4940 files changed, 390419 insertions, 1407549 deletions

diff --git a/.cvsignore b/.cvsignore
new file mode 100644
index 0000000000..9fd96ca149
--- /dev/null
+++ b/.cvsignore
@@ -0,0 +1,58 @@
+*.bak
+*.orig
+*.rej
+*.sav
+*~
+.ccmalloc
+.ppack
+.ext
+.git
+.svn
+.rbconfig.time
+COPYING.LIB
+ChangeLog.pre-alpha
+ChangeLog.pre1_1
+Makefile
+README.fat-patch
+README.v6
+README.atheos
+archive
+autom4te*.cache
+automake
+beos
+config.cache
+config.h
+config.h.in
+config.log
+config.status
+configure
+foo.rb
+libruby.so.*
+miniruby
+miniruby.elhash
+miniruby.elhash2
+miniruby.orig2
+miniruby.plhash
+miniruby.plhash2
+modex.rb
+newdate.rb
+newver.rb
+parse.c
+parse.y.try
+pitest.rb
+ppack
+preview
+rbconfig.rb
+rename2.h
+repack
+riscos
+rubicon
+ruby
+ruby-man.rd.gz
+rubyunit
+st.c.power
+this that
+tmp
+web
+y.output
+y.tab.c
diff --git a/.document b/.document
index fb27ba325d..230c50e387 100644
--- a/.document
+++ b/.document
@@ -6,21 +6,11 @@
 # Process all the C source files
 *.c
 
-# prelude
-prelude.rb
-
 # the lib/ directory (which has its own .document file)
-lib
-
-# and some of the ext/ directory (which has its own .document file)
-ext
 
-# rdoc files
-ChangeLog
+lib
 
-NEWS
 
-README.md
-README.ja.md
+# and some of the ext/ directory (which has its own .document file)
 
-doc
+ext
diff --git a/.editorconfig b/.editorconfig
deleted file mode 100644
index 67abf4b978..0000000000
--- a/.editorconfig
+++ /dev/null
@@ -1,16 +0,0 @@
-root = true
-
-[*]
-end_of_line = lf
-insert_final_newline = true
-trim_trailing_whitespace = true
-tab_width = 8
-indent_style = tab
-indent_size = 4
-
-[**.bat]
-end_of_line = crlf
-
-[**.rb]
-indent_style = space
-indent_size = 2
diff --git a/.gdbinit b/.gdbinit
deleted file mode 100644
index d31ccaa7df..0000000000
--- a/.gdbinit
+++ /dev/null
@@ -1,1210 +0,0 @@
-define hook-run
-  set $color_type = 0
-  set $color_highlite = 0
-  set $color_end = 0
-end
-
-define ruby_gdb_init
-  if !$color_type
-    set $color_type = "\033[31m"
-  end
-  if !$color_highlite
-    set $color_highlite = "\033[36m"
-  end
-  if !$color_end
-    set $color_end = "\033[m"
-  end
-  if ruby_dummy_gdb_enums.special_consts
-  end
-end
-
-# set prompt \033[36m(gdb)\033[m\040
-
-define rp
-  ruby_gdb_init
-  if (VALUE)($arg0) & RUBY_FIXNUM_FLAG
-    printf "FIXNUM: %ld\n", (long)($arg0) >> 1
-  else
-  if ((VALUE)($arg0) & ~(~(VALUE)0<<RUBY_SPECIAL_SHIFT)) == RUBY_SYMBOL_FLAG
-    set $id = (($arg0) >> RUBY_SPECIAL_SHIFT)
-    printf "%sSYMBOL%s: ", $color_type, $color_end
-    rp_id $id
-  else
-  if ($arg0) == RUBY_Qfalse
-    echo false\n
-  else
-  if ($arg0) == RUBY_Qtrue
-    echo true\n
-  else
-  if ($arg0) == RUBY_Qnil
-    echo nil\n
-  else
-  if ($arg0) == RUBY_Qundef
-    echo undef\n
-  else
-  if (VALUE)($arg0) & RUBY_IMMEDIATE_MASK
-    if ((VALUE)($arg0) & RUBY_FLONUM_MASK) == RUBY_FLONUM_FLAG
-      printf "%sFLONUM%s: %g\n", $color_type, $color_end, (double)rb_float_value($arg0)
-    else
-      echo immediate\n
-    end
-  else
-  set $flags = ((struct RBasic*)($arg0))->flags
-  if ($flags & RUBY_FL_PROMOTED) == RUBY_FL_PROMOTED
-    printf "[PROMOTED] "
-  end
-  if ($flags & RUBY_T_MASK) == RUBY_T_NONE
-    printf "%sT_NONE%s: ", $color_type, $color_end
-    print (struct RBasic *)($arg0)
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_NIL
-    printf "%sT_NIL%s: ", $color_type, $color_end
-    print (struct RBasic *)($arg0)
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_OBJECT
-    printf "%sT_OBJECT%s: ", $color_type, $color_end
-    print (struct RObject *)($arg0)
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_CLASS
-    printf "%sT_CLASS%s%s: ", $color_type, ($flags & RUBY_FL_SINGLETON) ? "*" : "", $color_end
-    rp_class $arg0
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_ICLASS
-    printf "%sT_ICLASS%s: ", $color_type, $color_end
-    rp_class $arg0
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_MODULE
-    printf "%sT_MODULE%s: ", $color_type, $color_end
-    rp_class $arg0
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_FLOAT
-    printf "%sT_FLOAT%s: %.16g ", $color_type, $color_end, (((struct RFloat*)($arg0))->float_value)
-    print (struct RFloat *)($arg0)
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_STRING
-    printf "%sT_STRING%s: ", $color_type, $color_end
-    rp_string $arg0 $flags
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_REGEXP
-    set $regsrc = ((struct RRegexp*)($arg0))->src
-    set $rsflags = ((struct RBasic*)$regsrc)->flags
-    printf "%sT_REGEXP%s: ", $color_type, $color_end
-    set print address off
-    output (char *)(($rsflags & RUBY_FL_USER1) ? \
-	    ((struct RString*)$regsrc)->as.heap.ptr : \
-	    ((struct RString*)$regsrc)->as.ary)
-    set print address on
-    printf " len:%ld ", ($rsflags & RUBY_FL_USER1) ? \
-            ((struct RString*)$regsrc)->as.heap.len : \
-            (($rsflags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
-    if $flags & RUBY_FL_USER6
-      printf "(none) "
-    end
-    if $flags & RUBY_FL_USER5
-      printf "(literal) "
-    end
-    if $flags & RUBY_FL_USER4
-      printf "(fixed) "
-    end
-    printf "encoding:%d ", ($flags & RUBY_ENCODING_MASK) >> RUBY_ENCODING_SHIFT
-    print (struct RRegexp *)($arg0)
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_ARRAY
-    if ($flags & RUBY_FL_USER1)
-      set $len = (($flags & (RUBY_FL_USER3|RUBY_FL_USER4)) >> (RUBY_FL_USHIFT+3))
-      printf "%sT_ARRAY%s: len=%ld ", $color_type, $color_end, $len
-      printf "(embed) "
-      if ($len == 0)
-	printf "{(empty)} "
-      else
-	output/x *((VALUE*)((struct RArray*)($arg0))->as.ary) @ $len
-	printf " "
-      end
-    else
-      set $len = ((struct RArray*)($arg0))->as.heap.len
-      printf "%sT_ARRAY%s: len=%ld ", $color_type, $color_end, $len
-      if ($flags & RUBY_FL_USER2)
-	printf "(shared) shared="
-	output/x ((struct RArray*)($arg0))->as.heap.aux.shared
-	printf " "
-      else
-	printf "(ownership) capa=%ld ", ((struct RArray*)($arg0))->as.heap.aux.capa
-      end
-      if ($len == 0)
-	printf "{(empty)} "
-      else
-	output/x *((VALUE*)((struct RArray*)($arg0))->as.heap.ptr) @ $len
-	printf " "
-      end
-    end
-    print (struct RArray *)($arg0)
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_FIXNUM
-    printf "%sT_FIXNUM%s: ", $color_type, $color_end
-    print (struct RBasic *)($arg0)
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_HASH
-    printf "%sT_HASH%s: ", $color_type, $color_end,
-    if ((struct RHash *)($arg0))->ntbl
-      printf "len=%ld ", ((struct RHash *)($arg0))->ntbl->num_entries
-    end
-    print (struct RHash *)($arg0)
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_STRUCT
-    printf "%sT_STRUCT%s: len=%ld ", $color_type, $color_end, \
-      (($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
-       ($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) >> (RUBY_FL_USHIFT+1) : \
-       ((struct RStruct *)($arg0))->as.heap.len)
-    print (struct RStruct *)($arg0)
-    x/xw (($flags & (RUBY_FL_USER1|RUBY_FL_USER2)) ? \
-          ((struct RStruct *)($arg0))->as.ary : \
-          ((struct RStruct *)($arg0))->as.heap.ptr)
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_BIGNUM
-    printf "%sT_BIGNUM%s: sign=%d len=%ld ", $color_type, $color_end, \
-      (($flags & RUBY_FL_USER1) != 0), \
-      (($flags & RUBY_FL_USER2) ? \
-       ($flags & (RUBY_FL_USER5|RUBY_FL_USER4|RUBY_FL_USER3)) >> (RUBY_FL_USHIFT+3) : \
-       ((struct RBignum*)($arg0))->as.heap.len)
-    if $flags & RUBY_FL_USER2
-      printf "(embed) "
-    end
-    print (struct RBignum *)($arg0)
-    x/xw (($flags & RUBY_FL_USER2) ? \
-          ((struct RBignum*)($arg0))->as.ary : \
-          ((struct RBignum*)($arg0))->as.heap.digits)
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_RATIONAL
-    printf "%sT_RATIONAL%s: ", $color_type, $color_end
-    print (struct RRational *)($arg0)
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_COMPLEX
-    printf "%sT_COMPLEX%s: ", $color_type, $color_end
-    print (struct RComplex *)($arg0)
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_FILE
-    printf "%sT_FILE%s: ", $color_type, $color_end
-    print (struct RFile *)($arg0)
-    output *((struct RFile *)($arg0))->fptr
-    printf "\n"
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_TRUE
-    printf "%sT_TRUE%s: ", $color_type, $color_end
-    print (struct RBasic *)($arg0)
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_FALSE
-    printf "%sT_FALSE%s: ", $color_type, $color_end
-    print (struct RBasic *)($arg0)
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_DATA
-    if ((struct RTypedData *)($arg0))->typed_flag == 1
-      printf "%sT_DATA%s(%s): ", $color_type, $color_end, ((struct RTypedData *)($arg0))->type->wrap_struct_name
-      print (struct RTypedData *)($arg0)
-    else
-      printf "%sT_DATA%s: ", $color_type, $color_end
-      print (struct RData *)($arg0)
-    end
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_MATCH
-    printf "%sT_MATCH%s: ", $color_type, $color_end
-    print (struct RMatch *)($arg0)
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_SYMBOL
-    printf "%sT_SYMBOL%s: ", $color_type, $color_end
-    print (struct RSymbol *)($arg0)
-    set $id_type = ((struct RSymbol *)($arg0))->id & RUBY_ID_SCOPE_MASK
-    if $id_type == RUBY_ID_LOCAL
-      printf "l"
-    else
-    if $id_type == RUBY_ID_INSTANCE
-      printf "i"
-    else
-    if $id_type == RUBY_ID_GLOBAL
-      printf "G"
-    else
-    if $id_type == RUBY_ID_ATTRSET
-      printf "a"
-    else
-    if $id_type == RUBY_ID_CONST
-      printf "C"
-    else
-    if $id_type == RUBY_ID_CLASS
-      printf "c"
-    else
-      printf "j"
-    end
-    end
-    end
-    end
-    end
-    end
-    set $id_fstr = ((struct RSymbol *)($arg0))->fstr
-    rp_string $id_fstr
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_UNDEF
-    printf "%sT_UNDEF%s: ", $color_type, $color_end
-    print (struct RBasic *)($arg0)
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_IMEMO
-    printf "%sT_IMEMO%s(", $color_type, $color_end
-    output (enum imemo_type)(($flags>>RUBY_FL_USHIFT)&imemo_mask)
-    printf "): "
-    rp_imemo $arg0
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_NODE
-    printf "%sT_NODE%s(", $color_type, $color_end
-    output (enum node_type)(($flags&RUBY_NODE_TYPEMASK)>>RUBY_NODE_TYPESHIFT)
-    printf "): "
-    print *(NODE *)($arg0)
-  else
-  if ($flags & RUBY_T_MASK) == RUBY_T_ZOMBIE
-    printf "%sT_ZOMBIE%s: ", $color_type, $color_end
-    print (struct RData *)($arg0)
-  else
-    printf "%sunknown%s: ", $color_type, $color_end
-    print (struct RBasic *)($arg0)
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-end
-document rp
-  Print a Ruby's VALUE.
-end
-
-define rp_id
-  set $id = (ID)$arg0
-  if $id == '!' || $id == '+' || $id == '-' || $id == '*' || $id == '/' || $id == '%' || $id == '<' || $id == '>' || $id == '`'
-    printf "(:%c)\n", $id
-  else
-  if $id == idDot2
-    printf "(:..)\n"
-  else
-  if $id == idDot3
-    printf "(:...)\n"
-  else
-  if $id == idUPlus
-    printf "(:+@)\n"
-  else
-  if $id == idUMinus
-    printf "(:-@)\n"
-  else
-  if $id == idPow
-    printf "(:**)\n"
-  else
-  if $id == idCmp
-    printf "(:<=>)\n"
-  else
-  if $id == idLTLT
-    printf "(:<<)\n"
-  else
-  if $id == idLE
-    printf "(:<=)\n"
-  else
-  if $id == idGE
-    printf "(:>=)\n"
-  else
-  if $id == idEq
-    printf "(:==)\n"
-  else
-  if $id == idEqq
-    printf "(:===)\n"
-  else
-  if $id == idNeq
-    printf "(:!=)\n"
-  else
-  if $id == idEqTilde
-    printf "(:=~)\n"
-  else
-  if $id == idNeqTilde
-    printf "(:!~)\n"
-  else
-  if $id == idAREF
-    printf "(:[])\n"
-  else
-  if $id == idASET
-    printf "(:[]=)\n"
-  else
-    if $id <= tLAST_OP_ID
-      printf "O"
-    else
-      set $id_type = $id & RUBY_ID_SCOPE_MASK
-      if $id_type == RUBY_ID_LOCAL
-        printf "l"
-      else
-      if $id_type == RUBY_ID_INSTANCE
-        printf "i"
-      else
-      if $id_type == RUBY_ID_GLOBAL
-        printf "G"
-      else
-      if $id_type == RUBY_ID_ATTRSET
-        printf "a"
-      else
-      if $id_type == RUBY_ID_CONST
-        printf "C"
-      else
-      if $id_type == RUBY_ID_CLASS
-        printf "c"
-      else
-        printf "j"
-      end
-      end
-      end
-      end
-      end
-      end
-    end
-    printf "(%ld): ", $id
-    set $str = lookup_id_str($id)
-    if $str
-      rp_string $str
-    else
-      echo undef\n
-    end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-end
-document rp_id
-  Print an ID.
-end
-
-define output_string
-  set $flags = ((struct RBasic*)($arg0))->flags
-  printf "%s", (char *)(($flags & RUBY_FL_USER1) ? \
-	    ((struct RString*)($arg0))->as.heap.ptr : \
-	    ((struct RString*)($arg0))->as.ary)
-end
-
-define rp_string
-  set $flags = ((struct RBasic*)($arg0))->flags
-  set print address off
-  output (char *)(($flags & RUBY_FL_USER1) ? \
-	    ((struct RString*)($arg0))->as.heap.ptr : \
-	    ((struct RString*)($arg0))->as.ary)
-  set print address on
-  printf " bytesize:%ld ", ($flags & RUBY_FL_USER1) ? \
-          ((struct RString*)($arg0))->as.heap.len : \
-          (($flags & (RUBY_FL_USER2|RUBY_FL_USER3|RUBY_FL_USER4|RUBY_FL_USER5|RUBY_FL_USER6)) >> RUBY_FL_USHIFT+2)
-  if !($flags & RUBY_FL_USER1)
-    printf "(embed) "
-  else
-    if ($flags & RUBY_FL_USER2)
-      printf "(shared) "
-    end
-    if ($flags & RUBY_FL_USER3)
-      printf "(assoc) "
-    end
-  end
-  printf "encoding:%d ", ($flags & RUBY_ENCODING_MASK) >> RUBY_ENCODING_SHIFT
-  if ($flags & RUBY_ENC_CODERANGE_MASK) == 0
-    printf "coderange:unknown "
-  else
-  if ($flags & RUBY_ENC_CODERANGE_MASK) == RUBY_ENC_CODERANGE_7BIT
-    printf "coderange:7bit "
-  else
-  if ($flags & RUBY_ENC_CODERANGE_MASK) == RUBY_ENC_CODERANGE_VALID
-    printf "coderange:valid "
-  else
-    printf "coderange:broken "
-  end
-  end
-  end
-  print (struct RString *)($arg0)
-end
-document rp_string
-  Print the content of a String.
-end
-
-define rp_class
-  printf "(struct RClass *) %p", (void*)$arg0
-  if ((struct RClass *)($arg0))->ptr.origin_ != $arg0
-    printf " -> %p", ((struct RClass *)($arg0))->ptr.origin_
-  end
-  printf "\n"
-  rb_classname $arg0
-  print *(struct RClass *)($arg0)
-  print *((struct RClass *)($arg0))->ptr
-end
-document rp_class
-  Print the content of a Class/Module.
-end
-
-define rp_imemo
-  set $flags = (enum imemo_type)((((struct RBasic *)($arg0))->flags >> RUBY_FL_USHIFT) & imemo_mask)
-  if $flags == imemo_cref
-    printf "(rb_cref_t *) %p\n", (void*)$arg0
-    print *(rb_cref_t *)$arg0
-  else
-  if $flags == imemo_svar
-    printf "(struct vm_svar *) %p\n", (void*)$arg0
-    print *(struct vm_svar *)$arg0
-  else
-  if $flags == imemo_throw_data
-    printf "(struct vm_throw_data *) %p\n", (void*)$arg0
-    print *(struct vm_throw_data *)$arg0
-  else
-  if $flags == imemo_ifunc
-    printf "(struct vm_ifunc *) %p\n", (void*)$arg0
-    print *(struct vm_ifunc *)$arg0
-  else
-  if $flags == imemo_memo
-    printf "(struct MEMO *) %p\n", (void*)$arg0
-    print *(struct MEMO *)$arg0
-  else
-  if $flags == imemo_ment
-    printf "(rb_method_entry_t *) %p\n", (void*)$arg0
-    print *(rb_method_entry_t *)$arg0
-  else
-  if $flags == imemo_iseq
-    printf "(rb_iseq_t *) %p\n", (void*)$arg0
-    print *(rb_iseq_t *)$arg0
-  else
-    printf "(struct RIMemo *) %p\n", (void*)$arg0
-    print *(struct RIMemo *)$arg0
-  end
-  end
-  end
-  end
-  end
-  end
-  end
-end
-document rp_imemo
-  Print the content of a memo
-end
-
-define nd_type
-  print (enum node_type)((((NODE*)($arg0))->flags&RUBY_NODE_TYPEMASK)>>RUBY_NODE_TYPESHIFT)
-end
-document nd_type
-  Print a Ruby' node type.
-end
-
-define nd_file
-  print ((NODE*)($arg0))->nd_file
-end
-document nd_file
-  Print the source file name of a node.
-end
-
-define nd_line
-  print ((unsigned int)((((NODE*)($arg0))->flags>>RUBY_NODE_LSHIFT)&RUBY_NODE_LMASK))
-end
-document nd_line
-  Print the source line number of a node.
-end
-
-# Print members of ruby node.
-
-define nd_head
-  printf "%su1.node%s: ", $color_highlite, $color_end
-  rp ($arg0).u1.node
-end
-
-define nd_alen
-  printf "%su2.argc%s: ", $color_highlite, $color_end
-  p ($arg0).u2.argc
-end
-
-define nd_next
-  printf "%su3.node%s: ", $color_highlite, $color_end
-  rp ($arg0).u3.node
-end
-
-
-define nd_cond
-  printf "%su1.node%s: ", $color_highlite, $color_end
-  rp ($arg0).u1.node
-end
-
-define nd_body
-  printf "%su2.node%s: ", $color_highlite, $color_end
-  rp ($arg0).u2.node
-end
-
-define nd_else
-  printf "%su3.node%s: ", $color_highlite, $color_end
-  rp ($arg0).u3.node
-end
-
-
-define nd_orig
-  printf "%su3.value%s: ", $color_highlite, $color_end
-  rp ($arg0).u3.value
-end
-
-
-define nd_resq
-  printf "%su2.node%s: ", $color_highlite, $color_end
-  rp ($arg0).u2.node
-end
-
-define nd_ensr
-  printf "%su3.node%s: ", $color_highlite, $color_end
-  rp ($arg0).u3.node
-end
-
-
-define nd_1st
-  printf "%su1.node%s: ", $color_highlite, $color_end
-  rp ($arg0).u1.node
-end
-
-define nd_2nd
-  printf "%su2.node%s: ", $color_highlite, $color_end
-  rp ($arg0).u2.node
-end
-
-
-define nd_stts
-  printf "%su1.node%s: ", $color_highlite, $color_end
-  rp ($arg0).u1.node
-end
-
-
-define nd_entry
-  printf "%su3.entry%s: ", $color_highlite, $color_end
-  p ($arg0).u3.entry
-end
-
-define nd_vid
-  printf "%su1.id%s: ", $color_highlite, $color_end
-  p ($arg0).u1.id
-end
-
-define nd_cflag
-  printf "%su2.id%s: ", $color_highlite, $color_end
-  p ($arg0).u2.id
-end
-
-define nd_cval
-  printf "%su3.value%s: ", $color_highlite, $color_end
-  rp ($arg0).u3.value
-end
-
-
-define nd_cnt
-  printf "%su3.cnt%s: ", $color_highlite, $color_end
-  p ($arg0).u3.cnt
-end
-
-define nd_tbl
-  printf "%su1.tbl%s: ", $color_highlite, $color_end
-  p ($arg0).u1.tbl
-end
-
-
-define nd_var
-  printf "%su1.node%s: ", $color_highlite, $color_end
-  rp ($arg0).u1.node
-end
-
-define nd_ibdy
-  printf "%su2.node%s: ", $color_highlite, $color_end
-  rp ($arg0).u2.node
-end
-
-define nd_iter
-  printf "%su3.node%s: ", $color_highlite, $color_end
-  rp ($arg0).u3.node
-end
-
-
-define nd_value
-  printf "%su2.node%s: ", $color_highlite, $color_end
-  rp ($arg0).u2.node
-end
-
-define nd_aid
-  printf "%su3.id%s: ", $color_highlite, $color_end
-  p ($arg0).u3.id
-end
-
-
-define nd_lit
-  printf "%su1.value%s: ", $color_highlite, $color_end
-  rp ($arg0).u1.value
-end
-
-
-define nd_frml
-  printf "%su1.node%s: ", $color_highlite, $color_end
-  rp ($arg0).u1.node
-end
-
-define nd_rest
-  printf "%su2.argc%s: ", $color_highlite, $color_end
-  p ($arg0).u2.argc
-end
-
-define nd_opt
-  printf "%su1.node%s: ", $color_highlite, $color_end
-  rp ($arg0).u1.node
-end
-
-
-define nd_recv
-  printf "%su1.node%s: ", $color_highlite, $color_end
-  rp ($arg0).u1.node
-end
-
-define nd_mid
-  printf "%su2.id%s: ", $color_highlite, $color_end
-  p ($arg0).u2.id
-end
-
-define nd_args
-  printf "%su3.node%s: ", $color_highlite, $color_end
-  rp ($arg0).u3.node
-end
-
-
-define nd_noex
-  printf "%su1.id%s: ", $color_highlite, $color_end
-  p ($arg0).u1.id
-end
-
-define nd_defn
-  printf "%su3.node%s: ", $color_highlite, $color_end
-  rp ($arg0).u3.node
-end
-
-
-define nd_old
-  printf "%su1.id%s: ", $color_highlite, $color_end
-  p ($arg0).u1.id
-end
-
-define nd_new
-  printf "%su2.id%s: ", $color_highlite, $color_end
-  p ($arg0).u2.id
-end
-
-
-define nd_cfnc
-  printf "%su1.cfunc%s: ", $color_highlite, $color_end
-  p ($arg0).u1.cfunc
-end
-
-define nd_argc
-  printf "%su2.argc%s: ", $color_highlite, $color_end
-  p ($arg0).u2.argc
-end
-
-
-define nd_cname
-  printf "%su1.id%s: ", $color_highlite, $color_end
-  p ($arg0).u1.id
-end
-
-define nd_super
-  printf "%su3.node%s: ", $color_highlite, $color_end
-  rp ($arg0).u3.node
-end
-
-
-define nd_modl
-  printf "%su1.id%s: ", $color_highlite, $color_end
-  p ($arg0).u1.id
-end
-
-define nd_clss
-  printf "%su1.value%s: ", $color_highlite, $color_end
-  rp ($arg0).u1.value
-end
-
-
-define nd_beg
-  printf "%su1.node%s: ", $color_highlite, $color_end
-  rp ($arg0).u1.node
-end
-
-define nd_end
-  printf "%su2.node%s: ", $color_highlite, $color_end
-  rp ($arg0).u2.node
-end
-
-define nd_state
-  printf "%su3.state%s: ", $color_highlite, $color_end
-  p ($arg0).u3.state
-end
-
-define nd_rval
-  printf "%su2.value%s: ", $color_highlite, $color_end
-  rp ($arg0).u2.value
-end
-
-
-define nd_nth
-  printf "%su2.argc%s: ", $color_highlite, $color_end
-  p ($arg0).u2.argc
-end
-
-
-define nd_tag
-  printf "%su1.id%s: ", $color_highlite, $color_end
-  p ($arg0).u1.id
-end
-
-define nd_tval
-  printf "%su2.value%s: ", $color_highlite, $color_end
-  rp ($arg0).u2.value
-end
-
-define nd_tree
-  set $buf = (struct RString *)rb_str_buf_new(0)
-  call dump_node((VALUE)($buf), rb_str_new(0, 0), 0, ($arg0))
-  printf "%s\n", $buf->as.heap.ptr
-end
-
-define rb_p
-  call rb_p($arg0)
-end
-
-define rb_numtable_entry
-  set $rb_numtable_tbl = $arg0
-  set $rb_numtable_id = (st_data_t)$arg1
-  set $rb_numtable_key = 0
-  set $rb_numtable_rec = 0
-  if $rb_numtable_tbl->entries_packed
-    set $rb_numtable_p = $rb_numtable_tbl->as.packed.bins
-    while $rb_numtable_p && $rb_numtable_p < $rb_numtable_tbl->as.packed.bins+$rb_numtable_tbl->num_entries
-      if $rb_numtable_p.k == $rb_numtable_id
-	set $rb_numtable_key = $rb_numtable_p.k
-	set $rb_numtable_rec = $rb_numtable_p.v
-	set $rb_numtable_p = 0
-      else
-	set $rb_numtable_p = $rb_numtable_p + 1
-      end
-    end
-  else
-    set $rb_numtable_p = $rb_numtable_tbl->as.big.bins[st_numhash($rb_numtable_id) % $rb_numtable_tbl->num_bins]
-    while $rb_numtable_p
-      if $rb_numtable_p->key == $rb_numtable_id
-	set $rb_numtable_key = $rb_numtable_p->key
-	set $rb_numtable_rec = $rb_numtable_p->record
-	set $rb_numtable_p = 0
-      else
-	set $rb_numtable_p = $rb_numtable_p->next
-      end
-    end
-  end
-end
-
-define rb_id2name
-  ruby_gdb_init
-  printf "%sID%s: ", $color_type, $color_end
-  rp_id $arg0
-end
-document rb_id2name
-  Print the name of id
-end
-
-define rb_method_entry
-  set $rb_method_entry_klass = (struct RClass *)$arg0
-  set $rb_method_entry_id = (ID)$arg1
-  set $rb_method_entry_me = (rb_method_entry_t *)0
-  while !$rb_method_entry_me && $rb_method_entry_klass
-    rb_numtable_entry $rb_method_entry_klass->m_tbl_wrapper->tbl $rb_method_entry_id
-    set $rb_method_entry_me = (rb_method_entry_t *)$rb_numtable_rec
-    if !$rb_method_entry_me
-      set $rb_method_entry_klass = (struct RClass *)RCLASS_SUPER($rb_method_entry_klass)
-    end
-  end
-  if $rb_method_entry_me
-    print *$rb_method_entry_klass
-    print *$rb_method_entry_me
-  else
-    echo method not found\n
-  end
-end
-document rb_method_entry
-  Search method entry by class and id
-end
-
-define rb_classname
-  # up to 128bit int
-  set $rb_classname_permanent = "0123456789ABCDEF"
-  set $rb_classname = classname($arg0, $rb_classname_permanent)
-  if $rb_classname != RUBY_Qnil
-    rp $rb_classname
-  else
-    echo anonymous class/module\n
-  end
-end
-
-define rb_ancestors
-  set $rb_ancestors_module = $arg0
-  while $rb_ancestors_module
-    rp_class $rb_ancestors_module
-    set $rb_ancestors_module = RCLASS_SUPER($rb_ancestors_module)
-  end
-end
-document rb_ancestors
-  Print ancestors.
-end
-
-define rb_backtrace
-  call rb_backtrace()
-end
-
-define iseq
-  if ruby_dummy_gdb_enums.special_consts
-  end
-  if ($arg0)->type == ISEQ_ELEMENT_NONE
-    echo [none]\n
-  end
-  if ($arg0)->type == ISEQ_ELEMENT_LABEL
-    print *(LABEL*)($arg0)
-  end
-  if ($arg0)->type == ISEQ_ELEMENT_INSN
-    print *(INSN*)($arg0)
-    if ((INSN*)($arg0))->insn_id != YARVINSN_jump
-      set $i = 0
-      set $operand_size = ((INSN*)($arg0))->operand_size
-      set $operands = ((INSN*)($arg0))->operands
-      while $i < $operand_size
-	rp $operands[$i++]
-      end
-    end
-  end
-  if ($arg0)->type == ISEQ_ELEMENT_ADJUST
-    print *(ADJUST*)($arg0)
-  end
-end
-
-define rb_ps
-  rb_ps_vm ruby_current_vm
-end
-document rb_ps
-Dump all threads and their callstacks
-end
-
-define rb_ps_vm
-  print $ps_vm = (rb_vm_t*)$arg0
-  set $ps_thread_ln = $ps_vm->living_threads.n.next
-  set $ps_thread_ln_last = $ps_vm->living_threads.n.prev
-  while 1
-    set $ps_thread_th = (rb_thread_t *)$ps_thread_ln
-    set $ps_thread = (VALUE)($ps_thread_th->self)
-    rb_ps_thread $ps_thread
-    if $ps_thread_ln == $ps_thread_ln_last
-      loop_break
-    end
-    set $ps_thread_ln = $ps_thread_ln->next
-  end
-end
-document rb_ps_vm
-Dump all threads in a (rb_vm_t*) and their callstacks
-end
-
-define print_lineno
-  set $cfp = $arg0
-  set $iseq = $cfp->iseq
-  set $pos = $cfp->pc - $iseq->body->iseq_encoded
-  if $pos != 0
-    set $pos = $pos - 1
-  end
-
-  set $i = 0
-  set $size = $iseq->body->line_info_size
-  set $table = $iseq->body->line_info_table
-  #printf "size: %d\n", $size
-  if $size == 0
-  else
-    set $i = 1
-    while $i < $size
-      #printf "table[%d]: position: %d, line: %d, pos: %d\n", $i, $table[$i].position, $table[$i].line_no, $pos
-      if $table[$i].position > $pos
-        loop_break
-      end
-      set $i = $i + 1
-      if $table[$i].position == $pos
-        loop_break
-      end
-    end
-    printf "%d", $table[$i-1].line_no
-  end
-end
-
-define check_method_entry
-  # get $immeo and $can_be_svar and return $me
-  set $imemo = (struct RBasic *)$arg0
-  set $can_be_svar = $arg1
-  if $imemo != RUBY_Qfalse
-    set $type = ($imemo->flags >> 12) & 0x07
-    if $type == imemo_ment
-      set $me = (rb_callable_method_entry_t *)$imemo
-    else
-    if $type == imemo_svar
-      set $imemo == ((struct vm_svar *)$imemo)->cref_or_me
-      check_method_entry $imemo 0
-    end
-    end
-  end
-end
-
-define output_id
-  set $id = $arg0
-  # rb_id_to_serial
-  if $id > tLAST_OP_ID
-    set $serial = (rb_id_serial_t)($id >> RUBY_ID_SCOPE_SHIFT)
-  else
-    set $serial = (rb_id_serial_t)$id
-  end
-  if $serial && $serial <= global_symbols.last_id
-    set $idx = $serial / ID_ENTRY_UNIT
-    set $ids = (struct RArray *)global_symbols.ids
-    set $flags = $ids->basic.flags
-    if ($flags & RUBY_FL_USER1)
-      set $idsptr = $ids->as.ary
-      set $idslen = (($flags & (RUBY_FL_USER3|RUBY_FL_USER4)) >> (RUBY_FL_USHIFT+3))
-    else
-      set $idsptr = $ids->as.heap.ptr
-      set $idslen = $ids->as.heap.len
-    end
-    if $idx < $idslen
-      set $t = 0
-      set $ary = (struct RArray *)$idsptr[$idx]
-      if $ary != RUBY_Qnil
-        set $flags = $ary->basic.flags
-        if ($flags & RUBY_FL_USER1)
-          set $aryptr = $ary->as.ary
-          set $arylen = (($flags & (RUBY_FL_USER3|RUBY_FL_USER4)) >> (RUBY_FL_USHIFT+3))
-        else
-          set $aryptr = $ary->as.heap.ptr
-          set $arylen = $ary->as.heap.len
-        end
-        set $result = $aryptr[($serial % ID_ENTRY_UNIT) * ID_ENTRY_SIZE + $t]
-        output_string $result
-      end
-    end
-  end
-end
-
-define rb_ps_thread
-  set $ps_thread = (struct RTypedData*)$arg0
-  set $ps_thread_th = (rb_thread_t*)$ps_thread->data
-  printf "* #<Thread:%p rb_thread_t:%p native_thread:%p>\n", \
-    $ps_thread, $ps_thread_th, $ps_thread_th->thread_id
-  set $cfp = $ps_thread_th->cfp
-  set $cfpend = (rb_control_frame_t *)($ps_thread_th->stack + $ps_thread_th->stack_size)-1
-  while $cfp < $cfpend
-    if $cfp->iseq
-      if $cfp->pc
-        set $location = $cfp->iseq->body->location
-        output_string $location.path
-        printf ":"
-        print_lineno $cfp
-        printf ":in `"
-        output_string $location.label
-        printf "'\n"
-      else
-        printf "???.rb:???:in `???'\n"
-      end
-    else
-      # if VM_FRAME_TYPE($cfp->flag) == VM_FRAME_MAGIC_CFUNC
-      set $ep = $cfp->ep
-      if ($ep[0] & 0xffff0001) == 0x55550001
-        #define VM_ENV_FLAG_LOCAL 0x02
-        #define VM_ENV_PREV_EP(ep)   GC_GUARDED_PTR_REF(ep[VM_ENV_DATA_INDEX_SPECVAL])
-        set $me = 0
-        set $env_specval = $ep[-1]
-        set $env_me_cref = $ep[-2]
-        while ($env_specval & 0x02) != 0
-          check_method_entry $env_me_cref 0
-          if $me != 0
-            loop_break
-          end
-          set $ep = $ep[0]
-          set $env_specval = $ep[-1]
-          set $env_me_cref = $ep[-2]
-        end
-        if $me == 0
-          check_method_entry $env_me_cref 1
-        end
-        set print symbol-filename on
-        output/a $me->def->body.cfunc.func
-        set print symbol-filename off
-        set $mid = $me->def->original_id
-        printf ":in `"
-        output_id $mid
-        printf "'\n"
-      else
-        printf "unknown_frame:???:in `???'\n"
-      end
-    end
-    set $cfp = $cfp + 1
-  end
-end
-
-define rb_count_objects
-  set $objspace = ruby_current_vm->objspace
-  set $counts_00 = 0
-  set $counts_01 = 0
-  set $counts_02 = 0
-  set $counts_03 = 0
-  set $counts_04 = 0
-  set $counts_05 = 0
-  set $counts_06 = 0
-  set $counts_07 = 0
-  set $counts_08 = 0
-  set $counts_09 = 0
-  set $counts_0a = 0
-  set $counts_0b = 0
-  set $counts_0c = 0
-  set $counts_0d = 0
-  set $counts_0e = 0
-  set $counts_0f = 0
-  set $counts_10 = 0
-  set $counts_11 = 0
-  set $counts_12 = 0
-  set $counts_13 = 0
-  set $counts_14 = 0
-  set $counts_15 = 0
-  set $counts_16 = 0
-  set $counts_17 = 0
-  set $counts_18 = 0
-  set $counts_19 = 0
-  set $counts_1a = 0
-  set $counts_1b = 0
-  set $counts_1c = 0
-  set $counts_1d = 0
-  set $counts_1e = 0
-  set $counts_1f = 0
-  set $total = 0
-  set $i = 0
-  while $i < $objspace->heap_pages.allocated_pages
-    printf "\rcounting... %d/%d", $i, $objspace->heap_pages.allocated_pages
-    set $page = $objspace->heap_pages.sorted[$i]
-    set $p = $page->start
-    set $pend = $p + $page->total_slots
-    while $p < $pend
-      set $flags = $p->as.basic.flags & 0x1f
-      eval "set $counts_%02x = $counts_%02x + 1", $flags, $flags
-      set $p = $p + 1
-    end
-    set $total = $total + $page->total_slots
-    set $i = $i + 1
-  end
-  printf "\rTOTAL: %d, FREE: %d\n", $total, $counts_00
-  printf "T_OBJECT: %d\n", $counts_01
-  printf "T_CLASS: %d\n", $counts_02
-  printf "T_MODULE: %d\n", $counts_03
-  printf "T_FLOAT: %d\n", $counts_04
-  printf "T_STRING: %d\n", $counts_05
-  printf "T_REGEXP: %d\n", $counts_06
-  printf "T_ARRAY: %d\n", $counts_07
-  printf "T_HASH: %d\n", $counts_08
-  printf "T_STRUCT: %d\n", $counts_09
-  printf "T_BIGNUM: %d\n", $counts_0a
-  printf "T_FILE: %d\n", $counts_0b
-  printf "T_DATA: %d\n", $counts_0c
-  printf "T_MATCH: %d\n", $counts_0d
-  printf "T_COMPLEX: %d\n", $counts_0e
-  printf "T_RATIONAL: %d\n", $counts_0f
-  #printf "UNKNOWN_10: %d\n", $counts_10
-  printf "T_NIL: %d\n", $counts_11
-  printf "T_TRUE: %d\n", $counts_12
-  printf "T_FALSE: %d\n", $counts_13
-  printf "T_SYMBOL: %d\n", $counts_14
-  printf "T_FIXNUM: %d\n", $counts_15
-  printf "T_UNDEF: %d\n", $counts_16
-  #printf "UNKNOWN_17: %d\n", $counts_17
-  #printf "UNKNOWN_18: %d\n", $counts_18
-  #printf "UNKNOWN_19: %d\n", $counts_19
-  printf "T_IMEMO: %d\n", $counts_1a
-  printf "T_NODE: %d\n", $counts_1b
-  printf "T_ICLASS: %d\n", $counts_1c
-  printf "T_ZOMBIE: %d\n", $counts_1d
-  #printf "UNKNOWN_1E: %d\n", $counts_1e
-  printf "T_MASK: %d\n", $counts_1f
-end
-document rb_count_objects
-  Counts all objects grouped by type.
-end
-
-# Details: https://bugs.ruby-lang.org/projects/ruby-trunk/wiki/MachineInstructionsTraceWithGDB
-define trace_machine_instructions
-  set logging on
-  set height 0
-  set width 0
-  display/i $pc
-  while !$exit_code
-    info line *$pc
-    si
-  end
-end
-
-define SDR
-  call rb_vmdebug_stack_dump_raw_current()
-end
-
-define rbi
-  if ((LINK_ELEMENT*)$arg0)->type == ISEQ_ELEMENT_LABEL
-    p *(LABEL*)$arg0
-  else
-  if ((LINK_ELEMENT*)$arg0)->type == ISEQ_ELEMENT_INSN
-    p *(INSN*)$arg0
-  else
-  if ((LINK_ELEMENT*)$arg0)->type == ISEQ_ELEMENT_ADJUST
-    p *(ADJUST*)$arg0
-  else
-    print *$arg0
-  end
-  end
-  end
-end
-
-define dump_node
-  set $str = rb_parser_dump_tree($arg0, 0)
-  set $flags = ((struct RBasic*)($str))->flags
-  printf "%s", (char *)(($flags & RUBY_FL_USER1) ? \
-                        ((struct RString*)$str)->as.heap.ptr : \
-                        ((struct RString*)$str)->as.ary)
-end
diff --git a/.gitattributes b/.gitattributes
deleted file mode 100644
index d9785fad00..0000000000
--- a/.gitattributes
+++ /dev/null
@@ -1,5 +0,0 @@
-*.gemspec diff=ruby
-*.rb diff=ruby
-bin/* diff=ruby
-tool/update-deps diff=ruby
-tool/make-snapshot diff=ruby
diff --git a/.gitignore b/.gitignore
deleted file mode 100644
index 9757768786..0000000000
--- a/.gitignore
+++ /dev/null
@@ -1,183 +0,0 @@
-*-*-*.def
-*-*-*.exp
-*-*-*.lib
-*.a
-*.bak
-*.bc
-*.dSYM
-*.dmyh
-*.dylib
-*.elc
-*.i
-*.inc
-*.log
-*.o
-*.obj
-*.orig
-*.pdb
-*.rej
-*.s
-*.sav
-*.swp
-*.yarb
-*~
-.*-*
-.*.list
-.*.time
-.DS_Store
-.ccmalloc
-.ext
-.pc
-.ppack
-.svn
-Makefile
-Makefile.old
-cygruby*.def
-extconf.h
-y.output
-y.tab.c
-
-# /
-/*-fake.rb
-/*.dll
-/*.exe
-/*.res
-/*.pc
-/*.rc
-/*_prelude.c
-/COPYING.LIB
-/ChangeLog-*
-/ChangeLog.pre-alpha
-/ChangeLog.pre1_1
-/Doxyfile
-/GNUmakefile
-/GNUmakefile.old
-/README.atheos
-/README.fat-patch
-/README.v6
-/TAGS
-/archive
-/autom4te*.cache
-/automake
-/beos
-/bmlog-*
-/breakpoints.gdb
-/config.cache
-/config.h
-/config.h.in
-/config.status
-/config.status.lineno
-/configure
-/coverage/simplecov
-/coverage/simplecov-html
-/coverage/doclie
-/coverage/.last_run.json
-/coverage/.resultset.json*
-/coverage/assets
-/coverage/index.html
-/doc/capi
-/enc.mk
-/encdb.h
-/exts.mk
-/goruby
-/id.[ch]
-/largefile.h
-/lex.c
-/libruby*.*
-/miniprelude.c
-/miniruby
-/newdate.rb
-/newline.c
-/newver.rb
-/parse.c
-/parse.h
-/patches
-/patches-master
-/pitest.rb
-/ppack
-/prelude.c
-/preview
-/probes.h
-/rbconfig.rb
-/rename2.h
-/repack
-/revision.h
-/riscos
-/rubicon
-/ruby
-/ruby-runner
-/ruby-runner.h
-/ruby-man.rd.gz
-/sizes.c
-/test.rb
-/tmp
-/transdb.h
-/uncommon.mk
-/verconf.h
-/verconf.mk
-/web
-/yasmdata.rb
-
-# /benchmark/
-/benchmark/bmx_*.rb
-/benchmark/fasta.output.*
-/benchmark/wc.input
-
-/enc/*.def
-/enc/*.exp
-/enc/*.lib
-/enc/unicode/data
-
-# /enc/trans/
-/enc/trans/*.c
-/enc/trans/*.def
-/enc/trans/*.exp
-/enc/trans/*.lib
-/enc/trans/.time
-
-# /ext/
-/ext/extinit.c
-
-# /ext/-test-/win32/dln/
-/ext/-test-/win32/dln/dlntest.exp
-/ext/-test-/win32/dln/dlntest.lib
-
-# /ext/dl/callback/
-/ext/dl/callback/callback-*.c
-/ext/dl/callback/callback.c
-
-# /ext/etc/
-/ext/etc/constdefs.h
-
-# /ext/fiddle/
-/ext/fiddle/libffi-*
-
-# /ext/rbconfig/
-/ext/rbconfig/sizeof/sizes.c
-
-# /ext/ripper/
-/ext/ripper/eventids1.c
-/ext/ripper/eventids2table.c
-/ext/ripper/ripper.*
-/ext/ripper/ids1
-/ext/ripper/ids2
-
-# /ext/socket/
-/ext/socket/constants.h
-/ext/socket/constdefs.h
-/ext/socket/constdefs.c
-
-# /gems
-/gems/*.gem
-
-# /spec/
-/spec/mspec
-/spec/rubyspec
-
-# /tool/
-/tool/config.guess
-/tool/config.sub
-
-# /win32/
-/win32/*.ico
-/win32/.time
diff --git a/.indent.pro b/.indent.pro
deleted file mode 100644
index 6a207a0554..0000000000
--- a/.indent.pro
+++ /dev/null
@@ -1,21 +0,0 @@
--bap
--nbbb
--nbc
--br
--nbs
--ncdb
--ce
--cli0.5
--ndj
--ei
--nfc1
--i4
--l120
--lp
--npcs
--psl
--sc
--sob
-
--TID
--TVALUE
diff --git a/.travis.yml b/.travis.yml
deleted file mode 100644
index 24ce0c9113..0000000000
--- a/.travis.yml
+++ /dev/null
@@ -1,102 +0,0 @@
-# Copyright (C) 2011 Urabe, Shyouhei.  All rights reserved.
-#
-# This file is  a part of the programming language  Ruby.  Permission is hereby
-# granted,  to either  redistribute  or  modify this  file,  provided that  the
-# conditions  mentioned in  the file  COPYING are  met.  Consult  the  file for
-# details.
-
-# This is  a Travis-CI  build configuration file.   The list  of configurations
-# available is located in
-#
-#     http://about.travis-ci.org/docs/user/build-configuration/
-#
-# and as Ruby itself is a project written in C language,
-#
-#     http://about.travis-ci.org/docs/user/languages/c/
-#
-# is also a good place to look at.
-
-# Language specification.
-language: c
-sudo: false
-
-# Compilers.  Several  compilers are  provided in Travis,  so we try  them all.
-# The value set here is visible via $CC environment variable.
-compiler:
-  - gcc
-
-os:
-  - linux
-
-# Dependencies.  Some  header files are missing  in a Travis' worker  VM, so we
-# have  to install  them.  The  "1.9.1" here  is OK.   It is  the  most adopted
-# version string  for Debian/Ubuntu, and  no dependencies have been  changed so
-# far since the 1.9.1 release.
-before_install:
-  - "CONFIG_FLAG="
-  - "JOBS='-j 4'"
-
-# Script is where the test runs.  Note  we just do "make test", not other tests
-# like  test-all, test-rubyspec.   This is  because  they take  too much  time,
-# enough for Travis to shut down the VM as being stalled.
-before_script:
-  - "uname -a"
-  - "uname -r"
-  - "rm -fr .ext autom4te.cache"
-  - "echo $TERM"
-  - "make -f common.mk BASERUBY=ruby MAKEDIRS='mkdir -p' srcdir=. update-config_files"
-  - "autoconf"
-  - "mkdir config_1st config_2nd"
-  - "./configure -C --disable-install-doc --with-gcc=$CC $CONFIG_FLAG"
-  - "cp -pr config.status .ext/include config_1st"
-  - "make reconfig"
-  - "cp -pr config.status .ext/include config_2nd"
-  - "diff -ru config_1st config_2nd"
-  - "make after-update BASERUBY=ruby"
-  - "make -s $JOBS"
-  - "make update-rubyspec"
-script:
-  - "make test TESTOPTS=--color=never"
-  - "make test-all TESTOPTS='-q -j3 --color=never --job-status=normal'"
-  - "make test-rubyspec MSPECOPT=-fm"
-
-# Branch matrix.  Not all branches are Travis-ready so we limit branches here.
-branches:
-  only:
-    - trunk
-    - ruby_2_1
-    - ruby_2_2
-    - ruby_2_3
-    - /^feature\//
-    - /^bug\//
-
-# We want to be notified when something happens.
-notifications:
-  irc:
-    channels:
-      - "irc.freenode.org#ruby-core"
-      - "irc.freenode.org#ruby-ja"
-    on_success: change # [always|never|change] # default: always
-    on_failure: always # [always|never|change] # default: always
-    template:
-      - "%{message} by @%{author}: See %{build_url}"
-
-  # Update ruby-head installed on Travis CI so other projects can test against it.
-  webhooks:
-    urls:
-      - "https://rubies.travis-ci.org/rebuild/ruby-head"
-    on_success: always
-    on_failure: never
-
-  email:
-    - ko1c-failure@atdot.net
-    - shibata.hiroshi@gmail.com
-
-# Local Variables:
-# mode: YAML
-# coding: utf-8-unix
-# indent-tabs-mode: nil
-# tab-width: 4
-# fill-column: 79
-# default-justification: full
-# End:
diff --git a/BSDL b/BSDL
deleted file mode 100644
index a009caefea..0000000000
--- a/BSDL
+++ /dev/null
@@ -1,22 +0,0 @@
-Copyright (C) 1993-2013 Yukihiro Matsumoto. All rights reserved.
-
-Redistribution and use in source and binary forms, with or without
-modification, are permitted provided that the following conditions
-are met:
-1. Redistributions of source code must retain the above copyright
-notice, this list of conditions and the following disclaimer.
-2. Redistributions in binary form must reproduce the above copyright
-notice, this list of conditions and the following disclaimer in the
-documentation and/or other materials provided with the distribution.
-
-THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
-ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
-IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
-ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
-FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
-DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
-OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
-HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
-LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
-OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
-SUCH DAMAGE.
diff --git a/CONTRIBUTING.md b/CONTRIBUTING.md
deleted file mode 100644
index ffdf2dd4b8..0000000000
--- a/CONTRIBUTING.md
+++ /dev/null
@@ -1,4 +0,0 @@
-Please see the [official issue tracker] and wiki [HowToContribute].
-
-[official issue tracker]: https://bugs.ruby-lang.org
-[HowToContribute]: https://bugs.ruby-lang.org/projects/ruby/wiki/HowToContribute
diff --git a/COPYING b/COPYING
index 426810a7fb..9043404a83 100644
--- a/COPYING
+++ b/COPYING
@@ -1,6 +1,6 @@
 Ruby is copyrighted free software by Yukihiro Matsumoto <matz@netlab.jp>.
-You can redistribute it and/or modify it under either the terms of the
-2-clause BSDL (see the file BSDL), or the conditions below:
+You can redistribute it and/or modify it under either the terms of the GPL
+version 2 (see the file GPL), or the conditions below:
 
   1. You may make and give away verbatim copies of the source form of the
      software without restriction, provided that you duplicate all of the
@@ -44,9 +44,9 @@ You can redistribute it and/or modify it under either the terms of the
      For the list of those files and their copying conditions, see the
      file LEGAL.
 
-  5. The scripts and library files supplied as input to or produced as
+  5. The scripts and library files supplied as input to or produced as 
      output from the software do not automatically fall under the
-     copyright of the software, but belong to whomever generated them,
+     copyright of the software, but belong to whomever generated them, 
      and may be sold commercially, and may be aggregated with this
      software.
 
diff --git a/COPYING.ja b/COPYING.ja
index e50d01c8d1..933cc7cb9a 100644
--- a/COPYING.ja
+++ b/COPYING.ja
@@ -1,51 +1,51 @@
-本プログラムはフリーソフトウェアです．2-clause BSDL
-または以下に示す条件で本プログラムを再配布できます
-2-clause BSDLについてはBSDLファイルを参照して下さい．
+$BK\%W%m%0%i%`$O%U%j!<%=%U%H%&%'%"$G$9!%(BGPL(the GNU General
+Public License)$B$^$?$O0J2<$K<($9>r7o$GK\%W%m%0%i%`$r:FG[I[$G(B
+$B$-$^$9!%(BGPL$B$K$D$$$F$O(BGPL$B%U%!%$%k$r;2>H$7$F2<$5$$!%(B
 
-  1. 複製は制限なく自由です．
+  1. $BJ#@=$O@)8B$J$/<+M3$G$9!%(B
 
-  2. 以下の条件のいずれかを満たす時に本プログラムのソースを
-     自由に変更できます．
+  2. $B0J2<$N>r7o$N$$$:$l$+$rK~$?$9;~$KK\%W%m%0%i%`$N%=!<%9$r(B
+     $B<+M3$KJQ99$G$-$^$9!%(B
 
-     (a) ネットニューズにポストしたり，作者に変更を送付する
-         などの方法で，変更を公開する．
+     (a) $B%M%C%H%K%e!<%:$K%]%9%H$7$?$j!$:n<T$KJQ99$rAwIU$9$k(B
+         $B$J$I$NJ}K!$G!$JQ99$r8x3+$9$k!%(B
 
-     (b) 変更した本プログラムを自分の所属する組織内部だけで
-         使う．
+     (b) $BJQ99$7$?K\%W%m%0%i%`$r<+J,$N=jB0$9$kAH?%FbIt$@$1$G(B
+         $B;H$&!%(B
 
-     (c) 変更点を明示したうえ，ソフトウェアの名前を変更する．
-         そのソフトウェアを配布する時には変更前の本プログラ
-         ムも同時に配布する．または変更前の本プログラムのソー
-         スの入手法を明示する．
+     (c) $BJQ99E@$rL@<($7$?$&$(!$%=%U%H%&%'%"$NL>A0$rJQ99$9$k!%(B
+         $B$=$N%=%U%H%&%'%"$rG[I[$9$k;~$K$OJQ99A0$NK\%W%m%0%i(B
+         $B%`$bF1;~$KG[I[$9$k!%$^$?$OJQ99A0$NK\%W%m%0%i%`$N%=!<(B
+         $B%9$NF~<jK!$rL@<($9$k!%(B
 
-     (d) その他の変更条件を作者と合意する．
+     (d) $B$=$NB>$NJQ99>r7o$r:n<T$H9g0U$9$k!%(B
 
-  3. 以下の条件のいずれかを満たす時に本プログラムをコンパイ
-     ルしたオブジェクトコードや実行形式でも配布できます．
+  3. $B0J2<$N>r7o$N$$$:$l$+$rK~$?$9;~$KK\%W%m%0%i%`$r%3%s%Q%$(B
+     $B%k$7$?%*%V%8%'%/%H%3!<%I$d<B9T7A<0$G$bG[I[$G$-$^$9!%(B
 
-     (a) バイナリを受け取った人がソースを入手できるように，
-         ソースの入手法を明示する．
+     (a) $B%P%$%J%j$r<u$1<h$C$??M$,%=!<%9$rF~<j$G$-$k$h$&$K!$(B
+         $B%=!<%9$NF~<jK!$rL@<($9$k!%(B
 
-     (b) 機械可読なソースコードを添付する．
+     (b) $B5!3#2DFI$J%=!<%9%3!<%I$rE:IU$9$k!%(B
 
-     (c) 変更を行ったバイナリは名前を変更したうえ，オリジナ
-         ルのソースコードの入手法を明示する．
+     (c) $BJQ99$r9T$C$?%P%$%J%j$OL>A0$rJQ99$7$?$&$(!$%*%j%8%J(B
+         $B%k$N%=!<%9%3!<%I$NF~<jK!$rL@<($9$k!%(B
 
-     (d) その他の配布条件を作者と合意する．
+     (d) $B$=$NB>$NG[I[>r7o$r:n<T$H9g0U$9$k!%(B
 
-  4. 他のプログラムへの引用はいかなる目的であれ自由です．た
-     だし，本プログラムに含まれる他の作者によるコードは，そ
-     れぞれの作者の意向による制限が加えられる場合があります．
+  4. $BB>$N%W%m%0%i%`$X$N0zMQ$O$$$+$J$kL\E*$G$"$l<+M3$G$9!%$?(B
+     $B$@$7!$K\%W%m%0%i%`$K4^$^$l$kB>$N:n<T$K$h$k%3!<%I$O!$$=(B
+     $B$l$>$l$N:n<T$N0U8~$K$h$k@)8B$,2C$($i$l$k>l9g$,$"$j$^$9!%(B
 
-     それらファイルの一覧とそれぞれの配布条件などに付いては
-     LEGALファイルを参照してください．
+     $B$=$l$i%U%!%$%k$N0lMw$H$=$l$>$l$NG[I[>r7o$J$I$KIU$$$F$O(B
+     LEGAL$B%U%!%$%k$r;2>H$7$F$/$@$5$$!%(B
 
-  5. 本プログラムへの入力となるスクリプトおよび，本プログラ
-     ムからの出力の権利は本プログラムの作者ではなく，それぞ
-     れの入出力を生成した人に属します．また，本プログラムに
-     組み込まれるための拡張ライブラリについても同様です．
+  5. $BK\%W%m%0%i%`$X$NF~NO$H$J$k%9%/%j%W%H$*$h$S!$K\%W%m%0%i(B
+     $B%`$+$i$N=PNO$N8"Mx$OK\%W%m%0%i%`$N:n<T$G$O$J$/!$$=$l$>(B
+     $B$l$NF~=PNO$r@8@.$7$??M$KB0$7$^$9!%$^$?!$K\%W%m%0%i%`$K(B
+     $BAH$_9~$^$l$k$?$a$N3HD%%i%$%V%i%j$K$D$$$F$bF1MM$G$9!%(B
 
-  6. 本プログラムは無保証です．作者は本プログラムをサポート
-     する意志はありますが，プログラム自身のバグあるいは本プ
-     ログラムの実行などから発生するいかなる損害に対しても責
-     任を持ちません．
+  6. $BK\%W%m%0%i%`$OL5J]>Z$G$9!%:n<T$OK\%W%m%0%i%`$r%5%]!<%H(B
+     $B$9$k0U;V$O$"$j$^$9$,!$%W%m%0%i%`<+?H$N%P%0$"$k$$$OK\%W(B
+     $B%m%0%i%`$N<B9T$J$I$+$iH/@8$9$k$$$+$J$kB;32$KBP$7$F$b@U(B
+     $BG$$r;}$A$^$;$s!%(B
diff --git a/ChangeLog b/ChangeLog
index 1fd1fd9ac1..c10e42d760 100644
--- a/ChangeLog
+++ b/ChangeLog
@@ -1,8061 +1,18324 @@
-Fri Sep  9 22:43:29 2016  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+Sun Jun  8 01:37:58 2008  Tanaka Akira  <akr@fsij.org>
 
-	* gems/bundled_gems: sort lines.
+	* ext/socket/socket.c (s_accept_nonblock): make accepted fd
+	  nonblocking.  [ruby-talk:274079]
 
-Fri Sep  9 17:59:46 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sun Jun  8 01:28:42 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* thread.c (rb_threadptr_raise): set cause from the called thread,
-	  but not from the thread to be interrupted.
-	  [ruby-core:77222] [Bug #12741]
+	* win32/mkexports.rb: deal with __fastcall name decorations.
+	  [ruby-list:44111]
 
-Fri Sep  9 13:50:05 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sun Jun  8 01:23:29 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* doc/extension.rdoc, doc/extension.ja.rdoc: fix file name.
-	  pointed out by @takkanm in the RubyKaigi talk.
+	* lib/rexml/source.rb (REXML::SourceFactory::SourceFactory): typo
+	  fixed.  [ruby-list:44099]
 
-Fri Sep  9 13:14:53 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Sun Jun  8 01:17:45 2008  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* News: Announcing update to Unicode version 9.0.0 [ci skip]
+	* {bcc32,win32}/Makefile.sub (COMMON_MACROS): workaround for old SDK's
+	  bug. [ruby-core:12584]
 
-Fri Sep  9 10:10:00 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sun Jun  8 00:56:44 2008  GOTOU Yuuzou  <gotoyuzo@notwork.org>
 
-	* variable.c (rb_const_search): warn with the actual class/module
-	  name which defines the deprecated constant.
+	* lib/net/http.rb, lib/open-uri.rb: remove
+	  Net::HTTP#enable_post_connection_check.  [ruby-dev:31960]
 
-	* variable.c (rb_const_search): raise with the actual class/module
-	  name which defines the private constant.
+	* lib/net/imap.rb: hostname should be verified against server's
+	  indentity as persented in the server's certificate. [ruby-dev:31960]
 
-Thu Sep  8 17:47:18 2016  Kazuki Tsujimoto  <kazuki@callcc.net>
+	* ext/openssl/lib/net/telnets.rb, ext/openssl/lib/net/ftptls.rb: ditto.
 
-	* array.c (flatten): use rb_obj_class instead of rb_class_of
-	  because rb_class_of may return a singleton class.
-	  [ruby-dev:49781] [Bug #12738]
+Thu Jun  5 16:19:27 2008  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Thu Sep  8 17:40:15 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* win32/win32.c (make_cmdvector): adjust escaped successive
+	  double-quote handling. (merge from trunk)
 
-	* tool/rbinstall.rb (gem): use the bindir of each gemspec instead
-	  of hardcoded 'bin', since rdoc 5.0.0 overrides it.
+Thu Jun  5 12:24:25 2008  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Thu Sep  8 16:47:03 2016  Shugo Maeda  <shugo@ruby-lang.org>
+	* win32/win32.c (init_env): initialize HOME and USER environment
+	  variables unless set. [ruby-core:12328] (merge from trunk)
 
-	* eval.c (rb_mod_s_used_modules): rename Module.used_refinements to
-	  Module.used_modules.  [Feature #7418] [ruby-core:49805]
+	* win32/win32.c (NtInitialize, getlogin): ditto.
 
-Thu Sep  8 14:21:48 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* configure.in, win32/Makefile.sub (LIBS): need to link shell32
+	  library for SH* functions on mswin32 and mingw32.
 
-	* ext/psych/psych.gemspec, lib/rdoc/rdoc.gemspec: Use file list instead of
-	  git output. It shows warning message when invoke `make install`
-	  [Bug #12736][ruby-dev:49778]
+Thu Jun  5 12:21:06 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Thu Sep  8 13:41:46 2016  Shugo Maeda  <shugo@ruby-lang.org>
+	* gc.c (id2ref): valid id should not refer T_VALUE nor T_ICLASS.
+	  [ruby-dev:31911]
 
-	* insns.def (setclassvariable, setconstant): warn when self is a
-	  refinement.  [Bug #10103] [ruby-core:64143]
+Wed Jun  4 16:39:56 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Sep  8 11:29:00 2016  Kenta Murata  <mrkn@mrkn.jp>
+	* Makefile.in (ext/extinit.o): use $(OUTFLAG) as well as other
+	  objects.  [ruby-Bugs-14228]
 
-	* hash.c (rb_hash_transform_values, rb_hash_transform_values_bang):
-	  Rename map_v to transform_values.
-	  [Feature #12512] [ruby-core:76095]
+Tue Jun  3 16:13:40 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/ruby/test_hash.rb: ditto.
+	* parse.y (yyerror): limit error message length.  [ruby-dev:31848]
 
-Thu Sep  8 10:08:35 2016  Kazuki Yamaguchi  <k@rhe.jp>
+	* regex.c (re_mbc_startpos): separated from re_adjust_startpos.
 
-	* {ext,test}/openssl: Import Ruby/OpenSSL 2.0.0.beta.2. The full commit
-	  history since v2.0.0.beta.1 can be found at:
-	  https://github.com/ruby/openssl/compare/v2.0.0.beta.1...v2.0.0.beta.2
+Tue Jun  3 15:27:11 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Sep  8 07:23:34 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* gc.c (os_obj_of, os_each_obj): hide objects to be finalized.
+	  [ruby-dev:31810]
 
-	* lib/rdoc/*, test/rdoc/*: Update rdoc-5.0.0.beta2
-	  Fixed ri parse defect with left-hand matched classes.
-	  https://github.com/rdoc/rdoc/pull/420
+Wed Jun  4 19:15:57 2008  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Thu Sep  8 01:12:47 2016  Shugo Maeda  <shugo@ruby-lang.org>
+	* eval.c (remove_method): should not remove undef place holder.
+	  [ruby-dev:31817]
 
-	* eval.c (rb_mod_s_used_refinements): new method
-	  Module.used_refinements.  based on the patch by Charlie
-	  Somerville.  [Feature #7418] [ruby-core:49805]
+Tue Jun  3 15:05:48 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Sep  7 17:50:38 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* process.c (struct rb_exec_arg): proc should be a VALUE.
 
-	* include/ruby/util.h (setenv): remove POSIX-noncompliant
-	  definition with 2 arguments.
+	* process.c (rb_f_exec): suppress a warning.
 
-Wed Sep  7 17:35:37 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* process.c (rb_detach_process): cast for the platforms where size of
+	  pointer differs from size of int.
 
-	* unicode/8.0.0/casefold.h, name2ctype.h, unicode/data/8.0.0:
-	  removing directories/files related to Unicode version 8.0.0
+	* process.c (rb_f_exec, rb_f_system): should not exceptions after
+	  fork.  [ruby-core:08262]
 
-Wed Sep  7 17:21:55 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed May 21 01:32:56 2008  GOTOU Yuuzou  <gotoyuzo@notwork.org>
 
-	* lib/timeout.rb (Timeout#timeout): add custom error message
-	  argument.  [Feature #11650]
+	* lib/webrick/httpservlet/filehandler.rb: should normalize path
+	  name in path_info to prevent script disclosure vulnerability on
+	  DOSISH filesystems. (fix: CVE-2008-1891)
+	  Note: NTFS/FAT filesystem should not be published by the platforms
+	  other than Windows. Pathname interpretation (including short
+	  filename) is less than perfect.
 
-Wed Sep  7 17:13:05 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* lib/webrick/httpservlet/abstract.rb
+	  (WEBrick::HTTPServlet::AbstracServlet#redirect_to_directory_uri):
+	  should escape the value of Location: header.
 
-	* common.mk: Updated Unicode version to 9.0.0 [Feature #12513]
+	* lib/webrick/httpservlet/cgi_runner.rb: accept interpreter
+	  command line arguments.
 
-	* unicode/9.0.0/casefold.h, name2ctype.h, unicode/data/9.0.0:
-	  new directories/files for Unicode version 9.0.0
+Sun May 18 01:57:44 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Sep  7 16:00:45 2016  Tanaka Akira  <akr@fsij.org>
+	* file.c (isdirsep): backslash is valid path separator on cygwin too.
+	  backported from 1.8 HEAD.
 
-	* lib/open-uri.rb: Allow http to https redirection.
-	  Note that https to http is still forbidden.
-	  [ruby-core:20485] [Feature #859] by Roman Shterenzon.
+Sat May 17 23:53:57 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Sep  7 14:56:59 2016  Kazuki Tsujimoto  <kazuki@callcc.net>
+	* file.c (file_expand_path): fix for short file name on Cygwin.
 
-	* lib/csv.rb (CSV::{Row,Table}#{each,delete_if}): returns an enumerator
-	  if no block is given. [ruby-core:75346] [Feature #12347]
+Sat May 17 23:50:29 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/csv/test_row.rb: add test for above.
+	* file.c (OpenFile): prevent conflict on Windows.
 
-	* test/csv/test_table.rb: ditto.
+	* file.c (USE_NTFS): fixed merge miss.
 
-Wed Sep  7 14:50:01 2016  Kazuki Tsujimoto  <kazuki@callcc.net>
+Sat May 17 12:36:46 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* gems/bundled_gems: update to power_assert 0.3.1.
+	* file.c (file_expand_path): rb_str_set_len is not backported.
 
-Wed Sep  7 12:16:09 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+Sat May 17 12:15:48 2008  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/psych/*, test/psych/*: Update psych-2.1.1
-	  This version fixed following pull requests.
-	  https://github.com/tenderlove/psych/pull/284
-	  https://github.com/tenderlove/psych/pull/276
+	* file.c (file_expand_path): support for alternative data stream
+	  and ignored trailing garbages of NTFS.
 
-Wed Sep  7 11:51:06 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* file.c (rb_file_s_basename): ditto.
 
-	* lib/rdoc/*, test/rdoc/*: Update rdoc-5.0.0.beta1
-	  This version is mostly same as r56072. It contains to remove code
-	  for Ruby 1.8
+	* file.c (rb_file_s_extname): ditto.
 
-Tue Sep  6 09:23:06 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+Mon Mar  3 23:36:41 2008  GOTOU Yuuzou  <gotoyuzo@notwork.org>
 
-	* lib/rdoc/rdoc.gemspec: partly reverted for default gem installer.
-	  upstream configuration is not working on ruby core repository.
+	* lib/webrick/httpservlet/filehandler.rb: should normalize path
+	  separators in path_info to prevent directory traversal attacks
+	  on DOSISH platforms.
+	  reported by Digital Security Research Group [DSECRG-08-026].
 
-Mon Sep  5 19:35:22 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* lib/webrick/httpservlet/filehandler.rb: pathnames which have
+	  not to be published should be checked case-insensitively.
 
-	* lib/rdoc/*, test/rdoc/*: Update rdoc/rdoc master(f191513)
-	  https://github.com/rdoc/rdoc/blob/master/History.rdoc#423--2016--
-	  https://github.com/rdoc/rdoc/blob/master/History.rdoc#422--2016-02-09
+Sun Sep 23 21:57:25 2007  GOTOU Yuuzou  <gotoyuzo@notwork.org>  
 
-Sun Sep  4 00:17:55 2016  Sho Hashimoto  <sho-h@ruby-lang.org>
+	* lib/net/http.rb: an SSL verification (the server hostname should
+	  be matched with its certificate's commonName) is added.
+	  this verification can be skipped by
+	  "Net::HTTP#enable_post_connection_check=(false)".
+	  suggested by Chris Clark <cclark at isecpartners.com>
 
-	* proc.c: [DOC] fix Object#define_singleton_method and
-	  main.define_method return value. [ci skip]
+	* lib/net/open-uri.rb: use Net::HTTP#enable_post_connection_check to
+	  perform SSL post connection check.
 
-Sat Sep  3 11:28:29 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/openssl/lib/openssl/ssl.c
+	(OpenSSL::SSL::SSLSocket#post_connection_check): refine error message.
 
-	* thread_pthread.c (ruby_init_stack): check stack bounds even if
-	  get_main_stack succeeded, on the "co-routine" case.
-	  https://github.com/ruby/ruby/commit/53953ee#commitcomment-18887413
+Sun Sep 23 06:08:38 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Sep  2 16:06:59 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/stringio/stringio.c (strio_init): separate from strio_initialize
+	  to share with strio_reopen properly.  [ruby-Bugs-13919]
 
-	* internal.h (MEMO_V1_SET, MEMO_V2_SET): fix typos.  use the macro
-	  parameter, not the local variable.
+Sun Sep 23 05:42:35 2007  URABE Shyouhei  <shyouhei@ruby-lang.org>
 
-Fri Sep  2 00:55:11 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/rdoc/options.rb (Options::check_diagram): dot -V output
+	  changed. [ ruby-Bugs-11978 ], Thanks Florian Frank.
 
-	* ext/extmk.rb (timestamp_file): move extmk.rb specific tricks
-	  from lib/mkmf.rb.  keep RUBYCOMMONDIR prefix not to conflict
-	  with a timestamp file in the toplevel.
+Mon Sep 17 04:47:02 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Thu Sep  1 14:24:16 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ruby.c (proc_options): -W should be allowed in RUBYOPT
+	  environment variable.  [ruby-core:12118]
 
-	* ext/extmk.rb (gems): move dirty hacks for bundled gems from
-	  mkmf.rb.
+Mon Sep 17 04:31:46 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* lib/mkmf.rb (create_makefile): yield all configuration strings.
+	* range.c (range_step): fixed integer overflow.  [ruby-dev:31763]
 
-Wed Aug 31 17:39:19 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Sep  7 14:57:36 2007  URABE Shyouhei  <shyouhei@ice.uec.ac.jp>
 
-	* ext/extmk.rb (create_makefile): make gem.build_complete file
-	  under TARGET_SO_DIR and install it only when the gem build
-	  succeeded.  [ruby-core:77057] [Bug #12681]
+	* ruby.c (rubylib_mangled_path): eliminate RSTRING_PTR
+	  [ruby-dev:31679]
 
-Wed Aug 31 15:36:10 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ruby.c(push_include_cygwin): ditto.
 
-	* ext/extmk.rb: move TARGET_SO_DIR stuffs to mkmf.rb.
+Fri Sep  7 14:32:38 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* lib/mkmf.rb (create_makefile): create target shared object files
-	  under $(TARGET_SO_DIR) which is $sodir if it is defined with
-	  $extout.  [ruby-core:77058] [Bug #12681]
+	* array.c (rb_ary_subseq): need integer overflow check.
+	  [ruby-dev:31736]
 
-Wed Aug 31 01:56:55 2016  Yuichiro Kaneko  <yui-knk@ruby-lang.org>
+	* array.c (rb_ary_splice): ditto.  [ruby-dev:31737]
 
-	* doc/extension.ja.rdoc: [DOC] Fix a typo. [ci skip]
+	* array.c (rb_ary_fill): ditto.  [ruby-dev:31738]
 
-Wed Aug 31 00:52:23 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* string.c (rb_str_splice): integer overflow for length.
+	  [ruby-dev:31739]
 
-	* ext/extmk.rb: make the gems target directory under the expanded
-	  name.  [ruby-core:77102] [Bug #12714]
+Fri Sep  7 14:27:33 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Tue Aug 30 15:27:27 2016  Kouhei Yanagita  <yanagi@shakenbu.org>
+	* eval.c (mnew): should preserve noex as safe_level.
 
-	* ext/json/lib/json/add/ostruct.rb (OpenStruct.json_create):
-	  Correct documentation, fix the name of values.  [Fix GH-1421]
+	* eval.c (rb_call0): tighten security check condition..
 
-Tue Aug 30 14:53:34 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+Fri Sep  7 14:19:16 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* io.c (nogvl_fsync, nogvl_fdatasync): on Windows, just ignore if the
-	  fd is associated to non-disk device.  if call fsync and/or fdatasync
-	  with such fds, it causes Errno::EBADF exception and the behavior is
-	  incompatible with ruby 2.1 and earlier unintentionally introduced.
+	* configure.in (group_member): check if presents.
 
-Tue Aug 30 03:38:35 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* configure.in (XCFLAGS): add _GNU_SOURCE on linux.
 
-	* vm_dump.c (backtrace): use rip in the saved context for the case
-	  the SIGSEGV is received when the process is in userland.
-	  Note that ip in the stack should be used if the signal is received
-	  when it is in kernel (when it is calling syscall) [Bug #12711]
+	* file.c (group_member): use system routine if available.
 
-Sat Aug 27 10:26:14 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Sep  7 14:14:19 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* array.c (rb_ary_concat_multi): take multiple arguments.  based
-	  on the patch by Satoru Horie.  [Feature #12333]
+	* include/ruby/defines.h (flush_register_windows): call "ta 0x03"
+	  even on Linux/Sparc.  [ruby-dev:31674]
 
-	* string.c (rb_str_concat_multi, rb_str_prepend_multi): ditto.
+Fri Sep  7 14:12:37 2007  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
 
-Thu Aug 25 00:42:31 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/win32ole/win32ole.c (ole_type_progid, reg_enum_key, 
+	  reg_get_val, ole_wc2mb): fix the bug. Thanks, arton. 
+	  [ruby-dev:31576]
 
-	* win32/file.c (append_wstr): remove a codepage argument, and use
-	  INVALID_CODE_PAGE for conversion by econv.
+Fri Sep  7 14:02:10 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* win32/file.c (append_wstr): exclude the terminator from the
-	  result length when input len == -1.
+	* process.c (detach_process_watcher): should not pass the pointer
+	  to an auto variable to the thread to be created.  pointed and
+	  fix by KUBO Takehiro <kubo at jiubao.org>  [ruby-dev:30618]
 
-Wed Aug 24 22:41:30 2016  Kouhei Sutou  <kou@cozmixng.org>
+Fri Sep  7 13:52:36 2007  Tanaka Akira  <akr@fsij.org>
 
-	* gc.c (gc_reset_malloc_info): Remove too much ";".
+	* bignum.c (big_lshift): make shift offset long type.
+	  (big_rshift): ditto.
+	  (rb_big_lshift): ditto.
+	  (big_rshift): ditto.
+	  [ruby-dev:31434]
 
-Wed Aug 24 20:07:57 2016  Naohisa Goto  <ngotogenome@gmail.com>
+Thu Aug 16 08:44:55 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* include/ruby/defines.h (ALWAYS_INLINE): Add alternative definition.
-	  Fix compile error with compilers that do not have force inline
-	  attribute, including old version of fcc on Solaris 10.
-	  [ruby-dev:49773] [Bug #12701]
+	* hash.c (rb_hash_delete_key): delete the entry without calling block.
 
-Wed Aug 24 16:56:26 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* hash.c (rb_hash_shift): should consider iter_lev too.
 
-	* .gdbinit: follow r55766's VM change.
+	* hash.c (delete_if_i): use rb_hash_delete_key() so that the block
+	  isn't called twice.  [ruby-core:11556]
 
-Wed Aug 24 12:57:56 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Aug 16 08:43:50 2007  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
 
-	* object.c (rb_mod_initialize, rb_class_initialize): [DOC] these
-	  methods do not invoke module_eval/class_eval, just eval the
-	  given block under the new module/class but sharing the context
-	  with the surrounding scope like those methods.
-	  [ruby-core:77023] [Bug #12696]
+	* lib/rinda/tuplespace.rb: fix Rinda::TupleSpace keeper thread bug.
+	  the thread is started too early. [ruby-talk:264062] 
 
-Tue Aug 23 10:34:40 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/rinda/test_rinda.rb: ditto.
 
-	* test/psych/test_psych.rb (test_load_file_with_fallback): fix
-	  Tempfile leak.  https://github.com/tenderlove/psych/pull/288
+Thu Aug 16 08:40:38 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Aug 23 10:15:01 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/pty/pty.c (establishShell): handshaking before close slave
+	  device.  [ruby-talk:263410]
 
-	* string.c (rb_fs_setter): check and convert $; value at
-	  assignment.
+Thu Aug 16 08:29:39 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Aug 23 02:09:57 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* configure.in (ac_cv_func_isinf): set yes also on OpenSolaris.
+	  [ruby-Bugs-12859]
 
-	* string.c (rb_str_split_m): show $; name in error message when it
-	  is a wrong object.
+Thu Aug 16 08:28:16 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Aug 22 16:29:52 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/rexml/encodings/{ISO-8859-15,CP-1252}.rb: fixed invalid syntax.
 
-	* lib/csv.rb (CSV#shift): store partial quoted strings in an array
-	  and join at last, to improve performance with very long quoted
-	  lines.  [ruby-core:76987] [Bug #12691]
+Thu Aug 16 08:26:08 2007  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Mon Aug 22 14:35:57 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/README: fixed a typo.
 
-	* man/irb.1: remove useless -width option.
-	  [ruby-dev:49767] [Bug #12692]
+Thu Aug 16 08:20:50 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Aug 22 09:02:56 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/extmk.rb (extmake): save all CONFIG values.
 
-	* iseq.c (Init_ISeq): undefine allocator of InstructionSequence,
-	  to get rid of segfaults at method call on uninitialized object.
+	* ext/extmk.rb (extmake): remove mkmf.log at clean, and extconf.h at
+	  distclean, respectively.
 
-Sat Aug 21 05:47:00 2016  Kenta Murata  <mrkn@mrkn.jp>
+	* ext/extmk.rb: remove rdoc at clean, and installed list file at
+	  distclean, respectively.
 
-	* enum.c (enum_sort): prevent wasteful array duplication.
+Thu Aug 16 07:58:18 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Aug 20 11:20:32 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* sprintf.c (rb_f_sprintf): should not check positional number as
+	  width.  [ruby-core:11838]
 
-	* rubystub.c: generalize win32/stub.c.
+Thu Aug 16 07:52:24 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Aug 19 11:39:06 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* dln.c (conv_to_posix_path): removed.
 
-	* parse.y (primary): allow parenthesised statement as a method
-	  argument.  [Feature #12686]
+	* ruby.c (rubylib_mangled_path, rubylib_mangled_path2): return
+	  VALUE instead of a pointer to static buffer.
 
-Fri Aug 19 09:12:45 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ruby.c (push_include_cygwin): fixed buffer overflow.
+	  [ruby-dev:31297]
 
-	* vm.c (vm_set_main_stack): TOPLEVEL_BINDING must be built.
-	  http://www.viva64.com/en/b/0414/#ID0EQ1CI  [ruby-core:76973]
+	* ruby.c (ruby_init_loadpath): not convert built-in paths.
 
-Fri Aug 19 01:00:53 2016  Yuichiro Kaneko  <yui-knk@ruby-lang.org>
+Thu Aug 16 07:51:37 2007  Akinori MUSHA  <knu@iDaemons.org>
 
-	* proc.c (mnew_missing): Remove an unused argument.
-	  After r51126 rid is not used.
+	* defines.h: Pull the RUBY_MBCHAR_MAXSIZE definition from trunk,
+	  which is necessary for dir.c to compile on djgpp and emx.
 
-Thu Aug 18 09:26:52 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+Thu Aug 16 07:42:10 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* gems/bundled_gems: bump to test-unit-3.2.1
+	* intern.h (is_ruby_native_thread): removed since declared as an int
+	  function in ruby.h already.
 
-Thu Aug 18 02:36:26 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Aug 16 07:40:41 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* tool/rbinstall.rb: skip gems which failed to build extensions.
-	  [ruby-dev:49764] [Bug #12683]
+	* file.c (rb_file_s_rename): deleted code to get rid of a bug of
+	  old Cygwin.
 
-Wed Aug 17 23:35:12 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* file.c (rb_file_truncate): added prototype of GetLastError()
+	  on cygwin.  [ruby-dev:31239]
 
-	* gems/bundled_gems (tk): bump up to 0.1.1.
+	* intern.h (is_ruby_native_thread): prototype.
 
-Wed Aug 17 23:14:42 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* missing/strftime.c (strftime): fix printf format and actual
+	  arguments.
 
-	* ext/extmk.rb: build gem extensions into separate directories
+	* ext/Win32API/Win32API.c (Win32API_initialize): ditto.
 
-	* tool/rbinstall.rb: install pre-built gem extension files gem
-	  extension directories.  [ruby-core:76931] [Bug #12681]
+	* ext/tk/tcltklib.c (ip_finalize): ditto.
 
-Tue Aug 16 21:04:30 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/dl/ptr.c (rb_dlptr_inspect): ditto.  [ruby-dev:31268]
 
-	* common.mk (UNICODE_HDR_DIR): separate unicode header files from
-	  unicode data files.  [ruby-core:76879] [Bug #12677]
+	* ext/dl/sym.c (rb_dlsym_inspect): ditto.
 
-Tue Aug 16 11:17:51 2016  Koichi ITO  <koic.ito@gmail.com>
+	* ext/socket/getnameinfo.c: include stdio.h always.
 
-	* lib/net/http/header.rb: Fix typo. [ci skip][fix GH-1407]
-	* transcode.c: ditto.
+	* ext/win32ole/win32ole.c (ole_hresult2msg, folevariable_name,
+	  folevariable_ole_type, folevariable_ole_type_detail,
+	  folevariable_value, folemethod_visible): missing return value.
 
-Tue Aug 16 11:02:31 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Aug 16 07:32:13 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* tool/make-snapshot (package): save generated header files from
-	  unicode data.  [ruby-core:76879] [Bug #12677]
+	* lib/mkmf.rb (create_makefile): make OBJS depend on RUBY_EXTCONF_H
+	  only if extconf.h is created.
 
-Mon Aug 15 20:31:34 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Aug 16 07:29:33 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* node.c (dump_array): show nd_alen field in NODE_ARRAY only in
-	  the first node.  it is nd_end in the rest nodes.
+	* {win32,wince,bcc32}/setup.mak (-version-): no RUBY_EXTERN magic.
 
-Mon Aug 15 16:41:32 2016  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+Thu Aug 16 06:43:03 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* appveyor.yml: Update libressl version to 2.3.7.
+	* lib/mkmf.rb (init_mkmf): should remove mkmf.log too.
 
-Mon Aug 15 11:46:50 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Aug 16 06:40:58 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/extmk.rb (extmake): extension libraries in gems cannot link
-	  statically.
+	* ext/openssl/ossl_config.c (ossl_config_set_section): do not
+	  initialize aggregations with dynamic values.  [ruby-talk:259306]
 
-Sun Aug 14 22:35:40 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Aug 16 06:39:19 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* id_table.c (hash_table_extend): should not shrink the table than
-	  the previous capacity.  [ruby-core:76534] [Bug #12614]
+	* eval.c (get_backtrace): check the result more.
+	  [ruby-dev:31261] [ruby-bugs-12398]
 
-Sun Aug 14 18:51:24 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Aug 16 06:32:25 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* gems/bundled_gems: add gemified tk 0.1.0.
-	  this needs `extract-gems` to build.
+	* bignum.c (rb_big_lshift, rb_big_rshift): separated functions
+	  to get rid of infinite recursion.  fixed calculation in edge
+	  cases.  [ruby-dev:31244]
 
-Sun Aug 14 14:54:14 2016  Kouhei Sutou  <kou@cozmixng.org>
+	* numeric.c (rb_fix_lshift, rb_fix_rshift): ditto.
 
-	* object.c (InitVM_Object): Update referenced document path.
+Thu Aug 16 06:26:58 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Aug 13 23:08:01 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* bignum.c (rb_big_pow): refine overflow check.  [ruby-dev:31242]
 
-	* numeric.c (num_funcall0, num_funcall1): get rid of infinite
-	  recursion in fallback methods of Numeric.
+Thu Aug 16 06:25:48 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Sat Aug 13 11:10:08 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* time.c (time_succ): Time#succ should return a time object in the
+	  same timezone mode to the original.  [ruby-talk:260256]
 
-	* parse.y (command_asgn, arg): fix syntax errors with chained
-	  assignment with op assign.  [Bug #12669]
+Thu Aug 16 06:24:39 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Sat Aug 13 10:52:19 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* numeric.c (fix_pow): integer power calculation: 0**n => 0, 
+	  1**n => 1, -1**n => 1 (n: even) / -1 (n: odd).
 
-	* parse.y (stmt, arg): rescue modifier in command op assignment
-	  should be limited to rhs only.  [ruby-core:75621] [Bug #12402]
+Thu Aug 16 06:11:34 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Sat Aug 13 07:51:40 2016  Masaki Suketa <masaki.suketa@nifty.ne.jp>
+	* lib/base64.rb (Base64::b64encode): should not specify /o option
+	  for regular expression.  [ruby-dev:31221]
 
-	* ext/win32ole/win32ole.c (ole_val2variant): fix integer conversion in
-	  cygwin64.
+Thu Aug 16 06:08:53 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Aug 12 21:05:19 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* sprintf.c (rb_f_sprintf): more checks for format argument.
+	  [ruby-core:11569], [ruby-core:11570], [ruby-core:11571],
+	  [ruby-core:11573]
 
-	* lib/webrick/config.rb (WEBrick::Config::General):
-	  disable reverse lookup by default. [ruby-core:45514] [Feature #6559]
-	  Socket.do_not_reverse_lookup is true by default but WEBrick
-	  overwrote it.
-	  patch by Eric Hodel [ruby-core:45527]
+Thu Aug 16 05:39:31 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Aug 12 12:50:31 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* bignum.c (bignorm): do not empty Bignum.  [ruby-dev:31229]
 
-	* error.c (rb_syntax_error_append): fix newline in syntax error
-	  message to the beginning, not after file name and line number.
-	  [Feature #11951]
+Thu Aug 16 05:12:05 2007  pegacorn  <subscriber.jp AT gmail.com>
 
-Thu Aug 11 16:24:23 2016  Ferdinand Niedermann  <nerdinand@nerdinand.com>
+	* ext/openssl/ossl.h: include ossl_pkcs5.h.  [ruby-dev:31231]
 
-	* compar.c (cmp_clamp): Introduce Comparable#clamp.  [Feature #10594]
+	* ext/openssl/ossl_pkcs5.h: new file for PKCS5.  [ruby-dev:31231]
 
-Thu Aug 11 03:16:59 2016  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+	* ext/openssl/ossl_x509name.c (ossl_x509name_to_s): use ossl_raise()
+	  instead of rb_raise().  [ruby-dev:31222]
 
-	* lib/prime.rb: Optimize prime?
-	  Adapted from patch by Jabari Zakiya [#12665]
+	* ext/sdbm/_sdbm.c: DOSISH platforms need io.h.  [ruby-dev:31232]
 
-	* test/test_prime.rb: Improve test
+	* ext/syck/syck.h: include stdlib.h for malloc() and free().
+	  [ruby-dev:31232]
 
-Wed Aug 10 22:37:01 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/syck/syck.h (syck_parser_set_input_type): prototype added.
+	  [ruby-dev:31231]
 
-	* parse.y (command_rhs, arg_rhs): introduce new rules to reduce
-	  repeated rules with rescue modifier.
+	* win32/win32.c: include mbstring.h for _mbspbrk().  [ruby-dev:31232]
 
-Wed Aug 10 17:26:43 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* win32.h (rb_w32_getcwd): prototype added.  [ruby-dev:31232]
 
-	* parse.y (command_asgn): rescue modifier in command assignment
-	  should be limited to rhs only.  [ruby-core:75621] [Bug #12402]
+Thu Aug 16 05:02:39 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Aug 10 15:35:03 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* bignum.c (rb_cstr_to_inum): check leading non-digits.
+	  [ruby-core:11691]
 
-	* ext/win32/resolv/resolv.c: needs windows.h for iphlpapi.h on
-	  cygwin.  [ruby-core:76791] [Bug #12663]
+Thu Aug 16 05:00:01 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* ext/win32/resolv/resolv.c (w32error_make_error): use
-	  Win32::Resolv::Error, an alias of Win32::Registry::Error.
+	* numeric.c (fix_pow): 0**2 should not raise floating point
+	  exception.  [ruby-dev:31216]
 
-Tue Aug  9 17:50:00 2016  Kenta Murata  <mrkn@mrkn.jp>
+Thu Aug 16 04:56:35 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* hash.c (rb_hash_map_v, rb_hash_map_v_bang): implement Hash#map_v and
-	  Hash#map_v! [Feature #12512] [ruby-core:76095]
+	* win32/win32.c (CreateChild): enclose command line except for
+	  command.com which can not handle quotes.  [ruby-talk:258939]
 
-	* test/ruby/test_hash.rb: add tests for above change.
+Thu Aug 16 04:54:45 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Aug  9 16:09:03 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* lib/mkmf.rb (link_command, cc_command, cpp_command): do not expand
+	  ::CONFIG which is an alias of MAKEFILE_CONFIG.
 
-	* vm_insnhelper.c (vm_getivar): use always_inline because
-	  gcc7 doesn't inline this without always_inline.
+Thu Aug 16 04:53:21 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Aug  9 15:41:24 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* struct.c (rb_struct_init_copy): disallow changing the size.
+	  [ruby-dev:31168]
 
-	* ext/tk: Tk is removed from stdlib.  [Feature #8539]
-	  https://github.com/ruby/tk is the new upstream.
+Thu Aug 16 04:52:11 2007  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-Tue Aug  9 00:12:31 2016  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+	* random.c: documentation fix.  srand(0) initializes PRNG with '0',
+	  not with random_seed.
 
-	* doc/maintainers.rdoc: Remove moved file section.
+Thu Aug 16 04:49:10 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Aug  8 20:56:46 2016  Masaki Suketa <masaki.suketa@nifty.ne.jp>
+	* bcc32/{Makefile.sub,setup.mak}: remove surplus slash from srcdir.
 
-	* ext/win32ole/sample/excel1.rb, ext/win32ole/sample/excel2.rb,
-	  ext/win32ole/sample/excel3.rb, ext/win32ole/sample/ie.rb,
-	  ext/win32ole/sample/ienavi.rb, ext/win32ole/sample/ienavi2.rb: use
-	  true instead of deprecated TRUE. [ci skip]
+Thu Aug 16 04:40:37 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Aug  8 12:51:12 2016  Zarko Todorovski <zarko@ca.ibm.com>
+	* sprintf.c (rb_f_sprintf): sign bit extension should not be done
+	  if FPLUS flag is specified.  [ruby-list:39224]
 
-	* internal.h (RBASIC_CLEAR_CLASS): Reroute ANSI C's strict
-	  aliasing rule.
-	  [ruby-core:74427][Bug #12191][ruby-core:76747][Bug #12657]
+Thu Aug 16 04:39:15 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Sun Aug  7 18:08:27 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* array.c (rb_ary_initialize): should call rb_ary_modify() first.
+	  [ruby-core:11562]
 
-	* object.c (InitVM_Object): deprecate toplevel constants TRUE,
-	  FALSE, and NIL.  [Feature #12574]
+Thu Aug 16 04:38:39 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Aug  7 06:48:21 2016  Eric Wong  <e@80x24.org>
+	* parse.y (yylex): return non-valid token for an invalid
+	  instance/class variable name.  a patch from from Yusuke ENDOH
+	  <mame AT tsg.ne.jp>.  [ruby-dev:31095]
 
-	* ext/openssl/ossl_ssl.c (ossl_ssl_write_internal):
-	  avoid undefined behavior
-	* test/openssl/test_pair.rb (test_write_zero): new test
-	  [ruby-core:76751] [Bug #12660]
+Thu Aug 16 04:36:41 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Aug  6 09:35:30 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* parse.y (dsym): return non-null NODE even if yyerror().  based on a
+	  patch from from Yusuke ENDOH <mame AT tsg.ne.jp>.  [ruby-dev:31085]
 
-	* id_table.h (rb_id_table_iterator_result): add dummy sentinel
-	  member because C standard prohibits a trailing comma.
+Thu Aug 16 04:34:56 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Aug  6 00:39:44 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* process.c (proc_exec_v, rb_proc_exec): preserve errno.
 
-	* hash.c (env_enc_str_new): make string for an environment
-	  variable name or value.
+Thu Aug 16 04:30:45 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* hash.c (env_name_new): make environment value string with the
-	  encoding for its name.
+	* variable.c (rb_path2class): get rid of dangling pointer caused by
+	  optimized out value.
 
-Fri Aug  5 23:18:35 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+Thu Aug 16 04:24:28 2007  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* hash.c (env_str_new): taint the string.  get rid of a test failure
-	  introduced at r55811.
+	* ext/dl/lib/dl/win32.rb: seems that dl doesn't accept void argument.
+	  fixed [ruby-bugs:PR#5489].
 
-Fri Aug  5 17:04:02 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Aug 16 04:23:44 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* hash.c (w32_getenv): call rb_w32_getenv and rb_w32_ugetenv via
-	  this pointer without further comparisons.
+	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser): handle more
+	  extensions.  [ruby-dev:30972]
 
-Thu Aug  4 11:54:30 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Aug 16 04:14:17 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* hash.c (env_assoc): the encoding of the value should be the
-	  locale, as well as other methods, [], fetch, values, etc.
+	* process.c (ruby_setreuid, ruby_setregid): rename to get rid of name
+	  clash.
+Thu Aug 16 04:11:17 2007  Ryan Davis  <ryand@zenspider.com>
 
-Wed Aug  3 21:31:23 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/rexml/dtd/dtd.rb: Fixed typo in code. Fixes bug #10420
 
-	* parse.y (reg_fragment_enc_error): compile_error is different
-	  between parser and ripper.  [ruby-core:76397] [Bug #12651]
+Thu Aug 16 04:08:20 2007  Shugo Maeda  <shugo@ruby-lang.org>
 
-Wed Aug  3 17:15:06 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/net/imap.rb (ResponseParser#next_token): fixed
+	  error message. (backported from HEAD)
 
-	* object.c (rb_obj_clone2): restrict freeze option to true other
-	  than false which only has the effect.  [Feature #12300]
+	* lib/net/imap.rb (ResponseParser#parse_error): fixed
+	  the condition not to refer @token.symbol unexpectedly.
+	  Thanks, Dick Monahan. (backported from HEAD)
 
-Wed Aug  3 10:47:07 2016  Koichi Sasada  <ko1@atdot.net>
+Thu Aug 16 04:05:20 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* vm_core.h: introduce VM_FRAME_RUBYFRAME_P()
-	  and VM_FRAME_CFRAME_P().
-	  Most of case, RUBY_VM_NORMAL_ISEQ_P() is no
-	  longer needed.
+	* marshal.c (w_extended): erroneous check condition when dump
+	  method is defined.  [ruby-core:10646]
 
-	* vm_core.h: introduce rb_obj_is_iseq().
+Sat Jun  9 10:40:00 2007  URABE Shyouhei  <shyouhei@ruby-lang.org>
 
-	* cont.c, vm.c: VM_FRAME_MAGIC_DUMMY with
-	  VM_FRAME_FLAG_CFRAME.
+	* stable version 1.8.5-p52 released.
 
-Wed Aug  3 09:25:16 2016  Koichi Sasada  <ko1@atdot.net>
+Thu Jun  7 14:53:46 2007  URABE Shyouhei  <shyouhei@ruby-lang.org>
 
-	* vm_core.h: rename macros and make them inline functions.
+	* eval.c (method_inspect): show proper class name.
+	  [ruby-talk:248647], Thanks Calamitas.
 
-	  * rename VM_FRAME_TYPE_FINISH_P() to VM_FRAME_FINISHED_P().
-	  * rename VM_FRAME_TYPE_BMETHOD_P() to VM_FRAME_BMETHOD_P().
+Mon May 28 19:37:24 2007  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Wed Aug 03 09:15:02 2016  Koichi Sasada  <ko1@atdot.net>
+	* win32/win32.c (move_to_next_entry): revert r12338. not necessary
+	  on ruby_1_8_5.
 
-	* vm_core.h: introduce VM_FRAME_FLAG_CFRAME to represent cfp->iseq
-	  type.
+Sun May 27 05:52:37 2007  URABE Shyouhei  <shyouhei@ruby-lang.org>
 
-Tue Aug  2 21:42:40 2016  Chia-sheng Chen  <qitar888@gmail.com>
+	* eval.c (mnew): call of super via a method object should work again.
+	  [ruby-talk:248647], Thanks Calamitas.
 
-	* math.c (tanh): make faster by the extract form if three
-	  hyperbolic functions are unavailable.  [Feature #12647]
+	* test/ruby/test_method.rb (TestMethod::test_method_super): test for
+	  above fix.
 
-Tue Aug  2 12:37:00 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed May 23 06:51:46 2007  URABE Shyouhei  <shyouhei@ruby-lang.org>
 
-	* ext/socket/option.c, ext/socket/rubysocket.h (inet_ntop): share
-	  the fallback definition.  [ruby-core:76646] [Bug #12645]
+	* lib/cgi.rb (CGI#[]): get rid of exceptions being raised.
+	  [ruby-dev:30740], Thanks Kentaro KAWAMOTO.
 
-Tue Aug  2 04:07:29 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+Wed May 23 06:14:15 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* win32/win32.c (set_pioinfo_extra): use more reliable way to search
-	  the position of pioinfo of VC14, and also support debug library of it.
-	  patched by davispuh AT gmail.com
-	  [ruby-core:76644] [Bug #12644]
-	  this fixes also [Bug #12631]
+	* win32/win32.c (move_to_next_entry): loc also must move forward.
+	  [ruby-talk:251987]
 
-Mon Aug  1 21:39:52 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed May 23 05:55:04 2007  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/extmk.rb: [EXPERIMENTAL] build extension libraries in
-	  extracted gems.
+	* win32/win32.c (init_stdhandle): stderr should be without buffering,
+	  but mswin32 use buffering when stderr is not connected to tty.
 
-Mon Aug  1 16:07:18 2016  URABE Shyouhei  <shyouhei@ruby-lang.org>
+Wed May 23 03:33:55 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* include/ruby/ruby.h (struct RStruct): no longer.
+	* lib/monitor.rb (ConditionVariable#wait, mon_enter, mon_exit_for_cond):
+	  ensures Thread.critical to be false.  [ruby-talk:248300]
 
-	* internal.h (struct RStruct): moved here.
+Wed May 23 03:25:13 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* struct.c (rb_struct_ptr): a compensation function for the lack
-	  of RSTRUCT_PTR.  But now that we have RSTRUCT_GET/SET, that must
-	  not be used anyway.  I mark this deprecated.  Dont use it.
+	* util.c (ruby_strtod): exponent is radix 10.  [ruby-talk:248272]
 
-Mon Aug  1 14:50:06 2016  Jeremy Evans <code@jeremyevans.net>
+Wed May 23 02:09:32 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* object.c (rb_obj_clone2): Allow Object#clone to take freeze:
-	  false keyword argument to not freeze the clone.
-	  [ruby-core:75017][Feature #12300]
+	* eval.c (rb_yield_0): should not clear state on TAG_NEXT when
+	  it's invoked from within lambda body.  [ruby-talk:248136]
 
-	* test/ruby/test_object.rb (TestObject): test for it.
+	* eval.c (proc_invoke): handle TAG_NEXT which would be caused by
+	  next in the lambda body as well.
 
-Mon Aug  1 12:16:19 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+Wed May 23 01:55:49 2007  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/json/*, test/json/json_parser_test.rb: Update json-2.0.2.
+	* win32/win32.c (rb_w32_fclose, rb_w32_close): need to save errno
+	  before calling original fclose()/close().
 
-Sun Jul 31 16:17:23 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed May 23 01:42:29 2007  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* ext/win32/resolv/resolv.c (get_dns_server_list): [Win32] get DNS
-	  servers only for connected network devices by GetNetworkParams
-	  API.  [Bug #12604]
+	* lib/net/imap.rb (disconnect): call shutdown for
+	  SSLSocket. Thanks, Technorama Ltd.
 
-Sat Jul 30 12:13:26 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Wed May 23 01:28:14 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* string.c (String#downcase), NEWS: Mentioned that case mapping for all
-	  of ISO-8859-1~16 is now supported. [ci skip]
+	* error.c (rb_notimplement), io.c (pipe_open): removed definite
+	  articles and UNIX manual section from messages.  [ruby-dev:30690]
 
-Sat Jul 30 12:00:01 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* io.c (pipe_open): raise NotImplementedError for command "-" on
+	  platforms where fork(2) is not available.  [ruby-dev:30681]
 
-	* enc/iso_8859_2.c, test/ruby/enc/test_case_comprehensive.rb:
-	  Implement non-ASCII case conversion for ISO-8859-2, by Yushiro Ishii.
+Wed May 23 00:06:19 2007  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Fri Jul 29 20:57:12 2016  chuanshuo  <lilijreey@126.com>
+	* ext/socket/socket.c (s_recv, s_recvfrom): some systems (such as
+	  windows) doesn't set fromlen if the socket is connection-oriented.
+	  reported by Bram Whillock in [ruby-core:10512] [ruby-Bugs#9061]
 
-	* *.c: rename rb_funcall2 to rb_funcallv, except for extensions
-	  which are/will be/may be gems.  [Fix GH-1406]
+Tue Mar 20 15:37:24 2007  URABE Shyouhei  <shyouhei@ruby-lang.org>
 
-Fri Jul 29 10:51:34 2016  Koichi Sasada  <ko1@atdot.net>
+	* distruby.rb: Add zip generation.
 
-	* proc.c (env_write): remove unused function.
+Fri Mar 16 21:48:11 2007  Akinori MUSHA  <knu@iDaemons.org>
 
-Fri Jul 29 10:49:52 2016  Koichi Sasada  <ko1@atdot.net>
+	* ext/dl/dl.c (rb_ary2cary): Fix a bug in type validation;
+	  submitted by sheepman <sheepman AT sheepman.sakura.ne.jp>
+	  in [ruby-dev:30554].
 
-	* vm_core.h (VM_LOCAL_P): should return an integer value.
-	  reported at
-	  http://d.hatena.ne.jp/nagachika/20160728/ruby_trunk_changes_55764_55770
+Fri Mar 16 18:28:06 2007  Akinori MUSHA  <knu@iDaemons.org>
 
-Fri Jul 29 04:23:08 2016  Koichi Sasada  <ko1@atdot.net>
+	* ext/etc/etc.c (etc_getgrgid): Fix a bug in Etc::getgrgid()
+	  always returning the (real) group entry of the running process;
+	  reported by: UEDA Hiroyuki <ueda AT netforest.ad.jp>
+	  in [ruby-dev:30586].
 
-	* vm_core.h (VM_ENV_LOCAL_P): return truthy (0 or not) value.
+Wed Mar 14 12:30:00 2007  Shigeo Kobayashi  <shigeo@tinyforest.jp>
 
-	* vm.c (rb_vm_make_proc_lambda): use VM_ENV_ESCAPED_P() macro.
+	* ext/bigdecimal/bigdecimal.c: BigDecimal("-.31") is now
+	  treated as ("-0.31") not as ("0.31").
 
-Fri Jul 29 03:49:04 2016  Koichi Sasada  <ko1@atdot.net>
+Fri Mar 16 18:05:40 2007  Akinori MUSHA  <knu@iDaemons.org>
 
-	* vm.c, internal.h: remove RubyVM::Env class and all of env objects
-	  are imemo objects (imemo_env).
+	* lib/cgi.rb (CGI::header): IIS >= 5.0 does not need the nph
+	  assumption any more; submitted by MIYASAKA Masaru <alkaid AT
+	  coral.ocn.ne.jp> in [ruby-dev:30537].
 
-	* NEWS: describe this change. I believe nobody touch these objects
-	  because there are no method defined.
+Tue Mar 13 17:29:43 2007  URABE Shyouhei  <shyouhei@ruby-lang.org>
 
-	* vm_core.h: remove the following definitions.
-	  * rb_cEnv decl.
-	  * GetEnvPtr() because Env is no longer T_DATA object.
+	* stable version 1.8.5-p35 released.
 
-	* vm_core.h (rb_env_t): fix layout for imemo values.
+Tue Mar 13 14:42:10 2007  URABE Shyouhei  <shyouhei@ruby-lang.org>
 
-	* vm_core.h (vm_assert_env): added.
+	* test/fileutils/fileasserts.rb: Fix wrong error message.
 
-	* vm_core.h (vm_env_new): added.
+	* lib/fileutils.rb (FileUtils::mv): Type Error; should utilize
+	  Strings instead of Symbols here.
 
-Thu Jul 28 19:53:21 2016  Koichi Sasada  <ko1@atdot.net>
+Mon Mar 12 17:22:44 2007  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* vm_core.h: revisit the structure of frame, block and env.
-	  [Bug #12628]
+	* lib/fileutils.rb (FileUtils::mv): fix incomplete backport of
+	  FileUtils.mv changes at r11988
 
-	  This patch introduce many changes.
+Mon Mar 12 16:09:28 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	  * Introduce concept of "Block Handler (BH)" to represent
-	    passed blocks.
+	* mkconfig.rb (patchlevel): read from version.h.
 
-	  * move rb_control_frame_t::flag to ep[0] (as a special local
-	    variable). This flags represents not only frame type, but also
-	    env flags such as escaped.
+Sun Mar 11 18:57:50 2007  Akinori MUSHA  <knu@iDaemons.org>
 
-	  * rename `rb_block_t` to `struct rb_block`.
+	* misc/README: Add a note about ruby-electric.el. 
 
-	  * Make Proc, Binding and RubyVM::Env objects wb-protected.
+	* misc/ruby-mode.el (ruby-non-block-do-re): Fix
+	  ruby-non-block-do-re. [ruby-core:03719]
 
-	  Check [Bug #12628] for more details.
+	* misc/inf-ruby.el: Synchronize the comment section with trunk.
 
-Thu Jul 28 15:05:12 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* misc/README, misc/rdebug.el: Add rdebug.el, Emacs ruby-debug
+	  interface based on rubydb3x.el; submitted by Martin Nordholts
+	  <enselic AT gmail.com> in [ruby-bugs:PR#9023].
 
-	* include/ruby/ruby.h (ruby_fl_type): use __extension__ to get rid
-	  of pedantic warning against RUBY_FL_USER19.
-	  https://github.com/skylightio/skylight-ruby/issues/64
+Sun Mar 11 17:45:51 2007  Akinori MUSHA  <knu@iDaemons.org>
 
-	* include/ruby/ruby.h (rb_mul_size_overflow): ditto for use of
-	  int128.
+	* ext/dl/mkcallback.rb (mkfunc): Make sure that a callback
+	  function is found in the function table before trying to call
+	  it; submitted by sheepman <sheepman AT sheepman.sakura.ne.jp>
+	  in [ruby-dev:30524].
 
-Wed Jul 27 10:32:59 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Tue Mar  6 18:58:37 2007  Keiju Ishitsuka  <keiju@ruby-lang.org>
+	
+	* lib/shell/process-controller.rb: fix thread synchronization
+	  problem for [ruby-dev:30477].
+	
+Sun Mar  4 23:53:27 2007  Minero Aoki  <aamine@loveruby.net>
 
-	* enc/windows_1253.c: Remove dead code found by Coverity Scan.
+	* lib/fileutils.rb (mv): could not move a directory between
+	  different filesystems. [ruby-dev:30411]
 
-Tue Jul 26 22:43:36 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Mar  3 21:41:31 2007  Akinori MUSHA  <knu@iDaemons.org>
 
-	* gc.c (run_finalizer): make saved running finalizer state
-	  volatile to ensure not to be clobbered by longjmp.
+	* eval.c (stack_check): Unset inline to fix build with GCC 3.4.6;
+	  submitted by: NISHIMATSU Takeshi <t_nissie AT yahoo.co.jp> in
+	  [ruby-list:43218].
+	  cf. http://gcc.gnu.org/bugzilla/show_bug.cgi?id=24556
 
-Tue Jul 26 19:26:00 2016  Koichi Sasada  <ko1@atdot.net>
+Sat Mar  3 16:30:39 2007  Akinori MUSHA  <knu@iDaemons.org>
 
-	* vm_insnhelper.c: introduce rb_vm_pop_frame() and use it
-	  instead of setting rb_thread_t::cfp directly.
+	* env.h (SCOPE_CLONE): Introduce a new scope flag to prevent a
+	  local_tbl region from getting freed many times; submitted by
+	  Chikanaga Tomoyuki <chikanag AT nippon-control-system.co.jp> in
+	  [ruby-dev:30460].
 
-	* vm_insnhelper.c (vm_pop_frame): return the result of
-	  finish frame or not.
+	* eval.c (proc_invoke): Ditto.
 
-Tue Jul 26 19:06:39 2016  Koichi Sasada  <ko1@atdot.net>
+	* gc.c (obj_free): Ditto.
 
-	* gc.c (rb_raw_obj_info): support to show Proc obj.
+	* parse.y (top_local_setup_gen): Ditto.
 
-Tue Jul 26 18:55:55 2016  Koichi Sasada  <ko1@atdot.net>
+Sat Mar  3 15:41:33 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* gc.c (gc_mark): add `inline' explicitly.
-	  I expected to inline this function implicitly at the loop
-	  (ex: marking T_ARRAY objects) but sometimes it remains as
-	  normal call.
+	* parse.y (stmt, arg): should not omit lhs of OP_ASGN1 even if
+	  empty.  [ruby-dev:30452]
 
-Tue Jul 26 16:33:16 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Wed Feb 28 20:51:32 2007  URABE Shyouhei  <shyouhei@ruby-lang.org>
 
-	* enc/windows_1257.c, test/ruby/enc/test_case_comprehensive.rb:
-	  Implement non-ASCII case conversion for Windows-1257, by Sho Koike.
+	* pack.c (pack_unpack): properly ignore non-base64 octets such as
+	  UTF-8 encoded BOMs; submitted by SOUMA Yutaka <holon@radastery.jp>
+	  to fix [ruby-core:10437]
 
-Tue Jul 26 16:19:41 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Wed Feb 28 00:08:11 2007  URABE Shyouhei  <shyouhei@ice.uec.ac.jp>
 
-	* enc/windows_1250.c, test/ruby/enc/test_case_comprehensive.rb:
-	  Implement non-ASCII case conversion for Windows-1250, by Sho Koike.
+	* mkconfig.rb (RbConfig): add CONFIG['PATCHLEVEL']
 
-	* ChangeLog: Fixed order of previous two entries.
+	* common.mk: new target dist
 
-Tue Jul 26 15:54:17 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* distruby.rb: new file
 
-	* enc/windows_1253.c, test/ruby/enc/test_case_comprehensive.rb:
-	  Implement non-ASCII case conversion for Windows-1253, by Takumi Koyama.
+Tue Feb 27 21:19:35 2007  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Tue Jul 26 15:30:37 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* win32/win32.c (set_pioinfo_extra): new function for VC++8 SP1
+	  workaround. [ruby-core:10259]
 
-	* enc/windows_1251.c, test/ruby/enc/test_case_comprehensive.rb:
-	  Implement non-ASCII case conversion for Windows-1251, by Shunsuke Sato.
+	* win32/win32.c (NtInitialize): call above function.
 
-Tue Jul 26 13:04:59 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Mon Feb 26 09:57:58 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* test/ruby/enc/test_case_comprehensive.rb: Add explicit skip test for
-	  availability of Unicode data files.
+	* signal.c (ruby_signal): don't set SA_RESTART.  a backport from
+	  the HEAD.  [ruby-talk:220937]  [ruby-talk:147220]
 
-Mon Jul 25 21:33:13 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Feb 13 02:21:12 2007  Sam Roberts  <sroberts@uniserve.com>
 
-	* range.c (check_step_domain): check step argument domain by <=>
-	  method, instead of < and >.
+	* io.c (rb_f_syscall): Fix buffer overflow with syscall
+	  arguments.  [ruby-bugs:PR#8541]
 
-Mon Jul 25 21:11:32 2016  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+Sat Feb 10 09:33:47 2007  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
 
-	* doc/maintainers.rdoc: fix filenames.
+	* ext/win32ole/win32ole.c (ole_variant2val): sorry, fix the enbug.
 
-Mon Jul 25 16:59:00 2016  Koichi Sasada  <ko1@atdot.net>
+Sat Feb 10 09:08:01 2007  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
 
-	* debug.c (ruby_debug_printf): use rb_raw_obj_info()
-	  instead of rb_inspect() because it is more robust way
-	  to see object internal.
+	* ext/win32ole/win32ole.c (ole_variant2val): fix compile error
+	  on VC++.
 
-Sun Jul 24 16:33:13 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Sat Feb 10 08:38:30 2007  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
 
-	* regenc.h/c, include/ruby/oniguruma.h, enc/ascii.c, big5.c, cp949.c,
-	  emacs_mule.c, euc_jp.c, euc_kr.c, euc_tw.c, gb18030.c, gbk.c,
-	  iso_8859_1|2|3|4|5|6|7|8|9|10|11|13|14|15|16.c, koi8_r.c, koi8_u.c,
-	  shift_jis.c, unicode.c, us_ascii.c, utf_16|32be|le.c, utf_8.c,
-	  windows_1250|51|52|53|54|57.c, windows_31j.c, unicode.c:
-	  Remove conditional compilation macro ONIG_CASE_MAPPING. [Feature #12386].
+	* ext/win32ole/win32ole.c (ole_variant2val): fix the bug when
+	  SAFEARRAY pointer is NULL.
 
-Sun Jul 24 12:53:42 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+Tue Feb  6 20:41:39 2007  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* doc/maintainers.rdoc: xmlrpc is bundled gem from Ruby 2.4.
+	* string.c (rb_str_sub_bang): calling rb_str_modify() should be just
+	  before actually modifying the string.
+	  fixed: [ruby-dev:30211] (originally reported by zunda)
 
-Sun Jul 24 12:07:39 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+Sat Jan 27 15:20:11 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* doc/maintainers.rdoc: Update OpenSSL maintainer.
+	* parse.y (dyna_var_lookup): should not alter dvar->val not to
+	  destroy living value.  [ruby-core:10076]
 
-Sat Jul 23 22:43:41 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* parse.y (dyna_init): ditto.
 
-	* internal.h (Check_Type): inline check for the object type.
+Wed Jan 24 18:05:39 2007  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Sat Jul 23 04:06:04 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* misc/ruby-mode.el (ruby-font-lock-syntactic-keywords): fix
+	  regexp font-lock bug.  [ruby-talk:235758]
 
-	* include/ruby/ruby.h (RTEST, NIL_P): use RUBY prefixed name in
-	  macros.
+Sun Jan 14 07:26:44 2007  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
 
-Sat Jul 23 01:41:29 2016  Eric Wong  <e@80x24.org>
+	* ext/win32ole/win32ole.c (ole_free, ole_type_free, 
+	  olemethod_free, olevariable_free, oleparam_free, 
+	  ole_event_free): fix memory leak.  [ruby-core:09846]
 
-	* lib/webrick/httpservlet/cgihandler.rb (do_GET): delete HTTP_PROXY
-	* test/webrick/test_cgi.rb (test_cgi_env): new test
-	* test/webrick/webrick.cgi (do_GET): new endpoint to dump env
-	  [ruby-core:76511] [Bug #12610]
+Tue Jan  9 12:29:20 2007  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Jul 22 19:55:20 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/etc/etc.c (etc_getpwuid, etc_getgrgid): fix to correctly
+	  convert uid/gid from VALUE.
 
-	* vm.c (vm_set_main_stack): remove unnecessary check.  toplevel
-	  binding must be initialized.  [Bug #12611] (N1)
+	* ext/etc/etc.c (etc_getpwuid): ditto.
 
-	* win32/win32.c (w32_symlink): fix return type.  [Bug #12611] (N3)
+Mon Dec 25 20:08:28 2006  URABE Shyouhei  <shyouhei@ruby-lang.org>
 
-	* string.c (rb_str_split_m): simplify the condition.
-	  [Bug #12611](N4)
+	* ext/openssl/ossl.h: fixed compilation problem on gcc 3.2.
+	  [ruby-talk:214786]
 
-Fri Jul 22 17:13:37 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Mon Dec 25 10:40:40 2006  URABE Shyouhei  <shyouhei@ruby-lang.org>
 
-	* string.c (String#dump): Change escaping of non-ASCII characters in
-	  UTF-8 to use upper-case four-digit hexadecimal escapes without braces
-	  where possible [Feature #12419].
+	* stable version 1.8.5-p12 released.
 
-	* test/ruby/test_string.rb (test_dump): Add tests for above.
+Sat Dec 16 04:02:10 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-Fri Jul 22 10:35:35 2016  Kouhei Sutou  <kou@cozmixng.org>
+	* ext/tk/tcltklib.c: shouldn't run the killed thread at callback.
+	  [ruby-talk: 227408]
 
-	* lib/rexml/attribute.rb (REXML::Attribute#to_string): Fix wrong
-	  entry reference name of double quote.
-	  [Bug #12609][ruby-core:76509]
-	  Patch by Joseph Marrero. Thanks!!!
+Fri Dec 15 17:21:14 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Fri Jul 22 10:32:13 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* lib/rdoc/ri/ri_options.rb: prevent NameError.  [ruby-dev:29597]
 
-	* template/unicode_norm_gen.tmpl: Remove
-	  UnicodeNormalize::UNICODE_VERSION at origin [Feature #12546].
+Thu Dec 14 23:37:38 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Jul 22 09:23:51 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* dir.c (glob_helper): get rid of possible memory leak.
 
-	* LEGAL: Added entries for files under the USD license.
-	  [Bug #12598][ruby-core:76428][ci skip]
+	* win32/win32.c (cmdglob, rb_w32_cmdvector, rb_w32_opendir,
+	  rb_w32_get_environ): not to use GC before initialization.
 
-Fri Jul 22 09:19:57 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+Wed Dec  6 19:53:41 2006  WATANABE Hirofumi  <eban@ruby-lang.org>
 
-	* LEGAL: Added entry for `lib/rdoc/generator/template/darkfish/css/fonts.css`
-	  [Misc #12550][ruby-core:76255][ci skip]
+	* configure.in (SITE_DIR): fixed to emtpy RUBY_SITE_LIB in config.h on
+	  NetBSD.  fixed: [ruby-dev:29358]
 
-Fri Jul 22 06:28:32 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon Dec  4 10:43:46 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* gc.c (run_finalizer): push and exec tag just once, instead of
-	  protecting for each finalizer.
+	* parse.y (dyna_init_gen): dvar initialization only if dvar is
+	  assigned inner block.  [ruby-talk:227402]
 
-	* gc.c (gc_start_internal, rb_gc_start): set finalizing flag
-	  whenever calling deferred finalizers not to recurse.
+Mon Dec  4 10:22:26 2006  URABE Shyouhei  <shyouhei@ice.uec.ac.jp>
 
-Thu Jul 21 22:26:40 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* stable version 1.8.5-p2 released.
 
-	* missing/strl{cat,cpy}.c: Update latest upstream files.
-	  [Misc #12205][ruby-core:74487]
-	* LEGAL: Update license for missing/strl{cat,cpy}.c.
+Sun Dec  3 17:11:12 2006  Shugo Maeda  <shugo@ruby-lang.org>
 
-Thu Jul 21 21:53:30 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* lib/cgi.rb (CGI::QueryExtension::read_multipart): should quote
+	  boundary. JVN#84798830
 
-	* LEGAL: added file list with Public domain license.
-	  [ruby-core:76254][Bug #12549]
+Sun Nov 26 16:36:46 2006  URABE Shyouhei  <shyouhei@ruby-lang.org>
 
-Wed Jul 20 17:44:07 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* version.h: addition of RUBY_PATCHLEVEL.
+	* version.c: ditto.
 
-	* enumerator.c (lazy_uniq): new method Enumerator::Lazy#uniq.
-	  [Feature #11090]
+Fri Nov 24 10:17:51 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* enum.c (enum_uniq): new method Enumerable#uniq.
-	  [Feature #11090]
+	* bignum.c (bignorm): avoid segmentation.  a patch from Hiroyuki
+	  Ito <ZXB01226@nifty.com>.  [ruby-list:43012]
 
-Wed Jul 20 17:35:23 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Nov  2 15:43:39 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* hash.c (rb_hash_add_new_element): add new element or do nothing
-	  if it is contained already.
+	* parse.y (primary): should set NODE even when compstmt is NULL.
+	  merge from trunk. fixed: [ruby-dev:29732]
 
-	* array.c (ary_add_hash, ary_add_hash_by): use
-	  rb_hash_add_new_element.
+Sat Sep 23 21:34:15 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Tue Jul 19 18:21:17 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* lib/cgi.rb (CGI::QueryExtension::read_multipart): CGI content
+	  may be empty.  a patch from Jamis Buck <jamis at 37signals.com>.
 
-	* lib/unicode_normalize/tables.rb: Remove
-	  UnicodeNormalize::UNICODE_VERSION (#12546).
+Mon Sep  4 21:43:57 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Jul 19 15:38:59 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/dbm/extconf.rb: create makefile according to the result of check
+	  for dbm header.  fixed: [ruby-dev:29445]
 
-	* variable.c (rb_local_constants_i): exclude private constants
-	  when excluding inherited constants too.  [Bug #12345]
+Tue Aug 29 19:10:10 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Jul 17 23:42:00 2016  Kenta Murata  <mrkn@mrkn.jp>
+	* hash.c (rb_hash_s_create): fixed memory leak, based on the patch
+	  by Kent Sibilev <ksruby at gmail.com>.  fixed: [ruby-talk:211233]
 
-	* numeric.c (num_finite_p, num_infinite_p): Add Numeric#finite? and
-	  Numeric#infinite?  [Feature #12039] [ruby-core:73618]
+Fri Aug 25 17:15:17 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* complex.c (rb_complex_finite_p): Add Complex#finite?
+	* stable version 1.8.5 released.
 
-	* complex.c (rb_complex_infinite_p): Add Complex#infinite?
+Fri Aug 25 17:02:06 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* test/ruby/test_bignum.rb: Add test for Integer#finite? and
-	  Integer#infinite?
+	* gc.c (gc_sweep): typo fixed.
 
-	* test/ruby/test_fixnum.rb: ditto.
+Tue Aug 22 18:47:51 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* test/ruby/test_rational.rb: Add test for Rational#finite? and
-	  Rational#infinite?
+	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::handle_method):
+	  rdoc documents C module methods as instance methods. a patch in
+	  [ruby-core:08536]. 
 
-	* test/ruby/test_complex.rb: Add test for Complex#finite? and
-	  Complex#infinite?
+Sat Aug 19 14:15:02 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Sun Jul 17 20:59:24 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* win32/Makefile.sub (config.status): include winsock2.h instead of
+	  winsock.h when --with-winsock2 is specified.
+	  fixed: [ruby-dev:29296]
 
-	* common.mk, enc/depend (casefold.h, name2ctype.h): move to
-	  unicode data directory per version.
+Sat Aug 19 11:28:08 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Jul 16 06:26:00 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* file.c (rb_file_s_rename): use errno if set properly.
+	  fixed: [ruby-dev:29293]
 
-	* common.mk, enc/Makefile.in: moved timestamp files for
-	  directories under the specific directory, to get rid of match
-	  with files under the source directory.
+Sat Aug 19 11:09:23 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Fri Jul 15 22:05:13 2016  Naohisa Goto  <ngotogenome@gmail.com>
+	* parse.y (then): remove semicolon warning.  [ruby-dev:29299]
 
-	* string.c (str_buf_cat): Fix potential integer overflow of capa.
-	  In addition, termlen is used instead of +1.
+Thu Aug 17 19:15:16 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Jul 15 21:30:38 2016  Naohisa Goto  <ngotogenome@gmail.com>
+	* file.c (rb_stat_[rRwWxX]): check for super user.
+	  fixed: [ruby-core:08616]
 
-	* string.c (str_buf_cat): Fix capa size for embed string.
-	  Fix bug in r55547. [Bug #12536]
+Thu Aug 17 14:47:06 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Jul 15 18:13:15 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* lib/mkmf.rb: added rdoc by Daniel Berger.  [ruby-core:08177]
 
-	* gems/bundled_gems: update latest gems.
+Thu Aug 17 00:39:05 2006  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
 
-Fri Jul 15 17:08:57 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/rinda/ring.rb (do_reply): Fix for RingServer fails to find a
+	  TupleSpace when TupleSpace resides in the same ruby process with
+	  RingServer. a patch from Kent Sibilev. [ruby-core:08453]
 
-	* util.c (ruby_strtod): do not underflow only by preceding zeros,
-	  which may be canceled out by the exponent.
-	  http://twitter.com/kazuho/status/753829998767714305
+Wed Aug 16 11:45:36 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Jul 15 09:53:48 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* process.c (proc_setuid, proc_setgid, proc_seteuid, proc_setegid):
+	  get rid of bogus implementations on Mac OS X.
 
-	* enc/unicode/case-folding.rb, tool/enc-unicode.rb: check if
-	  Unicode versions are consistent with each other.
+Tue Aug 15 19:10:18 2006  Eric Hodel  <drbrain@segment7.net>
 
-Fri Jul 15 08:25:15 2016  Jeremy Evans <code@jeremyevans.net>
+	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser#find_class_comment): Fix
+	  broken class-level documentation.
 
-	* string.c (STR_BUF_MIN_SIZE): reduce from 128 to 127
-	  [ruby-core:76371] [Feature #12025]
-	* string.c (rb_str_buf_new): adjust for above reduction
+Wed Aug 16 11:09:26 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Jul 14 17:26:00 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ruby.c (set_arg0): fill argv other than the first with an empty
+	  string instead of NULL.
 
-	* Makefile.in (enc/unicode/name2ctype.h): remove stale recipe,
-	  which did not support Unicode age properties.
+Wed Aug 16 11:08:00 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* common.mk (enc/unicode/name2ctype.h): update by --header option
-	  of tool/enc-unicode.rb.  enc/unicode/name2ctype.kwd file has not
-	  been used.
+	* win32/win32.h: removed an excess macro.  fixed: [ruby-dev:29258]
 
-	* common.mk (enc/unicode/name2ctype.kwd): rule to create from
-	  Unicode data files, used only when the target does not exist.
+Tue Aug  8 23:49:06 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Thu Jul 14 13:10:54 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/irb/extend-command.rb (IRB::ExtendCommandBundle): pacify
+	  RDoc.  a patch from Eric Hodel <drbrain at segment7.net>.
+	  [ruby-core:08522]
 
-	* ext/json/lib/json/ext: remove stale directory.  bundled
-	  extension libraries are placed under the directory for each
-	  architectures, but not mixed with plain text script libraries.
+Tue Aug  8 11:32:54 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Thu Jul 14 12:48:47 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* Makefile.in, common.mk, configure.in: fix for platforms without
+	  rm. patches from Yutaka kanemoto <kinpoco at gmail.com>.
+	  [ruby-dev:29215]
 
-	* ext/json/**/*.rb: merge original files from upstream repository.
-	  It only fixes styles of frozen string literal.
+Mon Aug  7 17:56:59 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Wed Jul 13 22:23:03 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* ext/bigdecimal/bigdecimal.c, ext/digest/rmd160/rmd160ossl.c,
+	  ext/digest/sha1/sha1ossl.c, ext/readline/readline.c: move
+	  incluion of config.h to pacify AIX.  a patch from Yutaka
+	  Kanemoto <kinpoco at gmail.com>.  [ruby-dev:29197]
 
-	* test/json/json_common_interface_test.rb: use assert_raise instead of
-	  assert_raises.
+Mon Aug  7 15:55:08 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Wed Jul 13 22:14:23 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* ext/syck/syck.c (syck_move_tokens): should avoid negative
+	  memmove.  [ruby-list:42625]
 
-	* test/lib/test/unit.rb: added test files with `_test` suffix for json
-	  upstream.
-	* test/json: merge original test files from json upstream.
+Mon Aug  7 14:37:48 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Wed Jul 13 18:09:42 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* configure.in, common.mk: AIX link issue.  a patch from Yutaka
+	  Kanemoto <kinpoco at gmail.com>.  [ruby-dev:29190]
 
-	* enc/iso_8859_9.c, test/ruby/enc/test_case_comprehensive.rb:
-	  Implement non-ASCII case conversion for ISO-8859-9, by Kazuki Iijima.
+	* ext/socket/socket.c: AIX socket support.  [ruby-dev:29190]
 
-	* enc/iso_8859_9.c: Exclude dotless i/I with dot from case-insensitive
-	  matching because they are not a case pair.
+Mon Aug  7 12:05:28 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* test/ruby/enc/test_iso_8859.rb: Make test coverage for ISO-8859-9
-	  a bit more complete.
+	* dln.c, eval.c, gc.c, regex.c, ruby.h: shut up AIX alloca
+	  warning.  a patch from Yutaka Kanemoto <kinpoco at gmail.com>.
+	  [ruby-dev:29191]
 
-Wed Jul 13 17:21:24 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Sun Aug  6 20:40:41 2006  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* enc/windows_1252.c, test/ruby/enc/test_case_comprehensive.rb:
-	  Implement non-ASCII case conversion for Windows-1252, by Serina Tai.
+	* lib/date/format.rb (str[fp]time): %[EO]U didn't denote %U.
 
-	* test/ruby/enc/test_case_comprehensive.rb: Fix order of encodings.
+Sat Aug  5 17:07:43 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Wed Jul 13 16:19:14 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* parse.y (top_local_setup): local_vars[-1] should point
+	  ruby_scope itself to protect local_tbl from garbage collection.
+	  [ruby-dev:29049]
 
-	* enc/iso_8859_7.c, test/ruby/enc/test_case_comprehensive.rb:
-	  Implement non-ASCII case conversion for ISO-8859-7, by Kosuke Kurihara.
+Sat Aug  5 13:54:03 2006  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* test/ruby/enc/test_case_comprehensive.rb: Fix order of encodings.
+	* lib/date/format.rb (str[fp]time): "%\n" means "\n".
 
-Wed Jul 13 16:08:08 2016  Koichi Sasada  <ko1@atdot.net>
+Fri Aug  4 15:21:00 2006  Eric Hodel  <drbrain@segment7.net>
 
-	* gc.c (gc_mark_roots): should mark the VM object itself to mark
-	  singleton class of the VM object.
-	  Before this patch, we only set mark bit for the VM object and
-	  invoke mark function separately.
-	  [Bug #12583]
+	* lib: Merge RDoc and .document from HEAD.
+	* lib/drb/ssl.rb: Close socket on SSLError [ruby-core:7197]
 
-	* test/ruby/test_gc.rb: add a test.
+Fri Aug  4 19:13:41 2006  Keiju Ishitsuka  <keiju@ruby-lang.org>
 
-Wed Jul 13 15:59:59 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* lib/irb/{init.rb,ruby-lex.rb,slex.rb}: can't input '\c' for
+	  [ruby-core: 7122].
 
-	* math.c (_USE_MATH_DEFINES): it must be set before including internal.h
-	  because internal.h includes ruby.h, ruby.h includes win32.h, and
-	  win32.h includes system's math.h.
-	  this change is to get rid of a compiler warning (redefinition of
-	  a macro) introduced at r55641.
+Fri Aug  4 14:02:14 2006  James Edward Gray II  <james@grayproductions.net>
 
-Wed Jul 13 15:19:03 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* lib/date/format.rb (__strptime, strftime): allow multi-line patterns
+	  in Date#strftime the same as Time#strftime accepts.
+	  fixed: [ruby-core:08466]
 
-	* enc/iso_8859_1.c, enc/iso_8859_4.c: Avoid setting modification flag if
-	  there is no modification.
+Fri Aug  4 13:56:51 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Jul 13 14:40:04 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* pack.c (pack_pack): check argument overrun for 'P'.  based on a
+	  patch by rucila <rucila at yahoo.cojp>.  fixed: [ruby-dev:29182]
 
-	* enc/iso_8859_5.c, test/ruby/enc/test_case_comprehensive.rb:
-	  Implement non-ASCII case conversion for ISO-8859-5, by Masaru Onodera.
+Tue Aug  1 17:44:03 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/ruby/enc/test_case_comprehensive.rb: Fix order of encodings.
+	* win32/win32.c (init_stdhandle): assign standard file handles.
 
-Wed Jul 13 14:28:33 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+Tue Aug  1 12:24:58 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* math.c (rb_math_sqrt): r55646 must use f_signbit.
+	* eval.c (Init_Binding): fix old commit miss.
 
-Wed Jul 13 14:22:50 2016  Koichi Sasada  <ko1@atdot.net>
+Mon Jul 31 17:08:20 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* iseq.c (Init_ISeq): undef ISeq.translate and ISeq.load_iseq
-	  to prevent calling super classes' methods.
+	* win32/win32.c (exit_handler): new function; release winsock and
+	  environment work area.
 
-	  Without this patch, you can write workaround like:
+	* win32/win32.c (NTInitialize): setup exit_handler.
 
-	    class << RubyVM::InstructionSequence
-	      def translate; end
-	      undef translate
-	    end
+	* win32/win32.c (StartSockets): use exit_handler.
 
-	* test/ruby/test_iseq.rb: add a test.
+	* win32/win32.c (rb_w32_getenv): use GetEnvironmentStrings() instead
+	  of GetEnvironmentVariable(), because the latter cannot distinguish
+	  wheather a null environment variable exists or not.
+	  fixed: [ruby-talk:205123]
 
-Wed Jul 13 14:16:03 2016  Koichi Sasada  <ko1@atdot.net>
+Mon Jul 31 16:15:13 2006  Tanaka Akira  <akr@fsij.org>
 
-	* vm_method.c (method_entry_get_without_cache): check
-	  undefined method even if ruby_running is FALSE.
+	* test/ruby/test_process.rb (TestProcess#test_rlimit_nofile):
+	  setrlimit may fail with EINVAL.
+	  reported by MIYAMUKO Katsuyuki.  [ruby-dev:29174]
 
-	  We haven't call "undef"ed methods before ruby_running.
-	  So that this issue does not make troubles.
+Mon Jul 31 13:38:22 2006  GOTOU Yuuzou  <gotoyuzo@notwork.org>
 
-Wed Jul 13 14:15:22 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* lib/webrick/httprequest.rb (WEBrick::HTTPReuqest#parse_uri): improve
+	  for the value of IPv6 address in the Host: header field.
 
-	* enc/windows_1254.c: Adjust variable/macro names.
+Mon Jul 31 09:22:12 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Wed Jul 13 13:19:12 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* ruby.h: use ifdef (or defined) for macro constants that may or
+	  may not be defined to shut up gcc's -Wundef warnings.
+	  [ruby-core:08447]
 
-	* enc/iso_8859_9.c, enc/windows_1254.c: Split Windows-1254 from
-	  ISO-8859-9 to be able to implement different case conversions.
+Sun Jul 30 23:26:22 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Jul 13 13:08:30 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* eval.c (rb_call0): trace call/return of method defined from block.
+	  fixed: [ruby-core:08329]
 
-	* enc/iso_8859_7.c, enc/windows_1253.c: Split Windows-1253 from
-	  ISO-8859-7 to be able to implement different case conversions.
+	* eval.c (rb_trap_eval): make the current thread runnable to deal with
+	  exceptions which occurred within the trap.  fixed: [ruby-dev:27729]
 
-Wed Jul 13 10:50:12 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* lib/cgi/session.rb, lib/cgi/session/pstore.rb: suppress warnings.
+	  fixed: [ruby-talk:204896]
 
-	* enc/iso_8859_13.c, test/ruby/enc/test_case_comprehensive.rb:
-	  Implement non-ASCII case conversion for ISO-8859-13, by Kanon Shindo.
+Sat Jul 29 06:12:06 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-Wed Jul 13 10:31:39 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* ext/tk/lib/multi-tk.rb: freeze ip_name for security reason.
 
-	* enc/iso_8859_13.c, enc/windows_1257.c: Split Windows-1257 from
-	  ISO-8859-13 to be able to implement different case conversions.
+Sat Jul 29 01:23:52 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Wed Jul 13 09:02:30 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* lib/logger.rb: improves the amount of documentation that Rdoc
+	  picks up when processing logger.rb by moving the require
+	  statement back before the comment block.  a patch from Hugh
+	  Sasse <hgs at dmu.ac.uk>.  [ruby-core:08422]
 
-	* enc/iso_8859_3.c, test/ruby/enc/test_case_comprehensive.rb:
-	  Implement non-ASCII case conversion for ISO-8859-3, by Takuya Miyamoto.
+Thu Jul 27 22:21:52 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/ruby/enc/test_case_comprehensive.rb: Extend special treatment
-	  for Turkic.
+	* time.c (time_to_s): fixed format mismatch.
 
-	* enc/iso_8859_3.c: Exclude dotless i/I with dot from case-insensitive
-	  matching because they are not a case pair.
+Thu Jul 27 21:19:54 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Wed Jul 13 08:40:21 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* math.c (domain_check): a new function to check domain error
+	  explicitly for systems that return NaN like FreeBSD.
+	  [ruby-core:07019]
 
-	* test/ruby/enc/test_iso_8859.rb: Exclude dotless i/I with dot from
-	  case-insensitive matching because they are not a case pair.
+	* math.c (math_acos, math_asin, math_acosh, math_atanh, math_log,
+	  math_log10, math_sqrt): use domain_check().
 
-Tue Jul 12 23:13:43 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* math.c (math_sqrt): fix documentation flaw.
 
-	* math.c (rb_math_sqrt): [EXPERIMENTAL] move Complex sqrt support
-	  from mathn.rb.
+Thu Jul 27 18:12:12 2006  WATANABE Hirofumi  <eban@ruby-lang.org>
 
-Tue Jul 12 01:25:09 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* time.c: need to declare time_utc_offset.
 
-	* configure.in, lib/mkmf.rb, win32/Makefile.sub (CSRCFLAG): make the
-	  compiler option replacable in Makefile.
+Thu Jul 27 17:01:01 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* win32/Makefile.sub (OUTFLAG, COUTFLAG): ditto.
+	* io.c (io_close): always calls "close" method of the receiver.
+	  [ruby-core:6911] [ruby-core:8112]
 
-	* win32/Makeile.sub, win32/setup.mak (CC): should not append `-nologo`
-	  option forcely.
+Thu Jul 27 16:49:01 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Mon Jul 11 18:05:40 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* time.c (time_to_s): use +0900 style timezone string for local time.
+	  [ruby-dev:29143]
 
-	* enc/iso_8859_1.c: Moved test for lowercase characters without
-	  uppercase equivalent.
+Thu Jul 27 16:41:15 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Mon Jul 11 17:49:25 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* ext/openssl/ossl.h: move <ruby.h> inclusion point to shut up
+	  Solaris compiler.  [ruby-core:08114]
 
-	* enc/iso_8859_4.c, enc/iso_8859_10.c, enc/iso_8859_14.c,
-	  enc/iso_8859_15.c, enc/iso_8859_16.c: Replace case-by-case code with
-	  lookup in ENC_ISO_8859_xx_TO_LOWER_CASE table.
+Wed Jul 26 22:20:59 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Mon Jul 11 16:00:56 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* configure.in: add support for as and ASFLAGS.  [ruby-dev:29138]
 
-	* ext/stringio/stringio.c (strio_each, strio_readlines): convert
-	  arguments just once before reading, instead of conversions for
-	  each lines, as r55603.
+Wed Jul 26 22:13:45 2006  Minero Aoki  <aamine@loveruby.net>
 
-Sun Jul 10 19:53:41 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* lib/net/http.rb: sync with HEAD (rev 1.132).
 
-	* enc/iso_8859_10.c, test/ruby/enc/test_case_comprehensive.rb:
-	  Implement non-ASCII case conversion for ISO-8859-10, by Toya Hosokawa.
+	* lib/net/http.rb (Net::HTTP#post, request_post, request): should
+	  set Content-Type: x-www-form-urlencoded by default.
 
-Sun Jul 10 19:33:47 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* lib/net/http.rb (Net::HTTPHeader#content_type): should return
+	  nil when there's no Content-Type.
 
-	* test/ruby/enc/test_case_comprehensive.rb: Changed testing logic to
-	  catch unintended modifications of characters that do not have a case
-	  equivalent in the respective encoding.
-	* enc/iso_8859_1.c, enc/iso_8859_15.c: Fixed unintended modifications of
-	  micro sign and y with diaeresis.
+	* lib/net/http.rb (Net::HTTPHeader#sub_type): should return nil
+	  when there's no sub Content-Type (e.g. "Content-Type: text").
 
-Sun Jul 10 17:05:36 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* lib/net/http.rb (Net::HTTPHeader#type_params): wrongly failed
+	  when there's no Content-Type.
 
-	* enc/iso_8859_4.c, test/ruby/enc/test_case_comprehensive.rb:
-	  Implement non-ASCII case conversion for ISO-8859-4, by Kotaro Yoshida.
+Wed Jul 26 18:35:38 2006  Minero Aoki  <aamine@loveruby.net>
 
-Sun Jul 10 16:17:47 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* ext/strscan/strscan.c: sync with HEAD (rev 1.25).
 
-	* test/ruby/enc/test_case_comprehensive.rb: Fixed a comment
-	  (message belongs to last commit). [ci skip]
+	* ext/strscan/strscan.c (strscan_do_scan):
+	  StringScanner.new("").scan(//) should return "". [ruby-Bugs:4361]
 
-Sun Jul 10 14:27:25 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Jul 26 18:14:19 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* util.c (ruby_dtoa): [EXPERIMENTAL] adjust the case that the
-	  Float value is close to the exact but unrepresentable middle
-	  value of two values in the given precision, as r55604.
+	* ext/pty/pty.c (getDevice): retry once after GC on failure.
+	  [ruby-core:08282]
 
-Sun Jul 10 08:57:20 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+Wed Jul 26 17:28:16 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* thread.c: Fixed implicit conversion error with Apple clang-800.0.31
+	* sprintf.c (rb_f_sprintf): prepend ".." to %u for negative bignum,
+	  but not "-".  fixed: [ruby-core:08167]
 
-Sat Jul  9 12:43:09 2016  Shugo Maeda  <shugo@ruby-lang.org>
+Wed Jul 26 16:39:07 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* lib/getoptlong.rb: use false instead of FALSE.
+	* string.c (rb_str_scan): add string modification check.
+	  [ruby-core:7216]
 
-Fri Jul  8 21:49:28 2016  Naohisa Goto  <ngotogenome@gmail.com>
+Wed Jul 26 16:06:03 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* thread.c (rb_wait_for_single_fd): Clean up fds.revents every time
-	  before calling ppoll(2). [Bug #12575] [ruby-dev:49725]
+	* lib/cgi.rb (CGI::QueryExtension::read_multipart): check
+	  multipart boundary end.  a patch from Fujioka <fuj at rabbix.jp>
+	  [ruby-dev:28470]
 
-Fri Jul  8 14:16:48 2016  Shugo Maeda  <shugo@ruby-lang.org>
+Wed Jul 26 01:02:59 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* vm_args.c (vm_caller_setup_arg_block): call rb_sym_to_proc()
-	  directly to reduce method dispatch overhead.
+	* configure.in: suppress warnings by automake 1.8 or later.
 
-Fri Jul  8 08:43:31 2016  Shugo Maeda  <shugo@ruby-lang.org>
+Tue Jul 25 00:30:06 2006  Eric Hodel  <drbrain@segment7.net>
 
-	* io.c (rb_io_s_read): add description of pipes to the documentation
-	  of IO.read.
+	* lib/prettyprint.rb: RD to RDoc conversion by Hugh Sasse.
 
-Fri Jul  8 03:54:22 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+Tue Jul 25 14:49:51 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* vm_args.c (setup_parameters_complex): don't raise ArgumentError
-	  if an array is given for instance_exec with optional argument.
-	  [ruby-core:76300] [Bug #12568]
-	  https://github.com/rails/rails/pull/25699
+	* lib/mkmf.rb (configuration): typo.
 
-Fri Jul  8 00:47:36 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+Tue Jul 25 13:14:32 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* vm_eval.c (yield_under): change prototype to get argc/argv.
+	* process.c (rb_proc_times): rename hz to hertz to avoid name
+	  crash on AIX.  [ruby-dev:29126]
 
-	* vm_eval.c (specific_eval): change for above.
+Mon Jul 24 22:03:40 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* vm_eval.c (rb_obj_instance_exec): avoid object allocation.
+	* eval.c (backtrace): skip frames successive on node and method name.
 
-	* vm_eval.c (rb_mod_module_exec): ditto.
+Mon Jul 24 17:55:55 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Thu Jul  7 20:08:37 2016  Shugo Maeda  <shugo@ruby-lang.org>
+	* process.c (rb_f_system): add security check.  [ruby-talk:202947]
 
-	* vm_args.c (vm_caller_setup_arg_block): disable symbol block
-	  argument optimization when tail call optimization is enabled,
-	  in order to avoid SEGV.  [ruby-core:76288] [Bug #12565]
+	* process.c (rb_f_system): move signal right before fork to avoid
+	  signal handler intervention.
 
-Thu Jul  7 16:37:53 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon Jul 24 15:51:52 2006  Tanaka Akira  <akr@fsij.org>
 
-	* numeric.c (flo_round): [EXPERIMENTAL] adjust the case that the
-	  receiver is close to the exact but unrepresentable middle value
-	  of two values in the given precision.
-	  http://d.hatena.ne.jp/hnw/20160702
+	* ext/readline/readline.c (readline_readline): rl_deprep_term_function
+	  may be NULL with libedit.  reported by Ryan Davis.  [ruby-dev:29070]
 
-Thu Jul  7 16:31:07 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon Jul 24 15:19:55 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* io.c (rb_io_s_foreach, rb_io_s_readlines): convert arguments
-	  just once before reading, instead of conversions for each lines.
+	* eval.c (rb_call0): revert last change.  [ruby-dev:29112]
+	  [ruby-core:08374]
 
-Wed Jul  6 19:54:17 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Sun Jul 23 22:59:49 2006  Tanaka Akira  <akr@fsij.org>
 
-	* enc/iso_8859_14.c, test/ruby/enc/test_case_comprehensive.rb:
-	  Implement non-ASCII case conversion for ISO-8859-14, by Yutaro Tada.
+	* test/socket/test_unix.rb: disabled on cygwin.
+	  reported by Kouhei Yanagita.  [ruby-dev:29080]
 
-Wed Jul  6 19:24:48 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Fri Jul 21 21:21:08 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* enc/iso_8859_1.c, enc/iso_8859_15.c, enc/iso_8859_16.c:
-	  Align indenting to onigmo convention.
+	* eval.c (rb_call0): include funcalled methods in caller list.
+	  fixed: [ruby-core:08290]
 
-Wed Jul  6 18:59:13 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Fri Jul 21 12:11:00 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* enc/iso_8859_15.c, test/ruby/enc/test_case_comprehensive.rb:
-	  Implement non-ASCII case conversion for ISO-8859-15, by Maho Harada.
+	* ext/extmk.rb, lib/mkmf.rb (with_destdir): remove drive letter before
+	  prepending destdir on DOSISH.
 
-Wed Jul  6 18:34:21 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Thu Jul 20 15:07:14 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* enc/iso_8859_16.c, test/ruby/enc/test_case_comprehensive.rb:
-	  Implement non-ASCII case conversion for ISO-8859-16, by Satoshi Kayama.
+	* ruby.h: export classes/modules to implement sandbox.
+	  [ruby-core:08283]
 
-Wed Jul  6 14:44:56 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Jul 20 00:06:29 2006  Keiju Ishitsuka  <keiju@ishitsuka.com>
 
-	* lib/mkmf.rb (create_makefile): store $headers in LOCAL_HDRS for
-	  depend files.
+	* lib/irb/completion.rb: support for completion of numeric
+    	  number. [ruby-dev: 29038]
 
-	* ext/digest/digest_conf.rb (digest_conf): add implementation
-	  specific headers to $header.
+Wed Jul 19 23:53:05 2006  Kouhei Sutou  <kou@cozmixng.org>
 
-	* ext/digest/{md5,rmd160,sha1,sha2}/depend: add LOCAL_HDRS to the
-	  dependencies.
+	* lib/rss/parser.rb, lib/rss/utils.rb: added documents.
 
-Wed Jul  6 08:59:35 2016  Shugo Maeda  <shugo@ruby-lang.org>
+Tue Jul 18 22:10:13 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* lib/net/http/generic_request.rb (write_header): A Request-Line must
-	  not contain CR or LF.
+	* process.c (rb_f_system): block SIGCHLD during the process
+	  execution, like glibc system(3) does.  [ruby-talk:202361]
 
-Wed Jul  6 07:11:27 2016  Shugo Maeda  <shugo@ruby-lang.org>
+Tue Jul 18 23:12:14 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/net/ftp.rb (putline): raise an ArgumentError when
-	  CR or LF is included in a line.
+	* win32/win32.c (open_ifs_socket): should not use plain malloc.
 
-Tue Jul  5 20:49:30 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* win32/win32.c (rb_w32_opendir): should not use plain realloc.
 
-	* ext/json/*, test/json/*: Update json-2.0.1.
-	  Changes of 2.0.0: https://github.com/flori/json/blob/f679ebd0c69a94e3e70a897ac9a229f5779c2ee1/CHANGES.md#2015-09-11-200
-	  Changes of 2.0.1: https://github.com/flori/json/blob/f679ebd0c69a94e3e70a897ac9a229f5779c2ee1/CHANGES.md#2016-07-01-201
-	  [Feature #12542][ruby-dev:49706][fix GH-1395]
+Tue Jul 18 18:05:49 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Tue Jul  5 19:39:49 2016  Naohisa Goto  <ngotogenome@gmail.com>
+	* test/ruby/test_float.rb (TestFloat::test_strtod): update test to
+	  conform strtod change.
 
-	* string.c (rb_str_change_terminator_length): New function to change
-	  termlen and resize heap for the terminator. This is split from
-	  rb_str_fill_terminator (str_fill_term) because filling terminator
-	  and changing terminator length are different things. [Bug #12536]
+Tue Jul 18 15:49:42 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* internal.h: declaration for rb_str_change_terminator_length.
+	* pack.c (pack_unpack): propagate association array to copied
+	  string.  [ruby-core:08223]
 
-	* string.c (str_fill_term): Simplify only to zero-fill the terminator.
-	  For non-shared strings, it assumes that (capa + termlen) bytes of
-	  heap is allocated. This partially reverts r55557.
+	* pack.c (pack_unpack): return referenced string itself if it has
+	  same length as specified.  a patch from <nobu at ruby-lang.org>
+	  in [ruby-core:08225].
 
-	* encoding.c (rb_enc_associate_index): rb_str_change_terminator_length
-	  is used, and it should be called whenever the termlen is changed.
+	* pack.c (pack_pack): taint 'p' packed strings.
 
-	* string.c (str_capacity): New static function to return capacity
-	  of a string with the given termlen, because the termlen may
-	  sometimes be different from TERM_LEN(str) especially during
-	  changing termlen or filling terminator with specific termlen.
+Tue Jul 18 14:03:02 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* string.c (rb_str_capacity): Use str_capacity.
+	* lib/webrick/httpserver.rb (WEBrick::HTTPServer::unmount): remove
+	  inpect argument from sprintf.  [ruby-dev:29039]
 
-Tue Jul  5 11:07:14 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+Tue Jul 18 10:53:37 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* pack.c (pack_pack): use union instead of bare variable to ease
-	  optimizations and avoid assigning x87 floating point number.
-	  [ruby-core:74496] [Bug #12209]
+	* object.c (rb_cstr_to_dbl): limit out-of-range message.
 
-	* pack.c (pack_unpack): ditto.
+	* util.c (ruby_strtod): return end pointer even if ERANGE occurred.
+	  fixed: [ruby-dev:29041]
 
-Mon Jul  4 13:56:34 2016  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* process.c: define sig_t if not exist.
-	  at least Solaris 10 and 11 doesn't have sig_t.
-
-Mon Jul  4 13:08:48 2016  NARUSE, Yui  <naruse@ruby-lang.org>
-
-	* random.c (random_ulong_limited): avoid left shift count >= width of
-	  type on 32bit environment.
-
-Sun Jul  3 18:51:42 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
-
-	* test/ruby/enc/test_case_comprehensive.rb, test_regex_casefold.rb,
-	  test/test_unicode_normalize.rb: Replace UNICODE_VERSION from
-	  UnicodeNormalize with RbConfig::CONFIG['UNICODE_VERSION'] from
-	  feature 12460.
-
-Sun Jul  3 06:04:09 2016  Eric Wong  <e@80x24.org>
-
-	* process.c (disable_child_handler_fork_child): simplify
-	  [ruby-core:75781] [Misc #12439]
-
-Sun Jul  3 05:25:46 2016  Eric Wong  <e@80x24.org>
-
-	* tool/asm_parse.rb: add description
-	* tool/change_maker.rb: ditto
-	* tool/downloader.rb: ditto
-	* tool/eval.rb: ditto
-	* tool/expand-config.rb: ditto
-	* tool/extlibs.rb: ditto
-	* tool/fake.rb: ditto
-	* tool/file2lastrev.rb: ditto
-	* tool/gem-unpack.rb: ditto
-	* tool/gen_dummy_probes.rb: ditto
-	* tool/gen_ruby_tapset.rb: ditto
-	* tool/generic_erb.rb: ditto
-	* tool/id2token.rb: ditto
-	* tool/ifchange: ditto
-	* tool/insns2vm.rb: ditto
-	* tool/instruction.rb: ditto
-	* tool/jisx0208.rb: ditto
-	* tool/merger.rb: ditto
-	* tool/mkrunnable.rb: ditto
-	* tool/node_name.rb: ditto
-	* tool/parse.rb: ditto
-	* tool/rbinstall.rb: ditto
-	* tool/rbuninstall.rb: ditto
-	* tool/rmdirs: ditto
-	* tool/runruby.rb: ditto
-	* tool/strip-rdoc.rb: ditto
-	* tool/vcs.rb: ditto
-	* tool/vtlh.rb: ditto
-	* tool/ytab.sed: ditto
-	* tool/enc-unicode.rb: fix typo
-	* tool/mk_call_iseq_optimized.rb: ditto
-	* tool/update-deps: ditto
-	  [ruby-core:76215] [Bug #12539]
-	  by Noah Gibbs <the.codefolio.guy@gmail.com>
+Mon Jul 18 00:43:05 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Jul  2 18:04:24 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* util.c (ruby_strtod): stop at dot not followed by digits.
+	  fixed: [ruby-dev:29035]
 
-	* lib/uri/mailto.rb (initialize): RFC3986_Parser#split sets opaque
-	  only if the URI has path-rootless, not path-empty.
-	  [ruby-core:76055] [Bug #12498]
-	  patched by Chris Heisterkamp <cheister@squareup.com>
+Tue Jul 18 00:01:27 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Jul  2 04:26:14 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* ext/extmk.rb: remove LIBRUBY_SO if static linked extensions exist.
 
-	* regcomp.c (noname_disable_map): don't optimize out group 0
-	  Ruby's Regexp doesn't allow normal numbered groups if the regexp
-	  has named groups. On such case it optimizes out related NT_ENCLOSE.
-	  But even on the case it can use \g<0>.
-	  This fix not to remove NT_ENCLOSE whose regnum is 0.
-	  [ruby-core:75828] [Bug #12454]
+Mon Jul 17 23:30:46 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Jul  2 03:09:27 2016  Naohisa Goto  <ngotogenome@gmail.com>
+	* configure.in (rb_cv_msvcrt): defaulted to msvcrt.  Workaround for a
+	  bug of cygwin 1.5.20.
 
-	* string.c: Partially reverts r55547 and r55555.
-	  ChangeLog about the reverted changes are also deleted in this file.
-	  [Bug #12536] [ruby-dev:49699] [ruby-dev:49702]
+Mon Jul 17 13:43:05 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Sat Jul  2 02:22:22 2016  Naohisa Goto  <ngotogenome@gmail.com>
+	* pack.c (define_swapx): should not use plain malloc.
 
-	* string.c (str_fill_term): When termlen increases, re-allocation
-	  of memory for termlen should always be needed.
-	  In this fix, if possible, decrease capa instead of realloc.
-	  [Bug #12536] [ruby-dev:49699]
+Mon Jul 17 12:58:41 2006  WATANABE Hirofumi  <eban@ruby-lang.org>
 
-Fri Jul  1 20:20:20 2016  Naohisa Goto  <ngotogenome@gmail.com>
+	* configure.in: should use ac_cv_lib_dl_dlopen=no on MinGW.
 
-	* string.c: Specify termlen as far as possible.
-	  Additional fix for [Bug #12536] [ruby-dev:49699].
+Sat Jul 15 23:50:12 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* string.c (str_new_static): Specify termlen from the given encoding
-	  when creating a new String object is needed.
+	* eval.c (rb_require_safe): wait for another thread requiring the same
+	  feature.  fixed: [ruby-core:08229]
 
-	* string.c (rb_tainted_str_new_with_enc): New function to create a
-	  tainted String object with the given encoding. This means that
-	  the termlen is correctly specified. Currently static function.
-	  The function name might be renamed to rb_tainted_enc_str_new
-	  or rb_enc_tainted_str_new.
+Sat Jul 15 01:27:13 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* string.c (rb_external_str_new_with_enc): Use encoding by using the
-	  above rb_tainted_str_new_with_enc().
+	* dir.c (has_magic): glob names contain alphabets to enable case fold
+	  search also for directories.  fixed: [ruby-talk:201917]
 
-Fri Jul  1 19:38:57 2016  Naohisa Goto  <ngotogenome@gmail.com>
+Sat Jul 15 01:09:22 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* test/fiddle/test_pointer.rb (test_to_str, test_to_s, test_aref_aset):
-	  Attempt to use independent strings for destructive tests that
-	  directly modify values on memory by using Fiddle::Pointer.
-	  [Bug #12537] [ruby-dev:49700]
+	* st.c (malloc): use xmalloc/xcalloc instead of plain
+	  malloc/calloc, to detect memory allocation failure.  see
+	  <http://www.nongnu.org/failmalloc/>.
 
-Fri Jul  1 18:20:00 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* gc.c (rb_memerror): should not raise empty nomem_error.
 
-	* .gdbinit (rb_ps_thread): show the detail of cfunc in ruby level
-	  backtrace.
+Fri Jul 14 13:08:13 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-Fri Jul  1 13:26:39 2016  Naohisa Goto  <ngotogenome@gmail.com>
+	* ext/tk/lib/tk.rb: add methods for new features of latest Tcl/Tk8.5.
 
-	* string.c (rb_str_subseq, str_substr): When RSTRING_EMBED_LEN_MAX
-	  is used, TERM_LEN(str) should be considered with it because
-	  embedded strings are also processed by TERM_FILL.
-	  Additional fix for [Bug #12536] [ruby-dev:49699].
+	* ext/tk/lib/tk/namespace.rb: ditto.
 
-Fri Jul  1 12:11:01 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+Fri Jul 14 02:30:12 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* .gdbinit (rb_count_objects): added gdb version of count_objects().
+	* lib/monitor.rb: document patch from Hugh Sasse <hgs at dmu.ac.uk>.
+	  [ruby-core:08205]
 
-Fri Jul  1 04:32:52 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+Fri Jul 14 01:09:46 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* .gdbinit (rb_ps_thread): show ruby level backtrace.
-	  Usually you can call `rb_ps` to show ruby level backtraces
-	  for all living threads.
-	  Note that it can call with core file like `gcore <pid>`
-	  and `gdb ruby core.<pid>`.
+	* parse.y (then): error in warning action.
 
-Thu Jun 30 19:15:13 2016  Naohisa Goto  <ngotogenome@gmail.com>
+Fri Jul 14 00:10:15 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* string.c: Fix memory corruptions when using UTF-16/32 strings.
-	  [Bug #12536] [ruby-dev:49699]
+	* array.c (rb_ary_pop): may cause realloc oscillation.  a patch
+	  from MORITA Naoyuki <mlgetter at kidou.sakura.ne.jp>.
+	  [ruby-dev:29028]
 
-	* string.c (rb_str_new_with_class): Use TERM_LEN of the "obj".
+Thu Jul 13 22:23:56 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-	* string.c (rb_str_plus, rb_str_justify): Use str_new0 which is aware
-	  of termlen.
+	* ext/tk/lib/tk/composite.rb: improve handling of the classname on the
+	  option database for the widget class which includes TkComposite.
 
-	* string.c (str_shared_replace): Copy +termlen bytes instead of +1.
+Thu Jul 13 20:32:19 2006  Kouhei Sutou  <kou@cozmixng.org>
 
-	* string.c (rb_str_times): termlen should not be included in capa.
+	* lib/rss/parser.rb: updated documents by a patch from
+	Hugh Sasse <hgs at dmu.ac.uk>. [ruby-core:8194]
 
-	* string.c (RESIZE_CAPA_TERM): When using RSTRING_EMBED_LEN_MAX,
-	  termlen should be counted with it because embedded strings are
-	  also processed by TERM_FILL.
+Wed Jul 12 13:54:09 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* string.c (rb_str_capacity, str_shared_replace, str_buf_cat): ditto.
+	* parse.y (then): we'd like to reserve colon here for the future.
+	  warning added.
 
-	* string.c (rb_str_drop_bytes, rb_str_setbyte, str_byte_substr): ditto.
+Tue Jul 11 20:58:18 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Wed Jun 29 22:24:37 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* ruby.h: export rb_cMethod.  [ruby-talk:201259]
 
-	* ext/psych/lib/psych_jars.rb: removed needless file required to JRuby.
+Tue Jul 11 19:13:33 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-Wed Jun 29 22:21:38 2016  Kazuki Yamaguchi  <k@rhe.jp>
+	* ext/tk/lib/multi-tk.rb: remove restriction on the class of
+	  pseudo-toplevel.
 
-	* ext/openssl/ossl_ocsp.c: The "reuse" behavior of d2i_ functions does
-	  not work well with OpenSSL 1.0.0t. So avoid it.
+Tue Jul 11 18:00:57 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-Wed Jun 29 15:18:28 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* ext/tk/lib/multi-tk.rb: security fix.
 
-	* insns.def (opt_succ): optimize like r55515. (but this argument is
-	  constant)
+Tue Jul 11 17:33:39 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Wed Jun 29 12:41:58 2016  Shugo Maeda  <shugo@ruby-lang.org>
+	* string.c (rb_str_dump): need to extend len for \b.
 
-	* test/ruby/test_refinement.rb: skip
-	  test_prepend_after_refine_wb_miss on ARM or MIPS.
-	  [ruby-core:76031] [Bug #12491]
+Mon Jul 10 22:00:00 2006  Shigeo Kobayashi  <shigek@ruby-lang.org>
 
-Wed Jun 29 08:45:53 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/bigdecimal/bigdecimal.c: Allows '_' to appear within
+	  digits.  [ruby-dev:28872]
 
-	* proc.c (passed_block): convert passed block symbol to proc.
-	  based on the patch by Daisuke Sato in [ruby-dev:49695].
-	  [Bug #12531]
+	* ext/bigdecimal/lib/bigdecimal/util.rb: Bug in to_r reported by
+	  [ruby-list:42533] fixed.
 
-Wed Jun 29 03:34:41 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+Mon Jul 10 19:22:19 2006  Tanaka Akira  <akr@fsij.org>
 
-	* bignum.c (rb_big2ulong): the old logic seems to try to avoid
-	  calculating `-(long)(num-1)-1` if `num` is not LONG_MIN. (Note that
-	  `-LONG_MIN` may be larger than LONG_MAX) But C compilers can
-	  optimize it into single NEG instruction.
-	  Therefore those two conditions can be single if-body.
+	* gc.c (gc_sweep): expand heap earlier.
+	  reported by MORITA Naoyuki.  [ruby-dev:28960]
 
-	* bignum.c (rb_big2long): ditto.
+Mon Jul 10 18:59:34 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-	* bignum.c (rb_big2ull): ditto.
+	* ext/tk/lib/tk/font.rb: sorry. mistaken to patch.
 
-	* bignum.c (rb_big2ll): ditto.
+Mon Jul 10 18:46:52 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-Tue Jun 28 22:55:00 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/tk/tcltklib.c: make SEGV risk lower at exit.
 
-	* lib/pstore.rb (PStore::CHECKSUM_ALGO): extract the algorithm for
-	  checksum, instead of qualified names for each times.
+	* ext/tk/lib/tk.rb: ditto.
 
-Tue Jun 28 22:29:36 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/tk/lib/multi-tk.rb: fail to call function-style methods on slave
+	  interpreters. The strategy (MultiTkIp_PseudoToplevel_Evaluable) to
+	  fix the problem is a little tricky. You may have to take care of
+	  conflicting with it.
 
-	* bootstraptest/runner.rb: do not use safe navigation operator.
-	  this runner may run on older ruby.  partially revert r53110
-	  (GH-1142 patched by @mlarraz).
+	* ext/tk/lib/tk.rb: a little change for the pseudo-toplevel strategy.
 
-Tue Jun 28 22:09:09 2016  Akio Tajima <artonx@yahoo.co.jp>
+	* ext/tk/lib/tk/font.rb: ditto.
 
-	* lib/fileutils.rb: rescue Errno:EACCES for chown.
-	  [Bug #12520]
+	* ext/tk/lib/tk/msgcat.rb: ditto.
 
-Tue Jun 28 18:38:09 2016  Naohisa Goto  <ngotogenome@gmail.com>
+	* ext/tk/lib/tkextlib/itk/incr_tk.rb: ditto.
 
-	* ext/digest/md5/md5ossl.h: Remove excess semicolons.
-	  Suppress warning on Solaris with Oracle Solaris Studio 12.
-	  [ruby-dev:49692] [Bug #12524]
+	* ext/tk/sample/demos-en/widget: fail to call function-style methods
+	  on sample scripts. To fix it, a strategy which similar to the way
+	  on MultiTiIp is used. Please take care when re-write and re-run a
+	  demo script on the Widget-Demo code viewer.
 
-	* ext/digest/md5/md5cc.h: ditto.
-	* ext/digest/sha1/sha1cc.h: ditto.
-	* ext/digest/sha1/sha1ossl.h: ditto.
-	* ext/digest/sha2/sha2cc.h: ditto.
-	* ext/digest/sha2/sha2ossl.h: ditto.
-	* ext/openssl/ossl_pkey_rsa.c: ditto.
+	* ext/tk/sample/demos-jp/widget: ditto.
 
-Tue Jun 28 15:56:48 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon Jul 10 13:58:40 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-	* test/ruby/enc/test_case_comprehensive.rb: noting to test if
-	  Unicode data files are available.
-	  [ruby-core:76160] [Bug #12433]
+	* signal.c (ruby_nativethread_signal, posix_nativethread_signal,
+	  sigsend_to_ruby_thread, install_nativethread_sighandler):
+	  nativethread-support on signal handler. RE-backport from 1.9.
 
-	* test/test_unicode_normalize.rb: ditto.
+	* ruby.h (HAVE_NATIVETHREAD_KILL): ditto.
 
-Tue Jun 28 15:20:18 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* eval.c (ruby_native_thread_kill): ditto.
 
-	* lib/net/http.rb (Net::HTTP#proxy_uri): cache the case no proxy
-	  is used.
+Mon Jul 10 10:54:14 2006  Ryan Davis  <ryand@zenspider.com>
 
-Tue Jun 28 09:56:29 2016  Stefan Schussler  <mail@stefanschuessler.de>
+	* lib/rdoc/parsers/parse_f95.rb: massive overhaul from Yasuhiro
+	  Morikawa including new file suffixes, function support, public
+	  variables and constants, derived-types, defined operators and
+	  assignments, namelists, and subroutine and function
+	  arguments. Truly massive.
 
-	* object.c (rb_mod_eqq): [DOC] Fix typo in RDoc.  [Fix GH-1393]
+	* lib/rdoc/diagram.rb: diagrams are now cached.
 
-Tue Jun 28 02:41:32 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* lib/irb/completion.rb: fixed a crasher when completing against
+	  an unnamed class/module.
 
-	* insns.def (opt_plus): use `- 1` instead of `& (~1)` to allow
-	  compilers to use x86 LEA instruction (3 operand).
-	  Even if 3 operand LEA's latency is 3 cycle after SandyBridge,
-	  it reduces code size and can be faster because of super scalar.
+	* lib/rdoc/parsers/parse_c.rb: private comment (--/++) support in
+	  C-file rdoc.
 
-	* insns.def (opt_plus): calculate and use rb_int2big.
-	  On positive Fixnum overflow, `recv - 1 + obj` doesn't carry
-	  because recv's msb and obj's msb are 0, and resulted msb is 1.
-	  Therefore simply rshift and cast as signed long works fine.
-	  On negative Fixnum overflow, it will carry because both arguments'
-	  msb are 1, and resulted msb is also 1.
-	  In this case it needs to restore carried sign bit after rshift.
+	* lib/debug.rb: minor clarification in help.
 
-Mon Jun 27 16:58:32 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/pp.rb: minor clarification on exception.
 
-	* lib/fileutils.rb (FileUtils#install): accecpt symbolic mode, as
-	  well as chmod.
+Mon Jul 10 09:29:12 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/fileutils.rb (FileUtils#install): add owner and group
-	  options.
+	* eval.c (rb_clear_cache_for_undef): clear entries for included
+	  module.  fixed: [ruby-core:08180]
+
+Mon Jul 10 01:48:38 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* st.h (st_data_t): use pointer sized integer for st_data_t.
+	  [ruby-dev:28988]
+
+Sun Jul  9 18:06:47 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/mkmf.rb (try_constant): fix for value 1 at cross compiling.
+
+	* lib/mkmf.rb (create_makefile): prevent substitution of macro
+	  definition.  fixed: http://www.yotabanana.com/lab/20060624.html#p02
+
+Sun Jul  9 00:54:34 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (next_jump): deal with destination of next.
+	  fixed: [ruby-core:08169]
+
+Fri Jul  7 00:38:49 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* hash.c (rb_hash_default): should not call default procedure if
+	  no key is given.  [ruby-list:42541]
+
+Fri Jul  7 00:29:10 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* time.c (time_mload): a patch from Daniel Berger
+	  <Daniel.Berger at qwest.com>.  [ruby-core:08128]
+
+Thu Jul  6 22:21:57 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* process.c (rb_proc_times): use sysconf(_SC_CLK_TCK) value prior to
+	  HZ and CLK_TCK.  fixed: [ruby-talk:200293]
+
+Thu Jul  6 22:17:21 2006  Minero Aoki  <aamine@loveruby.net>
+
+	* ext/racc/cparse/cparse.c: sync with original code, rev 1.8.
+
+	* ext/racc/cparse/cparse.c: should mark CparseParams objects.
+
+	* lib/racc/parser.rb: sync with original code, rev 1.8.
+
+	* lib/racc/parser.rb: update coding style.
+
+Mon Jul  3 19:04:38 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/tcltklib.c (ip_make_menu_embeddable): help to make a menu
+	  widget embeddable (pack, grid, and so on) like as a general widget.
+	  However, an embeddable menu may require to be definied some event
+	  bindings for general use.
+
+	* ext/tk/lib/tk/event.rb: [bug fix] Tk.callback_break and
+	  Tk.callback_continue don't work on MultiTkIp.
+
+	* ext/tk/lib/multi-tk.rb: ditto.
+
+	* ext/tk/lib/tk.rb: lack of Tk.callback_return.
+
+	* ext/tk/lib/tk/menu.rb: improve creating clone menus.
+
+Mon Jul  3 14:42:06 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/etc/extconf.rb (PW_UID2VAL, PW_GID2VAL): defaulted to conversion
+	  from int, and sys/types.h needs to be included before grp.h.
+	  fixed: [ruby-dev:28938]
+
+Mon Jul  3 01:14:15 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* string.c (rb_str_inspect): encode \b (\010) for escape.
+	  [ruby-dev:28927]
+
+	* string.c (rb_str_dump): ditto.
+
+Sun Jul  2 19:17:56 2006  Minero Aoki  <aamine@loveruby.net>
+
+	* ext/racc/cparse/cparse.c: sync with original code (rev 1.7).
+
+	* ext/racc/cparse/cparse.c: use rb_catch instead of rb_iterate.
+	  Giving a block to a Ruby-level method by rb_iterate is obsolete on
+	  Ruby 1.9.  Note that current cparse.c still includes one
+	  rb_iterate call on Ruby 1.8, but it is not a problem (at least
+	  just now).
+
+Sat Jul  1 15:15:49 2006  Tanaka Akira  <akr@m17n.org>
+
+	* test/socket/test_nonblock.rb: add timeout to send/receive
+	  an empty UDP packet.
+	  [ruby-dev:28820]
+
+Fri Jun 30 23:46:23 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* configure.in: should test isinf for Solaris with GCC compiler.
+	  a patch from <ville.mattila at stonesoft.com>.  [ruby-core:07791]
+
+	* configure.in: -shared patch from Andrew Morrow
+	  <andrew.c.morrow at gmail.com>.  [ruby-core:08100]
+
+Thu Jun 29 18:58:51 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* ext/bigdecimal/bigdecimal.c (BigDecimal_version): fix patch
+	  failure.
+
+Thu Jun 29 18:00:51 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* ext/bigdecimal/bigdecimal.c: add RDoc document.  a patch from
+	  mathew <meta at pobox.com>.   [ruby-core:07050]
+
+Wed Jun 28 15:47:14 2006  Eric Hodel  <drbrain@segment7.net>
+
+	* lib/optparse.rb: RDoc patch from Robin Stocker <robin@nibor.org>
+	  [ruby-core:08087]
+
+Wed Jun 28 19:04:34 2006  Tanaka Akira  <akr@m17n.org>
+
+	* test/socket/test_unix.rb: test_seqpacket_pair removed.
+	  [ruby-dev:28846]
+
+Tue Jun 27 23:03:49 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* string.c: RDoc update for =~ method.  a patch from Alex Young
+	  <alex at blackkettle.org>.  [ruby-core:08068]
+
+Tue Jun 27 22:47:18 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/tcltklib.c: forgot to update TCLTKLIB_RELEASE_DATE.
+
+	* ext/tk/lib/tk.rb (tk_tcl2ruby): [bug fix] sometimes fail to convert
+	  a tcl string to a ruby object if the tcl string includes "\n".
+
+Tue Jun 27 16:04:05 2006  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* win32/win32.h: define isascii on MinGW for msvcrt compatibility.
+
+	* configure.in: set ac_cv_header_sys_time_h=no on MinGW
+	  for msvcrt compatibility.
+
+Tue Jun 27 11:36:02 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/etc/etc.c (setup_passwd, setup_group): allow bignum uid, gid and
+	  so on.  [ruby-talk:199102]
+
+Mon Jun 26 13:37:27 2006  Eric Hodel  <drbrain@segment7.net>
+
+	* lib/rdoc: Merge from HEAD.
+	  Add options to limit the ri search path.
+
+Tue Jun 27 00:54:08 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* util.c (powersOf10): constified.
+
+Mon Jun 26 18:37:44 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/tcltklib.c (ip_delete): fix SEGV when a slave-ip is
+	  deleted on callback.
+
+Mon Jun 26 10:47:42 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Mon Jun 27 08:56:55 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* io.c (pipe_open): avoid closing uninitialized file descriptors.
+	  a patch from <tommy at tmtm.org> [ruby-dev:28600]
 
-	* compile.c (ADD_TRACE): ignore trace instruction on non-positive
-	  line.
+Mon Jun 26 09:56:22 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* parse.y (coverage): get rid of ArgumentError when the starting
-	  line number is not positive.  [ruby-core:76141] [Bug #12517]
+	* win32/win32.[ch] (rb_w32_send, rb_w32_sendto): constified.
 
-Sun Jun 26 10:20:25 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sun Jun 25 23:02:12 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/win32/lib/Win32API.rb (Win32API#initialize): Cygwin
-	  2.5.2-1 (perhaps) seems to no longer append ".dll" suffix
-	  implicitly.
+	* Makefile.in, mkconfig.rb: catch-up for latest autoconf.
 
-	* ext/win32/lib/win32/resolv.rb (Win32::Resolv): ditto.  Fix the
-	  error reported by yamataka AT u08.itscom.net in
-	  [ruby-list:50339], and pointed out and patched by cerberus AT
-	  m3.kcn.ne.jp in [ruby-list:50341].
+Sat Jun 24 06:35:00 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-Sat Jun 25 10:07:52 2016  Kazuki Yamaguchi  <k@rhe.jp>
+	* signal.c: revert last change.
 
-	* test/openssl/test_ocsp.rb: Ignore errors caused by bugs that exist in
-	  LibreSSL >= 2.3.1.
+	* ruby.h: ditto.
 
-Sat Jun 25 02:33:33 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* eval.c: ditto.
 
-	* vm_method.c (vm_respond_to): try method_missing if respond_to?
-	  is undefined, as if it is the default definition.
-	  [ruby-core:75377] [Bug #12353]
+Thu Jun 22 11:52:02 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Fri Jun 24 17:04:21 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* lib/net/http.rb (Net::HTTPResponse): duplicated error 501;
+	  HTTPInternalServerError should be error 500.  [ruby-core:08037]
 
-	* ext/psych/*, test/psych/*: Update psych 2.1.0
-	  This version fixed [Bug #11988][ruby-core:72850]
+Thu Jun 22 05:15:58 2006  Tanaka Akira  <akr@m17n.org>
 
-Fri Jun 24 13:12:41 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* ext/socket/socket.c (sock_s_socketpair): try GC only once.
+	  [ruby-dev:28778]
 
-	* lib/rubygems.rb, lib/rubygems/*, test/rubygems/*:
-	  Update rubygems 2.6.5 and 2.6.6.
-	  Release note of 2.6.5: https://github.com/rubygems/rubygems/commit/656f5d94dc888d78d0d00f3598a4fa37391aac80
-	  Release note of 2.6.6: https://github.com/rubygems/rubygems/commit/ccb9c3300c063f5b5656669972d24a10ef8afbf5
+Wed Jun 21 21:28:32 2006  Tadayoshi Funaba  <tadf@dotrb.org>
 
-Fri Jun 24 09:17:15 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/date.rb (jd_to_commercial): now works fine even if in
+	  mathn-ized context.
 
-	* common.mk (lib/unicode_normalize/tables.rb): should not depend
-	  on Unicode data files unless ALWAYS_UPDATE_UNICODE=yes, to get
-	  rid of downloading Unicode data unnecessary.  [ruby-dev:49681]
+Wed Jun 21 17:32:31 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-	* common.mk (enc/unicode/casefold.h): update Unicode files in a
-	  sub-make, not to let the header depend on the files always.
+	* signal.c (ruby_nativethread_signal, posix_nativethread_signal,
+	  sigsend_to_ruby_thread, install_nativethread_sighandler):
+	  nativethread-support on signal handler (backport from 1.9).
 
-	* enc/unicode/case-folding.rb: if gperf is not usable, assume the
-	  existing file is OK.
+	* ruby.h (HAVE_NATIVETHREAD_KILL): ditto.
 
-Tue Jun 21 19:44:54 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* eval.c (ruby_native_thread_kill): ditto.
 
-	* test/ruby/enc/test_regex_casefold.rb: Add Windows-1251, KOI8-R, and
-	  KOI8-U to encodings; definitely removed EUC-JP.
+Wed Jun 21 08:39:54 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Tue Jun 21 19:32:23 2016  Mark St.Godard  <markstgodard@gmail.com>
+	* lib/xmlrpc/create.rb (XMLRPC::Create::conv2value): merge Date
+	  and Time processing.  [ruby-core:08033]
 
-	* lib/webrick/httprequest.rb (setup_forwarded_info): Use the first
-	  value in X-Forwarded-Proto, if header contains multiple comma
-	  separated values.  Some middlewares may add these values to the
-	  list, not replacing.  [Fix GH-1386]
+Wed Jun 21 01:40:25 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Jun 21 17:17:42 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* parse.y (yylex, reswords): modifier token is no longer returned in
+	  fname state.  [ruby-dev:28775]
 
-	* test/ruby/test_io.rb: Skip test_readpartial_with_not_empty_buffer,
-	  test_read_buffer_error, test_read_unlocktmp_ensure,
-	  test_readpartial_unlocktmp_ensure, and
-	  test_sysread_unlocktmp_ensure on cygwin,
-	  because these tests repeatedly hang. This makes test_io.rb
-	  complete in finite time on cygwin.
+Wed Jun 21 01:12:46 2006  Kouhei Sutou  <kou@cozmixng.org>
 
-	* ChangeLog: Fix test_in.rb -> test_io.rb (two instances).
+	* lib/rss/rss.rb: RSS::Element.def_corresponded_attr_writer
+	  supported date type.
 
-Tue Jun 21 16:38:14 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Jun 20 22:08:36 2006  Kouhei Sutou  <kou@cozmixng.org>
 
-	* string.c (rb_str_casemap): do not put code with side effects
-	  inside RSTRING_PTR() macro which evaluates the argument multiple
-	  times.
+	* test/rss/test_parser.rb: split parser tests into ...
+	* test/rss/test_parser_1.0.rb: ... RSS 1.0 parsing tests and ...
+	* test/rss/test_parser_2.0.rb: ... RSS 2.0 parsing tests.
 
-Tue Jun 21 16:13:45 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+Tue Jun 20 21:19:06 2006  Kouhei Sutou  <kou@cozmixng.org>
 
-	* string.c (rb_str_casemap): fix memory leak.
+	* lib/rss/rss.rb: provided default RSS::Element#children.
 
-Tue Jun 21 16:12:21 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* lib/rss/0.9.rb: used default RSS::Element#children.
+	* lib/rss/1.0.rb: ditto.
+	* lib/rss/2.0.rb: ditto.
+	* lib/rss/taxonomy.rb: ditto.
 
-	* string.c (rb_str_casemap): int is too small for string size.
+Tue Jun 20 21:04:33 2006  Kouhei Sutou  <kou@cozmixng.org>
 
-Tue Jun 21 15:42:22 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* lib/rss/rss.rb: provided default RSS::Element#_tags.
 
-	* test/ruby/test_io.rb: Skip test_read_buffer_error on cygwin,
-	  because this test repeatedly hangs.
+	* lib/rss/0.9.rb: used default RSS::Element#_tags.
+	* lib/rss/1.0.rb: ditto.
+	* lib/rss/2.0.rb: ditto.
+	* lib/rss/image.rb: ditto.
+	* lib/rss/taxonomy.rb: ditto.
 
-Tue Jun 21 15:35:14 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Tue Jun 20 20:47:07 2006  Kouhei Sutou  <kou@cozmixng.org>
 
-	* LEGAL: Added filenames and copyrights for some files in
-	  enc/trans/JIS.
+	* lib/rss/rss.rb: hide RSS::Element.install_model.
+	  (RSS::Element.install_have_child_element,
+	   RSS::Element.install_have_children_element,
+	   RSS::Element.install_text_element,
+	   RSS::Element.install_date_element): call
+	  RSS::Element.install_model internally.
 
-Tue Jun 21 00:56:47 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/rss/0.9.rb: followed new API.
+	* lib/rss/1.0.rb: ditto.
+	* lib/rss/2.0.rb: ditto.
+	* lib/rss/content.rb: ditto.
+	* lib/rss/dublincore.rb: ditto.
+	* lib/rss/image.rb: ditto.
+	* lib/rss/syndication.rb: ditto.
+	* lib/rss/taxonomy.rb: ditto.
+	* lib/rss/trackback.rb: ditto.
 
-	* win32/win32.c (get_special_folder): fix calling convention of
-	  SHGetPathFromIDListEx, which should be WINAPI.  pointed out by
-	  @arton at http://twitter.com/arton/status/744884064277016576
+Tue Jun 20 20:18:05 2006  GOTOU Yuuzou  <gotoyuzo@notwork.org>
 
-Tue Jun 21 00:22:02 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/openssl/extconf.rb: add check for OBJ_NAME_do_all_sorted.
 
-	* configure.in, include/ruby/defines.h (RUBY_USE_SETJMPEX):
-	  include setjmpex.h only when using setjmpex() for RUBY_SETJMP.
-	  the header of mingw32 overrides setjmp() by setjmpex().
+	* ext/openssl/ossl_cipher.c (ossl_s_ciphers): new method
+	  OpenSSL::Cipher.ciphers. it returns all the cipher names.
 
-Mon Jun 20 18:39:16 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* ext/openssl/lib/openssl/cipher.rb:
+	  - add constants AES128, AES192, AES256. [ruby-dev:28610]
+	  - reimplement without eval()
 
-	* test/ruby/test_io.rb: Skip test_open_fifo_does_not_block_other_threads
-	  on cygwin. Fifos seem to work okay in cygwin, but this test repeatedly
-	  hangs.
+	* ext/openssl/lib/openssl/digest.rb: reimplement without eval().
 
-Mon Jun 20 13:35:06 2016  Shugo Maeda  <shugo@ruby-lang.org>
+	* test/openssl/test_cipher.rb, test_digest: fix about reimplemented
+	  features.
 
-	* vm.c (invoke_bmethod, invoke_block_from_c_0): revert r52104
-	  partially to avoid "self has wrong type to call super in this
-	  context" errors.
-	  [ruby-core:72724] [Bug #11954]
+	* sample/openssl/cipher.rb: rewrite all.
 
-Mon Jun 20 12:53:38 2016  Kazuki Yamaguchi  <k@rhe.jp>
+Sat Jun 19 11:21:46 2006  Eric Hodel  <drbrain@segment7.net>
 
-	* test/rubygems/test_gem_remote_fetcher.rb: OpenSSL::PKey::DH#priv_key=
-	  is not defined when ext/openssl is built with OpenSSL 1.1.0.
-	  https://github.com/rubygems/rubygems/pull/1648
-	  [ruby-core:75225] [Feature #12324]
+	* lib/test/unit/assertions.rb: Merge RDoc from HEAD.
 
-Sun Jun 19 21:25:43 2016  Kazuki Yamaguchi  <k@rhe.jp>
+Tue Jun 20 01:06:57 2006  Kouhei Sutou  <kou@cozmixng.org>
 
-	* ext/openssl/ossl_ocsp.c: Add OCSP::SingleResponse that represents an
-	  OCSP SingleResponse structure. Also add two new methods #responses
-	  and #find_response to OCSP::BasicResponse. A BasicResponse has one or
-	  more SingleResponse. We have OCSP::BasicResponse#status that returns
-	  them as an array of arrays, each containing the content of a
-	  SingleResponse, but this is not useful. When validating an OCSP
-	  response, we need to look into the each SingleResponse and check their
-	  validity but it is not simple. For example, when validating for a
-	  certificate 'cert', the code would be like:
+	* lib/rss/rss.rb:
+	  - cleanup validation mechanism. Now, #XXX_validation is
+	    needless.
+	  - changed internal variable name RSS::Element::MODEL to
+	    RSS::Element::MODELS.
+	  - RSS::Element.install_model requires uri.
 
-	    # certid_target is an OpenSSL::OCSP::CertificateId for cert
-	    basic = res.basic
-	    result = basic.status.any? do |ary|
-	      ary[0].cmp(certid_target) &&
-	        ary[4] <= Time.now && (!ary[5] || Time.now <= ary[5])
+	* lib/rss/0.9.rb: followed new validation API.
+	* lib/rss/1.0.rb: ditto.
+	* lib/rss/2.0.rb: ditto.
+	* lib/rss/content.rb: ditto.
+	* lib/rss/dublincore.rb: ditto.
+	* lib/rss/image.rb: ditto.
+	* lib/rss/syndication.rb: ditto.
+	* lib/rss/taxonomy.rb: ditto.
+	* lib/rss/trackback.rb: ditto.
+
+Mon Jun 19 23:40:59 2006  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/nkf/lib/kconv.rb: remove default -m0 and fix document.
+
+	* ext/nkf/nkf-8/{nkf.c, config.h, utf8tbl.c, utf8tbl.h}:
+	  imported nkf 2.0.7.
+
+Mon Jun 19 22:31:59 2006  Kouhei Sutou  <kou@cozmixng.org>
+
+	* lib/rss/rss.rb:
+	  - provided default #to_s as RSS::Element#to_s.
+	  - removed RSS::Element#other_element.
+	  - RSS::Element#tag requires attributes as Hash instead of Array.
+
+	* lib/rss/0.9.rb: removed #to_s to use RSS::Element#to_s.
+	* lib/rss/1.0.rb: ditto.
+	* lib/rss/image.rb: ditto.
+	* lib/rss/taxonomy.rb: ditto.
+	* lib/rss/trackback.rb: ditto.
+
+	* lib/rss/2.0.rb: removed #other_element.
+
+Mon Jun 19 22:09:16 2006  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
+
+	* ext/win32ole/win32ole.c(ole_invoke): support some kind of
+	  method of word. [ruby-Bugs#3237]
+
+	* ext/win32ole/tests/test_word.rb: ditto.
+
+	* ext/win32ole/tests/testall.rb: ditto.
+
+Mon Jun 19 00:02:17 2006  Kouhei Sutou  <kou@cozmixng.org>
+
+	* lib/rss/rss.rb: automatically detected attributes.
+
+	* lib/rss/0.9.rb: removed #_attrs.
+	* lib/rss/1.0.rb: ditto.
+	* lib/rss/2.0.rb: ditto.
+	* lib/rss/image.rb: ditto.
+	* lib/rss/taxonomy.rb: ditto.
+	* lib/rss/trackback.rb: ditto.
+
+	* lib/rss/parser.rb: followed new internal API.
+
+Mon Jun 19 00:00:17 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/multi-tk.rb: fix bug: initialize improper tables.
+
+Sun Jun 18 22:36:13 2006  Kouhei Sutou  <kou@cozmixng.org>
+
+	* lib/rss/rss.rb: RSS::Element#initialize accepts initial
+	  attributes.
+	* lib/rss/0.9.rb: ditto.
+	* lib/rss/1.0.rb: ditto.
+	* lib/rss/2.0.rb: ditto.
+	* lib/rss/dublincore.rb: ditto.
+	* lib/rss/image.rb: ditto.
+	* lib/rss/taxonomy.rb: ditto.
+	* lib/rss/trackback.rb: ditto.
+
+	* lib/rss/utils.rb: added Utils.element_initialize_arguments? to
+	  detect backward compatibility initial arguments.
+
+	* lib/rss/parser.rb: user initial attributes to initialize
+	  RSS::Element.
+
+Sun Jun 18 18:24:42 2006  Kouhei Sutou  <kou@cozmixng.org>
+
+	* lib/rss/converter.rb: use NKF for Uconv fallback.
+
+Sun Jun 18 18:22:04 2006  Kouhei Sutou  <kou@cozmixng.org>
+
+	* test/rss/test_image.rb: shared name space configuration.
+
+Sun Jun 18 18:13:25 2006  Kouhei Sutou  <kou@cozmixng.org>
+
+	* lib/rss/rss.rb: improved ignore_unknown_element
+	  handling. RSS::NotExpectedTagError provides tag URI.
+	* lib/rss/parser.rb: ditto.
+	* lib/rss/0.9.rb: ditto.
+	* lib/rss/1.0.rb: ditto.
+	* lib/rss/content.rb: ditto.
+	* lib/rss/dublincore.rb: ditto.
+	* lib/rss/image.rb: ditto.
+	* lib/rss/syndication.rb: ditto.
+	* lib/rss/taxonomy.rb: ditto.
+	* lib/rss/trackback.rb: ditto.
+
+	* test/rss/rss-assertions.rb: checked URI of not expected tag too.
+	* test/rss/test_parser.rb: ditto.
+
+Sun Jun 18 18:08:36 2006  Kouhei Sutou  <kou@cozmixng.org>
+
+	* lib/rss/rss.rb: changed empty namespace URI representation to ""
+	  from nil.
+	* lib/rss/parser.rb: ditto.
+	* lib/rss/0.9.rb: ditto.
+	* lib/rss/1.0.rb: ditto.
+	* lib/rss/2.0.rb: ditto.
+
+Sun Jun 18 18:03:50 2006  Kouhei Sutou  <kou@cozmixng.org>
+
+	* lib/rss/parser.rb: removed a guard for requiring open-uri.
+
+Sun Jun 18 18:01:26 2006  Kouhei Sutou  <kou@cozmixng.org>
+
+	* lib/rss/rss.rb: fixed typo: except -> expect
+	* lib/rss/parser.rb: ditto.
+	* test/rss/rss-assertions.rb: ditto.
+	* test/rss/test_parser.rb: ditto.
+
+Sun Jun 18 17:52:39 2006  Kouhei Sutou  <kou@cozmixng.org>
+
+	* lib/rss/rss.rb: RSS::Element#calc_indent became to be deprecated.
+	* lib/rss/0.9.rb: ditto.
+	* lib/rss/1.0.rb: ditto.
+	* lib/rss/image.rb: ditto.
+	* lib/rss/taxonomy.rb: ditto.
+	* lib/rss/trackback.rb: ditto.
+
+	* test/rss/test_1.0.rb: removed RSS::Element.indent_size tests.
+	* test/rss/test_2.0.rb: ditto.
+
+Sun Jun 18 00:49:11 2006  Tanaka Akira  <akr@m17n.org>
+
+	* ext/socket/socket.c (bsock_recv_nonblock): new method
+	  BasicSocket#recv_nonblock.
+	  (udp_recvfrom_nonblock): renamed from ip_recvfrom_nonblock.
+	  IPSocket#recvfrom_nonblock is moved to UDPSocket#recvfrom_nonblock.
+	  (unix_recvfrom_nonblock): removed.
+	  UNIXSocket#recvfrom_nonblock is removed.
+
+Sat Jun 17 22:17:17 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* lib/mathn.rb (Integer::prime_division): raise ZeroDivisionError
+	  on zeros.  [ruby-dev:28739]
+
+Sat Jun 17 14:53:32 2006  Tanaka Akira  <akr@m17n.org>
+
+	* lib/pathname.rb: backport from 1.9.
+	  (Kernel#Pathname): new method.
+
+Sat Jun 17 10:30:41 2006  Kouhei Sutou  <kou@cozmixng.org>
+
+	* lib/rss/rss.rb (Hash#merge, Enumerable#sort_by): removed.
+
+	* lib/rss/rss.rb (RSS::RootElementMixin#to_xml): added.
+	  [ruby-talk:197284]
+
+	  We can convert RSS version easily like the following:
+	    rss10 = RSS::Parser.parse(File.read("1.0.rdf"))
+	    File.open("2.0.rss", "w") {|f| f.print(rss10.to_xml("2.0"))}
+
+	* test/rss/test_1.0.rb: added #to_xml test.
+	* test/rss/test_2.0.rb: ditto.
+
+	* test/rss/rss-testcase.rb: added some helper methods that
+	  generates sample RSS 2.0.
+
+	* sample/rss/convert.rb: added a sample script to convert RSS format.
+
+Sat Jun 17 10:23:22 2006  Kouhei Sutou  <kou@cozmixng.org>
+
+	* lib/rss/rss.rb (Kernel#funcall): removed.
+	* lib/rss/parser.rb (Kernel.URI): removed.
+
+	* lib/rss/maker/: supported
+	    xxx.new_yyy do |yyy|
+	      yyy.zzz = zzz
+	      ...
 	    end
+	  style and this style became the style of the recommendation.
 
-	  Adding OCSP::SingleResponse at the same time allows exposing
-	  OCSP_check_validity(). With this, the code above can be rewritten as:
+	  Old style
+	    yyy = xxx.new_yyy
+	    yyy.zzz = zzz
+	    ...
+	  is supported too but this style isn't recommended.
+	  [ruby-talk:197284]
 
-	    basic = res.basic
-	    single = basic.find_response(certid_target)
-	    result = single.check_validity
+	* test/rss/test_*maker*.rb: used new recommended style.
 
-	* test/openssl/test_ocsp.rb: Test this.
+Sat Jun 17 09:03:47 2006  Kouhei Sutou  <kou@cozmixng.org>
 
-Sun Jun 19 18:40:19 2016  Kazuki Yamaguchi  <k@rhe.jp>
+	* lib/rss, test/rss: backported from trunk. (2005-11-16 - now)
 
-	* ext/openssl/ossl_ocsp.c (ossl_ocspbres_add_status): Allow specifying
-	  the times (thisUpdate, nextUpdate and revocationTime) with Time
-	  objects. Currently they accepts only relative seconds from the current
-	  time. This is inconvenience, especially for revocationTime. When
-	  Integer is passed, they are still treated as relative times. Since the
-	  type check is currently done with rb_Integer(), this is a slightly
-	  incompatible change. Hope no one passes a relative time as String or
-	  Time object...
-	  Also, allow passing nil as nextUpdate. It is optional.
+	* lib/rss/rss.rb (RSS::VERSION): 0.1.5 -> 0.1.6.
+	* test/rss/test_version.rb (RSS::TestVersion#test_version): ditto.
 
-	* ext/openssl/ruby_missing.h: Define RB_INTEGER_TYPE_P() if not defined.
-	  openssl gem will be released before Ruby 2.4.0.
+	* lib/rss/trackback.rb: added TrackBack prefix.
+	* lib/rss/maker/trackback.rb: ditto.
 
-Sun Jun 19 18:39:38 2016  Kazuki Yamaguchi  <k@rhe.jp>
+	* lib/rss/rss.rb : removed needless argument 'prefix'.
+	* lib/rss/parser.rb: ditto.
 
-	* ext/openssl/ossl_ocsp.c: Implement OCSP::{CertificateId,Request,
-	  BasicResponse,Response}#initialize_copy.
-	  [ruby-core:75504] [Bug #12381]
+	* lib/rss/1.0.rb: added rdf:Bag.
 
-	* test/openssl/test_ocsp.rb: Test them.
+	* lib/rss/taxonomy.rb: implemented taxonomy module.
+	* test/rss/test_taxonomy.rb: added tests for taxonomy support.
 
-Sun Jun 19 18:29:50 2016  Kazuki Yamaguchi  <k@rhe.jp>
+	* lib/rss/1.0.rb: added convenience method 'resources'.
+	* lib/rss/taxonomy.rb: ditto.
+	* test/rss/rss-assertions.rb: added test for 'resources'.
+	* test/rss/test_taxonomy.rb: ditto.
 
-	* ext/openssl/ossl_pkey_dh.c, ext/openssl/ossl_pkey_dsa.c,
-	  ext/openssl/ossl_pkey_ec.c, ext/openssl/ossl_pkey_rsa.c: Implement
-	  initialize_copy method for OpenSSL::PKey::*.
-	  [ruby-core:75504] [Bug #12381]
+	* lib/rss/rss.rb: fixed a indentation bug.
+	* lib/rss/taxonomy.rb: fixed <taxo:topic> #to_s bug.
+	* test/rss/test_taxonomy.rb: added a #to_s test.
 
-	* test/openssl/test_pkey_dh.rb, test/openssl/test_pkey_dsa.rb,
-	  test/openssl/test_pkey_ec.rb, test/openssl/test_pkey_rsa.rb: Test they
-	  actually copy the OpenSSL objects, and modifications to cloned object
-	  don't affect the original object.
+	* lib/rss/maker/taxonomy.rb: implemented taxonomy module for RSS
+	  Maker.
+	* lib/rss/taxonomy.rb: supported RSS Maker.
+	* lib/rss/maker.rb: added taxonomy module support.
 
-Sun Jun 19 16:55:16 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* lib/rss/rss.rb: adjusted to other element API.
+	* lib/rss/1.0.rb: adjusted to other element API but backward
+	  compatibility is reserved.
+	* lib/rss/0.9.rb: ditto.
 
-	* test/ruby/test_dir_m17n.rb: Skip tests with non-UTF-8 encodings
-	  on cygwin. Cygwin can use the Unicode PUA (private use area) to store
-	  bytes from non-UTF-8 filenames (see
-	  https://cygwin.com/cygwin-ug-net/using-specialnames.html#pathnames-specialchars),
-	  but we are not supporting this. [Bug #12443]
+	* test/rss/test_maker_taxo.rb: added test case for taxonomy module
+	  for RSS Maker.
+	* test/rss/test_setup_maker_1.0.rb: added tests for taxo:topic.
 
