  else
+    $stderr.print "#{@failed}F"
+    $stderr.printf(" %.3f", t) if @verbose
+    $stderr.print "#{@reset}"
+    $stderr.puts if @verbose
+    error faildesc, message
+    unless errout.empty?
+      $stderr.print "#{@failed}stderr output is not empty#{@reset}\n", adjust_indent(errout)
+    end
+    if @tty and !@verbose
+      $stderr.printf("%-*s%s", @width, @basename, @progress[@count % @progress.size])
+    end
+  end
+rescue Interrupt
+  raise Interrupt
+rescue Exception => err
+  $stderr.print 'E'
+  $stderr.puts if @verbose
+  error err.message, message
+end
+
+# NativeClient is special.  The binary is cross-compiled.  But runs on the build environment.
+# So RUBY_PLATFORM in this process is not useful to detect it.
+def nacl?
+  @ruby and File.basename(@ruby.split(/\s/).first)['sel_ldr']
+end
+
+def assert_check(testsrc, message = '', opt = '')
+  show_progress(message) {
+    result = get_result_string(testsrc, opt)
+    check_coredump
+    yield(result)
+  }
+end
+
+def assert_equal(expected, testsrc, message = '')
+  newtest
+  assert_check(testsrc, message) {|result|
+    if expected == result
+      nil
+    else
+      desc = "#{result.inspect} (expected #{expected.inspect})"
+      pretty(testsrc, desc, result)
+    end
+  }
+end
+
+def assert_match(expected_pattern, testsrc, message = '')
+  newtest
+  assert_check(testsrc, message) {|result|
+    if expected_pattern =~ result
+      nil
+    else
+      desc = "#{expected_pattern.inspect} expected to be =~\n#{result.inspect}"
+      pretty(testsrc, desc, result)
+    end
+  }
+end
+
+def assert_not_match(unexpected_pattern, testsrc, message = '')
+  newtest
+  assert_check(testsrc, message) {|result|
+    if unexpected_pattern !~ result
+      nil
+    else
+      desc = "#{unexpected_pattern.inspect} expected to be !~\n#{result.inspect}"
+      pretty(testsrc, desc, result)
+    end
+  }
+end
+
+def assert_valid_syntax(testsrc, message = '')
+  newtest
+  assert_check(testsrc, message, '-c') {|result|
+    result if /Syntax OK/ !~ result
+  }
+end
+
+def assert_normal_exit(testsrc, *rest)
+  newtest
+  opt = {}
+  opt = rest.pop if Hash === rest.last
+  message, ignore_signals = rest
+  message ||= ''
+  timeout = opt[:timeout]
+  show_progress(message) {
+    faildesc = nil
+    filename = make_srcfile(testsrc)
+    old_stderr = $stderr.dup
+    timeout_signaled = false
+    begin
+      $stderr.reopen("assert_normal_exit.log", "w")
+      io = IO.popen("#{@ruby} -W0 #{filename}")
+      pid = io.pid
+      th = Thread.new {
+        io.read
+        io.close
+        $?
+      }
+      if !th.join(timeout)
+        Process.kill :KILL, pid
+        timeout_signaled = true
+      end
+      status = th.value
+    ensure
+      $stderr.reopen(old_stderr)
+      old_stderr.close
+    end
+    if status&.signaled?
+      signo = status.termsig
+      signame = Signal.list.invert[signo]
+      unless ignore_signals and ignore_signals.include?(signame)
+        sigdesc = "signal #{signo}"
+        if signame
+          sigdesc = "SIG#{signame} (#{sigdesc})"
+        end
+        if timeout_signaled
+          sigdesc << " (timeout)"
+        end
+        faildesc = pretty(testsrc, "killed by #{sigdesc}", nil)
+        stderr_log = File.read("assert_normal_exit.log")
+        if !stderr_log.empty?
