4428 files changed, 71100 insertions, 1770623 deletions

diff --git a/.cvsignore b/.cvsignore
new file mode 100644
index 0000000000..2474526e2a
--- /dev/null
+++ b/.cvsignore
@@ -0,0 +1,18 @@
+Makefile
+parse.c
+newver.rb
+ruby
+miniruby
+README.fat-patch
+config.cache
+config.h
+config.log
+config.status
+Makefile
+ppack
+archive
+*.orig
+*.rej
+*.bak
+*.sav
+*~
diff --git a/.document b/.document
deleted file mode 100644
index fb27ba325d..0000000000
--- a/.document
+++ /dev/null
@@ -1,26 +0,0 @@
-# This file determines which files in the
-# Ruby hierarchy will be processed by the RDoc
-# tool when it is given the top-level directory
-# as an argument
-
-# Process all the C source files
-*.c
-
-# prelude
-prelude.rb
-
-# the lib/ directory (which has its own .document file)
-lib
-
-# and some of the ext/ directory (which has its own .document file)
-ext
-
-# rdoc files
-ChangeLog
-
-NEWS
-
-README.md
-README.ja.md
-
-doc
diff --git a/.editorconfig b/.editorconfig
deleted file mode 100644
index 67abf4b978..0000000000
--- a/.editorconfig
+++ /dev/null
@@ -1,16 +0,0 @@
-root = true
-
-[*]
-end_of_line = lf
-insert_final_newline = true
-trim_trailing_whitespace = true
-tab_width = 8
-indent_style = tab
-indent_size = 4
-
-[**.bat]
-end_of_line = crlf
-
-[**.rb]
-indent_style = space
-indent_size = 2
diff --git a/.gdbinit b/.gdbinit
deleted file mode 100644
index 03c2b653cb..0000000000
--- a/.gdbinit
+++ /dev/null
@@ -1,966 +0,0 @@
-define hook-run
-  set $color_type = 0
-  set $color_highlite = 0
-  set $color_end = 0
-end
-
-define ruby_gdb_init
-  if !$color_type
-    set $color_type = "\033[31m"
-  end
-  if !$color_highlite
-    set $color_highlite = "\033[36m"
-  end
-  if !$color_end
-    set $color_end = "\033[m"
-  end
-  if ruby_dummy_gdb_enums.special_consts
-  end
-end
-
-# set prompt \033[36m(gdb)\033[m\040
-
-define rp
-  ruby_gdb_init
-  if (VALUE)($arg0) & RUBY_FIXNUM_FLAG
-    printf "FIXNUM: %ld\n", (long)($arg0) >> 1
-  else
-  if ((VALUE)($arg0) & ~(~(VALUE)0<<RUBY_SPECIAL_SHIFT)) == RUBY_SYMBOL_FLAG
-    set $id = (($arg0) >> RUBY_SPECIAL_SHIFT)
-    printf "%sSYMBOL%s: ", $color_type, $color_end
-    rp_id $id
-  else
-  if ($arg0) == RUBY_Qfalse
-    echo false\n
-  else
-  if ($arg0) == RUBY_Qtrue
-    echo true\n
-  else
-  if ($arg0) == RUBY_Qnil
-    echo nil\n
-  else
-  if ($arg0) == RUBY_Qundef
-    echo undef\n
-  else
-  if (VALUE)($arg0) & RUBY_IMMEDIATE_MASK
-    if ((VALUE)($arg0) & RUBY_FLONUM_MASK) == RUBY_FLONUM_FLAG
-      printf "%sFLONUM%s: %g\n", $color_type, $color_end, (double)rb_float_value($arg0)
-    else
-      echo immediate\n
-    end
-  else
-  set $flags = ((struct RBasic*)($arg0))->flags
-  if ($flags & RUBY_FL_PROMOTED) == RUBY_FL_PROMOTED
-    printf "[PROMOTED] "
-  end
-  if ($flags & RUBY_T_MASK) == RUBY_T_NONE
-    printf "%sT_NONE%s: ", $color_type, $color_end
-    print (struct RBasic *)($arg0)
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_NIL
-    printf "%sT_NIL%s: ", $color_type, $color_end
-    print (struct RBasic *)($arg0)
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_OBJECT
-    printf "%sT_OBJECT%s: ", $color_type, $color_end
-    print (struct RObject *)($arg0)
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_CLASS
-    printf "%sT_CLASS%s%s: ", $color_type, ($flags & RUBY_FL_SINGLETON) ? "*" : "", $color_end
-    rp_class $arg0
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_ICLASS
-    printf "%sT_ICLASS%s: ", $color_type, $color_end
-    rp_class $arg0
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_MODULE
-    printf "%sT_MODULE%s: ", $color_type, $color_end
-    rp_class $arg0
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_FLOAT
-    printf "%sT_FLOAT%s: %.16g ", $color_type, $color_end, (((struct RFloat*)($arg0))->float_value)
-    print (struct RFloat *)($arg0)
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_STRING
-    printf "%sT_STRING%s: ", $color_type, $color_end
-    rp_string $arg0 $flags
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_REGEXP
-    set $regsrc = ((struct RRegexp*)($arg0))->src
-    set $rsflags = ((struct RBasic*)$regsrc)->flags
-    printf "%sT_REGEXP%s: ", $color_type, $color_end
-    set print address off
-    output (char *)(($rsflags & RUBY_FL_USER1) ? \
-	    ((struct RString*)$regsrc)->as.heap.ptr : \
-	    ((struct RString*)$regsrc)->as.ary)
-    set print address on
-    printf " len:%ld ", ($rsflags & RUBY_FL_USER1) ? \
-            ((struct RString*)$regsrc)->as.heap.len : \
-            (($rsflags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
-    if $flags & RUBY_FL_USER6
-      printf "(none) "
-    end
-    if $flags & RUBY_FL_USER5
-      printf "(literal) "
-    end
-    if $flags & RUBY_FL_USER4
-      printf "(fixed) "
-    end
-    printf "encoding:%d ", ($flags & RUBY_ENCODING_MASK) >> RUBY_ENCODING_SHIFT
-    print (struct RRegexp *)($arg0)
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_ARRAY
-    if ($flags & RUBY_FL_USER1)
-      set $len = (($flags & (RUBY_FL_USER3|RUBY_FL_USER4)) >> (RUBY_FL_USHIFT+3))
-      printf "%sT_ARRAY%s: len=%ld ", $color_type, $color_end, $len
-      printf "(embed) "
-      if ($len == 0)
-	printf "{(empty)} "
-      else
-	output/x *((VALUE*)((struct RArray*)($arg0))->as.ary) @ $len
-	printf " "
-      end
-    else
-      set $len = ((struct RArray*)($arg0))->as.heap.len
-      printf "%sT_ARRAY%s: len=%ld ", $color_type, $color_end, $len
-      if ($flags & RUBY_FL_USER2)
-	printf "(shared) shared="
-	output/x ((struct RArray*)($arg0))->as.heap.aux.shared
-	printf " "
-      else
-	printf "(ownership) capa=%ld ", ((struct RArray*)($arg0))->as.heap.aux.capa
-      end
-      if ($len == 0)
-	printf "{(empty)} "
-      else
-	output/x *((VALUE*)((struct RArray*)($arg0))->as.heap.ptr) @ $len
-	printf " "
-      end
-    end
-    print (struct RArray *)($arg0)
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_FIXNUM
-    printf "%sT_FIXNUM%s: ", $color_type, $color_end
-    print (struct RBasic *)($arg0)
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_HASH
-    printf "%sT_HASH%s: ", $color_type, $color_end,
-    if ((struct RHash *)($arg0))->ntbl
-      printf "len=%ld ", ((struct RHash *)($arg0))->ntbl->num_entries
-    end
-    print (struct RHash *)($arg0)
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_STRUCT
-    printf "%sT_STRUCT%s: len=%ld ", $color_type, $color_end, \
-      (($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
-       ($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) >> (RUBY_FL_USHIFT+1) : \
-       ((struct RStruct *)($arg0))->as.heap.len)
-    print (struct RStruct *)($arg0)
-    x/xw (($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
-          ((struct RStruct *)($arg0))->as.ary : \
-          ((struct RStruct *)($arg0))->as.heap.ptr)
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_BIGNUM
-    printf "%sT_BIGNUM%s: sign=%d len=%ld ", $color_type, $color_end, \
-      (($flags & RUBY_FL_USER1) != 0), \
-      (($flags & RUBY_FL_USER2) ? \
-       ($flags & (RUBY_FL_USER5|RUBY_FL_USER4|RUBY_FL_USER3)) >> (RUBY_FL_USHIFT+3) : \
-       ((struct RBignum*)($arg0))->as.heap.len)
-    if $flags & RUBY_FL_USER2
-      printf "(embed) "
-    end
-    print (struct RBignum *)($arg0)
-    x/xw (($flags & RUBY_FL_USER2) ? \
-          ((struct RBignum*)($arg0))->as.ary : \
-          ((struct RBignum*)($arg0))->as.heap.digits)
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_RATIONAL
-    printf "%sT_RATIONAL%s: ", $color_type, $color_end
-    print (struct RRational *)($arg0)
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_COMPLEX
-    printf "%sT_COMPLEX%s: ", $color_type, $color_end
-    print (struct RComplex *)($arg0)
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_FILE
-    printf "%sT_FILE%s: ", $color_type, $color_end
-    print (struct RFile *)($arg0)
-    output *((struct RFile *)($arg0))->fptr
-    printf "\n"
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_TRUE
-    printf "%sT_TRUE%s: ", $color_type, $color_end
-    print (struct RBasic *)($arg0)
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_FALSE
-    printf "%sT_FALSE%s: ", $color_type, $color_end
-    print (struct RBasic *)($arg0)
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_DATA
-    if ((struct RTypedData *)($arg0))->typed_flag == 1
-      printf "%sT_DATA%s(%s): ", $color_type, $color_end, ((struct RTypedData *)($arg0))->type->wrap_struct_name
-      print (struct RTypedData *)($arg0)
-    else
-      printf "%sT_DATA%s: ", $color_type, $color_end
-      print (struct RData *)($arg0)
-    end
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_MATCH
-    printf "%sT_MATCH%s: ", $color_type, $color_end
-    print (struct RMatch *)($arg0)
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_SYMBOL
-    printf "%sT_SYMBOL%s: ", $color_type, $color_end
-    print (struct RSymbol *)($arg0)
-    set $id_type = ((struct RSymbol *)($arg0))->id & RUBY_ID_SCOPE_MASK
-    if $id_type == RUBY_ID_LOCAL
-      printf "l"
-    else
-    if $id_type == RUBY_ID_INSTANCE
-      printf "i"
-    else
-    if $id_type == RUBY_ID_GLOBAL
-      printf "G"
-    else
-    if $id_type == RUBY_ID_ATTRSET
-      printf "a"
-    else
-    if $id_type == RUBY_ID_CONST
-      printf "C"
-    else
-    if $id_type == RUBY_ID_CLASS
-      printf "c"
-    else
-      printf "j"
-    end
-    end
-    end
-    end
-    end
-    end
-    set $id_fstr = ((struct RSymbol *)($arg0))->fstr
-    rp_string $id_fstr
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_UNDEF
-    printf "%sT_UNDEF%s: ", $color_type, $color_end
-    print (struct RBasic *)($arg0)
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_IMEMO
-    printf "%sT_IMEMO%s(", $color_type, $color_end
-    output (enum imemo_type)(($flags>>RUBY_FL_USHIFT)&imemo_mask)
-    printf "): "
-    rp_imemo $arg0
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_NODE
-    printf "%sT_NODE%s(", $color_type, $color_end
-    output (enum node_type)(($flags&RUBY_NODE_TYPEMASK)>>RUBY_NODE_TYPESHIFT)
-    printf "): "
-    print *(NODE *)($arg0)
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_ZOMBIE
-    printf "%sT_ZOMBIE%s: ", $color_type, $color_end
-    print (struct RData *)($arg0)
-  else
-    printf "%sunknown%s: ", $color_type, $color_end
-    print (struct RBasic *)($arg0)
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-end
-document rp
-  Print a Ruby's VALUE.
-end
-
-define rp_id
-  set $id = (ID)$arg0
-  if $id == '!' || $id == '+' || $id == '-' || $id == '*' || $id == '/' || $id == '%' || $id == '<' || $id == '>' || $id == '`'
-    printf "(:%c)\n", $id
-  else
-  if $id == idDot2
-    printf "(:..)\n"
-  else
-  if $id == idDot3
-    printf "(:...)\n"
-  else
-  if $id == idUPlus
-    printf "(:+@)\n"
-  else
-  if $id == idUMinus
-    printf "(:-@)\n"
-  else
-  if $id == idPow
-    printf "(:**)\n"
-  else
-  if $id == idCmp
-    printf "(:<=>)\n"
-  else
-  if $id == idLTLT
-    printf "(:<<)\n"
-  else
-  if $id == idLE
-    printf "(:<=)\n"
-  else
-  if $id == idGE
-    printf "(:>=)\n"
-  else
-  if $id == idEq
-    printf "(:==)\n"
-  else
-  if $id == idEqq
-    printf "(:===)\n"
-  else
-  if $id == idNeq
-    printf "(:!=)\n"
-  else
-  if $id == idEqTilde
-    printf "(:=~)\n"
-  else
-  if $id == idNeqTilde
-    printf "(:!~)\n"
-  else
-  if $id == idAREF
-    printf "(:[])\n"
-  else
-  if $id == idASET
-    printf "(:[]=)\n"
-  else
-    if $id <= tLAST_OP_ID
-      printf "O"
-    else
-      set $id_type = $id & RUBY_ID_SCOPE_MASK
-      if $id_type == RUBY_ID_LOCAL
-        printf "l"
-      else
-      if $id_type == RUBY_ID_INSTANCE
-        printf "i"
-      else
-      if $id_type == RUBY_ID_GLOBAL
-        printf "G"
-      else
-      if $id_type == RUBY_ID_ATTRSET
-        printf "a"
-      else
-      if $id_type == RUBY_ID_CONST
-        printf "C"
-      else
-      if $id_type == RUBY_ID_CLASS
-        printf "c"
-      else
-        printf "j"
-      end
-      end
-      end
-      end
-      end
-      end
-    end
-    printf "(%ld): ", $id
-    set $str = lookup_id_str($id)
-    if $str
-      rp_string $str
-    else
-      echo undef\n
-    end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-end
-document rp_id
-  Print an ID.
-end
-
-define rp_string
-  set $flags = ((struct RBasic*)($arg0))->flags
-  set print address off
-  output (char *)(($flags & RUBY_FL_USER1) ? \
-	    ((struct RString*)($arg0))->as.heap.ptr : \
-	    ((struct RString*)($arg0))->as.ary)
-  set print address on
-  printf " bytesize:%ld ", ($flags & RUBY_FL_USER1) ? \
-          ((struct RString*)($arg0))->as.heap.len : \
-          (($flags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
-  if !($flags & RUBY_FL_USER1)
-    printf "(embed) "
-  else
-    if ($flags & RUBY_FL_USER2)
-      printf "(shared) "
-    end
-    if ($flags & RUBY_FL_USER3)
-      printf "(assoc) "
-    end
-  end
-  printf "encoding:%d ", ($flags & RUBY_ENCODING_MASK) >> RUBY_ENCODING_SHIFT
-  if ($flags & RUBY_ENC_CODERANGE_MASK) == 0
-    printf "coderange:unknown "
-  else
-  if ($flags & RUBY_ENC_CODERANGE_MASK) == RUBY_ENC_CODERANGE_7BIT
-    printf "coderange:7bit "
-  else
-  if ($flags & RUBY_ENC_CODERANGE_MASK) == RUBY_ENC_CODERANGE_VALID
-    printf "coderange:valid "
-  else
-    printf "coderange:broken "
-  end
-  end
-  end
-  print (struct RString *)($arg0)
-end
-document rp_string
-  Print the content of a String.
-end
-
-define rp_class
-  printf "(struct RClass *) %p", (void*)$arg0
-  if ((struct RClass *)($arg0))->ptr.origin_ != $arg0
-    printf " -> %p", ((struct RClass *)($arg0))->ptr.origin_
-  end
-  printf "\n"
-  rb_classname $arg0
-  print *(struct RClass *)($arg0)
-  print *((struct RClass *)($arg0))->ptr
-end
-document rp_class
-  Print the content of a Class/Module.
-end
-
-define rp_imemo
-  set $flags = (((struct RBasic *)($arg0))->flags >> RUBY_FL_USHIFT) & imemo_mask
-  if $flags == imemo_cref
-    printf "(rb_cref_t *) %p\n", (void*)$arg0
-    print *(rb_cref_t *)$arg0
-  else
-  if $flags == imemo_svar
-    printf "(struct vm_svar *) %p\n", (void*)$arg0
-    print *(struct vm_svar *)$arg0
-  else
-  if $flags == imemo_throw_data
-    printf "(struct vm_throw_data *) %p\n", (void*)$arg0
-    print *(struct vm_throw_data *)$arg0
-  else
-  if $flags == imemo_ifunc
-    printf "(struct vm_ifunc *) %p\n", (void*)$arg0
-    print *(struct vm_ifunc *)$arg0
-  else
-  if $flags == imemo_memo
-    printf "(struct MEMO *) %p\n", (void*)$arg0
-    print *(struct MEMO *)$arg0
-  else
-    printf "(struct RIMemo *) %p\n", (void*)$arg0
-    print *(struct RIMemo *)$arg0
-  end
-  end
-  end
-  end
-  end
-end
-document rp_imemo
-  Print the content of a memo
-end
-
-define nd_type
-  print (enum node_type)((((NODE*)($arg0))->flags&RUBY_NODE_TYPEMASK)>>RUBY_NODE_TYPESHIFT)
-end
-document nd_type
-  Print a Ruby' node type.
-end
-
-define nd_file
-  print ((NODE*)($arg0))->nd_file
-end
-document nd_file
-  Print the source file name of a node.
-end
-
-define nd_line
-  print ((unsigned int)((((NODE*)($arg0))->flags>>RUBY_NODE_LSHIFT)&RUBY_NODE_LMASK))
-end
-document nd_line
-  Print the source line number of a node.
-end
-
-# Print members of ruby node.
-
-define nd_head
-  printf "%su1.node%s: ", $color_highlite, $color_end
-  rp ($arg0).u1.node
-end
-
-define nd_alen
-  printf "%su2.argc%s: ", $color_highlite, $color_end
-  p ($arg0).u2.argc
-end
-
-define nd_next
-  printf "%su3.node%s: ", $color_highlite, $color_end
-  rp ($arg0).u3.node
-end
-
-
-define nd_cond
-  printf "%su1.node%s: ", $color_highlite, $color_end
-  rp ($arg0).u1.node
-end
-
-define nd_body
-  printf "%su2.node%s: ", $color_highlite, $color_end
-  rp ($arg0).u2.node
-end
-
-define nd_else
-  printf "%su3.node%s: ", $color_highlite, $color_end
-  rp ($arg0).u3.node
-end
-
-
-define nd_orig
-  printf "%su3.value%s: ", $color_highlite, $color_end
-  rp ($arg0).u3.value
-end
-
-
-define nd_resq
-  printf "%su2.node%s: ", $color_highlite, $color_end
-  rp ($arg0).u2.node
-end
-
-define nd_ensr
-  printf "%su3.node%s: ", $color_highlite, $color_end
-  rp ($arg0).u3.node
-end
-
-
-define nd_1st
-  printf "%su1.node%s: ", $color_highlite, $color_end
-  rp ($arg0).u1.node
-end
-
-define nd_2nd
-  printf "%su2.node%s: ", $color_highlite, $color_end
-  rp ($arg0).u2.node
-end
-
-
-define nd_stts
-  printf "%su1.node%s: ", $color_highlite, $color_end
-  rp ($arg0).u1.node
-end
-
-
-define nd_entry
-  printf "%su3.entry%s: ", $color_highlite, $color_end
-  p ($arg0).u3.entry
-end
-
-define nd_vid
-  printf "%su1.id%s: ", $color_highlite, $color_end
-  p ($arg0).u1.id
-end
-
-define nd_cflag
-  printf "%su2.id%s: ", $color_highlite, $color_end
-  p ($arg0).u2.id
-end
-
-define nd_cval
-  printf "%su3.value%s: ", $color_highlite, $color_end
-  rp ($arg0).u3.value
-end
-
-
-define nd_cnt
-  printf "%su3.cnt%s: ", $color_highlite, $color_end
-  p ($arg0).u3.cnt
-end
-
-define nd_tbl
-  printf "%su1.tbl%s: ", $color_highlite, $color_end
-  p ($arg0).u1.tbl
-end
-
-
-define nd_var
-  printf "%su1.node%s: ", $color_highlite, $color_end
-  rp ($arg0).u1.node
-end
-
-define nd_ibdy
-  printf "%su2.node%s: ", $color_highlite, $color_end
-  rp ($arg0).u2.node
-end
-
-define nd_iter
-  printf "%su3.node%s: ", $color_highlite, $color_end
-  rp ($arg0).u3.node
-end
-
-
-define nd_value
-  printf "%su2.node%s: ", $color_highlite, $color_end
-  rp ($arg0).u2.node
-end
-
-define nd_aid
-  printf "%su3.id%s: ", $color_highlite, $color_end
-  p ($arg0).u3.id
-end
-
-
-define nd_lit
-  printf "%su1.value%s: ", $color_highlite, $color_end
-  rp ($arg0).u1.value
-end
-
-
-define nd_frml
-  printf "%su1.node%s: ", $color_highlite, $color_end
-  rp ($arg0).u1.node
-end
-
-define nd_rest
-  printf "%su2.argc%s: ", $color_highlite, $color_end
-  p ($arg0).u2.argc
-end
-
-define nd_opt
-  printf "%su1.node%s: ", $color_highlite, $color_end
-  rp ($arg0).u1.node
-end
-
-
-define nd_recv
-  printf "%su1.node%s: ", $color_highlite, $color_end
-  rp ($arg0).u1.node
-end
-
-define nd_mid
-  printf "%su2.id%s: ", $color_highlite, $color_end
-  p ($arg0).u2.id
-end
-
-define nd_args
-  printf "%su3.node%s: ", $color_highlite, $color_end
-  rp ($arg0).u3.node
-end
-
-
-define nd_noex
-  printf "%su1.id%s: ", $color_highlite, $color_end
-  p ($arg0).u1.id
-end
-
-define nd_defn
-  printf "%su3.node%s: ", $color_highlite, $color_end
-  rp ($arg0).u3.node
-end
-
-
-define nd_old
-  printf "%su1.id%s: ", $color_highlite, $color_end
-  p ($arg0).u1.id
-end
-
-define nd_new
-  printf "%su2.id%s: ", $color_highlite, $color_end
-  p ($arg0).u2.id
-end
-
-
-define nd_cfnc
-  printf "%su1.cfunc%s: ", $color_highlite, $color_end
-  p ($arg0).u1.cfunc
-end
-
-define nd_argc
-  printf "%su2.argc%s: ", $color_highlite, $color_end
-  p ($arg0).u2.argc
-end
-
-
-define nd_cname
-  printf "%su1.id%s: ", $color_highlite, $color_end
-  p ($arg0).u1.id
-end
-
-define nd_super
-  printf "%su3.node%s: ", $color_highlite, $color_end
-  rp ($arg0).u3.node
-end
-
-
-define nd_modl
-  printf "%su1.id%s: ", $color_highlite, $color_end
-  p ($arg0).u1.id
-end
-
-define nd_clss
-  printf "%su1.value%s: ", $color_highlite, $color_end
-  rp ($arg0).u1.value
-end
-
-
-define nd_beg
-  printf "%su1.node%s: ", $color_highlite, $color_end
-  rp ($arg0).u1.node
-end
-
-define nd_end
-  printf "%su2.node%s: ", $color_highlite, $color_end
-  rp ($arg0).u2.node
-end
-
-define nd_state
-  printf "%su3.state%s: ", $color_highlite, $color_end
-  p ($arg0).u3.state
-end
-
-define nd_rval
-  printf "%su2.value%s: ", $color_highlite, $color_end
-  rp ($arg0).u2.value
-end
-
-
-define nd_nth
-  printf "%su2.argc%s: ", $color_highlite, $color_end
-  p ($arg0).u2.argc
-end
-
-
-define nd_tag
-  printf "%su1.id%s: ", $color_highlite, $color_end
-  p ($arg0).u1.id
-end
-
-define nd_tval
-  printf "%su2.value%s: ", $color_highlite, $color_end
-  rp ($arg0).u2.value
-end
-
-define nd_tree
-  set $buf = (struct RString *)rb_str_buf_new(0)
-  call dump_node((VALUE)($buf), rb_str_new(0, 0), 0, ($arg0))
-  printf "%s\n", $buf->as.heap.ptr
-end
-
-define rb_p
-  call rb_p($arg0)
-end
-
-define rb_numtable_entry
-  set $rb_numtable_tbl = $arg0
-  set $rb_numtable_id = (st_data_t)$arg1
-  set $rb_numtable_key = 0
-  set $rb_numtable_rec = 0
-  if $rb_numtable_tbl->entries_packed
-    set $rb_numtable_p = $rb_numtable_tbl->as.packed.bins
-    while $rb_numtable_p && $rb_numtable_p < $rb_numtable_tbl->as.packed.bins+$rb_numtable_tbl->num_entries
-      if $rb_numtable_p.k == $rb_numtable_id
-	set $rb_numtable_key = $rb_numtable_p.k
-	set $rb_numtable_rec = $rb_numtable_p.v
-	set $rb_numtable_p = 0
-      else
-	set $rb_numtable_p = $rb_numtable_p + 1
-      end
-    end
-  else
-    set $rb_numtable_p = $rb_numtable_tbl->as.big.bins[st_numhash($rb_numtable_id) % $rb_numtable_tbl->num_bins]
-    while $rb_numtable_p
-      if $rb_numtable_p->key == $rb_numtable_id
-	set $rb_numtable_key = $rb_numtable_p->key
-	set $rb_numtable_rec = $rb_numtable_p->record
-	set $rb_numtable_p = 0
-      else
-	set $rb_numtable_p = $rb_numtable_p->next
-      end
-    end
-  end
-end
-
-define rb_id2name
-  ruby_gdb_init
-  printf "%sID%s: ", $color_type, $color_end
-  rp_id $arg0
-end
-document rb_id2name
-  Print the name of id
-end
-
-define rb_method_entry
-  set $rb_method_entry_klass = (struct RClass *)$arg0
-  set $rb_method_entry_id = (ID)$arg1
-  set $rb_method_entry_me = (rb_method_entry_t *)0
-  while !$rb_method_entry_me && $rb_method_entry_klass
-    rb_numtable_entry $rb_method_entry_klass->m_tbl_wrapper->tbl $rb_method_entry_id
-    set $rb_method_entry_me = (rb_method_entry_t *)$rb_numtable_rec
-    if !$rb_method_entry_me
-      set $rb_method_entry_klass = (struct RClass *)RCLASS_SUPER($rb_method_entry_klass)
-    end
-  end
-  if $rb_method_entry_me
-    print *$rb_method_entry_klass
-    print *$rb_method_entry_me
-  else
-    echo method not found\n
-  end
-end
-document rb_method_entry
-  Search method entry by class and id
-end
-
-define rb_classname
-  # up to 128bit int
-  set $rb_classname_permanent = "0123456789ABCDEF"
-  set $rb_classname = classname($arg0, $rb_classname_permanent)
-  if $rb_classname != RUBY_Qnil
-    rp $rb_classname
-  else
-    echo anonymous class/module\n
-  end
-end
-
-define rb_ancestors
-  set $rb_ancestors_module = $arg0
-  while $rb_ancestors_module
-    rp_class $rb_ancestors_module
-    set $rb_ancestors_module = RCLASS_SUPER($rb_ancestors_module)
-  end
-end
-document rb_ancestors
-  Print ancestors.
-end
-
-define rb_backtrace
-  call rb_backtrace()
-end
-
-define iseq
-  if ruby_dummy_gdb_enums.special_consts
-  end
-  if ($arg0)->type == ISEQ_ELEMENT_NONE
-    echo [none]\n
-  end
-  if ($arg0)->type == ISEQ_ELEMENT_LABEL
-    print *(LABEL*)($arg0)
-  end
-  if ($arg0)->type == ISEQ_ELEMENT_INSN
-    print *(INSN*)($arg0)
-    if ((INSN*)($arg0))->insn_id != YARVINSN_jump
-      set $i = 0
-      set $operand_size = ((INSN*)($arg0))->operand_size
-      set $operands = ((INSN*)($arg0))->operands
-      while $i < $operand_size
-	rp $operands[$i++]
-      end
-    end
-  end
-  if ($arg0)->type == ISEQ_ELEMENT_ADJUST
-    print *(ADJUST*)($arg0)
-  end
-end
-
-define rb_ps
-  rb_ps_vm ruby_current_vm
-end
-document rb_ps
-Dump all threads and their callstacks
-end
-
-define rb_ps_vm
-  print $ps_vm = (rb_vm_t*)$arg0
-  set $ps_thread_ln = $ps_vm->living_threads.n.next
-  set $ps_thread_ln_last = $ps_vm->living_threads.n.prev
-  while 1
-    set $ps_thread_th = (rb_thread_t *)$ps_thread_ln
-    set $ps_thread = (VALUE)($ps_thread_th->self)
-    rb_ps_thread $ps_thread
-    if $ps_thread_ln == $ps_thread_ln_last
-      loop_break
-    end
-    set $ps_thread_ln = $ps_thread_ln->next
-  end
-end
-document rb_ps_vm
-Dump all threads in a (rb_vm_t*) and their callstacks
-end
-
-define rb_ps_thread
-  set $ps_thread = (struct RTypedData*)$arg0
-  set $ps_thread_th = (rb_thread_t*)$ps_thread->data
-  printf "* #<Thread:%p rb_thread_t:%p native_thread:%p>\n", \
-    $ps_thread, $ps_thread_th, $ps_thread_th->thread_id
-end
-
-# Details: https://bugs.ruby-lang.org/projects/ruby-trunk/wiki/MachineInstructionsTraceWithGDB
-define trace_machine_instructions
-  set logging on
-  set height 0
-  set width 0
-  display/i $pc
-  while !$exit_code
-    info line *$pc
-    si
-  end
-end
-
-define SDR
-  call rb_vmdebug_stack_dump_raw_current()
-end
-
-define rbi
-  if ((LINK_ELEMENT*)$arg0)->type == ISEQ_ELEMENT_LABEL
-    p *(LABEL*)$arg0
-  else
-  if ((LINK_ELEMENT*)$arg0)->type == ISEQ_ELEMENT_INSN
-    p *(INSN*)$arg0
-  else
-  if ((LINK_ELEMENT*)$arg0)->type == ISEQ_ELEMENT_ADJUST
-    p *(ADJUST*)$arg0
-  else
-    print *$arg0
-  end
-  end
-  end
-end
diff --git a/.gitignore b/.gitignore
deleted file mode 100644
index 5129cee288..0000000000
--- a/.gitignore
+++ /dev/null
@@ -1,181 +0,0 @@
-*-*-*.def
-*-*-*.exp
-*-*-*.lib
-*.a
-*.bak
-*.dSYM
-*.dmyh
-*.dylib
-*.elc
-*.inc
-*.log
-*.o
-*.obj
-*.orig
-*.pdb
-*.rej
-*.sav
-*.swp
-*~
-.*-*
-.*.list
-.*.time
-.DS_Store
-.ccmalloc
-.ext
-.pc
-.ppack
-.svn
-Makefile
-Makefile.old
-extconf.h
-y.output
-y.tab.c
-
-# /
-/*-fake.rb
-/*.dll
-/*.exe
-/*.res
-/*.pc
-/*.rc
-/*_prelude.c
-/COPYING.LIB
-/ChangeLog-*
-/ChangeLog.pre-alpha
-/ChangeLog.pre1_1
-/Doxyfile
-/GNUmakefile
-/GNUmakefile.old
-/README.atheos
-/README.fat-patch
-/README.v6
-/TAGS
-/archive
-/autom4te*.cache
-/automake
-/beos
-/bmlog-*
-/breakpoints.gdb
-/config.cache
-/config.h
-/config.h.in
-/config.status
-/config.status.lineno
-/configure
-/coverage/simplecov
-/coverage/simplecov-html
-/coverage/doclie
-/coverage/.last_run.json
-/coverage/.resultset.json*
-/coverage/assets
-/coverage/index.html
-/doc/capi
-/enc.mk
-/encdb.h
-/exts.mk
-/goruby
-/id.[ch]
-/largefile.h
-/lex.c
-/libruby*.*
-/miniprelude.c
-/miniruby
-/newdate.rb
-/newline.c
-/newver.rb
-/parse.c
-/parse.h
-/patches
-/patches-master
-/pitest.rb
-/ppack
-/prelude.c
-/preview
-/probes.h
-/rbconfig.rb
-/rename2.h
-/repack
-/revision.h
-/riscos
-/rubicon
-/ruby
-/ruby-runner
-/ruby-runner.c
-/ruby-man.rd.gz
-/sizes.c
-/test.rb
-/tmp
-/transdb.h
-/uncommon.mk
-/verconf.h
-/verconf.mk
-/web
-/yasmdata.rb
-
-# /benchmark/
-/benchmark/bmx_*.rb
-/benchmark/fasta.output.*
-/benchmark/wc.input
-
-/enc/*.def
-/enc/*.exp
-/enc/*.lib
-/enc/unicode/data
-
-# /enc/trans/
-/enc/trans/*.c
-/enc/trans/*.def
-/enc/trans/*.exp
-/enc/trans/*.lib
-/enc/trans/.time
-
-# /ext/
-/ext/extinit.c
-
-# /ext/-test-/win32/dln/
-/ext/-test-/win32/dln/dlntest.exp
-/ext/-test-/win32/dln/dlntest.lib
-
-# /ext/dl/callback/
-/ext/dl/callback/callback-*.c
-/ext/dl/callback/callback.c
-
-# /ext/etc/
-/ext/etc/constdefs.h
-
-# /ext/fiddle/
-/ext/fiddle/libffi-*
-
-# /ext/rbconfig/
-/ext/rbconfig/sizeof/sizes.c
-
-# /ext/ripper/
-/ext/ripper/eventids1.c
-/ext/ripper/eventids2table.c
-/ext/ripper/ripper.*
-/ext/ripper/ids1
-/ext/ripper/ids2
-
-# /ext/socket/
-/ext/socket/constants.h
-/ext/socket/constdefs.h
-/ext/socket/constdefs.c
-
-# /ext/tk/
-/ext/tk/config_list
-
-# /gems
-/gems/*.gem
-
-# /spec/
-/spec/mspec
-/spec/rubyspec
-
-# /tool/
-/tool/config.guess
-/tool/config.sub
-
-# /win32/
-/win32/*.ico
-/win32/.time
diff --git a/.indent.pro b/.indent.pro
deleted file mode 100644
index 6a207a0554..0000000000
--- a/.indent.pro
+++ /dev/null
@@ -1,21 +0,0 @@
--bap
--nbbb
--nbc
--br
--nbs
--ncdb
--ce
--cli0.5
--ndj
--ei
--nfc1
--i4
--l120
--lp
--npcs
--psl
--sc
--sob
-
--TID
--TVALUE
diff --git a/.travis.yml b/.travis.yml
deleted file mode 100644
index 3f07bb6e94..0000000000
--- a/.travis.yml
+++ /dev/null
@@ -1,114 +0,0 @@
-# Copyright (C) 2011 Urabe, Shyouhei.  All rights reserved.
-#
-# This file is  a part of the programming language  Ruby.  Permission is hereby
-# granted,  to either  redistribute  or  modify this  file,  provided that  the
-# conditions  mentioned in  the file  COPYING are  met.  Consult  the  file for
-# details.
-
-# This is  a Travis-CI  build configuration file.   The list  of configurations
-# available is located in
-#
-#     http://about.travis-ci.org/docs/user/build-configuration/
-#
-# and as Ruby itself is a project written in C language,
-#
-#     http://about.travis-ci.org/docs/user/languages/c/
-#
-# is also a good place to look at.
-
-# Language specification.
-language: c
-
-# Compilers.  Several  compilers are  provided in Travis,  so we try  them all.
-# The value set here is visible via $CC environment variable.
-compiler:
-  - gcc
-  - clang
-
-os:
-  - linux
-  - osx
-
-# Dependencies.  Some  header files are missing  in a Travis' worker  VM, so we
-# have  to install  them.  The  "1.9.1" here  is OK.   It is  the  most adopted
-# version string  for Debian/Ubuntu, and  no dependencies have been  changed so
-# far since the 1.9.1 release.
-before_install:
-  - "CONFIG_FLAG="
-  - "if [[ $TRAVIS_OS_NAME = 'linux' ]]; then sudo apt-get -qq update; fi"
-  # Travis ships an outdated, broken version of libssl by default
-  - "if [[ $TRAVIS_OS_NAME = 'linux' ]]; then sudo apt-get -qq --only-upgrade install '^libssl.*'; fi"
-  - "if [[ $TRAVIS_OS_NAME = 'linux' ]]; then sudo apt-get -qq install $CC; fi" # upgrade if any
-  - "if [[ $TRAVIS_OS_NAME = 'linux' ]]; then JOBS='-j'; fi"
-  - "if [[ $TRAVIS_OS_NAME = 'osx' ]]; then brew install autoconf gdbm openssl; fi"
-  - "if [[ $TRAVIS_OS_NAME = 'osx' ]]; then CONFIG_FLAG=\"$CONFIG_FLAG --with-gdbm-dir=`brew --prefix gdbm`\"; fi"
-  - "if [[ $TRAVIS_OS_NAME = 'osx' ]]; then CONFIG_FLAG=\"$CONFIG_FLAG --with-openssl-dir=`brew --prefix openssl`\"; fi"
-  - "if [[ $TRAVIS_OS_NAME = 'osx' && $CC = 'gcc' ]]; then CC='gcc-4.9'; fi"
-install: "if [[ $TRAVIS_OS_NAME = 'linux' ]]; then sudo apt-get -qq build-dep ruby1.9.1 2>/dev/null; fi"
-
-# Script is where the test runs.  Note  we just do "make test", not other tests
-# like  test-all, test-rubyspec.   This is  because  they take  too much  time,
-# enough for Travis to shut down the VM as being stalled.
-before_script:
-  - "if [[ $TRAVIS_OS_NAME = 'osx' ]]; then rm -f ~/Library/Logs/DiagnosticReports/ruby_*.crash; fi"
-  - "uname -a"
-  - "uname -r"
-  - "rm -fr .ext autom4te.cache"
-  - "make -f common.mk BASERUBY=ruby MAKEDIRS='mkdir -p' srcdir=. update-config_files"
-  - "autoconf"
-  - "mkdir config_1st config_2nd"
-  - "./configure -C --disable-install-doc --with-gcc=$CC $CONFIG_FLAG"
-  - "cp -pr config.status .ext/include config_1st"
-  - "make reconfig"
-  - "cp -pr config.status .ext/include config_2nd"
-  - "diff -ru config_1st config_2nd"
-  - "make after-update BASERUBY=ruby"
-  - "make -s $JOBS encs"
-  - "make -s $JOBS exts"
-  - "make update-rubyspec"
-  - "if [[ $TRAVIS_OS_NAME = 'osx' ]]; then echo 'exclude :test_deadlock_by_signal_at_forking, \"under investigation\"' >> test/excludes/TestProcess.rb; fi"
-script:
-  - "make test"
-  - "make test-all TESTOPTS='-q -j2'"
-  - "make test-rubyspec"
-after_failure:
-  - "if [[ $TRAVIS_OS_NAME = 'osx' ]]; then find ~/Library/Logs/DiagnosticReports -type f -name ruby_\\*.crash -ls -execdir cat {} \\; -delete; fi"
-
-# Branch matrix.  Not all branches are Travis-ready so we limit branches here.
-branches:
-  only:
-    - trunk
-    - ruby_2_0_0
-    - ruby_2_1
-    - ruby_2_2
-
-# We want to be notified when something happens.
-notifications:
-  irc:
-    channels:
-      - "irc.freenode.org#ruby-core"
-      - "irc.freenode.org#ruby-ja"
-    on_success: change # [always|never|change] # default: always
-    on_failure: change # [always|never|change] # default: always
-    template:
-      - "%{message} by @%{author}: See %{build_url}"
-
-  # Update ruby-head installed on Travis CI so other projects can test against it.
-  webhooks:
-    urls:
-      - "https://rubies.travis-ci.org/rebuild/ruby-head"
-    on_success: always
-    on_failure: never
-
-  email:
-    - ko1c-failure@atdot.net
-    - shibata.hiroshi@gmail.com
-
-# Local Variables:
-# mode: YAML
-# coding: utf-8-unix
-# indent-tabs-mode: nil
-# tab-width: 4
-# fill-column: 79
-# default-justification: full
-# End:
diff --git a/BSDL b/BSDL
deleted file mode 100644
index a009caefea..0000000000
--- a/BSDL
+++ /dev/null
@@ -1,22 +0,0 @@
-Copyright (C) 1993-2013 Yukihiro Matsumoto. All rights reserved.
-
-Redistribution and use in source and binary forms, with or without
-modification, are permitted provided that the following conditions
-are met:
-1. Redistributions of source code must retain the above copyright
-notice, this list of conditions and the following disclaimer.
-2. Redistributions in binary form must reproduce the above copyright
-notice, this list of conditions and the following disclaimer in the
-documentation and/or other materials provided with the distribution.
-
-THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
-ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
-IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
-ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
-FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
-DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
-OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
-HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
-LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
-OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
-SUCH DAMAGE.
diff --git a/CONTRIBUTING.md b/CONTRIBUTING.md
deleted file mode 100644
index ffdf2dd4b8..0000000000
--- a/CONTRIBUTING.md
+++ /dev/null
@@ -1,4 +0,0 @@
-Please see the [official issue tracker] and wiki [HowToContribute].
-
-[official issue tracker]: https://bugs.ruby-lang.org
-[HowToContribute]: https://bugs.ruby-lang.org/projects/ruby/wiki/HowToContribute
diff --git a/COPYING b/COPYING
index a1f19ff99d..3c68f02bb4 100644
--- a/COPYING
+++ b/COPYING
@@ -1,56 +1,248 @@
-Ruby is copyrighted free software by Yukihiro Matsumoto <matz@netlab.jp>.
-You can redistribute it and/or modify it under either the terms of the
-2-clause BSDL (see the file BSDL), or the conditions below:
+		    GNU GENERAL PUBLIC LICENSE
+		     Version 1, February 1989
 
-  1. You may make and give away verbatim copies of the source form of the
-     software without restriction, provided that you duplicate all of the
-     original copyright notices and associated disclaimers.
+ Copyright (C) 1989 Free Software Foundation, Inc.
+                    675 Mass Ave, Cambridge, MA 02139, USA
+ Everyone is permitted to copy and distribute verbatim copies
+ of this license document, but changing it is not allowed.
 
-  2. You may modify your copy of the software in any way, provided that
-     you do at least ONE of the following:
+			    Preamble
 
-       a) place your modifications in the Public Domain or otherwise
-          make them Freely Available, such as by posting said
-	  modifications to Usenet or an equivalent medium, or by allowing
-	  the author to include your modifications in the software.
+  The license agreements of most software companies try to keep users
+at the mercy of those companies.  By contrast, our General Public
+License is intended to guarantee your freedom to share and change free
+software--to make sure the software is free for all its users.  The
+General Public License applies to the Free Software Foundation's
+software and to any other program whose authors commit to using it.
+You can use it for your programs, too.
 
-       b) use the modified software only within your corporation or
-          organization.
+  When we speak of free software, we are referring to freedom, not
+price.  Specifically, the General Public License is designed to make
+sure that you have the freedom to give away or sell copies of free
+software, that you receive source code or can get it if you want it,
+that you can change the software or use pieces of it in new free
+programs; and that you know you can do these things.
 
-       c) give non-standard binaries non-standard names, with
-          instructions on where to get the original software distribution.
+  To protect your rights, we need to make restrictions that forbid
+anyone to deny you these rights or to ask you to surrender the rights.
+These restrictions translate to certain responsibilities for you if you
+distribute copies of the software, or if you modify it.
 
-       d) make other distribution arrangements with the author.
+  For example, if you distribute copies of a such a program, whether
+gratis or for a fee, you must give the recipients all the rights that
+you have.  You must make sure that they, too, receive or can get the
+source code.  And you must tell them their rights.
 
-  3. You may distribute the software in object code or binary form,
-     provided that you do at least ONE of the following:
+  We protect your rights with two steps: (1) copyright the software, and
+(2) offer you this license which gives you legal permission to copy,
+distribute and/or modify the software.
 
-       a) distribute the binaries and library files of the software,
-	  together with instructions (in the manual page or equivalent)
-	  on where to get the original distribution.
+  Also, for each author's protection and ours, we want to make certain
+that everyone understands that there is no warranty for this free
+software.  If the software is modified by someone else and passed on, we
+want its recipients to know that what they have is not the original, so
+that any problems introduced by others will not reflect on the original
+authors' reputations.
 
-       b) accompany the distribution with the machine-readable source of
-	  the software.
+  The precise terms and conditions for copying, distribution and
+modification follow.
+
+		    GNU GENERAL PUBLIC LICENSE
+   TERMS AND CONDITIONS FOR COPYING, DISTRIBUTION AND MODIFICATION
 
-       c) give non-standard binaries non-standard names, with
-          instructions on where to get the original software distribution.
+  0. This License Agreement applies to any program or other work which
+contains a notice placed by the copyright holder saying it may be
+distributed under the terms of this General Public License.  The
+"Program", below, refers to any such program or work, and a "work based
+on the Program" means either the Program or any work containing the
+Program or a portion of it, either verbatim or with modifications.  Each
+licensee is addressed as "you".
 
-       d) make other distribution arrangements with the author.
+  1. You may copy and distribute verbatim copies of the Program's source
+code as you receive it, in any medium, provided that you conspicuously and
+appropriately publish on each copy an appropriate copyright notice and
+disclaimer of warranty; keep intact all the notices that refer to this
+General Public License and to the absence of any warranty; and give any
+other recipients of the Program a copy of this General Public License
+along with the Program.  You may charge a fee for the physical act of
+transferring a copy.
 
-  4. You may modify and include the part of the software into any other
-     software (possibly commercial).  But some files in the distribution
-     are not written by the author, so that they are not under these terms.
+  2. You may modify your copy or copies of the Program or any portion of
+it, and copy and distribute such modifications under the terms of Paragraph
+1 above, provided that you also do the following:
 
-     For the list of those files and their copying conditions, see the
-     file LEGAL.
+    a) cause the modified files to carry prominent notices stating that
+    you changed the files and the date of any change; and
 
-  5. The scripts and library files supplied as input to or produced as 
-     output from the software do not automatically fall under the
-     copyright of the software, but belong to whomever generated them, 
-     and may be sold commercially, and may be aggregated with this
-     software.
+    b) cause the whole of any work that you distribute or publish, that
+    in whole or in part contains the Program or any part thereof, either
+    with or without modifications, to be licensed at no charge to all
+    third parties under the terms of this General Public License (except
+    that you may choose to grant warranty protection to some or all
+    third parties, at your option).
 
-  6. THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR
-     IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED
-     WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
-     PURPOSE.
+    c) If the modified program normally reads commands interactively when
+    run, you must cause it, when started running for such interactive use
+    in the simplest and most usual way, to print or display an
+    announcement including an appropriate copyright notice and a notice
+    that there is no warranty (or else, saying that you provide a
+    warranty) and that users may redistribute the program under these
+    conditions, and telling the user how to view a copy of this General
+    Public License.
+
+    d) You may charge a fee for the physical act of transferring a
+    copy, and you may at your option offer warranty protection in
+    exchange for a fee.
+
+Mere aggregation of another independent work with the Program (or its
+derivative) on a volume of a storage or distribution medium does not bring
+the other work under the scope of these terms.
+
+  3. You may copy and distribute the Program (or a portion or derivative of
+it, under Paragraph 2) in object code or executable form under the terms of
+Paragraphs 1 and 2 above provided that you also do one of the following:
+
+    a) accompany it with the complete corresponding machine-readable
+    source code, which must be distributed under the terms of
+    Paragraphs 1 and 2 above; or,
+
+    b) accompany it with a written offer, valid for at least three
+    years, to give any third party free (except for a nominal charge
+    for the cost of distribution) a complete machine-readable copy of the
+    corresponding source code, to be distributed under the terms of
+    Paragraphs 1 and 2 above; or,
+
+    c) accompany it with the information you received as to where the
+    corresponding source code may be obtained.  (This alternative is
+    allowed only for noncommercial distribution and only if you
+    received the program in object code or executable form alone.)
+
+Source code for a work means the preferred form of the work for making
+modifications to it.  For an executable file, complete source code means
+all the source code for all modules it contains; but, as a special
+exception, it need not include source code for modules which are standard
+libraries that accompany the operating system on which the executable
+file runs, or for standard header files or definitions files that
+accompany that operating system.
+
+  4. You may not copy, modify, sublicense, distribute or transfer the
+Program except as expressly provided under this General Public License.
+Any attempt otherwise to copy, modify, sublicense, distribute or transfer
+the Program is void, and will automatically terminate your rights to use
+the Program under this License.  However, parties who have received
+copies, or rights to use copies, from you under this General Public
+License will not have their licenses terminated so long as such parties
+remain in full compliance.
+
+  5. By copying, distributing or modifying the Program (or any work based
+on the Program) you indicate your acceptance of this license to do so,
+and all its terms and conditions.
+
+  6. Each time you redistribute the Program (or any work based on the
+Program), the recipient automatically receives a license from the original
+licensor to copy, distribute or modify the Program subject to these
+terms and conditions.  You may not impose any further restrictions on the
+recipients' exercise of the rights granted herein.
+
+  7. The Free Software Foundation may publish revised and/or new versions
+of the General Public License from time to time.  Such new versions will
+be similar in spirit to the present version, but may differ in detail to
+address new problems or concerns.
+
+Each version is given a distinguishing version number.  If the Program
+specifies a version number of the license which applies to it and "any
+later version", you have the option of following the terms and conditions
+either of that version or of any later version published by the Free
+Software Foundation.  If the Program does not specify a version number of
+the license, you may choose any version ever published by the Free Software
+Foundation.
+
+  8. If you wish to incorporate parts of the Program into other free
+programs whose distribution conditions are different, write to the author
+to ask for permission.  For software which is copyrighted by the Free
+Software Foundation, write to the Free Software Foundation; we sometimes
+make exceptions for this.  Our decision will be guided by the two goals
+of preserving the free status of all derivatives of our free software and
+of promoting the sharing and reuse of software generally.
+
+			    NO WARRANTY
+
+  9. BECAUSE THE PROGRAM IS LICENSED FREE OF CHARGE, THERE IS NO WARRANTY
+FOR THE PROGRAM, TO THE EXTENT PERMITTED BY APPLICABLE LAW.  EXCEPT WHEN
+OTHERWISE STATED IN WRITING THE COPYRIGHT HOLDERS AND/OR OTHER PARTIES
+PROVIDE THE PROGRAM "AS IS" WITHOUT WARRANTY OF ANY KIND, EITHER EXPRESSED
+OR IMPLIED, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF
+MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE.  THE ENTIRE RISK AS
+TO THE QUALITY AND PERFORMANCE OF THE PROGRAM IS WITH YOU.  SHOULD THE
+PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF ALL NECESSARY SERVICING,
+REPAIR OR CORRECTION.
+
+  10. IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN WRITING
+WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MAY MODIFY AND/OR
+REDISTRIBUTE THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU FOR DAMAGES,
+INCLUDING ANY GENERAL, SPECIAL, INCIDENTAL OR CONSEQUENTIAL DAMAGES ARISING
+OUT OF THE USE OR INABILITY TO USE THE PROGRAM (INCLUDING BUT NOT LIMITED
+TO LOSS OF DATA OR DATA BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY
+YOU OR THIRD PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER
+PROGRAMS), EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE
+POSSIBILITY OF SUCH DAMAGES.
+
+		     END OF TERMS AND CONDITIONS
+
+	Appendix: How to Apply These Terms to Your New Programs
+
+  If you develop a new program, and you want it to be of the greatest
+possible use to humanity, the best way to achieve this is to make it
+free software which everyone can redistribute and change under these
+terms.
+
+  To do so, attach the following notices to the program.  It is safest to
+attach them to the start of each source file to most effectively convey
+the exclusion of warranty; and each file should have at least the
+"copyright" line and a pointer to where the full notice is found.
+
+    <one line to give the program's name and a brief idea of what it does.>
+    Copyright (C) 19yy  <name of author>
+
+    This program is free software; you can redistribute it and/or modify
+    it under the terms of the GNU General Public License as published by
+    the Free Software Foundation; either version 1, or (at your option)
+    any later version.
+
+    This program is distributed in the hope that it will be useful,
+    but WITHOUT ANY WARRANTY; without even the implied warranty of
+    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+    GNU General Public License for more details.
+
+    You should have received a copy of the GNU General Public License
+    along with this program; if not, write to the Free Software
+    Foundation, Inc., 675 Mass Ave, Cambridge, MA 02139, USA.
+
+Also add information on how to contact you by electronic and paper mail.
+
+If the program is interactive, make it output a short notice like this
+when it starts in an interactive mode:
+
+    Gnomovision version 69, Copyright (C) 19xx name of author
+    Gnomovision comes with ABSOLUTELY NO WARRANTY; for details type `show w'.
+    This is free software, and you are welcome to redistribute it
+    under certain conditions; type `show c' for details.
+
+The hypothetical commands `show w' and `show c' should show the
+appropriate parts of the General Public License.  Of course, the
+commands you use may be called something other than `show w' and `show
+c'; they could even be mouse-clicks or menu items--whatever suits your
+program.
+
+You should also get your employer (if you work as a programmer) or your
+school, if any, to sign a "copyright disclaimer" for the program, if
+necessary.  Here a sample; alter the names:
+
+  Yoyodyne, Inc., hereby disclaims all copyright interest in the
+  program `Gnomovision' (a program to direct compilers to make passes
+  at assemblers) written by James Hacker.
+
+  <signature of Ty Coon>, 1 April 1989
+  Ty Coon, President of Vice
+
+That's all there is to it!
diff --git a/COPYING.ja b/COPYING.ja
deleted file mode 100644
index e50d01c8d1..0000000000
--- a/COPYING.ja
+++ /dev/null
@@ -1,51 +0,0 @@
-本プログラム�フリーソフトウェア��．2-clause BSDL
-���以下�示��件�本プログラムを��布����
-2-clause BSDL�����BSDLファイルを�照��下��．
-
-  1. 複製�制���自由��．
-
-  2. 以下��件���れ�を満��時�本プログラム�ソースを
-     自由�変更����．
-
-     (a) �ットニューズ��スト��り，作者�変更を�付�る
-         ���方法�，変更を公開�る．
-
-     (b) 変更��本プログラムを自分�所属�る組織内部���
-         使�．
-
-     (c) 変更点を明示����，ソフトウェア���を変更�る．
-         ��ソフトウェアを�布�る時��変更��本プログラ
-         ムも�時��布�る．���変更��本プログラム�ソー
-         ス�入手法を明示�る．
-
-     (d) ��他�変更�件を作者����る．
-
-  3. 以下��件���れ�を満��時�本プログラムをコンパイ
-     ル��オブジェクトコードや実行形��も�布����．
-
-     (a) �イナリを�����人�ソースを入手��るよ��，
-         ソース�入手法を明示�る．
-
-     (b) 機械�読�ソースコードを添付�る．
-
-     (c) 変更を行���イナリ���を変更����，オリジナ
-         ル�ソースコード�入手法を明示�る．
-
-     (d) ��他��布�件を作者����る．
-
-  4. 他�プログラム��引用����る目的��れ自由��．�
-     ��，本プログラム���れる他�作者�よるコード�，�
-     れ�れ�作者����よる制��加�られる場���り��．
-
-     �れらファイル�一覧��れ�れ��布�件���付���
-     LEGALファイルを�照������．
-
-  5. 本プログラム��入力��るスクリプト�よ�，本プログラ
-     ム�ら�出力�権利�本プログラム�作者����，�れ�
-     れ�入出力を生���人�属���．��，本プログラム�
-     組�込�れる���拡張ライブラリ����も�様��．
-
-  6. 本プログラム�無�証��．作者�本プログラムをサ�ート
-     �る�志��り���，プログラム自身��グ�る��本プ
-     ログラム�実行���ら発生�る���る�害�対��も責
-     任を����ん．
diff --git a/ChangeLog b/ChangeLog
index 9c455b43f5..da56f8ed34 100644
--- a/ChangeLog
+++ b/ChangeLog
@@ -1,9744 +1,1909 @@
-Wed Nov 11 18:30:28 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu May 14 14:44:21 1998  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
 
-	* sprintf.c (rb_str_format): look up the key, then get default
-	  value and raise KeyError if the returned value is nil.
-	  [ruby-dev:49338] [Ruby trunk - Bug #11677]
+	* sun4 cc patches for intern.h and regex.h.
 
-Wed Nov 11 17:38:24 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu May 14 14:03:16 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* vm_eval.c (local_var_list_add): skip internal local variable
-	  name by its type but not if it has a name.  internal local
-	  variable names are just unique per frame, not globally.
-	  [ruby-core:71437] [Bug #11674]
+	* random.c (RANDOM_MAX): guessing proper maximum value for random
+ 	  numbers.
 
-Wed Nov 11 14:14:33 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* random.c (f_rand): use drand48 if possible.
 
-	* transcode.c: fix a typo
-	[ci skip][fix GH-1091] Patch by @jwworth
+Wed May 13 19:05:20 1998 1998  MAEDA shugo  <shugo@aianet.ne.jp>
 
-Wed Nov 11 11:58:38 2015  Shugo Maeda  <shugo@ruby-lang.org>
+	* BeOS patches for io.c, error.c and config.guess.
 
-	* lib/net/ftp.rb (initialize): Connections are in passive mode per
-	  default now.  The default mode can be changed by
-	  Net::FTP.default_passive=.
-	  [ruby-core:71146] [Feature #11612]
+Wed May 13 14:56:23 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* lib/net/ftp.rb (default_passive=, default_passive): new methods.
+	* experimental release 1.1b9_19.
 
-Wed Nov 11 09:03:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* most of the Mac and BeOS patches merged, except path separators.
 
-	* sprintf.c (rb_str_format): respect default value of a hash.  no
-	  longer raises KeyError unless the default value of the hash is
-	  nil.  [ruby-core:71354] [Bug #11661]
+	* error.c (err_append): generated SyntaxError was String.
 
-Tue Nov 10 20:35:12 2015  Tanaka Akira  <akr@fsij.org>
+	* ruby.h: xxx2INT, xxx2UINT checks values as int, not long.
 
-	* lib/open-uri.rb: Remove indicator for "frozen_string_literal: true".
+	* ruby.h: remove typedef's. INT, UINT, UCHAR, USHORT.
 
-	* lib/pp.rb: Ditto.
+Tue May 12 17:38:00 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* lib/prettyprint.rb: Ditto.
+	* experimental release 1.1b9_18.
 
-	* lib/resolv.rb: Ditto.
+Tue May 12 11:38:08 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* lib/securerandom.rb: Ditto.
+	* error.c (syserr_errno): returns errno of the SystemCallError.
 
-	* lib/tmpdir.rb: Ditto.
+	* error.c (rb_sys_fail): saves errno in the Exception.
 
-	* lib/unicode_normalize/tables.rb: Ditto.
+	* error.c (set_syserr): no need to protect syserr_list.
 
-	* test/net/ftp/test_buffered_socket.rb: Ditto.
+	* error.c (rb_sys_fail): no more bufsize limit.
 
-	* test/net/ftp/test_mlsx_entry.rb: Ditto.
+	* error.c (set_syserr): integer value of errno can be accessed by
+	  Errno::EXXX::Errno.
 
-	* test/open-uri/test_open-uri.rb: Ditto.
+Sun May 10 03:10:33 1998  WATANABE Tetsuya  <tetsu@jpn.hp.com>
 
-	* test/open-uri/test_ssl.rb: Ditto.
+	* io.c (io_tell etc.): moved from File class to IO class.
 
-	* test/pathname/test_pathname.rb: Ditto.
+Fri May  8 12:26:37 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* test/test_pp.rb: Ditto.
+	* pack.c (pack_unpack): should be unsigned int (was signed int).
 
-	* test/test_prettyprint.rb: Ditto.
+Thu May  7 16:34:10 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* tool/transcode-tblgen.rb: Ditto.
+	* pack.c (pack_pack): `V', `N' uses newly created NUM2UINT().
 
-	* ext/pathname/lib/pathname.rb: Ditto.
+	* ruby.h (NUM2UINT): new macro.
 
-Tue Nov 10 18:42:24 2015  Aleksandrs Ledovskis  <aleksandrs@ledovskis.lv>
+	* bignum.c (big2uint): try to convert bignum into UINT.
 
-	* defs/id.def, parse.y: Switch internal token name to reflect
-	  current form of safe-call operator.  [Fix GH-1090]
+	* re.c (reg_match): needed to return false for match with nil.
 
-Tue Nov 10 18:25:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* gc.c (obj_free): wrong condition to free string.
 
-	* hash.c (rb_hash_to_proc): use rb_func_proc_new to make light
-	  weight proc.  [Feature #11653]
+Wed May  6 21:08:08 1998  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
 
-Tue Nov 10 18:23:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ruby.c (ruby_process_options): modified for DJGPP.
 
-	* proc.c (cfunc_proc_t): add room for me.
+Wed May  6 15:48:03 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* proc.c (cfunc_proc_new): generalise for cfunc proc without env.
+	* experimental release 1.1b9_17.
 
-	* proc.c (rb_func_proc_new, rb_func_lambda_new): new functions to
-	  make proc/lambda without env from cfunc.
+Wed May  6 01:37:39 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Tue Nov 10 17:32:35 2015  Naohisa Goto  <ngotogenome@gmail.com>
+	* eval.c: remove global variable `errat'.
 
-	* bootstraptest/test_fork.rb ([ruby-dev:37934]): :NPROC (RLIMIT_NPROC)
-	  is not supported on some platforms (e.g. Solaris 10).
+	* eval.c (rb_longjmp): embed error position information in the
+ 	  exception object.
 
-Tue Nov 10 16:57:14 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat May  2 12:20:02 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* hash.c (rb_hash_to_proc): new method Hash#to_proc.
-	  [Feature #11653]
+	* re.c (reg_search): supports reverse search.
 
-Tue Nov 10 14:34:09 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+	* string.c (str_index_method): does update $~ etc.
 
-	* time.c (rb_time_timespec_new): swap utc and localtime
-	  to generate gmt flag by INT_MAX - gmtoff.
+	* eval.c (f_load): needed to clear the_dyna_vars.
 
-Tue Nov 10 14:01:59 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* eval.c (dyna_var_asgn): do not push dyna_var, which is id == 0.
 
-	* hash.c (rb_hash_{le,lt,ge,gt}): new methods, Hash#<=, Hash#<,
-	  Hash#>=, Hash#>, to test if all elements of a hash are also
-	  included in another hash, and vice versa.
-	  [ruby-core:68561] [Feature #10984]
+	* error.c (Init_Exception): NotImplementError is no longer
+	  StandardError, which is not handled by default rescue.
 
-Tue Nov 10 11:25:29 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+Fri May  1 00:35:51 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* time.c (rb_timespec_now): added.
+	* ruby.c (proc_options): `-d' turns on verbose flag too.
 
-	* time.c (rb_time_timespec_new): added.
+	* error.c (exception): last argument may be the superclass of the
+	  defining exception(s).
 
-Tue Nov 10 06:17:17 2015  Eric Wong  <e@80x24.org>
+	* io.c (Init_IO): EOFError is now subclass of the IOError.
 
-	* variable.c (rb_autoload_load): allow recursive calls
-	  [ruby-core:71345] [Bug #11658]
-	* test/ruby/test_autoload.rb (test_autoload_while_autoloading):
-	  new test by: Hiroshi Shirosaki <h.shirosaki@gmail.com>
-	  [ruby-core:71390]
+	* io.c (Init_IO): forgot to define IOError.
 
-Tue Nov 10 00:36:46 2015  Tanaka Akira  <akr@fsij.org>
+	* error.c (Init_Exception): old Exception class renamed to
+	  StandardError.  Exception now replaces old GlobalExit.
 
-	* lib/resolv.rb (Resolv::DNS::Message::MessageEncoder#put_labels):
-	  Prevent overflow of pointer to labels.
-	  Patch by Hannes Georg.  [ruby-core:71248] [Bug #11632]
+	* error.c (Init_Exception): Exception is now the root of the
+	  Global Exits.  There's no longer GlobalExit class.
 
-Tue Nov 10 00:25:41 2015  Kazuki Tsujimoto  <kazuki@callcc.net>
+	* util.c (ruby_mktemp): check TMP, TMPDIR first.
 
-	* gems/bundled_gems: update to power_assert 0.2.6.
+Thu Apr 30 01:08:35 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Mon Nov  9 21:48:17 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/tk.rb: call 'unknown', if proc not defined.
 
-	* vm_eval.c (rb_check_funcall_default): split from
-	  rb_check_funcall to return the given fallback value.
+	* eval.c (handle_rescue): default rescue handles `Exceptional' not 
+	  only the instance of the `Exception's.
 
-	* object.c (rb_obj_dig): use rb_check_funcall_default so that tail
-	  call optimization will be possible.  [Feature #11643]
+	* eval.c (f_raise): exception can be any object.
 
-Mon Nov  9 21:27:23 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* time.c (time_gm_or_local): call time_gmtime or time_localtime.
 
-	* array.c (rb_ary_dig): new method Array#dig.
+	* eval.c (f_raise): raises TypeError if the class which is not a
+	  subclass of String is specified (checked in exc_new()).
 
-	* hash.c (rb_hash_dig): new method Hash#dig.
+	* error.c (exc_new): need to check whether invalid class (not a
+	  subclass of String) is specified.
 
-	* object.c (rb_obj_dig): dig in nested arrays/hashes.
-	  [Feature #11643]
+Wed Apr 29 21:05:44 1998  WATANABE Hirofumi  <eban@os.rim.or.jp>
 
-Mon Nov  9 18:00:47 2015  Yuki Nishijima  <mail@yukinishijima.net>
+	* ruby.c (proc_options): option '-e' via tempfile.
 
-	* gems/bundled_gems: Upgrade the did_you_mean gem to 1.0.0.beta3
+Tue Apr 28 15:27:58 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Mon Nov  9 17:38:14 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* experimental release 1.1b9_16.
 
-	* test/runner.rb: use official repository for coverage tool.
-	* Makefile.in: ditto.
-	* common.mk: ditto.
-	* .gitignore: ignored third party repositories.
+Tue Apr 28 00:07:38 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Mon Nov  9 17:29:09 2015  Shugo Maeda  <shugo@ruby-lang.org>
+	* eval.c (obj_is_proc): type check predicate.
 
-	* compile.c (iseq_compile_each): Dynamic string literals should be
-	  frozen.
-	  [ruby-core:57574] [Feature #8976]
+	* eval.c (obj_is_block): ditto.
 
-Mon Nov  9 15:56:07 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+Mon Apr 27 16:59:17 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* common.mk: Use ruby organization url for simplecov repository.
+	* ext/gtk/gtk.c (Init_gtk): use timeout, not idle to avoid
+	  comsuming CPU too much.
 
-Sun Nov  8 16:24:09 2015  Masaki Matsushita <glass.saga@gmail.com>
+	* lib/tk.rb: use tcltklib#_invoke instead of `_eval'.
 
-	* NEWS: describe addition of File::TMPFILE
+Mon Apr 27 16:59:17 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Sun Nov  8 15:19:17 2015  Masaki Matsushita <glass.saga@gmail.com>
+	* array.c (ary_sort): use dup, not clone.
 
-	* file.c: Add O_TMPFILE.
+Mon Apr 27 13:46:27 1998  Tadahiro Maebashi  <maebashi@iij.ad.jp>
 
-Sun Nov  8 14:24:43 2015  windwiny  <windwiny.ubt@gmail.com>
+	* ext/tcltklib/tcltklib.c (ip_invoke): invoke tcl command
+	  directly.  need not worry about escaping tcl characters.
 
-	* method.h (METHOD_ENTRY_{VISI,BASIC,FLAGS}_SET): suppress
-	  shift-op-parentheses warnings.  [Fix GH-1082]
+Mon Apr 27 12:04:43 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Sun Nov  8 14:01:22 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* random.c (f_rand): do not call srand() implicitly.
 
-	* ext/psych/psych_emitter.c: backport 5bd7744 from tenderlove/psych.
-	  support backward compatibility of Ruby 2.0
+Fri Apr 24 14:35:45 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Sun Nov  8 10:55:10 2015  Anton Davydov  <antondavydov.o@gmail.com>
+	* experimental release 1.1b9_15.
 
-	* io.c (rb_io_gets_m): Update IO#gets doc for characters more than
-	  1 byte.  [Fix GH-1085]
+	* parse.y (assignable): dyna_var_asgn actually defines nested
+	  local variables in outer context.
 
-Sun Nov  8 10:37:58 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* random.c (f_rand): call srand(), if it has not called yet.
 
-	* lib/uri/ftp.rb: fix a typo.
-	  [fix GH-1084][ci skip] Patch by @windwiny
+	* random.c (f_srand): use tv_usec as the default seed.
 
-Sun Nov  8 08:10:31 2015  Koichi Sasada  <ko1@atdot.net>
+	* eval.c (rb_eval): values of nested local variables should be
+ 	  independent.
 
-	* vm_trace.c (exec_hooks_precheck): check need_clean everytime
-	  to clean-up unused hooks.
+	* eval.c (rb_yield_0): local variables wrong nested conditions.
 
-	* vm_trace.c (list->need_clean): use as boolean value.
+Wed Apr 22 23:27:17 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Sun Nov  8 01:31:27 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+	* io.c (select_get_io): get IO object by `to_io'.
 
-	* lib/net/http.rb (Net::HTTP#initialize):
-	  default value of Net::HTTP#open_timeout is now 60 (was nil).
+	* io.c (io_to_io): method to retrieve IO object, from delegating
+ 	  object for example.
 
-Sat Nov  7 12:18:05 2015  Eric Wong  <e@80x24.org>
+Wed Apr 22 16:52:37 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* string.c (id_to_s): remove redundant variable
-	  (rb_obj_as_string): trade id_to_s for idTo_s
-	  (rb_str_equal): replace rb_intern(...) with pre-defined ID
-	  (rb_str_cmp_m): ditto
-	  (rb_str_match): ditto
-	  (str_upto_each): ditto
-	  (rb_str_sum): ditto
-	  (Init_String): remove id_to_s initialization
+	* experimental release 1.1b9_14.
 
-Sat Nov  7 11:40:05 2015  Eric Wong  <e@80x24.org>
+	* string.c (str_modify): check for embedded pointer reference.
 
-	* thread.c (rb_cThreadShield): make static
+	* gc.c (obj_free): ditto.
 
-Sat Nov  7 09:51:38 2015  Koichi Sasada  <ko1@atdot.net>
+	* pack.c (pack_pack): p/P template to embed pointers.
 
-	* vm_trace.c (rb_threadptr_exec_event_hooks_orig):
-	  maintain trace_running counter on internal events.
+Wed Apr 22 00:07:10 1998  Tadayoshi Funaba  <tadf@kt.rim.or.jp>
 
-	  This patch is made by Takashi Kokubun <takashikkbn@gmail.com>.
-	  [Bug #11603] https://github.com/ruby/ruby/pull/1059
+	* array.c (ary_rindex): embarrassing typo.
 
-Sat Nov  7 03:32:27 2015  Koichi Sasada  <ko1@atdot.net>
+Tue Apr 21 12:31:48 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* include/ruby/ruby.h (RSTRUCT_PTR): need a close parenthesis.
+	* experimental release 1.1b9_13.
 
-Sat Nov  7 01:32:06 2015  Naohisa Goto  <ngotogenome@gmail.com>
+	* configure.in (RUBY_LIB): supports --program-{prefix,suffix}.
 
-	* dir.c (dir_fileno, dirfd): support of Dir#fileno on Solaris 10.
-	  Solaris 10 does not have dirfd, but the file descriptor of a
-	  directory is stored in the d_fd or dd_fd member in the DIR struct.
-	  Note that Solaris 11 has dirfd(3C).
+	* array.c (ary_rindex): new method.
 
-	* configure.in: checks for DIR.d_fd and DIR.dd_fd on Solaris 10.
+	* io.c (io_binmode): should return self.
 
-Fri Nov  6 23:13:53 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
+Tue Apr 21 08:23:04 1998  Tadayoshi Funaba  <tadf@kt.rim.or.jp>
 
-	* array.c: clarifies Array#reject! documentation.
-	  [fix GH-894][ci skip] Patch by @GxSplinter
+	* parse.y (here_document): calling parse_string with wrong
+	  arguments.
 
-Fri Nov  6 20:18:25 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* struct.c (struct_aset): problem member assignment with name.
 
-	* test/runner.rb: extracted test helper.
-	* test/lib/zombie_hunter.rb: ditto.
+Mon Apr 20 14:47:49 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Fri Nov  6 18:07:47 2015  Naohisa Goto  <ngotogenome@gmail.com>
+	* experimental release 1.1b9_12.
 
-	* include/ruby/ruby.h (rb_array_const_ptr, rb_struct_const_ptr):
-	  Suppress pointer type mismatch warnings occurred with old version
-	  of Fujitsu C Compiler (fcc) on Solaris 10. The warnings cause
-	  failure of TestMkmf::TestConvertible. [Bug #11644] [ruby-dev:49326]
-	* include/ruby/ruby.h (FIX_CONST_VALUE_PTR): macro for the above,
-	  only effective with fcc.
+	* time.c (time_arg): args may be string (support for reduced
+	  implicit type conversion).
 
-Fri Nov  6 12:39:21 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/base64.rb: changed to use pack/unpack with `m' template.
 
-	* defs/id.def (token_ops), parse.y (parser_yylex): change DOTQ
-	  from ".?" to "&.".  [ruby-core:71363] [Feature #11537]
+Mon Apr 20 06:23:20 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Fri Nov  6 09:01:26 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* variable.c (mod_remove_const): new method.
 
-	* parse.y (kwd_append): fix segv after invalid keyword argument,
-	  preceding keyword list is NULL when syntax error is there.
-	  [ruby-core:71356] [Bug #11663]
+Sat Apr 18 03:53:27 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Fri Nov  6 06:59:37 2015  Eric Wong  <e@80x24.org>
+	* hash.c (hash_each_with_index): removed.  use Enumerable's
+	  each_with_index instead.
 
-	* test/ruby/test_autoload: hoist out ruby_impl_require
+	* class.c (rb_include_module): check for super modules, since
+ 	  module's included modules may be changed.
 
-Thu Nov  5 13:03:58 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Apr 17 21:50:47 1998  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
 
-	* defs/id.def (token_ops): gather associations between IDs,
-	  operators, and parser tokens.
+	* marshal.c (r_long): r_byte() may return signed byte.
 
-Thu Nov  5 10:17:17 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Apr 17 11:58:30 1998  NAGAI Hidetoshi  <nagai@dumbo.ai.kyutech.ac.jp>
 
-	* ext/socket/socket.c (make_addrinfo): use RARRAY_ASET for
-	  write-barrier.
+	* ext/tcltklib/tcltklib.c (lib_mainloop): thread and interrupt check.
 
-	* ext/tk/tcltklib.c ({call,eval,invoke}_queue_handler): ditto.
+Fri Apr 17 11:06:30 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* ext/tk/tkutil/tkutil.c (ary2list, ary2list2): ditto.
+	* eval.c (find_file): try to fopen() to check whether file exists.
 
-Thu Nov  5 10:09:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ruby.c (load_file): ditto.
 
-	* ext/**/*.c: prefer RARRAY_AREF to indexing RARRAY_CONST_PTR.
-	  pointed out by hanmac.
-	  https://github.com/ruby/ruby/commit/3553a86#commitcomment-14187670
+	* struct.c (struct_aset): struct member can be set by member name.
 
-Wed Nov  4 17:33:24 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+Fri Apr 17 00:47:19 1998  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
 
-	* lib/debug.rb: Add documentation for #thread_list_all.
-	  [Misc #11580][ci skip]
+	* ext/extmk.rb.in: added m68k-human support
 
-Wed Nov  4 15:45:59 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* file.c (LOCK_SH): defines moved.
 
-	* class.c: fix documentation for rb_define_class{_id}_under.
-	  [fix GH-991][ci skip] Patch by @kachick
+	* array.c (ary_flatten_bang): simplified loop.
 
-Wed Nov  4 15:40:45 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+Thu Apr 16 16:52:01 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* method.h: fix typo. Patch by @davydovanton
-	  [fix GH-1076][ci skip]
+	* experimental release 1.1b9_11.
 
-Wed Nov  4 15:39:32 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* lib/tk.rb: thread support (experimental - maybe slow).
 
-	* hash.c: use correct grammer. Patch by @tveastman
-	  [fix GH-1079][ci skip]
+	* eval.c (rb_longjmp): trace event on exception in raising
+ 	  context, just before raising exception.
 
-Wed Nov  4 11:38:23 2015  Jake Worth  <jakeworth82@gmail.com>
+	* struct.c (struct_s_members): forgot to check singletons.
 
-	* process.c (proc_getsid): [DOC] Fix double word 'for' and typo.
-	  [Fix GH-1080]
+	* struct.c (struct_aref): members can be accessed by names too.
 
-Wed Nov  4 06:01:52 2015  Eric Wong  <e@80x24.org>
+	* array.c (ary_flatten): new method.
 
-	* include/ruby/ruby.h (struct RObject): hide iv_index_tbl type
-	  [ruby-core:71306] [Feature #11647]
+	* eval.c (rb_longjmp): prints exception information with `-d'.
 
-Tue Nov  3 06:48:58 2015  Eric Wong  <e@80x24.org>
+	* object.c (any_to_s): remove class name restriction.
 
-	* variable.c (find_class_path): remove cast for rb_class_ivar_set
-	  (rb_ivar_set): ditto
-	  (rb_cvar_set): ditto
+Thu Apr 16 01:38:02 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Tue Nov  3 06:18:21 2015  Eric Wong  <e@80x24.org>
+	* file.c (thread_flock): do not block other threads.
 
-	* variable.c (rb_global_tbl): convert to id_table
+	* eval.c (thread_trap_eval): signals are now delivered to the
+ 	  current thread again.  In case that the current thread is dead,
+ 	  signals are forwarded to the main thread.
 
-Tue Nov  3 01:58:46 2015  Naohisa Goto  <ngotogenome@gmail.com>
+	* string.c (str_new4): need not to duplicate frozen strings.
 
-	* parse.y (NO_QCALL): fix type mismatch of operands that causes
-	  compile error with Oracle Solaris Studio on Solaris.
-	  [Bug #11645] [ruby-dev:49327]
+Wed Apr 15 08:33:47 1998  Tadayoshi Funaba  <tadf@kt.rim.or.jp>
 
-Sun Nov  1 17:14:36 2015  Koichi Sasada  <ko1@atdot.net>
+	* struct.c (struct_inspect): remove restriction for struct names.
 
-	* id_table.c (mix_id_table_insert): do not touch list during
-	  list->hash transition because GC can run during transition.
+Wed Apr 15 02:55:02 1998  Kazuya 'Sharl' Masuda  <sharl@www.ufo.co.jp>
 
-Sun Nov  1 11:07:31 2015  Eric Wong  <e@80x24.org>
+	* x68 patches to config.sub, ext/extmk.rb.in
 
-	* iseq.c (iseq_memsize): account for rb_call_cache entries
+Wed Apr 15 01:22:56 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Sun Nov  1 09:12:10 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* string.c (str_dup_frozen): do not duplicate frozen strings.
 
-	* parse.y (parser_yylex): ':' separated by a comment and a newline
-	  is not valid as symbol.
+	* parse.y (yylex): allow nested parenthesises.
 
-Sat Oct 31 20:15:48 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* io.c (obj_displayln): prints newline after `display'ing the
+	  receiver.
 
-	* test/openssl/test_pair.rb: skipped tests if openssl doesn't support
-	  ECDH cipher.
+	* io.c (io_puts): avoid generating "\n" each time.  use RS_default
+ 	  instead.
 
-Sat Oct 31 14:58:10 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* io.c (f_p): ditto.
 
-	* man/ruby.1 (SYNOPSIS): remove extraneous space for -F option as
-	  it does not allow spaces before its argument.
-	  [ruby-core:71283] [Bug #11641]
+Tue Apr 14 22:18:17 1998  Tadayoshi Funaba  <tadf@kt.rim.or.jp>
 
-Sat Oct 31 14:58:01 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* struct.c (struct_aref): should not subtract negative index.
 
-	* man/ruby.1 (SYNOPSIS): remove extraneous space for -F option as
-	  it does not allow spaces before its argument.
-	  [ruby-core:71283] [Bug #11641]
+Tue Apr 14 11:34:50 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Sat Oct 31 10:22:49 2015  yui-knk  <spiketeika@gmail.com>
+	* experimental release 1.1b9_10.
 
-	* eval_error.c (undef_mesg_for): fix typo.  Before this commit
-	  `ArgumentError: malformed format string - %$` was raised when
-	  `NameError#message` is called.  [ruby-core:71282] [Bug #11640]
-	  [Fix GH-1077]
+	* parse.y: token names prefixed by `t'.
 
-Fri Oct 30 21:12:45 2015  Kazuki Tsujimoto  <kazuki@callcc.net>
+	* struct.c (struct_s_def): supports subclassing of Struct.
 
-	* gems/bundled_gems: update to power_assert 0.2.5.
+	* io.c (io_s_new): supports subclassing of IO.
 
-Fri Oct 30 19:29:52 2015  Koichi Sasada  <ko1@atdot.net>
+Mon Apr 13 11:07:39 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* gc.c (newobj_slowpath): do not need to use flags hack (commit miss).
+	* eval.c (f_binding): need to restore method name.
 
-Fri Oct 30 19:08:48 2015  Koichi Sasada  <ko1@atdot.net>
+	* eval.c (rb_call0): raises SystemStackError, not Fatal.
 
-	* gc.c (heap_get_freeobj_from_next_freepage): not so UNLIKELY.
+	* io.c (obj_display): same as `print self'.
 
-Fri Oct 30 18:09:51 2015  Koichi Sasada  <ko1@atdot.net>
+	* io.c (f_p): can now be called in the method form.
 
-	* gc.c (newobj_slowpath): reduce 1 parameter to use only registers
-	  for performance.
+	* re.c (reg_regsub): needed to be mbchar aware.
 
-	  On my laptop, 'N.times{x = []}' (where N = 29_000_000) is
-	  1.86 sec -> 1.74 sec.
+Mon Apr 13 13:18:32 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Fri Oct 30 12:53:21 2015  yui-knk  <spiketeika@gmail.com>
+	* eval.c (thread_trap_eval): all signals delivered to main_thread.
 
-	* test/ruby/test_call.rb: added test for safe navigation operator.
-	  [fix GH-1066]
+Mon Apr 13 12:47:03 1998  TAKAHASHI Masayoshi  <maki@inac.co.jp>
 
-Fri Oct 30 12:47:34 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* re.c (kcode_set_option): did not set SJIS on SJIS condition.
 
-	* ChangeLog: fix wrong commit name.
+Sun Apr 12 22:14:07 1998  Kazunori NISHI  <kazunori@swlab.csce.kyushu-u.ac.jp>
 
-Fri Oct 30 12:36:16 2015  yui-knk  <spiketeika@gmail.com>
+	* array.c (ary_uniq_bang): should be `==', not `='. embarrassing.
 
-	* vm_method.c: added documentation of protected/private methods.
-	  [fix GH-1072]
-	* test/ruby/test_module.rb: added testcase for method_defined?
-	  [fix GH-1071]
+Sat Apr 11 02:13:30 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Fri Oct 30 12:06:59 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* array.c (ary_subseq): SEGVed for `[][1,1]'.
 
-	* variable.c (rb_class_ivar_set): rename as class specific ivar
-	  setter, and st_table is no longer involved.
+Fri Apr 10 21:29:06 1998  Tadayoshi Funaba  <tadf@kt.rim.or.jp>
 
-Fri Oct 30 11:36:33 2015  Eric Wong  <e@80x24.org>
+	* array.c (ary_subseq): add check for beg larger than array length.
 
-	* variable.c (generic_ivar_remove): adjust type, set valp
-	  (rb_obj_remove_instance_variable): simplify call
-	* test/ruby/test_object.rb (test_remove_instance_variable):
-	  expand for implementation details
+Wed Apr  8 17:24:11 1998  MAEDA shugo  <shugo@po.aianet.ne.jp>
 
-Fri Oct 30 10:37:56 2015  Eric Wong  <e@80x24.org>
+	* dir.c (dir_s_open): can be called with block (like IO#open).
 
-	* internal.h (rb_st_insert_id_and_value): update prototype
-	* variable.c (rb_st_insert_id_and_value): reduce args
-	  (find_class_path): adjust call for less args
-	  (rb_ivar_set): ditto
-	  (rb_cvar_set): ditto
-	* class.c (rb_singleton_class_attached): ditto
+	* dir.c (dir_s_chdir): print directory path on error.
 
-Fri Oct 30 09:57:22 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* dir.c (dir_s_chroot): ditto
 
-	* gems/bundled_gems: update latest gems.
-	  test-unit-3.1.5 and minitest-5.8.2
+	* dir.c (Init_Dir): needed to override `new'.
 
-Fri Oct 30 09:54:05 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+Thu Apr  9 18:24:58 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* lib/rubygems: Update to RubyGems HEAD(60d7972).
-	  this version contains pull requests number of #1343, #1356, #1357, #1363
-	  at https://github.com/rubygems/rubygems/pulls
-	* test/rubygems: ditto.
+	* experimental release 1.1b9_09.
 
-Fri Oct 30 07:38:29 2015  Koichi Sasada  <ko1@atdot.net>
+	* string.c (str_cmp): do not depend on sentinel at the end of the
+	  strings. 
 
-	* insns.def (getinlinecache/setinlinecache): compare ic->ic_cref and
-	  current cref only when cached CREF list includes singleton class.
+	* string.c (str_chomp_bang): forgot to set the sentinel.
 
-	  Singleton classes have own namespaces, so that we need to check
-	  cref as a key (#10943).
+Wed Apr  8 00:59:13 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	  However, if current CREF list does not include singleton class,
-	  no need to check CREF because it should be same name space.
+	* bignum.c (big2int): converted int may be too big to fit in
+	  signed int.
 
-	* vm_insnhelper.c (vm_get_const_key_cref): add a function returns
-	  CREF only when it includes singleton class.
+	* parse.y (arg): `foo += 1' should not cause an error.
 
-	* vm_core.h: constify iseq_inline_cache_entry::ic_cref.
+	* variable.c (rb_const_defined): returned false even if the
+	  constant is defined at the top level.
 
-Fri Oct 30 06:43:50 2015  Koichi Sasada  <ko1@atdot.net>
+	* eval.c (f_local_variables): dyna_var->id may be null.  should
+	  have checked before calling str_new2().
 
-	* vm_insnhelper.c (vm_env_cref): make it inline for performance.
+Tue Apr  7 01:15:15 1998  Kaneko Naoshi  <wbs01621@mail.wbs.or.jp>
 
-	* vm_insnhelper.c (rb_vm_get_cref): use NULL instead of 0.
+	* re.c (reg_regsub): need to check string boundary.
 
-Fri Oct 30 06:20:40 2015  Koichi Sasada  <ko1@atdot.net>
+Tue Apr  7 19:19:12 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* insns.def: nobody set ic->ic_value.value to Qundef.
+	* string.c (str_cmp): returns either 1, 0, -1.
 
-Fri Oct 30 06:15:50 2015  Koichi Sasada  <ko1@atdot.net>
+	* array.c (ary_cmp): should check array length, too
 
-	* vm.c: add ifndef guard for VM_CHECK_MODE.
+Tue Apr  7 18:50:16 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Fri Oct 30 06:13:10 2015  Koichi Sasada  <ko1@atdot.net>
+	* experimental release 1.1b9_08.
 
-	* vm_insnhelper.c (vm_check_frame_detail): should require me for
-	  VM_FRAME_FLAG_BMETHOD type frame.
+Tue Apr  7 18:31:27 1998  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
 
-Thu Oct 29 18:42:30 2015  Koichi Sasada  <ko1@atdot.net>
+	* instruby.rb (mandir): dll installation for cygwin32
 
-	* gc.c (gc_mark_ptr): specify NOINLINE so that gc_mark() can return
-	  immediately when obj is not a markable object.
+Tue Apr  7 01:16:45 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Thu Oct 29 18:05:22 2015  Koichi Sasada  <ko1@atdot.net>
+	* config.sub (maybe_os): TOWNS support?
 
-	* encoding.c (rb_enc_check_str): add for performance.
-	  This function only accepts T_STRING (and T_REGEXP).
+	* config.guess: too strict check for libc versions on linuxes.
 
-	  This patch improves performance of a tiny_segmenter benchmark
-	  (num=2) 2.54sec -> 2.42sec on my machine.
-	  https://github.com/chezou/TinySegmenter.jl/blob/master/benchmark/benchmark.rb
+	* experimental release 1.1b9_07.
 
-	* encoding.c: add ENC_DEBUG and ENC_ASSERT() macros.
+	* array.c (ary_cmp): compare each element using `<=>'.
 
-	* internal.h: add a decl. of rb_enc_check_str().
+	* hash.c (hash_each_with_index): yields [value, key] pair.
 
-	* string.c (rb_str_plus): use rb_enc_check_str().
+	* class.c (class_protected_instance_methods): list protected
+	  method names.
 
-	* string.c (rb_str_subpat_set): ditto.
+	* class.c (ins_methods_i): exclude protected methods.
 
-Thu Oct 29 17:16:40 2015  Koichi Sasada  <ko1@atdot.net>
+	* eval.c (PUSH_BLOCK): dynamic variables can be accessed from
+ 	  eval() with bindings.
 
-	* internal.h: export rb_wb_(un)protected_newobj_of()
-	  because some extensions include internal.h.
+Mon Apr  6 14:49:06 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Thu Oct 29 16:42:19 2015  Koichi Sasada  <ko1@atdot.net>
+	* eval.c (thread_yield): must return evaluated value.
 
-	* gc.c (rb_imemo_new): should not pass FL_WB_PROTECTED flag.
+Fri Apr  3 13:07:29 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* gc.c (rb_wb_protected_newobj_of): add more assertions.
+	* eval.c (thread_schedule): context switch bypassed on wrong
+	  conditions.
 
-	* gc.c (rb_wb_unprotected_newobj_of): ditto.
+	* variable.c (rb_name_class): set classname by id before String
+ 	  class is initialized (1.0 behavior restored).
 
-Thu Oct 29 16:20:26 2015  Koichi Sasada  <ko1@atdot.net>
+Fri Apr  3 11:25:45 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* gc.c: introduce rb_wb_unprotected_newobj_of() and
-	  rb_wb_protected_newobj_of(), pass the WB_PROTECTED
-	  information explicitly.
+	* numeric.c (num2int): no implicit conversion from string.
 
-	* internal.h: use introduced functions by NEWOBJ_OF().
-	  `flag' is immediate value, so that C compilers can
-	  solve them at compile time.
+	* numeric.c (num2int): check whether `to_i' returns an Integer.
 
-	* include/ruby/ruby.h: add a comment about that.
+	* numeric.c (num_zero_p): new method.
 
-Thu Oct 29 14:52:03 2015  Koichi Sasada  <ko1@atdot.net>
+	* numeric.c (num_nonzero_p): new method.  returns the receiver if
+ 	  it's not zero.
 
-	* gc.c: add rb_objspace::flags::has_hook to represent hook availability.
+	* eval.c (obj_instance_eval): the_class should be the object's
+	  singleton class.
 
-	* gc.c: add gc_event_hook_available_p(objspace) to check that flag.
+	* error.c (exc_s_new): message is converted into a string.
 
-	* gc.c (newobj_of): use gc_event_hook_available_p() instead of
-	  checking gc_event_hook_needed_p(objspace, RUBY_INTERNAL_EVENT_NEWOBJ).
-	  for performance.
+Thu Apr  2 18:31:46 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* gc.c (newobj_init): add UNLIKELY() for FL_WB_PROTECTED flag.
+	* eval.c (obj_call_init): every object call `initialize'.
 
-	* gc.c (newobj_init): change parameters order (trivial change).
+Wed Apr  1 08:51:53 1998  Tadayoshi Funaba  <tadf@kt.rim.or.jp>
 
-Thu Oct 29 14:45:15 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* parse.y (stmt): UNTIL_MOD should be for stmt, not only for expr.
 
-	* vm_core.h (rb_thread_struct): move forward declarations before
-	  used.
+Wed Apr  1 01:20:31 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Thu Oct 29 14:07:54 2015  Koichi Sasada  <ko1@atdot.net>
+	* object.c (true_and): boolean operators &, | and ^.
 
-	* gc.c (gc_mark_ptr): remove debug code for #11244.
+Tue Mar 31 13:23:58 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Thu Oct 29 10:08:33 2015  Eric Wong  <e@80x24.org>
+	* array.c (ary_compact_bang): returns nil, if it does not modify
+	  the array like String's bang methods.
 
-	* variable.c (struct autoload_state): usable as wait-queue head
-	  (struct autoload_data_i): remove 2 words of overhead
-	  (autoload_i_mark): remove marking for thread
-	  (autoload_reset): adjust for struct changes
-	  (rb_autoload): ditto
-	  (rb_autoloading_value): ditto
-	  (rb_autoload_load): ditto
-	  (const_update): ditto
+	* array.c (ary_uniq_bang): new method to remove duplicate items.
 
-Thu Oct 29 08:48:05 2015  Eric Wong  <e@80x24.org>
+	* eval.c (bind_s_new): new method.
 
-	* variable.c (struct autoload_data_i): add waitq_head
-	  (struct autoload_state): new struct
-	  (autoload_require): save result in autoload_state for use
-	    in autoload_reset
-	  (autoload_reset): wake up other waiters with open-coded
-	    wait-queues
-	  (rb_autoload_load): add ensure autoload_const_set happens
-	    atomically w.r.t. autoload-triggered "require"
-	  [ruby-core:70075] [ruby-core:71239] [Bug #11384]
+	* numeric.c (num2int): raise exception if Fixnums too big to
+ 	  convert into `int' in case that sizeof(int) < sizeof(INT).
 
-Wed Oct 29 00:39:50 2015  Naohisa Goto  <ngotogenome@gmail.com>
+	* string.c (str_center): SEGV on negative width.
 
-	* test/rubygems/test_gem_commands_server_command.rb
-	  (test_handle_options_port): change port from http to discard.
-	  Solaris does not include "http 80/tcp" in its default
-	  /etc/inet/services. AFAIK, discard (9/tcp) is older than http
-	  and it is expected that all OS can resolve the service name.
-	  [Bug #10004] [ruby-core:63518]
+	* eval.c (eval): forgot to set sourcefile.
 
-Wed Oct 28 23:52:48 2015  Naohisa Goto  <ngotogenome@gmail.com>
+Mon Mar 30 11:12:29 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* probes_helper.h (RUBY_DTRACE_HOOK): add RB_GC_GUARD, though paranoic.
+	* file.c (f_test): raises exception for unkown command.
 
-Wed Oct 28 15:36:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* eval.c (Init_eval): `class_eval': alias to the module_eval.
 
-	* error.c (rb_name_err_new): store the receiver directly.
+Mon Mar 30 18:50:42 1998  Tadayoshi Funaba  <tadf@kt.rim.or.jp>
 
-	* error.c (name_err_receiver): return directly stored receiver.
-	  [Feature #10881]
+	* string.c (str_capitalize_bang): did not check string modification.
 
-	* error.c (name_err_mesg_to_str): quote the name if unprintable.
+	* string.c (str_delete_bang): wrong conversion.
 
-	* object.c (check_setter_id): use rb_check_id to convert names.
+	* string.c (str_intern): typo in error message.
 
-	* variable.c (uninitialized_constant): use NameError::message to
-	  keep the receiver of uninitialized constant.  [Feature #10881]
+Mon Mar 30 01:44:13 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* error.c (rb_name_err_new): new function to create NameError
-	  exception instance.  [Feature #10881]
+	* eval.c (obj_instance_eval): accepts block as evaluation body.
+	  No compilation needed each time.
 
-Wed Oct 28 13:29:39 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* eval.c (mod_module_eval): ditto
 
-	* parse.y (new_attr_op_assign): fix op_assign type, which is
-	  already an ID since r52284.  [Feature #11537]
+	* file.c (file_s_umask): umask did not return old values, if no
+ 	  argument given.
 
-Tue Oct 27 23:14:14 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sun Mar 29 00:54:23 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* defs/id.def: enable anonymous IDs not to expose internal IDs for
-	  frozen-string-literal-debug by Marshal.dump.
+	* eval.c (f_throw): nil returned always.
 
-Tue Oct 27 17:06:55 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Mar 28 20:40:12 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* defs/id.def: move internal IDs for frozen-string-literal-debug.
+	* experimental release 1.1b9_06.
 
-Tue Oct 27 16:41:05 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Mar 28 16:07:11 1998  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
 
-	* error.c (rb_error_frozen_object): use rb_attr_get instead of
-	  rb_ivar_get to get rid of warnings for string objects created
-	  when frozen-string-literal-debug is disabled.
+	* io.c (io_closed): should not cause exception fot closed IO.
 
-Tue Oct 27 16:18:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* string.c (str_tr): returned nil for success.
 
-	* lib/logger.rb (Logger::Period#previous_period_end): as weekly
-	  rotation shifts the log file on Sundays, the end date of the
-	  previous period should be Saturdays.  fix r45072.
-	  [ruby-dev:49314] [Bug #11622]
+Sat Mar 28 00:47:19 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Tue Oct 27 16:12:37 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+	* eval.c (f_local_variables): new method to return an array of
+ 	  local variable names.
 
-	* vm_dump.c (rb_print_backtrace): our addr2line doesn't work on sparc.
-	  http://rubyci.s3.amazonaws.com/unstable11s/ruby-trunk/log/20151027T043311Z.log.html.gz
+	* variable.c (obj_instance_variables): now returns an array of
+	  variable names, as described in the reference.
 
-Tue Oct 27 12:00:33 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* eval.c (rb_attr): honors default method visibility of the
+	  current scope.
 
-	* lib/logger.rb (Logger::Period#next_rotate_time): get rid of
-	  adding to mday not to exceed the days of the month.
-	  [ruby-core:71185] [Bug #11620]
+Fri Mar 27 13:49:27 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Mon Oct 26 22:43:03 2015  yui-knk  <spiketeika@gmail.com>
+	* experimental release 1.1b9_05.
 
-	* test/ruby/test_module.rb (test_method_defined): Add test cases
-	  for `public/protected/private _method_defined?`
-	  These methods accept string as argument, so add string argument
-	  cases.  [Fix GH-1067]
+	* ruby.c (ruby_prog_init): `site_ruby' added to load_path.
 
-Mon Oct 26 22:23:30 2015  SimonDKnight  <simondknight@hotmail.com>
+	* ruby.c (ruby_prog_init): load-path order changed.  Paths in
+ 	  the RUBYLIB environment variable comes first in non-tainted
+ 	  mode.
 
-	* lib/racc/rdoc/grammar.en.rdoc: Grammatical errors fixed.
-	  [Fix GH-1070]
+Thu Mar 26 11:51:09 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Mon Oct 26 18:36:43 2015  Shota Fukumori (sora_h) <her@sorah.jp>
+	* eval.c (rb_call): new feature: `protected' methods.
 
-	* vm_method.c(rb_method_entry_make):
-	  [DOC] [ci skip] Remove a needless space from comment
-	  [Fixes GH-1069] Patch by @yui-knk
+	* string.c (str_dump): new method.
 
-Mon Oct 26 17:30:13 2015  Ryan Hosford  <tad.hosford@gmail.com>
+	* eval.c (block_pass): block argument can be nil, which means no
+	  block is supplied for the method.
 
-	* lib/fileutils.rb: rename tailing to trailing.
-	  [Misc #11548]
+Wed Mar 25 21:20:13 1998  Tadayoshi Funaba  <tadf@kt.rim.or.jp>
 
-Mon Oct 26 17:11:53 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* string.c (str_reverse_bang): string copied to wrong place.
 
-	* parse.y (call_op, call_op2): fix values on ripper.  [Feature #11537]
+Wed Mar 25 08:12:07 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Mon Oct 26 12:55:06 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* numeric.c (flo_modulo): caused SEGV if left operand is not a
+ 	  float value.
 
-	* parse.y (call_op2): separate from call_op and also allow "::",
-	  while dot_or_colon should not allow ".?".  [Feature #11537]
+	* eval.c (f_eval): optional third and fourth argument to specify
+	  file-name and line-number.
 
-Mon Oct 26 01:03:23 2015  Rei Odaira  <Rei.Odaira@gmail.com>
+	* eval.c (eval): file-name and line-number set properly.
 
-	* thread_pthread.c: fix compile errors when
-	  USE_SLEEPY_TIMER_THREAD is disabled.
+	* parse.y (assign_in_cond): literal assignment is now warning, not 
+	  compile error.
 
-Sun Oct 25 10:12:05 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* error.c (Warn): Warn() always print message, OTOH Waring()
+	  prints when verbose flag is set.
 
-	* symbol.c (op_tbl): add DOTQ for ripper.  [Feature #11537]
+Tue Mar 24 12:50:06 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Sat Oct 24 22:51:18 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* ruby.c (ruby_prog_init): `.' should come last in the load-path.
 
-	* configure.in: fixed build failure of Haiku.
-	  [fix GH-984] Patch by @kallisti5
-	* ext/socket/getaddrinfo.c: ditto.
-	* ext/socket/getnameinfo.c: ditto.
-	* ext/socket/rubysocket.h: ditto.
+	* eval.c (Init_eval): `__send__', alias for `send'.
 
-Sat Oct 24 21:16:53 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon Mar 23 12:44:12 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* test/fileutils/test_fileutils.rb (test_uptodate): relax error
-	  message format.  [Feature #9025], [ruby-core:71178] [Bug #11617]
+	* string.c (str_chomp_bang): now takes `rs' as an argument.
 
-Sat Oct 24 21:06:43 2015  Shota Fukumori (sora_h)  <her@sorah.jp>
+	* eval.c (thread_free): main_thread should not be freed.
 
-	* lib/mkmf.rb: Revert r45640 because it may lead to link
-	  with different libruby. [Bug #9760]
+Fri Mar 20 16:40:34 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Sat Oct 24 15:42:20 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* string.c (str_chomp_bang): chomp! (and other ! methods) returns
+ 	  nil if it does not modify the string.
 
-	* bootstraptest/test_method.rb: relax error message format.
+	* string.c (str_sub_iter_s): should check last pattern since it
+ 	  may be matched to null.
 
-	* test/ruby/test_arity.rb (err_mess): ditto.
-	  [Feature #9025], [ruby-core:71178] [Bug #11617]
+Thu Mar 19 13:48:55 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Sat Oct 24 12:47:47 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* experimental release 1.1b9_04.
 
-	* vm_insnhelper.c: improved error message for "wrong number
-	  of arguments", distinguishing given and expected argument
-	  numbers clearly. [Feature #9025]
+	* parse.y (yylex): `10e0.9' should cause syntax error.
 
-Sat Oct 24 11:57:59 2015  Shugo Maeda  <shugo@ruby-lang.org>
+Wed Mar 18 17:46:31 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* vm_insnhelper.c: remove the typedef redeclaration of
-	  vm_call_handler.
+	* ruby.c (load_file): new file object constant DATA.  Only
+	  available for the script from the file.
 
-Sat Oct 24 07:29:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* regex.c (re_match): forwading failure point popped too much. 
 
-	* lib/forwardable.rb (def_instance_delegator, def_single_delegator):
-	  match backtraces against ::Forwardable in case the target class
-	  is a subclass of BasicObject and does not include Kernel.
-	  [ruby-core:71176] [Bug #11616]
+Tue Mar 17 18:23:06 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Sat Oct 24 04:10:13 2015  Koichi Sasada  <ko1@atdot.net>
+	* math.c (math_frexp): newly added.
 
-	* iseq.c (make_compile_option_value): include frozen_string_literal*
-	  in a made option value.
+	* math.c (math_ldexp): ditto.
 
-	* vm_opts.h: forgot to add OPT_FROZEN_STRING_LITERAL_DEBUG
-	  at last commit.
+	* bignum.c (bigdivmod): calculates modulo.
 
-Sat Oct 24 03:58:02 2015  Koichi Sasada  <ko1@atdot.net>
+	* numeric.c (fix_remainder): returns reminder, formerly introduced
+ 	  as modulo.
 
-	* ruby.c: introduce --enable-frozen-string-literal-debug option.
-	  If this option is enabled, the modify error will be:
-	    can't modify frozen String (RuntimeError) =>
-	    can't modify frozen String, created at test.rb:3 (RuntimeError)
+	* numeric.c (fix_modulo): calculates proper `modulo'.
 
-	* iseq.h: add compile option frozen_string_literal_debug.
+	* bignum.c (bigdivmod): wrong sign for reminder.
 
-	* compile.c: catch up this fix.
+Mon Mar 16 17:07:28 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* error.c (rb_error_frozen): ditto.
+	* experimental release 1.1b9_03.
 
-	* iseq.c (set_compile_option_from_hash): ditto.
+Mon Mar 16 16:33:53 1998  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
 
-	* test/ruby/test_rubyoptions.rb: add a test for this fix.
+	* io.c (pipe_finalize): needed to add pipe_finalize to pipes on
+	  cygwin32.
 
-Sat Oct 24 02:02:24 2015  Koichi Sasada  <ko1@atdot.net>
+Mon Mar 16 14:11:06 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* vm_insnhelper.c: introduce new call handler for simple ISeqs.
+	* class.c (ins_methods_i): needed to consider NOEX_UNDEF.
 
-	  vm_call_iseq_setup_normal_0start() is simple, however it has
-	  some loops/conditions depends on ISeq::param.size and
-	  ISeq::local_size (in vm_push_frame(), inlined into this function).
+Mon Mar 16 13:23:53 1998  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
 
-	  There are many simple methods which has a few parameters and local
-	  variables. So that this patch introduces several special functions
-	  generated in vm_call_iseq_optimized.inc by
-	  tool/mk_call_iseq_optimized.rb.
+	* io.c (io_check_closed): check for `fptr->f2 == NULL'.
 
-	  This script makes
-	    vm_call_iseq_setup_normal_0start_Xparams_Ylocals()
-	  where X is 0 to 3 and Y is 1 to 6 (as current setting).
-	  In this case, X * Y = 24 functions are created.
+	* io.c (io_fptr_close): ditto.
 
-	  These functions creates fast method dispatch by inlining
-	  vm_push_frame() with immediate params/locals sizes.
+Mon Mar 16 11:49:25 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	  On my laptop, we can have the following results.
+	* io.c (pipe_atexit): free()ing referencing pipe_list.
 
-	  vm2_method*       1.083 (8.3% faster)
-	  vm2_poly_method*  0.961 (3.4% slower)
+	* range.c (range_length): returns zero, if the first is greater
+	  than the last.
 
-	  It shows 8.3% faster for inner loop method dispatch (hit inline
-	  cache), but 3.4% slower when inline cache miss because we need
-	  to find a suitable call handler.
+	* signal.c (trap_restore_mask): restore signal mask before raising 
+	  exceptions and throws.
 
-	* common.mk: add a rule for vm_call_iseq_optimized.inc.
+Fri Mar 13 13:49:24 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* tool/mk_call_iseq_optimized.rb: added.
+	* experimental release 1.1b9_02.
 
-	* vm.c: include vm_call_iseq_optimized.inc.
+	* object.c (mod_clone): need to dups constants and instance
+	  variables.
 
-Sat Oct 24 01:58:50 2015  Koichi Sasada  <ko1@atdot.net>
+	* eval.c (rb_eval): forgot to initialize body for NODE_DEFS.
 
-	* vm_core.h: define vm_call_handler.
+	* eval.c (rb_eval): retrieve self from calling frame, since self
+	  changes sometimes.
 
-Sat Oct 24 01:56:01 2015  Koichi Sasada  <ko1@atdot.net>
+	* env.h (FRAME): need to save self in the calling frame.
 
-	* vm_core.h, vm_insnhelper.h: move definition of VMDEBUG
-	  from vm_insnhelper.h to vm_core.h.
+	* io.c (f_gets_method): rs should be initialized by RS.
 
-Sat Oct 24 01:51:01 2015  Akinori MUSHA  <knu@iDaemons.org>
+Thu Mar 12 15:33:57 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* NEWS: [DOC] In the new safe call syntax, arguments are evaluated
-	  only if a call is made.
+	* experimental release 1.1b9_01.
 
-	* doc/syntax/calling_methods.rdoc: Fix a typo.
+	* range.c (range_s_new): check values by `first <= last'.
 
-Sat Oct 24 00:38:34 2015  Shugo Maeda  <shugo@ruby-lang.org>
+	* parse.y (lastline_set): fixed offset for $_ and $~ in the local
+	  variable space.
 
-	* lib/forwardable (def_instance_delegator, def_single_delegator):
-	  rescue ::Exception instead of Exception in case Exception is
-	  defined under the target class.
-	  [ruby-core:71175] [Ruby trunk - Bug #11615]
+Wed Mar 11 02:14:17 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Fri Oct 23 21:10:37 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* io.c (io_gets): handle normal case specially for speed.
 
-	* error.c (name_err_mesg_to_str): separate class names from the
-	  receiver description.
+	* eval.c (rb_disable_super): function to disable superclass's
+	  method explicitly.
 
-	* vm_eval.c (make_no_method_exception, raise_method_missing): add
-	  format specifiers for class names.
+	* eval.c (rb_eval): inherits previous method definition's
+	  NOEX_UNDEF-ness, if exists.
 
-Fri Oct 23 18:10:32 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* class.c (rb_define_method): disables superclass's overriding
+ 	  method by default.
 
-	* .gitignore: ignored environmental wrapper files.
+Wed Mar 11 01:40:48 1998  MAEDA shugo  <shugo@po.aianet.ne.jp>
 
-Fri Oct 23 17:55:29 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* numeric.c (flo_gt,etc.): do not depend on `<=>', to handle NaN.
 
-	* lib/irb.rb: Ignored assignment of STDOUT.sync = true
-	  when irb.rb loaded. It's affected to IDE such as Jetbrain.
-	  [fix GH-864] Patch by @os97673
+Tue Mar 10 00:03:24 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Fri Oct 23 16:35:08 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* ruby.c (load_file): understands multiple options in #! line.
 
-	* lib/ipaddr.rb, test/test_ipaddr.rb: Reject invalid address contained
-	  EOL string. Patch by @kachick [fix GH-942][Bug #11513]
+	* regex.c (re_compile_pattern): support for [:alpha:] etc.
 
-Fri Oct 23 16:03:26 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+Mon Mar  9 16:53:51 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* file.c: fix indent style. [fix GH-977]
-	* test/ruby/test_string.rb: indent. [fix GH-975]
-	  [ci skip] These patches are contributed from @yui-knk
+	* io.h (GetOpenFile): embed io_check_closed in GetOpenFile.
 
-Fri Oct 23 15:46:09 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* sprintf.c (f_sprintf): zero padding failed for negative
+	  integers.
 
-	* string.c: Added method signature to include hash. It's inconsistency
-	  with `gsub` method signature.
-	  [ci skip][fix GH-1023] Patch by @danielevans
+	* sprintf.c (remove_sign_bits): failed to remove some bits.
 
-Fri Oct 23 15:25:51 2015  Shugo Maeda  <shugo@ruby-lang.org>
+Sat Mar  7 21:51:46 1998  MAEDA shugo  <shugo@po.aianet.ne.jp>
 
-	* lib/net/imap.rb: remove an empty comment line and -*-.
+	* class.c (ins_methods_i): body may be NULL for some case.
 
-Fri Oct 23 15:20:02 2015  Shugo Maeda  <shugo@ruby-lang.org>
+Fri Mar  6 17:23:07 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* lib/net/ftp.rb (gettextfile, getbinaryfile): use the safe
-	  navigation operator.
+	* regex.c (mbcinit): table driven mbchar detection.
 
-Fri Oct 23 13:51:33 2015  yui-knk  <spiketeika@gmail.com>
+	* object.c (obj_alloc): check for allocating instance for the
+	  primitive classes (mostly perfect).
 
-	* test_call.rb (test_safe_call): Add test cases for safe
-	  navigation operator assignment.  [Fix GH-1064]
-	  Validate:
-	  * can assign an attribute which is `nil`
-	  * can "or assign" an attribute which is `nil`
+	* ext/curses/curses.c (curses_finalize): restore original state at 
+	  interpreter temination.
 
-Fri Oct 23 11:58:21 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/curses/curses.c (curses_addstr): forgot to check argument
+	  type (caused SEGV).  now uses STR2CSTR() macro.
 
-	* compile.c (iseq_peephole_optimize): optimize lengthy safe
-	  navigation method chain.  [Feature #11537]
+Thu Mar  5 13:47:39 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Fri Oct 23 10:58:41 2015  Shugo Maeda  <shugo@ruby-lang.org>
+	* eval.c (block_pass): accepts method object as block args.
 
-	* lib/matrix/eigenvalue_decomposition.rb (tridiagonalize): fix
-	  indentation to avoid a warning when the command line option -w of
-	  ruby is specified.
+	* eval.c (f_missing): use any_to_s() for stringify.
 
-	* lib/matrix/eigenvalue_decomposition.rb (hessenberg_to_real_schur):
-	  change the name of a block parameter to avoid a warning when the
-	  command line option -w of ruby is specified.
+Wed Mar  4 01:39:52 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Fri Oct 23 10:49:36 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* parse.y (block_arg): new syntax - block argument in the
+	  calling arglist.
 
-	* compile.c (iseq_compile_each): support safe navigation of simple
-	  attribute assignment.  [Feature #11537]
+	* eval.c (rb_call): no module search. simplified a lot.
 
-	* parse.y (mlhs_node, lhs, attrset_gen): ditto.  keep mid
-	  non-attrset as the sign of safe navigation.
+	* eval.c (rb_eval): block arg support.
 
-Fri Oct 23 07:17:11 2015  Eric Wong  <e@80x24.org>
+	* parse.y (f_block_arg): new syntax - block argument in the
+ 	  formal arglist.
 
-	* test/io/wait/test_io_wait.rb (test_wait_eof): test return value
+Tue Mar  3 14:20:15 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Fri Oct 23 00:32:02 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+	* eval.c (obj_method): returns bound method object.
 
-	* ext/openssl/ossl_ssl.c (ssl_npn_select_cb): explicitly raise error
-	  in ext/openssl instead of OpenSSL itself because LibreSSL
-	  silently truncate the selected protocol name by casting the length
-	  from int to unsigned char. [Bug #11369]
-	  Patch by Jeremy Evans <merch-redmine@jeremyevans.net>
+	* eval.c (rb_call): argument check for empty methods.
 
-Fri Oct 23 00:49:45 2015  Shugo Maeda  <shugo@ruby-lang.org>
+	* ruby.h (NUM2CHR): new macro, originally from curses module.
 
-	* lib/un.rb (help): change the name of a block parameter to avoid
-	  a warning when the command line option -w of ruby is specified.
+Tue Mar  3 13:03:35 1998  MAEDA shugo  <shugo@po.aianet.ne.jp>
 
-Fri Oct 23 00:22:20 2015  Josef Simanek  <josef.simanek@gmail.com>
+	* io.c (io_putc): new method.
 
-	* string.c (rb_str_tr): [DOC] Escape backslash in String#tr
-	  documentation.  [Fix GH-1063]
+Tue Mar  3 11:21:28 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Fri Oct 23 00:19:04 2015  yui-knk  <spiketeika@gmail.com>
+	* string.c (str_inspect): more strict charcode detection.
 
-	* array.c (rb_ary_collect): [DOC] Fix space of code example of
-	  Array#map.  [Fix GH-1062]
+	* eval.c (thread_stop): stopping only thread raises ThreadError
+	  exception.
 
-Thu Oct 22 18:52:53 2015  Akinori MUSHA  <knu@iDaemons.org>
+Tue Mar  3 08:04:56 1998  Tadayoshi Funaba  <tadf@kt.rim.or.jp>
 
-	* vm_eval.c (rb_f_loop): When a loop is stopped by a StopIteration
-	  exception, return what the enumerator has returned instead of
-	  nil. [ruby-core:71133] [Feature #11498]
+	* struct.c (struct_alloc): imcomplete struct initialization made
+ 	  GC to access unallocated addresses.
 
-Thu Oct 22 18:25:10 2015  Shugo Maeda  <shugo@ruby-lang.org>
+Mon Mar  2 16:28:27 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* lib/net/imap.rb (idle): add a new argument timeout for keep-alive.
-	  [ruby-core:63693] [Bug #10031]
+	* eval.c (thread_stop_method): remove Thread#stop.
 
-Thu Oct 22 15:30:08 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Feb 27 18:16:26 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* compile.c (iseq_peephole_optimize): peephole optimization for
-	  branchnil jumps.
+	* version 1.1b9 released.
 
-	* compile.c (iseq_compile_each): generate save navigation operator
-	  code.
+Fri Feb 27 09:36:35 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* insns.def (branchnil): new opcode to pop the tos and branch if
-	  it is nil.
+	* hash.c (hash_delete_nil): needed to compare value to nil, since
+	  nil is the valid key for hashes.
 
-	* parse.y (NEW_QCALL, call_op, parser_yylex): parse token '.?'.
-	  [Feature #11537]
+	* hash.c (hash_foreach_iter): rehashing causes IndexError.
 
-Thu Oct 22 13:16:19 2015  Guilherme Reis Campos  <guilhermekbsa@gmail.com>
+	* hash.c (hash_foreach_iter): rehash check by pointer comparison.
 
-	* dir.c (ruby_brace_expand): glob brace expansion edge case fix.
-	  When there are closing braces '}' before a open brace '{' it
-	  must be ignored and considered as literal.
-	  [ruby-core:71138] [Bug #11609]
+Thu Feb 26 17:22:13 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Thu Oct 22 13:13:49 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* parse.y (fname): convert reswords into symbols.
 
-	* io.c (argf_next_argv): check ARGV element type, and try
-	  conversion if necessary.  [ruby-core:71140] [Bug #11610]
+	* parse.y (reswords): reserved words are now embedded in the
+ 	  syntax (sigh).
 
-Thu Oct 22 11:11:16 2015  Shugo Maeda  <shugo@ruby-lang.org>
+	* parse.y: now reserved words can be method names safely.
 
-	* test/net/ftp/test_ftp.rb: add tests for getbinaryfile and
-	  gettextfile.
+Wed Feb 25 15:50:07 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Wed Oct 21 18:34:06 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* eval.c (mod_module_eval): clear the_scope's PRIVATE flag before
+	  calling eval().
 
-	* parse.y (parser_magic_comment): allow a sole magic comment without
-	  indicators, neither other non-space comments.  [Feature #8976]
+	* gc.c (gc_call_finalizer_at_exit): run finalizers before any data 
+	  object being freed.
 
-Tue Oct 20 12:17:56 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+	* eval.c (rb_eval): needed to keep prot_tag->retval before
+	  evaluating the ensure clause.
 
-	* lib/prime.rb: Add basic argument checking to Prime.prime?
-	  [Bug #11606]
+Tue Feb 24 11:16:32 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Tue Oct 20 12:17:50 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+	* parse.y (yylex): reserved words can be appear as method names at
+ 	  right after 'def' and `.'(dot), like foo.next.
 
-	* lib/prime.rb: Optimize Integer#prime?
-	  Patch by Nick Slocum [Bug #10354]
+	* eval.c (return_check): checks for return out of thread (formerly
+ 	  done in return_value).
 
-Tue Oct 20 08:12:47 2015  Rei Odaira  <Rei.Odaira@gmail.com>
+	* eval.c (POP_TAG): copy retval to outer level.
 
-	* configure.in: pthread_getattr_np is broken on AIX.
-	  More specifically, the stack address and size returned are
-	  not correct.
+	* eval.c (return_value): just set retval, no check, no unwinding.
 
-Tue Oct 20 05:54:46 2015  Eric Wong  <e@80x24.org>
+	* parse.y (nextc): line continuation by backslash at end of line.
 
-	* ext/fiddle/closure.c (callback): static function
+	* regex.c (re_compile_pattern): forgot to clear pending_exact on
+	  closing parentheses.
 
-Mon Oct 19 10:33:46 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* parse.y (assignable): should not assign dyna_var to true, if it
+ 	  is already defined.
 
-	* ext/socket/init.c (rsock_raise_socket_error): get rid of a glibc
-	  bug.  [ruby-core:71100] [Bug #11600]
+Mon Feb 23 14:35:03 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Mon Oct 19 01:26:26 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* object.c (obj_is_kind_of): no longer accepts true/false/nil.
 
-	* file.c (rb_file_identical_p): not necessary to compare the paths after
-	  comparing the file indexes on Windows.  designate by kosaki.
+	* object.c ({true,false,nil}_to_i): can be converted into integers.
 
-Sun Oct 18 21:17:27 2015  Tanaka Akira  <akr@fsij.org>
+Mon Feb 23 12:11:51 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* lib/open-uri.rb: Specify frozen_string_literal: true.
+	* re.c (reg_s_quote): needed to be mbchar aware.
 
-Sun Oct 18 14:37:56 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+	* eval.c (proc_s_new): wrong iter mark.
 
-	* random.c (fill_random_bytes_urandom): add a comment why using
-	  O_NONBLOCK and O_NOCTTY.
+Sat Feb 21 22:59:30 1998  MAEDA shugo  <shugo@po.aianet.ne.jp>
 
-Sun Oct 18 13:24:17 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+	* io.c (f_syscall): no argument check.
 
-	* random.c (fill_random_bytes_syscall): use ATOMIC_SET() for
-	  updating try_syscall.
+Fri Feb 20 10:17:51 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Sun Oct 18 13:03:52 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+	* version 1.1b8 released.
 
-	* include/ruby/backward/util.h: Good-by Borland-C.
+	* ext/kconv/kconv.c (kconv_kconv): default output code now be
+	  determined according to the value of $KCODE.
 
-Sun Oct 18 13:03:09 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+	* re.c (rb_get_kcode): can retrieve $KCODE from C code. 
 
-	* common.mk: add a comment how to use "make test-all"
+	* parse.y (stmt): if/unless modifiers returns nil, if condition is 
+	  not established.
 
-Sun Oct 18 12:59:22 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+Thu Feb 19 11:06:47 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* common.mk: add comments how to use "make benchmark"
+	* ext/kconv/kconv.c (kconv_kconv): charcode can be specified by
+	  code name (JIS, SJIS, EUC like value of $KCODE).
 
-Sun Oct 18 12:58:15 2015  Tanaka Akira  <akr@fsij.org>
+	* regex.c (re_compile_pattern): forgot to fixup_jump for (?:..).
 
-	* lib/securerandom.rb: Specify frozen_string_literal: true.
+	* regex.c (re_compile_pattern): needed to clear pending_exact on
+	  non-registering grouping (?:...).
 
-Sun Oct 18 11:22:52 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+Wed Feb 18 19:54:21 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* dln.c: remove defined(__WATCOMC__).
+	* parse.y (here_document): needed to set lex_state to EXPR_END.
 
-Sun Oct 18 11:16:33 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+Wed Feb 18 18:45:10 1998  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
 
-	* lib/mkmf.rb: Good-by Borland-C.
+	* patches for cygwin32 applied.
 
-Sun Oct 18 11:04:36 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+Wed Feb 18 00:41:31 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* numeric.c: Good-by Borland-C.
-	* include/ruby/backward/rubyio.h: ditto.
-	* include/ruby/backward/st.h: ditto.
-	* include/ruby/backward/util.h: ditto.
-	* include/ruby/backward/rubysig.h: ditto.
-	* include/ruby/backward/classext.h: ditto.
-	* dln.c: ditto.
-	* gc.c: ditto.
-	* win32/resource.rb: ditto.
-	* win32/dir.h: ditto.
-	* ext/tk/tcltklib.c: ditto.
-	* NEWS: announce that Borland-C is no longer supported.
+	* string.c (str_sub_s): needed to be mbchar aware to increment one
+ 	  character.
 
-Sun Oct 18 10:54:52 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+	* regex.c (re_match): \Z matches newline just before the end of
+	  the string.
 
-	* dln.c: simplify #ifdef. _WIN32 and __CYGWIN__ are exclusive.
-	  see include/ruby/defines.h
-	* gc.c: ditto.
-	* ext/sdbm/_sdbm.c: ditto.
+Tue Feb 17 00:04:32 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Sun Oct 18 10:42:19 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+	* time.c (time_arg): Time.gm and Time.local now understands
+ 	  Time#to_a format.
 
-	* ruby.c (open_load_file): add a comment.
+	* string.c (str_sub_s): replace happened twice for null pattern.
 
-Sun Oct 18 10:12:46 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+	* regex.c (re_search): null pattern should not match after newline 
+	  at the end of string.
 
-	* file.c (rb_file_identical_p): simplify ifdefs
+	* time.c (time_isdst): now returns boolean value.
 
-Sun Oct 18 10:01:40 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+	* error.c (rb_check_type): treat special constants in messages.
 
-	* ChangeLog: Good-bye OS/2.
-	* common.mk: ditto.
-	* configure.in: ditto.
-	* dln_find.c: ditto.
-	* ext/Setup.emx: ditto.
-	* ext/extmk.rb: ditto.
-	* ext/socket/extconf.rb: ditto.
-	* ext/zlib/extconf.rb: ditto.
-	* file.c: ditto.
-	* include/ruby/defines.h: ditto.
-	* io.c: ditto.
-	* lib/mkmf.rb: ditto.
-	* missing/os2.c: ditto.
-	* process.c: ditto.
-	* ruby.c: ditto.
-	* NEWS: announce OS/2 is no longer supported.
+	* parse.y (yylex): new form `::Const' to see toplevel constants.
 
-Sun Oct 18 08:50:15 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+	* parse.y (cond): SEGV on `if ()'.
 
-	* include/ruby/defines.h (DOSISH): add comments.
+	* gc.c (obj_free): some data needed explicit free().
 
-Sun Oct 18 08:26:51 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+Mon Feb 16 23:55:40 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* io.c (fptr_finalize): don't release gvl if fptr is not writable.
-	  writable fd may block on close(2) when it's on NFS. But readonly
-	  fd doesn't. [Bug #11559]
-	  result: make benchmark OPTS="-p bm_require_t -e ruby-trunk -e ruby-2.2.2"
-	    build-ruby:             0.171
-	    ruby 2.3.0dev(r52151):  0.659
-	    ruby 2.2.0p95 (r50295): 0.834
+	* eval.c (blk_free): release duplicated block informations.
 
-Sun Oct 18 09:32:58 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+	* eval.c (blk_copy_prev): duplicate outer block information into
+ 	  the heap, when proc/binding created.
 
-	* file.c (ruby_is_fd_loadable): this should be fail if st_mode is
-	  not regular file nor FIFO.
+Mon Feb 16 14:38:25 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Sun Oct 18 09:20:17 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+	* time.c (time_mon): now 1 for January and so on.
 
-	* ruby.c (open_load_file): use rb_thread_wait_fd() instead of reopen.
+	* time.c (time_year): year in 19xx (no + 1900 needed anymore).
 
-Sun Oct 18 05:11:22 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+Mon Feb 16 13:28:33 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* ruby.c (open_load_file): reset O_NONBLOCK after open.
-	  Even if S_ISREG() is true, the file may be file on FUSE filesystem
-	  or something. We can't assume O_NONBLOCK is safe.
-	  Moreover, we should wait if the path is point to FIFO. That's
-	  FIFO semantics. GVL should be transparent from ruby script.
-	  Thus, just reopen without O_NONBLOCK for filling the requirements.
-	  [Bug #11060][Bug #11559]
+	* regex.c (re_compile_pattern): need to fetch mbchar's second byte
+ 	  without translation.
 
-	* ruby.c (loadopen_func): new for the above.
+Mon Feb 16 12:29:27 1998  MAEDA shugo  <shugo@po.aianet.ne.jp>
 
-	* file.c (ruby_is_fd_loadable): new. for checks loadable file type
-	  of not.
-	* file.c (rb_file_load_ok): use ruby_is_fd_loadble()
-	* internal.h: add ruby_is_fd_loadble()
+	* eval.c (f_pass_block): pass iterator block to other method.
 
-	* common.mk: now, ruby.o depend on thread.h.
+Fri Feb 13 08:16:11 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* test/ruby/test_require.rb
-	(TestRequire#test_loading_fifo_threading_success): new test.
-	  This test successful case that loading from FIFO.
+	* parse.y (parse_regx): handle \s before read_escape().
 
-	* test/ruby/test_require.rb
-	(TestRequire#test_loading_fifo_threading_raise): rename from
-	  test_loading_fifo_threading. You shouldn't rescue an exception
-	  if you test raise or not.
-	  Moreover, this case should be caught IOError because load(FIFO)
-	  should be blocked until given any input.
+	* parse.y (read_escape): `\s' in strings as space.
 
-Sat Oct 17 13:55:32 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Feb 10 17:29:08 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* file.c (rb_file_expand_path_internal): concatenate converted
-	  string to the result instead of making converted string and
-	  append it.
+	* version 1.1b7 released.
 
-	* string.c (rb_str_cat_conv_enc_opts): from rb_str_conv_enc_opts,
-	  separate function to concatenate with transcoding.
+	* string.c (str_aset): string insertion by `str[n] = str2'.
 
-Sat Oct 17 13:19:10 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* string.c (str_oct): does recognize `0x'.
 
-	* ruby.c (load_file): unify each preparations and clean-ups by
-	  merging load_file_internal and load_file_internal2, and remove
-	  nested rb_protect and rb_ensure.
+ 	* sprintf.c (f_sprintf): use baes 10 for conversion from string to
+ 	  integer.
 
-Sat Oct 17 05:28:32 2015  Rei Odaira  <Rei.Odaira@gmail.com>
+Mon Feb  9 14:51:56 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* test/ruby/test_symbol.rb (test_symbol_fstr_leak): add a warm-up
-	  code and check RSS to avoid false positive on AIX and false
-	  negative on Mac OS X. [Bug #10686]
+	* numeric.c (do_coerce): proper error message.
 
-Fri Oct 16 15:54:37 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* string.c (str_sum): bug - masked by wrong value. (sigh..)
 
-	* file.c (rb_file_load_ok): open in non-blocking mode withoout
-	  releasing GVL.  don't care about others than regular files and
-	  directories.  [ruby-dev:49272] [Bug #11559]
+Sat Feb  7 15:11:14 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* ruby.c (load_file_internal): ditto.
+	* string.c (str_empty): new method
 
-Thu Oct 15 23:56:03 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Feb  6 01:42:15 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* proc.c (rb_sym_to_proc): make void env.
+	* time.c (time_asctime): use asctime(3), not strftime(3).
 
-Thu Oct 15 13:37:23 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Feb  5 18:58:46 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* proc.c (rb_sym_to_proc): move from string.c and create a Proc
-	  with no environments.  [ruby-core:71088] [Bug #11594]
+	* io.c (io_fptr_close): do not free path on close().
 
-Thu Oct 15 01:57:03 2015  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+	* array.c (ary_filter): new method.
 
-	* test/objspace/test_objspace.rb
-	  (test_trace_object_allocations_start_stop_clear): clear object
-	  allocation table first to get rid of erroneous detection for obj3.
-	  [ruby-dev:49095] [Bug #11271]
+	* enum.c (enum_each_with_index): new method.
 
-Thu Oct 15 01:53:38 2015  Benoit Daloze  <eregontp@gmail.com>
+Thu Feb  5 14:10:35 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* test/ostruct/test_ostruct.rb: Add tests for OpenStruct#respond_to.
-	  Patch by @jeremy in [GH-1041]: https://github.com/ruby/ruby/pull/1041
+	* parse.y (primary): singleton class def can be appeared inside
+ 	  method bodies.
 
-Thu Oct 15 01:49:25 2015  Benoit Daloze  <eregontp@gmail.com>
+	* hash.c (hash_replace): replace content.
 
-	* lib/ostruct.rb: Finish defining OpenStruct attributes lazily.
-	  Patch by @sferik in [GH-1037]: https://github.com/ruby/ruby/pull/1037
-	  This commit is an addendum to https://github.com/ruby/ruby/pull/1033.
-	  It:
-	  1. lazily defines attribute accessors for copied and marshaled objects,
-	  2. returns nil when an attribute reader is not defined, and
-	  3. defines respond_to_missing? to maintain the same respond_to? behavior
+	* string.c (str_replace_method): replace content.
 
-Wed Oct 14 16:56:50 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* array.c (ary_replace_method): replace elements.
 
-	* configure.in: check for libunwind.h, which is not available in
-	  very old OS X SDK.  [ruby-core:71080] [Bug #11591]
+	* string.c (str_succ_bang): String#succ!
 
-Wed Oct 14 14:11:42 2015  Brian Black  <bblack@veracode.com>
+Thu Feb  5 18:20:30 1998  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
 
-	* iseq.c (rb_insn_operand_intern): change kw in callinfo disasm from the
-	  number of keyword arguments to an ordered list of the keywords used.
-	  [Feature #11589]
+	* string.c (str_upcase_bang): multi byte character support.
 
-Wed Oct 14 13:58:44 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Feb  4 13:55:26 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* parse.y (parser_nextc): send a warning to ripper, not to STDERR
-	  always.
+	* array.c (ary_reverse): SEGV on empty array reverse.
 
-	* parse.y (rb_warn1, rb_warning1): move argument conversions to
-	  callers.  PRIsVALUE is not valid in String#%.
+Tue Feb  3 12:24:07 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Wed Oct 14 13:37:23 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* re.c (match_to_a): non matching element should be nil.
 
-	* lib/racc/rdoc/grammar.en.rdoc: fix spell error.
-	  [fix GH-1053][ci skip] Patch by @Matrixbirds
+	* ruby.c (ruby_load_script): load script after all initialization.
 
-Tue Oct 13 22:06:50 2015  Tanaka Akira  <akr@fsij.org>
+	* bignum.c (str2inum): need to interpret prefix `0' of `0x'.
 
-	* ext/socket/raddrinfo.c (rsock_fd_family): Check sa_len.
+Tue Feb  3 10:00:18 1998  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
 
-Tue Oct 13 12:14:10 2015  Craig Davison  <craig65535@gmail.com>
+	* numeric.c (fix_rshift): use `sizeof(INT)*8' instead of 32.
 
-	* ext/socket/rsock_addrinfo (rsock_addrinfo): specify address
-	  family.  [Fix GH-1052]
+Mon Feb  2 14:09:24 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* ext/socket/udpsocket.c (udp_connect, udp_bind, udp_send):
-	  address family by the receiver.
+	* ruby.c (set_arg0): grab environment region too.
 
-Sun Oct 11 07:09:19 2015  Koichi Sasada  <ko1@atdot.net>
+Thu Jan 29 18:36:25 1998  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
 
-	* vm_insnhelper.c (vm_push_frame): initialize other than sp (and ep)
-	  first for performance.
+	* process.c (rb_proc_exec): check `sh' to be exist.
 
-Sun Oct 11 06:21:50 2015  Koichi Sasada  <ko1@atdot.net>
+Thu Jan 29 18:18:19 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* vm_eval.c, internal.h (rb_yield_1): added for performance which
-	  doesn't check Qundef.
+	* io.c (io_stdio_set): assignment to $stdin or $stdout does
+	  reopen() as well as $stderr.
 
-	* numeric.c (int_dotimes): use rb_yield_1.
+Thu Jan 29 14:18:40 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Sun Oct 11 06:19:49 2015  Koichi Sasada  <ko1@atdot.net>
+	* class.c (mod_ancestors): should not include singleton classes.
 
-	* vm_insnhelper.c (vm_call_iseq_setup_normal): setup sp first
-	  for performance.
+	* object.c (obj_type): should not return internal class.
 
-Sun Oct 11 05:29:51 2015  Koichi Sasada  <ko1@atdot.net>
+	* io.c (io_reopen): unwillingly closes stdio streams.
 
-	* vm.c (invoke_block_from_c): split this function into several
-	  functions.
+Thu Jan 29 11:50:35 1998  Toshihiko SHIMOKAWA  <toshi@csce.kyushu-u.ac.jp>
 
-	* vm_insnhelper.c (vm_yield_callee_setup_arg): remove this function
-	  because it is only delegation function.
+	* ext/socket/socket.c (udp_addrsetup): forgot to use htons().
 
-Sun Oct 11 03:48:46 2015  Koichi Sasada  <ko1@atdot.net>
+Tue Jan 27 23:15:24 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* gc.c (newobj_of_slowpass): fix typo (pass -> path).
-	  Pointed out by Yukihiro Matsumoto  <matz@ruby-lang.org>.
+	* keywords: __FILE__, __LINE__ are available again.
 
-	* gc.c (newobj_of_...): `of' is unnecessary.
+Fri Jan 23 14:19:28 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Sat Oct 10 19:04:42 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* version 1.1b6 released.
 
-	* ext/socket/udpsocket.c (udp_connect, udp_bind): get open files
-	  inside ensure functions.
+	* object.c (mod_to_s): need to duplicate classpath.
 
-Sat Oct 10 18:35:12 2015  Koichi Sasada  <ko1@atdot.net>
+	* error.c (exc_inspect): need to duplicate classpath.
 
-	* vm_insnhelper.c (vm_call_method0): do not propagate enable_fastpath,
-	  but pass dummy CC to prevent wrong caching.
+Thu Jan 22 00:37:47 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Sat Oct 10 15:28:45 2015  Koichi Sasada  <ko1@atdot.net>
+	* ruby.h (STR2CSTR): new macro to retrieve char*.
 
-	* import a github pull request
-	  https://github.com/ruby/ruby/pull/1050
-	  by Kazuho Oku <kazuho@natadeco.co>.
+	* class.c (rb_define_method): `initialize' should always be
+	  private, even if it defined by C extensions.
 
-	  This pull request has the following commits.
+	* eval.c (rb_eval): `initialize' should always be private.
 
-	* gc.c: reduce # of args to 6 (max. of register args on x86-64) so
-	  that the `newobj_of_slowpass` can be called via TCO.
+Thu Jan 22 16:21:08 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* gc.c (newobj_of), string.c (str_duplicate): for performance,
-	  the hot functions must be inlined.
+	* eval.c (rb_eval): some singleton class def cause SEGV.
 
-	* gc.c: for performance, preceding arguments of `.*newobj_of.*`
-	  must be same, so that the arg registers can be reused in case of
-	  TCO.
+	* eval.c (TMP_ALLOC): replace ALLOCA_N, where thread context
+ 	  switch may happen.
 
-Sat Oct 10 08:52:21 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Jan 21 01:43:42 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* ext/socket/udpsocket.c (udp_connect, udp_bind, udp_send): fix
-	  memory leaks at closed socket.
+	* eval.c (PUSH_FRAME): do not use ALLOCA_N().  crash on some
+	  platforms that use missing/alloca.c.
 
-Fri Oct  9 17:29:07 2015  Shugo Maeda  <shugo@ruby-lang.org>
+	* regex.c (re_compile_pattern): too many pops for non register
+	  subexpr.
 
-	* lib/net/ftp.rb (parse257): refactor.
+	* parse.y (yylex): open parentheses after identifiers are argument 
+	  list, even if whitespaces have seen.
 
-Fri Oct  9 16:42:26 2015  Shugo Maeda  <shugo@ruby-lang.org>
+Tue Jan 20 15:19:59 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* lib/net/imap.rb: use frozen_string_literal: true.
+	* parse.y (terms): quoted word list by %w(a b c).
 
-	* test/net/imap/test_imap.rb: ditto.
+	* ext/tcltklib/extconf.rb: more accurate check for tcl/tk libs.
 
-	* test/net/imap/test_imap_response_parser.rb: ditto.
+	* file.c (rb_stat): most of the FileTest methods (and function
+ 	  `test') accept File objects as the argument.
 
-Fri Oct  9 15:52:28 2015  Shugo Maeda  <shugo@ruby-lang.org>
+Tue Jan 19 18:19:24 1998  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
 
-	* lib/net/ftp.rb: use frozen_string_literal: true.
+	* ext/extmk.rb.in (install): there should be no newline after install:
 
-	* test/net/ftp/test_buffered_socket.rb: ditto.
+	* re.c (MIN): renamed from min().  there's a local variable named
+ 	  min in the file, so that some cpp will raise an error.
 
-	* test/net/ftp/test_ftp.rb: ditto.
+Mon Jan 19 16:30:05 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* test/net/ftp/test_mlsx_entry.rb: ditto.
+	* version 1.1b5 released.
 
-Fri Oct  9 14:12:35 2015  Shota Fukumori (sora_h)  <her@sorah.jp>
+	* process.c (rb_syswait): no exception raised.
 
-	* ext/openssl/lib/openssl/ssl.rb: Revert r52082 because it was
-	  dropping TLS v1.1 support too. Supporting only TLS v1.2 is too
-	  early, because many popular websites still don't support it.
+Fri Jan 16 00:43:43 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	  For instance, Servers where aws-sdk connects to still don't support
-	  TLS v1.2 and it became broken.
+	* ruby.h (CLONESETUP): copies its singleton classes too.
 
-	  We should consider more carefully about this.
+	* class.c (singleton_class_attached): saves binded object in the
+	  singleton classes.
 
-	  [Fix GH-873] [Feature #11524]
+	* eval.c (rb_eval): calls singleton_method_added even in the
+	  singleton class clauses.
 
-Fri Oct  9 12:52:08 2015  Shugo Maeda  <shugo@ruby-lang.org>
+Fri Jan 15 23:22:43 1998  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
 
-	* compile.c (iseq_compile_each): Dynamic string literals (e.g.,
-	  "#{x}") should not be frozen because they don't literally
-	  represent strings.
-	  https://twitter.com/shugomaeda/status/651937650027401216
-	  https://twitter.com/yukihiro_matz/status/651942882312482817
-	  https://twitter.com/yukihiro_matz/status/651980835181096960
+	* ruby.c (proc_options): -S does not recognize PATH.
 
-Fri Oct  9 06:52:49 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
+Thu Jan 15 02:03:12 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* benchmark/prepare_require.rb: skip file creation if it already
-	  exist. Suggested by ko1.
+	* eval.c (rb_clear_cache_by_id): clear only affected cache
+	  entries.
 
-Fri Oct  9 06:18:04 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
-	* benchmark/bm_require.rb: new benchmark for require.
-	* benchmark/bm_require_thread.rb: new benchmark for conflicting
-	  require vs thread. like [Bug #11559]
-	* prepare_require.rb: new file for preparing above tests.
-	* prepare_require.rb: ditto.
+Wed Jan 14 02:14:48 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Thu Oct  8 14:10:45 2015  Zachary Scott  <zzak@ruby-lang.org>
+	* ext/socket/socket.c: new UDP/IP socket classes.
 
-	* ext/openssl/lib/openssl/ssl.rb: Default to TLSv1.2 and drop TLS v1
-	  Patch provided by @claudijd [Fixes GH-873] [Feature #11524]:
-	  https://github.com/ruby/ruby/pull/873
+Tue Jan 13 10:00:18 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Wed Oct  7 22:55:02 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* string.c (str_cmp): ignorecase($=) works wrong.
 
-	* test/minitest/metametameta.rb (with_output): restore output to
-	  fix mixing test result output in worker responses.
+Fri Jan  9 13:19:55 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Wed Oct  7 21:32:51 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* version 1.1b4 released.
 
-	* string.c (str_duplicate): move from rb_str_resurrect to short
-	  circuit initialization.
+	* eval.c (f_missing): class name omitted from the error message.
 
-Wed Oct  7 20:43:14 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* error.c (exc_inspect): description changed.
 
-	* string.c (rb_str_resurrect): fix resurrection of short enough to
-	  be embedded but not embedded string.
+	* string.c (Init_String): GlobalExit's superclass did not filled,
+	  since GlobalExit created earlier than String.
 
-Wed Oct  7 20:17:29 2015  Koichi Sasada  <ko1@atdot.net>
+Thu Jan  8 12:10:09 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* gc.c (newobj_of): divide fast path and slow path
-	  to avoid register savings for fast path.
+	* parse.y (aryset): expr in the brackets can be null.
 
-	  This idea is given by Kazuho Oku <kazuho@natadeco.co>.
+Wed Jan  7 21:13:56 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Wed Oct  7 17:30:50 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* io.c (io_reopen): keep stderr unclosed.
 
-	* string.c (rb_str_times): optimize for the argument 0 and 1.
+	* io.c (io_errset): keep stderr unclosed.
 
-Wed Oct  7 01:20:46 2015  Koichi Sasada  <ko1@atdot.net>
+Tue Jan  6 00:27:43 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* gc.h, gc.c: introduce new debug function rb_obj_info_dump(VALUE obj)
-	  which prints the result of rb_raw_obj_info(..., obj).
+	* parse.y: syntax modified for `while expr do .. end' etc.
 
-Wed Oct  7 01:16:11 2015  Koichi Sasada  <ko1@atdot.net>
+	* process.c (f_exec,f_system): can supply arbitrary name for the
+ 	  new process.
 
-	* vm_args.c: remove an unused field args_info::calling.
+Mon Jan  5 16:59:13 1998  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
 
-Tue Oct  6 23:43:10 2015  Koichi Sasada  <ko1@atdot.net>
+	* file.c (file_s_basename): removes any extention by ".*".
 
-	* proc.c (rb_method_entry_min_max_arity): should support
-	  OPTIMIZED_METHOD_TYPE_CALL.
+Sun Jan  4 19:36:22 1998  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
 
-Tue Oct  6 21:29:08 2015  Tanaka Akira  <akr@fsij.org>
+	* parse.y (yylex): needed to update lex_p (reading point).
 
-	* lib/tmpdir.rb (Dir.tmpdir): return duplicated string to be
-	  modify safely even when $SAFE > 0.
+Sat Jan  3 19:14:14 1998  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
 
-Tue Oct  6 19:24:38 2015  Koichi Sasada  <ko1@atdot.net>
+	* class.c,object.c: duplicate defines mKernel and cFinxnum.
 
-	* vm_insnhelper.c (vm_call_method0): use switch() for visibilities
-	  (for readability).
+Fri Jan  2 20:38:59 1998  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Tue Oct  6 19:23:58 2015  Koichi Sasada  <ko1@atdot.net>
+	* ext/curses/curses.c (NUM2CHAR): uses the first character for
+ 	  string arguments.
 
-	* proc.c (Init_Proc): Proc#call and others should be public.
+	* array.c (ary_fill): did not extend array for ranges.
 
-Tue Oct  6 18:51:51 2015  Koichi Sasada  <ko1@atdot.net>
+	* array.c (beg_len): did not return end pos bigger than size.
 
-	* method.h: IMEMO_FL_USER3 and IMEMO_FL_USER4 is not needed any more.
+Fri Jan  2 02:09:16 1998  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
 
-Tue Oct  6 18:47:45 2015  Koichi Sasada  <ko1@atdot.net>
+	* dir.c (dir_s_chdir): bug in nil check.
 
-	* method.h: remove METHOD_ENTRY_SAFE(me) and related code
-	  because $SAFE = 3 and 4 is not available.
-	  Now, $SAFE is not checked on method dispatch at all.
+	* array.c (ary_fill): bug in nil check.
 
-	* vm_eval.c, vm_insnhelper.c, vm_method.c: ditto.
+Tue Dec 30 11:46:23 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Tue Oct  6 13:56:14 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* hash.c (env_path_tainted): checks directories in PATH
+	  environment variable are not world writable.
 
-	* include/ruby/ruby.h: turn function macros into inline functions,
-	  for debuggers.
+	* ruby.c (load_file): invoke specified interpreter if the #! line
+ 	  does not contain the word `ruby'.
 
-	* include/ruby/ruby.h: turn constant macros into enums, for
-	  debuggers.
+Fri Dec 26 03:26:41 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Tue Oct  6 13:48:05 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* string.c (uscore_get): type information included in the error
+ 	  message.
 
-	* method.h: typo fix. Patch by @davydovanton [fix GH-1032][ci skip]
+	* variable.c (f_untrace_var): does not free trace-data within
+ 	  trace procedure.
 
-Tue Oct  6 06:54:34 2015  Koichi Sasada  <ko1@atdot.net>
+Thu Dec 25 02:50:29 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* iseq.c (rb_iseq_free): free iseq::variable_body to avoid memory
-	  leak.
+	* version 1.1b3 released.
 
-Tue Oct  6 06:32:52 2015  Koichi Sasada  <ko1@atdot.net>
+	* ruby.h: inlining some functions on gcc 2.x
 
-	* proc.c: enable optimization of Proc#call.
-	  [Feature #11569]
+Tue Dec 23 02:47:33 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* NEWS: write about this optimization and incompatibilities.
+	* eval.c (rb_eval): public/private information kept in the current 
+	  scope, to remove undesired state from the class/module.
 
-	* test/ruby/test_backtrace.rb: catch up this fix.
+	* time.c (time_strftime): remove hidden limit of 100 bytes of
+	  result string, using malloc'ed buffer. 
 
-Tue Oct  6 04:41:03 2015  Koichi Sasada  <ko1@atdot.net>
+	* hash.c (hash_update): merges the contents of another hash,
+	  overriding existing keys.
 
-	* vm_insnhelper.c: solve goto spaghetti.
+	* regex.c (must_instr): totally re-written.
 
-	  Change all goto statement across blocks to tail call functions.
+	* io.c (read_all): try to allocate proper sized buffer using
+	  fstat(2) for speedup.
 
-Tue Oct  6 02:29:38 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Dec 20 00:27:28 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* string.c (rb_str_resurrect): optimize by short circuit to copy
-	  hidden string without checking length, encoding and so on.
+	* regex.c (must_instr): need to skip 2 bytes for mbchars.
 
-Mon Oct  5 23:08:17 2015  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+Fri Dec 19 01:18:29 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* test/ruby/test_thread.rb (test_handle_interrupt_blocking): check if
-	  exception handling was postponed until sleep.
+	* version 1.1b2 released.
 
-Mon Oct  5 22:25:49 2015  Tanaka Akira  <akr@fsij.org>
+	* eval.c (check_errat): check and convert (if necessary) traceback 
+	  information before assigning to the variable $@.
 
-	* lib/pp.rb: Use frozen_string_literal: true.
+	* eval.c (f_raise): optional third argument to specify traceback
+	  information.
 
-	* lib/prettyprint.rb: Ditto.
+	* io.c (f_open): prevent infinite recursive call.
 
-	* lib/resolv.rb: Ditto.
+Thu Dec 18 19:33:47 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* lib/tmpdir.rb: Ditto.
+	* string.c (str_rindex): now accepts regexp as index.
 
-	* test/test_pp.rb: Ditto.
+Thu Dec 18 18:42:50 1997  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
 
-	* test/test_prettyprint.rb: Ditto.
+	* ext/socket/extconf.rb: modified to detect win32 socket lib.
 
-	* tool/transcode-tblgen.rb: Ditto.
+Thu Dec 18 00:25:03 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Mon Oct  5 20:39:32 2015  Benoit Daloze  <eregontp@gmail.com>
+	* re.c (reg_equal): checks for source and casefold and kcode matching.
 
-	* test/ruby/test_thread.rb: fix potential race condition.
-	  The thread could have a "sleep" status because it tries
-	  to acquire the mutex, but does not have it yet.
+	* marshal.c: became built-in module.
 
-Mon Oct  5 15:39:30 2015  Zachary Scott  <zzak@ruby-lang.org>
+	* ext/marshal/marshal.c (r_object): displays struct name for
+	  non-compatible struct.
 
-	* numeric.c: [DOC] Overview for Numeric class by Joe Corcoran
-	  This patch was created at ROSSConf Berlin 2015 [Bug #11555]
+	* string.c (str_index_method): now searches character (fixnum) in
+	  the string.
 
-Mon Oct  5 15:34:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* string.c (str_include): redefine `include?'.
 
-	* proc.c (proc_new): link ep to calling block.
-	  [ruby-core:70980] [Bug #11566]
+	* regex.c (re_match): start_nowidth saves current stack position
+	  to stop_nowidth.
 
-Mon Oct  5 00:53:51 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* regex.c (re_compile_pattern): add space to stop_nowidth to save
+	  runtime stack position.
 
-	* dir.c (rb_dir_getwd): make ASCII-8BIT if filesystem encoding is
-	  US-ASCII, like as Dir.glob.
+Tue Dec 16 14:57:43 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Sun Oct  4 23:39:09 2015  Tanaka Akira  <akr@fsij.org>
+	* string.c (scan_once): wrong exception for regexp that match with 
+	  null string (use substr instead of subseq).
 
-	* enum.c (nmin_filter): Fix limit value.
-	  patch by Helder Pereira.
-	  [Bug #11471] [ruby-core:70477]
+Sat Dec 13 00:13:32 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Sun Oct  4 15:11:48 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+	* parse.y (expr): remove bare assocs from expr rule.
 
-	* enc/euc_jp.c (mbc_case_fold): check given string is valid or not,
-	  and if invalid, return 1. [Bug #11486]
+	* rbconfig.rb: renamed from config.rb (it was too generic name).
 
-Sun Oct  4 10:09:57 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Dec 12 00:50:25 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* dir.c (rb_dir_getwd): normalize OS path to UTF-8 on OS X.
+	* parse.y (expr): warns if BEGIN or END appear in the method
+ 	  bodies.
 
-Sun Oct  4 00:09:45 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* string.c (str_match): calls y =~ x if y is neither String nor
+	  Regexp so that eregex.rb works.  
 
-	* template/ruby-runner.c.in: wrapper to set dynamic loading path
-	  environment variable.  /bin/sh on Mac OS X 10.11 (El Capitan)
-	  clears DYLD_LIBRARY_PATH.
+	* eval.c (f_at_exit): to register end proc.
 
-	  it must:
-	  - do nothing even if current directory is not present
-	  - do not set other environment variables, e.g. PWD, SHLVL, etc
-	  - do not open other FDs, e.g. pipes for timer thread
+	* class.c (rb_define_module_function): define 'function' method
+	  for the Module, not private method.
 
-Sun Oct 2 10:59:00 2015  schneems  <richard.schneeman@gmail.com>
+	* class.c (rb_define_function): function to define `function' method.
 
-	* ext/pathname/lib/pathname.rb: freeze string literals for
-	  reduced object allocation.
-	  [Feature #11375] [ruby-core:70043]
+	* eval.c (rb_eval): inherit visibility from superclass's method
+	  except when it is set to `function'
 
-Fri Oct  2 09:20:20 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* eval.c (rb_eval): new visibility status `function'.
 
-	* common.mk, lib/unicode_normalize/tables.rb: Change Unicode
-	  Version for character normalization data from 7.0.0 to
-	  8.0.0.
+	* parse.y (yycompile): do not clear eval_tree. thus enable multipe 
+	  command line script by optn `-e'.
 
-Fri Oct  2 00:18:39 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* eval.c (rb_eval): END execute just once.
 
-	* proc.c (proc_mark): block.ep of Proc from Symbol is now NULL.
-	  [ruby-core:70961] [Bug #11560]
+	* parse.y (expr): BEGIN/END built in the syntax.
 
-Wed Sep 30 15:47:13 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Dec 11 13:14:35 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* vm_args.c (vm_caller_setup_arg_block): bypass Symbol#to_proc
-	  call to optimize symbol block passing.
+	* object.c (mod_le): Module (or Class) comparison.
 
-Wed Sep 30 01:34:34 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* eval.c (rb_remove_method): raises NameError if named method does 
+	  not exist.
 
-	* parse.y (parser_free): fix memory leak at syntax error when
-	  warn-indent is enabled.
+	* ext/curses/curses.c: remove CHECK macro for BSD curses.
+	
+Thu Dec 11 12:44:01 1997  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
 
-Tue Sep 29 22:27:50 2015  Benoit Daloze  <eregontp@gmail.com>
+	* pack.c: sun4 cc patch
 
-	* parse.y: fix minor typo. [ci skip][fix GH-1038].
-	  Patch by @ltratt.
+Wed Dec 10 15:21:36 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Tue Sep 29 16:53:53 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* ext/marshal/marshal.c (marshal_load): can supply evolution proc
+	  object as optional second argument.
 
-	* tool/unicode_norm_gen.tmpl, lib/unicode_normalize/tables.rb:
-	  get rid of many .freeze commands by using frozen_string_literal
-	  pragma.
+	* re.c (reg_source): get source string of the regular expression.
 
-Tue Sep 29 16:37:29 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Dec  9 10:05:17 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* compile.c (compile_dstr_fragments): fix performance by omitting
-	  the first empty string only for keeping literal encoding if
-	  other literals are too.  [ruby-core:70930] [Bug #11556]
+	* version 1.1b1 released.
 
-	* string.c (rb_str_append_literal): append but keep encoding non
-	  US-ASCII.
+	* parse.y (tokadd): token buffer overrun.
 
-Mon Sep 28 17:40:17 2015  Shugo Maeda  <shugo@ruby-lang.org>
+	* ruby.c (ruby_prog_init): forgot to protect rb_argv0 from gc.
 
-	* lib/net/ftp.rb (mtime): use usec instead of fractions to parse
-	  decimal fractions of a second correctly when the number of digits
-	  is not 6.
+	* eval.c (ruby_run): call finalizers at process termination.
 
-Mon Sep 28 16:07:08 2015  Shugo Maeda  <shugo@ruby-lang.org>
+	* gc.c (gc_call_finalizer_at_exit): call free proc for every Data
+ 	  Wrapper, and finalizer for specified objects at termination.
 
-	* lib/net/ftp.rb (mtime): parse decimal fractions of a second as
-	  specified in RFC 3659.
+	* version.c (show_version): version format changed.
 
-Mon Sep 28 10:31:12 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* regex.c (re_match): wrong match with non-greedy if they appear
+	  more than once in regular expressions.
 
-	* test/test_forwardable.rb: Write basic tests for lib/forwardable.
-	  [fix GH-1035] Patch by @kachick
+	* sample/ruby-mode.el (ruby-expr-beg): forgot to handle modifiers.
 
-Sun Sep 27 23:32:46 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon Dec  8 19:00:15 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* class.c (rb_define_class, rb_define_class_id_under): refine
-	  error messages.
+	* io.c (io_puts): just put a newline if no argument given.
 
-	* class.c (rb_define_module, rb_define_module_id_under): ditto,
-	  and make consistent with class.
+	* ext/tcltklib/tcltklib.c (lib_mainloop): thread-aware tk handle
+ 	  when $tk_thread_safe is set.
 
-Sun Sep 27 18:44:43 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* ext/tcltklib/tcltklib.c (lib_mainloop): use Tcl_DoOneEvent()
+	  instead of Tk_MainLoop().
 
-	* ChangeLog: removed duplicated message.
+Mon Dec  6 07:11:16 1997  MAEDA shugo  <shugo@po.aianet.ne.jp>
 
-Sun Sep 27 15:46:58 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* io.c (io_puts): core dumped without any argument.
 
-	* ruby.c (process_options): add an option to enable/disable
-	  frozen-string-literal.  [Feature #8976]
+Fri Dec  5 18:17:17 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* compile.c (iseq_compile_each): override compile option by option
-	  given by pragma.
+	* eval.c (mod_remove_method): remove (not undef) a method from the 
+	  class/module.
 
-	* iseq.c (rb_iseq_make_compile_option): extract a function to
-	  overwrite rb_compile_option_t.
-
-	* parse.y (parser_set_compile_option_flag): introduce pragma to
-	  override compile options.
-
-	* parse.y (magic_comments): new pragma "frozen-string-literal".
-	  [Feature #8976]
-
-Sun Sep 27 08:16:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/ostruct.rb (delete_field): do not raise NameError for
-	  existing keys.  [Fix GH-1033]
-
-Sun Sep 27 00:34:31 2015  Zachary Scott  <zzak@ruby-lang.org>
-
-	* lib/ostruct.rb: Move method definitions for getter/setter to be lazy
-	  Patch by @sferik in [GH-1033]: https://github.com/ruby/ruby/pull/1033
-
-Fri Sep 25 10:07:25 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* lib/net/http.rb: removed unused variable. It's removed at r13648.
-	  [fix GH-1022] Patch by @nkondratyev
-
-Fri Sep 25 09:48:27 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* gems/bundled_gems: upgrade to minitest-5.8.1
-
-Fri Sep 25 09:47:12 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* id_table.c: fix typo. [ci skip][fix GH-1031] Patch @davydovanton
-
-Fri Sep 25 07:54:05 2015  Rei Odaira  <Rei.Odaira@gmail.com>
-
-	* test/gdbm/test_gdbm.rb (TestGDBM#test_s_open_lock): skip
-	  this test on AIX. The issue is the same as on Solaris.
-	  [ruby-dev:47631]
-
-Thu Sep 24 17:25:09 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (paren_args): fix separator token at `foo::bar()` in
-	  ripper.
-
-Thu Sep 24 00:00:17 2015  Rei Odaira  <Rei.Odaira@gmail.com>
-
-	* complex.c: ruby/config.h must be included before math.h
-	  because it defines _LARGE_FILES on AIX and _LARGE_FILES
-	  must be defined before sys/types.h is included from math.h.
-	  [Bug #11483]
-
-Wed Sep 23 22:22:38 2015  Zachary Scott  <zzak@ruby-lang.org>
-
-	* ext/openssl/ossl_pkcs12*: Remove svn commit id macro
-
-Wed Sep 23 01:11:28 2015  Zachary Scott  <zzak@ruby-lang.org>
-
-	* ext/openssl/*: Remove svn commit id macros to make sync easier
-
-Tue Sep 22 04:20:01 2015  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
-
-	* test/drb/test_drb.rb: Run Rinda/DRb tests on localhost. [Fix GH-1027]
-	  patch by voxik.
-
-	* test/rinda/test_rinda.rb: ditto
-
-Mon Sep 21 20:53:39 2015  tbpgr  <tbpgr@tbpgr.jp>
-
-	* test/win32ole/test_win32ole_event.rb: fix typo.
-	  swbemsink_avairable? => swbemsink_available?  [Fix GH-1025]
-
-Sun Sep 20 10:07:35 2015  Anton Davydov  <antondavydov.o@gmail.com>
-
-	* cont.c (rb_callcc): [DOC] append continuations example accros
-	  methods.  [Fix GH-1026]
-
-Sun Sep 20 03:20:21 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* iseq.c (rb_iseq_free): free rb_iseq_t::body::cc_entries.
-
-Sun Sep 20 02:46:34 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_core.h: split rb_call_info_t into several structs.
-	  * rb_call_info (ci) has compiled fixed information.
-	  * if ci->flag & VM_CALL_KWARG, then rb_call_info is
-	    also rb_call_info_with_kwarg. This technique reduce one word
-	    for major rb_call_info data.
-	  * rb_calling_info has temporary data (argc, blockptr, recv).
-	    for each method dispatch. This data is allocated only on
-	    machine stack.
-	  * rb_call_cache is for inline method cache.
-
-	  Before this patch, only rb_call_info_t data is passed.
-	  After this patch, above three structs are passed.
-
-	  This patch improves:
-	  * data locality (rb_call_info is now read-only data).
-	  * reduce memory consumption (rb_call_info_with_kwarg,
-	    rb_calling_info).
-
-	* compile.c: use above data.
-
-	* insns.def: ditto.
-
-	* iseq.c: ditto.
-
-	* vm_args.c: ditto.
-
-	* vm_eval.c: ditto.
-
-	* vm_insnhelper.c: ditto.
-
-	* vm_insnhelper.h: ditto.
-
-	* iseq.h: add iseq_compile_data::ci_index and
-	  iseq_compile_data::ci_kw_index.
-
-	* tool/instruction.rb: introduce TS_CALLCACHE operand type.
-
-Sun Sep 20 02:18:10 2015  Tanaka Akira  <akr@fsij.org>
-
-	* test/lib/envutil.rb: mkfifo command based File.mkfifo method
-	  definition removed.
-
-Fri Sep 18 20:11:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* file.c (rb_file_s_mkfifo): implement File.mkfifo.
-	  [Feature #11536]
-
-Fri Sep 18 16:56:19 2015  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* NEWS: add Net::FTP#mlst and Net::FTP#mlsd.
-
-Fri Sep 18 07:39:22 2015  Aaron Patterson <tenderlove@ruby-lang.org>
-
-	* ext/objspace/objspace_dump.c (obj_type): add IMEMO types to the heap
-	  dump information.
-
-Thu Sep 17 22:33:07 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* common.mk: fix command error with outside builddir.
-
-Thu Sep 17 17:42:09 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* common.mk: separated test for test-framework from test-all task.
-	  They should be invoke at first before tests of test-all.
-
-Thu Sep 17 12:05:54 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
-
-	* test/ruby/test_dir.rb (TestDir#test_fileno): s/?x/"x"/. Don't
-	  use tricky code, please.
-
-Wed Sep 16 20:49:56 2015  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
-
-	* encindex.h: fix typo of last #endif comment. [ci skip]
-
-Wed Sep 16 20:39:26 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* variable.c (set_const_visibility): fail if the class/module is
-	  frozen.  [ruby-core:70828] [Bug #11532]
-
-Wed Sep 16 17:16:43 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* vm_core.h (ENABLE_VM_OBJSPACE): enable per-VM object space on
-	  Windows by default, as rb_w32_sysinit() no longer depends on
-	  ruby_xmalloc.
-
-Wed Sep 16 15:08:17 2015  Akinori MUSHA  <knu@iDaemons.org>
-
-	* doc/syntax/literals.rdoc (Strings): [DOC] Revise the character
-	  literal part.
-
-Wed Sep 16 14:55:33 2015  Akinori MUSHA  <knu@iDaemons.org>
-
-	* doc/syntax/literals.rdoc (Strings): [DOC] Document the full list
-	  of supported escape sequences in string literals.
-
-Wed Sep 16 14:49:58 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* string.c (rb_str_setbyte): keep the code range as possible.
-
-Wed Sep 16 13:23:48 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* doc/syntax/literals.rdoc (Strings): mention about ?a literal.
-
-Wed Sep 16 12:06:53 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
-
-	* dir.c (glob_helper): check pathtype once again by lstat(2) if
-	  dp->d_type is DT_UNKNOWN. XFS may return DT_UNKNOWN.
-
-Wed Sep 16 03:49:19 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
-
-	* test/ruby/test_thread.rb (TestThread#test_mutex_synchronize):
-	  insert waste loop for invoking preemptive thread context switch.
-	  [Bug #11496]
-
-Tue Sep 15 19:38:55 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* gc.c (rb_objspace_alloc, rb_objspace_free): define always
-	  regardless ENABLE_VM_OBJSPACE, and free heap pages.
-
-Tue Sep 15 15:15:41 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* win32/win32.c (rb_w32_sysinit, rb_w32_readdir): compare by
-	  encoding index to get rid of encoding initialization before VM
-	  object space allocation.
-
-	* dir.c (fundamental_encoding_p, push_glob): compare by encoding
-	  index immediately.
-
-	* enc/{ascii,us_ascii,utf_8}.c: set encoding indexes of
-	  fundamental built-in encodings so that usable as well as
-	  allocated rb_encoding before rb_enc_init().
-
-	* encindex.h: separate encoding index constants from internal.h.
-
-Tue Sep 15 13:13:13 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* array.c (rb_ary_sort_bang, rb_ary_sort): [DOC] correct block
-	  return values, which may be a negative or positive integer, not
-	  only -1 or +1.
-
-Tue Sep 15 12:49:10 2015  Jason Barnabe  <jason.barnabe@gmail.com>
-
-	* array.c (rb_ary_sort_bang, rb_ary_sort): [DOC] Correct
-	  description of array sort block return values.  And also fix up
-	  the grammar a bit.  [Fix GH-1020]
-
-Tue Sep 15 12:44:32 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* util.c (ruby_qsort): use BSD-style qsort_r if available.
-
-Mon Sep 14 19:26:34 2015  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/net/ftp.rb (parse_mlsx_entry): parse pathnames including
-	  space correctly.
-
-Mon Sep 14 11:12:10 2015  Anton Davydov  <antondavydov.o@gmail.com>
-
-	* lib/racc/rdoc/grammar.en.rdoc: [DOC] fix typo, "convertion" to
-	  "conversion".  [Fix GH-1016]
-
-Sun Sep 13 11:03:13 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* include/ruby/ruby.h: prefix RUBY or RB to global symbols to get
-	  rid of name conflicts with other headers.
-
-	* include/ruby/encoding.h, include/ruby/intern.h: ditto.
-
-Sun Sep 13 09:38:51 2015  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/net/ftp.rb (size, modify, create, type, unique, perm, lang,
-	  media_type, charset): new methods to return standard facts.
-
-Sat Sep 12 19:43:49 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_insnhelper.c (vm_call_iseq_setup_normal): do not clear local
-	  variables here. vm_push_frame() clears.
-
-	* vm_insnhelper.c (vm_call_iseq_setup_tailcall): ditto.
-
-	* vm_insnhelper.c (vm_push_frame): move check code to
-	  vm_check_frame().
-
-	  Reorder initialization timing to reuse same values (sp).
-
-	* compile.c (rb_iseq_compile_node): use
-	  iseq_set_exception_local_table() for ISEQ_TYPE_DEFINED_GUARD.
-
-Sat Sep 12 23:06:51 2015  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/net/ftp.rb (file?, directory?, appendable?, creatable?,
-	  deletable?, enterable?, renamable?, listable?, directory_makable?,
-	  purgeable?, readable?, writable?): new methods.
-
-Sat Sep 12 21:27:22 2015  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/net/ftp.rb (FACT_PARSERS): support system dependent facts
-	  UNIX.mode, UNIX.owner, UNIX.group, UNIX.ctime, and UNIX.atime.
-
-Sat Sep 12 19:08:58 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* win32/win32.c (rb_w32_dup2): should return the new fd on
-	  success, while msvcrt returns 0 wrongly.
-
-Sat Sep 12 18:14:11 2015  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/net/ftp.rb (parse_mlsx_entry, mlst) raise an FTPProtoError
-	  when parsing failed.
-
-Sat Sep 12 18:00:35 2015  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/net/ftp.rb (TIME_PARSER): use "Z" instead of "+00:00" to
-	  get UTC time.  Thanks, Wilson Bilkovich.
-
-Sat Sep 12 17:55:24 2015  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/net/ftp.rb (mlst, mlsd): support new commands MLST and MLSD
-	  specified in RFC 3659.
-
-Sat Sep 12 16:14:31 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* file.c: access()/eaccess() wrapping methods check more than just uid.
-	  [fix GH-1007][ci skip] Patch by @eam
-
-Sat Sep 12 16:07:01 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* README.md: improve markdown rendering for readability.
-	  [fix GH-1015][ci skip] Patch by @Matrixbirds
-
-Sat Sep 12 14:30:03 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* process.c (save_redirect_fd): make saved FDs close-on-exec not
-	  to be inherited.
-
-	* process.c (run_exec_dup2): restore close-on-exec flags too.
-
-	* win32/win32.c (fcntl): implement F_GETFD, F_SETFD, and
-	  F_DUPFD_CLOEXEC.
-
-Sat Sep 12 05:35:24 2015  Eric Wong  <e@80x24.org>
-
-	* rational.c (string_to_r_strict): preserve encoding in exception
-
-Fri Sep 11 20:23:35 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_core.h: remove rb_call_info_t::aux.opt_pc.
-
-	* vm_insnhelper.c: introduce shortcut functions for opt_pc == 0
-	  because opt_pc is always 0 on shortcut function.
-
-Fri Sep 11 17:49:36 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* iseq.c: disable ISeq.load. It enabled accidentally at r51794.
-
-Fri Sep 11 11:15:12 2015  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/net/ftp.rb (size, mdtm, system): parse responses according to
-	  RFC 959 and 3659, where reply codes must be followed by SP.
-
-	* lib/net/ftp.rb (system): remove LF from the return value.
-
-Thu Sep 10 22:48:49 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (literal_concat_gen, evstr2dstr_gen): keep literal
-	  encoding beginning with an interpolation same as the source file
-	  encoding.  [ruby-core:70703] [Bug #11519]
-
-Thu Sep 10 22:15:51 2015  Joe Rafaniello  <jrafanie@redhat.com>
-
-	* process.c (rb_f_spawn): Be more specific regarding "other
-	  values" by having "non-zero positive integers" Add nil, the
-	  default value, as a possible value and what it means.
-
-	  Try to use more consistent language.
-	  [Fix GH-1008]
-
-Thu Sep 10 15:16:02 2015  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/net/ftp.rb (getmultiline): refactor.
-
-Thu Sep 10 12:17:28 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* compile.c (iseq_build_from_ary_body): register cdhash to the
-	  iseq constant body instead of compile time mark array, not to
-	  get GCed.  [ruby-core:70708] [Feature #8543]
-
-Wed Sep  9 18:16:14 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* lib/rubygems/stub_specification.rb (Gem::StubSpecification#data):
-	  should not change the value of $. when `require`ing gems.
-	  this fixed test failures introduced by r51813.
-
-Wed Sep  9 16:55:45 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* ruby.c (usage, enable_option, disable_option, process_options): new
-	  option `--disable-did_you_mean`.
-
-	* gem_prelude.rb: now requires did_you_mean gem by default if available.
-
-Wed Sep  9 13:38:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* tool/extlibs.rb (do_patch): let "patch" command change the
-	  working directory and open the patch file there, instead of
-	  spawn options, so that proper error message will be shown by the
-	  command not just "chdir" or "open".
-
-Wed Sep  9 11:33:05 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* common.mk (update-gems): use BASERUBY instead of RUNRUBY.
-
-Wed Sep  9 11:08:59 2015  Zachary Scott  <zzak@ruby-lang.org>
-
-	* lib/delegate.rb: Remove backtrace cleaning for delegated methods
-	  This patch was provided by Rafael Franca and greatly improves
-	  performance when an exception is raised. [Bug #11461]
-
-Wed Sep  9 10:05:41 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* test/rubygems/test_config.rb: fix broken tests for Windows platform.
-
-Wed Sep  9 07:46:32 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* lib/rubygems: Update to RubyGems HEAD(fe61e4c112).
-	  this version contains new feature that warn invalid SPDX license
-	  identifiers. https://github.com/rubygems/rubygems/pull/1249
-	  and #1032, #1023, #1332, #1328, #1306, #1321, #1324
-	* test/rubygems: ditto.
-
-Tue Sep  8 23:17:36 2015  Yuki Nishijima  <mail@yukinishijima.net>
-
-	* gems/bundled_gems: Upgrade the did_you_mean gem to 1.0.0.beta2.
-
-Tue Sep  8 23:09:28 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* io.c (rb_io_s_popen): do not wait the child process during being
-	  killed.  [ruby-core:70671] [Bug #11510]
-
-Tue Sep  8 22:18:04 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* gems/bundled_gems: revert because ruby trunk never be able to install
-	  the did_you_mean gem.  retry after enough test.
-
-Tue Sep  8 21:48:22 2015  Yuki Nishijima  <mail@yukinishijima.net>
-
-	* gems/bundled_gems: Automatically install the did_you_mean gem
-	  as a bundled gem.  [Feature #11252]
-
-Tue Sep  8 17:17:48 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_core.h: remove rb_call_info_t::blockiseq.
-
-	* insns.def (send, invokesuper): pass blockiseq explicitly.
-
-	* compile.c: catch up this fix.
-
-	* iseq.c: ditto.
-
-	* vm_args.c: ditto.
-
-	* iseq.c (ISEQ_MINOR_VERSION): 2->3 because instruction spec was
-	  changed.
-
-Tue Sep  8 15:01:19 2015  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/net/ftp.rb (list): fetch all the lines before yielding a block
-	  to allow other commands in the block.  [Feature #11454]
-	  Patched by Srikanth Shreenivas.
-
-Tue Sep  8 12:05:00 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/win32.c (rb_w32_read_reparse_point): return correct required
-	  buffer size for IO_REPARSE_TAG_MOUNT_POINT.
-
-Tue Sep  8 00:14:43 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* process.c (rb_execarg_parent_start1): raise with the target path
-	  name when open() failed.
-
-Mon Sep  7 23:45:28 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* process.c (rb_exec_fail): raise with the target directory name
-	  when chdir() failed.  pointed out by sorah.
-
-Mon Sep  7 22:05:28 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* win32/win32.c (insert): should use plain strdup() instead of
-	  ruby_strdup() at startup time, and plain free()ed in cmdglob().
-
-Mon Sep  7 16:49:30 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* vm_core.h (rb_vm_struct): define objspace always regardless
-	  ENABLE_VM_OBJSPACE.
-
-Mon Sep  7 15:54:58 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ruby_atomic.h (ATOMIC_VALUE_CAS): fix typo.
-	  TODO: make arguments of all CAS macros consistent.
-
-Sun Sep  6 16:07:22 2015  Eric Wong  <e@80x24.org>
-
-	* ccan/list/list.h: suppress unused argument warnings
-	  [ccan commit 6aaca17e07588997417a73fac19dcf0ff17ed81b]
-
-Sat Sep  5 11:39:52 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/rss/rss.rb (Time#w3cdtf): fix zero-trimmed width of fraction
-	  digits.  [ruby-core:70667] [Bug #11509]
-
-Sat Sep  5 08:28:58 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* hash.c (rb_hash_equal, rb_hash_eql): [DOC] the orders of each
-	  hashes are not compared.  [Bug #11508]
-
-Fri Sep  4 23:26:22 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* include/ruby/win32.h: fix macro name for VC runtime version,
-	  RT_VER is only in Makefile.
-
-Fri Sep  4 17:46:17 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* doc/contributing.rdoc: fix configuration option.
-	  [ci skip] [fix GH-1009]
-
-Fri Sep  4 04:46:54 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* iseq.c (iseq_memsize): functions for wrapper object should have
-	  iseqw_ prefix.
-
-Thu Sep  3 21:12:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/cgi/session.rb (create_new_id): use SHA512 instead of MD5.
-	  pointed out by SARWAR JAHAN.
-
-Thu Sep  3 20:29:18 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (rb_raw_obj_info): iseq->body->location.first_lineno is Fixnum.
-
-Thu Sep  3 17:54:26 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* vm_eval.c (raise_method_missing): "names" should be singular.
-	  pointed out by Filip Bartuzi.
-
-Thu Sep  3 17:50:09 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (rb_raw_obj_info): should support IMEMO/iseq.
-
-Thu Sep  3 10:07:49 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* vm_eval.c (raise_method_missing): refine error messages when a
-	  symbol is not given.  [Fix GH-1013]
-
-Wed Sep  2 18:49:55 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* ext/psych/*: merge psych master(8737e5b). It contains following fixes.
-	  https://github.com/tenderlove/psych/pull/242
-	  https://github.com/tenderlove/psych/pull/246 [ruby-list:50219]
-	* test/psych/*: ditto.
-
-Wed Sep  2 18:04:13 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_insnhelper.h (GET_PC_COUNT): remove unused macro.
-
-Wed Sep  2 17:18:37 2015  Chris Schneider  <chris@christopher-schneider.com>
-
-	* process.c (proc_detach): [DOC] fix typo "intent" as "intend" in
-	  rdoc.  [Fix GH-1011]
-
-Wed Sep  2 16:58:21 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* file.c (rb_realpath_internal): use filesystem encoding if the
-	  argument is in ASCII encodings.
-
-	* win32/file.c (rb_readlink): needs the result encoding.
-
-Tue Sep  1 18:37:15 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* test/thread/test_queue.rb: catch up last commit.
-
-Tue Sep  1 18:16:32 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* thread_sync.c (queue_do_close): ignore multiple close to allow
-	  multiple producers.
-	  https://bugs.ruby-lang.org/issues/10600#note-14
-
-Tue Sep  1 18:06:26 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* thread_tools.c: rename thread_tools.c to thread_sync.c.
-
-Mon Aug 31 17:04:45 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* class.c (move_refined_method): should insert a write barrier
-	  from an original class to a created (cloned) method entry.
-
-	* test/ruby/test_refinement.rb: add a test.
-
-Sun Aug 30 02:42:22 2015  Aaron Patterson <tenderlove@ruby-lang.org>
-
-	* ext/openssl/ossl_ssl.c (ossl_ssl_method_tab): Only add SSLv3 support
-	  if the SSL library supports it.  Thanks Kurt Roeckx <kurt@roeckx.be>
-	  [Bug #11376]
-
-	* ext/openssl/extconf.rb: check for SSLv3 support in the SSL
-	  implementation.
-
-	* test/openssl/test_ssl.rb (class OpenSSL): Skip tests that need SSLv3
-	  if there is no support.
-
-Fri Aug 28 16:05:09 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* lib/rdoc/*: Update rdoc master(cfffed5)
-	  https://github.com/rdoc/rdoc/pull/337
-	  https://github.com/rdoc/rdoc/pull/367
-
-Fri Aug 28 10:16:20 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm.c (hook_before_rewind): prevent kicking :return event while
-	  finishing vm_exec func because invoke_block_from_c() kick a :return
-	  event for bmethods.
-	  [Bug #11492]
-
-	* test/ruby/test_settracefunc.rb: add a test.
-
-Thu Aug 27 18:05:42 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* lib/webrick/server.rb: use IO::NULL instead of '/dev/null'
-	* test/ruby/test_string.rb: ditto.
-
-Thu Aug 27 15:24:57 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* compile.c (iseq_set_sequence): rename variable names
-	  to make it readable.
-
-Thu Aug 27 07:45:34 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* thread_tools.c: add Queue#close(exception=false) and
-	  SizedQueue#close(exception=false).
-	  [Feature #10600]
-
-	  Trying to deq from a closed empty queue return nil
-	  if exception parameter equals to false (default).
-
-	  If exception parameter is truthy, it raises
-	  ClosedQueueError (< StopIteration).
-	  ClosedQueueError inherits StopIteration so that you can write:
-
-	    loop{ e = q.deq; (using e) }
-
-	  Trying to close a closed queue raises ClosedQueueError.
-
-	  Blocking threads to wait deq for Queue and SizedQueue will be
-	  restarted immediately by returning nil (exception=false) or
-	  raising a ClosedQueueError (exception=true).
-
-	  Blocking threads to wait enq for SizedQueue will be
-	  restarted by raising a ClosedQueueError immediately.
-
-	  The above specification is not proposed specification, so that
-	  we need to continue discussion to conclude specification this
-	  method.
-
-	* test/thread/test_queue.rb: add tests originally written by
-	  John Anderson and modify detailed behavior.
-
-Wed Aug 26 10:52:02 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* re.c (rb_memsearch_wchar, rb_memsearch_qchar): test matching
-	  till the end of string.  [ruby-core:70592] [Bug #11488]
-
-	* test/ruby/test_m17n.rb (test_include?, test_index): add tests by
-	  Tom Stuart.
-
-Wed Aug 26 09:26:00 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* id_table.c (list_table_extend, hash_table_extend): remove C99
-	  features.  [ruby-dev:49239] [Bug #11487]
-
-Tue Aug 25 06:34:43 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* win32/win32.c (w32_symlink): implement symlink().
-
-Mon Aug 24 16:01:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* encoding.c (rb_locale_encindex): find encoding index without
-	  making a string object every time.  [ruby-core:58160] [Bug #9080]
-
-Sat Aug 22 15:43:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* vm_eval.c (check_funcall_failed, check_funcall_missing): cache
-	  results of respond_to? and respond_to_missing?, and search a
-	  public method only for compatibility with rb_respond_to.
-
-Sat Aug 22 08:23:32 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* ext/thread/thread.c: move definitions of Queue, SizedQueue
-	  and ConditionalVariables to thread_tools.c. In other words,
-	  such classes are built-in.
-	  [Feature #8919]
-
-	  At first, I planned to embed only a Queue class.
-	  However, rubygems requires 'thread.rb' (rubygems are
-	  required at first, when launch MRI without --disable-gems).
-	  So most of people require 'thread.rb' as an embedded library.
-
-	  Now, ext/thread/thread.c is empty, only for a dummy for
-	  compatibility.
-
-	* thread.c: move a definition of Mutex class to thread_tools.c.
-
-	  And define Mutex class under Thread (so now Mutex is Thread::Mutex).
-	  Because other thread related classes are also defined under Thread.
-	  We remain ::Mutex as Thread::Mutex. Only an inspect result is changed.
-
-	* common.mk: add dependency from thread.o to thread_tools.c.
-
-Sat Aug 22 05:31:37 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_opts.h, iseq.c, iseq.h: add compile option to force frozen
-	  string literals.
-	  [Feature #11473]
-
-	  This addition is not specification change, but to try frozen
-	  string literal world discussed on [Feature #11473].
-
-	  You can try frozen string literal world using this magical line:
-
-	    RubyVM::InstructionSequence.compile_option =
-	      {frozen_string_literal: true}
-
-	  Note that this is a global compilation option, so that you need to
-	  compile another script like that:
-
-	    p 'foo'.frozen? #=> false
-	    RubyVM::InstructionSequence.compile_option =
-	      {frozen_string_literal: true}
-	    p 'foo'.frozen? #=> false, because this line is already compiled.
-	    p eval("'foo'.frozen?") #=> true
-
-	  Details:
-	    * String literals are deduped by rb_fstring().
-	    * Dynamic string literals ("...#{xyz}...") is now only frozen,
-	      not deduped. Maybe you have other ideas.
-
-	  Now, please do not use this option on your productions :)
-	  Of course, current specification can be changed.
-
-	* compile.c: ditto.
-
-	* test/ruby/test_iseq.rb: add a test.
-
-Sat Aug 22 02:53:12 2015  Aaron Patterson <tenderlove@ruby-lang.org>
-
-	* ext/psych/*: update to Psych 2.0.14
-
-	* test/psych/*: ditto
-
-Fri Aug 21 19:58:48 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* ext/objspace/objspace.c: add a new method ObjectSpace.count_symbols.
-	  [Feature #11158]
-
-	* symbol.c (rb_sym_immortal_count): added to count immortal symbols.
-
-	* symbol.h: ditto.
-
-	* test/objspace/test_objspace.rb: add a test for this method.
-
-	* NEWS: describe about this method.
-
-Fri Aug 21 19:48:17 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* win32/Makefile.sub ($(LIBRUBY_SO)): needs additional libraries
-	  for extension libraries to link statically.
-	  [ruby-core:70499] [Feature #9018]
-
-Fri Aug 21 18:49:22 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* include/ruby/ruby.h, cont.c, vm_trace.c: add a new event
-	  fiber_switch. We need more discussion about this feature
-	  so that I don't write it on NEWS.
-	  [Feature #11348]
-
-	* test/ruby/test_settracefunc.rb: add tests.
-
-Fri Aug 21 17:32:42 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_insnhelper.c (vm_invoke_block): we should not expect ci->argc is
-	  stable after invoking a block. [Bug #11451]
-
-	* test/ruby/test_yield.rb: add a test. This test script is given by
-	  Alex Dowad.
-
-Fri Aug 21 06:35:50 2015  Aaron Patterson <tenderlove@ruby-lang.org>
-
-	* test/openssl/test_ssl_session.rb: Fix tests so that they take in to
-	  account OpenSSL installations that have SSLv3 disabled by default.
-	  Thanks Jeremy Evans <code@jeremyevans.net> for the patches.
-	  [Bug #11366] [Bug #11367]
-
-Thu Aug 20 22:19:17 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* vm_method.c (basic_obj_respond_to): call respond_to_missing?
-	  only when redefined.  [ruby-core:70460] [Bug #11465]
-
-Thu Aug 20 14:13:27 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* vm_eval.c (check_funcall_respond_to): share the behavior with
-	  rb_obj_respond_to.  [ruby-core:70460] [Bug #11465]
-
-	* vm_method.c (vm_respond_to): extract from rb_obj_respond_to and
-	  merge r39881.
-
-Thu Aug 20 08:53:09 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* vm_method.c (rb_obj_respond_to): reuse found method entry
-	  instead of searching same entry repeatedly.
-
-Thu Aug 20 08:31:17 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (replace_real_basename), win32/win32.c (opendir_internal):
-	  check reparse point tags and treat supported tags only as
-	  symbolic links.  [ruby-core:70454] [Bug #11462]
-
-Wed Aug 19 23:59:28 2015  Aaron Patterson <tenderlove@ruby-lang.org>
-
-	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): add OP_ALL to
-	  existing options rather than just setting it.  Some vendors apply
-	  custom patches to their versions of OpenSSL that set default values
-	  for options.  This commit respects the custom patches they've
-	  applied.
-
-	* test/openssl/test_ssl.rb (class OpenSSL): check that OP_ALL has been
-	  added to the options.
-
-Wed Aug 19 23:55:29 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* process.c (rb_f_spawn): [DOC] elaborate environment variable
-	  values.  [ruby-core:70456] [Bug #11463]
-
-Wed Aug 19 23:48:06 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* win32/win32.c (winnt_lstat): check reparse point tags and treat
-	  supported tags only as symbolic links.
-	  [ruby-core:70454] [Bug #11462]
-
-Tue Aug 18 20:05:49 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* thread_pthread.c (reserve_stack): ensure the memory is really
-	  allocated. [Bug #11457]
-
-Tue Aug 18 17:19:21 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (IS_BEG): include labeled argument state, which was
-	  EXPR_LABELARG.  [ruby-dev:49221] [Bug #11456]
-
-Tue Aug 18 16:16:21 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* include/ruby/ruby.h (RClass): define only in C, `__attribute__`
-	  between `struct` and the name can't compile with g++.
-	  [ruby-core:70297] [Bug #11426]
-
-Mon Aug 17 20:56:36 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y: fix syntax error at do-block after a conditional
-	  operator.  separate label-allowed and after-a-label states from
-	  others as bit flags.  [ruby-dev:48790] [Bug #10653]
-
-Mon Aug 17 11:57:36 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* io.c (rb_io_each_codepoint): raise an exception at incomplete
-	  character before EOF when conversion takes place.  [Bug #11444]
-
-Sun Aug 16 17:33:45 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* gems/bundled_gems: update latest version of bundled gems.
-	  It includes minitest-5.8.0 and test-unit 3.1.3.
-
-Sun Aug 16 17:24:10 2015  Kazuki Tsujimoto  <kazuki@callcc.net>
-
-	* gc.c (gc_mark_children): check if RCLASS_EXT is valid
-	  before marking. This fixes the following test failure
-	  introduced in r51126:
-
-	    make test-all TESTOPTS='--gc-stress ruby/test_refinement.rb'
-
-Sat Aug 15 10:51:08 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/win32/lib/win32/registry.rb (API#SetValue): data size should
-	  be in bytes, not in chars.  [ruby-core:70365] [Bug #11439]
-
-Sat Aug 15 10:15:20 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* io.c (rb_io_each_codepoint): read more data when read partially.
-	  [ruby-core:70379] [Bug #11444]
-
-Sat Aug 15 04:33:39 2015  Eric Wong  <e@80x24.org>
-
-	* hash.c (any_hash): skip rb_objid_hash for static syms
-	  (rb_num_hash_start): extract from rb_ident_hash
-	  (rb_objid_hash): call rb_num_hash_start
-	  (rb_ident_hash): ditto
-	  [ruby-core:70181] [Feature #11405]
-
-Sat Aug 15 04:16:13 2015  Eric Wong  <e@80x24.org>
-
-	* iseq.c (rb_iseq_mark): reduce NULL checks
-
-Fri Aug 14 18:50:57 2015  Eric Wong  <e@80x24.org>
-
-	* method.h (METHOD_ENTRY_VISI_SET): cast visi to int
-	  (METHOD_ENTRY_FLAGS_SET): ditto
-
-Fri Aug 14 18:43:11 2015  Eric Wong  <e@80x24.org>
-
-	* process.c (close_unless_reserved): add extra check
-	  (dup2_with_divert): remove
-	  (redirect_dup2): use dup2 without divert
-	  (before_exec_non_async_signal_safe): adjust call + comment
-	  (rb_f_exec): stop timer thread for all OSes
-	  (rb_exec_without_timer_thread): remove
-	* eval.c (ruby_cleanup): adjust call
-	* thread.c (rb_thread_stop_timer_thread): always close pipes
-	* thread_pthread.c (struct timer_thread_pipe): add writing field,
-	  mark owner_process volatile for signal handlers
-	  (rb_thread_wakeup_timer_thread_fd): check valid FD
-	  (rb_thread_wakeup_timer_thread): set writing flag to prevent close
-	  (rb_thread_wakeup_timer_thread_low): ditto
-	  (CLOSE_INVALIDATE): new macro
-	  (close_invalidate): new function
-	  (close_communication_pipe): removed
-	  (setup_communication_pipe_internal): make errors non-fatal
-	  (setup_communication_pipe): ditto
-	  (thread_timer): close reading ends inside timer thread
-	  (rb_thread_create_timer_thread): make errors non-fatal
-	  (native_stop_timer_thread): close write ends only, always,
-	   wait for signal handlers to finish
-	  (rb_divert_reserved_fd): remove
-	* thread_win32.c (native_stop_timer_thread): adjust (untested)
-	  (rb_divert_reserved_fd): remove
-	* vm_core.h: adjust prototype
-	  [ruby-core:70386] [Bug #11336]
-
-Fri Aug 14 18:40:43 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/win32/lib/win32/registry.rb (API#SetValue): add terminator
-	  size, not 1 byte.  [ruby-core:70365] [Bug #11439]
-
-Thu Aug 13 22:49:42 2015  Juanito Fatas  <katehuang0320@gmail.com>
-
-	* lib/timeout.rb (Timeout#timeout): freeze a string message to
-	  reduce string allocations.  [Fix GH-996]
-
-Thu Aug 13 17:42:34 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_core.h (rb_call_info_kw_arg_bytes): move the definition
-	  to iseq.h because this function is shared with iseq.c and compile.c.
-
-Thu Aug 13 14:36:31 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* object.c (rb_num_to_dbl): move from num2dbl_with_to_f in math.c.
-
-Thu Aug 13 09:01:25 2015  Eric Wong  <e@80x24.org>
-
-	* load.c (features_index_add): avoid repeat calculation
-
-Wed Aug 12 21:57:31 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* id_table.c: IMPL() macro accept op as _opname instead of opname
-	  because jemalloc seems to replace the word `free' to `je_free'.
-
-Wed Aug 12 21:51:11 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* id_table.c (mix_id_table_insert): fix memory leak.
-
-Wed Aug 12 21:17:38 2015  Eric Wong  <e@80x24.org>
-
-	* iseq.c (iseq_memsize): reimplement for wrapper
-	  (param_keyword_size): extracted from iseq_memsize
-	  (iseqw_mark): new mark function
-	  (iseqw_data_type): new data type
-	  (iseqw_new): wrap as iseqw_data_type
-	  (iseqw_check): adjust for wrapper
-	  (Init_ISeq): remove iseqw_iseq_key initialization
-	* test/objspace/test_objspace.rb: new test
-	  [ruby-core:70344] [Feature #11435]
-
-Wed Aug 12 21:15:27 2015  Eric Wong  <e@80x24.org>
-
-	* vm_core.h (rb_call_info_kw_arg_bytes): extract from compile.c
-	* compile.c (iseq_build_callinfo_from_hash): use above function
-
-Wed Aug 12 18:00:17 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* class.c (move_refined_method): same as the last commit.
-
-Wed Aug 12 17:57:53 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* class.c, gc.c vm.c: use ID_TABLE_* instead of ST_*
-	  (such as ST_CONTINUE) for enum rb_id_table_iterator_result.
-
-Wed Aug 12 17:05:36 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* id_table.h: introduce ID key table.
-	  [Feature #11420]
-
-	  This table only manage ID->VALUE table to reduce overhead of st.
-
-	  Some functions prefixed rb_id_table_* are provided.
-
-	* id_table.c: implement rb_id_table_*.
-
-	  There are several algorithms to implement it.
-
-	  Now, there are roughly 4 types:
-
-	    * st
-	    * array
-	    * hash (implemented by  Yura Sokolov)
-	    * mix of array and hash
-
-	  The macro ID_TABLE_IMPL can choose implementation.
-	  You can see detailes about them at the head of id_table.c.
-
-	  At the default, I choose 34 (mix of list and hash).
-	  This is not final decision.
-	  Please report your suitable parameters or
-	  your data structure.
-
-	  * symbol.c: introduce rb_id_serial_t and rb_id_to_serial()
-	    to represent ID by serial number.
-
-	  * internal.h: use id_table for method tables.
-
-	  * class.c, gc.c, marshal.c, vm.c, vm_method.c: ditto.
-
-Wed Aug 12 05:19:11 2015  Eric Wong  <e@80x24.org>
-
-	* parse.y (rb_parser_compile_cstr): remove volatile arg
-	  (rb_parser_compile_string): ditto
-	  (rb_parser_compile_file): ditto
-	  (rb_parser_compile_string_path): ditto
-	  (rb_parser_compile_file_path): ditto
-	  [ruby-core:70323] [Misc #11431]
-
-Tue Aug 11 22:59:57 2015  Tanaka Akira  <akr@fsij.org>
-
-	* numeric.c (Init_Numeric): Fix document for Float::MIN and
-	  Float::EPSILON.
-
-Tue Aug 11 15:22:31 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* include/ruby/ruby.h (ALLOCV_N): check integer overflow, as well
-	  as ruby_xmalloc2.  pointed out by Paul <pawlkt AT gmail.com>.
-
-Tue Aug 11 14:57:09 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* array.c (rb_ary_repeated_permutation): fix buffer size, ALLOCV_N
-	  already multiplies element size.
-
-Tue Aug 11 12:13:20 2015  Jeremy Evans  <merch-redmine@jeremyevans.net>
-
-	* test/openssl/test_ssl.rb: Fix LocalJumpErrors being raised
-	  in OpenSSL tests. [ruby-core:70020][Bug #11368]
-
-Tue Aug 11 11:54:13 2015  Alexey Lipnyagov  <liptonshmidt@gmail.com>
-
-	* string.c: Fix documentation for String#slice
-	  [ruby-core:70298][Bug #11427]
-
-Tue Aug 11 11:53:28 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (superclass): make superclass rule optional and allow
-	  any contents without a terminator.  [EXPERIMENTAL]
-
-Tue Aug 11 10:58:42 2015  Juanito Fatas  <juanitofatas@gmail.com>
-
-	* string.c: [DOC] Make #end_with? example doc symmetry
-	  with #start_with? [fix GH-992][ci skip]
-
-Tue Aug 11 10:51:19 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* test/ruby/test_array.rb: Add test for `Array#flatten` with level 1
-	  [fix GH-986] Patch @yui-knk
-
-Tue Aug 11 10:48:16 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* enum.c: added doc for Enumerable#zip
-	  [fix GH-985] Patch by @yui-knk
-	* test/ruby/test_enum.rb: added tests for Enumerable#zip
-	  [fix GH-985] Patch @yui-knk
-
-Tue Aug 11 10:33:26 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* vm_method.c: typo fix [fix GH-993][ci skip] Patch by @0x0dea
-	* test/ruby/test_refinement.rb: ditto.
-
-Sun Aug  9 14:15:54 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* vm.c (Init_vm_objects, rb_vm_fstring_table): use frozen_strings
-	  table in rb_vm_t.  [ruby-core:70274] [Bug #11423]
-
-Sat Aug  8 03:59:51 2015  Zachary Scott  <zzak@ruby-lang.org>
-
-	* object.c: [DOC] Improve grammar for Module#===
-	  Patch by @SkyBirdSoar in documenting-ruby/ruby#52:
-	  https://github.com/documenting-ruby/ruby/pull/52
-
-Sat Aug  8 03:39:33 2015  Zachary Scott  <zzak@ruby-lang.org>
-
-	* hash.c: [DOC] Improve description of symbol key syntax
-	  Patch by Raphael Das Gupta in documenting-ruby/ruby#51:
-	  https://github.com/documenting-ruby/ruby/pull/51
-
-Fri Aug  7 21:04:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (parser_params): turn in_def and in_single into bit
-	  flags and reduce the size by 2-words.
-
-	* parse.y (parser_params): remove redundant prefixes.
-
-	* parse.y (yylex): non-pure parser has not been supported since
-	  merger of ripper.  change argument types from void pointers.
-
-Fri Aug  7 17:07:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* proc.c (method_super_method): uncallable method entry does not
-	  have the defined class, use the owner instead.
-	  [ruby-core:70254] [Bug #11419]
-
-	* test/ruby/test_method.rb (test_super_method_unbound): add test
-	  by Akira Matsuda.
-
-Thu Aug  6 10:49:57 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* node.c (rb_alloc_tmp_buffer): round up the size and check the
-	  range.
-
-	* ruby_atomic.h (ATOMIC_VALUE_EXCHANGE, ATOMIC_VALUE_CAS): add
-	  atomic operations for VALUE.
-
-Thu Aug  6 08:15:49 2015  Aaron Patterson <tenderlove@ruby-lang.org>
-
-	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): move
-	  SSLSocket#sysclose to Ruby.
-
-	* ext/openssl/ossl_ssl.c (ossl_ssl_close): ditto
-
-Thu Aug  6 07:57:21 2015  Aaron Patterson <tenderlove@ruby-lang.org>
-
-	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): move nonblock
-	  enable to SSLSocket#initialize and remove Nonblock module.
-
-Thu Aug  6 07:53:47 2015  Aaron Patterson <tenderlove@ruby-lang.org>
-
-	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): move
-	  OpenSSL::SSL::SSLSocket#initialize to Ruby.
-
-	* ext/openssl/ossl_ssl.c: ditto
-
-Thu Aug  6 02:25:31 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* node.c (rb_alloc_tmp_buffer): use NODE_ALLOCA to mark locations
-	  like as builtin alloca.  [ruby-core:70251] [Bug #11418]
-
-Wed Aug  5 14:37:55 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* transcode.c (rb_econv_open0): rb_econv_t::source_encoding_name
-	  and rb_econv_t::destination_encoding_name should refer static
-	  strings always or NULL.  [ruby-core:70247] [Bug #11416]
-
-Tue Aug  4 16:53:43 2015  Aaron Patterson <tenderlove@ruby-lang.org>
-
-	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): extract callback
-	  lookup to private Ruby methods. This means we can keep the default
-	  DH callback logic hidden from consumers.  Also, since the SSLSocket
-	  always has a context, we can remove conditionals about that
-	  instance.
-
-	* ext/openssl/ossl_ssl.c: move callback lookup methods to private Ruby
-	  methods.
-
-Tue Aug  4 16:40:26 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* test/ruby/test_module.rb: should not expect a method table ordering.
-	  [Feature #11414]
-
-Tue Aug 04 15:30:04 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* proc.c (rb_block_clear_env_self): clear by Qfalse instead of Qnil.
-	  [Bug #11409]
-
-	* test/ruby/test_eval.rb: add tests for this issue,
-	  written by @0x0dea.
-	  https://github.com/ruby/ruby/pull/988
-
-Tue Aug  4 12:12:14 2015  Eric Wong  <e@80x24.org>
-
-	* variable.c: wrap long lines
-
-Tue Aug  4 09:32:30 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* proc.c: Removing duplicate doc [fix GH-987][ci skip]
-	  Patch by @ronakjangir47
-
-Tue Aug  4 09:21:58 2015  Richard Schneeman  <richard.schneeman+foo@gmail.com>
-
-	* doc/contributing.rdoc: fixed wrong instructions with OS X
-	  [fix GH-989][ci skip] Patch by @schneems
-
-Mon Aug  3 10:08:33 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* re.c (rb_memsearch): should match only char boundaries in wide
-	  character encodings.  [ruby-core:70220] [Bug #11413]
-
-Sun Aug  2 07:01:17 2015  Eric Wong  <e@80x24.org>
-
-	* ext/openssl/lib/openssl/buffering.rb (gets):
-	  avoid comparing fixnum with nil
-	* test/openssl/test_pair.rb: test gets with limit when EOF is hit
-	  Thanks to Bar Hofesh <bar.hofesh@safe-t.com> for the bug report
-	  and testing.
-	  [ruby-core:70149] [Bug #11400]
-
-Sat Aug  1 17:13:15 2015  Kazuki Tsujimoto  <kazuki@callcc.net>
-
-	* lib/net/http/response.rb (Net::HTTPResponse::Inflater#finish):
-	  fix a bug that empty gzipped response body causes Zlib::BufError.
-	  [ruby-core:68846] [Bug #11058]
-
-	* test/net/http/test_httpresponse.rb: tests for the above.
-
-Sat Aug  1 17:05:18 2015  Kazuki Tsujimoto  <kazuki@callcc.net>
-
-	* lib/net/http/response.rb (Net::HTTPResponse#inflater):
-	  fix TypeError. An exception object might be nil.
-	  [ruby-core:68846] [Bug #11058]
-
-Sat Aug  1 09:09:46 2015  Aaron Patterson <tenderlove@ruby-lang.org>
-
-	* ext/openssl/ossl_ssl.c (ossl_sslctx_setup): Implement
-	  SSLContext#options and options= using SSL_CTX_set_options and
-	  SSL_CTX_get_options. This reduces the number of ivars we need and
-	  simplifies `ossl_sslctx_setup`.
-
-	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): Default `options`
-	  to SSL_OP_ALL
-
-Sat Aug  1 06:54:36 2015  Aaron Patterson <tenderlove@ruby-lang.org>
-
-	* ext/openssl/ossl_ssl.c (Init_ossl_ssl): OpenSSL declares these
-	  constants as longs, so we should follow that and use LONG2NUM.
-	  http://git.io/vOqxD
-
-Sat Aug  1 04:06:29 2015  Aaron Patterson <tenderlove@ruby-lang.org>
-
-	* ext/openssl/ossl_ssl.c (ossl_call_tmp_dh_callback): change callback
-	  to return the Ruby dh (or ecdh) object that the caller cares about
-	  instead of doing rb_iv_get / set to communicate.  This means we can
-	  remove an rb_iv_get call, and only use the set calls for their
-	  intended purpose (to prevent the object from being GC'd).
-
-	* ext/openssl/ossl_ssl.c (ossl_tmp_dh_callback): ditto
-	* ext/openssl/ossl_ssl.c (ossl_call_tmp_ecdh_callback): ditto
-	* ext/openssl/ossl_ssl.c (ossl_tmp_ecdh_callback): ditto
-
-Sat Aug  1 03:49:31 2015  Aaron Patterson <tenderlove@ruby-lang.org>
-
-	* ext/openssl/ossl_ssl.c (ossl_call_tmp_dh_callback): Similarly to the
-	  tmp_ecdh_callback, the SSLSocket instance always holds a reference
-	  to the SSLContext object (it's always set in `initialize`).  The
-	  SSLContext holds a reference to the tmp_dh_callback.  Ask the
-	  context for the callback instead of storing the callback in two
-	  places.
-
-Sat Aug  1 03:43:10 2015  Aaron Patterson <tenderlove@ruby-lang.org>
-
-	* ext/openssl/ossl_ssl.c (ossl_call_tmp_dh_callback): create an array
-	  and use `rb_apply` to clean up calls to `rb_protect`.
-
-	* ext/openssl/ossl_ssl.c (ossl_tmp_dh_callback): ditto
-
-Sat Aug  1 03:27:12 2015  Aaron Patterson <tenderlove@ruby-lang.org>
-
-	* ext/openssl/ossl_ssl.c (ossl_call_tmp_ecdh_callback): The SSL socket
-	  always holds a reference to the SSLContext object, which will have
-	  the callback object.  Ask the context for the callback instead of
-	  storing the callback in two places.
-
-Sat Aug  1 03:14:07 2015  Aaron Patterson <tenderlove@ruby-lang.org>
-
-	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): convert
-	  `tmp_dh_callback` to Ruby, and call it when setting up an SSL
-	  connection.  This allows us to move the "default" behavior to the
-	  reader method.
-
-	* ext/openssl/ossl_ssl.c: call the tmp_dh_callback instead of
-	  accessing the SSLContext's internals.
-
-Fri Jul 31 23:34:27 2015  Aaron Patterson <tenderlove@ruby-lang.org>
-
-	* .travis.yml: update libssl before running tests.
-	  Thanks to Chris Sinjakli <chris@sinjakli.co.uk> for figuring out the
-	  travis settings!
-
-Fri Jul 31 21:34:49 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* load.c (rb_require_internal): use rb_load_internal0 not to raise
-	  a exception to be caught.
-
-Thu Jul 30 13:19:54 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* variable.c (rb_const_get_0): warn deprecated constant reference.
-
-	* variable.c (rb_mod_deprecate_constant): mark constants to be
-	  warned as deprecated.  [Feature #11398]
-
-Thu Jul 30 11:53:54 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* thread.c (rb_thread_s_handle_interrupt): make identity hash, to
-	  compare masking classes just by their IDs.
-
-Thu Jul 30 11:52:55 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* load.c (rb_load_internal0): stop separating exits at loading
-	  from exits from execution.  TAG_FATAL is the only case that
-	  `errinfo` is a Fixnum, and should continue to exit by JUMP_TAG
-	  but not raising as an ordinary exception.
-	  [ruby-core:70169] [Bug #11404]
-
-Thu Jul 30 10:42:27 2015  Alex Dowad  <alexinbeijing@gmail.com>
-
-	* load.c (rb_load_internal0): extra check before returning
-	  TAG_RAISE when a non-local transfer of control happens while
-	  loading and parsing a Ruby source file.
-	  [ruby-core:70169] [Bug #11404]
-
-Thu Jul 30 08:48:42 2015  Eric Wong  <e@80x24.org>
-
-	* st.c (find_entry): constify st_table*
-	  (find_packed_index_from): ditto
-	  (find_packed_index): ditto
-	  (get_keys): ditto
-	  (get_values): ditto
-
-Thu Jul 30 04:29:25 2015  Eric Wong  <e@80x24.org>
-
-	* benchmark/bm_hash_aref_dsym.rb: new benchmark
-	* benchmark/bm_hash_aref_dsym_long.rb: ditto
-	* benchmark/bm_hash_aref_fix.rb: ditto
-
-Wed Jul 29 21:38:41 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* hash.c (any_hash), symbol.c (dsymbol_alloc): fix dynamic symbol
-	  hash value by restricting in Fixnum range, that is `long`.
-
-Wed Jul 29 17:25:46 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* hash.c (rb_obj_hash): move in order to share with rb_any_hash.
-
-Wed Jul 29 16:00:22 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* string.c (str_buf_cat): consider empty non-embed string case,
-	  not to loop infinitely.  [ruby-core:70074] [Bug #11383]
-
-Wed Jul 29 15:25:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* vm_eval.c (send_internal): set method_missing_reason before
-	  invoking overriding method_missing method so that the default
-	  method_missing can achieve it properly.
-	  [ruby-core:68515] [Bug #10969]
-
-Wed Jul 29 14:54:16 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* hash.c (rb_sym_hash): return same value as rb_any_hash() of
-	  Symbol.  [Bug #9381]
-
-	* hash.c (rb_any_hash): fix Float hash.  rb_dbl_hash() returns a
-	  Fixnum, but not a long.  [Bug #9381]
-
-Wed Jul 29 11:07:10 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* internal.h (LIKELY, UNLIKELY): make a boolean to enforce 1 or 0.
-
-Wed Jul 29 10:44:43 2015  Alex Dowad  <alexinbeijing@gmail.com>
-
-	* gc.c: document argument passed to finalizer proc.
-	  [fix GH-976][ci skip] Patch by @alexdowad
-
-Wed Jul 29 10:36:58 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* io.c (rb_io_extract_modeenc): add option parameter `flags'
-	  to append extra oflags to normal mode.
-	  [Feature #11253] [ruby-core:69539]
-
-Wed Jul 29 04:54:47 2015  Eric Wong  <e@80x24.org>
-
-	* test/rubygems/test_gem_remote_fetcher.rb: pre-generate test key
-	  [ruby-core:70151] [Bug #11397]
-
-Tue Jul 28 10:32:09 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* internal.h (struct RClass): moved from ruby/ruby.h to hide the
-	  internals.
-
-Tue Jul 28 08:48:29 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in (RUBY_TYPE_ATTRIBUTE): attribute declaration for
-	  types.
-
-Tue Jul 28 07:23:03 2015  Eric Wong  <e@80x24.org>
-
-	* symbol.h (struct RSymbol): add hashval field
-	* symbol.c (dsymbol_alloc): setup hashval field once
-	* hash.c (rb_any_hash): return RSymbol->hashval directly
-	* common.mk: hash.o depends on symbol.h
-	  Thanks to Bruno Escherl <bruno@escherl.net> for the bug report
-	  [ruby-core:70129] [Bug #11396]
-
-Tue Jul 28 03:26:15 2015  Aaron Patterson <tenderlove@ruby-lang.org>
-
-	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): raise a more
-	  helpful exception when verifying the peer connection and an
-	  anonymous cipher has been selected. [ruby-core:68330] [Bug #10910]
-	  Thanks to Chris Sinjakli <chris@sinjakli.co.uk> for the patch.
-
-	* test/openssl/test_ssl.rb (class OpenSSL): test for change
-
-Mon Jul 27 13:24:11 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* template/id.h.tmpl (ID2ATTRSET): remove an unused macro.
-
-Mon Jul 27 12:21:15 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* test/openssl/test_ssl.rb: run tests on non-Unix platforms.
-
-Sun Jul 26 19:21:31 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/openssl/ossl_ssl.c (ossl_ssl_alpn_protocol): fix condition
-	  to compile, needs ALPN to be available.  [Feature #9390]
-
-Sun Jul 26 11:29:01 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* signal.c (default_handler, Init_signal): discard SIGSYS, ENOSYS
-	  should raise a SystemCallError always instead.
-
-Sun Jul 26 10:26:35 2015  Aaron Patterson <tenderlove@ruby-lang.org>
-
-	* ext/openssl/ossl_ssl.c (ossl_call_servername_cb): set the ssl context
-	  object returned by the servername callback on to the socket as an
-	  instance variable.  If the callback allocated a new context object
-	  and didn't keep a reference to it, it could be GC'd out from under
-	  the socket object.
-
-	* test/openssl/test_ssl.rb (class OpenSSL): test for change.
-
-Sun Jul 26 10:07:26 2015  Aaron Patterson <tenderlove@ruby-lang.org>
-
-	* test/openssl/test_ssl.rb (class OpenSSL): add test coverage around
-	  OpenSSL::SSL::SSLContext#servername_cb
-
-Sun Jul 26 09:10:32 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* gems/bundled_gems: update latest version of bundled power_assert.
-
-Sun Jul 26 08:49:28 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* test/rubygems/test_gem_remote_fetcher.rb: backport rubygems upstream
-	  change for OpenSSL key length. see detail to
-	  https://github.com/rubygems/rubygems/pull/1290
-
-Sun Jul 26 08:33:03 2015  Aaron Patterson <tenderlove@ruby-lang.org>
-
-	* ext/openssl/lib/openssl/pkey.rb: implement DEFAULT_512 and
-	  DEFAULT_1024 constants in Ruby.
-
-	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): Ask PKey for the
-	  default DH callback since it already must check whether openssl has
-	  been compiled with DH support.
-
-	* ext/openssl/ossl_pkey_dh.c (OSSL_PKEY_BN): Remove C definitions of
-	  DEFAULT_512 and DEFAULT_1024
-
-	* ext/openssl/ossl_pkey_dh.c (Init_ossl_dh): ditto
-
-	* test/openssl/test_pkey_dh.rb (class OpenSSL): add test to ensure the
-	  Ruby definitions are the same as the C definitions were.
-
-Sun Jul 26 08:14:59 2015  Aaron Patterson <tenderlove@ruby-lang.org>
-
-	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): support
-	  specifically setting the tmp_dh_callback to nil.
-
-	* ext/openssl/ossl_ssl.c (Init_ossl_ssl): ditto
-
-	* test/openssl/test_pair.rb (module OpenSSL): add a test
-
-Sun Jul 26 07:47:14 2015  Aaron Patterson <tenderlove@ruby-lang.org>
-
-	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): move the default
-	  tmp_dh_callback Ruby code and set it as a default in `initialize`.
-
-	* ext/openssl/ossl_pkey_dh.c (static unsigned char DEFAULT_DH_512_GEN):
-	  move this constant to Ruby.
-
-	* ext/openssl/ossl_pkey_dh.c (static unsigned char DEFAULT_DH_1024_GEN):
-	  ditto
-
-	* ext/openssl/ossl_pkey_dh.c (Init_ossl_dh): ditto
-
-	* ext/openssl/ossl_ssl.c (ossl_tmp_dh_callback): ditto
-
-	* ext/openssl/ossl_ssl.c (ossl_sslctx_setup): tmp_dh_callback should
-	  always be set, so we can remove this conditional
-
-Sun Jul 26 06:22:24 2015  Aaron Patterson <tenderlove@ruby-lang.org>
-
-	* test/openssl/test_pair.rb: add a test ensuring that the default DH
-	  callback is used when no DH callback is specified.
-
-Sun Jul 26 04:08:27 2015  Aaron Patterson <tenderlove@ruby-lang.org>
-
-	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): add missing
-	  instance variables to squash warnings with alpn.
-
-Sun Jul 26 03:42:19 2015  Aaron Patterson <tenderlove@ruby-lang.org>
-
-	* ext/openssl/lib/openssl/ssl.rb (module OpenSSL): move
-	  OpenSSL::SSL::SSLContext#initialize implementation to pure Ruby.
-
-	* ext/openssl/ossl_ssl.c (ossl_sslctx_initialize): ditto
-
-	* ext/openssl/ossl_ssl.c (Init_ossl_ssl): ditto
-
-Sat Jul 25 21:03:45 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* random.c (fill_random_bytes_syscall): get rid of blocking when
-	  no entropy is available.  based on the patch by mame in
-	  [ruby-core:70114].  [Bug #11395]
-
-Sat Jul 25 11:05:31 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* string.c (str_replace_shared_without_enc): fill the terminator
-	  of embedded strings in wide char encodings.
-
-Sat Jul 25 06:38:36 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_core.h: size should be unsigned.
-	  * rb_call_info_t::index
-	  * rb_iseq_constant_body::stack_max
-	  * rb_iseq_constant_body::local_size
-	  * rb_iseq_constant_body::param::size
-	  * rb_iseq_constant_body::local_table_size
-	  * rb_iseq_constant_body::is_size
-	  * rb_iseq_constant_body::callinfo_size
-
-	* iseq.h: same for iseq_catch_table::size.
-
-	* compile.c: catch up these fix.
-
-	* iseq.c: ditto.
-
-	* proc.c: ditto.
-
-	* vm.c: ditto.
-
-	* vm_args.c: ditto.
-
-	* vm_eval.c: ditto.
-
-	* vm_insnhelper.c: ditto.
-
-Sat Jul 25 06:00:09 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_core.h: constify rb_iseq_constant_body::line_info_table.
-
-	* iseq.c: catch up this fix.
-
-Sat Jul 25 05:56:43 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_core.h: constify rb_iseq_constant_body::param::opt_table and
-	  rb_iseq_constant_body::param::keyword.
-
-	* compile.c: catch up this fix.
-
-Sat Jul 25 04:47:01 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_core.h: constify rb_iseq_constant_body::catch_table.
-
-	* compile.c (iseq_set_exception_table): catch up this fix.
-
-	* iseq.c: ditto.
-
-	* vm.c (vm_exec): ditto.
-
-Fri Jul 24 21:29:54 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* st.c (EQUAL, st_delete_safe): fix arguments order to compare
-	  function, searching key is the first and stored key is the
-	  second always.
-
-Fri Jul 24 21:27:29 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* string.c (fstr_update_callback): fstring must not be a shared
-	  string, or the content without RSTRING_FSTR may be freed.
-	  [ruby-dev:49188] [Bug #11386]
-
-Fri Jul 24 20:09:43 2015  Naohisa Goto  <ngotogenome@gmail.com>
-
-	* test/rinda/test_rinda.rb (RingIPv6#prepare_ipv6): prevent to use
-	  IPv6 loopback interface for
-	  Rinda::TestRingFinger#test_make_socket_ipv6_multicast and
-	  Rinda::TestRingFinger#test_make_socket_ipv6_multicast_hops.
-	  The tests are skipped if there are no IPv6 devices other than the
-	  loopback device. [Bug #11394] [ruby-dev:49199]
-
-	* test/rinda/test_rinda.rb (test_make_socket_ipv6_multicast): ditto
-	  for Rinda::TestRingServer#test_make_socket_ipv6_multicast.
-
-	* test/rinda/test_rinda.rb (test_ring_server_ipv6_multicast): ditto
-	  for Rinda::TestRingServer#test_ring_server_ipv6_multicast.
-
-Fri Jul 24 16:35:55 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* string.c (fstr_update_callback): pool bare strings only.
-
-	* string.c (rb_fstring): return the original string with sharing a
-	  fstring if it has extra attributes, not the fstring itself.
-	  [ruby-dev:49188] [Bug #11386]
-
-Fri Jul 24 16:35:34 2015  yui-knk  <spiketeika@gmail.com>
-
-	* file.c (rb_file_s_extname): [DOC] add an example.
-
-	* test/ruby/test_path.rb (test_extname): add tests.  [Fix GH-978]
-	  * path starts with dot ('.a.rb')
-	  * path includes dir name ('a/b/d/test.rb')
-	  * path includes dir name and dir name starts with dot
-	    ('.a/b/d/test.rb')
-
-Thu Jul 23 18:50:43 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_core.h: constify rb_iseq_constant_body::local_table and
-	  rb_iseq_param_keyword::table and
-	  rb_iseq_param_keyword::default_values.
-
-	* compile.c: catch up this fix.
-
-	* iseq.c: ditto.
-
-Thu Jul 23 17:30:43 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_core.h: constify rb_iseq_constant_body::iseq_encoded and
-	  rb_control_frame_t::pc.
-
-	* compile.c (rb_iseq_translate_threaded_code): catch up this fix.
-
-	* iseq.c: ditto.
-
-	* vm_exec.c (vm_exec_core): ditto.
-
-Thu Jul 23 10:25:46 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* include/ruby/ruby.h: add raw FL macros, which assume always the
-	  argument object is not a special constant.
-
-	* internal.h (STR_EMBED_P, STR_SHARED_P): valid only for T_STRING.
-
-	* string.c: deal with taint flags directly across String instances.
-
-Thu Jul 23 09:05:28 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (lambda_body): pop cmdarg stack for lookahead
-	  token.  [ruby-core:70067] [Bug #11380]
-
-Thu Jul 23 04:03:03 2015  Aaron Patterson <tenderlove@ruby-lang.org>
-
-	* ext/openssl/ossl_ssl.c: fix tests by not setting the instance
-	  variable on the frozen ssl instance.
-
-Thu Jul 23 03:32:26 2015  Aaron Patterson <tenderlove@ruby-lang.org>
-
-	* ext/openssl/ossl_ssl.c: add ECDH callback support. [Feature #11356]
-
-	* test/openssl/test_pair.rb: test for ECDH callback support
-
-Thu Jul 23 03:29:49 2015  Aaron Patterson <tenderlove@ruby-lang.org>
-
-	* ext/openssl/ossl_ssl.c: add ALPN support. [Feature #9390]
-
-	* ext/openssl/extconf.rb: detect ALPN support in OpenSSL
-
-	* test/openssl/test_ssl.rb: test for ALPN
-
-Wed Jul 22 23:44:17 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* string.c (rb_str_reverse): reversed string is not a substring,
-	  and should not set coderange of the original string.
-	  [ruby-dev:49189] [Bug #11387]
-
-Wed Jul 22 20:17:51 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_core.h: modify layout of rb_iseq_constant_body.
-
-	  Move frequent accessing fields to upper part.
-
-Wed Jul 22 19:57:47 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_core.h: remove unused declaration of
-	  iseq_compile_data_ensure_node_stack.
-
-Wed Jul 22 19:52:45 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_core.h: separate rb_iseq_body into rb_iseq_constant_body and
-	  rb_iseq_variable_body (rb_iseq_t::variable_body).
-
-	  rb_iseq_variable_body can be modified after compilation.
-
-	* compile.c: use rb_iseq_t::variable_body.
-
-	* iseq.c: ditto.
-
-	* thread.c: ditto.
-
-Wed Jul 22 17:50:35 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* lib/matrix/eigenvalue_decomposition.rb: refine code style.
-	  [fix GH-959][ci skip] Patch by @bogdanvlviv
-
-Wed Jul 22 15:48:47 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* test/ruby/test_range.rb: Add test case for Range#end with
-	  exclude_end true case. [fix GH-968] Patch by @yui-knk
-
-Wed Jul 22 09:45:31 2015  Maksim Sitnikov  <sitnikovme@undev.ru>
-
-	* numeric.c (num_coerce): [DOC] fix doc for Numeric#coerce,
-	  missing '+'.  [Fix GH-974]
-
-Wed Jul 22 07:24:18 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* make rb_iseq_t T_IMEMO object (type is imemo_iseq).
-
-	  All contents of previous rb_iseq_t is in rb_iseq_t::body.
-	  Remove rb_iseq_t::self because rb_iseq_t is an object.
-
-	  RubyVM::InstructionSequence is wrapper object points T_IMEMO/iseq.
-	  So RubyVM::ISeq.of(something) method returns different wrapper
-	  objects but they point the same T_IMEMO/iseq object.
-
-	  This patch is big, but most of difference is replacement of
-	  iseq->xxx to iseq->body->xxx.
-
-	  (previous) rb_iseq_t::compile_data is also located to
-	  rb_iseq_t::compile_data.
-	  It was moved from rb_iseq_body::compile_data.
-
-	  Now rb_iseq_t has empty two pointers.
-	  I will split rb_iseq_body data into static data and dynamic data.
-
-	* compile.c: rename some functions/macros.
-	  Now, we don't need to separate iseq and iseqval (only VALUE).
-
-	* eval.c (ruby_exec_internal): `n' is rb_iseq_t (T_IMEMO/iseq).
-
-	* ext/objspace/objspace.c (count_imemo_objects): count T_IMEMO/iseq.
-
-	* gc.c: check T_IMEMO/iseq.
-
-	* internal.h: add imemo_type::imemo_iseq.
-
-	* iseq.c: define RubyVM::InstructionSequence as T_OBJECT.
-	  Methods are implemented by functions named iseqw_....
-
-	* load.c (rb_load_internal0): rb_iseq_new_top() returns
-	  rb_iseq_t (T_IMEMO/iesq).
-
-	* method.h (rb_add_method_iseq): accept rb_iseq_t (T_IMEMO/iseq).
-
-	* vm_core.h (GetISeqPtr): removed because it is not T_DATA now.
-
-	* vm_core.h (struct rb_iseq_body): remove padding for
-	  [Bug #10037][ruby-core:63721].
-
-Wed Jul 22 07:15:33 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* ext/objspace/objspace.c (total_i): no need to skip singleton classes.
-
-Wed Jul 22 06:37:54 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_core.h: constify rb_call_info_t::kw_arg,
-	  rb_control_frame_t::iseq and rb_control_frame_t::block_iseq.
-
-	* iseq.c (iseq_free): catch up this fix.
-
-	* vm.c: ditto.
-
-	* vm_dump.c: ditto.
-
-Wed Jul 22 06:25:45 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_core.h: constify rb_call_info_t::blockiseq and rb_block_t::iseq.
-
-	* vm.c, vm_insnhelper.c: catch up this fix.
-
-	* iseq.c (iseq_data_to_ary): constify the first iseq parameter.
-
-	* vm_insnhelper.c (vm_make_proc_with_iseq): ditto.
-
-Wed Jul 22 06:17:35 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* method.h: constify rb_method_iseq_t::iseqptr.
-
-	* proc.c (rb_method_entry_min_max_arity): catch up this fix.
-
-	* vm_insnhelper.c (def_iseq_ptr): constify.
-
-Wed Jul 22 03:37:39 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (internal_object_p): Now a singleton classes appear by
-	  ObjectSpace.each_object. [Bug #11360]
-
-	* test/ruby/test_objectspace.rb: add a test about it.
-
-Tue Jul 21 21:21:33 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* thread.c (do_select): replace switch and goto with a loop to
-	  suppress maybe-uninitialized warnings by gcc6.
-
-	* thread.c (set_unblock_function, rb_wait_for_single_fd): ditto.
-
-Tue Jul 21 20:32:33 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* test/ruby/test_range.rb: Add test for Range#hash
-	  [fix GH-969] Patch by @yui-knk
-
-Tue Jul 21 19:43:20 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* compile.c: constify the first parameter (iseq).
-	  * iseq_add_mark_object()
-	  * iseq_add_mark_object_compile_time()
-
-	* iseq.c, iseq.h (rb_iseq_add_mark_object): ditto.
-
-Tue Jul 21 16:18:48 2015  Eric Wong  <e@80x24.org>
-
-	* test/socket/test_nonblock.rb: increase buffer sizes
-	  to OpenBSD limits. Thanks to Jeremy Evans <code@jeremyevans.net>
-	  [ruby-core:70058]
-
-Tue Jul 21 16:08:53 2015  Eric Wong  <e@80x24.org>
-
-	* load.c (ruby_dln_librefs): make static
-
-Tue Jul 21 13:36:54 2015  yuuji.yaginuma  <yuuji.yaginuma@gmail.com>
-
-	* lib/optparse.rb (complete): [DOC] fix typo.  [Fix GH-973]
-
-Tue Jul 21 05:20:21 2015  Eric Wong  <e@80x24.org>
-
-	* io.c (nogvl_wait_for_single_fd): new function for Linux
-	  (maygvl_copy_stream_wait_read): Linux-specific version
-	  (nogvl_copy_stream_wait_write): use nogvl_wait_for_single_fd
-	  [ruby-core:70051] [Feature #11377]
-
-Mon Jul 20 15:04:30 2015  Eric Wong  <e@80x24.org>
-
-	* parse.y (parser_initialize): avoid redundant zero-ing
-
-Mon Jul 20 12:12:05 2015  Eric Wong  <e@80x24.org>
-
-	* parse.y (struct parser_params): pack: 88 => 256 bytes on 64-bit
-	  [ruby-core:70034] [Feature #11371]
-
-Sun Jul 19 14:29:18 2015  windwiny  <windwiny.ubt@gmail.com>
-
-	* ext/pty/pty.c: [DOC] fix example typo, an old name at move from
-	  PTY.open.  [Fix GH-972]
-
-Sat Jul 18 21:29:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* thread.c (vm_check_ints_blocking): gather common statements at
-	  the end, and prefer LIKELY for Visual C optimization.
-
-Sat Jul 18 20:44:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* load.c (rb_load_internal0): do not raise any exceptions but
-	  return the result tag state.
-
-	* load.c (rb_load_protect): reduce nested EXEC_TAGs.
-
-Sat Jul 18 19:52:17 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* gc.c (run_finalizer): set and restore safe level here to reduce
-	  nested EXEC_TAGs.
-
-Sat Jul 18 18:45:22 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* eval.c (ruby_cleanup): error_handle() returns exit status to the
-	  system, not internal error state, do not convert the exit status
-	  again.
-
-Sat Jul 18 10:29:03 2015  Eric Wong  <e@80x24.org>
-
-	* test/ruby/test_process.rb: test thread+sigs work after failed exec
-
-Sat Jul 18 07:20:18 2015  Jeremy Evans  <code@jeremyevans.net>
-
-	* test/socket/test_nonblock: use smaller buffer for sendmsg
-	  [ruby-core:70016] [Bug #11364]
-
-Sat Jul 18 07:04:24 2015  Eric Wong  <e@80x24.org>
-
-	* signal.c (trap_handler): cleanup to use RSTRING_GETMEM + memcmp
-
-Sat Jul 18 02:53:06 2015  Eric Wong  <e@80x24.org>
-
-	* io.c (argf_read_nonblock): support `exception: false'
-	  (io_nonblock_eof): new function
-	  (io_read_nonblock): use io_nonblock_eof
-	  (argf_getpartial): accept kwargs hash for `exception: false'
-	* test/ruby/test_argf.rb (test_read_nonblock): new test
-	* NEWS: add item for ARGF.read_nonblock
-	  [ruby-core:70000] [Feature #11358]
-
-Fri Jul 17 23:51:31 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* vm_eval.c (rb_eval_cmd): $SAFE=4 has been deprecated.
-
-Fri Jul 17 22:18:09 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* compile.c (iseq_compile_each): use enum ruby_tag_type names.
-
-	* vm_core.h (ruby_tag_type): move from eval_intern.h for compiling
-	  break/next/redo/return.
-
-Fri Jul 17 15:39:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* include/ruby/encoding.h (ENC_CODERANGE_CLEAN_P): predicate that
-	  tells if the coderange is clean, that is 7bit or valid, and no
-	  needs to scrub.
-
-	* re.c (rb_reg_expr_str): use ENC_CODERANGE_CLEAN_P.
-
-	* string.c (enc_strlen, rb_enc_cr_str_buf_cat, rb_str_scrub):
-	  ditto.
-
-	* string.c (rb_str_enumerate_chars): ditto, and suppress a warning
-	  by gcc6.
-
-Fri Jul 17 15:36:52 2015  yui-knk  <spiketeika@gmail.com>
-
-	* test/ruby/test_range.rb (test_first_last): Add test for
-	  `Range.new`.  [Fix GH-971]
-
-Fri Jul 17 15:36:40 2015  yui-knk  <spiketeika@gmail.com>
-
-	* test/ruby/test_range.rb (test_first_last): Add assertions to
-	  test of `Range#last` with exclude_end true case.  [Fix GH-970]
-
-Fri Jul 17 09:59:14 2015  Eric Wong  <e@80x24.org>
-
-	* thread.c (rb_thread_alone): simplify
-
-Fri Jul 17 09:58:32 2015  Eric Wong  <e@80x24.org>
-
-	* lib/rinda/tuplespace.rb: remove enumerator require
-	* test/pathname/test_pathname.rb: ditto
-
-Fri Jul 17 05:33:58 2015  Eric Wong  <e@80x24.org>
-
-	* iseq.c (rb_iseq_compile_with_option): reuse result of previous
-	  GET_THREAD() call
-	* thread.c (thread_create_core): ditto
-	  (rb_mutex_trylock): ditto
-	  (rb_mutex_lock): ditto
-	* process.c (rb_waitpid): avoid multiple eval from RUBY_VM_CHECK_INTS
-	* thread.c (rb_thread_check_ints): ditto
-
-Thu Jul 16 19:12:30 2015  Eric Wong  <e@80x24.org>
-
-	* thread.c (mutex_alloc): remove needless volatile
-
-Thu Jul 16 22:05:29 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_core.h: constify rb_iseq_t::parent_iseq.
-
-	  rb_iseq_t::local_iseq is not constant data because
-	  local_iseq::flip_cnt can be modified (commented).
-
-	* compile.c: catch up this fix.
-
-	* iseq.c: ditto.
-
-	* vm_insnhelper.c: ditto.
-
-Thu Jul 16 21:47:47 2015  Naohisa Goto  <ngotogenome@gmail.com>
-
-	* process.c (redirect_dup2): when the new FD of dup2() conflicts
-	  with one of the timer thread FDs, the internal FD is diverted.
-	  [Bug #11336] [ruby-core:69886] [Bug #11350] [ruby-core:69961]
-
-	* process.c (dup2_with_divert): new function for the above purpose.
-
-	* thread_pthread.c (rb_divert_reserved_fd): new function for
-	  diverting reserved FD. If the given FD is the same as one of the
-	  reserved FDs, the reserved FD number is internally changed.
-	  It returns -1 when error. Otherwise, returns 0. It also returns
-	  0 if there is no need to change reserved FD number.
-
-	* thread_win32.c (rb_divert_reserved_fd): always returns 0 because
-	  of no reserved FDs.
-
-	* internal.h (rb_divert_reserved_fd): prototype declaration.
-	  It is Ruby internal use only.
-
-Thu Jul 16 21:47:46 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* iseq.c (rb_iseq_disasm): rename rb_iseq_t *iseqdat to iseq
-	  and VALUE *iseq to code.
-
-	* iseq.c (rb_iseq_disasm_insn): ditto.
-
-Thu Jul 16 14:34:24 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* vm.c (REWIND_CFP): keep the arguments region inside the valid
-	  value stack.  [ruby-core:69969] [Bug #11352]
-
-Thu Jul 16 11:38:21 2015  Eric Wong  <e@80x24.org>
-
-	* process.c (close_unless_reserved): declare type of `fd' arg
-
-Thu Jul 16 08:47:29 2015  Eric Wong  <e@80x24.org>
-
-	* load.c (rb_construct_expanded_load_path): fstring expanded path
-	  (get_loaded_features_index): fstring feature path
-	  (rb_provide_feature): ditto
-	  [ruby-core:69871] [Feature #11331]
-
-Thu Jul 16 02:56:14 2015  Eric Wong  <e@80x24.org>
-
-	* thread.c (thread_initialize): avoid RSTRING_PTR and NUMT2INT
-
-Thu Jul 16 01:00:46 2015  Naohisa Goto  <ngotogenome@gmail.com>
-
-	* test/ruby/test_process.rb (test_exec_close_reserved_fd): test for
-	  [Bug #11353]
-
-Thu Jul 16 00:35:42 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
-
-	* .gitignore: ignore version.i.
-
-Wed Jul 15 23:40:32 2015  Naohisa Goto  <ngotogenome@gmail.com>
-
-	* test/ruby/test_process.rb (test_deadlock_by_signal_at_forking):
-	  use RUBY (= EnvUtil.rubybin)
-
-Wed Jul 15 23:01:22 2015  Naohisa Goto  <ngotogenome@gmail.com>
-
-	* process.c (redirect_close, parent_redirect_close): should not close
-	  reserved FD. It should be closed in the exec system call due to the
-	  O_CLOEXEC or FD_CLOEXEC flag. [Bug #11353] [ruby-core:69977]
-
-	* process.c (close_unless_reserved): new function to close FD unless
-	  it is reserved for internal communication.
-
-	* thread_pthread.c (rb_reserved_fd_p): should check owner_process pid
-	  to avoid false positive in forked child process.
-
-Wed Jul 15 18:31:18 2015  Eric Wong  <e@80x24.org>
-
-	* proc.c (proc_mark): remove redundant check
-	* vm.c (env_mark): ditto
-
-Wed Jul 15 17:27:40 2015  Eric Wong  <e@80x24.org>
-
-	* iseq.c (iseq_mark): remove check for data pointer
-	* proc.c (binding_mark): ditto
-	* vm.c (rb_thread_mark): ditto
-	* vm_trace.c (tp_mark): ditto
-
-Wed Jul 15 16:55:04 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* encoding.c (enc_autoload): drop dummy encoding flag from
-	  the loaded encoding index.  this flag is used only in this
-	  source.
-
-Wed Jul 15 14:39:29 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm.c (vm_make_env_each): add comments about env layout.
-	  Do not use `i' to specify `new_ep'.
-
-	* vm.c (rb_proc_create, rb_vm_make_proc_lambda): envval is not used.
-
-Wed Jul 15 08:59:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* gc.h (RUBY_MARK_UNLESS_NULL): evaluate the argument only once
-	  to get rid of inadvertent side effects.
-
-Wed Jul 15 02:53:11 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_core.h, vm.c: remove rb_proc_t::envval because we can know it via
-	  rb_proc_t::block::ep.
-
-	  rb_vm_proc_envval(const rb_proc_t *proc) returns an Env object which
-	  the Proc object use.
-
-	* proc.c: catch up this fix.
-
-	* vm_dump.c (rb_vmdebug_proc_dump_raw): ditto.
-
-Wed Jul 15 02:27:22 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_core.h, vm.c: remove rb_env_t::prev_envval because we can know it
-	  via env->ep.
-
-	  rb_vm_env_prev_envval(env) returns prev_envval via env->ep.
-
-	* vm_core.h (rb_vm_env_local_variables): change parameter type
-	  from VALUE (T_DATA/env) to `const rb_env_t *' to make same as
-	  rb_vm_env_prev_envval().
-
-	* proc.c: catch up these changes.
-
-	* vm_dump.c: ditto.
-
-	* vm.c: rename macros.
-
-	  * ENV_IN_HEAP_P() to VM_EP_IN_HEAP_P() because it uses ep.
-	  * ENV_VAL() to VM_ENV_EP_ENVVAL() because it is too short.
-
-Wed Jul 15 01:09:09 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm.c: refactoring Proc/Env related code.
-
-	* vm_core.h: remove blockprocval field from rb_proc_t and rb_binding_t.
-	  Instead of this field, mark given block in Proc at rb_env_t::env.
-
-	* vm.c (vm_make_env_each): make an Env object with this layout.
-	  And also simplify parameters.
-
-	* proc.c: catch up this fix.
-
-	* vm_core.h: remove rb_env_t::local_size because it is not used.
-
-	* vm_dump.c (rb_vmdebug_env_dump_raw): catch up this fix.
-
-	* vm_core.h (rb_vm_make_env_object): remove rb_vm_make_env_object()
-	  because it is only referred from vm.c.
-
-	* vm_eval.c (eval_string_with_cref): catch up this fix.
-
-Wed Jul 15 00:03:36 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
-
-	* gc.c (__has_feature): move into internal.h.
-
-	* internal.h (__has_feature): ditto.
-
-	* internal.h (__has_extension): new macro.
-
-	* internal.h (STATIC_ASSERT): use _Static_assert with
-	  clang. [ruby-core:69931] [Bug #11343]
-
-Wed Jul 15 00:00:00 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
-
-	* random.c (fill_random_bytes_syscall): fix compile error with
-	  clang. [ruby-core:69931] [Bug #11343]
-
-Tue Jul 14 11:22:42 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/webrick/utils.rb (WEBrick::Utils::TimeoutHandler#register):
-	  notify the handler thread of new timeout registration.
-
-	* lib/webrick/utils.rb (WEBrick::Utils::TimeoutHandler#initialize):
-	  make sleep intervals adaptive than fixed period intervals.
-
-	* lib/webrick/server.rb (WEBrick::GenericServer#start): flush
-	  shutdown pipe.
-
-	* lib/webrick/server.rb (WEBrick::GenericServer#stop): request the
-	  server to stop immediately by sending data via shutdown pipe.
-
-Mon Jul 13 23:58:08 2015  Stefano Tortarolo  <stefano.tortarolo@gmail.com>
-
-	* lib/webrick/httpproxy.rb (WEBrick::HTTPProxyServer#do_CONNECT):
-	  fix typos in debugger statements.  [Fix GH-967]
-
-Mon Jul 13 19:11:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/timeout.rb (timeout): warn as deprecated for a long time.
-
-Mon Jul 13 01:37:27 2015  Zachary Scott  <zzak@ruby-lang.org>
-
-	* ext/openssl/ossl.c: [DOC] Backport ruby/openssl@dbb3fdb [Bug #11345]
-	  Thanks to Tomoya Chiba for the report and help with patch.
-
-Sun Jul 12 09:20:02 2015  Shota Fukumori  <her@sorah.jp>
-
-	* ext/socket/basicsocket.c: [DOC] typo (Errno::AGAIN -> Errno::EAGAIN)
-
-	* ext/socket/socket.c: ditto
-
-	* ext/socket/tcpserver.c: ditto
-
-	* ext/socket/udpsocket.c: ditto
-
-	* ext/socket/unixserver.c: ditto
-
-	* io.c: ditto
-
-Sun Jul 12 06:42:23 2015  ksss  <co000ri@gmail.com>
-
-	* test/stringio/test_stringio.rb (test_sysread): add a test for
-	  StringIO#sysread.  [Fix GH-966]
-
-Sat Jul 11 21:16:34 2015  ksss  <co000ri@gmail.com>
-
-	* ext/stringio/stringio.c (Init_stringio): [DOC] Fix an example,
-	  StringIO#puts should be set "\n" at last.  [Fix GH-965]
-
-Sat Jul 11 12:45:51 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/timeout.rb (Timeout#timeout): remove regexp with wrong line
-	  number and fix caller depth.
-
-Fri Jul 10 22:05:50 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/timeout.rb (ExitException): removed internal exception class
-	  and use Timeout::Error instead, as using throw/catch to isolate
-	  each timeouts now.  [ruby-dev:49179] [Bug #11344]
-
-Fri Jul 10 17:41:54 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (is_case_sensitive): get attributes by the file descriptor
-	  of open directory, instead of using mount point name.
-
-Fri Jul 10 10:46:02 2015  ksss  <co000ri@gmail.com>
-
-	* ext/stringio/stringio.c (writable): remove unnecessary check for
-	  deprecated safe level 4.  [Fix GH-963]
-
-Thu Jul  9 15:07:12 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/win32.c (waitpid): return immediately if interrupted.
-	  reported by <takkanm AT gmail.com> [ruby-dev:49176] [Bug #11340]
-
-Thu Jul  9 13:03:46 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_insnhelper.c (vm_search_super_method): use CI_SET_FASTPATH().
-
-Thu Jul  9 11:07:06 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_core.h: remove rb_call_info_t::klass because
-	  rb_callable_method_entry_t has information about defined class.
-
-	* vm_insnhelper.c (vm_search_method): don't set ci->klass because
-	  it is removed.
-
-	* vm_insnhelper.c (rb_equal_opt): ditto.
-
-	* vm_insnhelper.c (vm_search_superclass): removed because it is too
-	  simple to write code directly.
-
-	* vm_insnhelper.c (vm_defined): don't use vm_search_superclass().
-	  This fix avoid searching current callable `me' twice.
-
-	* vm_insnhelper.c (vm_search_super_method): ditto.
-
-Thu Jul  9 10:03:10 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* lib/net/http/responses.rb: Added 308 status to CODE_TO_OBJ list.
-	  [fix GH-961] Patch by @billinghamj
-
-Thu Jul  9 09:34:14 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_core.h (rb_control_frame_t): fix comments (layout index).
-
-Thu Jul  9 09:25:50 2015  Zachary Scott  <e@zzak.io>
-
-	* parse.y: Improve duplicate key warning with patch by @andremedeiros
-	  [Fix GH-938] https://github.com/ruby/ruby/pull/938 [Bug #11327]
-
-Wed Jul  8 07:43:01 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* lib/csv.rb: typo fix [ci skip][fix GH-958] Patch by @henrik
-
-Wed Jul  8 04:42:27 2015  Eric Wong  <e@80x24.org>
-
-	* iseq.c (iseq_data_to_ary): dump kw_arg as symbol
-	* test/-ext-/iseq_load/test_iseq_load.rb: test kw_arg roundtrip
-	  [ruby-core:69891] [Bug #11338]
-
-Tue Jul  7 18:18:41 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
-
-	* random.c (fill_random_bytes_syscall): fix compile error.
-
-Tue Jul  7 16:47:30 2015  Eric Wong  <e@80x24.org>
-
-	* compile.c (COMPILE_ERROR): reduce GET_THREAD() calls
-
-Tue Jul  7 16:39:04 2015  Eric Wong  <e@80x24.org>
-
-	* random.c (fill_random_bytes_syscall): return -1 for error
-	* random.c (fill_random_bytes): try urandom on syscall failure
-
-Tue Jul  7 15:02:18 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* file.c (rb_str_normalize_ospath): skip invalid byte sequence not
-	  to loop infinitely.  this case usually does not happen as the
-	  input name should come from real file systems.
-
-Tue Jul  7 14:40:08 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_backtrace.c: remove debug flag introduced accidentally.
-
-Tue Jul  7 12:05:37 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* cont.c (cont_free): remove mysterious fflush()
-	  introduced at r19890, maybe accidentally.
-
-Tue Jul  7 11:45:14 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* proc.c (rb_method_call): because data->me should be non-NULL,
-	  do not check data->me
-
-	* proc.c (method_inspect): ditto.
-
-Tue Jul  7 11:37:25 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_core.h: remove rb_iseq_t::orig because rb_iseq_clone()
-	  no longer exists.
-
-	* iseq.c: don't use rb_iseq_t::orig.
-
-Tue Jul 07 11:25:57 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* iseq.c, internal.h (rb_iseq_clone): removed because we don't need to
-	  clone iseq any more.
-
-	* class.c (clone_method): share iseq between cloned methods. All of
-	  method dependent information are able to refer from method entry.
-
-Tue Jul  7 04:42:25 2015  Eric Wong  <e@80x24.org>
-
-	* string.c (Init_String): use rb_str_freeze for String#freeze
-	  to resize internal buffer
-	  [ruby-core:69870] [Feature #11330]
-
-Tue Jul  7 04:12:32 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm.c (vm_define_method): remove an unused local variable.
-
-Tue Jul  7 03:57:28 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_core.h: remove rb_iseq_t::defined_method_id because it is not
-	  needed.
-
-	* eval.c (frame_func_id): simplify. rb_callable_method_entry_t
-	  has enough information.
-
-	* eval.c (frame_called_id): ditto.
-
-	* iseq.c (prepare_iseq_build): catch up this fix.
-
-	* proc.c (rb_mod_define_method): ditto.
-
-	* vm.c (vm_define_method): ditto.
-
-Tue Jul  7 03:47:26 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_core.h: remove a useless declaration.
-
-Tue Jul  7 03:33:20 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_core.h: remove rb_iseq_t::klass to reduce dynamic data.
-
-	* internal.h, iseq.c (rb_iseq_klass): remove it because
-	  rb_iseq_t::klass is removed.
-
-	* vm_insnhelper.c (vm_super_outside): do not see cfp->iseq, but
-	  check callable method entry on a frame.
-	  This fix simplify the logic to search super class.
-
-	* test/ruby/test_method.rb: support super() from Proc.
-	  Now, [Bug #4881] and [Bug #3136] was solved.
-
-	* proc.c (rb_mod_define_method): catch up this change.
-
-	* vm.c (vm_define_method): ditto.
-
-	* vm_backtrace.c (rb_profile_frames): now, each `frame' objects
-	  are rb_callable_method_entry_t data or iseq VALUEs.
-
-	  This fix introduce minor compatibility issue that
-	  rb_profile_frame_label() always returns
-	  rb_profile_frame_base_label().
-
-	* test/-ext-/debug/test_profile_frames.rb: catch up this change.
-
-Tue Jul  7 01:52:14 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* cont.c (fiber_init): initialize control frame correctly.
-	  This fix does not affect any ordinal execution, but
-	  affects debug prints.
-
-Mon Jul  6 17:59:05 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_insnhelper.c (vm_search_super_method): do not skip calling
-	  same methods in super.
-	  [Bug #3351]
-
-	* test/ruby/test_super.rb: fix a test.
-
-Mon Jul  6 17:59:11 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* ext/tk/tcltklib.c: removed deprecated safe level.
-
-Mon Jul  6 17:16:37 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* method.h, proc.c (rb_method_entry_location): make it static
-	  and remove prefix `rb_' because it is used only in proc.c.
-
-Mon Jul  6 16:42:10 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* test/lib/memory_status.rb: removed redundant path.
-
-Mon Jul  6 01:18:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* test/lib/test/unit/parallel.rb: make @@project_dir one level
-	  upper as this file had moved one level deeper.
-
-Sun Jul  5 23:54:10 2015  mizokami  <suzunatsu@yahoo.com>
-
-	* lib/optparse.rb: [DOC] Fix typo.
-
-Sun Jul  5 18:25:37 2015  Eric Wong  <e@80x24.org>
-
-	* gc.c (gc_profile_record_get): fix spelling error in keys
-
-Sun Jul  5 14:49:01 2015  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
-
-	* README.md: fix a typo pointed out by raoulvdberge.
-	  https://github.com/ruby/ruby/pull/953#commitcomment-11998186
-
-Sun Jul  5 12:56:20 2015  Irvi Firqotul Aini  <viarc7@gmail.com>
-
-	* README.md: Added link HowToReport bugs.
-
-Sun Jul  5 10:51:48 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* array.c (rb_ary_sort_bang): the original array may not be
-	  embedded even if a substitution array is embedded, as it is
-	  embedded when the original array is short enough but not
-	  embedded.  [ruby-dev:49166] [Bug #11332]
-
-Sun Jul  5 09:31:40 2015  Eric Wong  <e@80x24.org>
-
-	* test/ruby/test_process.rb: test for fd=3 usability in child
-
-Sat Jul  4 19:43:31 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* Add test case for empty array and first method with args.
-	  Patch by @yui-knk [fix GH-955]
-
-Sat Jul  4 19:39:08 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* Add test for `Enumerable#sort` with block. Patch by @yui-knk
-	  [fix GH-954]
-
-Sat Jul  4 14:38:43 2015  Eric Wong  <e@80x24.org>
-
-	* enum.c (zip_ary): remove volatile, use RB_GC_GUARD
-	  (zip_i): ditto
-
-Sat Jul  4 10:42:57 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/rubygems/test_case.rb (teardown): do not delete features
-	  loaded from the original load paths, the same libraries should
-	  be loaded again when the same features are required.
-	  [ruby-dev:49031] [Bug #11222]
-
-Sat Jul  4 09:38:52 2015  Eric Wong  <e@80x24.org>
-
-	* vm.c (rb_vm_mark): reduce branches for always-set VM fields
-	  (rb_vm_add_root_module): ditto
-
-Fri Jul 03 20:05:10 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* method.h: introduce rb_callable_method_entry_t to remove
-	  rb_control_frame_t::klass.
-	  [Bug #11278], [Bug #11279]
-
-	  rb_method_entry_t data belong to modules/classes.
-	  rb_method_entry_t::owner points defined module or class.
-
-	    module M
-	      def foo; end
-	    end
-
-	  In this case, owner is M.
-
-	  rb_callable_method_entry_t data belong to only classes.
-	  For modules, MRI creates corresponding T_ICLASS internally.
-	  rb_callable_method_entry_t can also belong to T_ICLASS.
-
-	  rb_callable_method_entry_t::defined_class points T_CLASS or
-	  T_ICLASS.
-	  rb_method_entry_t data for classes (not for modules) are also
-	  rb_callable_method_entry_t data because it is completely same data.
-	  In this case, rb_method_entry_t::owner == rb_method_entry_t::defined_class.
-
-	  For example, there are classes C and D, and includes M,
-
-	    class C; include M; end
-	    class D; include M; end
-
-	  then, two T_ICLASS objects for C's super class and D's super class
-	  will be created.
-
-	  When C.new.foo is called, then M#foo is searched and
-	  rb_callable_method_t data is used by VM to invoke M#foo.
-
-	  rb_method_entry_t data is only one for M#foo.
-	  However, rb_callable_method_entry_t data are two (and can be more).
-	  It is proportional to the number of including (and prepending)
-	  classes (the number of T_ICLASS which point to the module).
-
-	  Now, created rb_callable_method_entry_t are collected when
-	  the original module M was modified. We can think it is a cache.
-
-	  We need to select what kind of method entry data is needed.
-	  To operate definition, then you need to use rb_method_entry_t.
-
-	  You can access them by the following functions.
-
-	  * rb_method_entry(VALUE klass, ID id);
-	  * rb_method_entry_with_refinements(VALUE klass, ID id);
-	  * rb_method_entry_without_refinements(VALUE klass, ID id);
-	  * rb_resolve_refined_method(VALUE refinements, const rb_method_entry_t *me);
-
-	  To invoke methods, then you need to use rb_callable_method_entry_t
-	  which you can get by the following APIs corresponding to the
-	  above listed functions.
-
-	  * rb_callable_method_entry(VALUE klass, ID id);
-	  * rb_callable_method_entry_with_refinements(VALUE klass, ID id);
-	  * rb_callable_method_entry_without_refinements(VALUE klass, ID id);
-	  * rb_resolve_refined_method_callable(VALUE refinements, const rb_callable_method_entry_t *me);
-
-	  VM pushes rb_callable_method_entry_t, so that rb_vm_frame_method_entry()
-	  returns rb_callable_method_entry_t.
-	  You can check a super class of current method by
-	  rb_callable_method_entry_t::defined_class.
-
-	* method.h: renamed from rb_method_entry_t::klass to
-	  rb_method_entry_t::owner.
-
-	* internal.h: add rb_classext_struct::callable_m_tbl to cache
-	  rb_callable_method_entry_t data.
-
-	  We need to consider about this field again because it is only
-	  active for T_ICLASS.
-
-	* class.c (method_entry_i): ditto.
-
-	* class.c (rb_define_attr): rb_method_entry() does not takes
-	  defined_class_ptr.
-
-	* gc.c (mark_method_entry): mark RCLASS_CALLABLE_M_TBL() for T_ICLASS.
-
-	* cont.c (fiber_init): rb_control_frame_t::klass is removed.
-
-	* proc.c: fix `struct METHOD' data structure because
-	  rb_callable_method_t has all information.
-
-	* vm_core.h: remove several fields.
-	  * rb_control_frame_t::klass.
-	  * rb_block_t::klass.
-
-	  And catch up changes.
-
-	* eval.c: catch up changes.
-
-	* gc.c: ditto.
-
-	* insns.def: ditto.
-
-	* vm.c: ditto.
-
-	* vm_args.c: ditto.
-
-	* vm_backtrace.c: ditto.
-
-	* vm_dump.c: ditto.
-
-	* vm_eval.c: ditto.
-
-	* vm_insnhelper.c: ditto.
-
-	* vm_method.c: ditto.
-
-Fri Jul  3 14:30:18 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* win32/file.c: some mingw compilers need a tweek for the
-	  declarations of _wfreopen_s.  [Bug #11320]
-
-Fri Jul  3 12:25:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* transcode.c (rb_econv_set_replacement): target encoding name can
-	  be empty now.  [ruby-core:69841] [Bug #11324]
-
-Fri Jul  3 07:21:06 2015  Eric Wong  <e@80x24.org>
-
-	* benchmark/bm_io_nonblock_noex.rb: new benchmark
-	* ext/openssl/ossl_ssl.c (no_exception_p): new function
-	  (ossl_start_ssl): adjust for no_exception_p
-	  (ossl_ssl_connect): adjust ossl_start_ssl call
-	  (ossl_ssl_connect_nonblock): ditto
-	  (ossl_ssl_accept): ditto
-	  (ossl_ssl_accept_nonblock): ditto
-	  (ossl_ssl_read_internal): adjust for no_exception_p
-	  (ossl_ssl_write_internal): ditto
-	  (ossl_ssl_write): adjust ossl_write_internal call
-	  (ossl_ssl_write_nonblock): ditto
-	* ext/stringio/stringio.c (strio_read_nonblock):
-	  delay exception check
-	* io.c (no_exception_p): new function
-	  (io_getpartial): call no_exception_p
-	  (io_readpartial): adjust for io_getpartial
-	  (get_kwargs_exception): remove
-	  (io_read_nonblock): adjust for io_getpartial,
-	  check no_exception_p on EOF
-	  (io_write_nonblock): call no_exception_p
-	  (rb_io_write_nonblock): do not check `exception: false'
-	  (argf_getpartial): adjust for io_getpartial
-	  [ruby-core:69778] [Feature #11318]
-
-Fri Jul  3 07:13:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (replace_real_basename): Win32 API does not set errno, get
-	  the last error by GetLastError() and map to errno.  [Bug #10015]
-
-Thu Jul  2 21:32:06 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (replace_real_basename): show warnings at errors.
-	  [Bug #10015]
-
-Thu Jul  2 18:39:20 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c: remove `#define RGENGC_OBJ_INFO 1' line introduced to
-	  debug Bug #11244.
-
-Thu Jul  2 18:34:26 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (rb_raw_obj_info): separated from rb_obj_info().
-	  Fill internal object information into passed buffer.
-
-	* gc.h: declare rb_raw_obj_info().
-
-Thu Jul  2 16:15:04 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (replace_real_basename): update path type by the target
-	  attributes if possible, to improve the performance.  [Bug #10015]
-
-Thu Jul  2 14:45:53 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* st.c: get rid of VC++'s warnings of C4700 (uninitialized local
-	  variable used).  I think that these are wrong, but should shut them
-	  up.
-
-Thu Jul  2 14:15:50 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/rubygems.rb (Gem.load_path_insert_index): search
-	  @gem_prelude_index first.
-
-	* lib/rubygems/test_case.rb (Gem::TestCase#setup): keep already
-	  expanded paths to preserve instance variables.
-
-Thu Jul  2 14:12:01 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ruby.c (process_options): also copy initial load path marks at
-	  setting load paths encoding.
-
-Thu Jul  2 12:26:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* test/rubygems/test_gem_server.rb (process_based_port): use
-	  dynamically chosen port numbers to get rid of conflicts.
-
-Thu Jul  2 11:58:59 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* test/rubygems/test_gem_specification.rb: skip tests which the
-	  platform does not permit the filename of its test file.
-
-Thu Jul  2 11:36:20 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* test/rubygems/test_gem_resolver_git_specification.rb: require
-	  rubygems/installer.rb before Gem::TestCase#setup runs, otherwise
-	  as Gem::TestCase#teardown restores $LOADED_FEATURES to the state
-	  at that time, the requiring the file in GitSpecification#install
-	  method causes a lot of constant redefinitions.
-
-Thu Jul  2 10:43:36 2015  Eric Wong  <e@80x24.org>
-
-	* ext/socket/rubysocket.h: flags for common socket families
-	  (rsock_getfamily): update signature
-	* include/ruby/io.h: comment socket FMODE flags
-	* ext/socket/init.c (rsock_getfamily): memoize family
-	* ext/socket/basicsocket.c: adjust rsock_getfamily calls
-	* ext/socket/ancdata.c: ditto
-	  [ruby-core:69713] [Feature #11298]
-
-Thu Jul  2 10:30:01 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* lib/rubygems/resolver.rb: fixed NameError of Gem::Util::NULL_DEVICE.
-
-Thu Jul  2 09:51:44 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* lib/rubygems/resolver.rb: fix error of null device reference with DOSISH
-	  platform.
-
-Thu Jul  2 06:49:44 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* lib/rubygems: Update to RubyGems HEAD(c202db2).
-	  this version contains many enhancements see http://git.io/vtNwF
-	* test/rubygems: ditto.
-
-Wed Jul  1 23:50:34 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
-
-	* test/net/http/test_httpresponse.rb
-	(HTTPResponseTest#test_read_body_content_encoding_deflate_uppercase):
-	fix a failure without zlib.
-
-Wed Jul  1 10:54:56 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* Add test for Enumerable#none? [fix GH-950] Patch by @yui-knk
-
-Wed Jul  1 09:30:36 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* struct.c (struct_set_members): hide internal back_members
-	  object, and members object does not need to be duped as it
-	  should be frozen and hidden.
-
-Wed Jul  1 09:28:47 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* struct.c (struct_member_pos): revert r51080 to fix other
-	  implicit conversions but cast the return value to fix the
-	  previous implicit conversion.
-
-Wed Jul  1 08:47:24 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* struct.c (struct_member_pos): avoid implicit conversion loses
-	  integer precision: 'long' to 'int'.
-
-Wed Jul  1 05:57:03 2015  Eric Wong  <e@80x24.org>
-
-	* vm_method.c (rb_add_method_iseq): add RB_GC_GUARD
-	* class.c (clone_method): remove RB_GC_GUARD
-	* struct.c (define_aref_method): ditto
-	  (define_aset_method): ditto
-	* vm.c (vm_define_method):
-	* iseq.c (rb_iseq_clone): add RB_GC_GUARD
-
-Wed Jul  1 05:43:58 2015  Eric Wong  <e@80x24.org>
-
-	* struct.c (AREF_HASH_THRESHOLD): new macro
-	  (id_back_members): new ID
-	  (struct_member_pos_ideal): new function
-	  (struct_member_pos_probe): ditto
-	  (struct_set_members): ditto
-	  (struct_member_pos): ditto
-	  (rb_struct_getmember): use struct_member_pos for O(1) access
-	  (rb_struct_aref_sym): ditto
-	  (rb_struct_aset_sym): ditto
-	  (setup_struct): call struct_set_members
-	  (struct_define_without_accessor): ditto
-	  (Init_Struct): initialize __members_back__
-	  [ruby-core:66851] [ruby-core:69705] [ruby-core:69821]
-
-Tue Jun 30 23:12:08 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* io.c (rb_io_reopen): FilePathValue() ensures the path
-	  NUL-terminated and frozen, so it is unnecessary to make it shared.
-
-Tue Jun 30 23:11:53 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (check_dirname): ensure path name NUL-terminated for
-	  SHARABLE_MIDDLE_SUBSTRING.
-
-	* io.c (rb_sysopen): ditto.
-
-Tue Jun 30 18:38:16 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/file.c (rb_freopen): need to terminate by NUL.
-
-Tue Jun 30 17:28:25 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* io.c (rb_io_reopen): freopen(3) with OS encoding path.
-	  [ruby-core:69780] [Bug #11320]
-
-	* win32/file.c (rb_freopen): wrapper of wchar version freopen(3).
-	  use _wfreopen_s() if available.
-
-Tue Jun 30 08:24:08 2015  Eric Wong  <e@80x24.org>
-
-	* io.c (rb_io_oflags_modestr): handle O_TRUNC correctly
-	* test/ruby/test_io.rb (test_reopen_stdio): new test
-	  Patch-by: cremno phobia <cremno@mail.ru>
-	  [ruby-core:69779] [Bug #11319]
-
-Tue Jun 30 02:47:02 2015  Eric Wong  <e@80x24.org>
-
-	* include/ruby/st.h (struct st_table): hide struct list_head
-	* st.c (struct st_table_entry): adjust struct
-	  (head, tail): remove shortcut macros
-	  (st_head): new wrapper function
-	  (st_init_table_with_size): adjust to new struct and API
-	  (st_clear): ditto
-	  (add_direct): ditto
-	  (unpack_entries): ditto
-	  (rehash): ditto
-	  (st_copy): ditto
-	  (remove_entry): ditto
-	  (st_shift): ditto
-	  (st_foreach_check): ditto
-	  (st_foreach): ditto
-	  (get_keys): ditto
-	  (get_values): ditto
-	  (st_values_check): ditto
-	  (st_reverse_foreach_check): ditto (unused)
-	  (st_reverse_foreach): ditto (unused)
-	  [ruby-core:69726] [Misc #10278]
-
-Mon Jun 29 17:38:01 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* insns.def (defineclass): do not quote unprintable characters at
-	  raising an exception.
-
-Mon Jun 29 16:01:24 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* lib/net/http/response.rb (inflater): CONTENT_ENCODING can be upper
-	  case. [ruby-core:69670] [Bug #11285] patched by Andy Chu
-
-Mon Jun 29 14:50:08 2015  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* eval.c (add_activated_refinement): should not include the original
-	  class.
-
-Mon Jun 29 12:09:10 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* README.md: tweak styles. [fix GH-945][ci skip] Patch by @bryndyment
-
-Mon Jun 29 07:23:55 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* template/sizes.c.tmpl: extract RUBY_DEFINT to define sizes of
-	  types checked by configure.in, and fix size of intptr_t in
-	  universal binary.
-
-Mon Jun 29 02:10:10 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* insns.def (defineclass): preserve encoding of name in error
-	  messages for super class mismatch.
-
-	* insns.def (defineclass): preserve encoding of name in error
-	  messages for non-class super.
-
-	* insns.def (defineclass): preserve encoding of name in error
-	  messages when already defined but type mismatch.
-
-Sun Jun 28 12:07:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* class.c (rb_define_class_id_under): raise TypeError exception
-	  same as ruby level class definition when superclass mismatch.
-
-Sun Jun 14 19:02:03 2015  Benoit Daloze  <eregontp@gmail.com>
-
-	* lib/net/ftp.rb (makeport): close the TCPServer
-	  when sending the port fails.
-
-	* test/net/ftp/test_ftp.rb: test for above.
-
-Fri Jun 26 12:48:37 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* transcode.c (load_transcoder_entry): fix transcoder loading race
-	  condition, by waiting in require.  [ruby-dev:49106] [Bug #11277]
-
-Fri Jun 26 07:53:56 2015  Eric Wong  <e@80x24.org>
-
-	* enum.c (enum_minmax): simplify return value creation
-	* test/ruby/test_enum.rb: test behavior on empty
-	* hash.c (rb_hash_fetch_m): remove unnecessary volatile since r41597
-	  (env_reject_bang): trade volatile for GC guard
-	  (env_select): ditto
-	  (env_select_bang): ditto
-	  (env_keep_if): ditto
-	  (rb_env_clear): ditto
-
-Thu Jun 25 21:24:28 2015  Naohisa Goto  <ngotogenome@gmail.com>
-
-	* test/-ext-/popen_deadlock/test_popen_deadlock.rb: test [Bug #11265]
-
-	* ext/-test-/popen_deadlock/infinite_loop_dlsym.c: new ext to call
-	  dlsym(3) infinitely without GVL, used in the above test.
-
-	* ext/-test-/popen_deadlock/extconf.rb: extconf.rb for the above
-	  ext. Currently, only enabled on Solaris (main target) and Linux
-	  (as a reference platform and for debugging the ext).
-
-Thu Jun 25 19:24:25 2015  Naohisa Goto  <ngotogenome@gmail.com>
-
-	* configure.in: not to use vfork on Solaris to avoid deadlock
-	  occurred in vfork(2) with multi-threading and dynamic linker
-	  on Solaris. [Bug #11265] [ruby-dev:49089]
-
-Thu Jun 25 18:25:41 2015  Naohisa Goto  <ngotogenome@gmail.com>
-
-	* test/lib/envutil.rb (Test::Unit::Assertions#assert_no_memory_leak):
-	  NO_MEMORY_LEAK_ENVS is moved to Memory::NO_MEMORY_LEAK_ENVS
-	  to reduce child executions during test-all on Solaris.
-
-	* test/lib/memory_status.rb (Memory::NO_MEMORY_LEAK_ENVS): ditto.
-
-Thu Jun 25 17:32:33 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_method.c (rb_method_entry_create): need to call
-	  method_definition_reset() if def is given.
-
-	  Actually, `me' is a new object, so we don't need to call it.
-	  It is just to make sure.
-
-	* vm_method.c (method_definition_reset): remove duplicated insertion.
-
-	* vm_method.c (rb_method_entry_clone): assign dst->def here,
-	  not in method_definition_reset().
-
-Thu Jun 25 16:44:54 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_method.c: make a rb_method_definition_t data (def) *after* making
-	  a rb_method_entry_t data (me).
-
-	  Normally, `me' points `def'. Some Ruby objects pointed from `def'
-	  and objects are marked by `me' (mark_method_entry() in gc.c).
-	  However, `def' is built before making a `me', then nobody can mark
-	  objects pointed from `def' before making (and pointing from) `me'.
-
-	  I hope this patch solve #11244.
-
-	* vm_method.c: remove `rb_' prefix from some static functions.
-
-	* method.h (rb_method_entry_create): constify
-
-	* gc.c (mark_method_entry): add checking `def' and
-	  `def->body.iseq.iseqptr' availability because they can be NULL.
-
-Thu Jun 25 14:14:16 2015  takiy33  <takiy33@gmail.com>
-
-	* test/test_prime.rb (test_eratosthenes_works_fine_after_timeout):
-	  use spaces instead of TABs in ruby codes.  [Fix GH-944]
-
-Thu Jun 25 07:08:35 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (obj_info, method_type_name): show method type name in a string
-	  instead of a number.
-
-Thu Jun 25 06:49:25 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (obj_info): show more details for T_IMEMO/imemo_ment.
-
-Thu Jun 25 06:40:46 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_method.c (rb_method_definition_reset): need a WB for
-	  VM_METHOD_TYPE_ATTRSET.
-
-Thu Jun 25 03:33:21 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (RGENGC_OBJ_INFO, obj_info): add a macro to enable/disable
-	  rich obj_info() output.
-
-	  At the default, the value of RGENGC_OBJ_INFO is
-	  (RGENGC_DEBUG | RGENGC_CHECK_MODE).
-
-	* gc.c (RGENGC_OBJ_INFO): force enable it to debug #11244.
-
-	* gc.c (gc_mark_ptr): print more details with obj_info().
-
-	* gc.c (gc_mark_children): remove useless debug prints.
-
-Thu Jun 25 02:40:33 2015  Eric Wong  <e@80x24.org>
-
-	* ext/openssl/ossl_ssl.c (ossl_ssl_read_internal):
-	  do not process kwargs in blocking mode
-	* test/openssl/test_ssl.rb: test sysread
-
-Wed Jun 24 16:54:11 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (gc_mark_children): add additional debug code for #11244.
-
-Wed Jun 24 16:05:42 2015  Eric Wong  <e@80x24.org>
-
-	* string.c (rb_str_justify): use RB_GC_GUARD
-
-Wed Jun 24 14:25:17 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (gc_mark_ptr): add a check code for #11244.
-
-	  It should be removed later. But we can remain this check
-	  because it is only a branch.
-
-Wed Jun 24 12:49:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* string.c (rb_fstring_cstr): new function to make a fstring from
-	  a string literal.
-
-	* internal.h (rb_fstring_lit): new macro to make a fstring from a
-	  string literal.
-
-	* include/ruby/intern.h (rb_strlen_lit): new macro to get the
-	  length of a string literal, borrowed from mruby/mruby@e4afd53.
-
-Wed Jun 24 12:21:16 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* re.c: Update documentation for Regexp class.
-	  [fix GH-937][ci skip] Patch by @davydovanton
-
-Wed Jun 24 09:23:03 2015  Eric Wong  <e@80x24.org>
-
-	* variable.c (generic_ivar_set): remove FL_ABLE check
-	  (gen_ivar_copy): ditto
-	  [ruby-core:69715]
-
-Wed Jun 24 08:28:15 2015  Eric Wong  <e@80x24.org>
-
-	* ext/socket/ancdata.c (bsock_recvmsg_internal): reduce stack use
-	  [ruby-core:69595] [Feature #11263]
-
-Tue Jun 23 14:32:42 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* error.c (name_err_receiver): raise ArgumentError if no receiver
-	  is available on this exception object.  [Feature #10881]
-
-Tue Jun 23 09:48:34 2015  Eric Wong  <e@80x24.org>
-
-	* dir.c (check_dirname): avoid volatile, use return value
-	  (dir_s_chroot, dir_s_mkdir, dir_s_rmdir): adjust callers
-
-Tue Jun 23 06:37:10 2015  Eric Wong  <e@80x24.org>
-
-	* struct.c (struct_ivar_get): cache member definition in a subclass
-	  Thanks to Sokolov Yura aka funny_falcon <funny.falcon@gmail.com>
-	  in https://bugs.ruby-lang.org/issues/10585
-
-Tue Jun 23 04:58:06 2015  Eric Wong  <e@80x24.org>
-
-	* benchmark/bm_vm2_struct_big_href_hi.rb: new benchmark
-	* benchmark/bm_vm2_struct_big_href_lo.rb: ditto
-	* benchmark/bm_vm2_struct_big_hset.rb: ditto
-	* benchmark/bm_vm2_struct_small_href.rb: ditto
-	* benchmark/bm_vm2_struct_small_hset.rb: ditto
-	  Thanks to Sokolov Yura aka funny_falcon <funny.falcon@gmail.com>
-	  in https://bugs.ruby-lang.org/issues/10585
-
-Mon Jun 22 18:08:48 2015  Naohisa Goto  <ngotogenome@gmail.com>
-
-	* test/lib/test/unit.rb (Test::Unit::Parallel#start_watchdog): removed
-	  because it has been meaningless since r36385. [Bug #11288]
-
-	* test/lib/test/unit.rb (Test::Unit::Parallel#_run_parallel): delete
-	  lines related to the removed start_watchdog method
-
-Sun Jun 21 23:52:46 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
-
-	* NEWS: mention Array#bsearch_index and Hash#fetch_values.
-
-Sun Jun 21 23:46:27 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
-
-	* NEWS: add a reference to a ticket.
-
-Sun Jun 21 20:28:09 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* internal.h (roomof): extract from type_roomof, and move from
-	  bignum.c.
-
-Sun Jun 21 18:32:37 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ruby_atomic.h (ATOMIC_PTR_CAS): define by generic CAS macro, not
-	  via size_t, to suppress a warning by mingw gcc.
-
-Sun Jun 21 05:31:41 2015  Shota Fukumori  <her@sorah.jp>
-
-	* ext/objspace/objspace_dump.c(dump_object): Return empty JSON object when
-	  passed object is a special const, instead of SEGV.
-	  Based patch by Kohei Suzuki (eagletmt). [ruby-core:69692] [Bug #11291]
-
-	* test/objspace/test_objspace.rb(test_dump_special_consts): Test for above fix.
-
-
-Sat Jun 20 03:56:58 2015  Yusuke Endoh  <mame@ruby-lang.org>
-
-	* enc/make_encmake.rb: the list of encoding extension libraries must
-	  not include encinit.c itself.  It caused "undefined reference to
-	  Init_encinit".
-
-Sat Jun 20 02:03:53 2015  Naohisa Goto  <ngotogenome@gmail.com>
-
-	* process.c (rb_execarg_parent_start1): new macro ALWAYS_NEED_ENVP
-	  to generate envp_str anytime on Solaris 10 (or earlier version
-	  of Solaris) to avoid calling execv() which is async-signal unsafe
-	  on Solaris 10. [Bug #11265] [ruby-dev:49089]
-
-	* process.c (exec_with_sh, proc_exec_cmd): On Solaris 10,
-	  because ALWAYS_NEED_ENVP is 1 and envp_str is always generated,
-	  execv() in exec_with_sh() and proc_exec_cmd() are never called.
-	  To guarantee this, execv() is replaced by a macro to print
-	  out error message on Solaris 10.
-
-	* process.c (proc_exec_sh): Because proc_exec_sh() may be called
-	  by rb_proc_exec() with envp_str = Qfalse, execl() is replaced
-	  by a macro that calls execle() with "extern char **environ"
-	  traditional global variable on Solaris 10.
-	  TODO: This may be unsafe and should be changed in the future.
-	  Although rb_proc_exec() is not used from inside current version
-	  of ruby, it may be called by third-party extensions.
-
-Sat Jun 20 01:10:13 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
-
-	* NEWS: mention about $SAFE.
-
-Fri Jun 19 14:53:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* proc.c (rb_mod_define_method): now requires a block direct to
-	  this method call.  [ruby-core:69655] [Bug #11283]
-
-Fri Jun 19 13:54:43 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* proc.c (rb_mod_define_method): get rid of inadvertent ID
-	  creations at error.
-
-Fri Jun 19 07:58:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/extmk.rb: if no with-ext option is given, default to
-	  enable everything.  [ruby-dev:49108] [Bug #11280]
-
-Fri Jun 19 06:30:07 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* bootstraptest/test_method.rb: remove a test because $SAFE=2 was
-	  obsolete.
-
-	  Please check btest, too.
-
-Thu Jun 18 23:51:51 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
-
-	* bin/erb: $SAFE=3 is obsolete.
-
-Thu Jun 18 23:45:11 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
-
-	* safe.c: removed needless doc related $SAFE=2
-
-Thu Jun 18 23:38:07 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* thread.c (rb_thread_safe_level): fix document.  $SAFE=3 is obsolete.
-	  [ci skip]
-
-Thu Jun 18 23:25:51 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/extmk.rb: configure intersection of with-ext and not
-	  without-ext, as withouts is no longer true by default if
-	  with-ext option is given.  [ruby-dev:49108] [Bug #11280]
-
-Thu Jun 18 23:20:46 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* include/ruby/ruby.h: $SAFE=2 is now obsolete.
-
-	* dir.c, ext/fiddle/handle.c, ext/socket/basicsocket.c, file.c
-	  gc.c, io.c, process.c, safe.c, signal.c, win32/file.c:
-	  removed code for $SAFE=2
-
-	* test/erb/test_erb.rb, test/fiddle/test_handle.rb
-	  test/ruby/test_env.rb: removed tests for $SAFE=2.
-
-Thu Jun 18 22:50:07 2015  Yusuke Endoh  <mame@ruby-lang.org>
-
-	* enc/make_encmake.rb: added --transes and --no-transes options.
-
-Thu Jun 18 18:24:12 2015  Eric Wong  <e@80x24.org>
-
-	* test/socket/test_unix.rb: replace sleep with select
-
-Thu Jun 18 17:59:06 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm.c (rb_vm_control_frame_id_and_class): remove useless codes.
-	  `me' knows ID and owner class.
-
-Thu Jun 18 16:58:35 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* method.h: constify rb_method_alias_struct::original_me and
-	  rb_method_refined_struct::orig_me.
-
-	* class.c (move_refined_method): use RB_OBJ_WRITE() for
-	  me->def->body.refined.orig_me.
-
-Thu Jun 18 14:35:28 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* ext/objspace/objspace.c (count_imemo_objects): support imemo_ment.
-
-Thu Jun 18 13:32:46 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* error.c (name_err_receiver): add NameError#receiver method.
-	  [Feature #10881]
-
-Thu Jun 18 10:00:06 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* safe.c: removed needless doc related $SAFE=3
-
-Thu Jun 18 09:59:23 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* safe.c: rename old method name for $SAFE=3
-
-Thu Jun 18 06:02:42 2015  Eric Wong  <e@80x24.org>
-
-	* compile.c (get_exception_sym2type, iseq_build_from_ary_body):
-	  rely on %+PRIsVALUE instead of calling rb_inspect directly
-
-Wed Jun 17 20:59:25 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* common.mk (ENC_MK): needs fake.rb if cross compilation.
-	  [ruby-dev:49098] [Bug #11272]
-
-Wed Jun 17 20:23:29 2015  Tanaka Akira  <akr@fsij.org>
-
-	* ext/rbconfig/sizeof/extconf.rb: Check __float80.
-
-Wed Jun 17 15:15:53 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* safe.c (safe_setter): of course, don't have to warn the limitation of
-	  $SAFE=3 after it's removed.
-
-Wed Jun 17 14:29:43 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* include/ruby/ruby.h: $SAFE=3 is now obsolete.
-
-	* ext/socket/init.c, ext/socket/socket.c, ext/socket/tcpsocket.c
-	  ext/socket/udpsocket.c, gc.c, object.c, re.c, safe.c: removed code
-	  for $SAFE=3
-
-	* bootstraptest/test_method.rb, test/erb/test_erb.rb, test/ruby/test_dir.rb
-	  test/ruby/test_file.rb, test/ruby/test_method.rb, test/ruby/test_regexp.rb
-	  test/ruby/test_thread.rb: remove tests for $SAFE=3
-
-Wed Jun 17 12:13:33 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* ChangeLog: added contributor name.
-
-Wed Jun 17 10:57:28 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* lib/csv.rb: accept to use Range object for row selection.
-	  contributed by Mitsutaka Mimura.
-	  [Feature #11267][ruby-dev:49091]
-
-Wed Jun 17 09:50:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/rdoc/servlet.rb (documentation_search, root_search):
-	  requires json for JSON.dump and fix sporadic failures due to
-	  the loading order.
-
-Tue Jun 16 19:19:53 2015  Tanaka Akira  <akr@fsij.org>
-
-	* ext/rbconfig/sizeof/extconf.rb: Check several types defined in C99
-	  and x86_64 ABI.
-
-	* template/sizes.c.tmpl: Relax a pattern for types.
-
-Tue Jun 16 17:37:01 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* test/objspace/test_objspace.rb: relax pattern because uncollectible
-	  flag and marked flag can be false at major GC.
-	  [Bug #10852]
-
-Tue Jun 16 04:50:44 2015  Eric Wong  <e@80x24.org>
-
-	* ext/socket/basicsocket.c (bsock_recv): document outbuf
-	* ext/socket/unixsocket.c (unix_recvfrom): ditto
-	* ext/socket/init.c (rsock_strbuf, recvfrom_locktmp): new functions
-	  (rsock_s_recvfrom): support destination buffer as 3rd arg
-	  (rsock_s_recvfrom_nonblock): ditto
-	* string.c (rb_str_locktmp_ensure): export for internal ext
-	* test/socket/test_nonblock.rb: test recv_nonblock
-	* test/socket/test_unix.rb: test recv
-	  [ruby-core:69543] [Feature #11242]
-
-Tue Jun 16 04:38:02 2015  Eric Wong  <e@80x24.org>
-
-	* ext/socket/ancdata.c (bsock_sendmsg_internal,
-	  bsock_recvmsg_internal):
-	  support "exception: false" kwarg
-	* ext/socket/init.c (rsock_s_recvfrom_nonblock):
-	  ditto
-	* ext/socket/init.c (rsock_s_recvfrom_nonblock): use rsock_opt_false_p
-	* ext/socket/socket.c (sock_connect_nonblock): ditto
-	* ext/socket/rubysocket.h (rsock_opt_false_p): new function
-	* ext/socket/basicsocket.c (bsock_recv_nonblock): update rdoc
-	* ext/socket/udpsocket.c (udp_recvfrom_nonblock): ditto
-	* test/socket/test_nonblock.rb: new tests
-	  [ruby-core:69542] [Feature #11229]
-
-Mon Jun 15 14:33:02 2015  Akinori MUSHA  <knu@iDaemons.org>
-
-	* lib/set.rb: Make Set#each and SortedSet#each generate a sized
-	  enumerator. [GH-931] by kachick (Kenichi Kamiya)
-
-	* test/test_set.rb: Import tests from Set into SortedSet. [GH-931]
-	  by kachick (Kenichi Kamiya)
-
-Mon Jun 15 02:26:34 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* lib/net/http.rb (Net::HTTP#connect): use connect_nonblock and
-	  io/wait to eliminate timeout use. fix GH-899
-
-Sat Jun 13 07:21:18 2015  KOSAKI Motohiro  <kosaki.motohiro@gmail.com>
-
-	* thread.c (thread_start_func_2): don't interrupt when last thread
-	  exit unless main thread is already exited. Otherwise main thread
-	  could be wrongly interrupted when it uses rb_thread_call_without_gvl().
-	  Patch by Takehiro Kubo. [Bug #11237][ruby-dev:49044][GH-898]
-
-	* test/-ext-/gvl/test_last_thread.rb: new test for the above fix.
-
-	* ext/-test-/gvl/call_without_gvl/call_without_gvl.c: new ext for
-	  the above test.
-	* ext/-test-/gvl/call_without_gvl/extconf.rb: ditto.
-
-Mon Jun 15 00:14:33 2015  Tanaka Akira  <akr@fsij.org>
-
-	* ext/pathname/lib/pathname.rb (descend): Blockless form supported.
-	  (ascend): Ditto.
-	  [ruby-core:68820] [Feature #11052] Patch by Piotr Szotkowski.
-
-Sun Jun 14 20:09:25 2015  Tanaka Akira  <akr@fsij.org>
-
-	* time.c (time_getlocaltime): [DOC] Add examples of valid utc_offset
-	  formats.
-	  [ruby-core:68306] [Misc #10905] Patch by Charles Korn.
-
-Sun Jun 14 18:49:56 2015  Tanaka Akira  <akr@fsij.org>
-
-	* ext/socket/raddrinfo.c (parse_numeric_port): Detect
-	  port overflow.
-	  (numeric_getaddrinfo): Use parse_numeric_port.
-	  numeric_getaddrinfo fails if port is too big now.
-	  This makes rb_getaddrinfo invokes the real getaddrinfo()
-	  on such condition.
-	  This change is related to [ruby-core:69355] [Bug #11179].
-
-Sun Jun 14 17:26:03 2015  Tanaka Akira  <akr@fsij.org>
-
-	* enum.c (enum_chunk_while): New method Enumerable#chunk_while.
-	  [ruby-core:67738] [Feature #10769] proposed by Tsuyoshi Sawada.
-
-Sun Jun 14 17:20:40 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* file.c (rb_file_load_ok): try opening file without gvl not to
-	  lock entire process.  [Bug #11060]
-
-Sun Jun 14 10:43:50 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* tool/runruby.rb: just remove the lines of RUBY_VERSION check and raise
-	  instead of replacing the check to `true`, for getting rid of a
-	  warning `possibly useless use of true in void context`.
-
-Sun Jun 14 10:13:55 2015  Kouhei Sutou  <kou@cozmixng.org>
-
-	* lib/rexml/source.rb (REXML::IOSource#scan): Fix a typo in
-	  document. [fix GH-934]
-	  Patch by Anton Davydov. Thanks!!!
-
-Sun Jun 14 10:09:48 2015  Kouhei Sutou  <kou@cozmixng.org>
-
-	* lib/rexml/attlistdecl.rb (REXML::AttlistDecl): Fix a typo in
-	  document. [fix GH-934]
-	  Patch by Anton Davydov. Thanks!!!
-
-Sun Jun 14 06:24:57 2015  Benoit Daloze  <eregontp@gmail.com>
-
-	* test/ruby/test_io.rb: add test for IO.binread fd leak.
-	  See r50881.
-
-Sun Jun 14 05:23:51 2015  Benoit Daloze  <eregontp@gmail.com>
-
-	* io.c (rb_io_s_binread): close fd if seek offset is invalid.
-
-Sun Jun 14 04:40:32 2015  Benoit Daloze  <eregontp@gmail.com>
-
-	* test/lib/leakchecker.rb (check): refactor.
-
-Sun Jun 14 04:34:14 2015  Benoit Daloze  <eregontp@gmail.com>
-
-	* test/lib/leakchecker.rb: Return false for no leaks.
-	  Otherwise the GC could run for nothing.
-
-Sun Jun 14 04:15:40 2015  Benoit Daloze  <eregontp@gmail.com>
-
-	* lib/delegate.rb: [DOC] Update SimpleDelegator example. [ci skip]
-
-Sat Jun 13 20:28:14 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* file.c (rb_stat_ino): get inode from the interval of struct st.
-
-	* win32/win32.c (stati64_set_inode): get nFilIndexHigh/Low, and set it
-	  to the interval of struct st as inode.
-
-	* win32/win32.c (stati64_set_inode_handle): call stati64_set_inode.
-
-	* win32/win32.c (rb_w32_fstati64): call stati64_set_inode_handle.
-
-	* win32/win32.c (stati64_handle): call stati64_set_inode.
-
-Sat Jun 13 19:44:53 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* ext/io/console/depend (.list.chksum): revert a part of r50859, because
-	  it was not mentioned at its commit log and it caused a build error on
-	  Windows ($(MAKE) is already quoted).
-
-Sat Jun 13 17:35:11 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* vm_core.h (rb_thread_t): add th->name.
-
-	* vm.c (th_init): initialize th->name.
-
-	* thread.c (Init_Thread): add Thread.name and name=. [Feature #11251]
-
-	* thread.c (rb_thread_inspect): show thread's name if set.
-
-	* thread.c (rb_thread_getname): defined.
-
-	* thread.c (rb_thread_setname): ditto.
-
-Sat Jun 13 11:39:43 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* lib/tempfile.rb: Fix typo. [fix GH-933] Patch by @Zorbash
-
-Sat Jun 13 11:38:00 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* ext/openssl/ossl_ocsp.c: fix documentation on ocsp response cert status.
-	  [fix GH-932] Patch by @chrisholmes
-
-Sat Jun 13 11:35:19 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* ext/bigdecimal/bigdecimal.gemspec: Fix require paths for released gem.
-	  [fix GH-929] Patch by @voxik
-	* ext/io/console/io-console.gemspec: ditto.
-
-Sat Jun 13 00:45:08 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
-
-	* lib/prime.rb: Return sized enumerators.
-	  Patch by Kenichi Kamiya [GH-931]
-
-Sat Jun 13 00:45:06 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
-
-	* lib/prime.rb: Fix with_object with no block given
-
-Sat Jun 13 00:44:59 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
-
-	* lib/prime.rb: Have with_index accept an offset parameter.
-	  Based on patch by T Yamada. [#11007]
-
-Fri Jun 12 22:21:12 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
-
-	* test/ruby/test_extlibs.rb (TestExtLibs::check_existence): fix
-	  error. [Bug #11255] [ruby-dev:49079]
-
-Fri Jun 12 21:17:46 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* pack.c (pack_{un,}pack): new template character `j` and `J`, pointer
-	  with signed and unsigned integers.
-
-	* NEWS: mention about this feature.
-	  [Feature #11215] [ruby-dev:49015]
-
-Fri Jun 12 21:01:44 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* file.c (File::SHARE_DELETE): new flag to be able to delete opened file
-	  on Windows.
-
-	* include/win32/win32.c (O_SHARE_DELETE): new pseudo file mode flag.
-
-	* win32/win32.c (rb_w32_{w,}open): support above flag.  [EXPERIMENTAL]
-
-	* NEWS: mention about this feature.
-	  [Feature #11218] [ruby-dev:49022]
-
-Fri Jun 12 18:21:45 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* ChangeLog: added missing commit message.
-
-Fri Jun 12 18:20:37 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* sample/exyacc.rb: Fix some typos. [fix GH-927] Patch by @davydovanton
-	* sample/list.rb: ditto.
-	* sample/trick2013/kinaba/remarks.markdown: ditto.
-
-Fri Jun 12 17:34:14 2015  Wojciech Mach  <wojtek@wojtekmach.pl>
-
-	* hash.c (rb_hash_fetch_values): add `Hash#fetch_values`.
-	  [Feature #10017] [Fix GH-776]
-
-Fri Jun 12 16:28:17 2015  Radan Skoric  <radan.skoric@gmail.com>
-
-	* array.c (rb_ary_bsearch_index): Implement Array#bsearch_index
-	  method, which is similar to bsearch and returns the index or
-	  nil.  [Feature #10730]
-
-Thu Jun 11 19:11:22 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* ext/zlib/zlib.c: Fix indentation for rdoc.
-	  [Bug #11221][ruby-core:69465]
-
-Thu Jun 11 16:23:37 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* method.h (METHOD_ENTRY_BASIC_SET): fix last commit (unbalanced parens).
-
-Thu Jun 11 15:14:16 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* configure.in: define SET_THREAD_NAME if it has pthread_set_name_np
-	  for FreeBSD, and don't define it if both pthread_setname_np
-	  and pthread_set_name_np don't exist.
-
-	* thread_pthread.c (SET_THREAD_NAME): don't define if they don't exist.
-
-	* thread_pthread.c (native_set_thread_name): run if SET_THREAD_NAME
-	  is defined.
-
-Thu Jun 11 15:53:31 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* method.h (METHOD_ENTRY_BASIC_SET): should clear last bit.
-
-Thu Jun 11 14:34:45 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* lib/rubygems.rb: bump version to 2.4.7 and 2.4.8. these versions fixed
-	  CVE-2015-3900.
-	* lib/rubygems/remote_fetcher.rb: ditto.
-	* test/rubygems/test_gem_remote_fetcher.rb: added testcase for CVE-2015-3900
-
-Thu Jun 11 14:18:51 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* lib/rubygems.rb: bump version to 2.4.6. It's missing change at r49774.
-
-Thu Jun 11 13:50:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* array.c (ary_ensure_room_for_push): check if array size will
-	  exceed maximum size to get rid of buffer overflow.
-	  [ruby-dev:49043] [Bug #11235]
-
-	* array.c (ary_ensure_room_for_unshift, rb_ary_splice): ditto.
-
-Thu Jun 11 13:17:34 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* test/test_cmath.rb (TestCMath#test_trigonometric_functions): should
-	  not compare float values (in complex values) by `==`.
-
-Thu Jun 11 08:52:01 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* method.h: embed rb_method_entry_t::attr::flags (5 bits) into
-	  rb_method_entry_t::flags to make one word spare space.
-
-	  Add some macros to access these flags.
-
-	* vm_method.c: use these macros.
-
-	* internal.h: define IMEMO_FL_USHIFT and IMEMO_FL_USER[0-4]
-	  for T_IMEMO local flags.
-
-Thu Jun 11 08:27:06 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm.c: use VM_ASSERT instead of assert().
-
-	* vm_args.c: ditto.
-
-	* vm_insnhelper.c: ditto.
-
-	* vm_method.c: ditto.
-
-Thu Jun 11 08:16:48 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_core.h: define VM_ASSERT() for assertion
-	  enabled only when (VM_CHECK_MODE > 0).
-
-	* vm_insnhelper.c: move definition VM_CHECK_MODE
-	  from vm_insnhelper.c to vm_core.h.
-
-	* vm.c: remove <assert.h>
-
-Thu Jun 11 06:46:07 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_insnhelper.c (check_frame): check type of cref_or_me first.
-
-Thu Jun 11 04:34:39 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
-
-	* test/test_cmath.rb: Add some assertions.
-
-Thu Jun 11 00:34:39 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* template/fake.rb.in: expanded macro result may have spaces
-	  between tokens.  [ruby-dev:49047] [Bug #11243]
-
-Wed Jun 10 22:27:32 2015  Naohisa Goto  <ngotogenome@gmail.com>
-
-	* lib/mkmf.rb: revert r50804 because of build failure when specifying
-	  LDFLAGS during configure, observed on Solaris with GCC 4.6.
-	  [Bug #11245]
-
-Wed Jun 10 21:59:51 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
-
-	* README.ja.md: fix markup miss.
-
-Wed Jun 10 11:06:25 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* template/fake.rb.in: turn into erb template from autoconf
-	  template to fake more accurately.
-
-	* common.mk (fake.rb): needs preprocessed file now.
-
-	* version.c (Init_version): add dummy expression to
-	  RUBY_ENGINE_VERSION.
-
-Tue Jun  9 12:31:25 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
-
-	* lib/prime.rb: Simplify and optimize EratosthenesSieve
-
-Tue Jun  9 11:45:00 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
-
-	* lib/prime.rb: Simplify and optimize EratosthenesSieve
-	  based on patch by Ajay Kumar. [Fixes GH-921]
-
-Mon Jun  8 05:09:58 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (obj_info): print method id for T_IMEMO/ment.
-
-Sun Jun  7 07:05:43 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
-
-	* Move test cases from test/ruby/test_complex.rb to test/test_cmath.rb
-
-Sat Jun  6 18:23:41 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* method.h: back to share rb_method_definition_t by
-	  rb_method_entry_t.
-
-	  r50728 changed sharing `def's to isolating `def's
-	  on alias and so on. However, this change conflicts
-	  future improvement plan. So I change back to sharing approach.
-
-	* method.h: move rb_method_definition_t::flags to
-	  rb_method_entry_t::attr::flags.
-
-	  rb_method_entry_t::attr is union with VALUE because this field
-	  should have same size of VALUE. rb_method_entry_t is T_IMEMO).
-
-	  And also add the following access macros to it's fields.
-
-	  * METHOD_ENTRY_VISI(me)
-	  * METHOD_ENTRY_BASIC(me)
-	  * METHOD_ENTRY_SAFE(me)
-
-	* vm_method.c (rb_method_definition_addref): added instead of
-	  rb_method_definition_clone().
-
-	  Do not create new definition, but increment alias_count.
-
-	* class.c (clone_method): catch up this fix.
-
-	* class.c (method_entry_i): ditto.
-
-	* proc.c (mnew_internal): ditto.
-
-	* proc.c (mnew_missing): ditto.
-
-	* vm_eval.c: ditto.
-
-	* vm_insnhelper.c: ditto.
-
-	* vm_method.c: ditto.
-
-Sat Jun  6 15:59:38 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* class.c: ins_methods_push() needs rb_method_visibility_t type on
-	  2nd arg.
-
-Sat Jun  6 15:05:47 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* class.c (ins_methods_push): Change type and name of parameters
-	  to make more clear.
-
-Sat Jun  6 08:52:13 2015  Eric Wong  <e@80x24.org>
-
-	* test/socket/test_nonblock.rb: try to avoid EMSGSIZE
-	  [ruby-core:69466]
-
-Sat Jun  6 07:58:30 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c: remove struct mark_tbl_arg and pass objspace directly
-	  to avoid indirect access overhead.
-
-Sat Jun  6 07:08:45 2015  Eric Wong  <e@80x24.org>
-
-	* ext/socket/ancdata.c (bsock_sendmsg_internal): drop redundant assignment
-
-Sat Jun  6 01:00:06 2015  Naohisa Goto  <ngotogenome@gmail.com>
-
-	* ext/socket/ancdata.c (bsock_sendmsg_internal): all arguments are
-	  parsed even on systems without HAVE_STRUCT_MSGHDR_MSG_CONTROL
-	  to prevent SEGV caused by passing Qnil to RARRAY_LENINT and
-	  to preserve behavior before r50776.
-	  [Bug #11224] [ruby-core:69468] [Bug #11225] [ruby-core:69469]
-
-Fri Jun  5 22:37:42 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* class.c (ins_methods_push): change 3rd parameter's type
-	  from long to rb_method_visibility_t.
-
-	* class.c (ins_methods_i): catch up this fix.
-
-	* class.c (method_entry_i): cast to st_data_t instead of `long'.
-
-Fri Jun  5 20:37:10 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* internal.h: move definition of rb_cref_t to method.h.
-
-	* eval_intern.h: move definition of rb_scope_visibility_t
-	  to method.h.
-
-	* method.h: change rb_cref_t::scope_visi from VALUE to
-	  rb_scope_visibility_t.
-	  [Bug #11219]
-
-	* vm.c (vm_cref_new): accept rb_method_visibility_t directly.
-
-	* vm_insnhelper.c (rb_vm_rewrite_cref): don't use 0,
-	  but METHOD_VISI_UNDEF.
-
-	* vm_method.c (rb_scope_visibility_set): don't need to use cast.
-
-	* vm_method.c (rb_scope_module_func_set): ditto.
-
-Fri Jun  5 17:27:30 2015  Eric Wong  <e@80x24.org>
-
-	* ext/socket/ancdata.c (bsock_sendmsg_internal): avoid msg_control
-	  ptr if msg_controllen is zero to fix portability problems.
-
-Fri Jun  5 09:17:45 2015  Eric Wong  <e@80x24.org>
-
-	* ext/socket/ancdata.c (bsock_sendmsg_internal): fix build error
-	  from r50776
-
-Fri Jun  5 07:05:58 2015  Eric Wong  <e@80x24.org>
-
-	* io.c (sym_wait_readable, sym_wait_writable): declare
-	  (io_getpartial): use sym_wait_readable
-	  (io_write_nonblock): use sym_wait_writable
-	  (Init_IO): initialize sym_wait_*able
-
-Fri Jun  5 06:43:00 2015  Eric Wong  <e@80x24.org>
-
-	* doc/extension.rdoc: note rb_get_kwargs changes keywords_hash
-	  [ruby-core:68507]
-
-Fri Jun  5 05:50:29 2015  Eric Wong  <e@80x24.org>
-
-	* ext/socket/ancdata.c (bsock_sendmsg_internal): use rb_scan_args
-	  [ruby-core:69439] [Feature #11207]
-
-Fri Jun  5 02:20:06 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* test/lib/envutil.rb (assert_no_memory_leak): change default value
-	  of limit from 1.5 to 2.0. It is ad-hoc fix to solve test failure
-	  in travis-ci.
-
-Fri Jun  5 01:17:21 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_insnhelper.c (vm_defined): no need to use cast.
-
-Fri Jun  5 01:14:02 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_insnhelper.c (vm_defined): show additional messages on rb_bug().
-
-Fri Jun  5 01:06:02 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_method.c (rb_add_method_iseq): use intermediate struct to
-	  avoid initializing struct with variables.
-	  [Bug #11217]
-
-	* method.h: add a comment about it.
-
-Fri Jun  5 00:55:21 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* method.h: constify rb_method_refined_t::orig_me.
-
-	  Also constify the following functions.
-
-	  * rb_resolve_refined_method()
-	  * rb_method_entry_with_refinements()
-	  * rb_method_entry_without_refinements()
-	  * rb_method_entry_copy()'s parameter.
-
-	* class.c: catch up this fix.
-
-	* vm_insnhelper.c: ditto.
-
-	* vm_method.c: ditto.
-
-Thu Jun  4 12:47:54 SGT 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* array.c: Revert r50763. because "reentered" is not typo.
-
-Thu Jun  4 11:12:29 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* ext/win32ole/win32ole.c: fix a typo. Patch by @davydovanton
-	  [fix GH-923]
-	* include/ruby/st.h: ditto.
-	* include/ruby/util.h: ditto.
-
-Thu Jun  4 10:54:30 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* array.c: fix a typo. Patch by @manish-shrivastava
-	  [fix GH-922]
-
-Thu Jun  4 09:52:02 2015  Eric Wong  <e@80x24.org>
-
-	* ext/openssl/lib/openssl/ssl.rb: use io/nonblock instead of fcntl
-	  [ruby-core:69382] [Feature #11190]
-
-Thu Jun  4 07:22:45 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* method.h: introduce rb_method_refined_t for refined method entry.
-
-	* class.c (move_refined_method): catch up this fix.
-
-	* gc.c (mark_method_entry): ditto.
-
-	* vm_eval.c (vm_call0_body): ditto.
-
-	* vm_insnhelper.c (vm_call_method): ditto.
-
-	* vm_method.c: ditto.
-
-Thu Jun  4 07:12:20 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (dirent_match): match short names only when FNM_SHORTNAME
-	  flag is given, for the backward compatibility, and the new
-	  behavior is often dangerous.  [ruby-core:69435] [Bug #11206]
-
-Thu Jun  4 05:44:01 2015  Eric Wong  <e@80x24.org>
-
-	* variable.c (special_generic_ivar): remove flag
-	  (givar_i, rb_mark_generic_ivar_tbl): remove functions
-	  (rb_free_generic_ivar, rb_ivar_lookup, rb_ivar_delete,
-	   generic_ivar_set, rb_ivar_set, rb_ivar_defined,
-	   rb_copy_generic_ivar, rb_ivar_foreach, rb_ivar_count,
-	   rb_obj_remove_instance_variable):
-	   adjust for lack of ivar support in special constants
-	* test/ruby/test_variable.rb: test ivars for special consts
-	* internal.h: remove rb_mark_generic_ivar_tbl decl
-	* gc.c (gc_mark_roots): remove rb_mark_generic_ivar_tbl call
-	  [ruby-core:69441] [Feature #11208]
-
-Thu Jun  4 05:13:34 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_insnhelper.c (def_iseq_ptr): `iseqval' is not available any more.
-
-Thu Jun  4 04:50:12 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* class.c (method_entry_i): mtbl should not have `me' as NULL.
-
-Thu Jun  4 04:28:45 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* class.c (clone_method): do not use me->klass, but use explicitly
-	  passed argument.
-
-Thu Jun  4 04:10:43 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_core.h (rb_vm_rewrite_cref_stack): rename to rb_vm_rewrite_cref().
-
-	* class.c (clone_method): use renamed name.
-
-	* vm_insnhelper.c (rb_vm_rewrite_cref): do not use `node' in variable
-	  names.
-
-Wed Jun  3 23:03:50 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_method.c: rename `rb_frame_...' to `rb_scope_...'.
-
-	* eval_intern.h: move decl. of rb_scope_visibility_set() to method.h.
-
-	* load.c: catch up this fix.
-
-Wed Jun  3 21:14:20 2015  Tanaka Akira  <akr@fsij.org>
-
-	* ext/rbconfig/sizeof/extconf.rb: Check C99 standard integer types.
-
-Wed Jun  3 21:00:47 2015  Tanaka Akira  <akr@fsij.org>
-
-	* configure.in: Don't check __int128.
-
-	* ext/rbconfig/sizeof/extconf.rb: Check __int128.
-
-	* ext/rbconfig/sizeof/depend: sizes.c depends on
-	  ext/rbconfig/sizeof/extconf.rb.
-
-	* template/sizes.c.tmpl: Detect check_sizeof.
-
-Wed Jun  3 20:07:07 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* class.c (clone_method): remove redundant check for me->def != NULL.
-	  Now, all `me` have `me->def`.
-
-	* proc.c (rb_method_entry_location): ditto.
-
-	* vm.c (rb_vm_check_redefinition_opt_method): ditto.
-
-	* vm.c (add_opt_method): ditto.
-
-	* vm_eval.c (vm_call0_body): ditto.
-
-Wed Jun  3 19:24:12 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_core.h: rename enum missing_reason to enum method_missing_reason.
-
-	* vm_core.h: use enum method_missing_reason for
-	  rb_thread_t::method_missing_reason.
-
-	* vm_eval.c: catch up this fix.
-
-	* vm_insnhelper.c: ditto.
-
-Wed Jun  3 16:17:21 2015  Aaron Patterson <tenderlove@ruby-lang.org>
-
-	* vm.c: eagerly allocate `loading_table`.  This eliminates the need to
-	  do NULL checks when looking up the `loading_table` hash.
-	  https://github.com/ruby/ruby/pull/918
-
-	* load.c: remove various NULL checks
-
-Wed Jun  3 11:47:15 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* method.h: change fields order to gather frequent access fields.
-
-	* vm_insnhelper.c (vm_call_method): add LIKELY().
-
-Wed Jun 03 10:35:45 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* method.h: split rb_method_definition_t::flag to several flags.
-
-	  `flag' contains several categories of attributes and it makes us
-	  confusion (at least, I had confused).
-
-	  * rb_method_visibility_t (flags::visi)
-	    * NOEX_UNDEF     -> METHOD_VISI_UNDEF     = 0
-	    * NOEX_PUBLIC    -> METHOD_VISI_PUBLIC    = 1
-	    * NOEX_PRIVATE   -> METHOD_VISI_PRIVATE   = 2
-	    * NOEX_PROTECTED -> METHOD_VISI_PROTECTED = 3
-	  * NOEX_SAFE(flag)  -> safe (flags::safe, 3 bits)
-	  * NOEX_BASIC       -> basic (flags::basic, 1 bit)
-	  * NOEX_MODFUNC     -> rb_scope_visibility_t in CREF
-	  * NOEX_SUPER       -> MISSING_SUPER (enum missing_reason)
-	  * NOEX_VCALL       -> MISSING_VCALL (enum missing_reason)
-	  * NOEX_RESPONDS    -> BOUND_RESPONDS (macro)
-
-	  Now, NOEX_NOREDEF is not supported (I'm not sure it is needed).
-
-	  Background:
-	    I did not know what "NOEX" stands for.
-	    I asked Matz (who made this name) and his answer was "Nothing".
-	    "At first, it meant NO EXport (private), but the original
-	    meaning was gone."
-	    This is why I remove the mysterious word "NOEX" from MRI.
-
-	* vm_core.h: introduce `enum missing_reason' to represent
-	  method_missing (NoMethodError) reason.
-
-	* eval_intern.h: introduce rb_scope_visibility_t to represent
-	  scope visibility.
-	  It has 3 method visibilities (public/private/protected)
-	  and `module_function`.
-
-Wed Jun  3 08:06:30 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* gem/bundled_gems: updated to test-unit 3.1.1 and minitest 5.7.0.
-
-Wed Jun  3 04:48:05 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_insnhelper.c (vm_defined): check respond_to_missing?
-	  at defined?(func()).
-	  [Bug #11212]
-
-	* test/ruby/test_defined.rb: add a test for this fix.
-
-Wed Jun  3 04:34:39 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_insnhelper.c (vm_defined): skip respond_to_missing? when
-	  a method is available.
-	  [Bug #11211]
-
-	* test/ruby/test_defined.rb: add a test for this fix.
-
-Wed Jun  3 04:14:13 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* insns.def (defined), vm_insnhelper.c (vm_defined):
-	  move instruction body to the vm_defined() function.
-
-Wed Jun  3 02:29:25 2015  Benoit Daloze  <eregontp@gmail.com>
-
-	* test/ruby/test_module.rb: Do not assume class variable order.
-	  Patch by @enebo.
-
-Wed Jun  3 01:10:38 2015  Yusuke Endoh  <mame@tsg.ne.jp>
-
-	* vm_method.c (rb_method_definition_set): remove a double assignment.
-	  Coverity Scan found this bug.
-
-Wed Jun  3 00:04:51 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_method.c (rb_alias): rename parameter names.
-
-Tue Jun  2 23:27:18 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* method.h: remove rb_method_iseq_t::iseqval.
-	  While making a r50728, iseqval is needed (to mark correctly),
-	  but now just iseqptr is enough.
-
-	* class.c: catch up this fix.
-
-	* gc.c: ditto.
-
-	* proc.c: ditto.
-
-	* vm_method.c: ditto.
-
-Tue Jun  2 21:29:28 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* proc.c (proc_curry): remove a debug line.
-
-Tue Jun  2 12:43:46 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* method.h: make rb_method_entry_t a VALUE.
-	  Motivation and new data structure are described in [Bug #11203].
-
-	  This patch also solve the following issues.
-
-	  * [Bug #11200] Memory leak of method entries
-	  * [Bug #11046] __callee__ returns incorrect method name in orphan
-	                 proc
-
-	* test/ruby/test_method.rb: add a test for [Bug #11046].
-
-	* vm_core.h: remove rb_control_frame_t::me. me is located at value
-	  stack.
-
-	* vm_core.h, gc.c, vm_method.c: remove unlinked_method... codes
-	  because method entries are simple VALUEs.
-
-	* method.h: Now, all method entries has own independent method
-	  definitions. Strictly speaking, this change is not essential,
-	  but for future changes.
-
-	  * rb_method_entry_t::flag is move to rb_method_definition_t::flag.
-	  * rb_method_definition_t::alias_count is now
-	    rb_method_definition_t::alias_count_ptr, a pointer to the counter.
-
-	* vm_core.h, vm_insnhelper.c (rb_vm_frame_method_entry) added to
-	  search the current method entry from value stack.
-
-	* vm_insnhelper.c (VM_CHECK_MODE): introduced to enable/disable
-	  assertions.
-
-Tue Jun  2 10:46:36 2015  Eric Wong  <e@80x24.org>
-
-	* test/socket/test_nonblock.rb: new test for sendmsg_nonblock
-
-Tue Jun  2 09:04:14 2015  Eric Wong  <e@80x24.org>
-
-	* lib/benchmark.rb: just use Process::CLOCK_MONOTONIC
-	  [ruby-core:69390]
-
-Mon Jun  1 22:01:27 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/mkmf.rb (pkg_config): split --libs if --libs-only-l option
-	  is not available.  patch in [ruby-core:69428] by Hans Mackowiak.
-	  [ruby-core:69421] [Bug #11201]
-
-Mon Jun  1 21:18:24 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (gc_mark_children): remove a garbage character
-	  introduced at the last commit.
-
-Mon Jun  1 19:24:42 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_method.c (rb_method_entry_make): do not show warning message
-	  when method_entry is an alias.
-
-Mon Jun  1 15:47:16 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* internal.h: move class related definitions.
-
-Mon Jun  1 15:43:03 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* class.c: remove needless include pragma for method.h.
-
-	* struct.c: ditto.
-
-	* vm_method.c: ditto.
-
-Mon Jun  1 05:42:00 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* eval_intern.h, vm_method.c: move macros to functions.
-	  * SCOPE_TEST(f)  -> rb_frame_visibility_test(flag).
-	  * SCOPE_CHECK(f) -> rb_frame_visibility_check(flag).
-	  * SCOPE_SET(f)   -> rb_frame_visibility_set(flag).
-
-	* load.c (load_ext): use it.
-
-Mon Jun  1 04:47:37 2015  Zachary Scott  <e@zzak.io>
-
-	* ext/date/date_core.c: [DOC] Add comparison of Time and DateTime
-	  Patch provided by @pixeltrix
-
-Mon Jun  1 04:22:09 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_core.h (VM_FRAME_MAGIC_DUMMY): introduce new frame type to
-	  recognize dummy frame.
-
-	* vm.c (th_init): use new frame type.
-
-	* vm_args.c (raise_argument_error): ditto.
-
-Mon Jun  1 04:15:42 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* class.c (rb_class_has_methods): added to reduce dependency
-	  to internal class data structure.
-
-	* internal.h: ditto.
-
-	* hash.c (has_extra_methods): use added function.
-
-Mon Jun  1 04:11:48 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c , gc.h (rb_obj_info): export obj_info(VALUE) for debugging.
-
-Mon Jun  1 03:52:55 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* test/ruby/test_gc.rb: increase timeout seconds for GC stressful
-	  debugging.
-
-Sun May 31 04:18:06 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* method.h: fix typo of comments.
-
-Sun May 31 03:36:42 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* method.h: add VM_METHOD_TYPE_ALIAS rb_method_definition_t::type
-	  to fix [Bug #11173].
-
-	  Now, inter class/method alias creates new method entry
-	  VM_METHOD_TYPE_ALIAS, which has an original method entry.
-
-	* vm_insnhelper.c (find_defined_class_by_owner): added.
-	  Search corresponding defined_class from owner class/module.
-
-	* vm_method.c (rb_method_entry_get_without_cache): return me->klass
-	  directly for defined_class.
-
-	  Now, no need to check me->klass any more.
-
-	* vm_method.c (method_entry_set0): separated from method_entry_set().
-
-	* vm_method.c (rb_alias): make method entry has VM_METHOD_TYPE_ALIAS.
-
-	* vm_method.c (release_method_definition): support VM_METHOD_TYPE_ALIAS.
-
-	* vm_method.c (rb_hash_method_definition): ditto.
-
-	* vm_method.c (rb_method_definition_eq): ditto.
-
-	* vm_method.c (release_method_definition): ditto.
-
-	* vm_insnhelper.c (vm_call_method): ditto.
-
-	* vm_insnhelper.c (vm_method_cfunc_entry): ditto.
-
-	* vm_eval.c (vm_call0_body): ditto.
-
-	* gc.c (mark_method_entry): ditto.
-
-	* proc.c (method_def_iseq): ditto.
-
-	* proc.c (method_cref): ditto.
-
-	* proc.c (rb_method_entry_min_max_arity): ditto.
-
-	* test/ruby/test_alias.rb: add tests.
-
-	* test/ruby/test_module.rb: fix a test to catch up current behavior.
-
-Sun May 31 03:34:25 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_method.c (rb_unlink_method_entry): make it static.
-
-Sun May 31 03:26:58 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* method.h, vm_method.c (rb_free_method_entry): constify a parameter.
-
-	* vm_core.h: remove useless declaration about rb_unlink_method_entry().
-
-Sat May 30 18:05:02 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* lib/tempfile.rb (Remover#call): fixed wrong condition.  introduced at
-	  r50682.
-
-Sat May 30 16:12:35 2015  Eric Wong  <e@80x24.org>
-
-	* ext/socket/ancdata.c: use RB_GC_GUARD instead of volatile
-	  [ruby-core:69419] [Feature #11198]
-
-Sat May 30 15:59:10 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* lib/tempfile.rb (Tempfile#initialize): initialize @unlinked to fix
-	  test failures introduced at r50682.  I hope that check the results of
-	  tests before committing, at least the tests about the changed feature.
-
-Sat May 30 11:02:55 2015  Martin Englund <martin@englund.nu>
-
-	* doc/dtrace_probes.rdoc: change lingering dtrace probe documentation
-	  from function- to method-
-
-Sat May 30 10:26:09 2015  Masaki Matsushita <glass.saga@gmail.com>
-
-	* lib/tempfile.rb: refactoring.
-	  * use warn instead of STDERR.print
-	  * remove @tmpname and use @tmpfile.path
-	  * introduce @unlinked flag
-	  * Remover takes only @tmpfile
-	  * mode will be modified just before file reopen
-
-Sat May 30 09:02:51 2015  Eric Wong  <e@80x24.org>
-
-	* include/ruby/intern.h (rb_generic_ivar_table): deprecate
-	* internal.h (rb_attr_delete): declare
-	* marshal.c (has_ivars): use rb_ivar_foreach
-	  (w_ivar): ditto
-	  (w_object): update for new interface
-	* time.c (time_mload): use rb_attr_delete
-	* variable.c (generic_ivar_delete): implement
-	  (rb_ivar_delete): ditto
-	  (rb_attr_delete): ditto
-	  [ruby-core:69323] [Feature #11170]
-
-Sat May 30 09:14:28 2015  Scott Francis  <scott.francis@shopify.com>
-
-	* cont.c (cont_free): check if ruby_current_thread is still valid.
-	  [Fix GH-914]
-
-Sat May 30 08:36:04 2015  Eric Wong  <e@80x24.org>
-
-	* variable.c (static int special_generic_ivar): move
-	  (rb_generic_ivar_table): rewrite for compatibility
-	  (gen_ivtbl_bytes): new function
-	  (generic_ivar_get): update to use ivar index
-	  (generic_ivar_update): ditto
-	  (generic_ivar_set): ditto
-	  (generic_ivar_defined): ditto
-	  (generic_ivar_remove): ditto
-	  (rb_mark_generic_ivar): ditto
-	  (givar_i): ditto
-	  (rb_free_generic_ivar): ditto
-	  (rb_mark_generic_ivar_tbl): ditto
-	  (rb_generic_ivar_memsize): ditto
-	  (rb_copy_generic_ivar): ditto
-	  (rb_ivar_set): ditto
-	  (rb_ivar_foreach): ditto
-	  (rb_ivar_count): ditto
-	  (givar_mark_i): remove
-	  (gen_ivtbl_mark): new function
-	  (gen_ivar_each): ditto
-	  (iv_index_tbl_extend): update for struct ivar_update
-	  (iv_index_tbl_newsize): ditto
-	  [ruby-core:69323] [Feature #11170]
-
-Sat May 30 08:10:46 2015  Eric Wong  <e@80x24.org>
-
-	* variable.c (iv_index_tbl_make): extract from rb_ivar_set
-	  (iv_index_tbl_extend): ditto
-	  (iv_index_tbl_newsize): ditto
-	  (rb_ivar_set): use extracted functions
-	  [ruby-core:69323] (Part 1)
-
-Fri May 29 17:39:14 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* tool/make_hgraph.rb: added.
-
-Fri May 29 14:39:00 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* compile.c (iseq_compile_each): out of range NTH_REF is always
-	  nil.
-
-	* parse.y (parse_numvar): check overflow of NTH_REF and range.
-	  [ruby-core:69393] [Bug #11192]
-
-	* util.c (ruby_scan_digits): make public and add length parameter.
-
-Fri May 29 11:18:58 2015  Eric Wong  <e@80x24.org>
-
-	* ext/socket/ancdata.c (bsock_sendmsg_internal,
-	  bsock_recvmsg_internal):
-	  avoid redundant fcntl on Linux
-	  [ruby-core:69154] [Feature #11145]
-	* ext/socket/init.c (rsock_s_recvfrom_nonblock): ditto
-	* ext/socket/rubysocket.h (MSG_DONTWAIT_RELIABLE): new macro
-
-Fri May 29 10:30:34 2015  Eric Wong  <e@80x24.org>
-
-	* lib/net/resolv.rb (request): use monotonic clock
-	* lib/net/http.rb (begin_transport, end_transport): ditto
-	  [ruby-core:69384] [Feature #11124]
-
-Fri May 29 04:37:38 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* ext/objspace/objspace.c: add two methods to debug internals.
-
-	  * ObjectSpace.internal_class_of: return RBASIC_CLASS(obj).
-	  * ObjectSpace.internal_super_of: return RCLASS_SUPER(cls).
-
-	* NEWS: add information about both methods.
-
-	* test/objspace/test_objspace.rb: add tests for both methods.
-
-Thu May 28 06:55:53 2015  Anton Davydov  <antondavydov.o@gmail.com>
-
-	* ext/tk/sample/figmemo_sample.rb (open_file),
-	  ext/tk/sample/tktextio.rb (TkTextIO): fix typo in messages.
-	  [Fix GH-916]
-
-Wed May 27 09:50:51 2015  Eric Wong  <e@80x24.org>
-
-	* ext/openssl/ossl_asn1.c (ossl_asn1_traverse, ossl_asn1_decode,
-	  ossl_asn1_decode_all): use RB_GC_GUARD instead of volatile
-	  [ruby-core:69371] [Bug #11185]
-
-Wed May 27 09:27:30 2015  Eric Wong  <e@80x24.org>
-
-	* lib/drb/drb.rb (set_sockopt): remove redundant fcntl call
-	* lib/drb/unix.rb (set_sockopt): ditto
-	  [ruby-core:69128] [Feature #11137]
-
-Tue May 26 22:10:43 2015  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* vm_method.c (rb_alias): should resolve refined methods.
-	  [ruby-core:69360] [Bug #11182]
-
-Tue May 26 21:35:13 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
-
-	* include/ruby/defines.h (RUBY_ATTR_ALLOC_SIZE): fix condition.
-
-Mon May 25 22:35:58 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* tool/redmine-backporter.rb (rel): after the relations is changed,
-	  @changesets is no longer right.
-
-Mon May 25 11:27:14 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* win32/win32.c (setup_overlapped): seek to the file end only when
-	  writing (mode:a), not reading (mode:a+, read).
-
-Mon May 25 00:27:37 2015  Benoit Daloze  <eregontp@gmail.com>
-
-	* numeric.c (Numeric#negative?): [DOC] Fix call-seq.
-	  Patch by @yui-knk. [Fixes GH-908]
-
-Sun May 24 01:35:22 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* debug.c (ruby_debug_print_id): use rb_id2name() for fprintf().
-
-Sat May 23 18:38:46 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* man/*.1: updated dates in man pages.
-	  [ruby-dev:48988] [Bug #11171]
-
-Sat May 23 03:10:58 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/win32.c (rb_w32_write_console): should return the count of
-	  actually eaten characters, include escape sequences.
-
-Fri May 22 22:36:14 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
-
-	* lib/prime.rb: Remove obsolete Prime.new
-	  patch by Ajay Kumar. [Fixes GH-891]
-
-Fri May 22 21:13:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* include/ruby/intern.h (rb_sym_count): move `rb_sym_all_symbols`
-	  to a symbol.c specific section.  a part of patch by Lourens
-	  Naude.
-
-Fri May 22 20:56:33 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* complex.c (f_complex_polar): simple bug reproduced only when y is
-	  a float but x is not a float.
-
-Fri May 22 19:42:06 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* process.c (rb_spawn_process): do not discard global escape
-	  status.  [ruby-core:69304] [Bug #11166]
-
-	* process.c (rb_execarg_spawn): extract the start procedure in a
-	  parent process with ensuring the end procedure.
-
-Fri May 22 16:48:32 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* NEWS: added news for net-telnet and rake
-
-Thu May 21 20:27:07 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* configure.in (RUBY_DTRACE_POSTPROCESS): cmp -b is GNU extension.
-	  darwin uses GNU cmp, and FreeBSD and Solaris are not.
-	  Note that accidentally equals to expected result.
-
-Thu May 21 18:00:19 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* iseq.c: constify.
-
-	* iseq.h: ditto.
-
-	* method.h: ditto.
-
-	* proc.c: ditto.
-
-	* vm_method.c: ditto.
-
-Thu May 21 17:44:53 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* proc.c: fix issues caused by binding created from Method#to_proc.
-	  [Bug #11163]
-
-	* vm.c (vm_cref_new_toplevel): export as rb_vm_cref_new_toplevel().
-
-	* test/ruby/test_method.rb: add some assertions.
-
-Thu May 21 17:29:26 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* lib/matrix.rb: added documentation for Matrix#empty and Matrix#/
-	  [Feature #10070][ruby-dev:48433] Patch by @gogotanaka
-
-Thu May 21 17:02:43 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* proc.c: rename functions.
-	  * method_get_def() -> method_def()
-	  * method_get_iseq() -> method_def_iseq()
-	  * method_get_cref() -> method_cref()
-
-Thu May 21 16:52:44 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* proc.c (rb_method_get_iseq): rename to rb_method_iseq.
-
-	* iseq.c: catch up this fix.
-
-	* iseq.h: commit ditto.
-
-Thu May 21 15:41:45 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* lib/net/telnet.rb: gemify net-telnet.
-	  [Feature #11083]
-	* gems/bundled_gems: added net-telnet to bundled gems.
-
-Thu May 21 15:37:32 2015  Zachary Scott  <e@zzak.io>
-
-	* vm_method.c: Remove private attribute warning [Bug #10967]
-	  Patch by @spastorino [Fixes GH-849]
-	  https://github.com/ruby/ruby/pull/849
-
-	* test/ruby/test_module.rb: Update test for changes
-
-Thu May 21 10:59:43 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* proc.c (method_proc): rename to method_to_proc.
-
-Thu May 21 10:51:54 2015  Jake Worth  <jakeworth82@gmail.com>
-
-	* io.c (rb_f_select): [DOC] Fixes for grammar and style.
-	  [Fix GH-906]
-
-Thu May 21 08:25:19 2015  Eric Wong  <e@80x24.org>
-
-	* variable.c (Init_var_tables): init generic_iv_tbl
-	  (rb_generic_ivar_table, generic_ivar_get, generic_ivar_set,
-	   generic_ivar_defined, generic_ivar_remove,
-	   rb_mark_generic_ivar, givar_i, rb_mark_generic_ivar_tbl,
-	   rb_free_generic_ivar, rb_copy_generic_ivar, rb_ivar_foreach,
-	   rb_ivar_count): remove checks for uninitialize generic_iv_tbl
-	[ruby-core:69155] [Feature #11146]
-
-Thu May 21 04:11:03 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* iseq.c (exception_type2symbol): show correct bug message.
-
-Wed May 20 23:19:05 2015  Yusuke Endoh  <mame@ruby-lang.org>
-
-	* lib/base64.rb: Fix rdoc-formatting for padding argument.
-	  [fix GH-905][ci skip] Patch by @davydovanton
-
-Wed May 20 13:16:23 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in (DEPRECATED_BY): deprecate warning with preferable
-	  alternative.
-
-	* configure.in (RUBY_FUNC_ATTRIBUTE): allow attribute arguments in
-	  the macro.
-
-Wed May 20 11:23:24 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* vm_dump.c (rb_print_backtrace): return value of libexec's backtrace
-	  is size_t, so simply cast as int.
-
-Tue May 19 18:54:41 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* iseq.c (rb_iseq_compile_with_option): check source type, must be
-	  an IO or a String.  [ruby-core:69219] [Bug #11159]
-
-Tue May 19 17:15:03 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* lib/benchmark.rb: Update Benchmark documentation and formatting.
-	  [fix GH-903][ci skip] Patch by @davydovanton
-
-Tue May 19 13:10:08 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* numeric.c (num_positive_p): should false on Bignum 0.
-	  http://twitter.com/rafaelfranca/status/600509783427391488
-	  [ruby-core:69173] [Feature #11151]
-
-Tue May 19 11:22:28 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* lib/uri/rfc2396_parser.rb (initialize_pattern):
-	  URI::Generic.build should accept port as a string.
-	  pattern[:PORT] is not defined for long.
-	  by Dave Slutzkin <daveslutzkin@fastmail.fm>
-	  https://github.com/ruby/ruby/pull/804 fix GH-804
-
-Tue May 19 11:18:46 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* include/ruby/ruby.h (rb_data_typed_object_alloc),
-	  (rb_data_object_alloc): add old names for source level backward
-	  compatibilities.
-
-	* gc.c (rb_data_object_alloc, rb_data_typed_object_alloc): add
-	  aliases for binary level backward compatibilities.
-
-Tue May 19 09:54:44 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* include/ruby/ruby.h (Data_Make_Struct0): needs function pointer
-	  casts to fix function overloading in C++.
-
-Tue May 19 09:43:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* include/ruby/ruby.h (Data_Make_Struct0, TypedData_Make_Struct0):
-	  explicit cast from void* is necessary as implicit cast is
-	  disallowed in C++.
-
-Mon May 18 15:31:31 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* include/ruby/intern.h (rb_f_notimplement): should not respond to
-	  not-implemented methods.  as the address inside a DLL and the
-	  imported address are different on Windows, use an exported
-	  variable to share the same address.
-
-Mon May 18 13:55:01 2015  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/monitor.rb (mon_try_enter, mon_enter): should reset @mon_count
-	  just in case the previous owner thread dies without mon_exit.
-	  [fix GH-874] Patch by @chrisberkhout
-
-Sun May 17 17:21:29 2015  Eric Wong  <e@80x24.org>
-
-	* lib/webrick/utils.rb (set_non_blocking): use IO#nonblock=
-	* (set_close_on_exec): use IO#close_on_exec=
-	  [Feature #11136]
-
-Sun May 17 15:01:26 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* numeric.c (num_positive_p, num_negative_p): add methods
-	  Numeric#positive? and Numeric#negative?.
-	  [ruby-core:69173] [Feature #11151]
-
-	* numeric.c (flo_positive_p, flo_negative_p): specialized
-	  functions for Float.
-
-	* complex.c (Init_Complex): Complex do not have positive? and
-	  negative? methods
-
-Sun May 17 14:57:42 2015  Eric Wong  <e@80x24.org>
-
-	* lib/webrick/server.rb (accept_client): avoid redundant fcntl call
-	  [Feature #11137]
-
-Sun May 17 12:13:33 2015  Eric Wong  <e@80x24.org>
-
-	* ext/socket/init.c (cloexec_accept): support nonblock flag and
-	  use SOCK_NONBLOCK if possible
-	* ext/socket/init.c (rsock_s_accept_nonblock):
-	  update cloexec_accept call
-	* ext/socket/init.c (accept_blocking): ditto for blocking
-	* test/socket/test_nonblock.rb: check nonblock? on accepted socket
-	  [Feature #11138]
-
-Sun May 17 03:58:59 2015  Aaron Patterson <tenderlove@ruby-lang.org>
-
-	* load.c (loaded_feature_path): stop returning false negatives for
-	  filenames which are trailing substrings of file extensions.  For
-	  example, 'b', which a trailing substring of ".rb" should not return
-	  false. [Bug #11155][ruby-core:69206]
-
-	* test/ruby/test_autoload.rb: test for fix
-
-Sat May 16 21:41:24 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* string.c: added documentation for character sequence \' with String#sub
-	  [Bug #11132][ruby-core:69121][fix GH-900][ci skip] Patch by @shishir127
-
-Sat May 16 21:38:05 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* enum.c: fix a sample code. Patch by @eagletmt
-	  [fix GH-901][ci skip]
-
-Sat May 16 21:17:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* gc.c (rb_data_object_wrap, rb_data_typed_object_wrap): rename
-	  alloc as wrap.  these functions do not allocate data pointers
-	  but just wrap the given pointers.
-
-Sat May 16 19:59:24 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/win32.c (rb_w32_accept): simplified.
-
-Fri May 15 18:28:20 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* array.c (rb_ary_assoc, rb_ary_rassoc): [DOC] the result when key
-	  was found is the existing element, not a new array.  reported by
-	  Giau Nguyen <giaunv AT nustechnology.com>.
-
-Fri May 15 08:24:28 2015  Takeyuki FUJIOKA  <xibbar@ruby-lang.org>
-
-	* lib/cgi/cookie.rb: Implement HttpOnly flag for cookies.
-	  [fix GH-887] Patch by @martinpovolny
-
-Fri May 15 06:54:19 2015  Aaron Patterson <tenderlove@ruby-lang.org>
-
-	* variable.c: Change autoload to call `require` through Ruby rather
-	  than directly calling `rb_require_safe`.  This allows things like
-	  RubyGems to intercept file loading done though `autoload`.
-	  [Feature #11140]
-
-	* test/ruby/test_autoload.rb: Test for change.
-
-Wed Apr  8 19:18:02 2015  Shota Fukumori (sora_h)  <her@sorah.jp>
-
-	* enum.c (enum_grep_v, grep_i, grep_iter_i, Init_enum):
-	  Implement Enumerable#grep_v. [Feature #11049]
-
-Thu May 14 15:54:13 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* ext/pathname/lib/pathname.rb: Remove condition of RUBY_VERSION <= 1.9.
-	  [Feature #11082]
-
-Wed May 13 17:10:37 2015  Masaki Matsushita <glass.saga@gmail.com>
-
-	* enum.c (enum_to_a): revert r50457.
-	  it requires recursion check.
-	  then, it doesn't make performance improvement.
-	  [Bug #11130] [Feature #9118]
-
-Wed May 13 11:13:40 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (parse_gvar): separate message for gvar without
-	  non-space characters from message for invalid identifiers.
-
-Tue May 12 22:18:27 2015  Masaki Matsushita <glass.saga@gmail.com>
-
-	* enum.c (enum_to_a): fix incompatibility introduced in r50457.
-	  [Bug #11130]
-
-	* test/ruby/test_enum.rb: test for above.
-
-Tue May 12 17:08:03 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* method.h: remove unused declaration.
-
-Mon May 11 10:58:45 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* gems/bundled_gems: Update minitest-5.6.1 and power_assert-0.2.3.
-
-Mon May 11 00:20:31 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* include/ruby/ruby.h (Data_Make_Struct, TypedData_Make_Struct):
-	  allocate wrapper data object before allocating DATA_PTR to get
-	  rid of possible memory leak when the former failed.
-
-Sun May 10 21:32:45 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* gc.c (gc_mark_children): call dmark function for non-NULL
-	  pointers only, so that DATA_PTR can be NULL safely now.
-
-Sun May 10 16:23:58 2015  Kazuki Tsujimoto  <kazuki@callcc.net>
-
-	* proc.c (proc_binding): fix segmentation fault on marking phase.
-	  envptr of newenvval should not be NULL.
-
-	  You can reproduce by
-	   make test-all TESTS='--gc-stress -n test_to_proc_binding ruby/test_method.rb'
-
-Sun May 10 12:41:18 2015  Masaki Matsushita <glass.saga@gmail.com>
-
-	* ext/zlib/zlib.c (rb_gzreader_external_encoding):
-	  define GzipReader#external_encoding.
-	  [Bug #10900]
-
-	* test/zlib/test_zlib.rb: test for above.
-
-Sun May 10 11:57:48 2015  Masaki Matsushita <glass.saga@gmail.com>
-
-	* ext/win32ole/win32ole_variant.c: fix typo "indicies".
-	  the patch is from davydovanton <antondavydov.o at gmail.com>.
-	  [fix GH-892]
-
-	* lib/rubygems/indexer.rb: ditto.
-
-	* test/rubygems/test_gem_indexer.rb: ditto.
-
-Sun May 10 11:44:37 2015  Masaki Matsushita <glass.saga@gmail.com>
-
-	* string.c (rb_str_crypt): Raise ArgumentError when
-	  string passed to String#crypt contains null.
-	  the patch is from jrusnack <jrusnack at redhat.com>.
-	  [Bug #10988] [fix GH-853]
-
-	* test/ruby/test_string.rb: test for above.
-
-Sun May 10 11:23:03 2015  Masaki Matsushita <glass.saga@gmail.com>
-
-	* enum.c (enum_to_a): Use size to set array capa when possible.
-	  the patch is from HonoreDB <aweiner at mdsol.com>.
-	  [fix GH-444]
-
-Sat May  9 06:48:36 2015  Eric Wong  <e@80x24.org>
-
-	* ext/socket/ancdata.c (bsock_recvmsg_internal): GC guard
-	  [Bug #11123]
-
-Fri May  8 22:57:24 2015  takiy33  <takiy33@gmail.com>
-
-	* test/matrix/test_matrix.rb (test_determinant): refactor test on
-	  Matrix#determinant, by merging with test_det for an alias method
-	  det.  [Fix GH-897]
-
-Fri May  8 15:43:11 2015  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/net/imap.rb (body_ext_mpart): should work even if body-fld-dsp
-	  is omitted.  [ruby-core:69093] [Bug #11128]
-
-Fri May  8 15:05:57 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* doc/syntax/control_expressions.rdoc: fix a missing "a"
-	  [fix GH-888][ci skip] Patch by @riffraff
-
-Fri May  8 12:11:33 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* vm_eval.c (rb_method_call_status): resolve refined method entry
-	  to check if undefined.  [ruby-core:69064] [Bug #11117]
-
-Thu May  7 22:22:59 2015  Sho Hashimoto  <sho-h@ruby-lang.org>
-
-	* proc.c: [DOC] fix Binding#local_variable_set example. [ci skip]
-
-Thu May  7 11:32:57 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* Makefile.in (rbconfig.rb): add rule to make.
-
-Thu May  7 05:14:39 2015  Eric Wong  <e@80x24.org>
-
-	* ext/socket/lib/socket.rb (connect_nonblock): use IO#wait_writable
-	* lib/drb/drb.rb (DRB::DRbTCPSocket#alive?): use IO#wait_readable
-	* lib/webrick/httpserver.rb (run): ditto
-	* lib/resolv.rb (request): ditto for single socket case
-	  [ruby-core:68943] [Feature #11081]
-
-Wed May  6 22:49:54 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* vm_eval.c (rb_method_call_status): undefined refined method is
-	  not callable unless using.  [ruby-core:69064] [Bug #11117]
-
-Sun May  3 22:40:06 2015  Rei Odaira  <Rei.Odaira@gmail.com>
-
-	* ext/-test-/file/fs.c: need to include sys/statvfs.h
-	  to use statvfs().
-
-	* ext/-test-/file/extconf.rb: check the existence of
-	  sys/statvfs.h
-
-Sun May  3 21:59:48 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* lib/yaml.rb: fix typo. [ci skip][fix GH-890]
-	  Patch by @miketheman
-
-Sun May  3 10:02:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* range.c (linear_object_p, range_include): test if covered for
-	  linear objects.  [ruby-core:69052] [Bug #11113]
-
-Fri May  1 13:30:24 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dln.c (dln_load): check if a different libruby is loaded by the
-	  extension library, and then bail out to get rid of very
-	  frequently reported stale bug reports.
-
-Thu Apr 30 19:51:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* compile.c (iseq_compile_each): revert r46873 and r46875, not to
-	  allow to execute private readers by pretending op assign.
-	  [ruby-core:68984] [Bug #11096]
-
-Thu Apr 30 17:02:33 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* rational.c: Added documentation for rational literal.
-	  [Bug #11075][fix GH-885][ci skip] Patch by @shishir127
-
-Thu Apr 30 16:39:44 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/socket/ipsocket.c (init_inetsock_internal): preserve errno
-	  before other library calls and use rb_syserr_fail.
-	  [ruby-core:68531] [Bug #10975]
-
-Thu Apr 30 16:22:16 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (lambda): push and reset cmdarg_stack in lambda body.
-	  [ruby-core:69017] [Bug #11107]
-
-Sun Apr 26 07:36:48 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* enc/utf_8.c (code_to_mbclen, code_to_mbc): reject values larger
-	  than UTF-8 max codepoints.  [Feature #11094]
-
-Sat Apr 25 14:26:19 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* string.c (str_buf_cat): expand later so that the buffer can be
-	  larger for further use.  [Bug #11080] [Bug #11095]
-
-Fri Apr 24 23:48:45 2015  Akinori MUSHA  <knu@iDaemons.org>
-
-	* misc/ruby-electric.el: Import version 2.2.3 from
-	  https://github.com/knu/ruby-electric.el.
-
-Fri Apr 24 10:40:02 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/win32.c (rb_w32_{getc,putc}): removed.  they are needed for old
-	  ruby (before 1.8), but not now.
-
-Fri Apr 24 08:40:13 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* win32/win32.c: remove bcc related code.
-
-	* include/ruby/win32.h: ditto.
-
-Fri Apr 24 08:21:07 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* win32/win32.c (rb_acrt_lowio_lock_fh): wrap _pioinfo(i)->lock.
-
-	* win32/win32.c (rb_acrt_lowio_unlock_fh): ditto.
-
-Fri Apr 24 06:47:19 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* win32/win32.c (_filbuf): msvc14 doesn't have it, use _fgetc_nolock.
-
-	* win32/win32.c (_flsbuf): msvc14 doesn't have it, use _fputc_nolock.
-
-	* win32/win32.c (vcruntime_file): define vcruntime_file on msvc14
-	  because it doesn't export FILE's internal structure.
-
-	* win32/win32.c (FILE_COUNT): added to abstract FILE->_cnt.
-
-	* win32/win32.c (FILE_READPTR): added to abstract FILE->_ptr.
-
-	* win32/win32.c (FILE_FILENO): added to abstract FILE->_file.
-
-	* win32/win32.c (init_stdhandle): use FILE_FILENO.
-
-	* win32/win32.c (rb_w32_getc): use FILE_COUNT and FILE_READPTR.
-
-	* win32/win32.c (rb_w32_putc): ditto.
-
-Fri Apr 24 06:37:07 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* win32/win32.c (dupfd): use _set_osfhnd.
-
-	* win32/win32.c (rb_w32_wopen): use _set_osflags.
-
-Thu Apr 24 05:38:01 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (gc_mark_roots): fox to work PRINT_ROOT_TICKS.
-
-Fri Apr 24 04:49:05 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* win32/Makefile.sub: MSVC14 have struct timespec.
-
-	* win32/rtname.cmd: support vcruntime140.dll.
-
-	* time.c (localtime_with_gmtoff_zone): MSVC14 doesn't have tzname and
-	  daylight but have _tzname and _daylight.
-
-Thu Apr 23 11:35:55 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* vm_eval.c (rb_obj_instance_eval, rb_obj_instance_exec): allow
-	  symbols to just instance_eval/exec, except for definition of
-	  singletons.  [ruby-core:68961] [Bug #11086]
-
-Thu Apr 23 10:01:36 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* lib/delegate.rb: fix a typo.
-	  [fix GH-881][ci skip] Patch by @Zorbash
-
-Wed Apr 22 18:36:50 2015  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/net/imap.rb (move, uid_move): support the MOVE command defined
-	  in RFC6851.  Patch by ojab ojab.
-	  [ruby-core:68960] [Feature #11077]
-
-Tue Apr 22 12:42:12 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
-
-	* test/ruby/test_object.rb: add tests for Kernel#String and Kernel#Array.
-	  [fix GH-879][fix GH-880] Patch by @yui-knk
-
-Tue Apr 21 20:46:02 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* test/ruby/test_object.rb: renamed tests to explicitly class name.
-	  [fix GH-877] Patch by @yui-knk
-
-Tue Apr 21 05:31:00 2015  Eric Wong  <e@80x24.org>
-
-	* ext/socket/lib/socket.rb (connect_internal): avoid common exceptions
-	  from connect_nonblock. [ruby-core:68909]
-
-Mon Apr 20 23:46:53 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/win32.c (rb_w32_wreadlink): follow the official format of
-	  REPARSE_DATA_BUFFER structure.
-
-Mon Apr 20 20:23:04 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* common.mk ($(arch)-fake.rb): revert r50354 because bsdmake seems not
-	  to handle such substitution.
-
-	* tool/expand-config.rb: convert path separators here.
-
-Mon Apr 20 16:52:20 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* tool/fake.rb: don't fake libdir.  use libdirname instead.
-
-Mon Apr 20 16:49:52 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* lib/mkmf.rb (MakeMakefile#configuration): DESTDIR should never affect
-	  top_srcdir and builddir.
-
-Mon Apr 20 16:18:17 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* common.mk ($(arch)-fake.rb): fix the path separator up for Windows.
-
-Mon Apr 20 15:02:47 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/win32.c (rb_w32_wreadlink): fixed a bug that a junction misses
-	  its drive letter.
-
-Mon Apr 20 12:54:56 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* ext/openssl/*: use license instead of licence.
-	  [fix GH-876][ci skip] Patch by @davydovanton
-	* lib/net/https.rb: ditto.
-
-Mon Apr 20 12:42:40 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* benchmark/bm_so_meteor_contest.rb: fix a typo.
-	  [fix GH-876][ci skip] Patch by @davydovanton
-	* tool/bisect.sh: ditto.
-	* tool/update-deps: ditto.
-
-Mon Apr 20 11:10:46 2015  Eric Wong  <e@80x24.org>
-
-	* ext/socket/socket.c (sock_connect_nonblock): do not raise EISCONN
-	  [ruby-core:68926] [Feature #11072]
-	* test/socket/test_nonblock.rb: check non-EISCONN on 2nd connect
-
-Sun Apr 19 12:19:17 2015  Chad Brewbaker  <crb002@gmail.com>
-
-	* ext/{etc,openssl,tk}: Adding parens and comparisons around
-	  assignments to get rid of Wparentheses warnings.  [Fix GH-875]
-
-Sun Apr 19 10:42:54 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* hash.c (get_env_cstr): environment variables must be ASCII
-	  compatible, as dummy encodings and wide char encodings are
-	  unsupported now.
-
-Sat Apr 18 15:18:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/json/parser/parser.rl: raise with messages in UTF-8
-	  encoding.  [ruby-core:67386] [Bug #10705]
-
-Fri Apr 17 11:58:34 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* string.c (STR_SET_EMBED): clear NOFREE flag at embedding as
-	  embedded strings no longer refer static strings.
-	  [ruby-core:68436] [Bug #10942]
-
-Thu Apr 16 05:15:50 2015  Eric Wong  <e@80x24.org>
-
-	* NEWS: note IO#wait_readable change in r50263
-
-Thu Apr 16 05:09:36 2015  Eric Wong  <e@80x24.org>
-
-	* lib/net/protocol.rb (rbuf_fill): use IO#wait_*able
-	* lib/net/http/generic_request.rb (wait_for_continue): ditto
-	  [ruby-core:68891] [Feature #11056]
-
-Wed Apr 15 18:43:43 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_trace.c (rb_tracepoint_new): fix documentation.
-	  Commented by @emilsoman.
-
-Wed Apr 15 17:36:51 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_trace.c (rb_tracepoint_new): Add documentation for
-	  rb_tracepoint_new C level API [ci skip]
-	  Provided by @emilsoman. [fix GH-869]
-
-Wed Apr 15 10:37:40 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
-
-	* doc/contributors.rdoc: fix a typo. Patch by @davydovanton
-	  [fix GH-872][ci skip]
-	* doc/syntax/methods.rdoc: ditto.
-	* ext/digest/sha2/sha2.c: ditto.
-	* ext/socket/ipsocket.c: ditto.
-	* ext/tk/*: ditto.
-
-Wed Apr 15 07:51:23 2015  Yuki Yugui Sonoda  <yugui@yugui.jp>
-
-	* doc/extension.ja.rdoc: Added description of TypedData_XXX.
-	  Deprecated the old DATA_XXX.
-	  Reviewed by ko1 and nobu.
-	  Fixes [ruby-dev:40881] #3064
-
-	* doc/extension.rdoc: ditto.
-
-Wed Apr 15 07:34:49 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* thread_pthread.c (reserve_stack): keep sp safe zone to get rid
-	  of crash by -fstack-check.  [ruby-core:68740] [Bug #11030]
-
-Tue Apr 14 16:03:49 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* tool/merger.rb (versionup): should also increment revision when
-	  changing teeny.
-
-Tue Apr 14 11:24:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/-test-/printf/printf.c (uint_to_str): renamed to get rid of
-	  conflict on cygwin.  [ruby-core:68877] [Bug #11065]
-
-Tue Apr 14 08:59:04 2015  Zachary Scott  <e@zzak.io>
-
-	* gc.c: [DOC] Improve documentation for ObjectSpace.count_objects
-	  with regards to `:TOTAL` key, with patch by @schneems [Fixes GH-871]
-	  https://github.com/ruby/ruby/pull/871 [Bug #11067]
-
-Mon Apr 13 22:44:07 2015  Tanaka Akira  <akr@fsij.org>
-
-	* test/lib/envutil.rb (File.mkfifo): Defined using mkfifo command.
-
-	* test/ruby/test_io.rb: Use File.mkfifo.
-
-	* test/ruby/test_file_exhaustive.rb: Ditto.
-
-	* test/ruby/test_process.rb: Ditto.
-
-Mon Apr 13 21:20:20 2015  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
-
-	* ext/openssl/lib/openssl/ssl.rb: stricter hostname verification
-	  following RFC 6125. with the patch provided by Tony Arcieri and
-	  Hiroshi Nakamura [ruby-core:61545] [Bug #9644]
-	* test/openssl/test_ssl.rb: add tests for above.
-
-Sun Apr 12 18:40:04 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* ext/json/json.gemspec: bump version to 1.8.2.
-	* ext/json/lib/json/version.rb: ditto.
-
-Sun Apr 12 18:12:07 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* ext/json/json.gemspec, lib/rdoc/rdoc.gemspec: added gemspec directly.
-	* defs/default_gems, tool/rbinstall.rb: removed default_gems definition.
-	  it make simple installation for default gems.
-
-Sun Apr 12 17:35:17 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* ext/json/*, test/json/*: Reverted r50231.  Because it's not
-	  working with cross-compile environment.
-
-Sun Apr 12 15:34:59 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (arg): fix segfault by null caused by syntax error.
-	  [ruby-core:68851] [Bug #10957]
-
-Sun Apr 12 15:11:16 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* lib/rubygems/test_case.rb: use explicitly exception class and reverted
-	  to require JSON library for rubygems tests with Ruby 2.2.0 or earlier.
-
-Sun Apr 12 15:10:18 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/io/wait/wait.c (io_wait_readable): simply returns that IO is
-	  readable without blocking, but no longer returns EOF.
-
-	* ext/io/wait/wait.c (io_ready_p, io_wait_readable): try polling
-	  first and check FIONREAD optionally to see if EOF.
-	  [ruby-core:36805] [Feature #4849]
-
-Sun Apr 12 14:53:23 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* lib/rubygems/test_case.rb: fixed json load error for rubygems tests.
-
-Sun Apr 12 14:13:28 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* gc.c: Document require name for ObjectSpace methods.
-	  [ci skip][fix GH-860] Patch by @schneems
-
-Sun Apr 12 13:54:05 2015  Tanaka Akira  <akr@fsij.org>
-
-	* test/ruby/test_io.rb: New test that open(fifo) doesn't block other
-	  threads.
-
-Sun Apr 12 13:52:18 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* ext/coverage/coverage.c: Remove extension from require argument.
-	  [ci skip][fix GH-870] Patch by @yui-knk
-
-Sun Apr 12 10:29:14 2015  Eric Wong  <e@80x24.org>
-
-	* ext/openssl/ossl_ssl.c (ossl_ssl_connect_nonblock):
-	  support `exception: false'
-	* (get_no_exception): move function location
-	* ext/socket/socket.c (sock_connect_nonblock):
-	  support `exception: false'
-	* test/openssl/test_pair.rb (test_connect_accept_nonblock_no_exception):
-	  test `exception: false' on connect,
-	  rename from `test_accept_nonblock_no_exception'
-	* test/socket/test_nonblock.rb (test_connect_nonblock_no_exception):
-	  new test
-
-Sun Apr 12 09:57:16 2015  Tanaka Akira  <akr@fsij.org>
-
-	* test/ruby/test_file_exhaustive.rb: Test a block device on GNU/Linux.
-
-Sun Apr 12 09:24:03 2015  Tanaka Akira  <akr@fsij.org>
-
-	* test/ruby/test_file_exhaustive.rb: Test a file not owned.
-
-Sun Apr 12 09:05:44 2015  Tanaka Akira  <akr@fsij.org>
-
-	* ext/fiddle/depend: Fix "Wrong mix of special targets" error with
-	  OpenBSD make.
-
-Sun Apr 12 09:04:37 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* test/ruby/test_file_exhaustive.rb: Windows doesn't support Unix file
-	  modes.
-
-Sun Apr 12 08:56:44 2015  Tanaka Akira  <akr@fsij.org>
-
-	* ext/-test-/file/fs.c: OpenBSD needs sys/param.h before sys/mount.h.
-
-Sun Apr 12 08:52:01 2015  Tanaka Akira  <akr@fsij.org>
-
-	* test/ruby/test_file_exhaustive.rb: Test suid, sgid and sticky file.
-
-Sat Apr 11 23:48:30 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* template/fake.rb.in: Don't assign baseruby, Because it's affect to
-	  Makefile of native gem like json on bundled gems.
-
-Sat Apr 11 23:33:22 2015  Tanaka Akira  <akr@fsij.org>
-
-	* file.c (rb_f_test): Consider nsec for "=", "<" and ">" for "test"
-	  method.
-
-Sat Apr 11 23:26:05 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* tool/rbinstall.rb: support destdir for native extension gem.
-
-Sat Apr 11 21:02:06 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* test/ruby/test_file_exhaustive.rb
-	  (TestFileExhaustive#test_stat_socket_p): r50226 accidentally missed
-	  the guard for non-unix environments.
-
-Sat Apr 11 20:14:21 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* ext/json/*, test/json/*, defs/default_gems: Gemify JSON library.
-	  [fix GH-867][Feature #11057]
-	* test/ruby/test_extlibs.rb: removed json gem from existence extensions.
-	* gems/bundled_gems: added json gem into bundled gem.
-	* lib/rdoc/rubygems_hook.rb: ignored no json environment.
-	* lib/rubygems/test_case.rb, test/rubygems/*: ditto.
-	* lib/rdoc/test_case.rb, test/rdoc/*: ditto.
-
-Sat Apr 11 15:56:58 2015  Tanaka Akira  <akr@fsij.org>
-
-	* test/ruby/test_file_exhaustive.rb: Create sample files lazily.
-
-Sat Apr 11 14:03:47 2015  Tanaka Akira  <akr@fsij.org>
-
-	* test/ruby/test_file_exhaustive.rb: Test character device using
-	  /dev/null.
-
-Sat Apr 11 10:59:58 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/mkmf.rb (append_cppflags, append_cflags, append_ldflags):
-	  utility methods to append compiler options.
-
-Sat Apr 11 08:22:24 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* lib/rdoc/text.rb: removed duplicated code.
-
-Sat Apr 11 04:46:42 2015  Eric Wong  <e@80x24.org>
-
-	* lib/net/protocol.rb (rbuf_fill): avoid exception with read_nonblock
-	  [ruby-core:68787] [Feature #11044]
-
-Fri Apr 10 23:57:44 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (need_normalization): use getattrlist() if fgetattrlist()
-	  is unavailable, on OSX 10.5.  [ruby-core:68829] [Bug #11054]
-
-Fri Apr 10 22:29:21 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/mkmf.rb (try_compile): pass the given werror flag to try_do
-	  to check if stderr is empty.
-
-	* lib/mkmf.rb (try_cflags, try_ldflags): default werror to true.
-
-	* win32/Makefile.sub (WERRORFLAG): remove useless option.  VC does
-	  not make warnings of unknown command option an error.
-
-Fri Apr 10 19:34:24 2015  Tanaka Akira  <akr@fsij.org>
-
-	* test/ruby/test_file_exhaustive.rb: Test socket.
-
-Fri Apr 10 19:38:46 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* test/objspace/test_objspace.rb: remove debug prints.
-
-Fri Apr 10 19:35:51 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* ext/objspace/objspace.c: add ObjectSpace.count_imemo_objects method
-	  to count imemo objects for each type.
-
-	* test/objspace/test_objspace.rb: add a test.
-
-	* NEWS: describe about this addition.
-
-Fri Apr 10 19:34:24 2015  Tanaka Akira  <akr@fsij.org>
-
-	* test/ruby/test_file_exhaustive.rb: Test anonymous pipe.
-
-Fri Apr 10 19:31:56 2015  Tanaka Akira  <akr@fsij.org>
-
-	* test/ruby/test_file_exhaustive.rb: Test named pipe.
-
-Fri Apr 10 19:10:34 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* ext/objspace/objspace.c (setup_hash): unify common routine.
-
-Fri Apr 10 18:29:49 2015  Tanaka Akira  <akr@fsij.org>
-
-	* process.c (rb_execarg_parent_start1): Handle EINTR.
-
-Fri Apr 10 17:27:58 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm.c (vm_exec): check other events when RETURN is thrown.
-	  [Bug #10724]
-
-	* test/ruby/test_settracefunc.rb: add a test.
-
-Fri Apr 10 11:44:09 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/date/extconf.rb: check warnings.
-
-	* lib/mkmf.rb (try_cflags): pass options to try_compile.
-
-	* win32/Makefile.sub (WERRORFLAG): make unknown command line
-	  options an error.
-
-Fri Apr 10 08:00:17 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* test/ruby/test_process.rb: unfortunately, windows is not POSIX...
-	  cygwin has mkfifo command, but it does not affect system-wide.
-
-Fri Apr 10 02:18:53 2015  Tanaka Akira  <akr@fsij.org>
-
-	* test/ruby/test_process.rb: Use mkfifo command instead of mknod
-	  command to create a named pipe.  mkfifo command is defined by POSIX.
-
-Fri Apr 10 01:29:05 2015  Tanaka Akira  <akr@fsij.org>
-
-	* process.c: Release GVL when opening a file in spawn() to avoid whole
-	  process blocking when opening a named pipe.
-	  (open_func): New function.
-	  (rb_execarg_parent_start1): Extracted from rb_execarg_parent_start and
-	  use rb_thread_call_without_gvl2 to release GVL when opening a file.
-	  (rb_execarg_parent_start): Invoke rb_execarg_parent_start1 via
-	  rb_protect and invoke rb_execarg_parent_end when error.
-
-Thu Apr  9 22:19:19 2015  Tanaka Akira  <akr@fsij.org>
-
-	* process.c (redirect_open): Removed.
-
-Thu Apr  9 21:38:20 2015  Tanaka Akira  <akr@fsij.org>
-
-	* internal.h (rb_execarg_parent_end): Declared.
-
-	* process.c: "spawn" opens files in the parent process.
-	  (check_exec_redirect): Add an placeholder for fd in parameters
-	  for fd_open.
-	  (check_exec_fds_1): Delete fd_open condition.
-	  (check_exec_fds): Don't call check_exec_fds_1 with fd_open.
-	  (rb_execarg_parent_start): Open files specified as "spawn" options
-	  and add "dup2" options.
-	  (rb_execarg_parent_end): New function to close opened fds.
-	  (run_exec_open): Removed.
-	  (rb_execarg_run_options): Don't call run_exec_open.
-	  (rb_spawn_internal): Call rb_execarg_parent_end.
-
-	* io.c (pipe_open): Call rb_execarg_parent_end.
-
-	* ext/pty/pty.c (establishShell): Call rb_execarg_parent_end.
-
-Thu Apr  9 20:52:31 2015  Tanaka Akira  <akr@fsij.org>
-
-	* internal.h (rb_execarg_parent_start): Renamed from rb_execarg_fixup.
-
-	* process.c: Follows the above change.
-
-	* io.c: Ditto.
-
-	* ext/pty/pty.c: Ditto.
-
-Thu Apr  9 20:35:12 2015  Tanaka Akira  <akr@fsij.org>
-
-	* process.c (fd_clear_cloexec): Extracted from run_exec_dup2.
-
-Thu Apr  9 09:26:47 2015  Eric Wong  <e@80x24.org>
-
-	* ccan/list/list.h: sync with ccan upstream
-	  [ccan commit c2fbfe5282ba264f3485586e7efa8a5967f2d386]
-
-Thu Apr  9 08:24:03 2015  Masahiro Tomita  <tommy@tmtm.org>
-
-	* ext/socket/raddrinfo.c (addrinfo_mload): fix memory leak of
-	  addrinfo.  [ruby-dev:48923] [Bug #11051]
-
-Wed Apr  8 17:45:02 2015  Shannon Skipper  <shannonskipper@gmail.com>
-
-	* version.c (Init_version): the version of the engine or
-	  interpreter.  [Fix GH-858]
-
-Wed Apr  8 16:15:30 2015  Kenta Murata  <mrkn@cookpad.com>
-
-	* bigdecimal: conform to ruby's license.  [ruby-core:68466] [Bug #10952]
-
-Wed Apr  8 14:57:06 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* win32/win32.c (rb_w32_wreadlink): should treat junctions like as
-	  symlinks.
-
-Wed Apr  8 14:03:47 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* test/ruby/test_symbol.rb: fix syntax error.
-
-Wed Apr  8 13:01:06 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* hash.c (rb_any_hash): Symbols are compared by the identities
-	  always.  [ruby-core:68767] [Bug #11035]
-
-Tue Apr  7 10:22:51 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* internal.h: fix typo. Patch by @sferik [fix GH-865]
-
-Mon Apr  6 22:52:35 2015  Tanaka Akira  <akr@fsij.org>
-
-	* enum.c: Enumerable#chunk and Enumerable#slice_before no longer takes
-	  the initial_state argument.  [Feature #10958]
-
-Mon Apr  6 16:09:58 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_args.c: protect value stack from calling other methods
-	  during complex parameter setting process (splat, kw, and so on).
-	  [Bug #11027]
-
-	* vm_core.h: remove rb_thread_t::mark_stack_len.
-	  With this modification, we don't need to use th->mark_stack_len.
-
-	* test/ruby/test_keyword.rb: add a test.
-
-	* cont.c (cont_capture): catch up this fix.
-
-	* vm.c (rb_thread_mark): ditto.
-
-Mon Apr  6 11:26:42 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* tool/downloader.rb (http_options): prevent content auto decoding
-	  because this is a downloader.
-
-Sun Apr  5 09:55:18 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* doc/contributing.rdoc: update Maintainers list.
-
-Sun Apr  5 09:11:00 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* tool/rbinstall.rb: fix bin script permission of bundled gems.
-
-Sun Apr  5 08:46:08 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* tool/rbinstall.rb: support --program-suffix option.
-
-Sat Apr  4 21:31:18 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* lib/rake/*: Gemify rake [fix GH-862][Feature #11025]
-	* test/rake/*: ditto.
-	* tool/rbinstall.rb: ditto.
-
-Sat Apr  4 11:30:24 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* string.c (rb_str_setbyte): check the argument first not to
-	  discard shared string and code range unnecessarily until
-	  actually changing the contents.  pointed out by headius.
-
-Sat Apr  4 08:16:43 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* lib/net/http.rb (edit_path): use path which is absolute ftp url
-	  on using ftp_proxy.
-
-Fri Apr  3 11:43:17 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* vm_eval.c (vm_call0_cfunc): update invoker arguments.
-
-	* vm_insnhelper.c (vm_call_cfunc_latter): ditto.
-
-	* vm_insnhelper.c (rb_vm_call_cfunc_push_frame): ditto, and prefix
-	  with rb_.
-
-Thu Apr  2 16:26:59 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* common.mk, tool/mkconfig.rb: check the running ruby version in
-	  rbconfig.rb with the program version, as RUBY_VERSION has never
-	  been affected by --with-ruby-version option.
-	  [ruby-core:68639] [Bug #11002]
-
-	* configure.in (LIBRUBY_DLDFLAGS): compatibility_version must be
-	  valid version numbers, not an arbitrary string.
-
-Wed Apr  1 11:09:15 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (push_glob): remove indirect links of arguments for
-	  trampoline.
-
-Wed Apr  1 09:59:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/fileutils.rb (FileUtils#mv): show the exact target path in
-	  the error message instead of the destination parent directory
-	  name.  patched by Joao Britto <jabcalves AT gmail.com> at
-	  [ruby-core:68706].  [Bug #11021]
-
-Tue Mar 31 15:25:07 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* doc/ChangeLog-0.06_to_0.52: added archived Changelog.
-	  [ruby-list:50105]
-	* doc/ChangeLog-0.50_to_0.60: ditto.
-	* doc/ChangeLog-0.60_to_1.1: ditto.
-
-Mon Mar 30 22:02:55 2015  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
-
-	* README.EXT.ja: add redirect [ruby-core:68631]
-
-Mon Mar 30 14:42:41 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* win32/win32.c (fileattr_to_unixmode, winnt_lstat): deal with
-	  symbolic link than directory, and set executable bits.
-
-Mon Mar 30 11:27:54 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* io.c (copy_stream_body): use the arguments without conversion if
-	  having read, readpartial, and write methods, than conversion by
-	  to_path method.  [ruby-core:68676] [Bug #11015]
-
-Sun Mar 29 21:08:37 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* gc.c (objspace_allrefs_destruct_i): fix a typo.
-	  [Bug #11013]
-
-Sun Mar 29 11:51:32 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* proc.c (proc_binding): replicate env from method object, and
-	  allocate the local variable area for the iseq local table.
-	  [ruby-core:68673] [Bug #11012]
-
-Sat Mar 28 09:19:41 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* ext/date/extconf.rb: try_cflags("-std=iso9899:1999") [Bug #10906]
-	  ruby itself (including numeric.c) is built with strict compile
-	  options including -std=iso9899:1999, but ext/date is not.
-	  By the way -std=iso9899:1999 is not only a warning option but also
-	  changes behavior like MACRO definitions for example INFINITY.
-	  gcc on Solaris affect this.
-
-Fri Mar 27 16:34:16 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* common.mk: revert using BOOTSTRAPRUBY for enc.mk, as
-	  enc/depend uses CONFIG.  [ruby-core:68647] [Bug #11004]
-
-Thu Mar 26 10:05:13 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* test/test_observer.rb: add tests for Observable module.
-	  [fix GH-859] Patch by @brightbits
-
-Thu Mar 26 06:35:10 2015  Eric Wong  <e@80x24.org>
-
-	* README.EXT: add redirect [ruby-core:68631]
-
-Wed Mar 25 16:46:49 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* ext/socket/extconf.rb: Solaris 11 has struct tcp_info.tcpi_ca_state,
-	  but it is a dummy.
-
-	* ext/socket/option.c: Solaris 11 doesn't have u_intN_t.
-
-	* ext/socket/option.c: Solaris 11 needs inspect_tcpi_msec.
-
-	* ext/socket/raddrinfo.c: Solaris 11 has AF_PACKET but doesn't have
-	  related macros.
-
-Wed Mar 25 17:03:08 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/-test-/file/fs.c (get_fsname): try magic number only if
-	  f_type is included.  [ruby-dev:48913] [Bug #11000]
-
-Wed Mar 25 11:20:40 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* benchmark/bm_hash_aref_flo.rb: make more realistic data.
-	  [ruby-core:68632] [[Bug #10999]
-
-Wed Mar 25 10:39:06 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* .document: removed needless entries.
-
-Wed Mar 25 08:07:28 2015  Eric Wong  <e@80x24.org>
-
-	* doc/extension.rdoc: fix spelling of filename
-	* doc/extension.ja.rdoc: ditto.
-
-Tue Mar 25 06:55:43 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
-
-	* complex.c (k_inexact_p, k_exact_zero_p): use k_exact_zero_p macro
-	  to remove k_inexact_p macro.
-
-	* complex.c (k_exact_one_p): remove unused macro k_exact_one_p.
-
-Tue Mar 24 22:23:33 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* doc/extention.rdoc: move from toplevel document and added extname.
-	* doc/extention.ja.rdoc: ditto.
-
-Tue Mar 24 22:06:58 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* doc/standard_library.rdoc: strip.
-
-Tue Mar 24 22:06:27 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* doc/standard_library.rdoc: move Thread to Extensions.
-
-Tue Mar 24 21:59:10 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* doc/contributing.rdoc: update Maintainers list.
-
-Tue Mar 24 19:10:24 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (gc_writebarrier_generational): fix messages for rb_bug().
-	  Remove `rb_' prefix.
-
-	* gc.c (gc_writebarrier_incremental): ditto.
-
-Tue Mar 24 17:34:01 2015  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* README.ja.md: should be chunibyo.
-
-Tue Mar 24 17:30:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/-test-/file/fs.c (get_fsname): return filesystem name by
-	  statfs/statvfs.  [ruby-core:68624] [Bug #10998]
-
-Tue Mar 24 16:46:02 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* tool/redmine-backporter.rb: now doesn't required spaces just after
-	  `!`.
-
-Mon Mar 23 23:18:27 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (dir_close): don't raise on double close for consistent to
-	  IO#close.  [Feature #10950]
-
-Mon Mar 23 21:22:07 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* win32/file.c (rb_readlink): move from file.c for better buffer
-	  allocation and the result encoding.
-
-	* win32/win32.c (wreadlink, rb_w32_ureadlink): implement readlink().
-
-Mon Mar 23 14:40:45 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* win32/win32.c (winnt_stat): stat with following symbolic links.
-
-	* win32/win32.c (winnt_lstat): rename old winnt_stat, which does
-	  not follow symbolic links.
-
-Mon Mar 23 01:44:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* marshal.c (r_symreal): register symbol names as strings first so
-	  that r_symlink always returns valid names.
-	  [ruby-core:68587] [Bug #10991]
-
-	* marshal.c (r_ivar, r_object0): now need to intern symbol names.
-
-	* marshal.c (r_object0): compare with symbol names.
-
-Sun Mar 22 22:07:40 2015  Kouhei Sutou  <kou@cozmixng.org>
-
-	* doc/etc.rd.ja: Fix wrong coding for Emacs.
-
-Sun Mar 22 09:53:15 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* tool/make-snapshot (package): add default CONFIGURE name to
-	  follow r50039.
-
-	* tool/make-snapshot (package): substitute configuration variables
-	  in Makefile.in instead of passing by the command line, and make
-	  temporary Makefile instead of a pipe.
-
-Sun Mar 22 08:09:47 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* common.mk (ext/ripper/ripper.c, ext/rbconfig/sizeof/sizes.c):
-	  strip autogenerated dependencies which have invalid syntax in
-	  other than nmake.
-
-Sat Mar 21 15:01:26 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/io/console/console.c (console_set_winsize): use handle for
-	  writing.  GetConsoleScreenBufferInfo seems failing on a handle
-	  for reading.
-
-	* io.c: [DOC] update the example of IO#winsize to use $stdout
-	  instead of $stdin, which does not work on Windows.  a patch by
-	  Jan Lelis <mail AT janlelis.de> at [ruby-core:68574].
-	  [Bug #10986]
-
-Fri Mar 20 18:41:03 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* proc.c (respond_to_missing_p): check if the receiver responds to
-	  the given method by respond_to_missing?.
-
-	* proc.c (mnew_missing): create Method object for method_missing.
-	  [ruby-core:68564] [Bug #10985]
-
-Fri Mar 20 17:43:18 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* .travis.yml: enabled email notification.
-
-Fri Mar 20 17:39:52 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* .travis.yml: removed Ruby 1.9.3 build on Travis CI
-
-Fri Mar 20 12:38:36 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (obj_info): obj_info() can receive internal objects.
-
-	* gc.c (check_rvalue_consistency): obj_info() returns const char *.
-
-Fri Mar 20 12:14:37 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (obj_info): show class name and T_DATA type_name.
-
-Thu Mar 19 22:12:46 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (rb_copy_wb_protected_attribute): `dest' can be WB unprotected.
-
-Thu Mar 19 21:25:25 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (rb_copy_wb_protected_attribute): demote `dest' object.
-
-Thu Mar 19 16:18:00 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c, internal.h: export rb_gc_verify_internal_consistency().
-
-Thu Mar 19 16:15:24 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (obj_info): show allocation site if GC_DEBUG is not 0.
-
-Thu Mar 19 16:12:01 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (newobj_of): fix RGENGC_OLD_NEWOBJ_CHECK logics.
-	  * skip on incremental marking because not sure what happen :p
-	  * rb_gc_writebarrier_remember() is enough to mark children.
-
-Thu Mar 19 16:08:42 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (rb_copy_wb_protected_attribute): need demote for old objects.
-
-Thu Mar 19 10:31:00 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* random.c (fill_random_bytes): release the handle in the static
-	  variable, not a local variable.
-
-Thu Mar 19 06:30:35 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* object.c (rb_obj_clone): do not touch age (FL_PROMOTED[01]) because
-	  rb_obj_alloc() can return old object in debug.
-
-Thu Mar 19 06:29:28 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* test/objspace/test_objspace.rb: flag name was changed
-	  (long_lived -> uncollectible).
-
-Thu Mar 19 05:30:13 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* iseq.c (iseq_mark): skip some marking if iseq->orig is available.
-
-	* iseq.c (rb_iseq_clone): need WB for iseq1->klass = iseq0->klass
-	  (done in MEMCPY).
-
-Thu Mar 19 04:55:53 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* internal.h (IMEMO_DEBUG): added.
-
-	* internal.h: remove unused FL_IMEMO_MARK_V[0-3].
-
-	* gc.c (rb_imemo_new_debug): added.
-
-	* gc.c (obj_info): show imemo type name.
-
-Thu Mar 19 04:52:26 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (RGENGC_OLD_NEWOBJ_CHECK): add check mechanism.
-
-	  If RGENGC_OLD_NEWOBJ_CHECK > 0, then create old objects
-	  (not new objects) periodically.
-
-	  Create one old objects per RGENGC_OLD_NEWOBJ_CHECK objects are
-	  created.
-
-Thu Mar 19 04:46:36 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* enum.c (enum_sort_by): add WBs.
-
-Thu Mar 19 03:37:52 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (check_rvalue_consistency): refactoring.
-	  * not inline on RGENGC_CHECK_MODE > 0.
-	  * check SPECIAL_CONST_P(obj) first.
-	  * add a check that remembered_bit is only TRUE when old (age == 3).
-
-	* gc.c (RVALUE_DEMOTE): should clear RVALUE_REMEMBERED bit.
-
-	  remembered_bit should be TRUE only for old (age == 3) objects.
-
-	  Actually there are no effect because demoted objects will be
-	  uncollectible WB unprotected objects (marked at the beginning of
-	  every minor GC).
-
-Thu Mar 19 02:52:48 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c: rename terminologies.
-	  * long_lived -> uncollectible:
-	    because this bitmap does not mean "long lived objects in past",
-	    but means "prohibit collection these objects until next major GC".
-
-	    Uncollectible objects consist of two types objects, one is old
-	    objects (WB protected objects which age == 3) and another is
-	    uncollectible WB unprotected objects which are referred from old
-	    objects
-
-	  * remembered_wb_unprotected_objects ->
-	    uncollectible_wb_unprotected_objects:
-	    because uncollectible objects does not mean remembered objects.
-
-Wed Mar 18 17:21:12 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (gc_writebarrier_generational): add an alternative write
-	  barrier (WB) implementation.
-	  When finding reference from [Old obj] to [New obj] by WB, current
-	  implementation marks [Old obj] as remembered old objects and marks
-	  children of [Old obj] at the beginning of marking.
-
-	  Added (but disabled) code changes current behaviour. This fix promote
-	  [New obj] to old and marks as a remembered old object. We can assume
-	  "new objects referred from old objects are maybe long-lived old
-	  objects".
-
-	  Disadvantage of added algorithm is we may promote unwilling
-	  short-lived objects. For example, consider many new objects push and
-	  pop to an old stack object. All of new objects (short-lived objects)
-	  promote to old objects unexpectedly.
-
-	  To compare these behaviour, I add this new code (but disabled it).
-
-Wed Mar 18 17:14:39 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (RVALUE_PROMOTE_RAW): rename to RVALUE_OLD_LONG_LIVED_SET()
-	  to make clear.
-
-Wed Mar 18 17:10:01 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (check_rvalue_consistency): do not need to check is_sweeping().
-
-Wed Mar 18 14:13:22 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* benchmark/bm_vm1_gc_wb_ary.rb: run GC to finish "marking" phase.
-
-	* benchmark/bm_vm1_gc_wb_obj.rb: ditto.
-
-	* benchmark/bm_vm1_gc_wb_ary_promoted.rb: add parameter
-	  full_mark: false to invoke only minor GC.
-
-	* benchmark/bm_vm1_gc_wb_obj_promoted.rb: ditto.
-
-Wed Mar 18 12:07:36 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* string.c: add a comment about RSTRING_FSTR.
-
-Wed Mar 18 12:01:53 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* hash.c (rb_any_hash): use same hash values with Float#hash so
-	  that -0.0 and +0.0 will be identical.
-	  [ruby-core:68541] [Bug #10979]
-
-Wed Mar 18 05:34:32 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* string.c: introduce STR_FAKESTR to show string is FAKESTR or not.
-
-	* string.c (STR_SET_SHARED): ignore FAKESTR because only Ruby objects
-	  can use write barrier.
-
-Tue Mar 17 18:59:16 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* include/ruby/ruby.h: use rb_gc_writebrrier() simply.
-	  For incremental GC, we need to get a pointer to the objspace.
-	  We can share this pointer for the following WB process.
-	  And considering icache hit ratio, process in the GC.
-
-	* gc.c (rb_gc_writebarrier): added.
-
-	* gc.c (gc_writebarrier_generational, gc_writebarrier_incremental):
-	  make them NOINLINE because inlining them into rb_gc_writebarrier()
-	  makes a prologue code of rb_gc_writebarrier() longer (storing callee
-	  save registers).
-
-	  This patch improve the performance of WB on micro-benchmarks.
-
-	  name                   ruby 2.1   trunk   modified
-	  vm1_gc_wb_ary*            0.511   0.632      0.532
-	  vm1_gc_wb_ary_promoted*   0.578   0.701      0.674
-	  vm1_gc_wb_obj*            0.419   0.575      0.492
-	  vm1_gc_wb_obj_promoted*   0.537   0.664      0.618
-	                                                 (sec)
-
-Tue Mar 17 18:51:43 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* benchmark/bm_vm1_gc_wb_ary(_promoted).rb: separate fastpath and
-	  slowpath for WB.
-
-	  Before this change bm_vm1_gc_wb_ary.rb tried to check the performance
-	  for WB slowpath (making a reference from oldobj to newobj). However,
-	  from Ruby 2.2, 3 GCs are needed to promote new objects because
-	  only 3 age objects are promoted objects.
-
-	  To compare fastpath and slowpath, introduce new "promoted" version
-	  benchmark.
-
-	  bm_vm1_gc_wb_ary.rb is for fastpath and
-	  bm_vm1_gc_wb_ary_promoted.rb is for slowpath.
-
-	* benchmark/bm_vm1_gc_wb_obj(_promoted).rb: ditto.
-
-Tue Mar 17 17:23:11 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (glob_helper): distinguish not-yet-stated and DT_UNKNOWN
-	  by readdir, and traverse recursively for the former.  Linux
-	  readdir returns DT_UNKNOWN on some filesystems, e.g., smbfs,
-	  iso9660.
-
-Mon Mar 16 17:43:21 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* lib/webrick/server.rb: Fix regression bug in WEBrick's
-	  :DoNotReverseLookup config option implementation.
-	  [fix GH-731] Patch by @vais
-	* test/webrick/test_do_not_reverse_lookup.rb: ditto.
-
-Sat Mar 14 20:05:23 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
-
-	* math.c (math_gamma): optimization for passed small integer.
-
-Sat Mar 14 18:07:23 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
-
-	* enum.c: [DOC] Fixes Enumerable#member? documentation
-	  [fix GH-756][ci skip] Patch by @shamanime
-
-Sat Mar 14 12:23:53 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (glob_helper): use d_type to reduce lstat system calls.
-
-	* win32/dir.h (struct direct): add d_type instead of d_isdir and
-	  d_isrep.  SYMLINKD is unreliable, since the target can be
-	  replaced after a link was created.
-
-	* win32/win32.c (readdir_internal): set d_type.
-
-Sat Mar 14 02:14:50 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* parse.y (primary): empty parentheses at cmdarg can be null.
-	  [ruby-core:68477] [Bug #10957]
-
-Fri Mar 13 15:04:36 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/stringio/stringio.c (strio_close): don't raise on double
-	  close for consistent to IO#close.
-
-Fri Mar 13 15:03:20 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* io.c (rb_io_close_read, rb_io_close_write): don't raise after
-	  close same as IO#close.
-
-Fri Mar 13 12:29:07 2015  Tanaka Akira  <akr@fsij.org>
-
-	* test/readline/test_readline.rb: Restore environment variables:
-	  COLUMNS LINES
-
-Fri Mar 13 11:37:46 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/fiddle/extconf.rb: needs --enable-shared when linked to
-	  libruby or fiddle.so.  since --with-static-linked-ext does no
-	  longer link extensions to ruby program with --enable-shared, the
-	  only combination needs --enable-static is --disable-shared and
-	  --with-static-linked-ext.  [ruby-dev:48901] [Bug #10960]
-
-Fri Mar 13 07:02:20 2015  Eric Wong  <e@80x24.org>
-
-	* ext/socket/init.c (rsock_s_accept_nonblock): use rb_hash_lookup2
-	* ext/openssl/ossl_ssl.c (get_no_exception): new function
-	  (ossl_ssl_accept_nonblock): use get_no_exception
-	  (ossl_ssl_read_internal): ditto
-	  (ossl_ssl_write_nonblock): ditto
-	  [ruby-core:68511]
-
-Fri Mar 13 07:01:38 2015  Eric Wong  <e@80x24.org>
-
-	* ext/openssl/ossl_ssl.c: predefine wait_*able symbols
-
-Thu Mar 12 22:59:53 2015  Tanaka Akira  <akr@fsij.org>
-
-	* test/lib/leakchecker.rb: Check environment variables.
-
-Thu Mar 12 05:54:27 2015  Eric Wong  <e@80x24.org>
-
-	* ext/socket/init.c (rsock_s_accept_nonblock):
-	  support exception: false
-	  [ruby-core:66385] [Feature #10532]
-	* ext/socket/init.c (rsock_init_socket_init): define new symbols
-	* ext/socket/rubysocket.h: adjust prototype
-	* ext/socket/socket.c (sock_accept_nonblock): support exception: false
-	* ext/openssl/ossl_ssl.c (ossl_ssl_accept_nonblock): ditto
-	* ext/socket/socket.c (Init_socket): adjust accept_nonblock definition
-	* ext/openssl/ossl_ssl.c (Init_ossl_ssl): ditto
-	* ext/socket/tcpserver.c (rsock_init_tcpserver): ditto
-	* ext/socket/unixserver.c (rsock_init_unixserver): ditto
-	* ext/socket/tcpserver.c (tcp_accept_nonblock): adjust
-	  rsock_s_accept_nonblock call
-	* ext/socket/unixserver.c (unix_accept_nonblock): ditto
-	* ext/openssl/ossl_ssl.c (ossl_start_ssl): support no_exception
-	* ext/openssl/ossl_ssl.c (ossl_ssl_connect): adjust ossl_start_ssl call
-	* ext/openssl/ossl_ssl.c (ossl_ssl_connect_nonblock): ditto
-	* ext/openssl/ossl_ssl.c (ossl_ssl_accept): ditto
-	* test/socket/test_nonblock.rb (test_accept_nonblock): test for
-	  "exception :false"
-	* test/socket/test_tcp.rb (test_accept_nonblock): new test
-	* test/socket/test_unix.rb (test_accept_nonblock): ditto
-	* test/openssl/test_pair.rb (test_accept_nonblock_no_exception): ditto
-
-Thu Mar 12 10:53:06 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* internal.h, node.h: move a definition of `struct rb_global_entry'
-	  and related functions from node.h to internal.h.
-
-	* variable.c: remove unused include pragma.
-
-	* common.mk: remove unused dependency.
-
-Thu Mar 12 10:32:39 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* common.mk: remove unused dependency.
-
-Thu Mar 12 08:20:14 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* load.c: removed unused header file "node.h".
-
-	* method.h: ditto.
-
-	* symbol.c: ditto.
-
-Thu Mar 12 08:14:48 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c: RGENGC_CHECK_MODE should be 0.
-
-Thu Mar 12 07:44:17 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* internal.h: use T_IMEMO to represent `struct MEMO' value.
-	  memo->v1 and memo->v2 is WB protected values.
-	  So use MEMO_V1/V2_SET() macros to set these values.
-	  memo->u3 is ambiguous (sometimes a VALUE, sometimes an integer
-	  value), so use gc_mark_maybe() in gc.c to mark it.
-
-	  Rename NEW_MEMO() to MEMO_NEW().
-
-	  Move MEMO_FOR and NEW_MEMO_FOR macros from node.h.
-
-	  Export a rb_imemo_new() function for ext/ripper.
-
-	* node.h: remove NODE_MEMO.
-
-	* enum.c: catch up these change.
-
-	* enumerator.c: ditto.
-
-	* load.c: ditto.
-
-	* ext/objspace/objspace.c (count_nodes): ditto.
-
-	* gc.c (gc_mark_children): mark imemo_memo type.
-
-	* parse.y (new_args_gen): use T_IMEMO.
-	  (I'm not sure it is working correctly...)
-
-Wed Mar 11 22:36:34 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* eval.c (frame_called_id): it should use vm_ifunc type.
-
-	* eval.c (frame_func_id): ditto.
-
-Wed Mar 11 22:27:05 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* node.h: remove NODE_IFUNC, NEW_IFUNC.
-
-	* internal.h: use T_IMEMO for IFUNC.
-
-	  rename `struct IFUNC' to `struct vm_ifunc' and move the definition
-	  from vm_insnhelper.h. Add imemo_ifunc.
-
-	* gc.c (gc_mark_children): mark imemo_ifunc type T_IMEMO object.
-
-	* compile.c: catch up these changes.
-
-	* proc.c: ditto.
-
-	* vm_core.h (RUBY_VM_IFUNC_P): ditto.
-
-	* vm_eval.c (rb_iterate): ditto.
-
-	* vm_insnhelper.c: ditto.
-
-	* ext/objspace/objspace.c: ditto.
-
-Wed Mar 11 21:53:43 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* internal.h, eval_intern.h: move CREF accessors.
-
-	  List IMEMO supported types in internal.h.
-
-Wed Mar 11 21:45:36 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_insnhelper.h: use T_IMEMO to create THROW_DATA.
-
-	  Add THROW_DATA_NEW().
-
-	* internal.h: move definition of `struct THROW_DATA'
-	  from vm_insnhelper.h to internal.h.
-
-	  Rename `THROW_DATA' to `vm_throw_data'.
-
-	* eval_intern.h (THROW_DATA_P): move to internal.h.
-	  THROW_DATA is no longer T_NODE, so check T_IMEMO.
-
-	* gc.c (gc_mark_children): mark THROW_DATA.
-
-	* vm.c: catch up these changes.
-
-	* vm_eval.c: ditto.
-
-	* vm_insnhelper.c: ditto.
-
-Wed Mar 11 21:21:56 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_insnhelper.c: use T_IMEMO to create SVAR.
-
-	* internal.h, vm_insnhelper.h: move definition `struct SVAR'
-	  from vm_insnhelper.h to internal.h. And rename it to struct vm_svar.
-
-	  new imemo_type imemo_svar is added.
-
-	* gc.c (gc_mark_children): mark imemo_svar.
-
-	* node.c (rb_gc_mark_node): remove useless marking.
-
-Wed Mar 11 19:35:46 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* include/ruby/ruby.h: introduce new type T_IMEMO.
-	  T_IMEMO is Internal Memo type, internal use only.
-	  T_IMEMO has same purpose of NODE_MEMO.
-
-	  To insert T_IMEMO, type numbers are modified a little.
-
-	* internal.h: define struct RIMemo. Each RIMemo objects
-	  has imemo_type. We can observe it by the imemo_type() function.
-
-	* gc.c (rb_imemo_new): added.
-
-	* node.h: remove NODE_CREF and NEW_CREF().
-
-	* node.c (rb_gc_mark_node): ditto.
-
-	* vm.c (vm_cref_new): use rb_imem_new().
-
-	* vm_eval.c: ditto.
-
-	* vm_insnhelper.c: use RIMemo objects for CREF.
-
-	* ext/objspace/objspace.c: support T_IMEMO.
-
-Wed Mar 11 17:03:20 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c: fix memory leak by prepend method.
-
-	  It is easy to reproduce with such script:
-
-	    module M; def bar; end; end
-	    loop{
-	      Class.new do
-	        def foo; end
-	        prepend M
-	      end
-	    }
-
-	* gc.c (obj_free): free T_ICLASS::m_tbl if it is created by prepend.
-	  To recognize it, check RICLASS_IS_ORIGIN flag.
-
-	* gc.c (gc_mark_children): T_ICLASS objects only need to mark
-	  T_ICLASS::m_tbl if RICLASS_IS_ORIGIN is set.
-
-	* gc.c (obj_memsize_of): count T_ICLASS if RICLASS_IS_ORIGIN is set.
-
-	* internal.h (RCLASS_SET_ORIGIN): add to set RCLASS_SET_ORIGIN.
-
-	  TODO: The word `origin' seems not good name. We need to invent
-	  another good name.
-
-	* class.c: use RCLASS_SET_ORIGIN().
-
-	* class.c (class_alloc): zero clear rb_classext_t.
-
-Wed Mar 11 13:28:49 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in: check also procstat_getvmmap, which is not
-	  available on FreeBSD 9.  [ruby-core:68468] [Bug #10954]
-
-	* vm_dump.c (procstat_vm): use kinfo_getvmmap instead if
-	  procstat_getvmmap is not available.
-
-Wed Mar 11 09:15:21 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* internal.h: define struct MEMO.
-
-	* enum.c: use MEMO.
-
-	* enumerator.c: ditto.
-
-	* load.c: ditto.
-
-	* node.h: return (struct MEMO *) pointer.
-
-Wed Mar 11 06:26:21 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_insnhelper.h (THROW_DATA_STATE): return int, not VALUE.
-
-	* vm_insnhelper.h (THROW_DATA_STATE_SET): accept int value.
-
-Wed Mar 11 05:06:46 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_eval.c (rb_catch_protect): use THROW_DATA_VAL().
-
-Wed Mar 11 04:56:04 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_insnhelper.h: define struct IFUNC.
-
-	* vm_eval.c (rb_iterate): use it.
-
-	* vm_insnhelper.c (vm_yield_with_cfunc): ditto.
-
-Wed Mar 11 03:52:12 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* eval_intern.h (THROW_DATA_P): use RB_TYPE_P() instead of
-	  BUILTIN_TYPE().
-
-	* thread.c (thread_join): use THROW_DATA_P().
-
-Wed Mar 11 03:48:01 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* proc.c: use RUBY_VM_IFUNC_P() to recognize IFUNC or not.
-
-	* vm.c: ditto.
-
-	* vm_dump.c: ditto.
-
-	* vm_insnhelper.c: ditto.
-
-	* vm_core.h (RUBY_VM_IFUNC_P): use RB_TYPE_P() instead of
-	  BUILTIN_TYPE().
-
-Wed Mar 11 03:21:37 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_insnhelper.h: define struct THROW_DATA to represent
-	  throwing data. Also define accessor functions.
-
-	* eval_intern.h: move related changes into vm_insnhelper.h.
-	  Now these MACROs (functions) are only used in vm*.c.
-
-	  There is only THROW_DATA_P(err) to check this data type or not.
-
-	* vm.c: catch up these changes.
-
-	* vm_eval.c: ditto.
-
-	* vm_insnhelper.c: ditto.
-
-Wed Mar 11 00:57:00 2015  Rei Odaira  <Rei.Odaira@gmail.com>
-
-	* test/rubygems/test_gem_security_trust_dir.rb: The return value of
-	  File::Stat#mode is OS dependent. In AIX, 0200000 is set.
-
-Tue Mar 10 20:03:41 2015  Tanaka Akira  <akr@fsij.org>
-
-	* lib/webrick/server.rb: Invoke setup_shutdown_pipe in start method
-	  instead of listen method.
-	  [ruby-core:68476] [Bug #10956] Reported by Shintaro Kojima.
-
-Tue Mar 10 17:27:27 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* thread.c (thread_join): Fixnum (except TAG_FATAL) and
-	  NODE should not be reached here.
-
-Mon Mar  9 21:42:10 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_insnhelper.c (ep_cref): rename to lep_cref() because it should be
-	  local ep.
-
-Mon Mar  9 16:34:36 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/stringio/stringio.c (strio_close): don't raise on double
-	  close for consistent to IO#close.
-
-Mon Mar 09 06:44:48 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_insnhelper.h: define struct SVAR for SVAR.
-	  This data type is also same layout of NODE (NODE_IF).
-
-	* vm_insnhelper.c: catch up this change.
-
-Mon Mar  9 06:43:21 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_insnhelper.c (lep_svar_set): add WBs.
-
-Mon Mar  9 06:19:06 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* internal.h: define rb_cref_t and change to use it.
-
-	  rb_cref_t is data type of CREF. Now, the body is still NODE.
-	  It is easy to understand what is CREF and what is pure NODE.
-
-Mon Mar  9 06:00:37 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_insnhelper.h (COPY_CREF_OMOD): fix translation miss.
-
-Mon Mar  9 04:47:58 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* internal.h: define CREF accessor macros.
-	  * CREF_CLASS(cref)
-	  * CREF_NEXT(cref)
-	  * CREF_VISI(cref)
-	  * CREF_VISI_SET(cref, v)
-	  * CREF_REFINEMENTS(cref)
-	  * CREF_PUSHED_BY_EVAL(cref)
-	  * CREF_PUSHED_BY_EVAL_SET(cref)
-	  * CREF_OMOD_SHARED(cref)
-	  * CREF_OMOD_SHARED_SET(cref)
-	  * CREF_OMOD_SHARED_UNSET(cref)
-
-	  This is process to change CREF data type from NODE.
-
-Sun Mar  8 22:50:57 2015  Tanaka Akira  <akr@fsij.org>
-
-	* ext/zlib/zlib.c (rb_gzfile_close): Don't raise on double
-	  close for consistent to IO#close.
-
-Sun Mar  8 16:57:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (glob_helper): match patterns against legacy short names
-	  too, not only ordinary names.  [ruby-core:67954] [Bug #10819]
-
-	* win32/dir.h (struct direct): add short name members.
-
-	* win32/win32.c (opendir_internal, readdir_internal): ditto.
-
-Sat Mar  7 09:36:05 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* array.c: document that first element is kept when using
-	  Array#uniq and #uniq! [fix GH-845][ci skip]
-	  Patch by @riffraff
-
-Sat Mar  7 09:28:02 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* thread.c: Mutex#owned? is no longer experimental since 2.1.0
-	  [fix GH-839][ci skip] Patch by @takiy33
-
-Sat Mar  7 09:18:42 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* tool/merger.rb: Added documentation to version method.
-	  [fix GH-847][ci skip] Patch by @magikid
-
-Fri Mar  6 22:50:36 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* class.c (rb_prepend_module): need a WB for klass -> origin.
-
-Fri Mar  6 20:18:38 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* fix namespace issue on singleton class expressions. [Bug #10943]
-
-	* vm_core.h, method.h: remove rb_iseq_t::cref_stack. CREF is stored
-	  to rb_method_definition_t::body.iseq_body.cref.
-
-	* vm_insnhelper.c: modify SVAR usage.
-	  When calling ISEQ type method, push CREF information onto method
-	  frame, SVAR located place. Before this fix, SVAR is simply nil.
-	  After this patch, CREF (or NULL == Qfalse for not iseq methods)
-	  is stored at the method invocation.
-
-	  When SVAR is required, then put NODE_IF onto SVAR location,
-	  and NDOE_IF::nd_reserved points CREF itself.
-
-	* vm.c (vm_cref_new, vm_cref_dump, vm_cref_new_toplevel): added.
-
-	* vm_insnhelper.c (vm_push_frame): accept CREF.
-
-	* method.h, vm_method.c (rb_add_method_iseq): added. This function
-	  accepts iseq and CREF.
-
-	* class.c (clone_method): use rb_add_method_iseq().
-
-	* gc.c (mark_method_entry): mark method_entry::body.iseq_body.cref.
-
-	* iseq.c: remove CREF related codes.
-
-	* insns.def (getinlinecache/setinlinecache): CREF should be cache key
-	  because a different CREF has a different namespace.
-
-	* node.c (rb_gc_mark_node): mark NODE_IF::nd_reserved for SVAR.
-
-	* proc.c: catch up changes.
-
-	* struct.c: ditto.
-
-	* insns.def: ditto.
-
-	* vm_args.c (raise_argument_error): ditto.
-
-	* vm_eval.c: ditto.
-
-	* test/ruby/test_class.rb: add a test.
-
-Fri Mar  6 18:19:13 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* test/webrick/test_filehandler.rb: on vboxsf (on VirtualBox
-	  on Windows 7), file name and permissions are strange (can access
-	  by short file name and so on).
-
-	  Simply skip on such tests on such FS. To detect strange FS, this
-	  patch use a part of code `File.executable?(__FILE__)`.
-	  Please correct them if there are better ways.
-
-Fri Mar  6 17:31:29 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* test/ruby/test_beginendblock.rb: do not change directory.
-
-	  Run system command in the directory mounted by vboxsf on Windows 7
-	  and get warning like that "warning: Insecure world writable dir...".
-
-Fri Mar  6 10:31:00 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* vm_eval.c (vm_call_super): search next super class from the
-	  original class, to get rid of infinite recursion with
-	  prepending.  a patch by Seiei Higa <hanachin AT gmail.com> at
-	  [ruby-core:68434].  [ruby-core:68093] [Bug #10847]
-
-Fri Mar  6 08:45:26 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
-
-	* lib/matrix.rb: Add Vector#round. Patch by Jordan Stephens.
-	  [Fixes GH-802]
-
-Fri Mar  6 07:33:03 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (obj_info): show node name too.
-
-Fri Mar  6 07:00:44 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* internal.h: remove struct method_table_wrapper.
-	  struct method_table_wrapper was introduced to avoid duplicate marking
-	  for method tables.
-
-	  For example, `module M1; def foo; end; end` make one method table
-	  (mtbl) contains a method `foo`. M1 (T_MODULE) points mtbl.
-	  Classes C1 and C2 includes M1, then two T_ICLASS objects are created
-	  and they points mtbl too. In this case, three objects (one T_MODULE
-	  and two T_ICLASS objects) points same mtbl. On marking phase, these
-	  three objects mark same mtbl. To avoid such duplication, struct
-	  method_table_wrapper was introduced.
-
-	  However, created two T_ICLASS objects have same or shorter lifetime
-	  than M1 (T_MODULE) object. So that we only need to mark mtbl from M1,
-	  not from T_ICLASS objects. This patch tries marking only from M1.
-	  In other words, original module (M1) has responsibility to mark mtbl.
-	  Because of no duplicate marking, we don't need method_table_wrapper
-	  any more.
-
-	  Note that one `Module#prepend` call creates two T_ICLASS objects.
-	  One for referring to a prepending Module object, same as
-	  `Module#include`. We don't need to care this T_ICLASS.
-	  One for moving original mtbl from a prepending class. We need to
-	  mark such mtbl from this T_ICLASS object. To mark the mtbl,
-	  we need to use `RCLASS_ORIGIN(klass)` on marking from a prepended
-	  class `klass`.
-
-	* class.c: ditto.
-
-	* eval.c (rb_using_refinement): ditto.
-
-	* gc.c: ditto.
-
-	* include/ruby/ruby.h: define m_tbl directly. The definition of
-	  struct RClass should be moved to (srcdir)/internal.h.
-
-	* method.h: remove decl of rb_free_m_tbl_wrapper().
-
-	* object.c: use RCLASS_M_TBL() directly.
-
-Fri Mar  6 02:50:12 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* dir.c (replace_real_basename): need to check the return value of
-	  GLOB_REALLOC().
-
-Fri Mar  6 02:26:03 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* dir.c (replace_real_basename): shouldn't create Ruby object before
-	  the object system is loaded.
-	  [ruby-core:68430] [Bug #10941]
-
-Wed Mar  5 16:58:43 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
-
-	* hash.c: [DOC] #delete method actually returns nil, if the key
-	  is not found. [fix GH-844][ci skip] Patch by @ivdma
-
-Wed Mar  5 12:22:23 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
-
-	* math.c: refactoring: remove unnecessary variable d0 to unify code
-	  appearance.
-
-Thu Mar  5 11:50:54 2015  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* vm_eval.c (eval_string_with_cref): A binding should keep
-	  refinements activation information and the refinements should be
-	  activated in subsequent eval calls with the binding.
-	  [ruby-core:67945] [Bug #10818]
-
-Thu Mar  5 11:16:55 2015  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* test/ruby/test_refinement.rb: There is no need anymore to suppress
-	  warnings.
-
-Thu Mar  5 08:31:02 2015  Rei Odaira  <Rei.Odaira@gmail.com>
-
-	* random.c (random_raw_seed): Avoid calling fill_random_bytes()
-	  if the requested size is 0. AIX returns -1 for 0-byte read from
-	  /dev/urandom, while other UNIX returns 0. With this change,
-	  Random.raw_seed(0) consistently returns "" in any UNIX.
-
-Wed Mar  4 12:43:32 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
-
-	* test/ruby/test_math.rb (assert_float_and_int): Refactor test cases
-	  by introducing assert_float_and_int. [misc #10810]
-
-Wed Mar  4 11:52:30 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* symbol.c (Init_sym): make dsym_fstrs a hash compared by identity
-	  as the keys are unique fstrings, to get rid of running hash and
-	  compare methods and causing new object allocation during garbage
-	  collection phase.  [ruby-dev:48891] [Bug #10933]
-
-Wed Mar  4 10:16:57 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* enum.c: Fix typo in slice_after's exception message.
-	  [fix GH-842][ci skip] Patch by @jsyeo
-
-Wed Mar  4 10:15:37 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* doc/syntax/methods.rdoc: add some missing spaces and
-	  fix a grammatical error in method docs.
-	  [fix GH-843][ci skip] Patch by @nikolas
-
-Wed Mar  4 02:13:06 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* tool/redmine-backporter.rb (backport_command_string): pick up only
-	  when the revision exists in trunk.
-
-Wed Mar  4 00:44:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* thread.c (rb_thread_io_blocking_region): assigned variables
-	  inside EXEC_TAG() should be volatile.
-
-	* thread.c (rb_thread_s_handle_interrupt): ditto.
-
-	* thread.c (exec_recursive): ditto.
-
-Wed Mar  4 00:29:18 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* tool/redmine-backporter.rb: now can specify shorten form of commands.
-
-Tue Mar  3 23:41:42 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* tool/redmine-backporter.rb (Readline.readline): drop untreated control
-	  characters.
-
-Tue Mar  3 22:25:24 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* test/lib/envutil.rb (EnvUtil.invoke_ruby): need to rescue because
-	  Signal.signame may raise exception.
-
-Tue Mar  3 16:57:39 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* tool/redmine-backporter.rb: use 'b' instead of 's' for showing
-	  Backport options for merger.rb.
-
-Tue Mar  3 16:55:23 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* tool/redmine-backporter.rb: show selected ticket number at prompt.
-
-Tue Mar  3 14:47:30 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
-
-	* math.c (num2dbl_with_to_f): direct casting from Rational to double.
-	  [Feature #10909]
-
-	* test/ruby/test_math.rb: add tests for the above change.
-
-Tue Mar  3 07:52:20 2015  Rei Odaira  <Rei.Odaira@gmail.com>
-
-	* test/ruby/test_symbol.rb: avoid a false positive in AIX.
-
-Tue Mar  3 00:59:39 2015  Naohisa Goto  <ngotogenome@gmail.com>
-
-	* configure.in: set PRELOADENV in Solaris to avoid "wrong ELF class"
-	  error. [Bug #10926] [ruby-dev:48888]
-	* configure.in: set LIBPATHENV for 32-bit compile in Solaris
-	  in addition to 64-bit.
-
-Mon Mar  2 15:36:10 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in: do not check _setjmp unless _longjmp is available,
-	  so that configure results will not be changed by cache.
-
-Mon Mar  2 14:44:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in (RUBY_REPLACE_TYPE): restore unsigned type from
-	  cached variable only if the target type is not available.
-
-Mon Mar  2 13:04:27 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* signal.c (sig_signame): return nil if the argument is a valid
-	  signal number.
-
-Mon Mar  2 12:05:04 2015  Naohisa Goto  <ngotogenome@gmail.com>
-
-	* test/net/ftp/test_ftp.rb (create_ftp_server): set SO_OOBINLINE
-	  for receiving OOB data which is sent with MSG_OOB flag in
-	  portable way. [Bug #10915] [ruby-dev:48885]
-	* test/net/ftp/test_ftp.rb (test_abort, test_status): use gets
-	  for receiving OOB data in portable way.
-
-Mon Mar  2 11:43:07 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in (RUBY_REPLACE_TYPE): restore unsigned type from
-	  cached variable.
-
-Mon Mar  2 06:01:41 2015  Eric Wong  <e@80x24.org>
-
-	* ext/io/wait/wait.c (io_nread): wrap return value with INT2FIX
-	  Thanks to Yura Sokolov <funny.falcon@gmail.com>
-	  [ruby-core:68369] [Bug#10923]
-	* test/io/wait/test_io_wait.rb (test_nread_buffered):
-	  fix broken test
-
-Sun Mar  1 20:21:16 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in (RUBY_REPLACE_TYPE): restore convertible type from
-	  cached variable, so that configured results will be stable.
-
-Sun Mar  1 18:10:34 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in (rb_cv_broken_memmem): check before adding the
-	  result HAVE_MEMMEM macro to confdefs.h, so that configured
-	  results will be stable.
-
-Sun Mar  1 11:17:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* gc.c (id2ref): prohibit from accessing internal objects.
-	  [ruby-core:68348] [Bug #10918]
-
-Sun Mar  1 09:06:11 2015  Tanaka Akira  <akr@fsij.org>
-
-	* lib/time.rb (strptime): Support %s.%N.
-	  [ruby-core:68301] [Bug #10904] Patch by Sadayuki Furuhashi.
-
-Sat Feb 28 17:18:39 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* enum.c (enum_each_slice, enum_each_cons): limit elements size by
-	  the enumerator size.  suggested by Hans Mackowiak <hanmac AT
-	  gmx.de> at [ruby-core:68335]
-
-Sat Feb 28 15:44:20 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* vm_dump.c (rb_vm_bugreport): get rid of making new strings
-	  inside signal context.
-
-	* variable.c (rb_tmp_class_path): defer making temporary class
-	  path string.
-
-	* variable.c (rb_search_class_path): search class path or return
-	  Qnil or Qfalse if unnamed, not creating a temporary path.
-
-Sat Feb 28 15:02:02 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* variable.c (rb_tmp_class_path): preserve name encoding of an
-	  anonymous instance of module/class subclass.
-
-Sat Feb 28 08:24:30 2015  Rei Odaira  <Rei.Odaira@gmail.com>
-
-	* ext/pty/pty.c: AIX supports autopush.
-	  Patch by Perry Smith [ruby-core:58539] [Bug #9144]
-
-Fri Feb 27 22:00:05 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* lib/rubygems: Update to RubyGems 2.4.6 and HEAD(800f2e6).
-	  Fixed #1159, #1171, #1173 on rubygems/rubygems
-	* test/rubygems: ditto.
-
-Fri Feb 27 20:55:42 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* lib/rake: Update to rake (9237e74), typo fix and remove needless
-	  private syntax.
-	* test/rake: ditto.
-
-Fri Feb 27 17:06:44 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_core.h: define vm_svar_index.
-
-	* vm_insnhelper.c, vm.c, compile.c: use vm_svar_index names.
-
-	* iseq.h: remove DEFAULT_SPECIAL_VAR_COUNT.
-	  use VM_SVAR_FLIPFLOP_START instead.
-
-Fri Feb 27 13:57:48 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* io.c (setup_narg): wipe away expanded part of buffer to get rid
-	  of revealing uncleaned data.  reported by Dongkwan Kim <dkay AT
-	  kaist.ac.kr>.
-
-Wed Feb 25 22:25:07 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* spec/default.mspec: use default configuration file name.
-	  https://github.com/ruby/rubyspec/commit/cc69f337b06362e5607ffa3e3ad40ef7494960cf
-
-Wed Feb 25 22:21:56 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* spec/default.mspec: remove specific version number.
-	  https://github.com/ruby/rubyspec/commit/7a909e925c1baa9c700bd44af9241aef6e596714
-
-Wed Feb 25 22:04:04 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* ext/win32/Win32API.rb (initialize): accept both a string and an array
-	  for the arguments of the imported function.
-	  reported by Aaron Stone [ruby-core:68208] [Bug #10876] [Fixes GH-835]
-
-Wed Feb 25 18:12:11 2015  Eric Wong  <e@80x24.org>
-
-	* signal.c (sighandler): preserve errno
-	  Patch by Steven Stewart-Gallus <sstewartgallus00@mylangara.bc.ca>
-	  [ruby-core:68172] [Bug #10866]
-
-Wed Feb 25 15:59:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (push_pattern, push_glob): make globbed file names same
-	  encoding to the given pattern.
-
-Wed Feb 25 15:27:16 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* tool/merger.rb: support 2.1+ versioning scheme.
-
-Tue Feb 25 08:49:12 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
-
-	* lib/cmath.rb (log): raise ArgumentError when more than 2 arguments
-	  are passed. [ruby-core:66143] [Bug #10487]
-
-Tue Feb 25 02:15:17 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
-
-	* test/ruby/test_math.rb: Use assert_infinity instead of assert_equal(1.0/0, ...).
-
-	* test/ruby/test_math.rb: Add tests for overriding Integer#to_f.
-	  [ruby-core:67919] [Misc #10809]
-
-Tue Feb 24 22:58:48 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* complex.c (nucomp_mul): calculate as rotation in complex plane
-	  if matrix calculation resulted in NaN.
-
-Tue Feb 24 21:45:39 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
-
-	* test/ruby/test_math.rb(test_cbrt): Add an assertion for Math.cbrt(1.0/0)
-	  and move #test_cbrt to more proper place.
-
-Tue Feb 24 19:09:25 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* vm_insnhelper.c (lep_svar_place, lep_svar_get): do not create
-	  additional T_NODE object (svars holder) when only getting
-	  svars.
-
-Tue Feb 24 11:49:48 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* time.c (time_zone_name): should be US-ASCII only if all 7-bits,
-	  otherwise locale encoding.  [ruby-core:68230] [Bug #10887]
-
-Tue Feb 24 09:47:07 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* string.c (chompped_length): enable smart chomp for all non-dummy
-	  encoding strings, not only default_rs.
-	  [ruby-core:68258] [Bug #10893]
-
-Mon Feb 23 23:19:42 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* tool/vcs.rb (IO.popen): support :chdir option.
-
-	* tool/vcs.rb (VCS::GIT.get_revisions): use :chdir option instead
-	  of -C option which is not supported by older git.
-	  [ruby-dev:48880] [Bug #10890]
-
-Mon Feb 23 15:26:39 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* string.c (rb_str_split_m): raise ArgumentError at broken string
-	  not RegexpError, as Regexp is not involved in.
-	  [ruby-core:68229] [Bug #10886]
-
-Mon Feb 23 07:25:29 2015  Benoit Daloze  <eregontp@gmail.com>
-
-	* time.c: Zone encoding should be US-ASCII if all 7-bits. Fix r46907.
-
-	* test/ruby/test_time.rb, test/ruby/test_time_tz.rb: Update tests.
-
-Sun Feb 22 18:33:42 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* common.mk: use ruby organization for rubyspec.
-
-Sun Feb 22 15:56:06 2015  Kazuki Tsujimoto  <kazuki@callcc.net>
-
-	* vm_insnhelper.c (rb_vm_rewrite_cref_stack): copy nd_refinements
-	  of original crefs. It fixes segmentation fault when calling
-	  refined method in duplicate module. [ruby-dev:48878] [Bug #10885]
-
-	* vm_core.h, class.c: change accordingly.
-
-	* test/ruby/test_refinement.rb: add a test for above.
-
-Sun Feb 22 10:43:37 2015  Koichi Sasada  <ko1@atdot.net>
-
-	* gc.c (rb_objspace_call_finalizer): control GC execution during
-	  force firnalizations at the end of interpreter process.
-	  [Bug #10768]
-
-	  1) Prohibit incremental GC while running Ruby-level finalizers
-	     to avoid any danger.
-	  2) Prohibit GC while invoking T_DATA/T_FILE data structure
-	     because these operations break object relations consistency.
-
-	  This patch can introduce another memory consuming issue because
-	  Ruby-level finalizers can run after (2), GC is disabled.
-	  However, basically object consistency was broken at (2) as I
-	  described above. So that running Ruby-level finalizers contains
-	  danger originally. Because of this point, I need to suggest to
-	  remove these 3 lines (invoking remaining finalizers). And add a
-	  rule to add that finalizers should not add new finalizers, or
-	  say there is no guarantee to invoke finalizers that added by
-	  another finalizer.
-
-Sun Feb 22 04:07:05 2015  Zachary Scott  <e@zzak.io>
-
-	* ext/openssl/ossl_asn1.c: [DOC] RDoc formatting fixes for
-	  ASN1::ObjectId with patch from @vbatts [Fixes GH-834]
-
-	* ext/openssl/ossl_bn.c: ditto.
-
-Sat Feb 21 19:51:49 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* re.c (match_aref): RMatch::regexp is Qnil after matching by a
-	  string since r45451.  [ruby-core:68209] [Bug #10877]
-
-Sat Feb 21 16:18:42 2015  Stefan Schuler  <mail@stefanschuessler.de>
-
-	* compar.c (Init_Comparable): [DOC] Replace camelcase variable name.
-	  [Fix GH-833]
-
-Fri Feb 20 17:27:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* file.c (rb_file_identical_p): fix handle leak, ensure to close
-	  the handle of the first argument.
-
-Fri Feb 20 17:19:23 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* win32/win32.c (different_device_p): compare by volume serial
-	  numbers, not by path names.  [ruby-core:68162] [Bug #10865]
-
-Thu Feb 19 01:58:10 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* win32/file.c (rb_file_expand_path_internal): neither the drive
-	  of base directory nor the current drive are involved in the
-	  result if different than the drive of path.
-	  [ruby-core:68130] [Bug #10858]
-
-Wed Feb 18 10:48:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* win32/win32.c (wrename): return EXDEV if moving a directory to
-	  another drive, since MoveFileExW does not set proper error code.
-	  [ruby-core:68162] [Bug #10865]
-
-Wed Feb 18 03:13:52 2015  Aaron Patterson <aaron@tenderlovemaking.com>
-
-	* ext/psych/lib/psych.rb: bump psych version.
-	* ext/psych/psych.gemspec: ditto
-	* ext/psych/yaml/scanner.c: add latest libyaml change.
-	* test/psych/helper.rb: support newer minitest
-	* test/psych/test_to_yaml_properties.rb: ditto
-
-Tue Feb 17 11:47:17 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/resolv.rb (Resolv::DNS::Resource#==, #hash): elements
-	  returned by Kernel#instance_variables are Symbols now.
-	  [ruby-core:68128] [Bug #10857]
-
-Tue Feb 17 10:59:10 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* doc/syntax/calling_methods.rdoc: Fix documentation for "calling_methods"
-	  Patch by @sos4nt [fix GH-830][ci skip]
-
-Tue Feb 17 10:53:29 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* win32/file.c (rb_file_expand_path_internal): do not make invalid
-	  (or ADS) path if the path has a drive letter, the result also
-	  should have be under it.  [ruby-core:68130] [Bug #10858]
-
-Tue Feb 17 10:47:20 2015  Iain Beeston  <iain.beeston@gmail.com>
-
-	* hash.c: Added docs to explain that #include? and #member? do not
-	  check member equality
-	* lib/set.rb: ditto
-
-Mon Feb 16 20:58:49 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* compile.c (compile_massign): optimization for special case,
-	  assignments by aset or attrset.
-	  http://kokizzu.blogspot.jp/2015/02/c-java-hhvm-ruby-nodejsrhinojscspidermo.html
-	  http://www.atdot.net/~ko1/diary/201502.html#d16
-
-Sun Feb 15 10:41:23 2015  Sho Hashimoto  <sho-h@ruby-lang.org>
-
-	* doc/standard_library.rdoc: [DOC] delete removed libraries.
-	  [misc #10843] [ci skip]
-
-Sat Feb 14 12:20:01 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* random.c (rand_random_number): add a method to return a random
-	  number like SecureRandom to Random::Formatter.
-
-	* lib/securerandom.rb (random_bytes): move to Random::Formatter,
-	  the base method of the module.
-
-Sat Feb 14 12:01:32 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* random.c (random_raw_seed): extract platform dependent random
-	  seed initialization function as a new method Random.raw_seed.
-
-	* lib/securerandom.rb (SecureRandom): use Random.raw_seed.
-
-Sat Feb 14 00:49:37 2015  Aaron Patterson <aaron@tenderlovemaking.com>
-
-	* ext/coverage/coverage.c: Add Coverage.peek_result.  Allows you to
-	  capture coverage information without stopping the coverage tool.
-	  [ruby-core:67940] [Feature #10816]
-
-	* test/coverage/test_coverage.rb: test for change.
-
-Fri Feb 13 21:52:05 2015  Yusuke Endoh  <mame@tsg.ne.jp>
-
-	* string.c (str_discard): does not free for STR_NOFREE string.
-	  [Bug #10853][ruby-core:68110]
-
-	* bootstraptest/test_string.rb: test for above.
-
-Fri Feb 13 21:16:00 2015  Yusuke Endoh  <mame@tsg.ne.jp>
-
-	* lib/base64.rb: make urlsafe mode user-friendly.
-
-	* lib/base64.rb (Base64.urlsafe_encode64): a new option "padding" to
-	  suppress the padding character ("=").
-
-	* lib/base64.rb (Base64.urlsafe_decode64): now it accepts not only
-	  correctly-padded input but also unpadded input.
-	  [Feature #10740][ruby-core:67570]
-
-	* test/base64/test_base64.rb: Test for above
-
-Fri Feb 13 14:19:06 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* ext/json: merge upstream from flori/json
-	  change usage of TypedData. [Feature #10739][ruby-core:67564]
-
-Thu Feb 12 18:34:01 2015  multisnow  <infinity.blick.winkel@gmail.com>
-
-	* ext/openssl/extconf.rb: check RAND_edg to support libressl.
-
-	* ext/openssl/ossl_rand.c (ossl_rand_egd): define only if RAND_edg
-	  is available.  [Fix GH-829]
-
-Thu Feb 12 10:46:14 2015  Eric Hodel  <drbrain@segment7.net>
-
-	* proc.c (proc_call):  Improve Proc#call documentation.  Patch by
-	  Hsing-Hui Hsu.  [fix GH-761]
-
-Thu Feb 12 04:33:02 2015  Benoit Daloze  <eregontp@gmail.com>
-
-	* compar.c (cmp_equal): no more error hiding for Comparable#==.
-	  It now behaves as other Comparable methods. See #7688.
-
-	* test/ruby/test_comparable.rb: update related test.
-
-Thu Feb 12 03:28:05 2015  Eric Wong  <e@80x24.org>
-
-	* lib/set.rb (initialize): internal hash defaults to false
-
-	* lib/set.rb (include?): use Hash#[] for optimized dispatch.
-	  Patch by Ismael Abreu <ismaelga@gmail.com>
-	  [ruby-core:67664] [Misc #10754]
-
-Wed Feb 11 11:09:52 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/digest/digest_conf.rb (digest_conf): check for CommonDigest.
-
-	* ext/digest/*/*cc.h: for Apple CommonCrypto/CommonDigest.h.
-
-	* ext/digest/digest.h (DEFINE_FINISH_FUNC_FROM_FINAL): macro for
-	  finish functions, by inverting arguments order.
-
-	* ext/digest/digest_conf.rb (digest_conf): extract common
-	  configurations.
-
-Wed Feb 11 11:01:33 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/json/generator/generator.c (generate_json): get rid of
-	  unnecessary recursive calls which can cause infinite recursion.
-	  T_STRING may not have rb_cString.
-
-Wed Feb 11 07:53:35 2015  Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
-	* test/win32ole/test_word.rb: use skip method to skip test.
-
-Tue Feb 10 11:38:28 2015  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* vm_insnhelper.c (vm_call_method): stop method search when a method
-	  is not found in a refinement, to support undef in refinements.
-	  [ruby-core:66741] [Bug #10578]
-
-Tue Feb 10 11:19:11 2015  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* lib/net/ftp.rb (chdir, delete, gettextfile, mdtm, mkdir, nlst,
-	  putbinaryfile, puttextfile, rename, rmdir, size): support
-	  Pathname. Patch by Joe Rafaniello. [fix GH-828]
-
-Mon Feb  9 16:36:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* tool/make-snapshot (package): get rid of loading unbundled and
-	  unexpected libraries.  [ruby-core:67977] [Bug #10822]
-
-Sun Feb  8 20:09:37 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* lib/net/http/header.rb: pass header names as symbols.
-	  Patch by @DamirSvrtan [fix GH-805]
-	* test/net/http/test_httpheader.rb: added test.
-
-Sun Feb  8 13:04:25 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/socket/getaddrinfo.c (get_addr): reject too long hostname to
-	  get rid of GHOST vulnerability on very old platforms.
-
-	* ext/socket/raddrinfo.c (make_hostent_internal): ditto, paranoic
-	  check for the canonical name.
-
-Sun Feb  8 12:48:38 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/win32/lib/win32/registry.rb (Win32::Registry::API): use wide
-	  versions of RegDeleteValue and RegDeleteKey.
-	  [ruby-core:67958] [Bug #10820]
-
-Sat Feb  7 22:13:08 2015  Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
-	* test/win32ole/test_win32ole_record.rb: remove test using .NET
-	  Framework 3.5 because it is not included in Windows 8/8.1.
-
-Sat Feb  7 19:25:25 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (has_magic): always get long path name on Windows even if
-	  no tilde is there.  [ruby-core:68011] [Bug #10819]
-
-	* dir.c (replace_real_basename): FindFirstFile ignore redirection
-	  character, check if exists before call it.  cf. [Bug #8597]
-
-Sat Feb  7 13:30:11 2015  Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
-	* test/win32ole/test_win32ole_record.rb
-	  (test_ole_instance_variable_get): correct VT_RECORD type and
+	* variable.c (obj_remove_instance_variable): method to remove
 	  instance variables.
 