-Sun Jun 19 15:01:18 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* test/rss/test_setup_maker_1.0.rb: added backward compatibility
+	  test.
+	* test/rss/test_setup_maker_0.9.rb: ditto.
+	* test/rss/test_setup_maker_2.0.rb: ditto.
 
-	* localeinit.c: Fix filesystem encoding for cygwin to UTF-8 (see
-	  https://cygwin.com/cygwin-ug-net/using-specialnames.html#pathnames-unusual)
+	* test/rss/rss-testcase.rb: added convenience method for setting
+	  up taxo:topic.
+	* test/rss/rss-assertions.rb: added assertion for taxo:topic.
 
-Sun Jun 19 14:31:07 2016  Kazuki Yamaguchi  <k@rhe.jp>
+	* sample/rss/blend.rb: followed new API.
 
-	* ext/openssl/ossl_pkey.h, ext/openssl/ossl_pkey_dh.c,
-	  ext/openssl/ossl_pkey_dsa.c, ext/openssl/ossl_pkey_rsa.c: A few days
-	  ago, OpenSSL changed {DH,DSA,RSA}_get0_*() to take const BIGNUM **.
-	  https://git.openssl.org/gitweb/?p=openssl.git;a=commit;h=fd809cfdbd6e32b6b67b68c59f6d55fbed7a9327
-	  [ruby-core:75225] [Feature #12324]
+	* lib/rss/taxonomy.rb: changed class or module prefix to
+	  Taxonomy from Taxo.
+	* lib/rss/maker/taxonomy.rb: ditto.
 
-Sun Jun 19 11:19:43 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/rss/test_taxonomy.rb: use #reject directory.
 
-	* variable.c (rb_path_to_class): consider the string length
-	  instead of a terminator.
+	* lib/rss/: use #__send__ instead of #send.
+	* test/rss/: ditto.
 
-	* variable.c (rb_path_to_class): search the constant at once
-	  instead of checking if defined and then getting it.
+	* lib/rss/parser.rb: added entity handling type predicate.
+	* lib/rss/rexmlparser.rb: ditto.
+	* lib/rss/xmlparser.rb: ditto.
+	* lib/rss/xmlscanner.rb: ditto.
 
-Sat Jun 18 14:01:40 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* lib/rss/xmlscanner.rb: more robust entity handling.
 
-	* test/rubygems/test_gem_installer.rb: Fixed broken test with extension
-	  build. https://github.com/rubygems/rubygems/pull/1645
+	* test/rss/test_parser.rb: added an entity handling test.
 
-Sat Jun 18 13:59:54 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* test/rss/test_2.0.rb: added RSS 2.0 tests.
+	* test/rss/rss-assertions.rb: extended XML stylesheet assertion.
+	* lib/rss/0.9.rb: added initialize method.
+	* test/rss/test_1.0.rb: cleanup.
 
-	* lib/rubygems.rb, lib/rubygems/*, test/rubygems/*: Update rubygems
-	  HEAD(2c6d256). It contains to update vendored Molinillo to 0.5.0.
-	  https://github.com/rubygems/rubygems/pull/1638
+	* lib/rss/image.rb: added Image prefix.
+	* lib/rss/maker/image.rb: ditto.
 
-Sat Jun 18 10:13:37 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/rss/rss.rb: improved type conversion.
+	* lib/rss/1.0.rb: ditto.
+	* lib/rss/0.9.rb: ditto.
+	* lib/rss/2.0.rb: ditto.
+	* lib/rss/image.rb: ditto.
+	* lib/rss/syndication.rb: ditto.
 
-	* common.mk (build-ext), ext/extmk.rb: use variable EXTENCS
-	  different than ENCOBJS, to get rid of circular dependency.
-	  build libencs when linking encodings statically.
-	  [ruby-core:75618] [Bug #12401]
+	* test/rss/test_2.0.rb: added type conversion tests.
+	* test/rss/test_accessor.rb: ditto.
+	* test/rss/test_to_s.rb: ditto.
+	* test/rss/test_syndication.rb: ditto.
+	* test/rss/test_setup_maker_2.0.rb: ditto.
+	* test/rss/test_setup_maker_1.0.rb: ditto.
+	* test/rss/test_setup_maker_0.9.rb: ditto.
+	* test/rss/test_maker_sy.rb: ditto.
+	* test/rss/test_maker_image.rb: ditto.
+	* test/rss/test_maker_2.0.rb: ditto.
+	* test/rss/test_maker_0.9.rb: ditto.
+	* test/rss/test_image.rb: ditto.
 
-Sat Jun 18 08:52:46 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/rss/test_maker_1.0.rb: use assert instead of assert_equal.
 
-	* ext/stringio/stringio.c (strio_getline): fix pointer index
-	  overflow.  reported by Guido Vranken <guido AT guidovranken.nl>.
+	* test/rss/rss-assertions.rb: improved type conversion assertions.
 
-Thu Jun 16 16:35:35 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/rss/rss.rb: added backward compatibility codes.
+	* lib/rss/parser.rb: ditto.
+	* test/rss/test_parser.rb: ditto.
+	* test/rss/test_2.0.rb: ditto.
 
-	* class.c (Init_class_hierarchy): prevent rb_cObject which is the
-	  class tree root, from GC.  [ruby-dev:49666] [Bug #12492]
+Sat Jun 17 02:01:00 2006  Tanaka Akira  <akr@m17n.org>
 
-Thu Jun 16 12:17:52 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/pp.rb (Kernel#pretty_inspect): defined for pretty printed
+	  string.
 
-	* string.c (tr_trans): adjust buffer size by processed and rest
-	  lengths, instead of doubling repeatedly.
+Sat Jun 17 00:23:58 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Jun 16 11:15:25 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* parse.y (reswords): kDO_BLOCK was missing.  fixed: [ruby-core:7995]
 
-	* string.c (tr_trans): consider terminator length and fix heap
-	  overflow.  reported by Guido Vranken <guido AT guidovranken.nl>.
+Sat Jun 17 00:02:15 2006  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
 
-Thu Jun 16 00:02:32 2016  Kazuki Yamaguchi  <k@rhe.jp>
+	* ext/win32ole/win32ole.c (ole_propertyput): support
+	  PROPERTYPUTREF. [ruby-talk:183042]
 
-	* ext/openssl/ossl_ocsp.c (ossl_ocspreq_verify, ossl_ocspbres_verify):
-	  Use ossl_clear_error() so that they don't print warnings to stderr and
-	  leak errors in the OpenSSL error queue. Also, check the return value
-	  of OCSP_*_verify() correctly. They can return -1 on verification
-	  failure.
+	* ext/win32ole/tests/test_propertyputref.rb: ditto.
 
-Wed Jun 15 19:52:23 2016  Kazuki Yamaguchi  <k@rhe.jp>
+Thu Jun 15 23:02:47 2006  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
 
-	* ext/openssl/ossl_ocsp.c (ossl_ocspreq_sign, ossl_ocspbres_sign): Allow
-	  specifying hash algorithm used in signing. They are hard coded to use
-	  SHA-1.
-	  Based on a patch provided by Tim Shirley <tidoublemy@gmail.com>.
-	  [ruby-core:70915] [Feature #11552] [GH ruby/openssl#28]
+	* ext/win32ole/win32ole.c (fole_methods): The return value
+	  of WIN32OLE#ole_methods should include PROPERTYPUTREF methods.
 
-	* test/openssl/test_ocsp.rb: Test sign-verify works.
+	* ext/win32ole/win32ole.c (fole_put_methods): The return value
+	  of WIN32OLE#ole_put_methods should include PROPERTYPUTREF methods.
 
-Wed Jun 15 01:46:16 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/win32ole/tests/test_ole_methods.rb: ditto.
 
-	* numeric.c: [DOC] fix rdoc directive, and an example of negative
-	  value.  [ruby-core:76025] [Bug #12487]
+	* ext/win32ole/tests/testall.rb : ditto.
 
-Wed Jun 15 01:44:42 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Jun 14 18:23:28 2006  Eric Hodel  <drbrain@segment7.net>
 
-	* tool/mkconfig.rb: provide Unicode Version information as
-	  RbConfig::CONFIG['UNICODE_VERSION'].
-	  [ruby-core:75845] [Feature #12460]
+	* enum.c (enum_any): Documentation typo.
 
-Wed Jun 15 00:01:18 2016  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+Wed Jun 14 15:01:09 2006  Eric Hodel  <drbrain@segment7.net>
 
-	* test/ruby/enc/test_case_comprehensive.rb
-	  (TestComprehensiveCaseFold::read_data): use \A and \z instead of
-	  ^ and $ in regexp.
+	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser#warn): Don't print
+	  warnings when -q is set.
 
-Tue Jun 14 23:43:00 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Jun 14 23:03:53 2006  Tanaka Akira  <akr@m17n.org>
 
-	* include/ruby/backward.h (rb_cFixnum, rb_cBignum): remove the
-	  backward compatibility macros, to fail incompatible extension
-	  libraries early.  [Bug #12427]
+	* configure.in: check sizeof(rlim_t).
+	  check setrlimit.
 
-Tue Jun 14 22:22:07 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* process.c (proc_getrlimit): new method Process.getrlimit.
+	  (proc_setrlimit): new method Process.setrlimit.
 
-	* strftime.c (rb_strftime_with_timespec): limit the result string
-	  size by the format length, to get rid of unlimited memory use.
+	* ruby.h (NUM2ULL): new macro.
 
-Tue Jun 14 22:11:11 2016  Kazuki Yamaguchi  <k@rhe.jp>
+Mon Jun 12 22:25:09 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* ext/openssl/ossl_ocsp.c (ossl_ocspcid_get_issuer_name_hash,
-	  ossl_ocspcid_get_issuer_key_hash, ossl_ocspcid_get_hash_algorithm):
-	  Add accessor methods OCSP::CertificateId#issuer_name_hash,
-	  #issuer_key_hash, #hash_algorithm.
-	  Based on a patch provided by Paul Kehrer <paul.l.kehrer@gmail.com>.
-	  [ruby-core:48062] [Feature #7181]
+	* sprintf.c (rb_f_sprintf): adjust precision length to prevent
+	  splitting multi-byte characters.  [ruby-list:42389]
 
-	* test/openssl/test_ocsp.rb: Test these new methods.
+Sun Jun 11 23:20:07 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Jun 14 22:07:25 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/optparse.rb (OptionParser::Arguable#getopts): pass self to the
+	  parser.
 
-	* ext/date/date_strftime.c (date_strftime_with_tmx): reject too
-	  large precision to get rid of buffer overflow.
-	  reported by Guido Vranken <guido AT guidovranken.nl>.
+Sun Jun 11 10:00:57 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Tue Jun 14 21:40:42 2016  Kazuki Yamaguchi  <k@rhe.jp>
+	* win32/win32.h (write): not need to define on bcc.
 
-	* ext/openssl/ossl_ocsp.c (ossl_ocspbres_to_der, ossl_ocspcid_to_der):
-	  Implement #to_der methods for OCSP::BasicResponse and
-	  OCSP::CertificateId.
+Sun Jun 11 08:30:33 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	  (ossl_ocspreq_initialize, ossl_ocspres_initialize): Use GetOCSP*()
-	  instead of raw DATA_PTR().
+	* lib/optparse.rb (OptionParser#getopts): new methods.
 
-	  (ossl_ocspbres_initialize, ossl_ocspcid_initialize): Allow
-	  initializing from DER string.
+Sat Jun 10 18:02:40 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	  (Init_ossl_ocsp): Define new #to_der methods.
+	* ext/bigdecimal/lib/bigdecimal/newton.rb (Newton::nlsolve): typo
+	  fixed: raize -> raise.  [ruby-talk:196608]
 
-	* test/openssl/test_ocsp.rb: Test these changes. Also add missing tests
-	  for OCSP::{Response,Request}#to_der.
+Thu Jun  8 14:19:17 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Tue Jun 14 21:35:00 2016  Kazuki Yamaguchi  <k@rhe.jp>
+	* win32/win32.[ch] (rb_w32_read, rb_w32_write): new functions.
+	  use recv() and send() when fd is socket. fixed: [ruby-dev:28694]
 
-	* ext/openssl/openssl_missing.h (DH_set0_pqg, RSA_set0_key):
-	  DH_set0_pqg() allows 'q' to be NULL. Fix a typo in RSA_set0_key().
-	  Fixes r55285.  [ruby-core:75225] [Feature #12324]
+Wed Jun  7 16:22:51 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Mon Jun 14 10:19:00 2016  Kenta Murata  <mrkn@mrkn.jp>
+	* lib/tempfile.rb (Tempfile::make_tmpname): put dot between
+	  basename and pid.  [ruby-talk:196272]
 
-	* NEWS: describe Integer#digits.
+Wed Jun  7 14:53:04 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Mon Jun 13 21:09:40 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* win32/win32.c (errmap): add some winsock errors.
 
-	* thread.c (debug_deadlock_check): show thread lock dependency and
-	  backtrace [Feature #8214] [ruby-dev:47217]
+Wed Jun  7 11:34:38 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* thread.c (thread_status_name): show "sleep_forever" instead of
-	  "sleep" if called from inspect.
+	* configure.in: add new configure option `--with-winsock2' for mingw.
 
-Mon Jun 13 20:50:07 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* win32/Makefile.sub (config.h): define USE_WINSOCK2 in config.h
+	  instead of in CPPFLAGS.
 
-	* parse.y (reg_named_capture_assign_iter): remove named capture
-	  conflict warnings.  it is just annoying rather than useful.
-	  [ruby-core:75416] [Bug #12359]
+	* ext/socket/extconf.rb: determine whether to use winsock2 or not
+	  by using with_config.
 
-Mon Jun 13 20:04:00 2016  Kenta Murata  <mrkn@mrkn.jp>
+Wed Jun  7 10:45:10 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* numeric.c (rb_int_digits, rb_fix_digits, rb_int_digits_bigbase):
-	  Add Integer#digits to extract columns in place-value notation
-	  [Feature #12447] [ruby-core:75799]
+	* win32/{configure.bat, setup.mak, Makefile.sub, win32.h}: add
+	  new configure option `--with-winsock2'.
 
-	* test/ruby/test_integer.rb: Add tests for the above change.
+	* win32/win32.c (StartSockets): ditto.
 
-	* test/ruby/test_bignum.rb: ditto.
+	* ext/socket/extconf.rb: ditto.
 
-Mon Jun 13 20:34:53 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* win32/win32.c (open_ifs_socket): new function.
 
-	* include/ruby/ruby.h (RUBY_INTEGER_UNIFICATION): macro to tell if
-	  Integer is integrated.  [ruby-core:75718][Bug #12427]
+	* win32/win32.c (StartSockets, rb_w32_socket): use open_ifs_socket()
+	  instead of socket().
+	  ifs socket support is backported from trunk.
 
-	* include/ruby/backward.h, internal.h (rb_cFixnum, rb_cBignum):
-	  fallback to rb_cInteger.
+Wed Jun  7 09:14:44 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* bignum.c, numeric.c, ext/json/generator/generator.{c,h}: use the
-	  macro.
+	* eval.c (rb_call0): binding for the return event hook should have
+	  consistent scope.  [ruby-core:07928]
 
-Mon Jun 13 16:58:53 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* eval.c (EXEC_EVENT_HOOK): trace_func may remove itself from
+	  event_hooks.	no guarantee for arbitrary hook deletion.
+	  [ruby-dev:28632]
 
-	* test/ruby/enc/test_case_comprehensive.rb: Add tests for full Unicode
-	  swapcase.
+Mon Jun  5 18:12:12 2006  Tanaka Akira  <akr@m17n.org>
 
-Sun Jun 12 14:48:00 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* ext/socket/socket.c (sock_s_unpack_sockaddr_in): reject
+	  non-AF_INET/AF_INET6 sockaddr.
+	  (sock_s_unpack_sockaddr_un): reject non-AF_UNIX sockaddr.
+	  [ruby-dev:28691]
 
-	* test/ruby/enc/test_case_comprehensive.rb: Add tests for ASCII-only
-	  swapcase; store calculated values in hashes.
+Sun Jun  4 20:40:19 2006  Tanaka Akira  <akr@m17n.org>
 
-Sun Jun 12 14:05:45 2016  Kazuki Yamaguchi  <k@rhe.jp>
+	* ext/socket/socket.c: fix sockaddr_un handling.
+	  [ruby-dev:28677]
 
-	* ext/openssl/ossl_cipher.c (ossl_cipher_get_auth_tag,
-	  ossl_cipher_set_auth_tag): Check if the cipher flags retrieved by
-	  EVP_CIPHER_CTX_flags() includes EVP_CIPH_FLAG_AEAD_CIPHER to see if
-	  the cipher supports AEAD. AES-GCM was the only supported in OpenSSL
-	  1.0.1.
+Fri Jun  2 22:08:17 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	  (Init_ossl_cipher): Fix doc; OpenSSL::Cipher::AES.new(128, :GCM) can't
-	  work.
+	* lib/forwardable.rb: RDoc typo fix from Jan Svitok
+	  <jan.svitok at gmail.com>.  [ruby-core:07943]
 
-	* ext/openssl/openssl_missing.h: Define EVP_CTRL_AEAD_{GET,SET}_TAG if
-	  missing. They are added in OpenSSL 1.1.0, and have the same value as
-	  EVP_CTRL_GCM_{GET,SET}_TAG and EVP_CTRL_CCM_{GET,SET}_TAG.
+Fri Jun  2 19:02:09 2006  GOTOU Yuuzou  <gotoyuzo@notwork.org>
 
-Sun Jun 12 13:47:42 2016  Kazuki Yamaguchi  <k@rhe.jp>
+	* ext/openssl/extconf.rb: use create_header.
 
-	* test/openssl/test_engine.rb (test_openssl_engine_builtin,
-	  test_openssl_engine_by_id_string): Skip test if 'openssl' engine is
-	  already loaded. And test the number increased by Engine.load{_by_id,},
-	  not the total count of loaded engines. Previously, we called
-	  OpenSSL::Engine.cleanup every time running a test case, but we no
-	  longer can do it.
-	  [ruby-core:75225] [Feature #12324]
+	* ext/openssl/ossl.h, ext/openssl/openssl_missing.h:
+	  include RUBY_EXTCONF_H.
 
-Sun Jun 12 09:24:34 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Jun  2 17:16:52 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* file.c (append_fspath): normalize directory name to be appended
-	  on OS X.  [ruby-core:75957] [Ruby trunk Bug#12483]
-	  https://github.com/rails/rails/issues/25303#issuecomment-224834804
+	* lib/mkmf.rb (CLEANINGS): remove extconf.h by distclean if created.
 
-Sat Jun 11 23:07:32 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+Fri Jun  2 00:11:19 2006  Tanaka Akira  <akr@m17n.org>
 
-	* lib/forwardable.rb (_delegator_method): get rid of a warning which
-	  causes test failures introduced at r55376.
+	* ext/socket/socket.c (s_recvfrom): alen may be zero with UNIXSocket
+	  too.  (tested on NetBSD 3.0)
+	  (s_recvfrom_nonblock): extracted from sock_recvfrom_nonblock.
+	  (sock_recvfrom_nonblock): use s_recvfrom_nonblock.
+	  (ip_recvfrom_nonblock): new method: IPSocket#recvfrom_nonblock
+	  (unix_recvfrom_nonblock): new method: UNIXSocket#recvfrom_nonblock
+	  (s_accept_nonblock): extracted from sock_accept_nonblock.
+	  (sock_accept_nonblock): use s_accept_nonblock.
+	  (tcp_accept_nonblock): new method: TCPServer#accept_nonblock
+	  (unix_accept_nonblock): new method: UNIXServer#accept_nonblock
 
-Sat Jun 11 18:37:58 2016  Marcus Stollsteimer  <sto.mar@web.de>
+Thu Jun  1 19:12:37 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/json/lib/*.rb: Removed some comments. Because these are unnecessary
-	  class description. [ci skip][Bug #12255][ruby-core:74835]
+	* win32/win32.c (rb_w32_cmdvector): backslashes inside single-quotes
+	  no longer has special meanings.  fixed: [ruby-list:42311]
 
-Sat Jun 11 15:19:38 2016  takiy33  <takiy33@users.noreply.github.com>
+Thu Jun  1 16:14:41 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/net/smtp.rb: [DOC] Remove dead link on documentation for
-	  Japanese of SMTP.  [Fix GH-1380]
+	* win32/win32.c (rb_w32_getcwd): runtime's getcwd() will not success
+	  if the length of the cwd is longer than MAX_PATH.
+	  fixed [ruby-list:42335]
 
-Sat Jun 11 15:02:45 2016  Grant Hutchins  <github@nertzy.com>
+Thu Jun  1 11:29:14 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* string.c (rb_str_oct): [DOC] fix typo, hornored -> honored.
-	  [Fix GH-1379]
+	* win32/win32.c (rb_w32_getcwd): set errno if not set.
+	  fixed [ruby-list:42346]
 
-Sat Jun 11 14:04:19 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat May 27 11:29:46 2006  nobuyoshi nakada  <nobu@ruby-lang.org>
 
-	* ext/objspace/objspace_dump.c: generate valid JSON for dump_all.
+	* ext/extmk.rb (extmake): remove extinit files if no statically linked
+	  extensions.
 
-Sat Jun 11 13:52:33 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri May 26 09:05:11 2006  nobuyoshi nakada  <nobu@ruby-lang.org>
 
-	* lib/forwardable.rb (_delegator_method): remove __send__ call if
-	  possible, so that more optimizations will be enabled.
+	* ruby.h, lib/mkmf.rb (create_header): clear command line options for
+	  macros moved to extconf.h.
 
-Sat Jun 11 11:24:36 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/extmk.rb (extract_makefile, extmk): made RUBY_EXTCONF_H and
+	  EXTSTATIC permanent.
 
-	* enc/iso_8859.h (SHARP_s): name frequently used codepoint.
+	* ext/{dbm,digest/*,socket,zlib}/extconf.rb: used $defs and $INCFLAGS.
 
-Sat Jun 11 09:58:45 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* {bcc32,win32,wince}/Makefile.sub (COMPILE_C, COMPILE_CXX): added
+	  $(INCFLAGS).
 
-	* enc/iso_8859_1.c: Revert to older version of code.
+	* lib/mkmf.rb (configuration): add $defs unless extconf.h was created.
 
-Sat Jun 11 09:46:17 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Thu May 25 01:52:07 2006  nobuyoshi nakada  <nobu@ruby-lang.org>
 
-	* enc/iso_8859_1.c: Implement non-ASCII case mapping.
+	* lib/mkmf.rb (pkg_config): particular config commands support.
 
-	* test/ruby/enc/test_case_comprehensive.rb: Tests for above.
+	* ext/extmk.rb: deal with $static set in extconf.rb.
 
-	* string.c: Add iso-8859-1 to supported encodings.
+	* mkconfig.rb: merge multiple entries to an entry with multiple lines.
 
-Sat Jun 11 09:31:28 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/mkmf.rb: allow a series of commands to link.
 
-	* lib/forwardable.rb (_delegator_method): leave the backtrace
-	  untouched during accessor.  forwardable.rb does not appear in
-	  the backtrace during delegated method because of tail-call
-	  optimization.
+	* win32/Makefile.sub: embed manifests.
 
-Sat Jun 11 01:38:31 2016  Naohisa Goto  <ngotogenome@gmail.com>
+	* win32/setup.mak: suffix OS name by runtime version.
 
-	* include/ruby/defines.h (GCC_VERSION_SINCE): Fix logic error by
-	  adding parentheses. Fix failures of TestMkmf::TestConvertible
-	  with GCC 3.4.3 on Solaris 10. [Bug #12479] [ruby-dev:49660]
+Wed May 24 23:52:11 2006  nobuyoshi nakada  <nobu@ruby-lang.org>
 
-Fri Jun 10 21:54:24 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* configure.in (ac_install_sh): ignore dummy install-sh.
+	  [ruby-talk:193876]
 
-	* lib/forwardable.rb (Forwardable._delegator_method): extract
-	  method generator and deal with non-module objects.
-	  [ruby-dev:49656] [Bug #12478]
+Wed May 24 03:10:48 2006  GOTOU Yuuzou  <gotoyuzo@notwork.org>
 
-Fri Jun 10 17:35:11 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* ext/openssl/lib/openssl/ssl.rb
+	  (OpenSSL::SSL::SocketForwarder#setsockopt,getsockopt): typo fixed.
 
-	* string.c: Special-case :ascii option in rb_str_capitalize_bang and
-	  rb_str_swapcase_bang.
+Mon May 22 17:54:12 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Fri Jun 10 17:12:24 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* ext/socket/socket.c (sock_recvfrom_nonblock): use rb_read_pending
+	  instead of rb_io_read_pending.
+	  [ruby-dev:28663]
 
-	* string.c: Special-case :ascii option in rb_str_upcase_bang (retry).
+Mon May 22 17:30:04 2006  Tanaka Akira  <akr@m17n.org>
 
-Fri Jun 10 14:48:36 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* rubyio.h (rb_io_set_nonblock): declared.
 
-	* hash.c (get_env_cstr): ensure NUL-terminated.
-	  [ruby-dev:49655] [Bug #12475]
+	* io.c (rb_io_set_nonblock): new function.
+	  (io_getpartial): nonblocking read support.
+	  (io_read_nonblock): new method: IO#read_nonblock.
+	  (io_write_nonblock): new method: IO#write_nonblock.
 
-	* string.c (rb_str_fill_terminator): return the pointer to the
-	  NUL-terminated content.
+	* ext/socket/socket.c
+	  (sock_connect_nonblock): new method: Socket#connect_nonblock.
+	  (sock_accept_nonblock): new method: Socket#accept_nonblock.
+	  (sock_recvfrom_nonblock): new method: Socket#recvfrom_nonblock.
 
-Thu Jun  9 21:42:00 2016  Kazuki Yamaguchi  <k@rhe.jp>
+	  [ruby-core:7917]
 
-	* ext/openssl/ossl_asn1.c (asn1integer_to_num): Use
-	  ASN1_ENUMERATED_to_BN() to convert an ASN1_ENUMERATED to a BN.
-	  Starting from OpenSSL 1.1.0, ASN1_INTEGER_to_BN() rejects
-	  non-ASN1_INTEGER objects. The format of INTEGER and ENUMERATED are
-	  almost identical so they behaved in the same way in OpenSSL <= 1.0.2.
-	  [ruby-core:75225] [Feature #12324]
+Mon May 22 15:57:39 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* test/openssl/test_asn1.rb (test_decode_enumerated): Test that it
-	  works.
+	* eval.c (umethod_bind): should not update original class.
+	  [ruby-dev:28636]
 
-Thu Jun  9 21:10:04 2016  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+Mon May 22 13:38:57 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* tool/ifchange: fix timestamp error when target without
-	  directory.
+	* eval.c (ev_const_get): should support constant access from
+	  within instance_eval().  [ruby-dev:28327]
 
-Thu Jun  9 19:46:22 2016  Kazuki Yamaguchi  <k@rhe.jp>
+Thu May 18 17:51:32 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* ext/openssl/ossl_ssl.c: Add define guards for OPENSSL_NO_EC.
-	  SSL_CTX_set_ecdh_auto() is defined even when ECDH is disabled in
-	  OpenSSL's configuration. This fixes r55214.
+	* time.c (time_timeval): should round for usec floating
+	  number.  [ruby-core:07896]
 
-	* test/openssl/test_pair.rb (test_ecdh_curves): Skip if the OpenSSL does
-	  not support ECDH.
+	* time.c (time_add): ditto.
 
-	* test/openssl/utils.rb (start_server): Ignore error in
-	  SSLContext#ecdh_curves=.
+Thu May 18 17:11:45 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Thu Jun  9 18:12:42 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/cgi.rb (CGI::out): support utf-8.  a patch from Fujioka
+	  <fuj at rabbix.jp>.  [ruby-dev:28649]
 
-	* Makefile.in (un-runnable): fail with proper error message.
-	  [ruby-core:75905] [Bug #12472]
+Thu May 18 00:42:12 2006  nobuyoshi nakada  <nobu@ruby-lang.org>
 
-Thu Jun  9 15:32:17 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/extmk.rb, lib/mkmf.rb: use BUILD_FILE_SEPARATOR in Makefiles.
 
-	* common.mk (RBCONFIG): use ifchange tool to see if the content is
-	  changed and update the timestamp file.
+Wed May 17 17:55:26 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* tool/mkconfig.rb: remove ifchange features.
+	* dir.c (sys_warning): should not call a vararg function
+	  rb_sys_warning() indirectly.  [ruby-core:07886]
 
-	* tool/ifchange: make target directory if it does not exist with
-	  its parent directories.
+Wed May 17 08:17:15 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* win32/ifchange.bat: drop support for command.com used on old
-	  systems.
+	* util.c (ruby_strtod): try to reduce errors using powersOf10
+	  table.  [ruby-dev:28644]
 
-Thu Jun  9 15:03:35 2016  Kazuki Yamaguchi  <k@rhe.jp>
+Tue May 16 15:34:18 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* ext/openssl/extconf.rb: Check for CRYPTO_malloc() and SSL_new().
-	  OpenSSL_add_all_digests() and SSL_library_init() are deprecated and
-	  converted to macros in OpenSSL 1.1.0.
-	  [ruby-core:75225] [Feature #12324]
+	* re.c (rb_reg_initialize): should not allow modifying literal
+	  regexps.  frozen check moved from rb_reg_initialize_m as well.
 
-Wed Jun  8 23:09:51 2016  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+Tue May 16 09:20:16 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* string.c (rb_str_ascii_casemap): fix compile error.
+	* re.c (rb_reg_initialize): should not modify untainted objects in
+	  safe levels higher than 3.
 
-Wed Jun  8 22:22:24 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* re.c (rb_memcmp): type change from char* to const void*.
 
-	* string.c: Revert previous commit (possibility of endless loop).
+	* dir.c (dir_close): should not close untainted dir stream.
 
-Wed Jun  8 21:57:41 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* dir.c (GetDIR): add tainted/frozen check for each dir operation.
 
-	* string.c: Special-case :ascii option in rb_str_upcase_bang.
+Mon May 15 17:42:39 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Wed Jun  8 21:28:36 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_symbol_arg):
+	  typo fixed.  a patch from Florian Gross <florg at florg.net>.
 
-	* string.c: New static function rb_str_ascii_casemap; special-casing
-	  :ascii option in rb_str_upcase_bang and rb_str_downcase_bang.
+Sat May 13 16:14:05 2006  Tanaka Akira  <akr@m17n.org>
 
-	* regenc.c: Fix a bug (wrong use of unnecessary slack at end of string).
+	* lib/pp.rb (PP.mcall): new method.
+	  (Struct#pretty_print): call Kernel#class and Struct#members even if
+	  overridden.
+	  (Struct#pretty_print_cycle): ditto.
+	  [ruby-core:7865]
 
-	* regenc.h -> include/ruby/oniguruma.h: Move declaration of
-	  onigenc_ascii_only_case_map so that it is visible in string.c.
+Thu May 11 19:57:00 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Wed Jun  8 20:33:44 2016  Naohisa Goto  <ngotogenome@gmail.com>
+	* util.c (ruby_strtod): differ addition to minimize error.
+	  [ruby-dev:28619]
 
-	* include/ruby/intern.h: Remove excess semicolons in PUREFUNC().
-	  Fix failure of TestMkmf::TestConvertible on Solaris with
-	  Oracle Solaris Studio 12. [ruby-dev:49651] [Bug #12470]
-	* internal.h: ditto.
+Fri Aug 11 15:39:25 2006  Eric Hodel  <drbrain@segment7.net>
 
-Wed Jun  8 16:03:09 2016  Shugo Maeda  <shugo@ruby-lang.org>
+	* lib/yaml/tag.rb: Replace nodoc with stopdoc so Module methods get
+	  documented.
 
-	* lib/net/smtp.rb (getok, get_response): raise an ArgumentError when
-	  CR or LF is included in a line, because they are not allowed in
-	  RFC5321.  Thanks, Jeremy Daer.
+Thu May 11 18:10:43 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Tue Jun  7 21:27:25 2016  Kazuki Yamaguchi  <k@rhe.jp>
+	* util.c (ruby_strtod): should not raise ERANGE when the input
+	  string does not have any digits.  [ruby-dev:28629]
 
-	* test/rubygems/*_{cert,cert_32}.pem: Regenerate test certificates for
-	  OpenSSL 1.1.0. This is already in upstream.
-	  https://github.com/rubygems/rubygems/commit/9be5c53939440a61c4bba73cfffbeb5cfadf72be
-	  [ruby-core:75225] [Feature #12324]
+Sun May  7 03:09:51 2006  Stephan Maka  <stephan@spaceboyz.net>
 
-Tue Jun  7 21:27:17 2016  Kazuki Yamaguchi  <k@rhe.jp>
+	* lib/resolv.rb (Resolv::DNS::Requester::ConnectedUDP#initialize):
+	  Use AF_INET6 for nameservers containing colons.
 
-	* test/open-uri/test_ssl.rb: Regenerate test certificates. The test CA
-	  certificate was incorrectly generated. A CA certificate must have the
-	  basic constraints extension with cA bit set to TRUE. OpenSSL <= 1.0.2
-	  allowed the error when the certificate is in the trusted store but
-	  OpenSSL 1.1.0 no longer does.
-	  [ruby-core:75225] [Feature #12324]
+Sat May  6 00:38:42 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Tue Jun  7 21:20:38 2016  Kazuki Yamaguchi  <k@rhe.jp>
+	* signal.c (trap): sig should be less then NSIG.  Coverity found
+	  this bug.  a patch from Kevin Tew <tewk at tewk.com>.
+	  [ruby-core:07823]
 
-	* test/openssl/test_x509name.rb: Don't register OID for 'emailAddress'
-	  and 'serialNumber'. A recent change in OpenSSL made OBJ_create()
-	  reject an already existing OID. They were needed to run tests with
-	  OpenSSL 0.9.6 which is now unsupported.
-	  https://git.openssl.org/gitweb/?p=openssl.git;a=commit;h=52832e470f5fe8c222249ae5b539aeb3c74cdb25
-	  [ruby-core:75225] [Feature #12324]
+Thu May  4 02:24:16 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* test/openssl/test_ssl_session.rb (test_server_session): Duplicate
-	  SSL::Session before re-adding to the session store. OpenSSL 1.1.0
-	  starts rejecting SSL_SESSION once removed by SSL_CTX_remove_session().
-	  https://git.openssl.org/gitweb/?p=openssl.git;a=commit;h=7c2d4fee2547650102cd16d23f8125b76112ae75
+	* ext/syck/emitter.c (syck_scan_scalar): avoid accessing
+	  uninitialized array element.  a patch from Pat Eyler
+	  <rubypate at gmail.com>.  [ruby-core:07809]
 
-	* test/openssl/test_pkey_ec.rb (setup): Remove X25519 from @keys. X25519
-	  is new in OpenSSL 1.1.0 but this is for key agreement and not for
-	  signing.
+	* array.c (rb_ary_fill): initialize local variables first.  a
+	  patch from Pat Eyler <rubypate at gmail.com>.  [ruby-core:07810]
 
-	* test/openssl/test_pair.rb, test/openssl/test_ssl.rb,
-	  test/openssl/utils.rb: Set security level to 0 when using aNULL cipher
-	  suites.
+	* ext/syck/yaml2byte.c (syck_yaml2byte_handler): need to free
+	  type_tag.  a patch from Pat Eyler <rubypate at gmail.com>.
+	  [ruby-core:07808]
 
-	* test/openssl/utils.rb: Use 1024 bits DSA key for client certificates.
+Wed May  3 02:12:07 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* test/openssl/test_engine.rb: Run each test in separate process.
-	  We can no longer cleanup engines explicitly as ENGINE_cleanup() was
-	  removed.
-	  https://git.openssl.org/gitweb/?p=openssl.git;a=commit;h=6d4fb1d59e61aacefa25edc4fe5acfe1ac93f743
+	* ext/socket/socket.c (make_hostent_internal): accept ai_family
+	  check from Sam Roberts <sroberts at uniserve.com>.
+	  [ruby-core:07691]
 
-	* ext/openssl/ossl_engine.c (ossl_engine_s_cleanup): Add a note to the
-	  RDoc for Engine.cleanup.
+Mon May  1 12:23:19 2006    <sinara@blade.nagaokaut.ac.jp>
 
-	* ext/openssl/lib/openssl/digest.rb: Don't define constants for DSS,
-	  DSS1 and SHA(-0) when using with OpenSSL 1.1.0. They are removed.
+	* numeric.c (num_div): use floor rather than rb_Integer().
+	  [ruby-dev:28589]
 
-	* test/openssl/test_digest.rb, test/openssl/test_pkey_dsa.rb,
-	  test/openssl/test_pkey_dsa.rb, test/openssl/test_ssl.rb,
-	  test/openssl/test_x509cert.rb, test/openssl/test_x509req.rb: Don't
-	  test unsupported hash functions.
+	* numeric.c (flo_divmod): the first element of Float#divmod should
+	  be an integer. [ruby-dev:28589]
 
-Tue Jun  7 17:49:52 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* test/ruby/test_float.rb: add tests for divmod, div, modulo and remainder.
 
-	* test/ruby/enc/test_case_comprehensive: Change test for encodings
-	  without any non-ASCII case conversions from ASCII-only test
-	  to full test.
+Sat Apr 29 22:42:08 2006  GOTOU Yuuzou  <gotoyuzo@notwork.org>
 
-Tue Jun  7 17:18:39 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* ext/openssl/ossl_asn1.c (ossl_asn1_decode0): should initialize
+	  flag. [ruby-core:07785]
 
-	* string.c (rb_str_upcase_bang, rb_str_capitalize_bang,
-	  rb_str_swapcase_bang): Switch to use primitive.
+Fri Apr 28 10:53:16 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Tue Jun  7 16:44:16 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* util.c (ruby_strtod): should not cut off 18 digits for no
+	  reason.  [ruby-core:07796]
 
-	* string.c (rb_str_downcase_bang): Switch to use primitive except if
-	  conversion can be done ASCII-only.
+	* util.c (ruby_strtod): fixed wrong conversion.
 
-Tue Jun  7 16:13:36 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Thu Apr 27 01:38:10 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* test/ruby/enc/test_case_comprehensive: Add regression tests for
-	  current ASCII-only case conversion.
+	* array.c (rb_ary_fill): internalize local variable "beg" to
+	  pacify Coverity.  [ruby-core:07770]
 
-Tue Jun  7 15:28:38 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Wed Apr 26 16:59:24 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* test/ruby/enc/test_case_comprehensive: Fix method name
-	  (generate_casefold_tests -> generate_case_mapping_tests).
+	* pack.c (pack_unpack): now supports CRLF newlines.  a patch from
+	  <tommy at tmtm.org>.  [ruby-dev:28601]
 
-Tue Jun  7 15:05:13 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Tue Apr 25 18:00:05 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-	* regenc.h/c: Rename onigenc_not_support_case_map to
-	  onigenc_ascii_only_case_map.
+	* ext/tk/tcltklib.c (delete_slaves): maybe increment the reference
+	  count of a NULL Tcl_Obj [ruby-core:07759].
 
-	* regenc.h: Add definition of onigenc_single_byte_ascii_only_case_map.
+Tue Apr 25 07:55:31 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* enc/iso_8859_X.c, windows_125X.c, ascii.c, us-ascii.c, koi8_x.c:
-	  Replace onigenc_not_support_case_map by
-	  onigenc_single_byte_ascii_only_case_map.
+	* lib/jcode.rb (String::tr_s): should have translated non
+	  squeezing character sequence (i.e. a character) as well.  thanks
+	  to Hiroshi Ichikawa <gimite at gimite.ddo.jp> [ruby-list:42090]
 
-	* enc/big5.c, cp949.c, emacs_mule.c, euc_X.c, gbX.c, shift_jis.c,
-	  windows_31j.c: Replace onigenc_not_support_case_map by
-	  onigenc_ascii_only_case_map.
+Tue Apr 25 00:08:24 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Tue Jun  7 14:57:09 2016  Kazuki Yamaguchi  <k@rhe.jp>
+	* regex.c (re_compile_pattern): should check if c is not a
+	  multibyte character.  a patch from KIMURA Koichi
+	  <kimura.koichi at canon.co.jp>.  [ruby-dev:28598]
 
-	* ext/openssl/extconf.rb: Check for SSL_CTX_set_min_proto_version()
-	  macro added in OpenSSL 1.1.0. Version-specific methods, such as
-	  TLSv1_method(), are deprecated in OpenSSL 1.1.0. We need to use
-	  version-flexible methods (TLS_*method() or SSLv23_*method()) and
-	  disable other protocol versions as necessary.
-	  [ruby-core:75225] [Feature #12324]
+Fri Apr 21 15:19:13 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-	* ext/openssl/ossl_ssl.c: Use SSL_CTX_set_{min,max}_proto_version() to
-	  fix the protocol version.
+	* ext/tk/tcltklib.c (lib_eventloop_ensure): refer freed pointer
+	  [ruby-core:07744] and memory leak.
 
-Tue Jun  7 12:55:34 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Fri Apr 21 12:14:52 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* regenc.c (onigenc_not_support_case_map): Move to end of file;
-	  (onigenc_single_byte_ascii_only_case_map): Add new function.
+	* ext/socket/socket.c: document update patch from Sam Roberts
+	  <sroberts at uniserve.com>.  [ruby-core:07701]
 
-Tue Jun  7 09:26:37 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Wed Apr 19 13:55:27 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* regenc.c (onigenc_not_support_case_map): Rewrite to work correctly
-	  in ASCII range.
+	* parse.y (arg): too much NEW_LIST()
 
-Mon Jun  6 23:00:00 2016  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+	* eval.c (SETUP_ARGS0): remove unnecessary access to nd_alen.
 
-	* appveyor.yml: Update libressl version to 2.3.5.
+Wed Apr 19 11:57:04 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Mon Jun  6 18:37:57 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* eval.c (rb_eval): use ARGSCAT for NODE_OP_ASGN1.
+	  [ruby-dev:28585]
 
-	* vm_insnhelper.c (vm_throw_start): check if the iseq is symbol
-	  proc, class definition should not be a symbol proc.
-	  [ruby-core:75856] [Bug #12462]
+	* parse.y (list_concat): revert last change.
 
-Mon Jun  6 18:36:34 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* parse.y (arg): use NODE_ARGSCAT for placeholder.
 
-	* string.c: Added UTF-16BE/LE and UTF-32BE/LE to supported encodings
-	  for Unicode case mapping.
+Wed Apr 19 11:13:17 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* test/ruby/enc/test_case_comprehensive.rb: Tests for above
-	  functionality; fixed an encoding issue in assertion error message.
+	* lib/getoptlong.rb (GetoptLong::get): RDoc update patch from
+	  mathew <meta at pobox.com>.  [ruby-core:07738]
 
-Mon Jun  6 17:29:35 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Wed Apr 19 10:13:27 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* test/ruby/enc/test_case_comprehensive.rb: Speed up testing for small
-	  encodings by preselecting codepoints.
+	* variable.c (rb_const_set): raise error when no target klass is
+	  supplied.  [ruby-dev:28582]
 
-Mon Jun  6 17:10:50 2016  Kazuki Yamaguchi  <k@rhe.jp>
+Wed Apr 19 09:49:36 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* ext/openssl/ossl_cipher.c (ossl_cipher_free): Use EVP_CIPHER_CTX_free()
-	  to free EVP_CIPHER_CTX allocated by EVP_CIPHER_CTX_new().
-	  [ruby-core:75225] [Feature #12324]
+	* parse.y (list_concat): should not modify nodes other than
+	  NODE_ARRAY.  [ruby-dev:28583]
 
-Mon Jun  6 13:37:08 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Tue Apr 18 17:40:37 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-	* string.c Change rb_str_casemap to use encoding primitive
-	  case_map instead of directly calling onigenc_unicode_case_map.
+	* ext/tk/lib/multi-tk.rb: add a binding to a container for a slave IP.
 
-Mon Jun  6 13:16:46 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* ext/tk/lib/tk.rb: update RELEASE_DATE.
 
-	* test/ruby/enc/test_case_mapping.rb:
-	  Remove :lithuanian guard for Unicode case mapping.
+	* ext/tk/tcltklib.c: forget to reset a Tcl interpreter.
 
-Mon Jun  6 10:39:56 2016  Kazuki Yamaguchi  <k@rhe.jp>
+	* ext/tk/stubs.c: fix potential bugs about handling rb_argv0.
 
-	* ext/openssl/openssl_missing.h: Include ruby/config.h. r55285 added
-	  some inline functions but VC does not recognize 'inline' keyword.
+Tue Apr 18 00:11:21 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Mon Jun  6 09:25:34 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* eval.c: block_unique should be 1, not frame_unique.
+	  [ruby-dev:28577]
 
-	* thread.c (thread_start_func_2): report raised exception if
-	  report_on_exception flag is set.  [Feature #6647]
+Fri Aug 11 15:39:25 2006  Eric Hodel  <drbrain@segment7.net>
 
-Mon Jun  6 01:36:24 2016  Kazuki Yamaguchi  <k@rhe.jp>
+	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser#find_body): Make RDoc
+	  ignore C function prototypes.  Patch by Tilman Sauerbeck
+	  <tilman at code-monkey.de>.  [ruby-core:8574]
+	* lib/yaml/tag.rb: Replace nodoc with stopdoc so Module methods get
+	  documented.
 
-	* ext/openssl/extconf.rb: Check existence of SSL_is_server(). This
-	  function was introduced in OpenSSL 1.0.2.
-	  [ruby-core:75225] [Feature #12324]
+Mon Apr 10 01:03:10 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* ext/openssl/openssl_missing.h: Implement SSL_is_server() if missing.
+	* prec.c (prec_prec_f): documentation patch from
+	  <gerardo.santana at gmail.com>.  [ruby-core:07689]
 
-	* ext/openssl/ossl_ssl.c (ssl_info_cb): Use SSL_is_server() to see if
-	  the SSL is server. The state machine in OpenSSL was rewritten and
-	  SSL_get_state() no longer returns SSL_ST_ACCEPT.
+Sat Apr  8 02:34:34 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	  (ossl_ssl_cipher_to_ary, ossl_sslctx_session_get_cb): Add some
-	  `const`s to suppress warning.
+	* bignum.c (rb_big_pow): second operand may be too big even if
+	  it's a Fixnum.  [ruby-talk:187984]
 
-Mon Jun  6 01:18:10 2016  Kazuki Yamaguchi  <k@rhe.jp>
+Sat Apr  8 02:12:38 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* ext/openssl/ossl_asn1.c (decode_bool): Do the same thing as
-	  d2i_ASN1_BOOLEAN() does by ourselves. This function is removed in
-	  OpenSSL 1.1.0.
-	  [ruby-core:75225] [Feature #12324]
+	* README.EXT: update symbol description.  [ruby-talk:188104]
 
-Mon Jun  6 00:34:16 2016  Kazuki Yamaguchi  <k@rhe.jp>
+Thu Apr  6 23:28:47 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* ext/openssl/extconf.rb: Check existence of accessor functions that
-	  don't exist in OpenSSL 0.9.8. OpenSSL 1.1.0 made most of its
-	  structures opaque and requires use of these accessor functions.
-	  [ruby-core:75225] [Feature #12324]
+	* COPYING: explicitly note GPLv2.  [ruby-talk:187922]
 
-	* ext/openssl/openssl_missing.[ch]: Implement them if missing.
+Thu Apr  6 11:18:37 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-	* ext/openssl/ossl*.c: Use these accessor functions.
+	* ext/tk/lib/tk/panedwindow.rb: lack of arguments. [ruby-core:7681]
 
-	* test/openssl/test_hmac.rb: Add missing test for HMAC#reset.
+Thu Apr  6 01:04:47 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-Mon Jun  6 00:00:13 2016  Kazuki Yamaguchi  <k@rhe.jp>
+	* ext/tk/tcltklib.c: fix SEGV when embedding to an application.
+	  [ruby-core:7600]
 
-	* ext/openssl/openssl_missing.[ch]: Implement EVP_PKEY_get0_*() and
-	  {RSA,DSA,EC_KEY,DH}_get0_*() functions.
-	  OpenSSL 1.1.0 makes EVP_PKEY/RSA/DSA/DH opaque. We used to provide
-	  setter methods for each parameter of each PKey type, for example
-	  PKey::RSA#e=, but this is no longer possible because the new API
-	  RSA_set0_key() requires the 'n' at the same time. This commit adds
-	  deprecation warning to them and adds PKey::*#set_* methods as direct
-	  wrapper for those new APIs. For example, 'rsa.e = 3' now needs to be
-	  rewritten as 'rsa.set_key(rsa.n, 3, rsa.d)'.
-	  [ruby-core:75225] [Feature #12324]
+	* ext/tk/tcltklib.c: fix SEGV at exit. [ruby-talk:186489]
 
-	* ext/openssl/ossl_pkey*.[ch]: Use the new accessor functions. Implement
-	  RSA#set_{key,factors,crt_params}, DSA#set_{key,pqg}, DH#set_{key,pqg}.
-	  Emit a warning with rb_warning() when old setter methods are used.
+	* ext/tk/tkutil/tkutil.c: follow to changing specification of
+	  instance_eval on ruby-1.9.x.
 
-	* test/drb/ut_array_drbssl.rb, test/drb/ut_drb_drbssl.rb,
-	  test/rubygems/test_gem_remote_fetcher.rb: Don't set a priv_key for DH
-	  object that are used in tmp_dh_callback. Generating a new key pair
-	  every time should be fine - actually the private exponent is ignored
-	  in OpenSSL >= 1.0.2f/1.0.1r even if we explicitly set.
-	  https://www.openssl.org/news/secadv/20160128.txt
+	* ext/tk/lib/tk.rb: ditto.
 
-Sun Jun  5 22:06:00 2016  Kenta Murata  <mrkn@mrkn.jp>
+	* ext/tk/lib/multi-tk.rb: ditto.
 
-	* configure.in: Fix the timing to detect the appropriate C++ compiler
-	  in OS X.
+	* ext/tk/lib/tk.rb: remove warning about redefinition of methods.
 
-Sun Jun  5 21:42:24 2016  Kazuki Yamaguchi  <k@rhe.jp>
+	* ext/tk/lib/tk/variable.rb: remove warning about unseting Tcl
+	  variables.
 
-	* ext/openssl/extconf.rb: Check absence of CRYPTO_lock() to see if the
-	  OpenSSL has the new threading API. In OpenSSL <= 1.0.2, an application
-	  had to set locking callbacks to use OpenSSL in a multi-threaded
-	  environment. OpenSSL 1.1.0 now finds pthreads or Windows threads so we
-	  don't need to do something special.
-	  [ruby-core:75225] [Feature #12324]
+Wed Mar 29 20:54:44 2006  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
 
-	  Also check existence of *_up_ref(). Some structures in OpenSSL have
-	  a reference counter. We used to increment it with CRYPTO_add() which
-	  is a part of the old API.
+	* ext/win32ole/win32ole.c (fole_getproperty): WIN32OLE#[] should accept
+	  multi arguments.
 
-	* ext/openssl/openssl_missing.h: Implement *_up_ref() if missing.
+	* ext/win32ole/tests/testWIN32OLE.rb (test_setproperty_bracket): ditto.
 
-	* ext/openssl/ossl.c: Don't set locking callbacks if unneeded.
+Wed Mar 29 10:07:44 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/openssl/ossl_pkey.c, ext/openssl/ossl_ssl.c,
-	  ext/openssl/ossl_x509cert.c, ext/openssl/ossl_x509crl.c,
-	  ext/openssl/ossl_x509store.c: Use *_up_ref() instead of CRYPTO_add().
+	* ext/nkf/nkf-utf8/nkf.c (nkf_each_char_to_hex, encode_fallback_subchar,
+	  e2w_conv): support C90 compiler.
 
-Sun Jun  5 21:38:13 2016  Kazuki Yamaguchi  <k@rhe.jp>
+Wed Mar 29 06:48:40 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* ext/openssl/extconf.rb: Check if RAND_pseudo_bytes() is usable. It is
-	  marked as deprecated in OpenSSL 1.1.0.
-	  [ruby-core:75225] [Feature #12324]
+	* eval.c (backtrace): reports aliased method names in a generated
+	  backtrace.  a patch from "U.Nakamura" <usa at garbagecollect.jp>.
+	  [ruby-dev:28471]
 
-	* ext/openssl/ossl_rand.c: Disable Random.pseudo_bytes if
-	  RAND_pseudo_bytes() is unavailable.
+Mon Mar 27 22:19:09 2006  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* test/openssl/test_random.rb: Don't test Random.pseudo_bytes if not
-	  defined.
+	* ext/nkf/nkf-utf8/{nkf.c, utf8tbl.c, config.h}: imported nkf 2.0.6.
+	  * Add --ic / --oc option and mapping tables.
+	  * Add fallback option.
+	  * Add --no-best-fit-chars option.
+	  * Fix some bugs.
 
-Sun Jun  5 19:06:40 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* ext/nkf/nkf.c (nkf_split_options): added for parse option string.
 
-	* NEWS: Add news about Unicode-wide case mapping for
-	  String/Symbol#upcase/downcase/swapcase/capitalize(!).
+	* ext/nkf/lib/kconv.rb (Kconv.to*): add -m0.
+	  Note that Kconv.to* still imply -X.
 
-Sun Jun  5 15:24:33 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Mon Mar 27 03:17:21 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* test/ruby/enc/test_case_comprehensive.rb:
-	  Remove :lithuanian guard for Unicode case mapping.
+	* eval.c (rb_call0): insecure calling should be checked for non
+	  NODE_SCOPE method invocations too.
 
-Sun Jun  5 14:46:34 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* eval.c (rb_alias): should preserve the current safe level as
+	  well as method definition.
 
-	* string.c: Remove :lithuanian guard for Unicode case mapping.
+Fri Mar 24 23:14:30 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Sat Jun  4 10:54:52 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* eval.c (yield_under_i): pass self again for instance_eval().
+	  [ruby-dev:28466]
 
-	* missing/crypt.h (struct crypt_data): remove unnecessary member
-	  "initialized".
+Fri Mar 24 17:20:03 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* missing/crypt.c (des_setkey_r): nothing to be initialized in
-	  crypt_data.
+	* process.c (rb_f_sleep): remove description about SIGALRM which
+	  is not valid on the current implementation.  [ruby-dev:28464]
 
-	* configure.in (struct crypt_data): check for "initialized" in
-	  struct crypt_data, which may be only in glibc, and isn't on AIX
-	  at least.
+Thu Mar 23 10:47:03 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Sat Jun  4 10:38:39 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* eval.c (method_missing): should support argument splat in
+	  super.  [ruby-talk:185438]
 
-	* win32/win32.c: unify MAX_PATH, _MAX_PATH, and MAXPATHLEN to
-	  PATH_MAX, except for MAX_PATH in get_special_folder for an API
-	  limit.
+Mon Mar 20 12:05:18 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Fri Jun  3 21:27:22 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* configure.in: Solaris SunPro compiler -rapth patch from
+	  <kuwa at labs.fujitsu.com>.  [ruby-dev:28443]
 
-	* ruby.c (process_options): rb_str_conv_enc() never set encoding
-	  of the source string, but returns the string itself if the
-	  conversion failed.  then the instance variable does not need to
-	  be set again.
+Mon Mar 20 09:40:23 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Fri Jun  3 18:04:37 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* configure.in: remove enable_rpath=no for Solaris.
+	  [ruby-dev:28440]
 
-	* ruby.c (process_options): need to duplicate path before passing it to
-	  rb_str_conv_enc() because the function might call rb_enc_associate()
-	  internally.  this fixes test failures on Windows introduced at r55260.
+Fri Mar 17 19:08:49 2006  GOTOU Yuuzou  <gotoyuzo@notwork.org>
 
-Fri Jun  3 17:44:25 2016  Reiner Herrmann  <reiner@reiner-h.de>
+	* ext/openssl/ossl_ssl.c, ext/openssl/ossl_nsspki.c: fix typo.
+	  [ruby-core:07571]
 
-	* lib/mkmf.rb (create_makefile): sort lists of source and object
-	  files in generated Makefile, unless given by extconf.rb.
-	  [Fix GH-1367]
+Wed Mar 15 16:54:21 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Thu Jun  2 21:18:10 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/mkmf.rb (create_makefile): support libraries without *.so.
 
-	* win32/win32.c (get_special_folder): use SHGetPathFromIDListEx if
-	  available instead of old SHGetPathFromIDListW, to check the
-	  buffer size.
+Wed Mar 15 16:35:43 2006  GOTOU Yuuzou  <gotoyuzo@notwork.org>
 
-Thu Jun  2 17:05:19 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/openssl/ossl_ssl.c, ext/openssl/ossl_nsspki.c: should use
+	  "rb_str_new(0, 0)" to make empty string.
 
-	* ruby.c (ruby_init_loadpath_safe): remove MAXPATHLEN restriction
-	  for Windows 10.
+Sat Mar 11 14:24:06 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Thu Jun  2 16:51:35 2016  Koichi ITO  <koic.ito@gmail.com>
+	* lib/rdoc/ri/ri_formatter.rb (RI::TextFormatter::wrap): removed
+	  space before argument parenthesis.  [ruby-talk:183630]
 
-	* misc/ruby-mode.el (ruby-here-doc-beg-re),
-	  (ruby-here-doc-beg-match, ruby-parse-partial): Support for
-	  `squiggly heredoc' syntax in ruby-mode.  [Fix GH-1372]
+	* ruby.1: a clarification patch from David Lutterkort
+	  <dlutter at redhat.com>.  [ruby-core:7508]
 
-Thu Jun  2 10:24:48 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Sat Mar  4 15:26:40 2006  Tanaka Akira  <akr@m17n.org>
 
-	* string.c: Raise ArgumentError when invalid string is detected in
-	  case mapping methods.
+	* gc.c (id2ref): fix symbol test.
 
-	* enc/unicode.c: Check for invalid string and signal with negative
-	  length value.
+Sat Mar  4 01:08:07 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* test/ruby/enc/test_case_mapping.rb: Add tests for above.
+	* lib/rdoc/ri/ri_paths.rb (RI::Paths): adding paths from rubygems
+	  directories.  a patch from Eric Hodel <drbrain at segment7.net>.
+	  [ruby-core:07423]
 
-	* test/ruby/test_m17n_comb.rb: Add a message to clarify test failure.
+Thu Mar  2 19:44:18 2006  Tanaka Akira  <akr@m17n.org>
 
-Wed Jun  1 21:41:05 2016  Kazuki Yamaguchi  <k@rhe.jp>
+	* gc.c: align VALUE with sizeof(RVALUE) globally.
+	  (is_pointer_to_heap): check alignment out of loop.
+	  (id2ref): avoid collision between symbols and objects.
+	  (rb_obj_id): ditto.  moved from object.c.
+	  [ruby-talk:178364] [ruby-core:7305]
 
-	* ext/openssl/extconf.rb: Check existence of ASN1_TIME_adj(). The old
-	  ASN1_TIME_set() is not Year 2038 ready on sizeof(time_t) == 4
-	  environment. This function was added in OpenSSL 1.0.0.
-	  [ruby-core:45552] [Bug #6571]
+Thu Mar  2 18:58:18 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* ext/openssl/ossl_asn1.c (ossl_time_split): Added. Split the argument
-	  (Time) into the number of days elapsed since the epoch and the
-	  remainder seconds to conform to ASN1_TIME_adj().
-	  (obj_to_asn1utime, obj_to_asn1gtime): Use ossl_time_split() and
-	  ASN1_*TIME_adj().
+	* eval.c (rb_thread_fd_writable): should not re-schedule output
+	  from KILLED thread (must be error printing).
 
-	* ext/openssl/ossl_asn1.h: Add the function prototype for
-	  ossl_time_split().
+Thu Mar  2 17:57:49 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
 
-	* ext/openssl/ossl_x509.[ch]: Add ossl_x509_time_adjust(). Similarly to
-	  obj_to_asn1*time(), use X509_time_adj_ex() instead of X509_time_adj().
+	* gc.c: commited magic for reducing RVALUE size on windows. (24->20byte)
+	  [ruby-core:7474]
 
-	* ext/openssl/ossl_x509cert.c, ext/openssl/ossl_x509crl.c,
-	  ext/openssl/ossl_x509revoked.c: Use ossl_x509_time_adjust().
+Thu Mar  2 12:59:14 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
 
-Wed Jun  1 15:58:20 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* win32/win32.c (filetime_to_unixtime): should set tm_isdst to -1.
+	  stat() didn't treat daylight saving time property on WinNT.
+	  [ruby-talk:182100]
 
-	* configure.in: revert r55237.  replace crypt, not crypt_r, and
-	  check if crypt is broken more.
+Thu Mar  2 08:02:42 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* missing/crypt.c: move crypt_r.c
+	* gc.c (add_heap): heap_slots may overflow.  a patch from Stefan
+	  Weil <weil at mail.berlios.de>.
 
-	* string.c (rb_str_crypt): use crypt_r if provided by the system.
+Wed Mar  1 00:24:31 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
 
-Wed Jun  1 14:07:53 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/rdoc/parsers/parse_rb.rb (read_escape): could not handle /\^/.
+	  merged Mr. Ishizuka's lib/irb/ruby-lex.rb 's patch rev 1.29.
+	  [ruby-talk:181631] [ruby-dev:28404]
 
-	* missing/crypt_r.c (a64toi): initialize statically and fix out of
-	  bounds access when salt is not 7bit clean.
+Tue Feb 28 09:32:17 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Wed Jun  1 11:34:59 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* lib/drb/extservm.rb (invoke_service_command): cannot invoke command
+	  if command name is quoted on mswin32. [ruby-dev:28400]
 
-	* win32/Makefile.sub (MISSING): fixed build error introduced at r55237.
+Mon Feb 27 00:19:16 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Wed Jun  1 09:48:06 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ruby.h (SYM2ID): should not cast to signed long.
+	  [ruby-core:07414]
 
-	* string.c (rb_str_crypt): use reentrant crypt_r.
+Fri Feb 24 20:07:23 2006  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
 
-Wed Jun  1 09:37:26 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* test/drb/drbtest.rb (add_service_command): quote pathnames in the
+	  server's command line for space contained directory names.
+	  Thanks, arton. [ruby-dev:28386]
 
-	* missing/crypt.c (des_setkey): void function never returns any value.
+Fri Feb 24 12:11:08 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Wed Jun  1 09:16:22 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* instruby.rb: install *.exe.manifest and *.dll.manifest if exist.
+	  It's for VC++8.
 
-	* crypt.h: separate header file from missing/crypt.c.
+Fri Feb 24 11:33:52 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
 
-	* missing/crypt.c (crypt_r, setkey_r, encrypt_r): add reentrant
-	  versions.
+	* bcc32/Makefile.sub (HAVE_HYPOT): bcc32 has hypot().
 
-Wed Jun  1 02:25:38 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Feb 24 11:19:58 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* missing/crypt.c: fix size macros to use configured values
-	  for platforms long is larger than 32bit.
-	  [ruby-core:75792] [Bug #12446]
+	* time.c (time_new_internal): add prototype to tell the compiler
+	  arugments types.
 
-Tue May 31 17:28:46 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* win32/win32.c (NtInitialize): need to set a handler for VC++8.
 
-	* lib/optparse.rb (OptionParser::Completion.candidate): get rid of
-	  nil as key names.  [ruby-core:75773] [Bug #12438]
+Fri Feb 24 08:19:16 2006  NARUSE, Yui  <naruse@ruby-lang.org>
 
-	* lib/optparse.rb (OptionParser#make_switch): char class option
-	  cannot be NoArgument, default to RequiredArgument.
+	* test.rb: Removed.  Obsolete by test/nkf.
 
-Tue May 31 00:30:11 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* ext/.document: enabled documents in nkf and kconv
 
-	* ext/socket/raddrinfo.c (host_str, port_str): Use StringValueCStr
-	  instead of (Safe)StringValue, to detect NUL byte in the string.
+	* ext/nkf/nkf.c ext/nkf/lib/kconv.rb: Add rdoc.
 
-Mon May 30 22:02:01 2016  Kazuki Yamaguchi  <k@rhe.jp>
+Thu Feb 23 22:39:59 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
 
-	* ext/openssl/ossl_asn1.c (time_to_time_t): Use NUM2TIMET() instead of
-	  NUM2LONG(). time_t may be larger than long.
-	  [ruby-core:45552] [Bug #6571]
+	* bcc32/Makefile.sub: use borlndmm.dll if possible. bcc32's RTL internal
+	  memory manager cannot handle large memory block properly.
+	  ex: 10000.times { "" << "." * 529671; GC.start } # crash
+	  [ruby-dev:28230]
 
-Mon May 30 21:15:37 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Thu Feb 23 13:20:28 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
 
-	* string.c: Document current behavior for other case mapping methods
-	  on String. [ci skip]
+	* eval.c (SETUP_ARGS0): fixed memory corruption. [ruby-dev:28360]
 
-Mon May 30 20:00:25 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Tue Feb 21 02:18:46 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* string.c: Document current situation for String#downcase. [ci skip]
+	* configure.in (mingw): have link.  [ruby-list:41838]
 
-Mon May 30 18:29:28 2016  Kazuki Yamaguchi  <k@rhe.jp>
+	* win32/Makefile.sub (config.h): ditto.
 
-	* ext/openssl/ossl_ssl.c (ossl_sslctx_s_alloc): Enable the automatic
-	  curve selection for ECDH by calling SSL_CTX_set_ecdh_auto(). With
-	  this a TLS server automatically selects a curve which both the client
-	  and the server support to use in ECDH. This changes the default
-	  behavior but users can still disable ECDH by excluding 'ECDH' cipher
-	  suites from the cipher list (with SSLContext#ciphers=). This commit
-	  also deprecate #tmp_ecdh_callback=. It was added in Ruby 2.3.0. It
-	  wraps SSL_CTX_set_tmp_ecdh_callback() which will be removed in OpenSSL
-	  1.1.0. Its callback receives two values 'is_export' and 'keylength'
-	  but both are completely useless for determining a curve to use in
-	  ECDH. The automatic curve selection was introduced to replace this.
+Tue Feb 21 02:07:39 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	  (ossl_sslctx_setup): Deprecate SSLContext#tmp_ecdh_callback=. Emit a
-	  warning if this is in use.
+	* parse.y (f_arglist): should set command_start = Qtrue for
+	  command body.  [ruby-talk:180648]
 
-	  (ossl_sslctx_set_ecdh_curves): Add SSLContext#ecdh_curves=. Wrap
-	  SSL_CTX_set1_curves_list(). If it is not available, this falls back
-	  to SSL_CTX_set_tmp_ecdh().
+Mon Feb 20 17:37:26 2006  Tanaka Akira  <akr@m17n.org>
 
-	  (Init_ossl_ssl): Define SSLContext#ecdh_curves=.
+	* mkconfig.rb: alias RbConfig for Config.
 
-	* ext/openssl/extconf.rb: Check the existence of EC_curve_nist2nid(),
-	  SSL_CTX_set1_curves_list(), SSL_CTX_set_ecdh_auto() and
-	  SSL_CTX_set_tmp_ecdh_callback().
+Mon Feb 20 12:27:53 2006  Kent Sibilev  <ksruby@gmail.com>
 
-	* ext/openssl/openssl_missing.[ch]: Implement EC_curve_nist2nid() if
-	  missing.
+	* lib/rational.rb (Integer::gcd): small typo fix.
+	  [ruby-core:07395]
+
+Mon Feb 20 01:05:27 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* lib/rational.rb (Integer::gcd): replaced by gcd4 in
+	  [ruby-core:07390].  [ruby-core:07377]
+
+Mon Feb 20 00:57:02 2006  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/ossl.h (OSSL_Debug): should not use __func__.
+	  [ruby-dev:28339]
+
+Sun Feb 19 04:46:29 2006  Guy Decoux  <ts@moulon.inra.fr>
+
+	* eval.c: initial value for block_unique must be 1.
+	  [ruby-talk:180420]
+
+Sat Feb 18 23:58:26 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* lib/tracer.rb (Tracer::Tracer.add_filter): turn on tracer mode
+	  only when caller() level size is one.  [ruby-core:07389]
+
+	* lib/rdoc/parsers/parse_rb.rb: need not to require "tracer".
+	  [ruby-core:07389]
+
+	* sample/rtags.rb: ditto.
+
+Sat Feb 18 12:18:26 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* lib/fileutils.rb (FileUtils::fu_world_writable): make it
+	  private.  [ruby-core:07383]
+
+Sat Feb 18 00:22:39 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* lib/tracer.rb: merged a minor clarification patch from Daniel
+	  Berger <Daniel.Berger at qwest.com>.  [ruby-core:07376]
+
+Fri Feb 17 11:18:42 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* util.c (ruby_strtod): Float("1e") should fail. [ruby-core:7330]
+
+	* pack.c (EXTEND32): unpack("l") did not work where sizeof(long) != 4.
+	  [ruby-talk:180024]
+
+	* pack.c (pack_unpack): fixed integer overflow on template "w".
+	  [ruby-talk:180126]
+
+Fri Feb 17 09:39:29 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (rb_thread_wait_for): sleep should always sleep for
+	  specified amount of time.  [ruby-talk:180067]
+
+Thu Feb 16 01:10:48 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (backtrace): frame->orig_func may not be initialized.
+	  [ruby-core:07367]
+
+Wed Feb 15 16:52:52 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (rb_eval): NODE_OP_ASGN1 should allow splat in its
+	  argument list.  [ruby-core:07366]
+
+	* parse.y (arg): avoid unnecessary extra argument.
+	  [ruby-core:07366]
+
+	* eval.c (rb_eval): honor visibility on OP_ASGN1 and
+	  OP_ASGN2. [ruby-core:07366]
+
+Wed Feb 15 10:09:51 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (yield_under_i): should not pass self as an argument to
+	  the block for instance_eval.  [ruby-core:07364]
+
+Wed Feb 15 09:20:35 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (rb_obj_instance_eval): should be no singleton classes for
+	  true, false, and nil.  [ruby-dev:28186]
+
+Tue Feb 14 18:48:33 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (DMETHOD_P): accessing wrong frame.  [ruby-dev:28181]
+
+	* eval.c (proc_invoke): preserve FRAME_DMETH flag.
+
+Tue Feb 14 15:13:51 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* ext/zlib/zlib.c: supress warning on test/zlib. [ruby-dev:28323]
+
+Tue Feb 14 14:01:17 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* time.c (search_time_t): support non 32bit time_t environments.
+
+	* win32/Makefile.sub (config.h): VC++8 has ``long long'' type.
+
+	* win32/Makefile.sub (config.h): VC++8's time_t is 64bit value.
+
+	* win32/win32.c (rb_w32_utime): drop read-only attribute before
+	  changing file time.
+
+	  all changes are backported from CVS HEAD.
+
+Tue Feb 14 11:21:38 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* io.c (argf_forward): should not use frame->argv.
+	  [ruby-core:07358]
+
+Mon Feb 13 18:08:12 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (rb_call0): argument update propagation.  [ruby-dev:28044]
+
+	* env.h: remove argv member from struct FRAME.
+
+Mon Feb 13 13:27:00 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (eval): should push class from binding if supplied.
+	  [ruby-core:07347]
+
+Mon Feb 13 00:04:00 2006  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+
+	* lib/erb.rb (ERB::Compiler): add instance variable @insert_cmd to
+	  change <%='s behavior. (backported 1.15 - 1.16)
+
+Sat Feb 11 02:04:11 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (eval): no need to push ruby_class.  [ruby-dev:28176]
+
+Sat Feb 11 01:57:44 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (rb_f_autoload): check if ruby_cbase is nil (during
+	  instance_eval for objects cannot have singleton classes,
+	  e.g. fixnums and symbols).  [ruby-dev:28178]
+
+Tue Feb  7 23:03:24 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* ext/zlib/zlib.c: should not access ruby objects in finalizer.
+	  [ruby-dev:28286]
+
+Mon Feb  6 16:02:51 2006  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* file.c (rb_thread_flock): ERROR_NOT_LOCKED is not an error on Cygwin.
+	  In such situation, flock() should return 0.
+
+Mon Feb  6 00:41:08 2006  Tanaka Akira  <akr@m17n.org>
+
+	* ruby.h (RSTRUCT_LEN, RSTRUCT_PTR): defined for source level
+	  compatibility with ruby 1.9.
+
+Sun Feb  5 21:05:34 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* numeric.c (fix_to_s): removed workaround for radix 2. Historically,
+	  rb_fix2str could only handle radix 8, 10, 16. (Rev1.37) But for now,
+	  it can handle radix 2..36. [ruby-Bugs#3438] [ruby-core:7300]
+
+Sun Feb  5 18:55:08 2006  Minero Aoki  <aamine@loveruby.net>
+
+	* lib/net/http.rb: imported from trunk, rev 1.129
+
+	* lib/net/http.rb (add_field, get_fields): keep 1.8.2 backward
+	  compatibility.
+
+	* lib/net/https.rb: imported from trunk, rev 1.3.
+
+	* lib/net/https.rb: #use_ssl? definition moved from net/http.rb.
+
+Sun Feb  5 14:22:15 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* lib/pstore.rb: should return default value if name is not found.
+	  [ruby-core:7304]
+
+	* lib/pstore.rb: should raise PStore::Error if not in transaction.
+
+Sat Feb  4 22:51:43 2006  Tanaka Akira  <akr@m17n.org>
+
+	* eval.c: apply the FreeBSD getcontext/setcontext workaround
+	  only before FreeBSD 7-CURRENT.
+
+Sat Feb  4 21:19:23 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (LK_ERR): ERROR_NOT_LOCKED is not an error.
+	  In such situation, flock() should return 0.
+
+Sat Feb  4 15:56:37 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* numeric.c (fix_to_s): (2**32).to_s(2) fails with exception where
+	  sizeof(int) == 4 < sizeof(long). [ruby-core:7300]
+
+Fri Feb  3 15:06:50 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* ext/syck/syck.c (syck_move_tokens): should reset p->cursor or etc
+	  even if skip == 0. This causes buffer overrun.
+	  (ex: YAML.load('--- "..' + '\x82\xA0' * 511 + '"'))
+
+Thu Feb  2 23:51:18 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* ext/syck/emitter.c (syck_emitter_write): should not set '\0' on
+	  emitter's marker. if marker points to the end of buffer, this causes
+	  buffer overrun. (ex: YAML.dump("." * 12288))
+
+Thu Feb  2 16:01:24 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (eval): need not to protect $SAFE value.
+	  [ruby-core:07177]
+
+Thu Feb  2 14:45:53 2006  Ville Mattila  <ville.mattila@stonesoft.com>
+
+	* configure.in: The isinf is not regognized by autoconf
+	  library guesser on solaris 10. [ruby-core:7138]
+
+Wed Feb  1 22:01:47 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* configure.in, hash.c (ruby_setenv): use setenv(3) and unsetenv(3)
+	  where they are supported. modifing environ variable seems to
+	  segfault solaris 10. [ruby-core:7276] [ruby-dev:28270]
+
+	* ruby.c (set_arg0): if use setenv(3), environ space cannot be used
+	  for altering argv[0].
+
+Tue Jan 31 14:46:28 2006  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* struct.c (rb_struct_select): update RDoc description.
+	  [ruby-core:7254]
+
+Tue Jan 31 11:58:51 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/multi-tk.rb: add MultiTkIp#eval and bg_eval.
+
+	* ext/tk/lib/tk/namespace.rb: TkNamespace#eval was enbugged at the
+	  last commit. Now it will return a proper object.
+
+Tue Jan 31 00:10:26 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* ext/syck/rubyext.c (syck_resolver_transfer): workaround for SEGV.
+	  ex: ruby -ryaml -e 'YAML.load("!map:B {}")' [ruby-core:7217]
+
+Sat Jan 28 07:56:57 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* lib/rdoc/usage.rb: support "a:0:33" style caller[-1]. In this case
+	  file name is "a:0". I don't know this really happens though...
+	  [ruby-Bugs:3344]
+
+Wed Jan 25 22:29:04 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in, dln.c, file.c, intern.h, missing.h (eaccess): use
+	  system routine if provided.  fixed: [ruby-core:07195]
+
+Sun Jan 22 23:27:13 2006  Go Noguchi  <gonoguti@yahoo.co.jp>
+
+	* lib/test/unit/autorunner.rb (process_args): ignore arguments after
+	  '--' so that test scripts can handle them.  fixed: [ruby-dev:28258]
+
+Sun Jan 22 22:09:52 2006  Tanaka Akira  <akr@m17n.org>
+
+	* eval.c (POST_GETCONTEXT): define separately from PRE_GETCONTEXT on
+	  IA64 to avoid reusing variable address.
+
+Sun Jan 22 20:03:35 2006  Tanaka Akira  <akr@m17n.org>
+
+	* eval.c (ruby_setjmp): define PRE_GETCONTEXT and POST_GETCONTEXT
+	  instead of FUNCTION_CALL_MAY_RETURN_TWICE.
+	  define PRE_GETCONTEXT to clear carry flag for workaround of
+	  FreeBSD/i386 getcontext/setcontext bug.
+	  [ruby-dev:28263]
+
+Sat Jan 21 00:36:47 2006  Tanaka Akira  <akr@m17n.org>
+
+	* eval.c (FUNCTION_CALL_MAY_RETURN_TWICE): use only on SPARC and IA64
+	  before gcc 4.0.3.
+	  [ruby-dev:28247]
+
+Thu Jan 19 22:21:23 2006  Minero Aoki  <aamine@loveruby.net>
+
+	* lib/fileutils.rb (mv): should remove file after copying.
+	  [ruby-dev:28223]
+
+Wed Jan 18 23:37:06 2006  Tanaka Akira  <akr@m17n.org>
+
+	* eval.c (FUNCTION_CALL_MAY_RETURN_TWICE): don't clobber %l7 of SPARC
+	  if enable-shared.
+	  (ruby_setjmp): call FUNCTION_CALL_MAY_RETURN_TWICE after getcontext
+	  too.
+	  reported by Pav Lucistnik and Marius Strobl.
+	  http://lists.freebsd.org/pipermail/freebsd-sparc64/2006-January/003739.html
+
+Tue Jan 17 11:32:46 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/setup.mak (MAKE): workaround for nmake 8.
+
+Tue Jan 17 11:10:21 2006  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/{Makefile.sub,setup.mak}: invoke .bat via shell. workaround
+	  for nmake 8.
+
+Mon Jan 16 10:26:23 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* ext/syck/emitter.c (syck_emit_seq, syck_emit_map, syck_emit_item):
+	  should output complex key mark even if map's key is empty seq/map.
+	  [ruby-core:7129]
+
+Sat Jan 14 05:37:06 2006  Tanaka Akira  <akr@m17n.org>
+
+	* io.c (READ_DATA_PENDING, READ_DATA_PENDING_COUNT): defined
+	  for DragonFly BSD 1.4.0.
+
+Sat Jan 14 03:43:24 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* file.c (rb_file_s_chmod): avoid warning where sizeof(int) !=
+	  sizeof(void*).
+
+Fri Jan 13 19:14:56 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* lib/rdoc/diagram.rb:
+	    - properly quote bare element attributes
+	    - terminates dangling elements (e.g. <img>, <br>, <link>, etc)
+	    - converts "CVS" to the more HTML-friendly acronym element
+	    - adds missing type attributes to style elements
+
+	  based on Paul Duncan's patch <pabs@pablotron.org> [ruby-core:7028]
+
+	* lib/rdoc/generators/html_generator.rb: ditto.
+	* lib/rdoc/generators/template/html/hefss.rb: ditto.
+	* lib/rdoc/generators/template/html/html.rb: ditto.
+	* lib/rdoc/generators/template/html/kilmer.rb: ditto.
+
+Thu Jan 12 11:53:08 2006  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/sample/tkballoonhelp.rb: [bug fix] couldn't add to a widget
+	  which is constructed with TkComposite module.
+	  [new feature] support 'command' option which is called just before
+	  popping up the balloon help.
+
+Wed Jan 11 15:00:00 2006  Ville Mattila  <mulperi@iki.fi>
+
+	* io.c (READ_PENDING*): Support solaris 64-bit environments.
+	  Solaris defines a opaque FILE struct when compiling 64 bit
+	  binaries. This means that we dont have access to _ptr etc.
+	  members anymore. The solution by Steven Lumos is to define
+	  FILE64 that has needed members available. I've modified
+	  the origanal patch a bit so that it compiles both with gcc
+	  and now free sun studio 11 compiler and both amd64 and sparc.
+	  NOTE! We have to 64 bit solaris FILE structure time to time
+	  otherwise we'll get breakage.
+	  [ruby-core:7106]
+
+Tue Jan 10 19:42:33 2006  Tanaka Akira  <akr@m17n.org>
+
+	* gc.c (garbage_collect): mark ruby_current_node.
+	  if an exception is raised in a finalizer called written in C by
+	  rb_gc_call_finalizer_at_exit, ruby_set_current_source may use
+	  collected ruby_current_node and mark_source_filename may corrupt
+	  memory.
+
+Tue Jan 10 13:30:34 2006  akira yamada  <akira@ruby-lang.org>
+
+	* ext/syck/rubyext.c (syck_resolver_transfer): should be able to load
+	  !ruby/object:Bignum syntax 1.8.3 dumped. [ruby-core:6159]
+
+Tue Jan 10 12:47:41 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* lib/yaml/rubytypes.rb (Fixnum): Bignum could not be loaded in
+	  ruby 1.8.3/1.8.4. [ruby-core:6115]
+
+	* lib/yaml/rubytypes.rb (Numeric): Subclass of Numeric could not
+	  be dumped properly. [ruby-core:7047]
+
+Tue Jan 10 12:00:48 2006  Aaron Schrab  <aaron @nospam@ schrab.com>
+
+	* lib/yaml/rubytypes.rb (Symbol#yaml_new): YAML loading of quoted
+	  Symbols broken. [ruby-Bugs:2535]
+
+Mon Jan  9 19:54:35 2006  arton  <artonx@yahoo.co.jp>
+
+	* ext/zlib/extconf.rb: zlib compiled DLL version 1.2.3 distributed by
+	  http://www.zlib.net/ has zdll.lib. [ruby-dev:28209]
+
+Mon Jan  9 14:17:12 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* win32/Makefile.sub (OPTFLAGS): I have experienced trouble on y- flag,
+	  (VisualC++6) so use -O2b2xg- if  $(MSC_VER) < 1400. [ruby-core:7040]
+
+Mon Jan  9 14:17:12 2006  Kero van Gelder  <rubyforge @nospam@ kero.tmfweb.nl>
+
+	* lib/webrick/httpservlet/filehandler.rb: fixed typo. [ruby-core:7075]
+
+Sat Jan  7 15:40:07 2006  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (singleton): get rid of segfault on syntax error.
+	  fixed: [ruby-core:07070]
+
+Fri Jan  6 10:16:20 2006  Steven Lumos  <steven@lumos.us>
+
+	* io.c (READ_DATA_PENDING): defined for 64bit Solaris on SPARC.
+	  [ruby-core:7057]
+	  (READ_DATA_PENDING_COUNT): ditto.
+	  (READ_DATA_PENDING_PTR): ditto.
+
+Sun Jan  1 17:07:59 2006  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* win32/win32.c (rb_w32_seekdir): should not segfault even if passed
+	  the location which rb_w32_telldir didn't return. [ruby-core:7035]
+	  (I think HEAD implementation is better. but binary compatibility)
+
+	* test/ruby/test_dir.rb: added.
+
+Sat Dec 31 22:57:00 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (rb_thread_save_context): should not recycle scope object used
+	  in a thread.  fixed: [ruby-dev:28177]
+
+Fri Dec 30 18:22:42 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* gc.c (garbage_collect): mark objects refered from aborting threads.
+	  [ruby-dev:28190]
+
+	* win32/Makefile.sub: VC++8 support.
+
+Fri Dec 30 14:24:53 2005  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* dir.c (glob_helper): do not use TRUE for djgpp.
+
+Fri Dec 30 04:54:40 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* file.c (eaccess): workaround for VC++8 runtime.
+
+	* win32/win32.c (ioinfo): VC++8 support.
+
+Thu Dec 29 23:59:37 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (rb_gc_mark_threads): leave unmarked threads which won't wake
+	  up alone, and mark threads in the loading table.  [ruby-dev:28154]
+
+	* eval.c (rb_gc_abort_threads), gc.c (gc_sweep): kill unmarked
+	  threads.  [ruby-dev:28172]
+
+Thu Dec 29 17:02:07 2005  Tanaka Akira  <akr@m17n.org>
+
+	* test/ruby/envutil.rb (EnvUtil.rubybin): search "ruby" instead of
+	  "miniruby".  [ruby-dev:28140]
+
+Tue Dec 27 16:59:52 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* test/drb/drbtest.rb (DRbService::self.ext_service): increase
+	  timeout limit.  a patch from Kazuhiro NISHIYAMA
+	  <zn at mbf.nifty.com>. [ruby-dev:28132]
+
+Tue Dec 27 08:29:18 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/lib/openssl/ssl.rb (OpenSSL::SSL::SSLSocket#post_connection_chech):
+	  treat wildcard character in commonName. [ruby-dev:28121]
+
+Mon Dec 26 22:32:47 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (rb_eval), gc.c (gc_mark_children), node.h (NEW_ALIAS,
+	  NEW_VALIAS), parse.y (fitem): allow dynamic symbols to
+	  NODE_UNDEF and NODE_ALIAS.
+	  backported from trunk.  fixed: [ruby-dev:28105]
+
+Mon Dec 26 08:50:36 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (ev_const_get): fixed a bug in constant reference during
+	  instance_eval.  [yarv-dev:707]
+
+	* eval.c (ev_const_defined): ditto.
+
+	* lib/yaml.rb (YAML::add_domain_type): typo fixed.  a patch from
+	  Joel VanderWerf <vjoel at path.berkeley.edu>.
+	  [ruby-talk:165285] [ruby-core:6995]
+
+Sat Dec 24 18:58:14 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* stable version 1.8.4 released.
+
+Fri Dec 23 10:30:23 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* ext/digest/sha2/sha2.c (ULL): support AIX C.  a patch from
+	  Kailden <kailden at gmail.com>.  [ruby-core:06984]
+
+Wed Dec 21 16:53:06 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* file.c (w32_io_info): should return handle because FileIndex is
+	  valid only while file is open. [ruby-dev:28088]
+
+Wed Dec 21 14:53:26 2005  Tanaka Akira  <akr@m17n.org>
+
+	* lib/pathname.rb (test_kernel_open): use File.identical?.
+	  [ruby-talk:171804]
+
+Tue Dec 20 22:41:17 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (eval_under_i): evaluate source in caller's frame.
+	  [ruby-dev:28076]
+
+	* eval.c (rb_call_super): use original method name on exception.
+	  [ruby-dev:28078]
+
+Tue Dec 20 13:11:59 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* ext/syck/rubyext.c: fixed GC problem (backported HEAD 1.55 - 1.62)
+	  [ruby-dev:27839]
+
+	* ext/syck/syck.h (S_FREE): small hack. no need to check if pointer is
+	  NULL or not before S_FREE.
+
+	* st.c: uses malloc instead of xmalloc to avoid GC. syck uses st_insert
+	  in gram.c to insert node from rb_syck_bad_anchor_handler into
+	  SyckParser's hash table. if GC occurs in st_insert, it's not under
+	  SyckParser's mark system yet. so RString can be released wrongly.
+	  [ruby-dev:28057]
+
+Tue Dec 20 12:53:23 2005  why the lucky stiff  <why@ruby-lang.org>
+
+	* ext/syck/rubyext.c (syck_emitter_reset): to ensure compatibility
+	  with previous Ruby versions, documents are no longer headless.
+
+Tue Dec 20 01:46:48 2005  Tanaka Akira  <akr@m17n.org>
+
+	* io.c (rb_f_backquote): fix a GC problem on
+	  IA64 with gcc 4.0.3 20051216 (prerelease) -O3.
+
+Mon Dec 19 23:32:39 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (rb_symname_p): fixed wrong validation.  [ruby-dev:28047]
+
+Sat Dec 17 03:57:01 2005  Tanaka Akira  <akr@m17n.org>
+
+	* bignum.c (rb_big_rshift): fix a GC problem on
+	  IA64 with gcc 4.0.3 20051216 (prerelease).
+
+Sat Dec 17 03:30:23 2005  Tanaka Akira  <akr@m17n.org>
+
+	* eval.c (bmcall): fix a GC problem by tail call on
+	  IA64 with gcc 4.0.3 20051216 (prerelease).
+
+Fri Dec 16 00:54:06 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* signal.c (Init_signal): revert C++ style comment.
+	  [ruby-dev:28041]
+
+Thu Dec 15 12:35:14 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* lib/tmpdir.rb: merged RDoc patch from Eric Hodel <drbrain at
+	  segment7.net>.  [ruby-core:06894]
+
+Thu Dec 15 01:33:31 2005  Tanaka Akira  <akr@m17n.org>
+
+	* ext/zlib/zlib.c (zstream_run): fix a GC problem by tail call on
+	  x86_64 with gcc 4.0.3 20051111 (prerelease) (Debian 4.0.2-4)
+
+Wed Dec 14 12:11:46 2005  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* test/gdbm/test_gdbm.rb: specify pid for the argument of
+	  Process.wait.  workaround for Cygwin.
+
+Wed Dec 14 12:01:26 2005  Tanaka Akira  <akr@m17n.org>
+
+	* marshal.c (r_object0): fix a GC problem for reading a bignum on
+	  IA64 with gcc 3.3.5 (Debian 1:3.3.5-13).
+
+Tue Dec 13 12:23:47 2005  Tanaka Akira  <akr@m17n.org>
+
+	* re.c (rb_reg_regcomp): fix a GC problem on x86_64 with
+	  gcc 3.3.5 (Debian 1:3.3.5-13).
+
+Tue Dec 13 01:44:16 2005  Tanaka Akira  <akr@m17n.org>
+
+	* array.c (rb_ary_diff): fix a GC problem on IA64 with
+	  gcc 3.3.5 (Debian 1:3.3.5-13).
+	  When rb_ary_push is called, there was no register which contains
+	  `hash' but `&RHASH(hash)->tbl' instead.
+
+Tue Dec 13 00:08:09 2005  Tanaka Akira  <akr@m17n.org>
+
+	* sprintf.c (rb_str_format): fix a GC problem.
+	  [ruby-dev:28001]
+
+Mon Dec 12 15:54:56 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* test/openssl/test_ssl.rb (test_parallel): call GC.start to close
+	  unused files. [ruby-dev:27981]
+
+Mon Dec 12 00:33:56 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* ext/digest/digest.c (rb_digest_base_s_digest): add volatile to
+	  protect temporary context object.  [ruby-dev:27979]
+
+	* ext/iconv/iconv.c (Init_iconv): rb_gc_register_address() should
+	  be called before actual variable initialization.
+	  [ruby-dev:27986]
+
+Fri Dec  9 23:31:02 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/rexml/encoding.rb (encoding=): give priority to particular
+	  conversion to iconv.  [ruby-core:06520]
+
+Thu Dec  8 02:07:19 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (umethod_bind): adjust invoking class for module method.
+	  [ruby-dev:27964]
+
+Thu Dec  8 00:40:52 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (call_trace_func): klass parameter should be a
+	  class/module that defines calling method.  [ruby-talk:169307]
+
+Wed Dec  7 17:10:27 2005  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+
+	* sprintf.c (rb_f_sprintf): [ruby-dev:27967]
+
+Wed Dec  7 15:31:35 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* sprintf.c (rb_str_format): integer overflow check added.
+
+	* sprintf.c (GETASTER): ditto.
+
+Wed Dec  7 01:02:04 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/README.macosx-aqua: [new document] tips to avoid the known
+	  bug on platform specific dialogs of Tcl/Tk Aqua on MacOS X.
+
+	* ext/tk/tcltklib.c: fix bug on switching threads and waiting on the
+	  deleted interpreter on vwait and tkwait command.
+
+	* ext/tk/lib/multi-tk.rb: kill the meaningless loop for the deleted Tk
+	  interpreter.
+
+	* ext/tk/sample/demos-jp/image3.rb: [bug fix] wrong argument.
+
+	* ext/tk/sample/demos-en/image3.rb: ditto.
+
+	* ext/tk/sample/demos-jp/menu.rb: fix message for MacOS X.
+
+	* ext/tk/sample/demos-jp/menu8x.rb: ditto.
+
+	* ext/tk/sample/demos-en/menu.rb: ditto.
+
+Tue Dec  6 16:37:57 2005  Yuya Nishida  <yuya@j96.org>
+
+	* eval.c (exec_under): avoid accessing ruby_frame->prev.
+	  [ruby-dev:27948]
+
+Thu Dec  1 00:50:33 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (rb_funcall2): allow to call protected methods.
+	  fixed: [ruby-dev:27890]
+
+Wed Nov 30 23:52:17 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (NEWHEAP, ADD2HEAP): set count after pointer was set.
+	  fixed: [ruby-dev:27896]
+
+Wed Nov 30 13:43:07 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* misc/ruby-mode.el (ruby-expr-beg): support $! at the end of
+	  expression.   [ruby-dev:27868]
+
+Mon Nov 28 18:55:43 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ext/socket/socket.c (init_inetsock_internal): remove setting
+	  SO_REUSEADDR option on server socket on Cygwin.
+	  fixed: [ruby-core:6765] ([ ruby-Bugs-2872 ])
+
+Mon Nov 28 13:08:54 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* win32/win32.c (rb_w32_strerror): remove all CR and LF. (avoid broken
+	  error message on bccwin32 + winsock)
+
+Mon Nov 28 09:21:49 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* lib/mkmf.rb (create_makefile): should not change sodir with
+	  dir.gsub!. (bccwin32 failed to install third party exntesions)
+	  [ruby-dev:27834]
+
+Sun Nov 27 00:56:13 2005  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* lib/wsdl/xmlSchema/complexContent.rb: missing
+	  ComplexContent#elementformdefault method.
+
+Sat Nov 26 19:57:45 2005  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* dln.c (conv_to_posix_path): should initialize posix.
+
+Thu Nov 24 21:05:58 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* configure.in (AC_CHECK_FUNCS): need to check link().
+	  fixed: [ruby-dev:27814]
+
+Thu Nov 24 01:22:25 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* file.c (w32_io_info): CreateFile failed on Win9x if file was already
+	  opened. (FILE_SHARE_READ was needed, but actually I don't understand
+	  the flags of CreateFile well...)
+
+Wed Nov 23 20:59:01 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk.rb: add Tk.pkgconfig_list and Tk.pkgconfig_get
+	  [Tk8.5 feature].
+
+	* ext/tk/lib/tk/text.rb: supports new indices modifires on a Text
+	  widget [Tk8.5 feature].
+
+	* ext/tk/lib/tk/virtevent.rb: add TkNamedVirtualEvent.
+
+	* ext/tk/lib/tk/autoload.rb: ditto.
+
+	* ext/tk/lib/tk/event.rb: add :data key for virtual events [Tk8.5
+	  feature].
+
+Wed Nov 23 18:55:31 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* file.c (w32_io_info): should not call GetFileInformationByHandle
+	  for pipe.
+
+	* file.c (w32_io_info): checks return value from rb_w32_get_osfhandle.
+
+	* file.c (w32_io_info): now can identify directory on WinNT.
+
+Wed Nov 23 03:40:49 2005  Guy Decoux  <ts@moulon.inra.fr>
+
+	* re.c (KR_REHASH): should cast to unsigned for 64bit CPU.
+	  [ruby-core:06721]
+
+Wed Nov 23 11:01:33 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* intern.h, file.c: failed to compile on windows.
+
+Wed Nov 23 07:26:44 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/extconf.rb: check for X509V3_EXT_nconf_nid.
+
+	* ext/openssl/ossl_x509ext.c (MakeX509ExtFactory): should use
+	  OPENSSL_malloc to allocate X509V3_CTX.
+
+	* ext/openssl/ossl_x509ext.c (ossl_x509extfactory_create_ext): use
+	  X509V3_EXT_nconf_nid to avoid SEGV (and to build extensions which
+	  values are placed in separate section).
+
+	* test/openssl/test_x509ext.rb: new file.
+
+Wed Nov 23 01:22:57 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* file.c (test_identical): test if two files are identical.
+
+	* file.c (rb_f_test): support DOSISH systems where st_ino is not
+	  reliable.  fixed: [ruby-core:06672]
+
+	* win32.h, win32.c (rb_w32_osid): check the running platform.
+
+Tue Nov 22 23:52:06 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/optparse.rb: match incomplete (in current enconding) multibyte
+	  string.  http://inamode6.tokuhirom.dnsalias.org/show/1551
+
+Tue Nov 22 18:36:11 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* win32/win32.c (winnt_stat): set mapped errno instead of ENOENT.
+
+Tue Nov 22 14:46:57 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* file.c (rb_file_s_basename): skip slashes just after UNC top slashes.
+
+	* test/ruby/test_path.rb (test_dirname, test_basename): follow new
+	  spec. and add new tests.
+
+Tue Nov 22 13:18:32 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* win32/win32.c (rb_w32_stat): Dir.chdir('//server/shared');
+	  p Dir.glob('*') should work on WinNT. (implemented our own
+	  stat(2) on WinNT) [ruby-list:41552] [ruby-dev:27711]
+
+Tue Nov 22 02:31:53 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tkextlib/tile.rb: bug fix (Tk::Tile::USE_TTK_NAMESPACE
+	  is not defined).
+
+Tue Nov 22 01:45:21 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* file.c (rb_file_s_basename): DOSISH_UNC is defined on cygwin but
+	  DOSISH is not.  fixed: [ruby-dev:27797]
+
+Mon Nov 21 22:50:48 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* file.c (rb_path_skip_prefix, rb_file_s_basename): UNC without path
+	  should not be splitted.  fixed: [ruby-dev:27776] [ruby-dev:27786]
+
+	* parse.y (dsym): prohibit empty symbol literal by interpolation.
+	  fixed: [ruby-talk:166529]
+
+Mon Nov 21 16:03:48 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* win32/setup.mk: findstr doesn't exist on win9x.
+	  fixed: [ruby-dev:27756]
+
+Sun Nov 20 22:34:06 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (rb_symname_p): [ not followed by ] is not valid symbol.
+	  fixed: [ruby-talk:166520]
+
+Sat Nov 19 19:57:54 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* lib/fileutils.rb (FileUtils::ln): ln documentation fix.
+	  [ruby-core:06661]
+
+Sat Nov 19 07:34:32 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk/font.rb: remove dependency on Ruby's version (1.8
+	  or 1.9).
+
+	* ext/tk/lib/tkextlib/ICONS/icons.rb: ditto.
+
+	* ext/tk/sample/tkextlib/treectrl/demo.rb: ditto.
+
+Fri Nov 18 17:57:08 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* file.c (rb_file_s_dirname): should use skipprefix for UNC path.
+	  pointed out by nobu ([ruby-dev:27744]). fixed: [ruby-core:5076]
+
+Fri Nov 18 17:35:09 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/multi-tk.rb: add restriction to access the entried
+	  command table and manipulate other IPs (for reason of security).
+	  Now, a IP object can be controlled by only its master IP or the
+	  default IP.
+
+	* ext/tk/lib/remote-tk.rb: add restriction to manipulate.
+
+	* ext/tk/tcltklib.c (ip_is_slave_of_p): add TclTkIp#slave_of?(ip)
+	  to check manipulability.
+
+	* ext/tk/lib/tk.rb: bug fix on handling of Tcl's namespaces.
+
+	* ext/tk/lib/tk/namespace.rb: ditto.
+
+Fri Nov 18 17:26:06 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* file.c (rb_file_s_dirname): added checks for some patterns with drive
+	  letter. fixed: [ruby-dev:27738]
+
+	* test/ruby/test_path.rb (test_dirname): added tests for above
+	  patterns.
+
+Fri Nov 18 12:18:02 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* win32/win32.h (S_IFIFO): r,w = IO.pipe; r.stat.pipe? now
+	  returns true on VisualC++6.
+
+Wed Nov 16 23:24:17 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* common.mk (static-ruby): overridable.
+
+	* ext/extmk.rb (parse_args): force to link extensions statically only
+	  if static is given for extstatic.
+
+	* ext/extmk.rb (RUBY, RUBYW): overridable.
+
+Tue Nov 15 23:46:35 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* lib/find.rb (Find::find): should not ignore symbolic links to
+	  non-existing files.  [ruby-talk:165866]
+
+Tue Nov 15 16:23:26 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* array.c (rb_ary_fill): previous commit disabled this usage:
+
+	    a = [0,1,2,3,4,5,6,7,8,9]
+	    a.fill {|i| a[i] * 10} #=> [nil, nil, ...., nil]
+
+	  previous commit has the advantage of early garbage collection, but
+	  potensially this would break some script. so I reverted behavior.
+
+Tue Nov 15 16:04:10 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* array.c (rb_ary_fill): tail elements were vanished when the middle
+	  part of array was filled. (ie: [0,1,2,3,4].fill(-1,2,1) => [0,1,-1])
+
+	* test/ruby/test_array.rb (test_fill): added.
+
+Tue Nov 15 14:39:16 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* array.c (rb_ary_fill): should adjust array length correctly when
+	  an array is expanded in the fill process.  [ruby-core:06625]
+
+Mon Nov 14 23:49:57 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* file.c (rb_file_s_readlink): ERANGE will occur only on GPFS.
+	  [ruby-dev:27699]
+
+Mon Nov 14 17:36:22 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* array.c (rb_ary_first): RDoc update from Daniel Berger
+	  <djberg96@yahoo.com>.  [ruby-core:06577].
+
+Fri Nov 11 10:31:44 2005  Zach Dennis  <zdennis@mktec.com>
+
+	* ext/socket/socket.c: Socket Documentation. [ruby-core:6552]
+
+Fri Nov 11 08:20:56 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* Makefile.in (OUTFLAG): keep trailing spaces.  [ruby-dev:27666]
+
+	* mkconfig.rb: substitution refereces added.
+
+Fri Nov 11 07:44:18 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* configure.in: undef HAVE_LINK on BeOS. (link(2) always returns
+	  EINVAL, and this causes error in test/fileutils.)
+
+	* file.c: overwride chown(2) and fchown(2) on BeOS. (these functions
+	  should not change user/group id if -1 is passed as corresponding
+	  argument, and this causes error in test/fileutils too)
+	  [ruby-dev:27672]
+
+	* file.c (rb_file_s_link): checks HAVE_LINK.
+
+Tue Nov  8 15:32:27 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* lib/drb/ssl.rb (DRb::SSLConfig#accept): fixed typo.
+	  [ruby-dev:27560] [ruby-core:4627]
+
+Mon Nov  7 13:43:51 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/stubs.c (_nativethread_consistency_check): use simpler
+	  (low cost) way to check whether the Tcl interpreter was compiled
+	  with threads enabled of not.
+
+	* ext/tk/tcltklib.c: reduce warnings.
+
+	* ext/tk/tkutil/tkutil.c: ditto.
+
+Mon Nov  7 00:06:58 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* lib/yaml.rb: removed :nodoc: to generate Kernel doc. [ruby-core:6324]
+
+Sun Nov  6 23:39:13 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/iconv/iconv.c (Iconv::BrokenLibrary): exception when detected a
+	  bug of underlying library.
+
+Sun Nov  6 21:46:59 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* ext/tk/stubs.c (ruby_tcl_create_ip_and_stubs_init): should touch
+	  interpreter after initialization is done. [ruby-dev:27638]
+
+Sun Nov  6 20:13:27 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* file.c (rb_file_s_readlink): readlink(2) on AIX fails with ERANGE if
+	  buffer size is less than required.  fixed: [ruby-dev:27634]
+
+Wed Nov  2 20:25:28 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/extconf.rb: ext/tk/extconf.rb: change the check parameter
+	  for Win32.
+
+Wed Nov  2 20:14:53 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tcltklib: merge into ext/tk and remove.
+
+Wed Nov  2 19:03:06 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tcltklib/tcltklib.c (ip_rbUpdateObjCmd,
+	  ip_rb_threadUpdateObjCmd): passed improper flags to DoOneEvent().
+
+	* ext/tk/tkutil.c: use rb_obj_respond_to() instead of rb_respond_to().
+
+Tue Nov  1 14:20:11 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (rb_call_super): should call method_missing if super is
+	  called from Kernel method.
+
+	* eval.c (exec_under): frame during eval should preserve external
+	  information.
+
+Tue Nov  1 10:50:17 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/extconf.rb: should check ERR_peek_last_error().
+	  [ruby-dev:27597]
+
+	* ext/openssl/ossl.c (ossl_raise): ditto.
+
+Mon Oct 31 17:34:46 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* configure.in: use proper option for Sun linker. A patch from
+	  Shinya Kuwamura <kuwa at labs.fujitsu.com>.  [ruby-dev:27603]
+
+Mon Oct 31 11:27:22 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/gdbm/test_gdbm.rb, test/sdbm/test_sdbm.rb (test_s_open_error):
+	  skip on Win32/DOS platforms.
+
+Mon Oct 31 05:49:23 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/ossl_cipher.c (ossl_cipher_update): input data must
+	  not be empty. [ruby-talk:161220]
+
+	* test/openssl/test_cipher.rb: add test for Cipher#update("").
+
+Mon Oct 31 05:37:20 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* lib/webrick/httpservlet/cgihandler.rb
+	  (WEBrick::HTTPServlet::CGIHandler#do_GET): the value of Set-Cookie:
+	  header field should be splited into each cookie.  [ruby-Bugs:2199]
+
+	* lib/webrick/cookie.rb (WEBrick::Cookie.parse_set_cookie): new method
+	  to parse the value of Set-Cookie: header field.
+
+	* test/webrick/test_cookie.rb, test/webrick/test_cgi.rb,
+	  test/webrick/webrick.cgi: add some test for cookie.
+
+Mon Oct 31 03:19:36 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* ext/readline/readline.c (readline_readline): type check.
+	  [ruby-core:6089]
+
+	* numeric.c (fix_rshift): RDoc fix.  [ruby-core:6351]
+
+	* util.h (strtod): add #undef for platforms defines strtod()
+	  macro.   [ruby-dev:27563]
+
+Mon Oct 31 02:35:59 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* test/ruby/test_float.rb (test_precision): test by assert_in_delta.
+	  [ruby-dev:27575]
+
+Sat Oct 29 01:58:25 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* ext/etc/etc.c: document update from mathew <meta@pobox.com>.
+	  [ruby-core:06473]
+
+	* ext/fcntl/fcntl.c: ditto.
+
+Thu Oct 27 16:45:31 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* string.c (scan_once): wrong condition to use mbclen2().
+	  [ruby-dev:27535]
+
+Wed Oct 26 09:27:27 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* ext/syck/implicit.c (syck_type_id_to_uri): should return
+	  newly allocated memory. otherwise, type_id will be freed
+	  twice. [ruby-dev:27384] [ruby-core:6385]
+
+Wed Oct 26 09:04:51 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* ruby.h (Qfalse, Qtrue, Qnil, Qundef): make sure these immediate
+	  values have VALUE type. there is an environment where sizeof(VALUE)
+	  != sizeof(int) like IA64. if 32bit integer (Qtrue) is passed to ANYARGS
+	  and received by 64bit integer (VALUE), upper bits may have garbage value.
+	  [ruby-dev:27513]
+
+Wed Oct 26 01:58:19 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (RUBY_EXTERN): macro to export symbols in shared
+	  library.  [ruby-core:05528]
+
+	* defines.h, {bcc32,win32,wince}/Makefile.sub (RUBY_EXTERN): moved to
+	  configuration pass.
+
+	* ext/extmk.rb (extmake): RUBY_EXTERN for static linked extensions.
+
+Tue Oct 25 15:32:00 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* lib/rational.rb: applied documentation patch from Gavin Sinclair
+	  <gsinclair@gmail.com>.  [ruby-core:06364]
+
+	* lib/irb.rb (IRB::Irb::eval_input): handle prompts with newlines
+	  in irb auto-indentation mode.  [ruby-core:06358]
+
+Tue Oct 25 02:12:08 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/rdoc/markup/simple_markup.rb (SM::SimpleMarkup::LABEL_LIST_RE):
+	  reduce redundant backtrack.  [ruby-talk:161771]
+
+Tue Oct 25 00:27:35 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+
+	* lib/rinda/*: RDoc documentation from Eric Hodel
+	  <drbrain@segment7.net> added.
+
+Mon Oct 24 21:14:29 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in, io.c: use sys/syscall.h if syscall.h is not available.
+	  [ruby-core:06247]
+
+Mon Oct 24 20:49:45 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ext/Win32API/lib/win32/resolv.rb (get_info): support multiple DNS.
+	  fixed: [ruby-list:40058], [ruby-dev:27479]
+
+Mon Oct 24 07:57:56 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* ext/tk/lib/tk/canvas.rb (TkCanvasItemConfig::__item_val2ruby_optkeys):
+	  typo fixed.  [ruby-talk:162187]
+
+	* ext/tk/lib/tk/menu.rb (TkMenuEntryConfig::__item_val2ruby_optkeys):
+	  ditto.  [ruby-core:06359]
+
+Sun Oct 23 21:50:15 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* ext/enumerator/enumerator.c: applied documentation patch from
+	  James Edward Gray II <james@grayproductions.net>.
+	  [ruby-core:06348]
+
+Sun Oct 23 07:11:11 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tcltklib/extconf.rb: improve messages [ruby-core:06325].
+
+	* ext/tk/lib/tk.rb, ext/tk/lib/tk/canvas.rb, ext/tk/lib/tk/entry.rb,
+	  ext/tk/lib/tk/frame.rb, ext/tk/lib/tk/image.rb,
+	  ext/tk/lib/tk/itemconfig.rb, ext/tk/lib/tk/labelframe.rb,
+	  ext/tk/lib/tk/listbox.rb, ext/tk/lib/tk/menu.rb,
+	  ext/tk/lib/tk/radiobutton.rb, ext/tk/lib/tk/scale.rb,
+	  ext/tk/lib/tk/spinbox.rb, ext/tk/lib/tk/text.rb,
+	  ext/tk/lib/tk/toplevel.rb: improve conversion of option values.
+
+	* ext/tk/lib/tkextlib/*: ditto.
+
+	* ext/tk/lib/tkextlib/*: update to support ActiveTcl8.4.11.2.
+
+	* ext/tk/lib/tkextlib/trofs/*: support Trofs 0.4.3.
+
+	* ext/tk/lib/tkextlib/tile/*: support Tile 0.7.2.
+
+	* ext/tk/lib/tkextlib/vu/*: support vu 2.3.0.
+
+	* ext/tk/lib/tkextlib/tcllib/*: support Tcllib 1.8 (Tklib 0.3).
+
+Sat Oct 22 23:54:07 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/extmk.rb, lib/mkmf.rb (with_config): support --with-extension
+	  options.  [ruby-dev:27449]
+
+Sat Oct 22 13:26:57 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* object.c (sym_inspect), parse.y (parser_yylex, rb_symname_p): check
+	  if valid as a symbol name more strictly.  [ruby-dev:27478]
+
+	* test/ruby/test_symbol.rb: tests for [ruby-core:03573].
+
+	* time.c (rb_strftime): removed meaningless volatile modifiers, and
+	  concatenate successive nul characters at once.  [ruby-dev:27472]
+
+Fri Oct 21 19:21:56 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* rubysig.h (CHECK_INTS): fixed typo. (I believe bit-or is improper)
+
+Fri Oct 21 17:49:32 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* bin/erb (ERB::Main::run): typo fixed.  [ruby-core:06337]
+
+Fri Oct 21 15:27:17 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* bignum.c (bignew_1): convertion from `int' to `char' discards
+	  upper bits, (ie. (char)0xff00 -> 0) so it's better to test if
+	  nonzero and set 0 or 1 instead of simply casting ... as a flag usage.
+	  (but I believe this won't cause actual bug in current implementation)
+	  [ruby-dev:27055]
+
+	* time.c: should use LONG_LONG instead of `long long'.
+
+Thu Oct 20 09:37:15 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* lib/mkmf.rb (create_makefile): Borland make seems not to allow
+	  empty dependency list. If this change is not good, please correct
+	  it.
+
+Thu Oct 20 07:55:09 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/mkmf.rb (create_makefile): get rid of a restriction
+	  of Borland make.  fixed: [ruby-dev:27460]
+
+Thu Oct 20 00:13:18 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* rubysig.h (CHECK_INTS): fix typo.
+
+Wed Oct 19 23:58:03 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/mkmf.rb (create_makefile): do not create unnecessary empty
+	  directories.  fixed: [ruby-dev:27451]
+
+Wed Oct 19 19:26:15 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (rb_gc_mark_parser): get rid of segfault with old yacc.
+	  fixed: [ruby-dev:27439]
+
+Wed Oct 19 08:28:32 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* file.c (rb_file_join): elements may contain null pointer strings.
+	  report and fixed by Lloyd Zusman (hippoman): [ruby-core:06326]
+
+Wed Oct 19 02:34:33 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c, gc.c, time.c: made internal symbols static.  [ruby-dev:27435]
+
+Wed Oct 19 01:27:07 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* regex.c (re_compile_pattern): numeric literal inside character class
+	  disabled succeeding backtrack.  fixed: [ruby-list:41328]
+
+Mon Oct 17 21:18:50 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (parser_heap): byacc never free parser stack.
+	  fixed: [ruby-dev:27428]
+
+Mon Oct 17 16:04:47 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* file.c (chmod_internal, lchmod_internal): fixed type of 2nd argument.
+
+Sun Oct 16 22:16:51 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/extmk.rb: omit non-existing directories.
+
+Sun Oct 16 14:30:05 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+
+	* lib/rinda/rinda.rb (Rinda::Tuple#initialize): check remote hash
+	  tuple. fixed: [ruby-list:41227]
+
+	* test/rinda/test_rinda.rb: test it.
+
+Sun Oct 16 03:38:07 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* rubysig.h (CHECK_INTS): prevent signal handler to run during
+	  critical section.  [ruby-core:04039]
+
+	* eval.c (load_wait): need not to call rb_thread_schedule()
+	  explicitly.  [ruby-core:04039]
+
+	* eval.c (rb_thread_schedule): clear rb_thread_critical.
+	  [ruby-core:04039]
+
+Sat Oct 15 19:56:38 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+
+	* bin/erb: typo fixed, again. thanks, Doug Kearns.
+
+Fri Oct 14 22:08:26 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (ioctl): should set errno.
+
+Fri Oct 14 16:57:32 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* lib/webrick/config.rb (Config::FileHandler): :UserDir should be nil.
+	  It is harmful to permit the access to ~/public_html by default.
+	  suggested by Hiroyuki Iwatsuki.
+
+Thu Oct 13 23:29:51 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (HEAPCNT): bison allocates indivisible size.
+	  fixed: [ruby-core:06261]
+
+	* io.c, pack.c, ext/syck/rubyext.c, ext/syck/syck.h, missing/isinf.c:
+	  get rid of warnings.  fixed: [ruby-core:06247]
+
+Wed Oct 12 12:52:57 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/ossl.c (Init_openssl): should call
+	  OpenSSL_add_ssl_algorithms().
+
+Wed Oct 12 11:08:54 2005  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* file.c (rb_f_test): typo in RDoc comments.
+
+Tue Oct 11 21:41:58 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (rb_obj_respond_to): check if obj responds to the given
+	  method with the given visibility.  [ruby-dev:27408]
+
+	* eval.c (rb_respond_to): conform to Object#respond_to?.  [ruby-dev:27411]
+
+Tue Oct 11 00:01:21 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* st.c (st_free_table): do not call free() but xfree().
+	  [ruby-core:06205]
+
+Sat Oct  8 20:04:40 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (Init_Binding): add Binding#dup method.  [yarv-dev:666]
+
+	* parse.y (rb_parser_malloc, rb_parser_free): manage parser stack on
+	  heap.  [ruby-list:41199]
+
+	* ext/iconv/charset_alias.rb: parse config.charset_alias file directly.
+
+Fri Oct  7 09:54:00 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* lib/cgi.rb (CGI::Cookie::parse): Cookies from Nokia devices may
+	  not be parsed correctly.  A patch from August Z. Flatby
+	  (augustzf) in [ruby-Patches-2595].  [ruby-core:06183]
+
+Thu Oct  6 20:12:16 2005  Minero Aoki  <aamine@loveruby.net>
+
+	* ext/strscan/strscan.c (strscan_free): remove useless code.
+	  [ruby-dev:26368] [ruby-dev:27389]
+	  (backported from trunk, rev 1.22)
+
+Wed Oct  5 04:42:38 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* lib/xmlrpc/server.rb (XMLRPC::Server#initialize): should mount the
+	  servlet on "/".
+
+Wed Oct  5 03:59:09 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* lib/xmlrpc/server.rb (XMLRPC::Server#serve): delete wrong call
+	  of "join".
+
+Mon Oct  3 00:04:00 2005  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+
+	* pack.c (EXTEND16): [ruby-dev:27383]
+
+Thu Sep 29 10:26:18 2005  Tanaka Akira  <akr@m17n.org>
+
+	* ext/dl/dl.c (rb_io_to_ptr): abolish sizeof(FILE).
+	  [ruby-dev:27317]
+
+Thu Sep 29 07:22:05 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* evalc. (rb_f_send): underscores need to be escaped.
+	  fixed by Doug Kearns.  [ruby-core:06053]
+
+Thu Sep 29 00:57:35 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (ev_const_get), variable.c (rb_const_get_0): retry only when
+	  autoload succeeded.
+
+	* variable.c (rb_autoload_load): now return true if autoload
+	  succeeded.  fixed: [ruby-dev:27331]
+
+Wed Sep 28 23:42:15 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* file.c (apply2files): add prototype.
+
+	* file.c (rb_stat_inspect): constified.
+
+	* class.c (rb_mod_init_copy, rb_class_init_copy), file.c (rb_stat_init_copy),
+	  numeric.c (num_init_copy), object.c (rb_obj_init_copy, Init_Object),
+	  re.c (match_init_copy, rb_reg_init_copy), time.c (time_init_copy):
+	  undocumented.
+
+Wed Sep 28 23:09:23 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* lib/delegate.rb: document update from James Edward Gray II
+	  <james@grayproductions.net>.  [ruby-core:06027]
+
+Wed Sep 28 15:14:19 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* lib/webrick/cgi.rb (WEBrick::CGI#start): req.query_string should
+	  refer the value of QUERY_STRING. [ruby-list:41186]
+
+	* lib/webrick/httprequest.rb (WEBrick::HTTPRequest#query_string=):
+	  add new method.
+
+Wed Sep 28 10:45:44 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tcltklib/tcltklib.c: cannot compile with Tcl/Tk8.0.x
+	  [ruby-dev:27335].
+
+Wed Sep 28 08:12:18 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (read_buffered_data): check if reached EOF.  fixed: [ruby-dev:27334]
+
+Wed Sep 28 07:56:52 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/yaml/basenode.rb (YAML::BaseNode::match_segment): fix typo.
+	  [ruby-dev:27237], [ruby-core:05854]
+
+	* lib/yaml/tag.rb (Module#yaml_as): suppress warnings.
+
+	* lib/yaml/types.rb (YAML::PrivateType, YAML::DomainType): ditto.
+
+Wed Sep 28 03:23:35 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* rubysig.h: fixed build problem with --enable-pthread on platforms
+	  which don't have setitimer().
+
+Mon Sep 26 22:32:13 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (set_trace_func): add rb_secure(4) to prevent adding
+	  tracing function.
+
+Sun Sep 25 12:05:10 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+
+	* bin/erb: typo fixed.
+
+Sun Sep 25 01:46:43 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* misc/ruby-mode.el (ruby-calculate-indent): arrange deep-indent
+	  closing parenthesis at same column as the opening.
+
+Sun Sep 25 00:42:11 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* misc/ruby-mode.el (ruby-expr-beg): deal with heredoc separately.
+	  fixed: [ruby-list:41168]
+
+	* misc/ruby-mode.el (ruby-calculate-indent): not to deepen indent
+	  level for continuous line inside parentheses.
+	  http://nabeken.tdiary.net/20050915.html#p02
+
+Sun Sep 25 00:18:11 2005  Tanaka Akira  <akr@m17n.org>
+
+	* eval.c (unknown_node): show more information.  [ruby-dev:26196]
+
+Sat Sep 24 08:56:01 2005  Minero Aoki  <aamine@loveruby.net>
+
+	* lib/fileutils.rb (cd): no longer accept :noop option, related
+	  code is useless (backported from trunk, rev 1.67).
+	  [ruby-core:05858] [ruby-Bugs:2494]
+
+Sat Sep 24 08:38:07 2005  Minero Aoki  <aamine@loveruby.net>
+
+	* lib/fileutils.rb: fix visibility of FileUtils::NoWrite, Verbose,
+	  DryRun (backported from trunk, rev 1.66). [ruby-core:05954]
+
+	* test/fileutils/test_nowrite.rb: test it.
+
+	* test/fileutils/test_dryrun.rb: new file.
+
+	* test/fileutils/test_verbose.rb: new file.
+
+Sat Sep 24 02:40:20 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* lib/delegate.rb: document update from James Edward Gray II
+	  <james@grayproductions.net>.  [ruby-core:05942]
+
+Thu Sep 22 23:36:24 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/mkmf.rb (find_executable0): default path if environment is not
+	  set.  [ruby-dev:27281]
+
+Thu Sep 22 16:33:12 2005  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* test/readline/test_readline.rb (TestReadline::replace_stdio):
+	  merged the patch of [ruby-dev:25232] instead of [ruby-dev:25223].
+
+Wed Sep 21 23:30:44 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/mkmf.rb (configuration): generalized nmake dependent code.
+
+Wed Sep 21 09:07:55 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* stable version 1.8.3 released.
+
+Wed Sep 21 08:52:25 2005  why the lucky stiff  <why@ruby-lang.org>
+
+	* ext/syck/token.c: correctly compute identation of a block
+	  scalar's parent node. [ruby-talk:150620]
+
+Wed Sep 21 08:20:24 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* README.EXT, README.EXT.ja: add new features.
+
+Wed Sep 21 07:43:58 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/optparse.rb (default_argv, Arguable#options): defaults strings
+	  to be parsed to Arguable instance.
+
+Wed Sep 21 02:44:09 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* file.c (path_check_0): disallow sticky world writable directory
+	  in PATH (and $LOAD_PATH).  [ruby-dev:27226]
+
+	* file.c (fpath_check): typo fixed.
+
+Tue Sep 20 22:29:49 2005  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* test/wsdl/simpletype/rpc/test_rpc.rb, test/wsdl/ref/test_ref.rb,
+	  test/wsdl/any/test_any.rb test/soap/wsdlDriver/test_calc.rb:
+	  suppress deliberate warnings with $VERBOSE = nil.
+
+Tue Sep 20 21:26:23 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/io/wait/lib/nonblock.rb: disable on platforms non-blocking flag
+	  is not available.  fixed: [ruby-dev:27187]
+
+Tue Sep 20 18:23:04 2005  Tanaka Akira  <akr@m17n.org>
+
+	* eval.c (thread_mark): mark th->last_status.  [ruby-dev:27179]
+
+Tue Sep 20 18:20:33 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* lib/yaml.rb: require 'yaml/constants'.  [ruby-core:5776]
+
+Tue Sep 20 17:48:34 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* lib/xmlrpc/client.rb (XMLRPC::Client::do_rpc): add charset
+	  information to content-type header.[ruby-core:5127]
+
+	* lib/xmlrpc/server.rb (CGIServer::serve): ditto.
+
+	* lib/xmlrpc/server.rb (ModRubyServer::serve): ditto.
+
+	* lib/xmlrpc/server.rb (WEBrickServlet::service): ditto.
+
+Tue Sep 20 17:34:46 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* test/webrick/test_cgi.rb: set ENV["PATH"] to CGIEnvPath on
+	  windows. bcc32's runtime is not installed into system directory,
+	  so it cannot be found without this setting. [ruby-dev:27166]
+
+Tue Sep 20 17:10:38 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* test/dbm/test_dbm.rb (TestDBM::test_s_open_error): remove
+	  test_s_open_error test to detect duplicate open.
+	  [ruby-dev:27202]
+
+Tue Sep 20 17:08:31 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* io.c: PIPE_BUF is not defined on BeOS. use _POSIX_PIPE_BUF instead.
+	  [ruby-dev:27185]
+
+Tue Sep 20 16:53:53 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* test/readline/test_readline.rb (TestReadline::replace_stdio):
+	  BSD seek support from [ruby-dev:25223].  fixed: [ruby-dev:27150]
+
+Tue Sep 20 15:39:40 2005  why the lucky stiff  <why@ruby-lang.org>
+
+	* ext/syck/emitter.c (syck_scan_scalar): prevent indicators from
+	  appearing alone or at the end of plain scalars. [ruby-core:5826]
+
+	* ext/syck/emitter.c (syck_emit_scalar): treat typed scalar nodes
+	  as complex keys.
+
+	* lib/syck.h: version 0.60.
+
+	* lib/yaml/basenode.rb (YAML::BaseNode#at): transform keys during
+	  key searches.
+
+	* ext/syck/rubyext.c: loading of binary-typed nodes.  prevent
+	  emission of plain strings that look like symbols, but which aren't.
+
+Tue Sep 20 05:50:22 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* test/xmlrpc/test_webrick_server.rb (setup_http_server):
+	  should not include 'webrick/https' unless 'use_ssl' because
+	  it fails where openssl is not installed.
+
+Tue Sep 20 00:34:07 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* io.c (io_close): call rb_io_close() directly if io is a T_FILE
+	  object.  [ruby-dev:27156]
+
+Mon Sep 19 19:09:08 2005  Minero Aoki  <aamine@loveruby.net>
+
+	* file.c (rb_file_chown): should accept nil. [ruby-dev:27171]
+	  (backport from trunk, rev 1.208)
+
+Mon Sep 19 18:35:13 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* ext/dl/dl.c (rb_io_to_ptr): fix DragonFlyBSD support.
+	  [ruby-dev:27151]
+
+Mon Sep 19 14:17:04 2005  Minero Aoki  <aamine@loveruby.net>
+
+	* ext/syck/emitter.c (syck_emit): passing an int* value to the
+	  long* parameter causes unaligned access on LP64 systems.
+	  [ruby-dev:27161]
+
+Mon Sep 19 13:44:03 2005  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
+
+	* ext/win32ole/win32ole.c: avoid core dump with WIN32OLE_EVENT.
+	  [ruby-dev:27133]
+
+Mon Sep 19 10:36:06 2005  Minero Aoki  <aamine@loveruby.net>
+
+	* lib/fileutils.rb (cp_r): default is :dereference_root=>true for
+	  backward compatibility. [ruby-dev:27145]
+
+	* test/fileutils/test_fileutils.rb (test_cp_r): test it.
+
+Mon Sep 19 09:57:39 2005  Minero Aoki  <aamine@loveruby.net>
+
+	* test/fileutils/test_fileutils.rb: backported from trunk (1.36).
+	  (again) [ruby-dev:27145]
+
+Mon Sep 19 07:45:37 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/ossl_pkey.h, ossl_pkey_rsa.c, ossl_pkey_dsa.c:
+	  an instance variable "private" is added to OpenSSL::PKey class.
+	  this ivar is a flag that shows whether there is a private key
+	  in the instance.
+
+	* ext/openssl/ossl_engine.c: (ossl_engine_load_privkey): set private
+	  key flag.
+
+Mon Sep 19 06:41:32 2005  Minero Aoki  <aamine@loveruby.net>
+
+	* lib/fileutils.rb: backported from trunk (rev 1.65):
+
+	* lib/fileutils.rb (rm_r): new option :secure.
+
+	* lib/fileutils.rb (rm_rf): new option :secure.
+
+	* lib/fileutils.rb: new method #remove_entry_secure.
+
+	* lib/fileutils.rb (cd): remove option :noop.
+
+	* lib/fileutils.rb (cp_r): new option :dereference_root.
+
+	* lib/fileutils.rb (cp_r): new option :dereference_root.
+
+	* lib/fileutils.rb: new method #remove_entry.
+
+	* lib/fileutils.rb: new method #chmod_R.
+
+	* lib/fileutils.rb: new method #chown.
+
+	* lib/fileutils.rb: new method #chown_R.
+
+	* lib/fileutils.rb: new method .commands.
+
+	* lib/fileutils.rb: new method .options.
+
+	* lib/fileutils.rb: new method .have_option?.
+
+	* lib/fileutils.rb: new method .options_of.
+
+	* lib/fileutils.rb: new method .collect_method.
+
+	* lib/fileutils.rb: use module_function instead of single extend.
+
+	* test/fileutils/test_fileutils.rb: backported from trunk (1.36).
+
+Mon Sep 19 03:17:48 2005  Tanaka Akira  <akr@m17n.org>
+
+	* file.c (rb_thread_flock): wrap the flock system call by
+	  TRAP_BEG/TRAP_END to enable signals.  [ruby-dev:27122]
+
+	* ext/socket/socket.c (bsock_send): wrap the sendto and send system
+	  call by TRAP_BEG/TRAP_END to enable signals when writing to a socket
+	  which is full.  [ruby-dev:27132]
+
+	* io.c (rb_io_syswrite): wrap the write system call by
+	  TRAP_BEG/TRAP_END to enable signals when writing to a pipe which is
+	  full.  [ruby-dev:27134]
+
+Mon Sep 19 03:02:08 2005  Tanaka Akira  <akr@m17n.org>
+
+	* io.c (io_fwrite): wrap the write system call by TRAP_BEG/TRAP_END to
+	  enable signals when writing to a pipe which is full.
+
+Sun Sep 18 02:10:47 2005  why the lucky stiff  <why@ruby-lang.org>
+
+	* lib/yaml/rubytypes.rb: remove comments that are bungling up
+	  the rdoc and ri output.  output symbols as plain scalars.
+
+	* ext/syck/rubyext.c (syck_emitter_reset): emit headless
+	  documents always.
+
+	* ext/syck/emitter.c (syck_scan_scalar): quote scalars with any
+	  kind of surrounding line space, tabs or spaces alike.
+
+	* ext/syck/token.c: accept tabs as whitespace, not for indentation,
+	  but strip from plain scalars.
+
+	* test/yaml/test_yaml.rb: remove outdated tests.
+
+Sat Sep 17 23:25:04 2005  sheepman  <sheepman@sheepman.sakura.ne.jp>
+
+	* lib/mathn.rb (Rational::inspect): should preserve original
+	  operand.  [ruby-core:05806]
+
+Sat Sep 17 23:20:27 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* lib/cgi.rb (CGI::Cookie): should handle multiple values for a
+	  cookie name.  [ruby-talk:156140]
+
+Sat Sep 17 10:42:13 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/multi-tk.rb: MultiTkIp#eval_string and bg_eval_string
+	  should call Kernel.eval on caller's safe-level instead of slave's
+	  safe-level (Of course, the given script should be evaluated on
+	  slave's safe-level).
+
+Sat Sep 17 09:45:26 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* string.c (rb_str_substr): should propagate taintness even for
+	  empty strings.  [ruby-dev:27121]
+
+	* string.c (rb_str_aref): should infect result if range argument
+	  is tainted.  [ruby-dev:27121]
+
+Sat Sep 17 08:35:39 2005  Kouhei Sutou  <kou@cozmixng.org>
+
+	* lib/rss/maker/base.rb (RSS::Maker::ItemsBase#normalize): fixed
+	strange RSS::Maker::Item#max_size behavior.
+	Thanks to Kazuhiko <kazuhiko@fdiary.net>.
+
+	* test/rss/test_maker_1.0.rb (RSS::TestMaker10#test_items): ditto.
+
+Fri Sep 16 23:09:20 2005  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
+
+	* ext/win32ole/win32ole.c (ole_search_event_at): bug fix
+	  in ext/win32ole/sample/ienavi.rb.
+
+	* ext/win32ole/win32ole/tests/testOLEEVENT.rb: ditto.
+
+Fri Sep 16 22:41:18 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* file.c (rb_file_s_extname): empty string for path name ending with a
+	  period.  fixed: [ruby-core:05651]
+
+	* file.c (rb_file_join): smarter behavior at edge cases.
+	  fixed: [ruby-core:05706]
+
+Fri Sep 16 18:34:01 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* ext/syck/node.c (syck_replace_str): was using return from the
+	  void function.  a patch from MIYAMUKO Katsuyuki
+	  <miyamuko at mtb.biglobe.ne.jp>.  [ruby-dev:27111]
+
+Fri Sep 16 14:48:48 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/multi-tk.rb: fix typo on MultiTkIp#bg_eval_string
+
+Fri Sep 16 12:02:12 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* ext/syck/rubyext.c (syck_resolver_transfer): remove C++ style
+	  comment (//).  [ruby-core:05793]
+
+Fri Sep 16 00:14:14 2005  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* test/logger/test_logger.rb: unintentionally overwritten changes by
+	  Usa.  reverted.
+
+Fri Sep 16 00:06:18 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* lib/webrick/cgi.rb (WEBrick::CGI::Socket#initialize): should set
+	  $stdout.binmode.
+
+Thu Sep 15 23:25:21 2005  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* lib/{soap,wsdl,xsd}, test/{soap,wsdl,xsd}: imported soap4r/1.5.5.
+
+	  #nnn is a ticket number at http://dev.ctor.org/soap4r
+
+	  * SOAP
+
+	    * allow to configure an envelope namespace of SOAP request. (#124)
+	   	TemporaryNamespace = 'http://www.w3.org/2003/05/soap-envelope'
+	  	@client.options["soap.envelope.requestnamespace"] =
+		  TemporaryNamespace
+	 	@client.options["soap.envelope.responsenamespace"] =
+		  TemporaryNamespace
+		@client.do_proc(...)
+
+	    * let SOAP request XML indent space configuable.  see
+	      "soap.envelope.no_indent" option. (#130)
+
+	    * let external CES configuable.
+	      ex. client["soap.mapping.external_ces"] = 'SJIS'.  $KCODE is used
+	      by default. (#133)
+		external CES ::= CES used in Ruby object of client and server
+		internal CES ::= CES used in SOAP/OM
+
+	    * add iso-8859-1 external CES support. (#106)
+
+	    * fixed illegal 'qualified' handling of elements.  it caused
+	      ASP.NET inteoperability problem. (#144)
+
+	    * added 'soap.envelope.use_numeric_character_reference' (boolean)
+	      option to let query XML use numeric character reference in XML,
+	      not plain UTF-8 character.  !GoogleSearch server seems to not
+	      allow plain UTF-8 character since 2005-08-15 update. (#147)
+
+	    * SOAP::Header::SimpleHeader (de)serialization throws an exception
+	      on !SimpleHeader.on_(in|out)bound when header is a String.  so we
+	      could not use a simple single element headerItem.  fixed.  thanks
+	      to emil. (#129)
+
+	    * out parameter of rpc operation did not work.  (#132)
+
+	    * follow HTTP redirect only if using http-access2.  (#125) (#145)
+
+	    * add a workaround for importing an WSDL whose path begins with
+	      drive letter.  (#115)
+
+	  * WSDL
+
+	    * SOAP Data which is defined as a simpletype was not mapped
+	      correctly to Ruby obj when using wsdl2ruby.rb generated classdef
+	      file. (#123)
+
+	    * rpc/literal support. (#118)
+
+	    * re-implemented local element qualify/unqualify control.  handles
+	      elementFormDefault and form in WSDL.  (#119)
+
+	    * Array of an element which has simpleType causes a crash. (#128)
+
+	    * prarmeterOrder may not contain return part so it can be shorter
+	      than parts size.  Thanks to Hugh.  (#139)
+
+	  * Samples
+
+	    * added !BasicAuth client sample. (#117)
+
+	    * added Base64 client/server sample.
+
+	    * added Flickr SOAP interface client sample. (#122)
+
+	    * added !SalesForce client sample. (#135)
+
+	    * updated Thawte CA certificate for !GoogleAdWords sample.
+
+	    * updated a client script with the newer version made by Johan.
+	      thanks!
+
+	    * shortened long file names. (#120)
+
+	    * fixed typo in authheader sample. (#129)
+
+	    * updated deprecated method usage.  (#138)
+
+Thu Sep 15 23:02:57 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* win32/win32.h (rb_w32_stat): added prototype.
+
+Thu Sep 15 22:35:55 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/ruby/test_signal.rb (test_exit_action): skip the test using
+	  fork on fork-less platforms.
+
+Thu Sep 15 11:39:18 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk/dialog.rb: If a dialog does not show up yet,
+	  TkDialogObj#name raises an exception. [ruby-talk:156109]
+
+Thu Sep 15 01:39:19 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+
+	* lib/rinda/tuplespace.rb (Rinda::TemplateEntry::initialize): pull
+	  up method. Tabs converted to spaces.
+
+Thu Sep 15 00:18:24 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* lib/net/telnet.rb (Net::Telnet::waitfor): replace sysread with
+	  readpartial.  [ruby-talk:127641]
+
+Wed Sep 14 22:40:26 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (ruby_glob): glob function not using ruby exception system.
+
+Wed Sep 14 01:26:03 2005  Minero Aoki  <aamine@loveruby.net>
+
+	* lib/net/https.rb: backported from trunk, rev 1.3.
+	  [ruby-dev:25673] (again), [ruby-dev:26617] (again),
+	  [ruby-dev:27062]
+
+	* ext/openssl/lib/net/https.rb: removed.
+
+	* ext/openssl/lib/net/protocols.rb: removed.
+
+	* lib/net/http.rb: #use_ssl?, #use_ssl are moved from net/https.
+
+Tue Sep 13 22:09:40 2005  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* lib/logger.rb (Logger): added formatter accessor to logger for
+	  dictating the way in which the logger should format the messages it
+	  displays.  Thanks to Nicholas Seckar (cf. [ruby-talk:153391]) and
+	  Daniel Berger.
+
+	* lib/logger.rb (Logger): added VERSION constant.
+
+	* lib/logger.rb: removed document for LogDevice. It is an
+	  implementation detail and is not a public interface.
+
+	* test/logger/test_logger.rb: added tests.
+
+Tue Sep 13 21:47:17 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (BEGIN_CALLARGS): pop halfly pushed status.
+	  fixed: [ruby-dev:26881]
+
+Tue Sep 13 16:26:45 2005  Minero Aoki  <aamine@loveruby.net>
+
+	* lib/net/http.rb: backported from trunk, rev 1.128.
+	  [ruby-dev:25673] [ruby-dev:26617]
+
+	* lib/net/protocol.rb: backported from trunk, rev 1.78.
+
+	* lib/net/protocol.rb: new method #old_open to support net/smtp
+	  and net/pop.
+
+	* lib/net/smtp.rb: use #old_open.
+
+	* lib/net/pop.rb: ditto.
+
+Tue Sep 13 12:33:05 2005  why the lucky stiff  <why@ruby-lang.org>
+
+	* lib/yaml.rb: reworking YAML::Stream to use the new
+	  emitter.
+
+	* lib/yaml/stream.rb: ditto.
+
+	* lib/yaml/rubytypes.rb: added Object#yaml_new.
+
+	* lib/yaml/tag.rb: the tag_subclasses? method now
+	  shows up in the class.  allow taguri to be set using an accessor.
+	  continue support of Object#to_yaml_type.
+
+	* ext/syck/rubyext.c: new emitter code.  yaml_new and yaml_initialize
+	  get called, should they be present.  consolidated all the diaspora of internal
+	  node types into the family below YAML::Syck::Node -- Map,
+	  Seq, Scalar -- all of whom are SyckNode structs pointing to
+	  Ruby data.  moved Object#yaml_new into the node_import and made it the
+	  default behavior.  the target_class is always called wih yaml_new, prepended
+	  a parameter, which is the klass.  loaded nodes through GenericResolver show their style.
+	  new Resolver#tagurize converts type ids to taguris.
+
+	* ext/syck/implicit.re: were 'y' and 'n' seriously omitted??
+
+	* ext/syck/emitter.c: renovated emitter, walks the tree in advance.
+	  consolidated redundant block_styles struct into
+	  the scalar_style struct.  (this means loaded nodes can now
+	  be sent back to emitter and preserve at least its very basic
+	  formatting.)
+
+	* ext/syck/gram.c: headless documents of any kind allowed.
+
+	* ext/syck/node.c: new syck_replace_str methods and syck_empty_*
+	  methods for rewriting node contents, while keeping the ID
+	  and other setup info.  added syck_seq_assign.
+
+	* ext/syck/syck.h: reflect block_styles and new node functions.
+
+Mon Sep 12 20:53:06 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* test/openssl/test_pkcs7.rb (test_enveloped): skip this test
+	  to avoid a bug of PKCS7_enctypt() (only if ext/openssl is
+	  compiled with OpenSSL-0.9.7d or earlier versions).
+	  http://www.mail-archive.com/openssl-dev@openssl.org/msg17376.html
+
+Mon Sep 12 14:03:33 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* test/dbm/test_dbm.rb: remove locking test, which may not be
+	  supported on some platforms.  [ruby-dev:27030]
+
+Mon Sep 12 10:45:58 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* ext/dl/dl.c (rb_io_to_ptr): merged a patch for DragonFly BSD
+	  from Takahiro Kambe <taca at back-street.net>.  [ruby-dev:27023]
+
+Sun Sep 11 22:05:51 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+
+	* bin/erb (ERB::Main#run): set ERB#filename so that it is used
+	  when reporting syntax/runtime errors. Tabs converted to spaces.
+
+Sat Sep 10 10:17:03 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/ossl_engine.c (ossl_engine_s_by_id):
+	  OpenSSL::Engine.by_id calls given block before calling
+	  ENGINE_init (block parameter is the return value of this method
+	  itself).  this functionality is useful to load dynamic shared
+	  engines. the following code is a sample of loading a key using
+	  OpenSC PKCS #11 module.
+
+		require "openssl"
+		pkcs11 = OpenSSL::Engine.by_id("dynamic"){|e|
+		  e.ctrl_cmd("SO_PATH", "/usr/lib/opensc/engine_pkcs11.so")
+		  e.ctrl_cmd("LIST_ADD", "1")
+		  e.ctrl_cmd("LOAD")
+		}
+		pkcs11.ctrl_cmd("PIN", "secret")
+		key = pkcs11.load_private_key
+
+	* ext/openssl/ossl_engine.c (ossl_engine_ctrl_cmd): new method
+	  OpenSSL::Engine#ctrl_cmd. it wraps ENGINE_ctrl_cmd_string.
+
+	* ext/openssl/ossl_engine.c (ossl_engine_get_cmds): new method
+	  OpenSSL::Engine#cmds. it returms engine command definitions.
+
+Sat Sep 10 10:09:47 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/ossl_asn1.c (asn1str_to_str): new function.
+
+	* ext/openssl/ossl_pkcs7.c: new class OpenSSL::PKCS7::RecipientInfo.
+	  this class wraps PKCS7_RECIP_INFO struct.
+
+	* ext/openssl/ossl_pkcs7.c: OpenSSL::PKCS7::Signer is renamed to
+	  OpenSSL::PKCS7::SignerInfo. ("Signer" remains as an alias of
+	  SignerInfo.)
+
+	* test/openssl/test_pkcs7.rb: new file.
+
+Sat Sep 10 10:05:51 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/ossl_ns_spki.c (ossl_spki_initialize): assume that
+	  the argument is a DER string if Base64 decoding failed.
+
+	* ext/openssl/ossl_ns_pki.c (ossl_spki_to_der): new method.
+
+	* test/openssl/test_ns_spki.rb: add new file.
+
+Sat Sep 10 09:56:24 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/lib/digest.rb: added SHA224, SHA256, SHA384 and SHA512.
+	  these features are enabled if this library is compiled with
+	  OpenSSL 0.9.8 or later.
+
+	* test/openssl/test_digest.rb: add test for new digests.
+
+Sat Sep 10 09:51:30 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/ossl.c (ossl_raise): should use ERR_peek_last_error
+	  to get last error on the current thread. And should report
+	  errors on the stack while OpenSSL.debug is true.
+
+	* ext/openssl/ossl.c (ossl_get_errors): new method for debugging
+	  this library.
+
+	* ext/openssl/ossl_ssl.c (ossl_sslctx_set_ciphers): fix error message.
+
+	* ext/openssl/ossl_x509req.c (ossl_x509req_set_attributes): get rid
+	  of unused variable.
+
+	* ext/openssl/ossl_x509store.c (ossl_x509store_initialize): should
+	  set @time to avoid warning.
+
+	* ext/openssl/ossl_x509store.c (ossl_x509store_set_default_paths,
+	  X509_STORE_add_cert, X509_STORE_add_crl): should raise error if
+	  wrapped functions failed.
+
+	* test/openssl/test_x509store.rb: add test for errors.
+
+Fri Sep  9 22:13:19 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (rb_call0): prohibit calling tainted method (>2) when
+	  $SAFE == 0.
+
+Fri Sep  9 16:45:25 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (rb_str_times): make empty strings to keep taintness,
+	  and a little improvement.  [ruby-dev:26900]
+
+	* ext/iconv/iconv.c (iconv_try), ext/iconv/extconf.rb: get rid of meta
+	  characters in command line option.  fixed: [ruby-talk:155369]
+
+Thu Sep  8 14:58:11 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* merged a patch from Takahiro Kambe <taca at back-street.net> to
+	  support DragonFly BSD.  [ruby-dev:26984]
+
+Wed Sep  7 12:55:08 2005  Tanaka Akira  <akr@m17n.org>
+
+	* lib/open-uri.rb: abolish mod === tempfile to avoid a problem
+	  [ruby-dev:26967].
+
+Wed Sep  7 10:45:15 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (rb_thread_switch): convert all exceptions to
+	  SystemExit.  fixed: [ruby-core:05724]
+
+	* eval.c (rb_thread_terminated): show backtrace before propagate
+	  exceptions to main thread.
+
+Wed Sep  7 08:35:04 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* Makefile.in, configure.in (MINIOBJS): miniruby on HP-UX can not load
+	  extension libraries.
+
+	* bignum.c (bignew_1, bigadd): K&R style argument actually can't be
+	  defined as char.
+
+	* missing/vsnprintf.c: ANSI compiler supports const keyword.
+
+	* ext/digest/sha2/extconf.rb: reject platforms which has inttypes.h
+	  but no 64bit integer.
+
+	* lib/mkmf.rb (what_type?): guesstimate type.
+
+	* ext/etc/etc.c (setup_passwd), ext/etc/extconf.rb: pw_age might be
+	  char*.  fixed: [ruby-core:05470]
+
+Wed Sep  7 08:32:47 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* object.c (rb_mod_cvar_get, rb_mod_cvar_set): document fix from
+	  sheepman <sheepman@sheepman.sakura.ne.jp>; a bug in visibility
+	  description.  [ruby-dev:26965]
+
+	* sprintf.c (rb_f_sprintf): warn "too many argument" on verbose
+	  mode (-v/-w); backported from 1.9.  [ruby-dev:26963]
+
+Mon Sep  5 17:03:07 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* lib/ostruct.rb: a patch from Florian Gross <florgro at gmail.com>
+	  merged to allow recursive inspect (and to_s) for OpenStruct.
+	  [ruby-core:05532]
+
+Mon Sep  5 07:01:12 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/openssl/lib/openssl/buffering.rb (Buffering#do_write):
+	  should clear data from the buffer which already been output.
+
+Fri Sep  2 23:51:54 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib: do not use __send__ to access private methods.  [ruby-dev:26935]
+
+Fri Sep  2 03:29:00 2005  Keiju Ishitsuka  <keiju@ruby-lang.org>
+
+	* lib/irb/init.rb: make IRB -I option that is same befavior for ruby.
+	  [ruby-dev:26872], [ruby-dev: 26920]
+
+	* lib/irb/locale.rb: support to print help message when OS locale is
+	  ja_JP.utf-8. [ruby-dev:26872]
+
+Thu Sep  1 17:11:25 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (rb_call0): wrong condition for $SAFE restoration.
+
+Thu Sep  1 14:12:45 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/multi-tk.rb: On Tcl8.5, MultiTkIp#invoke_hidden doesn't
+	  work (gives wrong order of arguments).
+
+	* ext/tk/lib/multi-tk.rb: add MultiTkIp#invoke_hidden_on_namespace
+	  to support '-namespace' option of 'interp invokehidden' command
+	  on Tcl8.5.
+
+Wed Aug 31 14:43:15 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/Makefile.sub (OPTFLAGS): default global optimization to
+	  disabled for all VC++ versions.  fixed: [ruby-dev:26897]
+
+Wed Aug 31 11:35:43 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/gdbm/test_gdbm.rb (teardown): should remove GDBM temporary
+	  file.
+
+Wed Aug 31 10:30:56 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* process.c (proc_detach, proc_setmaxgroups): missing argument type
+	  declaration. (I recommend ANSI-style function)
+
+Tue Aug 30 23:20:19 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (rb_rescue2): initialization miss.  fixed: [ruby-dev:26917]
+
+	* lib/mkmf.rb (xsystem, xpopen): no longer expand by Config.
+
+	* lib/mkmf.rb (link_command, cc_command, cpp_command): expand
+	  variables at once, and quote hdrdir.  fixed: [ruby-core:05680]
+
+	* lib/mkmf.rb (libpathflag): quote paths.
+
+Tue Aug 30 19:34:27 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/digest/md5/md5ossl.h, ext/digest/rmd160/rmd160ossl.h,
+	  ext/digest/sha1/sha1ossl.h: include <stddef.h> to avoid
+	  error in compilation with OpenSSL-0.9.8. [ruby-list:41068]
+
+Mon Aug 29 19:54:21 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* lib/rdoc/usage.rb: improper exceptions. [ruby-dev:26870]
+
+	* lib/rdoc/usage.rb: support the case when non-ruby code exists before
+	  shebang. (this is needed when ri.bat is executed on windows)
+
+Mon Aug 29 17:48:17 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (method_arity): should return proper arity value.
+	  [ruby-dev:26390]
+
+Mon Aug 29 01:19:57 2005  Tanaka Akira  <akr@m17n.org>
+
+	* lib/time.rb (Time.parse): extract fractional seconds using
+	  Date._parse.  [ruby-talk:153859]
+
+Sat Aug 27 20:20:01 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* ext/curses/curses.c ({curses,window}_clrtoeol): added. suggested
+	  by Reyn Vlietstra.
+
+	* ext/curses/curses.c: chtype in curses is not `char', rahter `long'.
+	  [ruby-Bugs:2298]
+
+	* ext/curses/view.rb: String =~ String is deprecated.
+
+Wed Aug 24 10:53:28 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/logger/test_logger.rb (test_shifting_size): should close log
+	  device before unlink, since some platform cannot unlink opened
+	  file.
+
+Sun Aug 21 00:13:27 2005  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* lib/wsdl/xmlSchema/importer.rb (WSDL::XMLSchema::Importer#fetch): add
+	  a workaround for importing an WSDL whose path begins with drive
+	  letter.  [ruby-dev:26242]
+
+Sat Aug 20 22:37:13 2005  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* lib/logger.rb (write, shift_log?, shift_log): file shifting race
+	  condition bug fixed.  [ruby-dev:26764]
+
+	* test/logger/test_logger.rb: tests.
+
+Fri Aug 19 18:13:39 2005  Tanaka Akira  <akr@m17n.org>
+
+	* lib/time.rb (Time.apply_offset): fix a problem with last day of
+	  month.  reported by Lucas Nussbaum.  [ruby-talk:152866]
+
+Thu Aug 18 12:46:28 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* bcc32/Makefile.sub (COMMON_HEADERS): reverted 1.42.2.24.
+	  I misunderstood, bccwin32 on ruby_1_8 uses winsock2 originally.
+	  [ruby-dev:26806]
+
+	* win32/win32.h: include winsock2.h instead of winsock.h. (bcc32)
+
+Wed Aug 17 23:58:05 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* object.c (rb_to_integer): argument constified.
+
+	* eval.c (terminate_process): take String message.
+
+	* eval.c (rb_thread_switch): propagate the exception caused thread
+	  termination directly.  fixed: [ruby-core:05552]
+
+Wed Aug 17 00:05:46 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (rb_add_method): preserve safe level in the environment
+	  where a method is defined .
+
+	* eval.c (rb_call0): restore preserved safe level in the method
+	  execution.
+
+Mon Aug 15 00:38:51 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (rb_rescue2): reduce PUSH_TAG() as well as NODE_RESCUE.
+	  [ruby-dev:26800]
+
+	* range.c (range_check, range_init): reduce useless exceptions.
+
+Sat Aug 13 18:51:26 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (rb_block_pass): distinguish current block from others.
+	  fixed: [ruby-dev:26274]
+
+	* ext/stringio/stringio.c (strio_set_string): disallow nil.
+	  http://www.rubyist.net/~nobu/t/20050811.html#c05
+
+Thu Aug 11 23:29:03 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/stringio/stringio.c: keep holding string after closed.
+
+Thu Aug 11 13:01:48 2005  Kouhei Sutou  <kou@cozmixng.org>
+
+	* lib/rss: fixed sort bug. [ruby-list:41018]
+
+	* lib/rss/1.0.rb (RSS::RDF::Channel#setup_maker_attributes):
+	  removed self.
+
+	* lib/rss/maker/base.rb (RSS::Maker::ItemsBase#<=>): use #date
+	  instead of @date.
+	  (RSS::Maker::Base::self.def_array_element): added #size.
+
+	* lib/rss/maker/1.0.rb
+	  (RSS::Maker::RSS10::Channel#to_rss,
+	   RSS::Maker::RSS10::Items::Item#to_rss): cleared dc_dates set
+	  upped by using #date.
+
+	* lib/rss/maker/dublincore.rb
+	  (RSS::Maker::ChannelBase, RSS::Maker::ItemsBase::ItemBase):
+	  fixed opposite alias.
+
+	* test/rss/test_setup_maker_1.0.rb
+	  (RSS::TestSetupMaker10::test_setup_maker_items_sort): added some
+	  tests for RSS::Maker::ItemsBase#do_sort.
+
+Wed Aug 10 10:29:40 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk.rb: fix bug on handling __ruby2val_optkeys().
+
+	* ext/tk/lib/tk/itemconfig.rb: fix bug on handling
+	  __item_ruby2val_optkeys().
+
+	* ext/tk/lib/tk/canvas.rb: didn't check __item_ruby2val_optkeys().
+
+	* ext/tk/lib/tkextlib/blt/component.rb: ditto.
+
+Tue Aug  9 15:12:04 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tcltklib/tcltklib.c: remove dangerous 'rb_jump_tag's.
+
+	* ext/tk/lib/tk.rb: add __val2ruby_optkeys and __ruby2val_optkeys to
+	  help to convert option values between ruby and tcl.
+
+	* ext/tk/lib/tk/itemconfig.rb: add __item_val2ruby_optkeys and
+	  __item_ruby2val_optkeys to help to convert option values between
+	    ruby and tcl.
+
+	* ext/tk/lib/tk/radiobutton.rb: use __ruby2val_optkeys for 'variable'
+	  option (for the reason of backward compatibility).
+
+	* ext/tk/lib/tk/composite.rb: clarify the arguments of super().
+
+	* ext/tk/lib/tk/spinbox.rb: ditto.
+
+	* ext/tk/lib/tk/text.rb: ditto.
+
+	* ext/tk/lib/tk/validation.rb: ditto.
+
+	* ext/tk/lib/tkextlib/*: support to treat tkvariable-type
+	  configure options.
+
+Tue Aug  9 20:30:19 2005  Tadashi Saito  <shiba@mail2.accsnet.ne.jp>
+
+	* bignum.c (rb_big_coerce): allow bignum x bignum coercing.
+	  [ruby-dev:26778]
+
+Mon Aug  8 20:43:02 2005  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* test/ruby/test_method.rb: added.  [ruby-dev:26761]
+
+Sun Aug  7 23:50:14 2005  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* test/ruby/test_super.rb: added from HEAD. [ruby-dev:26743]
+
+Sun Aug  7 01:31:15 2005  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
+
+	* ext/win32ole/win32ole.c (WIN32OLE_EVENT#on_event): should set
+	  only one event handler.
+
+	* ext/win32ole/tests/testOLEEVENT.rb: ditto.
+
+	* ext/win32ole/tests/testOLEPARAM.rb: remove re-defined
+	  test_ole_type_detail method.
+
+Sat Aug  6 12:35:24 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/{tk.rb,tk/itemconfig.rb}: configure creates
+	  TkVariable if key name is 'variable' or 'textvariable'
+	  by default. [ruby-dev:26749]
+
+	* ext/tk/lib/tk/{label,radiobutton}.rb: removed its own
+	  {variable,textvariable} function.
+
+	* ext/tk/lib/tk/variable.rb: retains backward conpatibility.
+
+Fri Aug  5 12:50:32 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* ext/tcltklib/tcltklib.c: fixed memory leak when tk_funcall raised
+	  exception. (copies argv into heap in tk_funcall instead of
+	  caller)
+
+Fri Aug  5 12:42:57 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* lib/mkmf.rb (create_makefile): need to convert path separetor
+	  before invoking install command.
+
+Fri Aug  5 00:27:04 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* ext/tcltklib/tcltklib.c: refactoring - extract ruby string <->
+	  tcl object conversion as get_str_from_obj and get_obj_from_str.
+
+Fri Aug  5 00:19:33 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* extmk.rb (extmake): needs to be wrapped in an Array.
+
+Thu Aug  4 18:38:36 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tcltklib/tcltklib.c: cannot compile for Tcl7.6/Tk4.2.
+
+	* ext/tcltklib/tcltklib.c: add nativethread consistency check.
+
+	* ext/tcltklib/stubs.c: ditto.
+
+	* ext/tk/lib/tk.rb: forgot to define TclTkIp.encoding and encoding=
+	  when Tcl is 7.6 or 8.0.
+
+	* ext/tk/lib/tk/wm.rb: support to make some methods as options of
+	  root or toplevel widget. [ruby-talk:150336]
+
+	* ext/tk/lib/tk/root.rb: ditto.
+
+	* ext/tk/lib/tk/toplevel.rb: ditto.
+
+	* ext/tk/lib/tkextlib/SUPPRT_STATUS: update RELEASE_DATE
+
+Thu Aug  4 08:03:39 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/extmk.rb (extmake): should not modify $mflags for each
+	  extentions.
+
+Thu Aug  4 00:25:48 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* common.mk, Makefile.in, {bcc32,win32,wince}/Makefile.sub: integrated
+	  macro definitions.
+
+	* bcc32/Makefile.sub: LIBRUBY_SO should use DLDOBJS, not EXTOBJS.
+
+	* {win32,wince}/Makefile.sub: separate config.h for compiler versions.
+
+Wed Aug  3 21:59:16 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk/variable.rb: TkVariable#trace didn't work on
+	  TkVariable retrived from TkVariable.new_hash.ref. [ruby-dev:26721]
+
+Wed Aug  3 08:22:13 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* ext/socket/socket.c (ruby_connect): revert [ruby-talk:111654]
+	  changes at 2004-09-07.  [ruby-dev:26656]
+
+Tue Aug  2 10:20:54 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* ext/tcltklib/tcltklib.c: use Tcl_[GS]etVar2Ex instead of
+	  Tcl_Obj[GS]etVar2. (avoid Tcl_NewStringObj on supported platforms)
+
+	* ext/tcltklib/tcltklib.c: use ip_{get,set,unset}_variable2_core from
+	  ip_{get,set,unset}_variable.
+
+	* ext/tcltklib/tcltklib.c: replaced Tcl_Panic with rb_bug.
+
+Tue Aug  2 01:41:28 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* lib/ping.rb (Ping.pingecho): should rescue StandardError.
+	  [ruby-dev:26677]
+
+Mon Aug  1 19:09:41 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* ext/tcltklib/tcltklib.c: refactoring - replaced rb_ivar_defined &
+	  rb_ivar_get with single rb_attr_get call.
+
+Mon Aug  1 18:45:07 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* ext/tcltklib/tcltklib.c (Tcl_GetStringResult): refactoring - define
+	  alternative macro on Tcl7.x or earlier.
+
+Mon Aug  1 13:57:35 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* ext/tcltklib/tcltklib.c (deleted_ip): refactoring - interpreter
+	  deletion check. [ruby-dev:26664]
+
+Mon Aug  1 01:17:40 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+
+	* lib/drb/drb.rb (check_insecure_method): use private_methods and
+	  protected_methods instead of respond_to? to check method visibility.
+	  [ruby-dev:26616]
+
+	* test/drb/drbtest.rb: ditto.
+
+	* test/drb/ut_drb.rb: ditto.
+
+Mon Aug  1 00:07:32 2005  Keiju Ishitsuka  <keiju@ruby-lang.org>
+	* lib/irb/context.rb: fix `irb --readline` option. [ruby-list:40955]
+
+Fri Jul 29 09:59:38 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (rb_yield_0): push yielded node instead of yielding.
+	  fixed: [yarv-dev:549]
+
+Thu Jul 28 18:09:55 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tcltklib/stubs.c: When --enable-tcltk-stubs, the initialize
+	  routine creates a Tcl/Tk interpreter and deletes it. However,
+	  init cost of Tk's MainWindow is not so small. And that makes it
+	  impossible to use libraries written with Tcl functions only on
+	  an environment without a graphical display. This changes support
+	  delaying initalization of Tk_Stubs until the script needs Tk.
+
+	* ext/tcltklib/stubs.h: New file. Define prototypes and return
+	  codes of functions on stubs.c.
+
+	* ext/tcltklib/tcltklib.c: Support delaying initalization of
+	  Tk_Stubs until the script needs Tk.
+
+	* ext/tcltklib/tcltklib.c: Show friendly error messages for errors
+	  on initialization.
+
+	* ext/tcltklib/tcltklib.c: Avoid SEGV on ip_finalize() when ruby is
+	  exiting and $DEBUG is true. (Not fix. If you know the reason of
+	  why, please fix it.)
+
+	* ext/tk/tkutil.c (ary2list, ary2list2): bug fix on handling of
+	  encoding.
 
-	* test/openssl/test_pair.rb (test_ecdh_callback): Use
-	  EnvUtil.suppress_warning to suppress deprecated warning.
+	* ext/tk/lib/multi-tk.rb: MultiTkIp#eval_string and bg_eval_string
+	  don't work propery.
 
-	  (test_ecdh_curves): Test that SSLContext#ecdh_curves= works.
+	* ext/tk/lib/tk.rb: Forget extending Tk::Encoding module to Tk.
+	* ext/tk/lib/tk/variable.rb: TkVarAccess fails to initialize the
+	  object for an element of a Tcl's array variable.
 
-	* test/openssl/utils.rb (start_server): Use SSLContext#ecdh_curves=.
+Wed Jul 27 23:23:54 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Mon May 30 16:28:53 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* gc.c (obj_free): make message format consistent with one from
+	  gc_mark().  [ruby-talk:149668]
 
-	* ext/socket/raddrinfo.c (host_str, port_str): use RSTRING_LEN
-	  instead of strlen, since RSTRING_PTR StringValueCStr may not be
-	  NUL-terminated when SHARABLE_MIDDLE_SUBSTRING=1.  reported by
-	  @tmtms, http://twitter.com/tmtms/status/736910516229005312
+Wed Jul 27 22:11:37 2005  Kouhei Sutou  <kou@cozmixng.org>
 
-Mon May 30 16:20:26 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* sample/rss/tdiary_plugin: removed. because the plugin
+	  is imported in the tDiary plugin packages.
 
-	* string.c (str_fill_term): return new pointer reallocated by
-	  filling terminator.
+Wed Jul 27 10:59:02 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Mon May 30 14:54:58 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* dir.c (dir_each): rewinddir(3) before iteration.
+	  [ruby-talk:149628]
 
-	* ext/stringio/stringio.c (enc_subseq): share the return value and
-	  the buffer as possible.
+Tue Jul 26 12:57:49 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
 