+          faildesc << "\n" if /\n\z/ !~ faildesc
+          stderr_log << "\n" if /\n\z/ !~ stderr_log
+          stderr_log.gsub!(/^.*\n/) { '| ' + $& }
+          faildesc << stderr_log
+        end
+      end
+    end
+    faildesc
+  }
+end
+
+def assert_finish(timeout_seconds, testsrc, message = '')
+  newtest
+  show_progress(message) {
+    faildesc = nil
+    filename = make_srcfile(testsrc)
+    io = IO.popen("#{@ruby} -W0 #{filename}")
+    pid = io.pid
+    waited = false
+    tlimit = Time.now + timeout_seconds
+    while Time.now < tlimit
+      if Process.waitpid pid, Process::WNOHANG
+        waited = true
+        break
+      end
+      sleep 0.1
+    end
+    if !waited
+      Process.kill(:KILL, pid)
+      Process.waitpid pid
+      faildesc = pretty(testsrc, "not finished in #{timeout_seconds} seconds", nil)
+    end
+    io.close
+    faildesc
+  }
+end
+
+def flunk(message = '')
+  newtest
+  show_progress('') { message }
+end
+
+def pretty(src, desc, result)
+  src = src.sub(/\A.*\n/, '')
+  (/\n/ =~ src ? "\n#{adjust_indent(src)}" : src) + "  #=> #{desc}"
+end
+
+INDENT = 27
+
+def adjust_indent(src)
+  untabify(src).gsub(/^ {#{INDENT}}/o, '').gsub(/^/, '   ').sub(/\s*\z/, "\n")
+end
+
+def untabify(str)
+  str.gsub(/^\t+/) {' ' * (8 * $&.size) }
+end
+
+def make_srcfile(src)
+  filename = 'bootstraptest.tmp.rb'
+  File.open(filename, 'w') {|f|
+    f.puts "GC.stress = true" if $stress
+    f.puts "print(begin; #{src}; end)"
+  }
+  filename
+end
+
+def get_result_string(src, opt = '')
+  if @ruby
+    filename = make_srcfile(src)
+    begin
+      `#{@ruby} -W0 #{opt} #{filename}`
+    ensure
+      raise Interrupt if $? and $?.signaled? && $?.termsig == Signal.list["INT"]
+      raise CoreDumpError, "core dumped" if $? and $?.coredump?
+    end
+  else
+    eval(src).to_s
+  end
+end
+
+def with_stderr
+  out = err = nil
+  begin
+    r, w = IO.pipe
+    stderr = $stderr.dup
+    $stderr.reopen(w)
+    w.close
+    reader = Thread.start {r.read}
+    begin
+      out = yield
+    ensure
+      $stderr.reopen(stderr)
+      err = reader.value
+    end
+  ensure
+    w.close rescue nil
+    r.close rescue nil
+  end
+  return out, err
+end
+
+def newtest
+  @location = File.basename(caller(2).first)
+  @count += 1
+  cleanup_coredump
+end
+
+def error(msg, additional_message)
+  msg = "#{@failed}\##{@count} #{@location}#{@reset}: #{msg}  #{additional_message}"
+  if @tty
+    $stderr.puts "#{erase}#{msg}"
+  else
+    @errbuf.push msg
+  end
+  @error += 1
+end
+
+def in_temporary_working_directory(dir)
+  if dir
+    Dir.mkdir dir
+    Dir.chdir(dir) {
+      yield
+    }
+  else
+    Dir.mktmpdir(["bootstraptest", ".tmpwd"]) {|d|
+      Dir.chdir(d) {
+        yield
+      }
+    }
+  end
+end
+
+def cleanup_coredump
+  FileUtils.rm_f 'core'
+  FileUtils.rm_f Dir.glob('core.*')
+  FileUtils.rm_f @ruby+'.stackdump' if @ruby
+end
+
+class CoreDumpError < StandardError; end
+
+def check_coredump
+  if File.file?('core') or not Dir.glob('core.*').empty? or
+      (@ruby and File.exist?(@ruby+'.stackdump'))
+    raise CoreDumpError, "core dumped"
+  end
+end
+
+main
diff --git a/bootstraptest/test_attr.rb b/bootstraptest/test_attr.rb
new file mode 100644