-Fri Feb  6 17:47:05 2015  Aaron Patterson <aaron@tenderlovemaking.com>
-
-	* ext/psych/lib/psych/visitors/yaml_tree.rb: register nodes when
-	  dumping objects with custom coders. [ruby-core:66215] [Bug #10496]
-
-	* test/psych/test_coder.rb: test for fix
-
-Fri Feb  6 16:58:31 2015  Aaron Patterson <aaron@tenderlovemaking.com>
-
-	* ext/psych/lib/psych/visitors/to_ruby.rb: fix support for regular
-	  expressions with newlines. tenderlove/psych#222
-
-	* test/psych/test_yaml.rb: test for change.
-
-Fri Feb  6 10:31:50 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* vm_core.h (rb_call_info_kw_arg_struct): make keywords a symbols
-	  list to get rid of inadvertent creation by variable keyword
-	  arguments.  [ruby-core:68031] [Bug #10831]
-
-Thu Feb  5 22:42:34 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* lib/rubygems:  Update to RubyGems HEAD(5c3b6f3).
-	  Fixed #1156, #1142, #1115, #1142, #1139 on rubygems/rubygems
-	* test/rubygems:  ditto.
-
-Thu Feb  5 13:41:01 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* vm_eval.c (send_internal), vm_insnhelper.c (vm_call_opt_send):
-	  convert String method name into a Symbol, as method_missing
-	  method expects its first argument to be a Symbol.  [Bug #10828]
-
-	* vm_insnhelper.c (ci_missing_reason): return the reason of method
-	  missing in call info.
-
-	* vm_insnhelper.c (vm_call_opt_send): re-apply r49500 with the
-	  proper missing reason.  [Bug #10828]
-
-Thu Feb  5 10:31:46 2015  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* class.c (rb_obj_singleton_methods): should use RTEST() to convert
-	  VALUE to int.
-
-Thu Feb  5 03:59:33 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
-
-	* vm_insnhelper.c: Fix symbol leak with +send+ [Bug #10828]
-
-Wed Feb  4 20:26:54 2015  Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
-	* ext/win32ole/win32ole.c (Init_win32ole): should not use atexit to
-	  free allocated hash table to avoid error on Cygwin.
-
-Wed Feb  4 15:34:25 2015  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* class.c (method_entry_i, class_instance_method_list,
-	  rb_obj_singleton_methods): should not include methods of
-	  superclasses if recur is false. [ruby-dev:48854] [Bug #10826]
-
-Wed Feb  4 16:32:40 2015  Matt Hoyle  <matt@deployable.co>
-
-	* ext/bigdecimal/bigdecimal.c (VpSetPTR): fix a typo, 'expoennt'
-	  to 'exponent'.  [ruby-core:67980] [Bug #10823] [Fix GH-825]
-
-Wed Feb  4 15:55:38 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/sdbm/_sdbm.c: include ruby/ruby.h for PRIdPTRDIFF when a
-	  macro `DEBUG` is defined.  based on the patch by Owen Rodley in
-	  [ruby-core:67987]. [Bug #10825]
-
-Wed Feb  4 11:12:43 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* Makefile.in (probes.stamp): rebuild dtrace dependent objects
-	  only when `dtrace -G` modifies its input files.
-
-Tue Feb  3 19:27:16 2015  Naohisa Goto  <ngotogenome@gmail.com>
-
-	* common.mk (ruby-glommed.o): dependency on $(OBJ) should be written
-	  in common.mk (in which OBJ is defined) because of Makefile include
-	  and parse order. This partly reverts r49419.
-	  [ruby-dev:48849] [Bug #10808]
-
-	* Makefile.in (ruby-glommed.o): ditto.
-
-	* Makefile.in (ruby-glommed.o): remove excess $(DTRACE_OBJ) because
-	  it is included in $(OBJS) since r49451.
-
-	* Makefile.in (probes.o): should depend on $(DTRACE_DEPENDENT_OBJS)
-
-Tue Feb  3 17:15:45 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* lib/mkmf.rb (try_cppflags, try_cflags, try_ldflags): get rid of
-	  interference by modifying global variables in have_devel? method.
-	  [ruby-core:67962] [Bug #10821]
-
-Tue Feb  3 15:23:58 2015  Shugo Maeda  <shugo@ruby-lang.org>
-
-	* vm_method.c (remove_method): When remove refined
-	  method, raise a NameError if the method is not
-	  defined in refined class.
-
-	  But if the method is defined in refined class,
-	  it should keep refined method and remove original
-	  method.
-
-	  Patch by Seiei Higa. [ruby-core:67722] [Bug #10765]
-
-Tue Feb  3 14:04:47 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dir.c (glob_helper): obtain real name with FindFirstFile API
-	  instead of matching all entries, on Windows.
-	  [ruby-core:67954] [Bug #10819]
-
-Tue Feb  3 12:26:35 2015  Katsuhiko Nishimra  <ktns.87@gmail.com>
-
-	* lib/mkmf.rb (configuration): set the default cxxflags, which is
-	  referred from the default CXXFLAGS, for extension libraries.
-	  [Fix GH-823]
-
-Tue Feb  3 05:52:00 2015  Aman Gupta <ruby@tmm1.net>
-
-	* gc.c (rb_objspace_free): cause rb_bug if lazy sweep is in progress
-	  during rb_objspace_free. Adds extra protection for r46340.
-	  Patch by Vicent Marti. [Bug #10768] [ruby-core:67734]
-	* gc.c (rb_objspace_call_finalizer): Ensure GC is completed after
-	  finalizers have run. We already call gc_rest() before invoking
-	  finalizers, but finalizer can allocate new objects and start new GC
-	  cycle, so we call gc_rest() again after finalizers are complete.
-
-Mon Feb  2 10:51:34 2015  Ari Pollak  <ajp@aripollak.com>
-
-	* doc/security.rdoc (Symbols): update about Symbol GC.  Symbols
-	  explicitly converted from Strings now can be collected, but
-	  reflection/metaprogramming still can cause memory flooding.
-	  [Fix GH-725]
-
-Sun Feb  1 13:46:52 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* tool/rbinstall.rb (bin-comm): drop batch file installation.
-	  Windows 95 support has not been supported already.
-	  [Feature #10806]
-
-Sat Jan 31 12:06:23 2015  Scott Francis  <scott.francis@shopify.com>
-
-	* thread_pthread.c (reserve_stack): fix intermittent SIGBUS on
-	  Linux, by reserving the stack virtual address space at process
-	  start up so that it will not clash with the heap space.
-	  [Fix GH-822]
-
-Fri Jan 30 17:28:29 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
-
-	* math.c (num2dbl_with_to_f): make faster when Bignum passed by
-	  direct conversion using rb_big2dbl().  [Feature #10800]
-
-Thu Jan 29 23:30:00 2015  Kenta Murata  <mrkn@mrkn.jp>
-
-	* ext/bigdecimal/bigdecimal.c (rb_rational_num): add fallback function
-	  for rubies lower than 2.2.0.
-
-	* ext/bigdecimal/bigdecimal.c (rb_rational_den): ditto.
-
-	* ext/bigdecimal/extconf.rb: check the existences of struct RRational,
-	  rb_rational_num, and rb_rational_den.
-
-	* ext/bigdecimal/bigdecimal.bundle: bump version.
-
-Thu Jan 29 20:28:25 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* tool/make-snapshot: removed md5 digest with package information
-
-Thu Jan 29 10:41:52 2015  Kazuki Tanaka  <gogotanaka@ruby-lang.org>
-
-	* math.c (Get_Double): direct casting from Fixnum to double.
-	  [Feature #10785]
-
-Thu Jan 29 02:34:27 2015  Aaron Patterson <aaron@tenderlovemaking.com>
-
-	* ext/psych/lib/psych/visitors/to_ruby.rb: fix parsing hashes with
-	  instance variables when it is referenced multiple times.
-	* ext/psych/lib/psych.rb: bump version
-	* ext/psych/psych.gemspec: bump version
-	* test/psych/test_hash.rb: test for fix
-
-Thu Jan 29 02:06:09 2015  Eric Wong  <e@80x24.org>
-
-	* thread.c (struct join_arg): restructure and make smaller
-	  (thread_join_sleep): avoid timeofday() call if forever
-	  (thread_join): pass join_arg.delay directly
-	  (rb_thread_inspect_msg): remove, inline into rb_thread_inspect
-	  (rb_thread_inspect): reduce branching and string creation
-	* thread_pthread.c (native_set_thread_name): create string directly
-	  to avoid reparsing. [Misc #10723]
-
-Wed Jan 28 21:32:24 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* thread.c: Improve documentation for Thread#value
-	  [Bug #10694][ruby-core:67324][ci skip]
-
-Tue Jan 27 16:04:19 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* tool/redmine-backporter.rb: added `!` command.
-
-Tue Jan 27 15:58:23 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* tool/redmine-backporter.rb: added history feature for platforms which
-	  lack readline.
-
-Mon Jan 26 22:09:35 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* .gitignore: ignored temporary file with git.
-
-Mon Jan 26 18:06:03 2015  Akinori MUSHA  <knu@iDaemons.org>
-
-	* misc/ruby-electric.el: Import version 2.2.2 from
-	  https://github.com/knu/ruby-electric.el.
-
-Mon Jan 26 11:37:49 2015  Dave Stevens  <dave@crowdlab.com>
-
-	* string.c (str_make_independent_expand): terminate String when
-	  moved from heap to embedded.  [Fix GH-821].
-
-Sun Jan 25 12:04:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* array.c (flatten): no need to call to_ary method on elements
-	  beyond the given level.  [ruby-core:67637] [Bug #10748]
-
-Sun Jan 25 00:42:24 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/fiddle/win32/libffi.mk.tmpl: assemble without directory prefix.
-	  workaround of a bug of VC12 ml, by unak at [ruby-core:67792].
-	  [ruby-core:67789] [Bug #10780]
-
-Sat Jan 24 19:56:25 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* dln_find.c (dln_find_1): search regular files only.  based on
-	  the patch by Alex Coomans in [ruby-core:67766].  [Bug #10776]
-
-Fri Jan 23 23:57:05 2015  Misumi Rize  <r@ayase-e.li>
-
-	* vm_insnhelper.c (vm_throw_start): search the target to break
-	  from a block with nested rescue, from the nested blocks.
-	  [ruby-core:67765] [Bug #10775] [Fix GH-820]
-
-Fri Jan 23 20:00:59 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* marshal.c (w_object, marshal_dump): use identity tables for
-	  arbitrary VALUE keys, because of performance of FLONUM.
-	  [Bug #10761]
-
-	* marshal.c (obj_alloc_by_klass, marshal_load): ditto.
-
-Fri Jan 23 17:12:33 2015  Eric Wong  <e@80x24.org>
-
-	* benchmark/bm_marshal_dump_flo.rb: new benchmark for [Bug #10761]
-
-Thu Jan 22 18:03:19 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* tool/redmine-backporter.rb (find_svn_log): use double quotes instead
-	  of single quotes because cmd.exe doesn't handle them.
-
-	* tool/redmine-backporter.rb (done): the 2nd element of matched data
-	  is the offset of the end of matched string, not length.
-
-Thu Jan 22 16:45:24 2015  Eric Wong  <e@80x24.org>
-
-	* st.c (st_numhash): mix float value for flonum
-	* hash.c (rb_any_hash): ditto
-	* benchmark/bm_hash_aref_flo.rb: new benchmark
-	* benchmark/bm_hash_ident_flo.rb: ditto
-	  [Bug #10761]
-
-Wed Jan 21 22:33:51 2015  Akinori MUSHA  <knu@iDaemons.org>
-
-	* misc/ruby-electric.el: Import version 2.2.1 from
-	  https://github.com/knu/ruby-electric.el.  Improve compatibility
-	  with and optimize for Emacs 24.4.
-
-Wed Jan 21 09:40:52 2015  Zachary Scott  <e@zzak.io>
-
-	* file.c: Document other cases of missing birthtime on OS with patch
-	  provided by @sho-h similar to GH-817. [ci skip] [DOC]
-
-Wed Jan 21 09:09:19 2015  Tanaka Akira  <akr@fsij.org>
-
-	* NEWS: References to tickets added.
-	  [ruby-core:67701] [Bug #10760] Suggested by Zachary Scott.
-
-Tue Jan 20 22:59:54 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* tool/vcs.rb: fix the exception given remote-url of svn.
-
-Tue Jan 20 12:58:33 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* tool/redmine-backporter.rb: now can change the page of `ls`.
-
-Tue Jan 20 12:28:37 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* tool/redmine-backporter.rb (readline): fallback to normal gets on
-	  Windows because IO.console.getch is not always do as expected.
-
-Tue Jan 20 11:31:07 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
-
-	* tool/redmine-backporter.rb: update usage.
-
-Tue Jan 20 11:23:47 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* tool/redmine-backporter.rb (mygets): to support Backspace
-	  implement gets by itself.
-
-Tue Jan 20 02:54:11 2015  Zachary Scott  <e@zzak.io>
-
-	* file.c: NotImplementedError is raised if birthtime is unavailable.
-	  Patch by @y-yagi san and [Fixes GH-817] [ci skip] [DOC]
-
-	* ext/pathname/pathname.c: ditto.
-
-Mon Jan 19 22:08:26 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* class.c (include_modules_at): allow prepend each modules upto
-	  once for each classes.  [EXPERIMENTAL]
-
-Sun Jan 18 18:32:20 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
-
-	* math.c (math_atan2): revive documentation before r49220.
-	  http://d.hatena.ne.jp/nagachika/20150112/ruby_trunk_changes_49213_49226
-
-Sun Jan 18 15:57:32 2015  Seiei Higa  <hanachin@gmail.com>
-
-	* vm_method.c (check_definition): Module#public_method_defined?,
-	  Module#private_method_defined?, Module#protected_method_defined?
-	  should not use refinements. [ruby-core:67656] [Bug #10753]
-
-Sun Jan 18 15:50:39 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* vm_dump.c (rb_vm_bugreport): check by configured result instead
-	  of system name for old FreeBSD.  based on a patch by Steve Wills
-	  at [ruby-core:67655].  [Bug #10752]
-
-Sun Jan 18 12:56:49 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* Makefile.in (VPATH, NEWLINE_C), common.mk (common-srcs): make
-	  and use newline.c under enc/trans directory, not toplevel.  no
-	  longer search enc directory implicitly.
-
-	* configure.in, enc/Makefile.in (BUILTIN_ENCS, BUILTIN_TRANSES):
-	  prefix respective directory names to builtin encodings and
-	  transcoder source names.
-
-Sun Jan 18 11:49:46 2015  Masaki Suketa <masaki.suketa@nifty.ne.jp>
-
-	* ext/win32ole/win32ole.c (ole_invoke): avoid SEGV when VT_RECORD
-	  variable is passed by reference. [ruby-dev:48803] [Bug #10697]
-
-Sat Jan 17 23:59:15 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* ext/psych/lib/psych/visitors/yaml_tree.rb (visit_String):
-	  anchors like `\Z` are not valid inside character class.  use
-	  negative-lookahead instead.
-	  Fixes: https://github.com/tenderlove/psych/issues/221
-
-Sat Jan 17 23:42:27 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
-
-	* configure.in: get rid of pattern substitution, which is not
-	  supported by ash, and ash on NetBSD parses whole source first
-	  and fails to start.  [ruby-dev:48823] [Bug #10750]
-
-Fri Jan 16 18:42:58 2015  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* tool/redmine-backporter.rb: support adding related revisions
-	  to issues.
-
-Fri Jan 16 17:20:33 2015  Koichi Sasada  <ko1@atdot.net>
-
-	vm.c, vm_core.h: constify VM_CF_LEP, VM_CF_PREV_EP, VM_CF_BLOCK_PTR
-	and rb_vm_control_frame_block_ptr.
-
-Fri Jan 16 15:41:21 2015  Aaron Patterson <aaron@tenderlovemaking.com>
-
-	* ext/psych/lib/psych.rb: bump version
-
-	* ext/psych/psych.gemspec: ditto
-
-Fri Jan 16 15:37:49 2015  Aaron Patterson <aaron@tenderlovemaking.com>
-
-	* ext/psych/lib/psych/visitors/yaml_tree.rb: only dump hash
-	  subclasses. Thanks Joe Eli McIlvain <joe.eli.mac@gmail.com>
+Thu Dec  4 13:50:29 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* test/psych/test_hash.rb: test for change
+	* version 1.1b0 released.
 
-Fri Jan 16 15:35:21 2015  Aaron Patterson <aaron@tenderlovemaking.com>
+	* string.c (str_aref): called str_index for regexp.
 
-	* ext/psych/lib/psych.rb: bump version
+Mon Dec  1 15:24:41 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* ext/psych/lib/psych/visitors/yaml_tree.rb: fix line width wrapping
-	  for long strings.  Thanks Jakub Jirutka <jakub@jirutka.cz>
+	* compar.c (cmp_between): wrong comparison made.
 
-	* test/psych/test_string.rb: test for change
+Wed Nov 26 18:18:05 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Fri Jan 16 11:44:44 2015  Kazuki Tsujimoto  <kazuki@callcc.net>
+	* lib/mkmf.rb: generate Makefile for extention modules out of ruby 
+	  source tree. use like `ruby -r mkmf extconf.rb'.
 
-	* eval_intern.h, vm.c, vm_eval.c, vm_insnhelper.c:
-	  change throw mechanism (not save target ep, but save target cfp).
-	  It fixes `unexpected break' bug that occurs when
-	  TracePoint#binding is called.
-	  [ruby-dev:48797] [Bug #10689]
+	* numeric.c (fix2str): enlarge buffer to prevent overflow on some
+	  machines.
 
-	* test/ruby/test_settracefunc.rb: add a test.
+	* parse.y (here_document): wrong line number generated after here-doc.
 
-Thu Jan 15 23:55:15 2015  Tanaka Akira  <akr@fsij.org>
+Fri Nov 21 13:17:12 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* io.c (rb_io_close_m): Don't raise when the IO object is closed.
-	  [ruby-core:67444] [Feature #10718]
+	* parse.y (yylex): skip multibyte characters in comments.
 
-Thu Jan 15 21:34:57 2015  Seiei Higa  <hanachin@gmail.com>
+Wed Nov 19 17:19:20 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* proc.c (rb_obj_singleton_method): Kernel#singleton_method should
-	  not use refinements, as well as Kernel#method.
-	  [ruby-core:67603] [Bug #10744]
+	* object.c (nil_to_a): nil.to_a => [].
 
-Thu Jan 15 10:45:04 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* parse.y (call_args): wrong node generation.
 
-	* array.c (rb_ary_select_bang, ary_reject_bang): linear
-	  performance.  [ruby-core:67418] [Feature #10714]
+Tue Nov 18 10:13:08 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Wed Jan 14 18:06:06 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* array.c (Init_Array): Array#=== works as Array#include?
 
-	* lib/uri/mailto.rb: raising URI::InvalidComponentError instead
-	  of failing with undefined method `split' for nil:NilClass for
-	  mailto: URIs without opaque part. [Bug #10738]
-	* test/uri/testuri.rb: Test for above
+	* regex.c (re_compile_pattern): insert initialize code for jump_n, 
+	  before entering loops.
 
-Wed Jan 14 16:45:24 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* re.c (reg_search): does not save registers unless $& etc appear
+	  in the script.
 
-	* tool/downloader.rb (RubyGems.download): verify downloaded gem
-	  packages.  LowSecurity to allow untrusted certificates now.
+Mon Nov 17 13:01:43 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Wed Jan 14 15:43:48 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* eval.c (is_defined): add defined? check for receivers and
+ 	  arguments for calls.
 
-	* ext/readline/readline.c (readline_s_refresh_line): initialize
-	  before rl_refresh_line(), as some function make the internal
-	  state non-clean but rl_refresh_line() does not re-initialize it.
-	  [ruby-core:43957] [Bug #6232]
+	* re.c (reg_search): cache last match object.
 
-Tue Jan 13 21:59:24 2015  Michal Papis  <mpapis@gmail.com>
+	* re.c (match_aref): $[0] etc. are available.
 
-	* tool/rbinstall.rb (gem): fix changing permissions of installed
-	  bundled gems.  [Fix GH-812]
+Sat Nov 15 00:11:36 1997  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
 
-Tue Jan 13 21:57:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* io.c (io_s_popen): "rb" detection
 
-	* common.mk (distclean-local): remove autom4te.cache generated by
-	  autoconf.
+Fri Nov 14 18:28:40 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* common.mk (realclean-local): remove id sources and dummy header
-	  for dtrace.  [ruby-core:67562] [Bug #10737]
+	* string.c (scan_once): returns whole match if the pattern does
+	  not contain any parentheses.
 
-Tue Jan 13 21:08:22 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+Thu Nov 13 14:39:06 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* ext/json, test/json: merge JSON HEAD(259dee6)
-	  separate implementation of Typed_Data macro.
-	  https://github.com/flori/json/compare/v1.8.1...v1.8.2
+	* string.c (str_sub): returns copy of the receiver string, even if 
+	  any substitution occurred.
 
-Tue Jan 13 14:16:35 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* regex.c (re_compile_pattern): no-width match by (?=..), (?!..).
 
-	* test/net/http/test_http.rb: get rid of accessing DNS actually
-	  for some servers returning wrong results.
-	  [ruby-core:67454] [Bug #10721]
+Wed Nov 12 13:44:47 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Mon Jan 12 23:21:57 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* time.c: remove coerce from Time class.
 
-	* gems/bundled_gems: update test-unit to 3.0.9.
+	* regex.c (re_match): non-greedy match by ??, *? +?, {n,m}?.
 
-Mon Jan 12 18:35:44 2015  Eric Wong  <e@80x24.org>
+Mon Nov 10 11:24:51 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* numeric.c (bit_coerce): use original value for error message
-	  [ruby-core:67405] [Bug #10711]
-	* test/ruby/test_numeric.rb (test_coerce): check error message
+	* regex.c (re_compile_pattern): non-resitering parens (?:..).
 
-Mon Jan 12 18:01:24 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* regex.c (re_compile_pattern): new meta character \< (wordbeg)
+	  and \> (wordend).
 
-	* lib/rdoc/text.rb (expand_tabs): get rid of infinite loop with
-	  CR.  should check if substitution occurred too.
-	  [ruby-dev:48813] [Bug #10732]
+	* regex.c (re_compile_pattern): embedded comment for regular
+	  expression by (?#...).
 
-Mon Jan 12 16:45:46 2015  Seiei Higa  <hanachin@gmail.com>
+Fri Nov  7 16:58:24 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* vm_method.c (rb_alias): raise a NameError when creating alias to
-	  a refined method if the original method of the refined method is
-	  not defined.  [ruby-core:67523] [Bug #10731]
+	* regex.c (re_compile_pattern): perl5 regxp \A and \Z available.
 
-Mon Jan 12 13:53:17 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+	* regex.c (re_compile_pattern): can expand compile stack dynamically.
 
-	* math.c (math_atan2): improve documentation.
-	  [Feature #10323][ruby-core:65400][ci skip]
+	* regex.c (PUSH_FAILURE_POINT): wrong compare condition.
 
-Mon Jan 12 13:50:49 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+Wed Nov  2 16:00:00 1997  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
 
-	* ext/bigdecimal/bigdecimal.c: fixes documentation like labeled lists,
-	  code examples etc. [ruby-core:66730][Bug #10576][ci skip]
+	* string.c (str_sub_s): "".sub! "", "" => "\000"
 
-Mon Jan 12 13:36:44 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+Fri Oct 31 15:52:10 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* lib/optparse.rb: improvements for OptionParser documentation.
-	  [misc #10608][ruby-core:66901][ci skip]
+	* parse.y (assoc): keyword assoc like {fg->"black"}.
 
-Mon Jan 12 13:33:52 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+Thu Oct 30 17:33:38 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* array.c (rb_ary_each): documented return value.
-	  [misc #10469][ruby-core:66063]
+	* io.c (io_println): print with newline, which is not affected by
+	  the values of $/ and $\.
 
-Sun Jan 11 15:11:38 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Oct 30 16:54:01 1997  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
 
-	* test/webrick/test_utils.rb (test_create_listeners): use
-	  dynamically chosen port number, not hardcoded port number.
-	  [ruby-core:67508]
+	* string.c (str_chop_bang): "".chop caused SEGV.
 
-Sat Jan 10 12:57:12 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+	* string.c (str_chomp_bang): method to chop out last newline.
 
-	* ext/zlib/zlib.c: fix document of method signatures.
-	  [Bug #10668][ruby-core:67186][ci skip]
+Mon Oct 27 13:49:13 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Sat Jan 10 12:32:44 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* ext/extmk.rb.in: library may have pathname contains `.'
 
-	* eval_error.c (error_print): pos and len parameters of rb_str_substr()
-	  are counted by characters, not bytes.  use rb_str_subseq() instead.
-	  [Bug #10727] [ruby-core:67473]
+	* eval.c (rb_rescue): should not protect SystemError.
 
-Sat Jan 10 10:58:55 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+Fri Oct 24 10:58:53 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* complex.c: removed commented-out code.
+	* io.c (io_s_with_open_stream): ensures to close stream.
 
-Sat Jan 10 10:57:19 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+Thu Oct 23 11:17:44 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* rational.c: removed commented-out code.
-	  [Feature #10376][ruby-core:65643]
+	* io.c (io_errset): value of $stderr can be changed (to any IO
+ 	  object).
 
-Sat Jan 10 10:12:15 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* io.c (next_argv): $< can be anything that responds to `write'.
 
-	* array.c (rb_ary_select_bang): keep the array consistent by
-	  removing unselected values soon.  [ruby-dev:48805] [Bug #10722]
+	* file.c (file_s_with_open_file): ensures to close file.
 
-Fri Jan  9 23:20:04 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+	* error.c (exception): create error under the current class/module.
 
-	* lib/rubygems:  Update to RubyGems HEAD(e53c54a).
-	* test/rubygems:  ditto.
+	* range.c (range_eqq): fixnum check for last needed too.
 
-Fri Jan  9 11:13:01 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Oct 22 12:52:30 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* parse.y (assocs, assoc): eliminate splatting empty literal
-	  hashes.  [ruby-core:67446] [Bug #10719]
+	* ext/socket/socket.c: Socket::Constants added.
 
-	* compile.c (compile_array_): support splatted hash in hash type.
+	* file.c: File::Constants added for inclusion.
 
-Fri Jan  9 10:57:09 2015  Vit Ondruch  <vondruch@redhat.com>
+	* array.c (ary_join): call ary_join() recursively for the 1st
+ 	  array element.
 
-	* configure.in (RUBY_SETJMP_TYPE): Remove superfluous semicolon
-	  which causes a syntax error with autoconf 2.63.
-	  [ruby-core:67429] [Bug #10716]
+Mon Oct 20 12:18:29 1997  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
 
-Fri Jan  9 07:23:32 2015  Aaron Patterson <aaron@tenderlovemaking.com>
+	* ruby.c (load_file): wrong condition for #! check with -x.
 
-	* ext/psych/lib/psych/visitors/yaml_tree.rb: correctly quote non-ascii
-	  letters. Thanks @jirutka for the patch.
+	* file.c (file_s_dirname): did return "" for "/a".
 
-	* test/psych/test_string.rb: test for change
+Fri Oct 17 14:29:09 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Fri Jan  9 07:13:55 2015  Aaron Patterson <aaron@tenderlovemaking.com>
+	* ruby.c: now works on alpha-linux.
 
-	* ext/psych/lib/psych/visitors/to_ruby.rb: call `allocate` on hash
-	  subclasses.  Fixes github.com/tenderlove/psych/issues/196
+	* bignum.c (bigadd): some undefined side effect order assumed.
 
-	* test/psych/test_hash.rb: test for change
+Wed Oct 15 17:49:24 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Fri Jan  9 06:58:43 2015  Aaron Patterson <aaron@tenderlovemaking.com>
+	* intern.h: function prototypes added.
 
-	* ext/psych/lib/psych/visitors/to_ruby.rb: revive hashes with ivars
+Mon Oct 13 16:54:18 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* ext/psych/lib/psych/visitors/yaml_tree.rb: dump hashes with ivars.
-	  Fixes github.com/psych/issues/43
+	* class.c (rb_define_class_id): call superclass's `inherited'
+ 	  method when making subclasses.
 
-	* test/psych/test_hash.rb: test for change
+	* parse.y (nextc): clear lex_lastline at the end of file.
 
-Thu Jan  8 17:05:00 2015  Seiei Higa  <hanachin@gmail.com>
+	* object.c (Init_Object): need to undef Class#append_features.
 
-	* vm_method.c (rb_method_entry): if no super class, no original
-	  method entry.  [ruby-core:67389] [Bug #10707]
+	* eval.c (rb_eval): no warning on extending classes or modules.
 
-Thu Jan  8 16:31:43 2015  Seiei Higa  <hanachin@gmail.com>
+Thu Oct  9 11:17:50 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* vm_method.c (rb_export_method): bail out if the original method
-	  is undefined when the method is refined.
-	  [ruby-core:67387] [Bug #10706]
+	* eval.c (error_print): the exception name follows after the error 
+	  message.
 
-Thu Jan  8 12:53:44 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* eval.c (compile_error): error message slightly changed.
 
-	* dir.c (glob_helper): match in case-folding only if the directory
-	  resides on a case-insensitive file system, on OSX.
-	  [ruby-core:67364] [Bug #10700]
+	* parse.y (nextc): script parsing will be terminated by __END__ at
+ 	  beginning of line.
 
-Thu Jan  8 11:39:18 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+	* eval.c (compile_error): `__END__' is no longer a keyword.
 
-	* .travis.yml: Remove redundant configuration option.
-	  [fix GH-809] Patch by @gxworld
+	* parse.y (nextc): protect lastline read from script stream.
 
-Thu Jan  8 07:17:14 2015  Eric Wong  <e@80x24.org>
+Tue Oct  7 14:06:06 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* lib/resolv.rb: consider ENETUNREACH as ResolvTimeout
-	  [ruby-core:67411] [Bug #10712]
+	* version 1.1 alpha9 released.
 
-Thu Jan  8 00:13:52 2015  Tanaka Akira  <akr@fsij.org>
+	* eval.c (mod_append_features): renamed from extend_class.
 
-	* lib/open3.rb: Open3 properly passes non-keyword hash args to spawn.
-	  Fixed by Josh Cheek.  [Fix GH-808]
-	  Related to [ruby-core:67347] [Bug #10699]
+	* eval.c (rb_eval): defining method calls `method_added'.
 
-Wed Jan  7 19:19:26 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* eval.c (ruby_options): exception while processing options must
+	  terminate the interpreter.
 
-	* dir.c (dir_initialize): workaround of opendir failure at symlink
-	  directories on Windows via CIFS.
+	* error.c (Init_Exception): wrong method configuration.  `new'
+	  should have been a singleton method.
 
-Wed Jan  7 18:52:50 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon Oct  6 18:55:38 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* dir.c (need_normalization): not only HFS+, CIFS (SMB) is also
-	  decomposed.  [Bug #10704]
+	* ext/kconv/kconv.c (kconv_guess): code to guess character code
+	  from string.
 
-	* dir.c (NORMALIZE_UTF8PATH): Unicode decomposition seems to
-	  perform in an upper layer than file systems on OSX, as all path
-	  names are always decomposed regardless of file system types.
+Mon Oct  6 18:38:17 1997  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
 
-Tue Jan  6 21:41:04 2015  Tanaka Akira  <akr@fsij.org>
+	* pack.c: now encode/decode base64 by `m' template.
 
-	* time.c (timelocalw): Set tm_isdst field -1 if vtm->isdst is
-	  VTM_ISDST_INITVAL.  This bug is introduced at packing struct
-	  vtm (r45155).
-	  [ruby-core:67345] [Bug #10698] Reported by Boris Ruf.
+Fri Oct  3 10:51:10 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Tue Jan  6 03:10:54 2015  Koichi Sasada  <ko1@atdot.net>
+	* MANIFEST: needed to include lex.c in the distribution.
 
-	* test/fiddle/test_handle.rb: fix syntax.
+	* eval.c (ruby_options): f_require() called too early.
 
-Tue Jan  6 00:16:10 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* eval.c (rb_provide): module extentions should always be `.o'.
 
-	* test/fiddle/test_handle.rb (test_NEXT): use -test-/dln/empty
-	  which is always a shared object and is not used by others.
-	  [ruby-dev:48629] [Bug #10384]
+Thu Oct  2 11:38:31 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Mon Jan  5 14:58:01 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+	* version 1.1 alpha8 released.
 
-	* test/ruby/test_io.rb: added timeout for AIX environment.
-	  [ruby-core:62983][Bug #9917]
+	* ext/marshal/marshal.c (r_object): remove temporal regist for
+ 	  structs. (caused problem if structs form cycles.)
 
-Sun Jan  4 22:33:33 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* parse.y (match_gen): static binding for match(=~) calls
+	  with regexp literals.
 
-	* test/lib/test/unit.rb (ExcludesOption): add "excludes" support
-	  to test suite, for alternative implementations and platforms.
-	  [Feature #10682]
+Wed Oct  1 15:26:55 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Sun Jan  4 22:32:42 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* eval.c: protect retval in struct tag from GC for C_ALLOCA.
 
-	* test/lib/test/unit.rb (Test::Unit): reorder modules and merge
-	  each modules.
+	* eval.c: no more pointer value from setjmp/longjmp.
 
-	* test/lib/test/unit.rb (Test::Unit): split the large class into
-	  each modules.
+Wed Oct  1 14:01:49 1997  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
 
-Sun Jan  4 21:32:52 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/marshal/marshal.c (w_byte): argument must be char.
 
-	* parse.y (f_label): return tLABEL value as it is.
-	  [ruby-core:67315] [Bug #10693]
+Wed Oct  1 10:30:22 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Sun Jan  4 14:02:37 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* variable.c (mod_const_at): global constants now belongs to the
+	  class Object.
 
-	* test/lib/test/unit/parallel.rb (run): expand the file name to be
-	  loaded, so that relative paths work in parallel mode.
+	* object.c (Init_Object): new global constant NIL.
 
-Sun Jan  4 13:36:56 2015  Ayumu AIZAWA  <ayumu.aizawa@gmail.com>
+	* ext/marshal/marshal.c (marshal_dump): try to set binmode.
 
-	* test/test_tempfile.rb: use assert_file for more descriptive message.
-	  following r49131.
+	* ext/marshal/marshal.c (r_object): forgot to re-regist structs in 
+	  the object table.
 
-Sun Jan  4 13:05:09 2015  Ayumu AIZAWA  <ayumu.aizawa@gmail.com>
+	* eval.c (ruby_options): call Init_ext() before any require()
+ 	  calls by `-r'.
 
-	* string.c: improve docs for String#<=>. [ruby-core:65399][Feature #10322]
-	  Patch by gogo tanaka.
+Fri Sep 30 14:29:22 1997  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
 
-Sun Jan  4 12:42:24 2015  Ayumu AIZAWA  <ayumu.aizawa@gmail.com>
+	* ext/marshal/marshal.c (w_object): marshal dumped core.
 
-	* array.c: improve docs for Array#reject. [ruby-core:65324][misc #10307]
-	  Patched by Nebu Pookins.
+Tue Sep 30 10:27:39 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Sun Jan  4 12:24:11 2015  Ayumu AIZAWA  <ayumu.aizawa@gmail.com>
+	* sample/test.rb: bignum test suits added.
 
-	* string.c: improve docs for String#strip and variations.
-	  [ruby-core:66081][Bug #10476]
+	* eval.c (rb_eval): new pseudo variable `true' and `false'.
 
-Sun Jan  4 09:21:04 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+	* parse.y: new keywords `true' and `false' added.
 
-	* lib/drb/drb.rb: removed unused argument. Patch by @vipulnsward
-	  [fix GH-515]
+Mon Sep 29 13:37:58 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Sun Jan  4 09:18:31 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+	* ruby.c (forbid_setid): forbid some options in suid mode.
 
-	* lib/tempfile.rb: provide default basename parameter.
-	  [fix GH-523] Patch by @dissolved
-	* test/test_tempfile.rb: ditto.
+	* ruby.h (NUM2DBL): new macro to convert into doubles.
 
-Sun Jan  4 00:43:41 2015  Ayumu AIZAWA  <ayumu.aizawa@gmail.com>
+Mon Sep 27 09:53:48 1997  EGUCHI Osamu  <eguchi@shizuokanet.or.jp>
 
-	* README.ja.md: add guidance of mailing list and bugs.r-l.o.
+	* bignum.c: modified for speeding.
 
-Sat Jan  3 23:56:28 2015  Ayumu AIZAWA  <ayumu.aizawa@gmail.com>
+Fri Sep 26 18:27:59 1997  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
 
-	* hash.c: fix docs for Hash#invert. [ruby-core:66917] [Bug #10612]
+	* sample/from.rb: some extensions.
 
-Sat Jan  3 19:52:12 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon Sep 29 13:15:56 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* include/ruby/intern.h (rb_str_new_literal): define on all
-	  platforms, not only gcc.
+	* parse.y (lhs): no more syntax error on `obj.CONSTANT = value'.
 
-Sat Jan  3 18:53:28 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Sep 26 14:41:46 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* ext/fiddle/lib/fiddle/cparser.rb (parse_ctype): limit split word
-	  number as the rest are not used.
+	* eval.c (ruby_run): deferred calling Init_ext() just before eval_node.
 
-Sat Jan  3 18:19:50 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+Fri Sep 26 13:27:24 1997  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
 
-	* ext/fiddle/lib/fiddle/cparser.rb: r49110 broke Fiddle::Import with
-	  type_alias.
-	* test/fiddle/test_cparser.rb: added type_alias test for parse_ctype
-	  and parse_struct_signature.
+	* io.c (io_isatty): forgot to return TRUE value.
 
-Sat Jan  3 11:50:16 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+Fri Sep 25 11:10:58 1997  EGUCHI Osamu  <eguchi@shizuokanet.or.jp>
 
-	* ext/openssl/ossl.h: avoid to build failure of Windows environment.
-	* ext/openssl/ossl_ssl_session.c: ditto.
+	* eval.c: use _setjmp/_longjmp instead of setjmp/longjmp on some
+	  platforms.
 
-Sat Jan  3 11:27:46 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+Wed Sep 24 17:43:13 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* array.c: Improve performance of Array#shift. use shared instead of
-	  MEMMOVE if with arguments. Patch by @ksss [fix GH-537]
-	* test/ruby/test_array.rb: ditto.
-	* benchmark/bm_array_shift.rb: Added benchmark of GH-537 issue.
+	* string.c (Init_String): String#taint and String#taint? added.
 
-Sat Jan  3 10:38:52 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+	* class.c (mod_ancestors): ancestors include the class itself.
 
-	* lib/net/http.rb: More descriptive error message when net/http fails
-	  to connect to a server. Patch by @xaviershay [fix GH-700]
-	* test/net/http/test_http.rb: ditto.
+Wed Sep 24 00:57:00 1997  Katsuyuki Okabe  <HGC02147@niftyserve.or.jp>
 
-Sat Jan  3 10:14:51 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+	* X68000 patch.
 
-	* ext/openssl/ossl.h: Make `SSL_SESSION_cmp` use `CRYPTO_memcmp`
-	  [fix GH-591] Patch by @PiPeep
-	* ext/openssl/ossl_ssl_session.c: ditto.
+Tue Sep 23 20:42:30 1997  EGUCHI Osamu  <eguchi@shizuokanet.or.jp>
 
-Sat Jan  3 09:54:32 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+	* parse.y (node_newnode): SEGV on null node setup.
 
-	* ext/fiddle/lib/fiddle/cparser.rb: Support for Fiddle::CParser
-	  to handle rich signatures including parameter names and function
-	  pointer types. Patch by @theryan [fix GH-590]
-	* test/fiddle/test_cparser.rb: ditto.
+Mon Sep 22 11:22:46 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Sat Jan  3 09:01:43 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+	* ruby.c (ruby_prog_init): wrong safe condition check.
 
-	* NEWS: added compatibility entry of r49101.
+Sun Sep 21 14:46:02 1997  MAEDA shugo  <shugo@po.aianet.ne.jp>
 
-Fri Jan  2 21:06:59 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+	* error.c (exc_inspect): garbage added to classpath.
 
-	* lib/net/http.rb (Net::HTTP#send_request): there is no response body
-	  with HEAD request. Patch by @rodrigosaito [fix GH-520]
+Fri Sep 19 11:49:23 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Fri Jan  2 21:04:36 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+	* parse.y (newtok): forgot to adjust buffer size when shrinking
+	  the token buffer.
 
-	* test/net/http/test_http.rb (_test_send_request__HEAD): Added
-	  failing test for send_request with HEAD method.
+	* enum.c (enum_find): rb_eval_cmd() does not return value.
 
-Fri Jan  2 18:41:20 2015  Tanaka Akira  <akr@fsij.org>
+	* io.c (pipe_open): close fds on pipe exec. fcntl(fd, F_SETFD, 1)
+	  no longer used.
 
-	* eval.c (ruby_init): Print ruby_setup() error only in debug mode.
-	  Unsuppressable error message is not a good idea.
-	  Note that the message is printed sometimes with following
-	  code (highly timing dependent, though):
-	  pid = spawn("ruby -e ''"); Process.kill(:TERM, pid)
+Tue Sep 16 17:54:25 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Fri Jan  2 16:18:44 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+	* file.c (f_test): problem if wrong command specified.
 
-	* test/ruby/test_module.rb: Refactor invalid testcase.
-	  [fix GH-472][ruby-core:59035][Bug #9240]
+	* ruby.c (ruby_prog_init): close stdaux and stdprn for MSDOS.
 
-Fri Jan  2 15:53:00 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+	* ruby.c (ruby_prog_init): should not add path from environment
+	  variable, if ruby is running under seuid.
 
-	* lib/webrick/utils.rb: removed unused argument variable.
-	  [fix GH-356] Patch by @vipulnsward
-	* lib/webrick/server.rb: ditto.
-	* lib/webrick/ssl.rb: ditto.
-	* test/webrick/test_utils.rb: added test for WEBrick::Utils#create_listeners.
+	* process.c (init_ids): check suid check for setuid/seteuid etc.
 
-Fri Jan  2 15:35:53 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+Mon Sep 15 00:42:04 1997  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
 
-	* lib/securerandom.rb: improve syntax and grammar of documentation.
-	  [fix GH-796][ci skip] Patch by @Erol
+	* regex.c (re_compile_pattern): \w{3} and \W{3} did not work.
 
-Fri Jan  2 15:10:01 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+Thu Sep 11 10:31:48 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* test/openssl/test_ssl_session.rb (OpenSSL#test_ctx_client_session_cb):
-	  fix test failure with OpenSSL disabled SSLv3 protocol.
-	  [ruby-core:63772] [Bug #10046]
+	* version 1.1 alpha7 released.
 
-Fri Jan  2 09:08:31 2015  Tanaka Akira  <akr@fsij.org>
+	* ext/socket/socket.c (sock_new): no setbuf() for NT.
 
-	* lib/resolv.rb (Resolv::DNS::Label::Str#==): Check class equality.
-	  (Resolv::DNS::Name#initialize): Normalize labels as
-	  Resolv::DNS::Label::Str objects.
+	* io.c (rb_fopen,rb_fdopen): set close-on-exec for every fd.
 
-Thu Jan  1 21:41:49 2015  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+Wed Sep 10 15:55:31 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* doc/regexp.rdoc: fix regexp docs for whitespace character.
-	  [ruby-dev:48765] [Bug #10624]
+	* ext/marshal/marshal.c (r_bytes0): extra big length check.
 
-Thu Jan  1 17:50:52 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Sep  9 16:27:14 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* test/ruby/test_rubyoptions.rb: try locale encoding name.
-	  [ruby-core:67109] [Bug #10643]
+	* io.c (pipe_fptr_atexit): clean up popen()'ed fptr.
 
-Thu Jan  1 11:07:12 2015  Eric Wong  <e@80x24.org>
+	* error.c (set_syserr): some system has error code that is bigger
+	  than sys_nerr. grrr.
 
-	* symbol.c (rb_gc_free_dsymbol): delete from global fstr hash
-	* test/ruby/test_symbol.rb (test_symbol_fstr_leak): test for bug
-	  [ruby-core:67268] [Bug #10686]
+Mon Sep  8 18:33:33 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Thu Jan  1 09:14:21 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* io.c (io_s_new): dereferenced nil for optional mode.
 
-	* vm_args.c (keyword_hash_p): fix non-symbol keys hash.
-	  rb_extract_keywords() returns 0 not Qnil when no symbol keys is
-	  included.  [ruby-core:67264] [Bug #10685]
+Fri Sep  5 10:26:03 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Wed Dec 31 17:48:43 2014  Tanaka Akira  <akr@fsij.org>
+	* class.c (class_instance_methods): do not include methods which
+	  are changed to private in subclasses.
 
-	* lib/resolv.rb (Resolv::DNS::Label::Str#initialize): Set encoding
-	  ASCII-8BIT before downcase.  case insensitivity of DNS labels doesn't
-	  apply non-ASCII characters.  [RFC 4343]
+Thu Sep  4 12:38:53 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Wed Dec 31 16:48:44 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* variable.c (f_global_variables): list name of the global
+	  variables.
 
-	* parse.y (gettable_gen): disable warnings of possible reference
-	  to a local variable defined in a past scope.
-	  [ruby-core:67162] [Bug #10661]
+	* object.c (obj_id): returns unique integer.
 
-Wed Dec 31 13:43:48 2014  Tanaka Akira  <akr@fsij.org>
+Wed Sep  3 14:05:16 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* lib/resolv.rb (Resolv::DNS::Name#==): Compare an array of Label:Str
-	  objects.  Label#Str#== is case-insensitive.
+	* version 1.1 alpha6 released.
 
-Tue Dec 30 16:16:12 2014  Ben Miller  <bmiller@rackspace.com>
+	* eval.c (mod_s_constants): context sensitive constant list.
 
-	* lib/resolv.rb (Resolv::DNS::Name#==): DNS is case-insensitive, so the
-	  comparison should be case-insensitive as well.
-	  [ruby-core:66498] [Bug #10550]
+	* variable.c (mod_constants): no more `all' option.
 
-Tue Dec 30 16:03:45 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* variable.c (mod_const_of): the values for autoload classes are
+	  their name strings.
 
-	* lib/resolv.rb (Resolv::DNS::Name): names with different dots
-	  should be different.
+	* class.c (class_instance_methods): no special treatment for
+	  singleton classes.
 
-Tue Dec 30 13:16:56 2014  Martin Duerst  <bernhard+git@lsmod.de>
+	* object.c (obj_singleton_methods): returns list of singleton
+	  method names.
 
-	* lib/uri/common.rb: Initialize HTML5ASCIIINCOMPAT to empty Array
-	  to avoid error during bootstrap when encodings are not yet defined.
-	  [Bug #10678]
+	* parse.y (yylex): no here document after `class' keyword.
 
-Tue Dec 30 09:29:26 2014  Bernhard M. Wiedemann  <bernhard+git@lsmod.de>
+	* eval.c (f_load): expand path if fname begins with `~'.
 
-	* ext/dbm/dbm.c (Init_dbm): [DOC] as UNIX permissions are octal
-	  numbers, needs to be prefixed by 0.  [Fix GH-800]
+Tue Sep  2 13:19:48 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Tue Dec 30 08:57:39 2014  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+	* class.c (ins_methods_i): do not list undef'ed methods.
 
-	* lib/unicode_normalize.rb: typo fix. [ci skip]
-	  [ruby-dev:48794][misc #10675]
+Mon Sep  1 13:42:48 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Mon Dec 29 19:38:01 2014  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* version 1.1 alpha5 released.
 
-	* version.h (RUBY_VERSION): 2.3.0 development has started.
+	* object.c (mod_attr_reader): create methods to define attribute
+ 	  reader/write/accessor.
 
-Mon Dec 29 18:58:46 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* class.c (rb_define_attr): always defines accessors.
 
-	* re.c (unescape_nonascii): append escape sequence as-is not
-	  unescaped character, to get rid of unexpected meta-character.
-	  [ruby-core:67193] [Bug #10670]
+	* eval.c (rb_call): alias occured in the module body caused SEGV.
 
-Mon Dec 29 14:27:33 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* parse.y: did not generate here document strings properly.
 
-	* doc/syntax/literals.rdoc (Symbols): now Symbols created by
-	  interpolation can be garbage collected.  patch by Yihang Ho in
-	  [ruby-core:67194].  [Bug #10671]
+Mon Sep  1 11:43:57 1997  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
+	
+	* parse.y (yylex): heredoc dropped an extra character.
 
-Mon Dec 29 11:18:17 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Aug 29 11:10:21 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* thread.c (rb_thread_variable_get): fix dynamic symbol keys.
-	  rb_check_id() returns non-zero only for static symbols, whereas
-	  thread local variable keys can be dynamic symbols.
-	  [ruby-core:67185] [Bug #10667]
+	* class.c (class_instance_methods): same method names should not
+ 	  appear more than twice.
 
-Mon Dec 29 10:37:27 2014  Thiago Lewin  <thiago_lewin@yahoo.com.br>
+	* parse.y (yylex): spaces can follow =begin/=end.
 
-	* io.c (rb_f_select): [DOC] workaround for YARD doc.  [Fix GH-799]
+	* variable.c (find_class_path): look for class_tbl also for
+	  unnamed fundamental classes, such as Object, String, etc.
 
-	* process.c (proc_detach): [DOC] fix missing closing parenthesis.
-	  [Fix GH-799]
+	* variable.c (rb_name_class): can't name class before String class
+ 	  is initilialized.
 
-Mon Dec 29 07:27:23 2014  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+	* inits.c (rb_call_inits): unrecognized dependency from GC to
+	  Array.
 
-	* ext/json, test/json: merge JSON HEAD(17fe8e7)
-	  https://github.com/flori/json/compare/v1.8.1...17fe8e7
+	* variable.c (find_class_path): could not find class if Object's
+ 	  iv_tbl is NULL.
 
-Sun Dec 28 23:49:37 2014  Michal Papis  <mpapis@gmail.com>
+Thu Aug 28 13:12:05 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* rbinstall.rb: fix target location for installing bundled gems.
-	  install to the prepared directory instead of default Gem.dir,
-	  not to be affected GEM_HOME environment variable.  [Fix GH-798]
+	* version 1.1 alpha4 released.
 
-Sun Dec 28 18:19:28 2014  Eric Wong  <e@80x24.org>
+	* variable.c (mod_constants): wrong condition for singleton
+	  class. 
 
-	* test/-ext-/iseq_load/test_iseq_load.rb
-	  (test_next_in_block_in_block): test using ISeq#eval
-	  (test_break_ensure): ditto
-	  [ruby-core:66988]
+	* parse.y (yylex): revised `=begin' skip code.
 
-Sun Dec 28 16:25:12 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* parse.y (here_document): forgot to free(eos).
 
-	* cygwin/GNUmakefile.in (EXTOBJS): override to add resource files
-	  always.  [ruby-core:67153] [Bug #10657]
+	* parse.y (yylex): spaces after `<<' prohibited for here
+ 	  documents to avoid confusing with operator `<<'.
 
-Sun Dec 28 13:54:26 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* eval.c (is_defined): separated from rb_eval().
 
-	* parse.y (f_kwrest, new_args_tail_gen): unnamed rest keyword and
-	  keywords bits arguments should be unique.  since internal IDs
-	  depend on the local variable index in the current scope, new ID
-	  should be made before popping those vtables.
-	  [ruby-core:67157] [Bug #10659]
+Wed Aug 27 11:32:42 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Sat Dec 27 20:12:55 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* version 1.1 alpha3 released.
 
-	* ext/json/generator/generator.c (JSON_Generator_State_type): add
-	  #ifdef for backward compatibility.
+	* variable.c (mod_name): returns name of the class/module.
 
-	* ext/json/parser/parser.rl (JSON_Parser_type): ditto.
+	* parse.y (here_document): finally here document available now.
 
-	* ext/json/generator/generator.h (ZALLOC): add fallback definition.
+	* variable.c (fc_i): some classes/modules does not have iv_tbl.
 
-	* ext/json/parser/parser.h (ZALLOC): ditto.
+	* variable.c (find_class_path): avoid inifinite loop.
 
-Sat Dec 27 16:54:05 2014  Tanaka Akira  <akr@fsij.org>
+Tue Aug 26 13:43:47 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* process.c: Unused code removed.
-	  It seems waitpid() is universally available on POSIX platforms.
+	* eval.c (rb_eval): undef'ing non-existing method will raise
+	  NameError exception.
 
-Sat Dec 27 15:08:27 2014  Eric Wong  <e@80x24.org>
+	* object.c (class_s_new): needed to create metaclass too.
 
-	* vm_core.h (rb_vm_living_threads_insert): preserve order
-	  [Bug #10660] [ruby-core:67154] [ruby-core:67159]
+	* eval.c (error_print): no class name print for anonymous class.
 
-Sat Dec 27 13:08:20 2014  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+	* eval.c (rb_longjmp): proper exception raised if raise() called
+ 	  without arguments, with $! or $@ set.
 
-	* ext/socket/socket.c: improved document for YARD doc.
-	  [fix GH-795][ci skip] Patch by @tlewin
+	* object.c (Init_Object): superclass()'s method argument setting
+ 	  was wrong again.
 
-Sat Dec 27 10:11:21 2014  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+	* class.c (mod_anscestors): list superclasses and included modules 
+	  in priority order.
 
-	* ext/tk/lib/tkextlib/tcllib/plotchart.rb: fix to invoke correct function
-	  of tcllib. Patch by @zalt50 [fix GH-787]
+Mon Aug 25 11:53:11 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Sat Dec 27 10:03:41 2014  SHIBATA Hiroshi  <shibata.hiroshi@gmail.com>
+	* version 1.1 alpha2 released.
 
-	* tool/make-snapshot: show sha1 digest when making packages.
-	  it's request from https://github.com/ruby/www.ruby-lang.org/issues/921
-	  [fix GH-794]
+	* sample/ruby-mode.el (ruby-parse-region): auto-indent now
+ 	  supports "\\" in the strings.
 
-Fri Dec 26 15:32:16 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* struct.c (struct_getmember): new API to get member value from C
+	  language side.
 
-	* ext/tk/tcltklib.c (ip_invoke_core): remove probably duplicate
-	  dead code.
+Sat Aug 23 21:39:05 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Fri Dec 26 15:28:27 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* parse.y (asignable): remove unnecessary local variable
+	  initialize by nil.
 
-	* ext/tk/tcltklib.c (ip_ruby_cmd_receiver_const_get): simply use
-	  rb_path2class() to get a class/module from its name.
+Fri Aug 22 14:26:40 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Fri Dec 26 15:20:54 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* eval.c (error_print): modified exception print format.
 
-	* marshal.c (w_long): append at once by w_nbyte() instead of
-	  appending byte by byte.
+Thu Aug 21 16:10:58 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Fri Dec 26 15:13:13 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* sample/ruby-mode.el (ruby-calculate-indent): wrong indent level
+	  calculated with keyword operators.
 
-	* ext/json/parser/parser.rl (unescape_unicode): check if valid
-	  before bit-or assignments.
-	  reported by Denis Denisov <denji0k AT gmail.com>.
+Thu Aug 21 11:36:58 1997  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
 
-	* ext/nkf/nkf-utf8/nkf.c (nkf_iconv_t): fix a missing semicolon.
-	  reported by Denis Denisov <denji0k AT gmail.com>.
+	* parse.y (arg): ary[0] += 1 cause SEGV
 
-	* process.c (rb_spawn_process): get rid of usage of uninitialized
-	  variable.
-	  reported by Denis Denisov <denji0k AT gmail.com>.
+Wed Aug 20 17:28:50 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* regexec.c (match_at): ditto.
+	* ruby.c (ruby_process_options): require() all modules after
+ 	  processing all options
 
-	* ext/win32ole/win32ole.c (ole_wc2mb_alloc, ole_vstr2wc, ole_mb2wc):
-	  ditto.
+	* process.c (rb_proc_exec): more security checks added.
 
-	* dir.c (ruby_glob0): no need to check never-NULL pointer.
-	  reported by Denis Denisov <denji0k AT gmail.com>.
+	* process.c (rb_proc_exec): insecure path on exec.
 
-	* win32/file.c (rb_file_expand_path_internal): ditto.
+	* hash.c (f_getenv): PATH modification security check.
 
-	* win32/file.c (code_page_i): handle realloc failure.
-	  reported by Denis Denisov <denji0k AT gmail.com>.
+Tue Aug 19 00:15:38 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* win32/stub.c (stub_sysinit): ditto.
+	* version 1.1 alpha1 released.
 
-	* fix printf format conversion specifiers.
-	  reported by Denis Denisov <denji0k AT gmail.com>.
+	* eval.c (mod_eval): work as normal eval() if second binding
+ 	  argument given.
 
-Fri Dec 26 01:41:40 2014  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* eval.c (rb_call): did not raise ArgumentError if too many
+ 	  arguments more than optional arguments (without rest arg).
 
-	* tool/rbinstall.rb: skip installing bundle gems if zlib is unavailable.
-	  [Bug #10647] [ruby-dev:48787]
+	* eval.c (rb_eval): did not work well for op_asgn2 (attribute
+	  self assignment).
 
-Fri Dec 26 01:24:42 2014  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* eval.c (Init_Thread): returns main thread.
 
-	* tool/downloader.rb: support old versions of ruby.
+Mon Aug 18 09:25:56 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* tool/downloader.rb: now can download gems by http if openssl is not
-	  available (this may be danger!)
+	* object.c (inspect_i): did not display T_DATA instance variables.
 
-Fri Dec 26 00:13:48 2014  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* parse.y: provides more accurate line number information.
 
-	* test/ruby/test_extlibs.rb: check existence of extension libraries
-	  which not depend on outer libraries. (experimental)
+	* eval.c (thread_value): include value's backtrace information in
+	  the variable `$@'. 
 
-Thu Dec 25 21:58:15 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* eval.c (f_abort): print backtrace and exit.
 
-	* ext/fiddle/extconf.rb: make PIC objects if it will be linked as
-	  a shared object eventually.  [ruby-core:67128]
+Sat Aug 16 00:17:44 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-Thu Dec 25 19:01:13 2014  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* eval.c (class_new_instance): do not make instance from virtual
+	  classes. 
 
-	* ext/fiddle/win32/libffi-3.2.1-mswin.patch: support mswin32.
+	* object.c (class_s_new): do not make subclass of singleton class.
 
-Thu Dec 25 17:30:40 2014  Naohisa Goto  <ngotogenome@gmail.com>
+Fri Aug 15 15:49:46 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-	* gc.c (wmap_final_func): fix memory size shortage when realloc wmap.
-	  Fix SEGV during finalize of WeakRef on Solaris (though the SEGV
-	  could occur on all OS/platforms). [ruby-dev:48779] [Bug #10646]
+	* eval.c (call_trace_func): block context switch in the trace
+          function.
 
-Thu Dec 25 17:27:06 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* eval.c (rb_eval): clear method cache at class extention.
 
-	* configure.in (NET_LUID): include winsock2.h instead of windows.h.
-	  patch by Jon Forums in [ruby-core:67125].  [Bug #10640]
+	* object.c (obj_type): returns object's class even if it defines
+	  singleton methods.
 
-Thu Dec 25 16:14:10 2014  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Aug 15 19:40:43 1997  WATANABE Hirofumi  <watanabe@ase.ptg.sony.co.jp>
 
-	* ext/io/console/console.c (console_dev): send the given arguments
-	  to the opened console.  as a special case, do nothing if :close
-	  is given.
+	* ext/socket/socket.c (Init_socket): small typo caused SEGV.
 
-	* test/lib/leakchecker.rb (LeakChecker#check_fd_leak): close if
-	  console.
+Wed Aug 13 17:51:46 1997  Yukihiro Matsumoto  <matz@netlab.co.jp>
 
-For the changes before 2.2.0, see doc/ChangeLog-2.2.0
-For the changes before 2.1.0, see doc/ChangeLog-2.1.0
-For the changes before 2.0.0, see doc/ChangeLog-2.0.0
-For the changes before 1.9.3, see doc/ChangeLog-1.9.3
-For the changes before 1.8.0, see doc/ChangeLog-1.8.0
+	* version 1.1 alpha0 released.
 
-Local variables:
-coding: us-ascii
-add-log-time-format: (lambda ()
-  (let* ((time (current-time))
-	 (system-time-locale "C")
-	 (diff (+ (cadr time) 32400))
-	 (lo (% diff 65536))
-	 (hi (+ (car time) (/ diff 65536))))
-  (format-time-string "%a %b %e %H:%M:%S %Y" (list hi lo) t)))
-indent-tabs-mode: t
-tab-width: 8
-change-log-indent-text: 2
-end:
-vim: tabstop=8 shiftwidth=2
diff --git a/GPL b/GPL
deleted file mode 100644
index d159169d10..0000000000
--- a/GPL
+++ /dev/null
@@ -1,339 +0,0 @@
-                    GNU GENERAL PUBLIC LICENSE
-                       Version 2, June 1991
-
- Copyright (C) 1989, 1991 Free Software Foundation, Inc.,
- 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA
- Everyone is permitted to copy and distribute verbatim copies
- of this license document, but changing it is not allowed.
-
-                            Preamble
-
-  The licenses for most software are designed to take away your
-freedom to share and change it.  By contrast, the GNU General Public
-License is intended to guarantee your freedom to share and change free
-software--to make sure the software is free for all its users.  This
-General Public License applies to most of the Free Software
-Foundation's software and to any other program whose authors commit to
-using it.  (Some other Free Software Foundation software is covered by
-the GNU Lesser General Public License instead.)  You can apply it to
-your programs, too.
-
-  When we speak of free software, we are referring to freedom, not
-price.  Our General Public Licenses are designed to make sure that you
-have the freedom to distribute copies of free software (and charge for
-this service if you wish), that you receive source code or can get it
-if you want it, that you can change the software or use pieces of it
-in new free programs; and that you know you can do these things.
-
-  To protect your rights, we need to make restrictions that forbid
-anyone to deny you these rights or to ask you to surrender the rights.
-These restrictions translate to certain responsibilities for you if you
-distribute copies of the software, or if you modify it.
-
-  For example, if you distribute copies of such a program, whether
-gratis or for a fee, you must give the recipients all the rights that
-you have.  You must make sure that they, too, receive or can get the
-source code.  And you must show them these terms so they know their
-rights.
-
-  We protect your rights with two steps: (1) copyright the software, and
-(2) offer you this license which gives you legal permission to copy,
-distribute and/or modify the software.
-
-  Also, for each author's protection and ours, we want to make certain
-that everyone understands that there is no warranty for this free
-software.  If the software is modified by someone else and passed on, we
-want its recipients to know that what they have is not the original, so
-that any problems introduced by others will not reflect on the original
-authors' reputations.
-
-  Finally, any free program is threatened constantly by software
-patents.  We wish to avoid the danger that redistributors of a free
-program will individually obtain patent licenses, in effect making the
-program proprietary.  To prevent this, we have made it clear that any
-patent must be licensed for everyone's free use or not licensed at all.
-
-  The precise terms and conditions for copying, distribution and
-modification follow.
-
-                    GNU GENERAL PUBLIC LICENSE
-   TERMS AND CONDITIONS FOR COPYING, DISTRIBUTION AND MODIFICATION
-
-  0. This License applies to any program or other work which contains
-a notice placed by the copyright holder saying it may be distributed
-under the terms of this General Public License.  The "Program", below,
-refers to any such program or work, and a "work based on the Program"
-means either the Program or any derivative work under copyright law:
-that is to say, a work containing the Program or a portion of it,
-either verbatim or with modifications and/or translated into another
-language.  (Hereinafter, translation is included without limitation in
-the term "modification".)  Each licensee is addressed as "you".
-
-Activities other than copying, distribution and modification are not
-covered by this License; they are outside its scope.  The act of
-running the Program is not restricted, and the output from the Program
-is covered only if its contents constitute a work based on the
-Program (independent of having been made by running the Program).
-Whether that is true depends on what the Program does.
-
-  1. You may copy and distribute verbatim copies of the Program's
-source code as you receive it, in any medium, provided that you
-conspicuously and appropriately publish on each copy an appropriate
-copyright notice and disclaimer of warranty; keep intact all the
-notices that refer to this License and to the absence of any warranty;
-and give any other recipients of the Program a copy of this License
-along with the Program.
-
-You may charge a fee for the physical act of transferring a copy, and
-you may at your option offer warranty protection in exchange for a fee.
-
-  2. You may modify your copy or copies of the Program or any portion
-of it, thus forming a work based on the Program, and copy and
-distribute such modifications or work under the terms of Section 1
-above, provided that you also meet all of these conditions:
-
-    a) You must cause the modified files to carry prominent notices
-    stating that you changed the files and the date of any change.
-
-    b) You must cause any work that you distribute or publish, that in
-    whole or in part contains or is derived from the Program or any
-    part thereof, to be licensed as a whole at no charge to all third
-    parties under the terms of this License.
-
-    c) If the modified program normally reads commands interactively
-    when run, you must cause it, when started running for such
-    interactive use in the most ordinary way, to print or display an
-    announcement including an appropriate copyright notice and a
-    notice that there is no warranty (or else, saying that you provide
-    a warranty) and that users may redistribute the program under
-    these conditions, and telling the user how to view a copy of this
-    License.  (Exception: if the Program itself is interactive but
-    does not normally print such an announcement, your work based on
-    the Program is not required to print an announcement.)
-
-These requirements apply to the modified work as a whole.  If
-identifiable sections of that work are not derived from the Program,
-and can be reasonably considered independent and separate works in
-themselves, then this License, and its terms, do not apply to those
-sections when you distribute them as separate works.  But when you
-distribute the same sections as part of a whole which is a work based
-on the Program, the distribution of the whole must be on the terms of
-this License, whose permissions for other licensees extend to the
-entire whole, and thus to each and every part regardless of who wrote it.
-
-Thus, it is not the intent of this section to claim rights or contest
-your rights to work written entirely by you; rather, the intent is to
-exercise the right to control the distribution of derivative or
-collective works based on the Program.
-
-In addition, mere aggregation of another work not based on the Program
-with the Program (or with a work based on the Program) on a volume of
-a storage or distribution medium does not bring the other work under
-the scope of this License.
-
-  3. You may copy and distribute the Program (or a work based on it,
-under Section 2) in object code or executable form under the terms of
-Sections 1 and 2 above provided that you also do one of the following:
-
-    a) Accompany it with the complete corresponding machine-readable
-    source code, which must be distributed under the terms of Sections
-    1 and 2 above on a medium customarily used for software interchange; or,
-
-    b) Accompany it with a written offer, valid for at least three
-    years, to give any third party, for a charge no more than your
-    cost of physically performing source distribution, a complete
-    machine-readable copy of the corresponding source code, to be
-    distributed under the terms of Sections 1 and 2 above on a medium
-    customarily used for software interchange; or,
-
-    c) Accompany it with the information you received as to the offer
-    to distribute corresponding source code.  (This alternative is
-    allowed only for noncommercial distribution and only if you
-    received the program in object code or executable form with such
-    an offer, in accord with Subsection b above.)
-
-The source code for a work means the preferred form of the work for
-making modifications to it.  For an executable work, complete source
-code means all the source code for all modules it contains, plus any
-associated interface definition files, plus the scripts used to
-control compilation and installation of the executable.  However, as a
-special exception, the source code distributed need not include
-anything that is normally distributed (in either source or binary
-form) with the major components (compiler, kernel, and so on) of the
-operating system on which the executable runs, unless that component
-itself accompanies the executable.
-
-If distribution of executable or object code is made by offering
-access to copy from a designated place, then offering equivalent
-access to copy the source code from the same place counts as
-distribution of the source code, even though third parties are not
-compelled to copy the source along with the object code.
-
-  4. You may not copy, modify, sublicense, or distribute the Program
-except as expressly provided under this License.  Any attempt
-otherwise to copy, modify, sublicense or distribute the Program is
-void, and will automatically terminate your rights under this License.
-However, parties who have received copies, or rights, from you under
-this License will not have their licenses terminated so long as such
-parties remain in full compliance.
-
-  5. You are not required to accept this License, since you have not
-signed it.  However, nothing else grants you permission to modify or
-distribute the Program or its derivative works.  These actions are
-prohibited by law if you do not accept this License.  Therefore, by
-modifying or distributing the Program (or any work based on the
-Program), you indicate your acceptance of this License to do so, and
-all its terms and conditions for copying, distributing or modifying
-the Program or works based on it.
-
-  6. Each time you redistribute the Program (or any work based on the
-Program), the recipient automatically receives a license from the
-original licensor to copy, distribute or modify the Program subject to
-these terms and conditions.  You may not impose any further
-restrictions on the recipients' exercise of the rights granted herein.
-You are not responsible for enforcing compliance by third parties to
-this License.
-
-  7. If, as a consequence of a court judgment or allegation of patent
-infringement or for any other reason (not limited to patent issues),
-conditions are imposed on you (whether by court order, agreement or
-otherwise) that contradict the conditions of this License, they do not
-excuse you from the conditions of this License.  If you cannot
-distribute so as to satisfy simultaneously your obligations under this
-License and any other pertinent obligations, then as a consequence you
-may not distribute the Program at all.  For example, if a patent
-license would not permit royalty-free redistribution of the Program by
-all those who receive copies directly or indirectly through you, then
-the only way you could satisfy both it and this License would be to
-refrain entirely from distribution of the Program.
-
-If any portion of this section is held invalid or unenforceable under
-any particular circumstance, the balance of the section is intended to
-apply and the section as a whole is intended to apply in other
-circumstances.
-
-It is not the purpose of this section to induce you to infringe any
-patents or other property right claims or to contest validity of any
-such claims; this section has the sole purpose of protecting the
-integrity of the free software distribution system, which is
-implemented by public license practices.  Many people have made
-generous contributions to the wide range of software distributed
-through that system in reliance on consistent application of that
-system; it is up to the author/donor to decide if he or she is willing
-to distribute software through any other system and a licensee cannot
-impose that choice.
-
-This section is intended to make thoroughly clear what is believed to
-be a consequence of the rest of this License.
-
-  8. If the distribution and/or use of the Program is restricted in
-certain countries either by patents or by copyrighted interfaces, the
-original copyright holder who places the Program under this License
-may add an explicit geographical distribution limitation excluding
-those countries, so that distribution is permitted only in or among
-countries not thus excluded.  In such case, this License incorporates
-the limitation as if written in the body of this License.
-
-  9. The Free Software Foundation may publish revised and/or new versions
-of the General Public License from time to time.  Such new versions will
-be similar in spirit to the present version, but may differ in detail to
-address new problems or concerns.
-
-Each version is given a distinguishing version number.  If the Program
-specifies a version number of this License which applies to it and "any
-later version", you have the option of following the terms and conditions
-either of that version or of any later version published by the Free
-Software Foundation.  If the Program does not specify a version number of
-this License, you may choose any version ever published by the Free Software
-Foundation.
-
-  10. If you wish to incorporate parts of the Program into other free
-programs whose distribution conditions are different, write to the author
-to ask for permission.  For software which is copyrighted by the Free
-Software Foundation, write to the Free Software Foundation; we sometimes
-make exceptions for this.  Our decision will be guided by the two goals
-of preserving the free status of all derivatives of our free software and
-of promoting the sharing and reuse of software generally.
-
-                            NO WARRANTY
-
-  11. BECAUSE THE PROGRAM IS LICENSED FREE OF CHARGE, THERE IS NO WARRANTY
-FOR THE PROGRAM, TO THE EXTENT PERMITTED BY APPLICABLE LAW.  EXCEPT WHEN
-OTHERWISE STATED IN WRITING THE COPYRIGHT HOLDERS AND/OR OTHER PARTIES
-PROVIDE THE PROGRAM "AS IS" WITHOUT WARRANTY OF ANY KIND, EITHER EXPRESSED
-OR IMPLIED, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF
-MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE.  THE ENTIRE RISK AS
-TO THE QUALITY AND PERFORMANCE OF THE PROGRAM IS WITH YOU.  SHOULD THE
-PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF ALL NECESSARY SERVICING,
-REPAIR OR CORRECTION.
-
-  12. IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN WRITING
-WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MAY MODIFY AND/OR
-REDISTRIBUTE THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU FOR DAMAGES,
-INCLUDING ANY GENERAL, SPECIAL, INCIDENTAL OR CONSEQUENTIAL DAMAGES ARISING
-OUT OF THE USE OR INABILITY TO USE THE PROGRAM (INCLUDING BUT NOT LIMITED
-TO LOSS OF DATA OR DATA BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY
-YOU OR THIRD PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER
-PROGRAMS), EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE
-POSSIBILITY OF SUCH DAMAGES.
-
-                     END OF TERMS AND CONDITIONS
-
-            How to Apply These Terms to Your New Programs
-
-  If you develop a new program, and you want it to be of the greatest
-possible use to the public, the best way to achieve this is to make it
-free software which everyone can redistribute and change under these terms.
-
-  To do so, attach the following notices to the program.  It is safest
-to attach them to the start of each source file to most effectively
-convey the exclusion of warranty; and each file should have at least
-the "copyright" line and a pointer to where the full notice is found.
-
-    <one line to give the program's name and a brief idea of what it does.>
-    Copyright (C) <year>  <name of author>
-
-    This program is free software; you can redistribute it and/or modify
-    it under the terms of the GNU General Public License as published by
-    the Free Software Foundation; either version 2 of the License, or
-    (at your option) any later version.
-
-    This program is distributed in the hope that it will be useful,
-    but WITHOUT ANY WARRANTY; without even the implied warranty of
-    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
-    GNU General Public License for more details.
-
-    You should have received a copy of the GNU General Public License along
-    with this program; if not, write to the Free Software Foundation, Inc.,
-    51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA.
-
-Also add information on how to contact you by electronic and paper mail.
-
-If the program is interactive, make it output a short notice like this
-when it starts in an interactive mode:
-
-    Gnomovision version 69, Copyright (C) year name of author
-    Gnomovision comes with ABSOLUTELY NO WARRANTY; for details type `show w'.
-    This is free software, and you are welcome to redistribute it
-    under certain conditions; type `show c' for details.
-
-The hypothetical commands `show w' and `show c' should show the appropriate
-parts of the General Public License.  Of course, the commands you use may
-be called something other than `show w' and `show c'; they could even be
-mouse-clicks or menu items--whatever suits your program.
-
-You should also get your employer (if you work as a programmer) or your
-school, if any, to sign a "copyright disclaimer" for the program, if
-necessary.  Here is a sample; alter the names:
-
-  Yoyodyne, Inc., hereby disclaims all copyright interest in the program
-  `Gnomovision' (which makes passes at compilers) written by James Hacker.
-
-  <signature of Ty Coon>, 1 April 1989
-  Ty Coon, President of Vice
-
-This General Public License does not permit incorporating your program into
-proprietary programs.  If your program is a subroutine library, you may
-consider it more useful to permit linking proprietary applications with the
-library.  If this is what you want to do, use the GNU Lesser General
-Public License instead of this License.
diff --git a/KNOWNBUGS.rb b/KNOWNBUGS.rb
deleted file mode 100644
index b97a08d928..0000000000
--- a/KNOWNBUGS.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-#
-# This test file concludes tests which point out known bugs.
-# So all tests will cause failure.
-#
-
diff --git a/LEGAL b/LEGAL
deleted file mode 100644
index 2607f0082a..0000000000
--- a/LEGAL
+++ /dev/null
@@ -1,594 +0,0 @@
-LEGAL NOTICE INFORMATION
-------------------------
-
-All the files in this distribution are covered under either the Ruby's
-license (see the file COPYING) or public-domain except some files
-mentioned below.
-
-ccan/build_assert/build_assert.h
-ccan/check_type/check_type.h
-ccan/container_of/container_of.h
-ccan/str/str.h
-
-  These files are licensed under the CC0.
-
-    http://creativecommons.org/choose/zero/
-
-ccan/list/list.h
-
-  This file is licensed under the MIT License.
-
-    Permission is hereby granted, free of charge, to any person obtaining a copy
-    of this software and associated documentation files (the "Software"), to deal
-    in the Software without restriction, including without limitation the rights
-    to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
-    copies of the Software, and to permit persons to whom the Software is
-    furnished to do so, subject to the following conditions:
-
-    The above copyright notice and this permission notice shall be included in
-    all copies or substantial portions of the Software.
-
-    THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
-    IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
-    FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
-    AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
-    LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
-    OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN
-    THE SOFTWARE.
-
-include/ruby/oniguruma.h:
-regcomp.c:
-regenc.[ch]:
-regerror.c:
-regexec.c:
-regint.h:
-regparse.[ch]:
-enc/ascii.c
-enc/big5.c
-enc/cp949.c
-enc/emacs_mule.c
-enc/encdb.c
-enc/euc_jp.c
-enc/euc_kr.c
-enc/euc_tw.c
-enc/gb18030.c
-enc/gb2312.c
-enc/gbk.c
-enc/iso_8859_1.c
-enc/iso_8859_10.c
-enc/iso_8859_11.c
-enc/iso_8859_13.c
-enc/iso_8859_14.c
-enc/iso_8859_15.c
-enc/iso_8859_16.c
-enc/iso_8859_2.c
-enc/iso_8859_3.c
-enc/iso_8859_4.c
-enc/iso_8859_5.c
-enc/iso_8859_6.c
-enc/iso_8859_7.c
-enc/iso_8859_8.c
-enc/iso_8859_9.c
-enc/koi8_r.c
-enc/koi8_u.c
-enc/shift_jis.c
-enc/unicode.c
-enc/us_ascii.c
-enc/utf_16be.c
-enc/utf_16le.c
-enc/utf_32be.c
-enc/utf_32le.c
-enc/utf_8.c
-enc/windows_1251.c
-
-Oniguruma  ----   (C) K.Kosako <sndgk393 AT ybb DOT ne DOT jp>
-
-http://www.geocities.jp/kosako3/oniguruma/
-http://www.ruby-lang.org/cgi-bin/cvsweb.cgi/oniguruma/
-http://www.freebsd.org/cgi/cvsweb.cgi/ports/devel/oniguruma/
-
-   When this software is partly used or it is distributed with Ruby,
-   this of Ruby follows the license of Ruby.
-
-configure:
-
-  This file is free software.
-
-    Copyright (C) 1992, 93, 94, 95, 96 Free Software Foundation, Inc.
-
-    This configure script is free software; the Free Software Foundation
-    gives unlimited permission to copy, distribute and modify it.
-
-tool/config.guess:
-tool/config.sub:
-
-  As long as you distribute these files with the file configure, they
-  are covered under the Ruby's license.
-
-      Copyright (C) 1992, 1993, 1994, 1995, 1996, 1997, 1998, 1999
-      Free Software Foundation, Inc.
-
-    This file is free software; you can redistribute it and/or modify it
-    under the terms of the GNU General Public License as published by
-    the Free Software Foundation; either version 2 of the License, or
-    (at your option) any later version.
-
-    This program is distributed in the hope that it will be useful, but
-    WITHOUT ANY WARRANTY; without even the implied warranty of
-    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the GNU
-    General Public License for more details.
-
-    You should have received a copy of the GNU General Public License
-    along with this program; if not, write to the Free Software
-    Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
-
-    As a special exception to the GNU General Public License, if you
-    distribute this file as part of a program that contains a
-    configuration script generated by Autoconf, you may include it under
-    the same distribution terms that you use for the rest of that program.
-
-parse.c:
-
-  This file is licensed under the GPL, but is incorporated into Ruby and
-  redistributed under the terms of the Ruby license, as permitted by the
-  exception to the GPL below.
-
-     Copyright (C) 1984, 1989, 1990, 2000, 2001, 2002, 2003, 2004, 2005, 2006
-     Free Software Foundation, Inc.
-
-     This program is free software; you can redistribute it and/or modify
-     it under the terms of the GNU General Public License as published by
-     the Free Software Foundation; either version 2, or (at your option)
-     any later version.
-
-     This program is distributed in the hope that it will be useful,
-     but WITHOUT ANY WARRANTY; without even the implied warranty of
-     MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
-     GNU General Public License for more details.
-
-     You should have received a copy of the GNU General Public License
-     along with this program; if not, write to the Free Software
-     Foundation, Inc., 51 Franklin Street, Fifth Floor,
-     Boston, MA 02110-1301, USA.  */
-
-  /* As a special exception, you may create a larger work that contains
-     part or all of the Bison parser skeleton and distribute that work
-     under terms of your choice, so long as that work isn't itself a
-     parser generator using the skeleton or a modified version thereof
-     as a parser skeleton.  Alternatively, if you modify or redistribute
-     the parser skeleton itself, you may (at your option) remove this
-     special exception, which will cause the skeleton and the resulting
-     Bison output files to be licensed under the GNU General Public
-     License without this special exception.
-
-     This special exception was added by the Free Software Foundation in
-     version 2.2 of Bison.  */
-
-util.c (partly):
-
-    Copyright (c) 1991, 2000, 2001 by Lucent Technologies.
-
-    Permission to use, copy, modify, and distribute this software for any
-    purpose without fee is hereby granted, provided that this entire notice
-    is included in all copies of any software which is or includes a copy
-    or modification of this software and in all copies of the supporting
-    documentation for such software.
-
-    THIS SOFTWARE IS BEING PROVIDED "AS IS", WITHOUT ANY EXPRESS OR IMPLIED
-    WARRANTY.  IN PARTICULAR, NEITHER THE AUTHOR NOR LUCENT MAKES ANY
-    REPRESENTATION OR WARRANTY OF ANY KIND CONCERNING THE MERCHANTABILITY
-    OF THIS SOFTWARE OR ITS FITNESS FOR ANY PARTICULAR PURPOSE.
-
-win32/win32.[ch]:
-
-  You can apply the Artistic License to these files. (or GPL,
-  alternatively)
-
-    Copyright (c) 1993, Intergraph Corporation
-
-    You may distribute under the terms of either the GNU General Public
-    License or the Artistic License, as specified in the perl README file.
-
-util.c (partly):
-
-   Copyright (c) 2004-2008 David Schultz <das@FreeBSD.ORG>
-   All rights reserved.
-
-   Redistribution and use in source and binary forms, with or without
-   modification, are permitted provided that the following conditions
-   are met:
-   1. Redistributions of source code must retain the above copyright
-      notice, this list of conditions and the following disclaimer.
-   2. Redistributions in binary form must reproduce the above copyright
-      notice, this list of conditions and the following disclaimer in the
-      documentation and/or other materials provided with the distribution.
-
-   THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
-   ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
-   IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
-   ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
-   FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
-   DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
-   OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
-   HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
-   LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
-   OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
-   SUCH DAMAGE.
-
-random.c
-
-  This file is under the new-style BSD license.
-
-    A C-program for MT19937, with initialization improved 2002/2/10.
-    Coded by Takuji Nishimura and Makoto Matsumoto.
-    This is a faster version by taking Shawn Cokus's optimization,
-    Matthe Bellew's simplification, Isaku Wada's real version.
-
-    Before using, initialize the state by using init_genrand(seed)
-    or init_by_array(init_key, key_length).
-
-    Copyright (C) 1997 - 2002, Makoto Matsumoto and Takuji Nishimura,
-    All rights reserved.
-
-    Redistribution and use in source and binary forms, with or without
-    modification, are permitted provided that the following conditions
-    are met:
-
-      1. Redistributions of source code must retain the above copyright
-	 notice, this list of conditions and the following disclaimer.
-
-      2. Redistributions in binary form must reproduce the above copyright
-	 notice, this list of conditions and the following disclaimer in the
-	 documentation and/or other materials provided with the distribution.
-
-      3. The names of its contributors may not be used to endorse or promote
-	 products derived from this software without specific prior written
-	 permission.
-
-    THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS
-    "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
-    LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR
-    A PARTICULAR PURPOSE ARE DISCLAIMED.  IN NO EVENT SHALL THE COPYRIGHT OWNER OR
-    CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
-    EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
-    PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR
-    PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF
-    LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING
-    NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS
-    SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.
-
-
-    Any feedback is very welcome.
-    http://www.math.keio.ac.jp/matumoto/emt.html
-    email: matumoto@math.keio.ac.jp
-
-vm_dump.c:procstat_vm
-
-  This file is under the new-style BSD license.
-
-    Copyright (c) 2007 Robert N. M. Watson
-    All rights reserved.
-
-    Redistribution and use in source and binary forms, with or without
-    modification, are permitted provided that the following conditions
-    are met:
-    1. Redistributions of source code must retain the above copyright
-       notice, this list of conditions and the following disclaimer.
-    2. Redistributions in binary form must reproduce the above copyright
-       notice, this list of conditions and the following disclaimer in the
-       documentation and/or other materials provided with the distribution.
-
-    THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
-    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
-    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
-    ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
-    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
-    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
-    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
-    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
-    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
-    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
-    SUCH DAMAGE.
-
-    $FreeBSD: head/usr.bin/procstat/procstat_vm.c 261780 2014-02-11 21:57:37Z jhb $
-
-vsnprintf.c:
-
-  This file is under the old-style BSD license.  Note that the
-  paragraph 3 below is now null and void.
-
-    Copyright (c) 1990, 1993
-         The Regents of the University of California.  All rights reserved.
-
-    This code is derived from software contributed to Berkeley by
-    Chris Torek.
-
-    Redistribution and use in source and binary forms, with or without
-    modification, are permitted provided that the following conditions
-    are met:
-    1. Redistributions of source code must retain the above copyright
-       notice, this list of conditions and the following disclaimer.
-    2. Redistributions in binary form must reproduce the above copyright
-       notice, this list of conditions and the following disclaimer in the
-       documentation and/or other materials provided with the distribution.
-    3. Neither the name of the University nor the names of its contributors
-       may be used to endorse or promote products derived from this software
-       without specific prior written permission.
-
-    THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
-    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
-    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
-    ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
-    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
-    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
-    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
-    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
-    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
-    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
-    SUCH DAMAGE.
-
-    IMPORTANT NOTE:
-    --------------
-    From ftp://ftp.cs.berkeley.edu/pub/4bsd/README.Impt.License.Change
-    paragraph 3 above is now null and void.
-
-st.[ch]:
-missing/alloca.c:
-missing/dup2.c:
-missing/erf.c:
-missing/finite.c:
-missing/hypot.c:
-missing/isinf.c:
-missing/isnan.c:
-missing/lgamma_r.c:
-missing/memcmp.c:
-missing/memmove.c:
-missing/strchr.c:
-missing/strstr.c:
-missing/strtol.c:
-missing/tgamma.c:
-ext/digest/sha1/sha1.[ch]:
-
-  These files are all under public domain.
-
-missing/crypt.c:
-
-  This file is under the old-style BSD license.  Note that the
-  paragraph 3 below is now null and void.
-
-    Copyright (c) 1989, 1993
-    	The Regents of the University of California.  All rights reserved.
-
-    This code is derived from software contributed to Berkeley by
-    Tom Truscott.
-
-    Redistribution and use in source and binary forms, with or without
-    modification, are permitted provided that the following conditions
-    are met:
-    1. Redistributions of source code must retain the above copyright
-       notice, this list of conditions and the following disclaimer.
-    2. Redistributions in binary form must reproduce the above copyright
-       notice, this list of conditions and the following disclaimer in the
-       documentation and/or other materials provided with the distribution.
-    3. Neither the name of the University nor the names of its contributors
-       may be used to endorse or promote products derived from this software
-       without specific prior written permission.
-
-    THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
-    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
-    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
-    ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
-    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
-    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
-    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
-    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
-    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
-    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
-    SUCH DAMAGE.
-
-missing/setproctitle.c
-
-  This file is under the old-style BSD license.  Note that the
-  paragraph 3 below is now null and void.
-
-    Copyright 2003 Damien Miller
-    Copyright (c) 1983, 1995-1997 Eric P. Allman
-    Copyright (c) 1988, 1993
-    	The Regents of the University of California.  All rights reserved.
-
-    Redistribution and use in source and binary forms, with or without
-    modification, are permitted provided that the following conditions
-    are met:
-    1. Redistributions of source code must retain the above copyright
-       notice, this list of conditions and the following disclaimer.
-    2. Redistributions in binary form must reproduce the above copyright
-       notice, this list of conditions and the following disclaimer in the
-       documentation and/or other materials provided with the distribution.
-    3. Neither the name of the University nor the names of its contributors
-       may be used to endorse or promote products derived from this software
-       without specific prior written permission.
-
-    THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
-    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
-    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
-    ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
-    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
-    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
-    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
-    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
-    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
-    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
-    SUCH DAMAGE.
-
-missing/strlcat.c
-missing/strlcpy.c
-
-  These files are under the new-style BSD license.
-
-    Copyright (c) 1998 Todd C. Miller <Todd.Miller@courtesan.com>
-    All rights reserved.
-
-    Redistribution and use in source and binary forms, with or without
-    modification, are permitted provided that the following conditions
-    are met:
-    1. Redistributions of source code must retain the above copyright
-       notice, this list of conditions and the following disclaimer.
-    2. Redistributions in binary form must reproduce the above copyright
-       notice, this list of conditions and the following disclaimer in the
-       documentation and/or other materials provided with the distribution.
-    3. The name of the author may not be used to endorse or promote products
-       derived from this software without specific prior written permission.
-
-    THIS SOFTWARE IS PROVIDED ``AS IS'' AND ANY EXPRESS OR IMPLIED WARRANTIES,
-    INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY
-    AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED.  IN NO EVENT SHALL
-    THE AUTHOR BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
-    EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
-    PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS;
-    OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY,
-    WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR
-    OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF
-    ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.
-
-missing/langinfo.c
-
-  This file is from http://www.cl.cam.ac.uk/~mgk25/ucs/langinfo.c.
-  Ruby uses a modified version. The file contains the following
-  author/copyright notice:
-
-  Markus.Kuhn@cl.cam.ac.uk -- 2002-03-11
-  Permission to use, copy, modify, and distribute this software
-  for any purpose and without fee is hereby granted. The author
-  disclaims all warranties with regard to this software.
-
-ext/digest/md5/md5.[ch]:
-
-  These files are under the following license.  Ruby uses modified
-  versions of them.
-
-    Copyright (C) 1999, 2000 Aladdin Enterprises.  All rights reserved.
-
-    This software is provided 'as-is', without any express or implied
-    warranty.  In no event will the authors be held liable for any damages
-    arising from the use of this software.
-
-    Permission is granted to anyone to use this software for any purpose,
-    including commercial applications, and to alter it and redistribute it
-    freely, subject to the following restrictions:
-
-    1. The origin of this software must not be misrepresented; you must not
-       claim that you wrote the original software. If you use this software
-       in a product, an acknowledgment in the product documentation would be
-       appreciated but is not required.
-    2. Altered source versions must be plainly marked as such, and must not be
-       misrepresented as being the original software.
-    3. This notice may not be removed or altered from any source distribution.
-
-    L. Peter Deutsch
-    ghost@aladdin.com
-
-ext/digest/rmd160/rmd160.[ch]:
-
-  These files have the following copyright information, and by the
-  author we are allowed to use it under the new-style BSD license.
-
-    AUTHOR:   Antoon Bosselaers, ESAT-COSIC
-              (Arranged for libc by Todd C. Miller)
-    DATE:     1 March 1996
-
-    Copyright (c) Katholieke Universiteit Leuven
-    1996, All Rights Reserved
-
-ext/digest/sha2/sha2.[ch]:
-
-  These files are under the new-style BSD license.
-
-    Copyright 2000 Aaron D. Gifford.  All rights reserved.
-
-    Redistribution and use in source and binary forms, with or without
-    modification, are permitted provided that the following conditions
-    are met:
-    1. Redistributions of source code must retain the above copyright
-       notice, this list of conditions and the following disclaimer.
-    2. Redistributions in binary form must reproduce the above copyright
-       notice, this list of conditions and the following disclaimer in the
-       documentation and/or other materials provided with the distribution.
-    3. Neither the name of the copyright holder nor the names of contributors
-       may be used to endorse or promote products derived from this software
-       without specific prior written permission.
-
-    THIS SOFTWARE IS PROVIDED BY THE AUTHOR(S) AND CONTRIBUTOR(S) ``AS IS'' AND
-    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
-    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
-    ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR(S) OR CONTRIBUTOR(S) BE LIABLE
-    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
-    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
-    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
-    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
-    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
-    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
-    SUCH DAMAGE.
-
-ext/nkf/nkf-utf8/config.h:
-ext/nkf/nkf-utf8/nkf.c:
-ext/nkf/nkf-utf8/utf8tbl.c:
-
-  These files are under the following license.  So to speak, it is
-  copyrighted semi-public-domain software.
-
-    Copyright (C) 1987, Fujitsu LTD. (Itaru ICHIKAWA)
-       Everyone is permitted to do anything on this program
-       including copying, modifying, improving,
-       as long as you don't try to pretend that you wrote it.
-       i.e., the above copyright notice has to appear in all copies.
-       Binary distribution requires original version messages.
-       You don't have to ask before copying, redistribution or publishing.
-       THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE.
-
-ext/socket/addrinfo.h:
-ext/socket/getaddrinfo.c:
-ext/socket/getnameinfo.c:
-
-  These files are under the new-style BSD license.
-
-    Copyright (C) 1995, 1996, 1997, 1998, and 1999 WIDE Project.
-    All rights reserved.
-
-    Redistribution and use in source and binary forms, with or without
-    modification, are permitted provided that the following conditions
-    are met:
-    1. Redistributions of source code must retain the above copyright
-       notice, this list of conditions and the following disclaimer.
-    2. Redistributions in binary form must reproduce the above copyright
-       notice, this list of conditions and the following disclaimer in the
-       documentation and/or other materials provided with the distribution.
-    3. Neither the name of the project nor the names of its contributors
-       may be used to endorse or promote products derived from this software
-       without specific prior written permission.
-
-    THIS SOFTWARE IS PROVIDED BY THE PROJECT AND CONTRIBUTORS ``AS IS'' AND
-    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
-    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
-    ARE DISCLAIMED.  IN NO EVENT SHALL THE PROJECT OR CONTRIBUTORS BE LIABLE
-    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
-    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
-    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
-    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
-    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
-    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
-    SUCH DAMAGE.
-
-ext/win32ole/win32ole.c:
-
-  You can apply the Artistic License to this file. (or GPL,
-  alternatively)
-
-    (c) 1995 Microsoft Corporation. All rights reserved.
-    Developed by ActiveWare Internet Corp., http://www.ActiveWare.com
-
-    Other modifications Copyright (c) 1997, 1998 by Gurusamy Sarathy
-    <gsar@umich.edu> and Jan Dubois <jan.dubois@ibm.net>
-
-    You may distribute under the terms of either the GNU General Public
-    License or the Artistic License, as specified in the README file
-    of the Perl distribution.
diff --git a/MANIFEST b/MANIFEST
new file mode 100644
index 0000000000..04b578b538
--- /dev/null
+++ b/MANIFEST
@@ -0,0 +1,218 @@
+COPYING
+ChangeLog
+MANIFEST
+Makefile.in
+README
+README.jp
+README.EXT
+README.EXT.jp
+ToDo
+array.c
+bignum.c
+class.c
+compar.c
+configure
+configure.bat
+configure.in
+config.dj
+config.guess
+config.sub
+defines.h
+dir.c
+dln.c
+dln.h
+dmyext.c
+enum.c
+env.h
+error.c
+eval.c
+file.c
+fnmatch.c
+fnmatch.h
+gc.c
+glob.c
+hash.c
+inits.c
+install-sh
+instruby.rb
+intern.h
+io.c
+io.h
+keywords
+lex.c
+main.c
+marshal.c
+math.c
+mkconfig.rb
+node.h
+numeric.c
+object.c
+pack.c
+parse.y
+process.c
+random.c
+range.c
+re.c
+re.h
+regex.c
+regex.h
+ruby.1
+ruby.c
+ruby.h
+rubytest.rb
+sig.h
+signal.c
+sprintf.c
+st.c
+st.h
+string.c
+struct.c
+time.c
+top.sed
+util.h
+util.c
+variable.c
+version.c
+version.h
+ext/Setup
+ext/Setup.dj
+ext/Setup.nt
+ext/Setup.x68
+ext/aix_ld.rb
+ext/cygwin32_ld.rb
+ext/extmk.rb.in
+ext/extmk.rb.nt
+lib/English.rb
+lib/Env.rb
+lib/base64.rb
+lib/cgi-lib.rb
+lib/complex.rb
+lib/date.rb
+lib/date2.rb
+lib/debug.rb
+lib/delegate.rb
+lib/e2mmap.rb
+lib/eregex.rb
+lib/find.rb
+lib/final.rb
+lib/finalize.rb
+lib/ftplib.rb
+lib/ftools.rb
+lib/getopts.rb
+lib/importenv.rb
+lib/jcode.rb
+lib/mailread.rb
+lib/mathn.rb
+lib/matrix.rb
+lib/mkmf.rb
+lib/monitor.rb
+lib/mutex_m.rb
+lib/observer.rb
+lib/ostruct.rb
+lib/parsearg.rb
+lib/parsedate.rb
+lib/ping.rb
+lib/pstore.rb
+lib/rational.rb
+lib/shellwords.rb
+lib/sync.rb
+lib/telnet.rb
+lib/tempfile.rb
+lib/thread.rb
+lib/thwait.rb
+lib/tk.rb
+lib/tkcanvas.rb
+lib/tkclass.rb
+lib/tkdialog.rb
+lib/tkentry.rb
+lib/tkmenubar.rb
+lib/tkscrollbox.rb
+lib/tktext.rb
+lib/tracer.rb
+lib/weakref.rb
+missing/alloca.c
+missing/crypt.c
+missing/dir.h
+missing/dup2.c
+missing/file.h
+missing/flock.c
+missing/memcmp.c
+missing/memmove.c
+missing/mkdir.c
+missing/nt.c
+missing/nt.h
+missing/setenv.c
+missing/strcasecmp.c
+missing/strchr.c
+missing/strdup.c
+missing/strerror.c
+missing/strftime.c
+missing/strstr.c
+missing/strtol.c
+missing/strtoul.c
+missing/x68.c
+sample/biorhythm.rb
+sample/cbreak.rb
+sample/clnt.rb
+sample/dbmtest.rb
+sample/dir.rb
+sample/eval.rb
+sample/export.rb
+sample/exyacc.rb
+sample/fact.rb
+sample/fib.awk
+sample/fib.pl
+sample/fib.py
+sample/fib.rb
+sample/fib.scm
+sample/freq.rb
+sample/from.rb
+sample/fullpath.rb
+sample/getopts.test
+sample/goodfriday.rb
+sample/inf-ruby.el
+sample/less.rb
+sample/list.rb
+sample/list2.rb
+sample/list3.rb
+sample/mrshtest.rb
+sample/mkproto.rb
+sample/mpart.rb
+sample/observ.rb
+sample/occur.pl
+sample/occur.rb
+sample/occur2.rb
+sample/philos.rb
+sample/pi.rb
+sample/rbc.rb
+sample/rcs.awk
+sample/rcs.dat
+sample/rcs.rb
+sample/regx.rb
+sample/ruby-mode.el
+sample/rubydb2x.el
+sample/rubydb3x.el
+sample/sieve.rb
+sample/svr.rb
+sample/test.rb
+sample/time.rb
+sample/tkbiff.rb
+sample/tkbrowse.rb
+sample/tkdialog.rb
+sample/tkfrom.rb
+sample/tkhello.rb
+sample/tkline.rb
+sample/tktimer.rb
+sample/trojan.rb
+sample/tsvr.rb
+sample/uumerge.rb
+win32/Makefile
+win32/config.h
+win32/ntsetup.bat
+win32/ruby.def
+win32/sdbm.c
+win32/sdbm.h
+x68/fconvert.c
+x68/select.c
+x68/_dtos18.c
+x68/_round.c
diff --git a/Makefile.in b/Makefile.in
index 55ec051c1b..562948f382 100644
--- a/Makefile.in
+++ b/Makefile.in
@@ -1,545 +1,211 @@
 SHELL = /bin/sh
-NULLCMD = @NULLCMD@
-n=$(NULLCMD)
-ECHO1 = $(V:1=$n)
-RUNCMD = $(SHELL)
-CDPATH = .
-CHDIR = @CHDIR@
-exec = exec
-NULL = /dev/null
-PATH_SEPARATOR = @PATH_SEPARATOR@
 
 #### Start of system configuration section. ####
 
 srcdir = @srcdir@
-top_srcdir = $(srcdir)
-hdrdir = $(srcdir)/include
-PLATFORM_DIR = @PLATFORM_DIR@
+VPATH = @srcdir@:@srcdir@/missing
 
 CC = @CC@
-CPP = @CPP@
-LD = @LD@
-YACC = bison
+YACC = @YACC@
 PURIFY =
-AUTOCONF = autoconf
-CONFIGURE = @CONFIGURE@
 @SET_MAKE@
-MKFILES = @MAKEFILES@
-BASERUBY = @BASERUBY@
-HAVE_BASERUBY = @HAVE_BASERUBY@
-TEST_RUNNABLE = @TEST_RUNNABLE@
-CROSS_COMPILING = @CROSS_COMPILING@
-DOXYGEN = @DOXYGEN@
 
 prefix = @prefix@
-exec_prefix = @exec_prefix@
-bindir = @bindir@
-sbindir = @sbindir@
-libdir = @libdir@
-libexecdir = @libexecdir@
-datarootdir = @datarootdir@
-datadir = @datadir@
-arch = @arch@
-sitearch = @sitearch@
-sitedir = @sitedir@
-archlibdir = @archlibdir@
-ruby_version = @ruby_version@
-
-TESTUI = console
-TESTS =
-INSTALLDOC = @INSTALLDOC@
-DOCTARGETS = @RDOCTARGET@ @CAPITARGET@
-
-EXTOUT = @EXTOUT@
-arch_hdrdir = $(EXTOUT)/include/$(arch)
-VPATH = $(arch_hdrdir)/ruby:$(hdrdir)/ruby:$(srcdir):$(srcdir)/missing
-
-empty =
-CC_VERSION = @CC_VERSION@
-OUTFLAG = @OUTFLAG@$(empty)
-COUTFLAG = @COUTFLAG@$(empty)
-ARCH_FLAG = @ARCH_FLAG@
-CFLAGS_NO_ARCH = @CFLAGS@
-CFLAGS = $(CFLAGS_NO_ARCH) $(ARCH_FLAG)
-cflags = @cflags@
-optflags = @optflags@
-debugflags = @debugflags@
-warnflags = @warnflags@ @strict_warnflags@
-cppflags = @cppflags@
-INCFLAGS = -I. -I$(arch_hdrdir) -I$(hdrdir) -I$(srcdir)
-XCFLAGS = @XCFLAGS@
-CPPFLAGS = @CPPFLAGS@ $(INCFLAGS)
+CFLAGS = @CFLAGS@ -I@srcdir@ -I@includedir@
 LDFLAGS = @STATIC@ $(CFLAGS) @LDFLAGS@
-EXTLDFLAGS = @EXTLDFLAGS@
-XLDFLAGS = @XLDFLAGS@ $(EXTLDFLAGS)
-EXTLIBS =
 LIBS = @LIBS@ $(EXTLIBS)
 MISSING = @LIBOBJS@ @ALLOCA@
-LDSHARED = @LIBRUBY_LDSHARED@
-DLDFLAGS = @LIBRUBY_DLDFLAGS@ $(XLDFLAGS) $(ARCH_FLAG)
-SOLIBS = @SOLIBS@
-MAINLIBS = @MAINLIBS@
-ARCHMINIOBJS = @MINIOBJS@
-DLNOBJ = @DLNOBJ@
-ENCOBJS = @ENCOBJS@
-EXTOBJS = @EXTOBJS@
-BUILTIN_ENCOBJS = @BUILTIN_ENCOBJS@
-BUILTIN_TRANSSRCS = @BUILTIN_TRANSSRCS@
-BUILTIN_TRANSOBJS = @BUILTIN_TRANSOBJS@
-POSTLINK = @POSTLINK@
-
-RUBY_BASE_NAME=@RUBY_BASE_NAME@
-RUBY_PROGRAM_VERSION=@RUBY_PROGRAM_VERSION@
-RUBY_INSTALL_NAME=@RUBY_INSTALL_NAME@
-RUBY_SO_NAME=@RUBY_SO_NAME@
-EXEEXT = @EXEEXT@
-LIBEXT = @LIBEXT@
-PROGRAM=$(RUBY_INSTALL_NAME)$(EXEEXT)
-RUBY = $(RUBY_INSTALL_NAME)
-MINIRUBY = @MINIRUBY@\
-	$(MINIRUBYOPT)
-# RUNRUBY_COMMAND:: runruby.rb or baseruby. do not append options directly
-RUNRUBY_COMMAND = @RUNRUBY_COMMAND@
-# RUNRUBY:: run ruby with RUN_OPTS which is passed to ruby
-RUNRUBY = @RUNRUBY@ $(RUN_OPTS)
-# RUNRUBY_DEBUGGER:: debugging option for runruby.rb
-RUNRUBY_DEBUGGER = --debugger='gdb -x run.gdb --quiet --args'
-XRUBY = @XRUBY@
-BTESTRUBY = @BTESTRUBY@\
-	$(MINIRUBYOPT)
-INSTALL = @INSTALL@
-INSTALL_DATA = @INSTALL_DATA@
-INSTALL_SCRIPT = @INSTALL_SCRIPT@
-INSTALL_PROGRAM = @INSTALL_PROGRAM@
-XRUBY_LIBDIR = @XRUBY_LIBDIR@
-XRUBY_RUBYLIBDIR = @XRUBY_RUBYLIBDIR@
-XRUBY_RUBYHDRDIR = @XRUBY_RUBYHDRDIR@
-BOOTSTRAPRUBY = @BOOTSTRAPRUBY@
+
+binsuffix = @binsuffix@
 
 #### End of system configuration section. ####
 
-MAJOR=	@MAJOR@
-MINOR=	@MINOR@
-TEENY=	@TEENY@
-
-LIBRUBY_A     = @LIBRUBY_A@
-LIBRUBY_SO    = @LIBRUBY_SO@
-LIBRUBY_ALIASES= @LIBRUBY_ALIASES@
-LIBRUBY	      = @LIBRUBY@
-LIBRUBYARG    = @LIBRUBYARG@
-LIBRUBYARG_STATIC = @LIBRUBYARG_STATIC@
-LIBRUBYARG_SHARED = @LIBRUBYARG_SHARED@
-LIBRUBY_RELATIVE = @LIBRUBY_RELATIVE@
-LIBRUBY_A_OBJS = @LIBRUBY_A_OBJS@
-
-DTRACE_REBUILD_OBJS = $(DTRACE_REBUILD:yes=$(DTRACE_DEPENDENT_OBJS))
-
-DTRACE_DEPENDENT_OBJS = array.$(OBJEXT) \
-			eval.$(OBJEXT) \
-			gc.$(OBJEXT) \
-			hash.$(OBJEXT) \
-			load.$(OBJEXT) \
-			object.$(OBJEXT) \
-			parse.$(OBJEXT) \
-			string.$(OBJEXT) \
-			symbol.$(OBJEXT) \
-			vm.$(OBJEXT)
-
-THREAD_MODEL  = @THREAD_MODEL@
-
-PREP          = @PREP@
-ARCHFILE      = @ARCHFILE@
-SETUP         =
-EXTSTATIC     = @EXTSTATIC@
-ENCSTATIC     = @ENCSTATIC@
-SET_LC_MESSAGES = env LC_MESSAGES=C
-
-MAKEDIRS      = @MKDIR_P@
-CP            = cp
-MV            = mv
-RM            = rm -f
-RMDIR         = @RMDIR@
-RMDIRS        = @RMDIRS@
-RMALL         = @RMALL@
-NM            = @NM@
-AR            = @AR@
-ARFLAGS       = rcu
-RANLIB        = @RANLIB@
-AS            = @AS@
-ASFLAGS       = @ASFLAGS@ $(INCFLAGS)
-IFCHANGE      = $(srcdir)/tool/ifchange
-SET_LC_MESSAGES = env LC_MESSAGES=C
-OBJDUMP       = @OBJDUMP@
-OBJCOPY       = @OBJCOPY@
-VCS           = @VCS@
-VCSUP         = @VCSUP@
-DTRACE        = @DTRACE@
-DTRACE_EXT    = @DTRACE_EXT@
-DTRACE_OBJ    = @DTRACE_OBJ@
-DTRACE_REBUILD= @DTRACE_REBUILD@
-DTRACE_GLOMMED_OBJ = $(DTRACE_REBUILD:yes=ruby-glommed.$(OBJEXT))
-
-OBJEXT        = @OBJEXT@
-ASMEXT        = S
-DLEXT         = @DLEXT@
-MANTYPE	      = @MANTYPE@
-SYMBOL_PREFIX = @SYMBOL_PREFIX@
-
-INSTALLED_LIST= .installed.list
-
-NEWLINE_C     = enc/trans/newline.c
-MINIPRELUDE_C = miniprelude.c
-PRELUDE_C     = prelude.c
-RBCONFIG      = .rbconfig.time
-
-SRC_FILE      = $<
-OS_SRC_FILE   = $<
-DEST_FILE     = $@
-OS_DEST_FILE  = $@
-
-MESSAGE_BEGIN = @for line in
-MESSAGE_END = ; do echo "$$line"; done
-ECHO_BEGIN = @sep=''; for word in
-ECHO_END = ; do echo @ECHO_N@ "$$sep'$$word'@ECHO_C@"; sep=' '; done; echo
-
-DESTDIR       = @DESTDIR@
-
-configure_args = @configure_args@
-#### End of variables
-
-.SUFFIXES: .inc .h .c .y .i .$(DTRACE_EXT)
-
-all:
+
+LIBRUBY	      = libruby.a
+
+EXTOBJS	      = 
+
+MAINOBJ	      = main.o
+
+OBJS	      = array.o \
+		bignum.o \
+		class.o \
+		compar.o \
+		dir.o \
+		dln.o \
+		enum.o \
+		error.o \
+		eval.o \
+		file.o \
+		fnmatch.o \
+		gc.o \
+		glob.o \
+		hash.o \
+		inits.o \
+		io.o \
+		marshal.o \
+		math.o \
+		numeric.o \
+		object.o \
+		pack.o \
+		parse.o \
+		process.o \
+		random.o \
+		range.o \
+		re.o \
+		regex.o \
+		ruby.o \
+		signal.o \
+		sprintf.o \
+		st.o \
+		string.o \
+		struct.o \
+		time.o \
+		util.o \
+		variable.o \
+		version.o \
+		$(MISSING)
+
+all:		miniruby$(binsuffix) rbconfig.rb
+		@./miniruby$(binsuffix) -Xext extmk.rb @EXTSTATIC@
+
+miniruby$(binsuffix):	$(OBJS) $(MAINOBJ) dmyext.o
+		@rm -f $@
+		$(PURIFY) $(CC) $(LDFLAGS) $(MAINOBJ) $(OBJS) dmyext.o $(LIBS) -o $@
+
+ruby$(binsuffix):     	$(LIBRUBY) $(MAINOBJ) $(EXTOBJS) 
+		@rm -f $@
+		$(PURIFY) $(CC) $(LDFLAGS) $(MAINOBJ) $(EXTOBJS) $(LIBRUBY) $(LIBS) -o $@
+
+$(LIBRUBY):	$(OBJS) dmyext.o
+		@AR@ rcu $(LIBRUBY) $(OBJS) dmyext.o
+		@-@RANLIB@ $(LIBRUBY) 2> /dev/null || true
+
+install:	rbconfig.rb
+		./miniruby$(binsuffix) $(srcdir)/instruby.rb
+
+clean:;		@rm -f $(OBJS) $(LIBRUBY) $(MAINOBJ) rbconfig.rb
+		@rm -f ext/extinit.c ext/extinit.o dmyext.o
+		@if test -f ./miniruby$(binsuffix); then \
+			./miniruby$(binsuffix) -Xext extmk.rb clean; \
+		fi
+
+distclean:	clean
+		@rm -f Makefile ext/extmk.rb config.h
+		@rm -f ext/config.cache config.cache config.log config.status
+		@rm -f parse.c *~ core *.core gmon.out y.tab.c y.output
+		@rm -f ruby$(binsuffix) miniruby$(binsuffix)
+
+realclean:	distclean
+		@rm -f lex.c
+
+test:		miniruby$(binsuffix)
+		@./miniruby$(binsuffix) $(srcdir)/rubytest.rb
+
+rbconfig.rb:	config.status miniruby$(binsuffix)
+		@./miniruby$(binsuffix) $(srcdir)/mkconfig.rb rbconfig.rb
+
+.c.o:
+	$(CC) $(CFLAGS) $(CPPFLAGS) -c $<
+
+lex.c: keywords
+	gperf -p -j1 -i 1 -g -o -t -N rb_reserved_word -k1,3,$$ keywords > lex.c
+
+parse.c: parse.y
+	$(YACC) $<
+	mv -f y.tab.c parse.c
+
+alloca.o: @srcdir@/missing/alloca.c
+	$(CC) -I. $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/alloca.c
+
+crypt.o: @srcdir@/missing/crypt.c
+	$(CC) -I. $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/crypt.c
+
+dup2.o: @srcdir@/missing/dup2.c
+	$(CC) -I. $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/dup2.c
+
+flock.o: @srcdir@/missing/flock.c
+	$(CC) -I. $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/flock.c
+
+memcmp.o: @srcdir@/missing/memcmp.c
+	$(CC) $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/memcmp.c
+
+memmove.o: @srcdir@/missing/memmove.c
+	$(CC) $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/memmove.c
+
+mkdir.o: @srcdir@/missing/mkdir.c
+	$(CC) $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/mkdir.c
+
+setenv.o: @srcdir@/missing/setenv.c
+	$(CC) $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/setenv.c
+
+strcasecmp.o: @srcdir@/missing/strcasecmp.c
+	$(CC) $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/strcasecmp.c
+
+strchr.o: @srcdir@/missing/strchr.c
+	$(CC) $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/strchr.c
+
+strdup.o: @srcdir@/missing/strdup.c
+	$(CC) $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/strdup.c
+
+strerror.o: @srcdir@/missing/strerror.c
+	$(CC) $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/strerror.c
+
+strftime.o: @srcdir@/missing/strftime.c
+	$(CC) -I. $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/strftime.c
+
+strstr.o: @srcdir@/missing/strstr.c
+	$(CC) $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/strstr.c
+
+strtol.o: @srcdir@/missing/strtol.c
+	$(CC) $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/strtol.c
+
+strtoul.o: @srcdir@/missing/strtoul.c
+	$(CC) $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/strtoul.c
+
+nt.o: @srcdir@/missing/nt.c
+	$(CC) $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/nt.c
+
+x68.o: @srcdir@/missing/x68.c
+	$(CC) $(CFLAGS) $(CPPFLAGS) -c @srcdir@/missing/x68.c
 