-Mon May 30 14:50:25 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/openssl/openssl_missin.c: include <openssl/engine.h> before
+	  <openssl/x509_vfy.h> to avoid compilation error of mswin32.
+	  suggested by NAKAMURA Usaku.
+
+Mon Jul 25 21:30:46 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* {bcc32,win32,wince}/Makefile.sub: moved CPPFLAGS only for ruby
+	  source to XCFLAGS.
+
+Mon Jul 25 13:45:18 2005  NAJIMA Hiroki  <najima@mickey.ai.kyutech.ac.jp>
+
+	* io.c: check HAVE_SYS_IOCTL_H before including the header.
+	  [ruby-dev:26610]
+
+Mon Jul 25 14:10:02 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/multi-tk.rb: fix en-bugged part in the last commit.
+
+Sat Jul 23 16:49:04 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/ossl_engine.c (ossl_engine_s_load): should check
+	  OPENSSL_NO_STATIC_ENGINE.
+
+Fri Jul 22 21:06:08 2005  Tadashi Saito  <shiba@mail2.accsnet.ne.jp>
+
+	* bignum.c (rb_big_eq): reduce isnan().  [ruby-dev:26600]
+
+	* numeric.c (flo_eq, flo_gt, flo_ge, flo_lt, flo_le): ditto.
+
+Fri Jul 22 15:02:39 2005  Kouhei Sutou  <kou@cozmixng.org>
+
+	* lib/rss/rss.rb: moved copyright description to lib/rss.rb.
+
+	* lib/rss.rb: added for convenience.
+
+	* sample/rss/re_read.rb: added #to_s sample.
+
+	* sample/rss/blend.rb: use 'require "rss"' instead of
+	  'require "rss/*"'.
+	* sample/rss/list_description.rb: ditto.
+	* sample/rss/rss_recent.rb: ditto.
+	* sample/rss/tdiary-plugin/rss-recent.rb: ditto.
+
+	* sample/rss/tdiary-plugin/rss-recent.rb: 0.0.6 -> 0.0.7.
+
+Fri Jul 22 14:37:43 2005  Kouhei Sutou  <kou@cozmixng.org>
+
+	* lib/rss/parser.rb (RSS::Parser#initialize): accept HTTP/FTP
+	  URI and local file path too.
+
+	* test/rss/test_parser.rb (RSS::TestParser#test_parse): test
+	  for the above.
+
+Fri Jul 22 07:01:42 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/tkutil.c (tk_conv_args): forget to revert thread_critical
+	  and gc_disable when raise ArgumentError.
+
+	* ext/tk/lib/remote-tk.rb: RemoteTkIp doesn't need to include TkUtil.
+
+	* ext/tcltklib/tcltklib.c: add TclTkIp#has_mainwindow? method.
+
+	* ext/tk/lib/tk.rb: add Tk.has_mainwindow? method.
+
+	* ext/tk/lib/multi-tk.rb: add MultiTkIp#has_mainwindow? method.
+
+	* ext/tk/lib/remote-tk.rb: add RemoteTkIp#has_mainwindow? method.
+
+	* ext/tk/lib/multi-tk.rb: slave IP fail to exit itself when $SAFE==4.
+
+	* ext/tk/lib/multi-tk.rb: remove constants from MultiTkIp module to
+	  avoid access from external.
+
+	* ext/tk/lib/multi-tk.rb: check_root flag is ignored on slave IPs'
+	  mainloop.
+
+	* ext/tk/lib/multi-tk.rb: hang-up Tk.mainloop called on a slave IP
+	  with $SAFE==4.
+
+	* ext/tk/lib/multi-tk.rb: MultiTkIp#bg_eval_proc doesn't work
+	  properly.
+
+	* ext/tk/lib/multi-tk.rb: add MultiTkIp#set_cb_error(proc) and
+	  cb_error(exc) to log errors at callbacks on safe slave IPs.
+
+	* ext/tk/lib/multi-tk.rb: fail to get an available slave IP object
+	  when call Tk.mainloop in the block which is given to new_* method,
+	    because cannot finish initialize while the root widget is alive.
+
+	* ext/tk/lib/multi-tk.rb: fail to control a slave IP when Tk.mainloop
+	  runs on the IP.
+
+Wed Jul 20 19:20:37 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* io.c (S_ISREG): need to define S_ISREG before it is used first.
+
+Wed Jul 20 18:40:50 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* io.c (wsplit_p): patch for the environment where
+	  fcntl(F_GETFL, O_NONBLOCK) is not supported. in that case,
+	  set FMODE_WSPLIT without fcntl check. [ruby-dev:26566]
+
+Wed Jul 20 18:07:11 2005  Tanaka Akira  <akr@m17n.org>
+
+	* io.c (rb_io_ctl): update FMODE_WSPLIT_INITIALIZED and FMODE_WSPLIT
+	  by F_SETFL.
+
+Wed Jul 20 10:04:51 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* variable.c (rb_class_path): need to adjust snprintf() len for
+	  teminating NUL.  [ruby-dev:26581]
+
+Wed Jul 20 04:01:55 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* ext/socket/socket.c: sorry, BeOS also uses HAVE_CLOSESOCKET,
+	  so reverted.
+
+	* ext/socket/extconf.rb: should not define HAVE_CLOSESOCKET
+	  on windows.
+
+Wed Jul 20 03:16:43 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* ext/socket/socket.c: should not undef close() on win32.
+	  it's defined to rb_w32_close(), otherwise handle leaks.
+	  [ruby-Bugs-2131]
+
+Wed Jul 20 00:48:16 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* error.c (syserr_initialize): don't use str before StringValue()
+	  check.  [ruby-dev:26579]
+
+Tue Jul 19 22:47:29 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* error.c (syserr_initialize): add 1 byte for snprintf() size for
+	  NUL at the end.  [ruby-dev:26574]
+
+Tue Jul 19 16:39:46 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* io.c (rb_io_inspect): replace sprintf() with "%s" format all
+	  over the place by snprintf() to avoid integer overflow.
+
+Tue Jul 19 14:08:22 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* ext/tcltklib/tcltklib.c: rbtk_eventloop_depth is used as int.
+
+	* ext/tcltklib/tcltklib.c: rbtk_pending_exception is tested with
+	  NIL_P, so should assign Qnil instead of 0 (Qfalse).
+
+	* ext/tcltklib/tcltklib.c (ip_invoke_real): fixed memory leak when
+	  ip is deleted.
+
+Tue Jul 19 13:19:46 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk/variable.rb: For symmetry, add TkVariable#string. It
+	  returns a string even if the default value type of the TkVariable
+	  object is not "string".
+
+Mon Jul 18 21:40:20 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* eval.c (rb_call0): make the pointer to NODE volatile
+	  instead of NODE itself.
+
+Mon Jul 18 14:32:21 2005  Tanaka Akira  <akr@m17n.org>
+
+	* eval.c (rb_call0): make body volatile to avoid optimization problem.
+	  [ruby-dev:26195]
+
+Mon Jul 18 12:23:27 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* ext/io/wait/wait.c: wrong backport from trunk.  fixed: [ruby-dev:26562]
+
+Mon Jul 18 09:36:25 2005  Tanaka Akira  <akr@m17n.org>
+
+	* rubyio.h (FMODE_WSPLIT, FMODE_WSPLIT_INITIALIZED): new constant.
+
+	* io.c (wsplit_p): new function.
+	  (io_fwrite): split writing data by PIPE_BUF if wsplit_p is true in
+	  multi-threaded mode.
+	  [ruby-dev:26540]
+
+Sun Jul 17 13:46:54 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/io/wait/extconf.rb, ext/io/wait/wait.c: Win32 platforms support.
+
+Fri Jul 15 23:59:03 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/rdoc/parsers/parse_c.rb (handle_class_module): handle a
+	  module enclosed in a built-in module.  fixed: [ruby-talk:148239]
+
+	* lib/rdoc/parsers/parse_c.rb (find_body): allow macros as methods.
+
+	* lib/rdoc/parsers/parse_c.rb (find_call_seq): allow :nodoc: modifier
+	  in C.  [ruby-core:04572]
+
+Fri Jul 15 18:00:01 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* bcc32/Makefile.sub (COMMON_HEADERS): ruby_1_8 is using winsock.h.
+	  failed to compile ext/socket on bcc5.6.4. [ruby-dev:26193]
+
+Fri Jul 15 07:58:56 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* lib/webrick/server.rb (WEBrick::GenericServer#accept_client):
+	  sockets should be non-blocking mode. [ruby-dev:26405]
+
+	* lib/webrick/utils.rb (WEBrick::Utils.set_non_blocking): new method.
+
+	* lib/webrick/httprequest.rb (WEBrick::HTTPRequest#read_chunked):
+	  should call sock.read repeatedly until the preferred size data
+	  is obtained.
+
+Thu Jul 14 18:27:16 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* win32/win32.c (rb_w32_strerror): should return correct message
+	  for ENAMETOOLONG and ENOTEMPTY. (bcc32) [ruby-dev:26533]
+
+	* win32/win32.c (rb_w32_strerror): stripped CR LF on the tail.
+	  (bcc32) [ruby-dev:26533]
+
+Thu Jul 14 00:45:42 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* LEGAL (ext/nkf/nkf-utf8): updated from nkf1.7 to nkf-utf8.
+
+Wed Jul 13 19:37:47 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* win32/win32.c (rb_w32_mkdir): should set EEXIST (not EACCES)
+	  if file or directory already exists. (bcc32) [ruby-dev:26508]
+
+	* win32/win32.c (rb_w32_rmdir): should set ENOTDIR (not EINVAL)
+	  if it is not directory. (bcc32, win32)
+
+	* win32/win32.c (rb_w32_rmdir, rb_w32_unlink): restore
+	  FILE_ATTRIBUTE_READONLY flag on function failure.
+
+Wed Jul 13 12:40:00 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tcltklib/tcltklib.c: TclTkLib.do_one_event doesn't work.
+
+	* ext/tk/lib/tk.rb: Tk.thread_update is available.
+
+Tue Jul 12 23:32:11 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/mkmf.rb: keep curdir unexpanded.
+
+Mon Jul 11 08:31:29 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* regex.c (read_special): fix parsing backslashes following \c in
+	  regexp.  fixed: [ruby-dev:26500]
+
+Mon Jul 11 02:53:00 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* lib/webrick/cgi.rb (WEBrick::CGI::Socket#request_line):
+	  mistook in merging the patch of [ruby-dev:26235] at
+	  revision 1.4.2.6.
+
+Sun Jul 10 23:58:04 2005  Tanaka Akira  <akr@m17n.org>
+
+	* lib/pathname.rb (Pathname#unlink): try Dir.unlink first to
+	  avoid unlink a directory by root.
+	  cf. [ruby-dev:26237]
+
+Sun Jul 11 05:18:17 2005  Michael Neumann  <mneumann@ruby-lang.org>
+
+	* lib/xmlrpc/server.rb (XMLRPC::Server): Switch from GServer over to
+	  WEBrick. This makes file lib/xmlrpc/httpserver.rb obsolete (at least it is
+		no further used by the XML-RPC library).
+
+Sun Jul 10 12:47:01 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/debug.rb (debug_command): added a deficient format specifier.
+	  fixed: [ruby-core:05419]
+
+Sat Jul  9 21:28:46 2005  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
+
+	* ext/win32ole/win32ole.c (ole_method_dispid): convert dispid
+	  in Ruby and C by INT2NUM and NUM2INT.
+
+	* ext/win32ole/win32ole.c (ole_invoke2): ditto.
+
+	* ext/win32ole/test/testWIN32OLE.rb: ditto.
+
+	* ext/win32ole/test/testOLEMETHOD.rb: ditto.
+
+Fri Jul  8 15:45:04 2005  Kouhei Sutou  <kou@cozmixng.org>
+
+	* lib/rss/rss.rb (RSS::VERSION): 0.1.4 -> 0.1.5.
+
+	* test/rss/test_version.rb (RSS::TestVersion#test_version):
+	  ditto.
+
+	* lib/rss/0.9.rb (RSS::Rss::Channel::Item::Category):
+	  domain attribute of <category> is optional. Thanks to
+	  Chris Lee <clee@kde.org>.
+
+	* test/rss/test_parser.rb (RSS::TestParser#test_category20):
+	  adjusted test case.
+
+Tue Jul  5 23:44:06 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* instruby.rb: expand source library path.
+
+Tue Jul  5 23:27:14 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* array.c (sort_2): get rid of yet another bcc's bug.
+	  fixed: [ruby-core:05152]
+
+	* eval.c (rb_thread_save_context): must not switch contexts during
+	  re-allocating stack.  fixed: [ruby-core:05219]
+
+Tue Jul  5 15:15:10 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/tkutil.c: fix typo.
+
+Tue Jul  5 14:51:35 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tcltklib/tcltklib.c: bug fix on treating Unicode strings.
+
+	* ext/tcltklib/tcltklib.c: add methods to treat encoding mode.
+
+	* ext/tcltklib/MANUAL.eng: add description of TclTkLib#encoding,
+	  encoding_system, and so on.
+
+	* ext/tcltklib/MANUAL.euc: ditto.
+
+	* ext/tk/tkutil.c: fail to create a Tcl's list string from an
+	  array including multiple kind of encoded strings.
+
+	* ext/tk/lib/tk.rb: ditto.
+
+	* ext/tk/lib/multi-tk.rb: 2nd arg of _{to|from}UTF8 is omissible.
+
+	* ext/tk/lib/remote-tk.rb: ditto.
+
+	* ext/tk/lib/tk.rb: override TclTkLib#encoding and encoding= to
+	  use TkCore::INTERP.encoding and encoding=.
+
+	* ext/tk/lib/tk.rb: when "require 'tk'" and $KCODE=='NONE', check
+	  DEFAULT_TK_ENCODING to decide Ruby/Tk's system encoding mode.
+
+	* ext/tk/lib/tk/encodedstr.rb: check both of Tk.encoding and
+	  Tk.encoding_system. Tk.encoding has higher priority.
+
+	* ext/tk/lib/tk/optiondb.rb: ditto.
+
+	* ext/tk/lib/tk/spinbox.rb: ditto.
+
+	* ext/tk/lib/tk/validation.rb: ditto.
+
+	* ext/tk/lib/tk/namespace.rb: arguemnts for TclTkIp#_merge_tklist
+	  should be UTF-8 strings.
+
+Mon Jul  4 14:35:52 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* sample/svr.rb: service can be stopped by ill-behaved client; use
+	  tsvr.rb instead.
+
+Mon Jul  4 13:25:21 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* missing/erf.c: original erf.c by prof. Okumura is confirmed to
+	  be public domain.  reverted BSD implementation.
+
+Mon Jul  4 11:15:37 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/{dbm,gdbm,sdbm}/test_{dbm,gdbm,sdbm}.rb: skip some tests
+	  which using fork on fork-less platforms.
+
+Sun Jul  3 23:26:30 2005  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* test/wsdl/document/test_rpc.rb: compare formatted time string of
+	  Time objects instead of comparing Time objects itself to avoid
+	  unintended conflict of usec part.  [ruby-dev:26220]
+
+Sat Jul  2 22:41:04 2005  Tanaka Akira  <akr@m17n.org>
+
+	* ext/socket/socket.c (unix_send_io, unix_recv_io): support x86-64 and
+	  IA64.
+
+Sat Jul  2 17:06:23 2005  Tanaka Akira  <akr@m17n.org>
+
+	* defines.h (FLUSH_REGISTER_WINDOWS): defined for IA64.
+	  (flush_register_windows): declare flush_register_windows.
+
+	* eval.c (flush_register_windows): new function.
+
+Fri Jul  1 17:48:52 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* bignum.c (get2comp): revert all prior changes, and calculate
+	  proper 2's complement for negative numbers.  backported from
+	  HEAD.
+
+Fri Jul  1 15:50:12 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* missing/erf.c: need to include some headers for some platforms.
+
+	* win32/win32.h (copysign, scalb): define for compatibility with
+	  other platforms. [ruby-dev:26430]
+
+Fri Jul  1 15:37:42 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* missing/crypt.c: modified to make it compilable on platforms
+	  other than BSD.  [ruby-dev:26430]
+
+	* missing/erf.c: ditto.  code from <exp.c> merged.
+
+Fri Jul  1 12:44:56 2005  Tanaka Akira  <akr@m17n.org>
+
+	* lib/open-uri.rb (OpenURI.open_http): refine post_connection_check
+	  call.
+
+Fri Jul  1 11:34:08 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* missing/crypt.c: replaced with 4.4BSD version.
+
+	* missing/erf.c: ditto.
+
+	* missing/vsnprintf.c: removed the third provision from the old
+	  BSD license.  [ruby-core:05177]
+
+Fri Jul  1 01:45:21 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* enum.c (enum_min, enum_max): must not return Qundef.
+	  fixed: [ruby-core:05299]
+
+Fri Jul  1 00:18:40 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* lib/delegate.rb (Delegator::respond_to): respond_to? must check
+	  destination object.  [ruby-talk:146894]
+
+Thu Jun 30 19:00:21 2005  Keiju Ishitsuka  <keiju@ruby-lang.org>
+	* lib/irb/ruby-lex.rb (RubyLex::identify_number): alternative implements
+	  for [ruby-dev:26410]. And support a numeric form of 0d99999.
+
+Thu Jun 30 17:28:10 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* lib/irb/ruby-lex.rb (RubyLex::identify_number): should not treat
+	  plain zero as an octal number.  [ruby-dev:26410]
+
+Thu Jun 30 15:13:16 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (rb_eval): pre-evaluate argument for unambiguous
+	  evaluation order.  [ruby-dev:26383]
+
+Thu Jun 30 09:53:56 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* lib/delegate.rb (Delegator::method_missing): forward unknown
+	  method to the destination.  suggested by
+	  <christophe.poucet@gmail.com>.  [ruby-talk:146776]
+
+Tue Jun 28 21:59:29 2005  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+
+	* dir.c, eval.c, hash.c, process.c, ruby.c: avoid warning "unused
+	  variable" [ruby-dev:26387]
+
+Sat Jun 25 17:15:23 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* lib/webrick/httputils.rb (WEBrick::HTTPUtils.parse_query): should
+	  discard if key=val pair is empty. patch from Gary Wright.
+
+Sat Jun 25 23:30:51 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* process.c (detach_process_watcher): terminate process watcher
+	  thread right after rb_waitpid() succeed.  [ruby-talk:146430]
+
+Sat Jun 25 15:49:18 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* enum.c (enum_min, enum_max): do not ignore nil as the first element.
+
+Sat Jun 25 14:40:17 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* ext/sdbm/init.c (fsdbm_select): SDBM#select had returned the array
+	  which contained each elements twice. [ruby-dev:26358]
+
+Fri Jun 25 05:06:47 2005  Michael Neumann  <mneumann@ruby-lang.org>
+
+	* lib/xmlrpc/*, test/xmlrpc/*: backported changes from HEAD into 1.8
+
+Fri Jun 24 17:00:00 2005  Shigeo Kobayashi  <shigeo@tinyforest.jp>
+
+	* ext/bigdecimal/bigdecimal.c: patch from "NATORI Shin"
+	  (u-tokyo.ac.jp) applied to fix rounding bug.
+
+Fri Jun 24 13:06:45 2005  akira yamada  <akira@ruby-lang.org>
+
+	* lib/uri/common.rb, lib/uri/generic.rb: fixed typo in documents and
+	  replaced some existent domain name with "example.com".
+
+Fri Jun 24 12:23:19 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk.rb: fix typo on Tk.grid_propagate.
+
+	* ext/tk/lib/tk.rb: Tk.event_generate and TkWindow#event_generate
+	  accept TkEvent::Event object as context argument.
+
+	* ext/tk/lib/tk/event.rb: add TkEvent::Event#valid_fields and
+	  valid_for_generate to get field parameters of event_generate.
+
+Thu Jun 23 23:55:59 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* runruby.rb: should load built rbconfig.rb.
+
+Thu Jun 23 16:53:15 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk/canvastag.rb: TkcGroup.new cannot include given items.
+	  TkcGroup#exclude calls wrong method.
+	  Add alias TkcGroup#add [ruby-talk:146049].
+
+	* ext/tk/lib/tk/canvas.rb: TkCanvas#dtag and some subcommands of
+	  TkCanvas#addtag fail to treat a TkcTag argument.
+
+	* ext/tk/lib/tk/event.rb: add TkEvent::Event#generate to help to send
+	  current event to other widgets.
+
+Mon Jun 20 18:44:04 2005  Tanaka Akira  <akr@m17n.org>
+
+	* eval.c (FUNCTION_CALL_MAY_RETURN_TWICE): DUMMY_SETJMP is replaced
+	  because setjmp is not enough to fix getcontext and SPARC register
+	  window problem.
+
+Mon Jun 20 16:48:36 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ext/dbm/dbm.c (fdbm_closed): new method DBM#closed?
+
+	* ext/gdbm/gdbm.c (fgdbm_closed): new method GDBM#closed?
+
+	* ext/sdbm/init.c (fsdbm_closed): new method SDBM#closed?
+
+	* test/dbm/test_dbm.rb, test/gdbm/test_gdbm.rb, test/sdbm/test_sdbm.rb
+	  (teardown): close all db objects before deleting data files.
+
+	* win32/win32.{ch} (unlink): hook runtime function to change
+	  file attribute before unlinking.
+	  fixed: [ruby-dev:26360]
+
+Mon Jun 20 02:15:35 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* gc.c (define_final): document fix: finalizers never get called
+	  before target object is destroyed.
+
+Mon Jun 20 01:26:49 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/openssl_missing.c, ext/openssl/ossl.h,
+	  ext/openssl/ossl_asn1.c, ext/openssl/ossl_bio.c,
+	  ext/openssl/ossl_pkcs12.h, ext/openssl/ossl_x509req.c: avoid
+	  compiler warnings. suggested by Michal Rokos.
+
+Sun Jun 19 14:09:07 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* gc.c (run_final): reduce unnecessary object allocation during
+	  finalization.
+
+	* gc.c (rb_gc_call_finalizer_at_exit): deferred finalizers list should
+	  be cleared before calling them.  fixed: [ruby-talk:145790]
+
+Fri Jun 17 13:01:40 2005  Tanaka Akira  <akr@m17n.org>
+
+	* lib/time.rb (Time.parse): fix previous leap seconds support.
+	  (Time.rfc2822): ditto.
+	  (Time.xmlschema): ditto.
+
+Thu Jun 16 15:06:55 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* ext/tcltklib/tcltklib.c (ip_rb_threadVwaitCommand): Tcl_Release
+	  was missing.
+
+Thu Jun 16 13:34:48 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk.rb: add Tk.getMultiple{Open|Save}File() which return
+	  an Array of selected files.
+
+Thu Jun 16 12:53:24 2005  Tanaka Akira  <akr@m17n.org>
+
+	* lib/time.rb (Time.parse): "Fri Jan  1 08:59:60 +0900 1999" was
+	  parsed as "Fri Jan 01 09:00:00 JST 1999" even on an environment
+	  which supports leap seconds.
+	  (Time.rfc2822): ditto.
+	  (Time.xmlschema): ditto.
+
+Thu Jun 16 08:29:22 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* ext/dl/sym.c (rb_dlsym_call): needs FREE_ARGS before return.
+	  fixed memory leak. [ruby-Bugs-2034]
+
+Wed Jun 15 18:26:39 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk.rb: support "tk inactive" sub-command [for Tcl/Tk8.5a3]
+
+	* ext/tk/lib/tk/namespace.rb: support "namespace path" sub-command and
+	  'namespace ensemble' sub-command [for Tcl/Tk8.5a3]
+
+Tue Jun 14 02:02:43 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/tkutil.c: add TkUtil::CallbackSubst.subst_arg(m, ...) &
+	  _define_attribute_aliases(hash) to get substitution-argument from
+	  attributes (e.g. subst_arg(:x,:y,:num,:button) --> "%x %y %b %b ").
+
+	* ext/tk/lib/tk/event.rb: use _define_attribute_aliases().
+
+Mon Jun 13 13:01:05 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* hash.c (ruby_setenv): fixed SEGV. [ruby-dev:26186]
+
+Mon Jun 13 01:54:20 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* signal.c (sigexit): call rb_thread_signal_exit() instead of
+	  rb_exit().  [ruby-dev:26347]
+
+	* eval.c (rb_thread_signal_exit): a new function to exit on main
+	  thread.
+
+	* eval.c (rb_thread_switch): exit status should be retrieved from
+	  ruby_errinfo.
+
+	* eval.c (rb_f_exit): ensure exit(0) should call
+	  exit(EXIT_SUCCESS).
+
+Mon Jun 13 01:20:02 2005  Tanaka Akira  <akr@m17n.org>
+
+	* eval.c (rb_gc_mark_threads): curr_thread may not be part of the
+	  thread list.  [ruby-dev:26312]
+
+Fri Jun 10 23:35:34 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* missing/mkdir.c: remove. [ruby-core:05177]
+
+Fri Jun 10 22:54:26 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* missing.h: fd_set stuffs need sys/types.h.  fixed: [ruby-core:05179]
+
+Thu Jun  9 23:58:12 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/Win32API/Win32API.c (Win32API_Call): disable global
+	  optimization. fixed: [ruby-core:05143]
+
+Thu Jun  9 23:35:22 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* enum.c (enum_inject): default the result value to Qundef to use
+	  first element as initial value if not given.
+
+Thu Jun  9 19:55:41 2005  Tanaka Akira  <akr@m17n.org>
+
+	* eval.c (ruby_longjmp): new macro to call longjmp, setcontext, etc.
+	  (ruby_setjmp): new macro to call setjmp, getcontext, etc.
+	  (ruby_setjmp): call setjmp before getcontext to avoid IA64 register
+	  stack problem.
+	  [ruby-talk:144939]
+
+	* gc.c (Init_stack): remove IA64_MAGIC_STACK_LIMIT.
+
+Thu Jun  9 11:55:34 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* lib/delegate.rb (SimpleDelegator::__setobj__): need check for
+	  recursive delegation.  [ruby-core:04940]
+
+Wed Jun  8 18:47:10 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* misc/ruby-mode.el (ruby-expr-beg): fix looking point drift.
+
+Wed Jun  8 11:11:34 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* bignum.c (get2comp): calculate proper 2's complement for
+	  negative numbers.  a bug in normalizing negative numbers
+	  reported from Honda Hiroki <hhonda@ipflex.com>.
+
+Wed Jun  8 08:33:10 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* enum.c (enum_min_by, enum_max_by): return nil if no iteration.
+	  fixed: [ruby-dev:26245]
+
+	* eval.c (rb_need_block): ensure a block is given.
+
+	* eval.c (backtrace): skip successive frames sharing same node.
+
+Wed Jun  8 00:15:08 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* ext/socket/socket.c (ruby_getaddrinfo__aix): merged a patch from
+	  KUBO Takehiro <kubo at jiubao.org> to support AIX.  [ruby-list:40832]
+
+Wed Jun  8 00:09:01 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* lib/yaml/rubytypes.rb (Array::to_yaml): merged a patch from
+	  Tilman Sauerbeck <tilman at code-monkey.de>.  [ruby-core:05055]
+
+	* lib/yaml/rubytypes.rb (Hash::to_yaml): ditto.
+
+Wed Jun  8 00:00:01 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* ext/curses/curses.c (curses_insertln): merged a patch from
+	  TAKAHASHI Tamotsu <ttakah at lapis.plala.or.jp>.  [ruby-ext:02305]
+
+Tue Jun  7 19:34:15 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* lib/irb/init.rb (IRB::IRB.rc_file_generators): more flexible
+	  IRB.rc_file_generators.  [ruby-core:05163]
+
+Tue Jun  7 18:39:31 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* lib/thread.rb: RDoc documentation from Eric Hodel
+	  <drbrain at segment7.net> added.  [ruby-core:05148]
+
+Tue Jun  7 18:30:04 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/mkmf.rb (create_makefile): add .SUFFIXES from depend file.
+	  fixed: [ruby-dev:26294]
+
+Tue Jun  7 17:39:54 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* object.c (rb_mod_cvar_get): Module#class_variable_get(): back
+	  ported from CVS HEAD.  [ruby-talk:144741]
+
+	* object.c (rb_mod_cvar_set): Module#class_variable_set().
+	  [ruby-talk:144741]
+
+Tue Jun  7 16:32:53 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* sprintf.c (rb_f_sprintf): raise exception on debug mode (-d),
+	  not verbose mode (-v/-w).  [ruby-core:05123]
+
+Tue Jun  7 10:30:49 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/multi-tk.rb: slave-ip fails to call procedures
+	  delegated by master-ip.
+
+Sun Jun  5 23:00:35 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk/console.rb: create console when required
+
+	* ext/tk/sample/tkextlib/tile/demo.rb: fix TypeError & create Console
+
+Sat Jun  4 14:55:18 2005  Tanaka Akira  <akr@m17n.org>
+
+	* test/dbm/test_dbm.rb: merged from ext/dbm/testdbm.rb.
+
+	* test/gdbm/test_gdbm.rb: merged from ext/gdbm/testgdbm.rb.
+
+	* test/sdbm/test_sdbm.rb: renamed from ext/sdbm/testsdbm.rb with
+	  modification to use test/unit.
+
+Fri Jun  3 14:06:12 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/multi-tk.rb: fix typo.
+
+Wed Jun  1 11:32:42 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* bcc32/Makefile.sub: can use single quote character in DESTDIR.
+	  [ruby-dev:26205]
+
+Mon May 30 23:48:29 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk/macpkg.rb: add PACKAGE_NAME information of Tcl/Tk
+	  Extension.
+
+	* ext/tk/lib/tk/msgcat.rb: ditto.
+
+	* ext/tk/lib/tk/winpkg.rb: ditto.
+
+	* ext/tk/lib/tkextlib/*: ditto.
+
+Sat May 28 16:40:15 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* test/openssl/test_x509store.rb: add test for expired CRL
+	  and refine some assertions.
+
+Sat May 28 05:15:51 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/ossl_x509store.c (ossl_x509stctx_set_time): should
+	  not set internal flag directry.
+
+Sat May 28 02:00:11 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* lib/webrick/cgi.rb (WEBrick::CGI::Socket#request_line):
+	  ENV["REQUEST_URI"] is better to get correct Request-URI
+	  than ENV["SCRIPT_NAME"] + ENV["PATH_INFO"].  [ruby-dev:26235]
+
+Fri May 27 16:32:04 2005  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* lib/mkmf.rb: use the semicolon as the path separator
+	  in the environment of MSYS.  fixed: [ruby-dev:26232]
+
+Thu May 26 06:08:11 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk.rb: add shortcut-methods of tk_call + tk_split_list
+
+Wed May 25 22:52:42 2005  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/irb/input-method.rb: do not use Readline::HISTORY.pop.
+	  (backported from HEAD)
+
+Wed May 25 21:55:40 2005  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* ext/readline/readline.c: supported libedit. (backported from HEAD)
+
+	* ext/readline/extconf.rb: ditto.
+
+	* test/readline/test_readline.rb: ditto.
+
+Wed May 25 20:06:27 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk.rb: TkComm#tk_split_*list fail to split a kind of SJIS
+	  strings. To avoid the trouble, add arguments to control converting
+	  encoding, and do split on a UTF8 string.
+
+	* ext/tk/lib/multi-tk.rb: modify to attend encoding.
+
+	* ext/tk/lib/remote-tk.rb: ditto.
+
+	* ext/tk/lib/tk/itemconfig.rb: ditto.
+
+	* ext/tk/lib/tk/listbox.rb: ditto.
+
+	* ext/tk/lib/tk/namespace.rb: ditto.
+
+	* ext/tk/lib/tk/panedwindow.rb: ditto.
+
+	* ext/tk/lib/tk/text.rb: ditto.
+
+	* ext/tk/lib/tk/textmark.rb: ditto.
+
+	* ext/tk/lib/tk/texttag.rb: ditto.
+
+	* ext/tk/lib/tk/variable.rb: ditto.
+
+	* ext/tk/lib/tk/winfo.rb: ditto.
+
+	* ext/tk/lib/tkextlib/iwidgets/scrolledlistbox.rb: ditto.
+
+	* ext/tk/lib/tkextlib/iwidgets/scrolledtext.rb: ditto.
+
+	* ext/tk/lib/tk.rb: add TkWindow#lower_window/raise_window and
+	  Tk#lower_window/raise_window by reason of method-name conflict
+
+	* ext/tk/lib/tk/canvas.rb: bug fix on TkCanvas#delete when given
+	  non-TkcItem arguments.
+
+	* ext/tk/lib/tkextlib/iwidgets/scrolledcanvas.rb: ditto.
+
+Wed May 25 12:59:48 2005  Tanaka Akira  <akr@m17n.org>
+
+	* lib/open-uri.rb (OpenURI::Meta::RE_QUOTED_STRING): a content of
+	  quoted-string should be zero or more characters.
+
+Tue May 24 23:42:16 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* numeric.c (fix_pow): support Fixnum ** Float case directly
+	  without coercing.  [ruby-talk:142697] [ruby-talk:143054]
+
+Tue May 24 16:57:24 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* ruby.c (require_libraries): caused SEGV when continuation jumped
+	  in to the required library code.
+
+Tue May 24 11:56:25 2005  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* lib/getopts.rb: should warn only if verbose mode.
+	  fixed: [ruby-dev:26201]
+
+Tue May 24 06:45:31 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* misc/ruby-mode.el (ruby-font-lock-syntactic-keywords): string
+	  literals to be matched non-greedy.
+
+Tue May 24 00:34:32 2005  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* test/soap/calc: method name 'set' was able to crash with a class Set.
+	  [ruby-dev:26210]
+
+	* test/wsdl/document/test_rpc.rb: dateTime comparison failed under
+	  TZ=right/Asia/Tokyo (with leap second.) [ruby-dev:26208]
+
+Mon May 23 16:24:05 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tcltklib/extconf.rb: Framework support on MacOS X Tiger.
+
+	* ext/tcltklib/README.1st: add description of Framework support options.
+
+Mon May 23 12:21:37 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* re.c (make_regexp): should not return junk address during
+	  compile time.  [ruby-dev:26206]
+
+Sun May 22 21:54:06 2005  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* lib/{soap,wsdl,xsd}, test/{soap,wsdl,xsd}: imported soap4r/1.5.4.
+
+	  == SOAP client and server ==
+
+	  === for both client side and server side ===
+
+	  * improved document/literal service support.
+	    style(rpc,document)/use(encoding, literal) combination are all
+	    supported.  for the detail about combination, see
+	    test/soap/test_style.rb.
+
+	  * let WSDLEncodedRegistry#soap2obj map SOAP/OM to Ruby according to
+	    WSDL as well as obj2soap.  closes #70.
+
+	  * let SOAP::Mapping::Object handle XML attribute for doc/lit service.
+	    you can set/get XML attribute via accessor methods which as a name
+	    'xmlattr_' prefixed (<foo name="bar"/> -> Foo#xmlattr_name).
+
+	  === client side ===
+
+	  * WSDLDriver capitalized name operation bug fixed.  from
+	    1.5.3-ruby1.8.2, operation which has capitalized name (such as
+	    KeywordSearchRequest in AWS) is defined as a method having
+	    uncapitalized name. (converted with GenSupport.safemethodname
+	    to handle operation name 'foo-bar').  it introduced serious
+	    incompatibility; in the past, it was defined as a capitalized.
+	    define capitalized method as well under that circumstance.
+
+	  * added new factory interface 'WSDLDriverFactory#create_rpc_driver'
+	    to create RPC::Driver, not WSDLDriver (RPC::Driver and WSDLDriver
+	    are merged).  'WSDLDriverFactory#create_driver' still creates
+	    WSDLDriver for compatibility but it warns that the method is
+	    deprecated.  please use create_rpc_driver instead of create_driver.
+
+	  * allow to use an URI object as an endpoint_url even with net/http,
+	    not http-access2.
+
+	  === server side ===
+
+	  * added mod_ruby support to SOAP::CGIStub.  rename a CGI script
+	    server.cgi to server.rb and let mod_ruby's RubyHandler handles the
+	    script.  CGIStub detects if it's running under mod_ruby environment
+	    or not.
+
+	  * added fcgi support to SOAP::CGIStub.  see the sample at
+	    sample/soap/calc/server.fcgi.  (almost same as server.cgi but has
+	    fcgi handler at the bottom.)
+
+	  * allow to return a SOAPFault object to respond customized SOAP fault.
+
+	  * added the interface 'generate_explicit_type' for server side
+	    (CGIStub, HTTPServer).  call 'self.generate_explicit_type = true'
+	    if you want to return simplified XML even if it's rpc/encoded
+	    service.
+
+	  == WSDL ==
+
+	  === WSDL definition ===
+
+	  * improved XML Schema support such as extension, restriction,
+	    simpleType, complexType + simpleContent, ref, length, import,
+	    include.
+
+	  * reduced "unknown element/attribute" warnings (warn only 1 time for
+	    each QName).
+
+	  * importing XSD file at schemaLocation with xsd:import.
+
+	  === code generation from WSDL ===
+
+	  * generator crashed when there's '-' in defined element/attribute
+	    name.
+
+	  * added ApacheMap WSDL definition.
+
+	* sample/{soap,wsdl}: removed.
+
+Sun May 22 19:11:35 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/lib/openssl/ssl.rb (OpenSSL::SSL::SSLServer#intialize):
+	  should initialize session id context. [ruby-core:4663]
+
+	* ext/openssl/ossl_ssl.c (ossl_sslctx_setup): add session id support.
+
+Sat May 21 10:24:21 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* bcc32/Makefile.sub: tds files were not deleted when DESTDIR
+	  included '\' path delimiter. [ruby-dev:26193]
+
+Thu May 19 19:04:29 2005  speakillof  <speakillof@yahoo.co.jp>
+
+	* lib/rexml/encodings/SHIFT-JIS.rb: encoding and decoding were
+	  swapped. [ruby-core:4772]
+
+Wed May 18 23:42:25 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* error.c (exc_exception): reverted to call Exception#initialize
+	  directly.  fixed: [ruby-dev:26177]
+
+Wed May 18 23:39:09 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (glob_helper): get rid of using String.  [ruby-dev:26180]
+
+	* dir.c (push_braces): should skip balanced braces.
+
+	* eval.c (ruby_options), win32/win32.c (NtInitialize): move argument
+	  intialization back.  [ruby-dev:26180]
+
+Tue May 17 15:31:31 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* lib/webrick/httpserver.rb (WEBrick::HTTPServer#run): should
+	  break the loop if the socket reached to EOF. [ruby-talk:142285]
+
+Tue May 17 11:52:18 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (unixtime_to_filetime): use localtime() instead of
+	  gmtime() when using FileLocalTimeToFileTime().
+
+Mon May 16 22:28:43 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* win32/win32.h, {bcc32,win32,wince}/Makefile.sub: moved rb_[ugp]id_t
+	  to get rid of redefinition warnings on mingw.
+
+	* class.c (rb_class_init_copy): singleton class is disallowed to copy,
+	  from its definition.  fixed: [ruby-talk:142749]
+
+Mon May 16 08:52:29 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* win32/win32.{h,c}: define rb_[pgu]id_t.
+
+Mon May 16 00:21:02 2005  Tanaka Akira  <akr@m17n.org>
+
+	* lib/pathname.rb (Pathname#unlink): use SystemCallError instead of
+	  Errno::EISDIR because EISDIR is not portable.
+	  [ruby-core:5001]
+
+Sun May 15 22:11:33 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+
+	* lib/drb/drb.rb (DRbObject#method_missing): use raise(exception).
+	  [ruby-dev:26164]
+
+Sun May 15 18:56:35 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in, ruby.h: define rb_[pgu]id_t macros instead of typedefs
+	  to get rid of types which might not be defined yet.  [ruby-dev:26165]
+
+Sun May 15 14:35:46 2005  Tanaka Akira  <akr@m17n.org>
+
+	* lib/pathname.rb (Pathname#unlink): unlink a symlink to a directory
+	  was failed.  [ruby-core:4992]
+
+Sun May 15 09:57:30 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* win32/win32.c (unixtime_to_filetime): deal with DST.
+	  [ruby-talk:141817]
+
+Sat May 14 23:59:11 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* error.c (exc_exception, {exit,name_err,syserr}_initialize): call
+	  Execption#initialize.  fixed: [ruby-talk:142593]
+
+Sat May 14 23:57:26 2005  Erik Huelsmann  <ehuels@gmail.com>
+
+	* configure.in: Check for the availability of pid_t, gid_t and uid_t and
+	  remove AC_TYPE_UID_T.  fixed: [ruby-core:04745]
+
+	* defines.h: Remove pid_t typedef.
+
+	* ruby.h: Define rb_pid_t, rb_gid_t and rb_uid_t in accordance with
+	 the available system types.
+
+	* process.c: Change instances of pid_t and gid_t to their rb_*
+	 counterparts.
+
+	* ext/pty/pty.c: Change pid_t to rb_pid_t.
+
+	* vms/config.h: Define HAVE_{P,G,U}ID_T to 1.
+
+	* win32/Makefile.sub: Remove #define for {g,u}id_t.
+
+	* win32/win32.c: Change pid_t to rb_pid_t.
+
+	* wince/Makefile.sub: Remove #define for {g,u}id_t.
+
+	* wince/sys/types.h: Remove definitions of {p,g,u}id_t.
+
+Fri May 13 23:44:22 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/extmk.rb: keep srcdir unexpanded.
+
+	* lib/mkmf.rb (create_makefile): quote topdir and hdrdir if necessary.
+	  fixed: [ruby-core:04932]
+
+	* lib/mkmf.rb (configuration), {bcc32,win32,wince}/Makefile.sub: make
+	  also INSTALL_PROG and INSTALL_DATA system dependent.
+	  fixed: [ruby-core:04931]
+
+Fri May 13 17:54:39 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* variable.c (generic_ivar_get): rb_attr_get should not warn.
+	  [ruby-dev:26010]
+
+Fri May 13 12:28:43 2005  Daniel Berger  <djberge@qwest.com>
+
+	* array.c (rb_ary_select): can remove argc check. [ruby-core:4911]
+
+	* test/ruby/test_array.rb: add test for find_all.
+
+Fri May 13 11:29:00 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* eval.c (unknown_node): add volatile directive to prototype.
+
+Thu May 12 17:08:48 2005  Tanaka Akira  <akr@m17n.org>
+
+	* io.c (rb_io_eof, remain_size, read_all, io_read, appendline)
+	  (swallow, rb_io_each_byte, rb_io_getc): revert previous change.
+
+	* io.c (rb_io_eof, io_fread, appendline, swallow, rb_io_each_byte)
+	  (rb_io_getc, rb_getc): call clearerr before getc to avoid
+	  stdio incompatibility.
+
+Thu May 12 16:52:20 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* lib/rdoc/parsers/parse_c.rb: more readability for mixing
+	  progress "c..." and warning message.
+
+Thu May 12 16:31:00 2005  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/nkf/nkf-utf8/nkf.c: follow nkf 2.0.5
+
+Thu May 12 16:15:01 2005  Tanaka Akira  <akr@m17n.org>
+
+	* io.c (rb_io_eof, remain_size, read_all, io_read, appendline)
+	  (swallow, rb_io_each_byte, rb_io_getc): don't rely EOF flag.
+	  [ruby-talk:141527]
+
+Thu May 12 15:56:20 2005  Tilman Sauerbeck  <tilman@code-monkey.de>
+
+	* lib/rdoc/parsers/parse_c.rb: show parsing progress for C files.
+	  [ruby-core:4341]
+
+Thu May 12 13:47:56 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* test/drb/test_drb{ssl,unix}.rb: can test drb
+	  before install. (backported from HEAD) [ruby-dev:26146]
+
+Thu May 12 09:53:57 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* version.c (ruby_show_version): flush for non-tty stdout.
+
+Thu May 12 09:07:07 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* test/ruby/envutil.rb, test/drb/drbtest.rb: can test drb
+	  before install. (backported from HEAD) [ruby-Bugs-1672]
+
+Thu May 12 01:23:55 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (rb_eval), parse.y (arg): reduce fixnum range literal at
+	  parser.  fixed: [ruby-dev:26113]
+
+	* eval.c (unknown_node): ignore broken NODE to get rid of accessing
+	  possibly inaccessible address.  fixed: [ruby-dev:26122]
+	  should emit more useful information like [ruby-dev:26126], though.
+
+Wed May 11 16:20:01 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* lib/webrick/cgi.rb: new methods WEBrick::CGI#[], WEBrick::CGI#logger
+	  and WEBrick::CGI#config. (backported from HEAD)
+
+	* lib/webrick/httputils.rb (WEBrick::HTTPUtils.escape_path): should
+	  not use String#split("/"). (backported from HEAD)
+
+Wed May 11 15:58:39 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (break_jump): break should not cross functions.
+	  [ruby-list:40818]
+
+Wed May 11 10:39:37 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* lib/tempfile.rb (Tempfile#unlink): fixed typo.
+
+Wed May 11 01:03:36 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (TMP_ALLOC): use macro NEW_NODE() to get rid of warnings on
+	  platforms which have no alloca().  fixed: [ruby-talk:141301]
+
+Sun May  8 23:17:47 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk/timer.rb: fix typo.
+
+Sun May  8 16:52:56 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* lib/profiler.rb: fixed "undefined method `[]' for nil:NilClass"
+	  [ruby-core:4775] [ruby-talk:140401] [ruby-dev:26118]
+
+Sat May  7 22:58:00 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/mkmf.rb (have_var): no libs argument is given.
+
+Sun May  1 09:58:11 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ruby.c (process_sflag): replace '-' in variable names with '_'.
+	  [ruby-dev:26107]
+
+	* ruby.c (set_arg0): use also environment variable space for setting
+	  $0.  [ruby-core:04774]
+
+Wed Apr 27 23:42:22 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* win32/Makefile.sub (OPTFLAGS): default global optimization to
+	  disabled only for VC++6.
+
+Tue Apr 26 22:58:00 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tcltklib/tcltklib.c (ip_invoke_core): call Tcl's "::unknown"
+	  command when can't get information of target command.
+
+Mon Apr 25 01:18:43 2005  Tanaka Akira  <akr@m17n.org>
+
+	* regex.c: declare rb_warn to have variadic argument.  [ruby-core:4751]
+
+Sat Apr 23 19:45:59 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* ext/tcltklib/tcltklib.c (ip_RubyExitCommand): exit with status code
+	  via TclTkIp#_eval didn't work. [ruby-talk:139390]
+
+Fri Apr 22 16:41:50 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* ext/tcltklib/tcltklib.c (ip_set_exc_message): fixed memory leak.
+
+	* ext/tcltklib/tcltklib.c: eTkCallbackReturn was not initialized.
+
+Thu Apr 21 00:07:50 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/mkmf.rb (create_makefile): support platforms have file separator
+	  other than /.
+
+	* {bcc32,win32,wince}/Makefile.sub (BUILD_FILE_SEPARATOR): separator
+	  of building platform.
+
+	* {bcc32,win32,wince}/Makefile.sub (CP, INSTALL): use COPY command.
+
+Wed Apr 20 23:22:39 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* Makefile.in, common.mk: miniruby depens on MINIOBJS.
+
+	* dmydln.c (dln_load): dummy function to raise LoadError.
+
+	* cygwin/GNUmakefile.in, {bcc32,win32,wince}/Makefile.sub: miniruby
+	  can't load extensions on Windows.
+
+Wed Apr 20 23:01:35 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* win32/ifchange.bat: delete testing files.
+
+Wed Apr 20 07:27:18 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* {bcc32,win32,wince}/configure.bat, {bcc32,win32,wince}/setup.mak:
+	  add extout option.
+
+	* bcc32/setup.mak: make configuration variables overridable.
+
+Wed Apr 20 04:15:27 2005  Keiju Ishitsuka  <keiju@ruby-lang.org>
+
+	* lib/irb.rb lib/irb/* doc/irb: IRB 0.9.5
+
+Tue Apr 19 23:37:09 2005  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* lib/ftools.rb (File.safe_unlink): do not modify a symlinked file.
+
+Tue Apr 19 00:06:20 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/extmk.rb: expand path for ext/**/extconf.rb.
+
+Mon Apr 18 11:25:14 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* ext/zlib/zlib.c (zstream_run): fixed SEGV. [ruby-core:4712]
+
+Sun Apr 17 23:57:49 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/extmk.rb (extmake, parse_args): do not expand destdir.
+
+	* ext/extmk.rb (relative_from): treat mere drive letter as an absolute
+	  path.
+
+Sat Apr 16 17:01:16 2005  Kouhei Sutou  <kou@cozmixng.org>
+
+	* sample/rss/tdiary_plugin/rss-recent.rb (rss_recent_cache_rss):
+	  use the first date information of items as site date information
+	  if channel doesn't have date information.
+
+Sat Apr 16 15:27:03 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (RUBY_PROG_INSTALL): not add -p option to INSTALL.
+	  files need timestamps to be kept are only ar-archive on a few
+	  platforms, and be installed by instruby.rb but not INSTALL.
+	  fixed: [ruby-core:04721]
+
+	* mkconfig.rb: purge autoconf value variables.
+
+Sat Apr 16 10:36:01 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* bcc32/Makefile.sub: quick hack... prepend DESTDIR.
+	  still have restriction on DESTDIR ("", "/", "e:")
+
+Sat Apr 16 03:59:42 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/extconf.rb: check for OPENSSL_cleanse.
+
+	* ext/openssl/openssl_missing.h: ditto.
+
+Thu Apr 14 19:18:30 2005  Minero Aoki  <aamine@loveruby.net>
+
+	* lib/fileutils.rb (remove_file): ignore exceptions caused by
+	  chmod.
+
+	* lib/fileutils.rb (remove_dir): try to get rights to rmdir.
+	  [ruby-Bugs:1502] (2 items backportted from HEAD, rev 1.53-54)
+
+Thu Apr 14 16:57:40 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* bcc32/Makefile.sub: failed to remove debug information files.
+	  fixed: [ruby-dev:26034]
+
+Wed Apr 13 23:40:21 2005  Kouhei Sutou  <kou@cozmixng.org>
+
+	* lib/rss/rss.rb (RSS::VERSION): 0.1.3 -> 0.1.4.
+
+	* lib/rss/rss.rb (RSS::Element#converter): fixed converter
+	  transmission bug.
+
+Wed Apr 13 21:20:35 2005  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* configure.in (mingw32): extract msvcr*.dll from objdump result.
+
+Wed Apr 13 20:24:30 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (mingw32): use actual runtime DLL name as ruby DLL
+	  name and default load path.
+
+	* win32/Makefile.sub, win32/setup.mak: ditto.
+
+Tue Apr 12 15:33:09 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tcltklib/tcltklib.c (ip_finalize): better modification than the
+	  previous commit [ruby-dev:26029].
+
+Tue Apr 12 12:38:06 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tcltklib/tcltklib.c (ip_finalize): fix SEGV when Tcl_GlobalEval()
+	  modifies the argument string to eval.
+
+Tue Apr 12 02:21:55 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tcltklib/tcltklib.c (ip_finalize): add existence check of
+	  Tcl commands before calling Tcl_GlobalEval().
+
+Mon Apr 11 23:47:21 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+
+	* lib/drb/drb.rb: [druby-ja:123] fix: When reference of my object is
+	  loaded, the object is tainted.
+
+	* test/drb/test_drb.rb: ditto.
+
+Mon Apr 11 22:18:23 2005  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* dir.c, file.c (lstat): avoid warnings for mingw.
+
+Mon Apr 11 20:11:06 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tcltklib/tcltklib.c (ip_finalize): adhoc patch to avoid SEGV
+	  when exit on Tcl/Tk8.3.x.
+
+Mon Apr 11 15:26:25 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* lib/mkmf.rb (configuration): shouldn't output hdrdir twice.
+
+Mon Apr 11 12:09:05 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* {bcc32,win32,wince}/Makefile.sub: ri data was not installed
+	  into correct path. [ruby-dev:26011]
+
+	* bcc32/Makefile.sub: defaulted install-nodoc. [ruby-dev:26011]
+
+Sun Apr 10 10:12:42 2005  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
+
+	* ext/win32ole/win32ole.c(ole_invoke): retry after converting Qnil
+	  to VT_EMPTY.
+
+	* ext/win32ole/win32ole/tests/testWIN32OLE.rb: correct error
+	  message string "Unknown" => "unknown".
+
+Sat Apr  9 18:20:31 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk/image.rb: support to create TkImage object without
+	  creating a new image object on Tk.
+
+	* ext/tk/lib/tk/menu.rb: use TkCommandNames on create_self()
+
+	* ext/tk/lib/tk/root.rb: TkRoot.to_eval() returns '.'.
+
+	* ext/tk/lib/tk/text.rb: add methods to create a TkText::IndexString
+	  from (x, y) coords.
+
+	* ext/tk/lib/tkextlib/tile/: add demo and update support status.
+
+Sat Apr  9 14:42:29 2005  Kouhei Sutou  <kou@cozmixng.org>
+
+	* sample/rss/tdiary_plugin/rss-recent.rb: supported configuration
+	  via Web browser.
+
+Sat Apr  9 11:59:57 2005  Kouhei Sutou  <kou@cozmixng.org>
+
+	* lib/rss: backoported from HEAD.
+
+	* lib/rss: refactored.
+	  - gave a name to 'x'.
+	  - undef_method -> remove_method for avoiding a warning in ruby 1.6.
+
+
+	* lib/rss/parser.rb: @@setter -> @@setters.
+
+	* lib/rss/parser.rb
+	  (RSS::BaseListener.register_uri)
+	  (RSS::BaseListener.uri_registered?)
+	  (RSS::BaseListener.install_get_text_element):
+	  swapped the first argument and the second argument.
+
+	* lib/rss/taxonomy.rb: swapped the first argument and the second
+	  argument for RSS::BaseListener.install_get_text_element.
+	* lib/rss/image.rb: ditto.
+	* lib/rss/syndication.rb: ditto.
+	* lib/rss/dublincore.rb: ditto.
+	* lib/rss/parser.rb: ditto.
+	* lib/rss/1.0.rb: ditto.
+	* lib/rss/2.0.rb: ditto.
+	* lib/rss/0.9.rb: ditto.
+	* lib/rss/content.rb: ditto.
+
+	* lib/rss/parser.rb
+	  (RSS::BaseListener.install_setter)
+	  (RSS::BaseListener.register_uri): changed fallback way.
+
+	* lib/rss/parser.rb: added class name registry for complex model
+	  elements. (ex. have childlen elements, have some attributes and
+	  a child element and so on.)
+
+
+	* lib/rss/dublincore.rb: supported multiple Dublin Core items.
+	* lib/rss/maker/dublincore.rb: ditto.
+
+	* lib/rss/maker/image.rb: supproted new Dublin Core API.
+
+
+	* lib/rss/maker/base.rb: added default current_element implementation.
+
+
+	* lib/rss/trackback.rb (RSS::TrackBackUtils.new_with_value_if_need):
+	  moved to RSS::Utils.
+
+	* lib/rss/utils.rb (RSS::Utils.new_with_value_if_need):
+	  moved from RSS::TrackBackUtils.
+
+
+	* lib/rss/maker/image.rb: fixed invalid argument of
+	  add_need_initialize_variable bug.
+	* lib/rss/maker/trackback.rb: ditto.
+
+
+	* lib/rss/rss.rb (Hash#merge): added for ruby 1.6.
+
+	* lib/rss/rss.rb (RSS::BaseModel.date_writer): changed to accept nil
+	  for date value.
+
+
+	* test/test_dublincore.rb: added tests for plural accessor and
+	  multiple Dublin Core items.
+
+	* test/test_setup_maker_1.0.rb: fixed swapped actual and expected
+	  values.
+
+	* test/rss/rss-assertions.rb (assert_multiple_dublin_core): added
+	  an assertion for testing multiple Dublin Core items.
+
+	* test/rss/test_maker_dc.rb (test_rss10_multiple): added a test
+	  for making multiple Dublin Core items.
+
+	* test/rss/test_maker_dc.rb (test_date): added a test for #date=
+	  and #dc_date=.
+
+
+	* sample/rss/tdiary_plugin/rss-recent.rb:
+	  new option: @options['rss-recent.use-image-link']:
+	  use image as link instread of text if available.
+
+	* sample/rss/tdiary_plugin/rss-recent.rb (RSS_RECENT_VERSION):
+	  0.0.5 -> 0.0.6.
+
+Fri Apr  8 20:17:48 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/extmk.rb (extmake): hdrdir needs to be defined also in
+	  Config::CONFIG.
+
+	* lib/mkmf.rb (configuration, create_makefile): get rid of recursive
+	  macro reference.
+
+Fri Apr  8 18:26:56 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/ossl_ssl.c: add callbacks to OpenSSL::SSL::SSLContexts.
+	  - SSLContext#client_cert_cb=(aProc). it is called when a client
+	    certificate is requested by a server and no certificate was not
+	    set for the SSLContext. it must return an Array which includes
+	    OpenSSL::X509::Certificate and OpenSSL::PKey::RSA/DSA objects.
+	  - SSLContext#tmp_dh_callback=(aProc). it is called in key
+	    exchange with DH algorithm. it must return an OpenSSL::PKey::DH
+	    object.
+
+	* ext/openssl/ossl_ssl.c (ossl_sslctx_set_ciphers): ignore the
+	  argument if it's nil.
+
+	* ext/openssl/ossl_pkey.c
+	  (GetPrivPKeyPtr, ossl_pkey_sign): should call rb_funcall first.
+	  (DupPrivPKeyPtr): new function.
+
+	* ext/openssl/ossl_pkey_dh.c: add default DH parameters.
+
+	* ext/openssl/ossl_pkey.h: ditto.
+
+Fri Apr  8 01:55:20 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/sample/demos-{en,jp}/goldberg.rb: reduced window size.
+	  [ruby-dev:25992]
+
+Thu Apr  7 23:58:40 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/extmk.rb (extmake): keep directory names in Makefile as macros.
+
+	* lib/mkmf.rb (configuration, create_makefile): ditto.
+
+	* lib/mkmf.rb (CXX_EXT): separate C++ extensions.
+
+Thu Apr  7 17:43:25 2005  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* eval.c (rb_call0): "return" event hook should be always executed
+	  if event_hooks is set.  fixed: [ruby-core:04662]
+	  (backported from HEAD)
+
+Mon Apr  4 23:17:52 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk.rb (TkComm#array2tk_list): accept enc-mode argument to
+	  decide whether convert encoding of each element or not.
+
+	* ext/tk/lib/tk/variable.rb (TkVariable#value=): fail to convert the
+	  encoding of array elements when assign an array to an TkVariable
+	  object.
+
+Mon Apr  4 10:26:48 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* ext/tk/lib/tk/dialog.rb: fixed typo.
+
+Sun Apr  3 17:16:33 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* win32/win32.{h,c} (rb_w32_fdopen): avoid warning on bcc32.
+	  (backported from HEAD)
+
+Sat Apr  2 23:38:54 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (CP, INSTALL): get rid of less portable options.
+
+	* lib/mkmf.rb (configuration, create_makefile): correct configuration
+	  variable.
+
+	* {bcc32,win32,wince}/{Makefile.sub,setup.mak}: leave prefix empty in
+	  config.status for backward compatibility.  fixed: [ruby-core:04649]
+
+	* lib/mkmf.rb (create_makefile): ensure library directories get made
+	  before copying libraries there.
+
+Sat Apr  2 16:59:46 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk.rb: forgot to update RELEASE_DATE
+
+	* ext/tk/lib/tk/variable.rb: fix namespace trouble when autoloading
+
+	* ext/tk/lib/tk/palette.rb: define Tcl variable 'tkPalette' as global
+
+	* ext/tk/lib/tk/dialog.rb: use array2tk_list method when calling
+	  Tk.ip_eval.
+
+	* ext/tk/lib/tk/autoload.rb: add autoload entry 'TkDialogObj' and
+	  'TkWarningObj'
+
+Sat Apr  2 02:19:11 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk.rb (TkWindow.initialize): accept 'without_creating'
+	  option without 'widgetname' option to allow creating a widget object
+	  which is used as an argument of Tcl/Tk's widget allocation commands.
+
+	* ext/tk/lib/tk/image.rb (TkImage.initialize): accept 'imagename'
+	  option to create a image object by the given name.
+
+Thu Mar 31 22:23:51 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/mkmf.rb (SRC_EXT): exclude just case different suffixes on case
+	  insensitive file system platforms.
+
+	* README.EXT, README.EXT.ja (Appendix C): utility functions.
+
+Thu Mar 31 14:15:44 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/ossl_engine.c (ossl_engine_s_load): should return
+	  value. [ruby-dev:25971]
+
+Thu Mar 31 08:25:50 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* common.mk (RUBYOPT): clear for the environment RubyGems installed.
+
+	* common.mk (clean-local): keep $(PREP) files till distclean.
+
+	* common.mk (check): do all tests.
+
+Thu Mar 31 06:00:20 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/ossl_engine.c (ossl_engine_s_load): should not raise
+	  error even if the specified engine could not be loaded. (Dynamic
+	  engines don't have fixed name to load.)
+
+Thu Mar 31 00:18:27 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* win32/ifchange.bat, win32/rm.bat: backported from HEAD.
+
+Wed Mar 30 23:44:50 2005  Nobuyoshi Nakada  <nobu.nokada@softhome.net>
+
+	* Makefile.in, */Makefile.sub, */configure.bat,
+	  cygwin/GNUmakefile.in, common.mk, configure.in, ext/extmk.rb,
+	  lib/mkmf.rb, instruby.rb, runruby.rb: backport extout.
+	  [ruby-dev:25963]
+
+Wed Mar 30 17:41:48 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tcltklib/tcltklib.c: add TclTkIp#_create_console() method to
+	  create a Tcl/Tk's console window.
+
+	* ext/tk/lib/multi-tk.rb: support TclTkIp#_create_console() method.
+
+	* ext/tk/lib/remote-tk.rb: ditto.
+
+	* ext/tk/lib/tk/console.rb: ditto.
+
+	* ext/tk/lib/tk.rb: update RELEASE_DATE
+
+	* ext/tk/sample/demo-*/check2.rb: use 'return' in the Proc object.
+
+	* ext/tk/sample/tkextlib/**: ditto.
+
+Tue Mar 29 22:11:56 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+
+	* test/rinda/test_rinda.rb: use DRbObject.new_with instead of reinit.
+	  [ruby-dev:25961]
+
+Mon Mar 28 23:40:40 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+
+	* lib/drb/drb.rb: move method DRbObject#reinit to DRbObject.new_with.
+	  extract method DRbObject.prepare_backtrace. add DRb.regist_server,
+	  remove_server, fetch_server. change server in thread variable if
+	  in-proc server. [druby-ja:113]
+
+	* lib/drb/gw.rb: ditto.
+
+Mon Mar 28 20:43:34 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/syck/rubyext.c: get rid of warnings caused by a bug of VC.
+
+Mon Mar 28 08:39:49 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/iconv/iconv.c (iconv_create): Iconv::Failure requires 3
+	  arguments.  (pointed out by NaHi)
+
+Sat Mar 26 22:51:33 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk.rb (_callback_entry_class?): add for checking whether
+	  a class is available for a callback entry.
+
+	* ext/tk/lib/tk.rb (after_cancel): add Tk.after_cancel(afterID) method.
+
+	* ext/tk/lib/tk.rb (array2tk_list): change from private module method
+	  of TkComm to public module method.
+
+	* ext/tk/lib/tk.rb (cget): add check that slot argument is not
+	  empty string.
+
+	* ext/tk/lib/tk.rb (configinfo): ditto.
+
+	* ext/tk/lib/tk/itemconfig.rb (itemcget): add check that slot argument
+	  is not empty string.
+
+	* ext/tk/lib/tk/itemconfig.rb (itemconfiginfo): ditto.
+
+	* ext/tk/lib/tk/entry.rb: add TkEntry#icursor and icursor= (alias of
+	  cursor and cursor= method).
+
+	* ext/tk/lib/tk/font.rb: improve font treatment when the font name is
+	  empty string.
+
+	* ext/tk/lib/tk/variable.rb: add :variable, :window and :procedure
+	  type.
+
+	* ext/tk/lib/tk/variable.rb: improve treatment of array-type
+	  tkvariable.
+
+	* ext/tk/lib/tkextlib/blt.rb: add commands for zooming.
+
+	* ext/tk/lib/tkextlib/blt/*: bug fix.
+
+	* ext/tk/lib/tkextlib/treectrl/tktreectrl.rb: bug fix and add methods
+	  to call TreeCtrl commands for bindings.
+
+	* ext/tk/sample/tkextlib/blt/*: new sample scripts.
+
+	* ext/tk/sample/tkextlib/treectrl/*: ditto.
+
+Fri Mar 25 10:53:16 2005  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* configure.in (WIN32_LEAN_AND_MEAN): removed because a lot of
+	  troubles.  [ruby-list:40721]
+
+Thu Mar 24 23:10:44 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/mkmf.rb (macro_defined?): try to compile for an old compiler
+	  which doesn't bail out at #error directive.  [ruby-dev:25818]
+
+	* lib/mkmf.rb (check_sizeof): refine logging messages.
+
+Thu Mar 24 03:57:48 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* lib/webrick/utils.rb (WEBrick::Utils.create_listeners):
+	  - should raise ArgumentError if no port is specified.
+	  - even if the specified port is 0, all TCPServers should be
+	  initialized with the port given to the first one.
+
+	* lib/webrick/server.rb (WEBrick::GenericServer#initialize): if :Port
+	  parameter is 0, it should be updated with the port number which
+	  actually listened.
+
+Wed Mar 23 00:35:10 2005  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* test/ruby/test_settracefunc.rb (test_event): added tests for
+	  "class" and "end" and "raise".
+
+Tue Mar 22 22:40:18 2005  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* eval.c (rb_call0): check event_hooks instead of trace_func.
+
+Tue Mar 22 17:30:44 2005  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* eval.c (rb_add_event_hook): new function to add a hook function for
+	  interpreter events. (backported form HEAD)
+
+Sun Mar 20 22:51:19 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/mkmf.rb (mkmf_failed): check if Makefile is created without
+	  create_makefile.
+
+Sat Mar 19 23:48:10 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* misc/ruby-mode.el (ruby-expr-beg): returned true always.
+	  fixed: [ruby-list:40683]
+
+Sat Mar 19 00:41:02 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk/font.rb: add some TkFont class methods to get font
+	  information without creating a TkFont object.
+
+	* ext/tk/lib/tkextlib/treectrl/tktreectrl.rb: bug fix and define some
+	  classes for components of Tk::TreeCtrl
+
+Thu Mar 17 17:42:13 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* struct.c (make_struct): allow non local-id field
+	  names. [ruby-core:04575]
+
+	* struct.c (inspect_struct): ditto.
+
+Wed Mar 16 23:36:02 2005  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* eval.c (rb_call0): call_cfunc() should be protected.
+
+	* test/ruby/test_settracefunc.rb: added test for c-return.
+
+Wed Mar 16 22:20:25 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* object.c (str_to_id): fixed typo.
+
+Wed Mar 16 18:08:32 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (rb_call0): reorganize "return" event post.
+
+Tue Mar 15 23:49:19 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/iconv/iconv.c (Init_iconv): InvalidEncoding also should include
+	  Iconv::Failure.
+
+Tue Mar 15 16:38:11 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/tkutil.c (ary2list): give wrong arguments to hash2kv()
+
+Mon Mar 14 19:39:33 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk/timer.rb (TkTimer): forgot to clear @return_value
+	  when restarting
+
+	* ext/tk/lib/tk/sample/cd_timer.rb: new sample of TkRTTimer
+
+Mon Mar 14 12:21:03 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk/timer.rb (TkRTTimer): forgot to reset the callback
+	  time. So, 'continue' do all callbacks between 'stop' and 'continue'.
+
+Mon Mar 14 08:14:56 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* object.c (str_to_id): warn for NUL containing strings.
+
+Mon Mar 14 00:13:49 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk/timer.rb (TkRTTimer): correct calculation of offset
+	  value. get a little better accuracy.
+
+	* ext/tk/sample/demos-en/widget: use a binding with no local variables
+	  when eval a sample script.
+
+	* ext/tk/sample/demos-en/bind.rb: ditto.
+
+	* ext/tk/sample/demos-en/tcolor: ditto.
+
+	* ext/tk/sample/demos-jp/widget: ditto.
+
+	* ext/tk/sample/demos-jp/bind.rb: ditto.
+
+	* ext/tk/sample/demos-jp/tcolor: ditto.
+
+Sun Mar 13 10:04:17 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+
+	* test/rinda/test_rinda.rb: remove test_gc. [ruby-dev:25871]
+
+Thu Mar 10 19:12:06 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tcltklib/tcltklib.c (lib_eventloop_ensure): mis-delete a timer
+	  handler when exit from a recursive called eventloop
+
+	* ext/tk/lib/tk/timer.rb: new TkRTTimer class, which can works for a
+	  realtime operation
+
+	* ext/tk/sample/tkrttimer.rb: sample of TkRTTimer class
+
+	* ext/tk/lib/tk/textmark.rb: move  TkTextMark#+ and TkTextMark#- to
+	  TkText::IndexModMethods
+
+	* ext/tk/lib/tk/text.rb: improve TkTextMark#+ and TkTextMark#-, and
+	  add them to TkText::IndexModMethods module
+
+	* ext/tk/sample/tktextio.rb: add test part of "seek by text index
+	  modifiers"
+
+Thu Mar 10 08:10:11 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* re.c (make_regexp): need to free internal regexp structure when
+	  compilation fails.  [ruby-talk:133228]
+
+Wed Mar  9 20:25:58 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/ossl_ssl.c (ossl_start_ssl, ossl_ssl_write): call
+	  rb_sys_fail if errno isn't 0. [ruby-dev:25831]
+
+	* ext/openssl/lib/openssl/cipher.rb: fix typo. [ruby-dev:24285]
+
+Wed Mar  9 15:46:35 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* lib/webrick/server.rb (WEBrick::GenericServer#start): should
+	  restore @token if accept failure. suggested by Dominique Brezinski.
+	  [ruby-core:04518]
+
+Wed Mar  9 13:37:57 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/sample/tktextio.rb: fix bug of handling 'end' position.
+	  support initial text, overwrite setting and pos_gravity control.
+
+Tue Mar  8 18:16:55 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/sample/tktextio.rb: New sample script. TkTextIO class in this
+	  sample supports to use a text widget as if it is a I/O stream (such
+	  like as StringIO class).
+
+Tue Mar  8 13:54:40 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ext/socket/socket.c: workaround for some of 4.4BSD-Lite derived OSs.
+
+Tue Mar  8 12:36:17 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* ext/socket/socket.c: document from Sam Roberts
+	  <sroberts@uniserve.com> for getsockopt and setsockopt is merged.
+	  [ruby-doc:824]
+
+Tue Mar  8 01:27:00 2005  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/nkf/nkf-utf8/nkf.c: follow nkf 1.66
+	  fixed: [ruby-dev:25828]
+
+Mon Mar  7 21:35:02 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* sample/webrick/httpsd.rb: fix typo in comment. suggested by
+	  Kazuhiko Shiozaki.
+
+Mon Mar  7 14:55:43 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (block_pass): should not push unique number if a block is
+	  not an orphan.  [ruby-dev:25808]
+
+Wed Feb 16 02:55:21 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/ossl_ssl.c (ossl_start_ssl, ossl_ssl_read,
+	  ossl_ssl_write):
+	  - need to set errno on Win32 platform.
+	  - should call rb_sys_fail instead of rasing SSLError if
+	    SSL_ERROR_SYSCALL occured.
+	  - should wait for that the underlying IO become readable or
+	    writable if the error was SSL_ERROR_WANT_READ or
+	    SSL_ERROR_WANT_WRITE. [ruby-dev:25795]
+
+	* ext/openssl/lib/openssl/buffering.rb
+	  (Buffering#initialize): should set @eof and @rbuffer.
+	  (Buffering#fill_rbuff): should rescue Errno::EAGAIN.
+	  (Buffering#consume_rbuf): pointless eof flag resetting is deleted.
+	  (Buffering#read): should return an empty string if the specified
+	  size is zero.
+	  (Buffering#readpartial): new method.
+	  (Buffering#readline): fix typo.
+	  (Buffering#getc): return the first character of string correctly.
+	  (Buffering#each): fix typo.  suggested by Brian Ollenberger.
+	  (Buffering#readchar): fix typo.
+	  (Buffering#eof?): should read again it the input buffer is empty.
+	  (Buffering#do_write): should rescue Errno::EAGAIN.
+	  (Buffering#puts): use "\n" as the output field separator.
+
+	* ext/openssl/lib/openssl/ssl.rb: set non-blocking flag to the
+	  underlying IO.
+
+	* ext/openssl/extconf.rb: get rid of GNUmakefile generation.
+
+	* text/openssl/test_pair.rb: test for IO like methods.
+
+	* test/ruby/ut_eof.rb: test about empty file.
+
+Mon Mar  7 10:22:06 2005  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* lib/un.rb: should use OptionParser. (backported form HEAD)
+
+Mon Mar  7 09:18:42 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* string.c (rb_str_cmp_m): should not return false but nil.
+	  fixed: [ruby-dev:25811]
+
+Mon Mar  7 01:22:14 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/tkutil.c: remove the some codes which depend on the
+	  difference between Ruby1.8 and 1.9, because st.c on Ruby1.9
+	  was changed.
+
+Mon Mar  7 00:01:04 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tcltklib/tcltklib.c: fail to call TclTkLib.mainloop when $SAFE==4
+
+Sun Mar  6 16:41:33 2005  Minero Aoki  <aamine@loveruby.net>
+
+	* lib/net/http.rb: HTTPHeader holds its header fields as an array
+	  (backport from CVS HEAD rev 1.112-1.123). [ruby-list:40629]
+
+	* test/net/http/test_httpheader.rb: new file.
+
+Sun Mar  6 11:47:10 2005  Sam Roberts  <sroberts@uniserve.com>
+
+	* lib/pp.rb: rdoced.  [ruby-core:4490]
+
+Sun Mar  6 11:36:37 2005  Tanaka Akira  <akr@m17n.org>
+
+	* lib/pp.rb (File::Stat#pretty_print): Etc.getpwuid and Etc.getgrgid
+	  may return nil.  [ruby-talk:129826]
+	  reported by Daniel Berger.
+
+Sat Mar  5 18:06:21 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* dir.c (fnmatch): removed unnecessary code. (ruby_1_8 didn't have
+	  String#clear, so [ruby-dev:24749] didn't affect it)
+
+	* win32/win32.c (NtInitialize): ditto. (by numeric.c 1.101.2.14)
+
+Sat Mar  5 16:29:26 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/multi-tk.rb: freeze callback-entry objects
+
+	* ext/tk/lib/tkextlib/tile.rb: support tile-0.6
+
+Fri Mar  4 19:39:28 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser#do_includes): replace
+	  also locally defined modules.
+
+	* ext/iconv/iconv.c: backport Iconv::InvalidEncoding from CVS HEAD.
+
+	* ext/strscan/strscan.c: moved misplaced rdoc.
+
+Fri Mar  4 15:58:12 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* lib/cgi-lib.rb: add deprecation warning. [ruby-dev:25499]
+	  getopts.rb, parsearg.rb, importenv.rb as well.
+
+Fri Mar  4 11:17:06 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tcltklib/tcltklib.c (ip_rbUpdateCommand): get rid of
+	  warnings with Tcl/Tk 8.3 or former (backport from CVS_HEAD).
+
+	* ext/tcltklib/tcltklib.c (ip_rb_threadUpdateCommand): ditto.
+
+Fri Mar  4 10:15:30 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* lib/set.rb (SortedSet::setup): a hack to shut up warning.
+	  [ruby-talk:132866]
+
+Fri Mar  4 07:07:00 2005  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/nkf/nkf-utf8/nkf.c: follow nkf 1.63
+
+Thu Mar  3 23:49:00 2005  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/nkf/nkf-utf8/nkf.c: follow nkf 1.62
+
+Thu Mar  3 11:49:51 2005  Kouhei Sutou  <kou@cozmixng.org>
+
+	* sample/rss/tdiary_plugin/rss-recent.rb: added site information.
+
+Wed Mar  2 19:53:07 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/extmk.rb (parse_args): add DESTDIR only when not directed
+	  already.  fixed: [ruby-dev:25781]
+
+Wed Mar  2 17:14:18 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tcltklib/tcltklib.c (lib_eventloop_core): fix typo
+
+Wed Mar  2 16:00:02 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tcltklib/tcltklib.c: enforce thread-check and exception-handling
+	  to avoid SEGV trouble.
+	  [KNOWN BUG] When supports pthread and running multiple Tk
+	  interpreters, an interrupt signal causes SEGV frequently. That
+	  may be a trouble of Ruby's signal handler.
+
+	* ext/tk/tkutil/tkutil.c; fix a bug on converting a SJIS string array
+	  to a Tcl's list string.
+
+	* ext/tk/tcltklib.c: wrap Tcl's original "namespace" command to
+	  protect from namespace crash.
+
+	* ext/tk/lib/multi-tk.rb: enforce exception-handling.
+
+	* ext/tk/lib/multi-tk.rb: catch IRB_EXIT to work on irb.
+
+	* ext/tk/lib/tk.rb: ditto.
+
+	* ext/tk/tcltklib.c: add TclTkLib.mainloop_thread?
+
+	* ext/tk/lib/multi-tk.rb: (bug fix) callback returns a value.
+
+	* ext/tk/lib/tk/canvas.rb (delete): bug fix when multiple arguments.
+
+	* ext/tk/lib/clock.rb: fix 'no method error'.
+
+	* ext/tk/lib/clock.rb (self.clicks): accept a Symbol argument.
+
+	* ext/tk/lib/variable.rb: be able to set default_value_type; :numeric,
+	  :bool, :string, :symbol, :list, :numlist or nil (default; same to
+	  :string). If set a type, TkVariable#value returns a value of the
+	  type.
+
+	* ext/tk/lib/tkextlib/tclx/tclx.rb: add Tk::TclX.signal to warn the
+	  risk of using TclX extension's 'signal' command.
+
+	* ext/tk/sample/irbtk.rb: irb with Ruby/Tk.
+
+	* ext/tk/sample/demos-*/anilabel.rb: bug fix on 'show code'
+
+	* ext/tk/sample/demos-*/aniwave.rb: new Ruby/Tk animation demo.
+
+	* ext/tk/sample/demos-*/pendulum.rb: ditto.
+
+	* ext/tk/sample/demos-*/goldberg.rb: ditto.
+
+	* ext/tk/sample/demos-*/widget: add entries of animation demos.
+
+Tue Mar  1 00:47:43 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+
+	* test/rinda/test_rinda.rb: backport from CVS_HEAD. use
+	  MockClock.sleep instead of Kernel.sleep [ruby-dev:25387]
+
+Tue Mar  1 00:34:24 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+
+	* lib/rinda/tuplespace.rb (Rinda::TupleSpace): improved keeper thread.
+
+	* test/rinda/test_rinda.rb: ditto.
+
+Mon Feb 28 11:42:23 2005  Ian Macdonald  <ian@caliban.org>
+
+	* exception error messages updated.  [ruby-core:04497]
+
+Mon Feb 28 09:03:09 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* ext/socket/socket.c (Init_socket): add bunch of Socket
+	  constants.  Patch from Sam Roberts <sroberts@uniserve.com>.
+	  [ruby-core:04409]
+
+Wed Feb 23 15:04:32 2005  akira yamada  <akira@ruby-lang.org>
+
+	* lib/uri/generic.rb (split_userinfo): should split ":pass" into ""
+	  and "pass".  [ruby-dev:25667]
+
+Wed Feb 23 08:00:18 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* array.c (rb_ary_s_create): no need for negative argc check.
+	  [ruby-core:04463]
+
+	* array.c (rb_ary_unshift_m): ditto.
+
+Wed Feb 23 01:57:46 2005  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/imap.rb (initialize): handle certs correctly. Thanks,
+	  NABEYA Kenichi. (backported from CVS HEAD)
+
+Tue Feb 22 07:25:18 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (parser_yylex): identfier after dot must not be a variable.
+
+Mon Feb 21 10:04:49 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* {bcc32,win32,wince}/Makefile.sub (config.h): add fcntl.
+
+	* win32/win32.[ch] (fcntl): ditto.
+
+	* win32/win32.c (rb_w32_connect): support nonblocking mode.
+
+	* ext/socket/socket.c (wait_connectable, ruby_connect): support
+	  nonblocking connect on various platforms.
+	  all changes are backported from CVS HEAD. [ruby-core:3154],
+	  [ruby-core:4364].
+
+Sun Feb 20 00:48:48 2005  Tanaka Akira  <akr@m17n.org>
+
+	* lib/open-uri.rb (URI::FTP#buffer_open): access mechanism
+	  re-implemented according to RFC 1738.
+	  reported by Guillaume Marcais.  [ruby-talk:131650]
+
+Sat Feb 19 18:11:47 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+
+	* lib/drb/drb.rb (DRbObject#respond_to?): take two arguments.
+	  [ruby-dev:25722]
+
+	* test/drb/drbtest.rb: ditto.
+
+Sat Feb 19 13:52:02 2005  Tanaka Akira  <akr@m17n.org>
+
+	* lib/open-uri.rb: call OpenSSL::SSL::SSLSocket#post_connection_check
+	  after connection is made.
+
+Sat Feb 19 01:32:03 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* ext/bigdecimal/lib/bigdecimal/newton.rb: resolved LoadError.
+	  [ruby-dev:25685]
+
+	* ext/bigdecimal/sample/linear.rb: ditto.
+
+	* ext/bigdecimal/sample/nlsolve.rb: ditto.
+
+	* ext/bigdecimal/lib/bigdecimal/nlsolve.rb: removed because this file
+	  is sample script and same file exists in ext/bigdecimal/sample.
+
+Fri Feb 18 17:14:00 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* lib/xmlrpc/parser.rb (XMLRPC::FaultException): make it subclass
+	  of StandardError class, not Exception class.  [ruby-core:04429]
+
+Thu Feb 17 20:11:18 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* lib/drb/drb.rb (DRbServer.default_safe_level): fix typo.
+
+Thu Feb 17 20:11:18 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* test/digest/test_digest.rb: separate test case for each algorithms.
+	  [ruby-dev:25412]
+
+Thu Feb 17 11:54:00 2005  Nathaniel Talbott  <ntalbott@ruby-lang.org>
+
+	* lib/test/unit/collector.rb (collect_file): now deletes paths added
+	  to $LOAD_PATH instead of restoring it verbatim.
+
+	* lib/test/unit/autorunner.rb (AutoRunner.run): fixed so that
+	  'ruby -rtest/unit -rtest1 -rtest2 -e0' will use the objectspace
+	  collector again. Also tried to simplify the calling convention.
+
+	* test/runner.rb: adjusted for new AutoRunner semantics.
+
+	* lib/test/unit.rb: ditto.
+
+Thu Feb 17 04:21:47 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* lib/open3.rb (Open3::popen3): $? should not be EXIT_FAILURE.
+	  fixed: [ruby-core:04444]
+
+Thu Feb 17 00:09:45 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+
+	* test/drb/ignore_test_drb.rb: move TestDRbReusePort to new file
+	  [ruby-dev:25238]
+
+	* test/drb/test_drb.rb: add method DRbService.ext_service, move
+	  TestDRbReusePort to new file [ruby-dev:25238]
+
+	* test/drb/test_drb.rb: ditto.
+
+	* test/drb/test_drbssl.rb: ditto.
+
+	* test/drb/test_drbunix.rb: ditto.
+
+	* test/drb/ut_drb.rb: reduce sleep.
+
+Thu Feb 17 00:02:27 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (is_defined): NODE_IASGN is an assignment.
+
+Wed Feb 16 23:34:30 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+
+	* lib/drb/drb.rb: add lazy stop_service. ([druby-ja:109])
+
+	* lib/drb/extserv.rb: ditto.
+
+Wed Feb 16 17:07:57 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/tkutil.c: Follow the change of st.c (st_foreach)
+	  [ruby-list:40623].
+	  Sometimes mis-convert from a Ruby's Array of SJIS Strings, which
+	  includes some kind of SJIS characters, to a Tcl's UTF8 list string.
+
+Mon Feb 14 23:58:17 2005  Kouhei Sutou  <kou@cozmixng.org>
+
+	* lib/rss/parser.rb (RSS::ListenerMixin::tag_end):
+	  fixed invalid namespace handling bug.
+
+Mon Feb 14 13:12:38 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/lib/openssl/ssl.rb
+	 (OpenSSL::SSL::SSLSocket#post_connection_check): new method.
+
+Mon Feb 14 00:40:49 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+
+	* lib/drb/drb.rb (InvokeMethod.perform): pass DRb info to sub thread.
+
+	* test/drb/test_drb.rb (test_01_safe1_safe4_eval): fix test case.
+
+Sun Feb 13 23:13:46 2005  Kouhei Sutou  <kou@cozmixng.org>
+
+	* lib/rss/dublincore.rb (RSS::DublicCoreModel#date{,=}): added
+	  convenient methods.
+
+	* lib/rss/0.9.rb (RSS::Rss::Channel#date{,=}): ditto.
+
+	* lib/rss/2.0.rb (RSS::Rss::Channel::Item#date{,=}): ditto.
+
+	* test/rss/: added tests for the convenient methods.
+
+Sun Feb 13 22:43:03 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+
+	* lib/drb/drb.rb (DRbServer): add default_safe_level, safe_level,
+	  config[:safe_level] ([druby-ja:120])
+
+	* test/drb/test_drb.rb, ut_eval.rb, ut_safe1.rb: ditto.
+
+Sun Feb 13 16:56:52 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* lib/webrick/cgi.rb (WEBrick::CGI.start): should set reason-phrase
+	  to the value of status header field. ([ruby-dev:40617])
+
+Sun Feb 13 00:52:33 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+
+	* lib/erb.rb (ERB::Util.h, u): make it module_function.
+
+Sat Feb 12 17:29:19 2005  Tanaka Akira  <akr@m17n.org>
+
+	* lib/open-uri.rb (OpenURI.open_loop): send authentication only for
+	  the URI directly specified.
+
+Sat Feb 12 15:07:23 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* random.c (rand_init): suppress warning.
+
+Sat Feb 12 13:54:03 2005  Tanaka Akira  <akr@m17n.org>
+
+	* lib/open-uri.rb: support https if the platform provides CA
+	  certificates.
+
+Sat Feb 12 06:18:28 2005  URABE Shyouhei  <shyouhei@ice.uec.ac.jp>
+
+	* ext/etc/etc.c (Init_etc): sGroup needs HAVE_ST_GR_PASSWD check.
+	  [ruby-dev:25675]
+
+Fri Feb 11 17:40:42 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/ossl_x509store.c (ossl_x509store_set_default_paths):
+	  new method OpenSSL::X509::Store#set_default_paths.
+
+Fri Feb 11 11:33:53 2005  Tanaka Akira  <akr@m17n.org>
+
+	* lib/open-uri.rb (URI::HTTP#proxy_open): new option supported:
+	  :http_basic_authentication.
+	  suggested by Kent Sibilev.  [ruby-core:4392]
+
+Fri Feb 11 06:30:07 2005  George Ogata  <g_ogata@optushome.com.au>
+
+	* misc/ruby-mode.el: ignore parenthesis inside heredoc.
+	  [ruby-core:04415]
+
+Fri Feb 11 04:54:13 2005  Tilman Sauerbeck  <tilman@code-monkey.de>
+
+	* lib/rdoc/generators/html_generator.rb: [ruby-core:04412]
+
+	* lib/rdoc/generators/ri_generator.rb: ditto.
+
+Thu Feb 10 11:14:17 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/Makefile.sub (COMMON_HEADERS): shouldn't include winsock2.h.
+
+	* ext/socket/extconf.rb (sockaddr_storage): remove workaround for
+	  mswin32.
+
+Thu Feb 10 10:29:16 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ext/curses/curses.c: don't need to check HAVE_WCOLOR_SET excluding
+	  window_color_set().
+
+Thu Feb 10 00:47:25 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* struct.c (make_struct): fixed: [ruby-core:04402]
+
+Wed Feb  9 08:07:08 2005  Paul Duncan  <pabs@pablotron.org>
+
+	* ext/curses/curses.c (window_color_set): [ruby-core:04393]
+
+Tue Feb  8 23:51:47 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+
+	* lib/drb/drb.rb: reject :instance_eval, :class_eval, :module_eval
+	  [druby-ja:117]
+
+Tue Feb  8 13:06:12 2005  Sam Roberts  <sroberts@uniserve.com>
+
+	* ext/socket/socket.c (Init_socket): SO_REUSEPORT added.
+	  [ruby-talk:130092]
+
+Tue Feb  8 09:30:01 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* lib/cgi.rb (CGI::Cookie): [ruby-talk:130040]
+
+Tue Feb  8 00:19:02 2005  Tanaka Akira  <akr@m17n.org>
+
+	* lib/resolv.rb (Resolv::DNS::Name#subdomain_of?): new method.
+	  (Resolv::DNS::Name#inspect): ditto.
+	  Suggested by Sam Roberts.  [ruby-talk:129086]
+
+Mon Feb  7 10:06:30 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* object.c: [ruby-doc:818]
+
+Mon Feb  7 01:56:20 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* instruby.rb, rubytest.rb (srcdir): no longer embed srcdir into
+	  rbconfig.rb. (backported from CVS HEAD)
+
+	* ext/socket/extconf.rb (sockaddr_storage): winsock2.h have the
+	  definition of struct sockaddr_storage, but socket.c doesn't
+	  include it because this version of ruby still has binary level
+	  compatibility with winsock1.
+
+	* lib/mkmf.rb (create_makefile): should support header files in
+	  depend file.
+
+Mon Feb  7 01:21:50 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/socket/extconf.rb: check if getaddrinfo() works fine only when
+	  wide-getaddrinfo option is not given.  fixed: [ruby-dev:25422]
+
+	* lib/mkmf.rb ($extmk): check if under ext directory.
+
+	* lib/mkmf.rb (Logging.postpone): allow recursive operation.
+
+	* lib/mkmf.rb (try_constant): make sure if really a constant, reduce
+	  the number of times of compile.
+
+	* lib/mkmf.rb (have_macro, have_var, byte_order): new functions.
+
+	* lib/mkmf.rb (find_library): allow directory list with separators.
+
+	* lib/mkmf.rb (arg_config): manage provided configuration options.
+
+	* lib/mkmf.rb (dir_config): accept arrays of directory names as
+	  default values.
+
+	* mkconfig.rb: no longer embed srcdir and compile_dir into
+	  rbconfig.rb.
+
+	* lib/mkmf.rb (create_makefile): fix unbalanced parens.
+
+Sun Feb  6 19:23:01 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* eval.c (stack_extend): add prototype because VC++8 doesn't
+	  accept __declspec(noinline) with K&R style function definitions.
+	  (backported from CVS HEAD)
+
+Sun Feb  6 14:14:26 2005  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* lib/date.rb (new_with_hash): changed messages of exception.
+
+	* lib/date/format.rb (str[fp]time): undocumented conversion
+	  specifications %[1-3] are now deprecated.
+
+Sun Feb  6 12:20:11 2005  Akinori MUSHA  <knu@iDaemons.org>
+
+	* bignum.c (rb_big2ulong_pack): One too many arguments are passed
+	  to big2ulong().
+
+	* re.c (rb_reg_init_copy, rb_reg_initialize_m): One too many
+	  arguments are passed to rb_reg_initialize().
+
+Sun Feb  6 03:24:20 2005  Tanaka Akira  <akr@m17n.org>
+
+	* lib/resolv.rb (Resolv::DNS::Resource::TXT): multiple strings was not
+	  handled.
+	  (Resolv::DNS::Resource::TXT#strings): new method to return all
+	  strings.
+	  (Resolv::DNS::Message::MessageEncoder#put_string_list): new method.
+	  (Resolv::DNS::Message::MessageDecoder#get_string_list): ditto.
+	  based on [ruby-talk:129732] by Sam Roberts.
+
+Fri Feb  4 00:30:45 2005  Kouhei Sutou  <kou@cozmixng.org>
+
+	* lib/rss: supported Image module.
+	  http://web.resource.org/rss/1.0/modules/image/
+
+Thu Feb  3 23:42:36 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/stringio/stringio.c (strio_close, strio_close_read, strio_close_write):
+	  should return nil instead of self as well as IO.  [ruby-dev:25623]
+
+	* ext/stringio/stringio.c (strio_extend, strio_putc): fill with zero
+	  extended portion.  [ruby-dev:25626]
+
+Wed Feb  2 23:52:53 2005  sheepman  <sheepman@tcn.zaq.ne.jp>
+
+	* ext/stringio/stringio.c (strio_truncate): should MEMZERO an extended
+	  part.  [ruby-dev:25618]
+
+Wed Feb  2 21:56:01 2005  Kouhei Sutou  <kou@cozmixng.org>
+
+	* lib/rss/rss.rb (RSS::Element#convert): added.
+
+	* lib/rss/rss.rb: convert -> need_convert.
+
+	* lib/rss/1.0.rb: ditto.
+
+	* lib/rss/0.9.rb: ditto.
+
+	* lib/rss/2.0.rb: ditto.
+
+	* lib/rss/trackback.rb: ditto.
+
+Tue Feb  1 22:48:48 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+
+	* lib/drb/drb.rb (DRb::DRbObject#respond_to?): check marshal_dump and
+	_dump.
+
+Tue Feb  1 00:20:23 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (aix): fix linker flags on AIX.  [ruby-talk:125460]
+
+Mon Jan 31 13:33:21 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tcltklib/tcltklib.c: add invalid namespace check
+
+	* ext/tk/lib/multi-tk.rb: add invalid_namespace? method
+
+	* ext/tk/lib/remote-tk.rb: ditto
+
+Mon Jan 31 10:29:18 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* lib/irb/context.rb (IRB::Context::initialize): [ruby-core:04330]
+
+Sat Jan 29 09:42:12 2005  Sam Roberts  <sroberts@uniserve.com>
+
+	* lib/resolv.rb (Resolv::DNS::Resource::IN::SRV): Added RFC2782 SRV
+	  resource record for specifying location of services.
+
+Fri Jan 28 17:16:55 2005  Tanaka Akira  <akr@m17n.org>
+
+	* lib/resolv.rb (Resolv::DNS::Config.parse_resolv_conf):
+	  parse options line for ndots option.
+	  (Resolv::Hosts#lazy_initialize): return self.
+	  (Resolv::DNS#lazy_initialize): ditto.
+	  (Resolv::DNS::Config#lazy_initialize): ditto.
+	  Suggested by Sam Roberts.
+
+Thu Jan 27 13:18:03 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* st.c (st_foreach): report success/failure by return value.
+	  [ruby-Bugs-1396]
+
+Thu Jan 27 00:15:29 2005  Minero Aoki  <aamine@loveruby.net>
+
+	* test/fileutils/test_fileutils.rb (setup): support BSD-style
+	  directory group inheritance. (backport from HEAD, rev 1.32)
+
+	* test/fileutils/fileasserts.rb (assert_same_entry): show entry
+	  difference. (backport from HEAD, rev 1.4)
+
+Wed Jan 26 23:09:11 2005  Minero Aoki  <aamine@loveruby.net>
+
+	* lib/net/protocol.rb (WriteAdapter#puts): should append \n, not
+	  prepend. [ruby-talk:128302] (backport from HEAD, rev 1.75)
+
+Wed Jan 26 10:51:50 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (flock_winnt, flock_win95): unlock file even if
+	  LOCK_NB is specified. (backported from CVS HEAD)
+
+Tue Jan 25 17:11:51 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ruby.c (proc_options): correct -T option in RUBYOPT. (backported
+	  from CVS HEAD)
+
+Tue Jan 25 14:05:52 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tcltklib/tcltklib.c: fix SEGV bug; trouble on canceling remained
+	  after scripts [ruby-dev:25479]: NULL current namespace when deleting
+	    Tk interpreter [ruby-talk:126225]
+
+	* ext/tcltklib/extconf.rb: bug fix; TCL_ENABLE_THREAD flag is inverted
+	  [ruby-talk:126360]
+
+	* ext/tcltklib/extconf.rb: add yet another native-thread check
+
+	* ext/tk/tkutil.c: fix SEGV bug; NULL string pointer when finalize
+	  Ruby interpreter
+
+	* ext/tk/lib/multi-tk.rb: avoid warning for deleted safeTk ip frame
+
+	* ext/tk/lib/tk/bindtag.rb: bug fix; new method of named bindtag
+	  doesn't return the created object [ruby-dev:25479]
+
+	* ext/tk/lib/tk/menu.rb: bug on treating arguments [ruby-dev:25479]
+
+	* ext/tk/lib/tk.rb: bug fix; cannot accept a callback ID string for
+	  a command argument [ruby-dev:25479]
+
+	* ext/tk/lib/multi-tk.rb: ditto
+
+	* ext/tk/lib/tk/*.rb: ditto
+
+	* ext/tk/lib/tkextlib/*.rb: ditto
+
+	* ext/tk/sample/demos-jp/anilabel.rb: new demo script
+
+	* ext/tk/sample/demos-en/anilabel.rb: ditto
+
+	* ext/tk/sample/tkHTML/ss.rb: local variable scope bug fix
+	  [ruby-dev:25479]
+
+Mon Jan 24 15:44:25 2005  Tilman Sauerbeck  <tilman@code-monkey.de>
+
+	* lib/rdoc/parsers/parse_c.rb: allow whitespace after function names.
+	  [ruby-core:4296]
+
+	* lib/rdoc/parsers/parse_simple.rb: adds support for private comments
+	  in the "simple" parser. [ruby-core:4301]
+
+Mon Jan 24 15:44:25 2005  Charles Mills  <cmills@freeshell.org>
+
+	* lib/rdoc/parsers/parse_c.rb: adds support for constants
+	  (rb_define_const), accessors (rb_define_attr), and makes a
+	  couple fixes. [ruby-core:4307]
+
+Mon Jan 24 15:44:25 2005  Florian Gro  <florgro@gmail.com>
+
+	* lib/rdoc/parsers/parse_rb.rb: Logic for def Builtin.method() end
+	  [ruby-core:4302]
+
+Mon Jan 24 15:44:25 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* document updates - [ruby-core:04296], [ruby-core:04301],
+	  [ruby-core:04302], [ruby-core:04307]
+
+Sun Jan 23 12:41:16 2005  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* lib/soap/wsdlDriver.rb: from 1.5.3-ruby1.8.2, operation which has
+	  capitalized name (such as KeywordSearchRequest in AWS) is defined as
+	  a method having uncapitalized name. (converted with
+	  GenSupport.safemethodname to handle operation name 'foo-bar').  it
+	  introduced serious incompatibility; in the past, it was defined as a
+	  capitalized.
+
+	  define capitalized method as well under that circumstance.
+
+Sun Jan 23 05:24:42 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/ossl_ocsp.c (ossl_ocspreq_to_der): should call
+	  GetOCSPReq at first.
+
+Sat Jan 22 23:09:47 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+
+	* lib/drb/ssl.rb (accept): rescue SSLError. [druby-ja:110]
+
+Sat Jan 22 22:35:03 2005  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+
+	* lib/drb/unix.rb: fail if UNIXFileOwner is set. [druby-ja:111]
+
+Fri Jan 21 23:58:42 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* ext/stringio/stringio.c (strio_set_pos): clear EOF flag.
+	  [ruby-talk:127511]
+
+Fri Jan 21 20:07:02 2005  Tanaka Akira  <akr@m17n.org>
+
+	* lib/resolv.rb (Resolv::DNS::Config.resolv): don't raise ResolvError.
+	  reported by Sam Roberts.  [ruby-talk:127133]
+
+Fri Jan 21 16:58:10 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* dir.c (rb_push_glob): should work for NUL delimited patterns.
+
+Fri Jan 21 13:58:37 2005  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/imap.rb (u8tou16): fixed typo. fixed: [ruby-list:40546]
+	  (backported from CVS HEAD)
+
+Fri Jan 21 09:30:16 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* rubyio.h (rb_eof_error): should mark as NORETURN. (backported
+	  from CVS HEAD)
+
+Fri Jan 21 00:31:36 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* ext/syck/rubyext.c (syck_parser_bufsize_set): avoid VC++ warning
+	  "local variable 'size' used without having been initialized".
+
+Thu Jan 20 19:03:24 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ext/extmk.rb (extmake): shouldn't set $extflags on mswin32.
+
+	* win32/Makefile.sub (LIBRUBY_SO): should use $DLDOBJS instead of
+	  $EXTOBJS.
+	  fixed: [ruby-core:04290] (backported from CVS HEAD)
+
+Thu Jan 20 11:42:02 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* string.c (rb_str_new4): should propagate taintedness.
+
+	* struct.c (rb_struct_set): use original method name, not callee
+	  name, to retrieve member slot.  [ruby-core:04268]
+
+	* time.c (time_strftime): protect from format modification from GC
+	  finalizers.
+
+Wed Jan 19 18:06:40 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* lib/ipaddr.rb (to_s, test_to_s): too many colons with some cases.
+	  (backported from CVS HEAD)
+
+Wed Jan 19 01:16:30 2005  Tanaka Akira  <akr@m17n.org>
+
+	* lib/resolv.rb (Resolv::DNS::Config.parse_resolv_conf): ignore
+	  domain and search directive without an argument.
+	  reported by Sam Roberts.  [ruby-talk:126781]
+
+Tue Jan 18 15:03:05 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* lib/webrick/ssl.rb (WEBrick::Config::SSL): the default value
+	  of :SSLEnable is false.
+
+	* lib/webrick/server.rb (WEBrick::Daemon.start): prepared stdio
+	  don't allow changing its mode.
+
+	* lib/webrick/httpproxy.rb (WEBrick::HTTPProxyServer#proxy_service):
+	  should delete trailing LF from the result of pack("m*").
+
+	* lib/webrick/httpproxy.rb (WEBrick::HTTPProxyServer#proxy_connect):
+	  - should delete trailing LF from the result of pack("m*").
+	  - clear Request-Line not to send the response by HTTPServer#run.
+
+	* lib/webrick/httputils (WEBrick::HTTPUtils.parse_qvalues):
+	  refine regexp (and change the name of a local variable).
+
+	* lib/webrick/httputils.rb (WEBrick::HTTPUtils#escape_path): add
+	  new method to escape URI path component.
+
+	* lib/webrick/cgi.rb (WEBrick::CGI::Socket#request_line): should
+	  escape SCRIPT_NAME and PATH_INFO before being parsed as a URI.
+
+	* test/webrick/*, sample/webrick/httpproxy.rb: add new file.
+
+Mon Jan 17 23:33:46 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (aix): fix typo.  [ruby-talk:126401]
+
+Mon Jan 17 07:08:51 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/readline/readline.c: suppress warnings.
+
+	* lib/irb/extend-command.rb (IRB::ContextExtender.def_extend_command):
+	  ditto.
 
-	* string.c (str_substr, rb_str_aref): refactor not to create
-	  unnecessary empty string.
+	* lib/irb/ext/history.rb (IRB::Context::set_last_value): ditto.
 
-	* string.c (str_byte_substr, str_byte_aref): ditto.
+	* lib/irb/ext/history.rb (IRB::Context::eval_history): ditto.
 
-Mon May 30 00:09:37 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* lib/irb/locale.rb (IRB::Locale::real_load): ditto.
 
-	* ext/-test-/auto_ext.rb: fixed a heedless bug introduced at r55198.
-	  this change will make RubyCI green.
+	* lib/irb/slex.rb (SLex::Node::create_subnode): remove garbage.
 
-Sun May 29 22:58:19 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+Mon Jan 17 00:09:42 2005  WATANABE Hirofumi  <eban@ruby-lang.org>
 
-	* regexec.c (ONIGENC_IS_MBC_ASCII_WORD): redefine optimized one.
-	  WORD of Ruby's ascii compatible encoding is always [a-zA-Z0-9_].
+	* lib/uri/common.rb (PORT): typo fix. fixed: [ruby-core:04256]
 
-Sun May 29 22:44:19 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+Sat Jan 15 14:57:22 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* regexec.c (match_at): make compilers optimize harder.
+	* ruby.c (proc_options): ignore trailing CRs at the end of short
+	  options as well as long options.  fixed: [ruby-core:04232]
 
-Sun May 29 12:08:42 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Jan 15 13:35:16 2005  Kouhei Sutou  <kou@cozmixng.org>
 
-	* ext/-test-/auto_ext.rb (auto_ext): utility method to create
-	  extension libraries for tests.
+	* lib/rss/rss.rb (RSS::VERSION): 0.1.2 -> 0.1.3.
 
-Sat May 28 20:40:57 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/rss/rss.rb: accept inheritance. [ruby-talk:126104]
 
-	* misc/ruby-additional.el (ruby-insert-heredoc-code-block): insert
-	  here document code block for assert_separately mainly.
+Thu Jan 13 04:48:53 2005  Tanaka Akira  <akr@m17n.org>
 
-Sat May 28 20:34:19 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* io.c (io_fread): don't warn nonblocking behavior by default.
 
-	* test/test_unicode_normalize.rb: Add test to check for availability of
-	  Unicode data file; refactoring; fix an error with tests for destructive
-	  method (unicode_normalize!).
+Wed Jan 12 00:36:29 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat May 28 19:08:36 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* object.c (rb_class_superclass): superclass of singleton class also
+	  should be a singleton class.  fixed: [ruby-list:40519]
 
-	* test/ruby/enc/test_case_comprehensive.rb: Add error messages to tests
-	  for data file availability; refactoring.
+Tue Jan 11 09:44:40 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
 
-Sat May 28 14:00:10 2016  Kazuki Yamaguchi  <k@rhe.jp>
+	* numeric.c (Init_Numeric): turn off floating point exceptions
+	  on bcc32. "1e300".to_f had crashed by overflow.
 
-	* ext/openssl/lib/openssl/ssl.rb (SSLSocket): Move the implementation of
-	  SSLSocket#initialize to C. Initialize the SSL (OpenSSL object) in it.
-	  Currently this is delayed until ossl_ssl_setup(), which is called from
-	  SSLSocket#accept or #connect. Say we call SSLSocket#hostname= with an
-	  illegal value. We expect an exception to be raised in #hostname= but
-	  actually we get it in the later SSLSocket#connect. Because the SSL is
-	  not ready at #hostname=, the actual call of SSL_set_tlsext_host_name()
-	  is also delayed.
-	  This also fixes: [ruby-dev:49376] [Bug #11724]
+Tue Jan 11 03:10:10 2005  Minero Aoki  <aamine@loveruby.net>
 
-	* ext/openssl/ossl_ssl.c (ossl_ssl_initialize): Added. Almost the same
-	  as the Ruby version but this instantiate the SSL object at the same
-	  time.
+	* lib/fileutils.rb (copy_entry): could not copy symbolic link.
+	  [ruby-talk:125733]
 
-	  (ossl_ssl_setup): Adjust to the changes. Just set the underlying IO to
-	  the SSL.
+	* lib/fileutils.rb (copy_stream): use read/write instead of
+	  sysread/syswrite.
 
-	  (ssl_started): Added. Make use of SSL_get_fd(). This returns -1 if not
-	  yet set by SSL_set_fd().
+Mon Jan 10 23:08:15 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	  (ossl_ssl_data_get_struct): Removed. Now GetSSL() checks that the SSL
-	  exists.
+	* variable.c (rb_autoload): hide internal data from ruby level.
+	  fixed: [ruby-dev:25435], [ruby-list:40498]
 
-	  (ossl_ssl_set_session): Don't call ossl_ssl_setup() here as now the
-	  SSL is already instantiated in #initialize.
+Mon Jan 10 01:22:55 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	  (ossl_ssl_shutdown, ossl_start_ssl, ossl_ssl_read_internal,
-	   ossl_ssl_write_internal, ossl_ssl_stop, ossl_ssl_get_cert,
-	   ossl_ssl_get_peer_cert, ossl_ssl_get_peer_cert_chain,
-	   ossl_ssl_get_version, ossl_ssl_get_cipher, ossl_ssl_get_state,
-	   ossl_ssl_pending, ossl_ssl_session_reused,
-	   ossl_ssl_get_verify_result, ossl_ssl_get_client_ca_list,
-	   ossl_ssl_npn_protocol, ossl_ssl_alpn_protocol, ossl_ssl_tmp_key): Use
-	  GetSSL() instead of ossl_ssl_data_get_struct(). Use ssl_started().
+	* gc.c (rb_data_object_alloc): klass may be NULL.
+	  [ruby-list:40498]
 
-	  (Init_ossl_ssl): Add method declarations of SSLSocket#{initialize,
-	  hostname=}.
+Sun Jan  9 03:12:58 2005  Tanaka Akira  <akr@m17n.org>
 
-	* ext/openssl/ossl_ssl.h (GetSSL): Check that the SSL is not NULL. It
-	  should not be NULL because we now set it in #initialize.
+	* io.c (io_fread): warn nonblocking behavior.
+	  (io_readpartial): new method IO#readpartial.
 
-	* ext/openssl/ossl_ssl_session.c (ossl_ssl_session_initialize): No need
-	  to check if the SSL is NULL.
+Sat Jan  8 04:38:47 2005  why the lucky stiff  <why@ruby-lang.org>
 
-Sat May 28 10:47:40 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* lib/yaml.rb: Kernel#y requires an argument.
 
-	* gems/bundled_gems: Update latest releases, power_assert-0.3.0,
-	  test-unit 3.1.9, minitest 5.9.0, did_you_mean 1.0.1
+Fri Jan  7 21:12:29 2005  TAMURA Takashi  <sheepman@tcn.zaq.ne.jp>
 
-Sat May 28 10:45:40 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* random.c (rand_init): use ALLOC_N instead of ALLOCA_N
+	  [ruby-dev:25426]
 
-	* addr2line.c: drop support for ATARI ST platform. It was
-	  discontinued more than two decades ago. [fix GH-1350] Patch by
-	  @cremno
-	* include/ruby/ruby.h: ditto.
-	* io.c: ditto.
+Fri Jan  7 18:03:35 2005  Tanaka Akira  <akr@m17n.org>
 
-Sat May 28 10:39:47 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* gc.c (mark_locations_array): avoid core dump with -O3.
+	  [ruby-dev:25424]
 
-	* test/ruby/enc/test_case_comprehensive.rb: Converted exception for
-	  unavailable Unicode data files to failed assertion.
+Thu Jan  6 20:31:07 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Sat May 28 10:26:18 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* ext/zlib/zlib.c (zstream_end): should return value. (backported
+	  from CVS HEAD)
 
-	* lib/cgi/util.rb: added missing quote.
-	  [fix GH-1363][ci skip] Patch by @dwaller
+Thu Jan  6 19:55:13 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
 
-Fri May 27 17:38:49 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* win32/win32.c (rb_w32_close): didn't close socket handle.
+	  [ruby-dev:25414]
 
-	* variable.c (rb_local_constants_i): exclude hidden constants.
-	  [ruby-core:75575] [Bug #12389]
+	* win32/win32.c (rb_w32_open_osfhandle): bcc32's _open_osfhandle
+	  never set EMFILE.
 
-Fri May 27 17:09:44 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Jan  6 17:14:31 2005  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
 
-	* transcode.c (str_transcode0): scrub in the given encoding when
-	  the source encoding is given, not in the encoding of the
-	  receiver.  [ruby-core:75732] [Bug #12431]
+	* random.c (random_seed): O_NONBLOCK isn't defined on some
+	  platforms. [ruby-dev:25417]
 
-Fri May 27 15:07:32 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Jan  6 13:45:35 2005  Tanaka Akira  <akr@m17n.org>
 
-	* include/ruby/ruby.h (rb_scan_args): remove nul padding which
-	  caused syntax error if fmt is not a string literal.
+	* lib/time.rb: recognize +00:00 and GMT as a localtime.
 
-	* include/ruby/ruby.h (rb_scan_args_verify): suppress array-bounds
-	  warnings by old clang.
+Thu Jan  6 07:58:28 2005  Dave Thomas  <dave@pragprog.com>
 
-	* include/ruby/ruby.h (rb_scan_args0): make extractor macros
-	  inline functions, which do not validate the format and are
-	  unnecessary to be expanded.
+	* lib/rdoc/usage.rb (RDoc::RDoc.usage_no_exit): Allow for colons
+	  in path names on DOS machines. (thanks to Johan Nilsson)
 
-Fri May 27 01:00:36 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+Wed Jan  5 20:16:32 2005  Tanaka Akira  <akr@m17n.org>
 
-	* symbol.c (is_identchar): use ISDIGIT instead of rb_enc_isalnum.
-	  Though rb_enc_isalnum is encoding aware function, its argument here
-	  is *m, which is a single byte. Therefore ISDIGIT is faster.
+	* random.c (limited_big_rand): didn't work if SIZEOF_BDIGITS == 2.
+	  [ruby-dev:25408]
 
-	* symbol.c (is_special_global_name): ditto.
+	* random.c (random_seed): refined.
 
-	* symbol.c (rb_enc_symname_type): ditto.
+Wed Jan  5 12:49:39 2005  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri May 27 00:39:40 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* eval.c (rb_thread_initialize): Thread objects cannot be initialized
+	  again.  fixed: [ruby-core:04067]
 
-	* include/ruby/ruby.h (rb_scan_args): add nul padding here to
-	  apply to all references.
+Wed Jan  5 10:48:16 2005  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* include/ruby/ruby.h (rb_scan_args_verify): move length mismatch
-	  check outside conditional operators.
+	* dir.c (dir_s_mkdir): win32 special processing doesn't need any
+	  longer. (backported from CVS HEAD)
 
-Thu May 26 14:21:10 2016  Kazuki Yamaguchi  <k@rhe.jp>
+	* win32/win32.[ch] (rb_w32_mkdir): new function. POSIX.1 compatible
+	  interface. (backported from CVS HEAD)
 
-	* ext/openssl/ossl_pkey_dh.c (ossl_dh_compute_key): Check that the DH
-	  has 'p' (the prime) before calling DH_size(). We can create a DH with
-	  no parameter but DH_size() does not check and dereferences NULL.
-	  [ruby-core:75720] [Bug #12428]
+	* win32/win32.[ch] (rb_w32_rmdir): new function. (backported from CVS
+	  HEAD)
 
-	* ext/openssl/ossl_pkey_dsa.c (ossl_dsa_sign): Ditto. DSA_size() does
-	  not check dsa->q.
+Wed Jan  5 02:30:11 2005  Tanaka Akira  <akr@m17n.org>
+
+	* random.c (init_by_array): imported from mt19937ar-cok.tgz.
+	  (genrand_int32): ditto.
+	  (genrand_real): replaced with genrand_res53 in mt19937ar-cok.
+	  (rand_init): support bignum for longer seed.
+	  (random_seed): generate longer seed.
+	  (make_mask): new function.
+	  (limited_rand): ditto.
+	  (limited_big_rand): ditto.
+	  (rb_f_rand): call limited_rand and limited_big_rand.
+	  [ruby-dev:25403]
+
+Tue Jan  4 23:25:29 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* bignum.c (rb_big_rand): should return positive random number.
+	  [ruby-dev:25401]
+
+Tue Jan  4 11:15:29 2005  TAMURA Takashi  <sheepman@tcn.zaq.ne.jp>
+
+	* bignum.c (rb_big_rand): do not use rb_big_modulo to generate
+	  random bignums.  [ruby-dev:25396]
+
+Mon Jan  3 14:01:54 2005  Tanaka Akira  <akr@m17n.org>
+
+	* random.c (random_seed): don't use /dev/urandom if it is not
+	  character device.
+
+Mon Jan  3 11:37:42 2005  Tanaka Akira  <akr@m17n.org>
+
+	* random.c (random_seed): use /dev/urandom if available.
+	  [ruby-dev:25392]
+
+Mon Jan  3 07:46:42 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* lib/webrick/httpauth/htpasswd.rb (WEBrick::Htpasswd#reload):
+	  raise NotImplementedError if password is encrypted by digest
+	  algorithms. This patch is contributed by sheepman. [ruby-list:40467]
+
+	* lib/webrick/httpauth/digestauth.rb
+	  (WEBrick::HTTPAuth::DigestAuth#_authenticate): fix digest calculation.
+	  This patch is contributed by sheepman. [ruby-list:40482]
+
+	* lib/webrick/{httpauth.rb,httpauth/basicauth.rb,httpproxy.rb}: use
+	  pack/unpack-template char "m" instead of lib/base64.rb to do base64
+	  encoding/decoding. fixed: [ruby-dev:25336]
+
+	* test/webrick/test_httpauth.rb: new file.
+
+Sat Jan  1 04:20:23 2005  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/ossl_ns_spki.c (ossl_spki_set_challenge): should call
+	  StringValue before GetSPKI. fixed: [ruby-dev:25359].
+
+Sat Jan  1 01:13:28 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* variable.c (rb_autoload): [ruby-dev:25373]
+
+Fri Dec 31 14:10:43 2004  Dave Thomas  <dave@pragprog.com>
+
+	* lib/rdoc/ri/ri_formatter.rb (RI::TextFormatter::display_flow_item): Fix problem
+	  if heading contains formatting.
+
+Thu Dec 30 00:41:42 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (svalue_to_avalue): [ruby-dev:25366]
+
+	* string.c (rb_str_justify): [ruby-dev:25367]
+
+Wed Dec 29 11:07:07 2004  Dave Thomas  <dave@pragprog.com>
+
+	* lib/rdoc/generators/template/html/kilmer.rb: Update to use new
+	  sections.
+
+Tue Dec 28 22:31:46 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (rb_str_justify): create buffer string after argument type
+	  conversion.  fixed: [ruby-dev:25341]
+
+Tue Dec 28 15:41:48 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/nkf/nkf-utf8/nkf.c (reinit): should initialize all static
+	  variables.  fixed: [ruby-list:40445]
+
+Tue Dec 28 15:25:20 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/nkf/lib/kconv.rb (Kconv::RegexpEucjp): second byte is up to
+	  0xfe.
+
+	* ext/nkf/lib/kconv.rb (Kconv#kconv): should handle UTF8 and UTF16
+	  properly.
+
+Tue Dec 28 13:35:20 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/zlib/zlib.c (rb_deflate_s_deflate, rb_inflate_s_inflate): ensure
+	  freeing internal zstreams.  fixed: [ruby-dev:25309]
+
+	* ext/zlib/zlib.c (rb_deflate_init_copy): replace rb_deflate_clone.
+
+Tue Dec 28 12:26:45 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/Makefile.sub, win32/setup.mak (RDOCTARGET, install,
+	  install-nodoc, install-doc): rdoc support for mswin32.
+
+	* win32/configure.bat (--enable-install-doc, --disable-install-doc):
+	  ditto.
+
+Mon Dec 27 20:02:14 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tcltklib/tcltklib.c: fix SEGV bug when deleting Tk interp
+
+	* ext/tk/lib/multi-tk.rb: ditto
+
+Mon Dec 27 16:55:17 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/ossl_x509name.c (Init_ossl_x509name): should use
+	  rb_hash_new to get exactly a Hash. fix [ruby-dev:25325].
+
+Mon Dec 27 16:29:56 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* string.c (rb_str_justify): [ruby-dev:25341]
+
+Mon Dec 27 15:47:48 2004  Minero Aoki  <aamine@loveruby.net>
+
+	* test/fileutils/fileasserts.rb: sync with HEAD.
+
+	* test/fileutils/test_fileutils.rb: ditto.
+
+	* test/fileutils/test_nowrite.rb: ditto.
+
+Mon Dec 27 15:21:07 2004  Minero Aoki  <aamine@loveruby.net>
+
+	* lib/fileutils.rb (mv): should raise error when moving a
+	  directory to the (empty) directory. [ruby-talk:124368]
+	  (backport from HEAD 1.48)
+
+	* lib/fileutils.rb (mv): wrongly did not overwrite file on Win32
+	  platforms. (backport from HEAD 1.48)
+
+Sat Dec 25 11:11:48 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* stable version 1.8.2 released.
+
+Sat Dec 25 04:23:49 2004  Minero Aoki  <aamine@loveruby.net>
+
+	* lib/fileutils.rb (mkdir, mkdir_p): should ensure directory
+	  permission. (backportted from HEAD, 1.47)
+
+	* lib/fileutils.rb (traverse, remove_dir): untaint trasted
+	  objects. (backportted from HEAD, 1.46)
+
+Sat Dec 25 01:28:23 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* io.c: cancel io_reopen() change on Dec. 24th.
+
+	* dln.c: use <dlfcn.h> for NetBSD.  [ruby-dev:25313]
+
+	* io.c (rb_f_select): IO list could be altered.  [ruby-dev:25312]
+
+Fri Dec 24 23:51:48 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* bcc32/Makefile.sub: bcc32 should use RTL dll (backport from HEAD)
+	  [ruby-dev:25306]
+
+	* win32/win32.[ch]: ditto.
+
+Fri Dec 24 23:27:18 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk/image.rb: TkPhotoImage#cget bug fix
+
+Fri Dec 24 18:39:25 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* win32/win32.[ch]: failed to compile on bcc32 (and probably wince)
+	  [ruby-dev:25306]
+
+Fri Dec 24 02:52:52 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (io_reopen, rb_io_reopen): prohibit to change access mode for
+	  special IO ports.  [ruby-dev:25225]
+
+Fri Dec 24 02:22:53 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/syck/rubyext.c (rb_syck_io_str_read): [ruby-core:03973]
+
+	* ext/syck/rubyext.c (syck_loader_transfer): check type conversion.
+
+	* ext/syck/rubyext.c (syck_parser_assign_io, rb_new_syck_node): duck
+	  typing.
+
+	* ext/syck/rubyext.c (syck_parser_s_alloc, syck_parser_initialize):
+	  allocation framework.
+
+	* ext/syck/rubyext.c (syck_emitter_s_alloc, syck_emitter_initialize):
+	  ditto.
+
+Fri Dec 24 01:21:00 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tkextlib/blt.rb: add BLT extension support
+
+	* ext/tk/lib/tkextlib/blt/*.rb: ditto
+
+	* ext/tk/lib/tkextlib/blt/tile/*.rb: ditto
+
+Thu Dec 23 23:36:28 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* process.c (proc_setgroups): check if the argument lenght is
+	  modified.  fixed: [ruby-dev:25285]
+
+Thu Dec 23 13:13:33 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tcltklib/tcltklib.c: define TclTkLib::COMPILE_INFO and
+	  RELEASE_DATE
+
+	* ext/tcltklib/extconf.rb: ditto
+
+	* ext/tk/tkutil.c: define TkUtil::RELEASE_DATE
+
+	* ext/tk/lib/tk.rb: define Tk::RELEASE_DATE
+
+Thu Dec 23 09:38:31 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (io_reopen): restore exact mode.  fixed: [ruby-core:04003]
+
+Thu Dec 23 00:16:32 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (bsdi): use $(CC) for LDSHARED.  fixed [ruby-dev:25270]
+
+Wed Dec 22 11:14:55 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (rb_io_mode_modenum): replace O_ACCMODE with O_RDWR.
+	  fixed: [ruby-dev:25273]
+
+Wed Dec 22 08:34:32 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/dl/sym.c (rb_dlsym_initialize): extract internal pointers after
+	  all argument conversion.  fixed: [ruby-dev:25271]
+
+Wed Dec 22 00:08:01 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* lib/soap/*, test/soap/*, sample/soap/authheader/*: eval cleanup.
+
+Tue Dec 21 22:07:33 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/ossl_asn1.c (ossl_asn1_traverse, ossl_asn1_decode,
+	  ossl_asn1_decode_all): temporary value should be marked volatile.
+
+Tue Dec 21 14:40:02 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/ossl_asn1.c (ossl_asn1_traverse, ossl_asn1_decode,
+	  ossl_asn1_decode_all): use rb_str_new4 to avoid SEGV.
+	  fix [ruby-dev:25261]
+
+	* test/openssl/test_asn1.rb: add tests for OpenSSL::ASN1.
+
+Tue Dec 21 12:22:40 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (io_reopen): keep duplex pipe in correct mode for exception
+	  safeness.  fixed: [ruby-dev:25152]
+
+Tue Dec 21 12:10:04 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk/grid.rb: rescue bug of 'grid configure' on Tcl/Tk8.3-
+
+Tue Dec 21 00:53:01 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* ext/openssl/ossl_asn1.c (ossl_asn1_traverse): [ruby-dev:25261]
+
+	* ext/openssl/ossl_asn1.c (ossl_asn1_decode): ditto.
+
+	* ext/openssl/ossl_asn1.c (ossl_asn1_decode_all): ditto.
+
+Mon Dec 20 23:22:26 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* added files:
+	  * lib/soap/mapping/wsdl*.rb
+	  * lib/wsdl/soap/element.rb
+	  * lib/wsdl/xmlSchema/simpleContent.rb
+
+	* modified files:
+	  * lib/soap/*
+	  * lib/wsdl/*
+	  * lib/xsd/*
+	  * test/soap/*
+	  * test/wsdl/*
+	  * test/xsd/*
+	  * sample/soap/*
+	  * sample/sdl/*
+
+	* summary
+	  * imported from the soap4r repository.  Version: 1.5.3-ruby1.8.2
+
+	  * added several XSD basetype support: nonPositiveInteger,
+	    negativeInteger, nonNegativeInteger, unsignedLong, unsignedInt,
+	    unsignedShort, unsignedByte, positiveInteger
+
+	  * HTTP client connection/send/receive timeout support.
+
+	  * HTTP client/server gzipped content encoding support.
+
+	  * improved WSDL schema definition support; still is far from
+	    complete, but is making step by step improovement.
+
+Mon Dec 20 22:56:39 2004  Tanaka Akira  <akr@m17n.org>
+
+	* gc.c (stack_end_address): gcc noinline attribute is available since
+	  gcc-3.1.
+
+Mon Dec 20 14:07:02 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/multi-tk.rb: supports new features of Tcl/Tk8.5a2
+
+	* ext/tk/lib/tk/clock.rb: ditto
+
+	* ext/tk/lib/tk/text.rb: ditto
+
+	* ext/tk/lib/tk/panedwindow.rb: ditto
+
+Mon Dec 20 12:47:13 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/lib/net/https.rb,protocols.rb,telnets.rb: delete
+	  doc and code about SSLContext#{key_file,cert_file}.
+	  fixed: [ruby-dev:25243]
+
+Mon Dec 20 12:42:17 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* io.c (io_fwrite): workaround for MSVCRT's bug.
+	  fixed: [ruby-core:03982]
+
+Mon Dec 20 11:21:04 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (rb_io_eof): check if closed before clearerr().
+	  fixed: [ruby-dev:25251]
+
+Mon Dec 20 03:30:40 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/cgi/session.rb (CGI::Session#initialize): empty session id was
+	  used if request had no session key.  fixed: [ruby-core:03981]
+
+Mon Dec 20 01:51:01 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* struct.c (make_struct): [ruby-dev:25249]
+
+Mon Dec 20 00:28:20 2004  Kouhei Sutou  <kou@cozmixng.org>
+
+	* lib/rexml/encodings/SHIFT-JIS.rb: backported from CVS HEAD.
+
+	* lib/rexml/encodings/SHIFT_JIS.rb: ditto.
+
+Sun Dec 19 17:19:48 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/ossl_x509store.c
+	  (ossl_x509store_set_time): add OpenSSL::X509::Store#time=.
+	  (ossl_x509stctx_set_time): add OpenSSL::X509::StoreContext#time=.
+
+	* test/openssl/ossl_x509store.rb: test certificate validity times.
+
+	* ext/openssl/ossl_x509name.c (ossl_x509name_to_s): add optional
+	  second argument to specify the output format (see also
+	  X509_NAME_print_ex).
+
+	* ext/openssl/ossl_x509name.c (ossl_x509name_init): new constants:
+	  OpenSSL::X509::Name::COMPAT, OpenSSL::X509::Name::RFC2253,
+	  OpenSSL::X509::ONELINE, OpenSSL::X509::MULTILINE.
+
+	* ext/openssl/lib/openssl/x509.rb (OpenSSL::X509::Name::RFC2253DN):
+	  new module to provide the parse for RFC2253 DN format.
+
+	* ext/openssl/lib/openssl/x509.rb (OpenSSL::X509::Name.parse_rfc2253):
+	  new method to parse RFC2253 DN format.
+
+	* test/openssl/ossl_x509name.rb: add tests about RFC2253 DN.
+
+	* text/openssl/ssl_server.rb: try to listen ports from 20443 to 20542
+	  while EADDRINUSE is raised.
+
+	* all changes in this entry are backport from 1.9.
+
+Sun Dec 19 17:24:59 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (enable_rpath): use rpath flag to embed the library
+	  path into extensions on ELF environment.  [ruby-dev:25035]
+
+Sun Dec 19 11:01:25 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/test/unit.rb: use standalone runner for -e.
+
+	* lib/test/unit/autorunner.rb (Test::Unit::AutoRunner#options): accept
+	  multiple -p and -x options.
+
+	* lib/test/unit/collector/dir.rb (Test::Unit::Collector::Dir#recursive_collect):
+	  ditto.
+
+Sat Dec 18 16:36:23 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/zlib/zlib.c (rb_deflate_s_deflate, rb_inflate_s_inflate):
+	  disallow interrupt by type conversion.  fixed: [ruby-dev:25226]
+
+Sat Dec 18 15:16:41 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* lib/webrick/httpauth.rb,
+	  lib/webrick/httpauth/{basicauth.rb,digestauth.rb}: use
+	  pack/unpack-template char "m" instead of lib/base64.rb to do base64
+	  encoding/decoding.
+
+Sat Dec 18 10:51:01 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* dir.c (dir_open_dir): new function.  [ruby-dev:25242]
+
+Fri Dec 17 18:07:01 2004  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* test/readline/test_readline.rb: fix for BSD. Thanks, GOTOU Yuuzou.
+	  fixed: [ruby-dev:25218]
+
+Fri Dec 17 16:28:12 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk.rb: fix bug on setting up system encoding
+
+	* ext/tk/lib/tk/event.rb: fix error on require process
+
+	* ext/tk/lib/tk/font.rb: fix abnormal termination error on Windows
+
+	* ext/tk/lib/tk/virtevent.rb: TkVirtualEvent::PreDefVirtEvent.new()
+	  accepts event-sequence arguments
+
+	* ext/tk/lib/tk/text.rb: fail to dump embedded images
+
+	* ext/tk/lib/tk/text.rb: tag_nextrange and tag_prevrange returns wrong
+	  types of values
+
+	* ext/tk/lib/tk/texttag.rb: nextrange and prevrange returns wrong
+	  types of values
+
+	* ext/tk/lib/tk/text.rb: add TkText::IndexModMethods module and
+	  TkText::IndexString class to treat text index modifiers
+
+	* ext/tk/lib/tk/texttag.rb: use TkText::IndexModMethods module
+
+	* ext/tk/lib/tk/textmark.rb: ditto
+
+	* ext/tk/lib/tk/textimage.rb: ditto
+
+	* ext/tk/lib/tk/textwindow.rb: ditto
+
+	* ext/tk/lib/tk/textimage.rb: wrong gravity of text mark for embedded
+	  image
+
+	* ext/tk/lib/tk/textwindow.rb: wrong gravity of text mark for
+	  embedded window
+
+Fri Dec 17 13:50:00 2004  Akiyoshi, Masamichi  <akiyoshi@hp.com>
+
+	* vms/vmsruby_private.c, vms/vmsruby_private.h: private routines
+	  for VMS port are added.
+
+	* eval.c (ruby_init): change to call VMS private intialization routine.
+
+Fri Dec 17 13:33:58 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/cgi/session.rb (CGI::Session#initialize): control adding
+	  session_id hidden fields.  fixed: [ruby-talk:123850]
+
+Thu Dec 16 23:25:25 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+
+	* lib/drb/drb.rb, lib/drb/ssl.rb: backported from CVS HEAD.
+	  [druby-ja:101]
+
+	* test/drb/test_drb.rb: adjust and reduce sleep (backported from
+	  CVS HEAD.)
+
+Thu Dec 16 18:44:58 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* lib/webrick/httpserver.rb (WEBrick::HTTPServer#run): should wait
+	  for reading request till data arrive. [ruby-talk:121068]
+
+	* lib/webrick/server.rb (WEBrick::GenericServer#start_thread):
+	  should log about all accepted socket. [ruby-core:03962]
+
+	* lib/webrick/accesslog.rb (WEBrick::AccessLog#setup_params):
+	  "%%" and "%u" are supported. [webricken:135]
+
+	* lib/webrick/httpservlet/filehandler.rb
+	  (WEBrick::HTTPServlet::FileHandler#check_filename):
+	  :NondisclosureName is acceptable if it is Enumerable.
+
+	* lib/webrick/config.rb (WEBrick::Config::FileHandler):
+	  default value of :NondisclosureName is [".ht*", "*~"].
+
+Thu Dec 16 18:36:52 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/ossl.c (ossl_raise): refine message format.
+
+Thu Dec 16 16:29:44 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/sample/demos-en/widget: modify version check for
+	  supporting features
+
+Thu Dec 16 16:03:50 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk/bindtag.rb: bug fix [ruby-talk: 123667]
+
+	* ext/tk/lib/tk/timer.rb: accept :idle for the interval argument
+
+	* ext/tk/lib/tk.rb: add TkComm._callback_entry?()
+
+	* ext/tk/lib/multi-tk.rb: add MultiTkIp.cb_entry_class
+
+	* ext/tk/lib/tk/canvas.rb: use TkComm._callback_entry?()
+
+	* ext/tk/lib/tk/canvastag.rb: ditto
+
+	* ext/tk/lib/tk/dialog.rb: ditto
+
+	* ext/tk/lib/tk/optiondb.rb: ditto
+
+	* ext/tk/lib/tk/text.rb: ditto
+
+	* ext/tk/lib/tk/texttag.rb: ditto
+
+	* ext/tk/lib/tk/textwindow.rb: ditto
+
+	* ext/tk/lib/tk/timer.rb: ditto
+
+	* ext/tk/lib/tk/validation.rb: ditto
+
+	* ext/tk/lib/tkextlib/*: ditto
+
+Thu Dec 16 03:14:28 2004  Minero Aoki  <aamine@loveruby.net>
+
+	* lib/net/http.rb (basic_encode): return value of pack('m') may
+	  include multiple CR/LFs.  Backported from main trunk (rev 1.112).
+	  [ruby-dev:25212]
+
+Thu Dec 16 00:33:37 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* hash.c (Init_Hash): remove custom "hash" and "eql?".
+
+Wed Dec 15 18:57:01 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* lib/set.rb (Set::eql): wrong definition.  [ruby-dev:25207]
+
+Wed Dec 15 18:48:42 2004  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* ext/curses/curses.c (window_subwin): call NUM2INT() before
+	GetWINDOW(). (backported from CVS HEAD)
+
+Wed Dec 15 17:03:50 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.[ch] (rb_w32_isatty): new function to replace MSVCRT's
+	  isatty because it never sets errno. (backported from CVS HEAD)
+
+Wed Dec 15 15:39:32 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/ossl_x509name.c (ossl_x509name_to_a): avoid SEGV
+	  (rollback the previous commit).
+
+Wed Dec 15 16:10:23 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* object.c (rb_obj_id_obsolete): warn always.
+
+	* eval.c (rb_enable_super): ditto.
+
+Wed Dec 15 15:31:02 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* lib/set.rb (Set#==): [ruby-dev:25206]
+
+Wed Dec 15 14:22:10 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (rb_w32_fdisset): check whether the handle is valid.
+	  fixed: [ruby-core:03959]
+
+Wed Dec 15 10:30:37 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* ext/openssl/ossl_digest.c (ossl_digest_initialize): [ruby-dev:25198]
+
+Tue Dec 14 17:10:09 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (rb_w32_close): need to reset osfhnd().
+
+Tue Dec 14 14:03:57 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/ossl.c (ossl_raise): avoid buffer overrun.
+	  [ruby-dev:25187]
+
+Tue Dec 14 12:36:04 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* lib/cgi/session.rb (CGI::Session::initialize): generate new
+	  session if given session_id does not exist.  [ruby-list:40368]
+
+Mon Dec 13 18:13:52 2004  Tanaka Akira  <akr@m17n.org>
+
+	* gc.c (stack_end_address): new function to obtain stack end address.
+	  stack_end_address calls __builtin_frame_address(0) to obtain the
+	  frame pointer of a stack frame of stack_end_address.  The address
+	  is the stack pointer of the caller's stack frame.
+	  (SET_STACK_END): use stack_end_address.
+	  This makes the conservative garbage collector to scan a stack frame
+	  of the garbage_collect function itself.  This is required because
+	  callee-save registers may be stored in the frame.
+	  [ruby-dev:25158]
+
+Mon Dec 13 00:58:02 2004  Tanaka Akira  <akr@m17n.org>
+
+	* lib/pathname.rb (cleanpath_aggressive): make it private.
+	  (cleanpath_conservative): ditto.
+	  Suggested by Daniel Berger.  [ruby-core:3914]
+
+Sun Dec 12 20:06:38 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+
+	* lib/drb/drb.rb: backported from CVS HEAD.
+
+Sun Dec 12 10:35:10 2004  Dave Thomas  <dave@pragprog.com>
+
+	* lib/rdoc/generators/template/html/html.rb (RDoc::Page): Don't
+	  show an accessor's r/w flag if none was specified
+
+Sun Dec 12 10:14:03 2004  Dave Thomas  <dave@pragprog.com>
+
+	* lib/rdoc/rdoc.rb (RDoc::RDoc::parse_files): Never exclude files
+	  explicitly given on the command line.
+
+Sun Dec 11 23:54:07 2005  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/*: update to support libraries in ActiveTcl8.4.12.0
+	  (see ext/tk/ChangeLog.tkextlib).
+
+	* ext/tk/sample/scrollframe.rb: add a new sample.
+
+Sat Dec 11 20:12:21 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+
+	* lib/drb/drb.rb: add DRbRemoteError. [ruby-list:40348],
+	  [ruby-list:40390]
+
+	* test/drb/drbtest.rb: ditto.
+
+	* test/drb/ut_drb.rb: ditto.
+
+Sat Dec 11 15:38:14 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* lib/jcode.rb (String::succ): [ruby-dev:25156]
+
+Sat Dec 11 12:41:55 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* eval.c (run_trap_eval): prototype; avoid VC++ warnings.
+
+	* ext/socket/getaddrinfo.c: fix typo. fixed: [ruby-core:03947]
+
+	* win32/win32.c: need to include dln.h.
+
+Sat Dec 11 00:10:18 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* io.c (io_reopen): [ruby-dev:25150]
+
+Fri Dec 10 08:39:27 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/socket/socket.c (sock_listen): get OpenFile just before calling
+	  listen(2).  fixed: [ruby-dev:25149]
+
+Thu Dec  9 17:00:00 2004  Akiyoshi, Masamichi  <akiyoshi@hp.com>
+
+	* ext/socket/socket.c, ext/socket/getaddrinfo.c: port to VMS
+
+Thu Dec  9 16:31:02 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ext/sdbm/init.c (GetDBM): typo.
+
+Thu Dec  9 16:05:00 2004  Akiyoshi, Masamichi  <akiyoshi@hp.com>
+
+	* defines.h: change path of vms.h
+	* vms/vms.h: delete reference for snprintf()
+	* vms/config.h: new file
+	* vms/config.h_in: deleted
+
+Thu Dec  9 14:38:35 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (rb_str_inspect): escape # which starts an expression
+	  substitution.  fixed: [ruby-core:03922]
+
+	* string.c (rb_str_dump): not escape # which isn't a substitution.
+
+Thu Dec  9 10:54:36 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* ext/dbm/dbm.c (fdbm_select): [ruby-dev:25132]
+
+	* ext/sdbm/init.c: ditto.
+
+	* ext/gdbm/gdbm.c: ditto.
+
+Thu Dec  9 03:08:36 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tcltklib/tcltklib.c (ip_init): set root-win title to "ruby" when
+	  the running script is '-e one-liner' or '-' (stdin).
+
+	* ext/tcltklib/extconf.rb: add find_library("#{lib}#{ver}",..) for
+	  stub libs
+
+	* ext/tk/lib/tk/textmark.rb: TkTextMarkCurrent and TkTextMarkAnchor
+	  have a wrong parent class.
+
+	* ext/tk/lib/tk/dialog.rb: rename TkDialog2 --> TkDialogObj and
+	  TkWarning2 --> TkWarningObj (old names are changed to alias names)
+
+	* ext/tk/lib/tk/dialog.rb: bug fix of treatment of 'prev_command'
+	  option and hashes for configuration
+
+	* ext/tk/lib/tk/dialog.rb: add TkDialogObj#name to return the
+	  button name
+
+	* ext/tk/lib/tk/radiobutton.rb: rename enbugged method value() ==>
+	  get_value() and value=(val) ==> set_value(val).
+
+	* ext/tk/lib/tk/menu.rb: add TkMenu.new_menuspec
+
+	* ext/tk/lib/tk/menu.rb: add alias (TkMenuButton = TkMenubutton,
+	  TkOptionMenuButton = TkOptionMenubutton)
+
+	* ext/tk/lib/tk/event.rb: new method aliases (same as option keys of
+	  event_generate) for Event object
+
+	* ext/tk/lib/tk/font.rb: configinfo returns proper types of values
+
+	* ext/tk/lib/tk.rb: bind methods accept subst_args + block
+
+	* ext/tk/lib/tk/canvas.rb: ditto
+
+	* ext/tk/lib/tk/canvastag.rb: ditto
+
+	* ext/tk/lib/tk/frame.rb: ditto
+
+	* ext/tk/lib/tk/text.rb: ditto
+
+	* ext/tk/lib/tk/texttag.rb: ditto
+
+	* ext/tk/lib/tk/toplevel.rb: ditto
+
+	* ext/tk/lib/tkextlib/*: ditto and bug fix
+
+Wed Dec  8 23:54:29 2004  Dave Thomas  <dave@pragprog.com>
+
+	* lib/rdoc/generators/template/html/html.rb (RDoc::Page): Typo
+	  meant that h2 tag was invisible.
+
+Wed Dec  8 21:56:31 2004  Kouhei Sutou  <kou@cozmixng.org>
+
+	* lib/rss, test/rss, sample/rss: backported from CVS HEAD.
+
+Wed Dec  8 14:31:36 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* io.c (io_fwrite): change dereference for cosmetic reason.
+
+	* sprintf.c (rb_f_sprintf): [ruby-dev:25104]
+
+Tue Dec  7 19:08:00 2004  Akiyoshi, Masamichi  <akiyoshi@hp.com>
+
+	* io.c (io_fwrite): fix offset incrementation (for VMS and Human68k)
+
+Tue Dec  7 00:27:37 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* process.c (proc_setgroups): [ruby-dev:25081]
+
+Mon Dec  6 18:08:10 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* re.c (rb_reg_eqq): document fix.  [ruby-talk:122541]
+
+Mon Dec  6 17:19:13 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* rubysig.h (TRAP_BEG, TRAP_END): safe errno around CHECK_INTS.
+	  (backported from CVS HEAD)  [ruby-dev:24993]
+
+Mon Dec  6 10:18:17 2004  Dave Thomas  <dave@pragprog.com>
+
+	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::look_for_directives_in):
+	  Oops - 1.8 doesn't have String#clear
+
+Mon Dec  6 09:59:23 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* ext/socket/socket.c (sock_connect): use rb_str_new4().
+	  [ruby-dev:25052]
+
+Mon Dec  6 01:42:08 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
 
 	* ext/openssl/ossl_pkey_rsa.c (ossl_rsa_public_encrypt,
 	  ossl_rsa_public_decrypt, ossl_rsa_private_encrypt,
-	  ossl_rsa_private_decrypt): Ditto. RSA_size() does not check rsa->n.
+	  ossl_rsa_private_decrypt): should take an optional argument
+	  to specify padding mode. [ruby-talk:122539]
 
-Thu May 26 14:13:52 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/openssl/ossl_pkey_rsa.c (Init_ossl_rsa): add new constants
+	  PKCS1_PADDING, SSLV23_PADDING, NO_PADDING and PKCS1_OAEP_PADDING
+	  under OpenSSL::PKey::RSA.
 
-	* include/ruby/ruby.h (rb_scan_args_count): verify length with
-	  counting variables together.
+	* test/openssl/test_pkey_rsa.rb: new file.
 
-Thu May 26 09:45:41 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Sun Dec  5 19:39:17 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/ruby/enc/test_case_comprehensive.rb: Add set of comprehensive
-	  (across most Unicode characters; later across most character encodings)
-	  tests for case mapping.
+	* lib/optparse.rb (OptionParser::Completion#complete): new parameter
+	  to direct case insensitiveness.
 
-Thu May 26 05:00:13 2016  Benoit Daloze  <eregontp@gmail.com>
+	* lib/optparse.rb (OptionParser#order!): ignore case only for long
+	  option.  [ruby-dev:25048]
 
-	* class.c (rb_define_class): Fix documentation.
+Sat Dec  4 22:54:15 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Wed May 25 20:50:12 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* io.c (io_write): remove rb_str_locktmp().  [ruby-dev:25050]
 
-	* re.c (unescape_nonascii): scan hex up to only 3 characters.
-	  [Bug #12420] [Bug #12423]
+	* io.c (io_fwrite): takes VALUE string as an argument.
+	  [ruby-dev:25050]
 
-Wed May 25 19:07:19 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* ext/socket/socket.c (sock_connect): remove rb_str_locktmp().
+	  [ruby-dev:25050]
 
-	* enc/unicode.c: Handle DOTLESS_i by hand because it isn't involved in folding.
+	* ext/socket/socket.c (udp_connect): [ruby-dev:25045]
 
-Wed May 25 18:30:53 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* ext/socket/socket.c (udp_bind): ditto.
 
-	* regparse.c (fetch_token_in_cc): raise error if given octal escaped
-	  character is too big. [Bug #12420] [Bug #12423]
+	* ext/socket/socket.c (udp_send): ditto.
 
-Wed May 25 17:45:15 2016  Kazuki Yamaguchi  <k@rhe.jp>
+	* ext/socket/socket.c (bsock_send): ditto.
 
-	* ext/openssl, test/openssl: Drop OpenSSL < 0.9.8 support.
+	* ext/socket/socket.c (s_recvfrom): ditto.
 
-Wed May 25 17:43:30 2016  Kazuki Yamaguchi  <k@rhe.jp>
+	* hash.c (rb_hash_hash): should provide "hash" method where "eql?"
+	  is redefined.  [ruby-talk:122482]
 
-	* ext/openssl/openssl_missing.h, ext/openssl/ossl.h: Remove
-	  unnecessary 'extern "C"' blocks. We don't use C++ and these headers
-	  are local to ext/openssl, so there is no need to enclose with it.
+Sat Dec  4 14:54:52 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
 
-Wed May 25 17:42:58 2016  Kazuki Yamaguchi  <k@rhe.jp>
+	* eval.c (proc_invoke): use volatile `tmp' rather than `args'.
+	  [ruby-core:03882]
 
-	* ext/openssl/extconf.rb: Remove check of OPENSSL_FIPS macro. This is
-	  unneeded because we can check the macro directly in source code,
-	  just as we already do for OPENSSL_NO_* macros.
+Sat Dec  4 14:28:56 2004  Dave Thomas  <dave@pragprog.com>
 
-	* ext/openssl/ossl.c: Replace occurrences of HAVE_OPENSSL_FIPS with
-	  OPENSSL_FIPS.
+	* lib/rdoc/code_objects.rb (RDoc::Context::Section::set_comment):
+	  Section comments may now be bracketed by lines which are
+	  ignored. You can now write
+	      # -----------
+	      # :section: Dave's Section
+	      # comment material
+	      # -----------
+	   The lines before :section: are removed, and identical lines at the end are
+	   also removed if present.
 
-Wed May 25 17:13:35 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Dec  4 03:33:45 2004  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* class.c (rb_scan_args): merge code for n_trail.
+	* ext/readline/readline.c: check $SAFE. (backported from CVS HEAD)
 
-Wed May 25 17:11:34 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/readline/test_readline.rb: added tests for readline.
+	  (backported from CVS HEAD)
 
-	* include/ruby/ruby.h (rb_scan_args_validate): move failed
-	  condition to the terminal.  [ruby-core:75714] [Bug #12426]
+Sat Dec  4 02:24:00 2004  NARUSE, Yui  <naruse@ruby-lang.org>
 
-Wed May 25 13:13:37 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* ext/nkf/nkf.c: add constant NKF::VERSION
 
-	* regcomp.c: remove condition for debug output because prelude
-	  doesn't use regexp now.
+	* ext/nkf/nkf.c(guess): this becomes an alias of guess2
 
-Wed May 25 13:10:30 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* ext/nkf/test.rb(mime_out2): add --no-cp932
 
-	* regcomp.c (compile_length_tree): return error code immediately
-	  if compile_length_tree raised error [Bug #12418]
+	* ext/nkf/nkf-utf8/nkf.c: original nkf2 revision 1.47
 
-Wed May 25 08:01:39 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Sat Dec  4 00:35:08 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* enc/unicode.c: Fix flag error for switch from titlecase to lowercase.
+	* ext/socket/socket.c (bsock_setsockopt): [ruby-dev:25039]
 
-	* test/ruby/enc/test_case_mapping.rb: Tests for above error.
+Fri Dec  3 18:57:03 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Wed May 25 01:13:55 2016  Kazuki Yamaguchi  <k@rhe.jp>
+	* lib/ostruct.rb: 1.9 marshaling support back-ported.
+	  [ruby-core:03871]
 
-	* ext/openssl/ossl_pkey_ec.c (ec_key_new_from_group): Create a new
-	  EC_KEY on given EC group. Extracted from ossl_ec_key_initialize().
-	  (ossl_ec_key_s_generate): Added. Create a new EC instance and
-	  generate a random private and public key.
-	  (ossl_ec_key_initialize): Use ec_key_new_from_group().
-	  (Init_ossl_ec): Define the new method EC.generate. This change is
-	  for consistency with other PKey types.  [ruby-core:45541] [Bug #6567]
+Fri Dec  3 13:45:20 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* test/openssl/test_pkey_ec.rb: Test that EC.generate works.
+	* eval.c (proc_invoke): copy arguments to frame.argv.
+	  [ruby-core:03861]
 
-Wed May 25 00:37:16 2016  Kazuki Yamaguchi  <k@rhe.jp>
+Fri Dec  3 12:25:41 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/openssl/ossl_pkey_ec.c (ossl_ec_key_generate_key): Fix up RDoc.
-	  (Init_ossl_ec): Rename EC#generate_key to EC#generate_key!. Make the
-	  old name an alias of #generate_key!. This change is for consistency
-	  with other PKey types.  [ruby-core:45541] [Bug #6567]
+	* st.h: fix prototypes.
 
-	* test/openssl/test_pkey_ec.rb: Use EC#generate_key! instead of
-	  EC#generate_key.
+Fri Dec  3 00:21:05 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Wed May 25 00:23:05 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* object.c (convert_type): use rb_respond_to() again.
+	  [ruby-dev:25021]
 
-	* include/ruby/ruby.h (rb_scan_args_set): check the arity after
-	  adjusting argc for an option hash, for optimization in simpler
-	  cases.
+	* eval.c (rb_respond_to): funcall respond_to? if it's redefined.
+	  [ruby-dev:25021]
 
-Wed May 25 00:21:52 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Dec  3 01:55:24 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-	* configure.in (XCFLAGS): merge flags only for ruby itself from
-	  ruby_cflags.
+	* ext/tk/lib/tk.rb: widget configuration by TkWindow#method_missing
+	  returns proper object. "widget.option = val" returns val, and
+	  "widget.option(val)" returns self.
 
-Tue May 24 22:04:15 2016  Kazuki Yamaguchi  <k@rhe.jp>
+	* ext/tk/lib/tk/font.rb: TkFont#replace accepts only one font argument.
 
-	* ext/openssl/ossl_cipher.c (ossl_cipher_set_key, ossl_cipher_set_iv):
-	  Reject too long values as well as too short ones. Currently they
-	  just truncate the input but this would hide bugs and lead to
-	  unexpected encryption/decryption results.
+	* ext/tk/lib/tk/radiobutton.rb: add TkRadiobutton#value and
+	  TkRadiobutton#value=(val).
 
-	* test/openssl/test_cipher.rb: Test that Cipher#key= and #iv= reject
-	  Strings with invalid length.
+	* ext/tk/lib/tk/spinbox.rb: callback substitution support on
+	  command option.
 
-Tue May 24 21:32:21 2016  Kazuki Yamaguchi  <k@rhe.jp>
+	* ext/tk/sample/demos-en/widget: bug fix (wrong image height)
 
-	* ext/openssl/ossl_x509ext.c (ossl_x509ext_set_value): Use
-	  ASN1_OCTET_STRING_set() instead of M_ASN1_OCTET_STRING_set(). Macros
-	  prefixed by "M_" are discouraged to be used from outside OpenSSL
-	  library[1].
-	  (ossl_x509ext_get_value): Likewise, use ASN1_STRING_print() instead
-	  of M_ASN1_OCTET_STRING_print().
-	  [1] https://git.openssl.org/gitweb/?p=openssl.git;a=blob;f=CHANGES;h=bf61913d7b01212b4d8b2f3c13d71d645914f67c;hb=b6079a7835f61daa9fb2cbf9addfa86049523933#l878
+	* ext/tk/sample/demos-jp/widget: ditto.
 
-	* ext/openssl/ossl.h: Include openssl/asn1.h instead of
-	  openssl/asn1_mac.h. It just includes openssl/asn1.h and defines some
-	  additional "M_" macros.
+Fri Dec  3 00:11:48 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Tue May 24 18:52:11 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* io.c (rb_file_initialize): [ruby-dev:25032]
 
-	* include/ruby/ruby.h (rb_scan_args_verify): verify the format to
-	  scan if no invalid chars and variable argument length matching,
-	  at the compile time if possible.
+Thu Dec  2 16:41:03 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue May 24 17:18:46 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* eval.c (rb_protect): prevent continuations created inside from being
+	  called from the outside.  [ruby-dev:25003]
 
-	* include/ruby/defines.h (ERRORFUNC, WARNINGFUNC): add fallback
-	  definitions.
+	* eval.c (rb_callcc, rb_cont_call): prohibit calling from different
+	  signal contexts.  [ruby-dev:25022]
 
-Tue May 24 16:37:43 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+Thu Dec  2 09:57:24 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* configure.in (ruby_cflags): separate from optflags [Bug #12409]
-	  -fexcess-precision=standard and -fp-model precise are set to this now.
+	* lib/ostruct.rb (OpenStruct::Marshaler): OpenStruct can be
+	  marshaled again.  [ruby-core:03862]
 
-	* configure.in (cflags): use ruby_cflags.
+Thu Dec  2 09:30:06 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue May 24 16:20:53 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* eval.c (thread_mark): mark thread group.  [ruby-dev:25020]
 
-	* configure.in (ERRORFUNC, WARNINGFUNC): __error__ and __warning__
-	  attributes take a parenthesized string literal.
+	* eval.c (thgroup_add): check whether the argument is really a Thread.
 
-Tue May 24 12:35:56 2016  URABE Shyouhei  <shyouhei@ruby-lang.org>
+Thu Dec  2 07:57:16 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* common.mk: sort lines, and add missing dependencies suggested
-	  by tool/update-deps
+	* io.c (rb_io_ctl): [ruby-dev:25019]
 
-Mon May 23 21:33:36 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Dec  1 02:21:02 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* include/ruby/missing.h (isfinite): move from numeric.c.
+	* signal.c (sighandler): call handler immediately only for default
+	  handlers.  [ruby-dev:25003]
 
-Mon May 23 21:09:06 2016  Kazuki Yamaguchi  <k@rhe.jp>
+Tue Nov 30 23:38:18 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/openssl/ossl.c (Init_openssl): Avoid reference to unset global
-	  variable. ossl_raise() may be called before dOSSL is set. Since
-	  global variables default to 0 and the default value of dOSSL set in
-	  Init_openssl() is also Qfalse, there is no real issue but confusing.
-	  Patch by Bertram Scharpf <software@bertram-scharpf.de>
-	  [ruby-core:58264] [Bug #9101]
+	* io.c (io_fread): need not to null terminate.  [ruby-dev:24998]
 
-Mon May 23 20:32:16 2016  Kazuki Yamaguchi  <k@rhe.jp>
+	* io.c (read_all): remove unnecessary rb_str_resize().
+	  [ruby-dev:24996]  (backported from CVS HEAD)
 
-	* ext/openssl/ossl_asn1.c, ext/openssl/ossl_bn.c,
-	  ext/openssl/ossl_cipher.c, ext/openssl/ossl_digest.c
-	  ext/openssl/ossl_engine.c, ext/openssl/ossl_ns_spki.c
-	  ext/openssl/ossl_pkcs12.c, ext/openssl/ossl_pkcs7.c
-	  ext/openssl/ossl_pkey.c, ext/openssl/ossl_pkey_ec.c
-	  ext/openssl/ossl_rand.c, ext/openssl/ossl_ssl.c
-	  ext/openssl/ossl_x509attr.c, ext/openssl/ossl_x509cert.c
-	  ext/openssl/ossl_x509ext.c, ext/openssl/ossl_x509store.c: Use
-	  StringValueCStr() where NUL-terminated string is expected.
+	* io.c (io_readpartial): ditto.
 
-Mon May 23 20:20:12 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* io.c (io_read): ditto.
 
-	* ext/bigdecimal/bigdecimal.c (isfinite): get rid of a warning on
-	  cygwin. [Bug #12417][ruby-core:75691]
+Tue Nov 30 16:18:50 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Mon May 23 19:41:27 2016  Kazuki Yamaguchi  <k@rhe.jp>
+	* io.c (io_fread): need not to null terminate.  [ruby-dev:24998]
 
-	* ext/openssl/ossl_rand.c (ossl_rand_egd, ossl_rand_egd_bytes):
-	  RAND_egd{_bytes,}() return -1 on failure, not 0.
-	  Patch by cremno phobia <cremno@mail.ru>
-	  [ruby-core:63795] [Bug #10053]
-	  (ossl_pseudo_bytes): Similar, RAND_pseudo_bytes() may return 0 or
-	  -1 on failure.
+	* io.c (read_all): remove unnecessary rb_str_resize().
+	  [ruby-dev:24996]
 
-Mon May 23 15:52:07 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* io.c (io_read): ditto.
 
-	* ext/bigdecimal/bigdecimal.c (isfinite): isfinite does not always
-	  exist.  fixed build error on Windows introduced at r55123.
+Tue Nov 30 00:49:08 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Mon May 23 13:19:41 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* io.c (rb_io_sysread): use temporary lock.  [ruby-dev:24992]
 
-	* include/ruby/ruby.h (rb_scan_args0): make compile error if the
-	  format is wrong or does not match with the variable argument
-	  length if possible.
+Mon Nov 29 16:06:04 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon May 23 12:47:09 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/stringio/stringio.c (strio_write): insufficiently filled string
+	  being extended when overwriting.  [ruby-core:03836]
 
-	* include/ruby/ruby.h (rb_scan_args0): raise fatal error if
-	  variable argument length does not match, it is a bug in the code
-	  which uses rb_scan_args, not a runtime error.
+Mon Nov 29 15:59:05 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Mon May 23 12:30:29 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/ostruct.rb (OpenStruct::method_missing): check method
+	  duplication for -d.
 
-	* ext/bigdecimal/bigdecimal.c (GetVpValueWithPrec): consider
-	  non-finite float values not to raise FloatDomainError.
-	  [ruby-core:75682] [Bug #12414]
+	* lib/ostruct.rb (OpenStruct::initialize): ditto.
 
-Mon May 23 12:21:18 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+Mon Nov 29 15:22:28 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* array.c (rb_ary_fill): suppress warnings: 'item' may be used
-	  uninitialized in this function
+	* test/io/nonblock/test_flush.rb: abandon tests when io/nonblock is
+	  not supported.
 
-Mon May 23 07:41:49 2016  Eric Wong  <e@80x24.org>
+Mon Nov 29 03:08:30 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* dir.c (dir_close): update RDoc for 2.3 #close change
-	  [ruby-core:75679] [Bug #12413]
+	* object.c (convert_type): direct call conversion methods for the
+	  performance.  [ruby-core:03845]
 
-Sun May 22 20:01:21 2016  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+	* eval.c (rb_funcall_rescue): new function.
 
-	* lib/drb/timeridconv.rb: use finalizer trick instead of thread.
+	* object.c (rb_Array): avoid using rb_respond_to().
 
-	* test/drb/ut_timerholder.rb: ditto.
+	* object.c (rb_Integer): ditto.
 
-Sun May 22 17:25:18 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* parse.y (reduce_nodes): empty body should return nil.
 
-	* test/ruby/enc/test_case_options.rb: adjust test class name
-	  to match file name
+	* string.c (rb_str_aset): the original string should not be
+	  affected by modifying duplicated string.  [ruby-dev:24981]
 
-Sun May 22 17:24:07 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Mon Nov 29 13:57:38 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* rename test/ruby/enc/test_casing_options.rb to test_case_options.rb
-	  for consistency
+	* win32/win32.c (CreateChild): search executable file if no program
+	  name given. (backported from CVS HEAD)
 
-Sun May 22 17:06:55 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon Nov 29 13:37:54 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* transcode.c (enc_arg, str_transcode_enc_args, econv_args):
-	  remove volatile, and add GC guards in callers.
-	  [ruby-core:75664] [Bug #12411]
+	* io.c (fptr_finalize): must not use FILE after fclose().
+	  [ruby-dev:24985]
 
-Sun May 22 16:27:00 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon Nov 29 13:16:31 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/-test-/integer/core_ext.c: move testutil/integer.c.
+	* win32/win32.c (CreateChild): push back the last space before next
+	  loop because CharNext() eats it.
 
-	* test/lib/-test-/integer.rb: extract implementation details from
-	  test/unit/assertions.rb.  [Bug #12408]
+Mon Nov 29 01:18:18 2004  Tanaka Akira  <akr@m17n.org>
 
-Sun May 22 14:57:43 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* io.c (rb_io_check_writable): call io_seek regardless of
+	  NEED_IO_SEEK_BETWEEN_RW.  [ruby-dev:24986]
 
-	* include/ruby/oniguruma.h: Extend OnigEncodingTypeDefine to define a
-	  new encoding primitive 'case_map' for case mapping
+Sat Nov 27 21:43:39 2004  Tanaka Akira  <akr@m17n.org>
 
-	* enc/utf-8.c, utf_16be/le.c, utf_32be/le.c:
-	  add onigenc_unicode_case_map as case_map primitive
+	* io.c: avoid data lost with nonblocking fd and
+	  stdio buffering in sync mode.  [ruby-dev:24966]
+	  based on matz's patch [ruby-dev:24967]
+	  (io_fwrite): new primitive writing function which writes
+	  directly if sync mode.
+	  (rb_io_fwrite): wrapper for io_fwrite now.
+	  (io_write): call io_fwrite instead of rb_io_fwrite.
 
-	* enc/ascii.c, big5.c, cp949.c, emacs_mule.c, euc_jp/kr/tw.c, gb18030.c,
-	  gbk.c, iso_8859_1/2/3/4/5/6/7/8/9/10/11/13/14/15/16.c, koi8_r/u.c,
-	  shift_jis.c, us_ascii.c, windows_1250/1251/1252.c:
-	  add onigenc_not_support_case_map as case_map primitive
+Sat Nov 27 14:44:15 2004  Kent Sibilev  <ksibilev@bellsouth.net>
 
-Sun May 22 14:45:45 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* lib/cgi/session.rb (CGI::Session::initialize): create_new_id is
+	  now a instance method.  [ruby-core:03832]
 
-	* regenc.h/c: Define new function onigenc_not_support_case_map
+Sat Nov 27 09:41:21 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Sun May 22 12:14:06 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* io.c (io_fread): old rb_io_fread with file closing checking.
+	  (rb_io_fread): wrapper for io_fread now.
+	  [ruby-dev:24964]
 
-	* include/ruby/ruby.h (rb_scan_args): use original rb_scan_args
-	  when fmt is dynamic.
+Fri Nov 26 18:02:44 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-Sun May 22 11:41:12 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* ext/tk/lib/tk.rb: Tk.destroy uses TkWindow#epath
 
-	* class.c (rb_scan_args): moved to bottom of the file to make the
-	  effect of `#undef rb_scan_args` the minimum.
+	* ext/tk/lib/tk/image.rb: bug fix
 
-	* include/ruby/ruby.h (rb_scan_args): overwrite only if GCC and
-	  optimized. Visual C++ 14 or later can compile it but make it
-	  conservative.
+	* ext/tk/lib/tk/wm.rb: add 'iconphoto' method(Windows only)
 
-Sat May 21 22:45:50 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* ext/tk/lib/tkextlib/*: some methods uses TkWindow#epath
 
-	* include/ruby/ruby.h (rb_scan_args): don't use ALWAYS_INLINE with
-	  `inline`.  if gcc needs this duplication, do in ALWAYS_INLINE macro.
+Fri Nov 26 13:49:06 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Sat May 21 21:11:56 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* eval.c (method_missing): raise TypeError for classes do not
+	  have allocators.  [ruby-core:03752]
 
-	* include/ruby/ruby.h (rb_scan_args): use __VA_ARGS__ instead of
-	  va_arg to allow compilers optimize more aggressive.
-	  https://gustedt.wordpress.com/2011/07/10/avoid-writing-va_arg-functions/
-	  rb_scan_args is now expected to be statically resolved.
+	* lib/erb.rb: add RDoc by James Edward Gray II.  [ruby-core:03786]
 
-Sun May 22 02:41:52 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+Fri Nov 26 13:29:02 2004  Dave Thomas  <dave@pragprog.com>
 
-	* ext/zlib/zlib.c: remove hacky macro introduced at r30437.
+	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::look_for_directives_in): Break
+	  out of preprocessing when we find a :section: directive (previously cleared out the
+	  comment, but this apparently now generates an error in gsub!)
 
-	* ext/zlib/zlib.c (gzfile_make_header): cast as long (instead of int).
+Fri Nov 26 00:17:40 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* ext/zlib/zlib.c (gzfile_make_footer): ditto.
+	* io.c (io_read): move StringValue() check before GetOpenFile().
+	  [ruby-dev:24959]
 
-Sat May 21 21:07:18 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+Thu Nov 25 20:14:57 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* configure.in (ALWAYS_INLINE): force compilers the function inlined.
+	* lib/thwait.rb (ThreadsWait#join_nowait): abnormally terminated
+	  threads should be also processed.  [ruby-talk:121320]
 
-Sat May 21 16:16:03 2016  Kazuki Yamaguchi  <k@rhe.jp>
+Thu Nov 25 10:14:26 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/openssl/ossl_ssl.c (ossl_ssl_stop): Don't free the SSL struct
-	  here. Since some methods such as SSLSocket#connect releases GVL,
-	  there is a chance of use after free if we free the SSL from another
-	  thread. SSLSocket#stop was documented as "prepares it for another
-	  connection" so this is a slightly incompatible change. However when
-	  this sentence was added (r30090, Add toplevel documentation for
-	  OpenSSL, 2010-12-06), it didn't actually. The current behavior is
-	  from r40304 (Correct shutdown behavior w.r.t GC., 2013-04-15).
-	  [ruby-core:74978] [Bug #12292]
+	* dir.c (push_braces): do not reuse buffer strings.  [ruby-core:03806]
 
-	* ext/openssl/lib/openssl/ssl.rb (sysclose): Update doc.
+Thu Nov 25 07:59:41 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* test/openssl/test_ssl.rb: Test this.
+	* io.c (read_all): stringify non-nil buffer argument, and always
+	  taint the result.  [ruby-dev:24955]
 
-Sat May 21 14:41:14 2016  Kazuki Yamaguchi  <k@rhe.jp>
+Wed Nov 24 01:01:31 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* ext/openssl/ossl.c: [DOC] Fix SSL client example. The variable name
-	  was wrong. Patch by Andreas Tiefenthaler <at@an-ti.eu> (@pxlpnk).
-	  [GH ruby/openssl#32]
+	* io.c (io_read): integer conversion should be prior to
+	  GetOpenFile().  [ruby-dev:24952]
 
-Sat May 21 14:25:38 2016  Kazuki Yamaguchi  <k@rhe.jp>
+	* configure.in, io.c: cancel [ ruby-Patches-1074 ].
 
-	* ext/openssl/ossl_pkey_ec.c: rename PKey::EC#private_key? and
-	  #public_key? to #private? and #public? for consistency with other
-	  PKey types. Old names remain as alias.  [ruby-core:45541] [Bug #6567]
+Tue Nov 23 08:09:50 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-	* test/openssl/test_pkey_ec.rb (test_check_key): check private? and
-	  public? works correctly.
+	* ext/tk/lib/tk/menu.rb: improve usability of TkOptionMenubutton
 
-Sat May 21 12:40:36 2016  Kazuki Yamaguchi  <k@rhe.jp>
+Tue Nov 23 02:00:21 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* ext/openssl/lib/openssl/buffering.rb (read_nonblock, readpartial):
-	  Remove impossible EOFError raise. Patch by Zach Anker
-	  <zanker@squareup.com>.  [GH ruby/openssl#23]
+	* file.c (rb_file_chown): integer conversion should be prior to
+	  GetOpenFile().  [ruby-dev:24949]
 
-Sat May 21 11:18:42 2016  Evgeni Golov  <evgeni@golov.de>
+Tue Nov 23 00:10:48 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* lib/ipaddr.rb: [DOC] fix documentation of IN6MASK to mention
-	  IPv6.  [Fix GH-1349]
+	* file.c (rb_file_chown): integer conversion should be prior to
+	  GetOpenFile().  [ruby-dev:24947]
 
-Sat May 21 11:12:53 2016  Dan Martinez  <dfm@razorwind.org>
+	* file.c (rb_file_truncate): ditto.
 
-	* io.c (Init_IO): [DOC] define dummy ARGF instead of ARGF.class to
-	  re-enable the generation of ARGF documentation.  [Fix GH-1358]
+	* file.c (rb_file_s_truncate): ditto.
 
-Sat May 21 11:07:29 2016  0x01f7  <souk.0x01f7@gmail.com>
+	* dir.c (dir_seek): use NUM2OFFT().
 
-	* doc/syntax/methods.rdoc (Method Names): add proper closing tag.
-	  [Fix GH-1356]
+	* misc/ruby-mode.el (ruby-non-block-do-re): should not match words
+	  start with block keyword and underscore.  [ruby-core:03719]
 
-Sat May 21 09:26:28 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon Nov 22 22:33:02 2004  Dave Thomas  <dave@pragprog.com>
 
-	* configure.in (RUBY_CHECK_SETJMP): fix missing macro definition
-	  for the configured result.  fix up r55021.
+	* lib/rdoc/parsers/parse_rb.rb (RDoc::parse_require): Don't use names
+	  of variables or constants when oarsing 'require'
 
-Sat May 21 00:36:32 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon Nov 22 00:13:35 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* process.c (rb_execarg_commandline): build command line string
-	  from argument vector in rb_execarg.
-	  [ruby-core:75611] [Bug #12398]
+	* dir.c (dir_seek): should retrieve dir_data after NUM2INT().
+	  [ruby-dev:24941]
 
-Fri May 20 23:25:42 2016  Kazuki Yamaguchi  <k@rhe.jp>
+Sat Nov 20 23:57:33 2004  Dave Thomas  <dave@pragprog.com>
 
-	* ext/openssl/ossl.c (ossl_pem_passwd_value): Added. Convert the
-	  argument to String with StringValue() and validate the length is in
-	  4..PEM_BUFSIZE. PEM_BUFSIZE is a macro defined in OpenSSL headers.
-	  (ossl_pem_passwd_cb): When reading/writing encrypted PEM format, we
-	  used to pass the password to PEM_def_callback() directly but it was
-	  problematic. It is not NUL character safe. And surprisingly, it
-	  silently truncates the password to 1024 bytes.  [GH ruby/openssl#51]
+	* lib/rdoc/README (et al): Add a new directive, :section:, and
+	  change the output format to accomodate. :section: allows to to
+	  group together methods, attributes, constants, etc under
+	  headings in the output. If used, a table of contents is
+	  generated.
 
-	* ext/openssl/ossl.h: Add function prototype declaration of newly
-	  added ossl_pem_passwd_value().
+Sat Nov 20 23:56:54 2004  Dave Thomas  <dave@pragprog.com>
 
-	* ext/openssl/ossl_pkey.c (ossl_pkey_new_from_data): Use
-	  ossl_pem_passwd_value() to validate the password String.
+	* lib/rdoc/options.rb (Options::parse): Force --inline-source if
+	  --one-file option given
 
-	* ext/openssl/ossl_pkey_dsa.c (ossl_dsa_initialize, ossl_dsa_export):
-	  ditto.
+Sat Nov 20 23:55:19 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* string.c (rb_str_splice): should place index wrapping after
+	  possible modification.  [ruby-dev:24940]
+
+Sat Nov 20 13:26:03 2004  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/nkf/nkf-utf8/utf8tbl.c: original revision 1.7
+
+Sat Nov 20 05:34:24 2004  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/nkf/nkf-utf8/nkf.c: original nkf.c rev:1.40
+
+	* ext/nkf/test.rb: add test for mime encode/decode
+
+Sat Nov 20 01:37:34 2004  Johan Holmberg  <holmberg@iar.se>
+
+	* eval.c (error_print): nicer traceback at interrupt.
+	  [ruby-core:03774]
+
+Sat Nov 20 00:07:16 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* string.c (str_gsub): internal buffer should not be listed by
+	  ObjectSpace.each_object() by String#gsub.  [ruby-dev:24931]
+
+Fri Nov 19 01:20:22 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* lib/cgi/session.rb (CGI::Session::FileStore::initialize): raise
+	  exception if data corresponding to session specified from the
+	  client does not exist.
+
+Fri Nov 19 00:59:31 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* string.c (str_gsub): internal buffer should not be listed by
+	  ObjectSpace.each_object().  [ruby-dev:24919]
+
+Thu Nov 18 18:41:08 2004  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+
+	* test/ruby/test_stringchar.rb (test_bang): added.
+
+	* string.c (rb_str_upcase_bang, rb_str_capitalize_bang)
+	(rb_str_swapcase_bang): missing rb_str_modify().  [ruby-dev:24915]
+
+Thu Nov 18 00:21:15 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* process.c (proc_getpgrp): prohibit for $SAFE=2.
+	  [ruby-dev:24899]
+
+	* process.c (get_pid): ditto.  [ruby-dev:24904]
+
+	* process.c (get_ppid): ditto.
+
+	* array.c (rb_ary_delete): defer rb_ary_modify() until actual
+	  modification.  [ruby-dev:24901]
+
+Thu Nov 18 10:10:14 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c, rubyio.h (rb_io_modenum_flags): exported.
+
+	* ext/stringio/stringio.c (strio_initialize): allow Fixnum as mode as
+	  well as IO.new does.  [ruby-dev:24896]
+
+Wed Nov 17 23:42:40 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* test/ruby/test_settracefunc.rb: added.  [ruby-dev:24884]
+
+Wed Nov 17 13:56:57 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* parse.y (newline_node): should not use FL_SET. [ruby-dev:24874]
+
+	* parse.y (string_content): should not use FL_UNSET.
+
+	* node.h (NODE_NEWLINE): remove unused bit to utilize flag field
+	  in nodes.
+
+Wed Nov 17 13:09:40 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* {bcc32,win32,wince}/Makefile.sub (test): should build ruby.exe
+	  before running test. [ruby-core:03756]
+
+Wed Nov 17 04:33:01 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* pack.c: all features are backport from 1.9. [ruby-dev:24826]
+
+	* bignum.c (rb_big2ulong_pack): new function to pack Bignums.
+
+Wed Nov 17 03:42:45 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* string.c (rb_str_splice): move rb_str_modify() after
+	  StringValue(), which may alter the receiver.  [ruby-dev:24878]
+
+Tue Nov 16 23:45:07 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* numeric.c (flo_divmod): protect float values from GC by
+	  assignment to local variables.  [ruby-dev:24873]
+
+Tue Nov 16 16:30:21 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* {bcc32,win32,wince}/setup.mak (-epilogue-): remove config.h and
+	  config.status to force updating them.
+
+Tue Nov 16 16:20:45 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/stringio/stringio.c (strio_read): position was ignored when a
+	  buffer was passed.  http://www.yo.rim.or.jp/~nov/d/?date=20041116#p03
+
+Tue Nov 16 11:19:07 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/test/unit/autorunner.rb (Test::Unit::AutoRunner::options): use
+	  Regexp conversion.
+
+Tue Nov 16 01:41:31 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* string.c (str_mod_check): frozen check should be separated.
+	  [ruby-core:3742]
+
+	* array.c (rb_ary_update): pedantic check to detect
+	  rb_ary_to_ary() to modify the receiver.  [ruby-dev:24861]
+
+Mon Nov 15 13:50:52 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* string.c (rb_str_justify): typo fixed.  [ruby-dev:24851]
+
+Mon Nov 15 11:50:32 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* misc/ruby-mode.el (ruby-special-char-p, ruby-parse-partial): handle
+	  operator symbols.  [ruby-talk:120177]
+
+Sun Nov 14 13:27:03 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/pp.rb (PP#object_address_group): remove odd number of 'f'
+	  prefixed to negative address.
+
+Sun Nov 14 08:51:04 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* test/logger/test_logger.rb: Logger just expects
+	  Logger#datetime_format to be used for Time#strftime independently of
+	  locale. [ruby-dev:24828]
+
+Fri Nov 12 15:03:26 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* eval.c (ruby_options): now we cannot call rb_glob() before
+	  ruby_init(), so call rb_w32_cmdvector() at ruby_options().
+
+	* win32.{c,h} (rb_w32_cmdvector): rename make_cmdvector() and
+	  export it.
+
+Fri Nov 12 14:08:01 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk/event.rb: remove $LOADED_FEATURES trick
+
+	* ext/tk/lib/tk.rb: ditto
+
+Fri Nov 12 00:31:05 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* ext/gdbm/gdbm.c (fgdbm_store): StringValue() may alter string
+	  pointer.  [ruby-dev:24783]
+
+Thu Nov 11 17:36:12 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (rb_globi): also should call back via rb_glob_caller().
+	  [ruby-dev:24775]
+
+Thu Nov 11 16:47:21 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/ruby/test_file.rb (test_truncate_wbuf): we want to test
+	  only File#truncate, not behaviour of seek(2).
+
+Thu Nov 11 09:41:01 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* dir.c (push_braces): was confusing VALUE and char*.
+
+	* dir.c (rb_push_glob): Dir.glob should have called its block.
+
+Thu Nov 11 01:52:52 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* error.c (syserr_initialize): use stringified object.
+	  [ruby-dev:24768]
+
+Wed Nov 10 22:49:01 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* lib/delegate.rb (SimpleDelegator::dup): wrong number of
+	  arguments.
+
+	* lib/delegate.rb (DelegateClass::dup): ditto.
+
+Wed Nov 10 12:31:21 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* README.EXT (Example): extconf.rb is indispensable now.
+
+Wed Nov 10 03:33:36 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tcltklib/tcltklib.c: fix SEGV when compiled with Tcl/Tk8.3.x
+	  or older
+
+	* ext/tk/lib/tkextlib/tile/style.rb: bug fix
+
+Tue Nov  9 14:27:18 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/optparse.rb (OptionParser::Officious): moved from DefaultList.
+
+Tue Nov  9 01:05:04 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* dir.c (rb_glob2): do not allocate buffer from heap to avoid
+	  memory leaks.  use string object for buffering instead.
+	  [ruby-dev:24738]
+
+	* dir.c (join_path): ditto.
+
+	* io.c (io_read): external input buffer may be modified even after
+	  rb_str_locktmp().  [ruby-dev:24735]
+
+	* dir.c (fnmatch): p or s may be NULL.  [ruby-dev:24749]
+
+Tue Nov  9 00:53:53 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* regex.c (slow_match): avoid GCC 3.4.x warnings.
+
+Tue Nov  9 00:50:06 2004  Dave Thomas  <dave@pragprog.com>
+
+	* lib/rdoc/rdoc.rb: Change version numbering of RDoc and ri
+
+Mon Nov  8 23:38:35 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+
+	* lib/drb/extservm.rb: add DRb::ExtServManager#uri=.
+	  [ruby-dev:24743]
+
+Mon Nov  8 22:20:19 2004  Dave Thomas  <dave@pragprog.com>
+
+	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_class):
+	  Fix bug where parent class wasn't being detected if the
+	  child class was defined using the A::B notation.
+
+Mon Nov  8 00:14:13 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* configure.in: add setup for mignw32 cross compiling.
+	  [ruby-talk:119413]
+
+Sun Nov  7 23:49:26 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk.rb: bind-event methods accept multi substitution
+	  arguments.
+
+	* ext/tk/lib/tk/canvas.rb: ditto.
+
+	* ext/tk/lib/tk/canvastag.rb: ditto.
+
+	* ext/tk/lib/tk/text.rb: ditto.
+
+	* ext/tk/lib/tk/texttag.rb: ditto.
+
+	* ext/tk/lib/tkextlib: ditto.
+
+Sat Nov  6 14:58:44 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* lib/webrick/server.rb (WEBrick::HTTPServer#start): remove
+	  :DoNotReverseLookup option. (Socket#do_not_reverse_lookup is a
+	  ruby 1.9 feature)
+
+Sat Nov  6 11:31:04 2004  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* lib/date.rb (_parse): checks whether zone was given.
+
+Sat Nov  6 00:46:27 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* string.c (rb_str_locktmp): check STR_TMPLOCK flag before
+	  locking.  [ruby-dev:24727]
+
+Fri Nov  5 18:12:42 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk/scrollable.rb: divide Scrollable module into
+	  X_Scrollable and Y_Scrollable
+
+	* ext/tk/lib/tk/entry.rb: include X_Scrollable instead of Scrollable
+
+	* ext/tk/lib/tk/autoload.rb: define autoload for X_Scrollable and
+	  Y_Scrollable
+
+Fri Nov  5 16:05:32 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk.rb: TkComm._at() supprts both of "@x,y" and "@x"
+
+Fri Nov  5 13:22:58 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk/text.rb: sorry. bug fix again.
+
+Fri Nov  5 13:17:54 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk/text.rb: bug fix
+
+Fri Nov  5 08:52:48 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* gc.c (gc_mark): stricter GC stack check.
+
+Fri Nov  5 08:52:48 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* gc.c (gc_mark): stricter GC stack check.
+
+Fri Nov  5 08:34:43 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* string.c (str_gsub): should have removed rb_str_unlocktmp(str).
+	  [ruby-dev:24708]
+
+Thu Nov  4 21:25:38 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* string.c (str_gsub): string modify check no longer based on
+	  tmplock.  [ruby-dev:24706]
+
+Thu Nov  4 19:27:46 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* io.c (rb_f_open): fix typo.
+
+Thu Nov  4 15:02:14 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk/variable.rb: forget to initialize instance_variables
+	  of TkVarAccess objects
+
+Thu Nov  4 09:11:35 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* gc.c (gc_mark): enable GC stack checking.
+
+Thu Nov  4 03:11:33 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* string.c (str_gsub): lock strings temporarily.  [ruby-dev:24687]
+
+	* ext/socket/socket.c (s_recvfrom): tmplock input buffer.
+	  [ruby-dev:24705]
+
+Wed Nov  3 22:32:12 2004  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* process.c: On NetBSD don't use setruid() and setrgid().
+
+Wed Nov  3 22:24:17 2004  Daigo Moriwaki  <techml@sgtpepper.net>
+
+	* lib/webrick/httpauth/digestauth.rb: use Base64.encode64 to
+	  avoid warnings.
+
+Wed Nov  3 17:19:59 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* array.c (rb_ary_uniq_bang): do not push frozen string from hash
+	  table.  [ruby-dev:24695]
+
+	* array.c (rb_ary_and): ditto.
+
+	* array.c (rb_ary_or): ditto.
+
+Wed Nov  3 17:13:02 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* io.c (pipe_open): fix compile error
+
+Wed Nov  3 16:58:07 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk.rb: support to use different Tcl commands between
+	  configure and configinfo
+
+	* ext/tk/lib/font.rb: ditto.
+
+	* ext/tk/lib/itemconfig.rb: support to use different Tcl commands
+	  between item_configure and item_configinfo
+
+	* ext/tk/lib/itemfont.rb: ditto.
+
+	* ext/tk/extconf.rb: install SUPPORT_STATUS
+
+	* ext/tk/lib/tkextlib: some bug fixes (see ext/tk/ChangeLog.tkextlib)
+
+Wed Nov  3 16:30:41 2004  NARUSE, Yui  <naruse@ruby-lang.org>
+
+	* ext/nkf: follow nkf 2.0.4
+
+Wed Nov  3 15:53:34 2004  Kouhei Sutou  <kou@cozmixng.org>
+
+	* test/rss/test_maker_*.rb: added tests for RSS Maker.
+
+	* lib/rss/maker.rb: added RSS Maker.
+
+	* lib/rss/maker/*.rb: ditto.
+
+Tue Nov  2 16:35:57 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* ext/enumerator/enumerator.c (each_cons_i): pass copy of an
+	  internal consequent array.  [ruby-talk:118691]
+
+Tue Nov  2 16:05:21 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* process.c (rb_f_fork): need to flush stdout and stderr before
+	  fork(2).  [ruby-talk:117715]
+
+Tue Nov  2 01:20:09 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (proc_invoke): nail down dyna_var node when Proc object
+	  or continuation is created.  [ruby-dev:24671]
+
+Mon Nov  1 13:59:28 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* ext/extmk.rb (MANIFEST): do not use anymore, use extconf.rb instead.
+
+	* ext/enumerator/extconf.rb, ext/fcntl/extconf.rb,
+	  ext/stringio/extconf.rb: added.
+
+	* MANIFEST, ext/**/MANIFEST: removed.
+
+	* README.EXT, README.EXT.ja: remove MANIFEST stuff.
+
+Mon Nov  1 01:14:52 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* io.c (rb_f_open): create copy of popen specifier.  [ruby-dev:24656]
+
+Mon Nov  1 00:36:48 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* main.c (_stklen): move to gc.c.
+
+Sun Oct 31 00:22:28 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* string.c (rb_str_locktmp): lock string temporarily.
+
+	* string.c (str_independent): add tmplock check.
+
+	* io.c (io_write): lock output string temporarily.
+	  [ruby-dev:24649]
+
+	* io.c (io_write): use rb_str_locktmp().
+
+	* io.c (read_all): ditto.
+
+Sat Oct 30 06:53:24 2004  Peter Vanbroekhoven  <peter.vanbroekhoven@cs.kuleuven.ac.be>
+
+	* eval.c (rb_eval): NODE_XSTR should pass copy of literal string.
+
+Sat Oct 30 00:19:40 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* enum.c (enum_sort_by): protect continuation jump in.
+	  [ruby-dev:24642]
+
+Fri Oct 29 21:27:51 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (rb_io_check_initialized): new function to check uninitialized
+	  object.  [ruby-talk:118234]
+
+	* file.c (rb_file_path), io.c (rb_io_closed): check if initialized.
+
+Fri Oct 29 10:00:30 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (rb_thread_start_0): forget to free some memory chunks.
+	  [ruby-core:03611]
+
+	* eval.c (ruby_cleanup): ruby_finalize_1 may cause exception,
+	  should be wrapped by PUSH_TAG/POP_TAG().  [ruby-dev:24627]
+
+Thu Oct 28 08:42:02 2004  Tanaka Akira  <akr@m17n.org>
+
+	* io.c (argf_forward): use ANSI style.
+	  (argf_read): call argf_forward with argv argument.
+	  [ruby-dev:24624]
+
+Thu Oct 28 23:32:54 2004  akira yamada  <akira@ruby-lang.org>
+
+	* ext/zlib/zlib.c (zstream_detach_input): resets klass of z->input if
+	  z->input isn't nil.
+
+Thu Oct 28 23:19:31 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/extmk.rb: prefer relative path.  [ruby-talk:93037]
+
+Wed Oct 27 18:49:11 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* gc.c: prototype; rb_io_fptr_finalize() doesn't return any value
+	  at this version.
+
+Wed Oct 27 17:27:45 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* gc.c (gc_sweep): recover ruby_in_compile variable.
+
+Wed Oct 27 09:17:30 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (str_gsub): use a string object for exception safeness.
+	  [ruby-dev:24601]
+
+Tue Oct 26 23:52:32 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (rb_io_getline): rs modification check should not interfere in the loop.
+
+Tue Oct 26 23:30:39 2004  Dave Thomas  <dave@pragprog.com>
+
+	* lib/rdoc/code_objects.rb (RDoc::Context::add_class_or_module):
+	  Restore correct :nopdoc: behavior with nested classes and modules.
+
+Tue Oct 26 18:21:29 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* string.c (RESIZE_CAPA): check string attribute before modifying
+	  capacity member of string structure.  [ruby-dev:24594]
+
+Tue Oct 26 11:33:26 2004  David G. Andersen  <dga@lcs.mit.edu>
+
+	* ext/zlib/zlib.c (gzreader_gets): use memchr() to to gain
+	  performance.  [ruby-talk:117701]
+
+Tue Oct 26 10:56:55 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* sprintf.c (rb_f_sprintf): raise ArgumentError for extra
+	  arguments, unless (digit)$ style used.
+
+Tue Oct 26 11:33:26 2004  David G. Andersen  <dga@lcs.mit.edu>
+
+	* ext/zlib/zlib.c (gzreader_gets): use memchr() to to gain
+	  performance.  [ruby-talk:117701]
+
+Tue Oct 26 10:56:55 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* sprintf.c (rb_f_sprintf): raise ArgumentError for extra
+	  arguments, unless (digit)$ style used.
+
+Mon Oct 25 18:35:39 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
 
-	* ext/openssl/ossl_pkey_ec.c (ossl_ec_key_initialize,
-	  ossl_ec_key_to_string): ditto.
+	* win32/win32.c (isUNCRoot): should check NUL after '.'.
+	  [ruby-dev:24590]
 
-	* ext/openssl/ossl_pkey_rsa.c (ossl_rsa_initialize, ossl_rsa_export):
+	* win32/win32.c (isUNCRoot): fixed buffer overrun.
+
+Mon Oct 25 08:03:26 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (get_backtrace): ignore illegal backtrace.  [ruby-dev:24587]
+
+Sun Oct 24 00:41:09 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (rb_load, search_required, rb_require_safe, rb_require): use
+	  frozen shared string to avoid outside modification.  [ruby-dev:24580]
+
+Sat Oct 23 22:18:32 2004  Guy Decoux  <ts@moulon.inra.fr>
+
+	* eval.c (frame_free): Guy Decoux solved the leak problem.
+	  Thanks.  [ruby-core:03549]
+
+Sat Oct 23 00:20:55 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* ext/zlib/zlib.c (zstream_append_input): clear klass for z->input
+	  to avoid potential vulnerability.
+
+	* ext/zlib/zlib.c (zstream_run): always use zstream_append_input()
+	  to avoid SEGV.  [ruby-dev:24568]
+
+Fri Oct 22 12:02:28 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (rb_alias): was warning for wrong condition.
+	  [ruby-dev:24565]
+
+Fri Oct 22 10:36:37 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* lib/webrick/httprequest.rb (WEBrick::HTTPRequest#meta_vars):
+	  should check if path_info is not nil.
+
+Fri Oct 22 00:22:31 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* ext/zlib/zlib.c (zstream_shift_buffer): should restore class
+	  field of a buffer.  [ruby-dev:24562]
+
+Fri Oct 22 00:20:33 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (rb_str_include): should not treat char as negative value.
+	  [ruby-dev:24558]
+
+Thu Oct 21 21:32:30 2004  IWATSUKI Hiroyuki  <don@na.rim.or.jp>
+
+	* lib/pstore.rb (PStore#transaction): Use the empty content when a
+	  file is not found.  [ruby-dev:24561]
+
+Thu Oct 21 19:06:15 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* lib/webrick/httpresponse.rb (WEBrick::HTTPResponse#send_body_io):
+	  ensure to close @body. (http://bugs.debian.org/277520)
+
+Thu Oct 21 00:36:41 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (rb_alias): should warn on method discarding.
+	  [ruby-dev:24546]
+
+	* ext/zlib/zlib.c (zstream_expand_buffer_into): hide internal
+	  string buffer by clearing klass.  [ruby-dev:24548]
+
+Wed Oct 20 19:45:13 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* string.c (str_gsub): 	reentrant check.  [ruby-dev:24432]
+
+	* backport all SEGV bug fixes from CVS HEAD.  [ruby-dev:24536]
+
+Wed Oct 20 04:17:55 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* ext/dbm/dbm.c (fdbm_delete_if): should check if deleting element
+	  is a string.  [ruby-dev:24490]
+
+	* ext/sdbm/init.c (fsdbm_delete_if): ditto.
+
+Wed Oct 20 01:37:18 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* array.c (rb_ary_times): Array#* should return an instance of
+	  the class of right operand.  [ruby-dev:24526]
+
+	* ext/zlib/zlib.c (zstream_detach_buffer): should not expose
+	  class-less object to Ruby world. [ruby-dev:24530]
+
+	* eval.c (proc_dup): provide Proc#dup as well.  [ruby-talk:116915]
+
+	* eval.c (ruby_exec): stack marking position may be higher than
+	  expected.  thanks to Guy Decoux.  [ruby-core:03527]
+
+Tue Oct 19 22:43:12 2004  Dave Thomas  <dave@pragprog.com>
+
+	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_attr): If
+	  we come across 'attr' in a context where it isn't
+	  followed by a symbol, just issue a warning.
+
+Tue Oct 19 20:41:37 2004  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
+
+	* ext/win32ole.c(ole_invoke): retrieve the result value when
+	  retrying the IDispatch::invoke.
+
+Tue Oct 19 17:24:11 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* io.c (read_all): block string buffer modification during
+	  rb_io_fread() by freezing it temporarily. [ruby-dev:24479]
+
+	* dir.c (rb_push_glob): block call at once the end of method.
+	  [ruby-dev:24487]
+
+	* ext/enumerator/enumerator.c (enum_each_slice): remove
+	  rb_gc_force_recycle() to prevent potential SEGV.
+	  [ruby-dev:24499]
+
+	* ext/zlib/zlib.c (zstream_expand_buffer): hide internal string
+	  buffer by clearing klass.  [ruby-dev:24510]
+
+Tue Oct 19 16:12:18 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/tkutil.c: backport from CVS HEAD
+
+Tue Oct 19 08:54:26 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* intern.h, object.c (rb_class_inherited_p): export.
+
+Tue Oct 19 08:46:57 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* string.c (rb_str_upto): method result must be checked.  [ruby-dev:24504]
+
+	* eval.c (error_print): ditto.  [ruby-dev:24519]
+
+Mon Oct 18 23:37:05 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* marshal.c (r_object0): check inheritance by the internal function.
+	  [ruby-dev:24515]
+
+Mon Oct 18 15:58:01 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* range.c (range_step, range_each): need cast.
+
+Fri Oct 29 16:34:19 2004  Daiki Ueno  <ueno@unixuser.org>
+
+	* misc/ruby-mode.el (ruby-parse-partial): Parse the rest of the
+	line after opening heredoc identifier.  [ruby-dev:24635]
+
+Mon Oct 18 07:26:21 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* file.c (rb_file_truncate): discard read buffer before truncation.
+	  [ruby-dev:24197]
+
+Mon Oct 18 02:11:21 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* lib/webrick/config.rb (WEBrick::Config::General): add default values:
+	  - WEBrick::Config[:DoNotReverseLookup]
+	  - WEBrick::Config[:RequestCallback] (it used as an alias of
+	    :RequestHandler in WEBrick::HTTPServer#run)
+	  - WEBrick::Config::FileHandler[:AcceptableLanguages]
+
+	* lib/webrick/httpservlet/filehandler.rb
+	  (WEBrick::HTTPServlet::FileHandler#set_filename): search files
+	  having suffix of language-name which Accept-Language header field
+	  includes if :AcceptableLanguages options is present.
+
+	* lib/webrick/httpservlet/filehandler.rb
+	  (WEBrick::HTTPServlet::FileHandler#get_servlet): new method to
+	  search servlet correspond to the suffix of filename.
+
+	* lib/webrick/httprequest.rb: add attributes access methods: accept,
+	  accept_charset, accept_encoding, accept_language, content_length
+	  and content_type.
+
+	* lib/webrick/httpresponse.rb: add attribute access methods:
+	  content_length, content_length=, content_type and content_type=.
+
+	* lib/webrick/httputils.rb (WEBrick::HTTPUtils.mime_types):
+	  use the second suffix to detect media type. (the first suffix
+	  may be a language name.)
+
+	* lib/webrick/httputils.rb (WEBrick::HTTPUtils.parse_qvalues):
+	  add method to parse Accept header field. it returns an Array of
+	  values sorted by the qvalues.
+
+Mon Oct 18 02:04:11 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* lib/webrick/httpserver.rb (WEBrick::HTTPServer#virtual_host): new
+	  method to register virtual hosting servers.
+
+	* lib/webrick/server.rb (WEBrick::GenericServer#accept): call
+	  do_not_reverse_lookup for each socket if :DoNotReverseLookup
+	  is set.  [ruby-core:02357]
+
+Mon Oct 18 00:42:45 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* ext/socket/socket.c (sock_s_getservbyaname): protocol string
+	  might be altered.  [ruby-dev:24503]
+
+	* string.c (rb_str_upto): check if return value from succ is a
+	  string.  [ruby-dev:24504]
+
+Sun Oct 17 23:03:48 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk/timer.rb: TkTimer#start and restart accept a block
+
+Sun Oct 17 13:05:04 2004  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
+
+	* ext/win32ole/win32ole.c (fole_func_methods): correct argument mismatch.
+	* ext/win32ole/win32ole.c (fole_get_methods): ditto.
+	* ext/win32ole/win32ole.c (fole_put_methods): ditto.
+	* ext/win32ole/tests/testWIN32OLE.rb: add test for WIN32OLE#ole_func_methods
+	  WIN32OLE#ole_get_methods, WIN32OLE#ole_put_methods
+
+Sat Oct 16 14:45:28 2004  Kouhei Sutou  <kou@cozmixng.org>
+
+	* lib/rss/0.9.rb (RSS::Rss#to_s): removed garbage.
+
+Sat Oct 16 13:42:49 2004  Kouhei Sutou  <kou@cozmixng.org>
+
+	* lib/rss/: untabified.
+	* test/rss/: untabified.
+	* lib/rss/0.9.rb (RSS::Rss#to_s): inent -> indent.
+
+Sat Oct 16 13:34:56 2004  Kouhei Sutou  <kou@cozmixng.org>
+
+	* lib/rss: supported prety print.
+	* test/rss/test_1.0.rb: added test for calculating default indent size.
+
+Fri Oct 15 18:04:35 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk/timer.rb: TkTimer.new(interval, loop){ ... } is
+	  acceptable. Add TkTimer.start ( == new + start ).
+
+Fri Oct 15 12:43:09 2004  Tanaka Akira  <akr@m17n.org>
+
+	* eval.c (Init_stack): make prototype declaration consistent with
+	  the definition in gc.c.
+
+Thu Oct 14 14:34:01 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* io.c (MODE_BINMODE, MODE_BINARY): fixed reversed condition.
+
+Thu Oct 14 13:33:59 2004  Kouhei Sutou  <kou@cozmixng.org>
+
+	* lib/rss/rss.rb: added link to Tutorial.
+
+Mon Oct 11 13:48:20 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk/*: untabify
+
+Sun Oct 10 12:32:08 2004  Dave Thomas  <dave@pragprog.com>
+
+	* lib/rdoc/parsers/parse_rb.rb (RDoc::parse_require): Allow 'require'
+	  to be used as a variable name
+
+Sat Oct  9 21:23:37 2004  Kouhei Sutou  <kou@cozmixng.org>
+
+	* lib/rss/converter.rb: changed to try to use Iconv for default
+	  conversion.
+
+	* lib/rss/rss.rb: 0.0.9 -> 0.1.0.
+
+Sat Oct  9 19:50:36 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (rb_io_getline): should not treat char as negative value.
+	  [ruby-dev:24460]
+
+Fri Oct  8 09:49:32 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* pack.c (pack_pack): pointer modification check before each
+	  iteration.  [ruby-dev:24445]
+
+Fri Oct  8 01:13:05 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk/optiondb.rb: make it more secure
+
+Thu Oct  7 23:47:57 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk/scrollbar.rb: When 'set' operation, a scrollbar
+	  cannot propagate view port information from the source widget
+	  (that calls 'set') to other assigned widgets.
+
+Thu Oct  7 17:36:25 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk.rb: When CHILDKILLED and so on, Tk.errorCode returns
+	  a Fixnum for 2nd element (it's pid) of the return value.
+
+Thu Oct  7 12:55:04 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* io.c (io_read): should freeze buffer before thread context
+	  switch. [ruby-dev:24442]
+
+	* pack.c (pack_unpack): string conversion should at the top of the
+	  method.  [ruby-dev:24439]
+
+	* io.c (io_read): buffer should be frozen only after the length
+	  check.  [ruby-dev:24440]
+
+Thu Oct  7 02:56:43 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/stringio/stringio.c: use FMODE_APPEND.
+
+Thu Oct  7 01:05:33 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk.rb: add Tk.errorInfo and Tk.errorCode
+
+Thu Oct  7 00:08:37 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* io.c (rb_io_s_sysopen): preserve path in the buffer allocated by
+	  ALLOCA_N() to prevent modification.  [ruby-dev:24438]
+
+Wed Oct  6 09:21:00 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* io.c (rb_io_mode_flags): preserve append mode flag.
+	  [ruby-dev:24436]
+
+	* io.c (rb_io_modenum_mode): do not use external output buffer.
+
+	* string.c (rb_str_justify): differ pointer retrieval to prevent
+	  padding string modification.  [ruby-dev:24434]
+
+	* range.c (range_each_func): allow func to terminate loop by
+	  returning RANGE_EACH_BREAK.
+
+	* range.c (member_i): use RANGE_EACH_BREAK. [ruby-talk:114959]
+
+Mon Oct  4 14:04:14 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (rb_file_open_internal, rb_io_reopen): fname might be altered
+	  while GC.  [ruby-dev:24408]
+
+Mon Oct  4 12:53:45 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk/optiondb.rb: support definition of command
+	  resources on widgets
+
+	* ext/tk/lib/tk/image.rb: bug fix
+
+Sun Oct  3 21:20:03 2004  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/imap.rb (TEXT_REGEXP): allow 8-bit characters for the german
+	version of Microsoft Exchange Server. (backported from HEAD)
+
+	* lib/net/imap.rb (RTEXT_REGEXP): ditto.
+
+	* lib/net/imap.rb (CTEXT_REGEXP): ditto.
+
+Sat Oct  2 20:34:22 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* node.h (NEW_DVAR): extra semicolon.
+
+Sat Oct  2 00:42:20 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* marshal.c (r_byte): retrieve pointer from string value for each
+	  time.  [ruby-dev:24404]
+
+	* marshal.c (r_bytes0): ditto.
+
+	* enum.c (sort_by_i): re-entrance check added.  [ruby-dev:24399]
+
+	* io.c (io_read): should freeze all reading buffer.
+	  [ruby-dev:24400]
+
+	* string.c (rb_str_sum): should use bignums when bits is greater
+	  than or equals to sizeof(long)*CHAR_BITS. [ruby-dev:24395]
+
+	* eval.c (specific_eval): defer pointer retrieval to prevent
+	  unsafe sourcefile string modification.  [ruby-dev:24382]
+
+	* eval.c (specific_eval): defer pointer retrieval to prevent
+	  unsafe sourcefile string modification.  [ruby-dev:24382]
+
+	* string.c (rb_str_sum): wrong cast caused wrong result.
+	  [ruby-dev:24385]
+
+	* enum.c (enum_sort_by): hide temporary array from
+	  ObjectSpace.each_object.  [ruby-dev:24386]
+
+	* string.c (rb_str_sum): check was done with false pointer.
+	  [ruby-dev:24383]
+
+	* string.c (rb_str_sum): string may be altered.  [ruby-dev:24381]
+
+Mon Oct 11 17:51:34 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* io.c (rb_io_popen): get mode string via rb_io_flags_mode() to
+	  avoid mode string modification.  [ruby-dev:24454]
+
+	* io.c (rb_io_getline_fast): should take delim as unsigned char to
+	  distinguish EOF and '\377'.  [ruby-dev:24460]
+
+	* io.c (rb_io_getline): add check for RS modification.
+	  [ruby-dev:24461]
+
+	* enum.c (enum_sort_by): use qsort() directly instead using
+	  rb_iterate().  [ruby-dev:24462]
+
+	* enum.c (enum_each_with_index): remove rb_gc_force_recycle() to
+	  prevent access to recycled object (via continuation for
+	  example).  [ruby-dev:24463]
+
+Fri Oct  1 11:40:14 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (rb_f_eval): defer pointer retrieval to prevent unsafe
+	  sourcefile string modification.  [ruby-dev:24373]
+
+	* io.c (io_read): block string buffer modification during
+	  rb_io_fread() by freezing it temporarily. [ruby-dev:24366]
+
+	* io.c (rb_io_s_popen): mode argument may be altered.
+	  [ruby-dev:24375]
+
+	* file.c (rb_file_s_basename): ext argument may be altered.
+	  [ruby-dev:24377]
+
+	* enum.c (enum_sort_by): use NODE instead of 2 element arrays.
+	  [ruby-dev:24378]
+
+	* string.c (rb_str_chomp_bang): StringValue() may change the
+	  receiver.  [ruby-dev:24371]
+
+Fri Oct  1 11:25:20 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk/grid.rb: revive TkGrid.grid
+
+	* ext/tk/lib/tk/pack.rb: revive TkPack.pack
+
+	* ext/tk/lib/tk/place.rb: revive TkPlace.place
+
+Thu Sep 30 00:50:44 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tcltklib/tcltklib.c (ip_init): bug fix
+
+	* ext/tk/tkutil.c (get_eval_string_core): accept a Regexp object
+
+	* ext/tk/lib/multi-tk.rb: fix bug on 'exit' operation
+
+	* ext/tk/lib/tk/text.rb: 'tksearch' accepts a Regexp object as a
+	  matting pattern argument
+
+Wed Sep 29 10:58:07 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* enum.c (sort_by_i): internally used object must not be changed
+	  outside.  [ruby-dev:24368]
+
+Mon Sep 27 13:46:45 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* intern.h, struct.c (rb_struct_s_members, rb_struct_members): public
+	  accessors.  [ruby-dev:24342]
+
+	* marshal.c (w_object, r_object0): use accessors.
+
+Mon Sep 27 09:14:03 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* ext/socket/socket.c (s_accept): don't retry for EWOULDBLOCK.
+	  [ruby-talk:113807]
+
+Fri Sep 24 16:09:42 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (proc_invoke): propagate DVAR_DONT_RECYCLE on termination
+	  to avoid double call to rb_gc_force_recycle(). [ruby-dev:24311]
+
+Fri Sep 24 08:29:45 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* array.c (rb_ary_subseq): original object might be modified after
+	  sharing data creation.  [ruby-dev:24327]
+
+	* array.c (rb_ary_replace): ditto.
+
+	* array.c (ary_make_shared): freeze shared array. [ruby-dev:24325]
+
+	* struct.c (struct_members): always check struct size and size of
+	  members list in the class.  [ruby-dev:24320]
+
+Thu Sep 23 09:29:14 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* string.c (rb_str_sub_bang): check if string is not modified
+	  during iteration.  [ruby-dev:24315]
+
+	* hash.c (rb_hash_rehash): replace st_foreach() by its deep
+	  checking counterpart.  [ruby-dev:24310]
+
+Wed Sep 22 13:38:12 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* hash.c (rb_hash_rehash): add iteration check.  [ruby-dev:24301]
+
+	* st.c (st_foreach): add deep check.
+
+Wed Sep 22 13:06:14 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (rb_w32_call_handler): workaround for Ctrl-C.
+	  merge from HEAD.
+
+Wed Sep 22 00:11:12 2004  Dave Thomas  <dave@pragprog.com>
+
+	* process.c: Add documentation for fork()
+
+Wed Sep 22 09:04:41 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* array.c (rb_ary_collect_bang): element size might change during
+	  comparison.  [ruby-dev:24300]
+
+	* array.c (rb_ary_reject_bang): ditto. [ruby-dev:24300]
+
+	* array.c (rb_ary_eql): ditto. [ruby-dev:24300]
+
+Tue Sep 21 18:29:49 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* array.c (rb_ary_equal): merge miss.
+
+	* array.c (rb_ary_uniq_bang): element size might change during
+	  comparison.  [ruby-dev:24298]
+
+Mon Sep 20 00:24:19 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* enum.c (enum_sort_by): do not use qsort directly.  use
+	  rb_ary_sort_bang() instead.  [ruby-dev:24291]
+
+	* enum.c (enum_sort_by): pedantic type check added.
+	  [ruby-dev:24291]
+
+	* hash.c (rb_hash_foreach_iter): check iter_lev after each
+	  iteration.  [ruby-dev:24289]
+
+	* array.c (rb_ary_and): element size might change during
+	  comparison.  [ruby-dev:24290]
+
+	* array.c (rb_ary_or): ditto. [ruby-dev:24292]
+
+	* array.c (rb_ary_equal): wrong fix. [ruby-dev:24286]
+
+Sat Sep 18 15:02:22 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* array.c (rb_ary_equal): element size might change during
+	  comparison.  [ruby-dev:24254]
+
+	* array.c (rb_ary_diff): ditto. [ruby-dev:24274]
+
+	* array.c (rb_ary_select): ditto. [ruby-dev:24278]
+
+	* array.c (rb_ary_delete): ditto. [ruby-dev:24283]
+
+	* array.c (rb_ary_rindex): ditto. [ruby-dev:24275]
+
+	* array.c (rb_ary_initialize): element size might change during
+	  initializing block.  [ruby-dev:24284]
+
+Sat Sep 18 14:10:23 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* dir.c (dir_s_chdir): avoid memory leak and unnecessary chdir to
+	  the original directory when exception has caused in changing
+	  direcotry or within block.  thanks to Johan Holmberg
+	  <holmberg@iar.se> [ruby-core:03446]
+
+Fri Sep 17 20:20:27 2004  Minero Aoki  <aamine@loveruby.net>
+
+	* lib/fileutils.rb (mkdir_p): backport from CVS HEAD 1.45. [ruby-core:03420]
+
+Fri Sep 17 17:11:08 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* array.c (rb_ary_delete): element comparison might change array
+	  size. [ruby-dev:24273]
+
+	* file.c (rb_file_truncate): clear stdio buffer before truncating
+	  the file.  [ruby-dev:24191]
+
+	* ext/digest/digest.c: use rb_obj_class() instead of CLASS_OF
+	  which might return singleton class.  [ruby-dev:24202]
+
+Fri Sep 17 16:07:09 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/multi-tk.rb: improve exit operation
+
+Fri Sep 17 15:01:57 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tcltklib/tcltklib.c: fix SEGV when (thread_)vwait or
+	  (thread_)tkwait
+
+	* ext/tk/lib/tk.rb: add alias wait_window to wait_destroy
+
+	* ext/tk/lib/multi-tk.rb: support calling 'mainloop' on slave
+	  interpreters (however, the 'real' eventloop must be run on the
+	  Default Master IP)
+
+	* ext/tk/lib/remote-tk.rb: follow the changes of ext/tk/lib/multi-tk.rb
+
+	* ext/tk/sample/remote-ip_sample2.rb: ditto
+
+	* ext/tk/sample/tkoptdb-safeTk.rb: ditto
+
+Thu Sep 16 18:12:32 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* lib/webrick/cgi.rb (WEBrick::CGI#start): should set REMOTE_USER
+	  to request.user attribute.
+
+	* lib/webrick/httpservlet/filehandler.rb
+	  (WEBrick::HTTPServlet::FileHandler#initialize): should expand
+	  the pathname of document root directory.
+
+Thu Sep 16 15:49:28 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* string.c (rb_str_intern): protect string argument from GC.
+	  [ruby-core:03411]
+
+Wed Sep 15 20:22:23 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/sample/tkoptdb-safeTk.rb: fix a bug depend on the changes
+	  of MultiTkIp
+
+Tue Sep 14 23:54:11 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/multi-tk.rb: MultiTkIp#eval_string was en-bugged by
+	  the previous changes.
+
+Tue Sep 14 23:45:44 2004  Dave Thomas  <dave@pragprog.com>
+
+	* lib/rdoc/ri/ri_formatter.rb (RI::TextFormatter::TextFormatter.for):
+	  Add Eric Hodel's simpleformatter.
+
+Tue Sep 14 16:59:37 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tcltklib/tcltklib.c: fix SEGV
+
+	* ext/tk/lib/multi-tk.rb: improve safe-level handling of argument proc
+
+	* ext/tk/sample/multi-ip_sample.rb: rename of old 'safe-tk.rb'
+
+	* ext/tk/sample/safe-tk.rb: new sample script
+
+Tue Sep 14 00:15:15 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* ext/zlib/zlib.c: backported from HEAD.
+
+Mon Sep 13 19:16:33 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* eval.c (blk_copy_prev): need frame_dup().  [ruby-dev:24103]
+
+Mon Sep 13 16:23:27 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/multi-tk.rb: MultiTkIp.new_master and new_slave accept
+	  safe-level value argument
+
+Mon Sep 13 10:20:45 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* object.c (nil_inspect): fix typo.
+
+Mon Sep 13 01:03:02 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tcltklib/tcltklib.c: improve control of preserv/release tcltkip
+
+	* ext/tcltklib/tcltklib.c: store original 'exit' command
+
+	* ext/tk/tkutil.c: fix(?) SEGV
+
+Sun Sep 12 23:46:23 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* util.c (ruby_strdup): remove unnecessary code. (xmalloc never
+	  returns NULL.)
+
+	* util.c (ruby_getcwd): fix memory leak on failure.
+
+Sun Sep 12 02:41:58 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tcltklib/tcltklib.c: add TclTkIp#allow_ruby_exit? and
+	  allow_ruby_exit=
+
+
+	* ext/tk/lib/multi-tk.rb: ditto.
+
+	* ext/tk/lib/remote-tk.rb: ditto.
+
+	* ext/tcltklib/MANUAL.euc: ditto.
+
+	* ext/tcltklib/MANUAL.eng: ditto.
+
+	* ext/tcltklib/tcltklib.c: fix some reasons of SEGV
+
+	* ext/tk/tkutil.c: ditto.
+
+	* ext/tk/lib/multi-tk.rb: ditto.
+
+	* ext/tk/lib/tk/timer.rb: ditto.
+
+Sat Sep 11 16:09:46 2004  Dave Thomas  <dave@pragprog.com>
+
+	* lib/rdoc/parsers/parse_rb.rb: Fix up cross-file class merging.
+
+Fri Sep 10 20:20:53 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* ext/tcltklib/tcltklib.c (lib_merge_tklist): fix suspicious
+	  pointer conversion.
+
+Fri Sep 10 02:43:54 2004  Dave Thomas  <dave@pragprog.com>
+
+	* lib/rdoc/generators/template/kilmer.rb: James Buck's
+	  patch for call-seq.
+
+Thu Sep  9 13:58:56 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tcltklib/tcltklib.c (ip_init): change flag value for setting
+	  'argv' and 'argv0' variable
+
+	* ext/tk/lib/remote-tk.rb: follow changes of multi-tk.rb
+
+Thu Sep  9 11:46:18 2004  Dave Thomas  <dave@pragprog.com>
+
+	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::do_classes): Allow
+	  spaces aroun parameter to define_method_under (James Buck)
+
+Wed Sep  8 18:44:03 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/stringio/stringio.c (strio_write): zero fill a gap if exsts.
+	  [ruby-dev:24190]
+
+Wed Sep  8 15:19:49 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tcltklib/tcltklib.c (ip_init): cannot create a IP at level 4
+
+	* ext/tk/lib/multi-tk.rb: improve 'exit' operation, security check,
+	  and error treatment
+
+	* ext/tk/lib/multi-tk.rb: allow a trusted slave IP to create slave IPs
+
+	* ext/tk/lib/tk/listbox.rb: add TkListbox#value, value=, clear,	and
+	  erase
+
+	* ext/tk/lib/tk/text.rb: add TkText#clear and erase
+
+Tue Sep  7 15:17:49 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/socket/socket.c (ruby_connect): break immediately if a
+	  socket is non-blocking.  [ruby-talk:111654]
+
+Mon Sep  6 11:08:50 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* ext/tk/lib/tk/menu.rb(TkOptionMenubutton#insert): call correct method
+
+Mon Sep  6 11:00:47 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* dir.c (dir_s_chdir): the patch to shut up false warning when
+	  exception occurred within a block.  a patch was given from Johan
+	  Holmberg <holmberg at iar.se>.  [ruby-core:03292]
+
+Mon Sep  6 07:51:42 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (cvar_cbase): singletons should refer outer cvar scope.
+	  [ruby-dev:24223]
+
+	* eval.c (rb_load): should preserve previous ruby_wrapper value.
+	  [ruby-dev:24226]
+
+Sat Sep  4 01:14:57 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (cvar_cbase): class variables cause SEGV in
+	  instance_eval() for fixnums and symbols. [ruby-dev:24213]
+
+Fri Sep  3 17:47:58 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* struct.c (make_struct): remove redefining constant when
+	  conflict.  [ruby-dev:24210]
+
+Fri Sep  3 11:31:44 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk.rb: Tk.after makes TkCore::INTERP.tk_cmd_tbl grow
+	  [ruby-dev:24207]
+
+Fri Sep  3 02:12:48 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tcltklib/tcltklib.c: fix typo [ruby-talk:111266]
+
+	* ext/tk/lib/tk/text.rb: fix typo
+
+	* ext/tk/lib/multi-tk.rb: improve safe-level treatment on slave IPs
+
+Fri Sep  3 01:54:20 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/extmk.rb: already built-in libraries satisfy dependencies.
+	  [ruby-dev:24028]
+
+Thu Sep  2 11:36:20 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* eval.c (rb_obj_instance_eval): backported from HEAD.
+
+Wed Sep  1 21:18:25 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* ext/tk/lib/tk/spinbox.rb: fix typo
+
+Tue Aug 31 18:24:04 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* ext/tk/tkutil.c (cbsubst_init): fix memory leak
+
+	* ext/tk/tkutil.c (cbsubst_get_all_subst_keys): fix SEGV
+
+Tue Aug 31 16:04:22 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tcltklib/tcltklib.c (ip_delete): when a tcltkip is deleted,
+	  destroy its root widget
+
+Tue Aug 31 12:30:36 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tcltklib/tcltklib.c (del_root): fix SEGV
+
+Mon Aug 30 23:11:06 2004  Dave Thomas  <dave@pragprog.com>
+
+	* lib/rdoc/ri/ri_driver.rb (and others): ri now merges documentation
+	  if it finds the same class in multiple places.
+
+Mon Aug 30 22:40:30 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/multi-tk.rb: 'restart' method accepts arguments
+
+Mon Aug 30 21:50:14 2004  Dave Thomas  <dave@pragprog.com>
+
+	* object.c: Add RDoc for Module.included.
+
+Mon Aug 30 15:10:46 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* configure.in (GNU/k*BSD): fixed FTBFS on GNU/k*BSD. [ruby-dev:24051]
+
+Mon Aug 30 11:29:35 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (CreateChild): strip trailing spaces. [ruby-dev:24143]
+	  merge from HEAD.
+
+Sun Aug 29 14:08:56 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tcltklib/tcltklib.c: compile error on bcc32 [ruby-dev:24081]
+
+	* ext/tk/lib/multi-tk.rb: MultiTkIp#eval_string does not work
+
+Sat Aug 28 23:04:41 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* bignum.c (rb_big_and): protect parameters from GC.
+	  [ruby-talk:110664]
+
+Thu Aug 26 04:38:29 2004  Dave Thomas  <dave@pragprog.com>
+
+	* eval.c (return_jump): Minor typo in error message. Now reads
+	  "return can't jump across threads".
+
+Tue Aug 24 17:30:00 2004  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/cgi/session.rb (CGI::Session::FileStore#initialize): do not
+	  use a session id as a filename. (backported from HEAD)
+
+	* lib/cgi/session/pstore.rb (CGI::Session::PStore#initialize): ditto.
+
+	* lib/cgi/session/pstore.rb (CGI::Session::PStore#initialize): use
+	  Dir::tmpdir. (backported from HEAD)
+
+Tue Aug 24 14:40:16 2004  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/cgi/session.rb (CGI::Session::FileStore#initialize): untaint
+	  session id after check. (backported from HEAD)
+
+Tue Aug 24 09:09:01 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/ossl_x509attr.c (ossl_x509attr_initialize): d2i
+	  functions may replace the pointer indicated by the first argument.
+
+	* ext/openssl/ossl_x509ext.c (ossl_x509ext_initialize): ditto.
+
+	* ext/openssl/ossl_x509name.c (ossl_x509name_initialize): ditto.
+
+Mon Aug 23 14:04:51 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/ossl_ssl.c (ossl_ssl_read):
+	  - should return an empty string if specified length to read is 0.
+	  - should check for pending data and wait for fd before reading.
+	  - call underlying IO's sysread if SSL session is not started.
+	  [ruby-dev:24072], [ruby-dev:24075]
+
+	* ext/openssl/ossl_ssl.c (ossl_ssl_write):
+	  - call underlying IO's syswrite if SSL session is not started.
+
+	* ext/openssl/ossl_ssl.c (ossl_ssl_pending): new method
+	  OpenSSL::SSL#pending.
+
+	* ext/openssl/lib/openssl/buffering.rb: should not use select.
+
+Mon Aug 23 12:40:56 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* lib/resolv.rb (Config.default_config_hash): when multiple domains
+	  are set, Win32::Resolv.get_resolv_info returns Array.
+
+Sun Aug 22 01:15:31 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* lib/webrick/httpproxy.rb (WEBrick::HTTPProxyServer#proxy_connect):
+	  should call :ProxyContentHandler before finishing CONNECT.
+
+Sat Aug 21 06:41:16 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/tcltklib/extconf.rb (find_tcl, find_tk): find stub library.
+
+	* lib/mkmf.rb (arg_config, with_config): deal with '-' and '_'
+	  uniformly.  [ruby-dev:24118]
+
+Thu Aug 19 16:29:45 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk.rb: Fail to treat a hash value of 'font' option.
+
+	* ext/tk/lib/tk.rb: bindinfo cannot return '%' substiturion infomation.
+
+	* ext/tk/lib/menu.rb: typo bug.
+
+Thu Aug 19 15:15:24 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* dir.c (free_dir): fix memory leak.  reported by yamamoto
+	  madoka.
+
+Thu Aug 19 11:00:00 2004  Akiyoshi, Masamichi  <masamichi.akiyoshi@hp.com>
+
+	* dln.c (dln_load): Modify to call lib$find_image_symbol for VMS.
+	* io.c (rb_io_fwrite): Use fputc() for VMS non-stream file.
+
+Thu Aug 19 06:07:45 2004  why the lucky stiff  <why@ruby-lang.org>
+
+	* ext/syck/token.c: re2c no longer compiled with bit vectors.  caused
+	  problems for non-ascii characters. [ruby-core:03280]
+	* ext/syck/implicit.c: ditto.
+	* ext/syck/bytecode.c: ditto.
+
+	* lib/yaml/baseemitter.rb: folding now handles double-quoted strings,
+	  fixed problem with extra line feeds at end of folding, whitespace
+	  opening scalar blocks.
+
+	* lib/yaml/rubytypes.rb: subtelties in handling strings with
+	  non-printable characters and odd whitespace patterns.
+
+Wed Aug 18 23:41:33 2004  Minero Aoki  <aamine@loveruby.net>
+
+	* lib/net/protocol.rb (rbuf_fill): OpenSSL::SSL::SSLSocket has its own
+	  buffer, select(2) might not work. [ruby-dev:24072]
+
+Wed Aug 18 17:10:12 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* ext/tcltklib/stubs.c (ruby_tcltk_stubs): need to call
+	  Tcl_FindExecutable() for Tcl/Tk 8.4.
+
+Wed Aug 18 12:52:55 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (rb_obj_instance_eval): evaluates under special singleton
+	  classes as for special constants.
+
+Tue Aug 17 17:20:59 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* io.c (rb_io_reopen): should clear allocated OpenFile.  pointed
+	  out by Guy Decoux. [ruby-core:03288]
+
+Tue Aug 17 01:36:32 2004  Dave Thomas  <dave@pragprog.com>
+
+	* lib/rdoc/usage.rb: Remove extra indent. Tidy 'ri' option
+	  parsing so RDoc::usage plays better with OptionParser.
+
+Sat Aug 14 13:09:10 2004  Minero Aoki  <aamine@loveruby.net>
+
+	* lib/fileutils.rb: backport from CVS HEAD (rev1.44).
+
+	* lib/fileutils.rb: cp_r should copy symlink itself, except cp_r
+	  root.
+
+	* lib/fileutils.rb: new option mv :force.
+
+	* lib/fileutils.rb: new module FileUtils::DryRun.
+
+Sat Aug 14 02:48:16 2004  Dave Thomas  <dave@pragprog.com>
+
+	* lib/rdoc/usage.rb: Added. Allows command line programs
+	  to report usage using their initial RDoc comment.
+
+Fri Aug 13 13:23:17 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* lib/webrick/httputils.rb (WEBrick::HTTPUtils.parse_range_header):
+	  fix regex for range-spec.
+
+	* lib/webrick/httpservlet/filehandler.rb
+	  (WEBrick::HTTPServlet::DefaultFileHandler#make_partial_content):
+	  multipart/byteranges response was broken.
+
+	* lib/webrick/httpservlet/erbhandler.rb
+	  (WEBrick::HTTPServlet::ERBHandler#do_GET): should select media type
+	  by suffix of script filename.
+
+	* lib/xmlrpc/server.rb: refine example code.
+
+Wed Aug 11 17:17:50 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* configure.in (RPATHFLAG): stop setting RPATHFLAG on Interix.
+
+Sun Aug  8 00:43:31 2004  why the lucky stiff  <why@ruby-lang.org>
+
+	* lib/implicit.c: added sexagecimal float#base60.
+
+	* ext/syck/rubyext.c (yaml_org_handler): ditto.
+
+	* lib/token.c: indentation absolutely ignored when processing flow
+	  collections.  plain scalars are trimmed if indentation follows in
+	  an ambiguous flow collection.
+
+Sat Aug  7 00:50:01 2004  Tanaka Akira  <akr@m17n.org>
+
+	* ext/zlib/zlib.c: Zlib::GzipReader#read(0) returns "" instead of nil.
+
+Tue Aug  3 13:49:20 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk/namespace.rb: bug fix
+
+	* ext/tk/lib/tkextlib/treectrl/tktreectrl.rb: add Tk::TreeCtrl.loupe
+
+Mon Aug  2 18:04:21 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk/msgcat.rb (set_translation): bug fix (fail to set
+	  trans_str to the same as src_str when trans_str is not given.)
+
+Mon Aug  2 11:53:06 2004  Dave Thomas  <dave@pragprog.com>
+
+	* lib/rdoc/code_objects.rb (RDoc::Context::find_symbol): Fix infinite recursion
+	  looking up some top level symbols (batsman)
+
+Mon Aug  2 11:48:29 2004  Dave Thomas  <dave@pragprog.com>
+
+	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::do_methods): Allow '.'s in
+	  variable names to support SWIG generated files (Hans Fugal)
+
+Sat Jul 31 17:40:16 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* misc/ruby-mode.el (ruby-expr-beg, ruby-parse-partial,
+	  ruby-calculate-indent, ruby-move-to-block, ruby-forward-sexp,
+	  ruby-backward-sexp): keywords must match word-wise.
+
+Sat Jul 31 05:47:37 2004  why the lucky stiff  <why@ruby-lang.org>
+
+	* lib/yaml.rb (YAML::load_file, YAML::parse_file): added.
+
+	* lib/yaml/rubytypes.rb: exceptions were using an older
+	  YAML.object_maker. [ruby-core:03080]
+
+	* ext/syck/token.c (sycklex_yaml_utf8): using newline_len to
+	  handline CR-LFs.  "\000" was showing up on folded blocks which
+	  stopped at EOF.
+
+	* ext/syck/token.c: re2c compiled with bit vectors now.
+	* ext/syck/implicit.c: ditto.
+	* ext/syck/bytecode.c: ditto.
+
+Fri Jul 30 16:10:54 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tcltklib/tcltklib.c (lib_fromUTF8_core): raise ArgumentError when
+	  the unknown encoding name is given.
+
+	* ext/tcltklib/tcltklib.c (lib_toUTF8_core): ditto.
+
+	* ext/tk/lib/tk.rb (Tk::Encoding.encoding_convertfrom): bug fix.
+
+	* ext/tk/lib/tk.rb (Tk::Encoding.encoding_convertto): ditto.
+
+Wed Jul 28 18:59:17 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* lib/cgi.rb (CGI::initialize): remove at_exit code for CGI_PARAMS
+	  and CGI_COOKIES.  they will no longer be used.
+
+Wed Jul 28 01:04:44 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* gc.c (run_final): wrong order of data. [ruby-dev:23984]
+
+Tue Jul 27 07:05:04 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (rb_eval): copy on write for argument local variable
+	  assignment.
+
+	* eval.c (assign): ditto.
+
+	* eval.c (rb_call0): update ruby_frame->argv with the default
+	  value used for the optional arguments.
+
+	* object.c (Init_Object): "===" calls rb_obj_equal() directly.
+	  [ruby-list:39937]
+
+Mon Jul 26 11:22:55 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* lib/webrick/httputils.rb (WEBrick::HTTPUtils.escape): should
+	  escape space.
+
+Sun Jul 25 11:05:21 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* win32/win32.{h,c} (rb_w32_{f,fd,fs}open): workaround for bcc32's
+	  {f,fd,fs}open bug. set errno EMFILE and EBADF. [ruby-dev:23963]
+
+Sat Jul 24 13:32:47 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* range.c (rb_range_beg_len): returns Qnil only when "beg" points
+	  outside of a range.  No boundary check for "end".
+
+Fri Jul 23 16:40:25 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* gc.c (define_final): should not disclose NODE* to Ruby world.
+	  [ruby-dev:23957]
+
+Fri Jul 23 09:03:16 2004  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/imap.rb (disconnected?): new method. (backported from HEAD)
+
+Thu Jul 22 16:41:54 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* lib/cgi/session.rb (CGI::Session::FileStore#update): sets the
+	 permission of the session data file to 0600.
+
+	* lib/cgi/session/pstore.rb (CGI::Session::Pstore#initialize):
 	  ditto.
 
-	* test/openssl/test_pkey_{dsa,ec,rsa}.rb: test this.
+Thu Jul 22 00:02:21 2004  Masahiro Kitajima  <katonbo@katontech.com>
+
+	* process.c (rb_f_system): not need to call last_status_set() any
+	  longer on _WIN32.
+
+Tue Jul 20 09:15:17 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* test/fileutils/test_fileutils.rb: File.link raises EINVAL on BeOS.
+
+Mon Jul 19 01:15:07 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* lib/webrick/httpservlet/cgihandler.rb
+	  (WEBrick::HTTPServlet::CGIhandler#do_GET): set SystemRoot environment
+	  variable to CGI process on Windows native platforms. [ruby-dev:23936]
+
+	* lib/webrick/httpservlet/cgihandler.rb
+	  (WEBrick::HTTPServlet::CGIhandler#do_GET): use $?.exitstatus and
+	  refine log message.
+
+Sun Jul 18 16:14:29 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk/msgcat.rb (TkMsgCatalog.callback): bug fix
+	  ( wrong number of argument )
+
+Sun Jul 18 08:13:58 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* sprintf.c (rb_f_sprintf): remove extra sign digit.
+
+Sun Jul 18 03:21:42 2004  Akinori MUSHA  <knu@iDaemons.org>
+
+	* dir.c (range): use NULL instead of 0.
+
+	* dir.c (range): get rid of a gcc 3.4 warning.
+
+Sun Jul 18 03:12:11 2004  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/imap.rb (receive_responses): return if a LOGOUT response
+	received. (backported from HEAD)
+	* lib/net/imap.rb (send_string_data): wait command continuation
+	requests before sending octet data of literals. (backported from HEAD)
+
+Sat Jul 17 23:54:59 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk/variable.rb: TkVariable#ref returns a TkVariable object
+
+Sat Jul 17 22:04:44 2004  akira yamada  <akira@ruby-lang.org>
+
+	* lib/uri/ldap.rb: method hierarchical? should be in URI::LDAP.
+
+Sat Jul 17 18:29:07 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (stmt): not to show same error messages twice.
+
+Sat Jul 17 13:13:32 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* lib/irb/ruby-lex.rb (RubyLex::identify_string): %s string do not
+	  process expression interpolation.  [ruby-talk:106691]
+
+Sat Jul 17 05:26:27 2004  Dave Thomas  <dave@pragprog.com>
+
+	* lib/rdoc/diagram.rb: Incorporate Micheal Neuman's
+	  client-side imagemao patch
 
-Fri May 20 23:45:53 2016  Naohisa Goto  <ngotogenome@gmail.com>
+Sat Jul 17 01:57:03 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* id_table.c (list_id_table_init): When unaligned word access is
-	  prohibited and sizeof(VALUE) is 8 (64-bit machines),
-	  capa should always be even number for 8-byte word alignment
-	  of the values of a table. This code assumes that sizeof(ID) is 4,
-	  sizeof(VALUE) is 8, and xmalloc() returns 8-byte aligned memory.
-	  This fixes bus error on 64-bit SPARC Solaris 10.
-	  [Bug #12406][ruby-dev:49631]
+	* eval.c (THREAD_ALLOC): th->thread should be initialized to NULL.
+	  [ruby-talk:106657]  The solution was found by Guy Decoux.
 
-Fri May 20 22:30:09 2016  Naohisa Goto  <ngotogenome@gmail.com>
+Fri Jul 16 22:30:28 2004  Michael Neumann  <mneumann@ntecs.de>
 
-	* symbol.h (rb_id2sym): Use HAVE_BUILTIN___BUILTIN_CONSTANT_P
+	* file.c (rb_stat_dev_major): new methods File::Stat#dev_major and
+	  #dev_minor. [ruby-core:03195]
 
-Fri May 20 22:19:00 2016  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+Fri Jul 16 15:23:53 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/date/date_core.c: [DOC] fix typos.
-	  [fix GH-1360] patched by @soundasleep
+	* eval.c (return_jump, break_jump): raise unexpceted local jump
+	  exception directly.  [ruby-dev:23740]
 
-Fri May 20 21:26:58 2016  Naohisa Goto  <ngotogenome@gmail.com>
+	* lib/base64.rb (Deprecated): super in bound method calls original
+	  name method in stable version.  [ruby-dev:23916]
 
-	* include/ruby/defines.h (RB_GNUC_EXTENSION, RB_GNUC_EXTENSION_BLOCK):
-	  macros for skipping __extension__ on non-GCC compilers.
-	* eval_error.c (warn_print): use RB_GNUC_EXTENSION_BLOCK instead of
-	  __extension__ because __extension__ is a GNU extension.
-	  Fix compile error on Solaris 10 with Oracle Solaris Studio 12.x.
-	  [Bug #12397] [ruby-dev:49629].
-	* internal.h (rb_fstring_cstr, rb_fstring_enc_cstr): ditto
-	* include/ruby/encoding.h (rb_enc_str_new, rb_enc_str_new_cstr): ditto
-	* include/ruby/intern.h (rb_str_new, rb_str_new_cstr,
-	  rb_usascii_str_new, rb_utf8_str_new, rb_tainted_str_new_cstr,
-	  rb_usascii_str_new_cstr, rb_utf8_str_new_cstr,
-	  rb_external_str_new_cstr, rb_locale_str_new_cstr,
-	  rb_str_buf_new_cstr, rb_str_cat_cstr, rb_exc_new_cstr): ditto
+Fri Jul 16 11:31:49 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
 
-Fri May 20 21:17:13 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/test/unit/ui/{fox,gtk,gtk2}/testrunner.rb: remove
+	  garbage (patch from akira yamada) [ruby-dev:23911]
 
-	* ext/win32ole/win32ole.c (fole_missing): make substring or dup to
-	  share the content if possible.
+Fri Jul 16 11:20:00 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Fri May 20 19:48:48 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* sprintf.c (rb_f_sprintf): fix output of NaN, Inf and -Inf with
+	  "%f" or etc on MSVCRT platforms. (backported from HEAD)
 
-	* internal.h (NEW_PARTIAL_MEMO_FOR): shrink buffer array not to
-	  mark non-VALUE fields.  fix check_rvalue_consistency abort with
-	  RGENGC_CHECK_MODE=2.
+Fri Jul 16 11:17:38 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* internal.h (NEW_CMP_OPT_MEMO): exclude struct cmp_opt_data from
-	  the valid array range.
+	* error.c (exit_initialize): use EXIT_SUCCESS instead of 0.
+	  [ruby-dev:23913]
 
-	* enum.c (slicewhen_i): exclude inverted too.
+	* error.c (exit_success_p): new method SystemExit#success?.
+	  [ruby-dev:23912]
 
-Thu May 19 21:21:57 2016  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+	* error.c (syserr_initialize): initialization for subclasses.
+	  [ruby-dev:23912]
 
-	* re.c (rb_reg_match_m_p): [DOC] fix return value in rdoc.
+Thu Jul 15 23:53:38 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/ruby/test_regexp.rb (TestRegexp#test_match_p): add some
-	  tests from document.
+	* lib/optparse.rb (OptionParser#warn, OptionParser#abort): Exception
+	  no longer has to_str method.
 
-Thu May 19 13:22:44 2016  Kazuki Yamaguchi  <k@rhe.jp>
+Thu Jul 15 22:59:48 2004  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* ext/openssl/ossl.c (Init_openssl): register an ex_data index for
-	  X509_STORE and X509_STORE_CTX respectively. Since they don't share
-	  the ex_data index registry, we can't use the same index.
-	  (ossl_verify_cb): use the the correct index.
+	* ext/readline/extconf.rb: added dir_config for curses, ncurses,
+	termcap. (backported from HEAD)
 
-	* ext/openssl/ossl_ssl.c (ossl_ssl_verify_callback): ditto.
+Thu Jul 15 20:29:15 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
 
-	* ext/openssl/ossl_x509store.c (ossl_x509store_set_vfy_cb): ditto.
-	  (ossl_x509stctx_verify): ditto.
+	* class.c, error.c, eval.c, intern.h, object.c, variable.c:
+	  do not set path if it is a singleton class.  [ruby-dev:22588]
+	  (backport from 1.9)
 
-	* ext/openssl/ossl.h (void ossl_clear_error): add extern declarations
-	  of ossl_store_{ctx_,}ex_verify_cb_idx.
+Thu Jul 15 10:15:04 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-	* ext/openssl/openssl_missing.c: remove X509_STORE_set_ex_data and
-	  X509_STORE_get_ex_data.
+	* ext/tk/, ext/tcltklib/: bug fix
 
-	* ext/openssl/openssl_missing.h: implement X509_STORE_get_ex_data,
-	  X509_STORE_set_ex_data and X509_STORE_get_ex_new_index as macros.
+	* ext/tk/lib/tk.rb: better operation for SIGINT when processing
+	  callbacks.
+	* ext/tk/lib/tk/msgcat.rb: ditto.
+	* ext/tk/lib/tk/variable.rb: ditto.
+	* ext/tk/lib/tk/timer.rb: ditto.
 
-Thu May 19 13:11:35 2016  Kazuki Yamaguchi  <k@rhe.jp>
+	* ext/tk/lib/tk/validation.rb: add Tk::ValidateConfigure.__def_validcmd
+	  to define validatecommand methods easier
 
-	* ext/openssl/ossl_x509attr.c (ossl_x509attr_set_value): check that the
-	  argument is an OpenSSL::ASN1::Data before converting to ASN1_TYPE.
-	  This fixes SEGV on OpenSSL::X509::Attribute#value=(non-asn1-value).
+	* ext/tk/lib/tk.rb (_genobj_for_tkwidget): support autoload Tk ext
+	  classes
 
-	* test/openssl/test_x509attr.rb: add tests for OpenSSL::X509::Attribute.
+	* ext/tk/lib/tk/canvas.rb and so on: remove the parent widget type
+	  check for items (e.g. canvas items; depends on the class) to
+	  avoid some troubles on Tk extension widget class definition.
 