 # Prevent GNU make v3 from overflowing arg limit on SysV.
 .NOEXPORT:
-
-miniruby$(EXEEXT):
-		@-if test -f $@; then $(MV) -f $@ $@.old; $(RM) $@.old; fi
-		$(ECHO) linking $@
-		$(Q) $(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(NORMALMAINOBJ) $(MINIOBJS) $(COMMONOBJS) $(MAINLIBS) $(LIBS) $(OUTFLAG)$@
-
-$(PROGRAM):
-		@$(RM) $@
-		$(ECHO) linking $@
-		$(Q) $(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ) $(EXTOBJS) $(LIBRUBYARG) $(MAINLIBS) $(LIBS) $(EXTLIBS) $(OUTFLAG)$@
-		$(Q) $(POSTLINK)
-
-# We must `rm' the library each time this rule is invoked because "updating" a
-# MAB library on Apple/NeXT (see --enable-fat-binary in configure) is not
-# supported.
-$(LIBRUBY_A):
-		@$(RM) $@
-		$(ECHO) linking static-library $@
-		$(Q) $(AR) $(ARFLAGS) $@ $(LIBRUBY_A_OBJS) $(INITOBJS)
-		@-$(RANLIB) $@ 2> /dev/null || true
-		$(ECHO) verifying static-library $@
-		@$(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ) $(LIBRUBY_A) $(MAINLIBS) $(EXTLIBS) $(LIBS) $(OUTFLAG)conftest$(EXEEXT)
-		@$(RM) conftest$(EXEEXT) conftest.c
-
-$(LIBRUBY_SO):
-		@-$(PRE_LIBRUBY_UPDATE)
-		$(ECHO) linking shared-library $@
-		$(Q) $(LDSHARED) $(DLDFLAGS) $(OBJS) $(DLDOBJS) $(SOLIBS) $(EXTSOLIBS) $(OUTFLAG)$@
-		-$(Q) $(OBJCOPY) -w -L '$(SYMBOL_PREFIX)Init_*' -L '$(SYMBOL_PREFIX)ruby_static_id_*' \
-			-L '$(SYMBOL_PREFIX)*_threadptr_*' $@
-		$(Q) $(POSTLINK)
-		@-$(MINIRUBY) -e 'ARGV.each{|link| File.delete link rescue nil; \
-						  File.symlink "$(LIBRUBY_SO)", link}' \
-				$(LIBRUBY_ALIASES) || true
-
-ruby_pc = @ruby_pc@
-$(ruby_pc):
-		@./config.status --file=$@:$(srcdir)/template/ruby.pc.in
-
-ruby-runner.c: template/ruby-runner.c.in
-		@./config.status --file=$@:$(srcdir)/template/$(@F).in
-
-ruby-runner$(EXEEXT): ruby-runner.c
-	$(Q) $(PURIFY) $(CC) $(CFLAGS) $(CPPFLAGS) -DRUBY_INSTALL_NAME=$(RUBY_INSTALL_NAME) $(LDFLAGS) $(LIBS) $(OUTFLAG)$@ ruby-runner.c
-
-$(RBCONFIG): $($(CROSS_COMPILING:no=)PREP)
-
-rbconfig.rb: $(RBCONFIG)
-
-install-cross: $(arch)-fake.rb $(RBCONFIG) rbconfig.rb $(arch_hdrdir)/ruby/config.h \
-	$(LIBRUBY_A) $(LIBRUBY_SO) $(ARCHFILE)
-	$(ECHO) installing cross-compiling stuff
-	$(Q) $(MAKEDIRS) $(XRUBY_RUBYLIBDIR)/$(arch) $(XRUBY_RUBYHDRDIR)/$(arch)/ruby
-	$(Q) sed '/^\$$:\.unshift/q' $(arch)-fake.rb > fake.rb
-	$(Q) $(BASERUBY) -p \
-	-e '~/^\s*CONFIG\["LDFLAGS"\]/ and' \
-	-e '$$_[/(?=\s*"$$)/] = %q[ #{(CONFIG["LIBPATHFLAG"]%File.dirname(__FILE__)).strip}]' \
-	rbconfig.rb > fake-rbconfig.rb
-	$(INSTALL_SCRIPT) fake.rb $(XRUBY_RUBYLIBDIR)/$(arch)/fake.rb
-	$(INSTALL_SCRIPT) fake-rbconfig.rb $(XRUBY_RUBYLIBDIR)/$(arch)/rbconfig.rb
-	@$(RM) fake.rb fake-rbconfig.rb
-	$(INSTALL_DATA) $(arch_hdrdir)/ruby/config.h $(XRUBY_RUBYHDRDIR)/$(arch)/ruby
-	$(INSTALL_DATA) $(top_srcdir)/include/ruby/win32.h $(XRUBY_RUBYHDRDIR)/ruby
-	$(INSTALL_DATA) $(LIBRUBY) $(LIBRUBY_A) $(XRUBY_RUBYLIBDIR)/$(arch)
-	$(INSTALL_PROGRAM) $(LIBRUBY_SO) $(XRUBY_RUBYLIBDIR)/$(arch)
-
-Makefile:	$(srcdir)/Makefile.in $(srcdir)/enc/Makefile.in
-
-$(MKFILES): config.status $(srcdir)/version.h
-		@[ -f $@ ] && mv $@ $@.old
-		MAKE=$(MAKE) $(SHELL) ./config.status $@
-		@cmp $@ $@.old > /dev/null 2>&1 && echo $@ unchanged && exit 0; \
-		{ \
-		    echo "all:; -@rm -f conftest.mk"; \
-		    echo "conftest.mk: .force; @echo AUTO_REMAKE"; \
-		    echo ".force:"; \
-		} > conftest.mk || exit 1; \
-		$(MAKE) -f conftest.mk | grep '^AUTO_REMAKE$$' >/dev/null 2>&1 || \
-		{ echo "$@ updated, restart."; exit 1; }
-
-uncommon.mk: $(srcdir)/common.mk
-		sed 's/{\$$([^(){}]*)[^{}]*}//g' $< > $@
-
-.PHONY: reconfig
-reconfig-args = $(srcdir)/$(CONFIGURE) $(configure_args)
-config.status-args = ./config.status --recheck
-reconfig-exec-0 = test -t 1 && tty=yes; exec 3>&1; exit `exec 4>&1; { CONFIGURE_TTY=$$tty "$$@" 3>&- 4>&-; echo $$? 1>&4; } | fgrep -v '(cached)' 1>&3 3>&- 4>&-`
-reconfig-exec-1 = set -x; "$$@"
-
-reconfig config.status:	$(srcdir)/$(CONFIGURE) $(srcdir)/enc/Makefile.in \
-			$(srcdir)/include/ruby/version.h
-	@PWD= MINIRUBY="$(MINIRUBY)"; export MINIRUBY; \
-	set $(SHELL) $($@-args); $(reconfig-exec-$(V))
-
-$(srcdir)/$(CONFIGURE): $(srcdir)/configure.in $(srcdir)/aclocal.m4
-	$(CHDIR) $(srcdir) && exec $(AUTOCONF) -o $(@F)
-
-incs: id.h
-all-incs: probes.h
-
-# Things which should be considered:
-# * with gperf v.s. without gperf
-# * committers may have various versions of gperf
-# * ./configure v.s. ../ruby/configure
-# * GNU make v.s. HP-UX make	# HP-UX make invokes the action if lex.c and keywords has same mtime.
-# * svn checkout generate a file with mtime as current time
-# * ext4 and XFS has a mtime with fractional part
-lex.c: defs/keywords
-	@\
-	if cmp -s $(srcdir)/defs/lex.c.src $?; then \
-	  [ $(Q) ] && echo copying $@ || set -x; \
-	  $(CP) $(srcdir)/lex.c.blt $@; \
-	else \
-	  [ $(Q) ] && echo generating $@ || set -x; \
-	  gperf -C -P -p -j1 -i 1 -g -o -t -N rb_reserved_word -k1,3,$$ $? \
-	  | sed 's/(long)&((\(struct stringpool_t\) *\*)0)->\(stringpool_[a-z0-9]*\)/offsetof(\1, \2)/g' \
-	  > $@.tmp && \
-	  $(MV) $@.tmp $@ && \
-	  $(CP) $? $(srcdir)/defs/lex.c.src && \
-	  $(CP) $@ $(srcdir)/lex.c.blt; \
-	fi
-
-NAME2CTYPE_OPTIONS = -7 -c -j1 -i1 -t -C -P -T -H uniname2ctype_hash -Q uniname2ctype_pool -N uniname2ctype_p
-
-enc/unicode/name2ctype.h: enc/unicode/name2ctype.kwd
-	$(MAKEDIRS) $(@D)
-	@set +e; \
-	if cmp -s $(?:.kwd=.src) $?; then \
-	  set -x; \
-	  $(CP) $(?:.kwd=.h.blt) $@; \
-	else \
-	  trap '$(RM) $@-1.h $@-2.h' 0 && \
-	  set -x; \
-	  sed '/^#ifdef USE_UNICODE_PROPERTIES/,/^#endif/d' $? | gperf $(NAME2CTYPE_OPTIONS) > $@-1.h && \
-	  sed '/^#ifdef USE_UNICODE_PROPERTIES/d;/^#endif/d' $? | gperf $(NAME2CTYPE_OPTIONS) > $@-2.h && \
-	  diff -DUSE_UNICODE_PROPERTIES $@-1.h $@-2.h > $@.tmp || :; \
-	  $(MV) $@.tmp $@ && \
-	  $(CP) $? $(?:.kwd=.src) && \
-	  $(CP) $@ $(?:.kwd=.h.blt); \
-	fi
-
-JIS_PROPS_OPTIONS = -k1,3 -7 -c -j1 -i1 -t -C -P -t --ignore-case -H onig_jis_property_hash -Q onig_jis_property_pool -N onig_jis_property
-
-enc/jis/props.h: enc/jis/props.kwd
-	$(MAKEDIRS) $(@D)
-	@set +e; \
-	if cmp -s $(?:.kwd=.src) $?; then \
-	  set -x; \
-	  $(CP) $(?:.kwd=.h.blt) $@; \
-	else \
-	  set -x; \
-	  gperf $(JIS_PROPS_OPTIONS) $? | \
-	  sed 's/(int)(long)&((\([a-zA-Z_0-9 ]*[a-zA-Z_0-9]\) *\*)0)->\([a-zA-Z0-9_]*\),/(char)offsetof(\1, \2),/g' > $@ && \
-	  $(CP) $? $(?:.kwd=.src) && \
-	  $(CP) $@ $(?:.kwd=.h.blt); \
-	fi
-
-.c.@OBJEXT@:
-	@$(ECHO) compiling $<
-	$(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -c $<
-
-.s.@OBJEXT@:
-	@$(ECHO) assembling $<
-	$(Q) $(AS) $(ASFLAGS) -o $@ $<
-
-.c.S:
-	@$(ECHO) translating $<
-	$(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -S $<
-
-.c.i:
-	@$(ECHO) preprocessing $<
-	$(Q) $(CPP) $(warnflags) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -E $< > $@
-
-.d.h:
-	@$(ECHO) translating probes $<
-	$(Q) $(DTRACE) -o $@.tmp -h -C $(INCFLAGS) -s $<
-	$(Q) sed -e 's/RUBY_/RUBY_DTRACE_/g' -e 's/PROBES_H_TMP/RUBY_PROBES_H/' -e 's/(char \*/(const char */g' -e 's/, char \*/, const char */g' $@.tmp > $@
-	$(Q) $(RM) $@.tmp
-
-.dmyh.h:
-	@$(ECHO) copying dummy $(DEST_FILE)
-	$(Q) $(CP) $(OS_SRC_FILE) $(OS_DEST_FILE)
-
-probes.stamp: $(DTRACE_REBUILD_OBJS)
-	$(Q) if test -f $@ -o -f probes.$(OBJEXT); then \
-	  $(RM) $(DTRACE_REBUILD_OBJS) $@; \
-	  $(ECHO0) "rebuilding objects which were modified by \"dtrace -G\""; \
-	  $(MAKE) $(DTRACE_REBUILD_OBJS); \
-	fi
-	$(Q) touch $@
-
-probes.@OBJEXT@: $(srcdir)/probes.d $(DTRACE_REBUILD:yes=probes.stamp)
-	@$(ECHO) processing probes in object files
-	$(Q) $(RM) $@
-	$(Q) $(DTRACE) -G -C $(INCFLAGS) -s $(srcdir)/probes.d -o $@ $(DTRACE_REBUILD_OBJS)
-
-# DTrace static library hacks described here:
-# http://mail.opensolaris.org/pipermail/dtrace-discuss/2005-August/000207.html
-ruby-glommed.$(OBJEXT):
-	@$(ECHO) generating a glommed object with DTrace probes for static library
-	$(Q) $(LD) -r -o $@ $(OBJS)
-
-clean-local::
-	$(Q)$(RM) ext/extinit.c ext/extinit.$(OBJEXT) ext/ripper/y.output \
-		enc/encinit.c enc/encinit.$(OBJEXT)
-	-$(Q)$(RM) $(pkgconfig_DATA)
-
-distclean-local::
-	$(Q)$(RM) ext/config.cache $(RBCONFIG) Doxyfile
-	-$(Q)$(RM) run.gdb
-	-$(Q)$(RM) $(INSTALLED_LIST) $(arch_hdrdir)/ruby/config.h verconf.h
-	-$(Q)$(RMDIRS) $(arch_hdrdir)/ruby 2> /dev/null || true
-
-clean-ext distclean-ext realclean-ext::
-	@cd ext 2>/dev/null || exit 0; set dummy `echo "${EXTS}" | tr , ' '`; shift; \
-	test "$$#" = 0 && set .; \
-	set dummy `\
-	    find "$$@" -name Makefile -print | sed 's:^\./::;s:/Makefile$$::' | sort; \
-	`; shift; \
-	cd ..; \
-	for dir do \
-	    echo $(@:-ext=)ing "$$dir"; \
-	    (cd "ext/$$dir" && exec $(MAKE) $(MFLAGS) $(@:-ext=)) && \
-	    case "$@" in \
-	    *distclean-ext*|*realclean-ext*) \
-		$(RMDIRS) "ext/$$dir" 2> /dev/null || true;; \
-	    esac; \
-	done
-	-$(Q)$(RM) ext/extinit.$(OBJEXT)
-
-distclean-ext realclean-ext::
-	-$(Q)$(RM) ext/extinit.c
-	-$(Q)$(RMDIR) ext 2> /dev/null || true
-
-clean-extout:
-
-clean-enc distclean-enc realclean-enc:
-	@test -f "$(ENC_MK)" || exit 0; \
-	echo $(@:-enc=ing) encodings; \
-	exec $(MAKE) -f $(ENC_MK) $(MFLAGS) $(@:-enc=)
-
-ext/extinit.$(OBJEXT): ext/extinit.c $(SETUP)
-	$(ECHO) compiling $@
-	$(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -c ext/extinit.c
-
-enc/encinit.$(OBJEXT): enc/encinit.c $(SETUP)
-
-up::
-	@$(CHDIR) "$(srcdir)" && LC_TIME=C exec $(VCSUP)
-
-after-update:: update-config_files common-srcs
-
-update-mspec:
-	@$(CHDIR) $(srcdir); \
-	if [ -d spec/mspec ]; then \
-	  cd spec/mspec; \
-	  echo updating mspec ...; \
-	  exec git pull; \
-	else \
-	  echo retrieving mspec ...; \
-	  exec git clone $(MSPEC_GIT_URL) spec/mspec; \
-	fi
-
-update-rubyspec: update-mspec
-	@$(CHDIR) $(srcdir); \
-	if [ -d spec/rubyspec ]; then \
-	  cd spec/rubyspec; \
-	  echo updating rubyspec ...; \
-	  exec git pull; \
-	else \
-	  echo retrieving rubyspec ...; \
-	  exec git clone $(RUBYSPEC_GIT_URL) spec/rubyspec; \
-	fi
-
-test-rubyspec-precheck:
-	@if [ ! -d $(srcdir)/spec/rubyspec ]; then echo No rubyspec here.  make update-rubyspec first.; exit 1; fi
-
-update-doclie:
-	@$(CHDIR) $(srcdir); \
-	if [ -d coverage/doclie ]; then \
-	  cd coverage/doclie; \
-	  echo updating doclie ...; \
-	  exec git fetch; \
-		exec git checkout $(DOCLIE_GIT_REF); \
-	else \
-	  echo retrieving doclie ...; \
-	  exec git clone --branch $(DOCLIE_GIT_REF) $(DOCLIE_GIT_URL) coverage/doclie; \
-	fi
-
-update-simplecov-html:
-	@$(CHDIR) $(srcdir); \
-	if [ -d coverage/simplecov-html ]; then \
-	  cd coverage/simplecov-html; \
-	  echo updating simplecov-html ...; \
-	  exec git fetch; \
-		exec git checkout $(SIMPLECOV_HTML_GIT_REF); \
-	else \
-	  echo retrieving simplecov-html ...; \
-	  exec git clone --branch $(SIMPLECOV_HTML_GIT_REF) $(SIMPLECOV_HTML_GIT_URL) coverage/simplecov-html; \
-	fi
-
-update-simplecov:
-	@$(CHDIR) $(srcdir); \
-	if [ -d coverage/simplecov ]; then \
-	  cd coverage/simplecov; \
-	  echo updating simplecov ...; \
-	  exec git fetch; \
-		exec git checkout $(SIMPLECOV_GIT_REF); \
-	else \
-	  echo retrieving simplecov ...; \
-	  exec git clone --branch $(SIMPLECOV_GIT_REF) $(SIMPLECOV_GIT_URL) coverage/simplecov; \
-	fi
-
-update-coverage: update-simplecov update-simplecov-html update-doclie
-
-INSNS	= opt_sc.inc optinsn.inc optunifs.inc insns.inc insns_info.inc \
-	  vmtc.inc vm.inc
-
-$(INSNS): $(srcdir)/insns.def vm_opts.h \
-	  $(srcdir)/defs/opt_operand.def $(srcdir)/defs/opt_insn_unif.def \
-	  $(srcdir)/tool/instruction.rb $(srcdir)/tool/insns2vm.rb
-	$(ECHO) generating $@
-	$(Q) $(BASERUBY) -Ku $(srcdir)/tool/insns2vm.rb $(INSNS2VMOPT) $@
-
-verconf.h: $(RBCONFIG)
-
-loadpath: verconf.h
-	@$(CPP) $(XCFLAGS) $(CPPFLAGS) $(srcdir)/loadpath.c | \
-	sed -e '1,/^const char ruby_initial_load_paths/d;/;/,$$d' \
-	    -e '/^ /!d;s/ *"\\0"$$//;s/" *"//g'
+###
+parse.o: parse.y ruby.h config.h defines.h intern.h env.h node.h st.h regex.h util.h lex.c
+###
+array.o: array.c ruby.h config.h defines.h intern.h
+bignum.o: bignum.c ruby.h config.h defines.h intern.h
+class.o: class.c ruby.h config.h defines.h intern.h node.h st.h
+compar.o: compar.c ruby.h config.h defines.h intern.h
+dir.o: dir.c ruby.h config.h defines.h intern.h
+dln.o: dln.c config.h defines.h dln.h
+dmyext.o: dmyext.c
+enum.o: enum.c ruby.h config.h defines.h intern.h
+error.o: error.c ruby.h config.h defines.h intern.h env.h
+eval.o: eval.c ruby.h config.h defines.h intern.h node.h env.h sig.h st.h dln.h
+file.o: file.c ruby.h config.h defines.h intern.h io.h sig.h
+gc.o: gc.c ruby.h config.h defines.h intern.h sig.h st.h node.h env.h re.h regex.h
+hash.o: hash.c ruby.h config.h defines.h intern.h st.h sig.h
+inits.o: inits.c ruby.h config.h defines.h intern.h
+io.o: io.c ruby.h config.h defines.h intern.h io.h sig.h
+main.o: main.c ruby.h config.h defines.h intern.h
+marshal.o: marshal.c ruby.h config.h defines.h intern.h io.h sig.h st.h
+math.o: math.c ruby.h config.h defines.h intern.h
+numeric.o: numeric.c ruby.h config.h defines.h intern.h
+object.o: object.c ruby.h config.h defines.h intern.h st.h
+pack.o: pack.c ruby.h config.h defines.h intern.h
+process.o: process.c ruby.h config.h defines.h intern.h sig.h st.h
+random.o: random.c ruby.h config.h defines.h intern.h
+range.o: range.c ruby.h config.h defines.h intern.h
+re.o: re.c ruby.h config.h defines.h intern.h re.h regex.h
+ruby.o: ruby.c ruby.h config.h defines.h intern.h dln.h
+signal.o: signal.c ruby.h config.h defines.h intern.h sig.h
+sprintf.o: sprintf.c ruby.h config.h defines.h intern.h
+st.o: st.c config.h st.h
+string.o: string.c ruby.h config.h defines.h intern.h re.h regex.h
+struct.o: struct.c ruby.h config.h defines.h intern.h
+time.o: time.c ruby.h config.h defines.h intern.h
+util.o: util.c ruby.h config.h defines.h intern.h util.h
+variable.o: variable.c ruby.h config.h defines.h intern.h env.h node.h st.h
+version.o: version.c ruby.h config.h defines.h intern.h version.h
diff --git a/NEWS b/NEWS
deleted file mode 100644
index d71b913142..0000000000
--- a/NEWS
+++ /dev/null
@@ -1,227 +0,0 @@
-# -*- rdoc -*-
-
-= NEWS for Ruby 2.3.0
-
-This document is a list of user visible feature changes made between
-releases except for bug fixes.
-
-Note that each entry is kept so brief that no reason behind or
-reference information is supplied with.  For a full list of changes
-with all sufficient information, see the ChangeLog file.
-
-== Changes since the 2.2.0 release
-
-=== Language changes
-
-* frozen-string-literal pragma:
-  * new pragma, frozen-string-literal has been experimentally introduced.
-  * besides, --enable/--disable=frozen-string-literal options also have
-    been introduced.
-
-* safe navigation operator:
-
-  * new method call syntax, `object&.foo', method #foo is called on
-    `object' if it is not nil.
-    this is similar to `try!' in Active Support, except:
-    * method name is syntactically required
-          obj.try! {} # valid
-          obj&. {}    # syntax error
-    * arguments are evaluated only if a call is made:
-          obj.try!(:foo, bar())  # bar() is always evaluated
-          obj&.foo(bar())        # bar() is conditionally evaluated
-    * attribute assignment is valid
-          obj&.attr += 1
-
-=== Core classes updates (outstanding ones only)
-
-* ARGF
-
-  * ARGF.read_nonblock supports `exception: false' like IO#read_nonblock.
-    [Feature #11358]
-
-* Array
-
-  * Array#bsearch_index [Feature #10730]
-  * Array#dig [Feature #11643]
-
-* Enumerable
-
-  * Enumerable#grep_v is added as inverse version of Enumerable#grep.
-    [Feature #11049]
-  * Enumerable#chunk_while [Feature #10769]
-
-* File
-
-  * File.mkfifo [Feature #11536]
-  * Add File::TMPFILE corresponding to O_TMPFILE
-
-* Hash
-
-  * Hash#fetch_values [Feature #10017]
-  * Hash#dig [Feature #11643]
-  * Hash#<=, Hash#<, Hash#>=, Hash#> [Feature #10984]
-  * Hash#to_proc [Feature #11653]
-
-* IO
-
-  * new mode flag File::SHARE_DELETE is available.
-    this flag means to permit deleting opened file on Windows, but currently
-    this affect only files opened as binary.  [Feature #11218]
-
-  * new option parameter `flags' is added.
-    this parameter is bitwise-ORed to oflags generated by normal mode argument.
-    [Feature #11253]
-
-* Kernel
-
-  * Kernel#loop, when stopped by a StopIteration exception, returns
-    what the enumerator has returned instead of nil. [Feature #11498]
-
-* Module
-  * Module#deprecate_constant [Feature #11398]
-
-* NameError
-  * NameError#receiver is added to take the receiver object. [Feature #10881]
-
-* Numeric
-
-  * Numeric#positive? and Numeric#negative? are added, which return
-    true when the receiver is positive and negative respectively.
-    [Feature #11151]
-
-* Proc
-
-  * Proc#call (and also #[], #===, #yield) are optimized.
-    Backtrace doesn't show each methods (show block lines directly).
-    TracePoint also ignore these calls. [Feature #11569]
-
-* Thread
-  * Thread#name, Thread#name= are added to handle thread names [Feature #11251]
-
-=== Core classes compatibility issues (excluding feature bug fixes)
-
-* Array
-  * Array#select!, Array#keep_if, Array#reject!, and Array#delete_if
-    no longer changes the receiver array instantly every time the
-    block is called.  [Feature #10714]
-
-  * Array#flatten and Array#flatten! no longer try to call #to_ary
-    method on elements beyond the given level.  [Bug #10748]
-
-* Enumerable
-  * Enumerable#chunk and Enumerable#slice_before no longer takes the
-    initial_state argument.  [Feature #10958]
-    Use a local variable instead to maintain a state.
-
-* File::Stat
-  * On Windows File::Stat#ino always returned 0, but now returns
-    BY_HANDLE_FILE_INFORMATION.nFileIndexHigh/Low.
-
-* IO
-  * IO#close doesn't raise when the IO object is closed.  [Feature #10718]
-  * IO#each_codepoint raises an exception at incomplete character
-    before EOF when conversion takes place.  [Bug #11444]
-
-* Module
-  * Module#define_method and Object.define_singleton_method now
-    require method body, Proc, Method, or a block, and raise
-    ArgumentError if no block is given directly.  [Bug #11283]
-
-* pack/unpack (Array/String)
-  * j and J directives for pointer width integer type.  [Feature #11215]
-
-
-=== Stdlib updates (outstanding ones only)
-
-* Socket
-  * Socket#connect_nonblock, Socket#accept_nonblock,
-    TCPServer#accept_nonblock, UNIXServer#accept_nonblock,
-    BasicSocket#recv_nonblock, BasicSocket#recvmsg_nonblock,
-    BasicSocket#sendmsg_nonblock all support `exception: false` to return
-    :wait_readable or :wait_writable symbols instead of raising
-    IO::WaitReadable or IO::WaitWritable exceptions
-  * BasicSocket#recv and BasicSocket#recv_nonblock allow an output
-    String buffer argument like IO#read and IO#read_nonblock to reduce
-    GC overhead
-
-* ObjectSpace (objspace)
-  * ObjectSpace.count_symbols is added.
-  * ObjectSpace.count_imemo_objects is added.
-  * ObjectSpace.internal_class_of is added.
-  * ObjectSpace.internal_super_of is added.
-
-* OpenSSL
-  * OpenSSL::SSL::SSLSocket#accept_nonblock and
-    OpenSSL::SSL::SSLSocket#connect_nonblock supports `exception: false`.
-
-* Pathname
-  * Pathname#descend and Pathname#ascend supported blockless form.
-    [Feature #11052]
-
-* io/wait
-  * IO#wait_readable no longer checks FIONREAD, it may be used for
-    non-bytestream IO such as listen sockets.
-
-* timeout
-  * Object#timeout is now warned as deprecated when called.
-
-* Net::FTP
-  * Net::FTP#mlst is added.
-  * Net::FTP#mlsd is added.
-
-=== Stdlib compatibility issues (excluding feature bug fixes)
-
-* lib/webrick/utils.rb
- * removed unused argument. https://github.com/ruby/ruby/pull/356
-
-* lib/drb/drb.rb
- * removed unused argument. https://github.com/ruby/ruby/pull/515
-
-* lib/base64.rb
- * Base64.urlsafe_encode64: added a "padding" option to suppress
-   the padding character ("=").
- * Base64.urlsafe_decode64: now it accepts not only correctly-padded
-   input but also unpadded input.
-
-* lib/matrix.rb
- * Add Vector#round. https://github.com/ruby/ruby/pull/802
-
-* ext/coverage/coverage.c
-  * Coverage.peek_result: new method to allow coverage to be captured without
-    stopping the coverage tool.
-
-* Net::HTTP
-  * default value of Net::HTTP#open_timeout is now 60 (was nil).
-
-* Net::Telnet
-  * Net::Telnet is extracted to net-telnet gem. It's unmaintain code.
-
-* Net::FTP
-  * Connections are in passive mode per default now.  The default mode can
-    be changed by Net::FTP.default_passive=.
-
-* Rake
-  * Rake is removed from stdlib.
-
-=== Built-in global variables compatibility issues
-
-* $SAFE
-  * $SAFE=2 and $SAFE=3 are obsolete.  If $SAFE is set to 2 or larger,
-    an ArgumentError is raised.  [Feature #5455]
-
-=== C API updates
-
-* rb_define_class_id_under() now raises a TypeError exception when the
-  class is already defined but its superclass does not match the given
-  superclass, as well as definitions in ruby level.
-
-* rb_timespec_now() is added to fetch current datetime as struct timespec.
-
-* rb_time_timespec_new() is added to create a time object with epoch,
-  nanosecond, and UTC/localtime/time offset arguments.
-
-=== Build system updates
-
-=== Implementation changes
-* OS/2 is no longer supported
-* Borland-C is no longer supported
diff --git a/README b/README
new file mode 100644
index 0000000000..c8b975429e
--- /dev/null
+++ b/README
@@ -0,0 +1,130 @@
+* What's Ruby
+
+Ruby is the interpreted scripting language for quick and
+easy object-oriented programming.  It has many features to
+process text files and to do system management tasks (as in
+Perl).  It is simple, straight-forward, and extensible.
+
+* Features of Ruby
+
+  + Simple Syntax
+  + *Normal* Object-Oriented features(ex. class, method calls)
+  + *Advanced* Object-Oriented features(ex. Mix-in, Singleton-method)
+  + Operator Overloading
+  + Exception Handling
+  + Iterators and Closures
+  + Garbage Collection
+  + Dynamic Loading of Object files(on some architecture)
+  + Highly Portable(works on many UNIX machines)
+
+* How to get Ruby
+
+The Ruby distribution can be found on
+
+  ftp://ftp.netlab.co.jp/pub/lang/ruby/
+
+* How to compile and install
+
+This is what you need to do to compile and install Ruby:
+
+  1. Run ./configure, which will generate config.h and Makefile.
+
+  2. Edit defines.h if you need.  Probably this step will not need.
+
+  3. Remove comment mark(#) before the module names from ext/Setup (or
+     add module names if not present), if you want to link modules
+     statically.
+
+     If you don't want to compile non static extension modules
+     (probably on architectures which does not allow dynamic loading),
+     remove comment mark from the line "#option nodynamic" in
+     ext/Setup.
+
+  4. Run make.
+
+  5. Optionally, run 'make test' to check whether the compiled Ruby
+     interpreter works well.  If you see the message "test succeeded",
+     your Ruby works as it should (hopefully).
+
+  6. Run 'make install'
+
+If you fail to compile Ruby, please send the detailed error report with
+the error log and machine/OS type, to help others.
+
+* Copying
+
+Ruby is copyrighted free software by Yukihiro Matsumoto <matz@netlab.co.jp>.
+You can redistribute it and/or modify it under either the terms of the GPL
+(see COPYING file), or the conditions below:
+
+  1. You may make and give away verbatim copies of the source form of the
+     software without restriction, provided that you duplicate all of the
+     original copyright notices and associated disclaimers.
+
+  2. You may modify your copy of the software in any way, provided that
+     you do at least ONE of the following:
+
+       a) place your modifications in the Public Domain or otherwise
+          make them Freely Available, such as by posting said
+	  modifications to Usenet or an equivalent medium, or by allowing
+	  the author to include your modifications in the software.
+
+       b) use the modified software only within your corporation or
+          organization.
+
+       c) rename any non-standard executables so the names do not conflict
+	  with standard executables, which must also be provided.
+
+       d) make other distribution arrangements with the author.
+
+  3. You may distribute the software in object code or executable
+     form, provided that you do at least ONE of the following:
+
+       a) distribute the executables and library files of the software,
+	  together with instructions (in the manual page or equivalent)
+	  on where to get the original distribution.
+
+       b) accompany the distribution with the machine-readable source of
+	  the software.
+
+       c) give non-standard executables non-standard names, with
+          instructions on where to get the original software distribution.
+
+       d) make other distribution arrangements with the author.
+
+  4. You may modify and include the part of the software into any other
+     software (possibly commercial).  But some files in the distribution
+     are not written by the author, so that they are not under this terms.
+     They are gc.c(partly), utils.c(partly), regex.[ch], fnmatch.[ch],
+     glob.c, st.[ch] and some files under the ./missing directory.  See
+     each file for the copying condition.
+
+  5. The scripts and library files supplied as input to or produced as 
+     output from the software do not automatically fall under the
+     copyright of the software, but belong to whomever generated them, 
+     and may be sold commercially, and may be aggregated with this
+     software.
+
+  6. THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR
+     IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED
+     WARRANTIES OF MERCHANTIBILITY AND FITNESS FOR A PARTICULAR
+     PURPOSE.
+
+* Ruby home-page
+
+The URL of the Ruby home-page is:
+
+   http://www.netlab.co.jp/ruby/
+
+* The Author
+
+Feel free to send comments and bug reports to the author.  Here is the 
+author's latest mail address:
+
+  matz@netlab.co.jp
+
+-------------------------------------------------------
+created at: Thu Aug  3 11:57:36 JST 1995
+Local variables:
+mode: indented-text
+end:
diff --git a/README.EXT b/README.EXT
index 48b8d964c4..7d2d6456c4 100644
--- a/README.EXT
+++ b/README.EXT
@@ -1 +1,1060 @@
-Moved to doc/extension.rdoc
+.\" README.EXT -  -*- Text -*- created at: Mon Aug  7 16:45:54 JST 1995
+
+This document explains how to make extention modules for Ruby.
+
+1¡¥Basic knowledge
+
+In C, variables have types and data do not have types.  In contrast,
+Ruby variables do not have static type and data themselves have
+types.  So, data need to be converted across the languages.
+
+Data in Ruby represented C type `VALUE'.  Each VALUE data have its
+data-type.
+
+To retrieve an C data from the VALUE, you need to:
+
+ (1) Identify VALUE's data type
+ (2) Convert VALUE into C data
+
+Converting to wrong data type may cause serious promblems.
+
+
+1.1 Data-types
+
+Ruby interpreter has data-types as below:
+
+	T_NIL		nil
+	T_OBJECT	ordinaly object
+	T_CLASS		class
+	T_MODULE	module
+	T_FLOAT		floating point number
+	T_STRING	string
+	T_REGEXP	regular expression
+	T_ARRAY		array
+	T_FIXNUM	Fixnum(31bit integer)
+	T_HASH		assosiative array
+	T_STRUCT	(Ruby) structure
+	T_BIGNUM	multi precision integer
+	T_TRUE		true
+	T_FALSE		false
+	T_DATA		data
+
+Otherwise, there are several other types used internally:
+
+	T_ICLASS
+	T_MATCH
+	T_VARMAP
+	T_SCOPE
+	T_NODE
+
+Most of the types are represented by C structures.
+
+1.2 Check Data Type of the VALUE
+
+The macro TYPE() defined in ruby.h shows data-type of the VALUE.
+TYPE() returns the constant number T_XXXX described above.  To handle
+data-types, the code will be like:
+
+  switch (TYPE(obj)) {
+    case T_FIXNUM:
+      /* process Fixnum */
+      break;
+    case T_STRING:
+      /* process String */
+      break;
+    case T_ARRAY:
+      /* process Array */
+      break;
+    default:
+      /* raise exception */
+      Fail("not valid value");
+      break;
+  }
+
+There is the data-type check function.
+
+  void Check_Type(VALUE value, int type)
+
+It raises an exception, if the VALUE does not have the type specified.
+
+There are faster check-macros for fixnums and nil.
+
+  FIXNUM_P(obj)
+  NIL_P(obj)
+
+1.3 Convert VALUE into C data
+
+¥Ç¡¼¥¿¥¿¥¤¥×¤¬T_NIL, T_FALSE, T_TRUE¤Ç¤¢¤ë»þ¡¤¥Ç¡¼¥¿¤Ï¤½¤ì¤¾
+¤ìnil, false, true¤Ç¤¹¡¥¤³¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤Î¥ª¥Ö¥¸¥§¥¯¥È¤Ï¤Ò¤È
+¤Ä¤º¤Ä¤·¤«Â¸ºß¤·¤Þ¤»¤ó¡¥
+
+¥Ç¡¼¥¿¥¿¥¤¥×¤¬T_FIXNUM¤Î»þ¡¤¤³¤ì¤Ï31bit¤Î¥µ¥¤¥º¤ò»ý¤ÄÀ°¿ô¤Ç
+¤¹¡¥FIXNUM¤òC¤ÎÀ°¿ô¤ËÊÑ´¹¤¹¤ë¤¿¤á¤Ë¤Ï¥Þ¥¯¥í¡ÖFIX2INT()¡×¤ò»È
+¤¤¤Þ¤¹¡¥¤½¤ì¤«¤é¡¤FIXNUM¤Ë¸Â¤é¤ºRuby¤Î¥Ç¡¼¥¿¤òÀ°¿ô¤ËÊÑ´¹¤¹¤ë
+¡ÖNUM2INT()¡×¤È¤¤¤¦¥Þ¥¯¥í¤¬¤¢¤ê¤Þ¤¹¡¥¤³¤Î¥Þ¥¯¥í¤Ï¥Ç¡¼¥¿¥¿¥¤
+¥×¤Î¥Á¥§¥Ã¥¯Ìµ¤·¤Ç»È¤¨¤Þ¤¹(À°¿ô¤ËÊÑ´¹¤Ç¤­¤Ê¤¤¾ì¹ç¤Ë¤ÏÎã³°¤¬
+ȯÀ¸¤¹¤ë)¡¥
+
+¤½¤ì°Ê³°¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤ÏÂбþ¤¹¤ëC¤Î¹½Â¤ÂΤ¬¤¢¤ê¤Þ¤¹¡¥Âбþ¤¹
+¤ë¹½Â¤ÂΤΤ¢¤ëVALUE¤Ï¤½¤Î¤Þ¤Þ¥­¥ã¥¹¥È(·¿ÊÑ´¹)¤¹¤ì¤Ð¹½Â¤ÂΤÎ
+¥Ý¥¤¥ó¥¿¤ËÊÑ´¹¤Ç¤­¤Þ¤¹¡¥
+
+¹½Â¤ÂΤϡÖstruct RXxxxx¡×¤È¤¤¤¦Ì¾Á°¤Çruby.h¤ÇÄêµÁ¤µ¤ì¤Æ¤¤¤Þ
+¤¹¡¥Î㤨¤Ðʸ»úÎó¤Ï¡Östruct RString¡×¤Ç¤¹¡¥¼ÂºÝ¤Ë»È¤¦²ÄǽÀ­¤¬
+¤¢¤ë¤Î¤Ïʸ»úÎó¤ÈÇÛÎ󤯤餤¤À¤È»×¤¤¤Þ¤¹¡¥
+
+ruby.h¤Ç¤Ï¹½Â¤ÂΤإ­¥ã¥¹¥È¤¹¤ë¥Þ¥¯¥í¤â¡ÖRXXXXX()¡×(Á´ÉôÂçʸ
+»ú¤Ë¤·¤¿¤â¤Î)¤È¤¤¤¦Ì¾Á°¤ÇÄ󶡤µ¤ì¤Æ¤¤¤Þ¤¹(Îã: RSTRING())¡¥
+
+Î㤨¤Ð¡¤Ê¸»úÎóstr¤ÎŤµ¤òÆÀ¤ë¤¿¤á¤Ë¤Ï¡ÖRSTRING(str)->len¡×¤È
+¤·¡¤Ê¸»úÎóstr¤òchar*¤È¤·¤ÆÆÀ¤ë¤¿¤á¤Ë¤Ï¡ÖRSTRING(str)->ptr¡×
+¤È¤·¤Þ¤¹¡¥ÇÛÎó¤Î¾ì¹ç¤Ë¤Ï¡¤¤½¤ì¤¾¤ì¡ÖRARRAT(str)->len¡×¡¤
+¡ÖRARRAT(str)->ptr¡×¤È¤Ê¤ê¤Þ¤¹¡¥
+
+Ruby¤Î¹½Â¤ÂΤòľÀÜ¥¢¥¯¥»¥¹¤¹¤ë»þ¤Ëµ¤¤ò¤Ä¤±¤Ê¤±¤ì¤Ð¤Ê¤é¤Ê¤¤¤³
+¤È¤Ï¡¤ÇÛÎó¤äʸ»úÎó¤Î¹½Â¤ÂΤÎÃæ¿È¤Ï»²¾È¤¹¤ë¤À¤±¤Ç¡¤Ä¾ÀÜÊѹ¹¤·
+¤Ê¤¤¤³¤È¤Ç¤¹¡¥Ä¾ÀÜÊѹ¹¤·¤¿¾ì¹ç¡¤¥ª¥Ö¥¸¥§¥¯¥È¤ÎÆâÍƤÎÀ°¹çÀ­¤¬
+¤È¤ì¤Ê¤¯¤Ê¤Ã¤Æ¡¤»×¤ï¤Ì¥Ð¥°¤Î¸¶°ø¤Ë¤Ê¤ê¤Þ¤¹¡¥
+
+1.4 Convert C data into VALUE
+
+VALUE¤Î¼ÂºÝ¤Î¹½Â¤¤Ï
+
+  * FIXNUM¤Î¾ì¹ç
+
+    1bit±¦¥·¥Õ¥È¤·¤Æ¡¤LSB¤òΩ¤Æ¤ë¡¥
+
+  * ¤½¤Î¾¤Î¥Ý¥¤¥ó¥¿¤Î¾ì¹ç
+
+    ¤½¤Î¤Þ¤ÞVALUE¤Ë¥­¥ã¥¹¥È¤¹¤ë¡¥
+
+¤È¤Ê¤Ã¤Æ¤¤¤Þ¤¹¡¥¤è¤Ã¤Æ¡¤LSB¤ò¥Á¥§¥Ã¥¯¤¹¤ì¤ÐVALUE¤¬FIXNUM¤«¤É
+¤¦¤«¤ï¤«¤ë¤ï¤±¤Ç¤¹(¥Ý¥¤¥ó¥¿¤ÎLSB¤¬Î©¤Ã¤Æ¤¤¤Ê¤¤¤³¤È¤ò²¾Äꤷ¤Æ
+¤¤¤ë)¡¥
+
+¤Ç¤¹¤«¤é¡¤FIXNUM°Ê³°¤ÎRuby¤Î¥ª¥Ö¥¸¥§¥¯¥È¤Î¹½Â¤ÂΤÏñ¤ËVALUE
+¤Ë¥­¥ã¥¹¥È¤¹¤ë¤À¤±¤ÇVALUE¤ËÊÑ´¹½ÐÍè¤Þ¤¹¡¥¤¿¤À¤·¡¤Ç¤°Õ¤Î¹½Â¤
+ÂΤ¬VALUE¤Ë¥­¥ã¥¹¥È½ÐÍè¤ë¤ï¤±¤Ç¤Ï¤¢¤ê¤Þ¤»¤ó¡¥¥­¥ã¥¹¥È¤¹¤ë¤Î
+¤ÏRuby¤ÎÃΤäƤ¤¤ë¹½Â¤ÂÎ(ruby.h¤ÇÄêµÁ¤µ¤ì¤Æ¤¤¤ëstruct RXxxx
+¤Î¤â¤Î)¤À¤±¤Ë¤·¤Æ¤ª¤¤¤Æ¤¯¤À¤µ¤¤¡¥
+
+FIXNUM¤Ë´Ø¤·¤Æ¤ÏÊÑ´¹¥Þ¥¯¥í¤ò·Ðͳ¤¹¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¡¥C¤ÎÀ°¿ô
+¤«¤éVALUE¤ËÊÑ´¹¤¹¤ë¥Þ¥¯¥í¤Ï°Ê²¼¤Î¤â¤Î¤¬¤¢¤ê¤Þ¤¹¡¥É¬Íפ˱þ¤¸
+¤Æ»È¤¤Ê¬¤±¤Æ¤¯¤À¤µ¤¤¡¥
+
+  INT2FIX()	¤â¤È¤ÎÀ°¿ô¤¬31bit°ÊÆâ¤Ë¼ý¤Þ¤ë»þ
+  INT2NUM()	Ǥ°Õ¤ÎÀ°¿ô¤«¤éVALUE¤Ø
+
+INT2NUM()¤ÏÀ°¿ô¤¬FIXNUM¤ÎÈϰϤ˼ý¤Þ¤é¤Ê¤¤¾ì¹ç¡¤Bignum¤ËÊÑ´¹
+¤·¤Æ¤¯¤ì¤Þ¤¹(¤¬¡¤¾¯¤·ÃÙ¤¤)¡¥
+
+1.5 Manipulate Ruby data
+
+ÀèÄø¤â½Ò¤Ù¤¿Ä̤ꡤRuby¤Î¹½Â¤ÂΤò¥¢¥¯¥»¥¹¤¹¤ë»þ¤ËÆâÍƤι¹¿·¤ò
+¹Ô¤¦¤³¤È¤Ï´«¤á¤é¤ì¤Þ¤»¤ó¡¥¤Ç¡¤Ruby¤Î¥Ç¡¼¥¿¤òÁàºî¤¹¤ë»þ¤Ë¤Ï
+Ruby¤¬ÍÑ°Õ¤·¤Æ¤¤¤ë´Ø¿ô¤òÍѤ¤¤Æ¤¯¤À¤µ¤¤¡¥
+
+¤³¤³¤Ç¤Ï¤â¤Ã¤È¤â»È¤ï¤ì¤ë¤Ç¤¢¤í¤¦Ê¸»úÎó¤ÈÇÛÎó¤ÎÀ¸À®/Áàºî¤ò¹Ô
+¤¤´Ø¿ô¤ò¤¢¤²¤Þ¤¹(Á´Éô¤Ç¤Ï¤Ê¤¤¤Ç¤¹)¡¥
+
+ String funtions
+
+  str_new(char *ptr, int len)
+
+    Creates a new Ruby string.
+
+  str_new2(char *ptr)
+
+    Creates a new Ruby string from C string.  This is equivalent to
+    str_new(ptr, strlen(ptr)).
+
+  str_cat(VALUE str, char *ptr, int len)
+
+    Appends len bytes data from ptr to the Ruby string.
+
+ Array functions
+
+  ary_new()
+
+    Creates an array with no element.
+
+  ary_new2(int len)
+
+    Creates an array with no element, with allocating internal buffer
+    for len elements.
+
+  ary_new3(int n, ...)
+
+    Creates an n-elements array from arguments.
+
+  ary_new4(int n, VALUE *elts)
+
+    Creates an n-elements array from C array.
+
+  ary_push(VALUE ary)
+  ary_pop(VALUE ary, VALUE val)
+  ary_shift(VALUE ary)
+  ary_unshift(VALUE ary, VALUE val)
+  ary_entry(VALUE ary, int idx)
+
+    Array operations.  The first argument to each functions must be an 
+    array.  They may dump core if other types given.
+
+2. Extend Ruby with C
+
+¸¶ÍýŪ¤ËRuby¤Ç½ñ¤±¤ë¤³¤È¤ÏC¤Ç¤â½ñ¤±¤Þ¤¹¡¥Ruby¤½¤Î¤â¤Î¤¬C¤Çµ­
+½Ò¤µ¤ì¤Æ¤¤¤ë¤ó¤Ç¤¹¤«¤é¡¤ÅöÁ³¤È¤¤¤¨¤ÐÅöÁ³¤Ê¤ó¤Ç¤¹¤±¤É¡¥¤³¤³¤Ç
+¤ÏRuby¤Î³ÈÄ¥¤Ë»È¤¦¤³¤È¤¬Â¿¤¤¤À¤í¤¦¤Èͽ¬¤µ¤ì¤ëµ¡Ç½¤òÃæ¿´¤Ë¾Ò
+²ð¤·¤Þ¤¹¡¥
+
+2.1 Add new features to Ruby
+
+Ruby¤ÇÄ󶡤µ¤ì¤Æ¤¤¤ë´Ø¿ô¤ò»È¤¨¤ÐRuby¥¤¥ó¥¿¥×¥ê¥¿¤Ë¿·¤·¤¤µ¡Ç½
+¤òÄɲ乤뤳¤È¤¬¤Ç¤­¤Þ¤¹¡¥Ruby¤Ç¤Ï°Ê²¼¤Îµ¡Ç½¤òÄɲ乤ë´Ø¿ô¤¬
+Ä󶡤µ¤ì¤Æ¤¤¤Þ¤¹¡¥
+
+ * ¥¯¥é¥¹¡¤¥â¥¸¥å¡¼¥ë
+ * ¥á¥½¥Ã¥É¡¤Æðۥ᥽¥Ã¥É¤Ê¤É
+ * Äê¿ô
+
+¤Ç¤Ï½ç¤Ë¾Ò²ð¤·¤Þ¤¹¡¥
+
+2.1.1 Class/module definition
+
+¥¯¥é¥¹¤ä¥â¥¸¥å¡¼¥ë¤òÄêµÁ¤¹¤ë¤¿¤á¤Ë¤Ï¡¤°Ê²¼¤Î´Ø¿ô¤ò»È¤¤¤Þ¤¹¡¥
+
+  VALUE rb_define_class(char *name, VALUE super)
+  VALUE rb_define_module(char *name)
+
+¤³¤ì¤é¤Î´Ø¿ô¤Ï¿·¤·¤¯ÄêµÁ¤µ¤ì¤¿¥¯¥é¥¹¤ä¥â¥¸¥å¡¼¥ë¤òÊÖ¤·¤Þ¤¹¡¥
+¥á¥½¥Ã¥É¤äÄê¿ô¤ÎÄêµÁ¤Ë¤³¤ì¤é¤ÎÃͤ¬É¬ÍפʤΤǡ¤¤Û¤È¤ó¤É¤Î¾ì¹ç
+¤ÏÌá¤êÃͤòÊÑ¿ô¤Ë³ÊǼ¤·¤Æ¤ª¤¯É¬Íפ¬¤¢¤ë¤Ç¤·¤ç¤¦¡¥
+
+2.1.2 Method/singleton method definition
+
+¥á¥½¥Ã¥É¤äÆðۥ᥽¥Ã¥É¤òÄêµÁ¤¹¤ë¤Ë¤Ï°Ê²¼¤Î´Ø¿ô¤ò»È¤¤¤Þ¤¹¡¥
+
+  void rb_define_method(VALUE class, char *name, 
+		        VALUE (*func)(), int argc)
+
+  void rb_define_singleton_method(VALUE object, char *name, 
+			         VALUE (*func)(), int argc)
+
+
+Ç°¤Î¤¿¤áÀâÌÀ¤¹¤ë¤È¡ÖÆðۥ᥽¥Ã¥É¡×¤È¤Ï¡¤¤½¤ÎÆÃÄê¤Î¥ª¥Ö¥¸¥§¥¯
+¥È¤ËÂФ·¤Æ¤À¤±Í­¸ú¤Ê¥á¥½¥Ã¥É¤Ç¤¹¡¥Ruby¤Ç¤Ï¤è¤¯Smalltalk¤Ë¤ª
+¤±¤ë¥¯¥é¥¹¥á¥½¥Ã¥É¤È¤·¤Æ¡¤¥¯¥é¥¹¤ËÂФ¹¤ëÆðۥ᥽¥Ã¥É¤¬»È¤ï¤ì
+¤Þ¤¹¡¥
+
+¤³¤ì¤é¤Î´Ø¿ô¤Î argc¤È¤¤¤¦°ú¿ô¤ÏC¤Î´Ø¿ô¤ØÅϤµ¤ì¤ë°ú¿ô¤Î¿ô(¤È
+·Á¼°)¤ò·è¤á¤Þ¤¹¡¥argc¤¬Àµ¤Î»þ¤Ï´Ø¿ô¤Ë°ú¤­ÅϤ¹°ú¿ô¤Î¿ô¤ò°ÕÌ£
+¤·¤Þ¤¹¡¥16¸Ä°Ê¾å¤Î°ú¿ô¤Ï»È¤¨¤Þ¤»¤ó(¤¬¡¤Íפê¤Þ¤»¤ó¤è¤Í¡¤¤½¤ó
+¤Ê¤Ë)¡¥
+
+argc¤¬Éé¤Î»þ¤Ï°ú¿ô¤Î¿ô¤Ç¤Ï¤Ê¤¯¡¤·Á¼°¤ò»ØÄꤷ¤¿¤³¤È¤Ë¤Ê¤ê¤Þ¤¹¡¥
+argc¤¬-1¤Î»þ¤Ï°ú¿ô¤òÇÛÎó¤ËÆþ¤ì¤ÆÅϤµ¤ì¤Þ¤¹¡¥argc¤¬-2¤Î»þ¤Ï°ú
+¿ô¤ÏRuby¤ÎÇÛÎó¤È¤·¤ÆÅϤµ¤ì¤Þ¤¹¡¥
+
+¥á¥½¥Ã¥É¤òÄêµÁ¤¹¤ë´Ø¿ô¤Ï¤â¤¦Æó¤Ä¤¢¤ê¤Þ¤¹¡¥¤Ò¤È¤Ä¤Ïprivate¥á
+¥½¥Ã¥É¤òÄêµÁ¤¹¤ë´Ø¿ô¤Ç¡¤°ú¿ô¤Ïrb_define_method()¤ÈƱ¤¸¤Ç¤¹¡¥
+
+  void rb_define_private_method(VALUE class, char *name, 
+			        VALUE (*func)(), int argc)
+
+private¥á¥½¥Ã¥É¤È¤Ï´Ø¿ô·Á¼°¤Ç¤·¤«¸Æ¤Ó½Ð¤¹¤³¤È¤Î½ÐÍè¤Ê¤¤¥á¥½¥Ã
+¥É¤Ç¤¹¡¥
+
+¤â¤¦¤Ò¤È¤Ä¤Ï¥â¥¸¥å¡¼¥ë´Ø¿ô¤òÄêµÁ¤¹¤ë¤â¤Î¤Ç¤¹¡¥¥â¥¸¥å¡¼¥ë´Ø¿ô
+¤È¤Ï¥â¥¸¥å¡¼¥ë¤ÎÆðۥ᥽¥Ã¥É¤Ç¤¢¤ê¡¤Æ±»þ¤Ëprivate¥á¥½¥Ã¥É¤Ç
+¤â¤¢¤ë¤â¤Î¤Ç¤¹¡¥Îã¤ò¤¢¤²¤ë¤ÈMath¥â¥¸¥å¡¼¥ë¤Îsqrt()¤Ê¤É¤¬¤¢¤²
+¤é¤ì¤Þ¤¹¡¥¤³¤Î¥á¥½¥Ã¥É¤Ï
+
+  Math.sqrt(4)
+
+¤È¤¤¤¦·Á¼°¤Ç¤â
+
+  include Math
+  sqrt(4)
+
+¤È¤¤¤¦·Á¼°¤Ç¤â»È¤¨¤Þ¤¹¡¥¥â¥¸¥å¡¼¥ë´Ø¿ô¤òÄêµÁ¤¹¤ë´Ø¿ô¤Ï°Ê²¼¤Î
+Ä̤ê¤Ç¤¹¡¥
+
+  void rb_define_module_function(VALUE module, char *name, 
+				 VALUE (*func)(), int argc)
+
+´Ø¿ôŪ¥á¥½¥Ã¥É(Kernel¥â¥¸¥å¡¼¥ë¤Îprivaet method)¤òÄêµÁ¤¹¤ë¤¿
+¤á¤Î´Ø¿ô¤Ï°Ê²¼¤ÎÄ̤ê¤Ç¤¹¡¥
+
+  void rb_define_global_function(char *name, VALUE (*func)(), int argc)
+
+
+2.1.3 Constant definition
+
+³ÈÄ¥¥â¥¸¥å¡¼¥ë¤¬É¬ÍפÊÄê¿ô¤Ï¤¢¤é¤«¤¸¤áÄêµÁ¤·¤Æ¤ª¤¤¤¿Êý¤¬Îɤ¤
+¤Ç¤·¤ç¤¦¡¥Äê¿ô¤òÄêµÁ¤¹¤ë´Ø¿ô¤ÏÆó¤Ä¤¢¤ê¤Þ¤¹¡¥
+
+  void rb_define_const(VALUE class, char *name, VALUE val)
+  void rb_define_global_const(char *name, VALUE val)
+
+Á°¼Ô¤ÏÆÃÄê¤Î¥¯¥é¥¹/¥â¥¸¥å¡¼¥ë¤Ë°¤¹¤ëÄê¿ô¤òÄêµÁ¤¹¤ë¤â¤Î¡¤¸å
+¼Ô¤Ï¥°¥í¡¼¥Ð¥ë¤ÊÄê¿ô¤òÄêµÁ¤¹¤ë¤â¤Î¤Ç¤¹¡¥
+
+2.2 Use Ruby features from C
+
+´û¤Ë¡Ø1.5 Ruby¤Î¥Ç¡¼¥¿¤òÁàºî¤¹¤ë¡Ù¤Ç°ìÉô¾Ò²ð¤·¤¿¤è¤¦¤Ê´Ø¿ô¤ò
+»È¤¨¤Ð¡¤Ruby¤Îµ¡Ç½¤ò¼Â¸½¤·¤Æ¤¤¤ë´Ø¿ô¤òľÀܸƤӽФ¹¤³¤È¤¬½ÐÍè
+¤Þ¤¹¡¥
+
+# ¤³¤Î¤è¤¦¤Ê´Ø¿ô¤Î°ìÍ÷ɽ¤Ï¤¤¤Þ¤Î¤È¤³¤í¤¢¤ê¤Þ¤»¤ó¡¥¥½¡¼¥¹¤ò¸«
+# ¤ë¤·¤«¤Ê¤¤¤Ç¤¹¤Í¡¥
+
+¤½¤ì°Ê³°¤Ë¤âRuby¤Îµ¡Ç½¤ò¸Æ¤Ó½Ð¤¹ÊýË¡¤Ï¤¤¤¯¤Ä¤«¤¢¤ê¤Þ¤¹¡¥
+
+2.2.1 Ruby¤Î¥×¥í¥°¥é¥à¤òeval¤¹¤ë
+
+C¤«¤éRuby¤Îµ¡Ç½¤ò¸Æ¤Ó½Ð¤¹¤â¤Ã¤È¤â´Êñ¤ÊÊýË¡¤È¤·¤Æ¡¤Ê¸»úÎó¤Ç
+Í¿¤¨¤é¤ì¤¿Ruby¤Î¥×¥í¥°¥é¥à¤òɾ²Á¤¹¤ë´Ø¿ô¤¬¤¢¤ê¤Þ¤¹¡¥
+
+  VALUE rb_eval_string(char *str)
+
+¤³¤Îɾ²Á¤Ï¸½ºß¤Î´Ä¶­¤Ç¹Ô¤ï¤ì¤Þ¤¹¡¥¤Ä¤Þ¤ê¡¤¸½ºß¤Î¥í¡¼¥«¥ëÊÑ¿ô
+¤Ê¤É¤ò¼õ¤±·Ñ¤®¤Þ¤¹¡¥
+
+2.2.2 ID or Symbol
+
+C¤«¤éʸ»úÎó¤ò·Ðͳ¤»¤º¤ËRuby¤Î¥á¥½¥Ã¥É¤ò¸Æ¤Ó½Ð¤¹¤³¤È¤â¤Ç¤­¤Þ
+¤¹¡¥¤½¤ÎÁ°¤Ë¡¤Ruby¥¤¥ó¥¿¥×¥ê¥¿Æâ¤Ç¥á¥½¥Ã¥É¤äÊÑ¿ô̾¤ò»ØÄꤹ¤ë
+»þ¤Ë»È¤ï¤ì¤Æ¤¤¤ëID¤Ë¤Ä¤¤¤ÆÀâÌÀ¤·¤Æ¤ª¤­¤Þ¤·¤ç¤¦¡¥
+
+ID¤È¤ÏÊÑ¿ô̾¡¤¥á¥½¥Ã¥É̾¤òɽ¤¹À°¿ô¤Ç¤¹¡¥Ruby¤ÎÃæ¤Ç¤Ï
+
+ :¼±ÊÌ»Ò
+
+¤Ç¥¢¥¯¥»¥¹¤Ç¤­¤Þ¤¹¡¥C¤«¤é¤³¤ÎÀ°¿ô¤òÆÀ¤ë¤¿¤á¤Ë¤Ï´Ø¿ô
+
+  rb_intern(char *name)
+
+¤ò»È¤¤¤Þ¤¹¡¥¤Þ¤¿°ìʸ»ú¤Î±é»»»Ò¤Ï¤½¤Îʸ»ú¥³¡¼¥É¤¬¤½¤Î¤Þ¤Þ¥·¥ó
+¥Ü¥ë¤Ë¤Ê¤Ã¤Æ¤¤¤Þ¤¹¡¥
+
+2.2.3 Invoke Ruby method from C
+
+C¤«¤éʸ»úÎó¤ò·Ðͳ¤»¤º¤ËRuby¤Î¥á¥½¥Ã¥É¤ò¸Æ¤Ó½Ð¤¹¤¿¤á¤Ë¤Ï°Ê²¼
+¤Î´Ø¿ô¤ò»È¤¤¤Þ¤¹¡¥
+
+  VALUE rb_funcall(VALUE recv, ID mid, int argc, ...)
+
+¤³¤Î´Ø¿ô¤Ï¥ª¥Ö¥¸¥§¥¯¥Èrecv¤Îmid¤Ç»ØÄꤵ¤ì¤ë¥á¥½¥Ã¥É¤ò¸Æ¤Ó½Ð
+¤·¤Þ¤¹¡¥
+
+2.2.4 ÊÑ¿ô/Äê¿ô¤ò»²¾È/¹¹¿·¤¹¤ë
+
+C¤«¤é´Ø¿ô¤ò»È¤Ã¤Æ»²¾È¡¦¹¹¿·¤Ç¤­¤ë¤Î¤Ï¡¤¥¯¥é¥¹Äê¿ô¡¤¥¤¥ó¥¹¥¿
+¥ó¥¹ÊÑ¿ô¤Ç¤¹¡¥Âç°èÊÑ¿ô¤Ï°ìÉô¤Î¤â¤Î¤ÏC¤ÎÂç°èÊÑ¿ô¤È¤·¤Æ¥¢¥¯¥»
+¥¹¤Ç¤­¤Þ¤¹¡¥¥í¡¼¥«¥ëÊÑ¿ô¤ò»²¾È¤¹¤ëÊýË¡¤Ï¸ø³«¤·¤Æ¤¤¤Þ¤»¤ó¡¥
+
+¥ª¥Ö¥¸¥§¥¯¥È¤Î¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô¤ò»²¾È¡¦¹¹¿·¤¹¤ë´Ø¿ô¤Ï°Ê²¼¤ÎÄÌ
+¤ê¤Ç¤¹¡¥
+
+  VALUE rb_ivar_get(VALUE obj, ID id)
+  VALUE rb_ivar_set(VALUE obj, ID id, VALUE val)
+
+id¤Ïrb_intern()¤ÇÆÀ¤é¤ì¤ë¤â¤Î¤ò»È¤Ã¤Æ¤¯¤À¤µ¤¤¡¥
+
+¥¯¥é¥¹Äê¿ô¤ò»²¾È¤¹¤ë¤Ë¤Ï°Ê²¼¤Î´Ø¿ô¤ò»È¤Ã¤Æ¤¯¤À¤µ¤¤¡¥
+
+  VALUE rb_const_get(VALUE obj, ID id)
+
+¥¯¥é¥¹Äê¿ô¤ò¿·¤·¤¯ÄêµÁ¤¹¤ë¤¿¤á¤Ë¤Ï¡Ø2.1.3 Äê¿ôÄêµÁ¡Ù¤Ç¾Ò²ð¤µ
+¤ì¤Æ¤¤¤ë´Ø¿ô¤ò»È¤Ã¤Æ¤¯¤À¤µ¤¤¡¥
+
+3. Informatin sharing between Ruby and C
+
+C¸À¸ì¤ÈRuby¤Î´Ö¤Ç¾ðÊó¤ò¶¦Í­¤¹¤ëÊýË¡¤Ë¤Ä¤¤¤Æ²òÀ⤷¤Þ¤¹¡¥
+
+3.1 Ruby constant that C¤«¤é»²¾È¤Ç¤­¤ëRuby¤ÎÄê¿ô
+
+Following Ruby constants can be referred from C.
+
+  TRUE
+  FALSE
+
+Boolean values.  FALSE is false in the C also (i.e. 0).
+
+  Qnil
+
+Ruby nil in C scope.
+
+3.2 Global variables shared between C and Ruby
+
+C¤ÈRuby¤ÇÂç°èÊÑ¿ô¤ò»È¤Ã¤Æ¾ðÊó¤ò¶¦Í­¤Ç¤­¤Þ¤¹¡¥¶¦Í­¤Ç¤­¤ëÂç°è
+ÊÑ¿ô¤Ë¤Ï¤¤¤¯¤Ä¤«¤Î¼ïÎब¤¢¤ê¤Þ¤¹¡¥¤½¤Î¤Ê¤«¤Ç¤â¤Ã¤È¤âÎɤ¯»È¤ï
+¤ì¤ë¤È»×¤ï¤ì¤ë¤Î¤Ïrb_define_variable()¤Ç¤¹¡¥
+
+  void rb_define_variable(char *name, VALUE *var)
+
+¤³¤Î´Ø¿ô¤ÏRuby¤ÈC¤È¤Ç¶¦Í­¤¹¤ëÂç°èÊÑ¿ô¤òÄêµÁ¤·¤Þ¤¹¡¥ÊÑ¿ô̾¤¬
+`$'¤Ç»Ï¤Þ¤é¤Ê¤¤»þ¤Ë¤Ï¼«Æ°Åª¤ËÄɲ䵤ì¤Þ¤¹¡¥¤³¤ÎÊÑ¿ô¤ÎÃͤòÊÑ
+¹¹¤¹¤ë¤È¼«Æ°Åª¤ËRuby¤ÎÂбþ¤¹¤ëÊÑ¿ô¤ÎÃͤâÊѤï¤ê¤Þ¤¹¡¥
+
+¤Þ¤¿Ruby¦¤«¤é¤Ï¹¹¿·¤Ç¤­¤Ê¤¤ÊÑ¿ô¤â¤¢¤ê¤Þ¤¹¡¥¤³¤Îread only¤Î
+ÊÑ¿ô¤Ï°Ê²¼¤Î´Ø¿ô¤ÇÄêµÁ¤·¤Þ¤¹¡¥
+
+  void rb_define_readonly_variable(char *name, VALUE *var)
+
+¤³¤ì¤éÊÑ¿ô¤Î¾¤Ëhook¤ò¤Ä¤±¤¿Âç°èÊÑ¿ô¤òÄêµÁ¤Ç¤­¤Þ¤¹¡¥hookÉÕ¤­
+¤ÎÂç°èÊÑ¿ô¤Ï°Ê²¼¤Î´Ø¿ô¤òÍѤ¤¤ÆÄêµÁ¤·¤Þ¤¹¡¥hookÉÕ¤­Âç°èÊÑ¿ô¤Î
+Ãͤλ²¾È¤äÀßÄê¤Ïhook¤Ç¹Ô¤¦É¬Íפ¬¤¢¤ê¤Þ¤¹¡¥
+
+  void rb_define_hooked_variable(char *name, VALUE *var,
+				 VALUE (*getter)(), VALUE (*setter)())
+
+¤³¤Î´Ø¿ô¤ÏC¤Î´Ø¿ô¤Ë¤è¤Ã¤Æhook¤Î¤Ä¤±¤é¤ì¤¿Âç°èÊÑ¿ô¤òÄêµÁ¤·¤Þ
+¤¹¡¥ÊÑ¿ô¤¬»²¾È¤µ¤ì¤¿»þ¤Ë¤Ï´Ø¿ôgetter¤¬¡¤ÊÑ¿ô¤ËÃͤ¬¥»¥Ã¥È¤µ¤ì
+¤¿»þ¤Ë¤Ï´Ø¿ôsetter¤¬¸Æ¤Ð¤ì¤ë¡¥hook¤ò»ØÄꤷ¤Ê¤¤¾ì¹ç¤Ïgetter¤ä
+setter¤Ë0¤ò»ØÄꤷ¤Þ¤¹¡¥
+
+# getter¤âsetter¤â0¤Ê¤é¤Ðrb_define_variable()¤ÈƱ¤¸¤Ë¤Ê¤ë¡¥
+
+¤½¤ì¤«¤é¡¤C¤Î´Ø¿ô¤Ë¤è¤Ã¤Æ¼Â¸½¤µ¤ì¤ëRuby¤ÎÂç°èÊÑ¿ô¤òÄêµÁ¤¹¤ë
+´Ø¿ô¤¬¤¢¤ê¤Þ¤¹¡¥
+
+  void rb_define_virtual_variable(char *name,
+				  VALUE (*getter)(), VALUE (*setter)())
+
+¤³¤Î´Ø¿ô¤Ë¤è¤Ã¤ÆÄêµÁ¤µ¤ì¤¿Ruby¤ÎÂç°èÊÑ¿ô¤¬»²¾È¤µ¤ì¤¿»þ¤Ë¤Ï
+getter¤¬¡¤ÊÑ¿ô¤ËÃͤ¬¥»¥Ã¥È¤µ¤ì¤¿»þ¤Ë¤Ïsetter¤¬¸Æ¤Ð¤ì¤Þ¤¹¡¥
+
+The prototypes of the getter and setter functions are as following:
+
+  (*getter)(ID id, void *data, struct global_entry* entry);
+  (*setter)(VALUE val, ID id, void *data, struct global_entry* entry);
+
+3.3 Encapsulate C data into Ruby object
+
+C¤ÎÀ¤³¦¤ÇÄêµÁ¤µ¤ì¤¿¥Ç¡¼¥¿(¹½Â¤ÂÎ)¤òRuby¤Î¥ª¥Ö¥¸¥§¥¯¥È¤È¤·¤Æ
+¼è¤ê°·¤¤¤¿¤¤¾ì¹ç¤¬¤¢¤ê¤¨¤Þ¤¹¡¥¤³¤Î¤è¤¦¤Ê¾ì¹ç¤Ë¤Ï¡¤Data¤È¤¤¤¦
+Ruby¥ª¥Ö¥¸¥§¥¯¥È¤ËC¤Î¹½Â¤ÂÎ(¤Ø¤Î¥Ý¥¤¥ó¥¿)¤ò¤¯¤ë¤à¤³¤È¤ÇRuby
+¥ª¥Ö¥¸¥§¥¯¥È¤È¤·¤Æ¼è¤ê°·¤¨¤ë¤è¤¦¤Ë¤Ê¤ê¤Þ¤¹¡¥
+
+Data¥ª¥Ö¥¸¥§¥¯¥È¤òÀ¸À®¤·¤Æ¹½Â¤ÂΤòRuby¥ª¥Ö¥¸¥§¥¯¥È¤Ë¥«¥×¥»¥ë
+²½¤¹¤ë¤¿¤á¤Ë¤Ï¡¤°Ê²¼¤Î¥Þ¥¯¥í¤ò»È¤¤¤Þ¤¹¡¥
+
+  Data_Wrap_Struct(class,mark,free,ptr)
+
+¤³¤Î¥Þ¥¯¥í¤ÎÌá¤êÃͤÏÀ¸À®¤µ¤ì¤¿Data¥ª¥Ö¥¸¥§¥¯¥È¤Ç¤¹¡¥
+
+class¤Ï¤³¤ÎData¥ª¥Ö¥¸¥§¥¯¥È¤Î¥¯¥é¥¹¤Ç¤¹¡¥ptr¤Ï¥«¥×¥»¥ë²½¤¹¤ë
+C¤Î¹½Â¤ÂΤؤΥݥ¤¥ó¥¿¤Ç¤¹¡¥mark¤Ï¤³¤Î¹½Â¤ÂΤ¬Ruby¤Î¥ª¥Ö¥¸¥§
+¥¯¥È¤Ø¤Î»²¾È¤¬¤¢¤ë»þ¤Ë»È¤¦´Ø¿ô¤Ç¤¹¡¥¤½¤Î¤è¤¦¤Ê»²¾È¤ò´Þ¤Þ¤Ê¤¤
+»þ¤Ë¤Ï0¤ò»ØÄꤷ¤Þ¤¹¡¥
+
+# ¤½¤Î¤è¤¦¤Ê»²¾È¤Ï´«¤á¤é¤ì¤Þ¤»¤ó¡¥
+
+free¤Ï¤³¤Î¹½Â¤ÂΤ¬¤â¤¦ÉÔÍפˤʤä¿»þ¤Ë¸Æ¤Ð¤ì¤ë´Ø¿ô¤Ç¤¹¡¥¤³¤Î
+´Ø¿ô¤¬¥¬¡¼¥Ù¡¼¥¸¥³¥ì¥¯¥¿¤«¤é¸Æ¤Ð¤ì¤Þ¤¹¡¥
+
+C¤Î¹½Â¤ÂΤγäÅö¤ÈData¥ª¥Ö¥¸¥§¥¯¥È¤ÎÀ¸À®¤òƱ»þ¤Ë¹Ô¤¦¥Þ¥¯¥í¤È
+¤·¤Æ°Ê²¼¤Î¤â¤Î¤¬Ä󶡤µ¤ì¤Æ¤¤¤Þ¤¹¡¥
+
+  Data_Make_Struct(class, type, mark, free, sval)
+
+¤³¤Î¥Þ¥¯¥í¤ÎÌá¤êÃͤÏÀ¸À®¤µ¤ì¤¿Data¥ª¥Ö¥¸¥§¥¯¥È¤Ç¤¹¡¥
+
+class, mark, free¤ÏData_Wrap_Struct¤ÈƱ¤¸Æ¯¤­¤ò¤·¤Þ¤¹¡¥type
+¤Ï³ä¤êÅö¤Æ¤ëC¹½Â¤ÂΤη¿¤Ç¤¹¡¥³ä¤êÅö¤Æ¤é¤ì¤¿¹½Â¤ÂΤÏÊÑ¿ôsval
+¤ËÂåÆþ¤µ¤ì¤Þ¤¹¡¥¤³¤ÎÊÑ¿ô¤Î·¿¤Ï (type*) ¤Ç¤¢¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¡¥
+
+Data¥ª¥Ö¥¸¥§¥¯¥È¤«¤é¥Ý¥¤¥ó¥¿¤ò¼è¤ê½Ð¤¹¤Î¤Ï°Ê²¼¤Î¥Þ¥¯¥í¤òÍѤ¤
+¤Þ¤¹¡¥
+
+  Data_Get_Struct(obj, type, sval)
+
+C¤Î¹½Â¤ÂΤؤΥݥ¤¥ó¥¿¤ÏÊÑ¿ôsval¤ËÂåÆþ¤µ¤ì¤Þ¤¹¡¥
+
+¤³¤ì¤é¤ÎData¤Î»È¤¤Êý¤Ï¤Á¤ç¤Ã¤Èʬ¤«¤ê¤Ë¤¯¤¤¤Î¤Ç¡¤¸å¤ÇÀâÌÀ¤¹¤ë
+ÎãÂê¤ò»²¾È¤·¤Æ¤¯¤À¤µ¤¤¡¥
+
+4¡¥Example - Create dbm module
+
+¤³¤³¤Þ¤Ç¤ÎÀâÌÀ¤Ç¤È¤ê¤¢¤¨¤º³ÈÄ¥¥â¥¸¥å¡¼¥ë¤Ïºî¤ì¤ë¤Ï¤º¤Ç¤¹¡¥
+Ruby¤Îext¥Ç¥£¥ì¥¯¥È¥ê¤Ë¤¹¤Ç¤Ë´Þ¤Þ¤ì¤Æ¤¤¤ëdbm¥â¥¸¥å¡¼¥ë¤òÎã¤Ë
+¤·¤ÆÃʳ¬Åª¤ËÀâÌÀ¤·¤Þ¤¹¡¥
+
+(1) make the directory
+
+  % mkdir ext/dbm
+
+Ruby¤òŸ³«¤·¤¿¥Ç¥£¥ì¥¯¥È¥ê¤Î²¼¡¤ext¥Ç¥£¥ì¥¯¥È¥ê¤ÎÃæ¤Ë³ÈÄ¥¥â
+¥¸¥å¡¼¥ëÍѤΥǥ£¥ì¥¯¥È¥ê¤òºî¤ê¤Þ¤¹¡¥Ì¾Á°¤ÏŬÅö¤ËÁª¤ó¤Ç¹½¤¤¤Þ
+¤»¤ó¡¥
+
+(2) create MANIFEST file
+
+  % cd ext/dbm
+  % touch MANIFEST
+
+³ÈÄ¥¥â¥¸¥å¡¼¥ë¤Î¥Ç¥£¥ì¥¯¥È¥ê¤Î²¼¤Ë¤ÏMANIFEST¤È¤¤¤¦¥Õ¥¡¥¤¥ë¤¬
+ɬÍפʤΤǡ¤¤È¤ê¤¢¤¨¤º¶õ¤Î¥Õ¥¡¥¤¥ë¤òºî¤Ã¤Æ¤ª¤­¤Þ¤¹¡¥¸å¤Ç¤³¤Î
+¥Õ¥¡¥¤¥ë¤Ë¤ÏɬÍפʥե¡¥¤¥ë°ìÍ÷¤¬Æþ¤ë¤³¤È¤Ë¤Ê¤ê¤Þ¤¹¡¥
+
+MANIFEST¤È¤¤¤¦¥Õ¥¡¥¤¥ë¤Ï¡¤make¤Î»þ¤Ë¥Ç¥£¥ì¥¯¥È¥ê¤¬³ÈÄ¥¥â¥¸¥å¡¼
+¥ë¤ò´Þ¤ó¤Ç¤¤¤ë¤«¤É¤¦¤«È½Äꤹ¤ë¤¿¤á¤Ë»È¤ï¤ì¤ì¤Æ¤¤¤Þ¤¹¡¥
+
+(3) design the library
+
+¤Þ¤¢¡¤ÅöÁ³¤Ê¤ó¤Ç¤¹¤±¤É¡¤¤É¤¦¤¤¤¦µ¡Ç½¤ò¼Â¸½¤¹¤ë¤«¤É¤¦¤«¤Þ¤ºÀß
+·×¤¹¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¡¥¤É¤ó¤Ê¥¯¥é¥¹¤ò¤Ä¤¯¤ë¤«¡¤¤½¤Î¥¯¥é¥¹¤Ë¤Ï
+¤É¤ó¤Ê¥á¥½¥Ã¥É¤¬¤¢¤ë¤«¡¤¥¯¥é¥¹¤¬Ä󶡤¹¤ëÄê¿ô¤Ê¤É¤Ë¤Ä¤¤¤ÆÀß·×
+¤·¤Þ¤¹¡¥dbm¥¯¥é¥¹¤Ë¤Ä¤¤¤Æ¤Ïext/dbm.doc¤ò»²¾È¤·¤Æ¤¯¤À¤µ¤¤¡¥
+
+(4) write C code.
+
+³ÈÄ¥¥â¥¸¥å¡¼¥ëËÜÂΤȤʤëC¸À¸ì¤Î¥½¡¼¥¹¤ò½ñ¤­¤Þ¤¹¡¥C¸À¸ì¤Î¥½¡¼
+¥¹¤¬¤Ò¤È¤Ä¤Î»þ¤Ë¤Ï¡Ö¥â¥¸¥å¡¼¥ë̾.c¡×¤òÁª¤Ö¤ÈÎɤ¤¤Ç¤·¤ç¤¦¡¥C
+¸À¸ì¤Î¥½¡¼¥¹¤¬Ê£¿ô¤Î¾ì¹ç¤Ë¤ÏµÕ¤Ë¡Ö¥â¥¸¥å¡¼¥ë̾.c¡×¤È¤¤¤¦¥Õ¥¡
+¥¤¥ë̾¤ÏÈò¤±¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¡¥¥ª¥Ö¥¸¥§¥¯¥È¥Õ¥¡¥¤¥ë¤È¥â¥¸¥å¡¼
+¥ëÀ¸À®»þ¤ËÃæ´ÖŪ¤ËÀ¸À®¤µ¤ì¤ë¡Ö¥â¥¸¥å¡¼¥ë̾.o¡×¤È¤¤¤¦¥Õ¥¡¥¤¥ë
+¤È¤¬¾×Æͤ¹¤ë¤«¤é¤Ç¤¹¡¥
+
+Ruby¤Ï³ÈÄ¥¥â¥¸¥å¡¼¥ë¤ò¥í¡¼¥É¤¹¤ë»þ¤Ë¡ÖInit_¥â¥¸¥å¡¼¥ë̾¡×¤È
+¤¤¤¦´Ø¿ô¤ò¼«Æ°Åª¤Ë¼Â¹Ô¤·¤Þ¤¹¡¥dbm¥â¥¸¥å¡¼¥ë¤Î¾ì¹ç¡ÖInit_dbm¡×
+¤Ç¤¹¡¥¤³¤Î´Ø¿ô¤ÎÃæ¤Ç¥¯¥é¥¹¡¤¥â¥¸¥å¡¼¥ë¡¤¥á¥½¥Ã¥É¡¤Äê¿ô¤Ê¤É¤Î
+ÄêµÁ¤ò¹Ô¤¤¤Þ¤¹¡¥dbm.c¤«¤é°ìÉô°úÍѤ·¤Þ¤¹¡¥
+
+--
+Init_dbm()
+{
+    /* DBM¥¯¥é¥¹¤òÄêµÁ¤¹¤ë */
+    cDBM = rb_define_class("DBM", cObject);
+    /* DBM¤ÏEnumerate¥â¥¸¥å¡¼¥ë¤ò¥¤¥ó¥¯¥ë¡¼¥É¤¹¤ë */
+    rb_include_module(cDBM, mEnumerable);
+
+    /* DBM¥¯¥é¥¹¤Î¥¯¥é¥¹¥á¥½¥Ã¥Éopen(): °ú¿ô¤ÏC¤ÎÇÛÎó¤Ç¼õ¤±¤ë */
+    rb_define_singleton_method(cDBM, "open", fdbm_s_open, -1);
+
+    /* DBM¥¯¥é¥¹¤Î¥á¥½¥Ã¥Éclose(): °ú¿ô¤Ï¤Ê¤· */
+    rb_define_method(cDBM, "close", fdbm_close, 0);
+    /* DBM¥¯¥é¥¹¤Î¥á¥½¥Ã¥É[]: °ú¿ô¤Ï1¸Ä */
+    rb_define_method(cDBM, "[]", fdbm_fetch, 1);
+		:
+
+    /* DBM¥Ç¡¼¥¿¤ò³ÊǼ¤¹¤ë¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô̾¤Î¤¿¤á¤ÎID */
+    id_dbm = rb_intern("dbm");
+}
+--
+
+DBM¥â¥¸¥å¡¼¥ë¤Ïdbm¤Î¥Ç¡¼¥¿¤ÈÂбþ¤¹¤ë¥ª¥Ö¥¸¥§¥¯¥È¤Ë¤Ê¤ë¤Ï¤º¤Ç
+¤¹¤«¤é¡¤C¤ÎÀ¤³¦¤Îdbm¤òRuby¤ÎÀ¤³¦¤Ë¼è¤ê¹þ¤àɬÍפ¬¤¢¤ê¤Þ¤¹¡¥
+
+
+dbm.c¤Ç¤ÏData_Make_Struct¤ò°Ê²¼¤Î¤è¤¦¤Ë»È¤Ã¤Æ¤¤¤Þ¤¹¡¥
+
+--
+struct dbmdata {
+    int  di_size;
+    DBM *di_dbm;
+};
+
+
+obj = Data_Make_Struct(class,struct dbmdata,0,free_dbm,dbmp);
+--
+
+¤³¤³¤Ç¤Ïdbmstruct¹½Â¤ÂΤؤΥݥ¤¥ó¥¿¤òData¤Ë¥«¥×¥»¥ë²½¤·¤Æ¤¤
+¤Þ¤¹¡¥DBM*¤òľÀÜ¥«¥×¥»¥ë²½¤·¤Ê¤¤¤Î¤Ïclose()¤·¤¿»þ¤Î½èÍý¤ò¹Í
+¤¨¤Æ¤Î¤³¤È¤Ç¤¹¡¥
+
+Data¥ª¥Ö¥¸¥§¥¯¥È¤«¤édbmstruct¹½Â¤ÂΤΥݥ¤¥ó¥¿¤ò¼è¤ê½Ð¤¹¤¿¤á
+¤Ë°Ê²¼¤Î¥Þ¥¯¥í¤ò»È¤Ã¤Æ¤¤¤Þ¤¹¡¥
+
+--
+#define GetDBM(obj, dbmp) {\
+    Data_Get_Struct(obj, struct dbmdata, dbmp);\
+    if (dbmp->di_dbm == 0) closed_dbm();\
+}
+--
+
+¤Á¤ç¤Ã¤ÈÊ£»¨¤Ê¥Þ¥¯¥í¤Ç¤¹¤¬¡¤Íפ¹¤ë¤Ëdbmdata¹½Â¤ÂΤΥݥ¤¥ó¥¿
+¤Î¼è¤ê½Ð¤·¤È¡¤close¤µ¤ì¤Æ¤¤¤ë¤«¤É¤¦¤«¤Î¥Á¥§¥Ã¥¯¤ò¤Þ¤È¤á¤Æ¤¤
+¤ë¤À¤±¤Ç¤¹¡¥
+
+DBM¥¯¥é¥¹¤Ë¤Ï¤¿¤¯¤µ¤ó¥á¥½¥Ã¥É¤¬¤¢¤ê¤Þ¤¹¤¬¡¤Ê¬Îह¤ë¤È3¼ïÎà¤Î
+°ú¿ô¤Î¼õ¤±Êý¤¬¤¢¤ê¤Þ¤¹¡¥¤Ò¤È¤Ä¤Ï°ú¿ô¤Î¿ô¤¬¸ÇÄê¤Î¤â¤Î¤Ç¡¤Îã¤È
+¤·¤Æ¤Ïdelete¥á¥½¥Ã¥É¤¬¤¢¤ê¤Þ¤¹¡¥delete¥á¥½¥Ã¥É¤ò¼ÂÁõ¤·¤Æ¤¤¤ë
+fdbm_delete()¤Ï¤³¤Î¤è¤¦¤Ë¤Ê¤Ã¤Æ¤¤¤Þ¤¹¡¥
+
+--
+static VALUE
+fdbm_delete(obj, keystr)
+    VALUE obj, keystr;
+{
+	:
+}
+--
+
+°ú¿ô¤Î¿ô¤¬¸ÇÄê¤Î¥¿¥¤¥×¤ÏÂè1°ú¿ô¤¬self¡¤Âè2°ú¿ô°Ê¹ß¤¬¥á¥½¥Ã¥É
+¤Î°ú¿ô¤È¤Ê¤ê¤Þ¤¹¡¥
+
+°ú¿ô¤Î¿ô¤¬ÉÔÄê¤Î¤â¤Î¤ÏC¤ÎÇÛÎó¤Ç¼õ¤±¤ë¤â¤Î¤ÈRuby¤ÎÇÛÎó¤Ç¼õ¤±
+¤ë¤â¤Î¤È¤¬¤¢¤ê¤Þ¤¹¡¥dbm¥â¥¸¥å¡¼¥ë¤ÎÃæ¤Ç¡¤C¤ÎÇÛÎó¤Ç¼õ¤±¤ë¤â¤Î
+¤ÏDBM¤Î¥¯¥é¥¹¥á¥½¥Ã¥É¤Ç¤¢¤ëopen()¤Ç¤¹¡¥¤³¤ì¤ò¼ÂÁõ¤·¤Æ¤¤¤ë´Ø
+¿ôfdbm_s_open()¤Ï¤³¤¦¤Ê¤Ã¤Æ¤¤¤Þ¤¹¡¥
+
+--
+static VALUE
+fdbm_s_open(argc, argv, class)
+    int argc;
+    VALUE *argv;
+    VALUE class;
+{
+	:
+    if (rb_scan_args(argc, argv, "11", &file, &vmode) == 1) {
+	mode = 0666;		/* default value */
+    }
+	:
+}
+--
+
+¤³¤Î¥¿¥¤¥×¤Î´Ø¿ô¤ÏÂè1°ú¿ô¤¬Í¿¤¨¤é¤ì¤¿°ú¿ô¤Î¿ô¡¤Âè2°ú¿ô¤¬Í¿¤¨
+¤é¤ì¤¿°ú¿ô¤ÎÆþ¤Ã¤Æ¤¤¤ëÇÛÎó¤Ë¤Ê¤ê¤Þ¤¹¡¥self¤ÏÂè3°ú¿ô¤È¤·¤ÆÍ¿
+¤¨¤é¤ì¤Þ¤¹¡¥
+
+¤³¤ÎÇÛÎó¤ÇÍ¿¤¨¤é¤ì¤¿°ú¿ô¤ò²òÀϤ¹¤ë¤¿¤á¤Î´Ø¿ô¤¬open()¤Ç¤â»È¤ï
+¤ì¤Æ¤¤¤ërb_scan_args()¤Ç¤¹¡¥Âè3°ú¿ô¤Ë»ØÄꤷ¤¿¥Õ¥©¡¼¥Þ¥Ã¥È¤Ë
+½¾¤¤¡¤Âè4ÊÑ¿ô°Ê¹ß¤Ë»ØÄꤷ¤¿ÊÑ¿ô¤ËÃͤòÂåÆþ¤·¤Æ¤¯¤ì¤Þ¤¹¡¥¤³¤Î
+¥Õ¥©¡¼¥Þ¥Ã¥È¤Ï¡¤Âè1ʸ»úÌܤ¬¾Êά¤Ç¤­¤Ê¤¤°ú¿ô¤Î¿ô¡¤Âè2ʸ»úÌܤ¬
+¾Êά¤Ç¤­¤ë°ú¿ô¤Î¿ô¡¤Âè3ʸ»úÌܤ¬Âбþ¤¹¤ëÁê¼ê¤¬Ìµ¤¤¤¢¤Þ¤ê¤Î°ú
+¿ô¤¬¤¢¤ë¤«¤É¤¦¤«¤ò¼¨¤¹"*"¤Ç¤¹¡¥2ʸ»úÌܤÈ3ʸ»úÌܤϾÊά¤Ç¤­¤Þ
+¤¹¡¥dbm.c¤ÎÎã¤Ç¤Ï¡¤¥Õ¥©¡¼¥Þ¥Ã¥È¤Ï"11"¤Ç¤¹¤«¤é¡¤°ú¿ô¤ÏºÇÄã1¤Ä
+¤Ç¡¤2¤Ä¤Þ¤Çµö¤µ¤ì¤ë¤È¤¤¤¦°ÕÌ£¤Ë¤Ê¤ê¤Þ¤¹¡¥¾Êά¤µ¤ì¤Æ¤¤¤ë»þ¤Î
+ÊÑ¿ô¤ÎÃͤÏnil(C¸À¸ì¤Î¥ì¥Ù¥ë¤Ç¤ÏQnil)¤Ë¤Ê¤ê¤Þ¤¹¡¥
+
+Ruby¤ÎÇÛÎó¤Ç°ú¿ô¤ò¼õ¤±¼è¤ë¤â¤Î¤Ïindexes¤¬¤¢¤ê¤Þ¤¹¡¥¼ÂÁõ¤Ï¤³
+¤¦¤Ç¤¹¡¥
+
+--
+static VALUE
+fdbm_indexes(obj, args)
+    VALUE obj;
+    struct RArray *args;
+{
+	:
+}
+--
+
+Âè1°ú¿ô¤Ïself¡¤Âè2°ú¿ô¤ÏRuby¤ÎÇÛÎó¤Ç¤¹¡¥¤³¤³¤Ç¤Ï¥­¥ã¥¹¥È¤ò¸º
+¤é¤¹¤¿¤á struct RArray* ¤Ç¼õ¤±¤Æ¤¤¤Þ¤¹¤¬¡¤VALUE¤Ç¤âƱ¤¸¤³¤È
+¤Ç¤¹¡¥
+
+** Ãí°Õ»ö¹à
+
+Ruby¤È¶¦Í­¤Ï¤·¤Ê¤¤¤¬Ruby¤Î¥ª¥Ö¥¸¥§¥¯¥È¤ò³ÊǼ¤¹¤ë²ÄǽÀ­¤Î¤¢¤ë
+C¤ÎÂç°èÊÑ¿ô¤Ï°Ê²¼¤Î´Ø¿ô¤ò»È¤Ã¤ÆRuby¥¤¥ó¥¿¥×¥ê¥¿¤ËÊÑ¿ô¤Î¸ºß
+¤ò¶µ¤¨¤Æ¤¢¤²¤Æ¤¯¤À¤µ¤¤¡¥¤Ç¤Ê¤¤¤ÈGC¤Ç¥È¥é¥Ö¥ë¤òµ¯¤³¤·¤Þ¤¹¡¥
+
+  void rb_global_variable(VALUE *var)
+
+(5) prepare extconf.rb
+
+¤â¤·¥Ç¥£¥ì¥¯¥È¥ê¤Ë¡Öextconf.rb¡×¤È¤¤¤¦¥Õ¥¡¥¤¥ë¤¬Â¸ºß¤¹¤ì¤Ð¡¤
+make»þ¤Ë¼Â¹Ô¤µ¤ì¤Þ¤¹¡¥¤Ê¤±¤ì¤ÐŬÅö¤ËMakefile¤¬À¸À®¤µ¤ì¤Þ¤¹¡¥
+
+extconf.rb¤Ï¥â¥¸¥å¡¼¥ë¤Î¥³¥ó¥Ñ¥¤¥ë¤ËɬÍפʾò·ï¤Î¥Á¥§¥Ã¥¯¤Ê¤É
+¤ò¹Ô¤¦¤³¤È¤¬ÌÜŪ¤Ç¤¹¡¥extconf.rb¤ÎÃæ¤Ç¤Ï°Ê²¼¤ÎRuby´Ø¿ô¤ò»È¤¦
+¤³¤È¤¬½ÐÍè¤Þ¤¹¡¥
+
+  have_library(lib, func): ¥é¥¤¥Ö¥é¥ê¤Î¸ºß¥Á¥§¥Ã¥¯
+  have_func(func): ´Ø¿ô¤Î¸ºß¥Á¥§¥Ã¥¯
+  have_header(header): ¥Ø¥Ã¥À¥Õ¥¡¥¤¥ë¤Î¸ºß¥Á¥§¥Ã¥¯
+  create_makefile(target): Makefile¤ÎÀ¸À®
+
+°Ê²¼¤ÎÊÑ¿ô¤ò»È¤¦¤³¤È¤¬¤Ç¤­¤Þ¤¹¡¥
+
+  $CFLAGS: ¥³¥ó¥Ñ¥¤¥ë»þ¤ËÄɲÃŪ¤Ë»ØÄꤹ¤ë¥Õ¥é¥°(-I¤Ê¤É)
+  $LDFLAGS: ¥ê¥ó¥¯»þ¤ËÄɲÃŪ¤Ë»ØÄꤹ¤ë¥Õ¥é¥°(-L¤Ê¤É)
+
+¥â¥¸¥å¡¼¥ë¤ò¥³¥ó¥Ñ¥¤¥ë¤¹¤ë¾ò·ï¤¬Â·¤ï¤Ê¤º¡¤¤½¤Î¥â¥¸¥å¡¼¥ë¤Ï¥³
+¥ó¥Ñ¥¤¥ë¤·¤Ê¤¤»þ¤Ë¤Ïcreate_makefile¤ò¸Æ¤Ð¤Ê¤±¤ì¤ÐMakefile¤Ï
+À¸À®¤µ¤ì¤º¡¤¥³¥ó¥Ñ¥¤¥ë¤â¹Ô¤ï¤ì¤Þ¤»¤ó¡¥
+
+(6) prepare depend (optional)
+
+¤â¤·¡¤¥Ç¥£¥ì¥¯¥È¥ê¤Ëdepend¤È¤¤¤¦¥Õ¥¡¥¤¥ë¤¬Â¸ºß¤¹¤ì¤Ð¡¤
+Makefile¤¬°Í¸´Ø·¸¤ò¥Á¥§¥Ã¥¯¤·¤Æ¤¯¤ì¤Þ¤¹¡¥
+
+ % gcc -MM *.c > depend
+
+¤Ê¤É¤Çºî¤ë¤³¤È¤¬½ÐÍè¤Þ¤¹¡¥¤¢¤Ã¤Æ»¤Ï̵¤¤¤Ç¤·¤ç¤¦¡¥
+
+(7) MANIFEST¥Õ¥¡¥¤¥ë¤Ë¥Õ¥¡¥¤¥ë̾¤òÆþ¤ì¤ë
+
+  % ls > MANIFEST
+  % vi MANIFEST
+
+*.o, *~¤Ê¤ÉÉÔɬÍפʥե¡¥¤¥ë°Ê³°¤ÏMANIFEST¤ËÄɲ䷤Ƥª¤­¤Þ¤¹¡¥
+make»þ¤Ë¤ÏMANIFEST¤ÎÆâÍƤϻ²¾È¤·¤Þ¤»¤ó¤Î¤Ç¡¤¶õ¤Î¤Þ¤Þ¤Ç¤âÌäÂê
+¤Ïµ¯¤­¤Þ¤»¤ó¤¬¡¤¥Ñ¥Ã¥±¡¼¥¸¥ó¥°¤Î»þ¤Ë»²¾È¤¹¤ë¤³¤È¤¬¤¢¤ë¤Î¤È¡¤
+ɬÍפʥե¡¥¤¥ë¤ò¶èÊ̤Ǥ­¤ë¤Î¤Ç¡¤ÍÑ°Õ¤·¤Æ¤ª¤¤¤¿Êý¤¬Îɤ¤¤Ç¤·¤ç
+¤¦¡¥
+
+(8) make
+
+Ruby¤Î¥Ç¥£¥ì¥¯¥È¥ê¤Çmake¤ò¼Â¹Ô¤¹¤ë¤ÈMakefile¤òÀ¸À®¤«¤émake¡¤
+ɬÍפˤè¤Ã¤Æ¤Ï¤½¤Î¥â¥¸¥å¡¼¥ë¤ÎRuby¤Ø¤Î¥ê¥ó¥¯¤Þ¤Ç¼«Æ°Åª¤Ë¼Â¹Ô
+¤·¤Æ¤¯¤ì¤Þ¤¹¡¥extconf.rb¤ò½ñ¤­´¹¤¨¤ë¤Ê¤É¤·¤ÆMakefile¤ÎºÆÀ¸À®
+¤¬É¬Íפʻþ¤Ï¤Þ¤¿Ruby¥Ç¥£¥ì¥¯¥È¥ê¤Çmake¤·¤Æ¤¯¤À¤µ¤¤¡¥
+
+(9) debug
+
+You may need to debug the module.  The modules can be linked 
+statically by adding directory name in the ext/Setup file,
+so that you can inspect the module by the debugger.
+
+(10) done, now you have the extension module
+
+¸å¤Ï¤³¤Ã¤½¤ê»È¤¦¤Ê¤ê¡¤¹­¤¯¸ø³«¤¹¤ë¤Ê¤ê¡¤Çä¤ë¤Ê¤ê¡¤¤´¼«Í³¤Ë¤ª
+»È¤¤¤¯¤À¤µ¤¤¡¥Ruby¤Îºî¼Ô¤Ï³ÈÄ¥¥â¥¸¥å¡¼¥ë¤Ë´Ø¤·¤Æ°ìÀڤθ¢Íø¤ò
+¼çÄ¥¤·¤Þ¤»¤ó¡¥
+
+Appendix A. Ruby¤Î¥½¡¼¥¹¥³¡¼¥É¤ÎʬÎà
+
+Ruby¤Î¥½¡¼¥¹¤Ï¤¤¤¯¤Ä¤«¤ËʬÎह¤ë¤³¤È¤¬½ÐÍè¤Þ¤¹¡¥¤³¤Î¤¦¤Á¥¯¥é
+¥¹¥é¥¤¥Ö¥é¥ê¤ÎÉôʬ¤Ï´ðËÜŪ¤Ë³ÈÄ¥¥â¥¸¥å¡¼¥ë¤ÈƱ¤¸ºî¤êÊý¤Ë¤Ê¤Ã
+¤Æ¤¤¤Þ¤¹¡¥¤³¤ì¤é¤Î¥½¡¼¥¹¤Ïº£¤Þ¤Ç¤ÎÀâÌÀ¤Ç¤Û¤È¤ó¤ÉÍý²ò¤Ç¤­¤ë¤È
+»×¤¤¤Þ¤¹¡¥
+
+ruby language core
+
+  class.c
+  error.c
+  eval.c
+  gc.c
+  object.c
+  parse.y
+  variable.c
+
+utility functions
+
+  dln.c
+  fnmatch.c
+  glob.c
+  regex.c
+  st.c
+  util.c
+
+ruby interpreter implementation
+
+  dmyext.c
+  inits.c
+  main.c
+  ruby.c
+  version.c
+
+class library
+
+  array.c
+  bignum.c
+  compar.c
+  dir.c
+  enum.c
+  file.c
+  hash.c
+  io.c
+  math.c
+  numeric.c
+  pack.c
+  process.c
+  random.c
+  range.c
+  re.c
+  signal.c
+  sprintf.c
+  string.c
+  struct.c
+  time.c
+
+Appendix B. ³ÈÄ¥ÍÑ´Ø¿ô¥ê¥Õ¥¡¥ì¥ó¥¹
+
+C¸À¸ì¤«¤éRuby¤Îµ¡Ç½¤òÍøÍѤ¹¤ëAPI¤Ï°Ê²¼¤ÎÄ̤ê¤Ç¤¢¤ë¡¥
+
+** ·¿
+
+ VALUE
+
+Ruby¥ª¥Ö¥¸¥§¥¯¥È¤òɽ¸½¤¹¤ë·¿¡¥É¬Íפ˱þ¤¸¤Æ¥­¥ã¥¹¥È¤·¤ÆÍѤ¤¤ë¡¥
+ÁȤ߹þ¤ß·¿¤òɽ¸½¤¹¤ëC¤Î·¿¤Ïruby.h¤Ëµ­½Ò¤·¤Æ¤¢¤ëR¤Ç»Ï¤Þ¤ë¹½Â¤
+ÂΤǤ¢¤ë¡¥VALUE·¿¤ò¤³¤ì¤é¤Ë¥­¥ã¥¹¥È¤¹¤ë¤¿¤á¤ËR¤Ç»Ï¤Þ¤ë¹½Â¤ÂÎ
+̾¤òÁ´¤ÆÂçʸ»ú¤Ë¤·¤¿Ì¾Á°¤Î¥Þ¥¯¥í¤¬ÍÑ°Õ¤µ¤ì¤Æ¤¤¤ë¡¥
+
+** Variables and constants
+
+ Qnil
+
+const: nil object
+
+ TRUE
+
+const: TRUE object(default true value)
+
+ FALSE
+
+const: FALSE object
+
+** C¥Ç¡¼¥¿¤Î¥«¥×¥»¥ë²½
+
+ Data_Wrap_Struct(VALUE class, void (*mark)(), void (*free)(), void *sval)
+
+C¤ÎǤ°Õ¤Î¥Ý¥¤¥ó¥¿¤ò¥«¥×¥»¥ë²½¤·¤¿Ruby¥ª¥Ö¥¸¥§¥¯¥È¤òÊÖ¤¹¡¥¤³
+¤Î¥Ý¥¤¥ó¥¿¤¬Ruby¤«¤é¥¢¥¯¥»¥¹¤µ¤ì¤Ê¤¯¤Ê¤Ã¤¿»þ¡¤free¤Ç»ØÄꤷ¤¿
+´Ø¿ô¤¬¸Æ¤Ð¤ì¤ë¡¥¤Þ¤¿¡¤¤³¤Î¥Ý¥¤¥ó¥¿¤Î»Ø¤¹¥Ç¡¼¥¿¤¬Â¾¤ÎRuby¥ª¥Ö
+¥¸¥§¥¯¥È¤ò»Ø¤·¤Æ¤¤¤ë¾ì¹ç¡¤mark¤Ë»ØÄꤹ¤ë´Ø¿ô¤Ç¥Þ¡¼¥¯¤¹¤ëɬÍ×
+¤¬¤¢¤ë¡¥
+
+ Data_Make_Struct(class, type, mark, free, sval)
+
+type·¿¤Î¥á¥â¥ê¤òmalloc¤·¡¤ÊÑ¿ôsval¤ËÂåÆþ¤·¤¿¸å¡¤¤½¤ì¤ò¥«¥×¥»
+¥ë²½¤·¤¿¥Ç¡¼¥¿¤òÊÖ¤¹¥Þ¥¯¥í¡¥
+
+ Data_Get_Struct(data, type, sval)
+
+data¤«¤étype·¿¤Î¥Ý¥¤¥ó¥¿¤ò¼è¤ê½Ð¤·ÊÑ¿ôsval¤ËÂåÆþ¤¹¤ë¥Þ¥¯¥í¡¥
+
+** ¥¯¥é¥¹/¥â¥¸¥å¡¼¥ëÄêµÁ
+
+ VALUE rb_define_class(char *name, VALUE super)
+
+super¤Î¥µ¥Ö¥¯¥é¥¹¤È¤·¤Æ¿·¤·¤¤Ruby¥¯¥é¥¹¤òÄêµÁ¤¹¤ë¡¥
+
+ VALUE rb_define_class_under(VALUE module, char *name, VALUE super)
+
+super¤Î¥µ¥Ö¥¯¥é¥¹¤È¤·¤Æ¿·¤·¤¤Ruby¥¯¥é¥¹¤òÄêµÁ¤·¡¤module¤ÎÄê
+¿ô¤È¤·¤ÆÄêµÁ¤¹¤ë¡¥
+
+ VALUE rb_define_module(char *name)
+
+¿·¤·¤¤Ruby¥â¥¸¥å¡¼¥ë¤òÄêµÁ¤¹¤ë¡¥
+
+ VALUE rb_define_module_under(VALUE module, char *name, VALUE super)
+
+¿·¤·¤¤Ruby¥â¥¸¥å¡¼¥ë¤òÄêµÁ¤·¡¤module¤ÎÄê¿ô¤È¤·¤ÆÄêµÁ¤¹¤ë¡¥
+
+ void rb_include_module(VALUE class, VALUE module)
+
+¥â¥¸¥å¡¼¥ë¤ò¥¤¥ó¥¯¥ë¡¼¥É¤¹¤ë¡¥class¤¬¤¹¤Ç¤Ëmodule¤ò¥¤¥ó¥¯¥ë¡¼
+¥É¤·¤Æ¤¤¤ë»þ¤Ë¤Ï²¿¤â¤·¤Ê¤¤(¿½Å¥¤¥ó¥¯¥ë¡¼¥É¤Î¶Ø»ß)¡¥
+
+ void rb_extend_object(VALUE object, VALUE module)
+
+¥ª¥Ö¥¸¥§¥¯¥È¤ò¥â¥¸¥å¡¼¥ë(¤ÇÄêµÁ¤µ¤ì¤Æ¤¤¤ë¥á¥½¥Ã¥É)¤Ç³ÈÄ¥¤¹¤ë¡¥
+
+** Âç°èÊÑ¿ôÄêµÁ
+
+ void rb_define_variable(char *name, VALUE *var)
+
+Ruby¤ÈC¤È¤Ç¶¦Í­¤¹¤ë¥°¥í¡¼¥Ð¥ëÊÑ¿ô¤òÄêµÁ¤¹¤ë¡¥ÊÑ¿ô̾¤¬`$'¤Ç»Ï
+¤Þ¤é¤Ê¤¤»þ¤Ë¤Ï¼«Æ°Åª¤ËÄɲ䵤ì¤ë¡¥name¤È¤·¤ÆRuby¤Î¼±Ê̻ҤȤ·
+¤Æµö¤µ¤ì¤Ê¤¤Ê¸»ú(Î㤨¤Ð` ')¤ò´Þ¤à¾ì¹ç¤Ë¤ÏRuby¥×¥í¥°¥é¥à¤«¤é
+¤Ï¸«¤¨¤Ê¤¯¤Ê¤ë¡¥
+
+ void rb_define_readonly_variable(char *name, VALUE *var)
+
+Ruby¤ÈC¤È¤Ç¶¦Í­¤¹¤ëread only¤Î¥°¥í¡¼¥Ð¥ëÊÑ¿ô¤òÄêµÁ¤¹¤ë¡¥read
+only¤Ç¤¢¤ë¤³¤È°Ê³°¤Ïrb_define_variable()¤ÈƱ¤¸¡¥
+
+ void rb_define_virtual_variable(char *name,
+				VALUE (*getter)(), VALUE (*setter)())
+
+´Ø¿ô¤Ë¤è¤Ã¤Æ¼Â¸½¤µ¤ì¤ëRubyÊÑ¿ô¤òÄêµÁ¤¹¤ë¡¥ÊÑ¿ô¤¬»²¾È¤µ¤ì¤¿»þ
+¤Ë¤Ïgetter¤¬¡¤ÊÑ¿ô¤ËÃͤ¬¥»¥Ã¥È¤µ¤ì¤¿»þ¤Ë¤Ïsetter¤¬¸Æ¤Ð¤ì¤ë¡¥
+
+ void rb_define_hooked_variable(char *name, VALUE *var,
+				VALUE (*getter)(), VALUE (*setter)())
+
+´Ø¿ô¤Ë¤è¤Ã¤Æhook¤Î¤Ä¤±¤é¤ì¤¿¥°¥í¡¼¥Ð¥ëÊÑ¿ô¤òÄêµÁ¤¹¤ë¡¥ÊÑ¿ô¤¬
+»²¾È¤µ¤ì¤¿»þ¤Ë¤Ïgetter¤¬¡¤´Ø¿ô¤ËÃͤ¬¥»¥Ã¥È¤µ¤ì¤¿»þ¤Ë¤Ïsetter
+¤¬¸Æ¤Ð¤ì¤ë¡¥getter¤äsetter¤Ë0¤ò»ØÄꤷ¤¿»þ¤Ë¤Ïhook¤ò»ØÄꤷ¤Ê
+¤¤¤Î¤ÈƱ¤¸»ö¤Ë¤Ê¤ë¡¥
+
+ void rb_global_variable(VALUE *var)
+
+GC¤Î¤¿¤á¡¤Ruby¥×¥í¥°¥é¥à¤«¤é¤Ï¥¢¥¯¥»¥¹¤µ¤ì¤Ê¤¤¤¬, Ruby¥ª¥Ö¥¸¥§
+¥¯¥È¤ò´Þ¤àÂç°èÊÑ¿ô¤ò¥Þ¡¼¥¯¤¹¤ë¡¥
+
+** ¥¯¥é¥¹Äê¿ô
+
+ void rb_define_const(VALUE class, char *name, VALUE val)
+
+¥¯¥é¥¹Äê¿ô¤òÄêµÁ¤¹¤ë¡¥
+
+ void rb_define_global_const(char *name, VALUE val)
+
+Âç°èÄê¿ô¤òÄêµÁ¤¹¤ë¡¥
+
+     rb_define_const(cKernal, name, val)
+
+¤ÈƱ¤¸°ÕÌ£¡¥
+
+** ¥á¥½¥Ã¥ÉÄêµÁ
+
+ rb_define_method(VALUE class, char *name, VALUE (*func)(), int argc)
+
+¥á¥½¥Ã¥É¤òÄêµÁ¤¹¤ë¡¥argc¤Ïself¤ò½ü¤¯°ú¿ô¤Î¿ô¡¥argc¤¬-1¤Î»þ, 
+´Ø¿ô¤Ë¤Ï°ú¿ô¤Î¿ô(self¤ò´Þ¤Þ¤Ê¤¤)¤òÂè1°ú¿ô, °ú¿ô¤ÎÇÛÎó¤òÂè2°ú
+¿ô¤È¤¹¤ë·Á¼°¤ÇÍ¿¤¨¤é¤ì¤ë(Âè3°ú¿ô¤Ïself)¡¥argc¤¬-2¤Î»þ, Âè1°ú
+¿ô¤¬self, Âè2°ú¿ô¤¬args(args¤Ï°ú¿ô¤ò´Þ¤àRuby¤ÎÇÛÎó)¤È¤¤¤¦·Á
+¼°¤ÇÍ¿¤¨¤é¤ì¤ë¡¥
+
+ rb_define_private_method(VALUE class, char *name, VALUE (*func)(), int argc)
+
+private¥á¥½¥Ã¥É¤òÄêµÁ¤¹¤ë¡¥°ú¿ô¤Ïrb_define_method()¤ÈƱ¤¸¡¥
+
+ rb_define_singleton_method(VALUE class, char *name, VALUE (*func)(), int argc)
+
+Æðۥ᥽¥Ã¥É¤òÄêµÁ¤¹¤ë¡¥°ú¿ô¤Ïrb_define_method()¤ÈƱ¤¸¡¥
+
+ rb_scan_args(int atgc, VALUE *argv, char *fmt, ...)
+
+argc,argv·Á¼°¤ÇÍ¿¤¨¤é¤ì¤¿°ú¿ô¤òʬ²ò¤¹¤ë¡¥fmt¤Ïɬ¿Ü°ú¿ô¤Î¿ô, 
+Éղðú¿ô¤Î¿ô, »Ä¤ê¤Î°ú¿ô¤¬¤¢¤ë¤«¤ò»ØÄꤹ¤ëʸ»úÎó¤Ç, "¿ô»ú¿ô
+»ú*"¤È¤¤¤¦·Á¼°¤Ç¤¢¤ë¡¥ 2 ÈÖÌܤοô»ú¤È"*"¤Ï¤½¤ì¤¾¤ì¾Êά²Äǽ¤Ç
+¤¢¤ë¡¥É¬¿Ü°ú¿ô¤¬°ì¤Ä¤â¤Ê¤¤¾ì¹ç¤Ï0¤ò»ØÄꤹ¤ë¡¥Âè3°ú¿ô°Ê¹ß¤ÏÊÑ
+¿ô¤Ø¤Î¥Ý¥¤¥ó¥¿¤Ç, ³ºÅö¤¹¤ëÍ×ÁǤ¬¤½¤ÎÊÑ¿ô¤Ë³ÊǼ¤µ¤ì¤ë¡¥Éղðú
+¿ô¤ËÂбþ¤¹¤ë°ú¿ô¤¬Í¿¤¨¤é¤ì¤Æ¤¤¤Ê¤¤¾ì¹ç¤ÏÊÑ¿ô¤ËQnil¤¬ÂåÆþ¤µ¤ì
+¤ë¡¥
+
+** Ruby¥á¥½¥Ã¥É¸Æ¤Ó½Ð¤·
+
+ VALUE rb_funcall(VALUE recv, ID mid, int narg, ...)
+
+¥á¥½¥Ã¥É¸Æ¤Ó½Ð¤·¡¥Ê¸»úÎ󤫤émid¤òÆÀ¤ë¤¿¤á¤Ë¤Ïrb_intern()¤ò»È¤¦¡¥
+
+ VALUE rb_funcall2(VALUE recv, ID mid, int argc, VALUE *argv)
+
+¥á¥½¥Ã¥É¸Æ¤Ó½Ð¤·¡¥°ú¿ô¤òargc,argv·Á¼°¤ÇÅϤ¹¡¥
+
+ VALUE rb_eval_string(char *str)
+
+ʸ»úÎó¤òRuby¤È¥¹¥¯¥ê¥×¥È¤·¤Æ¥³¥ó¥Ñ¥¤¥ë¡¦¼Â¹Ô¤¹¤ë¡¥
+
+ ID rb_intern(char *name)
+
+ʸ»úÎó¤ËÂбþ¤¹¤ëID¤òÊÖ¤¹¡¥
+
+ char *rb_id2name(ID id)
+
+ID¤ËÂбþ¤¹¤ëʸ»úÎó¤òÊÖ¤¹(¥Ç¥Ð¥Ã¥°ÍÑ)¡¥
+
+ char *rb_class2name(VALUE class)
+
+class¤Î̾Á°¤òÊÖ¤¹(¥Ç¥Ð¥Ã¥°ÍÑ)¡¥class¤¬Ì¾Á°¤ò»ý¤¿¤Ê¤¤»þ¤Ë¤Ï, 
+ÁÄÀè¤òÁ̤äÆ̾Á°¤ò»ý¤Ä¥¯¥é¥¹¤Î̾Á°¤òÊÖ¤¹¡¥
+
+** ¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô
+
+ VALUE rb_iv_get(VALUE obj, char *name)
+
+obj¤Î¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô¤ÎÃͤòÆÀ¤ë¡¥`@'¤Ç»Ï¤Þ¤é¤Ê¤¤¥¤¥ó¥¹¥¿¥ó¥¹
+ÊÑ¿ô¤Ï Ruby¥×¥í¥°¥é¥à¤«¤é¥¢¥¯¥»¥¹¤Ç¤­¤Ê¤¤¡Ö±£¤ì¤¿¡×¥¤¥ó¥¹¥¿
+¥ó¥¹ÊÑ¿ô¤Ë¤Ê¤ë¡¥
+
+ VALUE rb_iv_set(VALUE obj, char *name, VALUE val)
+
+obj¤Î¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô¤òval¤Ë¥»¥Ã¥È¤¹¤ë¡¥
+
+** À©¸æ¹½Â¤
+
+ VALUE rb_iterate(VALUE (*func1)(), void *arg1, VALUE (*func2)(), void *arg2)
+
+func2¤ò¥Ö¥í¥Ã¥¯¤È¤·¤ÆÀßÄꤷ, func1¤ò¥¤¥Æ¥ì¡¼¥¿¤È¤·¤Æ¸Æ¤Ö¡¥ 
+func1¤Ë¤Ï arg1¤¬°ú¿ô¤È¤·¤ÆÅϤµ¤ì, func2¤Ë¤ÏÂè1°ú¿ô¤Ë¥¤¥Æ¥ì¡¼
+¥¿¤«¤éÍ¿¤¨¤é¤ì¤¿ÃÍ, Âè2°ú¿ô¤Ëarg2¤¬ÅϤµ¤ì¤ë¡¥
+ 
+ VALUE rb_yield(VALUE val)
+
+val¤òÃͤȤ·¤Æ¥¤¥Æ¥ì¡¼¥¿¥Ö¥í¥Ã¥¯¤ò¸Æ¤Ó½Ð¤¹¡¥
+
+ VALUE rb_rescue(VALUE (*func1)(), void *arg1, VALUE (*func2)(), void *arg2)
+
+´Ø¿ôfunc1¤òarg1¤ò°ú¿ô¤Ë¸Æ¤Ó½Ð¤¹¡¥func1¤Î¼Â¹ÔÃæ¤ËÎã³°¤¬È¯À¸¤·
+¤¿»þ¤Ë¤Ï func2¤òarg2¤ò°ú¿ô¤È¤·¤Æ¸Æ¤Ö¡¥Ìá¤êÃͤÏÎã³°¤¬È¯À¸¤·¤Ê
+¤«¤Ã¤¿»þ¤Ïfunc1¤ÎÌá¤êÃÍ, Îã³°¤¬È¯À¸¤·¤¿»þ¤Ë¤Ïfunc2¤ÎÌá¤êÃͤÇ
+¤¢¤ë¡¥
+
+ VALUE rb_ensure(VALUE (*func1)(), void *arg1, void (*func2)(), void *arg2)
+
+´Ø¿ôfunc1¤òarg1¤ò°ú¿ô¤È¤·¤Æ¼Â¹Ô¤·, ¼Â¹Ô½ªÎ»¸å(¤¿¤È¤¨Îã³°¤¬È¯
+À¸¤·¤Æ¤â) func2¤òarg2¤ò°ú¿ô¤È¤·¤Æ¼Â¹Ô¤¹¤ë¡¥Ìá¤êÃͤÏfunc1¤ÎÌá
+¤êÃͤǤ¢¤ë(Îã³°¤¬È¯À¸¤·¤¿»þ¤ÏÌá¤é¤Ê¤¤)¡¥
+
+** Îã³°¡¦¥¨¥é¡¼
+
+ void Warning(char *fmt, ...)
+
+verbose»þ¤Ëɸ½à¥¨¥é¡¼½ÐÎϤ˷ٹð¾ðÊó¤òɽ¼¨¤¹¤ë¡¥°ú¿ô¤Ïprintf()¤ÈƱ¤¸¡¥
+
+ void Fail(char *fmt, ...)
+
+Îã³°¤òȯÀ¸¤µ¤»¤ë¡¥°ú¿ô¤Ïprintf()¤ÈƱ¤¸¡¥
+
+ void Fatal(char *fmt, ...)
+
+Ã×̿ŪÎã³°¤òȯÀ¸¤µ¤»¤ë¡¥Ä̾ï¤ÎÎã³°½èÍý¤Ï¹Ô¤Ê¤ï¤ì¤º, ¥¤¥ó¥¿¡¼
+¥×¥ê¥¿¤¬½ªÎ»¤¹¤ë(¤¿¤À¤·ensure¤Ç»ØÄꤵ¤ì¤¿¥³¡¼¥É¤Ï½ªÎ»Á°¤Ë¼Â
+¹Ô¤µ¤ì¤ë)¡¥
+
+ void Bug(char *fmt, ...)
+
+¥¤¥ó¥¿¡¼¥×¥ê¥¿¤Ê¤É¥×¥í¥°¥é¥à¤Î¥Ð¥°¤Ç¤·¤«È¯À¸¤¹¤ë¤Ï¤º¤Î¤Ê¤¤¾õ
+¶·¤Î»þ¸Æ¤Ö¡¥¥¤¥ó¥¿¡¼¥×¥ê¥¿¤Ï¥³¥¢¥À¥ó¥×¤·Ä¾¤Á¤Ë½ªÎ»¤¹¤ë¡¥Îã³°
+½èÍý¤Ï°ìÀڹԤʤï¤ì¤Ê¤¤¡¥
+
+** Ruby¤Î½é´ü²½¡¦¼Â¹Ô
+
+Ruby¤ò¥¢¥×¥ê¥±¡¼¥·¥ç¥ó¤ËËä¤á¹þ¤à¾ì¹ç¤Ë¤Ï°Ê²¼¤Î¥¤¥ó¥¿¥Õ¥§¡¼¥¹
+¤ò»È¤¦¡¥Ä̾ï¤Î³ÈÄ¥¥â¥¸¥å¡¼¥ë¤Ë¤ÏɬÍפʤ¤¡¥
+
+ void ruby_init(int argc, char **argv, char **envp)
+
+Ruby¥¤¥ó¥¿¥×¥ê¥¿¤Î½é´ü²½¤ò¹Ô¤Ê¤¦¡¥
+
+ void ruby_run()
+
+Ruby¥¤¥ó¥¿¥×¥ê¥¿¤ò¼Â¹Ô¤¹¤ë¡¥
+
+ void ruby_script(char *name)
+
+Ruby¤Î¥¹¥¯¥ê¥×¥È̾($0)¤òÀßÄꤹ¤ë¡¥
+
+
+Appendix B. extconf.rb¤Ç»È¤¨¤ë´Ø¿ô¤¿¤Á
+
+extconf.rb¤ÎÃæ¤Ç¤ÏÍøÍѲÄǽ¤Ê¥³¥ó¥Ñ¥¤¥ë¾ò·ï¥Á¥§¥Ã¥¯¤Î´Ø¿ô¤Ï°Ê
+²¼¤ÎÄ̤ê¤Ç¤¢¤ë¡¥
+
+ have_library(lib, func)
+
+´Ø¿ôfunc¤òÄêµÁ¤·¤Æ¤¤¤ë¥é¥¤¥Ö¥é¥êlib¤Î¸ºß¤ò¥Á¥§¥Ã¥¯¤¹¤ë¡¥¥é
+¥¤¥Ö¥é¥ê¤¬Â¸ºß¤¹¤ë»þ¡¤TRUE¤òÊÖ¤¹¡¥
+
+ have_func(func)
+
+´Ø¿ôfunc¤Î¸ºß¤ò¥Á¥§¥Ã¥¯¤¹¤ë¡¥func¤¬É¸½à¤Ç¤Ï¥ê¥ó¥¯¤µ¤ì¤Ê¤¤¥é
+¥¤¥Ö¥é¥êÆâ¤Î¤â¤Î¤Ç¤¢¤ë»þ¤Ë¤ÏÀè¤Ëhave_library¤Ç¤½¤Î¥é¥¤¥Ö¥é¥ê
+¤ò¥Á¥§¥Ã¥¯¤·¤Æ¤ª¤¯»ö¡¥´Ø¿ô¤¬Â¸ºß¤¹¤ë»þTRUE¤òÊÖ¤¹¡¥
+
+ have_header(header)
+
+¥Ø¥Ã¥À¥Õ¥¡¥¤¥ë¤Î¸ºß¤ò¥Á¥§¥Ã¥¯¤¹¤ë¡¥¥Ø¥Ã¥À¥Õ¥¡¥¤¥ë¤¬Â¸ºß¤¹¤ë
+»þTRUE¤òÊÖ¤¹¡¥
+
+ create_makefile(target)
+
+³ÈÄ¥¥â¥¸¥å¡¼¥ëÍѤÎMakefile¤òÀ¸À®¤¹¤ë¡¥¤³¤Î´Ø¿ô¤ò¸Æ¤Ð¤Ê¤±¤ì¤Ð
+¤½¤Î¥â¥¸¥å¡¼¥ë¤Ï¥³¥ó¥Ñ¥¤¥ë¤µ¤ì¤Ê¤¤¡¥target¤Ï¥â¥¸¥å¡¼¥ë̾¤òɽ
+¤¹¡¥
+
+/*
+ * Local variables:
+ * fill-column: 60
+ * end:
+ */
diff --git a/README.EXT.ja b/README.EXT.ja
deleted file mode 100644
index f884ecbb0e..0000000000
--- a/README.EXT.ja
+++ /dev/null
@@ -1 +0,0 @@
-doc/extension.ja.rdoc�移動����
diff --git a/README.EXT.jp b/README.EXT.jp
new file mode 100644
index 0000000000..2929f1b2d1
--- /dev/null
+++ b/README.EXT.jp
@@ -0,0 +1,1147 @@
+.\" README.EXT -  -*- Text -*- created at: Mon Aug  7 16:45:54 JST 1995
+
+Ruby¤Î³ÈÄ¥¥â¥¸¥å¡¼¥ë¤Îºî¤êÊý¤òÀâÌÀ¤·¤Þ¤¹¡¥
+
+1¡¥´ðÁÃÃμ±
+
+C¤ÎÊÑ¿ô¤Ë¤Ï·¿¤¬¤¢¤ê¡¤¥Ç¡¼¥¿¤Ë¤Ï·¿¤¬¤¢¤ê¤Þ¤»¤ó¡¥¤Ç¤¹¤«¤é¡¤¤¿
+¤È¤¨¤Ð¥Ý¥¤¥ó¥¿¤òint¤ÎÊÑ¿ô¤ËÂåÆþ¤¹¤ë¤È¡¤¤½¤ÎÃͤÏÀ°¿ô¤È¤·¤Æ¼è
+¤ê°·¤ï¤ì¤Þ¤¹¡¥µÕ¤ËRuby¤ÎÊÑ¿ô¤Ë¤Ï·¿¤¬¤Ê¤¯¡¤¥Ç¡¼¥¿¤Ë·¿¤¬¤¢¤ê¤Þ
+¤¹¡¥¤³¤Î°ã¤¤¤Î¤¿¤á¡¤C¤ÈRuby¤ÏÁê¸ß¤ËÊÑ´¹¤·¤Ê¤±¤ì¤Ð¡¤¤ª¸ß¤¤¤Î
+¥Ç¡¼¥¿¤ò¥¢¥¯¥»¥¹¤Ç¤­¤Þ¤»¤ó¡¥
+
+Ruby¤Î¥Ç¡¼¥¿¤ÏVALUE¤È¤¤¤¦C¤Î·¿¤Çɽ¸½¤µ¤ì¤Þ¤¹¡¥VALUE·¿¤Î¥Ç¡¼
+¥¿¤Ï¤½¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤ò¼«Ê¬¤ÇÃΤäƤ¤¤Þ¤¹¡¥¤³¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤È
+¤¤¤¦¤Î¤Ï¥Ç¡¼¥¿(¥ª¥Ö¥¸¥§¥¯¥È)¤Î¼ÂºÝ¤Î¹½Â¤¤ò°ÕÌ£¤·¤Æ¤¤¤Æ¡¤Ruby
+¤Î¥¯¥é¥¹¤È¤Ï¤Þ¤¿°ã¤Ã¤¿¤â¤Î¤Ç¤¹¡¥
+
+VALUE¤«¤éC¤Ë¤È¤Ã¤Æ°ÕÌ£¤Î¤¢¤ë¥Ç¡¼¥¿¤ò¼è¤ê½Ð¤¹¤¿¤á¤Ë¤Ï
+
+ (1) VALUE¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤òÃΤë
+ (2) VALUE¤òC¤Î¥Ç¡¼¥¿¤ËÊÑ´¹¤¹¤ë
+
+¤ÎξÊý¤¬É¬ÍפǤ¹¡¥(1)¤ò˺¤ì¤ë¤È´Ö°ã¤Ã¤¿¥Ç¡¼¥¿¤ÎÊÑ´¹¤¬¹Ô¤ï¤ì
+¤Æ¡¤ºÇ°­¥×¥í¥°¥é¥à¤¬core dump¤·¤Þ¤¹¡¥
+
+1.1 ¥Ç¡¼¥¿¥¿¥¤¥×
+
+Ruby¤Ë¤Ï¥æ¡¼¥¶¤¬»È¤¦²ÄǽÀ­¤Î¤¢¤ë°Ê²¼¤Î¥¿¥¤¥×¤¬¤¢¤ê¤Þ¤¹¡¥
+
+	T_NIL		nil
+	T_OBJECT	Ä̾ï¤Î¥ª¥Ö¥¸¥§¥¯¥È
+	T_CLASS		¥¯¥é¥¹
+	T_MODULE	¥â¥¸¥å¡¼¥ë
+	T_FLOAT		ÉâÆ°¾®¿ôÅÀ¿ô
+	T_STRING	ʸ»úÎó
+	T_REGEXP	Àµµ¬É½¸½
+	T_ARRAY		ÇÛÎó
+	T_FIXNUM	Fixnum(31bitĹÀ°¿ô)
+	T_HASH		Ï¢ÁÛÇÛÎó
+	T_STRUCT	(Ruby¤Î)¹½Â¤ÂÎ
+	T_BIGNUM	¿ÇÜĹÀ°¿ô
+	T_FILE		Æþ½ÐÎÏ
+	T_TRUE		¿¿
+	T_FALSE		µ¶
+	T_DATA		¥Ç¡¼¥¿
+
+¤½¤Î¾¤ËÆâÉô¤ÇÍøÍѤµ¤ì¤Æ¤¤¤ë°Ê²¼¤Î¥¿¥¤¥×¤¬¤¢¤ê¤Þ¤¹¡¥
+
+	T_ICLASS
+	T_MATCH
+	T_VARMAP
+	T_SCOPE
+	T_NODE
+
+¤Û¤È¤ó¤É¤Î¥¿¥¤¥×¤ÏC¤Î¹½Â¤ÂΤǼÂÁõ¤µ¤ì¤Æ¤¤¤Þ¤¹¡¥
+
+1.2 VALUE¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤ò¥Á¥§¥Ã¥¯¤¹¤ë
+
+ruby.h¤Ç¤ÏTYPE()¤È¤¤¤¦¥Þ¥¯¥í¤¬ÄêµÁ¤µ¤ì¤Æ¤¤¤Æ¡¤VALUE¤Î¥Ç¡¼¥¿
+¥¿¥¤¥×¤òÃΤ뤳¤È¤¬½ÐÍè¤Þ¤¹¡¥TYPE()¥Þ¥¯¥í¤Ï¾å¤Ç¾Ò²ð¤·¤¿T_XXXX
+¤Î·Á¼°¤ÎÄê¿ô¤òÊÖ¤·¤Þ¤¹¡¥VALUE¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤Ë±þ¤¸¤Æ½èÍý¤¹¤ë
+¾ì¹ç¤Ë¤Ï¡¤TYPE()¤ÎÃͤÇʬ´ô¤¹¤ë¤³¤È¤Ë¤Ê¤ê¤Þ¤¹¡¥
+
+  switch (TYPE(obj)) {
+    case T_FIXNUM:
+      /* FIXNUM¤Î½èÍý */
+      break;
+    case T_STRING:
+      /* ʸ»úÎó¤Î½èÍý */
+      break;
+    case T_ARRAY:
+      /* ÇÛÎó¤Î½èÍý */
+      break;
+    default:
+      /* Îã³°¤òȯÀ¸¤µ¤»¤ë */
+      TypeError("not valid value");
+      break;
+  }
+
+¤½¤ì¤È¥Ç¡¼¥¿¥¿¥¤¥×¤ò¥Á¥§¥Ã¥¯¤·¤Æ¡¤Àµ¤·¤¯¤Ê¤±¤ì¤ÐÎã³°¤òȯÀ¸¤¹
+¤ë´Ø¿ô¤¬ÍÑ°Õ¤µ¤ì¤Æ¤¤¤Þ¤¹¡¥
+
+  void Check_Type(VALUE value, int type)
+
+¤³¤Î´Ø¿ô¤Ïvalue¤¬type¤Ç̵¤±¤ì¤Ð¡¤Îã³°¤òȯÀ¸¤µ¤»¤Þ¤¹¡¥°ú¿ô¤È
+¤·¤ÆÍ¿¤¨¤é¤ì¤¿VALUE¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤¬Àµ¤·¤¤¤«¤É¤¦¤«¥Á¥§¥Ã¥¯¤¹
+¤ë¤¿¤á¤Ë¤Ï¡¤¤³¤Î´Ø¿ô¤ò»È¤¤¤Þ¤¹¡¥
+
+FIXNUM¤ÈNIL¤Ë´Ø¤·¤Æ¤Ï¤è¤ê¹â®¤ÊȽÊÌ¥Þ¥¯¥í¤¬ÍÑ°Õ¤µ¤ì¤Æ¤¤¤Þ¤¹¡¥
+
+  FIXNUM_P(obj)
+  NIL_P(obj)
+
+1.3 VALUE¤òC¤Î¥Ç¡¼¥¿¤ËÊÑ´¹¤¹¤ë
+
+¥Ç¡¼¥¿¥¿¥¤¥×¤¬T_NIL, T_FALSE, T_TRUE¤Ç¤¢¤ë»þ¡¤¥Ç¡¼¥¿¤Ï¤½¤ì¤¾
+¤ìnil, false, true¤Ç¤¹¡¥¤³¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤Î¥ª¥Ö¥¸¥§¥¯¥È¤Ï¤Ò¤È
+¤Ä¤º¤Ä¤·¤«Â¸ºß¤·¤Þ¤»¤ó¡¥
+
+¥Ç¡¼¥¿¥¿¥¤¥×¤¬T_FIXNUM¤Î»þ¡¤¤³¤ì¤Ï31bit¤Î¥µ¥¤¥º¤ò»ý¤ÄÀ°¿ô¤Ç
+¤¹¡¥FIXNUM¤òC¤ÎÀ°¿ô¤ËÊÑ´¹¤¹¤ë¤¿¤á¤Ë¤Ï¥Þ¥¯¥í¡ÖFIX2INT()¡×¤ò»È
+¤¤¤Þ¤¹¡¥¤½¤ì¤«¤é¡¤FIXNUM¤Ë¸Â¤é¤ºRuby¤Î¥Ç¡¼¥¿¤òÀ°¿ô¤ËÊÑ´¹¤¹¤ë
+¡ÖNUM2INT()¡×¤È¤¤¤¦¥Þ¥¯¥í¤¬¤¢¤ê¤Þ¤¹¡¥¤³¤Î¥Þ¥¯¥í¤Ï¥Ç¡¼¥¿¥¿¥¤
+¥×¤Î¥Á¥§¥Ã¥¯Ìµ¤·¤Ç»È¤¨¤Þ¤¹(À°¿ô¤ËÊÑ´¹¤Ç¤­¤Ê¤¤¾ì¹ç¤Ë¤ÏÎã³°¤¬
+ȯÀ¸¤¹¤ë)¡¥
+
+ƱÍͤ˥Á¥§¥Ã¥¯Ìµ¤·¤Ç»È¤¨¤ëÊÑ´¹¥Þ¥¯¥í¤Ïdouble¤ò¼è¤ê½Ð¤¹
+¡ÖNUM2DBL()¡×¤Èchar*¤ò¼è¤ê½Ð¤¹¡ÖSTR2CSTR()¡×¤¬¤¢¤ê¤Þ¤¹¡¥
+
+¤½¤ì°Ê³°¤Î¥Ç¡¼¥¿¥¿¥¤¥×¤ÏÂбþ¤¹¤ëC¤Î¹½Â¤ÂΤ¬¤¢¤ê¤Þ¤¹¡¥Âбþ¤¹
+¤ë¹½Â¤ÂΤΤ¢¤ëVALUE¤Ï¤½¤Î¤Þ¤Þ¥­¥ã¥¹¥È(·¿ÊÑ´¹)¤¹¤ì¤Ð¹½Â¤ÂΤÎ
+¥Ý¥¤¥ó¥¿¤ËÊÑ´¹¤Ç¤­¤Þ¤¹¡¥
+
+¹½Â¤ÂΤϡÖstruct RXxxxx¡×¤È¤¤¤¦Ì¾Á°¤Çruby.h¤ÇÄêµÁ¤µ¤ì¤Æ¤¤¤Þ
+¤¹¡¥Î㤨¤Ðʸ»úÎó¤Ï¡Östruct RString¡×¤Ç¤¹¡¥¼ÂºÝ¤Ë»È¤¦²ÄǽÀ­¤¬
+¤¢¤ë¤Î¤Ïʸ»úÎó¤ÈÇÛÎ󤯤餤¤À¤È»×¤¤¤Þ¤¹¡¥
+
+ruby.h¤Ç¤Ï¹½Â¤ÂΤإ­¥ã¥¹¥È¤¹¤ë¥Þ¥¯¥í¤â¡ÖRXXXXX()¡×(Á´ÉôÂçʸ
+»ú¤Ë¤·¤¿¤â¤Î)¤È¤¤¤¦Ì¾Á°¤ÇÄ󶡤µ¤ì¤Æ¤¤¤Þ¤¹(Îã: RSTRING())¡¥
+
+Î㤨¤Ð¡¤Ê¸»úÎóstr¤ÎŤµ¤òÆÀ¤ë¤¿¤á¤Ë¤Ï¡ÖRSTRING(str)->len¡×¤È
+¤·¡¤Ê¸»úÎóstr¤òchar*¤È¤·¤ÆÆÀ¤ë¤¿¤á¤Ë¤Ï¡ÖRSTRING(str)->ptr¡×
+¤È¤·¤Þ¤¹¡¥ÇÛÎó¤Î¾ì¹ç¤Ë¤Ï¡¤¤½¤ì¤¾¤ì¡ÖRARRAY(str)->len¡×¡¤
+¡ÖRARRAY(str)->ptr¡×¤È¤Ê¤ê¤Þ¤¹¡¥
+
+Ruby¤Î¹½Â¤ÂΤòľÀÜ¥¢¥¯¥»¥¹¤¹¤ë»þ¤Ëµ¤¤ò¤Ä¤±¤Ê¤±¤ì¤Ð¤Ê¤é¤Ê¤¤¤³
+¤È¤Ï¡¤ÇÛÎó¤äʸ»úÎó¤Î¹½Â¤ÂΤÎÃæ¿È¤Ï»²¾È¤¹¤ë¤À¤±¤Ç¡¤Ä¾ÀÜÊѹ¹¤·
+¤Ê¤¤¤³¤È¤Ç¤¹¡¥Ä¾ÀÜÊѹ¹¤·¤¿¾ì¹ç¡¤¥ª¥Ö¥¸¥§¥¯¥È¤ÎÆâÍƤÎÀ°¹çÀ­¤¬
+¤È¤ì¤Ê¤¯¤Ê¤Ã¤Æ¡¤»×¤ï¤Ì¥Ð¥°¤Î¸¶°ø¤Ë¤Ê¤ê¤Þ¤¹¡¥
+
+1.4 C¤Î¥Ç¡¼¥¿¤òVALUE¤ËÊÑ´¹¤¹¤ë
+
+VALUE¤Î¼ÂºÝ¤Î¹½Â¤¤Ï
+
+  * FIXNUM¤Î¾ì¹ç
+
+    1bit±¦¥·¥Õ¥È¤·¤Æ¡¤LSB¤òΩ¤Æ¤ë¡¥
+
+  * ¤½¤Î¾¤Î¥Ý¥¤¥ó¥¿¤Î¾ì¹ç
+
+    ¤½¤Î¤Þ¤ÞVALUE¤Ë¥­¥ã¥¹¥È¤¹¤ë¡¥
+
+¤È¤Ê¤Ã¤Æ¤¤¤Þ¤¹¡¥¤è¤Ã¤Æ¡¤LSB¤ò¥Á¥§¥Ã¥¯¤¹¤ì¤ÐVALUE¤¬FIXNUM¤«¤É
+¤¦¤«¤ï¤«¤ë¤ï¤±¤Ç¤¹(¥Ý¥¤¥ó¥¿¤ÎLSB¤¬Î©¤Ã¤Æ¤¤¤Ê¤¤¤³¤È¤ò²¾Äꤷ¤Æ
+¤¤¤ë)¡¥
+
+¤Ç¤¹¤«¤é¡¤FIXNUM°Ê³°¤ÎRuby¤Î¥ª¥Ö¥¸¥§¥¯¥È¤Î¹½Â¤ÂΤÏñ¤ËVALUE
+¤Ë¥­¥ã¥¹¥È¤¹¤ë¤À¤±¤ÇVALUE¤ËÊÑ´¹½ÐÍè¤Þ¤¹¡¥¤¿¤À¤·¡¤Ç¤°Õ¤Î¹½Â¤
+ÂΤ¬VALUE¤Ë¥­¥ã¥¹¥È½ÐÍè¤ë¤ï¤±¤Ç¤Ï¤¢¤ê¤Þ¤»¤ó¡¥¥­¥ã¥¹¥È¤¹¤ë¤Î
+¤ÏRuby¤ÎÃΤäƤ¤¤ë¹½Â¤ÂÎ(ruby.h¤ÇÄêµÁ¤µ¤ì¤Æ¤¤¤ëstruct RXxxx
+¤Î¤â¤Î)¤À¤±¤Ç¤¹¡¥
+
+FIXNUM¤Ë´Ø¤·¤Æ¤ÏÊÑ´¹¥Þ¥¯¥í¤ò·Ðͳ¤¹¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¡¥C¤ÎÀ°¿ô
+¤«¤éVALUE¤ËÊÑ´¹¤¹¤ë¥Þ¥¯¥í¤Ï°Ê²¼¤Î¤â¤Î¤¬¤¢¤ê¤Þ¤¹¡¥É¬Íפ˱þ¤¸
+¤Æ»È¤¤Ê¬¤±¤Æ¤¯¤À¤µ¤¤¡¥
+
+  INT2FIX()	¤â¤È¤ÎÀ°¿ô¤¬31bit°ÊÆâ¤Ë¼ý¤Þ¤ë¼«¿®¤¬¤¢¤ë»þ
+  INT2NUM()	Ǥ°Õ¤ÎÀ°¿ô¤«¤éVALUE¤Ø
+
+INT2NUM()¤ÏÀ°¿ô¤¬FIXNUM¤ÎÈϰϤ˼ý¤Þ¤é¤Ê¤¤¾ì¹ç¡¤Bignum¤ËÊÑ´¹
+¤·¤Æ¤¯¤ì¤Þ¤¹(¤¬¡¤¾¯¤·ÃÙ¤¤)¡¥
+
+1.5 Ruby¤Î¥Ç¡¼¥¿¤òÁàºî¤¹¤ë
+
+ÀèÄø¤â½Ò¤Ù¤¿Ä̤ꡤRuby¤Î¹½Â¤ÂΤò¥¢¥¯¥»¥¹¤¹¤ë»þ¤ËÆâÍƤι¹¿·¤ò
+¹Ô¤¦¤³¤È¤Ï´«¤á¤é¤ì¤Þ¤»¤ó¡¥¤Ç¡¤Ruby¤Î¥Ç¡¼¥¿¤òÁàºî¤¹¤ë»þ¤Ë¤Ï
+Ruby¤¬ÍÑ°Õ¤·¤Æ¤¤¤ë´Ø¿ô¤òÍѤ¤¤Æ¤¯¤À¤µ¤¤¡¥
+
+¤³¤³¤Ç¤Ï¤â¤Ã¤È¤â»È¤ï¤ì¤ë¤Ç¤¢¤í¤¦Ê¸»úÎó¤ÈÇÛÎó¤ÎÀ¸À®/Áàºî¤ò¹Ô
+¤¤´Ø¿ô¤ò¤¢¤²¤Þ¤¹(Á´Éô¤Ç¤Ï¤Ê¤¤¤Ç¤¹)¡¥
+
+ ʸ»úÎó¤ËÂФ¹¤ë´Ø¿ô
+
+  str_new(char *ptr, int len)
+
+    ¿·¤·¤¤Ruby¤Îʸ»úÎó¤òÀ¸À®¤¹¤ë¡¥
+
+  str_new2(char *ptr)
+
+    C¤Îʸ»úÎ󤫤éRuby¤Îʸ»úÎó¤òÀ¸À®¤¹¤ë¡¥¤³¤Î´Ø¿ô¤Îµ¡Ç½¤Ï
+    str_new(ptr, strlen(ptr))¤ÈƱÅù¤Ç¤¢¤ë¡¥
+
+  str_cat(VALUE str, char *ptr, int len)
+
+    Ruby¤Îʸ»úÎóstr¤Ëlen¥Ð¥¤¥È¤Îʸ»úÎóptr¤òÄɲ乤롥
+
+ ÇÛÎó¤ËÂФ¹¤ë´Ø¿ô
+
+  ary_new()
+
+    Í×ÁǤ¬0¤ÎÇÛÎó¤òÀ¸À®¤¹¤ë¡¥
+
+  ary_new2(int len)
+
+    Í×ÁǤ¬0¤ÎÇÛÎó¤òÀ¸À®¤¹¤ë¡¥lenÍ×ÁÇʬ¤ÎÎΰè¤ò¤¢¤é¤«¤¸¤á³ä¤ê
+    Åö¤Æ¤Æ¤ª¤¯¡¥
+
+  ary_new3(int n, ...)
+
+    °ú¿ô¤Ç»ØÄꤷ¤¿nÍ×ÁǤò´Þ¤àÇÛÎó¤òÀ¸À®¤¹¤ë¡¥
+
+  ary_new4(int n, VALUE *elts)
+
+    ÇÛÎó¤ÇÍ¿¤¨¤¿nÍ×ÁǤÎÇÛÎó¤òÀ¸À®¤¹¤ë¡¥
+
+  ary_push(VALUE ary)
+  ary_pop(VALUE ary, VALUE val)
+  ary_shift(VALUE ary)
+  ary_unshift(VALUE ary, VALUE val)
+  ary_entry(VALUE ary, int idx)
+
+    Array¤ÎƱ̾¤Î¥á¥½¥Ã¥É¤ÈƱ¤¸Æ¯¤­¤ò¤¹¤ë´Ø¿ô¡¥Âè1°ú¿ô¤Ïɬ¤º
+    ÇÛÎó¤Ç¤Ê¤±¤ì¤Ð¤Ê¤é¤Ê¤¤¡¥
+
+2¡¥Ruby¤Îµ¡Ç½¤ò»È¤¦
+
+¸¶ÍýŪ¤ËRuby¤Ç½ñ¤±¤ë¤³¤È¤ÏC¤Ç¤â½ñ¤±¤Þ¤¹¡¥Ruby¤½¤Î¤â¤Î¤¬C¤Çµ­
+½Ò¤µ¤ì¤Æ¤¤¤ë¤ó¤Ç¤¹¤«¤é¡¤ÅöÁ³¤È¤¤¤¨¤ÐÅöÁ³¤Ê¤ó¤Ç¤¹¤±¤É¡¥¤³¤³¤Ç
+¤ÏRuby¤Î³ÈÄ¥¤Ë»È¤¦¤³¤È¤¬Â¿¤¤¤À¤í¤¦¤Èͽ¬¤µ¤ì¤ëµ¡Ç½¤òÃæ¿´¤Ë¾Ò
+²ð¤·¤Þ¤¹¡¥
+
+2.1 Ruby¤Ëµ¡Ç½¤òÄɲ乤ë
+
+Ruby¤ÇÄ󶡤µ¤ì¤Æ¤¤¤ë´Ø¿ô¤ò»È¤¨¤ÐRuby¥¤¥ó¥¿¥×¥ê¥¿¤Ë¿·¤·¤¤µ¡Ç½
+¤òÄɲ乤뤳¤È¤¬¤Ç¤­¤Þ¤¹¡¥Ruby¤Ç¤Ï°Ê²¼¤Îµ¡Ç½¤òÄɲ乤ë´Ø¿ô¤¬
+Ä󶡤µ¤ì¤Æ¤¤¤Þ¤¹¡¥
+
+ * ¥¯¥é¥¹¡¤¥â¥¸¥å¡¼¥ë
+ * ¥á¥½¥Ã¥É¡¤Æðۥ᥽¥Ã¥É¤Ê¤É
+ * Äê¿ô
+
+¤Ç¤Ï½ç¤Ë¾Ò²ð¤·¤Þ¤¹¡¥
+
+2.1.1 ¥¯¥é¥¹/¥â¥¸¥å¡¼¥ëÄêµÁ
+
+¥¯¥é¥¹¤ä¥â¥¸¥å¡¼¥ë¤òÄêµÁ¤¹¤ë¤¿¤á¤Ë¤Ï¡¤°Ê²¼¤Î´Ø¿ô¤ò»È¤¤¤Þ¤¹¡¥
+
+  VALUE rb_define_class(char *name, VALUE super)
+  VALUE rb_define_module(char *name)
+
+¤³¤ì¤é¤Î´Ø¿ô¤Ï¿·¤·¤¯ÄêµÁ¤µ¤ì¤¿¥¯¥é¥¹¤ä¥â¥¸¥å¡¼¥ë¤òÊÖ¤·¤Þ¤¹¡¥
+¥á¥½¥Ã¥É¤äÄê¿ô¤ÎÄêµÁ¤Ë¤³¤ì¤é¤ÎÃͤ¬É¬ÍפʤΤǡ¤¤Û¤È¤ó¤É¤Î¾ì¹ç
+¤ÏÌá¤êÃͤòÊÑ¿ô¤Ë³ÊǼ¤·¤Æ¤ª¤¯É¬Íפ¬¤¢¤ë¤Ç¤·¤ç¤¦¡¥
+
+¥¯¥é¥¹¤ä¥â¥¸¥å¡¼¥ë¤ò¾¤Î¥¯¥é¥¹¤ÎÆâÉô¤Ë¥Í¥¹¥È¤·¤ÆÄêµÁ¤¹¤ë»þ¤Ë
+¤Ï°Ê²¼¤Î´Ø¿ô¤ò»È¤¤¤Þ¤¹¡¥
+
+  VALUE rb_define_class(VALUE outer, char *name, VALUE super)
+  VALUE rb_define_module(VALUE outer, char *name)
+
+2.1.2 ¥á¥½¥Ã¥É/Æðۥ᥽¥Ã¥ÉÄêµÁ
+
+¥á¥½¥Ã¥É¤äÆðۥ᥽¥Ã¥É¤òÄêµÁ¤¹¤ë¤Ë¤Ï°Ê²¼¤Î´Ø¿ô¤ò»È¤¤¤Þ¤¹¡¥
+
+  void rb_define_method(VALUE class, char *name, 
+		        VALUE (*func)(), int argc)
+
+  void rb_define_singleton_method(VALUE object, char *name, 
+			          VALUE (*func)(), int argc)
+
+
+Ç°¤Î¤¿¤áÀâÌÀ¤¹¤ë¤È¡ÖÆðۥ᥽¥Ã¥É¡×¤È¤Ï¡¤¤½¤ÎÆÃÄê¤Î¥ª¥Ö¥¸¥§¥¯
+¥È¤ËÂФ·¤Æ¤À¤±Í­¸ú¤Ê¥á¥½¥Ã¥É¤Ç¤¹¡¥Ruby¤Ç¤Ï¤è¤¯Smalltalk¤Ë¤ª
+¤±¤ë¥¯¥é¥¹¥á¥½¥Ã¥É¤È¤·¤Æ¡¤¥¯¥é¥¹¤ËÂФ¹¤ëÆðۥ᥽¥Ã¥É¤¬»È¤ï¤ì
+¤Þ¤¹¡¥
+
+¤³¤ì¤é¤Î´Ø¿ô¤Î argc¤È¤¤¤¦°ú¿ô¤ÏC¤Î´Ø¿ô¤ØÅϤµ¤ì¤ë°ú¿ô¤Î¿ô(¤È
+·Á¼°)¤ò·è¤á¤Þ¤¹¡¥argc¤¬Àµ¤Î»þ¤Ï´Ø¿ô¤Ë°ú¤­ÅϤ¹°ú¿ô¤Î¿ô¤ò°ÕÌ£
+¤·¤Þ¤¹¡¥16¸Ä°Ê¾å¤Î°ú¿ô¤Ï»È¤¨¤Þ¤»¤ó(¤¬¡¤Íפê¤Þ¤»¤ó¤è¤Í¡¤¤½¤ó
+¤Ê¤Ë)¡¥¼ÂºÝ¤Î´Ø¿ô¤Ë¤ÏÀèƬ¤Î°ú¿ô¤È¤·¤Æself¤¬Í¿¤¨¤é¤ì¤Þ¤¹¤Î¤Ç¡¤
+»ØÄꤷ¤¿¿ô¤è¤ê1¿¤¤°ú¿ô¤ò»ý¤Ä¤³¤È¤Ë¤Ê¤ê¤Þ¤¹¡¥
+
+argc¤¬Éé¤Î»þ¤Ï°ú¿ô¤Î¿ô¤Ç¤Ï¤Ê¤¯¡¤·Á¼°¤ò»ØÄꤷ¤¿¤³¤È¤Ë¤Ê¤ê¤Þ¤¹¡¥
+argc¤¬-1¤Î»þ¤Ï°ú¿ô¤òÇÛÎó¤ËÆþ¤ì¤ÆÅϤµ¤ì¤Þ¤¹¡¥argc¤¬-2¤Î»þ¤Ï°ú
+¿ô¤ÏRuby¤ÎÇÛÎó¤È¤·¤ÆÅϤµ¤ì¤Þ¤¹¡¥
+
+¥á¥½¥Ã¥É¤òÄêµÁ¤¹¤ë´Ø¿ô¤Ï¤â¤¦Æó¤Ä¤¢¤ê¤Þ¤¹¡¥¤Ò¤È¤Ä¤Ïprivate¥á
+¥½¥Ã¥É¤òÄêµÁ¤¹¤ë´Ø¿ô¤Ç¡¤°ú¿ô¤Ïrb_define_method()¤ÈƱ¤¸¤Ç¤¹¡¥
+
+  void rb_define_private_method(VALUE class, char *name, 
+			        VALUE (*func)(), int argc)
+
+private¥á¥½¥Ã¥É¤È¤Ï´Ø¿ô·Á¼°¤Ç¤·¤«¸Æ¤Ó½Ð¤¹¤³¤È¤Î½ÐÍè¤Ê¤¤¥á¥½¥Ã
+¥É¤Ç¤¹¡¥
+
+¤â¤¦¤Ò¤È¤Ä¤Ï¥â¥¸¥å¡¼¥ë´Ø¿ô¤òÄêµÁ¤¹¤ë¤â¤Î¤Ç¤¹¡¥¥â¥¸¥å¡¼¥ë´Ø¿ô
+¤È¤Ï¥â¥¸¥å¡¼¥ë¤ÎÆðۥ᥽¥Ã¥É¤Ç¤¢¤ê¡¤Æ±»þ¤Ëprivate¥á¥½¥Ã¥É¤Ç
+¤â¤¢¤ë¤â¤Î¤Ç¤¹¡¥Îã¤ò¤¢¤²¤ë¤ÈMath¥â¥¸¥å¡¼¥ë¤Îsqrt()¤Ê¤É¤¬¤¢¤²
+¤é¤ì¤Þ¤¹¡¥¤³¤Î¥á¥½¥Ã¥É¤Ï
+
+  Math.sqrt(4)
+
+¤È¤¤¤¦·Á¼°¤Ç¤â
+
+  include Math
+  sqrt(4)
+
+¤È¤¤¤¦·Á¼°¤Ç¤â»È¤¨¤Þ¤¹¡¥¥â¥¸¥å¡¼¥ë´Ø¿ô¤òÄêµÁ¤¹¤ë´Ø¿ô¤Ï°Ê²¼¤Î
+Ä̤ê¤Ç¤¹¡¥
+
+  void rb_define_module_function(VALUE module, char *name, 
+		                 VALUE (*func)(), int argc)
+
+´Ø¿ôŪ¥á¥½¥Ã¥É(Kernel¥â¥¸¥å¡¼¥ë¤Îprivate method)¤òÄêµÁ¤¹¤ë¤¿
+¤á¤Î´Ø¿ô¤Ï°Ê²¼¤ÎÄ̤ê¤Ç¤¹¡¥
+
+  void rb_define_global_function(char *name, VALUE (*func)(), int argc)
+
+
+2.1.3 Äê¿ôÄêµÁ
+
+³ÈÄ¥¥â¥¸¥å¡¼¥ë¤¬É¬ÍפÊÄê¿ô¤Ï¤¢¤é¤«¤¸¤áÄêµÁ¤·¤Æ¤ª¤¤¤¿Êý¤¬Îɤ¤
+¤Ç¤·¤ç¤¦¡¥Äê¿ô¤òÄêµÁ¤¹¤ë´Ø¿ô¤ÏÆó¤Ä¤¢¤ê¤Þ¤¹¡¥
+
+  void rb_define_const(VALUE class, char *name, VALUE val)
+  void rb_define_global_const(char *name, VALUE val)
+
+Á°¼Ô¤ÏÆÃÄê¤Î¥¯¥é¥¹/¥â¥¸¥å¡¼¥ë¤Ë°¤¹¤ëÄê¿ô¤òÄêµÁ¤¹¤ë¤â¤Î¡¤¸å
+¼Ô¤Ï¥°¥í¡¼¥Ð¥ë¤ÊÄê¿ô¤òÄêµÁ¤¹¤ë¤â¤Î¤Ç¤¹¡¥
+
+2.2 Ruby¤Îµ¡Ç½¤òC¤«¤é¸Æ¤Ó½Ð¤¹
+
+´û¤Ë¡Ø1.5 Ruby¤Î¥Ç¡¼¥¿¤òÁàºî¤¹¤ë¡Ù¤Ç°ìÉô¾Ò²ð¤·¤¿¤è¤¦¤Ê´Ø¿ô¤ò
+»È¤¨¤Ð¡¤Ruby¤Îµ¡Ç½¤ò¼Â¸½¤·¤Æ¤¤¤ë´Ø¿ô¤òľÀܸƤӽФ¹¤³¤È¤¬½ÐÍè
+¤Þ¤¹¡¥
+
+# ¤³¤Î¤è¤¦¤Ê´Ø¿ô¤Î°ìÍ÷ɽ¤Ï¤¤¤Þ¤Î¤È¤³¤í¤¢¤ê¤Þ¤»¤ó¡¥¥½¡¼¥¹¤ò¸«
+# ¤ë¤·¤«¤Ê¤¤¤Ç¤¹¤Í¡¥
+
+¤½¤ì°Ê³°¤Ë¤âRuby¤Îµ¡Ç½¤ò¸Æ¤Ó½Ð¤¹ÊýË¡¤Ï¤¤¤¯¤Ä¤«¤¢¤ê¤Þ¤¹¡¥
+
+2.2.1 Ruby¤Î¥×¥í¥°¥é¥à¤òeval¤¹¤ë
+
+C¤«¤éRuby¤Îµ¡Ç½¤ò¸Æ¤Ó½Ð¤¹¤â¤Ã¤È¤â´Êñ¤ÊÊýË¡¤È¤·¤Æ¡¤Ê¸»úÎó¤Ç
+Í¿¤¨¤é¤ì¤¿Ruby¤Î¥×¥í¥°¥é¥à¤òɾ²Á¤¹¤ë´Ø¿ô¤¬¤¢¤ê¤Þ¤¹¡¥
+
+  VALUE rb_eval_string(char *str)
+
+¤³¤Îɾ²Á¤Ï¸½ºß¤Î´Ä¶­¤Ç¹Ô¤ï¤ì¤Þ¤¹¡¥¤Ä¤Þ¤ê¡¤¸½ºß¤Î¥í¡¼¥«¥ëÊÑ¿ô
+¤Ê¤É¤ò¼õ¤±·Ñ¤®¤Þ¤¹¡¥
+
+2.2.2 ID¤Þ¤¿¤Ï¥·¥ó¥Ü¥ë
+
+C¤«¤éʸ»úÎó¤ò·Ðͳ¤»¤º¤ËRuby¤Î¥á¥½¥Ã¥É¤ò¸Æ¤Ó½Ð¤¹¤³¤È¤â¤Ç¤­¤Þ
+¤¹¡¥¤½¤ÎÁ°¤Ë¡¤Ruby¥¤¥ó¥¿¥×¥ê¥¿Æâ¤Ç¥á¥½¥Ã¥É¤äÊÑ¿ô̾¤ò»ØÄꤹ¤ë
+»þ¤Ë»È¤ï¤ì¤Æ¤¤¤ëID¤Ë¤Ä¤¤¤ÆÀâÌÀ¤·¤Æ¤ª¤­¤Þ¤·¤ç¤¦¡¥
+
+ID¤È¤ÏÊÑ¿ô̾¡¤¥á¥½¥Ã¥É̾¤òɽ¤¹À°¿ô¤Ç¤¹¡¥Ruby¤ÎÃæ¤Ç¤Ï
+
+ :¼±ÊÌ»Ò
+
+¤Ç¥¢¥¯¥»¥¹¤Ç¤­¤Þ¤¹¡¥C¤«¤é¤³¤ÎÀ°¿ô¤òÆÀ¤ë¤¿¤á¤Ë¤Ï´Ø¿ô
+
+  rb_intern(char *name)
+
+¤ò»È¤¤¤Þ¤¹¡¥¤Þ¤¿°ìʸ»ú¤Î±é»»»Ò¤Ï¤½¤Îʸ»ú¥³¡¼¥É¤¬¤½¤Î¤Þ¤Þ¥·¥ó
+¥Ü¥ë¤Ë¤Ê¤Ã¤Æ¤¤¤Þ¤¹¡¥Ruby¤«¤é°ú¿ô¤È¤·¤ÆÍ¿¤¨¤é¤ì¤¿¥·¥ó¥Ü¥ë(¤Þ
+¤¿¤Ïʸ»úÎó)¤òID¤ËÊÑ´¹¤¹¤ë¤Ë¤Ï°Ê²¼¤Î´Ø¿ô¤ò»È¤¤¤Þ¤¹¡¥
+
+  rb_to_id(VALUE symbol)
+
+2.2.3 C¤«¤éRuby¤Î¥á¥½¥Ã¥É¤ò¸Æ¤Ó½Ð¤¹
+
+C¤«¤éʸ»úÎó¤ò·Ðͳ¤»¤º¤ËRuby¤Î¥á¥½¥Ã¥É¤ò¸Æ¤Ó½Ð¤¹¤¿¤á¤Ë¤Ï°Ê²¼
+¤Î´Ø¿ô¤ò»È¤¤¤Þ¤¹¡¥
+
+  VALUE rb_funcall(VALUE recv, ID mid, int argc, ...)
+
+¤³¤Î´Ø¿ô¤Ï¥ª¥Ö¥¸¥§¥¯¥Èrecv¤Îmid¤Ç»ØÄꤵ¤ì¤ë¥á¥½¥Ã¥É¤ò¸Æ¤Ó½Ð
+¤·¤Þ¤¹¡¥¤½¤Î¾¤Ë°ú¿ô¤Î»ØÄê¤Î»ÅÊý¤¬°ã¤¦°Ê²¼¤Î´Ø¿ô¤â¤¢¤ê¤Þ¤¹¡¥
+
+  VALUE rb_funcall2(VALUE recv, ID mid, int argc, VALUE *argv)
+  VALUE rb_apply(VALUE recv, ID mid, VALUE args)
+
+apply¤Ë¤Ï°ú¿ô¤È¤·¤ÆRuby¤ÎÇÛÎó¤òÍ¿¤¨¤Þ¤¹¡¥
+
+2.2.4 ÊÑ¿ô/Äê¿ô¤ò»²¾È/¹¹¿·¤¹¤ë
+
+C¤«¤é´Ø¿ô¤ò»È¤Ã¤Æ»²¾È¡¦¹¹¿·¤Ç¤­¤ë¤Î¤Ï¡¤¥¯¥é¥¹Äê¿ô¡¤¥¤¥ó¥¹¥¿
+¥ó¥¹ÊÑ¿ô¤Ç¤¹¡¥Âç°èÊÑ¿ô¤Ï°ìÉô¤Î¤â¤Î¤ÏC¤ÎÂç°èÊÑ¿ô¤È¤·¤Æ¥¢¥¯¥»
+¥¹¤Ç¤­¤Þ¤¹¡¥¥í¡¼¥«¥ëÊÑ¿ô¤ò»²¾È¤¹¤ëÊýË¡¤Ï¸ø³«¤·¤Æ¤¤¤Þ¤»¤ó¡¥
+
+¥ª¥Ö¥¸¥§¥¯¥È¤Î¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô¤ò»²¾È¡¦¹¹¿·¤¹¤ë´Ø¿ô¤Ï°Ê²¼¤ÎÄÌ
+¤ê¤Ç¤¹¡¥
+
+  VALUE rb_ivar_get(VALUE obj, ID id)
+  VALUE rb_ivar_set(VALUE obj, ID id, VALUE val)
+
+id¤Ïrb_intern()¤ÇÆÀ¤é¤ì¤ë¤â¤Î¤ò»È¤Ã¤Æ¤¯¤À¤µ¤¤¡¥
+
+¥¯¥é¥¹Äê¿ô¤ò»²¾È¤¹¤ë¤Ë¤Ï°Ê²¼¤Î´Ø¿ô¤ò»È¤Ã¤Æ¤¯¤À¤µ¤¤¡¥
+
+  VALUE rb_const_get(VALUE obj, ID id)
+
+¥¯¥é¥¹Äê¿ô¤ò¿·¤·¤¯ÄêµÁ¤¹¤ë¤¿¤á¤Ë¤Ï¡Ø2.1.3 Äê¿ôÄêµÁ¡Ù¤Ç¾Ò²ð¤µ
+¤ì¤Æ¤¤¤ë´Ø¿ô¤ò»È¤Ã¤Æ¤¯¤À¤µ¤¤¡¥
+
+3¡¥Ruby¤ÈC¤È¤Î¾ðÊó¶¦Í­
+
+C¸À¸ì¤ÈRuby¤Î´Ö¤Ç¾ðÊó¤ò¶¦Í­¤¹¤ëÊýË¡¤Ë¤Ä¤¤¤Æ²òÀ⤷¤Þ¤¹¡¥
+
+3.1 C¤«¤é»²¾È¤Ç¤­¤ëRuby¤ÎÄê¿ô
+
+°Ê²¼¤ÎRuby¤ÎÄê¿ô¤ÏC¤Î¥ì¥Ù¥ë¤«¤é»²¾È¤Ç¤­¤ë¡¥
+
+  TRUE
+  FALSE
+
+¿¿µ¶ÃÍ¡¥FALSE¤ÏC¸À¸ì¤Ç¤âµ¶¤È¤ß¤Ê¤µ¤ì¤ë(¤Ä¤Þ¤ê0)¡¥
+
+  Qnil
+
+C¸À¸ì¤«¤é¸«¤¿¡Önil¡×¡¥
+
+3.2 C¤ÈRuby¤Ç¶¦Í­¤µ¤ì¤ëÂç°èÊÑ¿ô
+
+C¤ÈRuby¤ÇÂç°èÊÑ¿ô¤ò»È¤Ã¤Æ¾ðÊó¤ò¶¦Í­¤Ç¤­¤Þ¤¹¡¥¶¦Í­¤Ç¤­¤ëÂç°è
+ÊÑ¿ô¤Ë¤Ï¤¤¤¯¤Ä¤«¤Î¼ïÎब¤¢¤ê¤Þ¤¹¡¥¤½¤Î¤Ê¤«¤Ç¤â¤Ã¤È¤âÎɤ¯»È¤ï
+¤ì¤ë¤È»×¤ï¤ì¤ë¤Î¤Ïrb_define_variable()¤Ç¤¹¡¥
+
+  void rb_define_variable(char *name, VALUE *var)
+
+¤³¤Î´Ø¿ô¤ÏRuby¤ÈC¤È¤Ç¶¦Í­¤¹¤ëÂç°èÊÑ¿ô¤òÄêµÁ¤·¤Þ¤¹¡¥ÊÑ¿ô̾¤¬
+`$'¤Ç»Ï¤Þ¤é¤Ê¤¤»þ¤Ë¤Ï¼«Æ°Åª¤ËÄɲ䵤ì¤Þ¤¹¡¥¤³¤ÎÊÑ¿ô¤ÎÃͤòÊÑ
+¹¹¤¹¤ë¤È¼«Æ°Åª¤ËRuby¤ÎÂбþ¤¹¤ëÊÑ¿ô¤ÎÃͤâÊѤï¤ê¤Þ¤¹¡¥
+
+¤Þ¤¿Ruby¦¤«¤é¤Ï¹¹¿·¤Ç¤­¤Ê¤¤ÊÑ¿ô¤â¤¢¤ê¤Þ¤¹¡¥¤³¤Îread only¤Î
+ÊÑ¿ô¤Ï°Ê²¼¤Î´Ø¿ô¤ÇÄêµÁ¤·¤Þ¤¹¡¥
+
+  void rb_define_readonly_variable(char *name, VALUE *var)
+
+¤³¤ì¤éÊÑ¿ô¤Î¾¤Ëhook¤ò¤Ä¤±¤¿Âç°èÊÑ¿ô¤òÄêµÁ¤Ç¤­¤Þ¤¹¡¥hookÉÕ¤­
+¤ÎÂç°èÊÑ¿ô¤Ï°Ê²¼¤Î´Ø¿ô¤òÍѤ¤¤ÆÄêµÁ¤·¤Þ¤¹¡¥hookÉÕ¤­Âç°èÊÑ¿ô¤Î
+Ãͤλ²¾È¤äÀßÄê¤Ïhook¤Ç¹Ô¤¦É¬Íפ¬¤¢¤ê¤Þ¤¹¡¥
+
+  void rb_define_hooked_variable(char *name, VALUE *var,
+				 VALUE (*getter)(), VALUE (*setter)())
+
+¤³¤Î´Ø¿ô¤ÏC¤Î´Ø¿ô¤Ë¤è¤Ã¤Æhook¤Î¤Ä¤±¤é¤ì¤¿Âç°èÊÑ¿ô¤òÄêµÁ¤·¤Þ
+¤¹¡¥ÊÑ¿ô¤¬»²¾È¤µ¤ì¤¿»þ¤Ë¤Ï´Ø¿ôgetter¤¬¡¤ÊÑ¿ô¤ËÃͤ¬¥»¥Ã¥È¤µ¤ì
+¤¿»þ¤Ë¤Ï´Ø¿ôsetter¤¬¸Æ¤Ð¤ì¤ë¡¥hook¤ò»ØÄꤷ¤Ê¤¤¾ì¹ç¤Ïgetter¤ä
+setter¤Ë0¤ò»ØÄꤷ¤Þ¤¹¡¥
+
+# getter¤âsetter¤â0¤Ê¤é¤Ðrb_define_variable()¤ÈƱ¤¸¤Ë¤Ê¤ë¡¥
+
+¤½¤ì¤«¤é¡¤C¤Î´Ø¿ô¤Ë¤è¤Ã¤Æ¼Â¸½¤µ¤ì¤ëRuby¤ÎÂç°èÊÑ¿ô¤òÄêµÁ¤¹¤ë
+´Ø¿ô¤¬¤¢¤ê¤Þ¤¹¡¥
+
+  void rb_define_virtual_variable(char *name,
+				  VALUE (*getter)(), VALUE (*setter)())
+
+¤³¤Î´Ø¿ô¤Ë¤è¤Ã¤ÆÄêµÁ¤µ¤ì¤¿Ruby¤ÎÂç°èÊÑ¿ô¤¬»²¾È¤µ¤ì¤¿»þ¤Ë¤Ï
+getter¤¬¡¤ÊÑ¿ô¤ËÃͤ¬¥»¥Ã¥È¤µ¤ì¤¿»þ¤Ë¤Ïsetter¤¬¸Æ¤Ð¤ì¤Þ¤¹¡¥
+
+getter¤Èsetter¤Î»ÅÍͤϰʲ¼¤ÎÄ̤ê¤Ç¤¹¡¥
+
+  (*getter)(ID id, void *data, struct global_entry* entry);
+  (*setter)(VALUE val, ID id, void *data, struct global_entry* entry);
+
+3.3 C¤Î¥Ç¡¼¥¿¤òRuby¥ª¥Ö¥¸¥§¥¯¥È¤Ë¤¹¤ë
+
+C¤ÎÀ¤³¦¤ÇÄêµÁ¤µ¤ì¤¿¥Ç¡¼¥¿(¹½Â¤ÂÎ)¤òRuby¤Î¥ª¥Ö¥¸¥§¥¯¥È¤È¤·¤Æ
+¼è¤ê°·¤¤¤¿¤¤¾ì¹ç¤¬¤¢¤ê¤¨¤Þ¤¹¡¥¤³¤Î¤è¤¦¤Ê¾ì¹ç¤Ë¤Ï¡¤Data¤È¤¤¤¦
+Ruby¥ª¥Ö¥¸¥§¥¯¥È¤ËC¤Î¹½Â¤ÂÎ(¤Ø¤Î¥Ý¥¤¥ó¥¿)¤ò¤¯¤ë¤à¤³¤È¤ÇRuby
+¥ª¥Ö¥¸¥§¥¯¥È¤È¤·¤Æ¼è¤ê°·¤¨¤ë¤è¤¦¤Ë¤Ê¤ê¤Þ¤¹¡¥
+
+Data¥ª¥Ö¥¸¥§¥¯¥È¤òÀ¸À®¤·¤Æ¹½Â¤ÂΤòRuby¥ª¥Ö¥¸¥§¥¯¥È¤Ë¥«¥×¥»¥ë
+²½¤¹¤ë¤¿¤á¤Ë¤Ï¡¤°Ê²¼¤Î¥Þ¥¯¥í¤ò»È¤¤¤Þ¤¹¡¥
+
+  Data_Wrap_Struct(class,mark,free,ptr)
+
+¤³¤Î¥Þ¥¯¥í¤ÎÌá¤êÃͤÏÀ¸À®¤µ¤ì¤¿Data¥ª¥Ö¥¸¥§¥¯¥È¤Ç¤¹¡¥
+
+class¤Ï¤³¤ÎData¥ª¥Ö¥¸¥§¥¯¥È¤Î¥¯¥é¥¹¤Ç¤¹¡¥ptr¤Ï¥«¥×¥»¥ë²½¤¹¤ë
+C¤Î¹½Â¤ÂΤؤΥݥ¤¥ó¥¿¤Ç¤¹¡¥mark¤Ï¤³¤Î¹½Â¤ÂΤ¬Ruby¤Î¥ª¥Ö¥¸¥§
+¥¯¥È¤Ø¤Î»²¾È¤¬¤¢¤ë»þ¤Ë»È¤¦´Ø¿ô¤Ç¤¹¡¥¤½¤Î¤è¤¦¤Ê»²¾È¤ò´Þ¤Þ¤Ê¤¤
+»þ¤Ë¤Ï0¤ò»ØÄꤷ¤Þ¤¹¡¥
+
+# ¤½¤Î¤è¤¦¤Ê»²¾È¤Ï´«¤á¤é¤ì¤Þ¤»¤ó¡¥
+
+free¤Ï¤³¤Î¹½Â¤ÂΤ¬¤â¤¦ÉÔÍפˤʤä¿»þ¤Ë¸Æ¤Ð¤ì¤ë´Ø¿ô¤Ç¤¹¡¥¤³¤Î
+´Ø¿ô¤¬¥¬¡¼¥Ù¡¼¥¸¥³¥ì¥¯¥¿¤«¤é¸Æ¤Ð¤ì¤Þ¤¹¡¥
+
+C¤Î¹½Â¤ÂΤγäÅö¤ÈData¥ª¥Ö¥¸¥§¥¯¥È¤ÎÀ¸À®¤òƱ»þ¤Ë¹Ô¤¦¥Þ¥¯¥í¤È
+¤·¤Æ°Ê²¼¤Î¤â¤Î¤¬Ä󶡤µ¤ì¤Æ¤¤¤Þ¤¹¡¥
+
+  Data_Make_Struct(class, type, mark, free, sval)
+
+¤³¤Î¥Þ¥¯¥í¤ÎÌá¤êÃͤÏÀ¸À®¤µ¤ì¤¿Data¥ª¥Ö¥¸¥§¥¯¥È¤Ç¤¹¡¥
+
+class, mark, free¤ÏData_Wrap_Struct¤ÈƱ¤¸Æ¯¤­¤ò¤·¤Þ¤¹¡¥type
+¤Ï³ä¤êÅö¤Æ¤ëC¹½Â¤ÂΤη¿¤Ç¤¹¡¥³ä¤êÅö¤Æ¤é¤ì¤¿¹½Â¤ÂΤÏÊÑ¿ôsval
+¤ËÂåÆþ¤µ¤ì¤Þ¤¹¡¥¤³¤ÎÊÑ¿ô¤Î·¿¤Ï (type*) ¤Ç¤¢¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¡¥
+
+Data¥ª¥Ö¥¸¥§¥¯¥È¤«¤é¥Ý¥¤¥ó¥¿¤ò¼è¤ê½Ð¤¹¤Î¤Ï°Ê²¼¤Î¥Þ¥¯¥í¤òÍѤ¤
+¤Þ¤¹¡¥
+
+  Data_Get_Struct(obj, type, sval)
+
+C¤Î¹½Â¤ÂΤؤΥݥ¤¥ó¥¿¤ÏÊÑ¿ôsval¤ËÂåÆþ¤µ¤ì¤Þ¤¹¡¥
+
+¤³¤ì¤é¤ÎData¤Î»È¤¤Êý¤Ï¤Á¤ç¤Ã¤Èʬ¤«¤ê¤Ë¤¯¤¤¤Î¤Ç¡¤¸å¤ÇÀâÌÀ¤¹¤ë
+ÎãÂê¤ò»²¾È¤·¤Æ¤¯¤À¤µ¤¤¡¥
+
+4¡¥ÎãÂê - dbm¥Ñ¥Ã¥±¡¼¥¸¤òºî¤ë
+
+¤³¤³¤Þ¤Ç¤ÎÀâÌÀ¤Ç¤È¤ê¤¢¤¨¤º³ÈÄ¥¥â¥¸¥å¡¼¥ë¤Ïºî¤ì¤ë¤Ï¤º¤Ç¤¹¡¥
+Ruby¤Îext¥Ç¥£¥ì¥¯¥È¥ê¤Ë¤¹¤Ç¤Ë´Þ¤Þ¤ì¤Æ¤¤¤ëdbm¥â¥¸¥å¡¼¥ë¤òÎã¤Ë
+¤·¤ÆÃʳ¬Åª¤ËÀâÌÀ¤·¤Þ¤¹¡¥
+
+(1) ¥Ç¥£¥ì¥¯¥È¥ê¤òºî¤ë
+
+  % mkdir ext/dbm
+
+Ruby 1.1¤«¤é¤ÏǤ°Õ¤Î¥Ç¥£¥ì¥¯¥È¥ê¤Ç¥À¥¤¥Ê¥ß¥Ã¥¯¥é¥¤¥Ö¥é¥ê¤òºî
+¤ë¤³¤È¤¬¤Ç¤­¤ë¤è¤¦¤Ë¤Ê¤ê¤Þ¤·¤¿¡¥Ruby¤ËÀÅŪ¤Ë¥ê¥ó¥¯¤¹¤ë¾ì¹ç¤Ë
+¤ÏRuby¤òŸ³«¤·¤¿¥Ç¥£¥ì¥¯¥È¥ê¤Î²¼¡¤ext¥Ç¥£¥ì¥¯¥È¥ê¤ÎÃæ¤Ë³ÈÄ¥
+¥â¥¸¥å¡¼¥ëÍѤΥǥ£¥ì¥¯¥È¥ê¤òºî¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¡¥Ì¾Á°¤ÏŬÅö¤Ë
+Áª¤ó¤Ç¹½¤¤¤Þ¤»¤ó¡¥
+
+(2) MANIFEST¥Õ¥¡¥¤¥ë¤òºî¤ë
+
+  % cd ext/dbm
+  % touch MANIFEST
+
+³ÈÄ¥¥â¥¸¥å¡¼¥ë¤Î¥Ç¥£¥ì¥¯¥È¥ê¤Î²¼¤Ë¤ÏMANIFEST¤È¤¤¤¦¥Õ¥¡¥¤¥ë¤¬
+ɬÍפʤΤǡ¤¤È¤ê¤¢¤¨¤º¶õ¤Î¥Õ¥¡¥¤¥ë¤òºî¤Ã¤Æ¤ª¤­¤Þ¤¹¡¥¸å¤Ç¤³¤Î
+¥Õ¥¡¥¤¥ë¤Ë¤ÏɬÍפʥե¡¥¤¥ë°ìÍ÷¤¬Æþ¤ë¤³¤È¤Ë¤Ê¤ê¤Þ¤¹¡¥
+
+MANIFEST¤È¤¤¤¦¥Õ¥¡¥¤¥ë¤Ï¡¤ÀÅŪ¥ê¥ó¥¯¤Îmake¤Î»þ¤Ë¥Ç¥£¥ì¥¯¥È¥ê
+¤¬³ÈÄ¥¥â¥¸¥å¡¼¥ë¤ò´Þ¤ó¤Ç¤¤¤ë¤«¤É¤¦¤«È½Äꤹ¤ë¤¿¤á¤Ë»È¤ï¤ì¤ì¤Æ
+¤¤¤Þ¤¹¡¥¥À¥¤¥Ê¥ß¥Ã¥¯¥é¥¤¥Ö¥é¥ê¤òºî¤ë¾ì¹ç¤Ë¤Ïɬ¤º¤·¤âɬÍפǤÏ
+¤¢¤ê¤Þ¤»¤ó¡¥
+
+(3) À߷פ¹¤ë
+
+¤Þ¤¢¡¤ÅöÁ³¤Ê¤ó¤Ç¤¹¤±¤É¡¤¤É¤¦¤¤¤¦µ¡Ç½¤ò¼Â¸½¤¹¤ë¤«¤É¤¦¤«¤Þ¤ºÀß
+·×¤¹¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¡¥¤É¤ó¤Ê¥¯¥é¥¹¤ò¤Ä¤¯¤ë¤«¡¤¤½¤Î¥¯¥é¥¹¤Ë¤Ï
+¤É¤ó¤Ê¥á¥½¥Ã¥É¤¬¤¢¤ë¤«¡¤¥¯¥é¥¹¤¬Ä󶡤¹¤ëÄê¿ô¤Ê¤É¤Ë¤Ä¤¤¤ÆÀß·×
+¤·¤Þ¤¹¡¥dbm¥¯¥é¥¹¤Ë¤Ä¤¤¤Æ¤Ïext/dbm.doc¤ò»²¾È¤·¤Æ¤¯¤À¤µ¤¤¡¥
+
+(4) C¥³¡¼¥É¤ò½ñ¤¯
+
+³ÈÄ¥¥â¥¸¥å¡¼¥ëËÜÂΤȤʤëC¸À¸ì¤Î¥½¡¼¥¹¤ò½ñ¤­¤Þ¤¹¡¥C¸À¸ì¤Î¥½¡¼
+¥¹¤¬¤Ò¤È¤Ä¤Î»þ¤Ë¤Ï¡Ö¥â¥¸¥å¡¼¥ë̾.c¡×¤òÁª¤Ö¤ÈÎɤ¤¤Ç¤·¤ç¤¦¡¥C
+¸À¸ì¤Î¥½¡¼¥¹¤¬Ê£¿ô¤Î¾ì¹ç¤Ë¤ÏµÕ¤Ë¡Ö¥â¥¸¥å¡¼¥ë̾.c¡×¤È¤¤¤¦¥Õ¥¡
+¥¤¥ë̾¤ÏÈò¤±¤ëɬÍפ¬¤¢¤ê¤Þ¤¹¡¥¥ª¥Ö¥¸¥§¥¯¥È¥Õ¥¡¥¤¥ë¤È¥â¥¸¥å¡¼
+¥ëÀ¸À®»þ¤ËÃæ´ÖŪ¤ËÀ¸À®¤µ¤ì¤ë¡Ö¥â¥¸¥å¡¼¥ë̾.o¡×¤È¤¤¤¦¥Õ¥¡¥¤¥ë
+¤È¤¬¾×Æͤ¹¤ë¤«¤é¤Ç¤¹¡¥
+
+Ruby¤Ï³ÈÄ¥¥â¥¸¥å¡¼¥ë¤ò¥í¡¼¥É¤¹¤ë»þ¤Ë¡ÖInit_¥â¥¸¥å¡¼¥ë̾¡×¤È
+¤¤¤¦´Ø¿ô¤ò¼«Æ°Åª¤Ë¼Â¹Ô¤·¤Þ¤¹¡¥dbm¥â¥¸¥å¡¼¥ë¤Î¾ì¹ç¡ÖInit_dbm¡×
+¤Ç¤¹¡¥¤³¤Î´Ø¿ô¤ÎÃæ¤Ç¥¯¥é¥¹¡¤¥â¥¸¥å¡¼¥ë¡¤¥á¥½¥Ã¥É¡¤Äê¿ô¤Ê¤É¤Î
+ÄêµÁ¤ò¹Ô¤¤¤Þ¤¹¡¥dbm.c¤«¤é°ìÉô°úÍѤ·¤Þ¤¹¡¥
+
+--
+Init_dbm()
+{
+    /* DBM¥¯¥é¥¹¤òÄêµÁ¤¹¤ë */
+    cDBM = rb_define_class("DBM", cObject);
+    /* DBM¤ÏEnumerate¥â¥¸¥å¡¼¥ë¤ò¥¤¥ó¥¯¥ë¡¼¥É¤¹¤ë */
+    rb_include_module(cDBM, mEnumerable);
+
+    /* DBM¥¯¥é¥¹¤Î¥¯¥é¥¹¥á¥½¥Ã¥Éopen(): °ú¿ô¤ÏC¤ÎÇÛÎó¤Ç¼õ¤±¤ë */
+    rb_define_singleton_method(cDBM, "open", fdbm_s_open, -1);
+
+    /* DBM¥¯¥é¥¹¤Î¥á¥½¥Ã¥Éclose(): °ú¿ô¤Ï¤Ê¤· */
+    rb_define_method(cDBM, "close", fdbm_close, 0);
+    /* DBM¥¯¥é¥¹¤Î¥á¥½¥Ã¥É[]: °ú¿ô¤Ï1¸Ä */
+    rb_define_method(cDBM, "[]", fdbm_fetch, 1);
+		:
+
+    /* DBM¥Ç¡¼¥¿¤ò³ÊǼ¤¹¤ë¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô̾¤Î¤¿¤á¤ÎID */
+    id_dbm = rb_intern("dbm");
+}
+--
+
+DBM¥â¥¸¥å¡¼¥ë¤Ïdbm¤Î¥Ç¡¼¥¿¤ÈÂбþ¤¹¤ë¥ª¥Ö¥¸¥§¥¯¥È¤Ë¤Ê¤ë¤Ï¤º¤Ç
+¤¹¤«¤é¡¤C¤ÎÀ¤³¦¤Îdbm¤òRuby¤ÎÀ¤³¦¤Ë¼è¤ê¹þ¤àɬÍפ¬¤¢¤ê¤Þ¤¹¡¥
+
+
+dbm.c¤Ç¤ÏData_Make_Struct¤ò°Ê²¼¤Î¤è¤¦¤Ë»È¤Ã¤Æ¤¤¤Þ¤¹¡¥
+
+--
+struct dbmdata {
+    int  di_size;
+    DBM *di_dbm;
+};
+
+
+obj = Data_Make_Struct(class,struct dbmdata,0,free_dbm,dbmp);
+--
+
+¤³¤³¤Ç¤Ïdbmstruct¹½Â¤ÂΤؤΥݥ¤¥ó¥¿¤òData¤Ë¥«¥×¥»¥ë²½¤·¤Æ¤¤
+¤Þ¤¹¡¥DBM*¤òľÀÜ¥«¥×¥»¥ë²½¤·¤Ê¤¤¤Î¤Ïclose()¤·¤¿»þ¤Î½èÍý¤ò¹Í
+¤¨¤Æ¤Î¤³¤È¤Ç¤¹¡¥
+
+Data¥ª¥Ö¥¸¥§¥¯¥È¤«¤édbmstruct¹½Â¤ÂΤΥݥ¤¥ó¥¿¤ò¼è¤ê½Ð¤¹¤¿¤á
+¤Ë°Ê²¼¤Î¥Þ¥¯¥í¤ò»È¤Ã¤Æ¤¤¤Þ¤¹¡¥
+
+--
+#define GetDBM(obj, dbmp) {\
+    Data_Get_Struct(obj, struct dbmdata, dbmp);\
+    if (dbmp->di_dbm == 0) closed_dbm();\
+}
+--
+
+¤Á¤ç¤Ã¤ÈÊ£»¨¤Ê¥Þ¥¯¥í¤Ç¤¹¤¬¡¤Íפ¹¤ë¤Ëdbmdata¹½Â¤ÂΤΥݥ¤¥ó¥¿
+¤Î¼è¤ê½Ð¤·¤È¡¤close¤µ¤ì¤Æ¤¤¤ë¤«¤É¤¦¤«¤Î¥Á¥§¥Ã¥¯¤ò¤Þ¤È¤á¤Æ¤¤
+¤ë¤À¤±¤Ç¤¹¡¥
+
+DBM¥¯¥é¥¹¤Ë¤Ï¤¿¤¯¤µ¤ó¥á¥½¥Ã¥É¤¬¤¢¤ê¤Þ¤¹¤¬¡¤Ê¬Îह¤ë¤È3¼ïÎà¤Î
+°ú¿ô¤Î¼õ¤±Êý¤¬¤¢¤ê¤Þ¤¹¡¥¤Ò¤È¤Ä¤Ï°ú¿ô¤Î¿ô¤¬¸ÇÄê¤Î¤â¤Î¤Ç¡¤Îã¤È
+¤·¤Æ¤Ïdelete¥á¥½¥Ã¥É¤¬¤¢¤ê¤Þ¤¹¡¥delete¥á¥½¥Ã¥É¤ò¼ÂÁõ¤·¤Æ¤¤¤ë
+fdbm_delete()¤Ï¤³¤Î¤è¤¦¤Ë¤Ê¤Ã¤Æ¤¤¤Þ¤¹¡¥
+
+--
+static VALUE
+fdbm_delete(obj, keystr)
+    VALUE obj, keystr;
+{
+	:
+}
+--
+
+°ú¿ô¤Î¿ô¤¬¸ÇÄê¤Î¥¿¥¤¥×¤ÏÂè1°ú¿ô¤¬self¡¤Âè2°ú¿ô°Ê¹ß¤¬¥á¥½¥Ã¥É
+¤Î°ú¿ô¤È¤Ê¤ê¤Þ¤¹¡¥
+
+°ú¿ô¤Î¿ô¤¬ÉÔÄê¤Î¤â¤Î¤ÏC¤ÎÇÛÎó¤Ç¼õ¤±¤ë¤â¤Î¤ÈRuby¤ÎÇÛÎó¤Ç¼õ¤±
+¤ë¤â¤Î¤È¤¬¤¢¤ê¤Þ¤¹¡¥dbm¥â¥¸¥å¡¼¥ë¤ÎÃæ¤Ç¡¤C¤ÎÇÛÎó¤Ç¼õ¤±¤ë¤â¤Î
+¤ÏDBM¤Î¥¯¥é¥¹¥á¥½¥Ã¥É¤Ç¤¢¤ëopen()¤Ç¤¹¡¥¤³¤ì¤ò¼ÂÁõ¤·¤Æ¤¤¤ë´Ø
+¿ôfdbm_s_open()¤Ï¤³¤¦¤Ê¤Ã¤Æ¤¤¤Þ¤¹¡¥
+
+--
+static VALUE
+fdbm_s_open(argc, argv, class)
+    int argc;
+    VALUE *argv;
+    VALUE class;
+{
+	:
+    if (rb_scan_args(argc, argv, "11", &file, &vmode) == 1) {
+	mode = 0666;		/* default value */
+    }
+	:
+}
+--
+
+¤³¤Î¥¿¥¤¥×¤Î´Ø¿ô¤ÏÂè1°ú¿ô¤¬Í¿¤¨¤é¤ì¤¿°ú¿ô¤Î¿ô¡¤Âè2°ú¿ô¤¬Í¿¤¨
+¤é¤ì¤¿°ú¿ô¤ÎÆþ¤Ã¤Æ¤¤¤ëÇÛÎó¤Ë¤Ê¤ê¤Þ¤¹¡¥self¤ÏÂè3°ú¿ô¤È¤·¤ÆÍ¿
+¤¨¤é¤ì¤Þ¤¹¡¥
+
+¤³¤ÎÇÛÎó¤ÇÍ¿¤¨¤é¤ì¤¿°ú¿ô¤ò²òÀϤ¹¤ë¤¿¤á¤Î´Ø¿ô¤¬open()¤Ç¤â»È¤ï
+¤ì¤Æ¤¤¤ërb_scan_args()¤Ç¤¹¡¥Âè3°ú¿ô¤Ë»ØÄꤷ¤¿¥Õ¥©¡¼¥Þ¥Ã¥È¤Ë
+½¾¤¤¡¤Âè4ÊÑ¿ô°Ê¹ß¤Ë»ØÄꤷ¤¿ÊÑ¿ô¤ËÃͤòÂåÆþ¤·¤Æ¤¯¤ì¤Þ¤¹¡¥¤³¤Î
+¥Õ¥©¡¼¥Þ¥Ã¥È¤Ï¡¤Âè1ʸ»úÌܤ¬¾Êά¤Ç¤­¤Ê¤¤°ú¿ô¤Î¿ô¡¤Âè2ʸ»úÌܤ¬
+¾Êά¤Ç¤­¤ë°ú¿ô¤Î¿ô¡¤Âè3ʸ»úÌܤ¬Âбþ¤¹¤ëÁê¼ê¤¬Ìµ¤¤¤¢¤Þ¤ê¤Î°ú
+¿ô¤¬¤¢¤ë¤«¤É¤¦¤«¤ò¼¨¤¹"*"¤Ç¤¹¡¥2ʸ»úÌܤÈ3ʸ»úÌܤϾÊά¤Ç¤­¤Þ
+¤¹¡¥dbm.c¤ÎÎã¤Ç¤Ï¡¤¥Õ¥©¡¼¥Þ¥Ã¥È¤Ï"11"¤Ç¤¹¤«¤é¡¤°ú¿ô¤ÏºÇÄã1¤Ä
+¤Ç¡¤2¤Ä¤Þ¤Çµö¤µ¤ì¤ë¤È¤¤¤¦°ÕÌ£¤Ë¤Ê¤ê¤Þ¤¹¡¥¾Êά¤µ¤ì¤Æ¤¤¤ë»þ¤Î
+ÊÑ¿ô¤ÎÃͤÏnil(C¸À¸ì¤Î¥ì¥Ù¥ë¤Ç¤ÏQnil)¤Ë¤Ê¤ê¤Þ¤¹¡¥
+
+Ruby¤ÎÇÛÎó¤Ç°ú¿ô¤ò¼õ¤±¼è¤ë¤â¤Î¤Ïindexes¤¬¤¢¤ê¤Þ¤¹¡¥¼ÂÁõ¤Ï¤³
+¤¦¤Ç¤¹¡¥
+
+--
+static VALUE
+fdbm_indexes(obj, args)
+    VALUE obj;
+    struct RArray *args;
+{
+	:
+}
+--
+
+Âè1°ú¿ô¤Ïself¡¤Âè2°ú¿ô¤ÏRuby¤ÎÇÛÎó¤Ç¤¹¡¥¤³¤³¤Ç¤Ï¥­¥ã¥¹¥È¤ò¸º
+¤é¤¹¤¿¤á struct RArray* ¤Ç¼õ¤±¤Æ¤¤¤Þ¤¹¤¬¡¤VALUE¤Ç¤âƱ¤¸¤³¤È
+¤Ç¤¹¡¥
+
+** Ãí°Õ»ö¹à
+
+Ruby¤È¶¦Í­¤Ï¤·¤Ê¤¤¤¬Ruby¤Î¥ª¥Ö¥¸¥§¥¯¥È¤ò³ÊǼ¤¹¤ë²ÄǽÀ­¤Î¤¢¤ë
+C¤ÎÂç°èÊÑ¿ô¤Ï°Ê²¼¤Î´Ø¿ô¤ò»È¤Ã¤ÆRuby¥¤¥ó¥¿¥×¥ê¥¿¤ËÊÑ¿ô¤Î¸ºß
+¤ò¶µ¤¨¤Æ¤¢¤²¤Æ¤¯¤À¤µ¤¤¡¥¤Ç¤Ê¤¤¤ÈGC¤Ç¥È¥é¥Ö¥ë¤òµ¯¤³¤·¤Þ¤¹¡¥
+
+  void rb_global_variable(VALUE *var)
+
+(5) extconf.rb¤òÍÑ°Õ¤¹¤ë
+
+Makefile¤òºî¤ë¾ì¹ç¤Î¿÷·¿¤Ë¤Ê¤ëextconf.rb¤È¤¤¤¦¥Õ¥¡¥¤¥ë¤òºî¤ê
+¤Þ¤¹¡¥extconf.rb¤Ï¥â¥¸¥å¡¼¥ë¤Î¥³¥ó¥Ñ¥¤¥ë¤ËɬÍפʾò·ï¤Î¥Á¥§¥Ã
+¥¯¤Ê¤É¤ò¹Ô¤¦¤³¤È¤¬ÌÜŪ¤Ç¤¹¡¥extconf.rb¤ÎÃæ¤Ç¤Ï°Ê²¼¤ÎRuby´Ø¿ô
+¤ò»È¤¦¤³¤È¤¬½ÐÍè¤Þ¤¹¡¥
+
+  have_library(lib, func): ¥é¥¤¥Ö¥é¥ê¤Î¸ºß¥Á¥§¥Ã¥¯
+  have_func(func): ´Ø¿ô¤Î¸ºß¥Á¥§¥Ã¥¯
+  have_header(header): ¥Ø¥Ã¥À¥Õ¥¡¥¤¥ë¤Î¸ºß¥Á¥§¥Ã¥¯
+  create_makefile(target): Makefile¤ÎÀ¸À®
+
+°Ê²¼¤ÎÊÑ¿ô¤ò»È¤¦¤³¤È¤¬¤Ç¤­¤Þ¤¹¡¥
+
+  $CFLAGS: ¥³¥ó¥Ñ¥¤¥ë»þ¤ËÄɲÃŪ¤Ë»ØÄꤹ¤ë¥Õ¥é¥°(-I¤Ê¤É)
+  $LDFLAGS: ¥ê¥ó¥¯»þ¤ËÄɲÃŪ¤Ë»ØÄꤹ¤ë¥Õ¥é¥°(-L¤Ê¤É)
+
+¥â¥¸¥å¡¼¥ë¤ò¥³¥ó¥Ñ¥¤¥ë¤¹¤ë¾ò·ï¤¬Â·¤ï¤Ê¤º¡¤¤½¤Î¥â¥¸¥å¡¼¥ë¤Ï¥³
+¥ó¥Ñ¥¤¥ë¤·¤Ê¤¤»þ¤Ë¤Ïcreate_makefile¤ò¸Æ¤Ð¤Ê¤±¤ì¤ÐMakefile¤Ï
+À¸À®¤µ¤ì¤º¡¤¥³¥ó¥Ñ¥¤¥ë¤â¹Ô¤ï¤ì¤Þ¤»¤ó¡¥
+
+¥â¥¸¥å¡¼¥ë¤¬Ruby 1.1ÀìÍѤǤ¢¤ë¾ì¹ç¤Ë¤Ï 
+
+  require 'mkmf'
+
+¤òextconf.rb¤ÎÀèƬ¤ËÃÖ¤¯¤ÈÊØÍø¤Ç¤·¤ç¤¦¡¥
+
+(6) depend¤òÍÑ°Õ¤¹¤ë
+
+¤â¤·¡¤¥Ç¥£¥ì¥¯¥È¥ê¤Ëdepend¤È¤¤¤¦¥Õ¥¡¥¤¥ë¤¬Â¸ºß¤¹¤ì¤Ð¡¤
+Makefile¤¬°Í¸´Ø·¸¤ò¥Á¥§¥Ã¥¯¤·¤Æ¤¯¤ì¤Þ¤¹¡¥
+
+ % gcc -MM *.c > depend
+
+¤Ê¤É¤Çºî¤ë¤³¤È¤¬½ÐÍè¤Þ¤¹¡¥¤¢¤Ã¤Æ»¤Ï̵¤¤¤Ç¤·¤ç¤¦¡¥
+
+(7) MANIFEST¥Õ¥¡¥¤¥ë¤Ë¥Õ¥¡¥¤¥ë̾¤òÆþ¤ì¤ë
+
+  % ls > MANIFEST
+  % vi MANIFEST
+
+*.o, *~¤Ê¤ÉÉÔɬÍפʥե¡¥¤¥ë°Ê³°¤ÏMANIFEST¤ËÄɲ䷤Ƥª¤­¤Þ¤¹¡¥
+make»þ¤Ë¤ÏMANIFEST¤ÎÆâÍƤϻ²¾È¤·¤Þ¤»¤ó¤Î¤Ç¡¤¶õ¤Î¤Þ¤Þ¤Ç¤âÌäÂê
+¤Ïµ¯¤­¤Þ¤»¤ó¤¬¡¤¥Ñ¥Ã¥±¡¼¥¸¥ó¥°¤Î»þ¤Ë»²¾È¤¹¤ë¤³¤È¤¬¤¢¤ë¤Î¤È¡¤
+ɬÍפʥե¡¥¤¥ë¤ò¶èÊ̤Ǥ­¤ë¤Î¤Ç¡¤ÍÑ°Õ¤·¤Æ¤ª¤¤¤¿Êý¤¬Îɤ¤¤Ç¤·¤ç
+¤¦¡¥
+
+(8) Makefile¤òÀ¸À®¤¹¤ë
+
+Makefile¤ò¼ÂºÝ¤ËÀ¸À®¤¹¤ë¤¿¤á¤Ë¤Ï
+
+  ruby extconf.rb
+
+¤È¤·¤Þ¤¹¡¥extconf.rb¤Ë require 'mkmf' ¤Î¹Ô¤¬¤Ê¤¤¾ì¹ç¤Ë¤Ï¥¨¥é¡¼
+¤Ë¤Ê¤ê¤Þ¤¹¤Î¤Ç¡¤°ú¿ô¤òÄɲä·¤Æ
+
+  ruby -r mkmf extconf.rb
+
+¤È¤·¤Æ¤¯¤À¤µ¤¤¡¥
+
+¥Ç¥£¥ì¥¯¥È¥ê¤òext°Ê²¼¤ËÍÑ°Õ¤·¤¿¾ì¹ç¤Ë¤ÏRubyÁ´ÂΤÎmake¤Î»þ¤Ë
+¼«Æ°Åª¤ËMakefile¤¬À¸À®¤µ¤ì¤Þ¤¹¤Î¤Ç¡¤¤³¤Î¥¹¥Æ¥Ã¥×¤ÏÉÔÍפǤ¹¡¥
+
+(9) make¤¹¤ë
+
+ưŪ¥ê¥ó¥¯¥é¥¤¥Ö¥é¥ê¤òÀ¸À®¤¹¤ë¾ì¹ç¤Ë¤Ï¤½¤Î¾ì¤Çmake¤·¤Æ¤¯¤À¤µ
+¤¤¡¥É¬ÍפǤ¢¤ì¤Ð make install ¤Ç¥¤¥ó¥¹¥È¡¼¥ë¤µ¤ì¤Þ¤¹¡¥
+
+ext°Ê²¼¤Ë¥Ç¥£¥ì¥¯¥È¥ê¤òÍÑ°Õ¤·¤¿¾ì¹ç¤Ï¡¤Ruby¤Î¥Ç¥£¥ì¥¯¥È¥ê¤Ç
+make¤ò¼Â¹Ô¤¹¤ë¤ÈMakefile¤òÀ¸À®¤«¤émake¡¤É¬Íפˤè¤Ã¤Æ¤Ï¤½¤Î¥â
+¥¸¥å¡¼¥ë¤ÎRuby¤Ø¤Î¥ê¥ó¥¯¤Þ¤Ç¼«Æ°Åª¤Ë¼Â¹Ô¤·¤Æ¤¯¤ì¤Þ¤¹¡¥
+extconf.rb¤ò½ñ¤­´¹¤¨¤ë¤Ê¤É¤·¤ÆMakefile¤ÎºÆÀ¸À®¤¬É¬Íפʻþ¤Ï¤Þ
+¤¿Ruby¥Ç¥£¥ì¥¯¥È¥ê¤Çmake¤·¤Æ¤¯¤À¤µ¤¤¡¥
+
+ưŪ¥ê¥ó¥¯¥é¥¤¥Ö¥é¥ê¤Ïmake install¤ÇRuby¥é¥¤¥Ö¥é¥ê¤Î¥Ç¥£¥ì¥¯
+¥È¥ê¤Î²¼¤Ë¥³¥Ô¡¼¤µ¤ì¤Þ¤¹¡¥¤â¤·¥â¥¸¥å¡¼¥ë¤È¶¨Ä´¤·¤Æ»È¤¦Ruby¤Ç
+µ­½Ò¤µ¤ì¤¿¥×¥í¥°¥é¥à¤¬¤¢¤ê¡¤Ruby¥é¥¤¥Ö¥é¥ê¤ËÃÖ¤­¤¿¤¤¾ì¹ç¤Ë¤Ï¡¤
+³ÈÄ¥¥â¥¸¥å¡¼¥ëÍѤΥǥ£¥ì¥¯¥È¥ê¤Î²¼¤Ë lib ¤È¤¤¤¦¥Ç¥£¥ì¥¯¥È¥ê
+¤òºî¤ê¡¤¤½¤³¤Ë ³ÈÄ¥»Ò .rb ¤Î¥Õ¥¡¥¤¥ë¤òÃÖ¤¤¤Æ¤ª¤±¤ÐƱ»þ¤Ë¥¤¥ó
+¥¹¥È¡¼¥ë¤µ¤ì¤Þ¤¹¡¥
+
+(10) ¥Ç¥Ð¥Ã¥°
+
+¤Þ¤¢¡¤¥Ç¥Ð¥Ã¥°¤·¤Ê¤¤¤ÈÆ°¤«¤Ê¤¤¤Ç¤·¤ç¤¦¤Í¡¥ext/Setup¤Ë¥Ç¥£¥ì
+¥¯¥È¥ê̾¤ò½ñ¤¯¤ÈÀÅŪ¤Ë¥ê¥ó¥¯¤¹¤ë¤Î¤Ç¥Ç¥Ð¥Ã¥¬¤¬»È¤¨¤ë¤è¤¦¤Ë¤Ê
+¤ê¤Þ¤¹¡¥¤½¤Îʬ¥³¥ó¥Ñ¥¤¥ë¤¬ÃÙ¤¯¤Ê¤ê¤Þ¤¹¤±¤É¡¥
+
+(11) ¤Ç¤­¤¢¤¬¤ê
+
+¸å¤Ï¤³¤Ã¤½¤ê»È¤¦¤Ê¤ê¡¤¹­¤¯¸ø³«¤¹¤ë¤Ê¤ê¡¤Çä¤ë¤Ê¤ê¡¤¤´¼«Í³¤Ë¤ª
+»È¤¤¤¯¤À¤µ¤¤¡¥Ruby¤Îºî¼Ô¤Ï³ÈÄ¥¥â¥¸¥å¡¼¥ë¤Ë´Ø¤·¤Æ°ìÀڤθ¢Íø¤ò
+¼çÄ¥¤·¤Þ¤»¤ó¡¥
+
+Appendix A. Ruby¤Î¥½¡¼¥¹¥³¡¼¥É¤ÎʬÎà
+
+Ruby¤Î¥½¡¼¥¹¤Ï¤¤¤¯¤Ä¤«¤ËʬÎह¤ë¤³¤È¤¬½ÐÍè¤Þ¤¹¡¥¤³¤Î¤¦¤Á¥¯¥é
+¥¹¥é¥¤¥Ö¥é¥ê¤ÎÉôʬ¤Ï´ðËÜŪ¤Ë³ÈÄ¥¥â¥¸¥å¡¼¥ë¤ÈƱ¤¸ºî¤êÊý¤Ë¤Ê¤Ã
+¤Æ¤¤¤Þ¤¹¡¥¤³¤ì¤é¤Î¥½¡¼¥¹¤Ïº£¤Þ¤Ç¤ÎÀâÌÀ¤Ç¤Û¤È¤ó¤ÉÍý²ò¤Ç¤­¤ë¤È
+»×¤¤¤Þ¤¹¡¥
+
+Ruby¸À¸ì¤Î¥³¥¢
+
+  class.c
+  error.c
+  eval.c
+  gc.c
+  object.c
+  parse.y
+  variable.c
+
+¥æ¡¼¥Æ¥£¥ê¥Æ¥£´Ø¿ô
+
+  dln.c
+  fnmatch.c
+  glob.c
+  regex.c
+  st.c
+  util.c
+
+Ruby¥³¥Þ¥ó¥É¤Î¼ÂÁõ
+
+  dmyext.c
+  inits.c
+  main.c
+  ruby.c
+  version.c
+
+¥¯¥é¥¹¥é¥¤¥Ö¥é¥ê
+
+  array.c
+  bignum.c
+  compar.c
+  dir.c
+  enum.c
+  file.c
+  hash.c
+  io.c
+  marshal.c
+  math.c
+  numeric.c
+  pack.c
+  process.c
+  random.c
+  range.c
+  re.c
+  signal.c
+  sprintf.c
+  string.c
+  struct.c
+  time.c
+
+Appendix B. ³ÈÄ¥ÍÑ´Ø¿ô¥ê¥Õ¥¡¥ì¥ó¥¹
+
+C¸À¸ì¤«¤éRuby¤Îµ¡Ç½¤òÍøÍѤ¹¤ëAPI¤Ï°Ê²¼¤ÎÄ̤ê¤Ç¤¢¤ë¡¥
+
+** ·¿
+
+ VALUE
+
+Ruby¥ª¥Ö¥¸¥§¥¯¥È¤òɽ¸½¤¹¤ë·¿¡¥É¬Íפ˱þ¤¸¤Æ¥­¥ã¥¹¥È¤·¤ÆÍѤ¤¤ë¡¥
+ÁȤ߹þ¤ß·¿¤òɽ¸½¤¹¤ëC¤Î·¿¤Ïruby.h¤Ëµ­½Ò¤·¤Æ¤¢¤ëR¤Ç»Ï¤Þ¤ë¹½Â¤
+ÂΤǤ¢¤ë¡¥VALUE·¿¤ò¤³¤ì¤é¤Ë¥­¥ã¥¹¥È¤¹¤ë¤¿¤á¤ËR¤Ç»Ï¤Þ¤ë¹½Â¤ÂÎ
+̾¤òÁ´¤ÆÂçʸ»ú¤Ë¤·¤¿Ì¾Á°¤Î¥Þ¥¯¥í¤¬ÍÑ°Õ¤µ¤ì¤Æ¤¤¤ë¡¥
+
+** ÊÑ¿ô¡¦Äê¿ô
+
+ Qnil
+
+Äê¿ô: nil¥ª¥Ö¥¸¥§¥¯¥È
+
+ TRUE
+
+Äê¿ô: true¥ª¥Ö¥¸¥§¥¯¥È(¿¿¤Î¥Ç¥Õ¥©¥ë¥ÈÃÍ)
+
+ FALSE
+
+Äê¿ô: false¥ª¥Ö¥¸¥§¥¯¥È
+
+** C¥Ç¡¼¥¿¤Î¥«¥×¥»¥ë²½
+
+ Data_Wrap_Struct(VALUE class, void (*mark)(), void (*free)(), void *sval)
+
+C¤ÎǤ°Õ¤Î¥Ý¥¤¥ó¥¿¤ò¥«¥×¥»¥ë²½¤·¤¿Ruby¥ª¥Ö¥¸¥§¥¯¥È¤òÊÖ¤¹¡¥¤³
+¤Î¥Ý¥¤¥ó¥¿¤¬Ruby¤«¤é¥¢¥¯¥»¥¹¤µ¤ì¤Ê¤¯¤Ê¤Ã¤¿»þ¡¤free¤Ç»ØÄꤷ¤¿
+´Ø¿ô¤¬¸Æ¤Ð¤ì¤ë¡¥¤Þ¤¿¡¤¤³¤Î¥Ý¥¤¥ó¥¿¤Î»Ø¤¹¥Ç¡¼¥¿¤¬Â¾¤ÎRuby¥ª¥Ö
+¥¸¥§¥¯¥È¤ò»Ø¤·¤Æ¤¤¤ë¾ì¹ç¡¤mark¤Ë»ØÄꤹ¤ë´Ø¿ô¤Ç¥Þ¡¼¥¯¤¹¤ëɬÍ×
+¤¬¤¢¤ë¡¥
+
+ Data_Make_Struct(class, type, mark, free, sval)
+
+type·¿¤Î¥á¥â¥ê¤òmalloc¤·¡¤ÊÑ¿ôsval¤ËÂåÆþ¤·¤¿¸å¡¤¤½¤ì¤ò¥«¥×¥»
+¥ë²½¤·¤¿¥Ç¡¼¥¿¤òÊÖ¤¹¥Þ¥¯¥í¡¥
+
+ Data_Get_Struct(data, type, sval)
+
+data¤«¤étype·¿¤Î¥Ý¥¤¥ó¥¿¤ò¼è¤ê½Ð¤·ÊÑ¿ôsval¤ËÂåÆþ¤¹¤ë¥Þ¥¯¥í¡¥
+
+** ·¿¥Á¥§¥Ã¥¯
+
+ TYPE(value)
+ FIXNUM_P(value)
+ NIL_P(value)
+ void Check_Type(VALUE value, int type)
+ void Check_SafeStr(VALUE value)
+
+** ·¿ÊÑ´¹
+
+ FIX2INT(value)
+ INT2FIX(i)
+ NUM2INT(value)
+ INT2NUM(i)
+ NUM2DBL(value)
+ float_new(f)
+ STR2CSTR(value)
+ str_new2(s)
+
+** ¥¯¥é¥¹/¥â¥¸¥å¡¼¥ëÄêµÁ
+
+ VALUE rb_define_class(char *name, VALUE super)
+
+super¤Î¥µ¥Ö¥¯¥é¥¹¤È¤·¤Æ¿·¤·¤¤Ruby¥¯¥é¥¹¤òÄêµÁ¤¹¤ë¡¥
+
+ VALUE rb_define_class_under(VALUE module, char *name, VALUE super)
+
+super¤Î¥µ¥Ö¥¯¥é¥¹¤È¤·¤Æ¿·¤·¤¤Ruby¥¯¥é¥¹¤òÄêµÁ¤·¡¤module¤ÎÄê
+¿ô¤È¤·¤ÆÄêµÁ¤¹¤ë¡¥
+
+ VALUE rb_define_module(char *name)
+
+¿·¤·¤¤Ruby¥â¥¸¥å¡¼¥ë¤òÄêµÁ¤¹¤ë¡¥
+
+ VALUE rb_define_module_under(VALUE module, char *name, VALUE super)
+
+¿·¤·¤¤Ruby¥â¥¸¥å¡¼¥ë¤òÄêµÁ¤·¡¤module¤ÎÄê¿ô¤È¤·¤ÆÄêµÁ¤¹¤ë¡¥
+
+ void rb_include_module(VALUE class, VALUE module)
+
+¥â¥¸¥å¡¼¥ë¤ò¥¤¥ó¥¯¥ë¡¼¥É¤¹¤ë¡¥class¤¬¤¹¤Ç¤Ëmodule¤ò¥¤¥ó¥¯¥ë¡¼
+¥É¤·¤Æ¤¤¤ë»þ¤Ë¤Ï²¿¤â¤·¤Ê¤¤(¿½Å¥¤¥ó¥¯¥ë¡¼¥É¤Î¶Ø»ß)¡¥
+
+ void rb_extend_object(VALUE object, VALUE module)
+
+¥ª¥Ö¥¸¥§¥¯¥È¤ò¥â¥¸¥å¡¼¥ë(¤ÇÄêµÁ¤µ¤ì¤Æ¤¤¤ë¥á¥½¥Ã¥É)¤Ç³ÈÄ¥¤¹¤ë¡¥
+
+** Âç°èÊÑ¿ôÄêµÁ
+
+ void rb_define_variable(char *name, VALUE *var)
+
+Ruby¤ÈC¤È¤Ç¶¦Í­¤¹¤ë¥°¥í¡¼¥Ð¥ëÊÑ¿ô¤òÄêµÁ¤¹¤ë¡¥ÊÑ¿ô̾¤¬`$'¤Ç»Ï
+¤Þ¤é¤Ê¤¤»þ¤Ë¤Ï¼«Æ°Åª¤ËÄɲ䵤ì¤ë¡¥name¤È¤·¤ÆRuby¤Î¼±Ê̻ҤȤ·
+¤Æµö¤µ¤ì¤Ê¤¤Ê¸»ú(Î㤨¤Ð` ')¤ò´Þ¤à¾ì¹ç¤Ë¤ÏRuby¥×¥í¥°¥é¥à¤«¤é
+¤Ï¸«¤¨¤Ê¤¯¤Ê¤ë¡¥
+
+ void rb_define_readonly_variable(char *name, VALUE *var)
+
+Ruby¤ÈC¤È¤Ç¶¦Í­¤¹¤ëread only¤Î¥°¥í¡¼¥Ð¥ëÊÑ¿ô¤òÄêµÁ¤¹¤ë¡¥read
+only¤Ç¤¢¤ë¤³¤È°Ê³°¤Ïrb_define_variable()¤ÈƱ¤¸¡¥
+
+ void rb_define_virtual_variable(char *name,
+				VALUE (*getter)(), VALUE (*setter)())
+
+´Ø¿ô¤Ë¤è¤Ã¤Æ¼Â¸½¤µ¤ì¤ëRubyÊÑ¿ô¤òÄêµÁ¤¹¤ë¡¥ÊÑ¿ô¤¬»²¾È¤µ¤ì¤¿»þ
+¤Ë¤Ïgetter¤¬¡¤ÊÑ¿ô¤ËÃͤ¬¥»¥Ã¥È¤µ¤ì¤¿»þ¤Ë¤Ïsetter¤¬¸Æ¤Ð¤ì¤ë¡¥
+
+ void rb_define_hooked_variable(char *name, VALUE *var,
+				VALUE (*getter)(), VALUE (*setter)())
+
+´Ø¿ô¤Ë¤è¤Ã¤Æhook¤Î¤Ä¤±¤é¤ì¤¿¥°¥í¡¼¥Ð¥ëÊÑ¿ô¤òÄêµÁ¤¹¤ë¡¥ÊÑ¿ô¤¬
+»²¾È¤µ¤ì¤¿»þ¤Ë¤Ïgetter¤¬¡¤´Ø¿ô¤ËÃͤ¬¥»¥Ã¥È¤µ¤ì¤¿»þ¤Ë¤Ïsetter
+¤¬¸Æ¤Ð¤ì¤ë¡¥getter¤äsetter¤Ë0¤ò»ØÄꤷ¤¿»þ¤Ë¤Ïhook¤ò»ØÄꤷ¤Ê
+¤¤¤Î¤ÈƱ¤¸»ö¤Ë¤Ê¤ë¡¥
+
+ void rb_global_variable(VALUE *var)
+
+GC¤Î¤¿¤á¡¤Ruby¥×¥í¥°¥é¥à¤«¤é¤Ï¥¢¥¯¥»¥¹¤µ¤ì¤Ê¤¤¤¬, Ruby¥ª¥Ö¥¸¥§
+¥¯¥È¤ò´Þ¤àÂç°èÊÑ¿ô¤ò¥Þ¡¼¥¯¤¹¤ë¡¥
+
+** ¥¯¥é¥¹Äê¿ô
+
+ void rb_define_const(VALUE class, char *name, VALUE val)
+
+¥¯¥é¥¹Äê¿ô¤òÄêµÁ¤¹¤ë¡¥
+
+ void rb_define_global_const(char *name, VALUE val)
+
+Âç°èÄê¿ô¤òÄêµÁ¤¹¤ë¡¥
+
+     rb_define_const(cKernal, name, val)
+
+¤ÈƱ¤¸°ÕÌ£¡¥
+
+** ¥á¥½¥Ã¥ÉÄêµÁ
+
+ rb_define_method(VALUE class, char *name, VALUE (*func)(), int argc)
+
+¥á¥½¥Ã¥É¤òÄêµÁ¤¹¤ë¡¥argc¤Ïself¤ò½ü¤¯°ú¿ô¤Î¿ô¡¥argc¤¬-1¤Î»þ, 
+´Ø¿ô¤Ë¤Ï°ú¿ô¤Î¿ô(self¤ò´Þ¤Þ¤Ê¤¤)¤òÂè1°ú¿ô, °ú¿ô¤ÎÇÛÎó¤òÂè2°ú
+¿ô¤È¤¹¤ë·Á¼°¤ÇÍ¿¤¨¤é¤ì¤ë(Âè3°ú¿ô¤Ïself)¡¥argc¤¬-2¤Î»þ, Âè1°ú
+¿ô¤¬self, Âè2°ú¿ô¤¬args(args¤Ï°ú¿ô¤ò´Þ¤àRuby¤ÎÇÛÎó)¤È¤¤¤¦·Á
+¼°¤ÇÍ¿¤¨¤é¤ì¤ë¡¥
+
+ rb_define_private_method(VALUE class, char *name, VALUE (*func)(), int argc)
+
+private¥á¥½¥Ã¥É¤òÄêµÁ¤¹¤ë¡¥°ú¿ô¤Ïrb_define_method()¤ÈƱ¤¸¡¥
+
+ rb_define_singleton_method(VALUE class, char *name, VALUE (*func)(), int argc)
+
+Æðۥ᥽¥Ã¥É¤òÄêµÁ¤¹¤ë¡¥°ú¿ô¤Ïrb_define_method()¤ÈƱ¤¸¡¥
+
+ rb_scan_args(int atgc, VALUE *argv, char *fmt, ...)
+
+argc,argv·Á¼°¤ÇÍ¿¤¨¤é¤ì¤¿°ú¿ô¤òʬ²ò¤¹¤ë¡¥fmt¤Ïɬ¿Ü°ú¿ô¤Î¿ô, 
+Éղðú¿ô¤Î¿ô, »Ä¤ê¤Î°ú¿ô¤¬¤¢¤ë¤«¤ò»ØÄꤹ¤ëʸ»úÎó¤Ç, "¿ô»ú¿ô
+»ú*"¤È¤¤¤¦·Á¼°¤Ç¤¢¤ë¡¥ 2 ÈÖÌܤοô»ú¤È"*"¤Ï¤½¤ì¤¾¤ì¾Êά²Äǽ¤Ç
+¤¢¤ë¡¥É¬¿Ü°ú¿ô¤¬°ì¤Ä¤â¤Ê¤¤¾ì¹ç¤Ï0¤ò»ØÄꤹ¤ë¡¥Âè3°ú¿ô°Ê¹ß¤ÏÊÑ
+¿ô¤Ø¤Î¥Ý¥¤¥ó¥¿¤Ç, ³ºÅö¤¹¤ëÍ×ÁǤ¬¤½¤ÎÊÑ¿ô¤Ë³ÊǼ¤µ¤ì¤ë¡¥Éղðú
+¿ô¤ËÂбþ¤¹¤ë°ú¿ô¤¬Í¿¤¨¤é¤ì¤Æ¤¤¤Ê¤¤¾ì¹ç¤ÏÊÑ¿ô¤ËQnil¤¬ÂåÆþ¤µ¤ì
+¤ë¡¥
+
+** Ruby¥á¥½¥Ã¥É¸Æ¤Ó½Ð¤·
+
+ VALUE rb_funcall(VALUE recv, ID mid, int narg, ...)
+
+¥á¥½¥Ã¥É¸Æ¤Ó½Ð¤·¡¥Ê¸»úÎ󤫤émid¤òÆÀ¤ë¤¿¤á¤Ë¤Ïrb_intern()¤ò»È¤¦¡¥
+
+ VALUE rb_funcall2(VALUE recv, ID mid, int argc, VALUE *argv)
+
+¥á¥½¥Ã¥É¸Æ¤Ó½Ð¤·¡¥°ú¿ô¤òargc,argv·Á¼°¤ÇÅϤ¹¡¥
+
+ VALUE rb_eval_string(char *str)
+
+ʸ»úÎó¤òRuby¤È¥¹¥¯¥ê¥×¥È¤·¤Æ¥³¥ó¥Ñ¥¤¥ë¡¦¼Â¹Ô¤¹¤ë¡¥
+
+ ID rb_intern(char *name)
+
+ʸ»úÎó¤ËÂбþ¤¹¤ëID¤òÊÖ¤¹¡¥
+
+ char *rb_id2name(ID id)
+
+ID¤ËÂбþ¤¹¤ëʸ»úÎó¤òÊÖ¤¹(¥Ç¥Ð¥Ã¥°ÍÑ)¡¥
+
+ char *rb_class2name(VALUE class)
+
+class¤Î̾Á°¤òÊÖ¤¹(¥Ç¥Ð¥Ã¥°ÍÑ)¡¥class¤¬Ì¾Á°¤ò»ý¤¿¤Ê¤¤»þ¤Ë¤Ï, 
+ÁÄÀè¤òÁ̤äÆ̾Á°¤ò»ý¤Ä¥¯¥é¥¹¤Î̾Á°¤òÊÖ¤¹¡¥
+
+** ¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô
+
+ VALUE rb_iv_get(VALUE obj, char *name)
+
+obj¤Î¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô¤ÎÃͤòÆÀ¤ë¡¥`@'¤Ç»Ï¤Þ¤é¤Ê¤¤¥¤¥ó¥¹¥¿¥ó¥¹
+ÊÑ¿ô¤Ï Ruby¥×¥í¥°¥é¥à¤«¤é¥¢¥¯¥»¥¹¤Ç¤­¤Ê¤¤¡Ö±£¤ì¤¿¡×¥¤¥ó¥¹¥¿
+¥ó¥¹ÊÑ¿ô¤Ë¤Ê¤ë¡¥Äê¿ô¤ÏÂçʸ»ú¤Î̾Á°¤ò»ý¤Ä¥¯¥é¥¹(¤Þ¤¿¤Ï¥â¥¸¥å¡¼
+¥ë)¤Î¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô¤È¤·¤Æ¼ÂÁõ¤µ¤ì¤Æ¤¤¤ë¡¥
+
+ VALUE rb_iv_set(VALUE obj, char *name, VALUE val)
+
+obj¤Î¥¤¥ó¥¹¥¿¥ó¥¹ÊÑ¿ô¤òval¤Ë¥»¥Ã¥È¤¹¤ë¡¥
+
+** À©¸æ¹½Â¤
+
+ VALUE rb_iterate(VALUE (*func1)(), void *arg1, VALUE (*func2)(), void *arg2)
+
+func2¤ò¥Ö¥í¥Ã¥¯¤È¤·¤ÆÀßÄꤷ, func1¤ò¥¤¥Æ¥ì¡¼¥¿¤È¤·¤Æ¸Æ¤Ö¡¥ 
+func1¤Ë¤Ï arg1¤¬°ú¿ô¤È¤·¤ÆÅϤµ¤ì, func2¤Ë¤ÏÂè1°ú¿ô¤Ë¥¤¥Æ¥ì¡¼
+¥¿¤«¤éÍ¿¤¨¤é¤ì¤¿ÃÍ, Âè2°ú¿ô¤Ëarg2¤¬ÅϤµ¤ì¤ë¡¥
+ 
+ VALUE rb_yield(VALUE val)
+
+val¤òÃͤȤ·¤Æ¥¤¥Æ¥ì¡¼¥¿¥Ö¥í¥Ã¥¯¤ò¸Æ¤Ó½Ð¤¹¡¥
+
+ VALUE rb_rescue(VALUE (*func1)(), void *arg1, VALUE (*func2)(), void *arg2)
+
+´Ø¿ôfunc1¤òarg1¤ò°ú¿ô¤Ë¸Æ¤Ó½Ð¤¹¡¥func1¤Î¼Â¹ÔÃæ¤ËÎã³°¤¬È¯À¸¤·
+¤¿»þ¤Ë¤Ï func2¤òarg2¤ò°ú¿ô¤È¤·¤Æ¸Æ¤Ö¡¥Ìá¤êÃͤÏÎã³°¤¬È¯À¸¤·¤Ê
+¤«¤Ã¤¿»þ¤Ïfunc1¤ÎÌá¤êÃÍ, Îã³°¤¬È¯À¸¤·¤¿»þ¤Ë¤Ïfunc2¤ÎÌá¤êÃͤÇ
+¤¢¤ë¡¥
+
+ VALUE rb_ensure(VALUE (*func1)(), void *arg1, void (*func2)(), void *arg2)
+
+´Ø¿ôfunc1¤òarg1¤ò°ú¿ô¤È¤·¤Æ¼Â¹Ô¤·, ¼Â¹Ô½ªÎ»¸å(¤¿¤È¤¨Îã³°¤¬È¯
+À¸¤·¤Æ¤â) func2¤òarg2¤ò°ú¿ô¤È¤·¤Æ¼Â¹Ô¤¹¤ë¡¥Ìá¤êÃͤÏfunc1¤ÎÌá
+¤êÃͤǤ¢¤ë(Îã³°¤¬È¯À¸¤·¤¿»þ¤ÏÌá¤é¤Ê¤¤)¡¥
+
+** Îã³°¡¦¥¨¥é¡¼
+
+ void Warning(char *fmt, ...)
+
+verbose»þ¤Ëɸ½à¥¨¥é¡¼½ÐÎϤ˷ٹð¾ðÊó¤òɽ¼¨¤¹¤ë¡¥°ú¿ô¤Ïprintf()¤ÈƱ¤¸¡¥
+
+ void Fail(char *fmt, ...)
+
+RuntimeErrorÎã³°¤òȯÀ¸¤µ¤»¤ë¡¥°ú¿ô¤Ïprintf()¤ÈƱ¤¸¡¥
+
+ void Raise(VALUE exception, char *fmt, ...)
+
+exception¤Ç»ØÄꤷ¤¿Îã³°¤òȯÀ¸¤µ¤»¤ë¡¥fmt°Ê²¼¤Î°ú¿ô¤Ïprintf()¤ÈƱ¤¸¡¥
+
+ void Fatal(char *fmt, ...)
+
+Ã×̿ŪÎã³°¤òȯÀ¸¤µ¤»¤ë¡¥Ä̾ï¤ÎÎã³°½èÍý¤Ï¹Ô¤Ê¤ï¤ì¤º, ¥¤¥ó¥¿¡¼
+¥×¥ê¥¿¤¬½ªÎ»¤¹¤ë(¤¿¤À¤·ensure¤Ç»ØÄꤵ¤ì¤¿¥³¡¼¥É¤Ï½ªÎ»Á°¤Ë¼Â
+¹Ô¤µ¤ì¤ë)¡¥
+
+ void Bug(char *fmt, ...)
+
+¥¤¥ó¥¿¡¼¥×¥ê¥¿¤Ê¤É¥×¥í¥°¥é¥à¤Î¥Ð¥°¤Ç¤·¤«È¯À¸¤¹¤ë¤Ï¤º¤Î¤Ê¤¤¾õ
+¶·¤Î»þ¸Æ¤Ö¡¥¥¤¥ó¥¿¡¼¥×¥ê¥¿¤Ï¥³¥¢¥À¥ó¥×¤·Ä¾¤Á¤Ë½ªÎ»¤¹¤ë¡¥Îã³°
+½èÍý¤Ï°ìÀڹԤʤï¤ì¤Ê¤¤¡¥
+
+** Ruby¤Î½é´ü²½¡¦¼Â¹Ô
+
+Ruby¤ò¥¢¥×¥ê¥±¡¼¥·¥ç¥ó¤ËËä¤á¹þ¤à¾ì¹ç¤Ë¤Ï°Ê²¼¤Î¥¤¥ó¥¿¥Õ¥§¡¼¥¹
+¤ò»È¤¦¡¥Ä̾ï¤Î³ÈÄ¥¥â¥¸¥å¡¼¥ë¤Ë¤ÏɬÍפʤ¤¡¥
+
+ void ruby_init(int argc, char **argv, char **envp)
+
+Ruby¥¤¥ó¥¿¥×¥ê¥¿¤Î½é´ü²½¤ò¹Ô¤Ê¤¦¡¥
+
+ void ruby_run()
+
+Ruby¥¤¥ó¥¿¥×¥ê¥¿¤ò¼Â¹Ô¤¹¤ë¡¥
+
+ void ruby_script(char *name)
+
+Ruby¤Î¥¹¥¯¥ê¥×¥È̾($0)¤òÀßÄꤹ¤ë¡¥
+
+
+Appendix B. extconf.rb¤Ç»È¤¨¤ë´Ø¿ô¤¿¤Á
+
+extconf.rb¤ÎÃæ¤Ç¤ÏÍøÍѲÄǽ¤Ê¥³¥ó¥Ñ¥¤¥ë¾ò·ï¥Á¥§¥Ã¥¯¤Î´Ø¿ô¤Ï°Ê
+²¼¤ÎÄ̤ê¤Ç¤¢¤ë¡¥
+
+ have_library(lib, func)
+
+´Ø¿ôfunc¤òÄêµÁ¤·¤Æ¤¤¤ë¥é¥¤¥Ö¥é¥êlib¤Î¸ºß¤ò¥Á¥§¥Ã¥¯¤¹¤ë¡¥¥é
+¥¤¥Ö¥é¥ê¤¬Â¸ºß¤¹¤ë»þ¡¤TRUE¤òÊÖ¤¹¡¥
+
+ have_func(func)
+
+´Ø¿ôfunc¤Î¸ºß¤ò¥Á¥§¥Ã¥¯¤¹¤ë¡¥func¤¬É¸½à¤Ç¤Ï¥ê¥ó¥¯¤µ¤ì¤Ê¤¤¥é
+¥¤¥Ö¥é¥êÆâ¤Î¤â¤Î¤Ç¤¢¤ë»þ¤Ë¤ÏÀè¤Ëhave_library¤Ç¤½¤Î¥é¥¤¥Ö¥é¥ê
+¤ò¥Á¥§¥Ã¥¯¤·¤Æ¤ª¤¯»ö¡¥´Ø¿ô¤¬Â¸ºß¤¹¤ë»þTRUE¤òÊÖ¤¹¡¥
+
+ have_header(header)
+
+¥Ø¥Ã¥À¥Õ¥¡¥¤¥ë¤Î¸ºß¤ò¥Á¥§¥Ã¥¯¤¹¤ë¡¥¥Ø¥Ã¥À¥Õ¥¡¥¤¥ë¤¬Â¸ºß¤¹¤ë
+»þTRUE¤òÊÖ¤¹¡¥
+
+ create_makefile(target)
+
+³ÈÄ¥¥â¥¸¥å¡¼¥ëÍѤÎMakefile¤òÀ¸À®¤¹¤ë¡¥¤³¤Î´Ø¿ô¤ò¸Æ¤Ð¤Ê¤±¤ì¤Ð
+¤½¤Î¥â¥¸¥å¡¼¥ë¤Ï¥³¥ó¥Ñ¥¤¥ë¤µ¤ì¤Ê¤¤¡¥target¤Ï¥â¥¸¥å¡¼¥ë̾¤òɽ
+¤¹¡¥
+
+/*
+ * Local variables:
+ * fill-column: 60
+ * end:
+ */
diff --git a/README.ja.md b/README.ja.md
deleted file mode 100644
index eee54a9171..0000000000
--- a/README.ja.md
+++ /dev/null
@@ -1,171 +0,0 @@
-# Ruby��
-
-Ruby�シンプル��強力�オブジェクト指�スクリプト言語��． Ruby�純粋�オブジェクト指�言語���設計�れ��る��，
-オブジェクト指�プログラミングを手軽�行�事�出���．も��ん普通�手続�型�プログラミングも�能��．
-
-Ruby�テキスト処�関係�能力���優れ，Perl����ら�強力��．�ら�シンプル�文法�，
-例外処�やイテレータ���機構�よ��，より分�りや��プログラミング�出���．
-
-## Ruby�特長
-
-*   シンプル�文法
-*   普通�オブジェクト指�機能(クラス，メソッドコール��)
-*   特殊�オブジェクト指�機能(Mixin, 特異メソッド��)
-*   演算�オー�ーロード
-*   例外処�機能
-*   イテレータ�クロージャ
-*   ガーベージコレクタ
-*   ダイナミックローディング (アーキテク�ャ�よる)
-*   移�性�高�．多��Unix-like/POSIX互�プラットフォーム上�動������，Windows， Mac OS
-    X，BeOS���上�も動� cf.
-    http://bugs.ruby-lang.org/projects/ruby-trunk/wiki/SupportedPlatformsJa
-
-
-## 入手法
-
-### FTP�
-
-以下�場所�����り��．
-
-ftp://ftp.ruby-lang.org/pub/ruby/
-
-### Subversion�
-
-開発先端�ソースコード�次�コマンド��得����．
-
-    $ svn co http://svn.ruby-lang.org/repos/ruby/trunk/ ruby
-
-他�開発中�ブラン��一覧�次�コマンド�見られ��．
-
-    $ svn ls http://svn.ruby-lang.org/repos/ruby/branches/
-
-### Git�
-
-Subversion�ミラーをGitHub�公開�����． 以下�コマンド�リ�ジトリを�得����．
-
-    $ git clone git://github.com/ruby/ruby.git
-
-## ホームページ
-
-Ruby�ホームページ�URL�
-
-http://www.ruby-lang.org/
-
-��．
-
-## メーリングリスト
-
-Ruby�メーリングリスト��り��．�加希望�方�
-
-mailto:ruby-list-request@ruby-lang.org
-
-��本文�
-
-    subscribe
-
-�書�����下��．
-
-Ruby開発者��メーリングリストも�り��．��ら��ruby��グ，将��仕様拡張��実装上��題����議論�れ����． �加希望�方�
-
-mailto:ruby-dev-request@ruby-lang.org
-
-��ruby-list��様�方法�メール������．
-
-Ruby拡張モジュール����話���ruby-extメーリングリスト�数学関係�話題����話���ruby-mathメーリングリスト�
-英語�ruby����話���ruby-talkメーリングリストも�り��．�加方法��れも����．
-
-## コンパイル・インストール
-
-以下�手順�行������．
-
-1.  も� `configure` ファイル�見��ら��，も��� `configure.in` より��よ��ら， `autoconf` を実行��
-    新�� `configure` を生��る
-
-2.  `configure` を実行�� `Makefile` ��を生��る
-
-    環境�よ���デフォルト�Cコンパイラ用オプション�付���． `configure` オプション� `optflags=..`
-    `warnflags=..` 等�上書�����．
-
-3.  (必��ら�)`defines.h` を編集�る
-
-    多分，必�無������．
-
-4.  (必��ら�)`ext/Setup` ��的�リンク�る拡張モジュールを指定�る
-
-    `ext/Setup` �記述��モジュール��的�リンク�れ��．
-
-    ダイナミックローディングをサ�ート�����アーキテク�ャ�� `Setup` �1行目�「`option nodynamic`����行�コ
-    メントを外�必���り��．��，��アーキテク�ャ�拡張モジュールを利用�る����，�ら����的�リンクを����必���り��．
-
-5.  `make` を実行��コンパイル�る
-
-6.  `make check`�テストを行�．
-
-    「`check succeeded`��表示�れれ��功��．���テスト��功��も完璧���証�れ��る訳���り��ん．
-
-7.  `make install`
-
-    以下�ディレクトリを作��，���ファイルをインストー ル���．
-
-    *   `${DESTDIR}${prefix}/bin`
-    *   `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}`
-    *   `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
-    *   `${DESTDIR}${prefix}/lib`
-    *   `${DESTDIR}${prefix}/lib/ruby`
-    *   `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}`
-    *   `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
-    *   `${DESTDIR}${prefix}/lib/ruby/site_ruby`
-    *   `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}`
-    *   `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
-    *   `${DESTDIR}${prefix}/lib/ruby/vendor_ruby`
-    *   `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}`
-    *   `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
-    *   `${DESTDIR}${prefix}/lib/ruby/gems/${MAJOR}.${MINOR}.${TEENY}`
-    *   `${DESTDIR}${prefix}/share/man/man1`
-    *   `${DESTDIR}${prefix}/share/ri/${MAJOR}.${MINOR}.${TEENY}/system`
-
-
-    Ruby�API�ージョン�'*x.y.z*'��れ�，`${MAJOR}`�
-    '*x*'�，`${MINOR}`�'*y*'，`${TEENY}`�'*z*'��．
-
-    **注�**: API�ージョン� `teeny` �，Rubyプログラム��ージョン��異�る����り��．
-
-    `root` �作業�る必���る�も�れ��ん．
-
-
-も�，コンパイル時�エラー�発生��場���エラー�ログ�マシン，OS�種類を�む��る��詳��レ�ートを作者����下�る�他�方����も�り��．
-
-## 移�
-
-UNIX��れ� `configure` ���ん��差異を�����れる�����，���見�������場�(�る事�多�)，作者���
-��を報告�れ�，解決��る�能性��り��．
-
-アーキテク�ャ�も��も�存�る��GC部��．Ruby�GC�対象
-�アーキテク�ャ�`setjmp()`���`getcontext()`�よ��全��レジスタを `jmp_buf` や `ucontext_t`
-�格��る���， `jmp_buf` や `ucontext_t` �スタック�32bitアラインメント�れ��る��を仮定
-�����．特��者��立���場��対応��常�困難��ょ�． 後者�解決�比較的簡��， `gc.c` �スタックをマーク���る
-部分�アラインメント��イト数���ら��マーク�るコードを追加�る���済���．`defined(__mc68000__)`�括られ��
-る部分を�考�������．
-
-レジスタウィンドウを��CPU��，レジスタウィンドウをスタック�フラッシュ�るアセンブラコードを追加�る必���る�も�れ��ん．
-
-## �布�件
-
-`COPYING.ja` ファイルを�照������．
-
-## フィード�ック
-
-Ruby�関�る質�� Ruby-Talk（英語）や Ruby-List（日本語） (https://www.ruby-lang.org/ja/community/mailing-lists) や，
-stackoverflow (http://ja.stackoverflow.com/) ���Webサイト�投稿������．
-
-�グ報告� http://bugs.ruby-lang.org ���付�����．
-
-
-## 著者
-
-Ruby�オリジナル版�，1995年���も�ゆ�����よ��設計・開発�れ���．
-
-<mailto:matz@ruby-lang.org>
-
----
-created at: Thu Aug  3 11:57:36 JST 1995
diff --git a/README.jp b/README.jp
new file mode 100644
index 0000000000..d1937eabaf
--- /dev/null
+++ b/README.jp
@@ -0,0 +1,169 @@
+* Ruby¤È¤Ï
+
+Ruby¤Ï¥·¥ó¥×¥ë¤«¤Ä¶¯ÎϤʥª¥Ö¥¸¥§¥¯¥È»Ø¸þ¥¹¥¯¥ê¥×¥È¸À¸ì¤Ç¤¹¡¥
+Ruby¤ÏºÇ½é¤«¤é½ã¿è¤Ê¥ª¥Ö¥¸¥§¥¯¥È»Ø¸þ¸À¸ì¤È¤·¤ÆÀ߷פµ¤ì¤Æ¤¤¤Þ
+¤¹¤«¤é¡¤¥ª¥Ö¥¸¥§¥¯¥È»Ø¸þ¥×¥í¥°¥é¥ß¥ó¥°¤ò¼ê·Ú¤Ë¹Ô¤¦»ö¤¬½ÐÍè¤Þ
+¤¹¡¥¤â¤Á¤í¤óÄ̾ï¤Î¼ê³¤­·¿¤Î¥×¥í¥°¥é¥ß¥ó¥°¤â²Äǽ¤Ç¤¹¡¥
+
+Ruby¤Ï¥Æ¥­¥¹¥È½èÍý´Ø·¸¤ÎǽÎϤʤɤËÍ¥¤ì¡¤Perl¤ÈƱ¤¸¤¯¤é¤¤¶¯ÎÏ
+¤Ç¤¹¡¥¤µ¤é¤Ë¥·¥ó¥×¥ë¤Êʸˡ¤È¡¤Îã³°½èÍý¤ä¥¤¥Æ¥ì¡¼¥¿¤Ê¤É¤Îµ¡¹½
+¤Ë¤è¤Ã¤Æ¡¤¤è¤êʬ¤«¤ê¤ä¤¹¤¤¥×¥í¥°¥é¥ß¥ó¥°¤¬½ÐÍè¤Þ¤¹¡¥
+
+
+* Ruby¤ÎÆÃĹ¡¥
+
+  + ¥·¥ó¥×¥ë¤Êʸˡ
+  + ÉáÄ̤Υª¥Ö¥¸¥§¥¯¥È»Ø¸þµ¡Ç½(¥¯¥é¥¹¡¤¥á¥½¥Ã¥É¥³¡¼¥ë¤Ê¤É)
+  + Æüì¤Ê¥ª¥Ö¥¸¥§¥¯¥È»Ø¸þµ¡Ç½(Mixin, Æðۥ᥽¥Ã¥É¤Ê¤É)
+  + ±é»»»Ò¥ª¡¼¥Ð¡¼¥í¡¼¥É
+  + Îã³°½èÍýµ¡Ç½
+  + ¥¤¥Æ¥ì¡¼¥¿¤È¥¯¥í¡¼¥¸¥ã
+  + ¥¬¡¼¥Ù¡¼¥¸¥³¥ì¥¯¥¿
+  + ¥À¥¤¥Ê¥ß¥Ã¥¯¥í¡¼¥Ç¥£¥ó¥° (¥¢¡¼¥­¥Æ¥¯¥Á¥ã¤Ë¤è¤ë)
+  + °Ü¿¢À­¤¬¹â¤¤¡¥Â¿¤¯¤ÎUNIX¾å¤ÇÆ°¤¯
+
+
+* Æþ¼êË¡
+
+** ftp¤Ç
+
+°Ê²¼¤Î¾ì½ê¤Ë¤ª¤¤¤Æ¤¢¤ê¤Þ¤¹¡¥
+
+  ftp://ftp.netlab.co.jp/pub/lang/ruby/
+
+
+* ¥Û¡¼¥à¥Ú¡¼¥¸
+
+ Ruby¤Î¥Û¡¼¥à¥Ú¡¼¥¸¤ÎURL¤Ï
+
+   http://www.netlab.co.jp/ruby/jp/
+
+ ¤Ç¤¹¡¥
+
+
+* ¥á¥¤¥ê¥ó¥°¥ê¥¹¥È
+
+ Ruby¤Ë´Ø¤ï¤ëÏÃÂê¤Î¤¿¤á¤Î¥á¥¤¥ê¥ó¥°¥ê¥¹¥È¤ò³«Àߤ·¤Þ¤·¤¿¡¥¥¢
+ ¥É¥ì¥¹¤Ï
+
+   ruby-list@netlab.co.jp
+
+ ¤Ç¤¹¡¥¤³¤Î¥¢¥É¥ì¥¹¤Ë¥á¥¤¥ë¤òÁ÷¤ì¤Ð¡¤¼«Æ°Åª¤ËÅÐÏ¿¤µ¤ì¤Þ¤¹¡¥
+
+
+* ¥³¥ó¥Ñ¥¤¥ë¡¦¥¤¥ó¥¹¥È¡¼¥ë
+
+°Ê²¼¤Î¼ê½ç¤Ç¹Ô¤Ã¤Æ¤¯¤À¤µ¤¤¡¥
+
+  1. configure¤ò¼Â¹Ô¤·¤ÆMakefile¤Ê¤É¤òÀ¸À®¤¹¤ë
+
+  2. (ɬÍפʤé¤Ð)defines.h¤òÊÔ½¸¤¹¤ë
+
+     ¿ʬ¡¤É¬Í×̵¤¤¤È»×¤¤¤Þ¤¹¡¥
+
+  3. (ɬÍפʤé¤Ð)ext/Setup¤ËÀÅŪ¤Ë¥ê¥ó¥¯¤¹¤ë³ÈÄ¥¥â¥¸¥å¡¼¥ë¤ò
+     »ØÄꤹ¤ë
+
+     ext/Setup¤Ëµ­½Ò¤·¤¿¥â¥¸¥å¡¼¥ë¤ÏÀÅŪ¤Ë¥ê¥ó¥¯¤µ¤ì¤Þ¤¹¡¥
+
+     ¥À¥¤¥Ê¥ß¥Ã¥¯¥í¡¼¥Ç¥£¥ó¥°¤ò¥µ¥Ý¡¼¥È¤·¤Æ¤¤¤Ê¤¤¥¢¡¼¥­¥Æ¥¯
+     ¥Á¥ã¤Ç¤ÏSetup¤Î1¹ÔÌܤΡÖoption nodynamic¡×¤È¤¤¤¦¹Ô¤Î¥³
+     ¥á¥ó¥È¤ò³°¤¹É¬Íפ¬¤¢¤ê¤Þ¤¹¡¥¤Þ¤¿¡¤¤³¤Î¥¢¡¼¥­¥Æ¥¯¥Á¥ã¤Ç
+     ³ÈÄ¥¥â¥¸¥å¡¼¥ë¤òÍøÍѤ¹¤ë¤¿¤á¤Ë¤Ï¡¤¤¢¤é¤«¤¸¤áÀÅŪ¤Ë¥ê¥ó
+     ¥¯¤·¤Æ¤ª¤¯É¬Íפ¬¤¢¤ê¤Þ¤¹¡¥
+
+  4. make¤ò¼Â¹Ô¤·¤Æ¥³¥ó¥Ñ¥¤¥ë¤¹¤ë
+
+  5. make test¤Ç¥Æ¥¹¥È¤ò¹Ô¤¦¡¥
+
+     ¡Ötest succeeded¡×¤Èɽ¼¨¤µ¤ì¤ì¤ÐÀ®¸ù¤Ç¤¹¡¥¤¿¤À¤·¥Æ¥¹¥È
+     ¤ËÀ®¸ù¤·¤Æ¤â´°àú¤À¤ÈÊݾڤµ¤ì¤Æ¤¤¤ëÌõ¤Ç¤Ï¤¢¤ê¤Þ¤»¤ó¡¥
+
+  6. make install
+
+¤â¤·¡¤¥³¥ó¥Ñ¥¤¥ë»þ¤Ë¥¨¥é¡¼¤¬È¯À¸¤·¤¿¾ì¹ç¤Ë¤Ï¥¨¥é¡¼¤Î¥í¥°¤È¥Þ
+¥·¥ó¡¤OS¤Î¼ïÎà¤ò´Þ¤à¤Ç¤­¤ë¤À¤±¾Ü¤·¤¤¥ì¥Ý¡¼¥È¤òºî¼Ô¤ËÁ÷¤Ã¤Æ¤¯
+¤À¤µ¤ë¤È¾¤ÎÊý¤Î¤¿¤á¤Ë¤â¤Ê¤ê¤Þ¤¹¡¥
+
+
+* °Ü¿¢
+
+UNIX¤Ç¤¢¤ì¤Ðconfigure¤¬¤Û¤È¤ó¤É¤Îº¹°Û¤òµÛ¼ý¤·¤Æ¤¯¤ì¤ë¤Ï¤º¤Ç
+¤¹¤¬¡¤»×¤ï¤Ì¸«Íî¤È¤·¤¬¤¢¤Ã¤¿¾ì¹ç(¤¢¤ë¤Ë°ã¤¤¤Ê¤¤)¡¤ºî¼Ô¤Ë¤½¤Î
+¤³¤È¤ò¥ì¥Ý¡¼¥È¤¹¤ì¤Ð¡¤²ò·è¤Ç¤­¤ë¤«¤âÃΤì¤Þ¤»¤ó¡¥
+
+¥¢¡¼¥¯¥Æ¥¯¥Á¥ã¤Ë¤â¤Ã¤È¤â°Í¸¤¹¤ë¤Î¤ÏGCÉô¤Ç¤¹¡¥Ruby¤ÎGC¤ÏÂоÝ
+¤Î¥¢¡¼¥­¥Æ¥¯¥Á¥ã¤¬setjmp()¤Ë¤è¤Ã¤ÆÁ´¤Æ¤Î¥ì¥¸¥¹¥¿¤ò jmp_buf¤Ë
+³ÊǼ¤¹¤ë¤³¤È¤È¡¤jmp_buf¤È¥¹¥¿¥Ã¥¯¤¬32bit¥¢¥é¥¤¥ó¥á¥ó¥È¤µ¤ì¤Æ
+¤¤¤ë¤³¤È¤ò²¾Äꤷ¤Æ¤¤¤Þ¤¹¡¥ÆäËÁ°¼Ô¤¬À®Î©¤·¤Ê¤¤¾ì¹ç¤ÎÂбþ¤ÏÈó
+¾ï¤Ëº¤Æñ¤Ç¤·¤ç¤¦¡¥¸å¼Ô¤Î²ò·è¤ÏÈæ³ÓŪ´Êñ¤Ç¡¤gc.c¤Ç¥¹¥¿¥Ã¥¯¤ò
+¥Þ¡¼¥¯¤·¤Æ¤¤¤ëÉôʬ¤Ë¥¢¥é¥¤¥ó¥á¥ó¥È¤Î¥Ð¥¤¥È¿ô¤À¤±¤º¤é¤·¤Æ¥Þ¡¼
+¥¯¤¹¤ë¥³¡¼¥É¤òÄɲ乤ë¤À¤±¤ÇºÑ¤ß¤Þ¤¹¡¥¡Ödefined(THINK_C)¡×¤Ç
+³ç¤é¤ì¤Æ¤¤¤ëÉôʬ¤ò»²¹Í¤Ë¤·¤Æ¤¯¤À¤µ¤¤
+
+# ¼ÂºÝ¤Ë¤ÏRuby¤ÏThink C¤Ç¤Ï¥³¥ó¥Ñ¥¤¥ë¤Ç¤­¤Þ¤»¤ó¡¥
+
+¥ì¥¸¥¹¥¿¥¦¥£¥ó¥É¥¦¤ò»ý¤ÄCPU¤Ç¤Ï¡¤¥ì¥¸¥¹¥¿¥¦¥£¥ó¥É¥¦¤ò¥¹¥¿¥Ã
+¥¯¤Ë¥Õ¥é¥Ã¥·¥å¤¹¤ë¥¢¥»¥ó¥Ö¥é¥³¡¼¥É¤òÄɲ乤ëɬÍפ¬¤¢¤ë¤«¤âÃÎ
+¤ì¤Þ¤»¤ó¡¥
+
+
+* ÇÛÉÛ¾ò·ï
+
+RUby¤Ï¥Õ¥ê¡¼¥½¥Õ¥È¥¦¥§¥¢¤Ç¤¹¡¥GPL(the GNU General Public
+Licence)¤Þ¤¿¤Ï°Ê²¼¤Ë¼¨¤¹¾ò·ï¤ÇRuby¤òºÆÇÛÉۤǤ­¤Þ¤¹¡¥GPL¤Ë¤Ä
+¤¤¤Æ¤ÏCOPYING¥Õ¥¡¥¤¥ë¤ò»²¾È¤·¤Æ²¼¤µ¤¤¡¥
+
+  1. Ê£À½¤ÏÀ©¸Â¤Ê¤¯¼«Í³¤Ç¤¹¡¥
+
+  2. °Ê²¼¤Î¾ò·ï¤Î¤¤¤º¤ì¤«¤òËþ¤¿¤¹»þ¤Ë¼ê¸µ¤ÎRuby¤Î¥½¡¼¥¹¤ò¼«
+     ͳ¤ËÊѹ¹¤Ç¤­¤Þ¤¹¡¥
+
+     (a) ¥Í¥Ã¥È¥Ë¥å¡¼¥º¤Ë¥Ý¥¹¥È¤·¤¿¤ê¡¤ºî¼Ô¤ËÊѹ¹¤òÁ÷ÉÕ¤¹¤ë
+         ¤Ê¤É¤ÎÊýË¡¤Ç¡¤Êѹ¹¤ò¸ø³«¤¹¤ë
+
+     (b) Êѹ¹¤·¤¿Ruby¤ò¼«Ê¬¤Î½ê°¤¹¤ëÁÈ¿¥ÆâÉô¤À¤±¤Ç»È¤¦
+
+     (c) Êѹ¹ÅÀ¤òÌÀ¼¨¤·¤¿¤¦¤¨¡¤¥½¥Õ¥È¥¦¥§¥¢¤Î̾Á°¤òÊѹ¹¤¹¤ë¡¥
+         ¤½¤Î¥½¥Õ¥È¥¦¥§¥¢¤òÇÛÉÛ¤¹¤ë»þ¤Ë¤Ï¤â¤È¤ÎRuby¤âƱ»þ¤Ë
+         ÇÛÉÛ¤¹¤ë
+
+     (d) ¤½¤Î¾¤ÎÊѹ¹¾ò·ï¤òºî¼Ô¤È¹ç°Õ¤¹¤ë
+
+  3. °Ê²¼¤Î¾ò·ï¤Î¤¤¤º¤ì¤«¤òËþ¤¿¤¹»þ¤ËRuby¤ò¥ª¥Ö¥¸¥§¥¯¥È¥³¡¼
+     ¥É¤ä¼Â¹Ô·Á¼°¤Ç¤âÇÛÉۤǤ­¤Þ¤¹¡¥
+
+     (a) ¥Ð¥¤¥Ê¥ê¤ò¼õ¤±¼è¤Ã¤¿¿Í¤¬¥½¡¼¥¹¤òÆþ¼ê¤Ç¤­¤ë¤è¤¦¤Ë¥½¡¼
+	 ¥¹¤ÎÆþ¼êË¡¤òÌÀ¼¨¤¹¤ë
+
+     (b) µ¡³£²ÄÆɤʥ½¡¼¥¹¥³¡¼¥É¤òźÉÕ¤¹¤ë
+
+     (c) Êѹ¹¤ò¹Ô¤Ã¤¿¥Ð¥¤¥Ê¥ê¤Ï̾Á°¤òÊѹ¹¤·¤¿¤¦¤¨¡¤¥½¡¼¥¹¤Î
+         Æþ¼êË¡¤òÌÀ¼¨¤¹¤ë
+
+     (d) ¤½¤Î¾¤ÎÇÛÉÛ¾ò·ï¤òºî¼Ô¤È¹ç°Õ¤¹¤ë
+
+  4. ¾¤Î¥×¥í¥°¥é¥à¤Ø¤Î°úÍѤϤ¤¤«¤Ê¤ëÌÜŪ¤Ç¤¢¤ì¼«Í³¤Ç¤¹¡¥¤¿
+     ¤À¤·¡¤Ruby¤Ë´Þ¤Þ¤ì¤ë¾¤Îºî¼Ô¤Ë¤è¤ë¥³¡¼¥É¤Ï¡¤¤½¤ì¤¾¤ì¤Î
+     ºî¼Ô¤Î°Õ¸þ¤Ë¤è¤ëÀ©¸Â¤¬²Ã¤¨¤é¤ì¤Þ¤¹¡¥¶ñÂÎŪ¤Ë¤Ïgc.c(°ìÉô)¡¤
+     util.c(°ìÉô)¡¤st.[ch]¡¤regex.[ch], fnmatch.[ch], glob.c 
+     ¤ª¤è¤Ó./missing¥Ç¥£¥ì¥¯¥È¥ê²¼¤Î¥Õ¥¡¥¤¥ë·²¤¬³ºÅö¤·¤Þ¤¹¡¥
+
+  5. Ruby¤Ø¤ÎÆþÎϤȤʤ륹¥¯¥ê¥×¥È¤ª¤è¤Ó¡¤Ruby¤«¤é¤Î½ÐÎϤθ¢
+     Íø¤ÏRuby¤Îºî¼Ô¤Ç¤Ï¤Ê¤¯¡¤¤½¤ì¤¾¤ì¤ÎÆþ½ÐÎϤòÀ¸À®¤·¤¿¿Í¤Ë
+     °¤·¤Þ¤¹¡¥¤Þ¤¿¡¤Ruby¤ËÁȤ߹þ¤à¤¿¤á¤Î³ÈÄ¥¥â¥¸¥å¡¼¥ë¤Ë¤Ä
+     ¤¤¤Æ¤âƱÍͤǤ¹¡¥
+
+  6. Ruby¤Ï̵ÊݾڤǤ¹¡¥ºî¼Ô¤ÏRuby¤ò¥µ¥Ý¡¼¥È¤¹¤ë°Õ»Ö¤Ï¤¢¤ê¤Þ
+     ¤¹¤¬¡¤Ruby¼«¿È¤Î¥Ð¥°¤¢¤ë¤¤¤ÏRuby¥¹¥¯¥ê¥×¥È¤Î¥Ð¥°¤Ê¤É¤«
+     ¤éȯÀ¸¤¹¤ë¤¤¤«¤Ê¤ë»³²¤ËÂФ·¤Æ¤âÀÕǤ¤ò»ý¤Á¤Þ¤»¤ó¡¥
+
+
+* Ãø¼Ô
+
+¥³¥á¥ó¥È¡¤¥Ð¥°¥ì¥Ý¡¼¥È¤½¤Î¾¤Ï matz@netlab.co.jp ¤Þ¤Ç¡¥
+-------------------------------------------------------
+created at: Thu Aug  3 11:57:36 JST 1995
+Local variables:
+mode: indented-text
+end:
diff --git a/README.md b/README.md
deleted file mode 100644
index 14fb7aa213..0000000000
--- a/README.md
+++ /dev/null
@@ -1,164 +0,0 @@
-# What's Ruby
-
-Ruby is the interpreted scripting language for quick and easy object-oriented
-programming.  It has many features to process text files and to do system
-management tasks (as in Perl).  It is simple, straight-forward, and
-extensible.
-
-## Features of Ruby
-
-*   Simple Syntax
-*   **Normal** Object-oriented Features (e.g. class, method calls)
-*   **Advanced** Object-oriented Features (e.g. Mix-in, Singleton-method)
-*   Operator Overloading
-*   Exception Handling
-*   Iterators and Closures
-*   Garbage Collection
-*   Dynamic Loading of Object Files (on some architectures)
-*   Highly Portable (works on many Unix-like/POSIX compatible platforms as
-    well as Windows, Mac OS X, BeOS, etc.) cf.
-    http://bugs.ruby-lang.org/projects/ruby-trunk/wiki/SupportedPlatforms
-
-
-## How to get Ruby
-
-For a complete list of ways to install Ruby, including using third-party tools
-like rvm, see:
-
-http://www.ruby-lang.org/en/downloads/
-
-The Ruby distribution files can be found on the following FTP site:
-
-ftp://ftp.ruby-lang.org/pub/ruby/
-
-The trunk of the Ruby source tree can be checked out with the following
-command:
-
-    $ svn co http://svn.ruby-lang.org/repos/ruby/trunk/ ruby
-
-Or if you are using git then use the following command:
-
-    $ git clone git://github.com/ruby/ruby.git
-
-There are some other branches under development.  Try the following command
-to see the list of branches:
-
-    $ svn ls http://svn.ruby-lang.org/repos/ruby/branches/
-
-Or if you are using git then use the following command:
-
-    $ git ls-remote git://github.com/ruby/ruby.git
-
-## Ruby home page
-
-The URL of the Ruby home page is:
-
-http://www.ruby-lang.org/
-
-## Mailing list
-
-There is a mailing list to talk about Ruby. To subscribe this list, please
-send the following phrase:
-
-    subscribe
-
-in the mail body (not subject) to the address
-<mailto:ruby-talk-request@ruby-lang.org>.
-
-## How to compile and install
-
-This is what you need to do to compile and install Ruby:
-
-1.  If you want to use Microsoft Visual C++ to compile ruby, read
-    win32/README.win32 instead of this document.
-
-2.  If `./configure` does not exist or is older than configure.in, run
-    `autoconf` to (re)generate configure.
-
-3.  Run `./configure`, which will generate `config.h` and `Makefile`.
-
-    Some C compiler flags may be added by default depending on your
-    environment.  Specify `optflags=..` and `warnflags=..` as necessary to
-    override them.
-
-4.  Edit `defines.h` if you need. Usually this step will not be needed.
-
-5.  Remove comment mark(`#`) before the module names from `ext/Setup` (or add
-    module names if not present), if you want to link modules statically.
-
-    If you don't want to compile non static extension modules (probably on
-    architectures which do not allow dynamic loading), remove comment mark
-    from the line "`#option nodynamic`" in `ext/Setup`.
-
-    Usually this step will not be needed.
-
-6.  Run `make`.
-
-7.  Optionally, run '`make check`' to check whether the compiled Ruby
-    interpreter works well. If you see the message "`check succeeded`", your
-    ruby works as it should (hopefully).
-
-8.  Run '`make install`'
-
-    This command will create following directories and install files onto
-    them.
-
-    *   `${DESTDIR}${prefix}/bin`
-    *   `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}`
-    *   `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
-    *   `${DESTDIR}${prefix}/lib`
-    *   `${DESTDIR}${prefix}/lib/ruby`
-    *   `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}`
-    *   `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
-    *   `${DESTDIR}${prefix}/lib/ruby/site_ruby`
-    *   `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}`
-    *   `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
-    *   `${DESTDIR}${prefix}/lib/ruby/vendor_ruby`
-    *   `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}`
-    *   `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
-    *   `${DESTDIR}${prefix}/lib/ruby/gems/${MAJOR}.${MINOR}.${TEENY}`
-    *   `${DESTDIR}${prefix}/share/man/man1`
-    *   `${DESTDIR}${prefix}/share/ri/${MAJOR}.${MINOR}.${TEENY}/system`
-
-
-    If Ruby's API version is '*x.y.z*', the `${MAJOR}` is '*x*', the
-    `${MINOR}` is '*y*', and the `${TEENY}` is '*z*'.
-
-    **NOTE**: teeny of the API version may be different from one of Ruby's
-    program version
-
-    You may have to be a super user to install ruby.
-
-
-If you fail to compile ruby, please send the detailed error report with the
-error log and machine/OS type, to help others.
-
-Some extension libraries may not get compiled because of lack of necessary
-external libraries and/or headers, then you will need to run '`make distclean-ext`'
-to remove old configuration after installing them in such case.
-
-## Copying
-
-See the file `COPYING`.
-
-## Feedback
-
-Questions about the Ruby language can be asked on the Ruby-Talk mailing list
-(http://www.ruby-lang.org/en/community/mailing-lists) or on websites like
-(http://stackoverflow.com).
-
-Bug reports should be filed at http://bugs.ruby-lang.org. Read [HowToReport] for more information.
-
-[HowToReport]: https://bugs.ruby-lang.org/projects/ruby/wiki/HowToReport
-
-##Contributing
-
-See the file `CONTRIBUTING.md`
-
-
-## The Author
-
-Ruby was originally designed and developed by Yukihiro Matsumoto (Matz) in
-1995.
-
-<mailto:matz@ruby-lang.org>
diff --git a/ToDo b/ToDo
new file mode 100644
index 0000000000..9710c42302
--- /dev/null
+++ b/ToDo
@@ -0,0 +1,3 @@
+* non-blocking open/write for thread
+* package or access control for global variables
+* format
diff --git a/aclocal.m4 b/aclocal.m4
deleted file mode 100644
index 30fccd52fe..0000000000
--- a/aclocal.m4
+++ /dev/null
@@ -1,46 +0,0 @@
-# -*- autoconf -*-
-
-AC_DEFUN([_COLORIZE_RESULT_PREPARE], [
-    msg_checking= msg_result_yes= msg_result_no= msg_result_other= msg_reset=
-    AS_IF([test "x${CONFIGURE_TTY}" = xyes -o -t 1], [
-	msg_begin="`tput smso 2>/dev/null`"
-    	AS_CASE(["$msg_begin"], ['@<:@'*m],
-	    [msg_begin="`echo "$msg_begin" | sed ['s/[0-9]*m$//']`"
-	    msg_checking="${msg_begin}33m"
-	    AS_IF([test ${TEST_COLORS:+set}], [
-		msg_result_yes=[`expr ":$TEST_COLORS:" : ".*:pass=\([^:]*\):"`]
-		msg_result_no=[`expr ":$TEST_COLORS:" : ".*:fail=\([^:]*\):"`]
-		msg_result_other=[`expr ":$TEST_COLORS:" : ".*:skip=\([^:]*\):"`]
-	    ])
-	    msg_result_yes="${msg_begin}${msg_result_yes:-32;1}m"
-	    msg_result_no="${msg_begin}${msg_result_no:-31;1}m"
-	    msg_result_other="${msg_begin}${msg_result_other:-33;1}m"
-	    msg_reset="${msg_begin}m"
-	    ])
-	AS_UNSET(msg_begin)
-	])
-    AS_REQUIRE_SHELL_FN([colorize_result],
-	[AS_FUNCTION_DESCRIBE([colorize_result], [MSG], [Colorize result])],
-        [AS_CASE(["$[]1"],
-            [yes], [AS_ECHO(["${msg_result_yes}$[]1${msg_reset}]")],
-            [no], [AS_ECHO(["${msg_result_no}$[]1${msg_reset}]")],
-            [AS_ECHO(["${msg_result_other}$[]1${msg_reset}]")])])
-])
-
-AC_DEFUN([COLORIZE_RESULT], [AC_REQUIRE([_COLORIZE_RESULT_PREPARE])dnl
-    AS_LITERAL_IF([$1],
-	[m4_case([$1],
-		[yes], [AS_ECHO(["${msg_result_yes}$1${msg_reset}"])],
-		[no], [AS_ECHO(["${msg_result_no}$1${msg_reset}"])],
-		[AS_ECHO(["${msg_result_other}$1${msg_reset}"])])],
-	[colorize_result "$1"]) dnl
-])
-
-AC_DEFUN([AC_CHECKING],[dnl
-AC_REQUIRE([_COLORIZE_RESULT_PREPARE])dnl
-AS_MESSAGE([checking ${msg_checking}$1${msg_reset}...])])
-
-AC_DEFUN([AC_MSG_RESULT], [dnl
-{ _AS_ECHO_LOG([result: $1])
-COLORIZE_RESULT([$1]); dnl
-}])
diff --git a/addr2line.c b/addr2line.c
deleted file mode 100644
index c8faf48d62..0000000000
--- a/addr2line.c
+++ /dev/null
@@ -1,1208 +0,0 @@
-/**********************************************************************
-
-  addr2line.c -
-
-  $Author$
-
-  Copyright (C) 2010 Shinichiro Hamaji
-
-**********************************************************************/
-
-#include "ruby/config.h"
-#include "ruby/missing.h"
-#include "addr2line.h"
-
-#include <stdio.h>
-#include <errno.h>
-
-#ifdef USE_ELF
-
-#include <fcntl.h>
-#include <limits.h>
-#include <stdio.h>
-#include <stdint.h>
-#include <stdlib.h>
-#include <string.h>
-#include <sys/mman.h>
-#include <sys/types.h>
-#include <sys/stat.h>
-#include <unistd.h>
-
-#ifdef __OpenBSD__
-#include <elf_abi.h>
-#else
-#include <elf.h>
-#endif
-
-/* Make alloca work the best possible way.  */
-#ifdef __GNUC__
-# ifndef atarist
-#  ifndef alloca
-#   define alloca __builtin_alloca
-#  endif
-# endif	/* atarist */
-#else
-# ifdef HAVE_ALLOCA_H
-#  include <alloca.h>
-# else
-#  ifdef _AIX
-#pragma alloca
-#  else
-#   ifndef alloca		/* predefined by HP cc +Olibcalls */
-void *alloca();
-#   endif
-#  endif /* AIX */
-# endif	/* HAVE_ALLOCA_H */
-#endif /* __GNUC__ */
-
-#ifdef HAVE_DLADDR
-# include <dlfcn.h>
-#endif
-
-#define DW_LNS_copy                     0x01
-#define DW_LNS_advance_pc               0x02
-#define DW_LNS_advance_line             0x03
-#define DW_LNS_set_file                 0x04
-#define DW_LNS_set_column               0x05
-#define DW_LNS_negate_stmt              0x06
-#define DW_LNS_set_basic_block          0x07
-#define DW_LNS_const_add_pc             0x08
-#define DW_LNS_fixed_advance_pc         0x09
-#define DW_LNS_set_prologue_end         0x0a /* DWARF3 */
-#define DW_LNS_set_epilogue_begin       0x0b /* DWARF3 */
-#define DW_LNS_set_isa                  0x0c /* DWARF3 */
-
-/* Line number extended opcode name. */
-#define DW_LNE_end_sequence             0x01
-#define DW_LNE_set_address              0x02
-#define DW_LNE_define_file              0x03
-#define DW_LNE_set_discriminator        0x04  /* DWARF4 */
-
-#ifndef ElfW
-# if SIZEOF_VOIDP == 8
-#  define ElfW(x) Elf64##_##x
-# else
-#  define ElfW(x) Elf32##_##x
-# endif
-#endif
-#ifndef ELF_ST_TYPE
-# if SIZEOF_VOIDP == 8
-#  define ELF_ST_TYPE ELF64_ST_TYPE
-# else
-#  define ELF_ST_TYPE ELF32_ST_TYPE
-# endif
-#endif
-#ifndef PATH_MAX
-#define PATH_MAX 4096
-#endif
-
-int kprintf(const char *fmt, ...);
-
-typedef struct {
-    const char *dirname;
-    const char *filename;
-    const char *path; /* object path */
-    int line;
-
-    uintptr_t base_addr;
-    uintptr_t saddr;
-    const char *sname; /* function name */
-} line_info_t;
-typedef struct obj_info obj_info_t;
-struct obj_info {
-    const char *path; /* object path */
-    int fd;
-    void *mapped;
-    size_t mapped_size;
-    uintptr_t base_addr;
-    obj_info_t *next;
-};
-
-/* Avoid consuming stack as this module may be used from signal handler */
-static char binary_filename[PATH_MAX];
-
-static unsigned long
-uleb128(char **p)
-{
-    unsigned long r = 0;
-    int s = 0;
-    for (;;) {
-	unsigned char b = *(unsigned char *)(*p)++;
-	if (b < 0x80) {
-	    r += (unsigned long)b << s;
-	    break;
-	}
-	r += (b & 0x7f) << s;
-	s += 7;
-    }
-    return r;
-}
-
-static long
-sleb128(char **p)
-{
-    long r = 0;
-    int s = 0;
-    for (;;) {
-	unsigned char b = *(unsigned char *)(*p)++;
-	if (b < 0x80) {
-	    if (b & 0x40) {
-		r -= (0x80 - b) << s;
-	    }
-	    else {
-		r += (b & 0x3f) << s;
-	    }
-	    break;
-	}
-	r += (b & 0x7f) << s;
-	s += 7;
-    }
-    return r;
-}
-
-static const char *
-get_nth_dirname(unsigned long dir, char *p)
-{
-    if (!dir--) {
-	return "";
-    }
-    while (dir--) {
-	while (*p) p++;
-	p++;
-	if (!*p) {
-	    kprintf("Unexpected directory number %lu in %s\n",
-		    dir, binary_filename);
-	    return "";
-	}
-    }
-    return p;
-}
-
-static void
-fill_filename(int file, char *include_directories, char *filenames,
-	      line_info_t *line)
-{
-    int i;
-    char *p = filenames;
-    char *filename;
-    unsigned long dir;
-    for (i = 1; i <= file; i++) {
-	filename = p;
-	if (!*p) {
-	    /* Need to output binary file name? */
-	    kprintf("Unexpected file number %d in %s\n",
-		    file, binary_filename);
-	    return;
-	}
-	while (*p) p++;
-	p++;
-	dir = uleb128(&p);
-	/* last modified. */
-	uleb128(&p);
-	/* size of the file. */
-	uleb128(&p);
-
-	if (i == file) {
-	    line->filename = filename;
-	    line->dirname = get_nth_dirname(dir, include_directories);
-	}
-    }
-}
-
-static void
-fill_line(int num_traces, void **traces, uintptr_t addr, int file, int line,
-	  char *include_directories, char *filenames,
-	  obj_info_t *obj, line_info_t *lines, int offset)
-{
-    int i;
-    addr += obj->base_addr;
-    for (i = offset; i < num_traces; i++) {
-	uintptr_t a = (uintptr_t)traces[i];
-	/* We assume one line code doesn't result >100 bytes of native code.
-       We may want more reliable way eventually... */
-	if (addr < a && a < addr + 100) {
-	    fill_filename(file, include_directories, filenames, &lines[i]);
-	    lines[i].line = line;
-	}
-    }
-}
-
-static void
-parse_debug_line_cu(int num_traces, void **traces, char **debug_line,
-		obj_info_t *obj, line_info_t *lines, int offset)
-{
-    char *p, *cu_end, *cu_start, *include_directories, *filenames;
-    unsigned long unit_length;
-    int default_is_stmt, line_base;
-    unsigned int header_length, minimum_instruction_length, line_range,
-		 opcode_base;
-    /* unsigned char *standard_opcode_lengths; */
-
-    /* The registers. */
-    unsigned long addr = 0;
-    unsigned int file = 1;
-    unsigned int line = 1;
-    /* unsigned int column = 0; */
-    int is_stmt;
-    /* int basic_block = 0; */
-    /* int end_sequence = 0; */
-    /* int prologue_end = 0; */
-    /* int epilogue_begin = 0; */
-    /* unsigned int isa = 0; */
-
-    p = *debug_line;
-
-    unit_length = *(unsigned int *)p;
-    p += sizeof(unsigned int);
-    if (unit_length == 0xffffffff) {
-	unit_length = *(unsigned long *)p;
-	p += sizeof(unsigned long);
-    }
-
-    cu_end = p + unit_length;
-
-    /*dwarf_version = *(unsigned short *)p;*/
-    p += 2;
-
-    header_length = *(unsigned int *)p;
-    p += sizeof(unsigned int);
-
-    cu_start = p + header_length;
-
-    minimum_instruction_length = *(unsigned char *)p;
-    p++;
-
-    is_stmt = default_is_stmt = *(unsigned char *)p;
-    p++;
-
-    line_base = *(signed char *)p;
-    p++;
-
-    line_range = *(unsigned char *)p;
-    p++;
-
-    opcode_base = *(unsigned char *)p;
-    p++;
-
-    /* standard_opcode_lengths = (unsigned char *)p - 1; */
-    p += opcode_base - 1;
-
-    include_directories = p;
-
-    /* skip include directories */
-    while (*p) {
-	while (*p) p++;
-	p++;
-    }
-    p++;
-
-    filenames = p;
-
-    p = cu_start;
-
-#define FILL_LINE()						    \
-    do {							    \
-	fill_line(num_traces, traces, addr, file, line,		    \
-		  include_directories, filenames,		    \
-		  obj, lines, offset);				    \
-	/*basic_block = prologue_end = epilogue_begin = 0;*/	    \
-    } while (0)
-
-    while (p < cu_end) {
-	unsigned long a;
-	unsigned char op = *p++;
-	switch (op) {
-	case DW_LNS_copy:
-	    FILL_LINE();
-	    break;
-	case DW_LNS_advance_pc:
-	    a = uleb128(&p);
-	    addr += a;
-	    break;
-	case DW_LNS_advance_line: {
-	    long a = sleb128(&p);
-	    line += a;
-	    break;
-	}
-	case DW_LNS_set_file:
-	    file = (unsigned int)uleb128(&p);
-	    break;
-	case DW_LNS_set_column:
-	    /*column = (unsigned int)*/(void)uleb128(&p);
-	    break;
-	case DW_LNS_negate_stmt:
-	    is_stmt = !is_stmt;
-	    break;
-	case DW_LNS_set_basic_block:
-	    /*basic_block = 1; */
-	    break;
-	case DW_LNS_const_add_pc:
-	    a = ((255 - opcode_base) / line_range) *
-		minimum_instruction_length;
-	    addr += a;
-	    break;
-	case DW_LNS_fixed_advance_pc:
-	    a = *(unsigned char *)p++;
-	    addr += a;
-	    break;
-	case DW_LNS_set_prologue_end:
-	    /* prologue_end = 1; */
-	    break;
-	case DW_LNS_set_epilogue_begin:
-	    /* epilogue_begin = 1; */
-	    break;
-	case DW_LNS_set_isa:
-	    /* isa = (unsigned int)*/(void)uleb128(&p);
-	    break;
-	case 0:
-	    a = *(unsigned char *)p++;
-	    op = *p++;
-	    switch (op) {
-	    case DW_LNE_end_sequence:
-		/* end_sequence = 1; */
-		FILL_LINE();
-		addr = 0;
-		file = 1;
-		line = 1;
-		/* column = 0; */
-		is_stmt = default_is_stmt;
-		/* end_sequence = 0; */
-		/* isa = 0; */
-		break;
-	    case DW_LNE_set_address:
-		addr = *(unsigned long *)p;
-		p += sizeof(unsigned long);
-		break;
-	    case DW_LNE_define_file:
-		kprintf("Unsupported operation in %s\n",
-			binary_filename);
-		break;
-	    case DW_LNE_set_discriminator:
-		/* TODO:currently ignore */
-		uleb128(&p);
-		break;
-	    default:
-		kprintf("Unknown extended opcode: %d in %s\n",
-			op, binary_filename);
-	    }
-	    break;
-	default: {
-	    unsigned long addr_incr;
-	    unsigned long line_incr;
-	    a = op - opcode_base;
-	    addr_incr = (a / line_range) * minimum_instruction_length;
-	    line_incr = line_base + (a % line_range);
-	    addr += (unsigned int)addr_incr;
-	    line += (unsigned int)line_incr;
-	    FILL_LINE();
-	}
-	}
-    }
-    *debug_line = p;
-}
-
-static void
-parse_debug_line(int num_traces, void **traces,
-		 char *debug_line, unsigned long size,
-		 obj_info_t *obj, line_info_t *lines, int offset)
-{
-    char *debug_line_end = debug_line + size;
-    while (debug_line < debug_line_end) {
-	parse_debug_line_cu(num_traces, traces, &debug_line, obj, lines, offset);
-    }
-    if (debug_line != debug_line_end) {
-	kprintf("Unexpected size of .debug_line in %s\n",
-		binary_filename);
-    }
-}
-
-/* read file and fill lines */
-static uintptr_t
-fill_lines(int num_traces, void **traces, int check_debuglink,
-	   obj_info_t **objp, line_info_t *lines, int offset);
-
-static void
-append_obj(obj_info_t **objp) {
-    obj_info_t *newobj = calloc(1, sizeof(obj_info_t));
-    if (*objp) (*objp)->next = newobj;
-    *objp = newobj;
-}
-
-static void
-follow_debuglink(char *debuglink, int num_traces, void **traces,
-		 obj_info_t **objp, line_info_t *lines, int offset)
-{
-    /* Ideally we should check 4 paths to follow gnu_debuglink,
-       but we handle only one case for now as this format is used
-       by some linux distributions. See GDB's info for detail. */
-    static const char global_debug_dir[] = "/usr/lib/debug";
-    char *p, *subdir;
-    obj_info_t *o1 = *objp, *o2;
-
-    p = strrchr(binary_filename, '/');
-    if (!p) {
-	return;
-    }
-    p[1] = '\0';
-
-    subdir = (char *)alloca(strlen(binary_filename) + 1);
-    strcpy(subdir, binary_filename);
-    strcpy(binary_filename, global_debug_dir);
-    strlcat(binary_filename, subdir, PATH_MAX);
-    strlcat(binary_filename, debuglink, PATH_MAX);
-
-    append_obj(objp);
-    o2 = *objp;
-    o2->base_addr = o1->base_addr;
-    o2->path = o1->path;
-    fill_lines(num_traces, traces, 0, objp, lines, offset);
-}
-
-/* read file and fill lines */
-static uintptr_t
-fill_lines(int num_traces, void **traces, int check_debuglink,
-	   obj_info_t **objp, line_info_t *lines, int offset)
-{
-    int i, j;
-    char *shstr;
-    char *section_name;
-    ElfW(Ehdr) *ehdr;
-    ElfW(Shdr) *shdr, *shstr_shdr;
-    ElfW(Shdr) *debug_line_shdr = NULL, *gnu_debuglink_shdr = NULL;
-    int fd;
-    off_t filesize;
-    char *file;
-    ElfW(Shdr) *symtab_shdr = NULL, *strtab_shdr = NULL;
-    ElfW(Shdr) *dynsym_shdr = NULL, *dynstr_shdr = NULL;
-    obj_info_t *obj = *objp;
-    uintptr_t dladdr_fbase = 0;
-
-    fd = open(binary_filename, O_RDONLY);
-    if (fd < 0) {
-	goto fail;
-    }
-    filesize = lseek(fd, 0, SEEK_END);
-    if (filesize < 0) {
-	int e = errno;
-	close(fd);
-	kprintf("lseek: %s\n", strerror(e));
-	goto fail;
-    }
-#if SIZEOF_OFF_T > SIZEOF_SIZE_T
-    if (filesize > (off_t)SIZE_MAX) {
-	close(fd);
-	kprintf("Too large file %s\n", binary_filename);
-	goto fail;
-    }
-#endif
-    lseek(fd, 0, SEEK_SET);
-    /* async-signal unsafe */
-    file = (char *)mmap(NULL, (size_t)filesize, PROT_READ, MAP_SHARED, fd, 0);
-    if (file == MAP_FAILED) {
-	int e = errno;
-	close(fd);
-	kprintf("mmap: %s\n", strerror(e));
-	goto fail;
-    }
-
-    ehdr = (ElfW(Ehdr) *)file;
-    if (memcmp(ehdr->e_ident, "\177ELF", 4) != 0) {
-	/*
-	 * Huh? Maybe filename was overridden by setproctitle() and
-	 * it match non-elf file.
-	 */
-	close(fd);
-	goto fail;
-    }
-
-    obj->fd = fd;
-    obj->mapped = file;
-    obj->mapped_size = (size_t)filesize;
-
-    shdr = (ElfW(Shdr) *)(file + ehdr->e_shoff);
-
-    shstr_shdr = shdr + ehdr->e_shstrndx;
-    shstr = file + shstr_shdr->sh_offset;
-
-    for (i = 0; i < ehdr->e_shnum; i++) {
-	section_name = shstr + shdr[i].sh_name;
-	switch (shdr[i].sh_type) {
-	  case SHT_STRTAB:
-	    if (!strcmp(section_name, ".strtab")) {
-		strtab_shdr = shdr + i;
-	    }
-	    else if (!strcmp(section_name, ".dynstr")) {
-		dynstr_shdr = shdr + i;
-	    }
-	    break;
-	  case SHT_SYMTAB:
-	    /* if (!strcmp(section_name, ".symtab")) */
-	    symtab_shdr = shdr + i;
-	    break;
-	  case SHT_DYNSYM:
-	    /* if (!strcmp(section_name, ".dynsym")) */
-	    dynsym_shdr = shdr + i;
-	    break;
-	  case SHT_PROGBITS:
-	    if (!strcmp(section_name, ".debug_line")) {
-		debug_line_shdr = shdr + i;
-	    }
-	    else if (!strcmp(section_name, ".gnu_debuglink")) {
-		gnu_debuglink_shdr = shdr + i;
-	    }
-	    break;
-	}
-    }
-
-    if (offset == -1) {
-	/* main executable */
-	offset = 0;
-	if (dynsym_shdr && dynstr_shdr) {
-	    char *strtab = file + dynstr_shdr->sh_offset;
-	    ElfW(Sym) *symtab = (ElfW(Sym) *)(file + dynsym_shdr->sh_offset);
-	    int symtab_count = (int)(dynsym_shdr->sh_size / sizeof(ElfW(Sym)));
-	    for (j = 0; j < symtab_count; j++) {
-		ElfW(Sym) *sym = &symtab[j];
-		Dl_info info;
-		void *h, *s;
-		if (ELF_ST_TYPE(sym->st_info) != STT_FUNC || sym->st_size <= 0) continue;
-		h = dlopen(NULL, RTLD_NOW|RTLD_LOCAL);
-		if (!h) continue;
-		s = dlsym(h, strtab + sym->st_name);
-		if (!s) continue;
-		if (dladdr(s, &info)) {
-		    dladdr_fbase = (uintptr_t)info.dli_fbase;
-		    break;
-		}
-	    }
-	    if (ehdr->e_type == ET_EXEC) {
-		obj->base_addr = 0;
-	    }
-	    else {
-		/* PIE (position-independent executable) */
-		obj->base_addr = dladdr_fbase;
-	    }
-	}
-    }
-
-    if (!symtab_shdr) {
-	symtab_shdr = dynsym_shdr;
-	strtab_shdr = dynstr_shdr;
-    }
-
-    if (symtab_shdr && strtab_shdr) {
-	char *strtab = file + strtab_shdr->sh_offset;
-	ElfW(Sym) *symtab = (ElfW(Sym) *)(file + symtab_shdr->sh_offset);
-	int symtab_count = (int)(symtab_shdr->sh_size / sizeof(ElfW(Sym)));
-	for (j = 0; j < symtab_count; j++) {
-	    ElfW(Sym) *sym = &symtab[j];
-	    uintptr_t saddr = (uintptr_t)sym->st_value + obj->base_addr;
-	    if (ELF_ST_TYPE(sym->st_info) != STT_FUNC || sym->st_size <= 0) continue;
-	    for (i = offset; i < num_traces; i++) {
-		uintptr_t d = (uintptr_t)traces[i] - saddr;
-		if (lines[i].line > 0 || d <= 0 || d > (uintptr_t)sym->st_size)
-		    continue;
-		/* fill symbol name and addr from .symtab */
-		lines[i].sname = strtab + sym->st_name;
-		lines[i].saddr = saddr;
-		lines[i].path  = obj->path;
-		lines[i].base_addr = obj->base_addr;
-	    }
-	}
-    }
-
-    if (!debug_line_shdr) {
-	/* This file doesn't have .debug_line section,
-	   let's check .gnu_debuglink section instead. */
-	if (gnu_debuglink_shdr && check_debuglink) {
-	    follow_debuglink(file + gnu_debuglink_shdr->sh_offset,
-			     num_traces, traces,
-			     objp, lines, offset);
-	}
-	goto finish;
-    }
-
-    parse_debug_line(num_traces, traces,
-		     file + debug_line_shdr->sh_offset,
-		     debug_line_shdr->sh_size,
-		     obj, lines, offset);
-finish:
-    return dladdr_fbase;
-fail:
-    return (uintptr_t)-1;
-}
-
-#define HAVE_MAIN_EXE_PATH
-#if defined(__FreeBSD__)
-# include <sys/sysctl.h>
-#endif
-/* ssize_t main_exe_path(void)
- *
- * store the path of the main executable to `binary_filename`,
- * and returns strlen(binary_filename).
- * it is NUL terminated.
- */
-#if defined(__linux__)
-ssize_t
-main_exe_path(void)
-{
-# define PROC_SELF_EXE "/proc/self/exe"
-    ssize_t len = readlink(PROC_SELF_EXE, binary_filename, PATH_MAX);
-    binary_filename[len] = 0;
-    return len;
-}
-#elif defined(__FreeBSD__)
-ssize_t
-main_exe_path(void)
-{
-    int mib[4] = {CTL_KERN, KERN_PROC, KERN_PROC_PATHNAME, -1};
-    size_t len = PATH_MAX;
-    int err = sysctl(mib, 4, binary_filename, &len, NULL, 0);
-    if (err) {
-	kprintf("Can't get the path of ruby");
-	return -1;
-    }
-    len--; /* sysctl sets strlen+1 */
-    return len;
-}
-#else
-#undef HAVE_MAIN_EXE_PATH
-#endif
-
-void
-rb_dump_backtrace_with_lines(int num_traces, void **traces)
-{
-    int i;
-    /* async-signal unsafe */
-    line_info_t *lines = (line_info_t *)calloc(num_traces, sizeof(line_info_t));
-    obj_info_t *obj = NULL;
-    /* 2 is NULL + main executable */
-    void **dladdr_fbases = (void **)calloc(num_traces+2, sizeof(void *));
-#ifdef HAVE_MAIN_EXE_PATH
-    char *main_path = NULL; /* used on printing backtrace */
-    ssize_t len;
-    if ((len = main_exe_path()) > 0) {
-	main_path = (char *)alloca(len + 1);
-	if (main_path) {
-	    uintptr_t addr;
-	    memcpy(main_path, binary_filename, len+1);
-	    append_obj(&obj);
-	    obj->path = main_path;
-	    addr = fill_lines(num_traces, traces, 1, &obj, lines, -1);
-	    if (addr != (uintptr_t)-1) {
-		dladdr_fbases[0] = (void *)addr;
-	    }
-	}
-    }
-#endif
-
-    /* fill source lines by reading dwarf */
-    for (i = 0; i < num_traces; i++) {
-	Dl_info info;
-	if (lines[i].line) continue;
-	if (dladdr(traces[i], &info)) {
-	    const char *path;
-	    void **p;
-
-	    /* skip symbols which is in already checked objects */
-	    /* if the binary is strip-ed, this may effect */
-	    for (p=dladdr_fbases; *p; p++) {
-		if (*p == info.dli_fbase) {
-		    lines[i].path = info.dli_fname;
-		    lines[i].sname = info.dli_sname;
-		    goto next_line;
-		}
-	    }
-	    *p = info.dli_fbase;
-
-	    append_obj(&obj);
-	    obj->base_addr = (uintptr_t)info.dli_fbase;
-	    path = info.dli_fname;
-	    obj->path = path;
-	    lines[i].path = path;
-	    strcpy(binary_filename, path);
-	    fill_lines(num_traces, traces, 1, &obj, lines, i);
-	}
-next_line:
-	continue;
-    }
-
-    /* output */
-    for (i = 0; i < num_traces; i++) {
-	line_info_t *line = &lines[i];
-	uintptr_t addr = (uintptr_t)traces[i];
-	uintptr_t d = addr - line->saddr;
-	if (!line->path) {
-	    kprintf("[0x%lx]\n", addr);
-	}
-	else if (!line->saddr || !line->sname) {
-	    kprintf("%s [0x%lx]\n", line->path, addr);
-	}
-	else if (line->line <= 0) {
-	    kprintf("%s(%s+0x%lx) [0x%lx]\n", line->path, line->sname,
-		    d, addr);
-	}
-	else if (!line->filename) {
-	    kprintf("%s(%s+0x%lx) [0x%lx] ???:%d\n", line->path, line->sname,
-		    d, addr, line->line);
-	}
-	else if (line->dirname && line->dirname[0]) {
-	    kprintf("%s(%s+0x%lx) [0x%lx] %s/%s:%d\n", line->path, line->sname,
-		    d, addr, line->dirname, line->filename, line->line);
-	}
-	else {
-	    kprintf("%s(%s+0x%lx) [0x%lx] %s:%d\n", line->path, line->sname,
-		    d, addr, line->filename, line->line);
-	}
-	/* FreeBSD's backtrace may show _start and so on */
-	if (line->sname && strcmp("main", line->sname) == 0)
-	    break;
-    }
-
-    /* free */
-    while (obj) {
-	obj_info_t *o = obj;
-	obj = o->next;
-	if (o->fd) {
-	    munmap(o->mapped, o->mapped_size);
-	    close(o->fd);
-	}
-	free(o);
-    }
-    free(lines);
-    free(dladdr_fbases);
-}
-
-/* From FreeBSD's lib/libstand/printf.c */
-/*-
- * Copyright (c) 1986, 1988, 1991, 1993
- *	The Regents of the University of California.  All rights reserved.
- * (c) UNIX System Laboratories, Inc.
- * All or some portions of this file are derived from material licensed
- * to the University of California by American Telephone and Telegraph
- * Co. or Unix System Laboratories, Inc. and are reproduced herein with
- * the permission of UNIX System Laboratories, Inc.
- *
- * Redistribution and use in source and binary forms, with or without
- * modification, are permitted provided that the following conditions
- * are met:
- * 1. Redistributions of source code must retain the above copyright
- *    notice, this list of conditions and the following disclaimer.
- * 2. Redistributions in binary form must reproduce the above copyright
- *    notice, this list of conditions and the following disclaimer in the
- *    documentation and/or other materials provided with the distribution.
- * 4. Neither the name of the University nor the names of its contributors
- *    may be used to endorse or promote products derived from this software
- *    without specific prior written permission.
- *
- * THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
- * ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
- * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- * ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
- * FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
- * DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
- * OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
- * HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
- * LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
- * OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
- * SUCH DAMAGE.
- *
- *	@(#)subr_prf.c	8.3 (Berkeley) 1/21/94
- */
-
-#include <stdarg.h>
-#define MAXNBUF (sizeof(intmax_t) * CHAR_BIT + 1)
-extern int rb_toupper(int c);
-#define    toupper(c)  rb_toupper(c)
-#define    hex2ascii(hex)  (hex2ascii_data[hex])
-char const hex2ascii_data[] = "0123456789abcdefghijklmnopqrstuvwxyz";
-static inline int imax(int a, int b) { return (a > b ? a : b); }
-static int kvprintf(char const *fmt, void (*func)(int), void *arg, int radix, va_list ap);
-
-static void putce(int c)
-{
-    char s[1];
-    ssize_t ret;
-
-    s[0] = (char)c;
-    ret = write(2, s, 1);
-    (void)ret;
-}
-
-int
-kprintf(const char *fmt, ...)
-{
-	va_list ap;
-	int retval;
-
-	va_start(ap, fmt);
-	retval = kvprintf(fmt, putce, NULL, 10, ap);
-	va_end(ap);
-	return retval;
-}
-
-/*
- * Put a NUL-terminated ASCII number (base <= 36) in a buffer in reverse
- * order; return an optional length and a pointer to the last character
- * written in the buffer (i.e., the first character of the string).
- * The buffer pointed to by `nbuf' must have length >= MAXNBUF.
- */
-static char *
-ksprintn(char *nbuf, uintmax_t num, int base, int *lenp, int upper)
-{
-	char *p, c;
-
-	p = nbuf;
-	*p = '\0';
-	do {
-		c = hex2ascii(num % base);
-		*++p = upper ? toupper(c) : c;
-	} while (num /= base);
-	if (lenp)
-		*lenp = (int)(p - nbuf);
-	return (p);
-}
-
-/*
- * Scaled down version of printf(3).
- *
- * Two additional formats:
- *
- * The format %b is supported to decode error registers.
- * Its usage is:
- *
- *	printf("reg=%b\n", regval, "<base><arg>*");
- *
- * where <base> is the output base expressed as a control character, e.g.
- * \10 gives octal; \20 gives hex.  Each arg is a sequence of characters,
- * the first of which gives the bit number to be inspected (origin 1), and
- * the next characters (up to a control character, i.e. a character <= 32),
- * give the name of the register.  Thus:
- *
- *	kvprintf("reg=%b\n", 3, "\10\2BITTWO\1BITONE\n");
- *
- * would produce output:
- *
- *	reg=3<BITTWO,BITONE>
- *
- * XXX:  %D  -- Hexdump, takes pointer and separator string:
- *		("%6D", ptr, ":")   -> XX:XX:XX:XX:XX:XX
- *		("%*D", len, ptr, " " -> XX XX XX XX ...
- */
-static int
-kvprintf(char const *fmt, void (*func)(int), void *arg, int radix, va_list ap)
-{
-#define PCHAR(c) {int cc=(c); if (func) (*func)(cc); else *d++ = cc; retval++; }
-	char nbuf[MAXNBUF];
-	char *d;
-	const char *p, *percent, *q;
-	unsigned char *up;
-	int ch, n;
-	uintmax_t num;
-	int base, lflag, qflag, tmp, width, ladjust, sharpflag, neg, sign, dot;
-	int cflag, hflag, jflag, tflag, zflag;
-	int dwidth, upper;
-	char padc;
-	int stop = 0, retval = 0;
-
-	num = 0;
-	if (!func)
-		d = (char *) arg;
-	else
-		d = NULL;
-
-	if (fmt == NULL)
-		fmt = "(fmt null)\n";
-
-	if (radix < 2 || radix > 36)
-		radix = 10;
-
-	for (;;) {
-		padc = ' ';
-		width = 0;
-		while ((ch = (unsigned char)*fmt++) != '%' || stop) {
-			if (ch == '\0')
-				return (retval);
-			PCHAR(ch);
-		}
-		percent = fmt - 1;
-		qflag = 0; lflag = 0; ladjust = 0; sharpflag = 0; neg = 0;
-		sign = 0; dot = 0; dwidth = 0; upper = 0;
-		cflag = 0; hflag = 0; jflag = 0; tflag = 0; zflag = 0;
-reswitch:	switch (ch = (unsigned char)*fmt++) {
-		case '.':
-			dot = 1;
-			goto reswitch;
-		case '#':
-			sharpflag = 1;
-			goto reswitch;
-		case '+':
-			sign = 1;
-			goto reswitch;
-		case '-':
-			ladjust = 1;
-			goto reswitch;
-		case '%':
-			PCHAR(ch);
-			break;
-		case '*':
-			if (!dot) {
-				width = va_arg(ap, int);
-				if (width < 0) {
-					ladjust = !ladjust;
-					width = -width;
-				}
-			} else {
-				dwidth = va_arg(ap, int);
-			}
-			goto reswitch;
-		case '0':
-			if (!dot) {
-				padc = '0';
-				goto reswitch;
-			}
-		case '1': case '2': case '3': case '4':
-		case '5': case '6': case '7': case '8': case '9':
-				for (n = 0;; ++fmt) {
-					n = n * 10 + ch - '0';
-					ch = *fmt;
-					if (ch < '0' || ch > '9')
-						break;
-				}
-			if (dot)
-				dwidth = n;
-			else
-				width = n;
-			goto reswitch;
-		case 'b':
-			num = (unsigned int)va_arg(ap, int);
-			p = va_arg(ap, char *);
-			for (q = ksprintn(nbuf, num, *p++, NULL, 0); *q;)
-				PCHAR(*q--);
-
-			if (num == 0)
-				break;
-
-			for (tmp = 0; *p;) {
-				n = *p++;
-				if (num & (1 << (n - 1))) {
-					PCHAR(tmp ? ',' : '<');
-					for (; (n = *p) > ' '; ++p)
-						PCHAR(n);
-					tmp = 1;
-				} else
-					for (; *p > ' '; ++p)
-						continue;
-			}
-			if (tmp)
-				PCHAR('>');
-			break;
-		case 'c':
-			PCHAR(va_arg(ap, int));
-			break;
-		case 'D':
-			up = va_arg(ap, unsigned char *);
-			p = va_arg(ap, char *);
-			if (!width)
-				width = 16;
-			while(width--) {
-				PCHAR(hex2ascii(*up >> 4));
-				PCHAR(hex2ascii(*up & 0x0f));
-				up++;
-				if (width)
-					for (q=p;*q;q++)
-						PCHAR(*q);
-			}
-			break;
-		case 'd':
-		case 'i':
-			base = 10;
-			sign = 1;
-			goto handle_sign;
-		case 'h':
-			if (hflag) {
-				hflag = 0;
-				cflag = 1;
-			} else
-				hflag = 1;
-			goto reswitch;
-		case 'j':
-			jflag = 1;
-			goto reswitch;
-		case 'l':
-			if (lflag) {
-				lflag = 0;
-				qflag = 1;
-			} else
-				lflag = 1;
-			goto reswitch;
-		case 'n':
-			if (jflag)
-				*(va_arg(ap, intmax_t *)) = retval;
-			else if (qflag)
-				*(va_arg(ap, int64_t *)) = retval;
-			else if (lflag)
-				*(va_arg(ap, long *)) = retval;
-			else if (zflag)
-				*(va_arg(ap, size_t *)) = retval;
-			else if (hflag)
-				*(va_arg(ap, short *)) = retval;
-			else if (cflag)
-				*(va_arg(ap, char *)) = retval;
-			else
-				*(va_arg(ap, int *)) = retval;
-			break;
-		case 'o':
-			base = 8;
-			goto handle_nosign;
-		case 'p':
-			base = 16;
-			sharpflag = (width == 0);
-			sign = 0;
-			num = (uintptr_t)va_arg(ap, void *);
-			goto number;
-		case 'q':
-			qflag = 1;
-			goto reswitch;
-		case 'r':
-			base = radix;
-			if (sign)
-				goto handle_sign;
-			goto handle_nosign;
-		case 's':
-			p = va_arg(ap, char *);
-			if (p == NULL)
-				p = "(null)";
-			if (!dot)
-				n = (int)strlen (p);
-			else
-				for (n = 0; n < dwidth && p[n]; n++)
-					continue;
-
-			width -= n;
-
-			if (!ladjust && width > 0)
-				while (width--)
-					PCHAR(padc);
-			while (n--)
-				PCHAR(*p++);
-			if (ladjust && width > 0)
-				while (width--)
-					PCHAR(padc);
-			break;
-		case 't':
-			tflag = 1;
-			goto reswitch;
-		case 'u':
-			base = 10;
-			goto handle_nosign;
-		case 'X':
-			upper = 1;
-		case 'x':
-			base = 16;
-			goto handle_nosign;
-		case 'y':
-			base = 16;
-			sign = 1;
-			goto handle_sign;
-		case 'z':
-			zflag = 1;
-			goto reswitch;
-handle_nosign:
-			sign = 0;
-			if (jflag)
-				num = va_arg(ap, uintmax_t);
-			else if (qflag)
-				num = va_arg(ap, uint64_t);
-			else if (tflag)
-				num = va_arg(ap, ptrdiff_t);
-			else if (lflag)
-				num = va_arg(ap, unsigned long);
-			else if (zflag)
-				num = va_arg(ap, size_t);
-			else if (hflag)
-				num = (unsigned short)va_arg(ap, int);
-			else if (cflag)
-				num = (unsigned char)va_arg(ap, int);
-			else
-				num = va_arg(ap, unsigned int);
-			goto number;
-handle_sign:
-			if (jflag)
-				num = va_arg(ap, intmax_t);
-			else if (qflag)
-				num = va_arg(ap, int64_t);
-			else if (tflag)
-				num = va_arg(ap, ptrdiff_t);
-			else if (lflag)
-				num = va_arg(ap, long);
-			else if (zflag)
-				num = va_arg(ap, ssize_t);
-			else if (hflag)
-				num = (short)va_arg(ap, int);
-			else if (cflag)
-				num = (char)va_arg(ap, int);
-			else
-				num = va_arg(ap, int);
-number:
-			if (sign && (intmax_t)num < 0) {
-				neg = 1;
-				num = -(intmax_t)num;
-			}
-			p = ksprintn(nbuf, num, base, &n, upper);
-			tmp = 0;
-			if (sharpflag && num != 0) {
-				if (base == 8)
-					tmp++;
-				else if (base == 16)
-					tmp += 2;
-			}
-			if (neg)
-				tmp++;
-
-			if (!ladjust && padc == '0')
-				dwidth = width - tmp;
-			width -= tmp + imax(dwidth, n);
-			dwidth -= n;
-			if (!ladjust)
-				while (width-- > 0)
-					PCHAR(' ');
-			if (neg)
-				PCHAR('-');
-			if (sharpflag && num != 0) {
-				if (base == 8) {
-					PCHAR('0');
-				} else if (base == 16) {
-					PCHAR('0');
-					PCHAR('x');
-				}
-			}
-			while (dwidth-- > 0)
-				PCHAR('0');
-
-			while (*p)
-				PCHAR(*p--);
-
-			if (ladjust)
-				while (width-- > 0)
-					PCHAR(' ');
-
-			break;
-		default:
-			while (percent < fmt)
-				PCHAR(*percent++);
-			/*
-			 * Since we ignore an formatting argument it is no
-			 * longer safe to obey the remaining formatting
-			 * arguments as the arguments will no longer match
-			 * the format specs.
-			 */
-			stop = 1;
-			break;
-		}
-	}
-#undef PCHAR
-}
-#else /* defined(USE_ELF) */
-#error not supported
-#endif
diff --git a/addr2line.h b/addr2line.h
deleted file mode 100644
index d99f010934..0000000000
--- a/addr2line.h
+++ /dev/null
@@ -1,21 +0,0 @@
-/**********************************************************************
-
-  addr2line.h -
-
-  $Author$
-
-  Copyright (C) 2010 Shinichiro Hamaji
-
-**********************************************************************/
-
-#ifndef RUBY_ADDR2LINE_H
-#define RUBY_ADDR2LINE_H
-
-#ifdef USE_ELF
-
-void
-rb_dump_backtrace_with_lines(int num_traces, void **traces);
-
-#endif /* USE_ELF */
-
-#endif /* RUBY_ADDR2LINE_H */
diff --git a/array.c b/array.c
index 7469cc2387..81b422a53b 100644
--- a/array.c
+++ b/array.c
@@ -1,5914 +1,1373 @@
-/**********************************************************************
+/************************************************
 
   array.c -
 
   $Author$
+  $Date$
   created at: Fri Aug  6 09:46:12 JST 1993
 
-  Copyright (C) 1993-2007 Yukihiro Matsumoto
-  Copyright (C) 2000  Network Applied Communication Laboratory, Inc.
-  Copyright (C) 2000  Information-technology Promotion Agency, Japan
+  Copyright (C) 1993-1998 Yukihiro Matsumoto
 
-**********************************************************************/
+************************************************/
 
-#include "internal.h"
-#include "ruby/util.h"
-#include "ruby/st.h"
-#include "probes.h"
-#include "id.h"
+#include "ruby.h"
 
-#ifndef ARRAY_DEBUG
-# define NDEBUG
-#endif
-#include <assert.h>
-
-VALUE rb_cArray;
 
-static ID id_cmp, id_div, id_power;
+VALUE cArray;
 
 #define ARY_DEFAULT_SIZE 16
-#define ARY_MAX_SIZE (LONG_MAX / (int)sizeof(VALUE))
-
-# define ARY_SHARED_P(ary) \
-    (assert(!FL_TEST((ary), ELTS_SHARED) || !FL_TEST((ary), RARRAY_EMBED_FLAG)), \
-     FL_TEST((ary),ELTS_SHARED)!=0)
-# define ARY_EMBED_P(ary) \
-    (assert(!FL_TEST((ary), ELTS_SHARED) || !FL_TEST((ary), RARRAY_EMBED_FLAG)), \
-     FL_TEST((ary), RARRAY_EMBED_FLAG)!=0)
-
-#define ARY_HEAP_PTR(a) (assert(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.ptr)
-#define ARY_HEAP_LEN(a) (assert(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.len)
-#define ARY_EMBED_PTR(a) (assert(ARY_EMBED_P(a)), RARRAY(a)->as.ary)
-#define ARY_EMBED_LEN(a) \
-    (assert(ARY_EMBED_P(a)), \
-     (long)((RBASIC(a)->flags >> RARRAY_EMBED_LEN_SHIFT) & \
-	 (RARRAY_EMBED_LEN_MASK >> RARRAY_EMBED_LEN_SHIFT)))
-#define ARY_HEAP_SIZE(a) (assert(!ARY_EMBED_P(a)), assert(ARY_OWNS_HEAP_P(a)), RARRAY(a)->as.heap.aux.capa * sizeof(VALUE))
-
-#define ARY_OWNS_HEAP_P(a) (!FL_TEST((a), ELTS_SHARED|RARRAY_EMBED_FLAG))
-#define FL_SET_EMBED(a) do { \
-    assert(!ARY_SHARED_P(a)); \
-    FL_SET((a), RARRAY_EMBED_FLAG); \
-} while (0)
-#define FL_UNSET_EMBED(ary) FL_UNSET((ary), RARRAY_EMBED_FLAG|RARRAY_EMBED_LEN_MASK)
-#define FL_SET_SHARED(ary) do { \
-    assert(!ARY_EMBED_P(ary)); \
-    FL_SET((ary), ELTS_SHARED); \
-} while (0)
-#define FL_UNSET_SHARED(ary) FL_UNSET((ary), ELTS_SHARED)
-
-#define ARY_SET_PTR(ary, p) do { \
-    assert(!ARY_EMBED_P(ary)); \
-    assert(!OBJ_FROZEN(ary)); \
-    RARRAY(ary)->as.heap.ptr = (p); \
-} while (0)
-#define ARY_SET_EMBED_LEN(ary, n) do { \
-    long tmp_n = (n); \
-    assert(ARY_EMBED_P(ary)); \
-    assert(!OBJ_FROZEN(ary)); \
-    RBASIC(ary)->flags &= ~RARRAY_EMBED_LEN_MASK; \
-    RBASIC(ary)->flags |= (tmp_n) << RARRAY_EMBED_LEN_SHIFT; \
-} while (0)
-#define ARY_SET_HEAP_LEN(ary, n) do { \
-    assert(!ARY_EMBED_P(ary)); \
-    RARRAY(ary)->as.heap.len = (n); \
-} while (0)
-#define ARY_SET_LEN(ary, n) do { \
-    if (ARY_EMBED_P(ary)) { \
-        ARY_SET_EMBED_LEN((ary), (n)); \
-    } \
-    else { \
-        ARY_SET_HEAP_LEN((ary), (n)); \
-    } \
-    assert(RARRAY_LEN(ary) == (n)); \
-} while (0)
-#define ARY_INCREASE_PTR(ary, n) do  { \
-    assert(!ARY_EMBED_P(ary)); \
-    assert(!OBJ_FROZEN(ary)); \
-    RARRAY(ary)->as.heap.ptr += (n); \
-} while (0)
-#define ARY_INCREASE_LEN(ary, n) do  { \
-    assert(!OBJ_FROZEN(ary)); \
-    if (ARY_EMBED_P(ary)) { \
-        ARY_SET_EMBED_LEN((ary), RARRAY_LEN(ary)+(n)); \
-    } \
-    else { \
-        RARRAY(ary)->as.heap.len += (n); \
-    } \
-} while (0)
-
-#define ARY_CAPA(ary) (ARY_EMBED_P(ary) ? RARRAY_EMBED_LEN_MAX : \
-		       ARY_SHARED_ROOT_P(ary) ? RARRAY_LEN(ary) : RARRAY(ary)->as.heap.aux.capa)
-#define ARY_SET_CAPA(ary, n) do { \
-    assert(!ARY_EMBED_P(ary)); \
-    assert(!ARY_SHARED_P(ary)); \
-    assert(!OBJ_FROZEN(ary)); \
-    RARRAY(ary)->as.heap.aux.capa = (n); \
-} while (0)
-
-#define ARY_SHARED(ary) (assert(ARY_SHARED_P(ary)), RARRAY(ary)->as.heap.aux.shared)
-#define ARY_SET_SHARED(ary, value) do { \
-    const VALUE _ary_ = (ary); \
-    const VALUE _value_ = (value); \
-    assert(!ARY_EMBED_P(_ary_)); \
-    assert(ARY_SHARED_P(_ary_)); \
-    assert(ARY_SHARED_ROOT_P(_value_)); \
-    RB_OBJ_WRITE(_ary_, &RARRAY(_ary_)->as.heap.aux.shared, _value_); \
-} while (0)
-#define RARRAY_SHARED_ROOT_FLAG FL_USER5
-#define ARY_SHARED_ROOT_P(ary) (FL_TEST((ary), RARRAY_SHARED_ROOT_FLAG))
-#define ARY_SHARED_NUM(ary) \
-    (assert(ARY_SHARED_ROOT_P(ary)), RARRAY(ary)->as.heap.aux.capa)
-#define ARY_SHARED_OCCUPIED(ary) (ARY_SHARED_NUM(ary) == 1)
-#define ARY_SET_SHARED_NUM(ary, value) do { \
-    assert(ARY_SHARED_ROOT_P(ary)); \
-    RARRAY(ary)->as.heap.aux.capa = (value); \
-} while (0)
-#define FL_SET_SHARED_ROOT(ary) do { \
-    assert(!ARY_EMBED_P(ary)); \
-    FL_SET((ary), RARRAY_SHARED_ROOT_FLAG); \
-} while (0)
-
-#define ARY_SET(a, i, v) RARRAY_ASET((assert(!ARY_SHARED_P(a)), (a)), (i), (v))
 
 void
-rb_mem_clear(register VALUE *mem, register long size)
+memclear(mem, size)
+    register VALUE *mem;
+    register int size;
 {
     while (size--) {
 	*mem++ = Qnil;
     }
 }
 
-static void
-ary_mem_clear(VALUE ary, long beg, long size)
-{
-    RARRAY_PTR_USE(ary, ptr, {
-	rb_mem_clear(ptr + beg, size);
-    });
-}
-
-static inline void
-memfill(register VALUE *mem, register long size, register VALUE val)
-{
-    while (size--) {
-	*mem++ = val;
-    }
-}
-
-static void
-ary_memfill(VALUE ary, long beg, long size, VALUE val)
-{
-    RARRAY_PTR_USE(ary, ptr, {
-	memfill(ptr + beg, size, val);
-	RB_OBJ_WRITTEN(ary, Qundef, val);
-    });
-}
-
-static void
-ary_memcpy0(VALUE ary, long beg, long argc, const VALUE *argv, VALUE buff_owner_ary)
-{
-#if 1
-    assert(!ARY_SHARED_P(buff_owner_ary));
-
-    if (argc > (int)(128/sizeof(VALUE)) /* is magic number (cache line size) */) {
-	rb_gc_writebarrier_remember(buff_owner_ary);
-	RARRAY_PTR_USE(ary, ptr, {
-	    MEMCPY(ptr+beg, argv, VALUE, argc);
-	});
-    }
-    else {
-	int i;
-	RARRAY_PTR_USE(ary, ptr, {
-	    for (i=0; i<argc; i++) {
-		RB_OBJ_WRITE(buff_owner_ary, &ptr[i+beg], argv[i]);
-	    }
-	});
-    }
-#else
-    /* giveup write barrier (traditional way) */
-    RARRAY_PTR(buff_owner_ary);
-    MEMCPY(RARRAY_PTR(ary)+beg, argv, VALUE, argc);
-#endif
-}
-
-static void
-ary_memcpy(VALUE ary, long beg, long argc, const VALUE *argv)
-{
-    ary_memcpy0(ary, beg, argc, argv, ary);
-}
-
-static void
-ary_resize_capa(VALUE ary, long capacity)
-{
-    assert(RARRAY_LEN(ary) <= capacity);
-    assert(!OBJ_FROZEN(ary));
-    assert(!ARY_SHARED_P(ary));
-    if (capacity > RARRAY_EMBED_LEN_MAX) {
-        if (ARY_EMBED_P(ary)) {
-            long len = ARY_EMBED_LEN(ary);
-            VALUE *ptr = ALLOC_N(VALUE, (capacity));
-            MEMCPY(ptr, ARY_EMBED_PTR(ary), VALUE, len);
-            FL_UNSET_EMBED(ary);
-            ARY_SET_PTR(ary, ptr);
-            ARY_SET_HEAP_LEN(ary, len);
-        }
-        else {
-	    SIZED_REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, capacity, RARRAY(ary)->as.heap.aux.capa);
-        }
-        ARY_SET_CAPA(ary, (capacity));
-    }
-    else {
-        if (!ARY_EMBED_P(ary)) {
-            long len = RARRAY_LEN(ary);
-	    const VALUE *ptr = RARRAY_CONST_PTR(ary);
-
-	    if (len > capacity) len = capacity;
-            MEMCPY((VALUE *)RARRAY(ary)->as.ary, ptr, VALUE, len);
-            FL_SET_EMBED(ary);
-            ARY_SET_LEN(ary, len);
-	    ruby_xfree((VALUE *)ptr);
-        }
-    }
-}
-
-static inline void
-ary_shrink_capa(VALUE ary)
-{
-    long capacity = ARY_HEAP_LEN(ary);
-    long old_capa = RARRAY(ary)->as.heap.aux.capa;
-    assert(!ARY_SHARED_P(ary));
-    assert(old_capa >= capacity);
-    if (old_capa > capacity)
-	REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, capacity);
-}
-
-static void
-ary_double_capa(VALUE ary, long min)
-{
-    long new_capa = ARY_CAPA(ary) / 2;
-
-    if (new_capa < ARY_DEFAULT_SIZE) {
-	new_capa = ARY_DEFAULT_SIZE;
-    }
-    if (new_capa >= ARY_MAX_SIZE - min) {
-	new_capa = (ARY_MAX_SIZE - min) / 2;
-    }
-    new_capa += min;
-    ary_resize_capa(ary, new_capa);
-}
-
-static void
-rb_ary_decrement_share(VALUE shared)
-{
-    if (shared) {
-	long num = ARY_SHARED_NUM(shared) - 1;
-	if (num == 0) {
-	    rb_ary_free(shared);
-	    rb_gc_force_recycle(shared);
-	}
-	else if (num > 0) {
-	    ARY_SET_SHARED_NUM(shared, num);
-	}
-    }
-}
+#define ARY_FREEZE   FL_USER1
 
 static void
-rb_ary_unshare(VALUE ary)
-{
-    VALUE shared = RARRAY(ary)->as.heap.aux.shared;
-    rb_ary_decrement_share(shared);
-    FL_UNSET_SHARED(ary);
-}
-
-static inline void
-rb_ary_unshare_safe(VALUE ary)
-{
-    if (ARY_SHARED_P(ary) && !ARY_EMBED_P(ary)) {
-	rb_ary_unshare(ary);
-    }
-}
-
-static VALUE
-rb_ary_increment_share(VALUE shared)
-{
-    long num = ARY_SHARED_NUM(shared);
-    if (num >= 0) {
-	ARY_SET_SHARED_NUM(shared, num + 1);
-    }
-    return shared;
-}
-
-static void
-rb_ary_set_shared(VALUE ary, VALUE shared)
-{
-    rb_ary_increment_share(shared);
-    FL_SET_SHARED(ary);
-    ARY_SET_SHARED(ary, shared);
-}
-
-static inline void
-rb_ary_modify_check(VALUE ary)
-{
-    rb_check_frozen(ary);
-}
-
-void
-rb_ary_modify(VALUE ary)
+ary_modify(ary)
+    VALUE ary;
 {
-    rb_ary_modify_check(ary);
-    if (ARY_SHARED_P(ary)) {
-	long shared_len, len = RARRAY_LEN(ary);
-	VALUE shared = ARY_SHARED(ary);
-        if (len <= RARRAY_EMBED_LEN_MAX) {
-	    const VALUE *ptr = ARY_HEAP_PTR(ary);
-            FL_UNSET_SHARED(ary);
-            FL_SET_EMBED(ary);
-	    MEMCPY((VALUE *)ARY_EMBED_PTR(ary), ptr, VALUE, len);
-            rb_ary_decrement_share(shared);
-            ARY_SET_EMBED_LEN(ary, len);
-        }
-	else if (ARY_SHARED_OCCUPIED(shared) && len > ((shared_len = RARRAY_LEN(shared))>>1)) {
-	    long shift = RARRAY_CONST_PTR(ary) - RARRAY_CONST_PTR(shared);
-	    FL_UNSET_SHARED(ary);
-	    ARY_SET_PTR(ary, RARRAY_CONST_PTR(shared));
-	    ARY_SET_CAPA(ary, shared_len);
-	    RARRAY_PTR_USE(ary, ptr, {
-		MEMMOVE(ptr, ptr+shift, VALUE, len);
-	    });
-	    FL_SET_EMBED(shared);
-	    rb_ary_decrement_share(shared);
-	}
-        else {
-            VALUE *ptr = ALLOC_N(VALUE, len);
-            MEMCPY(ptr, RARRAY_CONST_PTR(ary), VALUE, len);
-            rb_ary_unshare(ary);
-            ARY_SET_CAPA(ary, len);
-            ARY_SET_PTR(ary, ptr);
-        }
-
-	rb_gc_writebarrier_remember(ary);
+    rb_secure(5);
+    if (FL_TEST(ary, ARY_FREEZE)) {
+	TypeError("can't modify frozen array");
     }
 }
 
-static VALUE
-ary_ensure_room_for_push(VALUE ary, long add_len)
-{
-    long old_len = RARRAY_LEN(ary);
-    long new_len = old_len + add_len;
-    long capa;
-
-    if (old_len > ARY_MAX_SIZE - add_len) {
-	rb_raise(rb_eIndexError, "index %ld too big", new_len);
-    }
-    if (ARY_SHARED_P(ary)) {
-	if (new_len > RARRAY_EMBED_LEN_MAX) {
-	    VALUE shared = ARY_SHARED(ary);
-	    if (ARY_SHARED_OCCUPIED(shared)) {
-		if (RARRAY_CONST_PTR(ary) - RARRAY_CONST_PTR(shared) + new_len <= RARRAY_LEN(shared)) {
-		    rb_ary_modify_check(ary);
-		    return shared;
-		}
-		else {
-		    /* if array is shared, then it is likely it participate in push/shift pattern */
-		    rb_ary_modify(ary);
-		    capa = ARY_CAPA(ary);
-		    if (new_len > capa - (capa >> 6)) {
-			ary_double_capa(ary, new_len);
-		    }
-		    return ary;
-		}
-	    }
-	}
-    }
-    rb_ary_modify(ary);
-    capa = ARY_CAPA(ary);
-    if (new_len > capa) {
-	ary_double_capa(ary, new_len);
-    }
-
-    return ary;
-}
-
-/*
- *  call-seq:
- *      ary.freeze -> ary
- *
- *  Calls Object#freeze on +ary+ to prevent any further
- *  modification. A RuntimeError will be raised if a modification
- *  attempt is made.
- *
- */
-
 VALUE
-rb_ary_freeze(VALUE ary)
+ary_freeze(ary)
+    VALUE ary;
 {
-    return rb_obj_freeze(ary);
+    FL_SET(ary, ARY_FREEZE);
+    return ary;
 }
 
-/*
- *  call-seq:
- *     ary.frozen?  -> true or false
- *
- *  Return +true+ if this array is frozen (or temporarily frozen
- *  while being sorted). See also Object#frozen?
- */
-
 static VALUE
-rb_ary_frozen_p(VALUE ary)
+ary_frozen_p(ary)
+    VALUE ary;
 {
-    if (OBJ_FROZEN(ary)) return Qtrue;
-    return Qfalse;
+    if (FL_TEST(ary, ARY_FREEZE))
+	return TRUE;
+    return FALSE;
 }
 
-/* This can be used to take a snapshot of an array (with
-   e.g. rb_ary_replace) and check later whether the array has been
-   modified from the snapshot.  The snapshot is cheap, though if
-   something does modify the array it will pay the cost of copying
-   it.  If Array#pop or Array#shift has been called, the array will
-   be still shared with the snapshot, but the array length will
-   differ. */
 VALUE
-rb_ary_shared_with_p(VALUE ary1, VALUE ary2)
-{
-    if (!ARY_EMBED_P(ary1) && ARY_SHARED_P(ary1) &&
-	!ARY_EMBED_P(ary2) && ARY_SHARED_P(ary2) &&
-	RARRAY(ary1)->as.heap.aux.shared == RARRAY(ary2)->as.heap.aux.shared &&
-	RARRAY(ary1)->as.heap.len == RARRAY(ary2)->as.heap.len) {
-	return Qtrue;
-    }
-    return Qfalse;
-}
-
-static VALUE
-ary_alloc(VALUE klass)
+ary_new2(len)
+    int len;
 {
-    NEWOBJ_OF(ary, struct RArray, klass, T_ARRAY | RARRAY_EMBED_FLAG | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0));
-    /* Created array is:
-     *   FL_SET_EMBED((VALUE)ary);
-     *   ARY_SET_EMBED_LEN((VALUE)ary, 0);
-     */
-    return (VALUE)ary;
-}
+    NEWOBJ(ary, struct RArray);
+    OBJSETUP(ary, cArray, T_ARRAY);
 
-static VALUE
-empty_ary_alloc(VALUE klass)
-{
-    RUBY_DTRACE_CREATE_HOOK(ARRAY, 0);
-    return ary_alloc(klass);
-}
-
-static VALUE
-ary_new(VALUE klass, long capa)
-{
-    VALUE ary,*ptr;
-
-    if (capa < 0) {
-	rb_raise(rb_eArgError, "negative array size (or size too big)");
-    }
-    if (capa > ARY_MAX_SIZE) {
-	rb_raise(rb_eArgError, "array size too big");
-    }
-
-    RUBY_DTRACE_CREATE_HOOK(ARRAY, capa);
-
-    ary = ary_alloc(klass);
-    if (capa > RARRAY_EMBED_LEN_MAX) {
-	ptr = ALLOC_N(VALUE, capa);
-        FL_UNSET_EMBED(ary);
-        ARY_SET_PTR(ary, ptr);
-        ARY_SET_CAPA(ary, capa);
-        ARY_SET_HEAP_LEN(ary, 0);
+    ary->len = 0;
+    ary->capa = len;
+    if (len == 0)
+	ary->ptr = 0;
+    else {
+	ary->ptr = ALLOC_N(VALUE, len);
+	memclear(ary->ptr, len);
     }
 
-    return ary;
+    return (VALUE)ary;
 }
 
 VALUE
-rb_ary_new_capa(long capa)
+ary_new()
 {
-    return ary_new(rb_cArray, capa);
+    return ary_new2(ARY_DEFAULT_SIZE);
 }
 
-VALUE
-rb_ary_new(void)
-{
-    return rb_ary_new2(RARRAY_EMBED_LEN_MAX);
-}
+#ifdef HAVE_STDARG_PROTOTYPES
+#include <stdarg.h>
+#define va_init_list(a,b) va_start(a,b)
+#else
+#include <varargs.h>
+#define va_init_list(a,b) va_start(a)
+#endif
 
 VALUE
-(rb_ary_new_from_args)(long n, ...)
+#ifdef HAVE_STDARG_PROTOTYPES
+ary_new3(int n, ...)
+#else
+ary_new3(n, va_alist)
+    int n;
+    va_dcl
+#endif
 {
     va_list ar;
     VALUE ary;
-    long i;
+    int i;
 
-    ary = rb_ary_new2(n);
+    if (n < 0) {
+	IndexError("Negative number of items(%d)", n);
+    }
+    ary = ary_new2(n<ARY_DEFAULT_SIZE?ARY_DEFAULT_SIZE:n);
 
-    va_start(ar, n);
+    va_init_list(ar, n);
     for (i=0; i<n; i++) {
-	ARY_SET(ary, i, va_arg(ar, VALUE));
+	RARRAY(ary)->ptr[i] = va_arg(ar, VALUE);
     }
     va_end(ar);
 
-    ARY_SET_LEN(ary, n);
+    RARRAY(ary)->len = n;
     return ary;
 }
 
 VALUE
-rb_ary_new_from_values(long n, const VALUE *elts)
+ary_new4(n, elts)
+    int n;
+    VALUE *elts;
 {
     VALUE ary;
 
-    ary = rb_ary_new2(n);
-    if (n > 0 && elts) {
-	ary_memcpy(ary, 0, n, elts);
-	ARY_SET_LEN(ary, n);
-    }
-
-    return ary;
-}
-
-VALUE
-rb_ary_tmp_new(long capa)
-{
-    return ary_new(0, capa);
-}
-
-VALUE
-rb_ary_tmp_new_fill(long capa)
-{
-    VALUE ary = ary_new(0, capa);
-    ary_memfill(ary, 0, capa, Qnil);
-    ARY_SET_LEN(ary, capa);
-    return ary;
-}
-
-void
-rb_ary_free(VALUE ary)
-{
-    if (ARY_OWNS_HEAP_P(ary)) {
-	ruby_sized_xfree((void *)ARY_HEAP_PTR(ary), ARY_HEAP_SIZE(ary));
-    }
-}
-
-RUBY_FUNC_EXPORTED size_t
-rb_ary_memsize(VALUE ary)
-{
-    if (ARY_OWNS_HEAP_P(ary)) {
-	return RARRAY(ary)->as.heap.aux.capa * sizeof(VALUE);
+    ary = ary_new2(n);
+    if (elts) {
+	MEMCPY(RARRAY(ary)->ptr, elts, VALUE, n);
     }
     else {
-	return 0;
+	memclear(RARRAY(ary)->ptr, n);
     }
-}
+    RARRAY(ary)->len = n;
 
-static inline void
-ary_discard(VALUE ary)
-{
-    rb_ary_free(ary);
-    RBASIC(ary)->flags |= RARRAY_EMBED_FLAG;
-    RBASIC(ary)->flags &= ~RARRAY_EMBED_LEN_MASK;
-}
-
-static VALUE
-ary_make_shared(VALUE ary)
-{
-    assert(!ARY_EMBED_P(ary));
-    if (ARY_SHARED_P(ary)) {
-	return ARY_SHARED(ary);
-    }
-    else if (ARY_SHARED_ROOT_P(ary)) {
-	return ary;
-    }
-    else if (OBJ_FROZEN(ary)) {
-	ary_shrink_capa(ary);
-	FL_SET_SHARED_ROOT(ary);
-	ARY_SET_SHARED_NUM(ary, 1);
-	return ary;
-    }
-    else {
-	long capa = ARY_CAPA(ary), len = RARRAY_LEN(ary);
-	NEWOBJ_OF(shared, struct RArray, 0, T_ARRAY | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0));
-        FL_UNSET_EMBED(shared);
-
-	ARY_SET_LEN((VALUE)shared, capa);
-	ARY_SET_PTR((VALUE)shared, RARRAY_CONST_PTR(ary));
-	ary_mem_clear((VALUE)shared, len, capa - len);
-	FL_SET_SHARED_ROOT(shared);
-	ARY_SET_SHARED_NUM((VALUE)shared, 1);
-	FL_SET_SHARED(ary);
-	ARY_SET_SHARED(ary, (VALUE)shared);
-	OBJ_FREEZE(shared);
-	return (VALUE)shared;
-    }
+    return ary;
 }
 
-static VALUE
-ary_make_substitution(VALUE ary)
+VALUE
+assoc_new(car, cdr)
+    VALUE car, cdr;
 {
-    long len = RARRAY_LEN(ary);
+    VALUE ary;
 
-    if (len <= RARRAY_EMBED_LEN_MAX) {
-	VALUE subst = rb_ary_new2(len);
-	ary_memcpy(subst, 0, len, RARRAY_CONST_PTR(ary));
-        ARY_SET_EMBED_LEN(subst, len);
-        return subst;
-    }
-    else {
-        return rb_ary_increment_share(ary_make_shared(ary));
-    }
-}
+    ary = ary_new2(2);
+    RARRAY(ary)->ptr[0] = car;
+    RARRAY(ary)->ptr[1] = cdr;
+    RARRAY(ary)->len = 2;
 
-VALUE
-rb_assoc_new(VALUE car, VALUE cdr)
-{
-    return rb_ary_new3(2, car, cdr);
+    return ary;
 }
 
 static VALUE
-to_ary(VALUE ary)
-{
-    return rb_convert_type(ary, T_ARRAY, "Array", "to_ary");
-}
-
-VALUE
-rb_check_array_type(VALUE ary)
+ary_s_new(argc, argv, klass)
+    int argc;
+    VALUE *argv;
+    VALUE klass;
 {
-    return rb_check_convert_type(ary, T_ARRAY, "Array", "to_ary");
-}
+    VALUE size;
+    NEWOBJ(ary, struct RArray);
+    OBJSETUP(ary, klass, T_ARRAY);
 
-/*
- *  call-seq:
- *     Array.try_convert(obj) -> array or nil
- *
- *  Tries to convert +obj+ into an array, using +to_ary+ method.  Returns the
- *  converted array or +nil+ if +obj+ cannot be converted for any reason.
- *  This method can be used to check if an argument is an array.
- *
- *     Array.try_convert([1])   #=> [1]
- *     Array.try_convert("1")   #=> nil
- *
- *     if tmp = Array.try_convert(arg)
- *       # the argument is an array
- *     elsif tmp = String.try_convert(arg)
- *       # the argument is a string
- *     end
- *
- */
+    rb_scan_args(argc, argv, "01", &size);
+    ary->len = 0;
+    ary->capa = NIL_P(size)?ARY_DEFAULT_SIZE:NUM2INT(size);
+    ary->ptr = ALLOC_N(VALUE, ary->capa);
+    memclear(ary->ptr, ary->capa);
+    obj_call_init((VALUE)ary);
 
-static VALUE
-rb_ary_s_try_convert(VALUE dummy, VALUE ary)
-{
-    return rb_check_array_type(ary);
+    return (VALUE)ary;
 }
 
-/*
- *  call-seq:
- *     Array.new(size=0, default=nil)
- *     Array.new(array)
- *     Array.new(size) {|index| block }
- *
- *  Returns a new array.
- *
- *  In the first form, if no arguments are sent, the new array will be empty.
- *  When a +size+ and an optional +default+ are sent, an array is created with
- *  +size+ copies of +default+.  Take notice that all elements will reference the
- *  same object +default+.
- *
- *  The second form creates a copy of the array passed as a parameter (the
- *  array is generated by calling to_ary on the parameter).
- *
- *    first_array = ["Matz", "Guido"]
- *
- *    second_array = Array.new(first_array) #=> ["Matz", "Guido"]
- *
- *    first_array.equal? second_array       #=> false
- *
- *  In the last form, an array of the given size is created.  Each element in
- *  this array is created by passing the element's index to the given block
- *  and storing the return value.
- *
- *    Array.new(3){ |index| index ** 2 }
- *    # => [0, 1, 4]
- *
- *  == Common gotchas
- *
- *  When sending the second parameter, the same object will be used as the
- *  value for all the array elements:
- *
- *     a = Array.new(2, Hash.new)
- *     # => [{}, {}]
- *
- *     a[0]['cat'] = 'feline'
- *     a # => [{"cat"=>"feline"}, {"cat"=>"feline"}]
- *
- *     a[1]['cat'] = 'Felix'
- *     a # => [{"cat"=>"Felix"}, {"cat"=>"Felix"}]
- *
- *  Since all the Array elements store the same hash, changes to one of them
- *  will affect them all.
- *
- *  If multiple copies are what you want, you should use the block
- *  version which uses the result of that block each time an element
- *  of the array needs to be initialized:
- *
- *     a = Array.new(2) { Hash.new }
- *     a[0]['cat'] = 'feline'
- *     a # => [{"cat"=>"feline"}, {}]
- *
- */
-
 static VALUE
-rb_ary_initialize(int argc, VALUE *argv, VALUE ary)
+ary_s_create(argc, argv, klass)
+    int argc;
+    VALUE *argv;
+    VALUE klass;
 {
-    long len;
-    VALUE size, val;
+    NEWOBJ(ary, struct RArray);
+    OBJSETUP(ary, klass, T_ARRAY);
 
-    rb_ary_modify(ary);
+    ary->len = argc;
+    ary->capa = argc;
     if (argc == 0) {
-	if (ARY_OWNS_HEAP_P(ary) && RARRAY_CONST_PTR(ary) != 0) {
-	    ruby_sized_xfree((void *)RARRAY_CONST_PTR(ary), ARY_HEAP_SIZE(ary));
-	}
-        rb_ary_unshare_safe(ary);
-        FL_SET_EMBED(ary);
-	ARY_SET_EMBED_LEN(ary, 0);
-	if (rb_block_given_p()) {
-	    rb_warning("given block not used");
-	}
-	return ary;
-    }
-    rb_scan_args(argc, argv, "02", &size, &val);
-    if (argc == 1 && !FIXNUM_P(size)) {
-	val = rb_check_array_type(size);
-	if (!NIL_P(val)) {
-	    rb_ary_replace(ary, val);
-	    return ary;
-	}
-    }
-
-    len = NUM2LONG(size);
-    /* NUM2LONG() may call size.to_int, ary can be frozen, modified, etc */
-    if (len < 0) {
-	rb_raise(rb_eArgError, "negative array size");
-    }
-    if (len > ARY_MAX_SIZE) {
-	rb_raise(rb_eArgError, "array size too big");
-    }
-    /* recheck after argument conversion */
-    rb_ary_modify(ary);
-    ary_resize_capa(ary, len);
-    if (rb_block_given_p()) {
-	long i;
-
-	if (argc == 2) {
-	    rb_warn("block supersedes default value argument");
-	}
-	for (i=0; i<len; i++) {
-	    rb_ary_store(ary, i, rb_yield(LONG2NUM(i)));
-	    ARY_SET_LEN(ary, i + 1);
-	}
+	ary->ptr = 0;
     }
     else {
-	ary_memfill(ary, 0, len, val);
-	ARY_SET_LEN(ary, len);
+	ary->ptr = ALLOC_N(VALUE, argc);
+	MEMCPY(ary->ptr, argv, VALUE, argc);
     }
-    return ary;
-}
 
-/*
- * Returns a new array populated with the given objects.
- *
- *   Array.[]( 1, 'a', /^A/ ) # => [1, "a", /^A/]
- *   Array[ 1, 'a', /^A/ ]    # => [1, "a", /^A/]
- *   [ 1, 'a', /^A/ ]         # => [1, "a", /^A/]
- */
-
-static VALUE
-rb_ary_s_create(int argc, VALUE *argv, VALUE klass)
-{
-    VALUE ary = ary_new(klass, argc);
-    if (argc > 0 && argv) {
-        ary_memcpy(ary, 0, argc, argv);
-        ARY_SET_LEN(ary, argc);
-    }
-
-    return ary;
+    return (VALUE)ary;
 }
 
 void
-rb_ary_store(VALUE ary, long idx, VALUE val)
+ary_store(ary, idx, val)
+    VALUE ary;
+    int idx;
+    VALUE val;
 {
-    long len = RARRAY_LEN(ary);
-
+    ary_modify(ary);
     if (idx < 0) {
-	idx += len;
-	if (idx < 0) {
-	    rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
-		     idx - len, -len);
-	}
-    }
-    else if (idx >= ARY_MAX_SIZE) {
-	rb_raise(rb_eIndexError, "index %ld too big", idx);
+	IndexError("negative index for array");
     }
 
-    rb_ary_modify(ary);
-    if (idx >= ARY_CAPA(ary)) {
-	ary_double_capa(ary, idx);
+    if (idx >= RARRAY(ary)->capa) {
+	RARRAY(ary)->capa = idx + ARY_DEFAULT_SIZE;
+	REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->capa);
     }
-    if (idx > len) {
-	ary_mem_clear(ary, len, idx - len + 1);
+    if (idx > RARRAY(ary)->len) {
+	memclear(RARRAY(ary)->ptr+RARRAY(ary)->len, idx-RARRAY(ary)->len+1);
     }
 
-    if (idx >= len) {
-	ARY_SET_LEN(ary, idx + 1);
+    if (idx >= RARRAY(ary)->len) {
+	RARRAY(ary)->len = idx + 1;
     }
-    ARY_SET(ary, idx, val);
+    RARRAY(ary)->ptr[idx] = val;
 }
 
-static VALUE
-ary_make_partial(VALUE ary, VALUE klass, long offset, long len)
-{
-    assert(offset >= 0);
-    assert(len >= 0);
-    assert(offset+len <= RARRAY_LEN(ary));
-
-    if (len <= RARRAY_EMBED_LEN_MAX) {
-        VALUE result = ary_alloc(klass);
-	ary_memcpy(result, 0, len, RARRAY_CONST_PTR(ary) + offset);
-        ARY_SET_EMBED_LEN(result, len);
-        return result;
-    }
-    else {
-        VALUE shared, result = ary_alloc(klass);
-        FL_UNSET_EMBED(result);
-
-        shared = ary_make_shared(ary);
-        ARY_SET_PTR(result, RARRAY_CONST_PTR(ary));
-        ARY_SET_LEN(result, RARRAY_LEN(ary));
-        rb_ary_set_shared(result, shared);
-
-        ARY_INCREASE_PTR(result, offset);
-        ARY_SET_LEN(result, len);
-        return result;
-    }
-}
-
-static VALUE
-ary_make_shared_copy(VALUE ary)
+VALUE
+ary_push(ary, item)
+    VALUE ary;
+    VALUE item;
 {
-    return ary_make_partial(ary, rb_obj_class(ary), 0, RARRAY_LEN(ary));
+    ary_store(ary, RARRAY(ary)->len, item);
+    return ary;
 }
 
-enum ary_take_pos_flags
-{
-    ARY_TAKE_FIRST = 0,
-    ARY_TAKE_LAST = 1
-};
-
 static VALUE
-ary_take_first_or_last(int argc, const VALUE *argv, VALUE ary, enum ary_take_pos_flags last)
+ary_push_method(argc, argv, ary)
+    int argc;
+    VALUE *argv;
+    VALUE ary;
 {
-    VALUE nv;
-    long n;
-    long len;
-    long offset = 0;
-
-    rb_scan_args(argc, argv, "1", &nv);
-    n = NUM2LONG(nv);
-    len = RARRAY_LEN(ary);
-    if (n > len) {
-	n = len;
-    }
-    else if (n < 0) {
-	rb_raise(rb_eArgError, "negative array size");
-    }
-    if (last) {
-	offset = len - n;
+    while (argc--) {
+	ary_store(ary, RARRAY(ary)->len, *argv++);
     }
-    return ary_make_partial(ary, rb_cArray, offset, n);
-}
-
-/*
- *  call-seq:
- *     ary << obj            -> ary
- *
- *  Append---Pushes the given object on to the end of this array. This
- *  expression returns the array itself, so several appends
- *  may be chained together.
- *
- *     [ 1, 2 ] << "c" << "d" << [ 3, 4 ]
- *             #=>  [ 1, 2, "c", "d", [ 3, 4 ] ]
- *
- */
-
-VALUE
-rb_ary_push(VALUE ary, VALUE item)
-{
-    long idx = RARRAY_LEN(ary);
-    VALUE target_ary = ary_ensure_room_for_push(ary, 1);
-    RARRAY_PTR_USE(ary, ptr, {
-	RB_OBJ_WRITE(target_ary, &ptr[idx], item);
-    });
-    ARY_SET_LEN(ary, idx + 1);
     return ary;
 }
 
 VALUE
-rb_ary_cat(VALUE ary, const VALUE *argv, long len)
-{
-    long oldlen = RARRAY_LEN(ary);
-    VALUE target_ary = ary_ensure_room_for_push(ary, len);
-    ary_memcpy0(ary, oldlen, len, argv, target_ary);
-    ARY_SET_LEN(ary, oldlen + len);
-    return ary;
-}
-
-/*
- *  call-seq:
- *     ary.push(obj, ... )   -> ary
- *
- *  Append --- Pushes the given object(s) on to the end of this array. This
- *  expression returns the array itself, so several appends
- *  may be chained together. See also Array#pop for the opposite
- *  effect.
- *
- *     a = [ "a", "b", "c" ]
- *     a.push("d", "e", "f")
- *             #=> ["a", "b", "c", "d", "e", "f"]
- *     [1, 2, 3,].push(4).push(5)
- *             #=> [1, 2, 3, 4, 5]
- */
-
-static VALUE
-rb_ary_push_m(int argc, VALUE *argv, VALUE ary)
+ary_pop(ary)
+    VALUE ary;
 {
-    return rb_ary_cat(ary, argv, argc);
+    if (RARRAY(ary)->len == 0) return Qnil;
+    if (RARRAY(ary)->len * 10 < RARRAY(ary)->capa && RARRAY(ary)->capa > ARY_DEFAULT_SIZE) {
+	RARRAY(ary)->capa = RARRAY(ary)->len * 2;
+	REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->capa);
+    }
+    return RARRAY(ary)->ptr[--RARRAY(ary)->len];
 }
 
 VALUE
-rb_ary_pop(VALUE ary)
+ary_shift(ary)
+    VALUE ary;
 {
-    long n;
-    rb_ary_modify_check(ary);
-    n = RARRAY_LEN(ary);
-    if (n == 0) return Qnil;
-    if (ARY_OWNS_HEAP_P(ary) &&
-	n * 3 < ARY_CAPA(ary) &&
-	ARY_CAPA(ary) > ARY_DEFAULT_SIZE)
-    {
-	ary_resize_capa(ary, n * 2);
-    }
-    --n;
-    ARY_SET_LEN(ary, n);
-    return RARRAY_AREF(ary, n);
-}
+    VALUE top;
 
-/*
- *  call-seq:
- *     ary.pop    -> obj or nil
- *     ary.pop(n) -> new_ary
- *
- *  Removes the last element from +self+ and returns it, or
- *  +nil+ if the array is empty.
- *
- *  If a number +n+ is given, returns an array of the last +n+ elements
- *  (or less) just like <code>array.slice!(-n, n)</code> does. See also
- *  Array#push for the opposite effect.
- *
- *     a = [ "a", "b", "c", "d" ]
- *     a.pop     #=> "d"
- *     a.pop(2)  #=> ["b", "c"]
- *     a         #=> ["a"]
- */
+    if (RARRAY(ary)->len == 0) return Qnil;
 
-static VALUE
-rb_ary_pop_m(int argc, VALUE *argv, VALUE ary)
-{
-    VALUE result;
+    top = RARRAY(ary)->ptr[0];
+    RARRAY(ary)->len--;
 
-    if (argc == 0) {
-	return rb_ary_pop(ary);
+    /* sliding items */
+    MEMMOVE(RARRAY(ary)->ptr, RARRAY(ary)->ptr+1, VALUE, RARRAY(ary)->len);
+    if (RARRAY(ary)->len * 10 < RARRAY(ary)->capa && RARRAY(ary)->capa > ARY_DEFAULT_SIZE) {
+	RARRAY(ary)->capa = RARRAY(ary)->len * 2;
+	REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->capa);
     }
 
-    rb_ary_modify_check(ary);
-    result = ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
-    ARY_INCREASE_LEN(ary, -RARRAY_LEN(result));
-    return result;
+    return top;
 }
 
 VALUE
-rb_ary_shift(VALUE ary)
+ary_unshift(ary, item)
+    VALUE ary, item;
 {
-    VALUE top;
-    long len = RARRAY_LEN(ary);
-
-    rb_ary_modify_check(ary);
-    if (len == 0) return Qnil;
-    top = RARRAY_AREF(ary, 0);
-    if (!ARY_SHARED_P(ary)) {
-	if (len < ARY_DEFAULT_SIZE) {
-	    RARRAY_PTR_USE(ary, ptr, {
-		MEMMOVE(ptr, ptr+1, VALUE, len-1);
-	    }); /* WB: no new reference */
-            ARY_INCREASE_LEN(ary, -1);
-	    return top;
-	}
-        assert(!ARY_EMBED_P(ary)); /* ARY_EMBED_LEN_MAX < ARY_DEFAULT_SIZE */
-
-	ARY_SET(ary, 0, Qnil);
-	ary_make_shared(ary);
-    }
-    else if (ARY_SHARED_OCCUPIED(ARY_SHARED(ary))) {
-	RARRAY_PTR_USE(ary, ptr, ptr[0] = Qnil);
+    ary_modify(ary);
+    if (RARRAY(ary)->len >= RARRAY(ary)->capa) {
+	RARRAY(ary)->capa+=ARY_DEFAULT_SIZE;
+	REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->capa);
     }
-    ARY_INCREASE_PTR(ary, 1);		/* shift ptr */
-    ARY_INCREASE_LEN(ary, -1);
 