-Thu May 19 12:10:10 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/tk/lib/tkextlib/: add Iwidget and TkTable extension support
 
-	* re.c (rb_reg_match_m_p): fix match against empty string.
-	  rb_str_offset returns the end when the position exceeds the
-	  length.  fix the range parameter of onig_search.
-	  [ruby-core:75604] [Bug #12394]
+	* ext/tk/sample/tkextlib/: add samples of Iwidget and TkTable
 
-Thu May 19 11:37:36 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* re.c (rb_reg_match_m_p): should return false if no match, as the
-	  document says.  [Feature #8110]
+Wed Jul 14 18:08:37 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
 
-Thu May 19 00:17:01 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* ext/openssl/ossl_asn1.c (ossl_asn1cons_to_der): fix type of
+	  argument. [ruby-dev:23891]
 
-	* re.c (reg_names_iter): specify capacify
+	* test/openssl/test_x509store.rb: prune tests for CRL checking
+	  unless X509::V_FLAG_CRL_CHECK is defined.
 
-Wed May 18 21:29:59 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+Wed Jul 14 12:29:07 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
 
-	* thread.c (recursive_list_access): a object id may be a Bignum.  so,
-	  the list must be a objhash, instead of a identhash.
-	  this fixes many test errors on mswin64 CI.
+	* util.c (ruby_strtod): should not convert string in the form of
+	  "-I.FE-X" which both "I" and "F" are ommitted. [ruby-dev:23883]
 
-Wed May 18 19:33:54 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* test/ruby/test_float.rb (test_strtod): add test for bug fix.
 
-	* re.c (rb_reg_match_m_p): Introduce Regexp#match?, which returns
-	  bool and doesn't save backref.
+Wed Jul 14 00:31:15 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
 
-Wed May 18 16:52:03 2016  Kazuki Yamaguchi  <k@rhe.jp>
+	* array.c: rdoc patch. merged patch from Johan Holmberg
+	  <holmberg@iar.se> [ruby-core:3170]
 
-	* ext/openssl/ossl_pkcs12.c (ossl_pkcs12_initialize): pop errors
-	  leaked by PKCS12_parse(). This is a bug in OpenSSL, which exists
-	  in the versions before the version 1.0.0t, 1.0.1p, 1.0.2d.
+Tue Jul 13 19:39:12 2004  akira yamada  <akira@ruby-lang.org>
 
-Wed May 18 16:04:54 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/uri/generic.rb (URI::Generic#merge_path):
+	  "URI('http://www.example.com/foo/..') + './'" should return
+	  "URI('http://www.example.com/')".  [ruby-list:39838]
+	  "URI('http://www.example.com/') + './foo/bar/..'" should return
+	  "URI('http://www.example.com/foo/')".  [ruby-list:39844]
 
-	* tool/downloader.rb (Downloader::RubyGems.download): verify gems
-	  only if RubyGems is 2.4 or later.  old RubyGems fails to verify
-	  almost all of bundled gems.
+	* test/uri/test_generic.rb (TestGeneric#test_merge): added tests.
 
-Wed May 18 14:52:38 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Jul 13 15:51:45 2004  Akinori MUSHA  <knu@iDaemons.org>
 
-	* string.c (rb_str_modify_expand): check integer overflow.
-	  [ruby-core:75592] [Bug #12390]
+	* lib/mkmf.rb (init_mkmf): Do not add $(libdir) to $LIBPATH in
+	   extmk mode.
 
-Wed May 18 13:11:44 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* lib/mkmf.rb (dir_config): Prepend a new library path instead of
+	  appending so it is tried first.
 
-	* re.c (match_ary_subseq): get subseq of match array without creating
-	  temporary array.
+Tue Jul 13 00:50:48 2004  Dave Thomas  <dave@pragprog.com>
 
-	* re.c (match_ary_aref): get element(s) of match array without creating
-	  temporary array.
+	* lib/rdoc/parsers/parse_rb.rb: Support call-seq: for Ruby files.
 
-	* re.c (match_aref): Use match_ary_subseq with handling irregulars.
+Mon Jul 12 21:20:36 2004  Dave Thomas  <dave@pragprog.com>
 
-	* re.c (match_values_at): Use match_ary_aref.
+	* html_generator.rb: Support hyperlinks of the form {any text}[xxx]
+	  as well as stuff[xxx]
 
-Wed May 18 13:03:07 2016  Kazuki Yamaguchi  <k@rhe.jp>
+Sat Jul 10 09:30:24 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-	* ext/openssl/ossl_x509cert.c (ossl_x509_verify): X509_verify()
-	  family may put errors on 0 return (0 means verification failure).
-	  Clear OpenSSL error queue before return to Ruby. Since the queue is
-	  thread global, remaining errors in the queue can cause an unexpected
-	  error in the next OpenSSL operation.  [ruby-core:48284] [Bug #7215]
+	* test/soap/marshal/test_struct.rb: use qualified build-tin class name
+	  (::Struct) to avoid name crash.
 
-	* ext/openssl/ossl_x509crl.c (ossl_x509crl_verify): ditto.
+Sat Jul 10 04:21:56 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-	* ext/openssl/ossl_x509req.c (ossl_x509req_verify): ditto.
+	* ext/tk/lib/tk.rb: better operation for SIGINT when processing
+	  callbacks.
+	* ext/tk/lib/tk/msgcat.rb: ditto.
+	* ext/tk/lib/tk/variable.rb: ditto.
+	* ext/tk/lib/tk/timer.rb: ditto.
 
-	* ext/openssl/ossl_x509store.c (ossl_x509stctx_verify): ditto.
+	* ext/tk/lib/tk/validation.rb (__def_validcmd):  add a module
+	  function of Tk::ValidateConfigure to define validatecommand
+	  methods easier
 
-	* ext/openssl/ossl_pkey_dh.c (dh_generate): clear the OpenSSL error
-	  queue before re-raising exception.
+Fri Jul  9 22:36:36 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
 
-	* ext/openssl/ossl_pkey_dsa.c (dsa_generate): ditto.
+	* array.c, enum.c, pack.c: rdoc patch from Johan Holmberg
+	  <holmberg@iar.se> [ruby-core:3132] [ruby-core:3136]
 
-	* ext/openssl/ossl_pkey_rsa.c (rsa_generate): ditto.
+	* numeric.c: rdoc patch.
 
-	* ext/openssl/ossl_ssl.c (ossl_start_ssl): ditto.
+Fri Jul  9 19:26:39 2004  Tanaka Akira  <akr@m17n.org>
 
-	* test/openssl: check that OpenSSL.errors is empty every time after
-	  running a test case.
+	* lib/open-uri.rb (URI::HTTPS#proxy_open): raise ArgumentError to
+	  notice https is not supported.
 
-Wed May 18 12:07:42 2016  Kazuki Yamaguchi  <k@rhe.jp>
+Fri Jul  9 14:28:54 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/openssl/ossl.c (ossl_clear_error): Extracted from
-	  ossl_make_error(). This prints errors in the OpenSSL error queue if
-	  OpenSSL.debug is true, and clears the queue.
-	  (ossl_make_error): use ossl_clear_error().
+	* eval.c (rb_thread_raise): accept third argument as well as
+	  Kernel#raise, and evaluate the arguments to create an exception in
+	  the caller's context.  [ruby-talk:105507]
 
-	* ext/openssl/ossl.h: add prototype declaration of ossl_make_error().
-	  (OSSL_BIO_reset) use ossl_clear_error() to clear the queue. Clearing
-	  silently makes debugging difficult.
+Fri Jul  9 01:47:08 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-	* ext/openssl/ossl_engine.c (ossl_engine_s_by_id): ditto.
+	* ext/tk/lib : bug fix
+	* ext/tk/lib/tkextlib/itcl : add [incr Tcl] support
+	* ext/tk/lib/tkextlib/itk  : add [incr Tk] support
+	* ext/tk/lib/tkextlib/iwidgets : midway point of [incr Widgets] support
+	* ext/tk/sample/tkextlib/iwidgets : very simple examples of
+	  [incr Widgets]
 
-	* ext/openssl/ossl_ns_spki.c (ossl_spki_initialize): ditto.
+Thu Jul  8 22:52:19 2004  Kouhei Sutou  <kou@cozmixng.org>
 
-	* ext/openssl/ossl_pkcs7.c (ossl_pkcs7_verify): ditto.
+	* lib/rss/{rss,parser,0.9,1.0,2.0}.rb: supported RSS 0.9x/2.0
+	  validation and validation which disregard order of elements.
+	* test/rss/test_parser.rb: added tests for RSS 0.9x/2.0
+	  validation.
+	* test/rss/{test_trackback,rss-testcase}.rb: fixed no good method
+	  name.
+
+Thu Jul  8 00:05:23 2004  akira yamada  <akira@ruby-lang.org>
+
+	* lib/tempfile.rb (Tempfile::initialize): got out code of
+	  generating tmpname.  [ruby-dev:23832][ruby-dev:23837]
+
+Wed Jul  7 15:53:14 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* string.c (rb_str_match): raise TypeError when both arguments are
+	  strings. [ruby-dev:22869] (backported from HEAD)
+
+	* string.c (rb_str_match2): removed.
+
+	* Makefile.in, bcc32/Makefile.sub, win32/Makefile.sub,
+	  wince/Makefile.sub (string.c): now not depend on version.h.
+
+Wed Jul  7 00:48:34 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* ext/tk/lib/tkextlib/tktrans.rb,
+	  ext/tk/lib/tkextlib/treectrl.rb: fix syntax errors.
+
+Tue Jul  6 18:38:45 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib : improve framework of developping Tcl/Tk extension
+	  wrappers
+
+Mon Jul  5 23:56:42 2004  Kouhei Sutou  <kou@cozmixng.org>
+
+	* lib/rss/{trackback,syndication,dublincore,content}.rb: worked
+	  with ruby 1.6 again.
+
+	* test/rss/rss-assertions.rb: ditto.
+
+Mon Jul  5 22:54:39 2004  Tanaka Akira  <akr@m17n.org>
+
+	* lib/uri/common.rb (Kernel#URI): new global method for parsing URIs.
+
+Mon Jul  5 09:02:52 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (rb_thread_yield, rb_f_catch): 4th argument to rb_yield_0()
+	  is a set of bit flags.  [ruby-dev:23859]
+
+Mon Jul  5 01:27:32 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* lib/drb/drb.rb(DRbConn self.open): If socket pool is full, close
+	  the socket whose last-access-time is oldest. (and add new one)
+	  [ruby-dev:23860]
+
+Sun Jul  4 12:24:50 2004  Kouhei Sutou  <kou@cozmixng.org>
+
+	* lib/rss/rss.rb: added copyright header.
+
+Sun Jul  4 00:24:40 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* added files
+	  * lib/soap/attachment.rb
+	  * lib/soap/header
+	  * lib/soap/mimemessage.rb
+	  * lib/soap/rpc/httpserver.rb
+	  * lib/wsdl/soap/cgiStubCreator.rb
+	  * lib/wsdl/soap/classDefCreator.rb
+	  * lib/wsdl/soap/classDefCreatorSupport.rb
+	  * lib/wsdl/soap/clientSkeltonCreator.rb
+	  * lib/wsdl/soap/driverCreator.rb
+	  * lib/wsdl/soap/mappingRegistryCreator.rb
+	  * lib/wsdl/soap/methodDefCreator.rb
+	  * lib/wsdl/soap/servantSkeltonCreator.rb
+	  * lib/wsdl/soap/standaloneServerStubCreator.rb
+	  * lib/wsdl/xmlSchema/enumeration.rb
+	  * lib/wsdl/xmlSchema/simpleRestriction.rb
+	  * lib/wsdl/xmlSchema/simpleType.rb
+	  * lib/xsd/codegen
+	  * lib/xsd/codegen.rb
+	  * sample/soap/authheader
+	  * sample/soap/raa2.4
+	  * sample/soap/ssl
+	  * sample/soap/swa
+	  * sample/soap/whois.rb
+	  * sample/soap/calc/samplehttpd.conf
+	  * sample/soap/exchange/samplehttpd.conf
+	  * sample/soap/sampleStruct/samplehttpd.conf
+	  * sample/wsdl/raa2.4
+	  * sample/wsdl/googleSearch/samplehttpd.conf
+	  * test/openssl/_test_ssl.rb
+	  * test/soap/header
+	  * test/soap/ssl
+	  * test/soap/struct
+	  * test/soap/swa
+	  * test/soap/wsdlDriver
+	  * test/wsdl/multiplefault.wsdl
+	  * test/wsdl/simpletype
+	  * test/wsdl/test_multiplefault.rb
+
+	* modified files
+	  * lib/soap/baseData.rb
+	  * lib/soap/element.rb
+	  * lib/soap/generator.rb
+	  * lib/soap/marshal.rb
+	  * lib/soap/netHttpClient.rb
+	  * lib/soap/parser.rb
+	  * lib/soap/processor.rb
+	  * lib/soap/property.rb
+	  * lib/soap/soap.rb
+	  * lib/soap/streamHandler.rb
+	  * lib/soap/wsdlDriver.rb
+	  * lib/soap/encodingstyle/handler.rb
+	  * lib/soap/encodingstyle/literalHandler.rb
+	  * lib/soap/encodingstyle/soapHandler.rb
+	  * lib/soap/mapping/factory.rb
+	  * lib/soap/mapping/mapping.rb
+	  * lib/soap/mapping/registry.rb
+	  * lib/soap/mapping/rubytypeFactory.rb
+	  * lib/soap/mapping/wsdlRegistry.rb
+	  * lib/soap/rpc/cgistub.rb
+	  * lib/soap/rpc/driver.rb
+	  * lib/soap/rpc/element.rb
+	  * lib/soap/rpc/proxy.rb
+	  * lib/soap/rpc/router.rb
+	  * lib/soap/rpc/soaplet.rb
+	  * lib/soap/rpc/standaloneServer.rb
+	  * lib/wsdl/data.rb
+	  * lib/wsdl/definitions.rb
+	  * lib/wsdl/operation.rb
+	  * lib/wsdl/parser.rb
+	  * lib/wsdl/soap/definitions.rb
+	  * lib/wsdl/xmlSchema/complexContent.rb
+	  * lib/wsdl/xmlSchema/complexType.rb
+	  * lib/wsdl/xmlSchema/data.rb
+	  * lib/wsdl/xmlSchema/parser.rb
+	  * lib/wsdl/xmlSchema/schema.rb
+	  * lib/xsd/datatypes.rb
+	  * lib/xsd/qname.rb
+	  * sample/soap/calc/httpd.rb
+	  * sample/soap/exchange/httpd.rb
+	  * sample/soap/sampleStruct/httpd.rb
+	  * sample/soap/sampleStruct/server.rb
+	  * sample/wsdl/amazon/AmazonSearch.rb
+	  * sample/wsdl/amazon/AmazonSearchDriver.rb
+	  * sample/wsdl/googleSearch/httpd.rb
+	  * test/soap/test_basetype.rb
+	  * test/soap/test_property.rb
+	  * test/soap/test_streamhandler.rb
+	  * test/soap/calc/test_calc.rb
+	  * test/soap/calc/test_calc2.rb
+	  * test/soap/calc/test_calc_cgi.rb
+	  * test/soap/helloworld/test_helloworld.rb
+	  * test/wsdl/test_emptycomplextype.rb
+	  * test/wsdl/axisArray/test_axisarray.rb
+	  * test/wsdl/datetime/test_datetime.rb
+	  * test/wsdl/raa/test_raa.rb
+	  * test/xsd/test_xmlschemaparser.rb
+	  * test/xsd/test_xsd.rb
+
+	* summary
+	  * add SOAP Header mustUnderstand support.
+
+	  * add HTTP client SSL configuration and Cookies support (works
+	    completely with http-access2).
+
+	  * add header handler for handling sending/receiving SOAP Header.
+
+	  * map Ruby's anonymous Struct to common SOAP Struct in SOAP Object
+	    Model.  it caused error.
+
+	  * add WSDL simpleType support to restrict lexical value space.
+
+	  * add SOAP with Attachment support.
+
+Sat Jul  3 17:19:44 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* ext/tk/lib/tkextlib/tkDND.rb: fix syntax error.
+
+Thu Jul  1 23:15:29 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/pstore.rb (transaction): safer backup scheme.  [ruby-list:39102]
+
+	* lib/pstore.rb (commit_new): use FileUtils.copy_stream for Cygwin.
+	  [ruby-dev:23157]
+
+	* lib/pstore.rb (transaction): allow overriding dump and load.
+	  [ruby-dev:23567]
+
+	* lib/pstore.rb (PStore#transaction): get rid of opening in write mode
+	  when read only transaction.  [ruby-dev:23842]
+
+	* lib/yaml/store.rb: follow lib/pstore.rb's change.
+
+Thu Jul  1 18:36:08 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tcltklib : bug fix
+
+	* ext/tk/lib/tk : bug fix and add Tcl/Tk extension support libraries
+
+Thu Jul  1 11:59:45 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/extconf.rb: check for EVP_CIPHER_CTX_copy, ENGINE_add,
+	  EVP_CIPHER_CTX_set_padding, EVP_CipherFinal_ex, EVP_CipherInit_ex,
+	  EVP_DigestFinal_ex and EVP_DigestInit_ex.
+
+	* ext/openssl/openssl_missing.c (EVP_CIPHER_CTX_copy): new function.
+
+	* ext/openssl/openssl_missing.h (EVP_DigestInit_ex, EVP_DigestFinal_ex,
+	  EVP_CipherInit_ex, EVP_CipherFinal_ex, HMAC_Init_ex): new macro for
+	  OpenSSL 0.9.6.
+
+	* ext/openssl/ossl_cipher.c (ossl_cipher_encrypt, ossl_cipher_decrypt):
+	  re-implemnt (the arguments for this method is ).
+
+	* ext/openssl/ossl_cipher.c (ossl_cipher_pkcs5_keyivgen): new method
+	  OpenSSL::Cipher::Cipher#pkcs5_keyivgen. it calls EVP_BytesToKey().
+
+	* ext/openssl/ossl_cipher.c (ossl_cipher_alloc, ossl_cipher_initialize,
+	  ossl_cipher_copy, ossl_cipher_reset ossl_cipher_final,
+	  ossl_cipher_set_key, ossl_cipher_set_iv): replace all EVP_CipherInit
+	  and EVP_CipherFinal into EVP_CipherInit_ex and EVP_CipherFinal_ex.
+	  and EVP_CIPHER_CTX_init should only be called once.
+
+	* ext/openssl/ossl_cipher.c (ossl_cipher_set_key_length): new method
+	  OpenSSL::Cipher::Cipher#key_len=.
+
+	* ext/openssl/ossl_cipher.c (ossl_cipher_init_deprecated): new
+	  finction; print warning for Cipher#<<.
+
+	* ext/openssl/ossl_digest.c: replace all EVP_DigestInit and
+	  EVP_DigestFinal into EVP_DigestInit_ex and EVP_DigestFinal_ex.
+	  and EVP_MD_CTX_init should only be called once.
+
+	* ext/openssl/ossl_digest.c (digest_final): should call
+	  EVP_MD_CTX_cleanup to avoid memory leak.
+
+	* ext/openssl/ossl_hmac.c (ossl_hmac_initialize): repalce HMAC_init
+	  into HMAC_init_ex. and HMAC_CTX_init is moved to ossl_hmac_alloc.
+
+	* ext/openssl/ossl_hmac.c (hmac_final): should call
+	  HMAC_CTX_cleanup to avoid memory leak.
+
+	* test/openssl/test_cipher.rb, test/openssl/test_digest.rb,
+	  test/openssl/test_hmac.rb: new file.
+
+Thu Jul  1 04:08:30 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/ossl_asn1.c (ossl_i2d_ASN1_TYPE, ossl_ASN1_TYPE_free):
+	  workaround for the versions earlier than OpenSSL-0.9.7.
+
+Thu Jul  1 03:33:55 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/ossl_pkey_dh.c (ossl_dh_initialize): should create
+	  empty pkey object if no argument is passed. [ruby-talk:103328]
 
 	* ext/openssl/ossl_pkey_dsa.c (ossl_dsa_initialize): ditto.
 
-	* ext/openssl/ossl_pkey_ec.c (ossl_ec_key_initialize): ditto.
-	  (ossl_ec_group_initialize): ditto.
+	* ext/openssl/ossl_pkey_rsa.c (ossl_rsa_initialize): ditto.
 
-	* ext/openssl/ossl_ssl.c (ossl_ssl_shutdown): ditto.
+	* ext/openssl/ossl_pkey_dh.c: add new methods: OpenSSL::PKey::DH#p,
+	  OpenSSL::PKey::DH#p=, OpenSSL::PKey::DH#g, OpenSSL::PKey::DH#g=,
+	  OpenSSL::PKey::DH#pub_key, OpenSSL::PKey::DH#pub_key=,
+	  OpenSSL::PKey::DH#priv_key and OpenSSL::PKey::DH#priv_key=.
 
-Wed May 18 11:53:49 2016  Kazuki Yamaguchi  <k@rhe.jp>
+	* ext/openssl/ossl_pkey_dsa.c: add new methods: OpenSSL::PKey::DSA#p,
+	  OpenSSL::PKey::DSA#p=, OpenSSL::PKey::DSA#q, OpenSSL::PKey::DSA#q=,
+	  OpenSSL::PKey::DSA#g, OpenSSL::PKey::DSA#g=,
+	  OpenSSL::PKey::DSA#pub_key, OpenSSL::PKey::DSA#pub_key=,
+	  OpenSSL::PKey::DSA#priv_key and OpenSSL::PKey::DSA#priv_key=.
 
-	* ext/openssl/ossl_pkey_ec.c (ossl_ec_point_mul): Validate the
-	  arguments before passing to EC_POINT(s)_mul(). Add description of this
-	  method.  [ruby-core:65152] [Bug #10268]
+Thu Jul  1 03:16:09 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
 
-	* test/openssl/test_pkey_ec.rb (test_ec_point_mul): Test that
-	  OpenSSL::PKey::EC::Point#mul works.
+	* ext/openssl/ossl_ssl.c (ossl_ssl_read): take optional second argument
+	  to specify a string to be written.
 
-Wed May 18 11:19:59 2016  Kazuki Yamaguchi  <k@rhe.jp>
+	* ext/openssl/lib/openssl/buffering.rb (OpenSSL::Buffering#read):
+	  take optional second argument to specify a string to be written.
 
-	* ext/openssl/ossl_bn.c (try_convert_to_bnptr): Extracted from
-	  GetBNPtr(). This doesn't raise exception but returns NULL on error.
-	  (GetBNPtr): Raise TypeError if conversion fails.
-	  (ossl_bn_eq): Implement BN#==.
-	  (ossl_bn_eql): #eql? should not raise TypeError even if the argument
-	  is not compatible with BN.
-	  (ossl_bn_hash): Implement BN#hash.
+	* ext/openssl/lib/openssl/buffering.rb (OpenSSL::Buffering#gets):
+	  refine regexp for end-of-line.
 
-	* ext/openssl/ossl_bn.c (Init_ossl_bn): Define #== and #hash.
+	* ext/opnessl/lib/openssl/ssl.rb
+	  (OpenSSL::SSL::SocketForwarder#listen): fix typo.
 
-	* test/openssl/test_bn.rb: Test BN#eql?, #== and #hash
+Wed Jun 30 11:38:51 2004  Mikael Brockman  <phubuh@phubuh.org>
 
-Wed May 18 10:17:41 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* parse.y (primary): should not be NULL.  [ruby-core:03098]
 
-	* include/ruby/ruby.h (RB_INTEGER_TYPE_P): new macro and
-	  underlying inline function to check if the object is an
-	  Integer (Fixnum or Bignum).
+Wed Jun 30 02:53:24 2004  why the lucky stiff  <why@ruby-lang.org>
 
-Wed May 18 09:52:00 2016  Kenta Murata  <mrkn@mrkn.jp>
+	* ext/syck/rubyext.c (syck_emitter_new): set buffer after
+	  Data_Wrap_Struct to avoid possible GC. [ruby-talk:104835]
 
-	* enum.c (enum_sum, hash_sum, hash_sum_i, enum_sum_i, sum_iter):
-	  Optimize for hashes when each method isn't redefined.
+Tue Jun 29 10:31:19 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed May 18 09:14:00 2016  Kenta Murata  <mrkn@mrkn.jp>
+	* eval.c (rb_eval_cmd, rb_thread_trap_eval): restore safe level.
 
-	* enum.c (enum_sum, int_range_sum): Extract int_range_sum from
-	  enum_sum.
+	* gc.c (define_final, run_final): preserve and restore safe level for
+	  finalizers.  [ruby-core:03058]
 
-Wed May 18 03:16:06 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* signal.c (signal_exec, rb_trap_exit, trap): preserve and restore
+	  safe level for signal handlers.  [ruby-dev:23829]
 
-	* re.c (match_values_at): fix regression at r55036.
-	  MatchData#values_at accepts Range.
+Mon Jun 28 14:57:56 2004  Jeff Mitchell  <quixoticsycophant@yahoo.com>
 
-Wed May 18 02:02:58 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* configure.in, lib/mkmf.rb (LIBPATHFLAG): use double quotes due to
+	  DOSISH compilers.  [ruby-core:03107]
 
-	* re.c (match_aref): remove useless condition and call rb_fix2int.
-	  rb_reg_nth_match handles negative index.
+Mon Jun 28 00:30:19 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
 
-Wed May 18 01:57:43 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* sample/drb/*.rb: using 'DRb.thread.join' instead of 'gets'
 
-	* re.c (match_values_at): MatchData#values_at supports named captures
-	  [Feature #9179]
+Sun Jun 27 22:39:51 2004  Kouhei Sutou  <kou@cozmixng.org>
 
-	* re.c (namev_to_backref_number): separated.
+	* sample/rss/tdiary_plugin/rss-recent.rb: supported Hiki.
 
-Wed May 18 00:05:00 2016  Kenta Murata  <mrkn@mrkn.jp>
+Sun Jun 27 12:19:46 2004  Kouhei Sutou  <kou@cozmixng.org>
 
-	* enum.c (enum_sum): Optimize for a range from int to int.
+	* {lib,sample,test}/rss: added RSS Parser. [ruby-dev:23780]
 
-	* test/ruby/test_enum.rb (test_range_sum): Move from test_range.rb,
-	  and add assertions for some conditions.
+Sat Jun 26 11:07:30 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/ruby/test_enum.rb (test_hash_sum): Move from test_hash.rb.
+	* configure.in (aix): -b must come at the start of the command line,
+	  and -e must not appear while testing libraries.  [ruby-talk:104501]
 
-	* test/ruby/test_hash.rb, test/ruby/test_range.rb: Remove test_sum.
+	* lib/mkmf.rb (dir_config): quote directory names if necessary.
+	  [ruby-talk:104505]
 
-Tue May 17 23:08:00 2016  Kenta Murata  <mrkn@mrkn.jp>
+Fri Jun 25 15:33:19 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* enum.c (enum_sum): [DOC] Write documentation.
+	* ext/iconv/extconf.rb: check stricter.  [ruby-talk:104501]
 
-Tue May 17 22:53:00 2016  Kenta Murata  <mrkn@mrkn.jp>
+	* ext/iconv/extconf.rb: include iconv.h for libiconv.  [ruby-dev:22715]
 
-	* enum.c (enum_sum): Implement Enumerable#sum.
+Fri Jun 25 08:31:29 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* test/ruby/test_enum.rb (test_sum): Test sum for Enumerable.
+	* eval.c (rb_thread_atfork): remove "fork terminates thread"
+	  warning.  [ruby-dev:23768]
 
-	* test/ruby/test_hash.rb (test_sum): Test sum for Hash.
+	* object.c (rb_obj_clone): backport FL_FINALIZE patch from 1.9.
+	  [ruby-core:02786][ruby-core:03067]
 
-	* test/ruby/test_range.rb (test_sum): Test sum for Range.
+	* ext/socket/socket.c (sock_sockaddr): Socket#gethostbyname()
+	  should give us packed address, not struct sockaddr.
+	  [ruby-core:03053]
 
-Tue May 17 22:11:41 2016  Tanaka Akira  <akr@fsij.org>
+Fri Jun 25 02:04:23 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* object.c, numeric.c, enum.c, ext/-test-/bignum/mul.c,
-	  lib/rexml/quickpath.rb, lib/rexml/text.rb, lib/rexml/xpath_parser.rb,
-	  lib/rubygems/specification.rb, lib/uri/generic.rb,
-	  bootstraptest/test_eval.rb, basictest/test.rb,
-	  test/-ext-/bignum/test_big2str.rb, test/-ext-/bignum/test_div.rb,
-	  test/-ext-/bignum/test_mul.rb, test/-ext-/bignum/test_str2big.rb,
-	  test/csv/test_data_converters.rb, test/date/test_date.rb,
-	  test/json/test_json_generate.rb, test/minitest/test_minitest_mock.rb,
-	  test/openssl/test_cipher.rb, test/rexml/test_jaxen.rb,
-	  test/ruby/test_array.rb, test/ruby/test_basicinstructions.rb,
-	  test/ruby/test_bignum.rb, test/ruby/test_case.rb,
-	  test/ruby/test_class.rb, test/ruby/test_complex.rb,
-	  test/ruby/test_enum.rb, test/ruby/test_eval.rb,
-	  test/ruby/test_iseq.rb, test/ruby/test_literal.rb,
-	  test/ruby/test_math.rb, test/ruby/test_module.rb,
-	  test/ruby/test_numeric.rb, test/ruby/test_range.rb,
-	  test/ruby/test_rational.rb, test/ruby/test_refinement.rb,
-	  test/ruby/test_rubyvm.rb, test/ruby/test_struct.rb,
-	  test/ruby/test_variable.rb, test/rubygems/test_gem_specification.rb,
-	  test/thread/test_queue.rb: Use Integer instead of Fixnum and Bignum.
+	* {bcc32,win32,wince}/setup.mak: remove RUBY_EXTERN lines when
+	  including version.h. [ruby-talk:104456] (backported from HEAD)
 
-Tue May 17 15:26:10 2016  Tanaka Akira  <akr@fsij.org>
+Thu Jun 24 14:23:29 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* [Feature #12005] Unify Fixnum and Bignum into Integer
+	* io.c (rb_io_fread): return already read data when system call is
+	  interrupted.  [ruby-talk:97206]
 
-	* include/ruby/ruby.h (rb_class_of): Return rb_cInteger for fixnums.
+Thu Jun 24 01:32:43 2004  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* insns.def (INTEGER_REDEFINED_OP_FLAG): Unified from
-	  FIXNUM_REDEFINED_OP_FLAG and BIGNUM_REDEFINED_OP_FLAG.
+	* version.h: added declarations of ruby_version,
+	  ruby_release_date, ruby_platform.
+	  (backported from HEAD)
 
-	* vm_core.h: Ditto.
+Wed Jun 23 22:23:37 2004  Dave Thomas  <dave@pragprog.com>
 
-	* vm_insnhelper.c (opt_eq_func): Use INTEGER_REDEFINED_OP_FLAG instead
-	  of FIXNUM_REDEFINED_OP_FLAG.
+	* ext/socket/socket.c (sock_s_gethostbyaddr): Work around problem
+	  with OS X not returning 'from' parameter to recvfrom for
+	  connection-oriented sockets.
 
-	* vm.c (vm_redefinition_check_flag): Use rb_cInteger instead of
-	  rb_cFixnum and rb_cBignum.
-	  (C): Use Integer instead of Fixnum and Bignum.
+Wed Jun 23 01:45:27 2004  Dave Thomas  <dave@pragprog.com>
 
-	* numeric.c (fix_succ): Removed.
-	  (Init_Numeric): Define Fixnum as Integer.
+	* lib/rdoc/parsers/parse_rb.rb (RubyLex::identify_quotation):
+	  Fix problem with the 'r' being dropped from %r{xxx}
 
-	* bignum.c (bignew): Use rb_cInteger instead of rb_cBignum.
-	  (rb_int_coerce): replaced from rb_big_coerce and return fixnums
-	  as-is.
-	  (Init_Bignum): Define Bignum as Integer.
-	  Don't define ===.
+Wed Jun 23 00:20:20 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
 
-	* error.c (builtin_class_name): Return "Integer" for fixnums.
+	* ext/win32ole/win32ole.c (ole_hresult2msg): remove trailing
+	  CRs and LFs. (doesn't depend on CR+LF) [ruby-dev:23749]
 
-	* sprintf.c (ruby__sfvextra): Use rb_cInteger instead of rb_cFixnum.
+Wed Jun 23 00:00:25 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/-test-/testutil: New directory to test.
-	  Currently it provides utilities for fixnum and bignum.
+	* io.c (rb_io_initialize): should check fcntl result.  [ruby-dev:23742]
 
-	* ext/json/generator/generator.c: Define mInteger_to_json.
+Tue Jun 22 21:11:36 2004  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
 
-	* lib/mathn.rb (Fixnum#/): Redefinition removed.
+	* ext/win32ole/win32ole.c (OLE_FREE): should not call CoFreeUnuse-
+	  dLibraries().
 
-Tue May 17 11:58:58 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/win32ole/win32ole.c (ole_event_free): ditto.
 
-	* configure.in (RUBY_CHECK_BUILTIN_SETJMP): declare t as NORETURN
-	  to suppress warnings by -Wsuggest-attribute=noreturn.
-	  [ruby-core:75510] [Bug #12383]
+	* ext/win32ole/win32ole.c (ole_hresult2msg): truncate error message
+	  before CR.
 
-Tue May 17 10:40:18 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Jun 22 16:47:42 2004  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* configure.in (RUBY_CHECK_SETJMP): needs the header and proper
-	  arguments for builtin setjmp functions.
+	* lib/net/ftp.rb (MDTM_REGEXP): fix for demon's ftp server.
+	Thanks, Rutger Nijlunsing.
 
-Mon May 16 20:00:30 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Mon Jun 21 10:19:23 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* enc/unicode.h: Additional uses of ONIG_CASE_MAPPING compilation switch
+	* win32/win32.c (rb_w32_opendir): use FindFirstFile()/FindNextFile()/
+	  FindClose() instead of _findfirst()/_findnext()/_findclose().
+	  merge from HEAD.
 
-Mon May 16 19:46:33 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Sat Jun 19 13:24:15 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* include/ruby/oniguruma.h: Introducing ONIG_CASE_MAPPING compilation
-	  switch
+	* eval.c (method_call): allow changing $SAFE.  [ruby-dev:23713]
 
-	* include/ruby/oniguruma.h, enc/unicode.h: Using ONIG_CASE_MAPPING
-	  compilation switch
+Fri Jun 18 23:12:22 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon May 16 19:29:31 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* eval.c (proc_save_safe_level, rb_set_safe_level, safe_setter): limit
+	  safe level.
 
-	* gems/bundled_gems: Update xmlrpc-0.1.1. xmlrpc-0.1.0 didn't allow
-	  to install on 2.4.0dev.
+Wed Jun 16 23:05:57 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Mon May 16 13:28:59 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* object.c (rb_mod_freeze): prepare string representation before
+	  freezing. [ruby-talk:103646]
 
-	* configure.in (FUNC_STDCALL, FUNC_CDECL, FUNC_FASTCALL): set
-	  macro names explicitly to the old names, which are accidentally
-	  changed at r54985, for backward compatibilities.
-	  fiddle also depends on these names to fallback to ANSI names.
-	  [ruby-core:75494] [Bug #12377]
+Wed Jun 16 16:04:40 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon May 16 11:39:02 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* object.c (rb_mod_le): singleton class inherits Class rather than its
+	  object's class.  [ruby-dev:23690]
 
-	* lib/xmlrpc.rb, lib/xmlrpc/*, test/xmlrpc: XMLRPC is bundled gem
-	  on Ruby 2.4. It is extracted to https://github.com/ruby/xmlrpc
-	  [Feature #12160][ruby-core:74239]
-	* gems/bundled_gems: ditto.
+Wed Jun 16 16:01:17 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon May 16 06:06:21 2016  Eric Wong  <e@80x24.org>
+	* gc.c (stack_grow_direction): memoize the direction.
 
-	* proc.c: fix RDoc of Proc#===/call/yield/[]
-	  [Bug #12332]
+	* gc.c (Init_stack): should always move to end of VALUE.
 
-Sun May 15 20:55:31 2016  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+Tue Jun 15 12:10:04 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-	* lib/drb/timeridconv.rb: don't use keeper thread. [Bug #12342]
+	* ext/tk/lib/tk.rb: bug fix (TkWindow#grab)
 
-	* test/drb/ut_timerholder.rb: ditto.
+Mon Jun 14 18:23:27 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-Sun May 15 16:15:25 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* ext/tk/lib/remote-tk.rb: bug fix
 
-	* array.c (rb_ary_entry): extract rb_ary_elt to organize if-conditions
-	  and check whether is embedded at once.
+Sun Jun 13 00:23:04 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-Sun May 15 10:57:26 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/tcltklib/extconf.rb: [EXPERIMENTAL] MacOS X (darwin) support
 
-	* vm_insnhelper.c (vm_get_ev_const): warn deprecated constant even
-	  in the class context.  [ruby-core:75505] [Bug #12382]
+	* ext/tcltklib/tcltklib.c: fix thread trouble on callback proc, and
+	  eliminate warning about instance variable access
 
-Sun May 15 03:13:01 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* ext/tk/lib/tk/menubar.rb: improve supported menu_spec
 
-	* iseq.h (struct iseq_compile_data): use struct rb_id_table
-	  instead of st_table.
+	* ext/tk/lib/tk/menuspec.rb: [add] menu_spec support library
 
-	* iseq.c (prepare_iseq_build): don't allocate ivar_cache_table
-	  until it has at least one element.
+	* ext/tk/lib/tk/root.rb: add menu_spec support
 
-	* iseq.c (compile_data_free): free ivar_cache_table only if it
-	  is allocated.
+	* ext/tk/lib/tk/text.rb: bug fix
 
-	* compile.c (get_ivar_ic_value): allocate if the table is not
-	  allocated yet.
+	* ext/tk/lib/tk/toplevel.rb: add menu_spec support
 
-Sat May 14 09:04:34 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/tk/sample/menubar?.rb: [add] sample of menu_spec usage
 
-	* lib/mkmf.rb (pkg_config): use xsystem consistently to set up
-	  library path environment variable as well as latter pkg-config
-	  calls.  [ruby-dev:49619] [Bug #12379]
+Sat Jun 12 11:15:53 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
 
-Sat May 14 00:16:54 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* configure.in (target_os): strip -gnu suffix on Linux.
 
-	* random.c (make_seed_value): append leading-zero-guard and get
-	  rid of making a local copy of the seed.
+Fri Jun 11 17:08:21 2004  Akinori MUSHA  <knu@iDaemons.org>
 
-Fri May 13 08:46:42 2016  cremno  <cremno@mail.ru>
+	* config.guess: Restore a wrongly removed hyphen.
 
-	* NEWS: drop FreeBSD < 4 support.  [Fix GH-1339]
-	  The most recent version affected by this is 3.5 and was released
-	  in 2000.
-	  https://www.freebsd.org/releases/3.5R/announce.html
-	  https://en.wikipedia.org/wiki/History_of_FreeBSD#Version_history
+Fri Jun 11 14:30:08 2004  Akinori MUSHA  <knu@iDaemons.org>
 
-Fri May 13 03:12:09 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* config.guess: Attempt to avoid system name change on
+	  Darwin platforms also.
 
-	* include/ruby/defines.h (GCC_VERSION_SINCE): moved from internal.h.
+Fri Jun 11 14:22:45 2004  Akinori MUSHA  <knu@iDaemons.org>
 
-Fri May 13 03:11:20 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* config.guess, config.sub: Attempt to avoid system name change on
+	  Linux platforms.  We have been using "linux" instead of
+	  "linux-gnu" on this branch.
 
-	* configure.in (__builtin_constant_p): check.
+Thu Jun 10 19:19:41 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* internal.h: Use HAVE_BUILTIN___BUILTIN_CONSTANT_P
+	* ext/sdbm/init.c (fsdbm_store): sdbm should use StringValue().
+	  [ruby-talk:103062]
 
-Fri May 13 03:10:39 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+Wed Jun  9 18:04:14 2004  akira yamada  <akira@ruby-lang.org>
 
-	* configure.in: use alternative keyword
-	  to avoid macros conflicts with them.
+	* lib/uri/generic.rb (URI::Generic::merge,
+	  URI::Generic::route_from): accepts non-hierarchical URI.
+	  [ruby-dev:23631]
 
-Thu May 12 01:54:08 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/uri/test_generic.rb (TestGeneric::test_route,
+	  TestGeneric::test_merge): added tests for above changes.
 
-	* lib/mkmf.rb (try_func): get rid of conflict of declarations of
-	  main().  checking local symbol reference does not make sense.
+Wed Jun  9 17:39:37 2004  Akinori MUSHA  <knu@iDaemons.org>
 
-Thu May 12 00:18:19 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* config.guess, config.sub: Update to a more recent version as of
+	  2004-01-20.
 
-	* win32/Makefile.sub (HAVE_QSORT_S): use qsort_s only for Visual Studio
-	  2012 or later, because VS2010 seems to causes a SEGV in
-	  test/ruby/test_enum.rb.
+	* configure.in: Add support for DragonFly BSD.
 
-Wed May 11 23:59:47 2016  Masaya Tarui  <tarui@ruby-lang.org>
+Wed Jun  2 20:16:03 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* vm_insnhelper.c (vm_getivar): describe fast-path explicit
-	  (compiler friendly). [Bug #12274].
+	* string.c (str_new4): should share shared instance if it already
+	  exists.  [ruby-dev:23665]
 
-Wed May 11 21:30:07 2016  Masaya Tarui  <tarui@ruby-lang.org>
+Wed Jun  2 12:41:53 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* compile.c (iseq_compile_each): share InlineCache during same
-	  instance variable accesses. Reducing memory consumption,
-	  rising cache hit rate and rising branch prediction hit rate
-	  are expected. A part of [Bug #12274].
+	* io.c (rb_io_gets_m): set lastline ($_) even when read line is
+	  nil.  [ruby-dev:23663]
 
-	* iseq.h (struct iseq_compile_data): introduce instance
-	  variable IC table for sharing.
+Fri May 28 11:20:31 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* iseq.c (prepare_iseq_build, compile_data_free):
-	  construct/destruct above table.
+	* eval.c (rb_eval): bad influence on frame node.
 
-Wed May 11 17:18:53 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* eval.c (eval): reverted wrongly removed condition.  [ruby-dev:23638]
 
-	* util.c (ruby_qsort): use qsort_s if available, for Microsoft
-	  Visual Studio 2005 (msvcr80.dll) and mingw.
+Thu May 27 23:15:18 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-Wed May 11 10:33:26 2016  Marcus Stollsteimer  <sto.mar@web.de>
+	* lib/logger.rb: leading 0 padding of timestamp usec part.
 
-	* COPYING: Remove trailing-whitespaces.
-	  [ci skip][fix GH-1348]
+	* lib/csv.rb (CSV.parse): [CAUTION] behavior changed.  in the past,
+	  CSV.parse accepts a filename to be read-opened (it was just a
+	  shortcut of CSV.open(filename, 'r')).  now CSV.parse accepts a
+	  string or a stream to be parsed e.g.
+	  CSV.parse("1,2\n3,r") #=> [['1', '2'], ['3', '4']]
 
-Tue May 10 21:05:45 2016  Benoit Daloze  <eregontp@gmail.com>
+	* lib/csv.rb: CSV::Row and CSV::Cell are deprecated.  these classes
+	  are removed in the future.  in the new csv.rb, row is represented
+	  as just an Array.  since CSV::Row was a subclass of Array, it won't
+	  hurt almost all programs except one which depended CSV::Row#match.
+	  and a cell is represented as just a String or nil(NULL).  this
+	  change will cause widespread destruction.
 
-	* insns.def (defineclass): Also raise an error when redeclaring the
-	  superclass of a class as Object and it has another superclass.
-	  [Bug #12367] [ruby-core:75446]
+	      CSV.open("foo.csv", "r") do |row|
+		row.each do |cell|
+		  if cell.is_null       # using Cell#is_null
+		    p "(NULL)"
+		  else
+		    p cell.data         # using Cell#data
+		  end
+		end
+	      end
 
-	* test/ruby/test_class.rb: test for above.
+	    must be just;
 
-Tue May 10 14:57:09 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	      CSV.open("foo.csv", "r") do |row|
+		row.each do |cell|
+		  if cell.nil?
+		    p "(NULL)"
+		  else
+		    p cell
+		  end
+		end
+	      end
 
-	* random.c (obj_random_bytes): base on bytes method instead of
-	  rand method, not to call toplevel rand method.
+	* lib/csv.rb: [CAUTION] record separator(CR, LF, CR+LF) behavior
+	  change.  CSV.open, CSV.parse, and CSV,generate now do not force
+	  opened file binmode.  formerly it set binmode explicitly.
 
-Tue May 10 13:07:28 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	  with CSV.open, binmode of opened file depends the given mode
+	  parameter "r", "w", "rb", and "wb".  CSV.parse and CSV.generate open
+	  file with "r" and "w".
 
-	* configure.in (-fexcess-precision=standard): before r54895 -std=c99
-	  is specified and it implied -fexcess-precision=standard.
-	  Now with -std=gnu99, it should be explicitly specified.
-	  https://gcc.gnu.org/onlinedocs/gcc/Optimize-Options.html
+	  setting mode properly is user's responsibility now.
 
-Mon May  9 10:51:59 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/csv.rb: accepts String as a fs (field separator/column separator)
+	  and rs (record separator/row separator)
 
-	* thread.c (rb_thread_atfork_internal): move th to an argument.
+	* lib/csv.rb (CSV.read, CSV.readlines): added.  works as IO.read and
+	  IO.readlines in CSV format.
 
-	* thread.c (rb_thread_atfork): do not repeat GET_THREAD().
+	* lib/csv.rb: added CSV.foreach(path, rs = nil, &block).  CSV.foreach
+	  now does not handle "| cmd" as a path different from IO.foreach.
+	  needed?
 
-Mon May  9 10:46:36 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/csv/test_csv.rb: updated.
 
-	* thread.c (rb_thread_atfork, rb_thread_atfork_before_exec): do
-	  nothing unless working fork is available.
+	* test/ruby/test_float.rb: added test_strtod to test Float("0").
 
-	* thread_sync.c (rb_mutex_abandon_all): define only if working
-	  fork is available.
+Thu May 27 21:37:50 2004  Tanaka Akira  <akr@m17n.org>
 
-	* thread_sync.c (rb_mutex_abandon_keeping_mutexes): ditto.
+	* lib/pathname.rb (Pathname#initialize): refine pathname initialization
+	  by pathname.
 
-	* thread_sync.c (rb_mutex_abandon_locking_mutex): ditto.
+Thu May 27 20:22:05 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
 
-	* thread_win32.c (gvl_init): never used.
+	* io.c (rb_io_fwrite): check all case errno != 0 [ruby-dev:23648]
 
-Mon May  9 07:18:06 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+Thu May 27 14:53:13 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
 
-	* include/ruby/{defines,ruby}.h: need to define function attributes
-	  alternatives in defines.h instead of ruby.h, because they are used
-	  in oniguruma.h and the header used without including ruby.h at
-	  encoding library sources.
+	* io.c (rb_io_fwrite): workaround for bcc32's fwrite bug.
+	  add errno checking.  [ruby-dev:23627]
 
-Mon May  9 06:30:12 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+Wed May 26 14:19:42 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* include/ruby/ruby.h (CONSTFUNC, PUREFUNC): fixed build errors on
-	  non-gcc build environments introduced at r54952.
+	* eval.c (rb_eval, eval): make line number consistent on eval with
+	  Proc.  [ruby-talk:101253]
 
-Mon May  9 02:51:51 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+Wed May 26 13:59:17 2004  Dave Thomas  <dave@pragprog.com>
 
-	* gc.c (rb_gc_unprotect_logging): throw rb_memerror when it cannot
-	  allocate memory. This is pointed out by Facebook's Infer.
+	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::skip_for_variable): Allow for
+	  'do' after for statement
 
-	* gc.c (gc_prof_setup_new_record): ditto.
+Wed May 26 13:56:03 2004  Dave Thomas  <dave@pragprog.com>
 
-	* regparse.c (parse_regexp): ditto.
+	* lib/rdoc/generators/html_generator.rb (Generators::MarkUp::style_url): Fix
+	  relative path to code CSS file
 
-	* util.c (MALLOC): use xmalloc and xfree like above.
+Wed May 26 13:14:52 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon May  9 02:39:16 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* io.c (rb_io_init_copy): copy also positions.  [ruby-talk:100910]
 
-	* configure.in: check function attribute const and pure,
-	  and define CONSTFUNC and PUREFUNC if available.
-	  Note that I don't add those options as default because
-	  it still shows many false-positive (it seems not to consider
-	  longjmp).
+Wed May 26 00:00:00 2004  why the lucky stiff  <why@ruby-lang.org>
 
-	* vm_eval.c (stack_check): get rb_thread_t* as an argument
-	  to avoid duplicate call of GET_THREAD().
+	* ext/syck/syck.c (syck_new_parser): clear parser on init.
+	  thanks, ts. [ruby-core:02931]
 
-Sun May  8 21:01:14 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* ext/syck/token.c (sycklex_yaml_utf8): buffer underflow.
+	  thanks, ts. [ruby-core:02929]
 
-	* ext/openssl/extconf.rb: assume it doesn't have SSLv2 related
-	  functions when OPENSSL_NO_SSL2 is defined.
-	  Usually openssl's header and the library (libssl) have the same
-	  set of functions, but on some environment the library has functions
-	  whose headers doesn't declare. (openssl/opensslconf.h and libssl.so
-	  aren't be synchronized)
-	  To detect such case explicitly check feature macro and remove
-	  related functions.
+	* lib/yaml/baseemitter.rb (indent_text): simpler flow block code.
 
-Sun May  8 18:51:33 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/yaml.rb: added rdoc to beginning of lib.
 
-	* file.c (rb_home_dir_of): return the default home path if the
-	  user name is the current user name, on platforms where struct
-	  pwd is not supported.  a temporary measure against
-	  [Bug #12226].
+Mon May 24 10:46:26 2004  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
 
-Sun May  8 08:51:38 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* lib/rdoc/generators/template/html/html.rb: SYSTEM identifiers
+	  must be absolute URIs
 
-	* configure.in: add -Wsuggest-attribute=format and suppress warnings.
+Sat May 22 12:00:04 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun May  8 08:31:03 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* MANIFEST: add new encodings in rexml.
 
-	* configure.in: add -Wsuggest-attribute=noreturn and suppress warnings.
+	* ext/tk/MANIFEST: add recent files.
 
-Sun May  8 08:19:16 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+Sat May 22 05:37:11 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-	* configure.in: add -Werror=implicit-int to avoid missing type of
-	  function declaration.
+	* ext/tk/lib/remote-tk.rb: (NEW library) controll Tk interpreters
+	  on the other processes by Tcl/Tk's 'send' command
 
-Sat May  7 22:22:37 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+Fri May 21 09:22:05 2004  Dave Thomas  <dave@pragprog.com>
 
-	* lib/webrick/ssl.rb: Accept string value for SSLCertName. It is used
-	  to invoke ssl server with command line.
-	  [fix GH-1329] Patch by @kerlin
-	* test/webrick/test_ssl_server.rb: Added test for GH-1329
+	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_method_parameters):
+	  Add ()'s around parameters that don't have them
 
-Sat May  7 21:55:12 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+Thu May 20 17:02:03 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/webrick/test_ssl_server.rb: Added basic test for `webrick/ssl`
+	* lib/mkmf.rb (check_sizeof): define result size.  [ruby-core:02911]
 
-Sat May  7 16:22:13 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/mkmf.rb (create_header): macro name should not include equal
+	  sign.
 
-	* random.c (int_pair_to_real_inclusive): optimize to multiply
-	  without Bignum.
+Thu May 20 15:59:50 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
 
-Sat May  7 07:58:02 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/socket/socket.c: fix SEGV. [ruby-dev:23550]
 
-	* process.c (rb_exec_getargs): honor the expected argument types
-	  over the conversion method.  the basic language functionality
-	  should be robust.  [ruby-core:75388] [Bug #12355]
+Thu May 20 14:35:52 2004  Tanaka Akira  <akr@m17n.org>
 
-Fri May  6 08:16:26 2016  David Silva  <david.silva@digital.cabinet-office.gov.uk>
+	* ext/socket/socket.c: check SCM_RIGHTS macro addition to
+	  the msg_control field to test existence of file descriptor passing
+	  by msg_control.
 
-	* enum.c (enum_find): [DOC] add more examples to the documentation
-	  of Enumerable#detect, to show that it equals to Enumerable#find.
-	  [Fix GH-1340]
+Thu May 20 12:38:06 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Thu May  5 18:08:31 2016  Yuichiro Kaneko  <yui-knk@ruby-lang.org>
+	* numeric.c (flo_eq): always check if operands are NaN.
+	  [ruby-list:39685]
 
-	* test/ruby/test_complexrational.rb: Remove duplicated raise.
+Thu May 20 12:34:39 2004  Dave Thomas  <dave@pragprog.com>
 
-Thu May  5 14:41:05 2016  Yuichiro Kaneko  <yui-knk@ruby-lang.org>
+	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_visibility):
+	  At Ryan Davis' suggestion, honor visibility modifers if guarded by a
+	  statement modifier
 
-	* string.c (rb_str_sub): Fix a special match variable name.
-	  [ci skip]
+Thu May 20 12:22:13 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu May  5 12:22:17 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/mkmf.rb (have_type): do not check pointer to incomplete type,
+	  which always get compiled.  [ruby-list:39683]
 
-	* vm_eval.c (rb_eval_cmd, rb_catch_obj): use TH_JUMP_TAG with the
-	  same rb_thread_t used for TH_PUSH_TAG, instead of JUMP_TAG with
-	  the current thread global variable.
+Wed May 19 11:09:00 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-Thu May  5 10:49:33 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/tk/lib/tk.rb: change permition of TkObject#tk_send from
+	  private to public
 
-	* random.c (fill_random_bytes_syscall): use arc4random_buf if
-	  available.
+Tue May 18 14:00:46 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed May  4 23:13:58 2016  Yuichiro Kaneko  <yui-knk@ruby-lang.org>
+	* node.h (NEW_DSTR): adjust list length.
 
-	* numeric.c (fix_plus): Remove rb_nucomp_add prototype
-	  declaration.
+	* parse.y (literal_concat): ditto.
 
-	* numeric.c (fix_mul): Remove rb_nucomp_mul prototype
-	  declaration.
+Mon May 17 16:14:25 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
 
-	* internal.h (rb_nucomp_add, rb_nucomp_mul): add prototype
-	  declarations.
+	* numeric.c (flo_to_s): it's preferable that "p 0.0" outputs "0.0"
+	  instead of "0.0e+00". [ruby-dev:23480]
 
-Wed May  4 18:38:00 2016  Kazuki Tsujimoto  <kazuki@callcc.net>
+	* numeric.c (flo_to_s): it's preferable that "p 0.00000000000000000001"
+	  outputs "1.0e-20" instead of "9.999999999999999e-21". (the precision
+	  is considered, but there is assumption DBL_DIG == 15 in current
+	  implementation)
 
-	* lib/net/http/header.rb (Net::HTTPHeader#{each_header,each_name,
-	  each_capitalized_name,each_value,each_capitalized}): Return
-	  sized enumerators.
+Mon May 17 10:13:33 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* test/net/http/test_httpheader.rb: add test for above.
+	* ext/socket/socket.c (setup_domain_and_type): honor duck typing.
+	  [ruby-dev:23522]
 
-Wed May  4 17:53:15 2016  Kazuki Tsujimoto  <kazuki@callcc.net>
+	* ext/socket/socket.c (sock_s_getnameinfo): ditto.
 
-	* lib/set.rb (Set#{delete_if,keep_if,collect!,reject!,select!,classify,divide},
-	  SortedSet#{delete_if,keep_if}): Return sized enumerators.
+Mon May 17 01:15:23 2004  why the lucky stiff  <why@ruby-lang.org>
 
-	* test/test_set.rb: add test for above.
+	* lib/yaml.rb: removed fallback to pure Ruby parser.
 
-Tue May  3 23:25:48 2016  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+	* lib/yaml/baseemitter.rb (indent_text): was forcing a mod value
+	  of zero at times, which kept some blocks from getting indentation.
 
-	* numeric.c: [DOC] Update result of 123456789 ** -2.
-	  [ruby-dev:49606] [Bug #12339]
+	* lib/yaml/baseemitter.rb (node_text): rewriting folded scalars.
 
-Tue May  3 23:13:16 2016  Yuichiro Kaneko  <yui-knk@ruby-lang.org>
+	* ext/syck/syck.h: reports style of scalars now, be they plain, block
+	  single-, or double-quoted.
 
-	* internal.h (RCOMPLEX_SET_IMAG): undef RCOMPLEX_SET_IMAG
-	  instead of duplicated undef RCOMPLEX_SET_REAL.
+	* ext/syck/syck.c: ditto.
 
-Tue May  3 22:55:07 2016  Yuichiro Kaneko  <yui-knk@ruby-lang.org>
+	* ext/syck/gram.c: ditto.
 
-	* complex.c (rb_complex_set_imag): Fix to properly set imag
-	  of complex.
+	* ext/syck/node.c: ditto.
 
-Tue May  3 22:19:55 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* ext/syck/token.c: ditto.
 
-	* configure.in (warnflags): use -std=gnu99 instead of
-	  -std=iso9899:1999. [Feature #12336]
+	* ext/syck/rubyext.c (yaml_org_handler): symbols loaded only
+	  if scalar style is plain.
 
-Tue May  3 22:10:09 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* ext/syck/rubyext.c (yaml_org_handler): some empty strings were
+	  loaded as symbols.
 
-	* string.c (count_utf8_lead_bytes_with_word): Use __builtin_popcount
-	  only if it can use SSE 4.2 POPCNT whose latency is 3 cycle.
+	* test/yaml/test_yaml.rb (test_perl_regexp): updated test to
+	  match new regexp serialization.
 
-	* internal.h (rb_popcount64): use __builtin_popcountll because now
-	  it is in fast path.
+Mon May 17 00:03:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
 
-Tue May  3 14:19:18 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/drb/drb.rb: Cosmetic documentation changes.
 
-	* parse.y (new_if_gen): set newline flag to NODE_IF to trace all
-	  if/elsif statements.  [ruby-core:67720] [Bug #10763]
+Sun May 16 22:36:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
 
-Tue May  3 05:35:54 2016  Eric Wong  <e@80x24.org>
+	* lib/test/unit.rb: Removed :nodoc: directive (it prevented effective
+	  RDoc operation), and added file-level comment.
 
-	* process.c (disable_child_handler_fork_child):
-	  initialize handler for SIGPIPE for !POSIX_SIGNAL
+Sun May 16 20:55:49 2004  Tanaka Akira  <akr@m17n.org>
 
-Mon May  2 23:03:42 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* ext/dbm/dbm.c (fdbm_initialize): accept optional 3rd argument to
+	  specify an open flag.
+	  (Init_dbm): define open flags: DBM::READER, DBM::WRITER, DBM::WRCREAT
+	  and DBM::NEWDB.
 
-	* win32/win32.c, include/ruby/win32.h (rb_w32_utruncate): implements new
-	  truncate alternative which accepts UTF-8 path.
+Sun May 16 13:10:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
 
-	* file.c (truncate): use above function.
-	  [Bug #12340]
+	* lib/test/unit/**/*.rb: Removed :nodoc: directives (many were
+	  generating warnings, many were on private methods).
 
-Mon May  2 20:59:21 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+Sat May 15 01:41:34 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* re.c (str_coderange): to avoid function call when the string already
-	  has coderange information.
+	* eval.c (eval): forgot to restore $SAFE value before evaluating
+	  compiled node.  [ruby-core:02872]
 
-	* re.c (rb_reg_prepare_enc): add shortcut path when the regexp has
-	  the same encoding of given string.
+Sat May 15 01:33:12 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* re.c (rb_reg_prepare_re): avoid duplicated allocation of
-	  onig_errmsg_buffer.
+	* range.c (range_each_func): terminates loop if generating value
+	  is same to @end.  [ruby-talk:100269]
 
+Fri May 14 22:08:38 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Mon May  2 12:34:52 2016  Tanaka Akira  <akr@fsij.org>
+	* string.c (rb_str_new4): should not reuse frozen shared string if
+	  the original is not an instance of String. [ruby-talk:100193]
 
-	* test/ruby/test_refinement.rb (test_inspect): Use Integer instead of
-	  Fixnum.
+Fri May 14 18:39:25 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-Mon May  2 06:58:38 2016  Tanaka Akira  <akr@fsij.org>
+	* ext/tk/lib/tk/canvas.rb: improve coords support for canvas items.
+	  Now, supports all of the followings.
+	    TkcLine.new(c, 0, 0, 100, 100, :fill=>'red')
+	    TkcLine.new(c, [0, 0, 100, 100], :fill=>'red')
+	    TkcLine.new(c, [0, 0], [100, 100], :fill=>'red')
+	    TkcLine.new(c, [[0, 0], [100, 100]], :fill=>'red')
+	    TkcLine.new(c, :coords=>[0, 0, 100, 100], :fill=>'red')
+	    TkcLine.new(c, :coords=>[[0, 0], [100, 100]], :fill=>'red')
 
-	* complex.c: Don't refer rb_cFixnum and rb_cBignum.
-	  (k_fixnum_p): Use FIXNUM_P.
-	  (k_bignum_p): Use RB_TYPE_P.
+Fri May 14 12:11:43 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
 
-Mon May  2 01:27:59 2016  Tanaka Akira  <akr@fsij.org>
+	* util.c (ruby_strtod): strtod("0", &end); => end should point '\0'.
+	 [ruby-dev:23498]
 
-	* test/ruby/test_numeric.rb (test_step): Use Integer::FIXNUM_MAX.
+Thu May 13 15:47:30 2004  akira yamada  <akira@ruby-lang.org>
 
-Mon May  2 01:15:01 2016  Tanaka Akira  <akr@fsij.org>
+	* lib/net/telnet.rb (Net::Telnet::login): "options" can specify
+	  regexps for login prompt and/or password prompt.
 
-	* test/ruby/test_module.rb (test_name): Use Integer instead of Fixnum.
+Thu May 13 14:23:45 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
 
-Mon May  2 01:00:04 2016  Tanaka Akira  <akr@fsij.org>
+	* hash.c (delete_if_i): use st_delete_safe() (via
+	  rb_hash_delete()) instead of returning ST_DELETE.
+	  backport from HEAD.  [ruby-dev:23487]
 
-	* test/lib/test/unit/assertions.rb (assert_fixnum): Defined.
-	  (assert_bignum): Defined.
+Thu May 13 13:01:30 2004  akira yamada  <akira@ruby-lang.org>
 
-	* test/ruby/test_bignum.rb: Use assert_bignum.
+	* lib/uri/mailto.rb (URI::MailTo::to_s): should include fragment.
 
-	* test/ruby/test_integer_comb.rb: Use assert_fixnum and assert_bignum.
+Thu May 13 11:04:08 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/ruby/test_optimization.rb: Ditto.
+	* pack.c (pack_pack): always add with null for 'Z'.
 
-Mon May  2 00:41:53 2016  Tanaka Akira  <akr@fsij.org>
+	* pack.c (pack_unpack): terminated by null for 'Z'.  [ruby-talk:98281]
 
-	* vm_trace.c (recalc_remove_ruby_vm_event_flags): Add a cast to
-	  avoid signed integer overflow.
+Wed May 12 19:59:43 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon May  2 00:06:04 2016  Tanaka Akira  <akr@fsij.org>
+	* lib/mkmf.rb (have_type, check_sizeof): replace unusable characters.
+	  [ruby-talk:99788]
 
-	* test/lib/envutil.rb: Define Integer::{FIXNUM_MIN,FIXNUM_MAX}.
+Wed May 12 17:41:42 2004  Tanaka Akira  <akr@m17n.org>
 
-	* test/ruby/test_bignum.rb: Use Integer::{FIXNUM_MIN,FIXNUM_MAX}.
+	* lib/resolv.rb (Resolv::DNS::Config): make it configurable without
+	  external file such as /etc/resolv.conf.
 
-	* test/ruby/test_bignum.rb: Ditto.
+Wed May 12 14:37:27 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
 
-	* test/ruby/test_integer_comb.rb: Ditto.
+	* ext/openssl/ossl_x509name.c: attribute value of DC (short name of
+	  domainComponent) should be IA5String.
 
-	* test/ruby/test_marshal.rb: Ditto.
+Wed May 12 13:20:19 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-	* test/ruby/test_optimization.rb: Ditto.
+	* ext/tk/lib/tk/composite.rb: improve configure methods (based on
+	  the proposal of [ruby-talk:99671]).
 
-Sun May  1 23:59:59 2016  Kenta Murata  <mrkn@mrkn.jp>
+Wed May 12 11:51:08 2004  Dave Thomas  <dave@pragprog.com>
 
-	* array.c (rb_ary_sum): fix for mathn
+	* class.c (rb_obj_singleton_methods): fix rdoc
 
-	* test/ruby/test_array.rb (test_sum): ditto.
+Mon May 10 21:44:42 2004  Dave Thomas  <dave@pragprog.com>
 
-Sun May  1 23:51:54 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* lib/rdoc/generators/html_generator.rb: Change scheme for
+	  looking up symbols in  HTML generator.
 
-	* test/lib/test/unit.rb (Options#non_options): fixed wrong regexp.
-	  if both positives and negatives were specified, positives had to
-	  be specified from the beginning.
+Mon May 10 16:45:21 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Sun May  1 21:00:07 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* eval.c (eval): warning during eval should not cause deadlock.
+	  [ruby-talk:98651]
 
-	* win32/win32.c: drop Win2K support.
+	* eval.c (rb_eval): raise TypeError exception for superclass
+	  mismatch.  [ruby-list:39567]
 
-Sun May  1 20:39:47 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+Mon May 10 12:11:37 2004  Dave Thomas  <dave@pragprog.com>
 
-	* cont.c, hash.c, random.c, win32/win32.c: cleanup some Win9x/ME/NT4
-	  support leftovers.
-	  [fix GH-1328] patched by @cremno
+	* lib/rdoc/generators/html_generator.rb: Hack to search parents
+	  for unqualified constant names.
 
-Sun May  1 07:30:44 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+Mon May 10 12:11:37 2004  Dave Thomas  <dave@pragprog.com>
 
-	* string.c (search_nonascii): use nlz on big endian environments.
+	* lib/rdoc/generators/html_generator.rb: Hack to search parents
+	  for unqualified constant names.
 
-	* internal.h (nlz_intptr): defined.
+Sun May  9 22:37:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
 
-Sun May  1 00:03:30 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* lib/net/ftp.rb: improved documentation
+	* lib/net/imap.rb: ditto
+	* lib/net/pop.rb: ditto
+	* lib/net/smtp.rb: ditto
+	* lib/net/telnet.rb: ditto
 
-	* configure.in (__builtin_ctz): check.
+Fri May  7 21:50:21 2004  Dave Thomas  <dave@pragprog.com>
 
-	* configure.in (__builtin_ctzll): check.
+	* lib/rdoc/parsers/parse_rb.rb (RDoc::parse_include): Allow
+	  multiple arguments to 'include'
 
-	* internal.h (rb_popcount32): defined for ntz_int32.
-	  it can use __builtin_popcount but this function is not used on
-	  GCC environment because it uses __builtin_ctz.
-	  When another function uses this, using __builtin_popcount
-	  should be re-considered.
+Fri May  7 21:31:56 2004  Minero Aoki  <aamine@loveruby.net>
 
-	* internal.h (rb_popcount64): ditto.
+	* lib/fileutils.rb (fu_list): Array() breaks pathes including "\n".
+	  [ruby-core:02843]
 
-	* internal.h (ntz_int32): defined for ntz_intptr.
+Fri May  7 11:25:53 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
 
-	* internal.h (ntz_int64): defined for ntz_intptr.
+	* util.c (ruby_strtod): "0.0000000000000000001" should be converted
+	  to 1.0e-19 instead of 0.0. (leading zeros aren't significant digits)
+	  [ruby-talk:99318] [ruby-dev:23465]
 
-	* internal.h (ntz_intptr): defined as ntz for uintptr_t.
+Fri May  7 10:00:05 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-	* string.c (search_nonascii): unroll and use ntz.
+	* ext/tk/tkutil.c (get_eval_string_core): bug fix. [ruby-dev:23466]
 
-Sat Apr 30 21:54:13 2016  Tanaka Akira  <akr@fsij.org>
+Thu May  6 22:13:17 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
 
-	* numeric.c (Init_Numeric): Gather Fixnum method definitions.
+	* ext/socket/socket.c (ippaddr): use NUMERICHOST if can not resolve
+	  hostname.
 
-Sat Apr 30 21:28:14 2016  Tanaka Akira  <akr@fsij.org>
+Thu May  6 14:22:29 2004  why the lucky stiff  <why@ruby-lang.org>
 
-	* numeric.c (rb_int_div): Define Integer#/.
+	* lib/yaml/rubytypes.rb (to_yaml): added instance variable handling
+	  for Ranges, Strings, Structs, Regexps.
 
-	* bignum.c (rb_big_div): Don't define Bignum#/.
+	* lib/yaml/rubytypes.rb (to_yaml_fold): new method for setting a
+	  String's flow style.
 
-	* lib/mathn.rb (Integer#/): Replace Integer#/ instead of Bignum#/.
+	* lib/yaml.rb (YAML::object_maker): now uses Object.allocate.
 
-Sat Apr 30 21:11:08 2016  Tanaka Akira  <akr@fsij.org>
+	* ext/syck/gram.c: fixed transfer methods on structs, broke it
+	  last commit.
 
-	* numeric.c (rb_int_plus): Define Integer#+.
+Thu May  6 11:40:28 2004  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* bignum.c (rb_big_plus): Don't define Bignum#+.
+	* lib/net/imap.rb (string): accept NIL.
 
-Sat Apr 30 21:01:20 2016  Tanaka Akira  <akr@fsij.org>
+	* lib/net/imap.rb (body_type_basic): allow body-fields omissions.
 
-	* numeric.c (rb_int_minus): Define Integer#-.
+Thu May  6 01:59:04 2004  Dave Thomas  <dave@pragprog.com>
 
-	* bignum.c (rb_big_minus): Don't define Bignum#-.
+	* lib/rdoc/generators/html_generator.rb (Generators::HtmlMethod::params):
+	  Don't include the &block parameter if we have explicit
+	  yield parameters.
 
-Sat Apr 30 20:53:33 2016  Tanaka Akira  <akr@fsij.org>
+Wed May  5 03:40:29 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
 
-	* numeric.c (rb_int_mul): Define Integer#*.
+	* lib/rinda/ring.rb: use recv instead of recvfrom.
 
-	* bignum.c (rb_big_mul): Don't define Bignum#*.
+Tue May  4 23:52:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
 
-Sat Apr 30 20:30:44 2016  Tanaka Akira  <akr@fsij.org>
+	* lib/gserver.rb: documented
 
-	* numeric.c (rb_int_modulo): Define Integer#%.
+Tue May  4 23:46:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
 
-	* bignum.c (rb_big_modulo): Don't define Bignum#%.
+	* lib/xmlrpc/README.txt: introduced for documentation purposes
 
-Sat Apr 30 20:17:08 2016  Tanaka Akira  <akr@fsij.org>
+Mon May  3 09:47:24 2004  Dave Thomas  <dave@pragprog.com>
 
-	* numeric.c (int_equal): Define Integer#==.
+	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_method_or_yield_parameters):
+	  Fix parsing bug if yield called within 1 line block
 
-	* bignum.c (rb_big_eq): Don't define Bignum#==.
+Sun May  2 01:04:38 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-Sat Apr 30 19:41:15 2016  Tanaka Akira  <akr@fsij.org>
+	* ext/tcltklib, ext/tk: renewal Ruby/Tk
 
-	* numeric.c (int_gt): Define Integer#>.
+Fri Apr 30 20:08:41 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
 
-	* bignum.c (rb_big_gt): Don't define Bignum#>.
-	  Renamed from big_gt.
+	* time.c (SIZEOF_TIME_T): support SIZEOF_TIME_T == SIZEOF_INT.
 
-	* internal.h (rb_big_gt): Declared.
+Tue Apr 27 13:12:42 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Sat Apr 30 19:24:40 2016  Tanaka Akira  <akr@fsij.org>
+	* eval.c (rb_eval): too many line trace call. (ruby-bugs PR#1320)
 
-	* numeric.c (int_ge): Define Integer#>=.
+Tue Apr 27 08:41:28 2004  why the lucky stiff  <why@ruby-lang.org>
 
-	* bignum.c (rb_big_ge): Don't define Bignum#>=.
-	  Renamed from big_ge.
+	* lib/yaml/rubytypes.rb: passing Range tests.
 
-	* internal.h (rb_big_ge): Declared.
+	* ext/syck/syck.h: version 0.44.
 
-Sat Apr 30 19:20:40 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* ext/syck/gram.c: transfers no longer open an indentation.
+	  fixed transfers which precede blocks.
 
-	* doc/standard_library.rdoc: Remove obsoleted classes and modules.
+	* ext/syck/token.c: ditto.
 
-Sat Apr 30 19:09:23 2016  Tanaka Akira  <akr@fsij.org>
+	* ext/syck/syck.c: fixed segfault if an anchor has been released already.
 
-	* numeric.c (int_lt): Define Integer#<.
+	* ext/syck/node.c (syck_free_members): organized order of free'd nodes.
 
-	* bignum.c (rb_big_lt): Don't define Bignum#<.
-	  Renamed from big_lt.
+	* ext/syck/rubyext.c (syck_emitter_write_m): test for proper string with
+	  StringValue.
 
-	* internal.h (rb_big_lt): Declared.
+Mon Apr 26 23:56:54 2004  Daniel Kelley  <news-1082945587@dkelley.gmp.san-jose.ca.us>
 
-Sat Apr 30 18:44:05 2016  Tanaka Akira  <akr@fsij.org>
+	* README.EXT, README.EXT.ja: fixed wrong function signature.
+	  [ruby-talk:98349]
 
-	* numeric.c (int_le): Define Integer#<=.
+Mon Apr 26 21:40:09 2004  Dave Thomas  <dave@pragprog.com>
 
-	* bignum.c (rb_big_le): Don't define Bignum#<=.
-	  Renamed from big_le.
+	* lib/rdoc/code_objects.rb (RDoc::Context::add_alias): Only alias
+	  to instance methods.
 
-	* internal.h (rb_big_le): Declared.
+Sat Apr 24 10:38:31 2004  Dave Thomas  <dave@pragprog.com>
 
-Sat Apr 30 18:11:44 2016  Tanaka Akira  <akr@fsij.org>
+	* lib/rdoc/markup/simple_markup.rb (SM::SimpleMarkup::group_lines):
+	  Fix bug where consecutive headings are merged.
 
-	* bignum.c (Init_Bignum): Define Integer::GMP_VERSION.
+Fri Apr 23 23:26:13 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Apr 30 16:58:18 2016  Tanaka Akira  <akr@fsij.org>
+	* lib/mkmf.rb: $hdrdir should not contain macros for backward
+	  compatibility.  [bruby-dev:28]
 
-	* numeric.c (int_remainder): Define Integer#remainder.
+	* version.c (ruby_show_copyright): obtain copyright year from
+	  RUBY_RELEASE_YEAR.
 
-	* bignum.c (rb_big_remainder): Don't define Bignum#remainder.
+	* win32/resource.rb: ditto.
 
-	* internal.h (rb_big_remainder): Declared.
+	* win32/resource.rb: default rubyw icon to ruby.ico, and let DLL also
+	  include them.
 
-Sat Apr 30 15:29:24 2016  Tanaka Akira  <akr@fsij.org>
+	* win32/resource.rb: include winver.h for older WindowsCE.
 
-	* numeric.c (rb_int_uminus): {Fixnum,Bignum}#-@ is unified into
-	  Integer.
+Fri Apr 23 16:38:46 2004  Tanaka Akira  <akr@m17n.org>
 
-	* bignum.c (rb_big_uminus): Don't define Bignum#-@.
+	* lib/pathname.rb: sync taint/freeze flag between
+	  a pathname object and its internal string object.
 
-Sat Apr 30 14:42:20 2016  Tanaka Akira  <akr@fsij.org>
+Fri Apr 23 14:52:08 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* numeric.c (rb_int_idiv): {Fixnum,Bignum}#div is unified into
-	  Integer.
+	* parse.y (stmt, arg, aref_args): should not make sole splat into
+	  array, in aref_args other than aref with op_asgn.
 
-	* bignum.c (rb_big_idiv): Don't define Bignum#div.
+Fri Apr 23 14:14:38 2004  Tanaka Akira  <akr@m17n.org>
 
-Sat Apr 30 14:25:55 2016  Tanaka Akira  <akr@fsij.org>
+	* lib/resolv.rb: don't use Regexp#source to embed regexps.
+	  [ruby-dev:23432]
 
-	* numeric.c (rb_int_modulo): {Fixnum,Bignum}#modulo is unified into
-	  Integer.
+Thu Apr 22 04:15:36 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* bignum.c (rb_big_modulo): Don't define Bignum#modulo.
+	* parse.y (aref_args): should pass expanded list.  [ruby-core:02793]
 
-Sat Apr 30 14:04:30 2016  Tanaka Akira  <akr@fsij.org>
+Thu Apr 22 01:12:57 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* numeric.c (int_divmod): {Fixnum,Bignum}#divmod is unified into
-	  Integer.
+	* numeric.c (flo_to_s): tweak output string based to preserve
+	  decimal point and to remove trailing zeros.  [ruby-talk:97891]
 
-	* bignum.c (rb_big_divmod): Don't define Bignum#divmod.
+	* string.c (rb_str_index_m): use unsigned comparison for T_FIXNUM
+	  search.  [ruby-talk:97342]
 
-Sat Apr 30 13:20:00 2016  Tanaka Akira  <akr@fsij.org>
+Wed Apr 21 22:57:27 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
 
-	* numeric.c (int_fdiv): {Fixnum,Bignum}#fdiv is unified into
-	  Integer.
+	* lib/rinda/rinda.rb, test/rinda/test_rinda.rb: check Hash tuple size.
 
-	* bignum.c (rb_big_fdiv): Don't define Bignum#fdiv.
+Wed Apr 21 20:05:00 2004  Tanaka Akira  <akr@m17n.org>
 
-Sat Apr 30 12:25:43 2016  Tanaka Akira  <akr@fsij.org>
+	* lib/open-uri.rb (URI::HTTP#proxy_open): set Host: field explicitly.
+	  [ruby-list:39542]
 
-	* numeric.c (rb_int_pow): {Fixnum,Bignum}#** is unified into
-	  Integer.
+Mon Apr 19 18:11:15 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* bignum.c (rb_big_pow): Don't define Bignum#**.
+	* hash.c (rb_hash_equal): returns true if two hashes have same set
+	  of key-value set.  [ruby-talk:97559]
 
-Sat Apr 30 12:28:59 2016  Tanaka Akira  <akr@fsij.org>
+	* hash.c (rb_hash_eql): returns true if two hashes are equal and
+	  have same default values.
 
-	* bignum.c (rb_big_comp): Renamed from rb_big_neg.
+Mon Apr 19 08:19:58 2004  Doug Kearns  <djkea2@mugca.its.monash.edu.au>
 
-	* numeric.c (fix_comp): Renamed from fix_rev.
+	* dln.c, io.c, lib/benchmark.rb, lib/cgi.rb, lib/csv.rb, lib/date.rb,
+	  lib/ftools.rb, lib/getoptlong.rb, lib/logger.rb, lib/matrix.rb,
+	  lib/monitor.rb, lib/set.rb, lib/thwait.rb, lib/timeout.rb,
+	  lib/yaml.rb, lib/drb/drb.rb, lib/irb/workspace.rb, lib/net/ftp.rb,
+	  lib/net/http.rb, lib/net/imap.rb, lib/net/telnet.rb,
+	  lib/racc/parser.rb, lib/rinda/rinda.rb, lib/rinda/tuplespace.rb,
+	  lib/shell/command-processor.rb, lib/soap/rpc/soaplet.rb,
+	  lib/test/unit/testcase.rb, lib/test/unit/testsuite.rb: typo fix.
 
-Sat Apr 30 12:25:43 2016  Tanaka Akira  <akr@fsij.org>
+Mon Apr 19 08:14:18 2004  Dave Thomas  <dave@pragprog.com>
 
-	* numeric.c (int_comp): {Fixnum,Bignum}#~ is unified into
-	  Integer.
+	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::find_body): Allow for
+	  #ifdef HAVE_PROTOTYPES
 
-	* bignum.c (rb_big_neg): Don't define Bignum#~.
+Fri Apr 16 22:33:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
 
-	* internal.h (rb_big_neg): Declared.
+	* ext/iconv/iconv.c: nearly finished RDoc comments.
 
-Sat Apr 30 12:07:42 2016  Tanaka Akira  <akr@fsij.org>
+Fri Apr 16 17:04:07 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* numeric.c (int_and): {Fixnum,Bignum}#& is unified into
-	  Integer.
+	* string.c (rb_str_equal): always returns true or false, never
+	  returns nil. [ruby-dev:23404]
 
-	* bignum.c (rb_big_and): Don't define Bignum#&.
+Fri Apr 16 08:27:02 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Apr 30 11:56:15 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/extmk.rb: skip linking when libraries to be preloaded not
+	  compiled.  [ruby-list:39561]
 
-	* ext/thread: removed dummy extension library.  thread_sync.c
-	  provides "thread.rb" already.
+Thu Apr 15 23:21:52 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sat Apr 30 11:53:48 2016  Tanaka Akira  <akr@fsij.org>
+	* process.c (pst_success_p): new method Process::Status#success?.
+	  [ruby-dev:23385]
 
-	* numeric.c (int_or): {Fixnum,Bignum}#| is unified into
-	  Integer.
+Thu Apr 15 17:12:13 2004  Tanaka Akira  <akr@m17n.org>
 
-	* bignum.c (rb_big_or): Don't define Bignum#|.
+	* ext/gdbm/gdbm.c (Init_gdbm): define GDBM::READER, GDBM::WRITER,
+	  GDBM::WRCREAT and GDBM::NEWDB.
+	  (fgdbm_initialize): use specified read/write flag.
 
-Sat Apr 30 11:18:47 2016  Yuichiro Kaneko  <yui-knk@ruby-lang.org>
+Wed Apr 14 11:29:56 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
 
-	* vm_trace.c: Fix typos. [ci skip]
+	* numeric.c (flo_eq): workaround for bcc32's bug.
+	  (ruby-bugs-ja:PR#594)
 
-Sat Apr 30 10:09:04 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Apr 14 13:06:35 2004  Doug Kearns  <djkea2@mugca.its.monash.edu.au>
 
-	* ext/pty/pty.c (establishShell): honor USER environment variable
-	  and login name over uid, one uid can be shared by some login
-	  names.
+	* array.c, enum.c, eval.c, file.c, io.c, numeric.c, object.c, prec.c,
+	  process.c, re.c, string.c: typos in RDoc comments.  [ruby-core:02783]
 
-Fri Apr 29 22:40:28 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Apr 14 11:06:38 2004  Dave Thomas  <dave@pragprog.com>
 
-	* doc/maintainers.rdoc (ext/io/nonblock): still maintained, as
-	  well as ext/io/wait, which is the origin.
+	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::scan): Changed
+	  behavior of :enddoc: -- it now unconditionally terminates
+	  processing of the current file.
 
-Fri Apr 29 21:18:12 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+Wed Apr 14 11:03:22 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
 
-	* doc/maintainers.rdoc (ext/win32): of course, it's still maintained.
+	* defines.h: include <net/socket.h> to get fd_set definition in BeOS.
 
-Fri Apr 29 21:03:10 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+Tue Apr 13 23:06:30 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
 
-	* gems/bundled_gems: Update latest gems, test-unit-3.1.8 and rake-11.1.2.
+	* lib/rinda/rinda.rb: change pattern matching.
+	  a === b -> a == b || a === b. [druby-ja:98]
 
-Fri Apr 29 20:43:02 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* test/rinda/test_rinda.rb: ditto.
 
-	* doc/maintainers.rdoc: Update latest maintainers list on Ruby 2.4
+Tue Apr 13 19:54:29 2004  Minero Aoki  <aamine@loveruby.net>
 
-Fri Apr 29 19:52:45 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* lib/net/http.rb: should not overwrite HTTP request header.
+	  [ruby-list:39543]
 
-	* doc/maintainers.rdoc: Removed deprecated entries. These are already deleted.
+Tue Apr 13 01:30:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
 
-Fri Apr 29 19:48:45 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* ext/iconv/iconv.c: RDoc documentation (from RD; nearly finished).
+	* ext/iconv/charset_alias.rb: Prevent from RDoc'ing.
 
-	* doc/maintainers.rdoc: Removed Ruby 1.8 entries. It's not necessary to
-	  Ruby 2.4 or later.
+Mon Apr 12 19:11:29 2004  Eric Hodel  <drbrain@segment7.net>
 
-Thu Apr 28 17:03:17 2016  Nicholas Maccharoli  <nmaccharoli@gmail.com>
+	* gc.c (rb_gc_copy_finalizer): typo.  [ruby-core:02774]
 
-	* hash.c (rb_hash_update_{block,func}_callback): dry up hash
-	  update callback code.  [Fix GH-1338]
+Mon Apr 12 18:52:32 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
 
-Thu Apr 28 16:52:05 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* ext/openssl/ossl_x509name.c (ossl_x509name_init_i): should return
+	  a value.
 
-	* re.c (rb_reg_prepare_enc): use rb_enc_asciicompat(enc) instead of
-	  rb_enc_str_asciicompat_p(str) to avoid useless rb_enc_get(str) call.
+Mon Apr 12 10:43:47 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
 
-Thu Apr 28 16:33:41 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* dir.c (rb_glob2, rb_glob, rb_globi, push_globs, push_braces,
+	  rb_push_glob): fix memory leak. (leaked when block was interrupted)
 
-	* lib/optparse.rb: [DOC] fix example code.  base on the code by
-	  Semyon Gaivoronskiy in [ruby-core:75224].  [Bug #12323]
+Mon Apr 12 10:27:37 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
 
-Thu Apr 28 09:33:03 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* bcc32/Makefile.sub: backport SIZEOF_TIME_T definition from 1.9.
 
-	* lib/rubygems.rb, lib/rubygems/*, test/rubygems/*: Update rubygems-2.6.4.
-	  Please see entries of 2.6.4 on
-	  https://github.com/rubygems/rubygems/blob/master/History.txt
+	* win32/Makefile.sub: ditto.
 
-Thu Apr 28 04:49:07 2016  Rei Odaira  <Rei.Odaira@gmail.com>
+	* wince/Makefile.sub: ditto.
 
-	* configure.in (rb_cv_lgamma_r_pm0): check if lgamma_r(+0.0)
-	  returns positive infinity, in addition to lgamma_r(-0.0).
-	  AIX returns an incorrect result of negative infinity.
+Sun Apr 11 19:12:35 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* math.c (ruby_lgamma_r): handle +0.0, in addition to -0.0.
+	* ruby.c (require_libraries): restore source file/line after
+	  statically linked extensions initialized.  [ruby-dev:23357]
 
-Thu Apr 28 01:11:14 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+Sun Apr 11 10:47:04 2004  Dave Thomas  <dave@pragprog.com>
 
-	* time.c: define _DEFAULT_SOURCE because glibc 2.20 deprecates
-	  _BSD_SOURCE.
-	  https://sourceware.org/glibc/wiki/Release/2.20
+	* lib/rdoc/code_objects.rb (RDoc::TopLevel::add_class_or_module): Toplevel
+	  classes and modules are a special case too... (handle extending existing
+	  classes with or without :enddoc:)
 
-Thu Apr 28 00:27:55 2016  Tanaka Akira  <akr@fsij.org>
+Sat Apr 10 23:51:13 2004  Dave Thomas  <dave@pragprog.com>
 
-	* numeric.c (int_xor): {Fixnum,Bignum}#^ is unified into
-	  Integer.
+	* lib/rdoc/code_objects.rb (RDoc::Context::add_to): Implementation of :enddoc:
+	  made one too many assumptions...
 
-	* bignum.c (rb_big_xor): Don't define Bignum#^.
+Sat Apr 10 00:00:19 2004  Dave Thomas  <dave@pragprog.com>
 
-Wed Apr 27 20:53:59 2016  Tanaka Akira  <akr@fsij.org>
+	* lib/rdoc/markup/simple_markup/inline.rb: Fix problem
+	  with \_cat_<b>dog</b>
 
-	* numeric.c (int_aref): {Fixnum,Bignum}#[] is unified into
-	  Integer.
+Wed Apr  7 00:19:50 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
 
-	* bignum.c (rb_big_aref): Don't define Bignum#<<.
+	* lib/rinda/rinda.rb: fix hash tuple bug.
 
-	* internal.h (rb_big_aref): Declared.
+	* lib/rinda/tuplespace.rb: ditto.
 
-Wed Apr 27 16:10:35 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* test/rinda/test_rinda.rb
 
-	* tool/instruction.rb: fix to follow current implementation.
+Tue Apr  6 18:24:18 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Wed Apr 27 15:47:54 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* io.c (rb_io_reopen): should use rb_io_check_io().
 
-	* ext/stringio/stringio.c (strio_s_new): warn if a block is given,
-	  as well as IO.new.
+Tue Apr  6 16:46:09 2004  Tanaka Akira  <akr@m17n.org>
 
-Wed Apr 27 14:29:47 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* configure.in: check the size of time_t.
 
-	* error.c (ruby_only_for_internal_use): raise fatal error when
-	  deprecated function only for internal use is called, not just a
-	  warning.
+	* time.c (time_add): new function.
+	  (time_plus): use time_add.
+	  (time_minus): use time_add.
 
-Tue Apr 26 23:42:30 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+Tue Apr  6 13:21:30 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* tool/redmine-backporter.rb (rel): should not raise exceptions even if
-	  the user input is wrong.  only reports the error and continue process.
+	* ext/socket/socket.c (make_hostent): must return value.
 
-Tue Apr 26 23:35:23 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Apr  6 00:05:30 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
 
-	* ruby.c (process_options): convert -e script to the encoding
-	  given by a command line option on Windows.  assume it is the
-	  expected encoding.  [ruby-dev:49461] [Bug #11900]
+	* lib/rinda/rinda.rb: add require 'drb/drb'
 
-Tue Apr 26 21:11:02 2016  Tanaka Akira  <akr@fsij.org>
+Mon Apr  5 08:18:23 2004  Dave Thomas  <dave@pragprog.com>
 
-	* numeric.c (rb_int_lshift): {Fixnum,Bignum}#<< is unified into
-	  Integer.
+	* lib/rdoc/rdoc.rb: Remove leading ./ from file names so that cross
+	  references work properly.
 
-	* bignum.c (rb_big_lshift): Don't define Bignum#<<.
+Sun Apr  4 20:33:42 2004  Minero Aoki  <aamine@loveruby.net>
 
-Tue Apr 26 20:59:40 2016  Tanaka Akira  <akr@fsij.org>
+	* eval.c (Init_load): make $LOADED_FEATURES built-in.
+	  [ruby-dev:23299]
 
-	* numeric.c (rb_int_rshift): {Fixnum,Bignum}#>> is unified into
-	  Integer.
+	* ruby.c (ruby_prog_init): make $PROGRAM_NAME built-in.
 
-	* bignum.c (rb_big_rshift): Don't define Bignum#>>.
+	* lib/English.rb: remove $LOADED_FEATURES and $PROGRAM_NAME.
 
-Tue Apr 26 20:46:16 2016  Tanaka Akira  <akr@fsij.org>
+Sun Apr  4 14:01:20 2004  Dave Thomas  <dave@pragprog.com>
 
-	* numeric.c (int_size): {Fixnum,Bignum}#size is unified into Integer.
+	* lib/rdoc/options.rb (Options::parse): Allow multiple -x options to RDoc.
+	  Fix bug where files weren't being excluded properly
 
-	* bignum.c (rb_big_size_m): Don't define Bignum#size.
+Sat Apr  3 17:11:05 2004  why the lucky stiff  <why@ruby-lang.org>
 
-	* internal.h (rb_big_size_m): Declared.
+	* ext/syck/syck.h: version 0.43.
 
-Tue Apr 26 20:09:08 2016  Tanaka Akira  <akr@fsij.org>
+	* ext/syck/lib/gram.c: allow root-level inline collections.
+	 [ruby-talk:94922]
 
-	* numeric.c (rb_int_bit_length): {Fixnum,Bignum}#bit_length is
-	  unified into Integer.
+	* lib/yaml/rubytypes.rb (Symbol#to_yaml): emit symbols as implicits.
+	 [ruby-talk:94930]
 
-	* bignum.c (rb_big_bit_length): Don't define Bignum#bit_length.
+	* ext/syck/bytecode.c: turn off default implicit typing.
 
-	* internal.h (rb_big_bit_length): Declared.
+	* ext/syck/implicit.c: detect base60 integers.
 
-Tue Apr 26 19:56:16 2016  Tanaka Akira  <akr@fsij.org>
+	* ext/syck/rubyext.c: handle base60, as well as hex and octal
+	  with commas.  implicit typing of ruby symbols.
 
-	* numeric.c (int_abs): Integer#{abs,magnitude} moved from
-	  Fixnum and Bignum.
+Fri Apr  2 17:27:17 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* bignum.c (rb_big_abs): Don't define Bignum#{abs,magnitude}.
+	* eval.c (top_include): include in the wrapped load is done for
+	  the wrapper, not for a singleton class for wrapped main.
+	  [ruby-dev:23305]
 
-	* internal.h (rb_big_abs): Declared.
+Fri Apr  2 15:13:44 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Mon Apr 25 14:39:11 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* bignum.c (rb_big_eq): use temporary double variable to save the
+	  result (internal float register may be bigger than 64 bits, for
+	  example, 80 bits on x86).  [ruby-dev:23311]
 
-	* ext/rbconfig/sizeof/extconf.rb: just check the existence of each
-	  types, to reduce configuration time, especially cross-compiling.
+Fri Apr  2 14:35:26 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* template/sizes.c.tmpl: calculate sizes of checked types at
-	  compilation time.
+	* eval.c (block_pass): should generate unique identifier of the
+	  pushing block.  [ruby-talk:96363]
 
-Mon Apr 25 11:27:27 2016  Marcus Stollsteimer  <sto.mar@web.de>
+Fri Apr  2 07:31:38 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* doc/extension.rdoc: Improvements to english grammars.
-	  [Bug #12246][ruby-core:74792][ci skip]
+	* ext/socket/socket.c (make_hostent): fix memory leak, based on
+	  the patch from HORIKAWA Hisashi <vzw00011@nifty.ne.jp>.
 
-Mon Apr 25 11:17:50 2016  Marcus Stollsteimer  <sto.mar@web.de>
+Thu Apr  1 22:55:33 2004  Dave Thomas  <dave@pragprog.com>
 
-	* encoding.c: Fix return value of `Encoding::ISO8859_1.name`
-	  [Bug #12313][ruby-core:75147][ci skip]
-	* ext/bigdecimal/bigdecimal.c: Fix code sample of `BigDecimal.new`
+	* lib/rdoc/parsers/parse_rb.rb: Allow rdoc comments in
+	  =begin rdoc/=end
 
-Sun Apr 24 23:29:16 2016  Rei Odaira  <Rei.Odaira@gmail.com>
+	* lib/rdoc/parsers/parse_rb.rb: Fix problem with comment in
+	  top-level method being taken as file comment.
 
-	* configure.in: add missing -lm for AIX.
+Thu Apr  1 22:55:04 2004  Dave Thomas  <dave@pragprog.com>
 
-Sun Apr 24 18:33:58 2016  Kazuki Tsujimoto  <kazuki@callcc.net>
+	* lib/rdoc/ri/ri_options.rb: Fix undefined variable warning.
 
-	* vm_insnhelper.c (INLINE): disable r54738 if __NO_INLINE__ is defined.
-	  It caused "undefined reference to `vm_getivar'".
+Thu Apr  1 19:58:37 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-Sun Apr 24 09:32:12 2016  Yuichiro Kaneko  <yui-knk@ruby-lang.org>
+	* lib/soap/mapping/{factory.rb,registry.rb}: fixed illegal mapped URI
+	  object with soap/marshal.
+	  added URIFactory class for URI mapping.  BasetypeFactory checks
+	  instance_variables when original mapping is not allowed (ivar must
+	  be empty).  Instance of URI have instance_variables but it must be
+	  llowed whenever original mapping is allowed or not.
 
-	* test/ruby/test_array.rb: Add test cases for Array#sum with
-	  non-numeric objects.
+	* lib/xsd/datatypes.rb: check the smallest positive non-zero
+	  single-precision float exactly instead of packing with "f".
+	  [ruby-talk:88822]
 
-Sun Apr 24 04:21:27 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* lib/soap/mapping/rubytypeFactory.rb: should not dump singleton class.
+	  [ruby-dev:22588]
+	  c = class << Object.new; class C; self; end; end; SOAPMarshal.dump(c)
 
-	* vm_insnhelper.c (INLINE): define as `inline` when it is optimized.
-	  define as `static inline` when it is not optimized to keep
-	  the symbol generated.
+Wed Mar 31 19:06:23 2004  Tanaka Akira  <akr@m17n.org>
 
-	* vm_insnhelper.c (vm_getivar): use `INLINE` to force inline
-	  so that a compiler inlines it into vm_getinstancevariable
-	  and optimizes out is_attr and related branches.
+	* time.c (year_leap_p): new function.
+	  (timegm_noleapsecond): ditto.
+	  (search_time_t): use timegm_noleapsecond instead of
+	  mktime for first guess.
 
-	* vm_insnhelper.c (vm_getivar): use `inline` to recommend inline.
-	  Without this vm1_ivar_set is degraded.
+Wed Mar 31 12:04:04 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	  benchmark results:
-	  minimum results in each 5 measurements.
-	  Execution time (sec)
-	  name    ruby 2.4.0dev (2016-04-23 trunk 54727) [x86_64-linux]   ruby 2.4.0dev (2016-04-23 trunk 54733) [x86_64-linux]       built-ruby
-	  loop_whileloop 0.641                                                   0.642 0.646
-	  vm1_ivar* 1.002                                                   0.999 0.831
-	  vm1_ivar_set* 0.369                                                   1.106 0.362
+	* lib/delegate.rb (DelegateClass): define internal methods of the
+	  result class, but not metaclass of the caller.  [ruby-talk:96156]
 
-	  Speedup ratio: compare with the result of `ruby 2.4.0dev (2016-04-23
-	  trunk 54727) [x86_64-linux]' (greater is better)
-	  name    ruby 2.4.0dev (2016-04-23 trunk 54733) [x86_64-linux]
-	  built-ruby
-	  loop_whileloop
-	  0.998        0.991
-	  vm1_ivar*
-	  1.003        1.205
-	  vm1_ivar_set*
-	  0.334        1.018
+	* intern.h: provide proper prototypes.  [ruby-core:02724]
 
-Sat Apr 23 18:01:21 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* ruby.h: missing.h is now prerequisite to intern.h.
 
-	* vm_insnhelper.c (vm_getivar): specify inline instead of static inline.
-	  vm_getivar is called by vm_call_ivar and vm_getinstancevariable.
-	  At least with GCC 4.8 and 5.3 on Linux, they are inlining it into
-	  vm_call_ivar but not vm_getinstancevariable.
-	  By `inline`, they correctly inline it and gains performance.
+Tue Mar 30 20:25:34 2004  Tanaka Akira  <akr@m17n.org>
 
-	  Speedup ratio: compare with the result of `ruby 2.4.0dev (2016-04-23
-	  trunk 54727) [x86_64-linux]' (greater is better)
-	  name    built-ruby
-	  loop_whileloop       1.001
-	  vm1_ivar*            1.189
-	  vm1_ivar_set*        1.024
+	* time.c (search_time_t): limit guess range by mktime if it is
+	  available.  [ruby-dev:23274]
 
-	  Note the `inline`'s meaning is different between old GCC
-	  and C99. Old GCC's inline means C99's extern inline.
-	  https://gcc.gnu.org/onlinedocs/gcc/Inline.html
-	  Since Ruby specify -std=iso9899:1999, it works like C99.
+Sun Mar 28 14:16:59 2004  Minero Aoki  <aamine@loveruby.net>
 
-Sat Apr 23 16:11:39 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* lib/net/pop.rb (auth): failed when account/password include "%".
+	  [ruby-talk:95933]
 
-	* include/ruby/ruby.h (rb_mul_size_overflow): use UNLIKELY
-	  by user side to improve generality.
+Sat Mar 27 21:40:41 2004  Tanaka Akira  <akr@m17n.org>
 
-Sat Apr 23 16:10:02 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* lib/open-uri.rb: permit extra semicolon in content-type field.
 
-	* include/ruby/ruby.h (RB_LIKELY): use prefix in ruby.h.
+Sat Mar 27 10:40:48 2004  Tanaka Akira  <akr@m17n.org>
 
-	* intern.h (LIKELY): define with RB_LIKELY.
+	* (lib/pp.rb, lib/prettyprint.rb): define seplist in PP::PPMethods
+	  instead of PrettyPrint.
 
-Sat Apr 23 13:27:25 2016  Yuichiro Kaneko  <yui-knk@ruby-lang.org>
+Thu Mar 25 23:28:52 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* NEWS: Add descriptions for Time#to_time updates.
-	  [Bug #12271]
+	* time.c (time_overflow_p): backport 1.9 usec overflow function.
+	  (ruby-bugs PR#1307)
 
-Sat Apr 23 13:21:24 2016  Yuichiro Kaneko  <yui-knk@ruby-lang.org>
+Thu Mar 25 23:15:24 2004  Dave Thomas  <dave@pragprog.com>
 
-	* NEWS: Add descriptions for DateTime#to_time updates.
-	  [Bug #12189]
+	* lib/rdoc/ri/ri_options.rb (RI::Options::show_version):
+	  Add --version option
 
-Sat Apr 23 11:21:27 2016  Marcus Stollsteimer  <sto.mar@web.de>
+Thu Mar 25 04:16:18 2004  Dave Thomas  <dave@pragprog.com>
 
-	* ext/date/date_core.c (Init_date_core): [DOC] Convert DateTime
-	  documentation to RDoc from Markdown.
-	  [ruby-core:75136] [Bug #12311]
+	* lib/rdoc/ri/ri_options.rb (RI::Options): Add the --list-names option,
+	  which dumps our all known names
 
-Sat Apr 23 09:03:35 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Mar 25 03:57:47 2004  Dave Thomas  <dave@pragprog.com>
 
-	* ruby.c: cygwin does not use w32_cmdvector, command line can be
-	  other than UTF-8.  [ruby-dev:49519] [Bug #12184]
+	* lib/rdoc/ri/ri_util.rb (NameDescriptor::initialize): No longer
+	  allow nested classes to be designated using "."--you must
+	  now use "::"
 
-Sat Apr 23 01:00:03 2016  Rei Odaira  <Rei.Odaira@gmail.com>
+Thu Mar 25 02:00:18 2004  Dave Thomas  <dave@pragprog.com>
 
-	* configure.in: don't use the system-provided round(3) on AIX.
-	  In AIX, round(0.49999999999999994) returns 1.0.
-	  Use round() in numeric.c instead.
+	* lib/rdoc/generators/template/html/one_page_html.rb (Page):
+	  Fix to work with C modules.
 
-Fri Apr 22 21:00:44 2016  Tanaka Akira  <akr@fsij.org>
+Wed Mar 24 21:17:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
 
-	* test/ruby/test_time_tz.rb: Tests depends on Europe/Moscow removed
-	  to avoid test failures due to the tzdata change.
-	  https://github.com/eggert/tz/commit/8ee11a301cf173afb0c76e0315b9f9ec8ebb9d95
-	  Found by naruse.
+	* lib/uri.rb: Documented (thanks Dmitry V. Sabanin).
+	* lib/uri/common.rb: Ditto.
+	* lib/uri/ftp.rb: Ditto.
+	* lib/uri/generic.rb: Ditto.
+	* lib/uri/http.rb: Ditto.
+	* lib/uri/https.rb: Ditto.
+	* lib/uri/ldap.rb: Ditto.
+	* lib/uri/mailto.rb: Ditto.
+	  (All backported from 1.9)
 
-Fri Apr 22 20:18:40 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+Wed Mar 24 18:48:26 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* include/ruby/ruby.h (rb_mul_size_overflow): added to handle
-	  mul overflow efficiently.
+	* lib/mkmf.rb ($ruby, $topdir, $hdrdir): should not be affected by
+	  DESTDIR after installed.
 
-	* include/ruby/ruby.h (rb_alloc_tmp_buffer2): use rb_mul_size_overflow
-	  and avoid division where it can define DSIZE_T.
+	* lib/mkmf.rb (RUBY): / is not recognized as path separator on
+	  nmake/bmake. [ruby-list:39388]
 
-	* gc.c (xmalloc2_size): moved from ruby.h and use rb_mul_size_overflow.
+	* lib/mkmf.rb (init_mkmf): $INCFLAGS also should be lazy-evaluated.
 
-Fri Apr 22 20:34:04 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Mar 24 12:32:56 2004  Dave Thomas  <dave@pragprog.com>
 
-	* time.c (time_asctime): [DOC] add ctime example, not only
-	  asctime.  [ruby-core:75126] [Bug #12310]
+	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::handle_class_module):
+	  Don't document methods if we don't know for sure the
+	  class or module.
 
-Fri Apr 22 18:44:32 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_class):
+	  Don't store documentation for singleton classes if we
+	  don't know the real class.
 
-	* variable.c: use uint32_t instead of long to avoid confusion about
-	  the type of ivtbl->numiv.
+Wed Mar 24 11:11:26 2004  Dave Thomas  <dave@pragprog.com>
 
-Fri Apr 22 15:09:27 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/rdoc/generators/html_generator.rb (Generators::HTMLGenerator::load_html_template):
+	  Allow non-RDoc templates by putting a slash in the template name
 
-	* eval_jump.c (exec_end_procs_chain): restore previous error info
-	  for each end procs.  [ruby-core:75038] [Bug #12302]
+Mon Mar 22 16:19:57 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
 
-Fri Apr 22 15:04:56 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* ruby.1: add -width option to .Bl for old groff.
 
-	* tool/redmine-backporter.rb: the fullpath of merger.rb is too long to
-	  copy&paste on Windows.  show shorter name instead on the platform.
-	  I'm sure that the user of this command on Windows is only me.
+Sun Mar 21 21:11:16 2004  Keiju Ishitsuka  <keiju@ishitsuka.com>
 
-Fri Apr 22 14:52:04 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* lib/shell/*: bug fix for Shell#system(command_line_string).
 
-	* tool/merger.rb: remove temporary file.
+Sat Mar 20 20:57:10 2004  David Black  <dblack@wobblini.net>
 
-Fri Apr 22 11:27:03 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* lib/scanf.rb: Backported 1.9 branch
+	  modifications/corrections to 1.8 branch
 
-	* lib/net/http.rb: Improve documentation for SSL requests via GET method.
-	  [fix GH-1325][ci skip] Patch by @jsyeo
+Sat Mar 20 23:51:03 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
 
-Fri Apr 22 10:51:13 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* eval.c (rb_require_safe): preserve old ruby_errinfo.
+	  [ruby-talk:95409]
 
-	* lib/webrick/ssl.rb: Support to add SSLCiphers option.
-	  [fix GH-1321] Patch by @rhadoo
+	* eval.c (rb_f_raise): should not clear backtrace information if
+	  exception object already have one.
 
-Fri Apr 22 10:43:19 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+Sat Mar 20 15:25:36 2004  Dave Thomas  <dave@pragprog.com>
 
-	* file.c, win32/file.c: Removed obsoleted safe level checks.
-	  [fix GH-1327] Patch by @cremno
+	* lib/rdoc/generators/template/html/html.rb (RDoc::Page): Force
+	  page background to white.
 
-Fri Apr 22 10:01:48 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+Sat Mar 20 09:52:33 2004  Tadayoshi Funaba  <tadf@dotrb.org>
 
-	* benchmark/bm_so_meteor_contest.rb: fix a typo.
-	  [fix GH-1330][ci skip] Patch by @sachin21
+	* lib/date.rb, lib/date/format.rb: _parse() now accepts fractional
+	  part of second minute that follows a comma or a full stop.
 
-Fri Apr 22 04:57:01 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+Fri Mar 19 01:55:57 2004  Mauricio Fernandez  <batsman.geo@yahoo.com>
 
-	* gc.c (rb_alloc_tmp_buffer_with_count): added like xmalloc2 to
-	  avoid duplicated check of size.
+	* io.c (rb_io_sync): need not to check writable. [ruby-core:02674]
 
-	* gc.c (ruby_xmalloc2): added to keep separate layers.
+Thu Mar 18 21:44:38 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
 
-	* include/ruby/ruby.h (rb_alloc_tmp_buffer2): added to check
-	  the size more statically.
+	* lib/drb/drb.rb: backport drb.rb 1.16.
 
-Fri Apr 22 04:54:40 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+Fri Mar 18 17:49:51 2005  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* include/ruby/ruby.h (LIKELY): moved from internal.h.
+	* struct.c (make_struct): allow const_id for accessor names.
+	  [ruby-core:04585]
 
-	* include/ruby/ruby.h (UNLIKELY): ditto.
+	* eval.c (rb_attr): check if attribute name is local_id or
+	  const_id.
 
-Thu Apr 21 01:44:19 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+Thu Mar 18 16:22:38 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* gc.c (objspace_malloc_prepare): remove size check because it is
-	  used by objspace_xmalloc and objspace_xcalloc.
-	  objspace_xmalloc introduces its own check in this commit.
-	  objspace_xcalloc checks with xmalloc2_size (ruby_xmalloc2_size).
+	* eval.c (proc_eq): avoid false positive by using scope and
+	  dyna_vars.  no longer use frame.uniq.
 
-	* gc.c (objspace_xmalloc0): common xmalloc function.
+Wed Mar 17 14:44:43 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
 
-	* gc.c (objspace_xmalloc): introduce its own size check.
+	* dir.c (range): fix possible "\0" overrun. (in case of "\0-")
 
-	* gc.c (objspace_xmalloc2): separated from ruby_xmalloc2 to clarify
-	  the layer who has the responsibility to check the size.
+Mon Mar 15 07:39:13 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* gc.c (objspace_xrealloc): remove duplicated size check.
+	* eval.c (rb_yield_0): should not re-submit TAG_BREAK if this
+	  yield is not break destination. [ruby-dev:23197]
 
-	* gc.c (ruby_xmalloc2): use objspace_xmalloc2.
+Sat Mar 13 14:28:16 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
 
-	* include/ruby/ruby.h (ruby_xmalloc2_size): follow the size limit
-	  as SSIZE_MAX. Note that ISO C says size_t is unsigned integer.
+	* test/drb/test_drbssl.rb: rescue LoadError. (Barkport from main
+	  trunk)
 
-Thu Apr 21 12:14:04 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/drb/test_drbunix.rb: ditto.
 
-	* configure.in: check if succeeded in creating config.h.
+Wed Mar 10 22:28:09 2004  Minero Aoki  <aamine@loveruby.net>
 
-	* tool/ifchange: ignore failures when TEST_COLORS unmatched. just
-	  use the default value if expected name is not contained in it.
-	  [ruby-core:75046] [Bug #12303]
+	* lib/fileutils.rb (remove_dir): should handle symlink correctly.
+	  This patch is contributed by Christian Loew.  [ruby-talk:94635]
+	  (Backport from main trunk)
 
-Wed Apr 20 17:33:31 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Mar 10 16:28:42 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* ext/cgi/escape/escape.c (cgiesc_unescape): define unescape
-	  method instead of _unescape, and should pass the optional
-	  argument to the super method.
+	* eval.c (return_jump): set return value to the return
+	  destination.  separated from localjump_destination().
 
-	* lib/cgi/util.rb (CGI::Util#_unescape): remove intermediate
-	  method.
+	* eval.c (break_jump): break innermost loop (or thread or proc).
 
-Wed Apr 20 15:52:28 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* eval.c (rb_yield_0): set exit_value for block break.
 
-	* error.c (syntax_error_initialize): move the default message,
-	  "compile error", from parse.y.  the default parameter should
-	  belong to the class definition.
+Wed Mar 10 15:58:43 2004  Ryan Davis  <ryand@zenspider.com>
 
-	* parse.y (yycompile0): use the default parameter.
+	* eval.c (eval): Only print backtrace if generating the backtrace
+	  doesn't generate an exception.  [ruby-core:02621]
 
-Wed Apr 20 10:25:53 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Mar  9 13:04:26 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* compile.c (append_compile_error): use rb_syntax_error_append.
+	* io.c (rb_io_ungetc): raise IOError instead of calling
+	  rb_sys_fail().  [ruby-talk:23181]
 
-	* error.c (rb_syntax_error_append): append messages into a
-	  SyntaxError exception instance.
+Mon Mar  8 19:32:28 2004  akira yamada  <akira@ruby-lang.org>
 
-	* parse.y (yycompile0): make new SyntaxError instance in main
-	  mode, otherwise error_buffer should be a SyntaxError if error
-	  has occurred.
+	* lib/uri/common.rb (URI::REGEXP::PATTERN::HOSTPORT): (?:#{PORT})
+	  -> (?::#{PORT}).  [ruby-dev:23170]
 
-Tue Apr 19 17:42:47 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon Mar  8 15:31:41 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
 
-	* error.c (err_vcatf): rename, and separate appending message from
-	  creating a string buffer.
+	* dir.c (range): treat incomplete '[' as ordinary character (like
+	  has_magic does).
 
-	* error.c (rb_syntax_error_append): merge rb_error_vsprintf and
-	  rb_compile_err_append.
+	* dir.c (range):  Cancel above change. More discussion is needed.
 
-	* parse.y (parser_compile_error): use rb_syntax_error_append.
+Sun Mar  7 22:37:46 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
 
-Tue Apr 19 13:46:19 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/drb/ut_drb.rb: use 'druby://localhost:0'. [ruby-dev:23078]
 
-	* compile.c (append_compile_error, compile_bug): pass iseq and get
-	  error info and file from it, not by the thread error info.
+	* test/drb/ut_eval.rb: ditto.
 
-	* error.c (rb_report_bug_valist): take va_list instead of variadic
-	  arguments, and just report the bug but not abort.
+	* test/drb/ut_large.rb: ditto.
 
-Tue Apr 19 13:18:12 2016  Naotoshi Seo  <sonots@gmail.com>
+	* test/drb/ut_safe1.rb: ditto.
 
-	* lib/time.rb: revert r54167 because it would break
-	  backward compatibilities, and it is documented that
-	  Time.parse does not take into account time zone
-	  abbreations other than ones described in RFC 822
+	* test/drb/ut_drb_drbssl.rb: use 'drbssl://localhost:0'.
 
-Tue Apr 19 13:12:03 2016  Naotoshi Seo  <sonots@gmail.com>
+Sun Mar  7 16:22:26 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
 
-	* ChangeLog: Fix dates of previous commits
+	* Makefile.in (lex.c): use $? instead of $<.
 
-Tue Apr 19 12:45:03 2016  Naotoshi Seo  <sonots@gmail.com>
+Fri Mar  5 00:54:14 2004  Dave Thomas  <dave@pragprog.com>
 
-	* ChangeLog: Add descriptions for logger updates
-	* NEWS: Add descriptions for logger updates
+	* lib/test/unit.rb: MOve RDoc documentation so that you can
+	  now say 'ri Test::Unit'
 
-Tue Apr 19 12:45:02 2016  Naotoshi Seo  <sonots@gmail.com>
+Tue Mar  2 12:32:59 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/logger.rb: Add shift_period_suffix option
+	* win32/Makefile.sub, wince/Makefile.sub (config.h): shouldn't check
+	  defined? NORETURN. [ruby-dev:23100]
 
-Tue Apr 19 12:45:01 2016  Naotoshi Seo  <sonots@gmail.com>
+Mon Mar  1 12:24:10 2004  Dave Thomas  <dave@pragprog.com>
 
-	* lib/logger.rb: Allow specifying logger parameters in constructor
-	  such as level, progname, datetime_format, formatter.
+	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_alias):
+	  Allow aliases to have parentheses
 
-Mon Apr 18 16:07:01 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sun Feb 29 23:14:53 2004  Dave Thomas  <dave@pragprog.com>
 
-	* compile.c (iseq_peephole_optimize): should not replace the
-	  current target INSN, not to follow the replaced dangling link in
-	  the caller.  [ruby-core:74993] [Bug #11816]
+	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_class):
+	  Handle :nodoc: on singleton classes.
 
-Mon Apr 18 12:56:31 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Feb 28 10:58:49 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
 
-	* numeric.c (flo_truncate): add an optional parameter, digits, as
-	  well as Float#round.  [Feature #12245]
+	* MANIFEST: add test_erb.rb
 
-	* numeric.c (int_truncate): add an optional parameter, digits, as
-	  well as Integer#round.  [Feature #12245]
+	* lib/erb.rb, test/erb/test_erb.rb: don't forget filename,
+	  if both filename and safe_level given. [ruby-dev:23050]
 
-Sun Apr 17 04:18:56 2016  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+Fri Feb 27 01:00:09 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
 
-	* tool/redmine-backporter.rb: revisions are strings.
+	* lib/drb/drb.rb, test/drb/drbtest.rb: require drb/eq.rb by default
 
-Sat Apr 16 14:26:49 2016  Yuichiro Kaneko  <yui-knk@ruby-lang.org>
+Wed Feb 25 21:16:25 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/date/date_core.c : remove not used f_getlocal macro.
-	  After r54553 f_getlocal macro is not used.
+	* instruby.rb (with_destdir): should return the given argument if no
+	  DESTDIR is given.
 
-Sat Apr 16 14:15:24 2016  Yuichiro Kaneko  <yui-knk@ruby-lang.org>
+	* instruby.rb: use path name expansion of cmd.exe.
 
-	* ext/date/date_core.c : remove not used f_utc6 macro.
-	  After r54169 f_utc6 macro is not used.
+Wed Feb 25 09:35:22 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Sat Apr 16 10:00:11 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* error.c (NameError::Message): new class for lazy evaluation of
+	  message to ensure replaced before marshalling. merge from HEAD.
+	  (ruby-bugs-ja:PR#588)
 
-	* struct.c (struct_make_members_list, rb_struct_s_def): member
-	  names should be unique. [ruby-core:74971] [Bug #12291]
+	* eval.c (rb_method_missing): use NameError::Message. merge from
+	  HEAD. (ruby-bugs-ja:PR#588)
 
-	* struct.c (struct_make_members_list): extract making member name
-	  list from char* va_list, with creating symbols without
-	  intermediate IDs.
+Tue Feb 24 18:59:37 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
 
-Sat Apr 16 01:33:27 2016  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+	* dir.c (glob_helper): '**/' should not match leading period
+	  unless File::FNM_DOTMATCH is set. (like '*/') [ruby-dev:23014]
 
-	* tool/redmine-backporter.rb: sort revisions.
+Tue Feb 24 13:22:21 2004  Dave Thomas  <dave@pragprog.com>
 
-Sat Apr 16 01:16:02 2016  Tanaka Akira  <akr@fsij.org>
+	* lib/rdoc/rdoc.rb (RDoc::RDoc::normalized_file_list): Attempt to get better
+	  heuristics on which files to include and exclude. Now only include
+	  non-standard files if they are explicitly named in ARGV.
 
-	* array.c (rb_ary_sum): Don't yield same element twice.
-	  Found by nagachika.
+Tue Feb 24 07:23:30 2004  Dave Thomas  <dave@pragprog.com>
 
-Sat Apr 16 01:03:32 2016  Tanaka Akira  <akr@fsij.org>
+	* lib/rdoc/generators/html_generator.rb: Deal with :stopdoc: when
+	  choosing a default main page to display (ie. don't select a page
+	  if we don't have documentation for it).
 
-	* array.c (rb_ary_sum): Fix SEGV by [1/2r, 1].sum.
+Tue Feb 24 06:40:14 2004  Dave Thomas  <dave@pragprog.com>
 
-Fri Apr 15 23:52:00 2016  Kenta Murata  <mrkn@mrkn.jp>
+	* lib/rdoc/parsers/parse_rb.rb (RubyLex::identify_identifier): Handle
+	  class variables in code listings
 
-	* rational.c (rb_rational_plus): rename from rb_rational_add
-	  to be aligned with rb_fix_plus.
+Tue Feb 24 06:40:14 2004  Dave Thomas  <dave@pragprog.com>
 
-	* array.c (rb_ary_sum): ditto.
+	* lib/rdoc/parsers/parse_rb.rb (RubyLex::identify_identifier): Handle
+	  class variables in code listings
 
-	* internal.h: ditto.
+Tue Feb 24 06:32:27 2004  Dave Thomas  <dave@pragprog.com>
 
-Fri Apr 15 23:42:00 2016  Kenta Murata  <mrkn@mrkn.jp>
+	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::do_aliases): Handle
+	  aliases in C files.
 
-	* rational.c (rb_rational_add): rename from nurat_add.
+Tue Feb 24 06:16:22 2004  Dave Thomas  <dave@pragprog.com>
 
-	* array.c (rb_ary_sum): use rb_rational_add directly.
+	* lib/rdoc/rdoc.rb (RDoc::RDoc::document): Now create op dir _before_
+	  parsing files.
 
-	* test/ruby/test_array.rb (test_sum): add assertions for an array of
-	  Rational values.
+Tue Feb 24 06:08:47 2004  Dave Thomas  <dave@pragprog.com>
 
-Fri Apr 15 22:31:00 2016  Kenta Murata  <mrkn@mrkn.jp>
+	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_constant):
+	  Start collecting text of constant values earlier: was missing
+	  values in output if there was no space after '='
 
-	* array.c (rb_ary_sum): apply the precision compensated algorithm
-	  for an array in which Rational and Float values are mixed.
+Tue Feb 24 06:08:25 2004  Dave Thomas  <dave@pragprog.com>
 
-	* test/ruby/test_array.rb (test_sum): add assertions for the above
-	  change.
+	* lib/rdoc/generators/html_generator.rb: Escape contant values.
 
-Fri Apr 15 22:30:01 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Feb 24 03:45:06 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
 
-	* thread.c (rb_thread_setname): defer setting native thread name
-	  set in initialize until the native thread is created.
-	  [ruby-core:74963] [Bug #12290]
+	* ext/openssl/ossl_config.c (ossl_config_each): add new method
+	  OpenSSL::Config#each. it iterates with section name, field name
+	  and value.
 
-Fri Apr 15 20:27:16 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* ext/openssl/ossl_config.c (Init_ossl_config): include Enumerable.
 
-	* lib/irb/ext/save-history.rb: Fix NoMethodError when method is not defined.
+Mon Feb 23 09:16:35 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Apr 15 15:38:58 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* instruby.rb (DOSISH): embedded path in batch files should not be
+	  prefixed by DESTDIR.  [ruby-core:02186]
 
-	* common.mk (benchmark): order options for built-ruby and compare-ruby.
+Sun Feb 22 09:54:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
 
-Fri Apr 15 14:14:00 2016  Kenta Murata  <mrkn@mrkn.jp>
+	* re.c: corrected documentation format (again)
 
-	* test/ruby/test_array.rb (test_sum): add assertions for Rational and
-	  Complex numbers.
+Sun Feb 22 09:43:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
 
-Fri Apr 15 10:07:11 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* re.c: corrected documentation format (rb_reg_initialize_m)
 
-	* ext/io/console/console.c (console_key_pressed_p): raise the same
-	  exception, "unknown virtual key code", for names with nul chars.
-	  though console_win32_vk() considers the length and can deal with
-	  nul chars, rb_sprintf() raised at PRIsVALUE previously, so quote
-	  it if it is unprintable.
+Sat Feb 21 22:36:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
 
-Fri Apr 15 09:02:58 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/zlib/zlib.c: documented, but needs more effort.
 
-	* ext/io/console/console.c (rb_sym2str): fallback definition for
-	  older ruby.  [ruby-core:74953] [Bug #12284]
+Sat Feb 21 11:12:15 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Apr 14 21:46:36 2016  Tanaka Akira  <akr@fsij.org>
+	* missing/os2.c, missing/x68.c: typo fix.  pointed out by greentea.
 
-	* array.c (rb_ary_sum): Support the optional argument, init, and
-	  block.
+Fri Feb 20 18:59:47 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Thu Apr 14 19:02:41 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* lib/irb/init.rb (IRB::IRB.parse_opts): add -I option to
+	  irb. [ruby-dev:39243]
 
-	* lib/irb/ext/save-history.rb: suppress warning: method redefined;
-	  discarding old save_history=.
+Thu Feb 19 23:24:16 2004  Dave Thomas  <dave@pragprog.com>
 
-Thu Apr 14 14:58:14 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/rdoc/generators/html_generator.rb (Generators::HtmlClass::build_attribute_list):
+	  Support visibility modifiers for attributes
 
-	* ext/tk/tkutil/tkutil.c (tk_hash_kv): the third argument can be
-	  nil not only an Array.  reported by @windwiny at
-	  https://github.com/ruby/ruby/commit/cdaa94e#commitcomment-17096618
+Thu Feb 19 23:24:16 2004  Dave Thomas  <dave@pragprog.com>
 
-Thu Apr 14 14:28:55 2016  cremno phobia  <cremno@mail.ru>
+	* lib/rdoc/generators/html_generator.rb (Generators::HtmlClass::build_attribute_list):
+	  Support visibility modifiers for attributes
 
-	* cont.c (fiber_initialize_machine_stack_context): fix wrong
-	  _MSC_VER check, should be decimal but not hexadecimal.
-	  [ruby-core:74936] [Bug #12279]
+Thu Feb 19 22:39:04 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-Wed Apr 13 22:51:38 2016  Tanaka Akira  <akr@fsij.org>
+	* test/rinda/test_rinda.rb: DRb.start_service only once in testsuites.
+	  DRb.start_service could handle this.
 
-	* array.c (rb_ary_sum): Array#sum is implemented.
-	  Kahan's compensated summation algorithm for precise sum of float
-	  numbers is moved from ary_inject_op in enum.c.
+Thu Feb 19 22:19:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
 
-	* enum.c (ary_inject_op): Don't specialize for float numbers.
+	* lib/ostruct.rb: documented
 
-	  [ruby-core:74569] [Feature #12217] proposed by mrkn.
+Thu Feb 19 21:28:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
 
-Wed Apr 13 15:56:35 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/strscan/strscan.c: improved documentation
 
-	* numeric.c (flo_ceil): add an optional parameter, digits, as
-	  well as Float#round.  [Feature #12245]
+Thu Feb 19 03:10:52 2004  Minero Aoki  <aamine@loveruby.net>
 
-	* numeric.c (flo_floor): add an optional parameter, digits, as
-	  well as Float#round.  [Feature #12245]
+	* ext/strscan/strscan.c: synchronized with main trunk (rev 1.11).
 
-	* numeric.c (int_ceil): add an optional parameter, digits, as
-	  well as Integer#round.  [Feature #12245]
+Thu Feb 19 02:30:34 2004  Minero Aoki  <aamine@loveruby.net>
 
-	* numeric.c (int_floor): add an optional parameter, digits, as
-	  well as Integer#round.  [Feature #12245]
+	* ext/strscan/strscan.c: documentation checked.
 
-Wed Apr 13 14:47:47 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Feb 19 00:11:05 2004  Dave Thomas  <dave@pragprog.com>
 
-	* file.c (Init_File): add alias File.empty? to File.zero?.
-	  [Feature #9969]
+	* lib/rdoc/markup/simple_markup/preprocess.rb (SM::PreProcess::handle):
+	  Strip extraneous space from filenames in :include:
 
-Wed Apr 13 14:36:24 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Feb 18 22:52:00 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
 
-	* parse.y (assign_in_cond): allow multiple assignment in
-	  conditional expression.  [Feature #10617]
+	* lib/drb/unix.rb: remove O_NONBLOCK, thanks \ay
 
-Wed Apr 13 14:11:59 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Feb 18 22:47:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
 
-	* bignum.c (rb_big_size): add wrapper function of BIGSIZE and
-	  rename the method function with _m suffix.
+	* ext/strscan/strscan.c: documented
 
-	* numeric.c (int_round_zero_p): extracted from rb_int_round.
-	  optimize for Bignum, and convert VALUE returned by Numeric#size
-	  to long.
+Wed Feb 18 22:03:11 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-Wed Apr 13 12:00:08 2016  Koichi Sasada  <ko1@atdot.net>
+	* test/*: should not depend on $KCODE.
 
-	* test/ruby/test_basicinstructions.rb: add a test to check access
-	  instance variables on special const objects.
+Wed Feb 18 17:18:01 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
 
-	  All of such objects are frozen, so that we can not set instance
-	  variables for them. But we can read instance variables and return
-	  default value (nil).
+	* ext/win32ole/win32ole.c: need to include <olectl.h> on Cygwin.
 
-Tue Apr 12 20:40:35 2016  Kaneko Yuichiro  <spiketeika@gmail.com>
+Wed Feb 18 10:40:38 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* ext/date/date_core.c (time_to_time): should preserve timezone
-	  info.  [ruby-core:74889] [Bug #12271]
+	* sprintf.c (rb_f_sprintf): do not prepend dots for negative
+	  numbers if FZERO is specified.  [ruby-list:39218]
 
-Tue Apr 12 11:51:18 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Feb 17 23:40:34 2004  Guy Decoux  <ts@moulon.inra.fr>
 
-	* compile.c (new_label_body): initialize bit fields, since
-	  compile_data_alloc does not clear the memory.  [Bug #12082]
+	* sprintf.c (rb_f_sprintf): preserve original val for
+	  format_integer. [ruby-talk:92975]
 
-Mon Apr 11 20:18:43 2016  Koichi Sasada  <ko1@atdot.net>
+Tue Feb 17 23:28:45 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-	* vm_backtrace.c (frame2klass): filter only for imemo_ment.
-	  T_IMEMO/imemo_iseq can be passed here.
+	* test/ruby/marshaltestlib.rb: common marshal testcase added.
 
-Mon Apr 11 17:43:04 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/ruby/test_marshal.rb: use above testsuite.
 
-	* compile.c (iseq_optimize): disable tail call optimization in
-	  rescued, rescue, and ensure blocks.
-	  [ruby-core:73871] [Bug #12082]
+	* test/soap/marshal/test_marshal.rb: ditto.
 
-Mon Apr 11 06:54:39 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/soap/marshal/cmarshal.rb: removed (not used).
 
-	* file.c (apply2files): apply to a VALUE vector instead of a
-	  temporary array.
+Tue Feb 17 10:51:23 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Sun Apr 10 20:54:16 2016  Joe Swatosh  <joe.swatosh@gmail.com>
+	* ext/syck/rubyext.c (syck_emitter_end_object): takes only one arg.
 
-	* ext/win32/lib/win32/registry.rb (DeleteValue, DeleteKey): fix
-	  API names.  [ruby-core:74863] [Bug #12264]
+Tue Feb 17 01:35:28 2004  Tanaka Akira  <akr@m17n.org>
 
-Sun Apr 10 17:47:42 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* eval.c (rb_eval): care that another thread replace NODE_DREGX_ONCE
+	  to NODE_LIT.  [ruby-dev:22920]
 
-	* file.c (rb_realpath_internal): no argument conversions since
-	  this internal function does not need to_path and encoding
-	  conversions, not to be affected by the default internal
-	  encoding.
+Tue Feb 17 01:24:35 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* bcc32/Makefile.sub, win32/Makefile.sub (config.h): define
+	  STACK_GROW_DIRECTION. [ruby-dev:22910]
+
+	* bcc32/Makefile.sub (config.h): add newer checks.
+
+	* wince/Makefile.sub (config.h): define NEED_IO_SEEK_BETWEEN_RW.
+
+Tue Feb 17 00:38:10 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+
+	* lib/rinda/tuplespace.rb: TupleSpace#initialize, stop doubling timeout
+
+Tue Feb 17 00:18:03 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+
+	* test/rinda/test_rinda.rb: import test_rinda.rb
+
+Tue Feb 17 00:14:30 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* bcc32/Makefile.sub: avoid warning "Redefinition of macro
+	  'HAVE_GETLOGIN'".
+
+	* vms/config.h_in: ditto.
+
+Mon Feb 16 23:28:14 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* lib/csv.rb: document reduction.  [ruby-core:02429]
+
+Mon Feb 16 22:08:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
+
+	* lib/generator.rb: corrected doc format
+	* lib/rinda/rinda.rb: added documentation (from Hugh Sasse)
+	* lib/rinda/tuplespace.rb: ditto
+
+Mon Feb 16 20:41:32 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* bcc32/Makefile.sub: show more warnings. (refering to mingw)
+
+	* bcc32/setup.mak: ditto.
+
+Mon Feb 16 13:39:44 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* dir.c (rb_glob, rb_globi): add const.
+
+	* ruby.h: ditto.
+
+Mon Feb 16 02:16:33 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* bcc32/Makefile.sub: should warn suspicious pointer conversion.
+
+	* bcc32/setup.mak: ditto.
+
+Sun Feb 15 19:06:42 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+
+	* lib/rinda/tuplespace.rb: TupleSpace#read(tpl, 0), raise
+	  RequestExpiredError if not found.
+
+Sun Feb 15 15:56:46 2004  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
+
+	* ext/win32ole/win32ole.c: add IDispatch wrapper in val2variant.
+	  Thanks, arton.
+
+Sun Feb 15 01:46:05 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* lib/mkmf.rb: absolute path of ruby is assigned to $(RUBY).
+	  [ruby-dev:22870]
+
+Sat Feb 14 11:29:41 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+
+	* sample/drb/*: import lib/drb/sample
+
+Sat Feb 14 11:08:23 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+
+	* lib/drb/drb.rb: add pretty_print, thanks gotoken.
+
+Fri Feb 13 12:35:08 2004  Minero Aoki  <aamine@loveruby.net>
+
+	* test/fileutils/test_fileutils.rb: File.link may raise EINVAL and
+	  EACCES on Windows.
+
+Thu Feb 12 21:45:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
+
+	* lib/ftools.rb: documented
+
+Thu Feb 12 21:25:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
+
+	* lib/base64.rb: backported from HEAD (modularised and documented)
 
-Sat Apr  9 10:03:12 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Feb 12 20:31:48 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* load.c (rb_f_load): raise with the original path name before
-	  encoding conversion.
+	* lib/mkmf.rb (create_tmpsrc): cpp32 of Borland C++ ignores #error
+	  directives in DOS line-ending files at all.
 
-Sat Apr  9 02:05:10 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Feb 12 02:23:56 2004  Tanaka Akira  <akr@m17n.org>
 
-	* bignum.c (rb_cstr_parse_inum): [EXPERIMENTAL] new function to
-	  parse integer in C-string with length.  the name and the
-	  arguments may be changed in the future.
+	* lib/pathname.rb: use assert_raise instead of assert_raises.
 
-	* bignum.c (rb_str_to_inum): preserve encoding of the argument in
-	  error messages, and no longer needs to copy non-terminated
+	* lib/pp.rb: ditto.
+
+	* lib/time.rb: ditto.
+
+	* lib/tsort.rb: ditto.
+	  use TSortHash and TSortArray instead of Hash and Array in test.
+
+Wed Feb 11 20:01:12 2004  akira yamada  <akira@ruby-lang.org>
+
+	* test/ruby/test_file.rb (TestFile::test_fnmatch): added tests for
+	  File.fnmatch. [ruby-dev:22815][ruby-dev:22819]
+
+	* test/ruby/test_proc.rb (TestProc::test_eq): added a
+	  test.  [ruby-dev:22599]
+
+	* test/ruby/test_proc.rb (TestProc::test_eq): added tests for
+	   Proc#==.  [ruby-dev:22592], [ruby-dev:22601]
+
+Tue Feb 10 16:43:56 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (umethod_bind): purge unused check.  [ruby-dev:22850]
+
+Mon Feb  9 17:16:00 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* lib/rdoc/parsers/parse_c.rb: escape '{' and '}' to avoid warnings.
+
+Mon Feb  9 13:00:55 2004  Hirokazu Yamamoto  <ocean@m2.ccsnet.ne.jp>
+
+	* dir.c (fnmatch): File.fnmatch('*?', 'a') should return true.
+	  [ruby-dev:22815]
+
+	* dir.c (fnmatch): File.fnmatch('\[1\]' , '[1]') should return true.
+	  [ruby-dev:22819]
+
+Sun Feb  8 16:46:13 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/pp.rb (PP::PPMethods::object_address_group): suppress negative
+	  sign for higher heap areas.
+
+Fri Feb  6 22:48:16 2004  Dave Thomas  <dave@pragprog.com>
+
+	* lib/rdoc/generators/html_generator.rb (gen_url): Support
+	  https in RDoc hyperlinks
+
+Fri Feb  6 22:41:22 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* lib/pp.rb (PPInspectTest#test_to_s_with_iv): rollback the previous
+	  commit.  [ruby-dev:22813]
+
+Fri Feb  6 22:22:50 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* lib/pp.rb (PPInspectTest#test_to_s_with_iv): remove instance
+	  variable which is defined in the test.
+
+Fri Feb  6 00:48:37 2004  Tanaka Akira  <akr@m17n.org>
+
+	* lib/prettyprint.rb (PrettyPrint#first?): obsoleted.
+
+Thu Feb  5 23:56:55 2004  Tanaka Akira  <akr@m17n.org>
+
+	* lib/prettyprint.rb (PrettyPrint#seplist): added.
+
+	* lib/pp.rb (PPMethods#pp_object): use seplist.
+	  (PPMethods#pp_hash): ditto.
+	  (Array#pretty_print): ditto.
+	  (Struct#pretty_print): ditto.
+	  (MatchData#pretty_print): ditto.
+
+	* lib/set.rb (Set#pretty_print): use seplist.
+
+Wed Feb  4 02:12:06 2004  Tanaka Akira  <akr@m17n.org>
+
+	* file.c (test_l): fix wrong method name in document.
+	  (test_S): ditto.
+	  (test_b): ditto.
+	  (test_c): ditto.
+	  (test_suid): ditto.
+	  (test_sgid): ditto.
+	  (test_sticky): ditto.
+
+Tue Feb  3 08:04:57 2004  Tanaka Akira  <akr@m17n.org>
+
+	* lib/pp.rb (Struct#pretty_print_cycle): follow 1.8 style.
+
+Mon Feb  2 19:33:49 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* configure.in: backport from 1.9 for Interix.
+
+	* dln.c (dln_load): ditto.
+
+Mon Feb  2 13:31:51 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* lib/net/http.rb (canonical_each): fix merge miss.
+
+Mon Feb  2 01:54:00 2004  Tanaka Akira  <akr@m17n.org>
+
+	* lib/pp.rb (Struct#pretty_print): make it 1.8 style.
+	  (Numeric#pretty_print, FalseClass#pretty_print)
+	  (TrueClass#pretty_print, Module#pretty_print): fix pp for objects
+	  with instance variables.  [ruby-talk:91157]
+
+	* lib/open-uri.rb (URI::Generic#find_proxy): return nil on loopback
+	  address.
+
+	* lib/resolv-replace.rb (BasicSocket#send): don't replace because
+	  it has no hostname argument.
+	  (IPSocket.getaddress): raise SocketError instead of
+	  Resolv::ResolvError for errors.
+	  (TCPSocket#initialize, UDPSocket#bind, UDPSocket#connect)
+	  (SOCKSSocket#initialize): use IPSocket.getaddress instead of
+	  Resolv.getaddress.
+	  (UDPSocket#send): recognize 3 arguments form.  try all addresses on
+	  4 arguments form.
+
+Sun Feb  1 18:17:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
+
+	* lib/net/http.rb: merged coding style changes from HEAD.
+
+Sun Feb  1 16:15:00 2004  Gavin Sinclair  <gsinclair@soyabean.com.au>
+
+	* lib/test/unit.rb: rearranged documentation for RDoc's sake.
+	* lib/matrix.rb: improved documentation.
+	* lib/net/http.rb: slight documentation formatting improvement.
+
+Sun Feb  1 05:30:06 2004  Tanaka Akira  <akr@m17n.org>
+
+	* lib/open-uri.rb (URI::Generic#find_proxy): warn HTTP_PROXY.
+	 raise an errror on non-http proxy URI.
+	 (OpenURI::Buffer#<<): make a tempfile binmode.  [ruby-talk:90793]
+
+Sat Jan 31 09:20:32 2004  NAKAMURA, Hiroshi  <nakahiro@sairon.co.jp>
+
+	* sample/openssl/gen_csr.rb: wrong usage string.
+
+Sat Jan 31 01:00:32 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* lib/soap/wsdlDriver.rb, lib/wsdl/soap/operation.rb: add support of
+	  "parts" attribute of soap:body element in WSDL.
+
+	* lib/wsdl/xmlSchema/schema.rb: friendly warning message for
+	  simpleType element which is not supported for now.
+
+	* lib/soap/mapping/factory.rb: deleted unused methods.
+
+	* lib/soap/mapping/rubytypeFactory.rb: do no ignore case while xsi:type
+	  string <-> Ruby class name matching.
+
+	* test/wsdl/soap/{soapbodyparts.wsdl,test_soapbodyparts.wsdl}: new
+	  files.
+
+Thu Jan 29 23:56:00 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* util.c (mblen): fix overrun.  [ruby-dev:22672]
+
+Thu Jan 29 22:41:53 2004  Dave Thomas  <dave@pragprog.com>
+
+	* lib/rdoc/generators/html_generator.rb: Allow 'link:' in Tidylinks.
+	  THis means you can write "see f1[link:files/f1_rb.html]".
+
+Thu Jan 29 15:33:23 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/ossl_x509hame.c (ossl_x509name_initialize): change
+	  second argument. it expected to be a Hash not an Integer.
+
+	* ext/openssl/ossl_x509name.c (ossl_x509name_add_entry): add new
+	  function for OpenSSL::X509::Name#add_entry.
+
+	* ext/openssl/ossl_x509name.c (ossl_x509name_to_a): append ASN.1
+	  tag number to each element of return value.
+
+	* ext/openssl/ossl_x509name.c (Init_ossl_x509name): add constants
+	  OpenSSL::X509::Name::DEFAULT_OBJECT_TYPE and OBJECT_TYPE_TEMPLATE.
+
+	* ext/openssl/lib/openssl/x509.rb (OpenSSL::X509::Name#initialize):
+	  second argument takes OBJECT_TYPE_TEMPLATE by default.
+
+	* sample/openssl/gen_csr.rb: use OpenSSL::X509::Name.parse.
+
+Wed Jan 28 04:29:41 2004  Eric Schwartz  <emschwar@fc.hp.com>
+
+	* lib/cgi/session.rb: use LOCK_SH to read, and a few other
+	  improvements.  [ruby-core:02328]
+
+Tue Jan 27 11:09:29 2004  FUKUMOTO Atsushi  <fukumoto@nospam.imasy.or.jp>
+
+	* ext/socket/socket.c (s_recvfrom): sending length should be an
+	  invariant while retrying on EAGAIN.  [ruby-talk:89962]
+
+Tue Jan 27 10:35:18 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ext/win32ole/win32ole.c (set_argv): fix condition.
+
+Tue Jan 27 02:26:31 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* lib/webrick/httputils.rb (WEBrick:HTTPUtils::parse_header):
+	  refine regex for header-name.
+
+Tue Jan 27 00:30:11 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/Makefile.sub: rollback.
+
+Mon Jan 26 22:53:04 2004  Dave Thomas  <dave@pragprog.com>
+
+	* io.c: Remove documentation references to $defout.
+
+Mon Jan 26 15:11:47 2004  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* sample/exyacc.rb: escape '}' to avoid warning.
+
+Mon Jan 26 14:41:46 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* lib/delegate.rb (Delegator::initialize): preserve
+	  singleton_method_added method [ruby-dev:22685]
+
+	* lib/delegate.rb (Delegator::initialize): use Kernel::raise
+	  instead of mere raise.  [ruby-dev:22681]
+
+Mon Jan 26 12:47:17 2004  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tcltklib/tcltklib.c: define CONST84 when TCL_MAJOR_VERSION == 7
+
+Mon Jan 26 11:35:23 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/extmk.rb: Makefiles should depend on also rbconfig.rb.
+	  (ruby-bugs:PR#1256)
+
+	* ext/win32ole/win32ole.c (set_argv): set real arguments to
+	  WIN32OLE::ARGV.  [ruby-list:39073]
+
+Thu Jan 22 22:54:53 2004  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/imap.rb (BEG_REGEXP): allow 8-bit characters in quoted
+	  strings for Novell GroupWise Internet Agent.
+	* lib/net/imap.rb (DATA_REGEXP): ditto.
+
+Thu Jan 22 16:21:33 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (string_content): reset lexical states at the beginning of
+	  string contents.  [ruby-list:39061]
+
+Wed Jan 21 21:55:51 2004  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+
+	* lib/drb/drb.rb: remove O_NONBLOCK, thanks \ay
+	* lib/drb/extserv.rb: typo
+
+Wed Jan 21 17:57:56 2004  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/imap.rb (envelope): allow NIL.
+	* lib/net/imap.rb (body): ditto.
+	* lib/net/imap.rb (number): ditto.
+	* lib/net/imap.rb (ensure_nz_number): show a detailed error
+	  message.
+
+Wed Jan 21 16:44:20 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/mkmf.rb (merge_libs): squeeze successive same libraries.
+	  [ruby-dev:22652]
+
+Wed Jan 21 16:01:37 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/digest/rmd160/extconf.rb: have_library appends found library.
+
+Wed Jan 21 11:36:00 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* parse.y (block_append): update nd_end for "real" head node.
+	  [ruby-list:39058]
+
+Tue Jan 20 14:48:13 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/extconf.rb: should check <openssl/conf_api.h> instead
+	  of OPENSSL_VERSION_NUMBER. [ruby-list:39056]
+
+Tue Jan 20 14:43:17 2004  Dave Thomas  <dave@pragprog.com>
+
+	* lib/base64.rb: Add RDoc
+
+Tue Jan 20 14:25:51 2004  Dave Thomas  <dave@pragprog.com>
+
+	* lib/abbrev.rb: Add RDoc
+
+Tue Jan 20 13:22:39 2004  Dave Thomas  <dave@pragprog.com>
+
+	* lib/rdoc/generators/html_generator.rb: Document aliases at
+	  top-most level.
+
+	* lib/English.rb: Document English.rb.
+
+Tue Jan 20 02:49:22 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/extconf.rb: add check for OpenSSL version.
+	  [ruby-list:39054]
+
+Tue Jan 20 02:38:13 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* marshal.c (w_class): should not dump singleton class.
+	  [ruby-dev:22631]
+
+Tue Jan 20 01:31:36 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* io.c (lineno): typo fix(FIX2INT -> INT2FIX).
+
+Mon Jan 19 21:53:38 2004  akira yamada  <akira@ruby-lang.org>
+
+	* io.c, re.c, string.c, time.c: fixed up positions of RDocs.
+
+Mon Jan 19 07:09:20 2004  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* lib/date.rb: zone was wrong when it was behind UTC.
+	  Thanks Mark J. Reed.
+
+	* lib/date/format.rb: %z is now always replaced by four digits
+	  with a leading plus or minus sign.
+
+	* sample/cal.rb: added a class, anyway.
+
+Sun Jan 18 20:47:35 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* ruby.c: use translate_char() on Cygwin.
+
+Sun Jan 18 02:33:26 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* defines.h (_WIN32): undef _WIN32 on Cygwin before defining DOSISH.
+
+Sun Jan 18 00:23:55 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* marshal.c (class2path): check anonymous class/module before
+	  checking referable, and allow singleton classes.
+
+Fri Jan 16 14:33:35 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* marshal.c (class2path): get class path and check referable.
+	  [ruby-dev:22588]
+
+Fri Jan 16 09:52:23 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (proc_eq): Proc with empty body may not be equal.
+	  [ruby-dev:22590]
+
+Thu Jan 15 13:03:10 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (argf_read): do not append EOF.  (ruby-bugs-ja:PR#585)
+
+	* io.c (rb_io_fwrite): ad-hockery hack to get rid of HP-UX stdio
+	  weird behavior.  [ruby-dev:22424]
+
+Wed Jan 14 13:31:06 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/iconv/extconf.rb: wrapper iconv.rb is dependent on platform.
+
+Tue Jan 13 18:54:28 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* lib/logger.rb(Logger#msg2str): no special treatment for the object
+	  which responds to :to_str.  commited at 2004-01-11T21:46:27 by
+	  gsinclair.
+
+	* lib/logger.rb(LogDevice#initialize): remove type checking if the
+	  given object is a String.  Kernel.open handles it correctly.
+	  commited at 2004-01-11T21:46:27 by gsinclair.
+
+	* test/logger/test_logger.rb: follow above change (ArgumentError ->
+	  TypeError.)  follow above commit.
+
+Tue Jan 13 14:27:13 2004  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+
+	* lib/test/unit/ui/testrunnerutilities.rb (TestRunnerUtilities):
+	  moved run method which allows output level.  [ruby-dev:22554]
+
+Tue Jan 13 04:29:52 2004  Dave Thomas  <dave@pragprog.com>
+
+	* lib/rdoc/ri/ri_driver.rb (RiDriver::report_method_stuff):
+	  Show fully-qualified class names in class list.
+
+Tue Jan 13 01:04:37 2004  Dave Thomas  <dave@pragprog.com>
+
+	* lib/rdoc/ri/ri_paths.rb (RI::Paths): First attempt at
+	  incorporating DESTDIR in the rdoc installation.
+
+Mon Jan 12 23:27:19 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (primary): fix position after FCALL.  [ruby-dev:22574]
+
+Mon Jan 12 12:07:22 2004  Dave Thomas  <dave@pragprog.com>
+
+	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::do_methods):
+	  Someone changed the "// in eval.c" comments to "/*...*/" style,
+	  so the parsing of the source file name broke.
+
+	* object.c: Remove spurious space in TrueClass documentation.
+
+	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::find_body): Fix
+	  bad regexp: if the code before a documented method contained
+	  a comment that wasn't terminated by whitespace, that comment
+	  and all intervening code was included in the following
+	  method's documentation.
+
+	* lib/rdoc/ri/ri_formatter.rb (RI::HtmlFormatter::break_to_newline):
+	  HTML formats need explicit line breaks.
+
+Mon Jan 12 11:46:30 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (LIBPATHFLAG, RPATHFLAG): enclose paths with single
+	  quotes.  [ruby-dev:22564]
+
+	* lib/mkmf.rb (libpathflag): do not enclose with quotes always.
+
+	* {bcc32,win32,wince}/Makefile.sub (LIBPATHFLAG): quoted.
+
+Mon Jan 12 02:24:07 2004  Dave Thomas  <dave@pragprog.com>
+
+	* lib/rdoc/ri/ri_formatter.rb (RI::HtmlFormatter): Add HTML
+	  generation support to ri (Elliot Hughes)
+
+Mon Jan 12 02:24:07 2004  Dave Thomas  <dave@pragprog.com>
+
+	* lib/rdoc/ri/ri_formatter.rb (RI::HtmlFormatter): Add HTML
+	  generation support to ri (Elliot Hughes)
+
+Sun Jan 11 02:07:47 2004  Dave Thomas  <dave@pragprog.com>
+
+	* lib/rdoc/ri/ri_options.rb (RI::Options::OptionList::OptionList):
+	  Also accept command line options via the 'RI' environment variable.
+
+Sun Jan 11 02:07:47 2004  Dave Thomas  <dave@pragprog.com>
+
+	* lib/rdoc/ri/ri_options.rb (RI::Options::OptionList::OptionList):
+	  Also accept command line options via the 'RI' environment variable.
+
+Sat Jan 10 21:27:41 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (eval): need to add message delimiter. [ruby-dev:22561]
+
+Sat Jan 10 01:54:50 2004  Eric Sunshine  <sunshine@sunshineco.com>
+
+	* defines.h (__NeXT__): Ensure that all standard S_IRUSR, S_IWGRP,
+	  S_IRWXO, etc. macros are defined since future code might require
+	  them (even though present code only requires a subset).
+
+	* defines.h (__NeXT__): Bug fix: WORDS_BIGENDIAN was not being set
+	  correctly on Rhapsody when -arch compiler flag was used (via
+	  configure's --enable-fat-binary option).
+
+Fri Jan  9 10:05:14 2004  Siena.  <siena@faculty.chiba-u.jp>
+
+	* lib/mkmf.rb (libpathflag): use single quotes.  [ruby-dev:22440]
+
+Thu Jan  8 23:49:21 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* configure.in (RDOCTARGET): new macro.  if you want to install
+	  rdoc documentation, you need to run configure with
+	  --enable-install-doc.
+
+Thu Jan  8 21:29:43 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/ossl_pkey.c (ossl_pkey_to_der): removed; it returns
+	  public key only.
+
+	* ext/openssl/ossl_pkey_dh.c (ossl_dh_to_der): new function for
+	  OpenSSL::PKey::DH#to_der.
+
+	* ext/openssl/ossl_pkey_dsa.c (ossl_dsa_to_der): new function for
+	  OpenSSL::PKey::DSA#to_der.
+
+	* ext/openssl/ossl_pkey_rsa.c (ossl_rsa_to_der): new function for
+	  OpenSSL::PKey::RSA#to_der.
+
+Thu Jan  8 16:51:04 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* test/wsdl/datetime/test_datetime.rb: fixed a stupid testcase which
+	  dumps "E" at month-end.
+
+Thu Jan  8 11:20:01 2004  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* eval.c, object.c, process.c, re.c: don't use C++ style comments.
+
+Thu Jan  8 04:36:21 2004  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* lib/webrick/cgi.rb (WEBrick::CGI#initialize): should create
+	  @config[:Logger] if it was not given.
+
+	* sample/webrick/*: new files.
+
+	* MANIFEST: add sample/webrick/*
+
+Wed Jan  7 13:00:18 2004  Dave Thomas  <dave@pragprog.com>
+
+	* lib/rdoc/ri/ri_driver.rb: Fix problem where ri was
+	  being too eager to find matches of ambiguous method
+	  names (such as "ri Thread.join" would return both
+	  Thread.join and ThreadsWait.join)
+
+Wed Jan  7 12:35:41 2004  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* lib/debug.rb: revert command parse regexps.  [ruby-list:39014] by
+	  Shirai,Kaoru.
+
+Wed Jan  7 08:21:04 2004  Dave Thomas  <dave@pragprog.com>
+
+	* lib/rdoc/parsers/parserfactory.rb: Check for shebang
+	  line in files that would otherwise be treated as
+	  plain text.
+
+Tue Jan  6 22:13:34 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (rb_mod_modfunc): should break if m has no super class.
+	  [ruby-dev:22498]
+
+Tue Jan  6 21:55:02 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (fptr_finalize): should save errno just after failure.
+	  [ruby-dev:22492]
+
+Tue Jan  6 14:53:14 2004  Dave Thomas  <dave@pragprog.com>
+
+	* bin/ri: split out the display side, making it pluggable. Added
+	  new ri_driver and ri_display files in lib/rdoc/ri.
+
+Tue Jan  6 06:37:53 2004  Dave Thomas  <dave@pragprog.com>
+
+	* bin/rdoc: Add --ri-system switch
+
+	* lib/.document: Update with list of files that seem to have
+	  documentation
+
+	* lib/test/unit.rb: Reorder comment to make it RDoc friendly.
+
+	* Makefile.in: add install-nodoc target, and make it
+	  generate RDoc on default install.
+
+	* lib/rdoc/ri/ri_options.rb (RI::Options::parse): Add
+	  --doc-dir option to ri.
+
+Tue Jan  6 00:04:40 2004  Dave Thomas  <dave@pragprog.com>
+
+	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_method_or_yield_parameters):
+	  fix parsing if there are braces in a method parameter list
+
+Fri Jan  2 14:54:11 2004  Dave Thomas  <dave@pragprog.com>
+
+	* bin/ri: Add new --classes option, and arrange for
+	  help messages to be paged too.
+
+	* bin/rdoc: Add statistics.
+
+	* process.c: (MG) Added Process documentation
+
+	* lib/rdoc/ri/ri_formatter.rb (RI::AttributeFormatter::wrap):
+	  Fix problem with labels not displaying in RI labeled
+	  lists using BS and ANSI modes.
+
+Fri Jan  2 01:50:13 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* io.c (argf_eof): ARGF.eof? should not have any side effect.
+	  [ruby-dev:22469]
+
+Wed Dec 31 17:25:17 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* io.c (argf_each_byte): should return self.  [ruby-dev:22465]
+
+Wed Dec 31 11:20:34 2003  Dave Thomas  <dave@pragprog.com>
+
+	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::do_methods): Make
+	  file referenced in "// in sss.c" relative to current file.
+
+Wed Dec 31 11:17:37 2003  Dave Thomas  <dave@pragprog.com>
+
+	* lib/rdoc/generators/html_generator.rb: Fix problem when
+	  a public method was aliased, but the alias is then
+	  made private, and hence doesn't appear in RDoc output.
+
+Wed Dec 31 01:33:05 2003  Dave Thomas  <dave@pragprog.com>
+
+	* array.c, error.c, eval.c, io.c, prec.c, range.c, re.c,
+	  string.c, time.c: Add RDoc for Kernel functions, and tidy.
+
+Tue Dec 30 19:39:14 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* io.c (rb_f_readline): should raise EOFError at the end of
+	  files.  [ruby-dev:22458]
+
+	* io.c (argf_read): should concatenate input files when length
+	  argument is nil. [ruby-dev:22450]
+
+	* io.c (argf_read): should update supplied string buffer (2nd
+	  argument) even when IO#read is called multiple times.
+
+	* io.c: should initialize lineno by zero. [ruby-dev:22460]
+
+Tue Dec 30 12:30:30 2003  Dave Thomas  <dave@pragprog.com>
+
+	* lib/rdoc/code_objects.rb (RDoc::Context::find_symbol): If a
+	  class and a method have the same name, finding Xxx.abc was trying
+	  to find 'abc' in method 'Xxx', not class 'Xxx'.
+
+
+Tue Dec 30 08:32:32 2003  Dave Thomas  <dave@pragprog.com>
+
+	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_method):
+	  Handle undoing nesting of yield parameters correctly for:
+
+	  def each_entry(&b) Dir.foreach(@path) {|f| yield P.new(f) } end
+
+
+Tue Dec 30 08:32:32 2003  Dave Thomas  <dave@pragprog.com>
+
+	* lib/rdoc/parsers/parse_rb.rb (RDoc::RubyParser::parse_method):
+	  Handle undoing nesting of yield parameters correctly for:
+
+	    def each_entry(&block) Dir.foreach(@path) {|f| yield Pathname.new(f) } end
+
+Mon Dec 29 12:51:02 2003  Dave Thomas  <dave@pragprog.com>
+
+	* eval.c: Add RDoc for Kernel global functions.
+
+Mon Dec 29 11:00:16 2003  Dave Thomas  <dave@pragprog.com>
+
+	* array.c: Tidy up RDoc loose ends.
+
+Mon Dec 29 05:05:51 2003  Dave Thomas  <dave@pragprog.com>
+
+	* struct.c, random: Add RDoc comments
+
+Mon Dec 29 02:20:54 2003  Dave Thomas  <dave@pragprog.com>
+
+	* eval.c: Add RDoc for class Proc, Method, UnboundMethod
+
+Mon Dec 29 00:41:44 2003  Dave Thomas  <dave@pragprog.com>
+
+	* math.c: Add RDoc comments
+
+Sun Dec 28 20:19:11 2003  Tanaka Akira  <akr@m17n.org>
+
+	* ext/stringio/stringio.c (strio_sysread): StringIO.new.sysread didn't
+	  raise EOFError.
+
+	* ext/zlib/zlib.c (gzreader_gets): don't increment lineno when
+	  gzfile_read_all returns "".
+
+Sun Dec 28 15:25:08 2003  Dave Thomas  <dave@pragprog.com>
+
+	* class.c,object.c,parse.y,sprintf.c,variable.c: Document classes
+	  Object, Module, etc...
+
+Sun Dec 28 11:55:29 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* test/csv/test_csv.rb: generate bom.csv and mac.csv files on the fly.
+	  [ruby-talk:88852]
+
+	* test/csv/{bom.csv,mac.csv}: removed.
+
+Sun Dec 28 08:56:51 2003  Dave Thomas  <dave@pragprog.com>
+
+	* eval.c: Thead[Group] RDoc (thanks to MG)
+
+Sun Dec 28 03:50:05 2003  Dave Thomas  <dave@pragprog.com>
+
+	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::find_override_comment):
+	  Escape method names used in regexp
+
+Sun Dec 28 01:46:02 2003  Dave Thomas  <dave@pragprog.com>
+
+	* lib/rdoc/ri/ri_formatter.rb (RI::TextFormatter::display_flow_item):
+	  Add support for rules in 'ri' output.
+
+Sun Dec 28 01:35:35 2003  Dave Thomas  <dave@pragprog.com>
+
+	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::find_body):
+	  Sometimes the Ruby source aliases two otherwise
+	  unrelated methods (for example Kernel#object_id and
+	  Kernel#hash are both the same C function). Provide a
+	  facility to allow the methods to be documented
+	  separately.
+
+Sun Dec 28 01:05:31 2003  Dave Thomas  <dave@pragprog.com>
+
+	* marshal.c, signal.c: RDoc collemts added by Elliott Hughes
+
+Sun Dec 28 00:48:47 2003  Dave Thomas  <dave@pragprog.com>
+
+	* lib/rdoc/parsers/parse_c.rb (RDoc::C_Parser::find_class_comment):
+	  Some source files use lower case class or module names
+	  when naming the Init_XXX function in C.
+
+Sat Dec 27 23:41:46 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* configure.in: fix "test: too many arguments" error.
+
+Sat Dec 27 15:32:19 2003  Dave Thomas  <dave@wireless_3.local.thomases.com>
+
+	* time.c: RDoc comments added
+
+Sat Dec 27 15:07:57 2003  Dave Thomas  <dave@pragprog.com>
+
+	* object.c: Add RDoc comments for Symbol class.
+
+Sat Dec 27 14:42:30 2003  Dave Thomas  <dave@pragprog.com>
+
+	* numeric.c: Add RDoc comments.
+
+Sat Dec 27 00:44:00 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* io.c (next_argv): warn always for stdin on inplace edit mode.
+
+	* io.c (read_all): need to check string value.
+
+	* io.c (argf_read): allow ARGF.read(nil).  [ruby-dev:22433]
+
+Fri Dec 26 23:02:09 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* io.c (rb_f_backquote): need not to check nil result.
+	  [ruby-core:02078]
+
+	* io.c (rb_io_getline): should return nil when read_all gives
+	  empty string, even when nil rs is specified. [ruby-core:02077]
+
+Fri Dec 26 18:50:59 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in: check if getcontext and setcontext are available.
+
+	* eval.c: use presence of getcontext/setcontext.
+
+Fri Dec 26 16:40:53 2003  Tanaka Akira  <akr@m17n.org>
+
+	* lib/pathname.rb (PathnameTest#test_plus): add 2 assertions.
+
+Fri Dec 26 09:26:58 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* pack.c (pack_pack): add sign check for 'i', and 'l'.
+	  [ruby-dev:22427]
+
+	* bignum.c (rb_quad_pack): add range check for 'quad int'.
+
+Thu Dec 25 22:39:59 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* string.c (rb_str_update): don't return any value.
+
+Thu Dec 25 15:30:17 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* string.c (rb_str_update): call rb_str_modify().
+
+Thu Dec 25 05:08:09 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (search_required): search actual file name once when no
+	  extension specified.
+
+Thu Dec 25 04:00:44 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* stable version 1.8.1 released.
+
+Thu Dec 25 00:17:53 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* configure.in: check for nanosleep, -lrt if required.
+	  [ruby-core:02059]
+
+	* eval.c (thread_timer): use select(2) if nanosleep(2) is not
+	  available.
+
+	* eval.c: check __stub_getcontext for glibc on some platforms.
+	  [ruby-list:38984]
+
+Wed Dec 24 23:48:04 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* test/soap/test_basetype.rb, test/soap/marshal/test_marshal.rb
+	  test/xsd/test_xsd.rb: use "(-1.0 / (1.0 / 0.0))" instead of "-0.0"
+	  to express -0.0.  [ruby-talk:88786]
+
+Wed Dec 24 23:29:30 2003  Tanaka Akira  <akr@m17n.org>
+
+	* lib/tsort.rb (test_orphaned_break): removed.
+
+Wed Dec 24 20:53:06 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/sample/tkmulticolumnlist.rb: new sample
+
+	* ext/tk/sample/tkmultilistframe.rb: bug fix
+
+Wed Dec 24 20:37:37 2003  Eric Sunshine  <sunshine@sunshineco.com>
+
+	* configure.in (LDSHARED): Fixed typographical error in assignment of
+	  LDSHARED for Rhapsody which caused linking of extension modules to
+	  fail.
+
+Wed Dec 24 17:51:18 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* file.c (rb_thread_flock): enable thread support again.
+
+Wed Dec 24 16:46:08 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (catch_timer): do not call rb_thread_schedule() inside to
+	  avoid pthread_mutex_lock() deadlock.  interrupts to system calls
+	  are detected by TRAP_END via EINTR error.
+
+	* eval.c (thread_timer): do not post signal unless it is
+	  absolutely necessary.
+
+	* rubysig.h (TRAP_END): add CHECK_INTS to switch thread.
+
+	* regex.c (re_compile_pattern): check if nextp is smaller than
+	  pend.  [ruby-dev:22372]
+
+	* eval.c (umethod_bind): remove method overridden check.
+	  [ruby-dev:22366]
+
+Wed Dec 24 16:13:05 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/ossl_ssl.c (ossl_ssl_read): should check for error
+	  status by SSL_get_error().
+
+	* ext/openssl/ossl_ssl.c (ossl_ssl_write): ditto.
+
+Wed Dec 24 14:23:27 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/stringio/stringio.c (strio_read): clear the buffer argument
+	  when returning nil.  [ruby-dev:22363]
+
+	* test/ruby/ut_eof.rb (TestEOF::test_eof_0, TestEOF::test_eof_1):
+	  add buffer argument tests.
+
+Wed Dec 24 14:07:55 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/test/unit/assertions.rb: Modules are allowed to rescue.
+
+	* lib/test/unit/autorunner.rb: show output_level in order.
+
+	* lib/test/unit/collector/dir.rb: get rid of successive same
+	  directories in load path.
+
+	* test/testunit/test_assertions.rb (test_assert_nothing_raised,
+	  test_assert_raise): test for modules.
+
+Wed Dec 24 13:43:34 2003  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/net/imap.rb (authenticate): remove "\n" from base64 encoded
 	  strings.
 
-	* bignum.c (rb_str2big_{poweroftwo,normal,karatsuba,gmp}): ditto.
+Wed Dec 24 11:26:41 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* test/fileutils/test_fileutils.rb: should not create any
+	  files or directories in current directory.  [ruby-talk:88724]
+
+Wed Dec 24 10:29:53 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/stringio/stringio.c (strio_read): never return nil at
+	  unlimited read.  [ruby-dev:22334]
+
+	* ext/stringio/stringio.c (strio_read): support second
+	  argument.  [ruby-dev:22350]
+
+Wed Dec 24 09:38:49 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (arg): should return 0 after error.  [ruby-dev:22360]
+
+Wed Dec 24 00:56:54 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* io.c (read_all): do not return nil at the end of file.
+	  [ruby-dev:22334]
+
+	* io.c (argf_read): do not depend on nil at eof behavior of
+	  IO#read().
+
+	* eval.c (rb_thread_join): dup exception before re-raising it.
+
+	* io.c (rb_io_eof): call clearerr() to prevent side effect.  this
+	  patch is supplied by Masahiro Sakai <sakai@tom.sfc.keio.ac.jp>.
+	  [ruby-dev:22234]
+
+	* pack.c (OFF16): get offset for big endian machines.
+
+	* pack.c (pack_pack): use OFF16 instead of OFF16B.
+	  [ruby-dev:22344]
+
+	* pack.c (pack_unpack): ditto.
+
+Tue Dec 23 22:47:14 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* io.c (rb_io_check_readable): set FMODE_RBUF always, even if
+	  NEED_IO_SEEK_BETWEEN_RW is not defined. [ruby-dev:22340]
+
+	* io.c (rb_io_check_writable): clear FMODE_RBUF before writing
+	  something.
+
+Tue Dec 23 22:25:00 2003  Gavin Sinclair  <gsinclair@soyabean.com.au>
+
+	* lib/optparse.rb: incomplete RDoc documentation added in place of
+	  existing RD comments.  Tabs converted to spaces.
+
+Tue Dec 23 19:44:47 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* test/soap/test_streamhandler.rb (test_basic_auth): removed.
+	  soap4r + basic_auth is not officially supported in ruby/1.8.1 even
+	  though soap4r + basic_auth + http-access2 should run fine.
+
+Tue Dec 23 19:42:59 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* io.c (rb_io_ungetc): raise an exception at unread stream to
+	  avoid unspecified behavior.  [ruby-dev:22330]
+
+	* test/ruby/test_system.rb (test_syntax): glob relatively from
+	  __FILE__.
+
+Tue Dec 23 18:09:40 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* pack.c (pack_pack): remove unnecessary negative value check.
+	  [ruby-dev:22329]
+
+Tue Dec 23 17:26:55 2003  KONISHI Hiromasa  <konishih@fd6.so-net.ne.jp>
+
+	* bcc32/Makefile.sub (config.h): bcc has finite(). [ruby-list:38940]
+
+Tue Dec 23 16:08:16 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* lib/rexml/encodings/US-ASCII.rb: typo.  [ruby-talk:88650]
+
+	* test/ruby/test_system.rb: num of asserts depended on running dir.
+
+	* test/xsd/test_noencoding.rb: rexml + without iconv/uconv cannot
+	  handle euc-jp.  install iconv, uconv or xmlscan.
+
+Tue Dec 23 14:13:51 2003  akira yamada  <akira@ruby-lang.org>
+
+	* lib/uri/generic.rb (URI::Generic::check_userinfo,
+	  URI::Generic::check_user, URI::Generic::check_password): tests
+	  conflicts/depends with other components closely.
+
+	* test/uri/test_generic.rb (TestGeneric::test_set_component):
+	  added tets.
+
+Tue Dec 23 11:08:34 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* test/xsd/test_noencoding.rb: rescue Errno::EINVAL and do not test.
+	  "euc-jp" might not be in supported encoding name list.
+	  [ruby-talk:88650]
+
+Tue Dec 23 06:10:31 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* lib/webrick/cgi.rb (CGI): add support for mod_ruby.
+
+	* lib/webrick/cgi.rb (CGI::Socket): add check for existence of
+	  OpenSSL module in all HTTPS related methods.
+
+	* lib/webrick/cgi.rb (CGI::Socket#cipher): should create similar
+	  value to OpenSSL::SSLSocket#cipher.
+
+	* lib/webrick/httpresponse.rb (HTTPResponse#setup_header): should
+	  set "connection: close" if @keep_alive is false.
+
+	* lib/webrick/https.rb (HTTPrequest#meta_vars): add supprt for
+	  SSL_PROTOCOL, SSL_CIPHER_USEKEYSIZE and SSL_CIPHER_ALGKEYSIZE.
+
+Mon Dec 22 23:00:05 2003  akira yamada  <akira@ruby-lang.org>
+
+	* lib/uri/generic.rb (URI::Generic::check_opaque): fixed typo.
+
+Mon Dec 22 21:59:24 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/iconv/iconv.c (map_charset): always ensure code is a String.
+
+Mon Dec 22 21:15:29 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* class.c (rb_mod_init_copy): always copy singleton class.
+	  [ruby-dev:22325]
+
+Mon Dec 22 20:44:36 2003  akira yamada  <akira@ruby-lang.org>
+
+	* lib/uri/generic.rb (URI::Generic#route_from): accepts urls which
+	  has no host-part.
+
+	* test/uri/test_generic.rb (TestGeneric::test_route): added a test.
+
+Mon Dec 22 20:38:44 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/cgi.rb: reduce eval.
+
+	* lib/cgi.rb (CGI::QueryExtension::read_multipart): alias path to
+	  local_path.  [ruby-list:38883]
+
+Mon Dec 22 20:09:31 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* test/soap/test_property.rb: remove duplicated test method.
+
+Mon Dec 22 18:22:04 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* bcc32/Makefile.sub, win32/Makefile.sub (config.h): remove
+	  HAVE_ISINF definition to follow previous commits of missing.h
+	  and win32/win32.h.
+
+Mon Dec 22 17:23:42 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (ac_cv_func_setitimer): moved from defines.h
+
+	* defines.h, rubysig.h, signal.c: removed macro handling which
+	  should be done in configure.
+
+	* configure.in (intrinsics.h): check if present.
+
+	* ruby.h: include intrinsics.h if available.
+
+	* bignum.c, marshal.c: include ieeefp.h if available.
+
+	* missing.h (isinf): define as a macro if finite() and isnan()
+	  are available.  [ruby-core:02032]
+
+Mon Dec 22 17:07:31 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* configure.in (mingw): set isnan, finite and isinf to yes.
+
+Mon Dec 22 13:40:19 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* lib/soap/property.rb: passing block by reference.
+
+Mon Dec 22 00:32:43 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Thu Apr  7 19:04:03 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* eval.c (rb_with_disable_interrupt): use ENABLE_INTS instead of
+	  ALLOW_INTS which may switch context.  [ruby-dev:22319]
 
-	* doc/regexp.rdoc (comments): [DOC] terminators cannot appear in
-	  comments.  [ruby-core:74838] [Bug #12256]
+	* ext/syck/emitter.c (syck_emitter_write): str bigger than
+	  e->bufsize causes buffer overflow.  [ruby-dev:22307]
 
-Thu Apr  7 11:24:14 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sun Dec 21 17:29:00 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/tk/tkutil/tkutil.c (cbsubst_initialize): fix out-of-bound
-	  access when no arguments given.  `p Tk::Event.new` crashed.
+	* class.c (rb_check_inheritable): new function.  [ruby-dev:22316]
 
-Fri Apr  1 01:26:00 2016  Benoit Daloze  <eregontp@gmail.com>
+	* intern.h: add prototype.
 
-	* ext/coverage/coverage.c: Fully reset coverage to not persist global state.
-	  It was returning old file coverages as empty arrays to the user.
-	  [ruby-core:74596] [Bug #12220]
+	* eval.c (superclass): use rb_check_inheritable().
 
-	* ext/coverage/coverage.c (rb_coverages): remove unused static state.
+	* object.c (rb_class_initialize): check argument validity.
 
-	* thread.c: Moved and renamed coverage_clear_result_i to reset_coverage_i.
+Sun Dec 21 16:25:10 2003  Tanaka Akira  <akr@m17n.org>
 
-	* test/coverage/test_coverage.rb: improve precision of tests.
+	* lib/pathname.rb (Pathname#+): re-implemented to resolve ".." in
+	  beginning of the argument.
+	  (Pathname#join): concatenate from the last argument.
+	  (Pathname#parent): just use Pathname#+.
 
-Wed Apr  6 22:41:31 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sun Dec 21 00:12:37 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-	* configure.in (rb_cv_lgamma_r_m0): fix the condition for
-	  lgamma_r(-0.0).  [Bug #12249]
+	* ext/tk/lib/tk.rb: add new methods (TkScrollbar#assign, assign_list)
 
-Wed Apr  6 17:38:42 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* ext/tk/sample/tkmultilistframe.rb: use TkScrollbar#assign method
 
-	* tool/downloader.rb (RubyGems.download): follow the change of the
-	  rubygems ssl_certs directory tree introduced by previous commit.
+Sat Dec 20 21:59:03 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
 
-Wed Apr  6 15:00:27 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* lib/webrick/httprequest.rb (HTTPRequest#meta_vars): refine regexp.
 
-	* lib/rubygems.rb, lib/rubygems/*, test/rubygems/*: Update rubygems-2.6.3.
-	  Please see entries of 2.6.3 on
-	  https://github.com/rubygems/rubygems/blob/master/History.txt
+	* lib/webrick/cgi.rb (CGI#start): NPH scripts return status line
+	  instead of Status: header field.
 
-Wed Apr  6 14:13:28 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/webrick/cgi.rb (CGI::Socket): refine some coditions.
 
-	* configure.in (rb_cv_lgamma_r_m0): check if lgamma_r(-0.0)
-	  returns negative infinity.  [Bug #12249]
+Sat Dec 20 16:07:14 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* math.c (ruby_lgamma_r): define by the configured result.
+	* lib/optparse.rb (OptionParser::Completion::complete): wrong
+	  Regexp for word boundary.  pointed out by Gavin Sinclair.
 
-Wed Apr  6 10:56:15 2016  Anton Davydov  <antondavydov.o@gmail.com>
+	* lib/optparse.rb (OptionParser::make_switch): [no-] prefix was
+	  missing.
+
+Sat Dec 20 11:40:10 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/yaml.rb (YAML::YAML): adjust Marshal version.
+
+Sat Dec 20 03:56:02 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (rb_with_disable_interrupt): prohibit thread context
+	  switch during proc execution.  [ruby-dev:21899]
+
+Sat Dec 20 02:41:02 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* lib/webrick/cgi.rb: add file. (yet another CGI library)
+
+	* MANIFEST: add lib/webrick/cgi.rb.
+
+Sat Dec 20 02:18:31 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* misc/ruby-mode.el (ruby-calculate-indent): proper indentation
+	  inside of parentheses.  [ruby-dev:22308]
+
+Fri Dec 19 21:24:22 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* lib/webrick/httprequest.rb (HTTPRequest#meta_vars): should not set
+	  HTTP_CONTENT_TYPE and HTTP_CONTENT_LENGTH.
+
+	* lib/webrick/https.rb (HTTPRequest#parse): should check presence
+	  of cert() method to detect SSLSocket.
+
+Fri Dec 19 22:56:46 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* lib/soap/property.rb (SOAP::Property#load): new method for loading
+	  property value into existing property tree.
+
+	* test/soap/test_property.rb: add test.
+
+Fri Dec 19 19:21:49 2003  akira yamada  <akira@ruby-lang.org>
+
+	* lib/runit/cui/testrunner.rb (RUNIT::CUI::TestRunner::run):
+	  should use Test::Unit::UI::{PROGRESS_ONLY,VERBOSE}.
+
+Fri Dec 19 17:36:49 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/sample/tkmultilistbox.rb: bug fix
+
+	* ext/tk/sample/tkmultilistframe.rb: new sample script
+
+Fri Dec 19 03:44:27 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* lib/webrick/httputils.rb (parse_form_data): should return an
+	  empty Hash if the body is empty.
+
+Thu Dec 18 21:47:35 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* lib/mkmf.rb (create_makefile): should remove deffile if it's
+	  made by miniruby. based on nobu's patch.
+
+Thu Dec 18 21:44:21 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* eval.c (stack_extend): ignore inline optimization on VC7.
+
+	* win32/Makefile.sub (OS, RT): can override.
+
+	* win32/Makefile.sub (LDFLAGS): ditto. shouldn't use pdb:none
+	  option. based on Tietew's patch [ruby-dev:22289]
+
+Thu Dec 18 16:38:44 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (fnmatch): unlike find_dirsep(), rb_path_next() never
+	  return NULL.
+
+Thu Dec 18 15:27:59 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* lib/ipaddr.rb (IPSocket::getaddress): merge usa's patch.
+	  [ruby-dev:21678]
+
+Wed Dec 17 15:15:30 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* lib/cgi.rb (CGI::QueryExtension::Value::[]): should work like
+	  String#[] if more than one arguments are specified.
+
+	* lib/delegate.rb: avoid using common instance name as "@obj".
+
+	* lib/cgi.rb (CGI::QueryExtension::Value): Value is no longer
+	  subclass of String, but DelegateClass(String).
+
+	* ext/curses/extconf.rb: restore function check for init_color.
+	  [ruby-list:38905]
+
+	* Makefile.in: need to specify $(MAINLIBS) for the miniruby
+	  generation rule.
+
+	* configure.in: better FreeBSD -lc_r support.
+
+Wed Dec 17 00:16:14 2003  Minero Aoki  <aamine@loveruby.net>
+
+	* ext/strscan/strscan.c: new method
+	  StringScanner#beginning_of_line? (alias #bol?)
+
+	* ext/strscan/strscan.c: new method StringScanner#concat and #<<.
+
+	* ext/strscan/strscan.c: StringScanner#new(str) does not duplicate
+	  nor freeze STR (allow destructive modification).
+
+	* test/strscan/test_stringscanner.rb: test new methods above.
+
+	* test/strscan/test_stringscanner.rb: test destructive string
+	  modification.
+
+Tue Dec 16 21:20:47 2003  Tanaka Akira  <akr@m17n.org>
+
+	* lib/pp.rb: don't use local variable `pp'.
+
+	* lib/prettyprint.rb: ditto.
+
+Tue Dec 16 13:20:43 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk.rb: condition bug of if statement on
+	  {pack,grid}_propagate methods
+
+Tue Dec 16 03:17:29 2003  why the lucky stiff  <why@ruby-lang.org>
+
+	* lib/yaml/rubytypes.rb: comments in strings. [ruby-talk:88012]
+
+	* test/yaml/test_yaml.rb: add test.
+
+Tue Dec 16 01:14:44 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (catch_timer): check rb_thread_crtical in main native
+	  thread.
+
+	* eval.c (thread_timer): just sends signals periodically, to
+	  prevent main native thread from receiving them in critical
+	  section.  [ruby-core:01959]
+
+Mon Dec 15 13:32:22 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (check_dirname): check string safety and remove extraneous
+	  trailing directory separators.  [ruby-dev:22279]
+
+	* file.c: renamed and externalized rb_path_next,
+	  rb_path_skip_prefix, rb_path_last_separator, rb_path_end.
+
+	* intern.h: prototypes for rb_path_next, rb_path_skip_prefix,
+	  rb_path_last_separator, rb_path_end.
+
+Mon Dec 15 09:27:46 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ext/openssl/ossl_pkcs12.c (ossl_pkcs12_initialize): first argument
+	  of rb_protect should take an argument of VALUE.
+
+Sun Dec 14 18:46:48 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* ext/socket/socket.c (Init_socket): IPv6 is not supported although
+	  AF_INET6 is defined on MinGW.
+
+	* lib/ipaddr.rb (AF_INET6): workaround in the environment which does
+	  not support IPv6.
+
+Sat Dec 13 18:55:16 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/iconv/charset_alias.rb: preserve original order.
 
-	* lib/logger.rb (Logger#level=): remove unnecessary local
+	* ext/iconv/extconf.rb: remove wrapper file at clean.
+
+Sat Dec 13 18:09:42 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (thread_timer): use timer by sub-thread and nanosleep.
+	  [ruby-talk:87519]
+
+	* gc.c (Init_stack): no stack adjustment for THREAD_SAFE.
+
+Sat Dec 13 17:17:59 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (proc_alloc): cache the created object at first time.
+	  [ruby-talk:61288], [ruby-dev:22240]
+
+Sat Dec 13 09:01:23 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in: check ucontext.h.
+
+	* eval.c: use getcontext/setcontext() instead of setjmp/longjmp()
+	  on ia64 or with native thread enabled.  [ruby-core:01932]
+
+Sat Dec 13 03:09:14 2003  why the lucky stiff  <why@ruby-lang.org>
+
+	* lib/yaml/rubytypes.rb: anonymous struct fix. [ruby-core:01946]
+
+	* test/yaml/test_yaml.rb: add test.
+
+Fri Dec 12 22:36:44 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* lib/csv.rb: add Cell#to_str and Cell#to_s for /.../ =~ aCell,
+	  "#{aCell}" and so on.
+
+	* test/csv/test_csv.rb: add tests.
+
+Fri Dec 12 19:33:06 2003  Minero Aoki  <aamine@loveruby.net>
+
+	* lib/fileutils.rb (mkdir): remove trailing `/' from pathes.
+
+	* lib/fileutils.rb (rmdir): ditto. [ruby-dev:22238]
+
+	* lib/fileutils.rb (rmdir_r): ditto.
+
+	* lib/fileutils.rb (fu_copy_dir): check if it is a directory after
+	  mkdir(2).
+
+Fri Dec 12 06:06:09 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (proc_invoke): fix class name in warning message for
+	  define_method.  [ruby-dev:22235]
+
+Thu Dec 11 21:24:43 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/ossl_pkcs12.[ch]: new files. add OpenSSL::PKCS12.
+
+	* ext/openssl/ossl.[ch]: ditto.
+
+	* ext/openssl/MANIFEST: add ossl_pkcs12.[ch].
+
+Thu Dec 11 20:54:28 2003  Minero Aoki  <aamine@loveruby.net>
+
+	* lib/fileutils.rb (mkdir_p): remove trailing `/' befere mkdir(2).
+	  mkdir("nonexistdir/") does not work on NetBSD/Alpha 1.6.1.
+
+	* lib/fileutils.rb (fu_list): call to_str for all arguments.
+
+Thu Dec 11 20:07:01 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* lib/ftools.rb (makedirs): sync with fileutils.
+
+Thu Dec 11 19:53:03 2003  Minero Aoki  <aamine@loveruby.net>
+
+	* lib/fileutils.rb (mkdir_p): catch all SystemCallErrors.
+	  (mkdir("C:\") causes EACCESS on Windows 2000/NTFS)
+
+Thu Dec 11 19:08:02 2003  Minero Aoki  <aamine@loveruby.net>
+
+	* lib/fileutils.rb (mkdir_p): check if it is a directory after
+	  mkdir(2) instead of before mkdir(2), to avoid race condition.
+	  [ruby-talk:87730]
+	  Refer: mkinstalldirs sh script, GNU mkdir(1) (coreutils 5.0)
+
+Thu Dec 11 18:49:30 2003  Minero Aoki  <aamine@loveruby.net>
+
+	* lib/fileutils.rb: def m( arg ) -> def m(arg).
+
+Thu Dec 11 11:39:43 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (ieeefp.h), numeric.c: needed for finite() on
+	  Solaris.  [ruby-core:01921]
+
+	* file.c (rb_stat_inspect): adjust format specifier.
+
+	* parse.c (arg_prepend): nodetype() is for debug use.
+
+	* ruby.h (ISASCII, etc): cast to int to get rid of warning.
+
+	* ruby.h (alloca.h): include even in GCC.  [ruby-core:01925]
+
+	* ext/bigdecimal/bigdecimal.c (GetVpValue): adjust format
+	  specifier.
+
+	* ext/bigdecimal/bigdecimal.c (BigDecimal_prec, BigDecimal_coerce,
+	  BigDecimal_divmod): use rb_assoc_new() to suppress memory usage.
+
+	* ext/bigdecimal/bigdecimal.c (BigDecimal_split): ditto.
+
+	* ext/dl/sym.c (rb_dlsym_guardcall): guard itself should be
+	  volatile.
+
+	* ext/iconv/iconv.c (iconv_convert): ensure actual parameter with
+	  format specifier.
+
+	* ext/pty/pty.c (MasterDevice, SlaveDevice, deviceNo): do not
+	  define unless used.
+
+	* ext/pty/pty.c (getDevice): get rid of warning.
+
+	* ext/socket/socket.c (port_str, sock_s_getaddrinfo,
+	  sock_s_getnameinfo): FIX2INT() now returns long.
+
+	* ext/socket/socket.c (init_inetsock_internal): uninitialized
 	  variable.
 
-	* lib/logger.rb (Logger#initialize, Logger#reopen): [DOC] mention
-	  the default values.  cherrypicked from [GH-1319].
+	* ext/syck/rubyext.c (syck_parser_assign_io): add prototype.
 
-Wed Apr  6 10:17:53 2016  cremno phobia  <cremno@mail.ru>
+	* ext/syck/rubyext.c (rb_syck_mktime, yaml_org_handler): use
+	  ISDIGIT() instead of isdigit() to avoid warnings and for
+	  platforms which don't support non-ascii charater.
 
-	* math.c (ruby_lgamma_r): missing/lgamma_r.c is used on Windows,
-	  since msvcrt does not provide it.
+Wed Dec 10 19:28:56 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* missing/lgamma_r.c (lgamma_r): fix lgamma(-0.0).
-	  [ruby-core:74823] [Bug #12249]
+	* ext/stringio/stringio.c (strio_read): set EOF flag at short read.
+	  [ruby-dev:22223], [ruby-dev:22224]
 
-Wed Apr  6 01:22:55 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+Wed Dec 10 18:07:25 2003  Minero Aoki  <aamine@loveruby.net>
 
-	* math.c (ruby_lgamma_r): mswin's lgamma_r also seems to be wrong.
-	  cf. [Bug #12249]
+	* lib/erb.rb: new method ERB#filename(=). [ruby-dev:22208]
 
-Wed Apr  6 00:53:31 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Dec 10 17:54:51 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* math.c (ruby_lgamma_r): fix lgamma(-0.0) on mingw and OSX.
+	* ext/stringio/stringio.c (strio_read): do not set EOF flag when
+	  requested length is zero.  [ruby-dev:22214]
 
-	* math.c (ruby_tgamma): fix tgamma(-0.0) on mingw.
-	  [ruby-core:74817] [Bug #12249]
+Wed Dec 10 17:17:18 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Tue Apr  5 14:50:28 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* io.c (read_all): should return given string even if data read is
+	  empty.  [ruby-dev:22207]
 
-	* ext/nkf/nkf-utf8/nkf.c (mime_putc): fix typo.
-	  [Bug #12202] [ruby-core:74802]
+Wed Dec 10 17:16:06 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Apr  5 00:06:44 2016  Aeris  <aeris@imirhil.fr>
+	* ext/stringio/stringio.c (strio_read): adjust behavior at reading
+	  beyond EOF to IO.  [ruby-dev:22205]
 
-	* ext/openssl/ossl_ssl.c (ossl_ssl_tmp_key): Access to ephemeral
-	  TLS session key in case of forward secrecy cipher.  Only
-	  available since OpenSSL 1.0.2.  [Fix GH-1318]
+	* test/ruby/ut_eof.rb (TestEOF::Seek): test behaviors at reading
+	  beyond EOF.
 
-	* ext/openssl/extconf.rb: Check for SSL_get_server_tmp_key.
+	* test/ruby/test_file.rb, test/stringio/test_stringio.rb: include
+	  TestEOF::Seek test case.
 
-Mon Apr  4 23:37:05 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Dec 10 15:01:19 2003  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* vm_core.h (rb_vm_struct): make at_exit a single linked list but
-	  not RArray, not to mark the registered functions by the write
-	  barrier.  based on the patches by Evan Phoenix.
-	  [ruby-core:73908] [Bug #12095]
+	* test/monitor/test_monitor.rb (test_cond): use Queue#deq
+	  instead of sleep.
 
-Mon Apr  4 17:43:45 2016  Koichi Sasada  <ko1@atdot.net>
+Wed Dec 10 14:45:39 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
 
-	* gc.c: change default value of
-	  RUBY_GC_HEAP_FREE_SLOTS_MIN_RATIO 0.3 -> 0.2
-	  RUBY_GC_HEAP_FREE_SLOTS_MAX_RATIO 0.8 -> 0.65
+	* ext/pty/pty.c (HAVE_SYS_IOCTL_H): need to include <sys/ioctl.h>
+	  for TIOCSCTTY on *BSD.  based on gotoyuzo's patch.
+	  (ruby-bugs:PR#1211)
 
-	  These values are same as Ruby 2.0.0.
+	* ext/pty/pty.c (establishShell): should close descriptors if fork
+	  failed.
 
-	  This change cause GC counts.
-	  However, generational GC reduced each (minor) GC time and
-	  increase memory locality. So that not so big impact on my
-	  benchmarking results.
-	  (surprisingly, this fix speed up programs on some cases)
+Wed Dec 10 12:53:05 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
 
-	  You can change these values by environment variables
-	  if you feel wrong.
+	* win32/win32.h: define execv() using do_aspawn().
 
-Mon Apr  4 17:36:52 2016  Koichi Sasada  <ko1@atdot.net>
+	* process.c (proc_exec_v): remove #ifdef's which stopped needing.
 
-	* gc.c (get_envparam_double): take an upper_bound.
+Tue Dec  9 23:32:23 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-	  And also take an accept_zero flag which allow to accept zero
-	  even if lower_bound is set.
+	* ext/tk/lib/tk.rb, ext/tk/lib/tkcanvas.rb, ext/tk/lib/tkdialog.rb,
+	  ext/tk/lib/tkentry.rb, ext/tk/lib/tkscrollbox.rb, ext/tk/lib/tktext.rb,
+	  ext/tk/sample/tkalignbox.rb, ext/tk/sample/tkcombobox.rb,
+	  ext/tk/sample/tkmultilistbox.rb, ext/tk/sample/tkoptdb.rb, ext/tk/sample/tktextframe.rb,
+	  ext/tk/sample/demos-en/dialog1.rb, ext/tk/sample/demos-en/dialog2.rb,
+	  ext/tk/sample/demos-jp/dialog1.rb, ext/tk/sample/demos-jp/dialog2.rb:
+	  overrided instance methods, which are private methods on the super
+	  class, are changed to 'private'
 
-	* gc.c (ruby_gc_set_params): fix parameters.
+Tue Dec  9 19:53:02 2003  akira yamada  <akira@ruby-lang.org>
 
-	  RUBY_GC_HEAP_FREE_SLOTS_MAX_RATIO set 0.9 as *lower_bound*, so that
-	  it should be upper_bound.
-	  Set RUBY_GC_HEAP_FREE_SLOTS_MIN_RATIO as lower bound.
+	* lib/uri/generic.rb (URI::Generic#route_from0): make case insensitive
+	  for host-part.
 
-	  Also set lower/upper bound of RUBY_GC_HEAP_FREE_SLOTS_GOAL_RATIO to
-	  RUBY_GC_HEAP_FREE_SLOTS_MIN/MAX_RATIO.
+	* test/uri/test_generic.rb (test_route): added tests for the above
+	  change.
+
+Tue Dec  9 14:10:48 2003  Tanaka Akira  <akr@m17n.org>
 
-Mon Apr  4 16:41:32 2016  Koichi Sasada  <ko1@atdot.net>
+	* io.c (rb_io_check_readable): don't call io_seek if EOF flag is set,
+	  to avoid clearing EOF flag.
+	  (rb_io_check_writable): ditto.
 
-	* vm.c (Init_VM): should pass tokens.
+Tue Dec  9 02:53:55 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-Sun Apr  3 09:34:29 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/tk/sample/tkalignbox.rb: new sample script
 
-	* numeric.c (flodivmod): round division if it is a finite number
-	  and module is required.
+Tue Dec  9 00:45:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
 
-	* numeric.c (dbl2ival): do not round here.
+	* lib/test/unit/assertions.rb: renamed #assert_raises to #assert_raise
+	  and made the former call the latter. [ruby-core:01890]
 
-	* numeric.c (flo_ceil): use dbl2ival.
+	* test/testunit/test_assertions.rb: ditto.
 
-	* numeric.c (flo_round): round explicitly.
+Tue Dec  9 00:07:35 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-Sat Apr  2 15:24:18 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/soap/rpc/standaloneServer.rb: add 'shutdown' and 'status'
+	  methods as delegates to WEBrick.
 
-	* include/ruby/intern.h (rb_check_arity): returns argc.
+	* test/soap/calc/{test_calc.rb,test_calc2.rb},
+	  test/soap/helloworld/test_helloworld.rb,
+	  test/wsdl/datetime/test_datetime.rb, test/wsdl/raa/test_raa.rb:
+	  follow the change.
 
-Fri Apr  1 20:58:33 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Mon Dec  8 22:48:03 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* enc/unicode/case-folding.rb, casefold.h: Data generation to implement
-	  swapcase functionality for titlecase characters. Swapcase isn't defined
-	  by Unicode, because the purpose/usage of swapcase is unclear anyway.
-	  The implementation follows a proposal from Nobu, swapping the case of
-	  each component of a titlecase character individually.
-	  This means that the titlecase characters have to be decomposed.
+	* lib/test/unit/autorunner.rb: remove dependency to a particular
+	  runner.  [ruby-core:01901], [ruby-list:38869]
 
-	* enc/unicode.c: Code using the above data.
+	* lib/test/unit/ui/testrunnerutilities.rb: moved output level
+	  constants from Console.
 
-	* test/ruby/enc/test_case_mapping.rb: Tests for the above.
+	* lib/test/unit/ui/console/testrunner.rb: ditto.
 
-Fri Apr  1 14:55:28 2016  Kazuki Yamaguchi  <k@rhe.jp>
+	* lib/test/unit/ui/{fox,gtk,gtk2,tk}/testrunner.rb (initialize):
+	  accept output_level.
 
-	* configure.in (AC_CONFIG_FILES): $srcdir/.git can be a file pointing
-	  the real git_dir, such as when the git working tree is a "linked
-	  working tree" (a working tree created by git-worktree). So use
-	  git-rev-parse --git-dir to check if $srcdir is the top-level of a git
-	  repository, not just checking if the $srcdir/.git directory does exist
-	  or not.  [ruby-core:74759] [Bug #12239]
+Mon Dec  8 15:03:30 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* tool/change_maker.rb: use tool/vcs.rb to detect VCS. This used to have
-	  its own VCS detection code, while we have tool/vcs.rb.
+	* ext/syck/syck.c (syck_io_str_read): get rid of buffer overflow.
 
-	* tool/vcs.rb (detect): remove code duplication
+Mon Dec  8 13:02:11 2003  Minero Aoki  <aamine@loveruby.net>
 
-Fri Apr  1 04:50:44 2016  Eric Wong  <e@80x24.org>
+	* lib/uri/common.rb: new method URI.regexp. [ruby-dev:22121]
 
-	* ext/openssl/ossl_ssl.c (ossl_sslctx_s_alloc):
-	  enable SSL_MODE_ACCEPT_MOVING_WRITE_BUFFER by default
-	  [Bug #12126]
+	* test/uri/test_common.rb: add test for URI.regexp.
 
-Fri Apr  1 01:13:55 2016  Benoit Daloze  <eregontp@gmail.com>
+Mon Dec  8 12:44:14 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* thread.c (update_coverage): Do not track coverage in loaded files
-	  after Coverage.result. Avoids out-of-bounds access. [Bug #12237]
+	* pack.c: define swap16 and swap32 only if they are not
+	  defined. OpenBSD defines these macros. [ruby-dev:22181]
 
-	* ext/coverage/coverage.c (coverage_clear_result_i): document.
+Sun Dec  7 20:54:17 2003  Tanaka Akira  <akr@m17n.org>
 
-Thu Mar 31 19:16:16 2016  Koichi Sasada  <ko1@atdot.net>
+	* ext/iconv/iconv.c (map_charset): make case sensitive.
+	  ext/iconv/charset_alias.rb (charset_alias): don't ignore
+	  config.charset's information.  sort aliases.
 
-	* gc.c: need to set initial value of GC_HEAP_FREE_SLOTS_GOAL_RATIO.
+Sat Dec  6 22:58:03 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
 
-Thu Mar 31 17:50:27 2016  Koichi Sasada  <ko1@atdot.net>
+	* ext/openssl/ossl_ssl.c (ossl_start_ssl): new function to wrap
+	  SSL_connect and SSL_accept; if SSL_connect (or SSL_accept) returned
+	  but not finished the handshake process, we should retry it.
 
-	* gc.c: change additional allocation policy.
+	* ext/openssl/ossl_ssl.c (ossl_ssl_connect): call ossl_start_ssl.
 
-	  Introduce new environment variable
-	  RUBY_GC_HEAP_FREE_SLOTS_GOAL_RATIO (goal_ratio) to calculate the
-	  ratio of additional memory.
+	* ext/openssl/ossl_ssl.c (ossl_ssl_accept): ditto.
 
-	  Before this change, we add pages with the following formula
-	  (when free_slots < total_pages * RUBY_GC_HEAP_FREE_SLOTS_MIN_RATIO):
-	    next_pages = total_pages * RUBY_GC_HEAP_GROWTH_FACTOR
+	* ext/openssl/ossl_ssl.c (ossl_ssl_read): allow signal traps.
 
-	  This addition can allocate too much.
+Sat Dec  6 21:45:10 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
 
-	  With this change, we increase pages to satisfy the following formula:
-	    next_free_slots = next_total_slots * goal_ratio
-	  where
-	    next_free_slots = free_slots + adding_slots
-	    next_total_slots = total_slots + adding_slots.
+	* io.c (flush_before_seek): flush before seek on any platform.
 
-	  If you want to prepare many free slots, increase this ratio.
+	* configure.in: ditto.
 
-	  If this variable is 0, then simply multiply
-	  RUBY_GC_HEAP_GROWTH_FACTOR.
+Sat Dec  6 17:23:00 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-	* gc.c (get_envparam_double): enable to accept 0.
+	* lib/soap/soap.rb(SOAP::Env.getenv): allow upcase environment variable
+	  as well as downcase one.
 
-Thu Mar 31 17:48:25 2016  Koichi Sasada  <ko1@atdot.net>
+	* lib/soap/netHttpClient.rb(SOAP::NetHttpClient#proxy=): check URI.
 
-	* gc.c (gc_marks_finish): fix syntax error.
+Fri Dec  5 23:22:30 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Mar 31 16:49:36 2016  Koichi Sasada  <ko1@atdot.net>
+	* lib/test/unit/assertions.rb (Test::Unit::Assertions::assert_raises,
+	  Test::Unit::Assertions::assert_nothing_raised): use the last
+	  argument as message unless class object.
 
-	* gc.c: simplify allocate/free detecting logic at the end of marking.
+	* test/testunit/test_assertions.rb (test_assert_raises): test for
+	  multiple exception list.  [ruby-core:01891]
 
-	  Before this change, heap_pages_min_slots are calculated at the
-	  beginning sweeping phase. And this value is used at the end of
-	  *next* marking phase.
+	* test/testunit/test_assertions.rb (test_assert_nothing_raised): test
+	  for non-exception classes.
 
-	  To simplify it, we use this value at the end of this marking phase.
-	  It means that we don't need to store this value as global state.
+Fri Dec  5 22:23:04 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-	  Also heap_pages_max_slots is calculated at the begging of sweeping
-	  phase and used at the end of sweeping phase.
-	  To simplify this logic, we introduced new global value
-	  heap_pages_freeable_pages it means extra pages count we can free.
-	  gc_sweep_step() checks this value and moves empty pages to tomb_heap
-	  not more than this value.
+	* lib/soap/netHttpClient.rb: proxy support did not work.  fixed.
 
-	  Because of this fix, heap_pages_swept_slots is no longer needed.
+	* lib/soap/property.rb: add class methods for loading property from
+	  stream/file/propertyfile.  propertyfile is a file which is located at
+	  somedir in $:.
 
-	* gc.c (rb_objspace_t::heap_pages): restruct the objspace global
-	  status.
+	* lib/soap/soap.rb, lib/soap/wsdlDriver.rb, lib/soap/rpc/driver.rb,
+	  lib/wsdl/importer.rb: load property from propertyfile 'soap/property'
+	  e.g. /usr/local/lib/ruby/site_ruby/1.8/soap/property.
 
-	  remove the following fields
-	    * swept_slots (and heap_pages_swept_slots)
-	    * min_free_slots (and heap_pages_min_free_slots)
-	    * max_free_slots (and heap_pages_max_free_slots)
-	  And add the following filed.
-	    * freeable_pages (and heap_pages_freeable_pages)
+	* test/soap/test_property.rb, test/soap/test_streamhandler.rb: new file.
 
-	* gc.c (heap_pages_free_unused_pages): unlink tomb heap pages
-	  because tomb heap should have only freeable pages.
+Fri Dec  5 17:26:23 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* gc.c (heap_extend_pages): add parameters for future extension.
+	* eval.c (rb_exec_end_proc): maintain tmp_end_procs.
+	  [ruby-dev:22154]
 
-Thu Mar 31 16:43:02 2016  Koichi Sasada  <ko1@atdot.net>
+Fri Dec  5 13:36:59 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* gc.c: add GC parameters to configure the following values:
-	  * RUBY_GC_HEAP_FREE_SLOTS_MIN_RATIO:
-	    allocate additional pages when free slots is lower than
-	    the value (total_slots * (this ratio)).
-	  * RUBY_GC_HEAP_FREE_SLOTS_MAX_RATIO:
-	    allow to free pages when free slots is greater than
-	    the value (total_slots * (this ratio)).
+	* eval.c (rb_exec_end_proc): should not clear end_procs and
+	  ephemeral_end_procs before execution. [ruby-dev:22144]
 
-	  Before this change, these values are hard coded.
+	* eval.c (rb_obj_extend): call Module#extended hook after
+	  extended_object.  [ruby-list:38866]
 
-	* gc.c (ruby_gc_params_t): ditto.
+	* object.c (Init_Object): Module#extended defined.
 
-	* gc.c (ruby_gc_set_params): ditto.
+Fri Dec  5 13:17:30 2003  Tanaka Akira  <akr@m17n.org>
 
-Thu Mar 31 15:59:17 2016  Koichi Sasada  <ko1@atdot.net>
+	* test/ruby/test_pipe.rb: use IO.pipe instead of IO.popen.
 
-	* gc.c (gc_verify_heap_page): check the number of zombies.
+Fri Dec  5 11:54:45 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* gc.c (gc_verify_heap_pages): check also tomb heap.
+	* ext/stringio/stringio.c (strio_read): follow IO#read.
 
-Thu Mar 31 15:48:18 2016  Koichi Sasada  <ko1@atdot.net>
+	* test/ruby/ut_eof.rb, test/ruby/test_file.rb, test/ruby/test_pipe.rb,
+	  test/stringio/test_stringio.rb: add EOF test.
 
-	* gc.c (gc_page_sweep): return free slots count.
+Fri Dec  5 02:49:35 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* gc.c (gc_sweep_step): use returned free slots count.
+	* lib/test/unit/assertions.rb (Test::Unit::Assertions::assert_raises):
+	  allow multiple exception list.  [ruby-core:01884]
 
-	* gc.c (gc_sweep_step): change variable name `next'
-	  to `next_sweep_page'.
+	* lib/test/unit/assertions.rb (Test::Unit::Assertions::assert_nothing_raised):
+	  check whether arguments are subclass of Exception.
 
-Thu Mar 31 11:33:49 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Dec  4 23:54:00 2003  Rick Ohnemus  <rick.ohnemus@systemware.com>
 
-	* ext/date/date_core.c (d_lite_strftime, dt_lite_strftime): [DOC]
-	  fix indent not to be a big sole verbatim.
+	* dln.c (aix_loaderror): should not use member named 'errno' which
+	  might be a macro (e.g. on AIX).
 
-Thu Mar 31 11:18:19 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Dec  4 23:32:26 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* ext/date/date_core.c (Init_date_core): [DOC] fix misplaced doc
-	  of DateTime.  [ruby-core:74729] [Bug #12233]
+	* io.c (read_all): do not depend on lseek position.
+	  [ruby-dev:22026]
 
-Thu Mar 31 03:41:02 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+Thu Dec  4 22:37:26 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ext/nkf/nkf-utf8/nkf.c: Merge upstream 69f7e74dde.
-	  fix indent.
+	* eval.c (rb_eval): preserve $! value when retry happens in the
+	  rescue clause.  [ruby-talk:86697]
 
-Wed Mar 30 16:33:19 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Dec  4 21:50:07 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* extension.rdoc, extension.ja.rdoc: [DOC] Fix some errors.
-	  Renamed files, wrong method names or argument types; the example
-	  GetDBM macro is now updated to the current version of the actual
-	  code.  patch by Marcus Stollsteimer in [ruby-core:74690].
-	  [Bug #12228]
+	* lib/drb/drb.rb (DRb::DRbMessage::send_request, send_reply):
+	  should rescue errors and re-raise DRbConnError on write too.
+	  [ruby-dev:22132]
 
-Wed Mar 30 09:46:01 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+Thu Dec  4 16:41:17 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/open-uri.rb: Use `userinfo` for authenticated proxy.
-	  [fix GH-1148] Patch by @SokichiFujita
-	* test/open-uri/test_open-uri.rb: ditto.
-	  [fix GH-1309] Patch by @jdamick
+	* parse.y (exc_list): allow expanding list.  [ruby-dev:22134]
 
-Wed Mar 30 01:56:06 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+Thu Dec  4 14:09:24 2003  Minero Aoki  <aamine@loveruby.net>
 
-	* ext/nkf/nkf-utf8/nkf.c: Merge upstream 4f3edf80a0.
-	  patched by Anton Sivakov [Bug #12201] [Bug #12202]
+	* test/fileutils/test_fileutils.rb (test_cp): test if the error is
+	  kind of SystemCallError.  It is needless details that which errno
+	  is set on each systems.
 
-Wed Mar 30 01:54:30 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+Thu Dec  4 13:24:13 2003  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* tool/redmine-backporter.rb: add given revision to current changesets
-	  on associating the revision to the related ticket.
+	* lib/monitor.rb: use Object#__send__ instead of Object#send.
 
-Wed Mar 30 01:53:17 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+Thu Dec  4 13:17:45 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-	* tool/merger.rb: update revision.h before merge.
+	* lib/soap/streamHandler.rb: support latest released version of
+	  http-access2.
 
-Tue Mar 29 19:33:54 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+Thu Dec  4 13:04:44 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-	* addr2line.c: define toupper for its use. fix r54391.
+	* lib/soap/soap.rb: add SOAP::Env module for environment repository
+	  such as HTTP_PROXY.
 
-Tue Mar 29 19:23:46 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* lib/soap/property.rb: property implementation.
 
-	* include/ruby/ruby.h (rb_isupper, rb_islower, rb_isalpha, rb_isdigit,
-	  rb_isalnum, rb_isxdigit, rb_isblank, rb_isspace, rb_isblank,
-	  rb_iscntrl, rb_isprint, rb_ispunct, rb_isgraph,
-	  rb_tolower, rb_toupper): use inline function to avoid function call.
+	* lib/soap/streamHandler.rb, lib/soap/wsdlDriver.rb,
+	  lib/soap/rpc/driver.rb: use soap/property.rb.
 
-	* include/ruby/ruby.h (rb_isascii): use inline function to clarify
-	  the logic.
+	* lib/wsdl/importer.rb, lib/soap/wsdlDriver.rb, lib/soap/rpc/driver.rb:
+	  use SOAP::Env.
 
-Tue Mar 29 18:56:55 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* lib/soap/netHttpClient.rb: add basic_auth, ssl_config, and cookie
+	  management interface, but ignored for now.
 
-	* tool/redmine-backporter.rb (backport): show merger.rb's path.
+	* lib/xsd/charset.rb: add XSD::Charset.encoding= interface to set
+	  wiredump charset explicitly.  it was fixed to 'utf-8' when iconv or
+	  uconv module was found.
 
-	* tool/redmine-backporter.rb (show): show current issue again if no
-	  ticket number is given.
+Thu Dec  4 10:43:58 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* tool/redmine-backporter.rb (rel): show error message if current
-	  bugs.ruby-lang.org doesn't support the API.
+	* ext/dl/sym.c (rb_dlsym_guardcall): __declspec(noinline) is VC7
+	  feature.
 
-Tue Mar 29 18:54:34 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+Thu Dec  4 10:27:12 2003  Minero Aoki  <aamine@loveruby.net>
 
-	* tool/merger.rb: support to backport header as backport identifier.
-	  Now you can specify by 'merge revision(s) 49254: [Backport #10738]'.
+	* lib/net/http.rb: update hyperlink to the Japanese document.
 
-Tue Mar 29 16:53:44 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Thu Dec  4 09:12:43 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
 
-	* enc/unicode/case-folding.rb, casefold.h: Tweaked handling of 6
-	  special cases in CaseUnfold_11_Table.
+	* ext/openssl/ossl_asn1.c (asn1time_to_time): should check that
+	  the underlying value of ASN1_TIME isn't NULL. [ruby-core:01881]
 
-	* enc/unicode.c: Adjustments for above.
+Thu Dec  4 08:29:43 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
 
-	* test/ruby/enc/test_case_mapping.rb: Tests for the above: Some tests in
-	  test_titlecase activated; test_greek added. A test in test_cherokee fixed.
+	* lib/webrick/server.rb (GenericServer#start): should rescue
+	  Exception to avoid unexpected aborting. [ruby-core:01853]
 
-Tue Mar 29 13:31:00 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* lib/webrick/server.rb (GenericServer#start_thread): should check
+	  that peeraddr isn't nil before printing.
 
-	* enc/unicode.c: Cleaned up some comments.
+	* lib/webrick/httpresponse.rb (HTTPResponse#start_thread): should
+	  rescue Exception to avoid unexpected aborting of thread.
 
-Tue Mar 29 13:24:56 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Thu Dec  4 03:48:59 2003  Tanaka Akira  <akr@m17n.org>
 
-	* enc/unicode/case-folding.rb, casefold.h: Removing data for idempotent
-	  titlecasing.
+	* lib/pathname.rb (Pathname#link, Pathname#symlink): obsoleted.
+	  (Pathname#make_link, Pathname#make_symlink): new method.
 
-	* enc/unicode.c: Adjust code to data removal.
+Thu Dec  4 01:45:24 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Tue Mar 29 12:45:18 2016  Laurent Arnoud  <laurent@spkdev.net>
+	* io.c (argf_read): should not terminate on empty string; wait
+	  until real EOF.  [ruby-dev:21969]
 
-	* lib/webrick/httpresponse.rb: Move error_body to method. It allow to
-	  override the body more easily. [fix GH-1307]
-	* test/webrick/test_httpresponse.rb: ditto.
+	* io.c (argf_read): should adjust length to read, when length is
+	  specified and read spans command line argument files.
 
-Tue Mar 29 06:40:53 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Dec  3 19:38:36 2003  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
 
-	* error.c (rb_compile_err_append): rb_thread_t::base_block is no
-	  longer used.
+	* lib/drb/drb.rb: correct fcntl parameter. [ruby-dev:22120]
 
-	* iseq.c (rb_iseq_compile_with_option): ditto, no protection is
-	  needed.
+Wed Dec  3 13:49:07 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-Tue Mar 29 06:39:22 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/tk/lib/tk.rb: 'format'==>'Kernel.format' (avoid override trouble)
 
-	* parse.y (struct parser_params): move parse_in_eval flag from
-	  rb_thread_t.
+	* ext/tk/lib/tkafter.rb: ditto.
 
-	* parse.y (rb_parser_set_context): set parsing context, not only
-	  mild error flag.
+	* ext/tk/lib/tkcanvas.rb: ditto.
 
-	* iseq.c (rb_iseq_compile_with_option): the parser now refers no
-	  thread local states to be restored.
+	* ext/tk/lib/tkdialog.rb: ditto.
 
-	* vm_eval.c (eval_string_with_cref): ditto.
+	* ext/tk/lib/tktext.rb: ditto.
 
-Mon Mar 28 21:24:02 2016  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+Wed Dec  3 13:28:13 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* numeric.c (int_pos_p): fix typos.
+	* Makefile.in (lex.c): try gperf first, and copy from the source
+	  directory if failed.  [ruby-dev:22123]
 
-Mon Mar 28 14:54:49 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* ext/extmk.rb (MTIMES): let makefiles depend to mkmf.rb.
 
-	* enc/unicode.c: Refactoring in preparation for data reduction for
-	  titlecase.
+	* lib/mkmf.rb (configuration): DLDFLAGS was duplicated.
 
-Mon Mar 28 14:36:36 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Tue Dec  2 23:18:12 2003  Minero Aoki  <aamine@loveruby.net>
 
-	* enc/unicode.c: Minor refactoring for I WITH DOT ABOVE.
+	* lib/net/http.rb: wrote the warning about HTTP_PROXY environment
+	  variable.
 
-Mon Mar 28 14:26:24 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Tue Dec  2 21:31:42 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* enc/unicode.c: Removed code now covered by data from table.
+	* bin/testrb: new test runner.  [ruby-core:01845]
 
-Mon Mar 28 11:49:21 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* lib/test/unit/autorunner.rb (Test::Unit::AutoRunner.run,
+	  Test::Unit::AutoRunner#process_args): take test list to run and
+	  options.
 
-	* enc/unicode.c: Adding comments. [ci skip]
+	* lib/test/unit/autorunner.rb (Test::Unit::AutoRunner::RUNNERS,
+	  Test::Unit::AutoRunner#run): should not exit inside a library,
+	  just return the result instead.
 
-Mon Mar 28 11:30:23 2016  Shinichi Maeshima  <netwillnet@gmail.com>
+	* lib/test/unit.rb: ditto.
 
-	* lib/rubygems.rb: Fix `Gem.find_spec_for_exe` picks oldest gem.
-	  https://github.com/travis-ci/travis-ci/issues/5798
-	  https://github.com/rubygems/rubygems/pull/1566
-	* test/rubygems/test_gem.rb: ditto.
+	* test/runner.rb: exit with the test result.
 
-Mon Mar 28 11:26:31 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+Tue Dec  2 20:18:48 2003  Eric Sunshine  <sunshine@sunshineco.com>
 
-	* lib/rubygems.rb, lib/rubygems/*, test/rubygems/*: Update rubygems-2.6.2.
-	  Please see entries of 2.6.2 on
-	  https://github.com/rubygems/rubygems/blob/master/History.txt
+	* configure.in (AC_PROG_YACC): AC_DEFINE(OLD_YACC) if Yacc is found
+	  instead of Bison or byacc.
 
-Mon Mar 28 11:02:31 2016  Hiroshi Shirosaki  <h.shirosaki@gmail.com>
+	* parse.y: If OLD_YACC is defined, ensure that YYMAXDEPTH is at least
+	  10000 (Bison's default) since some old versions of Yacc define it as
+	  low as 150 by default, which is too low for Ruby to parse some files,
+	  such as date/format.rb.  Among other issues, the parse problem causes
+	  "make test" to fail.
 
-	* lib/rubygems/test_case.rb: Fix test on Windows for inconsistent temp path.
-	  https://github.com/rubygems/rubygems/pull/1554
-	  [Bug #12193][ruby-core:74431]
+Tue Dec  2 20:03:20 2003  Minero Aoki  <aamine@loveruby.net>
 
-Mon Mar 28 08:19:49 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/fileutils/test_fileutils.rb: check if Pathnames are usable
+	  for arguments.
 
-	* sprintf.c (rb_str_format): refactor floating point format of
-	  Rational by using generic Integer functions.
+Tue Dec  2 04:22:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
 
-	* sprintf.c (rb_str_format): fix buffer overflow, length must be
-	  greater than precision.  reported by William Bowling <will AT
-	  wbowling.info>.
+	* lib/test/unit/assertions.rb: fixed #assert_no_match message.
 
-Sun Mar 27 12:13:37 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/testunit/test_assertions.rb: ditto.
 
-	* sprintf.c (rb_str_format): convert Rational to floating point
-	  format by using generic Integer functions, not by methods which
-	  can be overwritten.
+Tue Dec  2 00:43:00 2003  why the lucky stiff  <why@ruby-lang.org>
 
-Sat Mar 26 10:55:12 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/syck/syck.c: string buffering bug.  decrementing by full
+	  max_size now. [ruby-core:01834]
 
-	* numeric.c (rb_int2str): conversion function to String for
-	  generic Integer.
+Mon Dec  1 21:33:08 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* numeric.c (rb_int_round): rounding function for generic
-	  Integers.
+	* numeric.c (num_sadded): prohibit singleton method definition for
+	  Numerics.  fill yet another gap between Fixnum and Bignum.
 
-	* numeric.c (rb_int_{uminus,plus,minus,mul,idiv,modulo}): basic
-	  arithmetic functions for generic Integers.
+Mon Dec  1 17:33:47 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* numeric.c (FIXNUM_{POSITIVE,NEGATIVE,ZERO}_P): predict macros
-	  only for Fixnum.
+	* pack.c (htov16): converts endian using swap16. htov32(), hton16,
+	  hton32 as well. [ruby-talk:85377]
 
-Sat Mar 26 06:34:24 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* pack.c (swap16): swap 2 bytes no matter how big short is on the
+	  platform.  swap32() is also prepared.
 
-	* localeinit.c (rb_locale_charmap_index): fix prototype.
-	  patched by Andreas Schwab [Bug #12218]
+	* numeric.c (rb_num2int): returns long to preserve information.
+	  rb_fix2int(), rb_num2uint(), rb_fix2uint() as well.
+	  [ruby-talk:85377]
 
-Fri Mar 25 16:40:48 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* numeric.c (rb_num2uint): should not check for value range if the
+	  source value is negative.
 
-	* test/ruby/enc/test_case_mapping.rb: Additional tests title case;
-	  some not yet activated.
+Mon Dec  1 17:14:34 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Mar 25 13:38:11 2016  Kazuki Yamaguchi  <k@rhe.jp>
+	* sample/optparse/opttest.rb: added.
 
-	* ext/openssl/extconf.rb: check SSL_CTX_set_next_proto_select_cb
-	  function rather than OPENSSL_NPN_NEGOTIATED macro. it exists
-	  even if it is disabled by OpenSSL configuration.
-	  [ruby-core:74384] [Bug #12182]
+Mon Dec  1 16:10:52 2003  Dave Thomas  <dave@pragprog.com>
 
-	* ext/openssl/ossl_ssl.c: update #ifdef(s) as above.
+	* lib/rdoc/rdoc.rb: (etc) initial merge into main tree.
 
-	* test/openssl/test_ssl.rb: skip NPN tests if NPN is disabled.
+Mon Dec  1 14:17:49 2003  Minero Aoki  <aamine@loveruby.net>
 
-Fri Mar 25 11:08:37 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/fileutils.rb (fu_each_src_dest0): call #to_str to allow
+	  Pathname for arguments. [ruby-core:01795]
 
-	* lib/uri/http.rb (URI::HTTP#initialize): [DOC] fix example,
-	  missing mandatory arguments.  [ruby-core:74540] [Bug #12215]
+	* test/fileutils/test_fileutils.rb: does much strict test on
+	  "same" files detecting.
 
-Fri Mar 25 01:50:58 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+Mon Dec  1 09:28:14 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* thread_pthread.c (reserve_stack): fix reserving position where
-	  the stack growing bottom to top. [Bug #12118]
+	* bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub
+	  (XCFLAGS): re-export $(XCFLAGS).
 
-Fri Mar 25 01:10:42 2016  Sebastian Schuberth  <sschuberth@gmail.com>
+	* bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub
+	  (ARCH_FLAG): export $(ARCH_FLAG) (perhaps empty value).
 
-	* lib/mkmf.rb (find_executable0): On Windows, it is actually valid
-	  to surround individual PATH directory entries with double
-	  quotes. Remove these before joining the path as otherwise the
-	  literal quotes would become part of the path, resulting in the
-	  executable not to be found.  [Fix GH-1305]
+Mon Dec  1 01:03:27 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
 
-Thu Mar 24 22:38:18 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/mkmf.rb (TRY_LINK, link_command): added support for DLDFLAGS
+	  and ARCH_FLAG.  [ruby-dev:22085]
 
-	* strftime.c (FMT, FMTV): remove recursive-assignments to get rid
-	  of undefined behavior.  [ruby-core:74532] [Bug #12213]
+Sun Nov 30 20:18:07 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
 
-Thu Mar 24 17:44:02 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* configure.in: keep ARCH_FLAG separate. export ARCH_FLAG.
+	  [ruby-core:01819]
 
-	* strftime.c (FMT_PADDING): extract format for padding.
+	* Makefile.in: add ARCH_FLAG to CFLAGS.
 
-	* strftime.c (FMT_PRECISION): extract precision formula.
+	* Makefile.in: add @CPPFLAGS@ to CPPFLAGS.
 
-	* strftime.c (FMTV): append formatted string to expand the result.
+	* lib/mkmf.rb (link_command, cc_command): use ARCH_FLAG.
 
-Thu Mar 24 14:20:21 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/mkmf.rb (configuration): add ARCH_FLAG to DLDFLAGS.
 
-	* strftime.c (STRFTIME): deal with case conversion flags for
-	  recursive formats.
+	* Makefile.in: add ARCH_FLAG to DLDFLAGS.
 
-Thu Mar 24 12:43:26 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* configure.in: should put getcwd in AC_CHECK_FUNCS, not
+	  AC_REPLACE_FUNCS.  [ruby-core:01826]
 
-	* ext/date/date_core.c (dt_lite_iso8601): strftimev() always
-	  returns a String, so append them directly.
+Sun Nov 30 18:22:48 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
 
-	* ext/date/date_core.c (d_lite_jisx0301, iso8601_timediv),
-	  (dt_lite_jisx0301): format by the format string in local buffer
-	  to prevent intermediate strings from GC.
+	* configure.in: do not override CCDLDFLAGS, LDFLAGS, XLDFLAGS,
+	  DLDFLAGS and LDSHARED.
 
-	* ext/date/date_core.c (mk_inspect_raw, mk_inspect): inspect by
-	  "%+"PRIsVALUE, to prevent intermediate strings from GC.
+	* configure.in: XCFLAGS for compiling ruby itself.  ARCH_FLAG is
+	  reflected in CFLAGS.
 
-Thu Mar 24 11:43:32 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/mkmf.rb: ditto.  do not import XCFLAGS from config.status.
 
-	* strftime.c (rb_strftime_with_timespec): remove unnecessary
-	  check, as `s` equals to `endp` when recursed STRFTIME resized
-	  the capacity same as the size.
+Sun Nov 30 17:37:36 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-Wed Mar 23 21:48:00 2016  Kenta Murata  <mrkn@mrkn.jp>
+	* ext/tk/lib/tk.rb: bug fix [ruby-talk:86746]
 
-	* enum.c (ary_inject_op): put subtract operation out of if-clause.
+Sun Nov 30 13:02:00 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-Wed Mar 23 21:38:00 2016  Kenta Murata  <mrkn@mrkn.jp>
+	* lib/soap/encodingstyle/soapHandler.rb: refactoring - Simplifying
+	  Conditional Expressions.
 
-	* enum.c (ary_inject_op): Use Kahan's compensated summation algorithm
-	  for summing up float values.
+	* lib/wsdl/soap/definitions.rb: refactoring - Move Method.
 
-Wed Mar 23 20:56:59 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/xsd/{test_noencoding.rb,noencoding.xml}: new files.  test for
+	  encoding unspecified XML file parsing.
 
-	* strftime.c (rb_strftime_with_timespec): append formatted results
-	  to the given string with expanding, and also deal with NUL chars.
+	* test/wsdl/{test_fault.rb,map,datetime}: new files.  test of
+	  SOAPFault, dateTime and Apache's Map.
 
-	* strftime.c (rb_strftime, rb_strftime_timespec): return formatted
-	  string, not the length put in the given buffer.
+Sun Nov 30 09:35:14 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* time.c (rb_strftime_alloc): no longer needs to retry with
-	  reallocating buffers.
+	* string.c (rb_str_update): get rid of SEGV at just allocated String.
+	  [ruby-core:01812]
 
-	* time.c (time_strftime): no longer needs to split by NUL chars.
+Fri Nov 28 23:19:34 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Wed Mar 23 14:23:54 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* gc.c (gc_mark): explicitly check mark recursion levels, instead
+	  of unreliable stack length.
 
-	* lib/rdoc/ri/driver.rb (interactive): rescue NotFoundError raised in
-	  expand_name. (display_name rescues NotFoundError by itself,
-	  the original logic looks buggy...)
+Fri Nov 28 22:49:56 2003  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
 
-Wed Mar 23 11:44:53 2016  cremno  <cremno@mail.ru>
+	* lib/rinda/rinda.rb: fix TupleSpaceProxy#read, read_all.
 
-	* marshal.c (r_long): cast to `signed char`, which is used
-	  already, instead of SIGN_EXTEND_CHAR.
+Fri Nov 28 21:44:40 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
 
-	* parse.y: SIGN_EXTEND_CHAR is no longer used.  [Fix GH-1302]
+	* test/fileutils/test_fileutils.rb (test_ln_s): should be a file, not
+	  a directory for FreeBSD.
 
-Wed Mar 23 11:38:47 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Nov 28 19:37:56 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* cygwin/GNUmakefile.in (MSYS2_ARG_CONV_EXCL_PARAM):
-	  * add missing parentheses and remove double quotes.
-	  * rename to get rid of recursive references.
-	  * as --excludes-dir option is for a path name, its argument
-	    should be converted.
-	  [ruby-dev:49526] [Bug #12199]
+	* hash.c (env_has_value, env_index): must match exactly.
 
-Wed Mar 23 10:39:38 2016  Koichi ITO  <koic.ito@gmail.com>
+	* test/ruby/test_env.rb (test_has_value, test_index): condition for
+	  aboves.
 
-	* variable.c: Added documentation about order of `Module#constants`
-	  [ci skip][Bug #12121][ruby-dev:49505][fix GH-1301]
+Fri Nov 28 17:59:20 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Tue Mar 22 21:08:30 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* test/ruby/test_env.rb: add tests for ENV.
 
-	* include/ruby/oniguruma.h: Additional flag for characters that are titlecase.
+Fri Nov 28 17:47:46 2003  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
 
-	* enc/unicode/case-folding.rb, casefold.h: Using above flag in data.
+	* lib/drb/drb.rb (DRbMessage#load): rescue Errno::* and raise
+	  DRbConnError.
 
-	* enc/unicode.c: Marking capitalized character as unmodified if it is
-	  already titlecase.
+Fri Nov 28 15:41:15 2003  Tanaka Akira  <akr@m17n.org>
 
-	* test/ruby/enc/test_case_mapping.rb: Tests for above functionality.
+	* lib/pathname.rb (Pathname#realpath): obsolete the force_absolute
+	  argument.
 
-Tue Mar 22 14:18:59 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Nov 28 14:41:52 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-	* parse.y (lambda_body, parser_yylex): warn mismatched indentation
-	  of lambda block.
+	* lib/soap/streamHandler.rb: drop unused http parameters.
 
-Tue Mar 22 11:36:49 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* lib/soap/encodingstyle/soapHandler.rb, lib/soap/mapping/factory.rb,
+	  lib/soap/mapping/mapping.rb, lib/soap/mapping/registry.rb,
+	  lib/wsdl/soap/complexType.rb: ApacheSOAP's map support was broken
+	  under WSDL dynanic client environment.  fixed.
 
-	* time.c (wmul): wrong condition.
-	  fixed many test failures on 32bit and LLP64 platforms.
+	* test/wsdl/raa/*: add tests.
 
-Tue Mar 22 10:31:34 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* lib/xsd/datatypes.rb: dateTime precision bug fix (at least, I hope.)
+	  bug of soap4r.  XSDDateTimeImple.to_time passed a Float to
+	  Time.local/Time.gm as an usec, and NUM2LONG(rb_num2long for Float)
+	  causes rounding error.
 
-	* time.c (wdiv, wmod): wdivmod0() assumes the 3rd and the 4th arguments
-	  are valid pointers.
-	  maybe checking them in wdivmod0() is better manner, but I guess that
-	  passing real dummy pointers may be faster than checking and branching
-	  in wdivmod0().
-	  this commit fixes SEGV on 32bit and LLP64 platforms.
+	* test/soap/test_basetype.rb, test/xsd/test_xsd.rb: add tests.
 
-Tue Mar 22 10:24:04 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+Fri Nov 28 04:15:24 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* time.c (divmodv): void function never returns any value.
+	* eval.c (method_arity): used wrong Proc object.  [ruby-talk:86504]
 
-Tue Mar 22 10:11:01 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Nov 28 00:47:29 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/lib/test/unit.rb (Test::Unit::StatusLine#failed): print
-	  failed messages only if replacing mode, otherwise defer them
-	  until the end, to get rid of interleaving failures with progress
-	  messages.  refix r54195.
+	* eval.c (rb_f_exit), process.c (rb_f_exit_bang): treat true as
+	  success, false as failure.  [ruby-dev:22067]
 
-Tue Mar 22 03:45:03 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* eval.c (rb_f_abort, rb_thread_switch), process.c (rb_f_system): use
+	  ANSI macro instead of hard coded value.
 
-	* time.c (MUL_OVERFLOW_FIXWV_P): defined for FIXWV.
+	* eval.c (rb_f_exit), process.c (rb_f_exit_bang): use VALUEs not but
+	  TYPEs.
 
-	* time.c (wmul): use MUL_OVERFLOW_FIXWV_P and only switch.
+Thu Nov 27 22:05:48 2003  Akinori MUSHA  <knu@iDaemons.org>
 
-	* time.c (wmul): use mul which has Fixnum optimization.
+	* eval.c, gc.c: FreeBSD/ia64 currently does not have a way for a
+	  process to get the base address for the RSE backing store, so
+	  hardcode it for the moment.
+	  [submitted by: Marcel Moolenaar <marcel@FreeBSD.org>]
 
-	* time.c (rb_time_magnify): If WIDEVALUE_IS_WIDER, wmul() has the same
-	  optimized logic, else mul() has also the similar logic for Fixnum.
+Thu Nov 27 17:36:42 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-	* time.c (rb_time_unmagnify): almost ditto.
+	* ext/tk/lib/tkafter.rb: bug fix on TkTimer#cancel_on_exception=(mode).
+	  TkTimer#wait recieves the exception of the callback.
+	  The exception is kept on @return_value.
 
-Tue Mar 22 03:10:09 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+Thu Nov 27 16:58:48 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
 
-	* time.c (divmodv): add the case both arguments are Fixnum.
+	* win32/win32.c (rb_w32_stat): remove _fullpath() for NUL: device.
 
-	* time.c (wquo): use quo which has Fixnum optimization.
+Wed Nov 26 15:38:47 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
 
-	* time.c (wdivmod0): added for WIDEVALUE_IS_WIDER.
+	* test/fileutils/test_fileutils.rb (test_ln_s): should take the
+	  existing symbolic link for OpenBSD.
 
-	* time.c (wdivmod): use wdivmod0 and divmodv.
-	  divmodv has Fixnum optimization.
+Wed Nov 26 04:48:42 2003  why the lucky stiff  <why@ruby-lang.org>
 
-	* time.c (wdiv): use wdivmod0 and div to avoid the use of divmodv which
-	  calls id_quo whose return value is array.
+	* ext/syck/token.c: removed YYTOKTMP references which
+	  were causing buffer overflows on large block scalars,
+	  comments, quoted scalars and plain scalars.
 
-	* time.c (wmod): use wdivmod0 and mod to avoid the use of divmodv which
-	  calls id_quo whose return value is array.
+	* ext/syck/rubyext.c: dynamic changing of buffer size.
 
-Mon Mar 21 22:32:50 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* ext/syck/syck.h: default buffer size of 4k.
 
-	* internal.h (rb_fix_divmod_fix): like r54213, use FIX2NUM only if
-	  x == FIXNUM_MIN && y == -1. This must be a rare case and it is
-	  expected compiler to handle well.
+Wed Nov 26 00:55:30 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
 
-Mon Mar 21 22:15:11 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* lib/webrick/httpresponse.rb: add HTTPResponse#keep_alive=.
 
-	* time.c (mod): Add Fixnum case.
+	* lib/webrick/httpserver.rb (HTTPServer#run): should pass the
+	  request's keep_alive flag to the response.
 
-	* time.c (quo): c can be Fixnum except a == FIXNUM_MIN && b == -1.
-	  Such case can be optimized out because quo()'s argument is constant.
+Tue Nov 25 21:41:35 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Mon Mar 21 22:09:24 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* defines.h (ENV_IGNORECASE): should define when DOSISH without
+	  human68k. [ruby-dev:22047]
 
-	* internal.h (rb_fix_mul_fix): multiply converted values, not
-	  object VALUEs.
+	* hash.c (env_has_value, env_index): don't ignore case of value.
+	  [ruby-dev:22048]
 
-Mon Mar 21 20:18:29 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Nov 25 21:39:37 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* common.mk (TEST_EXCLUDES, EXCLUDE_TESTFRAMEWORK): use full spell
-	  long option.
+	* file.c (path_check_1): honor sticky bits always.
+	  [ruby-talk:86273]
 
-	* cygwin/GNUmakefile.in (MSYS2_ARG_CONV_EXCL): suppress path name
-	  conversions by msys2.  [ruby-dev:49525] [Bug #12199]
+Tue Nov 25 20:02:14 2003  Minero Aoki  <aamine@loveruby.net>
 
-Mon Mar 21 19:09:31 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/fileutils/test_fileutils.rb: do test in more deep
+	  directory.
 
-	* string.c (enc_succ_alnum_char): try to skip an invalid character
-	  gap between GREEK CAPITAL RHO and SIGMA.
-	  [ruby-core:74478] [Bug #12204]
+	* test/fileutils/test_nowrite.rb: ditto.
 
-Mon Mar 21 18:55:49 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Nov 25 19:04:23 2003  Tanaka Akira  <akr@m17n.org>
 
-	* node.c (rb_gc_mark_node): NODE_MATCH2 can have nd_args, u3,
-	  since r54100.
+	* lib/open-uri.rb (URI::Generic#find_proxy): ENV case sensitivity test
+	  refined.
 
-Sun Mar 20 21:17:13 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+Tue Nov 25 18:13:30 2003  Minero Aoki  <aamine@loveruby.net>
 
-	* internal.h (rb_int128t2big): declare only when HAVE_INT128_T.
-	  fixed a compile error with VC++ introduced at r54203.
+	* test/fileutils/test_fileutils.rb: chdir Dir.tmpdir before each
+	  test. [ruby-dev:22045]
 
-Sun Mar 20 20:10:14 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* test/fileutils/test_nowrite.rb: ditto.
 
-	* internal.h (DLONG): defined if long is 32bit (and LONG_LONG is 64bit;
-	  but LONG_LONG is always defined as 64bit), or there's int128_t.
+Tue Nov 25 17:52:11 2003  Tanaka Akira  <akr@m17n.org>
 
-	* internal.h (DL2NUM): defined if DLONG is defined.
+	* lib/open-uri.rb (URI::Generic#find_proxy): use http_proxy under CGI
+	  if the environment variable is case sensitive.
 
-	* internal.h (rb_fix_mul_fix): defined for `Fixnum * Fixnum`.
+Tue Nov 25 16:41:33 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-	* insns.def (opt_mul): use rb_fix_mul_fix().
+	* test/wsdl/multiplefault.wsdl, test/wsdl/test_multiplefault.rb:
+	  removed.  this test requires extra libraries in soap4r/1.5.*.
 
-	* numeric.c (fix_mul): ditto.
+Tue Nov 25 16:24:42 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-	* time.c (mul): ditto.
+	* lib/soap/**/*.rb, lib/wsdl/**/*.rb, lib/xsd/**/*.rb: changed license;
+	  GPL2 -> Ruby's.
 
-Sun Mar 20 18:53:49 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/soap/rpc/driver.rb, lib/soap/wsdlDriver.rb,
+	  lib/soap/streamHandler.rb: add interface to streamhandler.
 
-	* numeric.c (fix_gt, fix_ge, fix_lt, fix_le): optimize comparisons
-	  Fixnum against Bignum by rb_big_cmp in inversed order without
-	  new Bignum instance.
+	* lib/soap/marshal.rb: raise error if parse fails.
 
-Sun Mar 20 18:44:52 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* lib/soap/netHttpClient.rb: add https support.  Patched by
+	  Oliver M. Bolzer.
 
-	* time.c (add): remove FIXABLE() which is in LONG2NUM().
+	* lib/soap/netHttpClient.rb: dump HTTP response message body by itself.
 
-	* time.c (sub): ditto.
+	* lib/soap/rpc/driver.rb, lib/soap/rpc/proxy.rb,
+	  lib/soap/wsdlDriver.rb: add driver#mandatorycharset interface to foce
+	  using charset for parsing response from buggy server.
 
-	* time.c (mul): ditto.
+	* lib/soap/encodingstyle/soapHandler.rb: support Apache Axis's half
+	  typed multi-ref array.
 
-Sun Mar 20 04:46:02 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* lib/soap/mapping/factory.rb, lib/soap/mapping/registry.rb: map
+	  SOAPStruct which has multi-accessors which name are the same, to an
+	  array.
 
-	* bignum.c (rb_big_cmp): reduce the code.
+	* lib/soap/rpc/element.rb: fixed illegal parameter order.
 
-	* bignum.c (rb_big_eq): If normalized bignum is still bignum,
-	  it must be larger than fixnum.
+	* lib/soap/rpc/element.rb: element name of response message could have
+	  the name other than 'return'.
 
-Sat Mar 20 00:58:00 2016  Kenta Murata  <mrkn@mrkn.jp>
+	* lib/wsdl/operation.rb, lib/wsdl/operationBinding.rb,
+	  lib/wsdl/soap/classDefCreator.rb, lib/wsdl/soap/methodDefCreator.rb,
+	  lib/wsdl/soap/methodDefCreatorSupport.rb: WSDL/1.1 allows plural
+	  fault definition in a operation. [ruby-talk:84948]
 
-	* include/ruby/intern.h (rb_big_odd_p, rb_big_even_p): move to
-	  internal.h so that they are exported only for ruby itself.
+	* test/wsdl/multiplefault.wsdl, test/wsdl/test_multiplefault.rb: add
+	  test for above fix.
 
-	* internal.h (rb_big_odd_p, rb_big_even_p): ditto.
+	* lib/wsdl/soap/complexType.rb: support WSDL array definition with
+	  maxOccures="unbound".
 
-Sat Mar 19 21:56:23 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/xsd/charset.rb: use cp932 under emx.  Patched by
+	  Siena. / SHINAGAWA, Norihide in [ruby-dev:21972]
 
-	* test/lib/test/unit.rb (Test::Unit::StatusLine#failed): defer
-	  failed messages until the end in verbose mode, to get rid of
-	  interleaving failures with progress messages.
+	* lib/xsd/xmlparser/parser.rb: set @charset nil by default.  Nil means
+	  'follow encoding declaration in XML'.
 
-Sat Mar 19 21:53:35 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* sample/soap/digraph.rb, sample/wsdl/amazon/wsdlDriver.rb,
+	  sample/wsdl/googleSearch/sampleClient.rb,
+	  sample/wsdl/googleSearch/wsdlDriver.rb,
+	  test/wsdl/test_emptycomplextype.rb,
+	  test/wsdl/marshal/test_wsdlmarshal.rb,
+	  test/xsd/test_xmlschemaparser.rb: use File.open(...) { |f| f.read }
+	  instead of File.open(...).read. [ruby-dev:21964]
 
-	* numeric.c (fix_cmp): invert the result as the comparison is
-	  inverted.
+	* test/wsdl/emptycomplextype.wsdl, test/wsdl/test_emptycomplextype.rb:
+	  simplify the test case.
 
-Sat Mar 19 18:32:00 2016  Kenta Murata  <mrkn@mrkn.jp>
+	* test/wsdl/axisArray/*: add tests for axis's array encoding.
 
-	* numeric.c (int_to_f): raise NotImplementedError when a receiver
-	  class is unknown.
+Tue Nov 25 16:15:29 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
 
-	* test/-ext-/integer/test_my_integer.rb (test_my_integer_to_f): modify
-	  a test for the above change.
+	* ruby.h: don't treat Cygwin as Windows.
 
-Sat Mar 19 18:21:00 2016  Kenta Murata  <mrkn@mrkn.jp>
+Tue Nov 25 15:18:28 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-	* bignum.c (Bignum#<=>): remove it because they are unified with
-	  Integer#<=>.
+	* configure.in: change default value of --enable-pthread (default: no)
 
-	* numeric.c (Integer#<=>, Fixnum#<=>): move <=> method from Fixnum to
-	  Integer.
+Tue Nov 25 07:31:16 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* numeric.c (int_cmp): add this method for Integer#<=>.
+	* parse.y (primary): allow newlines just before right argument
+	  parenthesis.  (ruby-bugs:PR#1221)
 
-	* test/-ext-/integer/test_my_integer.rb (test_my_integer_cmp): add a
-	  test to examine Integer#<=> for unknown subclasses.
+Mon Nov 24 23:32:06 2003  Tanaka Akira  <akr@m17n.org>
 
-Sat Mar 19 14:46:18 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/open-uri.rb (OpenURI.open_loop, URI::HTTP#proxy_open): use
+	  catch/throw for redirection instead of exception.
+	  (OpenURI.open_loop, OpenURI.redirectable?): restrict redirection.
 
-	* iseq.c (rb_iseq_compile_with_option): make the parser in mild
-	  error.
+Mon Nov 24 19:59:48 2003  Tanaka Akira  <akr@m17n.org>
 
-	* load.c (rb_load_internal0): ditto.
+	* lib/open-uri.rb (URI::Generic#find_proxy): use CGI_HTTP_PROXY
+	  instead of HTTP_PROXY in the CGI environment.
 
-	* parse.y (yycompile0): return the error message within the error
-	  to be raised.  [Feature #11951]
+Mon Nov 24 19:32:55 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
 
-	* parse.y (parser_compile_error): accumulate error messages in the
-	  error_buffer.
+	* ext/etc/extconf.rb: check for pw_passwd in struct passwd and
+	  gr_passwd in struct group for DJGPP.
 
-Sat Mar 19 03:57:13 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* ext/etc/etc.c: ditto.
 
-	* time.c (LOCALTIME): organize #ifdefs.
+	* ext/Setup.dj: support for curses, etc, zlib.
 
-	* time.c (GMTIME): define only ifndef HAVE_STRUCT_TM_TM_GMTOFF.
+Mon Nov 24 17:00:00 2003  Tanaka Akira  <akr@m17n.org>
 
-Sat Mar 19 03:53:31 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* lib/open-uri.rb: validate option names.
+	  :content_length_proc and :progress_proc option implemented.
 
-	* configure.in (rb_cv_member_struct_tm_tm_gmtoff): For Linux (glibc)
-	  define _BSD_SOURCE for time.h to define struct tm.tm_gmtoff.
+Mon Nov 24 14:53:10 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* time.c: define _BSD_SOURCE at the top.
+	* bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub
+	  (XCFLAGS): output empty value instead of `-DRUBY_EXPORT'.
 
-Sat Mar 19 03:00:50 2016  Rei Odaira  <Rei.Odaira@gmail.com>
+Sat Nov 22 23:09:45 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
 
-	* test/-ext-/time/test_new.rb (test_timespec_new): change a gmtoff
-	  test to a better one that does not depend on whether the current
-	  time is in summer time or not.
+	* configure.in: set enable_pthread to no on MinGW.
 
-Fri Mar 19 00:00:00 2016  Kenta Murata  <mrkn@mrkn.jp>
+Sat Nov 22 22:56:20 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-	* bignum.c (rb_big_to_f, Bignum#to_f): removed them because they are
-	  unified with int_to_f and Integer#to_f.
+	* configure.in: add --enable-pthread option (default: yes)
 
-	* numeric.c (int_to_f): treat Bignum values directly.
+Sat Nov 22 22:48:46 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-Fri Mar 18 23:41:00 2016  Kenta Murata  <mrkn@mrkn.jp>
+	* ext/tk/lib/tk.rb: add Tk.grab_release and fix bug of TkComposite
 
-	* numeric.c (int_to_f, fix_to_f): rename fix_to_f to int_to_f, and add
-	  treatment for subclasses which don't have definitions of to_f method.
+	* ext/tk/lib/tkafter.rb: bug fix of TkAfter#start
 
-	* numeric.c (Integer#to_f, Fixnum#to_f): move to_f method from Fixnum
-	  to Integer.
+	* ext/tk/sample/tkcombobox.rb: new sample script
 
-	* ext/-test-/integer/my_integer.c: define helper class for testing
-	  to_f method for a subclass of Integer.
+	* ext/tcltklib/tcltklib.c: add native thread check
 
-	* ext/-test-/integer/extconf.rb: ditto.
+Sat Nov 22 18:49:47 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/-test-/integer/init.c: ditto.
+	* ext/curses/curses.c (window_nodelay): nodelay() of NetBSD's
+	  libcruses returns no value, just like keypad().
 
-	* test/-ext-/integer/test_my_integer.rb: examine to_f method for a
-	  subclass of Integer.
+Sat Nov 22 17:36:36 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Fri Mar 18 22:32:00 2016  Kenta Murata  <mrkn@mrkn.jp>
+	* bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub
+	  (HAVE_GETCWD): output to config.h.
 
-	* include/ruby/intern.h (rb_big_hash): Move to internal.h.
+	* bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub
+	  (XCFLAGS): output to config.status.
 
-	* internal.h: ditto.
+Sat Nov 22 13:10:10 2003  Minero Aoki  <aamine@loveruby.net>
 
-Fri Mar 18 22:10:00 2016  Kenta Murata  <mrkn@mrkn.jp>
+	* lib/fileutils.rb (have_st_ino?): djgpp has valid st_ino.
 
-	* bignum.c (Bignum#eql?): remove its definition because it is unified
-	  with Numeric#eql?.
+Sat Nov 22 11:28:48 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* numeric.c (num_eql): treat Bignum values directly.
+	* gc.c (Init_stack): stack region is far smaller than usual if
+	  pthread is used.
 
-Fri Mar 18 21:57:00 2016  Kenta Murata  <mrkn@mrkn.jp>
+Sat Nov 22 07:30:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
 
-	* bignum.c (rb_big_to_s, Bignum#to_s): remove its definition because
-	  it is unified with Integer#to_s.
+	* lib/test/unit/util/backtracefilter.rb: fixed a bug that occurred
+	  when an exception had no backtrace.
 
-	* numeric.c (int_to_s): treat Bignum values directly.
+	* test/testunit/util/test_backtracefilter.rb: ditto.
 
-Fri Mar 18 21:30:00 2016  Kenta Murata  <mrkn@mrkn.jp>
+Fri Nov 21 16:44:18 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-	* numeric.c (int_to_s): Move from fix_to_s.
+	* ext/tk/lib/tkentry.rb: fix the encoding trouble of percent
+	  substitutions on validatecommand option of TkEntry widget
 
-	* numeric.c (Integer#to_s): Move from Fixnum#to_s.
+	* ext/tk/lib/tk.rb: fix bug on {pack|grid}_propagate() method
 
-Fri Mar 18 16:22:24 2016  Victor Nawothnig  <Victor.Nawothnig@gmail.com>
+Fri Nov 21 16:12:11 2003  Akinori MUSHA  <knu@iDaemons.org>
 
-	* parse.y (parse_numvar): NTH_REF must be less than a half of
-	  INT_MAX, as it is left-shifted to be ORed with back-ref flag.
-	  [ruby-core:74444] [Bug#12192] [Fix GH-1296]
+	* ruby.1: Fix markups and grammar.
 
-Fri Mar 18 12:25:30 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Nov 21 14:49:42 2003  Minero Aoki  <aamine@loveruby.net>
 
-	* gc.c (tick): fix missing close parenthesis.  [Fix GH-1291]
+	* ruby.1: wrote about ruby related environment variables.
 
-Fri Mar 18 10:24:12 2016  Naotoshi Seo  <sonots@gmail.com>
+Fri Nov 21 12:28:03 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* ext/date/date_core.c (datetime_to_time): preserve timezone info
-	  [Bug #12189] [Fix GH-1295]
+	* marshal.c (w_extended): singleton methods should not be checked
+	  when dumping via marshal_dump() or _dump(). [ruby-talk:85909]
 
-Fri Mar 18 10:17:00 2016  Kenta Murata  <mrkn@mrkn.jp>
+Fri Nov 21 01:40:00 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-	* bignum.c (rb_big_hash): make it public function to be available in
-	  other source files, and remove documentation comment for Bignum#hash.
+	* configure.in: check <pthread.h>
 
-	* bignum.c (Bignum#hash): remove its definition because it is unified
-	  with Object#hash.
+	* ruby.h: include pthread.h if existence.
+	  define is_ruby_native() macro when not HAVE_NATIVETHREAD
 
-	* include/ruby/intern.h (rb_big_hash): add a prototype declaration.
+	* eval.c: undef is_ruby_native() function when not HAVE_NATIVETHREAD
 
-	* hash.c (any_hash): treat Bignum values directly.
+Fri Nov 21 00:43:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
 
-Fri Mar 18 02:35:12 2016  Naotoshi Seo  <sonots@gmail.com>
+	* lib/test/unit/assertions.rb: use #__send__ instead of #send.
 
-	* lib/time.rb (parse, strptime): Fix Time.parse/strptime does not
-	  have compatibility with DateTime.parse/strptime in terms of parsing
-	  timezone [Bug #12190] [Fix GH-1297]
+	* lib/test/unit/testcase.rb: ditto.
 
-Fri Mar 18 02:17:00 2016  Kenta Murata  <mrkn@mrkn.jp>
+Thu Nov 20 19:19:22 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
 
-	* numeric.c (fix_zero_p, fix_even_p, fix_odd_p): remove needless
-	  functions.
+	* configure.in: don't find the Cygwin's pthread library on MinGW.
 
-Fri Mar 18 02:15:00 2016  Kenta Murata  <mrkn@mrkn.jp>
+Thu Nov 20 19:15:50 2003  Minero Aoki  <aamine@loveruby.net>
 
-	* numeric.c (int_even_p): treat Fixnum and Bignum values directly.
+	* lib/fileutils.rb (have_st_ino?): emx (OS/2 with EMX) does not
+	  have st_ino (always 0). [ruby-dev:21972]
 
-Fri Mar 18 02:07:00 2016  Kenta Murata  <mrkn@mrkn.jp>
+	* lib/fileutils.rb (rename_cannot_overwrite_file?): emx does not
+	  allow overwriting files by rename(2).
 
-	* bignum.c (Bignum#even?, Bignum#odd?): remove definitions
-	  because they are unified with Integer#even? and Integer#odd?.
+	* test/fileutils/test_fileutils.rb: windows? ->
+	  have_drive_letter?, have_file_perm?
 
-	* numeric.c (Fixnum#zero?, Fixnum#even?, Fixnum#odd?): remove
-	  definitions because they are unified with Numeric#zero?,
-	  Integer#even?, and Integer#odd?.
+Thu Nov 20 17:50:58 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-	* numeric.c (num_zero_p, int_odd_p): treat Fixnum and
-	  Bignum values directly.
+	* ext/tk/sample/tkballoonhelp.rb: new sample script
 
-	* test/ruby/test_integer.rb (test_odd_p_even_p): remove meaningless
-	  test case.
+	* ext/tk/sample/tkmultilistbox.rb: ditto
 
-Fri Mar 18 01:51:00 2016  Kenta Murata  <mrkn@mrkn.jp>
+	* ext/tk/sample/tktextframe.rb: ditto
 
-	* bignum.c (rb_big_even_p, rb_big_odd_p): make them public functions
-	  to be available in other source files.
+Thu Nov 20 13:37:34 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-	* include/ruby/intern.h (rb_big_even_p, rb_big_odd_p): add prototype
-	  declarations.
+	* ruby.h: define is_ruby_native_thread() for no native thread
+	  environment
 
-Fri Mar 18 00:25:56 2016  Tanaka Akira  <akr@fsij.org>
+	* eval.c: ditto
 
-	* enum.c (ary_inject_op): Implement the specialized code for sum of
-	  float numbers.
+Thu Nov 20 12:42:47 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-Fri Mar 18 00:15:05 2016  Yusuke Endoh  <mame@ruby-lang.org>
+	* configure.in: always check existence of the pthread library
 
-	* numeric.c (num_step): use rb_equal for zero check. rb_num_coerce_cmp
-	  created an object which caused extra overhead.
+	* ruby.h: define macros for ruby's native thread check
 
-Thu Mar 17 22:21:34 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* eval.c: add ruby's native thread check
 
-	* include/ruby/ruby.h (RB_GC_GUARD_PTR): remove intermediate
-	  macro, and expand for each RB_GC_GUARD.  [Fix GH-1293]
+	* gc.c: ditto
 
-Thu Mar 17 22:08:33 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Nov 19 14:45:18 2003  Minero Aoki  <aamine@loveruby.net>
 
-	* compile.c (iseq_specialized_instruction): move specialization
-	  for opt_newarray_max/min from translation phase.
+	* lib/net/http.rb (to_ary): print more friendly warning message.
 
-Thu Mar 17 21:52:09 2016  Yusuke Endoh  <mame@ruby-lang.org>
+Wed Nov 19 14:32:08 2003  Minero Aoki  <aamine@loveruby.net>
 
-	* array.c, enum.c: make rdoc format consistent.
+	* lib/fileutils.rb (fu_same?): add djgpp and wince.
 
-Thu Mar 17 21:47:57 2016  Yusuke Endoh  <mame@ruby-lang.org>
+	* lib/fileutils.rb (cannot_overwrite_file?): add wince.
 
-	* NEWS: add Array#max, #min, and the optimization.  [Feature #12172]
+Wed Nov 19 11:04:47 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Thu Mar 17 21:45:02 2016  Yusuke Endoh  <mame@ruby-lang.org>
+	* lib/fileutils.rb (cannot_overwrite_file?, have_st_ino?): bccwin32
+	  is same as mswin32.
 
-	* compile.c (NODE_CALL): add optimization shortcut for Array#max/min.
-	  Now `[x, y].max` is optimized so that a temporal array object is not
-	  created in some condition.  [Feature #12172]
+Wed Nov 19 07:54:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
 
-	* insns.def (opt_newarray_max, opt_newarray_min): added.
+	* lib/test/unit.rb: do not run tests if $! is set.
 
-Thu Mar 17 21:35:52 2016  Yusuke Endoh  <mame@ruby-lang.org>
+	* lib/test/unit/assertionfailederror.rb: extend StandardError instead
+	  Exception (irb catches the former but not the latter).
 
-	* array.c (rb_ary_max, rb_ary_min): implement Array#max and min with
-	  arguments.  replace super call with rb_nmin_run.
+Tue Nov 18 23:31:36 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
 
-	* enum.c (nmin_run): exported (as rb_nmin_run).
+	* missing/memmove.c (memmove): take void *, not char *.
 
-	* internal.h: added a prototype for rb_nmin_run.
+	* missing.h (memmove): ditto.
 
-Thu Mar 17 21:24:52 2016  Yusuke Endoh  <mame@ruby-lang.org>
+	* missing.h (strchr, strrchr): return char *, not int.
 
-	* array.c (rb_ary_max, rb_ary_min): implement a block by itself instead
-	  of delegating Enumerable#max/min.
+Tue Nov 18 22:20:10 2003  Minero Aoki  <aamine@loveruby.net>
 
-Thu Mar 17 21:09:34 2016  Yusuke Endoh  <mame@ruby-lang.org>
+	* lib/fileutils.rb (fu_same?): temporal fix for windows.
 
-	* array.c (rb_ary_max, rb_ary_min): Array#max and Array#min added.
-	  [Feature #12172]
+Tue Nov 18 19:05:04 2003  Minero Aoki  <aamine@loveruby.net>
 
-	* internal.h (OPTIMIZED_CMP): moved from enum.c so that array.c can
-	  use it.
+	* lib/fileutils.rb (fu_same?): check by inode instead of path
+	  name, to detect two hard links pointing to the same content.
 
-	* test/ruby/test_array.rb (test_max, test_min): tests for Array#max
-	  and Array#min.
+	* test/fileutils.rb: did not create correctly looped symlinks.
 
-	* test/ruby/test_enum.rb (test_max, test_min): revised a bit to test
-	  Enumerable#max and #min explicitly.
+Tue Nov 18 18:23:05 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Mar 17 21:02:42 2016  Yusuke Endoh  <mame@ruby-lang.org>
+	* ext/stringio/stringio.c (strio_read): behave as IO at empty string.
+	  [ruby-dev:21939], [ruby-dev:21941]
 
-	* internal.c: struct cmp_opt_data added for refactoring out a data
-	  structure for CMP_OPTIMIZABLE
+	* ext/stringio/stringio.c (strio_getc, strio_getline): set EOF flag.
 
-	* array.c (struct ary_sort_data): use struct cmp_opt_data.
+	* ext/stringio/stringio.c (strio_rewind, strio_seek, strio_ungetc):
+	  clear EOF flag.
 
-	* enum.c (struct min_t, max_t, min_max_t): use struct cmp_opt_data.
+	* test/stringio/test_stringio.rb: imported from [ruby-dev:21941].
 
-Thu Mar 17 20:55:21 2016  Tanaka Akira  <akr@fsij.org>
+Tue Nov 18 14:06:35 2003  Minero Aoki  <aamine@loveruby.net>
 
-	* enum.c (ary_inject_op): Extracted from enum_inject.
+	* lib/fileutils.rb (fu_each_src_dest): raise if src==dest.
+	  [ruby-talk:85344] [ruby-core:01699]
 
-Thu Mar 17 18:39:04 2016  Tanaka Akira  <akr@fsij.org>
+	* lib/fileutils.rb: use Object#is_a? instead of Class#=== to allow
+	  e.g. remote objects for receivers.
 
-	* enum.c (enum_inject): Implement the specialized code for sum of
-	  integers including Bignums.
+	* lib/fileutils.rb: FileTest -> File.
 
-	* internal.h (rb_fix_plus): Declared to be usable from enum_inject.
+	* lib/fileutils.rb: put parentheses for arguments of File.xxxx?
 
-	* numeric.c (rb_fix_plus): Defined.
+	* test/fileutils/test_fileutils.rb (test_cp): test "cp a a".
 
-Thu Mar 17 17:20:28 2016  Anton Davydov  <antondavydov.o@gmail.com>
+	* test/fileutils/test_fileutils.rb (test_mv): test "mv a a".
 
-	* thread_sync.c: [DOC] Update documentation for Queue class
-	  description.  [Fix GH-1292]
+	* test/fileutils/test_fileutils.rb (test_ln): test "ln a a".
 
-Thu Mar 17 17:14:51 2016  Dinar Valeev  <dvaleev@suse.com>
+	* test/fileutils/test_fileutils.rb (test_ln_s): test "ln_s a a".
 
-	* gc.c (tick): Use __builtin_ppc_get_timebase for POWER arch.
-	  [Fix GH-1291]
+	* test/fileutils/test_fileutils.rb (test_install): test "install a a".
 
-Thu Mar 17 11:51:48 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* test/fileutils/fileasserts.rb: new method assert_symlink.
 
-	* lib/securerandom.rb (gen_random): to avoid blocking on Windows.
-	  On Windows OpenSSL RAND_bytes (underlying implementation is
-	  RAND_poll in crypto/rand/rand_win.c) may be blocked at
-	  NetStatisticsGet.
-	  https://wiki.openssl.org/index.php/Random_Numbers#Windows_Issues
-	  Instead of this, use Random.raw_seed directly (whose implementation
-	  CryptGenRandom is one of the source of
-	  entropy of RAND_poll on Windows).
-	  https://wiki.openssl.org/index.php/Random_Numbers
-	  Note: CryptGenRandom function is PRNG and doesn't check its entropy,
-	  so it won't block. [Bug #12139]
-	  https://msdn.microsoft.com/ja-jp/library/windows/desktop/aa379942.aspx
-	  https://tools.ietf.org/html/rfc4086#section-7.1.3
-	  https://eprint.iacr.org/2007/419.pdf
-	  http://www.cs.huji.ac.il/~dolev/pubs/thesis/msc-thesis-leo.pdf
+	* test/fileutils/fileasserts.rb: assert_is_directory -> assert_directory.
 
-Thu Mar 17 12:09:00 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Mon Nov 17 19:38:49 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* enc/unicode.c: Fixed two macro definitions.
-	* test/ruby/enc/test_case_mapping.rb: Test cases that detected
-	  the above bugs.
+	* file.c (getcwdofdrv): avoid using getcwd() directly, use
+	  my_getcwd() instead.
 
-Thu Mar 17 11:36:27 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* merged NeXT, OpenStep, Rhapsody ports patch from Eric Sunshine
+	  <sunshine@sunshineco.com>.  [ruby-core:01596]
 
-	* ext/socket/option.c (inspect_tcpi_msec): more accurate condition
-	  for TCPI msec member inspection function.
-	  [ruby-core:74388] [Bug #12185]
+Mon Nov 17 10:50:27 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Mar 17 08:13:43 2016  Rei Odaira  <Rei.Odaira@gmail.com>
+	* lib/optparse.rb (OptionParser::Completion::complete): allow least
+	  common completion for three or more candidates.
 
-	* test/-ext-/time/test_new.rb (test_timespec_new): Time#gmtoff values
-	  are the same only when both or neither of the Time objects are in
-	  summer time (daylight-saving time).
+Mon Nov 17 09:41:38 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Mar 17 07:17:36 2016  Eric Hodel  <drbrain@segment7.net>
+	* lib/test/unit/ui/tk/testrunner.rb,
+	  lib/test/unit/ui/gtk/testrunner.rb:
+	  run GUI main loop in sub thread.
 
-	* marshal.c (r_object0):  raise ArgumentError when linking to undefined
-	  object.
+	* lib/test/unit/ui/gtk2/testrunner.rb: imported from rough.
 
-Thu Mar 17 00:45:00 2016  Kenta Murata  <mrkn@mrkn.jp>
+	* lib/test/unit/autorunner.rb (keyword_display): sort keywords.
 
-	* test/ruby/test_bignum.rb: Make sure to use Bignum values in the tests.
+Sun Nov 16 18:10:57 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Mar 16 23:10:25 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* eval.c (rb_eval): iterator should return value from next inside
+	  begin/rescue/end.  (ruby-bugs:PR#1218)
 
-	* defs/keywords (alias, undef): symbol literals are allowed.
+Sun Nov 16 13:26:07 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* parse.y (parse_percent): should parse symbol literals for alias
-	  and undef.  [ruby-dev:47681] [Bug #8851]
+	* marshal.c (w_object): LINK check earlier than anything else,
+	  i.e. do not dump TYPE_IVAR for already dumped objects.
+	  (ruby-bugs:PR#1220)
 
-Wed Mar 16 21:39:39 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* eval.c (rb_eval): call "inherited" only when a new class is
+	  generated; not on reopening.
 
-	* enc/trans/JIS: update Unicode's notice. [Bug #11844]
+	* eval.c (eval): prepend error position in evaluating string to
+	  "mesg" attribute string only when it's available and is a
+	  string.
 
-Wed Mar 16 20:03:35 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sun Nov 16 12:16:10 2003  Minero Aoki  <aamine@loveruby.net>
 
-	* proc.c (proc_binding): proc from symbol can not make a binding.
-	  [ruby-core:74100] [Bug #12137]
+	* lib/net/protocol.rb: logging response body. [experimental]
+	  [ruby-list:38800]
 
-Wed Mar 16 18:42:45 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Sun Nov 16 10:49:38 2003  Gavin Sinclair  <gsinclair@soyabean.com.au>
 
-	* test/ruby/enc/test_case_mapping.rb: Fixed and activated a test for Cherokee.
+	* lib/thread.rb (Thread.exclusive): wrap method definition in
+	  class Thread to enable rdoc to process.
 
-Wed Mar 16 17:58:56 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Sun Nov 16 09:45:23 2003  Minero Aoki  <aamine@loveruby.net>
 
-	* test/ruby/enc/test_case_mapping.rb: Fixed a logical error.
+	* lib/net/http.rb (set_debug_output): warn if method is called
+	  after #start.  [ruby-dev:38798]
 
-Wed Mar 16 17:57:34 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Sun Nov 16 04:41:33 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* test/ruby/enc/test_case_mapping.rb: Adding tests for Cherokee.
-	  One test not yet working.
-	  (with Kimihito Matsui)
+	* eval.c (eval): do not re-raise exception to avoid unnecessary
+	  exception copying, instead modify exception and internal
+	  information to adjust eval().
 
-Wed Mar 16 15:44:05 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* eval.c (backtrace): can return the current frame information
+	  only if lev < -1.
 
-	* test/ruby/enc/test_case_mapping.rb: Adding tests for actual Unicode
-	  case mapping. Fixing some aliasing issues.
-	  (with Kimihito Matsui)
+Sat Nov 15 22:16:42 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
 
-Tue Mar 15 21:38:28 2016  Tanaka Akira  <akr@fsij.org>
+	* /ext/openssl/ossl_x509ext.c (ossl_x509extfactory_create_ext):
+	  refine error message.
 
-	* enum.c (enum_inject): Consider redefinition of Fixnum#+.
-	  [ruby-dev:49510] [Bug#12178] Reported by usa.
+Sat Nov 15 10:05:40 2003  Tanaka Akira  <akr@m17n.org>
 
-Tue Mar 15 20:32:57 2016  Tanaka Akira  <akr@fsij.org>
+	* lib/open-uri.rb (OpenURI.open_loop, OpenURI::HTTP#proxy_open):
+	  refactored to support options.
+	  (Buffer): maintain size by this class.
 
-	* enum.c (enum_inject): Implement the specialized code for :+ operator
-	  for Fixnums.
+Sat Nov 15 07:40:14 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Tue Mar 15 20:21:01 2016  Tanaka Akira  <akr@fsij.org>
+	* eval.c (rb_method_node): new API to retrieve method body.
 
-	* enum.c (enum_inject): Implement the specialized code for self is an
-	  array and a symbol operator is given.
+Fri Nov 14 13:21:30 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-Tue Mar 15 16:29:51 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* ext/tcltklib/tcltklib.c: fix (en-bugged at 2003/11/07)
 
-	* enc/unicode.c: Eliminating common code.
-	  (with Kimihito Matsui)
+	* ext/tk/lib/tkdialog.rb: TkDialog.new accepts a parent widget
+	  argument [ruby-talk:85066]
 
-Tue Mar 15 16:17:09 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Thu Nov 13 20:53:35 2003  Tanaka Akira  <akr@m17n.org>
 
-	* enc/unicode.c: Expansion of some code repetition in preparation for
-	  elimination of common code pieces.
-	  (with Kimihito Matsui)
+	* lib/open-uri.rb (Kernel[#.]open): hard coded URI schemes removed.
+	  [ruby-ext:02251]
 
-Tue Mar 15 13:49:23 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Thu Nov 13 19:17:00 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-	* enc/unicode.c: Additional macros and code to use mapping data in
-	  CaseMappingSpecials array.
-	  (with Kimihito Matsui)
+	* lib/test/unit/ui/tk/testrunner.rb: use grid and panedwindow
+	  (if available)
 
-Tue Mar 15 13:41:22 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Nov 13 17:56:41 2003  Tanaka Akira  <akr@m17n.org>
 
-	* internal.h (rb_gc_mark_global_tbl): should be private,
-	  but was accidentally exported.
+	* lib/open-uri.rb (OpenURI.open_uri): use File::RDONLY.
+	  reported by Take_tk <ggb03124@nifty.ne.jp>.
+	  [ruby-ext:02245]
 
-Tue Mar 15 12:51:06 2016  Marcus Stollsteimer  <sto.mar@web.de>
+Thu Nov 13 16:45:53 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
 
-	* doc/extension.ja.rdoc: Fix RDoc markup in doc/extension*.rdoc.
-	  [ci skip][Bug #12143][ruby-core:74143]
-	* doc/extension.rdoc: ditto.
+	* ext/openssl/ossl_x509req.c (ossl_x509req_to_der): add function for
+	  X509::Request#to_der.
 
-Tue Mar 15 09:56:41 2016  Ian Lunderskov  <ian.lunderskov@gmail.com>
+Thu Nov 13 11:31:14 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* time.c: Minor typo in Time#dst? documentation.
-	  [ci skip][fix GH-1290]
+	* lib/optparse.rb (OptionParser::Completion#complete): prior shorter
+	  name to containing longer name.
 
-Tue Mar 15 04:36:41 2016  Charles Oliver Nutter  <headius@headius.com>
+Thu Nov 13 06:08:54 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-	* test/ruby/test_rubyoptions.rb (test_disable): add tests for
-	  --disable-gems and --disable-did_you_mean.
+	* ext/tk/lib/tk.rb: stop freezing some classes
 
-Tue Mar 15 03:35:04 2016  Eric Hodel  <drbrain@segment7.net>
+	* ext/tk/lib/multi-tk.rb: ditto.
 
-	* marshal.c (r_object0): Fix Marshal crash for corrupt extended object.
+Wed Nov 12 17:32:49 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Mar 15 01:22:27 2016  Charles Oliver Nutter  <headius@headius.com>
+	* lib/test/unit/assertions.rb (assert_throws, assert_nothing_thrown):
+	  uncaught throw in sub thread raises ThreadError.
 
-	* test/ruby/test_rubyoptions.rb: make version matching support
-	  JRuby's version output.
+	* lib/test/unit/ui/tk/testrunner.rb (setup_ui): "expand" is not
+	  necessary.
 
-Mon Mar 14 19:05:39 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+Wed Nov 12 14:09:43 2003  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* bignum.c (big2str_2bdigits): reduce div instruction.
+	* test/monitor/test_monitor.rb: fix the timing problem by Queue.
 
-Mon Mar 14 18:39:53 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Wed Nov 12 12:59:44 2003  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* include/ruby/oniguruma.h, enc/unicode.c: Adjusting flag assignments
-	  and macros to work with unified CaseMappingSpecials array.
-	  (with Kimihito Matsui)
+	* test/monitor/test_monitor.rb: added.
 
-Mon Mar 14 16:53:37 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Nov 12 10:14:28 2003  Shugo Maeda  <shugo@ruby-lang.org>
 
-	* compile.c (compile_named_capture_assign): optimize named capture
-	  assignments, by replacing repeating global variable accesses
-	  with `dup`, and by returning the matched result instead of
-	  re-getting it from the MatchData.
+	* lib/monitor.rb: refactored. Thanks, Gennady Bystritsky.
 
-	* parse.y (reg_named_capture_assign_gen): build just assignment
-	  nodes for the optimization.
+Wed Nov 12 06:11:39 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
 
-Mon Mar 14 16:02:59 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/openssl/ossl.c (ossl_x509_sk2ary, ossl_x509crl_sk2ary):
+	  add functions to convert STACK into Array.
 
-	* file.c (ruby_is_fd_loadable): now return -1 if loadable but
-	  may block.
+	* ext/openssl/ossl.h: add prototypes.
 
-	* ruby.c (open_load_file): wait to read by the result of
-	  ruby_is_fd_loadable, without fstat.
+	* ext/openssl/ossl_pkcs7.c (ossl_pkcs7_set_certificates,
+	  ossl_pkcs7_get_certificates, ossl_pkcs7_get_crls,
+	  ossl_pkcs7_set_crls): add functions for PKCS7#certificates=
+	  PKCS7#certificates, PKCS7#crls= and PKCS7#crls.
 
-Mon Mar 14 13:38:38 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+Wed Nov 12 00:47:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
 
-	* numeric.c (fix2str): improve r54092 like rb_int2big().
+	* lib/test/unit/ui/testrunnermediator.rb: should require 'test/unit'.
 
-Mon Mar 14 10:02:23 2016  Eric Wong  <e@80x24.org>
+Tue Nov 11 23:54:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
 
-	* ext/openssl/ossl_ssl.c (ossl_sslctx_setup): document as MT-unsafe
-	  [ruby-core:73803] [Bug #12069]
+	* lib/test/unit/ui/gtk/testrunner.rb: added a rescue clause to handle
+	  the case when the requested font is not available.
 
-Sun Mar 13 09:43:23 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Nov 11 22:44:08 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* include/ruby/win32.h (O_SHARE_DELETE): change to fit Fixnum
-	  limit.  [ruby-core:74285] [Bug #12171]
+	* io.c (appendline): file may not end with newline.  a bug if
+	  READ_DATA_PENDING_PTR is defined. [ruby-talk:84925]
 
-Sun Mar 13 09:15:45 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Nov 11 10:42:41 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-	* numeric.c (rb_fix2str): fix edge case, accidentally generated
-	  wrong Fixnum from LONG_MIN.
+	* ext/tk/lib/tk.rb: raise an exception when creating TkWindow
+	  object, because TkWindow class is an abstract class.
 
-Sat Mar 12 09:50:27 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Nov 11 03:30:43 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
 
-	* vm_eval.c (rb_f_catch): [DOC] fix malformed RDoc syntax, "+...+"
-	  cannot enclose non-identifier characters.
-	  a patch by Sebastian S in [ruby-core:74278].  [Bug#12170]
+	* lib/ext/openssl/ossl_conf.c (ossl_config_get_value): return nil
+	  if the specified value doesn't exist.
 
-Sat Mar 12 02:44:48 2016  Tanaka Akira  <akr@fsij.org>
+	* lib/ext/openssl/ossl_conf.c (ossl_config_get_section): return
+	  a empty hash if the specified section doesn't exist.
 
-	* test/lib/test/unit.rb: describe !/REGEXP/ in the help message.
+Mon Nov 10 11:40:29 2003  Shugo Maeda  <shugo@ruby-lang.org>
 
-Fri Mar 11 17:03:09 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/monitor.rb (wait): return true on signal/broadcastfalse and
+	  false on timeout. Thanks Gennady Bystritsky.
 
-	* test/lib/test/unit.rb (Options#non_options): make regexp name
-	  options prefixed with "!" negative filters.
+Mon Nov 10 00:07:10 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* common.mk (TEST_EXCLUDES): use negative filter to exclude memory
-	  leak tests.  -x option excludes test files, not test methods.
+	* parse.y (primary): primary_value may be 0 when syntax error.
+	  [ruby-talk:84893]
 
-Fri Mar 11 16:11:27 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Sun Nov  9 02:05:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
 
-	* enc/unicode/case-folding.rb, casefold.h: Streamlining approach to
-	  case mapping data not available from case folding by unifying all
-	  three cases (special title, special upper, special lower).
-	* enc/unicode.c: Adjust macro names for above (macros are currently inactive).
-	  (with Kimihito Matsui)
+	* lib/test/unit/assertions.rb: un-deprecated #assert_not_nil to
+	  maintain symmetry with #assert_nil. Also added better output for
+	  #assert_kind_of.
 
-Thu Mar 10 17:34:16 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/testunit/tc_assertions.rb: ditto.
 
-	* iseq.c (prepare_iseq_build): enable coverage by coverage_enabled
-	  option, not by parse_in_eval flag in the thread context.
+Sat Nov  8 18:50:20 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-	* iseq.h (rb_compile_option_struct): add coverage_enabled flag.
+	* test/wsdl/raa/*: add new testcase for WSDL loading, parsing and
+	  reading.
 
-	* parse.y (yycompile0): set coverage_enabled flag if coverage
-	  array is made.
+	* test/soap/marshal/*: backport from soap4r/1.5.1.  all differences are
+	  for ruby/1.6.
 
-Thu Mar 10 15:19:54 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/soap/*: backport from soap4r/1.5.1.  all differences are for
+	  ruby/1.6.
 
-	* node.c (dump_option): nd_compile_option is a hidden hash object,
-	  cannot call inspect on it.
+	* lib/wsdl/data.rb, lib/wsdl/xmlSchema/data.rb: move definition of
+	  ArrayTypeAttrName from ::WSDL::XMLSchema::* to ::WSDL::*.
+	  [ruby-talk:84813]
 
-Thu Mar 10 09:49:54 2016  Rei Odaira  <Rei.Odaira@gmail.com>
+	* lib/wsdl/soap/definitions.rb: element name typo in custom exception
+	  struct definition which is needed for wsdlDriver; camelCase ->
+	  underscore_name.
 
-	* test/socket/test_socket.rb (test_udp_recvmsg_truncation):
-	  AIX does not set the MSG_TRUNC flag for a message partially read
-	  by recvmsg(2) with the MSG_PEEK flag set.
+Sat Nov  8 13:49:50 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-Wed Mar  9 16:48:45 2016  Koichi Sasada  <ko1@atdot.net>
+	* configure.in: improvement of pthread check
 
-	* benchmark/driver.rb: fix my last commit (syntax error).
+Sat Nov  8 13:28:46 2003  Takaaki Tateishi  <ttate@ttsky.net>
+	* ext/dl/sym.c: Add DL.win32_last_error and DL.last_error.
+	  Thanks, Kaoru Shirai.
 
-Wed Mar  9 16:41:44 2016  Koichi Sasada  <ko1@atdot.net>
+Sat Nov  8 06:19:38 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-	* benchmark/driver.rb: fix output messages.
+	* ext/tcltklib/tcltklib.c: To fix 'pthread-enabled Tcl/Tk' problem,
+	  TclTkIp#_eval calls Tcl_Eval() on the mainloop thread only
+	  (queueing a handler to the EventQueue).
 
-	* benchmark/memory_wrapper.rb: use respond_to? because
-	  member? does not work well.
+	* ext/tcltklib/README.1st: edit the description of '--with-pthread-ext'
 
-Wed Mar  9 16:20:25 2016  Koichi Sasada  <ko1@atdot.net>
+Fri Nov  7 23:23:04 2003  Tanaka Akira  <akr@m17n.org>
 
-	* benchmark/driver.rb: support memory usage benchmark.
-	  use `--measure-target=[target]'.
-	  Now, we can use the following targets:
-	    * real (default): real time which returns process time in sec.
-	    * peak: peak memory usage (physical memory) in bytes.
-	    * size: last memory usage (physical memory) in bytes.
+	* lib/pathname.rb (Pathname#+): if self or the argument is `.', return
+	  another.
+	  (Pathname#parent): if self is `.', return `..'.
+	  (Pathname#children): if self is `.', don't prepend self for a
+	  pathname in a result.
+	  (Pathname#join): re-implemented using Pathname#+.
+	  (Pathname#find): if self is `.', remove `./' prefix of yielding
+	  pathname.
 
-	* benchmark/memory_wrapper.rb: ditto.
+Fri Nov  7 10:23:24 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Mar  9 15:04:22 2016  Koichi Sasada  <ko1@atdot.net>
+	* ext/socket/socket.c (make_hostent): get rid of SEGV on aliases
+	  lookup failure.  (ruby-bugs:PR#1215)
 
-	* benchmark/bm_vm3_gc_old_full.rb: add GC.start benchmark.
+Fri Nov  7 04:08:05 2003  UENO Katsuhiro  <katsu@blue.sky.or.jp>
 
-	* benchmark/bm_vm3_gc_old_immediate.rb: ditto.
+	* ext/zlib/zlib.c (Init_zlib): define Zlib::GzipReader#each_line as
+	  an alias of Zlib::GzipReader#each.
 
-	* benchmark/bm_vm3_gc_old_lazy.rb: ditto.
+Fri Nov  7 01:03:16 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Wed Mar  9 14:59:11 2016  Koichi Sasada  <ko1@atdot.net>
+	* eval.c (rb_load): save and restore rb_prohibit_interrupt.
+	  [ruby-dev:21857]
 
-	* benchmark/driver.rb: exit benchmarking if a benchmark process
-	  receives signals.
+Thu Nov  6 18:05:07 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Mar  9 13:22:49 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* io.c (rb_io_inspect): show the path also at a closed file.
+	  [ruby-dev:21851]
 
-	* test/lib/memory_status.rb: make Memory::Status independent of
-	  MiniTest::Skip.
+Thu Nov  6 11:42:07 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/lib/test/unit/assertions.rb (assert_no_memory_leak): skip
-	  if Memory::Status is not available.
+	* ext/stringio/stringio.c (strio_set_string, strio_reopen): check
+	  tainted.
 
-Wed Mar  9 09:19:55 2016  Rei Odaira  <Rei.Odaira@gmail.com>
+	* ext/stringio/stringio.c (strio_copy, strio_ungetc, strio_write,
+	  strio_putc): add infection.
 
-	* test/io/wait/test_io_wait.rb (test_wait_readwrite_timeout):
-	  select(2) in AIX returns "readable" for the write-side fd
-	  of a pipe, so it is not possible to use a pipe to test
-	  the read-write timeout of IO#wait on AIX.
+	* ext/stringio/stringio.c (strio_path): just nil.  [ruby-dev:21846]
 
-Wed Mar  9 03:35:22 2016  Charles Oliver Nutter  <headius@headius.com>
+	* ruby.c (proc_options): reserve searched script path in the
+	  source file name table.  [ruby-list:38765]
 
-	* test/ruby/test_require.rb (test_require_with_loaded_features_pop):
-	  Only remove PATH so threads don't accidentally double-pop.
+	* lib/optparse.rb (OptionParser::Completion#complete): default not to
+	  ignore case on completion.  [ruby-talk:84726]
 
-Wed Mar  9 00:29:46 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* win32/win32.c (make_cmdvector): process backslashes even if a quote
+	  is not enclosed.
 
-	* vm_method.c (rb_alias): the original name should be properly
-	  available method_added method, set the name before calling the
-	  hook.
+Wed Nov  5 23:49:45 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-Wed Mar  9 00:07:03 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* sample/openssl/gen_csr.rb: there (at least) is a CA which does not
+	  accept DN in UTF8STRING format.  it's a sample.
 
-	* lib/logger.rb (Logger::LogDevice#initialize): define using
-	  keyword arguments.
+Wed Nov  5 22:55:16 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-Tue Mar  8 23:37:07 2016  Charles Oliver Nutter  <headius@headius.com>
+	* configure.in, eval.c, signal.c: : add '--with-pthread-ext'
+	  option to fix the pthread trouble on 'tcltklib'
 
-	* test/ruby/test_array.rb: split out the test for no stack error
-	  on large input for test_permutation, test_repeated_permutation,
-	  and test_repeated_combination, and make them all timeout:30.
+	* ext/tcltklib/README.1st: add the description of '--with-pthread-ext'
 
-Tue Mar  8 17:20:21 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* ext/tk/lib/tktext.rb : add TkText#text_copy, text_cut, text_paste
+	  to support Tcl/Tk8.4's tk_textCopy, tk_textCut, tk_textPaste
 
-	* intern.h (rb_divmod): assume compilers `/` and `%` comply C99
-	  and reduce branching. If a compiler doesn't comply, add #ifdefs.
+	* ext/tk/lib/tk.rb : add TkMenu#set_focus support Tcl/Tk's
+	  tk_menuSetFocus
 
-	* intern.h (rb_div): added for Ruby's behavior.
+Wed Nov  5 17:33:45 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* intern.h (rb_mod): added for Ruby's behavior.
+	* eval.c (rb_load): allow interrupt during loaded program
+	  evaluation.  [ruby-dev:21834]
 
-	* insns.def (opt_div): use rb_div.
+	* hash.c (rb_hash_fetch): always warn if default argument and a
+	  block are supplied at the same time. [ruby-dev:21842]
 
-	* insns.def (opt_mod): use rb_mod.
+	* hash.c (env_fetch): ditto.
 
-	* numeric.c (fixdivmod): removed.
+	* array.c (rb_ary_fetch): ditto.
 
-	* numeric.c (fix_divide): use rb_div.
+Wed Nov  5 19:08:47 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* numeric.c (fix_mod): use rb_mod.
+	* lib/optparse.rb (OptionParser::Switch::PlacedArgument::parse):
+	  do not remove next argument if empty value is placed.
 
-	* numeric.c (fix_divmod): use rb_divmod.
+	* test/optparse: added.
 
-Tue Mar  8 17:53:09 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+Wed Nov  5 17:05:18 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* insns.def (opt_mod): show its method name on ZeroDivisionError.
-	  [Bug #12158]
+	* lib/test/unit/ui/gtk/testrunner.rb: typo.
 
-Tue Mar  8 17:33:38 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+Wed Nov  5 11:13:32 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* win32/win32.c (rb_w32_write_console): now no need to check
-	  ERROR_CALL_NOT_IMPLEMENTED because it is for old Win9X.
+	* string.c: add #include "version.h". this file still depends on it.
 
-Tue Mar  8 16:54:29 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* Makefile.in, bcc32/Makefile.sub, win32/Makefile.sub,
+	  wince/Makefile.sub: add version.h dependency to string.c.
 
-	* win32/win32.c (rb_w32_write_console): stop the VT100 emulation if the
-	  console supports it natively.
+Wed Nov  5 09:14:23 2003  Shugo Maeda  <shugo@ruby-lang.org>
 
-Tue Mar  8 08:13:01 2016  Rei Odaira  <Rei.Odaira@gmail.com>
+	* lib/monitor.rb: revert to the previous revision.
 
-	* test/net/imap/test_imap.rb (test_idle_timeout): Because of the
-	  timeout specified in "imap.idle(0.2)", there is no guarantee that
-	  the server thread has done all the work before the client thread
-	  performs the assertions. It depends on the thread scheduling.
-	  Add checks to avoid false positives (on AIX, particularly).
+Wed Nov  5 08:39:51 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
 
-Tue Mar  8 00:42:22 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* lib/webrick/https.rb (HTTPRequest#parse): set @client_cert_chain.
 
-	* ruby.c (warn_cr_in_shebang): meaningless check on DOSISH platforms.
-	  fixed a test failure introduced at r53998.
+	* lib/webrick/https.rb (HTTPRequest#meta_vars): create
+	  SSL_CLIENT_CERT_CHAIN_n from @client_cert_chain.
 
-Tue Mar  8 00:27:53 2016  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+	* ext/openssl/ossl_ssl.c (ossl_ssl_get_peer_cert_chain): return nil
+	  if no cert-chain was given.
 
-	* ext/tk/lib/tkextlib/tcllib/tablelist_tile.rb: fix method name typo.
-	  [ruby-core:72513] [Bug #11893] The patch provided by Akira Matsuda.
+Tue Nov  4 23:44:48 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
 
+	* bcc32/Makefile.sub, win32/Makefile.sub, wince/Makefile.sub:
+	  remove needless version.h dependency.
 
-Tue Mar  8 00:25:08 2016  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+Tue Nov  4 23:38:43 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
 
-	* ext/tk/lib/tkextlib/tcllib/toolbar.rb: fix method name typo.
-	  [ruby-core:72511] [Bug #11891] The patch provided by Akira Matsuda.
+	* class.c, hash.c, string.c: remove #include "version.h".
 
+	* Makefile.in: remove needless version.h dependency.
 
-Tue Mar  8 00:21:58 2016  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+Tue Nov  4 06:54:52 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* ext/tk/lib/tkextlib/blt/tree.rb: fix method name typo.
-	  [ruby-core:72510] [Bug #11890] The patch provided by Akira Matsuda.
+	* io.c (read_all): fptr->f may be NULL, if IO is closed in the
+	  signal handler.
 
+	* io.c (io_read): ditto.
 
-Tue Mar  8 00:11:47 2016  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+	* string.c (get_pat): remove 1.8.0 warning code.
 
-	* ext/tk/lib/tk/menubar.rb: fix a typo in font name. [ruby-core:72505]
-	  [Bug #11886] The patch provided by Akira Matsuda.
+	* string.c (rb_str_match): extend warning until 1.8.2.
 
-	* ext/tk/sample/*.rb: ditto.
+	* string.c (rb_str_match2): ditto.
 
-Mon Mar  7 13:32:58 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* class.c (class_instance_method_list): remove 1.8.0 warnings.
+	  method_list now recurs.  [ruby-dev:21816]
 
-	* class.c (rb_define_class, rb_define_class_id_under): raise
-	  ArgumentError if super is 0, deprecated behavior which has been
-	  warned long time.
+	* class.c (rb_obj_singleton_methods): ditto.
 
-Mon Mar  7 13:28:30 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* array.c (rb_ary_select): remove select with block.
+	  [ruby-dev:21824]
 
-	* internal.h: move function declarations for class internals from
-	  include/ruby/intern.h.
+	* hash.c (rb_hash_select): ditto.
 
-Mon Mar  7 10:58:07 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* hash.c (env_select): ditto.
 
-	* ext/win32ole/win32ole_event.c (rescue_callback): use
-	  rb_write_error_str instead of rb_write_error, to respect
-	  the encoding and prevent the message from GC.
+	* re.c (match_select): ditto.
 
-	* internal.h (rb_write_error_str): export.
+	* struct.c (rb_struct_select): ditto.
 
-Mon Mar  7 01:38:41 2016  Rei Odaira  <Rei.Odaira@gmail.com>
+Mon Nov  3 22:53:21 2003  Minero Aoki  <aamine@loveruby.net>
 
-	* test/ruby/test_process.rb (test_execopts_gid): Skip a test
-	  that is known to fail on AIX. AIX allows setgid to
-	  a supplementary group, but Ruby does not allow the "-e"
-	  option when setgid'ed, so the test does not work as intended.
+	* lib/racc/parser.rb: synchronize with Racc 1.4.4.
 
-Sun Mar  6 22:43:41 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/racc/cparse/cparse.c: ditto.
 
-	* io.c (rb_obj_display): [DOC] fix output of Array, as Array#to_s
-	  is same as Array#inspect since 1.9.
+	* ext/racc/cparse/cparse.c (parse_main): should abort when
+	  the length of LR state stack <=1, not ==0.
 
-Sat Mar  5 09:50:58 2016  Rei Odaira  <Rei.Odaira@gmail.com>
+Mon Nov  3 08:50:47 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* test/socket/test_addrinfo.rb (test_ipv6_address_predicates):
-	  IN6_IS_ADDR_V4COMPAT and IN6_IS_ADDR_V4MAPPED are broken
-	  on AIX, so skip related tests.
+	* process.c (check_uid_switch): remove duplicated error messages.
 
-Sat Mar  5 09:17:54 2016  Rei Odaira  <Rei.Odaira@gmail.com>
+	* process.c (check_gid_switch): ditto.
 
-	* test/rinda/test_rinda.rb (test_make_socket_ipv4_multicast):
-	  The fifth argument to getsockopt(2) should be modified to
-	  indicate the actual size of the value on return,
-	  but not in AIX. This is a know bug. Skip related tests.
-	* test/rinda/test_rinda.rb (test_ring_server_ipv4_multicast):
-	  ditto.
-	* test/rinda/test_rinda.rb (test_make_socket_unicast): ditto.
-	* test/socket/test_basicsocket.rb (test_getsockopt): ditto.
-	* test/socket/test_sockopt.rb (test_bool): ditto.
+Sun Nov  2 02:28:33 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* lib/webrick/ssl.rb: new option :SSLExtraChainCert.
+
+Sun Nov  2 01:02:04 2003  Akinori MUSHA  <knu@iDaemons.org>
+
+	* string.c (rb_str_hash): Update the HASH_PERL alternative hash
+	  algorithm in sync with Perl 5.8.
+
+	* st.c (strhash): Ditto.
+
+Sat Nov  1 18:21:09 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/ossl_ssl.c (ossl_ssl_peer_cert_chain): add new method
+	  SSLSocket#peer_cert_chain.
+
+	* ext/openssl/ossl_x509req.c (GetX509ReqPtr): new function
+	  which returns underlying X509_REQ.
+
+	* ext/openssl/ossl_x509ext.c (ossl_x509extfactory_set_issuer_cert,
+	  ossl_x509extfactory_set_subject_cert, ossl_x509extfactory_set_crl,
+	  ossl_x509extfactory_set_subject_req, ossl_x509extfactory_set_config):
+	  use underlying C struct without duplication not to leak momory.
 
-Sat Mar  5 07:36:27 2016  Rei Odaira  <Rei.Odaira@gmail.com>
+Sat Nov  1 01:49:03 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-	* test/-ext-/float/test_nextafter.rb: In AIX,
-	  nextafter(+0.0,-0.0)=+0.0, and nextafter(-0.0,+0.0)=-0.0,
-	  but they should return -0.0 and +0.0, respectively. This is
-	  a known bug in nextafter(3) on AIX, so skip related tests.
+	* lib/soap/mapping/factory.rb: mark marshalled basetype objects when
+	  @allow_original_mapping is true.  multi-referencing basetype node is
+	  prohibited in SOAP/1.1 encoding but soap4r's original ruby object
+	  mapping requires basetype to be marked to detect self referencing
+	  loop.  e.g. o = 1; o.instance_eval { @iv = o }  soap4r's original
+	  mapping is only used through soap/marshal API.
 
-Sat Mar  5 07:14:10 2016  Rei Odaira  <Rei.Odaira@gmail.com>
+	* test/soap/marshal/test_marshal.rb: add tests for self referencing
+	  immutable objects.
 
-	* test/zlib/test_zlib.rb (test_adler32_combine, test_crc32_combine):
-	  Skip two tests on AIX because zconf.h in zlib does not correctly
-	  recognize _LARGE_FILES in AIX. The problem was already reported
-	  to zlib, and skip these tests until it is fixed.
+	* test/soap/calc/test_calc_cgi.rb: fix test name.
 
-Sat Mar  5 03:07:40 2016  Rei Odaira  <Rei.Odaira@gmail.com>
+Fri Oct 31 22:26:29 2003  Takaaki Uematsu  <uema2x@jcom.home.ne.jp>
 
-	* thread_pthread.c (getstack): __pi_stacksize returned by
-	  pthread_getthrds_np() is wrong on AIX. Use
-	  __pi_stackend - __pi_stackaddr instead.
+	* wince/string_wce.c (strrchr): should decrement pointer.
 
-Fri Mar  4 19:19:42 2016  Koichi Sasada  <ko1@atdot.net>
+	* wince/Makefile.sub: correct a range of isdigit().
 
-	* gc.c: use 2 bits with unsigned int for rb_objspace::flags::mode
-	  because it always returns 0 to 2 (non-negative value).
+Fri Oct 31 12:55:24 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
 
-Fri Mar  4 18:42:08 2016  Koichi Sasada  <ko1@atdot.net>
+	* configure.in, lib/mkmf.rb: add RPATHFLAG for NetBSD.
+	  [ruby-dev:21791]
 
-	* gc.c: rename "enum gc_stat" to "enum gc_mode"
-	  because there is a same name (no related) function gc_stat().
+	* bcc32/Makefile.sub, win32/Makefile.sub, win32/Makefile.sub: ditto.
 
-	  Also gc_stat_* are renamed to gc_mode_*,
-	  gc_stat_transition() to gc_mode_transition(),
-	  rb_objspace::flags::stat is renamed to rb_objspace::flags::mode.
+Fri Oct 31 01:38:14 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	  Change rb_objspace::flags::mode from 2 bits to 3 bits because VC++
-	  returns negative enum value with 2 bits.
+	* wince/Makefile.sub, win32/Makefile.sub (.y.c): allow white spaces
+	  at the beginning of line to remove by sed. (ruby-bugs-ja:PR#580)
 
-	* gc.c (gc_mode): add a macro to access rb_objspace::flags::mode
-	  with verification code (verification is enabled only on
-	  RGENGC_CHECK_MODE > 0).
+Fri Oct 31 01:02:24 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* gc.c (gc_mode_set): same macro for setter.
+	* compar.c (cmp_equal): protect exceptions from <=> comparison
+	  again.  returns nil if any exception or error happened during
+	  comparison.
 
-Fri Mar  4 09:28:18 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* eval.c (search_required): should update *featurep when DLEXT2 is
+	  defined. (ruby-bugs-ja:PR#581)
 
-	* lib/rubygems.rb, lib/rubygems/*, test/rubygems/*: Update rubygems-2.6.1.
-	  Please see entries of 2.6.0 and 2.6.1 on
-	  https://github.com/rubygems/rubygems/blob/master/History.txt
-	  [fix GH-1270] Patch by @segiddins
+Thu Oct 30 23:41:04 2003  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
 
-Thu Mar  3 14:09:00 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/drb/drb.rb: add DRbArray
 
-	* lib/ostruct.rb (modifiable?, new_ostruct_member!, table!):
-	  rename methods for internal use with suffixes and make private,
-	  [ruby-core:71069] [Bug #11587]
+	* lib/drb/invokemethod.rb: fix Hash#each problem. [ruby-dev:21773]
 
-Wed Mar  2 16:28:48 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/drb/unix.rb: add LoadError. [ruby-dev:21743]
 
-	* vm_eval.c (method_missing): call by found method entry and get
-	  rid of searching the same method entry twice.
+Thu Oct 30 23:19:11 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-	* vm_eval.c (vm_call0_body): calling method_missing method is
-	  method_missing().
+	* lib/soap/generator.rb: better XML pretty printing.
 
-Wed Mar  2 15:13:33 2016  herwinw  <herwin@quarantainenet.nl>
+	* lib/soap/encodingstyle/soapHandler.rb: remove unnecessary namespace
+	  assignment in the element which has "encodingStyle" attribute, and
+	  add necessary namespace assignment for "arrayType" attribute.
 
-	* lib/xmlrpc.rb: Removed broken parser named XMLScanStreamParser.
-	  It's not works with current Ruby version.
-	  [fix GH-1271][ruby-core:59588][Bug #9369]
-	* lib/xmlrpc/config.rb: ditto.
-	* lib/xmlrpc/parser.rb: ditto.
+	* test/soap/calc/test_calc_cgi.rb: take over $DEBUG to ruby process
+	  through CGI.
 
-Wed Mar  2 15:08:33 2016  herwinw  <herwin@quarantainenet.nl>
+Thu Oct 30 22:59:39 2003  why the lucky stiff  <why@ruby-lang.org>
 
-	* lib/xmlrpc.rb: Removed broken parser named XMLTreeParser.
-	  Required gem of its parser didn't compile on newer Ruby versions.
-	  [fix GH-1271][ruby-core:59590][Bug #9370]
-	* lib/xmlrpc/config.rb: ditto.
-	* lib/xmlrpc/parser.rb: ditto.
+	* ext/syck/yaml2byte.c: HASH const too long.  Thanks, matz.
 
-Tue Mar  1 11:25:48 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Oct 30 19:13:53 2003  Akinori MUSHA  <knu@iDaemons.org>
 
-	* lib/fileutils.rb: use keyword arguments instead of option
-	  hashes.
+	* ext/syck/MANIFEST: Add yamlbyte.h.
 
-Mon Feb 29 16:50:20 2016  hanachin  <hanachin@gmail.com>
+Thu Oct 30 14:25:31 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* array.c (rb_ary_push_m): [DOC] Remove trailing comma from
-	  Array#push example, as other Array examples doesn't put trailing
-	  comma.  [Fix GH-1279]
+	* io.c (READ_DATA_BUFFERED): new macro to detect whether stdio
+	  buffer filled.
 
-Mon Feb 29 16:31:01 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* io.c (rb_io_fptr_cleanup): move path deallocation to
+	  rb_io_fptr_finalize (finalizer called by GC).
 
-	* common.mk, tool/mkconfig.rb: set cross_compiling option from
-	  Makefile, but not from rbconfig.rb, which is just going to be
-	  created by this command.
+Thu Oct 30 13:23:39 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Sun Feb 28 23:13:49 2016  C.J. Collier  <cjcollier@linuxfoundation.org>
+	* parse.y (logop): left may be NULL. [ruby-talk:84539]
 
-	* configure.in: Add summary to end of configure output.
-	  [Fix GH-1275]
+	* eval.c (rb_eval): NODE_CASE nd_head may be NULL.
 
-Sun Feb 28 20:23:36 2016  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+Thu Oct 30 10:14:51 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-	* lib/drb/drb.rb (error_print): Add verbose failure messages and
-	  avoid infamous DRb::DRbConnError. [Feature #12101]
+	* lib/test/unit/autorunner.rb: make fox runner work.
 
-Sun Feb 28 13:40:46 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Oct 30 09:32:26 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* error.c (nometh_err_initialize): add private_call? parameter.
+	* process.c (rb_f_system): fixed lack of security check before
+	  calling do_spawn() on win32. [ruby-talk:84555]
 
-	* error.c (nometh_err_private_call_p): add private_call? method,
-	  to tell if the exception raised in private form FCALL or VCALL.
-	  [Feature #12043]
+Thu Oct 30 02:46:35 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* vm_eval.c (make_no_method_exception): append private_call?
+	* eval.c (proc_invoke): single array value to normal Proc#call
+	  (i.e. not via lambda call), should be treated just like yield.
+	  [ruby-dev:21726]
+
+Thu Oct 30 02:25:48 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/lib/openssl/buffering.rb (Buffering#initialize):
+	  add new method to inherit @sync from @io.sync.
+
+	* ext/openssl/lib/net/protocols.rb (SSLIO#ssl_connect): no need to
+	  set sync flag explicitly.
+
+	* ext/openssl/ossl_ssl.c (ossl_sslctx_initialize): call super.
+
+	* ext/openssl/ossl_ssl.c (ossl_sslctx_setup): set extra chain
+	  certificates in @extra_chain_cert.
+
+Wed Oct 29 22:02:04 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* test/drb/drbtest.rb: use rbconfig.rb to make the path of ruby
+	  interpreter to exec, instead of test/ruby/envutil.rb,
+
+Wed Oct 29 19:58:59 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ext/tcltklib/tcltklib.c (CONST84): define CONST84 when it is not
+	  defined and TCL_MAJOR_VERSION >= 8.
+
+	* ext/tcltklib/tcltklib.c (VwaitVarProc, WaitVariableProc,
+	  rb_threadVwaitProc): use CONST84 instead of CONST.
+
+	* ext/tcltklib/tcltklib.c (ip_rbTkWaitCommand,
+	  ip_rb_threadTkWaitCommand): use CONST84 always.
+
+Wed Oct 29 17:27:05 2003  Tanaka Akira  <akr@m17n.org>
+
+	* re.c (rb_reg_s_union, Init_Regexp): new method `Regexp.union'.
+
+	* lib/pathname.rb (realpath): examine Dir.pwd because it may have
+	  symlinks.
+
+Wed Oct 29 17:16:31 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (rb_longjmp): must not disturb original jump.
+	  [ruby-dev:21733]
+
+Wed Oct 29 15:28:34 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (Init_Proc): taint preallocated exception object
+	  sysstack_error. [ruby-talk:84534]
+
+Wed Oct 29 11:27:39 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* parse.y (ret_args): node may be NULL. [ruby-talk:84530]
+
+Tue Oct 28 15:20:12 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ext/tcltklib/tcltklib.c (VwaitVarProc, ip_rbVwaitObjCmd,
+	  WaitVariableProc, WaitVisibilityProc, WaitWindowProc,
+	  ip_rbTkWaitObjCmd, ip_rbTkWaitCommand, rb_threadVwaitProc,
+	  rb_threadWaitVisibilityProc, rb_threadWaitWindowProc,
+	  ip_rb_threadVwaitObjCmd, ip_rb_threadTkWaitObjCmd): prototype;
+	  avoid VC++ warnings.
+
+Mon Oct 27 19:19:55 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (rb_longjmp): ignore reentering error while warning.
+	  [ruby-dev:21730]
+
+Mon Oct 27 00:23:50 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tcltklib/tcltklib.c (ip_ruby): bug fix on Win : hang-up when
+	  calling 'exit' in the Tk callback procedure. [ruby-list:38656]
+
+Sat Oct 25 09:18:04 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (rb_method_missing): protect exception from within
+	  "inspect".  (ruby-bugs:PR#1204)
+
+Fri Oct 24 23:26:34 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* hash.c (rb_hash_each): Hash#each should yield single value.
+	  [ruby-talk:84420]
+
+	* hash.c (env_each): ditto for ENV.each.
+
+Thu Oct 23 20:25:32 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* lib/webrick/server.rb (GenericServer#start): should rescue
+	  IOError from IO::accept. [ruby-dev:21692]
+
+Thu Oct 23 17:59:36 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (ruby_cleanup): initialize stack bottom for embedding.
+	  [ruby-dev:21686]
+
+	* ext/dl/extconf.rb: move list of files to clean from DEPEND file,
+	  to get rid of macro redefinitions.
+
+Thu Oct 23 13:44:00 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y: integrate operations for stack_type.  [ruby-dev:21681]
+
+Thu Oct 23 00:41:45 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* test/soap/calc/*, test/soap/helloworld/*: set logging threshold
+	  to ERROR.
+
+Wed Oct 22 12:53:31 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/test/unit/collector/dir.rb (Test::Unit::Collector::Dir#collect_file):
+	  ignore tests which raised LoadError.
+
+	* test/drb/drbtest.rb, test/ruby/test_beginendblock.rb,
+	  test/ruby/test_system.rb: avoid requiring same file twice.
+
+	* test/drb/test_drbssl.rb, test/drb/test_drbunix.rb: should not use
+	  ARGV unless invoked directly.  do not create test cases unless
+	  required libraries are available.
+
+Wed Oct 22 02:31:34 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (ruby_cleanup): should not ignore exit_value in END
+	  execution. [ruby-dev:21670]
+
+Tue Oct 21 23:16:26 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (ruby_cleanup): call finalizers and exit procs before
+	  terminating threads.
+
+	* eval.c (ruby_cleanup): preserve ruby_errinfo before ruby_finalize_0().
+
+Tue Oct 21 15:57:11 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* lib/test/unit/collector/dir.rb (Test::Unit::Collector::Dir#collect_file):
+	  prepend the directory of target file to the load path.
+
+Tue Oct 21 15:08:53 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (do_spawn, do_aspawn): should wait child process even
+	  if callded with P_OVERLAY.
+
+	* win32/win32.c (do_spawn, do_aspawn): should return child's exit
+	  status to parent.
+
+Tue Oct 21 00:35:02 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* test/soap/calc/*, test/soap/helloworld/*: catch the exception from
+	  test server thread and recover.
+
+Tue Oct 21 00:22:57 2003  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+
+	* test/drb/*: import drb/runit.
+
+Mon Oct 20 23:55:47 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (rb_eval): set current node after arguments evaluation.
+	  [ruby-dev:21632]
+
+	* eval.c (rb_yield_0): set current node and keep it at local jump.
+
+Mon Oct 20 22:01:18 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (rb_thread_cleanup): keep thread group for main thread.
+	  [ruby-dev:21644]
+
+Mon Oct 20 18:28:10 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (rb_catch): backout.
+
+Mon Oct 20 17:31:46 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (PUSH_FRAME): generate unique number to be TAG_JUMP()
+	  destination.
+
+	* eval.c (localjump_destination): use unique number in ruby_frame
+	  for localjump destination.
+
+Mon Oct 20 11:31:44 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* test/ruby/test_signal.rb (test_signal): restore old trap.
+
+Mon Oct 20 11:00:46 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* gc.c (gc_sweep): loosen page free condition to avoid add_heap()
+	  race condition. [ruby-dev:21633]
+
+	* gc.c (gc_sweep): do not update malloc_limit when malloc_increase
+	  is smaller than malloc_limit.
+
+Mon Oct 20 09:45:12 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* lib/debug.rb (debug_command): remove debug print.
+
+Wed Oct 20 00:25:41 2004  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (search_required): required name must not be changed before
+	  loading.  [ruby-dev:24492]
+
+Sun Oct 19 13:12:30 2003  Tanaka Akira  <akr@m17n.org>
+
+	* lib/pathname.rb (foreachline, dir_foreach): add obsolete warning.
+
+Sun Oct 19 00:14:22 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* test/soap/calc/*, test/soap/helloworkd/*: changed port# of test
+	  server. (17171)
+
+Sat Oct 18 23:01:32 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* missing/acosh.c (DBL_MANT_DIG): typo fix(ifdef -> ifndef).
+
+Sat Oct 18 05:48:59 2003  why the lucky stiff  <why@ruby-lang.org>
+
+	* ext/syck/rubyext.c: YAML::Syck::compile method.
+
+	* ext/syck/syck.c: Buffer edge bug.
+
+	* ext/syck/yaml2byte.c: YAML to bytecode converter.
+
+	* ext/syck/yamlbyte.h: Ditto.
+
+	* ext/syck/bytecode.c: Bytecode parser fixes to empty collections
+	  and empty strings.
+
+	* ext/syck/token.c: Ditto.
+
+Fri Oct 17 23:07:38 2003  Akinori MUSHA  <knu@iDaemons.org>
+
+	* ext/enumerator/enumerator.c, ext/enumerator/enumerator.txt:
+	  Provide Kernel#to_enum as an alias for Kernel#enum_for.  Maybe
+	  this is a better name.
+
+Fri Oct 17 23:00:30 2003  Akinori MUSHA  <knu@iDaemons.org>
+
+	* lib/generator.rb: Add rdoc documentation.
+
+Fri Oct 17 22:16:42 2003  Akinori MUSHA  <knu@iDaemons.org>
+
+	* lib/set.rb: Reword and fix Overview.
+
+	* lib/set.rb: It is not necessary to require
+	  'test/unit/ui/console/testrunner'.
+
+Fri Oct 17 11:15:22 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* test/ruby/test_range.rb: added.
+
+	* MANIFEST: add test/ruby/test_range.rb.
+
+Fri Oct 17 03:21:23 2003  William Sobel  <will.sobel@barra.com>
+
+	* ext/socket/socket.c (make_hostent): h_aliases may be NULL.
+	  (ruby-bugs:PR#1195)
+
+	* ext/socket/socket.c (sock_s_gethostbyaddr): ditto.
+
+Fri Oct 17 00:12:41 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk.rb: (bug fix) instance variable @frame was used
+	  without initializing on TkComposite module.
+
+Thu Oct 16 23:51:04 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk.rb: If $DEBUG == true and some exception is caused
+	  in a callback operation, Ruby/Tk shows a (verbose) backtrace
+	  information on the callback process.
+
+Thu Oct 16 17:09:19 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* lib/debug.rb (DEBUGGER__::Context::debug_command): do not call
+	  debug_silent_eval() when $1 is not set. (ruby-bugs:PR#1194)
+
+Thu Oct 16 16:54:57 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* string.c (rb_str_upto): ("a"..."a").to_a should return [].
+	  [ruby-core:01634]
+
+Thu Oct 16 16:40:51 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk.rb:
+	  Add Tk::EncodedString and Tk::UTF8_String class to support
+	  characters using the \uXXXX escape to the UNICODE string.
+
+	* ext/tk/sample/{demos-en,demos-jp}/unicodeout.rb
+	  new demo-scripts (samples of Tk::UTF8_String)
+
+	* ext/tk/sample/{demos-en,demos-jp}/widget
+	  add entries for 'unicodeout.rb'
+
+Thu Oct 16 08:38:06 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* test/digest/test_digest.rb (test_eq): show failed class.
+
+	* test/ruby/test_iterator.rb (test_break, test_return_trace_func):
+	  test localjump destination.
+
+Wed Oct 15 20:22:31 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* lib/soap/netHttpClient.rb: use URI::HTTP#request_uri instead of
+	  instance_eval('path_query').  [ruby-list:38575]
+
+Wed Oct 15 17:24:45 2003  URABE Shyouhei  <root@mput.dip.jp>
+
+	* lib/cgi.rb (CGI::Cookie): tiny typo fix.
+
+Wed Oct 15 15:00:54 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (ruby_run): just return FAILURE instead of parse error
+	  count.  [ruby-list:38569]
+
+Wed Oct 15 13:17:02 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ext/digest/digest.c (rb_digest_base_alloc): need to initialize
+	  buffer. [ruby-dev:21622]
+
+Wed Oct 15 11:23:05 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* marshal.c (w_object): dump extended modules as well.
+
+	* marshal.c (r_object0): TYPE_USRMARSHAL should restore extended
+	  modules before invoking marshal_load.  these two fixes are done
+	  by Masatoshi Seki <m_seki@mva.biglobe.ne.jp>.
+
+Wed Oct 15 09:30:34 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* ext/enumerator/enumerator.c (enumerator_each): avoid VC++ warning.
+
+	* ext/syck/syck.h: include stdio.h for definition of FILE.
+
+Wed Oct 15 08:09:07 2003  why the lucky stiff  <why@ruby-lang.org>
+
+	* ext/syck/bytecode.c: Checkin of YAML bytecode support.
+
+	* ext/syck/gram.c: Ditto.
+
+	* ext/syck/syck.c: Ditto.
+
+	* ext/syck/token.c: Ditto.
+
+	* ext/syck/handler.c: Ditto.
+
+	* ext/syck/handler.c: Now using 'tag' rather than 'taguri' in type URIs.
+
+	* ext/syck/rubyext.c: Ditto (on both counts).
+
+Wed Oct 15 05:05:53 2003  Akinori MUSHA  <knu@iDaemons.org>
+
+	* lib/generator.rb: A new library which converts an internal
+	  iterator to an external iterator.
+
+	* lib/abbrev.rb: A new library which creates an abbreviation table
+	  from a list.
+
+Wed Oct 15 04:31:51 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/sample/demos-en/entry3.rb, ext/tk/sample/demos-jp/entry3.rb :
+	  new demo-scripts
+
+	* ext/tk/sample/demos-en/widget, ext/tk/sample/demos-jp/widget :
+	  add entries for 'entry3.rb'
+
+Wed Oct 15 04:31:47 2003  Akinori MUSHA  <knu@iDaemons.org>
+
+	* test/digest/test_digest.rb: Moved from ext/digest/test.rb.
+
+Wed Oct 15 03:53:20 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tk/lib/tk.rb: fixed trouble on auto-load Tcl commands (enbug
+	  on the last commit).
+
+Wed Oct 15 00:25:00 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* parse.y (yylex): argument parentheses preceded by spaces should
+	  be warned; not error.  [ruby-talk:84103]
+
+Wed Oct 15 00:20:15 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* ext/tcltklib/tcltklib.c: replace Tcl/Tk's vwait and tkwait to
+	  switch on threads smoothly and avoid seg-fault.
+
+	* ext/tcltklib/tcltklib.c: add TclTkIp._thread_vwait and
+	  _thread_tkwait for waiting on a thread. (Because Tcl/Tk's vwait
+	  and tkwait command wait on an eventloop.)
+
+	* ext/tk/lib/multi-tk.rb: support TclTkIp._thread_vwait and
+	  _thread_tkwait.
+
+	* ext/tk/lib/tk.rb: now, TkVariable#wait has 2 arguments.
+	  If 1st argument is true, waits on a thread. If false, waits on
+	  an eventloop. If 2nd argument is true, checks existence of
+	  rootwidgets. If false, doesn't. Default is wait(true, false).
+
+	* ext/tk/lib/tk.rb: add TkVariable#tkwait(arg) which is equal to
+	  TkVariable#wait(arg, true). wait_visibility and wait_destroy
+	  have an argument for waiting on a thread or an eventloop.
+
+	* ext/tk/lib/tk.rb: improve of accessing Tcl/Tk's special variables.
+
+	* ext/tk/lib/tkafter.rb: support 'wait on a thread' and 'wait on
+	  an eventloop'.
+
+Wed Oct 15 00:10:24 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* lib/soap/baseData.rb: Introduce SOAPType as the common ancestor of
+	  SOAPBasetype and SOAPCompoundtype.
+
+	* lib/soap/generator.rb, lib/soap/element.rb, lib/soap/encodingstyle/*:
+	  Encoding methods signature change.  Pass SOAPGenerator as a parameter.
+
+	* lib/soap/mapping/*, test/soap/marshal/test_marshal.rb: Refactoring
+	  for better marshalling/unmarshalling support.  Now I think SOAP
+	  marshaller supports all kind of object graph which is supported by
+	  Ruby's original marshaller.  Of course there could be bugs as always.
+	  Find it.  :-)
+
+	* lib/soap/rpc/standaloneServer.rb: Set severity threshould to INFO.
+	  DEBUG is too noisy.
+
+	* lib/xsd/datatypes.rb: DateTime#of is obsoleted.  Use DateTime#offset.
+
+	* test/wsdl/emptycomplextype.wsdl, test/xsd/xmlschema.xml: Avoid
+	  useless warning.
+
+Tue Oct 14 19:09:35 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (ruby_finalize_0): return the given exit status unless
+	  SystemExit got raised.
+
+Tue Oct 14 11:53:49 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* intern.h (ruby_stop): never return.
+
+	* ruby.h (ruby_run): ditto.
+
+Tue Oct 14 04:43:55 2003  Tanaka Akira  <akr@m17n.org>
+
+	* lib/pathname.rb (realpath): make ELOOP check bit more robust.
+	  (children): prepend self by default.
+	  (chroot): obsoleted.
+
+Tue Oct 14 02:29:31 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (rb_require_safe): segfault after loading .so.
+
+Tue Oct 14 02:05:23 2003  Akinori MUSHA  <knu@iDaemons.org>
+
+	* ext/Setup*, ext/enumerator/*: Add ext/enumerator, a helper
+	  module for the Enumerable interface.
+
+Mon Oct 13 23:55:59 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* test/ruby/envutil.rb: use Config::CONFIG["ruby_install_name"],
+	  not "ruby".
+
+Mon Oct 13 23:57:29 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (rb_feature_p): match by classified suffix.
+
+	* eval.c (rb_require_safe): require library in the specified safe
+	  level.
+
+	* variable.c (rb_autoload, rb_autoload_load): restore safe level
+	  when autoload was called.  [ruby-dev:21338]
+
+	* intern.h: prototypes; rb_require_safe.
+
+	* test/runner.rb: accept non-option arguments.
+
+Mon Oct 13 20:49:51 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* string.c (str_new4): should not preserve FL_TAINT status in the
+	  internal shared string. [ruby-dev:21601]
+
+	* string.c (rb_str_new4): ditto.
+
+	* eval.c: use EXIT_SUCCESS and EXIT_FAILURE for exit values.
+
+	* process.c: ditto. [ruby-list:38521]
+
+Mon Oct 13 19:51:02 2003  Koji Arai  <jca02266@nifty.ne.jp>
+
+	* lib/debug.rb (debug_command): should enter emacs mode when
+	  assigned any value to the environment variable "EMACS".
+	  On Meadow, (getenv "EMACS") is "meadow".
+
+Sun Oct 12 14:45:03 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* ext/win32ole/extconf.rb: check "windows.h", not "windows".
+	  [ruby-talk:84051]
+
+Sat Oct 11 20:41:03 2003  Corinna Vinschen  <corinna@vinschen.de>
+
+	* file.c (eaccess): Use access(2) on Cygwin.
+
+Sat Oct 11 17:09:21 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* lib/rexml/quickpath.rb (REXML::QuickPath::match):
+	  escape '[' to avoid warning.
+
+Sat Oct 11 16:08:41 2003  Tanaka Akira  <akr@m17n.org>
+
+	* lib/pathname.rb (realpath): check existence of the file.
+
+	* lib/pathname.rb (realpath): re-implemented.
+	  (realpath_root?, realpath_rec): removed
+
+Sat Oct 11 10:19:39 2003  Shugo Maeda  <shugo@ruby-lang.org>
+
+	* lib/monitor.rb: handle exceptions correctly. Thanks, Gennady
+	  Bystritsky.
+
+Fri Oct 10 07:50:54 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (is_defined): inheritance line adjustment as like as
+	  rb_call_super().
+
+Fri Oct 10 01:19:00 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/ossl_x509name.c (ossl_x509name_initialize): add
+	  optional argument to specify the DirectoryString type
+	  (ASN1::UTF8STRING by default). RFC3280 deprecates PrintableString
+	  for DirectoryString, and strongly requires to use UTF8String for
+	  all certificates issued after December, 31 2003.
+
+	* ext/openssl/lib/openssl/x509.rb (X509::Name::parse): ditto.
+
+Thu Oct  9 23:50:21 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (rb_thread_start_0): prevent thread from GC.
+	  [ruby-dev:21572]
+
+Thu Oct  9 19:11:44 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (rb_thread_start_0): non-volatile should be restored from
+	  volatile.
+
+Thu Oct  9 17:43:36 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (proc_save_safe_level, proc_get_safe_level,
+	  proc_set_safe_level): save/restore safe level 1..4.
+
+Thu Oct  9 16:33:23 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* marshal.c (r_object0): remove unnecessary iv restoration for
+	  USRMARSHAL. [ruby-dev:21582]
+
+	* marshal.c (w_object): dump generic instance variables from
+	  a string from '_dump'.
+
+	* variable.c (rb_generic_ivar_table): return 0 if obj's FL_EXIVAR
+	  is not set.
+
+	* time.c (time_dump): copy instance variables to dumped string, to
+	  be included in the marshaled data.
+
+	* bignum.c (rb_big2ulong): add range check to ensure round trip.
+
+Thu Oct  9 15:45:27 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* pack.c (uv_to_utf8): change message to "out of range", since
+	  negative values are not "too big". [ruby-dev:21567]
+
+Thu Oct  9 14:05:38 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (rb_set_end_proc, rb_exec_end_proc): restore safe level.
+	  [ruby-dev:21557]
+
+Thu Oct  9 10:51:04 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (rb_yield_0): no error if block is empty.
+
+Thu Oct  9 06:43:33 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (localjump_error): id should be ID.
+
+	* eval.c (rb_eval): nd_rval is set in copy_node_scope().
+
+	* eval.c (rb_yield_0): unused variable.
+
+	* eval.c (rb_yield_0): nothing to do for empty node.
+
+	* eval.c (call_end_proc, proc_invoke): adjust backtrace in END.
+	  [ruby-dev:21551]
+
+	* eval.c (rb_thread_start_0): set the value by break as the result.
+	  [ruby-dev:21552]
+
+	* eval.c (rb_thread_start_0, rb_thread_raise, rb_callcc): save
+	  variables across THREAD_SAVE_CONTEXT.
+
+Thu Oct  9 12:05:46 2003  Eric Sunshine  <sunshine@sunshineco.com>
+
+	* configure.in: revived NextStep, OpenStep, and Rhapsody ports which
+	  had become unbuildable; enhanced --enable-fat-binary option so that
+	  it accepts a list of desired architectures (rather than assuming a
+	  fixed list), or defaults to a platform-appropriate list if user does
+	  not provide an explicit list; made the default list of architectures
+	  for MAB (fat binary) more comprehensive; now uses -fno-common even
+	  when building the interpreter (in addition to using it for
+	  extensions), thus allowing the interpreter to be embedded into a
+	  plugin module of an external project (in addition to allowing
+	  embedding directly into an application); added checks for
+	  <netinet/in_systm.h> (needed by `socket' extension) and getcwd(); now
+	  ensures that -I/usr/local/include is employed when extensions'
+	  extconf.rb scripts invoke have_header() since extension checks on
+	  NextStep and OpenStep will fail without it if the desired resource
+	  resides in the /usr/local tree; fixed formatting of --help message.
+
+	* Makefile.in: $(LIBRUBY_A) rule now deletes the archive before
+	  invoking $(AR) since `ar' on Apple/NeXT can not "update" MAB archives
+	  (see configure's --enable-fat-binary option); added rule for new
+	  missing/getcwd.c.
+
+	* defines.h: fixed endian handling during MAB build (see configure's
+	  --enable-fat-binary option) to ensure that all portions of the
+	  project see the correct WORDS_BIGENDIAN value (some extension modules
+	  were getting the wrong endian setting); added missing constants
+	  GETPGRP_VOID, WNOHANG, WUNTRACED, X_OK, and type pid_t for NextStep
+	  and OpenStep; removed unnecessary and problematic HAVE_SYS_WAIT_H
+	  define in NeXT section.
+
+	* dir.c: do not allow NAMLEN() macro to trust dirent::d_namlen on
+	  NextStep since, on some installations, this value always resolves
+	  uselessly to zero.
+
+	* dln.c: added error reporting to NextStep extension loader since the
+	  previous behavior of failing silently was not useful; now ensures
+	  that NSLINKMODULE_OPTION_BINDNOW compatibility constant is defined
+	  for OpenStep and Rhapsody; no longer includes <mach-o/dyld.h> twice
+	  on Rhapsody since this header lacks multiple-include protection,
+	  which resulted in "redefinition" compilation errors.
+
+	* main.c: also create hard reference to objc_msgSend() on NeXT
+	  platforms (in addition to Apple platforms).
+
+	* lib/mkmf.rb: now exports XCFLAGS from configure script to extension
+	  makefiles so that extensions can be built MAB (see configure's
+	  --enable-fat-binary option); also utilize XCFLAGS in cc_command()
+	  (but not cpp_command() because MAB flags are incompatible with
+	  direct invocation of `cpp').
+
+	* ext/curses/extconf.rb: now additionally checks for presence of these
+	  curses functions which are not present on NextStep or Openstep:
+	  bkgd(), bkgdset(), color(), curs(), getbkgd(), init(), scrl(), set(),
+	  setscrreg(), wattroff(), wattron(), wattrset(), wbkgd(), wbkgdset(),
+	  wscrl(), wsetscrreg()
+
+	* ext/curses/curses.c: added appropriate #ifdef's for additional set of
+	  curses functions now checked by extconf.rb; fixed curses_bkgd() and
+	  window_bkgd() to correctly return boolean result rather than numeric
+	  result; fixed window_getbkgd() to correctly signal an error by
+	  returning nil rather than -1.
+
+	* ext/etc/etc.c: setup_passwd() and setup_group() now check for null
+	  pointers before invoking rb_tainted_str_new2() upon fields extracted
+	  from `struct passwd' and `struct group' since null pointers in some
+	  fields are common on NextStep/OpenStep (especially so for the
+	  `pw_comment' field) and rb_tainted_str_new2() throws an exception
+	  when it receives a null pointer.
+
+	* ext/pty/pty.c: include "util.h" for strdup()/ruby_strdup() for
+	  platforms such as NextStep and OpenStep which lack strdup().
+
+	* ext/socket/getaddrinfo.c: cast first argument of getservbyname(),
+	  gethostbyaddr(), and gethostbyname() from (const char*) to non-const
+	  (char*) for older platforms such as NextStep and OpenStep.
+
+	* ext/socket/socket.c: include "util.h" for strdup()/ruby_strdup() for
+	  platforms such as NextStep and OpenStep which lack strdup(); include
+	  <netinet/in_systm.h> if present for NextStep and OpenStep; cast first
+	  argument of gethostbyaddr() and getservbyname() from (const char*) to
+	  non-const (char*) for older platforms.
+
+	* ext/syslog/syslog.c: include "util.h" for strdup()/ruby_strdup() for
+	  platforms such as NextStep and OpenStep which lack strdup().
+
+Wed Oct  8 22:19:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
+
+	* lib/test/unit.rb: removed installation instructions.
+
+	* lib/test/unit/ui/testrunnermediator.rb: moved the run flag to a more
+	  central location.
+
+	* lib/test/unit.rb: ditto.
+
+	* lib/test/unit.rb: extracted the running code in to AutoRunner.
+
+	* lib/test/unit/autorunner.rb: added.
+
+	* lib/test/unit/collector/objectspace.rb: extracted common test
+	  collection functionality in to a module.
+
+	* lib/test/unit/collector.rb: ditto; added.
+
+	* test/testunit/collector/test_objectspace.rb: ditto.
+
+	* lib/test/unit/collector/dir.rb: added. Supports collecting tests out
+	  of a directory structure.
+
+	* test/testunit/collector/test_dir.rb: added.
+
+	* test/runner.rb: simplified to use the new capabilities.
+
+Tue Oct  7 15:23:09 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* test/ruby/test_beginendblock.rb: add tests for nested BEGIN/END.
+
+	* test/ruby/beginmainend.rb: add tests for nested BEGIN/END.
+
+	* test/ruby/endblockwarn.rb: new file added to test of END-in-method
+	  warning.
+
+Tue Oct  7 12:23:47 2003  Tanaka Akira  <akr@m17n.org>
+
+	* ext/fcntl/fcntl.c (Init_fcntl): define Fcntl::O_ACCMODE.
+
+	* ext/socket/extconf.rb: useless assignment removed.
+
+Tue Oct  7 09:13:24 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* test/ruby/test_beginendblock.rb (test_endinmethod): END{} is now
+	  allowed in eval.
+
+Tue Oct  7 04:15:25 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* parse.y (stmt): should not expand mrhs if lhs is solely starred.
+
+Tue Oct  7 02:57:53 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* parse.y (stmt): rhs of multiple assignment should not be
+	  expanded using "to_a". [ruby-dev:21527]
+
+Tue Oct  7 01:42:34 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/ossl_asn1.c (ossl_asn1_get_asn1type): use appropriate
+	  free function for ASN1_OBJECT.
+
+	* ext/openssl/ossl_asn1.c (ossl_asn1obj_get_sn): add new function for
+	  ASN1::ObjectId#sn; it returns short name text representation of OID.
+
+	* ext/openssl/ossl_asn1.c (ossl_asn1obj_get_ln): add new function for
+	  ASN1::ObjectId#ln; it returns long name text representation of OID.
+
+	* ext/openssl/ossl_asn1.c (ossl_asn1obj_get_oid): add new function for
+	  ASN1::ObjectId#oid; it returns numerical representation of OID.
+
+Mon Oct  6 22:59:46 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* lib/csv.rb (IOReader, BasicWriter): call binmode when a given IO
+	  respond_to?(:binmode).  record separator was wrong when you gave
+	  text mode IO to Reader.parse and Writer.generate.
+
+	* test/csv/test_csv.rb: add tests for above change.
+
+Sun Oct  5 23:27:09 2003  Tanaka Akira  <akr@m17n.org>
+
+	* ext/socket/extconf.rb: check recvmsg even if sendmsg is exists.
+
+	* ext/socket/socket.c (thread_read_select): restored.
+
+Mon Oct  6 16:23:38 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* marshal.c (w_object): wrong method name in the message.
+
+Mon Oct  6 16:02:05 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* parse.y (stmt): END in method should cause warning.
+	  [ruby-dev:21519]
+
+Mon Oct  6 15:17:23 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* test/ruby/test_iterator.rb (test_block_argument_without_paren):
+	  added. (follows sample/test.rb)
+
+Mon Oct  6 11:57:06 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* test/ruby/test_beginendblock.rb, test/ruby/beginmainend.rb: added
+	  test for eval-ed BEGIN END order.
+
+Mon Oct  6 09:19:54 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* marshal.c (w_object): should pass "weak" value to next level.
+	  [ruby-dev:21496]
+
+	* eval.c (proc_alloc): should not use cached object if klass is
+	  different. [ruby-talk:83685]
+
+Sun Oct  5 23:27:09 2003  Tanaka Akira  <akr@m17n.org>
+
+	* lib/pathname.rb: version information is added in document.
+
+Sun Oct  5 23:07:03 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (rb_f_END): block should be given.  [ruby-dev:21497]
+
+Sun Oct  5 22:51:23 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* lib/ext/openssl/extconf.rb: add check for some engine functions
+	  unavailable in OpenSSL-0.9.6.
+
+	* lib/ext/openssl/ossl_engine.c: ditto.
+
+Sun Oct  5 17:56:30 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (rb_eval): fix evaluation order.  [ruby-list:38431]
+
+Sun Oct  5 15:05:06 2003  akira yamada  <akira@ruby-lang.org>
+
+	* test/uri/*: translated RUNIT to Test::Unit.
+
+Sun Oct  5 14:37:39 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* lib/xsd/datatypes.rb: Rational -> Decimal string bug fix.
+
+	* test/soap/marshal/test_marshal.rb: ditto.
+
+	* test/soap/calc/test_calc_cgi.rb: add Config::CONFIG["EXEEXT"] to
+	  RUBYBIN.
+
+Sun Oct  5 13:47:22 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* test/ruby/test_beginendblock.rb, test/ruby/beginmainend.rb: add tests
+	  about scope, order and allowed syntax.
+
+Sun Oct  5 11:54:29 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* test/ruby/envutil.rb: added.  split "rubybin" from test_system.rb.
+
+	* test/ruby/test_system.rb: use envutil.rb
+
+	* test/ruby/test_beginendblock.rb: added.
+
+	* test/ruby/beginmainend.rb: added.  used in test_beginendblock.rb.
+
+Sun Oct  5 11:23:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
+
+	* test/testunit/runit/test_testresult.rb: removed some unnecessary
+	  cruft.
+
+Sun Oct  5 11:14:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
+
+	* lib/rubyunit.rb: aliasing TestCase into the top level is
+	  problematic.
+
+	* lib/runit/assert.rb: fixed a couple of bugs caused by recent
+	  refactoring in Test::Unit.
+
+	* test/testunit/runit/*: added.
+
+Sun Oct  5 10:55:29 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* lib/open-uri.rb (URI::Generic#find_proxy): no_proxy support did not
+	  work.  [ruby-dev:21484]
+
+Sun Oct  5 09:52:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
+
+	* lib/test/unit/assertions.rb: will use pp for output if available.
+	  Can be disabled by setting Assertions.use_pp = false.
+
+	* test/testunit/test_assertions.rb: made a small change to exception
+	  formatting.
+
+Sun Oct  5 07:42:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
+
+	* lib/test/unit/assertions.rb: made small improvements to assertion
+	  messages. Deprecated Assertions#assert_not_nil; use #assert instead.
+
+	* test/testunit/test_assertions.rb: ditto.
+
+	* test/testunit/util/test_procwrapper.rb: use #assert instead of
+	  #assert_not_nil.
+
+Sun Oct  5 04:10:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
+
+	* lib/test/unit/assertions.rb: refactored message building.
+
+Sun Oct  5 03:40:22 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/ossl_asn1.h: global symbols should be declared
+	  as external.
+
+Sun Oct  5 03:03:20 2003  akira yamada  <akira@ruby-lang.org>
+
+	* test/ruby/test_exception.rb (test_else): added.
+
+Sun Oct  5 02:12:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
+
+	* lib/test/unit/assertions.rb: changed assertion messages to rely more
+	  heavily on #inspect. Added backtrace filtering for exceptions in
+	  assertion messages.
+
+	* test/testunit/test_assertions.rb: ditto.
+
+Sun Oct  5 02:12:00 2003  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+
+	* lib/drb/acl.rb, lib/drb/ssl.rb: added.
+
+	* lib/drb/drb.rb: exit from a thread using 'break'.
+
+Sat Oct  4 21:49:14 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* gc.c (Init_stack): the type of space is changed to unsigned int
+	  from double.  [ruby-dev:21483]
+
+Sat Oct  4 17:52:59 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* lib/soap/netHttpClient.rb: follow http-access2.  hosts which matches
+	  ENV['no_proxy'] or ENV['NO_PROXY'] are not proxyed.
+	  - [,:] separated. ("ruby-lang.org:rubyist.net")
+	  - no regexp. (give "ruby-lang.org", not "*.ruby-lang.org")
+	  - if you want specify host by IP address, give full address.
+	    ("192.168.1.1, 192.168.1.2")
+
+	* lib/soap/rpc/cgistub.rb: return "Status: XXX MMM" line.
+
+	* test/runner.rb: give testsuite name.
+
+Sat Oct  4 15:16:02 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* marshal.c (w_object): instance variable dump do not cause error
+	  for objects that cannot be dumped, if they traversed from
+	  marshal_dump.  they are just ignored.
+
+	* gc.c (Init_stack): cast "space" (doble value) into unsigned
+	  int.  should run on PowerPC.
+
+	* eval.c (rb_eval): should not execute else part if any exception
+	  is caught. [ruby-dev:21482]
+
+	* parse.y (f_args): should allow unparenthesized block argument.
+
+	* parse.y (f_rest_arg): should allow unparenthesized rest
 	  argument.
 
-	* vm_insnhelper.c (ci_missing_reason): copy FCALL flag.
+Sat Oct  4 14:59:51 2003  Tanaka Akira  <akr@m17n.org>
 
-Sun Feb 28 10:19:47 2016  Ryan T. Hosford  <tad.hosford@gmail.com>
+	* lib/pathname.rb (initialize): raise ArgumentError if argument has
+	  '\0' character.
+	  (relative_path_from): new method.
+	  (each_entry): new method for replacement of dir_foreach.
+	  (foreach, foreachline, dir_foreach, chdir): obsoleted.
 
-	* array.c (rb_ary_and): clarify that set intersection returns the
-	  unique elements common to both arrays.
+Sat Oct  4 12:58:48 2003  akira yamada  <akira@ruby-lang.org>
 
-	* array.c (rb_ary_or): clarify that union preserves the order from
-	  the given arrays.
+	* test/uri/* (6 files): added.
 
-Sat Feb 27 17:05:29 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Sat Oct  4 12:44:45 2003  akira yamada  <akira@ruby-lang.org>
 
-	* enc/unicode/case-folding.rb, casefold.h: Reducing size of TitleCase
-	  table by eliminating duplicates.
-	  (with Kimihito Matsui)
+	* lib/uri/ftp.rb, lib/uri/mailto.rb: renamed to #to_s from #to_str.
 
-Fri Feb 26 14:40:48 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Oct  4 07:33:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
 
-	* numeric.c (num_step_scan_args): comparison String with Numeric
-	  should raise TypeError. it is an invalid type, but not a
-	  mismatch the number of arguments.  [ruby-core:62430] [Bug #9810]
+	* lib/test/unit/testsuite.rb: changed #<< to return self, and added
+	  #delete.
 
-Fri Feb 26 14:39:39 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/testunit/test_testsuite.rb: ditto. Also slightly refactored
+	  #test_size.
 
-	* doc/extension.rdoc, doc/extension.ja.rdoc: add editor local
-	  variables, with commenting out by :enddoc: directives which are
-	  just ignored unless code object mode.  [Bug #12111]
+	* lib/test/unit/collector/objectspace.rb: collector now preserves the
+	  hierarchy of suites.
 
-Fri Feb 26 12:25:56 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* test/testunit/collector/test_objectspace.rb: ditto.
 
-	* doc/extension.ja.rdoc: removed rendering error caused by editor specific
-	  configuration on http://docs.ruby-lang.org/en/trunk/extension_rdoc.html .
-	  [Bug #12111][ruby-core:73990]
+Sat Oct  4 04:48:49 2003  why the lucky stiff  <why@ruby-lang.org>
 
-Fri Feb 26 11:21:41 2016  herwinw  <herwin@quarantainenet.nl>
+	* ext/syck/rubyext.c: default keys handled.
 
-	* lib/xmlrpc.rb: Removed references to NQXML. It's obsoleted parser.
-	  [fix GH-1245][ruby-core:59593][Feature #9371]
-	* lib/xmlrpc/config.rb: ditto.
-	* lib/xmlrpc/parser.rb: ditto.
+	* ext/syck/syck.h: lowered default buffer size to 16k for increased
+	  performance.
 
-Fri Feb 26 11:10:19 2016  Rick Salevsky  <rsalevsky@suse.com>
+	* test/yaml: checkin of basic unit tests.
 
-	* lib/tmpdir.rb: Unify to coding-style for method definition.
-	  [fix GH-1252]
+Sat Oct  4 04:24:19 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
 
-Fri Feb 26 11:02:04 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* ext/openssl/extconf.rb: add check for X509V3_set_nconf.
 
-	* README.md: update markdown syntax for anchor tag.
-	  [fix GH-1265] Patch by @lukBarros
+	* ext/openssl/ossl_x509ext.c (ossl_x509extfactory_set_config):
+	  cannot implement if X509V3_set_nconf doesn't exist.
 
-Fri Feb 26 10:52:29 2016  Alex Boyd  <alex@opengroove.org>
+Sat Oct  4 02:12:44 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-	* lib/irb.rb: avoid to needless truncation when using back_trace_limit option.
-	  [fix GH-1205][ruby-core:72773][Bug #11969]
+	* lib/xsd/datatypes.rb: dump sign by itself.  under the problematic
+	  platform, sprintf("%+.10g", -0.0) => +0.  sigh.
 
-Fri Feb 26 08:11:58 2016  Aaron Patterson <tenderlove@ruby-lang.org>
+	* sample/wsdl/amazon/*: update schema ver2 to ver3.
 
-	* gem_prelude.rb: Reduce system calls by activating the `did_you_mean`
-	  gem before requiring the gem.  Activating the gem puts the gem on
-	  the load path, where simply requiring the file will search every gem
-	  that's installed until it can find a gem that contains the
-	  `did_you_mean` file.
+Sat Oct  4 01:33:46 2003  Tanaka Akira  <akr@m17n.org>
 
-Thu Feb 25 19:04:13 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* lib/pathname.rb (initialize): duplicate and freeze argument.
+	  (to_s): return duplicated string.
+	  (children): new method.
+	  (each_line): new alias to foreachline.
 
-	* enc/unicode/case-folding.rb: Adding possibility for debugging output
-	  for TitleCase table in casefold.h.
-	  (with Kimihito Matsui)
+Fri Oct  3 16:13:19 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
 
-Wed Feb 24 22:31:13 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* ext/openssl/ossl_asn1.c: add DER encoder and decoder.
 
-	* include/ruby/oniguruma.h: Rearranging flag assignments and making
-	  space for titlecase indices; adding additional macros to add or
-	  extract titlecase index; adding comments for better documentation.
-	* enc/unicode.c: Moving some macros to include/ruby/oniguruma.h;
-	  activating use of titlecase indices.
-	  (with Kimihito Matsui)
+	* ext/openssl/ossl_asn1.h: add OpenSSL::ASN1 module.
 
-Wed Feb 24 21:03:04 2016  Tanaka Akira  <akr@fsij.org>
+	* ext/openssl/ossl.c (Init_openssl): call Init_ossl_asn1.
 
-	* random.c (limited_rand): Add a specialized path for when the limit fits
-	  in 32 bit.
+	* ext/openssl/extconf.rb: check if X509_ATTRIBUTE has field "single".
 
-Tue Feb 23 21:52:24 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* ext/openssl/ossl_x509attr.c (ossl_x509attr_set_value): accept
+	  DER encoded data argument.
 
-	* enc/unicode/case-folding.rb, casefold.h: Outputting actual titlecase
-	  data (new table, with indices from other tables).
-	* enc/unicode.c: Ignoring titlecase data indices for the moment.
-	  (with Kimihito Matsui)
+	* ext/openssl/ossl_x509attr.c (ossl_x509attr_get_value): return
+	  DER encoded data in OpenSSL::ASN1 types.
 
-Tue Feb 23 15:21:14 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Fri Oct  3 13:02:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
 
-	* enc/unicode/case-folding.rb, casefold.h: Reading casing data from
-	  SpecialCasing.txt.
-	  (with Kimihito Matsui)
+	* lib/test/unit.rb: refactored to use optparse.
 
-Mon Feb 22 18:33:55 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* lib/test/unit.rb: added support for selecting the output
+	  level from the command-line.
 
-	* enc/unicode/case-folding.rb, casefold.h: Adding flag for title-case,
-	  not yet operational.
-	  (with Kimihito Matsui)
+	* lib/test/unit.rb: added a command-line switch to stop processing
+	  the command-line, allowing arguments to be passed to tests.
 
-Mon Feb 22 18:17:03 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* lib/test/unit.rb: changed the method for specifying a runner or a
+	  filter from the command-line.
 
-	* enc/unicode/case-folding.rb, casefold.h: Fixed bug that avoided inclusion
-	  of compatibility characters in upper-/lower-case mappings.
-	  (with Kimihito Matsui)
+	* lib/test/unit/collector/objectspace.rb: fixed a bug causing all
+	  tests to be excluded when the filter was set to an empty array.
 
-Sun Feb 21 13:57:18 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/testunit/collector/test_objectspace.rb: ditto.
 
-	* cgi/escape/escape.c: Optimize CGI.unescape performance by C ext
-	  for ASCII-compatible encodings.  [Fix GH-1250]
+Fri Oct  3 08:14:32 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Sun Feb 21 13:56:57 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/irb/ruby-lex.rb (RubyLex::identify_identifier): support
+	  'class ::Foo' syntax. [ruby-talk:83514]
 
-	* cgi/escape/escape.c: Optimize CGI.unescapeHTML performance by C
-	  ext for ASCII-compatible encodings.  [Fix GH-1242]
+Fri Oct  3 08:01:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
 
-Sat Feb 20 15:38:16 2016  Eric Wong  <e@80x24.org>
+	* lib/test/unit/assertions.rb: added a default message for #assert,
+	  #assert_block, and #flunk.
 
-	* doc/extension.rdoc: update paths for defs/ directory
+	* test/testunit/test_assertions.rb: ditto.
 
-Sat Feb 20 14:44:15 2016  Lucas Buchala  <lucasbuchala@gmail.com>
+	* lib/test/unit/failure.rb: failures now show a better trace of where
+	  they occurred.
 
-	* vm_eval.c (rb_mod_module_eval): [DOC] Fix documentation
-	  signature for Module#module_eval.  [Fix GH-1258]
+	* test/testunit/test_failure.rb: ditto (added).
 
-Sat Feb 20 14:40:44 2016  Adam O'Connor  <northband@gmail.com>
+	* lib/test/unit/testcase.rb: ditto.
 
-	* README.md: a few grammatical changes to the main Ruby README.md.
-	  [Fix GH-1259]
+	* test/testunit/test_testcase.rb: ditto.
 
-Sat Feb 20 13:04:22 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/test/unit/util/backtracefilter.rb: added.
 
-	* dir.c (push_pattern, push_glob): deal with read paths as UTF-8
-	  to stat later, on Windows as well as OS X.
-	  [ruby-core:73868] [Bug #12081]
+	* test/testunit/util/test_backtracefilter.rb: added.
 
-Sat Feb 20 01:53:33 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/test/unit/error.rb: changed to use BacktraceFilter and improved
+	  output.
 
-	* object.c (rb_mod_const_get): make error message at uninterned
-	  string consistent with symbols.  [ruby-dev:49498] [Bug #12089]
+	* test/testunit/test_error.rb: ditto.
 
-Fri Feb 19 23:37:52 2016  Masahiro Tomita  <tommy@tmtm.org>
+Thu Oct  2 20:33:49 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/find.rb (Find#find): raise with the given path name if it
-	  does not exist.  [ruby-dev:49497] [Bug #12087]
+	* ext/iconv/iconv.c (iconv_failure_initialize): conform with
+	  orthodox initialization method.
 
-Fri Feb 19 12:44:57 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* ext/iconv/iconv.c (iconv_fail): initialize exception instance
+	  from the class, and do not share instance variables with the
+	  others.  [ruby-dev:21470]
 
-	* enc/unicode.c: Activated use of case mapping data in CaseUnfold_11 array.
-	  (with Kimihito Matsui)
+Thu Oct  2 18:20:27 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Feb 19 11:08:32 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* time.c (Init_Time): define initialize.  [ruby-dev:21469]
 
-	* ext/extmk.rb: add cygwin case, nothing excluded.
-	  [ruby-core:73806] [Bug#12071]
+Thu Oct  2 17:39:38 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
 
-Thu Feb 18 21:32:15 2016  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+	* ext/openssl/ossl_engine.c: add a new module OpenSSL::Engine.
+	  it supports OpenSSL hardware cryptographic engine interface.
 
-	* man/irb.1: fix output in EXAMPLES.
+	* ext/openssl/ossl_engine.h: ditto.
 
-Thu Feb 18 21:05:47 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/openssl/MANIFEST: add ossl_engine.c and ossl_engine.h.
 
-	* string.c (sym_match_m): delegate to String#match but not
-	  String#=~.  [ruby-core:72864] [Bug #11991]
+	* ext/openssl/extconf.rb: add check for openssl/engine.h.
 
-Thu Feb 18 14:15:38 2016  Shota Fukumori  <her@sorah.jp>
+	* ext/openssl/ossl.c: call Init_ossl_engine().
 
-	* re.c: Add MatchData#named_captures
-	  [Feature #11999] [ruby-core:72897]
+	* ext/openssl/ossl.h: include openssl/engine.h.
 
-	* test/ruby/test_regexp.rb(test_match_data_named_captures): Test for above.
+	* ext/openssl/ossl_pkey_{rsa,dsa,dh}.c: check if underlying
+	  EVP_PKEY referes engine.
 
-	* NEWS: News about MatchData#named_captures.
+Thu Oct  2 17:22:37 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Wed Feb 17 21:41:29 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* time.c (time_load): restore instance variables (if any) before
+	  loading from marshaled data.
 
-	* defs/id.def (predefined): add idLASTLINE and idBACKREF for $_
-	  and $~ respectively.
+Thu Oct  2 14:19:15 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* parse.y: use idLASTLINE and idBACKREF instead of rb_intern.
+	* ext/iconv/iconv.c (iconv_fail): now yield erred substring, and
+	  set error object to $!.
 
-Wed Feb 17 20:23:38 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/iconv/iconv.c (iconv_convert): error handler block should
+	  return appended part and the rest.  if rest is nil, the
+	  conversion stops.
 
-	* string.c (rb_str_init): fix segfault and memory leak, consider
-	  wide char encoding terminator.
+Thu Oct  2 12:00:18 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Feb 17 12:14:59 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* variable.c (rb_const_defined_0): look up constants in Object as
+	  well.  [ruby-dev:21458]
 
-	* string.c (rb_str_init): introduce String.new(capacity: size)
-	  [Feature #12024]
+	* test/ruby/test_defined.rb (TestDefined::test_defined): test for
+	  constants.
 
-Tue Feb 16 19:10:08 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Thu Oct  2 11:17:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
 
-	* enc/unicode/case-folding.rb, casefold.h: Used only first element
-	  (rather than all) of target in CaseUnfold_11 array.
-	  (with Kimihito Matsui)
+	* lib/test/unit/assertions.rb: should not capture an
+	  AssertionFailedError unless explicitly requested.
 
-Tue Feb 16 18:24:38 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/testunit/test_assertions.rb: ditto.
 
-	* numeric.c (compare_with_zero): fix variable name, rb_cmperr
-	  requires VALUEs but not an ID.
+	* test/testunit/collector/test_objectspace.rb: fixed a test failure
+	  caused by methods being returned in different orders on different
+	  platforms by moving test sorting from TestSuite into the locations
+	  where suites are constructed. [ruby-talk:83156]
 
-Tue Feb 16 17:34:18 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/test/unit/testcase.rb: ditto.
 
-	* dir.c (rb_dir_s_empty_p): add Dir.empty? method, which tells the
-	  argument is the name of an empty directory.  [Feature #10121]
+	* lib/test/unit/testsuite.rb: ditto.
 
-Tue Feb 16 09:51:20 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/test/unit/collector/objectspace.rb: ditto.
 
-	* tool/rbinstall.rb (without_destdir): just strip a drive letter
-	  which is prepended by with_destdir.
-	  pointed out by @DavidEGrayson.
-	  https://github.com/ruby/ruby/commit/0e5f9ae#commitcomment-16101763
+Thu Oct  2 03:25:01 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Tue Feb 16 04:42:13 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* eval.c (rb_thread_raise): prototype; avoid VC++ warning.
 
-	* insns.def (opt_plus): simply use LONG2NUM() instead of wrongly
-	  complex overflow case.
+Thu Oct  2 01:37:34 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* insns.def (opt_sub): ditto.
+	* time.c (time_mdump): new marshal dumper. _dump is still
+	  available for compatibility.
 
-Tue Feb 16 02:49:41 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* time.c (time_mload): new marshal loader.
 
-	* tool/rbinstall.rb (without_destdir): compare with the destdir
-	  after stripping a drive letter, on dosish platforms.
-	  pointed out by @DavidEGrayson.
-	  https://github.com/ruby/ruby/commit/d0cf23b#commitcomment-16100407
+	* marshal.c (w_object): preserve instance variables for objects
+	  with marshal_dump.
 
-Mon Feb 15 15:44:09 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* marshal.c (r_object0): restore instance variables before calling
+	  marshal_load.
 
-	* parse.y (parse_ident): allow keyword arguments just after a
-	  method where the same name local variable is defined.
-	  [ruby-core:73816] [Bug#12073]
+	* error.c (rb_warn_m): always return nil.
 
-Mon Feb 15 14:43:28 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Thu Oct  2 01:32:46 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* enc/unicode/case-folding.rb: Added debugging option
-	  (with Kimihito Matsui)
+	* eval.c (rb_f_block_given_p): real required condition is
+	  ruby_frame->prev->iter == ITER_CUR.
 
-Sun Feb 14 17:31:50 2016  Lars Kanis  <lars@greiz-reinsdorf.de>
+	* eval.c (rb_block_given_p): ditto.
 
-	* lib/mkmf.rb (with_{cpp,c,ld}flags): copy caller strings not to
-	  be modified, in append_{cpp,c,ld}flags respectively.
-	  [Fix GH-1246]
+	* eval.c (block_pass): update ruby_frame->iter only when previous
+	  value is ITER_NOT.
 
-Sun Feb 14 16:18:57 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Oct  2 01:02:35 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* eval.c (setup_exception): set the cause only if it is explicitly
-	  given or not set yet.  [Bug #12068]
+	* variable.c (rb_const_defined_at): should exclude constants from
+	  Object when TYPE(klass) == T_MODULE *and* exclude is on.
+	  [ruby-dev:21458]
 
-Sat Feb 13 21:44:58 2016  Tanaka Akira  <akr@fsij.org>
+	* variable.c (rb_const_get_0): do not lookup constants from Object
+	  when TYPE(klass) == T_MODULE *and* exclude is on.
 
-	* hash.c (rb_hash_invert): [DOC] more examples.
+Thu Oct  2 00:21:11 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-Sat Feb 13 17:30:49 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/logger/test_logger.rb: unlinking file before close causes
+	  problem under win32 box.
 
-	* lib/uri/generic.rb (URI::Generic#find_proxy): support CIDR in
-	  no_proxy.  [ruby-core:73769] [Feature#12062]
+	* lib/xsd/datatypes.rb(XSDFloat, XSDDouble): add +/- sign explicitly
+	  when stringified and embedded into XML instance.  Ruby's sprintf may
+	  format -0.0 as "0.0" (no minus sign) depending on underlying C
+	  sprintf implementation.
 
-Sat Feb 13 17:11:58 2016  Fabian Wiesel  <fabian.wiesel@sap.com>
+	* test/xsd/test_xsd.rb, test/soap/test_basetype.rb: follow above change.
 
-	* lib/uri/generic.rb (find_proxy): exclude white-spaces and allow
-	  for a leading dot in the domain name in no_proxy.
-	  [ruby-core:54542] [Feature #8317]
+	* test/soap/calc/*: give httpd config param "CGIInterpreter".
+	  "/usr/bin/env ruby" thing does not work under non-Unix boxes.
 
-Fri Feb 12 12:20:56 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Oct  2 00:42:20 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* error.c (name_err_initialize, nometh_err_initialize): [DOC] fix
-	  argument positions.  optional parameters except for the message
-	  are placed at the last.
+	* marshal.c (r_byte): retrieve pointer from string value for each
+	  time.  [ruby-dev:24404]
 
-Fri Feb 12 11:49:49 2016  Anthony Dmitriyev  <antstorm@gmail.com>
+	* marshal.c (r_bytes0): ditto.
 
-	* net/ftp.rb: add NullSocket#closed? to fix closing not opened
-	  connection.  [Fix GH-1232]
+	* enum.c (sort_by_i): re-entrance check added.  [ruby-dev:24399]
 
-Fri Feb 12 11:17:38 2016  Bogdan  <bogdanvlviv@gmail.com>
+	* io.c (io_read): should freeze all reading buffer.
+	  [ruby-dev:24400]
 
-	* re.c (rb_reg_initialize_m): [DOC] fix missing right bracket.
-	  [Fix GH-1243]
+	* string.c (rb_str_sum): should use bignums when bits is greater
+	  than or equals to sizeof(long)*CHAR_BITS. [ruby-dev:24395]
 
-Thu Feb 11 14:57:58 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* eval.c (specific_eval): defer pointer retrieval to prevent
+	  unsafe sourcefile string modification.  [ruby-dev:24382]
 
-	* configure.in (RUBY_CHECK_SIZEOF, RUBY_DEFINT): fix for types
-	  which are conditionally available depending on architectures
-	  when universal binary, e.g., __int128.
+	* string.c (rb_str_sum): wrong cast caused wrong result.
+	  [ruby-dev:24385]
 
-Thu Feb 11 06:26:18 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* enum.c (enum_sort_by): hide temporary array from
+	  ObjectSpace.each_object.  [ruby-dev:24386]
 
-	* configure.in (RUBY_DEFINT): use Parameter Expansion.
+	* string.c (rb_str_sum): check was done with false pointer.
+	  [ruby-dev:24383]
 
-Thu Feb 11 05:33:24 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* string.c (rb_str_sum): string may be altered.  [ruby-dev:24381]
 
-	* configure.in (int128_t): don't check HAVE_XXX (for example
-	  HAVE___INT128) because RUBY_CHECK_SIZEOF() don't define it for
-	  config.h and use of $ac_cv_sizeof___int128 alternates the check.
-	  (and don't need to define because users shouldn't know that)
+Thu Oct  2 00:25:21 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Feb 10 12:03:41 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* signal.c (ruby_signal_name): adjust to the prototype.
 
-	* configure.in (ARFLAGS): check if deterministic mode flag is
-	  effective, which is on by default on Ubuntu.
+	* process.c (pst_inspect): ditto.
 
-Tue Feb  9 16:36:23 2016  Naotoshi Seo  <sonots@gmail.com>
+	* ext/etc/etc.c (etc_getgrent, Init_etc): typo.
 
-	* lib/logger.rb: Remove block from Logger.add as it's not needed
-	  patch provided by Daniel Lobato Garcia [fix GH-1240] [Bug #12054]
+Wed Oct  1 20:49:41 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Tue Feb  9 14:32:23 2016  Zachary Scott  <zzak@ruby-lang.org>
+	* gc.c (heaps): manage slots and limits together.  [ruby-dev:21453]
 
-	* ext/zlib/zlib.c: Document mtime header behavior with patch by @schneems
-	  Fixes [GH-1129]: https://github.com/ruby/ruby/pull/1129
+	* gc.c (add_heap): should not clear heaps slot even if realloc()
+	  failed.
 
-Tue Feb  9 13:52:49 2016  Zachary Scott  <zzak@ruby-lang.org>
+Wed Oct  1 20:36:49 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
 
-	* re.c: Remove deprecated kcode argument from Regexp.new and compile
-	  patch provided by Dylan Pulliam [Bug #11495]
+	* MANIFEST: add wince/mkconfig_wce.rb.
 
-Mon Feb  8 21:26:19 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Wed Oct  1 17:22:33 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* enc/unicode/case-folding.rb, enc/unicode/casefold.h: Flags for
-	  upper/lower conversion added (titlecase and SpecialCasing still missing)
-	  (with Kimihito Matsui)
+	* ext/etc/etc.c: add new functions: setpwent, getpwent, endpwent,
+	  setgrent, getgrent, endgrent.
 
-Mon Feb  8 20:43:57 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* ext/socket/socket.c (sock_s_gethostbyname): do not reverse lookup.
 
-	* string.c, enc/unicode.c: Disassociating ONIGENC_CASE_FOLD flag from
-	  ONIGENC_CASE_DOWNCASE.
-	  (with Kimihito Matsui)
+Wed Oct  1 17:01:30 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Feb  8 13:00:17 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* eval.c (rb_load): Object scope had priority over required file
+	  scope.  [ruby-dev:21415]
 
-	* enc/unicode.c: Shortened macros for enc/unicode/casefold.h to
-	  single-letter; use flags in casefold.h for logic.
+Wed Oct  1 14:09:53 2003  Takaaki Uematsu  <uema2x@jcom.home.ne.jp>
 
-	* enc/unicode/case-folding.rb: Added flag for case folding.
-	  Changed parameter passing.
+	* wince/mkconfig_wce.rb: sorry, forget to commit.
 
-	* enc/unicode/casefold.h: New flags added.
-	  (with Kimihito Matsui)
+Wed Oct  1 10:08:42 2003  Takaaki Uematsu  <uema2x@jcom.home.ne.jp>
 
-Mon Feb  8 10:30:10 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* wince/setup.mak: add sigmarionIII SDK support.
 
-	* ruby.c (feature_option): raise a runtime error if ambiguous
-	  feature name is given, in the future.  [Bug #12050]
+	* wince/Makefile.sub: ditto.
 
-Mon Feb  8 09:43:57 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* wince/mkexports.rb: fix linker error in SH4.
 
-	* common.mk: Removed enc/unicode/casefold.h from automatic build because
-	  some CI systems don't have gperf. Creation of enc/unicode/casefold.h
-	  is now possible with make unicode-up. This is intended as a temporary measure.
+	* wince/mkconfig_wce.rb: camouflage RUBY_PLATFORM for compiling ext.
 
-Sun Feb  7 22:10:08 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Wed Oct  1 08:02:52 2003  Takaaki Uematsu  <uema2x@jcom.home.ne.jp>
 
-	* common.mk: Added two more precondition files for enc/unicode/casefold.h
+	* wince/time_wce.c (time): add zero check.
 
-	* enc/unicode.c: Added shortening macros for enc/unicode/casefold.h
+Tue Sep 30 16:11:05 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* enc/unicode/case-folding.rb: Fixed file encoding for CaseFolding.txt
-	  to ASCII-8BIT (should fix some ci errors). Clarified usage. Created
-	  class MapItem. Partially implemented class CaseMapping.
-	  (with Kimihito Matsui)
+	* Makefile.in: copy lex.c from $(srcdir) if it's not the current
+	  directory.  [ruby-dev:21437]
 
-Sun Feb  7 14:12:32 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Tue Sep 30 11:29:23 2003  Tanaka Akira  <akr@m17n.org>
 
-	* enc/unicode/case-folding.rb: Fixing parameter passing.
-	  (with Kimihito Matsui)
+	* process.c (pst_inspect): describe stopped process "stopped".
 
-Sun Feb  7 11:44:03 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Tue Sep 30 09:31:56 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* enc/unicode/case-folding.rb: New classes CaseMapping/CaseMappingDummy
-	  to pass as parameters; not yet implemented or used.
-	  (with Kimihito Matsui)
+	* test/runner.rb: glob for directories.
 
-Sun Feb  7 11:16:00 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Tue Sep 30 09:11:43 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* common.mk: using new option in recipe for enc/unicode/casefold.h
+	* eval.c (rb_eval): while/until should not capture break unless
+	  they are destination of the break.
 
-	* enc/unicode/case-folding.rb: Correctly specify argument to new option.
-	  (with Kimihito Matsui)
+Tue Sep 30 03:12:02 2003  Minero Aoki  <aamine@loveruby.net>
 
-Sun Feb  7 10:43:27 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* lib/net/http.rb (finish): revert to 1.93.
 
-	(this commit message applies to the previous commit)
-	* common.mk: explicit recipe for enc/unicode/casefold.h
+	* lib/net/pop.rb (finish): revert to 1.60.
 
-	* enc/unicode/case-folding.rb: Adding -m option to prepare for using
-	  multiple data files.
-	  (with Kimihito Matsui)
+	* lib/net/smtp.rb (finish): revert to 1.67.
 
-Sat Feb  6 22:30:57 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/net/http.rb (do_start): ensure to close socket if failed to
+	  start session.
 
-	* lib/cgi/util.rb (escapeHTML, unescapeHTML): consider
-	  ASCII-incompatible encodings.  [Fix GH-1239]
+	* lib/net/pop.rb (do_start): ditto.
 
-Sat Feb  6 15:18:28 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* lib/net/smtp.rb (do_start): ditto.
 
-	* test/ruby/enc/test_regex_casefold.rb: Added data-based testing for
-	  String#downcase :fold.
+	* lib/net/smtp.rb: SMTP#started? wrongly returned false always.
 
-	* enc/unicode.c: Fixed a range error (lowest non-ASCII character affected
-	  by case operations is U+00B5, MICRO SIGN)
+Tue Sep 30 02:54:49 2003  Minero Aoki  <aamine@loveruby.net>
 
-	* test/ruby/enc/test_case_mapping.rb: Explicit test for case folding of
-	  MICRO SIGN to Greek mu.
-	  (with Kimihito Matsui)
+	* test/ruby/test_iterator.rb: new test
+	  test_break__nested_loop[123].
 
-Sat Feb  6 14:51:23 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Mon Sep 29 23:39:13 2003  Minero Aoki  <aamine@loveruby.net>
 
-	* test/ruby/enc/test_regex_casefold.rb: Tests for three case folding
-	  primitives (mbc_case_fold, get_case_fold_codes_by_str,
-	  apply_all_case_fold) in the various encodings. Currently only known
-	  good encodings are tested to avoid test failures. For bug hunting,
-	  start by adding more encodings with
-	  generate_test_casefold encoding
-	  (with Kimihito Matsui)
+	* lib/net/http.rb (finish): does not raise IOError even if
+	  !started?, to allow closing socket which was opened before
+	  session started.
 
-Sat Feb  6 14:37:16 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* lib/net/pop.rb (finish): ditto.
 
-	* enc/unicode.c, test/ruby/enc/test_case_mapping.rb: Implemented :fold
-	  option for String#downcase by using case folding data from
-	  regular expression engine, and added a few simple tests.
-	  (with Kimihito Matsui)
+	* lib/net/smtp.rb (finish): ditto.
 
-Fri Feb  5 20:08:59 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Mon Sep 29 19:06:51 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
 
-	* test/ruby/enc/test_case_mapping.rb: added tests for :ascii option.
-	  (with Kimihito Matsui)
+	* ext/win32ole/extconf.rb: add windows.h checking.
+	  (ruby-bugs:PR#1185)
 
-Fri Feb  5 12:22:20 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+Mon Sep 29 16:18:30 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-	* insns.def (opt_mult): Use int128_t for overflow detection.
+	* lib/logger.rb: check if the given logdevice object respond_to :write
+	  and :close, not is_a? IO.  duck duck.
 
-	* bignum.c (rb_uint128t2big): added for opt_mult.
+	* test/logger/test_logger.rb: self IO.pipe reading/writing may be
+	  locked by the flood.  use tempfile.
 
-	* bignum.c (rb_uint128t2big): added for rb_uint128t2big..
+	* lib/wsdl/xmlSchema/data.rb: wrong constant reference.
 
-	* configure.in: define int128_t, uint128_t and related MACROs.
-	  Initially introduced by r41379 but reverted by r50749.
+Mon Sep 29 16:11:23 2003  Minero Aoki  <aamine@loveruby.net>
 
-Thu Feb  4 21:05:17 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* test/fileutils/test_fileutils.rb: clean up temporary symlink.
+	  Patched by NaHi.  [ruby-dev:21420]
 
-	* enc/unicode.c: Activated :ascii flag for ASCII-only case conversion
-	  (with Kimihito Matsui)
+Mon Sep 29 11:16:55 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Thu Feb  4 17:38:01 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* eval.c (rb_thread_atfork): wrong format specifier.
+	  [ruby-dev:21428]
 
-	* re.c (reg_set_source): make source string frozen without
-	  copying.
+	* process.c (pst_inspect): better description.
 
-	* re.c (rb_reg_initialize_m): refactor initialization with
-	  encoding.
+Mon Sep 29 02:31:44 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
 
-Thu Feb  4 15:35:29 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/webrick/utils.rb (Utils::su): use setgid and setuid to
+	  set real and effective IDs. and setup group access list by
+	  initgroups.
 
-	* string.c (rb_fstring_enc_new, rb_fstring_enc_cstr): functions to
-	  make fstring with encoding.
+Sun Sep 28 11:14:19 2003  Koji Arai  <jca02266@nifty.ne.jp>
 
-Thu Feb  4 14:42:29 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* ext/digest/digest.c (Init_digest): `copy_object' was deprecated.
+	  `initialize_copy' should be defined.
 
-	* common.mk: Added Unicode data file SpecialCasing.txt to be additionally
-	  downloaded (with Kimihito Matsui)
+	* ext/stringio/stringio.c (Init_stringio): ditto.
 
-Thu Feb  4 12:39:08 2016  joker1007  <kakyoin.hierophant@gmail.com>
+Sat Sep 27 18:25:13 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-	* cgi/escape/escape.c: Optimize CGI.escape performance by C ext
-	  for ASCII-compatible encodings.  [Fix GH-1238]
+	* lib/xsd/charset.rb: XSD::Charset.is_ces did return always true under
+	  $KCODE = "NONE" environment.  check added.
 
-Thu Feb  4 11:53:56 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* test/xsd/test_xsd.rb: add tests for above fix.
 
-	* common.mk: Introduce two variables (UNICODE_DATA_DIR and
-	  UNICODE_SRC_DATA_DIR) to eliminate repetitions.
+Sat Sep 27 15:58:50 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-Wed Feb  3 12:13:20 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* lib/soap/rpc/cgistub.rb: make logging severity threshold higher.
 
-	* string.c (str_new_frozen): if the given string is embeddedable
-	  but not embedded, embed a new copied string. [Bug #11946]
+	* lib/soap/rpc/standaloneServer.rb: defer WEBrick server start to give
+	  a chance to reset logging severity threshold.
 
-Wed Feb  3 08:25:38 2016  boshan  <boshan@subsplash.com>
+	* test/soap/calc/test_*, test/soap/helloworld/test_helloworld.rb: run
+	  silent.
 
-	* ext/openssl/ossl_pkey.c (Init_ossl_pkey): [DOC] Fix typo
-	  "encrypted" to "decrypted".  [Fix GH-1235]
+Sat Sep 27 09:44:18 2003  Minero Aoki  <aamine@loveruby.net>
 
-Wed Feb  3 08:21:32 2016  Seiei Miyagi  <hanachin@gmail.com>
+	* test/fileutils/test_fileutils.rb: clear all errors on Windows.
+	  [ruby-dev:21417]
 
-	* ext/ripper/lib/ripper/lexer.rb (on_heredoc_dedent): Fix
-	  Ripper.lex error in dedenting squiggly heredoc.  heredoc tree is
-	  also an array of Elem in the outer tree.  [Fix GH-1234]
+	* test/fileutils/test_nowrite.rb: ditto.
 
-Wed Feb  3 02:33:39 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+Mon Sep 27 09:14:03 2004  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* re.c (rb_reg_prepare_enc): use already compiled US-ASCII regexp
-	  if given string is ASCII only.
-	  121.2s to 113.9s on my x86_64-freebsd10.2 Intel Core i5 661
+	* array.c (rb_ary_delete): comparison may change the capacity.
+	  [ruby-dev:24348]
 
-Tue Feb  2 13:02:03 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* array.c (rb_ary_fill): fill should honor length argument.
+	  [ruby-dev:24346]
 
-	* re.c: Introduce RREGEXP_PTR.
-	  patch by dbussink.
-	  partially merge https://github.com/ruby/ruby/pull/497
+	* array.c (rb_ary_replace): should not use ptr from shared array.
+	  [ruby-dev:24345]
 
-	* include/ruby/ruby.h: ditto.
+	* ext/socket/socket.c (s_accept): don't retry for EWOULDBLOCK.
+	  [ruby-talk:113807]
 
-	* gc.c: ditto.
+Sat Sep 27 04:57:07 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-	* ext/strscan/strscan.c: ditto.
+	* test/ruby/test_file.rb: new file.  only asserts unlink-before-close
+	  behaviour now.
 
-	* parse.y: ditto.
+	* test/soap/marshal/test_digraph.rb: should close before unlink.
+	  unlink-before-close pattern is not needed here.
 
-	* string.c: ditto.
+Sat Sep 27 03:32:37 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-Tue Feb  2 09:08:27 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* test/soap/*, test/wsdl/*, test/xsd/*: move TestCase classes into
+	  each module namespace.  TestMarshal in
+	  test/soap/marshal/test_marshal.rb crashed with
+	  test/ruby/test_marshal.rb.
 
-	* lib/rubygems/specification.rb: `coding` is effective only first
-	  line except shebang.
+Sat Sep 27 01:30:59 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/rubygems/package.rb, lib/rubygems/package/*: ditto.
+	* ext/socket/socket.c (ruby_connect): on win32, type of the 4th
+	  argument of getsockopt is char *.
 
-Mon Feb  1 21:41:58 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+Fri Sep 26 18:35:40 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/rubygems.rb, lib/rubygems/*, test/rubygems/*: Update rubygems-2.5.2.
-	  It supports to enable frozen string literal and add `--norc` option for
-	  disable to `.gemrc` configuration.
-	  See 2.5.2 release notes for other fixes and enhancements.
-	  https://github.com/rubygems/rubygems/blob/a8aa3bac723f045c52471c7b9328310a048561e0/History.txt#L3
+	* lib/resolv-replace.rb: 1.8 compliance.  [ruby-talk:82946]
 
-Sun Jan 31 12:33:13 2016  Dan Kreiger  <dan@dankreiger.com>
+Fri Sep 26 17:39:27 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-	* test/drb/ut_large.rb (multiply, avg, median): add additional
-	  math operations to DRbLarge.  [Fix GH-1086]
+	* test/ruby/test_marshal.rb: add test for ruby's objects.
 
-Sun Jan 31 12:19:15 2016  Kuniaki IGARASHI  <igaiga@gmail.com>
+Fri Sep 26 09:52:44 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/ruby/test_file_exhaustive.rb (test_lstat): Add lacking test
-	  for File#lstat.  [Fix GH-1231]
+	* defines.h (flush_register_windows): use volatile only for gcc on
+	  Solaris.  [ruby-dev:21403]
 
-Sun Jan 31 12:15:33 2016  Prayag Verma  <prayag.verma@gmail.com>
+	* lib/mkmf.rb (xsystem): use system directly to honor shell meta
+	  charaters.
 
-	* doc/standard_library.rdoc: fix typo  [Fix GH-1230]
-	  Spelling mistakes -
-	  outputing > outputting
-	  publich > publish
+Fri Sep 26 00:10:13 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-Sat Jan 30 15:18:07 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/README: updated.
 
-	* vm_eval.c (rb_check_funcall_with_hook): also should call the
-	  given hook before returning Qundef when overridden respond_to?
-	  method returned false.  [ruby-core:73556] [Bug #12030]
+Thu Sep 25 17:48:10 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Fri Jan 29 17:40:07 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/openssl/ossl.c (ossl_buf2str): fix type of 1st argument for
+	  rb_protect.
 
-	* win32/file.c (rb_readlink): drop garbage after the substitute
-	  name, as rb_w32_read_reparse_point returns the expected buffer
-	  size but "\??\" prefix is dropped from the result.
+	* ext/openssl/ossl_hmac.c (ossl_hmac_digest): should return meaningful
+	  value.
 
-	* win32/win32.c (w32_readlink): ditto, including NUL-terminator.
+Thu Sep 25 09:00:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
 
-Fri Jan 29 17:07:27 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* lib/ostruct.rb: Added OpenStruct#==.
 
-	* win32/win32.c (fileattr_to_unixmode, rb_w32_reparse_symlink_p): volume
-	  mount point should be treated as directory, not symlink.
-	  [ruby-core:72483] [Bug #11874]
+	* test/ostruct/test_ostruct.rb: Added.
 
-	* win32/win32.c (rb_w32_read_reparse_point): check the reparse point is
-	  a volume mount point or not.
+Thu Sep 25 07:55:26 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* win32/file.c (rb_readlink): follow above change (but this pass won't
-	  be used).
+	* ext/win32ole/win32ole.c, ext/openssl/ossl_pkey_dsa.c,
+	  ext/openssl/ossl_pkey_rsa.c, ext/bigdecimal/bigdecimal.h: must
+	  not use C++ or C99 style comment yet.  (ruby-bugs:PR#1184)
 
-Fri Jan 29 16:17:07 2016  Lucas Buchala  <lucasbuchala@gmail.com>
+Thu Sep 25 00:23:22 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
 
-	* enum.c (enum_take_while, enum_drop_while): rename block
-	  parameter to obj, since they are generic objects.  [Fix GH-1226]
+	* MANIFEST: add SOAP4R.
 
-Fri Jan 29 14:15:26 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Sep 25 00:13:15 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-	* lib/erb.rb (ERB::Compiler#detect_magic_comment): allow
-	  frozen-string-literal in comment as well as encoding.
+	* lib/soap/* (29 files): SOAP4R added.
 
-	* lib/erb.rb (ERB#def_method): insert def line just before the
-	  first non-comment and non-empty line, not to leave duplicated
-	  and stale magic comments.
+	* lib/wsdl/* (42 files): WSDL4R added.
 
-Fri Jan 29 11:13:33 2016  Jeremy Evans  <code@jeremyevans.net>
+	* lib/xsd/* (12 files): XSD4R added.
 
-	* lib/erb.rb (ERB#set_eoutvar): explicitly make mutable string as
-	  a buffer to make ERB work with --enable-frozen-string-literal.
-	  [ruby-core:73561] [Bug #12031]
+	* test/soap/* (16 files): added.
 
-Fri Jan 29 10:44:56 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* test/wsdl/* (2 files): added.
 
-	* lib/net/http/header.rb: Warn nil variable on HTTP Header.
-	  It caused to NoMethodError. [fix GH-952][fix GH-641] Patch by @teosz
-	* test/net/http/test_httpheader.rb: Added test for nil HTTP Header.
+	* test/xsd/* (3 files): added.
 
-Thu Jan 28 17:31:43 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* sample/soap/* (27 files): added.
 
-	* ext/socket/socket.c (sock_gethostname): support unlimited size
-	  hostname.
+	* sample/wsdl/* (13 files): added.
+
+Wed Sep 24 02:08:11 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* lib/webrick/httpservlet/cgihandler.rb: conform to mswin32.
+	  [ruby-talk:82735], [ruby-talk:82748], [ruby-talk:82818]
+
+Tue Sep 23 23:10:16 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* lib/logger.rb: add Logger#<<(msg) for writing msg without any
+	  formatting.
+
+	* test/logger/test_logger.rb: ditto.
+
+Tue Sep 23 20:47:51 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* error.c (rb_warn_m): should not warn if -W0 is specified.
+	  [ruby-talk:82675]
+
+Mon Sep 22 21:28:57 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* MANIFEST: updated.
+
+Mon Sep 22 19:22:26 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* configure.in (AC_CHECK_FUNCS): add setuid and setgid.
+
+Mon Sep 22 12:34:55 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* util.c (ruby_strtod): skip preceding zeros before counting
+	  digits in the mantissa. (ruby-bugs:PR#1181)
+
+Sun Sep 21 04:12:36 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/ossl_ocsp.c (ossl_ocspreq_initialize): the argument
+	  should be a String.
+
+	* ext/openssl/ossl_ocsp.c (ossl_ocspres_initialize): ditt.
+
+	* ext/openssl/ossl_x509attr.c (ossl_x509attr_initialize): ditto.
+
+	* ext/openssl/ossl_x509ext.c (ossl_x509ext_initialize): ditto.
+
+	* ext/openssl/ossl_x509ext.c (ossl_x509ext_set_value): ditto.
+
+Sat Sep 20 11:49:05 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* lib/logger.rb: typo fixed.
+
+	* test/logger/test_logger.rb: new file.
+
+Fri Sep 19 11:39:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
+
+	* test/testunit/*: Added.
+
+	* lib/test/unit.rb: Documentation update.
+
+	* lib/test/unit/ui/console/testrunner.rb (TestRunner#initialize):
+	  Ditto.
+
+	* lib/test/unit.rb: Factored out an ObjectSpace collector.
+
+	* lib/test/unit/collector/objectspace.rb: Ditto.
+
+	* sample/testunit/*: Added.
+
+Fri Sep 19 01:00:48 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* lib/webrick/log.rb (BasicLog#log): get rid of as ineffectual
+	  condition.
+
+	* lib/webrick/log.rb (BasicLog#format): add "\n" to message.
+
+Thu Sep 18 22:43:20 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (proc_invoke): should push PROT_PCALL tag for orphans.
+
+	* eval.c (proc_invoke): should update "result" for orphans.
+
+Thu Sep 18 20:33:03 2003  Tietew  <tietew-ml-ruby-list@tietew.net>
+
+	* parse.y (str_xquote): do not prepend escapes in
+	  backqoute literals.  [ruby-list:38409]
+
+Thu Sep 18 20:30:17 2003  Tanaka Akira  <akr@m17n.org>
+
+	* lib/pathname.rb: update document.
+
+Thu Sep 18 15:27:05 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+
+	* lib/logger.rb: new file.  Logger, formerly called devel-logger or
+	  Devel::Logger.
+
+	* sample/logger/*: new file.  samples of logger.rb.
+
+Wed Sep 17 23:41:45 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (localjump_destination): should not raise ThreadError
+	  exception for "break". [ruby-dev:21348]
+
+	* eval.c (proc_invoke): use result instead of prot_tag->retval.
+	  retval is no longer propagated to the ancestors.
 
-Wed Jan 27 21:03:45 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+Wed Sep 17 20:34:00 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* test/-ext-/string/test_capacity.rb: Added missing library.
+	* parse.y (tokadd_string, parse_string, yylex): escaped terminator
+	  is now interpreted as is.  [ruby-talk:82206]
 
-Wed Jan 27 18:53:40 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Wed Sep 17 18:52:36 2003  Minero Aoki  <aamine@loveruby.net>
 
-	* enc/unicode.c: Fixed bit mask in macro OnigCodePointCount
+	* test/fileutils/fileassertions.rb: new file.
 
-Wed Jan 27 17:54:42 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* test/fileutils/test_fileutils.rb: new file.
 
-	* enc/unicode.c: Protect code point count by macro, in order to
-	  be able to use the remaining bits for flags.
-	  (with Kimihito Matsui)
+	* test/fileutils/test_nowrite.rb: new file.
 
-Wed Jan 27 16:34:35 2016  boshan  <boshan@subsplash.com>
+Wed Sep 17 18:51:02 2003  Minero Aoki  <aamine@loveruby.net>
 
-	* lib/tempfile.rb (Tempfile#initialize): [DOC] the first parameter
-	  `basename` is optional and defaulted to an empty string since
-	  [GH-523].  [Fix GH-1225]
+	* test/strscan/test_stringscanner.rb: require test/unit.
 
-Wed Jan 27 16:25:54 2016  Koichi ITO  <koic.ito@gmail.com>
+Wed Sep 17 18:35:34 2003  Minero Aoki  <aamine@loveruby.net>
 
-	* array.c (rb_ary_dig): [DOC] fix the exception class to be raised
-	  when intermediate object does not have dig method.  TypeError
-	  will be raised now.  [Fix GH-1224]
+	* test/strscan/test_stringscanner.rb: new file.
 
-Tue Jan 26 19:36:15 2016  Aggelos Avgerinos  <evaggelos.avgerinos@gmail.com>
+Wed Sep 17 18:03:30 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
 
-	* array.c (permute0, rpermute0): [DOC] Substitute indexes ->
-	  indices in documentation for consistency.  [Fix GH-1222]
+	* ext/openssl: all files are reviewed to simplify and avoid memory leak.
 
-Tue Jan 26 15:21:37 2016  Eric Wong  <e@80x24.org>
+	* ext/openssl/extconf.rb: add check for assert.h.
 
-	* compile.c (caller_location): use rb_fstring_cstr for "<compiled>"
-	  (it is converted to fstring anyways inside rb_iseq_new_with_opt)
-	* iseq.c (iseqw_s_compile): ditto
-	* iseq.c (rb_iseq_new_main): use rb_fstring_cstr for "<main>"
-	* vm.c (Init_VM): ditto, share with with above
-	* iseq.c (iseqw_s_compile_file): rb_fstring before rb_io_t->pathv
-	  share "<main>" with above
-	* vm.c (rb_binding_add_dynavars): fstring "<temp>" immediately
+	* ext/openssl/ossl.c (ossl_buf2str): new function to convert
+	  C buffer to String and free buffer.
 
-Tue Jan 26 15:14:01 2016  Kazuki Yamaguchi  <k@rhe.jp>
+	* ext/openssl/ossl.c (ossl_x509_ary2sk): new function to convert
+	  Array of OpenSSL::X509 to STACK_OF(X509) with exception safe.
 
-	* compile.c (iseq_peephole_optimize): don't apply tailcall
-	  optimization to send/invokesuper instructions with blockiseq.
-	  This is a follow-up to the changes in r51903; blockiseq is now
-	  the third operand of send/invokesuper instructions.
-	  [ruby-core:73413] [Bug #12018]
+	* ext/openssl/ossl.c (ossl_to_der, ossl_to_der_if_possible): new
+	  functions to convert object to DER string.
 
-Tue Jan 26 14:26:46 2016  Eric Wong  <e@80x24.org>
+	* ext/openssl/ossl.h: ditto.
 
-	* signal.c (sig_list): use fstring for hash key
-	* test/ruby/test_signal.rb (test_signal_list_dedupe_keys): added
+	* ext/openssl/ossl_bio.c (ossl_membio2str): new function to convert
+	  BIO to String object and free BIO.
 
-Tue Jan 26 13:08:34 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/openssl/ossl_bio.h: ditto.
 
-	* signal.c (rb_f_kill): should immediately deliver reserved
-	  signals SIGILL and SIGFPE, not only SIGSEGV and SIGBUS.
+	* ext/openssl/ossl_pkcs7.c (ossl_pkcs7_to_der): add for "to_der".
 
-Tue Jan 26 07:57:28 2016  Joseph Tibbertsma  <josephtibbertsma@gmail.com>
+	* ext/openssl/ossl_x509name.c (ossl_x509name_to_der): ditto.
 
-	* gc.c (RVALUE_PAGE_WB_UNPROTECTED): fix a typo of argument name.
-	  [Fix GH-1221]
+	* ext/openssl/ossl_x509ext.c (ossl_x509ext_to_der): ditto.
 
-Mon Jan 25 17:26:54 2016  Eric Wong  <e@80x24.org>
+	* ext/openssl/ossl_x509ext.c (create_ext_from_array): removed
+	  and reimplement in openssl/x509.rb.
 
-	* ruby_assert.h (RUBY_ASSERT_WHEN): fix reference to macro name
-	* vm_core.h: include ruby_assert.h before using
-	  [ruby-core:73371]
+	* ext/openssl/ossl_x509attr.c: reimplemented and disable some
+	  method temporarily. this class doesn't work fine without ASN.1
+	  data support;-) I'll rewrite in near future.
 
-Mon Jan 25 15:55:30 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/openssl/lib/openssl/x509.c (X509::Attribute): get rid off
+	  unused code.
 
-	* symbol.c (sym_check_asciionly): more informative error message
-	  with the encoding name and the inspected content.
-	  [ruby-core:73398] [Feature #12016]
+	* ext/openssl/lib/openssl/x509.c (X509::ExtensionFactory): refine all.
 
-Mon Jan 25 09:38:26 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+Tue Sep 16 22:25:06 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-	* test/ruby/test_string.rb: added testcase for next!, succ and succ!
-	  [fix GH-1213] Patch by @K0mAtoru
+	* test/csv/test_csv.rb: add negative tests of row_sep.
 
-Mon Jan 25 09:32:25 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+Tue Sep 16 18:02:36 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* lib/webrick/httpservlet/filehandler.rb: fix documentation for namespace.
-	  [fix GH-1219][ci skip] Patch by @leafac
+	* regex.c (re_compile_pattern): should not translate character
+	  class range edge. [ruby-list:38393]
 
-Sun Jan 24 19:34:23 2016  Eric Wong  <e@80x24.org>
+Tue Sep 16 16:47:56 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
 
-	* vm_insnhelper.c (vm_check_if_namespace): tiny size reduction
+	* MANIFEST: add test/csv/mac.csv.
 
-Sun Jan 24 18:12:36 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* win32/Makefile.sub, bcc32/Makefile.sub (test): add phony NUL target.
 
-	* common.mk: Simplifying Unicode data file download logic to make
-	  it more reliable (including additional fix not in r53633) [Bug #12007]
+Mon Sep 15 19:02:52 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-Sun Jan 24 16:54:11 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/csv.rb: add extra pamameter to specify row(record) separater
+	  character.  To parse Mac's CR separated CSV, do like this.
+	    CSV.open("mac.csv", "r", ?,, ?\r) { |row| p row.to_a }
+	  The 3rd parameter in this example ?, is for column separater and the
+	  4th ?\r is for row separater.  Row separater is nil by default.  Nil
+	  separater means "\r\n" or "\n".
 
-	* ext/io/wait/wait.c (io_wait_readwrite): [EXPERIMENTAL] allow to
-	  wait for multiple modes, readable and writable, at once.  the
-	  arguments may change in the future.  [Feature #12013]
+	* test/csv/test_csv.rb: add tests for above feature.
 
-Sat Jan 23 22:30:59 2016  K0mA  <mctj1218@gmail.com>
+	* test/csv/mac.csv: added.  Sample CR separated CSV file.
 
-	* test/ruby/test_array.rb (test_keep_if): Add test for
-	  Array#keep_if separate from Array#select!  [Fix GH-1218]
+Fri Sep 12 22:41:48 2003  Michal Rokos  <m.rokos@sh.cvut.cz>
 
-Sat Jan 23 20:54:26 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* ext/openssl/ossl.c: move ASN.1 stuff to ossl_asn1.[ch]
 
-	* common.mk: revert r53633. It broke rubyci and travis.
-	  https://travis-ci.org/ruby/ruby/builds/104259623
+	* ext/openssl/ossl.c: move BIO stuff to ossl_bio.[ch]
 
-Sat Jan 23 20:10:29 2016  Shugo Maeda  <shugo@ruby-lang.org>
+	* ext/openssl/ossl_asn1.[ch]: new files
 
-	* range.c (range_eqq): revert r51585 because rb_call_super() is
-	  called in range_include() and thus r51585 doesn't work when the
-	  receiver Range object consists of non linear objects such as Date
-	  objects.
-	  [ruby-core:72908] [Bug #12003]
+	* ext/openssl/ossl_bio.[ch]: new files
 
-Sat Jan 23 18:37:37 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Fri Sep 12 12:30:41 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* ChangeLog: Fixing wrong time on previous commit, and adding
-	  previous commit message to svn [ci skip]
+	* intern.h (rb_disable_super, rb_enable_super): replace with dummy
+	  expressions instead of prototypes.  the functions remain yet for
+	  binary compatibility.  [ruby-talk:81758]
 
-Sat Jan 23 18:30:30 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+Fri Sep 12 12:09:54 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* common.mk: Simplifying Unicode data file download logic to make
-	  it more reliable [Bug #12007]
+	* bignum.c (rb_big_and): convert argument using 'to_int'.
 
-Sat Jan 23 16:29:42 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* bignum.c (rb_big_or): ditto.
 
-	* tool/downloader.rb: Fixed a logical error, improved documentation
+	* bignum.c (rb_big_xor): ditto.
 
-Sat Jan 23 11:42:43 2016  Peter Suschlik  <ps@neopoly.de>
+Fri Sep 12 07:06:14 2003  David Black  <dblack@superlink.net>
 
-	* README.md: Use SVG Travis badge over PNG for better quality and
-	  device support.  [Fix GH-1214] [Fix GH-1216]
+	* lib/scanf.rb: Took out useless @matched_item variable; some small
+	  refactoring.
 
-Sat Jan 23 11:29:16 2016  Pascal Betz  <pascal.betz@simplificator.com>
+Thu Sep 11 08:43:44 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* lib/csv.rb: Update documentation of CSV header converter for
-	  r45498, [GH-575].  [Fix GH-1215]
+	* eval.c (rb_f_require): allow "require" on $SAFE>0, if feature
+	  name is not tainted.
 
-Fri Jan 22 17:36:46 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/rexml/parsers/baseparser.rb (REXML::Parsers::BaseParser::stream):
+	  Supports StringIO.
 
-	* vm_core.h (VM_ASSERT): use RUBY_ASSERT instead of rb_bug.
+Wed Sep 10 22:47:30 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
 
-	* error.c (rb_assert_failure): assertion with stack dump.
+	* ext/openssl/ossl.h: add a workaround for win32 platform.
+	  libeay32.dll doesn't export functions defined in conf_api.h.
 
-	* ruby_assert.h (RUBY_ASSERT): new header for the assertion.
+	* ext/openssl/ossl_config.c (ossl_config_initialize): ditto.
 
-Fri Jan 22 00:25:57 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* ext/openssl/ossl_config.c (ossl_config_add_value): ditto.
 
-	* regparse.c (fetch_name_with_level): allow non word characters
-	  at the first character.  [Feature #11949]
+	* ext/openssl/ossl_config.c (set_conf_section_i): should check
+	  if the argument is Array.
 
-	* regparse.c (fetch_name): ditto.
+Wed Sep 10 22:41:54 2003  Tietew  <tietew@tietew.net>
 
-Thu Jan 21 17:34:01 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* eval.c (win32_get_exception_list): avoid VC7 warning.
+	  [ruby-win32:577]
 
-	* marshal.c (r_object0): honor Marshal.load post proc
-	  value for TYPE_LINK.  by Hiroshi Nakamura <nahi@ruby-lang.org>
-	  https://github.com/ruby/ruby/pull/1204 fix GH-1204
+Tue Sep  9 10:39:51 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Jan 21 16:37:50 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* eval.c (struct tag): dst should be VALUE.
 
-	* Makefile.in (update-rubyspec): fix r53208 like r53451.
+Tue Sep  9 10:39:51 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Wed Jan 20 20:58:25 2016  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* eval.c (localjump_destination): stop at the scope where the current
+	  block was created.  [ruby-dev:21353]
 
-	* common.mk, Makefile.in: update-config_files is only for Unix
-	  platforms.
+Tue Sep  9 05:17:04 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
 
-Wed Jan 20 17:13:39 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/openssl/ossl_config.rb: avoid compile error in OpenSSL-0.9.6.
 
-	* tool/extlibs.rb: add --cache option to change cache directory.
+Tue Sep  9 02:41:35 2003  Michal Rokos  <m.rokos@sh.cvut.cz>
 
-Tue Jan 19 17:03:40 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* ext/openssl/ossl_config.c: Refine compatibility.
 
-	* common.mk: Added Unicode data file CaseFolding.txt to be additionally
-	  downloaded (with Kimihito Matsui)
+Tue Sep  9 01:50:45 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
 
-Tue Jan 19 10:09:58 2016  Sho Hashimoto  <sho-h@ruby-lang.org>
+	* lib/webrick/httpserver.rb (HTTPServer#access_log): add "\n" to
+	  the message.
 
-	* lib/shell.rb (Shell.debug_output_exclusive_unlock): remove
-	  because Mutex#exclusive_unlock was already deleted. [fix GH-1185]
+	* lib/webrick/log.rb (BasicLog#log): add "\n" only if needed.
 
-Tue Jan 19 09:38:27 2016  Nick Cox  <nick@nickcox.me>
+Mon Sep  8 22:15:33 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-	* vm_method.c: fix grammar in respond_to? warning.
-	  [fix GH-1047]
+	* ext/tk/lib/multi-tk.rb: modify security check at creating
+	  a new interpreter
 
-Mon Jan 18 14:37:07 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon Sep  8 20:00:12 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* parse.y (parser_here_document): an escaped newline is not an
-	  actual newline, and the rest part should not be dedented.
-	  [ruby-core:72855] [Bug #11989]
+	* lib/optparse.rb, lib/optparse/version.rb: search also all
+	  capital versions.
 
-Mon Jan 18 12:04:34 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+Mon Sep  8 19:26:33 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
 
-	* test/ruby/test_string.rb: Added extra testcase for test_rstrip_bang
-	  and test_lstrip_bang. [fix GH-1178] Patch by @Matrixbirds
+	* ext/openssl/ossl.h: include openssl/conf.h and openssl/conf_api.h.
 
-Mon Jan 18 11:47:27 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* ext/openssl/ossl_config.c: refine all with backward compatibility.
 
-	* string.c: fix a typo. [fix GH-1202][ci skip] Patch by @sunboshan
+	* ext/openssl/ossl_config.h: export GetConfigPtr() and DupConfigPtr().
 
-Sun Jan 17 21:15:30 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+	* ext/openssl/ossl_x509.c: added new constants under X509 module.
+	  DEFAULT_CERT_AREA, DEFAULT_CERT_DIR, DEFAULT_CERT_FILE,
+	  DEFAULT_CERT_DIR_ENV, DEFAULT_CERT_FILE_ENV and DEFAULT_PRIVATE_DIR.
 
-	* configure.in: improve ICC (Intel C Compiler) support.
+	* ext/openssl/ossl_x509ext.c (ossl_x509extfactory_free): don't free
+	  the members of the struct. it's left to GC.
 
-	* configure.in (CXX): The name of icc's c++ compiler is `icpc`.
+	* ext/openssl/ossl_x509ext.c (ossl_x509_set_config): add for config=.
 
-	* configure.in (warnings): Add `-diag-disable=2259` to suppress
-	  noisy warnings: "non-pointer conversion from "..." to "..." may
-	  lose significant bits".
+	* ext/openssl/ossl_x509ext.c (Xossl_x509extfactory_initialize):
+	  add attr readers: issuer_certificate, subject_certificate,
+	  subject_request, crl and config.
 
-	* configure.in (optflags): Add `-fp-model precise` like -fno-fast-math.
+Mon Sep  8 18:26:41 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
 
-	* lib/mkmf.rb: icc supports -Werror=division-by-zero
-	  and -Werror=deprecated-declarations, but doesn't support
-	  -Wdivision-by-zero and -Wdeprecated-declarations.
+	* lib/webrick/accesslog.rb (AccessLog::setup_params): use req.port
+	  instead of config[:Port] or req.request_uri.port.
 
-Sun Jan 17 20:40:10 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* lib/webrick/httprequest.rb (HTTPRequest#meta_vars): ditto.
 
-	* string.c: Any kind of option is now taking the new code path for
-	  upcase/downcase/capitalize/swapcase. :lithuanian can be used for
-	  testing if no specific option is desired.
-	* test/ruby/enc/test_case_mapping.rb: Adjusted to above.
-	  (with Kimihito Matsui)
+	* lib/webrick/httpservlet/filehandler.rb (FileHandler#dir_list): ditto.
 
-Sun Jan 17 20:10:10 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* lib/webrick/config.rb: :Listen option never be used.
 
-	* enc/unicode.c: Fixed a logical error and some comments.
-	* test/ruby/enc/test_case_mapping.rb: Made tests more general.
-	  (with Kimihito Matsui)
+	* lib/webrick/server.rb (GenericServer#initialize): don't use :Listen
+	  option and add warning message.
 
-Sun Jan 17 17:41:41 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* lib/webrick/log.rb (BasicLog#<<): shortcut of log(INFO, ...).
 
-	* enc/unicode.c: Removed artificial expansion for Turkic,
-	  added hand-coded support for Turkic, fixed logic for swapcase.
-	* string.c: Made use of new case mapping code possible from upcase,
-	  capitalize, and swapcase (with :lithuanian as a guard).
-	* test/ruby/enc/test_case_mapping.rb: Adjusted for above.
-	  (with Kimihito Matsui)
+	* lib/webrick/httpserver.rb (HTTPServer#accesslog): use << for logging.
 
-Sun Jan 17 15:30:57 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sun Sep  7 16:08:28 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-	* ext/socket/option.c (sockopt_bool): relax boolean size to be one
-	  too not only sizeof(int).  Winsock getsockopt() returns a single
-	  byte as a boolean socket option.  [ruby-core:72730] [Bug #11958]
+	* ext/tcltklib/tcltklib.c (lib_mainloop_core): fixed signal-trap bug
 
-Sun Jan 17 14:43:01 2016  Kuniaki IGARASHI  <igaiga@gmail.com>
+	* ext/tk/lib/*.rb : Ruby/Tk works at $SAFE == 4
 
-	* test/ruby/test_env.rb: [Fix GH-1201]
-	  * Extract test code for ENV#keep_if from ENV#select_bang
-	  * Add a test case for ENV#select_bang,keep_if
+Sat Sep  6 02:26:34 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-Sun Jan 17 14:42:25 2016  Kuniaki IGARASHI  <igaiga@gmail.com>
+	* test/ruby/test_*.rb: assert_same, assert_match, and so on.
 
-	* test/ruby/test_env.rb: [Fix GH-1201]
-	  * Extract test code for ENV#delete_if from ENV#reject_bang
-	  * Add a test case for ENV#reject_bang,delete_if
+Sat Sep  6 18:45:46 2003  Mauricio Fernandez  <batsman.geo@yahoo.com>
 
-Sun Jan 17 14:40:22 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* parse.y (assignable): call rb_compile_error(), not rb_bug().
+	  [ruby-core:01523]
 
-	* ext/socket/option.c (check_size): extract a macro to check
-	  binary data size, with a consistent message.
+Sat Sep  6 17:40:41 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
 
-	* ext/socket/option.c (sockopt_byte): fix error message,
-	  sizeof(int) differs from sizeof(unsigned char) in general.
+	* ext/openssl/ruby_missing.c: rid of unnecessary backward
+	  compatibility stuff. and remove DEFINE_ALLOC_WRAPPER from
+	  all sources.
 
-Sat Jan 16 21:16:21 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/openssl/ossl_x509ext.c (X509::Extension.new): new method.
 
-	* parse.y (xstring): reset heredoc indent after dedenting,
-	  so that following string literal would not be dedented.
-	  [ruby-core:72857] [Bug #11990]
+	* ext/openssl/ossl_x509ext.c (X509::Extension#oid=): new method.
 
-Sat Jan 16 17:24:24 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* ext/openssl/ossl_x509ext.c (X509::Extension#value=): new method.
 
-	* enc/unicode.c: Artificial mapping to test buffer expansion code.
-	* string.c: Fixed buffer expansion logic.
-	* test/ruby/enc/test_case_mapping.rb: Tests for above.
-	  (with Kimihito Matsui)
+	* ext/openssl/ossl_x509ext.c (X509::Extension#critical=): new method.
 
-Sat Jan 16 16:47:14 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+Sat Sep  6 01:23:22 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* ext/openssl/lib/openssl/pkey.rb: Added 2048 bit DH parameter.
-	* test/openssl/test_pkey_dh.rb: ditto.
+	* win32/win32.c (CreateChild): need to quote cmd if RUBYSHELL is set.
 