-    return top;
-}
+    /* sliding items */
+    MEMMOVE(RARRAY(ary)->ptr+1, RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
 
-/*
- *  call-seq:
- *     ary.shift    -> obj or nil
- *     ary.shift(n) -> new_ary
- *
- *  Removes the first element of +self+ and returns it (shifting all
- *  other elements down by one). Returns +nil+ if the array
- *  is empty.
- *
- *  If a number +n+ is given, returns an array of the first +n+ elements
- *  (or less) just like <code>array.slice!(0, n)</code> does. With +ary+
- *  containing only the remainder elements, not including what was shifted to
- *  +new_ary+. See also Array#unshift for the opposite effect.
- *
- *     args = [ "-m", "-q", "filename" ]
- *     args.shift     #=> "-m"
- *     args           #=> ["-q", "filename"]
- *
- *     args = [ "-m", "-q", "filename" ]
- *     args.shift(2)  #=> ["-m", "-q"]
- *     args           #=> ["filename"]
- */
+    RARRAY(ary)->len++;
+    return RARRAY(ary)->ptr[0] = item;
+}
 
-static VALUE
-rb_ary_shift_m(int argc, VALUE *argv, VALUE ary)
+VALUE
+ary_entry(ary, offset)
+    VALUE ary;
+    int offset;
 {
-    VALUE result;
-    long n;
+    if (RARRAY(ary)->len == 0) return Qnil;
 
-    if (argc == 0) {
-	return rb_ary_shift(ary);
-    }
-
-    rb_ary_modify_check(ary);
-    result = ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
-    n = RARRAY_LEN(result);
-    if (ARY_SHARED_P(ary)) {
-	if (ARY_SHARED_OCCUPIED(ARY_SHARED(ary))) {
-	  setup_occupied_shared:
-	    ary_mem_clear(ary, 0, n);
-	}
-        ARY_INCREASE_PTR(ary, n);
+    if (offset < 0) {
+	offset = RARRAY(ary)->len + offset;
     }
-    else {
-	if (RARRAY_LEN(ary) < ARY_DEFAULT_SIZE) {
-	    RARRAY_PTR_USE(ary, ptr, {
-		MEMMOVE(ptr, ptr+n, VALUE, RARRAY_LEN(ary)-n);
-	    }); /* WB: no new reference */
-	}
-	else {
-	    ary_make_shared(ary);
-	    goto setup_occupied_shared;
-	}
+    if (offset < 0 || RARRAY(ary)->len <= offset) {
+	return Qnil;
     }
-    ARY_INCREASE_LEN(ary, -n);
 
-    return result;
+    return RARRAY(ary)->ptr[offset];
 }
 
 static VALUE
-ary_ensure_room_for_unshift(VALUE ary, int argc)
+ary_subseq(ary, beg, len)
+    VALUE ary;
+    int beg, len;
 {
-    long len = RARRAY_LEN(ary);
-    long new_len = len + argc;
-    long capa;
-    const VALUE *head, *sharedp;
+    VALUE ary2;
 
-    if (len > ARY_MAX_SIZE - argc) {
-	rb_raise(rb_eIndexError, "index %ld too big", new_len);
+    if (beg < 0) {
+	beg = RARRAY(ary)->len + beg;
+	if (beg < 0) beg = 0;
     }
-
-    if (ARY_SHARED_P(ary)) {
-	VALUE shared = ARY_SHARED(ary);
-	capa = RARRAY_LEN(shared);
-	if (ARY_SHARED_OCCUPIED(shared) && capa > new_len) {
-	    head = RARRAY_CONST_PTR(ary);
-	    sharedp = RARRAY_CONST_PTR(shared);
-	    goto makeroom_if_need;
-	}
+    if (len < 0) {
+	IndexError("negative length %d", RARRAY(ary)->len);
     }
-
-    rb_ary_modify(ary);
-    capa = ARY_CAPA(ary);
-    if (capa - (capa >> 6) <= new_len) {
-	ary_double_capa(ary, new_len);
+    if (len == 0) {
+	return ary_new2(0);
     }
-
-    /* use shared array for big "queues" */
-    if (new_len > ARY_DEFAULT_SIZE * 4) {
-	/* make a room for unshifted items */
-	capa = ARY_CAPA(ary);
-	ary_make_shared(ary);
-
-	head = sharedp = RARRAY_CONST_PTR(ary);
-	goto makeroom;
-      makeroom_if_need:
-	if (head - sharedp < argc) {
-	    long room;
-	  makeroom:
-	    room = capa - new_len;
-	    room -= room >> 4;
-	    MEMMOVE((VALUE *)sharedp + argc + room, head, VALUE, len);
-	    head = sharedp + argc + room;
-	}
-	ARY_SET_PTR(ary, head - argc);
-	assert(ARY_SHARED_OCCUPIED(ARY_SHARED(ary)));
-	return ARY_SHARED(ary);
+    if (beg + len > RARRAY(ary)->len) {
+	len = RARRAY(ary)->len - beg;
     }
-    else {
-	/* sliding items */
-	RARRAY_PTR_USE(ary, ptr, {
-	    MEMMOVE(ptr + argc, ptr, VALUE, len);
-	});
-
-	return ary;
-    }
-}
-
-/*
- *  call-seq:
- *     ary.unshift(obj, ...)  -> ary
- *
- *  Prepends objects to the front of +self+, moving other elements upwards.
- *  See also Array#shift for the opposite effect.
- *
- *     a = [ "b", "c", "d" ]
- *     a.unshift("a")   #=> ["a", "b", "c", "d"]
- *     a.unshift(1, 2)  #=> [ 1, 2, "a", "b", "c", "d"]
- */
-
-static VALUE
-rb_ary_unshift_m(int argc, VALUE *argv, VALUE ary)
-{
-    long len = RARRAY_LEN(ary);
-    VALUE target_ary;
-
-    if (argc == 0) {
-	rb_ary_modify_check(ary);
-	return ary;
+    if (len < 0) {
+	len = 0;
     }
 
-    target_ary = ary_ensure_room_for_unshift(ary, argc);
-    ary_memcpy0(ary, 0, argc, argv, target_ary);
-    ARY_SET_LEN(ary, len + argc);
-    return ary;
-}
-
-VALUE
-rb_ary_unshift(VALUE ary, VALUE item)
-{
-    return rb_ary_unshift_m(1,&item,ary);
-}
-
-/* faster version - use this if you don't need to treat negative offset */
-static inline VALUE
-rb_ary_elt(VALUE ary, long offset)
-{
-    long len = RARRAY_LEN(ary);
-    if (len == 0) return Qnil;
-    if (offset < 0 || len <= offset) {
-	return Qnil;
-    }
-    return RARRAY_AREF(ary, offset);
-}
+    ary2 = ary_new2(len);
+    MEMCPY(RARRAY(ary2)->ptr, RARRAY(ary)->ptr+beg, VALUE, len);
+    RARRAY(ary2)->len = len;
 
-VALUE
-rb_ary_entry(VALUE ary, long offset)
-{
-    if (offset < 0) {
-	offset += RARRAY_LEN(ary);
-    }
-    return rb_ary_elt(ary, offset);
+    return ary2;
 }
 
-VALUE
-rb_ary_subseq(VALUE ary, long beg, long len)
+static VALUE
+beg_len(range, begp, lenp, len)
+    VALUE range;
+    int *begp, *lenp;
+    int len;
 {
-    VALUE klass;
-    long alen = RARRAY_LEN(ary);
+    int beg, end;
 
-    if (beg > alen) return Qnil;
-    if (beg < 0 || len < 0) return Qnil;
+    if (!range_beg_end(range, &beg, &end)) return FALSE;
 
-    if (alen < len || alen < beg + len) {
-	len = alen - beg;
+    if ((beg > 0 && end > 0 || beg < 0 && end < 0) && beg > end) {
+	IndexError("end smaller than beg [%d..%d]", beg, end);
     }
-    klass = rb_obj_class(ary);
-    if (len == 0) return ary_new(klass, 0);
 
-    return ary_make_partial(ary, klass, beg, len);
-}
-
-/*
- *  call-seq:
- *     ary[index]                -> obj     or nil
- *     ary[start, length]        -> new_ary or nil
- *     ary[range]                -> new_ary or nil
- *     ary.slice(index)          -> obj     or nil
- *     ary.slice(start, length)  -> new_ary or nil
- *     ary.slice(range)          -> new_ary or nil
- *
- *  Element Reference --- Returns the element at +index+, or returns a
- *  subarray starting at the +start+ index and continuing for +length+
- *  elements, or returns a subarray specified by +range+ of indices.
- *
- *  Negative indices count backward from the end of the array (-1 is the last
- *  element).  For +start+ and +range+ cases the starting index is just before
- *  an element.  Additionally, an empty array is returned when the starting
- *  index for an element range is at the end of the array.
- *
- *  Returns +nil+ if the index (or starting index) are out of range.
- *
- *     a = [ "a", "b", "c", "d", "e" ]
- *     a[2] +  a[0] + a[1]    #=> "cab"
- *     a[6]                   #=> nil
- *     a[1, 2]                #=> [ "b", "c" ]
- *     a[1..3]                #=> [ "b", "c", "d" ]
- *     a[4..7]                #=> [ "e" ]
- *     a[6..10]               #=> nil
- *     a[-3, 3]               #=> [ "c", "d", "e" ]
- *     # special cases
- *     a[5]                   #=> nil
- *     a[6, 1]                #=> nil
- *     a[5, 1]                #=> []
- *     a[5..10]               #=> []
- *
- */
-
-VALUE
-rb_ary_aref(int argc, const VALUE *argv, VALUE ary)
-{
-    VALUE arg;
-    long beg, len;
-
-    if (argc == 2) {
-	beg = NUM2LONG(argv[0]);
-	len = NUM2LONG(argv[1]);
-	if (beg < 0) {
-	    beg += RARRAY_LEN(ary);
-	}
-	return rb_ary_subseq(ary, beg, len);
-    }
-    if (argc != 1) {
-	rb_scan_args(argc, argv, "11", NULL, NULL);
-    }
-    arg = argv[0];
-    /* special case - speeding up */
-    if (FIXNUM_P(arg)) {
-	return rb_ary_entry(ary, FIX2LONG(arg));
-    }
-    /* check if idx is Range */
-    switch (rb_range_beg_len(arg, &beg, &len, RARRAY_LEN(ary), 0)) {
-      case Qfalse:
-	break;
-      case Qnil:
-	return Qnil;
-      default:
-	return rb_ary_subseq(ary, beg, len);
+    if (beg < 0) {
+	beg = len + beg;
+	if (beg < 0) beg = 0;
     }
-    return rb_ary_entry(ary, NUM2LONG(arg));
-}
-
-/*
- *  call-seq:
- *     ary.at(index)   ->   obj  or nil
- *
- *  Returns the element at +index+. A negative index counts from the end of
- *  +self+. Returns +nil+ if the index is out of range. See also
- *  Array#[].
- *
- *     a = [ "a", "b", "c", "d", "e" ]
- *     a.at(0)     #=> "a"
- *     a.at(-1)    #=> "e"
- */
-
-VALUE
-rb_ary_at(VALUE ary, VALUE pos)
-{
-    return rb_ary_entry(ary, NUM2LONG(pos));
-}
-
-/*
- *  call-seq:
- *     ary.first     ->   obj or nil
- *     ary.first(n)  ->   new_ary
- *
- *  Returns the first element, or the first +n+ elements, of the array.
- *  If the array is empty, the first form returns +nil+, and the
- *  second form returns an empty array. See also Array#last for
- *  the opposite effect.
- *
- *     a = [ "q", "r", "s", "t" ]
- *     a.first     #=> "q"
- *     a.first(2)  #=> ["q", "r"]
- */
-
-static VALUE
-rb_ary_first(int argc, VALUE *argv, VALUE ary)
-{
-    if (argc == 0) {
-	if (RARRAY_LEN(ary) == 0) return Qnil;
-	return RARRAY_AREF(ary, 0);
+    *begp = beg;
+    if (beg > len) {
+	*lenp = 0;
     }
     else {
-	return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
+	if (end < 0) {
+	    end = len + end;
+	    if (end < 0) end = -1;
+	}
+	if (beg > end) {
+	    *lenp = 0;
+	}
+	else {
+	    *lenp = end - beg +1;
+	}
     }
+    return TRUE;
 }
 
-/*
- *  call-seq:
- *     ary.last     ->  obj or nil
- *     ary.last(n)  ->  new_ary
- *
- *  Returns the last element(s) of +self+. If the array is empty,
- *  the first form returns +nil+.
- *
- *  See also Array#first for the opposite effect.
- *
- *     a = [ "w", "x", "y", "z" ]
- *     a.last     #=> "z"
- *     a.last(2)  #=> ["y", "z"]
- */
-
 VALUE
-rb_ary_last(int argc, const VALUE *argv, VALUE ary)
+ary_aref(argc, argv, ary)
+    int argc;
+    VALUE *argv;
+    VALUE ary;
 {
-    if (argc == 0) {
-	long len = RARRAY_LEN(ary);
-	if (len == 0) return Qnil;
-	return RARRAY_AREF(ary, len-1);
-    }
-    else {
-	return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
-    }
-}
-
-/*
- *  call-seq:
- *     ary.fetch(index)                    -> obj
- *     ary.fetch(index, default)           -> obj
- *     ary.fetch(index) { |index| block }  -> obj
- *
- *  Tries to return the element at position +index+, but throws an IndexError
- *  exception if the referenced +index+ lies outside of the array bounds.  This
- *  error can be prevented by supplying a second argument, which will act as a
- *  +default+ value.
- *
- *  Alternatively, if a block is given it will only be executed when an
- *  invalid +index+ is referenced.  Negative values of +index+ count from the
- *  end of the array.
- *
- *     a = [ 11, 22, 33, 44 ]
- *     a.fetch(1)               #=> 22
- *     a.fetch(-1)              #=> 44
- *     a.fetch(4, 'cat')        #=> "cat"
- *     a.fetch(100) { |i| puts "#{i} is out of bounds" }
- *                              #=> "100 is out of bounds"
- */
+    VALUE arg1, arg2;
+    int beg, len;
 
-static VALUE
-rb_ary_fetch(int argc, VALUE *argv, VALUE ary)
-{
-    VALUE pos, ifnone;
-    long block_given;
-    long idx;
-
-    rb_scan_args(argc, argv, "11", &pos, &ifnone);
-    block_given = rb_block_given_p();
-    if (block_given && argc == 2) {
-	rb_warn("block supersedes default value argument");
+    if (rb_scan_args(argc, argv, "11", &arg1, &arg2) == 2) {
+	beg = NUM2INT(arg1);
+	len = NUM2INT(arg2);
+	if (len <= 0) {
+	    return ary_new();
+	}
+	return ary_subseq(ary, beg, len);
     }
-    idx = NUM2LONG(pos);
 
-    if (idx < 0) {
-	idx +=  RARRAY_LEN(ary);
+    /* special case - speeding up */
+    if (FIXNUM_P(arg1)) {
+	return ary_entry(ary, FIX2INT(arg1));
     }
-    if (idx < 0 || RARRAY_LEN(ary) <= idx) {
-	if (block_given) return rb_yield(pos);
-	if (argc == 1) {
-	    rb_raise(rb_eIndexError, "index %ld outside of array bounds: %ld...%ld",
-			idx - (idx < 0 ? RARRAY_LEN(ary) : 0), -RARRAY_LEN(ary), RARRAY_LEN(ary));
+    else {
+	/* check if idx is Range */
+	if (beg_len(arg1, &beg, &len, RARRAY(ary)->len)) {
+	    return ary_subseq(ary, beg, len);
 	}
-	return ifnone;
     }
-    return RARRAY_AREF(ary, idx);
+    if (TYPE(arg1) == T_BIGNUM) {
+	IndexError("index too big");
+    }
+    return ary_entry(ary, NUM2INT(arg1));
 }
 
-/*
- *  call-seq:
- *     ary.find_index(obj)             ->  int or nil
- *     ary.find_index { |item| block } ->  int or nil
- *     ary.find_index                  ->  Enumerator
- *     ary.index(obj)             ->  int or nil
- *     ary.index { |item| block } ->  int or nil
- *     ary.index                  ->  Enumerator
- *
- *  Returns the _index_ of the first object in +ary+ such that the object is
- *  <code>==</code> to +obj+.
- *
- *  If a block is given instead of an argument, returns the _index_ of the
- *  first object for which the block returns +true+.  Returns +nil+ if no
- *  match is found.
- *
- *  See also Array#rindex.
- *
- *  An Enumerator is returned if neither a block nor argument is given.
- *
- *     a = [ "a", "b", "c" ]
- *     a.index("b")              #=> 1
- *     a.index("z")              #=> nil
- *     a.index { |x| x == "b" }  #=> 1
- */
-
 static VALUE
-rb_ary_index(int argc, VALUE *argv, VALUE ary)
-{
-    const VALUE *ptr;
+ary_index(ary, val)
+    VALUE ary;
     VALUE val;
-    long i, len;
+{
+    int i;
 
-    if (argc == 0) {
-	RETURN_ENUMERATOR(ary, 0, 0);
-	for (i=0; i<RARRAY_LEN(ary); i++) {
-	    if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
-		return LONG2NUM(i);
-	    }
-	}
-	return Qnil;
-    }
-    rb_check_arity(argc, 0, 1);
-    val = argv[0];
-    if (rb_block_given_p())
-	rb_warn("given block not used");
-    len = RARRAY_LEN(ary);
-    ptr = RARRAY_CONST_PTR(ary);
-    for (i=0; i<len; i++) {
-	VALUE e = ptr[i];
-	switch (rb_equal_opt(e, val)) {
-	  case Qundef:
-	    if (!rb_equal(e, val)) break;
-	  case Qtrue:
-	    return LONG2NUM(i);
-	  case Qfalse:
-	    continue;
-	}
-	len = RARRAY_LEN(ary);
-	ptr = RARRAY_CONST_PTR(ary);
+    for (i=0; i<RARRAY(ary)->len; i++) {
+	if (rb_equal(RARRAY(ary)->ptr[i], val))
+	    return INT2FIX(i);
     }
     return Qnil;
 }
 
-/*
- *  call-seq:
- *     ary.rindex(obj)             ->  int or nil
- *     ary.rindex { |item| block } ->  int or nil
- *     ary.rindex                  ->  Enumerator
- *
- *  Returns the _index_ of the last object in +self+ <code>==</code> to +obj+.
- *
- *  If a block is given instead of an argument, returns the _index_ of the
- *  first object for which the block returns +true+, starting from the last
- *  object.
- *
- *  Returns +nil+ if no match is found.
- *
- *  See also Array#index.
- *
- *  If neither block nor argument is given, an Enumerator is returned instead.
- *
- *     a = [ "a", "b", "b", "b", "c" ]
- *     a.rindex("b")             #=> 3
- *     a.rindex("z")             #=> nil
- *     a.rindex { |x| x == "b" } #=> 3
- */
-
 static VALUE
-rb_ary_rindex(int argc, VALUE *argv, VALUE ary)
-{
-    const VALUE *ptr;
+ary_rindex(ary, val)
+    VALUE ary;
     VALUE val;
-    long i = RARRAY_LEN(ary), len;
+{
+    int i = RARRAY(ary)->len;
 
-    if (argc == 0) {
-	RETURN_ENUMERATOR(ary, 0, 0);
-	while (i--) {
-	    if (RTEST(rb_yield(RARRAY_AREF(ary, i))))
-		return LONG2NUM(i);
-	    if (i > (len = RARRAY_LEN(ary))) {
-		i = len;
-	    }
-	}
-	return Qnil;
-    }
-    rb_check_arity(argc, 0, 1);
-    val = argv[0];
-    if (rb_block_given_p())
-	rb_warn("given block not used");
-    ptr = RARRAY_CONST_PTR(ary);
     while (i--) {
-	VALUE e = ptr[i];
-	switch (rb_equal_opt(e, val)) {
-	  case Qundef:
-	    if (!rb_equal(e, val)) break;
-	  case Qtrue:
-	    return LONG2NUM(i);
-	  case Qfalse:
-	    continue;
-	}
-	if (i > (len = RARRAY_LEN(ary))) {
-	    i = len;
-	}
-	ptr = RARRAY_CONST_PTR(ary);
+	if (rb_equal(RARRAY(ary)->ptr[i], val))
+	    return INT2FIX(i);
     }
     return Qnil;
 }
 
-VALUE
-rb_ary_to_ary(VALUE obj)
+static VALUE
+ary_indexes(argc, argv, ary)
+    int argc;
+    VALUE *argv;
+    VALUE ary;
 {
-    VALUE tmp = rb_check_array_type(obj);
+    VALUE new_ary;
+    int i;
 
-    if (!NIL_P(tmp)) return tmp;
-    return rb_ary_new3(1, obj);
+    new_ary = ary_new2(argc);
+    for (i=0; i<argc; i++) {
+	ary_store(new_ary, i, ary_entry(ary, NUM2INT(argv[i])));
+    }
+
+    return new_ary;
 }
 
 static void
-rb_ary_splice(VALUE ary, long beg, long len, VALUE rpl)
+ary_replace(ary, beg, len, rpl)
+    VALUE ary, rpl;
+    int beg, len;
 {
-    long rlen;
-    long olen;
-
-    if (len < 0) rb_raise(rb_eIndexError, "negative length (%ld)", len);
-    olen = RARRAY_LEN(ary);
-    if (beg < 0) {
-	beg += olen;
-	if (beg < 0) {
-	    rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
-		     beg - olen, -olen);
-	}
-    }
-    if (olen < len || olen < beg + len) {
-	len = olen - beg;
-    }
-
-    if (rpl == Qundef) {
-	rlen = 0;
+    ary_modify(ary);
+    if (TYPE(rpl) != T_ARRAY) {
+	rpl = rb_Array(rpl);
     }
-    else {
-	rpl = rb_ary_to_ary(rpl);
-	rlen = RARRAY_LEN(rpl);
-	olen = RARRAY_LEN(ary);	/* ary may be resized in rpl.to_ary too */
+    if (beg < 0) {
+	beg = RARRAY(ary)->len + beg;
+	if (beg < 0) beg = 0;
     }
-    if (beg >= olen) {
-	VALUE target_ary;
-	if (beg > ARY_MAX_SIZE - rlen) {
-	    rb_raise(rb_eIndexError, "index %ld too big", beg);
+    if (beg >= RARRAY(ary)->len) {
+	len = beg + RARRAY(rpl)->len;
+	if (len >= RARRAY(ary)->capa) {
+	    RARRAY(ary)->capa=len;
+	    REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->capa);
 	}
-	target_ary = ary_ensure_room_for_push(ary, rlen-len); /* len is 0 or negative */
-	len = beg + rlen;
-	ary_mem_clear(ary, olen, beg - olen);
-	if (rlen > 0) {
-	    ary_memcpy0(ary, beg, rlen, RARRAY_CONST_PTR(rpl), target_ary);
-	}
-	ARY_SET_LEN(ary, len);
+	memclear(RARRAY(ary)->ptr+RARRAY(ary)->len, beg-RARRAY(ary)->len);
+	MEMCPY(RARRAY(ary)->ptr+beg, RARRAY(rpl)->ptr, VALUE, RARRAY(rpl)->len);
+	RARRAY(ary)->len = len;
     }
     else {
-	long alen;
+	int alen;
 
-	if (olen - len > ARY_MAX_SIZE - rlen) {
-	    rb_raise(rb_eIndexError, "index %ld too big", olen + rlen - len);
+	if (beg + len > RARRAY(ary)->len) {
+	    len = RARRAY(ary)->len - beg;
 	}
-	rb_ary_modify(ary);
-	alen = olen + rlen - len;
-	if (alen >= ARY_CAPA(ary)) {
-	    ary_double_capa(ary, alen);
+	if (len < 0) {
+	    IndexError("negative length %d", RARRAY(ary)->len);
 	}
 
-	if (len != rlen) {
-	    RARRAY_PTR_USE(ary, ptr,
-			   MEMMOVE(ptr + beg + rlen, ptr + beg + len,
-				   VALUE, olen - (beg + len)));
-	    ARY_SET_LEN(ary, alen);
-	}
-	if (rlen > 0) {
-	    MEMMOVE(RARRAY_PTR(ary) + beg, RARRAY_CONST_PTR(rpl), VALUE, rlen);
+	alen = RARRAY(ary)->len + RARRAY(rpl)->len - len;
+	if (alen >= RARRAY(ary)->capa) {
+	    RARRAY(ary)->capa=alen;
+	    REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->capa);
 	}
-    }
-    RB_GC_GUARD(rpl);
-}
-
-void
-rb_ary_set_len(VALUE ary, long len)
-{
-    long capa;
-
-    rb_ary_modify_check(ary);
-    if (ARY_SHARED_P(ary)) {
-	rb_raise(rb_eRuntimeError, "can't set length of shared ");
-    }
-    if (len > (capa = (long)ARY_CAPA(ary))) {
-	rb_bug("probable buffer overflow: %ld for %ld", len, capa);
-    }
-    ARY_SET_LEN(ary, len);
-}
-
-/*!
- * expands or shrinks \a ary to \a len elements.
- * expanded region will be filled with Qnil.
- * \param ary  an array
- * \param len  new size
- * \return     \a ary
- * \post       the size of \a ary is \a len.
- */
-VALUE
-rb_ary_resize(VALUE ary, long len)
-{
-    long olen;
 
-    rb_ary_modify(ary);
-    olen = RARRAY_LEN(ary);
-    if (len == olen) return ary;
-    if (len > ARY_MAX_SIZE) {
-	rb_raise(rb_eIndexError, "index %ld too big", len);
-    }
-    if (len > olen) {
-	if (len >= ARY_CAPA(ary)) {
-	    ary_double_capa(ary, len);
-	}
-	ary_mem_clear(ary, olen, len - olen);
-	ARY_SET_LEN(ary, len);
-    }
-    else if (ARY_EMBED_P(ary)) {
-        ARY_SET_EMBED_LEN(ary, len);
-    }
-    else if (len <= RARRAY_EMBED_LEN_MAX) {
-	VALUE tmp[RARRAY_EMBED_LEN_MAX];
-	MEMCPY(tmp, ARY_HEAP_PTR(ary), VALUE, len);
-	ary_discard(ary);
-	MEMCPY((VALUE *)ARY_EMBED_PTR(ary), tmp, VALUE, len); /* WB: no new reference */
-        ARY_SET_EMBED_LEN(ary, len);
-    }
-    else {
-	if (olen > len + ARY_DEFAULT_SIZE) {
-	    SIZED_REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, len, RARRAY(ary)->as.heap.aux.capa);
-	    ARY_SET_CAPA(ary, len);
+	if (len != RARRAY(rpl)->len) {
+	    MEMMOVE(RARRAY(ary)->ptr+beg+RARRAY(rpl)->len, RARRAY(ary)->ptr+beg+len,
+		    VALUE, RARRAY(ary)->len-(beg+len));
+	    RARRAY(ary)->len = alen;
 	}
-	ARY_SET_HEAP_LEN(ary, len);
+	MEMCPY(RARRAY(ary)->ptr+beg, RARRAY(rpl)->ptr, VALUE, RARRAY(rpl)->len);
     }
-    return ary;
 }
 
-/*
- *  call-seq:
- *     ary[index]         = obj                      ->  obj
- *     ary[start, length] = obj or other_ary or nil  ->  obj or other_ary or nil
- *     ary[range]         = obj or other_ary or nil  ->  obj or other_ary or nil
- *
- *  Element Assignment --- Sets the element at +index+, or replaces a subarray
- *  from the +start+ index for +length+ elements, or replaces a subarray
- *  specified by the +range+ of indices.
- *
- *  If indices are greater than the current capacity of the array, the array
- *  grows automatically.  Elements are inserted into the array at +start+ if
- *  +length+ is zero.
- *
- *  Negative indices will count backward from the end of the array.  For
- *  +start+ and +range+ cases the starting index is just before an element.
- *
- *  An IndexError is raised if a negative index points past the beginning of
- *  the array.
- *
- *  See also Array#push, and Array#unshift.
- *
- *     a = Array.new
- *     a[4] = "4";                 #=> [nil, nil, nil, nil, "4"]
- *     a[0, 3] = [ 'a', 'b', 'c' ] #=> ["a", "b", "c", nil, "4"]
- *     a[1..2] = [ 1, 2 ]          #=> ["a", 1, 2, nil, "4"]
- *     a[0, 2] = "?"               #=> ["?", 2, nil, "4"]
- *     a[0..2] = "A"               #=> ["A", "4"]
- *     a[-1]   = "Z"               #=> ["A", "Z"]
- *     a[1..-1] = nil              #=> ["A", nil]
- *     a[1..-1] = []               #=> ["A"]
- *     a[0, 0] = [ 1, 2 ]          #=> [1, 2, "A"]
- *     a[3, 0] = "B"               #=> [1, 2, "A", "B"]
- */
-
 static VALUE
-rb_ary_aset(int argc, VALUE *argv, VALUE ary)
+ary_aset(argc, argv, ary)
+    int argc;
+    VALUE *argv;
+    VALUE ary;
 {
-    long offset, beg, len;
-
-    if (argc == 3) {
-	rb_ary_modify_check(ary);
-	beg = NUM2LONG(argv[0]);
-	len = NUM2LONG(argv[1]);
-	rb_ary_splice(ary, beg, len, argv[2]);
-	return argv[2];
+    VALUE arg1, arg2, arg3;
+    int offset;
+    int beg, len;
+
+    if (rb_scan_args(argc, argv, "21", &arg1, &arg2, &arg3) == 3) {
+	beg = NUM2INT(arg1);
+	len = NUM2INT(arg2);
+	ary_replace(ary, beg, len, arg3);
+	return arg3;
     }
-    rb_check_arity(argc, 2, 2);
-    rb_ary_modify_check(ary);
-    if (FIXNUM_P(argv[0])) {
-	offset = FIX2LONG(argv[0]);
+    else if (FIXNUM_P(arg1)) {
+	offset = FIX2INT(arg1);
 	goto fixnum;
     }
-    if (rb_range_beg_len(argv[0], &beg, &len, RARRAY_LEN(ary), 1)) {
+    else if (beg_len(arg1, &beg, &len, RARRAY(ary)->len)) {
 	/* check if idx is Range */
-	rb_ary_splice(ary, beg, len, argv[1]);
-	return argv[1];
-    }
-
-    offset = NUM2LONG(argv[0]);
-fixnum:
-    rb_ary_store(ary, offset, argv[1]);
-    return argv[1];
-}
-
-/*
- *  call-seq:
- *     ary.insert(index, obj...)  -> ary
- *
- *  Inserts the given values before the element with the given +index+.
- *
- *  Negative indices count backwards from the end of the array, where +-1+ is
- *  the last element. If a negative index is used, the given values will be
- *  inserted after that element, so using an index of +-1+ will insert the
- *  values at the end of the array.
- *
- *     a = %w{ a b c d }
- *     a.insert(2, 99)         #=> ["a", "b", 99, "c", "d"]
- *     a.insert(-2, 1, 2, 3)   #=> ["a", "b", 99, "c", 1, 2, 3, "d"]
- */
-
-static VALUE
-rb_ary_insert(int argc, VALUE *argv, VALUE ary)
-{
-    long pos;
-
-    rb_check_arity(argc, 1, UNLIMITED_ARGUMENTS);
-    rb_ary_modify_check(ary);
-    if (argc == 1) return ary;
-    pos = NUM2LONG(argv[0]);
-    if (pos == -1) {
-	pos = RARRAY_LEN(ary);
+	ary_replace(ary, beg, len, arg2);
+	return arg2;
     }
-    if (pos < 0) {
-	pos++;
+    if (TYPE(arg1) == T_BIGNUM) {
+	IndexError("index too big");
     }
-    rb_ary_splice(ary, pos, 0, rb_ary_new4(argc - 1, argv + 1));
-    return ary;
-}
 
-static VALUE
-rb_ary_length(VALUE ary);
-
-static VALUE
-ary_enum_length(VALUE ary, VALUE args, VALUE eobj)
-{
-    return rb_ary_length(ary);
+    offset = NUM2INT(arg1);
+  fixnum:
+    if (offset < 0) {
+	offset = RARRAY(ary)->len + offset;
+    }
+    ary_store(ary, offset, arg2);
+    return arg2;
 }
 
-/*
- *  call-seq:
- *     ary.each { |item| block }  -> ary
- *     ary.each                   -> Enumerator
- *
- *  Calls the given block once for each element in +self+, passing that element
- *  as a parameter.  Returns the array itself.
- *
- *  If no block is given, an Enumerator is returned.
- *
- *     a = [ "a", "b", "c" ]
- *     a.each {|x| print x, " -- " }
- *
- *  produces:
- *
- *     a -- b -- c --
- */
-
 VALUE
-rb_ary_each(VALUE ary)
+ary_each(ary)
+    VALUE ary;
 {
-    long i;
+    int i;
 
-    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
-    for (i=0; i<RARRAY_LEN(ary); i++) {
-	rb_yield(RARRAY_AREF(ary, i));
+    for (i=0; i<RARRAY(ary)->len; i++) {
+	rb_yield(RARRAY(ary)->ptr[i]);
     }
-    return ary;
+    return Qnil;
 }
 
-/*
- *  call-seq:
- *     ary.each_index { |index| block }  -> ary
- *     ary.each_index                    -> Enumerator
- *
- *  Same as Array#each, but passes the +index+ of the element instead of the
- *  element itself.
- *
- *  An Enumerator is returned if no block is given.
- *
- *     a = [ "a", "b", "c" ]
- *     a.each_index {|x| print x, " -- " }
- *
- *  produces:
- *
- *     0 -- 1 -- 2 --
- */
-
 static VALUE
-rb_ary_each_index(VALUE ary)
+ary_each_index(ary)
+    VALUE ary;
 {
-    long i;
-    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
+    int i;
 
-    for (i=0; i<RARRAY_LEN(ary); i++) {
-	rb_yield(LONG2NUM(i));
+    for (i=0; i<RARRAY(ary)->len; i++) {
+	rb_yield(INT2FIX(i));
     }
-    return ary;
+    return Qnil;
 }
 
-/*
- *  call-seq:
- *     ary.reverse_each { |item| block }  -> ary
- *     ary.reverse_each                   -> Enumerator
- *
- *  Same as Array#each, but traverses +self+ in reverse order.
- *
- *     a = [ "a", "b", "c" ]
- *     a.reverse_each {|x| print x, " " }
- *
- *  produces:
- *
- *     c b a
- */
-
 static VALUE
-rb_ary_reverse_each(VALUE ary)
+ary_reverse_each(ary)
+    VALUE ary;
 {
-    long len;
+    int len = RARRAY(ary)->len;
 
-    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
-    len = RARRAY_LEN(ary);
     while (len--) {
-	long nlen;
-	rb_yield(RARRAY_AREF(ary, len));
-	nlen = RARRAY_LEN(ary);
-	if (nlen < len) {
-	    len = nlen;
-	}
+	rb_yield(RARRAY(ary)->ptr[len]);
     }
-    return ary;
+    return Qnil;
 }
 
-/*
- *  call-seq:
- *     ary.length -> int
- *
- *  Returns the number of elements in +self+. May be zero.
- *
- *     [ 1, 2, 3, 4, 5 ].length   #=> 5
- *     [].length                  #=> 0
- */
-
 static VALUE
-rb_ary_length(VALUE ary)
+ary_length(ary)
+    VALUE ary;
 {
-    long len = RARRAY_LEN(ary);
-    return LONG2NUM(len);
+    return INT2FIX(RARRAY(ary)->len);
 }
 
-/*
- *  call-seq:
- *     ary.empty?   -> true or false
- *
- *  Returns +true+ if +self+ contains no elements.
- *
- *     [].empty?   #=> true
- */
-
 static VALUE
-rb_ary_empty_p(VALUE ary)
+ary_empty_p(ary)
+    VALUE ary;
 {
-    if (RARRAY_LEN(ary) == 0)
-	return Qtrue;
-    return Qfalse;
+    if (RARRAY(ary)->len == 0)
+	return TRUE;
+    return FALSE;
 }
 
-VALUE
-rb_ary_dup(VALUE ary)
+static VALUE
+ary_clone(ary)
+    VALUE ary;
 {
-    long len = RARRAY_LEN(ary);
-    VALUE dup = rb_ary_new2(len);
-    ary_memcpy(dup, 0, len, RARRAY_CONST_PTR(ary));
-    ARY_SET_LEN(dup, len);
-    return dup;
-}
+    VALUE ary2 = ary_new2(RARRAY(ary)->len);
 
-VALUE
-rb_ary_resurrect(VALUE ary)
-{
-    return rb_ary_new4(RARRAY_LEN(ary), RARRAY_CONST_PTR(ary));
+    CLONESETUP(ary2, ary);
+    MEMCPY(RARRAY(ary2)->ptr, RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
+    RARRAY(ary2)->len = RARRAY(ary)->len;
+    return ary2;
 }
 
-extern VALUE rb_output_fs;
-
-static void ary_join_1(VALUE obj, VALUE ary, VALUE sep, long i, VALUE result, int *first);
-
 static VALUE
-recursive_join(VALUE obj, VALUE argp, int recur)
+ary_dup(ary)
+    VALUE ary;
 {
-    VALUE *arg = (VALUE *)argp;
-    VALUE ary = arg[0];
-    VALUE sep = arg[1];
-    VALUE result = arg[2];
-    int *first = (int *)arg[3];
-
-    if (recur) {
-	rb_raise(rb_eArgError, "recursive array join");
-    }
-    else {
-	ary_join_1(obj, ary, sep, 0, result, first);
-    }
-    return Qnil;
+    return ary_new4(RARRAY(ary)->len, RARRAY(ary)->ptr);
 }
 
-static void
-ary_join_0(VALUE ary, VALUE sep, long max, VALUE result)
+static VALUE
+to_ary(ary)
+    VALUE ary;
 {
-    long i;
-    VALUE val;
-
-    if (max > 0) rb_enc_copy(result, RARRAY_AREF(ary, 0));
-    for (i=0; i<max; i++) {
-	val = RARRAY_AREF(ary, i);
-	if (i > 0 && !NIL_P(sep))
-	    rb_str_buf_append(result, sep);
-	rb_str_buf_append(result, val);
-	if (OBJ_TAINTED(val)) OBJ_TAINT(result);
-    }
+    return rb_convert_type(ary, T_ARRAY, "Array", "to_ary");
 }
 
-static void
-ary_join_1(VALUE obj, VALUE ary, VALUE sep, long i, VALUE result, int *first)
-{
-    VALUE val, tmp;
-
-    for (; i<RARRAY_LEN(ary); i++) {
-	if (i > 0 && !NIL_P(sep))
-	    rb_str_buf_append(result, sep);
-
-	val = RARRAY_AREF(ary, i);
-	if (RB_TYPE_P(val, T_STRING)) {
-	  str_join:
-	    rb_str_buf_append(result, val);
-	    *first = FALSE;
-	}
-	else if (RB_TYPE_P(val, T_ARRAY)) {
-	    obj = val;
-	  ary_join:
-	    if (val == ary) {
-		rb_raise(rb_eArgError, "recursive array join");
-	    }
-	    else {
-		VALUE args[4];
-
-		args[0] = val;
-		args[1] = sep;
-		args[2] = result;
-		args[3] = (VALUE)first;
-		rb_exec_recursive(recursive_join, obj, (VALUE)args);
-	    }
-	}
-	else {
-	    tmp = rb_check_string_type(val);
-	    if (!NIL_P(tmp)) {
-		val = tmp;
-		goto str_join;
-	    }
-	    tmp = rb_check_convert_type(val, T_ARRAY, "Array", "to_ary");
-	    if (!NIL_P(tmp)) {
-		obj = val;
-		val = tmp;
-		goto ary_join;
-	    }
-	    val = rb_obj_as_string(val);
-	    if (*first) {
-		rb_enc_copy(result, val);
-		*first = FALSE;
-	    }
-	    goto str_join;
-	}
-    }
-}
+extern VALUE OFS;
 
 VALUE
-rb_ary_join(VALUE ary, VALUE sep)
+ary_join(ary, sep)
+    VALUE ary;
+    VALUE sep;
 {
-    long len = 1, i;
-    int taint = FALSE;
-    VALUE val, tmp, result;
-
-    if (RARRAY_LEN(ary) == 0) return rb_usascii_str_new(0, 0);
-    if (OBJ_TAINTED(ary)) taint = TRUE;
+    int i;
+    VALUE result, tmp;
+    if (RARRAY(ary)->len == 0) return str_new(0, 0);
 
-    if (!NIL_P(sep)) {
-	StringValue(sep);
-	len += RSTRING_LEN(sep) * (RARRAY_LEN(ary) - 1);
+    switch (TYPE(RARRAY(ary)->ptr[0])) {
+      case T_STRING:
+	result = str_dup(RARRAY(ary)->ptr[0]);
+	break;
+      case T_ARRAY:
+	result = ary_join(RARRAY(ary)->ptr[0], sep);
+	break;
+      default:
+	result = obj_as_string(RARRAY(ary)->ptr[0]);
+	break;
     }
-    for (i=0; i<RARRAY_LEN(ary); i++) {
-	val = RARRAY_AREF(ary, i);
-	tmp = rb_check_string_type(val);
-
-	if (NIL_P(tmp) || tmp != val) {
-	    int first;
-	    result = rb_str_buf_new(len + (RARRAY_LEN(ary)-i)*10);
-	    rb_enc_associate(result, rb_usascii_encoding());
-	    if (taint) OBJ_TAINT(result);
-	    ary_join_0(ary, sep, i, result);
-	    first = i == 0;
-	    ary_join_1(ary, ary, sep, i, result, &first);
-	    return result;
-	}
 
-	len += RSTRING_LEN(tmp);
+    for (i=1; i<RARRAY(ary)->len; i++) {
+	tmp = RARRAY(ary)->ptr[i];
+	switch (TYPE(tmp)) {
+	  case T_STRING:
+	    break;
+	  case T_ARRAY:
+	    tmp = ary_join(tmp, sep);
+	    break;
+	  default:
+	    tmp = obj_as_string(tmp);
+	}
+	if (!NIL_P(sep)) str_concat(result, sep);
+	str_cat(result, RSTRING(tmp)->ptr, RSTRING(tmp)->len);
+	if (str_tainted(tmp)) str_taint(result);
     }
 
-    result = rb_str_buf_new(len);
-    if (taint) OBJ_TAINT(result);
-    ary_join_0(ary, sep, RARRAY_LEN(ary), result);
-
     return result;
 }
 
-/*
- *  call-seq:
- *     ary.join(separator=$,)    -> str
- *
- *  Returns a string created by converting each element of the array to
- *  a string, separated by the given +separator+.
- *  If the +separator+ is +nil+, it uses current $,.
- *  If both the +separator+ and $, are nil, it uses empty string.
- *
- *     [ "a", "b", "c" ].join        #=> "abc"
- *     [ "a", "b", "c" ].join("-")   #=> "a-b-c"
- */
-
 static VALUE
-rb_ary_join_m(int argc, VALUE *argv, VALUE ary)
+ary_join_method(argc, argv, ary)
+    int argc;
+    VALUE *argv;
+    VALUE ary;
 {
     VALUE sep;
 
     rb_scan_args(argc, argv, "01", &sep);
-    if (NIL_P(sep)) sep = rb_output_fs;
+    if (NIL_P(sep)) sep = OFS;
 
-    return rb_ary_join(ary, sep);
+    return ary_join(ary, sep);
 }
 
-static VALUE
-inspect_ary(VALUE ary, VALUE dummy, int recur)
+VALUE
+ary_to_s(ary)
+    VALUE ary;
 {
-    int tainted = OBJ_TAINTED(ary);
-    long i;
-    VALUE s, str;
-
-    if (recur) return rb_usascii_str_new_cstr("[...]");
-    str = rb_str_buf_new2("[");
-    for (i=0; i<RARRAY_LEN(ary); i++) {
-	s = rb_inspect(RARRAY_AREF(ary, i));
-	if (OBJ_TAINTED(s)) tainted = TRUE;
-	if (i > 0) rb_str_buf_cat2(str, ", ");
-	else rb_enc_copy(str, s);
-	rb_str_buf_append(str, s);
-    }
-    rb_str_buf_cat2(str, "]");
-    if (tainted) OBJ_TAINT(str);
+    VALUE str = ary_join(ary, OFS);
+    if (NIL_P(str)) return str_new(0, 0);
     return str;
 }
 
-/*
- *  call-seq:
- *     ary.inspect  -> string
- *     ary.to_s     -> string
- *
- *  Creates a string representation of +self+.
- *
- *     [ "a", "b", "c" ].to_s     #=> "[\"a\", \"b\", \"c\"]"
- */
-
 static VALUE
-rb_ary_inspect(VALUE ary)
-{
-    if (RARRAY_LEN(ary) == 0) return rb_usascii_str_new2("[]");
-    return rb_exec_recursive(inspect_ary, ary, 0);
-}
-
-VALUE
-rb_ary_to_s(VALUE ary)
+ary_inspect(ary)
+    VALUE ary;
 {
-    return rb_ary_inspect(ary);
-}
+    int i, len;
+    VALUE s, str;
 
-/*
- *  call-seq:
- *     ary.to_a     -> ary
- *
- *  Returns +self+.
- *
- *  If called on a subclass of Array, converts the receiver to an Array object.
- */
+    if (RARRAY(ary)->len == 0) return str_new2("[]");
+    str = str_new2("[");
+    len = 1;
 
-static VALUE
-rb_ary_to_a(VALUE ary)
-{
-    if (rb_obj_class(ary) != rb_cArray) {
-	VALUE dup = rb_ary_new2(RARRAY_LEN(ary));
-	rb_ary_replace(dup, ary);
-	return dup;
+    for (i=0; i<RARRAY(ary)->len; i++) {
+	s = rb_inspect(RARRAY(ary)->ptr[i]);
+	if (i > 0) str_cat(str, ", ", 2);
+	str_cat(str, RSTRING(s)->ptr, RSTRING(s)->len);
+	len += RSTRING(s)->len + 2;
     }
-    return ary;
-}
+    str_cat(str, "]", 1);
 
-/*
- *  call-seq:
- *     ary.to_h     -> hash
- *
- *  Returns the result of interpreting <i>ary</i> as an array of
- *  <tt>[key, value]</tt> pairs.
- *
- *     [[:foo, :bar], [1, 2]].to_h
- *       # => {:foo => :bar, 1 => 2}
- */
-
-static VALUE
-rb_ary_to_h(VALUE ary)
-{
-    long i;
-    VALUE hash = rb_hash_new();
-    for (i=0; i<RARRAY_LEN(ary); i++) {
-	const VALUE elt = rb_ary_elt(ary, i);
-	const VALUE key_value_pair = rb_check_array_type(elt);
-	if (NIL_P(key_value_pair)) {
-	    rb_raise(rb_eTypeError, "wrong element type %"PRIsVALUE" at %ld (expected array)",
-		     rb_obj_class(elt), i);
-	}
-	if (RARRAY_LEN(key_value_pair) != 2) {
-	    rb_raise(rb_eArgError, "wrong array length at %ld (expected 2, was %ld)",
-		i, RARRAY_LEN(key_value_pair));
-	}
-	rb_hash_aset(hash, RARRAY_AREF(key_value_pair, 0), RARRAY_AREF(key_value_pair, 1));
-    }
-    return hash;
+    return str;
 }
 
-/*
- *  call-seq:
- *     ary.to_ary -> ary
- *
- *  Returns +self+.
- */
-
 static VALUE
-rb_ary_to_ary_m(VALUE ary)
+ary_to_a(ary)
+    VALUE ary;
 {
     return ary;
 }
 
-static void
-ary_reverse(VALUE *p1, VALUE *p2)
-{
-    while (p1 < p2) {
-	VALUE tmp = *p1;
-	*p1++ = *p2;
-	*p2-- = tmp;
-    }
-}
-
 VALUE
-rb_ary_reverse(VALUE ary)
-{
-    VALUE *p2;
-    long len = RARRAY_LEN(ary);
-
-    rb_ary_modify(ary);
-    if (len > 1) {
-	RARRAY_PTR_USE(ary, p1, {
-	    p2 = p1 + len - 1;	/* points last item */
-	    ary_reverse(p1, p2);
-	}); /* WB: no new reference */
-    }
-    return ary;
-}
-
-/*
- *  call-seq:
- *     ary.reverse!   -> ary
- *
- *  Reverses +self+ in place.
- *
- *     a = [ "a", "b", "c" ]
- *     a.reverse!       #=> ["c", "b", "a"]
- *     a                #=> ["c", "b", "a"]
- */
-
-static VALUE
-rb_ary_reverse_bang(VALUE ary)
-{
-    return rb_ary_reverse(ary);
-}
-
-/*
- *  call-seq:
- *     ary.reverse    -> new_ary
- *
- *  Returns a new array containing +self+'s elements in reverse order.
- *
- *     [ "a", "b", "c" ].reverse   #=> ["c", "b", "a"]
- *     [ 1 ].reverse               #=> [1]
- */
-
-static VALUE
-rb_ary_reverse_m(VALUE ary)
+ary_reverse(ary)
+    VALUE ary;
 {
-    long len = RARRAY_LEN(ary);
-    VALUE dup = rb_ary_new2(len);
+    VALUE *p1, *p2;
+    VALUE tmp;
 
-    if (len > 0) {
-	const VALUE *p1 = RARRAY_CONST_PTR(ary);
-	VALUE *p2 = (VALUE *)RARRAY_CONST_PTR(dup) + len - 1;
-	do *p2-- = *p1++; while (--len > 0);
-    }
-    ARY_SET_LEN(dup, RARRAY_LEN(ary));
-    return dup;
-}
+    if (RARRAY(ary)->len == 0) return ary;
 
-static inline long
-rotate_count(long cnt, long len)
-{
-    return (cnt < 0) ? (len - (~cnt % len) - 1) : (cnt % len);
-}
+    p1 = RARRAY(ary)->ptr;
+    p2 = p1 + RARRAY(ary)->len - 1;	/* points last item */
 
-VALUE
-rb_ary_rotate(VALUE ary, long cnt)
-{
-    rb_ary_modify(ary);
-
-    if (cnt != 0) {
-	VALUE *ptr = RARRAY_PTR(ary);
-	long len = RARRAY_LEN(ary);
-
-	if (len > 0 && (cnt = rotate_count(cnt, len)) > 0) {
-	    --len;
-	    if (cnt < len) ary_reverse(ptr + cnt, ptr + len);
-	    if (--cnt > 0) ary_reverse(ptr, ptr + cnt);
-	    if (len > 0) ary_reverse(ptr, ptr + len);
-	    return ary;
-	}
+    while (p1 < p2) {
+	tmp = *p1;
+	*p1 = *p2;
+	*p2 = tmp;
+	p1++; p2--;
     }
 
-    return Qnil;
-}
-
-/*
- *  call-seq:
- *     ary.rotate!(count=1)   -> ary
- *
- *  Rotates +self+ in place so that the element at +count+ comes first, and
- *  returns +self+.
- *
- *  If +count+ is negative then it rotates in the opposite direction, starting
- *  from the end of the array where +-1+ is the last element.
- *
- *     a = [ "a", "b", "c", "d" ]
- *     a.rotate!        #=> ["b", "c", "d", "a"]
- *     a                #=> ["b", "c", "d", "a"]
- *     a.rotate!(2)     #=> ["d", "a", "b", "c"]
- *     a.rotate!(-3)    #=> ["a", "b", "c", "d"]
- */
-
-static VALUE
-rb_ary_rotate_bang(int argc, VALUE *argv, VALUE ary)
-{
-    long n = 1;
-
-    switch (argc) {
-      case 1: n = NUM2LONG(argv[0]);
-      case 0: break;
-      default: rb_scan_args(argc, argv, "01", NULL);
-    }
-    rb_ary_rotate(ary, n);
     return ary;
 }
 
-/*
- *  call-seq:
- *     ary.rotate(count=1)    -> new_ary
- *
- *  Returns a new array by rotating +self+ so that the element at +count+ is
- *  the first element of the new array.
- *
- *  If +count+ is negative then it rotates in the opposite direction, starting
- *  from the end of +self+ where +-1+ is the last element.
- *
- *     a = [ "a", "b", "c", "d" ]
- *     a.rotate         #=> ["b", "c", "d", "a"]
- *     a                #=> ["a", "b", "c", "d"]
- *     a.rotate(2)      #=> ["c", "d", "a", "b"]
- *     a.rotate(-3)     #=> ["b", "c", "d", "a"]
- */
-
 static VALUE
-rb_ary_rotate_m(int argc, VALUE *argv, VALUE ary)
-{
-    VALUE rotated;
-    const VALUE *ptr;
-    long len, cnt = 1;
-
-    switch (argc) {
-      case 1: cnt = NUM2LONG(argv[0]);
-      case 0: break;
-      default: rb_scan_args(argc, argv, "01", NULL);
-    }
-
-    len = RARRAY_LEN(ary);
-    rotated = rb_ary_new2(len);
-    if (len > 0) {
-	cnt = rotate_count(cnt, len);
-	ptr = RARRAY_CONST_PTR(ary);
-	len -= cnt;
-	ary_memcpy(rotated, 0, len, ptr + cnt);
-	ary_memcpy(rotated, len, cnt, ptr);
-    }
-    ARY_SET_LEN(rotated, RARRAY_LEN(ary));
-    return rotated;
-}
-
-struct ary_sort_data {
+ary_reverse_method(ary)
     VALUE ary;
-    int opt_methods;
-    int opt_inited;
-};
-
-enum {
-    sort_opt_Fixnum,
-    sort_opt_String,
-    sort_optimizable_count
-};
-
-#define STRING_P(s) (RB_TYPE_P((s), T_STRING) && CLASS_OF(s) == rb_cString)
-
-#define SORT_OPTIMIZABLE_BIT(type) (1U << TOKEN_PASTE(sort_opt_,type))
-#define SORT_OPTIMIZABLE(data, type) \
-    (((data)->opt_inited & SORT_OPTIMIZABLE_BIT(type)) ? \
-     ((data)->opt_methods & SORT_OPTIMIZABLE_BIT(type)) : \
-     (((data)->opt_inited |= SORT_OPTIMIZABLE_BIT(type)), \
-      rb_method_basic_definition_p(TOKEN_PASTE(rb_c,type), id_cmp) && \
-      ((data)->opt_methods |= SORT_OPTIMIZABLE_BIT(type))))
-
-static VALUE
-sort_reentered(VALUE ary)
 {
-    if (RBASIC(ary)->klass) {
-	rb_raise(rb_eRuntimeError, "sort reentered");
-    }
-    return Qnil;
+    return ary_reverse(ary_dup(ary));
 }
 
+static ID cmp;
+
 static int
-sort_1(const void *ap, const void *bp, void *dummy)
+sort_1(a, b)
+    VALUE *a, *b;
 {
-    struct ary_sort_data *data = dummy;
-    VALUE retval = sort_reentered(data->ary);
-    VALUE a = *(const VALUE *)ap, b = *(const VALUE *)bp;
-    int n;
-
-    retval = rb_yield_values(2, a, b);
-    n = rb_cmpint(retval, a, b);
-    sort_reentered(data->ary);
-    return n;
+    VALUE retval = rb_yield(assoc_new(*a, *b));
+    return NUM2INT(retval);
 }
 
 static int
-sort_2(const void *ap, const void *bp, void *dummy)
+sort_2(a, b)
+    VALUE *a, *b;
 {
-    struct ary_sort_data *data = dummy;
-    VALUE retval = sort_reentered(data->ary);
-    VALUE a = *(const VALUE *)ap, b = *(const VALUE *)bp;
-    int n;
+    VALUE retval;
 
-    if (FIXNUM_P(a) && FIXNUM_P(b) && SORT_OPTIMIZABLE(data, Fixnum)) {
-	if ((long)a > (long)b) return 1;
-	if ((long)a < (long)b) return -1;
-	return 0;
+    if (FIXNUM_P(*a)) {
+	if (FIXNUM_P(*b)) return *a - *b;
     }
-    if (STRING_P(a) && STRING_P(b) && SORT_OPTIMIZABLE(data, String)) {
-	return rb_str_cmp(a, b);
+    else if (TYPE(*a) == T_STRING) {
+	if (TYPE(*b) == T_STRING) return str_cmp(*a, *b);
     }
 
-    retval = rb_funcallv(a, id_cmp, 1, &b);
-    n = rb_cmpint(retval, a, b);
-    sort_reentered(data->ary);
-
-    return n;
+    retval = rb_funcall(*a, cmp, 1, *b);
+    return NUM2INT(retval);
 }
 
-/*
- *  call-seq:
- *     ary.sort!                   -> ary
- *     ary.sort! { |a, b| block }  -> ary
- *
- *  Sorts +self+ in place.
- *
- *  Comparisons for the sort will be done using the <code><=></code> operator
- *  or using an optional code block.
- *
- *  The block must implement a comparison between +a+ and +b+ and return
- *  an integer less than 0 when +b+ follows +a+, +0+ when +a+ and +b+
- *  are equivalent, or an integer greater than 0 when +a+ follows +b+.
- *
- *  See also Enumerable#sort_by.
- *
- *     a = [ "d", "a", "e", "c", "b" ]
- *     a.sort!                    #=> ["a", "b", "c", "d", "e"]
- *     a.sort! { |x,y| y <=> x }  #=> ["e", "d", "c", "b", "a"]
- */
-
 VALUE
-rb_ary_sort_bang(VALUE ary)
-{
-    rb_ary_modify(ary);
-    assert(!ARY_SHARED_P(ary));
-    if (RARRAY_LEN(ary) > 1) {
-	VALUE tmp = ary_make_substitution(ary); /* only ary refers tmp */
-	struct ary_sort_data data;
-	long len = RARRAY_LEN(ary);
-
-	RBASIC_CLEAR_CLASS(tmp);
-	data.ary = tmp;
-	data.opt_methods = 0;
-	data.opt_inited = 0;
-	RARRAY_PTR_USE(tmp, ptr, {
-	    ruby_qsort(ptr, len, sizeof(VALUE),
-		       rb_block_given_p()?sort_1:sort_2, &data);
-	}); /* WB: no new reference */
-	rb_ary_modify(ary);
-        if (ARY_EMBED_P(tmp)) {
-            if (ARY_SHARED_P(ary)) { /* ary might be destructively operated in the given block */
-                rb_ary_unshare(ary);
-		FL_SET_EMBED(ary);
-            }
-	    ary_memcpy(ary, 0, ARY_EMBED_LEN(tmp), ARY_EMBED_PTR(tmp));
-            ARY_SET_LEN(ary, ARY_EMBED_LEN(tmp));
-        }
-        else {
-            if (!ARY_EMBED_P(ary) && ARY_HEAP_PTR(ary) == ARY_HEAP_PTR(tmp)) {
-                FL_UNSET_SHARED(ary);
-                ARY_SET_CAPA(ary, RARRAY_LEN(tmp));
-            }
-            else {
-                assert(!ARY_SHARED_P(tmp));
-                if (ARY_EMBED_P(ary)) {
-                    FL_UNSET_EMBED(ary);
-                }
-                else if (ARY_SHARED_P(ary)) {
-                    /* ary might be destructively operated in the given block */
-                    rb_ary_unshare(ary);
-                }
-                else {
-		    ruby_sized_xfree((void *)ARY_HEAP_PTR(ary), ARY_HEAP_SIZE(ary));
-                }
-                ARY_SET_PTR(ary, RARRAY_CONST_PTR(tmp));
-                ARY_SET_HEAP_LEN(ary, len);
-                ARY_SET_CAPA(ary, RARRAY_LEN(tmp));
-            }
-            /* tmp was lost ownership for the ptr */
-            FL_UNSET(tmp, FL_FREEZE);
-            FL_SET_EMBED(tmp);
-            ARY_SET_EMBED_LEN(tmp, 0);
-            FL_SET(tmp, FL_FREEZE);
-	}
-        /* tmp will be GC'ed. */
-        RBASIC_SET_CLASS_RAW(tmp, rb_cArray); /* rb_cArray must be marked */
-    }
-    return ary;
-}
-
-/*
- *  call-seq:
- *     ary.sort                   -> new_ary
- *     ary.sort { |a, b| block }  -> new_ary
- *
- *  Returns a new array created by sorting +self+.
- *
- *  Comparisons for the sort will be done using the <code><=></code> operator
- *  or using an optional code block.
- *
- *  The block must implement a comparison between +a+ and +b+ and return
- *  an integer less than 0 when +b+ follows +a+, +0+ when +a+ and +b+
- *  are equivalent, or an integer greater than 0 when +a+ follows +b+.
- *
- *
- *  See also Enumerable#sort_by.
- *
- *     a = [ "d", "a", "e", "c", "b" ]
- *     a.sort                    #=> ["a", "b", "c", "d", "e"]
- *     a.sort { |x,y| y <=> x }  #=> ["e", "d", "c", "b", "a"]
- */
-
-VALUE
-rb_ary_sort(VALUE ary)
-{
-    ary = rb_ary_dup(ary);
-    rb_ary_sort_bang(ary);
-    return ary;
-}
-
-static VALUE rb_ary_bsearch_index(VALUE ary);
-
-/*
- *  call-seq:
- *     ary.bsearch {|x| block }  -> elem
- *
- *  By using binary search, finds a value from this array which meets
- *  the given condition in O(log n) where n is the size of the array.
- *
- *  You can use this method in two use cases: a find-minimum mode and
- *  a find-any mode.  In either case, the elements of the array must be
- *  monotone (or sorted) with respect to the block.
- *
- *  In find-minimum mode (this is a good choice for typical use case),
- *  the block must return true or false, and there must be an index i
- *  (0 <= i <= ary.size) so that:
- *
- *  - the block returns false for any element whose index is less than
- *    i, and
- *  - the block returns true for any element whose index is greater
- *    than or equal to i.
- *
- *  This method returns the i-th element.  If i is equal to ary.size,
- *  it returns nil.
- *
- *     ary = [0, 4, 7, 10, 12]
- *     ary.bsearch {|x| x >=   4 } #=> 4
- *     ary.bsearch {|x| x >=   6 } #=> 7
- *     ary.bsearch {|x| x >=  -1 } #=> 0
- *     ary.bsearch {|x| x >= 100 } #=> nil
- *
- *  In find-any mode (this behaves like libc's bsearch(3)), the block
- *  must return a number, and there must be two indices i and j
- *  (0 <= i <= j <= ary.size) so that:
- *
- *  - the block returns a positive number for ary[k] if 0 <= k < i,
- *  - the block returns zero for ary[k] if i <= k < j, and
- *  - the block returns a negative number for ary[k] if
- *    j <= k < ary.size.
- *
- *  Under this condition, this method returns any element whose index
- *  is within i...j.  If i is equal to j (i.e., there is no element
- *  that satisfies the block), this method returns nil.
- *
- *     ary = [0, 4, 7, 10, 12]
- *     # try to find v such that 4 <= v < 8
- *     ary.bsearch {|x| 1 - x / 4 } #=> 4 or 7
- *     # try to find v such that 8 <= v < 10
- *     ary.bsearch {|x| 4 - x / 2 } #=> nil
- *
- *  You must not mix the two modes at a time; the block must always
- *  return either true/false, or always return a number.  It is
- *  undefined which value is actually picked up at each iteration.
- */
-
-static VALUE
-rb_ary_bsearch(VALUE ary)
-{
-    VALUE index_result = rb_ary_bsearch_index(ary);
-
-    if (FIXNUM_P(index_result)) {
-	return rb_ary_entry(ary, FIX2LONG(index_result));
-    }
-    return index_result;
-}
-
-/*
- *  call-seq:
- *     ary.bsearch_index {|x| block }  -> int or nil
- *
- *  By using binary search, finds an index of a value from this array which
- *  meets the given condition in O(log n) where n is the size of the array.
- *
- *  It supports two modes, depending on the nature of the block and they are
- *  exactly the same as in the case of #bsearch method with the only difference
- *  being that this method returns the index of the element instead of the
- *  element itself. For more details consult the documentation for #bsearch.
- */
-
-static VALUE
-rb_ary_bsearch_index(VALUE ary)
-{
-    long low = 0, high = RARRAY_LEN(ary), mid;
-    int smaller = 0, satisfied = 0;
-    VALUE v, val;
-
-    RETURN_ENUMERATOR(ary, 0, 0);
-    while (low < high) {
-	mid = low + ((high - low) / 2);
-	val = rb_ary_entry(ary, mid);
-	v = rb_yield(val);
-	if (FIXNUM_P(v)) {
-	    if (v == INT2FIX(0)) return INT2FIX(mid);
-	    smaller = (SIGNED_VALUE)v < 0; /* Fixnum preserves its sign-bit */
-	}
-	else if (v == Qtrue) {
-	    satisfied = 1;
-	    smaller = 1;
-	}
-	else if (v == Qfalse || v == Qnil) {
-	    smaller = 0;
-	}
-	else if (rb_obj_is_kind_of(v, rb_cNumeric)) {
-	    const VALUE zero = INT2FIX(0);
-	    switch (rb_cmpint(rb_funcallv(v, id_cmp, 1, &zero), v, zero)) {
-	      case 0: return INT2FIX(mid);
-	      case 1: smaller = 1; break;
-	      case -1: smaller = 0;
-	    }
-	}
-	else {
-	    rb_raise(rb_eTypeError, "wrong argument type %"PRIsVALUE
-		     " (must be numeric, true, false or nil)",
-		     rb_obj_class(v));
-	}
-	if (smaller) {
-	    high = mid;
-	}
-	else {
-	    low = mid + 1;
-	}
-    }
-    if (!satisfied) return Qnil;
-    return INT2FIX(low);
-}
-
-
-static VALUE
-sort_by_i(RB_BLOCK_CALL_FUNC_ARGLIST(i, dummy))
-{
-    return rb_yield(i);
-}
-
-/*
- *  call-seq:
- *     ary.sort_by! { |obj| block }    -> ary
- *     ary.sort_by!                    -> Enumerator
- *
- *  Sorts +self+ in place using a set of keys generated by mapping the
- *  values in +self+ through the given block.
- *
- *  If no block is given, an Enumerator is returned instead.
- *
- */
-
-static VALUE
-rb_ary_sort_by_bang(VALUE ary)
-{
-    VALUE sorted;
-
-    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
-    rb_ary_modify(ary);
-    sorted = rb_block_call(ary, rb_intern("sort_by"), 0, 0, sort_by_i, 0);
-    rb_ary_replace(ary, sorted);
-    return ary;
-}
-
-
-/*
- *  call-seq:
- *     ary.collect { |item| block }  -> new_ary
- *     ary.map     { |item| block }  -> new_ary
- *     ary.collect                   -> Enumerator
- *     ary.map                       -> Enumerator
- *
- *  Invokes the given block once for each element of +self+.
- *
- *  Creates a new array containing the values returned by the block.
- *
- *  See also Enumerable#collect.
- *
- *  If no block is given, an Enumerator is returned instead.
- *
- *     a = [ "a", "b", "c", "d" ]
- *     a.collect { |x| x + "!" }         #=> ["a!", "b!", "c!", "d!"]
- *     a.map.with_index { |x, i| x * i } #=> ["", "b", "cc", "ddd"]
- *     a                                 #=> ["a", "b", "c", "d"]
- */
-
-static VALUE
-rb_ary_collect(VALUE ary)
-{
-    long i;
-    VALUE collect;
-
-    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
-    collect = rb_ary_new2(RARRAY_LEN(ary));
-    for (i = 0; i < RARRAY_LEN(ary); i++) {
-	rb_ary_push(collect, rb_yield(RARRAY_AREF(ary, i)));
-    }
-    return collect;
-}
-
-
-/*
- *  call-seq:
- *     ary.collect! {|item| block }   -> ary
- *     ary.map!     {|item| block }   -> ary
- *     ary.collect!                   -> Enumerator
- *     ary.map!                       -> Enumerator
- *
- *  Invokes the given block once for each element of +self+, replacing the
- *  element with the value returned by the block.
- *
- *  See also Enumerable#collect.
- *
- *  If no block is given, an Enumerator is returned instead.
- *
- *     a = [ "a", "b", "c", "d" ]
- *     a.map! {|x| x + "!" }
- *     a #=>  [ "a!", "b!", "c!", "d!" ]
- *     a.collect!.with_index {|x, i| x[0...i] }
- *     a #=>  ["", "b", "c!", "d!"]
- */
-
-static VALUE
-rb_ary_collect_bang(VALUE ary)
+ary_sort_bang(ary)
+    VALUE ary;
 {
-    long i;
+    if (RARRAY(ary)->len == 0) return ary;
 
-    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
-    rb_ary_modify(ary);
-    for (i = 0; i < RARRAY_LEN(ary); i++) {
-	rb_ary_store(ary, i, rb_yield(RARRAY_AREF(ary, i)));
-    }
+    ary_modify(ary);
+    qsort(RARRAY(ary)->ptr, RARRAY(ary)->len, sizeof(VALUE),
+	  iterator_p()?sort_1:sort_2);
     return ary;
 }
 
 VALUE
-rb_get_values_at(VALUE obj, long olen, int argc, const VALUE *argv, VALUE (*func) (VALUE, long))
-{
-    VALUE result = rb_ary_new2(argc);
-    long beg, len, i, j;
-
-    for (i=0; i<argc; i++) {
-	if (FIXNUM_P(argv[i])) {
-	    rb_ary_push(result, (*func)(obj, FIX2LONG(argv[i])));
-	    continue;
-	}
-	/* check if idx is Range */
-	if (rb_range_beg_len(argv[i], &beg, &len, olen, 1)) {
-	    long end = olen < beg+len ? olen : beg+len;
-	    for (j = beg; j < end; j++) {
-		rb_ary_push(result, (*func)(obj, j));
-	    }
-	    if (beg + len > j)
-		rb_ary_resize(result, RARRAY_LEN(result) + (beg + len) - j);
-	    continue;
-	}
-	rb_ary_push(result, (*func)(obj, NUM2LONG(argv[i])));
-    }
-    return result;
-}
-
-/*
- *  call-seq:
- *     ary.values_at(selector, ...)  -> new_ary
- *
- *  Returns an array containing the elements in +self+ corresponding to the
- *  given +selector+(s).
- *
- *  The selectors may be either integer indices or ranges.
- *
- *  See also Array#select.
- *
- *     a = %w{ a b c d e f }
- *     a.values_at(1, 3, 5)          # => ["b", "d", "f"]
- *     a.values_at(1, 3, 5, 7)       # => ["b", "d", "f", nil]
- *     a.values_at(-1, -2, -2, -7)   # => ["f", "e", "e", nil]
- *     a.values_at(4..6, 3...6)      # => ["e", "f", nil, "d", "e", "f"]
- */
-
-static VALUE
-rb_ary_values_at(int argc, VALUE *argv, VALUE ary)
-{
-    return rb_get_values_at(ary, RARRAY_LEN(ary), argc, argv, rb_ary_entry);
-}
-
-
-/*
- *  call-seq:
- *     ary.select { |item| block } -> new_ary
- *     ary.select                  -> Enumerator
- *
- *  Returns a new array containing all elements of +ary+
- *  for which the given +block+ returns a true value.
- *
- *  If no block is given, an Enumerator is returned instead.
- *
- *     [1,2,3,4,5].select { |num|  num.even?  }   #=> [2, 4]
- *
- *     a = %w{ a b c d e f }
- *     a.select { |v| v =~ /[aeiou]/ }  #=> ["a", "e"]
- *
- *  See also Enumerable#select.
- */
-
-static VALUE
-rb_ary_select(VALUE ary)
-{
-    VALUE result;
-    long i;
-
-    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
-    result = rb_ary_new2(RARRAY_LEN(ary));
-    for (i = 0; i < RARRAY_LEN(ary); i++) {
-	if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
-	    rb_ary_push(result, rb_ary_elt(ary, i));
-	}
-    }
-    return result;
-}
-
-struct select_bang_arg {
+ary_sort(ary)
     VALUE ary;
-    long len[2];
-};
-
-static VALUE
-select_bang_i(VALUE a)
-{
-    volatile struct select_bang_arg *arg = (void *)a;
-    VALUE ary = arg->ary;
-    long i1, i2;
-
-    for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); arg->len[0] = ++i1) {
-	VALUE v = RARRAY_AREF(ary, i1);
-	if (!RTEST(rb_yield(v))) continue;
-	if (i1 != i2) {
-	    rb_ary_store(ary, i2, v);
-	}
-	arg->len[1] = ++i2;
-    }
-    return (i1 == i2) ? Qnil : ary;
-}
-
-static VALUE
-select_bang_ensure(VALUE a)
-{
-    volatile struct select_bang_arg *arg = (void *)a;
-    VALUE ary = arg->ary;
-    long len = RARRAY_LEN(ary);
-    long i1 = arg->len[0], i2 = arg->len[1];
-
-    if (i2 < i1) {
-	if (i1 < len) {
-	    RARRAY_PTR_USE(ary, ptr, {
-		    MEMMOVE(ptr + i2, ptr + i1, VALUE, len - i1);
-		});
-	}
-	ARY_SET_LEN(ary, len - i1 + i2);
-    }
-    return ary;
-}
-
-/*
- *  call-seq:
- *     ary.select!  {|item| block } -> ary or nil
- *     ary.select!                  -> Enumerator
- *
- *  Invokes the given block passing in successive elements from +self+,
- *  deleting elements for which the block returns a +false+ value.
- *
- *  The array may not be changed instantly every time the block is called.
- *
- *  If changes were made, it will return +self+, otherwise it returns +nil+.
- *
- *  See also Array#keep_if
- *
- *  If no block is given, an Enumerator is returned instead.
- *
- */
-
-static VALUE
-rb_ary_select_bang(VALUE ary)
 {
-    struct select_bang_arg args;
-
-    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
-    rb_ary_modify(ary);
-
-    args.ary = ary;
-    args.len[0] = args.len[1] = 0;
-    return rb_ensure(select_bang_i, (VALUE)&args, select_bang_ensure, (VALUE)&args);
+    if (RARRAY(ary)->len == 0) return ary;
+    return ary_sort_bang(ary_dup(ary));
 }
 
-/*
- *  call-seq:
- *     ary.keep_if { |item| block } -> ary
- *     ary.keep_if                  -> Enumerator
- *
- *  Deletes every element of +self+ for which the given block evaluates to
- *  +false+.
- *
- *  See also Array#select!
- *
- *  If no block is given, an Enumerator is returned instead.
- *
- *     a = %w{ a b c d e f }
- *     a.keep_if { |v| v =~ /[aeiou]/ }  #=> ["a", "e"]
- */
-
-static VALUE
-rb_ary_keep_if(VALUE ary)
-{
-    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
-    rb_ary_select_bang(ary);
-    return ary;
-}
-
-static void
-ary_resize_smaller(VALUE ary, long len)
-{
-    rb_ary_modify(ary);
-    if (RARRAY_LEN(ary) > len) {
-	ARY_SET_LEN(ary, len);
-	if (len * 2 < ARY_CAPA(ary) &&
-	    ARY_CAPA(ary) > ARY_DEFAULT_SIZE) {
-	    ary_resize_capa(ary, len * 2);
-	}
-    }
-}
-
-/*
- *  call-seq:
- *     ary.delete(obj)            -> item or nil
- *     ary.delete(obj) { block }  -> item or result of block
- *
- *  Deletes all items from +self+ that are equal to +obj+.
- *
- *  Returns the last deleted item, or +nil+ if no matching item is found.
- *
- *  If the optional code block is given, the result of the block is returned if
- *  the item is not found.  (To remove +nil+ elements and get an informative
- *  return value, use Array#compact!)
- *
- *     a = [ "a", "b", "b", "b", "c" ]
- *     a.delete("b")                   #=> "b"
- *     a                               #=> ["a", "c"]
- *     a.delete("z")                   #=> nil
- *     a.delete("z") { "not found" }   #=> "not found"
- */
-
 VALUE
-rb_ary_delete(VALUE ary, VALUE item)
+ary_delete(ary, item)
+    VALUE ary;
+    VALUE item;
 {
-    VALUE v = item;
-    long i1, i2;
-
-    for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); i1++) {
-	VALUE e = RARRAY_AREF(ary, i1);
+    int i1, i2;
 
-	if (rb_equal(e, item)) {
-	    v = e;
-	    continue;
-	}
+    ary_modify(ary);
+    for (i1 = i2 = 0; i1 < RARRAY(ary)->len; i1++) {
+	if (rb_equal(RARRAY(ary)->ptr[i1], item)) continue;
 	if (i1 != i2) {
-	    rb_ary_store(ary, i2, e);
+	    RARRAY(ary)->ptr[i2] = RARRAY(ary)->ptr[i1];
 	}
 	i2++;
     }
-    if (RARRAY_LEN(ary) == i2) {
-	if (rb_block_given_p()) {
-	    return rb_yield(item);
-	}
+    if (RARRAY(ary)->len == i2) {
+	if (iterator_p()) rb_yield(item);
 	return Qnil;
     }
+    else {
+	RARRAY(ary)->len = i2;
+    }
 
-    ary_resize_smaller(ary, i2);
-
-    return v;
+    return item;
 }
 
-void
-rb_ary_delete_same(VALUE ary, VALUE item)
+VALUE
+ary_delete_at(ary, at)
+    VALUE ary;
+    VALUE at;
 {
-    long i1, i2;
-
-    for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); i1++) {
-	VALUE e = RARRAY_AREF(ary, i1);
+    int i1, i2, pos;
+    VALUE del = Qnil;
 
-	if (e == item) {
+    ary_modify(ary);
+    pos = NUM2INT(at);
+    for (i1 = i2 = 0; i1 < RARRAY(ary)->len; i1++) {
+	if (i1 == pos) {
+	    del = RARRAY(ary)->ptr[i1];
 	    continue;
 	}
 	if (i1 != i2) {
-	    rb_ary_store(ary, i2, e);
+	    RARRAY(ary)->ptr[i2] = RARRAY(ary)->ptr[i1];
 	}
 	i2++;
     }
-    if (RARRAY_LEN(ary) == i2) {
-	return;
-    }
-
-    ary_resize_smaller(ary, i2);
-}
-
-VALUE
-rb_ary_delete_at(VALUE ary, long pos)
-{
-    long len = RARRAY_LEN(ary);
-    VALUE del;
-
-    if (pos >= len) return Qnil;
-    if (pos < 0) {
-	pos += len;
-	if (pos < 0) return Qnil;
-    }
-
-    rb_ary_modify(ary);
-    del = RARRAY_AREF(ary, pos);
-    RARRAY_PTR_USE(ary, ptr, {
-	MEMMOVE(ptr+pos, ptr+pos+1, VALUE, len-pos-1);
-    });
-    ARY_INCREASE_LEN(ary, -1);
+    RARRAY(ary)->len = i2;
 
     return del;
 }
 
-/*
- *  call-seq:
- *     ary.delete_at(index)  -> obj or nil
- *
- *  Deletes the element at the specified +index+, returning that element, or
- *  +nil+ if the +index+ is out of range.
- *
- *  See also Array#slice!
- *
- *     a = ["ant", "bat", "cat", "dog"]
- *     a.delete_at(2)    #=> "cat"
- *     a                 #=> ["ant", "bat", "dog"]
- *     a.delete_at(99)   #=> nil
- */
-
-static VALUE
-rb_ary_delete_at_m(VALUE ary, VALUE pos)
-{
-    return rb_ary_delete_at(ary, NUM2LONG(pos));
-}
-
-/*
- *  call-seq:
- *     ary.slice!(index)         -> obj or nil
- *     ary.slice!(start, length) -> new_ary or nil
- *     ary.slice!(range)         -> new_ary or nil
- *
- *  Deletes the element(s) given by an +index+ (optionally up to +length+
- *  elements) or by a +range+.
- *
- *  Returns the deleted object (or objects), or +nil+ if the +index+ is out of
- *  range.
- *
- *     a = [ "a", "b", "c" ]
- *     a.slice!(1)     #=> "b"
- *     a               #=> ["a", "c"]
- *     a.slice!(-1)    #=> "c"
- *     a               #=> ["a"]
- *     a.slice!(100)   #=> nil
- *     a               #=> ["a"]
- */
-
 static VALUE
-rb_ary_slice_bang(int argc, VALUE *argv, VALUE ary)
-{
-    VALUE arg1, arg2;
-    long pos, len, orig_len;
-
-    rb_ary_modify_check(ary);
-    if (argc == 2) {
-	pos = NUM2LONG(argv[0]);
-	len = NUM2LONG(argv[1]);
-      delete_pos_len:
-	if (len < 0) return Qnil;
-	orig_len = RARRAY_LEN(ary);
-	if (pos < 0) {
-	    pos += orig_len;
-	    if (pos < 0) return Qnil;
-	}
-	else if (orig_len < pos) return Qnil;
-	if (orig_len < pos + len) {
-	    len = orig_len - pos;
-	}
-	if (len == 0) return rb_ary_new2(0);
-	arg2 = rb_ary_new4(len, RARRAY_CONST_PTR(ary)+pos);
-	RBASIC_SET_CLASS(arg2, rb_obj_class(ary));
-	rb_ary_splice(ary, pos, len, Qundef);
-	return arg2;
-    }
-
-    if (argc != 1) {
-	/* error report */
-	rb_scan_args(argc, argv, "11", NULL, NULL);
-    }
-    arg1 = argv[0];
-
-    if (!FIXNUM_P(arg1)) {
-	switch (rb_range_beg_len(arg1, &pos, &len, RARRAY_LEN(ary), 0)) {
-	  case Qtrue:
-	    /* valid range */
-	    goto delete_pos_len;
-	  case Qnil:
-	    /* invalid range */
-	    return Qnil;
-	  default:
-	    /* not a range */
-	    break;
-	}
-    }
-
-    return rb_ary_delete_at(ary, NUM2LONG(arg1));
-}
-
-static VALUE
-ary_reject(VALUE orig, VALUE result)
-{
-    long i;
-
-    for (i = 0; i < RARRAY_LEN(orig); i++) {
-	VALUE v = RARRAY_AREF(orig, i);
-	if (!RTEST(rb_yield(v))) {
-	    rb_ary_push(result, v);
-	}
-    }
-    return result;
-}
-
-static VALUE
-reject_bang_i(VALUE a)
+ary_delete_if(ary)
+    VALUE ary;
 {
-    volatile struct select_bang_arg *arg = (void *)a;
-    VALUE ary = arg->ary;
-    long i1, i2;
+    int i1, i2;
 
-    for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); arg->len[0] = ++i1) {
-	VALUE v = RARRAY_AREF(ary, i1);
-	if (RTEST(rb_yield(v))) continue;
+    ary_modify(ary);
+    for (i1 = i2 = 0; i1 < RARRAY(ary)->len; i1++) {
+	if (rb_yield(RARRAY(ary)->ptr[i1])) continue;
 	if (i1 != i2) {
-	    rb_ary_store(ary, i2, v);
+	    RARRAY(ary)->ptr[i2] = RARRAY(ary)->ptr[i1];
 	}
-	arg->len[1] = ++i2;
+	i2++;
     }
-    return (i1 == i2) ? Qnil : ary;
-}
-
-static VALUE
-ary_reject_bang(VALUE ary)
-{
-    struct select_bang_arg args;
-
-    rb_ary_modify_check(ary);
-    args.ary = ary;
-    args.len[0] = args.len[1] = 0;
-    return rb_ensure(reject_bang_i, (VALUE)&args, select_bang_ensure, (VALUE)&args);
-}
-
-/*
- *  call-seq:
- *     ary.reject! { |item| block }  -> ary or nil
- *     ary.reject!                   -> Enumerator
- *
- *  Deletes every element of +self+ for which the block evaluates to +true+,
- *  if no changes were made returns +nil+.
- *
- *  The array may not be changed instantly every time the block is called.
- *
- *  See also Enumerable#reject and Array#delete_if.
- *
- *  If no block is given, an Enumerator is returned instead.
- */
-
-static VALUE
-rb_ary_reject_bang(VALUE ary)
-{
-    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
-    return ary_reject_bang(ary);
-}
-
-/*
- *  call-seq:
- *     ary.reject  {|item| block }  -> new_ary
- *     ary.reject                   -> Enumerator
- *
- *  Returns a new array containing the items in +self+ for which the given
- *  block is not +true+. The ordering of non-rejected elements is maintained.
- *
- *  See also Array#delete_if
- *
- *  If no block is given, an Enumerator is returned instead.
- */
-
-static VALUE
-rb_ary_reject(VALUE ary)
-{
-    VALUE rejected_ary;
+    RARRAY(ary)->len = i2;
 
-    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
-    rejected_ary = rb_ary_new();
-    ary_reject(ary, rejected_ary);
-    return rejected_ary;
-}
-
-/*
- *  call-seq:
- *     ary.delete_if { |item| block }  -> ary
- *     ary.delete_if                   -> Enumerator
- *
- *  Deletes every element of +self+ for which block evaluates to +true+.
- *
- *  The array is changed instantly every time the block is called, not after
- *  the iteration is over.
- *
- *  See also Array#reject!
- *
- *  If no block is given, an Enumerator is returned instead.
- *
- *     scores = [ 97, 42, 75 ]
- *     scores.delete_if {|score| score < 80 }   #=> [97]
- */
-
-static VALUE
-rb_ary_delete_if(VALUE ary)
-{
-    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
-    ary_reject_bang(ary);
     return ary;
 }
 
 static VALUE
-take_i(RB_BLOCK_CALL_FUNC_ARGLIST(val, cbarg))
-{
-    VALUE *args = (VALUE *)cbarg;
-    if (args[1]-- == 0) rb_iter_break();
-    if (argc > 1) val = rb_ary_new4(argc, argv);
-    rb_ary_push(args[0], val);
-    return Qnil;
-}
-
-static VALUE
-take_items(VALUE obj, long n)
-{
-    VALUE result = rb_check_array_type(obj);
-    VALUE args[2];
-
-    if (!NIL_P(result)) return rb_ary_subseq(result, 0, n);
-    result = rb_ary_new2(n);
-    args[0] = result; args[1] = (VALUE)n;
-    if (rb_check_block_call(obj, idEach, 0, 0, take_i, (VALUE)args) == Qundef)
-	rb_raise(rb_eTypeError, "wrong argument type %"PRIsVALUE" (must respond to :each)",
-		 rb_obj_class(obj));
-    return result;
-}
-
-
-/*
- *  call-seq:
- *     ary.zip(arg, ...)                  -> new_ary
- *     ary.zip(arg, ...) { |arr| block }  -> nil
- *
- *  Converts any arguments to arrays, then merges elements of +self+ with
- *  corresponding elements from each argument.
- *
- *  This generates a sequence of <code>ary.size</code> _n_-element arrays,
- *  where _n_ is one more than the count of arguments.
- *
- *  If the size of any argument is less than the size of the initial array,
- *  +nil+ values are supplied.
- *
- *  If a block is given, it is invoked for each output +array+, otherwise an
- *  array of arrays is returned.
- *
- *     a = [ 4, 5, 6 ]
- *     b = [ 7, 8, 9 ]
- *     [1, 2, 3].zip(a, b)   #=> [[1, 4, 7], [2, 5, 8], [3, 6, 9]]
- *     [1, 2].zip(a, b)      #=> [[1, 4, 7], [2, 5, 8]]
- *     a.zip([1, 2], [8])    #=> [[4, 1, 8], [5, 2, nil], [6, nil, nil]]
- */
-
-static VALUE
-rb_ary_zip(int argc, VALUE *argv, VALUE ary)
+ary_filter(ary)
+    VALUE ary;
 {
-    int i, j;
-    long len = RARRAY_LEN(ary);
-    VALUE result = Qnil;
+    int i;
 
-    for (i=0; i<argc; i++) {
-	argv[i] = take_items(argv[i], len);
+    ary_modify(ary);
+    for (i = 0; i < RARRAY(ary)->len; i++) {
+	RARRAY(ary)->ptr[i] = rb_yield(RARRAY(ary)->ptr[i]);
     }
-
-    if (rb_block_given_p()) {
-	int arity = rb_block_arity();
-
-	if (arity > 1) {
-	    VALUE work, *tmp;
-
-	    tmp = ALLOCV_N(VALUE, work, argc+1);
-
-	    for (i=0; i<RARRAY_LEN(ary); i++) {
-		tmp[0] = RARRAY_AREF(ary, i);
-		for (j=0; j<argc; j++) {
-		    tmp[j+1] = rb_ary_elt(argv[j], i);
-		}
-		rb_yield_values2(argc+1, tmp);
-	    }
-
-	    if (work) ALLOCV_END(work);
-	}
-	else {
-	    for (i=0; i<RARRAY_LEN(ary); i++) {
-		VALUE tmp = rb_ary_new2(argc+1);
-
-		rb_ary_push(tmp, RARRAY_AREF(ary, i));
-		for (j=0; j<argc; j++) {
-		    rb_ary_push(tmp, rb_ary_elt(argv[j], i));
-		}
-		rb_yield(tmp);
-	    }
-	}
-    }
-    else {
-	result = rb_ary_new_capa(len);
-
-	for (i=0; i<len; i++) {
-	    VALUE tmp = rb_ary_new_capa(argc+1);
-
-	    rb_ary_push(tmp, RARRAY_AREF(ary, i));
-	    for (j=0; j<argc; j++) {
-		rb_ary_push(tmp, rb_ary_elt(argv[j], i));
-	    }
-	    rb_ary_push(result, tmp);
-	}
-    }
-
-    return result;
+    return ary;
 }
 
-/*
- *  call-seq:
- *     ary.transpose -> new_ary
- *
- *  Assumes that +self+ is an array of arrays and transposes the rows and
- *  columns.
- *
- *     a = [[1,2], [3,4], [5,6]]
- *     a.transpose   #=> [[1, 3, 5], [2, 4, 6]]
- *
- *  If the length of the subarrays don't match, an IndexError is raised.
- */
-
 static VALUE
-rb_ary_transpose(VALUE ary)
+ary_replace_method(ary, ary2)
+    VALUE ary, ary2;
 {
-    long elen = -1, alen, i, j;
-    VALUE tmp, result = 0;
-
-    alen = RARRAY_LEN(ary);
-    if (alen == 0) return rb_ary_dup(ary);
-    for (i=0; i<alen; i++) {
-	tmp = to_ary(rb_ary_elt(ary, i));
-	if (elen < 0) {		/* first element */
-	    elen = RARRAY_LEN(tmp);
-	    result = rb_ary_new2(elen);
-	    for (j=0; j<elen; j++) {
-		rb_ary_store(result, j, rb_ary_new2(alen));
-	    }
-	}
-	else if (elen != RARRAY_LEN(tmp)) {
-	    rb_raise(rb_eIndexError, "element size differs (%ld should be %ld)",
-		     RARRAY_LEN(tmp), elen);
-	}
-	for (j=0; j<elen; j++) {
-	    rb_ary_store(rb_ary_elt(result, j), i, rb_ary_elt(tmp, j));
-	}
-    }
-    return result;
-}
-
-/*
- *  call-seq:
- *     ary.replace(other_ary)  -> ary
- *     ary.initialize_copy(other_ary)	-> ary
- *
- *  Replaces the contents of +self+ with the contents of +other_ary+,
- *  truncating or expanding if necessary.
- *
- *     a = [ "a", "b", "c", "d", "e" ]
- *     a.replace([ "x", "y", "z" ])   #=> ["x", "y", "z"]
- *     a                              #=> ["x", "y", "z"]
- */
-
-VALUE
-rb_ary_replace(VALUE copy, VALUE orig)
-{
-    rb_ary_modify_check(copy);
-    orig = to_ary(orig);
-    if (copy == orig) return copy;
-
-    if (RARRAY_LEN(orig) <= RARRAY_EMBED_LEN_MAX) {
-        VALUE shared = 0;
-
-        if (ARY_OWNS_HEAP_P(copy)) {
-	    RARRAY_PTR_USE(copy, ptr, ruby_sized_xfree(ptr, ARY_HEAP_SIZE(copy)));
-	}
-        else if (ARY_SHARED_P(copy)) {
-            shared = ARY_SHARED(copy);
-            FL_UNSET_SHARED(copy);
-        }
-        FL_SET_EMBED(copy);
-	ary_memcpy(copy, 0, RARRAY_LEN(orig), RARRAY_CONST_PTR(orig));
-        if (shared) {
-            rb_ary_decrement_share(shared);
-        }
-        ARY_SET_LEN(copy, RARRAY_LEN(orig));
-    }
-    else {
-        VALUE shared = ary_make_shared(orig);
-        if (ARY_OWNS_HEAP_P(copy)) {
-	    RARRAY_PTR_USE(copy, ptr, ruby_sized_xfree(ptr, ARY_HEAP_SIZE(copy)));
-        }
-        else {
-            rb_ary_unshare_safe(copy);
-        }
-        FL_UNSET_EMBED(copy);
-        ARY_SET_PTR(copy, RARRAY_CONST_PTR(orig));
-        ARY_SET_LEN(copy, RARRAY_LEN(orig));
-        rb_ary_set_shared(copy, shared);
-    }
-    return copy;
+    ary2 = to_ary(ary2);
+    ary_replace(ary, 0, RARRAY(ary2)->len, ary2);
+    return ary;
 }
 
-/*
- *  call-seq:
- *     ary.clear    -> ary
- *
- *  Removes all elements from +self+.
- *
- *     a = [ "a", "b", "c", "d", "e" ]
- *     a.clear    #=> [ ]
- */
-
-VALUE
-rb_ary_clear(VALUE ary)
+static VALUE
+ary_clear(ary)
+    VALUE ary;
 {
-    rb_ary_modify_check(ary);
-    ARY_SET_LEN(ary, 0);
-    if (ARY_SHARED_P(ary)) {
-	if (!ARY_EMBED_P(ary)) {
-	    rb_ary_unshare(ary);
-	    FL_SET_EMBED(ary);
-	}
-    }
-    else if (ARY_DEFAULT_SIZE * 2 < ARY_CAPA(ary)) {
-	ary_resize_capa(ary, ARY_DEFAULT_SIZE * 2);
+    RARRAY(ary)->len = 0;
+    if (ARY_DEFAULT_SIZE*3 < RARRAY(ary)->capa) {
+	RARRAY(ary)->capa = ARY_DEFAULT_SIZE * 2;
+	REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->capa);
     }
     return ary;
 }
 
-/*
- *  call-seq:
- *     ary.fill(obj)                                 -> ary
- *     ary.fill(obj, start [, length])               -> ary
- *     ary.fill(obj, range )                         -> ary
- *     ary.fill { |index| block }                    -> ary
- *     ary.fill(start [, length] ) { |index| block } -> ary
- *     ary.fill(range) { |index| block }             -> ary
- *
- *  The first three forms set the selected elements of +self+ (which
- *  may be the entire array) to +obj+.
- *
- *  A +start+ of +nil+ is equivalent to zero.
- *
- *  A +length+ of +nil+ is equivalent to the length of the array.
- *
- *  The last three forms fill the array with the value of the given block,
- *  which is passed the absolute index of each element to be filled.
- *
- *  Negative values of +start+ count from the end of the array, where +-1+ is
- *  the last element.
- *
- *     a = [ "a", "b", "c", "d" ]
- *     a.fill("x")              #=> ["x", "x", "x", "x"]
- *     a.fill("z", 2, 2)        #=> ["x", "x", "z", "z"]
- *     a.fill("y", 0..1)        #=> ["y", "y", "z", "z"]
- *     a.fill { |i| i*i }       #=> [0, 1, 4, 9]
- *     a.fill(-2) { |i| i*i*i } #=> [0, 1, 8, 27]
- */
-
 static VALUE
-rb_ary_fill(int argc, VALUE *argv, VALUE ary)
+ary_fill(argc, argv, ary)
+    int argc;
+    VALUE *argv;
+    VALUE ary;
 {
     VALUE item, arg1, arg2;
-    long beg = 0, end = 0, len = 0;
-    int block_p = FALSE;
+    int beg, len, end;
+    VALUE *p, *pend;
 
-    if (rb_block_given_p()) {
-	block_p = TRUE;
-	rb_scan_args(argc, argv, "02", &arg1, &arg2);
-	argc += 1;		/* hackish */
+    rb_scan_args(argc, argv, "12", &item, &arg1, &arg2);
+    if (NIL_P(arg2) && beg_len(arg1, &beg, &len, RARRAY(ary)->len)) {
+	/* beg and len set already */
     }
     else {
-	rb_scan_args(argc, argv, "12", &item, &arg1, &arg2);
-    }
-    switch (argc) {
-      case 1:
-	beg = 0;
-	len = RARRAY_LEN(ary);
-	break;
-      case 2:
-	if (rb_range_beg_len(arg1, &beg, &len, RARRAY_LEN(ary), 1)) {
-	    break;
-	}
-	/* fall through */
-      case 3:
-	beg = NIL_P(arg1) ? 0 : NUM2LONG(arg1);
+	beg = NUM2INT(arg1);
 	if (beg < 0) {
-	    beg = RARRAY_LEN(ary) + beg;
+	    beg = RARRAY(ary)->len + beg;
 	    if (beg < 0) beg = 0;
 	}
-	len = NIL_P(arg2) ? RARRAY_LEN(ary) - beg : NUM2LONG(arg2);
-	break;
-    }
-    rb_ary_modify(ary);
-    if (len < 0) {
-        return ary;
-    }
-    if (beg >= ARY_MAX_SIZE || len > ARY_MAX_SIZE - beg) {
-	rb_raise(rb_eArgError, "argument too big");
+	if (!NIL_P(arg2)) {
+	    len = NUM2INT(arg2);
+	}
+	else {
+	    len = RARRAY(ary)->len - beg;
+	}
     }
     end = beg + len;
-    if (RARRAY_LEN(ary) < end) {
-	if (end >= ARY_CAPA(ary)) {
-	    ary_resize_capa(ary, end);
+    if (end > RARRAY(ary)->len) {
+	if (end >= RARRAY(ary)->capa) {
+	    RARRAY(ary)->capa=end;
+	    REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->capa);
 	}
-	ary_mem_clear(ary, RARRAY_LEN(ary), end - RARRAY_LEN(ary));
-	ARY_SET_LEN(ary, end);
-    }
-
-    if (block_p) {
-	VALUE v;
-	long i;
-
-	for (i=beg; i<end; i++) {
-	    v = rb_yield(LONG2NUM(i));
-	    if (i>=RARRAY_LEN(ary)) break;
-	    ARY_SET(ary, i, v);
+	if (beg > RARRAY(ary)->len) {
+	    memclear(RARRAY(ary)->ptr+RARRAY(ary)->len, end-RARRAY(ary)->len);
 	}
+	RARRAY(ary)->len = end;
     }
-    else {
-	ary_memfill(ary, beg, len, item);
+    p = RARRAY(ary)->ptr + beg; pend = p + len;
+
+    while (p < pend) {
+	*p++ = item;
     }
     return ary;
 }
 
-/*
- *  call-seq:
- *     ary + other_ary   -> new_ary
- *
- *  Concatenation --- Returns a new array built by concatenating the
- *  two arrays together to produce a third array.
- *
- *     [ 1, 2, 3 ] + [ 4, 5 ]    #=> [ 1, 2, 3, 4, 5 ]
- *     a = [ "a", "b", "c" ]
- *     c = a + [ "d", "e", "f" ]
- *     c                         #=> [ "a", "b", "c", "d", "e", "f" ]
- *     a                         #=> [ "a", "b", "c" ]
- *
- *  Note that
- *     x += y
- *  is the same as
- *     x = x + y
- *  This means that it produces a new array. As a consequence,
- *  repeated use of <code>+=</code> on arrays can be quite inefficient.
- *
- *  See also Array#concat.
- */
-
 VALUE
-rb_ary_plus(VALUE x, VALUE y)
+ary_plus(x, y)
+    VALUE x, y;
 {
     VALUE z;
-    long len, xlen, ylen;
 
-    y = to_ary(y);
-    xlen = RARRAY_LEN(x);
-    ylen = RARRAY_LEN(y);
-    len = xlen + ylen;
-    z = rb_ary_new2(len);
+    if (TYPE(y) != T_ARRAY) {
+	return ary_plus(x, rb_Array(y));
+    }
 
-    ary_memcpy(z, 0, xlen, RARRAY_CONST_PTR(x));
-    ary_memcpy(z, xlen, ylen, RARRAY_CONST_PTR(y));
-    ARY_SET_LEN(z, len);
+    z = ary_new2(RARRAY(x)->len + RARRAY(y)->len);
+    MEMCPY(RARRAY(z)->ptr, RARRAY(x)->ptr, VALUE, RARRAY(x)->len);
+    MEMCPY(RARRAY(z)->ptr+RARRAY(x)->len, RARRAY(y)->ptr, VALUE, RARRAY(y)->len);
+    RARRAY(z)->len = RARRAY(x)->len + RARRAY(y)->len;
     return z;
 }
 
-/*
- *  call-seq:
- *     ary.concat(other_ary)   -> ary
- *
- *  Appends the elements of +other_ary+ to +self+.
- *
- *     [ "a", "b" ].concat( ["c", "d"] ) #=> [ "a", "b", "c", "d" ]
- *     a = [ 1, 2, 3 ]
- *     a.concat( [ 4, 5 ] )
- *     a                                 #=> [ 1, 2, 3, 4, 5 ]
- *
- *  See also Array#+.
- */
-
 VALUE
-rb_ary_concat(VALUE x, VALUE y)
+ary_concat(x, y)
+    VALUE x, y;
 {
-    rb_ary_modify_check(x);
-    y = to_ary(y);
-    if (RARRAY_LEN(y) > 0) {
-	rb_ary_splice(x, RARRAY_LEN(x), 0, y);
+    VALUE *p, *pend;
+
+    if (TYPE(y) != T_ARRAY) {
+	return ary_concat(x, rb_Array(y));
+    }
+
+    p = RARRAY(y)->ptr;
+    pend = p + RARRAY(y)->len;
+    while (p < pend) {
+	ary_store(x, RARRAY(x)->len, *p);
+	p++;
     }
     return x;
 }
 
-
-/*
- *  call-seq:
- *     ary * int     -> new_ary
- *     ary * str     -> new_string
- *
- *  Repetition --- With a String argument, equivalent to
- *  <code>ary.join(str)</code>.
- *
- *  Otherwise, returns a new array built by concatenating the +int+ copies of
- *  +self+.
- *
- *
- *     [ 1, 2, 3 ] * 3    #=> [ 1, 2, 3, 1, 2, 3, 1, 2, 3 ]
- *     [ 1, 2, 3 ] * ","  #=> "1,2,3"
- *
- */
-
 static VALUE
-rb_ary_times(VALUE ary, VALUE times)
+ary_times(ary, times)
+    VALUE ary;
+    VALUE times;
 {
-    VALUE ary2, tmp;
-    const VALUE *ptr;
-    long t, len;
+    VALUE ary2;
+    int i, len;
 
-    tmp = rb_check_string_type(times);
-    if (!NIL_P(tmp)) {
-	return rb_ary_join(ary, tmp);
+    if (TYPE(times) == T_STRING) {
+	return ary_join(ary, times);
     }
 
-    len = NUM2LONG(times);
-    if (len == 0) {
-	ary2 = ary_new(rb_obj_class(ary), 0);
-	goto out;
-    }
+    len = NUM2INT(times) * RARRAY(ary)->len;
+    ary2 = ary_new2(len);
+    RARRAY(ary2)->len = len;
+
     if (len < 0) {
-	rb_raise(rb_eArgError, "negative argument");
-    }
-    if (ARY_MAX_SIZE/len < RARRAY_LEN(ary)) {
-	rb_raise(rb_eArgError, "argument too big");
+	ArgError("negative argument");
     }
-    len *= RARRAY_LEN(ary);
-
-    ary2 = ary_new(rb_obj_class(ary), len);
-    ARY_SET_LEN(ary2, len);
-
-    ptr = RARRAY_CONST_PTR(ary);
-    t = RARRAY_LEN(ary);
-    if (0 < t) {
-	ary_memcpy(ary2, 0, t, ptr);
-	while (t <= len/2) {
-	    ary_memcpy(ary2, t, t, RARRAY_CONST_PTR(ary2));
-            t *= 2;
-        }
-        if (t < len) {
-	    ary_memcpy(ary2, t, len-t, RARRAY_CONST_PTR(ary2));
-        }
+
+    for (i=0; i<len; i+=RARRAY(ary)->len) {
+	MEMCPY(RARRAY(ary2)->ptr+i, RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
     }
-  out:
-    OBJ_INFECT(ary2, ary);
 
     return ary2;
 }
 
-/*
- *  call-seq:
- *     ary.assoc(obj)   -> element_ary  or  nil
- *
- *  Searches through an array whose elements are also arrays comparing +obj+
- *  with the first element of each contained array using <code>obj.==</code>.
- *
- *  Returns the first contained array that matches (that is, the first
- *  associated array), or +nil+ if no match is found.
- *
- *  See also Array#rassoc
- *
- *     s1 = [ "colors", "red", "blue", "green" ]
- *     s2 = [ "letters", "a", "b", "c" ]
- *     s3 = "foo"
- *     a  = [ s1, s2, s3 ]
- *     a.assoc("letters")  #=> [ "letters", "a", "b", "c" ]
- *     a.assoc("foo")      #=> nil
- */
-
 VALUE
-rb_ary_assoc(VALUE ary, VALUE key)
+ary_assoc(ary, key)
+    VALUE ary;
+    VALUE key;
 {
-    long i;
-    VALUE v;
+    VALUE *p, *pend;
 
-    for (i = 0; i < RARRAY_LEN(ary); ++i) {
-	v = rb_check_array_type(RARRAY_AREF(ary, i));
-	if (!NIL_P(v) && RARRAY_LEN(v) > 0 &&
-	    rb_equal(RARRAY_AREF(v, 0), key))
-	    return v;
+    p = RARRAY(ary)->ptr; pend = p + RARRAY(ary)->len;
+    while (p < pend) {
+	if (TYPE(*p) == T_ARRAY
+	    && RARRAY(*p)->len > 1
+	    && rb_equal(RARRAY(*p)->ptr[0], key))
+	    return *p;
+	p++;
     }
     return Qnil;
 }
 
-/*
- *  call-seq:
- *     ary.rassoc(obj) -> element_ary or nil
- *
- *  Searches through the array whose elements are also arrays.
- *
- *  Compares +obj+ with the second element of each contained array using
- *  <code>obj.==</code>.
- *
- *  Returns the first contained array that matches +obj+.
- *
- *  See also Array#assoc.
- *
- *     a = [ [ 1, "one"], [2, "two"], [3, "three"], ["ii", "two"] ]
- *     a.rassoc("two")    #=> [2, "two"]
- *     a.rassoc("four")   #=> nil
- */
-
 VALUE
-rb_ary_rassoc(VALUE ary, VALUE value)
+ary_rassoc(ary, value)
+    VALUE ary;
+    VALUE value;
 {
-    long i;
-    VALUE v;
+    VALUE *p, *pend;
 
-    for (i = 0; i < RARRAY_LEN(ary); ++i) {
-	v = RARRAY_AREF(ary, i);
-	if (RB_TYPE_P(v, T_ARRAY) &&
-	    RARRAY_LEN(v) > 1 &&
-	    rb_equal(RARRAY_AREF(v, 1), value))
-	    return v;
+    p = RARRAY(ary)->ptr; pend = p + RARRAY(ary)->len;
+    while (p < pend) {
+	if (TYPE(*p) == T_ARRAY
+	    && RARRAY(*p)->len > 1
+	    && rb_equal(RARRAY(*p)->ptr[1], value))
+	    return *p;
+	p++;
     }
     return Qnil;
 }
 
 static VALUE
-recursive_equal(VALUE ary1, VALUE ary2, int recur)
+ary_equal(ary1, ary2)
+    VALUE ary1, ary2;
 {
-    long i, len1;
-    const VALUE *p1, *p2;
-
-    if (recur) return Qtrue; /* Subtle! */
-
-    p1 = RARRAY_CONST_PTR(ary1);
-    p2 = RARRAY_CONST_PTR(ary2);
-    len1 = RARRAY_LEN(ary1);
-
-    for (i = 0; i < len1; i++) {
-	if (*p1 != *p2) {
-	    if (rb_equal(*p1, *p2)) {
-		len1 = RARRAY_LEN(ary1);
-		if (len1 != RARRAY_LEN(ary2))
-		    return Qfalse;
-		if (len1 < i)
-		    return Qtrue;
-		p1 = RARRAY_CONST_PTR(ary1) + i;
-		p2 = RARRAY_CONST_PTR(ary2) + i;
-	    }
-	    else {
-		return Qfalse;
-	    }
-	}
-	p1++;
-	p2++;
-    }
-    return Qtrue;
-}
+    int i;
 
-/*
- *  call-seq:
- *     ary == other_ary   ->   bool
- *
- *  Equality --- Two arrays are equal if they contain the same number of
- *  elements and if each element is equal to (according to Object#==) the
- *  corresponding element in +other_ary+.
- *
- *     [ "a", "c" ]    == [ "a", "c", 7 ]     #=> false
- *     [ "a", "c", 7 ] == [ "a", "c", 7 ]     #=> true
- *     [ "a", "c", 7 ] == [ "a", "d", "f" ]   #=> false
- *
- */
-
-static VALUE
-rb_ary_equal(VALUE ary1, VALUE ary2)
-{
-    if (ary1 == ary2) return Qtrue;
-    if (!RB_TYPE_P(ary2, T_ARRAY)) {
-	if (!rb_respond_to(ary2, idTo_ary)) {
-	    return Qfalse;
-	}
-	return rb_equal(ary2, ary1);
+    if (TYPE(ary2) != T_ARRAY) return FALSE;
+    if (RARRAY(ary1)->len != RARRAY(ary2)->len) return FALSE;
+    for (i=0; i<RARRAY(ary1)->len; i++) {
+	if (!rb_equal(RARRAY(ary1)->ptr[i], RARRAY(ary2)->ptr[i]))
+	    return FALSE;
     }
-    if (RARRAY_LEN(ary1) != RARRAY_LEN(ary2)) return Qfalse;
-    if (RARRAY_CONST_PTR(ary1) == RARRAY_CONST_PTR(ary2)) return Qtrue;
-    return rb_exec_recursive_paired(recursive_equal, ary1, ary2, ary2);
+    return TRUE;
 }
 
 static VALUE
-recursive_eql(VALUE ary1, VALUE ary2, int recur)
+ary_eql(ary1, ary2)
+    VALUE ary1, ary2;
 {
-    long i;
+    int i;
 
-    if (recur) return Qtrue; /* Subtle! */
-    for (i=0; i<RARRAY_LEN(ary1); i++) {
-	if (!rb_eql(rb_ary_elt(ary1, i), rb_ary_elt(ary2, i)))
-	    return Qfalse;
+    if (TYPE(ary2) != T_ARRAY) return FALSE;
+    if (RARRAY(ary1)->len != RARRAY(ary2)->len)
+	return FALSE;
+    for (i=0; i<RARRAY(ary1)->len; i++) {
+	if (!rb_eql(RARRAY(ary1)->ptr[i], RARRAY(ary2)->ptr[i]))
+	    return FALSE;
     }
-    return Qtrue;
+    return TRUE;
 }
 
-/*
- *  call-seq:
- *     ary.eql?(other)  -> true or false
- *
- *  Returns +true+ if +self+ and +other+ are the same object,
- *  or are both arrays with the same content (according to Object#eql?).
- */
-
 static VALUE
-rb_ary_eql(VALUE ary1, VALUE ary2)
+ary_hash(ary)
+    VALUE ary;
 {
-    if (ary1 == ary2) return Qtrue;
-    if (!RB_TYPE_P(ary2, T_ARRAY)) return Qfalse;
-    if (RARRAY_LEN(ary1) != RARRAY_LEN(ary2)) return Qfalse;
-    if (RARRAY_CONST_PTR(ary1) == RARRAY_CONST_PTR(ary2)) return Qtrue;
-    return rb_exec_recursive_paired(recursive_eql, ary1, ary2, ary2);
-}
+    int h, i;
 
-/*
- *  call-seq:
- *     ary.hash   -> fixnum
- *
- *  Compute a hash-code for this array.
- *
- *  Two arrays with the same content will have the same hash code (and will
- *  compare using #eql?).
- *
- *  See also Object#hash.
- */
-
-static VALUE
-rb_ary_hash(VALUE ary)
-{
-    long i;
-    st_index_t h;
-    VALUE n;
-
-    h = rb_hash_start(RARRAY_LEN(ary));
-    h = rb_hash_uint(h, (st_index_t)rb_ary_hash);
-    for (i=0; i<RARRAY_LEN(ary); i++) {
-	n = rb_hash(RARRAY_AREF(ary, i));
-	h = rb_hash_uint(h, NUM2LONG(n));
+    h = RARRAY(ary)->len;
+    for (i=0; i<RARRAY(ary)->len; i++) {
+	h ^= rb_hash(RARRAY(ary)->ptr[i]);
     }
-    h = rb_hash_end(h);
-    return LONG2FIX(h);
+    return INT2FIX(h);
 }
 
-/*
- *  call-seq:
- *     ary.include?(object)   -> true or false
- *
- *  Returns +true+ if the given +object+ is present in +self+ (that is, if any
- *  element <code>==</code> +object+), otherwise returns +false+.
- *
- *     a = [ "a", "b", "c" ]
- *     a.include?("b")   #=> true
- *     a.include?("z")   #=> false
- */
-
 VALUE
-rb_ary_includes(VALUE ary, VALUE item)
+ary_includes(ary, item)
+    VALUE ary;
+    VALUE item;
 {
-    long i;
-    VALUE e;
-
-    for (i=0; i<RARRAY_LEN(ary); i++) {
-	e = RARRAY_AREF(ary, i);
-	switch (rb_equal_opt(e, item)) {
-	  case Qundef:
-	    if (rb_equal(e, item)) return Qtrue;
-	    break;
-	  case Qtrue:
-	    return Qtrue;
+    int i;
+    for (i=0; i<RARRAY(ary)->len; i++) {
+	if (rb_equal(RARRAY(ary)->ptr[i], item)) {
+	    return TRUE;
 	}
     }
-    return Qfalse;
+    return FALSE;
 }
 
-
-static VALUE
-recursive_cmp(VALUE ary1, VALUE ary2, int recur)
+VALUE
+ary_cmp(ary, ary2)
+    VALUE ary;
+    VALUE ary2;
 {
-    long i, len;
+    int i, len;
 
-    if (recur) return Qundef;	/* Subtle! */
-    len = RARRAY_LEN(ary1);
-    if (len > RARRAY_LEN(ary2)) {
-	len = RARRAY_LEN(ary2);
+    ary2 = to_ary(ary2);
+    len = RARRAY(ary)->len;
+    if (len > RARRAY(ary2)->len) {
+	len = RARRAY(ary2)->len;
     }
     for (i=0; i<len; i++) {
-	VALUE e1 = rb_ary_elt(ary1, i), e2 = rb_ary_elt(ary2, i);
-	VALUE v = rb_funcallv(e1, id_cmp, 1, &e2);
+	VALUE v = rb_funcall(RARRAY(ary)->ptr[i],cmp,1,RARRAY(ary2)->ptr[i]);
 	if (v != INT2FIX(0)) {
 	    return v;
 	}
     }
-    return Qundef;
-}
-
-/*
- *  call-seq:
- *     ary <=> other_ary   ->  -1, 0, +1 or nil
- *
- *  Comparison --- Returns an integer (+-1+, +0+, or <code>+1</code>) if this
- *  array is less than, equal to, or greater than +other_ary+.
- *
- *  Each object in each array is compared (using the <=> operator).
- *
- *  Arrays are compared in an "element-wise" manner; the first element of +ary+
- *  is compared with the first one of +other_ary+ using the <=> operator, then
- *  each of the second elements, etc...
- *  As soon as the result of any such comparison is non zero (i.e. the two
- *  corresponding elements are not equal), that result is returned for the
- *  whole array comparison.
- *
- *  If all the elements are equal, then the result is based on a comparison of
- *  the array lengths. Thus, two arrays are "equal" according to Array#<=> if,
- *  and only if, they have the same length and the value of each element is
- *  equal to the value of the corresponding element in the other array.
- *
- *  +nil+ is returned if the +other_ary+ is not an array or if the comparison
- *  of two elements returned +nil+.
- *
- *     [ "a", "a", "c" ]    <=> [ "a", "b", "c" ]   #=> -1
- *     [ 1, 2, 3, 4, 5, 6 ] <=> [ 1, 2 ]            #=> +1
- *     [ 1, 2 ]             <=> [ 1, :two ]         #=> nil
- *
- */
-
-VALUE
-rb_ary_cmp(VALUE ary1, VALUE ary2)
-{
-    long len;
-    VALUE v;
-
-    ary2 = rb_check_array_type(ary2);
-    if (NIL_P(ary2)) return Qnil;
-    if (ary1 == ary2) return INT2FIX(0);
-    v = rb_exec_recursive_paired(recursive_cmp, ary1, ary2, ary2);
-    if (v != Qundef) return v;
-    len = RARRAY_LEN(ary1) - RARRAY_LEN(ary2);
+    len = RARRAY(ary)->len - RARRAY(ary2)->len;
     if (len == 0) return INT2FIX(0);
     if (len > 0) return INT2FIX(1);
     return INT2FIX(-1);
 }
 
 static VALUE
-ary_add_hash(VALUE hash, VALUE ary)
-{
-    long i;
-
-    for (i=0; i<RARRAY_LEN(ary); i++) {
-	VALUE elt = RARRAY_AREF(ary, i);
-	if (rb_hash_lookup2(hash, elt, Qundef) == Qundef) {
-	    rb_hash_aset(hash, elt, elt);
-	}
-    }
-    return hash;
-}
-
-static inline VALUE
-ary_tmp_hash_new(void)
-{
-    VALUE hash = rb_hash_new();
-
-    RBASIC_CLEAR_CLASS(hash);
-    return hash;
-}
-
-static VALUE
-ary_make_hash(VALUE ary)
-{
-    VALUE hash = ary_tmp_hash_new();
-    return ary_add_hash(hash, ary);
-}
-
-static VALUE
-ary_add_hash_by(VALUE hash, VALUE ary)
-{
-    long i;
-
-    for (i = 0; i < RARRAY_LEN(ary); ++i) {
-	VALUE v = rb_ary_elt(ary, i), k = rb_yield(v);
-	if (rb_hash_lookup2(hash, k, Qundef) == Qundef) {
-	    rb_hash_aset(hash, k, v);
-	}
-    }
-    return hash;
-}
-
-static VALUE
-ary_make_hash_by(VALUE ary)
-{
-    VALUE hash = ary_tmp_hash_new();
-    return ary_add_hash_by(hash, ary);
-}
-
-static inline void
-ary_recycle_hash(VALUE hash)
-{
-    if (RHASH(hash)->ntbl) {
-	st_table *tbl = RHASH(hash)->ntbl;
-	RHASH(hash)->ntbl = 0;
-	st_free_table(tbl);
-    }
-    RB_GC_GUARD(hash);
-}
-
-/*
- *  call-seq:
- *     ary - other_ary    -> new_ary
- *
- *  Array Difference
- *
- *  Returns a new array that is a copy of the original array, removing any
- *  items that also appear in +other_ary+. The order is preserved from the
- *  original array.
- *
- *  It compares elements using their #hash and #eql? methods for efficiency.
- *
- *     [ 1, 1, 2, 2, 3, 3, 4, 5 ] - [ 1, 2, 4 ]  #=>  [ 3, 3, 5 ]
- *
- *  If you need set-like behavior, see the library class Set.
- */
-
-static VALUE
-rb_ary_diff(VALUE ary1, VALUE ary2)
+ary_diff(ary1, ary2)
+    VALUE ary1, ary2;
 {
     VALUE ary3;
-    VALUE hash;
-    long i;
-
-    hash = ary_make_hash(to_ary(ary2));
-    ary3 = rb_ary_new();
-
-    for (i=0; i<RARRAY_LEN(ary1); i++) {
-	if (st_lookup(rb_hash_tbl_raw(hash), RARRAY_AREF(ary1, i), 0)) continue;
-	rb_ary_push(ary3, rb_ary_elt(ary1, i));
-    }
-    ary_recycle_hash(hash);
-    return ary3;
-}
-
-/*
- *  call-seq:
- *     ary & other_ary      -> new_ary
- *
- *  Set Intersection --- Returns a new array containing elements common to the
- *  two arrays, excluding any duplicates. The order is preserved from the
- *  original array.
- *
- *  It compares elements using their #hash and #eql? methods for efficiency.
- *
- *     [ 1, 1, 3, 5 ] & [ 1, 2, 3 ]                 #=> [ 1, 3 ]
- *     [ 'a', 'b', 'b', 'z' ] & [ 'a', 'b', 'c' ]   #=> [ 'a', 'b' ]
- *
- *  See also Array#uniq.
- */
-
-
-static VALUE
-rb_ary_and(VALUE ary1, VALUE ary2)
-{
-    VALUE hash, ary3, v;
-    st_table *table;
-    st_data_t vv;
-    long i;
+    int i;
 
     ary2 = to_ary(ary2);
-    ary3 = rb_ary_new();
-    if (RARRAY_LEN(ary2) == 0) return ary3;
-    hash = ary_make_hash(ary2);
-    table = rb_hash_tbl_raw(hash);
-
-    for (i=0; i<RARRAY_LEN(ary1); i++) {
-	v = RARRAY_AREF(ary1, i);
-	vv = (st_data_t)v;
-	if (st_delete(table, &vv, 0)) {
-	    rb_ary_push(ary3, v);
-	}
+    ary3 = ary_new();
+    for (i=0; i<RARRAY(ary1)->len; i++) {
+	if (ary_includes(ary2, RARRAY(ary1)->ptr[i])) continue;
+	if (ary_includes(ary3, RARRAY(ary1)->ptr[i])) continue;
+	ary_push(ary3, RARRAY(ary1)->ptr[i]);
     }
-    ary_recycle_hash(hash);
-
     return ary3;
 }
 
-static int
-ary_hash_orset(st_data_t *key, st_data_t *value, st_data_t arg, int existing)
-{
-    if (existing) return ST_STOP;
-    *key = *value = (VALUE)arg;
-    return ST_CONTINUE;
-}
-
-/*
- *  call-seq:
- *     ary | other_ary     -> new_ary
- *
- *  Set Union --- Returns a new array by joining +ary+ with +other_ary+,
- *  excluding any duplicates and preserving the order from the original array.
- *
- *  It compares elements using their #hash and #eql? methods for efficiency.
- *
- *     [ "a", "b", "c" ] | [ "c", "d", "a" ]    #=> [ "a", "b", "c", "d" ]
- *
- *  See also Array#uniq.
- */
-
 static VALUE
-rb_ary_or(VALUE ary1, VALUE ary2)
+ary_and(ary1, ary2)
+    VALUE ary1, ary2;
 {
-    VALUE hash, ary3;
-    long i;
+    VALUE ary3;
+    int i;
 
     ary2 = to_ary(ary2);
-    hash = ary_make_hash(ary1);
-
-    for (i=0; i<RARRAY_LEN(ary2); i++) {
-	VALUE elt = RARRAY_AREF(ary2, i);
-	if (!st_update(RHASH_TBL_RAW(hash), (st_data_t)elt, ary_hash_orset, (st_data_t)elt)) {
-	    RB_OBJ_WRITTEN(hash, Qundef, elt);
+    ary3 = ary_new();
+    for (i=0; i<RARRAY(ary1)->len; i++) {
+	if (ary_includes(ary2, RARRAY(ary1)->ptr[i])
+	    && !ary_includes(ary3, RARRAY(ary1)->ptr[i])) {
+	    ary_push(ary3, RARRAY(ary1)->ptr[i]);
 	}
     }
-    ary3 = rb_hash_values(hash);
-    ary_recycle_hash(hash);
     return ary3;
 }
 
-static int
-push_value(st_data_t key, st_data_t val, st_data_t ary)
-{
-    rb_ary_push((VALUE)ary, (VALUE)val);
-    return ST_CONTINUE;
-}
-
-/*
- *  call-seq:
- *     ary.uniq!                -> ary or nil
- *     ary.uniq! { |item| ... } -> ary or nil
- *
- *  Removes duplicate elements from +self+.
- *
- *  If a block is given, it will use the return value of the block for
- *  comparison.
- *
- *  It compares values using their #hash and #eql? methods for efficiency.
- *
- *  +self+ is traversed in order, and the first occurrence is kept.
- *
- *  Returns +nil+ if no changes are made (that is, no duplicates are found).
- *
- *     a = [ "a", "a", "b", "b", "c" ]
- *     a.uniq!   # => ["a", "b", "c"]
- *
- *     b = [ "a", "b", "c" ]
- *     b.uniq!   # => nil
- *
- *     c = [["student","sam"], ["student","george"], ["teacher","matz"]]
- *     c.uniq! { |s| s.first } # => [["student", "sam"], ["teacher", "matz"]]
- *
- */
-
 static VALUE
-rb_ary_uniq_bang(VALUE ary)
+ary_or(ary1, ary2)
+    VALUE ary1, ary2;
 {
-    VALUE hash;
-    long hash_size;
-
-    rb_ary_modify_check(ary);
-    if (RARRAY_LEN(ary) <= 1)
-        return Qnil;
-    if (rb_block_given_p())
-	hash = ary_make_hash_by(ary);
-    else
-	hash = ary_make_hash(ary);
-
-    hash_size = RHASH_SIZE(hash);
-    if (RARRAY_LEN(ary) == hash_size) {
-	return Qnil;
-    }
-    rb_ary_modify_check(ary);
-    ARY_SET_LEN(ary, 0);
-    if (ARY_SHARED_P(ary) && !ARY_EMBED_P(ary)) {
-	rb_ary_unshare(ary);
-	FL_SET_EMBED(ary);
-    }
-    ary_resize_capa(ary, hash_size);
-    st_foreach(rb_hash_tbl_raw(hash), push_value, ary);
-    ary_recycle_hash(hash);
-
-    return ary;
-}
-
-/*
- *  call-seq:
- *     ary.uniq                -> new_ary
- *     ary.uniq { |item| ... } -> new_ary
- *
- *  Returns a new array by removing duplicate values in +self+.
- *
- *  If a block is given, it will use the return value of the block for comparison.
- *
- *  It compares values using their #hash and #eql? methods for efficiency.
- *
- *  +self+ is traversed in order, and the first occurrence is kept.
- *
- *     a = [ "a", "a", "b", "b", "c" ]
- *     a.uniq   # => ["a", "b", "c"]
- *
- *     b = [["student","sam"], ["student","george"], ["teacher","matz"]]
- *     b.uniq { |s| s.first } # => [["student", "sam"], ["teacher", "matz"]]
- *
- */
-
-static VALUE
-rb_ary_uniq(VALUE ary)
-{
-    VALUE hash, uniq;
+    VALUE ary3;
+    int i;
 
-    if (RARRAY_LEN(ary) <= 1)
-        return rb_ary_dup(ary);
-    if (rb_block_given_p()) {
-	hash = ary_make_hash_by(ary);
-	uniq = rb_hash_values(hash);
+    if (TYPE(ary2) != T_ARRAY) {
+	if (ary_includes(ary1, ary2)) return ary1;
+	else return ary_plus(ary1, ary2);
     }
-    else {
-	hash = ary_make_hash(ary);
-	uniq = rb_hash_values(hash);
-    }
-    RBASIC_SET_CLASS(uniq, rb_obj_class(ary));
-    ary_recycle_hash(hash);
-
-    return uniq;
-}
-
-/*
- *  call-seq:
- *     ary.compact!    -> ary  or  nil
- *
- *  Removes +nil+ elements from the array.
- *
- *  Returns +nil+ if no changes were made, otherwise returns the array.
- *
- *     [ "a", nil, "b", nil, "c" ].compact! #=> [ "a", "b", "c" ]
- *     [ "a", "b", "c" ].compact!           #=> nil
- */
 
-static VALUE
-rb_ary_compact_bang(VALUE ary)
-{
-    VALUE *p, *t, *end;
-    long n;
-
-    rb_ary_modify(ary);
-    p = t = (VALUE *)RARRAY_CONST_PTR(ary); /* WB: no new reference */
-    end = p + RARRAY_LEN(ary);
-
-    while (t < end) {
-	if (NIL_P(*t)) t++;
-	else *p++ = *t++;
+    ary3 = ary_new();
+    for (i=0; i<RARRAY(ary1)->len; i++) {
+	if (!ary_includes(ary3, RARRAY(ary1)->ptr[i]))
+		ary_push(ary3, RARRAY(ary1)->ptr[i]);
     }
-    n = p - RARRAY_CONST_PTR(ary);
-    if (RARRAY_LEN(ary) == n) {
-	return Qnil;
+    for (i=0; i<RARRAY(ary2)->len; i++) {
+	if (!ary_includes(ary3, RARRAY(ary2)->ptr[i]))
+		ary_push(ary3, RARRAY(ary2)->ptr[i]);
     }
-    ary_resize_smaller(ary, n);
-
-    return ary;
-}
-
-/*
- *  call-seq:
- *     ary.compact     -> new_ary
- *
- *  Returns a copy of +self+ with all +nil+ elements removed.
- *
- *     [ "a", nil, "b", nil, "c", nil ].compact
- *                       #=> [ "a", "b", "c" ]
- */
-
-static VALUE
-rb_ary_compact(VALUE ary)
-{
-    ary = rb_ary_dup(ary);
-    rb_ary_compact_bang(ary);
-    return ary;
+    return ary3;
 }
 
-/*
- *  call-seq:
- *     ary.count                   -> int
- *     ary.count(obj)              -> int
- *     ary.count { |item| block }  -> int
- *
- *  Returns the number of elements.
- *
- *  If an argument is given, counts the number of elements which equal +obj+
- *  using <code>==</code>.
- *
- *  If a block is given, counts the number of elements for which the block
- *  returns a true value.
- *
- *     ary = [1, 2, 4, 2]
- *     ary.count                  #=> 4
- *     ary.count(2)               #=> 2
- *     ary.count { |x| x%2 == 0 } #=> 3
- *
- */
-
 static VALUE
-rb_ary_count(int argc, VALUE *argv, VALUE ary)
+ary_uniq_bang(ary)
+    VALUE ary;
 {
-    long i, n = 0;
-
-    if (argc == 0) {
-	VALUE v;
-
-	if (!rb_block_given_p())
-	    return LONG2NUM(RARRAY_LEN(ary));
+    VALUE *p, *q, *t, *end;
+    VALUE v;
+    int i;
 
-	for (i = 0; i < RARRAY_LEN(ary); i++) {
-	    v = RARRAY_AREF(ary, i);
-	    if (RTEST(rb_yield(v))) n++;
-	}
-    }
-    else {
-	VALUE obj;
+    ary_modify(ary);
+    p = RARRAY(ary)->ptr;
+    end = p + RARRAY(ary)->len;
 
-	rb_scan_args(argc, argv, "1", &obj);
-	if (rb_block_given_p()) {
-	    rb_warn("given block not used");
-	}
-	for (i = 0; i < RARRAY_LEN(ary); i++) {
-	    if (rb_equal(RARRAY_AREF(ary, i), obj)) n++;
+    while (p < end) {
+	v = *p++;
+	q = t = p;
+	while (q < end) {
+	    if (rb_equal(*q, v)) q++;
+	    else *t++ = *q++;
 	}
+	end = t;
     }
-
-    return LONG2NUM(n);
-}
-
-static VALUE
-flatten(VALUE ary, int level, int *modified)
-{
-    long i = 0;
-    VALUE stack, result, tmp, elt;
-    st_table *memo;
-    st_data_t id;
-
-    stack = ary_new(0, ARY_DEFAULT_SIZE);
-    result = ary_new(0, RARRAY_LEN(ary));
-    memo = st_init_numtable();
-    st_insert(memo, (st_data_t)ary, (st_data_t)Qtrue);
-    *modified = 0;
-
-    while (1) {
-	while (i < RARRAY_LEN(ary)) {
-	    elt = RARRAY_AREF(ary, i++);
-	    if (level >= 0 && RARRAY_LEN(stack) / 2 >= level) {
-		rb_ary_push(result, elt);
-		continue;
-	    }
-	    tmp = rb_check_array_type(elt);
-	    if (RBASIC(result)->klass) {
-		rb_raise(rb_eRuntimeError, "flatten reentered");
-	    }
-	    if (NIL_P(tmp)) {
-		rb_ary_push(result, elt);
-	    }
-	    else {
-		*modified = 1;
-		id = (st_data_t)tmp;
-		if (st_lookup(memo, id, 0)) {
-		    st_free_table(memo);
-		    rb_raise(rb_eArgError, "tried to flatten recursive array");
-		}
-		st_insert(memo, id, (st_data_t)Qtrue);
-		rb_ary_push(stack, ary);
-		rb_ary_push(stack, LONG2NUM(i));
-		ary = tmp;
-		i = 0;
-	    }
-	}
-	if (RARRAY_LEN(stack) == 0) {
-	    break;
-	}
-	id = (st_data_t)ary;
-	st_delete(memo, &id, 0);
-	tmp = rb_ary_pop(stack);
-	i = NUM2LONG(tmp);
-	ary = rb_ary_pop(stack);
-    }
-
-    st_free_table(memo);
-
-    RBASIC_SET_CLASS(result, rb_class_of(ary));
-    return result;
-}
-
-/*
- *  call-seq:
- *     ary.flatten!        -> ary or nil
- *     ary.flatten!(level) -> ary or nil
- *
- *  Flattens +self+ in place.
- *
- *  Returns +nil+ if no modifications were made (i.e., the array contains no
- *  subarrays.)
- *
- *  The optional +level+ argument determines the level of recursion to flatten.
- *
- *     a = [ 1, 2, [3, [4, 5] ] ]
- *     a.flatten!   #=> [1, 2, 3, 4, 5]
- *     a.flatten!   #=> nil
- *     a            #=> [1, 2, 3, 4, 5]
- *     a = [ 1, 2, [3, [4, 5] ] ]
- *     a.flatten!(1) #=> [1, 2, 3, [4, 5]]
- */
-
-static VALUE
-rb_ary_flatten_bang(int argc, VALUE *argv, VALUE ary)
-{
-    int mod = 0, level = -1;
-    VALUE result, lv;
-
-    rb_scan_args(argc, argv, "01", &lv);
-    rb_ary_modify_check(ary);
-    if (!NIL_P(lv)) level = NUM2INT(lv);
-    if (level == 0) return Qnil;
-
-    result = flatten(ary, level, &mod);
-    if (mod == 0) {
-	ary_discard(result);
+    if (RARRAY(ary)->len == (end - RARRAY(ary)->ptr)) {
 	return Qnil;
     }
-    if (!(mod = ARY_EMBED_P(result))) rb_obj_freeze(result);
-    rb_ary_replace(ary, result);
-    if (mod) ARY_SET_EMBED_LEN(result, 0);
 
-    return ary;
-}
+    RARRAY(ary)->len = (end - RARRAY(ary)->ptr);
 
-/*
- *  call-seq:
- *     ary.flatten -> new_ary
- *     ary.flatten(level) -> new_ary
- *
- *  Returns a new array that is a one-dimensional flattening of +self+
- *  (recursively).
- *
- *  That is, for every element that is an array, extract its elements into
- *  the new array.
- *
- *  The optional +level+ argument determines the level of recursion to
- *  flatten.
- *
- *     s = [ 1, 2, 3 ]           #=> [1, 2, 3]
- *     t = [ 4, 5, 6, [7, 8] ]   #=> [4, 5, 6, [7, 8]]
- *     a = [ s, t, 9, 10 ]       #=> [[1, 2, 3], [4, 5, 6, [7, 8]], 9, 10]
- *     a.flatten                 #=> [1, 2, 3, 4, 5, 6, 7, 8, 9, 10]
- *     a = [ 1, 2, [3, [4, 5] ] ]
- *     a.flatten(1)              #=> [1, 2, 3, [4, 5]]
- */
-
-static VALUE
-rb_ary_flatten(int argc, VALUE *argv, VALUE ary)
-{
-    int mod = 0, level = -1;
-    VALUE result, lv;
-
-    rb_scan_args(argc, argv, "01", &lv);
-    if (!NIL_P(lv)) level = NUM2INT(lv);
-    if (level == 0) return ary_make_shared_copy(ary);
-
-    result = flatten(ary, level, &mod);
-    OBJ_INFECT(result, ary);
-
-    return result;
-}
-
-#define OPTHASH_GIVEN_P(opts) \
-    (argc > 0 && !NIL_P((opts) = rb_check_hash_type(argv[argc-1])) && (--argc, 1))
-static ID id_random;
-
-#define RAND_UPTO(max) (long)rb_random_ulong_limited((randgen), (max)-1)
-
-/*
- *  call-seq:
- *     ary.shuffle!              -> ary
- *     ary.shuffle!(random: rng) -> ary
- *
- *  Shuffles elements in +self+ in place.
- *
- *     a = [ 1, 2, 3 ]           #=> [1, 2, 3]
- *     a.shuffle!                #=> [2, 3, 1]
- *     a                         #=> [2, 3, 1]
- *
- *  The optional +rng+ argument will be used as the random number generator.
- *
- *     a.shuffle!(random: Random.new(1))  #=> [1, 3, 2]
- */
-
-static VALUE
-rb_ary_shuffle_bang(int argc, VALUE *argv, VALUE ary)
-{
-    VALUE opts, randgen = rb_cRandom;
-    long i, len;
-
-    if (OPTHASH_GIVEN_P(opts)) {
-	VALUE rnd;
-	ID keyword_ids[1];
-
-	keyword_ids[0] = id_random;
-	rb_get_kwargs(opts, keyword_ids, 0, 1, &rnd);
-	if (rnd != Qundef) {
-	    randgen = rnd;
-	}
-    }
-    rb_check_arity(argc, 0, 0);
-    rb_ary_modify(ary);
-    i = len = RARRAY_LEN(ary);
-    RARRAY_PTR_USE(ary, ptr, {
-	while (i) {
-	    long j = RAND_UPTO(i);
-	    VALUE tmp;
-	    if (len != RARRAY_LEN(ary) || ptr != RARRAY_CONST_PTR(ary)) {
-		rb_raise(rb_eRuntimeError, "modified during shuffle");
-	    }
-	    tmp = ptr[--i];
-	    ptr[i] = ptr[j];
-	    ptr[j] = tmp;
-	}
-    }); /* WB: no new reference */
     return ary;
 }
 
-
-/*
- *  call-seq:
- *     ary.shuffle              -> new_ary
- *     ary.shuffle(random: rng) -> new_ary
- *
- *  Returns a new array with elements of +self+ shuffled.
- *
- *     a = [ 1, 2, 3 ]           #=> [1, 2, 3]
- *     a.shuffle                 #=> [2, 3, 1]
- *     a                         #=> [1, 2, 3]
- *
- *  The optional +rng+ argument will be used as the random number generator.
- *
- *     a.shuffle(random: Random.new(1))  #=> [1, 3, 2]
- */
-
-static VALUE
-rb_ary_shuffle(int argc, VALUE *argv, VALUE ary)
-{
-    ary = rb_ary_dup(ary);
-    rb_ary_shuffle_bang(argc, argv, ary);
-    return ary;
-}
-
-
-/*
- *  call-seq:
- *     ary.sample                  -> obj
- *     ary.sample(random: rng)     -> obj
- *     ary.sample(n)               -> new_ary
- *     ary.sample(n, random: rng)  -> new_ary
- *
- *  Choose a random element or +n+ random elements from the array.
- *
- *  The elements are chosen by using random and unique indices into the array
- *  in order to ensure that an element doesn't repeat itself unless the array
- *  already contained duplicate elements.
- *
- *  If the array is empty the first form returns +nil+ and the second form
- *  returns an empty array.
- *
- *  The optional +rng+ argument will be used as the random number generator.
- *
- *     a = [ 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 ]
- *     a.sample         #=> 7
- *     a.sample(4)      #=> [6, 4, 2, 5]
- */
-
-
-static VALUE
-rb_ary_sample(int argc, VALUE *argv, VALUE ary)
-{
-    VALUE nv, result;
-    VALUE opts, randgen = rb_cRandom;
-    long n, len, i, j, k, idx[10];
-    long rnds[numberof(idx)];
-
-    if (OPTHASH_GIVEN_P(opts)) {
-	VALUE rnd;
-	ID keyword_ids[1];
-
-	keyword_ids[0] = id_random;
-	rb_get_kwargs(opts, keyword_ids, 0, 1, &rnd);
-	if (rnd != Qundef) {
-	    randgen = rnd;
-	}
-    }
-    len = RARRAY_LEN(ary);
-    if (argc == 0) {
-	if (len < 2)
-	    i = 0;
-	else
-	    i = RAND_UPTO(len);
-
-	return rb_ary_elt(ary, i);
-    }
-    rb_scan_args(argc, argv, "1", &nv);
-    n = NUM2LONG(nv);
-    if (n < 0) rb_raise(rb_eArgError, "negative sample number");
-    if (n > len) n = len;
-    if (n <= numberof(idx)) {
-	for (i = 0; i < n; ++i) {
-	    rnds[i] = RAND_UPTO(len - i);
-	}
-    }
-    k = len;
-    len = RARRAY_LEN(ary);
-    if (len < k && n <= numberof(idx)) {
-	for (i = 0; i < n; ++i) {
-	    if (rnds[i] >= len) return rb_ary_new_capa(0);
-	}
-    }
-    if (n > len) n = len;
-    switch (n) {
-      case 0:
-	return rb_ary_new_capa(0);
-      case 1:
-	i = rnds[0];
-	return rb_ary_new_from_values(1, &RARRAY_AREF(ary, i));
-      case 2:
-	i = rnds[0];
-	j = rnds[1];
-	if (j >= i) j++;
-	return rb_ary_new_from_args(2, RARRAY_AREF(ary, i), RARRAY_AREF(ary, j));
-      case 3:
-	i = rnds[0];
-	j = rnds[1];
-	k = rnds[2];
-	{
-	    long l = j, g = i;
-	    if (j >= i) l = i, g = ++j;
-	    if (k >= l && (++k >= g)) ++k;
-	}
-	return rb_ary_new_from_args(3, RARRAY_AREF(ary, i), RARRAY_AREF(ary, j), RARRAY_AREF(ary, k));
-    }
-    if (n <= numberof(idx)) {
-	long sorted[numberof(idx)];
-	sorted[0] = idx[0] = rnds[0];
-	for (i=1; i<n; i++) {
-	    k = rnds[i];
-	    for (j = 0; j < i; ++j) {
-		if (k < sorted[j]) break;
-		++k;
-	    }
-	    memmove(&sorted[j+1], &sorted[j], sizeof(sorted[0])*(i-j));
-	    sorted[j] = idx[i] = k;
-	}
-	result = rb_ary_new_capa(n);
-	RARRAY_PTR_USE(result, ptr_result, {
-	    for (i=0; i<n; i++) {
-		ptr_result[i] = RARRAY_AREF(ary, idx[i]);
-	    }
-	});
-    }
-    else {
-	result = rb_ary_dup(ary);
-	RBASIC_CLEAR_CLASS(result);
-	RB_GC_GUARD(ary);
-	RARRAY_PTR_USE(result, ptr_result, {
-	    for (i=0; i<n; i++) {
-		j = RAND_UPTO(len-i) + i;
-		nv = ptr_result[j];
-		ptr_result[j] = ptr_result[i];
-		ptr_result[i] = nv;
-	    }
-	});
-	RBASIC_SET_CLASS_RAW(result, rb_cArray);
-    }
-    ARY_SET_LEN(result, n);
-
-    return result;
-}
-
-static VALUE
-rb_ary_cycle_size(VALUE self, VALUE args, VALUE eobj)
-{
-    long mul;
-    VALUE n = Qnil;
-    if (args && (RARRAY_LEN(args) > 0)) {
-	n = RARRAY_AREF(args, 0);
-    }
-    if (RARRAY_LEN(self) == 0) return INT2FIX(0);
-    if (n == Qnil) return DBL2NUM(INFINITY);
-    mul = NUM2LONG(n);
-    if (mul <= 0) return INT2FIX(0);
-    n = LONG2FIX(mul);
-    return rb_funcallv(rb_ary_length(self), '*', 1, &n);
-}
-
-/*
- *  call-seq:
- *     ary.cycle(n=nil) { |obj| block }  -> nil
- *     ary.cycle(n=nil)                  -> Enumerator
- *
- *  Calls the given block for each element +n+ times or forever if +nil+ is
- *  given.
- *
- *  Does nothing if a non-positive number is given or the array is empty.
- *
- *  Returns +nil+ if the loop has finished without getting interrupted.
- *
- *  If no block is given, an Enumerator is returned instead.
- *
- *     a = ["a", "b", "c"]
- *     a.cycle { |x| puts x }     # print, a, b, c, a, b, c,.. forever.
- *     a.cycle(2) { |x| puts x }  # print, a, b, c, a, b, c.
- *
- */
-
-static VALUE
-rb_ary_cycle(int argc, VALUE *argv, VALUE ary)
-{
-    long n, i;
-    VALUE nv = Qnil;
-
-    rb_scan_args(argc, argv, "01", &nv);
-
-    RETURN_SIZED_ENUMERATOR(ary, argc, argv, rb_ary_cycle_size);
-    if (NIL_P(nv)) {
-        n = -1;
-    }
-    else {
-        n = NUM2LONG(nv);
-        if (n <= 0) return Qnil;
-    }
-
-    while (RARRAY_LEN(ary) > 0 && (n < 0 || 0 < n--)) {
-        for (i=0; i<RARRAY_LEN(ary); i++) {
-            rb_yield(RARRAY_AREF(ary, i));
-        }
-    }
-    return Qnil;
-}
-
-#define tmpbuf(n, size) rb_str_tmp_new((n)*(size))
-#define tmpbuf_discard(s) (rb_str_resize((s), 0L), RBASIC_SET_CLASS_RAW(s, rb_cString))
-#define tmpary(n) rb_ary_tmp_new(n)
-#define tmpary_discard(a) (ary_discard(a), RBASIC_SET_CLASS_RAW(a, rb_cArray))
-
-/*
- * Build a ruby array of the corresponding values and yield it to the
- * associated block.
- * Return the class of +values+ for reentry check.
- */
-static int
-yield_indexed_values(const VALUE values, const long r, const long *const p)
-{
-    const VALUE result = rb_ary_new2(r);
-    VALUE *const result_array = RARRAY_PTR(result);
-    const VALUE *const values_array = RARRAY_CONST_PTR(values);
-    long i;
-
-    for (i = 0; i < r; i++) result_array[i] = values_array[p[i]];
-    ARY_SET_LEN(result, r);
-    rb_yield(result);
-    return !RBASIC(values)->klass;
-}
-
-/*
- * Compute permutations of +r+ elements of the set <code>[0..n-1]</code>.
- *
- * When we have a complete permutation of array indexes, copy the values
- * at those indexes into a new array and yield that array.
- *
- * n: the size of the set
- * r: the number of elements in each permutation
- * p: the array (of size r) that we're filling in
- * used: an array of booleans: whether a given index is already used
- * values: the Ruby array that holds the actual values to permute
- */
-static void
-permute0(const long n, const long r, long *const p, char *const used, const VALUE values)
-{
-    long i = 0, index = 0;
-
-    for (;;) {
-	const char *const unused = memchr(&used[i], 0, n-i);
-	if (!unused) {
-	    if (!index) break;
-	    i = p[--index];                /* pop index */
-	    used[i++] = 0;                 /* index unused */
-	}
-	else {
-	    i = unused - used;
-	    p[index] = i;
-	    used[i] = 1;                   /* mark index used */
-	    ++index;
-	    if (index < r-1) {             /* if not done yet */
-		p[index] = i = 0;
-		continue;
-	    }
-	    for (i = 0; i < n; ++i) {
-		if (used[i]) continue;
-		p[index] = i;
-		if (!yield_indexed_values(values, r, p)) {
-		    rb_raise(rb_eRuntimeError, "permute reentered");
-		}
-	    }
-	    i = p[--index];                /* pop index */
-	    used[i] = 0;                   /* index unused */
-	    p[index] = ++i;
-	}
-    }
-}
-
-/*
- * Returns the product of from, from-1, ..., from - how_many + 1.
- * http://en.wikipedia.org/wiki/Pochhammer_symbol
- */
 static VALUE
-descending_factorial(long from, long how_many)
-{
-    VALUE cnt = LONG2FIX(how_many >= 0);
-    while (how_many-- > 0) {
-	VALUE v = LONG2FIX(from--);
-	cnt = rb_funcallv(cnt, '*', 1, &v);
-    }
-    return cnt;
-}
-
-static VALUE
-binomial_coefficient(long comb, long size)
-{
-    VALUE r, v;
-    if (comb > size-comb) {
-	comb = size-comb;
-    }
-    if (comb < 0) {
-	return LONG2FIX(0);
-    }
-    r = descending_factorial(size, comb);
-    v = descending_factorial(comb, comb);
-    return rb_funcallv(r, id_div, 1, &v);
-}
-
-static VALUE
-rb_ary_permutation_size(VALUE ary, VALUE args, VALUE eobj)
+ary_uniq(ary)
+    VALUE ary;
 {
-    long n = RARRAY_LEN(ary);
-    long k = (args && (RARRAY_LEN(args) > 0)) ? NUM2LONG(RARRAY_AREF(args, 0)) : n;
+    VALUE v = ary_uniq_bang(ary_dup(ary));
 
-    return descending_factorial(n, k);
+    if (NIL_P(v)) return ary;
+    return v;
 }
 
-/*
- *  call-seq:
- *     ary.permutation { |p| block }          -> ary
- *     ary.permutation                        -> Enumerator
- *     ary.permutation(n) { |p| block }       -> ary
- *     ary.permutation(n)                     -> Enumerator
- *
- * When invoked with a block, yield all permutations of length +n+ of the
- * elements of the array, then return the array itself.
- *
- * If +n+ is not specified, yield all permutations of all elements.
- *
- * The implementation makes no guarantees about the order in which the
- * permutations are yielded.
- *
- * If no block is given, an Enumerator is returned instead.
- *
- * Examples:
- *
- *   a = [1, 2, 3]
- *   a.permutation.to_a    #=> [[1,2,3],[1,3,2],[2,1,3],[2,3,1],[3,1,2],[3,2,1]]
- *   a.permutation(1).to_a #=> [[1],[2],[3]]
- *   a.permutation(2).to_a #=> [[1,2],[1,3],[2,1],[2,3],[3,1],[3,2]]
- *   a.permutation(3).to_a #=> [[1,2,3],[1,3,2],[2,1,3],[2,3,1],[3,1,2],[3,2,1]]
- *   a.permutation(0).to_a #=> [[]] # one permutation of length 0
- *   a.permutation(4).to_a #=> []   # no permutations of length 4
- */
-
 static VALUE
-rb_ary_permutation(int argc, VALUE *argv, VALUE ary)
+ary_compact_bang(ary)
+    VALUE ary;
 {
-    VALUE num;
-    long r, n, i;
-
-    n = RARRAY_LEN(ary);                  /* Array length */
-    RETURN_SIZED_ENUMERATOR(ary, argc, argv, rb_ary_permutation_size);   /* Return enumerator if no block */
-    rb_scan_args(argc, argv, "01", &num);
-    r = NIL_P(num) ? n : NUM2LONG(num);   /* Permutation size from argument */
+    VALUE *p, *t, *end;
 
-    if (r < 0 || n < r) {
-	/* no permutations: yield nothing */
-    }
-    else if (r == 0) { /* exactly one permutation: the zero-length array */
-	rb_yield(rb_ary_new2(0));
-    }
-    else if (r == 1) { /* this is a special, easy case */
-	for (i = 0; i < RARRAY_LEN(ary); i++) {
-	    rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
-	}
-    }
-    else {             /* this is the general case */
-	volatile VALUE t0;
-	long *p = ALLOCV_N(long, t0, r+roomof(n, sizeof(long)));
-	char *used = (char*)(p + r);
-	VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
-	RBASIC_CLEAR_CLASS(ary0);
-
-	MEMZERO(used, char, n); /* initialize array */
-
-	permute0(n, r, p, used, ary0); /* compute and yield permutations */
-	ALLOCV_END(t0);
-	RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
+    ary_modify(ary);
+    p = t = RARRAY(ary)->ptr;
+    end = p + RARRAY(ary)->len;
+    while (t < end) {
+	if (NIL_P(*t)) t++;
+	else *p++ = *t++;
     }
-    return ary;
-}
-
-static void
-combinate0(const long len, const long n, long *const stack, const VALUE values)
-{
-    long lev = 0;
-
-    MEMZERO(stack+1, long, n);
-    stack[0] = -1;
-    for (;;) {
-	for (lev++; lev < n; lev++) {
-	    stack[lev+1] = stack[lev]+1;
-	}
-	if (!yield_indexed_values(values, n, stack+1)) {
-	    rb_raise(rb_eRuntimeError, "combination reentered");
-	}
-	do {
-	    if (lev == 0) return;
-	    stack[lev--]++;
-	} while (stack[lev+1]+n == len+lev+1);
+    if (RARRAY(ary)->len == (p - RARRAY(ary)->ptr)) {
+	return Qnil;
     }
-}
-
-static VALUE
-rb_ary_combination_size(VALUE ary, VALUE args, VALUE eobj)
-{
-    long n = RARRAY_LEN(ary);
-    long k = NUM2LONG(RARRAY_AREF(args, 0));
-
-    return binomial_coefficient(k, n);
-}
+    RARRAY(ary)->len = RARRAY(ary)->capa = (p - RARRAY(ary)->ptr);
+    REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
 
-/*
- *  call-seq:
- *     ary.combination(n) { |c| block }    -> ary
- *     ary.combination(n)                  -> Enumerator
- *
- * When invoked with a block, yields all combinations of length +n+ of elements
- * from the array and then returns the array itself.
- *
- * The implementation makes no guarantees about the order in which the
- * combinations are yielded.
- *
- * If no block is given, an Enumerator is returned instead.
- *
- * Examples:
- *
- *     a = [1, 2, 3, 4]
- *     a.combination(1).to_a  #=> [[1],[2],[3],[4]]
- *     a.combination(2).to_a  #=> [[1,2],[1,3],[1,4],[2,3],[2,4],[3,4]]
- *     a.combination(3).to_a  #=> [[1,2,3],[1,2,4],[1,3,4],[2,3,4]]
- *     a.combination(4).to_a  #=> [[1,2,3,4]]
- *     a.combination(0).to_a  #=> [[]] # one combination of length 0
- *     a.combination(5).to_a  #=> []   # no combinations of length 5
- *
- */
-
-static VALUE
-rb_ary_combination(VALUE ary, VALUE num)
-{
-    long i, n, len;
-
-    n = NUM2LONG(num);
-    RETURN_SIZED_ENUMERATOR(ary, 1, &num, rb_ary_combination_size);
-    len = RARRAY_LEN(ary);
-    if (n < 0 || len < n) {
-	/* yield nothing */
-    }
-    else if (n == 0) {
-	rb_yield(rb_ary_new2(0));
-    }
-    else if (n == 1) {
-	for (i = 0; i < len; i++) {
-	    rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
-	}
-    }
-    else {
-	VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
-	volatile VALUE t0;
-	long *stack = ALLOCV_N(long, t0, n+1);
-
-	RBASIC_CLEAR_CLASS(ary0);
-	combinate0(len, n, stack, ary0);
-	ALLOCV_END(t0);
-	RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
-    }
     return ary;
 }
 
-/*
- * Compute repeated permutations of +r+ elements of the set
- * <code>[0..n-1]</code>.
- *
- * When we have a complete repeated permutation of array indexes, copy the
- * values at those indexes into a new array and yield that array.
- *
- * n: the size of the set
- * r: the number of elements in each permutation
- * p: the array (of size r) that we're filling in
- * values: the Ruby array that holds the actual values to permute
- */
-static void
-rpermute0(const long n, const long r, long *const p, const VALUE values)
-{
-    long i = 0, index = 0;
-
-    p[index] = i;
-    for (;;) {
-	if (++index < r-1) {
-	    p[index] = i = 0;
-	    continue;
-	}
-	for (i = 0; i < n; ++i) {
-	    p[index] = i;
-	    if (!yield_indexed_values(values, r, p)) {
-		rb_raise(rb_eRuntimeError, "repeated permute reentered");
-	    }
-	}
-	do {
-	    if (index <= 0) return;
-	} while ((i = ++p[--index]) >= n);
-    }
-}
-
 static VALUE
-rb_ary_repeated_permutation_size(VALUE ary, VALUE args, VALUE eobj)
+ary_compact(ary)
+    VALUE ary;
 {
-    long n = RARRAY_LEN(ary);
-    long k = NUM2LONG(RARRAY_AREF(args, 0));
-    VALUE v;
+    VALUE v = ary_compact_bang(ary_dup(ary));
 
-    if (k < 0) {
-	return LONG2FIX(0);
-    }
-
-    v = LONG2NUM(k);
-    return rb_funcallv(LONG2NUM(n), id_power, 1, &v);
+    if (NIL_P(v)) return ary;
+    return v;
 }
 
-/*
- *  call-seq:
- *     ary.repeated_permutation(n) { |p| block } -> ary
- *     ary.repeated_permutation(n)               -> Enumerator
- *
- * When invoked with a block, yield all repeated permutations of length +n+ of
- * the elements of the array, then return the array itself.
- *
- * The implementation makes no guarantees about the order in which the repeated
- * permutations are yielded.
- *
- * If no block is given, an Enumerator is returned instead.
- *
- * Examples:
- *
- *     a = [1, 2]
- *     a.repeated_permutation(1).to_a  #=> [[1], [2]]
- *     a.repeated_permutation(2).to_a  #=> [[1,1],[1,2],[2,1],[2,2]]
- *     a.repeated_permutation(3).to_a  #=> [[1,1,1],[1,1,2],[1,2,1],[1,2,2],
- *                                     #    [2,1,1],[2,1,2],[2,2,1],[2,2,2]]
- *     a.repeated_permutation(0).to_a  #=> [[]] # one permutation of length 0
- */
-
 static VALUE
-rb_ary_repeated_permutation(VALUE ary, VALUE num)
-{
-    long r, n, i;
-
-    n = RARRAY_LEN(ary);                  /* Array length */
-    RETURN_SIZED_ENUMERATOR(ary, 1, &num, rb_ary_repeated_permutation_size);      /* Return Enumerator if no block */
-    r = NUM2LONG(num);                    /* Permutation size from argument */
-
-    if (r < 0) {
-	/* no permutations: yield nothing */
-    }
-    else if (r == 0) { /* exactly one permutation: the zero-length array */
-	rb_yield(rb_ary_new2(0));
-    }
-    else if (r == 1) { /* this is a special, easy case */
-	for (i = 0; i < RARRAY_LEN(ary); i++) {
-	    rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
-	}
-    }
-    else {             /* this is the general case */
-	volatile VALUE t0;
-	long *p = ALLOCV_N(long, t0, r);
-	VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
-	RBASIC_CLEAR_CLASS(ary0);
-
-	rpermute0(n, r, p, ary0); /* compute and yield repeated permutations */
-	ALLOCV_END(t0);
-	RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
-    }
-    return ary;
-}
-
-static void
-rcombinate0(const long n, const long r, long *const p, const long rest, const VALUE values)
+ary_nitems(ary)
+    VALUE ary;
 {
-    long i = 0, index = 0;
+    int n = 0;
+    VALUE *p, *pend;
 
-    p[index] = i;
-    for (;;) {
-	if (++index < r-1) {
-	    p[index] = i;
-	    continue;
-	}
-	for (; i < n; ++i) {
-	    p[index] = i;
-	    if (!yield_indexed_values(values, r, p)) {
-		rb_raise(rb_eRuntimeError, "repeated combination reentered");
-	    }
-	}
-	do {
-	    if (index <= 0) return;
-	} while ((i = ++p[--index]) >= n);
-    }
-}
-
-static VALUE
-rb_ary_repeated_combination_size(VALUE ary, VALUE args, VALUE eobj)
-{
-    long n = RARRAY_LEN(ary);
-    long k = NUM2LONG(RARRAY_AREF(args, 0));
-    if (k == 0) {
-	return LONG2FIX(1);
+    p = RARRAY(ary)->ptr;
+    pend = p + RARRAY(ary)->len;
+    while (p < pend) {
+	if (!NIL_P(*p)) n++;
+	p++;
     }
-    return binomial_coefficient(k, n + k - 1);
+    return INT2FIX(n);
 }
 
-/*
- *  call-seq:
- *     ary.repeated_combination(n) { |c| block } -> ary
- *     ary.repeated_combination(n)               -> Enumerator
- *
- * When invoked with a block, yields all repeated combinations of length +n+ of
- * elements from the array and then returns the array itself.
- *
- * The implementation makes no guarantees about the order in which the repeated
- * combinations are yielded.
- *
- * If no block is given, an Enumerator is returned instead.
- *
- * Examples:
- *
- *   a = [1, 2, 3]
- *   a.repeated_combination(1).to_a  #=> [[1], [2], [3]]
- *   a.repeated_combination(2).to_a  #=> [[1,1],[1,2],[1,3],[2,2],[2,3],[3,3]]
- *   a.repeated_combination(3).to_a  #=> [[1,1,1],[1,1,2],[1,1,3],[1,2,2],[1,2,3],
- *                                   #    [1,3,3],[2,2,2],[2,2,3],[2,3,3],[3,3,3]]
- *   a.repeated_combination(4).to_a  #=> [[1,1,1,1],[1,1,1,2],[1,1,1,3],[1,1,2,2],[1,1,2,3],
- *                                   #    [1,1,3,3],[1,2,2,2],[1,2,2,3],[1,2,3,3],[1,3,3,3],
- *                                   #    [2,2,2,2],[2,2,2,3],[2,2,3,3],[2,3,3,3],[3,3,3,3]]
- *   a.repeated_combination(0).to_a  #=> [[]] # one combination of length 0
- *
- */
-
 static VALUE
-rb_ary_repeated_combination(VALUE ary, VALUE num)
+ary_flatten_bang(ary)
+    VALUE ary;
 {
-    long n, i, len;
+    int i;
+    int mod = 0;
 
-    n = NUM2LONG(num);                 /* Combination size from argument */
-    RETURN_SIZED_ENUMERATOR(ary, 1, &num, rb_ary_repeated_combination_size);   /* Return enumerator if no block */
-    len = RARRAY_LEN(ary);
-    if (n < 0) {
-	/* yield nothing */
-    }
-    else if (n == 0) {
-	rb_yield(rb_ary_new2(0));
-    }
-    else if (n == 1) {
-	for (i = 0; i < len; i++) {
-	    rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
+    ary_modify(ary);
+    for (i=0; i<RARRAY(ary)->len; i++) {
+	VALUE ary2 = RARRAY(ary)->ptr[i];
+	if (TYPE(ary2) == T_ARRAY) {
+	    ary_replace(ary, i--, 1, ary2);
+	    mod = 1;
 	}
     }
-    else if (len == 0) {
-	/* yield nothing */
-    }
-    else {
-	volatile VALUE t0;
-	long *p = ALLOCV_N(long, t0, n);
-	VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
-	RBASIC_CLEAR_CLASS(ary0);
-
-	rcombinate0(len, n, p, n, ary0); /* compute and yield repeated combinations */
-	ALLOCV_END(t0);
-	RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
-    }
+    if (mod == 0) return Qnil;
     return ary;
 }
 
-/*
- *  call-seq:
- *     ary.product(other_ary, ...)                -> new_ary
- *     ary.product(other_ary, ...) { |p| block }  -> ary
- *
- *  Returns an array of all combinations of elements from all arrays.
- *
- *  The length of the returned array is the product of the length of +self+ and
- *  the argument arrays.
- *
- *  If given a block, #product will yield all combinations and return +self+
- *  instead.
- *
- *     [1,2,3].product([4,5])     #=> [[1,4],[1,5],[2,4],[2,5],[3,4],[3,5]]
- *     [1,2].product([1,2])       #=> [[1,1],[1,2],[2,1],[2,2]]
- *     [1,2].product([3,4],[5,6]) #=> [[1,3,5],[1,3,6],[1,4,5],[1,4,6],
- *                                #     [2,3,5],[2,3,6],[2,4,5],[2,4,6]]
- *     [1,2].product()            #=> [[1],[2]]
- *     [1,2].product([])          #=> []
- */
-
 static VALUE
-rb_ary_product(int argc, VALUE *argv, VALUE ary)
-{
-    int n = argc+1;    /* How many arrays we're operating on */
-    volatile VALUE t0 = tmpary(n);
-    volatile VALUE t1 = tmpbuf(n, sizeof(int));
-    VALUE *arrays = RARRAY_PTR(t0); /* The arrays we're computing the product of */
-    int *counters = (int*)RSTRING_PTR(t1); /* The current position in each one */
-    VALUE result = Qnil;      /* The array we'll be returning, when no block given */
-    long i,j;
-    long resultlen = 1;
-
-    RBASIC_CLEAR_CLASS(t0);
-    RBASIC_CLEAR_CLASS(t1);
-
-    /* initialize the arrays of arrays */
-    ARY_SET_LEN(t0, n);
-    arrays[0] = ary;
-    for (i = 1; i < n; i++) arrays[i] = Qnil;
-    for (i = 1; i < n; i++) arrays[i] = to_ary(argv[i-1]);
-
-    /* initialize the counters for the arrays */
-    for (i = 0; i < n; i++) counters[i] = 0;
-
-    /* Otherwise, allocate and fill in an array of results */
-    if (rb_block_given_p()) {
-	/* Make defensive copies of arrays; exit if any is empty */
-	for (i = 0; i < n; i++) {
-	    if (RARRAY_LEN(arrays[i]) == 0) goto done;
-	    arrays[i] = ary_make_shared_copy(arrays[i]);
-	}
-    }
-    else {
-	/* Compute the length of the result array; return [] if any is empty */
-	for (i = 0; i < n; i++) {
-	    long k = RARRAY_LEN(arrays[i]);
-	    if (k == 0) {
-		result = rb_ary_new2(0);
-		goto done;
-	    }
-            if (MUL_OVERFLOW_LONG_P(resultlen, k))
-		rb_raise(rb_eRangeError, "too big to product");
-	    resultlen *= k;
-	}
-	result = rb_ary_new2(resultlen);
-    }
-    for (;;) {
-	int m;
-	/* fill in one subarray */
-	VALUE subarray = rb_ary_new2(n);
-	for (j = 0; j < n; j++) {
-	    rb_ary_push(subarray, rb_ary_entry(arrays[j], counters[j]));
-	}
-
-	/* put it on the result array */
-	if (NIL_P(result)) {
-	    FL_SET(t0, FL_USER5);
-	    rb_yield(subarray);
-	    if (! FL_TEST(t0, FL_USER5)) {
-		rb_raise(rb_eRuntimeError, "product reentered");
-	    }
-	    else {
-		FL_UNSET(t0, FL_USER5);
-	    }
-	}
-	else {
-	    rb_ary_push(result, subarray);
-	}
-
-	/*
-	 * Increment the last counter.  If it overflows, reset to 0
-	 * and increment the one before it.
-	 */
-	m = n-1;
-	counters[m]++;
-	while (counters[m] == RARRAY_LEN(arrays[m])) {
-	    counters[m] = 0;
-	    /* If the first counter overflows, we are done */
-	    if (--m < 0) goto done;
-	    counters[m]++;
-	}
-    }
-done:
-    tmpary_discard(t0);
-    tmpbuf_discard(t1);
-
-    return NIL_P(result) ? ary : result;
-}
-
-/*
- *  call-seq:
- *     ary.take(n)               -> new_ary
- *
- *  Returns first +n+ elements from the array.
- *
- *  If a negative number is given, raises an ArgumentError.
- *
- *  See also Array#drop
- *
- *     a = [1, 2, 3, 4, 5, 0]
- *     a.take(3)             #=> [1, 2, 3]
- *
- */
-
-static VALUE
-rb_ary_take(VALUE obj, VALUE n)
-{
-    long len = NUM2LONG(n);
-    if (len < 0) {
-	rb_raise(rb_eArgError, "attempt to take negative size");
-    }
-    return rb_ary_subseq(obj, 0, len);
-}
-
-/*
- *  call-seq:
- *     ary.take_while { |arr| block }  -> new_ary
- *     ary.take_while                  -> Enumerator
- *
- *  Passes elements to the block until the block returns +nil+ or +false+, then
- *  stops iterating and returns an array of all prior elements.
- *
- *  If no block is given, an Enumerator is returned instead.
- *
- *  See also Array#drop_while
- *
- *     a = [1, 2, 3, 4, 5, 0]
- *     a.take_while { |i| i < 3 }  #=> [1, 2]
- *
- */
-
-static VALUE
-rb_ary_take_while(VALUE ary)
-{
-    long i;
-
-    RETURN_ENUMERATOR(ary, 0, 0);
-    for (i = 0; i < RARRAY_LEN(ary); i++) {
-	if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) break;
-    }
-    return rb_ary_take(ary, LONG2FIX(i));
-}
-
-/*
- *  call-seq:
- *     ary.drop(n)               -> new_ary
- *
- *  Drops first +n+ elements from +ary+ and returns the rest of the elements in
- *  an array.
- *
- *  If a negative number is given, raises an ArgumentError.
- *
- *  See also Array#take
- *
- *     a = [1, 2, 3, 4, 5, 0]
- *     a.drop(3)             #=> [4, 5, 0]
- *
- */
-
-static VALUE
-rb_ary_drop(VALUE ary, VALUE n)
-{
-    VALUE result;
-    long pos = NUM2LONG(n);
-    if (pos < 0) {
-	rb_raise(rb_eArgError, "attempt to drop negative size");
-    }
-
-    result = rb_ary_subseq(ary, pos, RARRAY_LEN(ary));
-    if (result == Qnil) result = rb_ary_new();
-    return result;
-}
-
-/*
- *  call-seq:
- *     ary.drop_while { |arr| block }   -> new_ary
- *     ary.drop_while                  -> Enumerator
- *
- *  Drops elements up to, but not including, the first element for which the
- *  block returns +nil+ or +false+ and returns an array containing the
- *  remaining elements.
- *
- *  If no block is given, an Enumerator is returned instead.
- *
- *  See also Array#take_while
- *
- *     a = [1, 2, 3, 4, 5, 0]
- *     a.drop_while {|i| i < 3 }   #=> [3, 4, 5, 0]
- *
- */
-
-static VALUE
-rb_ary_drop_while(VALUE ary)
-{
-    long i;
-
-    RETURN_ENUMERATOR(ary, 0, 0);
-    for (i = 0; i < RARRAY_LEN(ary); i++) {
-	if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) break;
-    }
-    return rb_ary_drop(ary, LONG2FIX(i));
-}
-
-/*
- *  call-seq:
- *     ary.any? [{ |obj| block }]   -> true or false
- *
- *  See also Enumerable#any?
- */
-
-static VALUE
-rb_ary_any_p(VALUE ary)
+ary_flatten(ary)
+    VALUE ary;
 {
-    long i, len = RARRAY_LEN(ary);
-    const VALUE *ptr = RARRAY_CONST_PTR(ary);
+    VALUE v = ary_flatten_bang(ary_dup(ary));
 
-    if (!len) return Qfalse;
-    if (!rb_block_given_p()) {
-	for (i = 0; i < len; ++i) if (RTEST(ptr[i])) return Qtrue;
-    }
-    else {
-	for (i = 0; i < RARRAY_LEN(ary); ++i) {
-	    if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) return Qtrue;
-	}
-    }
-    return Qfalse;
-}
-
-/*
- * call-seq:
- *   ary.dig(idx, ...)                 -> object
- *
- * Retrieves the value object corresponding to the each <i>idx</i>
- * objects repeatedly.
- *
- *   a = [[1, [2, 3]]]
- *
- *   a.dig(0, 1, 1)                    #=> 3
- *   a.dig(0, 0, 0)                    #=> nil
- */
-
-VALUE
-rb_ary_dig(int argc, VALUE *argv, VALUE self)
-{
-    rb_check_arity(argc, 1, UNLIMITED_ARGUMENTS);
-    self = rb_ary_at(self, *argv);
-    if (!--argc) return self;
-    ++argv;
-    return rb_obj_dig(argc, argv, self, Qnil);
+    if (NIL_P(v)) return ary;
+    return v;
 }
 
-/*
- *  Arrays are ordered, integer-indexed collections of any object.
- *
- *  Array indexing starts at 0, as in C or Java.  A negative index is assumed
- *  to be relative to the end of the array---that is, an index of -1 indicates
- *  the last element of the array, -2 is the next to last element in the
- *  array, and so on.
- *
- *  == Creating Arrays
- *
- *  A new array can be created by using the literal constructor
- *  <code>[]</code>.  Arrays can contain different types of objects.  For
- *  example, the array below contains an Integer, a String and a Float:
- *
- *     ary = [1, "two", 3.0] #=> [1, "two", 3.0]
- *
- *  An array can also be created by explicitly calling Array.new with zero, one
- *  (the initial size of the Array) or two arguments (the initial size and a
- *  default object).
- *
- *     ary = Array.new    #=> []
- *     Array.new(3)       #=> [nil, nil, nil]
- *     Array.new(3, true) #=> [true, true, true]
- *
- *  Note that the second argument populates the array with references to the
- *  same object.  Therefore, it is only recommended in cases when you need to
- *  instantiate arrays with natively immutable objects such as Symbols,
- *  numbers, true or false.
- *
- *  To create an array with separate objects a block can be passed instead.
- *  This method is safe to use with mutable objects such as hashes, strings or
- *  other arrays:
- *
- *     Array.new(4) { Hash.new } #=> [{}, {}, {}, {}]
- *
- *  This is also a quick way to build up multi-dimensional arrays:
- *
- *     empty_table = Array.new(3) { Array.new(3) }
- *     #=> [[nil, nil, nil], [nil, nil, nil], [nil, nil, nil]]
- *
- *  An array can also be created by using the Array() method, provided by
- *  Kernel, which tries to call #to_ary, then #to_a on its argument.
- *
- *	Array({:a => "a", :b => "b"}) #=> [[:a, "a"], [:b, "b"]]
- *
- *  == Example Usage
- *
- *  In addition to the methods it mixes in through the Enumerable module, the
- *  Array class has proprietary methods for accessing, searching and otherwise
- *  manipulating arrays.
- *
- *  Some of the more common ones are illustrated below.
- *
- *  == Accessing Elements
- *
- *  Elements in an array can be retrieved using the Array#[] method.  It can
- *  take a single integer argument (a numeric index), a pair of arguments
- *  (start and length) or a range. Negative indices start counting from the end,
- *  with -1 being the last element.
- *
- *     arr = [1, 2, 3, 4, 5, 6]
- *     arr[2]    #=> 3
- *     arr[100]  #=> nil
- *     arr[-3]   #=> 4
- *     arr[2, 3] #=> [3, 4, 5]
- *     arr[1..4] #=> [2, 3, 4, 5]
- *     arr[1..-3] #=> [2, 3, 4]
- *
- *  Another way to access a particular array element is by using the #at method
- *
- *     arr.at(0) #=> 1
- *
- *  The #slice method works in an identical manner to Array#[].
- *
- *  To raise an error for indices outside of the array bounds or else to
- *  provide a default value when that happens, you can use #fetch.
- *
- *     arr = ['a', 'b', 'c', 'd', 'e', 'f']
- *     arr.fetch(100) #=> IndexError: index 100 outside of array bounds: -6...6
- *     arr.fetch(100, "oops") #=> "oops"
- *
- *  The special methods #first and #last will return the first and last
- *  elements of an array, respectively.
- *
- *     arr.first #=> 1
- *     arr.last  #=> 6
- *
- *  To return the first +n+ elements of an array, use #take
- *
- *     arr.take(3) #=> [1, 2, 3]
- *
- *  #drop does the opposite of #take, by returning the elements after +n+
- *  elements have been dropped:
- *
- *     arr.drop(3) #=> [4, 5, 6]
- *
- *  == Obtaining Information about an Array
- *
- *  Arrays keep track of their own length at all times.  To query an array
- *  about the number of elements it contains, use #length, #count or #size.
- *
- *    browsers = ['Chrome', 'Firefox', 'Safari', 'Opera', 'IE']
- *    browsers.length #=> 5
- *    browsers.count #=> 5
- *
- *  To check whether an array contains any elements at all
- *
- *    browsers.empty? #=> false
- *
- *  To check whether a particular item is included in the array
- *
- *    browsers.include?('Konqueror') #=> false
- *
- *  == Adding Items to Arrays
- *
- *  Items can be added to the end of an array by using either #push or #<<
- *
- *    arr = [1, 2, 3, 4]
- *    arr.push(5) #=> [1, 2, 3, 4, 5]
- *    arr << 6    #=> [1, 2, 3, 4, 5, 6]
- *
- *  #unshift will add a new item to the beginning of an array.
- *
- *     arr.unshift(0) #=> [0, 1, 2, 3, 4, 5, 6]
- *
- *  With #insert you can add a new element to an array at any position.
- *
- *     arr.insert(3, 'apple')  #=> [0, 1, 2, 'apple', 3, 4, 5, 6]
- *
- *  Using the #insert method, you can also insert multiple values at once:
- *
- *     arr.insert(3, 'orange', 'pear', 'grapefruit')
- *     #=> [0, 1, 2, "orange", "pear", "grapefruit", "apple", 3, 4, 5, 6]
- *
- *  == Removing Items from an Array
- *
- *  The method #pop removes the last element in an array and returns it:
- *
- *     arr =  [1, 2, 3, 4, 5, 6]
- *     arr.pop #=> 6
- *     arr #=> [1, 2, 3, 4, 5]
- *
- *  To retrieve and at the same time remove the first item, use #shift:
- *
- *     arr.shift #=> 1
- *     arr #=> [2, 3, 4, 5]
- *
- *  To delete an element at a particular index:
- *
- *     arr.delete_at(2) #=> 4
- *     arr #=> [2, 3, 5]
- *
- *  To delete a particular element anywhere in an array, use #delete:
- *
- *     arr = [1, 2, 2, 3]
- *     arr.delete(2) #=> 2
- *     arr #=> [1,3]
- *
- *  A useful method if you need to remove +nil+ values from an array is
- *  #compact:
- *
- *     arr = ['foo', 0, nil, 'bar', 7, 'baz', nil]
- *     arr.compact  #=> ['foo', 0, 'bar', 7, 'baz']
- *     arr          #=> ['foo', 0, nil, 'bar', 7, 'baz', nil]
- *     arr.compact! #=> ['foo', 0, 'bar', 7, 'baz']
- *     arr          #=> ['foo', 0, 'bar', 7, 'baz']
- *
- *  Another common need is to remove duplicate elements from an array.
- *
- *  It has the non-destructive #uniq, and destructive method #uniq!
- *
- *     arr = [2, 5, 6, 556, 6, 6, 8, 9, 0, 123, 556]
- *     arr.uniq #=> [2, 5, 6, 556, 8, 9, 0, 123]
- *
- *  == Iterating over Arrays
- *
- *  Like all classes that include the Enumerable module, Array has an each
- *  method, which defines what elements should be iterated over and how.  In
- *  case of Array's #each, all elements in the Array instance are yielded to
- *  the supplied block in sequence.
- *
- *  Note that this operation leaves the array unchanged.
- *
- *     arr = [1, 2, 3, 4, 5]
- *     arr.each { |a| print a -= 10, " " }
- *     # prints: -9 -8 -7 -6 -5
- *     #=> [1, 2, 3, 4, 5]
- *
- *  Another sometimes useful iterator is #reverse_each which will iterate over
- *  the elements in the array in reverse order.
- *
- *     words = %w[first second third fourth fifth sixth]
- *     str = ""
- *     words.reverse_each { |word| str += "#{word} " }
- *     p str #=> "sixth fifth fourth third second first "
- *
- *  The #map method can be used to create a new array based on the original
- *  array, but with the values modified by the supplied block:
- *
- *     arr.map { |a| 2*a }   #=> [2, 4, 6, 8, 10]
- *     arr                   #=> [1, 2, 3, 4, 5]
- *     arr.map! { |a| a**2 } #=> [1, 4, 9, 16, 25]
- *     arr                   #=> [1, 4, 9, 16, 25]
- *
- *  == Selecting Items from an Array
- *
- *  Elements can be selected from an array according to criteria defined in a
- *  block.  The selection can happen in a destructive or a non-destructive
- *  manner.  While the destructive operations will modify the array they were
- *  called on, the non-destructive methods usually return a new array with the
- *  selected elements, but leave the original array unchanged.
- *
- *  === Non-destructive Selection
- *
- *     arr = [1, 2, 3, 4, 5, 6]
- *     arr.select { |a| a > 3 }     #=> [4, 5, 6]
- *     arr.reject { |a| a < 3 }     #=> [3, 4, 5, 6]
- *     arr.drop_while { |a| a < 4 } #=> [4, 5, 6]
- *     arr                          #=> [1, 2, 3, 4, 5, 6]
- *
- *  === Destructive Selection
- *
- *  #select! and #reject! are the corresponding destructive methods to #select
- *  and #reject
- *
- *  Similar to #select vs. #reject, #delete_if and #keep_if have the exact
- *  opposite result when supplied with the same block:
- *
- *     arr.delete_if { |a| a < 4 } #=> [4, 5, 6]
- *     arr                         #=> [4, 5, 6]
- *
- *     arr = [1, 2, 3, 4, 5, 6]
- *     arr.keep_if { |a| a < 4 } #=> [1, 2, 3]
- *     arr                       #=> [1, 2, 3]
- *
- */
+extern VALUE mEnumerable;
 
 void
-Init_Array(void)
-{
-#undef rb_intern
-#define rb_intern(str) rb_intern_const(str)
-
-    rb_cArray  = rb_define_class("Array", rb_cObject);
-    rb_include_module(rb_cArray, rb_mEnumerable);
-
-    rb_define_alloc_func(rb_cArray, empty_ary_alloc);
-    rb_define_singleton_method(rb_cArray, "[]", rb_ary_s_create, -1);
-    rb_define_singleton_method(rb_cArray, "try_convert", rb_ary_s_try_convert, 1);
-    rb_define_method(rb_cArray, "initialize", rb_ary_initialize, -1);
-    rb_define_method(rb_cArray, "initialize_copy", rb_ary_replace, 1);
-
-    rb_define_method(rb_cArray, "inspect", rb_ary_inspect, 0);
-    rb_define_alias(rb_cArray,  "to_s", "inspect");
-    rb_define_method(rb_cArray, "to_a", rb_ary_to_a, 0);
-    rb_define_method(rb_cArray, "to_h", rb_ary_to_h, 0);
-    rb_define_method(rb_cArray, "to_ary", rb_ary_to_ary_m, 0);
-    rb_define_method(rb_cArray, "frozen?",  rb_ary_frozen_p, 0);
-
-    rb_define_method(rb_cArray, "==", rb_ary_equal, 1);
-    rb_define_method(rb_cArray, "eql?", rb_ary_eql, 1);
-    rb_define_method(rb_cArray, "hash", rb_ary_hash, 0);
-
-    rb_define_method(rb_cArray, "[]", rb_ary_aref, -1);
-    rb_define_method(rb_cArray, "[]=", rb_ary_aset, -1);
-    rb_define_method(rb_cArray, "at", rb_ary_at, 1);
-    rb_define_method(rb_cArray, "fetch", rb_ary_fetch, -1);
-    rb_define_method(rb_cArray, "first", rb_ary_first, -1);
-    rb_define_method(rb_cArray, "last", rb_ary_last, -1);
-    rb_define_method(rb_cArray, "concat", rb_ary_concat, 1);
-    rb_define_method(rb_cArray, "<<", rb_ary_push, 1);
-    rb_define_method(rb_cArray, "push", rb_ary_push_m, -1);
-    rb_define_method(rb_cArray, "pop", rb_ary_pop_m, -1);
-    rb_define_method(rb_cArray, "shift", rb_ary_shift_m, -1);
-    rb_define_method(rb_cArray, "unshift", rb_ary_unshift_m, -1);
-    rb_define_method(rb_cArray, "insert", rb_ary_insert, -1);
-    rb_define_method(rb_cArray, "each", rb_ary_each, 0);
-    rb_define_method(rb_cArray, "each_index", rb_ary_each_index, 0);
-    rb_define_method(rb_cArray, "reverse_each", rb_ary_reverse_each, 0);
-    rb_define_method(rb_cArray, "length", rb_ary_length, 0);
-    rb_define_alias(rb_cArray,  "size", "length");
-    rb_define_method(rb_cArray, "empty?", rb_ary_empty_p, 0);
-    rb_define_method(rb_cArray, "find_index", rb_ary_index, -1);
-    rb_define_method(rb_cArray, "index", rb_ary_index, -1);
-    rb_define_method(rb_cArray, "rindex", rb_ary_rindex, -1);
-    rb_define_method(rb_cArray, "join", rb_ary_join_m, -1);
-    rb_define_method(rb_cArray, "reverse", rb_ary_reverse_m, 0);
-    rb_define_method(rb_cArray, "reverse!", rb_ary_reverse_bang, 0);
-    rb_define_method(rb_cArray, "rotate", rb_ary_rotate_m, -1);
-    rb_define_method(rb_cArray, "rotate!", rb_ary_rotate_bang, -1);
-    rb_define_method(rb_cArray, "sort", rb_ary_sort, 0);
-    rb_define_method(rb_cArray, "sort!", rb_ary_sort_bang, 0);
-    rb_define_method(rb_cArray, "sort_by!", rb_ary_sort_by_bang, 0);
-    rb_define_method(rb_cArray, "collect", rb_ary_collect, 0);
-    rb_define_method(rb_cArray, "collect!", rb_ary_collect_bang, 0);
-    rb_define_method(rb_cArray, "map", rb_ary_collect, 0);
-    rb_define_method(rb_cArray, "map!", rb_ary_collect_bang, 0);
-    rb_define_method(rb_cArray, "select", rb_ary_select, 0);
-    rb_define_method(rb_cArray, "select!", rb_ary_select_bang, 0);
-    rb_define_method(rb_cArray, "keep_if", rb_ary_keep_if, 0);
-    rb_define_method(rb_cArray, "values_at", rb_ary_values_at, -1);
-    rb_define_method(rb_cArray, "delete", rb_ary_delete, 1);
-    rb_define_method(rb_cArray, "delete_at", rb_ary_delete_at_m, 1);
-    rb_define_method(rb_cArray, "delete_if", rb_ary_delete_if, 0);
-    rb_define_method(rb_cArray, "reject", rb_ary_reject, 0);
-    rb_define_method(rb_cArray, "reject!", rb_ary_reject_bang, 0);
-    rb_define_method(rb_cArray, "zip", rb_ary_zip, -1);
-    rb_define_method(rb_cArray, "transpose", rb_ary_transpose, 0);
-    rb_define_method(rb_cArray, "replace", rb_ary_replace, 1);
-    rb_define_method(rb_cArray, "clear", rb_ary_clear, 0);
-    rb_define_method(rb_cArray, "fill", rb_ary_fill, -1);
-    rb_define_method(rb_cArray, "include?", rb_ary_includes, 1);
-    rb_define_method(rb_cArray, "<=>", rb_ary_cmp, 1);
-
-    rb_define_method(rb_cArray, "slice", rb_ary_aref, -1);
-    rb_define_method(rb_cArray, "slice!", rb_ary_slice_bang, -1);
-
-    rb_define_method(rb_cArray, "assoc", rb_ary_assoc, 1);
-    rb_define_method(rb_cArray, "rassoc", rb_ary_rassoc, 1);
-
-    rb_define_method(rb_cArray, "+", rb_ary_plus, 1);
-    rb_define_method(rb_cArray, "*", rb_ary_times, 1);
-
-    rb_define_method(rb_cArray, "-", rb_ary_diff, 1);
-    rb_define_method(rb_cArray, "&", rb_ary_and, 1);
-    rb_define_method(rb_cArray, "|", rb_ary_or, 1);
-
-    rb_define_method(rb_cArray, "uniq", rb_ary_uniq, 0);
-    rb_define_method(rb_cArray, "uniq!", rb_ary_uniq_bang, 0);
-    rb_define_method(rb_cArray, "compact", rb_ary_compact, 0);
-    rb_define_method(rb_cArray, "compact!", rb_ary_compact_bang, 0);
-    rb_define_method(rb_cArray, "flatten", rb_ary_flatten, -1);
-    rb_define_method(rb_cArray, "flatten!", rb_ary_flatten_bang, -1);
-    rb_define_method(rb_cArray, "count", rb_ary_count, -1);
-    rb_define_method(rb_cArray, "shuffle!", rb_ary_shuffle_bang, -1);
-    rb_define_method(rb_cArray, "shuffle", rb_ary_shuffle, -1);
-    rb_define_method(rb_cArray, "sample", rb_ary_sample, -1);
-    rb_define_method(rb_cArray, "cycle", rb_ary_cycle, -1);
-    rb_define_method(rb_cArray, "permutation", rb_ary_permutation, -1);
-    rb_define_method(rb_cArray, "combination", rb_ary_combination, 1);
-    rb_define_method(rb_cArray, "repeated_permutation", rb_ary_repeated_permutation, 1);
-    rb_define_method(rb_cArray, "repeated_combination", rb_ary_repeated_combination, 1);
-    rb_define_method(rb_cArray, "product", rb_ary_product, -1);
-
-    rb_define_method(rb_cArray, "take", rb_ary_take, 1);
-    rb_define_method(rb_cArray, "take_while", rb_ary_take_while, 0);
-    rb_define_method(rb_cArray, "drop", rb_ary_drop, 1);
-    rb_define_method(rb_cArray, "drop_while", rb_ary_drop_while, 0);
-    rb_define_method(rb_cArray, "bsearch", rb_ary_bsearch, 0);
-    rb_define_method(rb_cArray, "bsearch_index", rb_ary_bsearch_index, 0);
-    rb_define_method(rb_cArray, "any?", rb_ary_any_p, 0);
-    rb_define_method(rb_cArray, "dig", rb_ary_dig, -1);
-
-    id_cmp = rb_intern("<=>");
-    id_random = rb_intern("random");
-    id_div = rb_intern("div");
-    id_power = rb_intern("**");
+Init_Array()
+{
+    cArray  = rb_define_class("Array", cObject);
+    rb_include_module(cArray, mEnumerable);
+
+    rb_define_singleton_method(cArray, "new", ary_s_new, -1);
+    rb_define_singleton_method(cArray, "[]", ary_s_create, -1);
+    rb_define_method(cArray, "to_s", ary_to_s, 0);
+    rb_define_method(cArray, "inspect", ary_inspect, 0);
+    rb_define_method(cArray, "to_a", ary_to_a, 0);
+    rb_define_method(cArray, "to_ary", ary_to_a, 0);
+
+    rb_define_method(cArray, "freeze",  ary_freeze, 0);
+    rb_define_method(cArray, "frozen?",  ary_frozen_p, 0);
+
+    rb_define_method(cArray, "==", ary_equal, 1);
+    rb_define_method(cArray, "eql?", ary_eql, 1);
+    rb_define_method(cArray, "hash", ary_hash, 0);
+
+    rb_define_method(cArray, "[]", ary_aref, -1);
+    rb_define_method(cArray, "[]=", ary_aset, -1);
+    rb_define_method(cArray, "concat", ary_concat, 1);
+    rb_define_method(cArray, "<<", ary_push, 1);
+    rb_define_method(cArray, "push", ary_push_method, -1);
+    rb_define_method(cArray, "pop", ary_pop, 0);
+    rb_define_method(cArray, "shift", ary_shift, 0);
+    rb_define_method(cArray, "unshift", ary_unshift, 1);
+    rb_define_method(cArray, "each", ary_each, 0);
+    rb_define_method(cArray, "each_index", ary_each_index, 0);
+    rb_define_method(cArray, "reverse_each", ary_reverse_each, 0);
+    rb_define_method(cArray, "length", ary_length, 0);
+    rb_define_alias(cArray,  "size", "length");
+    rb_define_method(cArray, "empty?", ary_empty_p, 0);
+    rb_define_method(cArray, "index", ary_index, 1);
+    rb_define_method(cArray, "rindex", ary_rindex, 1);
+    rb_define_method(cArray, "indexes", ary_indexes, -1);
+    rb_define_method(cArray, "indices", ary_indexes, -1);
+    rb_define_method(cArray, "clone", ary_clone, 0);
+    rb_define_method(cArray, "dup", ary_dup, 0);
+    rb_define_method(cArray, "join", ary_join_method, -1);
+    rb_define_method(cArray, "reverse", ary_reverse_method, 0);
+    rb_define_method(cArray, "reverse!", ary_reverse, 0);
+    rb_define_method(cArray, "sort", ary_sort, 0);
+    rb_define_method(cArray, "sort!", ary_sort_bang, 0);
+    rb_define_method(cArray, "delete", ary_delete, 1);
+    rb_define_method(cArray, "delete_at", ary_delete_at, 1);
+    rb_define_method(cArray, "delete_if", ary_delete_if, 0);
+    rb_define_method(cArray, "filter", ary_filter, 0);
+    rb_define_method(cArray, "replace", ary_replace_method, 1);
+    rb_define_method(cArray, "clear", ary_clear, 0);
+    rb_define_method(cArray, "fill", ary_fill, -1);
+    rb_define_method(cArray, "include?", ary_includes, 1);
+    rb_define_method(cArray, "===", ary_includes, 1);
+    rb_define_method(cArray, "<=>", ary_cmp, 1);
+
+    rb_define_method(cArray, "assoc", ary_assoc, 1);
+    rb_define_method(cArray, "rassoc", ary_rassoc, 1);
+
+    rb_define_method(cArray, "+", ary_plus, 1);
+    rb_define_method(cArray, "*", ary_times, 1);
+
+    rb_define_method(cArray, "-", ary_diff, 1);
+    rb_define_method(cArray, "&", ary_and, 1);
+    rb_define_method(cArray, "|", ary_or, 1);
+
+    rb_define_method(cArray, "uniq", ary_uniq, 0);
+    rb_define_method(cArray, "uniq!", ary_uniq_bang, 0);
+    rb_define_method(cArray, "compact", ary_compact, 0);
+    rb_define_method(cArray, "compact!", ary_compact_bang, 0);
+    rb_define_method(cArray, "flatten", ary_flatten, 0);
+    rb_define_method(cArray, "flatten!", ary_flatten_bang, 0);
+    rb_define_method(cArray, "nitems", ary_nitems, 0);
+
+    cmp = rb_intern("<=>");
 }
diff --git a/benchmark/bm_app_answer.rb b/benchmark/bm_app_answer.rb
deleted file mode 100644
index 3cd8a8fd37..0000000000
--- a/benchmark/bm_app_answer.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-def ack(m, n)
-  if m == 0 then
-    n + 1
-  elsif n == 0 then
-    ack(m - 1, 1)
-  else
-    ack(m - 1, ack(m, n - 1))
-  end
-end
-
-def the_answer_to_life_the_universe_and_everything
-  (ack(3,7).to_s.split(//).inject(0){|s,x| s+x.to_i}.to_s + "2" ).to_i
-end
-
-answer = the_answer_to_life_the_universe_and_everything
diff --git a/benchmark/bm_app_aobench.rb b/benchmark/bm_app_aobench.rb
deleted file mode 100644
index ffab116fcd..0000000000
--- a/benchmark/bm_app_aobench.rb
+++ /dev/null
@@ -1,291 +0,0 @@
-# AO render benchmark
-# Original program (C) Syoyo Fujita in Javascript (and other languages)
-#      https://code.google.com/p/aobench/
-# Ruby(yarv2llvm) version by Hideki Miura
-#
-
-IMAGE_WIDTH = 256
-IMAGE_HEIGHT = 256
-NSUBSAMPLES = 2
-NAO_SAMPLES = 8
-
-class Vec
-  def initialize(x, y, z)
-    @x = x
-    @y = y
-    @z = z
-  end
-
-  attr_accessor :x, :y, :z
-
-  def vadd(b)
-    Vec.new(@x + b.x, @y + b.y, @z + b.z)
-  end
-
-  def vsub(b)
-    Vec.new(@x - b.x, @y - b.y, @z - b.z)
-  end
-
-  def vcross(b)
-    Vec.new(@y * b.z - @z * b.y,
-            @z * b.x - @x * b.z,
-            @x * b.y - @y * b.x)
-  end
-
-  def vdot(b)
-    @x * b.x + @y * b.y + @z * b.z
-  end
-
-  def vlength
-    Math.sqrt(@x * @x + @y * @y + @z * @z)
-  end
-
-  def vnormalize
-    len = vlength
-    v = Vec.new(@x, @y, @z)
-    if len > 1.0e-17 then
-      v.x = v.x / len
-      v.y = v.y / len
-      v.z = v.z / len
-    end
-    v
-  end
-end
-
-
-class Sphere
-  def initialize(center, radius)
-    @center = center
-    @radius = radius
-  end
-
-  attr_reader :center, :radius
-
-  def intersect(ray, isect)
-    rs = ray.org.vsub(@center)
-    b = rs.vdot(ray.dir)
-    c = rs.vdot(rs) - (@radius * @radius)
-    d = b * b - c
-    if d > 0.0 then
-      t = - b - Math.sqrt(d)
-
-      if t > 0.0 and t < isect.t then
-        isect.t = t
-        isect.hit = true
-        isect.pl = Vec.new(ray.org.x + ray.dir.x * t,
-                          ray.org.y + ray.dir.y * t,
-                          ray.org.z + ray.dir.z * t)
-        n = isect.pl.vsub(@center)
-        isect.n = n.vnormalize
-      else
-        0.0
-      end
-    end
-    nil
-  end
-end
-
-class Plane
-  def initialize(p, n)
-    @p = p
-    @n = n
-  end
-
-  def intersect(ray, isect)
-    d = -@p.vdot(@n)
-    v = ray.dir.vdot(@n)
-    v0 = v
-    if v < 0.0 then
-      v0 = -v
-    end
-    if v0 < 1.0e-17 then
-      return
-    end
-
-    t = -(ray.org.vdot(@n) + d) / v
-
-    if t > 0.0 and t < isect.t then
-      isect.hit = true
-      isect.t = t
-      isect.n = @n
-      isect.pl = Vec.new(ray.org.x + t * ray.dir.x,
-                        ray.org.y + t * ray.dir.y,
-                        ray.org.z + t * ray.dir.z)
-    end
-    nil
-  end
-end
-
-class Ray
-  def initialize(org, dir)
-    @org = org
-    @dir = dir
-  end
-
-  attr_accessor :org, :dir
-end
-
-class Isect
-  def initialize
-    @t = 10000000.0
-    @hit = false
-    @pl = Vec.new(0.0, 0.0, 0.0)
-    @n = Vec.new(0.0, 0.0, 0.0)
-  end
-
-  attr_accessor :t, :hit, :pl, :n
-end
-
-def clamp(f)
-  i = f * 255.5
-  if i > 255.0 then
-    i = 255.0
-  end
-  if i < 0.0 then
-    i = 0.0
-  end
-  i.to_i
-end
-
-def otherBasis(basis, n)
-  basis[2] = Vec.new(n.x, n.y, n.z)
-  basis[1] = Vec.new(0.0, 0.0, 0.0)
-
-  if n.x < 0.6 and n.x > -0.6 then
-    basis[1].x = 1.0
-  elsif n.y < 0.6 and n.y > -0.6 then
-    basis[1].y = 1.0
-  elsif n.z < 0.6 and n.z > -0.6 then
-    basis[1].z = 1.0
-  else
-    basis[1].x = 1.0
-  end
-
-  basis[0] = basis[1].vcross(basis[2])
-  basis[0] = basis[0].vnormalize
-
-  basis[1] = basis[2].vcross(basis[0])
-  basis[1] = basis[1].vnormalize
-end
-
-class Scene
-  def initialize
-    @spheres = Array.new
-    @spheres[0] = Sphere.new(Vec.new(-2.0, 0.0, -3.5), 0.5)
-    @spheres[1] = Sphere.new(Vec.new(-0.5, 0.0, -3.0), 0.5)
-    @spheres[2] = Sphere.new(Vec.new(1.0, 0.0, -2.2), 0.5)
-    @plane = Plane.new(Vec.new(0.0, -0.5, 0.0), Vec.new(0.0, 1.0, 0.0))
-  end
-
-  def ambient_occlusion(isect)
-    basis = Array.new
-    otherBasis(basis, isect.n)
-
-    ntheta    = NAO_SAMPLES
-    nphi      = NAO_SAMPLES
-    eps       = 0.0001
-    occlusion = 0.0
-
-    p0 = Vec.new(isect.pl.x + eps * isect.n.x,
-                isect.pl.y + eps * isect.n.y,
-                isect.pl.z + eps * isect.n.z)
-    nphi.times do |j|
-      ntheta.times do |i|
-        r = rand
-        phi = 2.0 * 3.14159265 * rand
-        x = Math.cos(phi) * Math.sqrt(1.0 - r)
-        y = Math.sin(phi) * Math.sqrt(1.0 - r)
-        z = Math.sqrt(r)
-
-        rx = x * basis[0].x + y * basis[1].x + z * basis[2].x
-        ry = x * basis[0].y + y * basis[1].y + z * basis[2].y
-        rz = x * basis[0].z + y * basis[1].z + z * basis[2].z
-
-        raydir = Vec.new(rx, ry, rz)
-        ray = Ray.new(p0, raydir)
-
-        occisect = Isect.new
-        @spheres[0].intersect(ray, occisect)
-        @spheres[1].intersect(ray, occisect)
-        @spheres[2].intersect(ray, occisect)
-        @plane.intersect(ray, occisect)
-        if occisect.hit then
-          occlusion = occlusion + 1.0
-        else
-          0.0
-        end
-      end
-    end
-
-    occlusion = (ntheta.to_f * nphi.to_f - occlusion) / (ntheta.to_f * nphi.to_f)
-
-    Vec.new(occlusion, occlusion, occlusion)
-  end
-
-  def render(w, h, nsubsamples)
-    cnt = 0
-    nsf = nsubsamples.to_f
-    h.times do |y|
-      w.times do |x|
-        rad = Vec.new(0.0, 0.0, 0.0)
-
-        # Subsmpling
-        nsubsamples.times do |v|
-          nsubsamples.times do |u|
-
-            cnt = cnt + 1
-            wf = w.to_f
-            hf = h.to_f
-            xf = x.to_f
-            yf = y.to_f
-            uf = u.to_f
-            vf = v.to_f
-
-            px = (xf + (uf / nsf) - (wf / 2.0)) / (wf / 2.0)
-            py = -(yf + (vf / nsf) - (hf / 2.0)) / (hf / 2.0)
-
-            eye = Vec.new(px, py, -1.0).vnormalize
-
-            ray = Ray.new(Vec.new(0.0, 0.0, 0.0), eye)
-
-            isect = Isect.new
-            @spheres[0].intersect(ray, isect)
-            @spheres[1].intersect(ray, isect)
-            @spheres[2].intersect(ray, isect)
-            @plane.intersect(ray, isect)
-            if isect.hit then
-              col = ambient_occlusion(isect)
-              rad.x = rad.x + col.x
-              rad.y = rad.y + col.y
-              rad.z = rad.z + col.z
-            end
-          end
-        end
-
-        r = rad.x / (nsf * nsf)
-        g = rad.y / (nsf * nsf)
-        b = rad.z / (nsf * nsf)
-        printf("%c", clamp(r))
-        printf("%c", clamp(g))
-        printf("%c", clamp(b))
-      end
-      nil
-    end
-
-    nil
-  end
-end
-
-alias printf_orig printf
-def printf *args
-end
-
-# File.open("ao.ppm", "w") do |fp|
-  printf("P6\n")
-  printf("%d %d\n", IMAGE_WIDTH, IMAGE_HEIGHT)
-  printf("255\n", IMAGE_WIDTH, IMAGE_HEIGHT)
-  Scene.new.render(IMAGE_WIDTH, IMAGE_HEIGHT, NSUBSAMPLES)
-# end
-
-undef printf
-alias printf printf_orig
diff --git a/benchmark/bm_app_erb.rb b/benchmark/bm_app_erb.rb
deleted file mode 100644
index 77c66a7949..0000000000
--- a/benchmark/bm_app_erb.rb
+++ /dev/null
@@ -1,26 +0,0 @@
-#
-# Create many HTML strings with ERB.
-#
-
-require 'erb'
-
-data = DATA.read
-max = 15_000
-title = "hello world!"
-content = "hello world!\n" * 10
-
-max.times{
-  ERB.new(data).result(binding)
-}
-
-__END__
-
-<html>
-  <head> <%= title %> </head>
-  <body>
-    <h1> <%= title %> </h1>
-    <p>
-      <%= content %>
-    </p>
-  </body>
-</html>
diff --git a/benchmark/bm_app_factorial.rb b/benchmark/bm_app_factorial.rb
deleted file mode 100644
index 45f471dfdb..0000000000
--- a/benchmark/bm_app_factorial.rb
+++ /dev/null
@@ -1,11 +0,0 @@
-def fact(n)
-  if(n > 1)
-    n * fact(n-1)
-  else
-    1
-  end
-end
-
-100.times {
-  fact(5000)
-}
diff --git a/benchmark/bm_app_fib.rb b/benchmark/bm_app_fib.rb
deleted file mode 100644
index 34a7b2e725..0000000000
--- a/benchmark/bm_app_fib.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-def fib n
-  if n < 3
-    1
-  else
-    fib(n-1) + fib(n-2)
-  end
-end
-
-fib(34)
-
diff --git a/benchmark/bm_app_lc_fizzbuzz.rb b/benchmark/bm_app_lc_fizzbuzz.rb
deleted file mode 100644
index f09574bbeb..0000000000
--- a/benchmark/bm_app_lc_fizzbuzz.rb
+++ /dev/null
@@ -1,52 +0,0 @@
-#
-# FizzBuzz program using only lambda calculus
-#
-# This program is quoted from
-#   "Understanding Computation" by Tom Stuart
-#   http://computationbook.com/
-#
-# You can understand why this program works fine by reading this book.
-#
-
-solution = -> k { -> f { -> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> l { -> x { -> g { -> b { b }[-> p { p[-> x { -> y { x } }] }[l]][x][-> y { g[f[-> l { -> p { p[-> x { -> y { y } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][x][g]][-> l { -> p { p[-> x { -> y { x } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][y] }] } } } }][k][-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> l { -> x { -> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[l][f[x]] } }] } }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[m][n]][-> x { -> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[f[-> n { -> p { -> x { p[n[p][x]] } } }[m]][n]][m][x] }][-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]] } } }][-> p { -> x { p[x] } }][-> p { -> x { p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[x]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]] } }]][-> n { -> b { b }[-> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> p { -> x { p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[x]]]]]]]]]]]]]]] } }]]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]][-> b { b }[-> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> p { -> x { p[p[p[x]]] } }]]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]][-> b { b }[-> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> n { -> l { -> x { -> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> l { -> x { -> g { -> b { b }[-> p { p[-> x { -> y { x } }] }[l]][x][-> y { g[f[-> l { -> p { p[-> x { -> y { y } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][x][g]][-> l { -> p { p[-> x { -> y { x } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][y] }] } } } }][l][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][x]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }] } }[-> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]][-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> x { f[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { -> n { -> p { -> x { p[n[p][x]] } } }[f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n]][x] }][-> p { -> x { x } }] } } }][n][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][x] }]][-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]] } }][n]]]] }]
-
-FIRST     = -> l { LEFT[RIGHT[l]] }
-IF        = -> b { b }
-LEFT      = -> p { p[-> x { -> y { x } } ] }
-RIGHT     = -> p { p[-> x { -> y { y } } ] }
-IS_EMPTY  = LEFT
-REST      = -> l { RIGHT[RIGHT[l]] }
-
-def to_integer(proc)
-  proc[-> n { n + 1 }][0]
-end
-
-def to_boolean(proc)
-  IF[proc][true][false]
-end
-
-def to_array(proc)
-  array = []
-
-  until to_boolean(IS_EMPTY[proc])
-    array.push(FIRST[proc])
-    proc = REST[proc]
-  end
-
-  array
-end
-
-def to_char(c)
-  '0123456789BFiuz'.slice(to_integer(c))
-end
-
-def to_string(s)
-  to_array(s).map { |c| to_char(c) }.join
-end
-
-answer = to_array(solution).map do |p|
-  to_string(p)
-end
-
-answer_ary = answer.to_a
-# puts answer_ary
diff --git a/benchmark/bm_app_mandelbrot.rb b/benchmark/bm_app_mandelbrot.rb
deleted file mode 100644
index 801b75e8e2..0000000000
--- a/benchmark/bm_app_mandelbrot.rb
+++ /dev/null
@@ -1,23 +0,0 @@
-require 'complex'
-
-def mandelbrot? z
-  i = 0
-  while i<100
-    i += 1
-    z = z * z
-    return false if z.abs > 2
-  end
-  true
-end
-
-ary = []
-
-(0..1000).each{|dx|
-  (0..1000).each{|dy|
-    x = dx / 50.0
-    y = dy / 50.0
-    c = Complex(x, y)
-    ary << c if mandelbrot?(c)
-  }
-}
-
diff --git a/benchmark/bm_app_pentomino.rb b/benchmark/bm_app_pentomino.rb
deleted file mode 100644
index 59c63f358e..0000000000
--- a/benchmark/bm_app_pentomino.rb
+++ /dev/null
@@ -1,259 +0,0 @@
-#!/usr/local/bin/ruby
-# This program is contributed by Shin Nishiyama
-
-
-# modified by K.Sasada
-
-NP = 5
-ROW = 8 + NP
-COL = 8
-
-$p = []
-$b = []
-$no = 0
-
-def piece(n, a, nb)
-  nb.each{|x|
-    a[n] = x
-    if n == NP-1
-      $p << [a.sort]
-    else
-      nbc=nb.dup
-      [-ROW, -1, 1, ROW].each{|d|
-        if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
-          nbc << x+d
-        end
-      }
-      nbc.delete x
-      piece(n+1,a[0..n],nbc)
-    end
-  }
-end
-
-def kikaku(a)
-  a.collect {|x| x - a[0]}
-end
-def ud(a)
-  kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
-end
-def rl(a)
-  kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
-end
-def xy(a)
-  kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
-end
-
-def mkpieces
-  piece(0,[],[0])
-  $p.each do |a|
-    a0 = a[0]
-    a[1] = ud(a0)
-    a[2] = rl(a0)
-    a[3] = ud(rl(a0))
-    a[4] = xy(a0)
-    a[5] = ud(xy(a0))
-    a[6] = rl(xy(a0))
-    a[7] = ud(rl(xy(a0)))
-    a.sort!
-    a.uniq!
-  end
-  $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
-end
-
-def mkboard
-  (0...ROW*COL).each{|i|
-    if i % ROW >= ROW-NP
-      $b[i] = -2
-    else
-      $b[i] = -1
-    end
-    $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
-  }
-end
-
-def pboard
-  return # skip print
-  print "No. #$no\n"
-  (0...COL).each{|i|
-    print "|"
-    (0...ROW-NP).each{|j|
-      x = $b[i*ROW+j]
-      if x < 0
-        print "..|"
-      else
-        printf "%2d|",x+1
-      end
-    }
-    print "\n"
-  }
-  print "\n"
-end
-
-$pnum=[]
-def setpiece(a,pos)
-  if a.length == $p.length then
-    $no += 1
-    pboard
-    return
-  end
-  while $b[pos] != -1
-    pos += 1
-  end
-  ($pnum - a).each do |i|
-    $p[i].each do |x|
-      f = 0
-      x.each{|s|
-        if $b[pos+s] != -1
-          f=1
-          break
-        end
-      }
-      if f == 0 then
-        x.each{|s|
-          $b[pos+s] = i
-        }
-        a << i
-        setpiece(a.dup, pos)
-        a.pop
-        x.each{|s|
-          $b[pos+s] = -1
-        }
-      end
-    end
-  end
-end
-
-mkpieces
-mkboard
-$p[4] = [$p[4][0]]
-$pnum = (0...$p.length).to_a
-setpiece([],0)
-
-
-__END__
-
-# original
-
-NP = 5
-ROW = 8 + NP
-COL = 8
-
-$p = []
-$b = []
-$no = 0
-
-def piece(n,a,nb)
-  for x in nb
-    a[n] = x
-    if n == NP-1
-      $p << [a.sort]
-    else
-      nbc=nb.dup
-      for d in [-ROW, -1, 1, ROW]
-        if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
-          nbc << x+d
-        end
-      end
-      nbc.delete x
-      piece(n+1,a[0..n],nbc)
-    end
-  end
-end
-
-def kikaku(a)
-  a.collect {|x| x - a[0]}
-end
-def ud(a)
-  kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
-end
-def rl(a)
-  kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
-end
-def xy(a)
-  kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
-end
-
-def mkpieces
-  piece(0,[],[0])
-  $p.each do |a|
-    a0 = a[0]
-    a[1] = ud(a0)
-    a[2] = rl(a0)
-    a[3] = ud(rl(a0))
-    a[4] = xy(a0)
-    a[5] = ud(xy(a0))
-    a[6] = rl(xy(a0))
-    a[7] = ud(rl(xy(a0)))
-    a.sort!
-    a.uniq!
-  end
-  $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
-end
-
-def mkboard
-  for i in 0...ROW*COL
-    if i % ROW >= ROW-NP
-      $b[i] = -2
-    else
-      $b[i] = -1
-    end
-    $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
-  end
-end
-
-def pboard
-  print "No. #$no\n"
-  for i in 0...COL
-    print "|"
-    for j in 0...ROW-NP
-      x = $b[i*ROW+j]
-      if x < 0
-        print "..|"
-      else
-        printf "%2d|",x+1
-      end
-    end
-    print "\n"
-  end
-  print "\n"
-end
-
-$pnum=[]
-def setpiece(a,pos)
-  if a.length == $p.length then
-    $no += 1
-    pboard
-    return
-  end
-  while $b[pos] != -1
-    pos += 1
-  end
-  ($pnum - a).each do |i|
-    $p[i].each do |x|
-      f = 0
-      for s in x do
-        if $b[pos+s] != -1
-          f=1
-          break
-        end
-      end
-      if f == 0 then
-        for s in x do
-          $b[pos+s] = i
-        end
-        a << i
-        setpiece(a.dup, pos)
-        a.pop
-        for s in x do
-          $b[pos+s] = -1
-        end
-      end
-    end
-  end
-end
-
-mkpieces
-mkboard
-$p[4] = [$p[4][0]]
-$pnum = (0...$p.length).to_a
-setpiece([],0)
diff --git a/benchmark/bm_app_raise.rb b/benchmark/bm_app_raise.rb
deleted file mode 100644
index 5db8f95d50..0000000000
--- a/benchmark/bm_app_raise.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-i = 0
-while i<300000
-  i += 1
-  begin
-    raise
-  rescue
-  end
-end
diff --git a/benchmark/bm_app_strconcat.rb b/benchmark/bm_app_strconcat.rb
deleted file mode 100644
index 7eed7c1aed..0000000000
--- a/benchmark/bm_app_strconcat.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-i = 0
-while i<2_000_000
-  "#{1+1} #{1+1} #{1+1}"
-  i += 1
-end
diff --git a/benchmark/bm_app_tak.rb b/benchmark/bm_app_tak.rb
deleted file mode 100644
index efe5380f4e..0000000000
--- a/benchmark/bm_app_tak.rb
+++ /dev/null
@@ -1,13 +0,0 @@
-
-def tak x, y, z
-  unless y < x
-    z
-  else
-    tak( tak(x-1, y, z),
-         tak(y-1, z, x),
-         tak(z-1, x, y))
-  end
-end
-
-tak(18, 9, 0)
-
diff --git a/benchmark/bm_app_tarai.rb b/benchmark/bm_app_tarai.rb
deleted file mode 100644
index 4c146f5ccf..0000000000
--- a/benchmark/bm_app_tarai.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-def tarai( x, y, z )
-  if x <= y
-  then y
-  else tarai(tarai(x-1, y, z),
-             tarai(y-1, z, x),
-             tarai(z-1, x, y))
-  end
-end
-
-tarai(12, 6, 0)
diff --git a/benchmark/bm_app_uri.rb b/benchmark/bm_app_uri.rb
deleted file mode 100644
index 586edfd5dc..0000000000
--- a/benchmark/bm_app_uri.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-require 'uri'
-
-100_000.times{
-  uri = URI.parse('http://www.ruby-lang.org')
-  uri.scheme
-  uri.host
-  uri.port
-}
diff --git a/benchmark/bm_array_shift.rb b/benchmark/bm_array_shift.rb
deleted file mode 100644
index 798bb9e3f4..0000000000
--- a/benchmark/bm_array_shift.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-require 'benchmark'
-
-Benchmark.bm do |x|
-  [10_000,1_000_000,100_000_000].each do |n|
-    ary = Array.new(n,0)
-    GC.start
-    x.report("#{n}:shift"){ ary.shift }
-    (0..4).each do |i|
-      ary = Array.new(n,0)
-      GC.start
-      x.report("#{n}:shift(#{i})"){ ary.shift(i) }
-    end
-  end
-end
diff --git a/benchmark/bm_hash_aref_dsym.rb b/benchmark/bm_hash_aref_dsym.rb
deleted file mode 100644
index af4f8c36d4..0000000000
--- a/benchmark/bm_hash_aref_dsym.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-h = {}
-syms = ('a'..'z').map { |s| s.to_sym }
-syms.each { |s| h[s] = 1 }
-200_000.times { syms.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_aref_dsym_long.rb b/benchmark/bm_hash_aref_dsym_long.rb
deleted file mode 100644
index 9d7759379e..0000000000
--- a/benchmark/bm_hash_aref_dsym_long.rb
+++ /dev/null
@@ -1,21 +0,0 @@
-# [ruby-core:70129] [Bug #11396]
-collection_size = 200000
-sample_size = 10000
-
-values = (1..collection_size).to_a.map do |x|
-  "THIS IS A LONGER STRING THAT IS ALSO UNIQUE #{x}"
-end
-
-symbol_hash = {}
-
-values.each do |x|
-  symbol_hash[x.to_sym] = 1
-end
-
-# use the same samples each time to minimize deviations
-rng = Random.new(0)
-symbol_sample_array = values.sample(sample_size, random: rng).map(&:to_sym)
-
-3000.times do
-  symbol_sample_array.each { |x| symbol_hash[x] }
-end
diff --git a/benchmark/bm_hash_aref_fix.rb b/benchmark/bm_hash_aref_fix.rb
deleted file mode 100644
index 1346890582..0000000000
--- a/benchmark/bm_hash_aref_fix.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-h = {}
-nums = (1..26).to_a
-nums.each { |i| h[i] = i }
-200_000.times { nums.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_aref_flo.rb b/benchmark/bm_hash_aref_flo.rb
deleted file mode 100644
index 2217274c82..0000000000
--- a/benchmark/bm_hash_aref_flo.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-h = {}
-strs = [*1..10000].map! {|i| i.fdiv(10)}
-strs.each { |s| h[s] = s }
-50.times { strs.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_aref_miss.rb b/benchmark/bm_hash_aref_miss.rb
deleted file mode 100644
index b0913dd4bb..0000000000
--- a/benchmark/bm_hash_aref_miss.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-h = {}
-strs = ('a'..'z').to_a.map!(&:freeze)
-strs.each { |s| h[s] = s }
-strs = ('A'..'Z').to_a
-200_000.times { strs.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_aref_str.rb b/benchmark/bm_hash_aref_str.rb
deleted file mode 100644
index 19439b061b..0000000000
--- a/benchmark/bm_hash_aref_str.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-h = {}
-strs = ('a'..'z').to_a.map!(&:freeze)
-strs.each { |s| h[s] = s }
-200_000.times { strs.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_aref_sym.rb b/benchmark/bm_hash_aref_sym.rb
deleted file mode 100644
index f75d163fe6..0000000000
--- a/benchmark/bm_hash_aref_sym.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-h = {}
-syms = ('a'..'z').to_a
-begin
-  syms = eval("%i[#{syms.join(' ')}]")
-rescue SyntaxError # <= 1.9.3
-  syms.map!(&:to_sym)
-end
-syms.each { |s| h[s] = s }
-200_000.times { syms.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_aref_sym_long.rb b/benchmark/bm_hash_aref_sym_long.rb
deleted file mode 100644
index 9dab8df7be..0000000000
--- a/benchmark/bm_hash_aref_sym_long.rb
+++ /dev/null
@@ -1,13 +0,0 @@
-h = {}
-syms = %w[puts warn syswrite write stat bacon lettuce tomato
-some symbols in this array may already be interned  others should not be
-hash browns make good breakfast but not cooked using prime numbers
-shift for division entries delete_if keys exist?
-]
-begin
-  syms = eval("%i[#{syms.join(' ')}]")
-rescue SyntaxError # <= 1.9.3
-  syms.map!(&:to_sym)
-end
-syms.each { |s| h[s] = s }
-200_000.times { syms.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_flatten.rb b/benchmark/bm_hash_flatten.rb
deleted file mode 100644
index e944aae9f2..0000000000
--- a/benchmark/bm_hash_flatten.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-h = {}
-
-10000.times do |i|
-  h[i] = nil
-end
-
-1000.times do
-  h.flatten
-end
diff --git a/benchmark/bm_hash_ident_flo.rb b/benchmark/bm_hash_ident_flo.rb
deleted file mode 100644
index 0c7edfed3e..0000000000
--- a/benchmark/bm_hash_ident_flo.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-h = {}.compare_by_identity
-strs = (1..10000).to_a.map!(&:to_f)
-strs.each { |s| h[s] = s }
-50.times { strs.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_ident_num.rb b/benchmark/bm_hash_ident_num.rb
deleted file mode 100644
index b226736c6f..0000000000
--- a/benchmark/bm_hash_ident_num.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-h = {}.compare_by_identity
-nums = (1..26).to_a
-nums.each { |n| h[n] = n }
-200_000.times { nums.each { |n| h[n] } }
diff --git a/benchmark/bm_hash_ident_obj.rb b/benchmark/bm_hash_ident_obj.rb
deleted file mode 100644
index 4b3b58edec..0000000000
--- a/benchmark/bm_hash_ident_obj.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-h = {}.compare_by_identity
-objs = 26.times.map { Object.new }
-objs.each { |o| h[o] = o }
-200_000.times { objs.each { |o| h[o] } }
diff --git a/benchmark/bm_hash_ident_str.rb b/benchmark/bm_hash_ident_str.rb
deleted file mode 100644
index 8582b38e31..0000000000
--- a/benchmark/bm_hash_ident_str.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-h = {}.compare_by_identity
-strs = ('a'..'z').to_a
-strs.each { |s| h[s] = s }
-200_000.times { strs.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_ident_sym.rb b/benchmark/bm_hash_ident_sym.rb
deleted file mode 100644
index 4c81e3d28e..0000000000
--- a/benchmark/bm_hash_ident_sym.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-h = {}.compare_by_identity
-syms = ('a'..'z').to_a.map(&:to_sym)
-syms.each { |s| h[s] = s }
-200_000.times { syms.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_keys.rb b/benchmark/bm_hash_keys.rb
deleted file mode 100644
index 6863cd01f9..0000000000
--- a/benchmark/bm_hash_keys.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-h = {}
-
-10000.times do |i|
-  h[i] = nil
-end
-
-5000.times do
-  h.keys
-end
diff --git a/benchmark/bm_hash_shift.rb b/benchmark/bm_hash_shift.rb
deleted file mode 100644
index a645671a5b..0000000000
--- a/benchmark/bm_hash_shift.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-h = {}
-
-10000.times do |i|
-  h[i] = nil
-end
-
-50000.times do
-  k, v = h.shift
-  h[k] = v
-end
diff --git a/benchmark/bm_hash_to_proc.rb b/benchmark/bm_hash_to_proc.rb
deleted file mode 100644
index 2b675bf509..0000000000
--- a/benchmark/bm_hash_to_proc.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-h = {}
-
-10000.times do |i|
-  h[i] = nil
-end
-
-5000.times do |i|
-  [i].map(&h)
-end
diff --git a/benchmark/bm_hash_values.rb b/benchmark/bm_hash_values.rb
deleted file mode 100644
index 069441302f..0000000000
--- a/benchmark/bm_hash_values.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-h = {}
-
-10000.times do |i|
-  h[i] = nil
-end
-
-5000.times do
-  h.values
-end
diff --git a/benchmark/bm_io_file_create.rb b/benchmark/bm_io_file_create.rb
deleted file mode 100644
index 2f205c1333..0000000000
--- a/benchmark/bm_io_file_create.rb
+++ /dev/null
@@ -1,13 +0,0 @@
-#
-# Create files
-#
-
-max = 200_000
-file = './tmpfile_of_bm_io_file_create'
-
-max.times{
-  f = open(file, 'w')
-  f.close#(true)
-}
-File.unlink(file)
-
diff --git a/benchmark/bm_io_file_read.rb b/benchmark/bm_io_file_read.rb
deleted file mode 100644
index b9e796ed30..0000000000
--- a/benchmark/bm_io_file_read.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-#
-# Seek and Read file.
-#
-
-require 'tempfile'
-
-max = 200_000
-str = "Hello world!  " * 1000
-f = Tempfile.new('yarv-benchmark')
-f.write str
-
-max.times{
-  f.seek 0
-  f.read
-}
diff --git a/benchmark/bm_io_file_write.rb b/benchmark/bm_io_file_write.rb
deleted file mode 100644
index aa1be0e5fe..0000000000
--- a/benchmark/bm_io_file_write.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-#
-# Seek and Write file.
-#
-
-require 'tempfile'
-
-max = 200_000
-str = "Hello world!  " * 1000
-f = Tempfile.new('yarv-benchmark')
-
-max.times{
-  f.seek 0
-  f.write str
-}
diff --git a/benchmark/bm_io_nonblock_noex.rb b/benchmark/bm_io_nonblock_noex.rb
deleted file mode 100644
index da9357fdc6..0000000000
--- a/benchmark/bm_io_nonblock_noex.rb
+++ /dev/null
@@ -1,22 +0,0 @@
-nr = 1_000_000
-i = 0
-msg = '.'
-buf = '.'
-noex = { exception: false }
-begin
-  r, w = IO.pipe
-  while i < nr
-    i += 1
-    w.write_nonblock(msg, noex)
-    r.read_nonblock(1, buf, noex)
-  end
-rescue ArgumentError # old Rubies
-  while i < nr
-    i += 1
-    w.write_nonblock(msg)
-    r.read_nonblock(1, buf)
-  end
-ensure
-  r.close
-  w.close
-end
diff --git a/benchmark/bm_io_select.rb b/benchmark/bm_io_select.rb
deleted file mode 100644
index 19248daeb1..0000000000
--- a/benchmark/bm_io_select.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-# IO.select performance
-
-w = [ IO.pipe[1] ];
-
-nr = 1000000
-nr.times {
-  IO.select nil, w
-}
-
diff --git a/benchmark/bm_io_select2.rb b/benchmark/bm_io_select2.rb
deleted file mode 100644
index 10e37d71b2..0000000000
--- a/benchmark/bm_io_select2.rb
+++ /dev/null
@@ -1,22 +0,0 @@
-# IO.select performance. worst case of single fd.
-
-ios = []
-nr = 1000000
-if defined?(Process::RLIMIT_NOFILE)
-  max = Process.getrlimit(Process::RLIMIT_NOFILE)[0]
-else
-  max = 64
-end
-puts "max fd: #{max} (results not apparent with <= 1024 max fd)"
-
-((max / 2) - 10).times do
-  ios.concat IO.pipe
-end
-
-last = [ ios[-1] ]
-puts "last IO: #{last[0].inspect}"
-
-nr.times do
-  IO.select nil, last
-end
-
diff --git a/benchmark/bm_io_select3.rb b/benchmark/bm_io_select3.rb
deleted file mode 100644
index 7d0ba1f092..0000000000
--- a/benchmark/bm_io_select3.rb
+++ /dev/null
@@ -1,21 +0,0 @@
-# IO.select performance. a lot of fd
-
-ios = []
-nr = 100
-if defined?(Process::RLIMIT_NOFILE)
-  max = Process.getrlimit(Process::RLIMIT_NOFILE)[0]
-else
-  max = 64
-end
-puts "max fd: #{max} (results not apparent with <= 1024 max fd)"
-
-(max - 10).times do
-  r, w = IO.pipe
-  r.close
-  ios.push w
-end
-
-nr.times do
-  IO.select nil, ios
-end
-
diff --git a/benchmark/bm_loop_for.rb b/benchmark/bm_loop_for.rb
deleted file mode 100644
index 0fc4cc1511..0000000000
--- a/benchmark/bm_loop_for.rb
+++ /dev/null
@@ -1,3 +0,0 @@
-for i in 1..30_000_000
-  #
-end
diff --git a/benchmark/bm_loop_generator.rb b/benchmark/bm_loop_generator.rb
deleted file mode 100644
index d3375c744c..0000000000
--- a/benchmark/bm_loop_generator.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-max = 600000
-
-if defined? Fiber
-  gen = (1..max).each
-  loop do
-    gen.next
-  end
-else
-  require 'generator'
-  gen = Generator.new((0..max))
-  while gen.next?
-    gen.next
-  end
-end
diff --git a/benchmark/bm_loop_times.rb b/benchmark/bm_loop_times.rb
deleted file mode 100644
index 521f72ad1a..0000000000
--- a/benchmark/bm_loop_times.rb
+++ /dev/null
@@ -1 +0,0 @@
-30_000_000.times{|e|}
diff --git a/benchmark/bm_loop_whileloop.rb b/benchmark/bm_loop_whileloop.rb
deleted file mode 100644
index 0072822c06..0000000000
--- a/benchmark/bm_loop_whileloop.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-i = 0
-while i<30_000_000 # benchmark loop 1
-  i += 1
-end
diff --git a/benchmark/bm_loop_whileloop2.rb b/benchmark/bm_loop_whileloop2.rb
deleted file mode 100644
index 47d02dffc4..0000000000
--- a/benchmark/bm_loop_whileloop2.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-i = 0
-while i< 6_000_000 # benchmark loop 2
-  i += 1
-end
diff --git a/benchmark/bm_marshal_dump_flo.rb b/benchmark/bm_marshal_dump_flo.rb
deleted file mode 100644
index 9b8d0c6afb..0000000000
--- a/benchmark/bm_marshal_dump_flo.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-bug10761 = 10000.times.map { |x| x.to_f }
-100.times { Marshal.dump(bug10761) }
diff --git a/benchmark/bm_marshal_dump_load_geniv.rb b/benchmark/bm_marshal_dump_load_geniv.rb
deleted file mode 100644
index 8252ad90fa..0000000000
--- a/benchmark/bm_marshal_dump_load_geniv.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-a = ''
-a.instance_eval do
-  @a = :a
-  @b = :b
-  @c = :c
-end
-100000.times do
-  a = Marshal.load(Marshal.dump(a))
-end
-#p(a.instance_eval { @a == :a && @b == :b && @c == :c })
diff --git a/benchmark/bm_marshal_dump_load_time.rb b/benchmark/bm_marshal_dump_load_time.rb
deleted file mode 100644
index e29743b791..0000000000
--- a/benchmark/bm_marshal_dump_load_time.rb
+++ /dev/null
@@ -1 +0,0 @@
-100000.times { Marshal.load(Marshal.dump(Time.now)) }
diff --git a/benchmark/bm_require.rb b/benchmark/bm_require.rb
deleted file mode 100644
index b8abc88f41..0000000000
--- a/benchmark/bm_require.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-$:.push File.join(File.dirname(__FILE__), "bm_require.data")
-
-1.upto(10000) do |i|
-  require "c#{i}"
-end
-
-$:.pop
diff --git a/benchmark/bm_require_thread.rb b/benchmark/bm_require_thread.rb
deleted file mode 100644
index e54db6c6e5..0000000000
--- a/benchmark/bm_require_thread.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-$:.push File.join(File.dirname(__FILE__), "bm_require.data")
-
-i=0
-t = Thread.new do
-  while true
-    i = i+1 # dummy loop
-  end
-end
-
-1.upto(100) do |i|
-  require "c#{i}"
-end
-
-$:.pop
-t.kill
diff --git a/benchmark/bm_securerandom.rb b/benchmark/bm_securerandom.rb
deleted file mode 100644
index a082ea6d5b..0000000000
--- a/benchmark/bm_securerandom.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-require "securerandom"
-
-20_0000.times do
-  SecureRandom.random_number(100)
-end
diff --git a/benchmark/bm_so_ackermann.rb b/benchmark/bm_so_ackermann.rb
deleted file mode 100644
index 7db5be9050..0000000000
--- a/benchmark/bm_so_ackermann.rb
+++ /dev/null
@@ -1,19 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: ackermann-ruby.code,v 1.4 2004/11/13 07:40:41 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-
-def ack(m, n)
-    if m == 0 then
-        n + 1
-    elsif n == 0 then
-        ack(m - 1, 1)
-    else
-        ack(m - 1, ack(m, n - 1))
-    end
-end
-
-NUM = 9
-ack(3, NUM)
-
-
diff --git a/benchmark/bm_so_array.rb b/benchmark/bm_so_array.rb
deleted file mode 100644
index 2b8fce8f99..0000000000
--- a/benchmark/bm_so_array.rb
+++ /dev/null
@@ -1,23 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: ary-ruby.code,v 1.4 2004/11/13 07:41:27 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# with help from Paul Brannan and Mark Hubbart
-
-n = 9000 # Integer(ARGV.shift || 1)
-
-x = Array.new(n)
-y = Array.new(n, 0)
-
-n.times{|bi|
-  x[bi] = bi + 1
-}
-
-(0 .. 999).each do |e|
-  (n-1).step(0,-1) do |bi|
-    y[bi] += x.at(bi)
-  end
-end
-# puts "#{y.first} #{y.last}"
-
-
diff --git a/benchmark/bm_so_binary_trees.rb b/benchmark/bm_so_binary_trees.rb
deleted file mode 100644
index b1693e4109..0000000000
--- a/benchmark/bm_so_binary_trees.rb
+++ /dev/null
@@ -1,62 +0,0 @@
-# The Computer Language Shootout Benchmarks
-# http://shootout.alioth.debian.org
-#
-# contributed by Jesse Millikan
-
-# disable output
-alias puts_orig puts
-def puts str
-  # disable puts
-end
-
-def item_check(tree)
- if tree[0] == nil
-  tree[1]
- else
-  tree[1] + item_check(tree[0]) - item_check(tree[2])
- end
-end
-
-def bottom_up_tree(item, depth)
- if depth > 0
-  item_item = 2 * item
-  depth -= 1
-  [bottom_up_tree(item_item - 1, depth), item, bottom_up_tree(item_item, depth)]
- else
-  [nil, item, nil]
- end
-end
-
-max_depth = 16 # ARGV[0].to_i
-min_depth = 4
-
-max_depth = min_depth + 2 if min_depth + 2 > max_depth
-
-stretch_depth = max_depth + 1
-stretch_tree = bottom_up_tree(0, stretch_depth)
-
-puts "stretch tree of depth #{stretch_depth}\t check: #{item_check(stretch_tree)}"
-stretch_tree = nil
-
-long_lived_tree = bottom_up_tree(0, max_depth)
-
-min_depth.step(max_depth + 1, 2) do |depth|
- iterations = 2**(max_depth - depth + min_depth)
-
- check = 0
-
- for i in 1..iterations
-  temp_tree = bottom_up_tree(i, depth)
-  check += item_check(temp_tree)
-
-  temp_tree = bottom_up_tree(-i, depth)
-  check += item_check(temp_tree)
- end
-
- puts "#{iterations * 2}\t trees of depth #{depth}\t check: #{check}"
-end
-
-puts "long lived tree of depth #{max_depth}\t check: #{item_check(long_lived_tree)}"
-
-undef puts
-alias puts puts_orig
diff --git a/benchmark/bm_so_concatenate.rb b/benchmark/bm_so_concatenate.rb
deleted file mode 100644
index 873214de7c..0000000000
--- a/benchmark/bm_so_concatenate.rb
+++ /dev/null
@@ -1,18 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: strcat-ruby.code,v 1.4 2004/11/13 07:43:28 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# based on code from Aristarkh A Zagorodnikov and Dat Nguyen
-
-STUFF = "hello\n"
-i = 0
-while i<10
-  i += 1
-  hello = ''
-  4_000_000.times do |e|
-    hello << STUFF
-  end
-end
-# puts hello.length
-
-
diff --git a/benchmark/bm_so_count_words.rb b/benchmark/bm_so_count_words.rb
deleted file mode 100644
index 65f6337a4a..0000000000
--- a/benchmark/bm_so_count_words.rb
+++ /dev/null
@@ -1,19 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: wc-ruby.code,v 1.4 2004/11/13 07:43:32 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# with help from Paul Brannan
-
-input = open(File.join(File.dirname($0), 'wc.input'), 'rb')
-
-nl = nw = nc = 0
-while true
-  tmp = input.read(4096) or break
-  data = tmp << (input.gets || "")
-  nc += data.length
-  nl += data.count("\n")
-  ((data.strip! || data).tr!("\n", " ") || data).squeeze!
-  nw += data.count(" ") + 1
-end
-# STDERR.puts "#{nl} #{nw} #{nc}"
-
diff --git a/benchmark/bm_so_exception.rb b/benchmark/bm_so_exception.rb
deleted file mode 100644
index deb003a594..0000000000
--- a/benchmark/bm_so_exception.rb
+++ /dev/null
@@ -1,61 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: except-ruby.code,v 1.4 2004/11/13 07:41:33 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-
-$HI = 0
-$LO = 0
-NUM = 250000 # Integer(ARGV[0] || 1)
-
-
-class Lo_Exception < Exception
-  def initialize(num)
-    @value = num
-  end
-end
-
-class Hi_Exception < Exception
-  def initialize(num)
-    @value = num
-  end
-end
-
-def some_function(num)
-  begin
-    hi_function(num)
-  rescue
-    print "We shouldn't get here, exception is: #{$!.type}\n"
-  end
-end
-
-def hi_function(num)
-  begin
-    lo_function(num)
-  rescue Hi_Exception
-    $HI = $HI + 1
-  end
-end
-
-def lo_function(num)
-  begin
-    blowup(num)
-  rescue Lo_Exception
-    $LO = $LO + 1
-  end
-end
-
-def blowup(num)
-  if num % 2 == 0
-    raise Lo_Exception.new(num)
-  else
-    raise Hi_Exception.new(num)
-  end
-end
-
-
-i = 1
-max = NUM+1
-while i < max
-  i += 1
-  some_function(i+1)
-end
diff --git a/benchmark/bm_so_fannkuch.rb b/benchmark/bm_so_fannkuch.rb
deleted file mode 100644
index bac5ecd44c..0000000000
--- a/benchmark/bm_so_fannkuch.rb
+++ /dev/null
@@ -1,45 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org/
-# Contributed by Sokolov Yura
-# Modified by Ryan Williams
-
-def fannkuch(n)
-   maxFlips, m, r, check = 0, n-1, n, 0
-   count = (1..n).to_a
-   perm = (1..n).to_a
-
-   while true
-      if check < 30
-         puts "#{perm}"
-         check += 1
-      end
-
-      while r != 1
-         count[r-1] = r
-         r -= 1
-      end
-
-      if perm[0] != 1 and perm[m] != n
-         perml = perm.clone #.dup
-         flips = 0
-         while (k = perml.first ) != 1
-            perml = perml.slice!(0, k).reverse + perml
-            flips += 1
-         end
-         maxFlips = flips if flips > maxFlips
-      end
-      while true
-         if r==n then return maxFlips end
-         perm.insert r,perm.shift
-         break if (count[r] -= 1) > 0
-         r += 1
-      end
-   end
-end
-
-def puts *args
-end
-
-N = 9 # (ARGV[0] || 1).to_i
-puts "Pfannkuchen(#{N}) = #{fannkuch(N)}"
-
diff --git a/benchmark/bm_so_fasta.rb b/benchmark/bm_so_fasta.rb
deleted file mode 100644
index 3f759ba7ae..0000000000
--- a/benchmark/bm_so_fasta.rb
+++ /dev/null
@@ -1,81 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org/
-# Contributed by Sokolov Yura
-
-$last = 42.0
-def gen_random (max,im=139968,ia=3877,ic=29573)
-    (max * ($last = ($last * ia + ic) % im)) / im
-end
-
-alu =
-   "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
-   "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
-   "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
-   "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
-   "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
-   "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
-   "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
-
-iub = [
-    ["a", 0.27],
-    ["c", 0.12],
-    ["g", 0.12],
-    ["t", 0.27],
-
-    ["B", 0.02],
-    ["D", 0.02],
-    ["H", 0.02],
-    ["K", 0.02],
-    ["M", 0.02],
-    ["N", 0.02],
-    ["R", 0.02],
-    ["S", 0.02],
-    ["V", 0.02],
-    ["W", 0.02],
-    ["Y", 0.02],
-]
-homosapiens = [
-    ["a", 0.3029549426680],
-    ["c", 0.1979883004921],
-    ["g", 0.1975473066391],
-    ["t", 0.3015094502008],
-]
-
-def make_repeat_fasta(id, desc, src, n)
-    puts ">#{id} #{desc}"
-    v = nil
-    width = 60
-    l = src.length
-    s = src * ((n / l) + 1)
-    s.slice!(n, l)
-    puts(s.scan(/.{1,#{width}}/).join("\n"))
-end
-
-def make_random_fasta(id, desc, table, n)
-    puts ">#{id} #{desc}"
-    rand, v = nil,nil
-    width = 60
-    chunk = 1 * width
-    prob = 0.0
-    table.each{|v| v[1]= (prob += v[1])}
-    for i in 1..(n/width)
-        puts((1..width).collect{
-            rand = gen_random(1.0)
-            table.find{|v| v[1]>rand}[0]
-        }.join)
-    end
-    if n%width != 0
-        puts((1..(n%width)).collect{
-            rand = gen_random(1.0)
-            table.find{|v| v[1]>rand}[0]
-        }.join)
-    end
-end
-
-
-n = (ARGV[0] or 250_000).to_i
-
-make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
-make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
-make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
-
diff --git a/benchmark/bm_so_k_nucleotide.rb b/benchmark/bm_so_k_nucleotide.rb
deleted file mode 100644
index dadab3e79c..0000000000
--- a/benchmark/bm_so_k_nucleotide.rb
+++ /dev/null
@@ -1,48 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org
-#
-# contributed by jose fco. gonzalez
-# modified by Sokolov Yura
-
-seq = String.new
-
-def frecuency( seq,length )
-    n, table = seq.length - length + 1, Hash.new(0)
-    f, i = nil, nil
-    (0 ... length).each do |f|
-        (f ... n).step(length) do |i|
-            table[seq[i,length]] += 1
-        end
-    end
-    [n,table]
-
-end
-
-def sort_by_freq( seq,length )
-    n,table = frecuency( seq,length )
-    a, b, v = nil, nil, nil
-    table.sort{|a,b| b[1] <=> a[1]}.each do |v|
-        puts "%s %.3f" % [v[0].upcase,((v[1]*100).to_f/n)]
-    end
-    puts
-end
-
-def find_seq( seq,s )
-    n,table = frecuency( seq,s.length )
-    puts "#{table[s].to_s}\t#{s.upcase}"
-end
-
-input = open(File.join(File.dirname($0), 'fasta.output.100000'), 'rb')
-
-line = input.gets while line !~ /^>THREE/
-line = input.gets
-
-while (line !~ /^>/) & line do
-    seq << line.chomp
-    line = input.gets
-end
-
-[1,2].each {|i| sort_by_freq( seq,i ) }
-
-%w(ggt ggta ggtatt ggtattttaatt ggtattttaatttatagt).each{|s| find_seq( seq,s) }
-
diff --git a/benchmark/bm_so_lists.rb b/benchmark/bm_so_lists.rb
deleted file mode 100644
index e8f4a2a5f7..0000000000
--- a/benchmark/bm_so_lists.rb
+++ /dev/null
@@ -1,47 +0,0 @@
-#from http://www.bagley.org/~doug/shootout/bench/lists/lists.ruby
-
-NUM = 300
-SIZE = 10000
-
-def test_lists()
-  # create a list of integers (Li1) from 1 to SIZE
-  li1 = (1..SIZE).to_a
-  # copy the list to li2 (not by individual items)
-  li2 = li1.dup
-  # remove each individual item from left side of li2 and
-  # append to right side of li3 (preserving order)
-  li3 = Array.new
-  while (not li2.empty?)
-    li3.push(li2.shift)
-  end
-  # li2 must now be empty
-  # remove each individual item from right side of li3 and
-  # append to right side of li2 (reversing list)
-  while (not li3.empty?)
-    li2.push(li3.pop)
-  end
-  # li3 must now be empty
-  # reverse li1 in place
-  li1.reverse!
-  # check that first item is now SIZE
-  if li1[0] != SIZE then
-    p "not SIZE"
-    0
-  else
-    # compare li1 and li2 for equality
-    if li1 != li2 then
-      return(0)
-    else
-      # return the length of the list
-      li1.length
-    end
-  end
-end
-
-i = 0
-while i<NUM
-  i += 1
-  result = test_lists()
-end
-
-result
diff --git a/benchmark/bm_so_mandelbrot.rb b/benchmark/bm_so_mandelbrot.rb
deleted file mode 100644
index 76331c64b8..0000000000
--- a/benchmark/bm_so_mandelbrot.rb
+++ /dev/null
@@ -1,57 +0,0 @@
-#  The Computer Language Benchmarks Game
-#  http://shootout.alioth.debian.org/
-#
-#  contributed by Karl von Laudermann
-#  modified by Jeremy Echols
-
-size = 600 # ARGV[0].to_i
-
-puts "P4\n#{size} #{size}"
-
-ITER = 49                           # Iterations - 1 for easy for..in looping
-LIMIT_SQUARED = 4.0                 # Presquared limit
-
-byte_acc = 0
-bit_num = 0
-
-count_size = size - 1               # Precomputed size for easy for..in looping
-
-# For..in loops are faster than .upto, .downto, .times, etc.
-for y in 0..count_size
-  for x in 0..count_size
-    zr = 0.0
-    zi = 0.0
-    cr = (2.0*x/size)-1.5
-    ci = (2.0*y/size)-1.0
-    escape = false
-
-    # To make use of the for..in code, we use a dummy variable,
-    # like one would in C
-    for dummy in 0..ITER
-      tr = zr*zr - zi*zi + cr
-      ti = 2*zr*zi + ci
-      zr, zi = tr, ti
-
-      if (zr*zr+zi*zi) > LIMIT_SQUARED
-        escape = true
-        break
-      end
-    end
-
-    byte_acc = (byte_acc << 1) | (escape ? 0b0 : 0b1)
-    bit_num += 1
-
-    # Code is very similar for these cases, but using separate blocks
-    # ensures we skip the shifting when it's unnecessary, which is most cases.
-    if (bit_num == 8)
-      print byte_acc.chr
-      byte_acc = 0
-      bit_num = 0
-    elsif (x == count_size)
-      byte_acc <<= (8 - bit_num)
-      print byte_acc.chr
-      byte_acc = 0
-      bit_num = 0
-    end
-  end
-end
diff --git a/benchmark/bm_so_matrix.rb b/benchmark/bm_so_matrix.rb
deleted file mode 100644
index e2c5c8e559..0000000000
--- a/benchmark/bm_so_matrix.rb
+++ /dev/null
@@ -1,48 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: matrix-ruby.code,v 1.4 2004/11/13 07:42:14 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-
-n = 60 #Integer(ARGV.shift || 1)
-
-size = 40
-
-def mkmatrix(rows, cols)
-    count = 1
-    mx = Array.new(rows)
-    (0 .. (rows - 1)).each do |bi|
-        row = Array.new(cols, 0)
-        (0 .. (cols - 1)).each do |j|
-            row[j] = count
-            count += 1
-        end
-        mx[bi] = row
-    end
-    mx
-end
-
-def mmult(rows, cols, m1, m2)
-    m3 = Array.new(rows)
-    (0 .. (rows - 1)).each do |bi|
-        row = Array.new(cols, 0)
-        (0 .. (cols - 1)).each do |j|
-            val = 0
-            (0 .. (cols - 1)).each do |k|
-                val += m1.at(bi).at(k) * m2.at(k).at(j)
-            end
-            row[j] = val
-        end
-        m3[bi] = row
-    end
-    m3
-end
-
-m1 = mkmatrix(size, size)
-m2 = mkmatrix(size, size)
-mm = Array.new
-n.times do
-    mm = mmult(size, size, m1, m2)
-end
-# puts "#{mm[0][0]} #{mm[2][3]} #{mm[3][2]} #{mm[4][4]}"
-
-
diff --git a/benchmark/bm_so_meteor_contest.rb b/benchmark/bm_so_meteor_contest.rb
deleted file mode 100644
index 17e9c046a8..0000000000
--- a/benchmark/bm_so_meteor_contest.rb
+++ /dev/null
@@ -1,564 +0,0 @@
-#!/usr/bin/env ruby
-#
-# The Computer Language Shootout
-#   http://shootout.alioth.debian.org
-#   contributed by Kevin Barnes (Ruby novice)
-
-# PROGRAM:  the main body is at the bottom.
-#   1) read about the problem here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
-#   2) see how I represent a board as a bitmask by reading the blank_board comments
-#   3) read as your mental paths take you
-
-def print *args
-end
-
-# class to represent all information about a particular rotation of a particular piece
-class Rotation
-  # an array (by location) containing a bit mask for how the piece maps at the given location.
-  # if the rotation is invalid at that location the mask will contain false
-  attr_reader :start_masks
-
-  # maps a direction to a relative location.  these differ depending on whether it is an even or
-  # odd row being mapped from
-  @@rotation_even_adder = { :west => -1, :east => 1, :nw => -7, :ne => -6, :sw => 5, :se => 6 }
-  @@rotation_odd_adder = { :west => -1, :east => 1, :nw => -6, :ne => -5, :sw => 6, :se => 7 }
-
-  def initialize( directions )
-    @even_offsets, @odd_offsets = normalize_offsets( get_values( directions ))
-
-    @even_mask = mask_for_offsets( @even_offsets)
-    @odd_mask = mask_for_offsets( @odd_offsets)
-
-    @start_masks = Array.new(60)
-
-    # create the rotational masks by placing the base mask at the location and seeing if
-    # 1) it overlaps the boundaries and 2) it produces a prunable board.  if either of these
-    # is true the piece cannot be placed
-    0.upto(59) do | offset |
-      mask = is_even(offset) ? (@even_mask << offset) : (@odd_mask << offset)
-      if (blank_board & mask == 0 && !prunable(blank_board | mask, 0, true)) then
-        imask = compute_required( mask, offset)
-        @start_masks[offset] = [ mask, imask, imask | mask ]
-      else
-        @start_masks[offset] = false
-      end
-    end
-  end
-
-  def compute_required( mask, offset )
-    board = blank_board
-    0.upto(offset) { | i | board |= 1 << i }
-    board |= mask
-    return 0 if (!prunable(board | mask, offset))
-    board = flood_fill(board,58)
-    count = 0
-    imask = 0
-    0.upto(59) do | i |
-      if (board[i] == 0) then
-        imask |= (1 << i)
-        count += 1
-      end
-    end
-    (count > 0 && count < 5) ? imask : 0
-  end
-
-  def flood_fill( board, location)
-    return board if (board[location] == 1)
-    board |= 1 << location
-    row, col = location.divmod(6)
-    board = flood_fill( board, location - 1) if (col > 0)
-    board = flood_fill( board, location + 1) if (col < 4)
-    if (row % 2 == 0) then
-      board = flood_fill( board, location - 7) if (col > 0 && row > 0)
-      board = flood_fill( board, location - 6) if (row > 0)
-      board = flood_fill( board, location + 6) if (row < 9)
-      board = flood_fill( board, location + 5) if (col > 0 && row < 9)
-    else
-      board = flood_fill( board, location - 5) if (col < 4 && row > 0)
-      board = flood_fill( board, location - 6) if (row > 0)
-      board = flood_fill( board, location + 6) if (row < 9)
-      board = flood_fill( board, location + 7) if (col < 4 && row < 9)
-    end
-    board
-  end
-
-  # given a location, produces a list of relative locations covered by the piece at this rotation
-  def offsets( location)
-    if is_even( location) then
-      @even_offsets.collect { | value | value + location }
-    else
-      @odd_offsets.collect { | value | value + location }
-    end
-  end
-
-  # returns a set of offsets relative to the top-left most piece of the rotation (by even or odd rows)
-  # this is hard to explain. imagine we have this partial board:
-  #   0 0 0 0 0 x        [positions 0-5]
-  #    0 0 1 1 0 x       [positions 6-11]
-  #   0 0 1 0 0 x        [positions 12-17]
-  #    0 1 0 0 0 x       [positions 18-23]
-  #   0 1 0 0 0 x        [positions 24-29]
-  #    0 0 0 0 0 x       [positions 30-35]
-  #       ...
-  # The top-left of the piece is at position 8, the
-  # board would be passed as a set of positions (values array) containing [8,9,14,19,25] not necessarily in that
-  # sorted order.  Since that array starts on an odd row, the offsets for an odd row are: [0,1,6,11,17] obtained
-  # by subtracting 8 from everything.  Now imagine the piece shifted up and to the right so it's on an even row:
-  #   0 0 0 1 1 x        [positions 0-5]
-  #    0 0 1 0 0 x       [positions 6-11]
-  #   0 0 1 0 0 x        [positions 12-17]
-  #    0 1 0 0 0 x       [positions 18-23]
-  #   0 0 0 0 0 x        [positions 24-29]
-  #    0 0 0 0 0 x       [positions 30-35]
-  #       ...
-  # Now the positions are [3,4,8,14,19] which after subtracting the lowest value (3) gives [0,1,5,11,16] thus, the
-  # offsets for this particular piece are (in even, odd order) [0,1,5,11,16],[0,1,6,11,17] which is what
-  # this function would return
-  def normalize_offsets( values)
-    min = values.min
-    even_min = is_even(min)
-    other_min = even_min ? min + 6 : min + 7
-    other_values = values.collect do | value |
-      if is_even(value) then
-        value + 6 - other_min
-      else
-        value + 7 - other_min
-      end
-    end
-    values.collect! { | value | value - min }
-
-    if even_min then
-      [values, other_values]
-    else
-      [other_values, values]
-    end
-  end
-
-  # produce a bitmask representation of an array of offset locations
-  def mask_for_offsets( offsets )
-    mask = 0
-    offsets.each { | value | mask = mask + ( 1 << value ) }
-    mask
-  end
-
-  # finds a "safe" position that a position as described by a list of directions can be placed
-  # without falling off any edge of the board.  the values returned a location to place the first piece
-  # at so it will fit after making the described moves
-  def start_adjust( directions )
-    south = east = 0;
-    directions.each do | direction |
-      east += 1 if ( direction == :sw || direction == :nw || direction == :west )
-      south += 1 if ( direction == :nw || direction == :ne )
-    end
-    south * 6 + east
-  end
-
-  # given a set of directions places the piece (as defined by a set of directions) on the board at
-  # a location that will not take it off the edge
-  def get_values ( directions )
-    start = start_adjust(directions)
-    values = [ start ]
-    directions.each do | direction |
-      if (start % 12 >= 6) then
-        start += @@rotation_odd_adder[direction]
-      else
-        start += @@rotation_even_adder[direction]
-      end
-      values += [ start ]
-    end
-
-    # some moves take you back to an existing location, we'll strip duplicates
-    values.uniq
-  end
-end
-
-# describes a piece and caches information about its rotations to as to be efficient for iteration
-# ATTRIBUTES:
-#   rotations -- all the rotations of the piece
-#   type -- a numeic "name" of the piece
-#   masks -- an array by location of all legal rotational masks (a n inner array) for that location
-#   placed -- the mask that this piece was last placed at (not a location, but the actual mask used)
-class Piece
-  attr_reader :rotations, :type, :masks
-  attr_accessor :placed
-
-  # transform hashes that change one direction into another when you either flip or rotate a set of directions
-  @@flip_converter = { :west => :west, :east => :east, :nw => :sw, :ne => :se, :sw => :nw, :se => :ne }
-  @@rotate_converter = { :west => :nw, :east => :se, :nw => :ne, :ne => :east, :sw => :west, :se => :sw }
-
-  def initialize( directions, type )
-    @type = type
-    @rotations = Array.new();
-    @map = {}
-
-    generate_rotations( directions )
-    directions.collect! { | value | @@flip_converter[value] }
-    generate_rotations( directions )
-
-    # creates the masks AND a map that returns [location, rotation] for any given mask
-    # this is used when a board is found and we want to draw it, otherwise the map is unused
-    @masks = Array.new();
-    0.upto(59) do | i |
-      even = true
-      @masks[i] = @rotations.collect do | rotation |
-        mask = rotation.start_masks[i]
-        @map[mask[0]] = [ i, rotation ] if (mask)
-        mask || nil
-      end
-      @masks[i].compact!
-    end
-  end
-
-  # rotates a set of directions through all six angles and adds a Rotation to the list for each one
-  def generate_rotations( directions )
-    6.times do
-      rotations.push( Rotation.new(directions))
-      directions.collect! { | value | @@rotate_converter[value] }
-    end
-  end
-
-  # given a board string, adds this piece to the board at whatever location/rotation
-  # important: the outbound board string is 5 wide, the normal location notation is six wide (padded)
-  def fill_string( board_string)
-    location, rotation = @map[@placed]
-    rotation.offsets(location).each do | offset |
-      row, col = offset.divmod(6)
-      board_string[ row*5 + col, 1 ] = @type.to_s
-    end
-  end
-end
-
-# a blank bit board having this form:
-#
-#    0 0 0 0 0 1
-#     0 0 0 0 0 1
-#    0 0 0 0 0 1
-#     0 0 0 0 0 1
-#    0 0 0 0 0 1
-#     0 0 0 0 0 1
-#    0 0 0 0 0 1
-#     0 0 0 0 0 1
-#    0 0 0 0 0 1
-#     0 0 0 0 0 1
-#    1 1 1 1 1 1
-#
-# where left lest significant bit is the top left and the most significant is the lower right
-# the actual board only consists of the 0 places, the 1 places are blockers to keep things from running
-# off the edges or bottom
-def blank_board
-  0b111111100000100000100000100000100000100000100000100000100000100000
-end
-
-def full_board
-  0b111111111111111111111111111111111111111111111111111111111111111111
-end
-
-# determines if a location (bit position) is in an even row
-def is_even( location)
-  (location % 12) < 6
-end
-
-# support function that create three utility maps:
-#  $converter -- for each row an array that maps a five bit row (via array mapping)
-#                to the a a five bit representation of the bits below it
-#  $bit_count -- maps a five bit row (via array mapping) to the number of 1s in the row
-#  @@new_regions -- maps a five bit row (via array mapping) to an array of "region" arrays
-#                   a region array has three values the first is a mask of bits in the region,
-#                   the second is the count of those bits and the third is identical to the first
-#                   examples:
-#                           0b10010 => [ 0b01100, 2, 0b01100 ], [ 0b00001, 1, 0b00001]
-#                           0b01010 => [ 0b10000, 1, 0b10000 ], [ 0b00100, 1, 0b00100 ], [ 0b00001, 1, 0b00001]
-#                           0b10001 => [ 0b01110, 3, 0b01110 ]
-def create_collector_support
-  odd_map = [0b11, 0b110, 0b1100, 0b11000, 0b10000]
-  even_map = [0b1, 0b11, 0b110, 0b1100, 0b11000]
-
-  all_odds = Array.new(0b100000)
-  all_evens = Array.new(0b100000)
-  bit_counts = Array.new(0b100000)
-  new_regions = Array.new(0b100000)
-  0.upto(0b11111) do | i |
-    bit_count = odd = even = 0
-    0.upto(4) do | bit |
-      if (i[bit] == 1) then
-        bit_count += 1
-        odd |= odd_map[bit]
-        even |= even_map[bit]
-      end
-    end
-    all_odds[i] = odd
-    all_evens[i] = even
-    bit_counts[i] = bit_count
-    new_regions[i] = create_regions( i)
-  end
-
-  $converter = []
-  10.times { | row | $converter.push((row % 2 == 0) ? all_evens : all_odds) }
-  $bit_counts = bit_counts
-  $regions = new_regions.collect { | set | set.collect { | value | [ value, bit_counts[value], value] } }
-end
-
-# determines if a board is punable, meaning that there is no possibility that it
-# can be filled up with pieces.  A board is prunable if there is a grouping of unfilled spaces
-# that are not a multiple of five.  The following board is an example of a prunable board:
-#    0 0 1 0 0
-#     0 1 0 0 0
-#    1 1 0 0 0
-#     0 1 0 0 0
-#    0 0 0 0 0
-#       ...
-#
-# This board is prunable because the top left corner is only 3 bits in area, no piece will ever fit it
-# parameters:
-#   board -- an initial bit board (6 bit padded rows, see blank_board for format)
-#   location -- starting location, everything above and to the left is already full
-#   slotting -- set to true only when testing initial pieces, when filling normally
-#               additional assumptions are possible
-#
-# Algorithm:
-#    The algorithm starts at the top row (as determined by location) and iterates a row at a time
-#    maintainng counts of active open areas (kept in the collector array) each collector contains
-#    three values at the start of an iteration:
-#          0: mask of bits that would be adjacent to the collector in this row
-#          1: the number of bits collected so far
-#          2: a scratch space starting as zero, but used during the computation to represent
-#             the empty bits in the new row that are adjacent (position 0)
-#  The exact procedure is described in-code
-def prunable( board, location, slotting = false)
-  collectors = []
-  # loop across the rows
-  (location / 6).to_i.upto(9) do | row_on |
-    # obtain a set of regions representing the bits of the current row.
-    regions = $regions[(board >> (row_on * 6)) & 0b11111]
-    converter = $converter[row_on]
-
-    # track the number of collectors at the start of the cycle so that
-    # we don't compute against newly created collectors, only existing collectors
-    initial_collector_count = collectors.length
-
-    # loop against the regions.  For each region of the row
-    # we will see if it connects to one or more existing collectors.
-    # if it connects to 1 collector, the bits from the region are added to the
-    # bits of the collector and the mask is placed in collector[2]
-    # If the region overlaps more than one collector then all the collectors
-    # it overlaps with are merged into the first one (the others are set to nil in the array)
-    # if NO collectors are found then the region is copied as a new collector
-    regions.each do | region |
-      collector_found = nil
-      region_mask = region[2]
-      initial_collector_count.times do | collector_num |
-        collector = collectors[collector_num]
-        if (collector) then
-          collector_mask = collector[0]
-          if (collector_mask & region_mask != 0) then
-            if (collector_found) then
-              collector_found[0] |= collector_mask
-              collector_found[1] += collector[1]
-              collector_found[2] |= collector[2]
-              collectors[collector_num] = nil
-            else
-              collector_found = collector
-              collector[1] += region[1]
-              collector[2] |= region_mask
-            end
-          end
-        end
-      end
-      if (collector_found == nil) then
-        collectors.push(Array.new(region))
-      end
-    end
-
-    # check the existing collectors, if any collector overlapped no bits in the region its [2] value will
-    # be zero.  The size of any such reaason is tested if it is not a multiple of five true is returned since
-    # the board is prunable.  if it is a multiple of five it is removed.
-    # Collector that are still active have a new adjacent value [0] set based n the matched bits
-    # and have [2] cleared out for the next cycle.
-    collectors.length.times do | collector_num |
-      collector = collectors[collector_num]
-      if (collector) then
-        if (collector[2] == 0) then
-          return true if (collector[1] % 5 != 0)
-          collectors[collector_num] = nil
-        else
-          # if a collector matches all bits in the row then we can return unprunable early for the
-          # following reasons:
-          #    1) there can be no more unavailable bits bince we fill from the top left downward
-          #    2) all previous regions have been closed or joined so only this region can fail
-          #    3) this region must be good since there can never be only 1 region that is nuot
-          #       a multiple of five
-          # this rule only applies when filling normally, so we ignore the rule if we are "slotting"
-          # in pieces to see what configurations work for them (the only other time this algorithm is used).
-          return false if (collector[2] == 0b11111 && !slotting)
-          collector[0] = converter[collector[2]]
-          collector[2] = 0
-        end
-      end
-    end
-
-    # get rid of all the empty converters for the next round
-    collectors.compact!
-  end
-  return false if (collectors.length <= 1) # 1 collector or less and the region is fine
-  collectors.any? { | collector | (collector[1] % 5) != 0 } # more than 1 and we test them all for bad size
-end
-
-# creates a region given a row mask.  see prunable for what a "region" is
-def create_regions( value )
-  regions = []
-  cur_region = 0
-  5.times do | bit |
-    if (value[bit] == 0) then
-      cur_region |= 1 << bit
-    else
-      if (cur_region != 0 ) then
-        regions.push( cur_region)
-        cur_region = 0;
-      end
-    end
-  end
-  regions.push(cur_region) if (cur_region != 0)
-  regions
-end
-
-# find up to the counted number of solutions (or all solutions) and prints the final result
-def find_all
-  find_top( 1)
-  find_top( 0)
-  print_results
-end
-
-# show the board
-def print_results
-  print "#{@boards_found} solutions found\n\n"
-  print_full_board( @min_board)
-  print "\n"
-  print_full_board( @max_board)
-  print "\n"
-end
-
-# finds solutions.  This special version of the main function is only used for the top level
-# the reason for it is basically to force a particular ordering on how the rotations are tested for
-# the first piece.  It is called twice, first looking for placements of the odd rotations and then
-# looking for placements of the even locations.
-#
-# WHY?
-#   Since any found solution has an inverse we want to maximize finding solutions that are not already found
-#   as an inverse.  The inverse will ALWAYS be 3 one of the piece configurations that is exactly 3 rotations away
-#   (an odd number).  Checking even vs odd then produces a higher probability of finding more pieces earlier
-#   in the cycle.  We still need to keep checking all the permutations, but our probability of finding one will
-#   diminsh over time.  Since we are TOLD how many to search for this lets us exit before checking all pieces
-#   this bennifit is very great when seeking small numbers of solutions and is 0 when looking for more than the
-#   maximum number
-def find_top( rotation_skip)
-  board = blank_board
-  (@pieces.length-1).times do
-    piece = @pieces.shift
-    piece.masks[0].each do | mask, imask, cmask |
-      if ((rotation_skip += 1) % 2 == 0) then
-        piece.placed = mask
-        find( 1, 1, board | mask)
-      end
-    end
-    @pieces.push(piece)
-  end
-  piece = @pieces.shift
-  @pieces.push(piece)
-end
-
-# the normail find routine, iterates through the available pieces, checks all rotations at the current location
-# and adds any boards found.  depth is achieved via recursion.  the overall approach is described
-# here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
-# parameters:
-#  start_location -- where to start looking for place for the next piece at
-#  placed -- number of pieces placed
-#  board -- current state of the board
-#
-# see in-code comments
-def find( start_location, placed, board)
-  # find the next location to place a piece by looking for an empty bit
-  while board[start_location] == 1
-    start_location += 1
-  end
-
-  @pieces.length.times do
-    piece = @pieces.shift
-    piece.masks[start_location].each do | mask, imask, cmask |
-      if ( board & cmask == imask) then
-        piece.placed = mask
-        if (placed == 9) then
-          add_board
-        else
-          find( start_location + 1, placed + 1, board | mask)
-        end
-      end
-    end
-    @pieces.push(piece)
-  end
-end
-
-# print the board
-def print_full_board( board_string)
-  10.times do | row |
-    print " " if (row % 2 == 1)
-    5.times do | col |
-      print "#{board_string[row*5 + col,1]} "
-    end
-    print "\n"
-  end
-end
-
-# when a board is found we "draw it" into a string and then flip that string, adding both to
-# the list (hash) of solutions if they are unique.
-def add_board
-  board_string = "99999999999999999999999999999999999999999999999999"
-  @all_pieces.each {  | piece | piece.fill_string( board_string ) }
-  save( board_string)
-  save( board_string.reverse)
-end
-
-# adds a board string to the list (if new) and updates the current best/worst board
-def save( board_string)
-  if (@all_boards[board_string] == nil) then
-    @min_board = board_string if (board_string < @min_board)
-    @max_board = board_string if (board_string > @max_board)
-    @all_boards.store(board_string,true)
-    @boards_found += 1
-
-    # the exit motif is a time saver.  Ideally the function should return, but those tests
-    # take noticeable time (performance).
-    if (@boards_found == @stop_count) then
-      print_results
-      exit(0)
-    end
-  end
-end
-
-
-##
-## MAIN BODY :)
-##
-create_collector_support
-@pieces = [
-  Piece.new( [ :nw, :ne, :east, :east ], 2),
-  Piece.new( [ :ne, :se, :east, :ne ], 7),
-  Piece.new( [ :ne, :east, :ne, :nw ], 1),
-  Piece.new( [ :east, :sw, :sw, :se ], 6),
-  Piece.new( [ :east, :ne, :se, :ne ], 5),
-  Piece.new( [ :east, :east, :east, :se ], 0),
-  Piece.new( [ :ne, :nw, :se, :east, :se ], 4),
-  Piece.new( [ :se, :se, :se, :west ], 9),
-  Piece.new( [ :se, :se, :east, :se ], 8),
-  Piece.new( [ :east, :east, :sw, :se ], 3)
-  ];
-
-@all_pieces = Array.new( @pieces)
-
-@min_board = "99999999999999999999999999999999999999999999999999"
-@max_board = "00000000000000000000000000000000000000000000000000"
-@stop_count = ARGV[0].to_i || 2089
-@all_boards = {}
-@boards_found = 0
-
-find_all ######## DO IT!!!
-
diff --git a/benchmark/bm_so_nbody.rb b/benchmark/bm_so_nbody.rb
deleted file mode 100644
index d6c5bb9e61..0000000000
--- a/benchmark/bm_so_nbody.rb
+++ /dev/null
@@ -1,148 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org
-#
-# Optimized for Ruby by Jesse Millikan
-# From version ported by Michael Neumann from the C gcc version,
-# which was written by Christoph Bauer.
-
-SOLAR_MASS = 4 * Math::PI**2
-DAYS_PER_YEAR = 365.24
-
-def _puts *args
-end
-
-class Planet
- attr_accessor :x, :y, :z, :vx, :vy, :vz, :mass
-
- def initialize(x, y, z, vx, vy, vz, mass)
-  @x, @y, @z = x, y, z
-  @vx, @vy, @vz = vx * DAYS_PER_YEAR, vy * DAYS_PER_YEAR, vz * DAYS_PER_YEAR
-  @mass = mass * SOLAR_MASS
- end
-
- def move_from_i(bodies, nbodies, dt, i)
-  while i < nbodies
-   b2 = bodies[i]
-   dx = @x - b2.x
-   dy = @y - b2.y
-   dz = @z - b2.z
-
-   distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
-   mag = dt / (distance * distance * distance)
-   b_mass_mag, b2_mass_mag = @mass * mag, b2.mass * mag
-
-   @vx -= dx * b2_mass_mag
-   @vy -= dy * b2_mass_mag
-   @vz -= dz * b2_mass_mag
-   b2.vx += dx * b_mass_mag
-   b2.vy += dy * b_mass_mag
-   b2.vz += dz * b_mass_mag
-   i += 1
-  end
-
-  @x += dt * @vx
-  @y += dt * @vy
-  @z += dt * @vz
- end
-end
-
-def energy(bodies)
-  e = 0.0
-  nbodies = bodies.size
-
-  for i in 0 ... nbodies
-    b = bodies[i]
-    e += 0.5 * b.mass * (b.vx * b.vx + b.vy * b.vy + b.vz * b.vz)
-    for j in (i + 1) ... nbodies
-      b2 = bodies[j]
-      dx = b.x - b2.x
-      dy = b.y - b2.y
-      dz = b.z - b2.z
-      distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
-      e -= (b.mass * b2.mass) / distance
-    end
-  end
-  e
-end
-
-def offset_momentum(bodies)
-  px, py, pz = 0.0, 0.0, 0.0
-
-  for b in bodies
-    m = b.mass
-    px += b.vx * m
-    py += b.vy * m
-    pz += b.vz * m
-  end
-
-  b = bodies[0]
-  b.vx = - px / SOLAR_MASS
-  b.vy = - py / SOLAR_MASS
-  b.vz = - pz / SOLAR_MASS
-end
-
-BODIES = [
-  # sun
-  Planet.new(0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0),
-
-  # jupiter
-  Planet.new(
-    4.84143144246472090e+00,
-    -1.16032004402742839e+00,
-    -1.03622044471123109e-01,
-    1.66007664274403694e-03,
-    7.69901118419740425e-03,
-    -6.90460016972063023e-05,
-    9.54791938424326609e-04),
-
-  # saturn
-  Planet.new(
-    8.34336671824457987e+00,
-    4.12479856412430479e+00,
-    -4.03523417114321381e-01,
-    -2.76742510726862411e-03,
-    4.99852801234917238e-03,
-    2.30417297573763929e-05,
-    2.85885980666130812e-04),
-
-  # uranus
-  Planet.new(
-    1.28943695621391310e+01,
-    -1.51111514016986312e+01,
-    -2.23307578892655734e-01,
-    2.96460137564761618e-03,
-    2.37847173959480950e-03,
-    -2.96589568540237556e-05,
-    4.36624404335156298e-05),
-
-  # neptune
-  Planet.new(
-    1.53796971148509165e+01,
-    -2.59193146099879641e+01,
-    1.79258772950371181e-01,
-    2.68067772490389322e-03,
-    1.62824170038242295e-03,
-    -9.51592254519715870e-05,
-    5.15138902046611451e-05)
-]
-
-init = 200_000 # ARGV[0]
-n = Integer(init)
-
-offset_momentum(BODIES)
-
-puts "%.9f" % energy(BODIES)
-
-nbodies = BODIES.size
-dt = 0.01
-
-n.times do
-  i = 0
-  while i < nbodies
-    b = BODIES[i]
-    b.move_from_i(BODIES, nbodies, dt, i + 1)
-    i += 1
-  end
-end
-
-puts "%.9f" % energy(BODIES)
diff --git a/benchmark/bm_so_nested_loop.rb b/benchmark/bm_so_nested_loop.rb
deleted file mode 100644
index a0513f8c47..0000000000
--- a/benchmark/bm_so_nested_loop.rb
+++ /dev/null
@@ -1,24 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: nestedloop-ruby.code,v 1.4 2004/11/13 07:42:22 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# from Avi Bryant
-
-n = 16 # Integer(ARGV.shift || 1)
-x = 0
-n.times do
-    n.times do
-        n.times do
-            n.times do
-                n.times do
-                    n.times do
-                        x += 1
-                    end
-                end
-            end
-        end
-    end
-end
-# puts x
-
-
diff --git a/benchmark/bm_so_nsieve.rb b/benchmark/bm_so_nsieve.rb
deleted file mode 100644
index a65cc78233..0000000000
--- a/benchmark/bm_so_nsieve.rb
+++ /dev/null
@@ -1,35 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org/
-#
-# contributed by Glenn Parker, March 2005
-# modified by Evan Phoenix, Sept 2006
-
-def sieve(m)
-  flags = Flags.dup[0,m]
-  count = 0
-  pmax = m - 1
-  p = 2
-  while p <= pmax
-    unless flags[p].zero?
-      count += 1
-      mult = p
-      while mult <= pmax
-        flags[mult] = 0
-        mult += p
-      end
-    end
-    p += 1
-  end
-  count
-end
-
-n = 9 # (ARGV[0] || 2).to_i
-Flags = ("\x1" * ( 2 ** n * 10_000)).unpack("c*")
-
-n.downto(n-2) do |exponent|
-  break if exponent < 0
-  m = (1 << exponent) * 10_000
-  # m = (2 ** exponent) * 10_000
-  count = sieve(m)
-  printf "Primes up to %8d %8d\n", m, count
-end
diff --git a/benchmark/bm_so_nsieve_bits.rb b/benchmark/bm_so_nsieve_bits.rb
deleted file mode 100644
index 6f958ee44e..0000000000
--- a/benchmark/bm_so_nsieve_bits.rb
+++ /dev/null
@@ -1,43 +0,0 @@
-#!/usr/bin/ruby
-#coding: us-ascii
-#
-# The Great Computer Language Shootout
-# http://shootout.alioth.debian.org/
-#
-# nsieve-bits in Ruby
-# Contributed by Glenn Parker, March 2005
-
-CharExponent = 3
-BitsPerChar = 1 << CharExponent
-LowMask = BitsPerChar - 1
-
-def sieve(m)
-  items = "\xFF" * ((m / BitsPerChar) + 1)
-  masks = ""
-  BitsPerChar.times do |b|
-    masks << (1 << b).chr
-  end
-
-  count = 0
-  pmax = m - 1
-  2.step(pmax, 1) do |p|
-    if items[p >> CharExponent][p & LowMask] == 1
-      count += 1
-      p.step(pmax, p) do |mult|
-	a = mult >> CharExponent
-	b = mult & LowMask
-	items[a] -= masks[b] if items[a][b] != 0
-      end
-    end
-  end
-  count
-end
-
-n = 9 # (ARGV[0] || 2).to_i
-n.step(n - 2, -1) do |exponent|
-  break if exponent < 0
-  m = 2 ** exponent * 10_000
-  count = sieve(m)
-  printf "Primes up to %8d %8d\n", m, count
-end
-
diff --git a/benchmark/bm_so_object.rb b/benchmark/bm_so_object.rb
deleted file mode 100644
index e8607c7199..0000000000
--- a/benchmark/bm_so_object.rb
+++ /dev/null
@@ -1,56 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: objinst-ruby.code,v 1.4 2004/11/13 07:42:25 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# with help from Aristarkh Zagorodnikov
-
-class Toggle
-    def initialize(start_state)
-        @bool = start_state
-    end
-
-    def value
-        @bool
-    end
-
-    def activate
-        @bool = !@bool
-        self
-    end
-end
-
-class NthToggle < Toggle
-    def initialize(start_state, max_counter)
-        super start_state
-        @count_max = max_counter
-        @counter = 0
-    end
-
-    def activate
-        @counter += 1
-        if @counter >= @count_max
-            @bool = !@bool
-            @counter = 0
-        end
-        self
-    end
-end
-
-n = 1500000 # (ARGV.shift || 1).to_i
-
-toggle = Toggle.new 1
-5.times do
-    toggle.activate.value ? 'true' : 'false'
-end
-n.times do
-    toggle = Toggle.new 1
-end
-
-ntoggle = NthToggle.new 1, 3
-8.times do
-    ntoggle.activate.value ? 'true' : 'false'
-end
-n.times do
-    ntoggle = NthToggle.new 1, 3
-end
-
diff --git a/benchmark/bm_so_partial_sums.rb b/benchmark/bm_so_partial_sums.rb
deleted file mode 100644
index 630b45cb8d..0000000000
--- a/benchmark/bm_so_partial_sums.rb
+++ /dev/null
@@ -1,31 +0,0 @@
-n = 2_500_000 # (ARGV.shift || 1).to_i
-
-alt = 1.0 ; s0 = s1 = s2 = s3 = s4 = s5 = s6 = s7 = s8 = 0.0
-
-1.upto(n) do |d|
-  d = d.to_f ; d2 = d * d ; d3 = d2 * d ; ds = Math.sin(d) ; dc = Math.cos(d)
-
-  s0 += (2.0 / 3.0) ** (d - 1.0)
-  s1 += 1.0 / Math.sqrt(d)
-  s2 += 1.0 / (d * (d + 1.0))
-  s3 += 1.0 / (d3 * ds * ds)
-  s4 += 1.0 / (d3 * dc * dc)
-  s5 += 1.0 / d
-  s6 += 1.0 / d2
-  s7 += alt / d
-  s8 += alt / (2.0 * d - 1.0)
-
-  alt = -alt
-end
-
-if false
-  printf("%.9f\t(2/3)^k\n", s0)
-  printf("%.9f\tk^-0.5\n", s1)
-  printf("%.9f\t1/k(k+1)\n", s2)
-  printf("%.9f\tFlint Hills\n", s3)
-  printf("%.9f\tCookson Hills\n", s4)
-  printf("%.9f\tHarmonic\n", s5)
-  printf("%.9f\tRiemann Zeta\n", s6)
-  printf("%.9f\tAlternating Harmonic\n", s7)
-  printf("%.9f\tGregory\n", s8)
-end
diff --git a/benchmark/bm_so_pidigits.rb b/benchmark/bm_so_pidigits.rb
deleted file mode 100644
index c7d6fbfb4d..0000000000
--- a/benchmark/bm_so_pidigits.rb
+++ /dev/null
@@ -1,92 +0,0 @@
-# The Great Computer Language Shootout
-# http://shootout.alioth.debian.org/
-#
-# contributed by Gabriele Renzi
-
-class PiDigitSpigot
-
-    def initialize()
-        @z = Transformation.new 1,0,0,1
-        @x = Transformation.new 0,0,0,0
-        @inverse = Transformation.new 0,0,0,0
-    end
-
-    def next!
-        @y = @z.extract(3)
-        if safe? @y
-            @z = produce(@y)
-            @y
-        else
-            @z = consume @x.next!()
-            next!()
-        end
-    end
-
-    def safe?(digit)
-        digit == @z.extract(4)
-    end
-
-    def produce(i)
-        @inverse.qrst(10,-10*i,0,1).compose(@z)
-    end
-
-    def consume(a)
-        @z.compose(a)
-    end
-end
-
-
-class Transformation
-    attr_reader :q, :r, :s, :t
-    def initialize (q, r, s, t)
-        @q,@r,@s,@t,@k = q,r,s,t,0
-    end
-
-    def next!()
-        @q = @k = @k + 1
-        @r = 4 * @k + 2
-        @s = 0
-        @t = 2 * @k + 1
-        self
-    end
-
-    def extract(j)
-        (@q * j + @r) / (@s * j + @t)
-    end
-
-    def compose(a)
-        self.class.new( @q * a.q,
-                        @q * a.r + r * a.t,
-                        @s * a.q + t * a.s,
-                        @s * a.r + t * a.t
-                    )
-    end
-
-    def qrst *args
-        initialize *args
-        self
-    end
-
-
-end
-
-
-WIDTH = 10
-n = 2_500 # Integer(ARGV[0])
-j = 0
-
-digits = PiDigitSpigot.new
-
-while n > 0
-    if n >= WIDTH
-        WIDTH.times {print digits.next!}
-        j += WIDTH
-    else
-        n.times {print digits.next!}
-        (WIDTH-n).times {print " "}
-        j += n
-    end
-    puts "\t:"+j.to_s
-    n -= WIDTH
-end
-
diff --git a/benchmark/bm_so_random.rb b/benchmark/bm_so_random.rb
deleted file mode 100644
index a66b9e8e63..0000000000
--- a/benchmark/bm_so_random.rb
+++ /dev/null
@@ -1,20 +0,0 @@
-# from http://www.bagley.org/~doug/shootout/bench/random/random.ruby
-
-IM = 139968.0
-IA = 3877.0
-IC = 29573.0
-
-$last = 42.0
-
-def gen_random(max)
-  (max * ($last = ($last * IA + IC) % IM)) / IM
-end
-
-N = 3_000_000
-
-i = 0
-while i<N
-  i +=1
-  gen_random(100.0)
-end
-# "%.9f" % gen_random(100.0)
diff --git a/benchmark/bm_so_reverse_complement.rb b/benchmark/bm_so_reverse_complement.rb
deleted file mode 100644
index 82ea666994..0000000000
--- a/benchmark/bm_so_reverse_complement.rb
+++ /dev/null
@@ -1,30 +0,0 @@
-#!/usr/bin/ruby
-# The Great Computer Language Shootout
-# http://shootout.alioth.debian.org/
-#
-# Contributed by Peter Bjarke Olsen
-# Modified by Doug King
-
-seq=Array.new
-
-def revcomp(seq)
-  seq.reverse!.tr!('wsatugcyrkmbdhvnATUGCYRKMBDHVN','WSTAACGRYMKVHDBNTAACGRYMKVHDBN')
-  stringlen=seq.length
-  0.step(stringlen-1,60) {|x| print seq.slice(x,60) , "\n"}
-end
-
-input = open(File.join(File.dirname($0), 'fasta.output.2500000'), 'rb')
-
-while input.gets
-  if $_ =~ />/
-    if seq.length != 0
-      revcomp(seq.join)
-      seq=Array.new
-    end
-    puts $_
-  else
-    $_.sub(/\n/,'')
-    seq.push $_
-  end
-end
-revcomp(seq.join)
diff --git a/benchmark/bm_so_sieve.rb b/benchmark/bm_so_sieve.rb
deleted file mode 100644
index 43dc302648..0000000000
--- a/benchmark/bm_so_sieve.rb
+++ /dev/null
@@ -1,24 +0,0 @@
-# from http://www.bagley.org/~doug/shootout/bench/sieve/sieve.ruby
-num = 500
-count = i = j = 0
-flags0 = Array.new(8192,1)
-k = 0
-while k < num
-  k += 1
-  count = 0
-  flags = flags0.dup
-  i = 2
-  while i<8192
-    i += 1
-    if flags[i]
-      # remove all multiples of prime: i
-      j = i*i
-      while j < 8192
-        j += i
-        flags[j] = nil
-      end
-      count += 1
-    end
-  end
-end
-count
diff --git a/benchmark/bm_so_spectralnorm.rb b/benchmark/bm_so_spectralnorm.rb
deleted file mode 100644
index 6b97206689..0000000000
--- a/benchmark/bm_so_spectralnorm.rb
+++ /dev/null
@@ -1,50 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org/
-# Contributed by Sokolov Yura
-
-def eval_A(i,j)
-	return 1.0/((i+j)*(i+j+1)/2+i+1)
-end
-
-def eval_A_times_u(u)
-        v, i = nil, nil
-	(0..u.length-1).collect { |i|
-                v = 0
-		for j in 0..u.length-1
-			v += eval_A(i,j)*u[j]
-                end
-                v
-        }
-end
-
-def eval_At_times_u(u)
-	v, i = nil, nil
-	(0..u.length-1).collect{|i|
-                v = 0
-		for j in 0..u.length-1
-			v += eval_A(j,i)*u[j]
-                end
-                v
-        }
-end
-
-def eval_AtA_times_u(u)
-	return eval_At_times_u(eval_A_times_u(u))
-end
-
-n = 500 # ARGV[0].to_i
-
-u=[1]*n
-for i in 1..10
-        v=eval_AtA_times_u(u)
-        u=eval_AtA_times_u(v)
-end
-vBv=0
-vv=0
-for i in 0..n-1
-        vBv += u[i]*v[i]
-        vv += v[i]*v[i]
-end
-
-str = "%0.9f" % (Math.sqrt(vBv/vv)), "\n"
-# print str
diff --git a/benchmark/bm_vm1_attr_ivar.rb b/benchmark/bm_vm1_attr_ivar.rb
deleted file mode 100644
index 16906f3605..0000000000
--- a/benchmark/bm_vm1_attr_ivar.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-class C
-  attr_reader :a, :b
-  def initialize
-    @a = nil
-    @b = nil
-  end
-end
-obj = C.new
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  j = obj.a
-  k = obj.b
-end
diff --git a/benchmark/bm_vm1_attr_ivar_set.rb b/benchmark/bm_vm1_attr_ivar_set.rb
deleted file mode 100644
index 7e7a6b48c0..0000000000
--- a/benchmark/bm_vm1_attr_ivar_set.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-class C
-  attr_accessor :a, :b
-  def initialize
-    @a = nil
-    @b = nil
-  end
-end
-obj = C.new
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  obj.a = 1
-  obj.b = 2
-end
diff --git a/benchmark/bm_vm1_block.rb b/benchmark/bm_vm1_block.rb
deleted file mode 100644
index a9f56b15ea..0000000000
--- a/benchmark/bm_vm1_block.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-def m
-  yield
-end
-
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  m{
-  }
-end
diff --git a/benchmark/bm_vm1_const.rb b/benchmark/bm_vm1_const.rb
deleted file mode 100644
index ac59ebccf1..0000000000
--- a/benchmark/bm_vm1_const.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-Const = 1
-
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  j = Const
-  k = Const
-end
diff --git a/benchmark/bm_vm1_ensure.rb b/benchmark/bm_vm1_ensure.rb
deleted file mode 100644
index a1596145f2..0000000000
--- a/benchmark/bm_vm1_ensure.rb
+++ /dev/null
@@ -1,11 +0,0 @@
-i = 0
-while i<30_000_000 # benchmark loop 1
-  i += 1
-  begin
-    begin
-    ensure
-    end
-  ensure
-  end
-end
-
diff --git a/benchmark/bm_vm1_float_simple.rb b/benchmark/bm_vm1_float_simple.rb
deleted file mode 100644
index d4581439ff..0000000000
--- a/benchmark/bm_vm1_float_simple.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-i = 0.0; f = 0.0
-while i<30_000_000
-  i += 1
-  f += 0.1; f -= 0.1
-  f += 0.1; f -= 0.1
-  f += 0.1; f -= 0.1
-end
diff --git a/benchmark/bm_vm1_gc_short_lived.rb b/benchmark/bm_vm1_gc_short_lived.rb
deleted file mode 100644
index e78bca5668..0000000000
--- a/benchmark/bm_vm1_gc_short_lived.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-i = 0
-while i<30_000_000 # while loop 1
-  a = '' # short-lived String
-  b = ''
-  c = ''
-  d = ''
-  e = ''
-  f = ''
-  i+=1
-end
diff --git a/benchmark/bm_vm1_gc_short_with_complex_long.rb b/benchmark/bm_vm1_gc_short_with_complex_long.rb
deleted file mode 100644
index b66052dee0..0000000000
--- a/benchmark/bm_vm1_gc_short_with_complex_long.rb
+++ /dev/null
@@ -1,27 +0,0 @@
-def nested_hash h, n
-  if n == 0
-    ''
-  else
-    10.times{
-      h[Object.new] = nested_hash(h, n-1)
-    }
-  end
-end
-
-long_lived = Hash.new
-nested_hash long_lived, 6
-
-GC.start
-GC.start
-
-i = 0
-while i<30_000_000 # while loop 1
-  a = '' # short-lived String
-  b = ''
-  c = ''
-  d = ''
-  e = ''
-  f = ''
-  i+=1
-end
-
diff --git a/benchmark/bm_vm1_gc_short_with_long.rb b/benchmark/bm_vm1_gc_short_with_long.rb
deleted file mode 100644
index 298dbc845b..0000000000
--- a/benchmark/bm_vm1_gc_short_with_long.rb
+++ /dev/null
@@ -1,13 +0,0 @@
-long_lived = Array.new(1_000_000){|i| "#{i}"}
-GC.start
-GC.start
-i = 0
-while i<30_000_000 # while loop 1
-  a = '' # short-lived String
-  b = ''
-  c = ''
-  d = ''
-  e = ''
-  f = ''
-  i+=1
-end
diff --git a/benchmark/bm_vm1_gc_short_with_symbol.rb b/benchmark/bm_vm1_gc_short_with_symbol.rb
deleted file mode 100644
index 6b15c1b7bf..0000000000
--- a/benchmark/bm_vm1_gc_short_with_symbol.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-# make many symbols
-50_000.times{|i| sym = "sym#{i}".to_sym}
-GC.start
-GC.start
-
-i = 0
-while i<30_000_000 # while loop 1
-  a = '' # short-lived String
-  b = ''
-  c = ''
-  d = ''
-  e = ''
-  f = ''
-  i+=1
-end
diff --git a/benchmark/bm_vm1_gc_wb_ary.rb b/benchmark/bm_vm1_gc_wb_ary.rb
deleted file mode 100644
index 881528845b..0000000000
--- a/benchmark/bm_vm1_gc_wb_ary.rb
+++ /dev/null
@@ -1,12 +0,0 @@
-short_lived_ary = []
-
-if RUBY_VERSION >= "2.2.0"
-  GC.start(full_mark: false, immediate_mark: true, lazy_sweep: false)
-end
-
-i = 0
-short_lived = ''
-while i<30_000_000 # while loop 1
-  short_lived_ary[0] = short_lived # write barrier
-  i+=1
-end
diff --git a/benchmark/bm_vm1_gc_wb_ary_promoted.rb b/benchmark/bm_vm1_gc_wb_ary_promoted.rb
deleted file mode 100644
index 3c8279c956..0000000000
--- a/benchmark/bm_vm1_gc_wb_ary_promoted.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-long_lived = []
-
-if RUBY_VERSION > "2.2.0"
-  3.times{ GC.start(full_mark: false, immediate_mark: true, lazy_sweep: false) }
-elsif
-  GC.start
-end
-
-i = 0
-short_lived = ''
-while i<30_000_000 # while loop 1
-  long_lived[0] = short_lived # write barrier
-  i+=1
-end
diff --git a/benchmark/bm_vm1_gc_wb_obj.rb b/benchmark/bm_vm1_gc_wb_obj.rb
deleted file mode 100644
index a4067af36b..0000000000
--- a/benchmark/bm_vm1_gc_wb_obj.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-class C
-  attr_accessor :foo
-end
-short_lived_obj = C.new
-
-if RUBY_VERSION >= "2.2.0"
-  GC.start(full_mark: false, immediate_mark: true, lazy_sweep: false)
-end
-
-i = 0
-short_lived = ''
-while i<30_000_000 # while loop 1
-  short_lived_obj.foo = short_lived # write barrier
-  i+=1
-end
diff --git a/benchmark/bm_vm1_gc_wb_obj_promoted.rb b/benchmark/bm_vm1_gc_wb_obj_promoted.rb
deleted file mode 100644
index eee07a0248..0000000000
--- a/benchmark/bm_vm1_gc_wb_obj_promoted.rb
+++ /dev/null
@@ -1,17 +0,0 @@
-class C
-  attr_accessor :foo
-end
-long_lived = C.new
-
-if RUBY_VERSION >= "2.2.0"
-  3.times{ GC.start(full_mark: false, immediate_mark: true, lazy_sweep: false) }
-elsif
-  GC.start
-end
-
-i = 0
-short_lived = ''
-while i<30_000_000 # while loop 1
-  long_lived.foo = short_lived # write barrier
-  i+=1
-end
diff --git a/benchmark/bm_vm1_ivar.rb b/benchmark/bm_vm1_ivar.rb
deleted file mode 100644
index 68a73cf92f..0000000000
--- a/benchmark/bm_vm1_ivar.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-@a = 1
-
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  j = @a
-  k = @a
-end
diff --git a/benchmark/bm_vm1_ivar_set.rb b/benchmark/bm_vm1_ivar_set.rb
deleted file mode 100644
index bd81b06c34..0000000000
--- a/benchmark/bm_vm1_ivar_set.rb
+++ /dev/null
@@ -1,6 +0,0 @@
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  @a = 1
-  @b = 2
-end
diff --git a/benchmark/bm_vm1_length.rb b/benchmark/bm_vm1_length.rb
deleted file mode 100644
index 353de3ab0e..0000000000
--- a/benchmark/bm_vm1_length.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-a = 'abc'
-b = [1, 2, 3]
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  a.length
-  b.length
-end
-
diff --git a/benchmark/bm_vm1_lvar_init.rb b/benchmark/bm_vm1_lvar_init.rb
deleted file mode 100644
index 36f2068811..0000000000
--- a/benchmark/bm_vm1_lvar_init.rb
+++ /dev/null
@@ -1,18 +0,0 @@
-def m v
-  unless v
-    # unreachable code
-    v1 = v2 = v3 = v4 = v5 = v6 = v7 = v8 = v9 = v10 =
-    v11 = v12 = v13 = v14 = v15 = v16 = v17 = v18 = v19 = v20 =
-    v21 = v22 = v23 = v24 = v25 = v26 = v27 = v28 = v29 = v30 =
-    v31 = v32 = v33 = v34 = v35 = v36 = v37 = v38 = v39 = v40 =
-    v41 = v42 = v43 = v44 = v45 = v46 = v47 = v48 = v49 = v50 = 1
-  end
-end
-
-i = 0
-
-while i<30_000_000 # while loop 1
-  i += 1
-  m i
-end
-
diff --git a/benchmark/bm_vm1_lvar_set.rb b/benchmark/bm_vm1_lvar_set.rb
deleted file mode 100644
index 222e864134..0000000000
--- a/benchmark/bm_vm1_lvar_set.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  a = b = c = d = e = f = g = h = j = k = l = m = n = o = p = q = r = 1
-end
diff --git a/benchmark/bm_vm1_neq.rb b/benchmark/bm_vm1_neq.rb
deleted file mode 100644
index bbb4ae07a4..0000000000
--- a/benchmark/bm_vm1_neq.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-i = 0
-obj1 = Object.new
-obj2 = Object.new
-
-while i<30_000_000 # while loop 1
-  i += 1
-  obj1 != obj2
-end
diff --git a/benchmark/bm_vm1_not.rb b/benchmark/bm_vm1_not.rb
deleted file mode 100644
index b09ecdcc21..0000000000
--- a/benchmark/bm_vm1_not.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-i = 0
-obj = Object.new
-
-while i<30_000_000 # while loop 1
-  i += 1
-  !obj
-end
diff --git a/benchmark/bm_vm1_rescue.rb b/benchmark/bm_vm1_rescue.rb
deleted file mode 100644
index b0d3e2bdfa..0000000000
--- a/benchmark/bm_vm1_rescue.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  begin
-  rescue
-  end
-end
diff --git a/benchmark/bm_vm1_simplereturn.rb b/benchmark/bm_vm1_simplereturn.rb
deleted file mode 100644
index 63f9f21675..0000000000
--- a/benchmark/bm_vm1_simplereturn.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-def m
-  return 1
-end
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  m
-end
-
diff --git a/benchmark/bm_vm1_swap.rb b/benchmark/bm_vm1_swap.rb
deleted file mode 100644
index 918f8b2112..0000000000
--- a/benchmark/bm_vm1_swap.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-a = 1
-b = 2
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  a, b = b, a
-end
-
diff --git a/benchmark/bm_vm1_yield.rb b/benchmark/bm_vm1_yield.rb
deleted file mode 100644
index 775597cea6..0000000000
--- a/benchmark/bm_vm1_yield.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-def m
-  i = 0
-  while i<30_000_000 # while loop 1
-    i += 1
-    yield
-  end
-end
-
-m{}
-
diff --git a/benchmark/bm_vm2_array.rb b/benchmark/bm_vm2_array.rb
deleted file mode 100644
index df9037c83c..0000000000
--- a/benchmark/bm_vm2_array.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  a = [1,2,3,4,5,6,7,8,9,10]
-end
diff --git a/benchmark/bm_vm2_bigarray.rb b/benchmark/bm_vm2_bigarray.rb
deleted file mode 100644
index b02509d6a2..0000000000
--- a/benchmark/bm_vm2_bigarray.rb
+++ /dev/null
@@ -1,106 +0,0 @@
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  a = [
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-  ]
-end
diff --git a/benchmark/bm_vm2_bighash.rb b/benchmark/bm_vm2_bighash.rb
deleted file mode 100644
index 5e3f437bb8..0000000000
--- a/benchmark/bm_vm2_bighash.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-i = 0
-while i<60_000 # benchmark loop 2
-  i += 1
-  a = {0=>0, 1=>1, 2=>2, 3=>3, 4=>4, 5=>5, 6=>6, 7=>7, 8=>8, 9=>9, 10=>10, 11=>11, 12=>12, 13=>13, 14=>14, 15=>15, 16=>16, 17=>17, 18=>18, 19=>19, 20=>20, 21=>21, 22=>22, 23=>23, 24=>24, 25=>25, 26=>26, 27=>27, 28=>28, 29=>29, 30=>30, 31=>31, 32=>32, 33=>33, 34=>34, 35=>35, 36=>36, 37=>37, 38=>38, 39=>39, 40=>40, 41=>41, 42=>42, 43=>43, 44=>44, 45=>45, 46=>46, 47=>47, 48=>48, 49=>49, 50=>50, 51=>51, 52=>52, 53=>53, 54=>54, 55=>55, 56=>56, 57=>57, 58=>58, 59=>59, 60=>60, 61=>61, 62=>62, 63=>63, 64=>64, 65=>65, 66=>66, 67=>67, 68=>68, 69=>69, 70=>70, 71=>71, 72=>72, 73=>73, 74=>74, 75=>75, 76=>76, 77=>77, 78=>78, 79=>79, 80=>80, 81=>81, 82=>82, 83=>83, 84=>84, 85=>85, 86=>86, 87=>87, 88=>88, 89=>89, 90=>90, 91=>91, 92=>92, 93=>93, 94=>94, 95=>95, 96=>96, 97=>97, 98=>98, 99=>99, 100=>100, 101=>101, 102=>102, 103=>103, 104=>104, 105=>105, 106=>106, 107=>107, 108=>108, 109=>109, 110=>110, 111=>111, 112=>112, 113=>113, 114=>114, 115=>115, 116=>116, 117=>117, 118=>118, 119=>119, 120=>120, 121=>121, 122=>122, 123=>123, 124=>124, 125=>125, 126=>126, 127=>127, 128=>128, 129=>129, 130=>130, 131=>131, 132=>132, 133=>133, 134=>134, 135=>135, 136=>136, 137=>137, 138=>138, 139=>139, 140=>140, 141=>141, 142=>142, 143=>143, 144=>144, 145=>145, 146=>146, 147=>147, 148=>148, 149=>149, 150=>150, 151=>151, 152=>152, 153=>153, 154=>154, 155=>155, 156=>156, 157=>157, 158=>158, 159=>159, 160=>160, 161=>161, 162=>162, 163=>163, 164=>164, 165=>165, 166=>166, 167=>167, 168=>168, 169=>169, 170=>170, 171=>171, 172=>172, 173=>173, 174=>174, 175=>175, 176=>176, 177=>177, 178=>178, 179=>179, 180=>180, 181=>181, 182=>182, 183=>183, 184=>184, 185=>185, 186=>186, 187=>187, 188=>188, 189=>189, 190=>190, 191=>191, 192=>192, 193=>193, 194=>194, 195=>195, 196=>196, 197=>197, 198=>198, 199=>199, 200=>200, 201=>201, 202=>202, 203=>203, 204=>204, 205=>205, 206=>206, 207=>207, 208=>208, 209=>209, 210=>210, 211=>211, 212=>212, 213=>213, 214=>214, 215=>215, 216=>216, 217=>217, 218=>218, 219=>219, 220=>220, 221=>221, 222=>222, 223=>223, 224=>224, 225=>225, 226=>226, 227=>227, 228=>228, 229=>229, 230=>230, 231=>231, 232=>232, 233=>233, 234=>234, 235=>235, 236=>236, 237=>237, 238=>238, 239=>239, 240=>240, 241=>241, 242=>242, 243=>243, 244=>244, 245=>245, 246=>246, 247=>247, 248=>248, 249=>249, 250=>250, 251=>251, 252=>252, 253=>253, 254=>254, 255=>255, 256=>256, 257=>257, 258=>258, 259=>259, 260=>260, 261=>261, 262=>262, 263=>263, 264=>264, 265=>265, 266=>266, 267=>267, 268=>268, 269=>269, 270=>270, 271=>271, 272=>272, 273=>273, 274=>274, 275=>275, 276=>276, 277=>277, 278=>278, 279=>279, 280=>280, 281=>281, 282=>282, 283=>283, 284=>284, 285=>285, 286=>286, 287=>287, 288=>288, 289=>289, 290=>290, 291=>291, 292=>292, 293=>293, 294=>294, 295=>295, 296=>296, 297=>297, 298=>298, 299=>299, 300=>300, 301=>301, 302=>302, 303=>303, 304=>304, 305=>305, 306=>306, 307=>307, 308=>308, 309=>309, 310=>310, 311=>311, 312=>312, 313=>313, 314=>314, 315=>315, 316=>316, 317=>317, 318=>318, 319=>319, 320=>320, 321=>321, 322=>322, 323=>323, 324=>324, 325=>325, 326=>326, 327=>327, 328=>328, 329=>329, 330=>330, 331=>331, 332=>332, 333=>333, 334=>334, 335=>335, 336=>336, 337=>337, 338=>338, 339=>339, 340=>340, 341=>341, 342=>342, 343=>343, 344=>344, 345=>345, 346=>346, 347=>347, 348=>348, 349=>349, 350=>350, 351=>351, 352=>352, 353=>353, 354=>354, 355=>355, 356=>356, 357=>357, 358=>358, 359=>359, 360=>360, 361=>361, 362=>362, 363=>363, 364=>364, 365=>365, 366=>366, 367=>367, 368=>368, 369=>369, 370=>370, 371=>371, 372=>372, 373=>373, 374=>374, 375=>375, 376=>376, 377=>377, 378=>378, 379=>379, 380=>380, 381=>381, 382=>382, 383=>383, 384=>384, 385=>385, 386=>386, 387=>387, 388=>388, 389=>389, 390=>390, 391=>391, 392=>392, 393=>393, 394=>394, 395=>395, 396=>396, 397=>397, 398=>398, 399=>399, 400=>400, 401=>401, 402=>402, 403=>403, 404=>404, 405=>405, 406=>406, 407=>407, 408=>408, 409=>409, 410=>410, 411=>411, 412=>412, 413=>413, 414=>414, 415=>415, 416=>416, 417=>417, 418=>418, 419=>419, 420=>420, 421=>421, 422=>422, 423=>423, 424=>424, 425=>425, 426=>426, 427=>427, 428=>428, 429=>429, 430=>430, 431=>431, 432=>432, 433=>433, 434=>434, 435=>435, 436=>436, 437=>437, 438=>438, 439=>439, 440=>440, 441=>441, 442=>442, 443=>443, 444=>444, 445=>445, 446=>446, 447=>447, 448=>448, 449=>449, 450=>450, 451=>451, 452=>452, 453=>453, 454=>454, 455=>455, 456=>456, 457=>457, 458=>458, 459=>459, 460=>460, 461=>461, 462=>462, 463=>463, 464=>464, 465=>465, 466=>466, 467=>467, 468=>468, 469=>469, 470=>470, 471=>471, 472=>472, 473=>473, 474=>474, 475=>475, 476=>476, 477=>477, 478=>478, 479=>479, 480=>480, 481=>481, 482=>482, 483=>483, 484=>484, 485=>485, 486=>486, 487=>487, 488=>488, 489=>489, 490=>490, 491=>491, 492=>492, 493=>493, 494=>494, 495=>495, 496=>496, 497=>497, 498=>498, 499=>499, 500=>500,}
-end
diff --git a/benchmark/bm_vm2_case.rb b/benchmark/bm_vm2_case.rb
deleted file mode 100644
index adc6e4df0a..0000000000
--- a/benchmark/bm_vm2_case.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-i = 0
-while i<6_000_000 # while loop 2
-  case :foo
-  when :bar
-    raise
-  when :baz
-    raise
-  when :boo
-    raise
-  when :foo
-    i += 1
-  end
-end
-
diff --git a/benchmark/bm_vm2_defined_method.rb b/benchmark/bm_vm2_defined_method.rb
deleted file mode 100644
index 053ed6c912..0000000000
--- a/benchmark/bm_vm2_defined_method.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-class Object
-  define_method(:m){}
-end
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  m; m; m; m; m; m; m; m;
-end
diff --git a/benchmark/bm_vm2_dstr.rb b/benchmark/bm_vm2_dstr.rb
deleted file mode 100644
index 58c0f7bbc3..0000000000
--- a/benchmark/bm_vm2_dstr.rb
+++ /dev/null
@@ -1,6 +0,0 @@
-i = 0
-x = y = 'z'
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  str = "foo#{x}bar#{y}baz"
-end
diff --git a/benchmark/bm_vm2_eval.rb b/benchmark/bm_vm2_eval.rb
deleted file mode 100644
index 307cfc28ef..0000000000
--- a/benchmark/bm_vm2_eval.rb
+++ /dev/null
@@ -1,6 +0,0 @@
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  eval("1")
-end
-
diff --git a/benchmark/bm_vm2_method.rb b/benchmark/bm_vm2_method.rb
deleted file mode 100644
index a8ccff7138..0000000000
--- a/benchmark/bm_vm2_method.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-def m
-  nil
-end
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  m; m; m; m; m; m; m; m;
-end
diff --git a/benchmark/bm_vm2_method_missing.rb b/benchmark/bm_vm2_method_missing.rb
deleted file mode 100644
index 2badc73101..0000000000
--- a/benchmark/bm_vm2_method_missing.rb
+++ /dev/null
@@ -1,12 +0,0 @@
-class C
-  def method_missing mid
-  end
-end
-
-obj = C.new
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m;
-end
diff --git a/benchmark/bm_vm2_method_with_block.rb b/benchmark/bm_vm2_method_with_block.rb
deleted file mode 100644
index b4efb4f520..0000000000
--- a/benchmark/bm_vm2_method_with_block.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-def m
-  nil
-end
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  m{}; m{}; m{}; m{}; m{}; m{}; m{}; m{};
-end
diff --git a/benchmark/bm_vm2_mutex.rb b/benchmark/bm_vm2_mutex.rb
deleted file mode 100644
index 7362f738c5..0000000000
--- a/benchmark/bm_vm2_mutex.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-require 'thread'
-
-m = Mutex.new
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  m.synchronize{}
-end
diff --git a/benchmark/bm_vm2_newlambda.rb b/benchmark/bm_vm2_newlambda.rb
deleted file mode 100644
index 6422c9b0d0..0000000000
--- a/benchmark/bm_vm2_newlambda.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  lambda {}
-end
diff --git a/benchmark/bm_vm2_poly_method.rb b/benchmark/bm_vm2_poly_method.rb
deleted file mode 100644
index c82c0e4bce..0000000000
--- a/benchmark/bm_vm2_poly_method.rb
+++ /dev/null
@@ -1,20 +0,0 @@
-class C1
-  def m
-    1
-  end
-end
-class C2
-  def m
-    2
-  end
-end
-
-o1 = C1.new
-o2 = C2.new
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  o = (i % 2 == 0) ? o1 : o2
-  o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
-  i += 1
-end
diff --git a/benchmark/bm_vm2_poly_method_ov.rb b/benchmark/bm_vm2_poly_method_ov.rb
deleted file mode 100644
index aa5fd1dd38..0000000000
--- a/benchmark/bm_vm2_poly_method_ov.rb
+++ /dev/null
@@ -1,20 +0,0 @@
-class C1
-  def m
-    1
-  end
-end
-class C2
-  def m
-    2
-  end
-end
-
-o1 = C1.new
-o2 = C2.new
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  o = (i % 2 == 0) ? o1 : o2
-#  o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
-  i += 1
-end
diff --git a/benchmark/bm_vm2_proc.rb b/benchmark/bm_vm2_proc.rb
deleted file mode 100644
index 65e5217371..0000000000
--- a/benchmark/bm_vm2_proc.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-def m &b
-  b
-end
-
-pr = m{
-  a = 1
-}
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  pr.call
-end
-
diff --git a/benchmark/bm_vm2_raise1.rb b/benchmark/bm_vm2_raise1.rb
deleted file mode 100644
index aa5387987f..0000000000
--- a/benchmark/bm_vm2_raise1.rb
+++ /dev/null
@@ -1,18 +0,0 @@
-def rec n
-  if n > 0
-    rec n-1
-  else
-    raise
-  end
-end
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-
-  begin
-    rec 1
-  rescue
-    # ignore
-  end
-end
diff --git a/benchmark/bm_vm2_raise2.rb b/benchmark/bm_vm2_raise2.rb
deleted file mode 100644
index 1f61c63157..0000000000
--- a/benchmark/bm_vm2_raise2.rb
+++ /dev/null
@@ -1,18 +0,0 @@
-def rec n
-  if n > 0
-    rec n-1
-  else
-    raise
-  end
-end
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-
-  begin
-    rec 10
-  rescue
-    # ignore
-  end
-end
diff --git a/benchmark/bm_vm2_regexp.rb b/benchmark/bm_vm2_regexp.rb
deleted file mode 100644
index 55f9e957a3..0000000000
--- a/benchmark/bm_vm2_regexp.rb
+++ /dev/null
@@ -1,6 +0,0 @@
-i = 0
-str = 'xxxhogexxx'
-while i<6_000_000 # benchmark loop 2
-  /hoge/ =~ str
-  i += 1
-end
diff --git a/benchmark/bm_vm2_send.rb b/benchmark/bm_vm2_send.rb
deleted file mode 100644
index 6a3ab6fdab..0000000000
--- a/benchmark/bm_vm2_send.rb
+++ /dev/null
@@ -1,12 +0,0 @@
-class C
-  def m
-  end
-end
-
-o = C.new
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  o.__send__ :m
-end
diff --git a/benchmark/bm_vm2_string_literal.rb b/benchmark/bm_vm2_string_literal.rb
deleted file mode 100644
index 1d73036849..0000000000
--- a/benchmark/bm_vm2_string_literal.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  x = "xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx"
-end
diff --git a/benchmark/bm_vm2_struct_big_aref_hi.rb b/benchmark/bm_vm2_struct_big_aref_hi.rb
deleted file mode 100644
index 22cb26b0a5..0000000000
--- a/benchmark/bm_vm2_struct_big_aref_hi.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(*('a'..'z').map { |x| x.to_sym })
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  x.z # x[25]
-end
diff --git a/benchmark/bm_vm2_struct_big_aref_lo.rb b/benchmark/bm_vm2_struct_big_aref_lo.rb
deleted file mode 100644
index 5e61a7087e..0000000000
--- a/benchmark/bm_vm2_struct_big_aref_lo.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(*('a'..'z').map { |x| x.to_sym })
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  x.k # x[10]
-end
diff --git a/benchmark/bm_vm2_struct_big_aset.rb b/benchmark/bm_vm2_struct_big_aset.rb
deleted file mode 100644
index 5a1c3d16f3..0000000000
--- a/benchmark/bm_vm2_struct_big_aset.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(*('a'..'z').map { |x| x.to_sym })
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  x.k = i # x[10] = i
-end
diff --git a/benchmark/bm_vm2_struct_big_href_hi.rb b/benchmark/bm_vm2_struct_big_href_hi.rb
deleted file mode 100644
index fff940a80a..0000000000
--- a/benchmark/bm_vm2_struct_big_href_hi.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(*('a'..'z').map { |x| x.to_sym })
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  x[:z]
-end
diff --git a/benchmark/bm_vm2_struct_big_href_lo.rb b/benchmark/bm_vm2_struct_big_href_lo.rb
deleted file mode 100644
index 5e4085d59d..0000000000
--- a/benchmark/bm_vm2_struct_big_href_lo.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(*('a'..'z').map { |x| x.to_sym })
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  x[:k]
-end
diff --git a/benchmark/bm_vm2_struct_big_hset.rb b/benchmark/bm_vm2_struct_big_hset.rb
deleted file mode 100644
index 9c0cee4141..0000000000
--- a/benchmark/bm_vm2_struct_big_hset.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(*('a'..'z').map { |x| x.to_sym })
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  x[:k] = i
-end
diff --git a/benchmark/bm_vm2_struct_small_aref.rb b/benchmark/bm_vm2_struct_small_aref.rb
deleted file mode 100644
index 8eaa555b41..0000000000
--- a/benchmark/bm_vm2_struct_small_aref.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(:a, :b, :c)
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  x.a
-end
diff --git a/benchmark/bm_vm2_struct_small_aset.rb b/benchmark/bm_vm2_struct_small_aset.rb
deleted file mode 100644
index ecd0f95669..0000000000
--- a/benchmark/bm_vm2_struct_small_aset.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(:a, :b, :c)
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  x.a = i
-end
diff --git a/benchmark/bm_vm2_struct_small_href.rb b/benchmark/bm_vm2_struct_small_href.rb
deleted file mode 100644
index 2c88fee6bf..0000000000
--- a/benchmark/bm_vm2_struct_small_href.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(:a, :b, :c)
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  x[:a]
-end
diff --git a/benchmark/bm_vm2_struct_small_hset.rb b/benchmark/bm_vm2_struct_small_hset.rb
deleted file mode 100644
index 33c36d20f1..0000000000
--- a/benchmark/bm_vm2_struct_small_hset.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(:a, :b, :c)
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  x[:a] = 1
-end
diff --git a/benchmark/bm_vm2_super.rb b/benchmark/bm_vm2_super.rb
deleted file mode 100644
index afd8579e7b..0000000000
--- a/benchmark/bm_vm2_super.rb
+++ /dev/null
@@ -1,20 +0,0 @@
-
-class C
-  def m
-    1
-  end
-end
-
-class CC < C
-  def m
-    super()
-  end
-end
-
-obj = CC.new
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  obj.m
-  i += 1
-end
diff --git a/benchmark/bm_vm2_unif1.rb b/benchmark/bm_vm2_unif1.rb
deleted file mode 100644
index 1774625942..0000000000
--- a/benchmark/bm_vm2_unif1.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-i = 0
-def m a, b
-end
-
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  m 100, 200
-end
diff --git a/benchmark/bm_vm2_zsuper.rb b/benchmark/bm_vm2_zsuper.rb
deleted file mode 100644
index 2a43e62217..0000000000
--- a/benchmark/bm_vm2_zsuper.rb
+++ /dev/null
@@ -1,20 +0,0 @@
-i = 0
-
-class C
-  def m a
-    1
-  end
-end
-
-class CC < C
-  def m a
-    super
-  end
-end
-
-obj = CC.new
-
-while i<6_000_000 # benchmark loop 2
-  obj.m 10
-  i += 1
-end
diff --git a/benchmark/bm_vm3_backtrace.rb b/benchmark/bm_vm3_backtrace.rb
deleted file mode 100644
index 0fbf73e1ca..0000000000
--- a/benchmark/bm_vm3_backtrace.rb
+++ /dev/null
@@ -1,22 +0,0 @@
-# get last backtrace
-
-begin
-  caller(0, 0)
-rescue ArgumentError
-  alias caller_orig caller
-  def caller lev, n
-    caller_orig(lev)[0..n]
-  end
-end
-
-def rec n
-  if n < 0
-    100_000.times{
-      caller(0, 1)
-    }
-  else
-    rec(n-1)
-  end
-end
-
-rec 50
diff --git a/benchmark/bm_vm3_clearmethodcache.rb b/benchmark/bm_vm3_clearmethodcache.rb
deleted file mode 100644
index 9661323cd2..0000000000
--- a/benchmark/bm_vm3_clearmethodcache.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-i = 0
-while i<200_000
-  i += 1
-
-  Class.new{
-    def m; end
-  }
-end
diff --git a/benchmark/bm_vm3_gc.rb b/benchmark/bm_vm3_gc.rb
deleted file mode 100644
index e668026915..0000000000
--- a/benchmark/bm_vm3_gc.rb
+++ /dev/null
@@ -1,6 +0,0 @@
-5000.times do
-  100.times do
-    {"xxxx"=>"yyyy"}
-  end
-  GC.start
-end
diff --git a/benchmark/bm_vm_symbol_block_pass.rb b/benchmark/bm_vm_symbol_block_pass.rb
deleted file mode 100644
index 1d433353e1..0000000000
--- a/benchmark/bm_vm_symbol_block_pass.rb
+++ /dev/null
@@ -1,13 +0,0 @@
-class C
-  1000.times {|i|
-    eval("def i#{i};end")
-  }
-end
-
-c = C.new
-m = C.instance_methods(false)
-5_000.times do
-  m.each do |n|
-    c.tap(&n)
-  end
-end
diff --git a/benchmark/bm_vm_thread_alive_check1.rb b/benchmark/bm_vm_thread_alive_check1.rb
deleted file mode 100644
index c993accdda..0000000000
--- a/benchmark/bm_vm_thread_alive_check1.rb
+++ /dev/null
@@ -1,6 +0,0 @@
-5_000.times{
-  t = Thread.new{}
-  while t.alive?
-    Thread.pass
-  end
-}
diff --git a/benchmark/bm_vm_thread_close.rb b/benchmark/bm_vm_thread_close.rb
deleted file mode 100644
index 3e9a265ce8..0000000000
--- a/benchmark/bm_vm_thread_close.rb
+++ /dev/null
@@ -1,6 +0,0 @@
-1000.times { Thread.new { sleep } }
-i = 0
-while i<100_000 # benchmark loop 3
-  i += 1
-  IO.pipe.each(&:close)
-end
diff --git a/benchmark/bm_vm_thread_create_join.rb b/benchmark/bm_vm_thread_create_join.rb
deleted file mode 100644
index 393cd45df9..0000000000
--- a/benchmark/bm_vm_thread_create_join.rb
+++ /dev/null
@@ -1,6 +0,0 @@
-i = 0
-while i<100_000 # benchmark loop 3
-  i += 1
-  Thread.new{
-  }.join
-end
diff --git a/benchmark/bm_vm_thread_mutex1.rb b/benchmark/bm_vm_thread_mutex1.rb
deleted file mode 100644
index 5c9f85dfb7..0000000000
--- a/benchmark/bm_vm_thread_mutex1.rb
+++ /dev/null
@@ -1,21 +0,0 @@
-# one thread, one mutex (no contention)
-
-require 'thread'
-m = Mutex.new
-r = 0
-max = 2000
-lmax = max * max
-(1..1).map{
-  Thread.new{
-    i = 0
-    while i<lmax
-      i += 1
-      m.synchronize{
-        r += 1
-      }
-    end
-  }
-}.each{|e|
-  e.join
-}
-raise r.to_s if r != max * max
diff --git a/benchmark/bm_vm_thread_mutex2.rb b/benchmark/bm_vm_thread_mutex2.rb
deleted file mode 100644
index 10de59054f..0000000000
--- a/benchmark/bm_vm_thread_mutex2.rb
+++ /dev/null
@@ -1,21 +0,0 @@
-# two threads, one mutex
-
-require 'thread'
-m = Mutex.new
-r = 0
-max = 2000
-lmax = (max * max)/2
-(1..2).map{
-  Thread.new{
-    i = 0
-    while i<lmax
-      i += 1
-      m.synchronize{
-        r += 1
-      }
-    end
-  }
-}.each{|e|
-  e.join
-}
-raise r.to_s if r != max * max
diff --git a/benchmark/bm_vm_thread_mutex3.rb b/benchmark/bm_vm_thread_mutex3.rb
deleted file mode 100644
index 7f9a44b39d..0000000000
--- a/benchmark/bm_vm_thread_mutex3.rb
+++ /dev/null
@@ -1,20 +0,0 @@
-# 1000 threads, one mutex
-
-require 'thread'
-m = Mutex.new
-r = 0
-max = 2000
-(1..max).map{
-  Thread.new{
-    i = 0
-    while i<max
-      i += 1
-      m.synchronize{
-        r += 1
-      }
-    end
-  }
-}.each{|e|
-  e.join
-}
-raise r.to_s if r != max * max
diff --git a/benchmark/bm_vm_thread_pass.rb b/benchmark/bm_vm_thread_pass.rb
deleted file mode 100644
index b5b3c0bc85..0000000000
--- a/benchmark/bm_vm_thread_pass.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-# Plenty Thtread.pass
-# A performance may depend on GVL implementation.
-
-tmax = (ARGV.shift || 2).to_i
-lmax = 200_000 / tmax
-
-(1..tmax).map{
-  Thread.new{
-    lmax.times{
-      Thread.pass
-    }
-  }
-}.each{|t| t.join}
-
-
diff --git a/benchmark/bm_vm_thread_pass_flood.rb b/benchmark/bm_vm_thread_pass_flood.rb
deleted file mode 100644
index 27157d1a6f..0000000000
--- a/benchmark/bm_vm_thread_pass_flood.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-1000.times{
-  Thread.new{loop{Thread.pass}}
-}
-
-i = 0
-while i<10000
-  i += 1
-end
diff --git a/benchmark/bm_vm_thread_pipe.rb b/benchmark/bm_vm_thread_pipe.rb
deleted file mode 100644
index 272d231eba..0000000000
--- a/benchmark/bm_vm_thread_pipe.rb
+++ /dev/null
@@ -1,17 +0,0 @@
-# Mesure small and plenty pipe read/write.
-# A performance may depend on GVL implementation.
-
-lmax = 100_000
-r, w = IO.pipe
-[Thread.new{
-  lmax.times{
-    w.write('a')
-  }
-  p "w:exit"
-}, Thread.new{
-  lmax.times{
-    r.read(1)
-  }
-  p "r:exit"
-}].each{|t| t.join}
-
diff --git a/benchmark/bm_vm_thread_queue.rb b/benchmark/bm_vm_thread_queue.rb
deleted file mode 100644
index 37381ae62b..0000000000
--- a/benchmark/bm_vm_thread_queue.rb
+++ /dev/null
@@ -1,18 +0,0 @@
-require 'thread'
-
-n = 1_000_000
-q = Queue.new
-consumer = Thread.new{
-  while q.pop
-    # consuming
-  end
-}
-
-producer = Thread.new{
-  n.times{
-    q.push true
-  }
-  q.push nil
-}
-
-consumer.join
diff --git a/benchmark/driver.rb b/benchmark/driver.rb
deleted file mode 100644
index defe3c30be..0000000000
--- a/benchmark/driver.rb
+++ /dev/null
@@ -1,400 +0,0 @@
-#
-# Ruby Benchmark driver
-#
-
-first = true
-
-begin
-  require 'optparse'
-rescue LoadError
-  if first
-    first = false
-    $:.unshift File.join(File.dirname(__FILE__), '../lib')
-    retry
-  else
-    raise
-  end
-end
-
-require 'benchmark'
-require 'pp'
-
-class BenchmarkDriver
-  def self.benchmark(opt)
-    driver = self.new(opt[:execs], opt[:dir], opt)
-    begin
-      driver.run
-    ensure
-      driver.show_results
-    end
-  end
-
-  def self.load(input, type, opt)
-    attrs = [:executables, :results]
-    case type
-    when 'yaml'
-      require 'yaml'
-      h = YAML.load(input)
-    when 'json'
-      require 'json'
-      h = JSON.load(input)
-    else
-      h = eval(input.read)
-    end
-    obj = allocate
-    obj.instance_variable_set("@execs", h[:executables] || h["executables"])
-    obj.instance_variable_set("@results", h[:results] || h["results"])
-    obj.instance_variable_set("@opt", opt)
-    obj
-  end
-
-  def output *args
-    puts(*args)
-    @output and @output.puts(*args)
-  end
-
-  def message *args
-    output(*args) if @verbose
-  end
-
-  def message_print *args
-    if @verbose
-      print(*args)
-      STDOUT.flush
-      @output and @output.print(*args)
-    end
-  end
-
-  def progress_message *args
-    unless STDOUT.tty?
-      STDERR.print(*args)
-      STDERR.flush
-    end
-  end
-
-  def initialize execs, dir, opt = {}
-    @execs = execs.map{|e|
-      e.strip!
-      next if e.empty?
-
-      if /(.+)::(.+)/ =~ e
-        # ex) ruby-a::/path/to/ruby-a
-        label = $1.strip
-        path = $2
-        version = `#{path} -v`.chomp
-      else
-        path = e
-        version = label = `#{path} -v`.chomp
-      end
-      [path, label, version]
-    }.compact
-
-    @dir = dir
-    @repeat = opt[:repeat] || 1
-    @repeat = 1 if @repeat < 1
-    @pattern = opt[:pattern] || nil
-    @exclude = opt[:exclude] || nil
-    @verbose = opt[:quiet] ? false : (opt[:verbose] || false)
-    @output = opt[:output] ? open(opt[:output], 'w') : nil
-    @loop_wl1 = @loop_wl2 = nil
-    @ruby_arg = opt[:ruby_arg] || nil
-    @opt = opt
-
-    # [[name, [[r-1-1, r-1-2, ...], [r-2-1, r-2-2, ...]]], ...]
-    @results = []
-
-    if @verbose
-      @start_time = Time.now
-      message @start_time
-      @execs.each_with_index{|(path, label, version), i|
-        message "target #{i}: " + (label == version ? "#{label}" : "#{label} (#{version})") + " at \"#{path}\""
-      }
-    end
-  end
-
-  def adjusted_results name, results
-    s = nil
-    results.each_with_index{|e, i|
-      r = e.min
-      case name
-      when /^vm1_/
-        if @loop_wl1
-          r -= @loop_wl1[i]
-          r = 0 if r < 0
-          s = '*'
-        end
-      when /^vm2_/
-        if @loop_wl2
-          r -= @loop_wl2[i]
-          r = 0 if r < 0
-          s = '*'
-        end
-      end
-      yield r
-    }
-    s
-  end
-
-  def show_results
-    case @opt[:format]
-    when :tsv
-      strformat = "\t%1$s"
-      numformat = "\t%1$*2$.3f"
-      minwidth = 0
-      name_width = 0
-    when :markdown
-      markdown = true
-      strformat = "|%1$-*2$s"
-      numformat = "|%1$*2$.3f"
-    when :plain
-      strformat = " %1$-*2$s"
-      numformat = " %1$*2$.3f"
-    end
-
-    name_width ||= @results.map {|v,*| v.size}.max
-    minwidth ||= 7
-    width = @execs.map{|(_, v)| [v.size, minwidth].max}
-
-    output
-
-    if @verbose
-      message '-----------------------------------------------------------'
-      message 'raw data:'
-      message
-      message PP.pp(@results, "", 79)
-      message
-      message "Elapsed time: #{Time.now - @start_time} (sec)"
-    end
-
-    if rawdata_output = @opt[:rawdata_output]
-      h = {}
-      h[:cpuinfo] = File.read('/proc/cpuinfo') if File.exist?('/proc/cpuinfo')
-      h[:executables] = @execs
-      h[:results] = @results
-      if (type = File.extname(rawdata_output)).empty?
-        type = rawdata_output
-        rawdata_output = @output.path.sub(/\.[^.\/]+\z/, '') << '.' << rawdata_output
-      end
-      case type
-      when 'yaml'
-        require 'yaml'
-        h = YAML.dump(h)
-      when 'json'
-        require 'json'
-        h = JSON.pretty_generate(h)
-      else
-        require 'pp'
-        h = h.pretty_inspect
-      end
-      open(rawdata_output, 'w') {|f| f.puts h}
-    end
-
-    output '-----------------------------------------------------------'
-    output 'benchmark results:'
-
-    if @verbose and @repeat > 1
-      output "minimum results in each #{@repeat} measurements."
-    end
-
-    output "Execution time (sec)"
-    output if markdown
-    output ["name".ljust(name_width), @execs.map.with_index{|(_, v), i| sprintf(strformat, v, width[i])}].join("").rstrip
-    output ["-"*name_width, width.map{|n|":".rjust(n, "-")}].join("|") if markdown
-    @results.each{|v, result|
-      rets = []
-      s = adjusted_results(v, result){|r|
-        rets << sprintf(numformat, r, width[rets.size])
-      }
-      v += s if s
-      output [v.ljust(name_width), rets].join("")
-    }
-
-    if @execs.size > 1
-      output
-      output "Speedup ratio: compare with the result of `#{@execs[0][1]}' (greater is better)"
-      output if markdown
-      output ["name".ljust(name_width), @execs[1..-1].map.with_index{|(_, v), i| sprintf(strformat, v, width[i])}].join("").rstrip
-      output ["-"*name_width, width[1..-1].map{|n|":".rjust(n, "-")}].join("|") if markdown
-      @results.each{|v, result|
-        rets = []
-        first_value = nil
-        s = adjusted_results(v, result){|r|
-          if first_value
-            if r == 0
-              rets << "Error"
-            else
-              rets << sprintf(numformat, first_value/r, width[rets.size+1])
-            end
-          else
-            first_value = r
-          end
-        }
-        v += s if s
-        output [v.ljust(name_width), rets].join("")
-      }
-    end
-
-    if @opt[:output]
-      output
-      output "Log file: #{@opt[:output]}"
-    end
-  end
-
-  def files
-    flag = {}
-    @files = Dir.glob(File.join(@dir, 'bm*.rb')).map{|file|
-      next if @pattern && /#{@pattern}/ !~ File.basename(file)
-      next if @exclude && /#{@exclude}/ =~ File.basename(file)
-      case file
-      when /bm_(vm[12])_/, /bm_loop_(whileloop2?).rb/
-        flag[$1] = true
-      end
-      file
-    }.compact
-
-    if flag['vm1'] && !flag['whileloop']
-      @files << File.join(@dir, 'bm_loop_whileloop.rb')
-    elsif flag['vm2'] && !flag['whileloop2']
-      @files << File.join(@dir, 'bm_loop_whileloop2.rb')
-    end
-
-    @files.sort!
-    progress_message "total: #{@files.size * @repeat} trial(s) (#{@repeat} trial(s) for #{@files.size} benchmark(s))\n"
-    @files
-  end
-
-  def run
-    files.each_with_index{|file, i|
-      @i = i
-      r = measure_file(file)
-
-      if /bm_loop_whileloop.rb/ =~ file
-        @loop_wl1 = r[1].map{|e| e.min}
-      elsif /bm_loop_whileloop2.rb/ =~ file
-        @loop_wl2 = r[1].map{|e| e.min}
-      end
-    }
-  end
-
-  def measure_file file
-    name = File.basename(file, '.rb').sub(/^bm_/, '')
-    prepare_file = File.join(File.dirname(file), "prepare_#{name}.rb")
-    load prepare_file if FileTest.exist?(prepare_file)
-
-    if @verbose
-      output
-      output '-----------------------------------------------------------'
-      output name
-      output
-      output File.read(file)
-      output
-    end
-
-    result = [name]
-    result << @execs.map{|(e, v)|
-      (0...@repeat).map{
-        message_print "#{v}\t"
-        progress_message '.'
-
-        m = measure(e, file)
-        message "#{m}"
-        m
-      }
-    }
-    @results << result
-    result
-  end
-
-  unless defined?(File::NULL)
-    if File.exist?('/dev/null')
-      File::NULL = '/dev/null'
-    end
-  end
-
-  def measure executable, file
-    cmd = "#{executable} #{@ruby_arg} #{file}"
-
-    m = Benchmark.measure{
-      system(cmd, out: File::NULL)
-    }
-
-    if $? != 0
-      output "\`#{cmd}\' exited with abnormal status (#{$?})"
-      0
-    else
-      m.real
-    end
-  end
-end
-
-if __FILE__ == $0
-  opt = {
-    :execs => [],
-    :dir => File.dirname(__FILE__),
-    :repeat => 1,
-    :output => nil,
-    :raw_output => nil,
-    :format => :tsv,
-  }
-  formats = {
-    :tsv => ".tsv",
-    :markdown => ".md",
-    :plain => ".txt",
-  }
-
-  parser = OptionParser.new{|o|
-    o.on('-e', '--executables [EXECS]',
-      "Specify benchmark one or more targets (e1::path1; e2::path2; e3::path3;...)"){|e|
-       e.split(/;/).each{|path|
-         opt[:execs] << path
-       }
-    }
-    o.on('-d', '--directory [DIRECTORY]', "Benchmark suites directory"){|d|
-      opt[:dir] = d
-    }
-    o.on('-p', '--pattern [PATTERN]', "Benchmark name pattern"){|p|
-      opt[:pattern] = p
-    }
-    o.on('-x', '--exclude [PATTERN]', "Benchmark exclude pattern"){|e|
-      opt[:exclude] = e
-    }
-    o.on('-r', '--repeat-count [NUM]', "Repeat count"){|n|
-      opt[:repeat] = n.to_i
-    }
-    o.on('-o', '--output-file [FILE]', "Output file"){|f|
-      opt[:output] = f
-    }
-    o.on('--ruby-arg [ARG]', "Optional argument for ruby"){|a|
-      opt[:ruby_arg] = a
-    }
-    o.on('--rawdata-output [FILE]', 'output rawdata'){|r|
-      opt[:rawdata_output] = r
-    }
-    o.on('--load-rawdata=FILE', 'input rawdata'){|r|
-      opt[:rawdata_input] = r
-    }
-    o.on('-f', "--format=FORMAT", "output format (#{formats.keys.join(",")})", formats.keys){|r|
-      opt[:format] = r
-    }
-    o.on('-v', '--verbose'){|v|
-      opt[:verbose] = v
-    }
-    o.on('-q', '--quiet', "Run without notify information except result table."){|q|
-      opt[:quiet] = q
-      opt[:verbose] = false
-    }
-  }
-
-  parser.parse!(ARGV)
-  opt[:output] ||= "bmlog-#{Time.now.strftime('%Y%m%d-%H%M%S')}.#{$$}#{formats[opt[:format]]}"
-
-  if input = opt[:rawdata_input]
-    b = open(input) {|f|
-      BenchmarkDriver.load(f, File.extname(input)[1..-1], opt)
-    }
-    b.show_results
-  else
-    BenchmarkDriver.benchmark(opt)
-  end
-end
-
diff --git a/benchmark/gc/aobench.rb b/benchmark/gc/aobench.rb
deleted file mode 100644
index 2eed7abc83..0000000000
--- a/benchmark/gc/aobench.rb
+++ /dev/null
@@ -1 +0,0 @@
-require_relative '../bm_app_aobench.rb'
diff --git a/benchmark/gc/binary_trees.rb b/benchmark/gc/binary_trees.rb
deleted file mode 100644
index af8ea722aa..0000000000
--- a/benchmark/gc/binary_trees.rb
+++ /dev/null
@@ -1 +0,0 @@
-require_relative '../bm_so_binary_trees.rb'
diff --git a/benchmark/gc/gcbench.rb b/benchmark/gc/gcbench.rb
deleted file mode 100644
index 09a404466a..0000000000
--- a/benchmark/gc/gcbench.rb
+++ /dev/null
@@ -1,56 +0,0 @@
-require 'benchmark'
-require 'pp'
-require 'optparse'
-
-$list = true
-$gcprof = true
-
-opt = OptionParser.new
-opt.on('-q'){$list = false}
-opt.on('-d'){$gcprof = false}
-opt.parse!(ARGV)
-
-script = File.join(File.dirname(__FILE__), ARGV.shift)
-script += '.rb' unless FileTest.exist?(script)
-raise "#{script} not found" unless FileTest.exist?(script)
-
-puts "Script: #{script}"
-
-if $gcprof
-  GC::Profiler.enable
-end
-
-tms = Benchmark.measure{|x|
-  load script
-}
-
-gc_time = 0
-
-if $gcprof
-  gc_time = GC::Profiler.total_time
-  GC::Profiler.report if $list and RUBY_VERSION >= '2.0.0' # before 1.9.3, report() may run infinite loop
-  GC::Profiler.disable
-end
-
-pp GC.stat
-
-puts "#{RUBY_DESCRIPTION} #{GC::OPTS.inspect}" if defined?(GC::OPTS)
-
-desc = "#{RUBY_VERSION}#{RUBY_PATCHLEVEL >= 0 ? "p#{RUBY_PATCHLEVEL}" : "dev"}"
-name = File.basename(script, '.rb')
-
-puts
-puts script
-puts Benchmark::CAPTION
-puts tms
-puts "GC total time (sec): #{gc_time}"
-
-# show High-Water Mark on Linux
-if File.exist?('/proc/self/status') && /VmHWM:\s*(\d+.+)/ =~ File.read('/proc/self/status')
-  puts
-  puts "VmHWM: #{$1.chomp}"
-end
-
-puts
-puts "Summary of #{name} on #{desc}\t#{tms.real}\t#{gc_time}\t#{GC.count}"
-puts "         (real time in sec, GC time in sec, GC count)"
diff --git a/benchmark/gc/hash1.rb b/benchmark/gc/hash1.rb
deleted file mode 100644
index cb030d458d..0000000000
--- a/benchmark/gc/hash1.rb
+++ /dev/null
@@ -1,11 +0,0 @@
-value = 0.01
-h = {}
-n = 50_000
-
-1.upto(n){|i|
-  h["%020d" % i] = "v-#{i}"
-}
-
-(n * 1_000).times{
-  ''
-}
diff --git a/benchmark/gc/hash2.rb b/benchmark/gc/hash2.rb
deleted file mode 100644
index e8c943fb21..0000000000
--- a/benchmark/gc/hash2.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-value = 0.01
-h = {}
-n = 4*(10**6)
-
-1.upto(n){|i|
-  h["%020d" % i] = value * i
-}
diff --git a/benchmark/gc/null.rb b/benchmark/gc/null.rb
deleted file mode 100644
index c05a79f561..0000000000
--- a/benchmark/gc/null.rb
+++ /dev/null
@@ -1 +0,0 @@
-# null
diff --git a/benchmark/gc/pentomino.rb b/benchmark/gc/pentomino.rb
deleted file mode 100644
index 94ba74be89..0000000000
--- a/benchmark/gc/pentomino.rb
+++ /dev/null
@@ -1 +0,0 @@
-require_relative '../bm_app_pentomino.rb'
diff --git a/benchmark/gc/rdoc.rb b/benchmark/gc/rdoc.rb
deleted file mode 100644
index 14c89f5611..0000000000
--- a/benchmark/gc/rdoc.rb
+++ /dev/null
@@ -1,13 +0,0 @@
-require 'rdoc/rdoc'
-require 'tmpdir'
-
-srcdir = File.expand_path('../..', __dir__)
-
-Dir.mktmpdir('rdocbench-'){|d|
-  dir = File.join(d, 'rdocbench')
-  args = %W(--root #{srcdir} --page-dir #{srcdir}/doc --encoding=UTF-8 --no-force-update --all --ri --debug --quiet #{srcdir})
-  args << '--op' << dir
-
-  r = RDoc::RDoc.new
-  r.document args
-}
diff --git a/benchmark/gc/redblack.rb b/benchmark/gc/redblack.rb
deleted file mode 100644
index c66290140a..0000000000
--- a/benchmark/gc/redblack.rb
+++ /dev/null
@@ -1,366 +0,0 @@
-# This benchmark is imported from https://github.com/jruby/rubybench/blob/master/time/bench_red_black.rb
-# License is License is Apache-2
-
-require 'benchmark'
-
-# Algorithm based on "Introduction to Algorithms" by Cormen and others
-class RedBlackTree
-  class Node
-    attr_accessor :color
-    attr_accessor :key
-    attr_accessor :left
-    attr_accessor :right
-    attr_accessor :parent
-
-    RED = :red
-    BLACK = :black
-    COLORS = [RED, BLACK].freeze
-
-    def initialize(key, color = RED)
-      raise ArgumentError, "Bad value for color parameter" unless COLORS.include?(color)
-      @color = color
-      @key = key
-      @left = @right = @parent = NilNode.instance
-    end
-
-    def black?
-      return color == BLACK
-    end
-
-    def red?
-      return color == RED
-    end
-  end
-
-  class NilNode < Node
-    class << self
-      private :new
-
-      # it's not thread safe
-      def instance
-        @instance ||= begin
-          def instance
-            return @instance
-          end
-
-          new
-        end
-      end
-    end
-
-    def initialize
-      self.color = BLACK
-      self.key = 0
-      self.left = nil
-      self.right = nil
-      self.parent = nil
-    end
-
-    def nil?
-      return true
-    end
-  end
-
-  include Enumerable
-
-  attr_accessor :root
-  attr_accessor :size
-
-  def initialize
-    self.root = NilNode.instance
-    self.size = 0
-  end
-
-  def add(key)
-    insert(Node.new(key))
-  end
-
-  def insert(x)
-    insert_helper(x)
-
-    x.color = Node::RED
-    while x != root && x.parent.color == Node::RED
-      if x.parent == x.parent.parent.left
-        y = x.parent.parent.right
-        if !y.nil? && y.color == Node::RED
-          x.parent.color = Node::BLACK
-          y.color = Node::BLACK
-          x.parent.parent.color = Node::RED
-          x = x.parent.parent
-        else
-          if x == x.parent.right
-            x = x.parent
-            left_rotate(x)
-          end
-          x.parent.color = Node::BLACK
-          x.parent.parent.color = Node::RED
-          right_rotate(x.parent.parent)
-        end
-      else
-        y = x.parent.parent.left
-        if !y.nil? && y.color == Node::RED
-          x.parent.color = Node::BLACK
-          y.color = Node::BLACK
-          x.parent.parent.color = Node::RED
-          x = x.parent.parent
-        else
-          if x == x.parent.left
-            x = x.parent
-            right_rotate(x)
-          end
-          x.parent.color = Node::BLACK
-          x.parent.parent.color = Node::RED
-          left_rotate(x.parent.parent)
-        end
-      end
-    end
-    root.color = Node::BLACK
-  end
-
-  alias << insert
-
-  def delete(z)
-    y = (z.left.nil? || z.right.nil?) ? z : successor(z)
-    x = y.left.nil? ? y.right : y.left
-    x.parent = y.parent
-
-    if y.parent.nil?
-      self.root = x
-    else
-      if y == y.parent.left
-        y.parent.left = x
-      else
-        y.parent.right = x
-      end
-    end
-
-    z.key = y.key if y != z
-
-    if y.color == Node::BLACK
-      delete_fixup(x)
-    end
-
-    self.size -= 1
-    return y
-  end
-
-  def minimum(x = root)
-    while !x.left.nil?
-      x = x.left
-    end
-    return x
-  end
-
-  def maximum(x = root)
-    while !x.right.nil?
-      x = x.right
-    end
-    return x
-  end
-
-  def successor(x)
-    if !x.right.nil?
-      return minimum(x.right)
-    end
-    y = x.parent
-    while !y.nil? && x == y.right
-      x = y
-      y = y.parent
-    end
-    return y
-  end
-
-  def predecessor(x)
-    if !x.left.nil?
-      return maximum(x.left)
-    end
-    y = x.parent
-    while !y.nil? && x == y.left
-      x = y
-      y = y.parent
-    end
-    return y
-  end
-
-  def inorder_walk(x = root)
-    x = self.minimum
-    while !x.nil?
-      yield x.key
-      x = successor(x)
-    end
-  end
-
-  alias each inorder_walk
-
-  def reverse_inorder_walk(x = root)
-    x = self.maximum
-    while !x.nil?
-      yield x.key
-      x = predecessor(x)
-    end
-  end
-
-  alias reverse_each reverse_inorder_walk
-
-  def search(key, x = root)
-    while !x.nil? && x.key != key
-      key < x.key ? x = x.left : x = x.right
-    end
-    return x
-  end
-
-  def empty?
-    return self.root.nil?
-  end
-
-  def black_height(x = root)
-    height = 0
-    while !x.nil?
-      x = x.left
-      height +=1 if x.nil? || x.black?
-    end
-    return height
-  end
-
-private
-
-  def left_rotate(x)
-    raise "x.right is nil!" if x.right.nil?
-    y = x.right
-    x.right = y.left
-    y.left.parent = x if !y.left.nil?
-    y.parent = x.parent
-    if x.parent.nil?
-      self.root = y
-    else
-      if x == x.parent.left
-        x.parent.left = y
-      else
-        x.parent.right = y
-      end
-    end
-    y.left = x
-    x.parent = y
-  end
-
-  def right_rotate(x)
-    raise "x.left is nil!" if x.left.nil?
-    y = x.left
-    x.left = y.right
-    y.right.parent = x if !y.right.nil?
-    y.parent = x.parent
-    if x.parent.nil?
-      self.root = y
-    else
-      if x == x.parent.left
-        x.parent.left = y
-      else
-        x.parent.right = y
-      end
-    end
-    y.right = x
-    x.parent = y
-  end
-
-  def insert_helper(z)
-    y = NilNode.instance
-    x = root
-    while !x.nil?
-      y = x
-      z.key < x.key ? x = x.left : x = x.right
-    end
-    z.parent = y
-    if y.nil?
-      self.root = z
-    else
-      z.key < y.key ? y.left = z : y.right = z
-    end
-    self.size += 1
-  end
-
-  def delete_fixup(x)
-    while x != root && x.color == Node::BLACK
-      if x == x.parent.left
-        w = x.parent.right
-        if w.color == Node::RED
-          w.color = Node::BLACK
-          x.parent.color = Node::RED
-          left_rotate(x.parent)
-          w = x.parent.right
-        end
-        if w.left.color == Node::BLACK && w.right.color == Node::BLACK
-          w.color = Node::RED
-          x = x.parent
-        else
-          if w.right.color == Node::BLACK
-            w.left.color = Node::BLACK
-            w.color = Node::RED
-            right_rotate(w)
-            w = x.parent.right
-          end
-          w.color = x.parent.color
-          x.parent.color = Node::BLACK
-          w.right.color = Node::BLACK
-          left_rotate(x.parent)
-          x = root
-        end
-      else
-        w = x.parent.left
-        if w.color == Node::RED
-          w.color = Node::BLACK
-          x.parent.color = Node::RED
-          right_rotate(x.parent)
-          w = x.parent.left
-        end
-        if w.right.color == Node::BLACK && w.left.color == Node::BLACK
-          w.color = Node::RED
-          x = x.parent
-        else
-          if w.left.color == Node::BLACK
-            w.right.color = Node::BLACK
-            w.color = Node::RED
-            left_rotate(w)
-            w = x.parent.left
-          end
-          w.color = x.parent.color
-          x.parent.color = Node::BLACK
-          w.left.color = Node::BLACK
-          right_rotate(x.parent)
-          x = root
-        end
-      end
-    end
-    x.color = Node::BLACK
-  end
-end
-
-def rbt_bm
-  n = 100_000
-  a1 = []; n.times { a1 << rand(999_999) }
-  a2 = []; n.times { a2 << rand(999_999) }
-
-  start = Time.now
-
-  tree = RedBlackTree.new
-
-  n.times {|i| tree.add(i) }
-  n.times { tree.delete(tree.root) }
-
-  tree = RedBlackTree.new
-  a1.each {|e| tree.add(e) }
-  a2.each {|e| tree.search(e) }
-  tree.inorder_walk {|key| key + 1 }
-  tree.reverse_inorder_walk {|key| key + 1 }
-  n.times { tree.minimum }
-  n.times { tree.maximum }
-
-  return Time.now - start
-end
-
-N = (ARGV[0] || 10).to_i
-
-N.times do
-  # puts rbt_bm.to_f
-  rbt_bm.to_f
-  # puts "GC.count = #{GC.count}" if GC.respond_to?(:count)
-end
diff --git a/benchmark/gc/ring.rb b/benchmark/gc/ring.rb
deleted file mode 100644
index be2c7b7250..0000000000
--- a/benchmark/gc/ring.rb
+++ /dev/null
@@ -1,29 +0,0 @@
-# create many old objects
-
-max = 30_000_000
-
-class Ring
-  attr_reader :next_ring
-  def initialize n = nil
-    @next_ring = n
-  end
-
-
-  def size
-    s = 1
-    ring = self
-    while ring.next_ring
-      s += 1
-      ring = ring.next_ring
-    end
-    s
-  end
-end
-
-ring = Ring.new
-
-max.times{
-  ring = Ring.new(ring)
-}
-
-# p ring.size
diff --git a/benchmark/make_fasta_output.rb b/benchmark/make_fasta_output.rb
deleted file mode 100644
index b6d787ae27..0000000000
--- a/benchmark/make_fasta_output.rb
+++ /dev/null
@@ -1,19 +0,0 @@
-# prepare 'fasta.output'
-
-def prepare_fasta_output n
-  filebase = File.join(File.dirname($0), 'fasta.output')
-  script = File.join(File.dirname($0), 'bm_so_fasta.rb')
-  file = "#{filebase}.#{n}"
-
-  unless FileTest.exist?(file)
-    STDERR.puts "preparing #{file}"
-
-    open(file, 'w'){|f|
-      ARGV[0] = n
-      $stdout = f
-      load script
-      $stdout = STDOUT
-    }
-  end
-end
-
diff --git a/benchmark/other-lang/ack.pl b/benchmark/other-lang/ack.pl
deleted file mode 100644
index 201e22ddfa..0000000000
--- a/benchmark/other-lang/ack.pl
+++ /dev/null
@@ -1,11 +0,0 @@
-use integer;
-
-sub Ack {
-    return $_[0] ? ($_[1] ? Ack($_[0]-1, Ack($_[0], $_[1]-1))
-		    : Ack($_[0]-1, 1))
-	: $_[1]+1;
-}
-
-my $NUM = 9;
-$NUM = 1 if ($NUM < 1);
-my $ack = Ack(3, $NUM);
diff --git a/benchmark/other-lang/ack.py b/benchmark/other-lang/ack.py
deleted file mode 100644
index 9968e7cfcf..0000000000
--- a/benchmark/other-lang/ack.py
+++ /dev/null
@@ -1,16 +0,0 @@
-import sys
-sys.setrecursionlimit(5000000)
-
-def Ack(M, N):
-    if (not M):
-        return( N + 1 )
-    if (not N):
-        return( Ack(M-1, 1) )
-    return( Ack(M-1, Ack(M, N-1)) )
-
-def main():
-    NUM = 9
-    sys.setrecursionlimit(10000)
-    Ack(3, NUM)
-
-main()
diff --git a/benchmark/other-lang/ack.rb b/benchmark/other-lang/ack.rb
deleted file mode 100644
index 7451bed6c4..0000000000
--- a/benchmark/other-lang/ack.rb
+++ /dev/null
@@ -1,12 +0,0 @@
-def ack(m, n)
-    if m == 0 then
-        n + 1
-    elsif n == 0 then
-        ack(m - 1, 1)
-    else
-        ack(m - 1, ack(m, n - 1))
-    end
-end
-
-NUM = 9
-ack(3, NUM)
diff --git a/benchmark/other-lang/ack.scm b/benchmark/other-lang/ack.scm
deleted file mode 100644
index a80b73ba55..0000000000
--- a/benchmark/other-lang/ack.scm
+++ /dev/null
@@ -1,7 +0,0 @@
-(define (ack m n)
-  (cond ((zero? m) (+ n 1))
-	((zero? n) (ack (- m 1) 1))
-	(else      (ack (- m 1) (ack m (- n 1))))))
-
-(ack 3 9)
-
diff --git a/benchmark/other-lang/eval.rb b/benchmark/other-lang/eval.rb
deleted file mode 100644
index 48a2cea019..0000000000
--- a/benchmark/other-lang/eval.rb
+++ /dev/null
@@ -1,66 +0,0 @@
-
-Bench = %w(
-  loop
-  ack
-  fib
-  tak
-  fact
-)
-
-Lang = <<EOP.map{|l| l.strip}
-  ruby-cyg
-  ../../../test6/miniruby
-  perl
-  python
-  gosh
-EOP
-
-Bench.replace ['loop2']
-Lang.replace ['ruby-cyg']
-
-Ext = %w(
-  .rb
-  .rb
-  .pl
-  .py
-  .scm
-)
-
-p Bench
-p Lang
-
-require 'benchmark'
-
-def bench cmd
-  m = Benchmark.measure{
-    #p cmd
-    system(cmd)
-  }
-  [m.utime, m.real]
-end
-
-Result = []
-Bench.each{|b|
-  r = []
-  Lang.each_with_index{|l, idx|
-    cmd = "#{l} #{b}#{Ext[idx]}"
-    r << bench(cmd)
-  }
-  Result << r
-}
-
-require 'pp'
-# utime
-puts Lang.join("\t")
-Bench.each_with_index{|b, bi|
-  print b, "\t"
-  puts Result[bi].map{|e| e[0]}.join("\t")
-}
-
-# rtime
-puts Lang.join("\t")
-Bench.each_with_index{|b, bi|
-  print b, "\t"
-  puts Result[bi].map{|e| e[1]}.join("\t")
-}
-
diff --git a/benchmark/other-lang/fact.pl b/benchmark/other-lang/fact.pl
deleted file mode 100644
index a9b0b69cdf..0000000000
--- a/benchmark/other-lang/fact.pl
+++ /dev/null
@@ -1,13 +0,0 @@
-sub fact{
-  my $n = @_[0];
-  if($n < 2){
-    return 1;
-  }
-  else{
-    return $n * fact($n-1);
-  }
-}
-
-for($i=0; $i<10000; $i++){
-  &fact(100);
-}
diff --git a/benchmark/other-lang/fact.py b/benchmark/other-lang/fact.py
deleted file mode 100644
index 01593965d9..0000000000
--- a/benchmark/other-lang/fact.py
+++ /dev/null
@@ -1,18 +0,0 @@
-#import sys
-#sys.setrecursionlimit(1000)
-
-def factL(n):
-	r = 1
-	for x in range(2, n):
-		r *= x
-	return r
-
-def factR(n):
-	if n < 2:
-		return 1
-	else:
-		return n * factR(n-1)
-
-for i in range(10000):
-	factR(100)
-
diff --git a/benchmark/other-lang/fact.rb b/benchmark/other-lang/fact.rb
deleted file mode 100644
index 6cedc752cd..0000000000
--- a/benchmark/other-lang/fact.rb
+++ /dev/null
@@ -1,13 +0,0 @@
-def fact(n)
-  if n < 2
-    1
-  else
-    n * fact(n-1)
-  end
-end
-
-i = 0
-while i<10000
-  i += 1
-  fact(100)
-end
diff --git a/benchmark/other-lang/fact.scm b/benchmark/other-lang/fact.scm
deleted file mode 100644
index c98a7fedd3..0000000000
--- a/benchmark/other-lang/fact.scm
+++ /dev/null
@@ -1,8 +0,0 @@
-(define (fact n)
-        (if (< n 2)
-            1
-          (* n (fact (- n 1)))))
-
-(dotimes (i 10000)
-  (fact 100))
-
diff --git a/benchmark/other-lang/fib.pl b/benchmark/other-lang/fib.pl
deleted file mode 100644
index a46f666d1e..0000000000
--- a/benchmark/other-lang/fib.pl
+++ /dev/null
@@ -1,11 +0,0 @@
-sub fib{
-  my $n = $_[0];
-  if($n < 3){
-    return 1;
-  }
-  else{
-    return fib($n-1) + fib($n-2);
-  }
-};
-
-&fib(34);
diff --git a/benchmark/other-lang/fib.py b/benchmark/other-lang/fib.py
deleted file mode 100644
index 45f2bceb8d..0000000000
--- a/benchmark/other-lang/fib.py
+++ /dev/null
@@ -1,7 +0,0 @@
-def fib(n):
-  if n < 3:
-    return 1
-  else:
-    return fib(n-1) + fib(n-2)
-
-fib(34)
diff --git a/benchmark/other-lang/fib.rb b/benchmark/other-lang/fib.rb
deleted file mode 100644
index ec587eabe0..0000000000
--- a/benchmark/other-lang/fib.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-def fib n
-  if n < 3
-    1
-  else
-    fib(n-1) + fib(n-2)
-  end
-end
-
-fib(34)
diff --git a/benchmark/other-lang/fib.scm b/benchmark/other-lang/fib.scm
deleted file mode 100644
index 2fc4e225bd..0000000000
--- a/benchmark/other-lang/fib.scm
+++ /dev/null
@@ -1,7 +0,0 @@
-(define (fib n)
-        (if (< n 3)
-            1
-          (+ (fib (- n 1)) (fib (- n 2)))))
-
-(fib 34)
-
diff --git a/benchmark/other-lang/loop.pl b/benchmark/other-lang/loop.pl
deleted file mode 100644
index 2777490aaa..0000000000
--- a/benchmark/other-lang/loop.pl
+++ /dev/null
@@ -1,3 +0,0 @@
-for($i=0; $i<30000000; $i++){
-}
-
diff --git a/benchmark/other-lang/loop.py b/benchmark/other-lang/loop.py
deleted file mode 100644
index 003749bf3a..0000000000
--- a/benchmark/other-lang/loop.py
+++ /dev/null
@@ -1,2 +0,0 @@
-for i in xrange(30000000):
-	pass
diff --git a/benchmark/other-lang/loop.rb b/benchmark/other-lang/loop.rb
deleted file mode 100644
index b367b9dbf3..0000000000
--- a/benchmark/other-lang/loop.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-i = 0
-while i<30000000
-  i += 1
-end
diff --git a/benchmark/other-lang/loop.scm b/benchmark/other-lang/loop.scm
deleted file mode 100644
index 3364f7e679..0000000000
--- a/benchmark/other-lang/loop.scm
+++ /dev/null
@@ -1 +0,0 @@
-(dotimes (x 30000000))
diff --git a/benchmark/other-lang/loop2.rb b/benchmark/other-lang/loop2.rb
deleted file mode 100644
index df8fffc1ff..0000000000
--- a/benchmark/other-lang/loop2.rb
+++ /dev/null
@@ -1 +0,0 @@
-30000000.times{}
diff --git a/benchmark/other-lang/tak.pl b/benchmark/other-lang/tak.pl
deleted file mode 100644
index 7e748a67c6..0000000000
--- a/benchmark/other-lang/tak.pl
+++ /dev/null
@@ -1,11 +0,0 @@
-sub tak {
-    local($x, $y, $z) = @_;
-    if (!($y < $x)) {
-	return $z;
-    } else {
-	return &tak(&tak($x - 1, $y, $z),
-		    &tak($y - 1, $z, $x),
-		    &tak($z - 1, $x, $y));
-    }
-}
-&tak(18, 9, 0);
diff --git a/benchmark/other-lang/tak.py b/benchmark/other-lang/tak.py
deleted file mode 100644
index 04f3f6829c..0000000000
--- a/benchmark/other-lang/tak.py
+++ /dev/null
@@ -1,8 +0,0 @@
-def tak(x, y, z):
-	if not(y<x):
-		return z
-	else:
-		return tak(tak(x-1, y, z),
-		           tak(y-1, z, x),
-		           tak(z-1, x, y))
-tak(18, 9, 0)
diff --git a/benchmark/other-lang/tak.rb b/benchmark/other-lang/tak.rb
deleted file mode 100644
index efe5380f4e..0000000000
--- a/benchmark/other-lang/tak.rb
+++ /dev/null
@@ -1,13 +0,0 @@
-
-def tak x, y, z
-  unless y < x
-    z
-  else
-    tak( tak(x-1, y, z),
-         tak(y-1, z, x),
-         tak(z-1, x, y))
-  end
-end
-
-tak(18, 9, 0)
-
diff --git a/benchmark/other-lang/tak.scm b/benchmark/other-lang/tak.scm
deleted file mode 100644
index 52a7629ee5..0000000000
--- a/benchmark/other-lang/tak.scm
+++ /dev/null
@@ -1,10 +0,0 @@
-(define (tak x y z)
-        (if (not (< y x))
-            z
-          (tak (tak (- x 1) y z)
-               (tak (- y 1) z x)
-               (tak (- z 1) x y))))
-
-(tak 18 9 0)
-
-
diff --git a/benchmark/prepare_require.rb b/benchmark/prepare_require.rb
deleted file mode 100644
index c4786f04ad..0000000000
--- a/benchmark/prepare_require.rb
+++ /dev/null
@@ -1,25 +0,0 @@
-require "fileutils"
-
-def prepare
-  num_files = 10000
-
-  basename = File.dirname($0)
-  data_dir = File.join(basename, "bm_require.data")
-
-  # skip if all of files exists
-  if File.exist?(File.join(data_dir, "c#{num_files}.rb"))
-    return
-  end
-
-  FileUtils.mkdir_p(data_dir)
-
-  1.upto(num_files) do |i|
-    f = File.open("#{data_dir}/c#{i}.rb", "w")
-    f.puts <<-END
-      class C#{i}
-      end
-    END
-  end
-end
-
-prepare
diff --git a/benchmark/prepare_require_thread.rb b/benchmark/prepare_require_thread.rb
deleted file mode 100644
index 339ecb8b39..0000000000
--- a/benchmark/prepare_require_thread.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-load File.join(File.dirname(__FILE__), "prepare_require.rb")
-
diff --git a/benchmark/prepare_so_count_words.rb b/benchmark/prepare_so_count_words.rb
deleted file mode 100644
index ee2138cdb2..0000000000
--- a/benchmark/prepare_so_count_words.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-# prepare 'wc.input'
-
-def prepare_wc_input
-  wcinput = File.join(File.dirname($0), 'wc.input')
-  wcbase  = File.join(File.dirname($0), 'wc.input.base')
-  unless FileTest.exist?(wcinput)
-    data = File.read(wcbase)
-    13.times{
-      data << data
-    }
-    open(wcinput, 'w'){|f| f.write data}
-  end
-end
-
-prepare_wc_input
diff --git a/benchmark/prepare_so_k_nucleotide.rb b/benchmark/prepare_so_k_nucleotide.rb
deleted file mode 100644
index d83aeb7a7e..0000000000
--- a/benchmark/prepare_so_k_nucleotide.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-require_relative 'make_fasta_output'
-prepare_fasta_output(100_000)
diff --git a/benchmark/prepare_so_reverse_complement.rb b/benchmark/prepare_so_reverse_complement.rb
deleted file mode 100644
index da3ec2df14..0000000000
--- a/benchmark/prepare_so_reverse_complement.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-require_relative 'make_fasta_output'
-prepare_fasta_output(2_500_000)
diff --git a/benchmark/report.rb b/benchmark/report.rb
deleted file mode 100644
index d2dc56b1e1..0000000000
--- a/benchmark/report.rb
+++ /dev/null
@@ -1,79 +0,0 @@
-#
-# YARV benchmark driver
-#
-
-require 'yarvutil'
-require 'benchmark'
-require 'rbconfig'
-
-def exec_command type, file, w
-  <<-EOP
-  $DRIVER_PATH = '#{File.dirname($0)}'
-  $LOAD_PATH.replace $LOAD_PATH | #{$LOAD_PATH.inspect}
-  require 'benchmark'
-  require 'yarvutil'
-#  print '#{type}'
-  begin
-    puts Benchmark.measure{
-      #{w}('#{file}')
-    }.utime
-  rescue Exception => exec_command_error_variable
-    puts "\t" + exec_command_error_variable.message
-  end
-  EOP
-end
-
-def benchmark cmd
-  rubybin = ENV['RUBY'] || RbConfig.ruby
-
-  IO.popen(rubybin, 'r+'){|io|
-    io.write cmd
-    io.close_write
-    return io.gets
-  }
-end
-
-def ruby_exec file
-  prog = exec_command 'ruby', file, 'load'
-  benchmark prog
-end
-
-def yarv_exec file
-  prog = exec_command 'yarv', file, 'YARVUtil.load_bm'
-  benchmark prog
-end
-
-$wr = $wy = nil
-
-def measure bench
-  file = File.dirname($0) + "/bm_#{bench}.rb"
-  r = ruby_exec(file).to_f
-  y = yarv_exec(file).to_f
-  puts "#{bench}\t#{r}\t#{y}"
-end
-
-def measure2
-  r = ruby_exec.to_f
-  y = yarv_exec.to_f
-  puts r/y
-end
-
-if $0 == __FILE__
-  %w{
-    whileloop
-    whileloop2
-    times
-    const
-    method
-    poly_method
-    block
-    rescue
-    rescue2
-  }.each{|bench|
-    measure bench
-  }
-end
-
-
-
-
diff --git a/benchmark/run.rb b/benchmark/run.rb
deleted file mode 100644
index 0cd2363849..0000000000
--- a/benchmark/run.rb
+++ /dev/null
@@ -1,127 +0,0 @@
-#
-# Ruby benchmark driver
-#
-
-require 'benchmark'
-require 'rbconfig'
-
-$matzrubyonly = false
-$rubyonly = false
-
-$results  = []
-
-# prepare 'wc.input'
-def prepare_wc_input
-  wcinput = File.join(File.dirname($0), 'wc.input')
-  wcbase  = File.join(File.dirname($0), 'wc.input.base')
-  unless FileTest.exist?(wcinput)
-    data = File.read(wcbase)
-    13.times{
-      data << data
-    }
-    open(wcinput, 'w'){|f| f.write data}
-  end
-end
-
-prepare_wc_input
-
-def bm file
-  prog = File.readlines(file).map{|e| e.rstrip}.join("\n")
-  return if prog.empty?
-
-  /[a-z]+_(.+)\.rb/ =~ file
-  bm_name = $1
-  puts '-----------------------------------------------------------' unless $rubyonly || $matzrubyonly
-  puts "#{bm_name}: "
-
-
-puts <<EOS unless $matzrubyonly || $rubyonly
-#{prog}
---
-EOS
-  begin
-    result = [bm_name]
-    result << matzruby_exec(file) unless $rubyonly
-    result << ruby_exec(file) unless $matzrubyonly
-    $results << result
-
-  rescue Exception => e
-    puts
-    puts "** benchmark failure: #{e}"
-    puts e.backtrace
-  end
-end
-
-def benchmark file, bin
-  m = Benchmark.measure{
-    `#{bin} #{$opts} #{file}`
-  }
-  sec = '%.3f' % m.real
-  puts " #{sec}"
-  sec
-end
-
-def ruby_exec file
-  print 'ruby'
-  benchmark file, $ruby_program
-end
-
-def matzruby_exec file
-  print 'matz'
-  rubylib = ENV['RUBYLIB']
-  ENV['RUBYLIB'] = ''
-  r = benchmark file, $matzruby_program
-  ENV['RUBYLIB'] = rubylib
-  r
-end
-
-if $0 == __FILE__
-  ARGV.each{|arg|
-    case arg
-    when /\A--ruby=(.+)/
-      $ruby_program = $1
-    when /\A--matzruby=(.+)/
-      $matzruby_program = $1
-    when /\A--opts=(.+)/
-      $opts = $1
-    when /\A(-r|--only-ruby)\z/
-      $rubyonly = true
-    when /\A(-m|--only-matzruby)\z/
-      $matzrubyonly = true
-    end
-  }
-  ARGV.delete_if{|arg|
-    /\A-/ =~ arg
-  }
-
-  puts "MatzRuby:"
-  system("#{$matzruby_program} -v")
-  puts "Ruby:"
-  system("#{$ruby_program} -v")
-  puts
-
-  if ARGV.empty?
-    Dir.glob(File.dirname(__FILE__) + '/bm_*.rb').sort.each{|file|
-      bm file
-    }
-  else
-    ARGV.each{|file|
-      Dir.glob(File.join(File.dirname(__FILE__), file + '*')){|ef|
-        # file = "#{File.dirname(__FILE__)}/#{file}.rb"
-        bm ef
-      }
-    }
-  end
-
-  puts
-  puts "-- benchmark summary ---------------------------"
-  $results.each{|res|
-    print res.shift, "\t"
-    (res||[]).each{|result|
-      /([\d\.]+)/ =~ result
-      print $1 + "\t" if $1
-    }
-    puts
-  }
-end
-
diff --git a/benchmark/runc.rb b/benchmark/runc.rb
deleted file mode 100644
index 97c5cef045..0000000000
--- a/benchmark/runc.rb
+++ /dev/null
@@ -1,27 +0,0 @@
-#
-#
-#
-
-require 'benchmark'
-require 'rbconfig'
-
-$rubybin = ENV['RUBY'] || RbConfig.ruby
-
-def runfile file
-  puts file
-  file = File.join(File.dirname($0), 'contrib', file)
-  Benchmark.bm{|x|
-    x.report('ruby'){
-      system("#{$rubybin} #{file}")
-    }
-    x.report('yarv'){
-      system("#{$rubybin} -rite -I.. #{file}")
-    }
-  }
-end
-
-ARGV.each{|file|
-  runfile file
-}
-
-
diff --git a/benchmark/wc.input.base b/benchmark/wc.input.base
deleted file mode 100644
index 41143fbac0..0000000000
--- a/benchmark/wc.input.base
+++ /dev/null
@@ -1,25 +0,0 @@
-Subject:      Re: Who was Izchak Miller?
-From:         "Jane D. Anonymous" <nobody@yale.edu>
-Date:         1996/04/28
-Message-Id:   <4lv7bc$oh@news.ycc.yale.edu>
-References:   <317C405E.5DFA@panix.com> <4lk6vl$gde@ns.oar.net>
-To:           75176.2330@compuserve.com
-Content-Type: text/plain; charset=us-ascii
-Organization: Yale University
-X-Url:        news:4lk6vl$gde@ns.oar.net
-Mime-Version: 1.0
-Newsgroups:   rec.games.roguelike.nethack
-X-Mailer:     Mozilla 1.1N (Macintosh; I; 68K)
-
-Hello there, Izchak Miller was my father.  When I was younger I spent 
-many a night, hunched over the keyboard with a cup of tea, playing 
-nethack with him and my brother.  my dad was a philosopher with a strong 
-weakness for fantasy/sci fi.  I remember when he started to get involved 
-with the Nethack team- my brother's Dungeons and Dragons monster book 
-found a regular place beside my dad's desk. it's nice to see him living 
-on in the game he loved so much :-).  
-                                                                  Tamar Miller
-
-The following is a really long word of 5000 characters:
-
-wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww
diff --git a/bignum.c b/bignum.c
index c780e7d7a3..cce23273a4 100644
--- a/bignum.c
+++ b/bignum.c
@@ -1,5097 +1,398 @@
-/**********************************************************************
+/************************************************
 