-Sat Jan 16 10:51:19 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* win32/win32.c (CreateChild): fix condition about whether to call
+	  shell or not.
 
-	* enc/unicode.c: fix implicit conversion error with clang. fixup r53548.
-	* string.c: ditto.
+Sat Sep  6 00:36:20 2003  Nobuyoshi Nakada  <nobu.nokada@softhome.net>
 
-Sat Jan 16 10:31:00 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* Makefile.in (test): phony target.
 
-	* common.mk: test-sample was changed to test-basic.
-	  [Feature #11982][ruby-core:72823]
-	* basictest/runner.rb: ditto. rename from tool/rubytest.rb.
-	* basictest/test.rb: ditto. rename from sample/test.rb.
-	* defs/gmake.mk: picked from r53540
-	* sample/test.rb: backward compatibility for chkbuild.
+	* lib/mkmf.rb (have_library, find_library): configure by library
+	  name.
 
-Sat Jan 16 10:23:23 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* lib/optparse.rb (OptionParser#order, #permute, #parse): allow an
+	  array as argument.
 
-	* string.c, enc/unicode.c: New code path as a preparation for Unicode-wide
-	  case mapping. The code path is currently guarded by the :lithuanian
-	  option to avoid accidental problems in daily use.
-	* test/ruby/enc/test_case_mapping.rb: Test for above.
-	* string.c: function 'check_case_options': fixed logical errors
-	  (with Kimihito Matsui)
+	* test/ruby/test_*.rb: moved invariants to left side in
+	  assert_equal, and use assert_nil, assert_raises and so on.
 
-Fri Jan 15 20:20:20 2016  Naohisa Goto  <ngotogenome@gmail.com>
+	* win32/win32.c (isInternalCmd): distinguish command.com and
+	  cmd.exe.
 
-	* regint.h (PLATFORM_UNALIGNED_WORD_ACCESS): The value of
-	  UNALIGNED_WORD_ACCESS should be used to determine whether
-	  unaligned word access is allowed or not. After this commit,
-	  ./configure CPPFLAGS="-DUNALIGNED_WORD_ACCESS=0" disables
-	  unaligned word access even on platforms that support the feature.
+	* win32/win32.c (make_cmdvector): a character just after wildcard
+	  was ignored.  [ruby-core:01518]
 
-Fri Jan 15 16:12:10 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Sep  5 20:27:08 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-	* parse.y (string1): reset heredoc indent for each string literal
-	  so that concatenated string would not be dedented.
-	  [ruby-core:72857] [Bug #11990]
+	* test/ruby/test_*.rb: replace 'assert(a == b)' with assert_equal(a, b)'
 
-Thu Jan 14 20:01:00 2016  NARUSE, Yui  <naruse@ruby-lang.org>
+Fri Sep  5 18:00:51 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
 
-	* lib/uri/generic.rb (URI::Generic#to_s): change encoding to
-	  UTF-8 as Ruby 2.2/ by Koichi ITO <koic.ito@gmail.com>
-	  https://github.com/ruby/ruby/pull/1188 fix GH-1188
+	* ext/openssl/lib/openssl/x509.rb: new method X509::Name::parse.
 
-Thu Jan 14 17:36:16 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/openssl/ossl_digest.c: add ossl_digest_new().
 
-	* variable.c (rb_f_global_variables): add matched back references
-	  only, as well as defined? operator.
+	* ext/openssl/ossl_digest.h: ditto.
 
-Thu Jan 14 16:12:09 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/openssl/ossl_cipher.c: add ossl_cipher_new().
 
-	* sprintf.c (rb_str_format): format exact number more exactly.
+	* ext/openssl/ossl_cipher.h: ditto.
 
-Thu Jan 14 15:08:43 2016  Tony Arcieri  <bascule@gmail.com>
+Fri Sep  5 15:32:04 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* Remove 512-bit DH group. It's affected by LogJam Attack.
-	  https://weakdh.org/
-	  [fix GH-1196][Bug #11968][ruby-core:72766]
+	* misc/ruby-mode.el (ruby-font-lock-maybe-here-docs): should not
+	  search delimiter forward if found in backward.
 
-Thu Jan 14 11:44:29 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Fri Sep  5 13:32:48 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* variable.c (rb_f_global_variables): add $1..$9 only if $~ is
-	  set.  fix the condition removed at r14014.
+	* test/runner.rb: arguments should be keys.
 
-Wed Jan 13 17:21:45 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+Fri Sep  5 12:09:55 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
 
-	* .travis.yml: removed commented-out code.
+	* test/ruby/test_system.rb (test_system): check existence of ruby
+	  interpreter.
 
-Wed Jan 13 17:14:54 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+Fri Sep  5 11:32:17 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* .travis.yml: removed osx code. follow up with r53517
+	* lib/optparse.rb (--version): fix assignment/reference order.
 
-Wed Jan 13 16:56:19 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/optparse.rb (OptionParser#help): new; OptionParser#to_s may
+	  be deprecated in future.
 
-	* iseq.c (rb_iseq_mark): mark parent iseq to prevent dynamically
-	  generated iseq by eval from GC.  [ruby-core:72620] [Bug #11928]
+	* lib/optparse/version.rb (OptionParser#show_version): hide Object.
 
-Wed Jan 13 03:42:58 2016  Eric Wong  <e@80x24.org>
+	* test/runner.rb: fix optparse usage.
 
-	* class.c (Init_class_hierarchy): resolve name for rb_cObject ASAP
-	* object.c (rb_mod_const_set): move name resolution to rb_const_set
-	* variable.c (rb_const_set): do class resolution here
-	  [ruby-core:72807] [Bug #11977]
+	* test/runner.rb: glob all testsuits if no tests given.
 
-Wed Jan 13 00:37:12 2016  Satoshi Ohmori  <sachin21dev@gmail.com>
+Fri Sep  5 10:42:58 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-	* man/ruby.1: fix double word typo.  [Fix GH-1194]
+	* test/runner.rb: added.  gets testcases from command line and runs it.
 
-Tue Jan 12 21:01:09 2016  Benoit Daloze  <eregontp@gmail.com>
+	* test/ruby/test_gc.rb: remove useless part which was for dumping test
+	  result.
 
-	* common.mk: update URL and name for the Ruby spec suite.
+Fri Sep  5 09:28:59 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-Tue Jan 12 19:52:19 2016  sorah (Shota Fukumori)  <her@sorah.jp>
+	* test/ruby/test_gc.rb: added.  splitter.rb which I made to split
+	  sample/test.rb into test/ruby/test_* kindly removed GC test (the
+	  last section in the original test) to reduce things to be worried.
 
-	* lib/forwardable.rb: Convert given accessors to String.
+Fri Sep  5 03:00:04 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	  r53381 changed to accept only Symbol or String for accessors, but
-	  there are several rubygems that pass classes (e.g. Array,
-	  Hash, ...) as accessors. Prior r53381, it was accepted because Class#to_s
-	  returns its class name. After r53381 given accessors are checked
-	  with define_method, but it accepts only Symbol or String, otherwise
-	  raises TypeError.
+	* test/ruby/test_iterator.rb (test_block_in_arg): add no block
+	  given tests.
 
-	      def_delegator Foo, :some_method
+	* test/ruby/test_iterator.rb (test_ljump): uncomment LocalJumpError
+	  test.
 
-	  This change is to revert unexpected incompatibility. But this behavior
-	  may change in the future.
+Fri Sep  5 01:10:11 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-Mon Jan 12 18:41:41 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* test/ruby: tests for ruby itself.
 
-	* string.c: made a variable name more grammatically correct
+	* test/ruby/test_*.rb: split sample/test.rb into 28 test/unit testcases.
+	  some tests could not be translates...  search '!!' mark to see it.
 
-Mon Jan 12 18:34:34 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* test/csv/test_csv.rb: should require 'csv', not '../lib/csv'.  test
+	  runner should set load path correctly.
 
-	* string.c: minor grammar fix [ci skip]
+Fri Sep  5 01:03:59 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-Mon Jan 12 16:09:09 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* test/csv/test_csv.rb: close opened files for CSV::IOBuf explicitly.
+	  opened file cannot be removed under win32 box.
 
-	* test/ruby/enc/test_casing_options.rb: Tests for option
-	  parsing/checking for upcase/downcase/capitalize/swapcase
-	  (see r53503; with Kimihito Matsui)
+Thu Sep  4 23:59:40 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Jan 12 16:03:03 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* parse.y (tokadd_string): newlines have no special meanings in
+	  %w/%W, otherwise they are ignored only when interpolation is
+	  enabled.  [ruby-dev:21325]
 
-	* string.c: Added option parsing/checking for upcase/downcase/
-	  capitalize/swapcase (with Kimihito Matsui)
+Thu Sep  4 19:38:25 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-Mon Jan 11 21:28:28 2016  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* ext/io/wait/.cvsignore: added.
 
-	* include/ruby/oniguruma.h: Added flags needed for upcase/downcase
-	  Unicode addition (with Kimihito Matsui)
+	* ext/openssl/.cvsignore: added.
 
-Mon Jan 11 09:50:24 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Sep  4 19:28:24 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-	* configure.in: check if the API version number is consistent with
-	  the program version number.
+	* sample/openssl: added.  Sample of standard distribution library
+	  should be locate in sample/{module_name}/*.
 
-Sun Jan 10 20:57:25 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/openssl/sample/*: removed.  move to sample/openssl/*.
 
-	* compile.c (compile_massign_lhs): when index ends with splat,
-	  append rhs value to it like POSTARG, since VM_CALL_ARGS_SPLAT
-	  splats the last argument only.  [ruby-core:72777] [Bug #11970]
+Thu Sep  4 18:02:15 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-Sun Jan 10 15:45:10 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test/csv/test_csv.rb: use remove_const to reduce warnings.  use
+	  Dir.tmpdir to locate working files.
 
-	* include/ruby/missing.h (explicit_bzero_by_memset_s): remove
-	  inline implementation by memset_s, which needs a macro before
-	  including headers and can cause problems in extension libraries
-	  by the order of the macro and headers.
+Thu Sep  4 17:41:31 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Jan 10 13:41:36 2016  Eric Wong  <e@80x24.org>
+	* misc/ruby-mode.el (ruby-here-doc-beg-re): underscore also is
+	  valid delimiter.
 
-	* io.c (rb_deferr): remove long obsolete global
+	* misc/ruby-mode.el (ruby-here-doc-end-match): must quote
+	  arbitrary string to use as regexp.
 
-Sun Jan 10 09:14:42 2016  Eric Wong  <e@80x24.org>
+	* misc/ruby-mode.el (ruby-font-lock-maybe-here-docs): must not
+	  call `ruby-here-doc-end-match' unless `ruby-here-doc-beg-re'
+	  matched.
 
-	* ext/psych/lib/psych/visitors/yaml_tree.rb (visit_String):
-	  eliminate chomp
-	* lib/net/http.rb (connect): eliminate delete
-	* lib/net/http/header.rb (basic_encode): ditto
-	* lib/net/imap.rb (authenticate): eliminate gsub
-	  (self.encode_utf7): shorten delete arg
-	* lib/net/smtp.rb (base64_encode): eliminate gsub
-	* lib/open-uri.rb (OpenURI.open_http): eliminate delete
-	* lib/rss/rss.rb: ditto
-	* lib/securerandom.rb (base64): ditto
-	  (urlsafe_base64): eliminate delete!
-	* lib/webrick/httpauth/digestauth.rb (split_param_value):
-	  eliminate chop
-	* lib/webrick/httpproxy.rb (do_CONNECT): eliminate delete
-	  (setup_upstream_proxy_authentication): ditto
-	  [ruby-core:72666] [Feature #11938]
+Thu Sep  4 15:40:07 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-Sat Jan  9 23:19:14 2016  Kuniaki IGARASHI  <igaiga@gmail.com>
+	* test/csv/test_csv.rb: run on test/unit original layer.
 
-	* test/ruby/test_hash.rb (test_try_convert): Add test for
-	  Hash.try_convert.  [Fix GH-1190]
+Thu Sep  4 12:54:50 2003  why the lucky stiff  <why@ruby-lang.org>
 
-Sat Jan  9 23:15:25 2016  Jon Moss  <maclover7@users.noreply.github.com>
+	* ext/syck/token.c: headerless documents with root-level spacing now
+	  honored.
 
-	* ext/openssl/ossl.c: Add missing variables to documentation
-	  examples.  [Fix GH-1189]
+Thu Sep  4 00:06:14 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Sat Jan  9 18:25:57 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* eval.c (mark_frame_adj): need to adjust argv pointer if using
+	  system's alloca. [ruby-core:01503]
 
-	* symbol.h (is_attrset_id): ASET is an attrset ID.  fix
-	  unexpected safe call instead of an ordinary ASET.
+Wed Sep  3 21:33:20 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
 
-Sat Jan  9 10:44:33 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* test: add test directory.  Test::Unit aware testcases and needed
+	  files should be located in this directory.  dir/file name convention;
+	    test/{module_name}/test_{testcase_name}.rb
+	    test/{module_name}/{needed_files}
+	  someday, someone will write testrunner which searches test_*.rb and
+	  run testcases automatically.
 
-	* configure.in, win32/setup.mak: extract RUBY_PROGRAM_VERSION from
-	  RUBY_VERSION in version.h instead of RUBY_API_VERSION numbers in
-	  include/ruby/version.h, and cut it into version numbers.
+	* test/csv/*: add testcase for lib/csv.rb.
 
-Sat Jan  9 07:13:33 2016  Koichi Sasada  <ko1@atdot.net>
+Wed Sep  3 01:37:09 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* gc.c: rename PAGE_* to HEAP_PAGE_* because PAGE_SIZE is used
-	  in Mac OS X.
+	* io.c (rb_f_gets): should call next_argv() before type check
+	  current_file. [ruby-list:38336]
 
-	* test/ruby/test_gc.rb: catch up this fix.
+Tue Sep  2 20:37:15 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
 
-Sat Jan  9 05:45:40 2016  Koichi Sasada  <ko1@atdot.net>
+	* ext/openssl/lib/net/protocols.rb (SSLIO#ssl_connect): warning
+	  for skipping server verification.
 
-	* gc.c: PAGE_BITMAP_PLANES (the number of bitmap) is 4, not 3.
+Tue Sep  2 23:36:57 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Sat Jan  9 05:42:57 2016  Koichi Sasada  <ko1@atdot.net>
+	* eval.c (proc_invoke): should retrieve retval when pcall is true.
 
-	* gc.c: rename constant names HEAP_* to PAGE_*.
+Tue Sep  2 14:09:20 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	  Keys of GC::INTERNAL_CONSTANTS are also renamed.
+	* ext/socket/extconf.rb: check s6_addr8 in in6_addr (Tru64 UNIX).
+	  the patch is submitted by nmu <nmu@users.sourceforge.jp>.
 
-	* test/ruby/test_gc.rb: catch up this fix.
+	* ext/socket/getaddrinfo.c (getaddrinfo): should use in6_addr8 on
+	  some platforms.
 
-Fri Jan  8 22:30:06 2016  Akinori MUSHA  <knu@iDaemons.org>
+	* ext/socket/getnameinfo.c (getnameinfo): ditto.
 
-	* doc/regexp.rdoc: [DOC] Elaborate on the \G anchor. [ci skip]
+Tue Sep  2 14:02:19 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
 
-Fri Jan  8 19:49:27 2016  Koichi Sasada  <ko1@atdot.net>
+	* ext/tcltklib/tcltklib.c (ip_invoke): fixed bug on passing a exception
 
-	* gc.c: remove heap_page::body. Instead of this field,
-	  heap_page::start field works well.
+	* ext/tk/lib/{tk.rb, tkcanvas.rb, tkfont.rb, tktext.rb} :
+	  bug fix and improvement of font control
 
-Fri Jan  8 19:31:52 2016  Koichi Sasada  <ko1@atdot.net>
+Tue Sep  2 09:51:36 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* gc.c: rename rb_heap_t::page_length to rb_heap_t::total_pages.
+	* eval.c (rb_eval): should not handle exceptions within rescue
+	  argument.  [ruby-talk:80804]
 
-	  `page_length' is not clear (we may understand with length of
-	  a page).
+Tue Sep  2 00:44:37 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Jan  8 17:07:14 2016  Koichi Sasada  <ko1@atdot.net>
+	* re.c (rb_memsearch): fix overrun.  [ruby-talk:80759]
 
-	* gc.c: remove heap_page::heap. This field is only used to recognize
-	  whether a page is in a tomb or not. Instead of this field,
-	  heap_page::flags::in_tomb (1 bit field) is added.
+Tue Sep  2 00:41:27 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	  Also type of heap_page::(total|free|final)_slots are changed from
-	  int to short. 2B is enough for them.
+	* ext/iconv/iconv.c (map_charset): use lower case keys.
 
-Fri Jan  8 09:33:59 2016  Shugo Maeda  <shugo@ruby-lang.org>
+	* ext/iconv/iconv.c (iconv_fail): just yield error and return the
+	  result if a block is given.
 
-	* iseq.c (rb_iseq_compile_with_option): move variable initialization
-	  code to avoid maybe-uninitialized warnings by gcc 4.8.
+	* ext/iconv/iconv.c (iconv_convert): yield error and append the
+	  result if a block is given.
 
-Fri Jan  8 00:03:22 2016  Shugo Maeda  <shugo@ruby-lang.org>
+	* ext/iconv/charset_alias.rb (charset_alias): optional third
+	  argument.
+
+	* ext/iconv/charset_alias.rb (charset_alias): use CP932 instead of
+	  SHIFT_JIS on cygwin.
+
+Mon Sep  1 18:34:25 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (rb_eval): make tail recursion in ELSE clause of
+	  RESCUE a jump.
+
+Mon Sep  1 18:00:02 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* parse.y (aref_args): forgot to call NEW_SPLAT(). reported by
+	  Dave Butcher.
+
+	* eval.c (Init_Thread): protect thgroup_default.  suggested by Guy
+	  Decoux in [ruby-talk:80623]
+
+Mon Sep  1 16:59:10 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* eval.c (rb_thread_switch): add RESTORE_EXIT; exit by another
+	  thread termination.
+
+	* eval.c (rb_thread_start_0): should not error_print() within
+	  terminated thread, because $stderr used by it might be
+	  overriden now.  [ruby-dev:21280]
+
+Sun Aug 31 22:46:55 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* eval.c (TAG_DST()): take no argument.
+
+	* process.c (p_gid_sw_ensure): return VALUE.
+
+Sun Aug 31 22:27:10 2003  Hidetoshi NAGAI  <nagai@dumbo.ai.kyutech.ac.jp>
+
+	* process.c (p_gid_sw_ensure): lack of function type
+
+Sun Aug 31 12:25:06 2003  Nobuyoshi Nakada  <nobu.nokada@softhome.net>
+
+	* lib/optparse.rb: --version takes an optional argument; "all" or
+	  a list of package names.
+
+Sun Aug 31 10:17:02 2003  Tadayoshi Funaba  <tadf@dotrb.org>
+
+	* lib/date/format.rb: yyyy/mm is not an acceptable format.
+
+	* lib/time.rb: follow above.
+
+Sat Aug 30 14:25:43 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (rb_iter_break): should not call TAG_JUMP directly.
+
+Sat Aug 30 03:58:21 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (struct BLOCK): remove BLOCKTAG, use scope instead.
+
+	* eval.c (POP_TAG): no longer propagate retval.  retval is now set
+	  directly by localjump_destination().
+
+	* eval.c (localjump_destination): new function to cast
+	  return/break local jump.
+
+	* eval.c (rb_yield_0): stop TAG_RETURN/TAG_BREAK escaping.
+
+Fri Aug 29 22:35:00 2003  Shigeo Kobayashi  <shigek@ruby-lang.org>
+
+	* bigdecimal.c *.html: The 2nd arg. for add,sub,mult, and div is 0,
+	  then result will be the same as +,-,*,/ respectively.
+
+Fri Aug 29 17:30:15 2003  Hidetoshi NAGAI  <nagai@ai.kyutech.ac.jp>
+
+	* process.c: bug fix
+
+	* process.c: add rb_secure(2) to methods of Process::{UID,GID,Sys}
+
+	* process.c: deny handling IDs during evaluating the block given to
+	  the Process::{UID,GID}.switch method
+
+	* ext/tcltklib/tcltklib.c : some methods have no effect if on slave-IP
+
+	* ext/tcltklib/tcltklib.c : can create a interpreter without Tk
+
+	* ext/tcltklib/tcltklib.c : bug fix on handling exceptions
+
+	* ext/tcltklib/MANUAL.euc : modify
+
+	* ext/tk/lib/tk.rb : freeze some core modules
+
+	* ext/tk/lib/multi-tk.rb : more secure
+
+	* ext/tk/lib/tk.rb: TkVariable.new(array) --> treat the array as the
+	  Tk's list
+
+	* ext/tk/lib/tk.rb: improve accessibility of TkVariable object
+
+	* ext/tk/lib/tk.rb, ext/tk/lib/tkfont.rb, ext/tk/lib/tkcanvas.rb,
+	  ext/tk/lib/tktext.rb : fix bug of font handling
+
+	* ext/tk/lib/tkfont.rb TkFont.new() accepts compound fonts
+
+Thu Aug 28 22:07:12 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* variable.c (rb_autoload_load): call const_missing if autoloading
+	  constant is not defined to allow hook.
+
+	* eval.c (rb_eval): use rb_const_get_from() instead of
+	  rb_const_get_at().
+
+	* eval.c (is_defined): forgot to check NODE_COLON3.
+
+Thu Aug 28 17:30:24 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* variable.c (rb_const_get_0): should check constants defined in
+	  included modules, if klass is Object. [ruby-talk:79302]
+
+	* numeric.c (check_uint): check should be done using UINT_MAX, not
+	  INT_MAX. this fix is submitted by Lyle Johnson
+	  <lyle@knology.net> in [ruby-core:01486]
+
+Thu Aug 28 05:02:52 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* parse.y (singleton): typo fixed (ruby-bugs-ja:PR#562)
+
+Thu Aug 28 02:37:45 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (rb_eval): *a = [1,2] now assigns [[1,2]] to a.
+	  consistent with *a = [1], which set [[1]] to a.
+
+	* node.h: merge NODE_RESTARY to NODE_SPLAT.
+
+	* parse.y: rules simplified a bit by removing NODE_RESTARY.
+
+	* sample/test.rb: updated for new assignment behavior.
+
+Wed Aug 27 22:33:24 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* error.c (rb_bug): should not use other methods; this function is
+	  not for ordinary use.  [ruby-dev:21259]
+
+Wed Aug 27 15:07:57 2003  Minero Aoki  <aamine@loveruby.net>
+
+	* lib/net/smtp.rb (check_response): AUTH CRAM-MD5 returns 334
+	  response. [ruby-list:38279]
+
+Wed Aug 27 05:10:15 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* win32/win32.c (map_errno): support winsock error.
+
+	* win32/win32.c (pipe_exec, CreateChild, poll_child_status, waitpid,
+	  kill, link, rb_w32_rename, unixtime_to_filetime, rb_w32_utime):
+	  pass errno to map_errno().
+
+	* win32/win32.c (rb_w32_select, rb_w32_accept, rb_w32_bind,
+	  rb_w32_connect, rb_w32_getpeername, rb_w32_getsockname,
+	  rb_w32_getsockopt, rb_w32_ioctlsocket, rb_w32_listen, rb_w32_recv,
+	  rb_w32_recvfrom, rb_w32_send, rb_w32_sendto, rb_w32_setsockopt,
+	  rb_w32_shutdown, rb_w32_socket, rb_w32_gethostbyaddr,
+	  rb_w32_gethostbyname, rb_w32_gethostname, rb_w32_getprotobyname,
+	  rb_w32_getprotobynumber, rb_w32_getservbyname, rb_w32_getservbyport,
+	  rb_w32_fclose, rb_w32_close): use map_errno().
+
+	* win32/win32.h: add winsock errors.
+
+Tue Aug 26 23:53:23 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* lib/ostruct.rb (OpenStruct::method_missing): prohibit modifying
+	  frozen OpenStruct. [ruby-talk:80214]
 
-	* enum.c (enum_min, enum_max): do the same optimization as r53454.
+Tue Aug 26 20:03:50 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Jan  7 22:32:21 2016  Kenta Murata  <mrkn@mrkn.jp>
+	* lib/mkmf.rb (create_tmpsrc): add the hook for source.
+	  [ruby-list:38122]
 
-	* ruby.h: undef HAVE_BUILTIN___BUILTIN_CHOOSE_EXPR_CONSTANT_P
-	  and HAVE_BUILTIN___BUILTIN_TYPES_COMPATIBLE_P on C++.
-	  [ruby-core:72736] [Bug #11962]
+Tue Aug 26 15:59:53 2003  why the lucky stiff  <why@ruby-lang.org>
 
-Thu Jan  7 22:02:21 2016  Shugo Maeda  <shugo@ruby-lang.org>
+	* implicit.c (syck_type_id_to_taguri): corrected detection of
+	  x-private types.
 
-	* enum.c (enum_minmax): optimize object comparison in
-	  Enumerable#minmax.
+Sun Aug 24 01:02:48 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Thu Jan  7 14:49:12 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* file.c (file_expand_path): performance improvement.
+	  [ruby-talk:79748]
 
-	* thread.c (rb_thread_pending_interrupt_p): no pending interrupt
-	  before initialization.
+Sat Aug 23 23:41:16 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* thread.c (thread_raise_m, rb_thread_kill): uninitialized thread
-	  cannot interrupt.  [ruby-core:72732] [Bug #11959]
+	* file.c (rb_file_s_expand_path): avoid calling rb_scan_args() for
+	  apparent cases. [ruby-talk:79748]
 
-Thu Jan  7 11:34:14 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Aug 23 18:56:53 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* include/ruby/backward.h (ruby_show_copyright_to_die): for source
-	  code backward compatibility.
+	* ext/nkf/nkf.c (rb_nkf_putchar): should use rb_str_resize() to just
+	  resize a string, rb_str_cat() disallows NULL.  [ruby-dev:21237]
 
-	* ruby.c (process_options): return Qtrue to exit the process
-	  successfully.
+Sat Aug 23 16:48:41 2003  Keiju Ishitsuka  <keiju@ishitsuka.com>
 
-	* version.c (ruby_show_copyright): no longer exit.
+	* lib/irb/ruby-lex.rb: bug fix for "foo" !~ /bar/. [ruby-talk:79942]
 
-Wed Jan  6 17:22:53 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sat Aug 23 15:59:58 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/optparse.rb (OptionParser#order!): add `into` optional
-	  keyword argument to store the results.  [Feature #11191]
+	* eval.c (rb_eval, rb_iterate, block_pass): reduce PUSH/POP_TAG and
+	  EXEC_TAG() for retry.  [ruby-dev:21216]
 
-Tue Jan  5 21:44:37 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+Sat Aug 23 02:32:33 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* ChangeLog: fix wrong class name.
+	* eval.c (rb_yield_splat): should check if "values" is array.
 
-Tue Jan  5 21:43:50 2016  Kuniaki IGARASHI  <igaiga@gmail.com>
+	* enum.c (each_with_index_i): typo.
 
-	* test/ruby/test_string.rb(test_chr): added test for String#chr
-	  [fix GH-1179]
+Fri Aug 22 17:07:05 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Tue Jan  5 21:32:26 2016  Kuniaki IGARASHI  <igaiga@gmail.com>
+	* enum.c (inject_i): use rb_yield_values.
 
-	* test/ruby/test_numeric.rb (test_nonzero_p): added test for Numeric#nonzero?
-	  [fix GH-1187]
+	* enum.c (each_with_index_i): ditto.
 
-Tue Jan  5 11:47:23 2016  Damir Gaynetdinov  <damir.gaynetdinov@gmail.com>
+	* eval.c (rb_yield_splat): new function to call "yield *values".
 
-	* doc/marshal.rdoc: Clarify object references example, that the
-	  reference is same object.  [Fix GH-1156]
+	* string.c (rb_str_scan): use rb_yield_splat().
 
-Tue Jan  5 05:06:51 2016  Eric Wong  <e@80x24.org>
+Fri Aug 22 06:13:22 2003  why the lucky stiff  <why@ruby-lang.org>
 
-	* ext/stringio/stringio.c (strio_binmode): implement to set encoding
-	* test/stringio/test_stringio.rb (test_binmode): new test
-	  [ruby-core:72699] [Bug #11945]
+	* ext/syck/rubyext.c: refactoring of the transfer method
+	  dispatch.  added yaml_org_handler for faster dispatch of
+	  transfers to base types.
 
-Mon Jan  4 15:44:37 2016  Sho Hashimoto  <sho-h@ruby-lang.org>
+	* lib/yaml/rubytypes.rb: removed handling of builtins from
+	  Ruby library.
 
-	* variable.c (rb_mod_deprecate_constant): [DOC] added
-	  documentation for Module#deprecate_constant. [ci skip]
+	* ext/syck/token.c: quoted and block scalars are now implicit !str
 
-Mon Jan  4 15:36:38 2016  Sho Hashimoto  <sho-h@ruby-lang.org>
+	* ext/syck/implicit.c: empty string detected as !null.
 
-	* thread_sync.c: [DOC] remove SizedQueue#close argument.
-	  [ci skip]
+Fri Aug 22 01:00:31 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Mon Jan  4 10:14:24 2016  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* eval.c (block_pass): improve passing current block.
 
-	* test/coverage/test_coverage.rb: ignored test when enabled to coverage.
-	  It lead to crash with `make test-all`.
+Fri Aug 22 00:13:00 2003  Shigeo Kobayashi  <shigek@ruby-lang.org>
 
-Mon Jan  4 08:10:44 2016  Yuichiro Kaneko  <yui-knk@ruby-lang.org>
+	* ext/bigdecimal/bigdecimal.c: Int. overflow bug in multiplication
+	  fixed, and VpNmlz() speed up.
 
-	* insns.def (opt_case_dispatch): Move a comment to the
-	  appropriate position.
-	  [ci skip]
+Wed Aug 20 16:44:49 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Jan  3 23:55:13 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/socket/socket.c (ruby_connect): many systems seem to have
+	  a problem in select() after EINPROGRESS.  [ruby-list:38080]
 
-	* lib/rubygems/security.rb (DIGEST_ALGORITHM, KEY_ALGORITHM):
-	  should check same name as the used constants.
-	  [ruby-core:72674] [Bug #11940]
+Wed Aug 20 01:31:17 2003  why the lucky stiff  <why@ruby-lang.org>
 
-Sun Jan  3 19:22:01 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/syck/syck.h: Parser definition problems on HP-UX.
+	  [ruby-talk:79389]
 
-	* aclocal.m4: add fallback file for non-aclocal environments.
-	  [ruby-core:72683] [Bug #11942]
+	* ext/syck/handler.c (syck_hdlr_get_anchor): Memory leak.
 
-Sun Jan  3 13:56:49 2016  Yuichiro Kaneko  <yui-knk@ruby-lang.org>
+	* ext/syck/syck.s (syck_io_file_read): Bad arguments to fread.
 
-	* eval_error.c (rb_print_undef): Use `rb_method_visibility_t`
-	  instead of `int`.
-	* eval_intern.h (rb_print_undef): ditto
-	* proc.c (mnew_internal): ditto
-	* vm_method.c (rb_export_method): ditto
-	  [Misc #11649] [ruby-core:71311] [fix GH-1078]
+	* ext/syck/rubyext.c: Tainting issues.
 
-Sun Jan  3 12:12:09 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Aug 19 23:20:00 2003  Shigeo Kobayashi  <shigek@ruby-lang.org>
 
-	* acinclude.m4: rename aclocal.m4, which should be generated by
-	  aclocal.  [ruby-core:72675] [Bug #11941]
+	* ext/bigdecimal/bigdecimal.c .h .html: to_s("+") implemented.
 
-Sat Jan  2 21:07:55 2016  Eric Wong  <e@80x24.org>
+	* ext/bigdecimal/lib/bigdecimal/math.rb: E implemented.
 
-	* thread_sync.c (queue_do_pop): avoid cast with Qfalse
-	  (rb_szqueue_push): ditto, use queue_sleep wrapper
+Tue Aug 19 07:47:09 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
 
-Sat Jan  2 16:16:14 2016  Masatoshi SEKI  <m_seki@mva.biglobe.ne.jp>
+	* lib/webrick/ssl.rb: new file; SSL/TLS enhancement for GenericServer.
 
-	* lib/erb.rb: Allow ERB subclass to add token easily.
-	  [Feature #11936]
+	* lib/webrick/https.rb: SSLSocket handling is moved to webrick/ssl.rb.
 
-	* test/erb/test_erb.rb: ditto.
+	* lib/webrick/compat.rb (File::fnmatch): remove old migration code.
 
-Sat Jan  2 14:44:31 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* lib/webrick/httpserver.rb (HTTPServer#run): ditto.
 
-	* parse.y (regexp): set_yylval_num sets u1, should use nd_tag
-	  instead of nd_state.  [ruby-core:72638] [Bug #11932]
+	* lib/webrick/server.rb (GenericServer#listen): the body of this
+	  method is pull out as Utils::create_lisnteners.
 
-Sat Jan  2 02:27:22 2016  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+	* lib/webrick/utils.rb (Utils::create_lisnteners): new method.
 
-	* lib/ostruct.rb: Fix case of frozen object with initializer.
-	  Bug revealed by RubySpec [ruby-core:72639]
+	* lib/webrick/server.rb (GenericServer#start): should rescue
+	  unknown errors. and refine comments.
 
-Fri Jan  1 22:01:52 2016  Kazuhiro NISHIYAMA  <zn@mbf.nifty.com>
+	* ext/openssl/lib/openssl/ssl.rb (SSLServer#accept): should close
+	  socket if SSLSocket raises error.
 
-	* NEWS: mention CSV's liberal_parsing option.
+Tue Aug 19 11:19:33 2003  Shugo Maeda  <shugo@ruby-lang.org>
 
-Fri Jan  1 19:38:23 2016  okkez  <okkez000@gmail.com>
+	* io.c (next_argv): should not call GetOpenFile() if rb_stdout is
+	  not a IO (T_FILE).
 
-	* doc/NEWS-2.3.0: fix double words typo.
-	  [ci skip][fix GH-1183]
+Tue Aug 19 07:47:09 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
 
-Fri Jan  1 15:28:56 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/openssl/ossl_ssl.c: sync_close is moved to SSLSocket as
+	  a builtin.
 
-	* compile.c (remove_unreachable_chunk): decrease count of
-	  call_info in removed instructions.  fix up r53402.
+	* ext/openssl/lib/openssl/buffering.rb (Buffering#close): ditto.
 
-Fri Jan  1 12:05:53 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/openssl/lib/openssl/buffering.rb (Buffering#puts): should
+	  add a return to the tails of each line.
 
-	* compile.c (remove_unreachable_chunk): remove unreferred label
-	  to optimize away unreachable chunk.
+	* ext/openssl/lib/openssl/ssl.rb: new class OpenSSL::SSL::SSLServer.
 
-Fri Jan  1 11:42:57 2016  James Edward Gray II  <james@graysoftinc.com>
+	* ext/openssl/lib/net/protocols.rb (SSLIO#ssl_connect): use sync_close.
 
-	* lib/csv.rb (CSV): Add a liberal_parsing option.
-	  Patch by Braden Anderson. [#11839]
-	* test/csv/test_features.rb:  test liberal_parsing
+	* ext/openssl/sample/echo_svr.rb: use SSLServer.
 
-Fri Jan  1 10:27:28 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/openssl/sample/echo_cli.rb: add example of SSLSocket#sync_close.
 
-	* tool/mkconfig.rb (RbConfig): prefix SDKROOT to oldincludedir
-	  not includedir, the latter is outside the ruby installation.
-	  [ruby-core:72496] [Bug #11881]
+Tue Aug 19 01:24:34 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Jan  1 08:53:02 2016  Yuki Kurihara  <co000ri@gmail.com>
+	* ext/curses/curses.c (_XOPEN_SOURCE_EXTENDED): Mac OS X standard
+	  headers are inconsistent at this macro.  [ruby-core:01432]
 
-	* test/ruby/test_lazy_enumerator.rb (test_take_bad_arg): Add test
-	  code in case of Enumerator::Lazy#take called with negative number.
-	  [ruby-dev:49467] [Bug #11933]
+	* ext/curses/extconf.rb: check if _XOPEN_SOURCE_EXTENDED breaks.
 
-Fri Jan  1 05:06:20 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* ext/tcltklib/stubs.c: Status macro in X11/Xthreads.h bothers
+	  winspool.h
 
-	* parse.y (parser_here_document): update indent for each line in
-	  indented here document with single-quotes.
-	  [ruby-core:72479] [Bug #11871]
+	* instruby.rb: make list at first instead of iterator.
+	  [ruby-talk:79347]
+
+Mon Aug 18 11:23:11 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* dir.c (glob_helper): preserve raw order for **.
+
+Sun Aug 17 23:39:55 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/openssl/extconf.rb (HAVE_VA_ARGS_MACRO): need to compile.
+
+Sun Aug 17 17:10:03 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
+
+	* ext/openssl/lib/openssl/ssl.rb (SSLSocket#sync_close=): add a
+	  method to specify if the underlying IO will be closed in
+	  SSLSocket#close.
+
+	* ext/openssl/lib/openssl/buffering.rb: add forwarders to
+	  setsockopt, getsockopt and fcntl.
+
+	* ext/openssl/lib/net/protocols.rb: enable sync for SSLSocket.
+
+Sun Aug 17 11:32:04 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/extmk.rb (extmake): should not force to remake Makefile when
+	  installation and so on.
+
+Sat Aug 16 23:58:18 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* marshal.c (w_symbol, w_object): get rid of warnings.
+
+	* re.c (rb_memsearch): ditto.
+
+	* time.c (time_dump): ditto.
+
+	* ext/extmk.rb (extmake): not continue making when extconf.rb
+	  failed.
+
+	* ext/openssl/extconf.rb: check __VA_ARGS__ macro more precisely.
+
+	* ext/openssl/ossl.h: remove version.h dependency.
+
+	* ext/openssl/ruby_missing.h: ditto.
+
+	* lib/mkmf.rb (pkg_config): use --libs output except with
+	  only-L for other options.  [ruby-list:38099]
+
+	* lib/mkmf.rb (create_makefile): separate rule for static
+	  library from shared object.
+
+	* win32/Makefile.sub, bcc32/Makefile.sub, wince/Makefile.sub:
+	  define exec_prefix and libdir.
+
+Fri Aug 15 23:15:00 2003  Shigeo Kobayashi  <shigek@ruby-lang.org>
+
+	* ext/bigdecimal/bigdecimal.c .h: Bug in combination of limit & div
+	  method fixed.
+
+	* ext/bigdecimal/lib/bigdecimal/math.rb: atan() & sqrt() added.
+
+Fri Aug 15 12:01:43 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* configure.in (HUGE_ST_INO): check whether struct stat.st_ino
+	  is larger than long.  [ruby-dev:21194]
+	  http://www.geocities.co.jp/SiliconValley-PaloAlto/1409/ruby/beos.html
+
+	* error.c (syserr_eqq): errno might exceed Fixnum limit.
+
+	* error.c (Init_Exception): moved base initialization from
+	  init_syserr().
+
+	* inits.c (rb_call_inits): postpone initializing errnos until
+	  Bignum is available.
+
+Fri Aug 15 12:01:43 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+
+	* ext/curses/curses.c (_XOPEN_SOURCE_EXTENDED): needed to let
+	  keyname() and so on be declared.
+
+	* ext/curses/curses.c (curses_resizeterm, window_resize):
+	  arguments conflicted with macros in term.h.
+
+	* ext/curses/curses.c (Curses module methods): ensure
+	  initialized.  [ruby-dev:21191]
+
+Fri Aug 15 02:08:53 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* gc.c (id2ref): recycle check should be done by klass == 0.
+	  [ruby-core:01408]
+
+Fri Aug 15 01:34:23 2003  Michal Rokos  <m.rokos@sh.cvut.cz>
+
+	* ext/openssl/ossl_pkey.c: move generate_cb here
+
+	* ext/openssl/ossl_pkey_{dh|dsa|rsa}.c: adapt to this cb
+
+	* ext/openssl/openssl_missing.[ch]: add (0.9.6x, x<j) missing BN funcs
+
+	* ext/openssl/ossl_bn.c: use supplied funcs from openssl_missing.c
+
+Fri Aug 15 00:38:00 2003  Shigeo Kobayashi  <shigek@ruby-lang.org>
+
+	* ext/bigdecimal/bigdecimal.c: Bug in div method fixed.
+
+	* ext/bigdecimal/lib/bigdecimal/math.rb: Newly added.
+
+	* ext/bigdecimal/sample/pi.rb: Changed so as to use math.rb.
+
+Thu Aug 14 21:19:14 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (Init_Thread): Continuation#[] added.  [ruby-talk:79028]
+
+Thu Aug 14 20:03:34 2003  Masaki Suketa  <masaki.suketa@nifty.ne.jp>
+
+	* ext/win32ole/win32ole.c (OLE_FREE): should not call
+	  ole_message_loop.
+
+	* ext/win32ole/win32ole.c (ole_event_free): ditto.
+
+	* ext/win32ole/win32ole.c (ole_initialize): stop calling
+	  OleUninitialize at exit.
+
+Thu Aug 14 11:27:37 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
+
+	* gc.c (rb_data_object_alloc): check type of 1st argument.
+	  [ruby-dev:21192]
+
+Thu Aug 14 00:21:14 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* parse.y (mlhs_node): should allow "::Foo" (colon3) as lhs.
+
+	* parse.y (lhs): ditto.
+
+	* parse.y (yylex): should return tCOLON3 right after kCLASS.
+	  [ruby-talk:78918]
+
+	* error.c (exc_initialize): was converting argument to string too
+	  eagerly.  Only check was needed. [ruby-talk:78958]
+
+Wed Aug 13 23:31:00 2003  Shigeo Kobayashi  <shigek@ruby-lang.org>
+
+	* ext/bigdecimal/bigdecimal.c .h .html: Ambiguity of
+	  BigDecimal::limit removed.
+
+Wed Aug 13 19:21:34 2003  Christian Neukirchen  <chneukirchen@yahoo.de>
+
+	* lib/webrick/https.rb (HTTPServer#run): should set syncing-mode
+	  to SSLSocket. [ruby-talk:78919]
+
+Wed Aug 13 18:13:49 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
+
+	* eval.c (POP_BLOCK): turn on BLOCK_LEFT flag when leaving block.
+
+	* eval.c (proc_invoke): unpack return/break destination when block
+	  is already left.
+
+Wed Aug 13 15:58:31 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
+
+	* object.c (rb_class_s_alloc): add function prototype to avoid VC++
+	  warning.
 
-Fri Jan  1 03:26:44 2016  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Aug 13 13:50:59 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-	* lib/ostruct.rb (freeze): define deferred accessors before
-	  freezing to get rid of an error when just reading frozen
-	  OpenStruct.
+	* ext/Win32API/Win32API.c (Win32API_initialize): should pass some
+	  class to first argument of Data_Wrap_Struct(). (ruby-bugs:PR#1109)
 
-Thu Dec 31 14:36:45 2015  Marc-Andre Lafortune  <ruby-core@marc-andre.ca>
+Tue Aug 12 16:55:11 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-	* lib/ostruct.rb: Fix new_ostruct_member to correctly avoid
-	  redefinition [#11901]
+	* Makefile.in: static link libraries to LIBRUBY_SO with static linked
+	  ext.  [ruby-dev:21157]
 
-Thu Dec 31 02:45:12 2015  NARUSE, Yui  <naruse@ruby-lang.org>
+	* ext/extmk.rb (extmake): sort extension library initialization order.
 
-	* test/ruby/test_module.rb (test_classpath): r53376 may change
-	  the order of m.constants.
-	  `make TESTS='-v ruby/test_class.rb ruby/test_module.rb' test-all`
-	  may fail after that.
-	  http://rubyci.s3.amazonaws.com/tk2-243-31075/ruby-trunk/log/20151230T164202Z.log.html.gz
+	* ext/extmk.rb (extmake): compact $extlibs.
 
-Thu Dec 31 02:20:00 2015  Benoit Daloze  <eregontp@gmail.com>
+Tue Aug 12 02:48:56 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* common.mk (help): Fix typo.
+	* eval.c (THREAD_SAVE_CONTEXT): should explicitly turn off the
+	  flag before calling getcontext(2).
 
-Wed Dec 30 20:53:09 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* eval.c (struct thread): add member to save backing store on
+	  IA64. (ruby-bugs PR1086)
 
-	* lib/net/http/responses.rb: Added new response class for 451 status code.
-	* lib/net/http.rb: documentation for HTTPUnavailableForLegalReasons
+	* eval.c (thread_mark): mark IA64 backing store region.
 
-Wed Dec 30 20:45:45 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* eval.c (thread_free): free saved IA64 backing store.
 
-	* lib/webrick/httpstatus.rb: Added HTTP 451 Status Code.
-	  [fix GH-1167] Patch by @MuhammetDilmac
-	  https://tools.ietf.org/html/draft-tbray-http-legally-restricted-status-00
+	* eval.c (rb_thread_save_context): save IA64 backing store as well.
 
-Wed Dec 30 20:25:52 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* eval.c (rb_thread_restore_context): restore IA64 backing store.
 
-	* doc/syntax/calling_methods.rdoc: fix old operator for safe navigation
-	  operator. [ci skip][fix GH-1182] Patch by @dougo
+	* eval.c (THREAD_ALLOC): initialize IA64 members.
 
-Wed Dec 30 16:43:23 2015  Kuniaki IGARASHI  <igaiga@gmail.com>
+Mon Aug 11 22:31:50 2003  NAKAMURA, Hiroshi  <nahi@ruby-lang.org>
+	* lib/debug.rb(debug_command): inspection command should inspect
+	  resulting value even if it's nil.  [ruby-dev:21180] by OMAE, jun
+	  <jun66j5@ybb.ne.jp>.
 
-	* test/ruby/test_string.rb (test_ord): Add test for String#ord.
-	  [Fix GH-1181]
+	* lib/debug.rb(debug_command): incomplete regexp.
 
-Wed Dec 30 11:28:57 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Mon Aug 11 17:33:07 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* lib/forwardable.rb (def_instance_delegator): adjust backtrace of
-	  method body by tail call optimization.  adjusting the delegated
-	  target is still done by deleting backtrace.
+	* eval.c (rb_call_super): do not use rb_block_given_p() for
+	  check. [ruby-talk:78656]
 
-	* lib/forwardable.rb (def_single_delegator): ditto.
+	* eval.c (BEGIN_CALLARGS): push ITER_NOT only when ITER_PRE.
 
-Wed Dec 30 11:18:42 2015  Elliot Winkler  <elliot.winkler@gmail.com>
+Sun Aug 10 10:43:05 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
 
-	* lib/forwardable.rb (def_instance_delegator) fix delegating to
-	  'args' and 'block', clashing with local variables in generated
-	  methods.  [ruby-core:72579] [Bug #11916]
+	* ext/openssl/lib/openssl/buffering.rb: increase BLOCK_SIZE
+	  from 1k to 16k bytes. [ruby-talk:78603]
 
-	* lib/forwardable.rb (def_single_delegator): ditto.
+	* ext/openssl/ossl_ssl.c (ossl_sslctx_s_alloc): enable
+	  partial write to allow interruption in SSLSocket#write.
 
-Wed Dec 30 09:58:56 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Sun Aug 10 00:34:16 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
 
-	* object.c (rb_class_inherited_p): search the corresponding
-	  ancestor to prepended module from prepending class itself.
-	  [ruby-core:72493] [Bug #11878]
+	* cygwin/GNUmakefile: remove unnecessary '--drive-name=$(CC)'
+	  for ccache.
 
-Wed Dec 30 09:20:00 2015  Yuki Kurihara  <co000ri@gmail.com>
+Sat Aug  9 10:36:21 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* test/stringio/test_io.rb (test_flag): add assertion for error when
-	  text and binary mode are mixed.
-	  [ruby-dev:49465] [Feature #11921]
+	* marshal.c (w_object): do not dump generic instance variable when
+	  marshal_dump is defined.
 
-Wed Dec 30 08:43:59 2015  Yuki Kurihara  <co000ri@gmail.com>
+Sat Aug  9 00:35:00 2003  Shigeo Kobayashi  <shigek@ruby-lang.org>
 
-	* test/stringio/test_stringio.rb (test_initialize): add test for
-	  StringIO#initialize.  [ruby-core:72585] [Feature #11920]
+	* ext/bigdecimal.c: F style output(like 1234.56789) implemented
+	  to to_s method.
+	* ext/bigdecimal_??.html: F style output(like 1234.56789)
+	  implemented to to_s method.
 
-Wed Dec 30 05:19:24 2015  Eric Wong  <e@80x24.org>
+Fri Aug  8 12:33:17 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
 
-	* class.c (struct clone_const_arg): adjust for id_table
-	  (clone_const): ditto
-	  (clone_const_i): ditto
-	  (rb_mod_init_copy): ditto
-	  (rb_singleton_class_clone_and_attach): ditto
-	  (rb_include_class_new): ditto
-	  (include_modules_at): ditto
-	* constant.h (rb_free_const_table): ditto
-	* gc.c (free_const_entry_i): ditto
-	  (rb_free_const_table): ditto
-	  (obj_memsize_of): ditto
-	  (mark_const_entry_i): ditto
-	  (mark_const_tbl): ditto
-	* internal.h (struct rb_classext_struct): ditto
-	* object.c (rb_mod_const_set): resolve class name on assignment
-	* variable.c (const_update): replace with const_tbl_update
-	  (const_tbl_update): new function
-	  (fc_i): adjust for id_table
-	  (find_class_path): ditto
-	  (autoload_const_set): st_update => const_tbl_update
-	  (rb_const_remove): adjust for id_table
-	  (sv_i): ditto
-	  (rb_local_constants_i): ditto
-	  (rb_local_constants): ditto
-	  (rb_mod_const_at): ditto
-	  (rb_mod_const_set): ditto
-	  (rb_const_lookup): ditto
-	  [ruby-core:72112] [Feature #11614]
+	* bcc32/Makefile.sub: rubyw.exe should be a Windows GUI program.
+	  add the -aa option to WLDFLAGS.
 
-Wed Dec 30 04:10:13 2015  CHIKANAGA Tomoyuki  <nagachika@ruby-lang.org>
+Fri Aug  8 11:29:26 2003  Koji Arai  <jca02266@nifty.ne.jp>
 
-	* thread_pthread.c (rb_thread_create_timer_thread): destroy attr even
-	  if pthread_create() failed.
+	* marshal.c (w_object): should set `c_arg' at first.
 
-Wed Dec 30 02:55:09 2015  Eric Wong  <e@80x24.org>
+Fri Aug  8 03:22:28 2003  GOTOU Yuuzou  <gotoyuzo@notwork.org>
 
-	* thread_pthread.c (setup_communication_pipe): delay setting owner
-	  (rb_thread_create_timer_thread): until thread creation succeeds
-	  [ruby-core:72590] [Bug #11922]
+	* lib/webrick/httputils.rb (FormData#list): should not take
+	  a side effect for the receiver.
 
-Tue Dec 29 19:12:46 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Thu Aug  7 14:40:37 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
 
-	* ruby.c (proc_options): -W command line option should be able to
-	  override -w in RUBYOPT environment variable.
+	* cygwin/GNUmakefile: better --disbale-shared option support.
 
-Tue Dec 29 17:54:16 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* cygwin/GNUmakefile: add forwarding DLL target for cygwin.
 
-	* eval.c (ignored_block): warn if a block is given to `using`,
-	  which is probably for `Module.new`.
+Thu Aug  7 14:21:05 2003  Corinna Vinschen  <vinschen@redhat.com>
 
-Tue Dec 29 12:48:34 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* configure.in: Fix Cygwin specific naming of libraries to
+	  be net distribution compliant. (ruby-bugs:PR#1077)
+	  cygwin-ruby18.dll -> cygruby18.dll
 
-	* lib/ostruct.rb (OpenStruct): make respond_to? working on
-	  just-allocated objects for workaround of Psych.
-	  [ruby-core:72501] [Bug #11884]
+Thu Aug  7 12:51:38 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Tue Dec 29 10:35:00 2015  Kenta Murata  <mrkn@mrkn.jp>
+	* eval.c (rb_f_at_exit): should not be called without a block.
+	  block_given check added.
 
-	* test/mkmf/test_have_func.rb (test_have_func):
-	  Add assertion to examine the existence of HAVE_RUBY_INIT.
+Thu Aug  7 06:46:06 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-	* test/mkmf/test_have_func.rb (test_not_have_func):
-	  Add assertion to examine the absence of HAVE_RUBY_INIT.
+	* eval.c (rb_call0): forgot to pop ruby_class.
 
-Tue Dec 29 06:50:42 2015  Eric Wong  <e@80x24.org>
+	* eval.c (rb_call0): update ruby_class as well as ruby_cref.
+	  (ruby-bugs-ja:PR#540)
 
-	* thread_sync.c: static classes
+Thu Aug  7 04:52:50 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Tue Dec 29 05:30:30 2015  Eric Wong  <e@80x24.org>
+	* eval.c (rb_yield_0): remove ruby_frame->cbase and unify to
+	  ruby_cref.  [ruby-talk:78141]
 
-	* lib/resolv.rb (Resolv::IPv6.create): avoid modifying frozen
-	* test/resolv/test_dns.rb (test_ipv6_create): test for above
-	  [Bug #11910] [ruby-core:72559]
+Thu Aug  7 04:19:15 2003  Akinori MUSHA  <knu@iDaemons.org>
 
-Mon Dec 28 14:55:57 2015  Kuniaki IGARASHI  <igaiga@gmail.com>
+	* gc.c: FreeBSD/ia64's mcontext_t is a bit different from that of
+	  Linux/ia64.  This makes gc.c compile but miniruby coredumps for
+	  the moment.
 
-	* test/ruby/test_string.rb (TestString#test_rstrip_bang): Add test
-	  for String#rstrip!.  [Fix GH-1176]
+Thu Aug  7 00:15:00 2003  Shigeo Kobayashi  <shigek@ruby-lang.org>
 
-Mon Dec 28 09:18:53 2015  Kuniaki IGARASHI  <igaiga@gmail.com>
+	* ext/bigdecimal.c: Comparison results adjusted to Float's.
+	* ext/bigdecimal.c: Use rb_num_coerce_????(x,y) instead of own.
 
-	* test/ruby/test_string.rb (TestString#test_lstrip_bang): Add test
-	  for String#lstrip!.  [Fix GH-1176]
+Wed Aug  6 22:58:00 2003  Nathaniel Talbott  <ntalbott@ruby-lang.org>
 
-Sun Dec 27 23:32:26 2015  Masaki Suketa <masaki.suketa@nifty.ne.jp>
+	* lib/test/unit/testcase.rb: Added equality checking.
+	* lib/test/unit/testsuite.rb: Added equality checking.
+	* lib/test/unit/assertions.rb: Fixed a warning.
 
-	* ext/win32ole/win32ole.c (ole_variant2val): refactoring.
+Wed Aug  6 17:28:10 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Sun Dec 27 21:14:42 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* ext/extmk.rb (extmake): pass LIBPATH to make ruby.  [ruby-dev:21137]
 
-	* process.c (rb_execarg_parent_start1): need to convert the encoding to
-	  ospath's one.
+	* ext/extmk.rb (extmake): set library name as source file name in
+	  Init_ext().  [ruby-dev:21137]
 
-Sun Dec 27 20:54:22 2015  NAKAMURA Usaku  <usa@ruby-lang.org>
+	* lib/mkmf.rb (Logging::postpone): postpone logging messages after
+	  heading message as the result of the block.
 
-	* process.c: use rb_w32_uchdir() instead of plain chdir() on Windows.
-	  reported by naruse via twitter.
+	* lib/mkmf.rb (macro_defined?): append newline to src unless ended
+	  with it.
 
-	* process.c (rb_execarg_addopt): need to convert the encoding to
-	  ospath's one.
+	* lib/mkmf.rb (have_library): treat nil function name as "main".
+	  (ruby-bugs:PR#1083)
 
-Sun Dec 27 20:00:31 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* lib/mkmf.rb (pkg_config): should append additional libraries to
+	  $libs but not $LIBS.  [ruby-dev:21137]
 
-	* enc/x_emoji.h: fix dead-link.
+	* ext/io/wait/extconf.rb: check DOSISH macro instead of platform.
 
-Sun Dec 27 19:55:55 2015  SHIBATA Hiroshi  <hsbt@ruby-lang.org>
+	* ext/digest/sha1/extconf.rb: have_library already appends library
+	  name.
 
-	* doc/NEWS-2.3.0: fix a typo.
+Wed Aug  6 17:23:57 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Sun Dec 27 18:08:15 2015  Kuniaki IGARASHI  <igaiga@gmail.com>
+	* eval.c: initialize /* OK */ variables by Qnil to stop warnings.
 
-	* string.c (rb_str_lstrip_bang, rb_str_rstrip_bang): [DOC] Fix
-	  ruby-doc comments for String#rstrip! and lstrip!.  It looks like
-	  dropped bang.  [Fix GH-1175]
+Wed Aug  6 04:58:32 2003  NAKAMURA Usaku  <usa@ruby-lang.org>
 
-Sun Dec 27 15:14:20 2015  Eric Wong  <e@80x24.org>
+	* ext/Setup*: add io/wait and openssl.
 
-	* io.c (io_getpartial): remove unused kwarg from template
-	* test/ruby/test_io.rb (test_readpartial_bad_args): new
-	  [Bug #11885]
+Wed Aug  6 01:13:38 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Sun Dec 27 11:50:53 2015  Kuniaki IGARASHI  <igaiga@gmail.com>
+	* eval.c (rb_f_autoload): use ruby_cbase instead of ruby_class.
 
-	* test/ruby/test_string.rb (test_rstrip, test_lstrip): Add tests
-	  for String#lstrip and rstrip.  The test cases are used from
-	  string.c ruby-doc comments.  [Fix GH-1174]
+	* eval.c (rb_f_autoload_p): ditto.
 
-Sun Dec 27 11:47:46 2015  Kuniaki IGARASHI  <igaiga@gmail.com>
+	* class.c (rb_mod_init_copy): no longer implements independent
+	  clone and dup methods.  override "initialize_copy" instead.
+	  [ruby-core:01352]
 
-	* test/ruby/test_string.rb (test_insert): Add test for
-	  String#insert.  The test cases are written in string.c
-	  comments as a reference.  [Fix GH-1173]
+	* object.c (rb_class_s_alloc): define Class allocation function.
+	  this makes Classes to follow clone framework that uses
+	  initialize_copy.
 
-Sun Dec 27 11:03:33 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* object.c (rb_class_initialize): separate instantiation and
+	  initialization.
 
-	* parse.y (show_bitstack): trace stack_type value if yydebug.
+	* object.c (rb_obj_alloc): prohibit instantiation from
+	  uninitialized class.
 
-Sun Dec 27 10:03:14 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+	* object.c (rb_class_superclass): check uninitialized class.
 
-	* enc/depend (enc, trans): fix version dependency, shared object
-	  files depend on the RUBY_SO_NAME value for runtime link.
+	* array.c (rb_ary_fill): wrong index processing with block.  this
+	  fix was done by Koji Arai <JCA02266@nifty.ne.jp> [ruby-list:38029]
 
-Sun Dec 27 09:47:20 2015  Masaki Suketa <masaki.suketa@nifty.ne.jp>
+	* marshal.c (w_object): should preserve generic ivar for nil,
+	  true, false, symbols, and fixnums.
 
-	* ext/win32ole/win32ole.c (ole_vstr2wc, ole_variant2val): fix blank
-	  string conversion.
-	  [Bug #11880]
-	  Thanks Akio Tajima for the patch!
+	* marshal.c (w_uclass): base_klass check should be done after
+	  rb_class_real().
 
-Sun Dec 27 09:34:53 2015  craft4coder  <yooobuntu@163.com>
+Wed Aug  6 01:18:50 2003  Minero Aoki  <aamine@loveruby.net>
 
-	* doc/extension.rdoc: [DOC] `nul` should be uppercase.
-	  change 'nul' => 'NUL'.  [Fix GH-1172]
+	* lib/net/http.rb: update document.
 
-Sat Dec 26 18:29:01 2015  Kouhei Sutou  <kou@cozmixng.org>
+	* lib/net/pop.rb: ditto.
 
-	* lib/xmlrpc/client.rb: Support SSL options in async methods of
-	  XMLRPC::Client.
-	  [Bug #11489]
-	  Reported by Aleksandar Kostadinov. Thanks!!!
+	* lib/net/protocol.rb: ditto.
 
-Sat Dec 26 11:26:38 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Wed Aug  6 00:48:37 2003  Koji Arai  <jca02266@nifty.ne.jp>
 
-	* miniinit.c (Init_enc): add some common aliases of built-in
-	  encodings.  [ruby-core:72481] [Bug #11872]
+	* marshal.c (w_object): should recommend marshal_dump rather than
+	  _dump_data.
 
-Fri Dec 25 22:43:26 2015  Nobuyoshi Nakada  <nobu@ruby-lang.org>
+Tue Aug  5 17:58:57 2003  WATANABE Hirofumi  <eban@ruby-lang.org>
 
-	* configure.in: extract RUBY_RELEASE_DAY at generating Makefile.
+	* lib/fileutils.rb (install): should preserve timestamp only.
 
-	* version.h (RUBY_RELEASE_DATE): construct from RUBY_RELEASE_YEAR,
-	  RUBY_RELEASE_MONTH, and RUBY_RELEASE_DAY.
+Tue Aug  5 17:31:59 2003  Ian Macdonald  <ian@caliban.org>
 
-Fri Dec 25 21:33:06 2015  Yukihiro Matsumoto  <matz@ruby-lang.org>
+	* lib/shell/command-processor.rb (Shell::CommandProcessor::rmdir):
+	  simple typo.
 
-	* version.h (RUBY_VERSION): 2.4.0 development has started.
+Tue Aug  5 15:47:34 2003  Nobuyoshi Nakada  <nobu@ruby-lang.org>
 
-Fri Dec 25 14:12:12 2015  Martin Duerst  <duerst@it.aoyama.ac.jp>
+	* eval.c (rb_load): should preserve current source file/line.
 
-	* doc/ChangeLog-2.3.0, ext/tk/lib/tkextlib/SUPPORT_STATUS,
-	  include/ruby/version.h: minor grammar fixes [ci skip]
+Tue Aug  5 10:04:42 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
-Fri Dec 25 08:23:22 2015  Tadashi Saito  <tad.a.digger@gmail.com>
+	* string.c (str_new4): ptr may refer null_str.
 
-	* compile.c, cont.c, doc, man: fix common misspelling.
-	  [ruby-core:72466] [Bug #11870]
+Mon Aug  4 17:25:18 2003  Yukihiro Matsumoto  <matz@ruby-lang.org>
 
+	* stable version 1.8.0 released.
 
-For the changes before 2.3.0, see doc/ChangeLog-2.3.0
-For the changes before 2.2.0, see doc/ChangeLog-2.2.0
-For the changes before 2.1.0, see doc/ChangeLog-2.1.0
-For the changes before 2.0.0, see doc/ChangeLog-2.0.0
-For the changes before 1.9.3, see doc/ChangeLog-1.9.3
 For the changes before 1.8.0, see doc/ChangeLog-1.8.0
 
 Local variables:
-coding: us-ascii
 add-log-time-format: (lambda ()
   (let* ((time (current-time))
-	 (system-time-locale "C")
 	 (diff (+ (cadr time) 32400))
 	 (lo (% diff 65536))
-	 (hi (+ (car time) (/ diff 65536))))
+	 (hi  (+ (car time) (/ diff 65536))))
   (format-time-string "%a %b %e %H:%M:%S %Y" (list hi lo) t)))
 indent-tabs-mode: t
 tab-width: 8
-change-log-indent-text: 2
 end:
-vim: tabstop=8 shiftwidth=2
diff --git a/GPL b/GPL
index d159169d10..5b6e7c66c2 100644
--- a/GPL
+++ b/GPL
@@ -1,12 +1,12 @@
-                    GNU GENERAL PUBLIC LICENSE
-                       Version 2, June 1991
+		    GNU GENERAL PUBLIC LICENSE
+		       Version 2, June 1991
 
- Copyright (C) 1989, 1991 Free Software Foundation, Inc.,
- 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA
+ Copyright (C) 1989, 1991 Free Software Foundation, Inc.
+                       59 Temple Place, Suite 330, Boston, MA  02111-1307  USA
  Everyone is permitted to copy and distribute verbatim copies
  of this license document, but changing it is not allowed.
 
-                            Preamble
+			    Preamble
 
   The licenses for most software are designed to take away your
 freedom to share and change it.  By contrast, the GNU General Public
@@ -15,7 +15,7 @@ software--to make sure the software is free for all its users.  This
 General Public License applies to most of the Free Software
 Foundation's software and to any other program whose authors commit to
 using it.  (Some other Free Software Foundation software is covered by
-the GNU Lesser General Public License instead.)  You can apply it to
+the GNU Library General Public License instead.)  You can apply it to
 your programs, too.
 
   When we speak of free software, we are referring to freedom, not
@@ -55,8 +55,8 @@ patent must be licensed for everyone's free use or not licensed at all.
 
   The precise terms and conditions for copying, distribution and
 modification follow.
-
-                    GNU GENERAL PUBLIC LICENSE
+
+		    GNU GENERAL PUBLIC LICENSE
    TERMS AND CONDITIONS FOR COPYING, DISTRIBUTION AND MODIFICATION
 
   0. This License applies to any program or other work which contains
@@ -110,7 +110,7 @@ above, provided that you also meet all of these conditions:
     License.  (Exception: if the Program itself is interactive but
     does not normally print such an announcement, your work based on
     the Program is not required to print an announcement.)
-
+
 These requirements apply to the modified work as a whole.  If
 identifiable sections of that work are not derived from the Program,
 and can be reasonably considered independent and separate works in
@@ -168,7 +168,7 @@ access to copy from a designated place, then offering equivalent
 access to copy the source code from the same place counts as
 distribution of the source code, even though third parties are not
 compelled to copy the source along with the object code.
-
+
   4. You may not copy, modify, sublicense, or distribute the Program
 except as expressly provided under this License.  Any attempt
 otherwise to copy, modify, sublicense or distribute the Program is
@@ -225,7 +225,7 @@ impose that choice.
 
 This section is intended to make thoroughly clear what is believed to
 be a consequence of the rest of this License.
-
+
   8. If the distribution and/or use of the Program is restricted in
 certain countries either by patents or by copyrighted interfaces, the
 original copyright holder who places the Program under this License
@@ -255,7 +255,7 @@ make exceptions for this.  Our decision will be guided by the two goals
 of preserving the free status of all derivatives of our free software and
 of promoting the sharing and reuse of software generally.
 
-                            NO WARRANTY
+			    NO WARRANTY
 
   11. BECAUSE THE PROGRAM IS LICENSED FREE OF CHARGE, THERE IS NO WARRANTY
 FOR THE PROGRAM, TO THE EXTENT PERMITTED BY APPLICABLE LAW.  EXCEPT WHEN
@@ -277,9 +277,9 @@ YOU OR THIRD PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER
 PROGRAMS), EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE
 POSSIBILITY OF SUCH DAMAGES.
 
-                     END OF TERMS AND CONDITIONS
-
-            How to Apply These Terms to Your New Programs
+		     END OF TERMS AND CONDITIONS
+
+	    How to Apply These Terms to Your New Programs
 
   If you develop a new program, and you want it to be of the greatest
 possible use to the public, the best way to achieve this is to make it
@@ -303,9 +303,10 @@ the "copyright" line and a pointer to where the full notice is found.
     MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
     GNU General Public License for more details.
 
-    You should have received a copy of the GNU General Public License along
-    with this program; if not, write to the Free Software Foundation, Inc.,
-    51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA.
+    You should have received a copy of the GNU General Public License
+    along with this program; if not, write to the Free Software
+    Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA  02111-1307  USA
+
 
 Also add information on how to contact you by electronic and paper mail.
 
@@ -335,5 +336,5 @@ necessary.  Here is a sample; alter the names:
 This General Public License does not permit incorporating your program into
 proprietary programs.  If your program is a subroutine library, you may
 consider it more useful to permit linking proprietary applications with the
-library.  If this is what you want to do, use the GNU Lesser General
+library.  If this is what you want to do, use the GNU Library General
 Public License instead of this License.
diff --git a/KNOWNBUGS.rb b/KNOWNBUGS.rb
deleted file mode 100644
index 35a8e75876..0000000000
--- a/KNOWNBUGS.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-#
-# IMPORTANT: Always keep the first 7 lines (comments),
-# even if this file is otherwise empty.
-#
-# This test file includes tests which point out known bugs.
-# So all tests will cause failure.
-#
diff --git a/LEGAL b/LEGAL
index cd1cce2de1..908eb270f5 100644
--- a/LEGAL
+++ b/LEGAL
@@ -5,158 +5,34 @@ All the files in this distribution are covered under either the Ruby's
 license (see the file COPYING) or public-domain except some files
 mentioned below.
 
-ccan/build_assert/build_assert.h
-ccan/check_type/check_type.h
-ccan/container_of/container_of.h
-ccan/str/str.h
-
-  These files are licensed under the CC0.
-
-    http://creativecommons.org/choose/zero/
-
-ccan/list/list.h
-
-  This file is licensed under the MIT License.
-
-    Permission is hereby granted, free of charge, to any person obtaining a copy
-    of this software and associated documentation files (the "Software"), to deal
-    in the Software without restriction, including without limitation the rights
-    to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
-    copies of the Software, and to permit persons to whom the Software is
-    furnished to do so, subject to the following conditions:
-
-    The above copyright notice and this permission notice shall be included in
-    all copies or substantial portions of the Software.
-
-    THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
-    IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
-    FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
-    AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
-    LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
-    OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN
-    THE SOFTWARE.
-
-include/ruby/oniguruma.h:
-regcomp.c:
-regenc.[ch]:
-regerror.c:
-regexec.c:
-regint.h:
-regparse.[ch]:
-enc/ascii.c
-enc/big5.c
-enc/cp949.c
-enc/emacs_mule.c
-enc/encdb.c
-enc/euc_jp.c
-enc/euc_kr.c
-enc/euc_tw.c
-enc/gb18030.c
-enc/gb2312.c
-enc/gbk.c
-enc/iso_8859_1.c
-enc/iso_8859_10.c
-enc/iso_8859_11.c
-enc/iso_8859_13.c
-enc/iso_8859_14.c
-enc/iso_8859_15.c
-enc/iso_8859_16.c
-enc/iso_8859_2.c
-enc/iso_8859_3.c
-enc/iso_8859_4.c
-enc/iso_8859_5.c
-enc/iso_8859_6.c
-enc/iso_8859_7.c
-enc/iso_8859_8.c
-enc/iso_8859_9.c
-enc/koi8_r.c
-enc/koi8_u.c
-enc/shift_jis.c
-enc/unicode.c
-enc/us_ascii.c
-enc/utf_16be.c
-enc/utf_16le.c
-enc/utf_32be.c
-enc/utf_32le.c
-enc/utf_8.c
-enc/windows_1251.c
-
-Oniguruma  ----   (C) K.Kosako <sndgk393 AT ybb DOT ne DOT jp>
-
-http://www.geocities.jp/kosako3/oniguruma/
-http://www.ruby-lang.org/cgi-bin/cvsweb.cgi/oniguruma/
-http://www.freebsd.org/cgi/cvsweb.cgi/ports/devel/oniguruma/
-
-   When this software is partly used or it is distributed with Ruby,
-   this of Ruby follows the license of Ruby.
-
-enc/trans/GB/GB12345%UCS.src:
-enc/trans/GB/UCS%GB12345.src:
-
-    Copyright (c) 1991-1994 Unicode, Inc.  All Rights reserved.
-
-    This file is provided as-is by Unicode, Inc. (The Unicode Consortium).
-    No claims are made as to fitness for any particular purpose.  No
-    warranties of any kind are expressed or implied.  The recipient
-    agrees to determine applicability of information provided.  If this
-    file has been provided on magnetic media by Unicode, Inc., the sole
-    remedy for any claim will be exchange of defective media within 90
-    days of receipt.
-
-    Recipient is granted the right to make copies in any form for
-    internal distribution and to freely use the information supplied
-    in the creation of products supporting Unicode.  Unicode, Inc.
-    specifically excludes the right to re-distribute this file directly
-    to third parties or other organizations whether for profit or not.
-
-
-enc/trans/GB/GB2312%UCS.src:
-enc/trans/GB/UCS%GB2312.src:
-
-    Copyright (c) 1991-1999 Unicode, Inc.  All Rights reserved.
-
-    This file is provided as-is by Unicode, Inc. (The Unicode Consortium).
-    No claims are made as to fitness for any particular purpose.  No
-    warranties of any kind are expressed or implied.  The recipient
-    agrees to determine applicability of information provided.  If this
-    file has been provided on optical media by Unicode, Inc., the sole
-    remedy for any claim will be exchange of defective media within 90
-    days of receipt.
-
-    Unicode, Inc. hereby grants the right to freely use the information
-    supplied in this file in the creation of products supporting the
-    Unicode Standard, and to make copies of this file in any form for
-    internal or external distribution as long as this notice remains
-    attached.
-
-enc/trans/JIS/JISX0201-KANA%UCS.src:
-enc/trans/JIS/JISX0208@1990%UCS.src:
-enc/trans/JIS/JISX0212%UCS.src:
-enc/trans/JIS/UCS%JISX0201-KANA.src:
-enc/trans/JIS/UCS%JISX0208@1990.src:
-enc/trans/JIS/UCS%JISX0212.src:
-
-    © 2015 Unicode®, Inc.
-    For terms of use, see http://www.unicode.org/terms_of_use.html
-
-enc/trans/JIS/JISX0213-1%UCS@BMP.src:
-enc/trans/JIS/JISX0213-1%UCS@SIP.src:
-enc/trans/JIS/JISX0213-2%UCS@BMP.src:
-enc/trans/JIS/JISX0213-2%UCS@SIP.src:
-
- 	Copyright (C) 2001 earthian@tama.or.jp, All Rights Reserved.
- 	Copyright (C) 2001 I'O, All Rights Reserved.
- 	Copyright (C) 2006 Project X0213, All Rights Reserved.
- 	You can use, modify, distribute this table freely.
-
-enc/trans/JIS/UCS@BMP%JISX0213-1.src:
-enc/trans/JIS/UCS@BMP%JISX0213-2.src:
-enc/trans/JIS/UCS@SIP%JISX0213-1.src:
-enc/trans/JIS/UCS@SIP%JISX0213-2.src:
-
- 	Copyright (C) 2001 earthian@tama.or.jp, All Rights Reserved.
- 	Copyright (C) 2001 I'O, All Rights Reserved.
- 	You can use, modify, distribute this table freely.
+regex.[ch]:
+
+  These files are under LGPL.  Treat them as LGPL says. (See the file
+  LGPL for details)
+
+    Extended regular expression matching and search library.
+    Copyright (C) 1993, 94, 95, 96, 97, 98 Free Software Foundation, Inc.
+
+    The GNU C Library is free software; you can redistribute it and/or
+    modify it under the terms of the GNU Library General Public License as
+    published by the Free Software Foundation; either version 2 of the
+    License, or (at your option) any later version.
+
+    The GNU C Library is distributed in the hope that it will be useful,
+    but WITHOUT ANY WARRANTY; without even the implied warranty of
+    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the GNU
+    Library General Public License for more details.
+
+    You should have received a copy of the GNU Library General Public
+    License along with the GNU C Library; see the file LGPL.  If not,
+    write to the Free Software Foundation, Inc., 59 Temple Place - Suite 330,
+    Boston, MA 02111-1307, USA.  */
+
+    Multi-byte extension added May, 1993 by t^2 (Takahiro Tanimoto)
+    Last change: May 21, 1993 by t^2
+    removed gapped buffer support, multiple syntax support by matz <matz@nts.co.jp>
+    Perl5 extension added by matz <matz@caelum.co.jp>
+    UTF-8 extension added Jan 16 1999 by Yoshida Masato  <yoshidam@tau.bekkoame.ne.jp>
 
 configure:
 
@@ -167,8 +43,9 @@ configure:
     This configure script is free software; the Free Software Foundation
     gives unlimited permission to copy, distribute and modify it.
 
-tool/config.guess:
-tool/config.sub:
+config.guess:
+config.sub:
+parse.c:
 
   As long as you distribute these files with the file configure, they
   are covered under the Ruby's license.
@@ -195,58 +72,7 @@ tool/config.sub:
     configuration script generated by Autoconf, you may include it under
     the same distribution terms that you use for the rest of that program.
 
-parse.c:
-
-  This file is licensed under the GPL, but is incorporated into Ruby and
-  redistributed under the terms of the Ruby license, as permitted by the
-  exception to the GPL below.
-
-     Copyright (C) 1984, 1989, 1990, 2000, 2001, 2002, 2003, 2004, 2005, 2006
-     Free Software Foundation, Inc.
-
-     This program is free software; you can redistribute it and/or modify
-     it under the terms of the GNU General Public License as published by
-     the Free Software Foundation; either version 2, or (at your option)
-     any later version.
-
-     This program is distributed in the hope that it will be useful,
-     but WITHOUT ANY WARRANTY; without even the implied warranty of
-     MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
-     GNU General Public License for more details.
-
-     You should have received a copy of the GNU General Public License
-     along with this program; if not, write to the Free Software
-     Foundation, Inc., 51 Franklin Street, Fifth Floor,
-     Boston, MA 02110-1301, USA.  */
-
-  /* As a special exception, you may create a larger work that contains
-     part or all of the Bison parser skeleton and distribute that work
-     under terms of your choice, so long as that work isn't itself a
-     parser generator using the skeleton or a modified version thereof
-     as a parser skeleton.  Alternatively, if you modify or redistribute
-     the parser skeleton itself, you may (at your option) remove this
-     special exception, which will cause the skeleton and the resulting
-     Bison output files to be licensed under the GNU General Public
-     License without this special exception.
-
-     This special exception was added by the Free Software Foundation in
-     version 2.2 of Bison.  */
-
 util.c (partly):
-
-    Copyright (c) 1991, 2000, 2001 by Lucent Technologies.
-
-    Permission to use, copy, modify, and distribute this software for any
-    purpose without fee is hereby granted, provided that this entire notice
-    is included in all copies of any software which is or includes a copy
-    or modification of this software and in all copies of the supporting
-    documentation for such software.
-
-    THIS SOFTWARE IS BEING PROVIDED "AS IS", WITHOUT ANY EXPRESS OR IMPLIED
-    WARRANTY.  IN PARTICULAR, NEITHER THE AUTHOR NOR LUCENT MAKES ANY
-    REPRESENTATION OR WARRANTY OF ANY KIND CONCERNING THE MERCHANTABILITY
-    OF THIS SOFTWARE OR ITS FITNESS FOR ANY PARTICULAR PURPOSE.
-
 win32/win32.[ch]:
 
   You can apply the Artistic License to these files. (or GPL,
@@ -257,32 +83,6 @@ win32/win32.[ch]:
     You may distribute under the terms of either the GNU General Public
     License or the Artistic License, as specified in the perl README file.
 
-util.c (partly):
-
-   Copyright (c) 2004-2008 David Schultz <das@FreeBSD.ORG>
-   All rights reserved.
-
-   Redistribution and use in source and binary forms, with or without
-   modification, are permitted provided that the following conditions
-   are met:
-   1. Redistributions of source code must retain the above copyright
-      notice, this list of conditions and the following disclaimer.
-   2. Redistributions in binary form must reproduce the above copyright
-      notice, this list of conditions and the following disclaimer in the
-      documentation and/or other materials provided with the distribution.
-
-   THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
-   ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
-   IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
-   ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
-   FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
-   DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
-   OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
-   HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
-   LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
-   OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
-   SUCH DAMAGE.
-
 random.c
 
   This file is under the new-style BSD license.
@@ -292,11 +92,11 @@ random.c
     This is a faster version by taking Shawn Cokus's optimization,
     Matthe Bellew's simplification, Isaku Wada's real version.
 
-    Before using, initialize the state by using init_genrand(seed)
+    Before using, initialize the state by using init_genrand(seed) 
     or init_by_array(init_key, key_length).
 
     Copyright (C) 1997 - 2002, Makoto Matsumoto and Takuji Nishimura,
-    All rights reserved.
+    All rights reserved.                          
 
     Redistribution and use in source and binary forms, with or without
     modification, are permitted provided that the following conditions
@@ -309,8 +109,8 @@ random.c
 	 notice, this list of conditions and the following disclaimer in the
 	 documentation and/or other materials provided with the distribution.
 
-      3. The names of its contributors may not be used to endorse or promote
-	 products derived from this software without specific prior written
+      3. The names of its contributors may not be used to endorse or promote 
+	 products derived from this software without specific prior written 
 	 permission.
 
     THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS
@@ -330,146 +130,72 @@ random.c
     http://www.math.keio.ac.jp/matumoto/emt.html
     email: matumoto@math.keio.ac.jp
 
-vm_dump.c:procstat_vm
-
-  This file is under the new-style BSD license.
-
-    Copyright (c) 2007 Robert N. M. Watson
-    All rights reserved.
-
-    Redistribution and use in source and binary forms, with or without
-    modification, are permitted provided that the following conditions
-    are met:
-    1. Redistributions of source code must retain the above copyright
-       notice, this list of conditions and the following disclaimer.
-    2. Redistributions in binary form must reproduce the above copyright
-       notice, this list of conditions and the following disclaimer in the
-       documentation and/or other materials provided with the distribution.
-
-    THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
-    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
-    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
-    ARE DISCLAIMED.  IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
-    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
-    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
-    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
-    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
-    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
-    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
-    SUCH DAMAGE.
-
-    $FreeBSD: head/usr.bin/procstat/procstat_vm.c 261780 2014-02-11 21:57:37Z jhb $
-
-vsnprintf.c:
-
-  This file is under the old-style BSD license.  Note that the
-  paragraph 3 below is now null and void.
-
-    Copyright (c) 1990, 1993
-         The Regents of the University of California.  All rights reserved.
-
-    This code is derived from software contributed to Berkeley by
-    Chris Torek.
-
-    Redistribution and use in source and binary forms, with or without
-    modification, are permitted provided that the following conditions
-    are met:
-    1. Redistributions of source code must retain the above copyright
-       notice, this list of conditions and the following disclaimer.
-    2. Redistributions in binary form must reproduce the above copyright
-       notice, this list of conditions and the following disclaimer in the
-       documentation and/or other materials provided with the distribution.
-    3. Neither the name of the University nor the names of its contributors
-       may be used to endorse or promote products derived from this software
-       without specific prior written permission.
-
-    THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
-    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
-    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
-    ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
-    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
-    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
-    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
-    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
-    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
-    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
-    SUCH DAMAGE.
-
-    IMPORTANT NOTE:
-    --------------
-    From ftp://ftp.cs.berkeley.edu/pub/4bsd/README.Impt.License.Change
-    paragraph 3 above is now null and void.
-
-st.c:
-strftime.c:
-include/ruby/st.h:
-missing/acosh.c:
+st.[ch]:
+x68/*:
 missing/alloca.c:
 missing/dup2.c:
-missing/erf.c:
 missing/finite.c:
 missing/hypot.c:
 missing/isinf.c:
 missing/isnan.c:
-missing/lgamma_r.c:
 missing/memcmp.c:
 missing/memmove.c:
+missing/strcasecmp.c:
 missing/strchr.c:
-missing/strerror.c:
+missing/streror.c:
+missing/strftime.c:
+missing/strncasecmp.c:
 missing/strstr.c:
 missing/strtol.c:
-missing/tgamma.c:
-ext/date/date_strftime.c:
 ext/digest/sha1/sha1.[ch]:
-ext/sdbm/_sdbm.c:
-ext/sdbm/sdbm.h:
 
   These files are all under public domain.
 
-missing/crypt.c:
+missing/strtod.c:
 
-  This file is under the old-style BSD license.  Note that the
-  paragraph 3 below is now null and void.
+  This file will not be used on most platforms depending on how the
+  configure script results.  In any case you must not receive any fee
+  with the file itself.
 
-    Copyright (c) 1989, 1993
-    	The Regents of the University of California.  All rights reserved.
+    Copyright (c) 1988-1993 The Regents of the University of California.
+    Copyright (c) 1994 Sun Microsystems, Inc.
 
-    This code is derived from software contributed to Berkeley by
-    Tom Truscott.
+    Permission to use, copy, modify, and distribute this
+    software and its documentation for any purpose and without
+    fee is hereby granted, provided that the above copyright
+    notice appear in all copies.  The University of California
+    makes no representations about the suitability of this
+    software for any purpose.  It is provided "as is" without
+    express or implied warranty.
 
-    Redistribution and use in source and binary forms, with or without
-    modification, are permitted provided that the following conditions
-    are met:
-    1. Redistributions of source code must retain the above copyright
-       notice, this list of conditions and the following disclaimer.
-    2. Redistributions in binary form must reproduce the above copyright
-       notice, this list of conditions and the following disclaimer in the
-       documentation and/or other materials provided with the distribution.
-    3. Neither the name of the University nor the names of its contributors
-       may be used to endorse or promote products derived from this software
-       without specific prior written permission.
+missing/strtoul.c:
 
-    THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
-    ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
-    IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
-    ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
-    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
-    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
-    OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
-    HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
-    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
-    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
-    SUCH DAMAGE.
+  This file will not be used on most platforms depending on how the
+  configure script results.  In any case you must not receive any fee
+  with the file itself.
+
+    Copyright 1988 Regents of the University of California
 
-missing/setproctitle.c
+    Permission to use, copy, modify, and distribute this
+    software and its documentation for any purpose and without
+    fee is hereby granted, provided that the above copyright
+    notice appear in all copies.  The University of California
+    makes no representations about the suitability of this
+    software for any purpose.  It is provided "as is" without
+    express or implied warranty.
+
+missing/erf.c:
+missing/crypt.c:
+missing/vsnprintf.c:
 
   This file is under the old-style BSD license.  Note that the
   paragraph 3 below is now null and void.
 
-    Copyright 2003 Damien Miller
-    Copyright (c) 1983, 1995-1997 Eric P. Allman
-    Copyright (c) 1988, 1993
-    	The Regents of the University of California.  All rights reserved.
+    Copyright (c) 1990, 1993
+         The Regents of the University of California.  All rights reserved.
+
+    This code is derived from software contributed to Berkeley by
+    Chris Torek.
 
     Redistribution and use in source and binary forms, with or without
     modification, are permitted provided that the following conditions
@@ -495,35 +221,10 @@ missing/setproctitle.c
     OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
     SUCH DAMAGE.
 
-missing/strlcat.c
-missing/strlcpy.c
-
-  These files are under an ISC-style license.
-
-    Copyright (c) 1998, 2015 Todd C. Miller <Todd.Miller@courtesan.com>
-
-    Permission to use, copy, modify, and distribute this software for any
-    purpose with or without fee is hereby granted, provided that the above
-    copyright notice and this permission notice appear in all copies.
-
-    THE SOFTWARE IS PROVIDED "AS IS" AND THE AUTHOR DISCLAIMS ALL WARRANTIES
-    WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF
-    MERCHANTABILITY AND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR
-    ANY SPECIAL, DIRECT, INDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES
-    WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, WHETHER IN AN
-    ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF
-    OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE.
-
-missing/langinfo.c
-
-  This file is from http://www.cl.cam.ac.uk/~mgk25/ucs/langinfo.c.
-  Ruby uses a modified version. The file contains the following
-  author/copyright notice:
-
-  Markus.Kuhn@cl.cam.ac.uk -- 2002-03-11
-  Permission to use, copy, modify, and distribute this software
-  for any purpose and without fee is hereby granted. The author
-  disclaims all warranties with regard to this software.
+    IMPORTANT NOTE:
+    --------------
+    From ftp://ftp.cs.berkeley.edu/pub/4bsd/README.Impt.License.Change
+    paragraph 3 above is now null and void.
 
 ext/digest/md5/md5.[ch]:
 
@@ -563,7 +264,18 @@ ext/digest/rmd160/rmd160.[ch]:
     Copyright (c) Katholieke Universiteit Leuven
     1996, All Rights Reserved
 
+ext/digest/rmd160/rmd160hl.c:
+ext/digest/sha1/sha1hl.c:
+
+  These files are under the beer-ware license.
+
+    "THE BEER-WARE LICENSE" (Revision 42):
+    <phk@login.dkuug.dk> wrote this file.  As long as you retain this notice you
+    can do whatever you want with this stuff. If we meet some day, and you think
+    this stuff is worth it, you can buy me a beer in return.   Poul-Henning Kamp
+
 ext/digest/sha2/sha2.[ch]:
+ext/digest/sha2/sha2hl.c:
 
   These files are under the new-style BSD license.
 
@@ -593,28 +305,6 @@ ext/digest/sha2/sha2.[ch]:
     OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
     SUCH DAMAGE.
 
-ext/json/generator/generator.c:
-
-    Copyright 2001-2004 Unicode, Inc.
-
-    Disclaimer
-
-    This source code is provided as is by Unicode, Inc. No claims are
-    made as to fitness for any particular purpose. No warranties of any
-    kind are expressed or implied. The recipient agrees to determine
-    applicability of information provided. If this file has been
-    purchased on magnetic or optical media from Unicode, Inc., the
-    sole remedy for any claim will be exchange of defective media
-    within 90 days of receipt.
-
-    Limitations on Rights to Redistribute This Code
-
-    Unicode, Inc. hereby grants the right to freely use the information
-    supplied in this file in the creation of products supporting the
-    Unicode Standard, and to make copies of this file in any form
-    for internal or external distribution as long as this notice
-    remains attached.
-
 ext/nkf/nkf-utf8/config.h:
 ext/nkf/nkf-utf8/nkf.c:
 ext/nkf/nkf-utf8/utf8tbl.c:
@@ -623,7 +313,7 @@ ext/nkf/nkf-utf8/utf8tbl.c:
   copyrighted semi-public-domain software.
 
     Copyright (C) 1987, Fujitsu LTD. (Itaru ICHIKAWA)
-       Everyone is permitted to do anything on this program
+       Everyone is permitted to do anything on this program 
        including copying, modifying, improving,
        as long as you don't try to pretend that you wrote it.
        i.e., the above copyright notice has to appear in all copies.
@@ -674,13 +364,7 @@ ext/win32ole/win32ole.c:
 
     Other modifications Copyright (c) 1997, 1998 by Gurusamy Sarathy
     <gsar@umich.edu> and Jan Dubois <jan.dubois@ibm.net>
-
+ 
     You may distribute under the terms of either the GNU General Public
     License or the Artistic License, as specified in the README file
     of the Perl distribution.
-
-lib/rdoc/generator/template/darkfish/css/fonts.css:
-
-  This file is licensed under the SIL Open Font License.
-
-    http://scripts.sil.org/OFL
diff --git a/LGPL b/LGPL
new file mode 100644
index 0000000000..b1e3f5a263
--- /dev/null
+++ b/LGPL
@@ -0,0 +1,504 @@
+		  GNU LESSER GENERAL PUBLIC LICENSE
+		       Version 2.1, February 1999
+
+ Copyright (C) 1991, 1999 Free Software Foundation, Inc.
+     59 Temple Place, Suite 330, Boston, MA  02111-1307  USA
+ Everyone is permitted to copy and distribute verbatim copies
+ of this license document, but changing it is not allowed.
+
+[This is the first released version of the Lesser GPL.  It also counts
+ as the successor of the GNU Library Public License, version 2, hence
+ the version number 2.1.]
+
+			    Preamble
+
+  The licenses for most software are designed to take away your
+freedom to share and change it.  By contrast, the GNU General Public
+Licenses are intended to guarantee your freedom to share and change
+free software--to make sure the software is free for all its users.
+
+  This license, the Lesser General Public License, applies to some
+specially designated software packages--typically libraries--of the
+Free Software Foundation and other authors who decide to use it.  You
+can use it too, but we suggest you first think carefully about whether
+this license or the ordinary General Public License is the better
+strategy to use in any particular case, based on the explanations below.
+
+  When we speak of free software, we are referring to freedom of use,
+not price.  Our General Public Licenses are designed to make sure that
+you have the freedom to distribute copies of free software (and charge
+for this service if you wish); that you receive source code or can get
+it if you want it; that you can change the software and use pieces of
+it in new free programs; and that you are informed that you can do
+these things.
+
+  To protect your rights, we need to make restrictions that forbid
+distributors to deny you these rights or to ask you to surrender these
+rights.  These restrictions translate to certain responsibilities for
+you if you distribute copies of the library or if you modify it.
+
+  For example, if you distribute copies of the library, whether gratis
+or for a fee, you must give the recipients all the rights that we gave
+you.  You must make sure that they, too, receive or can get the source
+code.  If you link other code with the library, you must provide
+complete object files to the recipients, so that they can relink them
+with the library after making changes to the library and recompiling
+it.  And you must show them these terms so they know their rights.
+
+  We protect your rights with a two-step method: (1) we copyright the
+library, and (2) we offer you this license, which gives you legal
+permission to copy, distribute and/or modify the library.
+
+  To protect each distributor, we want to make it very clear that
+there is no warranty for the free library.  Also, if the library is
+modified by someone else and passed on, the recipients should know
+that what they have is not the original version, so that the original
+author's reputation will not be affected by problems that might be
+introduced by others.
+
+  Finally, software patents pose a constant threat to the existence of
+any free program.  We wish to make sure that a company cannot
+effectively restrict the users of a free program by obtaining a
+restrictive license from a patent holder.  Therefore, we insist that
+any patent license obtained for a version of the library must be
+consistent with the full freedom of use specified in this license.
+
+  Most GNU software, including some libraries, is covered by the
+ordinary GNU General Public License.  This license, the GNU Lesser
+General Public License, applies to certain designated libraries, and
+is quite different from the ordinary General Public License.  We use
+this license for certain libraries in order to permit linking those
+libraries into non-free programs.
+
+  When a program is linked with a library, whether statically or using
+a shared library, the combination of the two is legally speaking a
+combined work, a derivative of the original library.  The ordinary
+General Public License therefore permits such linking only if the
+entire combination fits its criteria of freedom.  The Lesser General
+Public License permits more lax criteria for linking other code with
+the library.
+
+  We call this license the "Lesser" General Public License because it
+does Less to protect the user's freedom than the ordinary General
+Public License.  It also provides other free software developers Less
+of an advantage over competing non-free programs.  These disadvantages
+are the reason we use the ordinary General Public License for many
+libraries.  However, the Lesser license provides advantages in certain
+special circumstances.
+
+  For example, on rare occasions, there may be a special need to
+encourage the widest possible use of a certain library, so that it becomes
+a de-facto standard.  To achieve this, non-free programs must be
+allowed to use the library.  A more frequent case is that a free
+library does the same job as widely used non-free libraries.  In this
+case, there is little to gain by limiting the free library to free
+software only, so we use the Lesser General Public License.
+
+  In other cases, permission to use a particular library in non-free
+programs enables a greater number of people to use a large body of
+free software.  For example, permission to use the GNU C Library in
+non-free programs enables many more people to use the whole GNU
+operating system, as well as its variant, the GNU/Linux operating
+system.
+
+  Although the Lesser General Public License is Less protective of the
+users' freedom, it does ensure that the user of a program that is
+linked with the Library has the freedom and the wherewithal to run
+that program using a modified version of the Library.
+
+  The precise terms and conditions for copying, distribution and
+modification follow.  Pay close attention to the difference between a
+"work based on the library" and a "work that uses the library".  The
+former contains code derived from the library, whereas the latter must
+be combined with the library in order to run.
+
+		  GNU LESSER GENERAL PUBLIC LICENSE
+   TERMS AND CONDITIONS FOR COPYING, DISTRIBUTION AND MODIFICATION
+
+  0. This License Agreement applies to any software library or other
+program which contains a notice placed by the copyright holder or
+other authorized party saying it may be distributed under the terms of
+this Lesser General Public License (also called "this License").
+Each licensee is addressed as "you".
+
+  A "library" means a collection of software functions and/or data
+prepared so as to be conveniently linked with application programs
+(which use some of those functions and data) to form executables.
+
+  The "Library", below, refers to any such software library or work
+which has been distributed under these terms.  A "work based on the
+Library" means either the Library or any derivative work under
+copyright law: that is to say, a work containing the Library or a
+portion of it, either verbatim or with modifications and/or translated
+straightforwardly into another language.  (Hereinafter, translation is
+included without limitation in the term "modification".)
+
+  "Source code" for a work means the preferred form of the work for
+making modifications to it.  For a library, complete source code means
+all the source code for all modules it contains, plus any associated
+interface definition files, plus the scripts used to control compilation
+and installation of the library.
+
+  Activities other than copying, distribution and modification are not
+covered by this License; they are outside its scope.  The act of
+running a program using the Library is not restricted, and output from
+such a program is covered only if its contents constitute a work based
+on the Library (independent of the use of the Library in a tool for
+writing it).  Whether that is true depends on what the Library does
+and what the program that uses the Library does.
+  
+  1. You may copy and distribute verbatim copies of the Library's
+complete source code as you receive it, in any medium, provided that
+you conspicuously and appropriately publish on each copy an
+appropriate copyright notice and disclaimer of warranty; keep intact
+all the notices that refer to this License and to the absence of any
+warranty; and distribute a copy of this License along with the
+Library.
+
+  You may charge a fee for the physical act of transferring a copy,
+and you may at your option offer warranty protection in exchange for a
+fee.
+
+  2. You may modify your copy or copies of the Library or any portion
+of it, thus forming a work based on the Library, and copy and
+distribute such modifications or work under the terms of Section 1
+above, provided that you also meet all of these conditions:
+
+    a) The modified work must itself be a software library.
+
+    b) You must cause the files modified to carry prominent notices
+    stating that you changed the files and the date of any change.
+
+    c) You must cause the whole of the work to be licensed at no
+    charge to all third parties under the terms of this License.
+
+    d) If a facility in the modified Library refers to a function or a
+    table of data to be supplied by an application program that uses
+    the facility, other than as an argument passed when the facility
+    is invoked, then you must make a good faith effort to ensure that,
+    in the event an application does not supply such function or
+    table, the facility still operates, and performs whatever part of
+    its purpose remains meaningful.
+
+    (For example, a function in a library to compute square roots has
+    a purpose that is entirely well-defined independent of the
+    application.  Therefore, Subsection 2d requires that any
+    application-supplied function or table used by this function must
+    be optional: if the application does not supply it, the square
+    root function must still compute square roots.)
+
+These requirements apply to the modified work as a whole.  If
+identifiable sections of that work are not derived from the Library,
+and can be reasonably considered independent and separate works in
+themselves, then this License, and its terms, do not apply to those
+sections when you distribute them as separate works.  But when you
+distribute the same sections as part of a whole which is a work based
+on the Library, the distribution of the whole must be on the terms of
+this License, whose permissions for other licensees extend to the
+entire whole, and thus to each and every part regardless of who wrote
+it.
+
+Thus, it is not the intent of this section to claim rights or contest
+your rights to work written entirely by you; rather, the intent is to
+exercise the right to control the distribution of derivative or
+collective works based on the Library.
+
+In addition, mere aggregation of another work not based on the Library
+with the Library (or with a work based on the Library) on a volume of
+a storage or distribution medium does not bring the other work under
+the scope of this License.
+
+  3. You may opt to apply the terms of the ordinary GNU General Public
+License instead of this License to a given copy of the Library.  To do
+this, you must alter all the notices that refer to this License, so
+that they refer to the ordinary GNU General Public License, version 2,
+instead of to this License.  (If a newer version than version 2 of the
+ordinary GNU General Public License has appeared, then you can specify
+that version instead if you wish.)  Do not make any other change in
+these notices.
+
+  Once this change is made in a given copy, it is irreversible for
+that copy, so the ordinary GNU General Public License applies to all
+subsequent copies and derivative works made from that copy.
+
+  This option is useful when you wish to copy part of the code of
+the Library into a program that is not a library.
+
+  4. You may copy and distribute the Library (or a portion or
+derivative of it, under Section 2) in object code or executable form
+under the terms of Sections 1 and 2 above provided that you accompany
+it with the complete corresponding machine-readable source code, which
+must be distributed under the terms of Sections 1 and 2 above on a
+medium customarily used for software interchange.
+
+  If distribution of object code is made by offering access to copy
+from a designated place, then offering equivalent access to copy the
+source code from the same place satisfies the requirement to
+distribute the source code, even though third parties are not
+compelled to copy the source along with the object code.
+
+  5. A program that contains no derivative of any portion of the
+Library, but is designed to work with the Library by being compiled or
+linked with it, is called a "work that uses the Library".  Such a
+work, in isolation, is not a derivative work of the Library, and
+therefore falls outside the scope of this License.
+
+  However, linking a "work that uses the Library" with the Library
+creates an executable that is a derivative of the Library (because it
+contains portions of the Library), rather than a "work that uses the
+library".  The executable is therefore covered by this License.
+Section 6 states terms for distribution of such executables.
+
+  When a "work that uses the Library" uses material from a header file
+that is part of the Library, the object code for the work may be a
+derivative work of the Library even though the source code is not.
+Whether this is true is especially significant if the work can be
+linked without the Library, or if the work is itself a library.  The
+threshold for this to be true is not precisely defined by law.
+
+  If such an object file uses only numerical parameters, data
+structure layouts and accessors, and small macros and small inline
+functions (ten lines or less in length), then the use of the object
+file is unrestricted, regardless of whether it is legally a derivative
+work.  (Executables containing this object code plus portions of the
+Library will still fall under Section 6.)
+
+  Otherwise, if the work is a derivative of the Library, you may
+distribute the object code for the work under the terms of Section 6.
+Any executables containing that work also fall under Section 6,
+whether or not they are linked directly with the Library itself.
+
+  6. As an exception to the Sections above, you may also combine or
+link a "work that uses the Library" with the Library to produce a
+work containing portions of the Library, and distribute that work
+under terms of your choice, provided that the terms permit
+modification of the work for the customer's own use and reverse
+engineering for debugging such modifications.
+
+  You must give prominent notice with each copy of the work that the
+Library is used in it and that the Library and its use are covered by
+this License.  You must supply a copy of this License.  If the work
+during execution displays copyright notices, you must include the
+copyright notice for the Library among them, as well as a reference
+directing the user to the copy of this License.  Also, you must do one
+of these things:
+
+    a) Accompany the work with the complete corresponding
+    machine-readable source code for the Library including whatever
+    changes were used in the work (which must be distributed under
+    Sections 1 and 2 above); and, if the work is an executable linked
+    with the Library, with the complete machine-readable "work that
+    uses the Library", as object code and/or source code, so that the
+    user can modify the Library and then relink to produce a modified
+    executable containing the modified Library.  (It is understood
+    that the user who changes the contents of definitions files in the
+    Library will not necessarily be able to recompile the application
+    to use the modified definitions.)
+
+    b) Use a suitable shared library mechanism for linking with the
+    Library.  A suitable mechanism is one that (1) uses at run time a
+    copy of the library already present on the user's computer system,
+    rather than copying library functions into the executable, and (2)
+    will operate properly with a modified version of the library, if
+    the user installs one, as long as the modified version is
+    interface-compatible with the version that the work was made with.
+
+    c) Accompany the work with a written offer, valid for at
+    least three years, to give the same user the materials
+    specified in Subsection 6a, above, for a charge no more
+    than the cost of performing this distribution.
+
+    d) If distribution of the work is made by offering access to copy
+    from a designated place, offer equivalent access to copy the above
+    specified materials from the same place.
+
+    e) Verify that the user has already received a copy of these
+    materials or that you have already sent this user a copy.
+
+  For an executable, the required form of the "work that uses the
+Library" must include any data and utility programs needed for
+reproducing the executable from it.  However, as a special exception,
+the materials to be distributed need not include anything that is
+normally distributed (in either source or binary form) with the major
+components (compiler, kernel, and so on) of the operating system on
+which the executable runs, unless that component itself accompanies
+the executable.
+
+  It may happen that this requirement contradicts the license
+restrictions of other proprietary libraries that do not normally
+accompany the operating system.  Such a contradiction means you cannot
+use both them and the Library together in an executable that you
+distribute.
+
+  7. You may place library facilities that are a work based on the
+Library side-by-side in a single library together with other library
+facilities not covered by this License, and distribute such a combined
+library, provided that the separate distribution of the work based on
+the Library and of the other library facilities is otherwise
+permitted, and provided that you do these two things:
+
+    a) Accompany the combined library with a copy of the same work
+    based on the Library, uncombined with any other library
+    facilities.  This must be distributed under the terms of the
+    Sections above.
+
+    b) Give prominent notice with the combined library of the fact
+    that part of it is a work based on the Library, and explaining
+    where to find the accompanying uncombined form of the same work.
+
+  8. You may not copy, modify, sublicense, link with, or distribute
+the Library except as expressly provided under this License.  Any
+attempt otherwise to copy, modify, sublicense, link with, or
+distribute the Library is void, and will automatically terminate your
+rights under this License.  However, parties who have received copies,
+or rights, from you under this License will not have their licenses
+terminated so long as such parties remain in full compliance.
+
+  9. You are not required to accept this License, since you have not
+signed it.  However, nothing else grants you permission to modify or
+distribute the Library or its derivative works.  These actions are
+prohibited by law if you do not accept this License.  Therefore, by
+modifying or distributing the Library (or any work based on the
+Library), you indicate your acceptance of this License to do so, and
+all its terms and conditions for copying, distributing or modifying
+the Library or works based on it.
+
+  10. Each time you redistribute the Library (or any work based on the
+Library), the recipient automatically receives a license from the
+original licensor to copy, distribute, link with or modify the Library
+subject to these terms and conditions.  You may not impose any further
+restrictions on the recipients' exercise of the rights granted herein.
+You are not responsible for enforcing compliance by third parties with
+this License.
+
+  11. If, as a consequence of a court judgment or allegation of patent
+infringement or for any other reason (not limited to patent issues),
+conditions are imposed on you (whether by court order, agreement or
+otherwise) that contradict the conditions of this License, they do not
+excuse you from the conditions of this License.  If you cannot
+distribute so as to satisfy simultaneously your obligations under this
+License and any other pertinent obligations, then as a consequence you
+may not distribute the Library at all.  For example, if a patent
+license would not permit royalty-free redistribution of the Library by
+all those who receive copies directly or indirectly through you, then
+the only way you could satisfy both it and this License would be to
+refrain entirely from distribution of the Library.
+
+If any portion of this section is held invalid or unenforceable under any
+particular circumstance, the balance of the section is intended to apply,
+and the section as a whole is intended to apply in other circumstances.
+
+It is not the purpose of this section to induce you to infringe any
+patents or other property right claims or to contest validity of any
+such claims; this section has the sole purpose of protecting the
+integrity of the free software distribution system which is
+implemented by public license practices.  Many people have made
+generous contributions to the wide range of software distributed
+through that system in reliance on consistent application of that
+system; it is up to the author/donor to decide if he or she is willing
+to distribute software through any other system and a licensee cannot
+impose that choice.
+
+This section is intended to make thoroughly clear what is believed to
+be a consequence of the rest of this License.
+
+  12. If the distribution and/or use of the Library is restricted in
+certain countries either by patents or by copyrighted interfaces, the
+original copyright holder who places the Library under this License may add
+an explicit geographical distribution limitation excluding those countries,
+so that distribution is permitted only in or among countries not thus
+excluded.  In such case, this License incorporates the limitation as if
+written in the body of this License.
+
+  13. The Free Software Foundation may publish revised and/or new
+versions of the Lesser General Public License from time to time.
+Such new versions will be similar in spirit to the present version,
+but may differ in detail to address new problems or concerns.
+
+Each version is given a distinguishing version number.  If the Library
+specifies a version number of this License which applies to it and
+"any later version", you have the option of following the terms and
+conditions either of that version or of any later version published by
+the Free Software Foundation.  If the Library does not specify a
+license version number, you may choose any version ever published by
+the Free Software Foundation.
+
+  14. If you wish to incorporate parts of the Library into other free
+programs whose distribution conditions are incompatible with these,
+write to the author to ask for permission.  For software which is
+copyrighted by the Free Software Foundation, write to the Free
+Software Foundation; we sometimes make exceptions for this.  Our
+decision will be guided by the two goals of preserving the free status
+of all derivatives of our free software and of promoting the sharing
+and reuse of software generally.
+
+			    NO WARRANTY
+
+  15. BECAUSE THE LIBRARY IS LICENSED FREE OF CHARGE, THERE IS NO
+WARRANTY FOR THE LIBRARY, TO THE EXTENT PERMITTED BY APPLICABLE LAW.
+EXCEPT WHEN OTHERWISE STATED IN WRITING THE COPYRIGHT HOLDERS AND/OR
+OTHER PARTIES PROVIDE THE LIBRARY "AS IS" WITHOUT WARRANTY OF ANY
+KIND, EITHER EXPRESSED OR IMPLIED, INCLUDING, BUT NOT LIMITED TO, THE
+IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
+PURPOSE.  THE ENTIRE RISK AS TO THE QUALITY AND PERFORMANCE OF THE
+LIBRARY IS WITH YOU.  SHOULD THE LIBRARY PROVE DEFECTIVE, YOU ASSUME
+THE COST OF ALL NECESSARY SERVICING, REPAIR OR CORRECTION.
+
+  16. IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN
+WRITING WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MAY MODIFY
+AND/OR REDISTRIBUTE THE LIBRARY AS PERMITTED ABOVE, BE LIABLE TO YOU
+FOR DAMAGES, INCLUDING ANY GENERAL, SPECIAL, INCIDENTAL OR
+CONSEQUENTIAL DAMAGES ARISING OUT OF THE USE OR INABILITY TO USE THE
+LIBRARY (INCLUDING BUT NOT LIMITED TO LOSS OF DATA OR DATA BEING
+RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU OR THIRD PARTIES OR A
+FAILURE OF THE LIBRARY TO OPERATE WITH ANY OTHER SOFTWARE), EVEN IF
+SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE POSSIBILITY OF SUCH
+DAMAGES.
+
+		     END OF TERMS AND CONDITIONS
+
+           How to Apply These Terms to Your New Libraries
+
+  If you develop a new library, and you want it to be of the greatest
+possible use to the public, we recommend making it free software that
+everyone can redistribute and change.  You can do so by permitting
+redistribution under these terms (or, alternatively, under the terms of the
+ordinary General Public License).
+
+  To apply these terms, attach the following notices to the library.  It is
+safest to attach them to the start of each source file to most effectively
+convey the exclusion of warranty; and each file should have at least the
+"copyright" line and a pointer to where the full notice is found.
+
+    <one line to give the library's name and a brief idea of what it does.>
+    Copyright (C) <year>  <name of author>
+
+    This library is free software; you can redistribute it and/or
+    modify it under the terms of the GNU Lesser General Public
+    License as published by the Free Software Foundation; either
+    version 2.1 of the License, or (at your option) any later version.
+
+    This library is distributed in the hope that it will be useful,
+    but WITHOUT ANY WARRANTY; without even the implied warranty of
+    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the GNU
+    Lesser General Public License for more details.
+
+    You should have received a copy of the GNU Lesser General Public
+    License along with this library; if not, write to the Free Software
+    Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA  02111-1307  USA
+
+Also add information on how to contact you by electronic and paper mail.
+
+You should also get your employer (if you work as a programmer) or your
+school, if any, to sign a "copyright disclaimer" for the library, if
+necessary.  Here is a sample; alter the names:
+
+  Yoyodyne, Inc., hereby disclaims all copyright interest in the
+  library `Frob' (a library for tweaking knobs) written by James Random Hacker.
+
+  <signature of Ty Coon>, 1 April 1990
+  Ty Coon, President of Vice
+
+That's all there is to it!
+
+
diff --git a/Makefile.in b/Makefile.in
index 9c8748aa4d..8fd59babcd 100644
--- a/Makefile.in
+++ b/Makefile.in
@@ -1,36 +1,16 @@
 SHELL = /bin/sh
-NULLCMD = @NULLCMD@
-n=$(NULLCMD)
-ECHO1 = $(V:1=$n)
-RUNCMD = $(SHELL)
-CDPATH = .
-CHDIR = @CHDIR@
-exec = exec
-NULL = /dev/null
-PATH_SEPARATOR = @PATH_SEPARATOR@
 
 #### Start of system configuration section. ####
 
 srcdir = @srcdir@
-top_srcdir = $(srcdir)
-hdrdir = $(srcdir)/include
-PLATFORM_DIR = @PLATFORM_DIR@
+VPATH = $(srcdir):$(srcdir)/missing
 
 CC = @CC@
-CPP = @CPP@
-LD = @LD@
-YACC = bison
+YACC = @YACC@
 PURIFY =
 AUTOCONF = autoconf
-ACLOCAL = aclocal
-CONFIGURE = @CONFIGURE@
 @SET_MAKE@
 MKFILES = @MAKEFILES@
-BASERUBY = @BASERUBY@
-HAVE_BASERUBY = @HAVE_BASERUBY@
-TEST_RUNNABLE = @TEST_RUNNABLE@
-CROSS_COMPILING = @CROSS_COMPILING@
-DOXYGEN = @DOXYGEN@
 
 prefix = @prefix@
 exec_prefix = @exec_prefix@
@@ -43,85 +23,43 @@ datadir = @datadir@
 arch = @arch@
 sitearch = @sitearch@
 sitedir = @sitedir@
-archlibdir = @archlibdir@
-ruby_version = @ruby_version@
 
 TESTUI = console
 TESTS =
-INSTALLDOC = @INSTALLDOC@
-DOCTARGETS = @RDOCTARGET@ @CAPITARGET@
+RDOCTARGET = @RDOCTARGET@
 
 EXTOUT = @EXTOUT@
-arch_hdrdir = $(EXTOUT)/include/$(arch)
-VPATH = $(arch_hdrdir)/ruby:$(hdrdir)/ruby:$(srcdir):$(srcdir)/missing
+RIDATADIR = $(DESTDIR)$(datadir)/ri/$(MAJOR).$(MINOR)/system
 
 empty =
-CC_VERSION = @CC_VERSION@
 OUTFLAG = @OUTFLAG@$(empty)
-COUTFLAG = @COUTFLAG@$(empty)
-ARCH_FLAG = @ARCH_FLAG@
-CFLAGS_NO_ARCH = @CFLAGS@
-CFLAGS = $(CFLAGS_NO_ARCH) $(ARCH_FLAG)
-cflags = @cflags@
-optflags = @optflags@
-debugflags = @debugflags@
-warnflags = @warnflags@ @strict_warnflags@
-cppflags = @cppflags@
-XCFLAGS = @XCFLAGS@
-CPPFLAGS = @CPPFLAGS@ $(INCFLAGS)
+CFLAGS = @CFLAGS@ @XCFLAGS@ @ARCH_FLAG@
+CPPFLAGS = -I. -I$(srcdir) @CPPFLAGS@
 LDFLAGS = @STATIC@ $(CFLAGS) @LDFLAGS@
-EXTLDFLAGS = @EXTLDFLAGS@
+EXTLDFLAGS = 
 XLDFLAGS = @XLDFLAGS@ $(EXTLDFLAGS)
-EXTLIBS =
+EXTLIBS = 
 LIBS = @LIBS@ $(EXTLIBS)
 MISSING = @LIBOBJS@ @ALLOCA@
 LDSHARED = @LIBRUBY_LDSHARED@
-DLDFLAGS = @LIBRUBY_DLDFLAGS@ $(XLDFLAGS) $(ARCH_FLAG)
+DLDFLAGS = @LIBRUBY_DLDFLAGS@ $(EXTLDFLAGS) @ARCH_FLAG@
 SOLIBS = @SOLIBS@
 MAINLIBS = @MAINLIBS@
-ARCHMINIOBJS = @MINIOBJS@
-DLNOBJ = @DLNOBJ@
-ENCOBJS = @ENCOBJS@
-EXTOBJS = @EXTOBJS@
-BUILTIN_ENCOBJS = @BUILTIN_ENCOBJS@
-BUILTIN_TRANSSRCS = @BUILTIN_TRANSSRCS@
-BUILTIN_TRANSOBJS = @BUILTIN_TRANSOBJS@
-POSTLINK = @POSTLINK@
-
-RUBY_BASE_NAME=@RUBY_BASE_NAME@
-RUBY_PROGRAM_VERSION=@RUBY_PROGRAM_VERSION@
+MINIOBJS = @MINIOBJS@
+
 RUBY_INSTALL_NAME=@RUBY_INSTALL_NAME@
 RUBY_SO_NAME=@RUBY_SO_NAME@
 EXEEXT = @EXEEXT@
-LIBEXT = @LIBEXT@
 PROGRAM=$(RUBY_INSTALL_NAME)$(EXEEXT)
 RUBY = $(RUBY_INSTALL_NAME)
-MINIRUBY = @MINIRUBY@\
-	$(MINIRUBYOPT)
-# RUNRUBY_COMMAND:: runruby.rb or baseruby. do not append options directly
-RUNRUBY_COMMAND = @RUNRUBY_COMMAND@
-# RUNRUBY:: run ruby with RUN_OPTS which is passed to ruby
-RUNRUBY = @RUNRUBY@ $(RUN_OPTS)
-# RUNRUBY_DEBUGGER:: debugging option for runruby.rb
-RUNRUBY_DEBUGGER = --debugger='gdb -x run.gdb --quiet --args'
-XRUBY = @XRUBY@
-BTESTRUBY = @BTESTRUBY@\
-	$(MINIRUBYOPT)
-INSTALL = @INSTALL@
-INSTALL_DATA = @INSTALL_DATA@
-INSTALL_SCRIPT = @INSTALL_SCRIPT@
-INSTALL_PROGRAM = @INSTALL_PROGRAM@
-XRUBY_LIBDIR = @XRUBY_LIBDIR@
-XRUBY_RUBYLIBDIR = @XRUBY_RUBYLIBDIR@
-XRUBY_RUBYHDRDIR = @XRUBY_RUBYHDRDIR@
-BOOTSTRAPRUBY = @BOOTSTRAPRUBY@
+MINIRUBY = @MINIRUBY@
+RUNRUBY = @RUNRUBY@
 
 #### End of system configuration section. ####
 
 MAJOR=	@MAJOR@
 MINOR=	@MINOR@
 TEENY=	@TEENY@
-RUBY_PROGRAM_VERSION = @RUBY_PROGRAM_VERSION@
 
 LIBRUBY_A     = @LIBRUBY_A@
 LIBRUBY_SO    = @LIBRUBY_SO@
@@ -130,420 +68,111 @@ LIBRUBY	      = @LIBRUBY@
 LIBRUBYARG    = @LIBRUBYARG@
 LIBRUBYARG_STATIC = @LIBRUBYARG_STATIC@
 LIBRUBYARG_SHARED = @LIBRUBYARG_SHARED@
-LIBRUBY_RELATIVE = @LIBRUBY_RELATIVE@
-LIBRUBY_A_OBJS = @LIBRUBY_A_OBJS@
-
-DTRACE_REBUILD_OBJS = $(DTRACE_REBUILD:yes=$(DTRACE_DEPENDENT_OBJS))
-
-DTRACE_DEPENDENT_OBJS = array.$(OBJEXT) \
-			eval.$(OBJEXT) \
-			gc.$(OBJEXT) \
-			hash.$(OBJEXT) \
-			load.$(OBJEXT) \
-			object.$(OBJEXT) \
-			parse.$(OBJEXT) \
-			string.$(OBJEXT) \
-			symbol.$(OBJEXT) \
-			vm.$(OBJEXT)
-
-THREAD_MODEL  = @THREAD_MODEL@
 
 PREP          = @PREP@
 ARCHFILE      = @ARCHFILE@
 SETUP         =
 EXTSTATIC     = @EXTSTATIC@
-ENCSTATIC     = @ENCSTATIC@
-SET_LC_MESSAGES = env LC_MESSAGES=C
 
-MAKEDIRS      = @MKDIR_P@
-CP            = cp
-MV            = mv
 RM            = rm -f
-RMDIR         = @RMDIR@
-RMDIRS        = @RMDIRS@
-RMALL         = @RMALL@
 NM            = @NM@
 AR            = @AR@
-ARFLAGS       = @ARFLAGS@
+ARFLAGS       = rcu
 RANLIB        = @RANLIB@
 AS            = @AS@
-ASFLAGS       = @ASFLAGS@ $(INCFLAGS)
-IFCHANGE      = $(srcdir)/tool/ifchange
-SET_LC_MESSAGES = env LC_MESSAGES=C
-OBJDUMP       = @OBJDUMP@
-OBJCOPY       = @OBJCOPY@
-VCS           = @VCS@
-VCSUP         = @VCSUP@
-DTRACE        = @DTRACE@
-DTRACE_EXT    = @DTRACE_EXT@
-DTRACE_OBJ    = @DTRACE_OBJ@
-DTRACE_REBUILD= @DTRACE_REBUILD@
-DTRACE_GLOMMED_OBJ = $(DTRACE_REBUILD:yes=ruby-glommed.$(OBJEXT))
+ASFLAGS       = @ASFLAGS@
 
 OBJEXT        = @OBJEXT@
-ASMEXT        = S
-DLEXT         = @DLEXT@
 MANTYPE	      = @MANTYPE@
-SYMBOL_PREFIX = @SYMBOL_PREFIX@
-
-INSTALLED_LIST= .installed.list
-
-NEWLINE_C     = enc/trans/newline.c
-MINIPRELUDE_C = miniprelude.c
-PRELUDE_C     = prelude.c
-RBCONFIG      = .rbconfig.time
-
-SRC_FILE      = $<
-OS_SRC_FILE   = $<
-DEST_FILE     = $@
-OS_DEST_FILE  = $@
-
-MESSAGE_BEGIN = @for line in
-MESSAGE_END = ; do echo "$$line"; done
-ECHO_BEGIN = @sep=''; for word in
-ECHO_END = ; do echo @ECHO_N@ "$$sep'$$word'@ECHO_C@"; sep=' '; done; echo
 
-DESTDIR       = @DESTDIR@
-
-configure_args = @configure_args@
+PREINSTALL    = @PREINSTALL@
 #### End of variables
 
-.SUFFIXES: .inc .h .c .y .i .$(DTRACE_EXT)
-
 all:
 
+.DEFAULT: all
+
 # Prevent GNU make v3 from overflowing arg limit on SysV.
 .NOEXPORT:
 
 miniruby$(EXEEXT):
-		@-if test -f $@; then $(MV) -f $@ $@.old; $(RM) $@.old; fi
-		$(ECHO) linking $@
-		$(Q) $(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(NORMALMAINOBJ) $(MINIOBJS) $(COMMONOBJS) $(MAINLIBS) $(LIBS) $(OUTFLAG)$@
+		@$(RM) $@
+		$(PURIFY) $(CC) $(MAINOBJ) $(MINIOBJS) $(LIBRUBY_A) $(LIBS) $(OUTFLAG)$@ $(LDFLAGS) $(MAINLIBS)
 
 $(PROGRAM):
 		@$(RM) $@
-		$(ECHO) linking $@
-		$(Q) $(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ) $(EXTOBJS) $(LIBRUBYARG) $(MAINLIBS) $(LIBS) $(EXTLIBS) $(OUTFLAG)$@
-		$(Q) $(POSTLINK)
+		$(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(MAINLIBS) $(MAINOBJ) $(EXTOBJS) $(LIBRUBYARG) $(LIBS) $(OUTFLAG)$@
 
 # We must `rm' the library each time this rule is invoked because "updating" a
 # MAB library on Apple/NeXT (see --enable-fat-binary in configure) is not
 # supported.
 $(LIBRUBY_A):
 		@$(RM) $@
-		$(ECHO) linking static-library $@
-		$(Q) $(AR) $(ARFLAGS) $@ $(LIBRUBY_A_OBJS) $(INITOBJS)
+		$(AR) $(ARFLAGS) $@ $(OBJS) $(DMYEXT)
 		@-$(RANLIB) $@ 2> /dev/null || true
-		$(ECHO) verifying static-library $@
-		@$(PURIFY) $(CC) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ) $(LIBRUBY_A) $(MAINLIBS) $(EXTLIBS) $(LIBS) $(OUTFLAG)conftest$(EXEEXT)
-		@$(RM) conftest$(EXEEXT) conftest.c
 
 $(LIBRUBY_SO):
-		@-$(PRE_LIBRUBY_UPDATE)
-		$(ECHO) linking shared-library $@
-		$(Q) $(LDSHARED) $(DLDFLAGS) $(OBJS) $(DLDOBJS) $(SOLIBS) $(EXTSOLIBS) $(OUTFLAG)$@
-		-$(Q) $(OBJCOPY) -w -L '$(SYMBOL_PREFIX)Init_*' -L '$(SYMBOL_PREFIX)ruby_static_id_*' \
-			-L '$(SYMBOL_PREFIX)*_threadptr_*' $@
-		$(Q) $(POSTLINK)
-		@-$(MINIRUBY) -e 'ARGV.each{|link| File.delete link rescue nil; \
+		$(LDSHARED) $(DLDFLAGS) $(OBJS) $(DLDOBJS) $(SOLIBS) $(OUTFLAG)$@
+		@-$(MINIRUBY) -e 'ARGV.each{|link| File.delete link if File.exist? link; \
 						  File.symlink "$(LIBRUBY_SO)", link}' \
 				$(LIBRUBY_ALIASES) || true
 
-ruby_pc = @ruby_pc@
-$(ruby_pc):
-		@./config.status --file=$@:$(srcdir)/template/ruby.pc.in
-
-ruby-runner.h: template/ruby-runner.h.in
-		@./config.status --file=$@:$(srcdir)/template/$(@F).in
-
-ruby-runner$(EXEEXT): ruby-runner.c ruby-runner.h
-	$(Q) $(PURIFY) $(CC) $(CFLAGS) $(CPPFLAGS) -DRUBY_INSTALL_NAME=$(RUBY_INSTALL_NAME) $(LDFLAGS) $(LIBS) $(OUTFLAG)$@ $<
-
-$(RBCONFIG): $(PREP)
-
-rbconfig.rb: $(RBCONFIG)
-
-install-cross: $(arch)-fake.rb $(RBCONFIG) rbconfig.rb $(arch_hdrdir)/ruby/config.h \
-	$(LIBRUBY_A) $(LIBRUBY_SO) $(ARCHFILE)
-	$(ECHO) installing cross-compiling stuff
-	$(Q) $(MAKEDIRS) $(XRUBY_RUBYLIBDIR)/$(arch) $(XRUBY_RUBYHDRDIR)/$(arch)/ruby
-	$(Q) sed '/^\$$:\.unshift/q' $(arch)-fake.rb > fake.rb
-	$(Q) $(BASERUBY) -p \
-	-e '~/^\s*CONFIG\["LDFLAGS"\]/ and' \
-	-e '$$_[/(?=\s*"$$)/] = %q[ #{(CONFIG["LIBPATHFLAG"]%File.dirname(__FILE__)).strip}]' \
-	rbconfig.rb > fake-rbconfig.rb
-	$(INSTALL_SCRIPT) fake.rb $(XRUBY_RUBYLIBDIR)/$(arch)/fake.rb
-	$(INSTALL_SCRIPT) fake-rbconfig.rb $(XRUBY_RUBYLIBDIR)/$(arch)/rbconfig.rb
-	@$(RM) fake.rb fake-rbconfig.rb
-	$(INSTALL_DATA) $(arch_hdrdir)/ruby/config.h $(XRUBY_RUBYHDRDIR)/$(arch)/ruby
-	$(INSTALL_DATA) $(top_srcdir)/include/ruby/win32.h $(XRUBY_RUBYHDRDIR)/ruby
-	$(INSTALL_DATA) $(LIBRUBY) $(LIBRUBY_A) $(XRUBY_RUBYLIBDIR)/$(arch)
-	$(INSTALL_PROGRAM) $(LIBRUBY_SO) $(XRUBY_RUBYLIBDIR)/$(arch)
-
-Makefile:	$(srcdir)/Makefile.in $(srcdir)/enc/Makefile.in
-
-$(MKFILES): config.status $(srcdir)/version.h
-		@[ -f $@ ] && mv $@ $@.old
-		MAKE=$(MAKE) $(SHELL) ./config.status $@
-		@cmp $@ $@.old > /dev/null 2>&1 && echo $@ unchanged && exit 0; \
-		{ \
+fake.rb:	Makefile
+		@echo ' \
+		class Object; \
+		  CROSS_COMPILING = RUBY_PLATFORM; \
+		  remove_const :RUBY_PLATFORM; \
+		  remove_const :RUBY_VERSION; \
+		  RUBY_PLATFORM = "@arch@"; \
+		  RUBY_VERSION = "@MAJOR@.@MINOR@.@TEENY@"; \
+		end; \
+		if RUBY_PLATFORM =~ /mswin|bccwin|mingw/; \
+		  class File; \
+		    remove_const :ALT_SEPARATOR; \
+		    ALT_SEPARATOR = "\\"; \
+		  end; \
+		end; \
+		' > $@
+
+Makefile:	$(srcdir)/Makefile.in
+
+$(MKFILES): config.status $(srcdir)/common.mk
+		MAKE=$(MAKE) $(SHELL) ./config.status
+		@{ \
 		    echo "all:; -@rm -f conftest.mk"; \
 		    echo "conftest.mk: .force; @echo AUTO_REMAKE"; \
 		    echo ".force:"; \
 		} > conftest.mk || exit 1; \
 		$(MAKE) -f conftest.mk | grep '^AUTO_REMAKE$$' >/dev/null 2>&1 || \
-		{ echo "$@ updated, restart."; exit 1; }
-
-uncommon.mk: $(srcdir)/common.mk
-		sed 's/{\$$([^(){}]*)[^{}]*}//g' $< > $@
-
-.PHONY: reconfig
-reconfig-args = $(srcdir)/$(CONFIGURE) $(configure_args)
-config.status-args = ./config.status --recheck
-reconfig-exec-0 = test -t 1 && { CONFIGURE_TTY=yes; export CONFIGURE_TTY; }; exec 3>&1; exit `exec 4>&1; { "$$@" 3>&- 4>&-; echo $$? 1>&4; } | fgrep -v '(cached)' 1>&3 3>&- 4>&-`
-reconfig-exec-1 = set -x; "$$@"
-
-reconfig config.status:	$(srcdir)/$(CONFIGURE) $(srcdir)/enc/Makefile.in \
-			$(srcdir)/include/ruby/version.h
-	@PWD= MINIRUBY="$(MINIRUBY)"; export MINIRUBY; \
-	set $(SHELL) $($@-args); $(reconfig-exec-$(V))
-
-$(srcdir)/$(CONFIGURE): $(srcdir)/configure.in $(srcdir)/aclocal.m4
-	$(CHDIR) $(srcdir) && exec $(AUTOCONF) -o $(@F)
-
-$(srcdir)/aclocal.m4:
-	$(CHDIR) $(srcdir) && \
-	type $(ACLOCAL) >/dev/null 2>&1 && exec $(ACLOCAL); \
-	touch $(@F)
-
-incs: id.h
-all-incs: probes.h
-
-# Things which should be considered:
-# * with gperf v.s. without gperf
-# * committers may have various versions of gperf
-# * ./configure v.s. ../ruby/configure
-# * GNU make v.s. HP-UX make	# HP-UX make invokes the action if lex.c and keywords has same mtime.
-# * svn checkout generate a file with mtime as current time
-# * ext4 and XFS has a mtime with fractional part
-lex.c: defs/keywords
-	@\
-	if cmp -s $(srcdir)/defs/lex.c.src $?; then \
-	  [ $(Q) ] && echo copying $@ || set -x; \
-	  $(CP) $(srcdir)/lex.c.blt $@; \
-	else \
-	  [ $(Q) ] && echo generating $@ || set -x; \
-	  gperf -C -P -p -j1 -i 1 -g -o -t -N rb_reserved_word -k1,3,$$ $? \
-	  | sed 's/(long)&((\(struct stringpool_t\) *\*)0)->\(stringpool_[a-z0-9]*\)/offsetof(\1, \2)/g' \
-	  > $@.tmp && \
-	  $(MV) $@.tmp $@ && \
-	  $(CP) $? $(srcdir)/defs/lex.c.src && \
-	  $(CP) $@ $(srcdir)/lex.c.blt; \
-	fi
-
-JIS_PROPS_OPTIONS = -k1,3 -7 -c -j1 -i1 -t -C -P -t --ignore-case -H onig_jis_property_hash -Q onig_jis_property_pool -N onig_jis_property
-
-enc/jis/props.h: enc/jis/props.kwd
-	$(MAKEDIRS) $(@D)
-	@set +e; \
-	if cmp -s $(?:.kwd=.src) $?; then \
-	  set -x; \
-	  $(CP) $(?:.kwd=.h.blt) $@; \
-	else \
-	  set -x; \
-	  gperf $(JIS_PROPS_OPTIONS) $? | \
-	  sed 's/(int)(long)&((\([a-zA-Z_0-9 ]*[a-zA-Z_0-9]\) *\*)0)->\([a-zA-Z0-9_]*\),/(char)offsetof(\1, \2),/g' > $@ && \
-	  $(CP) $? $(?:.kwd=.src) && \
-	  $(CP) $@ $(?:.kwd=.h.blt); \
-	fi
+		{ echo "Makefile updated, restart."; exit 1; }
+
+config.status:	$(srcdir)/configure
+		MINIRUBY="$(MINIRUBY)" $(SHELL) ./config.status --recheck
+
+$(srcdir)/configure: $(srcdir)/configure.in
+		cd $(srcdir) && $(AUTOCONF)
+
+lex.c: keywords
+	@-$(RM) $@
+	gperf -p -j1 -i 1 -g -o -t -N rb_reserved_word -k1,3,$$ $? > $@ || \
+	cp "$(srcdir)/$@" .
+
+.y.c:
+	$(YACC) $<
+	sed '/^#/s|y\.tab\.c|$@|' y.tab.c > $@
+	rm -f y.tab.c
 
 .c.@OBJEXT@:
-	@$(ECHO) compiling $<
-	$(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -c $<
+	$(CC) $(CFLAGS) $(CPPFLAGS) -c $<
 
 .s.@OBJEXT@:
-	@$(ECHO) assembling $<
-	$(Q) $(AS) $(ASFLAGS) -o $@ $<
-
-.c.S:
-	@$(ECHO) translating $<
-	$(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -S $<
-
-.c.i:
-	@$(ECHO) preprocessing $<
-	$(Q) $(CPP) $(warnflags) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -E $< > $@
-
-.d.h:
-	@$(ECHO) translating probes $<
-	$(Q) $(DTRACE) -o $@.tmp -h -C $(INCFLAGS) -s $<
-	$(Q) sed -e 's/RUBY_/RUBY_DTRACE_/g' -e 's/PROBES_H_TMP/RUBY_PROBES_H/' -e 's/(char \*/(const char */g' -e 's/, char \*/, const char */g' $@.tmp > $@
-	$(Q) $(RM) $@.tmp
-
-.dmyh.h:
-	@$(ECHO) making dummy $(DEST_FILE)
-	$(Q)echo '#include "$(*F).dmyh"' > $@
-
-probes.stamp: $(DTRACE_REBUILD_OBJS)
-	$(Q) if test -f $@ -o -f probes.$(OBJEXT); then \
-	  $(RM) $(DTRACE_REBUILD_OBJS) $@; \
-	  $(ECHO0) "rebuilding objects which were modified by \"dtrace -G\""; \
-	  $(MAKE) $(DTRACE_REBUILD_OBJS); \
-	fi
-	$(Q) touch $@
-
-probes.@OBJEXT@: $(srcdir)/probes.d $(DTRACE_REBUILD:yes=probes.stamp)
-	@$(ECHO) processing probes in object files
-	$(Q) $(RM) $@
-	$(Q) $(DTRACE) -G -C $(INCFLAGS) -s $(srcdir)/probes.d -o $@ $(DTRACE_REBUILD_OBJS)
-
-# DTrace static library hacks described here:
-# http://mail.opensolaris.org/pipermail/dtrace-discuss/2005-August/000207.html
-ruby-glommed.$(OBJEXT):
-	@$(ECHO) generating a glommed object with DTrace probes for static library
-	$(Q) $(LD) -r -o $@ $(OBJS)
+	$(AS) $(ASFLAGS) -o $@ $<
 
 clean-local::
-	$(Q)$(RM) ext/extinit.c ext/extinit.$(OBJEXT) ext/ripper/y.output \
-		enc/encinit.c enc/encinit.$(OBJEXT)
-	-$(Q)$(RM) $(pkgconfig_DATA)
+	@$(RM) ext/extinit.c ext/extinit.$(OBJEXT)
 
 distclean-local::
-	$(Q)$(RM) ext/config.cache $(RBCONFIG) Doxyfile
-	-$(Q)$(RM) run.gdb
-	-$(Q)$(RM) $(INSTALLED_LIST) $(arch_hdrdir)/ruby/config.h verconf.h
-	-$(Q)$(RMDIRS) $(arch_hdrdir)/ruby 2> /dev/null || true
-
-clean-ext distclean-ext realclean-ext::
-	@cd ext 2>/dev/null || exit 0; set dummy `echo "${EXTS}" | tr , ' '`; shift; \
-	test "$$#" = 0 && set .; \
-	set dummy `\
-	    find "$$@" -name Makefile -print | sed 's:^\./::;s:/Makefile$$::' | sort; \
-	`; shift; \
-	cd ..; \
-	for dir do \
-	    echo $(@:-ext=)ing "$$dir"; \
-	    (cd "ext/$$dir" && exec $(MAKE) $(MFLAGS) $(@:-ext=)) && \
-	    case "$@" in \
-	    *distclean-ext*|*realclean-ext*) \
-		$(RMDIRS) "ext/$$dir" 2> /dev/null || true;; \
-	    esac; \
-	done
-	-$(Q)$(RM) ext/extinit.$(OBJEXT)
-
-distclean-ext realclean-ext::
-	-$(Q)$(RM) ext/extinit.c
-	-$(Q)$(RMDIR) ext 2> /dev/null || true
-
-clean-extout:
-
-clean-enc distclean-enc realclean-enc:
-	@test -f "$(ENC_MK)" || exit 0; \
-	echo $(@:-enc=ing) encodings; \
-	exec $(MAKE) $(MAKE_ENC) $(@:-enc=)
+	@$(RM) ext/config.cache $(RBCONFIG)
 
 ext/extinit.$(OBJEXT): ext/extinit.c $(SETUP)
-	$(ECHO) compiling $@
-	$(Q) $(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(COUTFLAG)$@ -c ext/extinit.c
-
-enc/encinit.$(OBJEXT): enc/encinit.c $(SETUP)
-
-update-src::
-	@$(CHDIR) "$(srcdir)" && LC_TIME=C exec $(VCSUP)
-
-update-download:: update-config_files
-
-after-update:: common-srcs
-
-update-mspec:
-	@$(CHDIR) $(srcdir); \
-	if [ -d spec/mspec ]; then \
-	  echo updating mspec ...; \
-	  $(Q1:0=:) set -x; \
-	  cd spec/mspec && \
-	  exec git pull; \
-	else \
-	  echo retrieving mspec ...; \
-	  $(Q1:0=:) set -x; \
-	  exec git clone $(MSPEC_GIT_URL) spec/mspec; \
-	fi
-	$(Q)cd $(srcdir)/spec/mspec && exec git --no-pager log -1 --oneline
-
-update-rubyspec: update-mspec
-	@$(CHDIR) $(srcdir); \
-	if [ -d spec/rubyspec ]; then \
-	  echo updating rubyspec ...; \
-	  $(Q1:0=:) set -x; \
-	  cd spec/rubyspec && \
-	  exec git pull; \
-	else \
-	  echo retrieving rubyspec ...; \
-	  $(Q1:0=:) set -x; \
-	  exec git clone $(RUBYSPEC_GIT_URL) spec/rubyspec; \
-	fi
-	$(Q)cd $(srcdir)/spec/rubyspec && exec git --no-pager log -1 --oneline
-
-test-rubyspec-precheck:
-	@if [ ! -d $(srcdir)/spec/rubyspec ]; then echo No rubyspec here.  make update-rubyspec first.; exit 1; fi
-
-update-doclie:
-	@$(CHDIR) $(srcdir); \
-	if [ -d coverage/doclie ]; then \
-	  echo updating doclie ...; \
-	  $(Q1:0=:) set -x; \
-	  cd coverage/doclie && \
-	  git fetch && \
-	  exec git checkout $(DOCLIE_GIT_REF); \
-	else \
-	  echo retrieving doclie ...; \
-	  $(Q1:0=:) set -x; \
-	  exec git clone --branch $(DOCLIE_GIT_REF) $(DOCLIE_GIT_URL) coverage/doclie; \
-	fi
-
-update-simplecov-html:
-	@$(CHDIR) $(srcdir); \
-	if [ -d coverage/simplecov-html ]; then \
-	  echo updating simplecov-html ...; \
-	  $(Q1:0=:) set -x; \
-	  cd coverage/simplecov-html && \
-	  git fetch && \
-	  exec git checkout $(SIMPLECOV_HTML_GIT_REF); \
-	else \
-	  echo retrieving simplecov-html ...; \
-	  exec git clone --branch $(SIMPLECOV_HTML_GIT_REF) $(SIMPLECOV_HTML_GIT_URL) coverage/simplecov-html; \
-	fi
-
-update-simplecov:
-	@$(CHDIR) $(srcdir); \
-	if [ -d coverage/simplecov ]; then \
-	  echo updating simplecov ...; \
-	  $(Q1:0=:) set -x; \
-	  cd coverage/simplecov && \
-	  git fetch && \
-	  exec git checkout $(SIMPLECOV_GIT_REF); \
-	else \
-	  echo retrieving simplecov ...; \
-	  $(Q1:0=:) set -x; \
-	  exec git clone --branch $(SIMPLECOV_GIT_REF) $(SIMPLECOV_GIT_URL) coverage/simplecov; \
-	fi
-
-update-coverage: update-simplecov update-simplecov-html update-doclie
-
-INSNS	= opt_sc.inc optinsn.inc optunifs.inc insns.inc insns_info.inc \
-	  vmtc.inc vm.inc
-
-$(INSNS): $(srcdir)/insns.def vm_opts.h \
-	  $(srcdir)/defs/opt_operand.def $(srcdir)/defs/opt_insn_unif.def \
-	  $(srcdir)/tool/instruction.rb $(srcdir)/tool/insns2vm.rb
-	$(ECHO) generating $@
-	$(Q) $(BASERUBY) -Ku $(srcdir)/tool/insns2vm.rb $(INSNS2VMOPT) $@
-
-verconf.h: $(RBCONFIG)
-
-loadpath: verconf.h
-	@$(CPP) $(XCFLAGS) $(CPPFLAGS) $(srcdir)/loadpath.c | \
-	sed -e '1,/^const char ruby_initial_load_paths/d;/;/,$$d' \
-	    -e '/^ /!d;s/ *"\\0"$$//;s/" *"//g'
-
-un-runnable:
-	$(ECHO) cannot make runnable, configure with --enable-load-relative.
-	$(Q) exit 1
+	$(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) $(OUTFLAG)$@ -c ext/extinit.c
diff --git a/NEWS b/NEWS
deleted file mode 100644
index 986db329b3..0000000000
--- a/NEWS
+++ /dev/null
@@ -1,211 +0,0 @@
-# -*- rdoc -*-
-
-= NEWS for Ruby 2.4.0
-
-This document is a list of user visible feature changes made between
-releases except for bug fixes.
-
-Note that each entry is kept so brief that no reason behind or
-reference information is supplied with.  For a full list of changes
-with all sufficient information, see the ChangeLog file or Redmine
-(e.g. <tt>https://bugs.ruby-lang.org/issues/$FEATURE_OR_BUG_NUMBER</tt>)
-
-== Changes since the 2.3.0 release
-
-=== Language changes
-
-* Multiple assignment in conditional expression is now allowed.
-  [Feature #10617]
-
-=== Core classes updates (outstanding ones only)
-
-* Array
-
-  * Array#max and Array#min.  [Feature #12172]
-    This may cause a tiny incompatibility: if you redefine
-    Enumerable#max and call max to an Array, your redefinition will be
-    now ignored.  You should also redefine Array#max.
-
-  * Array#sum  [Feature #12217]
-    This is different from Enumerable#sum in that Array#sum doesn't depend on
-    the definition of each method.
-
-* Comparable
-
-  * Comparable#clamp.  [Feature #10594]
-
-* Dir
-
-  * Dir.empty?.  [Feature #10121]
-
-* Enumerable
-
-  * Enumerable#sum  [Feature #12217]
-  * Enumerable#uniq  [Feature #11090]
-
-* Enumerator::Lazy
-
-  * Enumerator::Lazy#uniq  [Feature #11090]
-
-* File
-
-  * File.empty?.  [Feature #9969]
-
-* Float
-
-  * Float#ceil, Float#floor, and Float#truncate now take an optional
-    digits, as well as Float#round.  [Feature #12245]
-
-* Hash
-
-  * Hash#transform_values and Hash#transform_values!  [Feature #12512]
-
-* Integer
-
-  * Integer#ceil, Integer#floor, and Integer#truncate now take an optional
-    digits, as well as Integer#round.  [Feature #12245]
-
-  * Fixnum and Bignum are unified into Integer  [Feature #12005]
-
-  * Integer#digits for extracting columns of place-value notation [Feature #12447]
-
-* Kernel
-
-  * Kernel#clone now takes an optional keyword argument, freeze flag.
-    [Feature #12300]
-
-* MatchData
-
-  * MatchData#named_captures [Feature #11999]
-  * MatchData#values_at supports named captures [Feature #9179]
-
-* Regexp
-
-  * Regexp#match? [Feature #8110]
-    This returns bool and doesn't save backref.
-
-* Regexp/String: Updated Unicode version from 8.0.0 to 9.0.0 [Feature #12513]
-
-* RubyVM::Env
-
-  * RubyVM::Env was removed.
-
-* String
-
-  * String#upcase, String#downcase, String#capitalize, String#swapcase and
-    their bang variants work for all of Unicode, and are no longer limited
-    to ASCII. Supported encodings are UTF-8, UTF-16BE/LE, UTF-32BE/LE, and
-    ISO-8859-1~16. Variations are available with options. See the documentation
-    of String#downcase for details. [Feature #10085]
-
-  * String.new(capacity: size) [Feature #12024]
-
-* Symbol
-
-  * Symbol#match now returns MatchData.  [Bug #11991]
-
-  * Symbol#upcase, Symbol#downcase, Symbol#capitalize, and Symbol#swapcase now
-    work for all of Unicode. See the documentation of String#downcase
-    for details. [Feature #10085]
-
-* Thread
-
-  * Thread#report_on_exception and Thread.report_on_exception
-    [Feature #6647]
-
-=== Stdlib updates (outstanding ones only)
-
-* CSV
-
-  * Add a liberal_parsing option. [Feature #11839]
-
-* Logger
-
-	* Allow specifying logger parameters in constructor such
-	  as level, progname, datetime_format, formatter. [Feature #12224]
-	* Add shift_period_suffix option. [Feature #10772]
-
-* OpenSSL
-
-  * OpenSSL is extracted as a gem and the upstream has been migrated to
-    https://github.com/ruby/openssl. OpenSSL still remains as a default gem.
-    Refer to its History.md for the full release note. [Feature #9612]
-
-* optparse
-
-  * Add an into option. [Feature #11191]
-
-=== Compatibility issues (excluding feature bug fixes)
-
-* Array#sum and Enumerable#sum are implemented.  [Feature #12217]
-  Ruby itself has no compatibility problem because Ruby didn't have sum method
-  for arrays before Ruby 2.4.
-  However many third party gems, activesupport, facets, simple_stats, etc,
-  defines sum method.  These implementations are mostly compatible but
-  there are subtle differences.
-  Ruby's sum method should be mostly compatible but it is impossible to
-  be perfectly compatible with all of them.
-
-* Fixnum and Bignum are unified into Integer  [Feature #12005]
-  Fixnum class and Bignum class is removed.
-  Integer class is changed from abstract class to concrete class.
-  For example, 0 is an instance of Integer: 0.class returns Integer.
-  The constants Fixnum and Bignum is bound to Integer.
-  So obj.kind_of?(Fixnum) works as obj.kind_of?(Integer).
-  At C-level, Fixnum object and Bignum object should be distinguished by
-  FIXNUM_P(obj) and RB_TYPE_P(obj, T_BIGNUM).
-  RUBY_INTEGER_UNIFICATION can be used to detect this feature.
-  ruby-2.4.0-preview1 (temporally) removes rb_cFixnum and rb_cBignum
-  to check the effect of incompatibility.
-  (rb_cFixnum and rb_cBignum may be defined as rb_cInteger later if
-  compilation failure of extension library is too big problem.)
-
-* String/Symbol#upcase/downcase/swapcase/capitalize(!) now work for all of
-  Unicode, not only for ASCII. [Feature #10085]
-  No change is needed if the data is in ASCII anyway or if the limitation
-  to ASCII was only tolerated while waiting for a more extensive implementation.
-  A change (using the :ascii option) is needed in cases where Unicode data
-  is processed, but the operation has to be limited to ASCII only.
-  A good example of this are internationalized domain names.
-
-=== Stdlib compatibility issues (excluding feature bug fixes)
-
-* DateTime
-
-  * DateTime#to_time now preserves timezone.  [Bug #12189]
-
-* Time
-
-  * Time#to_time now preserves timezone.  [Bug #12271]
-
-* thread
-
-  * the extension library is removed.  Till 2.0 it was a pure ruby script
-    "thread.rb", which has precedence over "thread.so", and has been provided
-    in $LOADED_FEATURES since 2.1.
-
-* Tk
-  * Tk is removed from stdlib.  [Feature #8539]
-    https://github.com/ruby/tk is the new upstream.
-
-=== C API updates
-
-* ruby_show_version() will no longer exits the process, if
-  RUBY_SHOW_COPYRIGHT_TO_DIE is set to 0.  This will be the default in
-  the future.
-
-=== Supported platform changes
-
-* FreeBSD < 4 is no longer supported
-
-=== Implementation improvements
-
-* In some condition, `[x, y].max` and `[x, y].min` are optimized
-  so that a temporal array is not created.  The concrete condition is
-  an implementation detail: currently, the array literal must have no
-  splat, must have at least one expression but literal, the length must
-  be <= 0x100, and Array#max and min must not be redefined.  It will work
-  in most casual and real-life use case where it is written with intent
-  to `Math.max(x, y)`.
-
-* Thread deadlock detection now shows their backtrace and dependency. [Feature #8214]
diff --git a/README b/README
new file mode 100644
index 0000000000..cf836415ad
--- /dev/null
+++ b/README
@@ -0,0 +1,114 @@
+* What's Ruby
+
+Ruby is the interpreted scripting language for quick and
+easy object-oriented programming.  It has many features to
+process text files and to do system management tasks (as in
+Perl).  It is simple, straight-forward, and extensible.
+
+
+* Features of Ruby
+
+  + Simple Syntax
+  + *Normal* Object-Oriented features(ex. class, method calls)
+  + *Advanced* Object-Oriented features(ex. Mix-in, Singleton-method)
+  + Operator Overloading
+  + Exception Handling
+  + Iterators and Closures
+  + Garbage Collection
+  + Dynamic Loading of Object files(on some architecture)
+  + Highly Portable(works on many UNIX machines, and on DOS,
+    Windows, Mac, BeOS etc.)
+
+
+* How to get Ruby
+
+The Ruby distribution files can be found in the following FTP site:
+
+  ftp://ftp.ruby-lang.org/pub/ruby/
+
+The latest source code of this version series can be checked out
+through SVN with the following command:
+
+  $ svn co http://svn.ruby-lang.org/repos/ruby/branches/ruby_1_8_6/
+
+The trunk of the Ruby source tree can be checked out with the
+following command:
+
+  $ svn co http://svn.ruby-lang.org/repos/ruby/trunk/ ruby
+
+There are some other branches under development.  Try the following
+command and see the list of branches:
+
+  $ svn ls http://svn.ruby-lang.org/repos/ruby/branches/
+
+
+* Ruby home-page
+
+The URL of the Ruby home-page is:
+
+   http://www.ruby-lang.org/
+
+
+* Mailing list
+
+There is a mailing list to talk about Ruby.
+To subscribe this list, please send the following phrase
+
+	subscribe YourFirstName YourFamilyName
+e.g.
+        subscribe Joseph Smith
+
+in the mail body (not subject) to the address <ruby-talk-ctl@ruby-lang.org>.
+
+
+* How to compile and install
+
+This is what you need to do to compile and install Ruby:
+
+  1. If ./configure does not exist or is older than configure.in,
+     run autoconf to (re)generate configure.
+
+  2. Run ./configure, which will generate config.h and Makefile.
+
+  3. Edit defines.h if you need.  Usually this step will not be needed.
+
+  4. Remove comment mark(#) before the module names from ext/Setup (or
+     add module names if not present), if you want to link modules
+     statically.
+
+     If you don't want to compile non static extension modules
+     (probably on architectures which does not allow dynamic loading),
+     remove comment mark from the line "#option nodynamic" in
+     ext/Setup.
+
+  5. Run make.
+
+  6. Optionally, run 'make test' to check whether the compiled Ruby
+     interpreter works well.  If you see the message "test succeeded",
+     your ruby works as it should (hopefully).
+
+  7. Run 'make install'
+
+     You may have to be a super user to install ruby.
+
+If you fail to compile ruby, please send the detailed error report with
+the error log and machine/OS type, to help others.
+
+
+* Copying
+
+See the file COPYING.
+
+
+* The Author
+
+Feel free to send comments and bug reports to the author.  Here is the 
+author's latest mail address:
+
+  matz@netlab.jp
+
+-------------------------------------------------------
+created at: Thu Aug  3 11:57:36 JST 1995
+Local variables:
+mode: indented-text
+end:
diff --git a/README.EXT b/README.EXT
index 48b8d964c4..e5d39911ca 100644
--- a/README.EXT
+++ b/README.EXT
@@ -1 +1,1133 @@
-Moved to doc/extension.rdoc
+.\" README.EXT -  -*- Text -*- created at: Mon Aug  7 16:45:54 JST 1995
+
+This document explains how to make extension libraries for Ruby.
+
+1. Basic knowledge
+
+In C, variables have types and data do not have types.  In contrast,
+Ruby variables do not have a static type, and data themselves have
+types, so data will need to be converted between the languages.
+
+Data in Ruby are represented by C type `VALUE'.  Each VALUE data has
+its data-type.
+
+To retrieve C data from a VALUE, you need to:
+
+ (1) Identify the VALUE's data type
+ (2) Convert the VALUE into C data
+
+Converting to the wrong data type may cause serious problems.
+
+
+1.1 Data-types
+
+The Ruby interpreter has the following data types:
+
+	T_NIL		nil
+	T_OBJECT	ordinary object
+	T_CLASS		class
+	T_MODULE	module
+	T_FLOAT		floating point number
+	T_STRING	string
+	T_REGEXP	regular expression
+	T_ARRAY		array
+	T_FIXNUM	Fixnum(31bit integer)
+	T_HASH		associative array
+	T_STRUCT	(Ruby) structure
+	T_BIGNUM	multi precision integer
+	T_FILE		IO
+	T_TRUE		true
+	T_FALSE		false
+	T_DATA		data
+	T_SYMBOL        symbol
+
+In addition, there are several other types used internally:
+
+	T_ICLASS
+	T_MATCH
+	T_UNDEF
+	T_VARMAP
+	T_SCOPE
+	T_NODE
+
+Most of the types are represented by C structures.
+
+1.2 Check Data Type of the VALUE
+
+The macro TYPE() defined in ruby.h shows the data type of the VALUE.
+TYPE() returns the constant number T_XXXX described above.  To handle
+data types, your code will look something like this:
+
+  switch (TYPE(obj)) {
+    case T_FIXNUM:
+      /* process Fixnum */
+      break;
+    case T_STRING:
+      /* process String */
+      break;
+    case T_ARRAY:
+      /* process Array */
+      break;
+    default:
+      /* raise exception */
+      rb_raise(rb_eTypeError, "not valid value");
+      break;
+  }
+
+There is the data-type check function
+
+  void Check_Type(VALUE value, int type)
+
+which raises an exception if the VALUE does not have the type specified.
+
+There are also faster check macros for fixnums and nil.
+
+  FIXNUM_P(obj)
+  NIL_P(obj)
+
+1.3 Convert VALUE into C data
+
+The data for type T_NIL, T_FALSE, T_TRUE are nil, true, false
+respectively.  They are singletons for the data type.
+
+The T_FIXNUM data is a 31bit length fixed integer (63bit length on
+some machines), which can be convert to a C integer by using the
+FIX2INT() macro.  There is also NUM2INT() which converts any Ruby
+numbers into C integers.  The NUM2INT() macro includes a type check, so
+an exception will be raised if the conversion failed.  NUM2DBL() can
+be used to retrieve the double float value in same way.
+
+To get char* from a VALUE, version 1.7 recommend to use new macros
+StringValue() and StringValuePtr().  StringValue(var) replaces var's
+value to the result of "var.to_str()".  StringValuePtr(var) does same
+replacement and returns char* representation of var.  These macros
+will skip the replacement if var is a String.  Notice that the macros
+requires to take only lvalue as their argument, to change the value
+of var in the replacement. 
+
+In version 1.6 or earlier, STR2CSTR() was used to do same thing
+but now it is obsoleted in version 1.7 because of STR2CSTR() has
+a risk of dangling pointer problem in to_str() impliclit conversion.
+
+Other data types have corresponding C structures, e.g. struct RArray
+for T_ARRAY etc. The VALUE of the type which has corresponding structure
+can be cast to retrieve the pointer to the struct.  The casting macro
+will be of the form RXXXX for each data type; for instance, RARRAY(obj). 
+See "ruby.h".
+
+For example, `RSTRING(str)->len' is the way to get the size of the
+Ruby String object.  The allocated region can be accessed by
+`RSTRING(str)->ptr'.  For arrays, use `RARRAY(ary)->len' and
+`RARRAY(ary)->ptr' respectively.
+
+Notice: Do not change the value of the structure directly, unless you
+are responsible for the result.  This ends up being the cause of interesting
+bugs.
+
+1.4 Convert C data into VALUE
+
+To convert C data to Ruby values:
+
+  * FIXNUM
+
+    left shift 1 bit, and turn on LSB.
+
+  * Other pointer values
+
+    cast to VALUE.
+
+You can determine whether a VALUE is pointer or not by checking its LSB.  
+
+Notice Ruby does not allow arbitrary pointer values to be a VALUE.  They
+should be pointers to the structures which Ruby knows about.  The known
+structures are defined in <ruby.h>.
+
+To convert C numbers to Ruby values, use these macros.
+
+  INT2FIX()	for integers within 31bits.
+  INT2NUM()	for arbitrary sized integer.
+
+INT2NUM() converts an integer into a Bignum if it is out of the FIXNUM
+range, but is a bit slower.
+
+1.5 Manipulating Ruby data
+
+As I already mentioned, it is not recommended to modify an object's internal
+structure.  To manipulate objects, use the functions supplied by the Ruby
+interpreter. Some (not all) of the useful functions are listed below:
+
+ String functions
+
+  rb_str_new(const char *ptr, long len)
+
+    Creates a new Ruby string.
+
+  rb_str_new2(const char *ptr)
+
+    Creates a new Ruby string from a C string.  This is equivalent to
+    rb_str_new(ptr, strlen(ptr)).
+
+  rb_tainted_str_new(const char *ptr, long len)
+
+    Creates a new tainted Ruby string.  Strings from external data
+    sources should be tainted.
+
+  rb_tainted_str_new2(const char *ptr)
+
+    Creates a new tainted Ruby string from a C string.
+
+  rb_str_cat(VALUE str, const char *ptr, long len)
+
+    Appends len bytes of data from ptr to the Ruby string.
+
+ Array functions
+
+  rb_ary_new()
+
+    Creates an array with no elements.
+
+  rb_ary_new2(long len)
+
+    Creates an array with no elements, allocating internal buffer
+    for len elements.
+
+  rb_ary_new3(long n, ...)
+
+    Creates an n-element array from the arguments.
+
+  rb_ary_new4(long n, VALUE *elts)
+
+    Creates an n-element array from a C array.
+
+  rb_ary_push(VALUE ary, VALUE val)
+  rb_ary_pop(VALUE ary)
+  rb_ary_shift(VALUE ary)
+  rb_ary_unshift(VALUE ary, VALUE val)
+
+    Array operations.  The first argument to each functions must be an 
+    array.  They may dump core if other types given.
+
+2. Extending Ruby with C
+
+2.1 Addding new features to Ruby
+
+You can add new features (classes, methods, etc.) to the Ruby
+interpreter.  Ruby provides APIs for defining the following things:
+
+ * Classes, Modules
+ * Methods, Singleton Methods
+ * Constants
+
+2.1.1 Class/module definition
+
+To define a class or module, use the functions below:
+
+  VALUE rb_define_class(const char *name, VALUE super)
+  VALUE rb_define_module(const char *name)
+
+These functions return the newly created class or module.  You may
+want to save this reference into a variable to use later.
+
+To define nested classes or modules, use the functions below:
+
+  VALUE rb_define_class_under(VALUE outer, const char *name, VALUE super)
+  VALUE rb_define_module_under(VALUE outer, const char *name)
+
+2.1.2 Method/singleton method definition
+
+To define methods or singleton methods, use these functions:
+
+  void rb_define_method(VALUE klass, const char *name, 
+		        VALUE (*func)(), int argc)
+
+  void rb_define_singleton_method(VALUE object, const char *name, 
+			          VALUE (*func)(), int argc)
+
+The `argc' represents the number of the arguments to the C function,
+which must be less than 17.  But I believe you don't need that much. :-)
+
+If `argc' is negative, it specifies the calling sequence, not number of
+the arguments.  
+
+If argc is -1, the function will be called as:
+
+  VALUE func(int argc, VALUE *argv, VALUE obj)
+
+where argc is the actual number of arguments, argv is the C array of
+the arguments, and obj is the receiver.
+
+If argc is -2, the arguments are passed in a Ruby array. The function
+will be called like:
+
+  VALUE func(VALUE obj, VALUE args)
+
+where obj is the receiver, and args is the Ruby array containing
+actual arguments.
+
+There are two more functions to define methods.  One is to define
+private methods:
+
+  void rb_define_private_method(VALUE klass, const char *name, 
+			        VALUE (*func)(), int argc)
+
+The other is to define module functions, which are private AND singleton
+methods of the module.  For example, sqrt is the module function
+defined in Math module.  It can be call in the form like:
+
+  Math.sqrt(4)
+
+or
+
+  include Math
+  sqrt(4)
+
+To define module functions, use:
+
+  void rb_define_module_function(VALUE module, const char *name, 
+				 VALUE (*func)(), int argc)
+
+Oh, in addition, function-like methods, which are private methods defined
+in the Kernel module, can be defined using:
+
+  void rb_define_global_function(const char *name, VALUE (*func)(), int argc)
+
+To define alias to the method,
+
+  void rb_define_alias(VALUE module, const char* new, const char* old);
+
+To define and undefine the `allocate' class method,
+
+  void rb_define_alloc_func(VALUE klass, VALUE (*func)(VALUE klass));
+  void rb_undef_alloc_func(VALUE klass);
+
+func have to take the klass as the argument and return a newly
+allocated instance.  This instance should be empty as possible,
+without any expensive (including external) resources.
+
+2.1.3 Constant definition
+
+We have 2 functions to define constants:
+
+  void rb_define_const(VALUE klass, const char *name, VALUE val)
+  void rb_define_global_const(const char *name, VALUE val)
+
+The former is to define a constant under specified class/module.  The
+latter is to define a global constant.
+
+2.2 Use Ruby features from C
+
+There are several ways to invoke Ruby's features from C code.
+
+2.2.1 Evaluate Ruby Programs in a String
+
+The easiest way to use Ruby's functionality from a C program is to
+evaluate the string as Ruby program.  This function will do the job.
+
+  VALUE rb_eval_string(const char *str)
+
+Evaluation is done under the current context, thus current local variables
+of the innermost method (which is defined by Ruby) can be accessed.
+
+2.2.2 ID or Symbol
+
+You can invoke methods directly, without parsing the string.  First I need
+to explain about ID.  ID is the integer number to represent Ruby's
+identifiers such as variable names.  The Ruby data type corresponding to ID
+is Symbol.  It can be accessed from Ruby in the form:
+
+ :Identifier
+
+You can get the ID value from a string within C code by using
+
+  rb_intern(const char *name)
+
+You can retrieve ID from Ruby object (Symbol or String) given as an
+argument by using
+
+  rb_to_id(VALUE symbol)
+
+You can convert C ID to Ruby Symbol by using
+
+  VALUE ID2SYM(ID id)
+
+and to convert Ruby Symbol object to ID, use
+
+  ID SYM2ID(VALUE symbol)
+
+2.2.3 Invoke Ruby method from C
+
+To invoke methods directly, you can use the function below
+
+  VALUE rb_funcall(VALUE recv, ID mid, int argc, ...)
+
+This function invokes a method on the recv, with the method name
+specified by the symbol mid.
+
+2.2.4 Accessing the variables and constants
+
+You can access class variables and instance variables using access
+functions.  Also, global variables can be shared between both environments.
+There's no way to access Ruby's local variables.
+
+The functions to access/modify instance variables are below:
+
+  VALUE rb_ivar_get(VALUE obj, ID id)
+  VALUE rb_ivar_set(VALUE obj, ID id, VALUE val)
+
+id must be the symbol, which can be retrieved by rb_intern().
+
+To access the constants of the class/module:
+
+  VALUE rb_const_get(VALUE obj, ID id)
+
+See 2.1.3 for defining new constant.
+
+3. Information sharing between Ruby and C
+
+3.1 Ruby constants that C can be accessed from C
+
+The following Ruby constants can be referred from C.
+
+  Qtrue
+  Qfalse
+
+Boolean values.  Qfalse is false in C also (i.e. 0).
+
+  Qnil
+
+Ruby nil in C scope.
+
+3.2 Global variables shared between C and Ruby
+
+Information can be shared between the two environments using shared global
+variables.  To define them, you can use functions listed below:
+
+  void rb_define_variable(const char *name, VALUE *var)
+
+This function defines the variable which is shared by both environments.
+The value of the global variable pointed to by `var' can be accessed
+through Ruby's global variable named `name'.
+
+You can define read-only (from Ruby, of course) variables using the
+function below.
+
+  void rb_define_readonly_variable(const char *name, VALUE *var)
+
+You can defined hooked variables.  The accessor functions (getter and
+setter) are called on access to the hooked variables.
+
+  void rb_define_hooked_variable(constchar *name, VALUE *var,
+				 VALUE (*getter)(), void (*setter)())
+
+If you need to supply either setter or getter, just supply 0 for the
+hook you don't need.  If both hooks are 0, rb_define_hooked_variable()
+works just like rb_define_variable().
+
+  void rb_define_virtual_variable(const char *name,
+				  VALUE (*getter)(), void (*setter)())
+
+This function defines a Ruby global variable without a corresponding C
+variable.  The value of the variable will be set/get only by hooks.
+
+The prototypes of the getter and setter functions are as follows:
+
+  (*getter)(ID id, void *data, struct global_entry* entry);
+  (*setter)(VALUE val, ID id, void *data, struct global_entry* entry);
+
+3.3 Encapsulate C data into Ruby object
+
+To wrap and objectify a C pointer as a Ruby object (so called
+DATA), use Data_Wrap_Struct().
+
+  Data_Wrap_Struct(klass, mark, free, ptr)
+
+Data_Wrap_Struct() returns a created DATA object.  The klass argument
+is the class for the DATA object.  The mark argument is the function
+to mark Ruby objects pointed by this data.  The free argument is the
+function to free the pointer allocation.  If this is -1, the pointer
+will be just freed.  The functions mark and free will be called from
+garbage collector.
+
+You can allocate and wrap the structure in one step.
+
+  Data_Make_Struct(klass, type, mark, free, sval)
+
+This macro returns an allocated Data object, wrapping the pointer to
+the structure, which is also allocated.  This macro works like:
+
+  (sval = ALLOC(type), Data_Wrap_Struct(klass, mark, free, sval))
+
+Arguments klass, mark, and free work like their counterparts in
+Data_Wrap_Struct().  A pointer to the allocated structure will be
+assigned to sval, which should be a pointer of the type specified.
+
+To retrieve the C pointer from the Data object, use the macro
+Data_Get_Struct().
+
+  Data_Get_Struct(obj, type, sval)
+
+A pointer to the structure will be assigned to the variable sval.
+
+See the example below for details. 
+
+4. Example - Creating dbm extension
+
+OK, here's the example of making an extension library.  This is the
+extension to access DBMs.  The full source is included in the ext/
+directory in the Ruby's source tree.
+
+(1) make the directory
+
+  % mkdir ext/dbm
+
+Make a directory for the extension library under ext directory.
+
+(2) design the library
+
+You need to design the library features, before making it.
+
+(3) write C code.
+
+You need to write C code for your extension library.  If your library
+has only one source file, choosing ``LIBRARY.c'' as a file name is
+preferred.  On the other hand, in case your library has multiple source
+files, avoid choosing ``LIBRARY.c'' for a file name.  It may conflict
+with an intermediate file ``LIBRARY.o'' on some platforms.
+
+Ruby will execute the initializing function named ``Init_LIBRARY'' in
+the library.  For example, ``Init_dbm()'' will be executed when loading
+the library.
+
+Here's the example of an initializing function.
+
+--
+Init_dbm()
+{
+    /* define DBM class */
+    cDBM = rb_define_class("DBM", rb_cObject);
+    /* DBM includes Enumerate module */
+    rb_include_module(cDBM, rb_mEnumerable);
+
+    /* DBM has class method open(): arguments are received as C array */
+    rb_define_singleton_method(cDBM, "open", fdbm_s_open, -1);
+
+    /* DBM instance method close(): no args */
+    rb_define_method(cDBM, "close", fdbm_close, 0);
+    /* DBM instance method []: 1 argument */
+    rb_define_method(cDBM, "[]", fdbm_fetch, 1);
+		:
+
+    /* ID for a instance variable to store DBM data */
+    id_dbm = rb_intern("dbm");
+}
+--
+
+The dbm extension wraps the dbm struct in the C environment using 
+Data_Make_Struct.
+
+--
+struct dbmdata {
+    int  di_size;
+    DBM *di_dbm;
+};
+
+
+obj = Data_Make_Struct(klass, struct dbmdata, 0, free_dbm, dbmp);
+--
+
+This code wraps the dbmdata structure into a Ruby object.  We avoid wrapping
+DBM* directly, because we want to cache size information.
+
+To retrieve the dbmdata structure from a Ruby object, we define the
+following macro:
+
+--
+#define GetDBM(obj, dbmp) {\
+    Data_Get_Struct(obj, struct dbmdata, dbmp);\
+    if (dbmp->di_dbm == 0) closed_dbm();\
+}
+--
+
+This sort of complicated macro does the retrieving and close checking for
+the DBM.
+
+There are three kinds of way to receive method arguments.  First,
+methods with a fixed number of arguments receive arguments like this:
+
+--
+static VALUE
+fdbm_delete(obj, keystr)
+    VALUE obj, keystr;
+{
+	:
+}
+--
+
+The first argument of the C function is the self, the rest are the
+arguments to the method.
+
+Second, methods with an arbitrary number of arguments receive
+arguments like this:
+
+--
+static VALUE
+fdbm_s_open(argc, argv, klass)
+    int argc;
+    VALUE *argv;
+    VALUE klass;
+{
+	:
+    if (rb_scan_args(argc, argv, "11", &file, &vmode) == 1) {
+	mode = 0666;		/* default value */
+    }
+	:
+}
+--
+
+The first argument is the number of method arguments, the second
+argument is the C array of the method arguments, and the third
+argument is the receiver of the method.
+
+You can use the function rb_scan_args() to check and retrieve the
+arguments.  For example, "11" means that the method requires at least one
+argument, and at most receives two arguments.
+
+Methods with an arbitrary number of arguments can receive arguments
+by Ruby's array, like this:
+
+--
+static VALUE
+fdbm_indexes(obj, args)
+    VALUE obj, args;
+{
+	:
+}
+--
+
+The first argument is the receiver, the second one is the Ruby array
+which contains the arguments to the method.
+
+** Notice
+
+GC should know about global variables which refer to Ruby's objects, but
+are not exported to the Ruby world.  You need to protect them by
+
+  void rb_global_variable(VALUE *var)
+
+(4) prepare extconf.rb
+
+If the file named extconf.rb exists, it will be executed to generate
+Makefile.
+
+extconf.rb is the file for check compilation conditions etc.  You
+need to put
+
+  require 'mkmf'
+
+at the top of the file.  You can use the functions below to check
+various conditions.
+
+  have_library(lib, func): check whether library containing function exists.
+  have_func(func, header): check whether function exists
+  have_header(header): check whether header file exists
+  create_makefile(target): generate Makefile
+
+The value of the variables below will affect the Makefile.
+
+  $CFLAGS: included in CFLAGS make variable (such as -O)
+  $CPPFLAGS: included in CPPFLAGS make variable (such as -I, -D)
+  $LDFLAGS: included in LDFLAGS make variable (such as -L)
+  $objs: list of object file names
+
+In normal, object files list is automatically generated by searching
+source files, but you need directs them explicitly if any sources will
+be generated while building.
+
+If a compilation condition is not fulfilled, you should not call
+``create_makefile''.  The Makefile will not generated, compilation will
+not be done.
+
+(5) prepare depend (optional)
+
+If the file named depend exists, Makefile will include that file to
+check dependencies.  You can make this file by invoking
+
+  % gcc -MM *.c > depend
+
+It's no harm.  Prepare it.
+
+(6) generate Makefile
+
+Try generating the Makefile by:
+
+  ruby extconf.rb
+
+You don't need this step if you put the extension library under the ext
+directory of the ruby source tree.  In that case, compilation of the
+interpreter will do this step for you.
+
+(7) make
+
+Type
+
+  make
+
+to compile your extension.  You don't need this step either if you have
+put extension library under the ext directory of the ruby source tree.
+
+(8) debug
+
+You may need to rb_debug the extension.  Extensions can be linked
+statically by the adding directory name in the ext/Setup file so that
+you can inspect the extension with the debugger.
+
+(9) done, now you have the extension library
+
+You can do anything you want with your library.  The author of Ruby
+will not claim any restrictions on your code depending on the Ruby API.
+Feel free to use, modify, distribute or sell your program.
+
+Appendix A. Ruby source files overview
+
+ruby language core
+
+  class.c
+  error.c
+  eval.c
+  gc.c
+  object.c
+  parse.y
+  variable.c
+
+utility functions
+
+  dln.c
+  regex.c
+  st.c
+  util.c
+
+ruby interpreter implementation
+
+  dmyext.c
+  inits.c
+  main.c
+  ruby.c
+  version.c
+
+class library
+
+  array.c
+  bignum.c
+  compar.c
+  dir.c
+  enum.c
+  file.c
+  hash.c
+  io.c
+  marshal.c
+  math.c
+  numeric.c
+  pack.c
+  prec.c
+  process.c
+  random.c
+  range.c
+  re.c
+  signal.c
+  sprintf.c
+  string.c
+  struct.c
+  time.c
+
+Appendix B. Ruby extension API reference
+
+** Types
+
+ VALUE
+
+The type for the Ruby object.  Actual structures are defined in ruby.h,
+such as struct RString, etc.  To refer the values in structures, use
+casting macros like RSTRING(obj).
+
+** Variables and constants
+
+ Qnil
+
+const: nil object
+
+ Qtrue
+
+const: true object(default true value)
+
+ Qfalse
+
+const: false object
+
+** C pointer wrapping
+
+ Data_Wrap_Struct(VALUE klass, void (*mark)(), void (*free)(), void *sval)
+
+Wrap a C pointer into a Ruby object.  If object has references to other
+Ruby objects, they should be marked by using the mark function during
+the GC process.  Otherwise, mark should be 0.  When this object is no
+longer referred by anywhere, the pointer will be discarded by free
+function.
+
+ Data_Make_Struct(klass, type, mark, free, sval)
+
+This macro allocates memory using malloc(), assigns it to the variable
+sval, and returns the DATA encapsulating the pointer to memory region.
+
+ Data_Get_Struct(data, type, sval)
+
+This macro retrieves the pointer value from DATA, and assigns it to
+the variable sval. 
+
+** Checking data types
+
+TYPE(value)
+FIXNUM_P(value)
+NIL_P(value)
+void Check_Type(VALUE value, int type)
+void Check_SafeStr(VALUE value)
+
+** Data type conversion
+
+FIX2INT(value)
+INT2FIX(i)
+NUM2INT(value)
+INT2NUM(i)
+NUM2DBL(value)
+rb_float_new(f)
+StringValue(value)
+StringValuePtr(value)
+StringValueCStr(value)
+rb_str_new2(s)
+
+** defining class/module
+
+ VALUE rb_define_class(const char *name, VALUE super)
+
+Defines a new Ruby class as a subclass of super.
+
+ VALUE rb_define_class_under(VALUE module, const char *name, VALUE super)
+
+Creates a new Ruby class as a subclass of super, under the module's
+namespace.
+
+ VALUE rb_define_module(const char *name)
+
+Defines a new Ruby module.
+
+ VALUE rb_define_module_under(VALUE module, const char *name)
+
+Defines a new Ruby module under the module's namespace.
+
+ void rb_include_module(VALUE klass, VALUE module)
+
+Includes module into class.  If class already includes it, just
+ignored.
+
+ void rb_extend_object(VALUE object, VALUE module)
+
+Extend the object with the module's attributes.
+
+** Defining Global Variables
+
+ void rb_define_variable(const char *name, VALUE *var)
+
+Defines a global variable which is shared between C and Ruby.  If name
+contains a character which is not allowed to be part of the symbol,
+it can't be seen from Ruby programs.
+
+ void rb_define_readonly_variable(const char *name, VALUE *var)
+
+Defines a read-only global variable.  Works just like
+rb_define_variable(), except defined variable is read-only.
+
+ void rb_define_virtual_variable(const char *name,
+				 VALUE (*getter)(), VALUE (*setter)())
+
+Defines a virtual variable, whose behavior is defined by a pair of C
+functions.  The getter function is called when the variable is
+referred.  The setter function is called when the value is set to the
+variable.  The prototype for getter/setter functions are:
+
+	VALUE getter(ID id)
+	void setter(VALUE val, ID id)
+
+The getter function must return the value for the access.
+
+ void rb_define_hooked_variable(const char *name, VALUE *var,
+				VALUE (*getter)(), VALUE (*setter)())
+
+Defines hooked variable.  It's a virtual variable with a C variable.  
+The getter is called as
+
+	VALUE getter(ID id, VALUE *var)
+
+returning a new value.  The setter is called as
+
+	void setter(VALUE val, ID id, VALUE *var)
+
+GC requires C global variables which hold Ruby values to be marked.
+
+ void rb_global_variable(VALUE *var)
+
+Tells GC to protect these variables.
+
+** Constant Definition
+
+ void rb_define_const(VALUE klass, const char *name, VALUE val)
+
+Defines a new constant under the class/module.
+
+ void rb_define_global_const(const char *name, VALUE val)
+
+Defines a global constant.  This is just the same as
+
+     rb_define_const(cKernal, name, val)
+
+** Method Definition
+
+ rb_define_method(VALUE klass, const char *name, VALUE (*func)(), int argc)
+
+Defines a method for the class.  func is the function pointer.  argc
+is the number of arguments.  if argc is -1, the function will receive
+3 arguments: argc, argv, and self.  if argc is -2, the function will
+receive 2 arguments, self and args, where args is a Ruby array of
+the method arguments.
+
+ rb_define_private_method(VALUE klass, const char *name, VALUE (*func)(), int argc)
+
+Defines a private method for the class.  Arguments are same as
+rb_define_method().
+
+ rb_define_singleton_method(VALUE klass, const char *name, VALUE (*func)(), int argc)
+
+Defines a singleton method.  Arguments are same as rb_define_method().
+
+ rb_scan_args(int argc, VALUE *argv, const char *fmt, ...)
+
+Retrieve argument from argc, argv.  The fmt is the format string for
+the arguments, such as "12" for 1 non-optional argument, 2 optional
+arguments.  If `*' appears at the end of fmt, it means the rest of
+the arguments are assigned to the corresponding variable, packed in
+an array.
+
+** Invoking Ruby method
+
+ VALUE rb_funcall(VALUE recv, ID mid, int narg, ...)
+
+Invokes a method.  To retrieve mid from a method name, use rb_intern().
+
+ VALUE rb_funcall2(VALUE recv, ID mid, int argc, VALUE *argv)
+
+Invokes a method, passing arguments by an array of values.
+
+ VALUE rb_eval_string(const char *str)
+
+Compiles and executes the string as a Ruby program.
+
+ ID rb_intern(const char *name)
+
+Returns ID corresponding to the name.
+
+ char *rb_id2name(ID id)
+
+Returns the name corresponding ID.
+
+ char *rb_class2name(VALUE klass)
+
+Returns the name of the class.
+
+ int rb_respond_to(VALUE object, ID id)
+
+Returns true if the object responds to the message specified by id.
+
+** Instance Variables
+
+ VALUE rb_iv_get(VALUE obj, const char *name)
+
+Retrieve the value of the instance variable.  If the name is not
+prefixed by `@', that variable shall be inaccessible from Ruby.
+
+ VALUE rb_iv_set(VALUE obj, const char *name, VALUE val)
+
+Sets the value of the instance variable.
+
+** Control Structure
+
+ VALUE rb_iterate(VALUE (*func1)(), void *arg1, VALUE (*func2)(), void *arg2)
+
+Calls the function func1, supplying func2 as the block.  func1 will be
+called with the argument arg1.  func2 receives the value from yield as
+the first argument, arg2 as the second argument.
+ 
+ VALUE rb_yield(VALUE val)
+
+Evaluates the block with value val.
+
+ VALUE rb_rescue(VALUE (*func1)(), void *arg1, VALUE (*func2)(), void *arg2)
+
+Calls the function func1, with arg1 as the argument.  If an exception
+occurs during func1, it calls func2 with arg2 as the argument.  The
+return value of rb_rescue() is the return value from func1 if no
+exception occurs, from func2 otherwise.
+
+ VALUE rb_ensure(VALUE (*func1)(), void *arg1, void (*func2)(), void *arg2)
+
+Calls the function func1 with arg1 as the argument, then calls func2
+with arg2 if execution terminated.  The return value from
+rb_ensure() is that of func1.
+
+** Exceptions and Errors
+
+ void rb_warn(const char *fmt, ...)
+
+Prints a warning message according to a printf-like format.
+
+ void rb_warning(const char *fmt, ...)
+
+Prints a warning message according to a printf-like format, if
+$VERBOSE is true.
+
+void rb_raise(rb_eRuntimeError, const char *fmt, ...)
+
+Raises RuntimeError.  The fmt is a format string just like printf().
+
+ void rb_raise(VALUE exception, const char *fmt, ...)
+
+Raises a class exception.  The fmt is a format string just like printf().
+
+ void rb_fatal(const char *fmt, ...)
+
+Raises a fatal error, terminates the interpreter.  No exception handling
+will be done for fatal errors, but ensure blocks will be executed.
+
+ void rb_bug(const char *fmt, ...)
+
+Terminates the interpreter immediately.  This function should be
+called under the situation caused by the bug in the interpreter.  No
+exception handling nor ensure execution will be done.
+
+** Initialize and Starts the Interpreter
+
+The embedding API functions are below (not needed for extension libraries):
+
+ void ruby_init()
+
+Initializes the interpreter.
+
+ void ruby_options(int argc, char **argv)
+
+Process command line arguments for the interpreter.
+
+ void ruby_run()
+
+Starts execution of the interpreter.
+
+ void ruby_script(char *name)
+
+Specifies the name of the script ($0).
+
+Appendix C. Functions Available in extconf.rb
+
+These functions are available in extconf.rb:
+
+ have_macro(macro, headers)
+
+Checks whether macro is defined with header.  Returns true if the macro
+is defined.
+
+ have_library(lib, func)
+
+Checks whether the library exists, containing the specified function.
+Returns true if the library exists.
+
+ find_library(lib, func, path...)
+
+Checks whether a library which contains the specified function exists in
+path.  Returns true if the library exists.
+
+ have_func(func, header)
+
+Checks whether func exists with header.  Returns true if the function
+exists.  To check functions in an additional library, you need to
+check that library first using have_library().
+
+ have_var(var, header)
+
+Checks whether var exists with header.  Returns true if the variable
+exists.  To check variables in an additional library, you need to
+check that library first using have_library().
+
+ have_header(header)
+
+Checks whether header exists.  Returns true if the header file exists.
+
+ find_header(header, path...)
+
+Checks whether header exists in path.  Returns true if the header file
+exists.
+
+ have_struct_member(type, member, header)
+
+Checks whether type has member with header.  Returns true if the type
+is defined and has the member.
+
+ have_type(type, header, opt)
+
+Checks whether type is defined with header.  Returns true if the type
+is defined.
+
+ check_sizeof(type, header)
+
+Checks the size of type in char with header.  Returns the size if the
+type is defined, otherwise nil.
+
+ create_makefile(target)
+
+Generates the Makefile for the extension library.  If you don't invoke
+this method, the compilation will not be done.
+
+ find_executable(bin, path)
+
+Finds command in path, which is File::PATH_SEPARATOR-separated list of
+directories.  If path is nil or omitted, environment varialbe PATH
+will be used.  Returns the path name of the command if it is found,
+otherwise nil.
+
+ with_config(withval[, default=nil])
+
+Parses the command line options and returns the value specified by
+--with-<withval>.
+
+ enable_config(config, *defaults)
+ disable_config(config, *defaults)
+
+Parses the command line options for boolean.  Returns true if
+--enable-<config> is given, or false if --disable-<config> is given.
+Otherwise, yields defaults to the given block and returns the result
+if it is called with a block, or returns defaults.
+
+ dir_config(target[, default_dir])
+ dir_config(target[, default_include, default_lib])
+
+Parses the command line options and adds the directories specified by
+--with-<target>-dir, --with-<target>-include, and/or --with-<target>-lib
+to $CFLAGS and/or $LDFLAGS.  --with-<target>-dir=/path is equivalent to
+--with-<target>-include=/path/include --with-<target>-lib=/path/lib.
+Returns an array of the added directories ([include_dir, lib_dir]).
+
+ pkg_config(pkg)
+
+Obtains the information of pkg by pkg-config command.  The actual
+command name can be overriden by --with-pkg-config command line
+option.
+
+/*
+ * Local variables:
+ * fill-column: 70
+ * end:
+ */
diff --git a/README.EXT.ja b/README.EXT.ja
index f884ecbb0e..30c4d520ba 100644
--- a/README.EXT.ja
+++ b/README.EXT.ja
@@ -1 +1,1258 @@
-doc/extension.ja.rdocに移動しました
+.\" README.EXT.ja -  -*- Text -*- created at: Mon Aug  7 16:45:54 JST 1995
+
+Ruby�γ�ĥ�饤�֥��κ�������������ޤ���
+
+1�������μ�
+
+C���ѿ��ˤϷ������ꡤ�ǡ����ˤϷ�������ޤ��󡥤Ǥ����顤��
+�Ȥ��Хݥ��󥿤�int���ѿ�����������ȡ������ͤ������Ȥ��Ƽ�
+�갷���ޤ����դ�Ruby���ѿ��ˤϷ����ʤ����ǡ����˷��������
+�������ΰ㤤�Τ��ᡤC��Ruby����ߤ��Ѵ����ʤ���С����ߤ���
+�ǡ����򥢥������Ǥ��ޤ���
+
+Ruby�Υǡ�����VALUE�Ȥ���C�η���ɽ������ޤ���VALUE���Υǡ�
+���Ϥ��Υǡ��������פ�ʬ���ΤäƤ��ޤ������Υǡ��������פ�
+�����Τϥǡ���(���֥�������)�μºݤι�¤���̣���Ƥ��ơ�Ruby
+�Υ��饹�ȤϤޤ���ä���ΤǤ���
+
+VALUE����C�ˤȤäư�̣�Τ���ǡ�������Ф�����ˤ�
+
+ (1) VALUE�Υǡ��������פ��Τ�
+ (2) VALUE��C�Υǡ������Ѵ�����
+
+��ξ����ɬ�פǤ���(1)��˺���ȴְ�ä��ǡ������Ѵ����Ԥ��
+�ơ��ǰ��ץ�����बcore dump���ޤ���
+
+1.1 �ǡ���������
+
+Ruby�ˤϥ桼�����Ȥ���ǽ���Τ���ʲ��Υ����פ�����ޤ���
+
+	T_NIL		nil
+	T_OBJECT	�̾�Υ��֥�������
+	T_CLASS		���饹
+	T_MODULE	�⥸�塼��
+	T_FLOAT		��ư��������
+	T_STRING	ʸ����
+	T_REGEXP	����ɽ��
+	T_ARRAY		����
+	T_FIXNUM	Fixnum(31bit����)
+	T_HASH		Ϣ������
+	T_STRUCT	(Ruby��)��¤��
+	T_BIGNUM	¿��Ĺ����
+	T_FILE		������
+	T_TRUE		��
+	T_FALSE		��
+	T_DATA		�ǡ���
+	T_SYMBOL	����ܥ�
+
+����¾�����������Ѥ���Ƥ���ʲ��Υ����פ�����ޤ���
+
+	T_ICLASS
+	T_MATCH
+	T_UNDEF
+	T_VARMAP
+	T_SCOPE
+	T_NODE
+
+�ۤȤ�ɤΥ����פ�C�ι�¤�ΤǼ�������Ƥ��ޤ���
+
+1.2 VALUE�Υǡ��������פ�����å�����
+
+ruby.h�Ǥ�TYPE()�Ȥ����ޥ������������Ƥ��ơ�VALUE�Υǡ���
+�����פ��Τ뤳�Ȥ�����ޤ���TYPE()�ޥ����Ͼ�ǾҲ𤷤�T_XXXX
+�η�����������֤��ޤ���VALUE�Υǡ��������פ˱����ƽ�������
+���ˤϡ�TYPE()���ͤ�ʬ�����뤳�Ȥˤʤ�ޤ���
+
+  switch (TYPE(obj)) {
+    case T_FIXNUM:
+      /* FIXNUM��� */
+      break;
+    case T_STRING:
+      /* ʸ����ν��� */
+      break;
+    case T_ARRAY:
+      /* ������ */
+      break;
+    default:
+      /* �㳰��ȯ�������� */
+      rb_raise(rb_eTypeError, "not valid value");
+      break;
+  }
+
+����ȥǡ��������פ�����å����ơ��������ʤ�����㳰��ȯ����
+��ؿ����Ѱդ���Ƥ��ޤ���
+
+  void Check_Type(VALUE value, int type)
+
+���δؿ���value��type��̵����С��㳰��ȯ�������ޤ���������
+����Ϳ����줿VALUE�Υǡ��������פ����������ɤ��������å���
+�뤿��ˤϡ����δؿ���Ȥ��ޤ���
+
+FIXNUM��NIL�˴ؤ��ƤϤ���®��Ƚ�̥ޥ������Ѱդ���Ƥ��ޤ���
+
+  FIXNUM_P(obj)
+  NIL_P(obj)
+
+1.3 VALUE��C�Υǡ������Ѵ�����
+
+�ǡ��������פ�T_NIL, T_FALSE, T_TRUE�Ǥ�������ǡ����Ϥ��줾
+��nil, false, true�Ǥ������Υǡ��������פΥ��֥������ȤϤҤ�
+�Ĥ��Ĥ���¸�ߤ��ޤ���
+
+�ǡ��������פ�T_FIXNUM�λ��������31bit�Υ����������������
+����FIXNUM��C���������Ѵ����뤿��ˤϥޥ�����FIX2INT()�פ��
+���ޤ������줫�顤FIXNUM�˸¤餺Ruby�Υǡ������������Ѵ�����
+��NUM2INT()�פȤ����ޥ���������ޤ������Υޥ����ϥǡ�������
+�פΥ����å�̵���ǻȤ��ޤ�(�������Ѵ��Ǥ��ʤ����ˤ��㳰��
+ȯ������)��Ʊ�ͤ˥����å�̵���ǻȤ����Ѵ��ޥ�����double��
+���Ф���NUM2DBL()�פ�����ޤ���
+
+char* ����Ф���硢version 1.6 �����Ǥϡ�STR2CSTR()�פ�
+�����ޥ�����ȤäƤ��ޤ������������ to_str() �ˤ����ۤ�
+���Ѵ���̤� GC ������ǽ�������뤿�ᡢversion 1.7 �ʹߤǤ�
+obsolete �Ȥʤꡢ����� StringValue() �� StringValuePtr()
+��Ȥ�����侩���Ƥ��ޤ���StringValue(var) �� var �� String
+ �Ǥ���в��⤻���������Ǥʤ���� var �� var.to_str() �η�̤�
+�֤�������ޥ�����StringValuePtr(var) ��Ʊ�ͤ� var ���֤�����
+�Ƥ��� var ��ʸ����ɽ�����Ф��� char* ���֤��ޥ����Ǥ���var ��
+���Ƥ�ľ���֤����������������Τǡ�var �� lvalue �Ǥ���ɬ�פ�
+����ޤ���
+
+����ʳ��Υǡ��������פ��б�����C�ι�¤�Τ�����ޤ����б���
+�빽¤�ΤΤ���VALUE�Ϥ��Τޤޥ��㥹��(���Ѵ�)����й�¤�Τ�
+�ݥ��󥿤��Ѵ��Ǥ��ޤ���
+
+��¤�Τϡ�struct RXxxxx�פȤ���̾����ruby.h���������Ƥ���
+�����㤨��ʸ����ϡ�struct RString�פǤ����ºݤ˻Ȥ���ǽ����
+����Τ�ʸ��������󤯤餤���Ȼפ��ޤ���
+
+ruby.h�ǤϹ�¤�Τإ��㥹�Ȥ���ޥ������RXXXXX()��(������ʸ
+���ˤ������)�Ȥ���̾�����󶡤���Ƥ��ޤ�(��: RSTRING())��
+
+�㤨�С�ʸ����str��Ĺ�������뤿��ˤϡ�RSTRING(str)->len�פ�
+����ʸ����str��char*�Ȥ������뤿��ˤϡ�RSTRING(str)->ptr��
+�Ȥ��ޤ�������ξ��ˤϡ����줾���RARRAY(ary)->len�ס�
+��RARRAY(ary)->ptr�פȤʤ�ޤ���
+
+Ruby�ι�¤�Τ�ľ�ܥ�������������˵���Ĥ��ʤ���Фʤ�ʤ���
+�Ȥϡ������ʸ����ι�¤�Τ���Ȥϻ��Ȥ�������ǡ�ľ���ѹ���
+�ʤ����ȤǤ���ľ���ѹ�������硤���֥������Ȥ����Ƥ���������
+�Ȥ�ʤ��ʤäơ��פ�̥Х��θ����ˤʤ�ޤ���
+
+1.4 C�Υǡ�����VALUE���Ѵ�����
+
+VALUE�μºݤι�¤��
+
+  * FIXNUM��
+
+    1bit�����եȤ��ơ�LSB��Ω�Ƥ롥
+
+  * ����¾�Υݥ��󥿤ξ��
+
+    ���Τޤ�VALUE�˥��㥹�Ȥ��롥
+
+�ȤʤäƤ��ޤ�����äơ�LSB������å������VALUE��FIXNUM����
+�����狼��櫓�Ǥ�(�ݥ��󥿤�LSB��Ω�äƤ��ʤ����Ȥ��ꤷ��
+����)��
+
+�Ǥ����顤FIXNUM�ʳ���Ruby�Υ��֥������Ȥι�¤�Τ�ñ��VALUE
+�˥��㥹�Ȥ��������VALUE���Ѵ�����ޤ�����������Ǥ�դι�¤
+�Τ�VALUE�˥��㥹�Ƚ����櫓�ǤϤ���ޤ��󡥥��㥹�Ȥ����
+��Ruby���ΤäƤ��빽¤��(ruby.h���������Ƥ���struct RXxxx
+�Τ��)�����Ǥ���
+
+FIXNUM�˴ؤ��Ƥ��Ѵ��ޥ������ͳ����ɬ�פ�����ޤ���C������
+����VALUE���Ѵ�����ޥ����ϰʲ��Τ�Τ�����ޤ���ɬ�פ˱���
+�ƻȤ�ʬ���Ƥ���������
+
+  INT2FIX()	��Ȥ�������31bit����˼��ޤ뼫���������
+  INT2NUM()	Ǥ�դ���������VALUE��
+
+INT2NUM()��������FIXNUM���ϰϤ˼��ޤ�ʤ���硤Bignum���Ѵ�
+���Ƥ���ޤ�(���������٤�)��
+
+1.5 Ruby�Υǡ���������
+
+������Ҥ٤��̤ꡤRuby�ι�¤�Τ򥢥���������������Ƥι�����
+�Ԥ����Ȥϴ�����ޤ��󡥤ǡ�Ruby�Υǡ�����������ˤ�
+Ruby���Ѱդ��Ƥ���ؿ����Ѥ��Ƥ���������
+
+�����ǤϤ�äȤ�Ȥ���Ǥ�����ʸ��������������/�����
+���ؿ��򤢤��ޤ�(�����ǤϤʤ��Ǥ�)��
+
+ ʸ������Ф���ؿ�
+
+  rb_str_new(const char *ptr, long len)
+
+    ������Ruby��ʸ������������롥
+
+  rb_str_new2(const char *ptr)
+
+    C��ʸ���󤫤�Ruby��ʸ������������롥���δؿ��ε�ǽ��
+    rb_str_new(ptr, strlen(ptr))��Ʊ���Ǥ��롥
+
+  rb_tainted_str_new(const char *ptr, long len)
+
+    �����ޡ������ղä��줿������Ruby��ʸ������������롥����
+    ����Υǡ����˴�Ť�ʸ����ˤϱ����ޡ������ղä����٤�
+    �Ǥ��롥
+
+  rb_tainted_str_new2(const char *ptr)
+
+    C��ʸ���󤫤�����ޡ������ղä��줿Ruby��ʸ������������롥
+
+  rb_str_cat(VALUE str, const char *ptr, long len)
+
+    Ruby��ʸ����str��len�Х��Ȥ�ʸ����ptr���ɲä��롥
+
+ ������Ф���ؿ�
+
+  rb_ary_new()
+
+    ���Ǥ�0��������������롥
+
+  rb_ary_new2(long len)
+
+    ���Ǥ�0��������������롥len����ʬ���ΰ�򤢤餫������
+    ���ƤƤ�����
+
+  rb_ary_new3(long n, ...)
+
+    �����ǻ��ꤷ��n���Ǥ�ޤ�������������롥
+
+  rb_ary_new4(long n, VALUE *elts)
+
+    �����Ϳ����n���Ǥ�������������롥
+
+  rb_ary_push(VALUE ary, VALUE val)
+  rb_ary_pop(VALUE ary)
+  rb_ary_shift(VALUE ary)
+  rb_ary_unshift(VALUE ary, VALUE val)
+
+    Array��Ʊ̾�Υ᥽�åɤ�Ʊ��Ư���򤹤�ؿ�����1������ɬ��
+    ����Ǥʤ���Фʤ�ʤ���
+
+2��Ruby�ε�ǽ��Ȥ�
+
+����Ū��Ruby�ǽ񤱤뤳�Ȥ�C�Ǥ�񤱤ޤ���Ruby���Τ�Τ�C�ǵ�
+�Ҥ���Ƥ����Ǥ����顤�����Ȥ����������ʤ�Ǥ����ɡ�������
+��Ruby�γ�ĥ�˻Ȥ����Ȥ�¿����������ͽ¬����뵡ǽ���濴�˾�
+�𤷤ޤ���
+
+2.1 Ruby�˵�ǽ���ɲä���
+
+Ruby���󶡤���Ƥ���ؿ���Ȥ���Ruby���󥿥ץ꥿�˿�������ǽ
+���ɲä��뤳�Ȥ��Ǥ��ޤ���Ruby�Ǥϰʲ��ε�ǽ���ɲä���ؿ���
+�󶡤���Ƥ��ޤ���
+
+ * ���饹���⥸�塼��
+ * �᥽�åɡ��ðۥ᥽�åɤʤ�
+ * ���
+
+�ǤϽ�˾Ҳ𤷤ޤ���
+
+2.1.1 ���饹/�⥸�塼�����
+
+���饹��⥸�塼���������뤿��ˤϡ��ʲ��δؿ���Ȥ��ޤ���
+
+  VALUE rb_define_class(const char *name, VALUE super)
+  VALUE rb_define_module(const char *name)
+
+�����δؿ��Ͽ�����������줿���饹��⥸�塼����֤��ޤ���
+�᥽�åɤ����������ˤ������ͤ�ɬ�פʤΤǡ��ۤȤ�ɤξ��
+������ͤ��ѿ��˳�Ǽ���Ƥ���ɬ�פ�����Ǥ��礦��
+
+���饹��⥸�塼���¾�Υ��饹�������˥ͥ��Ȥ�������������
+�ϰʲ��δؿ���Ȥ��ޤ���
+
+  VALUE rb_define_class_under(VALUE outer, const char *name, VALUE super)
+  VALUE rb_define_module_under(VALUE outer, const char *name)
+
+2.1.2 �᥽�å�/�ðۥ᥽�å����
+
+�᥽�åɤ��ðۥ᥽�åɤ��������ˤϰʲ��δؿ���Ȥ��ޤ���
+
+  void rb_define_method(VALUE klass, const char *name, 
+		        VALUE (*func)(), int argc)
+
+  void rb_define_singleton_method(VALUE object, const char *name, 
+			          VALUE (*func)(), int argc)
+
+
+ǰ�Τ�����������ȡ��ðۥ᥽�åɡפȤϡ���������Υ��֥�����
+�Ȥ��Ф��Ƥ���ͭ���ʥ᥽�åɤǤ���Ruby�ǤϤ褯Smalltalk�ˤ�
+���륯�饹�᥽�åɤȤ��ơ����饹���Ф����ðۥ᥽�åɤ��Ȥ��
+�ޤ���
+
+�����δؿ��� argc�Ȥ���������C�δؿ����Ϥ��������ο�(��
+����)����ޤ���argc��0�ʾ�λ��ϴؿ��˰����Ϥ������ο����
+̣���ޤ���16�İʾ�ΰ����ϻȤ��ޤ���(�����פ�ޤ����͡���
+��ʤ�)���ºݤδؿ��ˤ���Ƭ�ΰ����Ȥ���self��Ϳ�����ޤ���
+�ǡ����ꤷ�������1¿����������Ĥ��Ȥˤʤ�ޤ���
+
+argc����λ��ϰ����ο��ǤϤʤ�����������ꤷ�����Ȥˤʤ�ޤ���
+argc��-1�λ��ϰ����������������Ϥ���ޤ���argc��-2�λ��ϰ�
+����Ruby������Ȥ����Ϥ���ޤ���
+
+�᥽�åɤ��������ؿ��Ϥ⤦��Ĥ���ޤ����ҤȤĤ�private��
+���åɤ��������ؿ��ǡ�������rb_define_method()��Ʊ���Ǥ���
+
+  void rb_define_private_method(VALUE klass, const char *name, 
+				VALUE (*func)(), int argc)
+
+private�᥽�åɤȤϴؿ������Ǥ����ƤӽФ����Ȥν���ʤ��᥽��
+�ɤǤ���
+
+�⤦�ҤȤĤϥ⥸�塼��ؿ�����������ΤǤ����⥸�塼��ؿ�
+�Ȥϥ⥸�塼����ðۥ᥽�åɤǤ��ꡤƱ����private�᥽�åɤ�
+�⤢���ΤǤ�����򤢤����Math�⥸�塼���sqrt()�ʤɤ�����
+���ޤ������Υ᥽�åɤ�
+
+  Math.sqrt(4)
+
+�Ȥ��������Ǥ�
+
+  include Math
+  sqrt(4)
+
+�Ȥ��������Ǥ�Ȥ��ޤ����⥸�塼��ؿ����������ؿ��ϰʲ���
+�̤�Ǥ���
+
+  void rb_define_module_function(VALUE module, const char *name, 
+		                 VALUE (*func)(), int argc)
+
+�ؿ�Ū�᥽�å�(Kernel�⥸�塼���private method)��������뤿
+��δؿ��ϰʲ����̤�Ǥ���
+
+  void rb_define_global_function(const char *name, VALUE (*func)(), int argc)
+
+
+�᥽�åɤ���̾��������뤿��δؿ��ϰʲ����̤�Ǥ���
+
+  void rb_define_alias(VALUE module, const char* new, const char* old);
+
+���饹�᥽�å�allocate������������������ꤹ�뤿��δؿ���
+�ʲ����̤�Ǥ���
+
+  void rb_define_alloc_func(VALUE klass, VALUE (*func)(VALUE klass));
+  void rb_undef_alloc_func(VALUE klass);
+
+func�ϥ��饹������Ȥ��Ƽ�����äơ�������������Ƥ�줿����
+�����󥹤��֤��ʤ��ƤϤʤ�ޤ��󡣤��Υ��󥹥��󥹤ϡ�������
+�������ʤɤ�ޤޤʤ����Ǥ�������ֶ��פΤޤޤˤ��Ƥ������ۤ�
+���褤�Ǥ��礦��
+
+2.1.3 ������
+
+��ĥ�饤�֥�꤬ɬ�פ�����Ϥ��餫����������Ƥ����������ɤ�
+�Ǥ��礦��������������ؿ�����Ĥ���ޤ���
+
+  void rb_define_const(VALUE klass, const char *name, VALUE val)
+  void rb_define_global_const(const char *name, VALUE val)
+
+���Ԥ�����Υ��饹/�⥸�塼���°�����������������Ρ���
+�Ԥϥ������Х���������������ΤǤ���
+
+2.2 Ruby�ε�ǽ��C����ƤӽФ�
+
+���ˡ�1.5 Ruby�Υǡ���������٤ǰ����Ҳ𤷤��褦�ʴؿ���
+�Ȥ��С�Ruby�ε�ǽ��¸����Ƥ���ؿ���ľ�ܸƤӽФ����Ȥ�����
+�ޤ���
+
+# ���Τ褦�ʴؿ��ΰ���ɽ�Ϥ��ޤΤȤ�������ޤ��󡥥�������
+# �뤷���ʤ��Ǥ��͡�
+
+����ʳ��ˤ�Ruby�ε�ǽ��ƤӽФ���ˡ�Ϥ����Ĥ�����ޤ���
+
+2.2.1 Ruby�Υץ�������eval����
+
+C����Ruby�ε�ǽ��ƤӽФ���äȤ��ñ����ˡ�Ȥ��ơ�ʸ�����
+Ϳ����줿Ruby�Υץ�������ɾ������ʲ��δؿ�������ޤ���
+
+  VALUE rb_eval_string(const char *str)
+
+����ɾ���ϸ��ߤδĶ��ǹԤ��ޤ����Ĥޤꡤ���ߤΥ��������ѿ�
+�ʤɤ�����Ѥ��ޤ���
+
+2.2.2 ID�ޤ��ϥ���ܥ�
+
+C����ʸ������ͳ������Ruby�Υ᥽�åɤ�ƤӽФ����Ȥ�Ǥ���
+�����������ˡ�Ruby���󥿥ץ꥿��ǥ᥽�åɤ��ѿ�̾����ꤹ��
+���˻Ȥ��Ƥ���ID�ˤĤ����������Ƥ����ޤ��礦��
+
+ID�Ȥ��ѿ�̾���᥽�å�̾��ɽ�������Ǥ���Ruby�Ǥ�ID���б�����
+���֥������ȤȤ��ƥ���ܥ�(Symbol)�����ꡤ
+
+ :���̻�
+
+�ǥ��������Ǥ��ޤ���C���餳�����������뤿��ˤϴؿ�
+
+  rb_intern(const char *name)
+
+��Ȥ��ޤ���Ruby��������Ȥ���Ϳ����줿����ܥ�(�ޤ���ʸ��
+��)��ID���Ѵ�����ˤϰʲ��δؿ���Ȥ��ޤ���
+
+  rb_to_id(VALUE symbol)
+
+ID���饷��ܥ�����뤿��ˤϰʲ��Υޥ�����Ȥ��ޤ���
+
+  VALUE ID2SYM(ID id)
+
+����ܥ뤫��ID�����뤿��ˤϰʲ��Υޥ�����Ȥ��ޤ���
+
+  ID SYM2ID(VALUE symbol)
+
+2.2.3 C����Ruby�Υ᥽�åɤ�ƤӽФ�
+
+C����ʸ������ͳ������Ruby�Υ᥽�åɤ�ƤӽФ�����ˤϰʲ�
+�δؿ���Ȥ��ޤ���
+
+  VALUE rb_funcall(VALUE recv, ID mid, int argc, ...)
+
+���δؿ��ϥ��֥�������recv��mid�ǻ��ꤵ���᥽�åɤ�Ƥӽ�
+���ޤ�������¾�˰����λ���λ������㤦�ʲ��δؿ��⤢��ޤ���
+
+  VALUE rb_funcall2(VALUE recv, ID mid, int argc, VALUE *argv)
+  VALUE rb_apply(VALUE recv, ID mid, VALUE args)
+
+apply�ˤϰ����Ȥ���Ruby�������Ϳ���ޤ���
+
+2.2.4 �ѿ�/����򻲾�/��������
+
+C����ؿ���Ȥäƻ��ȡ������Ǥ���Τϡ���������󥹥�����
+���Ǥ�������ѿ��ϰ����Τ�Τ�C������ѿ��Ȥ��ƥ��������Ǥ�
+�ޤ������������ѿ��򻲾Ȥ�����ˡ�ϸ������Ƥ��ޤ���
+
+���֥������ȤΥ��󥹥����ѿ��򻲾ȡ���������ؿ��ϰʲ�����
+��Ǥ���
+
+  VALUE rb_ivar_get(VALUE obj, ID id)
+  VALUE rb_ivar_set(VALUE obj, ID id, VALUE val)
+
+id��rb_intern()���������Τ�ȤäƤ���������
+
+����򻲾Ȥ���ˤϰʲ��δؿ���ȤäƤ���������
+
+  VALUE rb_const_get(VALUE obj, ID id)
+
+����򿷤���������뤿��ˤϡ�2.1.3 �������٤ǾҲ�
+��Ƥ���ؿ���ȤäƤ���������
+
+3��Ruby��C�Ȥξ���ͭ
+
+C�����Ruby�δ֤Ǿ����ͭ������ˡ�ˤĤ��Ʋ��⤷�ޤ���
+
+3.1 C���黲�ȤǤ���Ruby�����
+
+�ʲ���Ruby�������C�Υ�٥뤫�黲�ȤǤ��ޤ���
+
+  Qtrue
+  Qfalse
+
+    �����͡�Qfalse��C����Ǥ⵶�Ȥߤʤ���ޤ�(�Ĥޤ�0)��
+
+  Qnil
+
+    C���줫�鸫����nil�ס�
+
+3.2 C��Ruby�Ƕ�ͭ���������ѿ�
+
+C��Ruby������ѿ���Ȥäƾ����ͭ�Ǥ��ޤ�����ͭ�Ǥ������
+�ѿ��ˤϤ����Ĥ��μ��ब����ޤ������Τʤ��Ǥ�äȤ��ɤ��Ȥ�
+���Ȼפ���Τ�rb_define_variable()�Ǥ���
+
+  void rb_define_variable(const char *name, VALUE *var)
+
+���δؿ���Ruby��C�ȤǶ�ͭ��������ѿ���������ޤ����ѿ�̾��
+`$'�ǻϤޤ�ʤ����ˤϼ�ưŪ���ɲä���ޤ��������ѿ����ͤ���
+������ȼ�ưŪ��Ruby���б������ѿ����ͤ��Ѥ��ޤ���
+
+�ޤ�Ruby¦����Ϲ����Ǥ��ʤ��ѿ��⤢��ޤ�������read only��
+�ѿ��ϰʲ��δؿ���������ޤ���
+
+  void rb_define_readonly_variable(const char *name, VALUE *var)
+
+������ѿ���¾��hook��Ĥ�������ѿ�������Ǥ��ޤ���hook�դ�
+������ѿ��ϰʲ��δؿ����Ѥ���������ޤ���hook�դ�����ѿ���
+�ͤλ��Ȥ������hook�ǹԤ�ɬ�פ�����ޤ���
+
+  void rb_define_hooked_variable(const char *name, VALUE *var,
+				 VALUE (*getter)(), void (*setter)())
+
+���δؿ���C�δؿ��ˤ�ä�hook�ΤĤ���줿����ѿ����������
+�����ѿ������Ȥ��줿���ˤϴؿ�getter�����ѿ����ͤ����åȤ���
+�����ˤϴؿ�setter���ƤФ�롥hook����ꤷ�ʤ�����getter��
+setter��0����ꤷ�ޤ���
+
+# getter��setter��0�ʤ��rb_define_variable()��Ʊ���ˤʤ롥
+
+���줫�顤C�δؿ��ˤ�äƼ¸������Ruby������ѿ����������
+�ؿ�������ޤ���
+
+  void rb_define_virtual_variable(const char *name,
+				  VALUE (*getter)(), void (*setter)())
+
+���δؿ��ˤ�ä�������줿Ruby������ѿ������Ȥ��줿���ˤ�
+getter�����ѿ����ͤ����åȤ��줿���ˤ�setter���ƤФ�ޤ���
+
+getter��setter�λ��ͤϰʲ����̤�Ǥ���
+
+  (*getter)(ID id, void *data, struct global_entry* entry);
+  (*setter)(VALUE val, ID id, void *data, struct global_entry* entry);
+
+3.3 C�Υǡ�����Ruby���֥������Ȥˤ���
+
+C��������������줿�ǡ���(��¤��)��Ruby�Υ��֥������ȤȤ���
+��갷��������礬���ꤨ�ޤ������Τ褦�ʾ��ˤϡ�Data�Ȥ���
+Ruby���֥������Ȥ�C�ι�¤��(�ؤΥݥ���)�򤯤�ळ�Ȥ�Ruby
+���֥������ȤȤ��Ƽ�갷����褦�ˤʤ�ޤ���
+
+Data���֥������Ȥ��������ƹ�¤�Τ�Ruby���֥������Ȥ˥��ץ���
+�����뤿��ˤϡ��ʲ��Υޥ�����Ȥ��ޤ���
+
+  Data_Wrap_Struct(klass, mark, free, ptr)
+
+���Υޥ���������ͤ��������줿Data���֥������ȤǤ���
+
+klass�Ϥ���Data���֥������ȤΥ��饹�Ǥ���ptr�ϥ��ץ��벽����
+C�ι�¤�ΤؤΥݥ��󥿤Ǥ���mark�Ϥ��ι�¤�Τ�Ruby�Υ��֥���
+���Ȥؤλ��Ȥ�������˻Ȥ��ؿ��Ǥ������Τ褦�ʻ��Ȥ�ޤޤʤ�
+���ˤ�0����ꤷ�ޤ���
+
+# ���Τ褦�ʻ��Ȥϴ�����ޤ���
+
+free�Ϥ��ι�¤�Τ��⤦���פˤʤä����˸ƤФ��ؿ��Ǥ�������
+�ؿ��������١������쥯������ƤФ�ޤ������줬-1�ξ��ϡ�ñ
+��˳�������ޤ���
+
+C�ι�¤�Τγ�����Data���֥������Ȥ�������Ʊ���˹Ԥ��ޥ�����
+���ưʲ��Τ�Τ��󶡤���Ƥ��ޤ���
+
+  Data_Make_Struct(klass, type, mark, free, sval)
+
+���Υޥ���������ͤ��������줿Data���֥������ȤǤ���
+
+klass, mark, free��Data_Wrap_Struct��Ʊ��Ư���򤷤ޤ���type
+�ϳ�����Ƥ�C��¤�Τη��Ǥ���������Ƥ�줿��¤�Τ��ѿ�sval
+����������ޤ��������ѿ��η��� (type*) �Ǥ���ɬ�פ�����ޤ���
+
+Data���֥������Ȥ���ݥ��󥿤���Ф��Τϰʲ��Υޥ������Ѥ�
+�ޤ���
+
+  Data_Get_Struct(obj, type, sval)
+
+C�ι�¤�ΤؤΥݥ��󥿤��ѿ�sval����������ޤ���
+
+������Data�λȤ����Ϥ���ä�ʬ����ˤ����Τǡ������������
+����򻲾Ȥ��Ƥ���������
+
+4������ - dbm�ѥå���������
+
+�����ޤǤ������ǤȤꤢ������ĥ�饤�֥��Ϻ���Ϥ��Ǥ���
+Ruby��ext�ǥ��쥯�ȥ�ˤ��Ǥ˴ޤޤ�Ƥ���dbm�饤�֥������
+�����ʳ�Ū���������ޤ���
+
+(1) �ǥ��쥯�ȥ����
+
+  % mkdir ext/dbm
+
+Ruby 1.1�����Ǥ�դΥǥ��쥯�ȥ�ǥ����ʥߥå��饤�֥����
+�뤳�Ȥ��Ǥ���褦�ˤʤ�ޤ�����Ruby����Ū�˥�󥯤������
+��Ruby��Ÿ�������ǥ��쥯�ȥ�β���ext�ǥ��쥯�ȥ����˳�ĥ
+�饤�֥���ѤΥǥ��쥯�ȥ����ɬ�פ�����ޤ���̾����Ŭ����
+����ǹ����ޤ���
+
+(2) �߷פ���
+
+�ޤ��������ʤ�Ǥ����ɡ��ɤ�������ǽ��¸����뤫�ɤ����ޤ���
+�פ���ɬ�פ�����ޤ����ɤ�ʥ��饹��Ĥ��뤫�����Υ��饹�ˤ�
+�ɤ�ʥ᥽�åɤ����뤫�����饹���󶡤�������ʤɤˤĤ����߷�
+���ޤ���
+
+(3) C�����ɤ��
+
+��ĥ�饤�֥�����ΤȤʤ�C����Υ�������񤭤ޤ���C����Υ���
+�����ҤȤĤλ��ˤϡ֥饤�֥��̾.c�פ����֤��ɤ��Ǥ��礦��C
+����Υ�������ʣ���ξ��ˤϵդˡ֥饤�֥��̾.c�פȤ����ե�
+����̾���򤱤�ɬ�פ�����ޤ������֥������ȥե�����ȥ⥸�塼
+�������������Ū�����������֥饤�֥��̾.o�פȤ����ե�����
+�Ȥ����ͤ��뤫��Ǥ���
+
+Ruby�ϳ�ĥ�饤�֥�������ɤ�����ˡ�Init_�饤�֥��̾�פ�
+�����ؿ���ưŪ�˼¹Ԥ��ޤ���dbm�饤�֥��ξ���Init_dbm��
+�Ǥ������δؿ�����ǥ��饹���⥸�塼�롤�᥽�åɡ�����ʤɤ�
+�����Ԥ��ޤ���dbm.c����������Ѥ��ޤ���
+
+--
+Init_dbm()
+{
+    /* DBM���饹��������� */
+    cDBM = rb_define_class("DBM", rb_cObject);
+    /* DBM��Enumerate�⥸�塼��򥤥󥯥롼�ɤ��� */
+    rb_include_module(cDBM, rb_mEnumerable);
+
+    /* DBM���饹�Υ��饹�᥽�å�open(): ������C������Ǽ����� */
+    rb_define_singleton_method(cDBM, "open", fdbm_s_open, -1);
+
+    /* DBM���饹�Υ᥽�å�close(): �����Ϥʤ� */
+    rb_define_method(cDBM, "close", fdbm_close, 0);
+    /* DBM���饹�Υ᥽�å�[]: ������1�� */
+    rb_define_method(cDBM, "[]", fdbm_fetch, 1);
+		:
+
+    /* DBM�ǡ������Ǽ���륤�󥹥����ѿ�̾�Τ����ID */
+    id_dbm = rb_intern("dbm");
+}
+--
+
+DBM�饤�֥���dbm�Υǡ������б����륪�֥������Ȥˤʤ�Ϥ���
+�����顤C��������dbm��Ruby�������˼�����ɬ�פ�����ޤ���
+
+
+dbm.c�Ǥ�Data_Make_Struct��ʲ��Τ褦�˻ȤäƤ��ޤ���
+
+--
+struct dbmdata {
+    int  di_size;
+    DBM *di_dbm;
+};
+
+
+obj = Data_Make_Struct(klass, struct dbmdata, 0, free_dbm, dbmp);
+--
+
+�����Ǥ�dbmstruct��¤�ΤؤΥݥ��󥿤�Data�˥��ץ��벽���Ƥ�
+�ޤ���DBM*��ľ�ܥ��ץ��벽���ʤ��Τ�close()�������ν������
+���ƤΤ��ȤǤ���
+
+Data���֥������Ȥ���dbmstruct��¤�ΤΥݥ��󥿤���Ф�����
+�˰ʲ��Υޥ�����ȤäƤ��ޤ���
+
+--
+#define GetDBM(obj, dbmp) {\
+    Data_Get_Struct(obj, struct dbmdata, dbmp);\
+    if (dbmp->di_dbm == 0) closed_dbm();\
+}
+--
+
+����ä�ʣ���ʥޥ����Ǥ������פ����dbmdata��¤�ΤΥݥ���
+�μ��Ф��ȡ�close����Ƥ��뤫�ɤ����Υ����å���ޤȤ�Ƥ�
+������Ǥ���
+
+DBM���饹�ˤϤ�������᥽�åɤ�����ޤ�����ʬ�ह���3�����
+�����μ�����������ޤ����ҤȤĤϰ����ο�������Τ�Τǡ����
+���Ƥ�delete�᥽�åɤ�����ޤ���delete�᥽�åɤ�������Ƥ���
+fdbm_delete()�Ϥ��Τ褦�ˤʤäƤ��ޤ���
+
+--
+static VALUE
+fdbm_delete(obj, keystr)
+    VALUE obj, keystr;
+{
+	:
+}
+--
+
+�����ο�������Υ����פ���1������self����2�����ʹߤ��᥽�å�
+�ΰ����Ȥʤ�ޤ���
+
+�����ο�������Τ�Τ�C������Ǽ������Τ�Ruby������Ǽ���
+���ΤȤ�����ޤ���dbm�饤�֥�����ǡ�C������Ǽ�������
+��DBM�Υ��饹�᥽�åɤǤ���open()�Ǥ��������������Ƥ����
+��fdbm_s_open()�Ϥ����ʤäƤ��ޤ���
+
+--
+static VALUE
+fdbm_s_open(argc, argv, klass)
+    int argc;
+    VALUE *argv;
+    VALUE klass;
+{
+	:
+    if (rb_scan_args(argc, argv, "11", &file, &vmode) == 1) {
+	mode = 0666;		/* default value */
+    }
+	:
+}
+--
+
+���Υ����פδؿ�����1������Ϳ����줿�����ο�����2������Ϳ��
+��줿���������äƤ�������ˤʤ�ޤ���self����3�����Ȥ���Ϳ
+�����ޤ���
+
+���������Ϳ����줿��������Ϥ��뤿��δؿ���open()�Ǥ�Ȥ�
+��Ƥ���rb_scan_args()�Ǥ�����3�����˻��ꤷ���ե����ޥåȤ�
+��������4�ѿ��ʹߤ˻��ꤷ���ѿ����ͤ��������Ƥ���ޤ�������
+�ե����ޥåȤϡ���1ʸ���ܤ���ά�Ǥ��ʤ������ο�����2ʸ���ܤ�
+��ά�Ǥ�������ο�����3ʸ���ܤ��б�������̵꤬�����ޤ�ΰ�
+�������뤫�ɤ����򼨤�"*"�Ǥ���2ʸ���ܤ�3ʸ���ܤϾ�ά�Ǥ���
+����dbm.c����Ǥϡ��ե����ޥåȤ�"11"�Ǥ����顤�����Ϻ���1��
+�ǡ�2�Ĥޤǵ������Ȥ�����̣�ˤʤ�ޤ�����ά����Ƥ������
+�ѿ����ͤ�nil(C����Υ�٥�Ǥ�Qnil)�ˤʤ�ޤ���
+
+Ruby������ǰ������������Τ�indexes������ޤ��������Ϥ�
+���Ǥ���
+
+--
+static VALUE
+fdbm_indexes(obj, args)
+    VALUE obj, args;
+{
+	:
+}
+--
+
+��1������self����2������Ruby������Ǥ���
+
+** ���ջ���
+
+Ruby�ȶ�ͭ�Ϥ��ʤ���Ruby�Υ��֥������Ȥ��Ǽ�����ǽ���Τ���
+C������ѿ��ϰʲ��δؿ���Ȥä�Ruby���󥿥ץ꥿���ѿ���¸��
+�򶵤��Ƥ����Ƥ����������Ǥʤ���GC�ǥȥ�֥�򵯤����ޤ���
+
+  void rb_global_variable(VALUE *var)
+
+(4) extconf.rb���Ѱդ���
+
+Makefile������ο����ˤʤ�extconf.rb�Ȥ����ե��������
+�ޤ���extconf.rb�ϥ饤�֥��Υ���ѥ����ɬ�פʾ��Υ�����
+���ʤɤ�Ԥ����Ȥ���Ū�Ǥ����ޤ���
+
+  require 'mkmf'
+
+��extconf.rb����Ƭ���֤��ޤ���extconf.rb����Ǥϰʲ���Ruby��
+����Ȥ����Ȥ�����ޤ���
+
+  have_library(lib, func): �饤�֥���¸�ߥ����å�
+  have_func(func, header): �ؿ���¸�ߥ����å�
+  have_header(header): �إå��ե������¸�ߥ����å�
+  create_makefile(target): Makefile������
+
+�ʲ����ѿ���Ȥ����Ȥ��Ǥ��ޤ���
+
+  $CFLAGS: ����ѥ�������ɲ�Ū�˻��ꤹ��ե饰(-O�ʤ�)
+  $CPPFLAGS: �ץ�ץ����å����ɲ�Ū�˻��ꤹ��ե饰(-I��-D�ʤ�)
+  $LDFLAGS: ��󥯻����ɲ�Ū�˻��ꤹ��ե饰(-L�ʤ�)
+  $objs: ��󥯤���륪�֥������ȥե�����̾�Υꥹ��
+
+���֥������ȥե�����Υꥹ�Ȥϡ��̾�ϥ������ե�����򸡺���
+�Ƽ�ưŪ����������ޤ�����make������ǥ���������������褦��
+��������Ū�˻��ꤹ��ɬ�פ�����ޤ���
+
+�饤�֥��򥳥�ѥ��뤹���郎·�鷺�����Υ饤�֥��򥳥�
+�ѥ��뤷�ʤ����ˤ�create_makefile��ƤФʤ����Makefile����
+�����줺������ѥ����Ԥ��ޤ���
+
+(5) depend���Ѱդ���
+
+�⤷���ǥ��쥯�ȥ��depend�Ȥ����ե����뤬¸�ߤ���С�
+Makefile����¸�ط�������å����Ƥ���ޤ���
+
+  % gcc -MM *.c > depend
+
+�ʤɤǺ�뤳�Ȥ�����ޤ������ä�»��̵���Ǥ��礦��
+
+(6) Makefile����������
+
+Makefile��ºݤ��������뤿��ˤ�
+
+  ruby extconf.rb
+
+�Ȥ��ޤ���extconf.rb�� require 'mkmf' �ιԤ��ʤ����ˤϥ��顼
+�ˤʤ�ޤ��Τǡ��������ɲä���
+
+  ruby -r mkmf extconf.rb
+
+�Ȥ��Ƥ���������
+
+�ǥ��쥯�ȥ��ext�ʲ����Ѱդ������ˤ�Ruby���Τ�make�λ���
+��ưŪ��Makefile����������ޤ��Τǡ����Υ��ƥåפ����פǤ���
+
+(7) make����
+
+ưŪ��󥯥饤�֥�������������ˤϤ��ξ��make���Ƥ�����
+����ɬ�פǤ���� make install �ǥ��󥹥ȡ��뤵��ޤ���
+
+ext�ʲ��˥ǥ��쥯�ȥ���Ѱդ������ϡ�Ruby�Υǥ��쥯�ȥ��
+make��¹Ԥ����Makefile����������make��ɬ�פˤ�äƤϤ��Υ�
+���塼���Ruby�ؤΥ�󥯤ޤǼ�ưŪ�˼¹Ԥ��Ƥ���ޤ���
+extconf.rb��񤭴�����ʤɤ���Makefile�κ�������ɬ�פʻ��Ϥ�
+��Ruby�ǥ��쥯�ȥ��make���Ƥ���������
+
+��ĥ�饤�֥���make install��Ruby�饤�֥��Υǥ��쥯�ȥ��
+���˥��ԡ�����ޤ����⤷��ĥ�饤�֥��ȶ�Ĵ���ƻȤ�Ruby�ǵ�
+�Ҥ��줿�ץ�����ब���ꡤRuby�饤�֥����֤��������ˤϡ�
+��ĥ�饤�֥���ѤΥǥ��쥯�ȥ�β��� lib �Ȥ����ǥ��쥯�ȥ�
+���ꡤ������ ��ĥ�� .rb �Υե�������֤��Ƥ�����Ʊ���˥���
+���ȡ��뤵��ޤ���
+
+(8) �ǥХå�
+
+�ޤ����ǥХå����ʤ���ư���ʤ��Ǥ��礦�͡�ext/Setup�˥ǥ���
+���ȥ�̾��񤯤���Ū�˥�󥯤���ΤǥǥХå����Ȥ���褦�ˤ�
+��ޤ�������ʬ����ѥ��뤬�٤��ʤ�ޤ����ɡ�
+
+(9) �Ǥ�������
+
+��Ϥ��ä���Ȥ��ʤꡤ������������ʤꡤ���ʤꡤ����ͳ�ˤ�
+�Ȥ�����������Ruby�κ�Ԥϳ�ĥ�饤�֥��˴ؤ��ư��ڤθ�����
+��ĥ���ޤ���
+
+Appendix A. Ruby�Υ����������ɤ�ʬ��
+
+Ruby�Υ������Ϥ����Ĥ���ʬ�ह�뤳�Ȥ�����ޤ������Τ�������
+���饤�֥�����ʬ�ϴ���Ū�˳�ĥ�饤�֥���Ʊ��������ˤʤ�
+�Ƥ��ޤ��������Υ������Ϻ��ޤǤ������ǤۤȤ������Ǥ����
+�פ��ޤ���
+
+Ruby�������
+
+  class.c
+  error.c
+  eval.c
+  gc.c
+  object.c
+  parse.y
+  variable.c
+
+�桼�ƥ���ƥ��ؿ�
+
+  dln.c
+  regex.c
+  st.c
+  util.c
+
+Ruby���ޥ�ɤμ���
+
+  dmyext.c
+  inits.c
+  main.c
+  ruby.c
+  version.c
+
+���饹�饤�֥��
+
+  array.c
+  bignum.c
+  compar.c
+  dir.c
+  enum.c
+  file.c
+  hash.c
+  io.c
+  marshal.c
+  math.c
+  numeric.c
+  pack.c
+  prec.c
+  process.c
+  random.c
+  range.c
+  re.c
+  signal.c
+  sprintf.c
+  string.c
+  struct.c
+  time.c
+
+Appendix B. ��ĥ�Ѵؿ���ե����
+
+C���줫��Ruby�ε�ǽ�����Ѥ���API�ϰʲ����̤�Ǥ��롥
+
+** ��
+
+VALUE
+
+  Ruby���֥������Ȥ�ɽ�����뷿��ɬ�פ˱����ƥ��㥹�Ȥ����Ѥ��롥
+  �Ȥ߹��߷���ɽ������C�η���ruby.h�˵��Ҥ��Ƥ���R�ǻϤޤ빽¤
+  �ΤǤ��롥VALUE���򤳤��˥��㥹�Ȥ��뤿���R�ǻϤޤ빽¤��
+  ̾��������ʸ���ˤ���̾���Υޥ������Ѱդ���Ƥ��롥
+
+** �ѿ������
+
+Qnil
+
+  ���: nil���֥�������
+
+Qtrue
+
+  ���: true���֥�������(���Υǥե������)
+
+Qfalse
+
+  ���: false���֥�������
+
+** C�ǡ����Υ��ץ��벽
+
+Data_Wrap_Struct(VALUE klass, void (*mark)(), void (*free)(), void *sval)
+
+  C��Ǥ�դΥݥ��󥿤򥫥ץ��벽����Ruby���֥������Ȥ��֤�����
+  �Υݥ��󥿤�Ruby���饢����������ʤ��ʤä�����free�ǻ��ꤷ��
+  �ؿ����ƤФ�롥�ޤ������Υݥ��󥿤λؤ��ǡ�����¾��Ruby����
+  �������Ȥ�ؤ��Ƥ����硤mark�˻��ꤹ��ؿ��ǥޡ�������ɬ��
+  �����롥
+
+Data_Make_Struct(klass, type, mark, free, sval)
+
+  type���Υ����malloc�����ѿ�sval�����������塤����򥫥ץ�
+  �벽�����ǡ������֤��ޥ�����
+
+Data_Get_Struct(data, type, sval)
+
+  data����type���Υݥ��󥿤���Ф��ѿ�sval����������ޥ�����
+
+** �������å�
+
+TYPE(value)
+FIXNUM_P(value)
+NIL_P(value)
+void Check_Type(VALUE value, int type)
+void Check_SafeStr(VALUE value)
+
+** ���Ѵ�
+
+FIX2INT(value)
+INT2FIX(i)
+NUM2INT(value)
+INT2NUM(i)
+NUM2DBL(value)
+rb_float_new(f)
+StringValue(value)
+StringValuePtr(value)
+StringValueCStr(value)
+rb_str_new2(s)
+
+** ���饹/�⥸�塼�����
+
+VALUE rb_define_class(const char *name, VALUE super)
+
+  super�Υ��֥��饹�Ȥ��ƿ�����Ruby���饹��������롥
+
+VALUE rb_define_class_under(VALUE module, const char *name, VALUE super)
+
+  super�Υ��֥��饹�Ȥ��ƿ�����Ruby���饹���������module��
+  ����Ȥ���������롥
+
+VALUE rb_define_module(const char *name)
+
+  ������Ruby�⥸�塼���������롥
+
+VALUE rb_define_module_under(VALUE module, const char *name)
+
+  ������Ruby�⥸�塼����������module������Ȥ���������롥
+
+void rb_include_module(VALUE klass, VALUE module)
+
+  �⥸�塼��򥤥󥯥롼�ɤ��롥class�����Ǥ�module�򥤥�
+  �롼�ɤ��Ƥ�����ˤϲ��⤷�ʤ�(¿�ť��󥯥롼�ɤζػ�)��
+
+void rb_extend_object(VALUE object, VALUE module)
+
+  ���֥������Ȥ�⥸�塼��(���������Ƥ���᥽�å�)�dz�ĥ���롥
+
+** ����ѿ����
+
+void rb_define_variable(const char *name, VALUE *var)
+
+  Ruby��C�ȤǶ�ͭ���륰�����Х��ѿ���������롥�ѿ�̾��`$'��
+  �Ϥޤ�ʤ����ˤϼ�ưŪ���ɲä���롥name�Ȥ���Ruby�μ��̻�
+  �Ȥ��Ƶ�����ʤ�ʸ��(�㤨��` ')��ޤ���ˤ�Ruby�ץ�����
+  �फ��ϸ����ʤ��ʤ롥
+
+void rb_define_readonly_variable(const char *name, VALUE *var)
+
+  Ruby��C�ȤǶ�ͭ����read only�Υ������Х��ѿ���������롥
+  read only�Ǥ��뤳�Ȱʳ���rb_define_variable()��Ʊ����
+
+void rb_define_virtual_variable(const char *name,
+				VALUE (*getter)(), void (*setter)())
+
+  �ؿ��ˤ�äƼ¸������Ruby�ѿ���������롥�ѿ������Ȥ��줿
+  ���ˤ�getter�����ѿ����ͤ����åȤ��줿���ˤ�setter���ƤФ�
+  �롥
+
+void rb_define_hooked_variable(const char *name, VALUE *var,
+			       VALUE (*getter)(), void (*setter)())
+
+  �ؿ��ˤ�ä�hook�ΤĤ���줿�������Х��ѿ���������롥�ѿ�
+  �����Ȥ��줿���ˤ�getter�����ؿ����ͤ����åȤ��줿���ˤ�
+  setter���ƤФ�롥getter��setter��0����ꤷ�����ˤ�hook��
+  ���ꤷ�ʤ��Τ�Ʊ�����ˤʤ롥
+
+void rb_global_variable(VALUE *var)
+
+  GC�Τ��ᡤRuby�ץ�����फ��ϥ�����������ʤ���, Ruby����
+  �������Ȥ�ޤ�����ѿ���ޡ������롥
+
+** ���
+
+void rb_define_const(VALUE klass, const char *name, VALUE val)
+
+  �����������롥
+
+void rb_define_global_const(const char *name, VALUE val)
+
+  ��������������롥
+
+     rb_define_const(rb_cObject, name, val)
+
+  ��Ʊ����̣��
+
+** �᥽�å����
+
+rb_define_method(VALUE klass, const char *name, VALUE (*func)(), int argc)
+
+  �᥽�åɤ�������롥argc��self����������ο���argc��-1�λ�, 
+  �ؿ��ˤϰ����ο�(self��ޤޤʤ�)����1����, �������������2
+  �����Ȥ��������Ϳ������(��3������self)��argc��-2�λ�, 
+  ��1������self, ��2������args(args�ϰ�����ޤ�Ruby������)��
+  ����������Ϳ�����롥
+ 
+rb_define_private_method(VALUE klass, const char *name, VALUE (*func)(), int argc)
+
+  private�᥽�åɤ�������롥������rb_define_method()��Ʊ����
+
+rb_define_singleton_method(VALUE klass, const char *name, VALUE (*func)(), int argc)
+
+  �ðۥ᥽�åɤ�������롥������rb_define_method()��Ʊ����
+
+rb_scan_args(int argc, VALUE *argv, const char *fmt, ...)
+
+  argc, argv������Ϳ����줿������ʬ�򤹤롥fmt��ɬ�ܰ����ο�, 
+  �ղð����ο�, �Ĥ�ΰ��������뤫����ꤹ��ʸ�����, "����
+  ����*"�Ȥ��������Ǥ��롥 2 ���ܤο�����"*"�Ϥ��줾���ά��
+  ǽ�Ǥ��롥ɬ�ܰ�������Ĥ�ʤ�����0����ꤹ�롥��3������
+  �ߤ��ѿ��ؤΥݥ��󥿤�, �����������Ǥ������ѿ��˳�Ǽ����롥
+  �ղð������б����������Ϳ�����Ƥ��ʤ������ѿ���Qnil��
+  ��������롥
+
+** Ruby�᥽�åɸƤӽФ�
+
+VALUE rb_funcall(VALUE recv, ID mid, int narg, ...)
+
+  �᥽�åɸƤӽФ���ʸ���󤫤�mid�����뤿��ˤ�rb_intern()��
+  �Ȥ���
+
+VALUE rb_funcall2(VALUE recv, ID mid, int argc, VALUE *argv)
+
+  �᥽�åɸƤӽФ���������argc, argv�������Ϥ���
+
+VALUE rb_eval_string(const char *str)
+
+  ʸ�����Ruby������ץȤȤ��ƥ���ѥ��롦�¹Ԥ��롥
+
+ID rb_intern(const char *name)
+
+  ʸ������б�����ID���֤���
+
+char *rb_id2name(ID id)
+
+  ID���б�����ʸ������֤�(�ǥХå���)��
+
+char *rb_class2name(VALUE klass)
+
+  ���饹��̾�����֤�(�ǥХå���)�����饹��̾��������ʤ����ˤ�, 
+  ������̤ä�̾������ĥ��饹��̾�����֤���
+
+int rb_respond_to(VALUE obj, ID id)
+
+  obj��id�Ǽ������᥽�åɤ���Ĥ��ɤ������֤���
+
+** ���󥹥����ѿ�
+
+VALUE rb_iv_get(VALUE obj, const char *name)
+
+  obj�Υ��󥹥����ѿ����ͤ����롥`@'�ǻϤޤ�ʤ����󥹥���
+  ���ѿ��� Ruby�ץ�����फ�饢�������Ǥ��ʤ��ֱ��줿�ץ���
+  �������ѿ��ˤʤ롥�������ʸ����̾������ĥ��饹(�ޤ���
+  �⥸�塼��)�Υ��󥹥����ѿ��Ȥ��Ƽ�������Ƥ��롥
+
+VALUE rb_iv_set(VALUE obj, const char *name, VALUE val)
+
+  obj�Υ��󥹥����ѿ���val�˥��åȤ��롥
+
+** ���湽¤
+
+VALUE rb_iterate(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2)
+
+  func2��֥��å��Ȥ������ꤷ, func1�򥤥ƥ졼���Ȥ��ƸƤ֡� 
+  func1�ˤ� arg1�������Ȥ����Ϥ���, func2�ˤ���1�����˥��ƥ졼
+  ������Ϳ����줿��, ��2������arg2���Ϥ���롥
+ 
+VALUE rb_yield(VALUE val)
+
+  val���ͤȤ��ƥ��ƥ졼���֥��å���ƤӽФ���
+
+VALUE rb_rescue(VALUE (*func1)(), VALUE arg1, VALUE (*func2)(), VALUE arg2)
+
+  �ؿ�func1��arg1������˸ƤӽФ���func1�μ¹�����㳰��ȯ��
+  �������ˤ� func2��arg2������Ȥ��ƸƤ֡�����ͤ��㳰��ȯ��
+  ���ʤ��ä�����func1�������, �㳰��ȯ���������ˤ�func2����
+  ���ͤǤ��롥
+
+VALUE rb_ensure(VALUE (*func1)(), VALUE arg1, void (*func2)(), VALUE arg2)
+
+  �ؿ�func1��arg1������Ȥ��Ƽ¹Ԥ�, �¹Խ�λ��(���Ȥ��㳰��
+  ȯ�����Ƥ�) func2��arg2������Ȥ��Ƽ¹Ԥ��롥����ͤ�func1
+  ������ͤǤ���(�㳰��ȯ�������������ʤ�)��
+
+** �㳰�����顼
+
+void rb_warning(const char *fmt, ...)
+
+  rb_verbose����ɸ�२�顼���Ϥ˷ٹ�����ɽ�����롥������
+  printf()��Ʊ����
+
+void rb_raise(rb_eRuntimeError, const char *fmt, ...)
+
+  RuntimeError�㳰��ȯ�������롥������printf()��Ʊ����
+
+void rb_raise(VALUE exception, const char *fmt, ...)
+
+  exception�ǻ��ꤷ���㳰��ȯ�������롥fmt�ʲ��ΰ�����
+  printf()��Ʊ����
+
+void rb_fatal(const char *fmt, ...)
+
+  ��̿Ū�㳰��ȯ�������롥�̾���㳰�����ϹԤʤ�줺, ���󥿡�
+  �ץ꥿����λ����(������ensure�ǻ��ꤵ�줿�����ɤϽ�λ����
+  �¹Ԥ����)��
+
+void rb_bug(const char *fmt, ...)
+
+  ���󥿡��ץ꥿�ʤɥץ������ΥХ��Ǥ���ȯ������Ϥ��Τʤ�
+  �����λ��Ƥ֡����󥿡��ץ꥿�ϥ�������פ�ľ���˽�λ���롥
+  �㳰�����ϰ��ڹԤʤ��ʤ���
+
+** Ruby�ν�������¹�
+
+Ruby�򥢥ץꥱ����������������ˤϰʲ��Υ��󥿥ե�����
+��Ȥ����̾�γ�ĥ�饤�֥��ˤ�ɬ�פʤ���
+
+void ruby_init()
+
+  Ruby���󥿥ץ꥿�ν������Ԥʤ���
+
+void ruby_options(int argc, char **argv)
+
+  Ruby���󥿥ץ꥿�Υ��ޥ�ɥ饤������ν�����Ԥʤ���
+
+void ruby_run()
+
+  Ruby���󥿥ץ꥿��¹Ԥ��롥
+
+void ruby_script(char *name)
+
+  Ruby�Υ�����ץ�̾($0)�����ꤹ�롥
+
+
+Appendix C. extconf.rb�ǻȤ���ؿ�����
+
+extconf.rb����Ǥ����Ѳ�ǽ�ʥ���ѥ���������å��δؿ��ϰ�
+�����̤�Ǥ��롥
+
+have_macro(macro, headers)
+
+  �إå��ե�����header�򥤥󥯥롼�ɤ��ƥޥ���macro�������
+  ��Ƥ��뤫�ɤ��������å����롥�ޥ������������Ƥ����true
+  ���֤���
+
+have_library(lib, func)
+
+  �ؿ�func��������Ƥ���饤�֥��lib��¸�ߤ�����å����롥
+  �饤�֥�꤬¸�ߤ������true���֤���
+
+find_library(lib, func, path...)
+
+  �ؿ�func��������Ƥ���饤�֥��lib��¸�ߤ� -Lpath ���ɲ�
+  ���ʤ�������å����롥�饤�֥�꤬���դ��ä�����true���֤���
+
+have_func(func, header)
+
+  �إå��ե�����header�򥤥󥯥롼�ɤ��ƴؿ�func��¸�ߤ������
+  �����롥func��ɸ��Ǥϥ�󥯤���ʤ��饤�֥����Τ�ΤǤ�
+  ����ˤ����have_library�Ǥ��Υ饤�֥�������å����Ƥ���
+  �����ؿ���¸�ߤ����true���֤���
+
+have_var(var, header)
+
+  �إå��ե�����header�򥤥󥯥롼�ɤ����ѿ�var��¸�ߤ������
+  �����롥var��ɸ��Ǥϥ�󥯤���ʤ��饤�֥����Τ�ΤǤ�
+  ����ˤ����have_library�Ǥ��Υ饤�֥�������å����Ƥ���
+  �����ѿ���¸�ߤ����true���֤���
+
+have_header(header)
+
+  �إå��ե������¸�ߤ�����å����롥�إå��ե����뤬¸�ߤ�
+  ���true���֤���
+
+find_header(header, path...)
+
+  �إå��ե�����header��¸�ߤ� -Ipath ���ɲä��ʤ�������å�
+  ���롥�إå��ե����뤬���դ��ä�����true���֤���
+
+have_struct_member(type, member, header)
+
+  �إå��ե�����header�򥤥󥯥롼�ɤ��Ʒ�type�˥���member
+  ��¸�ߤ��뤫������å����롥type���������Ƥ��ơ�member��
+  ���Ĥ����true���֤���
+
+have_type(type, header, opt)
+
+  �إå��ե�����header�򥤥󥯥롼�ɤ��Ʒ�type��¸�ߤ��뤫��
+  �����å����롥type���������Ƥ����true���֤���
+
+check_sizeof(type, header)
+
+  �إå��ե�����header�򥤥󥯥롼�ɤ��Ʒ�type��charñ�̥���
+  ����Ĵ�٤롥type���������Ƥ�������Υ��������֤��������
+  ��Ƥ��ʤ��Ȥ���nil���֤���
+
+create_makefile(target)
+
+  ��ĥ�饤�֥���Ѥ�Makefile���������롥���δؿ���ƤФʤ���
+  �Ф��Υ饤�֥��ϥ���ѥ��뤵��ʤ���target�ϥ⥸�塼��̾
+  ��ɽ����
+
+find_executable(command, path)
+
+  ���ޥ��command��File::PATH_SEPARATOR�Ƕ��ڤ�줿�ѥ�̾��
+  �ꥹ��path����õ����path��nil�ޤ��Ͼ�ά���줿���ϡ��Ķ�
+  �ѿ�PATH���ͤ���Ѥ��롥�¹Բ�ǽ�ʥ��ޥ�ɤ����Ĥ��ä����
+  �ϥѥ���ޤ�ե�����̾�����Ĥ���ʤ��ä�����nil���֤���
+
+with_config(withval[, default=nil])
+
+  ���ޥ�ɥ饤����--with-<withval>�ǻ��ꤵ�줿���ץ�����ͤ����롥
+
+enable_config(config, *defaults)
+disable_config(config, *defaults)
+
+  ���ޥ�ɥ饤����--enable-<config>�ޤ���
+  --disable-<config>�ǻ��ꤵ�줿�����ͤ����롥
+  --enable-<config>�����ꤵ��Ƥ�������true��
+  --disable-<config>�����ꤵ��Ƥ�������false���֤���
+  �ɤ������ꤵ��Ƥ��ʤ����ϡ��֥��å��Ĥ��ǸƤӽФ���Ƥ������
+  *defaults��yield������̡��֥��å��ʤ��ʤ�*defaults���֤���
+
+dir_config(target[, default_dir])
+dir_config(target[, default_include, default_lib])
+
+  ���ޥ�ɥ饤����--with-<target>-dir, --with-<target>-include,
+  --with-<target>-lib�Τ����줫�ǻ��ꤵ���ǥ��쥯�ȥ��
+  $CFLAGS �� $LDFLAGS ���ɲä��롥--with-<target>-dir=/path��
+  --with-<target>-include=/path/include --with-<target>-lib=/path/lib
+  �������Ǥ��롥�ɲä��줿 include �ǥ��쥯�ȥ�� lib �ǥ��쥯�ȥ��
+  ������֤��� ([include_dir, lib_dir])
+
+pkg_config(pkg)
+
+  pkg-config���ޥ�ɤ���ѥå�����pkg�ξ�������롥 
+  pkg-config�μºݤΥ��ޥ��̾�ϡ�--with-pkg-config���ޥ��
+  �饤�󥪥ץ����ǻ����ǽ��
+
+/*
+ * Local variables:
+ * fill-column: 60
+ * end:
+ */
diff --git a/README.ja b/README.ja
new file mode 100644
index 0000000000..df8cfc03f4
--- /dev/null
+++ b/README.ja
@@ -0,0 +1,160 @@
+* Ruby�Ȥ�
+
+Ruby�ϥ���ץ뤫�Ķ��Ϥʥ��֥������Ȼظ�������ץȸ���Ǥ���
+Ruby�Ϻǽ餫����ʥ��֥������Ȼظ�����Ȥ����߷פ���Ƥ���
+�����顤���֥������Ȼظ��ץ�����ߥ󥰤��ڤ˹Ԥ����������
+������������̾�μ�³�����Υץ�����ߥ󥰤��ǽ�Ǥ���
+
+Ruby�ϥƥ����Ƚ����ط���ǽ�Ϥʤɤ�ͥ�졤Perl��Ʊ�����餤����
+�Ǥ�������˥���ץ��ʸˡ�ȡ��㳰�����䥤�ƥ졼���ʤɤε���
+�ˤ�äơ����ʬ����䤹���ץ�����ߥ󥰤�����ޤ���
+
+
+* Ruby����Ĺ
+
+  + ����ץ��ʸˡ
+  + ���̤Υ��֥������Ȼظ���ǽ(���饹���᥽�åɥ�����ʤ�)
+  + �ü�ʥ��֥������Ȼظ���ǽ(Mixin, �ðۥ᥽�åɤʤ�)
+  + �黻�ҥ����С�������
+  + �㳰������ǽ
+  + ���ƥ졼���ȥ���������
+  + �����١������쥯��
+  + �����ʥߥå������ǥ��� (�������ƥ�����ˤ��)
+  + �ܿ������⤤��¿����UNIX���ư�������Ǥʤ���DOS��Windows��
+    Mac��BeOS�ʤɤξ�Ǥ�ư��
+
+
+* ����ˡ
+
+** FTP��
+
+�ʲ��ξ��ˤ����Ƥ���ޤ���
+
+  ftp://ftp.ruby-lang.org/pub/ruby/
+
+** Subversion��
+
+�ܥ֥�����Ruby�κǿ��Υ����������ɤϼ��Υ��ޥ�ɤǼ����Ǥ��ޤ���
+
+  $ svn co http://svn.ruby-lang.org/repos/ruby/branches/ruby_1_8_6/
+
+��ȯ��ü�Υ����������ɤϼ��Υ��ޥ�ɤǼ����Ǥ��ޤ���
+
+  $ svn co http://svn.ruby-lang.org/repos/ruby/trunk/ ruby
+
+¾�˳�ȯ��Υ֥����ΰ����ϼ��Υ��ޥ�ɤǸ����ޤ���
+
+  $ svn ls http://svn.ruby-lang.org/repos/ruby/branches/
+
+
+* �ۡ���ڡ���
+
+Ruby�Υۡ���ڡ�����URL��
+
+   http://www.ruby-lang.org/
+
+�Ǥ���
+
+
+* �᡼��󥰥ꥹ��
+
+Ruby�Υ᡼��󥰥ꥹ�Ȥ�����ޤ������ô�˾������
+
+   ruby-list-ctl@ruby-lang.org
+
+�ޤ���ʸ��
+
+   subscribe YourFirstName YourFamilyName
+   
+�Ƚ񤤤����äƲ������� 
+
+Ruby��ȯ�Ը����᡼��󥰥ꥹ�Ȥ⤢��ޤ���������Ǥ�ruby�Υ�
+��������λ��ͳ�ĥ�ʤɼ����������ˤĤ��Ƶ�������Ƥ��ޤ���
+���ô�˾������
+
+   ruby-dev-ctl@ruby-lang.org
+
+�ޤ�ruby-list��Ʊ�ͤ���ˡ�ǥ᡼�뤷�Ƥ��������� 
+
+Ruby��ĥ�⥸�塼��ˤĤ����ä��礦ruby-ext�᡼��󥰥ꥹ�Ȥ�
+���شط�������ˤĤ����ä��礦ruby-math�᡼��󥰥ꥹ�Ȥ�
+�Ѹ���ä��礦ruby-talk�᡼��󥰥ꥹ�Ȥ⤢��ޤ���������ˡ
+�Ϥɤ��Ʊ���Ǥ��� 
+
+
+* ����ѥ��롦���󥹥ȡ���
+
+�ʲ��μ��ǹԤäƤ���������
+
+  1. �⤷configure�ե����뤬���Ĥ���ʤ����⤷����
+     configure.in���Ť��褦�ʤ顢autoconf��¹Ԥ���
+     ������configure����������
+
+  2. configure��¹Ԥ���Makefile�ʤɤ���������
+
+  3. (ɬ�פʤ��)defines.h���Խ�����
+
+     ¿ʬ��ɬ��̵���Ȼפ��ޤ���
+
+  4. (ɬ�פʤ��)ext/Setup����Ū�˥�󥯤����ĥ�⥸�塼���
+     ���ꤹ��
+
+     ext/Setup�˵��Ҥ����⥸�塼�����Ū�˥�󥯤���ޤ���
+
+     �����ʥߥå������ǥ��󥰤򥵥ݡ��Ȥ��Ƥ��ʤ��������ƥ�
+     ����Ǥ�Setup��1���ܤΡ�option nodynamic�פȤ����ԤΥ�
+     ���Ȥ򳰤�ɬ�פ�����ޤ����ޤ������Υ������ƥ������
+     ��ĥ�⥸�塼������Ѥ��뤿��ˤϡ����餫������Ū�˥��
+     �����Ƥ���ɬ�פ�����ޤ���
+
+  5. make��¹Ԥ��ƥ���ѥ��뤹��
+
+  6. make test�ǥƥ��Ȥ�Ԥ���
+
+     ��test succeeded�פ�ɽ�������������Ǥ����������ƥ���
+     ���������Ƥⴰ�������ݾڤ���Ƥ������ǤϤ���ޤ���
+
+  7. make install
+
+     root�Ǻ�Ȥ���ɬ�פ����뤫�⤷��ޤ���
+
+�⤷������ѥ�����˥��顼��ȯ���������ˤϥ��顼�Υ����ȥ�
+����OS�μ����ޤ�Ǥ�������ܤ�����ݡ��Ȥ��Ԥ����äƤ�
+�������¾�����Τ���ˤ�ʤ�ޤ���
+
+
+* �ܿ�
+
+UNIX�Ǥ����configure���ۤȤ�ɤκ��ۤ�ۼ����Ƥ����Ϥ���
+�������פ�̸���Ȥ������ä����(����˰㤤�ʤ�)����Ԥˤ���
+���Ȥ��ݡ��Ȥ���С����Ǥ��뤫���Τ�ޤ���
+
+�������ƥ�����ˤ�äȤ��¸����Τ�GC���Ǥ���Ruby��GC���о�
+�Υ������ƥ����㤬setjmp()�ˤ�ä����ƤΥ쥸������ jmp_buf��
+��Ǽ���뤳�Ȥȡ�jmp_buf�ȥ����å���32bit���饤����Ȥ����
+���뤳�Ȥ��ꤷ�Ƥ��ޤ����ä����Ԥ���Ω���ʤ������б�����
+��˺���Ǥ��礦����Ԥβ������Ū��ñ�ǡ�gc.c�ǥ����å���
+�ޡ������Ƥ�����ʬ�˥��饤����ȤΥХ��ȿ��������餷�ƥޡ�
+�����륳���ɤ��ɲä�������ǺѤߤޤ�����defined(THINK_C)�פ�
+����Ƥ�����ʬ�򻲹ͤˤ��Ƥ�������
+
+# �ºݤˤ�Ruby��Think C�Ǥϥ���ѥ���Ǥ��ޤ���
+
+�쥸����������ɥ������CPU�Ǥϡ��쥸����������ɥ��򥹥���
+���˥ե�å��夹�륢����֥饳���ɤ��ɲä���ɬ�פ����뤫����
+��ޤ���
+
+
+* ���۾��
+
+COPYING.ja�ե�����򻲾Ȥ��Ƥ���������
+
+
+* ����
+
+�����ȡ��Х���ݡ��Ȥ���¾�� matz@netlab.jp �ޤǡ�
+-------------------------------------------------------
+created at: Thu Aug  3 11:57:36 JST 1995
+Local variables:
+mode: indented-text
+end:
diff --git a/README.ja.md b/README.ja.md
deleted file mode 100644
index 9d6131e416..0000000000
--- a/README.ja.md
+++ /dev/null
@@ -1,171 +0,0 @@
-# Rubyとは
-
-Rubyはシンプルかつ強力なオブジェクト指向スクリプト言語です． Rubyは純粋なオブジェクト指向言語として設計されているので，
-オブジェクト指向プログラミングを手軽に行う事が出来ます．もちろん普通の手続き型のプログラミングも可能です．
-
-Rubyはテキスト処理関係の能力などに優れ，Perlと同じくらい強力です．さらにシンプルな文法と，
-例外処理やイテレータなどの機構によって，より分かりやすいプログラミングが出来ます．
-
-## Rubyの特長
-
-*   シンプルな文法
-*   普通のオブジェクト指向機能(クラス，メソッドコールなど)
-*   特殊なオブジェクト指向機能(Mixin, 特異メソッドなど)
-*   演算子オーバーロード
-*   例外処理機能
-*   イテレータとクロージャ
-*   ガーベージコレクタ
-*   ダイナミックローディング (アーキテクチャによる)
-*   移植性が高い．多くのUnix-like/POSIX互換プラットフォーム上で動くだけでなく，Windows， Mac OS
-    X，BeOSなどの上でも動く cf.
-    http://bugs.ruby-lang.org/projects/ruby-trunk/wiki/SupportedPlatformsJa
-
-
-## 入手法
-
-### FTPで
-
-以下の場所においてあります．
-
-ftp://ftp.ruby-lang.org/pub/ruby/
-
-### Subversionで
-
-開発先端のソースコードは次のコマンドで取得できます．
-
-    $ svn co http://svn.ruby-lang.org/repos/ruby/trunk/ ruby
-
-他に開発中のブランチの一覧は次のコマンドで見られます．
-
-    $ svn ls http://svn.ruby-lang.org/repos/ruby/branches/
-
-### Gitで
-
-SubversionのミラーをGitHubに公開しています． 以下のコマンドでリポジトリを取得できます．
-
-    $ git clone git://github.com/ruby/ruby.git
-
-## ホームページ
-
-RubyのホームページのURLは
-
-http://www.ruby-lang.org/
-
-です．
-
-## メーリングリスト
-
-Rubyのメーリングリストがあります．参加希望の方は
-
-mailto:ruby-list-request@ruby-lang.org
-
-まで本文に
-
-    subscribe
-
-と書いて送って下さい．
-
-Ruby開発者向けメーリングリストもあります．こちらではrubyのバグ，将来の仕様拡張など実装上の問題について議論されています． 参加希望の方は
-
-mailto:ruby-dev-request@ruby-lang.org
-
-までruby-listと同様の方法でメールしてください．
-
-Ruby拡張モジュールについて話し合うruby-extメーリングリストと数学関係の話題について話し合うruby-mathメーリングリストと
-英語でrubyについて話し合うruby-talkメーリングリストもあります．参加方法はどれも同じです．
-
-## コンパイル・インストール
-
-以下の手順で行ってください．
-
-1.  もし `configure` ファイルが見つからない，もしくは `configure.in` より古いようなら， `autoconf` を実行して
-    新しく `configure` を生成する
-
-2.  `configure` を実行して `Makefile` などを生成する
-
-    環境によってはデフォルトのCコンパイラ用オプションが付きます． `configure` オプションで `optflags=..`
-    `warnflags=..` 等で上書きできます．
-
-3.  (必要ならば)`defines.h` を編集する
-
-    多分，必要無いと思います．
-
-4.  (必要ならば)`ext/Setup` に静的にリンクする拡張モジュールを指定する
-
-    `ext/Setup` に記述したモジュールは静的にリンクされます．
-
-    ダイナミックローディングをサポートしていないアーキテクチャでは `Setup` の1行目の「`option nodynamic`」という行のコ
-    メントを外す必要があります．また，このアーキテクチャで拡張モジュールを利用するためには，あらかじめ静的にリンクをしておく必要があります．
-
-5.  `make` を実行してコンパイルする
-
-6.  `make check`でテストを行う．
-
-    「`check succeeded`」と表示されれば成功です．ただしテストに成功しても完璧だと保証されている訳ではありません．
-
-7.  `make install`
-
-    以下のディレクトリを作って，そこにファイルをインストー ルします．
-
-    *   `${DESTDIR}${prefix}/bin`
-    *   `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}`
-    *   `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
-    *   `${DESTDIR}${prefix}/lib`
-    *   `${DESTDIR}${prefix}/lib/ruby`
-    *   `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}`
-    *   `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
-    *   `${DESTDIR}${prefix}/lib/ruby/site_ruby`
-    *   `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}`
-    *   `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
-    *   `${DESTDIR}${prefix}/lib/ruby/vendor_ruby`
-    *   `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}`
-    *   `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
-    *   `${DESTDIR}${prefix}/lib/ruby/gems/${MAJOR}.${MINOR}.${TEENY}`
-    *   `${DESTDIR}${prefix}/share/man/man1`
-    *   `${DESTDIR}${prefix}/share/ri/${MAJOR}.${MINOR}.${TEENY}/system`
-
-
-    RubyのAPIバージョンが'*x.y.z*'であれば，`${MAJOR}`は
-    '*x*'で，`${MINOR}`は'*y*'，`${TEENY}`は'*z*'です．
-
-    **注意**: APIバージョンの `teeny` は，Rubyプログラムのバージョンとは異なることがあります．
-
-    `root` で作業する必要があるかもしれません．
-
-
-もし，コンパイル時にエラーが発生した場合にはエラーのログとマシン，OSの種類を含むできるだけ詳しいレポートを作者に送って下さると他の方のためにもなります．
-
-## 移植
-
-UNIXであれば `configure` がほとんどの差異を吸収してくれるはずですが，思わぬ見落としがあった場合(ある事が多い)，作者にその
-ことを報告すれば，解決できる可能性があります．
-
-アーキテクチャにもっとも依存するのはGC部です．RubyのGCは対象
-のアーキテクチャが`setjmp()`または`getcontext()`によって全てのレジスタを `jmp_buf` や `ucontext_t`
-に格納することと， `jmp_buf` や `ucontext_t` とスタックが32bitアラインメントされていることを仮定
-しています．特に前者が成立しない場合の対応は非常に困難でしょう． 後者の解決は比較的簡単で， `gc.c` でスタックをマークしている
-部分にアラインメントのバイト数だけずらしてマークするコードを追加するだけで済みます．`defined(__mc68000__)`で括られてい
-る部分を参考にしてください．
-
-レジスタウィンドウを持つCPUでは，レジスタウィンドウをスタックにフラッシュするアセンブラコードを追加する必要があるかもしれません．
-
-## 配布条件
-
-[COPYING.ja](COPYING.ja) ファイルを参照してください．
-
-## フィードバック
-
-Rubyに関する質問は Ruby-Talk（英語）や Ruby-List（日本語） (https://www.ruby-lang.org/ja/community/mailing-lists) や，
-stackoverflow (http://ja.stackoverflow.com/) などのWebサイトに投稿してください．
-
-バグ報告は http://bugs.ruby-lang.org で受け付けています．
-
-
-## 著者
-
-Rubyのオリジナル版は，1995年にまつもとゆきひろ氏によって設計・開発されました．
-
-<mailto:matz@ruby-lang.org>
-
----
-created at: Thu Aug  3 11:57:36 JST 1995
diff --git a/README.md b/README.md
deleted file mode 100644
index f79ba9c718..0000000000
--- a/README.md
+++ /dev/null
@@ -1,167 +0,0 @@
-[![Build Status](https://travis-ci.org/ruby/ruby.svg)](https://travis-ci.org/ruby/ruby)
-[![Build status](https://ci.appveyor.com/api/projects/status/0sy8rrxut4o0k960/branch/trunk?svg=true)](https://ci.appveyor.com/project/ruby/ruby/branch/trunk)
-
-# What's Ruby
-
-Ruby is the interpreted scripting language for quick and easy object-oriented
-programming.  It has many features to process text files and to do system
-management tasks (as in Perl).  It is simple, straight-forward, and
-extensible.
-
-## Features of Ruby
-
-*   Simple Syntax
-*   **Normal** Object-oriented Features (e.g. class, method calls)
-*   **Advanced** Object-oriented Features (e.g. Mix-in, Singleton-method)
-*   Operator Overloading
-*   Exception Handling
-*   Iterators and Closures
-*   Garbage Collection
-*   Dynamic Loading of Object Files (on some architectures)
-*   Highly Portable (works on many Unix-like/POSIX compatible platforms as
-    well as Windows, Mac OS X, BeOS, etc.) cf.
-    http://bugs.ruby-lang.org/projects/ruby-trunk/wiki/SupportedPlatforms
-
-
-## How to get Ruby
-
-For a complete list of ways to install Ruby, including using third-party tools
-like rvm, see:
-
-http://www.ruby-lang.org/en/downloads/
-
-The Ruby distribution files can be found on the following FTP site:
-
-ftp://ftp.ruby-lang.org/pub/ruby/
-
-The trunk of the Ruby source tree can be checked out with the following
-command:
-
-    $ svn co http://svn.ruby-lang.org/repos/ruby/trunk/ ruby
-
-Or if you are using git then use the following command:
-
-    $ git clone git://github.com/ruby/ruby.git
-
-There are some other branches under development.  Try the following command
-to see the list of branches:
-
-    $ svn ls http://svn.ruby-lang.org/repos/ruby/branches/
-
-Or if you are using git then use the following command:
-
-    $ git ls-remote git://github.com/ruby/ruby.git
-
-## Ruby home page
-
-The URL of the Ruby home page is:
-
-http://www.ruby-lang.org/
-
-## Mailing list
-
-There is a mailing list to talk about Ruby. To subscribe to this list, please
-send the following phrase:
-
-    subscribe
-
-in the mail body (not subject) to the address
-<mailto:ruby-talk-request@ruby-lang.org>.
-
-## How to compile and install
-
-This is what you need to do to compile and install Ruby:
-
-1.  If you want to use Microsoft Visual C++ to compile ruby, read
-    win32/README.win32 instead of this document.
-
-2.  If `./configure` does not exist or is older than configure.in, run
-    `autoconf` to (re)generate configure.
-
-3.  Run `./configure`, which will generate `config.h` and `Makefile`.
-
-    Some C compiler flags may be added by default depending on your
-    environment.  Specify `optflags=..` and `warnflags=..` as necessary to
-    override them.
-
-4.  Edit `defines.h` if you need. Usually this step will not be needed.
-
-5.  Remove comment mark(`#`) before the module names from `ext/Setup` (or add
-    module names if not present), if you want to link modules statically.
-
-    If you don't want to compile non static extension modules (probably on
-    architectures which do not allow dynamic loading), remove comment mark
-    from the line "`#option nodynamic`" in `ext/Setup`.
-
-    Usually this step will not be needed.
-
-6.  Run `make`.
-
-7.  Optionally, run '`make check`' to check whether the compiled Ruby
-    interpreter works well. If you see the message "`check succeeded`", your
-    ruby works as it should (hopefully).
-
-8.  Run '`make install`'
-
-    This command will create the following directories and install files into
-    them.
-
-    *   `${DESTDIR}${prefix}/bin`
-    *   `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}`
-    *   `${DESTDIR}${prefix}/include/ruby-${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
-    *   `${DESTDIR}${prefix}/lib`
-    *   `${DESTDIR}${prefix}/lib/ruby`
-    *   `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}`
-    *   `${DESTDIR}${prefix}/lib/ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
-    *   `${DESTDIR}${prefix}/lib/ruby/site_ruby`
-    *   `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}`
-    *   `${DESTDIR}${prefix}/lib/ruby/site_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
-    *   `${DESTDIR}${prefix}/lib/ruby/vendor_ruby`
-    *   `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}`
-    *   `${DESTDIR}${prefix}/lib/ruby/vendor_ruby/${MAJOR}.${MINOR}.${TEENY}/${PLATFORM}`
-    *   `${DESTDIR}${prefix}/lib/ruby/gems/${MAJOR}.${MINOR}.${TEENY}`
-    *   `${DESTDIR}${prefix}/share/man/man1`
-    *   `${DESTDIR}${prefix}/share/ri/${MAJOR}.${MINOR}.${TEENY}/system`
-
-
-    If Ruby's API version is '*x.y.z*', the `${MAJOR}` is '*x*', the
-    `${MINOR}` is '*y*', and the `${TEENY}` is '*z*'.
-
-    **NOTE**: teeny of the API version may be different from one of Ruby's
-    program version
-
-    You may have to be a super user to install ruby.
-
-
-If you fail to compile ruby, please send the detailed error report with the
-error log and machine/OS type, to help others.
-
-Some extension libraries may not get compiled because of lack of necessary
-external libraries and/or headers, then you will need to run '`make distclean-ext`'
-to remove old configuration after installing them in such case.
-
-## Copying
-
-See the file [COPYING](COPYING).
-
-## Feedback
-
-Questions about the Ruby language can be asked on the Ruby-Talk mailing list
-(http://www.ruby-lang.org/en/community/mailing-lists) or on websites like
-(http://stackoverflow.com).
-
-Bug reports should be filed at http://bugs.ruby-lang.org. Read [HowToReport] for more information.
-
-[HowToReport]: https://bugs.ruby-lang.org/projects/ruby/wiki/HowToReport
-
-##Contributing
-
-See the file [CONTRIBUTING.md](CONTRIBUTING.md)
-
-
-## The Author
-
-Ruby was originally designed and developed by Yukihiro Matsumoto (Matz) in
-1995.
-
-<mailto:matz@ruby-lang.org>
diff --git a/ToDo b/ToDo
new file mode 100644
index 0000000000..b55e399edf
--- /dev/null
+++ b/ToDo
@@ -0,0 +1,126 @@
+Language Spec.
+
+- Class#allocate - basicNew
+- class Foo::Bar<Baz .. end, module Boo::Bar .. end
+* operator !! for rescue. ???
+* objectify characters
+* ../... outside condition invokes operator method too.
+* ... inside condition turns off just before right condition.???
+* package or access control for global variables??
+* named arguments like foo(nation:="german") or foo(nation: "german").
+* method to retrieve argument information (needs new C API)
+* multiple return values, yield values.  maybe incompatible ???
+* cascading method invocation ???
+* def Class#method .. end ??
+* def Foo::Bar::baz() .. end ??
+* I18N (or M17N) script/string/regexp
+* Fixnum 0 as false ????
+* discourage use of symbol variables (e.g. $/, etc.) in manual
+* discourage use of Perlish features by giving warnings.
+* non confusing in-block local variable (is it possible?)
+  + remove scope by block
+  + variables appears within block may have independent values.
+* Regexp: make /o thread safe.
+* decide whether begin with rescue or ensure make do..while loop.
+* a +1 to be a+1, not a(+1).
+* unify == and eql? again
+* to_i returns nil if str contains no digit.
+* raise exception by `` error
+* jar like combined library package. -> RubyGems?
+* resumable Exception via Exception#resume.
+* method combination, e.g. before, after, around, etc.
+* .. or something like defadvice in Emacs.
+* property - for methods, or for objects in general.
+* "in" modifier, to annotate, or to encourage assertion.
+* selector namespace - something like generic-flet in CLOS, to help RubyBehavior
+* private instance variable (as in Python?) @_foo in class Foo => @_Foo_foo
+* warn/error "bare word" method, like "foo",  you should type "foo()"
+* clarify evaluation order of operator argument (=~, .., ...)
+* :symbol => value hash in the form of {symbol: value, ...} ??
+
+Hacking Interpreter
+
+- generational GC
+* non-blocking open (e.g. for named pipe) for thread
+* avoid blocking with gethostbyname/gethostbyaddr (use fork ???)
+* objectify interpreters ???
+* remove rb_eval() recursions
+* syntax tree -> bytecode ???
+* scrambled script, or script filter
+* setuid ruby
+* performance tune for in-block (dynamic) local variables.
+* give warnings to assign magic variables.
+* export rb_io_{addstr,printf,puts,print}
+* autoload should work with threads [ruby-talk:4589]
+* remove stdio dependency from IOs.
+* warn for inconsistent local variable usage (lv m and method m at the same time). 
+* MicroRuby
+* Built-in Interactive Ruby.
+* Parser API
+* trap every method invocation, which can be enabled by e.g. trap_call :method.
+* unify Errno exceptions of same errno, or new exception comparison scheme.
+* 2.times{|i| if i==0 then a = 15 else puts eval("a") end} should print nil.
+* Thread#max_stack_size attribute (possible??)
+
+Standard Libraries
+
+- Module#define_method which takes a name and a body (block, proc or method).
+- Enume#inject
+- Array#fetch
+- IO::for_fd
+- Process::waitall [ruby-talk:4557]
+- Process::Status
+- File::lchown, File::lchmod; xxx - still need work for non existing platforms
+- move Time::times to Process.
+- Enumerable#sort_by for Schwartzian transformation
+- fork_and_kill_other_threads.
+- signal list (Signal::trap, Signal::list).
+- move NameError under StandardError.
+- Integer#to_s(base)
+- Hash::new{default}
+- hash etc. should handle self referenceing array/hash
+- Array#select(n1,n2...) works like Array#indexes(n1,n2...)
+- use Mersenne Twister RNG for random.
+- deprecate Array#indexes, and Array#indices.
+- remove dependency on MAXPATHLEN.
+* String#scanf(?)
+* Object#fmt(?)
+* Time::strptime
+* Integer[num], Float[num];  Fixnum[num]?
+* method to retrieve non-number trailer for to_i/to_f.
+* Stream or Port, abstract superclass of IO ?
+* String#{pred,prev}, String#downto
+* optional stepsize argument for succ()
+* Ruby module -- Ruby::Version, Ruby::Interpreter
+* introduce Boolean class; super of TrueClass, FalseClass
+* synchronized method - synchronized{...}, synchronized :foo, :bar
+* Array#&, Array#| to allow duplication. ???
+* way to specify immortal (fork endurance) thread;
+* or raise ForkException to every thread but fork caller.
+* new user-defined marshal scheme. _dump(dumper), _load(restorer)
+* library to load per-user profile seeking .ruby_profile or ruby.ini file.
+* warning framework (warn, warning for Ruby level)
+* marshal should not depend on sprintf (works bad with locale).
+* ternary arg pow: a.pow(b,c) == a**b%c
+* new caller(), e.g. call_stack; needs better name.
+* pointer share mechanism similar to one in String for Array.
+* require "1.6" etc. by /usr/lib/ruby/1.6/1.6.rb ;-)
+* save both "feature names" and "normalized path" in $"
+* implement Mutex_m (or MutexMixin) using Mutex.
+
+Extension Libraries
+
+* ptk.rb pTk wrapper that is compatible to tk.rb
+* Berkeley DB extension
+* BitVector
+* thread-safe fcgi
+
+Ruby Libraries
+
+* urllib.rb, nttplib.rb, etc.
+* format like perl's
+
+Tools
+
+* freeze or undump to bundle everything
+* bundle using zlib
diff --git a/acinclude.m4 b/acinclude.m4
deleted file mode 100644
index 99b24e6d93..0000000000
--- a/acinclude.m4
+++ /dev/null
@@ -1,46 +0,0 @@
-# -*- autoconf -*-
-
-AC_DEFUN([_COLORIZE_RESULT_PREPARE], [
-    msg_checking= msg_result_yes= msg_result_no= msg_result_other= msg_reset=
-    AS_IF([test "x${CONFIGURE_TTY}" = xyes -o -t 1], [
-	msg_begin="`tput smso 2>/dev/null`"
-	AS_CASE(["$msg_begin"], ['@<:@'*m],
-	    [msg_begin="`echo "$msg_begin" | sed ['s/[0-9]*m$//']`"
-	    msg_checking="${msg_begin}33m"
-	    AS_IF([test ${TEST_COLORS:+set}], [
-		msg_result_yes=[`expr ":$TEST_COLORS:" : ".*:pass=\([^:]*\):"`]
-		msg_result_no=[`expr ":$TEST_COLORS:" : ".*:fail=\([^:]*\):"`]
-		msg_result_other=[`expr ":$TEST_COLORS:" : ".*:skip=\([^:]*\):"`]
-	    ])
-	    msg_result_yes="${msg_begin}${msg_result_yes:-32;1}m"
-	    msg_result_no="${msg_begin}${msg_result_no:-31;1}m"
-	    msg_result_other="${msg_begin}${msg_result_other:-33;1}m"
-	    msg_reset="${msg_begin}m"
-	    ])
-	AS_UNSET(msg_begin)
-	])
-    AS_REQUIRE_SHELL_FN([colorize_result],
-	[AS_FUNCTION_DESCRIBE([colorize_result], [MSG], [Colorize result])],
-        [AS_CASE(["$[]1"],
-            [yes], [AS_ECHO(["${msg_result_yes}$[]1${msg_reset}]")],
-            [no], [AS_ECHO(["${msg_result_no}$[]1${msg_reset}]")],
-            [AS_ECHO(["${msg_result_other}$[]1${msg_reset}]")])])
-])
-
-AC_DEFUN([COLORIZE_RESULT], [AC_REQUIRE([_COLORIZE_RESULT_PREPARE])dnl
-    AS_LITERAL_IF([$1],
-	[m4_case([$1],
-		[yes], [AS_ECHO(["${msg_result_yes}$1${msg_reset}"])],
-		[no], [AS_ECHO(["${msg_result_no}$1${msg_reset}"])],
-		[AS_ECHO(["${msg_result_other}$1${msg_reset}"])])],
-	[colorize_result "$1"]) dnl
-])
-
-AC_DEFUN([AC_CHECKING],[dnl
-AC_REQUIRE([_COLORIZE_RESULT_PREPARE])dnl
-AS_MESSAGE([checking ${msg_checking}$1${msg_reset}...])])
-
-AC_DEFUN([AC_MSG_RESULT], [dnl
-{ _AS_ECHO_LOG([result: $1])
-COLORIZE_RESULT([$1]); dnl
-}])
diff --git a/aclocal.m4 b/aclocal.m4
deleted file mode 100644
index 56e944be8f..0000000000
--- a/aclocal.m4
+++ /dev/null
@@ -1,15 +0,0 @@
-# generated automatically by aclocal 1.15 -*- Autoconf -*-
-
-# Copyright (C) 1996-2014 Free Software Foundation, Inc.
-
-# This file is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# This program is distributed in the hope that it will be useful,
-# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
-# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
-# PARTICULAR PURPOSE.
-
-m4_ifndef([AC_CONFIG_MACRO_DIRS], [m4_defun([_AM_CONFIG_MACRO_DIRS], [])m4_defun([AC_CONFIG_MACRO_DIRS], [_AM_CONFIG_MACRO_DIRS($@)])])
-m4_include([acinclude.m4])
diff --git a/addr2line.c b/addr2line.c
deleted file mode 100644
index a20e5000c4..0000000000
--- a/addr2line.c
+++ /dev/null
@@ -1,1205 +0,0 @@
-/**********************************************************************
-
-  addr2line.c -
-
-  $Author$
-
-  Copyright (C) 2010 Shinichiro Hamaji
-
-**********************************************************************/
-
-#include "ruby/config.h"
-#include "ruby/missing.h"
-#include "addr2line.h"
-
-#include <stdio.h>
-#include <errno.h>
-
-#ifdef USE_ELF
-
-#include <fcntl.h>
-#include <limits.h>
-#include <stdio.h>
-#include <stdint.h>
-#include <stdlib.h>
-#include <string.h>
-#include <sys/mman.h>
-#include <sys/types.h>
-#include <sys/stat.h>
-#include <unistd.h>
-
-#ifdef __OpenBSD__
-#include <elf_abi.h>
-#else
-#include <elf.h>
-#endif
-
-/* Make alloca work the best possible way.  */
-#ifdef __GNUC__
-# ifndef alloca
-#  define alloca __builtin_alloca
-# endif
-#else
-# ifdef HAVE_ALLOCA_H
-#  include <alloca.h>
-# else
-#  ifdef _AIX
-#pragma alloca
-#  else
-#   ifndef alloca		/* predefined by HP cc +Olibcalls */
-void *alloca();
-#   endif
-#  endif /* AIX */
-# endif	/* HAVE_ALLOCA_H */
-#endif /* __GNUC__ */
-
-#ifdef HAVE_DLADDR
-# include <dlfcn.h>
-#endif
-
-#define DW_LNS_copy                     0x01
-#define DW_LNS_advance_pc               0x02
-#define DW_LNS_advance_line             0x03
-#define DW_LNS_set_file                 0x04
-#define DW_LNS_set_column               0x05
-#define DW_LNS_negate_stmt              0x06
-#define DW_LNS_set_basic_block          0x07
-#define DW_LNS_const_add_pc             0x08
-#define DW_LNS_fixed_advance_pc         0x09
-#define DW_LNS_set_prologue_end         0x0a /* DWARF3 */
-#define DW_LNS_set_epilogue_begin       0x0b /* DWARF3 */
-#define DW_LNS_set_isa                  0x0c /* DWARF3 */
-
-/* Line number extended opcode name. */
-#define DW_LNE_end_sequence             0x01
-#define DW_LNE_set_address              0x02
-#define DW_LNE_define_file              0x03
-#define DW_LNE_set_discriminator        0x04  /* DWARF4 */
-
-#ifndef ElfW
-# if SIZEOF_VOIDP == 8
-#  define ElfW(x) Elf64##_##x
-# else
-#  define ElfW(x) Elf32##_##x
-# endif
-#endif
-#ifndef ELF_ST_TYPE
-# if SIZEOF_VOIDP == 8
-#  define ELF_ST_TYPE ELF64_ST_TYPE
-# else
-#  define ELF_ST_TYPE ELF32_ST_TYPE
-# endif
-#endif
-#ifndef PATH_MAX
-#define PATH_MAX 4096
-#endif
-
-int kprintf(const char *fmt, ...);
-
-typedef struct {
-    const char *dirname;
-    const char *filename;
-    const char *path; /* object path */
-    int line;
-
-    uintptr_t base_addr;
-    uintptr_t saddr;
-    const char *sname; /* function name */
-} line_info_t;
-typedef struct obj_info obj_info_t;
-struct obj_info {
-    const char *path; /* object path */
-    int fd;
-    void *mapped;
-    size_t mapped_size;
-    uintptr_t base_addr;
-    obj_info_t *next;
-};
-
-/* Avoid consuming stack as this module may be used from signal handler */
-static char binary_filename[PATH_MAX];
-
-static unsigned long
-uleb128(char **p)
-{
-    unsigned long r = 0;
-    int s = 0;
-    for (;;) {
-	unsigned char b = *(unsigned char *)(*p)++;
-	if (b < 0x80) {
-	    r += (unsigned long)b << s;
-	    break;
-	}
-	r += (b & 0x7f) << s;
-	s += 7;
-    }
-    return r;
-}
-
-static long
-sleb128(char **p)
-{
-    long r = 0;
-    int s = 0;
-    for (;;) {
-	unsigned char b = *(unsigned char *)(*p)++;
-	if (b < 0x80) {
-	    if (b & 0x40) {
-		r -= (0x80 - b) << s;
-	    }
-	    else {
-		r += (b & 0x3f) << s;
-	    }
-	    break;
-	}
-	r += (b & 0x7f) << s;
-	s += 7;
-    }
-    return r;
-}
-
-static const char *
-get_nth_dirname(unsigned long dir, char *p)
-{
-    if (!dir--) {
-	return "";
-    }
-    while (dir--) {
-	while (*p) p++;
-	p++;
-	if (!*p) {
-	    kprintf("Unexpected directory number %lu in %s\n",
-		    dir, binary_filename);
-	    return "";
-	}
-    }
-    return p;
-}
-
-static void
-fill_filename(int file, char *include_directories, char *filenames,
-	      line_info_t *line)
-{
-    int i;
-    char *p = filenames;
-    char *filename;
-    unsigned long dir;
-    for (i = 1; i <= file; i++) {
-	filename = p;
-	if (!*p) {
-	    /* Need to output binary file name? */
-	    kprintf("Unexpected file number %d in %s\n",
-		    file, binary_filename);
-	    return;
-	}
-	while (*p) p++;
-	p++;
-	dir = uleb128(&p);
-	/* last modified. */
-	uleb128(&p);
-	/* size of the file. */
-	uleb128(&p);
-
-	if (i == file) {
-	    line->filename = filename;
-	    line->dirname = get_nth_dirname(dir, include_directories);
-	}
-    }
-}
-
-static void
-fill_line(int num_traces, void **traces, uintptr_t addr, int file, int line,
-	  char *include_directories, char *filenames,
-	  obj_info_t *obj, line_info_t *lines, int offset)
-{
-    int i;
-    addr += obj->base_addr;
-    for (i = offset; i < num_traces; i++) {
-	uintptr_t a = (uintptr_t)traces[i];
-	/* We assume one line code doesn't result >100 bytes of native code.
-       We may want more reliable way eventually... */
-	if (addr < a && a < addr + 100) {
-	    fill_filename(file, include_directories, filenames, &lines[i]);
-	    lines[i].line = line;
-	}
-    }
-}
-
-static void
-parse_debug_line_cu(int num_traces, void **traces, char **debug_line,
-		obj_info_t *obj, line_info_t *lines, int offset)
-{
-    char *p, *cu_end, *cu_start, *include_directories, *filenames;
-    unsigned long unit_length;
-    int default_is_stmt, line_base;
-    unsigned int header_length, minimum_instruction_length, line_range,
-		 opcode_base;
-    /* unsigned char *standard_opcode_lengths; */
-
-    /* The registers. */
-    unsigned long addr = 0;
-    unsigned int file = 1;
-    unsigned int line = 1;
-    /* unsigned int column = 0; */
-    int is_stmt;
-    /* int basic_block = 0; */
-    /* int end_sequence = 0; */
-    /* int prologue_end = 0; */
-    /* int epilogue_begin = 0; */
-    /* unsigned int isa = 0; */
-
-    p = *debug_line;
-
-    unit_length = *(unsigned int *)p;
-    p += sizeof(unsigned int);
-    if (unit_length == 0xffffffff) {
-	unit_length = *(unsigned long *)p;
-	p += sizeof(unsigned long);
-    }
-
-    cu_end = p + unit_length;
-
-    /*dwarf_version = *(unsigned short *)p;*/
-    p += 2;
-
-    header_length = *(unsigned int *)p;
-    p += sizeof(unsigned int);
-
-    cu_start = p + header_length;
-
-    minimum_instruction_length = *(unsigned char *)p;
-    p++;
-
-    is_stmt = default_is_stmt = *(unsigned char *)p;
-    p++;
-
-    line_base = *(signed char *)p;
-    p++;
-
-    line_range = *(unsigned char *)p;
-    p++;
-
-    opcode_base = *(unsigned char *)p;
-    p++;
-
-    /* standard_opcode_lengths = (unsigned char *)p - 1; */
-    p += opcode_base - 1;
-
-    include_directories = p;
-
-    /* skip include directories */
-    while (*p) {
-	while (*p) p++;
-	p++;
-    }
-    p++;
-
-    filenames = p;
-
-    p = cu_start;
-
-#define FILL_LINE()						    \
-    do {							    \
-	fill_line(num_traces, traces, addr, file, line,		    \
-		  include_directories, filenames,		    \
-		  obj, lines, offset);				    \
-	/*basic_block = prologue_end = epilogue_begin = 0;*/	    \
-    } while (0)
-
-    while (p < cu_end) {
-	unsigned long a;
-	unsigned char op = *p++;
-	switch (op) {
-	case DW_LNS_copy:
-	    FILL_LINE();
-	    break;
-	case DW_LNS_advance_pc:
-	    a = uleb128(&p);
-	    addr += a;
-	    break;
-	case DW_LNS_advance_line: {
-	    long a = sleb128(&p);
-	    line += a;
-	    break;
-	}
-	case DW_LNS_set_file:
-	    file = (unsigned int)uleb128(&p);
-	    break;
-	case DW_LNS_set_column:
-	    /*column = (unsigned int)*/(void)uleb128(&p);
-	    break;
-	case DW_LNS_negate_stmt:
-	    is_stmt = !is_stmt;
-	    break;
-	case DW_LNS_set_basic_block:
-	    /*basic_block = 1; */
-	    break;
-	case DW_LNS_const_add_pc:
-	    a = ((255 - opcode_base) / line_range) *
-		minimum_instruction_length;
-	    addr += a;
-	    break;
-	case DW_LNS_fixed_advance_pc:
-	    a = *(unsigned char *)p++;
-	    addr += a;
-	    break;
-	case DW_LNS_set_prologue_end:
-	    /* prologue_end = 1; */
-	    break;
-	case DW_LNS_set_epilogue_begin:
-	    /* epilogue_begin = 1; */
-	    break;
-	case DW_LNS_set_isa:
-	    /* isa = (unsigned int)*/(void)uleb128(&p);
-	    break;
-	case 0:
-	    a = *(unsigned char *)p++;
-	    op = *p++;
-	    switch (op) {
-	    case DW_LNE_end_sequence:
-		/* end_sequence = 1; */
-		FILL_LINE();
-		addr = 0;
-		file = 1;
-		line = 1;
-		/* column = 0; */
-		is_stmt = default_is_stmt;
-		/* end_sequence = 0; */
-		/* isa = 0; */
-		break;
-	    case DW_LNE_set_address:
-		addr = *(unsigned long *)p;
-		p += sizeof(unsigned long);
-		break;
-	    case DW_LNE_define_file:
-		kprintf("Unsupported operation in %s\n",
-			binary_filename);
-		break;
-	    case DW_LNE_set_discriminator:
-		/* TODO:currently ignore */
-		uleb128(&p);
-		break;
-	    default:
-		kprintf("Unknown extended opcode: %d in %s\n",
-			op, binary_filename);
-	    }
-	    break;
-	default: {
-	    unsigned long addr_incr;
-	    unsigned long line_incr;
-	    a = op - opcode_base;
-	    addr_incr = (a / line_range) * minimum_instruction_length;
-	    line_incr = line_base + (a % line_range);
-	    addr += (unsigned int)addr_incr;
-	    line += (unsigned int)line_incr;
-	    FILL_LINE();
-	}
-	}
-    }
-    *debug_line = p;
-}
-
-static void
-parse_debug_line(int num_traces, void **traces,
-		 char *debug_line, unsigned long size,
-		 obj_info_t *obj, line_info_t *lines, int offset)
-{
-    char *debug_line_end = debug_line + size;
-    while (debug_line < debug_line_end) {
-	parse_debug_line_cu(num_traces, traces, &debug_line, obj, lines, offset);
-    }
-    if (debug_line != debug_line_end) {
-	kprintf("Unexpected size of .debug_line in %s\n",
-		binary_filename);
-    }
-}
-
-/* read file and fill lines */
-static uintptr_t
-fill_lines(int num_traces, void **traces, int check_debuglink,
-	   obj_info_t **objp, line_info_t *lines, int offset);
-
-static void
-append_obj(obj_info_t **objp) {
-    obj_info_t *newobj = calloc(1, sizeof(obj_info_t));
-    if (*objp) (*objp)->next = newobj;
-    *objp = newobj;
-}
-
-static void
-follow_debuglink(char *debuglink, int num_traces, void **traces,
-		 obj_info_t **objp, line_info_t *lines, int offset)
-{
-    /* Ideally we should check 4 paths to follow gnu_debuglink,
-       but we handle only one case for now as this format is used
-       by some linux distributions. See GDB's info for detail. */
-    static const char global_debug_dir[] = "/usr/lib/debug";
-    char *p, *subdir;
-    obj_info_t *o1 = *objp, *o2;
-
-    p = strrchr(binary_filename, '/');
-    if (!p) {
-	return;
-    }
-    p[1] = '\0';
-
-    subdir = (char *)alloca(strlen(binary_filename) + 1);
-    strcpy(subdir, binary_filename);
-    strcpy(binary_filename, global_debug_dir);
-    strlcat(binary_filename, subdir, PATH_MAX);
-    strlcat(binary_filename, debuglink, PATH_MAX);
-
-    append_obj(objp);
-    o2 = *objp;
-    o2->base_addr = o1->base_addr;
-    o2->path = o1->path;
-    fill_lines(num_traces, traces, 0, objp, lines, offset);
-}
-
-/* read file and fill lines */
-static uintptr_t
-fill_lines(int num_traces, void **traces, int check_debuglink,
-	   obj_info_t **objp, line_info_t *lines, int offset)
-{
-    int i, j;
-    char *shstr;
-    char *section_name;
-    ElfW(Ehdr) *ehdr;
-    ElfW(Shdr) *shdr, *shstr_shdr;
-    ElfW(Shdr) *debug_line_shdr = NULL, *gnu_debuglink_shdr = NULL;
-    int fd;
-    off_t filesize;
-    char *file;
-    ElfW(Shdr) *symtab_shdr = NULL, *strtab_shdr = NULL;
-    ElfW(Shdr) *dynsym_shdr = NULL, *dynstr_shdr = NULL;
-    obj_info_t *obj = *objp;
-    uintptr_t dladdr_fbase = 0;
-
-    fd = open(binary_filename, O_RDONLY);
-    if (fd < 0) {
-	goto fail;
-    }
-    filesize = lseek(fd, 0, SEEK_END);
-    if (filesize < 0) {
-	int e = errno;
-	close(fd);
-	kprintf("lseek: %s\n", strerror(e));
-	goto fail;
-    }
-#if SIZEOF_OFF_T > SIZEOF_SIZE_T
-    if (filesize > (off_t)SIZE_MAX) {
-	close(fd);
-	kprintf("Too large file %s\n", binary_filename);
-	goto fail;
-    }
-#endif
-    lseek(fd, 0, SEEK_SET);
-    /* async-signal unsafe */
-    file = (char *)mmap(NULL, (size_t)filesize, PROT_READ, MAP_SHARED, fd, 0);
-    if (file == MAP_FAILED) {
-	int e = errno;
-	close(fd);
-	kprintf("mmap: %s\n", strerror(e));
-	goto fail;
-    }
-
-    ehdr = (ElfW(Ehdr) *)file;
-    if (memcmp(ehdr->e_ident, "\177ELF", 4) != 0) {
-	/*
-	 * Huh? Maybe filename was overridden by setproctitle() and
-	 * it match non-elf file.
-	 */
-	close(fd);
-	goto fail;
-    }
-
-    obj->fd = fd;
-    obj->mapped = file;
-    obj->mapped_size = (size_t)filesize;
-
-    shdr = (ElfW(Shdr) *)(file + ehdr->e_shoff);
-
-    shstr_shdr = shdr + ehdr->e_shstrndx;
-    shstr = file + shstr_shdr->sh_offset;
-
-    for (i = 0; i < ehdr->e_shnum; i++) {
-	section_name = shstr + shdr[i].sh_name;
-	switch (shdr[i].sh_type) {
-	  case SHT_STRTAB:
-	    if (!strcmp(section_name, ".strtab")) {
-		strtab_shdr = shdr + i;
-	    }
-	    else if (!strcmp(section_name, ".dynstr")) {
-		dynstr_shdr = shdr + i;
-	    }
-	    break;
-	  case SHT_SYMTAB:
-	    /* if (!strcmp(section_name, ".symtab")) */
-	    symtab_shdr = shdr + i;
-	    break;
-	  case SHT_DYNSYM:
-	    /* if (!strcmp(section_name, ".dynsym")) */
-	    dynsym_shdr = shdr + i;
-	    break;
-	  case SHT_PROGBITS:
-	    if (!strcmp(section_name, ".debug_line")) {
-		debug_line_shdr = shdr + i;
-	    }
-	    else if (!strcmp(section_name, ".gnu_debuglink")) {
-		gnu_debuglink_shdr = shdr + i;
-	    }
-	    break;
-	}
-    }
-
-    if (offset == -1) {
-	/* main executable */
-	offset = 0;
-	if (dynsym_shdr && dynstr_shdr) {
-	    char *strtab = file + dynstr_shdr->sh_offset;
-	    ElfW(Sym) *symtab = (ElfW(Sym) *)(file + dynsym_shdr->sh_offset);
-	    int symtab_count = (int)(dynsym_shdr->sh_size / sizeof(ElfW(Sym)));
-	    for (j = 0; j < symtab_count; j++) {
-		ElfW(Sym) *sym = &symtab[j];
-		Dl_info info;
-		void *h, *s;
-		if (ELF_ST_TYPE(sym->st_info) != STT_FUNC || sym->st_size <= 0) continue;
-		h = dlopen(NULL, RTLD_NOW|RTLD_LOCAL);
-		if (!h) continue;
-		s = dlsym(h, strtab + sym->st_name);
-		if (!s) continue;
-		if (dladdr(s, &info)) {
-		    dladdr_fbase = (uintptr_t)info.dli_fbase;
-		    break;
-		}
-	    }
-	    if (ehdr->e_type == ET_EXEC) {
-		obj->base_addr = 0;
-	    }
-	    else {
-		/* PIE (position-independent executable) */
-		obj->base_addr = dladdr_fbase;
-	    }
-	}
-    }
-
-    if (!symtab_shdr) {
-	symtab_shdr = dynsym_shdr;
-	strtab_shdr = dynstr_shdr;
-    }
-
-    if (symtab_shdr && strtab_shdr) {
-	char *strtab = file + strtab_shdr->sh_offset;
-	ElfW(Sym) *symtab = (ElfW(Sym) *)(file + symtab_shdr->sh_offset);
-	int symtab_count = (int)(symtab_shdr->sh_size / sizeof(ElfW(Sym)));
-	for (j = 0; j < symtab_count; j++) {
-	    ElfW(Sym) *sym = &symtab[j];
-	    uintptr_t saddr = (uintptr_t)sym->st_value + obj->base_addr;
-	    if (ELF_ST_TYPE(sym->st_info) != STT_FUNC || sym->st_size <= 0) continue;
-	    for (i = offset; i < num_traces; i++) {
-		uintptr_t d = (uintptr_t)traces[i] - saddr;
-		if (lines[i].line > 0 || d <= 0 || d > (uintptr_t)sym->st_size)
-		    continue;
-		/* fill symbol name and addr from .symtab */
-		lines[i].sname = strtab + sym->st_name;
-		lines[i].saddr = saddr;
-		lines[i].path  = obj->path;
-		lines[i].base_addr = obj->base_addr;
-	    }
-	}
-    }
-
-    if (!debug_line_shdr) {
-	/* This file doesn't have .debug_line section,
-	   let's check .gnu_debuglink section instead. */
-	if (gnu_debuglink_shdr && check_debuglink) {
-	    follow_debuglink(file + gnu_debuglink_shdr->sh_offset,
-			     num_traces, traces,
-			     objp, lines, offset);
-	}
-	goto finish;
-    }
-
-    parse_debug_line(num_traces, traces,
-		     file + debug_line_shdr->sh_offset,
-		     debug_line_shdr->sh_size,
-		     obj, lines, offset);
-finish:
-    return dladdr_fbase;
-fail:
-    return (uintptr_t)-1;
-}
-
-#define HAVE_MAIN_EXE_PATH
-#if defined(__FreeBSD__)
-# include <sys/sysctl.h>
-#endif
-/* ssize_t main_exe_path(void)
- *
- * store the path of the main executable to `binary_filename`,
- * and returns strlen(binary_filename).
- * it is NUL terminated.
- */
-#if defined(__linux__)
-ssize_t
-main_exe_path(void)
-{
-# define PROC_SELF_EXE "/proc/self/exe"
-    ssize_t len = readlink(PROC_SELF_EXE, binary_filename, PATH_MAX);
-    binary_filename[len] = 0;
-    return len;
-}
-#elif defined(__FreeBSD__)
-ssize_t
-main_exe_path(void)
-{
-    int mib[4] = {CTL_KERN, KERN_PROC, KERN_PROC_PATHNAME, -1};
-    size_t len = PATH_MAX;
-    int err = sysctl(mib, 4, binary_filename, &len, NULL, 0);
-    if (err) {
-	kprintf("Can't get the path of ruby");
-	return -1;
-    }
-    len--; /* sysctl sets strlen+1 */
-    return len;
-}
-#else
-#undef HAVE_MAIN_EXE_PATH
-#endif
-
-void
-rb_dump_backtrace_with_lines(int num_traces, void **traces)
-{
-    int i;
-    /* async-signal unsafe */
-    line_info_t *lines = (line_info_t *)calloc(num_traces, sizeof(line_info_t));
-    obj_info_t *obj = NULL;
-    /* 2 is NULL + main executable */
-    void **dladdr_fbases = (void **)calloc(num_traces+2, sizeof(void *));
-#ifdef HAVE_MAIN_EXE_PATH
-    char *main_path = NULL; /* used on printing backtrace */
-    ssize_t len;
-    if ((len = main_exe_path()) > 0) {
-	main_path = (char *)alloca(len + 1);
-	if (main_path) {
-	    uintptr_t addr;
-	    memcpy(main_path, binary_filename, len+1);
-	    append_obj(&obj);
-	    obj->path = main_path;
-	    addr = fill_lines(num_traces, traces, 1, &obj, lines, -1);
-	    if (addr != (uintptr_t)-1) {
-		dladdr_fbases[0] = (void *)addr;
-	    }
-	}
-    }
-#endif
-
-    /* fill source lines by reading dwarf */
-    for (i = 0; i < num_traces; i++) {
-	Dl_info info;
-	if (lines[i].line) continue;
-	if (dladdr(traces[i], &info)) {
-	    const char *path;
-	    void **p;
-
-	    /* skip symbols which is in already checked objects */
-	    /* if the binary is strip-ed, this may effect */
-	    for (p=dladdr_fbases; *p; p++) {
-		if (*p == info.dli_fbase) {
-		    lines[i].path = info.dli_fname;
-		    lines[i].sname = info.dli_sname;
-		    goto next_line;
-		}
-	    }
-	    *p = info.dli_fbase;
-
-	    append_obj(&obj);
-	    obj->base_addr = (uintptr_t)info.dli_fbase;
-	    path = info.dli_fname;
-	    obj->path = path;
-	    lines[i].path = path;
-	    strcpy(binary_filename, path);
-	    fill_lines(num_traces, traces, 1, &obj, lines, i);
-	}
-next_line:
-	continue;
-    }
-
-    /* output */
-    for (i = 0; i < num_traces; i++) {
-	line_info_t *line = &lines[i];
-	uintptr_t addr = (uintptr_t)traces[i];
-	uintptr_t d = addr - line->saddr;
-	if (!line->path) {
-	    kprintf("[0x%lx]\n", addr);
-	}
-	else if (!line->saddr || !line->sname) {
-	    kprintf("%s [0x%lx]\n", line->path, addr);
-	}
-	else if (line->line <= 0) {
-	    kprintf("%s(%s+0x%lx) [0x%lx]\n", line->path, line->sname,
-		    d, addr);
-	}
-	else if (!line->filename) {
-	    kprintf("%s(%s+0x%lx) [0x%lx] ???:%d\n", line->path, line->sname,
-		    d, addr, line->line);
-	}
-	else if (line->dirname && line->dirname[0]) {
-	    kprintf("%s(%s+0x%lx) [0x%lx] %s/%s:%d\n", line->path, line->sname,
-		    d, addr, line->dirname, line->filename, line->line);
-	}
-	else {
-	    kprintf("%s(%s+0x%lx) [0x%lx] %s:%d\n", line->path, line->sname,
-		    d, addr, line->filename, line->line);
-	}
-	/* FreeBSD's backtrace may show _start and so on */
-	if (line->sname && strcmp("main", line->sname) == 0)
-	    break;
-    }
-
-    /* free */
-    while (obj) {
-	obj_info_t *o = obj;
-	obj = o->next;
-	if (o->fd) {
-	    munmap(o->mapped, o->mapped_size);
-	    close(o->fd);
-	}
-	free(o);
-    }
-    free(lines);
-    free(dladdr_fbases);
-}
-
-/* From FreeBSD's lib/libstand/printf.c */
-/*-
- * Copyright (c) 1986, 1988, 1991, 1993
- *	The Regents of the University of California.  All rights reserved.
- * (c) UNIX System Laboratories, Inc.
- * All or some portions of this file are derived from material licensed
- * to the University of California by American Telephone and Telegraph
- * Co. or Unix System Laboratories, Inc. and are reproduced herein with
- * the permission of UNIX System Laboratories, Inc.
- *
- * Redistribution and use in source and binary forms, with or without
- * modification, are permitted provided that the following conditions
- * are met:
- * 1. Redistributions of source code must retain the above copyright
- *    notice, this list of conditions and the following disclaimer.
- * 2. Redistributions in binary form must reproduce the above copyright
- *    notice, this list of conditions and the following disclaimer in the
- *    documentation and/or other materials provided with the distribution.
- * 4. Neither the name of the University nor the names of its contributors
- *    may be used to endorse or promote products derived from this software
- *    without specific prior written permission.
- *
- * THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS ``AS IS'' AND
- * ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
- * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- * ARE DISCLAIMED.  IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE
- * FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
- * DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
- * OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
- * HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
- * LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
- * OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
- * SUCH DAMAGE.
- *
- *	@(#)subr_prf.c	8.3 (Berkeley) 1/21/94
- */
-
-#include <stdarg.h>
-#define MAXNBUF (sizeof(intmax_t) * CHAR_BIT + 1)
-static inline int toupper(int c) { return ('A' <= c && c <= 'Z') ? (c&0x5f) : c; }
-#define    hex2ascii(hex)  (hex2ascii_data[hex])
-char const hex2ascii_data[] = "0123456789abcdefghijklmnopqrstuvwxyz";
-static inline int imax(int a, int b) { return (a > b ? a : b); }
-static int kvprintf(char const *fmt, void (*func)(int), void *arg, int radix, va_list ap);
-
-static void putce(int c)
-{
-    char s[1];
-    ssize_t ret;
-
-    s[0] = (char)c;
-    ret = write(2, s, 1);
-    (void)ret;
-}
-
-int
-kprintf(const char *fmt, ...)
-{
-	va_list ap;
-	int retval;
-
-	va_start(ap, fmt);
-	retval = kvprintf(fmt, putce, NULL, 10, ap);
-	va_end(ap);
-	return retval;
-}
-
-/*
- * Put a NUL-terminated ASCII number (base <= 36) in a buffer in reverse
- * order; return an optional length and a pointer to the last character
- * written in the buffer (i.e., the first character of the string).
- * The buffer pointed to by `nbuf' must have length >= MAXNBUF.
- */
-static char *
-ksprintn(char *nbuf, uintmax_t num, int base, int *lenp, int upper)
-{
-	char *p, c;
-
-	p = nbuf;
-	*p = '\0';
-	do {
-		c = hex2ascii(num % base);
-		*++p = upper ? toupper(c) : c;
-	} while (num /= base);
-	if (lenp)
-		*lenp = (int)(p - nbuf);
-	return (p);
-}
-
-/*
- * Scaled down version of printf(3).
- *
- * Two additional formats:
- *
- * The format %b is supported to decode error registers.
- * Its usage is:
- *
- *	printf("reg=%b\n", regval, "<base><arg>*");
- *
- * where <base> is the output base expressed as a control character, e.g.
- * \10 gives octal; \20 gives hex.  Each arg is a sequence of characters,
- * the first of which gives the bit number to be inspected (origin 1), and
- * the next characters (up to a control character, i.e. a character <= 32),
- * give the name of the register.  Thus:
- *
- *	kvprintf("reg=%b\n", 3, "\10\2BITTWO\1BITONE\n");
- *
- * would produce output:
- *
- *	reg=3<BITTWO,BITONE>
- *
- * XXX:  %D  -- Hexdump, takes pointer and separator string:
- *		("%6D", ptr, ":")   -> XX:XX:XX:XX:XX:XX
- *		("%*D", len, ptr, " " -> XX XX XX XX ...
- */
-static int
-kvprintf(char const *fmt, void (*func)(int), void *arg, int radix, va_list ap)
-{
-#define PCHAR(c) {int cc=(c); if (func) (*func)(cc); else *d++ = cc; retval++; }
-	char nbuf[MAXNBUF];
-	char *d;
-	const char *p, *percent, *q;
-	unsigned char *up;
-	int ch, n;
-	uintmax_t num;
-	int base, lflag, qflag, tmp, width, ladjust, sharpflag, neg, sign, dot;
-	int cflag, hflag, jflag, tflag, zflag;
-	int dwidth, upper;
-	char padc;
-	int stop = 0, retval = 0;
-
-	num = 0;
-	if (!func)
-		d = (char *) arg;
-	else
-		d = NULL;
-
-	if (fmt == NULL)
-		fmt = "(fmt null)\n";
-
-	if (radix < 2 || radix > 36)
-		radix = 10;
-
-	for (;;) {
-		padc = ' ';
-		width = 0;
-		while ((ch = (unsigned char)*fmt++) != '%' || stop) {
-			if (ch == '\0')
-				return (retval);
-			PCHAR(ch);
-		}
-		percent = fmt - 1;
-		qflag = 0; lflag = 0; ladjust = 0; sharpflag = 0; neg = 0;
-		sign = 0; dot = 0; dwidth = 0; upper = 0;
-		cflag = 0; hflag = 0; jflag = 0; tflag = 0; zflag = 0;
-reswitch:	switch (ch = (unsigned char)*fmt++) {
-		case '.':
-			dot = 1;
-			goto reswitch;
-		case '#':
-			sharpflag = 1;
-			goto reswitch;
-		case '+':
-			sign = 1;
-			goto reswitch;
-		case '-':
-			ladjust = 1;
-			goto reswitch;
-		case '%':
-			PCHAR(ch);
-			break;
-		case '*':
-			if (!dot) {
-				width = va_arg(ap, int);
-				if (width < 0) {
-					ladjust = !ladjust;
-					width = -width;
-				}
-			} else {
-				dwidth = va_arg(ap, int);
-			}
-			goto reswitch;
-		case '0':
-			if (!dot) {
-				padc = '0';
-				goto reswitch;
-			}
-		case '1': case '2': case '3': case '4':
-		case '5': case '6': case '7': case '8': case '9':
-				for (n = 0;; ++fmt) {
-					n = n * 10 + ch - '0';
-					ch = *fmt;
-					if (ch < '0' || ch > '9')
-						break;
-				}
-			if (dot)
-				dwidth = n;
-			else
-				width = n;
-			goto reswitch;
-		case 'b':
-			num = (unsigned int)va_arg(ap, int);
-			p = va_arg(ap, char *);
-			for (q = ksprintn(nbuf, num, *p++, NULL, 0); *q;)
-				PCHAR(*q--);
-
-			if (num == 0)
-				break;
-
-			for (tmp = 0; *p;) {
-				n = *p++;
-				if (num & (1 << (n - 1))) {
-					PCHAR(tmp ? ',' : '<');
-					for (; (n = *p) > ' '; ++p)
-						PCHAR(n);
-					tmp = 1;
-				} else
-					for (; *p > ' '; ++p)
-						continue;
-			}
-			if (tmp)
-				PCHAR('>');
-			break;
-		case 'c':
-			PCHAR(va_arg(ap, int));
-			break;
-		case 'D':
-			up = va_arg(ap, unsigned char *);
-			p = va_arg(ap, char *);
-			if (!width)
-				width = 16;
-			while(width--) {
-				PCHAR(hex2ascii(*up >> 4));
-				PCHAR(hex2ascii(*up & 0x0f));
-				up++;
-				if (width)
-					for (q=p;*q;q++)
-						PCHAR(*q);
-			}
-			break;
-		case 'd':
-		case 'i':
-			base = 10;
-			sign = 1;
-			goto handle_sign;
-		case 'h':
-			if (hflag) {
-				hflag = 0;
-				cflag = 1;
-			} else
-				hflag = 1;
-			goto reswitch;
-		case 'j':
-			jflag = 1;
-			goto reswitch;
-		case 'l':
-			if (lflag) {
-				lflag = 0;
-				qflag = 1;
-			} else
-				lflag = 1;
-			goto reswitch;
-		case 'n':
-			if (jflag)
-				*(va_arg(ap, intmax_t *)) = retval;
-			else if (qflag)
-				*(va_arg(ap, int64_t *)) = retval;
-			else if (lflag)
-				*(va_arg(ap, long *)) = retval;
-			else if (zflag)
-				*(va_arg(ap, size_t *)) = retval;
-			else if (hflag)
-				*(va_arg(ap, short *)) = retval;
-			else if (cflag)
-				*(va_arg(ap, char *)) = retval;
-			else
-				*(va_arg(ap, int *)) = retval;
-			break;
-		case 'o':
-			base = 8;
-			goto handle_nosign;
-		case 'p':
-			base = 16;
-			sharpflag = (width == 0);
-			sign = 0;
-			num = (uintptr_t)va_arg(ap, void *);
-			goto number;
-		case 'q':
-			qflag = 1;
-			goto reswitch;
-		case 'r':
-			base = radix;
-			if (sign)
-				goto handle_sign;
-			goto handle_nosign;
-		case 's':
-			p = va_arg(ap, char *);
-			if (p == NULL)
-				p = "(null)";
-			if (!dot)
-				n = (int)strlen (p);
-			else
-				for (n = 0; n < dwidth && p[n]; n++)
-					continue;
-
-			width -= n;
-
-			if (!ladjust && width > 0)
-				while (width--)
-					PCHAR(padc);
-			while (n--)
-				PCHAR(*p++);
-			if (ladjust && width > 0)
-				while (width--)
-					PCHAR(padc);
-			break;
-		case 't':
-			tflag = 1;
-			goto reswitch;
-		case 'u':
-			base = 10;
-			goto handle_nosign;
-		case 'X':
-			upper = 1;
-		case 'x':
-			base = 16;
-			goto handle_nosign;
-		case 'y':
-			base = 16;
-			sign = 1;
-			goto handle_sign;
-		case 'z':
-			zflag = 1;
-			goto reswitch;
-handle_nosign:
-			sign = 0;
-			if (jflag)
-				num = va_arg(ap, uintmax_t);
-			else if (qflag)
-				num = va_arg(ap, uint64_t);
-			else if (tflag)
-				num = va_arg(ap, ptrdiff_t);
-			else if (lflag)
-				num = va_arg(ap, unsigned long);
-			else if (zflag)
-				num = va_arg(ap, size_t);
-			else if (hflag)
-				num = (unsigned short)va_arg(ap, int);
-			else if (cflag)
-				num = (unsigned char)va_arg(ap, int);
-			else
-				num = va_arg(ap, unsigned int);
-			goto number;
-handle_sign:
-			if (jflag)
-				num = va_arg(ap, intmax_t);
-			else if (qflag)
-				num = va_arg(ap, int64_t);
-			else if (tflag)
-				num = va_arg(ap, ptrdiff_t);
-			else if (lflag)
-				num = va_arg(ap, long);
-			else if (zflag)
-				num = va_arg(ap, ssize_t);
-			else if (hflag)
-				num = (short)va_arg(ap, int);
-			else if (cflag)
-				num = (char)va_arg(ap, int);
-			else
-				num = va_arg(ap, int);
-number:
-			if (sign && (intmax_t)num < 0) {
-				neg = 1;
-				num = -(intmax_t)num;
-			}
-			p = ksprintn(nbuf, num, base, &n, upper);
-			tmp = 0;
-			if (sharpflag && num != 0) {
-				if (base == 8)
-					tmp++;
-				else if (base == 16)
-					tmp += 2;
-			}
-			if (neg)
-				tmp++;
-
-			if (!ladjust && padc == '0')
-				dwidth = width - tmp;
-			width -= tmp + imax(dwidth, n);
-			dwidth -= n;
-			if (!ladjust)
-				while (width-- > 0)
-					PCHAR(' ');
-			if (neg)
-				PCHAR('-');
-			if (sharpflag && num != 0) {
-				if (base == 8) {
-					PCHAR('0');
-				} else if (base == 16) {
-					PCHAR('0');
-					PCHAR('x');
-				}
-			}
-			while (dwidth-- > 0)
-				PCHAR('0');
-
-			while (*p)
-				PCHAR(*p--);
-
-			if (ladjust)
-				while (width-- > 0)
-					PCHAR(' ');
-
-			break;
-		default:
-			while (percent < fmt)
-				PCHAR(*percent++);
-			/*
-			 * Since we ignore an formatting argument it is no
-			 * longer safe to obey the remaining formatting
-			 * arguments as the arguments will no longer match
-			 * the format specs.
-			 */
-			stop = 1;
-			break;
-		}
-	}
-#undef PCHAR
-}
-#else /* defined(USE_ELF) */
-#error not supported
-#endif
diff --git a/addr2line.h b/addr2line.h
deleted file mode 100644
index d99f010934..0000000000
--- a/addr2line.h
+++ /dev/null
@@ -1,21 +0,0 @@
-/**********************************************************************
-
-  addr2line.h -
-
-  $Author$
-
-  Copyright (C) 2010 Shinichiro Hamaji
-
-**********************************************************************/
-
-#ifndef RUBY_ADDR2LINE_H
-#define RUBY_ADDR2LINE_H
-
-#ifdef USE_ELF
-
-void
-rb_dump_backtrace_with_lines(int num_traces, void **traces);
-
-#endif /* USE_ELF */
-
-#endif /* RUBY_ADDR2LINE_H */
diff --git a/appveyor.yml b/appveyor.yml
deleted file mode 100644
index 2cda4817a6..0000000000
--- a/appveyor.yml
+++ /dev/null
@@ -1,37 +0,0 @@
----
-shallow_clone: true
-platform: x64
-install:
-  - SET
-  - '"C:\Program Files (x86)\Microsoft Visual Studio 12.0\VC\vcvarsall.bat" amd64'
-  - SET PATH=\usr\local\bin;C:\Ruby22-x64\bin;C:\Ruby21-x64\Devkit\mingw\bin;%PATH%;C:\msys64\usr\bin
-  - ruby --version
-  - 'cl'
-  - SET
-  - mkdir \usr\local\bin
-  - mkdir \usr\local\include
-  - mkdir \usr\local\lib
-  - ps: Start-FileDownload 'http://ftp.openbsd.org/pub/OpenBSD/LibreSSL/libressl-2.3.7-windows.zip'
-  - 7z x libressl-2.3.7-windows.zip
-  - copy libressl-2.3.7-windows\x64\libcrypto-37.lib \usr\local\lib\crypto.lib
-  - copy libressl-2.3.7-windows\x64\libssl-38.lib    \usr\local\lib\ssl.lib
-  - copy libressl-2.3.7-windows\x64\libcrypto-37.dll \usr\local\bin
-  - copy libressl-2.3.7-windows\x64\libssl-38.dll    \usr\local\bin
-  - xcopy /e libressl-2.3.7-windows\include          \usr\local\include
-  - ps: Start-FileDownload 'http://zlib.net/zlib128.zip'
-  - 7z x zlib128.zip
-  - cd zlib-1.2.8
-  - nmake -f win32/Makefile.msc
-  - copy zlib1.dll \usr\local\bin
-  - copy zlib.lib  \usr\local\lib
-  - copy zconf.h   \usr\local\include
-  - copy zlib.h    \usr\local\include
-build_script:
-  - cd %APPVEYOR_BUILD_FOLDER%
-  - win32\configure.bat --without-ext=+,dbm,gdbm,readline --with-opt-dir=/usr/local
-  - nmake -l up
-  - nmake -l
-  - nmake install-nodoc
-test_script:
-  - nmake -l "OPTS=-v -q" btest
-  - nmake -l "OPTS=-v -q" test-basic
diff --git a/array.c b/array.c
index 4e60177121..baae2706e5 100644
--- a/array.c
+++ b/array.c
@@ -2,501 +2,164 @@
 
   array.c -
 
-  $Author$
+  $Author: akr $
+  $Date: 2006/06/24 14:53:36 $
   created at: Fri Aug  6 09:46:12 JST 1993
 
-  Copyright (C) 1993-2007 Yukihiro Matsumoto
+  Copyright (C) 1993-2003 Yukihiro Matsumoto
   Copyright (C) 2000  Network Applied Communication Laboratory, Inc.
   Copyright (C) 2000  Information-technology Promotion Agency, Japan
 
 **********************************************************************/
 
-#include "internal.h"
-#include "ruby/util.h"
-#include "ruby/st.h"
-#include "probes.h"
-#include "id.h"
-
-#ifndef ARRAY_DEBUG
-# define NDEBUG
-#endif
-#include "ruby_assert.h"
+#include "ruby.h"
+#include "util.h"
+#include "st.h"
 
 VALUE rb_cArray;
-
-static ID id_cmp, id_div, id_power;
+static ID id_cmp;
 
 #define ARY_DEFAULT_SIZE 16
-#define ARY_MAX_SIZE (LONG_MAX / (int)sizeof(VALUE))
-
-# define ARY_SHARED_P(ary) \
-    (assert(!FL_TEST((ary), ELTS_SHARED) || !FL_TEST((ary), RARRAY_EMBED_FLAG)), \
-     FL_TEST((ary),ELTS_SHARED)!=0)
-# define ARY_EMBED_P(ary) \
-    (assert(!FL_TEST((ary), ELTS_SHARED) || !FL_TEST((ary), RARRAY_EMBED_FLAG)), \
-     FL_TEST((ary), RARRAY_EMBED_FLAG)!=0)
-
-#define ARY_HEAP_PTR(a) (assert(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.ptr)
-#define ARY_HEAP_LEN(a) (assert(!ARY_EMBED_P(a)), RARRAY(a)->as.heap.len)
-#define ARY_EMBED_PTR(a) (assert(ARY_EMBED_P(a)), RARRAY(a)->as.ary)
-#define ARY_EMBED_LEN(a) \
-    (assert(ARY_EMBED_P(a)), \
-     (long)((RBASIC(a)->flags >> RARRAY_EMBED_LEN_SHIFT) & \
-	 (RARRAY_EMBED_LEN_MASK >> RARRAY_EMBED_LEN_SHIFT)))
-#define ARY_HEAP_SIZE(a) (assert(!ARY_EMBED_P(a)), assert(ARY_OWNS_HEAP_P(a)), RARRAY(a)->as.heap.aux.capa * sizeof(VALUE))
-
-#define ARY_OWNS_HEAP_P(a) (!FL_TEST((a), ELTS_SHARED|RARRAY_EMBED_FLAG))
-#define FL_SET_EMBED(a) do { \
-    assert(!ARY_SHARED_P(a)); \
-    FL_SET((a), RARRAY_EMBED_FLAG); \
-} while (0)
-#define FL_UNSET_EMBED(ary) FL_UNSET((ary), RARRAY_EMBED_FLAG|RARRAY_EMBED_LEN_MASK)
-#define FL_SET_SHARED(ary) do { \
-    assert(!ARY_EMBED_P(ary)); \
-    FL_SET((ary), ELTS_SHARED); \
-} while (0)
-#define FL_UNSET_SHARED(ary) FL_UNSET((ary), ELTS_SHARED)
-
-#define ARY_SET_PTR(ary, p) do { \
-    assert(!ARY_EMBED_P(ary)); \
-    assert(!OBJ_FROZEN(ary)); \
-    RARRAY(ary)->as.heap.ptr = (p); \
-} while (0)
-#define ARY_SET_EMBED_LEN(ary, n) do { \
-    long tmp_n = (n); \
-    assert(ARY_EMBED_P(ary)); \
-    assert(!OBJ_FROZEN(ary)); \
-    RBASIC(ary)->flags &= ~RARRAY_EMBED_LEN_MASK; \
-    RBASIC(ary)->flags |= (tmp_n) << RARRAY_EMBED_LEN_SHIFT; \
-} while (0)
-#define ARY_SET_HEAP_LEN(ary, n) do { \
-    assert(!ARY_EMBED_P(ary)); \
-    RARRAY(ary)->as.heap.len = (n); \
-} while (0)
-#define ARY_SET_LEN(ary, n) do { \
-    if (ARY_EMBED_P(ary)) { \
-        ARY_SET_EMBED_LEN((ary), (n)); \
-    } \
-    else { \
-        ARY_SET_HEAP_LEN((ary), (n)); \
-    } \
-    assert(RARRAY_LEN(ary) == (n)); \
-} while (0)
-#define ARY_INCREASE_PTR(ary, n) do  { \
-    assert(!ARY_EMBED_P(ary)); \
-    assert(!OBJ_FROZEN(ary)); \
-    RARRAY(ary)->as.heap.ptr += (n); \
-} while (0)
-#define ARY_INCREASE_LEN(ary, n) do  { \
-    assert(!OBJ_FROZEN(ary)); \
-    if (ARY_EMBED_P(ary)) { \
-        ARY_SET_EMBED_LEN((ary), RARRAY_LEN(ary)+(n)); \
-    } \
-    else { \
-        RARRAY(ary)->as.heap.len += (n); \
-    } \
-} while (0)
-
-#define ARY_CAPA(ary) (ARY_EMBED_P(ary) ? RARRAY_EMBED_LEN_MAX : \
-		       ARY_SHARED_ROOT_P(ary) ? RARRAY_LEN(ary) : RARRAY(ary)->as.heap.aux.capa)
-#define ARY_SET_CAPA(ary, n) do { \
-    assert(!ARY_EMBED_P(ary)); \
-    assert(!ARY_SHARED_P(ary)); \
-    assert(!OBJ_FROZEN(ary)); \
-    RARRAY(ary)->as.heap.aux.capa = (n); \
-} while (0)
-
-#define ARY_SHARED(ary) (assert(ARY_SHARED_P(ary)), RARRAY(ary)->as.heap.aux.shared)
-#define ARY_SET_SHARED(ary, value) do { \
-    const VALUE _ary_ = (ary); \
-    const VALUE _value_ = (value); \
-    assert(!ARY_EMBED_P(_ary_)); \
-    assert(ARY_SHARED_P(_ary_)); \
-    assert(ARY_SHARED_ROOT_P(_value_)); \
-    RB_OBJ_WRITE(_ary_, &RARRAY(_ary_)->as.heap.aux.shared, _value_); \
-} while (0)
-#define RARRAY_SHARED_ROOT_FLAG FL_USER5
-#define ARY_SHARED_ROOT_P(ary) (FL_TEST((ary), RARRAY_SHARED_ROOT_FLAG))
-#define ARY_SHARED_NUM(ary) \
-    (assert(ARY_SHARED_ROOT_P(ary)), RARRAY(ary)->as.heap.aux.capa)
-#define ARY_SHARED_OCCUPIED(ary) (ARY_SHARED_NUM(ary) == 1)
-#define ARY_SET_SHARED_NUM(ary, value) do { \
-    assert(ARY_SHARED_ROOT_P(ary)); \
-    RARRAY(ary)->as.heap.aux.capa = (value); \
-} while (0)
-#define FL_SET_SHARED_ROOT(ary) do { \
-    assert(!ARY_EMBED_P(ary)); \
-    FL_SET((ary), RARRAY_SHARED_ROOT_FLAG); \
-} while (0)
-
-#define ARY_SET(a, i, v) RARRAY_ASET((assert(!ARY_SHARED_P(a)), (a)), (i), (v))
 
 void
-rb_mem_clear(register VALUE *mem, register long size)
+rb_mem_clear(mem, size)
+    register VALUE *mem;
+    register long size;
 {
     while (size--) {
 	*mem++ = Qnil;
     }
 }
 
-static void
-ary_mem_clear(VALUE ary, long beg, long size)
-{
-    RARRAY_PTR_USE(ary, ptr, {
-	rb_mem_clear(ptr + beg, size);
-    });
-}
-
 static inline void
-memfill(register VALUE *mem, register long size, register VALUE val)
+memfill(mem, size, val)
+    register VALUE *mem;
+    register long size;
+    register VALUE val;
 {
     while (size--) {
 	*mem++ = val;
     }
 }
 
-static void
-ary_memfill(VALUE ary, long beg, long size, VALUE val)
-{
-    RARRAY_PTR_USE(ary, ptr, {
-	memfill(ptr + beg, size, val);
-	RB_OBJ_WRITTEN(ary, Qundef, val);
-    });
-}
-
-static void
-ary_memcpy0(VALUE ary, long beg, long argc, const VALUE *argv, VALUE buff_owner_ary)
-{
-#if 1
-    assert(!ARY_SHARED_P(buff_owner_ary));
-
-    if (argc > (int)(128/sizeof(VALUE)) /* is magic number (cache line size) */) {
-	rb_gc_writebarrier_remember(buff_owner_ary);
-	RARRAY_PTR_USE(ary, ptr, {
-	    MEMCPY(ptr+beg, argv, VALUE, argc);
-	});
-    }
-    else {
-	int i;
-	RARRAY_PTR_USE(ary, ptr, {
-	    for (i=0; i<argc; i++) {
-		RB_OBJ_WRITE(buff_owner_ary, &ptr[i+beg], argv[i]);
-	    }
-	});
-    }
-#else
-    /* giveup write barrier (traditional way) */
-    RARRAY_PTR(buff_owner_ary);
-    MEMCPY(RARRAY_PTR(ary)+beg, argv, VALUE, argc);
-#endif
-}
-
-static void
-ary_memcpy(VALUE ary, long beg, long argc, const VALUE *argv)
-{
-    ary_memcpy0(ary, beg, argc, argv, ary);
-}
-
-static void
-ary_resize_capa(VALUE ary, long capacity)
-{
-    assert(RARRAY_LEN(ary) <= capacity);
-    assert(!OBJ_FROZEN(ary));
-    assert(!ARY_SHARED_P(ary));
-    if (capacity > RARRAY_EMBED_LEN_MAX) {
-        if (ARY_EMBED_P(ary)) {
-            long len = ARY_EMBED_LEN(ary);
-            VALUE *ptr = ALLOC_N(VALUE, (capacity));
-            MEMCPY(ptr, ARY_EMBED_PTR(ary), VALUE, len);
-            FL_UNSET_EMBED(ary);
-            ARY_SET_PTR(ary, ptr);
-            ARY_SET_HEAP_LEN(ary, len);
-        }
-        else {
-	    SIZED_REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, capacity, RARRAY(ary)->as.heap.aux.capa);
-        }
-        ARY_SET_CAPA(ary, (capacity));
-    }
-    else {
-        if (!ARY_EMBED_P(ary)) {
-            long len = RARRAY_LEN(ary);
-	    const VALUE *ptr = RARRAY_CONST_PTR(ary);
-
-	    if (len > capacity) len = capacity;
-            MEMCPY((VALUE *)RARRAY(ary)->as.ary, ptr, VALUE, len);
-            FL_SET_EMBED(ary);
-            ARY_SET_LEN(ary, len);
-	    ruby_xfree((VALUE *)ptr);
-        }
-    }
-}
-
-static inline void
-ary_shrink_capa(VALUE ary)
-{
-    long capacity = ARY_HEAP_LEN(ary);
-    long old_capa = RARRAY(ary)->as.heap.aux.capa;
-    assert(!ARY_SHARED_P(ary));
-    assert(old_capa >= capacity);
-    if (old_capa > capacity)
-	REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, capacity);
-}
-
-static void
-ary_double_capa(VALUE ary, long min)
-{
-    long new_capa = ARY_CAPA(ary) / 2;
-
-    if (new_capa < ARY_DEFAULT_SIZE) {
-	new_capa = ARY_DEFAULT_SIZE;
-    }
-    if (new_capa >= ARY_MAX_SIZE - min) {
-	new_capa = (ARY_MAX_SIZE - min) / 2;
-    }
-    new_capa += min;
-    ary_resize_capa(ary, new_capa);
-}
-
-static void
-rb_ary_decrement_share(VALUE shared)
-{
-    if (shared) {
-	long num = ARY_SHARED_NUM(shared) - 1;
-	if (num == 0) {
-	    rb_ary_free(shared);
-	    rb_gc_force_recycle(shared);
-	}
-	else if (num > 0) {
-	    ARY_SET_SHARED_NUM(shared, num);
-	}
-    }
-}
-
-static void
-rb_ary_unshare(VALUE ary)
-{
-    VALUE shared = RARRAY(ary)->as.heap.aux.shared;
-    rb_ary_decrement_share(shared);
-    FL_UNSET_SHARED(ary);
-}
+#define ARY_TMPLOCK  FL_USER1
 
 static inline void
-rb_ary_unshare_safe(VALUE ary)
-{
-    if (ARY_SHARED_P(ary) && !ARY_EMBED_P(ary)) {
-	rb_ary_unshare(ary);
-    }
-}
-
-static VALUE
-rb_ary_increment_share(VALUE shared)
+rb_ary_modify_check(ary)
+    VALUE ary;
 {
-    long num = ARY_SHARED_NUM(shared);
-    if (num >= 0) {
-	ARY_SET_SHARED_NUM(shared, num + 1);
-    }
-    return shared;
+    if (OBJ_FROZEN(ary)) rb_error_frozen("array");
+    if (FL_TEST(ary, ARY_TMPLOCK))
+	rb_raise(rb_eRuntimeError, "can't modify array during iteration");
+    if (!OBJ_TAINTED(ary) && rb_safe_level() >= 4)
+	rb_raise(rb_eSecurityError, "Insecure: can't modify array");
 }
 
 static void
-rb_ary_set_shared(VALUE ary, VALUE shared)
-{
-    rb_ary_increment_share(shared);
-    FL_SET_SHARED(ary);
-    ARY_SET_SHARED(ary, shared);
-}
-
-static inline void
-rb_ary_modify_check(VALUE ary)
+rb_ary_modify(ary)
+    VALUE ary;
 {
-    rb_check_frozen(ary);
-}
+    VALUE *ptr;
 
-void
-rb_ary_modify(VALUE ary)
-{
     rb_ary_modify_check(ary);
-    if (ARY_SHARED_P(ary)) {
-	long shared_len, len = RARRAY_LEN(ary);
-	VALUE shared = ARY_SHARED(ary);
-        if (len <= RARRAY_EMBED_LEN_MAX) {
-	    const VALUE *ptr = ARY_HEAP_PTR(ary);
-            FL_UNSET_SHARED(ary);
-            FL_SET_EMBED(ary);
-	    MEMCPY((VALUE *)ARY_EMBED_PTR(ary), ptr, VALUE, len);
-            rb_ary_decrement_share(shared);
-            ARY_SET_EMBED_LEN(ary, len);
-        }
-	else if (ARY_SHARED_OCCUPIED(shared) && len > ((shared_len = RARRAY_LEN(shared))>>1)) {
-	    long shift = RARRAY_CONST_PTR(ary) - RARRAY_CONST_PTR(shared);
-	    FL_UNSET_SHARED(ary);
-	    ARY_SET_PTR(ary, RARRAY_CONST_PTR(shared));
-	    ARY_SET_CAPA(ary, shared_len);
-	    RARRAY_PTR_USE(ary, ptr, {
-		MEMMOVE(ptr, ptr+shift, VALUE, len);
-	    });
-	    FL_SET_EMBED(shared);
-	    rb_ary_decrement_share(shared);
-	}
-        else {
-            VALUE *ptr = ALLOC_N(VALUE, len);
-            MEMCPY(ptr, RARRAY_CONST_PTR(ary), VALUE, len);
-            rb_ary_unshare(ary);
-            ARY_SET_CAPA(ary, len);
-            ARY_SET_PTR(ary, ptr);
-        }
-
-	rb_gc_writebarrier_remember(ary);
+    if (FL_TEST(ary, ELTS_SHARED)) {
+	ptr = ALLOC_N(VALUE, RARRAY(ary)->len);
+	FL_UNSET(ary, ELTS_SHARED);
+	RARRAY(ary)->aux.capa = RARRAY(ary)->len;
+	MEMCPY(ptr, RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
+	RARRAY(ary)->ptr = ptr;
     }
 }
 
-static VALUE
-ary_ensure_room_for_push(VALUE ary, long add_len)
-{
-    long old_len = RARRAY_LEN(ary);
-    long new_len = old_len + add_len;
-    long capa;
-
-    if (old_len > ARY_MAX_SIZE - add_len) {
-	rb_raise(rb_eIndexError, "index %ld too big", new_len);
-    }
-    if (ARY_SHARED_P(ary)) {
-	if (new_len > RARRAY_EMBED_LEN_MAX) {
-	    VALUE shared = ARY_SHARED(ary);
-	    if (ARY_SHARED_OCCUPIED(shared)) {
-		if (RARRAY_CONST_PTR(ary) - RARRAY_CONST_PTR(shared) + new_len <= RARRAY_LEN(shared)) {
-		    rb_ary_modify_check(ary);
-		    return shared;
-		}
-		else {
-		    /* if array is shared, then it is likely it participate in push/shift pattern */
-		    rb_ary_modify(ary);
-		    capa = ARY_CAPA(ary);
-		    if (new_len > capa - (capa >> 6)) {
-			ary_double_capa(ary, new_len);
-		    }
-		    return ary;
-		}
-	    }
-	}
-    }
-    rb_ary_modify(ary);
-    capa = ARY_CAPA(ary);
-    if (new_len > capa) {
-	ary_double_capa(ary, new_len);
-    }
-
-    return ary;
-}
-
-/*
- *  call-seq:
- *      ary.freeze -> ary
- *
- *  Calls Object#freeze on +ary+ to prevent any further
- *  modification. A RuntimeError will be raised if a modification
- *  attempt is made.
- *
- */
-
 VALUE
-rb_ary_freeze(VALUE ary)
+rb_ary_freeze(ary)
+    VALUE ary;
 {
     return rb_obj_freeze(ary);
 }
 
 /*
  *  call-seq:
- *     ary.frozen?  -> true or false
+ *     array.frozen?  -> true or false
  *
- *  Return +true+ if this array is frozen (or temporarily frozen
- *  while being sorted). See also Object#frozen?
+ *  Return <code>true</code> if this array is frozen (or temporarily frozen
+ *  while being sorted).
  */
 
 static VALUE
-rb_ary_frozen_p(VALUE ary)
+rb_ary_frozen_p(ary)
+    VALUE ary;
 {
     if (OBJ_FROZEN(ary)) return Qtrue;
+    if (FL_TEST(ary, ARY_TMPLOCK)) return Qtrue;
     return Qfalse;
 }
 
-/* This can be used to take a snapshot of an array (with
-   e.g. rb_ary_replace) and check later whether the array has been
-   modified from the snapshot.  The snapshot is cheap, though if
-   something does modify the array it will pay the cost of copying
-   it.  If Array#pop or Array#shift has been called, the array will
-   be still shared with the snapshot, but the array length will
-   differ. */
-VALUE
-rb_ary_shared_with_p(VALUE ary1, VALUE ary2)
-{
-    if (!ARY_EMBED_P(ary1) && ARY_SHARED_P(ary1) &&
-	!ARY_EMBED_P(ary2) && ARY_SHARED_P(ary2) &&
-	RARRAY(ary1)->as.heap.aux.shared == RARRAY(ary2)->as.heap.aux.shared &&
-	RARRAY(ary1)->as.heap.len == RARRAY(ary2)->as.heap.len) {
-	return Qtrue;
-    }
-    return Qfalse;
-}
-
+static VALUE ary_alloc _((VALUE));
 static VALUE
-ary_alloc(VALUE klass)
+ary_alloc(klass)
+    VALUE klass;
 {
-    NEWOBJ_OF(ary, struct RArray, klass, T_ARRAY | RARRAY_EMBED_FLAG | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0));
-    /* Created array is:
-     *   FL_SET_EMBED((VALUE)ary);
-     *   ARY_SET_EMBED_LEN((VALUE)ary, 0);
-     */
-    return (VALUE)ary;
-}
+    NEWOBJ(ary, struct RArray);
+    OBJSETUP(ary, klass, T_ARRAY);
 
-static VALUE
-empty_ary_alloc(VALUE klass)
-{
-    RUBY_DTRACE_CREATE_HOOK(ARRAY, 0);
-    return ary_alloc(klass);
+    ary->len = 0;
+    ary->ptr = 0;
+    ary->aux.capa = 0;
+
+    return (VALUE)ary;
 }
 
 static VALUE
-ary_new(VALUE klass, long capa)
+ary_new(klass, len)
+    VALUE klass;
+    long len;
 {
-    VALUE ary,*ptr;
+    VALUE ary = ary_alloc(klass);
 
-    if (capa < 0) {
+    if (len < 0) {
 	rb_raise(rb_eArgError, "negative array size (or size too big)");
     }
-    if (capa > ARY_MAX_SIZE) {
+    if (len > 0 && len * sizeof(VALUE) <= len) {
 	rb_raise(rb_eArgError, "array size too big");
     }
-
-    RUBY_DTRACE_CREATE_HOOK(ARRAY, capa);
-
-    ary = ary_alloc(klass);
-    if (capa > RARRAY_EMBED_LEN_MAX) {
-	ptr = ALLOC_N(VALUE, capa);
-        FL_UNSET_EMBED(ary);
-        ARY_SET_PTR(ary, ptr);
-        ARY_SET_CAPA(ary, capa);
-        ARY_SET_HEAP_LEN(ary, 0);
-    }
+    if (len == 0) len++;
+    RARRAY(ary)->ptr = ALLOC_N(VALUE, len);
+    RARRAY(ary)->aux.capa = len;
 
     return ary;
 }
 
 VALUE
-rb_ary_new_capa(long capa)
+rb_ary_new2(len)
+    long len;
 {
-    return ary_new(rb_cArray, capa);
+    return ary_new(rb_cArray, len);
 }
 
+
 VALUE
-rb_ary_new(void)
+rb_ary_new()
 {
-    return rb_ary_new2(RARRAY_EMBED_LEN_MAX);
+    return rb_ary_new2(ARY_DEFAULT_SIZE);
 }
 
+#ifdef HAVE_STDARG_PROTOTYPES
+#include <stdarg.h>
+#define va_init_list(a,b) va_start(a,b)
+#else
+#include <varargs.h>
+#define va_init_list(a,b) va_start(a)
+#endif
+
 VALUE
-(rb_ary_new_from_args)(long n, ...)
+#ifdef HAVE_STDARG_PROTOTYPES
+rb_ary_new3(long n, ...)
+#else
+rb_ary_new3(n, va_alist)
+    long n;
+    va_dcl
+#endif
 {
     va_list ar;
     VALUE ary;
@@ -504,240 +167,120 @@ VALUE
 
     ary = rb_ary_new2(n);
 
-    va_start(ar, n);
+    va_init_list(ar, n);
     for (i=0; i<n; i++) {
-	ARY_SET(ary, i, va_arg(ar, VALUE));
+	RARRAY(ary)->ptr[i] = va_arg(ar, VALUE);
     }
     va_end(ar);
 
-    ARY_SET_LEN(ary, n);
+    RARRAY(ary)->len = n;
     return ary;
 }
 
 VALUE
-rb_ary_new_from_values(long n, const VALUE *elts)
+rb_ary_new4(n, elts)
+    long n;
+    const VALUE *elts;
 {
     VALUE ary;
 
     ary = rb_ary_new2(n);
     if (n > 0 && elts) {
-	ary_memcpy(ary, 0, n, elts);
-	ARY_SET_LEN(ary, n);
+	MEMCPY(RARRAY(ary)->ptr, elts, VALUE, n);
     }
 
-    return ary;
-}
+    /* This assignment to len will be moved to the above "if" block in Ruby 1.9 */
+    RARRAY(ary)->len = n;
 
-VALUE
-rb_ary_tmp_new(long capa)
-{
-    return ary_new(0, capa);
-}
-
-VALUE
-rb_ary_tmp_new_fill(long capa)
-{
-    VALUE ary = ary_new(0, capa);
-    ary_memfill(ary, 0, capa, Qnil);
-    ARY_SET_LEN(ary, capa);
     return ary;
 }
 
-void
-rb_ary_free(VALUE ary)
-{
-    if (ARY_OWNS_HEAP_P(ary)) {
-	ruby_sized_xfree((void *)ARY_HEAP_PTR(ary), ARY_HEAP_SIZE(ary));
-    }
-}
-
-RUBY_FUNC_EXPORTED size_t
-rb_ary_memsize(VALUE ary)
-{
-    if (ARY_OWNS_HEAP_P(ary)) {
-	return RARRAY(ary)->as.heap.aux.capa * sizeof(VALUE);
-    }
-    else {
-	return 0;
-    }
-}
-
-static inline void
-ary_discard(VALUE ary)
-{
-    rb_ary_free(ary);
-    RBASIC(ary)->flags |= RARRAY_EMBED_FLAG;
-    RBASIC(ary)->flags &= ~RARRAY_EMBED_LEN_MASK;
-}
-
-static VALUE
-ary_make_shared(VALUE ary)
-{
-    assert(!ARY_EMBED_P(ary));
-    if (ARY_SHARED_P(ary)) {
-	return ARY_SHARED(ary);
-    }
-    else if (ARY_SHARED_ROOT_P(ary)) {
-	return ary;
-    }
-    else if (OBJ_FROZEN(ary)) {
-	ary_shrink_capa(ary);
-	FL_SET_SHARED_ROOT(ary);
-	ARY_SET_SHARED_NUM(ary, 1);
-	return ary;
-    }
-    else {
-	long capa = ARY_CAPA(ary), len = RARRAY_LEN(ary);
-	NEWOBJ_OF(shared, struct RArray, 0, T_ARRAY | (RGENGC_WB_PROTECTED_ARRAY ? FL_WB_PROTECTED : 0));
-        FL_UNSET_EMBED(shared);
-
-	ARY_SET_LEN((VALUE)shared, capa);
-	ARY_SET_PTR((VALUE)shared, RARRAY_CONST_PTR(ary));
-	ary_mem_clear((VALUE)shared, len, capa - len);
-	FL_SET_SHARED_ROOT(shared);
-	ARY_SET_SHARED_NUM((VALUE)shared, 1);
-	FL_SET_SHARED(ary);
-	ARY_SET_SHARED(ary, (VALUE)shared);
-	OBJ_FREEZE(shared);
-	return (VALUE)shared;
-    }
-}
-
-static VALUE
-ary_make_substitution(VALUE ary)
+VALUE
+rb_assoc_new(car, cdr)
+    VALUE car, cdr;
 {
-    long len = RARRAY_LEN(ary);
+    VALUE ary;
 
-    if (len <= RARRAY_EMBED_LEN_MAX) {
-	VALUE subst = rb_ary_new2(len);
-	ary_memcpy(subst, 0, len, RARRAY_CONST_PTR(ary));
-        ARY_SET_EMBED_LEN(subst, len);
-        return subst;
-    }
-    else {
-        return rb_ary_increment_share(ary_make_shared(ary));
-    }
-}
+    ary = rb_ary_new2(2);
+    RARRAY(ary)->ptr[0] = car;
+    RARRAY(ary)->ptr[1] = cdr;
+    RARRAY(ary)->len = 2;
 
-VALUE
-rb_assoc_new(VALUE car, VALUE cdr)
-{
-    return rb_ary_new3(2, car, cdr);
+    return ary;
 }
 
 static VALUE
-to_ary(VALUE ary)
+to_ary(ary)
+    VALUE ary;
 {
     return rb_convert_type(ary, T_ARRAY, "Array", "to_ary");
 }
 
 VALUE
-rb_check_array_type(VALUE ary)
+rb_check_array_type(ary)
+    VALUE ary;
 {
     return rb_check_convert_type(ary, T_ARRAY, "Array", "to_ary");
 }
 
-/*
- *  call-seq:
- *     Array.try_convert(obj) -> array or nil
- *
- *  Tries to convert +obj+ into an array, using +to_ary+ method.  Returns the
- *  converted array or +nil+ if +obj+ cannot be converted for any reason.
- *  This method can be used to check if an argument is an array.
- *
- *     Array.try_convert([1])   #=> [1]
- *     Array.try_convert("1")   #=> nil
- *
- *     if tmp = Array.try_convert(arg)
- *       # the argument is an array
- *     elsif tmp = String.try_convert(arg)
- *       # the argument is a string
- *     end
- *
- */
-
-static VALUE
-rb_ary_s_try_convert(VALUE dummy, VALUE ary)
-{
-    return rb_check_array_type(ary);
-}
+static VALUE rb_ary_replace _((VALUE, VALUE));
 
 /*
  *  call-seq:
- *     Array.new(size=0, default=nil)
+ *     Array.new(size=0, obj=nil)
  *     Array.new(array)
  *     Array.new(size) {|index| block }
  *
- *  Returns a new array.
- *
- *  In the first form, if no arguments are sent, the new array will be empty.
- *  When a +size+ and an optional +default+ are sent, an array is created with
- *  +size+ copies of +default+.  Take notice that all elements will reference the
- *  same object +default+.
- *
- *  The second form creates a copy of the array passed as a parameter (the
- *  array is generated by calling to_ary on the parameter).
- *
- *    first_array = ["Matz", "Guido"]
- *
- *    second_array = Array.new(first_array) #=> ["Matz", "Guido"]
- *
- *    first_array.equal? second_array       #=> false
- *
- *  In the last form, an array of the given size is created.  Each element in
- *  this array is created by passing the element's index to the given block
- *  and storing the return value.
- *
- *    Array.new(3){ |index| index ** 2 }
- *    # => [0, 1, 4]
- *
- *  == Common gotchas
- *
- *  When sending the second parameter, the same object will be used as the
- *  value for all the array elements:
- *
+ *  Returns a new array. In the first form, the new array is
+ *  empty. In the second it is created with _size_ copies of _obj_
+ *  (that is, _size_ references to the same
+ *  _obj_). The third form creates a copy of the array
+ *  passed as a parameter (the array is generated by calling
+ *  to_ary  on the parameter). In the last form, an array
+ *  of the given size is created. Each element in this array is
+ *  calculated by passing the element's index to the given block and
+ *  storing the return value.
+ *
+ *     Array.new
+ *     Array.new(2)
+ *     Array.new(5, "A")
+ * 
+ *     # only one copy of the object is created
  *     a = Array.new(2, Hash.new)
- *     # => [{}, {}]
- *
  *     a[0]['cat'] = 'feline'
- *     a # => [{"cat"=>"feline"}, {"cat"=>"feline"}]
- *
+ *     a
  *     a[1]['cat'] = 'Felix'
- *     a # => [{"cat"=>"Felix"}, {"cat"=>"Felix"}]
- *
- *  Since all the Array elements store the same hash, changes to one of them
- *  will affect them all.
- *
- *  If multiple copies are what you want, you should use the block
- *  version which uses the result of that block each time an element
- *  of the array needs to be initialized:
- *
+ *     a
+ * 
+ *     # here multiple copies are created
  *     a = Array.new(2) { Hash.new }
  *     a[0]['cat'] = 'feline'
- *     a # => [{"cat"=>"feline"}, {}]
- *
+ *     a
+ * 
+ *     squares = Array.new(5) {|i| i*i}
+ *     squares
+ * 
+ *     copy = Array.new(squares)
  */
 
 static VALUE
-rb_ary_initialize(int argc, VALUE *argv, VALUE ary)
+rb_ary_initialize(argc, argv, ary)
+    int argc;
+    VALUE *argv;
+    VALUE ary;
 {
     long len;
     VALUE size, val;
 
     rb_ary_modify(ary);
-    if (argc == 0) {
-	if (ARY_OWNS_HEAP_P(ary) && RARRAY_CONST_PTR(ary) != 0) {
-	    ruby_sized_xfree((void *)RARRAY_CONST_PTR(ary), ARY_HEAP_SIZE(ary));
-	}
-        rb_ary_unshare_safe(ary);
-        FL_SET_EMBED(ary);
-	ARY_SET_EMBED_LEN(ary, 0);
+    if (rb_scan_args(argc, argv, "02", &size, &val) == 0) {
+	RARRAY(ary)->len = 0;
 	if (rb_block_given_p()) {
 	    rb_warning("given block not used");
 	}
 	return ary;
     }
-    rb_scan_args(argc, argv, "02", &size, &val);
+
     if (argc == 1 && !FIXNUM_P(size)) {
 	val = rb_check_array_type(size);
 	if (!NIL_P(val)) {
@@ -747,16 +290,16 @@ rb_ary_initialize(int argc, VALUE *argv, VALUE ary)
     }
 
     len = NUM2LONG(size);
-    /* NUM2LONG() may call size.to_int, ary can be frozen, modified, etc */
     if (len < 0) {
 	rb_raise(rb_eArgError, "negative array size");
     }
-    if (len > ARY_MAX_SIZE) {
+    if (len > 0 && len * (long)sizeof(VALUE) <= len) {
 	rb_raise(rb_eArgError, "array size too big");
     }
-    /* recheck after argument conversion */
-    rb_ary_modify(ary);
-    ary_resize_capa(ary, len);
+    if (len > RARRAY(ary)->aux.capa) {
+	REALLOC_N(RARRAY(ary)->ptr, VALUE, len);
+	RARRAY(ary)->aux.capa = len;
+    }
     if (rb_block_given_p()) {
 	long i;
 
@@ -765,133 +308,86 @@ rb_ary_initialize(int argc, VALUE *argv, VALUE ary)
 	}
 	for (i=0; i<len; i++) {
 	    rb_ary_store(ary, i, rb_yield(LONG2NUM(i)));
-	    ARY_SET_LEN(ary, i + 1);
+	    RARRAY(ary)->len = i + 1;
 	}
     }
     else {
-	ary_memfill(ary, 0, len, val);
-	ARY_SET_LEN(ary, len);
+	memfill(RARRAY(ary)->ptr, len, val);
+	RARRAY(ary)->len = len;
     }
+
     return ary;
 }
 
-/*
- * Returns a new array populated with the given objects.
- *
- *   Array.[]( 1, 'a', /^A/ ) # => [1, "a", /^A/]
- *   Array[ 1, 'a', /^A/ ]    # => [1, "a", /^A/]
- *   [ 1, 'a', /^A/ ]         # => [1, "a", /^A/]
- */
+
+/* 
+* Returns a new array populated with the given objects. 
+*
+*   Array.[]( 1, 'a', /^A/ )
+*   Array[ 1, 'a', /^A/ ]
+*   [ 1, 'a', /^A/ ]
+*/
 
 static VALUE
-rb_ary_s_create(int argc, VALUE *argv, VALUE klass)
+rb_ary_s_create(argc, argv, klass)
+    int argc;
+    VALUE *argv;
+    VALUE klass;
 {
-    VALUE ary = ary_new(klass, argc);
-    if (argc > 0 && argv) {
-        ary_memcpy(ary, 0, argc, argv);
-        ARY_SET_LEN(ary, argc);
+    VALUE ary = ary_alloc(klass);
+
+    if (argc > 0) {
+	RARRAY(ary)->ptr = ALLOC_N(VALUE, argc);
+	MEMCPY(RARRAY(ary)->ptr, argv, VALUE, argc);
     }
+    RARRAY(ary)->len = RARRAY(ary)->aux.capa = argc;
 
     return ary;
 }
 
 void
-rb_ary_store(VALUE ary, long idx, VALUE val)
+rb_ary_store(ary, idx, val)
+    VALUE ary;
+    long idx;
+    VALUE val;
 {
-    long len = RARRAY_LEN(ary);
-
     if (idx < 0) {
-	idx += len;
+	idx += RARRAY(ary)->len;
 	if (idx < 0) {
-	    rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
-		     idx - len, -len);
+	    rb_raise(rb_eIndexError, "index %ld out of array",
+		    idx - RARRAY(ary)->len);
 	}
     }
-    else if (idx >= ARY_MAX_SIZE) {
-	rb_raise(rb_eIndexError, "index %ld too big", idx);
-    }
 
     rb_ary_modify(ary);
-    if (idx >= ARY_CAPA(ary)) {
-	ary_double_capa(ary, idx);
-    }
-    if (idx > len) {
-	ary_mem_clear(ary, len, idx - len + 1);
-    }
-
-    if (idx >= len) {
-	ARY_SET_LEN(ary, idx + 1);
-    }
-    ARY_SET(ary, idx, val);
-}
-
-static VALUE
-ary_make_partial(VALUE ary, VALUE klass, long offset, long len)
-{
-    assert(offset >= 0);
-    assert(len >= 0);
-    assert(offset+len <= RARRAY_LEN(ary));
+    if (idx >= RARRAY(ary)->aux.capa) {
+	long new_capa = RARRAY(ary)->aux.capa / 2;
 
-    if (len <= RARRAY_EMBED_LEN_MAX) {
-        VALUE result = ary_alloc(klass);
-	ary_memcpy(result, 0, len, RARRAY_CONST_PTR(ary) + offset);
-        ARY_SET_EMBED_LEN(result, len);
-        return result;
+	if (new_capa < ARY_DEFAULT_SIZE) {
+	    new_capa = ARY_DEFAULT_SIZE;
+	}
+	new_capa += idx;
+	if (new_capa * (long)sizeof(VALUE) <= new_capa) {
+	    rb_raise(rb_eArgError, "index too big");
+	}
+	REALLOC_N(RARRAY(ary)->ptr, VALUE, new_capa);
+	RARRAY(ary)->aux.capa = new_capa;
     }
-    else {
-        VALUE shared, result = ary_alloc(klass);
-        FL_UNSET_EMBED(result);
-
-        shared = ary_make_shared(ary);
-        ARY_SET_PTR(result, RARRAY_CONST_PTR(ary));
-        ARY_SET_LEN(result, RARRAY_LEN(ary));
-        rb_ary_set_shared(result, shared);
-
-        ARY_INCREASE_PTR(result, offset);
-        ARY_SET_LEN(result, len);
-        return result;
+    if (idx > RARRAY(ary)->len) {
+	rb_mem_clear(RARRAY(ary)->ptr + RARRAY(ary)->len,
+		     idx-RARRAY(ary)->len + 1);
     }
-}
 
-static VALUE
-ary_make_shared_copy(VALUE ary)
-{
-    return ary_make_partial(ary, rb_obj_class(ary), 0, RARRAY_LEN(ary));
-}
-
-enum ary_take_pos_flags
-{
-    ARY_TAKE_FIRST = 0,
-    ARY_TAKE_LAST = 1
-};
-
-static VALUE
-ary_take_first_or_last(int argc, const VALUE *argv, VALUE ary, enum ary_take_pos_flags last)
-{
-    VALUE nv;
-    long n;
-    long len;
-    long offset = 0;
-
-    rb_scan_args(argc, argv, "1", &nv);
-    n = NUM2LONG(nv);
-    len = RARRAY_LEN(ary);
-    if (n > len) {
-	n = len;
-    }
-    else if (n < 0) {
-	rb_raise(rb_eArgError, "negative array size");
-    }
-    if (last) {
-	offset = len - n;
+    if (idx >= RARRAY(ary)->len) {
+	RARRAY(ary)->len = idx + 1;
     }
-    return ary_make_partial(ary, rb_cArray, offset, n);
+    RARRAY(ary)->ptr[idx] = val;
 }
 
 /*
  *  call-seq:
- *     ary << obj            -> ary
- *
+ *     array << obj            -> array
+ *  
  *  Append---Pushes the given object on to the end of this array. This
  *  expression returns the array itself, so several appends
  *  may be chained together.
@@ -902,349 +398,241 @@ ary_take_first_or_last(int argc, const VALUE *argv, VALUE ary, enum ary_take_pos
  */
 
 VALUE
-rb_ary_push(VALUE ary, VALUE item)
-{
-    long idx = RARRAY_LEN(ary);
-    VALUE target_ary = ary_ensure_room_for_push(ary, 1);
-    RARRAY_PTR_USE(ary, ptr, {
-	RB_OBJ_WRITE(target_ary, &ptr[idx], item);
-    });
-    ARY_SET_LEN(ary, idx + 1);
-    return ary;
-}
-
-VALUE
-rb_ary_cat(VALUE ary, const VALUE *argv, long len)
+rb_ary_push(ary, item)
+    VALUE ary;
+    VALUE item;
 {
-    long oldlen = RARRAY_LEN(ary);
-    VALUE target_ary = ary_ensure_room_for_push(ary, len);
-    ary_memcpy0(ary, oldlen, len, argv, target_ary);
-    ARY_SET_LEN(ary, oldlen + len);
+    rb_ary_store(ary, RARRAY(ary)->len, item);
     return ary;
 }
 
-/*
+/* 
  *  call-seq:
- *     ary.push(obj, ... )   -> ary
- *
- *  Append --- Pushes the given object(s) on to the end of this array. This
+ *     array.push(obj, ... )   -> array
+ *  
+ *  Append---Pushes the given object(s) on to the end of this array. This
  *  expression returns the array itself, so several appends
- *  may be chained together. See also Array#pop for the opposite
- *  effect.
+ *  may be chained together.
  *
  *     a = [ "a", "b", "c" ]
- *     a.push("d", "e", "f")
+ *     a.push("d", "e", "f")  
  *             #=> ["a", "b", "c", "d", "e", "f"]
- *     [1, 2, 3].push(4).push(5)
- *             #=> [1, 2, 3, 4, 5]
  */
 
 static VALUE
-rb_ary_push_m(int argc, VALUE *argv, VALUE ary)
-{
-    return rb_ary_cat(ary, argv, argc);
-}
-
-VALUE
-rb_ary_pop(VALUE ary)
+rb_ary_push_m(argc, argv, ary)
+    int argc;
+    VALUE *argv;
+    VALUE ary;
 {
-    long n;
-    rb_ary_modify_check(ary);
-    n = RARRAY_LEN(ary);
-    if (n == 0) return Qnil;
-    if (ARY_OWNS_HEAP_P(ary) &&
-	n * 3 < ARY_CAPA(ary) &&
-	ARY_CAPA(ary) > ARY_DEFAULT_SIZE)
-    {
-	ary_resize_capa(ary, n * 2);
-    }
-    --n;
-    ARY_SET_LEN(ary, n);
-    return RARRAY_AREF(ary, n);
+    while (argc--) {
+	rb_ary_push(ary, *argv++);
+    }
+    return ary;
 }
 
 /*
  *  call-seq:
- *     ary.pop    -> obj or nil
- *     ary.pop(n) -> new_ary
- *
- *  Removes the last element from +self+ and returns it, or
- *  +nil+ if the array is empty.
- *
- *  If a number +n+ is given, returns an array of the last +n+ elements
- *  (or less) just like <code>array.slice!(-n, n)</code> does. See also
- *  Array#push for the opposite effect.
- *
- *     a = [ "a", "b", "c", "d" ]
- *     a.pop     #=> "d"
- *     a.pop(2)  #=> ["b", "c"]
- *     a         #=> ["a"]
+ *     array.pop  -> obj or nil
+ *  
+ *  Removes the last element from <i>self</i> and returns it, or
+ *  <code>nil</code> if the array is empty.
+ *     
+ *     a = [ "a", "m", "z" ]
+ *     a.pop   #=> "z"
+ *     a       #=> ["a", "m"]
  */
 
-static VALUE
-rb_ary_pop_m(int argc, VALUE *argv, VALUE ary)
+VALUE
+rb_ary_pop(ary)
+    VALUE ary;
 {
-    VALUE result;
-
-    if (argc == 0) {
-	return rb_ary_pop(ary);
-    }
-
     rb_ary_modify_check(ary);
-    result = ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
-    ARY_INCREASE_LEN(ary, -RARRAY_LEN(result));
-    return result;
+    if (RARRAY(ary)->len == 0) return Qnil;
+    if (!FL_TEST(ary, ELTS_SHARED) &&
+	    RARRAY(ary)->len * 2 < RARRAY(ary)->aux.capa &&
+	    RARRAY(ary)->aux.capa > ARY_DEFAULT_SIZE) {
+	RARRAY(ary)->aux.capa = RARRAY(ary)->len * 2;
+	REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->aux.capa);
+    }
+    return RARRAY(ary)->ptr[--RARRAY(ary)->len];
 }
 
-VALUE
-rb_ary_shift(VALUE ary)
+static VALUE
+ary_make_shared(ary)
+    VALUE ary;
 {
-    VALUE top;
-    long len = RARRAY_LEN(ary);
-
-    rb_ary_modify_check(ary);
-    if (len == 0) return Qnil;
-    top = RARRAY_AREF(ary, 0);
-    if (!ARY_SHARED_P(ary)) {
-	if (len < ARY_DEFAULT_SIZE) {
-	    RARRAY_PTR_USE(ary, ptr, {
-		MEMMOVE(ptr, ptr+1, VALUE, len-1);
-	    }); /* WB: no new reference */
-            ARY_INCREASE_LEN(ary, -1);
-	    return top;
-	}
-        assert(!ARY_EMBED_P(ary)); /* ARY_EMBED_LEN_MAX < ARY_DEFAULT_SIZE */
+    if (!FL_TEST(ary, ELTS_SHARED)) {
+	NEWOBJ(shared, struct RArray);
+	OBJSETUP(shared, rb_cArray, T_ARRAY);
 
-	ARY_SET(ary, 0, Qnil);
-	ary_make_shared(ary);
+	shared->len = RARRAY(ary)->len;
+	shared->ptr = RARRAY(ary)->ptr;
+	shared->aux.capa = RARRAY(ary)->aux.capa;
+	RARRAY(ary)->aux.shared = (VALUE)shared;
+	FL_SET(ary, ELTS_SHARED);
+	OBJ_FREEZE(shared);
+	return (VALUE)shared;
     }
-    else if (ARY_SHARED_OCCUPIED(ARY_SHARED(ary))) {
-	RARRAY_PTR_USE(ary, ptr, ptr[0] = Qnil);
+    else {
+	return RARRAY(ary)->aux.shared;
     }
-    ARY_INCREASE_PTR(ary, 1);		/* shift ptr */
-    ARY_INCREASE_LEN(ary, -1);
-
-    return top;
 }
 
 /*
  *  call-seq:
- *     ary.shift    -> obj or nil
- *     ary.shift(n) -> new_ary
- *
- *  Removes the first element of +self+ and returns it (shifting all
- *  other elements down by one). Returns +nil+ if the array
+ *     array.shift   ->   obj or nil
+ *  
+ *  Returns the first element of <i>self</i> and removes it (shifting all
+ *  other elements down by one). Returns <code>nil</code> if the array
  *  is empty.
- *
- *  If a number +n+ is given, returns an array of the first +n+ elements
- *  (or less) just like <code>array.slice!(0, n)</code> does. With +ary+
- *  containing only the remainder elements, not including what was shifted to
- *  +new_ary+. See also Array#unshift for the opposite effect.
- *
- *     args = [ "-m", "-q", "filename" ]
- *     args.shift     #=> "-m"
- *     args           #=> ["-q", "filename"]
- *
+ *     
  *     args = [ "-m", "-q", "filename" ]
- *     args.shift(2)  #=> ["-m", "-q"]
- *     args           #=> ["filename"]
+ *     args.shift   #=> "-m"
+ *     args         #=> ["-q", "filename"]
  */
 
-static VALUE
-rb_ary_shift_m(int argc, VALUE *argv, VALUE ary)
+VALUE
+rb_ary_shift(ary)
+    VALUE ary;
 {
-    VALUE result;
-    long n;
-
-    if (argc == 0) {
-	return rb_ary_shift(ary);
-    }
+    VALUE top;
 
     rb_ary_modify_check(ary);
-    result = ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
-    n = RARRAY_LEN(result);
-    if (ARY_SHARED_P(ary)) {
-	if (ARY_SHARED_OCCUPIED(ARY_SHARED(ary))) {
-	  setup_occupied_shared:
-	    ary_mem_clear(ary, 0, n);
-	}
-        ARY_INCREASE_PTR(ary, n);
-    }
-    else {
-	if (RARRAY_LEN(ary) < ARY_DEFAULT_SIZE) {
-	    RARRAY_PTR_USE(ary, ptr, {
-		MEMMOVE(ptr, ptr+n, VALUE, RARRAY_LEN(ary)-n);
-	    }); /* WB: no new reference */
-	}
-	else {
-	    ary_make_shared(ary);
-	    goto setup_occupied_shared;
-	}
-    }
-    ARY_INCREASE_LEN(ary, -n);
+    if (RARRAY(ary)->len == 0) return Qnil;
+    top = RARRAY(ary)->ptr[0];
+    ary_make_shared(ary);
+    RARRAY(ary)->ptr++;		/* shift ptr */
+    RARRAY(ary)->len--;
 
-    return result;
+    return top;
 }
 
-static VALUE
-ary_ensure_room_for_unshift(VALUE ary, int argc)
+VALUE
+rb_ary_unshift(ary, item)
+    VALUE ary, item;
 {
-    long len = RARRAY_LEN(ary);
-    long new_len = len + argc;
-    long capa;
-    const VALUE *head, *sharedp;
-
-    if (len > ARY_MAX_SIZE - argc) {
-	rb_raise(rb_eIndexError, "index %ld too big", new_len);
-    }
-
-    if (ARY_SHARED_P(ary)) {
-	VALUE shared = ARY_SHARED(ary);
-	capa = RARRAY_LEN(shared);
-	if (ARY_SHARED_OCCUPIED(shared) && capa > new_len) {
-	    head = RARRAY_CONST_PTR(ary);
-	    sharedp = RARRAY_CONST_PTR(shared);
-	    goto makeroom_if_need;
-	}
-    }
-
     rb_ary_modify(ary);
-    capa = ARY_CAPA(ary);
-    if (capa - (capa >> 6) <= new_len) {
-	ary_double_capa(ary, new_len);
-    }
-
-    /* use shared array for big "queues" */
-    if (new_len > ARY_DEFAULT_SIZE * 4) {
-	/* make a room for unshifted items */
-	capa = ARY_CAPA(ary);
-	ary_make_shared(ary);
-
-	head = sharedp = RARRAY_CONST_PTR(ary);
-	goto makeroom;
-      makeroom_if_need:
-	if (head - sharedp < argc) {
-	    long room;
-	  makeroom:
-	    room = capa - new_len;
-	    room -= room >> 4;
-	    MEMMOVE((VALUE *)sharedp + argc + room, head, VALUE, len);
-	    head = sharedp + argc + room;
+    if (RARRAY(ary)->len == RARRAY(ary)->aux.capa) {
+	long capa_inc = RARRAY(ary)->aux.capa / 2;
+	if (capa_inc < ARY_DEFAULT_SIZE) {
+	    capa_inc = ARY_DEFAULT_SIZE;
 	}
-	ARY_SET_PTR(ary, head - argc);
-	assert(ARY_SHARED_OCCUPIED(ARY_SHARED(ary)));
-	return ARY_SHARED(ary);
+	RARRAY(ary)->aux.capa += capa_inc;
+	REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->aux.capa);
     }
-    else {
-	/* sliding items */
-	RARRAY_PTR_USE(ary, ptr, {
-	    MEMMOVE(ptr + argc, ptr, VALUE, len);
-	});
 
-	return ary;
-    }
+    /* sliding items */
+    MEMMOVE(RARRAY(ary)->ptr + 1, RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
+
+    RARRAY(ary)->len++;
+    RARRAY(ary)->ptr[0] = item;
+
+    return ary;
 }
 
 /*
  *  call-seq:
- *     ary.unshift(obj, ...)  -> ary
- *
- *  Prepends objects to the front of +self+, moving other elements upwards.
- *  See also Array#shift for the opposite effect.
- *
+ *     array.unshift(obj, ...)  -> array
+ *  
+ *  Prepends objects to the front of <i>array</i>.
+ *  other elements up one.
+ *     
  *     a = [ "b", "c", "d" ]
  *     a.unshift("a")   #=> ["a", "b", "c", "d"]
  *     a.unshift(1, 2)  #=> [ 1, 2, "a", "b", "c", "d"]
  */
 
 static VALUE
-rb_ary_unshift_m(int argc, VALUE *argv, VALUE ary)
+rb_ary_unshift_m(argc, argv, ary)
+    int argc;
+    VALUE *argv;
+    VALUE ary;
 {
-    long len = RARRAY_LEN(ary);
-    VALUE target_ary;
+    long len = RARRAY(ary)->len;
 
-    if (argc == 0) {
-	rb_ary_modify_check(ary);
-	return ary;
-    }
+    if (argc == 0) return ary;
 
-    target_ary = ary_ensure_room_for_unshift(ary, argc);
-    ary_memcpy0(ary, 0, argc, argv, target_ary);
-    ARY_SET_LEN(ary, len + argc);
-    return ary;
-}
+    /* make rooms by setting the last item */
+    rb_ary_store(ary, len + argc - 1, Qnil);
 
-VALUE
-rb_ary_unshift(VALUE ary, VALUE item)
-{
-    return rb_ary_unshift_m(1,&item,ary);
+    /* sliding items */
+    MEMMOVE(RARRAY(ary)->ptr + argc, RARRAY(ary)->ptr, VALUE, len);
+    MEMCPY(RARRAY(ary)->ptr, argv, VALUE, argc);
+    
+    return ary;
 }
 
 /* faster version - use this if you don't need to treat negative offset */
 static inline VALUE
-rb_ary_elt(VALUE ary, long offset)
+rb_ary_elt(ary, offset)
+    VALUE ary;
+    long offset;
 {
-    long len = RARRAY_LEN(ary);
-    if (len == 0) return Qnil;
-    if (offset < 0 || len <= offset) {
+    if (RARRAY(ary)->len == 0) return Qnil;
+    if (offset < 0 || RARRAY(ary)->len <= offset) {
 	return Qnil;
     }
-    return RARRAY_AREF(ary, offset);
+    return RARRAY(ary)->ptr[offset];
 }
 
 VALUE
-rb_ary_entry(VALUE ary, long offset)
+rb_ary_entry(ary, offset)
+    VALUE ary;
+    long offset;
 {
-    long len = RARRAY_LEN(ary);
-    const VALUE *ptr = RARRAY_CONST_PTR(ary);
-    if (len == 0) return Qnil;
     if (offset < 0) {
-        offset += len;
-        if (offset < 0) return Qnil;
-    }
-    else if (len <= offset) {
-        return Qnil;
+	offset += RARRAY(ary)->len;
     }
-    return ptr[offset];
+    return rb_ary_elt(ary, offset);
 }
 
-VALUE
-rb_ary_subseq(VALUE ary, long beg, long len)
+static VALUE
+rb_ary_subseq(ary, beg, len)
+    VALUE ary;
+    long beg, len;
 {
-    VALUE klass;
-    long alen = RARRAY_LEN(ary);
+    VALUE klass, ary2, shared;
+    VALUE *ptr;
 
-    if (beg > alen) return Qnil;
+    if (beg > RARRAY(ary)->len) return Qnil;
     if (beg < 0 || len < 0) return Qnil;
 
-    if (alen < len || alen < beg + len) {
-	len = alen - beg;
+    if (RARRAY(ary)->len < len || RARRAY(ary)->len < beg + len) {
+	len = RARRAY(ary)->len - beg;
+	if (len < 0)
+	    len = 0;
     }
     klass = rb_obj_class(ary);
     if (len == 0) return ary_new(klass, 0);
 
-    return ary_make_partial(ary, klass, beg, len);
+    shared = ary_make_shared(ary);
+    ptr = RARRAY(ary)->ptr;
+    ary2 = ary_alloc(klass);
+    RARRAY(ary2)->ptr = ptr + beg;
+    RARRAY(ary2)->len = len;
+    RARRAY(ary2)->aux.shared = shared;
+    FL_SET(ary2, ELTS_SHARED);
+
+    return ary2;
 }
 
-/*
+/* 
  *  call-seq:
- *     ary[index]                -> obj     or nil
- *     ary[start, length]        -> new_ary or nil
- *     ary[range]                -> new_ary or nil
- *     ary.slice(index)          -> obj     or nil
- *     ary.slice(start, length)  -> new_ary or nil
- *     ary.slice(range)          -> new_ary or nil
+ *     array[index]                -> obj      or nil
+ *     array[start, length]        -> an_array or nil
+ *     array[range]                -> an_array or nil
+ *     array.slice(index)          -> obj      or nil
+ *     array.slice(start, length)  -> an_array or nil
+ *     array.slice(range)          -> an_array or nil
  *
- *  Element Reference --- Returns the element at +index+, or returns a
- *  subarray starting at the +start+ index and continuing for +length+
- *  elements, or returns a subarray specified by +range+ of indices.
- *
- *  Negative indices count backward from the end of the array (-1 is the last
- *  element).  For +start+ and +range+ cases the starting index is just before
- *  an element.  Additionally, an empty array is returned when the starting
- *  index for an element range is at the end of the array.
- *
- *  Returns +nil+ if the index (or starting index) are out of range.
+ *  Element Reference---Returns the element at _index_,
+ *  or returns a subarray starting at _start_ and
+ *  continuing for _length_ elements, or returns a subarray
+ *  specified by _range_.
+ *  Negative indices count backward from the end of the
+ *  array (-1 is the last element). Returns nil if the index
+ *  (or starting index) are out of range.
  *
  *     a = [ "a", "b", "c", "d", "e" ]
  *     a[2] +  a[0] + a[1]    #=> "cab"
@@ -1256,36 +644,44 @@ rb_ary_subseq(VALUE ary, long beg, long len)
  *     a[-3, 3]               #=> [ "c", "d", "e" ]
  *     # special cases
  *     a[5]                   #=> nil
- *     a[6, 1]                #=> nil
  *     a[5, 1]                #=> []
  *     a[5..10]               #=> []
  *
  */
 
 VALUE
-rb_ary_aref(int argc, const VALUE *argv, VALUE ary)
+rb_ary_aref(argc, argv, ary)
+    int argc;
+    VALUE *argv;
+    VALUE ary;
 {
     VALUE arg;
     long beg, len;
 
     if (argc == 2) {
+	if (SYMBOL_P(argv[0])) {
+	    rb_raise(rb_eTypeError, "Symbol as array index");
+	}
 	beg = NUM2LONG(argv[0]);
 	len = NUM2LONG(argv[1]);
 	if (beg < 0) {
-	    beg += RARRAY_LEN(ary);
+	    beg += RARRAY(ary)->len;
 	}
 	return rb_ary_subseq(ary, beg, len);
     }
     if (argc != 1) {
-	rb_scan_args(argc, argv, "11", NULL, NULL);
+	rb_scan_args(argc, argv, "11", 0, 0);
     }
     arg = argv[0];
     /* special case - speeding up */
     if (FIXNUM_P(arg)) {
 	return rb_ary_entry(ary, FIX2LONG(arg));
     }
+    if (SYMBOL_P(arg)) {
+	rb_raise(rb_eTypeError, "Symbol as array index");
+    }
     /* check if idx is Range */
-    switch (rb_range_beg_len(arg, &beg, &len, RARRAY_LEN(ary), 0)) {
+    switch (rb_range_beg_len(arg, &beg, &len, RARRAY(ary)->len, 0)) {
       case Qfalse:
 	break;
       case Qnil:
@@ -1296,105 +692,129 @@ rb_ary_aref(int argc, const VALUE *argv, VALUE ary)
     return rb_ary_entry(ary, NUM2LONG(arg));
 }
 
-/*
+/* 
  *  call-seq:
- *     ary.at(index)   ->   obj  or nil
+ *     array.at(index)   ->   obj  or nil
  *
- *  Returns the element at +index+. A negative index counts from the end of
- *  +self+. Returns +nil+ if the index is out of range. See also
- *  Array#[].
+ *  Returns the element at _index_. A
+ *  negative index counts from the end of _self_.  Returns +nil+
+ *  if the index is out of range. See also <code>Array#[]</code>.
+ *  (<code>Array#at</code> is slightly faster than <code>Array#[]</code>,
+ *  as it does not accept ranges and so on.)
  *
  *     a = [ "a", "b", "c", "d", "e" ]
  *     a.at(0)     #=> "a"
  *     a.at(-1)    #=> "e"
  */
 
-VALUE
-rb_ary_at(VALUE ary, VALUE pos)
+static VALUE
+rb_ary_at(ary, pos)
+    VALUE ary, pos;
 {
     return rb_ary_entry(ary, NUM2LONG(pos));
 }
 
 /*
  *  call-seq:
- *     ary.first     ->   obj or nil
- *     ary.first(n)  ->   new_ary
+ *     array.first   ->   obj or nil
+ *     array.first(n) -> an_array
  *
  *  Returns the first element, or the first +n+ elements, of the array.
- *  If the array is empty, the first form returns +nil+, and the
- *  second form returns an empty array. See also Array#last for
- *  the opposite effect.
+ *  If the array is empty, the first form returns <code>nil</code>, and the
+ *  second form returns an empty array.
  *
  *     a = [ "q", "r", "s", "t" ]
- *     a.first     #=> "q"
- *     a.first(2)  #=> ["q", "r"]
+ *     a.first    #=> "q"
+ *     a.first(1) #=> ["q"]
+ *     a.first(3) #=> ["q", "r", "s"]
  */
 
 static VALUE
-rb_ary_first(int argc, VALUE *argv, VALUE ary)
+rb_ary_first(argc, argv, ary)
+    int argc;
+    VALUE *argv;
+    VALUE ary;
 {
     if (argc == 0) {
-	if (RARRAY_LEN(ary) == 0) return Qnil;
-	return RARRAY_AREF(ary, 0);
+	if (RARRAY(ary)->len == 0) return Qnil;
+	return RARRAY(ary)->ptr[0];
     }
     else {
-	return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_FIRST);
+	VALUE nv, result;
+	long n, i;
+
+	rb_scan_args(argc, argv, "01", &nv);
+	n = NUM2LONG(nv);
+	if (n > RARRAY(ary)->len) n = RARRAY(ary)->len;
+	result = rb_ary_new2(n);
+	for (i=0; i<n; i++) {
+	    rb_ary_push(result, RARRAY(ary)->ptr[i]);
+	}
+	return result;
     }
 }
 
 /*
  *  call-seq:
- *     ary.last     ->  obj or nil
- *     ary.last(n)  ->  new_ary
- *
- *  Returns the last element(s) of +self+. If the array is empty,
- *  the first form returns +nil+.
- *
- *  See also Array#first for the opposite effect.
- *
- *     a = [ "w", "x", "y", "z" ]
- *     a.last     #=> "z"
- *     a.last(2)  #=> ["y", "z"]
+ *     array.last     ->  obj or nil
+ *     array.last(n)  ->  an_array
+ *  
+ *  Returns the last element(s) of <i>self</i>. If the array is empty,
+ *  the first form returns <code>nil</code>.
+ *     
+ *     [ "w", "x", "y", "z" ].last   #=> "z"
  */
 
-VALUE
-rb_ary_last(int argc, const VALUE *argv, VALUE ary)
+static VALUE
+rb_ary_last(argc, argv, ary)
+    int argc;
+    VALUE *argv;
+    VALUE ary;
 {
     if (argc == 0) {
-	long len = RARRAY_LEN(ary);
-	if (len == 0) return Qnil;
-	return RARRAY_AREF(ary, len-1);
+	if (RARRAY(ary)->len == 0) return Qnil;
+	return RARRAY(ary)->ptr[RARRAY(ary)->len-1];
     }
     else {
-	return ary_take_first_or_last(argc, argv, ary, ARY_TAKE_LAST);
+	VALUE nv, result;
+	long n, i;
+
+	rb_scan_args(argc, argv, "01", &nv);
+	n = NUM2LONG(nv);
+	if (n > RARRAY(ary)->len) n = RARRAY(ary)->len;
+	result = rb_ary_new2(n);
+	for (i=RARRAY(ary)->len-n; n--; i++) {
+	    rb_ary_push(result, RARRAY(ary)->ptr[i]);
+	}
+	return result;
     }
 }
 
 /*
  *  call-seq:
- *     ary.fetch(index)                    -> obj
- *     ary.fetch(index, default)           -> obj
- *     ary.fetch(index) { |index| block }  -> obj
- *
- *  Tries to return the element at position +index+, but throws an IndexError
- *  exception if the referenced +index+ lies outside of the array bounds.  This
- *  error can be prevented by supplying a second argument, which will act as a
- *  +default+ value.
- *
- *  Alternatively, if a block is given it will only be executed when an
- *  invalid +index+ is referenced.  Negative values of +index+ count from the
- *  end of the array.
- *
+ *     array.fetch(index)                    -> obj
+ *     array.fetch(index, default )          -> obj
+ *     array.fetch(index) {|index| block }   -> obj
+ *  
+ *  Tries to return the element at position <i>index</i>. If the index
+ *  lies outside the array, the first form throws an
+ *  <code>IndexError</code> exception, the second form returns
+ *  <i>default</i>, and the third form returns the value of invoking
+ *  the block, passing in the index. Negative values of <i>index</i>
+ *  count from the end of the array.
+ *     
  *     a = [ 11, 22, 33, 44 ]
  *     a.fetch(1)               #=> 22
  *     a.fetch(-1)              #=> 44
  *     a.fetch(4, 'cat')        #=> "cat"
- *     a.fetch(100) { |i| puts "#{i} is out of bounds" }
- *                              #=> "100 is out of bounds"
+ *     a.fetch(4) { |i| i*i }   #=> 16
  */
 
 static VALUE
-rb_ary_fetch(int argc, VALUE *argv, VALUE ary)
+rb_ary_fetch(argc, argv, ary)
+    int argc;
+    VALUE *argv;
+    VALUE ary;
 {
     VALUE pos, ifnone;
     long block_given;
@@ -1408,303 +828,198 @@ rb_ary_fetch(int argc, VALUE *argv, VALUE ary)
     idx = NUM2LONG(pos);
 
     if (idx < 0) {
-	idx +=  RARRAY_LEN(ary);
+	idx +=  RARRAY(ary)->len;
     }
-    if (idx < 0 || RARRAY_LEN(ary) <= idx) {
+    if (idx < 0 || RARRAY(ary)->len <= idx) {
 	if (block_given) return rb_yield(pos);
 	if (argc == 1) {
-	    rb_raise(rb_eIndexError, "index %ld outside of array bounds: %ld...%ld",
-			idx - (idx < 0 ? RARRAY_LEN(ary) : 0), -RARRAY_LEN(ary), RARRAY_LEN(ary));
+	    rb_raise(rb_eIndexError, "index %ld out of array", idx);
 	}
 	return ifnone;
     }
-    return RARRAY_AREF(ary, idx);
+    return RARRAY(ary)->ptr[idx];
 }
 
 /*
  *  call-seq:
- *     ary.find_index(obj)             ->  int or nil
- *     ary.find_index { |item| block } ->  int or nil
- *     ary.find_index                  ->  Enumerator
- *     ary.index(obj)             ->  int or nil
- *     ary.index { |item| block } ->  int or nil
- *     ary.index                  ->  Enumerator
- *
- *  Returns the _index_ of the first object in +ary+ such that the object is
- *  <code>==</code> to +obj+.
- *
- *  If a block is given instead of an argument, returns the _index_ of the
- *  first object for which the block returns +true+.  Returns +nil+ if no
- *  match is found.
- *
- *  See also Array#rindex.
- *
- *  An Enumerator is returned if neither a block nor argument is given.
- *
+ *     array.index(obj)   ->  int or nil
+ *  
+ *  Returns the index of the first object in <i>self</i> such that is 
+ *  <code>==</code> to <i>obj</i>. Returns <code>nil</code> if
+ *  no match is found.
+ *     
  *     a = [ "a", "b", "c" ]
- *     a.index("b")              #=> 1
- *     a.index("z")              #=> nil
- *     a.index { |x| x == "b" }  #=> 1
+ *     a.index("b")   #=> 1
+ *     a.index("z")   #=> nil
  */
 
 static VALUE
-rb_ary_index(int argc, VALUE *argv, VALUE ary)
-{
-    const VALUE *ptr;
+rb_ary_index(ary, val)
+    VALUE ary;
     VALUE val;
-    long i, len;
+{
+    long i;
 
-    if (argc == 0) {
-	RETURN_ENUMERATOR(ary, 0, 0);
-	for (i=0; i<RARRAY_LEN(ary); i++) {
-	    if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
-		return LONG2NUM(i);
-	    }
-	}
-	return Qnil;
-    }
-    rb_check_arity(argc, 0, 1);
-    val = argv[0];
-    if (rb_block_given_p())
-	rb_warn("given block not used");
-    len = RARRAY_LEN(ary);
-    ptr = RARRAY_CONST_PTR(ary);
-    for (i=0; i<len; i++) {
-	VALUE e = ptr[i];
-	switch (rb_equal_opt(e, val)) {
-	  case Qundef:
-	    if (!rb_equal(e, val)) break;
-	  case Qtrue:
+    for (i=0; i<RARRAY(ary)->len; i++) {
+	if (rb_equal(RARRAY(ary)->ptr[i], val))
 	    return LONG2NUM(i);
-	  case Qfalse:
-	    continue;
-	}
-	len = RARRAY_LEN(ary);
-	ptr = RARRAY_CONST_PTR(ary);
     }
     return Qnil;
 }
 
 /*
  *  call-seq:
- *     ary.rindex(obj)             ->  int or nil
- *     ary.rindex { |item| block } ->  int or nil
- *     ary.rindex                  ->  Enumerator
- *
- *  Returns the _index_ of the last object in +self+ <code>==</code> to +obj+.
- *
- *  If a block is given instead of an argument, returns the _index_ of the
- *  first object for which the block returns +true+, starting from the last
- *  object.
- *
- *  Returns +nil+ if no match is found.
- *
- *  See also Array#index.
- *
- *  If neither block nor argument is given, an Enumerator is returned instead.
- *
+ *     array.rindex(obj)    ->  int or nil
+ *  
+ *  Returns the index of the last object in <i>array</i> 
+ *  <code>==</code> to <i>obj</i>. Returns <code>nil</code> if
+ *  no match is found.
+ *     
  *     a = [ "a", "b", "b", "b", "c" ]
- *     a.rindex("b")             #=> 3
- *     a.rindex("z")             #=> nil
- *     a.rindex { |x| x == "b" } #=> 3
+ *     a.rindex("b")   #=> 3
+ *     a.rindex("z")   #=> nil
  */
 
 static VALUE
-rb_ary_rindex(int argc, VALUE *argv, VALUE ary)
-{
-    const VALUE *ptr;
+rb_ary_rindex(ary, val)
+    VALUE ary;
     VALUE val;
-    long i = RARRAY_LEN(ary), len;
+{
+    long i = RARRAY(ary)->len;
 
-    if (argc == 0) {
-	RETURN_ENUMERATOR(ary, 0, 0);
-	while (i--) {
-	    if (RTEST(rb_yield(RARRAY_AREF(ary, i))))
-		return LONG2NUM(i);
-	    if (i > (len = RARRAY_LEN(ary))) {
-		i = len;
-	    }
-	}
-	return Qnil;
-    }
-    rb_check_arity(argc, 0, 1);
-    val = argv[0];
-    if (rb_block_given_p())
-	rb_warn("given block not used");
-    ptr = RARRAY_CONST_PTR(ary);
     while (i--) {
-	VALUE e = ptr[i];
-	switch (rb_equal_opt(e, val)) {
-	  case Qundef:
-	    if (!rb_equal(e, val)) break;
-	  case Qtrue:
-	    return LONG2NUM(i);
-	  case Qfalse:
+	if (i > RARRAY(ary)->len) {
+	    i = RARRAY(ary)->len;
 	    continue;
 	}
-	if (i > (len = RARRAY_LEN(ary))) {
-	    i = len;
-	}
-	ptr = RARRAY_CONST_PTR(ary);
+	if (rb_equal(RARRAY(ary)->ptr[i], val))
+	    return LONG2NUM(i);
     }
     return Qnil;
 }
 
-VALUE
-rb_ary_to_ary(VALUE obj)
+/*
+ *  call-seq:
+ *     array.indexes( i1, i2, ... iN )   -> an_array
+ *     array.indices( i1, i2, ... iN )   -> an_array
+ *  
+ *  Deprecated; use <code>Array#values_at</code>.
+ */
+
+static VALUE
+rb_ary_indexes(argc, argv, ary)
+    int argc;
+    VALUE *argv;
+    VALUE ary;
 {
-    VALUE tmp = rb_check_array_type(obj);
+    VALUE new_ary;
+    long i;
+
+    rb_warn("Array#%s is deprecated; use Array#values_at", rb_id2name(rb_frame_last_func()));
+    new_ary = rb_ary_new2(argc);
+    for (i=0; i<argc; i++) {
+	rb_ary_push(new_ary, rb_ary_aref(1, argv+i, ary));
+    }
+
+    return new_ary;
+}
 
-    if (!NIL_P(tmp)) return tmp;
+VALUE
+rb_ary_to_ary(obj)
+    VALUE obj;
+{
+    if (TYPE(obj) == T_ARRAY) {
+	return obj;
+    }
+    if (rb_respond_to(obj, rb_intern("to_ary"))) {
+	return rb_convert_type(obj, T_ARRAY, "Array", "to_ary");
+    }
     return rb_ary_new3(1, obj);
 }
 
 static void
-rb_ary_splice(VALUE ary, long beg, long len, const VALUE *rptr, long rlen)
+rb_ary_splice(ary, beg, len, rpl)
+    VALUE ary;
+    long beg, len;
+    VALUE rpl;
 {
-    long olen;
-    long rofs;
+    long rlen;
 
     if (len < 0) rb_raise(rb_eIndexError, "negative length (%ld)", len);
-    olen = RARRAY_LEN(ary);
     if (beg < 0) {
-	beg += olen;
+	beg += RARRAY(ary)->len;
 	if (beg < 0) {
-	    rb_raise(rb_eIndexError, "index %ld too small for array; minimum: %ld",
-		     beg - olen, -olen);
+	    beg -= RARRAY(ary)->len;
+	    rb_raise(rb_eIndexError, "index %ld out of array", beg);
 	}
     }
-    if (olen < len || olen < beg + len) {
-	len = olen - beg;
+    if (RARRAY(ary)->len < len || RARRAY(ary)->len < beg + len) {
+	len = RARRAY(ary)->len - beg;
     }
 
-    {
-	const VALUE *optr = RARRAY_CONST_PTR(ary);
-	rofs = (rptr >= optr && rptr < optr + olen) ? rptr - optr : -1;
+    if (NIL_P(rpl)) {
+	rlen = 0;
+    }
+    else {
+	rpl = rb_ary_to_ary(rpl);
+	rlen = RARRAY(rpl)->len;
     }
+    rb_ary_modify(ary);
 
-    if (beg >= olen) {
-	VALUE target_ary;
-	if (beg > ARY_MAX_SIZE - rlen) {
-	    rb_raise(rb_eIndexError, "index %ld too big", beg);
-	}
-	target_ary = ary_ensure_room_for_push(ary, rlen-len); /* len is 0 or negative */
+    if (beg >= RARRAY(ary)->len) {
 	len = beg + rlen;
-	ary_mem_clear(ary, olen, beg - olen);
+	if (len >= RARRAY(ary)->aux.capa) {
+	    REALLOC_N(RARRAY(ary)->ptr, VALUE, len);
+	    RARRAY(ary)->aux.capa = len;
+	}
+	rb_mem_clear(RARRAY(ary)->ptr + RARRAY(ary)->len, beg - RARRAY(ary)->len);
 	if (rlen > 0) {
-	    if (rofs != -1) rptr = RARRAY_CONST_PTR(ary) + rofs;
-	    ary_memcpy0(ary, beg, rlen, rptr, target_ary);
+	    MEMCPY(RARRAY(ary)->ptr + beg, RARRAY(rpl)->ptr, VALUE, rlen);
 	}
-	ARY_SET_LEN(ary, len);
+	RARRAY(ary)->len = len;
     }
     else {
 	long alen;
 
-	if (olen - len > ARY_MAX_SIZE - rlen) {
-	    rb_raise(rb_eIndexError, "index %ld too big", olen + rlen - len);
+	if (beg + len > RARRAY(ary)->len) {
+	    len = RARRAY(ary)->len - beg;
 	}
-	rb_ary_modify(ary);
-	alen = olen + rlen - len;
-	if (alen >= ARY_CAPA(ary)) {
-	    ary_double_capa(ary, alen);
+
+	alen = RARRAY(ary)->len + rlen - len;
+	if (alen >= RARRAY(ary)->aux.capa) {
+	    REALLOC_N(RARRAY(ary)->ptr, VALUE, alen);
+	    RARRAY(ary)->aux.capa = alen;
 	}
 
 	if (len != rlen) {
-	    RARRAY_PTR_USE(ary, ptr,
-			   MEMMOVE(ptr + beg + rlen, ptr + beg + len,
-				   VALUE, olen - (beg + len)));
-	    ARY_SET_LEN(ary, alen);
+	    MEMMOVE(RARRAY(ary)->ptr + beg + rlen, RARRAY(ary)->ptr + beg + len,
+		    VALUE, RARRAY(ary)->len - (beg + len));
+	    RARRAY(ary)->len = alen;
 	}
 	if (rlen > 0) {
-	    if (rofs != -1) rptr = RARRAY_CONST_PTR(ary) + rofs;
-	    MEMMOVE(RARRAY_PTR(ary) + beg, rptr, VALUE, rlen);
+	    MEMMOVE(RARRAY(ary)->ptr + beg, RARRAY(rpl)->ptr, VALUE, rlen);
 	}
     }
 }
 
-void
-rb_ary_set_len(VALUE ary, long len)
-{
-    long capa;
-
-    rb_ary_modify_check(ary);
-    if (ARY_SHARED_P(ary)) {
-	rb_raise(rb_eRuntimeError, "can't set length of shared ");
-    }
-    if (len > (capa = (long)ARY_CAPA(ary))) {
-	rb_bug("probable buffer overflow: %ld for %ld", len, capa);
-    }
-    ARY_SET_LEN(ary, len);
-}
-
-/*!
- * expands or shrinks \a ary to \a len elements.
- * expanded region will be filled with Qnil.
- * \param ary  an array
- * \param len  new size
- * \return     \a ary
- * \post       the size of \a ary is \a len.
- */
-VALUE
-rb_ary_resize(VALUE ary, long len)
-{
-    long olen;
-
-    rb_ary_modify(ary);
-    olen = RARRAY_LEN(ary);
-    if (len == olen) return ary;
-    if (len > ARY_MAX_SIZE) {
-	rb_raise(rb_eIndexError, "index %ld too big", len);
-    }
-    if (len > olen) {
-	if (len >= ARY_CAPA(ary)) {
-	    ary_double_capa(ary, len);
-	}
-	ary_mem_clear(ary, olen, len - olen);
-	ARY_SET_LEN(ary, len);
-    }
-    else if (ARY_EMBED_P(ary)) {
-        ARY_SET_EMBED_LEN(ary, len);
-    }
-    else if (len <= RARRAY_EMBED_LEN_MAX) {
-	VALUE tmp[RARRAY_EMBED_LEN_MAX];
-	MEMCPY(tmp, ARY_HEAP_PTR(ary), VALUE, len);
-	ary_discard(ary);
-	MEMCPY((VALUE *)ARY_EMBED_PTR(ary), tmp, VALUE, len); /* WB: no new reference */
-        ARY_SET_EMBED_LEN(ary, len);
-    }
-    else {
-	if (olen > len + ARY_DEFAULT_SIZE) {
-	    SIZED_REALLOC_N(RARRAY(ary)->as.heap.ptr, VALUE, len, RARRAY(ary)->as.heap.aux.capa);
-	    ARY_SET_CAPA(ary, len);
-	}
-	ARY_SET_HEAP_LEN(ary, len);
-    }
-    return ary;
-}
-
-/*
+/* 
  *  call-seq:
- *     ary[index]         = obj                      ->  obj
- *     ary[start, length] = obj or other_ary or nil  ->  obj or other_ary or nil
- *     ary[range]         = obj or other_ary or nil  ->  obj or other_ary or nil
- *
- *  Element Assignment --- Sets the element at +index+, or replaces a subarray
- *  from the +start+ index for +length+ elements, or replaces a subarray
- *  specified by the +range+ of indices.
- *
- *  If indices are greater than the current capacity of the array, the array
- *  grows automatically.  Elements are inserted into the array at +start+ if
- *  +length+ is zero.
- *
- *  Negative indices will count backward from the end of the array.  For
- *  +start+ and +range+ cases the starting index is just before an element.
- *
- *  An IndexError is raised if a negative index points past the beginning of
- *  the array.
- *
- *  See also Array#push, and Array#unshift.
+ *     array[index]         = obj                     ->  obj
+ *     array[start, length] = obj or an_array or nil  ->  obj or an_array or nil
+ *     array[range]         = obj or an_array or nil  ->  obj or an_array or nil
  *
+ *  Element Assignment---Sets the element at _index_,
+ *  or replaces a subarray starting at _start_ and
+ *  continuing for _length_ elements, or replaces a subarray
+ *  specified by _range_.  If indices are greater than
+ *  the current capacity of the array, the array grows
+ *  automatically. A negative indices will count backward
+ *  from the end of the array. Inserts elements if _length_ is
+ *  zero. If +nil+ is used in the second and third form,
+ *  deletes elements from _self_. An +IndexError+ is raised if a
+ *  negative index points past the beginning of the array. See also
+ *  <code>Array#push</code>, and <code>Array#unshift</code>.
+ * 
  *     a = Array.new
  *     a[4] = "4";                 #=> [nil, nil, nil, nil, "4"]
  *     a[0, 3] = [ 'a', 'b', 'c' ] #=> ["a", "b", "c", nil, "4"]
@@ -1712,37 +1027,41 @@ rb_ary_resize(VALUE ary, long len)
  *     a[0, 2] = "?"               #=> ["?", 2, nil, "4"]
  *     a[0..2] = "A"               #=> ["A", "4"]
  *     a[-1]   = "Z"               #=> ["A", "Z"]
- *     a[1..-1] = nil              #=> ["A", nil]
- *     a[1..-1] = []               #=> ["A"]
- *     a[0, 0] = [ 1, 2 ]          #=> [1, 2, "A"]
- *     a[3, 0] = "B"               #=> [1, 2, "A", "B"]
+ *     a[1..-1] = nil              #=> ["A"]
  */
 
 static VALUE
-rb_ary_aset(int argc, VALUE *argv, VALUE ary)
+rb_ary_aset(argc, argv, ary)
+    int argc;
+    VALUE *argv;
+    VALUE ary;
 {
     long offset, beg, len;
-    VALUE rpl;
 
     if (argc == 3) {
-	rb_ary_modify_check(ary);
-	beg = NUM2LONG(argv[0]);
-	len = NUM2LONG(argv[1]);
-	goto range;
+	if (SYMBOL_P(argv[0])) {
+	    rb_raise(rb_eTypeError, "Symbol as array index");
+	}
+	if (SYMBOL_P(argv[1])) {
+	    rb_raise(rb_eTypeError, "Symbol as subarray length");
+	}
+	rb_ary_splice(ary, NUM2LONG(argv[0]), NUM2LONG(argv[1]), argv[2]);
+	return argv[2];
+    }
+    if (argc != 2) {
+	rb_raise(rb_eArgError, "wrong number of arguments (%d for 2)", argc);
     }
-    rb_check_arity(argc, 2, 2);
-    rb_ary_modify_check(ary);
     if (FIXNUM_P(argv[0])) {
 	offset = FIX2LONG(argv[0]);
 	goto fixnum;
     }
-    if (rb_range_beg_len(argv[0], &beg, &len, RARRAY_LEN(ary), 1)) {
+    if (SYMBOL_P(argv[0])) {
+	rb_raise(rb_eTypeError, "Symbol as array index");
+    }
+    if (rb_range_beg_len(argv[0], &beg, &len, RARRAY(ary)->len, 1)) {
 	/* check if idx is Range */
-      range:
-	rpl = rb_ary_to_ary(argv[argc-1]);
-	rb_ary_splice(ary, beg, len, RARRAY_CONST_PTR(rpl), RARRAY_LEN(rpl));
-	RB_GC_GUARD(rpl);
-	return argv[argc-1];
+	rb_ary_splice(ary, beg, len, argv[1]);
+	return argv[1];
     }
 
     offset = NUM2LONG(argv[0]);
@@ -1753,103 +1072,88 @@ fixnum:
 