   bignum.c -
 
   $Author$
+  $Date$
   created at: Fri Jun 10 00:48:55 JST 1994
 
-  Copyright (C) 1993-2007 Yukihiro Matsumoto
+************************************************/
 
-**********************************************************************/
-
-#include "internal.h"
-#include "ruby/thread.h"
-#include "ruby/util.h"
-
-#ifdef HAVE_STRINGS_H
-#include <strings.h>
-#endif
-#include <math.h>
-#include <float.h>
+#include "ruby.h"
 #include <ctype.h>
-#ifdef HAVE_IEEEFP_H
-#include <ieeefp.h>
-#endif
-#include <assert.h>
-
-#if defined(HAVE_LIBGMP) && defined(HAVE_GMP_H)
-#define USE_GMP
-#include <gmp.h>
-#endif
-
-#define RB_BIGNUM_TYPE_P(x) RB_TYPE_P((x), T_BIGNUM)
-
-VALUE rb_cBignum;
-const char ruby_digitmap[] = "0123456789abcdefghijklmnopqrstuvwxyz";
-
-#ifndef SIZEOF_BDIGIT_DBL
-# if SIZEOF_INT*2 <= SIZEOF_LONG_LONG
-#  define SIZEOF_BDIGIT_DBL SIZEOF_LONG_LONG
-# else
-#  define SIZEOF_BDIGIT_DBL SIZEOF_LONG
-# endif
-#endif
-
-STATIC_ASSERT(sizeof_bdigit_dbl, sizeof(BDIGIT_DBL) == SIZEOF_BDIGIT_DBL);
-STATIC_ASSERT(sizeof_bdigit_dbl_signed, sizeof(BDIGIT_DBL_SIGNED) == SIZEOF_BDIGIT_DBL);
-STATIC_ASSERT(sizeof_bdigit, SIZEOF_BDIGIT <= sizeof(BDIGIT));
-STATIC_ASSERT(sizeof_bdigit_and_dbl, SIZEOF_BDIGIT*2 <= SIZEOF_BDIGIT_DBL);
-STATIC_ASSERT(bdigit_signedness, 0 < (BDIGIT)-1);
-STATIC_ASSERT(bdigit_dbl_signedness, 0 < (BDIGIT_DBL)-1);
-STATIC_ASSERT(bdigit_dbl_signed_signedness, 0 > (BDIGIT_DBL_SIGNED)-1);
-STATIC_ASSERT(rbignum_embed_len_max, BIGNUM_EMBED_LEN_MAX <= (BIGNUM_EMBED_LEN_MASK >> BIGNUM_EMBED_LEN_SHIFT));
-
-#if SIZEOF_BDIGIT < SIZEOF_LONG
-STATIC_ASSERT(sizeof_long_and_sizeof_bdigit, SIZEOF_LONG % SIZEOF_BDIGIT == 0);
-#else
-STATIC_ASSERT(sizeof_long_and_sizeof_bdigit, SIZEOF_BDIGIT % SIZEOF_LONG == 0);
-#endif
-
-#ifdef WORDS_BIGENDIAN
-#   define HOST_BIGENDIAN_P 1
-#else
-#   define HOST_BIGENDIAN_P 0
-#endif
-#define ALIGNOF(type) ((int)offsetof(struct { char f1; type f2; }, f2))
-/* (!LSHIFTABLE(d, n) ? 0 : (n)) is same as n but suppress a warning, C4293, by Visual Studio.  */
-#define LSHIFTABLE(d, n) ((n) < sizeof(d) * CHAR_BIT)
-#define LSHIFTX(d, n) (!LSHIFTABLE(d, n) ? 0 : ((d) << (!LSHIFTABLE(d, n) ? 0 : (n))))
-#define CLEAR_LOWBITS(d, numbits) ((d) & LSHIFTX(~((d)*0), (numbits)))
-#define FILL_LOWBITS(d, numbits) ((d) | (LSHIFTX(((d)*0+1), (numbits))-1))
-#define POW2_P(x) (((x)&((x)-1))==0)
-
-#define BDIGITS(x) (BIGNUM_DIGITS(x))
-#define BITSPERDIG (SIZEOF_BDIGIT*CHAR_BIT)
-#define BIGRAD ((BDIGIT_DBL)1 << BITSPERDIG)
-#define BIGRAD_HALF ((BDIGIT)(BIGRAD >> 1))
-#define BDIGIT_MSB(d) (((d) & BIGRAD_HALF) != 0)
-#define BIGUP(x) LSHIFTX(((x) + (BDIGIT_DBL)0), BITSPERDIG)
-#define BIGDN(x) RSHIFT((x),BITSPERDIG)
-#define BIGLO(x) ((BDIGIT)((x) & BDIGMAX))
-#define BDIGMAX ((BDIGIT)(BIGRAD-1))
-#define BDIGIT_DBL_MAX (~(BDIGIT_DBL)0)
-
-#if SIZEOF_BDIGIT == 2
-#   define swap_bdigit(x) swap16(x)
-#elif SIZEOF_BDIGIT == 4
-#   define swap_bdigit(x) swap32(x)
-#elif SIZEOF_BDIGIT == 8
-#   define swap_bdigit(x) swap64(x)
-#endif
-
-#define BIGZEROP(x) (BIGNUM_LEN(x) == 0 || \
-		     (BDIGITS(x)[0] == 0 && \
-		      (BIGNUM_LEN(x) == 1 || bigzero_p(x))))
-#define BIGSIZE(x) (BIGNUM_LEN(x) == 0 ? (size_t)0 : \
-    BDIGITS(x)[BIGNUM_LEN(x)-1] ? \
-        (size_t)(BIGNUM_LEN(x)*SIZEOF_BDIGIT - nlz(BDIGITS(x)[BIGNUM_LEN(x)-1])/CHAR_BIT) : \
-    rb_absint_size(x, NULL))
-
-#define BIGDIVREM_EXTRA_WORDS 1
-#define bdigit_roomof(n) roomof(n, SIZEOF_BDIGIT)
-#define BARY_ARGS(ary) ary, numberof(ary)
-
-#define BARY_ADD(z, x, y) bary_add(BARY_ARGS(z), BARY_ARGS(x), BARY_ARGS(y))
-#define BARY_SUB(z, x, y) bary_sub(BARY_ARGS(z), BARY_ARGS(x), BARY_ARGS(y))
-#define BARY_SHORT_MUL(z, x, y) bary_short_mul(BARY_ARGS(z), BARY_ARGS(x), BARY_ARGS(y))
-#define BARY_DIVMOD(q, r, x, y) bary_divmod(BARY_ARGS(q), BARY_ARGS(r), BARY_ARGS(x), BARY_ARGS(y))
-#define BARY_ZERO_P(x) bary_zero_p(BARY_ARGS(x))
-
-#define BIGNUM_SET_NEGATIVE_SIGN(b) BIGNUM_SET_SIGN(b, 0)
-#define BIGNUM_SET_POSITIVE_SIGN(b) BIGNUM_SET_SIGN(b, 1)
-
-#define bignew(len,sign) bignew_1(rb_cBignum,(len),(sign))
-
-#define BDIGITS_ZERO(ptr, n) do { \
-  BDIGIT *bdigitz_zero_ptr = (ptr); \
-  size_t bdigitz_zero_n = (n); \
-  while (bdigitz_zero_n) { \
-    *bdigitz_zero_ptr++ = 0; \
-    bdigitz_zero_n--; \
-  } \
-} while (0)
-
-#define BARY_TRUNC(ds, n) do { \
-        while (0 < (n) && (ds)[(n)-1] == 0) \
-            (n)--; \
-    } while (0)
-
-#define KARATSUBA_BALANCED(xn, yn) ((yn)/2 < (xn))
-#define TOOM3_BALANCED(xn, yn) (((yn)+2)/3 * 2 < (xn))
-
-#define GMP_MUL_DIGITS 20
-#define KARATSUBA_MUL_DIGITS 70
-#define TOOM3_MUL_DIGITS 150
-
-#define GMP_DIV_DIGITS 20
-#define GMP_BIG2STR_DIGITS 20
-#define GMP_STR2BIG_DIGITS 20
-
-typedef void (mulfunc_t)(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn, BDIGIT *wds, size_t wn);
-
-static mulfunc_t bary_mul_toom3_start;
-static mulfunc_t bary_mul_karatsuba_start;
-static BDIGIT bigdivrem_single(BDIGIT *qds, const BDIGIT *xds, size_t xn, BDIGIT y);
-static void bary_divmod(BDIGIT *qds, size_t qn, BDIGIT *rds, size_t rn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn);
-
-static VALUE bigmul0(VALUE x, VALUE y);
-static void bary_mul_toom3(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn, BDIGIT *wds, size_t wn);
-static VALUE bignew_1(VALUE klass, size_t len, int sign);
-static inline VALUE bigtrunc(VALUE x);
-
-static VALUE bigsq(VALUE x);
-static void bigdivmod(VALUE x, VALUE y, volatile VALUE *divp, volatile VALUE *modp);
-static inline VALUE power_cache_get_power(int base, int power_level, size_t *numdigits_ret);
-
-#if SIZEOF_BDIGIT <= SIZEOF_INT
-static int nlz(BDIGIT x) { return nlz_int((unsigned int)x) - (SIZEOF_INT-SIZEOF_BDIGIT) * CHAR_BIT; }
-#elif SIZEOF_BDIGIT <= SIZEOF_LONG
-static int nlz(BDIGIT x) { return nlz_long((unsigned long)x) - (SIZEOF_LONG-SIZEOF_BDIGIT) * CHAR_BIT; }
-#elif SIZEOF_BDIGIT <= SIZEOF_LONG_LONG
-static int nlz(BDIGIT x) { return nlz_long_long((unsigned LONG_LONG)x) - (SIZEOF_LONG_LONG-SIZEOF_BDIGIT) * CHAR_BIT; }
-#elif SIZEOF_BDIGIT <= SIZEOF_INT128_T
-static int nlz(BDIGIT x) { return nlz_int128((uint128_t)x) - (SIZEOF_INT128_T-SIZEOF_BDIGIT) * CHAR_BIT; }
-#endif
-
-#define U16(a) ((uint16_t)(a))
-#define U32(a) ((uint32_t)(a))
-#ifdef HAVE_UINT64_T
-#define U64(a,b) (((uint64_t)(a) << 32) | (b))
-#endif
-#ifdef HAVE_UINT128_T
-#define U128(a,b,c,d) (((uint128_t)U64(a,b) << 64) | U64(c,d))
-#endif
-
-/* The following script, maxpow.rb, generates the tables follows.
-
-def big(n, bits)
-  ns = []
-  ((bits+31)/32).times {
-    ns << sprintf("0x%08x", n & 0xffff_ffff)
-    n >>= 32
-  }
-  "U#{bits}(" + ns.reverse.join(",") + ")"
-end
-def values(ary, width, indent)
-  lines = [""]
-  ary.each {|e|
-    lines << "" if !ary.last.empty? && width < (lines.last + e + ", ").length
-    lines.last << e + ", "
-  }
-  lines.map {|line| " " * indent + line.chomp(" ") + "\n" }.join
-end
-[16,32,64,128].each {|bits|
-  max = 2**bits-1
-  exps = []
-  nums = []
-  2.upto(36) {|base|
-    exp = 0
-    n = 1
-    while n * base <= max
-      exp += 1
-      n *= base
-    end
-    exps << exp.to_s
-    nums << big(n, bits)
-  }
-  puts "#ifdef HAVE_UINT#{bits}_T"
-  puts "static const int maxpow#{bits}_exp[35] = {"
-  print values(exps, 70, 4)
-  puts "};"
-  puts "static const uint#{bits}_t maxpow#{bits}_num[35] = {"
-  print values(nums, 70, 4)
-  puts "};"
-  puts "#endif"
-}
-
- */
-
-#if SIZEOF_BDIGIT_DBL == 2
-static const int maxpow16_exp[35] = {
-    15, 10, 7, 6, 6, 5, 5, 5, 4, 4, 4, 4, 4, 4, 3, 3, 3, 3, 3, 3, 3, 3,
-    3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3,
-};
-static const uint16_t maxpow16_num[35] = {
-    U16(0x00008000), U16(0x0000e6a9), U16(0x00004000), U16(0x00003d09),
-    U16(0x0000b640), U16(0x000041a7), U16(0x00008000), U16(0x0000e6a9),
-    U16(0x00002710), U16(0x00003931), U16(0x00005100), U16(0x00006f91),
-    U16(0x00009610), U16(0x0000c5c1), U16(0x00001000), U16(0x00001331),
-    U16(0x000016c8), U16(0x00001acb), U16(0x00001f40), U16(0x0000242d),
-    U16(0x00002998), U16(0x00002f87), U16(0x00003600), U16(0x00003d09),
-    U16(0x000044a8), U16(0x00004ce3), U16(0x000055c0), U16(0x00005f45),
-    U16(0x00006978), U16(0x0000745f), U16(0x00008000), U16(0x00008c61),
-    U16(0x00009988), U16(0x0000a77b), U16(0x0000b640),
-};
-#elif SIZEOF_BDIGIT_DBL == 4
-static const int maxpow32_exp[35] = {
-    31, 20, 15, 13, 12, 11, 10, 10, 9, 9, 8, 8, 8, 8, 7, 7, 7, 7, 7, 7,
-    7, 7, 6, 6, 6, 6, 6, 6, 6, 6, 6, 6, 6, 6, 6,
-};
-static const uint32_t maxpow32_num[35] = {
-    U32(0x80000000), U32(0xcfd41b91), U32(0x40000000), U32(0x48c27395),
-    U32(0x81bf1000), U32(0x75db9c97), U32(0x40000000), U32(0xcfd41b91),
-    U32(0x3b9aca00), U32(0x8c8b6d2b), U32(0x19a10000), U32(0x309f1021),
-    U32(0x57f6c100), U32(0x98c29b81), U32(0x10000000), U32(0x18754571),
-    U32(0x247dbc80), U32(0x3547667b), U32(0x4c4b4000), U32(0x6b5a6e1d),
-    U32(0x94ace180), U32(0xcaf18367), U32(0x0b640000), U32(0x0e8d4a51),
-    U32(0x1269ae40), U32(0x17179149), U32(0x1cb91000), U32(0x23744899),
-    U32(0x2b73a840), U32(0x34e63b41), U32(0x40000000), U32(0x4cfa3cc1),
-    U32(0x5c13d840), U32(0x6d91b519), U32(0x81bf1000),
-};
-#elif SIZEOF_BDIGIT_DBL == 8 && defined HAVE_UINT64_T
-static const int maxpow64_exp[35] = {
-    63, 40, 31, 27, 24, 22, 21, 20, 19, 18, 17, 17, 16, 16, 15, 15, 15,
-    15, 14, 14, 14, 14, 13, 13, 13, 13, 13, 13, 13, 12, 12, 12, 12, 12,
-    12,
-};
-static const uint64_t maxpow64_num[35] = {
-    U64(0x80000000,0x00000000), U64(0xa8b8b452,0x291fe821),
-    U64(0x40000000,0x00000000), U64(0x6765c793,0xfa10079d),
-    U64(0x41c21cb8,0xe1000000), U64(0x36427987,0x50226111),
-    U64(0x80000000,0x00000000), U64(0xa8b8b452,0x291fe821),
-    U64(0x8ac72304,0x89e80000), U64(0x4d28cb56,0xc33fa539),
-    U64(0x1eca170c,0x00000000), U64(0x780c7372,0x621bd74d),
-    U64(0x1e39a505,0x7d810000), U64(0x5b27ac99,0x3df97701),
-    U64(0x10000000,0x00000000), U64(0x27b95e99,0x7e21d9f1),
-    U64(0x5da0e1e5,0x3c5c8000), U64(0xd2ae3299,0xc1c4aedb),
-    U64(0x16bcc41e,0x90000000), U64(0x2d04b7fd,0xd9c0ef49),
-    U64(0x5658597b,0xcaa24000), U64(0xa0e20737,0x37609371),
-    U64(0x0c29e980,0x00000000), U64(0x14adf4b7,0x320334b9),
-    U64(0x226ed364,0x78bfa000), U64(0x383d9170,0xb85ff80b),
-    U64(0x5a3c23e3,0x9c000000), U64(0x8e651373,0x88122bcd),
-    U64(0xdd41bb36,0xd259e000), U64(0x0aee5720,0xee830681),
-    U64(0x10000000,0x00000000), U64(0x172588ad,0x4f5f0981),
-    U64(0x211e44f7,0xd02c1000), U64(0x2ee56725,0xf06e5c71),
-    U64(0x41c21cb8,0xe1000000),
-};
-#elif SIZEOF_BDIGIT_DBL == 16 && defined HAVE_UINT128_T
-static const int maxpow128_exp[35] = {
-    127, 80, 63, 55, 49, 45, 42, 40, 38, 37, 35, 34, 33, 32, 31, 31, 30,
-    30, 29, 29, 28, 28, 27, 27, 27, 26, 26, 26, 26, 25, 25, 25, 25, 24,
-    24,
-};
-static const uint128_t maxpow128_num[35] = {
-    U128(0x80000000,0x00000000,0x00000000,0x00000000),
-    U128(0x6f32f1ef,0x8b18a2bc,0x3cea5978,0x9c79d441),
-    U128(0x40000000,0x00000000,0x00000000,0x00000000),
-    U128(0xd0cf4b50,0xcfe20765,0xfff4b4e3,0xf741cf6d),
-    U128(0x6558e2a0,0x921fe069,0x42860000,0x00000000),
-    U128(0x5080c7b7,0xd0e31ba7,0x5911a67d,0xdd3d35e7),
-    U128(0x40000000,0x00000000,0x00000000,0x00000000),
-    U128(0x6f32f1ef,0x8b18a2bc,0x3cea5978,0x9c79d441),
-    U128(0x4b3b4ca8,0x5a86c47a,0x098a2240,0x00000000),
-    U128(0xffd1390a,0x0adc2fb8,0xdabbb817,0x4d95c99b),
-    U128(0x2c6fdb36,0x4c25e6c0,0x00000000,0x00000000),
-    U128(0x384bacd6,0x42c343b4,0xe90c4272,0x13506d29),
-    U128(0x31f5db32,0xa34aced6,0x0bf13a0e,0x00000000),
-    U128(0x20753ada,0xfd1e839f,0x53686d01,0x3143ee01),
-    U128(0x10000000,0x00000000,0x00000000,0x00000000),
-    U128(0x68ca11d6,0xb4f6d1d1,0xfaa82667,0x8073c2f1),
-    U128(0x223e493b,0xb3bb69ff,0xa4b87d6c,0x40000000),
-    U128(0xad62418d,0x14ea8247,0x01c4b488,0x6cc66f59),
-    U128(0x2863c1f5,0xcdae42f9,0x54000000,0x00000000),
-    U128(0xa63fd833,0xb9386b07,0x36039e82,0xbe651b25),
-    U128(0x1d1f7a9c,0xd087a14d,0x28cdf3d5,0x10000000),
-    U128(0x651b5095,0xc2ea8fc1,0xb30e2c57,0x77aaf7e1),
-    U128(0x0ddef20e,0xff760000,0x00000000,0x00000000),
-    U128(0x29c30f10,0x29939b14,0x6664242d,0x97d9f649),
-    U128(0x786a435a,0xe9558b0e,0x6aaf6d63,0xa8000000),
-    U128(0x0c5afe6f,0xf302bcbf,0x94fd9829,0xd87f5079),
-    U128(0x1fce575c,0xe1692706,0x07100000,0x00000000),
-    U128(0x4f34497c,0x8597e144,0x36e91802,0x00528229),
-    U128(0xbf3a8e1d,0x41ef2170,0x7802130d,0x84000000),
-    U128(0x0e7819e1,0x7f1eb0fb,0x6ee4fb89,0x01d9531f),
-    U128(0x20000000,0x00000000,0x00000000,0x00000000),
-    U128(0x4510460d,0xd9e879c0,0x14a82375,0x2f22b321),
-    U128(0x91abce3c,0x4b4117ad,0xe76d35db,0x22000000),
-    U128(0x08973ea3,0x55d75bc2,0x2e42c391,0x727d69e1),
-    U128(0x10e425c5,0x6daffabc,0x35c10000,0x00000000),
-};
-#endif
-
-static BDIGIT_DBL
-maxpow_in_bdigit_dbl(int base, int *exp_ret)
-{
-    BDIGIT_DBL maxpow;
-    int exponent;
-
-    assert(2 <= base && base <= 36);
-
-    {
-#if SIZEOF_BDIGIT_DBL == 2
-        maxpow = maxpow16_num[base-2];
-        exponent = maxpow16_exp[base-2];
-#elif SIZEOF_BDIGIT_DBL == 4
-        maxpow = maxpow32_num[base-2];
-        exponent = maxpow32_exp[base-2];
-#elif SIZEOF_BDIGIT_DBL == 8 && defined HAVE_UINT64_T
-        maxpow = maxpow64_num[base-2];
-        exponent = maxpow64_exp[base-2];
-#elif SIZEOF_BDIGIT_DBL == 16 && defined HAVE_UINT128_T
-        maxpow = maxpow128_num[base-2];
-        exponent = maxpow128_exp[base-2];
-#else
-        maxpow = base;
-        exponent = 1;
-        while (maxpow <= BDIGIT_DBL_MAX / base) {
-            maxpow *= base;
-            exponent++;
-        }
-#endif
-    }
-
-    *exp_ret = exponent;
-    return maxpow;
-}
-
-static inline BDIGIT_DBL
-bary2bdigitdbl(const BDIGIT *ds, size_t n)
-{
-    assert(n <= 2);
-
-    if (n == 2)
-        return ds[0] | BIGUP(ds[1]);
-    if (n == 1)
-        return ds[0];
-    return 0;
-}
-
-static inline void
-bdigitdbl2bary(BDIGIT *ds, size_t n, BDIGIT_DBL num)
-{
-    assert(n == 2);
-
-    ds[0] = BIGLO(num);
-    ds[1] = (BDIGIT)BIGDN(num);
-}
-
-static int
-bary_cmp(const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
-{
-    BARY_TRUNC(xds, xn);
-    BARY_TRUNC(yds, yn);
-
-    if (xn < yn)
-        return -1;
-    if (xn > yn)
-        return 1;
-
-    while (xn-- && xds[xn] == yds[xn])
-        ;
-    if (xn == (size_t)-1)
-        return 0;
-    return xds[xn] < yds[xn] ? -1 : 1;
-}
-
-static BDIGIT
-bary_small_lshift(BDIGIT *zds, const BDIGIT *xds, size_t n, int shift)
-{
-    size_t i;
-    BDIGIT_DBL num = 0;
-    assert(0 <= shift && shift < BITSPERDIG);
-
-    for (i=0; i<n; i++) {
-	num = num | (BDIGIT_DBL)*xds++ << shift;
-	*zds++ = BIGLO(num);
-	num = BIGDN(num);
-    }
-    return BIGLO(num);
-}
-
-static void
-bary_small_rshift(BDIGIT *zds, const BDIGIT *xds, size_t n, int shift, BDIGIT higher_bdigit)
-{
-    BDIGIT_DBL num = 0;
-    BDIGIT x;
-
-    assert(0 <= shift && shift < BITSPERDIG);
-
-    num = BIGUP(higher_bdigit);
-    while (n--) {
-	num = (num | xds[n]) >> shift;
-        x = xds[n];
-	zds[n] = BIGLO(num);
-	num = BIGUP(x);
-    }
-}
-
-static int
-bary_zero_p(BDIGIT *xds, size_t xn)
-{
-    if (xn == 0)
-        return 1;
-    do {
-	if (xds[--xn]) return 0;
-    } while (xn);
-    return 1;
-}
-
-static void
-bary_neg(BDIGIT *ds, size_t n)
-{
-    while (n--)
-        ds[n] = BIGLO(~ds[n]);
-}
-
-static int
-bary_2comp(BDIGIT *ds, size_t n)
-{
-    size_t i;
-    i = 0;
-    for (i = 0; i < n; i++) {
-        if (ds[i] != 0) {
-            goto non_zero;
-        }
-    }
-    return 1;
-
-  non_zero:
-    ds[i] = BIGLO(~ds[i] + 1);
-    i++;
-    for (; i < n; i++) {
-        ds[i] = BIGLO(~ds[i]);
-    }
-    return 0;
-}
-
-static void
-bary_swap(BDIGIT *ds, size_t num_bdigits)
-{
-    BDIGIT *p1 = ds;
-    BDIGIT *p2 = ds + num_bdigits - 1;
-    for (; p1 < p2; p1++, p2--) {
-        BDIGIT tmp = *p1;
-        *p1 = *p2;
-        *p2 = tmp;
-    }
-}
-
-#define INTEGER_PACK_WORDORDER_MASK \
-    (INTEGER_PACK_MSWORD_FIRST | \
-     INTEGER_PACK_LSWORD_FIRST)
-#define INTEGER_PACK_BYTEORDER_MASK \
-    (INTEGER_PACK_MSBYTE_FIRST | \
-     INTEGER_PACK_LSBYTE_FIRST | \
-     INTEGER_PACK_NATIVE_BYTE_ORDER)
-
-static void
-validate_integer_pack_format(size_t numwords, size_t wordsize, size_t nails, int flags, int supported_flags)
-{
-    int wordorder_bits = flags & INTEGER_PACK_WORDORDER_MASK;
-    int byteorder_bits = flags & INTEGER_PACK_BYTEORDER_MASK;
-
-    if (flags & ~supported_flags) {
-        rb_raise(rb_eArgError, "unsupported flags specified");
-    }
-    if (wordorder_bits == 0) {
-        if (1 < numwords)
-            rb_raise(rb_eArgError, "word order not specified");
-    }
-    else if (wordorder_bits != INTEGER_PACK_MSWORD_FIRST &&
-        wordorder_bits != INTEGER_PACK_LSWORD_FIRST)
-        rb_raise(rb_eArgError, "unexpected word order");
-    if (byteorder_bits == 0) {
-        rb_raise(rb_eArgError, "byte order not specified");
-    }
-    else if (byteorder_bits != INTEGER_PACK_MSBYTE_FIRST &&
-        byteorder_bits != INTEGER_PACK_LSBYTE_FIRST &&
-        byteorder_bits != INTEGER_PACK_NATIVE_BYTE_ORDER)
-        rb_raise(rb_eArgError, "unexpected byte order");
-    if (wordsize == 0)
-        rb_raise(rb_eArgError, "invalid wordsize: %"PRI_SIZE_PREFIX"u", wordsize);
-    if (SSIZE_MAX < wordsize)
-        rb_raise(rb_eArgError, "too big wordsize: %"PRI_SIZE_PREFIX"u", wordsize);
-    if (wordsize <= nails / CHAR_BIT)
-        rb_raise(rb_eArgError, "too big nails: %"PRI_SIZE_PREFIX"u", nails);
-    if (SIZE_MAX / wordsize < numwords)
-        rb_raise(rb_eArgError, "too big numwords * wordsize: %"PRI_SIZE_PREFIX"u * %"PRI_SIZE_PREFIX"u", numwords, wordsize);
-}
-
-static void
-integer_pack_loop_setup(
-    size_t numwords, size_t wordsize, size_t nails, int flags,
-    size_t *word_num_fullbytes_ret,
-    int *word_num_partialbits_ret,
-    size_t *word_start_ret,
-    ssize_t *word_step_ret,
-    size_t *word_last_ret,
-    size_t *byte_start_ret,
-    int *byte_step_ret)
-{
-    int wordorder_bits = flags & INTEGER_PACK_WORDORDER_MASK;
-    int byteorder_bits = flags & INTEGER_PACK_BYTEORDER_MASK;
-    size_t word_num_fullbytes;
-    int word_num_partialbits;
-    size_t word_start;
-    ssize_t word_step;
-    size_t word_last;
-    size_t byte_start;
-    int byte_step;
-
-    word_num_partialbits = CHAR_BIT - (int)(nails % CHAR_BIT);
-    if (word_num_partialbits == CHAR_BIT)
-        word_num_partialbits = 0;
-    word_num_fullbytes = wordsize - (nails / CHAR_BIT);
-    if (word_num_partialbits != 0) {
-        word_num_fullbytes--;
-    }
-
-    if (wordorder_bits == INTEGER_PACK_MSWORD_FIRST) {
-        word_start = wordsize*(numwords-1);
-        word_step = -(ssize_t)wordsize;
-        word_last = 0;
-    }
-    else {
-        word_start = 0;
-        word_step = wordsize;
-        word_last = wordsize*(numwords-1);
-    }
-
-    if (byteorder_bits == INTEGER_PACK_NATIVE_BYTE_ORDER) {
-#ifdef WORDS_BIGENDIAN
-        byteorder_bits = INTEGER_PACK_MSBYTE_FIRST;
-#else
-        byteorder_bits = INTEGER_PACK_LSBYTE_FIRST;
-#endif
-    }
-    if (byteorder_bits == INTEGER_PACK_MSBYTE_FIRST) {
-        byte_start = wordsize-1;
-        byte_step = -1;
-    }
-    else {
-        byte_start = 0;
-        byte_step = 1;
-    }
-
-    *word_num_partialbits_ret = word_num_partialbits;
-    *word_num_fullbytes_ret = word_num_fullbytes;
-    *word_start_ret = word_start;
-    *word_step_ret = word_step;
-    *word_last_ret = word_last;
-    *byte_start_ret = byte_start;
-    *byte_step_ret = byte_step;
-}
-
-static inline void
-integer_pack_fill_dd(BDIGIT **dpp, BDIGIT **dep, BDIGIT_DBL *ddp, int *numbits_in_dd_p)
-{
-    if (*dpp < *dep && BITSPERDIG <= (int)sizeof(*ddp) * CHAR_BIT - *numbits_in_dd_p) {
-        *ddp |= (BDIGIT_DBL)(*(*dpp)++) << *numbits_in_dd_p;
-        *numbits_in_dd_p += BITSPERDIG;
-    }
-    else if (*dpp == *dep) {
-        /* higher bits are infinity zeros */
-        *numbits_in_dd_p = (int)sizeof(*ddp) * CHAR_BIT;
-    }
-}
-
-static inline BDIGIT_DBL
-integer_pack_take_lowbits(int n, BDIGIT_DBL *ddp, int *numbits_in_dd_p)
-{
-    BDIGIT_DBL ret;
-    ret = (*ddp) & (((BDIGIT_DBL)1 << n) - 1);
-    *ddp >>= n;
-    *numbits_in_dd_p -= n;
-    return ret;
-}
-
-#if !defined(WORDS_BIGENDIAN)
-static int
-bytes_2comp(unsigned char *buf, size_t len)
-{
-    size_t i;
-    for (i = 0; i < len; i++)
-        buf[i] = ~buf[i];
-    for (i = 0; i < len; i++) {
-        buf[i]++;
-        if (buf[i] != 0)
-            return 0;
-    }
-    return 1;
-}
-#endif
-
-static int
-bary_pack(int sign, BDIGIT *ds, size_t num_bdigits, void *words, size_t numwords, size_t wordsize, size_t nails, int flags)
-{
-    BDIGIT *dp, *de;
-    unsigned char *buf, *bufend;
-
-    dp = ds;
-    de = ds + num_bdigits;
-
-    validate_integer_pack_format(numwords, wordsize, nails, flags,
-            INTEGER_PACK_MSWORD_FIRST|
-            INTEGER_PACK_LSWORD_FIRST|
-            INTEGER_PACK_MSBYTE_FIRST|
-            INTEGER_PACK_LSBYTE_FIRST|
-            INTEGER_PACK_NATIVE_BYTE_ORDER|
-            INTEGER_PACK_2COMP|
-            INTEGER_PACK_FORCE_GENERIC_IMPLEMENTATION);
-
-    while (dp < de && de[-1] == 0)
-        de--;
-    if (dp == de) {
-        sign = 0;
-    }
-
-    if (!(flags & INTEGER_PACK_FORCE_GENERIC_IMPLEMENTATION)) {
-        if (sign == 0) {
-            MEMZERO(words, unsigned char, numwords * wordsize);
-            return 0;
-        }
-        if (nails == 0 && numwords == 1) {
-            int need_swap = wordsize != 1 &&
-                (flags & INTEGER_PACK_BYTEORDER_MASK) != INTEGER_PACK_NATIVE_BYTE_ORDER &&
-                ((flags & INTEGER_PACK_MSBYTE_FIRST) ? !HOST_BIGENDIAN_P : HOST_BIGENDIAN_P);
-            if (0 < sign || !(flags & INTEGER_PACK_2COMP)) {
-                BDIGIT d;
-                if (wordsize == 1) {
-                    *((unsigned char *)words) = (unsigned char)(d = dp[0]);
-                    return ((1 < de - dp || CLEAR_LOWBITS(d, 8) != 0) ? 2 : 1) * sign;
-                }
-#if defined(HAVE_UINT16_T) && 2 <= SIZEOF_BDIGIT
-                if (wordsize == 2 && (uintptr_t)words % ALIGNOF(uint16_t) == 0) {
-                    uint16_t u = (uint16_t)(d = dp[0]);
-                    if (need_swap) u = swap16(u);
-                    *((uint16_t *)words) = u;
-                    return ((1 < de - dp || CLEAR_LOWBITS(d, 16) != 0) ? 2 : 1) * sign;
-                }
-#endif
-#if defined(HAVE_UINT32_T) && 4 <= SIZEOF_BDIGIT
-                if (wordsize == 4 && (uintptr_t)words % ALIGNOF(uint32_t) == 0) {
-                    uint32_t u = (uint32_t)(d = dp[0]);
-                    if (need_swap) u = swap32(u);
-                    *((uint32_t *)words) = u;
-                    return ((1 < de - dp || CLEAR_LOWBITS(d, 32) != 0) ? 2 : 1) * sign;
-                }
-#endif
-#if defined(HAVE_UINT64_T) && 8 <= SIZEOF_BDIGIT
-                if (wordsize == 8 && (uintptr_t)words % ALIGNOF(uint64_t) == 0) {
-                    uint64_t u = (uint64_t)(d = dp[0]);
-                    if (need_swap) u = swap64(u);
-                    *((uint64_t *)words) = u;
-                    return ((1 < de - dp || CLEAR_LOWBITS(d, 64) != 0) ? 2 : 1) * sign;
-                }
-#endif
-            }
-            else { /* sign < 0 && (flags & INTEGER_PACK_2COMP) */
-                BDIGIT_DBL_SIGNED d;
-                if (wordsize == 1) {
-                    *((unsigned char *)words) = (unsigned char)(d = -(BDIGIT_DBL_SIGNED)dp[0]);
-                    return (1 < de - dp || FILL_LOWBITS(d, 8) != -1) ? -2 : -1;
-                }
-#if defined(HAVE_UINT16_T) && 2 <= SIZEOF_BDIGIT
-                if (wordsize == 2 && (uintptr_t)words % ALIGNOF(uint16_t) == 0) {
-                    uint16_t u = (uint16_t)(d = -(BDIGIT_DBL_SIGNED)dp[0]);
-                    if (need_swap) u = swap16(u);
-                    *((uint16_t *)words) = u;
-                    return (wordsize == SIZEOF_BDIGIT && de - dp == 2 && dp[1] == 1 && dp[0] == 0) ? -1 :
-                        (1 < de - dp || FILL_LOWBITS(d, 16) != -1) ? -2 : -1;
-                }
-#endif
-#if defined(HAVE_UINT32_T) && 4 <= SIZEOF_BDIGIT
-                if (wordsize == 4 && (uintptr_t)words % ALIGNOF(uint32_t) == 0) {
-                    uint32_t u = (uint32_t)(d = -(BDIGIT_DBL_SIGNED)dp[0]);
-                    if (need_swap) u = swap32(u);
-                    *((uint32_t *)words) = u;
-                    return (wordsize == SIZEOF_BDIGIT && de - dp == 2 && dp[1] == 1 && dp[0] == 0) ? -1 :
-                        (1 < de - dp || FILL_LOWBITS(d, 32) != -1) ? -2 : -1;
-                }
-#endif
-#if defined(HAVE_UINT64_T) && 8 <= SIZEOF_BDIGIT
-                if (wordsize == 8 && (uintptr_t)words % ALIGNOF(uint64_t) == 0) {
-                    uint64_t u = (uint64_t)(d = -(BDIGIT_DBL_SIGNED)dp[0]);
-                    if (need_swap) u = swap64(u);
-                    *((uint64_t *)words) = u;
-                    return (wordsize == SIZEOF_BDIGIT && de - dp == 2 && dp[1] == 1 && dp[0] == 0) ? -1 :
-                        (1 < de - dp || FILL_LOWBITS(d, 64) != -1) ? -2 : -1;
-                }
-#endif
-            }
-        }
-#if !defined(WORDS_BIGENDIAN)
-        if (nails == 0 && SIZEOF_BDIGIT == sizeof(BDIGIT) &&
-            (flags & INTEGER_PACK_WORDORDER_MASK) == INTEGER_PACK_LSWORD_FIRST &&
-            (flags & INTEGER_PACK_BYTEORDER_MASK) != INTEGER_PACK_MSBYTE_FIRST) {
-            size_t src_size = (de - dp) * SIZEOF_BDIGIT;
-            size_t dst_size = numwords * wordsize;
-            int overflow = 0;
-            while (0 < src_size && ((unsigned char *)ds)[src_size-1] == 0)
-                src_size--;
-            if (src_size <= dst_size) {
-                MEMCPY(words, dp, char, src_size);
-                MEMZERO((char*)words + src_size, char, dst_size - src_size);
-            }
-            else {
-                MEMCPY(words, dp, char, dst_size);
-                overflow = 1;
-            }
-            if (sign < 0 && (flags & INTEGER_PACK_2COMP)) {
-                int zero_p = bytes_2comp(words, dst_size);
-                if (zero_p && overflow) {
-                    unsigned char *p = (unsigned char *)dp;
-                    if (dst_size == src_size-1 &&
-                        p[dst_size] == 1) {
-                        overflow = 0;
-                    }
-                }
-            }
-            if (overflow)
-                sign *= 2;
-            return sign;
-        }
-#endif
-        if (nails == 0 && SIZEOF_BDIGIT == sizeof(BDIGIT) &&
-            wordsize % SIZEOF_BDIGIT == 0 && (uintptr_t)words % ALIGNOF(BDIGIT) == 0) {
-            size_t bdigits_per_word = wordsize / SIZEOF_BDIGIT;
-            size_t src_num_bdigits = de - dp;
-            size_t dst_num_bdigits = numwords * bdigits_per_word;
-            int overflow = 0;
-            int mswordfirst_p = (flags & INTEGER_PACK_MSWORD_FIRST) != 0;
-            int msbytefirst_p = (flags & INTEGER_PACK_NATIVE_BYTE_ORDER) ? HOST_BIGENDIAN_P :
-                (flags & INTEGER_PACK_MSBYTE_FIRST) != 0;
-            if (src_num_bdigits <= dst_num_bdigits) {
-                MEMCPY(words, dp, BDIGIT, src_num_bdigits);
-                BDIGITS_ZERO((BDIGIT*)words + src_num_bdigits, dst_num_bdigits - src_num_bdigits);
-            }
-            else {
-                MEMCPY(words, dp, BDIGIT, dst_num_bdigits);
-                overflow = 1;
-            }
-            if (sign < 0 && (flags & INTEGER_PACK_2COMP)) {
-                int zero_p = bary_2comp(words, dst_num_bdigits);
-                if (zero_p && overflow &&
-                    dst_num_bdigits == src_num_bdigits-1 &&
-                    dp[dst_num_bdigits] == 1)
-                    overflow = 0;
-            }
-            if (msbytefirst_p != HOST_BIGENDIAN_P) {
-                size_t i;
-                for (i = 0; i < dst_num_bdigits; i++) {
-                    BDIGIT d = ((BDIGIT*)words)[i];
-                    ((BDIGIT*)words)[i] = swap_bdigit(d);
-                }
-            }
-            if (mswordfirst_p ? !msbytefirst_p : msbytefirst_p) {
-                size_t i;
-                BDIGIT *p = words;
-                for (i = 0; i < numwords; i++) {
-                    bary_swap(p, bdigits_per_word);
-                    p += bdigits_per_word;
-                }
-            }
-            if (mswordfirst_p) {
-                bary_swap(words, dst_num_bdigits);
-            }
-            if (overflow)
-                sign *= 2;
-            return sign;
-        }
-    }
-
-    buf = words;
-    bufend = buf + numwords * wordsize;
-
-    if (buf == bufend) {
-        /* overflow if non-zero*/
-        if (!(flags & INTEGER_PACK_2COMP) || 0 <= sign)
-            sign *= 2;
-        else {
-            if (de - dp == 1 && dp[0] == 1)
-                sign = -1; /* val == -1 == -2**(numwords*(wordsize*CHAR_BIT-nails)) */
-            else
-                sign = -2; /* val < -1 == -2**(numwords*(wordsize*CHAR_BIT-nails)) */
-        }
-    }
-    else if (dp == de) {
-        memset(buf, '\0', bufend - buf);
-    }
-    else if (dp < de && buf < bufend) {
-        int word_num_partialbits;
-        size_t word_num_fullbytes;
-
-        ssize_t word_step;
-        size_t byte_start;
-        int byte_step;
-
-        size_t word_start, word_last;
-        unsigned char *wordp, *last_wordp;
-        BDIGIT_DBL dd;
-        int numbits_in_dd;
-
-        integer_pack_loop_setup(numwords, wordsize, nails, flags,
-            &word_num_fullbytes, &word_num_partialbits,
-            &word_start, &word_step, &word_last, &byte_start, &byte_step);
-
-        wordp = buf + word_start;
-        last_wordp = buf + word_last;
-
-        dd = 0;
-        numbits_in_dd = 0;
-
-#define FILL_DD \
-    integer_pack_fill_dd(&dp, &de, &dd, &numbits_in_dd)
-#define TAKE_LOWBITS(n) \
-    integer_pack_take_lowbits(n, &dd, &numbits_in_dd)
-
-        while (1) {
-            size_t index_in_word = 0;
-            unsigned char *bytep = wordp + byte_start;
-            while (index_in_word < word_num_fullbytes) {
-                FILL_DD;
-                *bytep = TAKE_LOWBITS(CHAR_BIT);
-                bytep += byte_step;
-                index_in_word++;
-            }
-            if (word_num_partialbits) {
-                FILL_DD;
-                *bytep = TAKE_LOWBITS(word_num_partialbits);
-                bytep += byte_step;
-                index_in_word++;
-            }
-            while (index_in_word < wordsize) {
-                *bytep = 0;
-                bytep += byte_step;
-                index_in_word++;
-            }
-
-            if (wordp == last_wordp)
-                break;
-
-            wordp += word_step;
-        }
-        FILL_DD;
-        /* overflow tests */
-        if (dp != de || 1 < dd) {
-            /* 2**(numwords*(wordsize*CHAR_BIT-nails)+1) <= abs(val) */
-            sign *= 2;
-        }
-        else if (dd == 1) {
-            /* 2**(numwords*(wordsize*CHAR_BIT-nails)) <= abs(val) < 2**(numwords*(wordsize*CHAR_BIT-nails)+1) */
-            if (!(flags & INTEGER_PACK_2COMP) || 0 <= sign)
-                sign *= 2;
-            else { /* overflow_2comp && sign == -1 */
-                /* test lower bits are all zero. */
-                dp = ds;
-                while (dp < de && *dp == 0)
-                    dp++;
-                if (de - dp == 1 && /* only one non-zero word. */
-                    POW2_P(*dp)) /* *dp contains only one bit set. */
-                    sign = -1; /* val == -2**(numwords*(wordsize*CHAR_BIT-nails)) */
-                else
-                    sign = -2; /* val < -2**(numwords*(wordsize*CHAR_BIT-nails)) */
-            }
-        }
-    }
-
-    if ((flags & INTEGER_PACK_2COMP) && (sign < 0 && numwords != 0)) {
-        unsigned char *buf;
-
-        int word_num_partialbits;
-        size_t word_num_fullbytes;
-
-        ssize_t word_step;
-        size_t byte_start;
-        int byte_step;
-
-        size_t word_start, word_last;
-        unsigned char *wordp, *last_wordp;
-
-        unsigned int partialbits_mask;
-        int carry;
-
-        integer_pack_loop_setup(numwords, wordsize, nails, flags,
-            &word_num_fullbytes, &word_num_partialbits,
-            &word_start, &word_step, &word_last, &byte_start, &byte_step);
-
-        partialbits_mask = (1 << word_num_partialbits) - 1;
-
-        buf = words;
-        wordp = buf + word_start;
-        last_wordp = buf + word_last;
-
-        carry = 1;
-        while (1) {
-            size_t index_in_word = 0;
-            unsigned char *bytep = wordp + byte_start;
-            while (index_in_word < word_num_fullbytes) {
-                carry += (unsigned char)~*bytep;
-                *bytep = (unsigned char)carry;
-                carry >>= CHAR_BIT;
-                bytep += byte_step;
-                index_in_word++;
-            }
-            if (word_num_partialbits) {
-                carry += (*bytep & partialbits_mask) ^ partialbits_mask;
-                *bytep = carry & partialbits_mask;
-                carry >>= word_num_partialbits;
-                bytep += byte_step;
-                index_in_word++;
-            }
-
-            if (wordp == last_wordp)
-                break;
-
-            wordp += word_step;
-        }
-    }
-
-    return sign;
-#undef FILL_DD
-#undef TAKE_LOWBITS
-}
-
-static size_t
-integer_unpack_num_bdigits_small(size_t numwords, size_t wordsize, size_t nails, int *nlp_bits_ret)
-{
-    /* nlp_bits stands for number of leading padding bits */
-    size_t num_bits = (wordsize * CHAR_BIT - nails) * numwords;
-    size_t num_bdigits = (num_bits + BITSPERDIG - 1) / BITSPERDIG;
-    *nlp_bits_ret = (int)(num_bdigits * BITSPERDIG - num_bits);
-    return num_bdigits;
-}
-
-static size_t
-integer_unpack_num_bdigits_generic(size_t numwords, size_t wordsize, size_t nails, int *nlp_bits_ret)
-{
-    /* BITSPERDIG = SIZEOF_BDIGIT * CHAR_BIT */
-    /* num_bits = (wordsize * CHAR_BIT - nails) * numwords */
-    /* num_bdigits = (num_bits + BITSPERDIG - 1) / BITSPERDIG */
-
-    /* num_bits = CHAR_BIT * (wordsize * numwords) - nails * numwords = CHAR_BIT * num_bytes1 - nails * numwords */
-    size_t num_bytes1 = wordsize * numwords;
-
-    /* q1 * CHAR_BIT + r1 = numwords */
-    size_t q1 = numwords / CHAR_BIT;
-    size_t r1 = numwords % CHAR_BIT;
-
-    /* num_bits = CHAR_BIT * num_bytes1 - nails * (q1 * CHAR_BIT + r1) = CHAR_BIT * num_bytes2 - nails * r1 */
-    size_t num_bytes2 = num_bytes1 - nails * q1;
-
-    /* q2 * CHAR_BIT + r2 = nails */
-    size_t q2 = nails / CHAR_BIT;
-    size_t r2 = nails % CHAR_BIT;
-
-    /* num_bits = CHAR_BIT * num_bytes2 - (q2 * CHAR_BIT + r2) * r1 = CHAR_BIT * num_bytes3 - r1 * r2 */
-    size_t num_bytes3 = num_bytes2 - q2 * r1;
-
-    /* q3 * BITSPERDIG + r3 = num_bytes3 */
-    size_t q3 = num_bytes3 / BITSPERDIG;
-    size_t r3 = num_bytes3 % BITSPERDIG;
-
-    /* num_bits = CHAR_BIT * (q3 * BITSPERDIG + r3) - r1 * r2 = BITSPERDIG * num_digits1 + CHAR_BIT * r3 - r1 * r2 */
-    size_t num_digits1 = CHAR_BIT * q3;
-
-    /*
-     * if CHAR_BIT * r3 >= r1 * r2
-     *   CHAR_BIT * r3 - r1 * r2 = CHAR_BIT * BITSPERDIG - (CHAR_BIT * BITSPERDIG - (CHAR_BIT * r3 - r1 * r2))
-     *   q4 * BITSPERDIG + r4 = CHAR_BIT * BITSPERDIG - (CHAR_BIT * r3 - r1 * r2)
-     *   num_bits = BITSPERDIG * num_digits1 + CHAR_BIT * BITSPERDIG - (q4 * BITSPERDIG + r4) = BITSPERDIG * num_digits2 - r4
-     * else
-     *   q4 * BITSPERDIG + r4 = -(CHAR_BIT * r3 - r1 * r2)
-     *   num_bits = BITSPERDIG * num_digits1 - (q4 * BITSPERDIG + r4) = BITSPERDIG * num_digits2 - r4
-     * end
-     */
-
-    if (CHAR_BIT * r3 >= r1 * r2) {
-        size_t tmp1 = CHAR_BIT * BITSPERDIG - (CHAR_BIT * r3 - r1 * r2);
-        size_t q4 = tmp1 / BITSPERDIG;
-        int r4 = (int)(tmp1 % BITSPERDIG);
-        size_t num_digits2 = num_digits1 + CHAR_BIT - q4;
-        *nlp_bits_ret = r4;
-        return num_digits2;
-    }
-    else {
-        size_t tmp1 = r1 * r2 - CHAR_BIT * r3;
-        size_t q4 = tmp1 / BITSPERDIG;
-        int r4 = (int)(tmp1 % BITSPERDIG);
-        size_t num_digits2 = num_digits1 - q4;
-        *nlp_bits_ret = r4;
-        return num_digits2;
-    }
-}
-
-static size_t
-integer_unpack_num_bdigits(size_t numwords, size_t wordsize, size_t nails, int *nlp_bits_ret)
-{
-    size_t num_bdigits;
-
-    if (numwords <= (SIZE_MAX - (BITSPERDIG-1)) / CHAR_BIT / wordsize) {
-        num_bdigits = integer_unpack_num_bdigits_small(numwords, wordsize, nails, nlp_bits_ret);
-#ifdef DEBUG_INTEGER_PACK
-        {
-            int nlp_bits1;
-            size_t num_bdigits1 = integer_unpack_num_bdigits_generic(numwords, wordsize, nails, &nlp_bits1);
-            assert(num_bdigits == num_bdigits1);
-            assert(*nlp_bits_ret == nlp_bits1);
-        }
-#endif
-    }
-    else {
-        num_bdigits = integer_unpack_num_bdigits_generic(numwords, wordsize, nails, nlp_bits_ret);
-    }
-    return num_bdigits;
-}
-
-static inline void
-integer_unpack_push_bits(int data, int numbits, BDIGIT_DBL *ddp, int *numbits_in_dd_p, BDIGIT **dpp)
-{
-    (*ddp) |= ((BDIGIT_DBL)data) << (*numbits_in_dd_p);
-    *numbits_in_dd_p += numbits;
-    while (BITSPERDIG <= *numbits_in_dd_p) {
-        *(*dpp)++ = BIGLO(*ddp);
-        *ddp = BIGDN(*ddp);
-        *numbits_in_dd_p -= BITSPERDIG;
-    }
-}
-
-static int
-integer_unpack_single_bdigit(BDIGIT u, size_t size, int flags, BDIGIT *dp)
-{
-    int sign;
-    if (flags & INTEGER_PACK_2COMP) {
-        sign = (flags & INTEGER_PACK_NEGATIVE) ?
-            ((size == SIZEOF_BDIGIT && u == 0) ? -2 : -1) :
-            ((u >> (size * CHAR_BIT - 1)) ? -1 : 1);
-        if (sign < 0) {
-            u |= LSHIFTX(BDIGMAX, size * CHAR_BIT);
-            u = BIGLO(1 + ~u);
-        }
-    }
-    else
-        sign = (flags & INTEGER_PACK_NEGATIVE) ? -1 : 1;
-    *dp = u;
-    return sign;
-}
-
-static int
-bary_unpack_internal(BDIGIT *bdigits, size_t num_bdigits, const void *words, size_t numwords, size_t wordsize, size_t nails, int flags, int nlp_bits)
-{
-    int sign;
-    const unsigned char *buf = words;
-    BDIGIT *dp;
-    BDIGIT *de;
-
-    dp = bdigits;
-    de = dp + num_bdigits;
-
-    if (!(flags & INTEGER_PACK_FORCE_GENERIC_IMPLEMENTATION)) {
-        if (nails == 0 && numwords == 1) {
-            int need_swap = wordsize != 1 &&
-                (flags & INTEGER_PACK_BYTEORDER_MASK) != INTEGER_PACK_NATIVE_BYTE_ORDER &&
-                ((flags & INTEGER_PACK_MSBYTE_FIRST) ? !HOST_BIGENDIAN_P : HOST_BIGENDIAN_P);
-            if (wordsize == 1) {
-                return integer_unpack_single_bdigit(*(uint8_t *)buf, sizeof(uint8_t), flags, dp);
-            }
-#if defined(HAVE_UINT16_T) && 2 <= SIZEOF_BDIGIT
-            if (wordsize == 2 && (uintptr_t)words % ALIGNOF(uint16_t) == 0) {
-                uint16_t u = *(uint16_t *)buf;
-                return integer_unpack_single_bdigit(need_swap ? swap16(u) : u, sizeof(uint16_t), flags, dp);
-            }
-#endif
-#if defined(HAVE_UINT32_T) && 4 <= SIZEOF_BDIGIT
-            if (wordsize == 4 && (uintptr_t)words % ALIGNOF(uint32_t) == 0) {
-                uint32_t u = *(uint32_t *)buf;
-                return integer_unpack_single_bdigit(need_swap ? swap32(u) : u, sizeof(uint32_t), flags, dp);
-            }
-#endif
-#if defined(HAVE_UINT64_T) && 8 <= SIZEOF_BDIGIT
-            if (wordsize == 8 && (uintptr_t)words % ALIGNOF(uint64_t) == 0) {
-                uint64_t u = *(uint64_t *)buf;
-                return integer_unpack_single_bdigit(need_swap ? swap64(u) : u, sizeof(uint64_t), flags, dp);
-            }
-#endif
-        }
-#if !defined(WORDS_BIGENDIAN)
-        if (nails == 0 && SIZEOF_BDIGIT == sizeof(BDIGIT) &&
-            (flags & INTEGER_PACK_WORDORDER_MASK) == INTEGER_PACK_LSWORD_FIRST &&
-            (flags & INTEGER_PACK_BYTEORDER_MASK) != INTEGER_PACK_MSBYTE_FIRST) {
-            size_t src_size = numwords * wordsize;
-            size_t dst_size = num_bdigits * SIZEOF_BDIGIT;
-            MEMCPY(dp, words, char, src_size);
-            if (flags & INTEGER_PACK_2COMP) {
-                if (flags & INTEGER_PACK_NEGATIVE) {
-                    int zero_p;
-                    memset((char*)dp + src_size, 0xff, dst_size - src_size);
-                    zero_p = bary_2comp(dp, num_bdigits);
-                    sign = zero_p ? -2 : -1;
-                }
-                else if (buf[src_size-1] >> (CHAR_BIT-1)) {
-                    memset((char*)dp + src_size, 0xff, dst_size - src_size);
-                    bary_2comp(dp, num_bdigits);
-                    sign = -1;
-                }
-                else {
-                    MEMZERO((char*)dp + src_size, char, dst_size - src_size);
-                    sign = 1;
-                }
-            }
-            else {
-                MEMZERO((char*)dp + src_size, char, dst_size - src_size);
-                sign = (flags & INTEGER_PACK_NEGATIVE) ? -1 : 1;
-            }
-            return sign;
-        }
-#endif
-        if (nails == 0 && SIZEOF_BDIGIT == sizeof(BDIGIT) &&
-            wordsize % SIZEOF_BDIGIT == 0) {
-            size_t bdigits_per_word = wordsize / SIZEOF_BDIGIT;
-            int mswordfirst_p = (flags & INTEGER_PACK_MSWORD_FIRST) != 0;
-            int msbytefirst_p = (flags & INTEGER_PACK_NATIVE_BYTE_ORDER) ? HOST_BIGENDIAN_P :
-                (flags & INTEGER_PACK_MSBYTE_FIRST) != 0;
-            MEMCPY(dp, words, BDIGIT, numwords*bdigits_per_word);
-            if (mswordfirst_p) {
-                bary_swap(dp, num_bdigits);
-            }
-            if (mswordfirst_p ? !msbytefirst_p : msbytefirst_p) {
-                size_t i;
-                BDIGIT *p = dp;
-                for (i = 0; i < numwords; i++) {
-                    bary_swap(p, bdigits_per_word);
-                    p += bdigits_per_word;
-                }
-            }
-            if (msbytefirst_p != HOST_BIGENDIAN_P) {
-                BDIGIT *p;
-                for (p = dp; p < de; p++) {
-                    BDIGIT d = *p;
-                    *p = swap_bdigit(d);
-                }
-            }
-            if (flags & INTEGER_PACK_2COMP) {
-                if (flags & INTEGER_PACK_NEGATIVE) {
-                    int zero_p = bary_2comp(dp, num_bdigits);
-                    sign = zero_p ? -2 : -1;
-                }
-                else if (BDIGIT_MSB(de[-1])) {
-                    bary_2comp(dp, num_bdigits);
-                    sign = -1;
-                }
-                else {
-                    sign = 1;
-                }
-            }
-            else {
-                sign = (flags & INTEGER_PACK_NEGATIVE) ? -1 : 1;
-            }
-            return sign;
-        }
-    }
-
-    if (num_bdigits != 0) {
-        int word_num_partialbits;
-        size_t word_num_fullbytes;
-
-        ssize_t word_step;
-        size_t byte_start;
-        int byte_step;
-
-        size_t word_start, word_last;
-        const unsigned char *wordp, *last_wordp;
-        BDIGIT_DBL dd;
-        int numbits_in_dd;
-
-        integer_pack_loop_setup(numwords, wordsize, nails, flags,
-            &word_num_fullbytes, &word_num_partialbits,
-            &word_start, &word_step, &word_last, &byte_start, &byte_step);
-
-        wordp = buf + word_start;
-        last_wordp = buf + word_last;
-
-        dd = 0;
-        numbits_in_dd = 0;
-
-#define PUSH_BITS(data, numbits) \
-        integer_unpack_push_bits(data, numbits, &dd, &numbits_in_dd, &dp)
-
-        while (1) {
-            size_t index_in_word = 0;
-            const unsigned char *bytep = wordp + byte_start;
-            while (index_in_word < word_num_fullbytes) {
-                PUSH_BITS(*bytep, CHAR_BIT);
-                bytep += byte_step;
-                index_in_word++;
-            }
-            if (word_num_partialbits) {
-                PUSH_BITS(*bytep & ((1 << word_num_partialbits) - 1), word_num_partialbits);
-                bytep += byte_step;
-                index_in_word++;
-            }
-
-            if (wordp == last_wordp)
-                break;
-
-            wordp += word_step;
-        }
-        if (dd)
-            *dp++ = (BDIGIT)dd;
-        assert(dp <= de);
-        while (dp < de)
-            *dp++ = 0;
-#undef PUSH_BITS
-    }
-
-    if (!(flags & INTEGER_PACK_2COMP)) {
-        sign = (flags & INTEGER_PACK_NEGATIVE) ? -1 : 1;
-    }
-    else {
-        if (nlp_bits) {
-            if ((flags & INTEGER_PACK_NEGATIVE) ||
-                (bdigits[num_bdigits-1] >> (BITSPERDIG - nlp_bits - 1))) {
-                bdigits[num_bdigits-1] |= BIGLO(BDIGMAX << (BITSPERDIG - nlp_bits));
-                sign = -1;
-            }
-            else {
-                sign = 1;
-            }
-        }
-        else {
-            if (flags & INTEGER_PACK_NEGATIVE) {
-                sign = bary_zero_p(bdigits, num_bdigits) ? -2 : -1;
-            }
-            else {
-                if (num_bdigits != 0 && BDIGIT_MSB(bdigits[num_bdigits-1]))
-                    sign = -1;
-                else
-                    sign = 1;
-            }
-        }
-        if (sign == -1 && num_bdigits != 0) {
-            bary_2comp(bdigits, num_bdigits);
-        }
-    }
-
-    return sign;
-}
-
-static void
-bary_unpack(BDIGIT *bdigits, size_t num_bdigits, const void *words, size_t numwords, size_t wordsize, size_t nails, int flags)
-{
-    size_t num_bdigits0;
-    int nlp_bits;
-    int sign;
-
-    validate_integer_pack_format(numwords, wordsize, nails, flags,
-            INTEGER_PACK_MSWORD_FIRST|
-            INTEGER_PACK_LSWORD_FIRST|
-            INTEGER_PACK_MSBYTE_FIRST|
-            INTEGER_PACK_LSBYTE_FIRST|
-            INTEGER_PACK_NATIVE_BYTE_ORDER|
-            INTEGER_PACK_2COMP|
-            INTEGER_PACK_FORCE_BIGNUM|
-            INTEGER_PACK_NEGATIVE|
-            INTEGER_PACK_FORCE_GENERIC_IMPLEMENTATION);
-
-    num_bdigits0 = integer_unpack_num_bdigits(numwords, wordsize, nails, &nlp_bits);
-
-    assert(num_bdigits0 <= num_bdigits);
-
-    sign = bary_unpack_internal(bdigits, num_bdigits0, words, numwords, wordsize, nails, flags, nlp_bits);
-
-    if (num_bdigits0 < num_bdigits) {
-        BDIGITS_ZERO(bdigits + num_bdigits0, num_bdigits - num_bdigits0);
-        if (sign == -2) {
-            bdigits[num_bdigits0] = 1;
-        }
-    }
-}
-
-static int
-bary_subb(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn, int borrow)
-{
-    BDIGIT_DBL_SIGNED num;
-    size_t i;
-    size_t sn;
-
-    assert(xn <= zn);
-    assert(yn <= zn);
-
-    sn = xn < yn ? xn : yn;
-
-    num = borrow ? -1 : 0;
-    for (i = 0; i < sn; i++) {
-	num += (BDIGIT_DBL_SIGNED)xds[i] - yds[i];
-	zds[i] = BIGLO(num);
-	num = BIGDN(num);
-    }
-    if (yn <= xn) {
-        for (; i < xn; i++) {
-            if (num == 0) goto num_is_zero;
-            num += xds[i];
-            zds[i] = BIGLO(num);
-            num = BIGDN(num);
-        }
-    }
-    else {
-        for (; i < yn; i++) {
-            num -= yds[i];
-            zds[i] = BIGLO(num);
-            num = BIGDN(num);
-        }
-    }
-    if (num == 0) goto num_is_zero;
-    for (; i < zn; i++) {
-	zds[i] = BDIGMAX;
-    }
-    return 1;
-
-  num_is_zero:
-    if (xds == zds && xn == zn)
-        return 0;
-    for (; i < xn; i++) {
-	zds[i] = xds[i];
-    }
-    for (; i < zn; i++) {
-	zds[i] = 0;
-    }
-    return 0;
-}
-
-static int
-bary_sub(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
-{
-    return bary_subb(zds, zn, xds, xn, yds, yn, 0);
-}
-
-static int
-bary_sub_one(BDIGIT *zds, size_t zn)
-{
-    return bary_subb(zds, zn, zds, zn, NULL, 0, 1);
-}
-
-static int
-bary_addc(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn, int carry)
-{
-    BDIGIT_DBL num;
-    size_t i;
-
-    assert(xn <= zn);
-    assert(yn <= zn);
-
-    if (xn > yn) {
-	const BDIGIT *tds;
-	tds = xds; xds = yds; yds = tds;
-	i = xn; xn = yn; yn = i;
-    }
-
-    num = carry ? 1 : 0;
-    for (i = 0; i < xn; i++) {
-	num += (BDIGIT_DBL)xds[i] + yds[i];
-	zds[i] = BIGLO(num);
-	num = BIGDN(num);
-    }
-    for (; i < yn; i++) {
-        if (num == 0) goto num_is_zero;
-	num += yds[i];
-	zds[i] = BIGLO(num);
-	num = BIGDN(num);
-    }
-    for (; i < zn; i++) {
-        if (num == 0) goto num_is_zero;
-	zds[i] = BIGLO(num);
-	num = BIGDN(num);
-    }
-    return num != 0;
-
-  num_is_zero:
-    if (yds == zds && yn == zn)
-        return 0;
-    for (; i < yn; i++) {
-	zds[i] = yds[i];
-    }
-    for (; i < zn; i++) {
-	zds[i] = 0;
-    }
-    return 0;
-}
-
-static int
-bary_add(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
-{
-    return bary_addc(zds, zn, xds, xn, yds, yn, 0);
-}
-
-static int
-bary_add_one(BDIGIT *ds, size_t n)
-{
-    size_t i;
-    for (i = 0; i < n; i++) {
-	ds[i] = BIGLO(ds[i]+1);
-        if (ds[i] != 0)
-            return 0;
-    }
-    return 1;
-}
-
-static void
-bary_mul_single(BDIGIT *zds, size_t zn, BDIGIT x, BDIGIT y)
-{
-    BDIGIT_DBL n;
-
-    assert(2 <= zn);
-
-    n = (BDIGIT_DBL)x * y;
-    bdigitdbl2bary(zds, 2, n);
-    BDIGITS_ZERO(zds + 2, zn - 2);
-}
-
-static int
-bary_muladd_1xN(BDIGIT *zds, size_t zn, BDIGIT x, const BDIGIT *yds, size_t yn)
-{
-    BDIGIT_DBL n;
-    BDIGIT_DBL dd;
-    size_t j;
-
-    assert(zn > yn);
-
-    if (x == 0)
-        return 0;
-    dd = x;
-    n = 0;
-    for (j = 0; j < yn; j++) {
-        BDIGIT_DBL ee = n + dd * yds[j];
-        if (ee) {
-            n = zds[j] + ee;
-            zds[j] = BIGLO(n);
-            n = BIGDN(n);
-        }
-        else {
-            n = 0;
-        }
-
-    }
-    for (; j < zn; j++) {
-        if (n == 0)
-            break;
-        n += zds[j];
-        zds[j] = BIGLO(n);
-        n = BIGDN(n);
-    }
-    return n != 0;
-}
-
-static BDIGIT_DBL_SIGNED
-bigdivrem_mulsub(BDIGIT *zds, size_t zn, BDIGIT x, const BDIGIT *yds, size_t yn)
-{
-    size_t i;
-    BDIGIT_DBL t2;
-    BDIGIT_DBL_SIGNED num;
-
-    assert(zn == yn + 1);
-
-    num = 0;
-    t2 = 0;
-    i = 0;
-
-    do {
-        BDIGIT_DBL ee;
-        t2 += (BDIGIT_DBL)yds[i] * x;
-        ee = num - BIGLO(t2);
-        num = (BDIGIT_DBL)zds[i] + ee;
-        if (ee) zds[i] = BIGLO(num);
-        num = BIGDN(num);
-        t2 = BIGDN(t2);
-    } while (++i < yn);
-    num += zds[i] - t2; /* borrow from high digit; don't update */
-    return num;
-}
-
-static int
-bary_mulsub_1xN(BDIGIT *zds, size_t zn, BDIGIT x, const BDIGIT *yds, size_t yn)
-{
-    BDIGIT_DBL_SIGNED num;
-
-    assert(zn == yn + 1);
-
-    num = bigdivrem_mulsub(zds, zn, x, yds, yn);
-    zds[yn] = BIGLO(num);
-    if (BIGDN(num))
-        return 1;
-    return 0;
-}
-
-static void
-bary_mul_normal(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
-{
-    size_t i;
-
-    assert(xn + yn <= zn);
-
-    BDIGITS_ZERO(zds, zn);
-    for (i = 0; i < xn; i++) {
-        bary_muladd_1xN(zds+i, zn-i, xds[i], yds, yn);
-    }
-}
-
-VALUE
-rb_big_mul_normal(VALUE x, VALUE y)
-{
-    size_t xn = BIGNUM_LEN(x), yn = BIGNUM_LEN(y), zn = xn + yn;
-    VALUE z = bignew(zn, BIGNUM_SIGN(x)==BIGNUM_SIGN(y));
-    bary_mul_normal(BDIGITS(z), zn, BDIGITS(x), xn, BDIGITS(y), yn);
-    RB_GC_GUARD(x);
-    RB_GC_GUARD(y);
-    return z;
-}
-
-/* efficient squaring (2 times faster than normal multiplication)
- * ref: Handbook of Applied Cryptography, Algorithm 14.16
- *      http://www.cacr.math.uwaterloo.ca/hac/about/chap14.pdf
- */
-static void
-bary_sq_fast(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn)
-{
-    size_t i, j;
-    BDIGIT_DBL c, v, w;
-    BDIGIT vl;
-    int vh;
-
-    assert(xn * 2 <= zn);
-
-    BDIGITS_ZERO(zds, zn);
-
-    if (xn == 0)
-        return;
-
-    for (i = 0; i < xn-1; i++) {
-	v = (BDIGIT_DBL)xds[i];
-	if (!v)
-            continue;
-	c = (BDIGIT_DBL)zds[i + i] + v * v;
-	zds[i + i] = BIGLO(c);
-	c = BIGDN(c);
-	v *= 2;
-        vl = BIGLO(v);
-        vh = (int)BIGDN(v);
-	for (j = i + 1; j < xn; j++) {
-	    w = (BDIGIT_DBL)xds[j];
-	    c += (BDIGIT_DBL)zds[i + j] + vl * w;
-	    zds[i + j] = BIGLO(c);
-	    c = BIGDN(c);
-	    if (vh)
-                c += w;
-	}
-	if (c) {
-	    c += (BDIGIT_DBL)zds[i + xn];
-	    zds[i + xn] = BIGLO(c);
-	    c = BIGDN(c);
-            if (c)
-                zds[i + xn + 1] += (BDIGIT)c;
-	}
-    }
-
-    /* i == xn-1 */
-    v = (BDIGIT_DBL)xds[i];
-    if (!v)
-        return;
-    c = (BDIGIT_DBL)zds[i + i] + v * v;
-    zds[i + i] = BIGLO(c);
-    c = BIGDN(c);
-    if (c) {
-        zds[i + xn] += BIGLO(c);
-    }
-}
-
-VALUE
-rb_big_sq_fast(VALUE x)
-{
-    size_t xn = BIGNUM_LEN(x), zn = 2 * xn;
-    VALUE z = bignew(zn, 1);
-    bary_sq_fast(BDIGITS(z), zn, BDIGITS(x), xn);
-    RB_GC_GUARD(x);
-    return z;
-}
-
-/* balancing multiplication by slicing larger argument */
-static void
-bary_mul_balance_with_mulfunc(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn, BDIGIT *wds, size_t wn, mulfunc_t *mulfunc)
-{
-    VALUE work = 0;
-    size_t yn0 = yn;
-    size_t r, n;
-
-    assert(xn + yn <= zn);
-    assert(xn <= yn);
-    assert(!KARATSUBA_BALANCED(xn, yn) || !TOOM3_BALANCED(xn, yn));
-
-    BDIGITS_ZERO(zds, xn);
-
-    n = 0;
-    while (yn > 0) {
-        BDIGIT *tds;
-        size_t tn;
-	r = xn > yn ? yn : xn;
-        tn = xn + r;
-        if (2 * (xn + r) <= zn - n) {
-            tds = zds + n + xn + r;
-            mulfunc(tds, tn, xds, xn, yds + n, r, wds, wn);
-            BDIGITS_ZERO(zds + n + xn, r);
-            bary_add(zds + n, tn,
-                     zds + n, tn,
-                     tds, tn);
-        }
-        else {
-            if (wn < xn) {
-                wn = xn;
-                wds = ALLOCV_N(BDIGIT, work, wn);
-            }
-            tds = zds + n;
-            MEMCPY(wds, zds + n, BDIGIT, xn);
-            mulfunc(tds, tn, xds, xn, yds + n, r, wds+xn, wn-xn);
-            bary_add(zds + n, tn,
-                     zds + n, tn,
-                     wds, xn);
-        }
-	yn -= r;
-	n += r;
-    }
-    BDIGITS_ZERO(zds+xn+yn0, zn - (xn+yn0));
+#include <math.h>
 
-    if (work)
-        ALLOCV_END(work);
-}
+extern VALUE cInteger;
+VALUE cBignum;
+typedef unsigned short USHORT;
 
-VALUE
-rb_big_mul_balance(VALUE x, VALUE y)
-{
-    size_t xn = BIGNUM_LEN(x), yn = BIGNUM_LEN(y), zn = xn + yn;
-    VALUE z = bignew(zn, BIGNUM_SIGN(x)==BIGNUM_SIGN(y));
-    bary_mul_balance_with_mulfunc(BDIGITS(z), zn, BDIGITS(x), xn, BDIGITS(y), yn, NULL, 0, bary_mul_toom3_start);
-    RB_GC_GUARD(x);
-    RB_GC_GUARD(y);
-    return z;
-}
+#define BDIGITS(x) RBIGNUM(x)->digits
+#define BITSPERDIG (sizeof(short)*CHAR_BIT)
+#define BIGRAD (1L << BITSPERDIG)
+#define DIGSPERINT ((unsigned int)(sizeof(long)/sizeof(short)))
+#define BIGUP(x) ((unsigned int)(x) << BITSPERDIG)
+#define BIGDN(x) ((x) >> BITSPERDIG)
+#define BIGLO(x) ((x) & (BIGRAD-1))
 
-/* multiplication by karatsuba method */
-static void
-bary_mul_karatsuba(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn, BDIGIT *wds, size_t wn)
+static VALUE
+bignew_1(klass, len, sign)
+    VALUE klass;
+    unsigned int len;
+    char sign;
 {
-    VALUE work = 0;
-
-    size_t n;
-    int sub_p, borrow, carry1, carry2, carry3;
-
-    int odd_y = 0;
-    int odd_xy = 0;
-    int sq;
-
-    const BDIGIT *xds0, *xds1, *yds0, *yds1;
-    BDIGIT *zds0, *zds1, *zds2, *zds3;
-
-    assert(xn + yn <= zn);
-    assert(xn <= yn);
-    assert(yn < 2 * xn);
-
-    sq = xds == yds && xn == yn;
-
-    if (yn & 1) {
-        odd_y = 1;
-        yn--;
-        if (yn < xn) {
-            odd_xy = 1;
-            xn--;
-        }
-    }
-
-    n = yn / 2;
-
-    assert(n < xn);
-
-    if (wn < n) {
-        /* This function itself needs only n BDIGITs for work area.
-         * However this function calls bary_mul_karatsuba and
-         * bary_mul_balance recursively.
-         * 2n BDIGITs are enough to avoid allocations in
-         * the recursively called functions.
-         */
-        wn = 2*n;
-        wds = ALLOCV_N(BDIGIT, work, wn);
-    }
-
-    /* Karatsuba algorithm:
-     *
-     * x = x0 + r*x1
-     * y = y0 + r*y1
-     * z = x*y
-     *   = (x0 + r*x1) * (y0 + r*y1)
-     *   = x0*y0 + r*(x1*y0 + x0*y1) + r*r*x1*y1
-     *   = x0*y0 + r*(x0*y0 + x1*y1 - (x1-x0)*(y1-y0)) + r*r*x1*y1
-     *   = x0*y0 + r*(x0*y0 + x1*y1 - (x0-x1)*(y0-y1)) + r*r*x1*y1
-     */
-
-    xds0 = xds;
-    xds1 = xds + n;
-    yds0 = yds;
-    yds1 = yds + n;
-    zds0 = zds;
-    zds1 = zds + n;
-    zds2 = zds + 2*n;
-    zds3 = zds + 3*n;
-
-    sub_p = 1;
-
-    /* zds0:? zds1:? zds2:? zds3:? wds:? */
-
-    if (bary_sub(zds0, n, xds, n, xds+n, xn-n)) {
-        bary_2comp(zds0, n);
-        sub_p = !sub_p;
-    }
-
-    /* zds0:|x1-x0| zds1:? zds2:? zds3:? wds:? */
-
-    if (sq) {
-        sub_p = 1;
-        bary_mul_karatsuba_start(zds1, 2*n, zds0, n, zds0, n, wds, wn);
-    }
-    else {
-        if (bary_sub(wds, n, yds, n, yds+n, n)) {
-            bary_2comp(wds, n);
-            sub_p = !sub_p;
-        }
-
-        /* zds0:|x1-x0| zds1:? zds2:? zds3:? wds:|y1-y0| */
-
-        bary_mul_karatsuba_start(zds1, 2*n, zds0, n, wds, n, wds+n, wn-n);
-    }
+    NEWOBJ(big, struct RBignum);
+    OBJSETUP(big, klass, T_BIGNUM);
+    big->sign = sign;
+    big->len = len;
+    BDIGITS(big) = ALLOC_N(USHORT, len);
 
-    /* zds0:|x1-x0| zds1,zds2:|x1-x0|*|y1-y0| zds3:? wds:|y1-y0| */
-
-    borrow = 0;
-    if (sub_p) {
-        borrow = !bary_2comp(zds1, 2*n);
-    }
-    /* zds0:|x1-x0| zds1,zds2:-?|x1-x0|*|y1-y0| zds3:? wds:|y1-y0| */
-
-    MEMCPY(wds, zds1, BDIGIT, n);
-
-    /* zds0:|x1-x0| zds1,zds2:-?|x1-x0|*|y1-y0| zds3:? wds:lo(-?|x1-x0|*|y1-y0|) */
-
-    bary_mul_karatsuba_start(zds0, 2*n, xds0, n, yds0, n, wds+n, wn-n);
-
-    /* zds0,zds1:x0*y0 zds2:hi(-?|x1-x0|*|y1-y0|) zds3:? wds:lo(-?|x1-x0|*|y1-y0|) */
-
-    carry1 = bary_add(wds, n, wds, n, zds0, n);
-    carry1 = bary_addc(zds2, n, zds2, n, zds1, n, carry1);
-
-    /* zds0,zds1:x0*y0 zds2:hi(x0*y0-?|x1-x0|*|y1-y0|) zds3:? wds:lo(x0*y0-?|x1-x0|*|y1-y0|) */
-
-    carry2 = bary_add(zds1, n, zds1, n, wds, n);
-
-    /* zds0:lo(x0*y0) zds1:hi(x0*y0)+lo(x0*y0-?|x1-x0|*|y1-y0|) zds2:hi(x0*y0-?|x1-x0|*|y1-y0|) zds3:? wds:lo(x0*y0-?|x1-x0|*|y1-y0|) */
-
-    MEMCPY(wds, zds2, BDIGIT, n);
-
-    /* zds0:lo(x0*y0) zds1:hi(x0*y0)+lo(x0*y0-?|x1-x0|*|y1-y0|) zds2:_ zds3:? wds:hi(x0*y0-?|x1-x0|*|y1-y0|) */
-
-    bary_mul_karatsuba_start(zds2, zn-2*n, xds1, xn-n, yds1, n, wds+n, wn-n);
-
-    /* zds0:lo(x0*y0) zds1:hi(x0*y0)+lo(x0*y0-?|x1-x0|*|y1-y0|) zds2,zds3:x1*y1 wds:hi(x0*y0-?|x1-x0|*|y1-y0|) */
-
-    carry3 = bary_add(zds1, n, zds1, n, zds2, n);
-
-    /* zds0:lo(x0*y0) zds1:hi(x0*y0)+lo(x0*y0-?|x1-x0|*|y1-y0|)+lo(x1*y1) zds2,zds3:x1*y1 wds:hi(x0*y0-?|x1-x0|*|y1-y0|) */
-
-    carry3 = bary_addc(zds2, n, zds2, n, zds3, (4*n < zn ? n : zn-3*n), carry3);
-
-    /* zds0:lo(x0*y0) zds1:hi(x0*y0)+lo(x0*y0-?|x1-x0|*|y1-y0|)+lo(x1*y1) zds2,zds3:x1*y1+hi(x1*y1) wds:hi(x0*y0-?|x1-x0|*|y1-y0|) */
-
-    bary_add(zds2, zn-2*n, zds2, zn-2*n, wds, n);
-
-    /* zds0:lo(x0*y0) zds1:hi(x0*y0)+lo(x0*y0-?|x1-x0|*|y1-y0|)+lo(x1*y1) zds2,zds3:x1*y1+hi(x1*y1)+hi(x0*y0-?|x1-x0|*|y1-y0|) wds:_ */
-
-    if (carry2)
-        bary_add_one(zds2, zn-2*n);
-
-    if (carry1 + carry3 - borrow < 0)
-        bary_sub_one(zds3, zn-3*n);
-    else if (carry1 + carry3 - borrow > 0) {
-        BDIGIT c = carry1 + carry3 - borrow;
-        bary_add(zds3, zn-3*n, zds3, zn-3*n, &c, 1);
-    }
-
-    /*
-    if (SIZEOF_BDIGIT * zn <= 16) {
-        uint128_t z, x, y;
-        ssize_t i;
-        for (x = 0, i = xn-1; 0 <= i; i--) { x <<= SIZEOF_BDIGIT*CHAR_BIT; x |= xds[i]; }
-        for (y = 0, i = yn-1; 0 <= i; i--) { y <<= SIZEOF_BDIGIT*CHAR_BIT; y |= yds[i]; }
-        for (z = 0, i = zn-1; 0 <= i; i--) { z <<= SIZEOF_BDIGIT*CHAR_BIT; z |= zds[i]; }
-        assert(z == x * y);
-    }
-    */
-
-    if (odd_xy) {
-        bary_muladd_1xN(zds+yn, zn-yn, yds[yn], xds, xn);
-        bary_muladd_1xN(zds+xn, zn-xn, xds[xn], yds, yn+1);
-    }
-    else if (odd_y) {
-        bary_muladd_1xN(zds+yn, zn-yn, yds[yn], xds, xn);
-    }
-
-    if (work)
-        ALLOCV_END(work);
-}
-
-VALUE
-rb_big_mul_karatsuba(VALUE x, VALUE y)
-{
-    size_t xn = BIGNUM_LEN(x), yn = BIGNUM_LEN(y), zn = xn + yn;
-    VALUE z = bignew(zn, BIGNUM_SIGN(x)==BIGNUM_SIGN(y));
-    if (!((xn <= yn && yn < 2) || KARATSUBA_BALANCED(xn, yn)))
-        rb_raise(rb_eArgError, "unexpected bignum length for karatsuba");
-    bary_mul_karatsuba(BDIGITS(z), zn, BDIGITS(x), xn, BDIGITS(y), yn, NULL, 0);
-    RB_GC_GUARD(x);
-    RB_GC_GUARD(y);
-    return z;
+    return (VALUE)big;
 }
 
-static void
-bary_mul_toom3(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn, BDIGIT *wds, size_t wn)
-{
-    size_t n;
-    size_t wnc;
-    VALUE work = 0;
-
-    /* "p" stands for "positive".  Actually it means "non-negative", though. */
-    size_t x0n; const BDIGIT *x0ds;
-    size_t x1n; const BDIGIT *x1ds;
-    size_t x2n; const BDIGIT *x2ds;
-    size_t y0n; const BDIGIT *y0ds;
-    size_t y1n; const BDIGIT *y1ds;
-    size_t y2n; const BDIGIT *y2ds;
-
-    size_t u1n; BDIGIT *u1ds; int u1p;
-    size_t u2n; BDIGIT *u2ds; int u2p;
-    size_t u3n; BDIGIT *u3ds; int u3p;
-
-    size_t v1n; BDIGIT *v1ds; int v1p;
-    size_t v2n; BDIGIT *v2ds; int v2p;
-    size_t v3n; BDIGIT *v3ds; int v3p;
-
-    size_t t0n; BDIGIT *t0ds; int t0p;
-    size_t t1n; BDIGIT *t1ds; int t1p;
-    size_t t2n; BDIGIT *t2ds; int t2p;
-    size_t t3n; BDIGIT *t3ds; int t3p;
-    size_t t4n; BDIGIT *t4ds; int t4p;
-
-    size_t z0n; BDIGIT *z0ds;
-    size_t z1n; BDIGIT *z1ds; int z1p;
-    size_t z2n; BDIGIT *z2ds; int z2p;
-    size_t z3n; BDIGIT *z3ds; int z3p;
-    size_t z4n; BDIGIT *z4ds;
-
-    size_t zzn; BDIGIT *zzds;
-
-    int sq = xds == yds && xn == yn;
-
-    assert(xn <= yn);  /* assume y >= x */
-    assert(xn + yn <= zn);
-
-    n = (yn + 2) / 3;
-    assert(2*n < xn);
-
-    wnc = 0;
-
-    wnc += (u1n = n+1); /* BITSPERDIG*n+2 bits */
-    wnc += (u2n = n+1); /* BITSPERDIG*n+1 bits */
-    wnc += (u3n = n+1); /* BITSPERDIG*n+3 bits */
-    wnc += (v1n = n+1); /* BITSPERDIG*n+2 bits */
-    wnc += (v2n = n+1); /* BITSPERDIG*n+1 bits */
-    wnc += (v3n = n+1); /* BITSPERDIG*n+3 bits */
-
-    wnc += (t0n = 2*n); /* BITSPERDIG*2*n bits */
-    wnc += (t1n = 2*n+2); /* BITSPERDIG*2*n+4 bits but bary_mul needs u1n+v1n */
-    wnc += (t2n = 2*n+2); /* BITSPERDIG*2*n+2 bits but bary_mul needs u2n+v2n */
-    wnc += (t3n = 2*n+2); /* BITSPERDIG*2*n+6 bits but bary_mul needs u3n+v3n */
-    wnc += (t4n = 2*n); /* BITSPERDIG*2*n bits */
-
-    wnc += (z1n = 2*n+1); /* BITSPERDIG*2*n+5 bits */
-    wnc += (z2n = 2*n+1); /* BITSPERDIG*2*n+6 bits */
-    wnc += (z3n = 2*n+1); /* BITSPERDIG*2*n+8 bits */
-
-    if (wn < wnc) {
-        wn = wnc * 3 / 2; /* Allocate working memory for whole recursion at once. */
-        wds = ALLOCV_N(BDIGIT, work, wn);
-    }
-
-    u1ds = wds; wds += u1n;
-    u2ds = wds; wds += u2n;
-    u3ds = wds; wds += u3n;
-
-    v1ds = wds; wds += v1n;
-    v2ds = wds; wds += v2n;
-    v3ds = wds; wds += v3n;
-
-    t0ds = wds; wds += t0n;
-    t1ds = wds; wds += t1n;
-    t2ds = wds; wds += t2n;
-    t3ds = wds; wds += t3n;
-    t4ds = wds; wds += t4n;
-
-    z1ds = wds; wds += z1n;
-    z2ds = wds; wds += z2n;
-    z3ds = wds; wds += z3n;
-
-    wn -= wnc;
-
-    zzds = u1ds;
-    zzn = 6*n+1;
-
-    x0n = n;
-    x1n = n;
-    x2n = xn - 2*n;
-    x0ds = xds;
-    x1ds = xds + n;
-    x2ds = xds + 2*n;
-
-    if (sq) {
-        y0n = x0n;
-        y1n = x1n;
-        y2n = x2n;
-        y0ds = x0ds;
-        y1ds = x1ds;
-        y2ds = x2ds;
-    }
-    else {
-        y0n = n;
-        y1n = n;
-        y2n = yn - 2*n;
-        y0ds = yds;
-        y1ds = yds + n;
-        y2ds = yds + 2*n;
-    }
-
-    /*
-     * ref. http://en.wikipedia.org/wiki/Toom%E2%80%93Cook_multiplication
-     *
-     * x(b) = x0 * b^0 + x1 * b^1 + x2 * b^2
-     * y(b) = y0 * b^0 + y1 * b^1 + y2 * b^2
-     *
-     * z(b) = x(b) * y(b)
-     * z(b) = z0 * b^0 + z1 * b^1 + z2 * b^2 + z3 * b^3 + z4 * b^4
-     * where:
-     *   z0 = x0 * y0
-     *   z1 = x0 * y1 + x1 * y0
-     *   z2 = x0 * y2 + x1 * y1 + x2 * y0
-     *   z3 = x1 * y2 + x2 * y1
-     *   z4 = x2 * y2
-     *
-     * Toom3 method (a.k.a. Toom-Cook method):
-     * (Step1) calculating 5 points z(b0), z(b1), z(b2), z(b3), z(b4),
-     * where:
-     *   b0 = 0, b1 = 1, b2 = -1, b3 = -2, b4 = inf,
-     *   z(0)   = x(0)   * y(0)   = x0 * y0
-     *   z(1)   = x(1)   * y(1)   = (x0 + x1 + x2) * (y0 + y1 + y2)
-     *   z(-1)  = x(-1)  * y(-1)  = (x0 - x1 + x2) * (y0 - y1 + y2)
-     *   z(-2)  = x(-2)  * y(-2)  = (x0 - 2 * (x1 - 2 * x2)) * (y0 - 2 * (y1 - 2 * y2))
-     *   z(inf) = x(inf) * y(inf) = x2 * y2
-     *
-     * (Step2) interpolating z0, z1, z2, z3 and z4.
-     *
-     * (Step3) Substituting base value into b of the polynomial z(b),
-     */
-
-    /*
-     * [Step1] calculating 5 points z(b0), z(b1), z(b2), z(b3), z(b4)
-     */
-
-    /* u1 <- x0 + x2 */
-    bary_add(u1ds, u1n, x0ds, x0n, x2ds, x2n);
-    u1p = 1;
-
-    /* x(-1) : u2 <- u1 - x1 = x0 - x1 + x2 */
-    if (bary_sub(u2ds, u2n, u1ds, u1n, x1ds, x1n)) {
-        bary_2comp(u2ds, u2n);
-        u2p = 0;
-    }
-    else {
-        u2p = 1;
-    }
-
-    /* x(1) : u1 <- u1 + x1 = x0 + x1 + x2 */
-    bary_add(u1ds, u1n, u1ds, u1n, x1ds, x1n);
-
-    /* x(-2) : u3 <- 2 * (u2 + x2) - x0 = x0 - 2 * (x1 - 2 * x2) */
-    u3p = 1;
-    if (u2p) {
-        bary_add(u3ds, u3n, u2ds, u2n, x2ds, x2n);
-    }
-    else if (bary_sub(u3ds, u3n, x2ds, x2n, u2ds, u2n)) {
-        bary_2comp(u3ds, u3n);
-        u3p = 0;
-    }
-    bary_small_lshift(u3ds, u3ds, u3n, 1);
-    if (!u3p) {
-        bary_add(u3ds, u3n, u3ds, u3n, x0ds, x0n);
-    }
-    else if (bary_sub(u3ds, u3n, u3ds, u3n, x0ds, x0n)) {
-        bary_2comp(u3ds, u3n);
-        u3p = 0;
-    }
-
-    if (sq) {
-        v1n = u1n; v1ds = u1ds; v1p = u1p;
-        v2n = u2n; v2ds = u2ds; v2p = u2p;
-        v3n = u3n; v3ds = u3ds; v3p = u3p;
-    }
-    else {
-	/* v1 <- y0 + y2 */
-        bary_add(v1ds, v1n, y0ds, y0n, y2ds, y2n);
-        v1p = 1;
-
-	/* y(-1) : v2 <- v1 - y1 = y0 - y1 + y2 */
-        v2p = 1;
-        if (bary_sub(v2ds, v2n, v1ds, v1n, y1ds, y1n)) {
-            bary_2comp(v2ds, v2n);
-            v2p = 0;
-        }
-
-	/* y(1) : v1 <- v1 + y1 = y0 + y1 + y2 */
-        bary_add(v1ds, v1n, v1ds, v1n, y1ds, y1n);
-
-	/* y(-2) : v3 <- 2 * (v2 + y2) - y0 = y0 - 2 * (y1 - 2 * y2) */
-        v3p = 1;
-        if (v2p) {
-            bary_add(v3ds, v3n, v2ds, v2n, y2ds, y2n);
-        }
-        else if (bary_sub(v3ds, v3n, y2ds, y2n, v2ds, v2n)) {
-            bary_2comp(v3ds, v3n);
-            v3p = 0;
-        }
-        bary_small_lshift(v3ds, v3ds, v3n, 1);
-        if (!v3p) {
-            bary_add(v3ds, v3n, v3ds, v3n, y0ds, y0n);
-        }
-        else if (bary_sub(v3ds, v3n, v3ds, v3n, y0ds, y0n)) {
-            bary_2comp(v3ds, v3n);
-            v3p = 0;
-        }
-    }
-
-    /* z(0) : t0 <- x0 * y0 */
-    bary_mul_toom3_start(t0ds, t0n, x0ds, x0n, y0ds, y0n, wds, wn);
-    t0p = 1;
-
-    /* z(1) : t1 <- u1 * v1 */
-    bary_mul_toom3_start(t1ds, t1n, u1ds, u1n, v1ds, v1n, wds, wn);
-    t1p = u1p == v1p;
-    assert(t1ds[t1n-1] == 0);
-    t1n--;
-
-    /* z(-1) : t2 <- u2 * v2 */
-    bary_mul_toom3_start(t2ds, t2n, u2ds, u2n, v2ds, v2n, wds, wn);
-    t2p = u2p == v2p;
-    assert(t2ds[t2n-1] == 0);
-    t2n--;
-
-    /* z(-2) : t3 <- u3 * v3 */
-    bary_mul_toom3_start(t3ds, t3n, u3ds, u3n, v3ds, v3n, wds, wn);
-    t3p = u3p == v3p;
-    assert(t3ds[t3n-1] == 0);
-    t3n--;
-
-    /* z(inf) : t4 <- x2 * y2 */
-    bary_mul_toom3_start(t4ds, t4n, x2ds, x2n, y2ds, y2n, wds, wn);
-    t4p = 1;
-
-    /*
-     * [Step2] interpolating z0, z1, z2, z3 and z4.
-     */
-
-    /* z0 <- z(0) == t0 */
-    z0n = t0n; z0ds = t0ds;
-
-    /* z4 <- z(inf) == t4 */
-    z4n = t4n; z4ds = t4ds;
-
-    /* z3 <- (z(-2) - z(1)) / 3 == (t3 - t1) / 3 */
-    if (t3p == t1p) {
-        z3p = t3p;
-        if (bary_sub(z3ds, z3n, t3ds, t3n, t1ds, t1n)) {
-            bary_2comp(z3ds, z3n);
-            z3p = !z3p;
-        }
-    }
-    else {
-        z3p = t3p;
-        bary_add(z3ds, z3n, t3ds, t3n, t1ds, t1n);
-    }
-    bigdivrem_single(z3ds, z3ds, z3n, 3);
-
-    /* z1 <- (z(1) - z(-1)) / 2 == (t1 - t2) / 2 */
-    if (t1p == t2p) {
-        z1p = t1p;
-        if (bary_sub(z1ds, z1n, t1ds, t1n, t2ds, t2n)) {
-            bary_2comp(z1ds, z1n);
-            z1p = !z1p;
-        }
-    }
-    else {
-        z1p = t1p;
-        bary_add(z1ds, z1n, t1ds, t1n, t2ds, t2n);
-    }
-    bary_small_rshift(z1ds, z1ds, z1n, 1, 0);
-
-    /* z2 <- z(-1) - z(0) == t2 - t0 */
-    if (t2p == t0p) {
-        z2p = t2p;
-        if (bary_sub(z2ds, z2n, t2ds, t2n, t0ds, t0n)) {
-            bary_2comp(z2ds, z2n);
-            z2p = !z2p;
-        }
-    }
-    else {
-        z2p = t2p;
-        bary_add(z2ds, z2n, t2ds, t2n, t0ds, t0n);
-    }
-
-    /* z3 <- (z2 - z3) / 2 + 2 * z(inf) == (z2 - z3) / 2 + 2 * t4 */
-    if (z2p == z3p) {
-        z3p = z2p;
-        if (bary_sub(z3ds, z3n, z2ds, z2n, z3ds, z3n)) {
-            bary_2comp(z3ds, z3n);
-            z3p = !z3p;
-        }
-    }
-    else {
-        z3p = z2p;
-        bary_add(z3ds, z3n, z2ds, z2n, z3ds, z3n);
-    }
-    bary_small_rshift(z3ds, z3ds, z3n, 1, 0);
-    if (z3p == t4p) {
-        bary_muladd_1xN(z3ds, z3n, 2, t4ds, t4n);
-    }
-    else {
-        if (bary_mulsub_1xN(z3ds, z3n, 2, t4ds, t4n)) {
-            bary_2comp(z3ds, z3n);
-            z3p = !z3p;
-        }
-    }
-
-    /* z2 <- z2 + z1 - z(inf) == z2 + z1 - t4 */
-    if (z2p == z1p) {
-        bary_add(z2ds, z2n, z2ds, z2n, z1ds, z1n);
-    }
-    else {
-        if (bary_sub(z2ds, z2n, z2ds, z2n, z1ds, z1n)) {
-            bary_2comp(z2ds, z2n);
-            z2p = !z2p;
-        }
-    }
-
-    if (z2p == t4p) {
-        if (bary_sub(z2ds, z2n, z2ds, z2n, t4ds, t4n)) {
-            bary_2comp(z2ds, z2n);
-            z2p = !z2p;
-        }
-    }
-    else {
-        bary_add(z2ds, z2n, z2ds, z2n, t4ds, t4n);
-    }
-
-    /* z1 <- z1 - z3 */
-    if (z1p == z3p) {
-        if (bary_sub(z1ds, z1n, z1ds, z1n, z3ds, z3n)) {
-            bary_2comp(z1ds, z1n);
-            z1p = !z1p;
-        }
-    }
-    else {
-        bary_add(z1ds, z1n, z1ds, z1n, z3ds, z3n);
-    }
-
-    /*
-     * [Step3] Substituting base value into b of the polynomial z(b),
-     */
-
-    MEMCPY(zzds, z0ds, BDIGIT, z0n);
-    BDIGITS_ZERO(zzds + z0n, 4*n - z0n);
-    MEMCPY(zzds + 4*n, z4ds, BDIGIT, z4n);
-    BDIGITS_ZERO(zzds + 4*n + z4n, zzn - (4*n + z4n));
-    if (z1p)
-        bary_add(zzds +   n, zzn -   n, zzds +   n, zzn -   n, z1ds, z1n);
-    else
-        bary_sub(zzds +   n, zzn -   n, zzds +   n, zzn -   n, z1ds, z1n);
-    if (z2p)
-        bary_add(zzds + 2*n, zzn - 2*n, zzds + 2*n, zzn - 2*n, z2ds, z2n);
-    else
-        bary_sub(zzds + 2*n, zzn - 2*n, zzds + 2*n, zzn - 2*n, z2ds, z2n);
-    if (z3p)
-        bary_add(zzds + 3*n, zzn - 3*n, zzds + 3*n, zzn - 3*n, z3ds, z3n);
-    else
-        bary_sub(zzds + 3*n, zzn - 3*n, zzds + 3*n, zzn - 3*n, z3ds, z3n);
-
-    BARY_TRUNC(zzds, zzn);
-    MEMCPY(zds, zzds, BDIGIT, zzn);
-    BDIGITS_ZERO(zds + zzn, zn - zzn);
-
-    if (work)
-        ALLOCV_END(work);
-}
+#define bignew(len,sign) bignew_1(cBignum,len,sign)
 
 VALUE
-rb_big_mul_toom3(VALUE x, VALUE y)
-{
-    size_t xn = BIGNUM_LEN(x), yn = BIGNUM_LEN(y), zn = xn + yn;
-    VALUE z = bignew(zn, BIGNUM_SIGN(x)==BIGNUM_SIGN(y));
-    if (xn > yn || yn < 3 || !TOOM3_BALANCED(xn,yn))
-        rb_raise(rb_eArgError, "unexpected bignum length for toom3");
-    bary_mul_toom3(BDIGITS(z), zn, BDIGITS(x), xn, BDIGITS(y), yn, NULL, 0);
-    RB_GC_GUARD(x);
-    RB_GC_GUARD(y);
-    return z;
-}
-
-#ifdef USE_GMP
-static void
-bary_mul_gmp(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
+big_clone(x)
+    VALUE x;
 {
-    const size_t nails = (sizeof(BDIGIT)-SIZEOF_BDIGIT)*CHAR_BIT;
-    mpz_t x, y, z;
-    size_t count;
-
-    assert(xn + yn <= zn);
-
-    mpz_init(x);
-    mpz_init(y);
-    mpz_init(z);
-    mpz_import(x, xn, -1, sizeof(BDIGIT), 0, nails, xds);
-    if (xds == yds && xn == yn) {
-        mpz_mul(z, x, x);
-    }
-    else {
-        mpz_import(y, yn, -1, sizeof(BDIGIT), 0, nails, yds);
-        mpz_mul(z, x, y);
-    }
-    mpz_export(zds, &count, -1, sizeof(BDIGIT), 0, nails, z);
-    BDIGITS_ZERO(zds+count, zn-count);
-    mpz_clear(x);
-    mpz_clear(y);
-    mpz_clear(z);
-}
+    VALUE z = bignew_1(CLASS_OF(x), RBIGNUM(x)->len, RBIGNUM(x)->sign);
 
-VALUE
-rb_big_mul_gmp(VALUE x, VALUE y)
-{
-    size_t xn = BIGNUM_LEN(x), yn = BIGNUM_LEN(y), zn = xn + yn;
-    VALUE z = bignew(zn, BIGNUM_SIGN(x)==BIGNUM_SIGN(y));
-    bary_mul_gmp(BDIGITS(z), zn, BDIGITS(x), xn, BDIGITS(y), yn);
-    RB_GC_GUARD(x);
-    RB_GC_GUARD(y);
+    MEMCPY(BDIGITS(z), BDIGITS(x), USHORT, RBIGNUM(x)->len);
     return z;
 }
-#endif
-
-static void
-bary_short_mul(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
-{
-    assert(xn + yn <= zn);
-
-    if (xn == 1 && yn == 1) {
-        bary_mul_single(zds, zn, xds[0], yds[0]);
-    }
-    else {
-        bary_mul_normal(zds, zn, xds, xn, yds, yn);
-        rb_thread_check_ints();
-    }
-}
-
-/* determine whether a bignum is sparse or not by random sampling */
-static inline int
-bary_sparse_p(const BDIGIT *ds, size_t n)
-{
-    long c = 0;
-
-    if (          ds[rb_genrand_ulong_limited(n / 2) + n / 4]) c++;
-    if (c <= 1 && ds[rb_genrand_ulong_limited(n / 2) + n / 4]) c++;
-    if (c <= 1 && ds[rb_genrand_ulong_limited(n / 2) + n / 4]) c++;
-
-    return (c <= 1) ? 1 : 0;
-}
-
-static int
-bary_mul_precheck(BDIGIT **zdsp, size_t *znp, const BDIGIT **xdsp, size_t *xnp, const BDIGIT **ydsp, size_t *ynp)
-{
-    size_t nlsz; /* number of least significant zero BDIGITs */
-
-    BDIGIT *zds = *zdsp;
-    size_t zn = *znp;
-    const BDIGIT *xds = *xdsp;
-    size_t xn = *xnp;
-    const BDIGIT *yds = *ydsp;
-    size_t yn = *ynp;
-
-    assert(xn + yn <= zn);
-
-    nlsz = 0;
-
-    while (0 < xn) {
-        if (xds[xn-1] == 0) {
-            xn--;
-        }
-        else {
-            do {
-                if (xds[0] != 0)
-                    break;
-                xds++;
-                xn--;
-                nlsz++;
-            } while (0 < xn);
-            break;
-        }
-    }
-
-    while (0 < yn) {
-        if (yds[yn-1] == 0) {
-            yn--;
-        }
-        else {
-            do {
-                if (yds[0] != 0)
-                    break;
-                yds++;
-                yn--;
-                nlsz++;
-            } while (0 < yn);
-            break;
-        }
-    }
-
-    if (nlsz) {
-        BDIGITS_ZERO(zds, nlsz);
-        zds += nlsz;
-        zn -= nlsz;
-    }
 
-    /* make sure that y is longer than x */
-    if (xn > yn) {
-        const BDIGIT *tds;
-        size_t tn;
-	tds = xds; xds = yds; yds = tds;
-	tn = xn; xn = yn; yn = tn;
-    }
-    assert(xn <= yn);
-
-    if (xn <= 1) {
-        if (xn == 0) {
-            BDIGITS_ZERO(zds, zn);
-            return 1;
-        }
-
-        if (xds[0] == 1) {
-            MEMCPY(zds, yds, BDIGIT, yn);
-            BDIGITS_ZERO(zds+yn, zn-yn);
-            return 1;
-        }
-        if (POW2_P(xds[0])) {
-            zds[yn] = bary_small_lshift(zds, yds, yn, bit_length(xds[0])-1);
-            BDIGITS_ZERO(zds+yn+1, zn-yn-1);
-            return 1;
-        }
-        if (yn == 1 && yds[0] == 1) {
-            zds[0] = xds[0];
-            BDIGITS_ZERO(zds+1, zn-1);
-            return 1;
-        }
-        bary_mul_normal(zds, zn, xds, xn, yds, yn);
-        return 1;
-    }
-
-    *zdsp = zds;
-    *znp = zn;
-    *xdsp = xds;
-    *xnp = xn;
-    *ydsp = yds;
-    *ynp = yn;
-
-    return 0;
-}
-
-static void
-bary_mul_karatsuba_branch(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn, BDIGIT *wds, size_t wn)
-{
-    /* normal multiplication when x is small */
-    if (xn < KARATSUBA_MUL_DIGITS) {
-      normal:
-        if (xds == yds && xn == yn)
-            bary_sq_fast(zds, zn, xds, xn);
-        else
-            bary_short_mul(zds, zn, xds, xn, yds, yn);
-        return;
-    }
-
-    /* normal multiplication when x or y is a sparse bignum */
-    if (bary_sparse_p(xds, xn)) goto normal;
-    if (bary_sparse_p(yds, yn)) {
-        bary_short_mul(zds, zn, yds, yn, xds, xn);
-        return;
-    }
-
-    /* balance multiplication by slicing y when x is much smaller than y */
-    if (!KARATSUBA_BALANCED(xn, yn)) {
-        bary_mul_balance_with_mulfunc(zds, zn, xds, xn, yds, yn, wds, wn, bary_mul_karatsuba_start);
-        return;
-    }
-
-    /* multiplication by karatsuba method */
-    bary_mul_karatsuba(zds, zn, xds, xn, yds, yn, wds, wn);
-}
-
-static void
-bary_mul_karatsuba_start(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn, BDIGIT *wds, size_t wn)
-{
-    if (bary_mul_precheck(&zds, &zn, &xds, &xn, &yds, &yn))
-        return;
-
-    bary_mul_karatsuba_branch(zds, zn, xds, xn, yds, yn, wds, wn);
-}
-
-static void
-bary_mul_toom3_branch(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn, BDIGIT *wds, size_t wn)
-{
-    if (xn < TOOM3_MUL_DIGITS) {
-        bary_mul_karatsuba_branch(zds, zn, xds, xn, yds, yn, wds, wn);
-        return;
-    }
-
-    if (!TOOM3_BALANCED(xn, yn)) {
-        bary_mul_balance_with_mulfunc(zds, zn, xds, xn, yds, yn, wds, wn, bary_mul_toom3_start);
-        return;
-    }
-
-    bary_mul_toom3(zds, zn, xds, xn, yds, yn, wds, wn);
-}
-
-static void
-bary_mul_toom3_start(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn, BDIGIT *wds, size_t wn)
-{
-    if (bary_mul_precheck(&zds, &zn, &xds, &xn, &yds, &yn))
-        return;
-
-    bary_mul_toom3_branch(zds, zn, xds, xn, yds, yn, wds, wn);
-}
-
-static void
-bary_mul(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
-{
-#ifdef USE_GMP
-    const size_t naive_threshold = GMP_MUL_DIGITS;
-#else
-    const size_t naive_threshold = KARATSUBA_MUL_DIGITS;
-#endif
-    if (xn <= yn) {
-        if (xn < naive_threshold) {
-            if (xds == yds && xn == yn)
-                bary_sq_fast(zds, zn, xds, xn);
-            else
-                bary_short_mul(zds, zn, xds, xn, yds, yn);
-            return;
-        }
-    }
-    else {
-        if (yn < naive_threshold) {
-            bary_short_mul(zds, zn, yds, yn, xds, xn);
-            return;
-        }
-    }
-
-#ifdef USE_GMP
-    bary_mul_gmp(zds, zn, xds, xn, yds, yn);
-#else
-    bary_mul_toom3_start(zds, zn, xds, xn, yds, yn, NULL, 0);
-#endif
-}
-
-struct big_div_struct {
-    size_t yn, zn;
-    BDIGIT *yds, *zds;
-    volatile VALUE stop;
-};
-
-static void *
-bigdivrem1(void *ptr)
+void
+big_2comp(x)			/* get 2's complement */
+    VALUE x;
 {
-    struct big_div_struct *bds = (struct big_div_struct*)ptr;
-    size_t yn = bds->yn;
-    size_t zn = bds->zn;
-    BDIGIT *yds = bds->yds, *zds = bds->zds;
-    BDIGIT_DBL_SIGNED num;
-    BDIGIT q;
+    unsigned int i = RBIGNUM(x)->len;
+    USHORT *ds = BDIGITS(x);
+    long num;
 
+    while (i--) ds[i] = ~ds[i];
+    i = 0; num = 1;
     do {
-	if (bds->stop) {
-	    bds->zn = zn;
-	    return 0;
-        }
-	if (zds[zn-1] == yds[yn-1]) q = BDIGMAX;
-	else q = (BDIGIT)((BIGUP(zds[zn-1]) + zds[zn-2])/yds[yn-1]);
-	if (q) {
-            num = bigdivrem_mulsub(zds+zn-(yn+1), yn+1,
-                                   q,
-                                   yds, yn);
-	    while (num) { /* "add back" required */
-		q--;
-                num = bary_add(zds+zn-(yn+1), yn,
-                               zds+zn-(yn+1), yn,
-                               yds, yn);
-                num--;
-	    }
-	}
-        zn--;
-	zds[zn] = q;
-    } while (zn > yn);
-    return 0;
-}
-
-static void
-rb_big_stop(void *ptr)
-{
-    struct big_div_struct *bds = ptr;
-    bds->stop = Qtrue;
-}
-
-static BDIGIT
-bigdivrem_single1(BDIGIT *qds, const BDIGIT *xds, size_t xn, BDIGIT x_higher_bdigit, BDIGIT y)
-{
-    assert(0 < xn);
-    assert(x_higher_bdigit < y);
-    if (POW2_P(y)) {
-        BDIGIT r;
-        r = xds[0] & (y-1);
-        bary_small_rshift(qds, xds, xn, bit_length(y)-1, x_higher_bdigit);
-        return r;
-    }
-    else {
-        size_t i;
-        BDIGIT_DBL t2;
-        t2 = x_higher_bdigit;
-        i = xn;
-        while (i--) {
-            t2 = BIGUP(t2) + xds[i];
-            qds[i] = (BDIGIT)(t2 / y);
-            t2 %= y;
-        }
-        return (BDIGIT)t2;
-    }
-}
-
-static BDIGIT
-bigdivrem_single(BDIGIT *qds, const BDIGIT *xds, size_t xn, BDIGIT y)
-{
-    return bigdivrem_single1(qds, xds, xn, 0, y);
-}
-
-static void
-bigdivrem_restoring(BDIGIT *zds, size_t zn, BDIGIT *yds, size_t yn)
-{
-    struct big_div_struct bds;
-    size_t ynzero;
-
-    assert(yn < zn);
-    assert(BDIGIT_MSB(yds[yn-1]));
-    assert(zds[zn-1] < yds[yn-1]);
-
-    for (ynzero = 0; !yds[ynzero]; ynzero++);
-
-    if (ynzero+1 == yn) {
-        BDIGIT r;
-        r = bigdivrem_single1(zds+yn, zds+ynzero, zn-yn, zds[zn-1], yds[ynzero]);
-        zds[ynzero] = r;
-        return;
-    }
-
-    bds.yn = yn - ynzero;
-    bds.zds = zds + ynzero;
-    bds.yds = yds + ynzero;
-    bds.stop = Qfalse;
-    bds.zn = zn - ynzero;
-    if (bds.zn > 10000 || bds.yn > 10000) {
-      retry:
-	bds.stop = Qfalse;
-	rb_thread_call_without_gvl(bigdivrem1, &bds, rb_big_stop, &bds);
-
-	if (bds.stop == Qtrue) {
-	    /* execute trap handler, but exception was not raised. */
-	    goto retry;
+	num += (long)ds[i];
+	ds[i++] = BIGLO(num);
+	num = BIGDN(num);
+    } while (i < RBIGNUM(x)->len);
+    if (ds[0] == 1 || ds[0] == 0) {
+	for (i=1;i<RBIGNUM(x)->len;i++) {
+	    if (ds[i] != 0) return;
 	}
-    }
-    else {
-	bigdivrem1(&bds);
-    }
-}
-
-static void
-bary_divmod_normal(BDIGIT *qds, size_t qn, BDIGIT *rds, size_t rn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
-{
-    int shift;
-    BDIGIT *zds, *yyds;
-    size_t zn;
-    VALUE tmpyz = 0;
-
-    assert(yn < xn || (xn == yn && yds[yn - 1] <= xds[xn - 1]));
-    assert(qds ? (xn - yn + 1) <= qn : 1);
-    assert(rds ? yn <= rn : 1);
-
-    zn = xn + BIGDIVREM_EXTRA_WORDS;
-
-    shift = nlz(yds[yn-1]);
-    if (shift) {
-        int alloc_y = !rds;
-        int alloc_z = !qds || qn < zn;
-        if (alloc_y && alloc_z) {
-            yyds = ALLOCV_N(BDIGIT, tmpyz, yn+zn);
-            zds = yyds + yn;
-        }
-        else {
-            yyds = alloc_y ? ALLOCV_N(BDIGIT, tmpyz, yn) : rds;
-            zds = alloc_z ? ALLOCV_N(BDIGIT, tmpyz, zn) : qds;
-        }
-        zds[xn] = bary_small_lshift(zds, xds, xn, shift);
-        bary_small_lshift(yyds, yds, yn, shift);
-    }
-    else {
-        if (qds && zn <= qn)
-            zds = qds;
-        else
-            zds = ALLOCV_N(BDIGIT, tmpyz, zn);
-        MEMCPY(zds, xds, BDIGIT, xn);
-        zds[xn] = 0;
-        /* bigdivrem_restoring will not modify y.
-         * So use yds directly.  */
-        yyds = (BDIGIT *)yds;
-    }
-
-    bigdivrem_restoring(zds, zn, yyds, yn);
-
-    if (rds) {
-        if (shift)
-            bary_small_rshift(rds, zds, yn, shift, 0);
-        else
-            MEMCPY(rds, zds, BDIGIT, yn);
-        BDIGITS_ZERO(rds+yn, rn-yn);
-    }
-
-    if (qds) {
-        size_t j = zn - yn;
-        MEMMOVE(qds, zds+yn, BDIGIT, j);
-        BDIGITS_ZERO(qds+j, qn-j);
-    }
-
-    if (tmpyz)
-        ALLOCV_END(tmpyz);
-}
-
-VALUE
-rb_big_divrem_normal(VALUE x, VALUE y)
-{
-    size_t xn = BIGNUM_LEN(x), yn = BIGNUM_LEN(y), qn, rn;
-    BDIGIT *xds = BDIGITS(x), *yds = BDIGITS(y), *qds, *rds;
-    VALUE q, r;
-
-    BARY_TRUNC(yds, yn);
-    if (yn == 0)
-        rb_num_zerodiv();
-    BARY_TRUNC(xds, xn);
-
-    if (xn < yn || (xn == yn && xds[xn - 1] < yds[yn - 1]))
-        return rb_assoc_new(LONG2FIX(0), x);
-
-    qn = xn + BIGDIVREM_EXTRA_WORDS;
-    q = bignew(qn, BIGNUM_SIGN(x)==BIGNUM_SIGN(y));
-    qds = BDIGITS(q);
-
-    rn = yn;
-    r = bignew(rn, BIGNUM_SIGN(x));
-    rds = BDIGITS(r);
-
-    bary_divmod_normal(qds, qn, rds, rn, xds, xn, yds, yn);
-
-    bigtrunc(q);
-    bigtrunc(r);
-
-    RB_GC_GUARD(x);
-    RB_GC_GUARD(y);
-
-    return rb_assoc_new(q, r);
-}
-
-#ifdef USE_GMP
-static void
-bary_divmod_gmp(BDIGIT *qds, size_t qn, BDIGIT *rds, size_t rn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
-{
-    const size_t nails = (sizeof(BDIGIT)-SIZEOF_BDIGIT)*CHAR_BIT;
-    mpz_t x, y, q, r;
-    size_t count;
-
-    assert(yn < xn || (xn == yn && yds[yn - 1] <= xds[xn - 1]));
-    assert(qds ? (xn - yn + 1) <= qn : 1);
-    assert(rds ? yn <= rn : 1);
-    assert(qds || rds);
-
-    mpz_init(x);
-    mpz_init(y);
-    if (qds) mpz_init(q);
-    if (rds) mpz_init(r);
-
-    mpz_import(x, xn, -1, sizeof(BDIGIT), 0, nails, xds);
-    mpz_import(y, yn, -1, sizeof(BDIGIT), 0, nails, yds);
-
-    if (!rds) {
-        mpz_fdiv_q(q, x, y);
-    }
-    else if (!qds) {
-        mpz_fdiv_r(r, x, y);
-    }
-    else {
-        mpz_fdiv_qr(q, r, x, y);
-    }
-
-    mpz_clear(x);
-    mpz_clear(y);
-
-    if (qds) {
-        mpz_export(qds, &count, -1, sizeof(BDIGIT), 0, nails, q);
-        BDIGITS_ZERO(qds+count, qn-count);
-        mpz_clear(q);
-    }
-
-    if (rds) {
-        mpz_export(rds, &count, -1, sizeof(BDIGIT), 0, nails, r);
-        BDIGITS_ZERO(rds+count, rn-count);
-        mpz_clear(r);
+	REALLOC_N(BDIGITS(x), USHORT, RBIGNUM(x)->len++);
+	ds = BDIGITS(x);
+	ds[RBIGNUM(x)->len-1] = 1;
     }
 }
 
-VALUE
-rb_big_divrem_gmp(VALUE x, VALUE y)
-{
-    size_t xn = BIGNUM_LEN(x), yn = BIGNUM_LEN(y), qn, rn;
-    BDIGIT *xds = BDIGITS(x), *yds = BDIGITS(y), *qds, *rds;
-    VALUE q, r;
-
-    BARY_TRUNC(yds, yn);
-    if (yn == 0)
-        rb_num_zerodiv();
-    BARY_TRUNC(xds, xn);
-
-    if (xn < yn || (xn == yn && xds[xn - 1] < yds[yn - 1]))
-        return rb_assoc_new(LONG2FIX(0), x);
-
-    qn = xn - yn + 1;
-    q = bignew(qn, BIGNUM_SIGN(x)==BIGNUM_SIGN(y));
-    qds = BDIGITS(q);
-
-    rn = yn;
-    r = bignew(rn, BIGNUM_SIGN(x));
-    rds = BDIGITS(r);
-
-    bary_divmod_gmp(qds, qn, rds, rn, xds, xn, yds, yn);
-
-    bigtrunc(q);
-    bigtrunc(r);
-
-    RB_GC_GUARD(x);
-    RB_GC_GUARD(y);
-
-    return rb_assoc_new(q, r);
-}
-#endif
-
-static void
-bary_divmod_branch(BDIGIT *qds, size_t qn, BDIGIT *rds, size_t rn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
-{
-#ifdef USE_GMP
-    if (GMP_DIV_DIGITS < xn) {
-        bary_divmod_gmp(qds, qn, rds, rn, xds, xn, yds, yn);
-        return;
-    }
-#endif
-    bary_divmod_normal(qds, qn, rds, rn, xds, xn, yds, yn);
-}
-
-static void
-bary_divmod(BDIGIT *qds, size_t qn, BDIGIT *rds, size_t rn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
-{
-    assert(xn <= qn);
-    assert(yn <= rn);
-
-    BARY_TRUNC(yds, yn);
-    if (yn == 0)
-        rb_num_zerodiv();
-
-    BARY_TRUNC(xds, xn);
-    if (xn == 0) {
-        BDIGITS_ZERO(qds, qn);
-        BDIGITS_ZERO(rds, rn);
-        return;
-    }
-
-    if (xn < yn || (xn == yn && xds[xn - 1] < yds[yn - 1])) {
-        MEMCPY(rds, xds, BDIGIT, xn);
-        BDIGITS_ZERO(rds+xn, rn-xn);
-        BDIGITS_ZERO(qds, qn);
-    }
-    else if (yn == 1) {
-        MEMCPY(qds, xds, BDIGIT, xn);
-        BDIGITS_ZERO(qds+xn, qn-xn);
-        rds[0] = bigdivrem_single(qds, xds, xn, yds[0]);
-        BDIGITS_ZERO(rds+1, rn-1);
-    }
-    else if (xn == 2 && yn == 2) {
-        BDIGIT_DBL x = bary2bdigitdbl(xds, 2);
-        BDIGIT_DBL y = bary2bdigitdbl(yds, 2);
-        BDIGIT_DBL q = x / y;
-        BDIGIT_DBL r = x % y;
-        qds[0] = BIGLO(q);
-        qds[1] = BIGLO(BIGDN(q));
-        BDIGITS_ZERO(qds+2, qn-2);
-        rds[0] = BIGLO(r);
-        rds[1] = BIGLO(BIGDN(r));
-        BDIGITS_ZERO(rds+2, rn-2);
-    }
-    else {
-        bary_divmod_branch(qds, qn, rds, rn, xds, xn, yds, yn);
-    }
-}
-
-
-#define BIGNUM_DEBUG 0
-#if BIGNUM_DEBUG
-#define ON_DEBUG(x) do { x; } while (0)
-static void
-dump_bignum(VALUE x)
-{
-    long i;
-    printf("%c0x0", BIGNUM_SIGN(x) ? '+' : '-');
-    for (i = BIGNUM_LEN(x); i--; ) {
-        printf("_%0*"PRIxBDIGIT, SIZEOF_BDIGIT*2, BDIGITS(x)[i]);
-    }
-    printf(", len=%"PRIuSIZE, BIGNUM_LEN(x));
-    puts("");
-}
-
 static VALUE
-rb_big_dump(VALUE x)
-{
-    dump_bignum(x);
-    return x;
-}
-#else
-#define ON_DEBUG(x)
-#endif
-
-static int
-bigzero_p(VALUE x)
+bignorm(x)
+    VALUE x;
 {
-    return bary_zero_p(BDIGITS(x), BIGNUM_LEN(x));
-}
-
-int
-rb_bigzero_p(VALUE x)
-{
-    return BIGZEROP(x);
-}
-
-int
-rb_cmpint(VALUE val, VALUE a, VALUE b)
-{
-    if (NIL_P(val)) {
-	rb_cmperr(a, b);
-    }
-    if (FIXNUM_P(val)) {
-        long l = FIX2LONG(val);
-        if (l > 0) return 1;
-        if (l < 0) return -1;
-        return 0;
-    }
-    if (RB_BIGNUM_TYPE_P(val)) {
-	if (BIGZEROP(val)) return 0;
-	if (BIGNUM_SIGN(val)) return 1;
-	return -1;
-    }
-    if (RTEST(rb_funcall(val, '>', 1, INT2FIX(0)))) return 1;
-    if (RTEST(rb_funcall(val, '<', 1, INT2FIX(0)))) return -1;
-    return 0;
-}
+    unsigned int len = RBIGNUM(x)->len;
+    USHORT *ds = BDIGITS(x);
 
-#define BIGNUM_SET_LEN(b,l) \
-    ((RBASIC(b)->flags & BIGNUM_EMBED_FLAG) ? \
-     (void)(RBASIC(b)->flags = \
-	    (RBASIC(b)->flags & ~BIGNUM_EMBED_LEN_MASK) | \
-	    ((l) << BIGNUM_EMBED_LEN_SHIFT)) : \
-     (void)(RBIGNUM(b)->as.heap.len = (l)))
+    while (len-- && !ds[len]) ;
+    RBIGNUM(x)->len = ++len;
 
-static void
-rb_big_realloc(VALUE big, size_t len)
-{
-    BDIGIT *ds;
-    if (RBASIC(big)->flags & BIGNUM_EMBED_FLAG) {
-	if (BIGNUM_EMBED_LEN_MAX < len) {
-	    ds = ALLOC_N(BDIGIT, len);
-	    MEMCPY(ds, RBIGNUM(big)->as.ary, BDIGIT, BIGNUM_EMBED_LEN_MAX);
-	    RBIGNUM(big)->as.heap.len = BIGNUM_LEN(big);
-	    RBIGNUM(big)->as.heap.digits = ds;
-	    RBASIC(big)->flags &= ~BIGNUM_EMBED_FLAG;
+    if (len*sizeof(USHORT) < sizeof(VALUE) ||
+	(len*sizeof(USHORT) == sizeof(VALUE) &&
+	 ds[sizeof(VALUE)/sizeof(USHORT)-1] <= 0x3fff)) {
+	long num = 0;
+	while (len--) {
+	    num = BIGUP(num) + ds[len];
 	}
-    }
-    else {
-	if (len <= BIGNUM_EMBED_LEN_MAX) {
-	    ds = RBIGNUM(big)->as.heap.digits;
-	    RBASIC(big)->flags |= BIGNUM_EMBED_FLAG;
-	    BIGNUM_SET_LEN(big, len);
-            (void)VALGRIND_MAKE_MEM_UNDEFINED((void*)RBIGNUM(big)->as.ary, sizeof(RBIGNUM(big)->as.ary));
-	    if (ds) {
-		MEMCPY(RBIGNUM(big)->as.ary, ds, BDIGIT, len);
-		xfree(ds);
-	    }
+	if (RBIGNUM(x)->sign) {
+	    if (POSFIXABLE(num)) return INT2FIX(num);
 	}
-	else {
-	    if (BIGNUM_LEN(big) == 0) {
-		RBIGNUM(big)->as.heap.digits = ALLOC_N(BDIGIT, len);
-	    }
-	    else {
-		REALLOC_N(RBIGNUM(big)->as.heap.digits, BDIGIT, len);
-	    }
-	}
-    }
-}
-
-void
-rb_big_resize(VALUE big, size_t len)
-{
-    rb_big_realloc(big, len);
-    BIGNUM_SET_LEN(big, len);
-}
-
-static VALUE
-bignew_1(VALUE klass, size_t len, int sign)
-{
-    NEWOBJ_OF(big, struct RBignum, klass, T_BIGNUM | (RGENGC_WB_PROTECTED_BIGNUM ? FL_WB_PROTECTED : 0));
-    BIGNUM_SET_SIGN(big, sign?1:0);
-    if (len <= BIGNUM_EMBED_LEN_MAX) {
-	RBASIC(big)->flags |= BIGNUM_EMBED_FLAG;
-	BIGNUM_SET_LEN(big, len);
-        (void)VALGRIND_MAKE_MEM_UNDEFINED((void*)RBIGNUM(big)->as.ary, sizeof(RBIGNUM(big)->as.ary));
-    }
-    else {
-	RBIGNUM(big)->as.heap.digits = ALLOC_N(BDIGIT, len);
-	RBIGNUM(big)->as.heap.len = len;
-    }
-    OBJ_FREEZE(big);
-    return (VALUE)big;
-}
-
-VALUE
-rb_big_new(size_t len, int sign)
-{
-    return bignew(len, sign != 0);
-}
-
-VALUE
-rb_big_clone(VALUE x)
-{
-    size_t len = BIGNUM_LEN(x);
-    VALUE z = bignew_1(CLASS_OF(x), len, BIGNUM_SIGN(x));
-
-    MEMCPY(BDIGITS(z), BDIGITS(x), BDIGIT, len);
-    return z;
-}
-
-static void
-big_extend_carry(VALUE x)
-{
-    rb_big_resize(x, BIGNUM_LEN(x)+1);
-    BDIGITS(x)[BIGNUM_LEN(x)-1] = 1;
-}
-
-/* modify a bignum by 2's complement */
-static void
-get2comp(VALUE x)
-{
-    long i = BIGNUM_LEN(x);
-    BDIGIT *ds = BDIGITS(x);
-
-    if (bary_2comp(ds, i)) {
-        big_extend_carry(x);
-    }
-}
-
-void
-rb_big_2comp(VALUE x)			/* get 2's complement */
-{
-    get2comp(x);
-}
-
-static BDIGIT
-abs2twocomp(VALUE *xp, long *n_ret)
-{
-    VALUE x = *xp;
-    long n = BIGNUM_LEN(x);
-    BDIGIT *ds = BDIGITS(x);
-    BDIGIT hibits = 0;
-
-    BARY_TRUNC(ds, n);
-
-    if (n != 0 && BIGNUM_NEGATIVE_P(x)) {
-        VALUE z = bignew_1(CLASS_OF(x), n, 0);
-        MEMCPY(BDIGITS(z), ds, BDIGIT, n);
-        bary_2comp(BDIGITS(z), n);
-        hibits = BDIGMAX;
-	*xp = z;
-    }
-    *n_ret = n;
-    return hibits;
-}
-
-static void
-twocomp2abs_bang(VALUE x, int hibits)
-{
-    BIGNUM_SET_SIGN(x, !hibits);
-    if (hibits) {
-        get2comp(x);
-    }
-}
-
-static inline VALUE
-bigtrunc(VALUE x)
-{
-    size_t len = BIGNUM_LEN(x);
-    BDIGIT *ds = BDIGITS(x);
-
-    if (len == 0) return x;
-    while (--len && !ds[len]);
-    if (BIGNUM_LEN(x) > len+1) {
-	rb_big_resize(x, len+1);
-    }
-    return x;
-}
-
-static inline VALUE
-bigfixize(VALUE x)
-{
-    size_t n = BIGNUM_LEN(x);
-    BDIGIT *ds = BDIGITS(x);
-#if SIZEOF_BDIGIT < SIZEOF_LONG
-    unsigned long u;
-#else
-    BDIGIT u;
-#endif
-
-    BARY_TRUNC(ds, n);
-
-    if (n == 0) return INT2FIX(0);
-
-#if SIZEOF_BDIGIT < SIZEOF_LONG
-    if (sizeof(long)/SIZEOF_BDIGIT < n)
-        goto return_big;
-    else {
-        int i = (int)n;
-        u = 0;
-        while (i--) {
-            u = (unsigned long)(BIGUP(u) + ds[i]);
-        }
-    }
-#else /* SIZEOF_BDIGIT >= SIZEOF_LONG */
-    if (1 < n)
-        goto return_big;
-    else
-        u = ds[0];
-#endif
-
-    if (BIGNUM_POSITIVE_P(x)) {
-        if (POSFIXABLE(u)) return LONG2FIX((long)u);
-    }
-    else {
-        if (u <= -FIXNUM_MIN) return LONG2FIX(-(long)u);
-    }
-
-  return_big:
-    rb_big_resize(x, n);
-    return x;
-}
-
-static VALUE
-bignorm(VALUE x)
-{
-    if (RB_BIGNUM_TYPE_P(x)) {
-	x = bigfixize(x);
+	else if (NEGFIXABLE(-num)) return INT2FIX(-num);
     }
     return x;
 }
 
 VALUE
-rb_big_norm(VALUE x)
+big_norm(x)
+    VALUE x;
 {
-    return bignorm(x);
+    return bignorm(RBIGNUM(x));
 }
 
 VALUE
-rb_uint2big(VALUE n)
+uint2big(n)
+    unsigned long n;
 {
-    long i;
-    VALUE big = bignew(bdigit_roomof(SIZEOF_VALUE), 1);
-    BDIGIT *digits = BDIGITS(big);
+    unsigned int i = 0;
+    USHORT *digits;
+    VALUE big;
 
-#if SIZEOF_BDIGIT >= SIZEOF_VALUE
-    digits[0] = n;
-#else
-    for (i = 0; i < bdigit_roomof(SIZEOF_VALUE); i++) {
-	digits[i] = BIGLO(n);
+    i = 0;
+    big = bignew(DIGSPERINT, 1);
+    digits = BDIGITS(big);
+    while (i < DIGSPERINT) {
+	digits[i++] = BIGLO(n);
 	n = BIGDN(n);
     }
-#endif
 
-    i = bdigit_roomof(SIZEOF_VALUE);
-    while (--i && !digits[i]) ;
-    BIGNUM_SET_LEN(big, i+1);
+    i = DIGSPERINT;
+    while (i-- && !digits[i]) ;
+    RBIGNUM(big)->len = i+1;
     return big;
 }
 
 VALUE
-rb_int2big(SIGNED_VALUE n)
+int2big(n)
+    long n;
 {
     long neg = 0;
-    VALUE u;
     VALUE big;
 
     if (n < 0) {
-        u = 1 + (VALUE)(-(n + 1)); /* u = -n avoiding overflow */
+	n = -n;
 	neg = 1;
     }
-    else {
-        u = n;
-    }
-    big = rb_uint2big(u);
+    big = uint2big(n);
     if (neg) {
-	BIGNUM_SET_SIGN(big, 0);
+	RBIGNUM(big)->sign = 0;
     }
     return big;
 }
 
 VALUE
-rb_uint2inum(VALUE n)
-{
-    if (POSFIXABLE(n)) return LONG2FIX(n);
-    return rb_uint2big(n);
-}
-
-VALUE
-rb_int2inum(SIGNED_VALUE n)
-{
-    if (FIXABLE(n)) return LONG2FIX(n);
-    return rb_int2big(n);
-}
-
-void
-rb_big_pack(VALUE val, unsigned long *buf, long num_longs)
-{
-    rb_integer_pack(val, buf, num_longs, sizeof(long), 0,
-            INTEGER_PACK_LSWORD_FIRST|INTEGER_PACK_NATIVE_BYTE_ORDER|
-            INTEGER_PACK_2COMP);
-}
-
-VALUE
-rb_big_unpack(unsigned long *buf, long num_longs)
-{
-    return rb_integer_unpack(buf, num_longs, sizeof(long), 0,
-            INTEGER_PACK_LSWORD_FIRST|INTEGER_PACK_NATIVE_BYTE_ORDER|
-            INTEGER_PACK_2COMP);
-}
-
-/*
- * Calculate the number of bytes to be required to represent
- * the absolute value of the integer given as _val_.
- *
- * [val] an integer.
- * [nlz_bits_ret] number of leading zero bits in the most significant byte is returned if not NULL.
- *
- * This function returns ((val_numbits * CHAR_BIT + CHAR_BIT - 1) / CHAR_BIT)
- * where val_numbits is the number of bits of abs(val).
- * This function should not overflow.
- *
- * If nlz_bits_ret is not NULL,
- * (return_value * CHAR_BIT - val_numbits) is stored in *nlz_bits_ret.
- * In this case, 0 <= *nlz_bits_ret < CHAR_BIT.
- *
- */
-size_t
-rb_absint_size(VALUE val, int *nlz_bits_ret)
-{
-    BDIGIT *dp;
-    BDIGIT *de;
-    BDIGIT fixbuf[bdigit_roomof(sizeof(long))];
-
-    int num_leading_zeros;
-
-    val = rb_to_int(val);
-
-    if (FIXNUM_P(val)) {
-        long v = FIX2LONG(val);
-        if (v < 0) {
-            v = -v;
-        }
-#if SIZEOF_BDIGIT >= SIZEOF_LONG
-        fixbuf[0] = v;
-#else
-        {
-            int i;
-            for (i = 0; i < numberof(fixbuf); i++) {
-                fixbuf[i] = BIGLO(v);
-                v = BIGDN(v);
-            }
-        }
-#endif
-        dp = fixbuf;
-        de = fixbuf + numberof(fixbuf);
-    }
-    else {
-        dp = BDIGITS(val);
-        de = dp + BIGNUM_LEN(val);
-    }
-    while (dp < de && de[-1] == 0)
-        de--;
-    if (dp == de) {
-        if (nlz_bits_ret)
-            *nlz_bits_ret = 0;
-        return 0;
-    }
-    num_leading_zeros = nlz(de[-1]);
-    if (nlz_bits_ret)
-        *nlz_bits_ret = num_leading_zeros % CHAR_BIT;
-    return (de - dp) * SIZEOF_BDIGIT - num_leading_zeros / CHAR_BIT;
-}
-
-static size_t
-absint_numwords_small(size_t numbytes, int nlz_bits_in_msbyte, size_t word_numbits, size_t *nlz_bits_ret)
-{
-    size_t val_numbits = numbytes * CHAR_BIT - nlz_bits_in_msbyte;
-    size_t div = val_numbits / word_numbits;
-    size_t mod = val_numbits % word_numbits;
-    size_t numwords;
-    size_t nlz_bits;
-    numwords = mod == 0 ? div : div + 1;
-    nlz_bits = mod == 0 ? 0 : word_numbits - mod;
-    *nlz_bits_ret = nlz_bits;
-    return numwords;
-}
-
-static size_t
-absint_numwords_generic(size_t numbytes, int nlz_bits_in_msbyte, size_t word_numbits, size_t *nlz_bits_ret)
-{
-    static const BDIGIT char_bit[1] = { CHAR_BIT };
-    BDIGIT numbytes_bary[bdigit_roomof(sizeof(numbytes))];
-    BDIGIT val_numbits_bary[bdigit_roomof(sizeof(numbytes) + 1)];
-    BDIGIT nlz_bits_in_msbyte_bary[1];
-    BDIGIT word_numbits_bary[bdigit_roomof(sizeof(word_numbits))];
-    BDIGIT div_bary[numberof(val_numbits_bary) + BIGDIVREM_EXTRA_WORDS];
-    BDIGIT mod_bary[numberof(word_numbits_bary)];
-    BDIGIT one[1] = { 1 };
-    size_t nlz_bits;
-    size_t mod;
-    int sign;
-    size_t numwords;
-
-    nlz_bits_in_msbyte_bary[0] = nlz_bits_in_msbyte;
-
-    /*
-     * val_numbits = numbytes * CHAR_BIT - nlz_bits_in_msbyte
-     * div, mod = val_numbits.divmod(word_numbits)
-     * numwords = mod == 0 ? div : div + 1
-     * nlz_bits = mod == 0 ? 0 : word_numbits - mod
-     */
-
-    bary_unpack(BARY_ARGS(numbytes_bary), &numbytes, 1, sizeof(numbytes), 0,
-        INTEGER_PACK_NATIVE_BYTE_ORDER);
-    BARY_SHORT_MUL(val_numbits_bary, numbytes_bary, char_bit);
-    if (nlz_bits_in_msbyte)
-        BARY_SUB(val_numbits_bary, val_numbits_bary, nlz_bits_in_msbyte_bary);
-    bary_unpack(BARY_ARGS(word_numbits_bary), &word_numbits, 1, sizeof(word_numbits), 0,
-        INTEGER_PACK_NATIVE_BYTE_ORDER);
-    BARY_DIVMOD(div_bary, mod_bary, val_numbits_bary, word_numbits_bary);
-    if (BARY_ZERO_P(mod_bary)) {
-        nlz_bits = 0;
-    }
-    else {
-        BARY_ADD(div_bary, div_bary, one);
-        bary_pack(+1, BARY_ARGS(mod_bary), &mod, 1, sizeof(mod), 0,
-            INTEGER_PACK_NATIVE_BYTE_ORDER);
-        nlz_bits = word_numbits - mod;
-    }
-    sign = bary_pack(+1, BARY_ARGS(div_bary), &numwords, 1, sizeof(numwords), 0,
-        INTEGER_PACK_NATIVE_BYTE_ORDER);
-
-    if (sign == 2) {
-#if defined __GNUC__ && (__GNUC__ == 4 && __GNUC_MINOR__ == 4)
-	*nlz_bits_ret = 0;
-#endif
-        return (size_t)-1;
-    }
-    *nlz_bits_ret = nlz_bits;
-    return numwords;
-}
-
-/*
- * Calculate the number of words to be required to represent
- * the absolute value of the integer given as _val_.
- *
- * [val] an integer.
- * [word_numbits] number of bits in a word.
- * [nlz_bits_ret] number of leading zero bits in the most significant word is returned if not NULL.
- *
- * This function returns ((val_numbits * CHAR_BIT + word_numbits - 1) / word_numbits)
- * where val_numbits is the number of bits of abs(val).
- *
- * This function can overflow.
- * When overflow occur, (size_t)-1 is returned.
- *
- * If nlz_bits_ret is not NULL and overflow is not occur,
- * (return_value * word_numbits - val_numbits) is stored in *nlz_bits_ret.
- * In this case, 0 <= *nlz_bits_ret < word_numbits.
- *
- */
-size_t
-rb_absint_numwords(VALUE val, size_t word_numbits, size_t *nlz_bits_ret)
+uint2inum(n)
+    unsigned long n;
 {
-    size_t numbytes;
-    int nlz_bits_in_msbyte;
-    size_t numwords;
-    size_t nlz_bits;
-
-    if (word_numbits == 0)
-        return (size_t)-1;
-
-    numbytes = rb_absint_size(val, &nlz_bits_in_msbyte);
-
-    if (numbytes <= SIZE_MAX / CHAR_BIT) {
-        numwords = absint_numwords_small(numbytes, nlz_bits_in_msbyte, word_numbits, &nlz_bits);
-#ifdef DEBUG_INTEGER_PACK
-        {
-            size_t numwords0, nlz_bits0;
-            numwords0 = absint_numwords_generic(numbytes, nlz_bits_in_msbyte, word_numbits, &nlz_bits0);
-            assert(numwords0 == numwords);
-            assert(nlz_bits0 == nlz_bits);
-        }
-#endif
-    }
-    else {
-        numwords = absint_numwords_generic(numbytes, nlz_bits_in_msbyte, word_numbits, &nlz_bits);
-    }
-    if (numwords == (size_t)-1)
-        return numwords;
-
-    if (nlz_bits_ret)
-        *nlz_bits_ret = nlz_bits;
-
-    return numwords;
-}
-
-/* Test abs(val) consists only a bit or not.
- *
- * Returns 1 if abs(val) == 1 << n for some n >= 0.
- * Returns 0 otherwise.
- *
- * rb_absint_singlebit_p can be used to determine required buffer size
- * for rb_integer_pack used with INTEGER_PACK_2COMP (two's complement).
- *
- * Following example calculates number of bits required to
- * represent val in two's complement number, without sign bit.
- *
- *   size_t size;
- *   int neg = FIXNUM_P(val) ? FIX2LONG(val) < 0 : BIGNUM_NEGATIVE_P(val);
- *   size = rb_absint_numwords(val, 1, NULL)
- *   if (size == (size_t)-1) ...overflow...
- *   if (neg && rb_absint_singlebit_p(val))
- *     size--;
- *
- * Following example calculates number of bytes required to
- * represent val in two's complement number, with sign bit.
- *
- *   size_t size;
- *   int neg = FIXNUM_P(val) ? FIX2LONG(val) < 0 : BIGNUM_NEGATIVE_P(val);
- *   int nlz_bits;
- *   size = rb_absint_size(val, &nlz_bits);
- *   if (nlz_bits == 0 && !(neg && rb_absint_singlebit_p(val)))
- *     size++;
- */
-int
-rb_absint_singlebit_p(VALUE val)
-{
-    BDIGIT *dp;
-    BDIGIT *de;
-    BDIGIT fixbuf[bdigit_roomof(sizeof(long))];
-    BDIGIT d;
-
-    val = rb_to_int(val);
-
-    if (FIXNUM_P(val)) {
-        long v = FIX2LONG(val);
-        if (v < 0) {
-            v = -v;
-        }
-#if SIZEOF_BDIGIT >= SIZEOF_LONG
-        fixbuf[0] = v;
-#else
-        {
-            int i;
-            for (i = 0; i < numberof(fixbuf); i++) {
-                fixbuf[i] = BIGLO(v);
-                v = BIGDN(v);
-            }
-        }
-#endif
-        dp = fixbuf;
-        de = fixbuf + numberof(fixbuf);
-    }
-    else {
-        dp = BDIGITS(val);
-        de = dp + BIGNUM_LEN(val);
-    }
-    while (dp < de && de[-1] == 0)
-        de--;
-    while (dp < de && dp[0] == 0)
-        dp++;
-    if (dp == de) /* no bit set. */
-        return 0;
-    if (dp != de-1) /* two non-zero words. two bits set, at least. */
-        return 0;
-    d = *dp;
-    return POW2_P(d);
+    if (POSFIXABLE(n)) return INT2FIX(n);
+    return uint2big(n);
 }
 
-
-/*
- * Export an integer into a buffer.
- *
- * This function fills the buffer specified by _words_ and _numwords_ as
- * val in the format specified by _wordsize_, _nails_ and _flags_.
- *
- * [val] Fixnum, Bignum or another integer like object which has to_int method.
- * [words] buffer to export abs(val).
- * [numwords] the size of given buffer as number of words.
- * [wordsize] the size of word as number of bytes.
- * [nails] number of padding bits in a word.
- *   Most significant nails bits of each word are filled by zero.
- * [flags] bitwise or of constants which name starts "INTEGER_PACK_".
- *
- * flags:
- * [INTEGER_PACK_MSWORD_FIRST] Store the most significant word as the first word.
- * [INTEGER_PACK_LSWORD_FIRST] Store the least significant word as the first word.
- * [INTEGER_PACK_MSBYTE_FIRST] Store the most significant byte in a word as the first byte in the word.
- * [INTEGER_PACK_LSBYTE_FIRST] Store the least significant byte in a word as the first byte in the word.
- * [INTEGER_PACK_NATIVE_BYTE_ORDER] INTEGER_PACK_MSBYTE_FIRST or INTEGER_PACK_LSBYTE_FIRST corresponding to the host's endian.
- * [INTEGER_PACK_2COMP] Use 2's complement representation.
- * [INTEGER_PACK_LITTLE_ENDIAN] Same as INTEGER_PACK_LSWORD_FIRST|INTEGER_PACK_LSBYTE_FIRST
- * [INTEGER_PACK_BIG_ENDIAN] Same as INTEGER_PACK_MSWORD_FIRST|INTEGER_PACK_MSBYTE_FIRST
- * [INTEGER_PACK_FORCE_GENERIC_IMPLEMENTATION] Use generic implementation (for test and debug).
- *
- * This function fills the buffer specified by _words_
- * as abs(val) if INTEGER_PACK_2COMP is not specified in _flags_.
- * If INTEGER_PACK_2COMP is specified, 2's complement representation of val is
- * filled in the buffer.
- *
- * This function returns the signedness and overflow condition.
- * The overflow condition depends on INTEGER_PACK_2COMP.
- *
- * INTEGER_PACK_2COMP is not specified:
- *   -2 : negative overflow.  val <= -2**(numwords*(wordsize*CHAR_BIT-nails))
- *   -1 : negative without overflow.  -2**(numwords*(wordsize*CHAR_BIT-nails)) < val < 0
- *   0 : zero.  val == 0
- *   1 : positive without overflow.  0 < val < 2**(numwords*(wordsize*CHAR_BIT-nails))
- *   2 : positive overflow.  2**(numwords*(wordsize*CHAR_BIT-nails)) <= val
- *
- * INTEGER_PACK_2COMP is specified:
- *   -2 : negative overflow.  val < -2**(numwords*(wordsize*CHAR_BIT-nails))
- *   -1 : negative without overflow.  -2**(numwords*(wordsize*CHAR_BIT-nails)) <= val < 0
- *   0 : zero.  val == 0
- *   1 : positive without overflow.  0 < val < 2**(numwords*(wordsize*CHAR_BIT-nails))
- *   2 : positive overflow.  2**(numwords*(wordsize*CHAR_BIT-nails)) <= val
- *
- * The value, -2**(numwords*(wordsize*CHAR_BIT-nails)), is representable
- * in 2's complement representation but not representable in absolute value.
- * So -1 is returned for the value if INTEGER_PACK_2COMP is specified
- * but returns -2 if INTEGER_PACK_2COMP is not specified.
- *
- * The least significant words are filled in the buffer when overflow occur.
- */
-
-int
-rb_integer_pack(VALUE val, void *words, size_t numwords, size_t wordsize, size_t nails, int flags)
-{
-    int sign;
-    BDIGIT *ds;
-    size_t num_bdigits;
-    BDIGIT fixbuf[bdigit_roomof(sizeof(long))];
-
-    RB_GC_GUARD(val) = rb_to_int(val);
-
-    if (FIXNUM_P(val)) {
-        long v = FIX2LONG(val);
-        if (v < 0) {
-            sign = -1;
-            v = -v;
-        }
-        else {
-            sign = 1;
-        }
-#if SIZEOF_BDIGIT >= SIZEOF_LONG
-        fixbuf[0] = v;
-#else
-        {
-            int i;
-            for (i = 0; i < numberof(fixbuf); i++) {
-                fixbuf[i] = BIGLO(v);
-                v = BIGDN(v);
-            }
-        }
-#endif
-        ds = fixbuf;
-        num_bdigits = numberof(fixbuf);
-    }
-    else {
-        sign = BIGNUM_POSITIVE_P(val) ? 1 : -1;
-        ds = BDIGITS(val);
-        num_bdigits = BIGNUM_LEN(val);
-    }
-
-    return bary_pack(sign, ds, num_bdigits, words, numwords, wordsize, nails, flags);
-}
-
-/*
- * Import an integer into a buffer.
- *
- * [words] buffer to import.
- * [numwords] the size of given buffer as number of words.
- * [wordsize] the size of word as number of bytes.
- * [nails] number of padding bits in a word.
- *   Most significant nails bits of each word are ignored.
- * [flags] bitwise or of constants which name starts "INTEGER_PACK_".
- *
- * flags:
- * [INTEGER_PACK_MSWORD_FIRST] Interpret the first word as the most significant word.
- * [INTEGER_PACK_LSWORD_FIRST] Interpret the first word as the least significant word.
- * [INTEGER_PACK_MSBYTE_FIRST] Interpret the first byte in a word as the most significant byte in the word.
- * [INTEGER_PACK_LSBYTE_FIRST] Interpret the first byte in a word as the least significant byte in the word.
- * [INTEGER_PACK_NATIVE_BYTE_ORDER] INTEGER_PACK_MSBYTE_FIRST or INTEGER_PACK_LSBYTE_FIRST corresponding to the host's endian.
- * [INTEGER_PACK_2COMP] Use 2's complement representation.
- * [INTEGER_PACK_LITTLE_ENDIAN] Same as INTEGER_PACK_LSWORD_FIRST|INTEGER_PACK_LSBYTE_FIRST
- * [INTEGER_PACK_BIG_ENDIAN] Same as INTEGER_PACK_MSWORD_FIRST|INTEGER_PACK_MSBYTE_FIRST
- * [INTEGER_PACK_FORCE_BIGNUM] the result will be a Bignum
- *   even if it is representable as a Fixnum.
- * [INTEGER_PACK_NEGATIVE] Returns non-positive value.
- *   (Returns non-negative value if not specified.)
- * [INTEGER_PACK_FORCE_GENERIC_IMPLEMENTATION] Use generic implementation (for test and debug).
- *
- * This function returns the imported integer as Fixnum or Bignum.
- *
- * The range of the result value depends on INTEGER_PACK_2COMP and INTEGER_PACK_NEGATIVE.
- *
- * INTEGER_PACK_2COMP is not set:
- *   0 <= val < 2**(numwords*(wordsize*CHAR_BIT-nails)) if !INTEGER_PACK_NEGATIVE
- *   -2**(numwords*(wordsize*CHAR_BIT-nails)) < val <= 0 if INTEGER_PACK_NEGATIVE
- *
- * INTEGER_PACK_2COMP is set:
- *   -2**(numwords*(wordsize*CHAR_BIT-nails)-1) <= val <= 2**(numwords*(wordsize*CHAR_BIT-nails)-1)-1 if !INTEGER_PACK_NEGATIVE
- *   -2**(numwords*(wordsize*CHAR_BIT-nails)) <= val <= -1 if INTEGER_PACK_NEGATIVE
- *
- * INTEGER_PACK_2COMP without INTEGER_PACK_NEGATIVE means sign extension.
- * INTEGER_PACK_2COMP with INTEGER_PACK_NEGATIVE mean assuming the higher bits are 1.
- *
- * Note that this function returns 0 when numwords is zero and
- * INTEGER_PACK_2COMP is set but INTEGER_PACK_NEGATIVE is not set.
- */
-
 VALUE
-rb_integer_unpack(const void *words, size_t numwords, size_t wordsize, size_t nails, int flags)
-{
-    VALUE val;
-    size_t num_bdigits;
-    int sign;
-    int nlp_bits;
-    BDIGIT *ds;
-    BDIGIT fixbuf[2] = { 0, 0 };
-
-    validate_integer_pack_format(numwords, wordsize, nails, flags,
-            INTEGER_PACK_MSWORD_FIRST|
-            INTEGER_PACK_LSWORD_FIRST|
-            INTEGER_PACK_MSBYTE_FIRST|
-            INTEGER_PACK_LSBYTE_FIRST|
-            INTEGER_PACK_NATIVE_BYTE_ORDER|
-            INTEGER_PACK_2COMP|
-            INTEGER_PACK_FORCE_BIGNUM|
-            INTEGER_PACK_NEGATIVE|
-            INTEGER_PACK_FORCE_GENERIC_IMPLEMENTATION);
-
-    num_bdigits = integer_unpack_num_bdigits(numwords, wordsize, nails, &nlp_bits);
-
-    if (LONG_MAX-1 < num_bdigits)
-        rb_raise(rb_eArgError, "too big to unpack as an integer");
-    if (num_bdigits <= numberof(fixbuf) && !(flags & INTEGER_PACK_FORCE_BIGNUM)) {
-        val = Qfalse;
-        ds = fixbuf;
-    }
-    else {
-        val = bignew((long)num_bdigits, 0);
-        ds = BDIGITS(val);
-    }
-    sign = bary_unpack_internal(ds, num_bdigits, words, numwords, wordsize, nails, flags, nlp_bits);
-
-    if (sign == -2) {
-        if (val) {
-            big_extend_carry(val);
-        }
-        else if (num_bdigits == numberof(fixbuf)) {
-            val = bignew((long)num_bdigits+1, 0);
-	    MEMCPY(BDIGITS(val), fixbuf, BDIGIT, num_bdigits);
-            BDIGITS(val)[num_bdigits++] = 1;
-        }
-        else {
-            ds[num_bdigits++] = 1;
-        }
-    }
-
-    if (!val) {
-        BDIGIT_DBL u = fixbuf[0] + BIGUP(fixbuf[1]);
-        if (u == 0)
-            return LONG2FIX(0);
-	if (0 < sign && POSFIXABLE(u))
-            return LONG2FIX(u);
-	if (sign < 0 && BDIGIT_MSB(fixbuf[1]) == 0 &&
-                NEGFIXABLE(-(BDIGIT_DBL_SIGNED)u))
-            return LONG2FIX(-(BDIGIT_DBL_SIGNED)u);
-        val = bignew((long)num_bdigits, 0 <= sign);
-        MEMCPY(BDIGITS(val), fixbuf, BDIGIT, num_bdigits);
-    }
-
-    if ((flags & INTEGER_PACK_FORCE_BIGNUM) && sign != 0 &&
-        bary_zero_p(BDIGITS(val), BIGNUM_LEN(val)))
-        sign = 0;
-    BIGNUM_SET_SIGN(val, 0 <= sign);
-
-    if (flags & INTEGER_PACK_FORCE_BIGNUM)
-        return bigtrunc(val);
-    return bignorm(val);
-}
-
-#define conv_digit(c) (ruby_digit36_to_number_table[(unsigned char)(c)])
-
-static void
-str2big_scan_digits(const char *s, const char *str, int base, int badcheck, size_t *num_digits_p, size_t *len_p)
-{
-    char nondigit = 0;
-    size_t num_digits = 0;
-    const char *digits_start = str;
-    const char *digits_end = str;
-
-    int c;
-
-    if (badcheck && *str == '_') goto bad;
-
-    while ((c = *str++) != 0) {
-	if (c == '_') {
-	    if (nondigit) {
-		if (badcheck) goto bad;
-		break;
-	    }
-	    nondigit = (char) c;
-	    continue;
-	}
-	else if ((c = conv_digit(c)) < 0) {
-	    break;
-	}
-	if (c >= base) break;
-	nondigit = 0;
-        num_digits++;
-        digits_end = str;
-    }
-    if (badcheck) {
-	str--;
-	if (s+1 < str && str[-1] == '_') goto bad;
-	while (*str && ISSPACE(*str)) str++;
-	if (*str) {
-	  bad:
-	    rb_invalid_str(s, "Integer()");
-	}
-    }
-    *num_digits_p = num_digits;
-    *len_p = digits_end - digits_start;
-}
-
-static VALUE
-str2big_poweroftwo(
-    int sign,
-    const char *digits_start,
-    const char *digits_end,
-    size_t num_digits,
-    int bits_per_digit)
-{
-    BDIGIT *dp;
-    BDIGIT_DBL dd;
-    int numbits;
-
-    size_t num_bdigits;
-    const char *p;
-    int c;
-    VALUE z;
-
-    num_bdigits = (num_digits / BITSPERDIG) * bits_per_digit + roomof((num_digits % BITSPERDIG) * bits_per_digit, BITSPERDIG);
-    z = bignew(num_bdigits, sign);
-    dp = BDIGITS(z);
-    dd = 0;
-    numbits = 0;
-    for (p = digits_end; digits_start < p; p--) {
-        if ((c = conv_digit(p[-1])) < 0)
-            continue;
-        dd |= (BDIGIT_DBL)c << numbits;
-        numbits += bits_per_digit;
-        if (BITSPERDIG <= numbits) {
-            *dp++ = BIGLO(dd);
-            dd = BIGDN(dd);
-            numbits -= BITSPERDIG;
-        }
-    }
-    if (numbits) {
-        *dp++ = BIGLO(dd);
-    }
-    assert((size_t)(dp - BDIGITS(z)) == num_bdigits);
-
-    return z;
-}
-
-static VALUE
-str2big_normal(
-    int sign,
-    const char *digits_start,
-    const char *digits_end,
-    size_t num_bdigits,
-    int base)
-{
-    size_t blen = 1;
-    BDIGIT *zds;
-    BDIGIT_DBL num;
-
-    size_t i;
-    const char *p;
-    int c;
-    VALUE z;
-
-    z = bignew(num_bdigits, sign);
-    zds = BDIGITS(z);
-    BDIGITS_ZERO(zds, num_bdigits);
-
-    for (p = digits_start; p < digits_end; p++) {
-        if ((c = conv_digit(*p)) < 0)
-            continue;
-        num = c;
-        i = 0;
-        for (;;) {
-            while (i<blen) {
-                num += (BDIGIT_DBL)zds[i]*base;
-                zds[i++] = BIGLO(num);
-                num = BIGDN(num);
-            }
-            if (num) {
-                blen++;
-                continue;
-            }
-            break;
-        }
-        assert(blen <= num_bdigits);
-    }
-
-    return z;
-}
-
-static VALUE
-str2big_karatsuba(
-    int sign,
-    const char *digits_start,
-    const char *digits_end,
-    size_t num_digits,
-    size_t num_bdigits,
-    int digits_per_bdigits_dbl,
-    int base)
-{
-    VALUE powerv;
-    size_t unit;
-    VALUE tmpuv = 0;
-    BDIGIT *uds, *vds, *tds;
-    BDIGIT_DBL dd;
-    BDIGIT_DBL current_base;
-    int m;
-    int power_level = 0;
-
-    size_t i;
-    const char *p;
-    int c;
-    VALUE z;
-
-    uds = ALLOCV_N(BDIGIT, tmpuv, 2*num_bdigits);
-    vds = uds + num_bdigits;
-
-    powerv = power_cache_get_power(base, power_level, NULL);
-
-    i = 0;
-    dd = 0;
-    current_base = 1;
-    m = digits_per_bdigits_dbl;
-    if (num_digits < (size_t)m)
-        m = (int)num_digits;
-    for (p = digits_end; digits_start < p; p--) {
-        if ((c = conv_digit(p[-1])) < 0)
-            continue;
-        dd = dd + c * current_base;
-        current_base *= base;
-        num_digits--;
-        m--;
-        if (m == 0) {
-            uds[i++] = BIGLO(dd);
-            uds[i++] = (BDIGIT)BIGDN(dd);
-            dd = 0;
-            m = digits_per_bdigits_dbl;
-            if (num_digits < (size_t)m)
-                m = (int)num_digits;
-            current_base = 1;
-        }
-    }
-    assert(i == num_bdigits);
-    for (unit = 2; unit < num_bdigits; unit *= 2) {
-        for (i = 0; i < num_bdigits; i += unit*2) {
-            if (2*unit <= num_bdigits - i) {
-                bary_mul(vds+i, unit*2, BDIGITS(powerv), BIGNUM_LEN(powerv), uds+i+unit, unit);
-                bary_add(vds+i, unit*2, vds+i, unit*2, uds+i, unit);
-            }
-            else if (unit <= num_bdigits - i) {
-                bary_mul(vds+i, num_bdigits-i, BDIGITS(powerv), BIGNUM_LEN(powerv), uds+i+unit, num_bdigits-(i+unit));
-                bary_add(vds+i, num_bdigits-i, vds+i, num_bdigits-i, uds+i, unit);
-            }
-            else {
-                MEMCPY(vds+i, uds+i, BDIGIT, num_bdigits-i);
-            }
-        }
-        power_level++;
-        powerv = power_cache_get_power(base, power_level, NULL);
-        tds = vds;
-        vds = uds;
-        uds = tds;
-    }
-    BARY_TRUNC(uds, num_bdigits);
-    z = bignew(num_bdigits, sign);
-    MEMCPY(BDIGITS(z), uds, BDIGIT, num_bdigits);
-
-    if (tmpuv)
-        ALLOCV_END(tmpuv);
-
-    return z;
-}
-
-#ifdef USE_GMP
-static VALUE
-str2big_gmp(
-    int sign,
-    const char *digits_start,
-    const char *digits_end,
-    size_t num_digits,
-    size_t num_bdigits,
-    int base)
+int2inum(n)
+    long n;
 {
-    const size_t nails = (sizeof(BDIGIT)-SIZEOF_BDIGIT)*CHAR_BIT;
-    char *buf, *p;
-    const char *q;
-    VALUE tmps;
-    mpz_t mz;
-    VALUE z;
-    BDIGIT *zds;
-    size_t zn, count;
-
-    buf = ALLOCV_N(char, tmps, num_digits+1);
-    p = buf;
-    for (q = digits_start; q < digits_end; q++) {
-        if (conv_digit(*q) < 0)
-            continue;
-        *p++ = *q;
-    }
-    *p = '\0';
-
-    mpz_init(mz);
-    mpz_set_str(mz, buf, base);
-    zn = num_bdigits;
-    z = bignew(zn, sign);
-    zds = BDIGITS(z);
-    mpz_export(BDIGITS(z), &count, -1, sizeof(BDIGIT), 0, nails, mz);
-    BDIGITS_ZERO(zds+count, zn-count);
-    mpz_clear(mz);
-
-    if (tmps)
-        ALLOCV_END(tmps);
-
-    return z;
+    if (FIXABLE(n)) return INT2FIX(n);
+    return int2big(n);
 }
-#endif
 
-/*
- * Parse +str+ as Ruby Integer, i.e., underscores, 0d and 0b prefixes.
- *
- * str:      pointer to the string to be parsed.
- *	     should be NUL-terminated.
- * base:     base of conversion, must be 2..36, or -36..0.
- *           if +base+ > 0, the conversion is done according to the +base+
- *           and unmatched prefix is parsed as a part of the result if
- *           present.
- *           if +base+ <= 0, the conversion is done according to the
- *           prefix if present, in base <code>-base</code> if +base+ < -1,
- *           or in base 10.
- * badcheck: if non-zero, +ArgumentError+ is raised when +str+ is not
- *           valid as an Integer.  if zero, Fixnum 0 is returned in
- *           that case.
- */
 VALUE
-rb_cstr_to_inum(const char *str, int base, int badcheck)
+str2inum(str, base)
+    char *str;
+    int base;
 {
-    const char *s = str;
-    char sign = 1;
-    int c;
+    char sign = 1, c;
+    unsigned long num;
+    unsigned int len, blen = 1, i;
     VALUE z;
+    USHORT *zds;
 
-    int bits_per_digit;
-
-    const char *digits_start, *digits_end;
-    size_t num_digits;
-    size_t num_bdigits;
-    size_t len;
-
-    if (!str) {
-	if (badcheck) {
-          bad:
-            rb_invalid_str(s, "Integer()");
-        }
-	return INT2FIX(0);
-    }
-    while (ISSPACE(*str)) str++;
-
-    if (str[0] == '+') {
-	str++;
-    }
-    else if (str[0] == '-') {
+    while (isspace(*str)) str++;
+    if (*str == '-') {
 	str++;
 	sign = 0;
     }
-    if (str[0] == '+' || str[0] == '-') {
-	if (badcheck) goto bad;
-	return INT2FIX(0);
-    }
-    if (base <= 0) {
-	if (str[0] == '0') {
-	    switch (str[1]) {
-	      case 'x': case 'X':
+    if (base == 0) {
+	if (*str == '0') {
+	    str++;
+	    if (*str == 'x' || *str == 'X') {
+		str++;
 		base = 16;
-                str += 2;
-		break;
-	      case 'b': case 'B':
-		base = 2;
-                str += 2;
-		break;
-	      case 'o': case 'O':
-		base = 8;
-                str += 2;
-		break;
-	      case 'd': case 'D':
-		base = 10;
-                str += 2;
-		break;
-	      default:
+	    }
+	    else {
 		base = 8;
 	    }
-	}
-	else if (base < -1) {
-	    base = -base;
+	    if (*str == '\0') return INT2FIX(0);
 	}
 	else {
 	    base = 10;
 	}
     }
-    else if (base == 2) {
-	if (str[0] == '0' && (str[1] == 'b'||str[1] == 'B')) {
-	    str += 2;
-	}
+    if (base == 8) {
+	while (str[0] == '0') str++;
+	len = 3*strlen(str)*sizeof(char);
     }
-    else if (base == 8) {
-	if (str[0] == '0' && (str[1] == 'o'||str[1] == 'O')) {
+    else {			/* base == 10 or 16 */
+	if (base == 16 && str[0] == '0' && (str[1] == 'x'||str[1] == 'X')) {
 	    str += 2;
 	}
-    }
-    else if (base == 10) {
-	if (str[0] == '0' && (str[1] == 'd'||str[1] == 'D')) {
-	    str += 2;
-	}
-    }
-    else if (base == 16) {
-	if (str[0] == '0' && (str[1] == 'x'||str[1] == 'X')) {
-	    str += 2;
-	}
-    }
-    if (base < 2 || 36 < base) {
-        rb_raise(rb_eArgError, "invalid radix %d", base);
-    }
-    if (*str == '0') {		/* squeeze preceding 0s */
-	int us = 0;
-	while ((c = *++str) == '0' || c == '_') {
-	    if (c == '_') {
-		if (++us >= 2)
-		    break;
-	    }
-	    else {
-		us = 0;
-	    }
-	}
-	if (!(c = *str) || ISSPACE(c)) --str;
-    }
-    c = *str;
-    c = conv_digit(c);
-    if (c < 0 || c >= base) {
-	if (badcheck) goto bad;
-	return INT2FIX(0);
+	while (str[0] == '0') str++;
+	len = 4*strlen(str)*sizeof(char);
     }
 
-    bits_per_digit = bit_length(base-1);
-    if (bits_per_digit * strlen(str) <= sizeof(long) * CHAR_BIT) {
-        char *end;
-	unsigned long val = STRTOUL(str, &end, base);
-
-	if (str < end && *end == '_') goto bigparse;
-	if (badcheck) {
-	    if (end == str) goto bad; /* no number */
-	    while (*end && ISSPACE(*end)) end++;
-	    if (*end) goto bad;	      /* trailing garbage */
-	}
+    if (len <= (sizeof(VALUE)*CHAR_BIT)) {
+	unsigned int val = strtoul((char*)str, 0, base);
 
 	if (POSFIXABLE(val)) {
-	    if (sign) return LONG2FIX(val);
+	    if (sign) return INT2FIX(val);
 	    else {
 		long result = -(long)val;
-		return LONG2FIX(result);
+		return INT2FIX(result);
 	    }
 	}
 	else {
-	    VALUE big = rb_uint2big(val);
-	    BIGNUM_SET_SIGN(big, sign);
-	    return bignorm(big);
+	    VALUE big = uint2big(val);
+	    RBIGNUM(big)->sign = sign;
+	    return big;
 	}
     }
+    len = (len/BITSPERDIG)+1;
 
-  bigparse:
-    digits_start = str;
-    str2big_scan_digits(s, str, base, badcheck, &num_digits, &len);
-    digits_end = digits_start + len;
-
-    if (POW2_P(base)) {
-        z = str2big_poweroftwo(sign, digits_start, digits_end, num_digits,
-                bits_per_digit);
-    }
-    else {
-        int digits_per_bdigits_dbl;
-        maxpow_in_bdigit_dbl(base, &digits_per_bdigits_dbl);
-        num_bdigits = roomof(num_digits, digits_per_bdigits_dbl)*2;
-
-#ifdef USE_GMP
-        if (GMP_STR2BIG_DIGITS < num_bdigits) {
-            z = str2big_gmp(sign, digits_start, digits_end, num_digits,
-                    num_bdigits, base);
-        }
-        else
-#endif
-        if (num_bdigits < KARATSUBA_MUL_DIGITS) {
-            z = str2big_normal(sign, digits_start, digits_end,
-                    num_bdigits, base);
-        }
-        else {
-            z = str2big_karatsuba(sign, digits_start, digits_end, num_digits,
-                    num_bdigits, digits_per_bdigits_dbl, base);
-        }
-    }
-
-    return bignorm(z);
-}
-
-VALUE
-rb_str_to_inum(VALUE str, int base, int badcheck)
-{
-    char *s;
-    long len;
-    VALUE v = 0;
-    VALUE ret;
-
-    StringValue(str);
-    rb_must_asciicompat(str);
-    if (badcheck) {
-	s = StringValueCStr(str);
-    }
-    else {
-	s = RSTRING_PTR(str);
-    }
-    if (s) {
-	len = RSTRING_LEN(str);
-	if (s[len]) {		/* no sentinel somehow */
-	    char *p = ALLOCV(v, len+1);
-
-	    MEMCPY(p, s, char, len);
-	    p[len] = '\0';
-	    s = p;
+    z = bignew(len, sign);
+    zds = BDIGITS(z);
+    for (i=len;i--;) zds[i]=0;
+    while (c = *str++) {
+	switch (c) {
+	  case '0': case '1': case '2': case '3': case '4':
+	  case '5': case '6': case '7': case '8': case '9':
+	    c = c - '0';
+	    break;
+	  case 'a': case 'b': case 'c':
+	  case 'd': case 'e': case 'f':
+	    c = c - 'a' + 10;
+	    break;
+	  case 'A': case 'B': case 'C':
+	  case 'D': case 'E': case 'F':
+	    c = c - 'A' + 10;
+	    break;
+	  default:
+	    c = base;
+	    break;
+	}
+	if (c >= base) break;
+	i = 0;
+	num = c;
+	for (;;) {
+	    while (i<blen) {
+		num += zds[i]*base;
+		zds[i++] = BIGLO(num);
+		num = BIGDN(num);
+	    }
+	    if (num) {
+		blen++;
+		continue;
+	    }
+	    break;
 	}
     }
-    ret = rb_cstr_to_inum(s, base, badcheck);
-    if (v)
-	ALLOCV_END(v);
-    return ret;
-}
-
-VALUE
-rb_str2big_poweroftwo(VALUE arg, int base, int badcheck)
-{
-    int positive_p = 1;
-    const char *s, *str;
-    const char *digits_start, *digits_end;
-    size_t num_digits;
-    size_t len;
-    VALUE z;
-
-    if (base < 2 || 36 < base || !POW2_P(base)) {
-        rb_raise(rb_eArgError, "invalid radix %d", base);
-    }
-
-    rb_must_asciicompat(arg);
-    s = str = StringValueCStr(arg);
-    if (*str == '-') {
-        str++;
-        positive_p = 0;
-    }
-
-    digits_start = str;
-    str2big_scan_digits(s, str, base, badcheck, &num_digits, &len);
-    digits_end = digits_start + len;
-
-    z = str2big_poweroftwo(positive_p, digits_start, digits_end, num_digits,
-            bit_length(base-1));
-
-    RB_GC_GUARD(arg);
-
-    return bignorm(z);
-}
-
-VALUE
-rb_str2big_normal(VALUE arg, int base, int badcheck)
-{
-    int positive_p = 1;
-    const char *s, *str;
-    const char *digits_start, *digits_end;
-    size_t num_digits;
-    size_t len;
-    VALUE z;
-
-    int digits_per_bdigits_dbl;
-    size_t num_bdigits;
-
-    if (base < 2 || 36 < base) {
-        rb_raise(rb_eArgError, "invalid radix %d", base);
-    }
-
-    rb_must_asciicompat(arg);
-    s = str = StringValueCStr(arg);
-    if (*str == '-') {
-        str++;
-        positive_p = 0;
-    }
-
-    digits_start = str;
-    str2big_scan_digits(s, str, base, badcheck, &num_digits, &len);
-    digits_end = digits_start + len;
-
-    maxpow_in_bdigit_dbl(base, &digits_per_bdigits_dbl);
-    num_bdigits = roomof(num_digits, digits_per_bdigits_dbl)*2;
-
-    z = str2big_normal(positive_p, digits_start, digits_end,
-            num_bdigits, base);
-
-    RB_GC_GUARD(arg);
-
-    return bignorm(z);
-}
-
-VALUE
-rb_str2big_karatsuba(VALUE arg, int base, int badcheck)
-{
-    int positive_p = 1;
-    const char *s, *str;
-    const char *digits_start, *digits_end;
-    size_t num_digits;
-    size_t len;
-    VALUE z;
-
-    int digits_per_bdigits_dbl;
-    size_t num_bdigits;
-
-    if (base < 2 || 36 < base) {
-        rb_raise(rb_eArgError, "invalid radix %d", base);
-    }
-
-    rb_must_asciicompat(arg);
-    s = str = StringValueCStr(arg);
-    if (*str == '-') {
-        str++;
-        positive_p = 0;
-    }
-
-    digits_start = str;
-    str2big_scan_digits(s, str, base, badcheck, &num_digits, &len);
-    digits_end = digits_start + len;
-
-    maxpow_in_bdigit_dbl(base, &digits_per_bdigits_dbl);
-    num_bdigits = roomof(num_digits, digits_per_bdigits_dbl)*2;
-
-    z = str2big_karatsuba(positive_p, digits_start, digits_end, num_digits,
-            num_bdigits, digits_per_bdigits_dbl, base);
-
-    RB_GC_GUARD(arg);
-
     return bignorm(z);
 }
 
-#ifdef USE_GMP
+static char hexmap[] = "0123456789abcdef";
 VALUE
-rb_str2big_gmp(VALUE arg, int base, int badcheck)
-{
-    int positive_p = 1;
-    const char *s, *str;
-    const char *digits_start, *digits_end;
-    size_t num_digits;
-    size_t len;
-    VALUE z;
-
-    int digits_per_bdigits_dbl;
-    size_t num_bdigits;
-
-    if (base < 2 || 36 < base) {
-        rb_raise(rb_eArgError, "invalid radix %d", base);
-    }
-
-    rb_must_asciicompat(arg);
-    s = str = StringValueCStr(arg);
-    if (*str == '-') {
-        str++;
-        positive_p = 0;
-    }
-
-    digits_start = str;
-    str2big_scan_digits(s, str, base, badcheck, &num_digits, &len);
-    digits_end = digits_start + len;
-
-    maxpow_in_bdigit_dbl(base, &digits_per_bdigits_dbl);
-    num_bdigits = roomof(num_digits, digits_per_bdigits_dbl)*2;
-
-    z = str2big_gmp(positive_p, digits_start, digits_end, num_digits, num_bdigits, base);
-
-    RB_GC_GUARD(arg);
-
-    return bignorm(z);
-}
-#endif
-
-#if HAVE_LONG_LONG
-
-static VALUE
-rb_ull2big(unsigned LONG_LONG n)
-{
-    long i;
-    VALUE big = bignew(bdigit_roomof(SIZEOF_LONG_LONG), 1);
-    BDIGIT *digits = BDIGITS(big);
-
-#if SIZEOF_BDIGIT >= SIZEOF_LONG_LONG
-    digits[0] = n;
-#else
-    for (i = 0; i < bdigit_roomof(SIZEOF_LONG_LONG); i++) {
-	digits[i] = BIGLO(n);
-	n = BIGDN(n);
-    }
-#endif
-
-    i = bdigit_roomof(SIZEOF_LONG_LONG);
-    while (i-- && !digits[i]) ;
-    BIGNUM_SET_LEN(big, i+1);
-    return big;
-}
-
-static VALUE
-rb_ll2big(LONG_LONG n)
+big2str(x, base)
+    VALUE x;
+    int base;
 {
-    long neg = 0;
-    unsigned LONG_LONG u;
-    VALUE big;
+    VALUE t;
+    USHORT *ds;
+    unsigned int i, j, hbase;
+    VALUE ss;
+    char *s, c;
 
-    if (n < 0) {
-        u = 1 + (unsigned LONG_LONG)(-(n + 1)); /* u = -n avoiding overflow */
-	neg = 1;
-    }
-    else {
-        u = n;
+    if (FIXNUM_P(x)) {
+	return fix2str(x, base);
     }
-    big = rb_ull2big(u);
-    if (neg) {
-	BIGNUM_SET_SIGN(big, 0);
+    i = RBIGNUM(x)->len;
+    if (i == 0) return str_new2("0");
+    if (base == 10) {
+	j = (sizeof(USHORT)/sizeof(char)*CHAR_BIT*i*241L)/800+2;
+	hbase = 10000;
     }
-    return big;
-}
-
-VALUE
-rb_ull2inum(unsigned LONG_LONG n)
-{
-    if (POSFIXABLE(n)) return LONG2FIX(n);
-    return rb_ull2big(n);
-}
-
-VALUE
-rb_ll2inum(LONG_LONG n)
-{
-    if (FIXABLE(n)) return LONG2FIX(n);
-    return rb_ll2big(n);
-}
-
-#endif  /* HAVE_LONG_LONG */
-
-VALUE
-rb_cstr2inum(const char *str, int base)
-{
-    return rb_cstr_to_inum(str, base, base==0);
-}
-
-VALUE
-rb_str2inum(VALUE str, int base)
-{
-    return rb_str_to_inum(str, base, base==0);
-}
-
-static VALUE
-big_shift3(VALUE x, int lshift_p, size_t shift_numdigits, int shift_numbits)
-{
-    BDIGIT *xds, *zds;
-    long s1;
-    int s2;
-    VALUE z;
-    long xn;
-
-    if (lshift_p) {
-        if (LONG_MAX < shift_numdigits) {
-            rb_raise(rb_eArgError, "too big number");
-        }
-        s1 = shift_numdigits;
-        s2 = shift_numbits;
-        xn = BIGNUM_LEN(x);
-        z = bignew(xn+s1+1, BIGNUM_SIGN(x));
-        zds = BDIGITS(z);
-        BDIGITS_ZERO(zds, s1);
-        xds = BDIGITS(x);
-        zds[xn+s1] = bary_small_lshift(zds+s1, xds, xn, s2);
-    }
-    else {
-        long zn;
-        BDIGIT hibitsx;
-        if (LONG_MAX < shift_numdigits || (size_t)BIGNUM_LEN(x) <= shift_numdigits) {
-            if (BIGNUM_POSITIVE_P(x) ||
-                bary_zero_p(BDIGITS(x), BIGNUM_LEN(x)))
-                return INT2FIX(0);
-            else
-                return INT2FIX(-1);
-        }
-        s1 = shift_numdigits;
-        s2 = shift_numbits;
-        hibitsx = abs2twocomp(&x, &xn);
-        xds = BDIGITS(x);
-        if (xn <= s1) {
-            return hibitsx ? INT2FIX(-1) : INT2FIX(0);
-        }
-        zn = xn - s1;
-        z = bignew(zn, 0);
-        zds = BDIGITS(z);
-        bary_small_rshift(zds, xds+s1, zn, s2, hibitsx != 0 ? BDIGMAX : 0);
-        twocomp2abs_bang(z, hibitsx != 0);
+    else if (base == 16) {
+	j = (sizeof(USHORT)/sizeof(char)*CHAR_BIT*i)/4+2;
+	hbase = 0x10000;
     }
-    RB_GC_GUARD(x);
-    return z;
-}
-
-static VALUE
-big_shift2(VALUE x, int lshift_p, VALUE y)
-{
-    int sign;
-    size_t lens[2];
-    size_t shift_numdigits;
-    int shift_numbits;
-
-    assert(POW2_P(CHAR_BIT));
-    assert(POW2_P(BITSPERDIG));
-
-    if (BIGZEROP(x))
-        return INT2FIX(0);
-    sign = rb_integer_pack(y, lens, numberof(lens), sizeof(size_t), 0,
-        INTEGER_PACK_LSWORD_FIRST|INTEGER_PACK_NATIVE_BYTE_ORDER);
-    if (sign < 0) {
-        lshift_p = !lshift_p;
-        sign = -sign;
+    else if (base == 8) {
+	j = (sizeof(USHORT)/sizeof(char)*CHAR_BIT*i)+2;
+	hbase = 010000;
     }
-    if (lshift_p) {
-        if (1 < sign || CHAR_BIT <= lens[1])
-            rb_raise(rb_eRangeError, "shift width too big");
+    else if (base == 2) {
+	j = (sizeof(USHORT)*CHAR_BIT*i)+2;
+	hbase = 020;
     }
     else {
-        if (1 < sign || CHAR_BIT <= lens[1])
-            return BIGNUM_POSITIVE_P(x) ? INT2FIX(0) : INT2FIX(-1);
+	j = 0;
+	hbase = 0;
+	Fail("bignum cannot treat base %d", base);
     }
-    shift_numbits = (int)(lens[0] & (BITSPERDIG-1));
-    shift_numdigits = (lens[0] >> bit_length(BITSPERDIG-1)) |
-      (lens[1] << (CHAR_BIT*SIZEOF_SIZE_T - bit_length(BITSPERDIG-1)));
-    return big_shift3(x, lshift_p, shift_numdigits, shift_numbits);
-}
-
-static VALUE
-big_lshift(VALUE x, unsigned long shift)
-{
-    long s1 = shift/BITSPERDIG;
-    int s2 = (int)(shift%BITSPERDIG);
-    return big_shift3(x, 1, s1, s2);
-}
-
-static VALUE
-big_rshift(VALUE x, unsigned long shift)
-{
-    long s1 = shift/BITSPERDIG;
-    int s2 = (int)(shift%BITSPERDIG);
-    return big_shift3(x, 0, s1, s2);
-}
-
-#define MAX_BASE36_POWER_TABLE_ENTRIES (SIZEOF_SIZE_T * CHAR_BIT + 1)
 
-static VALUE base36_power_cache[35][MAX_BASE36_POWER_TABLE_ENTRIES];
-static size_t base36_numdigits_cache[35][MAX_BASE36_POWER_TABLE_ENTRIES];
+    t = big_clone(x);
+    ds = BDIGITS(t);
+    ss = str_new(0, j);
+    s = RSTRING(ss)->ptr;
 
-static void
-power_cache_init(void)
-{
-    int i, j;
-    for (i = 0; i < 35; ++i) {
-	for (j = 0; j < MAX_BASE36_POWER_TABLE_ENTRIES; ++j) {
-	    base36_power_cache[i][j] = Qnil;
+    s[0] = RBIGNUM(x)->sign ? '+' : '-';
+    while (i && j) {
+	int k = i;
+	unsigned long num = 0;
+	while (k--) {
+	    num = BIGUP(num) + ds[k];
+	    ds[k] = num / hbase;
+	    num %= hbase;
 	}
-    }
-}
-
-static inline VALUE
-power_cache_get_power(int base, int power_level, size_t *numdigits_ret)
-{
-    /*
-     * MAX_BASE36_POWER_TABLE_ENTRIES is big enough to that
-     * base36_power_cache[base][MAX_BASE36_POWER_TABLE_ENTRIES-1] fills whole memory.
-     * So MAX_BASE36_POWER_TABLE_ENTRIES <= power_level is not possible to calculate.
-     *
-     * number-of-bytes =
-     * log256(base36_power_cache[base][MAX_BASE36_POWER_TABLE_ENTRIES-1]) =
-     * log256(maxpow_in_bdigit_dbl(base)**(2**(MAX_BASE36_POWER_TABLE_ENTRIES-1))) =
-     * log256(maxpow_in_bdigit_dbl(base)**(2**(SIZEOF_SIZE_T*CHAR_BIT))) =
-     * (2**(SIZEOF_SIZE_T*CHAR_BIT))*log256(maxpow_in_bdigit_dbl(base)) =
-     * (256**SIZEOF_SIZE_T)*log256(maxpow_in_bdigit_dbl(base)) >
-     * (256**SIZEOF_SIZE_T)*(sizeof(BDIGIT_DBL)-1) >
-     * 256**SIZEOF_SIZE_T
-     */
-    if (MAX_BASE36_POWER_TABLE_ENTRIES <= power_level)
-        rb_bug("too big power number requested: maxpow_in_bdigit_dbl(%d)**(2**%d)", base, power_level);
-
-    if (NIL_P(base36_power_cache[base - 2][power_level])) {
-        VALUE power;
-        size_t numdigits;
-        if (power_level == 0) {
-            int numdigits0;
-            BDIGIT_DBL dd = maxpow_in_bdigit_dbl(base, &numdigits0);
-            power = bignew(2, 1);
-            bdigitdbl2bary(BDIGITS(power), 2, dd);
-            numdigits = numdigits0;
-        }
-        else {
-            power = bigtrunc(bigsq(power_cache_get_power(base, power_level - 1, &numdigits)));
-            numdigits *= 2;
-        }
-        rb_obj_hide(power);
-        base36_power_cache[base - 2][power_level] = power;
-        base36_numdigits_cache[base - 2][power_level] = numdigits;
-	rb_gc_register_mark_object(power);
-    }
-    if (numdigits_ret)
-        *numdigits_ret = base36_numdigits_cache[base - 2][power_level];
-    return base36_power_cache[base - 2][power_level];
-}
-
-struct big2str_struct {
-    int negative;
-    int base;
-    BDIGIT_DBL hbase2;
-    int hbase2_numdigits;
-    VALUE result;
-    char *ptr;
-};
-
-static void
-big2str_alloc(struct big2str_struct *b2s, size_t len)
-{
-    if (LONG_MAX-1 < len)
-        rb_raise(rb_eArgError, "too big number");
-    b2s->result = rb_usascii_str_new(0, (long)(len + 1)); /* plus one for sign */
-    b2s->ptr = RSTRING_PTR(b2s->result);
-    if (b2s->negative)
-        *b2s->ptr++ = '-';
-}
-
-static void
-big2str_2bdigits(struct big2str_struct *b2s, BDIGIT *xds, size_t xn, size_t taillen)
-{
-    size_t j;
-    BDIGIT_DBL num;
-    char buf[SIZEOF_BDIGIT_DBL*CHAR_BIT], *p;
-    int beginning = !b2s->ptr;
-    size_t len = 0;
-
-    assert(xn <= 2);
-    num = bary2bdigitdbl(xds, xn);
-
-    if (beginning) {
-        if (num == 0)
-            return;
-        p = buf;
-        j = sizeof(buf);
-        do {
-            p[--j] = ruby_digitmap[num % b2s->base];
-            num /= b2s->base;
-        } while (num);
-        len = sizeof(buf) - j;
-        big2str_alloc(b2s, len + taillen);
-	MEMCPY(b2s->ptr, buf + j, char, len);
-    }
-    else {
-        p = b2s->ptr;
-        j = b2s->hbase2_numdigits;
-        do {
-            p[--j] = ruby_digitmap[num % b2s->base];
-            num /= b2s->base;
-        } while (j);
-        len = b2s->hbase2_numdigits;
-    }
-    b2s->ptr += len;
-}
-
-static void
-big2str_karatsuba(struct big2str_struct *b2s, BDIGIT *xds, size_t xn, size_t wn,
-		  int power_level, size_t taillen)
-{
-    VALUE b;
-    size_t half_numdigits, lower_numdigits;
-    int lower_power_level;
-    size_t bn;
-    const BDIGIT *bds;
-    size_t len;
-
-    /*
-     * Precondition:
-     * abs(x) < maxpow**(2**power_level)
-     * where
-     *   maxpow = maxpow_in_bdigit_dbl(base, &numdigits)
-     *
-     * This function generates sequence of zeros, and then stringized abs(x) into b2s->ptr.
-     *
-     * b2s->ptr can be NULL.
-     * It is allocated when the first character is generated via big2str_alloc.
-     *
-     * The prefix zeros should be generated if and only if b2s->ptr is not NULL.
-     * When the zeros are generated, the zeros and abs(x) consists
-     * numdigits*(2**power_level) characters at total.
-     *
-     * Note:
-     * power_cache_get_power(base, power_level, &len) may not be cached yet. It should not be called.
-     * power_cache_get_power(base, power_level-1, &len) should be cached already if 0 <= power_level-1.
-     */
-
-    if (xn == 0 || bary_zero_p(xds, xn)) {
-	if (b2s->ptr) {
-            /* When x is zero, power_cache_get_power(base, power_level) should be cached already. */
-            power_cache_get_power(b2s->base, power_level, &len);
-	    memset(b2s->ptr, '0', len);
-            b2s->ptr += len;
+	if (ds[i-1] == 0) i--;
+	k = 4;
+	while (k--) {
+	    c = num % base;
+	    s[--j] = hexmap[(int)c];
+	    num /= base;
+	    if (i == 0 && num == 0) break;
 	}
-        return;
-    }
-
-    if (power_level == 0) {
-	big2str_2bdigits(b2s, xds, xn, taillen);
-        return;
-    }
-
-    lower_power_level = power_level-1;
-    b = power_cache_get_power(b2s->base, lower_power_level, &lower_numdigits);
-    bn = BIGNUM_LEN(b);
-    bds = BDIGITS(b);
-
-    half_numdigits = lower_numdigits;
-
-    while (0 < lower_power_level &&
-            (xn < bn ||
-             (xn == bn && bary_cmp(xds, xn, bds, bn) < 0))) {
-        lower_power_level--;
-        b = power_cache_get_power(b2s->base, lower_power_level, &lower_numdigits);
-        bn = BIGNUM_LEN(b);
-        bds = BDIGITS(b);
     }
+    while (s[j] == '0') j++;
+    RSTRING(ss)->len -= RBIGNUM(x)->sign?j:j-1;
+    memmove(RBIGNUM(x)->sign?s:s+1, s+j, RSTRING(ss)->len);
+    s[RSTRING(ss)->len] = '\0';
 
-    if (lower_power_level == 0 &&
-            (xn < bn ||
-             (xn == bn && bary_cmp(xds, xn, bds, bn) < 0))) {
-        if (b2s->ptr) {
-            len = half_numdigits * 2 - lower_numdigits;
-            memset(b2s->ptr, '0', len);
-            b2s->ptr += len;
-        }
-	big2str_2bdigits(b2s, xds, xn, taillen);
-    }
-    else {
-        BDIGIT *qds, *rds;
-        size_t qn, rn;
-        BDIGIT *tds;
-        int shift;
-
-        if (lower_power_level != power_level-1 && b2s->ptr) {
-            len = (half_numdigits - lower_numdigits) * 2;
-            memset(b2s->ptr, '0', len);
-            b2s->ptr += len;
-        }
-
-        shift = nlz(bds[bn-1]);
-
-        qn = xn + BIGDIVREM_EXTRA_WORDS;
-
-        if (shift == 0) {
-            /* bigdivrem_restoring will not modify y.
-             * So use bds directly.  */
-            tds = (BDIGIT *)bds;
-            xds[xn] = 0;
-        }
-        else {
-            /* bigdivrem_restoring will modify y.
-             * So use temporary buffer.  */
-            tds = xds + qn;
-            assert(qn + bn <= xn + wn);
-            bary_small_lshift(tds, bds, bn, shift);
-            xds[xn] = bary_small_lshift(xds, xds, xn, shift);
-        }
-
-        bigdivrem_restoring(xds, qn, tds, bn);
-
-        rds = xds;
-        rn = bn;
-
-        qds = xds + bn;
-        qn = qn - bn;
-
-        if (shift) {
-            bary_small_rshift(rds, rds, rn, shift, 0);
-        }
-
-        BARY_TRUNC(qds, qn);
-        assert(qn <= bn);
-        big2str_karatsuba(b2s, qds, qn, xn+wn - (rn+qn), lower_power_level, lower_numdigits+taillen);
-        BARY_TRUNC(rds, rn);
-        big2str_karatsuba(b2s, rds, rn, xn+wn - rn, lower_power_level, taillen);
-    }
+    return ss;
 }
 
 static VALUE
-big2str_base_poweroftwo(VALUE x, int base)
+big_to_s(x)
+    VALUE x;
 {
-    int word_numbits = ffs(base) - 1;
-    size_t numwords;
-    VALUE result;
-    char *ptr;
-    numwords = rb_absint_numwords(x, word_numbits, NULL);
-    if (BIGNUM_NEGATIVE_P(x)) {
-        if (LONG_MAX-1 < numwords)
-            rb_raise(rb_eArgError, "too big number");
-        result = rb_usascii_str_new(0, 1+numwords);
-        ptr = RSTRING_PTR(result);
-        *ptr++ = BIGNUM_POSITIVE_P(x) ? '+' : '-';
-    }
-    else {
-        if (LONG_MAX < numwords)
-            rb_raise(rb_eArgError, "too big number");
-        result = rb_usascii_str_new(0, numwords);
-        ptr = RSTRING_PTR(result);
-    }
-    rb_integer_pack(x, ptr, numwords, 1, CHAR_BIT-word_numbits,
-                    INTEGER_PACK_BIG_ENDIAN);
-    while (0 < numwords) {
-        *ptr = ruby_digitmap[*(unsigned char *)ptr];
-        ptr++;
-        numwords--;
-    }
-    return result;
-}
-
-VALUE
-rb_big2str_poweroftwo(VALUE x, int base)
-{
-    return big2str_base_poweroftwo(x, base);
-}
-
-static VALUE
-big2str_generic(VALUE x, int base)
-{
-    BDIGIT *xds;
-    size_t xn;
-    struct big2str_struct b2s_data;
-    int power_level;
-    VALUE power;
-
-    xds = BDIGITS(x);
-    xn = BIGNUM_LEN(x);
-    BARY_TRUNC(xds, xn);
-
-    if (xn == 0) {
-	return rb_usascii_str_new2("0");
-    }
-
-    if (base < 2 || 36 < base)
-	rb_raise(rb_eArgError, "invalid radix %d", base);
-
-    if (xn >= LONG_MAX/BITSPERDIG) {
-        rb_raise(rb_eRangeError, "bignum too big to convert into `string'");
-    }
-
-    power_level = 0;
-    power = power_cache_get_power(base, power_level, NULL);
-    while (power_level < MAX_BASE36_POWER_TABLE_ENTRIES &&
-           (size_t)BIGNUM_LEN(power) <= (xn+1)/2) {
-        power_level++;
-        power = power_cache_get_power(base, power_level, NULL);
-    }
-    assert(power_level != MAX_BASE36_POWER_TABLE_ENTRIES);
-
-    if ((size_t)BIGNUM_LEN(power) <= xn) {
-        /*
-         * This increment guarantees x < power_cache_get_power(base, power_level)
-         * without invoking it actually.
-         * (power_cache_get_power(base, power_level) can be slow and not used
-         * in big2str_karatsuba.)
-         *
-         * Although it is possible that x < power_cache_get_power(base, power_level-1),
-         * it is no problem because big2str_karatsuba checks it and
-         * doesn't affect the result when b2s_data.ptr is NULL.
-         */
-        power_level++;
-    }
-
-    b2s_data.negative = BIGNUM_NEGATIVE_P(x);
-    b2s_data.base = base;
-    b2s_data.hbase2 = maxpow_in_bdigit_dbl(base, &b2s_data.hbase2_numdigits);
-
-    b2s_data.result = Qnil;
-    b2s_data.ptr = NULL;
-
-    if (power_level == 0) {
-	big2str_2bdigits(&b2s_data, xds, xn, 0);
-    }
-    else {
-        VALUE tmpw = 0;
-        BDIGIT *wds;
-        size_t wn;
-        wn = power_level * BIGDIVREM_EXTRA_WORDS + BIGNUM_LEN(power);
-        wds = ALLOCV_N(BDIGIT, tmpw, xn + wn);
-        MEMCPY(wds, xds, BDIGIT, xn);
-	big2str_karatsuba(&b2s_data, wds, xn, wn, power_level, 0);
-        if (tmpw)
-            ALLOCV_END(tmpw);
-    }
-    RB_GC_GUARD(x);
-
-    *b2s_data.ptr = '\0';
-    rb_str_resize(b2s_data.result, (long)(b2s_data.ptr - RSTRING_PTR(b2s_data.result)));
-
-    RB_GC_GUARD(x);
-    return b2s_data.result;
-}
-
-VALUE
-rb_big2str_generic(VALUE x, int base)
-{
-    return big2str_generic(x, base);
-}
-
-#ifdef USE_GMP
-VALUE
-big2str_gmp(VALUE x, int base)
-{
-    const size_t nails = (sizeof(BDIGIT)-SIZEOF_BDIGIT)*CHAR_BIT;
-    mpz_t mx;
-    size_t size;
-    VALUE str;
-    BDIGIT *xds = BDIGITS(x);
-    size_t xn = BIGNUM_LEN(x);
-
-    mpz_init(mx);
-    mpz_import(mx, xn, -1, sizeof(BDIGIT), 0, nails, xds);
-
-    size = mpz_sizeinbase(mx, base);
-
-    if (BIGNUM_NEGATIVE_P(x)) {
-        mpz_neg(mx, mx);
-        str = rb_usascii_str_new(0, size+1);
-    }
-    else {
-        str = rb_usascii_str_new(0, size);
-    }
-    mpz_get_str(RSTRING_PTR(str), base, mx);
-    mpz_clear(mx);
-
-    if (RSTRING_PTR(str)[RSTRING_LEN(str)-1] == '\0') {
-        rb_str_set_len(str, RSTRING_LEN(str)-1);
-    }
-
-    RB_GC_GUARD(x);
-    return str;
-}
-
-VALUE
-rb_big2str_gmp(VALUE x, int base)
-{
-    return big2str_gmp(x, base);
-}
-#endif
-
-static VALUE
-rb_big2str1(VALUE x, int base)
-{
-    BDIGIT *xds;
-    size_t xn;
-
-    if (FIXNUM_P(x)) {
-	return rb_fix2str(x, base);
-    }
-
-    bigtrunc(x);
-    xds = BDIGITS(x);
-    xn = BIGNUM_LEN(x);
-    BARY_TRUNC(xds, xn);
-
-    if (xn == 0) {
-	return rb_usascii_str_new2("0");
-    }
-
-    if (base < 2 || 36 < base)
-	rb_raise(rb_eArgError, "invalid radix %d", base);
-
-    if (xn >= LONG_MAX/BITSPERDIG) {
-        rb_raise(rb_eRangeError, "bignum too big to convert into `string'");
-    }
-
-    if (POW2_P(base)) {
-        /* base == 2 || base == 4 || base == 8 || base == 16 || base == 32 */
-        return big2str_base_poweroftwo(x, base);
-    }
-
-#ifdef USE_GMP
-    if (GMP_BIG2STR_DIGITS < xn) {
-        return big2str_gmp(x, base);
-    }
-#endif
-
-    return big2str_generic(x, base);
-}
-
-VALUE
-rb_big2str(VALUE x, int base)
-{
-    return rb_big2str1(x, base);
-}
-
-/*
- *  call-seq:
- *     big.to_s(base=10)   ->  string
- *
- *  Returns a string containing the representation of <i>big</i> radix
- *  <i>base</i> (2 through 36).
- *
- *     12345654321.to_s         #=> "12345654321"
- *     12345654321.to_s(2)      #=> "1011011111110110111011110000110001"
- *     12345654321.to_s(8)      #=> "133766736061"
- *     12345654321.to_s(16)     #=> "2dfdbbc31"
- *     78546939656932.to_s(36)  #=> "rubyrules"
- */
-
-static VALUE
-rb_big_to_s(int argc, VALUE *argv, VALUE x)
-{
-    int base;
-
-    if (argc == 0) base = 10;
-    else {
-	VALUE b;
-
-	rb_scan_args(argc, argv, "01", &b);
-	base = NUM2INT(b);
-    }
-    return rb_big2str(x, base);
-}
-
-static unsigned long
-big2ulong(VALUE x, const char *type)
-{
-    size_t len = BIGNUM_LEN(x);
-    unsigned long num;
-    BDIGIT *ds;
-
-    if (len == 0)
-        return 0;
-    if (BIGSIZE(x) > sizeof(long)) {
-        rb_raise(rb_eRangeError, "bignum too big to convert into `%s'", type);
-    }
-    ds = BDIGITS(x);
-#if SIZEOF_LONG <= SIZEOF_BDIGIT
-    num = (unsigned long)ds[0];
-#else
-    num = 0;
-    while (len--) {
-	num <<= BITSPERDIG;
-	num += (unsigned long)ds[len]; /* overflow is already checked */
-    }
-#endif
-    return num;
+    return big2str(x, 10);
 }
 
 unsigned long
-rb_big2ulong(VALUE x)
-{
-    unsigned long num = big2ulong(x, "unsigned long");
-
-    if (BIGNUM_POSITIVE_P(x)) {
-        return num;
-    }
-    else {
-        if (num <= LONG_MAX)
-            return -(long)num;
-        if (num == 1+(unsigned long)(-(LONG_MIN+1)))
-            return LONG_MIN;
-    }
-    rb_raise(rb_eRangeError, "bignum out of range of unsigned long");
-}
-
-long
-rb_big2long(VALUE x)
+big2ulong(x)
+    VALUE x;
 {
-    unsigned long num = big2ulong(x, "long");
+    unsigned int num;
+    unsigned int len = RBIGNUM(x)->len;
+    USHORT *ds;
 
-    if (BIGNUM_POSITIVE_P(x)) {
-        if (num <= LONG_MAX)
-            return num;
-    }
-    else {
-        if (num <= LONG_MAX)
-            return -(long)num;
-        if (num == 1+(unsigned long)(-(LONG_MIN+1)))
-            return LONG_MIN;
-    }
-    rb_raise(rb_eRangeError, "bignum too big to convert into `long'");
-}
-
-#if HAVE_LONG_LONG
-
-static unsigned LONG_LONG
-big2ull(VALUE x, const char *type)
-{
-    size_t len = BIGNUM_LEN(x);
-    unsigned LONG_LONG num;
-    BDIGIT *ds = BDIGITS(x);
-
-    if (len == 0)
-        return 0;
-    if (BIGSIZE(x) > SIZEOF_LONG_LONG)
-	rb_raise(rb_eRangeError, "bignum too big to convert into `%s'", type);
-#if SIZEOF_LONG_LONG <= SIZEOF_BDIGIT
-    num = (unsigned LONG_LONG)ds[0];
-#else
+    if (len > sizeof(long)/sizeof(short))
+	ArgError("bignum too big to convert into `uint'");
+    ds = BDIGITS(x);
     num = 0;
     while (len--) {
 	num = BIGUP(num);
 	num += ds[len];
     }
-#endif
     return num;
 }
 
-unsigned LONG_LONG
-rb_big2ull(VALUE x)
+long
+big2long(x)
+    VALUE x;
 {
-    unsigned LONG_LONG num = big2ull(x, "unsigned long long");
+    unsigned long num = big2ulong(x);
 
-    if (BIGNUM_POSITIVE_P(x)) {
-        return num;
+    if ((long)num < 0) {
+	ArgError("bignum too big to convert into `int'");
     }
-    else {
-        if (num <= LLONG_MAX)
-            return -(LONG_LONG)num;
-        if (num == 1+(unsigned LONG_LONG)(-(LLONG_MIN+1)))
-            return LLONG_MIN;
-    }
-    rb_raise(rb_eRangeError, "bignum out of range of unsigned long long");
+    if (!RBIGNUM(x)->sign) return -num;
+    return num;
 }
 
-LONG_LONG
-rb_big2ll(VALUE x)
+VALUE
+big_to_i(x)
+    VALUE x;
 {
-    unsigned LONG_LONG num = big2ull(x, "long long");
-
-    if (BIGNUM_POSITIVE_P(x)) {
-        if (num <= LLONG_MAX)
-            return num;
-    }
-    else {
-        if (num <= LLONG_MAX)
-            return -(LONG_LONG)num;
-        if (num == 1+(unsigned LONG_LONG)(-(LLONG_MIN+1)))
-            return LLONG_MIN;
-    }
-    rb_raise(rb_eRangeError, "bignum too big to convert into `long long'");
+    return bignorm(x);
 }
 
-#endif  /* HAVE_LONG_LONG */
-
-static VALUE
-dbl2big(double d)
+VALUE
+dbl2big(d)
+    double d;
 {
-    long i = 0;
-    BDIGIT c;
-    BDIGIT *digits;
+    unsigned int i = 0;
+    long c;
+    USHORT *digits;
     VALUE z;
     double u = (d < 0)?-d:d;
 
-    if (isinf(d)) {
-	rb_raise(rb_eFloatDomainError, d < 0 ? "-Infinity" : "Infinity");
-    }
-    if (isnan(d)) {
-	rb_raise(rb_eFloatDomainError, "NaN");
-    }
-
-    while (1.0 <= u) {
+    while (0 != (long)u) {
 	u /= (double)(BIGRAD);
 	i++;
     }
@@ -5099,1963 +400,911 @@ dbl2big(double d)
     digits = BDIGITS(z);
     while (i--) {
 	u *= BIGRAD;
-	c = (BDIGIT)u;
+	c = (long)u;
 	u -= c;
 	digits[i] = c;
     }
 
-    return z;
-}
-
-VALUE
-rb_dbl2big(double d)
-{
-    return bignorm(dbl2big(d));
-}
-
-static double
-big2dbl(VALUE x)
-{
-    double d = 0.0;
-    long i = (bigtrunc(x), BIGNUM_LEN(x)), lo = 0, bits;
-    BDIGIT *ds = BDIGITS(x), dl;
-
-    if (i) {
-	bits = i * BITSPERDIG - nlz(ds[i-1]);
-	if (bits > DBL_MANT_DIG+DBL_MAX_EXP) {
-	    d = HUGE_VAL;
-	}
-	else {
-	    if (bits > DBL_MANT_DIG+1)
-		lo = (bits -= DBL_MANT_DIG+1) / BITSPERDIG;
-	    else
-		bits = 0;
-	    while (--i > lo) {
-		d = ds[i] + BIGRAD*d;
-	    }
-	    dl = ds[i];
-	    if (bits && (dl & ((BDIGIT)1 << (bits %= BITSPERDIG)))) {
-		int carry = (dl & ~(BDIGMAX << bits)) != 0;
-		if (!carry) {
-		    while (i-- > 0) {
-			carry = ds[i] != 0;
-			if (carry) break;
-		    }
-		}
-		if (carry) {
-		    dl &= BDIGMAX << bits;
-		    dl = BIGLO(dl + ((BDIGIT)1 << bits));
-		    if (!dl) d += 1;
-		}
-	    }
-	    d = dl + BIGRAD*d;
-	    if (lo) {
-		if (lo > INT_MAX / BITSPERDIG)
-		    d = HUGE_VAL;
-		else if (lo < INT_MIN / BITSPERDIG)
-		    d = 0.0;
-		else
-		    d = ldexp(d, (int)(lo * BITSPERDIG));
-	    }
-	}
-    }
-    if (!BIGNUM_SIGN(x)) d = -d;
-    return d;
+    return bignorm(z);
 }
 
 double
-rb_big2dbl(VALUE x)
+big2dbl(x)
+    VALUE x;
 {
-    double d = big2dbl(x);
+    double d = 0.0;
+    unsigned int i = RBIGNUM(x)->len;
+    USHORT *ds = BDIGITS(x);
 
-    if (isinf(d)) {
-	rb_warning("Bignum out of Float range");
-	if (d < 0.0)
-	    d = -HUGE_VAL;
-	else
-	    d = HUGE_VAL;
+    while (i--) {
+	d = ds[i] + BIGRAD*d;
     }
+    if (!RBIGNUM(x)->sign) d = -d;
     return d;
 }
 
-/*
- *  call-seq:
- *     big.to_f -> float
- *
- *  Converts <i>big</i> to a <code>Float</code>. If <i>big</i> doesn't
- *  fit in a <code>Float</code>, the result is infinity.
- *
- */
-
-static VALUE
-rb_big_to_f(VALUE x)
-{
-    return DBL2NUM(rb_big2dbl(x));
-}
-
-VALUE
-rb_integer_float_cmp(VALUE x, VALUE y)
-{
-    double yd = RFLOAT_VALUE(y);
-    double yi, yf;
-    VALUE rel;
-
-    if (isnan(yd))
-        return Qnil;
-    if (isinf(yd)) {
-        if (yd > 0.0) return INT2FIX(-1);
-        else return INT2FIX(1);
-    }
-    yf = modf(yd, &yi);
-    if (FIXNUM_P(x)) {
-#if SIZEOF_LONG * CHAR_BIT < DBL_MANT_DIG /* assume FLT_RADIX == 2 */
-        double xd = (double)FIX2LONG(x);
-        if (xd < yd)
-            return INT2FIX(-1);
-        if (xd > yd)
-            return INT2FIX(1);
-        return INT2FIX(0);
-#else
-        long xn, yn;
-        if (yi < FIXNUM_MIN)
-            return INT2FIX(1);
-        if (FIXNUM_MAX+1 <= yi)
-            return INT2FIX(-1);
-        xn = FIX2LONG(x);
-        yn = (long)yi;
-        if (xn < yn)
-            return INT2FIX(-1);
-        if (xn > yn)
-            return INT2FIX(1);
-        if (yf < 0.0)
-            return INT2FIX(1);
-        if (0.0 < yf)
-            return INT2FIX(-1);
-        return INT2FIX(0);
-#endif
-    }
-    y = rb_dbl2big(yi);
-    rel = rb_big_cmp(x, y);
-    if (yf == 0.0 || rel != INT2FIX(0))
-        return rel;
-    if (yf < 0.0)
-        return INT2FIX(1);
-    return INT2FIX(-1);
-}
-
-VALUE
-rb_integer_float_eq(VALUE x, VALUE y)
-{
-    double yd = RFLOAT_VALUE(y);
-    double yi, yf;
-
-    if (isnan(yd) || isinf(yd))
-        return Qfalse;
-    yf = modf(yd, &yi);
-    if (yf != 0)
-        return Qfalse;
-    if (FIXNUM_P(x)) {
-#if SIZEOF_LONG * CHAR_BIT < DBL_MANT_DIG /* assume FLT_RADIX == 2 */
-        double xd = (double)FIX2LONG(x);
-        if (xd != yd)
-            return Qfalse;
-        return Qtrue;
-#else
-        long xn, yn;
-        if (yi < LONG_MIN || LONG_MAX < yi)
-            return Qfalse;
-        xn = FIX2LONG(x);
-        yn = (long)yi;
-        if (xn != yn)
-            return Qfalse;
-        return Qtrue;
-#endif
-    }
-    y = rb_dbl2big(yi);
-    return rb_big_eq(x, y);
-}
-
-/*
- *  call-seq:
- *     big <=> numeric   -> -1, 0, +1 or nil
- *
- *  Comparison---Returns -1, 0, or +1 depending on whether +big+ is
- *  less than, equal to, or greater than +numeric+. This is the
- *  basis for the tests in Comparable.
- *
- *  +nil+ is returned if the two values are incomparable.
- *
- */
-
 VALUE
-rb_big_cmp(VALUE x, VALUE y)
+big_to_f(x)
+    VALUE x;
 {
-    int cmp;
-
-    if (FIXNUM_P(y)) {
-        x = bignorm(x);
-        if (FIXNUM_P(x)) {
-            if (FIX2LONG(x) > FIX2LONG(y)) return INT2FIX(1);
-            if (FIX2LONG(x) < FIX2LONG(y)) return INT2FIX(-1);
-            return INT2FIX(0);
-        }
-        else {
-            if (BIGNUM_NEGATIVE_P(x)) return INT2FIX(-1);
-            return INT2FIX(1);
-        }
-    }
-    else if (RB_BIGNUM_TYPE_P(y)) {
-    }
-    else if (RB_FLOAT_TYPE_P(y)) {
-        return rb_integer_float_cmp(x, y);
-    }
-    else {
-	return rb_num_coerce_cmp(x, y, rb_intern("<=>"));
-    }
-
-    if (BIGNUM_SIGN(x) > BIGNUM_SIGN(y)) return INT2FIX(1);
-    if (BIGNUM_SIGN(x) < BIGNUM_SIGN(y)) return INT2FIX(-1);
-
-    cmp = bary_cmp(BDIGITS(x), BIGNUM_LEN(x), BDIGITS(y), BIGNUM_LEN(y));
-    if (BIGNUM_SIGN(x))
-        return INT2FIX(cmp);
-    else
-        return INT2FIX(-cmp);
+    return float_new(big2dbl(x));
 }
 
-enum big_op_t {
-    big_op_gt,
-    big_op_ge,
-    big_op_lt,
-    big_op_le
-};
-
 static VALUE
-big_op(VALUE x, VALUE y, enum big_op_t op)
+big_cmp(x, y)
+    VALUE x, y;
 {
-    VALUE rel;
-    int n;
+    int xlen = RBIGNUM(x)->len;
 
-    if (FIXNUM_P(y) || RB_BIGNUM_TYPE_P(y)) {
-	rel = rb_big_cmp(x, y);
-    }
-    else if (RB_FLOAT_TYPE_P(y)) {
-        rel = rb_integer_float_cmp(x, y);
-    }
-    else {
-	ID id = 0;
-	switch (op) {
-	  case big_op_gt: id = '>'; break;
-	  case big_op_ge: id = rb_intern(">="); break;
-	  case big_op_lt: id = '<'; break;
-	  case big_op_le: id = rb_intern("<="); break;
-	}
-	return rb_num_coerce_relop(x, y, id);
-    }
+    switch (TYPE(y)) {
+      case T_FIXNUM:
+	y = int2big(FIX2INT(y));
+	break;
 
-    if (NIL_P(rel)) return Qfalse;
-    n = FIX2INT(rel);
+      case T_BIGNUM:
+	break;
 
-    switch (op) {
-	case big_op_gt: return n >  0 ? Qtrue : Qfalse;
-	case big_op_ge: return n >= 0 ? Qtrue : Qfalse;
-	case big_op_lt: return n <  0 ? Qtrue : Qfalse;
-	case big_op_le: return n <= 0 ? Qtrue : Qfalse;
+      default:
+	return num_coerce_bin(x, y);
     }
-    return Qundef;
-}
 
-/*
- * call-seq:
- *   big > real  ->  true or false
- *
- * Returns <code>true</code> if the value of <code>big</code> is
- * greater than that of <code>real</code>.
- */
+    if (RBIGNUM(x)->sign > RBIGNUM(y)->sign) return INT2FIX(1);
+    if (RBIGNUM(x)->sign < RBIGNUM(y)->sign) return INT2FIX(-1);
+    if (xlen < RBIGNUM(y)->len)
+	return (RBIGNUM(x)->sign) ? INT2FIX(-1) : INT2FIX(1);
+    if (xlen > RBIGNUM(y)->len)
+	return (RBIGNUM(x)->sign) ? INT2FIX(1) : INT2FIX(-1);
 
-static VALUE
-big_gt(VALUE x, VALUE y)
-{
-    return big_op(x, y, big_op_gt);
+    while(xlen-- && (BDIGITS(x)[xlen]==BDIGITS(y)[xlen]));
+    if (-1 == xlen) return INT2FIX(0);
+    return (BDIGITS(x)[xlen] > BDIGITS(y)[xlen]) ?
+	(RBIGNUM(x)->sign ? INT2FIX(1) : INT2FIX(-1)) :
+	    (RBIGNUM(x)->sign ? INT2FIX(-1) : INT2FIX(1));
 }
 
-/*
- * call-seq:
- *   big >= real  ->  true or false
- *
- * Returns <code>true</code> if the value of <code>big</code> is
- * greater than or equal to that of <code>real</code>.
- */
-
 static VALUE
-big_ge(VALUE x, VALUE y)
+big_eq(x, y)
+    VALUE x, y;
 {
-    return big_op(x, y, big_op_ge);
+    if (big_cmp(x, y) == INT2FIX(0)) return TRUE;
+    return FALSE;
 }
 
-/*
- * call-seq:
- *   big < real  ->  true or false
- *
- * Returns <code>true</code> if the value of <code>big</code> is
- * less than that of <code>real</code>.
- */
-
 static VALUE
-big_lt(VALUE x, VALUE y)
+big_uminus(x)
+    VALUE x;
 {
-    return big_op(x, y, big_op_lt);
-}
+    VALUE z = big_clone(x);
 
-/*
- * call-seq:
- *   big <= real  ->  true or false
- *
- * Returns <code>true</code> if the value of <code>big</code> is
- * less than or equal to that of <code>real</code>.
- */
-
-static VALUE
-big_le(VALUE x, VALUE y)
-{
-    return big_op(x, y, big_op_le);
-}
-
-/*
- *  call-seq:
- *     big == obj  -> true or false
- *
- *  Returns <code>true</code> only if <i>obj</i> has the same value
- *  as <i>big</i>. Contrast this with <code>Bignum#eql?</code>, which
- *  requires <i>obj</i> to be a <code>Bignum</code>.
- *
- *     68719476736 == 68719476736.0   #=> true
- */
-
-VALUE
-rb_big_eq(VALUE x, VALUE y)
-{
-    if (FIXNUM_P(y)) {
-	if (bignorm(x) == y) return Qtrue;
-	y = rb_int2big(FIX2LONG(y));
-    }
-    else if (RB_BIGNUM_TYPE_P(y)) {
-    }
-    else if (RB_FLOAT_TYPE_P(y)) {
-        return rb_integer_float_eq(x, y);
-    }
-    else {
-	return rb_equal(y, x);
-    }
-    if (BIGNUM_SIGN(x) != BIGNUM_SIGN(y)) return Qfalse;
-    if (BIGNUM_LEN(x) != BIGNUM_LEN(y)) return Qfalse;
-    if (MEMCMP(BDIGITS(x),BDIGITS(y),BDIGIT,BIGNUM_LEN(y)) != 0) return Qfalse;
-    return Qtrue;
-}
-
-/*
- *  call-seq:
- *     big.eql?(obj)   -> true or false
- *
- *  Returns <code>true</code> only if <i>obj</i> is a
- *  <code>Bignum</code> with the same value as <i>big</i>. Contrast this
- *  with <code>Bignum#==</code>, which performs type conversions.
- *
- *     68719476736.eql?(68719476736.0)   #=> false
- */
-
-VALUE
-rb_big_eql(VALUE x, VALUE y)
-{
-    if (!RB_BIGNUM_TYPE_P(y)) return Qfalse;
-    if (BIGNUM_SIGN(x) != BIGNUM_SIGN(y)) return Qfalse;
-    if (BIGNUM_LEN(x) != BIGNUM_LEN(y)) return Qfalse;
-    if (MEMCMP(BDIGITS(x),BDIGITS(y),BDIGIT,BIGNUM_LEN(y)) != 0) return Qfalse;
-    return Qtrue;
-}
-
-/*
- * call-seq:
- *    -big   ->  integer
- *
- * Unary minus (returns an integer whose value is 0-big)
- */
-
-VALUE
-rb_big_uminus(VALUE x)
-{
-    VALUE z = rb_big_clone(x);
-
-    BIGNUM_SET_SIGN(z, !BIGNUM_SIGN(x));
+    RBIGNUM(z)->sign = !RBIGNUM(x)->sign;
 
     return bignorm(z);
 }
 
-/*
- * call-seq:
- *     ~big  ->  integer
- *
- * Inverts the bits in big. As Bignums are conceptually infinite
- * length, the result acts as if it had an infinite number of one
- * bits to the left. In hex representations, this is displayed
- * as two periods to the left of the digits.
- *
- *   sprintf("%X", ~0x1122334455)    #=> "..FEEDDCCBBAA"
- */
-
 static VALUE
-rb_big_neg(VALUE x)
+big_neg(x)
+    VALUE x;
 {
-    VALUE z = rb_big_clone(x);
-    BDIGIT *ds = BDIGITS(z);
-    long n = BIGNUM_LEN(z);
+    VALUE z = big_clone(x);
+    unsigned int i = RBIGNUM(x)->len;
+    USHORT *ds = BDIGITS(z);
 
-    if (!n) return INT2FIX(-1);
-
-    if (BIGNUM_POSITIVE_P(z)) {
-        if (bary_add_one(ds, n)) {
-            big_extend_carry(z);
-        }
-        BIGNUM_SET_NEGATIVE_SIGN(z);
-    }
-    else {
-        bary_neg(ds, n);
-        if (bary_add_one(ds, n))
-            return INT2FIX(-1);
-        bary_neg(ds, n);
-        BIGNUM_SET_POSITIVE_SIGN(z);
-    }
+    if (!RBIGNUM(x)->sign) big_2comp(z);
+    while (i--) ds[i] = ~ds[i];
+    if (RBIGNUM(x)->sign) big_2comp(z);
+    RBIGNUM(z)->sign = !RBIGNUM(z)->sign;
 
     return bignorm(z);
 }
 
 static VALUE
-bigsub(VALUE x, VALUE y)
-{
-    VALUE z;
-    BDIGIT *xds, *yds, *zds;
-    long xn, yn, zn;
-
-    xn = BIGNUM_LEN(x);
-    yn = BIGNUM_LEN(y);
-    zn = xn < yn ? yn : xn;
-
-    z = bignew(zn, 1);
-
-    xds = BDIGITS(x);
-    yds = BDIGITS(y);
-    zds = BDIGITS(z);
-
-    if (bary_sub(zds, zn, xds, xn, yds, yn)) {
-        bary_2comp(zds, zn);
-        BIGNUM_SET_NEGATIVE_SIGN(z);
+bigsub(x, y)
+    VALUE x, y;
+{
+    VALUE z = 0;
+    USHORT *zds;
+    long num;
+    unsigned int i;
+
+    i = RBIGNUM(x)->len;
+    /* if x is larger than y, swap */
+    if (RBIGNUM(x)->len < RBIGNUM(y)->len) {
+	z = x; x = y; y = z;	/* swap x y */
+    }
+    else if (RBIGNUM(x)->len == RBIGNUM(y)->len) {
+	while (i > 0) {
+	    i--;
+	    if (BDIGITS(x)[i] > BDIGITS(y)[i]) {
+		break;
+	    }
+	    if (BDIGITS(x)[i] < BDIGITS(y)[i]) {
+		z = x; x = y; y = z;	/* swap x y */
+		break;
+	    }
+	}
     }
 
-    return z;
-}
-
-static VALUE bigadd_int(VALUE x, long y);
-
-static VALUE
-bigsub_int(VALUE x, long y0)
-{
-    VALUE z;
-    BDIGIT *xds, *zds;
-    long xn, zn;
-    BDIGIT_DBL_SIGNED num;
-    long i, y;
-
-    y = y0;
-    xds = BDIGITS(x);
-    xn = BIGNUM_LEN(x);
-
-    if (xn == 0)
-        return LONG2NUM(-y0);
-
-    zn = xn;
-#if SIZEOF_BDIGIT < SIZEOF_LONG
-    if (zn < bdigit_roomof(SIZEOF_LONG))
-        zn = bdigit_roomof(SIZEOF_LONG);
-#endif
-    z = bignew(zn, BIGNUM_SIGN(x));
+    z = bignew(RBIGNUM(x)->len, (z == 0)?1:0);
     zds = BDIGITS(z);
 
-#if SIZEOF_BDIGIT >= SIZEOF_LONG
-    assert(xn == zn);
-    num = (BDIGIT_DBL_SIGNED)xds[0] - y;
-    if (xn == 1 && num < 0) {
-	BIGNUM_SET_SIGN(z, !BIGNUM_SIGN(x));
-	zds[0] = (BDIGIT)-num;
-	RB_GC_GUARD(x);
-	return bignorm(z);
-    }
-    zds[0] = BIGLO(num);
-    num = BIGDN(num);
-    i = 1;
-    if (i < xn)
-        goto y_is_zero_x;
-    goto finish;
-#else
-    num = 0;
-    for (i=0; i < xn; i++) {
-        if (y == 0) goto y_is_zero_x;
-	num += (BDIGIT_DBL_SIGNED)xds[i] - BIGLO(y);
+    for (i = 0, num = 0; i < RBIGNUM(y)->len; i++) { 
+	num += (long)BDIGITS(x)[i] - BDIGITS(y)[i];
 	zds[i] = BIGLO(num);
 	num = BIGDN(num);
-	y = BIGDN(y);
-    }
-    for (; i < zn; i++) {
-        if (y == 0) goto y_is_zero_z;
-        num -= BIGLO(y);
-        zds[i] = BIGLO(num);
-        num = BIGDN(num);
-        y = BIGDN(y);
-    }
-    goto finish;
-#endif
-
-    for (; i < xn; i++) {
-      y_is_zero_x:
-        if (num == 0) goto num_is_zero_x;
-	num += xds[i];
-	zds[i] = BIGLO(num);
+    } 
+    while (num && i < RBIGNUM(x)->len) {
+	num += BDIGITS(x)[i];
+	zds[i++] = BIGLO(num);
 	num = BIGDN(num);
     }
-#if SIZEOF_BDIGIT < SIZEOF_LONG
-    for (; i < zn; i++) {
-      y_is_zero_z:
-        if (num == 0) goto num_is_zero_z;
-        zds[i] = BIGLO(num);
-        num = BIGDN(num);
-    }
-#endif
-    goto finish;
-
-    for (; i < xn; i++) {
-      num_is_zero_x:
-	zds[i] = xds[i];
-    }
-#if SIZEOF_BDIGIT < SIZEOF_LONG
-    for (; i < zn; i++) {
-      num_is_zero_z:
-        zds[i] = 0;
-    }
-#endif
-    goto finish;
-
-  finish:
-    assert(num == 0 || num == -1);
-    if (num < 0) {
-        get2comp(z);
-	BIGNUM_SET_SIGN(z, !BIGNUM_SIGN(x));
+    while (i < RBIGNUM(x)->len) {
+	zds[i] = BDIGITS(x)[i];
+	i++;
     }
-    RB_GC_GUARD(x);
+    
     return bignorm(z);
 }
 
 static VALUE
-bigadd_int(VALUE x, long y)
+bigadd(x, y, sign)
+    VALUE x, y;
+    char sign;
 {
     VALUE z;
-    BDIGIT *xds, *zds;
-    long xn, zn;
-    BDIGIT_DBL num;
-    long i;
-
-    xds = BDIGITS(x);
-    xn = BIGNUM_LEN(x);
-
-    if (xn == 0)
-        return LONG2NUM(y);
-
-    zn = xn;
-#if SIZEOF_BDIGIT < SIZEOF_LONG
-    if (zn < bdigit_roomof(SIZEOF_LONG))
-        zn = bdigit_roomof(SIZEOF_LONG);
-#endif
-    zn++;
-
-    z = bignew(zn, BIGNUM_SIGN(x));
-    zds = BDIGITS(z);
+    long num;
+    unsigned int i, len;
 
-#if SIZEOF_BDIGIT >= SIZEOF_LONG
-    num = (BDIGIT_DBL)xds[0] + y;
-    zds[0] = BIGLO(num);
-    num = BIGDN(num);
-    i = 1;
-    if (i < xn)
-        goto y_is_zero_x;
-    goto y_is_zero_z;
-#else
-    num = 0;
-    for (i=0; i < xn; i++) {
-        if (y == 0) goto y_is_zero_x;
-	num += (BDIGIT_DBL)xds[i] + BIGLO(y);
-	zds[i] = BIGLO(num);
-	num = BIGDN(num);
-	y = BIGDN(y);
+    if (RBIGNUM(x)->sign == (RBIGNUM(y)->sign ^ sign)) {
+	if (RBIGNUM(y)->sign == sign) return bigsub(y, x);
+	return bigsub(x, y);
     }
-    for (; i < zn; i++) {
-        if (y == 0) goto y_is_zero_z;
-	num += BIGLO(y);
-	zds[i] = BIGLO(num);
-	num = BIGDN(num);
-	y = BIGDN(y);
+    else if (sign == 0) {
+      /* x - y */
+      if ((RBIGNUM(x)->sign == 0) && (RBIGNUM(y)->sign == 1)) {
+	/* x is negative and y is positive. */
+	/* return -(abs(x) + y) */
+	VALUE ret;
+	RBIGNUM(x)->sign = 1;   /* x = abs(x) */
+	ret = bigadd(x, y, 1);  /* ret = x + y  (recursive call) */
+	RBIGNUM(ret)->sign = 0; /* ret = -ret */
+	return ret;
+      }
     }
-    goto finish;
 
-#endif
+    if (RBIGNUM(x)->len > RBIGNUM(y)->len) {
+	len = RBIGNUM(x)->len + 1;
+        z = x; x = y; y = z;
+    }
+    else {
+	len = RBIGNUM(y)->len + 1;
+    }
+    z = bignew(len, sign==RBIGNUM(y)->sign);
 
-    for (;i < xn; i++) {
-      y_is_zero_x:
-        if (num == 0) goto num_is_zero_x;
-	num += (BDIGIT_DBL)xds[i];
-	zds[i] = BIGLO(num);
+    len = RBIGNUM(x)->len;
+    for (i = 0, num = 0; i < len; i++) {
+	num += (long)(BDIGITS(x)[i] + BDIGITS(y)[i]);
+	BDIGITS(z)[i] = BIGLO(num);
 	num = BIGDN(num);
     }
-    for (; i < zn; i++) {
-      y_is_zero_z:
-        if (num == 0) goto num_is_zero_z;
-	zds[i] = BIGLO(num);
+    len = RBIGNUM(y)->len;
+    while (num && i < len) {
+	num += BDIGITS(y)[i];
+	BDIGITS(z)[i++] = BIGLO(num);
 	num = BIGDN(num);
     }
-    goto finish;
-
-    for (;i < xn; i++) {
-      num_is_zero_x:
-	zds[i] = xds[i];
-    }
-    for (; i < zn; i++) {
-      num_is_zero_z:
-	zds[i] = 0;
+    while (i < len) {
+	BDIGITS(z)[i] = BDIGITS(y)[i];
+	i++;
     }
-    goto finish;
+    BDIGITS(z)[i] = num;
 
-  finish:
-    RB_GC_GUARD(x);
     return bignorm(z);
 }
 
-static VALUE
-bigadd(VALUE x, VALUE y, int sign)
+VALUE
+big_plus(x, y)
+    VALUE x, y;
 {
-    VALUE z;
-    size_t len;
+    switch (TYPE(y)) {
+      case T_FIXNUM:
+	y = int2big(FIX2INT(y));
+	/* fall through */
+      case T_BIGNUM:
+	return bigadd(x, y, 1);
 
-    sign = (sign == BIGNUM_SIGN(y));
-    if (BIGNUM_SIGN(x) != sign) {
-	if (sign) return bigsub(y, x);
-	return bigsub(x, y);
-    }
+      case T_FLOAT:
+	return float_new(big2dbl(x) + RFLOAT(y)->value);
 
-    if (BIGNUM_LEN(x) > BIGNUM_LEN(y)) {
-	len = BIGNUM_LEN(x) + 1;
-    }
-    else {
-	len = BIGNUM_LEN(y) + 1;
+      default:
+	return num_coerce_bin(x, y);
     }
-    z = bignew(len, sign);
-
-    bary_add(BDIGITS(z), BIGNUM_LEN(z),
-             BDIGITS(x), BIGNUM_LEN(x),
-             BDIGITS(y), BIGNUM_LEN(y));
-
-    return z;
 }
 
-/*
- *  call-seq:
- *     big + other  -> Numeric
- *
- *  Adds big and other, returning the result.
- */
-
 VALUE
-rb_big_plus(VALUE x, VALUE y)
+big_minus(x, y)
+    VALUE x, y;
 {
-    long n;
+    switch (TYPE(y)) {
+      case T_FIXNUM:
+	y = int2big(FIX2INT(y));
+	/* fall through */
+      case T_BIGNUM:
+	return bigadd(x, y, 0);
 
-    if (FIXNUM_P(y)) {
-	n = FIX2LONG(y);
-	if ((n > 0) != BIGNUM_SIGN(x)) {
-	    if (n < 0) {
-		n = -n;
-	    }
-	    return bigsub_int(x, n);
-	}
-	if (n < 0) {
-	    n = -n;
-	}
-	return bigadd_int(x, n);
-    }
-    else if (RB_BIGNUM_TYPE_P(y)) {
-	return bignorm(bigadd(x, y, 1));
-    }
-    else if (RB_FLOAT_TYPE_P(y)) {
-	return DBL2NUM(rb_big2dbl(x) + RFLOAT_VALUE(y));
-    }
-    else {
-	return rb_num_coerce_bin(x, y, '+');
-    }
-}
+      case T_FLOAT:
+	return float_new(big2dbl(x) - RFLOAT(y)->value);
 
-/*
- *  call-seq:
- *     big - other  -> Numeric
- *
- *  Subtracts other from big, returning the result.
- */
-
-VALUE
-rb_big_minus(VALUE x, VALUE y)
-{
-    long n;
-
-    if (FIXNUM_P(y)) {
-	n = FIX2LONG(y);
-	if ((n > 0) != BIGNUM_SIGN(x)) {
-	    if (n < 0) {
-		n = -n;
-	    }
-	    return bigadd_int(x, n);
-	}
-	if (n < 0) {
-	    n = -n;
-	}
-	return bigsub_int(x, n);
-    }
-    else if (RB_BIGNUM_TYPE_P(y)) {
-	return bignorm(bigadd(x, y, 0));
-    }
-    else if (RB_FLOAT_TYPE_P(y)) {
-	return DBL2NUM(rb_big2dbl(x) - RFLOAT_VALUE(y));
-    }
-    else {
-	return rb_num_coerce_bin(x, y, '-');
+      default:
+	return num_coerce_bin(x, y);
     }
 }
 
-static VALUE
-bigsq(VALUE x)
+VALUE
+big_mul(x, y)
+    VALUE x, y;
 {
-    long xn, zn;
+    unsigned int i = 0, j;
+    unsigned long n = 0;
     VALUE z;
-    BDIGIT *xds, *zds;
-
-    xn = BIGNUM_LEN(x);
-    zn = 2 * xn;
-
-    z = bignew(zn, 1);
-
-    xds = BDIGITS(x);
-    zds = BDIGITS(z);
-
-#ifdef USE_GMP
-    if (xn < GMP_MUL_DIGITS)
-        bary_sq_fast(zds, zn, xds, xn);
-    else
-        bary_mul(zds, zn, xds, xn, xds, xn);
-#else
-    if (xn < KARATSUBA_MUL_DIGITS)
-        bary_sq_fast(zds, zn, xds, xn);
-    else
-        bary_mul(zds, zn, xds, xn, xds, xn);
-#endif
-
-    RB_GC_GUARD(x);
-    return z;
-}
+    USHORT *zds;
 
-static VALUE
-bigmul0(VALUE x, VALUE y)
-{
-    long xn, yn, zn;
-    VALUE z;
-    BDIGIT *xds, *yds, *zds;
+    if (FIXNUM_P(x)) x = int2big(FIX2INT(x));
+    switch (TYPE(y)) {
+      case T_FIXNUM:
+	y = int2big(FIX2INT(y));
+	break;
 
-    if (x == y)
-        return bigsq(x);
+      case T_BIGNUM:
+	break;
 
-    xn = BIGNUM_LEN(x);
-    yn = BIGNUM_LEN(y);
-    zn = xn + yn;
+      case T_FLOAT:
+	return float_new(big2dbl(x) * RFLOAT(y)->value);
 
-    z = bignew(zn, BIGNUM_SIGN(x)==BIGNUM_SIGN(y));
+      default:
+	return num_coerce_bin(x, y);
+    }
 
-    xds = BDIGITS(x);
-    yds = BDIGITS(y);
+    j = RBIGNUM(x)->len + RBIGNUM(y)->len + 1;
+    z = bignew(j, RBIGNUM(x)->sign==RBIGNUM(y)->sign);
     zds = BDIGITS(z);
-
-    bary_mul(zds, zn, xds, xn, yds, yn);
-
-    RB_GC_GUARD(x);
-    RB_GC_GUARD(y);
-    return z;
-}
-
-/*
- *  call-seq:
- *     big * other  -> Numeric
- *
- *  Multiplies big and other, returning the result.
- */
-
-VALUE
-rb_big_mul(VALUE x, VALUE y)
-{
-    if (FIXNUM_P(y)) {
-	y = rb_int2big(FIX2LONG(y));
-    }
-    else if (RB_BIGNUM_TYPE_P(y)) {
-    }
-    else if (RB_FLOAT_TYPE_P(y)) {
-	return DBL2NUM(rb_big2dbl(x) * RFLOAT_VALUE(y));
-    }
-    else {
-	return rb_num_coerce_bin(x, y, '*');
+    while (j--) zds[j] = 0;
+    for (i = 0; i < RBIGNUM(x)->len; i++) {
+	unsigned long dd = BDIGITS(x)[i]; 
+	if (dd == 0) continue;
+	n = 0;
+	for (j = 0; j < RBIGNUM(y)->len; j++) {
+	    int ee = n + dd * BDIGITS(y)[j];
+	    n = zds[i + j] + ee;
+	    if (ee) zds[i + j] = BIGLO(n);
+	    n = BIGDN(n);
+	}
+	if (n) {
+	    zds[i + j] = n;
+	}
     }
 
-    return bignorm(bigmul0(x, y));
+    return bignorm(z);
 }
 
-static VALUE
-bigdivrem(VALUE x, VALUE y, volatile VALUE *divp, volatile VALUE *modp)
-{
-    long xn = BIGNUM_LEN(x), yn = BIGNUM_LEN(y);
-    VALUE z;
-    BDIGIT *xds, *yds, *zds;
-    BDIGIT dd;
-
-    VALUE q = Qnil, r = Qnil;
-    BDIGIT *qds, *rds;
-    long qn, rn;
+static void
+bigdivmod(x, y, div, mod, modulo)
+    VALUE x, y;
+    VALUE *div, *mod;
+    int modulo;
+{
+    unsigned int nx = RBIGNUM(x)->len, ny = RBIGNUM(y)->len, i, j;
+    VALUE yy, z;
+    USHORT *xds, *yds, *zds, *tds;
+    unsigned long t2;
+    long num;
+    USHORT dd, q;
 
     yds = BDIGITS(y);
-    BARY_TRUNC(yds, yn);
-    if (yn == 0)
-        rb_num_zerodiv();
-
-    xds = BDIGITS(x);
-    BARY_TRUNC(xds, xn);
-
-    if (xn < yn || (xn == yn && xds[xn - 1] < yds[yn - 1])) {
-	if (divp) *divp = rb_int2big(0);
-	if (modp) *modp = x;
-	return Qnil;
+    if (ny == 0 && yds[0] == 0) num_zerodiv();
+    if (nx < ny	|| nx == ny && BDIGITS(x)[nx - 1] < BDIGITS(y)[ny - 1]) {
+	if (div) *div = INT2FIX(0);
+	if (mod) *mod = bignorm(x);
+	return;
     }
-    if (yn == 1) {
+    xds = BDIGITS(x);
+    if (ny == 1) {
 	dd = yds[0];
-	z = bignew(xn, BIGNUM_SIGN(x)==BIGNUM_SIGN(y));
+	z = big_clone(x);
 	zds = BDIGITS(z);
-        dd = bigdivrem_single(zds, xds, xn, dd);
-	if (modp) {
-	    *modp = rb_uint2big((VALUE)dd);
-	    BIGNUM_SET_SIGN(*modp, BIGNUM_SIGN(x));
+	t2 = 0; i = nx;
+	while (i--) {
+	    t2 = BIGUP(t2) + zds[i];
+	    zds[i] = t2 / dd;
+	    t2 %= dd;
 	}
-	if (divp) *divp = z;
-	return Qnil;
-    }
-    if (xn == 2 && yn == 2) {
-        BDIGIT_DBL x0 = bary2bdigitdbl(xds, 2);
-        BDIGIT_DBL y0 = bary2bdigitdbl(yds, 2);
-        BDIGIT_DBL q0 = x0 / y0;
-        BDIGIT_DBL r0 = x0 % y0;
-        if (divp) {
-            z = bignew(bdigit_roomof(sizeof(BDIGIT_DBL)), BIGNUM_SIGN(x)==BIGNUM_SIGN(y));
-            zds = BDIGITS(z);
-            zds[0] = BIGLO(q0);
-            zds[1] = BIGLO(BIGDN(q0));
-            *divp = z;
-        }
-        if (modp) {
-            z = bignew(bdigit_roomof(sizeof(BDIGIT_DBL)), BIGNUM_SIGN(x));
-            zds = BDIGITS(z);
-            zds[0] = BIGLO(r0);
-            zds[1] = BIGLO(BIGDN(r0));
-            *modp = z;
-        }
-        return Qnil;
-    }
-
-    if (divp) {
-        qn = xn + BIGDIVREM_EXTRA_WORDS;
-        q = bignew(qn, BIGNUM_SIGN(x)==BIGNUM_SIGN(y));
-        qds = BDIGITS(q);
-    }
-    else {
-        qn = 0;
-        qds = NULL;
+	if (div) *div = bignorm(z);
+	if (mod) {
+	    if (!RBIGNUM(y)->sign) t2 = -t2;
+	    *mod = INT2FIX(t2);
+	}
+	return;
     }
-
-    if (modp) {
-        rn = yn;
-        r = bignew(rn, BIGNUM_SIGN(x));
-        rds = BDIGITS(r);
+    z = bignew(nx==ny?nx+2:nx+1, RBIGNUM(x)->sign==RBIGNUM(y)->sign);
+    zds = BDIGITS(z);
+    if (nx==ny) zds[nx+1] = 0;
+    while (!yds[ny-1]) ny--;
+    if ((dd = BIGRAD/(int)(yds[ny-1]+1)) != 1) {
+	yy = big_clone(y);
+	tds = BDIGITS(yy);
+	j = 0;
+	num = 0;
+	while (j<ny) {
+	    num += (unsigned long)yds[j]*dd;
+	    tds[j++] = BIGLO(num);
+	    num = BIGDN(num);
+	}
+	yds = tds;
+	j = 0;
+	num = 0;
+	while (j<nx) {
+	    num += (unsigned long)xds[j]*dd;
+	    zds[j++] = BIGLO(num);
+	    num = BIGDN(num);
+	}
+	zds[j] = num;
     }
     else {
-        rn = 0;
-        rds = NULL;
-    }
-
-    bary_divmod_branch(qds, qn, rds, rn, xds, xn, yds, yn);
-
-    if (divp) {
-        bigtrunc(q);
-        *divp = q;
-    }
-    if (modp) {
-        bigtrunc(r);
-        *modp = r;
-    }
-
-    return Qnil;
-}
-
-static void
-bigdivmod(VALUE x, VALUE y, volatile VALUE *divp, volatile VALUE *modp)
-{
-    VALUE mod;
-
-    bigdivrem(x, y, divp, &mod);
-    if (BIGNUM_SIGN(x) != BIGNUM_SIGN(y) && !BIGZEROP(mod)) {
-	if (divp) *divp = bigadd(*divp, rb_int2big(1), 0);
-	if (modp) *modp = bigadd(mod, y, 1);
+	zds[nx] = 0;
+	j = nx;
+	while (j--) zds[j] = xds[j];
     }
-    else if (modp) {
-	*modp = mod;
-    }
-}
-
-
-static VALUE
-rb_big_divide(VALUE x, VALUE y, ID op)
-{
-    VALUE z;
-
-    if (FIXNUM_P(y)) {
-	y = rb_int2big(FIX2LONG(y));
-    }
-    else if (RB_BIGNUM_TYPE_P(y)) {
-    }
-    else if (RB_FLOAT_TYPE_P(y)) {
-	if (op == '/') {
-	    return DBL2NUM(rb_big2dbl(x) / RFLOAT_VALUE(y));
+    j = nx==ny?nx+1:nx;
+    do {
+	if (zds[j] ==  yds[ny-1]) q = BIGRAD-1;
+	else q = (BIGUP(zds[j]) + zds[j-1])/yds[ny-1];
+	if (q) {
+	    i = 0; num = 0; t2 = 0;
+	    do {			/* multiply and subtract */
+		int ee;
+		t2 += (unsigned long)yds[i] * q;
+		ee = num - BIGLO(t2);
+		num = zds[j - ny + i] + ee;
+		if (ee) zds[j - ny + i] = BIGLO(num);
+		num = BIGDN(num);
+		t2 = BIGDN(t2);
+	    } while (++i < ny);
+	    num += zds[j - ny + i] - t2; /* borrow from high digit; don't update */
+	    while (num) {		/* "add back" required */
+		i = 0; num = 0; q--;
+		do {
+		    int ee = num + yds[i];
+		    num = (long) zds[j - ny + i] + ee;
+		    if (ee) zds[j - ny + i] = BIGLO(num);
+		    num = BIGDN(num);
+		} while (++i < ny);
+		num--;
+	    }
 	}
-	else {
-	    double dy = RFLOAT_VALUE(y);
-	    if (dy == 0.0) rb_num_zerodiv();
-	    return rb_dbl2big(rb_big2dbl(x) / dy);
+	zds[j] = q;
+    } while (--j >= ny);
+    if (div) {			/* move quotient down in z */
+	*div = big_clone(z);
+	zds = BDIGITS(*div);
+	j = (nx==ny ? nx+2 : nx+1) - ny;
+	for (i = 0;i < j;i++) zds[i] = zds[i+ny];
+	RBIGNUM(*div)->len = i;
+	*div = bignorm(*div);
+    }
+    if (mod) {			/* just normalize remainder */
+	*mod = big_clone(z);
+	if (dd) {
+	    zds = BDIGITS(*mod);
+	    t2 = 0; i = ny;
+	    while(i--) {
+		t2 = BIGUP(t2) + zds[i];
+		zds[i] = t2 / dd;
+		t2 %= dd;
+	    }
 	}
+	RBIGNUM(*mod)->len = ny;
+	RBIGNUM(*mod)->sign = RBIGNUM(x)->sign;
+	if (modulo && RBIGNUM(x)->sign != RBIGNUM(y)->sign) {
+	    int len = ny;
+	    zds = BDIGITS(*mod);
+	    while (len-- && !zds[len]);
+	    if (len > 0) {
+		*mod = bigadd(*mod, y, 1);
+		return;
+	    }
+	}
+	*mod = bignorm(*mod);
     }
-    else {
-	return rb_num_coerce_bin(x, y, op);
-    }
-    bigdivmod(x, y, &z, 0);
-
-    return bignorm(z);
 }
 
-/*
- *  call-seq:
- *     big / other     -> Numeric
- *
- * Performs division: the class of the resulting object depends on
- * the class of <code>numeric</code> and on the magnitude of the
- * result.
- */
-
-VALUE
-rb_big_div(VALUE x, VALUE y)
+static VALUE
+big_div(x, y)
+    VALUE x, y;
 {
-    return rb_big_divide(x, y, '/');
-}
-
-/*
- *  call-seq:
- *     big.div(other)  -> integer
- *
- * Performs integer division: returns integer value.
- */
+    VALUE z;
 
-VALUE
-rb_big_idiv(VALUE x, VALUE y)
-{
-    return rb_big_divide(x, y, rb_intern("div"));
-}
+    switch (TYPE(y)) {
+      case T_FIXNUM:
+	y = int2big(FIX2INT(y));
+	break;
 
-/*
- *  call-seq:
- *     big % other         -> Numeric
- *     big.modulo(other)   -> Numeric
- *
- *  Returns big modulo other. See Numeric.divmod for more
- *  information.
- */
+      case T_BIGNUM:
+	break;
 
-VALUE
-rb_big_modulo(VALUE x, VALUE y)
-{
-    VALUE z;
+      case T_FLOAT:
+	return float_new(big2dbl(x) / RFLOAT(y)->value);
 
-    if (FIXNUM_P(y)) {
-	y = rb_int2big(FIX2LONG(y));
-    }
-    else if (!RB_BIGNUM_TYPE_P(y)) {
-	return rb_num_coerce_bin(x, y, '%');
+      default:
+	return num_coerce_bin(x, y);
     }
-    bigdivmod(x, y, 0, &z);
+    bigdivmod(x, y, &z, 0, 0);
 
-    return bignorm(z);
+    return z;
 }
 
-/*
- *  call-seq:
- *     big.remainder(numeric)    -> number
- *
- *  Returns the remainder after dividing <i>big</i> by <i>numeric</i>.
- *
- *     -1234567890987654321.remainder(13731)      #=> -6966
- *     -1234567890987654321.remainder(13731.24)   #=> -9906.22531493148
- */
+
 static VALUE
-rb_big_remainder(VALUE x, VALUE y)
+big_modulo(x, y, modulo)
+    VALUE x, y;
+    int modulo;
 {
     VALUE z;
 
-    if (FIXNUM_P(y)) {
-	y = rb_int2big(FIX2LONG(y));
-    }
-    else if (!RB_BIGNUM_TYPE_P(y)) {
-	return rb_num_coerce_bin(x, y, rb_intern("remainder"));
-    }
-    bigdivrem(x, y, 0, &z);
+    switch (TYPE(y)) {
+      case T_FIXNUM:
+	y = int2big(FIX2INT(y));
+	break;
 
-    return bignorm(z);
-}
+      case T_BIGNUM:
+	break;
 
-/*
- *  call-seq:
- *     big.divmod(numeric)   -> array
- *
- *  See <code>Numeric#divmod</code>.
- *
- */
-VALUE
-rb_big_divmod(VALUE x, VALUE y)
-{
-    VALUE div, mod;
+      case T_FLOAT:
+	y = dbl2big(RFLOAT(y)->value);
+	break;
 
-    if (FIXNUM_P(y)) {
-	y = rb_int2big(FIX2LONG(y));
-    }
-    else if (!RB_BIGNUM_TYPE_P(y)) {
-	return rb_num_coerce_bin(x, y, rb_intern("divmod"));
+      default:
+	return num_coerce_bin(x, y);
     }
-    bigdivmod(x, y, &div, &mod);
-
-    return rb_assoc_new(bignorm(div), bignorm(mod));
-}
+    bigdivmod(x, y, 0, &z, modulo);
 
-static VALUE
-big_shift(VALUE x, long n)
-{
-    if (n < 0)
-	return big_lshift(x, 1+(unsigned long)(-(n+1)));
-    else if (n > 0)
-	return big_rshift(x, (unsigned long)n);
-    return x;
+    return z;
 }
 
 static VALUE
-big_fdiv(VALUE x, VALUE y, long ey)
+big_mod(x, y)
+    VALUE x, y;
 {
-#define DBL_BIGDIG ((DBL_MANT_DIG + BITSPERDIG) / BITSPERDIG)
-    VALUE z;
-    long l, ex;
-
-    bigtrunc(x);
-    l = BIGNUM_LEN(x);
-    ex = l * BITSPERDIG - nlz(BDIGITS(x)[l-1]);
-    ex -= 2 * DBL_BIGDIG * BITSPERDIG;
-    if (ex) x = big_shift(x, ex);
-
-    bigdivrem(x, y, &z, 0);
-    l = ex - ey;
-#if SIZEOF_LONG > SIZEOF_INT
-    {
-	/* Visual C++ can't be here */
-	if (l > INT_MAX) return DBL2NUM(INFINITY);
-	if (l < INT_MIN) return DBL2NUM(0.0);
-    }
-#endif
-    return DBL2NUM(ldexp(big2dbl(z), (int)l));
+    return big_modulo(x, y, 1);
 }
 
 static VALUE
-big_fdiv_int(VALUE x, VALUE y)
+big_remainder(x, y)
+    VALUE x, y;
 {
-    long l, ey;
-    bigtrunc(y);
-    l = BIGNUM_LEN(y);
-    ey = l * BITSPERDIG - nlz(BDIGITS(y)[l-1]);
-    ey -= DBL_BIGDIG * BITSPERDIG;
-    if (ey) y = big_shift(y, ey);
-    return big_fdiv(x, y, ey);
+    return big_modulo(x, y, 0);
 }
 
 static VALUE
-big_fdiv_float(VALUE x, VALUE y)
+big_divmod(x, y)
+    VALUE x, y;
 {
-    int i;
-    y = dbl2big(ldexp(frexp(RFLOAT_VALUE(y), &i), DBL_MANT_DIG));
-    return big_fdiv(x, y, i - DBL_MANT_DIG);
-}
+    VALUE div, mod;
 
-/*
- *  call-seq:
-  *     big.fdiv(numeric) -> float
- *
- *  Returns the floating point result of dividing <i>big</i> by
- *  <i>numeric</i>.
- *
- *     -1234567890987654321.fdiv(13731)      #=> -89910996357705.5
- *     -1234567890987654321.fdiv(13731.24)   #=> -89909424858035.7
- *
- */
+    switch (TYPE(y)) {
+      case T_FIXNUM:
+	y = int2big(FIX2INT(y));
+	break;
 
+      case T_FLOAT:
+	y = dbl2big(RFLOAT(y)->value);
+	break;
 
-VALUE
-rb_big_fdiv(VALUE x, VALUE y)
-{
-    double dx, dy;
+      case T_BIGNUM:
+	break;
 
-    dx = big2dbl(x);
-    if (FIXNUM_P(y)) {
-	dy = (double)FIX2LONG(y);
-	if (isinf(dx))
-	    return big_fdiv_int(x, rb_int2big(FIX2LONG(y)));
+      default:
+	return num_coerce_bin(x, y);
     }
-    else if (RB_BIGNUM_TYPE_P(y)) {
-	dy = rb_big2dbl(y);
-	if (isinf(dx) || isinf(dy))
-	    return big_fdiv_int(x, y);
-    }
-    else if (RB_FLOAT_TYPE_P(y)) {
-	dy = RFLOAT_VALUE(y);
-	if (isnan(dy))
-	    return y;
-	if (isinf(dx))
-	    return big_fdiv_float(x, y);
-    }
-    else {
-	return rb_num_coerce_bin(x, y, rb_intern("fdiv"));
-    }
-    return DBL2NUM(dx / dy);
-}
+    bigdivmod(x, y, &div, &mod, 1);
 
-/*
- *  call-seq:
- *     big ** exponent   -> numeric
- *
- *  Raises _big_ to the _exponent_ power (which may be an integer, float,
- *  or anything that will coerce to a number). The result may be
- *  a Fixnum, Bignum, or Float
- *
- *    123456789 ** 2      #=> 15241578750190521
- *    123456789 ** 1.2    #=> 5126464716.09932
- *    123456789 ** -2     #=> 6.5610001194102e-17
- */
+    return assoc_new(div, mod);;
+}
 
 VALUE
-rb_big_pow(VALUE x, VALUE y)
+big_pow(x, y)
+    VALUE x, y;
 {
     double d;
-    SIGNED_VALUE yy;
-
-  again:
-    if (y == INT2FIX(0)) return INT2FIX(1);
-    if (RB_FLOAT_TYPE_P(y)) {
-	d = RFLOAT_VALUE(y);
-	if ((!BIGNUM_SIGN(x) && !BIGZEROP(x)) && d != round(d))
-	    return rb_funcall(rb_complex_raw1(x), rb_intern("**"), 1, y);
-    }
-    else if (RB_BIGNUM_TYPE_P(y)) {
-	y = bignorm(y);
-	if (FIXNUM_P(y))
-	    goto again;
-	rb_warn("in a**b, b may be too big");
-	d = rb_big2dbl(y);
-    }
-    else if (FIXNUM_P(y)) {
-	yy = FIX2LONG(y);
-
-	if (yy < 0)
-	    return rb_funcall(rb_rational_raw1(x), rb_intern("**"), 1, y);
-	else {
-	    VALUE z = 0;
-	    SIGNED_VALUE mask;
-            const size_t xbits = rb_absint_numwords(x, 1, NULL);
-	    const size_t BIGLEN_LIMIT = 32*1024*1024;
-
-	    if (xbits == (size_t)-1 ||
-                (xbits > BIGLEN_LIMIT) ||
-                (xbits * yy > BIGLEN_LIMIT)) {
-		rb_warn("in a**b, b may be too big");
-		d = (double)yy;
-	    }
-	    else {
-		for (mask = FIXNUM_MAX + 1; mask; mask >>= 1) {
-		    if (z) z = bigsq(z);
-		    if (yy & mask) {
-			z = z ? bigtrunc(bigmul0(z, x)) : x;
-		    }
-		}
-		return bignorm(z);
-	    }
-	}
-    }
-    else {
-	return rb_num_coerce_bin(x, y, rb_intern("**"));
-    }
-    return DBL2NUM(pow(rb_big2dbl(x), d));
-}
-
-static VALUE
-bigand_int(VALUE x, long xn, BDIGIT hibitsx, long y)
-{
     VALUE z;
-    BDIGIT *xds, *zds;
-    long zn;
-    long i;
-    BDIGIT hibitsy;
-
-    if (y == 0) return INT2FIX(0);
-    if (xn == 0) return hibitsx ? LONG2NUM(y) : 0;
-    hibitsy = 0 <= y ? 0 : BDIGMAX;
-    xds = BDIGITS(x);
-#if SIZEOF_BDIGIT >= SIZEOF_LONG
-    if (!hibitsy) {
-	y &= xds[0];
-	return LONG2NUM(y);
-    }
-#endif
+    
+    if (y == INT2FIX(0)) return INT2FIX(1);
+    switch (TYPE(y)) {
+      case T_FLOAT:
+	d = RFLOAT(y)->value;
+	break;
 
-    zn = xn;
-#if SIZEOF_BDIGIT < SIZEOF_LONG
-    if (hibitsx && zn < bdigit_roomof(SIZEOF_LONG))
-        zn = bdigit_roomof(SIZEOF_LONG);
-#endif
+      case T_BIGNUM:
+	if (RBIGNUM(y)->sign) goto pos_big;
+	d = big2dbl(y);
+	break;
 
-    z = bignew(zn, 0);
-    zds = BDIGITS(z);
+      case T_FIXNUM:
+	if (FIX2INT(y) > 0) goto pos_big;
+	d = (double)FIX2INT(y);
+	break;
 
-#if SIZEOF_BDIGIT >= SIZEOF_LONG
-    i = 1;
-    zds[0] = xds[0] & BIGLO(y);
-#else
-    for (i=0; i < xn; i++) {
-        if (y == 0 || y == -1) break;
-        zds[i] = xds[i] & BIGLO(y);
-        y = BIGDN(y);
-    }
-    for (; i < zn; i++) {
-        if (y == 0 || y == -1) break;
-        zds[i] = hibitsx & BIGLO(y);
-        y = BIGDN(y);
-    }
-#endif
-    for (;i < xn; i++) {
-	zds[i] = xds[i] & hibitsy;
+      default:
+	return num_coerce_bin(x, y);
     }
-    for (;i < zn; i++) {
-	zds[i] = hibitsx & hibitsy;
+    return float_new(pow(big2dbl(x), d));
+
+  pos_big:
+    z = x;
+    for (;;) {
+	y = rb_funcall(y, '-', 1, INT2FIX(1));
+	if (y == INT2FIX(0)) break;
+	while (rb_funcall(y, '%', 1, INT2FIX(2)) == INT2FIX(0)) {
+	    y = rb_funcall(y, '/', 1, INT2FIX(2));
+	    x = big_mul(x, x);
+	}
+	z = big_mul(z, x);
     }
-    twocomp2abs_bang(z, hibitsx && hibitsy);
-    RB_GC_GUARD(x);
-    return bignorm(z);
+    return z;
 }
 
-/*
- * call-seq:
- *     big & numeric   ->  integer
- *
- * Performs bitwise +and+ between _big_ and _numeric_.
- */
-
 VALUE
-rb_big_and(VALUE x, VALUE y)
+big_and(x, y)
+    VALUE x, y;
 {
     VALUE z;
-    BDIGIT *ds1, *ds2, *zds;
-    long i, xn, yn, n1, n2;
-    BDIGIT hibitsx, hibitsy;
-    BDIGIT hibits1, hibits2;
-    VALUE tmpv;
-    BDIGIT tmph;
-    long tmpn;
-
-    if (!FIXNUM_P(y) && !RB_BIGNUM_TYPE_P(y)) {
-	return rb_num_coerce_bit(x, y, '&');
-    }
+    USHORT *ds1, *ds2, *zds;
+    unsigned int i, l1, l2;
+    char sign;
 
-    hibitsx = abs2twocomp(&x, &xn);
     if (FIXNUM_P(y)) {
-	return bigand_int(x, xn, hibitsx, FIX2LONG(y));
+	y = int2big(FIX2INT(y));
     }
-    hibitsy = abs2twocomp(&y, &yn);
-    if (xn > yn) {
-        tmpv = x; x = y; y = tmpv;
-        tmpn = xn; xn = yn; yn = tmpn;
-        tmph = hibitsx; hibitsx = hibitsy; hibitsy = tmph;
+    else {
+	Check_Type(y, T_BIGNUM);
     }
-    n1 = xn;
-    n2 = yn;
-    ds1 = BDIGITS(x);
-    ds2 = BDIGITS(y);
-    hibits1 = hibitsx;
-    hibits2 = hibitsy;
-
-    if (!hibits1)
-        n2 = n1;
 
-    z = bignew(n2, 0);
+    if (!RBIGNUM(y)->sign) {
+	y = big_clone(y);
+	big_2comp(y);
+    }
+    if (!RBIGNUM(x)->sign) {
+	x = big_clone(x);
+	big_2comp(x);
+    }
+    if (RBIGNUM(x)->len > RBIGNUM(y)->len) {
+	l1 = RBIGNUM(y)->len;
+	l2 = RBIGNUM(x)->len;
+	ds1 = BDIGITS(y);
+	ds2 = BDIGITS(x);
+	sign = RBIGNUM(y)->sign;
+    }
+    else {
+	l1 = RBIGNUM(x)->len;
+	l2 = RBIGNUM(y)->len;
+	ds1 = BDIGITS(x);
+	ds2 = BDIGITS(y);
+	sign = RBIGNUM(x)->sign;
+    }
+    z = bignew(l2, RBIGNUM(x)->sign && RBIGNUM(y)->sign);
     zds = BDIGITS(z);
 
-    for (i=0; i<n1; i++) {
+    for (i=0; i<l1; i++) {
 	zds[i] = ds1[i] & ds2[i];
     }
-    for (; i<n2; i++) {
-	zds[i] = hibits1 & ds2[i];
+    for (; i<l2; i++) {
+	zds[i] = sign?0:ds2[i];
     }
-    twocomp2abs_bang(z, hibits1 && hibits2);
-    RB_GC_GUARD(x);
-    RB_GC_GUARD(y);
+    if (!RBIGNUM(z)->sign) big_2comp(z);
     return bignorm(z);
 }
 
-static VALUE
-bigor_int(VALUE x, long xn, BDIGIT hibitsx, long y)
+VALUE
+big_or(x, y)
+    VALUE x, y;
 {
     VALUE z;
-    BDIGIT *xds, *zds;
-    long zn;
-    long i;
-    BDIGIT hibitsy;
-
-    if (y == -1) return INT2FIX(-1);
-    if (xn == 0) return hibitsx ? INT2FIX(-1) : LONG2FIX(y);
-    hibitsy = 0 <= y ? 0 : BDIGMAX;
-    xds = BDIGITS(x);
-
-    zn = BIGNUM_LEN(x);
-#if SIZEOF_BDIGIT < SIZEOF_LONG
-    if (zn < bdigit_roomof(SIZEOF_LONG))
-        zn = bdigit_roomof(SIZEOF_LONG);
-#endif
-    z = bignew(zn, 0);
-    zds = BDIGITS(z);
+    USHORT *ds1, *ds2, *zds;
+    unsigned int i, l1, l2;
+    char sign;
 
-#if SIZEOF_BDIGIT >= SIZEOF_LONG
-    i = 1;
-    zds[0] = xds[0] | BIGLO(y);
-    if (i < zn)
-        goto y_is_fixed_point;
-    goto finish;
-#else
-    for (i=0; i < xn; i++) {
-        if (y == 0 || y == -1) goto y_is_fixed_point;
-        zds[i] = xds[i] | BIGLO(y);
-        y = BIGDN(y);
+    if (FIXNUM_P(y)) {
+	y = int2big(FIX2INT(y));
     }
-    if (hibitsx)
-        goto fill_hibits;
-    for (; i < zn; i++) {
-        if (y == 0 || y == -1) goto y_is_fixed_point;
-        zds[i] = BIGLO(y);
-        y = BIGDN(y);
+    else {
+	Check_Type(y, T_BIGNUM);
     }
-  goto finish;
-#endif
 
-  y_is_fixed_point:
-    if (hibitsy)
-        goto fill_hibits;
-    for (; i < xn; i++) {
-        zds[i] = xds[i];
+    if (!RBIGNUM(y)->sign) {
+	y = big_clone(y);
+	big_2comp(y);
     }
-    if (hibitsx)
-        goto fill_hibits;
-    for (; i < zn; i++) {
-        zds[i] = 0;
+    if (!RBIGNUM(x)->sign) {
+	x = big_clone(x);
+	big_2comp(x);
     }
-  goto finish;
+    if (RBIGNUM(x)->len > RBIGNUM(y)->len) {
+	l1 = RBIGNUM(y)->len;
+	l2 = RBIGNUM(x)->len;
+	ds1 = BDIGITS(y);
+	ds2 = BDIGITS(x);
+	sign = RBIGNUM(y)->sign;
+    }
+    else {
+	l1 = RBIGNUM(x)->len;
+	l2 = RBIGNUM(y)->len;
+	ds1 = BDIGITS(x);
+	ds2 = BDIGITS(y);
+	sign = RBIGNUM(x)->sign;
+    }
+    z = bignew(l2, RBIGNUM(x)->sign || RBIGNUM(y)->sign);
+    zds = BDIGITS(z);
 
-  fill_hibits:
-    for (; i < zn; i++) {
-        zds[i] = BDIGMAX;
+    for (i=0; i<l1; i++) {
+	zds[i] = ds1[i] | ds2[i];
     }
+    for (; i<l2; i++) {
+	zds[i] = sign?ds2[i]:(BIGRAD-1);
+    }
+    if (!RBIGNUM(z)->sign) big_2comp(z);
 
-  finish:
-    twocomp2abs_bang(z, hibitsx || hibitsy);
-    RB_GC_GUARD(x);
     return bignorm(z);
 }
 
-/*
- * call-seq:
- *     big | numeric   ->  integer
- *
- * Performs bitwise +or+ between _big_ and _numeric_.
- */
-
 VALUE
-rb_big_or(VALUE x, VALUE y)
+big_xor(x, y)
+    VALUE x, y;
 {
     VALUE z;
-    BDIGIT *ds1, *ds2, *zds;
-    long i, xn, yn, n1, n2;
-    BDIGIT hibitsx, hibitsy;
-    BDIGIT hibits1, hibits2;
-    VALUE tmpv;
-    BDIGIT tmph;
-    long tmpn;
-
-    if (!FIXNUM_P(y) && !RB_BIGNUM_TYPE_P(y)) {
-	return rb_num_coerce_bit(x, y, '|');
-    }
+    USHORT *ds1, *ds2, *zds;
+    unsigned int i, l1, l2;
+    char sign;
 
-    hibitsx = abs2twocomp(&x, &xn);
     if (FIXNUM_P(y)) {
-	return bigor_int(x, xn, hibitsx, FIX2LONG(y));
+	y = int2big(FIX2INT(y));
     }
-    hibitsy = abs2twocomp(&y, &yn);
-    if (xn > yn) {
-        tmpv = x; x = y; y = tmpv;
-        tmpn = xn; xn = yn; yn = tmpn;
-        tmph = hibitsx; hibitsx = hibitsy; hibitsy = tmph;
+    else {
+	Check_Type(y, T_BIGNUM);
     }
-    n1 = xn;
-    n2 = yn;
-    ds1 = BDIGITS(x);
-    ds2 = BDIGITS(y);
-    hibits1 = hibitsx;
-    hibits2 = hibitsy;
-
-    if (hibits1)
-        n2 = n1;
 
-    z = bignew(n2, 0);
+    if (!RBIGNUM(y)->sign) {
+	y = big_clone(y);
+	big_2comp(y);
+    }
+    if (!RBIGNUM(x)->sign) {
+	x = big_clone(x);
+	big_2comp(x);
+    }
+    if (RBIGNUM(x)->len > RBIGNUM(y)->len) {
+	l1 = RBIGNUM(y)->len;
+	l2 = RBIGNUM(x)->len;
+	ds1 = BDIGITS(y);
+	ds2 = BDIGITS(x);
+	sign = RBIGNUM(y)->sign;
+    }
+    else {
+	l1 = RBIGNUM(x)->len;
+	l2 = RBIGNUM(y)->len;
+	ds1 = BDIGITS(x);
+	ds2 = BDIGITS(y);
+	sign = RBIGNUM(x)->sign;
+    }
+    RBIGNUM(x)->sign = RBIGNUM(x)->sign?1:0;
+    RBIGNUM(y)->sign = RBIGNUM(y)->sign?1:0;
+    z = bignew(l2, !(RBIGNUM(x)->sign ^ RBIGNUM(y)->sign));
     zds = BDIGITS(z);
 
-    for (i=0; i<n1; i++) {
-	zds[i] = ds1[i] | ds2[i];
+    for (i=0; i<l1; i++) {
+	zds[i] = ds1[i] ^ ds2[i];
     }
-    for (; i<n2; i++) {
-	zds[i] = hibits1 | ds2[i];
+    for (; i<l2; i++) {
+	zds[i] = sign?ds2[i]:~ds2[i];
     }
-    twocomp2abs_bang(z, hibits1 || hibits2);
-    RB_GC_GUARD(x);
-    RB_GC_GUARD(y);
+    if (!RBIGNUM(z)->sign) big_2comp(z);
+
     return bignorm(z);
 }
 
-static VALUE
-bigxor_int(VALUE x, long xn, BDIGIT hibitsx, long y)
+static VALUE big_rshift();
+
+VALUE
+big_lshift(x, y)
+    VALUE x, y;
 {
+    USHORT *xds, *zds;
+    int shift = NUM2INT(y);
+    unsigned int s1 = shift/BITSPERDIG;
+    unsigned int s2 = shift%BITSPERDIG;
     VALUE z;
-    BDIGIT *xds, *zds;
-    long zn;
-    long i;
-    BDIGIT hibitsy;
+    unsigned long num = 0;
+    unsigned int len, i;
 
-    hibitsy = 0 <= y ? 0 : BDIGMAX;
+    if (shift < 0) return big_rshift(x, INT2FIX(-shift));
     xds = BDIGITS(x);
-    zn = BIGNUM_LEN(x);
-#if SIZEOF_BDIGIT < SIZEOF_LONG
-    if (zn < bdigit_roomof(SIZEOF_LONG))
-        zn = bdigit_roomof(SIZEOF_LONG);
-#endif
-    z = bignew(zn, 0);
+    len = RBIGNUM(x)->len;
+    z = bignew(len+s1+1, RBIGNUM(x)->sign);
     zds = BDIGITS(z);
-
-#if SIZEOF_BDIGIT >= SIZEOF_LONG
-    i = 1;
-    zds[0] = xds[0] ^ BIGLO(y);
-#else
-    for (i = 0; i < xn; i++) {
-        zds[i] = xds[i] ^ BIGLO(y);
-        y = BIGDN(y);
+    for (i=0; i<s1; i++) {
+	*zds++ = 0;
     }
-    for (; i < zn; i++) {
-        zds[i] = hibitsx ^ BIGLO(y);
-        y = BIGDN(y);
-    }
-#endif
-    for (; i < xn; i++) {
-        zds[i] = xds[i] ^ hibitsy;
-    }
-    for (; i < zn; i++) {
-        zds[i] = hibitsx ^ hibitsy;
+    for (i=0; i<len; i++) {
+	num = num | *xds++<<s2;
+	*zds++ = BIGLO(num);
+	num = BIGDN(num);
     }
-    twocomp2abs_bang(z, (hibitsx ^ hibitsy) != 0);
-    RB_GC_GUARD(x);
+    *zds = BIGLO(num);
     return bignorm(z);
 }
-/*
- * call-seq:
- *     big ^ numeric   ->  integer
- *
- * Performs bitwise +exclusive or+ between _big_ and _numeric_.
- */
 
-VALUE
-rb_big_xor(VALUE x, VALUE y)
+static VALUE
+big_rshift(x, y)
+    VALUE x, y;
 {
+    USHORT *xds, *zds;
+    int shift = NUM2INT(y);
+    unsigned int s1 = shift/BITSPERDIG;
+    unsigned int s2 = shift%BITSPERDIG;
     VALUE z;
-    BDIGIT *ds1, *ds2, *zds;
-    long i, xn, yn, n1, n2;
-    BDIGIT hibitsx, hibitsy;
-    BDIGIT hibits1, hibits2;
-    VALUE tmpv;
-    BDIGIT tmph;
-    long tmpn;
-
-    if (!FIXNUM_P(y) && !RB_BIGNUM_TYPE_P(y)) {
-	return rb_num_coerce_bit(x, y, '^');
-    }
+    unsigned long num = 0;
+    unsigned int i = RBIGNUM(x)->len;
+    unsigned int j;
 
-    hibitsx = abs2twocomp(&x, &xn);
-    if (FIXNUM_P(y)) {
-	return bigxor_int(x, xn, hibitsx, FIX2LONG(y));
-    }
-    hibitsy = abs2twocomp(&y, &yn);
-    if (xn > yn) {
-        tmpv = x; x = y; y = tmpv;
-        tmpn = xn; xn = yn; yn = tmpn;
-        tmph = hibitsx; hibitsx = hibitsy; hibitsy = tmph;
+    if (shift < 0) return big_lshift(x, INT2FIX(-shift));
+    if (s1 > RBIGNUM(x)->len) {
+	if (RBIGNUM(x)->sign)
+	    return INT2FIX(0);
+	else
+	    return INT2FIX(-1);
     }
-    n1 = xn;
-    n2 = yn;
-    ds1 = BDIGITS(x);
-    ds2 = BDIGITS(y);
-    hibits1 = hibitsx;
-    hibits2 = hibitsy;
-
-    z = bignew(n2, 0);
+    xds = BDIGITS(x);
+    i = RBIGNUM(x)->len; j = i - s1;
+    z = bignew(j, RBIGNUM(x)->sign);
     zds = BDIGITS(z);
-
-    for (i=0; i<n1; i++) {
-	zds[i] = ds1[i] ^ ds2[i];
+    while (i--, j--) {
+	num = (num | xds[i]) >> s2;
+	zds[j] = BIGLO(num);
+	num = BIGUP(xds[i]);
     }
-    for (; i<n2; i++) {
-	zds[i] = hibitsx ^ ds2[i];
-    }
-    twocomp2abs_bang(z, (hibits1 ^ hibits2) != 0);
-    RB_GC_GUARD(x);
-    RB_GC_GUARD(y);
     return bignorm(z);
 }
 
-/*
- * call-seq:
- *     big << numeric   ->  integer
- *
- * Shifts big left _numeric_ positions (right if _numeric_ is negative).
- */
-
-VALUE
-rb_big_lshift(VALUE x, VALUE y)
-{
-    int lshift_p;
-    size_t shift_numdigits;
-    int shift_numbits;
-
-    for (;;) {
-	if (FIXNUM_P(y)) {
-	    long l = FIX2LONG(y);
-            unsigned long shift;
-	    if (0 <= l) {
-		lshift_p = 1;
-                shift = l;
-            }
-            else {
-		lshift_p = 0;
-		shift = 1+(unsigned long)(-(l+1));
-	    }
-            shift_numbits = (int)(shift & (BITSPERDIG-1));
-            shift_numdigits = shift >> bit_length(BITSPERDIG-1);
-            return bignorm(big_shift3(x, lshift_p, shift_numdigits, shift_numbits));
-	}
-	else if (RB_BIGNUM_TYPE_P(y)) {
-            return bignorm(big_shift2(x, 1, y));
-	}
-	y = rb_to_int(y);
-    }
-}
-
-
-/*
- * call-seq:
- *     big >> numeric   ->  integer
- *
- * Shifts big right _numeric_ positions (left if _numeric_ is negative).
- */
-
-VALUE
-rb_big_rshift(VALUE x, VALUE y)
+static VALUE
+big_aref(x, y)
+    VALUE x, y;
 {
-    int lshift_p;
-    size_t shift_numdigits;
-    int shift_numbits;
+    USHORT *xds;
+    int shift = NUM2INT(y);
+    unsigned int s1, s2;
 
-    for (;;) {
-	if (FIXNUM_P(y)) {
-	    long l = FIX2LONG(y);
-            unsigned long shift;
-            if (0 <= l) {
-                lshift_p = 0;
-                shift = l;
-            }
-            else {
-                lshift_p = 1;
-		shift = 1+(unsigned long)(-(l+1));
-	    }
-            shift_numbits = (int)(shift & (BITSPERDIG-1));
-            shift_numdigits = shift >> bit_length(BITSPERDIG-1);
-            return bignorm(big_shift3(x, lshift_p, shift_numdigits, shift_numbits));
-	}
-	else if (RB_BIGNUM_TYPE_P(y)) {
-            return bignorm(big_shift2(x, 0, y));
-	}
-	y = rb_to_int(y);
-    }
-}
-
-/*
- *  call-seq:
- *     big[n] -> 0, 1
- *
- *  Bit Reference---Returns the <em>n</em>th bit in the (assumed) binary
- *  representation of <i>big</i>, where <i>big</i>[0] is the least
- *  significant bit.
- *
- *     a = 9**15
- *     50.downto(0) do |n|
- *       print a[n]
- *     end
- *
- *  <em>produces:</em>
- *
- *     000101110110100000111000011110010100111100010111001
- *
- */
+    if (shift < 0) return INT2FIX(0);
+    s1 = shift/BITSPERDIG;
+    s2 = shift%BITSPERDIG;
 
-static VALUE
-rb_big_aref(VALUE x, VALUE y)
-{
-    BDIGIT *xds;
-    size_t shift;
-    size_t i, s1, s2;
-    long l;
-    BDIGIT bit;
-
-    if (RB_BIGNUM_TYPE_P(y)) {
-	if (!BIGNUM_SIGN(y))
-	    return INT2FIX(0);
-	bigtrunc(y);
-	if (BIGSIZE(y) > sizeof(size_t)) {
-	  out_of_range:
-	    return BIGNUM_SIGN(x) ? INT2FIX(0) : INT2FIX(1);
-	}
-#if SIZEOF_SIZE_T <= SIZEOF_LONG
-	shift = big2ulong(y, "long");
-#else
-	shift = big2ull(y, "long long");
-#endif
+    if (!RBIGNUM(x)->sign) {
+	if (s1 >= RBIGNUM(x)->len) return INT2FIX(1);
+	x = big_clone(x);
+	big_2comp(x);
     }
     else {
-	l = NUM2LONG(y);
-	if (l < 0) return INT2FIX(0);
-	shift = (size_t)l;
+	if (s1 >= RBIGNUM(x)->len) return INT2FIX(0);
     }
-    s1 = shift/BITSPERDIG;
-    s2 = shift%BITSPERDIG;
-    bit = (BDIGIT)1 << s2;
-
-    if (s1 >= BIGNUM_LEN(x)) goto out_of_range;
-
     xds = BDIGITS(x);
-    if (BIGNUM_POSITIVE_P(x))
-        return (xds[s1] & bit) ? INT2FIX(1) : INT2FIX(0);
-    if (xds[s1] & (bit-1))
-        return (xds[s1] & bit) ? INT2FIX(0) : INT2FIX(1);
-    for (i = 0; i < s1; i++)
-        if (xds[i])
-            return (xds[s1] & bit) ? INT2FIX(0) : INT2FIX(1);
-    return (xds[s1] & bit) ? INT2FIX(1) : INT2FIX(0);
+    if (xds[s1] & (1<<s2))
+	return INT2FIX(1);
+    return INT2FIX(0);
 }
 
-/*
- * call-seq:
- *   big.hash   -> fixnum
- *
- * Compute a hash based on the value of _big_.
- *
- * See also Object#hash.
- */
-
 static VALUE
-rb_big_hash(VALUE x)
+big_hash(x)
+    VALUE x;
 {
-    st_index_t hash;
+    int i, len, key;
+    USHORT *digits;
 
-    hash = rb_memhash(BDIGITS(x), sizeof(BDIGIT)*BIGNUM_LEN(x)) ^ BIGNUM_SIGN(x);
-    return INT2FIX(hash);
+    key = 0; digits = BDIGITS(x);
+    for (i=0,len=RBIGNUM(x)->len; i<RBIGNUM(x)->len; i++) {
+	key ^= *digits++;
+    }
+    return INT2FIX(key);
 }
 
-/*
- * call-seq:
- *   big.coerce(numeric)  ->  array
- *
- * Returns an array with both a +numeric+ and a +big+ represented as Bignum
- * objects.
- *
- * This is achieved by converting +numeric+ to a Bignum.
- *
- * A TypeError is raised if the +numeric+ is not a Fixnum or Bignum type.
- *
- *     (0x3FFFFFFFFFFFFFFF+1).coerce(42)   #=> [42, 4611686018427387904]
- */
-
 static VALUE
-rb_big_coerce(VALUE x, VALUE y)
+big_coerce(x, y)
+    VALUE x, y;
 {
     if (FIXNUM_P(y)) {
-	y = rb_int2big(FIX2LONG(y));
+	return assoc_new(int2big(FIX2INT(y)), x);
     }
-    else if (!RB_BIGNUM_TYPE_P(y)) {
-	rb_raise(rb_eTypeError, "can't coerce %"PRIsVALUE" to Bignum",
-		 rb_obj_class(y));
+    else {
+	TypeError("can't coerce %s to Bignum", rb_class2name(CLASS_OF(y)));
     }
-    return rb_assoc_new(y, x);
+    /* not reached */
 }
 
-/*
- *  call-seq:
- *     big.abs -> aBignum
- *     big.magnitude -> aBignum
- *
- *  Returns the absolute value of <i>big</i>.
- *
- *     -1234567890987654321.abs   #=> 1234567890987654321
- */
-
 static VALUE
-rb_big_abs(VALUE x)
+big_abs(x)
+    VALUE x;
 {
-    if (!BIGNUM_SIGN(x)) {
-	x = rb_big_clone(x);
-	BIGNUM_SET_SIGN(x, 1);
+    if (!RBIGNUM(x)->sign) {
+	x = big_clone(x);
+	RBIGNUM(x)->sign = 1;
     }
     return x;
 }
 
-/*
- *  call-seq:
- *     big.size -> integer
- *
- *  Returns the number of bytes in the machine representation of
- *  <i>big</i>.
- *
- *     (256**10 - 1).size   #=> 12
- *     (256**20 - 1).size   #=> 20
- *     (256**40 - 1).size   #=> 40
- */
-
-static VALUE
-rb_big_size(VALUE big)
-{
-    return SIZET2NUM(BIGSIZE(big));
-}
+/* !!!warnig!!!!
+   this is not really a random number!!
+*/
 
-/*
- *  call-seq:
- *     int.bit_length -> integer
- *
- *  Returns the number of bits of the value of <i>int</i>.
- *
- *  "the number of bits" means that
- *  the bit position of the highest bit which is different to the sign bit.
- *  (The bit position of the bit 2**n is n+1.)
- *  If there is no such bit (zero or minus one), zero is returned.
- *
- *  I.e. This method returns ceil(log2(int < 0 ? -int : int+1)).
- *
- *     (-2**10000-1).bit_length  #=> 10001
- *     (-2**10000).bit_length    #=> 10000
- *     (-2**10000+1).bit_length  #=> 10000
- *
- *     (-2**1000-1).bit_length   #=> 1001
- *     (-2**1000).bit_length     #=> 1000
- *     (-2**1000+1).bit_length   #=> 1000
- *
- *     (2**1000-1).bit_length    #=> 1000
- *     (2**1000).bit_length      #=> 1001
- *     (2**1000+1).bit_length    #=> 1001
- *
- *     (2**10000-1).bit_length   #=> 10000
- *     (2**10000).bit_length     #=> 10001
- *     (2**10000+1).bit_length   #=> 10001
- *
- *  This method can be used to detect overflow in Array#pack as follows.
- *
- *     if n.bit_length < 32
- *       [n].pack("l") # no overflow
- *     else
- *       raise "overflow"
- *     end
- */
-
-static VALUE
-rb_big_bit_length(VALUE big)
+VALUE
+big_rand(max)
+    VALUE max;
 {
-    int nlz_bits;
-    size_t numbytes;
-
-    static const BDIGIT char_bit[1] = { CHAR_BIT };
-    BDIGIT numbytes_bary[bdigit_roomof(sizeof(size_t))];
-    BDIGIT nlz_bary[1];
-    BDIGIT result_bary[bdigit_roomof(sizeof(size_t)+1)];
-
-    numbytes = rb_absint_size(big, &nlz_bits);
-
-    if (numbytes == 0)
-        return LONG2FIX(0);
-
-    if (BIGNUM_NEGATIVE_P(big) && rb_absint_singlebit_p(big)) {
-        if (nlz_bits != CHAR_BIT-1) {
-            nlz_bits++;
-        }
-        else {
-            nlz_bits = 0;
-            numbytes--;
-        }
-    }
+    struct RBignum *v;
+    int len;
 
-    if (numbytes <= SIZE_MAX / CHAR_BIT) {
-        return SIZET2NUM(numbytes * CHAR_BIT - nlz_bits);
+    len = RBIGNUM(max)->len;
+    v = RBIGNUM(bignew(len,1));
+    while (len--) {
+#ifdef HAVE_RANDOM
+	BDIGITS(v)[len] = random();
+#else
+	BDIGITS(v)[len] = rand();
+#endif
     }
 
-    nlz_bary[0] = nlz_bits;
-
-    bary_unpack(BARY_ARGS(numbytes_bary), &numbytes, 1, sizeof(numbytes), 0,
-            INTEGER_PACK_NATIVE_BYTE_ORDER);
-    BARY_SHORT_MUL(result_bary, numbytes_bary, char_bit);
-    BARY_SUB(result_bary, result_bary, nlz_bary);
-
-    return rb_integer_unpack(result_bary, numberof(result_bary), sizeof(BDIGIT), 0,
-            INTEGER_PACK_LSWORD_FIRST|INTEGER_PACK_NATIVE_BYTE_ORDER);
+    return big_mod(v, max);
 }
 
-/*
- *  call-seq:
- *     big.odd? -> true or false
- *
- *  Returns <code>true</code> if <i>big</i> is an odd number.
- */
-
 static VALUE
-rb_big_odd_p(VALUE num)
+big_size(big)
+    VALUE big;
 {
-    if (BIGNUM_LEN(num) != 0 && BDIGITS(num)[0] & 1) {
-	return Qtrue;
-    }
-    return Qfalse;
+    return INT2FIX(RBIGNUM(big)->len*sizeof(USHORT));
 }
 
-/*
- *  call-seq:
- *     big.even? -> true or false
- *
- *  Returns <code>true</code> if <i>big</i> is an even number.
- */
-
 static VALUE
-rb_big_even_p(VALUE num)
+big_zero_p(big)
+    VALUE big;
 {
-    if (BIGNUM_LEN(num) != 0 && BDIGITS(num)[0] & 1) {
-	return Qfalse;
-    }
-    return Qtrue;
+    return FALSE;
 }
 
-/*
- *  Bignum objects hold integers outside the range of
- *  Fixnum. Bignum objects are created
- *  automatically when integer calculations would otherwise overflow a
- *  Fixnum. When a calculation involving
- *  Bignum objects returns a result that will fit in a
- *  Fixnum, the result is automatically converted.
- *
- *  For the purposes of the bitwise operations and <code>[]</code>, a
- *  Bignum is treated as if it were an infinite-length
- *  bitstring with 2's complement representation.
- *
- *  While Fixnum values are immediate, Bignum
- *  objects are not---assignment and parameter passing work with
- *  references to objects, not the objects themselves.
- *
- */
-
 void
-Init_Bignum(void)
-{
-    rb_cBignum = rb_define_class("Bignum", rb_cInteger);
-
-    rb_define_method(rb_cBignum, "to_s", rb_big_to_s, -1);
-    rb_define_alias(rb_cBignum, "inspect", "to_s");
-    rb_define_method(rb_cBignum, "coerce", rb_big_coerce, 1);
-    rb_define_method(rb_cBignum, "-@", rb_big_uminus, 0);
-    rb_define_method(rb_cBignum, "+", rb_big_plus, 1);
-    rb_define_method(rb_cBignum, "-", rb_big_minus, 1);
-    rb_define_method(rb_cBignum, "*", rb_big_mul, 1);
-    rb_define_method(rb_cBignum, "/", rb_big_div, 1);
-    rb_define_method(rb_cBignum, "%", rb_big_modulo, 1);
-    rb_define_method(rb_cBignum, "div", rb_big_idiv, 1);
-    rb_define_method(rb_cBignum, "divmod", rb_big_divmod, 1);
-    rb_define_method(rb_cBignum, "modulo", rb_big_modulo, 1);
-    rb_define_method(rb_cBignum, "remainder", rb_big_remainder, 1);
-    rb_define_method(rb_cBignum, "fdiv", rb_big_fdiv, 1);
-    rb_define_method(rb_cBignum, "**", rb_big_pow, 1);
-    rb_define_method(rb_cBignum, "&", rb_big_and, 1);
-    rb_define_method(rb_cBignum, "|", rb_big_or, 1);
-    rb_define_method(rb_cBignum, "^", rb_big_xor, 1);
-    rb_define_method(rb_cBignum, "~", rb_big_neg, 0);
-    rb_define_method(rb_cBignum, "<<", rb_big_lshift, 1);
-    rb_define_method(rb_cBignum, ">>", rb_big_rshift, 1);
-    rb_define_method(rb_cBignum, "[]", rb_big_aref, 1);
-
-    rb_define_method(rb_cBignum, "<=>", rb_big_cmp, 1);
-    rb_define_method(rb_cBignum, "==", rb_big_eq, 1);
-    rb_define_method(rb_cBignum, ">", big_gt, 1);
-    rb_define_method(rb_cBignum, ">=", big_ge, 1);
-    rb_define_method(rb_cBignum, "<", big_lt, 1);
-    rb_define_method(rb_cBignum, "<=", big_le, 1);
-    rb_define_method(rb_cBignum, "===", rb_big_eq, 1);
-    rb_define_method(rb_cBignum, "eql?", rb_big_eql, 1);
-    rb_define_method(rb_cBignum, "hash", rb_big_hash, 0);
-    rb_define_method(rb_cBignum, "to_f", rb_big_to_f, 0);
-    rb_define_method(rb_cBignum, "abs", rb_big_abs, 0);
-    rb_define_method(rb_cBignum, "magnitude", rb_big_abs, 0);
-    rb_define_method(rb_cBignum, "size", rb_big_size, 0);
-    rb_define_method(rb_cBignum, "bit_length", rb_big_bit_length, 0);
-    rb_define_method(rb_cBignum, "odd?", rb_big_odd_p, 0);
-    rb_define_method(rb_cBignum, "even?", rb_big_even_p, 0);
-
-#ifdef USE_GMP
-    /* The version of loaded GMP. */
-    rb_define_const(rb_cBignum, "GMP_VERSION", rb_sprintf("GMP %s", gmp_version));
-#endif
-
-    power_cache_init();
+Init_Bignum()
+{
+    cBignum = rb_define_class("Bignum", cInteger);
+
+    rb_undef_method(CLASS_OF(cBignum), "new");
+
+    rb_define_method(cBignum, "to_s", big_to_s, 0);
+    rb_define_method(cBignum, "coerce", big_coerce, 1);
+    rb_define_method(cBignum, "-@", big_uminus, 0);
+    rb_define_method(cBignum, "+", big_plus, 1);
+    rb_define_method(cBignum, "-", big_minus, 1);
+    rb_define_method(cBignum, "*", big_mul, 1);
+    rb_define_method(cBignum, "/", big_div, 1);
+    rb_define_method(cBignum, "%", big_mod, 1);
+    rb_define_method(cBignum, "divmod", big_divmod, 1);
+    rb_define_method(cBignum, "**", big_pow, 1);
+    rb_define_method(cBignum, "&", big_and, 1);
+    rb_define_method(cBignum, "|", big_or, 1);
+    rb_define_method(cBignum, "^", big_xor, 1);
+    rb_define_method(cBignum, "~", big_neg, 0);
+    rb_define_method(cBignum, "<<", big_lshift, 1);
+    rb_define_method(cBignum, ">>", big_rshift, 1);
+    rb_define_method(cBignum, "[]", big_aref, 1);
+
+    rb_define_method(cBignum, "<=>", big_cmp, 1);
+    rb_define_method(cBignum, "==", big_eq, 1);
+    rb_define_method(cBignum, "eql?", big_eq, 1);
+    rb_define_method(cBignum, "hash", big_hash, 0);
+    rb_define_method(cBignum, "to_i", big_to_i, 0);
+    rb_define_method(cBignum, "to_f", big_to_f, 0);
+    rb_define_method(cBignum, "abs", big_abs, 0);
+    rb_define_method(cBignum, "size", big_size, 0);
+    rb_define_method(cBignum, "zero?", big_zero_p, 0);
 }
diff --git a/bin/erb b/bin/erb
deleted file mode 100755
index 6a88c3b26a..0000000000
--- a/bin/erb
+++ /dev/null
@@ -1,171 +0,0 @@
-#!/usr/bin/env ruby
-# Tiny eRuby --- ERB2
-# Copyright (c) 1999-2000,2002 Masatoshi SEKI
-# You can redistribute it and/or modify it under the same terms as Ruby.
-
-require 'erb'
-
-class ERB
-  module Main
-    def ARGV.switch
-      return nil if self.empty?
-      arg = self.shift
-      return nil if arg == '--'
-      case arg
-      when /\A-(.)(.*)/
-        if $1 == '-'
-          arg, @maybe_arg = arg.split(/=/, 2)
-          return arg
-        end
-        raise 'unknown switch "-"' if $2[0] == ?- and $1 != 'T'
-        if $2.size > 0
-          self.unshift "-#{$2}"
-          @maybe_arg = $2
-        else
-          @maybe_arg = nil
-        end
-        "-#{$1}"
-      when /\A(\w+)=/
-        arg
-      else
-        self.unshift arg
-        nil
-      end
-    end
-
-    def ARGV.req_arg
-      (@maybe_arg || self.shift || raise('missing argument')).tap {
-        @maybe_arg = nil
-      }
-    end
-
-    def trim_mode_opt(trim_mode, disable_percent)
-      return trim_mode if disable_percent
-      case trim_mode
-      when 0
-        return '%'
-      when 1
-        return '%>'
-      when 2
-        return '%<>'
-      when '-'
-        return '%-'
-      end
-    end
-    module_function :trim_mode_opt
-
-    def run(factory=ERB)
-      trim_mode = 0
-      disable_percent = false
-      variables = {}
-      begin
-        while switch = ARGV.switch
-          case switch
-          when '-x'                        # ruby source
-            output = true
-          when '-n'                        # line number
-            number = true
-          when '-v'                        # verbose
-            $VERBOSE = true
-          when '--version'                 # version
-            STDERR.puts factory.version
-            exit
-          when '-d', '--debug'             # debug
-            $DEBUG = true
-          when '-r'                        # require
-            require ARGV.req_arg
-          when '-S'                        # security level
-            arg = ARGV.req_arg
-            raise "invalid safe_level #{arg.dump}" unless arg =~ /\A[0-1]\z/
-            safe_level = arg.to_i
-          when '-T'                        # trim mode
-            arg = ARGV.req_arg
-            if arg == '-'
-              trim_mode = arg
-              next
-            end
-            raise "invalid trim mode #{arg.dump}" unless arg =~ /\A[0-2]\z/
-            trim_mode = arg.to_i
-          when '-E', '--encoding'
-            arg = ARGV.req_arg
-            set_encoding(*arg.split(/:/, 2))
-          when '-U'
-            set_encoding(Encoding::UTF_8, Encoding::UTF_8)
-          when '-P'
-            disable_percent = true
-          when '--help'
-            raise "print this help"
-          when /\A-/
-            raise "unknown switch #{switch.dump}"
-          else
-            var, val = *switch.split('=', 2)
-            (variables ||= {})[var] = val
-          end
-        end
-      rescue                               # usage
-        STDERR.puts $!.to_s
-        STDERR.puts File.basename($0) +
-          " [switches] [var=value...] [inputfile]"
-        STDERR.puts <<EOU
-  -x               print ruby script
-  -n               print ruby script with line number
-  -v               enable verbose mode
-  -d               set $DEBUG to true
-  -r library       load a library
-  -S safe_level    set $SAFE (0..1)
-  -E ex[:in]       set default external/internal encodings
-  -U               set default encoding to UTF-8.
-  -T trim_mode     specify trim_mode (0..2, -)
-  -P               ignore lines which start with "%"
-  var=value        set variable
-EOU
-        exit 1
-      end
-
-      $<.set_encoding(Encoding::ASCII_8BIT, nil)
-      src = $<.read
-      filename = $FILENAME
-      exit 2 unless src
-      trim = trim_mode_opt(trim_mode, disable_percent)
-      erb = factory.new(src.untaint, safe_level, trim)
-      erb.filename = filename
-      if output
-        if number
-          erb.src.each_line.with_index do |line, l|
-            puts "%3d %s"%[l+1, line]
-          end
-        else
-          puts erb.src
-        end
-      else
-        bind = TOPLEVEL_BINDING.taint
-        if variables
-          enc = erb.encoding
-          for var, val in variables do
-            val = val.encode(enc) if val
-            bind.local_variable_set(var, val)
-          end
-        end
-        erb.run(bind)
-      end
-    end
-    module_function :run
-
-    def set_encoding(extern, intern = nil)
-      verbose, $VERBOSE = $VERBOSE, nil
-      Encoding.default_external = extern unless extern.nil? || extern == ""
-      Encoding.default_internal = intern unless intern.nil? || intern == ""
-      [$stdin, $stdout, $stderr].each do |io|
-        io.set_encoding(extern, intern)
-      end
-    ensure
-      $VERBOSE = verbose
-    end
-    module_function :set_encoding
-    class << self; private :set_encoding; end
-  end
-end
-
-if __FILE__ == $0
-  ERB::Main.run
-end
diff --git a/bin/gem b/bin/gem
deleted file mode 100755
index a4ec754abb..0000000000
--- a/bin/gem
+++ /dev/null
@@ -1,25 +0,0 @@
-#!/usr/bin/env ruby
-#--
-# Copyright 2006 by Chad Fowler, Rich Kilmer, Jim Weirich and others.
-# All rights reserved.
-# See LICENSE.txt for permissions.
-#++
-
-require 'rubygems'
-require 'rubygems/gem_runner'
-require 'rubygems/exceptions'
-
-required_version = Gem::Requirement.new ">= 1.8.7"
-
-unless required_version.satisfied_by? Gem.ruby_version then
-  abort "Expected Ruby Version #{required_version}, is #{Gem.ruby_version}"
-end
-
-args = ARGV.clone
-
-begin
-  Gem::GemRunner.new.run args
-rescue Gem::SystemExitException => e
-  exit e.exit_code
-end
-
diff --git a/bin/irb b/bin/irb
deleted file mode 100755
index c64ee85fbd..0000000000
--- a/bin/irb
+++ /dev/null
@@ -1,11 +0,0 @@
-#!/usr/bin/env ruby
-#
-#   irb.rb - interactive ruby
-#   	$Release Version: 0.9.6 $
-#   	$Revision$
-#   	by Keiju ISHITSUKA(keiju@ruby-lang.org)
-#
-
-require "irb"
-
-IRB.start(__FILE__)
diff --git a/bin/rdoc b/bin/rdoc
deleted file mode 100755
index aaa23292df..0000000000
--- a/bin/rdoc
+++ /dev/null
@@ -1,44 +0,0 @@
-#!/usr/bin/env ruby
-#
-#  RDoc: Documentation tool for source code
-#        (see lib/rdoc/rdoc.rb for more information)
-#
-#  Copyright (c) 2003 Dave Thomas
-#  Released under the same terms as Ruby
-
-begin
-  gem 'rdoc'
-rescue NameError => e # --disable-gems
-  raise unless e.name == :gem
-rescue Gem::LoadError
-end
-
-require 'rdoc/rdoc'
-
-begin
-  r = RDoc::RDoc.new
-  r.document ARGV
-rescue Errno::ENOSPC
-  $stderr.puts 'Ran out of space creating documentation'
-  $stderr.puts
-  $stderr.puts 'Please free up some space and try again'
-rescue SystemExit
-  raise
-rescue Exception => e
-  if $DEBUG_RDOC then
-    $stderr.puts e.message
-    $stderr.puts "#{e.backtrace.join "\n\t"}"
-    $stderr.puts
-  elsif Interrupt === e then
-    $stderr.puts
-    $stderr.puts 'Interrupted'
-  else
-    $stderr.puts "uh-oh! RDoc had a problem:"
-    $stderr.puts e.message
-    $stderr.puts
-    $stderr.puts "run with --debug for full backtrace"
-  end
-
-  exit 1
-end
-
diff --git a/bin/ri b/bin/ri
deleted file mode 100755
index 7fbed0c099..0000000000
--- a/bin/ri
+++ /dev/null
@@ -1,12 +0,0 @@
-#!/usr/bin/env ruby
-
-begin
-  gem 'rdoc'
-rescue NameError => e # --disable-gems
-  raise unless e.name == :gem
-rescue Gem::LoadError
-end
-
-require 'rdoc/ri/driver'
-
-RDoc::RI::Driver.run ARGV
diff --git a/bootstraptest/pending.rb b/bootstraptest/pending.rb
deleted file mode 100644
index 744c0adac1..0000000000
--- a/bootstraptest/pending.rb
+++ /dev/null
@@ -1,39 +0,0 @@
-assert_equal 'A', %q{
-  class A
-    @@a = 'A'
-    def a=(x)
-      @@a = x
-    end
-    def a
-      @@a
-    end
-  end
-
-  B = A.dup
-  B.new.a = 'B'
-  A.new.a
-}, '[ruby-core:17019]'
-
-assert_equal 'ok', %q{
-  def m
-    lambda{
-      proc{
-        return :ng1
-      }
-    }.call.call
-    :ng2
-  end
-
-  begin
-    m()
-  rescue LocalJumpError
-    :ok
-  end
-}
-
-assert_normal_exit %q{
-  r = Range.allocate
-  def r.<=>(o) true end
-  r.instance_eval { initialize r, r }
-  r.inspect
-}
diff --git a/bootstraptest/runner.rb b/bootstraptest/runner.rb
deleted file mode 100755
index d9711fef38..0000000000
--- a/bootstraptest/runner.rb
+++ /dev/null
@@ -1,511 +0,0 @@
-"exec" "${RUBY-ruby}" "-x" "$0" "$@" || true # -*- mode: ruby; coding: utf-8 -*-
-#!./ruby
-# $Id$
-
-# NOTE:
-# Never use optparse in this file.
-# Never use test/unit in this file.
-# Never use Ruby extensions in this file.
-
-begin
-  require 'fileutils'
-  require 'tmpdir'
-rescue LoadError
-  $:.unshift File.join(File.dirname(__FILE__), '../lib')
-  retry
-end
-
-if !Dir.respond_to?(:mktmpdir)
-  # copied from lib/tmpdir.rb
-  def Dir.mktmpdir(prefix_suffix=nil, tmpdir=nil)
-    case prefix_suffix
-    when nil
-      prefix = "d"
-      suffix = ""
-    when String
-      prefix = prefix_suffix
-      suffix = ""
-    when Array
-      prefix = prefix_suffix[0]
-      suffix = prefix_suffix[1]
-    else
-      raise ArgumentError, "unexpected prefix_suffix: #{prefix_suffix.inspect}"
-    end
-    tmpdir ||= Dir.tmpdir
-    t = Time.now.strftime("%Y%m%d")
-    n = nil
-    begin
-      path = "#{tmpdir}/#{prefix}#{t}-#{$$}-#{rand(0x100000000).to_s(36)}"
-      path << "-#{n}" if n
-      path << suffix
-      Dir.mkdir(path, 0700)
-    rescue Errno::EEXIST
-      n ||= 0
-      n += 1
-      retry
-    end
-
-    if block_given?
-      begin
-        yield path
-      ensure
-        FileUtils.remove_entry_secure path
-      end
-    else
-      path
-    end
-  end
-end
-
-def main
-  @ruby = File.expand_path('miniruby')
-  @verbose = false
-  $stress = false
-  @color = nil
-  @tty = nil
-  @quiet = false
-  dir = nil
-  quiet = false
-  tests = nil
-  ARGV.delete_if {|arg|
-    case arg
-    when /\A--ruby=(.*)/
-      @ruby = $1
-      @ruby.gsub!(/^([^ ]*)/){File.expand_path($1)}
-      @ruby.gsub!(/(\s+-I\s*)((?!(?:\.\/)*-(?:\s|\z))\S+)/){$1+File.expand_path($2)}
-      @ruby.gsub!(/(\s+-r\s*)(\.\.?\/\S+)/){$1+File.expand_path($2)}
-      true
-    when /\A--sets=(.*)/
-      tests = Dir.glob("#{File.dirname($0)}/test_{#{$1}}*.rb").sort
-      puts tests.map {|path| File.basename(path) }.inspect
-      true
-    when /\A--dir=(.*)/
-      dir = $1
-      true
-    when /\A(--stress|-s)/
-      $stress = true
-    when /\A--color(?:=(?:always|(auto)|(never)|(.*)))?\z/
-      warn "unknown --color argument: #$3" if $3
-      @color = $1 ? nil : !$2
-      true
-    when /\A--tty(=(?:yes|(no)|(.*)))?\z/
-      warn "unknown --tty argument: #$3" if $3
-      @tty = !$1 || !$2
-      true
-    when /\A(-q|--q(uiet))\z/
-      quiet = true
-      @quiet = true
-      true
-    when /\A(-v|--v(erbose))\z/
-      @verbose = true
-    when /\A(-h|--h(elp)?)\z/
-      puts(<<-End)
-Usage: #{File.basename($0, '.*')} --ruby=PATH [--sets=NAME,NAME,...]
-        --sets=NAME,NAME,...        Name of test sets.
-        --dir=DIRECTORY             Working directory.
-                                    default: /tmp/bootstraptestXXXXX.tmpwd
-        --color[=WHEN]              Colorize the output.  WHEN defaults to 'always'
-                                    or can be 'never' or 'auto'.
-    -s, --stress                    stress test.
-    -v, --verbose                   Output test name before exec.
-    -q, --quiet                     Don\'t print header message.
-    -h, --help                      Print this message and quit.
-End
-      exit true
-    when /\A-j/
-      true
-    else
-      false
-    end
-  }
-  if tests and not ARGV.empty?
-    $stderr.puts "--tests and arguments are exclusive"
-    exit false
-  end
-  tests ||= ARGV
-  tests = Dir.glob("#{File.dirname($0)}/test_*.rb").sort if tests.empty?
-  pathes = tests.map {|path| File.expand_path(path) }
-
-  @progress = %w[- \\ | /]
-  @progress_bs = "\b" * @progress[0].size
-  @tty = $stderr.tty? if @tty.nil?
-  case @color
-  when nil
-    @color = @tty && /dumb/ !~ ENV["TERM"]
-  end
-  @tty &&= !@verbose
-  if @color
-    # dircolors-like style
-    colors = (colors = ENV['TEST_COLORS']) ? Hash[colors.scan(/(\w+)=([^:\n]*)/)] : {}
-    begin
-      File.read(File.join(__dir__, "../test/colors")).scan(/(\w+)=([^:\n]*)/) do |n, c|
-        colors[n] ||= c
-      end
-    rescue
-    end
-    @passed = "\e[;#{colors["pass"] || "32"}m"
-    @failed = "\e[;#{colors["fail"] || "31"}m"
-    @reset = "\e[m"
-  else
-    @passed = @failed = @reset = ""
-  end
-  unless quiet
-    puts Time.now
-    if defined?(RUBY_DESCRIPTION)
-      puts "Driver is #{RUBY_DESCRIPTION}"
-    elsif defined?(RUBY_PATCHLEVEL)
-      puts "Driver is ruby #{RUBY_VERSION} (#{RUBY_RELEASE_DATE}#{RUBY_PLATFORM}) [#{RUBY_PLATFORM}]"
-    else
-      puts "Driver is ruby #{RUBY_VERSION} (#{RUBY_RELEASE_DATE}) [#{RUBY_PLATFORM}]"
-    end
-    puts "Target is #{`#{@ruby} -v`.chomp}"
-    puts
-    $stdout.flush
-  end
-
-  in_temporary_working_directory(dir) {
-    exec_test pathes
-  }
-end
-
-def erase(e = true)
-  if e and @columns > 0 and !@verbose
-    "\r#{" "*@columns}\r"
-  else
-    ""
-  end
-end
-
-def exec_test(pathes)
-  @count = 0
-  @error = 0
-  @errbuf = []
-  @location = nil
-  @columns = 0
-  @width = pathes.map {|path| File.basename(path).size}.max + 2
-  pathes.each do |path|
-    @basename = File.basename(path)
-    $stderr.printf("%s%-*s ", erase(@quiet), @width, @basename)
-    $stderr.flush
-    @columns = @width + 1
-    $stderr.puts if @verbose
-    count = @count
-    error = @error
-    load File.expand_path(path)
-    if @tty
-      if @error == error
-        msg = "PASS #{@count-count}"
-        @columns += msg.size - 1
-        $stderr.print "#{@progress_bs}#{@passed}#{msg}#{@reset}"
-      else
-        msg = "FAIL #{@error-error}/#{@count-count}"
-        $stderr.print "#{@progress_bs}#{@failed}#{msg}#{@reset}"
-        @columns = 0
-      end
-    end
-    $stderr.puts unless @quiet and @tty and @error == error
-  end
-  $stderr.print(erase) if @quiet
-  if @error == 0
-    if @count == 0
-      $stderr.puts "No tests, no problem"
-    else
-      $stderr.puts "#{@passed}PASS#{@reset} all #{@count} tests"
-    end
-    exit true
-  else
-    @errbuf.each do |msg|
-      $stderr.puts msg
-    end
-    $stderr.puts "#{@failed}FAIL#{@reset} #{@error}/#{@count} tests failed"
-    exit false
-  end
-end
-
-def show_progress(message = '')
-  if @verbose
-    $stderr.print "\##{@count} #{@location} "
-  elsif @tty
-    $stderr.print "#{@progress_bs}#{@progress[@count % @progress.size]}"
-  end
-  t = Time.now if @verbose
-  faildesc, errout = with_stderr {yield}
-  t = Time.now - t if @verbose
-  if !faildesc
-    if @tty
-      $stderr.print "#{@progress_bs}#{@progress[@count % @progress.size]}"
-    elsif @verbose
-      $stderr.printf(". %.3f\n", t)
-    else
-      $stderr.print '.'
-    end
-  else
-    $stderr.print "#{@failed}F"
-    $stderr.printf(" %.3f", t) if @verbose
-    $stderr.print "#{@reset}"
-    $stderr.puts if @verbose
-    error faildesc, message
-    unless errout.empty?
-      $stderr.print "#{@failed}stderr output is not empty#{@reset}\n", adjust_indent(errout)
-    end
-    if @tty and !@verbose
-      $stderr.printf("%-*s%s", @width, @basename, @progress[@count % @progress.size])
-    end
-  end
-rescue Interrupt
-  raise Interrupt
-rescue Exception => err
-  $stderr.print 'E'
-  $stderr.puts if @verbose
-  error err.message, message
-end
-
-# NativeClient is special.  The binary is cross-compiled.  But runs on the build environment.
-# So RUBY_PLATFORM in this process is not useful to detect it.
-def nacl?
-  @ruby and File.basename(@ruby.split(/\s/).first)['sel_ldr']
-end
-
-def assert_check(testsrc, message = '', opt = '')
-  show_progress(message) {
-    result = get_result_string(testsrc, opt)
-    check_coredump
-    yield(result)
-  }
-end
-
-def assert_equal(expected, testsrc, message = '')
-  newtest
-  assert_check(testsrc, message) {|result|
-    if expected == result
-      nil
-    else
-      desc = "#{result.inspect} (expected #{expected.inspect})"
-      pretty(testsrc, desc, result)
-    end
-  }
-end
-
-def assert_match(expected_pattern, testsrc, message = '')
-  newtest
-  assert_check(testsrc, message) {|result|
-    if expected_pattern =~ result
-      nil
-    else
-      desc = "#{expected_pattern.inspect} expected to be =~\n#{result.inspect}"
-      pretty(testsrc, desc, result)
-    end
-  }
-end
-
-def assert_not_match(unexpected_pattern, testsrc, message = '')
-  newtest
-  assert_check(testsrc, message) {|result|
-    if unexpected_pattern !~ result
-      nil
-    else
-      desc = "#{unexpected_pattern.inspect} expected to be !~\n#{result.inspect}"
-      pretty(testsrc, desc, result)
-    end
-  }
-end
-
-def assert_valid_syntax(testsrc, message = '')
-  newtest
-  assert_check(testsrc, message, '-c') {|result|
-    result if /Syntax OK/ !~ result
-  }
-end
-
-def assert_normal_exit(testsrc, *rest)
-  newtest
-  opt = {}
-  opt = rest.pop if Hash === rest.last
-  message, ignore_signals = rest
-  message ||= ''
-  timeout = opt[:timeout]
-  show_progress(message) {
-    faildesc = nil
-    filename = make_srcfile(testsrc)
-    old_stderr = $stderr.dup
-    timeout_signaled = false
-    begin
-      $stderr.reopen("assert_normal_exit.log", "w")
-      io = IO.popen("#{@ruby} -W0 #{filename}")
-      pid = io.pid
-      th = Thread.new {
-        io.read
-        io.close
-        $?
-      }
-      if !th.join(timeout)
-        Process.kill :KILL, pid
-        timeout_signaled = true
-      end
-      status = th.value
-    ensure
-      $stderr.reopen(old_stderr)
-      old_stderr.close
-    end
-    if status && status.signaled?
-      signo = status.termsig
-      signame = Signal.list.invert[signo]
-      unless ignore_signals and ignore_signals.include?(signame)
-        sigdesc = "signal #{signo}"
-        if signame
-          sigdesc = "SIG#{signame} (#{sigdesc})"
-        end
-        if timeout_signaled
-          sigdesc << " (timeout)"
-        end
-        faildesc = pretty(testsrc, "killed by #{sigdesc}", nil)
-        stderr_log = File.read("assert_normal_exit.log")
-        if !stderr_log.empty?
-          faildesc << "\n" if /\n\z/ !~ faildesc
-          stderr_log << "\n" if /\n\z/ !~ stderr_log
-          stderr_log.gsub!(/^.*\n/) { '| ' + $& }
-          faildesc << stderr_log
-        end
-      end
-    end
-    faildesc
-  }
-end
-
-def assert_finish(timeout_seconds, testsrc, message = '')
-  newtest
-  show_progress(message) {
-    faildesc = nil
-    filename = make_srcfile(testsrc)
-    io = IO.popen("#{@ruby} -W0 #{filename}")
-    pid = io.pid
-    waited = false
-    tlimit = Time.now + timeout_seconds
-    while Time.now < tlimit
-      if Process.waitpid pid, Process::WNOHANG
-        waited = true
-        break
-      end
-      sleep 0.1
-    end
-    if !waited
-      Process.kill(:KILL, pid)
-      Process.waitpid pid
-      faildesc = pretty(testsrc, "not finished in #{timeout_seconds} seconds", nil)
-    end
-    io.close
-    faildesc
-  }
-end
-
-def flunk(message = '')
-  newtest
-  show_progress('') { message }
-end
-
-def pretty(src, desc, result)
-  src = src.sub(/\A.*\n/, '')
-  (/\n/ =~ src ? "\n#{adjust_indent(src)}" : src) + "  #=> #{desc}"
-end
-
-INDENT = 27
-
-def adjust_indent(src)
-  untabify(src).gsub(/^ {#{INDENT}}/o, '').gsub(/^/, '   ').sub(/\s*\z/, "\n")
-end
-
-def untabify(str)
-  str.gsub(/^\t+/) {' ' * (8 * $&.size) }
-end
-
-def make_srcfile(src)
-  filename = 'bootstraptest.tmp.rb'
-  File.open(filename, 'w') {|f|
-    f.puts "GC.stress = true" if $stress
-    f.puts "print(begin; #{src}; end)"
-  }
-  filename
-end
-
-def get_result_string(src, opt = '')
-  if @ruby
-    filename = make_srcfile(src)
-    begin
-      `#{@ruby} -W0 #{opt} #{filename}`
-    ensure
-      raise Interrupt if $? and $?.signaled? && $?.termsig == Signal.list["INT"]
-      raise CoreDumpError, "core dumped" if $? and $?.coredump?
-    end
-  else
-    eval(src).to_s
-  end
-end
-
-def with_stderr
-  out = err = nil
-  begin
-    r, w = IO.pipe
-    stderr = $stderr.dup
-    $stderr.reopen(w)
-    w.close
-    reader = Thread.start {r.read}
-    begin
-      out = yield
-    ensure
-      $stderr.reopen(stderr)
-      err = reader.value
-    end
-  ensure
-    w.close rescue nil
-    r.close rescue nil
-  end
-  return out, err
-end
-
-def newtest
-  @location = File.basename(caller(2).first)
-  @count += 1
-  cleanup_coredump
-end
-
-def error(msg, additional_message)
-  msg = "#{@failed}\##{@count} #{@location}#{@reset}: #{msg}  #{additional_message}"
-  if @tty
-    $stderr.puts "#{erase}#{msg}"
-  else
-    @errbuf.push msg
-  end
-  @error += 1
-end
-
-def in_temporary_working_directory(dir)
-  if dir
-    Dir.mkdir dir
-    Dir.chdir(dir) {
-      yield
-    }
-  else
-    Dir.mktmpdir(["bootstraptest", ".tmpwd"]) {|d|
-      Dir.chdir(d) {
-        yield
-      }
-    }
-  end
-end
-
-def cleanup_coredump
-  FileUtils.rm_f 'core'
-  FileUtils.rm_f Dir.glob('core.*')
-  FileUtils.rm_f @ruby+'.stackdump' if @ruby
-end
-
-class CoreDumpError < StandardError; end
-
-def check_coredump
-  if File.file?('core') or not Dir.glob('core.*').empty? or
-      (@ruby and File.exist?(@ruby+'.stackdump'))
-    raise CoreDumpError, "core dumped"
-  end
-end
-
-main
diff --git a/bootstraptest/test_attr.rb b/bootstraptest/test_attr.rb
deleted file mode 100644
index 721a847145..0000000000
--- a/bootstraptest/test_attr.rb
+++ /dev/null
@@ -1,36 +0,0 @@
-assert_equal 'ok', %q{
-  module M
-    class A
-      class << self
-        attr_accessor :at
-        def workflow_rule
-          yield self
-        end
-
-        def eval_str(str)
-          eval(str)
-        end
-      end
-    end
-  end
-  begin
-    M::A.eval_str(<<-END)
-    workflow_rule do |r|
-      r.at 1
-    end
-    END
-  rescue ArgumentError => e
-    print "ok"
-  end
-}, '[ruby-core:14641]'
-
-assert_equal %{ok}, %{
-  class A
-    attr :m
-  end
-  begin
-    A.new.m(3)
-  rescue ArgumentError => e
-    print "ok"
-  end
-}, '[ruby-core:15120]'
diff --git a/bootstraptest/test_autoload.rb b/bootstraptest/test_autoload.rb
deleted file mode 100644
index a9f8e6dacd..0000000000
--- a/bootstraptest/test_autoload.rb
+++ /dev/null
@@ -1,70 +0,0 @@
-assert_equal 'ok', %q{
-  File.unlink('zzz.rb') if File.file?('zzz.rb')
-  instance_eval do
-    autoload :ZZZ, './zzz.rb'
-    begin
-      ZZZ
-    rescue LoadError
-      :ok
-    end
-  end
-}, '[ruby-dev:43816]'
-
-assert_equal 'ok', %q{
-  open('zzz.rb', 'w') {|f| f.puts '' }
-  instance_eval do
-    autoload :ZZZ, './zzz.rb'
-    begin
-      ZZZ
-    rescue NameError
-      :ok
-    end
-  end
-}, '[ruby-dev:43816]'
-
-assert_equal 'ok', %q{
-  open('zzz.rb', 'w') {|f| f.puts 'class ZZZ; def self.ok;:ok;end;end'}
-  instance_eval do
-    autoload :ZZZ, './zzz.rb'
-    ZZZ.ok
-  end
-}, '[ruby-dev:43816]'
-
-assert_equal 'ok', %q{
-  open("zzz.rb", "w") {|f| f.puts "class ZZZ; def self.ok;:ok;end;end"}
-  autoload :ZZZ, "./zzz.rb"
-  ZZZ.ok
-}
-
-assert_equal 'ok', %q{
-  open("zzz.rb", "w") {|f| f.puts "class ZZZ; def self.ok;:ok;end;end"}
-  autoload :ZZZ, "./zzz.rb"
-  require "./zzz.rb"
-  ZZZ.ok
-}
-
-assert_equal 'okok', %q{
-  open("zzz.rb", "w") {|f| f.puts "class ZZZ; def self.ok;:ok;end;end"}
-  autoload :ZZZ, "./zzz.rb"
-  t1 = Thread.new {ZZZ.ok}
-  t2 = Thread.new {ZZZ.ok}
-  [t1.value, t2.value].join
-}
-
-assert_finish 5, %q{
-  autoload :ZZZ, File.expand_path(__FILE__)
-  begin
-    ZZZ
-  rescue NameError
-  end
-}, '[ruby-core:21696]'
-
-assert_equal 'A::C', %q{
-  open("zzz.rb", "w") {}
-  class A
-    autoload :C, "./zzz"
-    class C
-    end
-    C
-  end
-}
diff --git a/bootstraptest/test_block.rb b/bootstraptest/test_block.rb
deleted file mode 100644
index cdc5960a59..0000000000
--- a/bootstraptest/test_block.rb
+++ /dev/null
@@ -1,613 +0,0 @@
-assert_equal %q{1}, %q{
-  1.times{
-    begin
-      a = 1
-    ensure
-      foo = nil
-    end
-  }
-}
-assert_equal %q{2}, %q{
-  [1,2,3].find{|x| x == 2}
-}
-assert_equal %q{2}, %q{
-  class E
-    include Enumerable
-    def each(&block)
-      [1, 2, 3].each(&block)
-    end
-  end
-  E.new.find {|x| x == 2 }
-}
-assert_equal %q{6}, %q{
-  sum = 0
-  for x in [1, 2, 3]
-    sum += x
-  end
-  sum
-}
-assert_equal %q{15}, %q{
-  sum = 0
-  for x in (1..5)
-    sum += x
-  end
-  sum
-}
-assert_equal %q{0}, %q{
-  sum = 0
-  for x in []
-    sum += x
-  end
-  sum
-}
-assert_equal %q{1}, %q{
-  ans = []
-  1.times{
-    for n in 1..3
-      a = n
-      ans << a
-    end
-  }
-}
-assert_equal %q{1..3}, %q{
-  ans = []
-  for m in 1..3
-    for n in 1..3
-      a = [m, n]
-      ans << a
-    end
-  end
-}
-assert_equal %q{[1, 2, 3]}, %q{
-  (1..3).to_a
-}
-assert_equal %q{[4, 8, 12]}, %q{
-  (1..3).map{|e|
-    e * 4
-  }
-}
-assert_equal %q{[1, 2, 3]}, %q{
-  class C
-    include Enumerable
-    def each
-      [1,2,3].each{|e|
-        yield e
-      }
-    end
-  end
-
-  C.new.to_a
-}
-assert_equal %q{[4, 5, 6]}, %q{
-  class C
-    include Enumerable
-    def each
-      [1,2,3].each{|e|
-        yield e
-      }
-    end
-  end
-
-  C.new.map{|e|
-    e + 3
-  }
-}
-assert_equal %q{100}, %q{
-  def m
-    yield
-  end
-  def n
-    yield
-  end
-
-  m{
-    n{
-      100
-    }
-  }
-}
-assert_equal %q{20}, %q{
-  def m
-    yield 1
-  end
-
-  m{|ib|
-    m{|jb|
-      i = 20
-    }
-  }
-}
-assert_equal %q{2}, %q{
-  def m
-    yield 1
-  end
-
-  m{|ib|
-    m{|jb|
-      ib = 20
-      kb = 2
-    }
-  }
-}
-assert_equal %q{3}, %q{
-  def iter1
-    iter2{
-      yield
-    }
-  end
-
-  def iter2
-    yield
-  end
-
-  iter1{
-    jb = 2
-    iter1{
-      jb = 3
-    }
-    jb
-  }
-}
-assert_equal %q{2}, %q{
-  def iter1
-    iter2{
-      yield
-    }
-  end
-
-  def iter2
-    yield
-  end
-
-  iter1{
-    jb = 2
-    iter1{
-      jb
-    }
-    jb
-  }
-}
-assert_equal %q{2}, %q{
-  def m
-    yield 1
-  end
-  m{|ib|
-    ib*2
-  }
-}
-assert_equal %q{92580}, %q{
-  def m
-    yield 12345, 67890
-  end
-  m{|ib,jb|
-    ib*2+jb
-  }
-}
-assert_equal %q{[10, nil]}, %q{
-  def iter
-    yield 10
-  end
-
-  a = nil
-  [iter{|a|
-    a
-  }, a]
-}
-assert_equal %q{21}, %q{
-  def iter
-    yield 10
-  end
-
-  iter{|a|
-    iter{|a|
-      a + 1
-    } + a
-  }
-}
-assert_equal %q{[10, 20, 30, 40, nil, nil, nil, nil]}, %q{
-  def iter
-    yield 10, 20, 30, 40
-  end
-
-  a = b = c = d = nil
-  iter{|a, b, c, d|
-    [a, b, c, d]
-  } + [a, b, c, d]
-}
-assert_equal %q{[10, 20, 30, 40, nil, nil]}, %q{
-  def iter
-    yield 10, 20, 30, 40
-  end
-
-  a = b = nil
-  iter{|a, b, c, d|
-    [a, b, c, d]
-  } + [a, b]
-}
-assert_equal %q{[1]}, %q{
-  $a = []
-
-  def iter
-    yield 1
-  end
-
-  def m
-    x = iter{|x|
-      $a << x
-      y = 0
-    }
-  end
-  m
-  $a
-}
-assert_equal %q{[1, [2]]}, %q{
-  def iter
-    yield 1, 2
-  end
-
-  iter{|a, *b|
-    [a, b]
-  }
-}
-assert_equal %q{[[1, 2]]}, %q{
-  def iter
-    yield 1, 2
-  end
-
-  iter{|*a|
-    [a]
-  }
-}
-assert_equal %q{[1, 2, []]}, %q{
-  def iter
-    yield 1, 2
-  end
-
-  iter{|a, b, *c|
-    [a, b, c]
-  }
-}
-assert_equal %q{[1, 2, nil, []]}, %q{
-  def iter
-    yield 1, 2
-  end
-
-  iter{|a, b, c, *d|
-    [a, b, c, d]
-  }
-}
-assert_equal %q{1}, %q{
-  def m
-    yield
-  end
-  m{
-    1
-  }
-}
-assert_equal %q{15129}, %q{
-  def m
-    yield 123
-  end
-  m{|ib|
-    m{|jb|
-      ib*jb
-    }
-  }
-}
-assert_equal %q{2}, %q{
-  def m a
-    yield a
-  end
-  m(1){|ib|
-    m(2){|jb|
-      ib*jb
-    }
-  }
-}
-assert_equal %q{9}, %q{
-  sum = 0
-  3.times{|ib|
-    2.times{|jb|
-      sum += ib + jb
-    }}
-  sum
-}
-assert_equal %q{10}, %q{
-  3.times{|bl|
-    break 10
-  }
-}
-assert_equal %q{[1, 2]}, %q{
-  def iter
-    yield 1,2,3
-  end
-
-  iter{|i, j|
-    [i, j]
-  }
-}
-assert_equal %q{[1, nil]}, %q{
-  def iter
-    yield 1
-  end
-
-  iter{|i, j|
-    [i, j]
-  }
-}
-
-assert_equal '0', %q{
-def m()
-end
-m {|(v0,*,(*)),|}
-m {|(*v0,(*)),|}
-m {|(v0,*v1,(*)),|}
-m {|((v0,*v1,v2)),|}
-m {|(v0,*v1,v2),|}
-m {|(v0,*v1,(v2)),|}
-m {|((*),*v0,v1),|}
-m {|((v0),*v1,v2),|}
-m {|(v0,v1,*v2,v3),|}
-m {|v0,(v1,*v2,v3),|}
-m {|(v0,*v1,v2),v3,|}
-m {|(v0,*v1,v2)|}
-m {|(v0,*v1,v2),&v3|}
-m {|(v0,*v1,v2),*|}
-m {|(v0,*v1,v2),*,&v3|}
-m {|*,(v0,*v1,v2)|}
-m {|*,(v0,*v1,v2),&v3|}
-m {|v0,*,(v1,*v2,v3)|}
-m {|v0,*,(v1,*v2,v3),&v4|}
-m {|(v0,*v1,v2),*,v3|}
-m {|(v0,*v1,v2),*,v3,&v4|}
-m {|(v0, *v1, v2)|}
-m {|(*,v)|}
-0
-}, "block parameter (shouldn't SEGV: [ruby-dev:31143])"
-
-assert_equal 'nil', %q{
-  def m
-    yield
-  end
-  m{|&b| b}.inspect
-}, '[ruby-dev:31147]'
-
-assert_equal 'nil', %q{
-  def m()
-    yield
-  end
-  m {|(v,(*))|}.inspect
-}, '[ruby-dev:31160]'
-
-assert_equal 'nil', %q{
-  def m()
-    yield
-  end
-  m {|(*,a,b)|}.inspect
-}, '[ruby-dev:31153]'
-
-assert_equal 'nil', %q{
-  def m()
-    yield
-  end
-  m {|((*))|}.inspect
-}
-
-assert_equal %q{[1, 1, [1, nil], [1, nil], [1, nil], [1, nil], [1, 1], 1, [1, nil], [1, nil], [1, nil], [1, nil], [[1, 1], [1, 1]], [1, 1], [1, 1], [1, 1], [1, nil], [1, nil], [[[1, 1], [1, 1]], [[1, 1], [1, 1]]], [[1, 1], [1, 1]], [[1, 1], [1, 1]], [[1, 1], [1, 1]], [1, 1], [1, 1], [[[[1, 1], [1, 1]], [[1, 1], [1, 1]]], [[[1, 1], [1, 1]], [[1, 1], [1, 1]]]], [[[1, 1], [1, 1]], [[1, 1], [1, 1]]], [[[1, 1], [1, 1]], [[1, 1], [1, 1]]], [[[1, 1], [1, 1]], [[1, 1], [1, 1]]], [[1, 1], [1, 1]], [[1, 1], [1, 1]]]}, %q{
-def m(ary = [])
-  yield(ary)
-end
-
-$ans = []
-o = 1
-5.times{
-  v,(*) = o; $ans << o
-  m(o){|(v,(*))| $ans << v}
-  ((x, y)) = o; $ans << [x, y]
-  m(o){|((x, y))| $ans << [x, y]}
-  (((x, y))) = o; $ans << [x, y]
-  m(o){|(((x, y)))| $ans << [x, y]}
-  o = [o, o]
-}; $ans
-}
-
-assert_equal '0', %q{
-  def m()
-    yield [0]
-  end
-  m {|*,v| v}.inspect
-}, '[ruby-dev:31437]'
-assert_equal '[0]', %q{
-  def m
-    yield [0]
-  end
-  m{|v, &b| v}.inspect
-}, '[ruby-dev:31440]'
-assert_equal 'ok', %q{
-  begin
-    lambda{|a|}.call(1, 2)
-  rescue ArgumentError
-    :ok
-  else
-    :ng
-  end
-}, '[ruby-dev:31464]'
-assert_equal 'ok', %q{
-  begin
-    lambda{|&b|}.call(3)
-  rescue ArgumentError
-    :ok
-  else
-    :ng
-  end
-}, '[ruby-dev:31472]'
-assert_equal 'ok', %q{
-  class C
-    def each
-      yield [1,2]
-      yield 1,2
-    end
-  end
-  vs1 = []
-  C.new.each {|*v| vs1 << v }
-  vs2 = []
-  C.new.to_enum.each {|*v| vs2 << v }
-  vs1 == vs2 ? :ok : :ng
-}, '[ruby-dev:32329]'
-
-assert_normal_exit %q{
-  e = [1,2,3].each
-  10000.times {
-    e = [e].each
-  }
-  Thread.new { GC.start }.join
-}, '[ruby-dev:32604]'
-
-
-assert_equal '[nil, []]', %q{
-  def m() yield nil,[] end
-  l = lambda {|*v| v}
-  GC.stress=true
-  r = m(&l)
-  GC.stress=false
-  r.inspect
-}, '[ruby-dev:32567]'
-
-assert_equal NilClass.to_s, %q{
-  r = false; 1.times{|&b| r = b}; r.class
-}
-
-assert_equal 'ok', %q{
-  class C
-    define_method(:foo) do |arg, &block|
-      if block then block.call else arg end
-    end
-  end
-  C.new.foo("ng") {"ok"}
-}, '[ruby-talk:266422]'
-
-assert_equal 'ok', %q{
-  class C
-    define_method(:xyz) do |o, k, &block|
-      block.call(o, k)
-    end
-  end
-  C.new.xyz("o","k") {|o, k| o+k}
-}, '[ruby-core:20544]'
-
-assert_equal 'ok', %q{
-  class C
-    define_method(:xyz) do |*args, &block|
-      block.call(*args)
-    end
-  end
-  C.new.xyz("o","k") {|*args| args.join("")}
-}, '[ruby-core:20544]'
-
-assert_equal 'ok', %q{
-  STDERR.reopen(STDOUT)
-  class C
-    define_method(:foo) do |&block|
-      block.call if block
-    end
-    result = "ng"
-    new.foo() {result = "ok"}
-    result
-  end
-}
-
-assert_equal "ok", %q{
-  class Bar
-    def bar; :ok; end
-  end
-  def foo
-    yield(Bar.new) if block_given?
-  end
-  foo(&:bar)
-}, '[ruby-core:14279]'
-
-assert_normal_exit %q{
-  class Controller
-    def respond_to(&block)
-      responder = Responder.new
-      block.call(responder)
-      responder.respond
-    end
-    def test_for_bug
-      respond_to{|format|
-        format.js{
-          puts "in test"
-          render{|obj|
-            puts obj
-          }
-        }
-      }
-    end
-    def render(&block)
-      puts "in render"
-    end
-  end
-
-  class Responder
-    def method_missing(symbol, &block)
-      puts "enter method_missing"
-      @response = Proc.new{
-        puts 'in method missing'
-        block.call
-      }
-      puts "leave method_missing"
-    end
-    def respond
-      @response.call
-    end
-  end
-  t = Controller.new
-  t.test_for_bug
-}, '[ruby-core:14395]'
-
-assert_equal 'true', %q{
-  class C0
-    def foo
-      block_given?
-    end
-  end
-
-  class C1 < C0
-    def foo
-      super
-    end
-  end
-
-  C1.new.foo{}
-}
-
-assert_equal 'true', %q{
-  class C0
-    def foo
-      block_given?
-    end
-  end
-
-  class C1 < C0
-    def foo
-      super()
-    end
-  end
-
-  C1.new.foo{}
-}
-
-assert_equal 'ok', %q{
-  1.times do
-    begin
-      raise
-    rescue
-      begin
-        raise
-      rescue
-        break
-      end
-    end
-  end
-  'ok'
-}
diff --git a/bootstraptest/test_class.rb b/bootstraptest/test_class.rb
deleted file mode 100644
index b7fe0a1acd..0000000000
--- a/bootstraptest/test_class.rb
+++ /dev/null
@@ -1,169 +0,0 @@
-# class
-assert_equal 'true',    %q( class C; end
-                            Object.const_defined?(:C) )
-assert_equal 'Class',   %q( class C; end
-                            C.class )
-assert_equal 'C',       %q( class C; end
-                            C.name )
-assert_equal 'C',       %q( class C; end
-                            C.new.class )
-assert_equal 'C',       %q( class C; end
-                            C.new.class.name )
-assert_equal 'Class',   %q( class C; end
-                            C.new.class.class )
-assert_equal 'true',    %q( Object.__send__(:remove_const, :TrueClass)
-                            GC.start
-                            true.inspect)
-assert_equal 'false',   %q( Object.__send__(:remove_const, :FalseClass)
-                            GC.start
-                            false.inspect)
-assert_equal 'nil',     %q( Object.__send__(:remove_const, :NilClass)
-                            GC.start
-                            nil.inspect)
-
-
-# inherited class
-assert_equal 'true',    %q( class A; end
-                            class C < A; end
-                            Object.const_defined?(:C) )
-assert_equal 'Class',   %q( class A; end
-                            class C < A; end
-                            C.class )
-assert_equal 'C',       %q( class A; end
-                            class C < A; end
-                            C.name )
-assert_equal 'C',       %q( class A; end
-                            class C < A; end
-                            C.new.class )
-assert_equal 'C',       %q( class A; end
-                            class C < A; end
-                            C.new.class.name )
-assert_equal 'Class',   %q( class A; end
-                            class C < A; end
-                            C.new.class.class )
-
-# module
-assert_equal 'true',    %q( module M; end
-                            Object.const_defined?(:M) )
-assert_equal 'Module',  %q( module M; end
-                            M.class )
-assert_equal 'M',       %q( module M; end
-                            M.name )
-assert_equal 'C',       %q( module M; end
-                            class C; include M; end
-                            C.new.class )
-
-# nested class
-assert_equal 'A::B',    %q( class A; end
-                            class A::B; end
-                            A::B )
-assert_equal 'A::B',    %q( class A; end
-                            class A::B; end
-                            A::B.name )
-assert_equal 'A::B',    %q( class A; end
-                            class A::B; end
-                            A::B.new.class )
-assert_equal 'Class',   %q( class A; end
-                            class A::B; end
-                            A::B.new.class.class )
-assert_equal 'A::B::C', %q( class A; end
-                            class A::B; end
-                            class A::B::C; end
-                            A::B::C )
-assert_equal 'A::B::C', %q( class A; end
-                            class A::B; end
-                            class A::B::C; end
-                            A::B::C.name )
-assert_equal 'Class',   %q( class A; end
-                            class A::B; end
-                            class A::B::C; end
-                            A::B::C.class )
-assert_equal 'A::B::C', %q( class A; end
-                            class A::B; end
-                            class A::B::C; end
-                            A::B::C.new.class )
-assert_equal 'Class',   %q( class A; end
-                            class A::B; end
-                            class A::B::C; end
-                            A::B::C.new.class.class )
-assert_equal 'A::B2',   %q( class A; end
-                            class A::B; end
-                            class A::B2 < A::B; end
-                            A::B2 )
-assert_equal 'Class',   %q( class A; end
-                            class A::B; end
-                            class A::B2 < A::B; end
-                            A::B2.class )
-
-# reopen
-assert_equal 'true',    %q( class C; end;  c1 = ::C
-                            class C; end;  c2 = ::C
-                            c1.equal?(c2) )
-assert_equal '1',       %q( class C; end
-                            class A; end
-                            begin class C < A; end; rescue TypeError; 1 end )
-assert_equal '1',       %q( class C; end
-                            begin module C; end; rescue TypeError; 1 end )
-assert_equal '1',       %q( C = 1   # [yarv-dev:782]
-                            begin class C; end; rescue TypeError; 1 end )
-assert_equal '1',       %q( C = 1   # [yarv-dev:800]
-                            begin module C; end; rescue TypeError; 1 end )
-
-# colon2, colon3
-assert_equal '1',       %q( class A; end;  A::C = 1;  A::C )
-assert_equal '1',       %q( A = 7;  begin A::C = 7; rescue TypeError; 1 end )
-assert_equal '1',       %q( begin 7::C = 7; rescue TypeError; 1 end )
-assert_equal 'C',       %q( class A; class ::C; end end;  C )
-assert_equal 'Class',   %q( class A; class ::C; end end;  C.class )
-assert_equal 'OK',      %q( class A; ::C = "OK"; end;  C )
-assert_equal 'String',  %q( class A; ::C = "OK"; end;  C.class )
-
-# class/module dup
-assert_equal 'Class',   %q( class C; end;  C.dup.class )
-assert_equal 'Module',  %q( module M; end;  M.dup.class )
-
-
-assert_equal "ok", %q{
-  module Foo
-  end
-
-  begin
-    def foo(&b)
-      Foo.module_eval &b
-    end
-    foo{
-      def bar
-      end
-    }
-    bar()
-  rescue NameError
-    :ok
-  end
-}, '[ruby-core:14378]'
-
-assert_equal '3', %q{
-  $i = 0
-  class C
-    def self.const_missing *args
-      $i+=1
-    end
-  end
-
-  3.times{
-    C::FOO
-  }
-  $i
-}
-
-assert_match /::C\z/, %q{
-  c = nil
-  Module.new{|m| c = class m::C; name; end}
-  c
-}, '[ruby-dev:38456]'
-
-assert_normal_exit %q{
-  s = Symbol.dup
-  class << s
-  end
-  s.allocate.to_s
-}, '[ruby-core:30843]'
diff --git a/bootstraptest/test_eval.rb b/bootstraptest/test_eval.rb
deleted file mode 100644
index bf7478006d..0000000000
--- a/bootstraptest/test_eval.rb
+++ /dev/null
@@ -1,324 +0,0 @@
-assert_equal %q{ok}, %q{
-  def m
-    a = :ok
-    $b = binding
-  end
-  m
-  eval('a', $b)
-}
-assert_equal %q{[:ok, :ok2]}, %q{
-  def m
-    a = :ok
-    $b = binding
-  end
-  m
-  eval('b = :ok2', $b)
-  eval('[a, b]', $b)
-}
-assert_equal %q{[nil, 1]}, %q{
-  $ans = []
-  def m
-    $b = binding
-  end
-  m
-  $ans << eval(%q{
-    $ans << eval(%q{
-      a
-    }, $b)
-    a = 1
-  }, $b)
-  $ans
-}
-assert_equal %q{C}, %q{
-  Const = :top
-  class C
-    Const = :C
-    def m
-      binding
-    end
-  end
-  eval('Const', C.new.m)
-}
-assert_equal %q{top}, %q{
-  Const = :top
-  a = 1
-  class C
-    Const = :C
-    def m
-      eval('Const', TOPLEVEL_BINDING)
-    end
-  end
-  C.new.m
-}
-assert_equal %q{:ok
-ok}, %q{
-  class C
-    $b = binding
-  end
-  eval %q{
-    def m
-      :ok
-    end
-  }, $b
-  p C.new.m
-}
-assert_equal %q{ok}, %q{
-  b = proc{
-    a = :ok
-    binding
-  }.call
-  a = :ng
-  eval("a", b)
-}
-assert_equal %q{C}, %q{
-  class C
-    def foo
-      binding
-    end
-  end
-  C.new.foo.eval("self.class.to_s")
-}
-assert_equal %q{1}, %q{
-  eval('1')
-}
-assert_equal %q{1}, %q{
-  eval('a=1; a')
-}
-assert_equal %q{1}, %q{
-  a = 1
-  eval('a')
-}
-assert_equal %q{ok}, %q{
-  __send__ :eval, %{
-    :ok
-  }
-}
-assert_equal %q{ok}, %q{
-  1.__send__ :instance_eval, %{
-    :ok
-  }
-}
-assert_equal %q{1}, %q{
-  1.instance_eval{
-    self
-  }
-}
-assert_equal %q{foo}, %q{
-  'foo'.instance_eval{
-    self
-  }
-}
-assert_equal %q{1}, %q{
-  class Fixnum
-    Const = 1
-  end
-  1.instance_eval %{
-    Const
-  }
-}
-assert_equal %q{top}, %q{
-  Const = :top
-  class C
-    Const = :C
-  end
-  C.module_eval{
-    Const
-  }
-}
-assert_equal %q{C}, %q{
-  Const = :top
-  class C
-    Const = :C
-  end
-  C.class_eval %{
-    def m
-      Const
-    end
-  }
-  C.new.m
-}
-assert_equal %q{top}, %q{
-  Const = :top
-  class C
-    Const = :C
-  end
-  C.class_eval{
-    def m
-      Const
-    end
-  }
-  C.new.m
-}
-assert_equal %q{[:top, :C, :top, :C]}, %q{
-  Const = :top
-  class C
-    Const = :C
-  end
-  $nest = false
-  $ans = []
-  def m
-    $ans << Const
-    C.module_eval %{
-      $ans << Const
-      Boo = false unless defined? Boo
-      unless $nest
-        $nest = true
-        m
-      end
-    }
-  end
-  m
-  $ans
-}
-assert_equal %q{[10, main]}, %q{
-  $nested = false
-  $ans = []
-  $pr = proc{
-    $ans << self
-    unless $nested
-      $nested = true
-      $pr.call
-    end
-  }
-  class C
-    def initialize &b
-      10.instance_eval(&b)
-    end
-  end
-  C.new(&$pr)
-  $ans
-}
-
-%w[break next redo].each do |keyword|
-  assert_match %r"Can't escape from eval with #{keyword}\z", %{
-    begin
-      eval "0 rescue #{keyword}"
-    rescue SyntaxError => e
-      e.message
-    end
-  }, '[ruby-dev:31372]'
-end
-
-assert_normal_exit %q{
-  STDERR.reopen(STDOUT)
-  class Foo
-     def self.add_method
-       class_eval("def some-bad-name; puts 'hello' unless @some_variable.some_function(''); end")
-     end
-  end
-  Foo.add_method
-}, '[ruby-core:14556] reported by Frederick Cheung'
-
-assert_equal 'ok', %q{
-  class Module
-    def my_module_eval(&block)
-      module_eval(&block)
-    end
-  end
-  class String
-    Integer.my_module_eval do
-      def hoge; end
-    end
-  end
-  if Integer.instance_methods(false).map{|m|m.to_sym}.include?(:hoge) &&
-     !String.instance_methods(false).map{|m|m.to_sym}.include?(:hoge)
-    :ok
-  else
-    :ng
-  end
-}, "[ruby-dev:34236]"
-
-assert_equal 'ok', %q{
-  begin
-    eval("class nil::Foo; end")
-    :ng
-  rescue Exception
-    :ok
-  end
-}
-
-assert_equal 'ok', %q{
-  begin
-    0.instance_eval { def m() :m end }
-    1.m
-    :ng
-  rescue Exception
-    :ok
-  end
-}, '[ruby-dev:34579]'
-
-assert_equal 'ok', %q{
-  begin
-    12.instance_eval { @@a }
-  rescue NameError
-    :ok
-  end
-}, '[ruby-core:16794]'
-
-assert_equal 'ok', %q{
-  begin
-    12.instance_exec { @@a }
-  rescue NameError
-    :ok
-  end
-}, '[ruby-core:16794]'
-
-assert_equal 'ok', %q{
-  nil.instance_eval {
-    def defd_using_instance_eval() :ok end
-  }
-  nil.defd_using_instance_eval
-}, '[ruby-core:28324]'
-
-assert_equal 'ok', %q{
-  nil.instance_exec {
-    def defd_using_instance_exec() :ok end
-  }
-  nil.defd_using_instance_exec
-}, '[ruby-core:28324]'
-
-assert_normal_exit %q{
-  eval("", method(:proc).call {}.binding)
-}
-
-assert_equal "", %q{
-  b = binding
-  10.times{
-    eval('', b)
-  }
-  begin
-    eval('1.times{raise}', b)
-  rescue => e
-    e.message
-  end
-}, '[ruby-dev:35392]'
-
-assert_equal "[:x]", %q{
-  def kaboom!
-    yield.eval("local_variables")
-  end
-
-  for x in enum_for(:kaboom!)
-    binding
-  end
-}, '[ruby-core:25125]'
-
-assert_normal_exit %q{
-  hash = {}
-  ("aaaa".."matz").each_with_index do |s, i|
-    hash[s] = i
-  end
-  begin
-    eval "class C; @@h = #{hash.inspect}; end"
-  end
-}, '[ruby-core:25714]'
-
-assert_normal_exit %q{
-  begin
-    eval("# encoding:utf-16le\nfoo")
-  rescue Exception => e
-    p e
-    RubyVM::InstructionSequence.compile("p:hello")
-  end
-}, 'check escaping the internal value th->base_block'
-
diff --git a/bootstraptest/test_exception.rb b/bootstraptest/test_exception.rb
deleted file mode 100644
index 35c8d25e37..0000000000
--- a/bootstraptest/test_exception.rb
+++ /dev/null
@@ -1,432 +0,0 @@
-assert_equal %q{2}, %q{
-  begin
-    1+1
-  ensure
-    2+2
-  end
-}
-assert_equal %q{4}, %q{
-  begin
-    1+1
-    begin
-      2+2
-    ensure
-      3+3
-    end
-  ensure
-    4+4
-  end
-}
-assert_equal %q{4}, %q{
-  begin
-    1+1
-    begin
-      2+2
-    ensure
-      3+3
-    end
-  ensure
-    4+4
-    begin
-      5+5
-    ensure
-      6+6
-    end
-  end
-}
-assert_equal %q{NilClass}, %q{
-  a = nil
-  1.times{|e|
-    begin
-    rescue => err
-    end
-    a = err.class
-  }
-  a
-}
-assert_equal %q{RuntimeError}, %q{
-  a = nil
-  1.times{|e|
-    begin
-      raise
-    rescue => err
-    end
-    a = err.class
-  }
-  a
-}
-assert_equal %q{}, %q{
-  $!
-}
-assert_equal %q{FOO}, %q{
-  begin
-    raise "FOO"
-  rescue
-    $!
-  end
-}
-assert_equal %q{FOO}, %q{
-  def m
-    $!
-  end
-  begin
-    raise "FOO"
-  rescue
-    m()
-  end
-}
-assert_equal %q{[#<RuntimeError: BAR>, #<RuntimeError: FOO>]}, %q{
-  $ans = []
-  def m
-    $!
-  end
-  begin
-    raise "FOO"
-  rescue
-    begin
-      raise "BAR"
-    rescue
-      $ans << m()
-    end
-    $ans << m()
-  end
-  $ans
-}
-assert_equal %q{[#<RuntimeError: FOO>, #<RuntimeError: FOO>]}, %q{
-  $ans = []
-  def m
-    $!
-  end
-
-  begin
-    begin
-      raise "FOO"
-    ensure
-      $ans << m()
-    end
-  rescue
-    $ans << m()
-  end
-}
-assert_equal %q{[nil]}, %q{
-  $ans = []
-  def m
-    $!
-  end
-  def m2
-    1.times{
-      begin
-        return
-      ensure
-        $ans << m
-      end
-    }
-  end
-  m2
-  $ans
-}
-assert_equal %q{ok}, %q{
-  begin
-    raise
-  rescue
-    :ok
-  end
-}
-assert_equal %q{ok}, %q{
-  begin
-    raise
-  rescue
-    :ok
-  ensure
-    :ng
-  end
-}
-assert_equal %q{RuntimeError}, %q{
-  begin
-    raise
-  rescue => e
-    e.class
-  end
-}
-assert_equal %q{ng}, %q{
-  begin
-    raise
-  rescue StandardError
-    :ng
-  rescue Exception
-    :ok
-  end
-}
-assert_equal %q{c}, %q{
-  begin
-    begin
-      raise "a"
-    rescue
-      raise "b"
-    ensure
-      raise "c"
-    end
-  rescue => e
-    e.message
-  end
-}
-assert_equal %q{33}, %q{
-  def m a, b
-    a + b
-  end
-  m(1, begin
-         raise
-       rescue
-         2
-       end) +
-  m(10, begin
-         raise
-       rescue
-         20
-       ensure
-         30
-       end)
-}
-assert_equal %q{3}, %q{
-  def m a, b
-    a + b
-  end
-  m(begin
-      raise
-    rescue
-      1
-    end,
-    begin
-      raise
-    rescue
-      2
-    end)
-}
-assert_equal %q{ok3}, %q{
-  class E1 < Exception
-  end
-
-  def m
-    yield
-  end
-
-  begin
-    begin
-      begin
-        m{
-          raise
-        }
-      rescue E1
-        :ok2
-      ensure
-      end
-    rescue
-      :ok3
-    ensure
-    end
-  rescue E1
-    :ok
-  ensure
-  end
-}
-assert_equal %q{7}, %q{
-  $i = 0
-  def m
-    iter{
-      begin
-        $i += 1
-        begin
-          $i += 2
-          break
-        ensure
-
-        end
-      ensure
-        $i += 4
-      end
-      $i = 0
-    }
-  end
-
-  def iter
-    yield
-  end
-  m
-  $i
-}
-assert_equal %q{10}, %q{
-  $i = 0
-  def m
-    begin
-      $i += 1
-      begin
-        $i += 2
-        return
-      ensure
-        $i += 3
-      end
-    ensure
-      $i += 4
-    end
-    p :end
-  end
-  m
-  $i
-}
-assert_equal %q{1}, %q{
-  begin
-    1
-  rescue
-    2
-  end
-}
-assert_equal %q{4}, %q{
-  begin
-    1
-    begin
-      2
-    rescue
-      3
-    end
-    4
-  rescue
-    5
-  end
-}
-assert_equal %q{3}, %q{
-  begin
-    1
-  rescue
-    2
-  else
-    3
-  end
-}
-assert_equal %q{2}, %q{
-  begin
-    1+1
-  rescue
-    2+2
-  ensure
-    3+3
-  end
-   }
-assert_equal %q{2}, %q{
-  begin
-    1+1
-  rescue
-    2+2
-  ensure
-    3+3
-  end
-   }
-assert_equal %q{6}, %q{
-  begin
-    1+1
-  rescue
-    2+2
-  else
-    3+3
-  ensure
-    4+4
-  end
-   }
-assert_equal %q{12}, %q{
- begin
-   1+1
-   begin
-     2+2
-   rescue
-     3+3
-   else
-     4+4
-   end
- rescue
-   5+5
- else
-   6+6
- ensure
-   7+7
- end
-   }
-assert_equal %q{ok}, %q{ #
-  proc{
-    begin
-      raise
-      break
-    rescue
-      :ok
-    end
-  }.call
-}
-assert_equal %q{}, %q{
-  proc do
-    begin
-      raise StandardError
-      redo
-    rescue StandardError
-    end
-  end.call
-}
-
-##
-assert_match /undefined method `foo\'/, %q{#`
-  STDERR.reopen(STDOUT)
-  class C
-    def inspect
-      bar {}
-    end
-
-    def bar
-      raise
-    ensure
-    end
-  end
-  C.new.foo
-}, "[ruby-dev:31407]"
-
-assert_equal 'nil', %q{
-  doit = false
-  exc = nil
-  t = Thread.new {
-    begin
-      doit = true
-      sleep 10
-    ensure
-      exc = $!
-    end
-  }
-  Thread.pass until doit
-  t.kill
-  t.join
-  exc.inspect
-}, '[ruby-dev:32608]'
-
-assert_equal 'exception class/object expected', %q{
-  class ZeroDivisionError
-    def self.new(message)
-      42
-    end
-  end
-  begin
-    1/0
-  rescue Exception => e
-    e.message
-  end
-}, '[ruby-core:24767]'
-
-assert_equal 'ok', %q{
-  class C
-    def ===(o)
-      true
-    end
-  end
-  begin
-    begin
-      raise
-    rescue C.new
-    end
-  rescue TypeError
-    :ok
-  end
-}
diff --git a/bootstraptest/test_finalizer.rb b/bootstraptest/test_finalizer.rb
deleted file mode 100644
index 22a16b1220..0000000000
--- a/bootstraptest/test_finalizer.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-assert_normal_exit %q{
-a1,a2,b1,b2=Array.new(4){""}
-ObjectSpace.define_finalizer(b2,proc{})
-ObjectSpace.define_finalizer(b1,proc{b1.inspect})
-
-ObjectSpace.define_finalizer(a2,proc{a1.inspect})
-ObjectSpace.define_finalizer(a1,proc{})
-}, '[ruby-dev:35778]'
diff --git a/bootstraptest/test_flip.rb b/bootstraptest/test_flip.rb
deleted file mode 100644
index ff194868b2..0000000000
--- a/bootstraptest/test_flip.rb
+++ /dev/null
@@ -1 +0,0 @@
-assert_equal %q{E}, %q{$_ = "E"; eval("nil if true..~/^E/",nil,"-e"); $_}
diff --git a/bootstraptest/test_flow.rb b/bootstraptest/test_flow.rb
deleted file mode 100644
index 0390062a24..0000000000
--- a/bootstraptest/test_flow.rb
+++ /dev/null
@@ -1,591 +0,0 @@
-assert_equal %q{[1, 2, 4, 5, 6, 7, 8]}, %q{$a = []; begin;  ; $a << 1
-  [1,2].each{; $a << 2
-    break; $a << 3
-  }; $a << 4
-  begin; $a << 5
-  ensure; $a << 6
-  end; $a << 7
-; $a << 8
-; rescue Exception; $a << 99; end; $a}
-assert_equal %q{[1, 2, 3, 5, 6, 7, 8]}, %q{$a = []; begin;  ; $a << 1
-  begin; $a << 2
-    [1,2].each do; $a << 3
-      break; $a << 4
-    end; $a << 5
-  ensure; $a << 6
-  end; $a << 7
-; $a << 8
-; rescue Exception; $a << 99; end; $a}
-assert_equal %q{ok}, %q{
-  ["a"].inject("ng"){|x,y|
-    break :ok
-  }
-}
-assert_equal %q{ok}, %q{
-  unless ''.respond_to? :lines
-    class String
-      def lines
-        self
-      end
-    end
-  end
-
-  ('a').lines.map{|e|
-    break :ok
-  }
-}
-assert_equal %q{[1, 2, 4, 5]}, %q{$a = []; begin; ; $a << 1
-  ["a"].inject("ng"){|x,y|; $a << 2
-    break :ok; $a << 3
-  }; $a << 4
-; $a << 5
-; rescue Exception; $a << 99; end; $a}
-assert_equal %q{[1, 2, 4, 5]}, %q{$a = []; begin; ; $a << 1
-  ('a'..'b').map{|e|; $a << 2
-    break :ok; $a << 3
-  }; $a << 4
-; $a << 5
-; rescue Exception; $a << 99; end; $a}
-assert_equal %q{[1, 2, 3, 5, 7, 8]}, %q{$a = []; begin;  ; $a << 1
-  [1,2].each do; $a << 2
-    begin; $a << 3
-      break; $a << 4
-    ensure; $a << 5
-    end; $a << 6
-  end; $a << 7
-; $a << 8
-; rescue Exception; $a << 99; end; $a}
-assert_equal %q{[1, 2, 3, 4, 5, 6, 9, 10]}, %q{$a = []; begin; ; $a << 1
-  i=0; $a << 2
-  while i<3; $a << 3
-    i+=1; $a << 4
-    begin; $a << 5
-    ensure; $a << 6
-      break; $a << 7
-    end; $a << 8
-  end; $a << 9
-; $a << 10
-; rescue Exception; $a << 99; end; $a}
-assert_equal %q{[1, 2, 3, 4, 5, 7, 10, 11]}, %q{$a = []; begin; ; $a << 1
-  i=0; $a << 2
-  while i<3; $a << 3
-    i+=1; $a << 4
-    begin; $a << 5
-      raise; $a << 6
-    ensure; $a << 7
-      break; $a << 8
-    end; $a << 9
-  end; $a << 10
-; $a << 11
-; rescue Exception; $a << 99; end; $a}
-assert_equal %q{[1, 2, 3, 4, 5, 7, 10, 11]}, %q{$a = []; begin; ; $a << 1
-  i=0; $a << 2
-  while i<3; $a << 3
-    i+=1; $a << 4
-    begin; $a << 5
-      raise; $a << 6
-    rescue; $a << 7
-      break; $a << 8
-    end; $a << 9
-  end; $a << 10
-; $a << 11
-; rescue Exception; $a << 99; end; $a}
-assert_equal %q{[1, 2, 3, 5, 8, 9]}, %q{$a = []; begin;  ; $a << 1
-  [1,2].each do; $a << 2
-    begin; $a << 3
-      raise StandardError; $a << 4
-    ensure; $a << 5
-      break; $a << 6
-    end; $a << 7
-  end; $a << 8
-; $a << 9
-; rescue Exception; $a << 99; end; $a}
-assert_equal %q{[1, 2, 3, 5, 8, 9]}, %q{$a = []; begin;  ; $a << 1
-  [1,2].each do; $a << 2
-    begin; $a << 3
-      raise StandardError; $a << 4
-    rescue; $a << 5
-      break; $a << 6
-    end; $a << 7
-  end; $a << 8
-; $a << 9
-; rescue Exception; $a << 99; end; $a}
-assert_equal %q{[1, 2, 3, 4, 6, 8, 10, 11]}, %q{$a = []; begin;  ; $a << 1
-  [1,2].each do; $a << 2
-    begin; $a << 3
-      begin; $a << 4
-        break; $a << 5
-      ensure; $a << 6
-      end; $a << 7
-    ensure; $a << 8
-    end; $a << 9
-  end; $a << 10
-; $a << 11
-; rescue Exception; $a << 99; end; $a}
-assert_equal %q{[1, 2, 3, 4, 5, 6, 7, 8, 10, 13, 3, 4, 5, 6, 7, 8, 10, 13, 3, 4, 5, 6, 7, 8, 10, 13, 14, 15]}, %q{$a = []; begin; ; $a << 1
-  i = 0; $a << 2
-  while i<3; $a << 3
-    i+=1; $a << 4
-    j = 0; $a << 5
-    while j<3; $a << 6
-      j+=1; $a << 7
-      begin; $a << 8
-        raise; $a << 9
-      rescue; $a << 10
-        break; $a << 11
-      end; $a << 12
-    end; $a << 13
-  end; $a << 14
-; $a << 15
-; rescue Exception; $a << 99; end; $a}
-assert_equal %q{[1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 14, 6, 7, 8, 9, 11, 14, 6, 7, 8, 9, 11, 14, 15, 3, 4, 5, 6, 7, 8, 9, 11, 14, 6, 7, 8, 9, 11, 14, 6, 7, 8, 9, 11, 14, 15, 3, 4, 5, 6, 7, 8, 9, 11, 14, 6, 7, 8, 9, 11, 14, 6, 7, 8, 9, 11, 14, 15, 16, 17]}, %q{$a = []; begin; ; $a << 1
-  i = 0; $a << 2
-  while i<3; $a << 3
-    i+=1; $a << 4
-    j = 0; $a << 5
-    while j<3; $a << 6
-      j+=1; $a << 7
-      1.times{; $a << 8
-        begin; $a << 9
-          raise; $a << 10
-        rescue; $a << 11
-          break; $a << 12
-        end; $a << 13
-      }; $a << 14
-    end; $a << 15
-  end; $a << 16
-; $a << 17
-; rescue Exception; $a << 99; end; $a}
-assert_equal %q{[1, 2, 3, 4, 5, 6, 7, 8, 10, 13, 3, 4, 5, 6, 7, 8, 10, 13, 3, 4, 5, 6, 7, 8, 10, 13, 14, 15]}, %q{$a = []; begin; ; $a << 1
-  i = 0; $a << 2
-  while i<3; $a << 3
-    i+=1; $a << 4
-    j = 0; $a << 5
-    while j<3; $a << 6
-      j+=1; $a << 7
-      begin; $a << 8
-        raise; $a << 9
-      ensure; $a << 10
-        break; $a << 11
-      end; $a << 12
-    end; $a << 13
-  end; $a << 14
-; $a << 15
-; rescue Exception; $a << 99; end; $a}
-assert_equal %q{[1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 14, 6, 7, 8, 9, 11, 14, 6, 7, 8, 9, 11, 14, 15, 3, 4, 5, 6, 7, 8, 9, 11, 14, 6, 7, 8, 9, 11, 14, 6, 7, 8, 9, 11, 14, 15, 3, 4, 5, 6, 7, 8, 9, 11, 14, 6, 7, 8, 9, 11, 14, 6, 7, 8, 9, 11, 14, 15, 16, 17]}, %q{$a = []; begin; ; $a << 1
-  i = 0; $a << 2
-  while i<3; $a << 3
-    i+=1; $a << 4
-    j = 0; $a << 5
-    while j<3; $a << 6
-      j+=1; $a << 7
-      1.times{; $a << 8
-        begin; $a << 9
-          raise; $a << 10
-        ensure; $a << 11
-          break; $a << 12
-        end; $a << 13
-      }; $a << 14
-    end; $a << 15
-  end; $a << 16
-; $a << 17
-; rescue Exception; $a << 99; end; $a}
-assert_equal %q{[1, 2, 3, 5, 8, 9]}, %q{$a = []; begin; ; $a << 1
-  while true; $a << 2
-    begin; $a << 3
-      break; $a << 4
-    ensure; $a << 5
-      break; $a << 6
-    end; $a << 7
-  end; $a << 8
-; $a << 9
-; rescue Exception; $a << 99; end; $a}
-assert_equal %q{[1, 2, 3, 5, 99]}, %q{
-$a = [];
-begin; ; $a << 1
-  while true; $a << 2
-    begin; $a << 3
-      break; $a << 4
-    ensure; $a << 5
-      raise; $a << 6
-    end; $a << 7
-  end; $a << 8
-; $a << 9
-; rescue Exception; $a << 99; end; $a}
-assert_equal %q{[1, 2, 3, 4, 6, 8, 9, 10, 11]}, %q{$a = []; begin;  ; $a << 1
-  begin; $a << 2
-    [1,2].each do; $a << 3
-      begin; $a << 4
-        break; $a << 5
-      ensure; $a << 6
-      end; $a << 7
-    end; $a << 8
-  ensure; $a << 9
-  end; $a << 10
-; $a << 11
-; rescue Exception; $a << 99; end; $a}
-assert_equal %q{[1, 2, 4, 99]}, %q{$a = []; begin; ; $a << 1
-  begin; $a << 2
-    raise StandardError; $a << 3
-  ensure; $a << 4
-  end; $a << 5
-; $a << 6
-; rescue Exception; $a << 99; end; $a}
-assert_equal %q{[1, 2, 3, 4]}, %q{$a = []; begin;  ; $a << 1
-  begin; $a << 2
-  ensure; $a << 3
-  end ; $a << 4
-; rescue Exception; $a << 99; end; $a}
-assert_equal %q{[1, 2, 3, 5, 99]}, %q{$a = []; begin;  ; $a << 1
-  [1,2].each do; $a << 2
-    begin; $a << 3
-      break; $a << 4
-    ensure; $a << 5
-      raise StandardError; $a << 6
-    end; $a << 7
-  end; $a << 8
-; $a << 9
-; rescue Exception; $a << 99; end; $a}
-assert_equal %q{3}, %q{
-  def m a, b
-    a + b
-  end
-  m(1,
-    while true
-      break 2
-    end
-    )
-}
-assert_equal %q{4}, %q{
-  def m a, b
-    a + b
-  end
-  m(1,
-    (i=0; while i<2
-       i+=1
-       class C
-         next 2
-       end
-     end; 3)
-    )
-}
-assert_equal %q{34}, %q{
-  def m a, b
-    a+b
-  end
-  m(1, 1.times{break 3}) +
-  m(10, (1.times{next 3}; 20))
-}
-assert_equal %q{[1, 2, 3, 6, 7]}, %q{$a = []; begin; ; $a << 1
-  3.times{; $a << 2
-    class C; $a << 3
-      break; $a << 4
-    end; $a << 5
-  }; $a << 6
-; $a << 7
-; rescue Exception; $a << 99; end; $a}
-assert_equal %q{[1, 2, 3, 4, 8, 9]}, %q{$a = []; begin; ; $a << 1
-  3.times{; $a << 2
-    class A; $a << 3
-      class B; $a << 4
-        break; $a << 5
-      end; $a << 6
-    end; $a << 7
-  }; $a << 8
-; $a << 9
-; rescue Exception; $a << 99; end; $a}
-assert_equal %q{[1, 2, 3, 2, 3, 2, 3, 6, 7]}, %q{$a = []; begin; ; $a << 1
-  3.times{; $a << 2
-    class C; $a << 3
-      next; $a << 4
-    end; $a << 5
-  }; $a << 6
-; $a << 7
-; rescue Exception; $a << 99; end; $a}
-assert_equal %q{[1, 2, 3, 4, 2, 3, 4, 2, 3, 4, 8, 9]}, %q{$a = []; begin; ; $a << 1
-  3.times{; $a << 2
-    class C; $a << 3
-      class D; $a << 4
-        next; $a << 5
-      end; $a << 6
-    end; $a << 7
-  }; $a << 8
-; $a << 9
-; rescue Exception; $a << 99; end; $a}
-assert_equal %q{[1, 2, 3, 6, 7]}, %q{$a = []; begin; ; $a << 1
-  while true; $a << 2
-    class C; $a << 3
-      break; $a << 4
-    end; $a << 5
-  end; $a << 6
-; $a << 7
-; rescue Exception; $a << 99; end; $a}
-assert_equal %q{[1, 2, 3, 4, 8, 9]}, %q{$a = []; begin; ; $a << 1
-  while true; $a << 2
-    class C; $a << 3
-      class D; $a << 4
-        break; $a << 5
-      end; $a << 6
-    end; $a << 7
-  end; $a << 8
-; $a << 9
-; rescue Exception; $a << 99; end; $a}
-assert_equal %q{[1, 2, 3, 4, 5, 3, 4, 5, 3, 4, 5, 8, 9]}, %q{$a = []; begin; ; $a << 1
-  i=0; $a << 2
-  while i<3; $a << 3
-    i+=1; $a << 4
-    class C; $a << 5
-      next 10; $a << 6
-    end; $a << 7
-  end; $a << 8
-; $a << 9
-; rescue Exception; $a << 99; end; $a}
-assert_equal %q{1}, %q{
-  1.times{
-    while true
-      class C
-        begin
-          break
-        ensure
-          break
-        end
-      end
-    end
-  }
-}
-assert_equal %q{[1, 2, 3, 5, 2, 3, 5, 7, 8]}, %q{$a = []; begin;  ; $a << 1
-  [1,2].each do; $a << 2
-    begin; $a << 3
-      next; $a << 4
-    ensure; $a << 5
-    end; $a << 6
-  end; $a << 7
-; $a << 8
-; rescue Exception; $a << 99; end; $a}
-assert_equal %q{[1, 2, 6, 3, 5, 7, 8]}, %q{$a = []; begin;  ; $a << 1
-  o = "test"; $a << 2
-  def o.test(a); $a << 3
-    return a; $a << 4
-  ensure; $a << 5
-  end; $a << 6
-  o.test(123); $a << 7
-; $a << 8
-; rescue Exception; $a << 99; end; $a}
-assert_equal %q{[1, 4, 7, 5, 8, 9]}, %q{$a = []; begin; ; $a << 1
-  def m1 *args; $a << 2
-    ; $a << 3
-  end; $a << 4
-  def m2; $a << 5
-    m1(:a, :b, (return 1; :c)); $a << 6
-  end; $a << 7
-  m2; $a << 8
-; $a << 9
-; rescue Exception; $a << 99; end; $a}
-assert_equal %q{[1, 8, 2, 3, 4, 5, 9, 10]}, %q{$a = []; begin; ; $a << 1
-  def m(); $a << 2
-    begin; $a << 3
-      2; $a << 4
-    ensure; $a << 5
-      return 3; $a << 6
-    end; $a << 7
-  end; $a << 8
-  m; $a << 9
-; $a << 10
-; rescue Exception; $a << 99; end; $a}
-assert_equal %q{[1, 3, 11, 4, 5, 6, 7, 12, 13]}, %q{$a = []; begin; ; $a << 1
-  def m2; $a << 2
-  end; $a << 3
-  def m(); $a << 4
-    m2(begin; $a << 5
-         2; $a << 6
-       ensure; $a << 7
-         return 3; $a << 8
-       end); $a << 9
-    4; $a << 10
-  end; $a << 11
-  m(); $a << 12
-; $a << 13
-; rescue Exception; $a << 99; end; $a}
-assert_equal %q{[1, 16, 2, 3, 4, 5, 6, 7, 10, 11, 17, 18]}, %q{$a = []; begin; ; $a << 1
-  def m; $a << 2
-    1; $a << 3
-    1.times{; $a << 4
-      2; $a << 5
-      begin; $a << 6
-        3; $a << 7
-        return; $a << 8
-        4; $a << 9
-      ensure; $a << 10
-        5; $a << 11
-      end; $a << 12
-      6; $a << 13
-    }; $a << 14
-    7; $a << 15
-  end; $a << 16
-  m(); $a << 17
-; $a << 18
-; rescue Exception; $a << 99; end; $a}
-assert_equal %q{[:ok, :ok2, :last]}, %q{
-  a = []
-  i = 0
-  begin
-    while i < 1
-      i+=1
-      begin
-        begin
-          next
-        ensure
-          a << :ok
-        end
-      ensure
-        a << :ok2
-      end
-    end
-  ensure
-    a << :last
-  end
-  a
-}
-assert_equal %q{[:ok, :ok2, :last]}, %q{
-  a = []
-  i = 0
-  begin
-    while i < 1
-      i+=1
-      begin
-        begin
-          break
-        ensure
-          a << :ok
-        end
-      ensure
-        a << :ok2
-      end
-    end
-  ensure
-    a << :last
-  end
-  a
-}
-assert_equal %q{[:ok, :ok2, :last]}, %q{
-  a = []
-  i = 0
-  begin
-    while i < 1
-      if i>0
-        break
-      end
-      i+=1
-      begin
-        begin
-          redo
-        ensure
-          a << :ok
-        end
-      ensure
-        a << :ok2
-      end
-    end
-  ensure
-    a << :last
-  end
-  a
-}
-assert_equal %Q{ENSURE\n}, %q{
-  def test
-    while true
-      return
-    end
-  ensure
-    puts("ENSURE")
-  end
-  test
-}, '[ruby-dev:37967]'
-
-[['[ruby-core:28129]', %q{
-  class Bug2728
-    include Enumerable
-    define_method(:dynamic_method) do
-      "dynamically defined method"
-    end
-    def each
-      begin
-        yield :foo
-      ensure
-        dynamic_method
-      end
-    end
-  end
-  e = Bug2728.new
-}],
- ['[ruby-core:28132]', %q{
-  class Bug2729
-    include Enumerable
-    def each
-      begin
-        yield :foo
-      ensure
-        proc {}.call
-      end
-    end
-  end
-  e = Bug2729.new
-}],
- ['[ruby-core:39125]', %q{
-  class Bug5234
-    include Enumerable
-    def each
-      begin
-        yield :foo
-      ensure
-        proc
-      end
-    end
-  end
-  e = Bug5234.new
-}],
- ['[ruby-dev:45656]', %q{
-  class Bug6460
-    include Enumerable
-    def each
-      begin
-        yield :foo
-      ensure
-        1.times { Proc.new }
-      end
-    end
-  end
-  e = Bug6460.new
-}]].each do |bug, src|
-  assert_equal "foo", src + %q{e.detect {true}}, bug
-  assert_equal "true", src + %q{e.any? {true}}, bug
-  assert_equal "false", src + %q{e.all? {false}}, bug
-  assert_equal "true", src + %q{e.include?(:foo)}, bug
-end
-
-assert_equal "foo", %q{
-  class Bug6460
-    def m1
-      m2 {|e|
-        return e
-      }
-    end
-
-    def m2
-      begin
-        yield :foo
-      ensure
-        begin
-          begin
-            yield :foo
-          ensure
-            Proc.new
-            raise ''
-          end
-        rescue
-        end
-      end
-    end
-  end
-  Bug6460.new.m1
-}, '[ruby-dev:46372]'
diff --git a/bootstraptest/test_fork.rb b/bootstraptest/test_fork.rb
deleted file mode 100644
index 1cd9f7ac6c..0000000000
--- a/bootstraptest/test_fork.rb
+++ /dev/null
@@ -1,75 +0,0 @@
-assert_equal '0', %q{
-  begin
-    GC.stress = true
-    pid = fork {}
-    Process.wait pid
-    $?.to_i
-  rescue NotImplementedError
-    0
-  end
-}, '[ruby-dev:32404]'
-
-assert_finish 10, %q{
-  begin
-    children = (1..10).map{
-      Thread.start{fork{}}.value
-    }
-    while !children.empty? and pid = Process.wait
-      children.delete(pid)
-    end
-  rescue NotImplementedError
-  end
-}, '[ruby-core:22158]'
-
-assert_normal_exit(<<'End', '[ruby-dev:37934]')
-  main = Thread.current
-  Thread.new { sleep 0.01 until main.stop?; Thread.kill main }
-  Process.setrlimit(:NPROC, 1) if defined?(Process::RLIMIT_NPROC)
-  fork {}
-End
-
-assert_equal 'ok', %q{
-  begin
-    r, w = IO.pipe
-    if pid1 = fork
-      w.close
-      r.read(1)
-      Process.kill("USR1", pid1)
-      _, s = Process.wait2(pid1)
-      s.success? ? :ok : :ng
-    else
-      r.close
-      if pid2 = fork
-        trap("USR1") { Time.now.to_s; Process.kill("USR2", pid2) }
-        w.close
-        Process.wait2(pid2)
-      else
-        w.close
-        sleep 0.2
-      end
-      exit true
-    end
-  rescue NotImplementedError
-    :ok
-  end
-}, '[ruby-core:28924]'
-
-assert_equal '[1, 2]', %q{
-  a = []
-  main = Thread.current
-  trap(:INT) { a.push(1).size == 2 and main.wakeup }
-  trap(:TERM) { a.push(2).size == 2 and main.wakeup }
-  pid = $$
-  begin
-    pid = fork do
-      Process.kill(:INT, pid)
-      Process.kill(:TERM, pid)
-    end
-    Process.wait(pid)
-    100.times {break if a.size > 1; sleep 0.001}
-    a.sort
-  rescue NotImplementedError
-    [1, 2]
-  end
-}, '[ruby-dev:44005] [Ruby 1.9 - Bug #4950]'
-
diff --git a/bootstraptest/test_gc.rb b/bootstraptest/test_gc.rb
deleted file mode 100644
index eb68c9845e..0000000000
--- a/bootstraptest/test_gc.rb
+++ /dev/null
@@ -1,34 +0,0 @@
-assert_normal_exit %q{
-a = []
-ms = "a".."k"
-("A".."Z").each do |mod|
-  mod = eval("module #{mod}; self; end")
-  ms.each do |meth|
-    iseq = RubyVM::InstructionSequence.compile("module #{mod}; def #{meth}; end; end")
-    GC.stress = true
-    iseq.eval
-    GC.stress = false
-  end
-  o = Object.new.extend(mod)
-  ms.each do |meth|
-    o.send(meth)
-  end
-end
-}, '[ruby-dev:39453]'
-
-assert_normal_exit %q{
-a = []
-ms = "a".."k"
-("A".."Z").each do |mod|
-  mod = eval("module #{mod}; self; end")
-  ms.each do |meth|
-    GC.stress = true
-    mod.module_eval {define_method(meth) {}}
-    GC.stress = false
-  end
-  o = Object.new.extend(mod)
-  ms.each do |meth|
-    o.send(meth)
-  end
-end
-}, '[ruby-dev:39453]'
diff --git a/bootstraptest/test_io.rb b/bootstraptest/test_io.rb
deleted file mode 100644
index 1d2b19368a..0000000000
--- a/bootstraptest/test_io.rb
+++ /dev/null
@@ -1,112 +0,0 @@
-assert_finish 5, %q{
-  r, w = IO.pipe
-  t1 = Thread.new { r.sysread(1) }
-  t2 = Thread.new { r.sysread(1) }
-  sleep 0.01 until t1.stop? and t2.stop?
-  w.write "a"
-  w.write "a"
-}, '[ruby-dev:31866]'
-
-assert_finish 10, %q{
-  begin
-    require "io/nonblock"
-    require "timeout"
-    timeout(3) do
-      r, w = IO.pipe
-      w.nonblock?
-      w.nonblock = true
-      w.write_nonblock("a" * 100000)
-      w.nonblock = false
-      t1 = Thread.new { w.write("b" * 4096) }
-      t2 = Thread.new { w.write("c" * 4096) }
-      sleep 0.5
-      r.sysread(4096).length
-      sleep 0.5
-      r.sysread(4096).length
-      t1.join
-      t2.join
-    end
-  rescue LoadError, Timeout::Error, NotImplementedError
-  end
-}, '[ruby-dev:32566]'
-
-assert_finish 1, %q{
-  r, w = IO.pipe
-  Thread.new {
-    w << "ab"
-    sleep 0.01
-    w << "ab"
-  }
-  r.gets("abab")
-}
-
-assert_equal 'ok', %q{
-  require 'tmpdir'
-  begin
-    tmpname = "#{Dir.tmpdir}/ruby-btest-#{$$}-#{rand(0x100000000).to_s(36)}"
-    rw = File.open(tmpname, File::RDWR|File::CREAT|File::EXCL)
-  rescue Errno::EEXIST
-    retry
-  end
-  save = STDIN.dup
-  STDIN.reopen(rw)
-  STDIN.reopen(save)
-  rw.close
-  File.unlink(tmpname) unless RUBY_PLATFORM['nacl']
-  :ok
-}
-
-assert_equal 'ok', %q{
-  require 'tmpdir'
-  begin
-    tmpname = "#{Dir.tmpdir}/ruby-btest-#{$$}-#{rand(0x100000000).to_s(36)}"
-    rw = File.open(tmpname, File::RDWR|File::CREAT|File::EXCL)
-  rescue Errno::EEXIST
-    retry
-  end
-  save = STDIN.dup
-  STDIN.reopen(rw)
-  STDIN.print "a"
-  STDIN.reopen(save)
-  rw.close
-  File.unlink(tmpname) unless RUBY_PLATFORM['nacl']
-  :ok
-}
-
-assert_equal 'ok', %q{
-  dup = STDIN.dup
-  dupfd = dup.fileno
-  dupfd == STDIN.dup.fileno ? :ng : :ok
-}, '[ruby-dev:46834]'
-
-assert_normal_exit %q{
-  ARGF.set_encoding "foo"
-}
-
-10.times do
-  assert_normal_exit %q{
-    at_exit { p :foo }
-
-    megacontent = "abc" * 12345678
-    #File.open("megasrc", "w") {|f| f << megacontent }
-
-    t0 = Thread.main
-    Thread.new { sleep 0.001 until t0.stop?; Process.kill(:INT, $$) }
-
-    r1, w1 = IO.pipe
-    r2, w2 = IO.pipe
-    t1 = Thread.new { w1 << megacontent; w1.close }
-    t2 = Thread.new { r2.read; r2.close }
-    IO.copy_stream(r1, w2) rescue nil
-    w2.close
-    r1.close
-    t1.join
-    t2.join
-  }, 'megacontent-copy_stream', ["INT"], :timeout => 10 or break
-end
-
-assert_normal_exit %q{
-  r, w = IO.pipe
-  STDOUT.reopen(w)
-  STDOUT.reopen(__FILE__, "r")
-}, '[ruby-dev:38131]'
diff --git a/bootstraptest/test_jump.rb b/bootstraptest/test_jump.rb
deleted file mode 100644
index 595aaa7c4b..0000000000
--- a/bootstraptest/test_jump.rb
+++ /dev/null
@@ -1,308 +0,0 @@
-assert_equal %q{ok}, %q{
-  def m
-    :ng1
-    mm{
-      yield
-    }
-    :ng2
-  end
-
-  def mm
-    :ng3
-    yield
-    :ng4
-  end
-
-  m{
-    break :ok
-  }
-}
-assert_equal %q{ok}, %q{
-  3.times{
-    break :ok
-  }
-}
-assert_equal %q{}, %q{
-  catch(:foo){
-    throw :foo
-  }
-}
-assert_equal %q{false}, %q{
-  catch(:foo){
-    throw :foo, false
-  }
-}
-assert_equal %q{}, %q{
-  catch(:foo){
-    throw :foo, nil
-  }
-}
-assert_equal %q{ok}, %q{
-  catch(:foo){
-    throw :foo, :ok
-  }
-}
-assert_equal %q{}, %q{
-  catch(:foo){
-    1.times{
-      throw :foo
-    }
-  }
-}
-assert_equal %q{ok}, %q{
-  catch(:foo){
-    1.times{
-      throw :foo, :ok
-    }
-  }
-}
-assert_equal %q{ok}, %q{
-  catch(:foo){
-    catch(:bar){
-      throw :foo, :ok
-    }
-    :ng
-  }
-}
-assert_equal %q{ok}, %q{
-  catch(:foo){
-    catch(:bar){
-      1.times{
-        throw :foo, :ok
-      }
-    }
-    :ng
-  }
-}
-assert_equal %q{2}, %q{
-  module Enumerable
-    def all_?
-      self.each{|e|
-        unless yield(e)
-          return false
-        end
-      }
-      true
-    end
-  end
-
-  xxx = 0
-  [1,2].each{|bi|
-    [3,4].each{|bj|
-      [true, nil, true].all_?{|be| be}
-      break
-    }
-    xxx += 1
-  }
-  xxx
-}
-assert_equal %q{ok}, %q{
-  def m
-    yield
-  end
-
-  m{
-    begin
-    ensure
-      break :ok
-    end
-  }
-}
-assert_equal %q{ok}, %q{
-  def m
-    yield
-    :ok
-  end
-  i=0
-  m{
-    if i>10
-      i*i
-    else
-      i+=1
-      next
-    end
-  }
-}
-assert_equal %q{ok}, %q{
-  def m
-    yield
-  end
-
-  m{
-    next :ok
-  }
-}
-assert_equal %q{131}, %q{
-  def m
-    yield + 10
-  end
-  i=0
-  m{
-    if i>10
-      i*i
-    else
-      i+=1
-      redo
-    end
-  }
-}
-assert_equal %q{ok}, %q{
-begin
-  eval %q{
-    1.times{
-      retry
-    }
-  }
-rescue SyntaxError
-  :ok
-end
-}
-assert_equal %q{3}, %q{
-  def m
-    return 3
-  end
-  m
-}
-assert_equal %q{ok}, %q{
-  def m
-    :ng1
-    mm{
-      return :ok
-    }
-    :ng2
-  end
-
-  def mm
-    :ng3
-    yield
-    :ng4
-  end
-  m
-}
-assert_equal %q{100}, %q{
-  $i = 0
-  def m
-    begin
-      iter{
-        return
-      }
-    ensure
-      $i = 100
-    end
-  end
-
-  def iter
-    yield
-  end
-  m
-  $i
-}
-assert_equal %q{ok}, %q{
-  def m
-    begin
-      raise
-    rescue
-      return :ok
-    end
-    :ng
-  end
-  m
-}
-assert_equal %q{1}, %q{
-  def m
-    begin
-      raise
-    rescue
-      return 1
-    end
-  end
-
-  m
-}
-assert_equal %q{1}, %q{
-  def m
-    begin
-      #
-    ensure
-      return 1
-    end
-  end
-
-  m
-}
-assert_equal 'ok', %q{
-  begin
-    catch {|t| throw t, :ok }
-  rescue ArgumentError
-    :ng
-  end
-}, '[ruby-dev:31609]'
-
-assert_equal "1", %q{
-  catch do |t|
-    begin
-      throw t, 1
-      2
-    ensure
-      3
-    end
-  end
-}, "[ruby-dev:31698]"
-
-assert_normal_exit %q{
-  f = 0
-  1.times do
-    begin
-      f += 1
-    ensure
-      redo unless f > 2
-    end
-  end
-}
-
-assert_normal_exit %q{
-  -> do
-    1.times do
-      begin
-        raise
-      rescue
-        return
-      end
-    end
-  end.call
-}
-
-assert_normal_exit %q{
-  while true
-    begin
-      raise
-      next
-    rescue
-    end
-    break
-  end
-}, '[ruby-core:28172]'
-
-assert_equal "true", %q{
-  class Object
-    def return_eigenclass
-      class << self
-        return self
-      end
-    end
-  end
-  s = "foo"
-  s.return_eigenclass == class << s; self; end
-}, '[ruby-core:21379]'
-
-assert_equal "true", %q{
-  class Object
-    def yield_eigenclass
-      class << self
-        yield self
-      end
-    end
-  end
-  s = "foo"
-  s.yield_eigenclass {|c| c == class << s; self; end }
-}, '[ruby-dev:40975]'
diff --git a/bootstraptest/test_literal.rb b/bootstraptest/test_literal.rb
deleted file mode 100644
index aa65bddae1..0000000000
--- a/bootstraptest/test_literal.rb
+++ /dev/null
@@ -1,231 +0,0 @@
-# empty program
-assert_equal '',                ''
-assert_equal '',                ' '
-assert_equal '',                "\n"
-
-# special const
-assert_equal 'true',            'true'
-assert_equal 'TrueClass',       'true.class'
-assert_equal 'false',           'false'
-assert_equal 'FalseClass',      'false.class'
-assert_equal '',                'nil'
-assert_equal 'nil',             'nil.inspect'
-assert_equal 'NilClass',        'nil.class'
-assert_equal 'sym',             ':sym'
-assert_equal ':sym',            ':sym.inspect'
-assert_equal 'Symbol',          ':sym.class'
-assert_equal '1234',            '1234'
-assert_equal 'Fixnum',          '1234.class'
-assert_equal '1234',            '1_2_3_4'
-assert_equal 'Fixnum',          '1_2_3_4.class'
-assert_equal '18',              '0x12'
-assert_equal 'Fixnum',          '0x12.class'
-assert_equal '15',              '0o17'
-assert_equal 'Fixnum',          '0o17.class'
-assert_equal '5',               '0b101'
-assert_equal 'Fixnum',          '0b101.class'
-assert_equal '123456789012345678901234567890', '123456789012345678901234567890'
-assert_equal 'Bignum',          '123456789012345678901234567890.class'
-assert_equal '2.0',             '2.0'
-assert_equal 'Float',           '1.3.class'
-
-# self
-assert_equal 'main',            'self'
-assert_equal 'Object',          'self.class'
-
-# string literal
-assert_equal 'a',               '?a'
-assert_equal 'String',          '?a.class'
-assert_equal 'A',               '?A'
-assert_equal 'String',          '?A.class'
-assert_equal "\n",              '?\n'
-assert_equal 'String',          '?\n.class'
-assert_equal ' ',               '?\ '
-assert_equal 'String',          '?\ .class'
-assert_equal 'string',          "'string'"
-assert_equal 'string',          '"string"'
-assert_equal 'string',          '%(string)'
-assert_equal 'string',          '%q(string)'
-assert_equal 'string',          '%Q(string)'
-assert_equal 'string string',   '"string string"'
-assert_equal ' ',               '" "'
-assert_equal "\0",              '"\0"'
-assert_equal "\1",              '"\1"'
-assert_equal "3",               '"\x33"'
-assert_equal "\n",              '"\n"'
-
-# dynamic string literal
-assert_equal '2',               '"#{1 + 1}"'
-assert_equal '16',              '"#{2 ** 4}"'
-assert_equal 'string',          's = "string"; "#{s}"'
-
-# dynamic symbol literal
-assert_equal 'a3c',             ':"a#{1+2}c"'
-assert_equal ':a3c',            ':"a#{1+2}c".inspect'
-assert_equal 'Symbol',          ':"a#{1+2}c".class'
-
-# xstring
-unless nacl?
-  assert_equal "foo\n",           %q(`echo foo`)
-  assert_equal "foo\n",           %q(s = "foo"; `echo #{s}`)
-end
-
-# regexp
-assert_equal '',                '//.source'
-assert_equal 'Regexp',          '//.class'
-assert_equal '0',               '// =~ "a"'
-assert_equal '0',               '// =~ ""'
-assert_equal 'a',               '/a/.source'
-assert_equal 'Regexp',          '/a/.class'
-assert_equal '0',               '/a/ =~ "a"'
-assert_equal '0',               '/test/ =~ "test"'
-assert_equal '',                '/test/ =~ "tes"'
-assert_equal '0',               're = /test/; re =~ "test"'
-assert_equal '0',               'str = "test"; /test/ =~ str'
-assert_equal '0',               're = /test/; str = "test"; re =~ str'
-
-# dynamic regexp
-assert_equal 'regexp',          %q(/re#{'ge'}xp/.source)
-assert_equal 'Regexp',          %q(/re#{'ge'}xp/.class)
-
-# array
-assert_equal 'Array',           '[].class'
-assert_equal '0',               '[].size'
-assert_equal '0',               '[].length'
-assert_equal '[]',              '[].inspect'
-assert_equal 'Array',           '[0].class'
-assert_equal '1',               '[3].size'
-assert_equal '[3]',             '[3].inspect'
-assert_equal '3',               'a = [3]; a[0]'
-assert_equal 'Array',           '[1,2].class'
-assert_equal '2',               '[1,2].size'
-assert_equal '[1, 2]',           '[1,2].inspect'
-assert_equal 'Array',           '[1,2,3,4,5].class'
-assert_equal '5',               '[1,2,3,4,5].size'
-assert_equal '[1, 2, 3, 4, 5]', '[1,2,3,4,5].inspect'
-assert_equal '1',               'a = [1,2]; a[0]'
-assert_equal '2',               'a = [1,2]; a[1]'
-assert_equal 'Array',           'a = [1 + 2, 3 + 4, 5 + 6]; a.class'
-assert_equal '[3, 7, 11]',      'a = [1 + 2, 3 + 4, 5 + 6]; a.inspect'
-assert_equal '7',               'a = [1 + 2, 3 + 4, 5 + 6]; a[1]'
-assert_equal '1',               '([0][0] += 1)'
-assert_equal '1',               '([2][0] -= 1)'
-assert_equal 'Array',           'a = [obj = Object.new]; a.class'
-assert_equal '1',               'a = [obj = Object.new]; a.size'
-assert_equal 'true',            'a = [obj = Object.new]; a[0] == obj'
-assert_equal '5',               'a = [1,2,3]; a[1] = 5; a[1]'
-assert_equal 'bar',             '[*:foo];:bar'
-assert_equal '[1, 2]',          'def nil.to_a; [2]; end; [1, *nil]'
-assert_equal '[1, 2]',          'def nil.to_a; [1, 2]; end; [*nil]'
-assert_equal '[0, 1, {2=>3}]',  '[0, *[1], 2=>3]', "[ruby-dev:31592]"
-
-
-# hash
-assert_equal 'Hash',            '{}.class'
-assert_equal '{}',              '{}.inspect'
-assert_equal 'Hash',            '{1=>2}.class'
-assert_equal '{1=>2}',          '{1=>2}.inspect'
-assert_equal '2',               'h = {1 => 2}; h[1]'
-assert_equal '0',               'h = {1 => 2}; h.delete(1); h.size'
-assert_equal '',                'h = {1 => 2}; h.delete(1); h[1]'
-assert_equal '2',               'h = {"string" => "literal", "goto" => "hell"}; h.size'
-assert_equal 'literal', 'h = {"string"=>"literal", "goto"=>"hell"}; h["string"]'
-assert_equal 'hell', 'h = {"string"=>"literal", "goto"=>"hell"}; h["goto"]'
-
-# range
-assert_equal 'Range',           '(1..2).class'
-assert_equal '1..2',            '(1..2).inspect'
-assert_equal '1',               '(1..2).begin'
-assert_equal '2',               '(1..2).end'
-assert_equal 'false',           '(1..2).exclude_end?'
-assert_equal 'Range',           'r = 1..2; r.class'
-assert_equal '1..2',            'r = 1..2; r.inspect'
-assert_equal '1',               'r = 1..2; r.begin'
-assert_equal '2',               'r = 1..2; r.end'
-assert_equal 'false',           'r = 1..2; r.exclude_end?'
-assert_equal 'Range',           '(1...3).class'
-assert_equal '1...3',           '(1...3).inspect'
-assert_equal '1',               '(1...3).begin'
-assert_equal '3',               '(1...3).end'
-assert_equal 'true',            '(1...3).exclude_end?'
-assert_equal 'Range',           'r = (1...3); r.class'
-assert_equal '1...3',           'r = (1...3); r.inspect'
-assert_equal '1',               'r = (1...3); r.begin'
-assert_equal '3',               'r = (1...3); r.end'
-assert_equal 'true',            'r = (1...3); r.exclude_end?'
-assert_equal 'Range',           'r = (1+2 .. 3+4); r.class'
-assert_equal '3..7',            'r = (1+2 .. 3+4); r.inspect'
-assert_equal '3',               'r = (1+2 .. 3+4); r.begin'
-assert_equal '7',               'r = (1+2 .. 3+4); r.end'
-assert_equal 'false',           'r = (1+2 .. 3+4); r.exclude_end?'
-assert_equal 'Range',           'r = (1+2 ... 3+4); r.class'
-assert_equal '3...7',           'r = (1+2 ... 3+4); r.inspect'
-assert_equal '3',               'r = (1+2 ... 3+4); r.begin'
-assert_equal '7',               'r = (1+2 ... 3+4); r.end'
-assert_equal 'true',            'r = (1+2 ... 3+4); r.exclude_end?'
-assert_equal 'Range',           'r = ("a".."c"); r.class'
-assert_equal '"a".."c"',        'r = ("a".."c"); r.inspect'
-assert_equal 'a',               'r = ("a".."c"); r.begin'
-assert_equal 'c',               'r = ("a".."c"); r.end'
-
-assert_equal 'String',          '__FILE__.class'
-assert_equal 'Fixnum',          '__LINE__.class'
-
-###
-
-assert_equal 'ok', %q{
-  # this cause "called on terminated object".
-  ObjectSpace.each_object(Module) {|m| m.name.inspect }
-  :ok
-}
-
-assert_normal_exit %q{
-  begin
-    r = 0**-1
-    r + r
-  rescue
-  end
-}, '[ruby-dev:34524]'
-
-assert_normal_exit %q{
-  begin
-    r = Marshal.load("\x04\bU:\rRational[\ai\x06i\x05")
-    r + r
-  rescue
-  end
-}, '[ruby-dev:34536]'
-
-assert_equal 'ok', %q{
-  "#{}""#{}ok"
-}, '[ruby-dev:38968]'
-
-assert_equal 'ok', %q{
-  "#{}o""#{}k""#{}"
-}, '[ruby-core:25284]'
-
-assert_equal 'ok', %q{ #  long array literal
-  x = nil
-  eval "a = [#{(1..10_000).map{'x'}.join(", ")}]"
-  :ok
-}
-
-assert_equal 'ok', %q{ #  long array literal (optimized)
-  eval "a = [#{(1..10_000).to_a.join(", ")}]"
-  :ok
-}
-
-assert_equal 'ok', %q{ #  long hash literal
-  x = nil
-  eval "a = {#{(1..10_000).map{|n| "#{n} => x"}.join(', ')}}"
-  :ok
-}
-
-assert_equal 'ok', %q{ #  long hash literal (optimized)
-  eval "a = {#{(1..10_000).map{|n| "#{n} => #{n}"}.join(', ')}}"
-  :ok
-}
-
-assert_equal 'ok', %q{
-  [print(:ok), exit] # void literal with side-effect
-  :dummy
-}
diff --git a/bootstraptest/test_literal_suffix.rb b/bootstraptest/test_literal_suffix.rb
deleted file mode 100644
index 4316c9e040..0000000000
--- a/bootstraptest/test_literal_suffix.rb
+++ /dev/null
@@ -1,54 +0,0 @@
-# numbers with suffix
-assert_equal '0/1',             '0r'
-assert_equal 'Rational',        '0r.class'
-assert_equal '1/1',             '1r'
-assert_equal 'Rational',        '1r.class'
-assert_equal '-1/1',            '-1r'
-assert_equal 'Rational',        '(-1r).class'
-assert_equal '1/1',             '0x1r'
-assert_equal 'Rational',        '0x1r.class'
-assert_equal '1/1',             '0b1r'
-assert_equal 'Rational',        '0b1r.class'
-assert_equal '1/1',             '0d1r'
-assert_equal 'Rational',        '0d1r.class'
-assert_equal '1/1',             '0o1r'
-assert_equal 'Rational',        '0o1r.class'
-assert_equal '1/1',             '01r'
-assert_equal 'Rational',        '01r.class'
-assert_equal '6/5',             '1.2r'
-assert_equal 'Rational',        '1.2r.class'
-assert_equal '-6/5',            '-1.2r'
-assert_equal 'Rational',        '(-1.2r).class'
-assert_equal '0+0i',            '0i'
-assert_equal 'Complex',         '0i.class'
-assert_equal '0+1i',            '1i'
-assert_equal 'Complex',         '1i.class'
-assert_equal '0+1i',            '0x1i'
-assert_equal 'Complex',         '0x1i.class'
-assert_equal '0+1i',            '0b1i'
-assert_equal 'Complex',         '0b1i.class'
-assert_equal '0+1i',            '0d1i'
-assert_equal 'Complex',         '0d1i.class'
-assert_equal '0+1i',            '0o1i'
-assert_equal 'Complex',         '0o1i.class'
-assert_equal '0+1i',            '01i'
-assert_equal 'Complex',         '01i.class'
-assert_equal '0+1.2i',          '1.2i'
-assert_equal 'Complex',         '1.2i.class'
-assert_equal '0+1/1i',          '1ri'
-assert_equal 'Complex',         '1ri.class'
-assert_equal '0+6/5i',          '1.2ri'
-assert_equal 'Complex',         '1.2ri.class'
-assert_equal '0+10.0i',         '1e1i'
-assert_equal 'Complex',         '1e1i.class'
-assert_equal '1',               '1if true'
-assert_equal '1',               '1rescue nil'
-assert_equal '10000000000000000001/10000000000000000000',
-             '1.0000000000000000001r'
-
-assert_equal 'syntax error, unexpected tIDENTIFIER, expecting end-of-input',
-             %q{begin eval('1ir', nil, '', 0); rescue SyntaxError => e; e.message[/\A:(?:\d+:)? (.*)/, 1] end}
-assert_equal 'syntax error, unexpected tIDENTIFIER, expecting end-of-input',
-             %q{begin eval('1.2ir', nil, '', 0); rescue SyntaxError => e; e.message[/\A:(?:\d+:)? (.*)/, 1] end}
-assert_equal 'syntax error, unexpected tIDENTIFIER, expecting end-of-input',
-             %q{begin eval('1e1r', nil, '', 0); rescue SyntaxError => e; e.message[/\A:(?:\d+:)? (.*)/, 1] end}
diff --git a/bootstraptest/test_load.rb b/bootstraptest/test_load.rb
deleted file mode 100644
index e63c93a8f4..0000000000
--- a/bootstraptest/test_load.rb
+++ /dev/null
@@ -1,27 +0,0 @@
-assert_equal 'ok', %q{
-  open("require-lock-test.rb", "w") {|f|
-    f.puts "sleep 0.1"
-    f.puts "module M"
-    f.puts "end"
-  }
-  $:.unshift Dir.pwd
-  vs = (1..2).map {|i|
-    Thread.start {
-      require "require-lock-test"
-      M
-    }
-  }.map {|t| t.value }
-  vs[0] == M && vs[1] == M ? :ok : :ng
-}, '[ruby-dev:32048]'
-
-assert_equal 'ok', %q{
-  %w[a a/foo b].each {|d| Dir.mkdir(d)}
-  open("b/foo", "w") {|f| f.puts "$ok = :ok"}
-  $:.replace(%w[a b])
-  begin
-    load "foo"
-    $ok
-  rescue => e
-    e.message
-  end
-}, '[ruby-dev:38097]'
diff --git a/bootstraptest/test_marshal.rb b/bootstraptest/test_marshal.rb
deleted file mode 100644
index 7e34176169..0000000000
--- a/bootstraptest/test_marshal.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-
-assert_normal_exit %q{
-  Marshal.load(Marshal.dump({"k"=>"v"}), lambda {|v| v})
-}
-
diff --git a/bootstraptest/test_massign.rb b/bootstraptest/test_massign.rb
deleted file mode 100644
index 0f63dd424a..0000000000
--- a/bootstraptest/test_massign.rb
+++ /dev/null
@@ -1,183 +0,0 @@
-assert_equal '[[1], 2, 3]', '*v1, (a, b) = [1,[2, 3]]; [v1, a, b]'
-assert_equal '[[1], 2, 3]', '*v1,(*), (a, b) = [1,:x,[2, 3]]; [v1, a, b]'
-
-assert_equal '[]',          '*a = *nil; a'
-assert_equal '[nil]',       '*a = nil; a'
-assert_equal '2',           'a, a = 1, 2; a', "[ruby-dev:31522]"
-assert_equal '[1, 2]',      'a, b = 1, 2'
-assert_equal '[1, 2]', %q{
-  ans = []
-  trace_var(:$a){|v| ans << v}
-  trace_var(:$b){|v| ans << v}
-  $a, $b = 1, 2
-  ans
-}
-
-assert_equal 'ok', %q{
-  r = :ok
-  :ng.tap {|(r)|}
-  r
-}, '[ruby-dev:31507]'
-
-=begin
-# generated by this script:
-
-3.times{|i|
-  8.times{|e|
-    ary = (0...e).to_a
-    a,b,c,d,e,f = nil
-    vals = %w(a b c d e f)
-    vals[i] = '*' + vals[i]
-    program = "#{vals.join(", ")} = *ary"
-    eval(program)
-    ans = [a,b,c,d,e,f]
-    puts %Q{
-      assert_equal "#{ans.inspect}", %q{
-        ary = #{ary.inspect}
-        #{program}; [a, b, c, d, e, f]
-      }}
-  }
-}
-=end
-
-      assert_equal "[[], nil, nil, nil, nil, nil]", %q{
-        ary = []
-        *a, b, c, d, e, f = *ary; [a, b, c, d, e, f]
-      }
-
-      assert_equal "[[], 0, nil, nil, nil, nil]", %q{
-        ary = [0]
-        *a, b, c, d, e, f = *ary; [a, b, c, d, e, f]
-      }
-
-      assert_equal "[[], 0, 1, nil, nil, nil]", %q{
-        ary = [0, 1]
-        *a, b, c, d, e, f = *ary; [a, b, c, d, e, f]
-      }
-
-      assert_equal "[[], 0, 1, 2, nil, nil]", %q{
-        ary = [0, 1, 2]
-        *a, b, c, d, e, f = *ary; [a, b, c, d, e, f]
-      }
-
-      assert_equal "[[], 0, 1, 2, 3, nil]", %q{
-        ary = [0, 1, 2, 3]
-        *a, b, c, d, e, f = *ary; [a, b, c, d, e, f]
-      }
-
-      assert_equal "[[], 0, 1, 2, 3, 4]", %q{
-        ary = [0, 1, 2, 3, 4]
-        *a, b, c, d, e, f = *ary; [a, b, c, d, e, f]
-      }
-
-      assert_equal "[[0], 1, 2, 3, 4, 5]", %q{
-        ary = [0, 1, 2, 3, 4, 5]
-        *a, b, c, d, e, f = *ary; [a, b, c, d, e, f]
-      }
-
-      assert_equal "[[0, 1], 2, 3, 4, 5, 6]", %q{
-        ary = [0, 1, 2, 3, 4, 5, 6]
-        *a, b, c, d, e, f = *ary; [a, b, c, d, e, f]
-      }
-
-      assert_equal "[nil, [], nil, nil, nil, nil]", %q{
-        ary = []
-        a, *b, c, d, e, f = *ary; [a, b, c, d, e, f]
-      }
-
-      assert_equal "[0, [], nil, nil, nil, nil]", %q{
-        ary = [0]
-        a, *b, c, d, e, f = *ary; [a, b, c, d, e, f]
-      }
-
-      assert_equal "[0, [], 1, nil, nil, nil]", %q{
-        ary = [0, 1]
-        a, *b, c, d, e, f = *ary; [a, b, c, d, e, f]
-      }
-
-      assert_equal "[0, [], 1, 2, nil, nil]", %q{
-        ary = [0, 1, 2]
-        a, *b, c, d, e, f = *ary; [a, b, c, d, e, f]
-      }
-
-      assert_equal "[0, [], 1, 2, 3, nil]", %q{
-        ary = [0, 1, 2, 3]
-        a, *b, c, d, e, f = *ary; [a, b, c, d, e, f]
-      }
-
-      assert_equal "[0, [], 1, 2, 3, 4]", %q{
-        ary = [0, 1, 2, 3, 4]
-        a, *b, c, d, e, f = *ary; [a, b, c, d, e, f]
-      }
-
-      assert_equal "[0, [1], 2, 3, 4, 5]", %q{
-        ary = [0, 1, 2, 3, 4, 5]
-        a, *b, c, d, e, f = *ary; [a, b, c, d, e, f]
-      }
-
-      assert_equal "[0, [1, 2], 3, 4, 5, 6]", %q{
-        ary = [0, 1, 2, 3, 4, 5, 6]
-        a, *b, c, d, e, f = *ary; [a, b, c, d, e, f]
-      }
-
-      assert_equal "[nil, nil, [], nil, nil, nil]", %q{
-        ary = []
-        a, b, *c, d, e, f = *ary; [a, b, c, d, e, f]
-      }
-
-      assert_equal "[0, nil, [], nil, nil, nil]", %q{
-        ary = [0]
-        a, b, *c, d, e, f = *ary; [a, b, c, d, e, f]
-      }
-
-      assert_equal "[0, 1, [], nil, nil, nil]", %q{
-        ary = [0, 1]
-        a, b, *c, d, e, f = *ary; [a, b, c, d, e, f]
-      }
-
-      assert_equal "[0, 1, [], 2, nil, nil]", %q{
-        ary = [0, 1, 2]
-        a, b, *c, d, e, f = *ary; [a, b, c, d, e, f]
-      }
-
-      assert_equal "[0, 1, [], 2, 3, nil]", %q{
-        ary = [0, 1, 2, 3]
-        a, b, *c, d, e, f = *ary; [a, b, c, d, e, f]
-      }
-
-      assert_equal "[0, 1, [], 2, 3, 4]", %q{
-        ary = [0, 1, 2, 3, 4]
-        a, b, *c, d, e, f = *ary; [a, b, c, d, e, f]
-      }
-
-      assert_equal "[0, 1, [2], 3, 4, 5]", %q{
-        ary = [0, 1, 2, 3, 4, 5]
-        a, b, *c, d, e, f = *ary; [a, b, c, d, e, f]
-      }
-
-      assert_equal "[0, 1, [2, 3], 4, 5, 6]", %q{
-        ary = [0, 1, 2, 3, 4, 5, 6]
-        a, b, *c, d, e, f = *ary; [a, b, c, d, e, f]
-      }
-
-
-#
-assert_equal 'ok', %q{
-  a,s=[],"aaa"
-  300.times { a<<s; s=s.succ }
-  eval <<-END__
-  GC.stress=true
-  Fiber.new do
-    #{ a.join(",") },*zzz=1
-  end.resume
-  END__
-  :ok
-}, '[ruby-dev:32581]'
-
-assert_equal 'ok', %q{
-  while true
-    *, z = 1
-    break
-  end
-  :ok
-}, '[ruby-dev:32892]'
diff --git a/bootstraptest/test_method.rb b/bootstraptest/test_method.rb
deleted file mode 100644
index 3462aa9434..0000000000
--- a/bootstraptest/test_method.rb
+++ /dev/null
@@ -1,1192 +0,0 @@
-# regular argument
-assert_equal '1',       'def m() 1 end; m()'
-assert_equal '1',       'def m(a) a end; m(1)'
-assert_equal '[1, 2]',  'def m(a,b) [a, b] end; m(1,2)'
-assert_equal '[1, 2, 3]', 'def m(a,b,c) [a, b, c] end; m(1,2,3)'
-assert_match /\Awrong number of arguments \(.*\b1\b.* 0\)\z/, %q{
-  def m; end
-  begin
-    m(1)
-  rescue => e
-    e.message
-  end
-}
-
-assert_match /\Awrong number of arguments \(.*\b0\b.* 1\)\z/, %q{
-  def m a; end
-  begin
-    m
-  rescue => e
-    e.message
-  end
-}
-
-# default argument
-assert_equal '1',       'def m(x=1) x end; m()'
-assert_equal '1',       'def m(x=7) x end; m(1)'
-assert_equal '1',       'def m(a,x=1) x end; m(7)'
-assert_equal '1',       'def m(a,x=7) x end; m(7,1)'
-assert_equal '1',       'def m(a,b,x=1) x end; m(7,7)'
-assert_equal '1',       'def m(a,b,x=7) x end; m(7,7,1)'
-assert_equal '1',       'def m(a,x=1,y=1) x end; m(7)'
-assert_equal '1',       'def m(a,x=1,y=1) y end; m(7)'
-assert_equal '1',       'def m(a,x=7,y=1) x end; m(7,1)'
-assert_equal '1',       'def m(a,x=7,y=1) y end; m(7,1)'
-assert_equal '1',       'def m(a,x=7,y=7) x end; m(7,1,1)'
-assert_equal '1',       'def m(a,x=7,y=7) y end; m(7,1,1)'
-
-# rest argument
-assert_equal '[]',      'def m(*a) a end; m().inspect'
-assert_equal '[1]',     'def m(*a) a end; m(1).inspect'
-assert_equal '[1, 2]',  'def m(*a) a end; m(1,2).inspect'
-assert_equal '[]',      'def m(x,*a) a end; m(7).inspect'
-assert_equal '[1]',     'def m(x,*a) a end; m(7,1).inspect'
-assert_equal '[1, 2]',  'def m(x,*a) a end; m(7,1,2).inspect'
-assert_equal '[]',      'def m(x,y,*a) a end; m(7,7).inspect'
-assert_equal '[1]',     'def m(x,y,*a) a end; m(7,7,1).inspect'
-assert_equal '[1, 2]',  'def m(x,y,*a) a end; m(7,7,1,2).inspect'
-assert_equal '[]',      'def m(x,y=7,*a) a end; m(7).inspect'
-assert_equal '[]',      'def m(x,y,z=7,*a) a end; m(7,7).inspect'
-assert_equal '[]',      'def m(x,y,z=7,*a) a end; m(7,7,7).inspect'
-assert_equal '[]',      'def m(x,y,z=7,zz=7,*a) a end; m(7,7,7).inspect'
-assert_equal '[]',      'def m(x,y,z=7,zz=7,*a) a end; m(7,7,7,7).inspect'
-assert_equal '1',       'def m(x,y,z=7,zz=1,*a) zz end; m(7,7,7).inspect'
-assert_equal '1',       'def m(x,y,z=7,zz=1,*a) zz end; m(7,7,7).inspect'
-assert_equal '1',       'def m(x,y,z=7,zz=7,*a) zz end; m(7,7,7,1).inspect'
-
-# block argument
-assert_equal 'Proc',    'def m(&block) block end; m{}.class'
-assert_equal 'nil',     'def m(&block) block end; m().inspect'
-assert_equal 'Proc',    'def m(a,&block) block end; m(7){}.class'
-assert_equal 'nil',     'def m(a,&block) block end; m(7).inspect'
-assert_equal '1',       'def m(a,&block) a end; m(1){}'
-assert_equal 'Proc',    'def m(a,b=nil,&block) block end; m(7){}.class'
-assert_equal 'nil',     'def m(a,b=nil,&block) block end; m(7).inspect'
-assert_equal 'Proc',    'def m(a,b=nil,&block) block end; m(7,7){}.class'
-assert_equal '1',       'def m(a,b=nil,&block) b end; m(7,1){}'
-assert_equal 'Proc',    'def m(a,b=nil,*c,&block) block end; m(7){}.class'
-assert_equal 'nil',     'def m(a,b=nil,*c,&block) block end; m(7).inspect'
-assert_equal '1',       'def m(a,b=nil,*c,&block) a end; m(1).inspect'
-assert_equal '1',       'def m(a,b=1,*c,&block) b end; m(7).inspect'
-assert_equal '1',       'def m(a,b=7,*c,&block) b end; m(7,1).inspect'
-assert_equal '[1]',     'def m(a,b=7,*c,&block) c end; m(7,7,1).inspect'
-
-# splat
-assert_equal '1',       'def m(a) a end; m(*[1])'
-assert_equal '1',       'def m(x,a) a end; m(7,*[1])'
-assert_equal '1',       'def m(x,y,a) a end; m(7,7,*[1])'
-assert_equal '1',       'def m(a,b) a end; m(*[1,7])'
-assert_equal '1',       'def m(a,b) b end; m(*[7,1])'
-assert_equal '1',       'def m(x,a,b) b end; m(7,*[7,1])'
-assert_equal '1',       'def m(x,y,a,b) b end; m(7,7,*[7,1])'
-assert_equal '1',       'def m(a,b,c) a end; m(*[1,7,7])'
-assert_equal '1',       'def m(a,b,c) b end; m(*[7,1,7])'
-assert_equal '1',       'def m(a,b,c) c end; m(*[7,7,1])'
-assert_equal '1',       'def m(x,a,b,c) a end; m(7,*[1,7,7])'
-assert_equal '1',       'def m(x,y,a,b,c) a end; m(7,7,*[1,7,7])'
-
-# hash argument
-assert_equal '1',       'def m(h) h end; m(7=>1)[7]'
-assert_equal '1',       'def m(h) h end; m(7=>1).size'
-assert_equal '1',       'def m(h) h end; m(7=>1, 8=>7)[7]'
-assert_equal '2',       'def m(h) h end; m(7=>1, 8=>7).size'
-assert_equal '1',       'def m(h) h end; m(7=>1, 8=>7, 9=>7)[7]'
-assert_equal '3',       'def m(h) h end; m(7=>1, 8=>7, 9=>7).size'
-assert_equal '1',       'def m(x,h) h end; m(7, 7=>1)[7]'
-assert_equal '1',       'def m(x,h) h end; m(7, 7=>1, 8=>7)[7]'
-assert_equal '1',       'def m(x,h) h end; m(7, 7=>1, 8=>7, 9=>7)[7]'
-assert_equal '1',       'def m(x,y,h) h end; m(7,7, 7=>1)[7]'
-assert_equal '1',       'def m(x,y,h) h end; m(7,7, 7=>1, 8=>7)[7]'
-assert_equal '1',       'def m(x,y,h) h end; m(7,7, 7=>1, 8=>7, 9=>7)[7]'
-
-# block argument
-assert_equal '1',       %q(def m(&block) mm(&block) end
-                           def mm() yield 1 end
-                           m {|a| a })
-assert_equal '1',       %q(def m(x,&block) mm(x,&block) end
-                           def mm(x) yield 1 end
-                           m(7) {|a| a })
-assert_equal '1',       %q(def m(x,y,&block) mm(x,y,&block) end
-                           def mm(x,y) yield 1 end
-                           m(7,7) {|a| a })
-
-# recursive call
-assert_equal '1',       %q(def m(n) n == 0 ? 1 : m(n-1) end; m(5))
-
-# instance method
-assert_equal '1',       %q(class C; def m() 1 end end;  C.new.m)
-assert_equal '1',       %q(class C; def m(a) a end end;  C.new.m(1))
-assert_equal '1',       %q(class C; def m(a = 1) a end end;  C.new.m)
-assert_equal '[1]',     %q(class C; def m(*a) a end end;  C.new.m(1).inspect)
-assert_equal '1',       %q( class C
-                              def m() mm() end
-                              def mm() 1 end
-                            end
-                            C.new.m )
-
-# singleton method (const)
-assert_equal '1',       %q(class C; def C.m() 1 end end;  C.m)
-assert_equal '1',       %q(class C; def C.m(a) a end end;  C.m(1))
-assert_equal '1',       %q(class C; def C.m(a = 1) a end end;  C.m)
-assert_equal '[1]',     %q(class C; def C.m(*a) a end end;  C.m(1).inspect)
-assert_equal '1',       %q(class C; end; def C.m() 1 end;  C.m)
-assert_equal '1',       %q(class C; end; def C.m(a) a end;  C.m(1))
-assert_equal '1',       %q(class C; end; def C.m(a = 1) a end;  C.m)
-assert_equal '[1]',     %q(class C; end; def C.m(*a) a end;  C.m(1).inspect)
-assert_equal '1',       %q(class C; def m() 7 end end; def C.m() 1 end;  C.m)
-assert_equal '1',       %q( class C
-                              def C.m() mm() end
-                              def C.mm() 1 end
-                            end
-                            C.m )
-
-# singleton method (lvar)
-assert_equal '1',       %q(obj = Object.new; def obj.m() 1 end;  obj.m)
-assert_equal '1',       %q(obj = Object.new; def obj.m(a) a end;  obj.m(1))
-assert_equal '1',       %q(obj = Object.new; def obj.m(a=1) a end;  obj.m)
-assert_equal '[1]',     %q(obj = Object.new; def obj.m(*a) a end;  obj.m(1))
-assert_equal '1',       %q(class C; def m() 7 end; end
-                           obj = C.new
-                           def obj.m() 1 end
-                           obj.m)
-
-# inheritance
-assert_equal '1',       %q(class A; def m(a) a end end
-                           class B < A; end
-                           B.new.m(1))
-assert_equal '1',       %q(class A; end
-                           class B < A; def m(a) a end end
-                           B.new.m(1))
-assert_equal '1',       %q(class A; def m(a) a end end
-                           class B < A; end
-                           class C < B; end
-                           C.new.m(1))
-
-# include
-assert_equal '1',       %q(class A; def m(a) a end end
-                           module M; end
-                           class B < A; include M; end
-                           B.new.m(1))
-assert_equal '1',       %q(class A; end
-                           module M; def m(a) a end end
-                           class B < A; include M; end
-                           B.new.m(1))
-
-# alias
-assert_equal '1',       %q( def a() 1 end
-                            alias m a
-                            m() )
-assert_equal '1',       %q( class C
-                              def a() 1 end
-                              alias m a
-                            end
-                            C.new.m )
-assert_equal '1',       %q( class C
-                              def a() 1 end
-                              alias :m a
-                            end
-                            C.new.m )
-assert_equal '1',       %q( class C
-                              def a() 1 end
-                              alias m :a
-                            end
-                            C.new.m )
-assert_equal '1',       %q( class C
-                              def a() 1 end
-                              alias :m :a
-                            end
-                            C.new.m )
-assert_equal '1',       %q( class C
-                              def a() 1 end
-                              alias m a
-                              undef a
-                            end
-                            C.new.m )
-
-# undef
-assert_equal '1',       %q( class C
-                              def m() end
-                              undef m
-                            end
-                            begin C.new.m; rescue NoMethodError; 1 end )
-assert_equal '1',       %q( class A
-                              def m() end
-                            end
-                            class C < A
-                              def m() end
-                              undef m
-                            end
-                            begin C.new.m; rescue NoMethodError; 1 end )
-assert_equal '1',       %q( class A; def a() end end   # [yarv-dev:999]
-                            class B < A
-                              def b() end
-                              undef a, b
-                            end
-                            begin B.new.a; rescue NoMethodError; 1 end )
-assert_equal '1',       %q( class A; def a() end end   # [yarv-dev:999]
-                            class B < A
-                              def b() end
-                              undef a, b
-                            end
-                            begin B.new.b; rescue NoMethodError; 1 end )
-
-assert_equal '3',  %q{
-  def m1
-    1
-  end
-  alias m2 m1
-  alias :"#{'m3'}" m1
-  m1 + m2 + m3
-}, '[ruby-dev:32308]'
-assert_equal '1', %q{
-  def foobar
-  end
-  undef :"foo#{:bar}"
-  1
-}, '[ruby-dev:32308]'
-assert_equal '1', %q{
-  def foobar
-    1
-  end
-  alias :"bar#{:baz}" :"foo#{:bar}"
-  barbaz
-}, '[ruby-dev:32308]'
-
-# private
-assert_equal '1',       %q( class C
-                              def m() mm() end
-                              def mm() 1 end
-                              private :mm
-                            end
-                            C.new.m )
-assert_equal '1',       %q( class C
-                              def m() 7 end
-                              private :m
-                            end
-                            begin C.m; rescue NoMethodError; 1 end )
-assert_equal '1',       %q( class C
-                              def C.m() mm() end
-                              def C.mm() 1 end
-                              private_class_method :mm
-                            end
-                            C.m )
-assert_equal '1',       %q( class C
-                              def C.m() 7 end
-                              private_class_method :m
-                            end
-                            begin C.m; rescue NoMethodError; 1 end )
-assert_equal '1',       %q( class C; def m() 1 end end
-                            C.new.m   # cache
-                            class C
-                              alias mm m; private :mm
-                            end
-                            C.new.m
-                            begin C.new.mm; 7; rescue NoMethodError; 1 end )
-
-# nested method
-assert_equal '1',       %q( class C
-                              def m
-                                def mm() 1 end
-                              end
-                            end
-                            C.new.m
-                            C.new.mm )
-assert_equal '1',       %q( class C
-                              def m
-                                def mm() 1 end
-                              end
-                            end
-                            instance_eval "C.new.m; C.new.mm" )
-
-# method_missing
-assert_equal ':m',      %q( class C
-                              def method_missing(mid, *args) mid end
-                            end
-                            C.new.m.inspect )
-assert_equal ':mm',     %q( class C
-                              def method_missing(mid, *args) mid end
-                            end
-                            C.new.mm.inspect )
-assert_equal '[1, 2]',  %q( class C
-                              def method_missing(mid, *args) args end
-                            end
-                            C.new.m(1,2).inspect )
-assert_equal '1',       %q( class C
-                              def method_missing(mid, *args) yield 1 end
-                            end
-                            C.new.m {|a| a })
-assert_equal 'nil',     %q( class C
-                              def method_missing(mid, *args, &block) block end
-                            end
-                            C.new.m.inspect )
-
-# send
-assert_equal '1',       %q( class C; def m() 1 end end;
-                            C.new.__send__(:m) )
-assert_equal '1',       %q( class C; def m() 1 end end;
-                            C.new.send(:m) )
-assert_equal '1',       %q( class C; def m(a) a end end;
-                            C.new.send(:m,1) )
-assert_equal '1',       %q( class C; def m(a,b) a end end;
-                            C.new.send(:m,1,7) )
-assert_equal '1',       %q( class C; def m(x,a=1) a end end;
-                            C.new.send(:m,7) )
-assert_equal '1',       %q( class C; def m(x,a=7) a end end;
-                            C.new.send(:m,7,1) )
-assert_equal '[1, 2]',  %q( class C; def m(*a) a end end;
-                            C.new.send(:m,1,2).inspect )
-assert_equal '1',       %q( class C; def m() 7 end; private :m end
-                            begin C.new.public_send(:m); rescue NoMethodError; 1 end )
-assert_equal '1',       %q( class C; def m() 1 end; private :m end
-                            C.new.send(:m) )
-
-# with block
-assert_equal '[[:ok1, :foo], [:ok2, :foo, :bar]]',
-%q{
-  class C
-    def [](a)
-      $ary << [yield, a]
-    end
-    def []=(a, b)
-      $ary << [yield, a, b]
-    end
-  end
-
-  $ary = []
-  C.new[:foo, &lambda{:ok1}]
-  C.new[:foo, &lambda{:ok2}] = :bar
-  $ary
-}
-
-# with
-assert_equal '[:ok1, [:ok2, 11]]', %q{
-  class C
-    def []
-      $ary << :ok1
-      10
-    end
-    def []=(a)
-      $ary << [:ok2, a]
-    end
-  end
-  $ary = []
-  C.new[]+=1
-  $ary
-}
-
-# splat and block arguments
-assert_equal %q{[[[:x, :y, :z], NilClass], [[1, :x, :y, :z], NilClass], [[1, 2, :x, :y, :z], NilClass], [[:obj], NilClass], [[1, :obj], NilClass], [[1, 2, :obj], NilClass], [[], Proc], [[1], Proc], [[1, 2], Proc], [[], Proc], [[1], Proc], [[1, 2], Proc], [[:x, :y, :z], Proc], [[1, :x, :y, :z], Proc], [[1, 2, :x, :y, :z], Proc]]}, %q{
-def m(*args, &b)
-  $result << [args, b.class]
-end
-$result = []
-ary = [:x, :y, :z]
-obj = :obj
-b = Proc.new{}
-
-m(*ary)
-m(1,*ary)
-m(1,2,*ary)
-m(*obj)
-m(1,*obj)
-m(1,2,*obj)
-m(){}
-m(1){}
-m(1,2){}
-m(&b)
-m(1,&b)
-m(1,2,&b)
-m(*ary,&b)
-m(1,*ary,&b)
-m(1,2,*ary,&b)
-$result
-}
-
-# aset and splat
-assert_equal '4', %q{class Foo;def []=(a,b,c,d);end;end;Foo.new[1,*a=[2,3]]=4}
-assert_equal '4', %q{class Foo;def []=(a,b,c,d);end;end;def m(&blk)Foo.new[1,*a=[2,3],&blk]=4;end;m{}}
-
-# post test
-assert_equal %q{[1, 2, :o1, :o2, [], 3, 4, NilClass, nil, nil]}, %q{
-def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2, &b)
-  x, y = :x, :y if $foo
-  [m1, m2, o1, o2, r, p1, p2, b.class, x, y]
-end
-; m(1, 2, 3, 4)}
-
-assert_equal %q{[1, 2, 3, :o2, [], 4, 5, NilClass, nil, nil]}, %q{
-def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2, &b)
-  x, y = :x, :y if $foo
-  [m1, m2, o1, o2, r, p1, p2, b.class, x, y]
-end
-; m(1, 2, 3, 4, 5)}
-
-assert_equal %q{[1, 2, 3, 4, [], 5, 6, NilClass, nil, nil]}, %q{
-def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2, &b)
-  x, y = :x, :y if $foo
-  [m1, m2, o1, o2, r, p1, p2, b.class, x, y]
-end
-; m(1, 2, 3, 4, 5, 6)}
-
-assert_equal %q{[1, 2, 3, 4, [5], 6, 7, NilClass, nil, nil]}, %q{
-def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2, &b)
-  x, y = :x, :y if $foo
-  [m1, m2, o1, o2, r, p1, p2, b.class, x, y]
-end
-; m(1, 2, 3, 4, 5, 6, 7)}
-
-assert_equal %q{[1, 2, 3, 4, [5, 6], 7, 8, NilClass, nil, nil]}, %q{
-def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2, &b)
-  x, y = :x, :y if $foo
-  [m1, m2, o1, o2, r, p1, p2, b.class, x, y]
-end
-; m(1, 2, 3, 4, 5, 6, 7, 8)}
-
-assert_equal %q{[1, 2, 3, 4, [5, 6, 7], 8, 9, NilClass, nil, nil]}, %q{
-def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2, &b)
-  x, y = :x, :y if $foo
-  [m1, m2, o1, o2, r, p1, p2, b.class, x, y]
-end
-; m(1, 2, 3, 4, 5, 6, 7, 8, 9)}
-
-assert_equal %q{[1, 2, 3, 4, [5, 6, 7, 8], 9, 10, NilClass, nil, nil]}, %q{
-def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2, &b)
-  x, y = :x, :y if $foo
-  [m1, m2, o1, o2, r, p1, p2, b.class, x, y]
-end
-; m(1, 2, 3, 4, 5, 6, 7, 8, 9, 10)}
-
-assert_equal %q{[1, 2, 3, 4, [5, 6, 7, 8, 9], 10, 11, NilClass, nil, nil]}, %q{
-def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2, &b)
-  x, y = :x, :y if $foo
-  [m1, m2, o1, o2, r, p1, p2, b.class, x, y]
-end
-; m(1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11)}
-
-assert_equal %q{[1, 2, :o1, :o2, [], 3, 4, Proc, nil, nil]}, %q{
-def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2, &b)
-  x, y = :x, :y if $foo
-  [m1, m2, o1, o2, r, p1, p2, b.class, x, y]
-end
-; m(1, 2, 3, 4){}}
-
-assert_equal %q{[1, 2, 3, :o2, [], 4, 5, Proc, nil, nil]}, %q{
-def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2, &b)
-  x, y = :x, :y if $foo
-  [m1, m2, o1, o2, r, p1, p2, b.class, x, y]
-end
-; m(1, 2, 3, 4, 5){}}
-
-assert_equal %q{[1, 2, 3, 4, [], 5, 6, Proc, nil, nil]}, %q{
-def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2, &b)
-  x, y = :x, :y if $foo
-  [m1, m2, o1, o2, r, p1, p2, b.class, x, y]
-end
-; m(1, 2, 3, 4, 5, 6){}}
-
-assert_equal %q{[1, 2, 3, 4, [5], 6, 7, Proc, nil, nil]}, %q{
-def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2, &b)
-  x, y = :x, :y if $foo
-  [m1, m2, o1, o2, r, p1, p2, b.class, x, y]
-end
-; m(1, 2, 3, 4, 5, 6, 7){}}
-
-assert_equal %q{[1, 2, 3, 4, [5, 6], 7, 8, Proc, nil, nil]}, %q{
-def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2, &b)
-  x, y = :x, :y if $foo
-  [m1, m2, o1, o2, r, p1, p2, b.class, x, y]
-end
-; m(1, 2, 3, 4, 5, 6, 7, 8){}}
-
-assert_equal %q{[1, 2, 3, 4, [5, 6, 7], 8, 9, Proc, nil, nil]}, %q{
-def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2, &b)
-  x, y = :x, :y if $foo
-  [m1, m2, o1, o2, r, p1, p2, b.class, x, y]
-end
-; m(1, 2, 3, 4, 5, 6, 7, 8, 9){}}
-
-assert_equal %q{[1, 2, 3, 4, [5, 6, 7, 8], 9, 10, Proc, nil, nil]}, %q{
-def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2, &b)
-  x, y = :x, :y if $foo
-  [m1, m2, o1, o2, r, p1, p2, b.class, x, y]
-end
-; m(1, 2, 3, 4, 5, 6, 7, 8, 9, 10){}}
-
-assert_equal %q{[1, 2, 3, 4, [5, 6, 7, 8, 9], 10, 11, Proc, nil, nil]}, %q{
-def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2, &b)
-  x, y = :x, :y if $foo
-  [m1, m2, o1, o2, r, p1, p2, b.class, x, y]
-end
-; m(1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11){}}
-
-assert_equal %q{[1, 2, :o1, :o2, [], 3, 4, nil, nil]}, %q{
-def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2)
-  x, y = :x, :y if $foo
-  [m1, m2, o1, o2, r, p1, p2, x, y]
-end
-; m(1, 2, 3, 4)}
-
-assert_equal %q{[1, 2, 3, :o2, [], 4, 5, nil, nil]}, %q{
-def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2)
-  x, y = :x, :y if $foo
-  [m1, m2, o1, o2, r, p1, p2, x, y]
-end
-; m(1, 2, 3, 4, 5)}
-
-assert_equal %q{[1, 2, 3, 4, [], 5, 6, nil, nil]}, %q{
-def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2)
-  x, y = :x, :y if $foo
-  [m1, m2, o1, o2, r, p1, p2, x, y]
-end
-; m(1, 2, 3, 4, 5, 6)}
-
-
-#
-# super
-#
-=begin
-# below programs are generated by this program:
-
-BASE = <<EOS__
-class C0; def m *args; [:C0_m, args]; end; end
-class C1 < C0; <TEST>; super; end; end
-EOS__
-
-tests = {
-%q{
-  def m
-} => %q{
-  C1.new.m
-},
-#
-%q{
-  def m a
-} => %q{
-  C1.new.m 1
-},
-%q{
-  def m a
-    a = :a
-} => %q{
-  C1.new.m 1
-},
-#
-%q{
-  def m a, o=:o
-} => %q{
-  C1.new.m 1
-  C1.new.m 1, 2
-},
-%q{
-  def m a, o=:o
-    a = :a
-} => %q{
-  C1.new.m 1
-  C1.new.m 1, 2
-},
-%q{
-  def m a, o=:o
-    o = :x
-} => %q{
-  C1.new.m 1
-  C1.new.m 1, 2
-},
-#
-%q{
-  def m a, *r
-} => %q{
-  C1.new.m 1
-  C1.new.m 1, 2
-  C1.new.m 1, 2, 3
-},
-%q{
-  def m a, *r
-    r = [:x, :y]
-} => %q{
-  C1.new.m 1
-  C1.new.m 1, 2
-  C1.new.m 1, 2, 3
-},
-#
-%q{
-  def m a, o=:o, *r
-} => %q{
-  C1.new.m 1
-  C1.new.m 1, 2
-  C1.new.m 1, 2, 3
-  C1.new.m 1, 2, 3, 4
-},
-#
-%q{
-  def m a, o=:o, *r, &b
-} => %q{
-  C1.new.m 1
-  C1.new.m 1, 2
-  C1.new.m 1, 2, 3
-  C1.new.m 1, 2, 3, 4
-  C1.new.m(1){}
-  C1.new.m(1, 2){}
-  C1.new.m(1, 2, 3){}
-  C1.new.m(1, 2, 3, 4){}
-},
-#
-"def m(m1, m2, o1=:o1, o2=:o2, p1, p2)" =>
-%q{
-C1.new.m(1,2,3,4)
-C1.new.m(1,2,3,4,5)
-C1.new.m(1,2,3,4,5,6)
-},
-#
-"def m(m1, m2, *r, p1, p2)" =>
-%q{
-C1.new.m(1,2,3,4)
-C1.new.m(1,2,3,4,5)
-C1.new.m(1,2,3,4,5,6)
-C1.new.m(1,2,3,4,5,6,7)
-C1.new.m(1,2,3,4,5,6,7,8)
-},
-#
-"def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2)" =>
-%q{
-C1.new.m(1,2,3,4)
-C1.new.m(1,2,3,4,5)
-C1.new.m(1,2,3,4,5,6)
-C1.new.m(1,2,3,4,5,6,7)
-C1.new.m(1,2,3,4,5,6,7,8)
-C1.new.m(1,2,3,4,5,6,7,8,9)
-},
-
-###
-}
-
-
-tests.each{|setup, methods| setup = setup.dup; setup.strip!
-  setup = BASE.gsub(/<TEST>/){setup}
-  methods.split(/\n/).each{|m| m = m.dup; m.strip!
-    next if m.empty?
-    expr = "#{setup}; #{m}"
-    result = eval(expr)
-    puts "assert_equal %q{#{result.inspect}}, %q{\n#{expr}}"
-    puts
-  }
-}
-
-=end
-
-assert_equal %q{[:C0_m, [1, 2, :o1, :o2, 3, 4]]}, %q{
-class C0; def m *args; [:C0_m, args]; end; end
-class C1 < C0; def m(m1, m2, o1=:o1, o2=:o2, p1, p2); super; end; end
-; C1.new.m(1,2,3,4)}
-
-assert_equal %q{[:C0_m, [1, 2, 3, :o2, 4, 5]]}, %q{
-class C0; def m *args; [:C0_m, args]; end; end
-class C1 < C0; def m(m1, m2, o1=:o1, o2=:o2, p1, p2); super; end; end
-; C1.new.m(1,2,3,4,5)}
-
-assert_equal %q{[:C0_m, [1, 2, 3, 4, 5, 6]]}, %q{
-class C0; def m *args; [:C0_m, args]; end; end
-class C1 < C0; def m(m1, m2, o1=:o1, o2=:o2, p1, p2); super; end; end
-; C1.new.m(1,2,3,4,5,6)}
-
-assert_equal %q{[:C0_m, [1, :o]]}, %q{
-class C0; def m *args; [:C0_m, args]; end; end
-class C1 < C0; def m a, o=:o, *r; super; end; end
-; C1.new.m 1}
-
-assert_equal %q{[:C0_m, [1, 2]]}, %q{
-class C0; def m *args; [:C0_m, args]; end; end
-class C1 < C0; def m a, o=:o, *r; super; end; end
-; C1.new.m 1, 2}
-
-assert_equal %q{[:C0_m, [1, 2, 3]]}, %q{
-class C0; def m *args; [:C0_m, args]; end; end
-class C1 < C0; def m a, o=:o, *r; super; end; end
-; C1.new.m 1, 2, 3}
-
-assert_equal %q{[:C0_m, [1, 2, 3, 4]]}, %q{
-class C0; def m *args; [:C0_m, args]; end; end
-class C1 < C0; def m a, o=:o, *r; super; end; end
-; C1.new.m 1, 2, 3, 4}
-
-assert_equal %q{[:C0_m, [:a]]}, %q{
-class C0; def m *args; [:C0_m, args]; end; end
-class C1 < C0; def m a
-    a = :a; super; end; end
-; C1.new.m 1}
-
-assert_equal %q{[:C0_m, [1, 2, 3, 4]]}, %q{
-class C0; def m *args; [:C0_m, args]; end; end
-class C1 < C0; def m(m1, m2, *r, p1, p2); super; end; end
-; C1.new.m(1,2,3,4)}
-
-assert_equal %q{[:C0_m, [1, 2, 3, 4, 5]]}, %q{
-class C0; def m *args; [:C0_m, args]; end; end
-class C1 < C0; def m(m1, m2, *r, p1, p2); super; end; end
-; C1.new.m(1,2,3,4,5)}
-
-assert_equal %q{[:C0_m, [1, 2, 3, 4, 5, 6]]}, %q{
-class C0; def m *args; [:C0_m, args]; end; end
-class C1 < C0; def m(m1, m2, *r, p1, p2); super; end; end
-; C1.new.m(1,2,3,4,5,6)}
-
-assert_equal %q{[:C0_m, [1, 2, 3, 4, 5, 6, 7]]}, %q{
-class C0; def m *args; [:C0_m, args]; end; end
-class C1 < C0; def m(m1, m2, *r, p1, p2); super; end; end
-; C1.new.m(1,2,3,4,5,6,7)}
-
-assert_equal %q{[:C0_m, [1, 2, 3, 4, 5, 6, 7, 8]]}, %q{
-class C0; def m *args; [:C0_m, args]; end; end
-class C1 < C0; def m(m1, m2, *r, p1, p2); super; end; end
-; C1.new.m(1,2,3,4,5,6,7,8)}
-
-assert_equal %q{[:C0_m, [1, :o]]}, %q{
-class C0; def m *args; [:C0_m, args]; end; end
-class C1 < C0; def m a, o=:o, *r, &b; super; end; end
-; C1.new.m 1}
-
-assert_equal %q{[:C0_m, [1, 2]]}, %q{
-class C0; def m *args; [:C0_m, args]; end; end
-class C1 < C0; def m a, o=:o, *r, &b; super; end; end
-; C1.new.m 1, 2}
-
-assert_equal %q{[:C0_m, [1, 2, 3]]}, %q{
-class C0; def m *args; [:C0_m, args]; end; end
-class C1 < C0; def m a, o=:o, *r, &b; super; end; end
-; C1.new.m 1, 2, 3}
-
-assert_equal %q{[:C0_m, [1, 2, 3, 4]]}, %q{
-class C0; def m *args; [:C0_m, args]; end; end
-class C1 < C0; def m a, o=:o, *r, &b; super; end; end
-; C1.new.m 1, 2, 3, 4}
-
-assert_equal %q{[:C0_m, [1, :o]]}, %q{
-class C0; def m *args; [:C0_m, args]; end; end
-class C1 < C0; def m a, o=:o, *r, &b; super; end; end
-; C1.new.m(1){}}
-
-assert_equal %q{[:C0_m, [1, 2]]}, %q{
-class C0; def m *args; [:C0_m, args]; end; end
-class C1 < C0; def m a, o=:o, *r, &b; super; end; end
-; C1.new.m(1, 2){}}
-
-assert_equal %q{[:C0_m, [1, 2, 3]]}, %q{
-class C0; def m *args; [:C0_m, args]; end; end
-class C1 < C0; def m a, o=:o, *r, &b; super; end; end
-; C1.new.m(1, 2, 3){}}
-
-assert_equal %q{[:C0_m, [1, 2, 3, 4]]}, %q{
-class C0; def m *args; [:C0_m, args]; end; end
-class C1 < C0; def m a, o=:o, *r, &b; super; end; end
-; C1.new.m(1, 2, 3, 4){}}
-
-assert_equal %q{[:C0_m, [1, :x]]}, %q{
-class C0; def m *args; [:C0_m, args]; end; end
-class C1 < C0; def m a, o=:o
-    o = :x; super; end; end
-; C1.new.m 1}
-
-assert_equal %q{[:C0_m, [1, :x]]}, %q{
-class C0; def m *args; [:C0_m, args]; end; end
-class C1 < C0; def m a, o=:o
-    o = :x; super; end; end
-; C1.new.m 1, 2}
-
-assert_equal %q{[:C0_m, [:a, :o]]}, %q{
-class C0; def m *args; [:C0_m, args]; end; end
-class C1 < C0; def m a, o=:o
-    a = :a; super; end; end
-; C1.new.m 1}
-
-assert_equal %q{[:C0_m, [:a, 2]]}, %q{
-class C0; def m *args; [:C0_m, args]; end; end
-class C1 < C0; def m a, o=:o
-    a = :a; super; end; end
-; C1.new.m 1, 2}
-
-assert_equal %q{[:C0_m, [1]]}, %q{
-class C0; def m *args; [:C0_m, args]; end; end
-class C1 < C0; def m a; super; end; end
-; C1.new.m 1}
-
-assert_equal %q{[:C0_m, [1, :x, :y]]}, %q{
-class C0; def m *args; [:C0_m, args]; end; end
-class C1 < C0; def m a, *r
-    r = [:x, :y]; super; end; end
-; C1.new.m 1}
-
-assert_equal %q{[:C0_m, [1, :x, :y]]}, %q{
-class C0; def m *args; [:C0_m, args]; end; end
-class C1 < C0; def m a, *r
-    r = [:x, :y]; super; end; end
-; C1.new.m 1, 2}
-
-assert_equal %q{[:C0_m, [1, :x, :y]]}, %q{
-class C0; def m *args; [:C0_m, args]; end; end
-class C1 < C0; def m a, *r
-    r = [:x, :y]; super; end; end
-; C1.new.m 1, 2, 3}
-
-assert_equal %q{[:C0_m, [1, 2, :o1, :o2, 3, 4]]}, %q{
-class C0; def m *args; [:C0_m, args]; end; end
-class C1 < C0; def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2); super; end; end
-; C1.new.m(1,2,3,4)}
-
-assert_equal %q{[:C0_m, [1, 2, 3, :o2, 4, 5]]}, %q{
-class C0; def m *args; [:C0_m, args]; end; end
-class C1 < C0; def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2); super; end; end
-; C1.new.m(1,2,3,4,5)}
-
-assert_equal %q{[:C0_m, [1, 2, 3, 4, 5, 6]]}, %q{
-class C0; def m *args; [:C0_m, args]; end; end
-class C1 < C0; def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2); super; end; end
-; C1.new.m(1,2,3,4,5,6)}
-
-assert_equal %q{[:C0_m, [1, 2, 3, 4, 5, 6, 7]]}, %q{
-class C0; def m *args; [:C0_m, args]; end; end
-class C1 < C0; def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2); super; end; end
-; C1.new.m(1,2,3,4,5,6,7)}
-
-assert_equal %q{[:C0_m, [1, 2, 3, 4, 5, 6, 7, 8]]}, %q{
-class C0; def m *args; [:C0_m, args]; end; end
-class C1 < C0; def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2); super; end; end
-; C1.new.m(1,2,3,4,5,6,7,8)}
-
-assert_equal %q{[:C0_m, [1, 2, 3, 4, 5, 6, 7, 8, 9]]}, %q{
-class C0; def m *args; [:C0_m, args]; end; end
-class C1 < C0; def m(m1, m2, o1=:o1, o2=:o2, *r, p1, p2); super; end; end
-; C1.new.m(1,2,3,4,5,6,7,8,9)}
-
-assert_equal %q{[:C0_m, [1]]}, %q{
-class C0; def m *args; [:C0_m, args]; end; end
-class C1 < C0; def m a, *r; super; end; end
-; C1.new.m 1}
-
-assert_equal %q{[:C0_m, [1, 2]]}, %q{
-class C0; def m *args; [:C0_m, args]; end; end
-class C1 < C0; def m a, *r; super; end; end
-; C1.new.m 1, 2}
-
-assert_equal %q{[:C0_m, [1, 2, 3]]}, %q{
-class C0; def m *args; [:C0_m, args]; end; end
-class C1 < C0; def m a, *r; super; end; end
-; C1.new.m 1, 2, 3}
-
-assert_equal %q{[:C0_m, []]}, %q{
-class C0; def m *args; [:C0_m, args]; end; end
-class C1 < C0; def m; super; end; end
-; C1.new.m}
-
-assert_equal %q{[:C0_m, [1, :o]]}, %q{
-class C0; def m *args; [:C0_m, args]; end; end
-class C1 < C0; def m a, o=:o; super; end; end
-; C1.new.m 1}
-
-assert_equal %q{[:C0_m, [1, 2]]}, %q{
-class C0; def m *args; [:C0_m, args]; end; end
-class C1 < C0; def m a, o=:o; super; end; end
-; C1.new.m 1, 2}
-
-assert_equal 'ok', %q{
-  class C
-    def x=(n)
-    end
-    def m
-      self.x = :ok
-    end
-  end
-  C.new.m
-}
-
-assert_equal 'ok', %q{
-  proc{
-    $SAFE = 1
-    class C
-      def m
-        :ok
-      end
-    end
-  }.call
-  C.new.m
-}, '[ruby-core:11998]'
-
-assert_equal 'ok', %q{
-  class B
-    def m() :fail end
-  end
-  class C < B
-    undef m
-    begin
-      remove_method :m
-    rescue NameError
-    end
-  end
-  begin
-    C.new.m
-  rescue NameError
-    :ok
-  end
-}, '[ruby-dev:31816], [ruby-dev:31817]'
-
-assert_normal_exit %q{
-  begin
-    Process.setrlimit(Process::RLIMIT_STACK, 4_206_592)
-    # FreeBSD SEGVs this less than 4M + 12K bytes.
-  rescue Exception
-    exit
-  end
-  class C
-    attr "a" * (10*1024*1024)
-  end
-}, '[ruby-dev:31818]'
-
-assert_equal 'ok', %q{
-  class Module
-    def define_method2(name, &block)
-      define_method(name, &block)
-    end
-  end
-  class C
-    define_method2(:m) {|x, y| :fail }
-  end
-  begin
-    C.new.m([1,2])
-  rescue ArgumentError
-    :ok
-  end
-}
-
-assert_not_match /method_missing/, %q{
-  STDERR.reopen(STDOUT)
-  variable_or_mehtod_not_exist
-}
-
-assert_equal '[false, false, false, false, true, true]', %q{
-  class C
-    define_method(:foo) {
-      block_given?
-    }
-  end
-
-  C.new.foo {}
-
-  class D
-    def foo
-      D.module_eval{
-        define_method(:m1){
-          block_given?
-        }
-      }
-    end
-    def bar
-      D.module_eval{
-        define_method(:m2){
-          block_given?
-        }
-      }
-    end
-  end
-
-  D.new.foo
-  D.new.bar{}
-  [C.new.foo, C.new.foo{}, D.new.m1, D.new.m1{}, D.new.m2, D.new.m2{}]
-}, '[ruby-core:14813]'
-
-assert_equal 'ok', %q{
-  class Foo
-    define_method(:foo) do |&b|
-      b.call
-    end
-  end
-  Foo.new.foo do
-    break :ok
-  end
-}, '[ruby-dev:36028]'
-
-assert_equal '[1, 2, [3, 4]]', %q{
-  def regular(a, b, *c)
-    [a, b, c]
-  end
-  regular(*[], 1, *[], *[2, 3], *[], 4)
-}, '[ruby-core:19413]'
-
-assert_equal '[1, [:foo, 3, 4, :foo]]', %q{
-  def regular(a, *b)
-    [a, b]
-  end
-  a = b = [:foo]
-  regular(1, *a, *[3, 4], *b)
-}
-
-assert_equal '["B", "A"]', %q{
-  class A
-    def m
-      'A'
-    end
-  end
-
-  class B < A
-    define_method(:m) do
-      ['B', super()]
-    end
-  end
-
-  class C < B
-  end
-
-  C.new.m
-}
-
-assert_equal 'ok', %q{
-  module Foo
-    def foo
-      begin
-        super
-      rescue NoMethodError
-        :ok
-      end
-    end
-    module_function :foo
-  end
-  Foo.foo
-}, '[ruby-dev:37587]'
-
-assert_equal 'Object#foo', %q{
-  class Object
-    def self.foo
-      "Object.foo"
-    end
-    def foo
-      "Object#foo"
-    end
-  end
-
-  module Foo
-    def foo
-      begin
-        super
-      rescue NoMethodError
-        :ok
-      end
-    end
-    module_function :foo
-  end
-  Foo.foo
-}, '[ruby-dev:37587]'
-
-assert_normal_exit %q{
-  class BasicObject
-    remove_method :method_missing
-  end
-  begin
-    "a".lalala!
-  rescue NoMethodError => e
-    e.message == "undefined method `lalala!' for \"a\":String" ? :ok : :ng
-  end
-}, '[ruby-core:22298]'
-
-assert_equal 'ok', %q{
-  "hello"[0] ||= "H"
-  "ok"
-}
-
-assert_equal 'ok', %q{
-  "hello"[0, 1] ||= "H"
-  "ok"
-}
-
-assert_equal 'ok', %q{
-  class C
-    define_method(:foo) do
-      C.class_eval { remove_method(:foo) }
-      super()
-    end
-  end
-  begin
-    C.new.foo
-  rescue NoMethodError
-    'ok'
-  end
-}
-assert_equal 'ok', %q{
-  [0][0, &proc{}] += 21
-  'ok'
-}, '[ruby-core:30534]'
-
-# should not cache when splat
-assert_equal 'ok', %q{
-  class C
-    attr_reader :a
-    def initialize
-      @a = 1
-    end
-  end
-
-  def m *args
-    C.new.a(*args)
-  end
-
-  m()
-  begin
-    m(1)
-  rescue ArgumentError
-    'ok'
-  end
-}
-
-assert_equal 'DC', %q{
-  $result = []
-
-  class C
-    def foo *args
-      $result << 'C'
-    end
-  end
-  class D
-    def foo *args
-      $result << 'D'
-    end
-  end
-
-  o1 = $o1 = C.new
-  o2 = $o2 = D.new
-
-  args = Object.new
-  def args.to_a
-    test1 $o2, nil
-    []
-  end
-  def test1 o, args
-    o.foo(*args)
-  end
-  test1 o1, args
-  $result.join
-}
-
-assert_equal 'DC', %q{
-  $result = []
-
-  class C
-    def foo *args
-      $result << 'C'
-    end
-  end
-  class D
-    def foo *args
-      $result << 'D'
-    end
-  end
-
-  o1 = $o1 = C.new
-  o2 = $o2 = D.new
-
-  block = Object.new
-  def block.to_proc
-    test2 $o2, %w(a, b, c), nil
-    Proc.new{}
-  end
-  def test2 o, args, block
-    o.foo(*args, &block)
-  end
-  test2 o1, [], block
-  $result.join
-}
diff --git a/bootstraptest/test_objectspace.rb b/bootstraptest/test_objectspace.rb
deleted file mode 100644
index 862a94e376..0000000000
--- a/bootstraptest/test_objectspace.rb
+++ /dev/null
@@ -1,46 +0,0 @@
-assert_normal_exit %q{
-  eval("", TOPLEVEL_BINDING)
-  minobj = ObjectSpace.to_enum(:each_object).min_by {|a| a.object_id }
-  maxobj = ObjectSpace.to_enum(:each_object).max_by {|a| a.object_id }
-  (((minobj.object_id-100)..(minobj.object_id+100))+
-   ((maxobj.object_id-100)..(maxobj.object_id+100))).each {|id|
-    begin
-      o = ObjectSpace._id2ref(id)
-    rescue RangeError
-      next
-    end
-    o.inspect if defined?(o.inspect)
-  }
-}, '[ruby-dev:31911]'
-
-assert_normal_exit %q{
-  ary = (1..10).to_a
-  ary.permutation(2) {|x|
-    if x == [1,2]
-      ObjectSpace.each_object(String) {|s|
-        s.clear if !s.frozen? && (s.length == 40 || s.length == 80)
-      }
-    end
-  }
-}, '[ruby-dev:31982]'
-
-assert_normal_exit %q{
-  ary = (1..100).to_a
-  ary.permutation(2) {|x|
-    if x == [1,2]
-      ObjectSpace.each_object(Array) {|o| o.clear if o == ary && o.object_id != ary.object_id }
-    end
-  }
-}, '[ruby-dev:31985]'
-
-assert_normal_exit %q{
-  ObjectSpace.define_finalizer("") do
-    Mutex.new.lock
-  end
-}, '[ruby-dev:44049]'
-
-assert_normal_exit %q{
-  ObjectSpace.define_finalizer("") do
-    Thread.new {}
-  end
-}, '[ruby-core:37858]'
diff --git a/bootstraptest/test_proc.rb b/bootstraptest/test_proc.rb
deleted file mode 100644
index c23394e8d2..0000000000
--- a/bootstraptest/test_proc.rb
+++ /dev/null
@@ -1,483 +0,0 @@
-assert_equal %q{[1, 2, 3]}, %q{
-  def getproc &b
-    b
-  end
-
-  def m
-    yield
-  end
-
-  m{
-    i = 1
-    m{
-      j = 2
-      m{
-        k = 3
-        getproc{
-          [i, j, k]
-        }
-      }
-    }
-  }.call
-}
-assert_equal %q{7}, %q{
-  def make_proc(&b)
-    b
-  end
-
-  def make_closure
-    a = 0
-    make_proc{
-      a+=1
-    }
-  end
-
-  cl = make_closure
-  cl.call + cl.call * cl.call
-}
-assert_equal %q{ok}, %q{
-  class C
-    def foo
-      :ok
-    end
-  end
-
-  def block
-    C.method(:new).to_proc
-  end
-  b = block()
-  b.call.foo
-}
-assert_equal %q{[0, 1, :last, 0, 2, :last]}, %q{
-  def proc &b
-    b
-  end
-
-  pr = []
-  proc{|i_b|
-    p3 = proc{|j_b|
-      pr << proc{|k_b|
-        [i_b, j_b, k_b]
-      }
-    }
-    p3.call(1)
-    p3.call(2)
-  }.call(0)
-
-  pr[0].call(:last).concat pr[1].call(:last)
-}
-assert_equal %q{12}, %q{
-  def iter
-    yield
-  end
-
-  def getproc &b
-    b
-  end
-
-  iter{
-    bvar = 3
-    getproc{
-      bvar2 = 4
-      bvar * bvar2
-    }
-  }.call
-}
-assert_equal %q{200}, %q{
-  def iter
-    yield
-  end
-
-  def getproc &b
-    b
-  end
-
-  loc1 = 0
-  pr1 = iter{
-    bl1 = 1
-    getproc{
-      loc1 += 1
-      bl1  += 1
-      loc1 + bl1
-    }
-  }
-
-  pr2 = iter{
-    bl1 = 1
-    getproc{
-      loc1 += 1
-      bl1  += 1
-      loc1 + bl1
-    }
-  }
-
-  pr1.call; pr2.call
-  pr1.call; pr2.call
-  pr1.call; pr2.call
-  (pr1.call + pr2.call) * loc1
-}
-assert_equal %q{[1, 2]}, %q{
-  def proc(&pr)
-    pr
-  end
-
-  def m
-    a = 1
-    m2{
-      a
-    }
-  end
-
-  def m2
-    b = 2
-    proc{
-      [yield, b]
-    }
-  end
-
-  pr = m
-  x = ['a', 1,2,3,4,5,6,7,8,9,0,
-            1,2,3,4,5,6,7,8,9,0,
-            1,2,3,4,5,6,7,8,9,0,
-            1,2,3,4,5,6,7,8,9,0,
-            1,2,3,4,5,6,7,8,9,0,]
-  pr.call
-}
-assert_equal %q{1}, %q{
-  def proc(&pr)
-    pr
-  end
-
-  def m
-    a = 1
-    m2{
-      a
-    }
-  end
-
-  def m2
-    b = 2
-    proc{
-      [yield, b]
-    }
-    100000.times{|x|
-      "#{x}"
-    }
-    yield
-  end
-  m
-}
-assert_equal %q{[:C, :C]}, %q{
-  Const = :top
-  class C
-    Const = :C
-    $pr = proc{
-      (1..2).map{
-        Const
-      }
-    }
-  end
-  $pr.call
-}
-assert_equal %q{top}, %q{
-  Const = :top
-  class C
-    Const = :C
-  end
-  pr = proc{
-    Const
-  }
-  C.class_eval %q{
-    pr.call
-  }
-}
-assert_equal %q{1}, %q{
-  def m(&b)
-    b
-  end
-
-  m{|e_proctest| e_proctest}.call(1)
-}
-assert_equal %q{12}, %q{
-  def m(&b)
-    b
-  end
-
-  m{|e_proctest1, e_proctest2|
-    a = e_proctest1 * e_proctest2 * 2
-    a * 3
-  }.call(1, 2)
-}
-assert_equal %q{[[], [1], [1, 2], [1, 2, 3]]}, %q{
-  [
-  Proc.new{|*args| args}.call(),
-  Proc.new{|*args| args}.call(1),
-  Proc.new{|*args| args}.call(1, 2),
-  Proc.new{|*args| args}.call(1, 2, 3),
-  ]
-}
-assert_equal %q{[[nil, []], [1, []], [1, [2]], [1, [2, 3]]]}, %q{
-  [
-  Proc.new{|a, *b| [a, b]}.call(),
-  Proc.new{|a, *b| [a, b]}.call(1),
-  Proc.new{|a, *b| [a, b]}.call(1, 2),
-  Proc.new{|a, *b| [a, b]}.call(1, 2, 3),
-  ]
-}
-assert_equal %q{0}, %q{
-  pr = proc{
-    $SAFE
-  }
-  $SAFE = 1
-  pr.call
-}
-assert_equal %q{[1, 0]}, %q{
-  pr = proc{
-    $SAFE += 1
-  }
-  [pr.call, $SAFE]
-}
-assert_equal %q{1}, %q{
-  def m(&b)
-    b
-  end
-  m{1}.call
-}
-assert_equal %q{3}, %q{
-  def m(&b)
-    b
-  end
-
-  m{
-    a = 1
-    a + 2
-  }.call
-}
-assert_equal %Q{ok\n}, %q{
-  class A; def get_block; proc {puts "ok"} end end
-  block = A.new.get_block
-  GC.start
-  block.call
-}, '[ruby-core:14885]'
-
-assert_equal 'ok', %q{
-  a = lambda {|x, y, &b| b }
-  b = a.curry[1]
-  if b.call(2){} == nil
-    :ng
-  else
-    :ok
-  end
-}, '[ruby-core:15551]'
-
-assert_equal 'ok', %q{
-  lambda {
-    break :ok
-    :ng
-  }.call
-}, '[ruby-dev:34646]'
-
-assert_equal %q{[:bar, :foo]}, %q{
-  def foo
-    klass = Class.new do
-      define_method(:bar) do
-        return :bar
-      end
-    end
-    [klass.new.bar, :foo]
-  end
-  foo
-}, "[ ruby-Bugs-19304 ]"
-
-assert_equal 'ok', %q{
-   $x = :ok
-   def def7(x, y)
-      x[y]
-      $x = :ng
-   end
-   def test_def7
-      def7(lambda {|x| x.call}, Proc.new {return})
-      $x = :ng
-   end
-   test_def7
-   $x
-}, '[ruby-core:17164]'
-
-assert_equal 'ok', %q{
-  lambda { a = lambda { return }; $x = :ng; a[]; $x = :ok }.call
-  $x
-}, '[ruby-core:17164]'
-
-assert_equal 'ok', %q{
-  lambda { a = lambda { break }; $x = :ng; a[]; $x = :ok }.call
-  $x
-}, '[ruby-core:17164]'
-
-assert_equal 'ok', %q{
-  def def8
-    $x = :ng
-    lambda { a = Proc.new { return }; a[]}.call
-    $x = :ok
-  end
-  def8
-  $x
-}, '[ruby-core:17164]'
-
-
-assert_equal 'ok', %q{
-   def def9
-      lambda {|a| $x = :ok; a[]; $x = :ng }.call(Proc.new { return })
-      $x = :ng
-   end
-   def9
-   $x
-}, '[ruby-core:17164]'
-
-assert_equal 'ok', %q{
-   def def10
-     $x = :ng
-     lambda { 1.times { return } }.call
-     $x = :ok
-   end
-   $x = :ok
-   def10
-   $x
-}, '[ruby-core:17164]'
-
-assert_equal 'ok', %q{
-   def def11
-      yield
-   end
-   begin
-      lambda { def11 { return } }.call
-   rescue LocalJumpError
-      :ng
-   else
-      :ok
-   end
-}, '[ruby-core:17164]'
-
-assert_equal 'ok', %q{
-   def def12
-      b = Proc.new { $x = :ng; lambda { return }.call; $x = :ok }.call
-   end
-   def12
-   $x
-}, '[ruby-core:17164]'
-
-assert_equal 'ok', %q{
-  def m
-    pr = proc{
-      proc{
-        return :ok
-      }
-    }.call
-    pr.call
-    :ng
-  end
-  m()
-}
-
-assert_equal 'ok', %q{
-  class Foo
-    def call_it
-      p = Proc.new
-      p.call
-    end
-  end
-
-  def give_it
-    proc { :ok }
-  end
-
-  f = Foo.new
-  a_proc = give_it
-  f.call_it(&give_it())
-}, '[ruby-core:15711]'
-
-assert_equal 'foo!', %q{
-  class FooProc < Proc
-    def initialize
-      @foo = "foo!"
-    end
-
-    def bar
-      @foo
-    end
-  end
-
-  def bar
-    FooProc.new &lambda{
-      p 1
-    }
-  end
-
-  fp = bar(&lambda{
-    p 2
-  })
-
-  fp.bar
-}, 'Subclass of Proc'
-
-assert_equal 'ok', %q{
-  o = Object.new
-  def o.write(s); end
-  $stderr = o
-  at_exit{
-    print $!.message
-  }
-  raise "ok"
-}
-
-assert_equal 'ok', %q{
-  lambda do
-    class A
-      class B
-        proc{return :ng}.call
-      end
-    end
-  end.call
-  :ok
-}
-
-assert_equal 'ok', %q{
-  $proc = proc{return}
-  begin
-    lambda do
-      class A
-        class B
-          $proc.call
-        end
-      end
-    end.call
-    :ng
-  rescue LocalJumpError
-    :ok
-  end
-}
-
-assert_equal 'ok', %q{
-  def x
-    binding
-  end
-  b = x{|a| a }
-  b.eval('yield("ok")')
-}, '[Bug #5634]'
-
-assert_equal 'ok', %q{
-  def x
-    binding
-  end
-  eval("x { 'ok' }").eval "yield"
-}, '[Bug #5634]'
-
-assert_equal 'ok', %q{
-  def x
-    binding
-  end
-  def m
-    x{ 'ok' }
-  end
-  eval('yield', m)
-}, '[Bug #5634]'
-
diff --git a/bootstraptest/test_string.rb b/bootstraptest/test_string.rb
deleted file mode 100644
index 849dcd45b0..0000000000
--- a/bootstraptest/test_string.rb
+++ /dev/null
@@ -1,3 +0,0 @@
-assert_normal_exit %q{
-  inspect.clear
-}, '[ruby-core:68110]'
diff --git a/bootstraptest/test_struct.rb b/bootstraptest/test_struct.rb
deleted file mode 100644
index a65964d5f9..0000000000
--- a/bootstraptest/test_struct.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-assert_equal 'Struct::Foo', %q{
-  Struct.instance_eval { const_set(:Foo, nil) }
-  Struct.new("Foo")
-  Struct::Foo
-}
diff --git a/bootstraptest/test_syntax.rb b/bootstraptest/test_syntax.rb
deleted file mode 100644
index a111990a1f..0000000000
--- a/bootstraptest/test_syntax.rb
+++ /dev/null
@@ -1,904 +0,0 @@
-assert_equal %q{4}, %q{1 && 2 && 3 && 4}
-assert_equal %q{}, %q{1 && nil && 3 && 4}
-assert_equal %q{}, %q{1 && 2 && 3 && nil}
-assert_equal %q{false}, %q{1 && 2 && 3 && false}
-assert_equal %q{4}, %q{1 and 2 and 3 and 4}
-assert_equal %q{}, %q{1 and nil and 3 and 4}
-assert_equal %q{}, %q{1 and 2 and 3 and nil}
-assert_equal %q{false}, %q{1 and 2 and 3 and false}
-assert_equal %q{}, %q{nil && true}
-assert_equal %q{false}, %q{false && true}
-assert_equal %q{}, %q{
-  case 1
-  when 2
-    :ng
-  end}
-assert_equal %q{ok}, %q{
-  case 1
-  when 10,20,30
-    :ng1
-  when 1,2,3
-    :ok
-  when 100,200,300
-    :ng2
-  else
-    :elseng
-  end}
-assert_equal %q{elseok}, %q{
-  case 123
-  when 10,20,30
-    :ng1
-  when 1,2,3
-    :ng2
-  when 100,200,300
-    :ng3
-  else
-    :elseok
-  end
-}
-assert_equal %q{ok}, %q{
-  case 'test'
-  when /testx/
-    :ng1
-  when /test/
-    :ok
-  when /tetxx/
-    :ng2
-  else
-    :ng_else
-  end
-}
-assert_equal %q{ok}, %q{
-  case Object.new
-  when Object
-    :ok
-  end
-}
-assert_equal %q{ok}, %q{
-  case Object
-  when Object.new
-    :ng
-  else
-    :ok
-  end
-}
-assert_equal %q{ok}, %q{
-  case 'test'
-  when 'tes'
-    :ng
-  when 'te'
-    :ng
-  else
-    :ok
-  end
-}
-assert_equal %q{ok}, %q{
-  case 'test'
-  when 'tes'
-    :ng
-  when 'te'
-    :ng
-  when 'test'
-    :ok
-  end
-}
-assert_equal %q{ng}, %q{
-  case 'test'
-  when 'tes'
-    :ng
-  when /te/
-    :ng
-  else
-    :ok
-  end
-}
-assert_equal %q{ok}, %q{
-  case 'test'
-  when 'tes'
-    :ng
-  when /test/
-    :ok
-  else
-    :ng
-  end
-}
-assert_equal %q{100}, %q{
-  def test(arg)
-    case 1
-    when 2
-      3
-    end
-    return arg
-  end
-
-  test(100)
-}
-assert_equal %q{ok}, %q{
-  ary = [1, 2]
-  case 1
-  when *ary
-    :ok
-  else
-    :ng
-  end
-}
-assert_equal %q{ok}, %q{
-  ary = [1, 2]
-  case 3
-  when *ary
-    :ng
-  else
-    :ok
-  end
-}
-assert_equal %q{ok}, %q{
-  ary = [1, 2]
-  case 1
-  when :x, *ary
-    :ok
-  when :z
-    :ng1
-  else
-    :ng2
-  end
-}
-assert_equal %q{ok}, %q{
-  ary = [1, 2]
-  case 3
-  when :x, *ary
-    :ng1
-  when :z
-    :ng2
-  else
-    :ok
-  end
-}
-assert_equal %q{[:false, :false, :false, :false, :false, :false, :false, :false, :false, :false, :false, :then, :false, :false, :false, :then, :false, :false, :false, :then, :false, :false, :false, :then, :false, :false, :then, :then, :false, :false, :then, :then, :false, :false, :then, :then, :false, :false, :then, :then, :false, :then, :then, :then, :false, :then, :then, :then, :false, :then, :then, :then, :false, :then, :then, :then, :then, :then, :then, :then, :then, :then, :then, :then, :false, :false, :false, :then, :false, :false, :false, :then, :false, :false, :false, :false, :false, :false, :false, :false, :false, :false, :then, :then, :false, :false, :then, :then, :false, :false, :false, :then, :false, :false, :false, :then, :false, :then, :then, :then, :false, :then, :then, :then, :false, :false, :then, :then, :false, :false, :then, :then, :then, :then, :then, :then, :then, :then, :then, :then, :false, :then, :then, :then, :false, :then, :then, :then, :false, :false, :false, :then, :false, :false, :false, :then, :false, :false, :then, :then, :false, :false, :then, :then, :false, :false, :false, :false, :false, :false, :false, :false, :false, :false, :false, :then, :false, :false, :false, :then, :false, :then, :then, :then, :false, :then, :then, :then, :then, :then, :then, :then, :then, :then, :then, :then, :false, :false, :then, :then, :false, :false, :then, :then, :false, :then, :then, :then, :false, :then, :then, :then, :false, :false, :then, :then, :false, :false, :then, :then, :false, :false, :false, :then, :false, :false, :false, :then, :false, :false, :false, :then, :false, :false, :false, :then, :false, :false, :false, :false, :false, :false, :false, :false, :then, :then, :then, :then, :then, :then, :then, :then, :false, :then, :then, :then, :false, :then, :then, :then, :false, :then, :then, :then, :false, :then, :then, :then, :false, :false, :then, :then, :false, :false, :then, :then, :false, :false, :then, :then, :false, :false, :then, :then, :false, :then, :then, :then, :false, :then, :then, :then, :false, :then, :then, :then, :false, :then, :then, :then, :then, :then, :then, :then, :then, :then, :then, :then, :false, :false, :false, :false, :false, :false, :false, :false, :false, :false, :false, :then, :false, :false, :false, :then, :false, :false, :false, :then, :false, :false, :false, :then, :false, :false, :then, :then, :false, :false, :then, :then, :false, :then, :then, :then, :false, :then, :then, :then, :false, :false, :then, :then, :false, :false, :then, :then, :then, :then, :then, :then, :then, :then, :then, :then, :false, :then, :then, :then, :false, :then, :then, :then, :false, :false, :false, :then, :false, :false, :false, :then, :false, :false, :false, :false, :false, :false, :false, :false, :false, :false, :then, :then, :false, :false, :then, :then, :false, :false, :false, :then, :false, :false, :false, :then, :false, :then, :then, :then, :false, :then, :then, :then, :then, :then, :then, :then, :then, :then, :then, :then, :false, :false, :then, :then, :false, :false, :then, :then, :false, :then, :then, :then, :false, :then, :then, :then, :false, :false, :false, :then, :false, :false, :false, :then, :false, :false, :then, :then, :false, :false, :then, :then, :false, :false, :false, :false, :false, :false, :false, :false, :false, :false, :false, :then, :false, :false, :false, :then, :then, :then, :then, :then, :then, :then, :then, :then, :false, :then, :then, :then, :false, :then, :then, :then, :false, :then, :then, :then, :false, :then, :then, :then, :false, :false, :then, :then, :false, :false, :then, :then, :false, :false, :then, :then, :false, :false, :then, :then, :false, :false, :false, :then, :false, :false, :false, :then, :false, :false, :false, :then, :false, :false, :false, :then, :false, :false, :false, :false, :false, :false, :false, :false, :then, :then, :then, :then, :then, :then, :then, :then, :then, :then, :then, :false, :then, :then, :then, :false, :then, :then, :then, :false, :then, :then, :then, :false, :then, :then, :false, :false, :then, :then, :false, :false, :then, :then, :false, :false, :then, :then, :false, :false, :then, :false, :false, :false, :then, :false, :false, :false, :then, :false, :false, :false, :then, :false, :false, :false, :false, :false, :false, :false, :false, :false, :false, :false, :then, :then, :then, :false, :then, :then, :then, :false, :then, :then, :then, :then, :then, :then, :then, :then, :then, :then, :false, :false, :then, :then, :false, :false, :then, :then, :then, :false, :then, :then, :then, :false, :then, :false, :false, :false, :then, :false, :false, :false, :then, :then, :false, :false, :then, :then, :false, :false, :false, :false, :false, :false, :false, :false, :false, :false, :then, :false, :false, :false, :then, :false, :false, :false, :then, :then, :then, :false, :then, :then, :then, :false, :then, :then, :false, :false, :then, :then, :false, :false, :then, :then, :then, :then, :then, :then, :then, :then, :then, :then, :then, :false, :then, :then, :then, :false, :then, :false, :false, :false, :then, :false, :false, :false, :false, :false, :false, :false, :false, :false, :false, :false, :then, :then, :false, :false, :then, :then, :false, :false, :then, :false, :false, :false, :then, :false, :false, :false, :then, :then, :false, :false, :then, :then, :false, :false, :then, :then, :then, :false, :then, :then, :then, :false, :then, :then, :then, :false, :then, :then, :then, :false, :then, :then, :then, :then, :then, :then, :then, :then, :false, :false, :false, :false, :false, :false, :false, :false, :then, :false, :false, :false, :then, :false, :false, :false, :then, :false, :false, :false, :then, :false, :false, :false, :then, :then, :false, :false, :then, :then, :false, :false, :then, :then, :false, :false, :then, :then, :false, :false, :then, :false, :false, :false, :then, :false, :false, :false, :then, :false, :false, :false, :then, :false, :false, :false, :false, :false, :false, :false, :false, :false, :false, :false, :then, :then, :then, :then, :then, :then, :then, :then, :then, :then, :then, :false, :then, :then, :then, :false, :then, :then, :then, :false, :then, :then, :then, :false, :then, :then, :false, :false, :then, :then, :false, :false, :then, :false, :false, :false, :then, :false, :false, :false, :then, :then, :false, :false, :then, :then, :false, :false, :false, :false, :false, :false, :false, :false, :false, :false, :then, :false, :false, :false, :then, :false, :false, :false, :then, :then, :then, :false, :then, :then, :then, :false, :then, :then, :then, :then, :then, :then, :then, :then, :then, :then, :false, :false, :then, :then, :false, :false, :then, :then, :then, :false, :then, :then, :then, :false, :then, :false, :false, :false, :then, :false, :false, :false, :false, :false, :false, :false, :false, :false, :false, :false, :then, :then, :false, :false, :then, :then, :false, :false, :then, :false, :false, :false, :then, :false, :false, :false, :then, :then, :then, :false, :then, :then, :then, :false, :then, :then, :false, :false, :then, :then, :false, :false, :then, :then, :then, :then, :then, :then, :then, :then, :then, :then, :then, :false, :then, :then, :then, :false, :false, :false, :false, :false, :false, :false, :false, :false, :then, :false, :false, :false, :then, :false, :false, :false, :then, :false, :false, :false, :then, :false, :false, :false, :then, :then, :false, :false, :then, :then, :false, :false, :then, :then, :false, :false, :then, :then, :false, :false, :then, :then, :then, :false, :then, :then, :then, :false, :then, :then, :then, :false, :then, :then, :then, :false, :then, :then, :then, :then, :then, :then, :then, :then, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep, :then, :sep]}, %q{
-
-  def make_perm ary, num
-    if num == 1
-      ary.map{|e| [e]}
-    else
-      base = make_perm(ary, num-1)
-      res  = []
-      base.each{|b|
-        ary.each{|e|
-          res << [e] + b
-        }
-      }
-      res
-    end
-  end
-
-  def each_test
-    conds = make_perm(['fv', 'tv'], 3)
-    bangs = make_perm(['', '!'], 3)
-    exprs = make_perm(['and', 'or'], 3)
-    ['if', 'unless'].each{|syn|
-      conds.each{|cs|
-        bangs.each{|bs|
-          exprs.each{|es|
-            yield(syn, cs, bs, es)
-          }
-        }
-      }
-    }
-  end
-
-  fv = false
-  tv = true
-
-  $ans = []
-  each_test{|syn, conds, bangs, exprs|
-    c1, c2, c3 = conds
-    bang1, bang2, bang3 = bangs
-    e1, e2 = exprs
-    eval %Q{
-      #{syn} #{bang1}#{c1} #{e1} #{bang2}#{c2} #{e2} #{bang3}#{c3}
-        $ans << :then
-      else
-        $ans << :false
-      end
-    }
-  }
-
-  each_test{|syn, conds, bangs, exprs|
-    c1, c2, c3 = conds
-    bang1, bang2, bang3 = bangs
-    e1, e2 = exprs
-    eval %Q{
-      #{syn} #{bang1}#{c1} #{e1} #{bang2}#{c2} #{e2} #{bang3}#{c3}
-        $ans << :then
-      end
-      $ans << :sep
-    }
-  }
-  $ans
-}
-assert_equal %q{}, %q{
-  defined?(m)
-}
-assert_equal %q{method}, %q{
-  def m
-  end
-  defined?(m)
-}
-assert_equal %q{}, %q{
-  defined?(a.class)
-}
-assert_equal %q{method}, %q{
-  a = 1
-  defined?(a.class)
-}
-assert_equal %q{["method", "method", "method", "method", nil, nil, "method", "method", "method", nil]}, %q{
-  class C
-    def test
-      [defined?(m1()), defined?(self.m1), defined?(C.new.m1),
-       defined?(m2()), defined?(self.m2), defined?(C.new.m2),
-       defined?(m3()), defined?(self.m3), defined?(C.new.m3)]
-    end
-    def m1
-    end
-    private
-    def m2
-    end
-    protected
-    def m3
-    end
-  end
-  C.new.test + [defined?(C.new.m3)]
-}
-assert_equal %q{[nil, nil, nil, nil, "global-variable", "global-variable", nil, nil]}, %q{
-  $ans = [defined?($1), defined?($2), defined?($3), defined?($4)]
-  /(a)(b)/ =~ 'ab'
-  $ans + [defined?($1), defined?($2), defined?($3), defined?($4)]
-}
-assert_equal %q{nilselftruefalse}, %q{
-  defined?(nil) + defined?(self) +
-    defined?(true) + defined?(false)
-}
-assert_equal %q{}, %q{
-  defined?(@a)
-}
-assert_equal %q{instance-variable}, %q{
-  @a = 1
-  defined?(@a)
-}
-assert_equal %q{}, %q{
-  defined?(@@a)
-}
-assert_equal %q{class variable}, %q{
-  @@a = 1
-  defined?(@@a)
-}
-assert_equal %q{}, %q{
-  defined?($a)
-}
-assert_equal %q{global-variable}, %q{
-  $a = 1
-  defined?($a)
-}
-assert_equal %q{}, %q{
-  defined?(C_definedtest)
-}
-assert_equal %q{constant}, %q{
-  C_definedtest = 1
-  defined?(C_definedtest)
-}
-assert_equal %q{}, %q{
-  defined?(::C_definedtest)
-}
-assert_equal %q{constant}, %q{
-  C_definedtest = 1
-  defined?(::C_definedtest)
-}
-assert_equal %q{}, %q{
-  defined?(C_definedtestA::C_definedtestB::C_definedtestC)
-}
-assert_equal %q{constant}, %q{
-  class C_definedtestA
-    class C_definedtestB
-      C_definedtestC = 1
-    end
-  end
-  defined?(C_definedtestA::C_definedtestB::C_definedtestC)
-}
-assert_equal %q{30}, %q{
-  sum = 0
-  30.times{|ib|
-    if ib % 10 == 0 .. true
-      sum += ib
-    end
-  }
-  sum
-}
-assert_equal %q{63}, %q{
-  sum = 0
-  30.times{|ib|
-    if ib % 10 == 0 ... true
-      sum += ib
-    end
-  }
-  sum
-}
-assert_equal %q{[["NUM", "Type: NUM\n"], ["NUM", "123\n"], ["NUM", "456\n"], ["NUM", "Type: ARP\n"], ["NUM", "aaa\n"], ["NUM", "bbb\n"], ["NUM", "\f\n"], ["ARP", "Type: ARP\n"], ["ARP", "aaa\n"], ["ARP", "bbb\n"]]}, %q{
-  t = nil
-  unless ''.respond_to? :lines
-    class String
-      def lines
-        self
-      end
-    end
-  end
-  ary = []
-"this must not print
-Type: NUM
-123
-456
-Type: ARP
-aaa
-bbb
-\f
-this must not print
-hoge
-Type: ARP
-aaa
-bbb
-".lines.each{|l|
-    if (t = l[/^Type: (.*)/, 1])..(/^\f/ =~ l)
-      ary << [t, l]
-    end
-  }
-  ary
-}
-assert_equal %q{1}, %q{if true  then 1 ; end}
-assert_equal %q{}, %q{if false then 1 ; end}
-assert_equal %q{1}, %q{if true  then 1 ; else; 2; end}
-assert_equal %q{2}, %q{if false then 1 ; else; 2; end}
-assert_equal %q{}, %q{if true  then   ; elsif true then ; 1 ; end}
-assert_equal %q{1}, %q{if false then   ; elsif true then ; 1 ; end}
-assert_equal %q{}, %q{unless true  then 1 ; end}
-assert_equal %q{1}, %q{unless false then 1 ; end}
-assert_equal %q{2}, %q{unless true  then 1 ; else; 2; end}
-assert_equal %q{1}, %q{unless false then 1 ; else; 2; end}
-assert_equal %q{1}, %q{1 if true}
-assert_equal %q{}, %q{1 if false}
-assert_equal %q{}, %q{1 if nil}
-assert_equal %q{}, %q{1 unless true}
-assert_equal %q{1}, %q{1 unless false}
-assert_equal %q{1}, %q{1 unless nil}
-assert_equal %q{1}, %q{1 || 2 || 3 || 4}
-assert_equal %q{1}, %q{1 || false || 3 || 4}
-assert_equal %q{2}, %q{nil || 2 || 3 || 4}
-assert_equal %q{2}, %q{false || 2 || 3 || 4}
-assert_equal %q{false}, %q{nil || false || nil || false}
-assert_equal %q{1}, %q{1 or 2 or 3 or 4}
-assert_equal %q{1}, %q{1 or false or 3 or 4}
-assert_equal %q{2}, %q{nil or 2 or 3 or 4}
-assert_equal %q{2}, %q{false or 2 or 3 or 4}
-assert_equal %q{1}, %q{if true && ""; then 1; end}
-assert_equal %q{1}, %q{if nil || true; then 1; end}
-assert_equal %q{false}, %q{nil or false or nil or false}
-assert_equal %q{elseng}, %q{
-  case
-  when 1==2, 2==3
-    :ng1
-  when false, 4==5
-    :ok
-  when false
-    :ng2
-  else
-    :elseng
-  end
-}
-assert_equal %q{ok}, %q{
-  case
-  when nil, nil
-    :ng1
-  when 1,2,3
-    :ok
-  when false, false
-    :ng2
-  else
-    :elseng
-  end
-}
-assert_equal %q{elseok}, %q{
-  case
-  when nil
-    :ng1
-  when false
-    :ng2
-  else
-    :elseok
-  end}
-assert_equal %q{}, %q{
-  case
-  when 1
-  end
-}
-assert_equal %q{ok}, %q{
-  r = nil
-  ary = []
-  case
-  when false
-    r = :ng1
-  when false, false
-    r = :ng2
-  when *ary
-    r = :ng3
-  when false, *ary
-    r = :ng4
-  when true, *ary
-    r = :ok
-  end
-  r
-}
-assert_equal %q{ok}, %q{
-  ary = []
-  case
-  when false, *ary
-    :ng
-  else
-    :ok
-  end
-}
-assert_equal %q{ok}, %q{
-  ary = [false, nil]
-  case
-  when *ary
-    :ng
-  else
-    :ok
-  end
-}
-assert_equal %q{ok}, %q{
-  ary = [false, nil]
-  case
-  when *ary
-    :ng
-  when true
-    :ok
-  else
-    :ng2
-  end
-}
-assert_equal %q{ng}, %q{
-  ary = [false, nil]
-  case
-  when *ary
-    :ok
-  else
-    :ng
-  end
-}
-assert_equal %q{ok}, %q{
-  ary = [false, true]
-  case
-  when *ary
-    :ok
-  else
-    :ng
-  end
-}
-assert_equal %q{ok}, %q{
-  ary = [false, true]
-  case
-  when false, false
-  when false, *ary
-    :ok
-  else
-    :ng
-  end
-}
-assert_equal %q{}, %q{
-  i = 0
-  while i < 10
-    i+=1
-  end}
-assert_equal %q{10}, %q{
-  i = 0
-  while i < 10
-    i+=1
-  end; i}
-assert_equal %q{}, %q{
-  i = 0
-  until i > 10
-    i+=1
-  end}
-assert_equal %q{11}, %q{
-  i = 0
-  until i > 10
-    i+=1
-  end; i}
-assert_equal %q{1}, %q{
-  i = 0
-  begin
-    i+=1
-  end while false
-  i
-}
-assert_equal %q{1}, %q{
-  i = 0
-  begin
-    i+=1
-  end until true
-  i
-}
-def assert_syntax_error expected, code, message = ''
-  assert_equal "#{expected}",
-    "begin eval(%q{#{code}}, nil, '', 0)"'; rescue SyntaxError => e; e.message[/\A:(?:\d+:)? (.*)/, 1] end', message
-end
-assert_syntax_error "unterminated string meets end of file", '().."', '[ruby-dev:29732]'
-assert_equal %q{[]}, %q{$&;[]}, '[ruby-dev:31068]'
-assert_syntax_error "syntax error, unexpected *, expecting '}'", %q{{*0}}, '[ruby-dev:31072]'
-assert_syntax_error "`@0' is not allowed as an instance variable name", %q{@0..0}, '[ruby-dev:31095]'
-assert_syntax_error "identifier $00 is not valid to get", %q{$00..0}, '[ruby-dev:31100]'
-assert_syntax_error "identifier $00 is not valid to set", %q{0..$00=1}
-assert_equal %q{0}, %q{[*0];0}, '[ruby-dev:31102]'
-assert_syntax_error "syntax error, unexpected ')'", %q{v0,(*,v1,) = 0}, '[ruby-dev:31104]'
-assert_equal %q{1}, %q{
-  class << (ary=[]); def []; 0; end; def []=(x); super(0,x);end;end; ary[]+=1
-}, '[ruby-dev:31110]'
-assert_syntax_error "Can't set variable $1", %q{0..$1=1}, '[ruby-dev:31118]'
-assert_valid_syntax %q{1.times{1+(1&&next)}}, '[ruby-dev:31119]'
-assert_valid_syntax %q{x=-1;loop{x+=1&&redo if (x+=1).zero?}}, '[ruby-dev:31119]'
-assert_syntax_error %q{syntax error, unexpected end-of-input}, %q{!}, '[ruby-dev:31243]'
-assert_equal %q{[nil]}, %q{[()]}, '[ruby-dev:31252]'
-assert_equal %q{true}, %q{!_=()}, '[ruby-dev:31263]'
-assert_equal 'ok', %q{while true; redo; end if 1 == 2; :ok}, '[ruby-dev:31360]'
-assert_equal 'ok', %q{
-  1.times {
-    begin
-    ensure
-      next
-    end
-  }; :ok
-}, '[ruby-dev:31373]'
-assert_equal 'ok', %q{
-  flag = false
-  1.times {
-    next if flag
-    flag = true
-    begin
-    ensure
-      redo
-    end
-  }; :ok
-}, '[ruby-dev:31373]'
-
-assert_equal 'ok', %q{
-  1.times{
-    p(1, (next; 2))
-  }; :ok
-}
-assert_equal '3', %q{
-  i = 0
-  1 + (while true
-         break 2 if (i+=1) > 1
-         next
-       end)
-}
-assert_equal '3', %q{
-  i = 0
-  1 + (while true
-         break 2 if (i+=1) > 1
-         p(1, (next; 2))
-       end)
-}
-# redo
-assert_equal 'ok', %q{
-  i = 0
-  1.times{
-    break if i>1
-    i+=1
-    p(1, (redo; 2))
-  }; :ok
-}
-assert_equal '3', %q{
-  i = 0
-  1 + (while true
-         break 2 if (i+=1) > 1
-         redo
-       end)
-}
-assert_equal '3', %q{
-  i = 0
-  1 + (while true
-         break 2 if (i+=1) > 1
-         p(1, (redo; 2))
-       end)
-}
-assert_equal '1', %q{
-  a = [0]
-  a[*a]+=1
-}
-assert_equal '2', %q{
-  ary = [0]
-  case 1
-  when *ary, 1
-    1
-  end +
-  case
-  when *ary
-    1
-  end
-}
-
-assert_match /invalid multibyte char/, %q{
-  STDERR.reopen(STDOUT)
-  eval("\"\xf0".force_encoding("utf-8"))
-}, '[ruby-dev:32429]'
-
-# method ! and !=
-assert_equal 'true', %q{!false}
-assert_equal 'true', %q{1 == 1}
-assert_equal 'true', %q{1 != 2}
-assert_equal 'true', %q{
-  class C; def !=(obj); true; end; end
-  C.new != 1
-}
-assert_equal 'true', %q{
-  class C; def !@; true; end; end
-  !C.new
-}
-assert_normal_exit %q{
-  eval "while true; return; end rescue p $!"
-}, '[ruby-dev:31663]'
-assert_equal '1', %q{
-  def bar
-    raise
-  end
-
-  def foo
-    1.times{
-      begin
-        return bar
-      rescue
-        :ok
-      end
-    }
-  end
-
-  foo
-}
-
-assert_equal 'ok', %q{
-  counter = 2
-  while true
-    counter -= 1
-    next if counter != 0
-    break
-  end
-  :ok
-}, '[ruby-core:14385]'
-
-assert_equal 'ok', %q{
-  counter = 2
-  while true
-    counter -= 1
-    next if counter != 0
-    break :ok
-  end # direct
-}, '[ruby-core:14385]'
-
-assert_equal 'ok', %q{
-  counter = 2
-  while true
-    counter -= 1
-    break if counter == 0
-    "#{next}"
-  end
-  :ok
-}, 'reported by Yusuke ENDOH'
-
-assert_equal 'ok', %q{
-  counter = 2
-  while true
-    counter -= 1
-    break if counter == 0
-    next
-    redo
-  end
-  :ok
-}, 'reported by Yusuke ENDOH'
-
-assert_equal 'ok', %q{
-  counter = 2
-  while true
-    counter -= 1
-    break if counter == 0
-    next
-    "#{ redo }"
-  end
-  :ok
-}, 'reported by Yusuke ENDOH'
-
-assert_normal_exit %q{
-  begin
-    raise
-  rescue
-    counter = 2
-    while true
-      counter -= 1
-      break if counter == 0
-      next
-      retry
-    end
-  end
-}, 'reported by Yusuke ENDOH'
-
-assert_normal_exit %q{
-  counter = 2
-  while true
-    counter -= 1
-    break if counter == 0
-    next
-    "#{ break }"
-  end
-}, 'reported by Yusuke ENDOH'
-
-assert_normal_exit %q{
-  counter = 2
-  while true
-    counter -= 1
-    next if counter != 0
-    "#{ break }"
-  end
-}, 'reported by Yusuke ENDOH'
-
-assert_equal 'ok', %q{
-  1.times do
-    [
-      1, 2, 3, 4, 5, 6, 7, 8,
-      begin
-        false ? next : p
-        break while true
-      end
-    ]
-  end
-  :ok
-}, '[ruby-dev:32882]'
-
-assert_equal "1\n2\n", %q{
-  i = 0
-  while i<2
-    i += 1
-    next p(i)
-  end
-}
-
-assert_valid_syntax('1.times {|i|print (42),1;}', '[ruby-list:44479]')
-
-assert_equal 'ok', %q{
-  def a() end
-  begin
-    if defined?(a(1).a)
-      :ng
-    else
-      :ok
-    end
-  rescue
-    :ng
-  end
-}, '[ruby-core:16010]'
-
-assert_equal 'ok', %q{
-  def a() end
-  begin
-    if defined?(a::B)
-      :ng
-    else
-      :ok
-    end
-  rescue
-    :ng
-  end
-}, '[ruby-core:16010]'
-
-assert_normal_exit %q{
-  defined? C && 0
-}
-
-assert_normal_exit %q{
-  class C
-    def m
-      defined?(super())
-    end
-  end
-  C.new.m
-}
-
-assert_equal 'ok', %q{
-  class X < RuntimeError;end
-  x = [X]
-  begin
-   raise X
-  rescue *x
-   :ok
-  end
-}, '[ruby-core:14537]'
-
-assert_equal 'ok', %q{
-  a = [false]
-  (a[0] &&= true) == false ? :ok : :ng
-}, '[ruby-dev:34679]'
-
-assert_normal_exit %q{
-  a = []
-  100.times {|i| a << i << nil << nil }
-  p a.compact!
-}
-
-assert_equal 'ok', %q{
-  "#{}""#{}ok"
-}, '[ruby-dev:38968]'
-
-
-assert_equal 'ok', %q{
-  "o" "#{}k"
-}, '[ruby-dev:38980]'
-
-bug2415 = '[ruby-core:26961]'
-assert_normal_exit %q{
-  0.times do
-    0.times do
-      def x(a=1, b, *rest); nil end
-    end
-  end
-}, bug2415
-
-assert_normal_exit %q{
-  0.times do
-    0.times do
-      def x@; nil end
-    end
-  end
-}, bug2415
-
-assert_normal_exit %q{
-  0.times do
-    0.times do
-      def x(a = 0.times do
-              def y(a=1, b, *rest); nil; end
-            end)
-        nil
-      end
-    end
-  end
-}, bug2415
-
-assert_normal_exit %q{
-  0.times do
-    0.times do
-      def x(a = 0.times do
-              def x@; nil; end
-            end)
-        nil
-      end
-    end
-  end
-}, bug2415
-
-assert_normal_exit %q{
-  a {
-    b {|c.d| }
-    e
-  }
-}, '[ruby-dev:39861]'
-
-bug1240 = '[ruby-core:22637]'
-assert_valid_syntax('x y { "#{}".z { } }', bug1240)
-assert_valid_syntax('x y { "#{}".z do end }', bug1240)
-
-assert_valid_syntax('y "#{a 1}" do end', '[ruby-core:29579]')
-assert_normal_exit %q{
-  def foo(&block)
-    yield
-  end
-
-  foo do
-    s = defined?(raise + 1)
-    Class
-  end
-}, '[ruby-core:30293]'
diff --git a/bootstraptest/test_thread.rb b/bootstraptest/test_thread.rb
deleted file mode 100644
index d64f44be49..0000000000
--- a/bootstraptest/test_thread.rb
+++ /dev/null
@@ -1,476 +0,0 @@
-# Thread and Fiber
-
-assert_equal %q{ok}, %q{
-  Thread.new{
-  }.join
-  :ok
-}
-assert_equal %q{ok}, %q{
-  Thread.new{
-    :ok
-  }.value
-}
-assert_equal %q{ok}, %q{
-begin
-  v = 0
-  (1..200).map{|i|
-    Thread.new{
-      i
-    }
-  }.each{|t|
-    v += t.value
-  }
-  v == 20100 ? :ok : v
-rescue ThreadError => e
-  :ok if /can't create Thread/ =~ e.message
-end
-}
-assert_equal %q{5000}, %q{
-  5000.times{|e|
-    (1..2).map{
-      Thread.new{
-      }
-    }.each{|e|
-      e.join()
-    }
-  }
-}
-assert_equal %q{5000}, %q{
-  5000.times{|e|
-    (1..2).map{
-      Thread.new{
-      }
-    }.each{|e|
-      e.join(1000000000)
-    }
-  }
-}
-assert_equal %q{ok}, %q{
-begin
-  :ok if 5000 == 5000.times{
-    t = Thread.new{}
-    while t.alive?
-      Thread.pass
-    end
-  }
-rescue NoMemoryError
-  :ok
-end
-}
-assert_equal %q{100}, %q{
-  100.times{
-    Thread.new{loop{Thread.pass}}
-  }
-}
-assert_equal %q{ok}, %q{
-  Thread.new{
-    :ok
-  }.join.value
-}
-assert_equal %q{ok}, %q{
-  begin
-    Thread.new{
-      raise "ok"
-    }.join
-  rescue => e
-    e
-  end
-}
-assert_equal %q{ok}, %q{
-  ans = nil
-  t = Thread.new{
-    begin
-      sleep 0.5
-    ensure
-      ans = :ok
-    end
-  }
-  Thread.pass until t.stop?
-  t.kill
-  t.join
-  ans
-}
-assert_equal %q{ok}, %q{
-  t = Thread.new{
-    sleep
-  }
-  sleep 0.1
-  t.raise
-  begin
-    t.join
-    :ng
-  rescue
-    :ok
-  end
-}
-assert_equal %q{ok}, %q{
-  t = Thread.new{
-    loop{}
-  }
-  Thread.pass
-  t.raise
-  begin
-    t.join
-    :ng
-  rescue
-    :ok
-  end
-}
-assert_equal %q{ok}, %q{
-  t = Thread.new{
-  }
-  Thread.pass
-  t.join
-  t.raise # raise to exited thread
-  begin
-    t.join
-    :ok
-  rescue
-    :ng
-  end
-}
-assert_equal %q{run}, %q{
-  t = Thread.new{
-    loop{}
-  }
-  st = t.status
-  t.kill
-  st
-}
-assert_equal %q{sleep}, %q{
-  t = Thread.new{
-    sleep
-  }
-  sleep 0.1
-  st = t.status
-  t.kill
-  st
-}
-assert_equal %q{false}, %q{
-  t = Thread.new{
-  }
-  t.kill
-  sleep 0.1
-  t.status
-}
-assert_equal %q{[ThreadGroup, true]}, %q{
-  ptg = Thread.current.group
-  Thread.new{
-    ctg = Thread.current.group
-    [ctg.class, ctg == ptg]
-  }.value
-}
-assert_equal %q{[1, 1]}, %q{
-  thg = ThreadGroup.new
-
-  t = Thread.new{
-    thg.add Thread.current
-    sleep
-  }
-  sleep 0.1
-  [thg.list.size, ThreadGroup::Default.list.size]
-}
-assert_equal %q{true}, %q{
-  thg = ThreadGroup.new
-
-  t = Thread.new{sleep 5}
-  thg.add t
-  thg.list.include?(t)
-}
-assert_equal %q{[true, nil, true]}, %q{
-  /a/ =~ 'a'
-  $a = $~
-  Thread.new{
-    $b = $~
-    /b/ =~ 'b'
-    $c = $~
-  }.join
-  $d = $~
-  [$a == $d, $b, $c != $d]
-}
-assert_equal %q{11}, %q{
-  Thread.current[:a] = 1
-  Thread.new{
-    Thread.current[:a] = 10
-    Thread.pass
-    Thread.current[:a]
-  }.value + Thread.current[:a]
-}
-assert_normal_exit %q{
-  begin
-    100.times do |i|
-      begin
-        th = Thread.start(Thread.current) {|u| u.raise }
-        raise
-      rescue
-      ensure
-        th.join
-      end
-    end
-  rescue
-  end
-}, '[ruby-dev:31371]'
-
-assert_equal 'true', %{
-  t = Thread.new { loop {} }
-  begin
-    pid = fork {
-      exit t.status != "run"
-    }
-    Process.wait pid
-    $?.success?
-  rescue NotImplementedError
-    true
-  end
-}
-
-assert_equal 'ok', %{
-  open("zzz.rb", "w") do |f|
-    f.puts <<-END
-      begin
-        Thread.new { fork { GC.start } }.join
-        pid, status = Process.wait2
-        $result = status.success? ? :ok : :ng
-      rescue NotImplementedError
-        $result = :ok
-      end
-    END
-  end
-  require "./zzz.rb"
-  $result
-}
-
-assert_finish 3, %{
-  th = Thread.new {sleep 0.2}
-  th.join(0.1)
-  th.join
-}
-
-assert_finish 3, %{
-  require 'timeout'
-  th = Thread.new {sleep 0.2}
-  begin
-    Timeout.timeout(0.1) {th.join}
-  rescue Timeout::Error
-  end
-  th.join
-}
-
-assert_normal_exit %q{
-  STDERR.reopen(STDOUT)
-  exec "/"
-}
-
-assert_normal_exit %q{
-  (0..10).map {
-    Thread.new {
-     10000.times {
-        Object.new.to_s
-      }
-    }
-  }.each {|t|
-    t.join
-  }
-}
-
-assert_equal 'ok', %q{
-  def m
-    t = Thread.new { while true; // =~ "" end }
-    sleep 0.01
-    10.times {
-      if /((ab)*(ab)*)*(b)/ =~ "ab"*7
-        return :ng if !$4
-        return :ng if $~.size != 5
-      end
-    }
-    :ok
-  ensure
-    Thread.kill t
-  end
-  m
-}, '[ruby-dev:34492]'
-
-assert_normal_exit %q{
-  at_exit { Fiber.new{}.resume }
-}
-
-assert_normal_exit %q{
-  g = enum_for(:local_variables)
-  loop { g.next }
-}, '[ruby-dev:34128]'
-
-assert_normal_exit %q{
-  g = enum_for(:block_given?)
-  loop { g.next }
-}, '[ruby-dev:34128]'
-
-assert_normal_exit %q{
-  g = enum_for(:binding)
-  loop { g.next }
-}, '[ruby-dev:34128]'
-
-assert_normal_exit %q{
-  g = "abc".enum_for(:scan, /./)
-  loop { g.next }
-}, '[ruby-dev:34128]'
-
-assert_normal_exit %q{
-  g = Module.enum_for(:new)
-  loop { g.next }
-}, '[ruby-dev:34128]'
-
-assert_normal_exit %q{
-  Fiber.new(&Object.method(:class_eval)).resume("foo")
-}, '[ruby-dev:34128]'
-
-assert_normal_exit %q{
-  Thread.new("foo", &Object.method(:class_eval)).join
-}, '[ruby-dev:34128]'
-
-assert_equal 'ok', %q{
-  begin
-    Thread.new { Thread.stop }
-    Thread.stop
-    :ng
-  rescue Exception
-    :ok
-  end
-}
-
-assert_equal 'ok', %q{
-  begin
-    m1, m2 = Mutex.new, Mutex.new
-    f1 = f2 = false
-    Thread.new { m1.lock; f2 = true; sleep 0.001 until f1; m2.lock }
-    m2.lock; f1 = true; sleep 0.001 until f2; m1.lock
-    :ng
-  rescue Exception
-    :ok
-  end
-}
-
-assert_equal 'ok', %q{
-  m = Mutex.new
-  Thread.new { m.lock }; sleep 0.1; m.lock
-  :ok
-}
-
-assert_equal 'ok', %q{
-  m = Mutex.new
-  Thread.new { m.lock }; m.lock
-  :ok
-}
-
-assert_equal 'ok', %q{
-  m = Mutex.new
-  Thread.new { m.lock }.join; m.lock
-  :ok
-}
-
-assert_equal 'ok', %q{
-  m = Mutex.new
-  Thread.new { m.lock; sleep 0.2 }
-  sleep 0.1; m.lock
-  :ok
-}
-
-assert_equal 'ok', %q{
-  m = Mutex.new
-  Thread.new { m.lock; sleep 0.2; m.unlock }
-  sleep 0.1; m.lock
-  :ok
-}
-
-assert_equal 'ok', %q{
-  t = Thread.new {`echo`}
-  t.join
-  $? ? :ng : :ok
-}, '[ruby-dev:35414]'
-
-assert_equal 'ok', %q{
-  begin
-    100.times{
-      (1..100).map{ Thread.new(true) {|x| x == false } }.each{|th| th.join}
-    }
-  rescue NoMemoryError, StandardError
-  end
-  :ok
-}
-
-assert_equal 'ok', %{
-  open("zzz.rb", "w") do |f|
-    f.puts <<-'end;' # do
-      begin
-        m = Mutex.new
-        parent = Thread.current
-        th1 = Thread.new { m.lock; sleep }
-        sleep 0.01 until th1.stop?
-        Thread.new do
-          sleep 0.01 until parent.stop?
-          begin
-            fork { GC.start }
-          rescue Exception
-            parent.raise $!
-          end
-          th1.run
-        end
-        m.lock
-        pid, status = Process.wait2
-        $result = status.success? ? :ok : :ng
-      rescue NotImplementedError
-        $result = :ok
-      end
-    end;
-  end
-  require "./zzz.rb"
-  $result
-}
-
-assert_finish 3, %q{
-  require 'thread'
-
-  lock = Mutex.new
-  cond = ConditionVariable.new
-  t = Thread.new do
-    lock.synchronize do
-      cond.wait(lock)
-    end
-  end
-
-  begin
-    pid = fork do
-      # Child
-      STDOUT.write "This is the child process.\n"
-      STDOUT.write "Child process exiting.\n"
-    end
-    Process.waitpid(pid)
-  rescue NotImplementedError
-  end
-}, '[ruby-core:23572]'
-
-assert_equal 'ok', %q{
-  begin
-    Process.waitpid2(fork {})[1].success? ? 'ok' : 'ng'
-  rescue NotImplementedError
-    'ok'
-  end
-}
-
-assert_equal 'foo', %q{
-  i = 0
-  Thread.start {sleep 1; exit!}
-  f = proc {|s, c| /#{c.call; s}/o }
-  th2 = Thread.new {
-    sleep 0.01 until i == 1
-    i = 2
-    f.call("bar", proc {sleep 2});
-    nil
-  }
-  th1 = Thread.new {
-    f.call("foo", proc {i = 1; sleep 0.01 until i == 2; sleep 0.01})
-    nil
-  }
-  [th1, th2].each {|t| t.join }
-  GC.start
-  f.call.source
-}
diff --git a/ccan/build_assert/build_assert.h b/ccan/build_assert/build_assert.h
deleted file mode 100644
index a04d1d4709..0000000000
--- a/ccan/build_assert/build_assert.h
+++ /dev/null
@@ -1,40 +0,0 @@
-/* CC0 (Public domain) - see ccan/licenses/CC0 file for details */
-#ifndef CCAN_BUILD_ASSERT_H
-#define CCAN_BUILD_ASSERT_H
-
-/**
- * BUILD_ASSERT - assert a build-time dependency.
- * @cond: the compile-time condition which must be true.
- *
- * Your compile will fail if the condition isn't true, or can't be evaluated
- * by the compiler.  This can only be used within a function.
- *
- * Example:
- *	#include <stddef.h>
- *	...
- *	static char *foo_to_char(struct foo *foo)
- *	{
- *		// This code needs string to be at start of foo.
- *		BUILD_ASSERT(offsetof(struct foo, string) == 0);
- *		return (char *)foo;
- *	}
- */
-#define BUILD_ASSERT(cond) \
-	do { (void) sizeof(char [1 - 2*!(cond)]); } while(0)
-
-/**
- * BUILD_ASSERT_OR_ZERO - assert a build-time dependency, as an expression.
- * @cond: the compile-time condition which must be true.
- *
- * Your compile will fail if the condition isn't true, or can't be evaluated
- * by the compiler.  This can be used in an expression: its value is "0".
- *
- * Example:
- *	#define foo_to_char(foo)					\
- *		 ((char *)(foo)						\
- *		  + BUILD_ASSERT_OR_ZERO(offsetof(struct foo, string) == 0))
- */
-#define BUILD_ASSERT_OR_ZERO(cond) \
-	(sizeof(char [1 - 2*!(cond)]) - 1)
-
-#endif /* CCAN_BUILD_ASSERT_H */
diff --git a/ccan/check_type/check_type.h b/ccan/check_type/check_type.h
deleted file mode 100644
index 1f77a535e4..0000000000
--- a/ccan/check_type/check_type.h
+++ /dev/null
@@ -1,63 +0,0 @@
-/* CC0 (Public domain) - see ccan/licenses/CC0 file for details */
-#ifndef CCAN_CHECK_TYPE_H
-#define CCAN_CHECK_TYPE_H
-
-/**
- * check_type - issue a warning or build failure if type is not correct.
- * @expr: the expression whose type we should check (not evaluated).
- * @type: the exact type we expect the expression to be.
- *
- * This macro is usually used within other macros to try to ensure that a macro
- * argument is of the expected type.  No type promotion of the expression is
- * done: an unsigned int is not the same as an int!
- *
- * check_type() always evaluates to 0.
- *
- * If your compiler does not support typeof, then the best we can do is fail
- * to compile if the sizes of the types are unequal (a less complete check).
- *
- * Example:
- *	// They should always pass a 64-bit value to _set_some_value!
- *	#define set_some_value(expr)			\
- *		_set_some_value((check_type((expr), uint64_t), (expr)))
- */
-
-/**
- * check_types_match - issue a warning or build failure if types are not same.
- * @expr1: the first expression (not evaluated).
- * @expr2: the second expression (not evaluated).
- *
- * This macro is usually used within other macros to try to ensure that
- * arguments are of identical types.  No type promotion of the expressions is
- * done: an unsigned int is not the same as an int!
- *
- * check_types_match() always evaluates to 0.
- *
- * If your compiler does not support typeof, then the best we can do is fail
- * to compile if the sizes of the types are unequal (a less complete check).
- *
- * Example:
- *	// Do subtraction to get to enclosing type, but make sure that
- *	// pointer is of correct type for that member.
- *	#define container_of(mbr_ptr, encl_type, mbr)			\
- *		(check_types_match((mbr_ptr), &((encl_type *)0)->mbr),	\
- *		 ((encl_type *)						\
- *		  ((char *)(mbr_ptr) - offsetof(enclosing_type, mbr))))
- */
-#if HAVE_TYPEOF
-#define check_type(expr, type)			\
-	((typeof(expr) *)0 != (type *)0)
-
-#define check_types_match(expr1, expr2)		\
-	((typeof(expr1) *)0 != (typeof(expr2) *)0)
-#else
-#include "ccan/build_assert/build_assert.h"
-/* Without typeof, we can only test the sizes. */
-#define check_type(expr, type)					\
-	BUILD_ASSERT_OR_ZERO(sizeof(expr) == sizeof(type))
-
-#define check_types_match(expr1, expr2)				\
-	BUILD_ASSERT_OR_ZERO(sizeof(expr1) == sizeof(expr2))
-#endif /* HAVE_TYPEOF */
-
-#endif /* CCAN_CHECK_TYPE_H */
diff --git a/ccan/container_of/container_of.h b/ccan/container_of/container_of.h
deleted file mode 100644
index ae3e1fc81f..0000000000
--- a/ccan/container_of/container_of.h
+++ /dev/null
@@ -1,142 +0,0 @@
-/* CC0 (Public domain) - see ccan/licenses/CC0 file for details */
-#ifndef CCAN_CONTAINER_OF_H
-#define CCAN_CONTAINER_OF_H
-#include "ccan/check_type/check_type.h"
-
-/**
- * container_of - get pointer to enclosing structure
- * @member_ptr: pointer to the structure member
- * @containing_type: the type this member is within
- * @member: the name of this member within the structure.
- *
- * Given a pointer to a member of a structure, this macro does pointer
- * subtraction to return the pointer to the enclosing type.
- *
- * Example:
- *	struct foo {
- *		int fielda, fieldb;
- *		// ...
- *	};
- *	struct info {
- *		int some_other_field;
- *		struct foo my_foo;
- *	};
- *
- *	static struct info *foo_to_info(struct foo *foo)
- *	{
- *		return container_of(foo, struct info, my_foo);
- *	}
- */
-#define container_of(member_ptr, containing_type, member)		\
-	 ((containing_type *)						\
-	  ((char *)(member_ptr)						\
-	   - container_off(containing_type, member))			\
-	  + check_types_match(*(member_ptr), ((containing_type *)0)->member))
-
-
-/**
- * container_of_or_null - get pointer to enclosing structure, or NULL
- * @member_ptr: pointer to the structure member
- * @containing_type: the type this member is within
- * @member: the name of this member within the structure.
- *
- * Given a pointer to a member of a structure, this macro does pointer
- * subtraction to return the pointer to the enclosing type, unless it
- * is given NULL, in which case it also returns NULL.
- *
- * Example:
- *	struct foo {
- *		int fielda, fieldb;
- *		// ...
- *	};
- *	struct info {
- *		int some_other_field;
- *		struct foo my_foo;
- *	};
- *
- *	static struct info *foo_to_info_allowing_null(struct foo *foo)
- *	{
- *		return container_of_or_null(foo, struct info, my_foo);
- *	}
- */
-static inline char *container_of_or_null_(void *member_ptr, size_t offset)
-{
-	return member_ptr ? (char *)member_ptr - offset : NULL;
-}
-#define container_of_or_null(member_ptr, containing_type, member)	\
-	((containing_type *)						\
-	 container_of_or_null_(member_ptr,				\
-			       container_off(containing_type, member))	\
-	 + check_types_match(*(member_ptr), ((containing_type *)0)->member))
-
-/**
- * container_off - get offset to enclosing structure
- * @containing_type: the type this member is within
- * @member: the name of this member within the structure.
- *
- * Given a pointer to a member of a structure, this macro does
- * typechecking and figures out the offset to the enclosing type.
- *
- * Example:
- *	struct foo {
- *		int fielda, fieldb;
- *		// ...
- *	};
- *	struct info {
- *		int some_other_field;
- *		struct foo my_foo;
- *	};
- *
- *	static struct info *foo_to_info(struct foo *foo)
- *	{
- *		size_t off = container_off(struct info, my_foo);
- *		return (void *)((char *)foo - off);
- *	}
- */
-#define container_off(containing_type, member)	\
-	offsetof(containing_type, member)
-
-/**
- * container_of_var - get pointer to enclosing structure using a variable
- * @member_ptr: pointer to the structure member
- * @container_var: a pointer of same type as this member's container
- * @member: the name of this member within the structure.
- *
- * Given a pointer to a member of a structure, this macro does pointer
- * subtraction to return the pointer to the enclosing type.
- *
- * Example:
- *	static struct info *foo_to_i(struct foo *foo)
- *	{
- *		struct info *i = container_of_var(foo, i, my_foo);
- *		return i;
- *	}
- */
-#if HAVE_TYPEOF
-#define container_of_var(member_ptr, container_var, member) \
-	container_of(member_ptr, typeof(*container_var), member)
-#else
-#define container_of_var(member_ptr, container_var, member)	\
-	((void *)((char *)(member_ptr)	-			\
-		  container_off_var(container_var, member)))
-#endif
-
-/**
- * container_off_var - get offset of a field in enclosing structure
- * @container_var: a pointer to a container structure
- * @member: the name of a member within the structure.
- *
- * Given (any) pointer to a structure and a its member name, this
- * macro does pointer subtraction to return offset of member in a
- * structure memory layout.
- *
- */
-#if HAVE_TYPEOF
-#define container_off_var(var, member)		\
-	container_off(typeof(*var), member)
-#else
-#define container_off_var(var, member)			\
-	((const char *)&(var)->member - (const char *)(var))
-#endif
-
-#endif /* CCAN_CONTAINER_OF_H */
diff --git a/ccan/licenses/BSD-MIT b/ccan/licenses/BSD-MIT
deleted file mode 100644
index 89de354795..0000000000
--- a/ccan/licenses/BSD-MIT
+++ /dev/null
@@ -1,17 +0,0 @@
-Permission is hereby granted, free of charge, to any person obtaining a copy
-of this software and associated documentation files (the "Software"), to deal
-in the Software without restriction, including without limitation the rights
-to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
-copies of the Software, and to permit persons to whom the Software is
-furnished to do so, subject to the following conditions:
-
-The above copyright notice and this permission notice shall be included in
-all copies or substantial portions of the Software.
-
-THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
-IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
-FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
-AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
-LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
-OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN
-THE SOFTWARE.
diff --git a/ccan/licenses/CC0 b/ccan/licenses/CC0
deleted file mode 100644
index feb9b118e6..0000000000
--- a/ccan/licenses/CC0
+++ /dev/null
@@ -1,28 +0,0 @@
-Statement of Purpose
-
-The laws of most jurisdictions throughout the world automatically confer exclusive Copyright and Related Rights (defined below) upon the creator and subsequent owner(s) (each and all, an "owner") of an original work of authorship and/or a database (each, a "Work").
-
-Certain owners wish to permanently relinquish those rights to a Work for the purpose of contributing to a commons of creative, cultural and scientific works ("Commons") that the public can reliably and without fear of later claims of infringement build upon, modify, incorporate in other works, reuse and redistribute as freely as possible in any form whatsoever and for any purposes, including without limitation commercial purposes. These owners may contribute to the Commons to promote the ideal of a free culture and the further production of creative, cultural and scientific works, or to gain reputation or greater distribution for their Work in part through the use and efforts of others.
-
-For these and/or other purposes and motivations, and without any expectation of additional consideration or compensation, the person associating CC0 with a Work (the "Affirmer"), to the extent that he or she is an owner of Copyright and Related Rights in the Work, voluntarily elects to apply CC0 to the Work and publicly distribute the Work under its terms, with knowledge of his or her Copyright and Related Rights in the Work and the meaning and intended legal effect of CC0 on those rights.
-
-1. Copyright and Related Rights. A Work made available under CC0 may be protected by copyright and related or neighboring rights ("Copyright and Related Rights"). Copyright and Related Rights include, but are not limited to, the following:
-
-    the right to reproduce, adapt, distribute, perform, display, communicate, and translate a Work;
-    moral rights retained by the original author(s) and/or performer(s);
-    publicity and privacy rights pertaining to a person's image or likeness depicted in a Work;
-    rights protecting against unfair competition in regards to a Work, subject to the limitations in paragraph 4(a), below;
-    rights protecting the extraction, dissemination, use and reuse of data in a Work;
-    database rights (such as those arising under Directive 96/9/EC of the European Parliament and of the Council of 11 March 1996 on the legal protection of databases, and under any national implementation thereof, including any amended or successor version of such directive); and
-    other similar, equivalent or corresponding rights throughout the world based on applicable law or treaty, and any national implementations thereof.
-
-2. Waiver. To the greatest extent permitted by, but not in contravention of, applicable law, Affirmer hereby overtly, fully, permanently, irrevocably and unconditionally waives, abandons, and surrenders all of Affirmer's Copyright and Related Rights and associated claims and causes of action, whether now known or unknown (including existing as well as future claims and causes of action), in the Work (i) in all territories worldwide, (ii) for the maximum duration provided by applicable law or treaty (including future time extensions), (iii) in any current or future medium and for any number of copies, and (iv) for any purpose whatsoever, including without limitation commercial, advertising or promotional purposes (the "Waiver"). Affirmer makes the Waiver for the benefit of each member of the public at large and to the detriment of Affirmer's heirs and successors, fully intending that such Waiver shall not be subject to revocation, rescission, cancellation, termination, or any other legal or equitable action to disrupt the quiet enjoyment of the Work by the public as contemplated by Affirmer's express Statement of Purpose.
-
-3. Public License Fallback. Should any part of the Waiver for any reason be judged legally invalid or ineffective under applicable law, then the Waiver shall be preserved to the maximum extent permitted taking into account Affirmer's express Statement of Purpose. In addition, to the extent the Waiver is so judged Affirmer hereby grants to each affected person a royalty-free, non transferable, non sublicensable, non exclusive, irrevocable and unconditional license to exercise Affirmer's Copyright and Related Rights in the Work (i) in all territories worldwide, (ii) for the maximum duration provided by applicable law or treaty (including future time extensions), (iii) in any current or future medium and for any number of copies, and (iv) for any purpose whatsoever, including without limitation commercial, advertising or promotional purposes (the "License"). The License shall be deemed effective as of the date CC0 was applied by Affirmer to the Work. Should any part of the License for any reason be judged legally invalid or ineffective under applicable law, such partial invalidity or ineffectiveness shall not invalidate the remainder of the License, and in such case Affirmer hereby affirms that he or she will not (i) exercise any of his or her remaining Copyright and Related Rights in the Work or (ii) assert any associated claims and causes of action with respect to the Work, in either case contrary to Affirmer's express Statement of Purpose.
-
-4. Limitations and Disclaimers.
-
-    No trademark or patent rights held by Affirmer are waived, abandoned, surrendered, licensed or otherwise affected by this document.
-    Affirmer offers the Work as-is and makes no representations or warranties of any kind concerning the Work, express, implied, statutory or otherwise, including without limitation warranties of title, merchantability, fitness for a particular purpose, non infringement, or the absence of latent or other defects, accuracy, or the present or absence of errors, whether or not discoverable, all to the greatest extent permissible under applicable law.
-    Affirmer disclaims responsibility for clearing rights of other persons that may apply to the Work or any use thereof, including without limitation any person's Copyright and Related Rights in the Work. Further, Affirmer disclaims responsibility for obtaining any necessary consents, permissions or other rights required for any use of the Work.
-    Affirmer understands and acknowledges that Creative Commons is not a party to this document and has no duty or obligation with respect to this CC0 or use of the Work.
diff --git a/ccan/list/list.h b/ccan/list/list.h
deleted file mode 100644
index ca9f9f1f7f..0000000000
--- a/ccan/list/list.h
+++ /dev/null
@@ -1,773 +0,0 @@
-/* Licensed under BSD-MIT - see ccan/licenses/BSD-MIT file for details */
-#ifndef CCAN_LIST_H
-#define CCAN_LIST_H
-#include <assert.h>
-#include "ccan/str/str.h"
-#include "ccan/container_of/container_of.h"
-#include "ccan/check_type/check_type.h"
-
-/**
- * struct list_node - an entry in a doubly-linked list
- * @next: next entry (self if empty)
- * @prev: previous entry (self if empty)
- *
- * This is used as an entry in a linked list.
- * Example:
- *	struct child {
- *		const char *name;
- *		// Linked list of all us children.
- *		struct list_node list;
- *	};
- */
-struct list_node
-{
-	struct list_node *next, *prev;
-};
-
-/**
- * struct list_head - the head of a doubly-linked list
- * @h: the list_head (containing next and prev pointers)
- *
- * This is used as the head of a linked list.
- * Example:
- *	struct parent {
- *		const char *name;
- *		struct list_head children;
- *		unsigned int num_children;
- *	};
- */
-struct list_head
-{
-	struct list_node n;
-};
-
-#define LIST_LOC __FILE__  ":" stringify(__LINE__)
-#define list_debug(h, loc) ((void)loc, h)
-#define list_debug_node(n, loc) ((void)loc, n)
-
-/**
- * LIST_HEAD_INIT - initializer for an empty list_head
- * @name: the name of the list.
- *
- * Explicit initializer for an empty list.
- *
- * See also:
- *	LIST_HEAD, list_head_init()
- *
- * Example:
- *	static struct list_head my_list = LIST_HEAD_INIT(my_list);
- */
-#define LIST_HEAD_INIT(name) { { &name.n, &name.n } }
-
-/**
- * LIST_HEAD - define and initialize an empty list_head
- * @name: the name of the list.
- *
- * The LIST_HEAD macro defines a list_head and initializes it to an empty
- * list.  It can be prepended by "static" to define a static list_head.
- *
- * See also:
- *	LIST_HEAD_INIT, list_head_init()
- *
- * Example:
- *	static LIST_HEAD(my_global_list);
- */
-#define LIST_HEAD(name) \
-	struct list_head name = LIST_HEAD_INIT(name)
-
-/**
- * list_head_init - initialize a list_head
- * @h: the list_head to set to the empty list
- *
- * Example:
- *	...
- *	struct parent *parent = malloc(sizeof(*parent));
- *
- *	list_head_init(&parent->children);
- *	parent->num_children = 0;
- */
-static inline void list_head_init(struct list_head *h)
-{
-	h->n.next = h->n.prev = &h->n;
-}
-
-/**
- * list_node_init - initialize a list_node
- * @n: the list_node to link to itself.
- *
- * You don't need to use this normally!  But it lets you list_del(@n)
- * safely.
- */
-static inline void list_node_init(struct list_node *n)
-{
-	n->next = n->prev = n;
-}
-
-/**
- * list_add_after - add an entry after an existing node in a linked list
- * @h: the list_head to add the node to (for debugging)
- * @p: the existing list_node to add the node after
- * @n: the new list_node to add to the list.
- *
- * The existing list_node must already be a member of the list.
- * The new list_node does not need to be initialized; it will be overwritten.
- *
- * Example:
- *	struct child c1, c2, c3;
- *	LIST_HEAD(h);
- *
- *	list_add_tail(&h, &c1.list);
- *	list_add_tail(&h, &c3.list);
- *	list_add_after(&h, &c1.list, &c2.list);
- */
-#define list_add_after(h, p, n) list_add_after_(h, p, n, LIST_LOC)
-static inline void list_add_after_(struct list_head *h,
-				   struct list_node *p,
-				   struct list_node *n,
-				   const char *abortstr)
-{
-	n->next = p->next;
-	n->prev = p;
-	p->next->prev = n;
-	p->next = n;
-	(void)list_debug(h, abortstr);
-}
-
-/**
- * list_add - add an entry at the start of a linked list.
- * @h: the list_head to add the node to
- * @n: the list_node to add to the list.
- *
- * The list_node does not need to be initialized; it will be overwritten.
- * Example:
- *	struct child *child = malloc(sizeof(*child));
- *
- *	child->name = "marvin";
- *	list_add(&parent->children, &child->list);
- *	parent->num_children++;
- */
-#define list_add(h, n) list_add_(h, n, LIST_LOC)
-static inline void list_add_(struct list_head *h,
-			     struct list_node *n,
-			     const char *abortstr)
-{
-	list_add_after_(h, &h->n, n, abortstr);
-}
-
-/**
- * list_add_before - add an entry before an existing node in a linked list
- * @h: the list_head to add the node to (for debugging)
- * @p: the existing list_node to add the node before
- * @n: the new list_node to add to the list.
- *
- * The existing list_node must already be a member of the list.
- * The new list_node does not need to be initialized; it will be overwritten.
- *
- * Example:
- *	list_head_init(&h);
- *	list_add_tail(&h, &c1.list);
- *	list_add_tail(&h, &c3.list);
- *	list_add_before(&h, &c3.list, &c2.list);
- */
-#define list_add_before(h, p, n) list_add_before_(h, p, n, LIST_LOC)
-static inline void list_add_before_(struct list_head *h,
-				    struct list_node *p,
-				    struct list_node *n,
-				    const char *abortstr)
-{
-	n->next = p;
-	n->prev = p->prev;
-	p->prev->next = n;
-	p->prev = n;
-	(void)list_debug(h, abortstr);
-}
-
-/**
- * list_add_tail - add an entry at the end of a linked list.
- * @h: the list_head to add the node to
- * @n: the list_node to add to the list.
- *
- * The list_node does not need to be initialized; it will be overwritten.
- * Example:
- *	list_add_tail(&parent->children, &child->list);
- *	parent->num_children++;
- */
-#define list_add_tail(h, n) list_add_tail_(h, n, LIST_LOC)
-static inline void list_add_tail_(struct list_head *h,
-				  struct list_node *n,
-				  const char *abortstr)
-{
-	list_add_before_(h, &h->n, n, abortstr);
-}
-
-/**
- * list_empty - is a list empty?
- * @h: the list_head
- *
- * If the list is empty, returns true.
- *
- * Example:
- *	assert(list_empty(&parent->children) == (parent->num_children == 0));
- */
-#define list_empty(h) list_empty_(h, LIST_LOC)
-static inline int list_empty_(const struct list_head *h, const char* abortstr)
-{
-	(void)list_debug(h, abortstr);
-	return h->n.next == &h->n;
-}
-
-/**
- * list_empty_nodebug - is a list empty (and don't perform debug checks)?
- * @h: the list_head
- *
- * If the list is empty, returns true.
- * This differs from list_empty() in that if CCAN_LIST_DEBUG is set it
- * will NOT perform debug checks. Only use this function if you REALLY
- * know what you're doing.
- *
- * Example:
- *	assert(list_empty_nodebug(&parent->children) == (parent->num_children == 0));
- */
-#ifndef CCAN_LIST_DEBUG
-#define list_empty_nodebug(h) list_empty(h)
-#else
-static inline int list_empty_nodebug(const struct list_head *h)
-{
-	return h->n.next == &h->n;
-}
-#endif
-
-/**
- * list_del - delete an entry from an (unknown) linked list.
- * @n: the list_node to delete from the list.
- *
- * Note that this leaves @n in an undefined state; it can be added to
- * another list, but not deleted again.
- *
- * See also:
- *	list_del_from(), list_del_init()
- *
- * Example:
- *	list_del(&child->list);
- *	parent->num_children--;
- */
-#define list_del(n) list_del_(n, LIST_LOC)
-static inline void list_del_(struct list_node *n, const char* abortstr)
-{
-	(void)list_debug_node(n, abortstr);
-	n->next->prev = n->prev;
-	n->prev->next = n->next;
-#ifdef CCAN_LIST_DEBUG
-	/* Catch use-after-del. */
-	n->next = n->prev = NULL;
-#endif
-}
-
-/**
- * list_del_init - delete a node, and reset it so it can be deleted again.
- * @n: the list_node to be deleted.
- *
- * list_del(@n) or list_del_init() again after this will be safe,
- * which can be useful in some cases.
- *
- * See also:
- *	list_del_from(), list_del()
- *
- * Example:
- *	list_del_init(&child->list);
- *	parent->num_children--;
- */
-#define list_del_init(n) list_del_init_(n, LIST_LOC)
-static inline void list_del_init_(struct list_node *n, const char *abortstr)
-{
-	list_del_(n, abortstr);
-	list_node_init(n);
-}
-
-/**
- * list_del_from - delete an entry from a known linked list.
- * @h: the list_head the node is in.
- * @n: the list_node to delete from the list.
- *
- * This explicitly indicates which list a node is expected to be in,
- * which is better documentation and can catch more bugs.
- *
- * See also: list_del()
- *
- * Example:
- *	list_del_from(&parent->children, &child->list);
- *	parent->num_children--;
- */
-static inline void list_del_from(struct list_head *h, struct list_node *n)
-{
-#ifdef CCAN_LIST_DEBUG
-	{
-		/* Thorough check: make sure it was in list! */
-		struct list_node *i;
-		for (i = h->n.next; i != n; i = i->next)
-			assert(i != &h->n);
-	}
-#endif /* CCAN_LIST_DEBUG */
-
-	/* Quick test that catches a surprising number of bugs. */
-	assert(!list_empty(h));
-	list_del(n);
-}
-
-/**
- * list_swap - swap out an entry from an (unknown) linked list for a new one.
- * @o: the list_node to replace from the list.
- * @n: the list_node to insert in place of the old one.
- *
- * Note that this leaves @o in an undefined state; it can be added to
- * another list, but not deleted/swapped again.
- *
- * See also:
- *	list_del()
- *
- * Example:
- *	struct child x1, x2;
- *	LIST_HEAD(xh);
- *
- *	list_add(&xh, &x1.list);
- *	list_swap(&x1.list, &x2.list);
- */
-#define list_swap(o, n) list_swap_(o, n, LIST_LOC)
-static inline void list_swap_(struct list_node *o,
-			      struct list_node *n,
-			      const char* abortstr)
-{
-	(void)list_debug_node(o, abortstr);
-	*n = *o;
-	n->next->prev = n;
-	n->prev->next = n;
-#ifdef CCAN_LIST_DEBUG
-	/* Catch use-after-del. */
-	o->next = o->prev = NULL;
-#endif
-}
-
-/**
- * list_entry - convert a list_node back into the structure containing it.
- * @n: the list_node
- * @type: the type of the entry
- * @member: the list_node member of the type
- *
- * Example:
- *	// First list entry is children.next; convert back to child.
- *	child = list_entry(parent->children.n.next, struct child, list);
- *
- * See Also:
- *	list_top(), list_for_each()
- */
-#define list_entry(n, type, member) container_of(n, type, member)
-
-/**
- * list_top - get the first entry in a list
- * @h: the list_head
- * @type: the type of the entry
- * @member: the list_node member of the type
- *
- * If the list is empty, returns NULL.
- *
- * Example:
- *	struct child *first;
- *	first = list_top(&parent->children, struct child, list);
- *	if (!first)
- *		printf("Empty list!\n");
- */
-#define list_top(h, type, member)					\
-	((type *)list_top_((h), list_off_(type, member)))
-
-static inline const void *list_top_(const struct list_head *h, size_t off)
-{
-	if (list_empty(h))
-		return NULL;
-	return (const char *)h->n.next - off;
-}
-
-/**
- * list_pop - remove the first entry in a list
- * @h: the list_head
- * @type: the type of the entry
- * @member: the list_node member of the type
- *
- * If the list is empty, returns NULL.
- *
- * Example:
- *	struct child *one;
- *	one = list_pop(&parent->children, struct child, list);
- *	if (!one)
- *		printf("Empty list!\n");
- */
-#define list_pop(h, type, member)					\
-	((type *)list_pop_((h), list_off_(type, member)))
-
-static inline const void *list_pop_(const struct list_head *h, size_t off)
-{
-	struct list_node *n;
-
-	if (list_empty(h))
-		return NULL;
-	n = h->n.next;
-	list_del(n);
-	return (const char *)n - off;
-}
-
-/**
- * list_tail - get the last entry in a list
- * @h: the list_head
- * @type: the type of the entry
- * @member: the list_node member of the type
- *
- * If the list is empty, returns NULL.
- *
- * Example:
- *	struct child *last;
- *	last = list_tail(&parent->children, struct child, list);
- *	if (!last)
- *		printf("Empty list!\n");
- */
-#define list_tail(h, type, member) \
-	((type *)list_tail_((h), list_off_(type, member)))
-
-static inline const void *list_tail_(const struct list_head *h, size_t off)
-{
-	if (list_empty(h))
-		return NULL;
-	return (const char *)h->n.prev - off;
-}
-
-/**
- * list_for_each - iterate through a list.
- * @h: the list_head (warning: evaluated multiple times!)
- * @i: the structure containing the list_node
- * @member: the list_node member of the structure
- *
- * This is a convenient wrapper to iterate @i over the entire list.  It's
- * a for loop, so you can break and continue as normal.
- *
- * Example:
- *	list_for_each(&parent->children, child, list)
- *		printf("Name: %s\n", child->name);
- */
-#define list_for_each(h, i, member)					\
-	list_for_each_off(h, i, list_off_var_(i, member))
-
-/**
- * list_for_each_rev - iterate through a list backwards.
- * @h: the list_head
- * @i: the structure containing the list_node
- * @member: the list_node member of the structure
- *
- * This is a convenient wrapper to iterate @i over the entire list.  It's
- * a for loop, so you can break and continue as normal.
- *
- * Example:
- *	list_for_each_rev(&parent->children, child, list)
- *		printf("Name: %s\n", child->name);
- */
-#define list_for_each_rev(h, i, member)					\
-	list_for_each_rev_off(h, i, list_off_var_(i, member))
-
-/**
- * list_for_each_rev_safe - iterate through a list backwards,
- * maybe during deletion
- * @h: the list_head
- * @i: the structure containing the list_node
- * @nxt: the structure containing the list_node
- * @member: the list_node member of the structure
- *
- * This is a convenient wrapper to iterate @i over the entire list backwards.
- * It's a for loop, so you can break and continue as normal.  The extra
- * variable * @nxt is used to hold the next element, so you can delete @i
- * from the list.
- *
- * Example:
- *	struct child *next;
- *	list_for_each_rev_safe(&parent->children, child, next, list) {
- *		printf("Name: %s\n", child->name);
- *	}
- */
-#define list_for_each_rev_safe(h, i, nxt, member)			\
-	list_for_each_rev_safe_off(h, i, nxt, list_off_var_(i, member))
-
-/**
- * list_for_each_safe - iterate through a list, maybe during deletion
- * @h: the list_head
- * @i: the structure containing the list_node
- * @nxt: the structure containing the list_node
- * @member: the list_node member of the structure
- *
- * This is a convenient wrapper to iterate @i over the entire list.  It's
- * a for loop, so you can break and continue as normal.  The extra variable
- * @nxt is used to hold the next element, so you can delete @i from the list.
- *
- * Example:
- *	list_for_each_safe(&parent->children, child, next, list) {
- *		list_del(&child->list);
- *		parent->num_children--;
- *	}
- */
-#define list_for_each_safe(h, i, nxt, member)				\
-	list_for_each_safe_off(h, i, nxt, list_off_var_(i, member))
-
-/**
- * list_next - get the next entry in a list
- * @h: the list_head
- * @i: a pointer to an entry in the list.
- * @member: the list_node member of the structure
- *
- * If @i was the last entry in the list, returns NULL.
- *
- * Example:
- *	struct child *second;
- *	second = list_next(&parent->children, first, list);
- *	if (!second)
- *		printf("No second child!\n");
- */
-#define list_next(h, i, member)						\
-	((list_typeof(i))list_entry_or_null(list_debug(h,		\
-					    __FILE__ ":" stringify(__LINE__)), \
-					    (i)->member.next,		\
-					    list_off_var_((i), member)))
-
-/**
- * list_prev - get the previous entry in a list
- * @h: the list_head
- * @i: a pointer to an entry in the list.
- * @member: the list_node member of the structure
- *
- * If @i was the first entry in the list, returns NULL.
- *
- * Example:
- *	first = list_prev(&parent->children, second, list);
- *	if (!first)
- *		printf("Can't go back to first child?!\n");
- */
-#define list_prev(h, i, member)						\
-	((list_typeof(i))list_entry_or_null(list_debug(h,		\
-					    __FILE__ ":" stringify(__LINE__)), \
-					    (i)->member.prev,		\
-					    list_off_var_((i), member)))
-
-/**
- * list_append_list - empty one list onto the end of another.
- * @to: the list to append into
- * @from: the list to empty.
- *
- * This takes the entire contents of @from and moves it to the end of
- * @to.  After this @from will be empty.
- *
- * Example:
- *	struct list_head adopter;
- *
- *	list_append_list(&adopter, &parent->children);
- *	assert(list_empty(&parent->children));
- *	parent->num_children = 0;
- */
-#define list_append_list(t, f) list_append_list_(t, f,			\
-				   __FILE__ ":" stringify(__LINE__))
-static inline void list_append_list_(struct list_head *to,
-				     struct list_head *from,
-				     const char *abortstr)
-{
-	struct list_node *from_tail = list_debug(from, abortstr)->n.prev;
-	struct list_node *to_tail = list_debug(to, abortstr)->n.prev;
-
-	/* Sew in head and entire list. */
-	to->n.prev = from_tail;
-	from_tail->next = &to->n;
-	to_tail->next = &from->n;
-	from->n.prev = to_tail;
-
-	/* Now remove head. */
-	list_del(&from->n);
-	list_head_init(from);
-}
-
-/**
- * list_prepend_list - empty one list into the start of another.
- * @to: the list to prepend into
- * @from: the list to empty.
- *
- * This takes the entire contents of @from and moves it to the start
- * of @to.  After this @from will be empty.
- *
- * Example:
- *	list_prepend_list(&adopter, &parent->children);
- *	assert(list_empty(&parent->children));
- *	parent->num_children = 0;
- */
-#define list_prepend_list(t, f) list_prepend_list_(t, f, LIST_LOC)
-static inline void list_prepend_list_(struct list_head *to,
-				      struct list_head *from,
-				      const char *abortstr)
-{
-	struct list_node *from_tail = list_debug(from, abortstr)->n.prev;
-	struct list_node *to_head = list_debug(to, abortstr)->n.next;
-
-	/* Sew in head and entire list. */
-	to->n.next = &from->n;
-	from->n.prev = &to->n;
-	to_head->prev = from_tail;
-	from_tail->next = to_head;
-
-	/* Now remove head. */
-	list_del(&from->n);
-	list_head_init(from);
-}
-
-/* internal macros, do not use directly */
-#define list_for_each_off_dir_(h, i, off, dir)				\
-	for (i = list_node_to_off_(list_debug(h, LIST_LOC)->n.dir,	\
-				   (off));				\
-	list_node_from_off_((void *)i, (off)) != &(h)->n;		\
-	i = list_node_to_off_(list_node_from_off_((void *)i, (off))->dir, \
-			      (off)))
-
-#define list_for_each_safe_off_dir_(h, i, nxt, off, dir)		\
-	for (i = list_node_to_off_(list_debug(h, LIST_LOC)->n.dir,	\
-				   (off)),				\
-	nxt = list_node_to_off_(list_node_from_off_(i, (off))->dir,	\
-				(off));					\
-	list_node_from_off_(i, (off)) != &(h)->n;			\
-	i = nxt,							\
-	nxt = list_node_to_off_(list_node_from_off_(i, (off))->dir,	\
-				(off)))
-
-/**
- * list_for_each_off - iterate through a list of memory regions.
- * @h: the list_head
- * @i: the pointer to a memory region wich contains list node data.
- * @off: offset(relative to @i) at which list node data resides.
- *
- * This is a low-level wrapper to iterate @i over the entire list, used to
- * implement all oher, more high-level, for-each constructs. It's a for loop,
- * so you can break and continue as normal.
- *
- * WARNING! Being the low-level macro that it is, this wrapper doesn't know
- * nor care about the type of @i. The only assumtion made is that @i points
- * to a chunk of memory that at some @offset, relative to @i, contains a
- * properly filled `struct node_list' which in turn contains pointers to
- * memory chunks and it's turtles all the way down. Whith all that in mind
- * remember that given the wrong pointer/offset couple this macro will
- * happilly churn all you memory untill SEGFAULT stops it, in other words
- * caveat emptor.
- *
- * It is worth mentioning that one of legitimate use-cases for that wrapper
- * is operation on opaque types with known offset for `struct list_node'
- * member(preferably 0), because it allows you not to disclose the type of
- * @i.
- *
- * Example:
- *	list_for_each_off(&parent->children, child,
- *				offsetof(struct child, list))
- *		printf("Name: %s\n", child->name);
- */
-#define list_for_each_off(h, i, off)                                    \
-	list_for_each_off_dir_((h),(i),(off),next)
-
-/**
- * list_for_each_rev_off - iterate through a list of memory regions backwards
- * @h: the list_head
- * @i: the pointer to a memory region wich contains list node data.
- * @off: offset(relative to @i) at which list node data resides.
- *
- * See list_for_each_off for details
- */
-#define list_for_each_rev_off(h, i, off)                                    \
-	list_for_each_off_dir_((h),(i),(off),prev)
-
-/**
- * list_for_each_safe_off - iterate through a list of memory regions, maybe
- * during deletion
- * @h: the list_head
- * @i: the pointer to a memory region wich contains list node data.
- * @nxt: the structure containing the list_node
- * @off: offset(relative to @i) at which list node data resides.
- *
- * For details see `list_for_each_off' and `list_for_each_safe'
- * descriptions.
- *
- * Example:
- *	list_for_each_safe_off(&parent->children, child,
- *		next, offsetof(struct child, list))
- *		printf("Name: %s\n", child->name);
- */
-#define list_for_each_safe_off(h, i, nxt, off)                          \
-	list_for_each_safe_off_dir_((h),(i),(nxt),(off),next)
-
-/**
- * list_for_each_rev_safe_off - iterate backwards through a list of
- * memory regions, maybe during deletion
- * @h: the list_head
- * @i: the pointer to a memory region wich contains list node data.
- * @nxt: the structure containing the list_node
- * @off: offset(relative to @i) at which list node data resides.
- *
- * For details see `list_for_each_rev_off' and `list_for_each_rev_safe'
- * descriptions.
- *
- * Example:
- *	list_for_each_rev_safe_off(&parent->children, child,
- *		next, offsetof(struct child, list))
- *		printf("Name: %s\n", child->name);
- */
-#define list_for_each_rev_safe_off(h, i, nxt, off)                      \
-	list_for_each_safe_off_dir_((h),(i),(nxt),(off),prev)
-
-/* Other -off variants. */
-#define list_entry_off(n, type, off)		\
-	((type *)list_node_from_off_((n), (off)))
-
-#define list_head_off(h, type, off)		\
-	((type *)list_head_off((h), (off)))
-
-#define list_tail_off(h, type, off)		\
-	((type *)list_tail_((h), (off)))
-
-#define list_add_off(h, n, off)                 \
-	list_add((h), list_node_from_off_((n), (off)))
-
-#define list_del_off(n, off)                    \
-	list_del(list_node_from_off_((n), (off)))
-
-#define list_del_from_off(h, n, off)			\
-	list_del_from(h, list_node_from_off_((n), (off)))
-
-/* Offset helper functions so we only single-evaluate. */
-static inline void *list_node_to_off_(struct list_node *node, size_t off)
-{
-	return (void *)((char *)node - off);
-}
-static inline struct list_node *list_node_from_off_(void *ptr, size_t off)
-{
-	return (struct list_node *)((char *)ptr + off);
-}
-
-/* Get the offset of the member, but make sure it's a list_node. */
-#define list_off_(type, member)					\
-	(container_off(type, member) +				\
-	 check_type(((type *)0)->member, struct list_node))
-
-#define list_off_var_(var, member)			\
-	(container_off_var(var, member) +		\
-	 check_type(var->member, struct list_node))
-
-#if HAVE_TYPEOF
-#define list_typeof(var) typeof(var)
-#else
-#define list_typeof(var) void *
-#endif
-
-/* Returns member, or NULL if at end of list. */
-static inline void *list_entry_or_null(const struct list_head *h,
-				       const struct list_node *n,
-				       size_t off)
-{
-	if (n == &h->n)
-		return NULL;
-	return (char *)n - off;
-}
-#endif /* CCAN_LIST_H */
diff --git a/ccan/str/str.h b/ccan/str/str.h
deleted file mode 100644
index 9a9da9cd3f..0000000000
--- a/ccan/str/str.h
+++ /dev/null
@@ -1,16 +0,0 @@
-/* CC0 (Public domain) - see ccan/licenses/CC0 file for details */
-#ifndef CCAN_STR_H
-#define CCAN_STR_H
-/**
- * stringify - Turn expression into a string literal
- * @expr: any C expression
- *
- * Example:
- *	#define PRINT_COND_IF_FALSE(cond) \
- *		((cond) || printf("%s is false!", stringify(cond)))
- */
-#define stringify(expr)		stringify_1(expr)
-/* Double-indirection required to stringify expansions */
-#define stringify_1(expr)	#expr
-
-#endif /* CCAN_STR_H */
diff --git a/class.c b/class.c
index f95890bbc4..22894927d8 100644
--- a/class.c
+++ b/class.c
@@ -1,2008 +1,653 @@
-/**********************************************************************
+/************************************************
 
   class.c -
 
   $Author$
+  $Date$
   created at: Tue Aug 10 15:05:44 JST 1993
 
-  Copyright (C) 1993-2007 Yukihiro Matsumoto
-
-**********************************************************************/
-
-/*!
- * \defgroup class Classes and their hierarchy.
- * \par Terminology
- * - class: same as in Ruby.
- * - singleton class: class for a particular object
- * - eigenclass: = singleton class
- * - metaclass: class of a class. metaclass is a kind of singleton class.
- * - metametaclass: class of a metaclass.
- * - meta^(n)-class: class of a meta^(n-1)-class.
- * - attached object: A singleton class knows its unique instance.
- *   The instance is called the attached object for the singleton class.
- * \{
- */
-
-#include "internal.h"
-#include "ruby/st.h"
-#include "constant.h"
-#include "vm_core.h"
-#include "id_table.h"
-#include <ctype.h>
-
-#define id_attached id__attached__
-
-void
-rb_class_subclass_add(VALUE super, VALUE klass)
-{
-    rb_subclass_entry_t *entry, *head;
-
-    if (super && super != Qundef) {
-	entry = ALLOC(rb_subclass_entry_t);
-	entry->klass = klass;
-	entry->next = NULL;
-
-	head = RCLASS_EXT(super)->subclasses;
-	if (head) {
-	    entry->next = head;
-	    RCLASS_EXT(head->klass)->parent_subclasses = &entry->next;
-	}
-
-	RCLASS_EXT(super)->subclasses = entry;
-	RCLASS_EXT(klass)->parent_subclasses = &RCLASS_EXT(super)->subclasses;
-    }
-}
-
-static void
-rb_module_add_to_subclasses_list(VALUE module, VALUE iclass)
-{
-    rb_subclass_entry_t *entry, *head;
-
-    entry = ALLOC(rb_subclass_entry_t);
-    entry->klass = iclass;
-    entry->next = NULL;
-
-    head = RCLASS_EXT(module)->subclasses;
-    if (head) {
-	entry->next = head;
-	RCLASS_EXT(head->klass)->module_subclasses = &entry->next;
-    }
-
-    RCLASS_EXT(module)->subclasses = entry;
-    RCLASS_EXT(iclass)->module_subclasses = &RCLASS_EXT(module)->subclasses;
-}
-
-void
-rb_class_remove_from_super_subclasses(VALUE klass)
-{
-    rb_subclass_entry_t *entry;
-
-    if (RCLASS_EXT(klass)->parent_subclasses) {
-	entry = *RCLASS_EXT(klass)->parent_subclasses;
-
-	*RCLASS_EXT(klass)->parent_subclasses = entry->next;
-	if (entry->next) {
-	    RCLASS_EXT(entry->next->klass)->parent_subclasses = RCLASS_EXT(klass)->parent_subclasses;
-	}
-	xfree(entry);
-    }
-
-    RCLASS_EXT(klass)->parent_subclasses = NULL;
-}
-
-void
-rb_class_remove_from_module_subclasses(VALUE klass)
-{
-    rb_subclass_entry_t *entry;
-
-    if (RCLASS_EXT(klass)->module_subclasses) {
-	entry = *RCLASS_EXT(klass)->module_subclasses;
-	*RCLASS_EXT(klass)->module_subclasses = entry->next;
+  Copyright (C) 1993-1998 Yukihiro Matsumoto
 
-	if (entry->next) {
-	    RCLASS_EXT(entry->next->klass)->module_subclasses = RCLASS_EXT(klass)->module_subclasses;
-	}
-
-	xfree(entry);
-    }
-
-    RCLASS_EXT(klass)->module_subclasses = NULL;
-}
+************************************************/
 
-void
-rb_class_foreach_subclass(VALUE klass, void (*f)(VALUE, VALUE), VALUE arg)
-{
-    rb_subclass_entry_t *cur = RCLASS_EXT(klass)->subclasses;
-
-    /* do not be tempted to simplify this loop into a for loop, the order of
-       operations is important here if `f` modifies the linked list */
-    while (cur) {
-	VALUE curklass = cur->klass;
-	cur = cur->next;
-	f(curklass, arg);
-    }
-}
+#include "ruby.h"
+#include "node.h"
+#include "st.h"
 
-static void
-class_detach_subclasses(VALUE klass, VALUE arg)
-{
-    rb_class_remove_from_super_subclasses(klass);
-}
+#ifdef USE_CWGUSI
+#include <stdio.h>
+#endif
 
-void
-rb_class_detach_subclasses(VALUE klass)
-{
-    rb_class_foreach_subclass(klass, class_detach_subclasses, Qnil);
-}
+struct st_table *new_idhash();
+extern st_table *rb_class_tbl;
 
-static void
-class_detach_module_subclasses(VALUE klass, VALUE arg)
-{
-    rb_class_remove_from_module_subclasses(klass);
-}
+extern VALUE cClass;
+extern VALUE cModule;
 
-void
-rb_class_detach_module_subclasses(VALUE klass)
-{
-    rb_class_foreach_subclass(klass, class_detach_module_subclasses, Qnil);
-}
-
-/**
- * Allocates a struct RClass for a new class.
- *
- * \param flags     initial value for basic.flags of the returned class.
- * \param klass     the class of the returned class.
- * \return          an uninitialized Class object.
- * \pre  \p klass must refer \c Class class or an ancestor of Class.
- * \pre  \code (flags | T_CLASS) != 0  \endcode
- * \post the returned class can safely be \c #initialize 'd.
- *
- * \note this function is not Class#allocate.
- */
-static VALUE
-class_alloc(VALUE flags, VALUE klass)
-{
-    NEWOBJ_OF(obj, struct RClass, klass, (flags & T_MASK) | FL_PROMOTED1 /* start from age == 2 */ | (RGENGC_WB_PROTECTED_CLASS ? FL_WB_PROTECTED : 0));
-    obj->ptr = ZALLOC(rb_classext_t);
-    /* ZALLOC
-      RCLASS_IV_TBL(obj) = 0;
-      RCLASS_CONST_TBL(obj) = 0;
-      RCLASS_M_TBL(obj) = 0;
-      RCLASS_IV_INDEX_TBL(obj) = 0;
-      RCLASS_SET_SUPER((VALUE)obj, 0);
-      RCLASS_EXT(obj)->subclasses = NULL;
-      RCLASS_EXT(obj)->parent_subclasses = NULL;
-      RCLASS_EXT(obj)->module_subclasses = NULL;
-     */
-    RCLASS_SET_ORIGIN((VALUE)obj, (VALUE)obj);
-    RCLASS_SERIAL(obj) = rb_next_class_serial();
-    RCLASS_REFINED_CLASS(obj) = Qnil;
-    RCLASS_EXT(obj)->allocator = 0;
-
-    return (VALUE)obj;
-}
-
-static void
-RCLASS_M_TBL_INIT(VALUE c)
-{
-    RCLASS_M_TBL(c) = rb_id_table_create(0);
-}
-
-/*!
- * A utility function that wraps class_alloc.
- *
- * allocates a class and initializes safely.
- * \param super     a class from which the new class derives.
- * \return          a class object.
- * \pre  \a super must be a class.
- * \post the metaclass of the new class is Class.
- */
 VALUE
-rb_class_boot(VALUE super)
+class_new(super)
+    VALUE super;
 {
-    VALUE klass = class_alloc(T_CLASS, rb_cClass);
+    NEWOBJ(klass, struct RClass);
+    OBJSETUP(klass, cClass, T_CLASS);
 
-    RCLASS_SET_SUPER(klass, super);
-    RCLASS_M_TBL_INIT(klass);
+    klass->super = super;
+    klass->iv_tbl = 0;
+    klass->m_tbl = 0;		/* safe GC */
+    klass->m_tbl = new_idhash();
 
-    OBJ_INFECT(klass, super);
     return (VALUE)klass;
 }
 
-
-/*!
- * Ensures a class can be derived from super.
- *
- * \param super a reference to an object.
- * \exception TypeError if \a super is not a Class or \a super is a singleton class.
- */
-void
-rb_check_inheritable(VALUE super)
-{
-    if (!RB_TYPE_P(super, T_CLASS)) {
-	rb_raise(rb_eTypeError, "superclass must be a Class (%"PRIsVALUE" given)",
-		 rb_obj_class(super));
-    }
-    if (RBASIC(super)->flags & FL_SINGLETON) {
-	rb_raise(rb_eTypeError, "can't make subclass of singleton class");
-    }
-    if (super == rb_cClass) {
-	rb_raise(rb_eTypeError, "can't make subclass of Class");
-    }
-}
-
-
-/*!
- * Creates a new class.
- * \param super     a class from which the new class derives.
- * \exception TypeError \a super is not inheritable.
- * \exception TypeError \a super is the Class class.
- */
 VALUE
-rb_class_new(VALUE super)
-{
-    Check_Type(super, T_CLASS);
-    rb_check_inheritable(super);
-    return rb_class_boot(super);
-}
-
-static void
-clone_method(VALUE old_klass, VALUE new_klass, ID mid, const rb_method_entry_t *me)
+singleton_class_new(super)
+    VALUE super;
 {
-    if (me->def->type == VM_METHOD_TYPE_ISEQ) {
-	rb_cref_t *new_cref;
-	rb_vm_rewrite_cref(me->def->body.iseq.cref, old_klass, new_klass, &new_cref);
-	rb_add_method_iseq(new_klass, mid, me->def->body.iseq.iseqptr, new_cref, METHOD_ENTRY_VISI(me));
-    }
-    else {
-	rb_method_entry_set(new_klass, mid, me, METHOD_ENTRY_VISI(me));
-    }
-}
+    VALUE klass = class_new(super);
 
-struct clone_method_arg {
-    VALUE new_klass;
-    VALUE old_klass;
-};
-
-static enum rb_id_table_iterator_result
-clone_method_i(ID key, VALUE value, void *data)
-{
-    const struct clone_method_arg *arg = (struct clone_method_arg *)data;
-    clone_method(arg->old_klass, arg->new_klass, key, (const rb_method_entry_t *)value);
-    return ID_TABLE_CONTINUE;
+    FL_SET(klass, FL_SINGLETON);
+    return klass;
 }
 
-struct clone_const_arg {
-    VALUE klass;
-    st_table *tbl;
-};
-
 static int
-clone_const(ID key, const rb_const_entry_t *ce, struct clone_const_arg *arg)
+clone_method(mid, body, tbl)
+    ID mid;
+    NODE *body;
+    st_table *tbl;
 {
-    rb_const_entry_t *nce = ALLOC(rb_const_entry_t);
-    MEMCPY(nce, ce, rb_const_entry_t, 1);
-    RB_OBJ_WRITTEN(arg->klass, Qundef, ce->value);
-    RB_OBJ_WRITTEN(arg->klass, Qundef, ce->file);
-
-    st_insert(arg->tbl, key, (st_data_t)nce);
+    st_insert(tbl, mid, NEW_METHOD(body->nd_body, body->nd_noex));
     return ST_CONTINUE;
 }
 
-static int
-clone_const_i(st_data_t key, st_data_t value, st_data_t data)
-{
-    return clone_const((ID)key, (const rb_const_entry_t *)value, (struct clone_const_arg *)data);
-}
-
-static void
-class_init_copy_check(VALUE clone, VALUE orig)
-{
-    if (orig == rb_cBasicObject) {
-	rb_raise(rb_eTypeError, "can't copy the root class");
-    }
-    if (RCLASS_SUPER(clone) != 0 || clone == rb_cBasicObject) {
-	rb_raise(rb_eTypeError, "already initialized class");
-    }
-    if (FL_TEST(orig, FL_SINGLETON)) {
-	rb_raise(rb_eTypeError, "can't copy singleton class");
-    }
-}
-
-/* :nodoc: */
-VALUE
-rb_mod_init_copy(VALUE clone, VALUE orig)
-{
-    if (RB_TYPE_P(clone, T_CLASS)) {
-	class_init_copy_check(clone, orig);
-    }
-    if (!OBJ_INIT_COPY(clone, orig)) return clone;
-    if (!FL_TEST(CLASS_OF(clone), FL_SINGLETON)) {
-	RBASIC_SET_CLASS(clone, rb_singleton_class_clone(orig));
-	rb_singleton_class_attached(RBASIC(clone)->klass, (VALUE)clone);
-    }
-    RCLASS_SET_SUPER(clone, RCLASS_SUPER(orig));
-    RCLASS_EXT(clone)->allocator = RCLASS_EXT(orig)->allocator;
-    if (RCLASS_IV_TBL(clone)) {
-	st_free_table(RCLASS_IV_TBL(clone));
-	RCLASS_IV_TBL(clone) = 0;
-    }
-    if (RCLASS_CONST_TBL(clone)) {
-	rb_free_const_table(RCLASS_CONST_TBL(clone));
-	RCLASS_CONST_TBL(clone) = 0;
-    }
-    RCLASS_M_TBL(clone) = 0;
-    if (RCLASS_IV_TBL(orig)) {
-	st_data_t id;
-
-	RCLASS_IV_TBL(clone) = rb_st_copy(clone, RCLASS_IV_TBL(orig));
-	CONST_ID(id, "__tmp_classpath__");
-	st_delete(RCLASS_IV_TBL(clone), &id, 0);
-	CONST_ID(id, "__classpath__");
-	st_delete(RCLASS_IV_TBL(clone), &id, 0);
-	CONST_ID(id, "__classid__");
-	st_delete(RCLASS_IV_TBL(clone), &id, 0);
-    }
-    if (RCLASS_CONST_TBL(orig)) {
-	struct clone_const_arg arg;
-
-	RCLASS_CONST_TBL(clone) = st_init_numtable();
-	arg.klass = clone;
-	arg.tbl = RCLASS_CONST_TBL(clone);
-	st_foreach(RCLASS_CONST_TBL(orig), clone_const_i, (st_data_t)&arg);
-    }
-    if (RCLASS_M_TBL(orig)) {
-	struct clone_method_arg arg;
-	arg.old_klass = orig;
-	arg.new_klass = clone;
-	RCLASS_M_TBL_INIT(clone);
-	rb_id_table_foreach(RCLASS_M_TBL(orig), clone_method_i, &arg);
-    }
-
-    return clone;
-}
-
 VALUE
-rb_singleton_class_clone(VALUE obj)
-{
-    return rb_singleton_class_clone_and_attach(obj, Qundef);
-}
-
-VALUE
-rb_singleton_class_clone_and_attach(VALUE obj, VALUE attach)
+singleton_class_clone(klass)
+    VALUE klass;
 {
-    const VALUE klass = RBASIC(obj)->klass;
-
     if (!FL_TEST(klass, FL_SINGLETON))
 	return klass;
     else {
 	/* copy singleton(unnamed) class */
-	VALUE clone = class_alloc(RBASIC(klass)->flags, 0);
-
-	if (BUILTIN_TYPE(obj) == T_CLASS) {
-	    RBASIC_SET_CLASS(clone, clone);
-	}
-	else {
-	    RBASIC_SET_CLASS(clone, rb_singleton_class_clone(klass));
-	}
-
-	RCLASS_SET_SUPER(clone, RCLASS_SUPER(klass));
-	RCLASS_EXT(clone)->allocator = RCLASS_EXT(klass)->allocator;
-	if (RCLASS_IV_TBL(klass)) {
-	    RCLASS_IV_TBL(clone) = rb_st_copy(clone, RCLASS_IV_TBL(klass));
-	}
-	if (RCLASS_CONST_TBL(klass)) {
-	    struct clone_const_arg arg;
-	    RCLASS_CONST_TBL(clone) = st_init_numtable();
-	    arg.klass = clone;
-	    arg.tbl = RCLASS_CONST_TBL(clone);
-	    st_foreach(RCLASS_CONST_TBL(klass), clone_const_i, (st_data_t)&arg);
-	}
-	if (attach != Qundef) {
-	    rb_singleton_class_attached(clone, attach);
-	}
-	RCLASS_M_TBL_INIT(clone);
-	{
-	    struct clone_method_arg arg;
-	    arg.old_klass = klass;
-	    arg.new_klass = clone;
-	    rb_id_table_foreach(RCLASS_M_TBL(klass), clone_method_i, &arg);
-	}
-	rb_singleton_class_attached(RBASIC(clone)->klass, clone);
+	NEWOBJ(clone, struct RClass);
+	CLONESETUP(clone, klass);
+
+	clone->super = RCLASS(klass)->super;
+	clone->iv_tbl = 0;
+	clone->m_tbl = 0;
+	clone->m_tbl = new_idhash();
+	st_foreach(RCLASS(klass)->m_tbl, clone_method, clone->m_tbl);
 	FL_SET(clone, FL_SINGLETON);
-
-	return clone;
+	return (VALUE)clone;
     }
 }
 
-/*!
- * Attach a object to a singleton class.
- * @pre \a klass is the singleton class of \a obj.
- */
 void
-rb_singleton_class_attached(VALUE klass, VALUE obj)
-{
-    if (FL_TEST(klass, FL_SINGLETON)) {
-	if (!RCLASS_IV_TBL(klass)) {
-	    RCLASS_IV_TBL(klass) = st_init_numtable();
-	}
-	rb_class_ivar_set(klass, id_attached, obj);
-    }
-}
-
-
-
-#define METACLASS_OF(k) RBASIC(k)->klass
-#define SET_METACLASS_OF(k, cls) RBASIC_SET_CLASS(k, cls)
-
-/*!
- * whether k is a meta^(n)-class of Class class
- * @retval 1 if \a k is a meta^(n)-class of Class class (n >= 0)
- * @retval 0 otherwise
- */
-#define META_CLASS_OF_CLASS_CLASS_P(k)  (METACLASS_OF(k) == (k))
-
-/*!
- * whether k has a metaclass
- * @retval 1 if \a k has a metaclass
- * @retval 0 otherwise
- */
-#define HAVE_METACLASS_P(k) \
-    (FL_TEST(METACLASS_OF(k), FL_SINGLETON) && \
-     rb_ivar_get(METACLASS_OF(k), id_attached) == (k))
-
-/*!
- * ensures \a klass belongs to its own eigenclass.
- * @return the eigenclass of \a klass
- * @post \a klass belongs to the returned eigenclass.
- *       i.e. the attached object of the eigenclass is \a klass.
- * @note this macro creates a new eigenclass if necessary.
- */
-#define ENSURE_EIGENCLASS(klass) \
-    (HAVE_METACLASS_P(klass) ? METACLASS_OF(klass) : make_metaclass(klass))
-
-
-/*!
- * Creates a metaclass of \a klass
- * \param klass     a class
- * \return          created metaclass for the class
- * \pre \a klass is a Class object
- * \pre \a klass has no singleton class.
- * \post the class of \a klass is the returned class.
- * \post the returned class is meta^(n+1)-class when \a klass is a meta^(n)-klass for n >= 0
- */
-static inline VALUE
-make_metaclass(VALUE klass)
+singleton_class_attached(klass, obj)
+    VALUE klass, obj;
 {
-    VALUE super;
-    VALUE metaclass = rb_class_boot(Qundef);
-
-    FL_SET(metaclass, FL_SINGLETON);
-    rb_singleton_class_attached(metaclass, klass);
-
-    if (META_CLASS_OF_CLASS_CLASS_P(klass)) {
-	SET_METACLASS_OF(klass, metaclass);
-	SET_METACLASS_OF(metaclass, metaclass);
-    }
-    else {
-	VALUE tmp = METACLASS_OF(klass); /* for a meta^(n)-class klass, tmp is meta^(n)-class of Class class */
-	SET_METACLASS_OF(klass, metaclass);
-	SET_METACLASS_OF(metaclass, ENSURE_EIGENCLASS(tmp));
-    }
-
-    super = RCLASS_SUPER(klass);
-    while (RB_TYPE_P(super, T_ICLASS)) super = RCLASS_SUPER(super);
-    RCLASS_SET_SUPER(metaclass, super ? ENSURE_EIGENCLASS(super) : rb_cClass);
-
-    OBJ_INFECT(metaclass, RCLASS_SUPER(metaclass));
-
-    return metaclass;
-}
-
-/*!
- * Creates a singleton class for \a obj.
- * \pre \a obj must not a immediate nor a special const.
- * \pre \a obj must not a Class object.
- * \pre \a obj has no singleton class.
- */
-static inline VALUE
-make_singleton_class(VALUE obj)
-{
-    VALUE orig_class = RBASIC(obj)->klass;
-    VALUE klass = rb_class_boot(orig_class);
-
-    FL_SET(klass, FL_SINGLETON);
-    RBASIC_SET_CLASS(obj, klass);
-    rb_singleton_class_attached(klass, obj);
-
-    SET_METACLASS_OF(klass, METACLASS_OF(rb_class_real(orig_class)));
-    return klass;
-}
-
-
-static VALUE
-boot_defclass(const char *name, VALUE super)
-{
-    VALUE obj = rb_class_boot(super);
-    ID id = rb_intern(name);
-
-    rb_name_class(obj, id);
-    rb_const_set((rb_cObject ? rb_cObject : obj), id, obj);
-    return obj;
+    if (FL_TEST(klass, FL_SINGLETON))
+	rb_iv_set(klass, "__attached__", obj);
 }
 
-void
-Init_class_hierarchy(void)
-{
-    rb_cBasicObject = boot_defclass("BasicObject", 0);
-    rb_cObject = boot_defclass("Object", rb_cBasicObject);
-    rb_cModule = boot_defclass("Module", rb_cObject);
-    rb_cClass =  boot_defclass("Class",  rb_cModule);
-
-    rb_const_set(rb_cObject, rb_intern_const("BasicObject"), rb_cBasicObject);
-    RBASIC_SET_CLASS(rb_cClass, rb_cClass);
-    RBASIC_SET_CLASS(rb_cModule, rb_cClass);
-    RBASIC_SET_CLASS(rb_cObject, rb_cClass);
-    RBASIC_SET_CLASS(rb_cBasicObject, rb_cClass);
-}
-
-
-/*!
- * \internal
- * Creates a new *singleton class* for an object.
- *
- * \pre \a obj has no singleton class.
- * \note DO NOT USE the function in an extension libraries. Use \ref rb_singleton_class.
- * \param obj     An object.
- * \param unused  ignored.
- * \return        The singleton class of the object.
- */
 VALUE
-rb_make_metaclass(VALUE obj, VALUE unused)
-{
-    if (BUILTIN_TYPE(obj) == T_CLASS) {
-	return make_metaclass(obj);
-    }
-    else {
-	return make_singleton_class(obj);
-    }
-}
-
-
-/*!
- * Defines a new class.
- * \param id     ignored
- * \param super  A class from which the new class will derive. NULL means \c Object class.
- * \return       the created class
- * \throw TypeError if super is not a \c Class object.
- *
- * \note the returned class will not be associated with \a id.
- *       You must explicitly set a class name if necessary.
- */
-VALUE
-rb_define_class_id(ID id, VALUE super)
+rb_define_class_id(id, super)
+    ID id;
+    VALUE super;
 {
     VALUE klass;
 
-    if (!super) super = rb_cObject;
-    klass = rb_class_new(super);
-    rb_make_metaclass(klass, RBASIC(super)->klass);
+    if (!super) super = cObject;
+    klass = class_new(super);
+    rb_name_class(klass, id);
+    /* make metaclass */
+    RBASIC(klass)->klass = singleton_class_new(RBASIC(super)->klass);
+    singleton_class_attached(RBASIC(klass)->klass, klass);
+    rb_funcall(super, rb_intern("inherited"), 1, klass);
 
     return klass;
 }
 
-
-/*!
- * Calls Class#inherited.
- * \param super  A class which will be called #inherited.
- *               NULL means Object class.
- * \param klass  A Class object which derived from \a super
- * \return the value \c Class#inherited's returns
- * \pre Each of \a super and \a klass must be a \c Class object.
- */
-VALUE
-rb_class_inherited(VALUE super, VALUE klass)
-{
-    ID inherited;
-    if (!super) super = rb_cObject;
-    CONST_ID(inherited, "inherited");
-    return rb_funcall(super, inherited, 1, klass);
-}
-
-
-
-/*!
- * Defines a top-level class.
- * \param name   name of the class
- * \param super  a class from which the new class will derive.
- *               NULL means \c Object class.
- * \return the created class
- * \throw TypeError if the constant name \a name is already taken but
- *                  the constant is not a \c Class.
- * \throw NameError if the class is already defined but the class can not
- *                  be reopened because its superclass is not \a super.
- * \post top-level constant named \a name refers the returned class.
- *
- * \note if a class named \a name is already defined and its superclass is
- *       \a super, the function just returns the defined class.
- */
 VALUE
-rb_define_class(const char *name, VALUE super)
+rb_define_class(name, super)
+    char *name;
+    VALUE super;
 {
     VALUE klass;
     ID id;
 
     id = rb_intern(name);
-    if (rb_const_defined(rb_cObject, id)) {
-	klass = rb_const_get(rb_cObject, id);
-	if (!RB_TYPE_P(klass, T_CLASS)) {
-	    rb_raise(rb_eTypeError, "%s is not a class (%"PRIsVALUE")",
-		     name, rb_obj_class(klass));
-	}
-	if (rb_class_real(RCLASS_SUPER(klass)) != super) {
-	    rb_raise(rb_eTypeError, "superclass mismatch for class %s", name);
-	}
-	return klass;
-    }
-    if (!super) {
-	rb_warn("no super class for `%s', Object assumed", name);
-    }
     klass = rb_define_class_id(id, super);
-    rb_vm_add_root_module(id, klass);
-    rb_name_class(klass, id);
-    rb_const_set(rb_cObject, id, klass);
-    rb_class_inherited(super, klass);
+    st_add_direct(rb_class_tbl, id, klass);
 
     return klass;
 }
 
-
-/*!
- * Defines a class under the namespace of \a outer.
- * \param outer  a class which contains the new class.
- * \param name   name of the new class
- * \param super  a class from which the new class will derive.
- *               NULL means \c Object class.
- * \return the created class
- * \throw TypeError if the constant name \a name is already taken but
- *                  the constant is not a \c Class.
- * \throw TypeError if the class is already defined but the class can not
- *                  be reopened because its superclass is not \a super.
- * \post top-level constant named \a name refers the returned class.
- *
- * \note if a class named \a name is already defined and its superclass is
- *       \a super, the function just returns the defined class.
- */
-VALUE
-rb_define_class_under(VALUE outer, const char *name, VALUE super)
-{
-    return rb_define_class_id_under(outer, rb_intern(name), super);
-}
-
-
-/*!
- * Defines a class under the namespace of \a outer.
- * \param outer  a class which contains the new class.
- * \param id     name of the new class
- * \param super  a class from which the new class will derive.
- *               NULL means \c Object class.
- * \return the created class
- * \throw TypeError if the constant name \a name is already taken but
- *                  the constant is not a \c Class.
- * \throw TypeError if the class is already defined but the class can not
- *                  be reopened because its superclass is not \a super.
- * \post top-level constant named \a name refers the returned class.
- *
- * \note if a class named \a name is already defined and its superclass is
- *       \a super, the function just returns the defined class.
- */
 VALUE
-rb_define_class_id_under(VALUE outer, ID id, VALUE super)
+rb_define_class_under(outer, name, super)
+    VALUE outer;
+    char *name;
+    VALUE super;
 {
     VALUE klass;
+    ID id;
 
-    if (rb_const_defined_at(outer, id)) {
-	klass = rb_const_get_at(outer, id);
-	if (!RB_TYPE_P(klass, T_CLASS)) {
-	    rb_raise(rb_eTypeError, "%"PRIsVALUE"::%"PRIsVALUE" is not a class"
-		     " (%"PRIsVALUE")",
-		     outer, rb_id2str(id), rb_obj_class(klass));
-	}
-	if (rb_class_real(RCLASS_SUPER(klass)) != super) {
-	    rb_raise(rb_eTypeError, "superclass mismatch for class "
-		     "%"PRIsVALUE"::%"PRIsVALUE""
-		     " (%"PRIsVALUE" is given but was %"PRIsVALUE")",
-		     outer, rb_id2str(id), RCLASS_SUPER(klass), super);
-	}
-	return klass;
-    }
-    if (!super) {
-	rb_warn("no super class for `%"PRIsVALUE"::%"PRIsVALUE"', Object assumed",
-		rb_class_path(outer), rb_id2str(id));
-    }
+    id = rb_intern(name);
     klass = rb_define_class_id(id, super);
-    rb_set_class_path_string(klass, outer, rb_id2str(id));
     rb_const_set(outer, id, klass);
-    rb_class_inherited(super, klass);
-    rb_gc_register_mark_object(klass);
+    rb_set_class_path(klass, outer, name);
 
     return klass;
 }
 
 VALUE
-rb_module_new(void)
+module_new()
 {
-    VALUE mdl = class_alloc(T_MODULE, rb_cModule);
-    RCLASS_M_TBL_INIT(mdl);
+    NEWOBJ(mdl, struct RClass);
+    OBJSETUP(mdl, cModule, T_MODULE);
+
+    mdl->super = 0;
+    mdl->iv_tbl = 0;
+    mdl->m_tbl = 0;
+    mdl->m_tbl = new_idhash();
+
     return (VALUE)mdl;
 }
 
 VALUE
-rb_define_module_id(ID id)
+rb_define_module_id(id)
+    ID id;
 {
-    VALUE mdl;
+    extern st_table *rb_class_tbl;
+    VALUE mdl = module_new();
 
-    mdl = rb_module_new();
     rb_name_class(mdl, id);
 
     return mdl;
 }
 
 VALUE
-rb_define_module(const char *name)
+rb_define_module(name)
+    char *name;
 {
     VALUE module;
     ID id;
 
     id = rb_intern(name);
-    if (rb_const_defined(rb_cObject, id)) {
-	module = rb_const_get(rb_cObject, id);
-	if (!RB_TYPE_P(module, T_MODULE)) {
-	    rb_raise(rb_eTypeError, "%s is not a module (%"PRIsVALUE")",
-		     name, rb_obj_class(module));
-	}
-	return module;
-    }
     module = rb_define_module_id(id);
-    rb_vm_add_root_module(id, module);
-    rb_const_set(rb_cObject, id, module);
+    st_add_direct(rb_class_tbl, id, module);
 
     return module;
 }
 
 VALUE
-rb_define_module_under(VALUE outer, const char *name)
-{
-    return rb_define_module_id_under(outer, rb_intern(name));
-}
-
-VALUE
-rb_define_module_id_under(VALUE outer, ID id)
+rb_define_module_under(outer, name)
+    VALUE outer;
+    char *name;
 {
     VALUE module;
+    ID id;
 
-    if (rb_const_defined_at(outer, id)) {
-	module = rb_const_get_at(outer, id);
-	if (!RB_TYPE_P(module, T_MODULE)) {
-	    rb_raise(rb_eTypeError, "%"PRIsVALUE"::%"PRIsVALUE" is not a module"
-		     " (%"PRIsVALUE")",
-		     outer, rb_id2str(id), rb_obj_class(module));
-	}
-	return module;
-    }
+    id = rb_intern(name);
     module = rb_define_module_id(id);
     rb_const_set(outer, id, module);
-    rb_set_class_path_string(module, outer, rb_id2str(id));
-    rb_gc_register_mark_object(module);
+    rb_set_class_path(module, outer, name);
 
     return module;
 }
 
-VALUE
-rb_include_class_new(VALUE module, VALUE super)
+static VALUE
+include_class_new(module, super)
+    VALUE module, super;
 {
-    VALUE klass = class_alloc(T_ICLASS, rb_cClass);
+    NEWOBJ(klass, struct RClass);
+    OBJSETUP(klass, cClass, T_ICLASS);
 
-    if (BUILTIN_TYPE(module) == T_ICLASS) {
-	module = RBASIC(module)->klass;
-    }
-    if (!RCLASS_IV_TBL(module)) {
-	RCLASS_IV_TBL(module) = st_init_numtable();
-    }
-    if (!RCLASS_CONST_TBL(module)) {
-	RCLASS_CONST_TBL(module) = st_init_numtable();
-    }
-    RCLASS_IV_TBL(klass) = RCLASS_IV_TBL(module);
-    RCLASS_CONST_TBL(klass) = RCLASS_CONST_TBL(module);
-
-    RCLASS_M_TBL(OBJ_WB_UNPROTECT(klass)) =
-      RCLASS_M_TBL(OBJ_WB_UNPROTECT(RCLASS_ORIGIN(module))); /* TODO: unprotected? */
-
-    RCLASS_SET_SUPER(klass, super);
-    if (RB_TYPE_P(module, T_ICLASS)) {
-	RBASIC_SET_CLASS(klass, RBASIC(module)->klass);
+    klass->m_tbl = RCLASS(module)->m_tbl;
+    klass->iv_tbl = RCLASS(module)->iv_tbl;
+    klass->super = super;
+    if (TYPE(module) == T_ICLASS) {
+	RBASIC(klass)->klass = RBASIC(module)->klass;
     }
     else {
-	RBASIC_SET_CLASS(klass, module);
+	RBASIC(klass)->klass = module;
     }
-    OBJ_INFECT(klass, module);
-    OBJ_INFECT(klass, super);
 
     return (VALUE)klass;
 }
 
-static int include_modules_at(const VALUE klass, VALUE c, VALUE module, int search_super);
-
 void
-rb_include_module(VALUE klass, VALUE module)
+rb_include_module(klass, module)
+    VALUE klass, module;
 {
-    int changed = 0;
+    VALUE p;
 
-    rb_frozen_class_p(klass);
+    if (NIL_P(module)) return;
+    if (klass == module) return;
 
-    if (!RB_TYPE_P(module, T_MODULE)) {
+    switch (TYPE(module)) {
+      case T_MODULE:
+      case T_CLASS:
+      case T_ICLASS:
+	break;
+      default:
 	Check_Type(module, T_MODULE);
     }
 
-    OBJ_INFECT(klass, module);
-
-    changed = include_modules_at(klass, RCLASS_ORIGIN(klass), module, TRUE);
-    if (changed < 0)
-	rb_raise(rb_eArgError, "cyclic include detected");
-}
-
-static enum rb_id_table_iterator_result
-add_refined_method_entry_i(ID key, VALUE value, void *data)
-{
-    rb_add_refined_method_entry((VALUE)data, key);
-    return ID_TABLE_CONTINUE;
-}
-
-static int
-include_modules_at(const VALUE klass, VALUE c, VALUE module, int search_super)
-{
-    VALUE p, iclass;
-    int method_changed = 0, constant_changed = 0;
-    struct rb_id_table *const klass_m_tbl = RCLASS_M_TBL(RCLASS_ORIGIN(klass));
-
     while (module) {
-	int superclass_seen = FALSE;
-
-	if (RCLASS_ORIGIN(module) != module)
-	    goto skip;
-	if (klass_m_tbl && klass_m_tbl == RCLASS_M_TBL(module))
-	    return -1;
 	/* ignore if the module included already in superclasses */
-	for (p = RCLASS_SUPER(klass); p; p = RCLASS_SUPER(p)) {
-	    int type = BUILTIN_TYPE(p);
-	    if (type == T_ICLASS) {
-		if (RCLASS_M_TBL(p) == RCLASS_M_TBL(module)) {
-		    if (!superclass_seen) {
-			c = p;  /* move insertion point */
-		    }
-		    goto skip;
+	for (p = RCLASS(klass)->super; p; p = RCLASS(p)->super) {
+	    if (BUILTIN_TYPE(p) == T_ICLASS &&
+		RCLASS(p)->m_tbl == RCLASS(module)->m_tbl) {
+		if (RCLASS(module)->super) {
+		    rb_include_module(p, RCLASS(module)->super);
 		}
+		return;
 	    }
-	    else if (type == T_CLASS) {
-		if (!search_super) break;
-		superclass_seen = TRUE;
-	    }
-	}
-	iclass = rb_include_class_new(module, RCLASS_SUPER(c));
-	c = RCLASS_SET_SUPER(c, iclass);
-
-	{
-	    VALUE m = module;
-	    if (BUILTIN_TYPE(m) == T_ICLASS) m = RBASIC(m)->klass;
-	    rb_module_add_to_subclasses_list(m, iclass);
-	}
-
-	if (FL_TEST(klass, RMODULE_IS_REFINEMENT)) {
-	    VALUE refined_class =
-		rb_refinement_module_get_refined_class(klass);
-
-	    rb_id_table_foreach(RMODULE_M_TBL(module), add_refined_method_entry_i, (void *)refined_class);
-	    FL_SET(c, RMODULE_INCLUDED_INTO_REFINEMENT);
-	}
-	if (RMODULE_M_TBL(module) && rb_id_table_size(RMODULE_M_TBL(module))) method_changed = 1;
-	if (RMODULE_CONST_TBL(module) && RMODULE_CONST_TBL(module)->num_entries) constant_changed = 1;
-      skip:
-	module = RCLASS_SUPER(module);
-    }
-
-    if (method_changed) rb_clear_method_cache_by_class(klass);
-    if (constant_changed) rb_clear_constant_cache();
-
-    return method_changed;
-}
-
-static enum rb_id_table_iterator_result
-move_refined_method(ID key, VALUE value, void *data)
-{
-    rb_method_entry_t *me = (rb_method_entry_t *) value;
-    VALUE klass = (VALUE)data;
-    struct rb_id_table *tbl = RCLASS_M_TBL(klass);
-
-    if (me->def->type == VM_METHOD_TYPE_REFINED) {
-	if (me->def->body.refined.orig_me) {
-	    const rb_method_entry_t *orig_me = me->def->body.refined.orig_me, *new_me;
-	    RB_OBJ_WRITE(me, &me->def->body.refined.orig_me, NULL);
-	    new_me = rb_method_entry_clone(me);
-	    rb_id_table_insert(tbl, key, (VALUE)new_me);
-	    RB_OBJ_WRITTEN(klass, Qundef, new_me);
-	    rb_method_entry_copy(me, orig_me);
-	    return ID_TABLE_CONTINUE;
-	}
-	else {
-	    rb_id_table_insert(tbl, key, (VALUE)me);
-	    return ID_TABLE_DELETE;
 	}
+	RCLASS(klass)->super =
+	    include_class_new(module, RCLASS(klass)->super);
+	klass = RCLASS(klass)->super;
+	module = RCLASS(module)->super;
     }
-    else {
-	return ID_TABLE_CONTINUE;
-    }
-}
-
-void
-rb_prepend_module(VALUE klass, VALUE module)
-{
-    VALUE origin;
-    int changed = 0;
-
-    rb_frozen_class_p(klass);
-
-    Check_Type(module, T_MODULE);
-
-    OBJ_INFECT(klass, module);
-
-    origin = RCLASS_ORIGIN(klass);
-    if (origin == klass) {
-	origin = class_alloc(T_ICLASS, klass);
-	OBJ_WB_UNPROTECT(origin); /* TODO: conservative shading. Need more survey. */
-	RCLASS_SET_SUPER(origin, RCLASS_SUPER(klass));
-	RCLASS_SET_SUPER(klass, origin);
-	RCLASS_SET_ORIGIN(klass, origin);
-	RCLASS_M_TBL(origin) = RCLASS_M_TBL(klass);
-	RCLASS_M_TBL_INIT(klass);
-	rb_id_table_foreach(RCLASS_M_TBL(origin), move_refined_method, (void *)klass);
-    }
-    changed = include_modules_at(klass, klass, module, FALSE);
-    if (changed < 0)
-	rb_raise(rb_eArgError, "cyclic prepend detected");
-    if (changed) {
-	rb_vm_check_redefinition_by_prepend(klass);
-    }
+    rb_clear_cache();
 }
 
-/*
- *  call-seq:
- *     mod.included_modules -> array
- *
- *  Returns the list of modules included in <i>mod</i>.
- *
- *     module Mixin
- *     end
- *
- *     module Outer
- *       include Mixin
- *     end
- *
- *     Mixin.included_modules   #=> []
- *     Outer.included_modules   #=> [Mixin]
- */
-
 VALUE
-rb_mod_included_modules(VALUE mod)
+mod_included_modules(mod)
+    VALUE mod;
 {
-    VALUE ary = rb_ary_new();
+    VALUE ary = ary_new();
     VALUE p;
-    VALUE origin = RCLASS_ORIGIN(mod);
 
-    for (p = RCLASS_SUPER(mod); p; p = RCLASS_SUPER(p)) {
-	if (p != origin && BUILTIN_TYPE(p) == T_ICLASS) {
-	    VALUE m = RBASIC(p)->klass;
-	    if (RB_TYPE_P(m, T_MODULE))
-		rb_ary_push(ary, m);
+    for (p = RCLASS(mod)->super; p; p = RCLASS(p)->super) {
+	if (BUILTIN_TYPE(p) == T_ICLASS) {
+	    ary_push(ary, RBASIC(p)->klass);
 	}
     }
     return ary;
 }
 
-/*
- *  call-seq:
- *     mod.include?(module)    -> true or false
- *
- *  Returns <code>true</code> if <i>module</i> is included in
- *  <i>mod</i> or one of <i>mod</i>'s ancestors.
- *
- *     module A
- *     end
- *     class B
- *       include A
- *     end
- *     class C < B
- *     end
- *     B.include?(A)   #=> true
- *     C.include?(A)   #=> true
- *     A.include?(A)   #=> false
- */
-
 VALUE
-rb_mod_include_p(VALUE mod, VALUE mod2)
+mod_ancestors(mod)
+    VALUE mod;
 {
+    VALUE ary = ary_new();
     VALUE p;
 
-    Check_Type(mod2, T_MODULE);
-    for (p = RCLASS_SUPER(mod); p; p = RCLASS_SUPER(p)) {
+    for (p = mod; p; p = RCLASS(p)->super) {
+	if (FL_TEST(p, FL_SINGLETON))
+	    continue;
 	if (BUILTIN_TYPE(p) == T_ICLASS) {
-	    if (RBASIC(p)->klass == mod2) return Qtrue;
+	    ary_push(ary, RBASIC(p)->klass);
 	}
-    }
-    return Qfalse;
-}
-
-/*
- *  call-seq:
- *     mod.ancestors -> array
- *
- *  Returns a list of modules included/prepended in <i>mod</i>
- *  (including <i>mod</i> itself).
- *
- *     module Mod
- *       include Math
- *       include Comparable
- *       prepend Enumerable
- *     end
- *
- *     Mod.ancestors        #=> [Enumerable, Mod, Comparable, Math]
- *     Math.ancestors       #=> [Math]
- *     Enumerable.ancestors #=> [Enumerable]
- */
-
-VALUE
-rb_mod_ancestors(VALUE mod)
-{
-    VALUE p, ary = rb_ary_new();
-
-    for (p = mod; p; p = RCLASS_SUPER(p)) {
-	if (BUILTIN_TYPE(p) == T_ICLASS) {
-	    rb_ary_push(ary, RBASIC(p)->klass);
-	}
-	else if (p == RCLASS_ORIGIN(p)) {
-	    rb_ary_push(ary, p);
+	else {
+	    ary_push(ary, p);
 	}
     }
     return ary;
 }
 
 static int
-ins_methods_push(ID name, rb_method_visibility_t visi, VALUE ary, rb_method_visibility_t expected_visi)
+ins_methods_i(key, body, ary)
+    ID key;
+    NODE *body;
+    VALUE ary;
 {
-    if (visi == METHOD_VISI_UNDEF) return ST_CONTINUE;
+    if ((body->nd_noex&(NOEX_PRIVATE|NOEX_PROTECTED)) == 0) {
+	VALUE name = str_new2(rb_id2name(key));
 
-    switch (expected_visi) {
-      case METHOD_VISI_UNDEF:
-	if (visi != METHOD_VISI_PRIVATE) rb_ary_push(ary, ID2SYM(name));
-	break;
-      case METHOD_VISI_PRIVATE:
-      case METHOD_VISI_PROTECTED:
-      case METHOD_VISI_PUBLIC:
-	if (visi == expected_visi) rb_ary_push(ary, ID2SYM(name));
-	break;
+	if (!ary_includes(ary, name)) {
+	    if (!body->nd_body) {
+		ary_push(ary, Qnil);
+	    }
+	    ary_push(ary, name);
+	}
+    }
+    else if (body->nd_body && nd_type(body->nd_body) == NODE_ZSUPER) {
+	ary_push(ary, Qnil);
+	ary_push(ary, str_new2(rb_id2name(key)));
     }
     return ST_CONTINUE;
 }
 
 static int
-ins_methods_i(st_data_t name, st_data_t type, st_data_t ary)
-{
-    return ins_methods_push((ID)name, (rb_method_visibility_t)type, (VALUE)ary, METHOD_VISI_UNDEF); /* everything but private */
-}
-
-static int
-ins_methods_prot_i(st_data_t name, st_data_t type, st_data_t ary)
+ins_methods_prot_i(key, body, ary)
+    ID key;
+    NODE *body;
+    VALUE ary;
 {
-    return ins_methods_push((ID)name, (rb_method_visibility_t)type, (VALUE)ary, METHOD_VISI_PROTECTED);
-}
+    if (!body->nd_body) {
+	ary_push(ary, Qnil);
+	ary_push(ary, str_new2(rb_id2name(key)));
+    }
+    else if (body->nd_noex & NOEX_PROTECTED) {
+	VALUE name = str_new2(rb_id2name(key));
 
-static int
-ins_methods_priv_i(st_data_t name, st_data_t type, st_data_t ary)
-{
-    return ins_methods_push((ID)name, (rb_method_visibility_t)type, (VALUE)ary, METHOD_VISI_PRIVATE);
+	if (!ary_includes(ary, name)) {
+	    ary_push(ary, name);
+	}
+    }
+    else if (nd_type(body->nd_body) == NODE_ZSUPER) {
+	ary_push(ary, Qnil);
+	ary_push(ary, str_new2(rb_id2name(key)));
+    }
+    return ST_CONTINUE;
 }
 
 static int
-ins_methods_pub_i(st_data_t name, st_data_t type, st_data_t ary)
-{
-    return ins_methods_push((ID)name, (rb_method_visibility_t)type, (VALUE)ary, METHOD_VISI_PUBLIC);
-}
-
-struct method_entry_arg {
-    st_table *list;
-    int recur;
-};
-
-static enum rb_id_table_iterator_result
-method_entry_i(ID key, VALUE value, void *data)
+ins_methods_priv_i(key, body, ary)
+    ID key;
+    NODE *body;
+    VALUE ary;
 {
-    const rb_method_entry_t *me = (const rb_method_entry_t *)value;
-    struct method_entry_arg *arg = (struct method_entry_arg *)data;
-    rb_method_visibility_t type;
-
-    if (me->def->type == VM_METHOD_TYPE_REFINED) {
-	VALUE owner = me->owner;
-	me = rb_resolve_refined_method(Qnil, me);
-	if (!me) return ID_TABLE_CONTINUE;
-	if (!arg->recur && me->owner != owner) return ID_TABLE_CONTINUE;
+    if (!body->nd_body) {
+	ary_push(ary, Qnil);
+	ary_push(ary, str_new2(rb_id2name(key)));
     }
-    if (!st_lookup(arg->list, key, 0)) {
-	if (UNDEFINED_METHOD_ENTRY_P(me)) {
-	    type = METHOD_VISI_UNDEF; /* none */
-	}
-	else {
-	    type = METHOD_ENTRY_VISI(me);
+    else if (body->nd_noex & NOEX_PRIVATE) {
+	VALUE name = str_new2(rb_id2name(key));
+
+	if (!ary_includes(ary, name)) {
+	    ary_push(ary, name);
 	}
-	st_add_direct(arg->list, key, (st_data_t)type);
     }
-    return ID_TABLE_CONTINUE;
+    else if (nd_type(body->nd_body) == NODE_ZSUPER) {
+	ary_push(ary, Qnil);
+	ary_push(ary, str_new2(rb_id2name(key)));
+    }
+    return ST_CONTINUE;
 }
 
 static VALUE
-class_instance_method_list(int argc, const VALUE *argv, VALUE mod, int obj, int (*func) (st_data_t, st_data_t, st_data_t))
+method_list(mod, option, func)
+    VALUE mod;
+    int option;
+    int (*func)();
 {
     VALUE ary;
-    int recur, prepended = 0;
-    struct method_entry_arg me_arg;
-
-    if (argc == 0) {
-	recur = TRUE;
-    }
-    else {
-	VALUE r;
-	rb_scan_args(argc, argv, "01", &r);
-	recur = RTEST(r);
-    }
+    VALUE klass;
+    VALUE *p, *q, *pend;
 
-    if (!recur && RCLASS_ORIGIN(mod) != mod) {
-	mod = RCLASS_ORIGIN(mod);
-	prepended = 1;
+    ary = ary_new();
+    for (klass = mod; klass; klass = RCLASS(klass)->super) {
+	st_foreach(RCLASS(klass)->m_tbl, func, ary);
+	if (!option) break;
     }
-
-    me_arg.list = st_init_numtable();
-    me_arg.recur = recur;
-    for (; mod; mod = RCLASS_SUPER(mod)) {
-	if (RCLASS_M_TBL(mod)) rb_id_table_foreach(RCLASS_M_TBL(mod), method_entry_i, &me_arg);
-	if (BUILTIN_TYPE(mod) == T_ICLASS && !prepended) continue;
-	if (obj && FL_TEST(mod, FL_SINGLETON)) continue;
-	if (!recur) break;
+    p = q = RARRAY(ary)->ptr; pend = p + RARRAY(ary)->len;
+    while (p < pend) {
+	if (*p == Qnil) {
+	    p+=2;
+	    continue;
+	}
+	*q++ = *p++;
     }
-    ary = rb_ary_new();
-    st_foreach(me_arg.list, func, ary);
-    st_free_table(me_arg.list);
-
+    RARRAY(ary)->len = q - RARRAY(ary)->ptr;
     return ary;
 }
 
-/*
- *  call-seq:
- *     mod.instance_methods(include_super=true)   -> array
- *
- *  Returns an array containing the names of the public and protected instance
- *  methods in the receiver. For a module, these are the public and protected methods;
- *  for a class, they are the instance (not singleton) methods. If the optional
- *  parameter is <code>false</code>, the methods of any ancestors are not included.
- *
- *     module A
- *       def method1()  end
- *     end
- *     class B
- *       include A
- *       def method2()  end
- *     end
- *     class C < B
- *       def method3()  end
- *     end
- *
- *     A.instance_methods(false)                   #=> [:method1]
- *     B.instance_methods(false)                   #=> [:method2]
- *     B.instance_methods(true).include?(:method1) #=> true
- *     C.instance_methods(false)                   #=> [:method3]
- *     C.instance_methods.include?(:method2)       #=> true
- */
-
 VALUE
-rb_class_instance_methods(int argc, const VALUE *argv, VALUE mod)
+class_instance_methods(argc, argv, mod)
+    int argc;
+    VALUE *argv;
+    VALUE mod;
 {
-    return class_instance_method_list(argc, argv, mod, 0, ins_methods_i);
-}
-
-/*
- *  call-seq:
- *     mod.protected_instance_methods(include_super=true)   -> array
- *
- *  Returns a list of the protected instance methods defined in
- *  <i>mod</i>. If the optional parameter is <code>false</code>, the
- *  methods of any ancestors are not included.
- */
+    VALUE option;
 
-VALUE
-rb_class_protected_instance_methods(int argc, const VALUE *argv, VALUE mod)
-{
-    return class_instance_method_list(argc, argv, mod, 0, ins_methods_prot_i);
+    rb_scan_args(argc, argv, "01", &option);
+    return method_list(mod, RTEST(option), ins_methods_i);
 }
 
-/*
- *  call-seq:
- *     mod.private_instance_methods(include_super=true)    -> array
- *
- *  Returns a list of the private instance methods defined in
- *  <i>mod</i>. If the optional parameter is <code>false</code>, the
- *  methods of any ancestors are not included.
- *
- *     module Mod
- *       def method1()  end
- *       private :method1
- *       def method2()  end
- *     end
- *     Mod.instance_methods           #=> [:method2]
- *     Mod.private_instance_methods   #=> [:method1]
- */
-
 VALUE
-rb_class_private_instance_methods(int argc, const VALUE *argv, VALUE mod)
+class_protected_instance_methods(argc, argv, mod)
+    int argc;
+    VALUE *argv;
+    VALUE mod;
 {
-    return class_instance_method_list(argc, argv, mod, 0, ins_methods_priv_i);
-}
+    VALUE option;
 
-/*
- *  call-seq:
- *     mod.public_instance_methods(include_super=true)   -> array
- *
- *  Returns a list of the public instance methods defined in <i>mod</i>.
- *  If the optional parameter is <code>false</code>, the methods of
- *  any ancestors are not included.
- */
-
-VALUE
-rb_class_public_instance_methods(int argc, const VALUE *argv, VALUE mod)
-{
-    return class_instance_method_list(argc, argv, mod, 0, ins_methods_pub_i);
+    rb_scan_args(argc, argv, "01", &option);
+    return method_list(mod, RTEST(option), ins_methods_prot_i);
 }
 
-/*
- *  call-seq:
- *     obj.methods(regular=true)    -> array
- *
- *  Returns a list of the names of public and protected methods of
- *  <i>obj</i>. This will include all the methods accessible in
- *  <i>obj</i>'s ancestors.
- *  If the optional parameter is <code>false</code>, it
- *  returns an array of <i>obj<i>'s public and protected singleton methods,
- *  the array will not include methods in modules included in <i>obj</i>.
- *
- *     class Klass
- *       def klass_method()
- *       end
- *     end
- *     k = Klass.new
- *     k.methods[0..9]    #=> [:klass_method, :nil?, :===,
- *                        #    :==~, :!, :eql?
- *                        #    :hash, :<=>, :class, :singleton_class]
- *     k.methods.length   #=> 56
- *
- *     k.methods(false)   #=> []
- *     def k.singleton_method; end
- *     k.methods(false)   #=> [:singleton_method]
- *
- *     module M123; def m123; end end
- *     k.extend M123
- *     k.methods(false)   #=> [:singleton_method]
- */
-
 VALUE
-rb_obj_methods(int argc, const VALUE *argv, VALUE obj)
+class_private_instance_methods(argc, argv, mod)
+    int argc;
+    VALUE *argv;
+    VALUE mod;
 {
-    rb_check_arity(argc, 0, 1);
-    if (argc > 0 && !RTEST(argv[0])) {
-	return rb_obj_singleton_methods(argc, argv, obj);
-    }
-    return class_instance_method_list(argc, argv, CLASS_OF(obj), 1, ins_methods_i);
-}
+    VALUE option;
 
-/*
- *  call-seq:
- *     obj.protected_methods(all=true)   -> array
- *
- *  Returns the list of protected methods accessible to <i>obj</i>. If
- *  the <i>all</i> parameter is set to <code>false</code>, only those methods
- *  in the receiver will be listed.
- */
-
-VALUE
-rb_obj_protected_methods(int argc, const VALUE *argv, VALUE obj)
-{
-    return class_instance_method_list(argc, argv, CLASS_OF(obj), 1, ins_methods_prot_i);
-}
-
-/*
- *  call-seq:
- *     obj.private_methods(all=true)   -> array
- *
- *  Returns the list of private methods accessible to <i>obj</i>. If
- *  the <i>all</i> parameter is set to <code>false</code>, only those methods
- *  in the receiver will be listed.
- */
-
-VALUE
-rb_obj_private_methods(int argc, const VALUE *argv, VALUE obj)
-{
-    return class_instance_method_list(argc, argv, CLASS_OF(obj), 1, ins_methods_priv_i);
+    rb_scan_args(argc, argv, "01", &option);
+    return method_list(mod, RTEST(option), ins_methods_priv_i);
 }
 
-/*
- *  call-seq:
- *     obj.public_methods(all=true)   -> array
- *
- *  Returns the list of public methods accessible to <i>obj</i>. If
- *  the <i>all</i> parameter is set to <code>false</code>, only those methods
- *  in the receiver will be listed.
- */
-
 VALUE
-rb_obj_public_methods(int argc, const VALUE *argv, VALUE obj)
+obj_singleton_methods(obj)
+    VALUE obj;
 {
-    return class_instance_method_list(argc, argv, CLASS_OF(obj), 1, ins_methods_pub_i);
-}
-
-/*
- *  call-seq:
- *     obj.singleton_methods(all=true)    -> array
- *
- *  Returns an array of the names of singleton methods for <i>obj</i>.
- *  If the optional <i>all</i> parameter is true, the list will include
- *  methods in modules included in <i>obj</i>.
- *  Only public and protected singleton methods are returned.
- *
- *     module Other
- *       def three() end
- *     end
- *
- *     class Single
- *       def Single.four() end
- *     end
- *
- *     a = Single.new
- *
- *     def a.one()
- *     end
- *
- *     class << a
- *       include Other
- *       def two()
- *       end
- *     end
- *
- *     Single.singleton_methods    #=> [:four]
- *     a.singleton_methods(false)  #=> [:two, :one]
- *     a.singleton_methods         #=> [:two, :one, :three]
- */
-
-VALUE
-rb_obj_singleton_methods(int argc, const VALUE *argv, VALUE obj)
-{
-    VALUE recur, ary, klass, origin;
-    struct method_entry_arg me_arg;
-    struct rb_id_table *mtbl;
+    VALUE ary;
+    VALUE klass;
+    VALUE *p, *q, *pend;
 
-    if (argc == 0) {
-	recur = Qtrue;
-    }
-    else {
-	rb_scan_args(argc, argv, "01", &recur);
-    }
+    ary = ary_new();
     klass = CLASS_OF(obj);
-    origin = RCLASS_ORIGIN(klass);
-    me_arg.list = st_init_numtable();
-    me_arg.recur = RTEST(recur);
-    if (klass && FL_TEST(klass, FL_SINGLETON)) {
-	if ((mtbl = RCLASS_M_TBL(origin)) != 0) rb_id_table_foreach(mtbl, method_entry_i, &me_arg);
-	klass = RCLASS_SUPER(klass);
+    while (klass && FL_TEST(klass, FL_SINGLETON)) {
+	st_foreach(RCLASS(klass)->m_tbl, ins_methods_i, ary);
+	klass = RCLASS(klass)->super;
     }
-    if (RTEST(recur)) {
-	while (klass && (FL_TEST(klass, FL_SINGLETON) || RB_TYPE_P(klass, T_ICLASS))) {
-	    if (klass != origin && (mtbl = RCLASS_M_TBL(klass)) != 0) rb_id_table_foreach(mtbl, method_entry_i, &me_arg);
-	    klass = RCLASS_SUPER(klass);
+    p = q = RARRAY(ary)->ptr; pend = p + RARRAY(ary)->len;
+    while (p < pend) {
+	if (*p == Qnil) {
+	    p+=2;
+	    continue;
 	}
+	*q++ = *p++;
     }
-    ary = rb_ary_new();
-    st_foreach(me_arg.list, ins_methods_i, ary);
-    st_free_table(me_arg.list);
+    RARRAY(ary)->len = q - RARRAY(ary)->ptr;
 
     return ary;
 }
 
-/*!
- * \}
- */
-/*!
- * \defgroup defmethod Defining methods
- * There are some APIs to define a method from C.
- * These API takes a C function as a method body.
- *
- * \par Method body functions
- * Method body functions must return a VALUE and
- * can be one of the following form:
- * <dl>
- * <dt>Fixed number of parameters</dt>
- * <dd>
- *     This form is a normal C function, excepting it takes
- *     a receiver object as the first argument.
- *
- *     \code
- *     static VALUE my_method(VALUE self, VALUE x, VALUE y);
- *     \endcode
- * </dd>
- * <dt>argc and argv style</dt>
- * <dd>
- *     This form takes three parameters: \a argc, \a argv and \a self.
- *     \a self is the receiver. \a argc is the number of arguments.
- *     \a argv is a pointer to an array of the arguments.
- *
- *     \code
- *     static VALUE my_method(int argc, VALUE *argv, VALUE self);
- *     \endcode
- * </dd>
- * <dt>Ruby array style</dt>
- * <dd>
- *     This form takes two parameters: self and args.
- *     \a self is the receiver. \a args is an Array object which
- *     contains the arguments.
- *
- *     \code
- *     static VALUE my_method(VALUE self, VALUE args);
- *     \endcode
- * </dd>
- *
- * \par Number of parameters
- * Method defining APIs takes the number of parameters which the
- * method will takes. This number is called \a argc.
- * \a argc can be:
- * <dl>
- * <dt>zero or positive number</dt>
- * <dd>This means the method body function takes a fixed number of parameters</dd>
- * <dt>-1</dt>
- * <dd>This means the method body function is "argc and argv" style.</dd>
- * <dt>-2</dt>
- * <dd>This means the method body function is "self and args" style.</dd>
- * </dl>
- * \{
- */
-
 void
-rb_define_method_id(VALUE klass, ID mid, VALUE (*func)(ANYARGS), int argc)
+rb_define_method_id(klass, name, func, argc)
+    VALUE klass;
+    ID name;
+    VALUE (*func)();
+    int argc;
 {
-    rb_add_method_cfunc(klass, mid, func, argc, METHOD_VISI_PUBLIC);
+    rb_add_method(klass, name, NEW_CFUNC(func,argc), NOEX_PUBLIC|NOEX_CFUNC);
 }
 
 void
-rb_define_method(VALUE klass, const char *name, VALUE (*func)(ANYARGS), int argc)
+rb_define_method(klass, name, func, argc)
+    VALUE klass;
+    char *name;
+    VALUE (*func)();
+    int argc;
 {
-    rb_add_method_cfunc(klass, rb_intern(name), func, argc, METHOD_VISI_PUBLIC);
-}
+    ID id = rb_intern(name);
 
-void
-rb_define_protected_method(VALUE klass, const char *name, VALUE (*func)(ANYARGS), int argc)
-{
-    rb_add_method_cfunc(klass, rb_intern(name), func, argc, METHOD_VISI_PROTECTED);
+    rb_add_method(klass, id, NEW_CFUNC(func, argc), 
+		  ((name[0] == 'i' && id == rb_intern("initialize"))?
+		   NOEX_PRIVATE:NOEX_PUBLIC)|NOEX_CFUNC);
 }
 
 void
-rb_define_private_method(VALUE klass, const char *name, VALUE (*func)(ANYARGS), int argc)
+rb_define_protected_method(klass, name, func, argc)
+    VALUE klass;
+    char *name;
+    VALUE (*func)();
+    int argc;
 {
-    rb_add_method_cfunc(klass, rb_intern(name), func, argc, METHOD_VISI_PRIVATE);
+    rb_add_method(klass, rb_intern(name), NEW_CFUNC(func, argc),
+		  NOEX_PROTECTED|NOEX_CFUNC);
 }
 
 void
-rb_undef_method(VALUE klass, const char *name)
-{
-    rb_add_method(klass, rb_intern(name), VM_METHOD_TYPE_UNDEF, 0, METHOD_VISI_UNDEF);
-}
-
-/*!
- * \}
- */
-/*!
- * \addtogroup class
- * \{
- */
-
-#define SPECIAL_SINGLETON(x,c) do {\
-    if (obj == (x)) {\
-	return (c);\
-    }\
-} while (0)
-
-static inline VALUE
-special_singleton_class_of(VALUE obj)
-{
-    SPECIAL_SINGLETON(Qnil, rb_cNilClass);
-    SPECIAL_SINGLETON(Qfalse, rb_cFalseClass);
-    SPECIAL_SINGLETON(Qtrue, rb_cTrueClass);
-    return Qnil;
-}
-
-VALUE
-rb_special_singleton_class(VALUE obj)
-{
-    return special_singleton_class_of(obj);
-}
-
-/*!
- * \internal
- * Returns the singleton class of \a obj. Creates it if necessary.
- *
- * \note DO NOT expose the returned singleton class to
- *       outside of class.c.
- *       Use \ref rb_singleton_class instead for
- *       consistency of the metaclass hierarchy.
- */
-static VALUE
-singleton_class_of(VALUE obj)
-{
+rb_define_private_method(klass, name, func, argc)
     VALUE klass;
-
-    if (FIXNUM_P(obj) || FLONUM_P(obj) || STATIC_SYM_P(obj)) {
-      no_singleton:
-	rb_raise(rb_eTypeError, "can't define singleton");
-    }
-    if (SPECIAL_CONST_P(obj)) {
-	klass = special_singleton_class_of(obj);
-	if (NIL_P(klass))
-	    rb_bug("unknown immediate %p", (void *)obj);
-	return klass;
-    }
-    else {
-	switch (BUILTIN_TYPE(obj)) {
-	  case T_FLOAT: case T_BIGNUM: case T_SYMBOL:
-	    goto no_singleton;
-	}
-    }
-
-    klass = RBASIC(obj)->klass;
-    if (!(FL_TEST(klass, FL_SINGLETON) &&
-	  rb_ivar_get(klass, id_attached) == obj)) {
-	klass = rb_make_metaclass(obj, klass);
-    }
-
-    if (OBJ_TAINTED(obj)) {
-	OBJ_TAINT(klass);
-    }
-    else {
-	FL_UNSET(klass, FL_TAINT);
-    }
-    if (OBJ_FROZEN(obj)) OBJ_FREEZE_RAW(klass);
-
-    return klass;
+    char *name;
+    VALUE (*func)();
+    int argc;
+{
+    rb_add_method(klass, rb_intern(name), NEW_CFUNC(func, argc),
+		  NOEX_PRIVATE|NOEX_CFUNC);
 }
 
 void
-rb_freeze_singleton_class(VALUE x)
+rb_undef_method(klass, name)
+    VALUE klass;
+    char *name;
 {
-    /* should not propagate to meta-meta-class, and so on */
-    if (!(RBASIC(x)->flags & FL_SINGLETON)) {
-	VALUE klass = RBASIC_CLASS(x);
-	if (klass && (klass = RCLASS_ORIGIN(klass)) != 0 &&
-	    FL_TEST(klass, (FL_SINGLETON|FL_FREEZE)) == FL_SINGLETON) {
-	    OBJ_FREEZE_RAW(klass);
-	}
-    }
+    rb_add_method(klass, rb_intern(name), 0, NOEX_UNDEF);
 }
 
-/*!
- * Returns the singleton class of \a obj, or nil if obj is not a
- * singleton object.
- *
- * \param obj an arbitrary object.
- * \return the singleton class or nil.
- */
 VALUE
-rb_singleton_class_get(VALUE obj)
+rb_singleton_class(obj)
+    VALUE obj;
 {
-    VALUE klass;
-
-    if (SPECIAL_CONST_P(obj)) {
-	return rb_special_singleton_class(obj);
+    if (rb_special_const_p(obj)) {
+	TypeError("cannot define singleton");
     }
-    klass = RBASIC(obj)->klass;
-    if (!FL_TEST(klass, FL_SINGLETON)) return Qnil;
-    if (rb_ivar_get(klass, id_attached) != obj) return Qnil;
-    return klass;
-}
-
-/*!
- * Returns the singleton class of \a obj. Creates it if necessary.
- *
- * \param obj an arbitrary object.
- * \throw TypeError if \a obj is a Fixnum or a Symbol.
- * \return the singleton class.
- *
- * \post \a obj has its own singleton class.
- * \post if \a obj is a class,
- *       the returned singleton class also has its own
- *       singleton class in order to keep consistency of the
- *       inheritance structure of metaclasses.
- * \note a new singleton class will be created
- *       if \a obj does not have it.
- * \note the singleton classes for nil, true and false are:
- *       NilClass, TrueClass and FalseClass.
- */
-VALUE
-rb_singleton_class(VALUE obj)
-{
-    VALUE klass = singleton_class_of(obj);
-
-    /* ensures an exposed class belongs to its own eigenclass */
-    if (RB_TYPE_P(obj, T_CLASS)) (void)ENSURE_EIGENCLASS(klass);
-
-    return klass;
+    if (FL_TEST(RBASIC(obj)->klass, FL_SINGLETON)) {
+	return RBASIC(obj)->klass;
+    }
+    RBASIC(obj)->klass = singleton_class_new(RBASIC(obj)->klass);
+    singleton_class_attached(RBASIC(obj)->klass, obj);
+    return RBASIC(obj)->klass;
 }
 
-/*!
- * \}
- */
-
-/*!
- * \addtogroup defmethod
- * \{
- */
-
-/*!
- * Defines a singleton method for \a obj.
- * \param obj    an arbitrary object
- * \param name   name of the singleton method
- * \param func   the method body
- * \param argc   the number of parameters, or -1 or -2. see \ref defmethod.
- */
 void
-rb_define_singleton_method(VALUE obj, const char *name, VALUE (*func)(ANYARGS), int argc)
+rb_define_singleton_method(obj, name, func, argc)
+    VALUE obj;
+    char *name;
+    VALUE (*func)();
+    int argc;
 {
-    rb_define_method(singleton_class_of(obj), name, func, argc);
+    rb_define_method(rb_singleton_class(obj), name, func, argc);
 }
 
-
-
-/*!
- * Defines a module function for \a module.
- * \param module  an module or a class.
- * \param name    name of the function
- * \param func    the method body
- * \param argc    the number of parameters, or -1 or -2. see \ref defmethod.
- */
 void
-rb_define_module_function(VALUE module, const char *name, VALUE (*func)(ANYARGS), int argc)
+rb_define_module_function(module, name, func, argc)
+    VALUE module;
+    char *name;
+    VALUE (*func)();
+    int argc;
 {
     rb_define_private_method(module, name, func, argc);
     rb_define_singleton_method(module, name, func, argc);
 }
 
+extern VALUE mKernel;
 
-/*!
- * Defines a global function
- * \param name    name of the function
- * \param func    the method body
- * \param argc    the number of parameters, or -1 or -2. see \ref defmethod.
- */
 void
-rb_define_global_function(const char *name, VALUE (*func)(ANYARGS), int argc)
+rb_define_global_function(name, func, argc)
+    char *name;
+    VALUE (*func)();
+    int argc;
 {
-    rb_define_module_function(rb_mKernel, name, func, argc);
+    rb_define_private_method(mKernel, name, func, argc);
 }
 
-
-/*!
- * Defines an alias of a method.
- * \param klass  the class which the original method belongs to
- * \param name1  a new name for the method
- * \param name2  the original name of the method
- */
 void
-rb_define_alias(VALUE klass, const char *name1, const char *name2)
+rb_define_alias(klass, name1, name2)
+    VALUE klass;
+    char *name1, *name2;
 {
     rb_alias(klass, rb_intern(name1), rb_intern(name2));
 }
 
-/*!
- * Defines (a) public accessor method(s) for an attribute.
- * \param klass  the class which the attribute will belongs to
- * \param name   name of the attribute
- * \param read   a getter method for the attribute will be defined if \a read is non-zero.
- * \param write  a setter method for the attribute will be defined if \a write is non-zero.
- */
 void
-rb_define_attr(VALUE klass, const char *name, int read, int write)
+rb_define_attr(klass, name, read, write)
+    VALUE klass;
+    char *name;
+    int read, write;
 {
     rb_attr(klass, rb_intern(name), read, write, FALSE);
 }
 
-int
-rb_obj_basic_to_s_p(VALUE obj)
-{
-    const rb_method_entry_t *me = rb_method_entry(CLASS_OF(obj), rb_intern("to_s"));
-    if (me && me->def && me->def->type == VM_METHOD_TYPE_CFUNC &&
-	me->def->body.cfunc.func == rb_any_to_s)
-	return 1;
-    return 0;
-}
-
+#ifdef HAVE_STDARG_PROTOTYPES
 #include <stdarg.h>
+#define va_init_list(a,b) va_start(a,b)
+#else
+#include <varargs.h>
+#define va_init_list(a,b) va_start(a)
+#endif
+#include <ctype.h>
 
 int
-rb_scan_args(int argc, const VALUE *argv, const char *fmt, ...)
-{
-    int i;
-    const char *p = fmt;
+#ifdef HAVE_STDARG_PROTOTYPES
+rb_scan_args(int argc, VALUE *argv, char *fmt, ...)
+#else
+rb_scan_args(argc, argv, fmt, va_alist)
+    int argc;
+    VALUE *argv;
+    char *fmt;
+    va_dcl
+#endif
+{
+    int n, i;
+    char *p = fmt;
     VALUE *var;
     va_list vargs;
-    int f_var = 0, f_hash = 0, f_block = 0;
-    int n_lead = 0, n_opt = 0, n_trail = 0, n_mand;
-    int argi = 0;
-    VALUE hash = Qnil;
 
-    if (ISDIGIT(*p)) {
-	n_lead = *p - '0';
-	p++;
-	if (ISDIGIT(*p)) {
-	    n_opt = *p - '0';
-	    p++;
-	    if (ISDIGIT(*p)) {
-		n_trail = *p - '0';
-		p++;
-		goto block_arg;
-	    }
-	}
-    }
+    va_init_list(vargs, fmt);
+
     if (*p == '*') {
-	f_var = 1;
-	p++;
-	if (ISDIGIT(*p)) {
-	    n_trail = *p - '0';
-	    p++;
-	}
+	var = va_arg(vargs, VALUE*);
+	*var = ary_new4(argc, argv);
+	return argc;
     }
-  block_arg:
-    if (*p == ':') {
-	f_hash = 1;
-	p++;
-    }
-    if (*p == '&') {
-	f_block = 1;
+
+    if (isdigit(*p)) {
+	n = *p - '0';
+	if (n > argc)
+	    ArgError("Wrong # of arguments (%d for %d)", argc, n);
+	for (i=0; i<n; i++) {
+	    var = va_arg(vargs, VALUE*);
+	    *var = argv[i];
+	}
 	p++;
     }
-    if (*p != '\0') {
-	rb_fatal("bad scan arg format: %s", fmt);
+    else {
+	goto error;
     }
-    n_mand = n_lead + n_trail;
-
-    if (argc < n_mand)
-	goto argc_error;
-
-    va_start(vargs, fmt);
-
-    /* capture an option hash - phase 1: pop */
-    if (f_hash && n_mand < argc) {
-	VALUE last = argv[argc - 1];
 
-	if (NIL_P(last)) {
-	    /* nil is taken as an empty option hash only if it is not
-	       ambiguous; i.e. '*' is not specified and arguments are
-	       given more than sufficient */
-	    if (!f_var && n_mand + n_opt < argc)
-		argc--;
-	}
-	else {
-	    hash = rb_check_hash_type(last);
-	    if (!NIL_P(hash)) {
-		VALUE opts = rb_extract_keywords(&hash);
-		if (!hash) argc--;
-		hash = opts ? opts : Qnil;
+    if (isdigit(*p)) {
+	n = i + *p - '0';
+	for (; i<n; i++) {
+	    var = va_arg(vargs, VALUE*);
+	    if (argc > i) {
+		*var = argv[i];
+	    }
+	    else {
+		*var = Qnil;
 	    }
 	}
+	p++;
     }
-    /* capture leading mandatory arguments */
-    for (i = n_lead; i-- > 0; ) {
-	var = va_arg(vargs, VALUE *);
-	if (var) *var = argv[argi];
-	argi++;
-    }
-    /* capture optional arguments */
-    for (i = n_opt; i-- > 0; ) {
-	var = va_arg(vargs, VALUE *);
-	if (argi < argc - n_trail) {
-	    if (var) *var = argv[argi];
-	    argi++;
-	}
-	else {
-	    if (var) *var = Qnil;
-	}
-    }
-    /* capture variable length arguments */
-    if (f_var) {
-	int n_var = argc - argi - n_trail;
-
-	var = va_arg(vargs, VALUE *);
-	if (0 < n_var) {
-	    if (var) *var = rb_ary_new4(n_var, &argv[argi]);
-	    argi += n_var;
+
+    if(*p == '*') {
+	var = va_arg(vargs, VALUE*);
+	if (argc > i) {
+	    *var = ary_new4(argc-i, argv+i);
 	}
 	else {
-	    if (var) *var = rb_ary_new();
+	    *var = ary_new();
 	}
     }
-    /* capture trailing mandatory arguments */
-    for (i = n_trail; i-- > 0; ) {
-	var = va_arg(vargs, VALUE *);
-	if (var) *var = argv[argi];
-	argi++;
-    }
-    /* capture an option hash - phase 2: assignment */
-    if (f_hash) {
-	var = va_arg(vargs, VALUE *);
-	if (var) *var = hash;
-    }
-    /* capture iterator block */
-    if (f_block) {
-	var = va_arg(vargs, VALUE *);
-	if (rb_block_given_p()) {
-	    *var = rb_block_proc();
-	}
-	else {
-	    *var = Qnil;
+    else if (*p == '\0') {
+	if (argc > i) {
+	    ArgError("Wrong # of arguments(%d for %d)", argc, i);
 	}
     }
-    va_end(vargs);
-
-    if (argi < argc) {
-      argc_error:
-	rb_error_arity(argc, n_mand, f_var ? UNLIMITED_ARGUMENTS : n_mand + n_opt);
-    }
-
-    return argc;
-}
-
-VALUE
-rb_keyword_error_new(const char *error, VALUE keys)
-{
-    const char *msg = "";
-    VALUE error_message;
-
-    if (RARRAY_LEN(keys) == 1) {
-	keys = RARRAY_AREF(keys, 0);
-    }
     else {
-	keys = rb_ary_join(keys, rb_usascii_str_new2(", "));
-	msg = "s";
+	goto error;
     }
 
-    error_message = rb_sprintf("%s keyword%s: %"PRIsVALUE, error, msg, keys);
-
-    return rb_exc_new_str(rb_eArgError, error_message);
-}
-
-NORETURN(static void rb_keyword_error(const char *error, VALUE keys));
-static void
-rb_keyword_error(const char *error, VALUE keys)
-{
-    rb_exc_raise(rb_keyword_error_new(error, keys));
-}
-
-NORETURN(static void unknown_keyword_error(VALUE hash, const ID *table, int keywords));
-static void
-unknown_keyword_error(VALUE hash, const ID *table, int keywords)
-{
-    st_table *tbl = rb_hash_tbl_raw(hash);
-    VALUE keys;
-    int i;
-    for (i = 0; i < keywords; i++) {
-	st_data_t key = ID2SYM(table[i]);
-	st_delete(tbl, &key, NULL);
-    }
-    keys = rb_funcallv(hash, rb_intern("keys"), 0, 0);
-    if (!RB_TYPE_P(keys, T_ARRAY)) rb_raise(rb_eArgError, "unknown keyword");
-    rb_keyword_error("unknown", keys);
-}
-
-static int
-separate_symbol(st_data_t key, st_data_t value, st_data_t arg)
-{
-    VALUE *kwdhash = (VALUE *)arg;
-
-    if (!SYMBOL_P(key)) kwdhash++;
-    if (!*kwdhash) *kwdhash = rb_hash_new();
-    rb_hash_aset(*kwdhash, (VALUE)key, (VALUE)value);
-    return ST_CONTINUE;
-}
-
-VALUE
-rb_extract_keywords(VALUE *orighash)
-{
-    VALUE parthash[2] = {0, 0};
-    VALUE hash = *orighash;
-
-    if (RHASH_EMPTY_P(hash)) {
-	*orighash = 0;
-	return hash;
-    }
-    st_foreach(rb_hash_tbl_raw(hash), separate_symbol, (st_data_t)&parthash);
-    *orighash = parthash[1];
-    return parthash[0];
-}
-
-int
-rb_get_kwargs(VALUE keyword_hash, const ID *table, int required, int optional, VALUE *values)
-{
-    int i = 0, j;
-    int rest = 0;
-    VALUE missing = Qnil;
-    st_data_t key;
-
-#define extract_kwarg(keyword, val) \
-    (key = (st_data_t)(keyword), values ? \
-     st_delete(rb_hash_tbl_raw(keyword_hash), &key, (val)) : \
-     st_lookup(rb_hash_tbl_raw(keyword_hash), key, (val)))
-
-    if (NIL_P(keyword_hash)) keyword_hash = 0;
-
-    if (optional < 0) {
-	rest = 1;
-	optional = -1-optional;
-    }
-    if (values) {
-	for (j = 0; j < required + optional; j++) {
-	    values[j] = Qundef;
-	}
-    }
-    if (required) {
-	for (; i < required; i++) {
-	    VALUE keyword = ID2SYM(table[i]);
-	    if (keyword_hash) {
-		st_data_t val;
-		if (extract_kwarg(keyword, &val)) {
-		    if (values) values[i] = (VALUE)val;
-		    continue;
-		}
-	    }
-	    if (NIL_P(missing)) missing = rb_ary_tmp_new(1);
-	    rb_ary_push(missing, keyword);
-	}
-	if (!NIL_P(missing)) {
-	    rb_keyword_error("missing", missing);
-	}
-    }
-    j = i;
-    if (optional && keyword_hash) {
-	for (i = 0; i < optional; i++) {
-	    st_data_t val;
-	    if (extract_kwarg(ID2SYM(table[required+i]), &val)) {
-		if (values) values[required+i] = (VALUE)val;
-		j++;
-	    }
-	}
-    }
-    if (!rest && keyword_hash) {
-	if (RHASH_SIZE(keyword_hash) > (unsigned int)j) {
-	    unknown_keyword_error(keyword_hash, table, required+optional);
-	}
-    }
-    return j;
-#undef extract_kwarg
-}
+    va_end(vargs);
+    return argc;
 
-int
-rb_class_has_methods(VALUE c)
-{
-    return rb_id_table_size(RCLASS_M_TBL(c)) == 0 ? FALSE : TRUE;
+  error:
+    Fatal("bad scan arg format: %s", fmt);
+    return 0;
 }
-
-/*!
- * \}
- */
diff --git a/common.mk b/common.mk
deleted file mode 100644
index 602c3f7f0f..0000000000
--- a/common.mk
+++ /dev/null
@@ -1,2505 +0,0 @@
-bin: $(PROGRAM) $(WPROGRAM)
-lib: $(LIBRUBY)
-dll: $(LIBRUBY_SO)
-
-.SUFFIXES: .inc .h .c .y .i .$(DTRACE_EXT)
-
-# V=0 quiet, V=1 verbose.  other values don't work.
-V = 0
-Q1 = $(V:1=)
-Q = $(Q1:0=@)
-ECHO0 = $(ECHO1:0=echo)
-ECHO = @$(ECHO0)
-
-UNICODE_VERSION = 8.0.0
-
-RUBYLIB       = $(PATH_SEPARATOR)
-RUBYOPT       = -
-RUN_OPTS      = --disable-gems
-
-GEM_HOME =
-GEM_PATH =
-GEM_VENDOR =
-
-SPEC_GIT_BASE = git://github.com/ruby
-MSPEC_GIT_URL = $(SPEC_GIT_BASE)/mspec.git
-RUBYSPEC_GIT_URL = $(SPEC_GIT_BASE)/rubyspec.git
-
-SIMPLECOV_GIT_URL = git://github.com/colszowka/simplecov.git
-SIMPLECOV_GIT_REF = v0.10.0
-SIMPLECOV_HTML_GIT_URL = git://github.com/colszowka/simplecov-html.git
-SIMPLECOV_HTML_GIT_REF = v0.10.0
-DOCLIE_GIT_URL = git://github.com/ms-ati/docile.git
-DOCLIE_GIT_REF = v1.1.5
-
-STATIC_RUBY   = static-ruby
-
-EXTCONF       = extconf.rb
-LIBRUBY_EXTS  = ./.libruby-with-ext.time
-REVISION_H    = ./.revision.time
-PLATFORM_D    = ./$(PLATFORM_DIR)/.time
-ENC_TRANS_D   = ./enc/trans/.time
-RDOCOUT       = $(EXTOUT)/rdoc
-HTMLOUT       = $(EXTOUT)/html
-CAPIOUT       = doc/capi
-
-INITOBJS      = dmyext.$(OBJEXT) dmyenc.$(OBJEXT)
-NORMALMAINOBJ = main.$(OBJEXT)
-MAINOBJ       = $(NORMALMAINOBJ)
-DLDOBJS	      = $(INITOBJS)
-EXTSOLIBS     =
-MINIOBJS      = $(ARCHMINIOBJS) miniinit.$(OBJEXT) dmyext.$(OBJEXT) miniprelude.$(OBJEXT)
-ENC_MK        = enc.mk
-
-COMMONOBJS    = array.$(OBJEXT) \
-		bignum.$(OBJEXT) \
-		class.$(OBJEXT) \
-		compar.$(OBJEXT) \
-		complex.$(OBJEXT) \
-		dir.$(OBJEXT) \
-		dln_find.$(OBJEXT) \
-		encoding.$(OBJEXT) \
-		enum.$(OBJEXT) \
-		enumerator.$(OBJEXT) \
-		error.$(OBJEXT) \
-		eval.$(OBJEXT) \
-		load.$(OBJEXT) \
-		proc.$(OBJEXT) \
-		file.$(OBJEXT) \
-		gc.$(OBJEXT) \
-		hash.$(OBJEXT) \
-		inits.$(OBJEXT) \
-		io.$(OBJEXT) \
-		marshal.$(OBJEXT) \
-		math.$(OBJEXT) \
-		node.$(OBJEXT) \
-		numeric.$(OBJEXT) \
-		object.$(OBJEXT) \
-		pack.$(OBJEXT) \
-		parse.$(OBJEXT) \
-		process.$(OBJEXT) \
-		random.$(OBJEXT) \
-		range.$(OBJEXT) \
-		rational.$(OBJEXT) \
-		re.$(OBJEXT) \
-		regcomp.$(OBJEXT) \
-		regenc.$(OBJEXT) \
-		regerror.$(OBJEXT) \
-		regexec.$(OBJEXT) \
-		regparse.$(OBJEXT) \
-		regsyntax.$(OBJEXT) \
-		ruby.$(OBJEXT) \
-		safe.$(OBJEXT) \
-		signal.$(OBJEXT) \
-		sprintf.$(OBJEXT) \
-		st.$(OBJEXT) \
-		strftime.$(OBJEXT) \
-		string.$(OBJEXT) \
-		struct.$(OBJEXT) \
-		symbol.$(OBJEXT) \
-		time.$(OBJEXT) \
-		transcode.$(OBJEXT) \
-		util.$(OBJEXT) \
-		variable.$(OBJEXT) \
-		version.$(OBJEXT) \
-		compile.$(OBJEXT) \
-		debug.$(OBJEXT) \
-		iseq.$(OBJEXT) \
-		vm.$(OBJEXT) \
-		vm_dump.$(OBJEXT) \
-		vm_backtrace.$(OBJEXT) \
-		vm_trace.$(OBJEXT) \
-		thread.$(OBJEXT) \
-		cont.$(OBJEXT) \
-		$(DTRACE_OBJ) \
-		$(BUILTIN_ENCOBJS) \
-		$(BUILTIN_TRANSOBJS) \
-		$(MISSING)
-
-EXPORTOBJS    = $(DLNOBJ) \
-		localeinit.$(OBJEXT) \
-		loadpath.$(OBJEXT) \
-		$(COMMONOBJS)
-
-OBJS          = $(EXPORTOBJS) prelude.$(OBJEXT)
-ALLOBJS       = $(NORMALMAINOBJ) $(MINIOBJS) $(COMMONOBJS) $(INITOBJS)
-
-GOLFOBJS      = goruby.$(OBJEXT) golf_prelude.$(OBJEXT)
-
-DEFAULT_PRELUDES = $(GEM_PRELUDE)
-PRELUDE_SCRIPTS = $(srcdir)/prelude.rb $(srcdir)/enc/prelude.rb $(DEFAULT_PRELUDES)
-GEM_PRELUDE   = $(srcdir)/gem_prelude.rb
-PRELUDES      = {$(srcdir)}prelude.c {$(srcdir)}miniprelude.c
-GOLFPRELUDES  = {$(srcdir)}golf_prelude.c
-
-SCRIPT_ARGS   =	--dest-dir="$(DESTDIR)" \
-		--extout="$(EXTOUT)" \
-		--mflags="$(MFLAGS)" \
-		--make-flags="$(MAKEFLAGS)"
-EXTMK_ARGS    =	$(SCRIPT_ARGS) --extension $(EXTS) --extstatic $(EXTSTATIC) \
-		--make-flags="V=$(V) MINIRUBY='$(MINIRUBY)'" --gnumake=$(gnumake) \
-		--
-INSTRUBY      =	$(SUDO) $(RUNRUBY) -r./$(arch)-fake $(srcdir)/tool/rbinstall.rb
-INSTRUBY_ARGS =	$(SCRIPT_ARGS) \
-		--data-mode=$(INSTALL_DATA_MODE) \
-		--prog-mode=$(INSTALL_PROG_MODE) \
-		--installed-list $(INSTALLED_LIST) \
-		--mantype="$(MANTYPE)"
-INSTALL_PROG_MODE = 0755
-INSTALL_DATA_MODE = 0644
-
-PRE_LIBRUBY_UPDATE = $(MINIRUBY) -e 'ARGV[1] or File.unlink(ARGV[0]) rescue nil' -- \
-			$(LIBRUBY_EXTS) $(LIBRUBY_SO_UPDATE)
-
-TESTSDIR      = $(srcdir)/test
-TEST_EXCLUDES = --excludes=$(TESTSDIR)/excludes -x /memory_leak/
-EXCLUDE_TESTFRAMEWORK = -x /testunit/ -x /minitest/
-TESTWORKDIR   = testwork
-TESTOPTS      = $(RUBY_TESTOPTS)
-
-TESTRUN_SCRIPT = $(srcdir)/test.rb
-
-COMPILE_PRELUDE = $(srcdir)/tool/generic_erb.rb $(srcdir)/template/prelude.c.tmpl
-
-SHOWFLAGS = showflags
-
-all: $(SHOWFLAGS) main docs
-
-main: $(SHOWFLAGS) $(ENCSTATIC:static=lib)encs exts
-	@$(NULLCMD)
-
-.PHONY: showflags
-exts enc trans: $(SHOWFLAGS)
-showflags:
-	$(MESSAGE_BEGIN) \
-	"	CC = $(CC)" \
-	"	LD = $(LD)" \
-	"	LDSHARED = $(LDSHARED)" \
-	"	CFLAGS = $(CFLAGS)" \
-	"	XCFLAGS = $(XCFLAGS)" \
-	"	CPPFLAGS = $(CPPFLAGS)" \
-	"	DLDFLAGS = $(DLDFLAGS)" \
-	"	SOLIBS = $(SOLIBS)" \
-	$(MESSAGE_END)
-	-@$(CC_VERSION)
-
-.PHONY: showconfig
-showconfig:
-	@$(ECHO_BEGIN) \
-	$(configure_args) \
-	$(ECHO_END)
-
-exts: build-ext
-
-EXTS_MK = exts.mk
-$(EXTS_MK): $(MKFILES) all-incs $(PREP) $(RBCONFIG) $(LIBRUBY)
-	$(ECHO) generating makefile $@
-	$(Q)$(MINIRUBY) $(srcdir)/ext/extmk.rb --make="$(MAKE)" --command-output=$(EXTS_MK) $(EXTMK_ARGS) configure
-
-configure-ext: $(EXTS_MK)
-
-build-ext: $(EXTS_MK)
-	$(Q)$(MAKE) -f $(EXTS_MK) $(MFLAGS) libdir="$(libdir)" LIBRUBY_EXTS=$(LIBRUBY_EXTS) \
-	    ENCOBJS="$(ENCOBJS)" UPDATE_LIBRARIES=no $(EXTSTATIC)
-
-prog: program wprogram
-
-$(PREP): $(MKFILES)
-
-miniruby$(EXEEXT): config.status $(ALLOBJS) $(ARCHFILE)
-
-objs: $(ALLOBJS)
-
-GORUBY = go$(RUBY_INSTALL_NAME)
-golf: $(LIBRUBY) $(GOLFOBJS) PHONY
-	$(Q) $(MAKE) $(MFLAGS) MAINOBJ="$(GOLFOBJS)" PROGRAM=$(GORUBY)$(EXEEXT) program
-capi: $(CAPIOUT)/.timestamp PHONY
-
-$(CAPIOUT)/.timestamp: Doxyfile $(PREP)
-	$(Q) $(MAKEDIRS) "$(@D)"
-	$(ECHO) generating capi
-	-$(Q) $(DOXYGEN) -b
-	$(Q) $(MINIRUBY) -e 'File.open(ARGV[0], "w"){|f| f.puts(Time.now)}' "$@"
-
-Doxyfile: $(srcdir)/template/Doxyfile.tmpl $(PREP) $(srcdir)/tool/generic_erb.rb $(RBCONFIG)
-	$(ECHO) generating $@
-	$(Q) $(MINIRUBY) $(srcdir)/tool/generic_erb.rb -o $@ $(srcdir)/template/Doxyfile.tmpl \
-	--srcdir="$(srcdir)" --miniruby="$(MINIRUBY)"
-
-program: $(SHOWFLAGS) $(PROGRAM)
-wprogram: $(SHOWFLAGS) $(WPROGRAM)
-mini: PHONY miniruby$(EXEEXT)
-
-$(PROGRAM) $(WPROGRAM): $(LIBRUBY) $(MAINOBJ) $(OBJS) $(EXTOBJS) $(SETUP) $(PREP)
-
-$(LIBRUBY_A):	$(LIBRUBY_A_OBJS) $(MAINOBJ) $(INITOBJS) $(ARCHFILE)
-
-$(LIBRUBY_SO):	$(OBJS) $(DLDOBJS) $(LIBRUBY_A) $(PREP) $(LIBRUBY_SO_UPDATE) $(BUILTIN_ENCOBJS)
-
-$(LIBRUBY_EXTS):
-	@exit > $@
-
-$(STATIC_RUBY)$(EXEEXT): $(MAINOBJ) $(DLDOBJS) $(EXTOBJS) $(LIBRUBY_A)
-	$(Q)$(RM) $@
-	$(PURIFY) $(CC) $(MAINOBJ) $(DLDOBJS) $(EXTOBJS) $(LIBRUBY_A) $(MAINLIBS) $(EXTLIBS) $(LIBS) $(OUTFLAG)$@ $(LDFLAGS) $(XLDFLAGS)
-
-ruby.imp: $(COMMONOBJS)
-	$(Q)$(NM) -Pgp $(COMMONOBJS) | \
-	awk 'BEGIN{print "#!"}; $$2~/^[BDT]$$/&&$$1!~/^(Init_|ruby_static_id_|.*_threadptr_|\.)/{print $$1}' | \
-	sort -u -o $@
-
-install: install-$(INSTALLDOC)
-docs: $(DOCTARGETS)
-pkgconfig-data: $(ruby_pc)
-$(ruby_pc): $(srcdir)/template/ruby.pc.in config.status
-
-install-all: docs pre-install-all do-install-all post-install-all
-pre-install-all:: all pre-install-local pre-install-ext pre-install-doc
-do-install-all: pre-install-all
-	$(INSTRUBY) --make="$(MAKE)" $(INSTRUBY_ARGS) --install=all --rdoc-output="$(RDOCOUT)"
-post-install-all:: post-install-local post-install-ext post-install-doc
-	@$(NULLCMD)
-
-install-nodoc: pre-install-nodoc do-install-nodoc post-install-nodoc
-pre-install-nodoc:: pre-install-local pre-install-ext
-do-install-nodoc: main pre-install-nodoc
-	$(INSTRUBY) --make="$(MAKE)" $(INSTRUBY_ARGS)
-post-install-nodoc:: post-install-local post-install-ext
-
-install-local: pre-install-local do-install-local post-install-local
-pre-install-local:: pre-install-bin pre-install-lib pre-install-man
-do-install-local: $(PROGRAM) pre-install-local
-	$(INSTRUBY) --make="$(MAKE)" $(INSTRUBY_ARGS) --install=local
-post-install-local:: post-install-bin post-install-lib post-install-man
-
-install-ext: pre-install-ext do-install-ext post-install-ext
-pre-install-ext:: pre-install-ext-arch pre-install-ext-comm
-do-install-ext: exts pre-install-ext
-	$(INSTRUBY) --make="$(MAKE)" $(INSTRUBY_ARGS) --install=ext
-post-install-ext:: post-install-ext-arch post-install-ext-comm
-
-install-arch: pre-install-arch do-install-arch post-install-arch
-pre-install-arch:: pre-install-bin pre-install-ext-arch
-do-install-arch: main do-install-arch
-	$(INSTRUBY) --make="$(MAKE)" $(INSTRUBY_ARGS) --install=arch
-post-install-arch:: post-install-bin post-install-ext-arch
-
-install-comm: pre-install-comm do-install-comm post-install-comm
-pre-install-comm:: pre-install-lib pre-install-ext-comm pre-install-man
-do-install-comm: $(PREP) pre-install-comm
-	$(INSTRUBY) --make="$(MAKE)" $(INSTRUBY_ARGS) --install=lib --install=ext-comm --install=man
-post-install-comm:: post-install-lib post-install-ext-comm post-install-man
-
-install-bin: pre-install-bin do-install-bin post-install-bin
-pre-install-bin:: install-prereq
-do-install-bin: $(PROGRAM) pre-install-bin
-	$(INSTRUBY) --make="$(MAKE)" $(INSTRUBY_ARGS) --install=bin
-post-install-bin::
-	@$(NULLCMD)
-
-install-lib: pre-install-lib do-install-lib post-install-lib
-pre-install-lib:: install-prereq
-do-install-lib: $(PREP) pre-install-lib
-	$(INSTRUBY) --make="$(MAKE)" $(INSTRUBY_ARGS) --install=lib
-post-install-lib::
-	@$(NULLCMD)
-
-install-ext-comm: pre-install-ext-comm do-install-ext-comm post-install-ext-comm
-pre-install-ext-comm:: install-prereq
-do-install-ext-comm: exts pre-install-ext-comm
-	$(INSTRUBY) --make="$(MAKE)" $(INSTRUBY_ARGS) --install=ext-comm
-post-install-ext-comm::
-	@$(NULLCMD)
-
-install-ext-arch: pre-install-ext-arch do-install-ext-arch post-install-ext-arch
-pre-install-ext-arch:: install-prereq
-do-install-ext-arch: exts pre-install-ext-arch
-	$(INSTRUBY) --make="$(MAKE)" $(INSTRUBY_ARGS) --install=ext-arch
-post-install-ext-arch::
-	@$(NULLCMD)
-
-install-man: pre-install-man do-install-man post-install-man
-pre-install-man:: install-prereq
-do-install-man: $(PREP) pre-install-man
-	$(INSTRUBY) --make="$(MAKE)" $(INSTRUBY_ARGS) --install=man
-post-install-man::
-	@$(NULLCMD)
-
-install-capi: capi pre-install-capi do-install-capi post-install-capi
-pre-install-capi:: install-prereq
-do-install-capi: $(PREP) pre-install-capi
-	$(INSTRUBY) --make="$(MAKE)" $(INSTRUBY_ARGS) --install=capi
-post-install-capi::
-	@$(NULLCMD)
-
-what-where: no-install
-no-install: no-install-$(INSTALLDOC)
-what-where-all: no-install-all
-no-install-all: pre-no-install-all dont-install-all post-no-install-all
-pre-no-install-all:: pre-no-install-local pre-no-install-ext pre-no-install-doc
-dont-install-all: $(PROGRAM)
-	$(INSTRUBY) -n --make="$(MAKE)" $(INSTRUBY_ARGS) --install=all --rdoc-output="$(RDOCOUT)"
-post-no-install-all:: post-no-install-local post-no-install-ext post-no-install-doc
-	@$(NULLCMD)
-
-uninstall: $(INSTALLED_LIST) sudo-precheck
-	$(Q)$(SUDO) $(MINIRUBY) $(srcdir)/tool/rbuninstall.rb --destdir=$(DESTDIR) $(INSTALLED_LIST)
-
-reinstall: all uninstall install
-
-what-where-nodoc: no-install-nodoc
-no-install-nodoc: pre-no-install-nodoc dont-install-nodoc post-no-install-nodoc
-pre-no-install-nodoc:: pre-no-install-local pre-no-install-ext
-dont-install-nodoc:  $(PREP)
-	$(INSTRUBY) -n --make="$(MAKE)" $(INSTRUBY_ARGS)
-post-no-install-nodoc:: post-no-install-local post-no-install-ext
-
-what-where-local: no-install-local
-no-install-local: pre-no-install-local dont-install-local post-no-install-local
-pre-no-install-local:: pre-no-install-bin pre-no-install-lib pre-no-install-man
-dont-install-local: $(PREP)
-	$(INSTRUBY) -n --make="$(MAKE)" $(INSTRUBY_ARGS) --install=local
-post-no-install-local:: post-no-install-bin post-no-install-lib post-no-install-man
-
-what-where-ext: no-install-ext
-no-install-ext: pre-no-install-ext dont-install-ext post-no-install-ext
-pre-no-install-ext:: pre-no-install-ext-arch pre-no-install-ext-comm
-dont-install-ext: $(PREP)
-	$(INSTRUBY) -n --make="$(MAKE)" $(INSTRUBY_ARGS) --install=ext
-post-no-install-ext:: post-no-install-ext-arch post-no-install-ext-comm
-
-what-where-arch: no-install-arch
-no-install-arch: pre-no-install-arch dont-install-arch post-no-install-arch
-pre-no-install-arch:: pre-no-install-bin pre-no-install-ext-arch
-dont-install-arch: $(PREP)
-	$(INSTRUBY) -n --make="$(MAKE)" $(INSTRUBY_ARGS) --install=bin --install=ext-arch
-post-no-install-arch:: post-no-install-lib post-no-install-man post-no-install-ext-arch
-
-what-where-comm: no-install-comm
-no-install-comm: pre-no-install-comm dont-install-comm post-no-install-comm
-pre-no-install-comm:: pre-no-install-lib pre-no-install-ext-comm pre-no-install-man
-dont-install-comm: $(PREP)
-	$(INSTRUBY) -n --make="$(MAKE)" $(INSTRUBY_ARGS) --install=lib --install=ext-comm --install=man
-post-no-install-comm:: post-no-install-lib post-no-install-ext-comm post-no-install-man
-
-what-where-bin: no-install-bin
-no-install-bin: pre-no-install-bin dont-install-bin post-no-install-bin
-pre-no-install-bin:: install-prereq
-dont-install-bin: $(PREP)
-	$(INSTRUBY) -n --make="$(MAKE)" $(INSTRUBY_ARGS) --install=bin
-post-no-install-bin::
-	@$(NULLCMD)
-
-what-where-lib: no-install-lib
-no-install-lib: pre-no-install-lib dont-install-lib post-no-install-lib
-pre-no-install-lib:: install-prereq
-dont-install-lib: $(PREP)
-	$(INSTRUBY) -n --make="$(MAKE)" $(INSTRUBY_ARGS) --install=lib
-post-no-install-lib::
-	@$(NULLCMD)
-
-what-where-ext-comm: no-install-ext-comm
-no-install-ext-comm: pre-no-install-ext-comm dont-install-ext-comm post-no-install-ext-comm
-pre-no-install-ext-comm:: install-prereq
-dont-install-ext-comm: $(PREP)
-	$(INSTRUBY) -n --make="$(MAKE)" $(INSTRUBY_ARGS) --install=ext-comm
-post-no-install-ext-comm::
-	@$(NULLCMD)
-
-what-where-ext-arch: no-install-ext-arch
-no-install-ext-arch: pre-no-install-ext-arch dont-install-ext-arch post-no-install-ext-arch
-pre-no-install-ext-arch:: install-prereq
-dont-install-ext-arch: $(PREP)
-	$(INSTRUBY) -n --make="$(MAKE)" $(INSTRUBY_ARGS) --install=ext-arch
-post-no-install-ext-arch::
-	@$(NULLCMD)
-
-what-where-man: no-install-man
-no-install-man: pre-no-install-man dont-install-man post-no-install-man
-pre-no-install-man:: install-prereq
-dont-install-man: $(PREP)
-	$(INSTRUBY) -n --make="$(MAKE)" $(INSTRUBY_ARGS) --install=man
-post-no-install-man::
-	@$(NULLCMD)
-
-install-doc: rdoc pre-install-doc do-install-doc post-install-doc
-pre-install-doc:: install-prereq
-do-install-doc: $(PROGRAM) pre-install-doc
-	$(INSTRUBY) --make="$(MAKE)" $(INSTRUBY_ARGS) --install=rdoc --rdoc-output="$(RDOCOUT)"
-post-install-doc::
-	@$(NULLCMD)
-
-install-gem: pre-install-gem do-install-gem post-install-gem
-pre-install-gem:: pre-install-bin pre-install-lib pre-install-man
-do-install-gem: $(PROGRAM) pre-install-gem
-	$(INSTRUBY) --make="$(MAKE)" $(INSTRUBY_ARGS) --install=gem
-post-install-gem::
-	@$(NULLCMD)
-
-rdoc: PHONY main
-	@echo Generating RDoc documentation
-	$(Q) $(XRUBY) "$(srcdir)/bin/rdoc" --root "$(srcdir)" --page-dir "$(srcdir)/doc" --encoding=UTF-8 --no-force-update --all --ri --op "$(RDOCOUT)" --debug $(RDOCFLAGS) "$(srcdir)"
-
-html: PHONY main
-	@echo Generating RDoc HTML files
-	$(Q) $(XRUBY) "$(srcdir)/bin/rdoc" --root "$(srcdir)" --page-dir "$(srcdir)/doc" --encoding=UTF-8 --no-force-update --all --op "$(HTMLOUT)" --debug $(RDOCFLAGS) "$(srcdir)"
-
-rdoc-coverage: PHONY main
-	@echo Generating RDoc coverage report
-	$(Q) $(XRUBY) "$(srcdir)/bin/rdoc" --root "$(srcdir)" --encoding=UTF-8 --all --quiet -C $(RDOCFLAGS) "$(srcdir)"
-
-RDOCBENCHOUT=/tmp/rdocbench
-
-GCBENCH_ITEM=null
-
-gcbench: PHONY
-	$(Q) $(XRUBY) "$(srcdir)/benchmark/gc/gcbench.rb" $(GCBENCH_ITEM)
-
-gcbench-rdoc: PHONY
-	$(Q) $(XRUBY) "$(srcdir)/benchmark/gc/gcbench.rb" rdoc
-
-nodoc: PHONY
-
-what-where-doc: no-install-doc
-no-install-doc: pre-no-install-doc dont-install-doc post-no-install-doc
-pre-no-install-doc:: install-prereq
-dont-install-doc:: $(PREP)
-	$(INSTRUBY) -n --make="$(MAKE)" $(INSTRUBY_ARGS) --install=rdoc --rdoc-output="$(RDOCOUT)"
-post-no-install-doc::
-	@$(NULLCMD)
-
-CLEAR_INSTALLED_LIST = clear-installed-list
-
-install-prereq: $(CLEAR_INSTALLED_LIST) yes-fake sudo-precheck PHONY
-
-clear-installed-list: PHONY
-	@> $(INSTALLED_LIST) set MAKE="$(MAKE)"
-
-clean: clean-ext clean-enc clean-golf clean-rdoc clean-capi clean-extout clean-local clean-platform
-clean-local:: clean-runnable
-	$(Q)$(RM) $(OBJS) $(MINIOBJS) $(MAINOBJ) $(LIBRUBY_A) $(LIBRUBY_SO) $(LIBRUBY) $(LIBRUBY_ALIASES)
-	$(Q)$(RM) $(PROGRAM) $(WPROGRAM) miniruby$(EXEEXT) dmyext.$(OBJEXT) dmyenc.$(OBJEXT) $(ARCHFILE) .*.time
-	$(Q)$(RM) y.tab.c y.output encdb.h transdb.h config.log rbconfig.rb $(ruby_pc) probes.h probes.$(OBJEXT) probes.stamp ruby-glommed.$(OBJEXT)
-	$(Q)$(RM) GNUmakefile.old Makefile.old $(arch)-fake.rb bisect.sh $(ENC_TRANS_D)
-	-$(Q) $(RMDIR) enc/jis enc/trans enc 2> $(NULL) || exit 0
-clean-runnable:: PHONY
-	$(Q)$(CHDIR) bin 2>$(NULL) && $(RM) $(PROGRAM) $(WPROGRAM) $(GORUBY)$(EXEEXT) bin/*.$(DLEXT) 2>$(NULL) || exit 0
-	$(Q)$(CHDIR) lib 2>$(NULL) && $(RM) $(LIBRUBY_A) $(LIBRUBY) $(LIBRUBY_ALIASES) $(RUBY_BASE_NAME)/$(RUBY_PROGRAM_VERSION) $(RUBY_BASE_NAME)/vendor_ruby 2>$(NULL) || exit 0
-	$(Q)$(RMDIR) lib/$(RUBY_BASE_NAME) lib bin 2>$(NULL) || exit 0
-clean-ext:: PHONY
-clean-golf: PHONY
-	$(Q)$(RM) $(GORUBY)$(EXEEXT) $(GOLFOBJS)
-clean-rdoc: PHONY
-clean-html: PHONY
-clean-capi: PHONY
-clean-platform: PHONY
-clean-extout: PHONY
-	-$(Q)$(RMDIR) $(EXTOUT)/$(arch) $(EXTOUT) 2> $(NULL) || exit 0
-clean-docs: clean-rdoc clean-html clean-capi
-
-distclean: distclean-ext distclean-enc distclean-golf distclean-extout distclean-local distclean-platform
-distclean-local:: clean-local
-	$(Q)$(RM) $(MKFILES) yasmdata.rb *.inc $(PRELUDES)
-	$(Q)$(RM) config.cache config.status config.status.lineno
-	$(Q)$(RM) *~ *.bak *.stackdump core *.core gmon.out $(PREP)
-	-$(Q)$(RMALL) $(srcdir)/autom4te.cache
-distclean-ext:: PHONY
-distclean-golf: clean-golf
-distclean-rdoc: PHONY
-distclean-html: PHONY
-distclean-capi: PHONY
-distclean-extout: clean-extout
-distclean-platform: clean-platform
-
-realclean:: realclean-ext realclean-local realclean-enc realclean-golf realclean-extout
-realclean-local:: distclean-local
-	$(Q)$(RM) parse.c parse.h lex.c enc/trans/newline.c revision.h
-	$(Q)$(RM) id.c id.h probes.dmyh
-	$(Q)$(CHDIR) $(srcdir) && $(exec) $(RM) parse.c parse.h lex.c enc/trans/newline.c $(PRELUDES) revision.h
-	$(Q)$(CHDIR) $(srcdir) && $(exec) $(RM) id.c id.h probes.dmyh
-	$(Q)$(CHDIR) $(srcdir) && $(exec) $(RM) configure tool/config.guess tool/config.sub gems/*.gem
-realclean-ext:: PHONY
-realclean-golf: distclean-golf
-	$(Q)$(RM) $(GOLFPRELUDES)
-realclean-capi: PHONY
-realclean-extout: distclean-extout
-
-clean-ext distclean-ext realclean-ext::
-	$(Q)$(RM) $(EXTS_MK)
-	$(Q)$(RM) $(EXTOUT)/.timestamp/.*.time
-	$(Q)$(RMDIR) $(EXTOUT)/.timestamp 2> $(NULL) || exit 0
-
-clean-enc distclean-enc realclean-enc: PHONY
-
-clean-enc: clean-enc.d
-
-clean-enc.d: PHONY
-	$(Q)$(RM) $(ENC_TRANS_D)
-	-$(Q) $(RMDIR) enc/jis enc/trans enc 2> $(NULL) || exit 0
-
-clean-rdoc distclean-rdoc realclean-rdoc:
-	@echo $(@:-rdoc=ing) rdoc
-	$(Q)$(RMALL) $(RDOCOUT)
-
-clean-html distclean-html realclean-html:
-	@echo $(@:-html=ing) HTML
-	$(Q)$(RMALL) $(HTMLOUT)
-
-clean-capi distclean-capi realclean-capi:
-	@echo $(@:-capi=ing) capi
-	$(Q)$(RMALL) $(CAPIOUT)
-
-clean-platform:
-	$(Q) $(RM) $(PLATFORM_D)
-	-$(Q) $(RMDIR) $(PLATFORM_DIR) 2> $(NULL) || exit 0
-
-check: main test test-testframework test-almost
-	$(ECHO) check succeeded
-check-ruby: test test-ruby
-
-fake: $(CROSS_COMPILING)-fake
-yes-fake: $(arch)-fake.rb $(RBCONFIG) PHONY
-no-fake -fake: PHONY
-
-# really doesn't depend on .o, just ensure newer than headers which
-# version.o depends on.
-$(arch)-fake.rb: $(srcdir)/template/fake.rb.in $(srcdir)/tool/generic_erb.rb version.$(OBJEXT)
-	$(ECHO) generating $@
-	$(Q) $(CPP) $(warnflags) $(XCFLAGS) $(CPPFLAGS) "$(srcdir)/version.c" | \
-	$(BOOTSTRAPRUBY) "$(srcdir)/tool/generic_erb.rb" -o $@ "$(srcdir)/template/fake.rb.in" \
-		i=- srcdir="$(srcdir)" BASERUBY="$(BASERUBY)"
-
-btest: $(TEST_RUNNABLE)-btest
-no-btest: PHONY
-yes-btest: fake miniruby$(EXEEXT) PHONY
-	$(Q)$(exec) $(BOOTSTRAPRUBY) "$(srcdir)/bootstraptest/runner.rb" --ruby="$(BTESTRUBY) $(RUN_OPTS)" $(OPTS) $(TESTOPTS)
-
-btest-ruby: $(TEST_RUNNABLE)-btest-ruby
-no-btest-ruby: PHONY
-yes-btest-ruby: prog PHONY
-	$(Q)$(exec) $(RUNRUBY) "$(srcdir)/bootstraptest/runner.rb" --ruby="$(PROGRAM) -I$(srcdir)/lib $(RUN_OPTS)" -q $(OPTS) $(TESTOPTS)
-
-test-sample: $(TEST_RUNNABLE)-test-sample
-no-test-sample: PHONY
-yes-test-sample: prog PHONY
-	$(Q)$(exec) $(RUNRUBY) "$(srcdir)/tool/rubytest.rb" --run-opt=$(RUN_OPTS) $(OPTS) $(TESTOPTS)
-
-test-knownbugs: test-knownbug
-test-knownbug: $(TEST_RUNNABLE)-test-knownbug
-no-test-knownbug: PHONY
-yes-test-knownbug: prog PHONY
-	-$(exec) $(RUNRUBY) "$(srcdir)/bootstraptest/runner.rb" --ruby="$(PROGRAM) $(RUN_OPTS)" $(OPTS) $(TESTOPTS) $(srcdir)/KNOWNBUGS.rb
-
-test-testframework: $(TEST_RUNNABLE)-test-testframework
-yes-test-testframework: prog PHONY
-	$(Q)$(exec) $(RUNRUBY) "$(srcdir)/test/runner.rb" --ruby="$(RUNRUBY)" $(TESTOPTS) testunit minitest
-no-test-testframework: PHONY
-
-test: test-sample btest-ruby test-knownbug
-
-# $ make test-all TESTOPTS="--help" displays more detail
-# for example, make test-all TESTOPTS="-j2 -v -n test-name -- test-file-name"
-test-all: $(TEST_RUNNABLE)-test-all
-yes-test-all: prog PHONY
-	$(Q)$(exec) $(RUNRUBY) "$(srcdir)/test/runner.rb" --ruby="$(RUNRUBY)" $(TEST_EXCLUDES) $(TESTOPTS) $(TESTS)
-TESTS_BUILD = mkmf
-no-test-all: PHONY
-	$(MINIRUBY) -I"$(srcdir)/lib" "$(srcdir)/test/runner.rb" $(TESTOPTS) $(TESTS_BUILD)
-
-test-almost: $(TEST_RUNNABLE)-test-almost
-yes-test-almost: prog PHONY
-	$(Q)$(exec) $(RUNRUBY) "$(srcdir)/test/runner.rb" --ruby="$(RUNRUBY)" $(TEST_EXCLUDES) $(TESTOPTS) $(EXCLUDE_TESTFRAMEWORK) $(TESTS)
-no-test-almost: PHONY
-
-test-ruby: $(TEST_RUNNABLE)-test-ruby
-no-test-ruby: PHONY
-yes-test-ruby: prog encs PHONY
-	$(RUNRUBY) "$(srcdir)/test/runner.rb" $(TEST_EXCLUDES) $(TESTOPTS) -- ruby -ext-
-
-extconf: $(PREP)
-	$(Q) $(MAKEDIRS) "$(EXTCONFDIR)"
-	$(RUNRUBY) -C "$(EXTCONFDIR)" $(EXTCONF) $(EXTCONFARGS)
-
-$(RBCONFIG): $(srcdir)/tool/mkconfig.rb config.status $(srcdir)/version.h
-	$(Q)$(BOOTSTRAPRUBY) $(srcdir)/tool/mkconfig.rb -timestamp=$@ \
-		-arch=$(arch) -version=$(RUBY_PROGRAM_VERSION) \
-		-install_name=$(RUBY_INSTALL_NAME) \
-		-so_name=$(RUBY_SO_NAME) rbconfig.rb
-
-test-rubyspec-precheck:
-
-test-rubyspec: test-rubyspec-precheck $(arch)-fake.rb
-	$(RUNRUBY) -r./$(arch)-fake $(srcdir)/spec/mspec/bin/mspec run -B $(srcdir)/spec/default.mspec $(MSPECOPT)
-
-RUNNABLE = $(LIBRUBY_RELATIVE:no=un)-runnable
-runnable: $(RUNNABLE) prog $(srcdir)/tool/mkrunnable.rb PHONY
-	$(Q) $(MINIRUBY) $(srcdir)/tool/mkrunnable.rb -v $(EXTOUT)
-yes-runnable: PHONY
-
-encs: enc trans
-libencs: libenc libtrans
-encs enc trans libencs libenc libtrans: $(SHOWFLAGS) $(ENC_MK) $(LIBRUBY) $(PREP) PHONY
-	$(ECHO) making $@
-	$(Q) $(MAKE) -f $(ENC_MK) V="$(V)" \
-		RUBY="$(MINIRUBY)" MINIRUBY="$(MINIRUBY)" \
-		$(MFLAGS) $@
-
-
-libenc enc: {$(VPATH)}encdb.h
-libtrans trans: {$(VPATH)}transdb.h
-
-$(ENC_MK): $(srcdir)/enc/make_encmake.rb $(srcdir)/enc/Makefile.in $(srcdir)/enc/depend \
-	$(srcdir)/enc/encinit.c.erb $(srcdir)/lib/mkmf.rb $(RBCONFIG) fake
-	$(ECHO) generating $@
-	$(Q) $(MINIRUBY) $(srcdir)/enc/make_encmake.rb --builtin-encs="$(BUILTIN_ENCOBJS)" --builtin-transes="$(BUILTIN_TRANSOBJS)" --module$(ENCSTATIC) $(ENCS) $@
-
-.PRECIOUS: $(MKFILES)
-
-.PHONY: PHONY all fake prereq incs srcs preludes help
-.PHONY: test install install-nodoc install-doc dist
-.PHONY: loadpath golf capi rdoc install-prereq clear-installed-list
-.PHONY: clean clean-ext clean-local clean-enc clean-golf clean-rdoc clean-html clean-extout
-.PHONY: distclean distclean-ext distclean-local distclean-enc distclean-golf distclean-extout
-.PHONY: realclean realclean-ext realclean-local realclean-enc realclean-golf realclean-extout
-.PHONY: check test test-all btest btest-ruby test-sample test-knownbug
-.PHONY: run runruby parse benchmark benchmark-each tbench gdb gdb-ruby
-.PHONY: update-mspec update-rubyspec test-rubyspec
-
-PHONY:
-
-{$(VPATH)}parse.c: {$(VPATH)}parse.y $(srcdir)/tool/ytab.sed {$(VPATH)}id.h
-{$(VPATH)}parse.h: {$(VPATH)}parse.c
-
-{$(srcdir)}.y.c:
-	$(ECHO) generating $@
-	$(Q)$(BASERUBY) $(srcdir)/tool/id2token.rb --path-separator=.$(PATH_SEPARATOR)./ --vpath=$(VPATH) id.h $(SRC_FILE) > parse.tmp.y
-	$(Q)$(YACC) -d $(YFLAGS) -o y.tab.c parse.tmp.y
-	$(Q)$(RM) parse.tmp.y
-	$(Q)sed -f $(srcdir)/tool/ytab.sed -e "/^#/s!parse\.tmp\.[iy]!parse.y!" -e "/^#/s!y\.tab\.c!$@!" y.tab.c > $@.new
-	$(Q)$(MV) $@.new $@
-	$(Q)sed -e "/^#line.*y\.tab\.h/d;/^#line.*parse.*\.y/d" y.tab.h > $(@:.c=.h)
-	$(Q)$(RM) y.tab.c y.tab.h
-
-$(PLATFORM_D):
-	$(Q) $(MAKEDIRS) $(PLATFORM_DIR)
-	@exit > $@
-
-$(BUILTIN_ENCOBJS) $(BUILTIN_TRANSOBJS): $(ENC_TRANS_D)
-
-$(ENC_TRANS_D):
-	$(Q) $(MAKEDIRS) enc/trans
-	@exit > $@
-
-###
-CCAN_DIR = {$(VPATH)}ccan
-
-RUBY_H_INCLUDES    = {$(VPATH)}ruby.h {$(VPATH)}config.h {$(VPATH)}defines.h \
-		     {$(VPATH)}intern.h {$(VPATH)}missing.h {$(VPATH)}st.h \
-		     {$(VPATH)}subst.h
-
-###
-
-acosh.$(OBJEXT): {$(VPATH)}acosh.c
-alloca.$(OBJEXT): {$(VPATH)}alloca.c {$(VPATH)}config.h
-crypt.$(OBJEXT): {$(VPATH)}crypt.c
-dup2.$(OBJEXT): {$(VPATH)}dup2.c
-erf.$(OBJEXT): {$(VPATH)}erf.c
-finite.$(OBJEXT): {$(VPATH)}finite.c
-flock.$(OBJEXT): {$(VPATH)}flock.c
-memcmp.$(OBJEXT): {$(VPATH)}memcmp.c
-memmove.$(OBJEXT): {$(VPATH)}memmove.c
-mkdir.$(OBJEXT): {$(VPATH)}mkdir.c
-setproctitle.$(OBJEXT): {$(VPATH)}setproctitle.c
-strchr.$(OBJEXT): {$(VPATH)}strchr.c
-strdup.$(OBJEXT): {$(VPATH)}strdup.c
-strerror.$(OBJEXT): {$(VPATH)}strerror.c
-strlcat.$(OBJEXT): {$(VPATH)}strlcat.c
-strlcpy.$(OBJEXT): {$(VPATH)}strlcpy.c
-strstr.$(OBJEXT): {$(VPATH)}strstr.c
-strtod.$(OBJEXT): {$(VPATH)}strtod.c
-strtol.$(OBJEXT): {$(VPATH)}strtol.c
-nt.$(OBJEXT): {$(VPATH)}nt.c
-ia64.$(OBJEXT): {$(VPATH)}ia64.s
-	$(CC) $(CFLAGS) -c $<
-
-###
-
-# dependencies for generated C sources.
-parse.$(OBJEXT): {$(VPATH)}parse.c
-miniprelude.$(OBJEXT): {$(VPATH)}miniprelude.c
-prelude.$(OBJEXT): {$(VPATH)}prelude.c
-
-# dependencies for optional sources.
-compile.$(OBJEXT): {$(VPATH)}opt_sc.inc {$(VPATH)}optunifs.inc
-
-win32/win32.$(OBJEXT): {$(VPATH)}win32/win32.c {$(VPATH)}win32/file.h \
-  {$(VPATH)}dln.h {$(VPATH)}dln_find.c {$(VPATH)}encindex.h \
-  {$(VPATH)}internal.h {$(VPATH)}util.h $(RUBY_H_INCLUDES) $(PLATFORM_D)
-win32/file.$(OBJEXT): {$(VPATH)}win32/file.c {$(VPATH)}win32/file.h \
-  $(RUBY_H_INCLUDES) $(PLATFORM_D)
-
-$(NEWLINE_C): $(srcdir)/enc/trans/newline.trans $(srcdir)/tool/transcode-tblgen.rb
-	$(Q) $(MAKEDIRS) $(@D)
-	$(Q) $(BASERUBY) "$(srcdir)/tool/transcode-tblgen.rb" -vo $@ $(srcdir)/enc/trans/newline.trans
-enc/trans/newline.$(OBJEXT): $(NEWLINE_C)
-
-verconf.h: $(srcdir)/template/verconf.h.tmpl $(srcdir)/tool/generic_erb.rb
-	$(ECHO) creating $@
-	$(Q) $(BOOTSTRAPRUBY) "$(srcdir)/tool/generic_erb.rb" -o $@ $(srcdir)/template/verconf.h.tmpl
-
-ruby-glommed.$(OBJEXT): $(OBJS)
-
-$(OBJS):  {$(VPATH)}config.h {$(VPATH)}missing.h
-
-INSNS2VMOPT = --srcdir="$(srcdir)"
-
-{$(VPATH)}minsns.inc: $(srcdir)/template/minsns.inc.tmpl
-
-{$(VPATH)}opt_sc.inc: $(srcdir)/template/opt_sc.inc.tmpl
-
-{$(VPATH)}optinsn.inc: $(srcdir)/template/optinsn.inc.tmpl
-
-{$(VPATH)}optunifs.inc: $(srcdir)/template/optunifs.inc.tmpl
-
-{$(VPATH)}insns.inc: $(srcdir)/template/insns.inc.tmpl
-
-{$(VPATH)}insns_info.inc: $(srcdir)/template/insns_info.inc.tmpl
-
-{$(VPATH)}vmtc.inc: $(srcdir)/template/vmtc.inc.tmpl
-
-{$(VPATH)}vm.inc: $(srcdir)/template/vm.inc.tmpl
-
-common-srcs: {$(VPATH)}parse.c {$(VPATH)}lex.c {$(VPATH)}enc/trans/newline.c {$(VPATH)}id.c \
-	     srcs-lib srcs-ext
-
-srcs: common-srcs srcs-enc
-
-EXT_SRCS = $(srcdir)/ext/ripper/ripper.c \
-	   $(srcdir)/ext/rbconfig/sizeof/sizes.c
-
-srcs-ext: $(EXT_SRCS)
-
-srcs-extra: $(srcdir)/ext/json/parser/parser.c
-
-LIB_SRCS = $(srcdir)/lib/unicode_normalize/tables.rb
-
-srcs-lib: $(LIB_SRCS)
-
-srcs-enc: $(ENC_MK)
-	$(ECHO) making srcs under enc
-	$(Q) $(MAKE) -f $(ENC_MK) RUBY="$(MINIRUBY)" MINIRUBY="$(MINIRUBY)" $(MFLAGS) srcs
-
-all-incs: incs {$(VPATH)}encdb.h {$(VPATH)}transdb.h
-incs: $(INSNS) {$(VPATH)}node_name.inc {$(VPATH)}known_errors.inc \
-      {$(VPATH)}vm_call_iseq_optimized.inc $(srcdir)/revision.h \
-      $(REVISION_H) enc/unicode/name2ctype.h enc/jis/props.h \
-      {$(VPATH)}id.h {$(VPATH)}probes.dmyh
-
-insns: $(INSNS)
-
-id.h: $(srcdir)/tool/generic_erb.rb $(srcdir)/template/id.h.tmpl $(srcdir)/defs/id.def
-	$(ECHO) generating $@
-	$(Q) $(BASERUBY) $(srcdir)/tool/generic_erb.rb --output=$@ \
-		$(srcdir)/template/id.h.tmpl
-
-id.c: $(srcdir)/tool/generic_erb.rb $(srcdir)/template/id.c.tmpl $(srcdir)/defs/id.def
-	$(ECHO) generating $@
-	$(Q) $(BASERUBY) $(srcdir)/tool/generic_erb.rb --output=$@ \
-		$(srcdir)/template/id.c.tmpl
-
-node_name.inc: {$(VPATH)}node.h
-	$(ECHO) generating $@
-	$(Q) $(BASERUBY) -n $(srcdir)/tool/node_name.rb < $? > $@
-
-encdb.h: $(PREP) $(srcdir)/tool/generic_erb.rb $(srcdir)/template/encdb.h.tmpl
-	$(ECHO) generating $@
-	$(Q) $(MINIRUBY) $(srcdir)/tool/generic_erb.rb -c -o $@ $(srcdir)/template/encdb.h.tmpl $(srcdir)/enc enc
-
-transdb.h: $(PREP) srcs-enc $(srcdir)/tool/generic_erb.rb $(srcdir)/template/transdb.h.tmpl
-	$(ECHO) generating $@
-	$(Q) $(MINIRUBY) $(srcdir)/tool/generic_erb.rb -c -o $@ $(srcdir)/template/transdb.h.tmpl $(srcdir)/enc/trans enc/trans
-
-enc/encinit.c: $(ENC_MK) $(srcdir)/enc/encinit.c.erb
-
-known_errors.inc: $(srcdir)/template/known_errors.inc.tmpl $(srcdir)/defs/known_errors.def
-	$(ECHO) generating $@
-	$(Q) $(BASERUBY) $(srcdir)/tool/generic_erb.rb -c -o $@ $(srcdir)/template/known_errors.inc.tmpl $(srcdir)/defs/known_errors.def
-
-vm_call_iseq_optimized.inc: $(srcdir)/tool/mk_call_iseq_optimized.rb
-	$(ECHO) generating $@
-	$(Q) $(BASERUBY) $(srcdir)/tool/mk_call_iseq_optimized.rb > $@
-
-$(MINIPRELUDE_C): $(COMPILE_PRELUDE)
-	$(ECHO) generating $@
-	$(Q) $(BASERUBY) $(srcdir)/tool/generic_erb.rb -I$(srcdir) -o $@ \
-		$(srcdir)/template/prelude.c.tmpl
-
-$(PRELUDE_C): $(COMPILE_PRELUDE) \
-	   {$(srcdir)}lib/rubygems/defaults.rb \
-	   {$(srcdir)}lib/rubygems/core_ext/kernel_gem.rb \
-	   $(PRELUDE_SCRIPTS) $(LIB_SRCS)
-	$(ECHO) generating $@
-	$(Q) $(BASERUBY) $(srcdir)/tool/generic_erb.rb -I$(srcdir) -c -o $@ \
-		$(srcdir)/template/prelude.c.tmpl $(PRELUDE_SCRIPTS)
-
-{$(VPATH)}golf_prelude.c: $(COMPILE_PRELUDE) {$(srcdir)}golf_prelude.rb
-	$(ECHO) generating $@
-	$(Q) $(BASERUBY) $(srcdir)/tool/generic_erb.rb -I$(srcdir) -c -o $@ \
-		$(srcdir)/template/prelude.c.tmpl golf_prelude.rb
-
-probes.dmyh: {$(srcdir)}probes.d $(srcdir)/tool/gen_dummy_probes.rb
-	$(BASERUBY) $(srcdir)/tool/gen_dummy_probes.rb $(srcdir)/probes.d > $@
-
-probes.h: {$(VPATH)}probes.$(DTRACE_EXT)
-
-prereq: incs srcs preludes PHONY
-
-preludes: {$(VPATH)}prelude.c
-preludes: {$(VPATH)}miniprelude.c
-preludes: {$(srcdir)}golf_prelude.c
-
-$(srcdir)/revision.h:
-	@exit > $@
-
-$(REVISION_H): $(srcdir)/version.h $(srcdir)/ChangeLog $(srcdir)/tool/file2lastrev.rb $(REVISION_FORCE)
-	-$(Q) $(BASERUBY) $(srcdir)/tool/file2lastrev.rb --revision.h "$(srcdir)" > revision.tmp
-	$(Q)$(IFCHANGE) "--timestamp=$@" "$(srcdir)/revision.h" revision.tmp
-
-$(srcdir)/ext/ripper/ripper.c: parse.y id.h
-	$(ECHO) generating $@
-	$(Q) $(CHDIR) $(@D) && \
-	sed /AUTOGENERATED/q depend | \
-	$(exec) $(MAKE) -f - $(MFLAGS) \
-		Q=$(Q) ECHO=$(ECHO) RM="$(RM)" top_srcdir=../.. srcdir=. VPATH=../.. \
-		RUBY="$(BASERUBY)" PATH_SEPARATOR="$(PATH_SEPARATOR)"
-
-$(srcdir)/ext/json/parser/parser.c: $(srcdir)/ext/json/parser/parser.rl
-	$(ECHO) generating $@
-	$(Q) $(CHDIR) $(@D) && $(exec) $(MAKE) -f prereq.mk $(MFLAGS) \
-		Q=$(Q) ECHO=$(ECHO) top_srcdir=../../.. srcdir=. VPATH=../../.. BASERUBY="$(BASERUBY)"
-
-$(srcdir)/ext/rbconfig/sizeof/sizes.c: $(srcdir)/ext/rbconfig/sizeof/depend \
-		$(srcdir)/tool/generic_erb.rb $(srcdir)/template/sizes.c.tmpl $(srcdir)/configure.in
-	$(ECHO) generating $@
-	$(Q) $(CHDIR) $(@D) && \
-	sed /AUTOGENERATED/q depend | \
-	$(exec) $(MAKE) -f - $(MFLAGS) \
-		Q=$(Q) ECHO=$(ECHO) top_srcdir=../../.. srcdir=. VPATH=../../.. RUBY="$(BASERUBY)"
-
-##
-
-run: fake miniruby$(EXEEXT) PHONY
-	$(BTESTRUBY) $(TESTRUN_SCRIPT) $(RUNOPT)
-
-runruby: $(PROGRAM) PHONY
-	$(RUNRUBY) $(TESTRUN_SCRIPT)
-
-parse: fake miniruby$(EXEEXT) PHONY
-	$(BTESTRUBY) $(srcdir)/tool/parse.rb $(TESTRUN_SCRIPT)
-
-bisect: PHONY
-	$(srcdir)/tool/bisect.sh miniruby $(srcdir)
-
-bisect-ruby: PHONY
-	$(srcdir)/tool/bisect.sh ruby $(srcdir)
-
-COMPARE_RUBY = $(BASERUBY)
-ITEM =
-OPTS =
-
-# You can pass several options through OPTS environment variable.
-# $ make benchmark OPTS="--help" displays more detail.
-# for example,
-#  $ make benchmark COMPARE_RUBY="ruby-trunk" OPTS="-e ruby-2.2.2"
-# This command compares trunk and built-ruby and 2.2.2
-benchmark: $(PROGRAM) PHONY
-	$(BASERUBY) $(srcdir)/benchmark/driver.rb -v \
-	            --executables="$(COMPARE_RUBY); built-ruby::$(RUNRUBY)" \
-	            --pattern='bm_' --directory=$(srcdir)/benchmark $(OPTS)
-
-benchmark-each: $(PROGRAM) PHONY
-	$(BASERUBY) $(srcdir)/benchmark/driver.rb -v \
-	            --executables="$(COMPARE_RUBY); built-ruby::$(RUNRUBY)" \
-	            --pattern=$(ITEM) --directory=$(srcdir)/benchmark $(OPTS)
-
-tbench: $(PROGRAM) PHONY
-	$(BASERUBY) $(srcdir)/benchmark/driver.rb -v \
-	            --executables="$(COMPARE_RUBY); built-ruby::$(RUNRUBY)" \
-	            --pattern='bmx_' --directory=$(srcdir)/benchmark $(OPTS)
-
-run.gdb:
-	echo set breakpoint pending on         > run.gdb
-	echo b ruby_debug_breakpoint          >> run.gdb
-	echo '# handle SIGINT nostop'         >> run.gdb
-	echo '# handle SIGPIPE nostop'        >> run.gdb
-	echo '# b rb_longjmp'                 >> run.gdb
-	echo source $(srcdir)/breakpoints.gdb >> run.gdb
-	echo source $(srcdir)/.gdbinit        >> run.gdb
-	echo 'set $$_exitcode = -999'         >> run.gdb
-	echo run                              >> run.gdb
-	echo 'if $$_exitcode != -999'         >> run.gdb
-	echo '  quit'                         >> run.gdb
-	echo end                              >> run.gdb
-
-
-gdb: miniruby$(EXEEXT) run.gdb PHONY
-	gdb -x run.gdb --quiet --args $(MINIRUBY) $(TESTRUN_SCRIPT)
-
-gdb-ruby: $(PROGRAM) run.gdb PHONY
-	$(Q) $(RUNRUBY_COMMAND) $(RUNRUBY_DEBUGGER) -- $(TESTRUN_SCRIPT)
-
-dist:
-	$(BASERUBY) $(srcdir)/tool/make-snapshot -srcdir=$(srcdir) tmp $(RELNAME)
-
-up::
-	-$(Q)$(MAKE) $(MFLAGS) Q=$(Q) REVISION_FORCE=PHONY "$(REVISION_H)"
-
-up::
-	-$(Q)$(MAKE) $(MFLAGS) Q=$(Q) after-update
-
-after-update:: update-unicode update-gems extract-extlibs
-
-update-config_files: PHONY
-	$(Q) $(BASERUBY) -C "$(srcdir)/tool" \
-	    ../tool/downloader.rb -e gnu \
-	    config.guess config.sub
-
-update-gems: PHONY
-	$(ECHO) Downloading bundled gem files...
-	$(Q) $(BASERUBY) -C "$(srcdir)/gems" \
-	    -I../tool -rdownloader -answ \
-	    -e 'gem, ver = *$$F' \
-	    -e 'old = Dir.glob("#{gem}-*.gem")' \
-	    -e 'gem = "#{gem}-#{ver}.gem"' \
-	    -e 'Downloader::RubyGems.download(gem, nil, nil) and' \
-	    -e 'File.unlink(*(old-[gem]))' \
-	    bundled_gems
-
-extract-gems: PHONY
-	$(ECHO) Extracting bundled gem files...
-	$(Q) $(RUNRUBY) -C "$(srcdir)/gems" \
-	    -I../tool -rgem-unpack -answ \
-	    -e 'gem, ver = *$$F' \
-	    -e 'Gem.unpack("#{gem}-#{ver}.gem")' \
-	    bundled_gems
-
-UPDATE_LIBRARIES = no
-
-### set the following environment variable or uncomment the line if
-### the Unicode data files are updated every minute.
-# ALWAYS_UPDATE_UNICODE = yes
-
-UNICODE_FILES = $(srcdir)/enc/unicode/data/$(UNICODE_VERSION)/UnicodeData.txt \
-		$(srcdir)/enc/unicode/data/$(UNICODE_VERSION)/CompositionExclusions.txt \
-		$(srcdir)/enc/unicode/data/$(UNICODE_VERSION)/NormalizationTest.txt
-
-update-unicode: $(UNICODE_FILES) PHONY
-
-UNICODE_FILES_DEPS0 = $(UPDATE_LIBRARIES:yes=download-unicode-data)
-UNICODE_FILES_DEPS = $(UNICODE_FILES_DEPS0:no=)
-$(UNICODE_FILES): $(UNICODE_FILES_DEPS)
-
-download-unicode-data: ./.unicode-$(UNICODE_VERSION).time
-./.unicode-$(UNICODE_VERSION).time: PHONY
-	$(ECHO) Downloading Unicode $(UNICODE_VERSION) data files...
-	$(Q) $(MAKEDIRS) "$(srcdir)/enc/unicode/data/$(UNICODE_VERSION)"
-	$(Q) $(BASERUBY) -C "$(srcdir)" tool/downloader.rb \
-	    -d enc/unicode/data/$(UNICODE_VERSION) \
-	    -e $(ALWAYS_UPDATE_UNICODE:yes=-a) unicode \
-	    $(UNICODE_VERSION)/ucd/UnicodeData.txt \
-	    $(UNICODE_VERSION)/ucd/CompositionExclusions.txt \
-	    $(UNICODE_VERSION)/ucd/NormalizationTest.txt
-	@exit > $@
-
-$(srcdir)/$(HAVE_BASERUBY:yes=lib/unicode_normalize/tables.rb): \
-	$(UNICODE_FILES_DEPS:download-unicode-data=./.unicode-tables.time)
-
-./.unicode-tables.time: $(srcdir)/tool/generic_erb.rb \
-		$(UNICODE_FILES) $(UNICODE_FILES_DEPS) \
-		$(srcdir)/template/unicode_norm_gen.tmpl
-	$(Q) $(BASERUBY) $(srcdir)/tool/generic_erb.rb \
-		-c -t$@ -o $(srcdir)/lib/unicode_normalize/tables.rb \
-		-I $(srcdir) \
-		$(srcdir)/template/unicode_norm_gen.tmpl \
-		enc/unicode/data/$(UNICODE_VERSION) lib/unicode_normalize
-
-download-extlibs:
-	$(Q) $(BASERUBY) -C $(srcdir) -w tool/extlibs.rb --download ext
-
-extract-extlibs:
-	$(Q) $(BASERUBY) -C $(srcdir) -w tool/extlibs.rb --all ext
-
-clean-extlibs:
-	$(Q) $(RMALL) $(srcdir)/.downloaded-cache
-
-clean-gems:
-	$(Q) $(RM) gems/*.gem
-
-CLEAN_CACHE = clean-extlibs
-
-info: info-program info-libruby_a info-libruby_so info-arch
-info-program: PHONY
-	@echo PROGRAM=$(PROGRAM)
-info-libruby_a: PHONY
-	@echo LIBRUBY_A=$(LIBRUBY_A)
-info-libruby_so: PHONY
-	@echo LIBRUBY_SO=$(LIBRUBY_SO)
-info-arch: PHONY
-	@echo arch=$(arch)
-
-change: PHONY
-	$(BASERUBY) -C "$(srcdir)" ./tool/change_maker.rb $(CHANGES) > change.log
-
-exam: check test-rubyspec
-
-love: sudo-precheck up all test install check
-	@echo love is all you need
-
-yes-test-all: sudo-precheck
-
-sudo-precheck: PHONY
-	@$(SUDO) echo > $(NULL)
-
-update-man-date: PHONY
-	-$(Q) $(BASERUBY) -I"$(srcdir)/tool" -rvcs -i -p \
-	-e 'BEGIN{@vcs=VCS.detect(ARGV.shift)}' \
-	-e '$$_.sub!(/^(\.Dd ).*/){$$1+@vcs.modified(ARGF.path).strftime("%B %d, %Y")}' \
-	"$(srcdir)" "$(srcdir)"/man/*.1
-
-help: PHONY
-	$(MESSAGE_BEGIN) \
-	"                Makefile of Ruby" \
-	"" \
-	"targets:" \
-	"  all (default):   builds all of below" \
-	"  miniruby:        builds only miniruby" \
-	"  encs:            builds encodings" \
-	"  exts:            builds extensions" \
-	"  main:            builds encodings, extensions and ruby" \
-	"  docs:            builds documents" \
-	"  run:             runs test.rb by miniruby" \
-	"  runruby:         runs test.rb by ruby you just built" \
-	"  gdb:             runs test.rb by miniruby under gdb" \
-	"  gdb-ruby:        runs test.rb by ruby under gdb" \
-	"  check:           equals make test test-all" \
-	"  test:            ruby core tests" \
-	"  test-all:        all ruby tests [TESTS=<test files>]" \
-	"  test-rubyspec:   run RubySpec test suite" \
-	"  update-rubyspec: update local copy of RubySpec" \
-	"  benchmark:       benchmark this ruby and COMPARE_RUBY." \
-	"  gcbench:         gc benchmark [GCBENCH_ITEM=<item_name>]" \
-	"  gcbench-rdoc:    gc benchmark with GCBENCH_ITEM=rdoc" \
-	"  install:         install all ruby distributions" \
-	"  install-nodoc:   install without rdoc" \
-	"  install-cross:   install cross compiling staff" \
-	"  clean:           clean for tarball" \
-	"  distclean:       clean for repository" \
-	"  change:          make change log template" \
-	"  golf:            for golfers" \
-	"" \
-	"see DeveloperHowto for more detail: " \
-	"  https://bugs.ruby-lang.org/projects/ruby/wiki/DeveloperHowto" \
-	$(MESSAGE_END)
-
-# AUTOGENERATED DEPENDENCIES START
-addr2line.$(OBJEXT): {$(VPATH)}addr2line.c
-addr2line.$(OBJEXT): {$(VPATH)}addr2line.h
-addr2line.$(OBJEXT): {$(VPATH)}config.h
-addr2line.$(OBJEXT): {$(VPATH)}missing.h
-array.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-array.$(OBJEXT): $(top_srcdir)/include/ruby.h
-array.$(OBJEXT): {$(VPATH)}array.c
-array.$(OBJEXT): {$(VPATH)}config.h
-array.$(OBJEXT): {$(VPATH)}defines.h
-array.$(OBJEXT): {$(VPATH)}encoding.h
-array.$(OBJEXT): {$(VPATH)}id.h
-array.$(OBJEXT): {$(VPATH)}intern.h
-array.$(OBJEXT): {$(VPATH)}internal.h
-array.$(OBJEXT): {$(VPATH)}io.h
-array.$(OBJEXT): {$(VPATH)}missing.h
-array.$(OBJEXT): {$(VPATH)}oniguruma.h
-array.$(OBJEXT): {$(VPATH)}probes.h
-array.$(OBJEXT): {$(VPATH)}st.h
-array.$(OBJEXT): {$(VPATH)}subst.h
-array.$(OBJEXT): {$(VPATH)}util.h
-array.$(OBJEXT): {$(VPATH)}vm_opts.h
-bignum.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-bignum.$(OBJEXT): $(top_srcdir)/include/ruby.h
-bignum.$(OBJEXT): {$(VPATH)}bignum.c
-bignum.$(OBJEXT): {$(VPATH)}config.h
-bignum.$(OBJEXT): {$(VPATH)}defines.h
-bignum.$(OBJEXT): {$(VPATH)}encoding.h
-bignum.$(OBJEXT): {$(VPATH)}intern.h
-bignum.$(OBJEXT): {$(VPATH)}internal.h
-bignum.$(OBJEXT): {$(VPATH)}io.h
-bignum.$(OBJEXT): {$(VPATH)}missing.h
-bignum.$(OBJEXT): {$(VPATH)}oniguruma.h
-bignum.$(OBJEXT): {$(VPATH)}st.h
-bignum.$(OBJEXT): {$(VPATH)}subst.h
-bignum.$(OBJEXT): {$(VPATH)}thread.h
-bignum.$(OBJEXT): {$(VPATH)}util.h
-class.$(OBJEXT): $(CCAN_DIR)/check_type/check_type.h
-class.$(OBJEXT): $(CCAN_DIR)/container_of/container_of.h
-class.$(OBJEXT): $(CCAN_DIR)/list/list.h
-class.$(OBJEXT): $(CCAN_DIR)/str/str.h
-class.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-class.$(OBJEXT): $(top_srcdir)/include/ruby.h
-class.$(OBJEXT): {$(VPATH)}class.c
-class.$(OBJEXT): {$(VPATH)}config.h
-class.$(OBJEXT): {$(VPATH)}constant.h
-class.$(OBJEXT): {$(VPATH)}defines.h
-class.$(OBJEXT): {$(VPATH)}encoding.h
-class.$(OBJEXT): {$(VPATH)}id.h
-class.$(OBJEXT): {$(VPATH)}id_table.h
-class.$(OBJEXT): {$(VPATH)}intern.h
-class.$(OBJEXT): {$(VPATH)}internal.h
-class.$(OBJEXT): {$(VPATH)}io.h
-class.$(OBJEXT): {$(VPATH)}method.h
-class.$(OBJEXT): {$(VPATH)}missing.h
-class.$(OBJEXT): {$(VPATH)}node.h
-class.$(OBJEXT): {$(VPATH)}oniguruma.h
-class.$(OBJEXT): {$(VPATH)}ruby_atomic.h
-class.$(OBJEXT): {$(VPATH)}st.h
-class.$(OBJEXT): {$(VPATH)}subst.h
-class.$(OBJEXT): {$(VPATH)}thread_$(THREAD_MODEL).h
-class.$(OBJEXT): {$(VPATH)}thread_native.h
-class.$(OBJEXT): {$(VPATH)}vm_core.h
-class.$(OBJEXT): {$(VPATH)}vm_debug.h
-class.$(OBJEXT): {$(VPATH)}vm_opts.h
-compar.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-compar.$(OBJEXT): {$(VPATH)}compar.c
-compar.$(OBJEXT): {$(VPATH)}config.h
-compar.$(OBJEXT): {$(VPATH)}defines.h
-compar.$(OBJEXT): {$(VPATH)}intern.h
-compar.$(OBJEXT): {$(VPATH)}missing.h
-compar.$(OBJEXT): {$(VPATH)}st.h
-compar.$(OBJEXT): {$(VPATH)}subst.h
-compile.$(OBJEXT): $(CCAN_DIR)/check_type/check_type.h
-compile.$(OBJEXT): $(CCAN_DIR)/container_of/container_of.h
-compile.$(OBJEXT): $(CCAN_DIR)/list/list.h
-compile.$(OBJEXT): $(CCAN_DIR)/str/str.h
-compile.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-compile.$(OBJEXT): $(top_srcdir)/include/ruby.h
-compile.$(OBJEXT): {$(VPATH)}compile.c
-compile.$(OBJEXT): {$(VPATH)}config.h
-compile.$(OBJEXT): {$(VPATH)}defines.h
-compile.$(OBJEXT): {$(VPATH)}encoding.h
-compile.$(OBJEXT): {$(VPATH)}id.h
-compile.$(OBJEXT): {$(VPATH)}insns.inc
-compile.$(OBJEXT): {$(VPATH)}insns_info.inc
-compile.$(OBJEXT): {$(VPATH)}intern.h
-compile.$(OBJEXT): {$(VPATH)}internal.h
-compile.$(OBJEXT): {$(VPATH)}io.h
-compile.$(OBJEXT): {$(VPATH)}iseq.h
-compile.$(OBJEXT): {$(VPATH)}method.h
-compile.$(OBJEXT): {$(VPATH)}missing.h
-compile.$(OBJEXT): {$(VPATH)}node.h
-compile.$(OBJEXT): {$(VPATH)}oniguruma.h
-compile.$(OBJEXT): {$(VPATH)}optinsn.inc
-compile.$(OBJEXT): {$(VPATH)}ruby_atomic.h
-compile.$(OBJEXT): {$(VPATH)}st.h
-compile.$(OBJEXT): {$(VPATH)}subst.h
-compile.$(OBJEXT): {$(VPATH)}thread_$(THREAD_MODEL).h
-compile.$(OBJEXT): {$(VPATH)}thread_native.h
-compile.$(OBJEXT): {$(VPATH)}vm_core.h
-compile.$(OBJEXT): {$(VPATH)}vm_debug.h
-compile.$(OBJEXT): {$(VPATH)}vm_opts.h
-complex.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-complex.$(OBJEXT): $(top_srcdir)/include/ruby.h
-complex.$(OBJEXT): {$(VPATH)}complex.c
-complex.$(OBJEXT): {$(VPATH)}config.h
-complex.$(OBJEXT): {$(VPATH)}defines.h
-complex.$(OBJEXT): {$(VPATH)}encoding.h
-complex.$(OBJEXT): {$(VPATH)}intern.h
-complex.$(OBJEXT): {$(VPATH)}internal.h
-complex.$(OBJEXT): {$(VPATH)}io.h
-complex.$(OBJEXT): {$(VPATH)}missing.h
-complex.$(OBJEXT): {$(VPATH)}oniguruma.h
-complex.$(OBJEXT): {$(VPATH)}st.h
-complex.$(OBJEXT): {$(VPATH)}subst.h
-cont.$(OBJEXT): $(CCAN_DIR)/check_type/check_type.h
-cont.$(OBJEXT): $(CCAN_DIR)/container_of/container_of.h
-cont.$(OBJEXT): $(CCAN_DIR)/list/list.h
-cont.$(OBJEXT): $(CCAN_DIR)/str/str.h
-cont.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-cont.$(OBJEXT): $(top_srcdir)/include/ruby.h
-cont.$(OBJEXT): {$(VPATH)}config.h
-cont.$(OBJEXT): {$(VPATH)}cont.c
-cont.$(OBJEXT): {$(VPATH)}defines.h
-cont.$(OBJEXT): {$(VPATH)}encoding.h
-cont.$(OBJEXT): {$(VPATH)}eval_intern.h
-cont.$(OBJEXT): {$(VPATH)}gc.h
-cont.$(OBJEXT): {$(VPATH)}id.h
-cont.$(OBJEXT): {$(VPATH)}intern.h
-cont.$(OBJEXT): {$(VPATH)}internal.h
-cont.$(OBJEXT): {$(VPATH)}io.h
-cont.$(OBJEXT): {$(VPATH)}method.h
-cont.$(OBJEXT): {$(VPATH)}missing.h
-cont.$(OBJEXT): {$(VPATH)}node.h
-cont.$(OBJEXT): {$(VPATH)}oniguruma.h
-cont.$(OBJEXT): {$(VPATH)}ruby_atomic.h
-cont.$(OBJEXT): {$(VPATH)}st.h
-cont.$(OBJEXT): {$(VPATH)}subst.h
-cont.$(OBJEXT): {$(VPATH)}thread_$(THREAD_MODEL).h
-cont.$(OBJEXT): {$(VPATH)}thread_native.h
-cont.$(OBJEXT): {$(VPATH)}vm_core.h
-cont.$(OBJEXT): {$(VPATH)}vm_debug.h
-cont.$(OBJEXT): {$(VPATH)}vm_opts.h
-debug.$(OBJEXT): $(CCAN_DIR)/check_type/check_type.h
-debug.$(OBJEXT): $(CCAN_DIR)/container_of/container_of.h
-debug.$(OBJEXT): $(CCAN_DIR)/list/list.h
-debug.$(OBJEXT): $(CCAN_DIR)/str/str.h
-debug.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-debug.$(OBJEXT): $(top_srcdir)/include/ruby.h
-debug.$(OBJEXT): {$(VPATH)}config.h
-debug.$(OBJEXT): {$(VPATH)}debug.c
-debug.$(OBJEXT): {$(VPATH)}defines.h
-debug.$(OBJEXT): {$(VPATH)}encoding.h
-debug.$(OBJEXT): {$(VPATH)}eval_intern.h
-debug.$(OBJEXT): {$(VPATH)}id.h
-debug.$(OBJEXT): {$(VPATH)}intern.h
-debug.$(OBJEXT): {$(VPATH)}internal.h
-debug.$(OBJEXT): {$(VPATH)}io.h
-debug.$(OBJEXT): {$(VPATH)}method.h
-debug.$(OBJEXT): {$(VPATH)}missing.h
-debug.$(OBJEXT): {$(VPATH)}node.h
-debug.$(OBJEXT): {$(VPATH)}oniguruma.h
-debug.$(OBJEXT): {$(VPATH)}ruby_atomic.h
-debug.$(OBJEXT): {$(VPATH)}st.h
-debug.$(OBJEXT): {$(VPATH)}subst.h
-debug.$(OBJEXT): {$(VPATH)}thread_$(THREAD_MODEL).h
-debug.$(OBJEXT): {$(VPATH)}thread_native.h
-debug.$(OBJEXT): {$(VPATH)}util.h
-debug.$(OBJEXT): {$(VPATH)}vm_core.h
-debug.$(OBJEXT): {$(VPATH)}vm_debug.h
-debug.$(OBJEXT): {$(VPATH)}vm_opts.h
-dir.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-dir.$(OBJEXT): $(top_srcdir)/include/ruby.h
-dir.$(OBJEXT): {$(VPATH)}config.h
-dir.$(OBJEXT): {$(VPATH)}defines.h
-dir.$(OBJEXT): {$(VPATH)}dir.c
-dir.$(OBJEXT): {$(VPATH)}encindex.h
-dir.$(OBJEXT): {$(VPATH)}encoding.h
-dir.$(OBJEXT): {$(VPATH)}intern.h
-dir.$(OBJEXT): {$(VPATH)}internal.h
-dir.$(OBJEXT): {$(VPATH)}io.h
-dir.$(OBJEXT): {$(VPATH)}missing.h
-dir.$(OBJEXT): {$(VPATH)}oniguruma.h
-dir.$(OBJEXT): {$(VPATH)}st.h
-dir.$(OBJEXT): {$(VPATH)}subst.h
-dir.$(OBJEXT): {$(VPATH)}util.h
-dln.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-dln.$(OBJEXT): {$(VPATH)}config.h
-dln.$(OBJEXT): {$(VPATH)}defines.h
-dln.$(OBJEXT): {$(VPATH)}dln.c
-dln.$(OBJEXT): {$(VPATH)}dln.h
-dln.$(OBJEXT): {$(VPATH)}intern.h
-dln.$(OBJEXT): {$(VPATH)}missing.h
-dln.$(OBJEXT): {$(VPATH)}st.h
-dln.$(OBJEXT): {$(VPATH)}subst.h
-dln_find.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-dln_find.$(OBJEXT): {$(VPATH)}config.h
-dln_find.$(OBJEXT): {$(VPATH)}defines.h
-dln_find.$(OBJEXT): {$(VPATH)}dln.h
-dln_find.$(OBJEXT): {$(VPATH)}dln_find.c
-dln_find.$(OBJEXT): {$(VPATH)}intern.h
-dln_find.$(OBJEXT): {$(VPATH)}missing.h
-dln_find.$(OBJEXT): {$(VPATH)}st.h
-dln_find.$(OBJEXT): {$(VPATH)}subst.h
-dmydln.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-dmydln.$(OBJEXT): {$(VPATH)}config.h
-dmydln.$(OBJEXT): {$(VPATH)}defines.h
-dmydln.$(OBJEXT): {$(VPATH)}dmydln.c
-dmydln.$(OBJEXT): {$(VPATH)}intern.h
-dmydln.$(OBJEXT): {$(VPATH)}missing.h
-dmydln.$(OBJEXT): {$(VPATH)}st.h
-dmydln.$(OBJEXT): {$(VPATH)}subst.h
-dmyenc.$(OBJEXT): {$(VPATH)}dmyenc.c
-dmyext.$(OBJEXT): {$(VPATH)}dmyext.c
-enc/ascii.$(OBJEXT): {$(VPATH)}config.h
-enc/ascii.$(OBJEXT): {$(VPATH)}defines.h
-enc/ascii.$(OBJEXT): {$(VPATH)}enc/ascii.c
-enc/ascii.$(OBJEXT): {$(VPATH)}encindex.h
-enc/ascii.$(OBJEXT): {$(VPATH)}missing.h
-enc/ascii.$(OBJEXT): {$(VPATH)}oniguruma.h
-enc/ascii.$(OBJEXT): {$(VPATH)}regenc.h
-enc/trans/newline.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-enc/trans/newline.$(OBJEXT): {$(VPATH)}config.h
-enc/trans/newline.$(OBJEXT): {$(VPATH)}defines.h
-enc/trans/newline.$(OBJEXT): {$(VPATH)}enc/trans/newline.c
-enc/trans/newline.$(OBJEXT): {$(VPATH)}intern.h
-enc/trans/newline.$(OBJEXT): {$(VPATH)}missing.h
-enc/trans/newline.$(OBJEXT): {$(VPATH)}st.h
-enc/trans/newline.$(OBJEXT): {$(VPATH)}subst.h
-enc/trans/newline.$(OBJEXT): {$(VPATH)}transcode_data.h
-enc/unicode.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-enc/unicode.$(OBJEXT): {$(VPATH)}config.h
-enc/unicode.$(OBJEXT): {$(VPATH)}defines.h
-enc/unicode.$(OBJEXT): {$(VPATH)}enc/unicode.c
-enc/unicode.$(OBJEXT): {$(VPATH)}enc/unicode/casefold.h
-enc/unicode.$(OBJEXT): {$(VPATH)}enc/unicode/name2ctype.h
-enc/unicode.$(OBJEXT): {$(VPATH)}intern.h
-enc/unicode.$(OBJEXT): {$(VPATH)}missing.h
-enc/unicode.$(OBJEXT): {$(VPATH)}oniguruma.h
-enc/unicode.$(OBJEXT): {$(VPATH)}regenc.h
-enc/unicode.$(OBJEXT): {$(VPATH)}regint.h
-enc/unicode.$(OBJEXT): {$(VPATH)}st.h
-enc/unicode.$(OBJEXT): {$(VPATH)}subst.h
-enc/us_ascii.$(OBJEXT): {$(VPATH)}config.h
-enc/us_ascii.$(OBJEXT): {$(VPATH)}defines.h
-enc/us_ascii.$(OBJEXT): {$(VPATH)}enc/us_ascii.c
-enc/us_ascii.$(OBJEXT): {$(VPATH)}encindex.h
-enc/us_ascii.$(OBJEXT): {$(VPATH)}missing.h
-enc/us_ascii.$(OBJEXT): {$(VPATH)}oniguruma.h
-enc/us_ascii.$(OBJEXT): {$(VPATH)}regenc.h
-enc/utf_8.$(OBJEXT): {$(VPATH)}config.h
-enc/utf_8.$(OBJEXT): {$(VPATH)}defines.h
-enc/utf_8.$(OBJEXT): {$(VPATH)}enc/utf_8.c
-enc/utf_8.$(OBJEXT): {$(VPATH)}encindex.h
-enc/utf_8.$(OBJEXT): {$(VPATH)}missing.h
-enc/utf_8.$(OBJEXT): {$(VPATH)}oniguruma.h
-enc/utf_8.$(OBJEXT): {$(VPATH)}regenc.h
-encoding.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-encoding.$(OBJEXT): $(top_srcdir)/include/ruby.h
-encoding.$(OBJEXT): {$(VPATH)}config.h
-encoding.$(OBJEXT): {$(VPATH)}defines.h
-encoding.$(OBJEXT): {$(VPATH)}encindex.h
-encoding.$(OBJEXT): {$(VPATH)}encoding.c
-encoding.$(OBJEXT): {$(VPATH)}encoding.h
-encoding.$(OBJEXT): {$(VPATH)}intern.h
-encoding.$(OBJEXT): {$(VPATH)}internal.h
-encoding.$(OBJEXT): {$(VPATH)}io.h
-encoding.$(OBJEXT): {$(VPATH)}missing.h
-encoding.$(OBJEXT): {$(VPATH)}oniguruma.h
-encoding.$(OBJEXT): {$(VPATH)}regenc.h
-encoding.$(OBJEXT): {$(VPATH)}st.h
-encoding.$(OBJEXT): {$(VPATH)}subst.h
-encoding.$(OBJEXT): {$(VPATH)}util.h
-enum.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-enum.$(OBJEXT): $(top_srcdir)/include/ruby.h
-enum.$(OBJEXT): {$(VPATH)}config.h
-enum.$(OBJEXT): {$(VPATH)}defines.h
-enum.$(OBJEXT): {$(VPATH)}encoding.h
-enum.$(OBJEXT): {$(VPATH)}enum.c
-enum.$(OBJEXT): {$(VPATH)}id.h
-enum.$(OBJEXT): {$(VPATH)}intern.h
-enum.$(OBJEXT): {$(VPATH)}internal.h
-enum.$(OBJEXT): {$(VPATH)}io.h
-enum.$(OBJEXT): {$(VPATH)}missing.h
-enum.$(OBJEXT): {$(VPATH)}oniguruma.h
-enum.$(OBJEXT): {$(VPATH)}st.h
-enum.$(OBJEXT): {$(VPATH)}subst.h
-enum.$(OBJEXT): {$(VPATH)}util.h
-enumerator.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-enumerator.$(OBJEXT): $(top_srcdir)/include/ruby.h
-enumerator.$(OBJEXT): {$(VPATH)}config.h
-enumerator.$(OBJEXT): {$(VPATH)}defines.h
-enumerator.$(OBJEXT): {$(VPATH)}encoding.h
-enumerator.$(OBJEXT): {$(VPATH)}enumerator.c
-enumerator.$(OBJEXT): {$(VPATH)}intern.h
-enumerator.$(OBJEXT): {$(VPATH)}internal.h
-enumerator.$(OBJEXT): {$(VPATH)}io.h
-enumerator.$(OBJEXT): {$(VPATH)}missing.h
-enumerator.$(OBJEXT): {$(VPATH)}oniguruma.h
-enumerator.$(OBJEXT): {$(VPATH)}st.h
-enumerator.$(OBJEXT): {$(VPATH)}subst.h
-error.$(OBJEXT): $(CCAN_DIR)/check_type/check_type.h
-error.$(OBJEXT): $(CCAN_DIR)/container_of/container_of.h
-error.$(OBJEXT): $(CCAN_DIR)/list/list.h
-error.$(OBJEXT): $(CCAN_DIR)/str/str.h
-error.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-error.$(OBJEXT): $(top_srcdir)/include/ruby.h
-error.$(OBJEXT): {$(VPATH)}config.h
-error.$(OBJEXT): {$(VPATH)}defines.h
-error.$(OBJEXT): {$(VPATH)}encoding.h
-error.$(OBJEXT): {$(VPATH)}error.c
-error.$(OBJEXT): {$(VPATH)}id.h
-error.$(OBJEXT): {$(VPATH)}intern.h
-error.$(OBJEXT): {$(VPATH)}internal.h
-error.$(OBJEXT): {$(VPATH)}io.h
-error.$(OBJEXT): {$(VPATH)}known_errors.inc
-error.$(OBJEXT): {$(VPATH)}method.h
-error.$(OBJEXT): {$(VPATH)}missing.h
-error.$(OBJEXT): {$(VPATH)}node.h
-error.$(OBJEXT): {$(VPATH)}oniguruma.h
-error.$(OBJEXT): {$(VPATH)}ruby_atomic.h
-error.$(OBJEXT): {$(VPATH)}st.h
-error.$(OBJEXT): {$(VPATH)}subst.h
-error.$(OBJEXT): {$(VPATH)}thread_$(THREAD_MODEL).h
-error.$(OBJEXT): {$(VPATH)}thread_native.h
-error.$(OBJEXT): {$(VPATH)}vm_core.h
-error.$(OBJEXT): {$(VPATH)}vm_debug.h
-error.$(OBJEXT): {$(VPATH)}vm_opts.h
-eval.$(OBJEXT): $(CCAN_DIR)/check_type/check_type.h
-eval.$(OBJEXT): $(CCAN_DIR)/container_of/container_of.h
-eval.$(OBJEXT): $(CCAN_DIR)/list/list.h
-eval.$(OBJEXT): $(CCAN_DIR)/str/str.h
-eval.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-eval.$(OBJEXT): $(top_srcdir)/include/ruby.h
-eval.$(OBJEXT): {$(VPATH)}config.h
-eval.$(OBJEXT): {$(VPATH)}defines.h
-eval.$(OBJEXT): {$(VPATH)}encoding.h
-eval.$(OBJEXT): {$(VPATH)}eval.c
-eval.$(OBJEXT): {$(VPATH)}eval_error.c
-eval.$(OBJEXT): {$(VPATH)}eval_intern.h
-eval.$(OBJEXT): {$(VPATH)}eval_jump.c
-eval.$(OBJEXT): {$(VPATH)}gc.h
-eval.$(OBJEXT): {$(VPATH)}id.h
-eval.$(OBJEXT): {$(VPATH)}intern.h
-eval.$(OBJEXT): {$(VPATH)}internal.h
-eval.$(OBJEXT): {$(VPATH)}io.h
-eval.$(OBJEXT): {$(VPATH)}iseq.h
-eval.$(OBJEXT): {$(VPATH)}method.h
-eval.$(OBJEXT): {$(VPATH)}missing.h
-eval.$(OBJEXT): {$(VPATH)}node.h
-eval.$(OBJEXT): {$(VPATH)}oniguruma.h
-eval.$(OBJEXT): {$(VPATH)}probes.h
-eval.$(OBJEXT): {$(VPATH)}probes_helper.h
-eval.$(OBJEXT): {$(VPATH)}ruby_atomic.h
-eval.$(OBJEXT): {$(VPATH)}st.h
-eval.$(OBJEXT): {$(VPATH)}subst.h
-eval.$(OBJEXT): {$(VPATH)}thread_$(THREAD_MODEL).h
-eval.$(OBJEXT): {$(VPATH)}thread_native.h
-eval.$(OBJEXT): {$(VPATH)}vm.h
-eval.$(OBJEXT): {$(VPATH)}vm_core.h
-eval.$(OBJEXT): {$(VPATH)}vm_debug.h
-eval.$(OBJEXT): {$(VPATH)}vm_opts.h
-file.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-file.$(OBJEXT): $(top_srcdir)/include/ruby.h
-file.$(OBJEXT): {$(VPATH)}config.h
-file.$(OBJEXT): {$(VPATH)}defines.h
-file.$(OBJEXT): {$(VPATH)}dln.h
-file.$(OBJEXT): {$(VPATH)}encindex.h
-file.$(OBJEXT): {$(VPATH)}encoding.h
-file.$(OBJEXT): {$(VPATH)}file.c
-file.$(OBJEXT): {$(VPATH)}intern.h
-file.$(OBJEXT): {$(VPATH)}internal.h
-file.$(OBJEXT): {$(VPATH)}io.h
-file.$(OBJEXT): {$(VPATH)}missing.h
-file.$(OBJEXT): {$(VPATH)}oniguruma.h
-file.$(OBJEXT): {$(VPATH)}st.h
-file.$(OBJEXT): {$(VPATH)}subst.h
-file.$(OBJEXT): {$(VPATH)}util.h
-gc.$(OBJEXT): $(CCAN_DIR)/check_type/check_type.h
-gc.$(OBJEXT): $(CCAN_DIR)/container_of/container_of.h
-gc.$(OBJEXT): $(CCAN_DIR)/list/list.h
-gc.$(OBJEXT): $(CCAN_DIR)/str/str.h
-gc.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-gc.$(OBJEXT): $(top_srcdir)/include/ruby.h
-gc.$(OBJEXT): {$(VPATH)}config.h
-gc.$(OBJEXT): {$(VPATH)}constant.h
-gc.$(OBJEXT): {$(VPATH)}debug.h
-gc.$(OBJEXT): {$(VPATH)}defines.h
-gc.$(OBJEXT): {$(VPATH)}encoding.h
-gc.$(OBJEXT): {$(VPATH)}eval_intern.h
-gc.$(OBJEXT): {$(VPATH)}gc.c
-gc.$(OBJEXT): {$(VPATH)}gc.h
-gc.$(OBJEXT): {$(VPATH)}id.h
-gc.$(OBJEXT): {$(VPATH)}id_table.h
-gc.$(OBJEXT): {$(VPATH)}intern.h
-gc.$(OBJEXT): {$(VPATH)}internal.h
-gc.$(OBJEXT): {$(VPATH)}io.h
-gc.$(OBJEXT): {$(VPATH)}method.h
-gc.$(OBJEXT): {$(VPATH)}missing.h
-gc.$(OBJEXT): {$(VPATH)}node.h
-gc.$(OBJEXT): {$(VPATH)}oniguruma.h
-gc.$(OBJEXT): {$(VPATH)}probes.h
-gc.$(OBJEXT): {$(VPATH)}re.h
-gc.$(OBJEXT): {$(VPATH)}regenc.h
-gc.$(OBJEXT): {$(VPATH)}regex.h
-gc.$(OBJEXT): {$(VPATH)}regint.h
-gc.$(OBJEXT): {$(VPATH)}ruby_atomic.h
-gc.$(OBJEXT): {$(VPATH)}st.h
-gc.$(OBJEXT): {$(VPATH)}subst.h
-gc.$(OBJEXT): {$(VPATH)}thread.h
-gc.$(OBJEXT): {$(VPATH)}thread_$(THREAD_MODEL).h
-gc.$(OBJEXT): {$(VPATH)}thread_native.h
-gc.$(OBJEXT): {$(VPATH)}util.h
-gc.$(OBJEXT): {$(VPATH)}vm_core.h
-gc.$(OBJEXT): {$(VPATH)}vm_debug.h
-gc.$(OBJEXT): {$(VPATH)}vm_opts.h
-golf_prelude.$(OBJEXT): $(CCAN_DIR)/check_type/check_type.h
-golf_prelude.$(OBJEXT): $(CCAN_DIR)/container_of/container_of.h
-golf_prelude.$(OBJEXT): $(CCAN_DIR)/list/list.h
-golf_prelude.$(OBJEXT): $(CCAN_DIR)/str/str.h
-golf_prelude.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-golf_prelude.$(OBJEXT): $(top_srcdir)/include/ruby.h
-golf_prelude.$(OBJEXT): {$(VPATH)}config.h
-golf_prelude.$(OBJEXT): {$(VPATH)}defines.h
-golf_prelude.$(OBJEXT): {$(VPATH)}encoding.h
-golf_prelude.$(OBJEXT): {$(VPATH)}golf_prelude.c
-golf_prelude.$(OBJEXT): {$(VPATH)}id.h
-golf_prelude.$(OBJEXT): {$(VPATH)}intern.h
-golf_prelude.$(OBJEXT): {$(VPATH)}internal.h
-golf_prelude.$(OBJEXT): {$(VPATH)}io.h
-golf_prelude.$(OBJEXT): {$(VPATH)}method.h
-golf_prelude.$(OBJEXT): {$(VPATH)}missing.h
-golf_prelude.$(OBJEXT): {$(VPATH)}node.h
-golf_prelude.$(OBJEXT): {$(VPATH)}oniguruma.h
-golf_prelude.$(OBJEXT): {$(VPATH)}ruby_atomic.h
-golf_prelude.$(OBJEXT): {$(VPATH)}st.h
-golf_prelude.$(OBJEXT): {$(VPATH)}subst.h
-golf_prelude.$(OBJEXT): {$(VPATH)}thread_$(THREAD_MODEL).h
-golf_prelude.$(OBJEXT): {$(VPATH)}thread_native.h
-golf_prelude.$(OBJEXT): {$(VPATH)}vm_core.h
-golf_prelude.$(OBJEXT): {$(VPATH)}vm_debug.h
-golf_prelude.$(OBJEXT): {$(VPATH)}vm_opts.h
-goruby.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-goruby.$(OBJEXT): $(top_srcdir)/include/ruby.h
-goruby.$(OBJEXT): {$(VPATH)}config.h
-goruby.$(OBJEXT): {$(VPATH)}defines.h
-goruby.$(OBJEXT): {$(VPATH)}goruby.c
-goruby.$(OBJEXT): {$(VPATH)}intern.h
-goruby.$(OBJEXT): {$(VPATH)}main.c
-goruby.$(OBJEXT): {$(VPATH)}missing.h
-goruby.$(OBJEXT): {$(VPATH)}node.h
-goruby.$(OBJEXT): {$(VPATH)}st.h
-goruby.$(OBJEXT): {$(VPATH)}subst.h
-goruby.$(OBJEXT): {$(VPATH)}vm_debug.h
-hash.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-hash.$(OBJEXT): $(top_srcdir)/include/ruby.h
-hash.$(OBJEXT): {$(VPATH)}config.h
-hash.$(OBJEXT): {$(VPATH)}defines.h
-hash.$(OBJEXT): {$(VPATH)}encoding.h
-hash.$(OBJEXT): {$(VPATH)}hash.c
-hash.$(OBJEXT): {$(VPATH)}id.h
-hash.$(OBJEXT): {$(VPATH)}intern.h
-hash.$(OBJEXT): {$(VPATH)}internal.h
-hash.$(OBJEXT): {$(VPATH)}io.h
-hash.$(OBJEXT): {$(VPATH)}missing.h
-hash.$(OBJEXT): {$(VPATH)}oniguruma.h
-hash.$(OBJEXT): {$(VPATH)}probes.h
-hash.$(OBJEXT): {$(VPATH)}st.h
-hash.$(OBJEXT): {$(VPATH)}subst.h
-hash.$(OBJEXT): {$(VPATH)}symbol.h
-hash.$(OBJEXT): {$(VPATH)}util.h
-hash.$(OBJEXT): {$(VPATH)}vm_opts.h
-inits.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-inits.$(OBJEXT): $(top_srcdir)/include/ruby.h
-inits.$(OBJEXT): {$(VPATH)}config.h
-inits.$(OBJEXT): {$(VPATH)}defines.h
-inits.$(OBJEXT): {$(VPATH)}encoding.h
-inits.$(OBJEXT): {$(VPATH)}inits.c
-inits.$(OBJEXT): {$(VPATH)}intern.h
-inits.$(OBJEXT): {$(VPATH)}internal.h
-inits.$(OBJEXT): {$(VPATH)}io.h
-inits.$(OBJEXT): {$(VPATH)}missing.h
-inits.$(OBJEXT): {$(VPATH)}oniguruma.h
-inits.$(OBJEXT): {$(VPATH)}st.h
-inits.$(OBJEXT): {$(VPATH)}subst.h
-io.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-io.$(OBJEXT): $(top_srcdir)/include/ruby.h
-io.$(OBJEXT): {$(VPATH)}config.h
-io.$(OBJEXT): {$(VPATH)}defines.h
-io.$(OBJEXT): {$(VPATH)}dln.h
-io.$(OBJEXT): {$(VPATH)}encindex.h
-io.$(OBJEXT): {$(VPATH)}encoding.h
-io.$(OBJEXT): {$(VPATH)}id.h
-io.$(OBJEXT): {$(VPATH)}intern.h
-io.$(OBJEXT): {$(VPATH)}internal.h
-io.$(OBJEXT): {$(VPATH)}io.c
-io.$(OBJEXT): {$(VPATH)}io.h
-io.$(OBJEXT): {$(VPATH)}missing.h
-io.$(OBJEXT): {$(VPATH)}oniguruma.h
-io.$(OBJEXT): {$(VPATH)}ruby_atomic.h
-io.$(OBJEXT): {$(VPATH)}st.h
-io.$(OBJEXT): {$(VPATH)}subst.h
-io.$(OBJEXT): {$(VPATH)}thread.h
-io.$(OBJEXT): {$(VPATH)}util.h
-iseq.$(OBJEXT): $(CCAN_DIR)/check_type/check_type.h
-iseq.$(OBJEXT): $(CCAN_DIR)/container_of/container_of.h
-iseq.$(OBJEXT): $(CCAN_DIR)/list/list.h
-iseq.$(OBJEXT): $(CCAN_DIR)/str/str.h
-iseq.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-iseq.$(OBJEXT): $(top_srcdir)/include/ruby.h
-iseq.$(OBJEXT): {$(VPATH)}config.h
-iseq.$(OBJEXT): {$(VPATH)}defines.h
-iseq.$(OBJEXT): {$(VPATH)}encoding.h
-iseq.$(OBJEXT): {$(VPATH)}eval_intern.h
-iseq.$(OBJEXT): {$(VPATH)}gc.h
-iseq.$(OBJEXT): {$(VPATH)}id.h
-iseq.$(OBJEXT): {$(VPATH)}insns.inc
-iseq.$(OBJEXT): {$(VPATH)}insns_info.inc
-iseq.$(OBJEXT): {$(VPATH)}intern.h
-iseq.$(OBJEXT): {$(VPATH)}internal.h
-iseq.$(OBJEXT): {$(VPATH)}io.h
-iseq.$(OBJEXT): {$(VPATH)}iseq.c
-iseq.$(OBJEXT): {$(VPATH)}iseq.h
-iseq.$(OBJEXT): {$(VPATH)}method.h
-iseq.$(OBJEXT): {$(VPATH)}missing.h
-iseq.$(OBJEXT): {$(VPATH)}node.h
-iseq.$(OBJEXT): {$(VPATH)}node_name.inc
-iseq.$(OBJEXT): {$(VPATH)}oniguruma.h
-iseq.$(OBJEXT): {$(VPATH)}ruby_atomic.h
-iseq.$(OBJEXT): {$(VPATH)}st.h
-iseq.$(OBJEXT): {$(VPATH)}subst.h
-iseq.$(OBJEXT): {$(VPATH)}thread_$(THREAD_MODEL).h
-iseq.$(OBJEXT): {$(VPATH)}thread_native.h
-iseq.$(OBJEXT): {$(VPATH)}util.h
-iseq.$(OBJEXT): {$(VPATH)}vm_core.h
-iseq.$(OBJEXT): {$(VPATH)}vm_debug.h
-iseq.$(OBJEXT): {$(VPATH)}vm_opts.h
-load.$(OBJEXT): $(CCAN_DIR)/check_type/check_type.h
-load.$(OBJEXT): $(CCAN_DIR)/container_of/container_of.h
-load.$(OBJEXT): $(CCAN_DIR)/list/list.h
-load.$(OBJEXT): $(CCAN_DIR)/str/str.h
-load.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-load.$(OBJEXT): $(top_srcdir)/include/ruby.h
-load.$(OBJEXT): {$(VPATH)}config.h
-load.$(OBJEXT): {$(VPATH)}defines.h
-load.$(OBJEXT): {$(VPATH)}dln.h
-load.$(OBJEXT): {$(VPATH)}encoding.h
-load.$(OBJEXT): {$(VPATH)}eval_intern.h
-load.$(OBJEXT): {$(VPATH)}id.h
-load.$(OBJEXT): {$(VPATH)}intern.h
-load.$(OBJEXT): {$(VPATH)}internal.h
-load.$(OBJEXT): {$(VPATH)}io.h
-load.$(OBJEXT): {$(VPATH)}load.c
-load.$(OBJEXT): {$(VPATH)}method.h
-load.$(OBJEXT): {$(VPATH)}missing.h
-load.$(OBJEXT): {$(VPATH)}node.h
-load.$(OBJEXT): {$(VPATH)}oniguruma.h
-load.$(OBJEXT): {$(VPATH)}probes.h
-load.$(OBJEXT): {$(VPATH)}ruby_atomic.h
-load.$(OBJEXT): {$(VPATH)}st.h
-load.$(OBJEXT): {$(VPATH)}subst.h
-load.$(OBJEXT): {$(VPATH)}thread_$(THREAD_MODEL).h
-load.$(OBJEXT): {$(VPATH)}thread_native.h
-load.$(OBJEXT): {$(VPATH)}util.h
-load.$(OBJEXT): {$(VPATH)}vm_core.h
-load.$(OBJEXT): {$(VPATH)}vm_debug.h
-load.$(OBJEXT): {$(VPATH)}vm_opts.h
-loadpath.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-loadpath.$(OBJEXT): $(hdrdir)/ruby/version.h
-loadpath.$(OBJEXT): $(top_srcdir)/version.h
-loadpath.$(OBJEXT): {$(VPATH)}config.h
-loadpath.$(OBJEXT): {$(VPATH)}defines.h
-loadpath.$(OBJEXT): {$(VPATH)}intern.h
-loadpath.$(OBJEXT): {$(VPATH)}loadpath.c
-loadpath.$(OBJEXT): {$(VPATH)}missing.h
-loadpath.$(OBJEXT): {$(VPATH)}st.h
-loadpath.$(OBJEXT): {$(VPATH)}subst.h
-loadpath.$(OBJEXT): {$(VPATH)}verconf.h
-localeinit.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-localeinit.$(OBJEXT): $(top_srcdir)/include/ruby.h
-localeinit.$(OBJEXT): {$(VPATH)}config.h
-localeinit.$(OBJEXT): {$(VPATH)}defines.h
-localeinit.$(OBJEXT): {$(VPATH)}encindex.h
-localeinit.$(OBJEXT): {$(VPATH)}encoding.h
-localeinit.$(OBJEXT): {$(VPATH)}intern.h
-localeinit.$(OBJEXT): {$(VPATH)}internal.h
-localeinit.$(OBJEXT): {$(VPATH)}io.h
-localeinit.$(OBJEXT): {$(VPATH)}localeinit.c
-localeinit.$(OBJEXT): {$(VPATH)}missing.h
-localeinit.$(OBJEXT): {$(VPATH)}oniguruma.h
-localeinit.$(OBJEXT): {$(VPATH)}st.h
-localeinit.$(OBJEXT): {$(VPATH)}subst.h
-main.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-main.$(OBJEXT): $(top_srcdir)/include/ruby.h
-main.$(OBJEXT): {$(VPATH)}config.h
-main.$(OBJEXT): {$(VPATH)}defines.h
-main.$(OBJEXT): {$(VPATH)}intern.h
-main.$(OBJEXT): {$(VPATH)}main.c
-main.$(OBJEXT): {$(VPATH)}missing.h
-main.$(OBJEXT): {$(VPATH)}node.h
-main.$(OBJEXT): {$(VPATH)}st.h
-main.$(OBJEXT): {$(VPATH)}subst.h
-main.$(OBJEXT): {$(VPATH)}vm_debug.h
-marshal.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-marshal.$(OBJEXT): $(top_srcdir)/include/ruby.h
-marshal.$(OBJEXT): {$(VPATH)}config.h
-marshal.$(OBJEXT): {$(VPATH)}defines.h
-marshal.$(OBJEXT): {$(VPATH)}encindex.h
-marshal.$(OBJEXT): {$(VPATH)}encoding.h
-marshal.$(OBJEXT): {$(VPATH)}id_table.h
-marshal.$(OBJEXT): {$(VPATH)}intern.h
-marshal.$(OBJEXT): {$(VPATH)}internal.h
-marshal.$(OBJEXT): {$(VPATH)}io.h
-marshal.$(OBJEXT): {$(VPATH)}marshal.c
-marshal.$(OBJEXT): {$(VPATH)}missing.h
-marshal.$(OBJEXT): {$(VPATH)}oniguruma.h
-marshal.$(OBJEXT): {$(VPATH)}st.h
-marshal.$(OBJEXT): {$(VPATH)}subst.h
-marshal.$(OBJEXT): {$(VPATH)}util.h
-math.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-math.$(OBJEXT): $(top_srcdir)/include/ruby.h
-math.$(OBJEXT): {$(VPATH)}config.h
-math.$(OBJEXT): {$(VPATH)}defines.h
-math.$(OBJEXT): {$(VPATH)}encoding.h
-math.$(OBJEXT): {$(VPATH)}intern.h
-math.$(OBJEXT): {$(VPATH)}internal.h
-math.$(OBJEXT): {$(VPATH)}io.h
-math.$(OBJEXT): {$(VPATH)}math.c
-math.$(OBJEXT): {$(VPATH)}missing.h
-math.$(OBJEXT): {$(VPATH)}oniguruma.h
-math.$(OBJEXT): {$(VPATH)}st.h
-math.$(OBJEXT): {$(VPATH)}subst.h
-miniinit.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-miniinit.$(OBJEXT): {$(VPATH)}config.h
-miniinit.$(OBJEXT): {$(VPATH)}defines.h
-miniinit.$(OBJEXT): {$(VPATH)}encoding.h
-miniinit.$(OBJEXT): {$(VPATH)}intern.h
-miniinit.$(OBJEXT): {$(VPATH)}miniinit.c
-miniinit.$(OBJEXT): {$(VPATH)}missing.h
-miniinit.$(OBJEXT): {$(VPATH)}oniguruma.h
-miniinit.$(OBJEXT): {$(VPATH)}st.h
-miniinit.$(OBJEXT): {$(VPATH)}subst.h
-miniprelude.$(OBJEXT): {$(VPATH)}miniprelude.c
-node.$(OBJEXT): $(CCAN_DIR)/check_type/check_type.h
-node.$(OBJEXT): $(CCAN_DIR)/container_of/container_of.h
-node.$(OBJEXT): $(CCAN_DIR)/list/list.h
-node.$(OBJEXT): $(CCAN_DIR)/str/str.h
-node.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-node.$(OBJEXT): $(top_srcdir)/include/ruby.h
-node.$(OBJEXT): {$(VPATH)}config.h
-node.$(OBJEXT): {$(VPATH)}defines.h
-node.$(OBJEXT): {$(VPATH)}encoding.h
-node.$(OBJEXT): {$(VPATH)}id.h
-node.$(OBJEXT): {$(VPATH)}intern.h
-node.$(OBJEXT): {$(VPATH)}internal.h
-node.$(OBJEXT): {$(VPATH)}io.h
-node.$(OBJEXT): {$(VPATH)}method.h
-node.$(OBJEXT): {$(VPATH)}missing.h
-node.$(OBJEXT): {$(VPATH)}node.c
-node.$(OBJEXT): {$(VPATH)}node.h
-node.$(OBJEXT): {$(VPATH)}oniguruma.h
-node.$(OBJEXT): {$(VPATH)}ruby_atomic.h
-node.$(OBJEXT): {$(VPATH)}st.h
-node.$(OBJEXT): {$(VPATH)}subst.h
-node.$(OBJEXT): {$(VPATH)}thread_$(THREAD_MODEL).h
-node.$(OBJEXT): {$(VPATH)}thread_native.h
-node.$(OBJEXT): {$(VPATH)}vm_core.h
-node.$(OBJEXT): {$(VPATH)}vm_debug.h
-node.$(OBJEXT): {$(VPATH)}vm_opts.h
-numeric.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-numeric.$(OBJEXT): $(top_srcdir)/include/ruby.h
-numeric.$(OBJEXT): {$(VPATH)}config.h
-numeric.$(OBJEXT): {$(VPATH)}defines.h
-numeric.$(OBJEXT): {$(VPATH)}encoding.h
-numeric.$(OBJEXT): {$(VPATH)}id.h
-numeric.$(OBJEXT): {$(VPATH)}intern.h
-numeric.$(OBJEXT): {$(VPATH)}internal.h
-numeric.$(OBJEXT): {$(VPATH)}io.h
-numeric.$(OBJEXT): {$(VPATH)}missing.h
-numeric.$(OBJEXT): {$(VPATH)}numeric.c
-numeric.$(OBJEXT): {$(VPATH)}oniguruma.h
-numeric.$(OBJEXT): {$(VPATH)}st.h
-numeric.$(OBJEXT): {$(VPATH)}subst.h
-numeric.$(OBJEXT): {$(VPATH)}util.h
-object.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-object.$(OBJEXT): $(top_srcdir)/include/ruby.h
-object.$(OBJEXT): {$(VPATH)}config.h
-object.$(OBJEXT): {$(VPATH)}constant.h
-object.$(OBJEXT): {$(VPATH)}defines.h
-object.$(OBJEXT): {$(VPATH)}encoding.h
-object.$(OBJEXT): {$(VPATH)}id.h
-object.$(OBJEXT): {$(VPATH)}intern.h
-object.$(OBJEXT): {$(VPATH)}internal.h
-object.$(OBJEXT): {$(VPATH)}io.h
-object.$(OBJEXT): {$(VPATH)}missing.h
-object.$(OBJEXT): {$(VPATH)}object.c
-object.$(OBJEXT): {$(VPATH)}oniguruma.h
-object.$(OBJEXT): {$(VPATH)}probes.h
-object.$(OBJEXT): {$(VPATH)}st.h
-object.$(OBJEXT): {$(VPATH)}subst.h
-object.$(OBJEXT): {$(VPATH)}util.h
-object.$(OBJEXT): {$(VPATH)}vm_opts.h
-pack.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-pack.$(OBJEXT): $(top_srcdir)/include/ruby.h
-pack.$(OBJEXT): {$(VPATH)}config.h
-pack.$(OBJEXT): {$(VPATH)}defines.h
-pack.$(OBJEXT): {$(VPATH)}encoding.h
-pack.$(OBJEXT): {$(VPATH)}intern.h
-pack.$(OBJEXT): {$(VPATH)}internal.h
-pack.$(OBJEXT): {$(VPATH)}io.h
-pack.$(OBJEXT): {$(VPATH)}missing.h
-pack.$(OBJEXT): {$(VPATH)}oniguruma.h
-pack.$(OBJEXT): {$(VPATH)}pack.c
-pack.$(OBJEXT): {$(VPATH)}st.h
-pack.$(OBJEXT): {$(VPATH)}subst.h
-parse.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-parse.$(OBJEXT): $(top_srcdir)/include/ruby.h
-parse.$(OBJEXT): {$(VPATH)}config.h
-parse.$(OBJEXT): {$(VPATH)}defines.h
-parse.$(OBJEXT): {$(VPATH)}defs/keywords
-parse.$(OBJEXT): {$(VPATH)}encoding.h
-parse.$(OBJEXT): {$(VPATH)}id.h
-parse.$(OBJEXT): {$(VPATH)}intern.h
-parse.$(OBJEXT): {$(VPATH)}internal.h
-parse.$(OBJEXT): {$(VPATH)}io.h
-parse.$(OBJEXT): {$(VPATH)}lex.c
-parse.$(OBJEXT): {$(VPATH)}missing.h
-parse.$(OBJEXT): {$(VPATH)}node.h
-parse.$(OBJEXT): {$(VPATH)}oniguruma.h
-parse.$(OBJEXT): {$(VPATH)}parse.c
-parse.$(OBJEXT): {$(VPATH)}parse.h
-parse.$(OBJEXT): {$(VPATH)}parse.y
-parse.$(OBJEXT): {$(VPATH)}probes.h
-parse.$(OBJEXT): {$(VPATH)}regenc.h
-parse.$(OBJEXT): {$(VPATH)}regex.h
-parse.$(OBJEXT): {$(VPATH)}st.h
-parse.$(OBJEXT): {$(VPATH)}subst.h
-parse.$(OBJEXT): {$(VPATH)}symbol.h
-parse.$(OBJEXT): {$(VPATH)}util.h
-parse.$(OBJEXT): {$(VPATH)}vm_opts.h
-prelude.$(OBJEXT): $(CCAN_DIR)/check_type/check_type.h
-prelude.$(OBJEXT): $(CCAN_DIR)/container_of/container_of.h
-prelude.$(OBJEXT): $(CCAN_DIR)/list/list.h
-prelude.$(OBJEXT): $(CCAN_DIR)/str/str.h
-prelude.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-prelude.$(OBJEXT): $(top_srcdir)/include/ruby.h
-prelude.$(OBJEXT): {$(VPATH)}config.h
-prelude.$(OBJEXT): {$(VPATH)}defines.h
-prelude.$(OBJEXT): {$(VPATH)}encoding.h
-prelude.$(OBJEXT): {$(VPATH)}id.h
-prelude.$(OBJEXT): {$(VPATH)}intern.h
-prelude.$(OBJEXT): {$(VPATH)}internal.h
-prelude.$(OBJEXT): {$(VPATH)}io.h
-prelude.$(OBJEXT): {$(VPATH)}method.h
-prelude.$(OBJEXT): {$(VPATH)}missing.h
-prelude.$(OBJEXT): {$(VPATH)}node.h
-prelude.$(OBJEXT): {$(VPATH)}oniguruma.h
-prelude.$(OBJEXT): {$(VPATH)}prelude.c
-prelude.$(OBJEXT): {$(VPATH)}ruby_atomic.h
-prelude.$(OBJEXT): {$(VPATH)}st.h
-prelude.$(OBJEXT): {$(VPATH)}subst.h
-prelude.$(OBJEXT): {$(VPATH)}thread_$(THREAD_MODEL).h
-prelude.$(OBJEXT): {$(VPATH)}thread_native.h
-prelude.$(OBJEXT): {$(VPATH)}vm_core.h
-prelude.$(OBJEXT): {$(VPATH)}vm_debug.h
-prelude.$(OBJEXT): {$(VPATH)}vm_opts.h
-proc.$(OBJEXT): $(CCAN_DIR)/check_type/check_type.h
-proc.$(OBJEXT): $(CCAN_DIR)/container_of/container_of.h
-proc.$(OBJEXT): $(CCAN_DIR)/list/list.h
-proc.$(OBJEXT): $(CCAN_DIR)/str/str.h
-proc.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-proc.$(OBJEXT): $(top_srcdir)/include/ruby.h
-proc.$(OBJEXT): {$(VPATH)}config.h
-proc.$(OBJEXT): {$(VPATH)}defines.h
-proc.$(OBJEXT): {$(VPATH)}encoding.h
-proc.$(OBJEXT): {$(VPATH)}eval_intern.h
-proc.$(OBJEXT): {$(VPATH)}gc.h
-proc.$(OBJEXT): {$(VPATH)}id.h
-proc.$(OBJEXT): {$(VPATH)}intern.h
-proc.$(OBJEXT): {$(VPATH)}internal.h
-proc.$(OBJEXT): {$(VPATH)}io.h
-proc.$(OBJEXT): {$(VPATH)}iseq.h
-proc.$(OBJEXT): {$(VPATH)}method.h
-proc.$(OBJEXT): {$(VPATH)}missing.h
-proc.$(OBJEXT): {$(VPATH)}node.h
-proc.$(OBJEXT): {$(VPATH)}oniguruma.h
-proc.$(OBJEXT): {$(VPATH)}proc.c
-proc.$(OBJEXT): {$(VPATH)}ruby_atomic.h
-proc.$(OBJEXT): {$(VPATH)}st.h
-proc.$(OBJEXT): {$(VPATH)}subst.h
-proc.$(OBJEXT): {$(VPATH)}thread_$(THREAD_MODEL).h
-proc.$(OBJEXT): {$(VPATH)}thread_native.h
-proc.$(OBJEXT): {$(VPATH)}vm_core.h
-proc.$(OBJEXT): {$(VPATH)}vm_debug.h
-proc.$(OBJEXT): {$(VPATH)}vm_opts.h
-process.$(OBJEXT): $(CCAN_DIR)/check_type/check_type.h
-process.$(OBJEXT): $(CCAN_DIR)/container_of/container_of.h
-process.$(OBJEXT): $(CCAN_DIR)/list/list.h
-process.$(OBJEXT): $(CCAN_DIR)/str/str.h
-process.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-process.$(OBJEXT): $(top_srcdir)/include/ruby.h
-process.$(OBJEXT): {$(VPATH)}config.h
-process.$(OBJEXT): {$(VPATH)}defines.h
-process.$(OBJEXT): {$(VPATH)}dln.h
-process.$(OBJEXT): {$(VPATH)}encoding.h
-process.$(OBJEXT): {$(VPATH)}id.h
-process.$(OBJEXT): {$(VPATH)}intern.h
-process.$(OBJEXT): {$(VPATH)}internal.h
-process.$(OBJEXT): {$(VPATH)}io.h
-process.$(OBJEXT): {$(VPATH)}method.h
-process.$(OBJEXT): {$(VPATH)}missing.h
-process.$(OBJEXT): {$(VPATH)}node.h
-process.$(OBJEXT): {$(VPATH)}oniguruma.h
-process.$(OBJEXT): {$(VPATH)}process.c
-process.$(OBJEXT): {$(VPATH)}ruby_atomic.h
-process.$(OBJEXT): {$(VPATH)}st.h
-process.$(OBJEXT): {$(VPATH)}subst.h
-process.$(OBJEXT): {$(VPATH)}thread.h
-process.$(OBJEXT): {$(VPATH)}thread_$(THREAD_MODEL).h
-process.$(OBJEXT): {$(VPATH)}thread_native.h
-process.$(OBJEXT): {$(VPATH)}util.h
-process.$(OBJEXT): {$(VPATH)}vm_core.h
-process.$(OBJEXT): {$(VPATH)}vm_debug.h
-process.$(OBJEXT): {$(VPATH)}vm_opts.h
-random.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-random.$(OBJEXT): $(top_srcdir)/include/ruby.h
-random.$(OBJEXT): {$(VPATH)}config.h
-random.$(OBJEXT): {$(VPATH)}defines.h
-random.$(OBJEXT): {$(VPATH)}encoding.h
-random.$(OBJEXT): {$(VPATH)}intern.h
-random.$(OBJEXT): {$(VPATH)}internal.h
-random.$(OBJEXT): {$(VPATH)}io.h
-random.$(OBJEXT): {$(VPATH)}missing.h
-random.$(OBJEXT): {$(VPATH)}oniguruma.h
-random.$(OBJEXT): {$(VPATH)}random.c
-random.$(OBJEXT): {$(VPATH)}ruby_atomic.h
-random.$(OBJEXT): {$(VPATH)}siphash.c
-random.$(OBJEXT): {$(VPATH)}siphash.h
-random.$(OBJEXT): {$(VPATH)}st.h
-random.$(OBJEXT): {$(VPATH)}subst.h
-range.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-range.$(OBJEXT): $(top_srcdir)/include/ruby.h
-range.$(OBJEXT): {$(VPATH)}config.h
-range.$(OBJEXT): {$(VPATH)}defines.h
-range.$(OBJEXT): {$(VPATH)}encoding.h
-range.$(OBJEXT): {$(VPATH)}id.h
-range.$(OBJEXT): {$(VPATH)}intern.h
-range.$(OBJEXT): {$(VPATH)}internal.h
-range.$(OBJEXT): {$(VPATH)}io.h
-range.$(OBJEXT): {$(VPATH)}missing.h
-range.$(OBJEXT): {$(VPATH)}oniguruma.h
-range.$(OBJEXT): {$(VPATH)}range.c
-range.$(OBJEXT): {$(VPATH)}st.h
-range.$(OBJEXT): {$(VPATH)}subst.h
-rational.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-rational.$(OBJEXT): $(top_srcdir)/include/ruby.h
-rational.$(OBJEXT): {$(VPATH)}config.h
-rational.$(OBJEXT): {$(VPATH)}defines.h
-rational.$(OBJEXT): {$(VPATH)}encoding.h
-rational.$(OBJEXT): {$(VPATH)}intern.h
-rational.$(OBJEXT): {$(VPATH)}internal.h
-rational.$(OBJEXT): {$(VPATH)}io.h
-rational.$(OBJEXT): {$(VPATH)}missing.h
-rational.$(OBJEXT): {$(VPATH)}oniguruma.h
-rational.$(OBJEXT): {$(VPATH)}rational.c
-rational.$(OBJEXT): {$(VPATH)}st.h
-rational.$(OBJEXT): {$(VPATH)}subst.h
-re.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-re.$(OBJEXT): $(top_srcdir)/include/ruby.h
-re.$(OBJEXT): {$(VPATH)}config.h
-re.$(OBJEXT): {$(VPATH)}defines.h
-re.$(OBJEXT): {$(VPATH)}encindex.h
-re.$(OBJEXT): {$(VPATH)}encoding.h
-re.$(OBJEXT): {$(VPATH)}intern.h
-re.$(OBJEXT): {$(VPATH)}internal.h
-re.$(OBJEXT): {$(VPATH)}io.h
-re.$(OBJEXT): {$(VPATH)}missing.h
-re.$(OBJEXT): {$(VPATH)}oniguruma.h
-re.$(OBJEXT): {$(VPATH)}re.c
-re.$(OBJEXT): {$(VPATH)}re.h
-re.$(OBJEXT): {$(VPATH)}regenc.h
-re.$(OBJEXT): {$(VPATH)}regex.h
-re.$(OBJEXT): {$(VPATH)}regint.h
-re.$(OBJEXT): {$(VPATH)}st.h
-re.$(OBJEXT): {$(VPATH)}subst.h
-re.$(OBJEXT): {$(VPATH)}util.h
-regcomp.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-regcomp.$(OBJEXT): {$(VPATH)}config.h
-regcomp.$(OBJEXT): {$(VPATH)}defines.h
-regcomp.$(OBJEXT): {$(VPATH)}intern.h
-regcomp.$(OBJEXT): {$(VPATH)}missing.h
-regcomp.$(OBJEXT): {$(VPATH)}oniguruma.h
-regcomp.$(OBJEXT): {$(VPATH)}regcomp.c
-regcomp.$(OBJEXT): {$(VPATH)}regenc.h
-regcomp.$(OBJEXT): {$(VPATH)}regint.h
-regcomp.$(OBJEXT): {$(VPATH)}regparse.h
-regcomp.$(OBJEXT): {$(VPATH)}st.h
-regcomp.$(OBJEXT): {$(VPATH)}subst.h
-regenc.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-regenc.$(OBJEXT): {$(VPATH)}config.h
-regenc.$(OBJEXT): {$(VPATH)}defines.h
-regenc.$(OBJEXT): {$(VPATH)}intern.h
-regenc.$(OBJEXT): {$(VPATH)}missing.h
-regenc.$(OBJEXT): {$(VPATH)}oniguruma.h
-regenc.$(OBJEXT): {$(VPATH)}regenc.c
-regenc.$(OBJEXT): {$(VPATH)}regenc.h
-regenc.$(OBJEXT): {$(VPATH)}regint.h
-regenc.$(OBJEXT): {$(VPATH)}st.h
-regenc.$(OBJEXT): {$(VPATH)}subst.h
-regerror.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-regerror.$(OBJEXT): {$(VPATH)}config.h
-regerror.$(OBJEXT): {$(VPATH)}defines.h
-regerror.$(OBJEXT): {$(VPATH)}intern.h
-regerror.$(OBJEXT): {$(VPATH)}missing.h
-regerror.$(OBJEXT): {$(VPATH)}oniguruma.h
-regerror.$(OBJEXT): {$(VPATH)}regenc.h
-regerror.$(OBJEXT): {$(VPATH)}regerror.c
-regerror.$(OBJEXT): {$(VPATH)}regint.h
-regerror.$(OBJEXT): {$(VPATH)}st.h
-regerror.$(OBJEXT): {$(VPATH)}subst.h
-regexec.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-regexec.$(OBJEXT): {$(VPATH)}config.h
-regexec.$(OBJEXT): {$(VPATH)}defines.h
-regexec.$(OBJEXT): {$(VPATH)}intern.h
-regexec.$(OBJEXT): {$(VPATH)}missing.h
-regexec.$(OBJEXT): {$(VPATH)}oniguruma.h
-regexec.$(OBJEXT): {$(VPATH)}regenc.h
-regexec.$(OBJEXT): {$(VPATH)}regexec.c
-regexec.$(OBJEXT): {$(VPATH)}regint.h
-regexec.$(OBJEXT): {$(VPATH)}st.h
-regexec.$(OBJEXT): {$(VPATH)}subst.h
-regparse.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-regparse.$(OBJEXT): {$(VPATH)}config.h
-regparse.$(OBJEXT): {$(VPATH)}defines.h
-regparse.$(OBJEXT): {$(VPATH)}intern.h
-regparse.$(OBJEXT): {$(VPATH)}missing.h
-regparse.$(OBJEXT): {$(VPATH)}oniguruma.h
-regparse.$(OBJEXT): {$(VPATH)}regenc.h
-regparse.$(OBJEXT): {$(VPATH)}regint.h
-regparse.$(OBJEXT): {$(VPATH)}regparse.c
-regparse.$(OBJEXT): {$(VPATH)}regparse.h
-regparse.$(OBJEXT): {$(VPATH)}st.h
-regparse.$(OBJEXT): {$(VPATH)}subst.h
-regsyntax.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-regsyntax.$(OBJEXT): {$(VPATH)}config.h
-regsyntax.$(OBJEXT): {$(VPATH)}defines.h
-regsyntax.$(OBJEXT): {$(VPATH)}intern.h
-regsyntax.$(OBJEXT): {$(VPATH)}missing.h
-regsyntax.$(OBJEXT): {$(VPATH)}oniguruma.h
-regsyntax.$(OBJEXT): {$(VPATH)}regenc.h
-regsyntax.$(OBJEXT): {$(VPATH)}regint.h
-regsyntax.$(OBJEXT): {$(VPATH)}regsyntax.c
-regsyntax.$(OBJEXT): {$(VPATH)}st.h
-regsyntax.$(OBJEXT): {$(VPATH)}subst.h
-ruby.$(OBJEXT): $(CCAN_DIR)/check_type/check_type.h
-ruby.$(OBJEXT): $(CCAN_DIR)/container_of/container_of.h
-ruby.$(OBJEXT): $(CCAN_DIR)/list/list.h
-ruby.$(OBJEXT): $(CCAN_DIR)/str/str.h
-ruby.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-ruby.$(OBJEXT): $(top_srcdir)/include/ruby.h
-ruby.$(OBJEXT): {$(VPATH)}config.h
-ruby.$(OBJEXT): {$(VPATH)}defines.h
-ruby.$(OBJEXT): {$(VPATH)}dln.h
-ruby.$(OBJEXT): {$(VPATH)}encoding.h
-ruby.$(OBJEXT): {$(VPATH)}eval_intern.h
-ruby.$(OBJEXT): {$(VPATH)}id.h
-ruby.$(OBJEXT): {$(VPATH)}intern.h
-ruby.$(OBJEXT): {$(VPATH)}internal.h
-ruby.$(OBJEXT): {$(VPATH)}io.h
-ruby.$(OBJEXT): {$(VPATH)}method.h
-ruby.$(OBJEXT): {$(VPATH)}missing.h
-ruby.$(OBJEXT): {$(VPATH)}node.h
-ruby.$(OBJEXT): {$(VPATH)}oniguruma.h
-ruby.$(OBJEXT): {$(VPATH)}ruby.c
-ruby.$(OBJEXT): {$(VPATH)}ruby_atomic.h
-ruby.$(OBJEXT): {$(VPATH)}st.h
-ruby.$(OBJEXT): {$(VPATH)}subst.h
-ruby.$(OBJEXT): {$(VPATH)}thread.h
-ruby.$(OBJEXT): {$(VPATH)}thread_$(THREAD_MODEL).h
-ruby.$(OBJEXT): {$(VPATH)}thread_native.h
-ruby.$(OBJEXT): {$(VPATH)}util.h
-ruby.$(OBJEXT): {$(VPATH)}vm_core.h
-ruby.$(OBJEXT): {$(VPATH)}vm_debug.h
-ruby.$(OBJEXT): {$(VPATH)}vm_opts.h
-safe.$(OBJEXT): $(CCAN_DIR)/check_type/check_type.h
-safe.$(OBJEXT): $(CCAN_DIR)/container_of/container_of.h
-safe.$(OBJEXT): $(CCAN_DIR)/list/list.h
-safe.$(OBJEXT): $(CCAN_DIR)/str/str.h
-safe.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-safe.$(OBJEXT): $(top_srcdir)/include/ruby.h
-safe.$(OBJEXT): {$(VPATH)}config.h
-safe.$(OBJEXT): {$(VPATH)}defines.h
-safe.$(OBJEXT): {$(VPATH)}encoding.h
-safe.$(OBJEXT): {$(VPATH)}id.h
-safe.$(OBJEXT): {$(VPATH)}intern.h
-safe.$(OBJEXT): {$(VPATH)}internal.h
-safe.$(OBJEXT): {$(VPATH)}io.h
-safe.$(OBJEXT): {$(VPATH)}method.h
-safe.$(OBJEXT): {$(VPATH)}missing.h
-safe.$(OBJEXT): {$(VPATH)}node.h
-safe.$(OBJEXT): {$(VPATH)}oniguruma.h
-safe.$(OBJEXT): {$(VPATH)}ruby_atomic.h
-safe.$(OBJEXT): {$(VPATH)}safe.c
-safe.$(OBJEXT): {$(VPATH)}st.h
-safe.$(OBJEXT): {$(VPATH)}subst.h
-safe.$(OBJEXT): {$(VPATH)}thread_$(THREAD_MODEL).h
-safe.$(OBJEXT): {$(VPATH)}thread_native.h
-safe.$(OBJEXT): {$(VPATH)}vm_core.h
-safe.$(OBJEXT): {$(VPATH)}vm_debug.h
-safe.$(OBJEXT): {$(VPATH)}vm_opts.h
-setproctitle.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-setproctitle.$(OBJEXT): $(top_srcdir)/include/ruby.h
-setproctitle.$(OBJEXT): {$(VPATH)}config.h
-setproctitle.$(OBJEXT): {$(VPATH)}defines.h
-setproctitle.$(OBJEXT): {$(VPATH)}intern.h
-setproctitle.$(OBJEXT): {$(VPATH)}missing.h
-setproctitle.$(OBJEXT): {$(VPATH)}setproctitle.c
-setproctitle.$(OBJEXT): {$(VPATH)}st.h
-setproctitle.$(OBJEXT): {$(VPATH)}subst.h
-setproctitle.$(OBJEXT): {$(VPATH)}util.h
-signal.$(OBJEXT): $(CCAN_DIR)/check_type/check_type.h
-signal.$(OBJEXT): $(CCAN_DIR)/container_of/container_of.h
-signal.$(OBJEXT): $(CCAN_DIR)/list/list.h
-signal.$(OBJEXT): $(CCAN_DIR)/str/str.h
-signal.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-signal.$(OBJEXT): $(top_srcdir)/include/ruby.h
-signal.$(OBJEXT): {$(VPATH)}config.h
-signal.$(OBJEXT): {$(VPATH)}defines.h
-signal.$(OBJEXT): {$(VPATH)}encoding.h
-signal.$(OBJEXT): {$(VPATH)}eval_intern.h
-signal.$(OBJEXT): {$(VPATH)}id.h
-signal.$(OBJEXT): {$(VPATH)}intern.h
-signal.$(OBJEXT): {$(VPATH)}internal.h
-signal.$(OBJEXT): {$(VPATH)}io.h
-signal.$(OBJEXT): {$(VPATH)}method.h
-signal.$(OBJEXT): {$(VPATH)}missing.h
-signal.$(OBJEXT): {$(VPATH)}node.h
-signal.$(OBJEXT): {$(VPATH)}oniguruma.h
-signal.$(OBJEXT): {$(VPATH)}ruby_atomic.h
-signal.$(OBJEXT): {$(VPATH)}signal.c
-signal.$(OBJEXT): {$(VPATH)}st.h
-signal.$(OBJEXT): {$(VPATH)}subst.h
-signal.$(OBJEXT): {$(VPATH)}thread_$(THREAD_MODEL).h
-signal.$(OBJEXT): {$(VPATH)}thread_native.h
-signal.$(OBJEXT): {$(VPATH)}vm_core.h
-signal.$(OBJEXT): {$(VPATH)}vm_debug.h
-signal.$(OBJEXT): {$(VPATH)}vm_opts.h
-sprintf.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-sprintf.$(OBJEXT): $(top_srcdir)/include/ruby.h
-sprintf.$(OBJEXT): {$(VPATH)}config.h
-sprintf.$(OBJEXT): {$(VPATH)}defines.h
-sprintf.$(OBJEXT): {$(VPATH)}encoding.h
-sprintf.$(OBJEXT): {$(VPATH)}id.h
-sprintf.$(OBJEXT): {$(VPATH)}intern.h
-sprintf.$(OBJEXT): {$(VPATH)}internal.h
-sprintf.$(OBJEXT): {$(VPATH)}io.h
-sprintf.$(OBJEXT): {$(VPATH)}missing.h
-sprintf.$(OBJEXT): {$(VPATH)}oniguruma.h
-sprintf.$(OBJEXT): {$(VPATH)}re.h
-sprintf.$(OBJEXT): {$(VPATH)}regex.h
-sprintf.$(OBJEXT): {$(VPATH)}sprintf.c
-sprintf.$(OBJEXT): {$(VPATH)}st.h
-sprintf.$(OBJEXT): {$(VPATH)}subst.h
-sprintf.$(OBJEXT): {$(VPATH)}vsnprintf.c
-st.$(OBJEXT): $(CCAN_DIR)/check_type/check_type.h
-st.$(OBJEXT): $(CCAN_DIR)/container_of/container_of.h
-st.$(OBJEXT): $(CCAN_DIR)/list/list.h
-st.$(OBJEXT): $(CCAN_DIR)/str/str.h
-st.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-st.$(OBJEXT): $(top_srcdir)/include/ruby.h
-st.$(OBJEXT): {$(VPATH)}config.h
-st.$(OBJEXT): {$(VPATH)}defines.h
-st.$(OBJEXT): {$(VPATH)}encoding.h
-st.$(OBJEXT): {$(VPATH)}intern.h
-st.$(OBJEXT): {$(VPATH)}internal.h
-st.$(OBJEXT): {$(VPATH)}io.h
-st.$(OBJEXT): {$(VPATH)}missing.h
-st.$(OBJEXT): {$(VPATH)}oniguruma.h
-st.$(OBJEXT): {$(VPATH)}st.c
-st.$(OBJEXT): {$(VPATH)}st.h
-st.$(OBJEXT): {$(VPATH)}subst.h
-strftime.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-strftime.$(OBJEXT): {$(VPATH)}config.h
-strftime.$(OBJEXT): {$(VPATH)}defines.h
-strftime.$(OBJEXT): {$(VPATH)}encoding.h
-strftime.$(OBJEXT): {$(VPATH)}intern.h
-strftime.$(OBJEXT): {$(VPATH)}missing.h
-strftime.$(OBJEXT): {$(VPATH)}oniguruma.h
-strftime.$(OBJEXT): {$(VPATH)}st.h
-strftime.$(OBJEXT): {$(VPATH)}strftime.c
-strftime.$(OBJEXT): {$(VPATH)}subst.h
-strftime.$(OBJEXT): {$(VPATH)}timev.h
-string.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-string.$(OBJEXT): $(top_srcdir)/include/ruby.h
-string.$(OBJEXT): {$(VPATH)}config.h
-string.$(OBJEXT): {$(VPATH)}defines.h
-string.$(OBJEXT): {$(VPATH)}encindex.h
-string.$(OBJEXT): {$(VPATH)}encoding.h
-string.$(OBJEXT): {$(VPATH)}gc.h
-string.$(OBJEXT): {$(VPATH)}id.h
-string.$(OBJEXT): {$(VPATH)}intern.h
-string.$(OBJEXT): {$(VPATH)}internal.h
-string.$(OBJEXT): {$(VPATH)}io.h
-string.$(OBJEXT): {$(VPATH)}missing.h
-string.$(OBJEXT): {$(VPATH)}oniguruma.h
-string.$(OBJEXT): {$(VPATH)}probes.h
-string.$(OBJEXT): {$(VPATH)}re.h
-string.$(OBJEXT): {$(VPATH)}regex.h
-string.$(OBJEXT): {$(VPATH)}st.h
-string.$(OBJEXT): {$(VPATH)}string.c
-string.$(OBJEXT): {$(VPATH)}subst.h
-string.$(OBJEXT): {$(VPATH)}vm_opts.h
-strlcat.$(OBJEXT): {$(VPATH)}config.h
-strlcat.$(OBJEXT): {$(VPATH)}missing.h
-strlcat.$(OBJEXT): {$(VPATH)}strlcat.c
-strlcpy.$(OBJEXT): {$(VPATH)}config.h
-strlcpy.$(OBJEXT): {$(VPATH)}missing.h
-strlcpy.$(OBJEXT): {$(VPATH)}strlcpy.c
-struct.$(OBJEXT): $(CCAN_DIR)/check_type/check_type.h
-struct.$(OBJEXT): $(CCAN_DIR)/container_of/container_of.h
-struct.$(OBJEXT): $(CCAN_DIR)/list/list.h
-struct.$(OBJEXT): $(CCAN_DIR)/str/str.h
-struct.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-struct.$(OBJEXT): $(top_srcdir)/include/ruby.h
-struct.$(OBJEXT): {$(VPATH)}config.h
-struct.$(OBJEXT): {$(VPATH)}defines.h
-struct.$(OBJEXT): {$(VPATH)}encoding.h
-struct.$(OBJEXT): {$(VPATH)}id.h
-struct.$(OBJEXT): {$(VPATH)}intern.h
-struct.$(OBJEXT): {$(VPATH)}internal.h
-struct.$(OBJEXT): {$(VPATH)}io.h
-struct.$(OBJEXT): {$(VPATH)}method.h
-struct.$(OBJEXT): {$(VPATH)}missing.h
-struct.$(OBJEXT): {$(VPATH)}node.h
-struct.$(OBJEXT): {$(VPATH)}oniguruma.h
-struct.$(OBJEXT): {$(VPATH)}ruby_atomic.h
-struct.$(OBJEXT): {$(VPATH)}st.h
-struct.$(OBJEXT): {$(VPATH)}struct.c
-struct.$(OBJEXT): {$(VPATH)}subst.h
-struct.$(OBJEXT): {$(VPATH)}thread_$(THREAD_MODEL).h
-struct.$(OBJEXT): {$(VPATH)}thread_native.h
-struct.$(OBJEXT): {$(VPATH)}vm_core.h
-struct.$(OBJEXT): {$(VPATH)}vm_debug.h
-struct.$(OBJEXT): {$(VPATH)}vm_opts.h
-symbol.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-symbol.$(OBJEXT): $(top_srcdir)/include/ruby.h
-symbol.$(OBJEXT): {$(VPATH)}config.h
-symbol.$(OBJEXT): {$(VPATH)}defines.h
-symbol.$(OBJEXT): {$(VPATH)}encoding.h
-symbol.$(OBJEXT): {$(VPATH)}gc.h
-symbol.$(OBJEXT): {$(VPATH)}id.c
-symbol.$(OBJEXT): {$(VPATH)}id.h
-symbol.$(OBJEXT): {$(VPATH)}intern.h
-symbol.$(OBJEXT): {$(VPATH)}internal.h
-symbol.$(OBJEXT): {$(VPATH)}io.h
-symbol.$(OBJEXT): {$(VPATH)}missing.h
-symbol.$(OBJEXT): {$(VPATH)}oniguruma.h
-symbol.$(OBJEXT): {$(VPATH)}probes.h
-symbol.$(OBJEXT): {$(VPATH)}st.h
-symbol.$(OBJEXT): {$(VPATH)}subst.h
-symbol.$(OBJEXT): {$(VPATH)}symbol.c
-symbol.$(OBJEXT): {$(VPATH)}id_table.c
-symbol.$(OBJEXT): {$(VPATH)}id_table.h
-symbol.$(OBJEXT): {$(VPATH)}symbol.h
-symbol.$(OBJEXT): {$(VPATH)}vm_opts.h
-thread.$(OBJEXT): $(CCAN_DIR)/check_type/check_type.h
-thread.$(OBJEXT): $(CCAN_DIR)/container_of/container_of.h
-thread.$(OBJEXT): $(CCAN_DIR)/list/list.h
-thread.$(OBJEXT): $(CCAN_DIR)/str/str.h
-thread.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-thread.$(OBJEXT): $(top_srcdir)/include/ruby.h
-thread.$(OBJEXT): {$(VPATH)}config.h
-thread.$(OBJEXT): {$(VPATH)}defines.h
-thread.$(OBJEXT): {$(VPATH)}encoding.h
-thread.$(OBJEXT): {$(VPATH)}eval_intern.h
-thread.$(OBJEXT): {$(VPATH)}gc.h
-thread.$(OBJEXT): {$(VPATH)}id.h
-thread.$(OBJEXT): {$(VPATH)}intern.h
-thread.$(OBJEXT): {$(VPATH)}internal.h
-thread.$(OBJEXT): {$(VPATH)}io.h
-thread.$(OBJEXT): {$(VPATH)}method.h
-thread.$(OBJEXT): {$(VPATH)}missing.h
-thread.$(OBJEXT): {$(VPATH)}node.h
-thread.$(OBJEXT): {$(VPATH)}oniguruma.h
-thread.$(OBJEXT): {$(VPATH)}ruby_atomic.h
-thread.$(OBJEXT): {$(VPATH)}st.h
-thread.$(OBJEXT): {$(VPATH)}subst.h
-thread.$(OBJEXT): {$(VPATH)}thread.c
-thread.$(OBJEXT): {$(VPATH)}thread.h
-thread.$(OBJEXT): {$(VPATH)}thread_$(THREAD_MODEL).c
-thread.$(OBJEXT): {$(VPATH)}thread_$(THREAD_MODEL).h
-thread.$(OBJEXT): {$(VPATH)}thread_native.h
-thread.$(OBJEXT): {$(VPATH)}thread_sync.c
-thread.$(OBJEXT): {$(VPATH)}timev.h
-thread.$(OBJEXT): {$(VPATH)}vm_core.h
-thread.$(OBJEXT): {$(VPATH)}vm_debug.h
-thread.$(OBJEXT): {$(VPATH)}vm_opts.h
-time.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-time.$(OBJEXT): $(top_srcdir)/include/ruby.h
-time.$(OBJEXT): {$(VPATH)}config.h
-time.$(OBJEXT): {$(VPATH)}defines.h
-time.$(OBJEXT): {$(VPATH)}encoding.h
-time.$(OBJEXT): {$(VPATH)}intern.h
-time.$(OBJEXT): {$(VPATH)}internal.h
-time.$(OBJEXT): {$(VPATH)}io.h
-time.$(OBJEXT): {$(VPATH)}missing.h
-time.$(OBJEXT): {$(VPATH)}oniguruma.h
-time.$(OBJEXT): {$(VPATH)}st.h
-time.$(OBJEXT): {$(VPATH)}subst.h
-time.$(OBJEXT): {$(VPATH)}time.c
-time.$(OBJEXT): {$(VPATH)}timev.h
-transcode.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-transcode.$(OBJEXT): $(top_srcdir)/include/ruby.h
-transcode.$(OBJEXT): {$(VPATH)}config.h
-transcode.$(OBJEXT): {$(VPATH)}defines.h
-transcode.$(OBJEXT): {$(VPATH)}encoding.h
-transcode.$(OBJEXT): {$(VPATH)}intern.h
-transcode.$(OBJEXT): {$(VPATH)}internal.h
-transcode.$(OBJEXT): {$(VPATH)}io.h
-transcode.$(OBJEXT): {$(VPATH)}missing.h
-transcode.$(OBJEXT): {$(VPATH)}oniguruma.h
-transcode.$(OBJEXT): {$(VPATH)}st.h
-transcode.$(OBJEXT): {$(VPATH)}subst.h
-transcode.$(OBJEXT): {$(VPATH)}transcode.c
-transcode.$(OBJEXT): {$(VPATH)}transcode_data.h
-util.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-util.$(OBJEXT): $(top_srcdir)/include/ruby.h
-util.$(OBJEXT): {$(VPATH)}config.h
-util.$(OBJEXT): {$(VPATH)}defines.h
-util.$(OBJEXT): {$(VPATH)}encoding.h
-util.$(OBJEXT): {$(VPATH)}intern.h
-util.$(OBJEXT): {$(VPATH)}internal.h
-util.$(OBJEXT): {$(VPATH)}io.h
-util.$(OBJEXT): {$(VPATH)}missing.h
-util.$(OBJEXT): {$(VPATH)}oniguruma.h
-util.$(OBJEXT): {$(VPATH)}st.h
-util.$(OBJEXT): {$(VPATH)}subst.h
-util.$(OBJEXT): {$(VPATH)}util.c
-util.$(OBJEXT): {$(VPATH)}util.h
-variable.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-variable.$(OBJEXT): $(top_srcdir)/include/ruby.h
-variable.$(OBJEXT): {$(VPATH)}config.h
-variable.$(OBJEXT): {$(VPATH)}constant.h
-variable.$(OBJEXT): {$(VPATH)}defines.h
-variable.$(OBJEXT): {$(VPATH)}encoding.h
-variable.$(OBJEXT): {$(VPATH)}id.h
-variable.$(OBJEXT): {$(VPATH)}intern.h
-variable.$(OBJEXT): {$(VPATH)}internal.h
-variable.$(OBJEXT): {$(VPATH)}io.h
-variable.$(OBJEXT): {$(VPATH)}missing.h
-variable.$(OBJEXT): {$(VPATH)}oniguruma.h
-variable.$(OBJEXT): {$(VPATH)}st.h
-variable.$(OBJEXT): {$(VPATH)}subst.h
-variable.$(OBJEXT): {$(VPATH)}util.h
-variable.$(OBJEXT): {$(VPATH)}variable.c
-version.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-version.$(OBJEXT): $(hdrdir)/ruby/version.h
-version.$(OBJEXT): $(top_srcdir)/revision.h
-version.$(OBJEXT): $(top_srcdir)/version.h
-version.$(OBJEXT): {$(VPATH)}config.h
-version.$(OBJEXT): {$(VPATH)}defines.h
-version.$(OBJEXT): {$(VPATH)}intern.h
-version.$(OBJEXT): {$(VPATH)}missing.h
-version.$(OBJEXT): {$(VPATH)}st.h
-version.$(OBJEXT): {$(VPATH)}subst.h
-version.$(OBJEXT): {$(VPATH)}version.c
-vm.$(OBJEXT): $(CCAN_DIR)/check_type/check_type.h
-vm.$(OBJEXT): $(CCAN_DIR)/container_of/container_of.h
-vm.$(OBJEXT): $(CCAN_DIR)/list/list.h
-vm.$(OBJEXT): $(CCAN_DIR)/str/str.h
-vm.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-vm.$(OBJEXT): $(top_srcdir)/include/ruby.h
-vm.$(OBJEXT): {$(VPATH)}config.h
-vm.$(OBJEXT): {$(VPATH)}constant.h
-vm.$(OBJEXT): {$(VPATH)}defines.h
-vm.$(OBJEXT): {$(VPATH)}encoding.h
-vm.$(OBJEXT): {$(VPATH)}eval_intern.h
-vm.$(OBJEXT): {$(VPATH)}gc.h
-vm.$(OBJEXT): {$(VPATH)}id.h
-vm.$(OBJEXT): {$(VPATH)}id_table.h
-vm.$(OBJEXT): {$(VPATH)}insns.def
-vm.$(OBJEXT): {$(VPATH)}insns.inc
-vm.$(OBJEXT): {$(VPATH)}intern.h
-vm.$(OBJEXT): {$(VPATH)}internal.h
-vm.$(OBJEXT): {$(VPATH)}io.h
-vm.$(OBJEXT): {$(VPATH)}iseq.h
-vm.$(OBJEXT): {$(VPATH)}method.h
-vm.$(OBJEXT): {$(VPATH)}missing.h
-vm.$(OBJEXT): {$(VPATH)}node.h
-vm.$(OBJEXT): {$(VPATH)}oniguruma.h
-vm.$(OBJEXT): {$(VPATH)}probes.h
-vm.$(OBJEXT): {$(VPATH)}probes_helper.h
-vm.$(OBJEXT): {$(VPATH)}ruby_atomic.h
-vm.$(OBJEXT): {$(VPATH)}st.h
-vm.$(OBJEXT): {$(VPATH)}subst.h
-vm.$(OBJEXT): {$(VPATH)}thread_$(THREAD_MODEL).h
-vm.$(OBJEXT): {$(VPATH)}thread_native.h
-vm.$(OBJEXT): {$(VPATH)}vm.c
-vm.$(OBJEXT): {$(VPATH)}vm.h
-vm.$(OBJEXT): {$(VPATH)}vm.inc
-vm.$(OBJEXT): {$(VPATH)}vm_call_iseq_optimized.inc
-vm.$(OBJEXT): {$(VPATH)}vm_args.c
-vm.$(OBJEXT): {$(VPATH)}vm_core.h
-vm.$(OBJEXT): {$(VPATH)}vm_debug.h
-vm.$(OBJEXT): {$(VPATH)}vm_eval.c
-vm.$(OBJEXT): {$(VPATH)}vm_exec.c
-vm.$(OBJEXT): {$(VPATH)}vm_exec.h
-vm.$(OBJEXT): {$(VPATH)}vm_insnhelper.c
-vm.$(OBJEXT): {$(VPATH)}vm_insnhelper.h
-vm.$(OBJEXT): {$(VPATH)}vm_method.c
-vm.$(OBJEXT): {$(VPATH)}vm_opts.h
-vm.$(OBJEXT): {$(VPATH)}vmtc.inc
-vm_backtrace.$(OBJEXT): $(CCAN_DIR)/check_type/check_type.h
-vm_backtrace.$(OBJEXT): $(CCAN_DIR)/container_of/container_of.h
-vm_backtrace.$(OBJEXT): $(CCAN_DIR)/list/list.h
-vm_backtrace.$(OBJEXT): $(CCAN_DIR)/str/str.h
-vm_backtrace.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-vm_backtrace.$(OBJEXT): $(top_srcdir)/include/ruby.h
-vm_backtrace.$(OBJEXT): {$(VPATH)}config.h
-vm_backtrace.$(OBJEXT): {$(VPATH)}debug.h
-vm_backtrace.$(OBJEXT): {$(VPATH)}defines.h
-vm_backtrace.$(OBJEXT): {$(VPATH)}encoding.h
-vm_backtrace.$(OBJEXT): {$(VPATH)}eval_intern.h
-vm_backtrace.$(OBJEXT): {$(VPATH)}id.h
-vm_backtrace.$(OBJEXT): {$(VPATH)}intern.h
-vm_backtrace.$(OBJEXT): {$(VPATH)}internal.h
-vm_backtrace.$(OBJEXT): {$(VPATH)}io.h
-vm_backtrace.$(OBJEXT): {$(VPATH)}iseq.h
-vm_backtrace.$(OBJEXT): {$(VPATH)}method.h
-vm_backtrace.$(OBJEXT): {$(VPATH)}missing.h
-vm_backtrace.$(OBJEXT): {$(VPATH)}node.h
-vm_backtrace.$(OBJEXT): {$(VPATH)}oniguruma.h
-vm_backtrace.$(OBJEXT): {$(VPATH)}ruby_atomic.h
-vm_backtrace.$(OBJEXT): {$(VPATH)}st.h
-vm_backtrace.$(OBJEXT): {$(VPATH)}subst.h
-vm_backtrace.$(OBJEXT): {$(VPATH)}thread_$(THREAD_MODEL).h
-vm_backtrace.$(OBJEXT): {$(VPATH)}thread_native.h
-vm_backtrace.$(OBJEXT): {$(VPATH)}vm_backtrace.c
-vm_backtrace.$(OBJEXT): {$(VPATH)}vm_core.h
-vm_backtrace.$(OBJEXT): {$(VPATH)}vm_debug.h
-vm_backtrace.$(OBJEXT): {$(VPATH)}vm_opts.h
-vm_call.$(OBJEXT): $(top_srcdir)/include/ruby.h
-vm_call.$(OBJEXT): {$(VPATH)}vm_core.h
-vm_call.$(OBJEXT): {$(VPATH)}vm_call_iseq_optimized.inc
-vm_dump.$(OBJEXT): $(CCAN_DIR)/check_type/check_type.h
-vm_dump.$(OBJEXT): $(CCAN_DIR)/container_of/container_of.h
-vm_dump.$(OBJEXT): $(CCAN_DIR)/list/list.h
-vm_dump.$(OBJEXT): $(CCAN_DIR)/str/str.h
-vm_dump.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-vm_dump.$(OBJEXT): $(top_srcdir)/include/ruby.h
-vm_dump.$(OBJEXT): {$(VPATH)}addr2line.h
-vm_dump.$(OBJEXT): {$(VPATH)}config.h
-vm_dump.$(OBJEXT): {$(VPATH)}defines.h
-vm_dump.$(OBJEXT): {$(VPATH)}encoding.h
-vm_dump.$(OBJEXT): {$(VPATH)}id.h
-vm_dump.$(OBJEXT): {$(VPATH)}intern.h
-vm_dump.$(OBJEXT): {$(VPATH)}internal.h
-vm_dump.$(OBJEXT): {$(VPATH)}io.h
-vm_dump.$(OBJEXT): {$(VPATH)}iseq.h
-vm_dump.$(OBJEXT): {$(VPATH)}method.h
-vm_dump.$(OBJEXT): {$(VPATH)}missing.h
-vm_dump.$(OBJEXT): {$(VPATH)}node.h
-vm_dump.$(OBJEXT): {$(VPATH)}oniguruma.h
-vm_dump.$(OBJEXT): {$(VPATH)}ruby_atomic.h
-vm_dump.$(OBJEXT): {$(VPATH)}st.h
-vm_dump.$(OBJEXT): {$(VPATH)}subst.h
-vm_dump.$(OBJEXT): {$(VPATH)}thread_$(THREAD_MODEL).h
-vm_dump.$(OBJEXT): {$(VPATH)}thread_native.h
-vm_dump.$(OBJEXT): {$(VPATH)}vm_core.h
-vm_dump.$(OBJEXT): {$(VPATH)}vm_debug.h
-vm_dump.$(OBJEXT): {$(VPATH)}vm_dump.c
-vm_dump.$(OBJEXT): {$(VPATH)}vm_opts.h
-vm_trace.$(OBJEXT): $(CCAN_DIR)/check_type/check_type.h
-vm_trace.$(OBJEXT): $(CCAN_DIR)/container_of/container_of.h
-vm_trace.$(OBJEXT): $(CCAN_DIR)/list/list.h
-vm_trace.$(OBJEXT): $(CCAN_DIR)/str/str.h
-vm_trace.$(OBJEXT): $(hdrdir)/ruby/ruby.h
-vm_trace.$(OBJEXT): $(top_srcdir)/include/ruby.h
-vm_trace.$(OBJEXT): {$(VPATH)}config.h
-vm_trace.$(OBJEXT): {$(VPATH)}debug.h
-vm_trace.$(OBJEXT): {$(VPATH)}defines.h
-vm_trace.$(OBJEXT): {$(VPATH)}encoding.h
-vm_trace.$(OBJEXT): {$(VPATH)}eval_intern.h
-vm_trace.$(OBJEXT): {$(VPATH)}id.h
-vm_trace.$(OBJEXT): {$(VPATH)}intern.h
-vm_trace.$(OBJEXT): {$(VPATH)}internal.h
-vm_trace.$(OBJEXT): {$(VPATH)}io.h
-vm_trace.$(OBJEXT): {$(VPATH)}method.h
-vm_trace.$(OBJEXT): {$(VPATH)}missing.h
-vm_trace.$(OBJEXT): {$(VPATH)}node.h
-vm_trace.$(OBJEXT): {$(VPATH)}oniguruma.h
-vm_trace.$(OBJEXT): {$(VPATH)}ruby_atomic.h
-vm_trace.$(OBJEXT): {$(VPATH)}st.h
-vm_trace.$(OBJEXT): {$(VPATH)}subst.h
-vm_trace.$(OBJEXT): {$(VPATH)}thread_$(THREAD_MODEL).h
-vm_trace.$(OBJEXT): {$(VPATH)}thread_native.h
-vm_trace.$(OBJEXT): {$(VPATH)}vm_core.h
-vm_trace.$(OBJEXT): {$(VPATH)}vm_debug.h
-vm_trace.$(OBJEXT): {$(VPATH)}vm_opts.h
-vm_trace.$(OBJEXT): {$(VPATH)}vm_trace.c
-# AUTOGENERATED DEPENDENCIES END
diff --git a/compar.c b/compar.c
index 946d0e07e9..ce85198873 100644
--- a/compar.c
+++ b/compar.c
@@ -1,230 +1,100 @@
-/**********************************************************************
+/************************************************
 
   compar.c -
 
   $Author$
+  $Date$
   created at: Thu Aug 26 14:39:48 JST 1993
 
-  Copyright (C) 1993-2007 Yukihiro Matsumoto
+  Copyright (C) 1993-1998 Yukihiro Matsumoto
 
-**********************************************************************/
+************************************************/
 
-#include "ruby/ruby.h"
+#include "ruby.h"
 
-VALUE rb_mComparable;
+VALUE mComparable;
 
 static ID cmp;
 
-void
-rb_cmperr(VALUE x, VALUE y)
-{
-    VALUE classname;
-
-    if (SPECIAL_CONST_P(y) || BUILTIN_TYPE(y) == T_FLOAT) {
-	classname = rb_inspect(y);
-    }
-    else {
-	classname = rb_obj_class(y);
-    }
-    rb_raise(rb_eArgError, "comparison of %"PRIsVALUE" with %"PRIsVALUE" failed",
-	     rb_obj_class(x), classname);
-}
-
-static VALUE
-invcmp_recursive(VALUE x, VALUE y, int recursive)
-{
-    if (recursive) return Qnil;
-    return rb_check_funcall(y, cmp, 1, &x);
-}
-
-VALUE
-rb_invcmp(VALUE x, VALUE y)
-{
-    VALUE invcmp = rb_exec_recursive(invcmp_recursive, x, y);
-    if (invcmp == Qundef || NIL_P(invcmp)) {
-	return Qnil;
-    }
-    else {
-	int result = -rb_cmpint(invcmp, x, y);
-	return INT2FIX(result);
-    }
-}
-
-static VALUE
-cmp_eq_recursive(VALUE arg1, VALUE arg2, int recursive)
-{
-    if (recursive) return Qnil;
-    return rb_funcallv(arg1, cmp, 1, &arg2);
-}
-
-/*
- *  call-seq:
- *     obj == other    -> true or false
- *
- *  Compares two objects based on the receiver's <code><=></code>
- *  method, returning true if it returns 0. Also returns true if
- *  _obj_ and _other_ are the same object.
- *
- *  Even if _obj_ <=> _other_ raised an exception, the exception
- *  is ignored and returns false.
- */
-
 static VALUE
-cmp_equal(VALUE x, VALUE y)
+cmp_eq(x, y)
+    VALUE x, y;
 {
-    VALUE c;
-    if (x == y) return Qtrue;
-
-    c = rb_exec_recursive_paired_outer(cmp_eq_recursive, x, y, y);
+    VALUE c = rb_funcall(x, cmp, 1, y);
+    int t = NUM2INT(c);
 
-    if (NIL_P(c)) return Qfalse;
-    if (rb_cmpint(c, x, y) == 0) return Qtrue;
-    return Qfalse;
+    if (t == 0) return TRUE;
+    return FALSE;
 }
 
-/*
- *  call-seq:
- *     obj > other    -> true or false
- *
- *  Compares two objects based on the receiver's <code><=></code>
- *  method, returning true if it returns 1.
- */
-
 static VALUE
-cmp_gt(VALUE x, VALUE y)
+cmp_gt(x, y)
+    VALUE x, y;
 {
     VALUE c = rb_funcall(x, cmp, 1, y);
+    int t = NUM2INT(c);
 
-    if (rb_cmpint(c, x, y) > 0) return Qtrue;
-    return Qfalse;
+    if (t > 0) return TRUE;
+    return FALSE;
 }
 
-/*
- *  call-seq:
- *     obj >= other    -> true or false
- *
- *  Compares two objects based on the receiver's <code><=></code>
- *  method, returning true if it returns 0 or 1.
- */
-
 static VALUE
-cmp_ge(VALUE x, VALUE y)
+cmp_ge(x, y)
+    VALUE x, y;
 {
     VALUE c = rb_funcall(x, cmp, 1, y);
+    int t = NUM2INT(c);
 
-    if (rb_cmpint(c, x, y) >= 0) return Qtrue;
-    return Qfalse;
+    if (t >= 0) return TRUE;
+    return FALSE;
 }
 
-/*
- *  call-seq:
- *     obj < other    -> true or false
- *
- *  Compares two objects based on the receiver's <code><=></code>
- *  method, returning true if it returns -1.
- */
-
 static VALUE
-cmp_lt(VALUE x, VALUE y)
+cmp_lt(x, y)
+    VALUE x, y;
 {
     VALUE c = rb_funcall(x, cmp, 1, y);
+    int t = NUM2INT(c);
 
-    if (rb_cmpint(c, x, y) < 0) return Qtrue;
-    return Qfalse;
+    if (t < 0) return TRUE;
+    return FALSE;
 }
 
-/*
- *  call-seq:
- *     obj <= other    -> true or false
- *
- *  Compares two objects based on the receiver's <code><=></code>
- *  method, returning true if it returns -1 or 0.
- */
-
 static VALUE
-cmp_le(VALUE x, VALUE y)
+cmp_le(x, y)
+    VALUE x, y;
 {
     VALUE c = rb_funcall(x, cmp, 1, y);
+    int t = NUM2INT(c);
 
-    if (rb_cmpint(c, x, y) <= 0) return Qtrue;
-    return Qfalse;
+    if (t <= 0) return TRUE;
+    return FALSE;
 }
 
-/*
- *  call-seq:
- *     obj.between?(min, max)    -> true or false
- *
- *  Returns <code>false</code> if <i>obj</i> <code><=></code>
- *  <i>min</i> is less than zero or if <i>anObject</i> <code><=></code>
- *  <i>max</i> is greater than zero, <code>true</code> otherwise.
- *
- *     3.between?(1, 5)               #=> true
- *     6.between?(1, 5)               #=> false
- *     'cat'.between?('ant', 'dog')   #=> true
- *     'gnu'.between?('ant', 'dog')   #=> false
- *
- */
-
 static VALUE
-cmp_between(VALUE x, VALUE min, VALUE max)
+cmp_between(x, min, max)
+    VALUE x, min, max;
 {
-    if (RTEST(cmp_lt(x, min))) return Qfalse;
-    if (RTEST(cmp_gt(x, max))) return Qfalse;
-    return Qtrue;
+    VALUE c = rb_funcall(x, cmp, 1, min);
+    int t = NUM2INT(c);
+    if (t < 0) return FALSE;
+
+    c = rb_funcall(x, cmp, 1, max);
+    t = NUM2INT(c);
+    if (t > 0) return FALSE;
+    return TRUE;
 }
 
-/*
- *  The <code>Comparable</code> mixin is used by classes whose objects
- *  may be ordered. The class must define the <code><=></code> operator,
- *  which compares the receiver against another object, returning -1, 0,
- *  or +1 depending on whether the receiver is less than, equal to, or
- *  greater than the other object. If the other object is not comparable
- *  then the <code><=></code> operator should return nil.
- *  <code>Comparable</code> uses
- *  <code><=></code> to implement the conventional comparison operators
- *  (<code><</code>, <code><=</code>, <code>==</code>, <code>>=</code>,
- *  and <code>></code>) and the method <code>between?</code>.
- *
- *     class SizeMatters
- *       include Comparable
- *       attr :str
- *       def <=>(other)
- *         str.size <=> other.str.size
- *       end
- *       def initialize(str)
- *         @str = str
- *       end
- *       def inspect
- *         @str
- *       end
- *     end
- *
- *     s1 = SizeMatters.new("Z")
- *     s2 = SizeMatters.new("YY")
- *     s3 = SizeMatters.new("XXX")
- *     s4 = SizeMatters.new("WWWW")
- *     s5 = SizeMatters.new("VVVVV")
- *
- *     s1 < s2                       #=> true
- *     s4.between?(s1, s3)           #=> false
- *     s4.between?(s3, s5)           #=> true
- *     [ s3, s2, s5, s4, s1 ].sort   #=> [Z, YY, XXX, WWWW, VVVVV]
- *
- */
-
 void
-Init_Comparable(void)
+Init_Comparable()
 {
-#undef rb_intern
-#define rb_intern(str) rb_intern_const(str)
-
-    rb_mComparable = rb_define_module("Comparable");
-    rb_define_method(rb_mComparable, "==", cmp_equal, 1);
-    rb_define_method(rb_mComparable, ">", cmp_gt, 1);
-    rb_define_method(rb_mComparable, ">=", cmp_ge, 1);
-    rb_define_method(rb_mComparable, "<", cmp_lt, 1);
-    rb_define_method(rb_mComparable, "<=", cmp_le, 1);
-    rb_define_method(rb_mComparable, "between?", cmp_between, 2);
+    mComparable = rb_define_module("Comparable");
+    rb_define_method(mComparable, "==", cmp_eq, 1);
+    rb_define_method(mComparable, ">", cmp_gt, 1);
+    rb_define_method(mComparable, ">=", cmp_ge, 1);
+    rb_define_method(mComparable, "<", cmp_lt, 1);
+    rb_define_method(mComparable, "<=", cmp_le, 1);
+    rb_define_method(mComparable, "between?", cmp_between, 2);
 
     cmp = rb_intern("<=>");
 }
diff --git a/compile.c b/compile.c
deleted file mode 100644
index 3e3499405a..0000000000
--- a/compile.c
+++ /dev/null
@@ -1,6574 +0,0 @@
-/**********************************************************************
-
-  compile.c - ruby node tree -> VM instruction sequence
-
-  $Author$
-  created at: 04/01/01 03:42:15 JST
-
-  Copyright (C) 2004-2007 Koichi Sasada
-
-**********************************************************************/
-
-#include "internal.h"
-#include <math.h>
-
-#define USE_INSN_STACK_INCREASE 1
-#include "vm_core.h"
-#include "iseq.h"
-#include "insns.inc"
-#include "insns_info.inc"
-
-#ifdef HAVE_DLADDR
-# include <dlfcn.h>
-#endif
-
-#define FIXNUM_INC(n, i) ((n)+(INT2FIX(i)&~FIXNUM_FLAG))
-#define FIXNUM_OR(n, i) ((n)|INT2FIX(i))
-
-typedef struct iseq_link_element {
-    enum {
-	ISEQ_ELEMENT_NONE,
-	ISEQ_ELEMENT_LABEL,
-	ISEQ_ELEMENT_INSN,
-	ISEQ_ELEMENT_ADJUST
-    } type;
-    struct iseq_link_element *next;
-    struct iseq_link_element *prev;
-} LINK_ELEMENT;
-
-typedef struct iseq_link_anchor {
-    LINK_ELEMENT anchor;
-    LINK_ELEMENT *last;
-} LINK_ANCHOR;
-
-typedef struct iseq_label_data {
-    LINK_ELEMENT link;
-    int label_no;
-    int position;
-    int sc_state;
-    int set;
-    int sp;
-} LABEL;
-
-typedef struct iseq_insn_data {
-    LINK_ELEMENT link;
-    enum ruby_vminsn_type insn_id;
-    unsigned int line_no;
-    int operand_size;
-    int sc_state;
-    VALUE *operands;
-} INSN;
-
-typedef struct iseq_adjust_data {
-    LINK_ELEMENT link;
-    LABEL *label;
-    int line_no;
-} ADJUST;
-
-struct ensure_range {
-    LABEL *begin;
-    LABEL *end;
-    struct ensure_range *next;
-};
-
-struct iseq_compile_data_ensure_node_stack {
-    NODE *ensure_node;
-    struct iseq_compile_data_ensure_node_stack *prev;
-    struct ensure_range *erange;
-};
-
-/**
- * debug function(macro) interface depend on CPDEBUG
- * if it is less than 0, runtime option is in effect.
- *
- * debug level:
- *  0: no debug output
- *  1: show node type
- *  2: show node important parameters
- *  ...
- *  5: show other parameters
- * 10: show every AST array
- */
-
-#ifndef CPDEBUG
-#define CPDEBUG 0
-#endif
-
-#if CPDEBUG >= 0
-#define compile_debug CPDEBUG
-#else
-#define compile_debug iseq->compile_data->option->debug_level
-#endif
-
-#if CPDEBUG
-
-#define compile_debug_print_indent(level) \
-    ruby_debug_print_indent((level), compile_debug, gl_node_level * 2)
-
-#define debugp(header, value) (void) \
-  (compile_debug_print_indent(1) && \
-   ruby_debug_print_value(1, compile_debug, (header), (value)))
-
-#define debugi(header, id)  (void) \
-  (compile_debug_print_indent(1) && \
-   ruby_debug_print_id(1, compile_debug, (header), (id)))
-
-#define debugp_param(header, value)  (void) \
-  (compile_debug_print_indent(1) && \
-   ruby_debug_print_value(1, compile_debug, (header), (value)))
-
-#define debugp_verbose(header, value)  (void) \
-  (compile_debug_print_indent(2) && \
-   ruby_debug_print_value(2, compile_debug, (header), (value)))
-
-#define debugp_verbose_node(header, value)  (void) \
-  (compile_debug_print_indent(10) && \
-   ruby_debug_print_value(10, compile_debug, (header), (value)))
-
-#define debug_node_start(node)  ((void) \
-  (compile_debug_print_indent(1) && \
-   (ruby_debug_print_node(1, CPDEBUG, "", (NODE *)(node)), gl_node_level)), \
-   gl_node_level++)
-
-#define debug_node_end()  gl_node_level --
-
-#else
-
-static inline ID
-r_id(ID id)
-{
-    return id;
-}
-
-static inline VALUE
-r_value(VALUE value)
-{
-    return value;
-}
-
-#define debugi(header, id)                 r_id(id)
-#define debugp(header, value)              r_value(value)
-#define debugp_verbose(header, value)      r_value(value)
-#define debugp_verbose_node(header, value) r_value(value)
-#define debugp_param(header, value)        r_value(value)
-#define debug_node_start(node)             ((void)0)
-#define debug_node_end()                   ((void)0)
-#endif
-
-#if CPDEBUG > 1 || CPDEBUG < 0
-#define printf ruby_debug_printf
-#define debugs if (compile_debug_print_indent(1)) ruby_debug_printf
-#define debug_compile(msg, v) ((void)(compile_debug_print_indent(1) && fputs((msg), stderr)), (v))
-#else
-#define debugs                             if(0)printf
-#define debug_compile(msg, v) (v)
-#endif
-
-
-/* create new label */
-#define NEW_LABEL(l) new_label_body(iseq, (l))
-
-#define iseq_path(iseq) ((iseq)->body->location.path)
-#define iseq_absolute_path(iseq) ((iseq)->body->location.absolute_path)
-
-#define NEW_ISEQ(node, name, type, line_no) \
-  new_child_iseq(iseq, (node), rb_fstring(name), 0, (type), (line_no))
-
-#define NEW_CHILD_ISEQ(node, name, type, line_no) \
-  new_child_iseq(iseq, (node), rb_fstring(name), iseq, (type), (line_no))
-
-/* add instructions */
-#define ADD_SEQ(seq1, seq2) \
-  APPEND_LIST((seq1), (seq2))
-
-/* add an instruction */
-#define ADD_INSN(seq, line, insn) \
-  ADD_ELEM((seq), (LINK_ELEMENT *) new_insn_body(iseq, (line), BIN(insn), 0))
-
-/* add an instruction with some operands (1, 2, 3, 5) */
-#define ADD_INSN1(seq, line, insn, op1) \
-  ADD_ELEM((seq), (LINK_ELEMENT *) \
-           new_insn_body(iseq, (line), BIN(insn), 1, (VALUE)(op1)))
-
-/* add an instruction with label operand (alias of ADD_INSN1) */
-#define ADD_INSNL(seq, line, insn, label) ADD_INSN1(seq, line, insn, label)
-
-#define ADD_INSN2(seq, line, insn, op1, op2) \
-  ADD_ELEM((seq), (LINK_ELEMENT *) \
-           new_insn_body(iseq, (line), BIN(insn), 2, (VALUE)(op1), (VALUE)(op2)))
-
-#define ADD_INSN3(seq, line, insn, op1, op2, op3) \
-  ADD_ELEM((seq), (LINK_ELEMENT *) \
-           new_insn_body(iseq, (line), BIN(insn), 3, (VALUE)(op1), (VALUE)(op2), (VALUE)(op3)))
-
-/* Specific Insn factory */
-#define ADD_SEND(seq, line, id, argc) \
-  ADD_SEND_R((seq), (line), (id), (argc), NULL, (VALUE)INT2FIX(0), NULL)
-
-#define ADD_SEND_WITH_FLAG(seq, line, id, argc, flag) \
-  ADD_SEND_R((seq), (line), (id), (argc), NULL, (VALUE)(flag), NULL)
-
-#define ADD_SEND_WITH_BLOCK(seq, line, id, argc, block) \
-  ADD_SEND_R((seq), (line), (id), (argc), (block), (VALUE)INT2FIX(0), NULL)
-
-#define ADD_CALL_RECEIVER(seq, line) \
-  ADD_INSN((seq), (line), putself)
-
-#define ADD_CALL(seq, line, id, argc) \
-  ADD_SEND_R((seq), (line), (id), (argc), NULL, (VALUE)INT2FIX(VM_CALL_FCALL), NULL)
-
-#define ADD_CALL_WITH_BLOCK(seq, line, id, argc, block) \
-  ADD_SEND_R((seq), (line), (id), (argc), (block), (VALUE)INT2FIX(VM_CALL_FCALL), NULL)
-
-#define ADD_SEND_R(seq, line, id, argc, block, flag, keywords) \
-  ADD_ELEM((seq), (LINK_ELEMENT *) new_insn_send(iseq, (line), (id), (VALUE)(argc), (block), (VALUE)(flag), (keywords)))
-
-#define ADD_TRACE(seq, line, event) \
-  do { \
-      if ((event) == RUBY_EVENT_LINE && iseq->variable_body->coverage && \
-	  (line) != iseq->compile_data->last_coverable_line) { \
-	  RARRAY_ASET(iseq->variable_body->coverage, (line) - 1, INT2FIX(0)); \
-	  iseq->compile_data->last_coverable_line = (line); \
-	  ADD_INSN1((seq), (line), trace, INT2FIX(RUBY_EVENT_COVERAGE)); \
-      } \
-      if (iseq->compile_data->option->trace_instruction) { \
-	  ADD_INSN1((seq), (line), trace, INT2FIX(event)); \
-      } \
-  } while (0)
-
-/* add label */
-#define ADD_LABEL(seq, label) \
-  ADD_ELEM((seq), (LINK_ELEMENT *) (label))
-
-#define APPEND_LABEL(seq, before, label) \
-  APPEND_ELEM((seq), (before), (LINK_ELEMENT *) (label))
-
-#define ADD_ADJUST(seq, line, label) \
-  ADD_ELEM((seq), (LINK_ELEMENT *) new_adjust_body(iseq, (label), (line)))
-
-#define ADD_ADJUST_RESTORE(seq, label) \
-  ADD_ELEM((seq), (LINK_ELEMENT *) new_adjust_body(iseq, (label), -1))
-
-#define ADD_CATCH_ENTRY(type, ls, le, iseqv, lc) do {				\
-    VALUE _e = rb_ary_new3(5, (type),						\
-			   (VALUE)(ls) | 1, (VALUE)(le) | 1,			\
-			   (VALUE)(iseqv), (VALUE)(lc) | 1);			\
-    rb_ary_push(iseq->compile_data->catch_table_ary, freeze_hide_obj(_e));	\
-} while (0)
-
-/* compile node */
-#define COMPILE(anchor, desc, node) \
-  (debug_compile("== " desc "\n", \
-                 iseq_compile_each(iseq, (anchor), (node), 0)))
-
-/* compile node, this node's value will be popped */
-#define COMPILE_POPED(anchor, desc, node)    \
-  (debug_compile("== " desc "\n", \
-                 iseq_compile_each(iseq, (anchor), (node), 1)))
-
-/* compile node, which is popped when 'poped' is true */
-#define COMPILE_(anchor, desc, node, poped)  \
-  (debug_compile("== " desc "\n", \
-                 iseq_compile_each(iseq, (anchor), (node), (poped))))
-
-#define COMPILE_RECV(anchor, desc, node) \
-    (private_recv_p(node) ? \
-     (ADD_INSN(anchor, nd_line(node), putself), VM_CALL_FCALL) : \
-     (COMPILE(anchor, desc, node->nd_recv), 0))
-
-#define OPERAND_AT(insn, idx) \
-  (((INSN*)(insn))->operands[(idx)])
-
-#define INSN_OF(insn) \
-  (((INSN*)(insn))->insn_id)
-
-/* error */
-#define COMPILE_ERROR(strs)                        \
-{                                                  \
-  rb_thread_t *th = GET_THREAD();                  \
-  VALUE tmp = th->errinfo;                         \
-  if (compile_debug) rb_compile_bug strs;          \
-  th->errinfo = iseq->compile_data->err_info;      \
-  rb_compile_error strs;                           \
-  RB_OBJ_WRITE(iseq, &iseq->compile_data->err_info, th->errinfo); \
-  th->errinfo = tmp;                               \
-  ret = 0;                                         \
-  break;                                           \
-}
-
-#define ERROR_ARGS ruby_sourcefile, nd_line(node),
-
-
-#define COMPILE_OK 1
-#define COMPILE_NG 0
-
-
-/* leave name uninitialized so that compiler warn if INIT_ANCHOR is
- * missing */
-#define DECL_ANCHOR(name) \
-  LINK_ANCHOR *name, name##_body__ = {{0,},}
-#define INIT_ANCHOR(name) \
-  (name##_body__.last = &name##_body__.anchor, name = &name##_body__)
-
-static inline VALUE
-freeze_hide_obj(VALUE obj)
-{
-    OBJ_FREEZE(obj);
-    RBASIC_CLEAR_CLASS(obj);
-    return obj;
-}
-
-#include "optinsn.inc"
-#if OPT_INSTRUCTIONS_UNIFICATION
-#include "optunifs.inc"
-#endif
-
-/* for debug */
-#if CPDEBUG < 0
-#define ISEQ_ARG iseq,
-#define ISEQ_ARG_DECLARE rb_iseq_t *iseq,
-#else
-#define ISEQ_ARG
-#define ISEQ_ARG_DECLARE
-#endif
-
-#if CPDEBUG
-#define gl_node_level iseq->compile_data->node_level
-#endif
-
-static void dump_disasm_list(LINK_ELEMENT *elem);
-
-static int insn_data_length(INSN *iobj);
-static int calc_sp_depth(int depth, INSN *iobj);
-
-static INSN *new_insn_body(rb_iseq_t *iseq, int line_no, enum ruby_vminsn_type insn_id, int argc, ...);
-static LABEL *new_label_body(rb_iseq_t *iseq, long line);
-static ADJUST *new_adjust_body(rb_iseq_t *iseq, LABEL *label, int line);
-
-static int iseq_compile_each(rb_iseq_t *iseq, LINK_ANCHOR *anchor, NODE * n, int);
-static int iseq_setup(rb_iseq_t *iseq, LINK_ANCHOR *anchor);
-static int iseq_optimize(rb_iseq_t *iseq, LINK_ANCHOR *anchor);
-static int iseq_insns_unification(rb_iseq_t *iseq, LINK_ANCHOR *anchor);
-
-static int iseq_set_local_table(rb_iseq_t *iseq, const ID *tbl);
-static int iseq_set_exception_local_table(rb_iseq_t *iseq);
-static int iseq_set_arguments(rb_iseq_t *iseq, LINK_ANCHOR *anchor, NODE * node);
-
-static int iseq_set_sequence_stackcaching(rb_iseq_t *iseq, LINK_ANCHOR *anchor);
-static int iseq_set_sequence(rb_iseq_t *iseq, LINK_ANCHOR *anchor);
-static int iseq_set_exception_table(rb_iseq_t *iseq);
-static int iseq_set_optargs_table(rb_iseq_t *iseq);
-
-/*
- * To make Array to LinkedList, use link_anchor
- */
-
-static void
-verify_list(ISEQ_ARG_DECLARE const char *info, LINK_ANCHOR *anchor)
-{
-#if CPDEBUG
-    int flag = 0;
-    LINK_ELEMENT *list, *plist;
-
-    if (!compile_debug) return;
-
-    list = anchor->anchor.next;
-    plist = &anchor->anchor;
-    while (list) {
-	if (plist != list->prev) {
-	    flag += 1;
-	}
-	plist = list;
-	list = list->next;
-    }
-
-    if (anchor->last != plist && anchor->last != 0) {
-	flag |= 0x70000;
-    }
-
-    if (flag != 0) {
-	rb_bug("list verify error: %08x (%s)", flag, info);
-    }
-#endif
-}
-#if CPDEBUG < 0
-#define verify_list(info, anchor) verify_list(iseq, (info), (anchor))
-#endif
-
-/*
- * elem1, elem2 => elem1, elem2, elem
- */
-static void
-ADD_ELEM(ISEQ_ARG_DECLARE LINK_ANCHOR *anchor, LINK_ELEMENT *elem)
-{
-    elem->prev = anchor->last;
-    anchor->last->next = elem;
-    anchor->last = elem;
-    verify_list("add", anchor);
-}
-
-/*
- * elem1, before, elem2 => elem1, before, elem, elem2
- */
-static void
-APPEND_ELEM(ISEQ_ARG_DECLARE LINK_ANCHOR *anchor, LINK_ELEMENT *before, LINK_ELEMENT *elem)
-{
-    elem->prev = before;
-    elem->next = before->next;
-    elem->next->prev = elem;
-    before->next = elem;
-    if (before == anchor->last) anchor->last = elem;
-    verify_list("add", anchor);
-}
-#if CPDEBUG < 0
-#define ADD_ELEM(anchor, elem) ADD_ELEM(iseq, (anchor), (elem))
-#define APPEND_ELEM(anchor, before, elem) APPEND_ELEM(iseq, (anchor), (before), (elem))
-#endif
-
-static int
-iseq_add_mark_object(const rb_iseq_t *iseq, VALUE v)
-{
-    if (!SPECIAL_CONST_P(v)) {
-	rb_iseq_add_mark_object(iseq, v);
-    }
-    return COMPILE_OK;
-}
-
-#define ruby_sourcefile		RSTRING_PTR(iseq->body->location.path)
-
-static int
-iseq_add_mark_object_compile_time(const rb_iseq_t *iseq, VALUE v)
-{
-    if (!SPECIAL_CONST_P(v)) {
-	rb_ary_push(iseq->compile_data->mark_ary, v);
-    }
-    return COMPILE_OK;
-}
-
-static int
-validate_label(st_data_t name, st_data_t label, st_data_t arg)
-{
-    rb_iseq_t *iseq = (rb_iseq_t *)arg;
-    LABEL *lobj = (LABEL *)label;
-    if (!lobj->link.next) {
-	do {
-	    int ret;
-	    COMPILE_ERROR((ruby_sourcefile, lobj->position,
-			   "%"PRIsVALUE": undefined label",
-			   rb_id2str((ID)name)));
-	    if (ret) break;
-	} while (0);
-    }
-    return ST_CONTINUE;
-}
-
-static void
-validate_labels(rb_iseq_t *iseq, st_table *labels_table)
-{
-    st_foreach(labels_table, validate_label, (st_data_t)iseq);
-    if (!NIL_P(iseq->compile_data->err_info)) {
-	rb_exc_raise(iseq->compile_data->err_info);
-    }
-}
-
-VALUE
-rb_iseq_compile_node(rb_iseq_t *iseq, NODE *node)
-{
-    DECL_ANCHOR(ret);
-    INIT_ANCHOR(ret);
-
-    if (node == 0) {
-	COMPILE(ret, "nil", node);
-	iseq_set_local_table(iseq, 0);
-    }
-    else if (nd_type(node) == NODE_SCOPE) {
-	/* iseq type of top, method, class, block */
-	iseq_set_local_table(iseq, node->nd_tbl);
-	iseq_set_arguments(iseq, ret, node->nd_args);
-
-	switch (iseq->body->type) {
-	  case ISEQ_TYPE_BLOCK:
-	    {
-		LABEL *start = iseq->compile_data->start_label = NEW_LABEL(0);
-		LABEL *end = iseq->compile_data->end_label = NEW_LABEL(0);
-
-		ADD_TRACE(ret, FIX2INT(iseq->body->location.first_lineno), RUBY_EVENT_B_CALL);
-		ADD_LABEL(ret, start);
-		COMPILE(ret, "block body", node->nd_body);
-		ADD_LABEL(ret, end);
-		ADD_TRACE(ret, nd_line(node), RUBY_EVENT_B_RETURN);
-
-		/* wide range catch handler must put at last */
-		ADD_CATCH_ENTRY(CATCH_TYPE_REDO, start, end, 0, start);
-		ADD_CATCH_ENTRY(CATCH_TYPE_NEXT, start, end, 0, end);
-		break;
-	    }
-	  case ISEQ_TYPE_CLASS:
-	    {
-		ADD_TRACE(ret, FIX2INT(iseq->body->location.first_lineno), RUBY_EVENT_CLASS);
-		COMPILE(ret, "scoped node", node->nd_body);
-		ADD_TRACE(ret, nd_line(node), RUBY_EVENT_END);
-		break;
-	    }
-	  case ISEQ_TYPE_METHOD:
-	    {
-		ADD_TRACE(ret, FIX2INT(iseq->body->location.first_lineno), RUBY_EVENT_CALL);
-		COMPILE(ret, "scoped node", node->nd_body);
-		ADD_TRACE(ret, nd_line(node), RUBY_EVENT_RETURN);
-		break;
-	    }
-	  default: {
-	    COMPILE(ret, "scoped node", node->nd_body);
-	    break;
-	  }
-	}
-    }
-    else if (RB_TYPE_P((VALUE)node, T_IMEMO)) {
-	const struct vm_ifunc *ifunc = (struct vm_ifunc *)node;
-	/* user callback */
-	(*ifunc->func)(iseq, ret, ifunc->data);
-    }
-    else {
-	switch (iseq->body->type) {
-	  case ISEQ_TYPE_METHOD:
-	  case ISEQ_TYPE_CLASS:
-	  case ISEQ_TYPE_BLOCK:
-	  case ISEQ_TYPE_EVAL:
-	  case ISEQ_TYPE_MAIN:
-	  case ISEQ_TYPE_TOP:
-	    rb_compile_error(ERROR_ARGS "compile/should not be reached: %s:%d",
-			     __FILE__, __LINE__);
-	    break;
-	  case ISEQ_TYPE_RESCUE:
-	    iseq_set_exception_local_table(iseq);
-	    COMPILE(ret, "rescue", node);
-	    break;
-	  case ISEQ_TYPE_ENSURE:
-	    iseq_set_exception_local_table(iseq);
-	    COMPILE_POPED(ret, "ensure", node);
-	    break;
-	  case ISEQ_TYPE_DEFINED_GUARD:
-	    iseq_set_exception_local_table(iseq);
-	    COMPILE(ret, "defined guard", node);
-	    break;
-	  default:
-	    rb_bug("unknown scope");
-	}
-    }
-
-    if (iseq->body->type == ISEQ_TYPE_RESCUE || iseq->body->type == ISEQ_TYPE_ENSURE) {
-	ADD_INSN2(ret, 0, getlocal, INT2FIX(2), INT2FIX(0));
-	ADD_INSN1(ret, 0, throw, INT2FIX(0) /* continue throw */ );
-    }
-    else {
-	ADD_INSN(ret, iseq->compile_data->last_line, leave);
-    }
-
-#if SUPPORT_JOKE
-    if (iseq->compile_data->labels_table) {
-	validate_labels(iseq, iseq->compile_data->labels_table);
-    }
-#endif
-    return iseq_setup(iseq, ret);
-}
-
-int
-rb_iseq_translate_threaded_code(rb_iseq_t *iseq)
-{
-#if OPT_DIRECT_THREADED_CODE || OPT_CALL_THREADED_CODE
-    const void * const *table = rb_vm_get_insns_address_table();
-    unsigned int i;
-    VALUE *encoded = (VALUE *)iseq->body->iseq_encoded;
-
-    for (i = 0; i < iseq->body->iseq_size; /* */ ) {
-	int insn = (int)iseq->body->iseq_encoded[i];
-	int len = insn_len(insn);
-	encoded[i] = (VALUE)table[insn];
-	i += len;
-    }
-#endif
-    return COMPILE_OK;
-}
-
-#if OPT_DIRECT_THREADED_CODE || OPT_CALL_THREADED_CODE
-static int
-rb_vm_insn_addr2insn(const void *addr) /* cold path */
-{
-    int insn;
-    const void * const *table = rb_vm_get_insns_address_table();
-
-    for (insn = 0; insn < VM_INSTRUCTION_SIZE; insn++) {
-	if (table[insn] == addr) {
-	    return insn;
-	}
-    }
-    rb_bug("rb_vm_insn_addr2insn: invalid insn address: %p", addr);
-}
-#endif
-
-VALUE *
-rb_iseq_original_iseq(const rb_iseq_t *iseq) /* cold path */
-{
-    if (iseq->variable_body->iseq) return iseq->variable_body->iseq;
-
-    iseq->variable_body->iseq = ALLOC_N(VALUE, iseq->body->iseq_size);
-
-    MEMCPY(iseq->variable_body->iseq, iseq->body->iseq_encoded, VALUE, iseq->body->iseq_size);
-
-#if OPT_DIRECT_THREADED_CODE || OPT_CALL_THREADED_CODE
-    {
-	unsigned int i;
-
-	for (i = 0; i < iseq->body->iseq_size; /* */ ) {
-	    const void *addr = (const void *)iseq->variable_body->iseq[i];
-	    const int insn = rb_vm_insn_addr2insn(addr);
-
-	    iseq->variable_body->iseq[i] = insn;
-	    i += insn_len(insn);
-	}
-    }
-#endif
-    return iseq->variable_body->iseq;
-}
-
-/*********************************************/
-/* definition of data structure for compiler */
-/*********************************************/
-
-/*
- * On 32-bit SPARC, GCC by default generates SPARC V7 code that may require
- * 8-byte word alignment. On the other hand, Oracle Solaris Studio seems to
- * generate SPARCV8PLUS code with unaligned memory accesss instructions.
- * That is why the STRICT_ALIGNMENT is defined only with GCC.
- */
-#if defined(__sparc) && SIZEOF_VOIDP == 4 && defined(__GNUC__)
-  #define STRICT_ALIGNMENT
-#endif
-
-#ifdef STRICT_ALIGNMENT
-  #if defined(HAVE_TRUE_LONG_LONG) && SIZEOF_LONG_LONG > SIZEOF_VALUE
-    #define ALIGNMENT_SIZE SIZEOF_LONG_LONG
-  #else
-    #define ALIGNMENT_SIZE SIZEOF_VALUE
-  #endif
-  #define PADDING_SIZE_MAX    ((size_t)((ALIGNMENT_SIZE) - 1))
-  #define ALIGNMENT_SIZE_MASK PADDING_SIZE_MAX
-  /* Note: ALIGNMENT_SIZE == (2 ** N) is expected. */
-#else
-  #define PADDING_SIZE_MAX 0
-#endif /* STRICT_ALIGNMENT */
-
-#ifdef STRICT_ALIGNMENT
-/* calculate padding size for aligned memory access */
-static size_t
-calc_padding(void *ptr, size_t size)
-{
-    size_t mis;
-    size_t padding = 0;
-
-    mis = (size_t)ptr & ALIGNMENT_SIZE_MASK;
-    if (mis > 0) {
-        padding = ALIGNMENT_SIZE - mis;
-    }
-/*
- * On 32-bit sparc or equivalents, when a single VALUE is requested
- * and padding == sizeof(VALUE), it is clear that no padding is needed.
- */
-#if ALIGNMENT_SIZE > SIZEOF_VALUE
-    if (size == sizeof(VALUE) && padding == sizeof(VALUE)) {
-        padding = 0;
-    }
-#endif
-
-    return padding;
-}
-#endif /* STRICT_ALIGNMENT */
-
-static void *
-compile_data_alloc(rb_iseq_t *iseq, size_t size)
-{
-    void *ptr = 0;
-    struct iseq_compile_data_storage *storage =
-	iseq->compile_data->storage_current;
-#ifdef STRICT_ALIGNMENT
-    size_t padding = calc_padding((void *)&storage->buff[storage->pos], size);
-#else
-    const size_t padding = 0; /* expected to be optimized by compiler */
-#endif /* STRICT_ALIGNMENT */
-
-    if (size >= INT_MAX - padding) rb_memerror();
-    if (storage->pos + size + padding > storage->size) {
-	unsigned int alloc_size = storage->size;
-
-	while (alloc_size < size + PADDING_SIZE_MAX) {
-	    if (alloc_size >= INT_MAX / 2) rb_memerror();
-	    alloc_size *= 2;
-	}
-	storage->next = (void *)ALLOC_N(char, alloc_size +
-					SIZEOF_ISEQ_COMPILE_DATA_STORAGE);
-	storage = iseq->compile_data->storage_current = storage->next;
-	storage->next = 0;
-	storage->pos = 0;
-	storage->size = alloc_size;
-#ifdef STRICT_ALIGNMENT
-        padding = calc_padding((void *)&storage->buff[storage->pos], size);
-#endif /* STRICT_ALIGNMENT */
-    }
-
-#ifdef STRICT_ALIGNMENT
-    storage->pos += (int)padding;
-#endif /* STRICT_ALIGNMENT */
-
-    ptr = (void *)&storage->buff[storage->pos];
-    storage->pos += (int)size;
-    return ptr;
-}
-
-static INSN *
-compile_data_alloc_insn(rb_iseq_t *iseq)
-{
-    return (INSN *)compile_data_alloc(iseq, sizeof(INSN));
-}
-
-static LABEL *
-compile_data_alloc_label(rb_iseq_t *iseq)
-{
-    return (LABEL *)compile_data_alloc(iseq, sizeof(LABEL));
-}
-
-static ADJUST *
-compile_data_alloc_adjust(rb_iseq_t *iseq)
-{
-    return (ADJUST *)compile_data_alloc(iseq, sizeof(ADJUST));
-}
-
-/*
- * elem1, elemX => elem1, elem2, elemX
- */
-static void
-INSERT_ELEM_NEXT(LINK_ELEMENT *elem1, LINK_ELEMENT *elem2)
-{
-    elem2->next = elem1->next;
-    elem2->prev = elem1;
-    elem1->next = elem2;
-    if (elem2->next) {
-	elem2->next->prev = elem2;
-    }
-}
-
-/*
- * elem1, elemX => elemX, elem2, elem1
- */
-static void
-INSERT_ELEM_PREV(LINK_ELEMENT *elem1, LINK_ELEMENT *elem2)
-{
-    elem2->prev = elem1->prev;
-    elem2->next = elem1;
-    elem1->prev = elem2;
-    if (elem2->prev) {
-	elem2->prev->next = elem2;
-    }
-}
-
-/*
- * elemX, elem1, elemY => elemX, elem2, elemY
- */
-static void
-REPLACE_ELEM(LINK_ELEMENT *elem1, LINK_ELEMENT *elem2)
-{
-    elem2->prev = elem1->prev;
-    elem2->next = elem1->next;
-    if (elem1->prev) {
-	elem1->prev->next = elem2;
-    }
-    if (elem1->next) {
-	elem1->next->prev = elem2;
-    }
-}
-
-static void
-REMOVE_ELEM(LINK_ELEMENT *elem)
-{
-    elem->prev->next = elem->next;
-    if (elem->next) {
-	elem->next->prev = elem->prev;
-    }
-}
-
-static LINK_ELEMENT *
-FIRST_ELEMENT(LINK_ANCHOR *anchor)
-{
-    return anchor->anchor.next;
-}
-
-static LINK_ELEMENT *
-LAST_ELEMENT(LINK_ANCHOR *anchor)
-{
-    return anchor->last;
-}
-
-static LINK_ELEMENT *
-POP_ELEMENT(ISEQ_ARG_DECLARE LINK_ANCHOR *anchor)
-{
-    LINK_ELEMENT *elem = anchor->last;
-    anchor->last = anchor->last->prev;
-    anchor->last->next = 0;
-    verify_list("pop", anchor);
-    return elem;
-}
-#if CPDEBUG < 0
-#define POP_ELEMENT(anchor) POP_ELEMENT(iseq, (anchor))
-#endif
-
-static int
-LIST_SIZE_ZERO(LINK_ANCHOR *anchor)
-{
-    if (anchor->anchor.next == 0) {
-	return 1;
-    }
-    else {
-	return 0;
-    }
-}
-
-/*
- * anc1: e1, e2, e3
- * anc2: e4, e5
- *#=>
- * anc1: e1, e2, e3, e4, e5
- * anc2: e4, e5 (broken)
- */
-static void
-APPEND_LIST(ISEQ_ARG_DECLARE LINK_ANCHOR *anc1, LINK_ANCHOR *anc2)
-{
-    if (anc2->anchor.next) {
-	anc1->last->next = anc2->anchor.next;
-	anc2->anchor.next->prev = anc1->last;
-	anc1->last = anc2->last;
-    }
-    verify_list("append", anc1);
-}
-#if CPDEBUG < 0
-#define APPEND_LIST(anc1, anc2) APPEND_LIST(iseq, (anc1), (anc2))
-#endif
-
-/*
- * anc1: e1, e2, e3
- * anc2: e4, e5
- *#=>
- * anc1: e4, e5, e1, e2, e3
- * anc2: e4, e5 (broken)
- */
-static void
-INSERT_LIST(ISEQ_ARG_DECLARE LINK_ANCHOR *anc1, LINK_ANCHOR *anc2)
-{
-    if (anc2->anchor.next) {
-	LINK_ELEMENT *first = anc1->anchor.next;
-	anc1->anchor.next = anc2->anchor.next;
-	anc1->anchor.next->prev = &anc1->anchor;
-	anc2->last->next = first;
-	if (first) {
-	    first->prev = anc2->last;
-	}
-	else {
-	    anc1->last = anc2->last;
-	}
-    }
-
-    verify_list("append", anc1);
-}
-#if CPDEBUG < 0
-#define INSERT_LIST(anc1, anc2) INSERT_LIST(iseq, (anc1), (anc2))
-#endif
-
-#if CPDEBUG && 0
-static void
-debug_list(ISEQ_ARG_DECLARE LINK_ANCHOR *anchor)
-{
-    LINK_ELEMENT *list = FIRST_ELEMENT(anchor);
-    printf("----\n");
-    printf("anch: %p, frst: %p, last: %p\n", &anchor->anchor,
-	   anchor->anchor.next, anchor->last);
-    while (list) {
-	printf("curr: %p, next: %p, prev: %p, type: %d\n", list, list->next,
-	       list->prev, FIX2INT(list->type));
-	list = list->next;
-    }
-    printf("----\n");
-
-    dump_disasm_list(anchor->anchor.next);
-    verify_list("debug list", anchor);
-}
-#if CPDEBUG < 0
-#define debug_list(anc) debug_list(iseq, (anc))
-#endif
-#endif
-
-static LABEL *
-new_label_body(rb_iseq_t *iseq, long line)
-{
-    LABEL *labelobj = compile_data_alloc_label(iseq);
-
-    labelobj->link.type = ISEQ_ELEMENT_LABEL;
-    labelobj->link.next = 0;
-
-    labelobj->label_no = iseq->compile_data->label_no++;
-    labelobj->sc_state = 0;
-    labelobj->sp = -1;
-    return labelobj;
-}
-
-static ADJUST *
-new_adjust_body(rb_iseq_t *iseq, LABEL *label, int line)
-{
-    ADJUST *adjust = compile_data_alloc_adjust(iseq);
-    adjust->link.type = ISEQ_ELEMENT_ADJUST;
-    adjust->link.next = 0;
-    adjust->label = label;
-    adjust->line_no = line;
-    return adjust;
-}
-
-static INSN *
-new_insn_core(rb_iseq_t *iseq, int line_no,
-	      int insn_id, int argc, VALUE *argv)
-{
-    INSN *iobj = compile_data_alloc_insn(iseq);
-    /* printf("insn_id: %d, line: %d\n", insn_id, line_no); */
-
-    iobj->link.type = ISEQ_ELEMENT_INSN;
-    iobj->link.next = 0;
-    iobj->insn_id = insn_id;
-    iobj->line_no = line_no;
-    iobj->operands = argv;
-    iobj->operand_size = argc;
-    iobj->sc_state = 0;
-    return iobj;
-}
-
-static INSN *
-new_insn_body(rb_iseq_t *iseq, int line_no, enum ruby_vminsn_type insn_id, int argc, ...)
-{
-    VALUE *operands = 0;
-    va_list argv;
-    if (argc > 0) {
-	int i;
-	va_init_list(argv, argc);
-	operands = (VALUE *)compile_data_alloc(iseq, sizeof(VALUE) * argc);
-	for (i = 0; i < argc; i++) {
-	    VALUE v = va_arg(argv, VALUE);
-	    operands[i] = v;
-	}
-	va_end(argv);
-    }
-    return new_insn_core(iseq, line_no, insn_id, argc, operands);
-}
-
-static struct rb_call_info *
-new_callinfo(rb_iseq_t *iseq, ID mid, int argc, unsigned int flag, struct rb_call_info_kw_arg *kw_arg, int has_blockiseq)
-{
-    size_t size = kw_arg != NULL ? sizeof(struct rb_call_info_with_kwarg) : sizeof(struct rb_call_info);
-    struct rb_call_info *ci = (struct rb_call_info *)compile_data_alloc(iseq, size);
-    struct rb_call_info_with_kwarg *ci_kw = (struct rb_call_info_with_kwarg *)ci;
-
-    ci->mid = mid;
-    ci->flag = flag;
-    ci->orig_argc = argc;
-
-    if (kw_arg) {
-	ci->flag |= VM_CALL_KWARG;
-	ci_kw->kw_arg = kw_arg;
-	ci->orig_argc += kw_arg->keyword_len;
-	iseq->body->ci_kw_size++;
-    }
-    else {
-	iseq->body->ci_size++;
-    }
-
-    if (!(ci->flag & (VM_CALL_ARGS_SPLAT | VM_CALL_ARGS_BLOCKARG)) &&
-	kw_arg == NULL && !has_blockiseq) {
-	ci->flag |= VM_CALL_ARGS_SIMPLE;
-    }
-    return ci;
-}
-
-static INSN *
-new_insn_send(rb_iseq_t *iseq, int line_no, ID id, VALUE argc, const rb_iseq_t *blockiseq, VALUE flag, struct rb_call_info_kw_arg *keywords)
-{
-    VALUE *operands = (VALUE *)compile_data_alloc(iseq, sizeof(VALUE) * 3);
-    operands[0] = (VALUE)new_callinfo(iseq, id, FIX2INT(argc), FIX2INT(flag), keywords, blockiseq != NULL);
-    operands[1] = Qfalse; /* cache */
-    operands[2] = (VALUE)blockiseq;
-    return new_insn_core(iseq, line_no, BIN(send), 3, operands);
-}
-
-static rb_iseq_t *
-new_child_iseq(rb_iseq_t *iseq, NODE *node,
-	       VALUE name, const rb_iseq_t *parent, enum iseq_type type, int line_no)
-{
-    rb_iseq_t *ret_iseq;
-
-    debugs("[new_child_iseq]> ---------------------------------------\n");
-    ret_iseq = rb_iseq_new_with_opt(node, name,
-				    iseq_path(iseq), iseq_absolute_path(iseq),
-				    INT2FIX(line_no), parent, type, iseq->compile_data->option);
-    debugs("[new_child_iseq]< ---------------------------------------\n");
-    iseq_add_mark_object(iseq, (VALUE)ret_iseq);
-    return ret_iseq;
-}
-
-static int
-iseq_setup(rb_iseq_t *iseq, LINK_ANCHOR *anchor)
-{
-    /* debugs("[compile step 2] (iseq_array_to_linkedlist)\n"); */
-
-    if (compile_debug > 5)
-	dump_disasm_list(FIRST_ELEMENT(anchor));
-
-    debugs("[compile step 3.1 (iseq_optimize)]\n");
-    iseq_optimize(iseq, anchor);
-
-    if (compile_debug > 5)
-	dump_disasm_list(FIRST_ELEMENT(anchor));
-
-    if (iseq->compile_data->option->instructions_unification) {
-	debugs("[compile step 3.2 (iseq_insns_unification)]\n");
-	iseq_insns_unification(iseq, anchor);
-	if (compile_debug > 5)
-	    dump_disasm_list(FIRST_ELEMENT(anchor));
-    }
-
-    if (iseq->compile_data->option->stack_caching) {
-	debugs("[compile step 3.3 (iseq_set_sequence_stackcaching)]\n");
-	iseq_set_sequence_stackcaching(iseq, anchor);
-	if (compile_debug > 5)
-	    dump_disasm_list(FIRST_ELEMENT(anchor));
-    }
-
-    debugs("[compile step 4.1 (iseq_set_sequence)]\n");
-    iseq_set_sequence(iseq, anchor);
-    if (compile_debug > 5)
-	dump_disasm_list(FIRST_ELEMENT(anchor));
-
-    debugs("[compile step 4.2 (iseq_set_exception_table)]\n");
-    iseq_set_exception_table(iseq);
-
-    debugs("[compile step 4.3 (set_optargs_table)] \n");
-    iseq_set_optargs_table(iseq);
-
-    debugs("[compile step 5 (iseq_translate_threaded_code)] \n");
-    rb_iseq_translate_threaded_code(iseq);
-
-    if (compile_debug > 1) {
-	VALUE str = rb_iseq_disasm(iseq);
-	printf("%s\n", StringValueCStr(str));
-    }
-    debugs("[compile step: finish]\n");
-
-    return 0;
-}
-
-static int
-iseq_set_exception_local_table(rb_iseq_t *iseq)
-{
-    /* TODO: every id table is same -> share it.
-     * Current problem is iseq_free().
-     */
-    ID id_dollar_bang;
-    ID *ids = (ID *)ALLOC_N(ID, 1);
-
-    CONST_ID(id_dollar_bang, "#$!");
-    iseq->body->local_table_size = 1;
-    iseq->body->local_size = iseq->body->local_table_size + 1;
-    ids[0] = id_dollar_bang;
-    iseq->body->local_table = ids;
-    return COMPILE_OK;
-}
-
-static int
-get_lvar_level(const rb_iseq_t *iseq)
-{
-    int lev = 0;
-    while (iseq != iseq->body->local_iseq) {
-	lev++;
-	iseq = iseq->body->parent_iseq;
-    }
-    return lev;
-}
-
-static int
-get_dyna_var_idx_at_raw(const rb_iseq_t *iseq, ID id)
-{
-    unsigned int i;
-
-    for (i = 0; i < iseq->body->local_table_size; i++) {
-	if (iseq->body->local_table[i] == id) {
-	    return (int)i;
-	}
-    }
-    return -1;
-}
-
-static int
-get_local_var_idx(const rb_iseq_t *iseq, ID id)
-{
-    int idx = get_dyna_var_idx_at_raw(iseq->body->local_iseq, id);
-
-    if (idx < 0) {
-	rb_bug("get_local_var_idx: %d", idx);
-    }
-
-    return idx;
-}
-
-static int
-get_dyna_var_idx(const rb_iseq_t *iseq, ID id, int *level, int *ls)
-{
-    int lv = 0, idx = -1;
-
-    while (iseq) {
-	idx = get_dyna_var_idx_at_raw(iseq, id);
-	if (idx >= 0) {
-	    break;
-	}
-	iseq = iseq->body->parent_iseq;
-	lv++;
-    }
-
-    if (idx < 0) {
-	rb_bug("get_dyna_var_idx: -1");
-    }
-
-    *level = lv;
-    *ls = iseq->body->local_size;
-    return idx;
-}
-
-static void
-iseq_calc_param_size(rb_iseq_t *iseq)
-{
-    if (iseq->body->param.flags.has_opt ||
-	iseq->body->param.flags.has_post ||
-	iseq->body->param.flags.has_rest ||
-	iseq->body->param.flags.has_block ||
-	iseq->body->param.flags.has_kw ||
-	iseq->body->param.flags.has_kwrest) {
-
-	if (iseq->body->param.flags.has_block) {
-	    iseq->body->param.size = iseq->body->param.block_start + 1;
-	}
-	else if (iseq->body->param.flags.has_kwrest) {
-	    iseq->body->param.size = iseq->body->param.keyword->rest_start + 1;
-	}
-	else if (iseq->body->param.flags.has_kw) {
-	    iseq->body->param.size = iseq->body->param.keyword->bits_start + 1;
-	}
-	else if (iseq->body->param.flags.has_post) {
-	    iseq->body->param.size = iseq->body->param.post_start + iseq->body->param.post_num;
-	}
-	else if (iseq->body->param.flags.has_rest) {
-	    iseq->body->param.size = iseq->body->param.rest_start + 1;
-	}
-	else if (iseq->body->param.flags.has_opt) {
-	    iseq->body->param.size = iseq->body->param.lead_num + iseq->body->param.opt_num;
-	}
-	else {
-	    rb_bug("unreachable");
-	}
-    }
-    else {
-	iseq->body->param.size = iseq->body->param.lead_num;
-    }
-}
-
-static void
-iseq_set_arguments_keywords(rb_iseq_t *iseq, LINK_ANCHOR *optargs, const struct rb_args_info *args)
-{
-    NODE *node = args->kw_args;
-    struct rb_iseq_param_keyword *keyword;
-    const VALUE default_values = rb_ary_tmp_new(1);
-    const VALUE complex_mark = rb_str_tmp_new(0);
-    int kw = 0, rkw = 0, di = 0, i;
-
-    iseq->body->param.flags.has_kw = TRUE;
-    iseq->body->param.keyword = keyword = ZALLOC_N(struct rb_iseq_param_keyword, 1);
-    keyword->bits_start = get_dyna_var_idx_at_raw(iseq, args->kw_rest_arg->nd_vid);
-
-    while (node) {
-	NODE *val_node = node->nd_body->nd_value;
-	VALUE dv;
-
-	if (val_node == (NODE *)-1) {
-	    ++rkw;
-	}
-	else {
-	    switch (nd_type(val_node)) {
-	      case NODE_LIT:
-		dv = val_node->nd_lit;
-		iseq_add_mark_object(iseq, dv);
-		break;
-	      case NODE_NIL:
-		dv = Qnil;
-		break;
-	      case NODE_TRUE:
-		dv = Qtrue;
-		break;
-	      case NODE_FALSE:
-		dv = Qfalse;
-		break;
-	      default:
-		COMPILE_POPED(optargs, "kwarg", node); /* nd_type(node) == NODE_KW_ARG */
-		dv = complex_mark;
-	    }
-
-	    keyword->num = ++di;
-	    rb_ary_push(default_values, dv);
-	}
-
-	kw++;
-	node = node->nd_next;
-    }
-
-    keyword->num = kw;
-
-    if (args->kw_rest_arg->nd_cflag != 0) {
-	keyword->rest_start =  get_dyna_var_idx_at_raw(iseq, args->kw_rest_arg->nd_cflag);
-	iseq->body->param.flags.has_kwrest = TRUE;
-    }
-    keyword->required_num = rkw;
-    keyword->table = &iseq->body->local_table[keyword->bits_start - keyword->num];
-
-    {
-	VALUE *dvs = ALLOC_N(VALUE, RARRAY_LEN(default_values));
-
-	for (i = 0; i < RARRAY_LEN(default_values); i++) {
-	    VALUE dv = RARRAY_AREF(default_values, i);
-	    if (dv == complex_mark) dv = Qundef;
-	    dvs[i] = dv;
-	}
-
-	keyword->default_values = dvs;
-    }
-}
-
-static int
-iseq_set_arguments(rb_iseq_t *iseq, LINK_ANCHOR *optargs, NODE *node_args)
-{
-    debugs("iseq_set_arguments: %s\n", node_args ? "" : "0");
-
-    if (node_args) {
-	struct rb_args_info *args = node_args->nd_ainfo;
-	ID rest_id = 0;
-	int last_comma = 0;
-	ID block_id = 0;
-
-	if (nd_type(node_args) != NODE_ARGS) {
-	    rb_bug("iseq_set_arguments: NODE_ARGS is expected, but %s",
-		   ruby_node_name(nd_type(node_args)));
-	}
-
-
-	iseq->body->param.lead_num = (int)args->pre_args_num;
-	if (iseq->body->param.lead_num > 0) iseq->body->param.flags.has_lead = TRUE;
-	debugs("  - argc: %d\n", iseq->body->param.lead_num);
-
-	rest_id = args->rest_arg;
-	if (rest_id == 1) {
-	    last_comma = 1;
-	    rest_id = 0;
-	}
-	block_id = args->block_arg;
-
-	if (args->first_post_arg) {
-	    iseq->body->param.post_start = get_dyna_var_idx_at_raw(iseq, args->first_post_arg);
-	    iseq->body->param.post_num = args->post_args_num;
-	    iseq->body->param.flags.has_post = TRUE;
-	}
-
-	if (args->opt_args) {
-	    NODE *node = args->opt_args;
-	    LABEL *label;
-	    VALUE labels = rb_ary_tmp_new(1);
-	    VALUE *opt_table;
-	    int i = 0, j;
-
-	    while (node) {
-		label = NEW_LABEL(nd_line(node));
-		rb_ary_push(labels, (VALUE)label | 1);
-		ADD_LABEL(optargs, label);
-		COMPILE_POPED(optargs, "optarg", node->nd_body);
-		node = node->nd_next;
-		i += 1;
-	    }
-
-	    /* last label */
-	    label = NEW_LABEL(nd_line(node_args));
-	    rb_ary_push(labels, (VALUE)label | 1);
-	    ADD_LABEL(optargs, label);
-
-	    opt_table = ALLOC_N(VALUE, i+1);
-
-	    MEMCPY(opt_table, RARRAY_CONST_PTR(labels), VALUE, i+1);
-	    for (j = 0; j < i+1; j++) {
-		opt_table[j] &= ~1;
-	    }
-	    rb_ary_clear(labels);
-
-	    iseq->body->param.flags.has_opt = TRUE;
-	    iseq->body->param.opt_num = i;
-	    iseq->body->param.opt_table = opt_table;
-	}
-
-	if (args->kw_args) {
-	    iseq_set_arguments_keywords(iseq, optargs, args);
-	}
-	else if (args->kw_rest_arg) {
-	    struct rb_iseq_param_keyword *keyword = ZALLOC_N(struct rb_iseq_param_keyword, 1);
-	    keyword->rest_start = get_dyna_var_idx_at_raw(iseq, args->kw_rest_arg->nd_vid);
-	    iseq->body->param.keyword = keyword;
-	    iseq->body->param.flags.has_kwrest = TRUE;
-	}
-
-	if (args->pre_init) { /* m_init */
-	    COMPILE_POPED(optargs, "init arguments (m)", args->pre_init);
-	}
-	if (args->post_init) { /* p_init */
-	    COMPILE_POPED(optargs, "init arguments (p)", args->post_init);
-	}
-
-	if (rest_id) {
-	    iseq->body->param.rest_start = get_dyna_var_idx_at_raw(iseq, rest_id);
-	    iseq->body->param.flags.has_rest = TRUE;
-	    assert(iseq->body->param.rest_start != -1);
-
-	    if (iseq->body->param.post_start == 0) { /* TODO: why that? */
-		iseq->body->param.post_start = iseq->body->param.rest_start + 1;
-	    }
-	}
-
-	if (block_id) {
-	    iseq->body->param.block_start = get_dyna_var_idx_at_raw(iseq, block_id);
-	    iseq->body->param.flags.has_block = TRUE;
-	}
-
-	iseq_calc_param_size(iseq);
-
-	if (iseq->body->type == ISEQ_TYPE_BLOCK) {
-	    if (iseq->body->param.flags.has_opt    == FALSE &&
-		iseq->body->param.flags.has_post   == FALSE &&
-		iseq->body->param.flags.has_rest   == FALSE &&
-		iseq->body->param.flags.has_kw     == FALSE &&
-		iseq->body->param.flags.has_kwrest == FALSE) {
-
-		if (iseq->body->param.lead_num == 1 && last_comma == 0) {
-		    /* {|a|} */
-		    iseq->body->param.flags.ambiguous_param0 = TRUE;
-		}
-	    }
-	}
-    }
-
-    return COMPILE_OK;
-}
-
-static int
-iseq_set_local_table(rb_iseq_t *iseq, const ID *tbl)
-{
-    int size;
-
-    if (tbl) {
-	size = (int)*tbl;
-	tbl++;
-    }
-    else {
-	size = 0;
-    }
-
-    if (size > 0) {
-	ID *ids = (ID *)ALLOC_N(ID, size);
-	MEMCPY(ids, tbl, ID, size);
-	iseq->body->local_table = ids;
-    }
-
-    iseq->body->local_size = iseq->body->local_table_size = size;
-    iseq->body->local_size += 1;
-    /*
-      if (lfp == dfp ) { // top, class, method
-	  dfp[-1]: svar
-      else {             // block
-          dfp[-1]: cref
-      }
-     */
-
-    debugs("iseq_set_local_table: %d, %d\n", iseq->body->local_size, iseq->body->local_table_size);
-    return COMPILE_OK;
-}
-
-static int
-cdhash_cmp(VALUE val, VALUE lit)
-{
-    if (val == lit) return 0;
-    if (SPECIAL_CONST_P(lit)) {
-	return val != lit;
-    }
-    if (SPECIAL_CONST_P(val) || BUILTIN_TYPE(val) != BUILTIN_TYPE(lit)) {
-	return -1;
-    }
-    if (BUILTIN_TYPE(lit) == T_STRING) {
-	return rb_str_hash_cmp(lit, val);
-    }
-    return !rb_eql(lit, val);
-}
-
-static st_index_t
-cdhash_hash(VALUE a)
-{
-    if (SPECIAL_CONST_P(a)) return (st_index_t)a;
-    if (RB_TYPE_P(a, T_STRING)) return rb_str_hash(a);
-    {
-	VALUE hval = rb_hash(a);
-	return (st_index_t)FIX2LONG(hval);
-    }
-}
-
-static const struct st_hash_type cdhash_type = {
-    cdhash_cmp,
-    cdhash_hash,
-};
-
-struct cdhash_set_label_struct {
-    VALUE hash;
-    int pos;
-    int len;
-};
-
-static int
-cdhash_set_label_i(VALUE key, VALUE val, void *ptr)
-{
-    struct cdhash_set_label_struct *data = (struct cdhash_set_label_struct *)ptr;
-    LABEL *lobj = (LABEL *)(val & ~1);
-    rb_hash_aset(data->hash, key, INT2FIX(lobj->position - (data->pos+data->len)));
-    return ST_CONTINUE;
-}
-
-/**
-  ruby insn object list -> raw instruction sequence
- */
-static int
-iseq_set_sequence(rb_iseq_t *iseq, LINK_ANCHOR *anchor)
-{
-    LABEL *lobj;
-    INSN *iobj;
-    struct iseq_line_info_entry *line_info_table;
-    unsigned int last_line = 0;
-    LINK_ELEMENT *list;
-    VALUE *generated_iseq;
-
-    int insn_num, code_index, line_info_index, sp, stack_max = 0, line = 0;
-
-    /* fix label position */
-    list = FIRST_ELEMENT(anchor);
-    insn_num = code_index = 0;
-    while (list) {
-	switch (list->type) {
-	  case ISEQ_ELEMENT_INSN:
-	    {
-		iobj = (INSN *)list;
-		line = iobj->line_no;
-		code_index += insn_data_length(iobj);
-		insn_num++;
-		break;
-	    }
-	  case ISEQ_ELEMENT_LABEL:
-	    {
-		lobj = (LABEL *)list;
-		lobj->position = code_index;
-		lobj->set = TRUE;
-		break;
-	    }
-	  case ISEQ_ELEMENT_NONE:
-	    {
-		/* ignore */
-		break;
-	    }
-	  case ISEQ_ELEMENT_ADJUST:
-	    {
-		ADJUST *adjust = (ADJUST *)list;
-		if (adjust->line_no != -1) {
-		    code_index += 2 /* insn + 1 operand */;
-		    insn_num++;
-		}
-		break;
-	    }
-	  default:
-	    dump_disasm_list(FIRST_ELEMENT(anchor));
-	    dump_disasm_list(list);
-	    rb_compile_error(RSTRING_PTR(iseq->body->location.path), line,
-			     "error: set_sequence");
-	    break;
-	}
-	list = list->next;
-    }
-
-    /* make instruction sequence */
-    generated_iseq = ALLOC_N(VALUE, code_index);
-    line_info_table = ALLOC_N(struct iseq_line_info_entry, insn_num);
-    iseq->body->is_entries = ZALLOC_N(union iseq_inline_storage_entry, iseq->body->is_size);
-    iseq->body->ci_entries = (struct rb_call_info *)ruby_xmalloc(sizeof(struct rb_call_info) * iseq->body->ci_size +
-								 sizeof(struct rb_call_info_with_kwarg) * iseq->body->ci_kw_size);
-    iseq->body->cc_entries = ZALLOC_N(struct rb_call_cache, iseq->body->ci_size + iseq->body->ci_kw_size);
-
-    iseq->compile_data->ci_index = iseq->compile_data->ci_kw_index = 0;
-
-    list = FIRST_ELEMENT(anchor);
-    line_info_index = code_index = sp = 0;
-
-    while (list) {
-	switch (list->type) {
-	  case ISEQ_ELEMENT_INSN:
-	    {
-		int j, len, insn;
-		const char *types;
-		VALUE *operands;
-
-		iobj = (INSN *)list;
-
-		/* update sp */
-		sp = calc_sp_depth(sp, iobj);
-		if (sp > stack_max) {
-		    stack_max = sp;
-		}
-
-		/* fprintf(stderr, "insn: %-16s, sp: %d\n", insn_name(iobj->insn_id), sp); */
-		operands = iobj->operands;
-		insn = iobj->insn_id;
-		generated_iseq[code_index] = insn;
-		types = insn_op_types(insn);
-		len = insn_len(insn);
-
-		/* operand check */
-		if (iobj->operand_size != len - 1) {
-		    /* printf("operand size miss! (%d, %d)\n", iobj->operand_size, len); */
-		    dump_disasm_list(list);
-		    rb_compile_error(RSTRING_PTR(iseq->body->location.path), iobj->line_no,
-				     "operand size miss! (%d for %d)",
-				     iobj->operand_size, len - 1);
-		    xfree(generated_iseq);
-		    xfree(line_info_table);
-		    return 0;
-		}
-
-		for (j = 0; types[j]; j++) {
-		    char type = types[j];
-		    /* printf("--> [%c - (%d-%d)]\n", type, k, j); */
-		    switch (type) {
-		      case TS_OFFSET:
-			{
-			    /* label(destination position) */
-			    lobj = (LABEL *)operands[j];
-			    if (!lobj->set) {
-				rb_compile_error(RSTRING_PTR(iseq->body->location.path), iobj->line_no,
-						 "unknown label");
-			    }
-			    if (lobj->sp == -1) {
-				lobj->sp = sp;
-			    }
-			    generated_iseq[code_index + 1 + j] = lobj->position - (code_index + len);
-			    break;
-			}
-		      case TS_CDHASH:
-			{
-			    VALUE map = operands[j];
-			    struct cdhash_set_label_struct data;
-                            data.hash = map;
-                            data.pos = code_index;
-                            data.len = len;
-			    rb_hash_foreach(map, cdhash_set_label_i, (VALUE)&data);
-
-			    freeze_hide_obj(map);
-			    generated_iseq[code_index + 1 + j] = map;
-			    break;
-			}
-		      case TS_LINDEX:
-		      case TS_NUM:	/* ulong */
-			generated_iseq[code_index + 1 + j] = FIX2INT(operands[j]);
-			break;
-		      case TS_ISEQ:	/* iseq */
-			{
-			    VALUE v = operands[j];
-			    generated_iseq[code_index + 1 + j] = v;
-			    break;
-			}
-		      case TS_VALUE:	/* VALUE */
-			{
-			    VALUE v = operands[j];
-			    generated_iseq[code_index + 1 + j] = v;
-			    /* to mark ruby object */
-			    iseq_add_mark_object(iseq, v);
-			    break;
-			}
-		      case TS_IC: /* inline cache */
-			{
-			    unsigned int ic_index = FIX2UINT(operands[j]);
-			    IC ic = (IC)&iseq->body->is_entries[ic_index];
-			    if (UNLIKELY(ic_index >= iseq->body->is_size)) {
-				rb_bug("iseq_set_sequence: ic_index overflow: index: %d, size: %d", ic_index, iseq->body->is_size);
-			    }
-			    generated_iseq[code_index + 1 + j] = (VALUE)ic;
-			    break;
-			}
-		      case TS_CALLINFO: /* call info */
-			{
-			    struct rb_call_info *base_ci = (struct rb_call_info *)operands[j];
-			    struct rb_call_info *ci;
-
-			    if (base_ci->flag & VM_CALL_KWARG) {
-				struct rb_call_info_with_kwarg *ci_kw_entries = (struct rb_call_info_with_kwarg *)&iseq->body->ci_entries[iseq->body->ci_size];
-				struct rb_call_info_with_kwarg *ci_kw = &ci_kw_entries[iseq->compile_data->ci_kw_index++];
-				*ci_kw = *((struct rb_call_info_with_kwarg *)base_ci);
-				ci = (struct rb_call_info *)ci_kw;
-				assert(iseq->compile_data->ci_kw_index <= iseq->body->ci_kw_size);
-			    }
-			    else {
-				ci = &iseq->body->ci_entries[iseq->compile_data->ci_index++];
-				*ci = *base_ci;
-				assert(iseq->compile_data->ci_index <= iseq->body->ci_size);
-			    }
-
-			    generated_iseq[code_index + 1 + j] = (VALUE)ci;
-			    break;
-			}
-		      case TS_CALLCACHE:
-			{
-			    struct rb_call_cache *cc = &iseq->body->cc_entries[iseq->compile_data->ci_index + iseq->compile_data->ci_kw_index - 1];
-			    generated_iseq[code_index + 1 + j] = (VALUE)cc;
-			    break;
-			}
-		      case TS_ID: /* ID */
-			generated_iseq[code_index + 1 + j] = SYM2ID(operands[j]);
-			break;
-		      case TS_GENTRY:
-			{
-			    struct rb_global_entry *entry =
-				(struct rb_global_entry *)(operands[j] & (~1));
-			    generated_iseq[code_index + 1 + j] = (VALUE)entry;
-			}
-			break;
-		      case TS_FUNCPTR:
-			generated_iseq[code_index + 1 + j] = operands[j];
-			break;
-		      default:
-			rb_compile_error(RSTRING_PTR(iseq->body->location.path), iobj->line_no,
-					 "unknown operand type: %c", type);
-			xfree(generated_iseq);
-			xfree(line_info_table);
-			return 0;
-		    }
-		}
-		if (last_line != iobj->line_no) {
-		    line_info_table[line_info_index].line_no = last_line = iobj->line_no;
-		    line_info_table[line_info_index].position = code_index;
-		    line_info_index++;
-		}
-		code_index += len;
-		break;
-	    }
-	  case ISEQ_ELEMENT_LABEL:
-	    {
-		lobj = (LABEL *)list;
-		if (lobj->sp == -1) {
-		    lobj->sp = sp;
-		}
-		else {
-		    sp = lobj->sp;
-		}
-		break;
-	    }
-	  case ISEQ_ELEMENT_ADJUST:
-	    {
-		ADJUST *adjust = (ADJUST *)list;
-		int orig_sp = sp;
-
-		if (adjust->label) {
-		    sp = adjust->label->sp;
-		}
-		else {
-		    sp = 0;
-		}
-
-		if (adjust->line_no != -1) {
-		    if (orig_sp - sp > 0) {
-			if (last_line != (unsigned int)adjust->line_no) {
-			    line_info_table[line_info_index].line_no = last_line = adjust->line_no;
-			    line_info_table[line_info_index].position = code_index;
-			    line_info_index++;
-			}
-			generated_iseq[code_index++] = BIN(adjuststack);
-			generated_iseq[code_index++] = orig_sp - sp;
-		    }
-		    else if (orig_sp - sp == 0) {
-			/* jump to next insn */
-			if (last_line != (unsigned int)adjust->line_no) {
-			    line_info_table[line_info_index].line_no = last_line = adjust->line_no;
-			    line_info_table[line_info_index].position = code_index;
-			    line_info_index++;
-			}
-			generated_iseq[code_index++] = BIN(nop);
-			generated_iseq[code_index++] = BIN(nop);
-		    }
-		    else {
-			rb_bug("iseq_set_sequence: adjust bug");
-		    }
-		}
-		break;
-	    }
-	  default:
-	    /* ignore */
-	    break;
-	}
-	list = list->next;
-    }
-
-    iseq->body->iseq_encoded = (void *)generated_iseq;
-    iseq->body->iseq_size = code_index;
-    iseq->body->stack_max = stack_max;
-
-    REALLOC_N(line_info_table, struct iseq_line_info_entry, line_info_index);
-    iseq->body->line_info_table = line_info_table;
-    iseq->body->line_info_size = line_info_index;
-
-    return COMPILE_OK;
-}
-
-static int
-label_get_position(LABEL *lobj)
-{
-    return lobj->position;
-}
-
-static int
-label_get_sp(LABEL *lobj)
-{
-    return lobj->sp;
-}
-
-static int
-iseq_set_exception_table(rb_iseq_t *iseq)
-{
-    const VALUE *tptr, *ptr;
-    unsigned int tlen, i;
-    struct iseq_catch_table_entry *entry;
-
-    tlen = (int)RARRAY_LEN(iseq->compile_data->catch_table_ary);
-    tptr = RARRAY_CONST_PTR(iseq->compile_data->catch_table_ary);
-
-    if (tlen > 0) {
-	struct iseq_catch_table *table = xmalloc(iseq_catch_table_bytes(tlen));
-	table->size = tlen;
-
-	for (i = 0; i < table->size; i++) {
-	    ptr = RARRAY_CONST_PTR(tptr[i]);
-	    entry = &table->entries[i];
-	    entry->type = (enum catch_type)(ptr[0] & 0xffff);
-	    entry->start = label_get_position((LABEL *)(ptr[1] & ~1));
-	    entry->end = label_get_position((LABEL *)(ptr[2] & ~1));
-	    entry->iseq = (rb_iseq_t *)ptr[3];
-
-	    /* register iseq as mark object */
-	    if (entry->iseq != 0) {
-		iseq_add_mark_object(iseq, (VALUE)entry->iseq);
-	    }
-
-	    /* stack depth */
-	    if (ptr[4]) {
-		LABEL *lobj = (LABEL *)(ptr[4] & ~1);
-		entry->cont = label_get_position(lobj);
-		entry->sp = label_get_sp(lobj);
-
-		/* TODO: Dirty Hack!  Fix me */
-		if (entry->type == CATCH_TYPE_RESCUE ||
-		    entry->type == CATCH_TYPE_BREAK ||
-		    entry->type == CATCH_TYPE_NEXT) {
-		    entry->sp--;
-		}
-	    }
-	    else {
-		entry->cont = 0;
-	    }
-	}
-	iseq->body->catch_table = table;
-	RB_OBJ_WRITE(iseq, &iseq->compile_data->catch_table_ary, 0); /* free */
-    }
-    else {
-	iseq->body->catch_table = NULL;
-    }
-
-    return COMPILE_OK;
-}
-
-/*
- * set optional argument table
- *   def foo(a, b=expr1, c=expr2)
- *   =>
- *    b:
- *      expr1
- *    c:
- *      expr2
- */
-static int
-iseq_set_optargs_table(rb_iseq_t *iseq)
-{
-    int i;
-    VALUE *opt_table = (VALUE *)iseq->body->param.opt_table;
-
-    if (iseq->body->param.flags.has_opt) {
-	for (i = 0; i < iseq->body->param.opt_num + 1; i++) {
-	    opt_table[i] = label_get_position((LABEL *)opt_table[i]);
-	}
-    }
-    return COMPILE_OK;
-}
-
-static LINK_ELEMENT *
-get_destination_insn(INSN *iobj)
-{
-    LABEL *lobj = (LABEL *)OPERAND_AT(iobj, 0);
-    LINK_ELEMENT *list;
-
-    list = lobj->link.next;
-    while (list) {
-	if (list->type == ISEQ_ELEMENT_INSN || list->type == ISEQ_ELEMENT_ADJUST) {
-	    break;
-	}
-	list = list->next;
-    }
-    return list;
-}
-
-static LINK_ELEMENT *
-get_next_insn(INSN *iobj)
-{
-    LINK_ELEMENT *list = iobj->link.next;
-
-    while (list) {
-	if (list->type == ISEQ_ELEMENT_INSN || list->type == ISEQ_ELEMENT_ADJUST) {
-	    return list;
-	}
-	list = list->next;
-    }
-    return 0;
-}
-
-static LINK_ELEMENT *
-get_prev_insn(INSN *iobj)
-{
-    LINK_ELEMENT *list = iobj->link.prev;
-
-    while (list) {
-	if (list->type == ISEQ_ELEMENT_INSN || list->type == ISEQ_ELEMENT_ADJUST) {
-	    return list;
-	}
-	list = list->prev;
-    }
-    return 0;
-}
-
-static int
-iseq_peephole_optimize(rb_iseq_t *iseq, LINK_ELEMENT *list, const int do_tailcallopt)
-{
-    INSN *iobj = (INSN *)list;
-  again:
-    if (iobj->insn_id == BIN(jump)) {
-	INSN *niobj, *diobj, *piobj;
-	/*
-	 *  useless jump elimination:
-	 *     jump LABEL1
-	 *     ...
-	 *   LABEL1:
-	 *     jump LABEL2
-	 *
-	 *   => in this case, first jump instruction should jump to
-	 *      LABEL2 directly
-	 */
-	diobj = (INSN *)get_destination_insn(iobj);
-	niobj = (INSN *)get_next_insn(iobj);
-
-	if (diobj == niobj) {
-	    /*
-	     *   jump LABEL
-	     *  LABEL:
-	     * =>
-	     *   LABEL:
-	     */
-	    REMOVE_ELEM(&iobj->link);
-	}
-	else if (iobj != diobj && diobj->insn_id == BIN(jump)) {
-	    if (OPERAND_AT(iobj, 0) != OPERAND_AT(diobj, 0)) {
-		OPERAND_AT(iobj, 0) = OPERAND_AT(diobj, 0);
-		goto again;
-	    }
-	}
-	else if (diobj->insn_id == BIN(leave)) {
-	    /*
-	     *  jump LABEL
-	     *  ...
-	     * LABEL:
-	     *  leave
-	     * =>
-	     *  leave
-	     *  ...
-	     * LABEL:
-	     *  leave
-	     */
-	    INSN *eiobj = new_insn_core(iseq, iobj->line_no, BIN(leave),
-					diobj->operand_size, diobj->operands);
-	    INSN *popiobj = new_insn_core(iseq, iobj->line_no,
-					  BIN(pop), 0, 0);
-	    /* replace */
-	    REPLACE_ELEM((LINK_ELEMENT *)iobj, (LINK_ELEMENT *)eiobj);
-	    INSERT_ELEM_NEXT((LINK_ELEMENT *)eiobj, (LINK_ELEMENT *)popiobj);
-	    iobj = popiobj;
-	}
-	/*
-	 * useless jump elimination (if/unless destination):
-	 *   if   L1
-	 *   jump L2
-	 * L1:
-	 *   ...
-	 * L2:
-	 *
-	 * ==>
-	 *   unless L2
-	 * L1:
-	 *   ...
-	 * L2:
-	 */
-	else if ((piobj = (INSN *)get_prev_insn(iobj)) != 0 &&
-		 (piobj->insn_id == BIN(branchif) ||
-		  piobj->insn_id == BIN(branchunless))) {
-	    if (niobj == (INSN *)get_destination_insn(piobj)) {
-		piobj->insn_id = (piobj->insn_id == BIN(branchif))
-		  ? BIN(branchunless) : BIN(branchif);
-		OPERAND_AT(piobj, 0) = OPERAND_AT(iobj, 0);
-		REMOVE_ELEM(&iobj->link);
-	    }
-	}
-    }
-
-    if (iobj->insn_id == BIN(branchif) ||
-	iobj->insn_id == BIN(branchnil) ||
-	iobj->insn_id == BIN(branchunless)) {
-	/*
-	 *   if L1
-	 *   ...
-	 * L1:
-	 *   jump L2
-	 * =>
-	 *   if L2
-	 */
-	INSN *nobj = (INSN *)get_destination_insn(iobj);
-	INSN *pobj = (INSN *)iobj->link.prev;
-	int prev_dup = (pobj && pobj->insn_id == BIN(dup));
-
-	for (;;) {
-	    if (nobj->insn_id == BIN(jump)) {
-		OPERAND_AT(iobj, 0) = OPERAND_AT(nobj, 0);
-	    }
-	    else if (prev_dup && nobj->insn_id == BIN(dup) &&
-		     !!(nobj = (INSN *)nobj->link.next) &&
-		     /* basic blocks, with no labels in the middle */
-		     nobj->insn_id == iobj->insn_id) {
-		/*
-		 *   dup
-		 *   if L1
-		 *   ...
-		 * L1:
-		 *   dup
-		 *   if L2
-		 * =>
-		 *   dup
-		 *   if L2
-		 *   ...
-		 * L1:
-		 *   dup
-		 *   if L2
-		 */
-		OPERAND_AT(iobj, 0) = OPERAND_AT(nobj, 0);
-	    }
-	    else break;
-	    nobj = (INSN *)get_destination_insn(nobj);
-	}
-    }
-
-    if (iobj->insn_id == BIN(pop)) {
-	/*
-	 *  putself / putnil / putobject obj / putstring "..."
-	 *  pop
-	 * =>
-	 *  # do nothing
-	 */
-	LINK_ELEMENT *prev = iobj->link.prev;
-	if (prev->type == ISEQ_ELEMENT_INSN) {
-	    enum ruby_vminsn_type previ = ((INSN *)prev)->insn_id;
-	    if (previ == BIN(putobject) || previ == BIN(putnil) ||
-		previ == BIN(putself) || previ == BIN(putstring)) {
-		/* just push operand or static value and pop soon, no
-		 * side effects */
-		REMOVE_ELEM(prev);
-		REMOVE_ELEM(&iobj->link);
-	    }
-	}
-    }
-
-    if (do_tailcallopt && iobj->insn_id == BIN(leave)) {
-	/*
-	 *  send ...
-	 *  leave
-	 * =>
-	 *  send ..., ... | VM_CALL_TAILCALL, ...
-	 *  leave # unreachable
-	 */
-	INSN *piobj = (INSN *)get_prev_insn((INSN *)list);
-	enum ruby_vminsn_type previ = piobj->insn_id;
-
-	if (previ == BIN(send) || previ == BIN(opt_send_without_block) || previ == BIN(invokesuper)) {
-	    struct rb_call_info *ci = (struct rb_call_info *)piobj->operands[0];
-	    rb_iseq_t *blockiseq = (rb_iseq_t *)piobj->operands[1];
-	    if (blockiseq == 0) {
-		ci->flag |= VM_CALL_TAILCALL;
-	    }
-	}
-    }
-    return COMPILE_OK;
-}
-
-static int
-insn_set_specialized_instruction(rb_iseq_t *iseq, INSN *iobj, int insn_id)
-{
-    iobj->insn_id = insn_id;
-    iobj->operand_size = insn_len(insn_id) - 1;
-
-    if (insn_id == BIN(opt_neq)) {
-	VALUE *old_operands = iobj->operands;
-	iobj->operand_size = 4;
-	iobj->operands = (VALUE *)compile_data_alloc(iseq, iobj->operand_size * sizeof(VALUE));
-	iobj->operands[0] = old_operands[0];
-	iobj->operands[1] = Qfalse; /* CALL_CACHE */
-	iobj->operands[2] = (VALUE)new_callinfo(iseq, idEq, 1, 0, NULL, FALSE);
-	iobj->operands[3] = Qfalse; /* CALL_CACHE */
-    }
-
-    return COMPILE_OK;
-}
-
-static int
-iseq_specialized_instruction(rb_iseq_t *iseq, INSN *iobj)
-{
-    if (iobj->insn_id == BIN(send)) {
-	struct rb_call_info *ci = (struct rb_call_info *)OPERAND_AT(iobj, 0);
-	const rb_iseq_t *blockiseq = (rb_iseq_t *)OPERAND_AT(iobj, 2);
-
-#define SP_INSN(opt) insn_set_specialized_instruction(iseq, iobj, BIN(opt_##opt))
-	if (ci->flag & VM_CALL_ARGS_SIMPLE) {
-	    switch (ci->orig_argc) {
-	      case 0:
-		switch (ci->mid) {
-		  case idLength: SP_INSN(length); return COMPILE_OK;
-		  case idSize:	 SP_INSN(size);	  return COMPILE_OK;
-		  case idEmptyP: SP_INSN(empty_p);return COMPILE_OK;
-		  case idSucc:	 SP_INSN(succ);	  return COMPILE_OK;
-		  case idNot:	 SP_INSN(not);	  return COMPILE_OK;
-		}
-		break;
-	      case 1:
-		switch (ci->mid) {
-		  case idPLUS:	 SP_INSN(plus);	  return COMPILE_OK;
-		  case idMINUS:	 SP_INSN(minus);  return COMPILE_OK;
-		  case idMULT:	 SP_INSN(mult);	  return COMPILE_OK;
-		  case idDIV:	 SP_INSN(div);	  return COMPILE_OK;
-		  case idMOD:	 SP_INSN(mod);	  return COMPILE_OK;
-		  case idEq:	 SP_INSN(eq);	  return COMPILE_OK;
-		  case idNeq:	 SP_INSN(neq);	  return COMPILE_OK;
-		  case idLT:	 SP_INSN(lt);	  return COMPILE_OK;
-		  case idLE:	 SP_INSN(le);	  return COMPILE_OK;
-		  case idGT:	 SP_INSN(gt);	  return COMPILE_OK;
-		  case idGE:	 SP_INSN(ge);	  return COMPILE_OK;
-		  case idLTLT:	 SP_INSN(ltlt);	  return COMPILE_OK;
-		  case idAREF:	 SP_INSN(aref);	  return COMPILE_OK;
-		}
-		break;
-	      case 2:
-		switch (ci->mid) {
-		  case idASET:	 SP_INSN(aset);	  return COMPILE_OK;
-		}
-		break;
-	    }
-	}
-
-	if ((ci->flag & VM_CALL_ARGS_BLOCKARG) == 0 && blockiseq == NULL) {
-	    iobj->insn_id = BIN(opt_send_without_block);
-	    iobj->operand_size = insn_len(iobj->insn_id) - 1;
-	}
-    }
-#undef SP_INSN
-
-    return COMPILE_OK;
-}
-
-static int
-iseq_optimize(rb_iseq_t *iseq, LINK_ANCHOR *anchor)
-{
-    LINK_ELEMENT *list;
-    const int do_peepholeopt = iseq->compile_data->option->peephole_optimization;
-    const int do_tailcallopt = iseq->compile_data->option->tailcall_optimization;
-    const int do_si = iseq->compile_data->option->specialized_instruction;
-    const int do_ou = iseq->compile_data->option->operands_unification;
-    list = FIRST_ELEMENT(anchor);
-
-    while (list) {
-	if (list->type == ISEQ_ELEMENT_INSN) {
-	    if (do_peepholeopt) {
-		iseq_peephole_optimize(iseq, list, do_tailcallopt);
-	    }
-	    if (do_si) {
-		iseq_specialized_instruction(iseq, (INSN *)list);
-	    }
-	    if (do_ou) {
-		insn_operands_unification((INSN *)list);
-	    }
-	}
-	list = list->next;
-    }
-    return COMPILE_OK;
-}
-
-#if OPT_INSTRUCTIONS_UNIFICATION
-static INSN *
-new_unified_insn(rb_iseq_t *iseq,
-		 int insn_id, int size, LINK_ELEMENT *seq_list)
-{
-    INSN *iobj = 0;
-    LINK_ELEMENT *list = seq_list;
-    int i, argc = 0;
-    VALUE *operands = 0, *ptr = 0;
-
-
-    /* count argc */
-    for (i = 0; i < size; i++) {
-	iobj = (INSN *)list;
-	argc += iobj->operand_size;
-	list = list->next;
-    }
-
-    if (argc > 0) {
-	ptr = operands =
-	    (VALUE *)compile_data_alloc(iseq, sizeof(VALUE) * argc);
-    }
-
-    /* copy operands */
-    list = seq_list;
-    for (i = 0; i < size; i++) {
-	iobj = (INSN *)list;
-	MEMCPY(ptr, iobj->operands, VALUE, iobj->operand_size);
-	ptr += iobj->operand_size;
-	list = list->next;
-    }
-
-    return new_insn_core(iseq, iobj->line_no, insn_id, argc, operands);
-}
-#endif
-
-/*
- * This scheme can get more performance if do this optimize with
- * label address resolving.
- * It's future work (if compile time was bottle neck).
- */
-static int
-iseq_insns_unification(rb_iseq_t *iseq, LINK_ANCHOR *anchor)
-{
-#if OPT_INSTRUCTIONS_UNIFICATION
-    LINK_ELEMENT *list;
-    INSN *iobj, *niobj;
-    int id, k;
-    intptr_t j;
-
-    list = FIRST_ELEMENT(anchor);
-    while (list) {
-	if (list->type == ISEQ_ELEMENT_INSN) {
-	    iobj = (INSN *)list;
-	    id = iobj->insn_id;
-	    if (unified_insns_data[id] != 0) {
-		const int *const *entry = unified_insns_data[id];
-		for (j = 1; j < (intptr_t)entry[0]; j++) {
-		    const int *unified = entry[j];
-		    LINK_ELEMENT *li = list->next;
-		    for (k = 2; k < unified[1]; k++) {
-			if (li->type != ISEQ_ELEMENT_INSN ||
-			    ((INSN *)li)->insn_id != unified[k]) {
-			    goto miss;
-			}
-			li = li->next;
-		    }
-		    /* matched */
-		    niobj =
-			new_unified_insn(iseq, unified[0], unified[1] - 1,
-					 list);
-
-		    /* insert to list */
-		    niobj->link.prev = (LINK_ELEMENT *)iobj->link.prev;
-		    niobj->link.next = li;
-		    if (li) {
-			li->prev = (LINK_ELEMENT *)niobj;
-		    }
-
-		    list->prev->next = (LINK_ELEMENT *)niobj;
-		    list = (LINK_ELEMENT *)niobj;
-		    break;
-		  miss:;
-		}
-	    }
-	}
-	list = list->next;
-    }
-#endif
-    return COMPILE_OK;
-}
-
-#if OPT_STACK_CACHING
-
-#define SC_INSN(insn, stat) sc_insn_info[(insn)][(stat)]
-#define SC_NEXT(insn)       sc_insn_next[(insn)]
-
-#include "opt_sc.inc"
-
-static int
-insn_set_sc_state(rb_iseq_t *iseq, INSN *iobj, int state)
-{
-    int nstate;
-    int insn_id;
-
-    insn_id = iobj->insn_id;
-    iobj->insn_id = SC_INSN(insn_id, state);
-    nstate = SC_NEXT(iobj->insn_id);
-
-    if (insn_id == BIN(jump) ||
-	insn_id == BIN(branchif) || insn_id == BIN(branchunless)) {
-	LABEL *lobj = (LABEL *)OPERAND_AT(iobj, 0);
-
-	if (lobj->sc_state != 0) {
-	    if (lobj->sc_state != nstate) {
-		dump_disasm_list((LINK_ELEMENT *)iobj);
-		dump_disasm_list((LINK_ELEMENT *)lobj);
-		printf("\n-- %d, %d\n", lobj->sc_state, nstate);
-		rb_compile_error(RSTRING_PTR(iseq->body->location.path), iobj->line_no,
-				 "insn_set_sc_state error\n");
-		return 0;
-	    }
-	}
-	else {
-	    lobj->sc_state = nstate;
-	}
-	if (insn_id == BIN(jump)) {
-	    nstate = SCS_XX;
-	}
-    }
-    else if (insn_id == BIN(leave)) {
-	nstate = SCS_XX;
-    }
-
-    return nstate;
-}
-
-static int
-label_set_sc_state(LABEL *lobj, int state)
-{
-    if (lobj->sc_state != 0) {
-	if (lobj->sc_state != state) {
-	    state = lobj->sc_state;
-	}
-    }
-    else {
-	lobj->sc_state = state;
-    }
-
-    return state;
-}
-
-
-#endif
-
-static int
-iseq_set_sequence_stackcaching(rb_iseq_t *iseq, LINK_ANCHOR *anchor)
-{
-#if OPT_STACK_CACHING
-    LINK_ELEMENT *list;
-    int state, insn_id;
-
-    /* initialize */
-    state = SCS_XX;
-    list = FIRST_ELEMENT(anchor);
-    /* dump_disasm_list(list); */
-
-    /* for each list element */
-    while (list) {
-      redo_point:
-	switch (list->type) {
-	  case ISEQ_ELEMENT_INSN:
-	    {
-		INSN *iobj = (INSN *)list;
-		insn_id = iobj->insn_id;
-
-		/* dump_disasm_list(list); */
-
-		switch (insn_id) {
-		  case BIN(nop):
-		    {
-			/* exception merge point */
-			if (state != SCS_AX) {
-			    INSN *rpobj =
-				new_insn_body(iseq, 0, BIN(reput), 0);
-
-			    /* replace this insn */
-			    REPLACE_ELEM(list, (LINK_ELEMENT *)rpobj);
-			    list = (LINK_ELEMENT *)rpobj;
-			    goto redo_point;
-			}
-			break;
-		    }
-		  case BIN(swap):
-		    {
-			if (state == SCS_AB || state == SCS_BA) {
-			    state = (state == SCS_AB ? SCS_BA : SCS_AB);
-
-			    REMOVE_ELEM(list);
-			    list = list->next;
-			    goto redo_point;
-			}
-			break;
-		    }
-		  case BIN(pop):
-		    {
-			switch (state) {
-			  case SCS_AX:
-			  case SCS_BX:
-			    state = SCS_XX;
-			    break;
-			  case SCS_AB:
-			    state = SCS_AX;
-			    break;
-			  case SCS_BA:
-			    state = SCS_BX;
-			    break;
-			  case SCS_XX:
-			    goto normal_insn;
-			  default:
-			    rb_compile_error(RSTRING_PTR(iseq->body->location.path), iobj->line_no,
-					     "unreachable");
-			}
-			/* remove useless pop */
-			REMOVE_ELEM(list);
-			list = list->next;
-			goto redo_point;
-		    }
-		  default:;
-		    /* none */
-		}		/* end of switch */
-	      normal_insn:
-		state = insn_set_sc_state(iseq, iobj, state);
-		break;
-	    }
-	  case ISEQ_ELEMENT_LABEL:
-	    {
-		LABEL *lobj;
-		lobj = (LABEL *)list;
-
-		state = label_set_sc_state(lobj, state);
-	    }
-	  default:
-	    break;
-	}
-	list = list->next;
-    }
-#endif
-    return COMPILE_OK;
-}
-
-static int
-compile_dstr_fragments(rb_iseq_t *iseq, LINK_ANCHOR *ret, NODE *node, int *cntp)
-{
-    NODE *list = node->nd_next;
-    VALUE lit = node->nd_lit;
-    LINK_ELEMENT *first_lit = 0;
-    int cnt = 0;
-
-    debugp_param("nd_lit", lit);
-    if (!NIL_P(lit)) {
-	cnt++;
-	if (!RB_TYPE_P(lit, T_STRING)) {
-	    rb_compile_bug(ERROR_ARGS "dstr: must be string: %s",
-			   rb_builtin_type_name(TYPE(lit)));
-	}
-	lit = node->nd_lit = rb_fstring(lit);
-	ADD_INSN1(ret, nd_line(node), putobject, lit);
-	if (RSTRING_LEN(lit) == 0) first_lit = LAST_ELEMENT(ret);
-    }
-
-    while (list) {
-	node = list->nd_head;
-	if (nd_type(node) == NODE_STR) {
-	    node->nd_lit = rb_fstring(node->nd_lit);
-	    ADD_INSN1(ret, nd_line(node), putobject, node->nd_lit);
-	    lit = Qnil;
-	}
-	else {
-	    COMPILE(ret, "each string", node);
-	}
-	cnt++;
-	list = list->nd_next;
-    }
-    if (NIL_P(lit) && first_lit) {
-	REMOVE_ELEM(first_lit);
-	--cnt;
-    }
-    *cntp = cnt;
-
-    return COMPILE_OK;
-}
-
-static int
-compile_dstr(rb_iseq_t *iseq, LINK_ANCHOR *ret, NODE * node)
-{
-    int cnt;
-    compile_dstr_fragments(iseq, ret, node, &cnt);
-    ADD_INSN1(ret, nd_line(node), concatstrings, INT2FIX(cnt));
-    return COMPILE_OK;
-}
-
-static int
-compile_dregx(rb_iseq_t *iseq, LINK_ANCHOR *ret, NODE * node)
-{
-    int cnt;
-    compile_dstr_fragments(iseq, ret, node, &cnt);
-    ADD_INSN2(ret, nd_line(node), toregexp, INT2FIX(node->nd_cflag), INT2FIX(cnt));
-    return COMPILE_OK;
-}
-
-static int
-compile_branch_condition(rb_iseq_t *iseq, LINK_ANCHOR *ret, NODE * cond,
-			 LABEL *then_label, LABEL *else_label)
-{
-    switch (nd_type(cond)) {
-      case NODE_AND:
-	{
-	    LABEL *label = NEW_LABEL(nd_line(cond));
-	    compile_branch_condition(iseq, ret, cond->nd_1st, label,
-				     else_label);
-	    ADD_LABEL(ret, label);
-	    compile_branch_condition(iseq, ret, cond->nd_2nd, then_label,
-				     else_label);
-	    break;
-	}
-      case NODE_OR:
-	{
-	    LABEL *label = NEW_LABEL(nd_line(cond));
-	    compile_branch_condition(iseq, ret, cond->nd_1st, then_label,
-				     label);
-	    ADD_LABEL(ret, label);
-	    compile_branch_condition(iseq, ret, cond->nd_2nd, then_label,
-				     else_label);
-	    break;
-	}
-      case NODE_LIT:		/* NODE_LIT is always not true */
-      case NODE_TRUE:
-      case NODE_STR:
-	/* printf("useless condition eliminate (%s)\n",  ruby_node_name(nd_type(cond))); */
-	ADD_INSNL(ret, nd_line(cond), jump, then_label);
-	break;
-      case NODE_FALSE:
-      case NODE_NIL:
-	/* printf("useless condition eliminate (%s)\n", ruby_node_name(nd_type(cond))); */
-	ADD_INSNL(ret, nd_line(cond), jump, else_label);
-	break;
-      default:
-	COMPILE(ret, "branch condition", cond);
-	ADD_INSNL(ret, nd_line(cond), branchunless, else_label);
-	ADD_INSNL(ret, nd_line(cond), jump, then_label);
-	break;
-    }
-    return COMPILE_OK;
-}
-
-static int
-compile_array_keyword_arg(rb_iseq_t *iseq, LINK_ANCHOR *ret, const NODE * const root_node, struct rb_call_info_kw_arg ** const kw_arg_ptr)
-{
-    if (kw_arg_ptr == NULL) return FALSE;
-
-    if (nd_type(root_node) == NODE_HASH && root_node->nd_head && nd_type(root_node->nd_head) == NODE_ARRAY) {
-	NODE *node = root_node->nd_head;
-
-	while (node) {
-	    NODE *key_node = node->nd_head;
-
-	    assert(nd_type(node) == NODE_ARRAY);
-	    if (key_node && nd_type(key_node) == NODE_LIT && RB_TYPE_P(key_node->nd_lit, T_SYMBOL)) {
-		/* can be keywords */
-	    }
-	    else {
-		return FALSE;
-	    }
-	    node = node->nd_next; /* skip value node */
-	    node = node->nd_next;
-	}
-
-	/* may be keywords */
-	node = root_node->nd_head;
-	{
-	    int len = (int)node->nd_alen / 2;
-	    struct rb_call_info_kw_arg *kw_arg  = (struct rb_call_info_kw_arg *)ruby_xmalloc(sizeof(struct rb_call_info_kw_arg) + sizeof(VALUE) * (len - 1));
-	    VALUE *keywords = kw_arg->keywords;
-	    int i = 0;
-	    kw_arg->keyword_len = len;
-
-	    *kw_arg_ptr = kw_arg;
-
-	    for (i=0; node != NULL; i++, node = node->nd_next->nd_next) {
-		NODE *key_node = node->nd_head;
-		NODE *val_node = node->nd_next->nd_head;
-		keywords[i] = key_node->nd_lit;
-		COMPILE(ret, "keyword values", val_node);
-	    }
-	    assert(i == len);
-	    return TRUE;
-	}
-    }
-    return FALSE;
-}
-
-enum compile_array_type_t {
-    COMPILE_ARRAY_TYPE_ARRAY,
-    COMPILE_ARRAY_TYPE_HASH,
-    COMPILE_ARRAY_TYPE_ARGS
-};
-
-static int
-compile_array_(rb_iseq_t *iseq, LINK_ANCHOR *ret, NODE* node_root,
-	       enum compile_array_type_t type, struct rb_call_info_kw_arg **keywords_ptr, int poped)
-{
-    NODE *node = node_root;
-    int line = (int)nd_line(node);
-    int len = 0;
-
-    if (nd_type(node) == NODE_ZARRAY) {
-	if (!poped) {
-	    switch (type) {
-	      case COMPILE_ARRAY_TYPE_ARRAY: ADD_INSN1(ret, line, newarray, INT2FIX(0)); break;
-	      case COMPILE_ARRAY_TYPE_HASH: ADD_INSN1(ret, line, newhash, INT2FIX(0)); break;
-	      case COMPILE_ARRAY_TYPE_ARGS: /* do nothing */ break;
-	    }
-	}
-    }
-    else {
-	int opt_p = 1;
-	int first = 1, i;
-
-	while (node) {
-	    NODE *start_node = node, *end_node;
-	    NODE *kw = 0;
-	    const int max = 0x100;
-	    DECL_ANCHOR(anchor);
-	    INIT_ANCHOR(anchor);
-
-	    for (i=0; i<max && node; i++, len++, node = node->nd_next) {
-		if (CPDEBUG > 0 && nd_type(node) != NODE_ARRAY) {
-		    rb_bug("compile_array: This node is not NODE_ARRAY, but %s", ruby_node_name(nd_type(node)));
-		}
-
-		if (type != COMPILE_ARRAY_TYPE_ARRAY && !node->nd_head) {
-		    kw = node->nd_next;
-		    node = 0;
-		    if (kw) {
-			opt_p = 0;
-			node = kw->nd_next;
-			kw = kw->nd_head;
-		    }
-		    break;
-		}
-		if (opt_p && nd_type(node->nd_head) != NODE_LIT) {
-		    opt_p = 0;
-		}
-
-		if (type == COMPILE_ARRAY_TYPE_ARGS && node->nd_next == NULL /* last node */ && compile_array_keyword_arg(iseq, anchor, node->nd_head, keywords_ptr)) {
-		    len--;
-		}
-		else {
-		    COMPILE_(anchor, "array element", node->nd_head, poped);
-		}
-	    }
-
-	    if (opt_p && type != COMPILE_ARRAY_TYPE_ARGS) {
-		if (!poped) {
-		    VALUE ary = rb_ary_tmp_new(i);
-
-		    end_node = node;
-		    node = start_node;
-
-		    while (node != end_node) {
-			rb_ary_push(ary, node->nd_head->nd_lit);
-			node = node->nd_next;
-		    }
-		    while (node && nd_type(node->nd_head) == NODE_LIT &&
-			   node->nd_next && nd_type(node->nd_next->nd_head) == NODE_LIT) {
-			rb_ary_push(ary, node->nd_head->nd_lit);
-			node = node->nd_next;
-			rb_ary_push(ary, node->nd_head->nd_lit);
-			node = node->nd_next;
-			len++;
-		    }
-
-		    OBJ_FREEZE(ary);
-
-		    iseq_add_mark_object_compile_time(iseq, ary);
-
-		    if (first) {
-			first = 0;
-			if (type == COMPILE_ARRAY_TYPE_ARRAY) {
-			    ADD_INSN1(ret, line, duparray, ary);
-			}
-			else { /* COMPILE_ARRAY_TYPE_HASH */
-			    ADD_INSN1(ret, line, putspecialobject, INT2FIX(VM_SPECIAL_OBJECT_VMCORE));
-			    ADD_INSN1(ret, line, putobject, ary);
-			    ADD_SEND(ret, line, id_core_hash_from_ary, INT2FIX(1));
-			}
-		    }
-		    else {
-			if (type == COMPILE_ARRAY_TYPE_ARRAY) {
-			    ADD_INSN1(ret, line, putobject, ary);
-			    ADD_INSN(ret, line, concatarray);
-			}
-			else {
-			    ADD_INSN1(ret, line, putspecialobject, INT2FIX(VM_SPECIAL_OBJECT_VMCORE));
-			    ADD_INSN1(ret, line, putobject, ary);
-			    ADD_SEND(ret, line, id_core_hash_merge_ary, INT2FIX(1));
-			}
-		    }
-		}
-	    }
-	    else {
-		if (!poped) {
-		    switch (type) {
-		      case COMPILE_ARRAY_TYPE_ARRAY:
-			ADD_INSN1(anchor, line, newarray, INT2FIX(i));
-
-			if (first) {
-			    first = 0;
-			}
-			else {
-			    ADD_INSN(anchor, line, concatarray);
-			}
-
-			APPEND_LIST(ret, anchor);
-			break;
-		      case COMPILE_ARRAY_TYPE_HASH:
-			if (i > 0) {
-			    if (first) {
-				ADD_INSN1(anchor, line, newhash, INT2FIX(i));
-				APPEND_LIST(ret, anchor);
-			    }
-			    else {
-				ADD_INSN1(ret, line, putspecialobject, INT2FIX(VM_SPECIAL_OBJECT_VMCORE));
-				ADD_INSN(ret, line, swap);
-				APPEND_LIST(ret, anchor);
-				ADD_SEND(ret, line, id_core_hash_merge_ptr, INT2FIX(i + 1));
-			    }
-			}
-			if (kw) {
-			    VALUE nhash = (i > 0 || !first) ? INT2FIX(2) : INT2FIX(1);
-			    ADD_INSN1(ret, line, putspecialobject, INT2FIX(VM_SPECIAL_OBJECT_VMCORE));
-			    if (i > 0 || !first) ADD_INSN(ret, line, swap);
-			    COMPILE(ret, "keyword splat", kw);
-			    ADD_SEND(ret, line, id_core_hash_merge_kwd, nhash);
-			    if (nhash == INT2FIX(1)) ADD_SEND(ret, line, rb_intern("dup"), INT2FIX(0));
-			}
-			first = 0;
-			break;
-		      case COMPILE_ARRAY_TYPE_ARGS:
-			APPEND_LIST(ret, anchor);
-			break;
-		    }
-		}
-		else {
-		    /* poped */
-		    APPEND_LIST(ret, anchor);
-		}
-	    }
-	}
-    }
-    return len;
-}
-
-static VALUE
-compile_array(rb_iseq_t *iseq, LINK_ANCHOR *ret, NODE* node_root, enum compile_array_type_t type)
-{
-    return compile_array_(iseq, ret, node_root, type, NULL, 0);
-}
-
-static VALUE
-case_when_optimizable_literal(NODE * node)
-{
-    switch (nd_type(node)) {
-      case NODE_LIT: {
-	VALUE v = node->nd_lit;
-	double ival;
-	if (RB_TYPE_P(v, T_FLOAT) &&
-	    modf(RFLOAT_VALUE(v), &ival) == 0.0) {
-	    return FIXABLE(ival) ? LONG2FIX((long)ival) : rb_dbl2big(ival);
-	}
-	if (SYMBOL_P(v) || rb_obj_is_kind_of(v, rb_cNumeric)) {
-	    return v;
-	}
-	break;
-      }
-      case NODE_STR:
-	return node->nd_lit = rb_fstring(node->nd_lit);
-    }
-    return Qundef;
-}
-
-static int
-when_vals(rb_iseq_t *iseq, LINK_ANCHOR *cond_seq, NODE *vals, LABEL *l1, int only_special_literals, VALUE literals)
-{
-    while (vals) {
-	NODE* val = vals->nd_head;
-	VALUE lit = case_when_optimizable_literal(val);
-
-	if (lit == Qundef) {
-	    only_special_literals = 0;
-	}
-	else {
-	    if (rb_hash_lookup(literals, lit) != Qnil) {
-		rb_compile_warning(RSTRING_PTR(iseq->body->location.path), nd_line(val), "duplicated when clause is ignored");
-	    }
-	    else {
-		rb_hash_aset(literals, lit, (VALUE)(l1) | 1);
-	    }
-	}
-
-	ADD_INSN(cond_seq, nd_line(val), dup); /* dup target */
-
-	if (nd_type(val) == NODE_STR) {
-	    val->nd_lit = rb_fstring(val->nd_lit);
-	    debugp_param("nd_lit", val->nd_lit);
-	    ADD_INSN1(cond_seq, nd_line(val), putobject, val->nd_lit);
-	}
-	else {
-	    COMPILE(cond_seq, "when cond", val);
-	}
-
-	ADD_INSN1(cond_seq, nd_line(vals), checkmatch, INT2FIX(VM_CHECKMATCH_TYPE_CASE));
-	ADD_INSNL(cond_seq, nd_line(val), branchif, l1);
-	vals = vals->nd_next;
-    }
-    return only_special_literals;
-}
-
-static int
-compile_massign_lhs(rb_iseq_t *iseq, LINK_ANCHOR *ret, NODE *node)
-{
-    switch (nd_type(node)) {
-      case NODE_ATTRASGN: {
-	INSN *iobj, *topdup;
-	struct rb_call_info *ci;
-	VALUE dupidx;
-
-	COMPILE_POPED(ret, "masgn lhs (NODE_ATTRASGN)", node);
-
-	iobj = (INSN *)get_prev_insn((INSN *)LAST_ELEMENT(ret)); /* send insn */
-	ci = (struct rb_call_info *)iobj->operands[0];
-	ci->orig_argc += 1;
-	dupidx = INT2FIX(ci->orig_argc);
-
-	topdup = new_insn_body(iseq, nd_line(node), BIN(topn), 1, dupidx);
-	INSERT_ELEM_PREV(&iobj->link, &topdup->link);
-	ADD_INSN(ret, nd_line(node), pop);	/* result */
-	break;
-      }
-      case NODE_MASGN: {
-	DECL_ANCHOR(anchor);
-	INIT_ANCHOR(anchor);
-	COMPILE_POPED(anchor, "nest masgn lhs", node);
-	REMOVE_ELEM(FIRST_ELEMENT(anchor));
-	ADD_SEQ(ret, anchor);
-	break;
-      }
-      default: {
-	DECL_ANCHOR(anchor);
-	INIT_ANCHOR(anchor);
-	COMPILE_POPED(anchor, "masgn lhs", node);
-	REMOVE_ELEM(FIRST_ELEMENT(anchor));
-	ADD_SEQ(ret, anchor);
-      }
-    }
-
-    return COMPILE_OK;
-}
-
-static void
-compile_massign_opt_lhs(rb_iseq_t *iseq, LINK_ANCHOR *ret, NODE *lhsn)
-{
-    if (lhsn) {
-	compile_massign_opt_lhs(iseq, ret, lhsn->nd_next);
-	compile_massign_lhs(iseq, ret, lhsn->nd_head);
-    }
-}
-
-static int
-compile_massign_opt(rb_iseq_t *iseq, LINK_ANCHOR *ret,
-		    NODE *rhsn, NODE *orig_lhsn)
-{
-    VALUE mem[64];
-    const int memsize = numberof(mem);
-    int memindex = 0;
-    int llen = 0, rlen = 0;
-    int i;
-    NODE *lhsn = orig_lhsn;
-
-#define MEMORY(v) { \
-    int i; \
-    if (memindex == memsize) return 0; \
-    for (i=0; i<memindex; i++) { \
-	if (mem[i] == (v)) return 0; \
-    } \
-    mem[memindex++] = (v); \
-}
-
-    if (rhsn == 0 || nd_type(rhsn) != NODE_ARRAY) {
-	return 0;
-    }
-
-    while (lhsn) {
-	NODE *ln = lhsn->nd_head;
-	switch (nd_type(ln)) {
-	  case NODE_LASGN:
-	    MEMORY(ln->nd_vid);
-	    break;
-	  case NODE_DASGN:
-	  case NODE_DASGN_CURR:
-	  case NODE_IASGN:
-	  case NODE_IASGN2:
-	  case NODE_CVASGN:
-	    MEMORY(ln->nd_vid);
-	    break;
-	  default:
-	    return 0;
-	}
-	lhsn = lhsn->nd_next;
-	llen++;
-    }
-
-    while (rhsn) {
-	if (llen <= rlen) {
-	    COMPILE_POPED(ret, "masgn val (popped)", rhsn->nd_head);
-	}
-	else {
-	    COMPILE(ret, "masgn val", rhsn->nd_head);
-	}
-	rhsn = rhsn->nd_next;
-	rlen++;
-    }
-
-    if (llen > rlen) {
-	for (i=0; i<llen-rlen; i++) {
-	    ADD_INSN(ret, nd_line(orig_lhsn), putnil);
-	}
-    }
-
-    compile_massign_opt_lhs(iseq, ret, orig_lhsn);
-    return 1;
-}
-
-static void
-adjust_stack(rb_iseq_t *iseq, LINK_ANCHOR *ret, int line, int rlen, int llen)
-{
-    if (rlen < llen) {
-	do {ADD_INSN(ret, line, putnil);} while (++rlen < llen);
-    }
-    else if (rlen > llen) {
-	do {ADD_INSN(ret, line, pop);} while (--rlen > llen);
-    }
-}
-
-static int
-compile_massign(rb_iseq_t *iseq, LINK_ANCHOR *ret, NODE *node, int poped)
-{
-    NODE *rhsn = node->nd_value;
-    NODE *splatn = node->nd_args;
-    NODE *lhsn = node->nd_head;
-    int lhs_splat = (splatn && (VALUE)splatn != (VALUE)-1) ? 1 : 0;
-
-    if (!poped || splatn || !compile_massign_opt(iseq, ret, rhsn, lhsn)) {
-	int llen = 0;
-	int expand = 1;
-	DECL_ANCHOR(lhsseq);
-
-	INIT_ANCHOR(lhsseq);
-
-	while (lhsn) {
-	    compile_massign_lhs(iseq, lhsseq, lhsn->nd_head);
-	    llen += 1;
-	    lhsn = lhsn->nd_next;
-	}
-
-	COMPILE(ret, "normal masgn rhs", rhsn);
-
-	if (!poped) {
-	    ADD_INSN(ret, nd_line(node), dup);
-	}
-	else if (!lhs_splat) {
-	    INSN *last = (INSN*)ret->last;
-	    if (last->link.type == ISEQ_ELEMENT_INSN &&
-		last->insn_id == BIN(newarray) &&
-		last->operand_size == 1) {
-		int rlen = FIX2INT(OPERAND_AT(last, 0));
-		/* special case: assign to aset or attrset */
-		if (llen == 2) {
-		    POP_ELEMENT(ret);
-		    adjust_stack(iseq, ret, nd_line(node), rlen, llen);
-		    ADD_INSN(ret, nd_line(node), swap);
-		    expand = 0;
-		}
-		else if (llen > 2 && llen != rlen) {
-		    POP_ELEMENT(ret);
-		    adjust_stack(iseq, ret, nd_line(node), rlen, llen);
-		    ADD_INSN1(ret, nd_line(node), reverse, INT2FIX(llen));
-		    expand = 0;
-		}
-		else if (llen > 2) {
-		    last->insn_id = BIN(reverse);
-		    expand = 0;
-		}
-	    }
-	}
-	if (expand) {
-	    ADD_INSN2(ret, nd_line(node), expandarray,
-		      INT2FIX(llen), INT2FIX(lhs_splat));
-	}
-	ADD_SEQ(ret, lhsseq);
-
-	if (lhs_splat) {
-	    if (nd_type(splatn) == NODE_POSTARG) {
-		/*a, b, *r, p1, p2 */
-		NODE *postn = splatn->nd_2nd;
-		NODE *restn = splatn->nd_1st;
-		int num = (int)postn->nd_alen;
-		int flag = 0x02 | (((VALUE)restn == (VALUE)-1) ? 0x00 : 0x01);
-
-		ADD_INSN2(ret, nd_line(splatn), expandarray,
-			  INT2FIX(num), INT2FIX(flag));
-
-		if ((VALUE)restn != (VALUE)-1) {
-		    compile_massign_lhs(iseq, ret, restn);
-		}
-		while (postn) {
-		    compile_massign_lhs(iseq, ret, postn->nd_head);
-		    postn = postn->nd_next;
-		}
-	    }
-	    else {
-		/* a, b, *r */
-		compile_massign_lhs(iseq, ret, splatn);
-	    }
-	}
-    }
-    return COMPILE_OK;
-}
-
-static int
-compile_colon2(rb_iseq_t *iseq, NODE * node,
-	       LINK_ANCHOR *pref, LINK_ANCHOR *body)
-{
-    switch (nd_type(node)) {
-      case NODE_CONST:
-	debugi("compile_colon2 - colon", node->nd_vid);
-	ADD_INSN1(body, nd_line(node), getconstant, ID2SYM(node->nd_vid));
-	break;
-      case NODE_COLON3:
-	debugi("compile_colon2 - colon3", node->nd_mid);
-	ADD_INSN(body, nd_line(node), pop);
-	ADD_INSN1(body, nd_line(node), putobject, rb_cObject);
-	ADD_INSN1(body, nd_line(node), getconstant, ID2SYM(node->nd_mid));
-	break;
-      case NODE_COLON2:
-	compile_colon2(iseq, node->nd_head, pref, body);
-	debugi("compile_colon2 - colon2", node->nd_mid);
-	ADD_INSN1(body, nd_line(node), getconstant, ID2SYM(node->nd_mid));
-	break;
-      default:
-	COMPILE(pref, "const colon2 prefix", node);
-	break;
-    }
-    return COMPILE_OK;
-}
-
-static VALUE
-compile_cpath(LINK_ANCHOR *ret, rb_iseq_t *iseq, NODE *cpath)
-{
-    if (nd_type(cpath) == NODE_COLON3) {
-	/* toplevel class ::Foo */
-	ADD_INSN1(ret, nd_line(cpath), putobject, rb_cObject);
-	return Qfalse;
-    }
-    else if (cpath->nd_head) {
-	/* Bar::Foo */
-	COMPILE(ret, "nd_else->nd_head", cpath->nd_head);
-	return Qfalse;
-    }
-    else {
-	/* class at cbase Foo */
-	ADD_INSN1(ret, nd_line(cpath), putspecialobject,
-		  INT2FIX(VM_SPECIAL_OBJECT_CONST_BASE));
-	return Qtrue;
-    }
-}
-
-#define private_recv_p(node) (nd_type((node)->nd_recv) == NODE_SELF)
-
-#define defined_expr defined_expr0
-static int
-defined_expr(rb_iseq_t *iseq, LINK_ANCHOR *ret,
-	     NODE *node, LABEL **lfinish, VALUE needstr)
-{
-    enum defined_type expr_type = 0;
-    enum node_type type;
-
-    switch (type = nd_type(node)) {
-
-	/* easy literals */
-      case NODE_NIL:
-	expr_type = DEFINED_NIL;
-	break;
-      case NODE_SELF:
-	expr_type = DEFINED_SELF;
-	break;
-      case NODE_TRUE:
-	expr_type = DEFINED_TRUE;
-	break;
-      case NODE_FALSE:
-	expr_type = DEFINED_FALSE;
-	break;
-
-      case NODE_ARRAY:{
-	NODE *vals = node;
-
-	do {
-	    defined_expr(iseq, ret, vals->nd_head, lfinish, Qfalse);
-
-	    if (!lfinish[1]) {
-		lfinish[1] = NEW_LABEL(nd_line(node));
-	    }
-	    ADD_INSNL(ret, nd_line(node), branchunless, lfinish[1]);
-	} while ((vals = vals->nd_next) != NULL);
-      }
-      case NODE_STR:
-      case NODE_LIT:
-      case NODE_ZARRAY:
-      case NODE_AND:
-      case NODE_OR:
-      default:
-	expr_type = DEFINED_EXPR;
-	break;
-
-	/* variables */
-      case NODE_LVAR:
-      case NODE_DVAR:
-	expr_type = DEFINED_LVAR;
-	break;
-
-      case NODE_IVAR:
-	ADD_INSN(ret, nd_line(node), putnil);
-	ADD_INSN3(ret, nd_line(node), defined, INT2FIX(DEFINED_IVAR),
-		  ID2SYM(node->nd_vid), needstr);
-	return 1;
-
-      case NODE_GVAR:
-	ADD_INSN(ret, nd_line(node), putnil);
-	ADD_INSN3(ret, nd_line(node), defined, INT2FIX(DEFINED_GVAR),
-		  ID2SYM(node->nd_entry->id), needstr);
-	return 1;
-
-      case NODE_CVAR:
-	ADD_INSN(ret, nd_line(node), putnil);
-	ADD_INSN3(ret, nd_line(node), defined, INT2FIX(DEFINED_CVAR),
-		  ID2SYM(node->nd_vid), needstr);
-	return 1;
-
-      case NODE_CONST:
-	ADD_INSN(ret, nd_line(node), putnil);
-	ADD_INSN3(ret, nd_line(node), defined, INT2FIX(DEFINED_CONST),
-		  ID2SYM(node->nd_vid), needstr);
-	return 1;
-      case NODE_COLON2:
-	if (!lfinish[1]) {
-	    lfinish[1] = NEW_LABEL(nd_line(node));
-	}
-	defined_expr(iseq, ret, node->nd_head, lfinish, Qfalse);
-	ADD_INSNL(ret, nd_line(node), branchunless, lfinish[1]);
-
-	if (rb_is_const_id(node->nd_mid)) {
-	    COMPILE(ret, "defined/colon2#nd_head", node->nd_head);
-	    ADD_INSN3(ret, nd_line(node), defined, INT2FIX(DEFINED_CONST),
-		      ID2SYM(node->nd_mid), needstr);
-	}
-	else {
-	    COMPILE(ret, "defined/colon2#nd_head", node->nd_head);
-	    ADD_INSN3(ret, nd_line(node), defined, INT2FIX(DEFINED_METHOD),
-		      ID2SYM(node->nd_mid), needstr);
-	}
-	return 1;
-      case NODE_COLON3:
-	ADD_INSN1(ret, nd_line(node), putobject, rb_cObject);
-	ADD_INSN3(ret, nd_line(node), defined,
-		  INT2FIX(DEFINED_CONST), ID2SYM(node->nd_mid), needstr);
-	return 1;
-
-	/* method dispatch */
-      case NODE_CALL:
-      case NODE_VCALL:
-      case NODE_FCALL:
-      case NODE_ATTRASGN:{
-	const int explicit_receiver =
-	    (type == NODE_CALL ||
-	     (type == NODE_ATTRASGN && !private_recv_p(node)));
-
-	if (!lfinish[1]) {
-	    lfinish[1] = NEW_LABEL(nd_line(node));
-	}
-	if (node->nd_args) {
-	    defined_expr(iseq, ret, node->nd_args, lfinish, Qfalse);
-	    ADD_INSNL(ret, nd_line(node), branchunless, lfinish[1]);
-	}
-	if (explicit_receiver) {
-	    defined_expr(iseq, ret, node->nd_recv, lfinish, Qfalse);
-	    ADD_INSNL(ret, nd_line(node), branchunless, lfinish[1]);
-	    COMPILE(ret, "defined/recv", node->nd_recv);
-	    ADD_INSN3(ret, nd_line(node), defined, INT2FIX(DEFINED_METHOD),
-		      ID2SYM(node->nd_mid), needstr);
-	}
-	else {
-	    ADD_INSN(ret, nd_line(node), putself);
-	    ADD_INSN3(ret, nd_line(node), defined, INT2FIX(DEFINED_FUNC),
-		      ID2SYM(node->nd_mid), needstr);
-	}
-	return 1;
-      }
-
-      case NODE_YIELD:
-	ADD_INSN(ret, nd_line(node), putnil);
-	ADD_INSN3(ret, nd_line(node), defined, INT2FIX(DEFINED_YIELD), 0,
-		  needstr);
-	return 1;
-
-      case NODE_BACK_REF:
-      case NODE_NTH_REF:
-	ADD_INSN(ret, nd_line(node), putnil);
-	ADD_INSN3(ret, nd_line(node), defined, INT2FIX(DEFINED_REF),
-		  INT2FIX((node->nd_nth << 1) | (type == NODE_BACK_REF)),
-		  needstr);
-	return 1;
-
-      case NODE_SUPER:
-      case NODE_ZSUPER:
-	ADD_INSN(ret, nd_line(node), putnil);
-	ADD_INSN3(ret, nd_line(node), defined, INT2FIX(DEFINED_ZSUPER), 0,
-		  needstr);
-	return 1;
-
-      case NODE_OP_ASGN1:
-      case NODE_OP_ASGN2:
-      case NODE_OP_ASGN_OR:
-      case NODE_OP_ASGN_AND:
-      case NODE_MASGN:
-      case NODE_LASGN:
-      case NODE_DASGN:
-      case NODE_DASGN_CURR:
-      case NODE_GASGN:
-      case NODE_IASGN:
-      case NODE_CDECL:
-      case NODE_CVDECL:
-      case NODE_CVASGN:
-	expr_type = DEFINED_ASGN;
-	break;
-    }
-
-    if (expr_type) {
-	if (needstr != Qfalse) {
-	    VALUE str = rb_iseq_defined_string(expr_type);
-	    ADD_INSN1(ret, nd_line(node), putobject, str);
-	}
-	else {
-	    ADD_INSN1(ret, nd_line(node), putobject, Qtrue);
-	}
-	return 1;
-    }
-    return 0;
-}
-#undef defined_expr
-
-static int
-defined_expr(rb_iseq_t *iseq, LINK_ANCHOR *ret,
-	     NODE *node, LABEL **lfinish, VALUE needstr)
-{
-    LINK_ELEMENT *lcur = ret->last;
-    int done = defined_expr0(iseq, ret, node, lfinish, needstr);
-    if (lfinish[1]) {
-	int line = nd_line(node);
-	LABEL *lstart = NEW_LABEL(line);
-	LABEL *lend = NEW_LABEL(line);
-	const rb_iseq_t *rescue = NEW_CHILD_ISEQ(NEW_NIL(),
-						 rb_str_concat(rb_str_new2
-							       ("defined guard in "),
-							       iseq->body->location.label),
-						 ISEQ_TYPE_DEFINED_GUARD, 0);
-	APPEND_LABEL(ret, lcur, lstart);
-	ADD_LABEL(ret, lend);
-	ADD_CATCH_ENTRY(CATCH_TYPE_RESCUE, lstart, lend, rescue, lfinish[1]);
-    }
-    return done;
-}
-
-static VALUE
-make_name_for_block(const rb_iseq_t *orig_iseq)
-{
-    int level = 1;
-    const rb_iseq_t *iseq = orig_iseq;
-
-    if (orig_iseq->body->parent_iseq != 0) {
-	while (orig_iseq->body->local_iseq != iseq) {
-	    if (iseq->body->type == ISEQ_TYPE_BLOCK) {
-		level++;
-	    }
-	    iseq = iseq->body->parent_iseq;
-	}
-    }
-
-    if (level == 1) {
-	return rb_sprintf("block in %"PRIsVALUE, iseq->body->location.label);
-    }
-    else {
-	return rb_sprintf("block (%d levels) in %"PRIsVALUE, level, iseq->body->location.label);
-    }
-}
-
-static void
-push_ensure_entry(rb_iseq_t *iseq,
-		  struct iseq_compile_data_ensure_node_stack *enl,
-		  struct ensure_range *er, NODE *node)
-{
-    enl->ensure_node = node;
-    enl->prev = iseq->compile_data->ensure_node_stack;	/* prev */
-    enl->erange = er;
-    iseq->compile_data->ensure_node_stack = enl;
-}
-
-static void
-add_ensure_range(rb_iseq_t *iseq, struct ensure_range *erange,
-		 LABEL *lstart, LABEL *lend)
-{
-    struct ensure_range *ne =
-	compile_data_alloc(iseq, sizeof(struct ensure_range));
-
-    while (erange->next != 0) {
-	erange = erange->next;
-    }
-    ne->next = 0;
-    ne->begin = lend;
-    ne->end = erange->end;
-    erange->end = lstart;
-
-    erange->next = ne;
-}
-
-static void
-add_ensure_iseq(LINK_ANCHOR *ret, rb_iseq_t *iseq, int is_return)
-{
-    struct iseq_compile_data_ensure_node_stack *enlp =
-	iseq->compile_data->ensure_node_stack;
-    struct iseq_compile_data_ensure_node_stack *prev_enlp = enlp;
-    DECL_ANCHOR(ensure);
-
-    INIT_ANCHOR(ensure);
-    while (enlp) {
-	if (enlp->erange != 0) {
-	    DECL_ANCHOR(ensure_part);
-	    LABEL *lstart = NEW_LABEL(0);
-	    LABEL *lend = NEW_LABEL(0);
-	    INIT_ANCHOR(ensure_part);
-
-	    add_ensure_range(iseq, enlp->erange, lstart, lend);
-
-	    iseq->compile_data->ensure_node_stack = enlp->prev;
-	    ADD_LABEL(ensure_part, lstart);
-	    COMPILE_POPED(ensure_part, "ensure part", enlp->ensure_node);
-	    ADD_LABEL(ensure_part, lend);
-	    ADD_SEQ(ensure, ensure_part);
-	}
-	else {
-	    if (!is_return) {
-		break;
-	    }
-	}
-	enlp = enlp->prev;
-    }
-    iseq->compile_data->ensure_node_stack = prev_enlp;
-    ADD_SEQ(ret, ensure);
-}
-
-static VALUE
-setup_args(rb_iseq_t *iseq, LINK_ANCHOR *args, NODE *argn, unsigned int *flag, struct rb_call_info_kw_arg **keywords)
-{
-    VALUE argc = INT2FIX(0);
-    int nsplat = 0;
-    DECL_ANCHOR(arg_block);
-    DECL_ANCHOR(args_splat);
-
-    INIT_ANCHOR(arg_block);
-    INIT_ANCHOR(args_splat);
-    if (argn && nd_type(argn) == NODE_BLOCK_PASS) {
-	COMPILE(arg_block, "block", argn->nd_body);
-	*flag |= VM_CALL_ARGS_BLOCKARG;
-	argn = argn->nd_head;
-    }
-
-  setup_argn:
-    if (argn) {
-	switch (nd_type(argn)) {
-	  case NODE_SPLAT: {
-	    COMPILE(args, "args (splat)", argn->nd_head);
-	    ADD_INSN1(args, nd_line(argn), splatarray, Qfalse);
-	    argc = INT2FIX(1);
-	    nsplat++;
-	    *flag |= VM_CALL_ARGS_SPLAT;
-	    break;
-	  }
-	  case NODE_ARGSCAT:
-	  case NODE_ARGSPUSH: {
-	    int next_is_array = (nd_type(argn->nd_head) == NODE_ARRAY);
-	    DECL_ANCHOR(tmp);
-
-	    INIT_ANCHOR(tmp);
-	    COMPILE(tmp, "args (cat: splat)", argn->nd_body);
-	    if (nd_type(argn) == NODE_ARGSCAT) {
-		ADD_INSN1(tmp, nd_line(argn), splatarray, Qfalse);
-	    }
-	    else {
-		ADD_INSN1(tmp, nd_line(argn), newarray, INT2FIX(1));
-	    }
-	    INSERT_LIST(args_splat, tmp);
-	    nsplat++;
-	    *flag |= VM_CALL_ARGS_SPLAT;
-
-	    if (next_is_array) {
-		argc = INT2FIX(compile_array(iseq, args, argn->nd_head, COMPILE_ARRAY_TYPE_ARGS) + 1);
-	    }
-	    else {
-		argn = argn->nd_head;
-		goto setup_argn;
-	    }
-	    break;
-	  }
-	  case NODE_ARRAY:
-	    {
-		argc = INT2FIX(compile_array_(iseq, args, argn, COMPILE_ARRAY_TYPE_ARGS, keywords, FALSE));
-		break;
-	    }
-	  default: {
-	    rb_bug("setup_arg: unknown node: %s\n", ruby_node_name(nd_type(argn)));
-	  }
-	}
-    }
-
-    if (nsplat > 1) {
-	int i;
-	for (i=1; i<nsplat; i++) {
-	    ADD_INSN(args_splat, nd_line(args), concatarray);
-	}
-    }
-
-    if (!LIST_SIZE_ZERO(args_splat)) {
-	ADD_SEQ(args, args_splat);
-    }
-
-    if (*flag & VM_CALL_ARGS_BLOCKARG) {
-	ADD_SEQ(args, arg_block);
-    }
-    return argc;
-}
-
-static VALUE
-build_postexe_iseq(rb_iseq_t *iseq, LINK_ANCHOR *ret, NODE *body)
-{
-    int line = nd_line(body);
-    VALUE argc = INT2FIX(0);
-    const rb_iseq_t *block = NEW_CHILD_ISEQ(body, make_name_for_block(iseq->body->parent_iseq), ISEQ_TYPE_BLOCK, line);
-
-    ADD_INSN1(ret, line, putspecialobject, INT2FIX(VM_SPECIAL_OBJECT_VMCORE));
-    ADD_CALL_WITH_BLOCK(ret, line, id_core_set_postexe, argc, block);
-    iseq_set_local_table(iseq, 0);
-    return Qnil;
-}
-
-/**
-  compile each node
-
-  self:  InstructionSequence
-  node:  Ruby compiled node
-  poped: This node will be poped
- */
-static int
-iseq_compile_each(rb_iseq_t *iseq, LINK_ANCHOR *ret, NODE * node, int poped)
-{
-    enum node_type type;
-    LINK_ELEMENT *saved_last_element = 0;
-    int line;
-
-    if (node == 0) {
-	if (!poped) {
-	    debugs("node: NODE_NIL(implicit)\n");
-	    ADD_INSN(ret, iseq->compile_data->last_line, putnil);
-	}
-	return COMPILE_OK;
-    }
-
-    line = (int)nd_line(node);
-
-    if (iseq->compile_data->last_line == line) {
-	/* ignore */
-    }
-    else {
-	if (node->flags & NODE_FL_NEWLINE) {
-	    iseq->compile_data->last_line = line;
-	    ADD_TRACE(ret, line, RUBY_EVENT_LINE);
-	    saved_last_element = ret->last;
-	}
-    }
-
-    debug_node_start(node);
-
-    type = nd_type(node);
-
-    switch (type) {
-      case NODE_BLOCK:{
-	while (node && nd_type(node) == NODE_BLOCK) {
-	    COMPILE_(ret, "BLOCK body", node->nd_head,
-		     (node->nd_next == 0 && poped == 0) ? 0 : 1);
-	    node = node->nd_next;
-	}
-	if (node) {
-	    COMPILE_(ret, "BLOCK next", node->nd_next, poped);
-	}
-	break;
-      }
-      case NODE_IF:{
-	DECL_ANCHOR(cond_seq);
-	DECL_ANCHOR(then_seq);
-	DECL_ANCHOR(else_seq);
-	LABEL *then_label, *else_label, *end_label;
-
-	INIT_ANCHOR(cond_seq);
-	INIT_ANCHOR(then_seq);
-	INIT_ANCHOR(else_seq);
-	then_label = NEW_LABEL(line);
-	else_label = NEW_LABEL(line);
-	end_label = NEW_LABEL(line);
-
-	compile_branch_condition(iseq, cond_seq, node->nd_cond,
-				 then_label, else_label);
-	COMPILE_(then_seq, "then", node->nd_body, poped);
-	COMPILE_(else_seq, "else", node->nd_else, poped);
-
-	ADD_SEQ(ret, cond_seq);
-
-	ADD_LABEL(ret, then_label);
-	ADD_SEQ(ret, then_seq);
-	ADD_INSNL(ret, line, jump, end_label);
-
-	ADD_LABEL(ret, else_label);
-	ADD_SEQ(ret, else_seq);
-
-	ADD_LABEL(ret, end_label);
-
-	break;
-      }
-      case NODE_CASE:{
-	NODE *vals;
-	NODE *tempnode = node;
-	LABEL *endlabel, *elselabel;
-	DECL_ANCHOR(head);
-	DECL_ANCHOR(body_seq);
-	DECL_ANCHOR(cond_seq);
-	int only_special_literals = 1;
-	VALUE literals = rb_hash_new();
-
-	INIT_ANCHOR(head);
-	INIT_ANCHOR(body_seq);
-	INIT_ANCHOR(cond_seq);
-
-	rb_hash_tbl_raw(literals)->type = &cdhash_type;
-
-	if (node->nd_head == 0) {
-	    COMPILE_(ret, "when", node->nd_body, poped);
-	    break;
-	}
-	COMPILE(head, "case base", node->nd_head);
-
-	node = node->nd_body;
-	type = nd_type(node);
-	line = nd_line(node);
-
-	if (type != NODE_WHEN) {
-	    COMPILE_ERROR((ERROR_ARGS "NODE_CASE: unexpected node. must be NODE_WHEN, but %s", ruby_node_name(type)));
-	}
-
-	endlabel = NEW_LABEL(line);
-	elselabel = NEW_LABEL(line);
-
-	ADD_SEQ(ret, head);	/* case VAL */
-
-	while (type == NODE_WHEN) {
-	    LABEL *l1;
-
-	    l1 = NEW_LABEL(line);
-	    ADD_LABEL(body_seq, l1);
-	    ADD_INSN(body_seq, line, pop);
-	    COMPILE_(body_seq, "when body", node->nd_body, poped);
-	    ADD_INSNL(body_seq, line, jump, endlabel);
-
-	    vals = node->nd_head;
-	    if (vals) {
-		switch (nd_type(vals)) {
-		  case NODE_ARRAY:
-		    only_special_literals = when_vals(iseq, cond_seq, vals, l1, only_special_literals, literals);
-		    break;
-		  case NODE_SPLAT:
-		  case NODE_ARGSCAT:
-		  case NODE_ARGSPUSH:
-		    only_special_literals = 0;
-		    ADD_INSN (cond_seq, nd_line(vals), dup);
-		    COMPILE(cond_seq, "when/cond splat", vals);
-		    ADD_INSN1(cond_seq, nd_line(vals), checkmatch, INT2FIX(VM_CHECKMATCH_TYPE_CASE | VM_CHECKMATCH_ARRAY));
-		    ADD_INSNL(cond_seq, nd_line(vals), branchif, l1);
-		    break;
-		  default:
-		    rb_bug("NODE_CASE: unknown node (%s)",
-			   ruby_node_name(nd_type(vals)));
-		}
-	    }
-	    else {
-		rb_bug("NODE_CASE: must be NODE_ARRAY, but 0");
-	    }
-
-	    node = node->nd_next;
-	    if (!node) {
-		break;
-	    }
-	    type = nd_type(node);
-	    line = nd_line(node);
-	}
-	/* else */
-	if (node) {
-	    ADD_LABEL(cond_seq, elselabel);
-	    ADD_INSN(cond_seq, line, pop);
-	    COMPILE_(cond_seq, "else", node, poped);
-	    ADD_INSNL(cond_seq, line, jump, endlabel);
-	}
-	else {
-	    debugs("== else (implicit)\n");
-	    ADD_LABEL(cond_seq, elselabel);
-	    ADD_INSN(cond_seq, nd_line(tempnode), pop);
-	    if (!poped) {
-		ADD_INSN(cond_seq, nd_line(tempnode), putnil);
-	    }
-	    ADD_INSNL(cond_seq, nd_line(tempnode), jump, endlabel);
-	}
-
-	if (only_special_literals) {
-	    iseq_add_mark_object(iseq, literals);
-
-	    ADD_INSN(ret, nd_line(tempnode), dup);
-	    ADD_INSN2(ret, nd_line(tempnode), opt_case_dispatch, literals, elselabel);
-	}
-
-	ADD_SEQ(ret, cond_seq);
-	ADD_SEQ(ret, body_seq);
-	ADD_LABEL(ret, endlabel);
-	break;
-      }
-      case NODE_WHEN:{
-	NODE *vals;
-	NODE *val;
-	NODE *orig_node = node;
-	LABEL *endlabel;
-	DECL_ANCHOR(body_seq);
-
-	INIT_ANCHOR(body_seq);
-	endlabel = NEW_LABEL(line);
-
-	while (node && nd_type(node) == NODE_WHEN) {
-	    LABEL *l1 = NEW_LABEL(line = nd_line(node));
-	    ADD_LABEL(body_seq, l1);
-	    COMPILE_(body_seq, "when", node->nd_body, poped);
-	    ADD_INSNL(body_seq, line, jump, endlabel);
-
-	    vals = node->nd_head;
-	    if (!vals) {
-		rb_bug("NODE_WHEN: must be NODE_ARRAY, but 0");
-	    }
-	    switch (nd_type(vals)) {
-	      case NODE_ARRAY:
-		while (vals) {
-		    val = vals->nd_head;
-		    COMPILE(ret, "when2", val);
-		    ADD_INSNL(ret, nd_line(val), branchif, l1);
-		    vals = vals->nd_next;
-		}
-		break;
-	      case NODE_SPLAT:
-	      case NODE_ARGSCAT:
-	      case NODE_ARGSPUSH:
-		ADD_INSN(ret, nd_line(vals), putnil);
-		COMPILE(ret, "when2/cond splat", vals);
-		ADD_INSN1(ret, nd_line(vals), checkmatch, INT2FIX(VM_CHECKMATCH_TYPE_WHEN | VM_CHECKMATCH_ARRAY));
-		ADD_INSNL(ret, nd_line(vals), branchif, l1);
-		break;
-	      default:
-		rb_bug("NODE_WHEN: unknown node (%s)",
-		       ruby_node_name(nd_type(vals)));
-	    }
-	    node = node->nd_next;
-	}
-	/* else */
-	COMPILE_(ret, "else", node, poped);
-	ADD_INSNL(ret, nd_line(orig_node), jump, endlabel);
-
-	ADD_SEQ(ret, body_seq);
-	ADD_LABEL(ret, endlabel);
-
-	break;
-      }
-      case NODE_OPT_N:
-      case NODE_WHILE:
-      case NODE_UNTIL:{
-	LABEL *prev_start_label = iseq->compile_data->start_label;
-	LABEL *prev_end_label = iseq->compile_data->end_label;
-	LABEL *prev_redo_label = iseq->compile_data->redo_label;
-	int prev_loopval_popped = iseq->compile_data->loopval_popped;
-
-	struct iseq_compile_data_ensure_node_stack enl;
-
-	LABEL *next_label = iseq->compile_data->start_label = NEW_LABEL(line);	/* next  */
-	LABEL *redo_label = iseq->compile_data->redo_label = NEW_LABEL(line);	/* redo  */
-	LABEL *break_label = iseq->compile_data->end_label = NEW_LABEL(line);	/* break */
-	LABEL *end_label = NEW_LABEL(line);
-
-	LABEL *next_catch_label = NEW_LABEL(line);
-	LABEL *tmp_label = NULL;
-
-	iseq->compile_data->loopval_popped = 0;
-	push_ensure_entry(iseq, &enl, 0, 0);
-
-	if (type == NODE_OPT_N || node->nd_state == 1) {
-	    ADD_INSNL(ret, line, jump, next_label);
-	}
-	else {
-	    tmp_label = NEW_LABEL(line);
-	    ADD_INSNL(ret, line, jump, tmp_label);
-	}
-	ADD_INSN(ret, line, putnil);
-	ADD_LABEL(ret, next_catch_label);
-	ADD_INSN(ret, line, pop);
-	ADD_INSNL(ret, line, jump, next_label);
-	if (tmp_label) ADD_LABEL(ret, tmp_label);
-
-	ADD_LABEL(ret, redo_label);
-	COMPILE_POPED(ret, "while body", node->nd_body);
-	ADD_LABEL(ret, next_label);	/* next */
-
-	if (type == NODE_WHILE) {
-	    compile_branch_condition(iseq, ret, node->nd_cond,
-				     redo_label, end_label);
-	}
-	else if (type == NODE_UNTIL) {
-	    /* until */
-	    compile_branch_condition(iseq, ret, node->nd_cond,
-				     end_label, redo_label);
-	}
-	else {
-	    ADD_CALL_RECEIVER(ret, line);
-	    ADD_CALL(ret, line, idGets, INT2FIX(0));
-	    ADD_INSNL(ret, line, branchif, redo_label);
-	    /* opt_n */
-	}
-
-	ADD_LABEL(ret, end_label);
-
-	if (node->nd_state == Qundef) {
-	    /* ADD_INSN(ret, line, putundef); */
-	    rb_bug("unsupported: putundef");
-	}
-	else {
-	    ADD_INSN(ret, line, putnil);
-	}
-
-	ADD_LABEL(ret, break_label);	/* break */
-
-	if (poped) {
-	    ADD_INSN(ret, line, pop);
-	}
-
-	ADD_CATCH_ENTRY(CATCH_TYPE_BREAK, redo_label, break_label,
-			0, break_label);
-	ADD_CATCH_ENTRY(CATCH_TYPE_NEXT, redo_label, break_label, 0,
-			next_catch_label);
-	ADD_CATCH_ENTRY(CATCH_TYPE_REDO, redo_label, break_label, 0,
-			iseq->compile_data->redo_label);
-
-	iseq->compile_data->start_label = prev_start_label;
-	iseq->compile_data->end_label = prev_end_label;
-	iseq->compile_data->redo_label = prev_redo_label;
-	iseq->compile_data->loopval_popped = prev_loopval_popped;
-	iseq->compile_data->ensure_node_stack = iseq->compile_data->ensure_node_stack->prev;
-	break;
-      }
-      case NODE_FOR:
-	if (node->nd_var) {
-	    /* massign to var in "for"
-	     * args.length == 1 && Array === (tmp = args[0]) ? tmp : args
-	     */
-	    NODE *var = node->nd_var;
-	    LABEL *not_single = NEW_LABEL(nd_line(var));
-	    LABEL *not_ary = NEW_LABEL(nd_line(var));
-	    COMPILE(ret, "for var", var);
-	    ADD_INSN(ret, line, dup);
-	    ADD_CALL(ret, line, idLength, INT2FIX(0));
-	    ADD_INSN1(ret, line, putobject, INT2FIX(1));
-	    ADD_CALL(ret, line, idEq, INT2FIX(1));
-	    ADD_INSNL(ret, line, branchunless, not_single);
-	    ADD_INSN(ret, line, dup);
-	    ADD_INSN1(ret, line, putobject, INT2FIX(0));
-	    ADD_CALL(ret, line, idAREF, INT2FIX(1));
-	    ADD_INSN1(ret, line, putobject, rb_cArray);
-	    ADD_INSN1(ret, line, topn, INT2FIX(1));
-	    ADD_CALL(ret, line, idEqq, INT2FIX(1));
-	    ADD_INSNL(ret, line, branchunless, not_ary);
-	    ADD_INSN(ret, line, swap);
-	    ADD_LABEL(ret, not_ary);
-	    ADD_INSN(ret, line, pop);
-	    ADD_LABEL(ret, not_single);
-	    break;
-	}
-      case NODE_ITER:{
-	const rb_iseq_t *prevblock = iseq->compile_data->current_block;
-	LABEL *retry_label = NEW_LABEL(line);
-	LABEL *retry_end_l = NEW_LABEL(line);
-
-	ADD_LABEL(ret, retry_label);
-	if (nd_type(node) == NODE_FOR) {
-	    COMPILE(ret, "iter caller (for)", node->nd_iter);
-
-	    iseq->compile_data->current_block = NEW_CHILD_ISEQ(node->nd_body, make_name_for_block(iseq),
-							       ISEQ_TYPE_BLOCK, line);
-	    ADD_SEND_WITH_BLOCK(ret, line, idEach, INT2FIX(0), iseq->compile_data->current_block);
-	}
-	else {
-	    iseq->compile_data->current_block = NEW_CHILD_ISEQ(node->nd_body, make_name_for_block(iseq),
-							       ISEQ_TYPE_BLOCK, line);
-	    COMPILE(ret, "iter caller", node->nd_iter);
-	}
-	ADD_LABEL(ret, retry_end_l);
-
-	if (poped) {
-	    ADD_INSN(ret, line, pop);
-	}
-
-	iseq->compile_data->current_block = prevblock;
-
-	ADD_CATCH_ENTRY(CATCH_TYPE_BREAK, retry_label, retry_end_l, 0, retry_end_l);
-
-	break;
-      }
-      case NODE_BREAK:{
-	unsigned long level = 0;
-
-	if (iseq->compile_data->redo_label != 0) {
-	    /* while/until */
-	    LABEL *splabel = NEW_LABEL(0);
-	    ADD_LABEL(ret, splabel);
-	    ADD_ADJUST(ret, line, iseq->compile_data->redo_label);
-	    COMPILE_(ret, "break val (while/until)", node->nd_stts, iseq->compile_data->loopval_popped);
-	    add_ensure_iseq(ret, iseq, 0);
-	    ADD_INSNL(ret, line, jump, iseq->compile_data->end_label);
-	    ADD_ADJUST_RESTORE(ret, splabel);
-
-	    if (!poped) {
-		ADD_INSN(ret, line, putnil);
-	    }
-	}
-	else if (iseq->body->type == ISEQ_TYPE_BLOCK) {
-	  break_by_insn:
-	    /* escape from block */
-	    COMPILE(ret, "break val (block)", node->nd_stts);
-	    ADD_INSN1(ret, line, throw, INT2FIX(level | TAG_BREAK));
-	    if (poped) {
-		ADD_INSN(ret, line, pop);
-	    }
-	}
-	else if (iseq->body->type == ISEQ_TYPE_EVAL) {
-	  break_in_eval:
-	    COMPILE_ERROR((ERROR_ARGS "Can't escape from eval with break"));
-	}
-	else {
-	    const rb_iseq_t *ip = iseq->body->parent_iseq;
-
-	    while (ip) {
-		if (!ip->compile_data) {
-		    ip = 0;
-		    break;
-		}
-
-		level++;
-		if (ip->compile_data->redo_label != 0) {
-		    level = VM_THROW_NO_ESCAPE_FLAG;
-		    goto break_by_insn;
-		}
-		else if (ip->body->type == ISEQ_TYPE_BLOCK) {
-		    level <<= VM_THROW_LEVEL_SHIFT;
-		    goto break_by_insn;
-		}
-		else if (ip->body->type == ISEQ_TYPE_EVAL) {
-		    goto break_in_eval;
-		}
-
-		ip = ip->body->parent_iseq;
-	    }
-	    COMPILE_ERROR((ERROR_ARGS "Invalid break"));
-	}
-	break;
-      }
-      case NODE_NEXT:{
-	unsigned long level = 0;
-
-	if (iseq->compile_data->redo_label != 0) {
-	    LABEL *splabel = NEW_LABEL(0);
-	    debugs("next in while loop\n");
-	    ADD_LABEL(ret, splabel);
-	    COMPILE(ret, "next val/valid syntax?", node->nd_stts);
-	    add_ensure_iseq(ret, iseq, 0);
-	    ADD_ADJUST(ret, line, iseq->compile_data->redo_label);
-	    ADD_INSNL(ret, line, jump, iseq->compile_data->start_label);
-	    ADD_ADJUST_RESTORE(ret, splabel);
-	    if (!poped) {
-		ADD_INSN(ret, line, putnil);
-	    }
-	}
-	else if (iseq->compile_data->end_label) {
-	    LABEL *splabel = NEW_LABEL(0);
-	    debugs("next in block\n");
-	    ADD_LABEL(ret, splabel);
-	    ADD_ADJUST(ret, line, iseq->compile_data->start_label);
-	    COMPILE(ret, "next val", node->nd_stts);
-	    add_ensure_iseq(ret, iseq, 0);
-	    ADD_INSNL(ret, line, jump, iseq->compile_data->end_label);
-	    ADD_ADJUST_RESTORE(ret, splabel);
-
-	    if (!poped) {
-		ADD_INSN(ret, line, putnil);
-	    }
-	}
-	else if (iseq->body->type == ISEQ_TYPE_EVAL) {
-	  next_in_eval:
-	    COMPILE_ERROR((ERROR_ARGS "Can't escape from eval with next"));
-	}
-	else {
-	    const rb_iseq_t *ip = iseq;
-
-	    while (ip) {
-		if (!ip->compile_data) {
-		    ip = 0;
-		    break;
-		}
-
-		level = VM_THROW_NO_ESCAPE_FLAG;
-		if (ip->compile_data->redo_label != 0) {
-		    /* while loop */
-		    break;
-		}
-		else if (ip->body->type == ISEQ_TYPE_BLOCK) {
-		    break;
-		}
-		else if (ip->body->type == ISEQ_TYPE_EVAL) {
-		    goto next_in_eval;
-		}
-
-		ip = ip->body->parent_iseq;
-	    }
-	    if (ip != 0) {
-		COMPILE(ret, "next val", node->nd_stts);
-		ADD_INSN1(ret, line, throw, INT2FIX(level | TAG_NEXT));
-
-		if (poped) {
-		    ADD_INSN(ret, line, pop);
-		}
-	    }
-	    else {
-		COMPILE_ERROR((ERROR_ARGS "Invalid next"));
-	    }
-	}
-	break;
-      }
-      case NODE_REDO:{
-	if (iseq->compile_data->redo_label) {
-	    LABEL *splabel = NEW_LABEL(0);
-	    debugs("redo in while");
-	    ADD_LABEL(ret, splabel);
-	    ADD_ADJUST(ret, line, iseq->compile_data->redo_label);
-	    add_ensure_iseq(ret, iseq, 0);
-	    ADD_INSNL(ret, line, jump, iseq->compile_data->redo_label);
-	    ADD_ADJUST_RESTORE(ret, splabel);
-	    if (!poped) {
-		ADD_INSN(ret, line, putnil);
-	    }
-	}
-	else if (iseq->body->type == ISEQ_TYPE_EVAL) {
-	  redo_in_eval:
-	    COMPILE_ERROR((ERROR_ARGS "Can't escape from eval with redo"));
-	}
-	else if (iseq->compile_data->start_label) {
-	    LABEL *splabel = NEW_LABEL(0);
-
-	    debugs("redo in block");
-	    ADD_LABEL(ret, splabel);
-	    add_ensure_iseq(ret, iseq, 0);
-	    ADD_ADJUST(ret, line, iseq->compile_data->start_label);
-	    ADD_INSNL(ret, line, jump, iseq->compile_data->start_label);
-	    ADD_ADJUST_RESTORE(ret, splabel);
-
-	    if (!poped) {
-		ADD_INSN(ret, line, putnil);
-	    }
-	}
-	else {
-	    const rb_iseq_t *ip = iseq;
-	    const unsigned long level = VM_THROW_NO_ESCAPE_FLAG;
-
-	    while (ip) {
-		if (!ip->compile_data) {
-		    ip = 0;
-		    break;
-		}
-
-		if (ip->compile_data->redo_label != 0) {
-		    break;
-		}
-		else if (ip->body->type == ISEQ_TYPE_BLOCK) {
-		    break;
-		}
-		else if (ip->body->type == ISEQ_TYPE_EVAL) {
-		    goto redo_in_eval;
-		}
-
-		ip = ip->body->parent_iseq;
-	    }
-	    if (ip != 0) {
-		ADD_INSN(ret, line, putnil);
-		ADD_INSN1(ret, line, throw, INT2FIX(level | TAG_REDO));
-
-		if (poped) {
-		    ADD_INSN(ret, line, pop);
-		}
-	    }
-	    else {
-		COMPILE_ERROR((ERROR_ARGS "Invalid redo"));
-	    }
-	}
-	break;
-      }
-      case NODE_RETRY:{
-	if (iseq->body->type == ISEQ_TYPE_RESCUE) {
-	    ADD_INSN(ret, line, putnil);
-	    ADD_INSN1(ret, line, throw, INT2FIX(TAG_RETRY));
-
-	    if (poped) {
-		ADD_INSN(ret, line, pop);
-	    }
-	}
-	else {
-	    COMPILE_ERROR((ERROR_ARGS "Invalid retry"));
-	}
-	break;
-      }
-      case NODE_BEGIN:{
-	COMPILE_(ret, "NODE_BEGIN", node->nd_body, poped);
-	break;
-      }
-      case NODE_RESCUE:{
-	LABEL *lstart = NEW_LABEL(line);
-	LABEL *lend = NEW_LABEL(line);
-	LABEL *lcont = NEW_LABEL(line);
-	const rb_iseq_t *rescue = NEW_CHILD_ISEQ(node->nd_resq,
-						 rb_str_concat(rb_str_new2("rescue in "), iseq->body->location.label),
-						 ISEQ_TYPE_RESCUE, line);
-
-	ADD_LABEL(ret, lstart);
-	COMPILE(ret, "rescue head", node->nd_head);
-	ADD_LABEL(ret, lend);
-	if (node->nd_else) {
-	    ADD_INSN(ret, line, pop);
-	    COMPILE(ret, "rescue else", node->nd_else);
-	}
-	ADD_INSN(ret, line, nop);
-	ADD_LABEL(ret, lcont);
-
-	if (poped) {
-	    ADD_INSN(ret, line, pop);
-	}
-
-	/* register catch entry */
-	ADD_CATCH_ENTRY(CATCH_TYPE_RESCUE, lstart, lend, rescue, lcont);
-	ADD_CATCH_ENTRY(CATCH_TYPE_RETRY, lend, lcont, 0, lstart);
-	break;
-      }
-      case NODE_RESBODY:{
-	NODE *resq = node;
-	NODE *narg;
-	LABEL *label_miss, *label_hit;
-
-	while (resq) {
-	    label_miss = NEW_LABEL(line);
-	    label_hit = NEW_LABEL(line);
-
-	    narg = resq->nd_args;
-	    if (narg) {
-		switch (nd_type(narg)) {
-		  case NODE_ARRAY:
-		    while (narg) {
-			ADD_INSN2(ret, line, getlocal, INT2FIX(2), INT2FIX(0));
-			COMPILE(ret, "rescue arg", narg->nd_head);
-			ADD_INSN1(ret, line, checkmatch, INT2FIX(VM_CHECKMATCH_TYPE_RESCUE));
-			ADD_INSNL(ret, line, branchif, label_hit);
-			narg = narg->nd_next;
-		    }
-		    break;
-		  case NODE_SPLAT:
-		  case NODE_ARGSCAT:
-		  case NODE_ARGSPUSH:
-		    ADD_INSN2(ret, line, getlocal, INT2FIX(2), INT2FIX(0));
-		    COMPILE(ret, "rescue/cond splat", narg);
-		    ADD_INSN1(ret, line, checkmatch, INT2FIX(VM_CHECKMATCH_TYPE_RESCUE | VM_CHECKMATCH_ARRAY));
-		    ADD_INSNL(ret, line, branchif, label_hit);
-		    break;
-		  default:
-		    rb_bug("NODE_RESBODY: unknown node (%s)",
-			   ruby_node_name(nd_type(narg)));
-		}
-	    }
-	    else {
-		ADD_INSN2(ret, line, getlocal, INT2FIX(2), INT2FIX(0));
-		ADD_INSN1(ret, line, putobject, rb_eStandardError);
-		ADD_INSN1(ret, line, checkmatch, INT2FIX(VM_CHECKMATCH_TYPE_RESCUE));
-		ADD_INSNL(ret, line, branchif, label_hit);
-	    }
-	    ADD_INSNL(ret, line, jump, label_miss);
-	    ADD_LABEL(ret, label_hit);
-	    COMPILE(ret, "resbody body", resq->nd_body);
-	    if (iseq->compile_data->option->tailcall_optimization) {
-		ADD_INSN(ret, line, nop);
-	    }
-	    ADD_INSN(ret, line, leave);
-	    ADD_LABEL(ret, label_miss);
-	    resq = resq->nd_head;
-	}
-	break;
-      }
-      case NODE_ENSURE:{
-	DECL_ANCHOR(ensr);
-	const rb_iseq_t *ensure = NEW_CHILD_ISEQ(node->nd_ensr,
-						 rb_str_concat(rb_str_new2 ("ensure in "), iseq->body->location.label),
-						 ISEQ_TYPE_ENSURE, line);
-	LABEL *lstart = NEW_LABEL(line);
-	LABEL *lend = NEW_LABEL(line);
-	LABEL *lcont = NEW_LABEL(line);
-	struct ensure_range er;
-	struct iseq_compile_data_ensure_node_stack enl;
-	struct ensure_range *erange;
-
-	INIT_ANCHOR(ensr);
-	COMPILE_POPED(ensr, "ensure ensr", node->nd_ensr);
-
-	er.begin = lstart;
-	er.end = lend;
-	er.next = 0;
-	push_ensure_entry(iseq, &enl, &er, node->nd_ensr);
-
-	ADD_LABEL(ret, lstart);
-	COMPILE_(ret, "ensure head", node->nd_head, poped);
-	ADD_LABEL(ret, lend);
-	if (ensr->anchor.next == 0) {
-	    ADD_INSN(ret, line, nop);
-	}
-	else {
-	    ADD_SEQ(ret, ensr);
-	}
-	ADD_LABEL(ret, lcont);
-
-	erange = iseq->compile_data->ensure_node_stack->erange;
-	while (erange) {
-	    ADD_CATCH_ENTRY(CATCH_TYPE_ENSURE, erange->begin, erange->end,
-			    ensure, lcont);
-	    erange = erange->next;
-	}
-
-	iseq->compile_data->ensure_node_stack = enl.prev;
-	break;
-      }
-
-      case NODE_AND:
-      case NODE_OR:{
-	LABEL *end_label = NEW_LABEL(line);
-	COMPILE(ret, "nd_1st", node->nd_1st);
-	if (!poped) {
-	    ADD_INSN(ret, line, dup);
-	}
-	if (type == NODE_AND) {
-	    ADD_INSNL(ret, line, branchunless, end_label);
-	}
-	else {
-	    ADD_INSNL(ret, line, branchif, end_label);
-	}
-	if (!poped) {
-	    ADD_INSN(ret, line, pop);
-	}
-	COMPILE_(ret, "nd_2nd", node->nd_2nd, poped);
-	ADD_LABEL(ret, end_label);
-	break;
-      }
-
-      case NODE_MASGN:{
-	compile_massign(iseq, ret, node, poped);
-	break;
-      }
-
-      case NODE_LASGN:{
-	ID id = node->nd_vid;
-	int idx = iseq->body->local_iseq->body->local_size - get_local_var_idx(iseq, id);
-
-	debugs("lvar: %"PRIsVALUE" idx: %d\n", rb_id2str(id), idx);
-	COMPILE(ret, "rvalue", node->nd_value);
-
-	if (!poped) {
-	    ADD_INSN(ret, line, dup);
-	}
-	ADD_INSN2(ret, line, setlocal, INT2FIX(idx), INT2FIX(get_lvar_level(iseq)));
-
-	break;
-      }
-      case NODE_DASGN:
-      case NODE_DASGN_CURR:{
-	int idx, lv, ls;
-	COMPILE(ret, "dvalue", node->nd_value);
-	debugi("dassn id", rb_id2str(node->nd_vid) ? node->nd_vid : '*');
-
-	if (!poped) {
-	    ADD_INSN(ret, line, dup);
-	}
-
-	idx = get_dyna_var_idx(iseq, node->nd_vid, &lv, &ls);
-
-	if (idx < 0) {
-	    rb_bug("NODE_DASGN(_CURR): unknown id (%"PRIsVALUE")", rb_id2str(node->nd_vid));
-	}
-
-	ADD_INSN2(ret, line, setlocal, INT2FIX(ls - idx), INT2FIX(lv));
-	break;
-      }
-      case NODE_GASGN:{
-	COMPILE(ret, "lvalue", node->nd_value);
-
-	if (!poped) {
-	    ADD_INSN(ret, line, dup);
-	}
-	ADD_INSN1(ret, line, setglobal,
-		  ((VALUE)node->nd_entry | 1));
-	break;
-      }
-      case NODE_IASGN:
-      case NODE_IASGN2:{
-	COMPILE(ret, "lvalue", node->nd_value);
-	if (!poped) {
-	    ADD_INSN(ret, line, dup);
-	}
-	ADD_INSN2(ret, line, setinstancevariable,
-		  ID2SYM(node->nd_vid), INT2FIX(iseq->body->is_size++));
-	break;
-      }
-      case NODE_CDECL:{
-	COMPILE(ret, "lvalue", node->nd_value);
-
-	if (!poped) {
-	    ADD_INSN(ret, line, dup);
-	}
-
-	if (node->nd_vid) {
-	    ADD_INSN1(ret, line, putspecialobject,
-		      INT2FIX(VM_SPECIAL_OBJECT_CONST_BASE));
-	    ADD_INSN1(ret, line, setconstant, ID2SYM(node->nd_vid));
-	}
-	else {
-	    compile_cpath(ret, iseq, node->nd_else);
-	    ADD_INSN1(ret, line, setconstant, ID2SYM(node->nd_else->nd_mid));
-	}
-	break;
-      }
-      case NODE_CVASGN:{
-	COMPILE(ret, "cvasgn val", node->nd_value);
-	if (!poped) {
-	    ADD_INSN(ret, line, dup);
-	}
-	ADD_INSN1(ret, line, setclassvariable,
-		  ID2SYM(node->nd_vid));
-	break;
-      }
-      case NODE_OP_ASGN1: {
-	DECL_ANCHOR(args);
-	VALUE argc;
-	unsigned int flag = 0;
-	unsigned int asgnflag = 0;
-	ID id = node->nd_mid;
-	int boff = 0;
-
-	/*
-	 * a[x] (op)= y
-	 *
-	 * nil       # nil
-	 * eval a    # nil a
-	 * eval x    # nil a x
-	 * dupn 2    # nil a x a x
-	 * send :[]  # nil a x a[x]
-	 * eval y    # nil a x a[x] y
-	 * send op   # nil a x ret
-	 * setn 3    # ret a x ret
-	 * send []=  # ret ?
-	 * pop       # ret
-	 */
-
-	/*
-	 * nd_recv[nd_args->nd_body] (nd_mid)= nd_args->nd_head;
-	 * NODE_OP_ASGN nd_recv
-	 *              nd_args->nd_head
-	 *              nd_args->nd_body
-	 *              nd_mid
-	 */
-
-	if (!poped) {
-	    ADD_INSN(ret, line, putnil);
-	}
-	asgnflag = COMPILE_RECV(ret, "NODE_OP_ASGN1 recv", node);
-	switch (nd_type(node->nd_args->nd_head)) {
-	  case NODE_ZARRAY:
-	    argc = INT2FIX(0);
-	    break;
-	  case NODE_BLOCK_PASS:
-	    boff = 1;
-	  default:
-	    INIT_ANCHOR(args);
-	    argc = setup_args(iseq, args, node->nd_args->nd_head, &flag, NULL);
-	    ADD_SEQ(ret, args);
-	}
-	ADD_INSN1(ret, line, dupn, FIXNUM_INC(argc, 1 + boff));
-	ADD_SEND_WITH_FLAG(ret, line, idAREF, argc, INT2FIX(flag));
-	flag |= asgnflag;
-
-	if (id == 0 || id == 1) {
-	    /* 0: or, 1: and
-	       a[x] ||= y
-
-	       unless/if a[x]
-	       a[x]= y
-	       else
-	       nil
-	       end
-	    */
-	    LABEL *label = NEW_LABEL(line);
-	    LABEL *lfin = NEW_LABEL(line);
-
-	    ADD_INSN(ret, line, dup);
-	    if (id == 0) {
-		/* or */
-		ADD_INSNL(ret, line, branchif, label);
-	    }
-	    else {
-		/* and */
-		ADD_INSNL(ret, line, branchunless, label);
-	    }
-	    ADD_INSN(ret, line, pop);
-
-	    COMPILE(ret, "NODE_OP_ASGN1 args->body: ", node->nd_args->nd_body);
-	    if (!poped) {
-		ADD_INSN1(ret, line, setn, FIXNUM_INC(argc, 2+boff));
-	    }
-	    if (flag & VM_CALL_ARGS_SPLAT) {
-		ADD_INSN1(ret, line, newarray, INT2FIX(1));
-		if (boff > 0) {
-		    ADD_INSN1(ret, line, dupn, INT2FIX(3));
-		    ADD_INSN(ret, line, swap);
-		    ADD_INSN(ret, line, pop);
-		}
-		ADD_INSN(ret, line, concatarray);
-		if (boff > 0) {
-		    ADD_INSN1(ret, line, setn, INT2FIX(3));
-		    ADD_INSN(ret, line, pop);
-		    ADD_INSN(ret, line, pop);
-		}
-		ADD_SEND_WITH_FLAG(ret, line, idASET, argc, INT2FIX(flag));
-	    }
-	    else {
-		if (boff > 0)
-		    ADD_INSN(ret, line, swap);
-		ADD_SEND_WITH_FLAG(ret, line, idASET, FIXNUM_INC(argc, 1), INT2FIX(flag));
-	    }
-	    ADD_INSN(ret, line, pop);
-	    ADD_INSNL(ret, line, jump, lfin);
-	    ADD_LABEL(ret, label);
-	    if (!poped) {
-		ADD_INSN1(ret, line, setn, FIXNUM_INC(argc, 2+boff));
-	    }
-	    ADD_INSN1(ret, line, adjuststack, FIXNUM_INC(argc, 2+boff));
-	    ADD_LABEL(ret, lfin);
-	}
-	else {
-	    COMPILE(ret, "NODE_OP_ASGN1 args->body: ", node->nd_args->nd_body);
-	    ADD_SEND(ret, line, id, INT2FIX(1));
-	    if (!poped) {
-		ADD_INSN1(ret, line, setn, FIXNUM_INC(argc, 2+boff));
-	    }
-	    if (flag & VM_CALL_ARGS_SPLAT) {
-		ADD_INSN1(ret, line, newarray, INT2FIX(1));
-		if (boff > 0) {
-		    ADD_INSN1(ret, line, dupn, INT2FIX(3));
-		    ADD_INSN(ret, line, swap);
-		    ADD_INSN(ret, line, pop);
-		}
-		ADD_INSN(ret, line, concatarray);
-		if (boff > 0) {
-		    ADD_INSN1(ret, line, setn, INT2FIX(3));
-		    ADD_INSN(ret, line, pop);
-		    ADD_INSN(ret, line, pop);
-		}
-		ADD_SEND_WITH_FLAG(ret, line, idASET, argc, INT2FIX(flag));
-	    }
-	    else {
-		if (boff > 0)
-		    ADD_INSN(ret, line, swap);
-		ADD_SEND_WITH_FLAG(ret, line, idASET, FIXNUM_INC(argc, 1), INT2FIX(flag));
-	    }
-	    ADD_INSN(ret, line, pop);
-	}
-
-	break;
-      }
-      case NODE_OP_ASGN2:{
-	ID atype = node->nd_next->nd_mid;
-	ID vid = node->nd_next->nd_vid, aid = rb_id_attrset(vid);
-	VALUE asgnflag;
-	LABEL *lfin = NEW_LABEL(line);
-	LABEL *lcfin = NEW_LABEL(line);
-	LABEL *lskip = 0;
-	/*
-	  class C; attr_accessor :c; end
-	  r = C.new
-	  r.a &&= v # asgn2
-
-	  eval r    # r
-	  dup       # r r
-	  eval r.a  # r o
-
-	  # or
-	  dup       # r o o
-	  if lcfin  # r o
-	  pop       # r
-	  eval v    # r v
-	  swap      # v r
-	  topn 1    # v r v
-	  send a=   # v ?
-	  jump lfin # v ?
-
-	  lcfin:      # r o
-	  swap      # o r
-
-	  lfin:       # o ?
-	  pop       # o
-
-	  # and
-	  dup       # r o o
-	  unless lcfin
-	  pop       # r
-	  eval v    # r v
-	  swap      # v r
-	  topn 1    # v r v
-	  send a=   # v ?
-	  jump lfin # v ?
-
-	  # others
-	  eval v    # r o v
-	  send ??   # r w
-	  send a=   # w
-
-	*/
-
-	asgnflag = COMPILE_RECV(ret, "NODE_OP_ASGN2#recv", node);
-	if (node->nd_next->nd_aid) {
-	    lskip = NEW_LABEL(line);
-	    ADD_INSN(ret, line, dup);
-	    ADD_INSNL(ret, line, branchnil, lskip);
-	}
-	ADD_INSN(ret, line, dup);
-	ADD_SEND(ret, line, vid, INT2FIX(0));
-
-	if (atype == 0 || atype == 1) {	/* 0: OR or 1: AND */
-	    ADD_INSN(ret, line, dup);
-	    if (atype == 0) {
-		ADD_INSNL(ret, line, branchif, lcfin);
-	    }
-	    else {
-		ADD_INSNL(ret, line, branchunless, lcfin);
-	    }
-	    ADD_INSN(ret, line, pop);
-	    COMPILE(ret, "NODE_OP_ASGN2 val", node->nd_value);
-	    ADD_INSN(ret, line, swap);
-	    ADD_INSN1(ret, line, topn, INT2FIX(1));
-	    ADD_SEND_WITH_FLAG(ret, line, aid, INT2FIX(1), INT2FIX(asgnflag));
-	    ADD_INSNL(ret, line, jump, lfin);
-
-	    ADD_LABEL(ret, lcfin);
-	    ADD_INSN(ret, line, swap);
-
-	    ADD_LABEL(ret, lfin);
-	    ADD_INSN(ret, line, pop);
-	    if (lskip) {
-		ADD_LABEL(ret, lskip);
-	    }
-	    if (poped) {
-		/* we can apply more optimize */
-		ADD_INSN(ret, line, pop);
-	    }
-	}
-	else {
-	    COMPILE(ret, "NODE_OP_ASGN2 val", node->nd_value);
-	    ADD_SEND(ret, line, atype, INT2FIX(1));
-	    if (!poped) {
-		ADD_INSN(ret, line, swap);
-		ADD_INSN1(ret, line, topn, INT2FIX(1));
-	    }
-	    ADD_SEND_WITH_FLAG(ret, line, aid, INT2FIX(1), INT2FIX(asgnflag));
-	    ADD_INSN(ret, line, pop);
-	    if (lskip) {
-		ADD_LABEL(ret, lskip);
-	    }
-	}
-	break;
-      }
-      case NODE_OP_CDECL: {
-	LABEL *lfin = 0;
-	LABEL *lassign = 0;
-	ID mid;
-
-	switch (nd_type(node->nd_head)) {
-	  case NODE_COLON3:
-	    ADD_INSN1(ret, line, putobject, rb_cObject);
-	    break;
-	  case NODE_COLON2:
-	    COMPILE(ret, "NODE_OP_CDECL/colon2#nd_head", node->nd_head->nd_head);
-	    break;
-	  default:
-	    do {
-		COMPILE_ERROR((ERROR_ARGS "%s: invalid node in NODE_OP_CDECL",
-			       ruby_node_name(nd_type(node->nd_head))));
-	    } while (0);
-	    return COMPILE_NG;
-	}
-	mid = node->nd_head->nd_mid;
-	/* cref */
-	if (node->nd_aid == 0) {
-	    lassign = NEW_LABEL(line);
-	    ADD_INSN(ret, line, dup); /* cref cref */
-	    ADD_INSN3(ret, line, defined, INT2FIX(DEFINED_CONST),
-		      ID2SYM(mid), Qfalse); /* cref bool */
-	    ADD_INSNL(ret, line, branchunless, lassign); /* cref */
-	}
-	ADD_INSN(ret, line, dup); /* cref cref */
-	ADD_INSN1(ret, line, getconstant, ID2SYM(mid)); /* cref obj */
-
-	if (node->nd_aid == 0 || node->nd_aid == 1) {
-	    lfin = NEW_LABEL(line);
-	    if (!poped) ADD_INSN(ret, line, dup); /* cref [obj] obj */
-	    if (node->nd_aid == 0)
-		ADD_INSNL(ret, line, branchif, lfin);
-	    else
-		ADD_INSNL(ret, line, branchunless, lfin);
-	    /* cref [obj] */
-	    if (!poped) ADD_INSN(ret, line, pop); /* cref */
-	    if (lassign) ADD_LABEL(ret, lassign);
-	    COMPILE(ret, "NODE_OP_CDECL#nd_value", node->nd_value);
-	    /* cref value */
-	    if (poped)
-		ADD_INSN1(ret, line, topn, INT2FIX(1)); /* cref value cref */
-	    else {
-		ADD_INSN1(ret, line, dupn, INT2FIX(2)); /* cref value cref value */
-		ADD_INSN(ret, line, swap); /* cref value value cref */
-	    }
-	    ADD_INSN1(ret, line, setconstant, ID2SYM(mid)); /* cref [value] */
-	    ADD_LABEL(ret, lfin);			    /* cref [value] */
-	    if (!poped) ADD_INSN(ret, line, swap); /* [value] cref */
-	    ADD_INSN(ret, line, pop); /* [value] */
-	}
-	else {
-	    COMPILE(ret, "NODE_OP_CDECL#nd_value", node->nd_value);
-	    /* cref obj value */
-	    ADD_CALL(ret, line, node->nd_aid, INT2FIX(1));
-	    /* cref value */
-	    ADD_INSN(ret, line, swap); /* value cref */
-	    if (!poped) {
-		ADD_INSN1(ret, line, topn, INT2FIX(1)); /* value cref value */
-		ADD_INSN(ret, line, swap); /* value value cref */
-	    }
-	    ADD_INSN1(ret, line, setconstant, ID2SYM(mid));
-	}
-	break;
-      }
-      case NODE_OP_ASGN_AND:
-      case NODE_OP_ASGN_OR:{
-	LABEL *lfin = NEW_LABEL(line);
-	LABEL *lassign;
-
-	if (nd_type(node) == NODE_OP_ASGN_OR) {
-	    LABEL *lfinish[2];
-	    lfinish[0] = lfin;
-	    lfinish[1] = 0;
-	    defined_expr(iseq, ret, node->nd_head, lfinish, Qfalse);
-	    lassign = lfinish[1];
-	    if (!lassign) {
-		lassign = NEW_LABEL(line);
-	    }
-	    ADD_INSNL(ret, line, branchunless, lassign);
-	}
-	else {
-	    lassign = NEW_LABEL(line);
-	}
-
-	COMPILE(ret, "NODE_OP_ASGN_AND/OR#nd_head", node->nd_head);
-	ADD_INSN(ret, line, dup);
-
-	if (nd_type(node) == NODE_OP_ASGN_AND) {
-	    ADD_INSNL(ret, line, branchunless, lfin);
-	}
-	else {
-	    ADD_INSNL(ret, line, branchif, lfin);
-	}
-
-	ADD_INSN(ret, line, pop);
-	ADD_LABEL(ret, lassign);
-	COMPILE(ret, "NODE_OP_ASGN_AND/OR#nd_value", node->nd_value);
-	ADD_LABEL(ret, lfin);
-
-	if (poped) {
-	    /* we can apply more optimize */
-	    ADD_INSN(ret, line, pop);
-	}
-	break;
-      }
-      case NODE_CALL:
-	/* optimization shortcut
-	 *   "literal".freeze -> opt_str_freeze("literal")
-	 */
-	if (node->nd_recv && nd_type(node->nd_recv) == NODE_STR &&
-	    node->nd_mid == idFreeze && node->nd_args == NULL &&
-	    iseq->compile_data->current_block == NULL &&
-	    iseq->compile_data->option->specialized_instruction) {
-	    VALUE str = rb_fstring(node->nd_recv->nd_lit);
-	    iseq_add_mark_object(iseq, str);
-	    ADD_INSN1(ret, line, opt_str_freeze, str);
-	    if (poped) {
-		ADD_INSN(ret, line, pop);
-	    }
-	    break;
-	}
-	/* optimization shortcut
-	 *   obj["literal"] -> opt_aref_with(obj, "literal")
-	 */
-	if (node->nd_mid == idAREF && !private_recv_p(node) && node->nd_args &&
-	    nd_type(node->nd_args) == NODE_ARRAY && node->nd_args->nd_alen == 1 &&
-	    nd_type(node->nd_args->nd_head) == NODE_STR &&
-	    iseq->compile_data->current_block == NULL &&
-	    iseq->compile_data->option->specialized_instruction) {
-	    VALUE str = rb_fstring(node->nd_args->nd_head->nd_lit);
-	    node->nd_args->nd_head->nd_lit = str;
-	    COMPILE(ret, "recv", node->nd_recv);
-	    ADD_INSN3(ret, line, opt_aref_with,
-		      new_callinfo(iseq, idAREF, 1, 0, NULL, FALSE),
-		      Qnil, /* CALL_CACHE */
-		      str);
-	    if (poped) {
-		ADD_INSN(ret, line, pop);
-	    }
-	    break;
-	}
-      case NODE_QCALL:
-      case NODE_FCALL:
-      case NODE_VCALL:{		/* VCALL: variable or call */
-	/*
-	  call:  obj.method(...)
-	  fcall: func(...)
-	  vcall: func
-	*/
-	DECL_ANCHOR(recv);
-	DECL_ANCHOR(args);
-	LABEL *lskip = 0;
-	ID mid = node->nd_mid;
-	VALUE argc;
-	unsigned int flag = 0;
-	struct rb_call_info_kw_arg *keywords = NULL;
-	const rb_iseq_t *parent_block = iseq->compile_data->current_block;
-	iseq->compile_data->current_block = NULL;
-
-	INIT_ANCHOR(recv);
-	INIT_ANCHOR(args);
-#if SUPPORT_JOKE
-	if (nd_type(node) == NODE_VCALL) {
-	    ID id_bitblt;
-	    ID id_answer;
-
-	    CONST_ID(id_bitblt, "bitblt");
-	    CONST_ID(id_answer, "the_answer_to_life_the_universe_and_everything");
-
-	    if (mid == id_bitblt) {
-		ADD_INSN(ret, line, bitblt);
-		break;
-	    }
-	    else if (mid == id_answer) {
-		ADD_INSN(ret, line, answer);
-		break;
-	    }
-	}
-	/* only joke */
-	{
-	    ID goto_id;
-	    ID label_id;
-
-	    CONST_ID(goto_id, "__goto__");
-	    CONST_ID(label_id, "__label__");
-
-	    if (nd_type(node) == NODE_FCALL &&
-		(mid == goto_id || mid == label_id)) {
-		LABEL *label;
-		st_data_t data;
-		st_table *labels_table = iseq->compile_data->labels_table;
-		ID label_name;
-
-		if (!labels_table) {
-		    labels_table = st_init_numtable();
-		    iseq->compile_data->labels_table = labels_table;
-		}
-		if (nd_type(node->nd_args->nd_head) == NODE_LIT &&
-		    SYMBOL_P(node->nd_args->nd_head->nd_lit)) {
-
-		    label_name = SYM2ID(node->nd_args->nd_head->nd_lit);
-		    if (!st_lookup(labels_table, (st_data_t)label_name, &data)) {
-			label = NEW_LABEL(line);
-			label->position = line;
-			st_insert(labels_table, (st_data_t)label_name, (st_data_t)label);
-		    }
-		    else {
-			label = (LABEL *)data;
-		    }
-		}
-		else {
-		    COMPILE_ERROR((ERROR_ARGS "invalid goto/label format"));
-		}
-
-
-		if (mid == goto_id) {
-		    ADD_INSNL(ret, line, jump, label);
-		}
-		else {
-		    ADD_LABEL(ret, label);
-		}
-		break;
-	    }
-	}
-#endif
-	/* receiver */
-	if (type == NODE_CALL || type == NODE_QCALL) {
-	    COMPILE(recv, "recv", node->nd_recv);
-	    if (type == NODE_QCALL) {
-		lskip = NEW_LABEL(line);
-		ADD_INSN(recv, line, dup);
-		ADD_INSNL(recv, line, branchnil, lskip);
-	    }
-	}
-	else if (type == NODE_FCALL || type == NODE_VCALL) {
-	    ADD_CALL_RECEIVER(recv, line);
-	}
-
-	/* args */
-	if (nd_type(node) != NODE_VCALL) {
-	    argc = setup_args(iseq, args, node->nd_args, &flag, &keywords);
-	}
-	else {
-	    argc = INT2FIX(0);
-	}
-
-	ADD_SEQ(ret, recv);
-	ADD_SEQ(ret, args);
-
-	debugp_param("call args argc", argc);
-	debugp_param("call method", ID2SYM(mid));
-
-	switch (nd_type(node)) {
-	  case NODE_VCALL:
-	    flag |= VM_CALL_VCALL;
-	    /* VCALL is funcall, so fall through */
-	  case NODE_FCALL:
-	    flag |= VM_CALL_FCALL;
-	}
-
-	ADD_SEND_R(ret, line, mid, argc, parent_block, INT2FIX(flag), keywords);
-
-	if (lskip) {
-	    ADD_LABEL(ret, lskip);
-	}
-	if (poped) {
-	    ADD_INSN(ret, line, pop);
-	}
-	break;
-      }
-      case NODE_SUPER:
-      case NODE_ZSUPER:{
-	DECL_ANCHOR(args);
-	int argc;
-	unsigned int flag = 0;
-	struct rb_call_info_kw_arg *keywords = NULL;
-	const rb_iseq_t *parent_block = iseq->compile_data->current_block;
-
-	INIT_ANCHOR(args);
-	iseq->compile_data->current_block = NULL;
-	if (nd_type(node) == NODE_SUPER) {
-	    VALUE vargc = setup_args(iseq, args, node->nd_args, &flag, &keywords);
-	    argc = FIX2INT(vargc);
-	}
-	else {
-	    /* NODE_ZSUPER */
-	    int i;
-	    const rb_iseq_t *liseq = iseq->body->local_iseq;
-	    int lvar_level = get_lvar_level(iseq);
-
-	    argc = liseq->body->param.lead_num;
-
-	    /* normal arguments */
-	    for (i = 0; i < liseq->body->param.lead_num; i++) {
-		int idx = liseq->body->local_size - i;
-		ADD_INSN2(args, line, getlocal, INT2FIX(idx), INT2FIX(lvar_level));
-	    }
-
-	    if (liseq->body->param.flags.has_opt) {
-		/* optional arguments */
-		int j;
-		for (j = 0; j < liseq->body->param.opt_num; j++) {
-		    int idx = liseq->body->local_size - (i + j);
-		    ADD_INSN2(args, line, getlocal, INT2FIX(idx), INT2FIX(lvar_level));
-		}
-		i += j;
-		argc = i;
-	    }
-	    if (liseq->body->param.flags.has_rest) {
-		/* rest argument */
-		int idx = liseq->body->local_size - liseq->body->param.rest_start;
-		ADD_INSN2(args, line, getlocal, INT2FIX(idx), INT2FIX(lvar_level));
-		argc = liseq->body->param.rest_start + 1;
-		flag |= VM_CALL_ARGS_SPLAT;
-	    }
-	    if (liseq->body->param.flags.has_post) {
-		/* post arguments */
-		int post_len = liseq->body->param.post_num;
-		int post_start = liseq->body->param.post_start;
-
-		if (liseq->body->param.flags.has_rest) {
-		    int j;
-		    for (j=0; j<post_len; j++) {
-			int idx = liseq->body->local_size - (post_start + j);
-			ADD_INSN2(args, line, getlocal, INT2FIX(idx), INT2FIX(lvar_level));
-		    }
-		    ADD_INSN1(args, line, newarray, INT2FIX(j));
-		    ADD_INSN (args, line, concatarray);
-		    /* argc is settled at above */
-		}
-		else {
-		    int j;
-		    for (j=0; j<post_len; j++) {
-			int idx = liseq->body->local_size - (post_start + j);
-			ADD_INSN2(args, line, getlocal, INT2FIX(idx), INT2FIX(lvar_level));
-		    }
-		    argc = post_len + post_start;
-		}
-	    }
-
-	    if (liseq->body->param.flags.has_kw) { /* TODO: support keywords */
-		int local_size = liseq->body->local_size;
-		argc++;
-
-		ADD_INSN1(args, line, putspecialobject, INT2FIX(VM_SPECIAL_OBJECT_VMCORE));
-
-		if (liseq->body->param.flags.has_kwrest) {
-		    ADD_INSN2(args, line, getlocal, INT2FIX(liseq->body->local_size - liseq->body->param.keyword->rest_start), INT2FIX(lvar_level));
-		    ADD_SEND (args, line, rb_intern("dup"), INT2FIX(0));
-		}
-		else {
-		    ADD_INSN1(args, line, newhash, INT2FIX(0));
-		}
-		for (i = 0; i < liseq->body->param.keyword->num; ++i) {
-		    ID id = liseq->body->param.keyword->table[i];
-		    int idx = local_size - get_local_var_idx(liseq, id);
-		    ADD_INSN1(args, line, putobject, ID2SYM(id));
-		    ADD_INSN2(args, line, getlocal, INT2FIX(idx), INT2FIX(lvar_level));
-		}
-		ADD_SEND(args, line, id_core_hash_merge_ptr, INT2FIX(i * 2 + 1));
-		if (liseq->body->param.flags.has_rest) {
-		    ADD_INSN1(args, line, newarray, INT2FIX(1));
-		    ADD_INSN (args, line, concatarray);
-		    --argc;
-		}
-	    }
-	    else if (liseq->body->param.flags.has_kwrest) {
-		ADD_INSN2(args, line, getlocal, INT2FIX(liseq->body->local_size - liseq->body->param.keyword->rest_start), INT2FIX(lvar_level));
-		ADD_SEND (args, line, rb_intern("dup"), INT2FIX(0));
-		if (liseq->body->param.flags.has_rest) {
-		    ADD_INSN1(args, line, newarray, INT2FIX(1));
-		    ADD_INSN (args, line, concatarray);
-		}
-		else {
-		    argc++;
-		}
-	    }
-	}
-
-	/* dummy receiver */
-	ADD_INSN1(ret, line, putobject, nd_type(node) == NODE_ZSUPER ? Qfalse : Qtrue);
-	ADD_SEQ(ret, args);
-	ADD_INSN3(ret, line, invokesuper,
-		  new_callinfo(iseq, 0, argc, flag | VM_CALL_SUPER | VM_CALL_FCALL, keywords, parent_block != NULL),
-		  Qnil, /* CALL_CACHE */
-		  parent_block);
-
-	if (poped) {
-	    ADD_INSN(ret, line, pop);
-	}
-	break;
-      }
-      case NODE_ARRAY:{
-	compile_array_(iseq, ret, node, COMPILE_ARRAY_TYPE_ARRAY, NULL, poped);
-	break;
-      }
-      case NODE_ZARRAY:{
-	if (!poped) {
-	    ADD_INSN1(ret, line, newarray, INT2FIX(0));
-	}
-	break;
-      }
-      case NODE_VALUES:{
-	NODE *n = node;
-	while (n) {
-	    COMPILE(ret, "values item", n->nd_head);
-	    n = n->nd_next;
-	}
-	ADD_INSN1(ret, line, newarray, INT2FIX(node->nd_alen));
-	if (poped) {
-	    ADD_INSN(ret, line, pop);
-	}
-	break;
-      }
-      case NODE_HASH:{
-	DECL_ANCHOR(list);
-	int type = node->nd_head ? nd_type(node->nd_head) : NODE_ZARRAY;
-
-	INIT_ANCHOR(list);
-	switch (type) {
-	  case NODE_ARRAY:
-	    compile_array(iseq, list, node->nd_head, COMPILE_ARRAY_TYPE_HASH);
-	    ADD_SEQ(ret, list);
-	    break;
-
-	  case NODE_ZARRAY:
-	    ADD_INSN1(ret, line, newhash, INT2FIX(0));
-	    break;
-
-	  default:
-	    rb_bug("can't make hash with this node: %s", ruby_node_name(type));
-	}
-
-	if (poped) {
-	    ADD_INSN(ret, line, pop);
-	}
-	break;
-      }
-      case NODE_RETURN:{
-	rb_iseq_t *is = iseq;
-
-	if (is) {
-	    if (is->body->type == ISEQ_TYPE_TOP) {
-		COMPILE_ERROR((ERROR_ARGS "Invalid return"));
-	    }
-	    else {
-		LABEL *splabel = 0;
-
-		if (is->body->type == ISEQ_TYPE_METHOD) {
-		    splabel = NEW_LABEL(0);
-		    ADD_LABEL(ret, splabel);
-		    ADD_ADJUST(ret, line, 0);
-		}
-
-		COMPILE(ret, "return nd_stts (return val)", node->nd_stts);
-
-		if (is->body->type == ISEQ_TYPE_METHOD) {
-		    add_ensure_iseq(ret, iseq, 1);
-		    ADD_TRACE(ret, line, RUBY_EVENT_RETURN);
-		    ADD_INSN(ret, line, leave);
-		    ADD_ADJUST_RESTORE(ret, splabel);
-
-		    if (!poped) {
-			ADD_INSN(ret, line, putnil);
-		    }
-		}
-		else {
-		    ADD_INSN1(ret, line, throw, INT2FIX(TAG_RETURN));
-		    if (poped) {
-			ADD_INSN(ret, line, pop);
-		    }
-		}
-	    }
-	}
-	break;
-      }
-      case NODE_YIELD:{
-	DECL_ANCHOR(args);
-	VALUE argc;
-	unsigned int flag = 0;
-	struct rb_call_info_kw_arg *keywords = NULL;
-
-	INIT_ANCHOR(args);
-	if (iseq->body->type == ISEQ_TYPE_TOP) {
-	    COMPILE_ERROR((ERROR_ARGS "Invalid yield"));
-	}
-
-	if (node->nd_head) {
-	    argc = setup_args(iseq, args, node->nd_head, &flag, &keywords);
-	}
-	else {
-	    argc = INT2FIX(0);
-	}
-
-	ADD_SEQ(ret, args);
-	ADD_INSN1(ret, line, invokeblock, new_callinfo(iseq, 0, FIX2INT(argc), flag, keywords, FALSE));
-
-	if (poped) {
-	    ADD_INSN(ret, line, pop);
-	}
-	break;
-      }
-      case NODE_LVAR:{
-	if (!poped) {
-	    ID id = node->nd_vid;
-	    int idx = iseq->body->local_iseq->body->local_size - get_local_var_idx(iseq, id);
-
-	    debugs("id: %"PRIsVALUE" idx: %d\n", rb_id2str(id), idx);
-	    ADD_INSN2(ret, line, getlocal, INT2FIX(idx), INT2FIX(get_lvar_level(iseq)));
-	}
-	break;
-      }
-      case NODE_DVAR:{
-	int lv, idx, ls;
-	debugi("nd_vid", node->nd_vid);
-	if (!poped) {
-	    idx = get_dyna_var_idx(iseq, node->nd_vid, &lv, &ls);
-	    if (idx < 0) {
-		rb_bug("unknown dvar (%"PRIsVALUE")", rb_id2str(node->nd_vid));
-	    }
-	    ADD_INSN2(ret, line, getlocal, INT2FIX(ls - idx), INT2FIX(lv));
-	}
-	break;
-      }
-      case NODE_GVAR:{
-	ADD_INSN1(ret, line, getglobal,
-		  ((VALUE)node->nd_entry | 1));
-	if (poped) {
-	    ADD_INSN(ret, line, pop);
-	}
-	break;
-      }
-      case NODE_IVAR:{
-	debugi("nd_vid", node->nd_vid);
-	if (!poped) {
-	    ADD_INSN2(ret, line, getinstancevariable,
-		      ID2SYM(node->nd_vid), INT2FIX(iseq->body->is_size++));
-	}
-	break;
-      }
-      case NODE_CONST:{
-	debugi("nd_vid", node->nd_vid);
-
-	if (iseq->compile_data->option->inline_const_cache) {
-	    LABEL *lend = NEW_LABEL(line);
-	    int ic_index = iseq->body->is_size++;
-
-	    ADD_INSN2(ret, line, getinlinecache, lend, INT2FIX(ic_index));
-	    ADD_INSN1(ret, line, getconstant, ID2SYM(node->nd_vid));
-	    ADD_INSN1(ret, line, setinlinecache, INT2FIX(ic_index));
-	    ADD_LABEL(ret, lend);
-	}
-	else {
-	    ADD_INSN(ret, line, putnil);
-	    ADD_INSN1(ret, line, getconstant, ID2SYM(node->nd_vid));
-	}
-
-	if (poped) {
-	    ADD_INSN(ret, line, pop);
-	}
-	break;
-      }
-      case NODE_CVAR:{
-	if (!poped) {
-	    ADD_INSN1(ret, line, getclassvariable,
-		      ID2SYM(node->nd_vid));
-	}
-	break;
-      }
-      case NODE_NTH_REF:{
-        if (!poped) {
-	    if (!node->nd_nth) {
-		ADD_INSN(ret, line, putnil);
-		break;
-	    }
-	    ADD_INSN2(ret, line, getspecial, INT2FIX(1) /* '~'  */,
-		      INT2FIX(node->nd_nth << 1));
-	}
-	break;
-      }
-      case NODE_BACK_REF:{
-	if (!poped) {
-	    ADD_INSN2(ret, line, getspecial, INT2FIX(1) /* '~' */,
-		      INT2FIX(0x01 | (node->nd_nth << 1)));
-	}
-	break;
-      }
-      case NODE_MATCH:
-      case NODE_MATCH2:
-      case NODE_MATCH3:{
-	DECL_ANCHOR(recv);
-	DECL_ANCHOR(val);
-
-	INIT_ANCHOR(recv);
-	INIT_ANCHOR(val);
-	switch (nd_type(node)) {
-	  case NODE_MATCH:
-	    ADD_INSN1(recv, line, putobject, node->nd_lit);
-	    ADD_INSN2(val, line, getspecial, INT2FIX(0),
-		      INT2FIX(0));
-	    break;
-	  case NODE_MATCH2:
-	    COMPILE(recv, "receiver", node->nd_recv);
-	    COMPILE(val, "value", node->nd_value);
-	    break;
-	  case NODE_MATCH3:
-	    COMPILE(recv, "receiver", node->nd_value);
-	    COMPILE(val, "value", node->nd_recv);
-	    break;
-	}
-
-	if (iseq->compile_data->option->specialized_instruction) {
-	    /* TODO: detect by node */
-	    if (recv->last == recv->anchor.next &&
-		INSN_OF(recv->last) == BIN(putobject) &&
-		nd_type(node) == NODE_MATCH2) {
-		ADD_SEQ(ret, val);
-		ADD_INSN1(ret, line, opt_regexpmatch1,
-			  OPERAND_AT(recv->last, 0));
-	    }
-	    else {
-		ADD_SEQ(ret, recv);
-		ADD_SEQ(ret, val);
-		ADD_INSN2(ret, line, opt_regexpmatch2, new_callinfo(iseq, idEqTilde, 1, 0, NULL, FALSE), Qnil);
-	    }
-	}
-	else {
-	    ADD_SEQ(ret, recv);
-	    ADD_SEQ(ret, val);
-	    ADD_SEND(ret, line, idEqTilde, INT2FIX(1));
-	}
-
-	if (poped) {
-	    ADD_INSN(ret, line, pop);
-	}
-	break;
-      }
-      case NODE_LIT:{
-	debugp_param("lit", node->nd_lit);
-	if (!poped) {
-	    ADD_INSN1(ret, line, putobject, node->nd_lit);
-	}
-	break;
-      }
-      case NODE_STR:{
-	debugp_param("nd_lit", node->nd_lit);
-	if (!poped) {
-	    node->nd_lit = rb_fstring(node->nd_lit);
-	    if (!iseq->compile_data->option->frozen_string_literal) {
-		ADD_INSN1(ret, line, putstring, node->nd_lit);
-	    }
-	    else {
-		if (!iseq->compile_data->option->frozen_string_literal_debug) {
-		    ADD_INSN1(ret, line, putobject, node->nd_lit); /* already frozen */
-		}
-		else {
-		    VALUE str = rb_str_dup(node->nd_lit);
-		    rb_ivar_set(str, id_debug_created_path, iseq->body->location.path);
-		    rb_ivar_set(str, id_debug_created_line, INT2FIX(line));
-		    ADD_INSN1(ret, line, putobject, rb_obj_freeze(str));
-		}
-	    }
-	}
-	break;
-      }
-      case NODE_DSTR:{
-	compile_dstr(iseq, ret, node);
-
-	if (poped) {
-	    ADD_INSN(ret, line, pop);
-	}
-	else {
-	    if (iseq->compile_data->option->frozen_string_literal) {
-		ADD_SEND (ret, line, idFreeze, INT2FIX(0));
-	    }
-	}
-	break;
-      }
-      case NODE_XSTR:{
-	node->nd_lit = rb_fstring(node->nd_lit);
-	ADD_CALL_RECEIVER(ret, line);
-	ADD_INSN1(ret, line, putobject, node->nd_lit);
-	ADD_CALL(ret, line, idBackquote, INT2FIX(1));
-
-	if (poped) {
-	    ADD_INSN(ret, line, pop);
-	}
-	break;
-      }
-      case NODE_DXSTR:{
-	ADD_CALL_RECEIVER(ret, line);
-	compile_dstr(iseq, ret, node);
-	ADD_CALL(ret, line, idBackquote, INT2FIX(1));
-
-	if (poped) {
-	    ADD_INSN(ret, line, pop);
-	}
-	break;
-      }
-      case NODE_EVSTR:{
-	COMPILE(ret, "nd_body", node->nd_body);
-
-	if (poped) {
-	    ADD_INSN(ret, line, pop);
-	}
-	else {
-	    ADD_INSN(ret, line, tostring);
-	}
-	break;
-      }
-      case NODE_DREGX:{
-	compile_dregx(iseq, ret, node);
-
-	if (poped) {
-	    ADD_INSN(ret, line, pop);
-	}
-	break;
-      }
-      case NODE_DREGX_ONCE:{
-	int ic_index = iseq->body->is_size++;
-	NODE *dregx_node = NEW_NODE(NODE_DREGX, node->u1.value, node->u2.value, node->u3.value);
-	NODE *block_node = NEW_NODE(NODE_SCOPE, 0, dregx_node, 0);
-	const rb_iseq_t * block_iseq = NEW_CHILD_ISEQ(block_node, make_name_for_block(iseq), ISEQ_TYPE_BLOCK, line);
-
-	ADD_INSN2(ret, line, once, block_iseq, INT2FIX(ic_index));
-
-	if (poped) {
-	    ADD_INSN(ret, line, pop);
-	}
-	break;
-      }
-      case NODE_ARGSCAT:{
-	if (poped) {
-	    COMPILE(ret, "argscat head", node->nd_head);
-	    ADD_INSN1(ret, line, splatarray, Qfalse);
-	    ADD_INSN(ret, line, pop);
-	    COMPILE(ret, "argscat body", node->nd_body);
-	    ADD_INSN1(ret, line, splatarray, Qfalse);
-	    ADD_INSN(ret, line, pop);
-	}
-	else {
-	    COMPILE(ret, "argscat head", node->nd_head);
-	    COMPILE(ret, "argscat body", node->nd_body);
-	    ADD_INSN(ret, line, concatarray);
-	}
-	break;
-      }
-      case NODE_ARGSPUSH:{
-	if (poped) {
-	    COMPILE(ret, "arsgpush head", node->nd_head);
-	    ADD_INSN1(ret, line, splatarray, Qfalse);
-	    ADD_INSN(ret, line, pop);
-	    COMPILE_(ret, "argspush body", node->nd_body, poped);
-	}
-	else {
-	    COMPILE(ret, "arsgpush head", node->nd_head);
-	    COMPILE_(ret, "argspush body", node->nd_body, poped);
-	    ADD_INSN1(ret, line, newarray, INT2FIX(1));
-	    ADD_INSN(ret, line, concatarray);
-	}
-	break;
-      }
-      case NODE_SPLAT:{
-	COMPILE(ret, "splat", node->nd_head);
-	ADD_INSN1(ret, line, splatarray, Qtrue);
-
-	if (poped) {
-	    ADD_INSN(ret, line, pop);
-	}
-	break;
-      }
-      case NODE_DEFN:{
-	const rb_iseq_t *method_iseq = NEW_ISEQ(node->nd_defn,
-						rb_id2str(node->nd_mid),
-						ISEQ_TYPE_METHOD, line);
-
-	debugp_param("defn/iseq", (VALUE)method_iseq);
-
-	ADD_INSN1(ret, line, putspecialobject, INT2FIX(VM_SPECIAL_OBJECT_VMCORE));
-	ADD_INSN1(ret, line, putspecialobject, INT2FIX(VM_SPECIAL_OBJECT_CBASE));
-	ADD_INSN1(ret, line, putobject, ID2SYM(node->nd_mid));
-	ADD_INSN1(ret, line, putiseq, method_iseq);
-	ADD_SEND (ret, line, id_core_define_method, INT2FIX(3));
-
-	if (poped) {
-	    ADD_INSN(ret, line, pop);
-	}
-
-	break;
-      }
-      case NODE_DEFS:{
-	const rb_iseq_t * singleton_method = NEW_ISEQ(node->nd_defn,
-						      rb_id2str(node->nd_mid),
-						      ISEQ_TYPE_METHOD, line);
-
-	debugp_param("defs/iseq", (VALUE)singleton_method);
-
-	ADD_INSN1(ret, line, putspecialobject, INT2FIX(VM_SPECIAL_OBJECT_VMCORE));
-	COMPILE(ret, "defs: recv", node->nd_recv);
-	ADD_INSN1(ret, line, putobject, ID2SYM(node->nd_mid));
-	ADD_INSN1(ret, line, putiseq, singleton_method);
-	ADD_SEND (ret, line, id_core_define_singleton_method, INT2FIX(3));
-
-	if (poped) {
-	    ADD_INSN(ret, line, pop);
-	}
-	break;
-      }
-      case NODE_ALIAS:{
-	ADD_INSN1(ret, line, putspecialobject, INT2FIX(VM_SPECIAL_OBJECT_VMCORE));
-	ADD_INSN1(ret, line, putspecialobject, INT2FIX(VM_SPECIAL_OBJECT_CBASE));
-	COMPILE(ret, "alias arg1", node->u1.node);
-	COMPILE(ret, "alias arg2", node->u2.node);
-	ADD_SEND(ret, line, id_core_set_method_alias, INT2FIX(3));
-
-	if (poped) {
-	    ADD_INSN(ret, line, pop);
-	}
-	break;
-      }
-      case NODE_VALIAS:{
-	ADD_INSN1(ret, line, putspecialobject, INT2FIX(VM_SPECIAL_OBJECT_VMCORE));
-	ADD_INSN1(ret, line, putobject, ID2SYM(node->u1.id));
-	ADD_INSN1(ret, line, putobject, ID2SYM(node->u2.id));
-	ADD_SEND(ret, line, id_core_set_variable_alias, INT2FIX(2));
-
-	if (poped) {
-	    ADD_INSN(ret, line, pop);
-	}
-	break;
-      }
-      case NODE_UNDEF:{
-	ADD_INSN1(ret, line, putspecialobject, INT2FIX(VM_SPECIAL_OBJECT_VMCORE));
-	ADD_INSN1(ret, line, putspecialobject, INT2FIX(VM_SPECIAL_OBJECT_CBASE));
-	COMPILE(ret, "undef arg", node->u2.node);
-	ADD_SEND(ret, line, id_core_undef_method, INT2FIX(2));
-
-	if (poped) {
-	    ADD_INSN(ret, line, pop);
-	}
-	break;
-      }
-      case NODE_CLASS:{
-	const rb_iseq_t *class_iseq = NEW_CHILD_ISEQ(node->nd_body,
-						     rb_sprintf("<class:%"PRIsVALUE">", rb_id2str(node->nd_cpath->nd_mid)),
-						     ISEQ_TYPE_CLASS, line);
-	VALUE noscope = compile_cpath(ret, iseq, node->nd_cpath);
-	int flags = VM_DEFINECLASS_TYPE_CLASS;
-
-	if (!noscope) flags |= VM_DEFINECLASS_FLAG_SCOPED;
-	if (node->nd_super) flags |= VM_DEFINECLASS_FLAG_HAS_SUPERCLASS;
-	COMPILE(ret, "super", node->nd_super);
-	ADD_INSN3(ret, line, defineclass, ID2SYM(node->nd_cpath->nd_mid), class_iseq, INT2FIX(flags));
-
-	if (poped) {
-	    ADD_INSN(ret, line, pop);
-	}
-	break;
-      }
-      case NODE_MODULE:{
-        const rb_iseq_t *module_iseq = NEW_CHILD_ISEQ(node->nd_body,
-						      rb_sprintf("<module:%"PRIsVALUE">", rb_id2str(node->nd_cpath->nd_mid)),
-						      ISEQ_TYPE_CLASS, line);
-	VALUE noscope = compile_cpath(ret, iseq, node->nd_cpath);
-	int flags = VM_DEFINECLASS_TYPE_MODULE;
-
-	if (!noscope) flags |= VM_DEFINECLASS_FLAG_SCOPED;
-	ADD_INSN (ret, line, putnil); /* dummy */
-	ADD_INSN3(ret, line, defineclass, ID2SYM(node->nd_cpath->nd_mid), module_iseq, INT2FIX(flags));
-
-	if (poped) {
-	    ADD_INSN(ret, line, pop);
-	}
-	break;
-      }
-      case NODE_SCLASS:{
-	ID singletonclass;
-	const rb_iseq_t *singleton_class = NEW_ISEQ(node->nd_body, rb_str_new2("singleton class"),
-						    ISEQ_TYPE_CLASS, line);
-
-	COMPILE(ret, "sclass#recv", node->nd_recv);
-	ADD_INSN (ret, line, putnil);
-	CONST_ID(singletonclass, "singletonclass");
-	ADD_INSN3(ret, line, defineclass,
-		  ID2SYM(singletonclass), singleton_class,
-		  INT2FIX(VM_DEFINECLASS_TYPE_SINGLETON_CLASS));
-
-	if (poped) {
-	    ADD_INSN(ret, line, pop);
-	}
-	break;
-      }
-      case NODE_COLON2:{
-	if (rb_is_const_id(node->nd_mid)) {
-	    /* constant */
-	    LABEL *lend = NEW_LABEL(line);
-	    int ic_index = iseq->body->is_size++;
-
-	    DECL_ANCHOR(pref);
-	    DECL_ANCHOR(body);
-
-	    INIT_ANCHOR(pref);
-	    INIT_ANCHOR(body);
-	    compile_colon2(iseq, node, pref, body);
-	    if (LIST_SIZE_ZERO(pref)) {
-		if (iseq->compile_data->option->inline_const_cache) {
-		    ADD_INSN2(ret, line, getinlinecache, lend, INT2FIX(ic_index));
-		}
-		else {
-		    ADD_INSN(ret, line, putnil);
-		}
-
-		ADD_SEQ(ret, body);
-
-		if (iseq->compile_data->option->inline_const_cache) {
-		    ADD_INSN1(ret, line, setinlinecache, INT2FIX(ic_index));
-		    ADD_LABEL(ret, lend);
-		}
-	    }
-	    else {
-		ADD_SEQ(ret, pref);
-		ADD_SEQ(ret, body);
-	    }
-	}
-	else {
-	    /* function call */
-	    ADD_CALL_RECEIVER(ret, line);
-	    COMPILE(ret, "colon2#nd_head", node->nd_head);
-	    ADD_CALL(ret, line, node->nd_mid, INT2FIX(1));
-	}
-	if (poped) {
-	    ADD_INSN(ret, line, pop);
-	}
-	break;
-      }
-      case NODE_COLON3:{
-	LABEL *lend = NEW_LABEL(line);
-	int ic_index = iseq->body->is_size++;
-
-	debugi("colon3#nd_mid", node->nd_mid);
-
-	/* add cache insn */
-	if (iseq->compile_data->option->inline_const_cache) {
-	    ADD_INSN2(ret, line, getinlinecache, lend, INT2FIX(ic_index));
-	    ADD_INSN(ret, line, pop);
-	}
-
-	ADD_INSN1(ret, line, putobject, rb_cObject);
-	ADD_INSN1(ret, line, getconstant, ID2SYM(node->nd_mid));
-
-	if (iseq->compile_data->option->inline_const_cache) {
-	    ADD_INSN1(ret, line, setinlinecache, INT2FIX(ic_index));
-	    ADD_LABEL(ret, lend);
-	}
-
-	if (poped) {
-	    ADD_INSN(ret, line, pop);
-	}
-	break;
-      }
-      case NODE_DOT2:
-      case NODE_DOT3:{
-	VALUE flag = type == NODE_DOT2 ? INT2FIX(0) : INT2FIX(1);
-	COMPILE(ret, "min", (NODE *) node->nd_beg);
-	COMPILE(ret, "max", (NODE *) node->nd_end);
-	if (poped) {
-	    ADD_INSN(ret, line, pop);
-	    ADD_INSN(ret, line, pop);
-	}
-	else {
-	    ADD_INSN1(ret, line, newrange, flag);
-	}
-	break;
-      }
-      case NODE_FLIP2:
-      case NODE_FLIP3:{
-	LABEL *lend = NEW_LABEL(line);
-	LABEL *lfin = NEW_LABEL(line);
-	LABEL *ltrue = NEW_LABEL(line);
-	rb_iseq_t *local_iseq = iseq->body->local_iseq;
-	rb_num_t cnt;
-	VALUE key;
-
-	cnt = local_iseq->variable_body->flip_cnt++ + VM_SVAR_FLIPFLOP_START;
-	key = INT2FIX(cnt);
-
-	ADD_INSN2(ret, line, getspecial, key, INT2FIX(0));
-	ADD_INSNL(ret, line, branchif, lend);
-
-	/* *flip == 0 */
-	COMPILE(ret, "flip2 beg", node->nd_beg);
-	ADD_INSN(ret, line, dup);
-	ADD_INSNL(ret, line, branchunless, lfin);
-	if (nd_type(node) == NODE_FLIP3) {
-	    ADD_INSN(ret, line, dup);
-	    ADD_INSN1(ret, line, setspecial, key);
-	    ADD_INSNL(ret, line, jump, lfin);
-	}
-	else {
-	    ADD_INSN1(ret, line, setspecial, key);
-	}
-
-	/* *flip == 1 */
-	ADD_LABEL(ret, lend);
-	COMPILE(ret, "flip2 end", node->nd_end);
-	ADD_INSNL(ret, line, branchunless, ltrue);
-	ADD_INSN1(ret, line, putobject, Qfalse);
-	ADD_INSN1(ret, line, setspecial, key);
-
-	ADD_LABEL(ret, ltrue);
-	ADD_INSN1(ret, line, putobject, Qtrue);
-
-	ADD_LABEL(ret, lfin);
-	break;
-      }
-      case NODE_SELF:{
-	if (!poped) {
-	    ADD_INSN(ret, line, putself);
-	}
-	break;
-      }
-      case NODE_NIL:{
-	if (!poped) {
-	    ADD_INSN(ret, line, putnil);
-	}
-	break;
-      }
-      case NODE_TRUE:{
-	if (!poped) {
-	    ADD_INSN1(ret, line, putobject, Qtrue);
-	}
-	break;
-      }
-      case NODE_FALSE:{
-	if (!poped) {
-	    ADD_INSN1(ret, line, putobject, Qfalse);
-	}
-	break;
-      }
-      case NODE_ERRINFO:{
-	if (!poped) {
-	    if (iseq->body->type == ISEQ_TYPE_RESCUE) {
-		ADD_INSN2(ret, line, getlocal, INT2FIX(2), INT2FIX(0));
-	    }
-	    else {
-		const rb_iseq_t *ip = iseq;
-		int level = 0;
-		while (ip) {
-		    if (ip->body->type == ISEQ_TYPE_RESCUE) {
-			break;
-		    }
-		    ip = ip->body->parent_iseq;
-		    level++;
-		}
-		if (ip) {
-		    ADD_INSN2(ret, line, getlocal, INT2FIX(2), INT2FIX(level));
-		}
-		else {
-		    ADD_INSN(ret, line, putnil);
-		}
-	    }
-	}
-	break;
-      }
-      case NODE_DEFINED:{
-	if (poped) break;
-	if (!node->nd_head) {
-	    VALUE str = rb_iseq_defined_string(DEFINED_NIL);
-	    ADD_INSN1(ret, nd_line(node), putobject, str);
-	}
-	else {
-	    LABEL *lfinish[2];
-	    lfinish[0] = NEW_LABEL(line);
-	    lfinish[1] = 0;
-	    ADD_INSN(ret, line, putnil);
-	    defined_expr(iseq, ret, node->nd_head, lfinish, Qtrue);
-	    ADD_INSN(ret, line, swap);
-	    ADD_INSN(ret, line, pop);
-	    if (lfinish[1]) {
-		ADD_LABEL(ret, lfinish[1]);
-	    }
-	    ADD_LABEL(ret, lfinish[0]);
-	}
-	break;
-      }
-      case NODE_POSTEXE:{
-	/* compiled to:
-	 *   ONCE{ rb_mRubyVMFrozenCore::core#set_postexe{ ... } }
-	 */
-	int is_index = iseq->body->is_size++;
-	const rb_iseq_t *once_iseq = NEW_CHILD_ISEQ((NODE *)IFUNC_NEW(build_postexe_iseq, node->nd_body, 0),
-						    make_name_for_block(iseq), ISEQ_TYPE_BLOCK, line);
-
-	ADD_INSN2(ret, line, once, once_iseq, INT2FIX(is_index));
-
-	if (poped) {
-	    ADD_INSN(ret, line, pop);
-	}
-	break;
-      }
-      case NODE_KW_ARG:
-	{
-	    LABEL *end_label = NEW_LABEL(nd_line(node));
-	    NODE *default_value = node->nd_body->nd_value;
-
-	    if (default_value == (NODE *)-1) {
-		/* required argument. do nothing */
-		rb_bug("unreachable");
-	    }
-	    else if (nd_type(default_value) == NODE_LIT ||
-		     nd_type(default_value) == NODE_NIL ||
-		     nd_type(default_value) == NODE_TRUE ||
-		     nd_type(default_value) == NODE_FALSE) {
-		rb_bug("unreachable");
-	    }
-	    else {
-		/* if keywordcheck(_kw_bits, nth_keyword)
-		 *   kw = default_value
-		 * end
-		 */
-		int kw_bits_idx = iseq->body->local_size - iseq->body->param.keyword->bits_start;
-		int keyword_idx = iseq->body->param.keyword->num;
-
-		ADD_INSN2(ret, line, checkkeyword, INT2FIX(kw_bits_idx), INT2FIX(keyword_idx));
-		ADD_INSNL(ret, line, branchif, end_label);
-		COMPILE_POPED(ret, "keyword default argument", node->nd_body);
-		ADD_LABEL(ret, end_label);
-	    }
-
-	    break;
-	}
-      case NODE_DSYM:{
-	compile_dstr(iseq, ret, node);
-	if (!poped) {
-	    ADD_SEND(ret, line, idIntern, INT2FIX(0));
-	}
-	else {
-	    ADD_INSN(ret, line, pop);
-	}
-	break;
-      }
-      case NODE_ATTRASGN:{
-	DECL_ANCHOR(recv);
-	DECL_ANCHOR(args);
-	unsigned int flag = 0;
-	ID mid = node->nd_mid;
-	LABEL *lskip = 0;
-	VALUE argc;
-
-	/* optimization shortcut
-	 *   obj["literal"] = value -> opt_aset_with(obj, "literal", value)
-	 */
-	if (mid == idASET && !private_recv_p(node) && node->nd_args &&
-	    nd_type(node->nd_args) == NODE_ARRAY && node->nd_args->nd_alen == 2 &&
-	    nd_type(node->nd_args->nd_head) == NODE_STR &&
-	    iseq->compile_data->current_block == NULL &&
-	    iseq->compile_data->option->specialized_instruction)
-	{
-	    VALUE str = rb_fstring(node->nd_args->nd_head->nd_lit);
-	    node->nd_args->nd_head->nd_lit = str;
-	    iseq_add_mark_object(iseq, str);
-	    COMPILE(ret, "recv", node->nd_recv);
-	    COMPILE(ret, "value", node->nd_args->nd_next->nd_head);
-	    if (!poped) {
-		ADD_INSN(ret, line, swap);
-		ADD_INSN1(ret, line, topn, INT2FIX(1));
-	    }
-	    ADD_INSN3(ret, line, opt_aset_with,
-		      new_callinfo(iseq, idASET, 2, 0, NULL, FALSE),
-		      Qnil/* CALL_CACHE */, str);
-	    ADD_INSN(ret, line, pop);
-	    break;
-	}
-
-	INIT_ANCHOR(recv);
-	INIT_ANCHOR(args);
-	argc = setup_args(iseq, args, node->nd_args, &flag, NULL);
-
-	flag |= COMPILE_RECV(recv, "recv", node);
-
-	debugp_param("argc", argc);
-	debugp_param("nd_mid", ID2SYM(mid));
-
-	if (!rb_is_attrset_id(mid)) {
-	    /* safe nav attr */
-	    mid = rb_id_attrset(mid);
-	    ADD_INSN(recv, line, dup);
-	    lskip = NEW_LABEL(line);
-	    ADD_INSNL(recv, line, branchnil, lskip);
-	}
-	if (!poped) {
-	    ADD_INSN(ret, line, putnil);
-	    ADD_SEQ(ret, recv);
-	    ADD_SEQ(ret, args);
-
-	    if (flag & VM_CALL_ARGS_BLOCKARG) {
-		ADD_INSN1(ret, line, topn, INT2FIX(1));
-		if (flag & VM_CALL_ARGS_SPLAT) {
-		    ADD_INSN1(ret, line, putobject, INT2FIX(-1));
-		    ADD_SEND(ret, line, idAREF, INT2FIX(1));
-		}
-		ADD_INSN1(ret, line, setn, FIXNUM_INC(argc, 3));
-		ADD_INSN (ret, line, pop);
-	    }
-	    else if (flag & VM_CALL_ARGS_SPLAT) {
-		ADD_INSN(ret, line, dup);
-		ADD_INSN1(ret, line, putobject, INT2FIX(-1));
-		ADD_SEND(ret, line, idAREF, INT2FIX(1));
-		ADD_INSN1(ret, line, setn, FIXNUM_INC(argc, 2));
-		ADD_INSN (ret, line, pop);
-	    }
-	    else {
-		ADD_INSN1(ret, line, setn, FIXNUM_INC(argc, 1));
-	    }
-	}
-	else {
-	    ADD_SEQ(ret, recv);
-	    ADD_SEQ(ret, args);
-	}
-	ADD_SEND_WITH_FLAG(ret, line, mid, argc, INT2FIX(flag));
-	if (lskip) ADD_LABEL(ret, lskip);
-	ADD_INSN(ret, line, pop);
-
-	break;
-      }
-      case NODE_PRELUDE:{
-	const rb_compile_option_t *orig_opt = iseq->compile_data->option;
-	if (node->nd_orig) {
-	    rb_compile_option_t new_opt = *orig_opt;
-	    rb_iseq_make_compile_option(&new_opt, node->nd_orig);
-	    iseq->compile_data->option = &new_opt;
-	}
-	COMPILE_POPED(ret, "prelude", node->nd_head);
-	COMPILE_(ret, "body", node->nd_body, poped);
-	iseq->compile_data->option = orig_opt;
-	break;
-      }
-      case NODE_LAMBDA:{
-	/* compile same as lambda{...} */
-	const rb_iseq_t *block = NEW_CHILD_ISEQ(node->nd_body, make_name_for_block(iseq), ISEQ_TYPE_BLOCK, line);
-	VALUE argc = INT2FIX(0);
-
-	ADD_INSN1(ret, line, putspecialobject, INT2FIX(VM_SPECIAL_OBJECT_VMCORE));
-	ADD_CALL_WITH_BLOCK(ret, line, idLambda, argc, block);
-
-	if (poped) {
-	    ADD_INSN(ret, line, pop);
-	}
-	break;
-      }
-      default:
-	rb_bug("iseq_compile_each: unknown node: %s", ruby_node_name(type));
-	return COMPILE_NG;
-    }
-
-    /* check & remove redundant trace(line) */
-    if (saved_last_element && ret /* ret can be 0 when error */ &&
-	ret->last == saved_last_element &&
-	((INSN *)saved_last_element)->insn_id == BIN(trace)) {
-	POP_ELEMENT(ret);
-    }
-
-    debug_node_end();
-    return COMPILE_OK;
-}
-
-/***************************/
-/* instruction information */
-/***************************/
-
-static int
-insn_data_length(INSN *iobj)
-{
-    return insn_len(iobj->insn_id);
-}
-
-static int
-calc_sp_depth(int depth, INSN *insn)
-{
-    return insn_stack_increase(depth, insn->insn_id, insn->operands);
-}
-
-static VALUE
-opobj_inspect(VALUE obj)
-{
-    struct RBasic *r = (struct RBasic *) obj;
-    if (!SPECIAL_CONST_P(r)  && r->klass == 0) {
-	switch (BUILTIN_TYPE(r)) {
-	  case T_STRING:
-	    obj = rb_str_new_cstr(RSTRING_PTR(obj));
-	    break;
-	  case T_ARRAY:
-	    obj = rb_ary_dup(obj);
-	    break;
-	}
-    }
-    return rb_inspect(obj);
-}
-
-
-
-static VALUE
-insn_data_to_s_detail(INSN *iobj)
-{
-    VALUE str = rb_sprintf("%-20s ", insn_name(iobj->insn_id));
-
-    if (iobj->operands) {
-	const char *types = insn_op_types(iobj->insn_id);
-	int j;
-
-	for (j = 0; types[j]; j++) {
-	    char type = types[j];
-
-	    switch (type) {
-	      case TS_OFFSET:	/* label(destination position) */
-		{
-		    LABEL *lobj = (LABEL *)OPERAND_AT(iobj, j);
-		    rb_str_catf(str, "<L%03d>", lobj->label_no);
-		    break;
-		}
-		break;
-	      case TS_ISEQ:	/* iseq */
-		{
-		    rb_iseq_t *iseq = (rb_iseq_t *)OPERAND_AT(iobj, j);
-		    VALUE val = Qnil;
-		    if (0 && iseq) { /* TODO: invalidate now */
-			val = (VALUE)iseq;
-		    }
-		    rb_str_concat(str, opobj_inspect(val));
-		}
-		break;
-	      case TS_LINDEX:
-	      case TS_NUM:	/* ulong */
-	      case TS_VALUE:	/* VALUE */
-		{
-		    VALUE v = OPERAND_AT(iobj, j);
-		    rb_str_concat(str, opobj_inspect(v));
-		    break;
-		}
-	      case TS_ID:	/* ID */
-		rb_str_concat(str, opobj_inspect(OPERAND_AT(iobj, j)));
-		break;
-	      case TS_GENTRY:
-		{
-		    struct rb_global_entry *entry = (struct rb_global_entry *)
-		      (OPERAND_AT(iobj, j) & (~1));
-		    rb_str_append(str, rb_id2str(entry->id));
-		    break;
-		}
-	      case TS_IC:	/* inline cache */
-		rb_str_catf(str, "<ic:%d>", FIX2INT(OPERAND_AT(iobj, j)));
-		break;
-	      case TS_CALLINFO: /* call info */
-		{
-		    struct rb_call_info *ci = (struct rb_call_info *)OPERAND_AT(iobj, j);
-		    rb_str_cat2(str, "<callinfo:");
-		    if (ci->mid) rb_str_catf(str, "%"PRIsVALUE, rb_id2str(ci->mid));
-		    rb_str_catf(str, ", %d>", ci->orig_argc);
-		    break;
-		}
-	      case TS_CALLCACHE: /* call cache */
-		{
-		    rb_str_catf(str, "<call cache>");
-		    break;
-		}
-	      case TS_CDHASH:	/* case/when condition cache */
-		rb_str_cat2(str, "<ch>");
-		break;
-	      case TS_FUNCPTR:
-		{
-		    rb_insn_func_t func = (rb_insn_func_t)OPERAND_AT(iobj, j);
-#ifdef HAVE_DLADDR
-		    Dl_info info;
-		    if (dladdr(func, &info) && info.dli_sname) {
-			rb_str_cat2(str, info.dli_sname);
-			break;
-		    }
-#endif
-		    rb_str_catf(str, "<%p>", func);
-		}
-		break;
-	      default:{
-		rb_raise(rb_eSyntaxError, "unknown operand type: %c", type);
-	      }
-	    }
-	    if (types[j + 1]) {
-		rb_str_cat2(str, ", ");
-	    }
-	}
-    }
-    return str;
-}
-
-static void
-dump_disasm_list(struct iseq_link_element *link)
-{
-    int pos = 0;
-    INSN *iobj;
-    LABEL *lobj;
-    VALUE str;
-
-    printf("-- raw disasm--------\n");
-
-    while (link) {
-	switch (link->type) {
-	  case ISEQ_ELEMENT_INSN:
-	    {
-		iobj = (INSN *)link;
-		str = insn_data_to_s_detail(iobj);
-		printf("%04d %-65s(%4u)\n", pos, StringValueCStr(str), iobj->line_no);
-		pos += insn_data_length(iobj);
-		break;
-	    }
-	  case ISEQ_ELEMENT_LABEL:
-	    {
-		lobj = (LABEL *)link;
-		printf("<L%03d>\n", lobj->label_no);
-		break;
-	    }
-	  case ISEQ_ELEMENT_NONE:
-	    {
-		printf("[none]\n");
-		break;
-	    }
-	  case ISEQ_ELEMENT_ADJUST:
-	    {
-		ADJUST *adjust = (ADJUST *)link;
-		printf("adjust: [label: %d]\n", adjust->label ? adjust->label->label_no : -1);
-		break;
-	    }
-	  default:
-	    /* ignore */
-	    rb_raise(rb_eSyntaxError, "dump_disasm_list error: %ld\n", FIX2LONG(link->type));
-	}
-	link = link->next;
-    }
-    printf("---------------------\n");
-}
-
-const char *
-rb_insns_name(int i)
-{
-    return insn_name_info[i];
-}
-
-VALUE
-rb_insns_name_array(void)
-{
-    VALUE ary = rb_ary_new();
-    int i;
-    for (i = 0; i < numberof(insn_name_info); i++) {
-	rb_ary_push(ary, rb_fstring(rb_str_new2(insn_name_info[i])));
-    }
-    return rb_obj_freeze(ary);
-}
-
-static LABEL *
-register_label(rb_iseq_t *iseq, struct st_table *labels_table, VALUE obj)
-{
-    LABEL *label = 0;
-    st_data_t tmp;
-    obj = rb_convert_type(obj, T_SYMBOL, "Symbol", "to_sym");
-
-    if (st_lookup(labels_table, obj, &tmp) == 0) {
-	label = NEW_LABEL(0);
-	st_insert(labels_table, obj, (st_data_t)label);
-    }
-    else {
-	label = (LABEL *)tmp;
-    }
-    return label;
-}
-
-static VALUE
-get_exception_sym2type(VALUE sym)
-{
-#undef rb_intern
-#define rb_intern(str) rb_intern_const(str)
-    static VALUE symRescue, symEnsure, symRetry;
-    static VALUE symBreak, symRedo, symNext;
-
-    if (symRescue == 0) {
-	symRescue = ID2SYM(rb_intern("rescue"));
-	symEnsure = ID2SYM(rb_intern("ensure"));
-	symRetry  = ID2SYM(rb_intern("retry"));
-	symBreak  = ID2SYM(rb_intern("break"));
-	symRedo   = ID2SYM(rb_intern("redo"));
-	symNext   = ID2SYM(rb_intern("next"));
-    }
-
-    if (sym == symRescue) return CATCH_TYPE_RESCUE;
-    if (sym == symEnsure) return CATCH_TYPE_ENSURE;
-    if (sym == symRetry)  return CATCH_TYPE_RETRY;
-    if (sym == symBreak)  return CATCH_TYPE_BREAK;
-    if (sym == symRedo)   return CATCH_TYPE_REDO;
-    if (sym == symNext)   return CATCH_TYPE_NEXT;
-    rb_raise(rb_eSyntaxError, "invalid exception symbol: %+"PRIsVALUE, sym);
-    return 0;
-}
-
-static int
-iseq_build_from_ary_exception(rb_iseq_t *iseq, struct st_table *labels_table,
-		     VALUE exception)
-{
-    int i;
-
-    for (i=0; i<RARRAY_LEN(exception); i++) {
-	const rb_iseq_t *eiseq;
-	VALUE v, type;
-	const VALUE *ptr;
-	LABEL *lstart, *lend, *lcont;
-	unsigned int sp;
-
-	v = rb_convert_type(RARRAY_AREF(exception, i), T_ARRAY,
-					 "Array", "to_ary");
-	if (RARRAY_LEN(v) != 6) {
-	    rb_raise(rb_eSyntaxError, "wrong exception entry");
-	}
-	ptr  = RARRAY_CONST_PTR(v);
-	type = get_exception_sym2type(ptr[0]);
-	if (ptr[1] == Qnil) {
-	    eiseq = NULL;
-	}
-	else {
-	    eiseq = rb_iseqw_to_iseq(rb_iseq_load(ptr[1], (VALUE)iseq, Qnil));
-	}
-
-	lstart = register_label(iseq, labels_table, ptr[2]);
-	lend   = register_label(iseq, labels_table, ptr[3]);
-	lcont  = register_label(iseq, labels_table, ptr[4]);
-	sp     = NUM2UINT(ptr[5]);
-
-	(void)sp;
-
-	ADD_CATCH_ENTRY(type, lstart, lend, eiseq, lcont);
-
-	RB_GC_GUARD(v);
-    }
-    return COMPILE_OK;
-}
-
-static struct st_table *
-insn_make_insn_table(void)
-{
-    struct st_table *table;
-    int i;
-    table = st_init_numtable();
-
-    for (i=0; i<VM_INSTRUCTION_SIZE; i++) {
-	st_insert(table, ID2SYM(rb_intern(insn_name(i))), i);
-    }
-
-    return table;
-}
-
-static const rb_iseq_t *
-iseq_build_load_iseq(const rb_iseq_t *iseq, VALUE op)
-{
-    VALUE iseqw;
-    const rb_iseq_t *loaded_iseq;
-
-    if (RB_TYPE_P(op, T_ARRAY)) {
-	iseqw = rb_iseq_load(op, (VALUE)iseq, Qnil);
-    }
-    else if (CLASS_OF(op) == rb_cISeq) {
-	iseqw = op;
-    }
-    else {
-	rb_raise(rb_eSyntaxError, "ISEQ is required");
-    }
-
-    loaded_iseq = rb_iseqw_to_iseq(iseqw);
-    iseq_add_mark_object(iseq, (VALUE)loaded_iseq);
-    return loaded_iseq;
-}
-
-static VALUE
-iseq_build_callinfo_from_hash(rb_iseq_t *iseq, VALUE op)
-{
-    ID mid = 0;
-    int orig_argc = 0;
-    unsigned int flag = 0;
-    struct rb_call_info_kw_arg *kw_arg = 0;
-
-    if (!NIL_P(op)) {
-	VALUE vmid = rb_hash_aref(op, ID2SYM(rb_intern("mid")));
-	VALUE vflag = rb_hash_aref(op, ID2SYM(rb_intern("flag")));
-	VALUE vorig_argc = rb_hash_aref(op, ID2SYM(rb_intern("orig_argc")));
-	VALUE vkw_arg = rb_hash_aref(op, ID2SYM(rb_intern("kw_arg")));
-
-	if (!NIL_P(vmid)) mid = SYM2ID(vmid);
-	if (!NIL_P(vflag)) flag = NUM2UINT(vflag);
-	if (!NIL_P(vorig_argc)) orig_argc = FIX2INT(vorig_argc);
-
-	if (!NIL_P(vkw_arg)) {
-	    int i;
-	    int len = RARRAY_LENINT(vkw_arg);
-	    size_t n = rb_call_info_kw_arg_bytes(len);
-
-	    kw_arg = xmalloc(n);
-	    kw_arg->keyword_len = len;
-	    for (i = 0; i < len; i++) {
-		VALUE kw = RARRAY_AREF(vkw_arg, i);
-		SYM2ID(kw);	/* make immortal */
-		kw_arg->keywords[i] = kw;
-	    }
-	}
-    }
-
-    return (VALUE)new_callinfo(iseq, mid, orig_argc, flag, kw_arg, (flag & VM_CALL_ARGS_SIMPLE) == 0);
-}
-
-static int
-iseq_build_from_ary_body(rb_iseq_t *iseq, LINK_ANCHOR *anchor,
-		VALUE body, struct st_table *labels_table)
-{
-    /* TODO: body should be frozen */
-    const VALUE *ptr = RARRAY_CONST_PTR(body);
-    long i, len = RARRAY_LEN(body);
-    int j;
-    int line_no = 0;
-
-    /*
-     * index -> LABEL *label
-     */
-    static struct st_table *insn_table;
-
-    if (insn_table == 0) {
-	insn_table = insn_make_insn_table();
-    }
-
-    for (i=0; i<len; i++) {
-	VALUE obj = ptr[i];
-
-	if (SYMBOL_P(obj)) {
-	    LABEL *label = register_label(iseq, labels_table, obj);
-	    ADD_LABEL(anchor, label);
-	}
-	else if (FIXNUM_P(obj)) {
-	    line_no = NUM2INT(obj);
-	}
-	else if (RB_TYPE_P(obj, T_ARRAY)) {
-	    VALUE *argv = 0;
-	    int argc = RARRAY_LENINT(obj) - 1;
-	    st_data_t insn_id;
-	    VALUE insn;
-
-	    insn = (argc < 0) ? Qnil : RARRAY_AREF(obj, 0);
-	    if (st_lookup(insn_table, (st_data_t)insn, &insn_id) == 0) {
-		/* TODO: exception */
-		rb_compile_error(RSTRING_PTR(iseq->body->location.path), line_no,
-				 "unknown instruction: %+"PRIsVALUE, insn);
-	    }
-
-	    if (argc != insn_len((VALUE)insn_id)-1) {
-		rb_compile_error(RSTRING_PTR(iseq->body->location.path), line_no,
-				 "operand size mismatch");
-	    }
-
-	    if (argc > 0) {
-		argv = compile_data_alloc(iseq, sizeof(VALUE) * argc);
-		for (j=0; j<argc; j++) {
-		    VALUE op = rb_ary_entry(obj, j+1);
-		    switch (insn_op_type((VALUE)insn_id, j)) {
-		      case TS_OFFSET: {
-			LABEL *label = register_label(iseq, labels_table, op);
-			argv[j] = (VALUE)label;
-			break;
-		      }
-		      case TS_LINDEX:
-		      case TS_NUM:
-			(void)NUM2INT(op);
-			argv[j] = op;
-			break;
-		      case TS_VALUE:
-			argv[j] = op;
-			iseq_add_mark_object(iseq, op);
-			break;
-		      case TS_ISEQ:
-			{
-			    if (op != Qnil) {
-				argv[j] = (VALUE)iseq_build_load_iseq(iseq, op);
-			    }
-			    else {
-				argv[j] = 0;
-			    }
-			}
-			break;
-		      case TS_GENTRY:
-			op = rb_convert_type(op, T_SYMBOL, "Symbol", "to_sym");
-			argv[j] = (VALUE)rb_global_entry(SYM2ID(op));
-			break;
-		      case TS_IC:
-			argv[j] = op;
-			if (NUM2UINT(op) >= iseq->body->is_size) {
-			    iseq->body->is_size = NUM2INT(op) + 1;
-			}
-			break;
-		      case TS_CALLINFO:
-			argv[j] = iseq_build_callinfo_from_hash(iseq, op);
-			break;
-		      case TS_CALLCACHE:
-			argv[j] = Qfalse;
-			break;
-		      case TS_ID:
-			argv[j] = rb_convert_type(op, T_SYMBOL,
-						  "Symbol", "to_sym");
-			break;
-		      case TS_CDHASH:
-			{
-			    int i;
-			    VALUE map = rb_hash_new();
-
-			    rb_hash_tbl_raw(map)->type = &cdhash_type;
-			    op = rb_convert_type(op, T_ARRAY, "Array", "to_ary");
-			    op = rb_ary_dup(op);
-			    for (i=0; i<RARRAY_LEN(op); i+=2) {
-				VALUE key = RARRAY_AREF(op, i);
-				VALUE sym = RARRAY_AREF(op, i+1);
-				LABEL *label =
-				  register_label(iseq, labels_table, sym);
-				rb_hash_aset(map, key, (VALUE)label | 1);
-			    }
-			    RB_GC_GUARD(op);
-			    argv[j] = map;
-			    rb_iseq_add_mark_object(iseq, map);
-			}
-			break;
-		      case TS_FUNCPTR:
-			{
-#if SIZEOF_VALUE <= SIZEOF_LONG
-			    long funcptr = NUM2LONG(op);
-#else
-			    LONG_LONG funcptr = NUM2LL(op);
-#endif
-			    argv[j] = (VALUE)funcptr;
-			}
-			break;
-		      default:
-			rb_raise(rb_eSyntaxError, "unknown operand: %c", insn_op_type((VALUE)insn_id, j));
-		    }
-		}
-	    }
-	    ADD_ELEM(anchor,
-		     (LINK_ELEMENT*)new_insn_core(iseq, line_no,
-						  (enum ruby_vminsn_type)insn_id, argc, argv));
-	}
-	else {
-	    rb_raise(rb_eTypeError, "unexpected object for instruction");
-	}
-    }
-    validate_labels(iseq, labels_table);
-    st_free_table(labels_table);
-    iseq_setup(iseq, anchor);
-    return COMPILE_OK;
-}
-
-#define CHECK_ARRAY(v)   rb_convert_type((v), T_ARRAY, "Array", "to_ary")
-#define CHECK_SYMBOL(v)  rb_convert_type((v), T_SYMBOL, "Symbol", "to_sym")
-
-static int
-int_param(int *dst, VALUE param, VALUE sym)
-{
-    VALUE val = rb_hash_aref(param, sym);
-    switch (TYPE(val)) {
-      case T_NIL:
-	return FALSE;
-      case T_FIXNUM:
-	*dst = FIX2INT(val);
-	return TRUE;
-      default:
-	rb_raise(rb_eTypeError, "invalid %+"PRIsVALUE" Fixnum: %+"PRIsVALUE,
-		 sym, val);
-    }
-    return FALSE;
-}
-
-static const struct rb_iseq_param_keyword *
-iseq_build_kw(rb_iseq_t *iseq, VALUE params, VALUE keywords)
-{
-    int i, j;
-    int len = RARRAY_LENINT(keywords);
-    int default_len;
-    VALUE key, sym, default_val;
-    VALUE *dvs;
-    ID *ids;
-    struct rb_iseq_param_keyword *keyword = ZALLOC(struct rb_iseq_param_keyword);
-
-    iseq->body->param.flags.has_kw = TRUE;
-
-    keyword->num = len;
-#define SYM(s) ID2SYM(rb_intern(#s))
-    (void)int_param(&keyword->bits_start, params, SYM(kwbits));
-    i = keyword->bits_start - keyword->num;
-    ids = (VALUE *)&iseq->body->local_table[i];
-#undef SYM
-
-    /* required args */
-    for (i = 0; i < len; i++) {
-	VALUE val = RARRAY_AREF(keywords, i);
-
-	if (!SYMBOL_P(val)) {
-	    goto default_values;
-	}
-	ids[i] = SYM2ID(val);
-	keyword->required_num++;
-    }
-
-  default_values: /* note: we intentionally preserve `i' from previous loop */
-    default_len = len - i;
-    if (default_len == 0) {
-	return keyword;
-    }
-
-    dvs = ALLOC_N(VALUE, default_len);
-
-    for (j = 0; i < len; i++, j++) {
-	key = RARRAY_AREF(keywords, i);
-	CHECK_ARRAY(key);
-
-	switch (RARRAY_LEN(key)) {
-	  case 1:
-	    sym = RARRAY_AREF(key, 0);
-	    default_val = Qundef;
-	    break;
-	  case 2:
-	    sym = RARRAY_AREF(key, 0);
-	    default_val = RARRAY_AREF(key, 1);
-	    break;
-	  default:
-	    rb_raise(rb_eTypeError, "keyword default has unsupported len %+"PRIsVALUE, key);
-	}
-	ids[i] = SYM2ID(sym);
-	dvs[j] = default_val;
-    }
-
-    keyword->table = ids;
-    keyword->default_values = dvs;
-
-    return keyword;
-}
-
-void
-rb_iseq_build_from_ary(rb_iseq_t *iseq, VALUE misc, VALUE locals, VALUE params,
-			 VALUE exception, VALUE body)
-{
-#define SYM(s) ID2SYM(rb_intern(#s))
-    int i, len;
-    ID *tbl;
-    struct st_table *labels_table = st_init_numtable();
-    VALUE arg_opt_labels = rb_hash_aref(params, SYM(opt));
-    VALUE keywords = rb_hash_aref(params, SYM(keyword));
-    VALUE sym_arg_rest = ID2SYM(rb_intern("#arg_rest"));
-    DECL_ANCHOR(anchor);
-    INIT_ANCHOR(anchor);
-
-    len = RARRAY_LENINT(locals);
-    iseq->body->local_table_size = len;
-    iseq->body->local_table = tbl = (ID *)ALLOC_N(ID, iseq->body->local_table_size);
-    iseq->body->local_size = iseq->body->local_table_size + 1;
-
-    for (i = 0; i < len; i++) {
-	VALUE lv = RARRAY_AREF(locals, i);
-
-	if (sym_arg_rest == lv) {
-	    tbl[i] = 0;
-	}
-	else {
-	    tbl[i] = FIXNUM_P(lv) ? (ID)FIX2LONG(lv) : SYM2ID(CHECK_SYMBOL(lv));
-	}
-    }
-
-    /*
-     * we currently ignore misc params,
-     * local_size, stack_size and param.size are all calculated
-     */
-
-#define INT_PARAM(F) int_param(&iseq->body->param.F, params, SYM(F))
-    if (INT_PARAM(lead_num)) {
-	iseq->body->param.flags.has_lead = TRUE;
-    }
-    if (INT_PARAM(post_num)) iseq->body->param.flags.has_post = TRUE;
-    if (INT_PARAM(post_start)) iseq->body->param.flags.has_post = TRUE;
-    if (INT_PARAM(rest_start)) iseq->body->param.flags.has_rest = TRUE;
-    if (INT_PARAM(block_start)) iseq->body->param.flags.has_block = TRUE;
-#undef INT_PARAM
-
-    switch (TYPE(arg_opt_labels)) {
-      case T_ARRAY:
-	len = RARRAY_LENINT(arg_opt_labels);
-	iseq->body->param.flags.has_opt = !!(len - 1 >= 0);
-
-	if (iseq->body->param.flags.has_opt) {
-	    VALUE *opt_table = ALLOC_N(VALUE, len);
-
-	    for (i = 0; i < len; i++) {
-		VALUE ent = RARRAY_AREF(arg_opt_labels, i);
-		LABEL *label = register_label(iseq, labels_table, ent);
-		opt_table[i] = (VALUE)label;
-	    }
-
-	    iseq->body->param.opt_num = len - 1;
-	    iseq->body->param.opt_table = opt_table;
-	}
-      case T_NIL:
-	break;
-      default:
-	rb_raise(rb_eTypeError, ":opt param is not an array: %+"PRIsVALUE,
-		 arg_opt_labels);
-    }
-
-    switch (TYPE(keywords)) {
-      case T_ARRAY:
-	iseq->body->param.keyword = iseq_build_kw(iseq, params, keywords);
-      case T_NIL:
-	break;
-      default:
-	rb_raise(rb_eTypeError, ":keywords param is not an array: %+"PRIsVALUE,
-		 keywords);
-    }
-
-    if (Qtrue == rb_hash_aref(params, SYM(ambiguous_param0))) {
-	iseq->body->param.flags.ambiguous_param0 = TRUE;
-    }
-
-    if (int_param(&i, params, SYM(kwrest))) {
-	struct rb_iseq_param_keyword *keyword = (struct rb_iseq_param_keyword *)iseq->body->param.keyword;
-	if (keyword == NULL) {
-	    iseq->body->param.keyword = keyword = ZALLOC(struct rb_iseq_param_keyword);
-	}
-	keyword->rest_start = i;
-	iseq->body->param.flags.has_kwrest = TRUE;
-    }
-#undef SYM
-    iseq_calc_param_size(iseq);
-
-    /* exception */
-    iseq_build_from_ary_exception(iseq, labels_table, exception);
-
-    /* body */
-    iseq_build_from_ary_body(iseq, anchor, body, labels_table);
-}
-
-/* for parser */
-
-int
-rb_dvar_defined(ID id)
-{
-    rb_thread_t *th = GET_THREAD();
-    const rb_iseq_t *iseq;
-
-    if (th->base_block && (iseq = th->base_block->iseq)) {
-	while (iseq->body->type == ISEQ_TYPE_BLOCK ||
-	       iseq->body->type == ISEQ_TYPE_RESCUE ||
-	       iseq->body->type == ISEQ_TYPE_ENSURE ||
-	       iseq->body->type == ISEQ_TYPE_EVAL ||
-	       iseq->body->type == ISEQ_TYPE_MAIN
-	       ) {
-	    unsigned int i;
-
-	    for (i = 0; i < iseq->body->local_table_size; i++) {
-		if (iseq->body->local_table[i] == id) {
-		    return 1;
-		}
-	    }
-	    iseq = iseq->body->parent_iseq;
-	}
-    }
-    return 0;
-}
-
-int
-rb_local_defined(ID id)
-{
-    rb_thread_t *th = GET_THREAD();
-    const rb_iseq_t *iseq;
-
-    if (th->base_block && th->base_block->iseq) {
-	unsigned int i;
-	iseq = th->base_block->iseq->body->local_iseq;
-
-	for (i=0; i<iseq->body->local_table_size; i++) {
-	    if (iseq->body->local_table[i] == id) {
-		return 1;
-	    }
-	}
-    }
-    return 0;
-}
-
-int
-rb_parse_in_eval(void)
-{
-    return GET_THREAD()->parse_in_eval > 0;
-}
-
-int
-rb_parse_in_main(void)
-{
-    return GET_THREAD()->parse_in_eval < 0;
-}
-
-static int
-caller_location(VALUE *path, VALUE *absolute_path)
-{
-    const rb_thread_t *const th = GET_THREAD();
-    const rb_control_frame_t *const cfp =
-	rb_vm_get_ruby_level_next_cfp(th, th->cfp);
-
-    if (cfp) {
-	int line = rb_vm_get_sourceline(cfp);
-	*path = cfp->iseq->body->location.path;
-	*absolute_path = cfp->iseq->body->location.absolute_path;
-	return line;
-    }
-    else {
-	*path = rb_str_new2("<compiled>");
-	*absolute_path = *path;
-	return 1;
-    }
-}
-
-typedef struct {
-    VALUE arg;
-    rb_insn_func_t func;
-    int line;
-} accessor_args;
-
-static const rb_iseq_t *
-method_for_self(VALUE name, VALUE arg, rb_insn_func_t func,
-		VALUE (*build)(rb_iseq_t *, LINK_ANCHOR *, VALUE))
-{
-    VALUE path, absolute_path;
-    accessor_args acc;
-
-    acc.arg = arg;
-    acc.func = func;
-    acc.line = caller_location(&path, &absolute_path);
-    return rb_iseq_new_with_opt((NODE *)IFUNC_NEW(build, (VALUE)&acc, 0),
-				rb_sym2str(name), path, absolute_path,
-				INT2FIX(acc.line), 0, ISEQ_TYPE_METHOD, 0);
-}
-
-static VALUE
-for_self_aref(rb_iseq_t *iseq, LINK_ANCHOR *ret, VALUE a)
-{
-    const accessor_args *const args = (void *)a;
-    const int line = args->line;
-
-    iseq_set_local_table(iseq, 0);
-    iseq->body->param.lead_num = 0;
-    iseq->body->param.size = 0;
-
-    ADD_INSN1(ret, line, putobject, args->arg);
-    ADD_INSN1(ret, line, opt_call_c_function, (VALUE)args->func);
-    return Qnil;
-}
-
-static VALUE
-for_self_aset(rb_iseq_t *iseq, LINK_ANCHOR *ret, VALUE a)
-{
-    const accessor_args *const args = (void *)a;
-    const int line = args->line;
-    static const ID vars[] = {1, idUScore};
-
-    iseq_set_local_table(iseq, vars);
-    iseq->body->param.lead_num = 1;
-    iseq->body->param.size = 1;
-
-    ADD_INSN2(ret, line, getlocal, INT2FIX(numberof(vars)-0), INT2FIX(0));
-    ADD_INSN1(ret, line, putobject, args->arg);
-    ADD_INSN1(ret, line, opt_call_c_function, (VALUE)args->func);
-    ADD_INSN(ret, line, pop);
-    return Qnil;
-}
-
-/*
- * func (index) -> (value)
- */
-const rb_iseq_t *
-rb_method_for_self_aref(VALUE name, VALUE arg, rb_insn_func_t func)
-{
-    return method_for_self(name, arg, func, for_self_aref);
-}
-
-/*
- * func (index, value) -> (index, value)
- */
-const rb_iseq_t *
-rb_method_for_self_aset(VALUE name, VALUE arg, rb_insn_func_t func)
-{
-    return method_for_self(name, arg, func, for_self_aset);
-}
diff --git a/complex.c b/complex.c
deleted file mode 100644
index ec52beaf0a..0000000000
--- a/complex.c
+++ /dev/null
@@ -1,2280 +0,0 @@
-/*
-  complex.c: Coded by Tadayoshi Funaba 2008-2012
-
-  This implementation is based on Keiju Ishitsuka's Complex library
-  which is written in ruby.
-*/
-
-#include "ruby/config.h"
-#if defined _MSC_VER
-/* Microsoft Visual C does not define M_PI and others by default */
-# define _USE_MATH_DEFINES 1
-#endif
-#include <math.h>
-#include "internal.h"
-
-#define NDEBUG
-#include <assert.h>
-
-#define ZERO INT2FIX(0)
-#define ONE INT2FIX(1)
-#define TWO INT2FIX(2)
-#define RFLOAT_0 DBL2NUM(0)
-#if defined(HAVE_SIGNBIT) && defined(__GNUC__) && defined(__sun) && \
-    !defined(signbit)
-extern int signbit(double);
-#endif
-
-VALUE rb_cComplex;
-
-static VALUE nucomp_abs(VALUE self);
-static VALUE nucomp_arg(VALUE self);
-
-static ID id_abs, id_arg, id_convert,
-    id_denominator, id_eqeq_p, id_expt, id_fdiv,
-    id_negate, id_numerator, id_quo,
-    id_real_p, id_to_f, id_to_i, id_to_r,
-    id_i_real, id_i_imag;
-
-#define f_boolcast(x) ((x) ? Qtrue : Qfalse)
-
-#define binop(n,op) \
-inline static VALUE \
-f_##n(VALUE x, VALUE y)\
-{\
-    return rb_funcall(x, (op), 1, y);\
-}
-
-#define fun1(n) \
-inline static VALUE \
-f_##n(VALUE x)\
-{\
-    return rb_funcall(x, id_##n, 0);\
-}
-
-#define fun2(n) \
-inline static VALUE \
-f_##n(VALUE x, VALUE y)\
-{\
-    return rb_funcall(x, id_##n, 1, y);\
-}
-
-#define math1(n) \
-inline static VALUE \
-m_##n(VALUE x)\
-{\
-    return rb_funcall(rb_mMath, id_##n, 1, x);\
-}
-
-#define math2(n) \
-inline static VALUE \
-m_##n(VALUE x, VALUE y)\
-{\
-    return rb_funcall(rb_mMath, id_##n, 2, x, y);\
-}
-
-#define PRESERVE_SIGNEDZERO
-
-inline static VALUE
-f_add(VALUE x, VALUE y)
-{
-#ifndef PRESERVE_SIGNEDZERO
-    if (FIXNUM_P(y) && FIX2LONG(y) == 0)
-	return x;
-    else if (FIXNUM_P(x) && FIX2LONG(x) == 0)
-	return y;
-#endif
-    return rb_funcall(x, '+', 1, y);
-}
-
-inline static VALUE
-f_div(VALUE x, VALUE y)
-{
-    if (FIXNUM_P(y) && FIX2LONG(y) == 1)
-	return x;
-    return rb_funcall(x, '/', 1, y);
-}
-
-inline static VALUE
-f_gt_p(VALUE x, VALUE y)
-{
-    if (FIXNUM_P(x) && FIXNUM_P(y))
-	return f_boolcast(FIX2LONG(x) > FIX2LONG(y));
-    return rb_funcall(x, '>', 1, y);
-}
-
-inline static VALUE
-f_mul(VALUE x, VALUE y)
-{
-#ifndef PRESERVE_SIGNEDZERO
-    if (FIXNUM_P(y)) {
-	long iy = FIX2LONG(y);
-	if (iy == 0) {
-	    if (FIXNUM_P(x) || RB_TYPE_P(x, T_BIGNUM))
-		return ZERO;
-	}
-	else if (iy == 1)
-	    return x;
-    }
-    else if (FIXNUM_P(x)) {
-	long ix = FIX2LONG(x);
-	if (ix == 0) {
-	    if (FIXNUM_P(y) || RB_TYPE_P(y, T_BIGNUM))
-		return ZERO;
-	}
-	else if (ix == 1)
-	    return y;
-    }
-#endif
-    return rb_funcall(x, '*', 1, y);
-}
-
-inline static VALUE
-f_sub(VALUE x, VALUE y)
-{
-#ifndef PRESERVE_SIGNEDZERO
-    if (FIXNUM_P(y) && FIX2LONG(y) == 0)
-	return x;
-#endif
-    return rb_funcall(x, '-', 1, y);
-}
-
-fun1(abs)
-fun1(arg)
-fun1(denominator)
-fun1(negate)
-fun1(numerator)
-fun1(real_p)
-
-inline static VALUE
-f_to_i(VALUE x)
-{
-    if (RB_TYPE_P(x, T_STRING))
-	return rb_str_to_inum(x, 10, 0);
-    return rb_funcall(x, id_to_i, 0);
-}
-inline static VALUE
-f_to_f(VALUE x)
-{
-    if (RB_TYPE_P(x, T_STRING))
-	return DBL2NUM(rb_str_to_dbl(x, 0));
-    return rb_funcall(x, id_to_f, 0);
-}
-
-fun1(to_r)
-
-inline static VALUE
-f_eqeq_p(VALUE x, VALUE y)
-{
-    if (FIXNUM_P(x) && FIXNUM_P(y))
-	return f_boolcast(FIX2LONG(x) == FIX2LONG(y));
-    return rb_funcall(x, id_eqeq_p, 1, y);
-}
-
-fun2(expt)
-fun2(fdiv)
-fun2(quo)
-
-inline static VALUE
-f_negative_p(VALUE x)
-{
-    if (FIXNUM_P(x))
-	return f_boolcast(FIX2LONG(x) < 0);
-    return rb_funcall(x, '<', 1, ZERO);
-}
-
-#define f_positive_p(x) (!f_negative_p(x))
-
-inline static VALUE
-f_zero_p(VALUE x)
-{
-    if (RB_TYPE_P(x, T_FIXNUM)) {
-	return f_boolcast(FIX2LONG(x) == 0);
-    }
-    else if (RB_TYPE_P(x, T_BIGNUM)) {
-	return Qfalse;
-    }
-    else if (RB_TYPE_P(x, T_RATIONAL)) {
-	VALUE num = RRATIONAL(x)->num;
-
-	return f_boolcast(FIXNUM_P(num) && FIX2LONG(num) == 0);
-    }
-    return rb_funcall(x, id_eqeq_p, 1, ZERO);
-}
-
-#define f_nonzero_p(x) (!f_zero_p(x))
-
-inline static VALUE
-f_one_p(VALUE x)
-{
-    if (RB_TYPE_P(x, T_FIXNUM)) {
-	return f_boolcast(FIX2LONG(x) == 1);
-    }
-    else if (RB_TYPE_P(x, T_BIGNUM)) {
-	return Qfalse;
-    }
-    else if (RB_TYPE_P(x, T_RATIONAL)) {
-	VALUE num = RRATIONAL(x)->num;
-	VALUE den = RRATIONAL(x)->den;
-
-	return f_boolcast(FIXNUM_P(num) && FIX2LONG(num) == 1 &&
-			  FIXNUM_P(den) && FIX2LONG(den) == 1);
-    }
-    return rb_funcall(x, id_eqeq_p, 1, ONE);
-}
-
-inline static VALUE
-f_kind_of_p(VALUE x, VALUE c)
-{
-    return rb_obj_is_kind_of(x, c);
-}
-
-inline static VALUE
-k_numeric_p(VALUE x)
-{
-    return f_kind_of_p(x, rb_cNumeric);
-}
-
-inline static VALUE
-k_fixnum_p(VALUE x)
-{
-    return f_kind_of_p(x, rb_cFixnum);
-}
-
-inline static VALUE
-k_bignum_p(VALUE x)
-{
-    return f_kind_of_p(x, rb_cBignum);
-}
-
-inline static VALUE
-k_float_p(VALUE x)
-{
-    return f_kind_of_p(x, rb_cFloat);
-}
-
-inline static VALUE
-k_rational_p(VALUE x)
-{
-    return f_kind_of_p(x, rb_cRational);
-}
-
-inline static VALUE
-k_complex_p(VALUE x)
-{
-    return f_kind_of_p(x, rb_cComplex);
-}
-
-#define k_exact_p(x) (!k_float_p(x))
-
-#define k_exact_zero_p(x) (k_exact_p(x) && f_zero_p(x))
-
-#define get_dat1(x) \
-    struct RComplex *dat;\
-    dat = ((struct RComplex *)(x))
-
-#define get_dat2(x,y) \
-    struct RComplex *adat, *bdat;\
-    adat = ((struct RComplex *)(x));\
-    bdat = ((struct RComplex *)(y))
-
-inline static VALUE
-nucomp_s_new_internal(VALUE klass, VALUE real, VALUE imag)
-{
-    NEWOBJ_OF(obj, struct RComplex, klass, T_COMPLEX | (RGENGC_WB_PROTECTED_COMPLEX ? FL_WB_PROTECTED : 0));
-
-    RCOMPLEX_SET_REAL(obj, real);
-    RCOMPLEX_SET_IMAG(obj, imag);
-
-    return (VALUE)obj;
-}
-
-static VALUE
-nucomp_s_alloc(VALUE klass)
-{
-    return nucomp_s_new_internal(klass, ZERO, ZERO);
-}
-
-#if 0
-static VALUE
-nucomp_s_new_bang(int argc, VALUE *argv, VALUE klass)
-{
-    VALUE real, imag;
-
-    switch (rb_scan_args(argc, argv, "11", &real, &imag)) {
-      case 1:
-	if (!k_numeric_p(real))
-	    real = f_to_i(real);
-	imag = ZERO;
-	break;
-      default:
-	if (!k_numeric_p(real))
-	    real = f_to_i(real);
-	if (!k_numeric_p(imag))
-	    imag = f_to_i(imag);
-	break;
-    }
-
-    return nucomp_s_new_internal(klass, real, imag);
-}
-#endif
-
-inline static VALUE
-f_complex_new_bang1(VALUE klass, VALUE x)
-{
-    assert(!k_complex_p(x));
-    return nucomp_s_new_internal(klass, x, ZERO);
-}
-
-inline static VALUE
-f_complex_new_bang2(VALUE klass, VALUE x, VALUE y)
-{
-    assert(!k_complex_p(x));
-    assert(!k_complex_p(y));
-    return nucomp_s_new_internal(klass, x, y);
-}
-
-#ifdef CANONICALIZATION_FOR_MATHN
-#define CANON
-#endif
-
-#ifdef CANON
-static int canonicalization = 0;
-
-RUBY_FUNC_EXPORTED void
-nucomp_canonicalization(int f)
-{
-    canonicalization = f;
-}
-#else
-#define canonicalization 0
-#endif
-
-inline static void
-nucomp_real_check(VALUE num)
-{
-    if (!RB_TYPE_P(num, T_FIXNUM) &&
-	!RB_TYPE_P(num, T_BIGNUM) &&
-	!RB_TYPE_P(num, T_FLOAT) &&
-	!RB_TYPE_P(num, T_RATIONAL)) {
-	if (!k_numeric_p(num) || !f_real_p(num))
-	    rb_raise(rb_eTypeError, "not a real");
-    }
-}
-
-inline static VALUE
-nucomp_s_canonicalize_internal(VALUE klass, VALUE real, VALUE imag)
-{
-#ifdef CANON
-#define CL_CANON
-#ifdef CL_CANON
-    if (k_exact_zero_p(imag) && canonicalization)
-	return real;
-#else
-    if (f_zero_p(imag) && canonicalization)
-	return real;
-#endif
-#endif
-    if (f_real_p(real) && f_real_p(imag))
-	return nucomp_s_new_internal(klass, real, imag);
-    else if (f_real_p(real)) {
-	get_dat1(imag);
-
-	return nucomp_s_new_internal(klass,
-				     f_sub(real, dat->imag),
-				     f_add(ZERO, dat->real));
-    }
-    else if (f_real_p(imag)) {
-	get_dat1(real);
-
-	return nucomp_s_new_internal(klass,
-				     dat->real,
-				     f_add(dat->imag, imag));
-    }
-    else {
-	get_dat2(real, imag);
-
-	return nucomp_s_new_internal(klass,
-				     f_sub(adat->real, bdat->imag),
-				     f_add(adat->imag, bdat->real));
-    }
-}
-
-/*
- * call-seq:
- *    Complex.rect(real[, imag])         ->  complex
- *    Complex.rectangular(real[, imag])  ->  complex
- *
- * Returns a complex object which denotes the given rectangular form.
- *
- *    Complex.rectangular(1, 2)  #=> (1+2i)
- */
-static VALUE
-nucomp_s_new(int argc, VALUE *argv, VALUE klass)
-{
-    VALUE real, imag;
-
-    switch (rb_scan_args(argc, argv, "11", &real, &imag)) {
-      case 1:
-	nucomp_real_check(real);
-	imag = ZERO;
-	break;
-      default:
-	nucomp_real_check(real);
-	nucomp_real_check(imag);
-	break;
-    }
-
-    return nucomp_s_canonicalize_internal(klass, real, imag);
-}
-
-inline static VALUE
-f_complex_new2(VALUE klass, VALUE x, VALUE y)
-{
-    assert(!k_complex_p(x));
-    return nucomp_s_canonicalize_internal(klass, x, y);
-}
-
-/*
- * call-seq:
- *    Complex(x[, y])  ->  numeric
- *
- * Returns x+i*y;
- *
- *    Complex(1, 2)    #=> (1+2i)
- *    Complex('1+2i')  #=> (1+2i)
- *    Complex(nil)     #=> TypeError
- *    Complex(1, nil)  #=> TypeError
- *
- * Syntax of string form:
- *
- *   string form = extra spaces , complex , extra spaces ;
- *   complex = real part | [ sign ] , imaginary part
- *           | real part , sign , imaginary part
- *           | rational , "@" , rational ;
- *   real part = rational ;
- *   imaginary part = imaginary unit | unsigned rational , imaginary unit ;
- *   rational = [ sign ] , unsigned rational ;
- *   unsigned rational = numerator | numerator , "/" , denominator ;
- *   numerator = integer part | fractional part | integer part , fractional part ;
- *   denominator = digits ;
- *   integer part = digits ;
- *   fractional part = "." , digits , [ ( "e" | "E" ) , [ sign ] , digits ] ;
- *   imaginary unit = "i" | "I" | "j" | "J" ;
- *   sign = "-" | "+" ;
- *   digits = digit , { digit | "_" , digit };
- *   digit = "0" | "1" | "2" | "3" | "4" | "5" | "6" | "7" | "8" | "9" ;
- *   extra spaces = ? \s* ? ;
- *
- * See String#to_c.
- */
-static VALUE
-nucomp_f_complex(int argc, VALUE *argv, VALUE klass)
-{
-    return rb_funcall2(rb_cComplex, id_convert, argc, argv);
-}
-
-#define imp1(n) \
-inline static VALUE \
-m_##n##_bang(VALUE x)\
-{\
-    return rb_math_##n(x);\
-}
-
-#define imp2(n) \
-inline static VALUE \
-m_##n##_bang(VALUE x, VALUE y)\
-{\
-    return rb_math_##n(x, y);\
-}
-
-imp2(atan2)
-imp1(cos)
-imp1(cosh)
-imp1(exp)
-imp2(hypot)
-
-#define m_hypot(x,y) m_hypot_bang((x),(y))
-
-static VALUE
-m_log_bang(VALUE x)
-{
-    return rb_math_log(1, &x);
-}
-
-imp1(sin)
-imp1(sinh)
-
-static VALUE
-m_cos(VALUE x)
-{
-    if (f_real_p(x))
-	return m_cos_bang(x);
-    {
-	get_dat1(x);
-	return f_complex_new2(rb_cComplex,
-			      f_mul(m_cos_bang(dat->real),
-				    m_cosh_bang(dat->imag)),
-			      f_mul(f_negate(m_sin_bang(dat->real)),
-				    m_sinh_bang(dat->imag)));
-    }
-}
-
-static VALUE
-m_sin(VALUE x)
-{
-    if (f_real_p(x))
-	return m_sin_bang(x);
-    {
-	get_dat1(x);
-	return f_complex_new2(rb_cComplex,
-			      f_mul(m_sin_bang(dat->real),
-				    m_cosh_bang(dat->imag)),
-			      f_mul(m_cos_bang(dat->real),
-				    m_sinh_bang(dat->imag)));
-    }
-}
-
-#if 0
-imp1(sqrt)
-
-static VALUE
-m_sqrt(VALUE x)
-{
-    if (f_real_p(x)) {
-	if (f_positive_p(x))
-	    return m_sqrt_bang(x);
-	return f_complex_new2(rb_cComplex, ZERO, m_sqrt_bang(f_negate(x)));
-    }
-    else {
-	get_dat1(x);
-
-	if (f_negative_p(dat->imag))
-	    return f_conj(m_sqrt(f_conj(x)));
-	else {
-	    VALUE a = f_abs(x);
-	    return f_complex_new2(rb_cComplex,
-				  m_sqrt_bang(f_div(f_add(a, dat->real), TWO)),
-				  m_sqrt_bang(f_div(f_sub(a, dat->real), TWO)));
-	}
-    }
-}
-#endif
-
-static VALUE
-f_complex_polar(VALUE klass, VALUE x, VALUE y)
-{
-    assert(!k_complex_p(x));
-    assert(!k_complex_p(y));
-    if (f_zero_p(x) || f_zero_p(y)) {
-	if (canonicalization) return x;
-	return nucomp_s_new_internal(klass, x, RFLOAT_0);
-    }
-    if (RB_FLOAT_TYPE_P(y)) {
-	const double arg = RFLOAT_VALUE(y);
-	if (arg == M_PI) {
-	    x = f_negate(x);
-	    if (canonicalization) return x;
-	    y = RFLOAT_0;
-	}
-	else if (arg == M_PI_2) {
-	    y = x;
-	    x = RFLOAT_0;
-	}
-	else if (arg == M_PI_2+M_PI) {
-	    y = f_negate(x);
-	    x = RFLOAT_0;
-	}
-	else if (RB_FLOAT_TYPE_P(x)) {
-	    const double abs = RFLOAT_VALUE(x);
-	    const double real = abs * cos(arg), imag = abs * sin(arg);
-	    x = DBL2NUM(real);
-	    if (canonicalization && imag == 0.0) return x;
-	    y = DBL2NUM(imag);
-	}
-	else {
-	    y = f_mul(x, DBL2NUM(sin(arg)));
-	    x = f_mul(x, DBL2NUM(cos(arg)));
-	    if (canonicalization && f_zero_p(y)) return x;
-	}
-	return nucomp_s_new_internal(klass, x, y);
-    }
-    return nucomp_s_canonicalize_internal(klass,
-					  f_mul(x, m_cos(y)),
-					  f_mul(x, m_sin(y)));
-}
-
-/*
- * call-seq:
- *    Complex.polar(abs[, arg])  ->  complex
- *
- * Returns a complex object which denotes the given polar form.
- *
- *    Complex.polar(3, 0)            #=> (3.0+0.0i)
- *    Complex.polar(3, Math::PI/2)   #=> (1.836909530733566e-16+3.0i)
- *    Complex.polar(3, Math::PI)     #=> (-3.0+3.673819061467132e-16i)
- *    Complex.polar(3, -Math::PI/2)  #=> (1.836909530733566e-16-3.0i)
- */
-static VALUE
-nucomp_s_polar(int argc, VALUE *argv, VALUE klass)
-{
-    VALUE abs, arg;
-
-    switch (rb_scan_args(argc, argv, "11", &abs, &arg)) {
-      case 1:
-	nucomp_real_check(abs);
-	if (canonicalization) return abs;
-	return nucomp_s_new_internal(klass, abs, ZERO);
-      default:
-	nucomp_real_check(abs);
-	nucomp_real_check(arg);
-	break;
-    }
-    return f_complex_polar(klass, abs, arg);
-}
-
-/*
- * call-seq:
- *    cmp.real  ->  real
- *
- * Returns the real part.
- *
- *    Complex(7).real      #=> 7
- *    Complex(9, -4).real  #=> 9
- */
-static VALUE
-nucomp_real(VALUE self)
-{
-    get_dat1(self);
-    return dat->real;
-}
-
-/*
- * call-seq:
- *    cmp.imag       ->  real
- *    cmp.imaginary  ->  real
- *
- * Returns the imaginary part.
- *
- *    Complex(7).imaginary      #=> 0
- *    Complex(9, -4).imaginary  #=> -4
- */
-static VALUE
-nucomp_imag(VALUE self)
-{
-    get_dat1(self);
-    return dat->imag;
-}
-
-/*
- * call-seq:
- *    -cmp  ->  complex
- *
- * Returns negation of the value.
- *
- *    -Complex(1, 2)  #=> (-1-2i)
- */
-static VALUE
-nucomp_negate(VALUE self)
-{
-  get_dat1(self);
-  return f_complex_new2(CLASS_OF(self),
-			f_negate(dat->real), f_negate(dat->imag));
-}
-
-inline static VALUE
-f_addsub(VALUE self, VALUE other,
-	 VALUE (*func)(VALUE, VALUE), ID id)
-{
-    if (k_complex_p(other)) {
-	VALUE real, imag;
-
-	get_dat2(self, other);
-
-	real = (*func)(adat->real, bdat->real);
-	imag = (*func)(adat->imag, bdat->imag);
-
-	return f_complex_new2(CLASS_OF(self), real, imag);
-    }
-    if (k_numeric_p(other) && f_real_p(other)) {
-	get_dat1(self);
-
-	return f_complex_new2(CLASS_OF(self),
-			      (*func)(dat->real, other), dat->imag);
-    }
-    return rb_num_coerce_bin(self, other, id);
-}
-
-/*
- * call-seq:
- *    cmp + numeric  ->  complex
- *
- * Performs addition.
- *
- *    Complex(2, 3)  + Complex(2, 3)   #=> (4+6i)
- *    Complex(900)   + Complex(1)      #=> (901+0i)
- *    Complex(-2, 9) + Complex(-9, 2)  #=> (-11+11i)
- *    Complex(9, 8)  + 4               #=> (13+8i)
- *    Complex(20, 9) + 9.8             #=> (29.8+9i)
- */
-VALUE
-rb_nucomp_add(VALUE self, VALUE other)
-{
-    return f_addsub(self, other, f_add, '+');
-}
-#define nucomp_add rb_nucomp_add
-
-/*
- * call-seq:
- *    cmp - numeric  ->  complex
- *
- * Performs subtraction.
- *
- *    Complex(2, 3)  - Complex(2, 3)   #=> (0+0i)
- *    Complex(900)   - Complex(1)      #=> (899+0i)
- *    Complex(-2, 9) - Complex(-9, 2)  #=> (7+7i)
- *    Complex(9, 8)  - 4               #=> (5+8i)
- *    Complex(20, 9) - 9.8             #=> (10.2+9i)
- */
-static VALUE
-nucomp_sub(VALUE self, VALUE other)
-{
-    return f_addsub(self, other, f_sub, '-');
-}
-
-static VALUE
-safe_mul(VALUE a, VALUE b, int az, int bz)
-{
-    double v;
-    if (!az && bz && RB_FLOAT_TYPE_P(a) && (v = RFLOAT_VALUE(a), !isnan(v))) {
-	a = signbit(v) ? DBL2NUM(-1.0) : DBL2NUM(1.0);
-    }
-    if (!bz && az && RB_FLOAT_TYPE_P(b) && (v = RFLOAT_VALUE(b), !isnan(v))) {
-	b = signbit(v) ? DBL2NUM(-1.0) : DBL2NUM(1.0);
-    }
-    return f_mul(a, b);
-}
-
-/*
- * call-seq:
- *    cmp * numeric  ->  complex
- *
- * Performs multiplication.
- *
- *    Complex(2, 3)  * Complex(2, 3)   #=> (-5+12i)
- *    Complex(900)   * Complex(1)      #=> (900+0i)
- *    Complex(-2, 9) * Complex(-9, 2)  #=> (0-85i)
- *    Complex(9, 8)  * 4               #=> (36+32i)
- *    Complex(20, 9) * 9.8             #=> (196.0+88.2i)
- */
-VALUE
-rb_nucomp_mul(VALUE self, VALUE other)
-{
-    if (k_complex_p(other)) {
-	VALUE real, imag;
-	VALUE areal, aimag, breal, bimag;
-	int arzero, aizero, brzero, bizero;
-
-	get_dat2(self, other);
-
-	arzero = !!f_zero_p(areal = adat->real);
-	aizero = !!f_zero_p(aimag = adat->imag);
-	brzero = !!f_zero_p(breal = bdat->real);
-	bizero = !!f_zero_p(bimag = bdat->imag);
-	real = f_sub(safe_mul(areal, breal, arzero, brzero),
-		     safe_mul(aimag, bimag, aizero, bizero));
-	imag = f_add(safe_mul(areal, bimag, arzero, bizero),
-		     safe_mul(aimag, breal, aizero, brzero));
-
-	return f_complex_new2(CLASS_OF(self), real, imag);
-    }
-    if (k_numeric_p(other) && f_real_p(other)) {
-	get_dat1(self);
-
-	return f_complex_new2(CLASS_OF(self),
-			      f_mul(dat->real, other),
-			      f_mul(dat->imag, other));
-    }
-    return rb_num_coerce_bin(self, other, '*');
-}
-#define nucomp_mul rb_nucomp_mul
-
-inline static VALUE
-f_divide(VALUE self, VALUE other,
-	 VALUE (*func)(VALUE, VALUE), ID id)
-{
-    if (k_complex_p(other)) {
-	int flo;
-	get_dat2(self, other);
-
-	flo = (k_float_p(adat->real) || k_float_p(adat->imag) ||
-	       k_float_p(bdat->real) || k_float_p(bdat->imag));
-
-	if (f_gt_p(f_abs(bdat->real), f_abs(bdat->imag))) {
-	    VALUE r, n;
-
-	    r = (*func)(bdat->imag, bdat->real);
-	    n = f_mul(bdat->real, f_add(ONE, f_mul(r, r)));
-	    if (flo)
-		return f_complex_new2(CLASS_OF(self),
-				      (*func)(self, n),
-				      (*func)(f_negate(f_mul(self, r)), n));
-	    return f_complex_new2(CLASS_OF(self),
-				  (*func)(f_add(adat->real,
-						f_mul(adat->imag, r)), n),
-				  (*func)(f_sub(adat->imag,
-						f_mul(adat->real, r)), n));
-	}
-	else {
-	    VALUE r, n;
-
-	    r = (*func)(bdat->real, bdat->imag);
-	    n = f_mul(bdat->imag, f_add(ONE, f_mul(r, r)));
-	    if (flo)
-		return f_complex_new2(CLASS_OF(self),
-				      (*func)(f_mul(self, r), n),
-				      (*func)(f_negate(self), n));
-	    return f_complex_new2(CLASS_OF(self),
-				  (*func)(f_add(f_mul(adat->real, r),
-						adat->imag), n),
-				  (*func)(f_sub(f_mul(adat->imag, r),
-						adat->real), n));
-	}
-    }
-    if (k_numeric_p(other) && f_real_p(other)) {
-	get_dat1(self);
-
-	return f_complex_new2(CLASS_OF(self),
-			      (*func)(dat->real, other),
-			      (*func)(dat->imag, other));
-    }
-    return rb_num_coerce_bin(self, other, id);
-}
-
-#define rb_raise_zerodiv() rb_raise(rb_eZeroDivError, "divided by 0")
-
-/*
- * call-seq:
- *    cmp / numeric     ->  complex
- *    cmp.quo(numeric)  ->  complex
- *
- * Performs division.
- *
- *    Complex(2, 3)  / Complex(2, 3)   #=> ((1/1)+(0/1)*i)
- *    Complex(900)   / Complex(1)      #=> ((900/1)+(0/1)*i)
- *    Complex(-2, 9) / Complex(-9, 2)  #=> ((36/85)-(77/85)*i)
- *    Complex(9, 8)  / 4               #=> ((9/4)+(2/1)*i)
- *    Complex(20, 9) / 9.8             #=> (2.0408163265306123+0.9183673469387754i)
- */
-static VALUE
-nucomp_div(VALUE self, VALUE other)
-{
-    return f_divide(self, other, f_quo, id_quo);
-}
-
-#define nucomp_quo nucomp_div
-
-/*
- * call-seq:
- *    cmp.fdiv(numeric)  ->  complex
- *
- * Performs division as each part is a float, never returns a float.
- *
- *    Complex(11, 22).fdiv(3)  #=> (3.6666666666666665+7.333333333333333i)
- */
-static VALUE
-nucomp_fdiv(VALUE self, VALUE other)
-{
-    return f_divide(self, other, f_fdiv, id_fdiv);
-}
-
-inline static VALUE
-f_reciprocal(VALUE x)
-{
-    return f_quo(ONE, x);
-}
-
-/*
- * call-seq:
- *    cmp ** numeric  ->  complex
- *
- * Performs exponentiation.
- *
- *    Complex('i') ** 2              #=> (-1+0i)
- *    Complex(-8) ** Rational(1, 3)  #=> (1.0000000000000002+1.7320508075688772i)
- */
-static VALUE
-nucomp_expt(VALUE self, VALUE other)
-{
-    if (k_numeric_p(other) && k_exact_zero_p(other))
-	return f_complex_new_bang1(CLASS_OF(self), ONE);
-
-    if (k_rational_p(other) && f_one_p(f_denominator(other)))
-	other = f_numerator(other); /* c14n */
-
-    if (k_complex_p(other)) {
-	get_dat1(other);
-
-	if (k_exact_zero_p(dat->imag))
-	    other = dat->real; /* c14n */
-    }
-
-    if (k_complex_p(other)) {
-	VALUE r, theta, nr, ntheta;
-
-	get_dat1(other);
-
-	r = f_abs(self);
-	theta = f_arg(self);
-
-	nr = m_exp_bang(f_sub(f_mul(dat->real, m_log_bang(r)),
-			      f_mul(dat->imag, theta)));
-	ntheta = f_add(f_mul(theta, dat->real),
-		       f_mul(dat->imag, m_log_bang(r)));
-	return f_complex_polar(CLASS_OF(self), nr, ntheta);
-    }
-    if (k_fixnum_p(other)) {
-	if (f_gt_p(other, ZERO)) {
-	    VALUE x, z;
-	    long n;
-
-	    x = self;
-	    z = x;
-	    n = FIX2LONG(other) - 1;
-
-	    while (n) {
-		long q, r;
-
-		while (1) {
-		    get_dat1(x);
-
-		    q = n / 2;
-		    r = n % 2;
-
-		    if (r)
-			break;
-
-		    x = nucomp_s_new_internal(CLASS_OF(self),
-				       f_sub(f_mul(dat->real, dat->real),
-					     f_mul(dat->imag, dat->imag)),
-				       f_mul(f_mul(TWO, dat->real), dat->imag));
-		    n = q;
-		}
-		z = f_mul(z, x);
-		n--;
-	    }
-	    return z;
-	}
-	return f_expt(f_reciprocal(self), f_negate(other));
-    }
-    if (k_numeric_p(other) && f_real_p(other)) {
-	VALUE r, theta;
-
-	if (k_bignum_p(other))
-	    rb_warn("in a**b, b may be too big");
-
-	r = f_abs(self);
-	theta = f_arg(self);
-
-	return f_complex_polar(CLASS_OF(self), f_expt(r, other),
-			       f_mul(theta, other));
-    }
-    return rb_num_coerce_bin(self, other, id_expt);
-}
-
-/*
- * call-seq:
- *    cmp == object  ->  true or false
- *
- * Returns true if cmp equals object numerically.
- *
- *    Complex(2, 3)  == Complex(2, 3)   #=> true
- *    Complex(5)     == 5               #=> true
- *    Complex(0)     == 0.0             #=> true
- *    Complex('1/3') == 0.33            #=> false
- *    Complex('1/2') == '1/2'           #=> false
- */
-static VALUE
-nucomp_eqeq_p(VALUE self, VALUE other)
-{
-    if (k_complex_p(other)) {
-	get_dat2(self, other);
-
-	return f_boolcast(f_eqeq_p(adat->real, bdat->real) &&
-			  f_eqeq_p(adat->imag, bdat->imag));
-    }
-    if (k_numeric_p(other) && f_real_p(other)) {
-	get_dat1(self);
-
-	return f_boolcast(f_eqeq_p(dat->real, other) && f_zero_p(dat->imag));
-    }
-    return f_eqeq_p(other, self);
-}
-
-/* :nodoc: */
-static VALUE
-nucomp_coerce(VALUE self, VALUE other)
-{
-    if (k_numeric_p(other) && f_real_p(other))
-	return rb_assoc_new(f_complex_new_bang1(CLASS_OF(self), other), self);
-    if (RB_TYPE_P(other, T_COMPLEX))
-	return rb_assoc_new(other, self);
-
-    rb_raise(rb_eTypeError, "%"PRIsVALUE" can't be coerced into %"PRIsVALUE,
-	     rb_obj_class(other), rb_obj_class(self));
-    return Qnil;
-}
-
-/*
- * call-seq:
- *    cmp.abs        ->  real
- *    cmp.magnitude  ->  real
- *
- * Returns the absolute part of its polar form.
- *
- *    Complex(-1).abs         #=> 1
- *    Complex(3.0, -4.0).abs  #=> 5.0
- */
-static VALUE
-nucomp_abs(VALUE self)
-{
-    get_dat1(self);
-
-    if (f_zero_p(dat->real)) {
-	VALUE a = f_abs(dat->imag);
-	if (k_float_p(dat->real) && !k_float_p(dat->imag))
-	    a = f_to_f(a);
-	return a;
-    }
-    if (f_zero_p(dat->imag)) {
-	VALUE a = f_abs(dat->real);
-	if (!k_float_p(dat->real) && k_float_p(dat->imag))
-	    a = f_to_f(a);
-	return a;
-    }
-    return m_hypot(dat->real, dat->imag);
-}
-
-/*
- * call-seq:
- *    cmp.abs2  ->  real
- *
- * Returns square of the absolute value.
- *
- *    Complex(-1).abs2         #=> 1
- *    Complex(3.0, -4.0).abs2  #=> 25.0
- */
-static VALUE
-nucomp_abs2(VALUE self)
-{
-    get_dat1(self);
-    return f_add(f_mul(dat->real, dat->real),
-		 f_mul(dat->imag, dat->imag));
-}
-
-/*
- * call-seq:
- *    cmp.arg    ->  float
- *    cmp.angle  ->  float
- *    cmp.phase  ->  float
- *
- * Returns the angle part of its polar form.
- *
- *    Complex.polar(3, Math::PI/2).arg  #=> 1.5707963267948966
- */
-static VALUE
-nucomp_arg(VALUE self)
-{
-    get_dat1(self);
-    return m_atan2_bang(dat->imag, dat->real);
-}
-
-/*
- * call-seq:
- *    cmp.rect         ->  array
- *    cmp.rectangular  ->  array
- *
- * Returns an array; [cmp.real, cmp.imag].
- *
- *    Complex(1, 2).rectangular  #=> [1, 2]
- */
-static VALUE
-nucomp_rect(VALUE self)
-{
-    get_dat1(self);
-    return rb_assoc_new(dat->real, dat->imag);
-}
-
-/*
- * call-seq:
- *    cmp.polar  ->  array
- *
- * Returns an array; [cmp.abs, cmp.arg].
- *
- *    Complex(1, 2).polar  #=> [2.23606797749979, 1.1071487177940904]
- */
-static VALUE
-nucomp_polar(VALUE self)
-{
-    return rb_assoc_new(f_abs(self), f_arg(self));
-}
-
-/*
- * call-seq:
- *    cmp.conj       ->  complex
- *    cmp.conjugate  ->  complex
- *
- * Returns the complex conjugate.
- *
- *    Complex(1, 2).conjugate  #=> (1-2i)
- */
-static VALUE
-nucomp_conj(VALUE self)
-{
-    get_dat1(self);
-    return f_complex_new2(CLASS_OF(self), dat->real, f_negate(dat->imag));
-}
-
-#if 0
-/* :nodoc: */
-static VALUE
-nucomp_true(VALUE self)
-{
-    return Qtrue;
-}
-#endif
-
-/*
- * call-seq:
- *    cmp.real?  ->  false
- *
- * Returns false.
- */
-static VALUE
-nucomp_false(VALUE self)
-{
-    return Qfalse;
-}
-
-#if 0
-/* :nodoc: */
-static VALUE
-nucomp_exact_p(VALUE self)
-{
-    get_dat1(self);
-    return f_boolcast(k_exact_p(dat->real) && k_exact_p(dat->imag));
-}
-
-/* :nodoc: */
-static VALUE
-nucomp_inexact_p(VALUE self)
-{
-    return f_boolcast(!nucomp_exact_p(self));
-}
-#endif
-
-/*
- * call-seq:
- *    cmp.denominator  ->  integer
- *
- * Returns the denominator (lcm of both denominator - real and imag).
- *
- * See numerator.
- */
-static VALUE
-nucomp_denominator(VALUE self)
-{
-    get_dat1(self);
-    return rb_lcm(f_denominator(dat->real), f_denominator(dat->imag));
-}
-
-/*
- * call-seq:
- *    cmp.numerator  ->  numeric
- *
- * Returns the numerator.
- *
- *        1   2       3+4i  <-  numerator
- *        - + -i  ->  ----
- *        2   3        6    <-  denominator
- *
- *    c = Complex('1/2+2/3i')  #=> ((1/2)+(2/3)*i)
- *    n = c.numerator          #=> (3+4i)
- *    d = c.denominator        #=> 6
- *    n / d                    #=> ((1/2)+(2/3)*i)
- *    Complex(Rational(n.real, d), Rational(n.imag, d))
- *                             #=> ((1/2)+(2/3)*i)
- * See denominator.
- */
-static VALUE
-nucomp_numerator(VALUE self)
-{
-    VALUE cd;
-
-    get_dat1(self);
-
-    cd = f_denominator(self);
-    return f_complex_new2(CLASS_OF(self),
-			  f_mul(f_numerator(dat->real),
-				f_div(cd, f_denominator(dat->real))),
-			  f_mul(f_numerator(dat->imag),
-				f_div(cd, f_denominator(dat->imag))));
-}
-
-/* :nodoc: */
-static VALUE
-nucomp_hash(VALUE self)
-{
-    st_index_t v, h[2];
-    VALUE n;
-
-    get_dat1(self);
-    n = rb_hash(dat->real);
-    h[0] = NUM2LONG(n);
-    n = rb_hash(dat->imag);
-    h[1] = NUM2LONG(n);
-    v = rb_memhash(h, sizeof(h));
-    return LONG2FIX(v);
-}
-
-/* :nodoc: */
-static VALUE
-nucomp_eql_p(VALUE self, VALUE other)
-{
-    if (k_complex_p(other)) {
-	get_dat2(self, other);
-
-	return f_boolcast((CLASS_OF(adat->real) == CLASS_OF(bdat->real)) &&
-			  (CLASS_OF(adat->imag) == CLASS_OF(bdat->imag)) &&
-			  f_eqeq_p(self, other));
-
-    }
-    return Qfalse;
-}
-
-inline static VALUE
-f_signbit(VALUE x)
-{
-    if (RB_TYPE_P(x, T_FLOAT)) {
-	double f = RFLOAT_VALUE(x);
-	return f_boolcast(!isnan(f) && signbit(f));
-    }
-    return f_negative_p(x);
-}
-
-inline static VALUE
-f_tpositive_p(VALUE x)
-{
-    return f_boolcast(!f_signbit(x));
-}
-
-static VALUE
-f_format(VALUE self, VALUE (*func)(VALUE))
-{
-    VALUE s, impos;
-
-    get_dat1(self);
-
-    impos = f_tpositive_p(dat->imag);
-
-    s = (*func)(dat->real);
-    rb_str_cat2(s, !impos ? "-" : "+");
-
-    rb_str_concat(s, (*func)(f_abs(dat->imag)));
-    if (!rb_isdigit(RSTRING_PTR(s)[RSTRING_LEN(s) - 1]))
-	rb_str_cat2(s, "*");
-    rb_str_cat2(s, "i");
-
-    return s;
-}
-
-/*
- * call-seq:
- *    cmp.to_s  ->  string
- *
- * Returns the value as a string.
- *
- *    Complex(2).to_s                       #=> "2+0i"
- *    Complex('-8/6').to_s                  #=> "-4/3+0i"
- *    Complex('1/2i').to_s                  #=> "0+1/2i"
- *    Complex(0, Float::INFINITY).to_s      #=> "0+Infinity*i"
- *    Complex(Float::NAN, Float::NAN).to_s  #=> "NaN+NaN*i"
- */
-static VALUE
-nucomp_to_s(VALUE self)
-{
-    return f_format(self, rb_String);
-}
-
-/*
- * call-seq:
- *    cmp.inspect  ->  string
- *
- * Returns the value as a string for inspection.
- *
- *    Complex(2).inspect                       #=> "(2+0i)"
- *    Complex('-8/6').inspect                  #=> "((-4/3)+0i)"
- *    Complex('1/2i').inspect                  #=> "(0+(1/2)*i)"
- *    Complex(0, Float::INFINITY).inspect      #=> "(0+Infinity*i)"
- *    Complex(Float::NAN, Float::NAN).inspect  #=> "(NaN+NaN*i)"
- */
-static VALUE
-nucomp_inspect(VALUE self)
-{
-    VALUE s;
-
-    s = rb_usascii_str_new2("(");
-    rb_str_concat(s, f_format(self, rb_inspect));
-    rb_str_cat2(s, ")");
-
-    return s;
-}
-
-/* :nodoc: */
-static VALUE
-nucomp_dumper(VALUE self)
-{
-    return self;
-}
-
-/* :nodoc: */
-static VALUE
-nucomp_loader(VALUE self, VALUE a)
-{
-    get_dat1(self);
-
-    RCOMPLEX_SET_REAL(dat, rb_ivar_get(a, id_i_real));
-    RCOMPLEX_SET_IMAG(dat, rb_ivar_get(a, id_i_imag));
-
-    return self;
-}
-
-/* :nodoc: */
-static VALUE
-nucomp_marshal_dump(VALUE self)
-{
-    VALUE a;
-    get_dat1(self);
-
-    a = rb_assoc_new(dat->real, dat->imag);
-    rb_copy_generic_ivar(a, self);
-    return a;
-}
-
-/* :nodoc: */
-static VALUE
-nucomp_marshal_load(VALUE self, VALUE a)
-{
-    Check_Type(a, T_ARRAY);
-    if (RARRAY_LEN(a) != 2)
-	rb_raise(rb_eArgError, "marshaled complex must have an array whose length is 2 but %ld", RARRAY_LEN(a));
-    rb_ivar_set(self, id_i_real, RARRAY_AREF(a, 0));
-    rb_ivar_set(self, id_i_imag, RARRAY_AREF(a, 1));
-    return self;
-}
-
-/* --- */
-
-VALUE
-rb_complex_raw(VALUE x, VALUE y)
-{
-    return nucomp_s_new_internal(rb_cComplex, x, y);
-}
-
-VALUE
-rb_complex_new(VALUE x, VALUE y)
-{
-    return nucomp_s_canonicalize_internal(rb_cComplex, x, y);
-}
-
-VALUE
-rb_complex_polar(VALUE x, VALUE y)
-{
-    return f_complex_polar(rb_cComplex, x, y);
-}
-
-static VALUE nucomp_s_convert(int argc, VALUE *argv, VALUE klass);
-
-VALUE
-rb_Complex(VALUE x, VALUE y)
-{
-    VALUE a[2];
-    a[0] = x;
-    a[1] = y;
-    return nucomp_s_convert(2, a, rb_cComplex);
-}
-
-VALUE
-rb_complex_set_real(VALUE cmp, VALUE r)
-{
-    RCOMPLEX_SET_REAL(cmp, r);
-    return cmp;
-}
-
-VALUE
-rb_complex_set_imag(VALUE cmp, VALUE i)
-{
-    RCOMPLEX_SET_REAL(cmp, i);
-    return cmp;
-}
-
-/*
- * call-seq:
- *    cmp.to_i  ->  integer
- *
- * Returns the value as an integer if possible (the imaginary part
- * should be exactly zero).
- *
- *    Complex(1, 0).to_i    #=> 1
- *    Complex(1, 0.0).to_i  # RangeError
- *    Complex(1, 2).to_i    # RangeError
- */
-static VALUE
-nucomp_to_i(VALUE self)
-{
-    get_dat1(self);
-
-    if (!k_exact_zero_p(dat->imag)) {
-	rb_raise(rb_eRangeError, "can't convert %"PRIsVALUE" into Integer",
-		 self);
-    }
-    return f_to_i(dat->real);
-}
-
-/*
- * call-seq:
- *    cmp.to_f  ->  float
- *
- * Returns the value as a float if possible (the imaginary part should
- * be exactly zero).
- *
- *    Complex(1, 0).to_f    #=> 1.0
- *    Complex(1, 0.0).to_f  # RangeError
- *    Complex(1, 2).to_f    # RangeError
- */
-static VALUE
-nucomp_to_f(VALUE self)
-{
-    get_dat1(self);
-
-    if (!k_exact_zero_p(dat->imag)) {
-	rb_raise(rb_eRangeError, "can't convert %"PRIsVALUE" into Float",
-		 self);
-    }
-    return f_to_f(dat->real);
-}
-
-/*
- * call-seq:
- *    cmp.to_r  ->  rational
- *
- * Returns the value as a rational if possible (the imaginary part
- * should be exactly zero).
- *
- *    Complex(1, 0).to_r    #=> (1/1)
- *    Complex(1, 0.0).to_r  # RangeError
- *    Complex(1, 2).to_r    # RangeError
- *
- * See rationalize.
- */
-static VALUE
-nucomp_to_r(VALUE self)
-{
-    get_dat1(self);
-
-    if (!k_exact_zero_p(dat->imag)) {
-	rb_raise(rb_eRangeError, "can't convert %"PRIsVALUE" into Rational",
-		 self);
-    }
-    return f_to_r(dat->real);
-}
-
-/*
- * call-seq:
- *    cmp.rationalize([eps])  ->  rational
- *
- * Returns the value as a rational if possible (the imaginary part
- * should be exactly zero).
- *
- *    Complex(1.0/3, 0).rationalize  #=> (1/3)
- *    Complex(1, 0.0).rationalize    # RangeError
- *    Complex(1, 2).rationalize      # RangeError
- *
- * See to_r.
- */
-static VALUE
-nucomp_rationalize(int argc, VALUE *argv, VALUE self)
-{
-    get_dat1(self);
-
-    rb_scan_args(argc, argv, "01", NULL);
-
-    if (!k_exact_zero_p(dat->imag)) {
-       rb_raise(rb_eRangeError, "can't convert %"PRIsVALUE" into Rational",
-                self);
-    }
-    return rb_funcall2(dat->real, rb_intern("rationalize"), argc, argv);
-}
-
-/*
- * call-seq:
- *    complex.to_c  ->  self
- *
- * Returns self.
- *
- *    Complex(2).to_c      #=> (2+0i)
- *    Complex(-8, 6).to_c  #=> (-8+6i)
- */
-static VALUE
-nucomp_to_c(VALUE self)
-{
-    return self;
-}
-
-/*
- * call-seq:
- *    nil.to_c  ->  (0+0i)
- *
- * Returns zero as a complex.
- */
-static VALUE
-nilclass_to_c(VALUE self)
-{
-    return rb_complex_new1(INT2FIX(0));
-}
-
-/*
- * call-seq:
- *    num.to_c  ->  complex
- *
- * Returns the value as a complex.
- */
-static VALUE
-numeric_to_c(VALUE self)
-{
-    return rb_complex_new1(self);
-}
-
-#include <ctype.h>
-
-inline static int
-issign(int c)
-{
-    return (c == '-' || c == '+');
-}
-
-static int
-read_sign(const char **s,
-	  char **b)
-{
-    int sign = '?';
-
-    if (issign(**s)) {
-	sign = **b = **s;
-	(*s)++;
-	(*b)++;
-    }
-    return sign;
-}
-
-inline static int
-isdecimal(int c)
-{
-    return isdigit((unsigned char)c);
-}
-
-static int
-read_digits(const char **s, int strict,
-	    char **b)
-{
-    int us = 1;
-
-    if (!isdecimal(**s))
-	return 0;
-
-    while (isdecimal(**s) || **s == '_') {
-	if (**s == '_') {
-	    if (strict) {
-		if (us)
-		    return 0;
-	    }
-	    us = 1;
-	}
-	else {
-	    **b = **s;
-	    (*b)++;
-	    us = 0;
-	}
-	(*s)++;
-    }
-    if (us)
-	do {
-	    (*s)--;
-	} while (**s == '_');
-    return 1;
-}
-
-inline static int
-islettere(int c)
-{
-    return (c == 'e' || c == 'E');
-}
-
-static int
-read_num(const char **s, int strict,
-	 char **b)
-{
-    if (**s != '.') {
-	if (!read_digits(s, strict, b))
-	    return 0;
-    }
-
-    if (**s == '.') {
-	**b = **s;
-	(*s)++;
-	(*b)++;
-	if (!read_digits(s, strict, b)) {
-	    (*b)--;
-	    return 0;
-	}
-    }
-
-    if (islettere(**s)) {
-	**b = **s;
-	(*s)++;
-	(*b)++;
-	read_sign(s, b);
-	if (!read_digits(s, strict, b)) {
-	    (*b)--;
-	    return 0;
-	}
-    }
-    return 1;
-}
-
-inline static int
-read_den(const char **s, int strict,
-	 char **b)
-{
-    if (!read_digits(s, strict, b))
-	return 0;
-    return 1;
-}
-
-static int
-read_rat_nos(const char **s, int strict,
-	     char **b)
-{
-    if (!read_num(s, strict, b))
-	return 0;
-    if (**s == '/') {
-	**b = **s;
-	(*s)++;
-	(*b)++;
-	if (!read_den(s, strict, b)) {
-	    (*b)--;
-	    return 0;
-	}
-    }
-    return 1;
-}
-
-static int
-read_rat(const char **s, int strict,
-	 char **b)
-{
-    read_sign(s, b);
-    if (!read_rat_nos(s, strict, b))
-	return 0;
-    return 1;
-}
-
-inline static int
-isimagunit(int c)
-{
-    return (c == 'i' || c == 'I' ||
-	    c == 'j' || c == 'J');
-}
-
-static VALUE
-str2num(char *s)
-{
-    if (strchr(s, '/'))
-	return rb_cstr_to_rat(s, 0);
-    if (strpbrk(s, ".eE"))
-	return DBL2NUM(rb_cstr_to_dbl(s, 0));
-    return rb_cstr_to_inum(s, 10, 0);
-}
-
-static int
-read_comp(const char **s, int strict,
-	  VALUE *ret, char **b)
-{
-    char *bb;
-    int sign;
-    VALUE num, num2;
-
-    bb = *b;
-
-    sign = read_sign(s, b);
-
-    if (isimagunit(**s)) {
-	(*s)++;
-	num = INT2FIX((sign == '-') ? -1 : + 1);
-	*ret = rb_complex_new2(ZERO, num);
-	return 1; /* e.g. "i" */
-    }
-
-    if (!read_rat_nos(s, strict, b)) {
-	**b = '\0';
-	num = str2num(bb);
-	*ret = rb_complex_new2(num, ZERO);
-	return 0; /* e.g. "-" */
-    }
-    **b = '\0';
-    num = str2num(bb);
-
-    if (isimagunit(**s)) {
-	(*s)++;
-	*ret = rb_complex_new2(ZERO, num);
-	return 1; /* e.g. "3i" */
-    }
-
-    if (**s == '@') {
-	int st;
-
-	(*s)++;
-	bb = *b;
-	st = read_rat(s, strict, b);
-	**b = '\0';
-	if (strlen(bb) < 1 ||
-	    !isdecimal(*(bb + strlen(bb) - 1))) {
-	    *ret = rb_complex_new2(num, ZERO);
-	    return 0; /* e.g. "1@-" */
-	}
-	num2 = str2num(bb);
-	*ret = rb_complex_polar(num, num2);
-	if (!st)
-	    return 0; /* e.g. "1@2." */
-	else
-	    return 1; /* e.g. "1@2" */
-    }
-
-    if (issign(**s)) {
-	bb = *b;
-	sign = read_sign(s, b);
-	if (isimagunit(**s))
-	    num2 = INT2FIX((sign == '-') ? -1 : + 1);
-	else {
-	    if (!read_rat_nos(s, strict, b)) {
-		*ret = rb_complex_new2(num, ZERO);
-		return 0; /* e.g. "1+xi" */
-	    }
-	    **b = '\0';
-	    num2 = str2num(bb);
-	}
-	if (!isimagunit(**s)) {
-	    *ret = rb_complex_new2(num, ZERO);
-	    return 0; /* e.g. "1+3x" */
-	}
-	(*s)++;
-	*ret = rb_complex_new2(num, num2);
-	return 1; /* e.g. "1+2i" */
-    }
-    /* !(@, - or +) */
-    {
-	*ret = rb_complex_new2(num, ZERO);
-	return 1; /* e.g. "3" */
-    }
-}
-
-inline static void
-skip_ws(const char **s)
-{
-    while (isspace((unsigned char)**s))
-	(*s)++;
-}
-
-static int
-parse_comp(const char *s, int strict,
-	   VALUE *num)
-{
-    char *buf, *b;
-    VALUE tmp;
-    int ret = 1;
-
-    buf = ALLOCV_N(char, tmp, strlen(s) + 1);
-    b = buf;
-
-    skip_ws(&s);
-    if (!read_comp(&s, strict, num, &b)) {
-	ret = 0;
-    }
-    else {
-	skip_ws(&s);
-
-	if (strict)
-	    if (*s != '\0')
-		ret = 0;
-    }
-    ALLOCV_END(tmp);
-
-    return ret;
-}
-
-static VALUE
-string_to_c_strict(VALUE self)
-{
-    char *s;
-    VALUE num;
-
-    rb_must_asciicompat(self);
-
-    s = RSTRING_PTR(self);
-
-    if (!s || memchr(s, '\0', RSTRING_LEN(self)))
-	rb_raise(rb_eArgError, "string contains null byte");
-
-    if (s && s[RSTRING_LEN(self)]) {
-	rb_str_modify(self);
-	s = RSTRING_PTR(self);
-	s[RSTRING_LEN(self)] = '\0';
-    }
-
-    if (!s)
-	s = (char *)"";
-
-    if (!parse_comp(s, 1, &num)) {
-	rb_raise(rb_eArgError, "invalid value for convert(): %+"PRIsVALUE,
-		 self);
-    }
-
-    return num;
-}
-
-/*
- * call-seq:
- *    str.to_c  ->  complex
- *
- * Returns a complex which denotes the string form.  The parser
- * ignores leading whitespaces and trailing garbage.  Any digit
- * sequences can be separated by an underscore.  Returns zero for null
- * or garbage string.
- *
- *    '9'.to_c           #=> (9+0i)
- *    '2.5'.to_c         #=> (2.5+0i)
- *    '2.5/1'.to_c       #=> ((5/2)+0i)
- *    '-3/2'.to_c        #=> ((-3/2)+0i)
- *    '-i'.to_c          #=> (0-1i)
- *    '45i'.to_c         #=> (0+45i)
- *    '3-4i'.to_c        #=> (3-4i)
- *    '-4e2-4e-2i'.to_c  #=> (-400.0-0.04i)
- *    '-0.0-0.0i'.to_c   #=> (-0.0-0.0i)
- *    '1/2+3/4i'.to_c    #=> ((1/2)+(3/4)*i)
- *    'ruby'.to_c        #=> (0+0i)
- *
- * See Kernel.Complex.
- */
-static VALUE
-string_to_c(VALUE self)
-{
-    char *s;
-    VALUE num;
-
-    rb_must_asciicompat(self);
-
-    s = RSTRING_PTR(self);
-
-    if (s && s[RSTRING_LEN(self)]) {
-	rb_str_modify(self);
-	s = RSTRING_PTR(self);
-	s[RSTRING_LEN(self)] = '\0';
-    }
-
-    if (!s)
-	s = (char *)"";
-
-    (void)parse_comp(s, 0, &num);
-
-    return num;
-}
-
-static VALUE
-nucomp_s_convert(int argc, VALUE *argv, VALUE klass)
-{
-    VALUE a1, a2, backref;
-
-    rb_scan_args(argc, argv, "11", &a1, &a2);
-
-    if (NIL_P(a1) || (argc == 2 && NIL_P(a2)))
-	rb_raise(rb_eTypeError, "can't convert nil into Complex");
-
-    backref = rb_backref_get();
-    rb_match_busy(backref);
-
-    if (RB_TYPE_P(a1, T_STRING)) {
-	a1 = string_to_c_strict(a1);
-    }
-
-    if (RB_TYPE_P(a2, T_STRING)) {
-	a2 = string_to_c_strict(a2);
-    }
-
-    rb_backref_set(backref);
-
-    if (RB_TYPE_P(a1, T_COMPLEX)) {
-	{
-	    get_dat1(a1);
-
-	    if (k_exact_zero_p(dat->imag))
-		a1 = dat->real;
-	}
-    }
-
-    if (RB_TYPE_P(a2, T_COMPLEX)) {
-	{
-	    get_dat1(a2);
-
-	    if (k_exact_zero_p(dat->imag))
-		a2 = dat->real;
-	}
-    }
-
-    if (RB_TYPE_P(a1, T_COMPLEX)) {
-	if (argc == 1 || (k_exact_zero_p(a2)))
-	    return a1;
-    }
-
-    if (argc == 1) {
-	if (k_numeric_p(a1) && !f_real_p(a1))
-	    return a1;
-	/* should raise exception for consistency */
-	if (!k_numeric_p(a1))
-	    return rb_convert_type(a1, T_COMPLEX, "Complex", "to_c");
-    }
-    else {
-	if ((k_numeric_p(a1) && k_numeric_p(a2)) &&
-	    (!f_real_p(a1) || !f_real_p(a2)))
-	    return f_add(a1,
-			 f_mul(a2,
-			       f_complex_new_bang2(rb_cComplex, ZERO, ONE)));
-    }
-
-    {
-	VALUE argv2[2];
-	argv2[0] = a1;
-	argv2[1] = a2;
-	return nucomp_s_new(argc, argv2, klass);
-    }
-}
-
-/* --- */
-
-/*
- * call-seq:
- *    num.real  ->  self
- *
- * Returns self.
- */
-static VALUE
-numeric_real(VALUE self)
-{
-    return self;
-}
-
-/*
- * call-seq:
- *    num.imag       ->  0
- *    num.imaginary  ->  0
- *
- * Returns zero.
- */
-static VALUE
-numeric_imag(VALUE self)
-{
-    return INT2FIX(0);
-}
-
-/*
- * call-seq:
- *    num.abs2  ->  real
- *
- * Returns square of self.
- */
-static VALUE
-numeric_abs2(VALUE self)
-{
-    return f_mul(self, self);
-}
-
-#define id_PI rb_intern("PI")
-
-/*
- * call-seq:
- *    num.arg    ->  0 or float
- *    num.angle  ->  0 or float
- *    num.phase  ->  0 or float
- *
- * Returns 0 if the value is positive, pi otherwise.
- */
-static VALUE
-numeric_arg(VALUE self)
-{
-    if (f_positive_p(self))
-	return INT2FIX(0);
-    return rb_const_get(rb_mMath, id_PI);
-}
-
-/*
- * call-seq:
- *    num.rect  ->  array
- *    num.rectangular  ->  array
- *
- * Returns an array; [num, 0].
- */
-static VALUE
-numeric_rect(VALUE self)
-{
-    return rb_assoc_new(self, INT2FIX(0));
-}
-
-/*
- * call-seq:
- *    num.polar  ->  array
- *
- * Returns an array; [num.abs, num.arg].
- */
-static VALUE
-numeric_polar(VALUE self)
-{
-    return rb_assoc_new(f_abs(self), f_arg(self));
-}
-
-/*
- * call-seq:
- *    num.conj       ->  self
- *    num.conjugate  ->  self
- *
- * Returns self.
- */
-static VALUE
-numeric_conj(VALUE self)
-{
-    return self;
-}
-
-/*
- * call-seq:
- *    flo.arg    ->  0 or float
- *    flo.angle  ->  0 or float
- *    flo.phase  ->  0 or float
- *
- * Returns 0 if the value is positive, pi otherwise.
- */
-static VALUE
-float_arg(VALUE self)
-{
-    if (isnan(RFLOAT_VALUE(self)))
-	return self;
-    if (f_tpositive_p(self))
-	return INT2FIX(0);
-    return rb_const_get(rb_mMath, id_PI);
-}
-
-/*
- * A complex number can be represented as a paired real number with
- * imaginary unit; a+bi.  Where a is real part, b is imaginary part
- * and i is imaginary unit.  Real a equals complex a+0i
- * mathematically.
- *
- * Complex object can be created as literal, and also by using
- * Kernel#Complex, Complex::rect, Complex::polar or to_c method.
- *
- *    2+1i                 #=> (2+1i)
- *    Complex(1)           #=> (1+0i)
- *    Complex(2, 3)        #=> (2+3i)
- *    Complex.polar(2, 3)  #=> (-1.9799849932008908+0.2822400161197344i)
- *    3.to_c               #=> (3+0i)
- *
- * You can also create complex object from floating-point numbers or
- * strings.
- *
- *    Complex(0.3)         #=> (0.3+0i)
- *    Complex('0.3-0.5i')  #=> (0.3-0.5i)
- *    Complex('2/3+3/4i')  #=> ((2/3)+(3/4)*i)
- *    Complex('1@2')       #=> (-0.4161468365471424+0.9092974268256817i)
- *
- *    0.3.to_c             #=> (0.3+0i)
- *    '0.3-0.5i'.to_c      #=> (0.3-0.5i)
- *    '2/3+3/4i'.to_c      #=> ((2/3)+(3/4)*i)
- *    '1@2'.to_c           #=> (-0.4161468365471424+0.9092974268256817i)
- *
- * A complex object is either an exact or an inexact number.
- *
- *    Complex(1, 1) / 2    #=> ((1/2)+(1/2)*i)
- *    Complex(1, 1) / 2.0  #=> (0.5+0.5i)
- */
-void
-Init_Complex(void)
-{
-    VALUE compat;
-#undef rb_intern
-#define rb_intern(str) rb_intern_const(str)
-
-    assert(fprintf(stderr, "assert() is now active\n"));
-
-    id_abs = rb_intern("abs");
-    id_arg = rb_intern("arg");
-    id_convert = rb_intern("convert");
-    id_denominator = rb_intern("denominator");
-    id_eqeq_p = rb_intern("==");
-    id_expt = rb_intern("**");
-    id_fdiv = rb_intern("fdiv");
-    id_negate = rb_intern("-@");
-    id_numerator = rb_intern("numerator");
-    id_quo = rb_intern("quo");
-    id_real_p = rb_intern("real?");
-    id_to_f = rb_intern("to_f");
-    id_to_i = rb_intern("to_i");
-    id_to_r = rb_intern("to_r");
-    id_i_real = rb_intern("@real");
-    id_i_imag = rb_intern("@image"); /* @image, not @imag */
-
-    rb_cComplex = rb_define_class("Complex", rb_cNumeric);
-
-    rb_define_alloc_func(rb_cComplex, nucomp_s_alloc);
-    rb_undef_method(CLASS_OF(rb_cComplex), "allocate");
-
-#if 0
-    rb_define_private_method(CLASS_OF(rb_cComplex), "new!", nucomp_s_new_bang, -1);
-    rb_define_private_method(CLASS_OF(rb_cComplex), "new", nucomp_s_new, -1);
-#else
-    rb_undef_method(CLASS_OF(rb_cComplex), "new");
-#endif
-
-    rb_define_singleton_method(rb_cComplex, "rectangular", nucomp_s_new, -1);
-    rb_define_singleton_method(rb_cComplex, "rect", nucomp_s_new, -1);
-    rb_define_singleton_method(rb_cComplex, "polar", nucomp_s_polar, -1);
-
-    rb_define_global_function("Complex", nucomp_f_complex, -1);
-
-    rb_undef_method(rb_cComplex, "%");
-    rb_undef_method(rb_cComplex, "<");
-    rb_undef_method(rb_cComplex, "<=");
-    rb_undef_method(rb_cComplex, "<=>");
-    rb_undef_method(rb_cComplex, ">");
-    rb_undef_method(rb_cComplex, ">=");
-    rb_undef_method(rb_cComplex, "between?");
-    rb_undef_method(rb_cComplex, "div");
-    rb_undef_method(rb_cComplex, "divmod");
-    rb_undef_method(rb_cComplex, "floor");
-    rb_undef_method(rb_cComplex, "ceil");
-    rb_undef_method(rb_cComplex, "modulo");
-    rb_undef_method(rb_cComplex, "remainder");
-    rb_undef_method(rb_cComplex, "round");
-    rb_undef_method(rb_cComplex, "step");
-    rb_undef_method(rb_cComplex, "truncate");
-    rb_undef_method(rb_cComplex, "i");
-
-    rb_define_method(rb_cComplex, "real", nucomp_real, 0);
-    rb_define_method(rb_cComplex, "imaginary", nucomp_imag, 0);
-    rb_define_method(rb_cComplex, "imag", nucomp_imag, 0);
-
-    rb_define_method(rb_cComplex, "-@", nucomp_negate, 0);
-    rb_define_method(rb_cComplex, "+", nucomp_add, 1);
-    rb_define_method(rb_cComplex, "-", nucomp_sub, 1);
-    rb_define_method(rb_cComplex, "*", nucomp_mul, 1);
-    rb_define_method(rb_cComplex, "/", nucomp_div, 1);
-    rb_define_method(rb_cComplex, "quo", nucomp_quo, 1);
-    rb_define_method(rb_cComplex, "fdiv", nucomp_fdiv, 1);
-    rb_define_method(rb_cComplex, "**", nucomp_expt, 1);
-
-    rb_define_method(rb_cComplex, "==", nucomp_eqeq_p, 1);
-    rb_define_method(rb_cComplex, "coerce", nucomp_coerce, 1);
-
-    rb_define_method(rb_cComplex, "abs", nucomp_abs, 0);
-    rb_define_method(rb_cComplex, "magnitude", nucomp_abs, 0);
-    rb_define_method(rb_cComplex, "abs2", nucomp_abs2, 0);
-    rb_define_method(rb_cComplex, "arg", nucomp_arg, 0);
-    rb_define_method(rb_cComplex, "angle", nucomp_arg, 0);
-    rb_define_method(rb_cComplex, "phase", nucomp_arg, 0);
-    rb_define_method(rb_cComplex, "rectangular", nucomp_rect, 0);
-    rb_define_method(rb_cComplex, "rect", nucomp_rect, 0);
-    rb_define_method(rb_cComplex, "polar", nucomp_polar, 0);
-    rb_define_method(rb_cComplex, "conjugate", nucomp_conj, 0);
-    rb_define_method(rb_cComplex, "conj", nucomp_conj, 0);
-#if 0
-    rb_define_method(rb_cComplex, "~", nucomp_conj, 0); /* gcc */
-#endif
-
-    rb_define_method(rb_cComplex, "real?", nucomp_false, 0);
-#if 0
-    rb_define_method(rb_cComplex, "complex?", nucomp_true, 0);
-    rb_define_method(rb_cComplex, "exact?", nucomp_exact_p, 0);
-    rb_define_method(rb_cComplex, "inexact?", nucomp_inexact_p, 0);
-#endif
-
-    rb_define_method(rb_cComplex, "numerator", nucomp_numerator, 0);
-    rb_define_method(rb_cComplex, "denominator", nucomp_denominator, 0);
-
-    rb_define_method(rb_cComplex, "hash", nucomp_hash, 0);
-    rb_define_method(rb_cComplex, "eql?", nucomp_eql_p, 1);
-
-    rb_define_method(rb_cComplex, "to_s", nucomp_to_s, 0);
-    rb_define_method(rb_cComplex, "inspect", nucomp_inspect, 0);
-
-    rb_undef_method(rb_cComplex, "positive?");
-    rb_undef_method(rb_cComplex, "negative?");
-
-    rb_define_private_method(rb_cComplex, "marshal_dump", nucomp_marshal_dump, 0);
-    compat = rb_define_class_under(rb_cComplex, "compatible", rb_cObject); /* :nodoc: */
-    rb_define_private_method(compat, "marshal_load", nucomp_marshal_load, 1);
-    rb_marshal_define_compat(rb_cComplex, compat, nucomp_dumper, nucomp_loader);
-
-    /* --- */
-
-    rb_define_method(rb_cComplex, "to_i", nucomp_to_i, 0);
-    rb_define_method(rb_cComplex, "to_f", nucomp_to_f, 0);
-    rb_define_method(rb_cComplex, "to_r", nucomp_to_r, 0);
-    rb_define_method(rb_cComplex, "rationalize", nucomp_rationalize, -1);
-    rb_define_method(rb_cComplex, "to_c", nucomp_to_c, 0);
-    rb_define_method(rb_cNilClass, "to_c", nilclass_to_c, 0);
-    rb_define_method(rb_cNumeric, "to_c", numeric_to_c, 0);
-
-    rb_define_method(rb_cString, "to_c", string_to_c, 0);
-
-    rb_define_private_method(CLASS_OF(rb_cComplex), "convert", nucomp_s_convert, -1);
-
-    /* --- */
-
-    rb_define_method(rb_cNumeric, "real", numeric_real, 0);
-    rb_define_method(rb_cNumeric, "imaginary", numeric_imag, 0);
-    rb_define_method(rb_cNumeric, "imag", numeric_imag, 0);
-    rb_define_method(rb_cNumeric, "abs2", numeric_abs2, 0);
-    rb_define_method(rb_cNumeric, "arg", numeric_arg, 0);
-    rb_define_method(rb_cNumeric, "angle", numeric_arg, 0);
-    rb_define_method(rb_cNumeric, "phase", numeric_arg, 0);
-    rb_define_method(rb_cNumeric, "rectangular", numeric_rect, 0);
-    rb_define_method(rb_cNumeric, "rect", numeric_rect, 0);
-    rb_define_method(rb_cNumeric, "polar", numeric_polar, 0);
-    rb_define_method(rb_cNumeric, "conjugate", numeric_conj, 0);
-    rb_define_method(rb_cNumeric, "conj", numeric_conj, 0);
-
-    rb_define_method(rb_cFloat, "arg", float_arg, 0);
-    rb_define_method(rb_cFloat, "angle", float_arg, 0);
-    rb_define_method(rb_cFloat, "phase", float_arg, 0);
-
-    /*
-     * The imaginary unit.
-     */
-    rb_define_const(rb_cComplex, "I",
-		    f_complex_new_bang2(rb_cComplex, ZERO, ONE));
-
-    rb_provide("complex.so");	/* for backward compatibility */
-}
-
-/*
-Local variables:
-c-file-style: "ruby"
-End:
-*/
diff --git a/config.dj b/config.dj
new file mode 100644
index 0000000000..896b00fdda
--- /dev/null
+++ b/config.dj