 /*
  *  call-seq:
- *     ary.insert(index, obj...)  -> ary
- *
- *  Inserts the given values before the element with the given +index+.
- *
- *  Negative indices count backwards from the end of the array, where +-1+ is
- *  the last element. If a negative index is used, the given values will be
- *  inserted after that element, so using an index of +-1+ will insert the
- *  values at the end of the array.
- *
+ *     array.insert(index, obj...)  -> array
+ *  
+ *  Inserts the given values before the element with the given index
+ *  (which may be negative).
+ *     
  *     a = %w{ a b c d }
  *     a.insert(2, 99)         #=> ["a", "b", 99, "c", "d"]
  *     a.insert(-2, 1, 2, 3)   #=> ["a", "b", 99, "c", 1, 2, 3, "d"]
  */
 
 static VALUE
-rb_ary_insert(int argc, VALUE *argv, VALUE ary)
+rb_ary_insert(argc, argv, ary)
+    int argc;
+    VALUE *argv;
+    VALUE ary;
 {
     long pos;
 
-    rb_check_arity(argc, 1, UNLIMITED_ARGUMENTS);
-    rb_ary_modify_check(ary);
     if (argc == 1) return ary;
+    if (argc < 1) {
+	rb_raise(rb_eArgError, "wrong number of arguments (at least 1)");
+    }
     pos = NUM2LONG(argv[0]);
     if (pos == -1) {
-	pos = RARRAY_LEN(ary);
+	pos = RARRAY(ary)->len;
     }
     if (pos < 0) {
 	pos++;
     }
-    rb_ary_splice(ary, pos, 0, argv + 1, argc - 1);
+    rb_ary_splice(ary, pos, 0, rb_ary_new4(argc - 1, argv + 1));
     return ary;
 }
 
-static VALUE
-rb_ary_length(VALUE ary);
-
-static VALUE
-ary_enum_length(VALUE ary, VALUE args, VALUE eobj)
-{
-    return rb_ary_length(ary);
-}
-
 /*
  *  call-seq:
- *     ary.each { |item| block }  -> ary
- *     ary.each                   -> Enumerator
- *
- *  Calls the given block once for each element in +self+, passing that element
- *  as a parameter.  Returns the array itself.
- *
- *  If no block is given, an Enumerator is returned.
- *
+ *     array.each {|item| block }   ->   array
+ *  
+ *  Calls <i>block</i> once for each element in <i>self</i>, passing that
+ *  element as a parameter.
+ *     
  *     a = [ "a", "b", "c" ]
  *     a.each {|x| print x, " -- " }
- *
+ *     
  *  produces:
- *
+ *     
  *     a -- b -- c --
  */
 
 VALUE
-rb_ary_each(VALUE ary)
+rb_ary_each(ary)
+    VALUE ary;
 {
     long i;
 
-    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
-    for (i=0; i<RARRAY_LEN(ary); i++) {
-	rb_yield(RARRAY_AREF(ary, i));
+    for (i=0; i<RARRAY(ary)->len; i++) {
+	rb_yield(RARRAY(ary)->ptr[i]);
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *     ary.each_index { |index| block }  -> ary
- *     ary.each_index                    -> Enumerator
- *
- *  Same as Array#each, but passes the +index+ of the element instead of the
- *  element itself.
- *
- *  An Enumerator is returned if no block is given.
- *
+ *     array.each_index {|index| block }  ->  array
+ *  
+ *  Same as <code>Array#each</code>, but passes the index of the element
+ *  instead of the element itself.
+ *     
  *     a = [ "a", "b", "c" ]
  *     a.each_index {|x| print x, " -- " }
- *
+ *     
  *  produces:
- *
+ *     
  *     0 -- 1 -- 2 --
  */
 
 static VALUE
-rb_ary_each_index(VALUE ary)
+rb_ary_each_index(ary)
+    VALUE ary;
 {
     long i;
-    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
 
-    for (i=0; i<RARRAY_LEN(ary); i++) {
+    for (i=0; i<RARRAY(ary)->len; i++) {
 	rb_yield(LONG2NUM(i));
     }
     return ary;
@@ -1857,32 +1161,29 @@ rb_ary_each_index(VALUE ary)
 
 /*
  *  call-seq:
- *     ary.reverse_each { |item| block }  -> ary
- *     ary.reverse_each                   -> Enumerator
- *
- *  Same as Array#each, but traverses +self+ in reverse order.
- *
+ *     array.reverse_each {|item| block } 
+ *  
+ *  Same as <code>Array#each</code>, but traverses <i>self</i> in reverse
+ *  order.
+ *     
  *     a = [ "a", "b", "c" ]
  *     a.reverse_each {|x| print x, " " }
- *
+ *     
  *  produces:
- *
+ *     
  *     c b a
  */
 
 static VALUE
-rb_ary_reverse_each(VALUE ary)
+rb_ary_reverse_each(ary)
+    VALUE ary;
 {
-    long len;
+    long len = RARRAY(ary)->len;
 
-    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
-    len = RARRAY_LEN(ary);
     while (len--) {
-	long nlen;
-	rb_yield(RARRAY_AREF(ary, len));
-	nlen = RARRAY_LEN(ary);
-	if (nlen < len) {
-	    len = nlen;
+	rb_yield(RARRAY(ary)->ptr[len]);
+	if (RARRAY(ary)->len < len) {
+	    len = RARRAY(ary)->len;
 	}
     }
     return ary;
@@ -1890,879 +1191,555 @@ rb_ary_reverse_each(VALUE ary)
 
 /*
  *  call-seq:
- *     ary.length -> int
- *
- *  Returns the number of elements in +self+. May be zero.
- *
+ *     array.length -> int
+ *  
+ *  Returns the number of elements in <i>self</i>. May be zero.
+ *     
  *     [ 1, 2, 3, 4, 5 ].length   #=> 5
- *     [].length                  #=> 0
  */
 
 static VALUE
-rb_ary_length(VALUE ary)
+rb_ary_length(ary)
+    VALUE ary;
 {
-    long len = RARRAY_LEN(ary);
-    return LONG2NUM(len);
+    return LONG2NUM(RARRAY(ary)->len);
 }
 
 /*
  *  call-seq:
- *     ary.empty?   -> true or false
- *
- *  Returns +true+ if +self+ contains no elements.
- *
+ *     array.empty?   -> true or false
+ *  
+ *  Returns <code>true</code> if <i>self</i> array contains no elements.
+ *     
  *     [].empty?   #=> true
  */
 
 static VALUE
-rb_ary_empty_p(VALUE ary)
+rb_ary_empty_p(ary)
+    VALUE ary;
 {
-    if (RARRAY_LEN(ary) == 0)
+    if (RARRAY(ary)->len == 0)
 	return Qtrue;
     return Qfalse;
 }
 
 VALUE
-rb_ary_dup(VALUE ary)
+rb_ary_dup(ary)
+    VALUE ary;
 {
-    long len = RARRAY_LEN(ary);
-    VALUE dup = rb_ary_new2(len);
-    ary_memcpy(dup, 0, len, RARRAY_CONST_PTR(ary));
-    ARY_SET_LEN(dup, len);
-    return dup;
-}
+    VALUE dup = rb_ary_new2(RARRAY(ary)->len);
 
-VALUE
-rb_ary_resurrect(VALUE ary)
-{
-    return rb_ary_new4(RARRAY_LEN(ary), RARRAY_CONST_PTR(ary));
+    DUPSETUP(dup, ary);
+    MEMCPY(RARRAY(dup)->ptr, RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
+    RARRAY(dup)->len = RARRAY(ary)->len;
+    return dup;
 }
 
 extern VALUE rb_output_fs;
 
-static void ary_join_1(VALUE obj, VALUE ary, VALUE sep, long i, VALUE result, int *first);
-
 static VALUE
-recursive_join(VALUE obj, VALUE argp, int recur)
-{
-    VALUE *arg = (VALUE *)argp;
-    VALUE ary = arg[0];
-    VALUE sep = arg[1];
-    VALUE result = arg[2];
-    int *first = (int *)arg[3];
-
-    if (recur) {
-	rb_raise(rb_eArgError, "recursive array join");
-    }
-    else {
-	ary_join_1(obj, ary, sep, 0, result, first);
-    }
-    return Qnil;
-}
-
-static void
-ary_join_0(VALUE ary, VALUE sep, long max, VALUE result)
+inspect_join(ary, arg)
+    VALUE ary;
+    VALUE *arg;
 {
-    long i;
-    VALUE val;
-
-    if (max > 0) rb_enc_copy(result, RARRAY_AREF(ary, 0));
-    for (i=0; i<max; i++) {
-	val = RARRAY_AREF(ary, i);
-	if (i > 0 && !NIL_P(sep))
-	    rb_str_buf_append(result, sep);
-	rb_str_buf_append(result, val);
-	if (OBJ_TAINTED(val)) OBJ_TAINT(result);
-    }
+    return rb_ary_join(arg[0], arg[1]);
 }
 
-static void
-ary_join_1(VALUE obj, VALUE ary, VALUE sep, long i, VALUE result, int *first)
+VALUE
+rb_ary_join(ary, sep)
+    VALUE ary, sep;
 {
-    VALUE val, tmp;
+    long len = 1, i;
+    int taint = Qfalse;
+    VALUE result, tmp;
 
-    for (; i<RARRAY_LEN(ary); i++) {
-	if (i > 0 && !NIL_P(sep))
-	    rb_str_buf_append(result, sep);
+    if (RARRAY(ary)->len == 0) return rb_str_new(0, 0);
+    if (OBJ_TAINTED(ary) || OBJ_TAINTED(sep)) taint = Qtrue;
 
-	val = RARRAY_AREF(ary, i);
-	if (RB_TYPE_P(val, T_STRING)) {
-	  str_join:
-	    rb_str_buf_append(result, val);
-	    *first = FALSE;
-	}
-	else if (RB_TYPE_P(val, T_ARRAY)) {
-	    obj = val;
-	  ary_join:
-	    if (val == ary) {
-		rb_raise(rb_eArgError, "recursive array join");
+    for (i=0; i<RARRAY(ary)->len; i++) {
+	tmp = rb_check_string_type(RARRAY(ary)->ptr[i]);
+	len += NIL_P(tmp) ? 10 : RSTRING(tmp)->len;
+    }
+    if (!NIL_P(sep)) {
+	StringValue(sep);
+	len += RSTRING(sep)->len * (RARRAY(ary)->len - 1);
+    }
+    result = rb_str_buf_new(len);
+    for (i=0; i<RARRAY(ary)->len; i++) {
+	tmp = RARRAY(ary)->ptr[i];
+	switch (TYPE(tmp)) {
+	  case T_STRING:
+	    break;
+	  case T_ARRAY:
+	    if (rb_inspecting_p(tmp)) {
+		tmp = rb_str_new2("[...]");
 	    }
 	    else {
-		VALUE args[4];
+		VALUE args[2];
 
-		args[0] = val;
+		args[0] = tmp;
 		args[1] = sep;
-		args[2] = result;
-		args[3] = (VALUE)first;
-		rb_exec_recursive(recursive_join, obj, (VALUE)args);
-	    }
-	}
-	else {
-	    tmp = rb_check_string_type(val);
-	    if (!NIL_P(tmp)) {
-		val = tmp;
-		goto str_join;
+		tmp = rb_protect_inspect(inspect_join, ary, (VALUE)args);
 	    }
-	    tmp = rb_check_convert_type(val, T_ARRAY, "Array", "to_ary");
-	    if (!NIL_P(tmp)) {
-		obj = val;
-		val = tmp;
-		goto ary_join;
-	    }
-	    val = rb_obj_as_string(val);
-	    if (*first) {
-		rb_enc_copy(result, val);
-		*first = FALSE;
-	    }
-	    goto str_join;
-	}
-    }
-}
-
-VALUE
-rb_ary_join(VALUE ary, VALUE sep)
-{
-    long len = 1, i;
-    int taint = FALSE;
-    VALUE val, tmp, result;
-
-    if (RARRAY_LEN(ary) == 0) return rb_usascii_str_new(0, 0);
-    if (OBJ_TAINTED(ary)) taint = TRUE;
-
-    if (!NIL_P(sep)) {
-	StringValue(sep);
-	len += RSTRING_LEN(sep) * (RARRAY_LEN(ary) - 1);
-    }
-    for (i=0; i<RARRAY_LEN(ary); i++) {
-	val = RARRAY_AREF(ary, i);
-	tmp = rb_check_string_type(val);
-
-	if (NIL_P(tmp) || tmp != val) {
-	    int first;
-	    result = rb_str_buf_new(len + (RARRAY_LEN(ary)-i)*10);
-	    rb_enc_associate(result, rb_usascii_encoding());
-	    if (taint) OBJ_TAINT(result);
-	    ary_join_0(ary, sep, i, result);
-	    first = i == 0;
-	    ary_join_1(ary, ary, sep, i, result, &first);
-	    return result;
+	    break;
+	  default:
+	    tmp = rb_obj_as_string(tmp);
 	}
-
-	len += RSTRING_LEN(tmp);
+	if (i > 0 && !NIL_P(sep))
+	    rb_str_buf_append(result, sep);
+	rb_str_buf_append(result, tmp);
+	if (OBJ_TAINTED(tmp)) taint = Qtrue;
     }
 
-    result = rb_str_buf_new(len);
     if (taint) OBJ_TAINT(result);
-    ary_join_0(ary, sep, RARRAY_LEN(ary), result);
-
     return result;
 }
 
 /*
  *  call-seq:
- *     ary.join(separator=$,)    -> str
- *
+ *     array.join(sep=$,)    -> str
+ *  
  *  Returns a string created by converting each element of the array to
- *  a string, separated by the given +separator+.
- *  If the +separator+ is +nil+, it uses current $,.
- *  If both the +separator+ and $, are nil, it uses empty string.
- *
+ *  a string, separated by <i>sep</i>.
+ *     
  *     [ "a", "b", "c" ].join        #=> "abc"
  *     [ "a", "b", "c" ].join("-")   #=> "a-b-c"
  */
 
 static VALUE
-rb_ary_join_m(int argc, VALUE *argv, VALUE ary)
+rb_ary_join_m(argc, argv, ary)
+    int argc;
+    VALUE *argv;
+    VALUE ary;
 {
     VALUE sep;
 
     rb_scan_args(argc, argv, "01", &sep);
     if (NIL_P(sep)) sep = rb_output_fs;
-
+    
     return rb_ary_join(ary, sep);
 }
 
-static VALUE
-inspect_ary(VALUE ary, VALUE dummy, int recur)
-{
-    int tainted = OBJ_TAINTED(ary);
-    long i;
-    VALUE s, str;
-
-    if (recur) return rb_usascii_str_new_cstr("[...]");
-    str = rb_str_buf_new2("[");
-    for (i=0; i<RARRAY_LEN(ary); i++) {
-	s = rb_inspect(RARRAY_AREF(ary, i));
-	if (OBJ_TAINTED(s)) tainted = TRUE;
-	if (i > 0) rb_str_buf_cat2(str, ", ");
-	else rb_enc_copy(str, s);
-	rb_str_buf_append(str, s);
-    }
-    rb_str_buf_cat2(str, "]");
-    if (tainted) OBJ_TAINT(str);
-    return str;
-}
-
 /*
  *  call-seq:
- *     ary.inspect  -> string
- *     ary.to_s     -> string
+ *     array.to_s -> string
+ *  
+ *  Returns _self_<code>.join</code>.
+ *     
+ *     [ "a", "e", "i", "o" ].to_s   #=> "aeio"
  *
- *  Creates a string representation of +self+.
- *
- *     [ "a", "b", "c" ].to_s     #=> "[\"a\", \"b\", \"c\"]"
  */
 
-static VALUE
-rb_ary_inspect(VALUE ary)
-{
-    if (RARRAY_LEN(ary) == 0) return rb_usascii_str_new2("[]");
-    return rb_exec_recursive(inspect_ary, ary, 0);
-}
-
 VALUE
-rb_ary_to_s(VALUE ary)
+rb_ary_to_s(ary)
+    VALUE ary;
 {
-    return rb_ary_inspect(ary);
+    if (RARRAY(ary)->len == 0) return rb_str_new(0, 0);
+    
+    return rb_ary_join(ary, rb_output_fs);
 }
 
-/*
- *  call-seq:
- *     ary.to_a     -> ary
- *
- *  Returns +self+.
- *
- *  If called on a subclass of Array, converts the receiver to an Array object.
- */
+static ID inspect_key;
+
+struct inspect_arg {
+    VALUE (*func)();
+    VALUE arg1, arg2;
+};
 
 static VALUE
-rb_ary_to_a(VALUE ary)
+inspect_call(arg)
+    struct inspect_arg *arg;
 {
-    if (rb_obj_class(ary) != rb_cArray) {
-	VALUE dup = rb_ary_new2(RARRAY_LEN(ary));
-	rb_ary_replace(dup, ary);
-	return dup;
-    }
-    return ary;
+    return (*arg->func)(arg->arg1, arg->arg2);
 }
 
-/*
- *  call-seq:
- *     ary.to_h     -> hash
- *
- *  Returns the result of interpreting <i>ary</i> as an array of
- *  <tt>[key, value]</tt> pairs.
- *
- *     [[:foo, :bar], [1, 2]].to_h
- *       # => {:foo => :bar, 1 => 2}
- */
-
 static VALUE
-rb_ary_to_h(VALUE ary)
+get_inspect_tbl(create)
+    int create;
 {
-    long i;
-    VALUE hash = rb_hash_new();
-    for (i=0; i<RARRAY_LEN(ary); i++) {
-	const VALUE elt = rb_ary_elt(ary, i);
-	const VALUE key_value_pair = rb_check_array_type(elt);
-	if (NIL_P(key_value_pair)) {
-	    rb_raise(rb_eTypeError, "wrong element type %"PRIsVALUE" at %ld (expected array)",
-		     rb_obj_class(elt), i);
-	}
-	if (RARRAY_LEN(key_value_pair) != 2) {
-	    rb_raise(rb_eArgError, "wrong array length at %ld (expected 2, was %ld)",
-		i, RARRAY_LEN(key_value_pair));
+    VALUE inspect_tbl = rb_thread_local_aref(rb_thread_current(), inspect_key);
+
+    if (NIL_P(inspect_tbl)) {
+	if (create) {
+	  tbl_init:
+	    inspect_tbl = rb_ary_new();
+	    rb_thread_local_aset(rb_thread_current(), inspect_key, inspect_tbl);
 	}
-	rb_hash_aset(hash, RARRAY_AREF(key_value_pair, 0), RARRAY_AREF(key_value_pair, 1));
     }
-    return hash;
+    else if (TYPE(inspect_tbl) != T_ARRAY) {
+	rb_warn("invalid inspect_tbl value");
+	if (create) goto tbl_init;
+	rb_thread_local_aset(rb_thread_current(), inspect_key, Qnil);
+	return Qnil;
+    }
+    return inspect_tbl;
 }
 
-/*
- *  call-seq:
- *     ary.to_ary -> ary
- *
- *  Returns +self+.
- */
-
 static VALUE
-rb_ary_to_ary_m(VALUE ary)
+inspect_ensure(obj)
+    VALUE obj;
 {
-    return ary;
+    VALUE inspect_tbl;
+
+    inspect_tbl = get_inspect_tbl(Qfalse);
+    if (!NIL_P(inspect_tbl)) {
+	rb_ary_pop(inspect_tbl);
+    }
+    return 0;
 }
 
-static void
-ary_reverse(VALUE *p1, VALUE *p2)
+VALUE
+rb_protect_inspect(func, obj, arg)
+    VALUE (*func)(ANYARGS);
+    VALUE obj, arg;
 {
-    while (p1 < p2) {
-	VALUE tmp = *p1;
-	*p1++ = *p2;
-	*p2-- = tmp;
+    struct inspect_arg iarg;
+    VALUE inspect_tbl;
+    VALUE id;
+
+    inspect_tbl = get_inspect_tbl(Qtrue);
+    id = rb_obj_id(obj);
+    if (rb_ary_includes(inspect_tbl, id)) {
+	return (*func)(obj, arg);
     }
+    rb_ary_push(inspect_tbl, id);
+    iarg.func = func;
+    iarg.arg1 = obj;
+    iarg.arg2 = arg;
+
+    return rb_ensure(inspect_call, (VALUE)&iarg, inspect_ensure, obj);
 }
 
 VALUE
-rb_ary_reverse(VALUE ary)
+rb_inspecting_p(obj)
+    VALUE obj;
 {
-    VALUE *p2;
-    long len = RARRAY_LEN(ary);
+    VALUE inspect_tbl;
 
-    rb_ary_modify(ary);
-    if (len > 1) {
-	RARRAY_PTR_USE(ary, p1, {
-	    p2 = p1 + len - 1;	/* points last item */
-	    ary_reverse(p1, p2);
-	}); /* WB: no new reference */
+    inspect_tbl = get_inspect_tbl(Qfalse);
+    if (NIL_P(inspect_tbl)) return Qfalse;
+    return rb_ary_includes(inspect_tbl, rb_obj_id(obj));
+}
+
+static VALUE
+inspect_ary(ary)
+    VALUE ary;
+{
+    int tainted = OBJ_TAINTED(ary);
+    long i;
+    VALUE s, str;
+
+    str = rb_str_buf_new2("[");
+    for (i=0; i<RARRAY(ary)->len; i++) {
+	s = rb_inspect(RARRAY(ary)->ptr[i]);
+	if (OBJ_TAINTED(s)) tainted = Qtrue;
+	if (i > 0) rb_str_buf_cat2(str, ", ");
+	rb_str_buf_append(str, s);
     }
-    return ary;
+    rb_str_buf_cat2(str, "]");
+    if (tainted) OBJ_TAINT(str);
+    return str;
 }
 
 /*
  *  call-seq:
- *     ary.reverse!   -> ary
- *
- *  Reverses +self+ in place.
+ *     array.inspect  -> string
  *
- *     a = [ "a", "b", "c" ]
- *     a.reverse!       #=> ["c", "b", "a"]
- *     a                #=> ["c", "b", "a"]
+ *  Create a printable version of <i>array</i>.
  */
 
 static VALUE
-rb_ary_reverse_bang(VALUE ary)
+rb_ary_inspect(ary)
+    VALUE ary;
 {
-    return rb_ary_reverse(ary);
+    if (RARRAY(ary)->len == 0) return rb_str_new2("[]");
+    if (rb_inspecting_p(ary)) return rb_str_new2("[...]");
+    return rb_protect_inspect(inspect_ary, ary, 0);
 }
 
 /*
  *  call-seq:
- *     ary.reverse    -> new_ary
- *
- *  Returns a new array containing +self+'s elements in reverse order.
- *
- *     [ "a", "b", "c" ].reverse   #=> ["c", "b", "a"]
- *     [ 1 ].reverse               #=> [1]
+ *     array.to_a     -> array
+ *  
+ *  Returns _self_. If called on a subclass of Array, converts
+ *  the receiver to an Array object.
  */
 
 static VALUE
-rb_ary_reverse_m(VALUE ary)
+rb_ary_to_a(ary)
+    VALUE ary;
 {
-    long len = RARRAY_LEN(ary);
-    VALUE dup = rb_ary_new2(len);
-
-    if (len > 0) {
-	const VALUE *p1 = RARRAY_CONST_PTR(ary);
-	VALUE *p2 = (VALUE *)RARRAY_CONST_PTR(dup) + len - 1;
-	do *p2-- = *p1++; while (--len > 0);
+    if (rb_obj_class(ary) != rb_cArray) {
+	VALUE dup = rb_ary_new2(RARRAY(ary)->len);
+	rb_ary_replace(dup, ary);
+	return dup;
     }
-    ARY_SET_LEN(dup, RARRAY_LEN(ary));
-    return dup;
+    return ary;
 }
 
-static inline long
-rotate_count(long cnt, long len)
+/*
+ *  call-seq:
+ *     array.to_ary -> array
+ *  
+ *  Returns _self_.
+ */
+
+static VALUE
+rb_ary_to_ary_m(ary)
+    VALUE ary;
 {
-    return (cnt < 0) ? (len - (~cnt % len) - 1) : (cnt % len);
+    return ary;
 }
 
 VALUE
-rb_ary_rotate(VALUE ary, long cnt)
+rb_ary_reverse(ary)
+    VALUE ary;
 {
-    rb_ary_modify(ary);
+    VALUE *p1, *p2;
+    VALUE tmp;
 
-    if (cnt != 0) {
-	VALUE *ptr = RARRAY_PTR(ary);
-	long len = RARRAY_LEN(ary);
+    rb_ary_modify(ary);
+    if (RARRAY(ary)->len > 1) {
+	p1 = RARRAY(ary)->ptr;
+	p2 = p1 + RARRAY(ary)->len - 1;	/* points last item */
 
-	if (len > 0 && (cnt = rotate_count(cnt, len)) > 0) {
-	    --len;
-	    if (cnt < len) ary_reverse(ptr + cnt, ptr + len);
-	    if (--cnt > 0) ary_reverse(ptr, ptr + cnt);
-	    if (len > 0) ary_reverse(ptr, ptr + len);
-	    return ary;
+	while (p1 < p2) {
+	    tmp = *p1;
+	    *p1++ = *p2;
+	    *p2-- = tmp;
 	}
     }
-
-    return Qnil;
+    return ary;
 }
 
 /*
  *  call-seq:
- *     ary.rotate!(count=1)   -> ary
- *
- *  Rotates +self+ in place so that the element at +count+ comes first, and
- *  returns +self+.
- *
- *  If +count+ is negative then it rotates in the opposite direction, starting
- *  from the end of the array where +-1+ is the last element.
- *
- *     a = [ "a", "b", "c", "d" ]
- *     a.rotate!        #=> ["b", "c", "d", "a"]
- *     a                #=> ["b", "c", "d", "a"]
- *     a.rotate!(2)     #=> ["d", "a", "b", "c"]
- *     a.rotate!(-3)    #=> ["a", "b", "c", "d"]
+ *     array.reverse!   -> array 
+ *  
+ *  Reverses _self_ in place.
+ *     
+ *     a = [ "a", "b", "c" ]
+ *     a.reverse!       #=> ["c", "b", "a"]
+ *     a                #=> ["c", "b", "a"]
  */
 
 static VALUE
-rb_ary_rotate_bang(int argc, VALUE *argv, VALUE ary)
+rb_ary_reverse_bang(ary)
+    VALUE ary;
 {
-    long n = 1;
-
-    switch (argc) {
-      case 1: n = NUM2LONG(argv[0]);
-      case 0: break;
-      default: rb_scan_args(argc, argv, "01", NULL);
-    }
-    rb_ary_rotate(ary, n);
-    return ary;
+    return rb_ary_reverse(ary);
 }
 
 /*
  *  call-seq:
- *     ary.rotate(count=1)    -> new_ary
- *
- *  Returns a new array by rotating +self+ so that the element at +count+ is
- *  the first element of the new array.
- *
- *  If +count+ is negative then it rotates in the opposite direction, starting
- *  from the end of +self+ where +-1+ is the last element.
- *
- *     a = [ "a", "b", "c", "d" ]
- *     a.rotate         #=> ["b", "c", "d", "a"]
- *     a                #=> ["a", "b", "c", "d"]
- *     a.rotate(2)      #=> ["c", "d", "a", "b"]
- *     a.rotate(-3)     #=> ["b", "c", "d", "a"]
+ *     array.reverse -> an_array
+ *  
+ *  Returns a new array containing <i>self</i>'s elements in reverse order.
+ *     
+ *     [ "a", "b", "c" ].reverse   #=> ["c", "b", "a"]
+ *     [ 1 ].reverse               #=> [1]
  */
 
 static VALUE
-rb_ary_rotate_m(int argc, VALUE *argv, VALUE ary)
+rb_ary_reverse_m(ary)
+    VALUE ary;
 {
-    VALUE rotated;
-    const VALUE *ptr;
-    long len, cnt = 1;
-
-    switch (argc) {
-      case 1: cnt = NUM2LONG(argv[0]);
-      case 0: break;
-      default: rb_scan_args(argc, argv, "01", NULL);
-    }
-
-    len = RARRAY_LEN(ary);
-    rotated = rb_ary_new2(len);
-    if (len > 0) {
-	cnt = rotate_count(cnt, len);
-	ptr = RARRAY_CONST_PTR(ary);
-	len -= cnt;
-	ary_memcpy(rotated, 0, len, ptr + cnt);
-	ary_memcpy(rotated, len, cnt, ptr);
-    }
-    ARY_SET_LEN(rotated, RARRAY_LEN(ary));
-    return rotated;
+    return rb_ary_reverse(rb_ary_dup(ary));
 }
 
 struct ary_sort_data {
     VALUE ary;
-    struct cmp_opt_data cmp_opt;
+    VALUE *ptr;
+    long len;
 };
 
-static VALUE
-sort_reentered(VALUE ary)
+static void
+ary_sort_check(data)
+    struct ary_sort_data *data;
 {
-    if (RBASIC(ary)->klass) {
-	rb_raise(rb_eRuntimeError, "sort reentered");
+    if (RARRAY(data->ary)->ptr != data->ptr || RARRAY(data->ary)->len != data->len) {
+	rb_raise(rb_eArgError, "array modified during sort");
     }
-    return Qnil;
 }
 
 static int
-sort_1(const void *ap, const void *bp, void *dummy)
+sort_1(a, b, data)
+    VALUE *a, *b;
+    struct ary_sort_data *data;
 {
-    struct ary_sort_data *data = dummy;
-    VALUE retval = sort_reentered(data->ary);
-    VALUE a = *(const VALUE *)ap, b = *(const VALUE *)bp;
+    VALUE retval = rb_yield_values(2, *a, *b);
     int n;
 
-    retval = rb_yield_values(2, a, b);
-    n = rb_cmpint(retval, a, b);
-    sort_reentered(data->ary);
+    n = rb_cmpint(retval, *a, *b);
+    ary_sort_check(data);
     return n;
 }
 
 static int
-sort_2(const void *ap, const void *bp, void *dummy)
+sort_2(ap, bp, data)
+    VALUE *ap, *bp;
+    struct ary_sort_data *data;
 {
-    struct ary_sort_data *data = dummy;
-    VALUE retval = sort_reentered(data->ary);
-    VALUE a = *(const VALUE *)ap, b = *(const VALUE *)bp;
+    VALUE retval;
+    VALUE a = *ap, b = *bp;
     int n;
 
-    if (FIXNUM_P(a) && FIXNUM_P(b) && CMP_OPTIMIZABLE(data->cmp_opt, Fixnum)) {
+    if (FIXNUM_P(a) && FIXNUM_P(b)) {
 	if ((long)a > (long)b) return 1;
 	if ((long)a < (long)b) return -1;
 	return 0;
     }
-    if (STRING_P(a) && STRING_P(b) && CMP_OPTIMIZABLE(data->cmp_opt, String)) {
-	return rb_str_cmp(a, b);
+    if (TYPE(a) == T_STRING) {
+	if (TYPE(b) == T_STRING) return rb_str_cmp(a, b);
     }
 
-    retval = rb_funcallv(a, id_cmp, 1, &b);
+    retval = rb_funcall(a, id_cmp, 1, b);
     n = rb_cmpint(retval, a, b);
-    sort_reentered(data->ary);
+    ary_sort_check(data);
 
     return n;
 }
 
-/*
- *  call-seq:
- *     ary.sort!                   -> ary
- *     ary.sort! { |a, b| block }  -> ary
- *
- *  Sorts +self+ in place.
- *
- *  Comparisons for the sort will be done using the <code><=></code> operator
- *  or using an optional code block.
- *
- *  The block must implement a comparison between +a+ and +b+ and return
- *  an integer less than 0 when +b+ follows +a+, +0+ when +a+ and +b+
- *  are equivalent, or an integer greater than 0 when +a+ follows +b+.
- *
- *  See also Enumerable#sort_by.
- *
- *     a = [ "d", "a", "e", "c", "b" ]
- *     a.sort!                    #=> ["a", "b", "c", "d", "e"]
- *     a.sort! { |x,y| y <=> x }  #=> ["e", "d", "c", "b", "a"]
- */
-
-VALUE
-rb_ary_sort_bang(VALUE ary)
+static VALUE
+sort_internal(ary)
+    VALUE ary;
 {
-    rb_ary_modify(ary);
-    assert(!ARY_SHARED_P(ary));
-    if (RARRAY_LEN(ary) > 1) {
-	VALUE tmp = ary_make_substitution(ary); /* only ary refers tmp */
-	struct ary_sort_data data;
-	long len = RARRAY_LEN(ary);
-
-	RBASIC_CLEAR_CLASS(tmp);
-	data.ary = tmp;
-	data.cmp_opt.opt_methods = 0;
-	data.cmp_opt.opt_inited = 0;
-	RARRAY_PTR_USE(tmp, ptr, {
-	    ruby_qsort(ptr, len, sizeof(VALUE),
-		       rb_block_given_p()?sort_1:sort_2, &data);
-	}); /* WB: no new reference */
-	rb_ary_modify(ary);
-        if (ARY_EMBED_P(tmp)) {
-            if (ARY_SHARED_P(ary)) { /* ary might be destructively operated in the given block */
-                rb_ary_unshare(ary);
-		FL_SET_EMBED(ary);
-            }
-	    ary_memcpy(ary, 0, ARY_EMBED_LEN(tmp), ARY_EMBED_PTR(tmp));
-            ARY_SET_LEN(ary, ARY_EMBED_LEN(tmp));
-        }
-        else {
-            if (!ARY_EMBED_P(ary) && ARY_HEAP_PTR(ary) == ARY_HEAP_PTR(tmp)) {
-                FL_UNSET_SHARED(ary);
-                ARY_SET_CAPA(ary, RARRAY_LEN(tmp));
-            }
-            else {
-                assert(!ARY_SHARED_P(tmp));
-                if (ARY_EMBED_P(ary)) {
-                    FL_UNSET_EMBED(ary);
-                }
-                else if (ARY_SHARED_P(ary)) {
-                    /* ary might be destructively operated in the given block */
-                    rb_ary_unshare(ary);
-                }
-                else {
-		    ruby_sized_xfree((void *)ARY_HEAP_PTR(ary), ARY_HEAP_SIZE(ary));
-                }
-                ARY_SET_PTR(ary, RARRAY_CONST_PTR(tmp));
-                ARY_SET_HEAP_LEN(ary, len);
-                ARY_SET_CAPA(ary, RARRAY_LEN(tmp));
-            }
-            /* tmp was lost ownership for the ptr */
-            FL_UNSET(tmp, FL_FREEZE);
-            FL_SET_EMBED(tmp);
-            ARY_SET_EMBED_LEN(tmp, 0);
-            FL_SET(tmp, FL_FREEZE);
-	}
-        /* tmp will be GC'ed. */
-        RBASIC_SET_CLASS_RAW(tmp, rb_cArray); /* rb_cArray must be marked */
-    }
-    return ary;
-}
+    struct ary_sort_data data;
 
-/*
- *  call-seq:
- *     ary.sort                   -> new_ary
- *     ary.sort { |a, b| block }  -> new_ary
- *
- *  Returns a new array created by sorting +self+.
- *
- *  Comparisons for the sort will be done using the <code><=></code> operator
- *  or using an optional code block.
- *
- *  The block must implement a comparison between +a+ and +b+ and return
- *  an integer less than 0 when +b+ follows +a+, +0+ when +a+ and +b+
- *  are equivalent, or an integer greater than 0 when +a+ follows +b+.
- *
- *
- *  See also Enumerable#sort_by.
- *
- *     a = [ "d", "a", "e", "c", "b" ]
- *     a.sort                    #=> ["a", "b", "c", "d", "e"]
- *     a.sort { |x,y| y <=> x }  #=> ["e", "d", "c", "b", "a"]
- */
-
-VALUE
-rb_ary_sort(VALUE ary)
-{
-    ary = rb_ary_dup(ary);
-    rb_ary_sort_bang(ary);
+    data.ary = ary;
+    data.ptr = RARRAY(ary)->ptr; data.len = RARRAY(ary)->len;
+    qsort(RARRAY(ary)->ptr, RARRAY(ary)->len, sizeof(VALUE),
+	  rb_block_given_p()?sort_1:sort_2, &data);
     return ary;
 }
 
-static VALUE rb_ary_bsearch_index(VALUE ary);
-
-/*
- *  call-seq:
- *     ary.bsearch {|x| block }  -> elem
- *
- *  By using binary search, finds a value from this array which meets
- *  the given condition in O(log n) where n is the size of the array.
- *
- *  You can use this method in two use cases: a find-minimum mode and
- *  a find-any mode.  In either case, the elements of the array must be
- *  monotone (or sorted) with respect to the block.
- *
- *  In find-minimum mode (this is a good choice for typical use case),
- *  the block must return true or false, and there must be an index i
- *  (0 <= i <= ary.size) so that:
- *
- *  - the block returns false for any element whose index is less than
- *    i, and
- *  - the block returns true for any element whose index is greater
- *    than or equal to i.
- *
- *  This method returns the i-th element.  If i is equal to ary.size,
- *  it returns nil.
- *
- *     ary = [0, 4, 7, 10, 12]
- *     ary.bsearch {|x| x >=   4 } #=> 4
- *     ary.bsearch {|x| x >=   6 } #=> 7
- *     ary.bsearch {|x| x >=  -1 } #=> 0
- *     ary.bsearch {|x| x >= 100 } #=> nil
- *
- *  In find-any mode (this behaves like libc's bsearch(3)), the block
- *  must return a number, and there must be two indices i and j
- *  (0 <= i <= j <= ary.size) so that:
- *
- *  - the block returns a positive number for ary[k] if 0 <= k < i,
- *  - the block returns zero for ary[k] if i <= k < j, and
- *  - the block returns a negative number for ary[k] if
- *    j <= k < ary.size.
- *
- *  Under this condition, this method returns any element whose index
- *  is within i...j.  If i is equal to j (i.e., there is no element
- *  that satisfies the block), this method returns nil.
- *
- *     ary = [0, 4, 7, 10, 12]
- *     # try to find v such that 4 <= v < 8
- *     ary.bsearch {|x| 1 - x / 4 } #=> 4 or 7
- *     # try to find v such that 8 <= v < 10
- *     ary.bsearch {|x| 4 - x / 2 } #=> nil
- *
- *  You must not mix the two modes at a time; the block must always
- *  return either true/false, or always return a number.  It is
- *  undefined which value is actually picked up at each iteration.
- */
-
 static VALUE
-rb_ary_bsearch(VALUE ary)
+sort_unlock(ary)
+    VALUE ary;
 {
-    VALUE index_result = rb_ary_bsearch_index(ary);
-
-    if (FIXNUM_P(index_result)) {
-	return rb_ary_entry(ary, FIX2LONG(index_result));
-    }
-    return index_result;
+    FL_UNSET(ary, ARY_TMPLOCK);
+    return ary;
 }
 
 /*
  *  call-seq:
- *     ary.bsearch_index {|x| block }  -> int or nil
- *
- *  By using binary search, finds an index of a value from this array which
- *  meets the given condition in O(log n) where n is the size of the array.
- *
- *  It supports two modes, depending on the nature of the block and they are
- *  exactly the same as in the case of #bsearch method with the only difference
- *  being that this method returns the index of the element instead of the
- *  element itself. For more details consult the documentation for #bsearch.
+ *     array.sort!                   -> array
+ *     array.sort! {| a,b | block }  -> array 
+ *  
+ *  Sorts _self_. Comparisons for
+ *  the sort will be done using the <code><=></code> operator or using
+ *  an optional code block. The block implements a comparison between
+ *  <i>a</i> and <i>b</i>, returning -1, 0, or +1. See also
+ *  <code>Enumerable#sort_by</code>.
+ *     
+ *     a = [ "d", "a", "e", "c", "b" ]
+ *     a.sort                    #=> ["a", "b", "c", "d", "e"]
+ *     a.sort {|x,y| y <=> x }   #=> ["e", "d", "c", "b", "a"]
  */
 
-static VALUE
-rb_ary_bsearch_index(VALUE ary)
+VALUE
+rb_ary_sort_bang(ary)
+    VALUE ary;
 {
-    long low = 0, high = RARRAY_LEN(ary), mid;
-    int smaller = 0, satisfied = 0;
-    VALUE v, val;
-
-    RETURN_ENUMERATOR(ary, 0, 0);
-    while (low < high) {
-	mid = low + ((high - low) / 2);
-	val = rb_ary_entry(ary, mid);
-	v = rb_yield(val);
-	if (FIXNUM_P(v)) {
-	    if (v == INT2FIX(0)) return INT2FIX(mid);
-	    smaller = (SIGNED_VALUE)v < 0; /* Fixnum preserves its sign-bit */
-	}
-	else if (v == Qtrue) {
-	    satisfied = 1;
-	    smaller = 1;
-	}
-	else if (v == Qfalse || v == Qnil) {
-	    smaller = 0;
-	}
-	else if (rb_obj_is_kind_of(v, rb_cNumeric)) {
-	    const VALUE zero = INT2FIX(0);
-	    switch (rb_cmpint(rb_funcallv(v, id_cmp, 1, &zero), v, zero)) {
-	      case 0: return INT2FIX(mid);
-	      case 1: smaller = 1; break;
-	      case -1: smaller = 0;
-	    }
-	}
-	else {
-	    rb_raise(rb_eTypeError, "wrong argument type %"PRIsVALUE
-		     " (must be numeric, true, false or nil)",
-		     rb_obj_class(v));
-	}
-	if (smaller) {
-	    high = mid;
-	}
-	else {
-	    low = mid + 1;
-	}
+    rb_ary_modify(ary);
+    if (RARRAY(ary)->len > 1) {
+	FL_SET(ary, ARY_TMPLOCK);	/* prohibit modification during sort */
+	rb_ensure(sort_internal, ary, sort_unlock, ary);
     }
-    if (!satisfied) return Qnil;
-    return INT2FIX(low);
-}
-
-
-static VALUE
-sort_by_i(RB_BLOCK_CALL_FUNC_ARGLIST(i, dummy))
-{
-    return rb_yield(i);
+    return ary;
 }
 
 /*
  *  call-seq:
- *     ary.sort_by! { |obj| block }    -> ary
- *     ary.sort_by!                    -> Enumerator
- *
- *  Sorts +self+ in place using a set of keys generated by mapping the
- *  values in +self+ through the given block.
- *
- *  If no block is given, an Enumerator is returned instead.
- *
+ *     array.sort                   -> an_array 
+ *     array.sort {| a,b | block }  -> an_array 
+ *  
+ *  Returns a new array created by sorting <i>self</i>. Comparisons for
+ *  the sort will be done using the <code><=></code> operator or using
+ *  an optional code block. The block implements a comparison between
+ *  <i>a</i> and <i>b</i>, returning -1, 0, or +1. See also
+ *  <code>Enumerable#sort_by</code>.
+ *     
+ *     a = [ "d", "a", "e", "c", "b" ]
+ *     a.sort                    #=> ["a", "b", "c", "d", "e"]
+ *     a.sort {|x,y| y <=> x }   #=> ["e", "d", "c", "b", "a"]
  */
 
-static VALUE
-rb_ary_sort_by_bang(VALUE ary)
+VALUE
+rb_ary_sort(ary)
+    VALUE ary;
 {
-    VALUE sorted;
-
-    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
-    rb_ary_modify(ary);
-    sorted = rb_block_call(ary, rb_intern("sort_by"), 0, 0, sort_by_i, 0);
-    rb_ary_replace(ary, sorted);
+    ary = rb_ary_dup(ary);
+    rb_ary_sort_bang(ary);
     return ary;
 }
 
-
 /*
  *  call-seq:
- *     ary.collect { |item| block }  -> new_ary
- *     ary.map     { |item| block }  -> new_ary
- *     ary.collect                   -> Enumerator
- *     ary.map                       -> Enumerator
- *
- *  Invokes the given block once for each element of +self+.
- *
- *  Creates a new array containing the values returned by the block.
- *
- *  See also Enumerable#collect.
- *
- *  If no block is given, an Enumerator is returned instead.
- *
+ *     array.collect {|item| block }  -> an_array
+ *     array.map     {|item| block }  -> an_array
+ *  
+ *  Invokes <i>block</i> once for each element of <i>self</i>. Creates a 
+ *  new array containing the values returned by the block.
+ *  See also <code>Enumerable#collect</code>.
+ *     
  *     a = [ "a", "b", "c", "d" ]
- *     a.collect { |x| x + "!" }         #=> ["a!", "b!", "c!", "d!"]
- *     a.map.with_index { |x, i| x * i } #=> ["", "b", "cc", "ddd"]
- *     a                                 #=> ["a", "b", "c", "d"]
+ *     a.collect {|x| x + "!" }   #=> ["a!", "b!", "c!", "d!"]
+ *     a                          #=> ["a", "b", "c", "d"]
  */
 
 static VALUE
-rb_ary_collect(VALUE ary)
+rb_ary_collect(ary)
+    VALUE ary;
 {
     long i;
     VALUE collect;
 
-    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
-    collect = rb_ary_new2(RARRAY_LEN(ary));
-    for (i = 0; i < RARRAY_LEN(ary); i++) {
-	rb_ary_push(collect, rb_yield(RARRAY_AREF(ary, i)));
+    if (!rb_block_given_p()) {
+	return rb_ary_new4(RARRAY(ary)->len, RARRAY(ary)->ptr);
+    }
+
+    collect = rb_ary_new2(RARRAY(ary)->len);
+    for (i = 0; i < RARRAY(ary)->len; i++) {
+	rb_ary_push(collect, rb_yield(RARRAY(ary)->ptr[i]));
     }
     return collect;
 }
 
-
-/*
+/* 
  *  call-seq:
- *     ary.collect! {|item| block }   -> ary
- *     ary.map!     {|item| block }   -> ary
- *     ary.collect!                   -> Enumerator
- *     ary.map!                       -> Enumerator
- *
- *  Invokes the given block once for each element of +self+, replacing the
- *  element with the value returned by the block.
- *
- *  See also Enumerable#collect.
- *
- *  If no block is given, an Enumerator is returned instead.
+ *     array.collect! {|item| block }   ->   array
+ *     array.map!     {|item| block }   ->   array
  *
+ *  Invokes the block once for each element of _self_, replacing the
+ *  element with the value returned by _block_.
+ *  See also <code>Enumerable#collect</code>.
+ *   
  *     a = [ "a", "b", "c", "d" ]
- *     a.map! {|x| x + "!" }
- *     a #=>  [ "a!", "b!", "c!", "d!" ]
- *     a.collect!.with_index {|x, i| x[0...i] }
- *     a #=>  ["", "b", "c!", "d!"]
+ *     a.collect! {|x| x + "!" }
+ *     a             #=>  [ "a!", "b!", "c!", "d!" ]
  */
 
 static VALUE
-rb_ary_collect_bang(VALUE ary)
+rb_ary_collect_bang(ary)
+    VALUE ary;
 {
     long i;
 
-    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
     rb_ary_modify(ary);
-    for (i = 0; i < RARRAY_LEN(ary); i++) {
-	rb_ary_store(ary, i, rb_yield(RARRAY_AREF(ary, i)));
+    for (i = 0; i < RARRAY(ary)->len; i++) {
+	rb_ary_store(ary, i, rb_yield(RARRAY(ary)->ptr[i]));
     }
     return ary;
 }
 
 VALUE
-rb_get_values_at(VALUE obj, long olen, int argc, const VALUE *argv, VALUE (*func) (VALUE, long))
+rb_values_at(obj, olen, argc, argv, func)
+    VALUE obj;
+    long olen;
+    int argc;
+    VALUE *argv;
+    VALUE (*func) _((VALUE,long));
 {
     VALUE result = rb_ary_new2(argc);
     long beg, len, i, j;
@@ -2773,13 +1750,15 @@ rb_get_values_at(VALUE obj, long olen, int argc, const VALUE *argv, VALUE (*func
 	    continue;
 	}
 	/* check if idx is Range */
-	if (rb_range_beg_len(argv[i], &beg, &len, olen, 1)) {
-	    long end = olen < beg+len ? olen : beg+len;
-	    for (j = beg; j < end; j++) {
-		rb_ary_push(result, (*func)(obj, j));
+	switch (rb_range_beg_len(argv[i], &beg, &len, olen, 0)) {
+	  case Qfalse:
+	    break;
+	  case Qnil:
+	    continue;
+	  default:
+	    for (j=0; j<len; j++) {
+		rb_ary_push(result, (*func)(obj, j+beg));
 	    }
-	    if (beg + len > j)
-		rb_ary_resize(result, RARRAY_LEN(result) + (beg + len) - j);
 	    continue;
 	}
 	rb_ary_push(result, (*func)(obj, NUM2LONG(argv[i])));
@@ -2787,188 +1766,69 @@ rb_get_values_at(VALUE obj, long olen, int argc, const VALUE *argv, VALUE (*func
     return result;
 }
 
-/*
+/* 
  *  call-seq:
- *     ary.values_at(selector, ...)  -> new_ary
- *
- *  Returns an array containing the elements in +self+ corresponding to the
- *  given +selector+(s).
- *
- *  The selectors may be either integer indices or ranges.
- *
- *  See also Array#select.
+ *     array.values_at(selector,... )  -> an_array
  *
+ *  Returns an array containing the elements in
+ *  _self_ corresponding to the given selector(s). The selectors
+ *  may be either integer indices or ranges. 
+ *  See also <code>Array#select</code>.
+ * 
  *     a = %w{ a b c d e f }
- *     a.values_at(1, 3, 5)          # => ["b", "d", "f"]
- *     a.values_at(1, 3, 5, 7)       # => ["b", "d", "f", nil]
- *     a.values_at(-1, -2, -2, -7)   # => ["f", "e", "e", nil]
- *     a.values_at(4..6, 3...6)      # => ["e", "f", nil, "d", "e", "f"]
+ *     a.values_at(1, 3, 5)
+ *     a.values_at(1, 3, 5, 7)
+ *     a.values_at(-1, -3, -5, -7)
+ *     a.values_at(1..3, 2...5)
  */
 
 static VALUE
-rb_ary_values_at(int argc, VALUE *argv, VALUE ary)
+rb_ary_values_at(argc, argv, ary)
+    int argc;
+    VALUE *argv;
+    VALUE ary;
 {
-    return rb_get_values_at(ary, RARRAY_LEN(ary), argc, argv, rb_ary_entry);
+    return rb_values_at(ary, RARRAY(ary)->len, argc, argv, rb_ary_entry);
 }
 
-
 /*
  *  call-seq:
- *     ary.select { |item| block } -> new_ary
- *     ary.select                  -> Enumerator
- *
- *  Returns a new array containing all elements of +ary+
- *  for which the given +block+ returns a true value.
- *
- *  If no block is given, an Enumerator is returned instead.
- *
- *     [1,2,3,4,5].select { |num|  num.even?  }   #=> [2, 4]
- *
+ *     array.select {|item| block } -> an_array
+ *  
+ *  Invokes the block passing in successive elements from <i>array</i>,
+ *  returning an array containing those elements for which the block
+ *  returns a true value (equivalent to <code>Enumerable#select</code>).
+ *     
  *     a = %w{ a b c d e f }
- *     a.select { |v| v =~ /[aeiou]/ }  #=> ["a", "e"]
- *
- *  See also Enumerable#select.
+ *     a.select {|v| v =~ /[aeiou]/}   #=> ["a", "e"]
  */
 
 static VALUE
-rb_ary_select(VALUE ary)
+rb_ary_select(ary)
+    VALUE ary;
 {
     VALUE result;
     long i;
 
-    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
-    result = rb_ary_new2(RARRAY_LEN(ary));
-    for (i = 0; i < RARRAY_LEN(ary); i++) {
-	if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) {
+    result = rb_ary_new2(RARRAY(ary)->len);
+    for (i = 0; i < RARRAY(ary)->len; i++) {
+	if (RTEST(rb_yield(RARRAY(ary)->ptr[i]))) {
 	    rb_ary_push(result, rb_ary_elt(ary, i));
 	}
     }
     return result;
 }
 
-struct select_bang_arg {
-    VALUE ary;
-    long len[2];
-};
-
-static VALUE
-select_bang_i(VALUE a)
-{
-    volatile struct select_bang_arg *arg = (void *)a;
-    VALUE ary = arg->ary;
-    long i1, i2;
-
-    for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); arg->len[0] = ++i1) {
-	VALUE v = RARRAY_AREF(ary, i1);
-	if (!RTEST(rb_yield(v))) continue;
-	if (i1 != i2) {
-	    rb_ary_store(ary, i2, v);
-	}
-	arg->len[1] = ++i2;
-    }
-    return (i1 == i2) ? Qnil : ary;
-}
-
-static VALUE
-select_bang_ensure(VALUE a)
-{
-    volatile struct select_bang_arg *arg = (void *)a;
-    VALUE ary = arg->ary;
-    long len = RARRAY_LEN(ary);
-    long i1 = arg->len[0], i2 = arg->len[1];
-
-    if (i2 < i1) {
-	if (i1 < len) {
-	    RARRAY_PTR_USE(ary, ptr, {
-		    MEMMOVE(ptr + i2, ptr + i1, VALUE, len - i1);
-		});
-	}
-	ARY_SET_LEN(ary, len - i1 + i2);
-    }
-    return ary;
-}
-
 /*
  *  call-seq:
- *     ary.select!  {|item| block } -> ary or nil
- *     ary.select!                  -> Enumerator
- *
- *  Invokes the given block passing in successive elements from +self+,
- *  deleting elements for which the block returns a +false+ value.
- *
- *  The array may not be changed instantly every time the block is called.
- *
- *  If changes were made, it will return +self+, otherwise it returns +nil+.
- *
- *  See also Array#keep_if
- *
- *  If no block is given, an Enumerator is returned instead.
- *
- */
-
-static VALUE
-rb_ary_select_bang(VALUE ary)
-{
-    struct select_bang_arg args;
-
-    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
-    rb_ary_modify(ary);
-
-    args.ary = ary;
-    args.len[0] = args.len[1] = 0;
-    return rb_ensure(select_bang_i, (VALUE)&args, select_bang_ensure, (VALUE)&args);
-}
-
-/*
- *  call-seq:
- *     ary.keep_if { |item| block } -> ary
- *     ary.keep_if                  -> Enumerator
- *
- *  Deletes every element of +self+ for which the given block evaluates to
- *  +false+.
- *
- *  See also Array#select!
- *
- *  If no block is given, an Enumerator is returned instead.
- *
- *     a = %w{ a b c d e f }
- *     a.keep_if { |v| v =~ /[aeiou]/ }  #=> ["a", "e"]
- */
-
-static VALUE
-rb_ary_keep_if(VALUE ary)
-{
-    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
-    rb_ary_select_bang(ary);
-    return ary;
-}
-
-static void
-ary_resize_smaller(VALUE ary, long len)
-{
-    rb_ary_modify(ary);
-    if (RARRAY_LEN(ary) > len) {
-	ARY_SET_LEN(ary, len);
-	if (len * 2 < ARY_CAPA(ary) &&
-	    ARY_CAPA(ary) > ARY_DEFAULT_SIZE) {
-	    ary_resize_capa(ary, len * 2);
-	}
-    }
-}
-
-/*
- *  call-seq:
- *     ary.delete(obj)            -> item or nil
- *     ary.delete(obj) { block }  -> item or result of block
- *
- *  Deletes all items from +self+ that are equal to +obj+.
- *
- *  Returns the last deleted item, or +nil+ if no matching item is found.
- *
- *  If the optional code block is given, the result of the block is returned if
- *  the item is not found.  (To remove +nil+ elements and get an informative
- *  return value, use Array#compact!)
- *
+ *     array.delete(obj)            -> obj or nil 
+ *     array.delete(obj) { block }  -> obj or nil
+ *  
+ *  Deletes items from <i>self</i> that are equal to <i>obj</i>. If
+ *  the item is not found, returns <code>nil</code>. If the optional
+ *  code block is given, returns the result of <i>block</i> if the item
+ *  is not found.
+ *     
  *     a = [ "a", "b", "b", "b", "c" ]
  *     a.delete("b")                   #=> "b"
  *     a                               #=> ["a", "c"]
@@ -2977,62 +1837,47 @@ ary_resize_smaller(VALUE ary, long len)
  */
 
 VALUE
-rb_ary_delete(VALUE ary, VALUE item)
+rb_ary_delete(ary, item)
+    VALUE ary;
+    VALUE item;
 {
-    VALUE v = item;
     long i1, i2;
 
-    for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); i1++) {
-	VALUE e = RARRAY_AREF(ary, i1);
+    for (i1 = i2 = 0; i1 < RARRAY(ary)->len; i1++) {
+	VALUE e = RARRAY(ary)->ptr[i1];
 
-	if (rb_equal(e, item)) {
-	    v = e;
-	    continue;
-	}
+	if (rb_equal(e, item)) continue;
 	if (i1 != i2) {
 	    rb_ary_store(ary, i2, e);
 	}
 	i2++;
     }
-    if (RARRAY_LEN(ary) == i2) {
+    if (RARRAY(ary)->len == i2) {
 	if (rb_block_given_p()) {
 	    return rb_yield(item);
 	}
 	return Qnil;
     }
 
-    ary_resize_smaller(ary, i2);
-
-    return v;
-}
-
-void
-rb_ary_delete_same(VALUE ary, VALUE item)
-{
-    long i1, i2;
-
-    for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); i1++) {
-	VALUE e = RARRAY_AREF(ary, i1);
-
-	if (e == item) {
-	    continue;
-	}
-	if (i1 != i2) {
-	    rb_ary_store(ary, i2, e);
+    rb_ary_modify(ary);
+    if (RARRAY(ary)->len > i2) {
+	RARRAY(ary)->len = i2;
+	if (i2 * 2 < RARRAY(ary)->aux.capa &&
+	    RARRAY(ary)->aux.capa > ARY_DEFAULT_SIZE) {
+	    REALLOC_N(RARRAY(ary)->ptr, VALUE, i2 * 2);
+	    RARRAY(ary)->aux.capa = i2 * 2;
 	}
-	i2++;
-    }
-    if (RARRAY_LEN(ary) == i2) {
-	return;
     }
 
-    ary_resize_smaller(ary, i2);
+    return item;
 }
 
 VALUE
-rb_ary_delete_at(VALUE ary, long pos)
+rb_ary_delete_at(ary, pos)
+    VALUE ary;
+    long pos;
 {
-    long len = RARRAY_LEN(ary);
+    long i, len = RARRAY(ary)->len;
     VALUE del;
 
     if (pos >= len) return Qnil;
@@ -3042,48 +1887,52 @@ rb_ary_delete_at(VALUE ary, long pos)
     }
 
     rb_ary_modify(ary);
-    del = RARRAY_AREF(ary, pos);
-    RARRAY_PTR_USE(ary, ptr, {
-	MEMMOVE(ptr+pos, ptr+pos+1, VALUE, len-pos-1);
-    });
-    ARY_INCREASE_LEN(ary, -1);
+    del = RARRAY(ary)->ptr[pos];
+    for (i = pos + 1; i < len; i++, pos++) {
+	RARRAY(ary)->ptr[pos] = RARRAY(ary)->ptr[i];
+    }
+    RARRAY(ary)->len = pos;
 
     return del;
 }
 
 /*
  *  call-seq:
- *     ary.delete_at(index)  -> obj or nil
- *
- *  Deletes the element at the specified +index+, returning that element, or
- *  +nil+ if the +index+ is out of range.
- *
- *  See also Array#slice!
- *
- *     a = ["ant", "bat", "cat", "dog"]
+ *     array.delete_at(index)  -> obj or nil
+ *  
+ *  Deletes the element at the specified index, returning that element,
+ *  or <code>nil</code> if the index is out of range. See also
+ *  <code>Array#slice!</code>.
+ *     
+ *     a = %w( ant bat cat dog )
  *     a.delete_at(2)    #=> "cat"
  *     a                 #=> ["ant", "bat", "dog"]
  *     a.delete_at(99)   #=> nil
  */
 
 static VALUE
-rb_ary_delete_at_m(VALUE ary, VALUE pos)
+rb_ary_delete_at_m(ary, pos)
+    VALUE ary, pos;
 {
     return rb_ary_delete_at(ary, NUM2LONG(pos));
 }
 
 /*
  *  call-seq:
- *     ary.slice!(index)         -> obj or nil
- *     ary.slice!(start, length) -> new_ary or nil
- *     ary.slice!(range)         -> new_ary or nil
- *
- *  Deletes the element(s) given by an +index+ (optionally up to +length+
- *  elements) or by a +range+.
- *
- *  Returns the deleted object (or objects), or +nil+ if the +index+ is out of
- *  range.
- *
+ *     array.slice!(index)         -> obj or nil
+ *     array.slice!(start, length) -> sub_array or nil
+ *     array.slice!(range)         -> sub_array or nil 
+ *  
+ *  Deletes the element(s) given by an index (optionally with a length)
+ *  or by a range. Returns the deleted object, subarray, or
+ *  <code>nil</code> if the index is out of range. Equivalent to:
+ *     
+ *     def slice!(*args)
+ *       result = self[*args]
+ *       self[*args] = nil
+ *       result
+ *     end
+ *     
  *     a = [ "a", "b", "c" ]
  *     a.slice!(1)     #=> "b"
  *     a               #=> ["a", "c"]
@@ -3094,312 +1943,194 @@ rb_ary_delete_at_m(VALUE ary, VALUE pos)
  */
 
 static VALUE
-rb_ary_slice_bang(int argc, VALUE *argv, VALUE ary)
+rb_ary_slice_bang(argc, argv, ary)
+    int argc;
+    VALUE *argv;
+    VALUE ary;
 {
     VALUE arg1, arg2;
-    long pos, len, orig_len;
+    long pos, len;
 
-    rb_ary_modify_check(ary);
-    if (argc == 2) {
-	pos = NUM2LONG(argv[0]);
-	len = NUM2LONG(argv[1]);
+    if (rb_scan_args(argc, argv, "11", &arg1, &arg2) == 2) {
+	pos = NUM2LONG(arg1);
+	len = NUM2LONG(arg2);
       delete_pos_len:
-	if (len < 0) return Qnil;
-	orig_len = RARRAY_LEN(ary);
 	if (pos < 0) {
-	    pos += orig_len;
-	    if (pos < 0) return Qnil;
-	}
-	else if (orig_len < pos) return Qnil;
-	if (orig_len < pos + len) {
-	    len = orig_len - pos;
+	    pos = RARRAY(ary)->len + pos;
 	}
-	if (len == 0) return rb_ary_new2(0);
-	arg2 = rb_ary_new4(len, RARRAY_CONST_PTR(ary)+pos);
-	RBASIC_SET_CLASS(arg2, rb_obj_class(ary));
-	rb_ary_splice(ary, pos, len, 0, 0);
+	arg2 = rb_ary_subseq(ary, pos, len);
+	rb_ary_splice(ary, pos, len, Qnil);	/* Qnil/rb_ary_new2(0) */
 	return arg2;
     }
 
-    if (argc != 1) {
-	/* error report */
-	rb_scan_args(argc, argv, "11", NULL, NULL);
-    }
-    arg1 = argv[0];
-
-    if (!FIXNUM_P(arg1)) {
-	switch (rb_range_beg_len(arg1, &pos, &len, RARRAY_LEN(ary), 0)) {
-	  case Qtrue:
-	    /* valid range */
-	    goto delete_pos_len;
-	  case Qnil:
-	    /* invalid range */
-	    return Qnil;
-	  default:
-	    /* not a range */
-	    break;
-	}
+    if (!FIXNUM_P(arg1) && rb_range_beg_len(arg1, &pos, &len, RARRAY(ary)->len, 1)) {
+	goto delete_pos_len;
     }
 
     return rb_ary_delete_at(ary, NUM2LONG(arg1));
 }
 
-static VALUE
-ary_reject(VALUE orig, VALUE result)
-{
-    long i;
-
-    for (i = 0; i < RARRAY_LEN(orig); i++) {
-	VALUE v = RARRAY_AREF(orig, i);
-	if (!RTEST(rb_yield(v))) {
-	    rb_ary_push(result, v);
-	}
-    }
-    return result;
-}
+/*
+ *  call-seq:
+ *     array.reject! {|item| block }  -> array or nil
+ *  
+ *  Equivalent to <code>Array#delete_if</code>, deleting elements from
+ *  _self_ for which the block evaluates to true, but returns
+ *  <code>nil</code> if no changes were made. Also see
+ *  <code>Enumerable#reject</code>.
+ */
 
 static VALUE
-reject_bang_i(VALUE a)
+rb_ary_reject_bang(ary)
+    VALUE ary;
 {
-    volatile struct select_bang_arg *arg = (void *)a;
-    VALUE ary = arg->ary;
     long i1, i2;
 
-    for (i1 = i2 = 0; i1 < RARRAY_LEN(ary); arg->len[0] = ++i1) {
-	VALUE v = RARRAY_AREF(ary, i1);
+    rb_ary_modify(ary);
+    for (i1 = i2 = 0; i1 < RARRAY(ary)->len; i1++) {
+	VALUE v = RARRAY(ary)->ptr[i1];
 	if (RTEST(rb_yield(v))) continue;
 	if (i1 != i2) {
 	    rb_ary_store(ary, i2, v);
 	}
-	arg->len[1] = ++i2;
+	i2++;
     }
-    return (i1 == i2) ? Qnil : ary;
-}
-
-static VALUE
-ary_reject_bang(VALUE ary)
-{
-    struct select_bang_arg args;
-
-    rb_ary_modify_check(ary);
-    args.ary = ary;
-    args.len[0] = args.len[1] = 0;
-    return rb_ensure(reject_bang_i, (VALUE)&args, select_bang_ensure, (VALUE)&args);
-}
-
-/*
- *  call-seq:
- *     ary.reject! { |item| block }  -> ary or nil
- *     ary.reject!                   -> Enumerator
- *
- *  Deletes every element of +self+ for which the block evaluates to +true+,
- *  if no changes were made returns +nil+.
- *
- *  The array may not be changed instantly every time the block is called.
- *
- *  See also Enumerable#reject and Array#delete_if.
- *
- *  If no block is given, an Enumerator is returned instead.
- */
+    if (RARRAY(ary)->len == i2) return Qnil;
+    if (i2 < RARRAY(ary)->len)
+	RARRAY(ary)->len = i2;
 
-static VALUE
-rb_ary_reject_bang(VALUE ary)
-{
-    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
-    return ary_reject_bang(ary);
+    return ary;
 }
 
 /*
  *  call-seq:
- *     ary.reject  {|item| block }  -> new_ary
- *     ary.reject                   -> Enumerator
- *
- *  Returns a new array containing the items in +self+ for which the given
- *  block is not +true+. The ordering of non-rejected elements is maintained.
- *
- *  See also Array#delete_if
- *
- *  If no block is given, an Enumerator is returned instead.
+ *     array.reject {|item| block }  -> an_array
+ *  
+ *  Returns a new array containing the items in _self_
+ *  for which the block is not true.
  */
 
 static VALUE
-rb_ary_reject(VALUE ary)
+rb_ary_reject(ary)
+    VALUE ary;
 {
-    VALUE rejected_ary;
-
-    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
-    rejected_ary = rb_ary_new();
-    ary_reject(ary, rejected_ary);
-    return rejected_ary;
+    ary = rb_ary_dup(ary);
+    rb_ary_reject_bang(ary);
+    return ary;
 }
 
 /*
  *  call-seq:
- *     ary.delete_if { |item| block }  -> ary
- *     ary.delete_if                   -> Enumerator
- *
- *  Deletes every element of +self+ for which block evaluates to +true+.
- *
- *  The array is changed instantly every time the block is called, not after
- *  the iteration is over.
- *
- *  See also Array#reject!
- *
- *  If no block is given, an Enumerator is returned instead.
- *
- *     scores = [ 97, 42, 75 ]
- *     scores.delete_if {|score| score < 80 }   #=> [97]
+ *     array.delete_if {|item| block }  -> array
+ *  
+ *  Deletes every element of <i>self</i> for which <i>block</i> evaluates
+ *  to <code>true</code>.
+ *     
+ *     a = [ "a", "b", "c" ]
+ *     a.delete_if {|x| x >= "b" }   #=> ["a"]
  */
 
 static VALUE
-rb_ary_delete_if(VALUE ary)
+rb_ary_delete_if(ary)
+    VALUE ary;
 {
-    RETURN_SIZED_ENUMERATOR(ary, 0, 0, ary_enum_length);
-    ary_reject_bang(ary);
+    rb_ary_reject_bang(ary);
     return ary;
 }
 
-static VALUE
-take_i(RB_BLOCK_CALL_FUNC_ARGLIST(val, cbarg))
-{
-    VALUE *args = (VALUE *)cbarg;
-    if (args[1]-- == 0) rb_iter_break();
-    if (argc > 1) val = rb_ary_new4(argc, argv);
-    rb_ary_push(args[0], val);
-    return Qnil;
-}
-
-static VALUE
-take_items(VALUE obj, long n)
-{
-    VALUE result = rb_check_array_type(obj);
-    VALUE args[2];
-
-    if (!NIL_P(result)) return rb_ary_subseq(result, 0, n);
-    result = rb_ary_new2(n);
-    args[0] = result; args[1] = (VALUE)n;
-    if (rb_check_block_call(obj, idEach, 0, 0, take_i, (VALUE)args) == Qundef)
-	rb_raise(rb_eTypeError, "wrong argument type %"PRIsVALUE" (must respond to :each)",
-		 rb_obj_class(obj));
-    return result;
-}
-
-
 /*
  *  call-seq:
- *     ary.zip(arg, ...)                  -> new_ary
- *     ary.zip(arg, ...) { |arr| block }  -> nil
- *
- *  Converts any arguments to arrays, then merges elements of +self+ with
- *  corresponding elements from each argument.
- *
- *  This generates a sequence of <code>ary.size</code> _n_-element arrays,
- *  where _n_ is one more than the count of arguments.
- *
- *  If the size of any argument is less than the size of the initial array,
- *  +nil+ values are supplied.
- *
- *  If a block is given, it is invoked for each output +array+, otherwise an
- *  array of arrays is returned.
- *
+ *     array.zip(arg, ...)                   -> an_array
+ *     array.zip(arg, ...) {| arr | block }  -> nil
+ *  
+ *  Converts any arguments to arrays, then merges elements of
+ *  <i>self</i> with corresponding elements from each argument. This
+ *  generates a sequence of <code>self.size</code> <em>n</em>-element
+ *  arrays, where <em>n</em> is one more that the count of arguments. If
+ *  the size of any argument is less than <code>enumObj.size</code>,
+ *  <code>nil</code> values are supplied. If a block given, it is
+ *  invoked for each output array, otherwise an array of arrays is
+ *  returned.
+ *     
  *     a = [ 4, 5, 6 ]
  *     b = [ 7, 8, 9 ]
- *     [1, 2, 3].zip(a, b)   #=> [[1, 4, 7], [2, 5, 8], [3, 6, 9]]
- *     [1, 2].zip(a, b)      #=> [[1, 4, 7], [2, 5, 8]]
- *     a.zip([1, 2], [8])    #=> [[4, 1, 8], [5, 2, nil], [6, nil, nil]]
+ *     
+ *     [1,2,3].zip(a, b)      #=> [[1, 4, 7], [2, 5, 8], [3, 6, 9]]
+ *     [1,2].zip(a,b)         #=> [[1, 4, 7], [2, 5, 8]]
+ *     a.zip([1,2],[8])       #=> [[4,1,8], [5,2,nil], [6,nil,nil]]
  */
 
 static VALUE
-rb_ary_zip(int argc, VALUE *argv, VALUE ary)
+rb_ary_zip(argc, argv, ary)
+    int argc;
+    VALUE *argv;
+    VALUE ary;
 {
     int i, j;
-    long len = RARRAY_LEN(ary);
-    VALUE result = Qnil;
+    long len;
+    VALUE result;
 
     for (i=0; i<argc; i++) {
-	argv[i] = take_items(argv[i], len);
+	argv[i] = to_ary(argv[i]);
     }
-
     if (rb_block_given_p()) {
-	int arity = rb_block_arity();
-
-	if (arity > 1) {
-	    VALUE work, *tmp;
+	for (i=0; i<RARRAY(ary)->len; i++) {
+	    VALUE tmp = rb_ary_new2(argc+1);
 
-	    tmp = ALLOCV_N(VALUE, work, argc+1);
-
-	    for (i=0; i<RARRAY_LEN(ary); i++) {
-		tmp[0] = RARRAY_AREF(ary, i);
-		for (j=0; j<argc; j++) {
-		    tmp[j+1] = rb_ary_elt(argv[j], i);
-		}
-		rb_yield_values2(argc+1, tmp);
-	    }
-
-	    if (work) ALLOCV_END(work);
-	}
-	else {
-	    for (i=0; i<RARRAY_LEN(ary); i++) {
-		VALUE tmp = rb_ary_new2(argc+1);
-
-		rb_ary_push(tmp, RARRAY_AREF(ary, i));
-		for (j=0; j<argc; j++) {
-		    rb_ary_push(tmp, rb_ary_elt(argv[j], i));
-		}
-		rb_yield(tmp);
-	    }
-	}
-    }
-    else {
-	result = rb_ary_new_capa(len);
-
-	for (i=0; i<len; i++) {
-	    VALUE tmp = rb_ary_new_capa(argc+1);
-
-	    rb_ary_push(tmp, RARRAY_AREF(ary, i));
+	    rb_ary_push(tmp, rb_ary_elt(ary, i));
 	    for (j=0; j<argc; j++) {
 		rb_ary_push(tmp, rb_ary_elt(argv[j], i));
 	    }
-	    rb_ary_push(result, tmp);
+	    rb_yield(tmp);
 	}
+	return Qnil;
     }
+    len = RARRAY(ary)->len;
+    result = rb_ary_new2(len);
+    for (i=0; i<len; i++) {
+	VALUE tmp = rb_ary_new2(argc+1);
 
+	rb_ary_push(tmp, rb_ary_elt(ary, i));
+	for (j=0; j<argc; j++) {
+	    rb_ary_push(tmp, rb_ary_elt(argv[j], i));
+	}
+	rb_ary_push(result, tmp);
+    }
     return result;
 }
 
 /*
  *  call-seq:
- *     ary.transpose -> new_ary
- *
- *  Assumes that +self+ is an array of arrays and transposes the rows and
- *  columns.
- *
+ *     array.transpose -> an_array
+ *  
+ *  Assumes that <i>self</i> is an array of arrays and transposes the
+ *  rows and columns.
+ *     
  *     a = [[1,2], [3,4], [5,6]]
  *     a.transpose   #=> [[1, 3, 5], [2, 4, 6]]
- *
- *  If the length of the subarrays don't match, an IndexError is raised.
  */
 
 static VALUE
-rb_ary_transpose(VALUE ary)
+rb_ary_transpose(ary)
+    VALUE ary;
 {
     long elen = -1, alen, i, j;
     VALUE tmp, result = 0;
 
-    alen = RARRAY_LEN(ary);
+    alen = RARRAY(ary)->len;
     if (alen == 0) return rb_ary_dup(ary);
     for (i=0; i<alen; i++) {
 	tmp = to_ary(rb_ary_elt(ary, i));
 	if (elen < 0) {		/* first element */
-	    elen = RARRAY_LEN(tmp);
+	    elen = RARRAY(tmp)->len;
 	    result = rb_ary_new2(elen);
 	    for (j=0; j<elen; j++) {
 		rb_ary_store(result, j, rb_ary_new2(alen));
 	    }
 	}
-	else if (elen != RARRAY_LEN(tmp)) {
-	    rb_raise(rb_eIndexError, "element size differs (%ld should be %ld)",
-		     RARRAY_LEN(tmp), elen);
+	else if (elen != RARRAY(tmp)->len) {
+	    rb_raise(rb_eIndexError, "element size differs (%d should be %d)",
+		     RARRAY(tmp)->len, elen);
 	}
 	for (j=0; j<elen; j++) {
 	    rb_ary_store(rb_ary_elt(result, j), i, rb_ary_elt(tmp, j));
@@ -3410,121 +2141,96 @@ rb_ary_transpose(VALUE ary)
 
 /*
  *  call-seq:
- *     ary.replace(other_ary)  -> ary
- *     ary.initialize_copy(other_ary)	-> ary
- *
- *  Replaces the contents of +self+ with the contents of +other_ary+,
- *  truncating or expanding if necessary.
- *
+ *     array.replace(other_array)  -> array
+ *  
+ *  Replaces the contents of <i>self</i> with the contents of
+ *  <i>other_array</i>, truncating or expanding if necessary.
+ *     
  *     a = [ "a", "b", "c", "d", "e" ]
  *     a.replace([ "x", "y", "z" ])   #=> ["x", "y", "z"]
  *     a                              #=> ["x", "y", "z"]
  */
 
-VALUE
-rb_ary_replace(VALUE copy, VALUE orig)
+static VALUE
+rb_ary_replace(copy, orig)
+    VALUE copy, orig;
 {
-    rb_ary_modify_check(copy);
+    VALUE shared;
+
+    rb_ary_modify(copy);
     orig = to_ary(orig);
     if (copy == orig) return copy;
+    shared = ary_make_shared(orig);
+    if (RARRAY(copy)->ptr && !FL_TEST(copy, ELTS_SHARED))
+	free(RARRAY(copy)->ptr);
+    RARRAY(copy)->ptr = RARRAY(orig)->ptr;
+    RARRAY(copy)->len = RARRAY(orig)->len;
+    RARRAY(copy)->aux.shared = shared;
+    FL_SET(copy, ELTS_SHARED);
 
-    if (RARRAY_LEN(orig) <= RARRAY_EMBED_LEN_MAX) {
-        VALUE shared = 0;
-
-        if (ARY_OWNS_HEAP_P(copy)) {
-	    RARRAY_PTR_USE(copy, ptr, ruby_sized_xfree(ptr, ARY_HEAP_SIZE(copy)));
-	}
-        else if (ARY_SHARED_P(copy)) {
-            shared = ARY_SHARED(copy);
-            FL_UNSET_SHARED(copy);
-        }
-        FL_SET_EMBED(copy);
-	ary_memcpy(copy, 0, RARRAY_LEN(orig), RARRAY_CONST_PTR(orig));
-        if (shared) {
-            rb_ary_decrement_share(shared);
-        }
-        ARY_SET_LEN(copy, RARRAY_LEN(orig));
-    }
-    else {
-        VALUE shared = ary_make_shared(orig);
-        if (ARY_OWNS_HEAP_P(copy)) {
-	    RARRAY_PTR_USE(copy, ptr, ruby_sized_xfree(ptr, ARY_HEAP_SIZE(copy)));
-        }
-        else {
-            rb_ary_unshare_safe(copy);
-        }
-        FL_UNSET_EMBED(copy);
-        ARY_SET_PTR(copy, RARRAY_CONST_PTR(orig));
-        ARY_SET_LEN(copy, RARRAY_LEN(orig));
-        rb_ary_set_shared(copy, shared);
-    }
     return copy;
 }
 
-/*
+/* 
  *  call-seq:
- *     ary.clear    -> ary
+ *     array.clear    ->  array
  *
- *  Removes all elements from +self+.
+ *  Removes all elements from _self_.
  *
  *     a = [ "a", "b", "c", "d", "e" ]
  *     a.clear    #=> [ ]
  */
 
 VALUE
-rb_ary_clear(VALUE ary)
+rb_ary_clear(ary)
+    VALUE ary;
 {
-    rb_ary_modify_check(ary);
-    ARY_SET_LEN(ary, 0);
-    if (ARY_SHARED_P(ary)) {
-	if (!ARY_EMBED_P(ary)) {
-	    rb_ary_unshare(ary);
-	    FL_SET_EMBED(ary);
-	}
-    }
-    else if (ARY_DEFAULT_SIZE * 2 < ARY_CAPA(ary)) {
-	ary_resize_capa(ary, ARY_DEFAULT_SIZE * 2);
+    rb_ary_modify(ary);
+    RARRAY(ary)->len = 0;
+    if (ARY_DEFAULT_SIZE * 2 < RARRAY(ary)->aux.capa) {
+	REALLOC_N(RARRAY(ary)->ptr, VALUE, ARY_DEFAULT_SIZE * 2);
+	RARRAY(ary)->aux.capa = ARY_DEFAULT_SIZE * 2;
     }
     return ary;
 }
 
 /*
  *  call-seq:
- *     ary.fill(obj)                                 -> ary
- *     ary.fill(obj, start [, length])               -> ary
- *     ary.fill(obj, range )                         -> ary
- *     ary.fill { |index| block }                    -> ary
- *     ary.fill(start [, length] ) { |index| block } -> ary
- *     ary.fill(range) { |index| block }             -> ary
- *
- *  The first three forms set the selected elements of +self+ (which
- *  may be the entire array) to +obj+.
- *
- *  A +start+ of +nil+ is equivalent to zero.
- *
- *  A +length+ of +nil+ is equivalent to the length of the array.
- *
- *  The last three forms fill the array with the value of the given block,
- *  which is passed the absolute index of each element to be filled.
- *
- *  Negative values of +start+ count from the end of the array, where +-1+ is
- *  the last element.
- *
+ *     array.fill(obj)                                -> array
+ *     array.fill(obj, start [, length])              -> array
+ *     array.fill(obj, range )                        -> array
+ *     array.fill {|index| block }                    -> array
+ *     array.fill(start [, length] ) {|index| block } -> array
+ *     array.fill(range) {|index| block }             -> array
+ *  
+ *  The first three forms set the selected elements of <i>self</i> (which
+ *  may be the entire array) to <i>obj</i>. A <i>start</i> of
+ *  <code>nil</code> is equivalent to zero. A <i>length</i> of
+ *  <code>nil</code> is equivalent to <i>self.length</i>. The last three
+ *  forms fill the array with the value of the block. The block is
+ *  passed the absolute index of each element to be filled.
+ *     
  *     a = [ "a", "b", "c", "d" ]
  *     a.fill("x")              #=> ["x", "x", "x", "x"]
  *     a.fill("z", 2, 2)        #=> ["x", "x", "z", "z"]
  *     a.fill("y", 0..1)        #=> ["y", "y", "z", "z"]
- *     a.fill { |i| i*i }       #=> [0, 1, 4, 9]
- *     a.fill(-2) { |i| i*i*i } #=> [0, 1, 8, 27]
+ *     a.fill {|i| i*i}         #=> [0, 1, 4, 9]
+ *     a.fill(-2) {|i| i*i*i}   #=> [0, 1, 8, 27]
  */
 
 static VALUE
-rb_ary_fill(int argc, VALUE *argv, VALUE ary)
+rb_ary_fill(argc, argv, ary)
+    int argc;
+    VALUE *argv;
+    VALUE ary;
 {
-    VALUE item = Qundef, arg1, arg2;
+    VALUE item, arg1, arg2;
     long beg = 0, end = 0, len = 0;
+    VALUE *p, *pend;
+    int block_p = Qfalse;
 
     if (rb_block_given_p()) {
+	block_p = Qtrue;
 	rb_scan_args(argc, argv, "02", &arg1, &arg2);
 	argc += 1;		/* hackish */
     }
@@ -3534,158 +2240,112 @@ rb_ary_fill(int argc, VALUE *argv, VALUE ary)
     switch (argc) {
       case 1:
 	beg = 0;
-	len = RARRAY_LEN(ary);
+	len = RARRAY(ary)->len;
 	break;
       case 2:
-	if (rb_range_beg_len(arg1, &beg, &len, RARRAY_LEN(ary), 1)) {
+	if (rb_range_beg_len(arg1, &beg, &len, RARRAY(ary)->len, 1)) {
 	    break;
 	}
 	/* fall through */
       case 3:
 	beg = NIL_P(arg1) ? 0 : NUM2LONG(arg1);
 	if (beg < 0) {
-	    beg = RARRAY_LEN(ary) + beg;
+	    beg = RARRAY(ary)->len + beg;
 	    if (beg < 0) beg = 0;
 	}
-	len = NIL_P(arg2) ? RARRAY_LEN(ary) - beg : NUM2LONG(arg2);
+	len = NIL_P(arg2) ? RARRAY(ary)->len - beg : NUM2LONG(arg2);
 	break;
     }
     rb_ary_modify(ary);
-    if (len < 0) {
-        return ary;
-    }
-    if (beg >= ARY_MAX_SIZE || len > ARY_MAX_SIZE - beg) {
+    end = beg + len;
+    if (end < 0) {
 	rb_raise(rb_eArgError, "argument too big");
     }
-    end = beg + len;
-    if (RARRAY_LEN(ary) < end) {
-	if (end >= ARY_CAPA(ary)) {
-	    ary_resize_capa(ary, end);
+    if (end > RARRAY(ary)->len) {
+	if (end >= RARRAY(ary)->aux.capa) {
+	    REALLOC_N(RARRAY(ary)->ptr, VALUE, end);
+	    RARRAY(ary)->aux.capa = end;
 	}
-	ary_mem_clear(ary, RARRAY_LEN(ary), end - RARRAY_LEN(ary));
-	ARY_SET_LEN(ary, end);
+	rb_mem_clear(RARRAY(ary)->ptr + RARRAY(ary)->len, end - RARRAY(ary)->len);
+	RARRAY(ary)->len = end;
     }
 
-    if (item == Qundef) {
+    if (block_p) {
 	VALUE v;
 	long i;
 
 	for (i=beg; i<end; i++) {
 	    v = rb_yield(LONG2NUM(i));
-	    if (i>=RARRAY_LEN(ary)) break;
-	    ARY_SET(ary, i, v);
+	    if (i>=RARRAY(ary)->len) break;
+	    RARRAY(ary)->ptr[i] = v;
 	}
     }
     else {
-	ary_memfill(ary, beg, len, item);
+	p = RARRAY(ary)->ptr + beg;
+	pend = p + len;
+	while (p < pend) {
+	    *p++ = item;
+	}
     }
     return ary;
 }
 
-/*
+/* 
  *  call-seq:
- *     ary + other_ary   -> new_ary
+ *     array + other_array   -> an_array
  *
- *  Concatenation --- Returns a new array built by concatenating the
+ *  Concatenation---Returns a new array built by concatenating the
  *  two arrays together to produce a third array.
- *
+ * 
  *     [ 1, 2, 3 ] + [ 4, 5 ]    #=> [ 1, 2, 3, 4, 5 ]
- *     a = [ "a", "b", "c" ]
- *     c = a + [ "d", "e", "f" ]
- *     c                         #=> [ "a", "b", "c", "d", "e", "f" ]
- *     a                         #=> [ "a", "b", "c" ]
- *
- *  Note that
- *     x += y
- *  is the same as
- *     x = x + y
- *  This means that it produces a new array. As a consequence,
- *  repeated use of <code>+=</code> on arrays can be quite inefficient.
- *
- *  See also Array#concat.
  */
 
 VALUE
-rb_ary_plus(VALUE x, VALUE y)
+rb_ary_plus(x, y)
+    VALUE x, y;
 {
     VALUE z;
-    long len, xlen, ylen;
+    long len;
 
     y = to_ary(y);
-    xlen = RARRAY_LEN(x);
-    ylen = RARRAY_LEN(y);
-    len = xlen + ylen;
+    len = RARRAY(x)->len + RARRAY(y)->len;
     z = rb_ary_new2(len);
-
-    ary_memcpy(z, 0, xlen, RARRAY_CONST_PTR(x));
-    ary_memcpy(z, xlen, ylen, RARRAY_CONST_PTR(y));
-    ARY_SET_LEN(z, len);
+    MEMCPY(RARRAY(z)->ptr, RARRAY(x)->ptr, VALUE, RARRAY(x)->len);
+    MEMCPY(RARRAY(z)->ptr + RARRAY(x)->len, RARRAY(y)->ptr, VALUE, RARRAY(y)->len);
+    RARRAY(z)->len = len;
     return z;
 }
 
-static VALUE
-ary_append(VALUE x, VALUE y)
-{
-    long n = RARRAY_LEN(y);
-    if (n > 0) {
-	rb_ary_splice(x, RARRAY_LEN(x), 0, RARRAY_CONST_PTR(y), n);
-    }
-    return x;
-}
-
-/*
+/* 
  *  call-seq:
- *     ary.concat(other_ary1, other_ary2,...)   -> ary
- *
- *  Appends the elements of +other_ary+s to +self+.
+ *     array.concat(other_array)   ->  array
  *
+ *  Appends the elements in other_array to _self_.
+ *  
  *     [ "a", "b" ].concat( ["c", "d"] ) #=> [ "a", "b", "c", "d" ]
- *     [ "a" ].concat( ["b"], ["c", "d"] ) #=> [ "a", "b", "c", "d" ]
- *     [ "a" ].concat #=> [ "a" ]
- *
- *     a = [ 1, 2, 3 ]
- *     a.concat( [ 4, 5 ] )
- *     a                                 #=> [ 1, 2, 3, 4, 5 ]
- *
- *     a = [ 1, 2 ]
- *     a.concat(a, a)                    #=> [1, 2, 1, 2, 1, 2]
- *
- *  See also Array#+.
  */
 
-static VALUE
-rb_ary_concat_multi(int argc, VALUE *argv, VALUE ary)
-{
-    rb_ary_modify_check(ary);
-
-    if (argc > 0) {
-	int i;
-	VALUE args = rb_ary_tmp_new(argc);
-	for (i = 0; i < argc; i++) {
-	    rb_ary_concat(args, argv[i]);
-	}
-	ary_append(ary, args);
-    }
-
-    return ary;
-}
 
 VALUE
-rb_ary_concat(VALUE x, VALUE y)
+rb_ary_concat(x, y)
+    VALUE x, y;
 {
-    return ary_append(x, to_ary(y));
+    y = to_ary(y);
+    if (RARRAY(y)->len > 0) {
+	rb_ary_splice(x, RARRAY(x)->len, 0, y);
+    }
+    return x;
 }
 
-/*
+
+/* 
  *  call-seq:
- *     ary * int     -> new_ary
- *     ary * str     -> new_string
- *
- *  Repetition --- With a String argument, equivalent to
- *  <code>ary.join(str)</code>.
+ *     array * int     ->    an_array
+ *     array * str     ->    a_string
  *
- *  Otherwise, returns a new array built by concatenating the +int+ copies of
- *  +self+.
+ *  Repetition---With a String argument, equivalent to
+ *  self.join(str). Otherwise, returns a new array
+ *  built by concatenating the _int_ copies of _self_.
  *
  *
  *     [ 1, 2, 3 ] * 3    #=> [ 1, 2, 3, 1, 2, 3, 1, 2, 3 ]
@@ -3694,11 +2354,11 @@ rb_ary_concat(VALUE x, VALUE y)
  */
 
 static VALUE
-rb_ary_times(VALUE ary, VALUE times)
+rb_ary_times(ary, times)
+    VALUE ary, times;
 {
     VALUE ary2, tmp;
-    const VALUE *ptr;
-    long t, len;
+    long i, len;
 
     tmp = rb_check_string_type(times);
     if (!NIL_P(tmp)) {
@@ -3706,50 +2366,37 @@ rb_ary_times(VALUE ary, VALUE times)
     }
 
     len = NUM2LONG(times);
-    if (len == 0) {
-	ary2 = ary_new(rb_obj_class(ary), 0);
-	goto out;
-    }
+    if (len == 0) return ary_new(rb_obj_class(ary), 0);
     if (len < 0) {
 	rb_raise(rb_eArgError, "negative argument");
     }
-    if (ARY_MAX_SIZE/len < RARRAY_LEN(ary)) {
+    if (LONG_MAX/len < RARRAY(ary)->len) {
 	rb_raise(rb_eArgError, "argument too big");
     }
-    len *= RARRAY_LEN(ary);
+    len *= RARRAY(ary)->len;
 
     ary2 = ary_new(rb_obj_class(ary), len);
-    ARY_SET_LEN(ary2, len);
-
-    ptr = RARRAY_CONST_PTR(ary);
-    t = RARRAY_LEN(ary);
-    if (0 < t) {
-	ary_memcpy(ary2, 0, t, ptr);
-	while (t <= len/2) {
-	    ary_memcpy(ary2, t, t, RARRAY_CONST_PTR(ary2));
-            t *= 2;
-        }
-        if (t < len) {
-	    ary_memcpy(ary2, t, len-t, RARRAY_CONST_PTR(ary2));
-        }
-    }
-  out:
+    RARRAY(ary2)->len = len;
+
+    for (i=0; i<len; i+=RARRAY(ary)->len) {
+	MEMCPY(RARRAY(ary2)->ptr+i, RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
+    }
     OBJ_INFECT(ary2, ary);
 
     return ary2;
 }
 
-/*
+/* 
  *  call-seq:
- *     ary.assoc(obj)   -> element_ary  or  nil
+ *     array.assoc(obj)   ->  an_array  or  nil
  *
- *  Searches through an array whose elements are also arrays comparing +obj+
- *  with the first element of each contained array using <code>obj.==</code>.
- *
- *  Returns the first contained array that matches (that is, the first
- *  associated array), or +nil+ if no match is found.
- *
- *  See also Array#rassoc
+ *  Searches through an array whose elements are also arrays
+ *  comparing _obj_ with the first element of each contained array
+ *  using obj.==.
+ *  Returns the first contained array that matches (that
+ *  is, the first associated array),
+ *  or +nil+ if no match is found.
+ *  See also <code>Array#rassoc</code>.
  *
  *     s1 = [ "colors", "red", "blue", "green" ]
  *     s2 = [ "letters", "a", "b", "c" ]
@@ -3760,15 +2407,17 @@ rb_ary_times(VALUE ary, VALUE times)
  */
 
 VALUE
-rb_ary_assoc(VALUE ary, VALUE key)
+rb_ary_assoc(ary, key)
+    VALUE ary, key;
 {
     long i;
     VALUE v;
 
-    for (i = 0; i < RARRAY_LEN(ary); ++i) {
-	v = rb_check_array_type(RARRAY_AREF(ary, i));
-	if (!NIL_P(v) && RARRAY_LEN(v) > 0 &&
-	    rb_equal(RARRAY_AREF(v, 0), key))
+    for (i = 0; i < RARRAY(ary)->len; ++i) {
+	v = RARRAY(ary)->ptr[i];
+	if (TYPE(v) == T_ARRAY &&
+	    RARRAY(v)->len > 0 &&
+	    rb_equal(RARRAY(v)->ptr[0], key))
 	    return v;
     }
     return Qnil;
@@ -3776,78 +2425,42 @@ rb_ary_assoc(VALUE ary, VALUE key)
 
 /*
  *  call-seq:
- *     ary.rassoc(obj) -> element_ary or nil
- *
- *  Searches through the array whose elements are also arrays.
- *
- *  Compares +obj+ with the second element of each contained array using
- *  <code>obj.==</code>.
- *
- *  Returns the first contained array that matches +obj+.
- *
- *  See also Array#assoc.
- *
+ *     array.rassoc(key) -> an_array or nil
+ *  
+ *  Searches through the array whose elements are also arrays. Compares
+ *  <em>key</em> with the second element of each contained array using
+ *  <code>==</code>. Returns the first contained array that matches. See
+ *  also <code>Array#assoc</code>.
+ *     
  *     a = [ [ 1, "one"], [2, "two"], [3, "three"], ["ii", "two"] ]
  *     a.rassoc("two")    #=> [2, "two"]
  *     a.rassoc("four")   #=> nil
  */
 
 VALUE
-rb_ary_rassoc(VALUE ary, VALUE value)
+rb_ary_rassoc(ary, value)
+    VALUE ary, value;
 {
     long i;
     VALUE v;
 
-    for (i = 0; i < RARRAY_LEN(ary); ++i) {
-	v = RARRAY_AREF(ary, i);
-	if (RB_TYPE_P(v, T_ARRAY) &&
-	    RARRAY_LEN(v) > 1 &&
-	    rb_equal(RARRAY_AREF(v, 1), value))
+    for (i = 0; i < RARRAY(ary)->len; ++i) {
+	v = RARRAY(ary)->ptr[i];
+	if (TYPE(v) == T_ARRAY &&
+	    RARRAY(v)->len > 1 &&
+	    rb_equal(RARRAY(v)->ptr[1], value))
 	    return v;
     }
     return Qnil;
 }
 
-static VALUE
-recursive_equal(VALUE ary1, VALUE ary2, int recur)
-{
-    long i, len1;
-    const VALUE *p1, *p2;
-
-    if (recur) return Qtrue; /* Subtle! */
-
-    p1 = RARRAY_CONST_PTR(ary1);
-    p2 = RARRAY_CONST_PTR(ary2);
-    len1 = RARRAY_LEN(ary1);
-
-    for (i = 0; i < len1; i++) {
-	if (*p1 != *p2) {
-	    if (rb_equal(*p1, *p2)) {
-		len1 = RARRAY_LEN(ary1);
-		if (len1 != RARRAY_LEN(ary2))
-		    return Qfalse;
-		if (len1 < i)
-		    return Qtrue;
-		p1 = RARRAY_CONST_PTR(ary1) + i;
-		p2 = RARRAY_CONST_PTR(ary2) + i;
-	    }
-	    else {
-		return Qfalse;
-	    }
-	}
-	p1++;
-	p2++;
-    }
-    return Qtrue;
-}
-
-/*
+/* 
  *  call-seq:
- *     ary == other_ary   ->   bool
+ *     array == other_array   ->   bool
  *
- *  Equality --- Two arrays are equal if they contain the same number of
- *  elements and if each element is equal to (according to Object#==) the
- *  corresponding element in +other_ary+.
+ *  Equality---Two arrays are equal if they contain the same number
+ *  of elements and if each element is equal to (according to
+ *  Object.==) the corresponding element in the other array.
  *
  *     [ "a", "c" ]    == [ "a", "c", 7 ]     #=> false
  *     [ "a", "c", 7 ] == [ "a", "c", 7 ]     #=> true
@@ -3856,28 +2469,21 @@ recursive_equal(VALUE ary1, VALUE ary2, int recur)
  */
 
 static VALUE
-rb_ary_equal(VALUE ary1, VALUE ary2)
+rb_ary_equal(ary1, ary2)
+    VALUE ary1, ary2;
 {
+    long i;
+
     if (ary1 == ary2) return Qtrue;
-    if (!RB_TYPE_P(ary2, T_ARRAY)) {
-	if (!rb_respond_to(ary2, idTo_ary)) {
+    if (TYPE(ary2) != T_ARRAY) {
+	if (!rb_respond_to(ary2, rb_intern("to_ary"))) {
 	    return Qfalse;
 	}
 	return rb_equal(ary2, ary1);
     }
-    if (RARRAY_LEN(ary1) != RARRAY_LEN(ary2)) return Qfalse;
-    if (RARRAY_CONST_PTR(ary1) == RARRAY_CONST_PTR(ary2)) return Qtrue;
-    return rb_exec_recursive_paired(recursive_equal, ary1, ary2, ary2);
-}
-
-static VALUE
-recursive_eql(VALUE ary1, VALUE ary2, int recur)
-{
-    long i;
-
-    if (recur) return Qtrue; /* Subtle! */
-    for (i=0; i<RARRAY_LEN(ary1); i++) {
-	if (!rb_eql(rb_ary_elt(ary1, i), rb_ary_elt(ary2, i)))
+    if (RARRAY(ary1)->len != RARRAY(ary2)->len) return Qfalse;
+    for (i=0; i<RARRAY(ary1)->len; i++) {
+	if (!rb_equal(rb_ary_elt(ary1, i), rb_ary_elt(ary2, i)))
 	    return Qfalse;
     }
     return Qtrue;
@@ -3885,76 +2491,74 @@ recursive_eql(VALUE ary1, VALUE ary2, int recur)
 
 /*
  *  call-seq:
- *     ary.eql?(other)  -> true or false
+ *     array.eql?(other)  -> true or false
  *
- *  Returns +true+ if +self+ and +other+ are the same object,
- *  or are both arrays with the same content (according to Object#eql?).
+ *  Returns <code>true</code> if _array_ and _other_ are the same object,
+ *  or are both arrays with the same content.
  */
 
 static VALUE
-rb_ary_eql(VALUE ary1, VALUE ary2)
+rb_ary_eql(ary1, ary2)
+    VALUE ary1, ary2;
 {
+    long i;
+
     if (ary1 == ary2) return Qtrue;
-    if (!RB_TYPE_P(ary2, T_ARRAY)) return Qfalse;
-    if (RARRAY_LEN(ary1) != RARRAY_LEN(ary2)) return Qfalse;
-    if (RARRAY_CONST_PTR(ary1) == RARRAY_CONST_PTR(ary2)) return Qtrue;
-    return rb_exec_recursive_paired(recursive_eql, ary1, ary2, ary2);
+    if (TYPE(ary2) != T_ARRAY) return Qfalse;
+    if (RARRAY(ary1)->len != RARRAY(ary2)->len) return Qfalse;
+    for (i=0; i<RARRAY(ary1)->len; i++) {
+	if (!rb_eql(rb_ary_elt(ary1, i), rb_ary_elt(ary2, i)))
+	    return Qfalse;
+    }
+    return Qtrue;
 }
 
 /*
  *  call-seq:
- *     ary.hash   -> integer
+ *     array.hash   -> fixnum
  *
- *  Compute a hash-code for this array.
- *
- *  Two arrays with the same content will have the same hash code (and will
- *  compare using #eql?).
- *
- *  See also Object#hash.
+ *  Compute a hash-code for this array. Two arrays with the same content
+ *  will have the same hash code (and will compare using <code>eql?</code>).
  */
 
 static VALUE
-rb_ary_hash(VALUE ary)
+rb_ary_hash(ary)
+    VALUE ary;
 {
-    long i;
-    st_index_t h;
+    long i, h;
     VALUE n;
 
-    h = rb_hash_start(RARRAY_LEN(ary));
-    h = rb_hash_uint(h, (st_index_t)rb_ary_hash);
-    for (i=0; i<RARRAY_LEN(ary); i++) {
-	n = rb_hash(RARRAY_AREF(ary, i));
-	h = rb_hash_uint(h, NUM2LONG(n));
+    h = RARRAY(ary)->len;
+    for (i=0; i<RARRAY(ary)->len; i++) {
+	h = (h << 1) | (h<0 ? 1 : 0);
+	n = rb_hash(RARRAY(ary)->ptr[i]);
+	h ^= NUM2LONG(n);
     }
-    h = rb_hash_end(h);
     return LONG2FIX(h);
 }
 
 /*
  *  call-seq:
- *     ary.include?(object)   -> true or false
- *
- *  Returns +true+ if the given +object+ is present in +self+ (that is, if any
- *  element <code>==</code> +object+), otherwise returns +false+.
- *
+ *     array.include?(obj)   -> true or false
+ *  
+ *  Returns <code>true</code> if the given object is present in
+ *  <i>self</i> (that is, if any object <code>==</code> <i>anObject</i>),
+ *  <code>false</code> otherwise.
+ *     
  *     a = [ "a", "b", "c" ]
  *     a.include?("b")   #=> true
  *     a.include?("z")   #=> false
  */
 
 VALUE
-rb_ary_includes(VALUE ary, VALUE item)
+rb_ary_includes(ary, item)
+    VALUE ary;
+    VALUE item;
 {
     long i;
-    VALUE e;
-
-    for (i=0; i<RARRAY_LEN(ary); i++) {
-	e = RARRAY_AREF(ary, i);
-	switch (rb_equal_opt(e, item)) {
-	  case Qundef:
-	    if (rb_equal(e, item)) return Qtrue;
-	    break;
-	  case Qtrue:
+    
+    for (i=0; i<RARRAY(ary)->len; i++) {
+	if (rb_equal(RARRAY(ary)->ptr[i], item)) {
 	    return Qtrue;
 	}
     }
@@ -3962,515 +2566,271 @@ rb_ary_includes(VALUE ary, VALUE item)
 }
 
 
-static VALUE
-recursive_cmp(VALUE ary1, VALUE ary2, int recur)
-{
-    long i, len;
-
-    if (recur) return Qundef;	/* Subtle! */
-    len = RARRAY_LEN(ary1);
-    if (len > RARRAY_LEN(ary2)) {
-	len = RARRAY_LEN(ary2);
-    }
-    for (i=0; i<len; i++) {
-	VALUE e1 = rb_ary_elt(ary1, i), e2 = rb_ary_elt(ary2, i);
-	VALUE v = rb_funcallv(e1, id_cmp, 1, &e2);
-	if (v != INT2FIX(0)) {
-	    return v;
-	}
-    }
-    return Qundef;
-}
-
-/*
+/* 
  *  call-seq:
- *     ary <=> other_ary   ->  -1, 0, +1 or nil
- *
- *  Comparison --- Returns an integer (+-1+, +0+, or <code>+1</code>) if this
- *  array is less than, equal to, or greater than +other_ary+.
- *
- *  Each object in each array is compared (using the <=> operator).
- *
- *  Arrays are compared in an "element-wise" manner; the first element of +ary+
- *  is compared with the first one of +other_ary+ using the <=> operator, then
- *  each of the second elements, etc...
- *  As soon as the result of any such comparison is non zero (i.e. the two
- *  corresponding elements are not equal), that result is returned for the
- *  whole array comparison.
- *
- *  If all the elements are equal, then the result is based on a comparison of
- *  the array lengths. Thus, two arrays are "equal" according to Array#<=> if,
- *  and only if, they have the same length and the value of each element is
- *  equal to the value of the corresponding element in the other array.
- *
- *  +nil+ is returned if the +other_ary+ is not an array or if the comparison
- *  of two elements returned +nil+.
+ *     array <=> other_array   ->  -1, 0, +1
  *
+ *  Comparison---Returns an integer (-1, 0,
+ *  or +1) if this array is less than, equal to, or greater than
+ *  other_array.  Each object in each array is compared
+ *  (using <=>). If any value isn't
+ *  equal, then that inequality is the return value. If all the
+ *  values found are equal, then the return is based on a
+ *  comparison of the array lengths.  Thus, two arrays are
+ *  ``equal'' according to <code>Array#<=></code> if and only if they have
+ *  the same length and the value of each element is equal to the
+ *  value of the corresponding element in the other array.
+ *  
  *     [ "a", "a", "c" ]    <=> [ "a", "b", "c" ]   #=> -1
  *     [ 1, 2, 3, 4, 5, 6 ] <=> [ 1, 2 ]            #=> +1
- *     [ 1, 2 ]             <=> [ 1, :two ]         #=> nil
  *
  */
 
 VALUE
-rb_ary_cmp(VALUE ary1, VALUE ary2)
+rb_ary_cmp(ary1, ary2)
+    VALUE ary1, ary2;
 {
-    long len;
-    VALUE v;
+    long i, len;
 
-    ary2 = rb_check_array_type(ary2);
-    if (NIL_P(ary2)) return Qnil;
-    if (ary1 == ary2) return INT2FIX(0);
-    v = rb_exec_recursive_paired(recursive_cmp, ary1, ary2, ary2);
-    if (v != Qundef) return v;
-    len = RARRAY_LEN(ary1) - RARRAY_LEN(ary2);
+    ary2 = to_ary(ary2);
+    len = RARRAY(ary1)->len;
+    if (len > RARRAY(ary2)->len) {
+	len = RARRAY(ary2)->len;
+    }
+    for (i=0; i<len; i++) {
+	VALUE v = rb_funcall(rb_ary_elt(ary1, i), id_cmp, 1, rb_ary_elt(ary2, i));
+	if (v != INT2FIX(0)) {
+	    return v;
+	}
+    }
+    len = RARRAY(ary1)->len - RARRAY(ary2)->len;
     if (len == 0) return INT2FIX(0);
     if (len > 0) return INT2FIX(1);
     return INT2FIX(-1);
 }
 
 static VALUE
-ary_add_hash(VALUE hash, VALUE ary)
-{
-    long i;
-
-    for (i=0; i<RARRAY_LEN(ary); i++) {
-	VALUE elt = RARRAY_AREF(ary, i);
-	rb_hash_add_new_element(hash, elt, elt);
-    }
-    return hash;
-}
-
-static inline VALUE
-ary_tmp_hash_new(void)
+ary_make_hash(ary1, ary2)
+    VALUE ary1, ary2;
 {
     VALUE hash = rb_hash_new();
-
-    RBASIC_CLEAR_CLASS(hash);
-    return hash;
-}
-
-static VALUE
-ary_make_hash(VALUE ary)
-{
-    VALUE hash = ary_tmp_hash_new();
-    return ary_add_hash(hash, ary);
-}
-
-static VALUE
-ary_add_hash_by(VALUE hash, VALUE ary)
-{
     long i;
 
-    for (i = 0; i < RARRAY_LEN(ary); ++i) {
-	VALUE v = rb_ary_elt(ary, i), k = rb_yield(v);
-	rb_hash_add_new_element(hash, k, v);
+    for (i=0; i<RARRAY(ary1)->len; i++) {
+	rb_hash_aset(hash, RARRAY(ary1)->ptr[i], Qtrue);
     }
-    return hash;
-}
-
-static VALUE
-ary_make_hash_by(VALUE ary)
-{
-    VALUE hash = ary_tmp_hash_new();
-    return ary_add_hash_by(hash, ary);
-}
-
-static inline void
-ary_recycle_hash(VALUE hash)
-{
-    if (RHASH(hash)->ntbl) {
-	st_table *tbl = RHASH(hash)->ntbl;
-	RHASH(hash)->ntbl = 0;
-	st_free_table(tbl);
+    if (ary2) {
+	for (i=0; i<RARRAY(ary2)->len; i++) {
+	    rb_hash_aset(hash, RARRAY(ary2)->ptr[i], Qtrue);
+	}
     }
-    RB_GC_GUARD(hash);
+    return hash;
 }
 
-/*
+/* 
  *  call-seq:
- *     ary - other_ary    -> new_ary
+ *     array - other_array    -> an_array
  *
- *  Array Difference
- *
- *  Returns a new array that is a copy of the original array, removing any
- *  items that also appear in +other_ary+. The order is preserved from the
- *  original array.
- *
- *  It compares elements using their #hash and #eql? methods for efficiency.
+ *  Array Difference---Returns a new array that is a copy of
+ *  the original array, removing any items that also appear in
+ *  other_array. (If you need set-like behavior, see the
+ *  library class Set.)
  *
  *     [ 1, 1, 2, 2, 3, 3, 4, 5 ] - [ 1, 2, 4 ]  #=>  [ 3, 3, 5 ]
- *
- *  If you need set-like behavior, see the library class Set.
  */
 
 static VALUE
-rb_ary_diff(VALUE ary1, VALUE ary2)
+rb_ary_diff(ary1, ary2)
+    VALUE ary1, ary2;
 {
     VALUE ary3;
-    VALUE hash;
+    volatile VALUE hash;
     long i;
 
-    hash = ary_make_hash(to_ary(ary2));
+    hash = ary_make_hash(to_ary(ary2), 0);
     ary3 = rb_ary_new();
 
-    for (i=0; i<RARRAY_LEN(ary1); i++) {
-	if (st_lookup(rb_hash_tbl_raw(hash), RARRAY_AREF(ary1, i), 0)) continue;
+    for (i=0; i<RARRAY(ary1)->len; i++) {
+	if (st_lookup(RHASH(hash)->tbl, RARRAY(ary1)->ptr[i], 0)) continue;
 	rb_ary_push(ary3, rb_ary_elt(ary1, i));
     }
-    ary_recycle_hash(hash);
     return ary3;
 }
 
-/*
+/* 
  *  call-seq:
- *     ary & other_ary      -> new_ary
+ *     array & other_array
  *
- *  Set Intersection --- Returns a new array containing unique elements common to the
- *  two arrays. The order is preserved from the original array.
+ *  Set Intersection---Returns a new array
+ *  containing elements common to the two arrays, with no duplicates.
  *
- *  It compares elements using their #hash and #eql? methods for efficiency.
- *
- *     [ 1, 1, 3, 5 ] & [ 3, 2, 1 ]                 #=> [ 1, 3 ]
- *     [ 'a', 'b', 'b', 'z' ] & [ 'a', 'b', 'c' ]   #=> [ 'a', 'b' ]
- *
- *  See also Array#uniq.
+ *     [ 1, 1, 3, 5 ] & [ 1, 2, 3 ]   #=> [ 1, 3 ]
  */
 
 
 static VALUE
-rb_ary_and(VALUE ary1, VALUE ary2)
+rb_ary_and(ary1, ary2)
+    VALUE ary1, ary2;
 {
-    VALUE hash, ary3, v;
-    st_table *table;
-    st_data_t vv;
+    VALUE hash, ary3, v, vv;
     long i;
 
     ary2 = to_ary(ary2);
-    ary3 = rb_ary_new();
-    if (RARRAY_LEN(ary2) == 0) return ary3;
-    hash = ary_make_hash(ary2);
-    table = rb_hash_tbl_raw(hash);
-
-    for (i=0; i<RARRAY_LEN(ary1); i++) {
-	v = RARRAY_AREF(ary1, i);
-	vv = (st_data_t)v;
-	if (st_delete(table, &vv, 0)) {
+    ary3 = rb_ary_new2(RARRAY(ary1)->len < RARRAY(ary2)->len ?
+	    RARRAY(ary1)->len : RARRAY(ary2)->len);
+    hash = ary_make_hash(ary2, 0);
+
+    for (i=0; i<RARRAY(ary1)->len; i++) {
+	v = vv = rb_ary_elt(ary1, i);
+	if (st_delete(RHASH(hash)->tbl, (st_data_t*)&vv, 0)) {
 	    rb_ary_push(ary3, v);
 	}
     }
-    ary_recycle_hash(hash);
 
     return ary3;
 }
 
-static int
-ary_hash_orset(st_data_t *key, st_data_t *value, st_data_t arg, int existing)
-{
-    if (existing) return ST_STOP;
-    *key = *value = (VALUE)arg;
-    return ST_CONTINUE;
-}
-
-/*
+/* 
  *  call-seq:
- *     ary | other_ary     -> new_ary
- *
- *  Set Union --- Returns a new array by joining +ary+ with +other_ary+,
- *  excluding any duplicates and preserving the order from the given arrays.
- *
- *  It compares elements using their #hash and #eql? methods for efficiency.
+ *     array | other_array     ->  an_array
  *
- *     [ "a", "b", "c" ] | [ "c", "d", "a" ]    #=> [ "a", "b", "c", "d" ]
- *     [ "c", "d", "a" ] | [ "a", "b", "c" ]    #=> [ "c", "d", "a", "b" ]
+ *  Set Union---Returns a new array by joining this array with
+ *  other_array, removing duplicates.
  *
- *  See also Array#uniq.
+ *     [ "a", "b", "c" ] | [ "c", "d", "a" ]
+ *            #=> [ "a", "b", "c", "d" ]
  */
 
 static VALUE
-rb_ary_or(VALUE ary1, VALUE ary2)
+rb_ary_or(ary1, ary2)
+    VALUE ary1, ary2;
 {
     VALUE hash, ary3;
+    VALUE v, vv;
     long i;
 
     ary2 = to_ary(ary2);
-    hash = ary_make_hash(ary1);
+    ary3 = rb_ary_new2(RARRAY(ary1)->len+RARRAY(ary2)->len);
+    hash = ary_make_hash(ary1, ary2);
 
-    for (i=0; i<RARRAY_LEN(ary2); i++) {
-	VALUE elt = RARRAY_AREF(ary2, i);
-	if (!st_update(RHASH_TBL_RAW(hash), (st_data_t)elt, ary_hash_orset, (st_data_t)elt)) {
-	    RB_OBJ_WRITTEN(hash, Qundef, elt);
-	}
-    }
-    ary3 = rb_hash_values(hash);
-    ary_recycle_hash(hash);
-    return ary3;
-}
-
-/*
- *  call-seq:
- *     ary.max                     -> obj
- *     ary.max { |a, b| block }    -> obj
- *     ary.max(n)                  -> array
- *     ary.max(n) { |a, b| block } -> array
- *
- *  Returns the object in _ary_ with the maximum value. The
- *  first form assumes all objects implement <code>Comparable</code>;
- *  the second uses the block to return <em>a <=> b</em>.
- *
- *     a = %w(albatross dog horse)
- *     a.max                                   #=> "horse"
- *     a.max { |a, b| a.length <=> b.length }  #=> "albatross"
- *
- *  If the +n+ argument is given, maximum +n+ elements are returned
- *  as an array.
- *
- *     a = %w[albatross dog horse]
- *     a.max(2)                                  #=> ["horse", "dog"]
- *     a.max(2) {|a, b| a.length <=> b.length }  #=> ["albatross", "horse"]
- */
-static VALUE
-rb_ary_max(int argc, VALUE *argv, VALUE ary)
-{
-    struct cmp_opt_data cmp_opt = { 0, 0 };
-    VALUE result = Qundef, v;
-    VALUE num;
-    long i;
-
-    rb_scan_args(argc, argv, "01", &num);
-
-    if (!NIL_P(num))
-       return rb_nmin_run(ary, num, 0, 1, 1);
-
-    if (rb_block_given_p()) {
-	for (i = 0; i < RARRAY_LEN(ary); i++) {
-	   v = RARRAY_AREF(ary, i);
-	   if (result == Qundef || rb_cmpint(rb_yield_values(2, v, result), v, result) > 0) {
-	       result = v;
-	   }
-	}
-    }
-    else {
-	for (i = 0; i < RARRAY_LEN(ary); i++) {
-	   v = RARRAY_AREF(ary, i);
-	   if (result == Qundef || OPTIMIZED_CMP(v, result, cmp_opt) > 0) {
-	       result = v;
-	   }
-	}
-    }
-    if (result == Qundef) return Qnil;
-    return result;
-}
-
-/*
- *  call-seq:
- *     ary.min                     -> obj
- *     ary.min {| a,b | block }    -> obj
- *     ary.min(n)                  -> array
- *     ary.min(n) {| a,b | block } -> array
- *
- *  Returns the object in _ary_ with the minimum value. The
- *  first form assumes all objects implement <code>Comparable</code>;
- *  the second uses the block to return <em>a <=> b</em>.
- *
- *     a = %w(albatross dog horse)
- *     a.min                                   #=> "albatross"
- *     a.min { |a, b| a.length <=> b.length }  #=> "dog"
- *
- *  If the +n+ argument is given, minimum +n+ elements are returned
- *  as an array.
- *
- *     a = %w[albatross dog horse]
- *     a.min(2)                                  #=> ["albatross", "dog"]
- *     a.min(2) {|a, b| a.length <=> b.length }  #=> ["dog", "horse"]
- */
-static VALUE
-rb_ary_min(int argc, VALUE *argv, VALUE ary)
-{
-    struct cmp_opt_data cmp_opt = { 0, 0 };
-    VALUE result = Qundef, v;
-    VALUE num;
-    long i;
-
-    rb_scan_args(argc, argv, "01", &num);
-
-    if (!NIL_P(num))
-       return rb_nmin_run(ary, num, 0, 0, 1);
-
-    if (rb_block_given_p()) {
-	for (i = 0; i < RARRAY_LEN(ary); i++) {
-	   v = RARRAY_AREF(ary, i);
-	   if (result == Qundef || rb_cmpint(rb_yield_values(2, v, result), v, result) < 0) {
-	       result = v;
-	   }
+    for (i=0; i<RARRAY(ary1)->len; i++) {
+	v = vv = rb_ary_elt(ary1, i);
+	if (st_delete(RHASH(hash)->tbl, (st_data_t*)&vv, 0)) {
+	    rb_ary_push(ary3, v);
 	}
     }
-    else {
-	for (i = 0; i < RARRAY_LEN(ary); i++) {
-	   v = RARRAY_AREF(ary, i);
-	   if (result == Qundef || OPTIMIZED_CMP(v, result, cmp_opt) < 0) {
-	       result = v;
-	   }
+    for (i=0; i<RARRAY(ary2)->len; i++) {
+	v = vv = rb_ary_elt(ary2, i);
+	if (st_delete(RHASH(hash)->tbl, (st_data_t*)&vv, 0)) {
+	    rb_ary_push(ary3, v);
 	}
     }
-    if (result == Qundef) return Qnil;
-    return result;
-}
-
-static int
-push_value(st_data_t key, st_data_t val, st_data_t ary)
-{
-    rb_ary_push((VALUE)ary, (VALUE)val);
-    return ST_CONTINUE;
+    return ary3;
 }
 
 /*
  *  call-seq:
- *     ary.uniq!                -> ary or nil
- *     ary.uniq! { |item| ... } -> ary or nil
- *
- *  Removes duplicate elements from +self+.
- *
- *  If a block is given, it will use the return value of the block for
- *  comparison.
- *
- *  It compares values using their #hash and #eql? methods for efficiency.
- *
- *  +self+ is traversed in order, and the first occurrence is kept.
- *
- *  Returns +nil+ if no changes are made (that is, no duplicates are found).
- *
+ *     array.uniq! -> array or nil
+ *  
+ *  Removes duplicate elements from _self_.
+ *  Returns <code>nil</code> if no changes are made (that is, no
+ *  duplicates are found).
+ *     
  *     a = [ "a", "a", "b", "b", "c" ]
- *     a.uniq!   # => ["a", "b", "c"]
- *
+ *     a.uniq!   #=> ["a", "b", "c"]
  *     b = [ "a", "b", "c" ]
- *     b.uniq!   # => nil
- *
- *     c = [["student","sam"], ["student","george"], ["teacher","matz"]]
- *     c.uniq! { |s| s.first } # => [["student", "sam"], ["teacher", "matz"]]
- *
+ *     b.uniq!   #=> nil
  */
 
 static VALUE
-rb_ary_uniq_bang(VALUE ary)
+rb_ary_uniq_bang(ary)
+    VALUE ary;
 {
-    VALUE hash;
-    long hash_size;
+    VALUE hash, v, vv;
+    long i, j;
 
-    rb_ary_modify_check(ary);
-    if (RARRAY_LEN(ary) <= 1)
-        return Qnil;
-    if (rb_block_given_p())
-	hash = ary_make_hash_by(ary);
-    else
-	hash = ary_make_hash(ary);
-
-    hash_size = RHASH_SIZE(hash);
-    if (RARRAY_LEN(ary) == hash_size) {
+    hash = ary_make_hash(ary, 0);
+
+    if (RARRAY(ary)->len == RHASH(hash)->tbl->num_entries) {
 	return Qnil;
     }
-    rb_ary_modify_check(ary);
-    ARY_SET_LEN(ary, 0);
-    if (ARY_SHARED_P(ary) && !ARY_EMBED_P(ary)) {
-	rb_ary_unshare(ary);
-	FL_SET_EMBED(ary);
+    for (i=j=0; i<RARRAY(ary)->len; i++) {
+	v = vv = rb_ary_elt(ary, i);
+	if (st_delete(RHASH(hash)->tbl, (st_data_t*)&vv, 0)) {
+	    rb_ary_store(ary, j++, v);
+	}
     }
-    ary_resize_capa(ary, hash_size);
-    st_foreach(rb_hash_tbl_raw(hash), push_value, ary);
-    ary_recycle_hash(hash);
+    RARRAY(ary)->len = j;
 
     return ary;
 }
 
 /*
  *  call-seq:
- *     ary.uniq                -> new_ary
- *     ary.uniq { |item| ... } -> new_ary
- *
- *  Returns a new array by removing duplicate values in +self+.
- *
- *  If a block is given, it will use the return value of the block for comparison.
- *
- *  It compares values using their #hash and #eql? methods for efficiency.
- *
- *  +self+ is traversed in order, and the first occurrence is kept.
- *
+ *     array.uniq   -> an_array
+ *  
+ *  Returns a new array by removing duplicate values in <i>self</i>.
+ *     
  *     a = [ "a", "a", "b", "b", "c" ]
- *     a.uniq   # => ["a", "b", "c"]
- *
- *     b = [["student","sam"], ["student","george"], ["teacher","matz"]]
- *     b.uniq { |s| s.first } # => [["student", "sam"], ["teacher", "matz"]]
- *
+ *     a.uniq   #=> ["a", "b", "c"]
  */
 
 static VALUE
-rb_ary_uniq(VALUE ary)
+rb_ary_uniq(ary)
+    VALUE ary;
 {
-    VALUE hash, uniq;
-
-    if (RARRAY_LEN(ary) <= 1)
-        return rb_ary_dup(ary);
-    if (rb_block_given_p()) {
-	hash = ary_make_hash_by(ary);
-	uniq = rb_hash_values(hash);
-    }
-    else {
-	hash = ary_make_hash(ary);
-	uniq = rb_hash_values(hash);
-    }
-    RBASIC_SET_CLASS(uniq, rb_obj_class(ary));
-    ary_recycle_hash(hash);
-
-    return uniq;
+    ary = rb_ary_dup(ary);
+    rb_ary_uniq_bang(ary);
+    return ary;
 }
 
-/*
+/* 
  *  call-seq:
- *     ary.compact!    -> ary  or  nil
+ *     array.compact!    ->   array  or  nil
  *
- *  Removes +nil+ elements from the array.
- *
- *  Returns +nil+ if no changes were made, otherwise returns the array.
+ *  Removes +nil+ elements from array.
+ *  Returns +nil+ if no changes were made.
  *
  *     [ "a", nil, "b", nil, "c" ].compact! #=> [ "a", "b", "c" ]
  *     [ "a", "b", "c" ].compact!           #=> nil
  */
 
 static VALUE
-rb_ary_compact_bang(VALUE ary)
+rb_ary_compact_bang(ary)
+    VALUE ary;
 {
     VALUE *p, *t, *end;
-    long n;
 
     rb_ary_modify(ary);
-    p = t = (VALUE *)RARRAY_CONST_PTR(ary); /* WB: no new reference */
-    end = p + RARRAY_LEN(ary);
-
+    p = t = RARRAY(ary)->ptr;
+    end = p + RARRAY(ary)->len;
+    
     while (t < end) {
 	if (NIL_P(*t)) t++;
 	else *p++ = *t++;
     }
-    n = p - RARRAY_CONST_PTR(ary);
-    if (RARRAY_LEN(ary) == n) {
+    if (RARRAY(ary)->len == (p - RARRAY(ary)->ptr)) {
 	return Qnil;
     }
-    ary_resize_smaller(ary, n);
+    RARRAY(ary)->len = RARRAY(ary)->aux.capa = (p - RARRAY(ary)->ptr);
+    REALLOC_N(RARRAY(ary)->ptr, VALUE, RARRAY(ary)->len);
 
     return ary;
 }
 
 /*
  *  call-seq:
- *     ary.compact     -> new_ary
+ *     array.compact     ->  an_array
  *
- *  Returns a copy of +self+ with all +nil+ elements removed.
+ *  Returns a copy of _self_ with all +nil+ elements removed.
  *
  *     [ "a", nil, "b", nil, "c", nil ].compact
  *                       #=> [ "a", "b", "c" ]
  */
 
 static VALUE
-rb_ary_compact(VALUE ary)
+rb_ary_compact(ary)
+    VALUE ary;
 {
     ary = rb_ary_dup(ary);
     rb_ary_compact_bang(ary);
@@ -4479,1614 +2839,147 @@ rb_ary_compact(VALUE ary)
 
 /*
  *  call-seq:
- *     ary.count                   -> int
- *     ary.count(obj)              -> int
- *     ary.count { |item| block }  -> int
- *
- *  Returns the number of elements.
- *
- *  If an argument is given, counts the number of elements which equal +obj+
- *  using <code>==</code>.
- *
- *  If a block is given, counts the number of elements for which the block
- *  returns a true value.
- *
- *     ary = [1, 2, 4, 2]
- *     ary.count                  #=> 4
- *     ary.count(2)               #=> 2
- *     ary.count { |x| x%2 == 0 } #=> 3
- *
+ *     array.nitems -> int
+ *  
+ *  Returns the number of non-<code>nil</code> elements in _self_.
+ *  May be zero.
+ *     
+ *     [ 1, nil, 3, nil, 5 ].nitems   #=> 3
  */
 
 static VALUE
-rb_ary_count(int argc, VALUE *argv, VALUE ary)
+rb_ary_nitems(ary)
+    VALUE ary;
 {
-    long i, n = 0;
-
-    if (argc == 0) {
-	VALUE v;
+    long n = 0;
+    VALUE *p, *pend;
 
-	if (!rb_block_given_p())
-	    return LONG2NUM(RARRAY_LEN(ary));
+    p = RARRAY(ary)->ptr;
+    pend = p + RARRAY(ary)->len;
 
-	for (i = 0; i < RARRAY_LEN(ary); i++) {
-	    v = RARRAY_AREF(ary, i);
-	    if (RTEST(rb_yield(v))) n++;
-	}
-    }
-    else {
-	VALUE obj;
-
-	rb_scan_args(argc, argv, "1", &obj);
-	if (rb_block_given_p()) {
-	    rb_warn("given block not used");
-	}
-	for (i = 0; i < RARRAY_LEN(ary); i++) {
-	    if (rb_equal(RARRAY_AREF(ary, i), obj)) n++;
-	}
+    while (p < pend) {
+	if (!NIL_P(*p)) n++;
+	p++;
     }
-
     return LONG2NUM(n);
 }
 
-static VALUE
-flatten(VALUE ary, int level, int *modified)
+static long
+flatten(ary, idx, ary2, memo)
+    VALUE ary;
+    long idx;
+    VALUE ary2, memo;
 {
-    long i = 0;
-    VALUE stack, result, tmp, elt;
-    st_table *memo;
-    st_data_t id;
-
-    stack = ary_new(0, ARY_DEFAULT_SIZE);
-    result = ary_new(0, RARRAY_LEN(ary));
-    memo = st_init_numtable();
-    st_insert(memo, (st_data_t)ary, (st_data_t)Qtrue);
-    *modified = 0;
-
-    while (1) {
-	while (i < RARRAY_LEN(ary)) {
-	    elt = RARRAY_AREF(ary, i++);
-	    if (level >= 0 && RARRAY_LEN(stack) / 2 >= level) {
-		rb_ary_push(result, elt);
-		continue;
-	    }
-	    tmp = rb_check_array_type(elt);
-	    if (RBASIC(result)->klass) {
-		rb_raise(rb_eRuntimeError, "flatten reentered");
-	    }
-	    if (NIL_P(tmp)) {
-		rb_ary_push(result, elt);
-	    }
-	    else {
-		*modified = 1;
-		id = (st_data_t)tmp;
-		if (st_lookup(memo, id, 0)) {
-		    st_free_table(memo);
-		    rb_raise(rb_eArgError, "tried to flatten recursive array");
-		}
-		st_insert(memo, id, (st_data_t)Qtrue);
-		rb_ary_push(stack, ary);
-		rb_ary_push(stack, LONG2NUM(i));
-		ary = tmp;
-		i = 0;
-	    }
-	}
-	if (RARRAY_LEN(stack) == 0) {
-	    break;
-	}
-	id = (st_data_t)ary;
-	st_delete(memo, &id, 0);
-	tmp = rb_ary_pop(stack);
-	i = NUM2LONG(tmp);
-	ary = rb_ary_pop(stack);
+    VALUE id;
+    long i = idx;
+    long n, lim = idx + RARRAY(ary2)->len;
+
+    id = rb_obj_id(ary2);
+    if (rb_ary_includes(memo, id)) {
+	rb_raise(rb_eArgError, "tried to flatten recursive array");
     }
+    rb_ary_push(memo, id);
+    rb_ary_splice(ary, idx, 1, ary2);
+    while (i < lim) {
+	VALUE tmp;
 
-    st_free_table(memo);
+	tmp = rb_check_array_type(rb_ary_elt(ary, i));
+	if (!NIL_P(tmp)) {
+	    n = flatten(ary, i, tmp, memo);
+	    i += n; lim += n;
+	}
+	i++;
+    }
+    rb_ary_pop(memo);
 
-    RBASIC_SET_CLASS(result, rb_obj_class(ary));
-    return result;
+    return lim - idx - 1;	/* returns number of increased items */
 }
 
 /*
  *  call-seq:
- *     ary.flatten!        -> ary or nil
- *     ary.flatten!(level) -> ary or nil
- *
- *  Flattens +self+ in place.
- *
- *  Returns +nil+ if no modifications were made (i.e., the array contains no
- *  subarrays.)
- *
- *  The optional +level+ argument determines the level of recursion to flatten.
- *
+ *     array.flatten! -> array or nil
+ *  
+ *  Flattens _self_ in place.
+ *  Returns <code>nil</code> if no modifications were made (i.e.,
+ *  <i>array</i> contains no subarrays.)
+ *     
  *     a = [ 1, 2, [3, [4, 5] ] ]
  *     a.flatten!   #=> [1, 2, 3, 4, 5]
  *     a.flatten!   #=> nil
  *     a            #=> [1, 2, 3, 4, 5]
- *     a = [ 1, 2, [3, [4, 5] ] ]
- *     a.flatten!(1) #=> [1, 2, 3, [4, 5]]
  */
 
 static VALUE
-rb_ary_flatten_bang(int argc, VALUE *argv, VALUE ary)
+rb_ary_flatten_bang(ary)
+    VALUE ary;
 {
-    int mod = 0, level = -1;
-    VALUE result, lv;
+    long i = 0;
+    int mod = 0;
+    VALUE memo = Qnil;
 
-    rb_scan_args(argc, argv, "01", &lv);
-    rb_ary_modify_check(ary);
-    if (!NIL_P(lv)) level = NUM2INT(lv);
-    if (level == 0) return Qnil;
+    while (i<RARRAY(ary)->len) {
+	VALUE ary2 = RARRAY(ary)->ptr[i];
+	VALUE tmp;
 
-    result = flatten(ary, level, &mod);
-    if (mod == 0) {
-	ary_discard(result);
-	return Qnil;
+	tmp = rb_check_array_type(ary2);
+	if (!NIL_P(tmp)) {
+	    if (NIL_P(memo)) {
+		memo = rb_ary_new();
+	    }
+	    i += flatten(ary, i, tmp, memo);
+	    mod = 1;
+	}
+	i++;
     }
-    if (!(mod = ARY_EMBED_P(result))) rb_obj_freeze(result);
-    rb_ary_replace(ary, result);
-    if (mod) ARY_SET_EMBED_LEN(result, 0);
-
+    if (mod == 0) return Qnil;
     return ary;
 }
 
 /*
  *  call-seq:
- *     ary.flatten -> new_ary
- *     ary.flatten(level) -> new_ary
- *
- *  Returns a new array that is a one-dimensional flattening of +self+
- *  (recursively).
- *
- *  That is, for every element that is an array, extract its elements into
- *  the new array.
- *
- *  The optional +level+ argument determines the level of recursion to
- *  flatten.
- *
+ *     array.flatten -> an_array
+ *  
+ *  Returns a new array that is a one-dimensional flattening of this
+ *  array (recursively). That is, for every element that is an array,
+ *  extract its elements into the new array.
+ *     
  *     s = [ 1, 2, 3 ]           #=> [1, 2, 3]
  *     t = [ 4, 5, 6, [7, 8] ]   #=> [4, 5, 6, [7, 8]]
  *     a = [ s, t, 9, 10 ]       #=> [[1, 2, 3], [4, 5, 6, [7, 8]], 9, 10]
- *     a.flatten                 #=> [1, 2, 3, 4, 5, 6, 7, 8, 9, 10]
- *     a = [ 1, 2, [3, [4, 5] ] ]
- *     a.flatten(1)              #=> [1, 2, 3, [4, 5]]
+ *     a.flatten                 #=> [1, 2, 3, 4, 5, 6, 7, 8, 9, 10
  */
 
 static VALUE
-rb_ary_flatten(int argc, VALUE *argv, VALUE ary)
-{
-    int mod = 0, level = -1;
-    VALUE result, lv;
-
-    rb_scan_args(argc, argv, "01", &lv);
-    if (!NIL_P(lv)) level = NUM2INT(lv);
-    if (level == 0) return ary_make_shared_copy(ary);
-
-    result = flatten(ary, level, &mod);
-    OBJ_INFECT(result, ary);
-
-    return result;
-}
-
-#define OPTHASH_GIVEN_P(opts) \
-    (argc > 0 && !NIL_P((opts) = rb_check_hash_type(argv[argc-1])) && (--argc, 1))
-static ID id_random;
-
-#define RAND_UPTO(max) (long)rb_random_ulong_limited((randgen), (max)-1)
-
-/*
- *  call-seq:
- *     ary.shuffle!              -> ary
- *     ary.shuffle!(random: rng) -> ary
- *
- *  Shuffles elements in +self+ in place.
- *
- *     a = [ 1, 2, 3 ]           #=> [1, 2, 3]
- *     a.shuffle!                #=> [2, 3, 1]
- *     a                         #=> [2, 3, 1]
- *
- *  The optional +rng+ argument will be used as the random number generator.
- *
- *     a.shuffle!(random: Random.new(1))  #=> [1, 3, 2]
- */
-
-static VALUE
-rb_ary_shuffle_bang(int argc, VALUE *argv, VALUE ary)
-{
-    VALUE opts, randgen = rb_cRandom;
-    long i, len;
-
-    if (OPTHASH_GIVEN_P(opts)) {
-	VALUE rnd;
-	ID keyword_ids[1];
-
-	keyword_ids[0] = id_random;
-	rb_get_kwargs(opts, keyword_ids, 0, 1, &rnd);
-	if (rnd != Qundef) {
-	    randgen = rnd;
-	}
-    }
-    rb_check_arity(argc, 0, 0);
-    rb_ary_modify(ary);
-    i = len = RARRAY_LEN(ary);
-    RARRAY_PTR_USE(ary, ptr, {
-	while (i) {
-	    long j = RAND_UPTO(i);
-	    VALUE tmp;
-	    if (len != RARRAY_LEN(ary) || ptr != RARRAY_CONST_PTR(ary)) {
-		rb_raise(rb_eRuntimeError, "modified during shuffle");
-	    }
-	    tmp = ptr[--i];
-	    ptr[i] = ptr[j];
-	    ptr[j] = tmp;
-	}
-    }); /* WB: no new reference */
-    return ary;
-}
-
-
-/*
- *  call-seq:
- *     ary.shuffle              -> new_ary
- *     ary.shuffle(random: rng) -> new_ary
- *
- *  Returns a new array with elements of +self+ shuffled.
- *
- *     a = [ 1, 2, 3 ]           #=> [1, 2, 3]
- *     a.shuffle                 #=> [2, 3, 1]
- *     a                         #=> [1, 2, 3]
- *
- *  The optional +rng+ argument will be used as the random number generator.
- *
- *     a.shuffle(random: Random.new(1))  #=> [1, 3, 2]
- */
-
-static VALUE
-rb_ary_shuffle(int argc, VALUE *argv, VALUE ary)
+rb_ary_flatten(ary)
+    VALUE ary;
 {
     ary = rb_ary_dup(ary);
-    rb_ary_shuffle_bang(argc, argv, ary);
+    rb_ary_flatten_bang(ary);
     return ary;
 }
 
 
-/*
- *  call-seq:
- *     ary.sample                  -> obj
- *     ary.sample(random: rng)     -> obj
- *     ary.sample(n)               -> new_ary
- *     ary.sample(n, random: rng)  -> new_ary
- *
- *  Choose a random element or +n+ random elements from the array.
- *
- *  The elements are chosen by using random and unique indices into the array
- *  in order to ensure that an element doesn't repeat itself unless the array
- *  already contained duplicate elements.
- *
- *  If the array is empty the first form returns +nil+ and the second form
- *  returns an empty array.
- *
- *  The optional +rng+ argument will be used as the random number generator.
- *
- *     a = [ 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 ]
- *     a.sample         #=> 7
- *     a.sample(4)      #=> [6, 4, 2, 5]
- */
-
-
-static VALUE
-rb_ary_sample(int argc, VALUE *argv, VALUE ary)
-{
-    VALUE nv, result;
-    VALUE opts, randgen = rb_cRandom;
-    long n, len, i, j, k, idx[10];
-    long rnds[numberof(idx)];
-
-    if (OPTHASH_GIVEN_P(opts)) {
-	VALUE rnd;
-	ID keyword_ids[1];
-
-	keyword_ids[0] = id_random;
-	rb_get_kwargs(opts, keyword_ids, 0, 1, &rnd);
-	if (rnd != Qundef) {
-	    randgen = rnd;
-	}
-    }
-    len = RARRAY_LEN(ary);
-    if (argc == 0) {
-	if (len < 2)
-	    i = 0;
-	else
-	    i = RAND_UPTO(len);
-
-	return rb_ary_elt(ary, i);
-    }
-    rb_scan_args(argc, argv, "1", &nv);
-    n = NUM2LONG(nv);
-    if (n < 0) rb_raise(rb_eArgError, "negative sample number");
-    if (n > len) n = len;
-    if (n <= numberof(idx)) {
-	for (i = 0; i < n; ++i) {
-	    rnds[i] = RAND_UPTO(len - i);
-	}
-    }
-    k = len;
-    len = RARRAY_LEN(ary);
-    if (len < k && n <= numberof(idx)) {
-	for (i = 0; i < n; ++i) {
-	    if (rnds[i] >= len) return rb_ary_new_capa(0);
-	}
-    }
-    if (n > len) n = len;
-    switch (n) {
-      case 0:
-	return rb_ary_new_capa(0);
-      case 1:
-	i = rnds[0];
-	return rb_ary_new_from_values(1, &RARRAY_AREF(ary, i));
-      case 2:
-	i = rnds[0];
-	j = rnds[1];
-	if (j >= i) j++;
-	return rb_ary_new_from_args(2, RARRAY_AREF(ary, i), RARRAY_AREF(ary, j));
-      case 3:
-	i = rnds[0];
-	j = rnds[1];
-	k = rnds[2];
-	{
-	    long l = j, g = i;
-	    if (j >= i) l = i, g = ++j;
-	    if (k >= l && (++k >= g)) ++k;
-	}
-	return rb_ary_new_from_args(3, RARRAY_AREF(ary, i), RARRAY_AREF(ary, j), RARRAY_AREF(ary, k));
-    }
-    if (n <= numberof(idx)) {
-	long sorted[numberof(idx)];
-	sorted[0] = idx[0] = rnds[0];
-	for (i=1; i<n; i++) {
-	    k = rnds[i];
-	    for (j = 0; j < i; ++j) {
-		if (k < sorted[j]) break;
-		++k;
-	    }
-	    memmove(&sorted[j+1], &sorted[j], sizeof(sorted[0])*(i-j));
-	    sorted[j] = idx[i] = k;
-	}
-	result = rb_ary_new_capa(n);
-	RARRAY_PTR_USE(result, ptr_result, {
-	    for (i=0; i<n; i++) {
-		ptr_result[i] = RARRAY_AREF(ary, idx[i]);
-	    }
-	});
-    }
-    else {
-	result = rb_ary_dup(ary);
-	RBASIC_CLEAR_CLASS(result);
-	RB_GC_GUARD(ary);
-	RARRAY_PTR_USE(result, ptr_result, {
-	    for (i=0; i<n; i++) {
-		j = RAND_UPTO(len-i) + i;
-		nv = ptr_result[j];
-		ptr_result[j] = ptr_result[i];
-		ptr_result[i] = nv;
-	    }
-	});
-	RBASIC_SET_CLASS_RAW(result, rb_cArray);
-    }
-    ARY_SET_LEN(result, n);
-
-    return result;
-}
-
-static VALUE
-rb_ary_cycle_size(VALUE self, VALUE args, VALUE eobj)
-{
-    long mul;
-    VALUE n = Qnil;
-    if (args && (RARRAY_LEN(args) > 0)) {
-	n = RARRAY_AREF(args, 0);
-    }
-    if (RARRAY_LEN(self) == 0) return INT2FIX(0);
-    if (n == Qnil) return DBL2NUM(INFINITY);
-    mul = NUM2LONG(n);
-    if (mul <= 0) return INT2FIX(0);
-    n = LONG2FIX(mul);
-    return rb_funcallv(rb_ary_length(self), '*', 1, &n);
-}
-
-/*
- *  call-seq:
- *     ary.cycle(n=nil) { |obj| block }  -> nil
- *     ary.cycle(n=nil)                  -> Enumerator
- *
- *  Calls the given block for each element +n+ times or forever if +nil+ is
- *  given.
- *
- *  Does nothing if a non-positive number is given or the array is empty.
- *
- *  Returns +nil+ if the loop has finished without getting interrupted.
- *
- *  If no block is given, an Enumerator is returned instead.
- *
- *     a = ["a", "b", "c"]
- *     a.cycle { |x| puts x }     # print, a, b, c, a, b, c,.. forever.
- *     a.cycle(2) { |x| puts x }  # print, a, b, c, a, b, c.
- *
- */
-
-static VALUE
-rb_ary_cycle(int argc, VALUE *argv, VALUE ary)
-{
-    long n, i;
-    VALUE nv = Qnil;
-
-    rb_scan_args(argc, argv, "01", &nv);
-
-    RETURN_SIZED_ENUMERATOR(ary, argc, argv, rb_ary_cycle_size);
-    if (NIL_P(nv)) {
-        n = -1;
-    }
-    else {
-        n = NUM2LONG(nv);
-        if (n <= 0) return Qnil;
-    }
-
-    while (RARRAY_LEN(ary) > 0 && (n < 0 || 0 < n--)) {
-        for (i=0; i<RARRAY_LEN(ary); i++) {
-            rb_yield(RARRAY_AREF(ary, i));
-        }
-    }
-    return Qnil;
-}
-
-#define tmpbuf(n, size) rb_str_tmp_new((n)*(size))
-#define tmpbuf_discard(s) (rb_str_resize((s), 0L), RBASIC_SET_CLASS_RAW(s, rb_cString))
-#define tmpary(n) rb_ary_tmp_new(n)
-#define tmpary_discard(a) (ary_discard(a), RBASIC_SET_CLASS_RAW(a, rb_cArray))
-
-/*
- * Build a ruby array of the corresponding values and yield it to the
- * associated block.
- * Return the class of +values+ for reentry check.
- */
-static int
-yield_indexed_values(const VALUE values, const long r, const long *const p)
-{
-    const VALUE result = rb_ary_new2(r);
-    VALUE *const result_array = RARRAY_PTR(result);
-    const VALUE *const values_array = RARRAY_CONST_PTR(values);
-    long i;
-
-    for (i = 0; i < r; i++) result_array[i] = values_array[p[i]];
-    ARY_SET_LEN(result, r);
-    rb_yield(result);
-    return !RBASIC(values)->klass;
-}
-
-/*
- * Compute permutations of +r+ elements of the set <code>[0..n-1]</code>.
- *
- * When we have a complete permutation of array indices, copy the values
- * at those indices into a new array and yield that array.
- *
- * n: the size of the set
- * r: the number of elements in each permutation
- * p: the array (of size r) that we're filling in
- * used: an array of booleans: whether a given index is already used
- * values: the Ruby array that holds the actual values to permute
- */
-static void
-permute0(const long n, const long r, long *const p, char *const used, const VALUE values)
-{
-    long i = 0, index = 0;
-
-    for (;;) {
-	const char *const unused = memchr(&used[i], 0, n-i);
-	if (!unused) {
-	    if (!index) break;
-	    i = p[--index];                /* pop index */
-	    used[i++] = 0;                 /* index unused */
-	}
-	else {
-	    i = unused - used;
-	    p[index] = i;
-	    used[i] = 1;                   /* mark index used */
-	    ++index;
-	    if (index < r-1) {             /* if not done yet */
-		p[index] = i = 0;
-		continue;
-	    }
-	    for (i = 0; i < n; ++i) {
-		if (used[i]) continue;
-		p[index] = i;
-		if (!yield_indexed_values(values, r, p)) {
-		    rb_raise(rb_eRuntimeError, "permute reentered");
-		}
-	    }
-	    i = p[--index];                /* pop index */
-	    used[i] = 0;                   /* index unused */
-	    p[index] = ++i;
-	}
-    }
-}
-
-/*
- * Returns the product of from, from-1, ..., from - how_many + 1.
- * http://en.wikipedia.org/wiki/Pochhammer_symbol
- */
-static VALUE
-descending_factorial(long from, long how_many)
-{
-    VALUE cnt = LONG2FIX(how_many >= 0);
-    while (how_many-- > 0) {
-	VALUE v = LONG2FIX(from--);
-	cnt = rb_funcallv(cnt, '*', 1, &v);
-    }
-    return cnt;
-}
-
-static VALUE
-binomial_coefficient(long comb, long size)
-{
-    VALUE r, v;
-    if (comb > size-comb) {
-	comb = size-comb;
-    }
-    if (comb < 0) {
-	return LONG2FIX(0);
-    }
-    r = descending_factorial(size, comb);
-    v = descending_factorial(comb, comb);
-    return rb_funcallv(r, id_div, 1, &v);
-}
-
-static VALUE
-rb_ary_permutation_size(VALUE ary, VALUE args, VALUE eobj)
-{
-    long n = RARRAY_LEN(ary);
-    long k = (args && (RARRAY_LEN(args) > 0)) ? NUM2LONG(RARRAY_AREF(args, 0)) : n;
-
-    return descending_factorial(n, k);
-}
-
-/*
- *  call-seq:
- *     ary.permutation { |p| block }          -> ary
- *     ary.permutation                        -> Enumerator
- *     ary.permutation(n) { |p| block }       -> ary
- *     ary.permutation(n)                     -> Enumerator
- *
- * When invoked with a block, yield all permutations of length +n+ of the
- * elements of the array, then return the array itself.
- *
- * If +n+ is not specified, yield all permutations of all elements.
- *
- * The implementation makes no guarantees about the order in which the
- * permutations are yielded.
- *
- * If no block is given, an Enumerator is returned instead.
- *
- * Examples:
- *
- *   a = [1, 2, 3]
- *   a.permutation.to_a    #=> [[1,2,3],[1,3,2],[2,1,3],[2,3,1],[3,1,2],[3,2,1]]
- *   a.permutation(1).to_a #=> [[1],[2],[3]]
- *   a.permutation(2).to_a #=> [[1,2],[1,3],[2,1],[2,3],[3,1],[3,2]]
- *   a.permutation(3).to_a #=> [[1,2,3],[1,3,2],[2,1,3],[2,3,1],[3,1,2],[3,2,1]]
- *   a.permutation(0).to_a #=> [[]] # one permutation of length 0
- *   a.permutation(4).to_a #=> []   # no permutations of length 4
- */
-
-static VALUE
-rb_ary_permutation(int argc, VALUE *argv, VALUE ary)
-{
-    VALUE num;
-    long r, n, i;
-
-    n = RARRAY_LEN(ary);                  /* Array length */
-    RETURN_SIZED_ENUMERATOR(ary, argc, argv, rb_ary_permutation_size);   /* Return enumerator if no block */
-    rb_scan_args(argc, argv, "01", &num);
-    r = NIL_P(num) ? n : NUM2LONG(num);   /* Permutation size from argument */
-
-    if (r < 0 || n < r) {
-	/* no permutations: yield nothing */
-    }
-    else if (r == 0) { /* exactly one permutation: the zero-length array */
-	rb_yield(rb_ary_new2(0));
-    }
-    else if (r == 1) { /* this is a special, easy case */
-	for (i = 0; i < RARRAY_LEN(ary); i++) {
-	    rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
-	}
-    }
-    else {             /* this is the general case */
-	volatile VALUE t0;
-	long *p = ALLOCV_N(long, t0, r+roomof(n, sizeof(long)));
-	char *used = (char*)(p + r);
-	VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
-	RBASIC_CLEAR_CLASS(ary0);
-
-	MEMZERO(used, char, n); /* initialize array */
-
-	permute0(n, r, p, used, ary0); /* compute and yield permutations */
-	ALLOCV_END(t0);
-	RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
-    }
-    return ary;
-}
-
-static void
-combinate0(const long len, const long n, long *const stack, const VALUE values)
-{
-    long lev = 0;
-
-    MEMZERO(stack+1, long, n);
-    stack[0] = -1;
-    for (;;) {
-	for (lev++; lev < n; lev++) {
-	    stack[lev+1] = stack[lev]+1;
-	}
-	if (!yield_indexed_values(values, n, stack+1)) {
-	    rb_raise(rb_eRuntimeError, "combination reentered");
-	}
-	do {
-	    if (lev == 0) return;
-	    stack[lev--]++;
-	} while (stack[lev+1]+n == len+lev+1);
-    }
-}
-
-static VALUE
-rb_ary_combination_size(VALUE ary, VALUE args, VALUE eobj)
-{
-    long n = RARRAY_LEN(ary);
-    long k = NUM2LONG(RARRAY_AREF(args, 0));
-
-    return binomial_coefficient(k, n);
-}
-
-/*
- *  call-seq:
- *     ary.combination(n) { |c| block }    -> ary
- *     ary.combination(n)                  -> Enumerator
- *
- * When invoked with a block, yields all combinations of length +n+ of elements
- * from the array and then returns the array itself.
- *
- * The implementation makes no guarantees about the order in which the
- * combinations are yielded.
- *
- * If no block is given, an Enumerator is returned instead.
- *
- * Examples:
- *
- *     a = [1, 2, 3, 4]
- *     a.combination(1).to_a  #=> [[1],[2],[3],[4]]
- *     a.combination(2).to_a  #=> [[1,2],[1,3],[1,4],[2,3],[2,4],[3,4]]
- *     a.combination(3).to_a  #=> [[1,2,3],[1,2,4],[1,3,4],[2,3,4]]
- *     a.combination(4).to_a  #=> [[1,2,3,4]]
- *     a.combination(0).to_a  #=> [[]] # one combination of length 0
- *     a.combination(5).to_a  #=> []   # no combinations of length 5
- *
- */
-
-static VALUE
-rb_ary_combination(VALUE ary, VALUE num)
-{
-    long i, n, len;
-
-    n = NUM2LONG(num);
-    RETURN_SIZED_ENUMERATOR(ary, 1, &num, rb_ary_combination_size);
-    len = RARRAY_LEN(ary);
-    if (n < 0 || len < n) {
-	/* yield nothing */
-    }
-    else if (n == 0) {
-	rb_yield(rb_ary_new2(0));
-    }
-    else if (n == 1) {
-	for (i = 0; i < len; i++) {
-	    rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
-	}
-    }
-    else {
-	VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
-	volatile VALUE t0;
-	long *stack = ALLOCV_N(long, t0, n+1);
-
-	RBASIC_CLEAR_CLASS(ary0);
-	combinate0(len, n, stack, ary0);
-	ALLOCV_END(t0);
-	RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
-    }
-    return ary;
-}
-
-/*
- * Compute repeated permutations of +r+ elements of the set
- * <code>[0..n-1]</code>.
- *
- * When we have a complete repeated permutation of array indices, copy the
- * values at those indices into a new array and yield that array.
- *
- * n: the size of the set
- * r: the number of elements in each permutation
- * p: the array (of size r) that we're filling in
- * values: the Ruby array that holds the actual values to permute
- */
-static void
-rpermute0(const long n, const long r, long *const p, const VALUE values)
-{
-    long i = 0, index = 0;
-
-    p[index] = i;
-    for (;;) {
-	if (++index < r-1) {
-	    p[index] = i = 0;
-	    continue;
-	}
-	for (i = 0; i < n; ++i) {
-	    p[index] = i;
-	    if (!yield_indexed_values(values, r, p)) {
-		rb_raise(rb_eRuntimeError, "repeated permute reentered");
-	    }
-	}
-	do {
-	    if (index <= 0) return;
-	} while ((i = ++p[--index]) >= n);
-    }
-}
-
-static VALUE
-rb_ary_repeated_permutation_size(VALUE ary, VALUE args, VALUE eobj)
-{
-    long n = RARRAY_LEN(ary);
-    long k = NUM2LONG(RARRAY_AREF(args, 0));
-    VALUE v;
-
-    if (k < 0) {
-	return LONG2FIX(0);
-    }
-
-    v = LONG2NUM(k);
-    return rb_funcallv(LONG2NUM(n), id_power, 1, &v);
-}
-
-/*
- *  call-seq:
- *     ary.repeated_permutation(n) { |p| block } -> ary
- *     ary.repeated_permutation(n)               -> Enumerator
- *
- * When invoked with a block, yield all repeated permutations of length +n+ of
- * the elements of the array, then return the array itself.
- *
- * The implementation makes no guarantees about the order in which the repeated
- * permutations are yielded.
- *
- * If no block is given, an Enumerator is returned instead.
- *
- * Examples:
- *
- *     a = [1, 2]
- *     a.repeated_permutation(1).to_a  #=> [[1], [2]]
- *     a.repeated_permutation(2).to_a  #=> [[1,1],[1,2],[2,1],[2,2]]
- *     a.repeated_permutation(3).to_a  #=> [[1,1,1],[1,1,2],[1,2,1],[1,2,2],
- *                                     #    [2,1,1],[2,1,2],[2,2,1],[2,2,2]]
- *     a.repeated_permutation(0).to_a  #=> [[]] # one permutation of length 0
- */
-
-static VALUE
-rb_ary_repeated_permutation(VALUE ary, VALUE num)
-{
-    long r, n, i;
-
-    n = RARRAY_LEN(ary);                  /* Array length */
-    RETURN_SIZED_ENUMERATOR(ary, 1, &num, rb_ary_repeated_permutation_size);      /* Return Enumerator if no block */
-    r = NUM2LONG(num);                    /* Permutation size from argument */
-
-    if (r < 0) {
-	/* no permutations: yield nothing */
-    }
-    else if (r == 0) { /* exactly one permutation: the zero-length array */
-	rb_yield(rb_ary_new2(0));
-    }
-    else if (r == 1) { /* this is a special, easy case */
-	for (i = 0; i < RARRAY_LEN(ary); i++) {
-	    rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
-	}
-    }
-    else {             /* this is the general case */
-	volatile VALUE t0;
-	long *p = ALLOCV_N(long, t0, r);
-	VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
-	RBASIC_CLEAR_CLASS(ary0);
-
-	rpermute0(n, r, p, ary0); /* compute and yield repeated permutations */
-	ALLOCV_END(t0);
-	RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
-    }
-    return ary;
-}
-
-static void
-rcombinate0(const long n, const long r, long *const p, const long rest, const VALUE values)
-{
-    long i = 0, index = 0;
-
-    p[index] = i;
-    for (;;) {
-	if (++index < r-1) {
-	    p[index] = i;
-	    continue;
-	}
-	for (; i < n; ++i) {
-	    p[index] = i;
-	    if (!yield_indexed_values(values, r, p)) {
-		rb_raise(rb_eRuntimeError, "repeated combination reentered");
-	    }
-	}
-	do {
-	    if (index <= 0) return;
-	} while ((i = ++p[--index]) >= n);
-    }
-}
-
-static VALUE
-rb_ary_repeated_combination_size(VALUE ary, VALUE args, VALUE eobj)
-{
-    long n = RARRAY_LEN(ary);
-    long k = NUM2LONG(RARRAY_AREF(args, 0));
-    if (k == 0) {
-	return LONG2FIX(1);
-    }
-    return binomial_coefficient(k, n + k - 1);
-}
-
-/*
- *  call-seq:
- *     ary.repeated_combination(n) { |c| block } -> ary
- *     ary.repeated_combination(n)               -> Enumerator
- *
- * When invoked with a block, yields all repeated combinations of length +n+ of
- * elements from the array and then returns the array itself.
- *
- * The implementation makes no guarantees about the order in which the repeated
- * combinations are yielded.
- *
- * If no block is given, an Enumerator is returned instead.
- *
- * Examples:
- *
- *   a = [1, 2, 3]
- *   a.repeated_combination(1).to_a  #=> [[1], [2], [3]]
- *   a.repeated_combination(2).to_a  #=> [[1,1],[1,2],[1,3],[2,2],[2,3],[3,3]]
- *   a.repeated_combination(3).to_a  #=> [[1,1,1],[1,1,2],[1,1,3],[1,2,2],[1,2,3],
- *                                   #    [1,3,3],[2,2,2],[2,2,3],[2,3,3],[3,3,3]]
- *   a.repeated_combination(4).to_a  #=> [[1,1,1,1],[1,1,1,2],[1,1,1,3],[1,1,2,2],[1,1,2,3],
- *                                   #    [1,1,3,3],[1,2,2,2],[1,2,2,3],[1,2,3,3],[1,3,3,3],
- *                                   #    [2,2,2,2],[2,2,2,3],[2,2,3,3],[2,3,3,3],[3,3,3,3]]
- *   a.repeated_combination(0).to_a  #=> [[]] # one combination of length 0
- *
- */
-
-static VALUE
-rb_ary_repeated_combination(VALUE ary, VALUE num)
-{
-    long n, i, len;
-
-    n = NUM2LONG(num);                 /* Combination size from argument */
-    RETURN_SIZED_ENUMERATOR(ary, 1, &num, rb_ary_repeated_combination_size);   /* Return enumerator if no block */
-    len = RARRAY_LEN(ary);
-    if (n < 0) {
-	/* yield nothing */
-    }
-    else if (n == 0) {
-	rb_yield(rb_ary_new2(0));
-    }
-    else if (n == 1) {
-	for (i = 0; i < len; i++) {
-	    rb_yield(rb_ary_new3(1, RARRAY_AREF(ary, i)));
-	}
-    }
-    else if (len == 0) {
-	/* yield nothing */
-    }
-    else {
-	volatile VALUE t0;
-	long *p = ALLOCV_N(long, t0, n);
-	VALUE ary0 = ary_make_shared_copy(ary); /* private defensive copy of ary */
-	RBASIC_CLEAR_CLASS(ary0);
-
-	rcombinate0(len, n, p, n, ary0); /* compute and yield repeated combinations */
-	ALLOCV_END(t0);
-	RBASIC_SET_CLASS_RAW(ary0, rb_cArray);
-    }
-    return ary;
-}
-
-/*
- *  call-seq:
- *     ary.product(other_ary, ...)                -> new_ary
- *     ary.product(other_ary, ...) { |p| block }  -> ary
- *
- *  Returns an array of all combinations of elements from all arrays.
- *
- *  The length of the returned array is the product of the length of +self+ and
- *  the argument arrays.
- *
- *  If given a block, #product will yield all combinations and return +self+
- *  instead.
- *
- *     [1,2,3].product([4,5])     #=> [[1,4],[1,5],[2,4],[2,5],[3,4],[3,5]]
- *     [1,2].product([1,2])       #=> [[1,1],[1,2],[2,1],[2,2]]
- *     [1,2].product([3,4],[5,6]) #=> [[1,3,5],[1,3,6],[1,4,5],[1,4,6],
- *                                #     [2,3,5],[2,3,6],[2,4,5],[2,4,6]]
- *     [1,2].product()            #=> [[1],[2]]
- *     [1,2].product([])          #=> []
- */
-
-static VALUE
-rb_ary_product(int argc, VALUE *argv, VALUE ary)
-{
-    int n = argc+1;    /* How many arrays we're operating on */
-    volatile VALUE t0 = tmpary(n);
-    volatile VALUE t1 = tmpbuf(n, sizeof(int));
-    VALUE *arrays = RARRAY_PTR(t0); /* The arrays we're computing the product of */
-    int *counters = (int*)RSTRING_PTR(t1); /* The current position in each one */
-    VALUE result = Qnil;      /* The array we'll be returning, when no block given */
-    long i,j;
-    long resultlen = 1;
-
-    RBASIC_CLEAR_CLASS(t0);
-    RBASIC_CLEAR_CLASS(t1);
-
-    /* initialize the arrays of arrays */
-    ARY_SET_LEN(t0, n);
-    arrays[0] = ary;
-    for (i = 1; i < n; i++) arrays[i] = Qnil;
-    for (i = 1; i < n; i++) arrays[i] = to_ary(argv[i-1]);
-
-    /* initialize the counters for the arrays */
-    for (i = 0; i < n; i++) counters[i] = 0;
-
-    /* Otherwise, allocate and fill in an array of results */
-    if (rb_block_given_p()) {
-	/* Make defensive copies of arrays; exit if any is empty */
-	for (i = 0; i < n; i++) {
-	    if (RARRAY_LEN(arrays[i]) == 0) goto done;
-	    arrays[i] = ary_make_shared_copy(arrays[i]);
-	}
-    }
-    else {
-	/* Compute the length of the result array; return [] if any is empty */
-	for (i = 0; i < n; i++) {
-	    long k = RARRAY_LEN(arrays[i]);
-	    if (k == 0) {
-		result = rb_ary_new2(0);
-		goto done;
-	    }
-            if (MUL_OVERFLOW_LONG_P(resultlen, k))
-		rb_raise(rb_eRangeError, "too big to product");
-	    resultlen *= k;
-	}
-	result = rb_ary_new2(resultlen);
-    }
-    for (;;) {
-	int m;
-	/* fill in one subarray */
-	VALUE subarray = rb_ary_new2(n);
-	for (j = 0; j < n; j++) {
-	    rb_ary_push(subarray, rb_ary_entry(arrays[j], counters[j]));
-	}
-
-	/* put it on the result array */
-	if (NIL_P(result)) {
-	    FL_SET(t0, FL_USER5);
-	    rb_yield(subarray);
-	    if (! FL_TEST(t0, FL_USER5)) {
-		rb_raise(rb_eRuntimeError, "product reentered");
-	    }
-	    else {
-		FL_UNSET(t0, FL_USER5);
-	    }
-	}
-	else {
-	    rb_ary_push(result, subarray);
-	}
-
-	/*
-	 * Increment the last counter.  If it overflows, reset to 0
-	 * and increment the one before it.
-	 */
-	m = n-1;
-	counters[m]++;
-	while (counters[m] == RARRAY_LEN(arrays[m])) {
-	    counters[m] = 0;
-	    /* If the first counter overflows, we are done */
-	    if (--m < 0) goto done;
-	    counters[m]++;
-	}
-    }
-done:
-    tmpary_discard(t0);
-    tmpbuf_discard(t1);
-
-    return NIL_P(result) ? ary : result;
-}
-
-/*
- *  call-seq:
- *     ary.take(n)               -> new_ary
- *
- *  Returns first +n+ elements from the array.
- *
- *  If a negative number is given, raises an ArgumentError.
- *
- *  See also Array#drop
- *
- *     a = [1, 2, 3, 4, 5, 0]
- *     a.take(3)             #=> [1, 2, 3]
- *
- */
-
-static VALUE
-rb_ary_take(VALUE obj, VALUE n)
-{
-    long len = NUM2LONG(n);
-    if (len < 0) {
-	rb_raise(rb_eArgError, "attempt to take negative size");
-    }
-    return rb_ary_subseq(obj, 0, len);
-}
-
-/*
- *  call-seq:
- *     ary.take_while { |obj| block }  -> new_ary
- *     ary.take_while                  -> Enumerator
- *
- *  Passes elements to the block until the block returns +nil+ or +false+, then
- *  stops iterating and returns an array of all prior elements.
- *
- *  If no block is given, an Enumerator is returned instead.
- *
- *  See also Array#drop_while
- *
- *     a = [1, 2, 3, 4, 5, 0]
- *     a.take_while { |i| i < 3 }  #=> [1, 2]
- *
- */
-
-static VALUE
-rb_ary_take_while(VALUE ary)
-{
-    long i;
-
-    RETURN_ENUMERATOR(ary, 0, 0);
-    for (i = 0; i < RARRAY_LEN(ary); i++) {
-	if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) break;
-    }
-    return rb_ary_take(ary, LONG2FIX(i));
-}
-
-/*
- *  call-seq:
- *     ary.drop(n)               -> new_ary
- *
- *  Drops first +n+ elements from +ary+ and returns the rest of the elements in
- *  an array.
- *
- *  If a negative number is given, raises an ArgumentError.
- *
- *  See also Array#take
- *
- *     a = [1, 2, 3, 4, 5, 0]
- *     a.drop(3)             #=> [4, 5, 0]
- *
- */
-
-static VALUE
-rb_ary_drop(VALUE ary, VALUE n)
-{
-    VALUE result;
-    long pos = NUM2LONG(n);
-    if (pos < 0) {
-	rb_raise(rb_eArgError, "attempt to drop negative size");
-    }
-
-    result = rb_ary_subseq(ary, pos, RARRAY_LEN(ary));
-    if (result == Qnil) result = rb_ary_new();
-    return result;
-}
-
-/*
- *  call-seq:
- *     ary.drop_while { |obj| block }   -> new_ary
- *     ary.drop_while                  -> Enumerator
- *
- *  Drops elements up to, but not including, the first element for which the
- *  block returns +nil+ or +false+ and returns an array containing the
- *  remaining elements.
- *
- *  If no block is given, an Enumerator is returned instead.
- *
- *  See also Array#take_while
- *
- *     a = [1, 2, 3, 4, 5, 0]
- *     a.drop_while {|i| i < 3 }   #=> [3, 4, 5, 0]
- *
- */
-
-static VALUE
-rb_ary_drop_while(VALUE ary)
-{
-    long i;
-
-    RETURN_ENUMERATOR(ary, 0, 0);
-    for (i = 0; i < RARRAY_LEN(ary); i++) {
-	if (!RTEST(rb_yield(RARRAY_AREF(ary, i)))) break;
-    }
-    return rb_ary_drop(ary, LONG2FIX(i));
-}
-
-/*
- *  call-seq:
- *     ary.any? [{ |obj| block }]   -> true or false
- *
- *  See also Enumerable#any?
- */
-
-static VALUE
-rb_ary_any_p(VALUE ary)
-{
-    long i, len = RARRAY_LEN(ary);
-    const VALUE *ptr = RARRAY_CONST_PTR(ary);
-
-    if (!len) return Qfalse;
-    if (!rb_block_given_p()) {
-	for (i = 0; i < len; ++i) if (RTEST(ptr[i])) return Qtrue;
-    }
-    else {
-	for (i = 0; i < RARRAY_LEN(ary); ++i) {
-	    if (RTEST(rb_yield(RARRAY_AREF(ary, i)))) return Qtrue;
-	}
-    }
-    return Qfalse;
-}
-
-/*
- * call-seq:
- *   ary.dig(idx, ...)                 -> object
- *
- * Extracts the nested value specified by the sequence of <i>idx</i>
- * objects by calling +dig+ at each step, returning +nil+ if any
- * intermediate step is +nil+.
- *
- *   a = [[1, [2, 3]]]
- *
- *   a.dig(0, 1, 1)                    #=> 3
- *   a.dig(1, 2, 3)                    #=> nil
- *   a.dig(0, 0, 0)                    #=> TypeError: Fixnum does not have #dig method
- *   [42, {foo: :bar}].dig(1, :foo)    #=> :bar
- */
-
-VALUE
-rb_ary_dig(int argc, VALUE *argv, VALUE self)
-{
-    rb_check_arity(argc, 1, UNLIMITED_ARGUMENTS);
-    self = rb_ary_at(self, *argv);
-    if (!--argc) return self;
-    ++argv;
-    return rb_obj_dig(argc, argv, self, Qnil);
-}
-
-/*
- * call-seq:
- *   ary.sum(init=0)                    -> number
- *   ary.sum(init=0) {|e| expr }        -> number
- *
- * Returns the sum of elements.
- * For example, [e1, e2, e3].sum returns init + e1 + e2 + e3.
- *
- * If a block is given, the block is applied to each element
- * before addition.
- *
- * If <i>ary</i> is empty, it returns <i>init</i>.
- *
- *   [].sum                             #=> 0
- *   [].sum(0.0)                        #=> 0.0
- *   [1, 2, 3].sum                      #=> 6
- *   [3, 5.5].sum                       #=> 8.5
- *   [2.5, 3.0].sum(0.0) {|e| e * e }   #=> 15.25
- *   [Object.new].sum                   #=> TypeError
- *
- * The (arithmetic) mean value of an array can be obtained as follows.
- *
- *   mean = ary.sum(0.0) / ary.length
- *
- * This method can be used for non-numeric objects by
- * explicit <i>init</i> argument.
- *
- *   ["a", "b", "c"].sum("")            #=> "abc"
- *   [[1], [[2]], [3]].sum([])          #=> [1, [2], 3]
- *
- * However, Array#join and Array#flatten is faster than Array#sum.
- *
- *   ["a", "b", "c"].join               #=> "abc"
- *   [[1], [[2]], [3]].flatten(1)       #=> [1, [2], 3]
- *
- *
- * Array#sum method may not respect method redefinition of "+" methods
- * such as Fixnum#+.
- *
- */
-
-static VALUE
-rb_ary_sum(int argc, VALUE *argv, VALUE ary)
-{
-    VALUE e, v, r;
-    long i, n;
-    int block_given;
-
-    if (rb_scan_args(argc, argv, "01", &v) == 0)
-        v = LONG2FIX(0);
-
-    block_given = rb_block_given_p();
-
-    if (RARRAY_LEN(ary) == 0)
-        return v;
-
-    n = 0;
-    r = Qundef;
-    for (i = 0; i < RARRAY_LEN(ary); i++) {
-        e = RARRAY_AREF(ary, i);
-        if (block_given)
-            e = rb_yield(e);
-        if (FIXNUM_P(e)) {
-            n += FIX2LONG(e); /* should not overflow long type */
-            if (!FIXABLE(n)) {
-                v = rb_big_plus(LONG2NUM(n), v);
-                n = 0;
-            }
-        }
-        else if (RB_TYPE_P(e, T_BIGNUM))
-            v = rb_big_plus(e, v);
-        else if (RB_TYPE_P(e, T_RATIONAL)) {
-            if (r == Qundef)
-                r = e;
-            else
-                r = rb_rational_plus(r, e);
-        }
-        else
-            goto not_exact;
-    }
-    if (n != 0)
-        v = rb_fix_plus(LONG2FIX(n), v);
-    if (r != Qundef) {
-        /* r can be a Integer when mathn is loaded */
-        if (FIXNUM_P(r))
-            v = rb_fix_plus(r, v);
-        else if (RB_TYPE_P(r, T_BIGNUM))
-            v = rb_big_plus(r, v);
-        else
-            v = rb_rational_plus(r, v);
-    }
-    return v;
-
-  not_exact:
-    if (n != 0)
-        v = rb_fix_plus(LONG2FIX(n), v);
-    if (r != Qundef) {
-        /* r can be a Integer when mathn is loaded */
-        if (FIXNUM_P(r))
-            v = rb_fix_plus(r, v);
-        else if (RB_TYPE_P(r, T_BIGNUM))
-            v = rb_big_plus(r, v);
-        else
-            v = rb_rational_plus(r, v);
-    }
-
-    if (RB_FLOAT_TYPE_P(e)) {
-        /* Kahan's compensated summation algorithm */
-        double f, c;
-
-        f = NUM2DBL(v);
-        c = 0.0;
-        goto has_float_value;
-        for (; i < RARRAY_LEN(ary); i++) {
-            double x, y, t;
-            e = RARRAY_AREF(ary, i);
-            if (block_given)
-                e = rb_yield(e);
-            if (RB_FLOAT_TYPE_P(e))
-              has_float_value:
-                x = RFLOAT_VALUE(e);
-            else if (FIXNUM_P(e))
-                x = FIX2LONG(e);
-            else if (RB_TYPE_P(e, T_BIGNUM))
-                x = rb_big2dbl(e);
-            else if (RB_TYPE_P(e, T_RATIONAL))
-                x = rb_num2dbl(e);
-            else
-                goto not_float;
-
-            y = x - c;
-            t = f + y;
-            c = (t - f) - y;
-            f = t;
-        }
-        return DBL2NUM(f);
-
-      not_float:
-        v = DBL2NUM(f);
-    }
-
-    goto has_some_value;
-    for (; i < RARRAY_LEN(ary); i++) {
-        e = RARRAY_AREF(ary, i);
-        if (block_given)
-            e = rb_yield(e);
-      has_some_value:
-        v = rb_funcall(v, idPLUS, 1, e);
-    }
-    return v;
-}
-
-/*
- *  Arrays are ordered, integer-indexed collections of any object.
- *
- *  Array indexing starts at 0, as in C or Java.  A negative index is assumed
- *  to be relative to the end of the array---that is, an index of -1 indicates
- *  the last element of the array, -2 is the next to last element in the
- *  array, and so on.
- *
- *  == Creating Arrays
- *
- *  A new array can be created by using the literal constructor
- *  <code>[]</code>.  Arrays can contain different types of objects.  For
- *  example, the array below contains an Integer, a String and a Float:
- *
- *     ary = [1, "two", 3.0] #=> [1, "two", 3.0]
- *
- *  An array can also be created by explicitly calling Array.new with zero, one
- *  (the initial size of the Array) or two arguments (the initial size and a
- *  default object).
- *
- *     ary = Array.new    #=> []
- *     Array.new(3)       #=> [nil, nil, nil]
- *     Array.new(3, true) #=> [true, true, true]
- *
- *  Note that the second argument populates the array with references to the
- *  same object.  Therefore, it is only recommended in cases when you need to
- *  instantiate arrays with natively immutable objects such as Symbols,
- *  numbers, true or false.
- *
- *  To create an array with separate objects a block can be passed instead.
- *  This method is safe to use with mutable objects such as hashes, strings or
- *  other arrays:
- *
- *     Array.new(4) { Hash.new } #=> [{}, {}, {}, {}]
- *
- *  This is also a quick way to build up multi-dimensional arrays:
- *
- *     empty_table = Array.new(3) { Array.new(3) }
- *     #=> [[nil, nil, nil], [nil, nil, nil], [nil, nil, nil]]
- *
- *  An array can also be created by using the Array() method, provided by
- *  Kernel, which tries to call #to_ary, then #to_a on its argument.
- *
- *	Array({:a => "a", :b => "b"}) #=> [[:a, "a"], [:b, "b"]]
- *
- *  == Example Usage
- *
- *  In addition to the methods it mixes in through the Enumerable module, the
- *  Array class has proprietary methods for accessing, searching and otherwise
- *  manipulating arrays.
- *
- *  Some of the more common ones are illustrated below.
- *
- *  == Accessing Elements
- *
- *  Elements in an array can be retrieved using the Array#[] method.  It can
- *  take a single integer argument (a numeric index), a pair of arguments
- *  (start and length) or a range. Negative indices start counting from the end,
- *  with -1 being the last element.
- *
- *     arr = [1, 2, 3, 4, 5, 6]
- *     arr[2]    #=> 3
- *     arr[100]  #=> nil
- *     arr[-3]   #=> 4
- *     arr[2, 3] #=> [3, 4, 5]
- *     arr[1..4] #=> [2, 3, 4, 5]
- *     arr[1..-3] #=> [2, 3, 4]
- *
- *  Another way to access a particular array element is by using the #at method
- *
- *     arr.at(0) #=> 1
- *
- *  The #slice method works in an identical manner to Array#[].
- *
- *  To raise an error for indices outside of the array bounds or else to
- *  provide a default value when that happens, you can use #fetch.
- *
- *     arr = ['a', 'b', 'c', 'd', 'e', 'f']
- *     arr.fetch(100) #=> IndexError: index 100 outside of array bounds: -6...6
- *     arr.fetch(100, "oops") #=> "oops"
- *
- *  The special methods #first and #last will return the first and last
- *  elements of an array, respectively.
- *
- *     arr.first #=> 1
- *     arr.last  #=> 6
- *
- *  To return the first +n+ elements of an array, use #take
- *
- *     arr.take(3) #=> [1, 2, 3]
- *
- *  #drop does the opposite of #take, by returning the elements after +n+
- *  elements have been dropped:
- *
- *     arr.drop(3) #=> [4, 5, 6]
- *
- *  == Obtaining Information about an Array
- *
- *  Arrays keep track of their own length at all times.  To query an array
- *  about the number of elements it contains, use #length, #count or #size.
- *
- *    browsers = ['Chrome', 'Firefox', 'Safari', 'Opera', 'IE']
- *    browsers.length #=> 5
- *    browsers.count #=> 5
- *
- *  To check whether an array contains any elements at all
- *
- *    browsers.empty? #=> false
- *
- *  To check whether a particular item is included in the array
- *
- *    browsers.include?('Konqueror') #=> false
- *
- *  == Adding Items to Arrays
- *
- *  Items can be added to the end of an array by using either #push or #<<
- *
- *    arr = [1, 2, 3, 4]
- *    arr.push(5) #=> [1, 2, 3, 4, 5]
- *    arr << 6    #=> [1, 2, 3, 4, 5, 6]
- *
- *  #unshift will add a new item to the beginning of an array.
- *
- *     arr.unshift(0) #=> [0, 1, 2, 3, 4, 5, 6]
- *
- *  With #insert you can add a new element to an array at any position.
- *
- *     arr.insert(3, 'apple')  #=> [0, 1, 2, 'apple', 3, 4, 5, 6]
- *
- *  Using the #insert method, you can also insert multiple values at once:
- *
- *     arr.insert(3, 'orange', 'pear', 'grapefruit')
- *     #=> [0, 1, 2, "orange", "pear", "grapefruit", "apple", 3, 4, 5, 6]
- *
- *  == Removing Items from an Array
- *
- *  The method #pop removes the last element in an array and returns it:
- *
- *     arr =  [1, 2, 3, 4, 5, 6]
- *     arr.pop #=> 6
- *     arr #=> [1, 2, 3, 4, 5]
- *
- *  To retrieve and at the same time remove the first item, use #shift:
- *
- *     arr.shift #=> 1
- *     arr #=> [2, 3, 4, 5]
- *
- *  To delete an element at a particular index:
- *
- *     arr.delete_at(2) #=> 4
- *     arr #=> [2, 3, 5]
- *
- *  To delete a particular element anywhere in an array, use #delete:
- *
- *     arr = [1, 2, 2, 3]
- *     arr.delete(2) #=> 2
- *     arr #=> [1,3]
- *
- *  A useful method if you need to remove +nil+ values from an array is
- *  #compact:
- *
- *     arr = ['foo', 0, nil, 'bar', 7, 'baz', nil]
- *     arr.compact  #=> ['foo', 0, 'bar', 7, 'baz']
- *     arr          #=> ['foo', 0, nil, 'bar', 7, 'baz', nil]
- *     arr.compact! #=> ['foo', 0, 'bar', 7, 'baz']
- *     arr          #=> ['foo', 0, 'bar', 7, 'baz']
- *
- *  Another common need is to remove duplicate elements from an array.
- *
- *  It has the non-destructive #uniq, and destructive method #uniq!
- *
- *     arr = [2, 5, 6, 556, 6, 6, 8, 9, 0, 123, 556]
- *     arr.uniq #=> [2, 5, 6, 556, 8, 9, 0, 123]
- *
- *  == Iterating over Arrays
- *
- *  Like all classes that include the Enumerable module, Array has an each
- *  method, which defines what elements should be iterated over and how.  In
- *  case of Array's #each, all elements in the Array instance are yielded to
- *  the supplied block in sequence.
- *
- *  Note that this operation leaves the array unchanged.
- *
- *     arr = [1, 2, 3, 4, 5]
- *     arr.each { |a| print a -= 10, " " }
- *     # prints: -9 -8 -7 -6 -5
- *     #=> [1, 2, 3, 4, 5]
- *
- *  Another sometimes useful iterator is #reverse_each which will iterate over
- *  the elements in the array in reverse order.
- *
- *     words = %w[first second third fourth fifth sixth]
- *     str = ""
- *     words.reverse_each { |word| str += "#{word} " }
- *     p str #=> "sixth fifth fourth third second first "
- *
- *  The #map method can be used to create a new array based on the original
- *  array, but with the values modified by the supplied block:
- *
- *     arr.map { |a| 2*a }   #=> [2, 4, 6, 8, 10]
- *     arr                   #=> [1, 2, 3, 4, 5]
- *     arr.map! { |a| a**2 } #=> [1, 4, 9, 16, 25]
- *     arr                   #=> [1, 4, 9, 16, 25]
- *
- *  == Selecting Items from an Array
- *
- *  Elements can be selected from an array according to criteria defined in a
- *  block.  The selection can happen in a destructive or a non-destructive
- *  manner.  While the destructive operations will modify the array they were
- *  called on, the non-destructive methods usually return a new array with the
- *  selected elements, but leave the original array unchanged.
- *
- *  === Non-destructive Selection
- *
- *     arr = [1, 2, 3, 4, 5, 6]
- *     arr.select { |a| a > 3 }     #=> [4, 5, 6]
- *     arr.reject { |a| a < 3 }     #=> [3, 4, 5, 6]
- *     arr.drop_while { |a| a < 4 } #=> [4, 5, 6]
- *     arr                          #=> [1, 2, 3, 4, 5, 6]
- *
- *  === Destructive Selection
- *
- *  #select! and #reject! are the corresponding destructive methods to #select
- *  and #reject
- *
- *  Similar to #select vs. #reject, #delete_if and #keep_if have the exact
- *  opposite result when supplied with the same block:
- *
- *     arr.delete_if { |a| a < 4 } #=> [4, 5, 6]
- *     arr                         #=> [4, 5, 6]
- *
- *     arr = [1, 2, 3, 4, 5, 6]
- *     arr.keep_if { |a| a < 4 } #=> [1, 2, 3]
- *     arr                       #=> [1, 2, 3]
- *
+/* Arrays are ordered, integer-indexed collections of any object. 
+ * Array indexing starts at 0, as in C or Java.  A negative index is 
+ * assumed to be relative to the end of the array---that is, an index of -1 
+ * indicates the last element of the array, -2 is the next to last 
+ * element in the array, and so on. 
  */
 
 void
-Init_Array(void)
+Init_Array()
 {
-#undef rb_intern
-#define rb_intern(str) rb_intern_const(str)
-
     rb_cArray  = rb_define_class("Array", rb_cObject);
     rb_include_module(rb_cArray, rb_mEnumerable);
 
-    rb_define_alloc_func(rb_cArray, empty_ary_alloc);
+    rb_define_alloc_func(rb_cArray, ary_alloc);
     rb_define_singleton_method(rb_cArray, "[]", rb_ary_s_create, -1);
-    rb_define_singleton_method(rb_cArray, "try_convert", rb_ary_s_try_convert, 1);
     rb_define_method(rb_cArray, "initialize", rb_ary_initialize, -1);
     rb_define_method(rb_cArray, "initialize_copy", rb_ary_replace, 1);
 
+    rb_define_method(rb_cArray, "to_s", rb_ary_to_s, 0);
     rb_define_method(rb_cArray, "inspect", rb_ary_inspect, 0);
-    rb_define_alias(rb_cArray,  "to_s", "inspect");
     rb_define_method(rb_cArray, "to_a", rb_ary_to_a, 0);
-    rb_define_method(rb_cArray, "to_h", rb_ary_to_h, 0);
     rb_define_method(rb_cArray, "to_ary", rb_ary_to_ary_m, 0);
     rb_define_method(rb_cArray, "frozen?",  rb_ary_frozen_p, 0);
 
@@ -6100,11 +2993,11 @@ Init_Array(void)
     rb_define_method(rb_cArray, "fetch", rb_ary_fetch, -1);
     rb_define_method(rb_cArray, "first", rb_ary_first, -1);
     rb_define_method(rb_cArray, "last", rb_ary_last, -1);
-    rb_define_method(rb_cArray, "concat", rb_ary_concat_multi, -1);
+    rb_define_method(rb_cArray, "concat", rb_ary_concat, 1);
     rb_define_method(rb_cArray, "<<", rb_ary_push, 1);
     rb_define_method(rb_cArray, "push", rb_ary_push_m, -1);
-    rb_define_method(rb_cArray, "pop", rb_ary_pop_m, -1);
-    rb_define_method(rb_cArray, "shift", rb_ary_shift_m, -1);
+    rb_define_method(rb_cArray, "pop", rb_ary_pop, 0);
+    rb_define_method(rb_cArray, "shift", rb_ary_shift, 0);
     rb_define_method(rb_cArray, "unshift", rb_ary_unshift_m, -1);
     rb_define_method(rb_cArray, "insert", rb_ary_insert, -1);
     rb_define_method(rb_cArray, "each", rb_ary_each, 0);
@@ -6113,24 +3006,20 @@ Init_Array(void)
     rb_define_method(rb_cArray, "length", rb_ary_length, 0);
     rb_define_alias(rb_cArray,  "size", "length");
     rb_define_method(rb_cArray, "empty?", rb_ary_empty_p, 0);
-    rb_define_method(rb_cArray, "find_index", rb_ary_index, -1);
-    rb_define_method(rb_cArray, "index", rb_ary_index, -1);
-    rb_define_method(rb_cArray, "rindex", rb_ary_rindex, -1);
+    rb_define_method(rb_cArray, "index", rb_ary_index, 1);
+    rb_define_method(rb_cArray, "rindex", rb_ary_rindex, 1);
+    rb_define_method(rb_cArray, "indexes", rb_ary_indexes, -1);
+    rb_define_method(rb_cArray, "indices", rb_ary_indexes, -1);
     rb_define_method(rb_cArray, "join", rb_ary_join_m, -1);
     rb_define_method(rb_cArray, "reverse", rb_ary_reverse_m, 0);
     rb_define_method(rb_cArray, "reverse!", rb_ary_reverse_bang, 0);
-    rb_define_method(rb_cArray, "rotate", rb_ary_rotate_m, -1);
-    rb_define_method(rb_cArray, "rotate!", rb_ary_rotate_bang, -1);
     rb_define_method(rb_cArray, "sort", rb_ary_sort, 0);
     rb_define_method(rb_cArray, "sort!", rb_ary_sort_bang, 0);
-    rb_define_method(rb_cArray, "sort_by!", rb_ary_sort_by_bang, 0);
     rb_define_method(rb_cArray, "collect", rb_ary_collect, 0);
     rb_define_method(rb_cArray, "collect!", rb_ary_collect_bang, 0);
     rb_define_method(rb_cArray, "map", rb_ary_collect, 0);
     rb_define_method(rb_cArray, "map!", rb_ary_collect_bang, 0);
     rb_define_method(rb_cArray, "select", rb_ary_select, 0);
-    rb_define_method(rb_cArray, "select!", rb_ary_select_bang, 0);
-    rb_define_method(rb_cArray, "keep_if", rb_ary_keep_if, 0);
     rb_define_method(rb_cArray, "values_at", rb_ary_values_at, -1);
     rb_define_method(rb_cArray, "delete", rb_ary_delete, 1);
     rb_define_method(rb_cArray, "delete_at", rb_ary_delete_at_m, 1);
@@ -6158,38 +3047,14 @@ Init_Array(void)
     rb_define_method(rb_cArray, "&", rb_ary_and, 1);
     rb_define_method(rb_cArray, "|", rb_ary_or, 1);
 
-    rb_define_method(rb_cArray, "max", rb_ary_max, -1);
-    rb_define_method(rb_cArray, "min", rb_ary_min, -1);
-
     rb_define_method(rb_cArray, "uniq", rb_ary_uniq, 0);
     rb_define_method(rb_cArray, "uniq!", rb_ary_uniq_bang, 0);
     rb_define_method(rb_cArray, "compact", rb_ary_compact, 0);
     rb_define_method(rb_cArray, "compact!", rb_ary_compact_bang, 0);
-    rb_define_method(rb_cArray, "flatten", rb_ary_flatten, -1);
-    rb_define_method(rb_cArray, "flatten!", rb_ary_flatten_bang, -1);
-    rb_define_method(rb_cArray, "count", rb_ary_count, -1);
-    rb_define_method(rb_cArray, "shuffle!", rb_ary_shuffle_bang, -1);
-    rb_define_method(rb_cArray, "shuffle", rb_ary_shuffle, -1);
-    rb_define_method(rb_cArray, "sample", rb_ary_sample, -1);
-    rb_define_method(rb_cArray, "cycle", rb_ary_cycle, -1);
-    rb_define_method(rb_cArray, "permutation", rb_ary_permutation, -1);
-    rb_define_method(rb_cArray, "combination", rb_ary_combination, 1);
-    rb_define_method(rb_cArray, "repeated_permutation", rb_ary_repeated_permutation, 1);
-    rb_define_method(rb_cArray, "repeated_combination", rb_ary_repeated_combination, 1);
-    rb_define_method(rb_cArray, "product", rb_ary_product, -1);
-
-    rb_define_method(rb_cArray, "take", rb_ary_take, 1);
-    rb_define_method(rb_cArray, "take_while", rb_ary_take_while, 0);
-    rb_define_method(rb_cArray, "drop", rb_ary_drop, 1);
-    rb_define_method(rb_cArray, "drop_while", rb_ary_drop_while, 0);
-    rb_define_method(rb_cArray, "bsearch", rb_ary_bsearch, 0);
-    rb_define_method(rb_cArray, "bsearch_index", rb_ary_bsearch_index, 0);
-    rb_define_method(rb_cArray, "any?", rb_ary_any_p, 0);
-    rb_define_method(rb_cArray, "dig", rb_ary_dig, -1);
-    rb_define_method(rb_cArray, "sum", rb_ary_sum, -1);
+    rb_define_method(rb_cArray, "flatten", rb_ary_flatten, 0);
+    rb_define_method(rb_cArray, "flatten!", rb_ary_flatten_bang, 0);
+    rb_define_method(rb_cArray, "nitems", rb_ary_nitems, 0);
 
     id_cmp = rb_intern("<=>");
-    id_random = rb_intern("random");
-    id_div = rb_intern("div");
-    id_power = rb_intern("**");
+    inspect_key = rb_intern("__inspect_key__");
 }
diff --git a/basictest/runner.rb b/basictest/runner.rb
deleted file mode 100755
index 0330b6d506..0000000000
--- a/basictest/runner.rb
+++ /dev/null
@@ -1,33 +0,0 @@
-#! ./miniruby
-
-exit if defined?(CROSS_COMPILING) and CROSS_COMPILING
-ruby = ENV["RUBY"]
-unless ruby
-  load './rbconfig.rb'
-  ruby = "./#{RbConfig::CONFIG['ruby_install_name']}#{RbConfig::CONFIG['EXEEXT']}"
-end
-unless File.exist? ruby
-  print "#{ruby} is not found.\n"
-  print "Try `make' first, then `make test', please.\n"
-  exit false
-end
-ARGV[0] and opt = ARGV[0][/\A--run-opt=(.*)/, 1] and ARGV.shift
-
-$stderr.reopen($stdout)
-error = ''
-
-srcdir = File.expand_path('..', File.dirname(__FILE__))
-if opt = ENV["RUBYOPT"]
-  ENV["RUBYOPT"] = opt + " -W1"
-end
-`#{ruby} #{opt} -W1 #{srcdir}/basictest/test.rb #{ARGV.join(' ')}`.each_line do |line|
-  if line =~ /^end of test/
-    print "\ntest succeeded\n"
-    exit true
-  end
-  error << line if %r:^(basictest/test.rb|not): =~ line
-end
-puts
-print error
-print "test failed\n"
-exit false
diff --git a/basictest/test.rb b/basictest/test.rb
deleted file mode 100755
index 8472a0d14a..0000000000
--- a/basictest/test.rb
+++ /dev/null
@@ -1,2367 +0,0 @@
-#! /usr/bin/env ruby
-# -*- coding: us-ascii -*-
-
-$testnum=0
-$ntest=0
-$failed = 0
-class Progress
-  def initialize
-    @color = nil
-    @tty = nil
-    @quiet = nil
-    @verbose = nil
-    ARGV.each do |arg|
-      case arg
-      when /\A--color(?:=(?:always|(auto)|(never)|(.*)))?\z/
-        warn "unknown --color argument: #$3" if $3
-        @color = $1 ? nil : !$2
-      when /\A--tty(=(?:yes|(no)|(.*)))?\z/
-        warn "unknown --tty argument: #$3" if $3
-        @tty = !$1 || !$2
-        true
-      when /\A-(q|-quiet)\z/
-        @quiet = true
-      when /\A-(v|-verbose)\z/
-        @verbose = true
-      end
-    end
-    @tty = STDERR.tty? && !STDOUT.tty? && /dumb/ !~ ENV["TERM"] if @tty.nil?
-    @eol = @tty && !@verbose ? "\r\e[K\r" : "\n"
-    case @color
-    when nil
-      @color = @tty
-    end
-    if @color
-      # dircolors-like style
-      colors = (colors = ENV['TEST_COLORS']) ? Hash[colors.scan(/(\w+)=([^:\n]*)/)] : {}
-      begin
-        File.read(File.join(__dir__, "../test/colors")).scan(/(\w+)=([^:\n]*)/) do |n, c|
-          colors[n] ||= c
-        end
-      rescue
-      end
-      @passed = "\e[;#{colors["pass"] || "32"}m"
-      @failed = "\e[;#{colors["fail"] || "31"}m"
-      @reset = "\e[m"
-    else
-      @passed = @failed = @reset = ""
-    end
-    extend(Rotator) if @tty
-  end
-
-  def passed_string
-    "."
-  end
-  def failed_string
-    "#{@failed}F#{@reset}"
-  end
-  def init_string
-  end
-  def finish_string
-    if @quiet
-      @eol
-    else
-      "#{@passed}#{@ok ? 'OK' : ''} #{$testnum}#{@reset}#{@eol}"
-    end
-  end
-  def pass
-    STDERR.print passed_string
-  end
-  def fail
-    @ok = false
-    STDERR.print failed_string
-  end
-  def init
-    @ok = true
-    STDERR.print init_string
-  end
-  def finish
-    STDERR.print finish_string
-  end
-
-  module Rotator
-    ROTATOR = %w[- \\ | /]
-    BS = "\b" * ROTATOR[0].size
-    def passed_string
-      "#{BS}#{ROTATOR[(@count += 1) % ROTATOR.size]}"
-    end
-    def failed_string
-      "#{BS}#{super}#{ROTATOR[@count % ROTATOR.size]}"
-    end
-    def init_string
-      @count = 0
-      " "
-    end
-    def finish_string
-      s = "#{BS}#{' ' * BS.size}#{BS}#{super}"
-      s.gsub!(/\n/, "\r\e[2K\r") if @quiet
-      s
-    end
-  end
-end
-PROGRESS = Progress.new
-
-def test_check(what)
-  unless $ntest.zero?
-    PROGRESS.finish
-  end
-  STDERR.print "#{$0}:#{what} "
-  PROGRESS.init
-  $what = what
-  $testnum = 0
-end
-
-def test_ok(cond,n=1)
-  $testnum+=1
-  $ntest+=1
-  where = (st = caller(n)) ? st[0] : "caller error! (n=#{n}, trace=#{caller(0).join(', ')}"
-  if cond
-    PROGRESS.pass
-    printf "ok %d (%s)\n", $testnum, where
-  else
-    PROGRESS.fail
-    printf "not ok %s %d -- %s\n", $what, $testnum, where
-    $failed+=1
-  end
-  STDOUT.flush
-  STDERR.flush
-end
-
-# make sure conditional operators work
-
-test_check "assignment"
-
-a=[]; a[0] ||= "bar";
-test_ok(a[0] == "bar")
-h={}; h["foo"] ||= "bar";
-test_ok(h["foo"] == "bar")
-
-aa = 5
-aa ||= 25
-test_ok(aa == 5)
-bb ||= 25
-test_ok(bb == 25)
-cc &&=33
-test_ok(cc == nil)
-cc = 5
-cc &&=44
-test_ok(cc == 44)
-
-a = nil; test_ok(a == nil)
-a = 1; test_ok(a == 1)
-a = []; test_ok(a == [])
-a = [1]; test_ok(a == [1])
-a = [nil]; test_ok(a == [nil])
-a = [[]]; test_ok(a == [[]])
-a = [1,2]; test_ok(a == [1,2])
-a = [*[]]; test_ok(a == [])
-a = [*[1]]; test_ok(a == [1])
-a = [*[1,2]]; test_ok(a == [1,2])
-
-a = *[]; test_ok(a == [])
-a = *[1]; test_ok(a == [1])
-a = *[nil]; test_ok(a == [nil])
-a = *[[]]; test_ok(a == [[]])
-a = *[1,2]; test_ok(a == [1,2])
-a = *[*[]]; test_ok(a == [])
-a = *[*[1]]; test_ok(a == [1])
-a = *[*[1,2]]; test_ok(a == [1,2])
-
-a, = nil; test_ok(a == nil)
-a, = 1; test_ok(a == 1)
-a, = []; test_ok(a == nil)
-a, = [1]; test_ok(a == 1)
-a, = [nil]; test_ok(a == nil)
-a, = [[]]; test_ok(a == [])
-a, = 1,2; test_ok(a == 1)
-a, = [1,2]; test_ok(a == 1)
-a, = [*[]]; test_ok(a == nil)
-a, = [*[1]]; test_ok(a == 1)
-a, = *[1,2]; test_ok(a == 1)
-a, = [*[1,2]]; test_ok(a == 1)
-
-a, = *[]; test_ok(a == nil)
-a, = *[1]; test_ok(a == 1)
-a, = *[nil]; test_ok(a == nil)
-a, = *[[]]; test_ok(a == [])
-a, = *[1,2]; test_ok(a == 1)
-a, = *[*[]]; test_ok(a == nil)
-a, = *[*[1]]; test_ok(a == 1)
-a, = *[*[1,2]]; test_ok(a == 1)
-
-*a = nil; test_ok(a == [nil])
-*a = 1; test_ok(a == [1])
-*a = []; test_ok(a == [])
-*a = [1]; test_ok(a == [1])
-*a = [nil]; test_ok(a == [nil])
-*a = [[]]; test_ok(a == [[]])
-*a = [1,2]; test_ok(a == [1,2])
-*a = [*[]]; test_ok(a == [])
-*a = [*[1]]; test_ok(a == [1])
-*a = [*[1,2]]; test_ok(a == [1,2])
-
-*a = *[]; test_ok(a == [])
-*a = *[1]; test_ok(a == [1])
-*a = *[nil]; test_ok(a == [nil])
-*a = *[[]]; test_ok(a == [[]])
-*a = *[1,2]; test_ok(a == [1,2])
-*a = *[*[]]; test_ok(a == [])
-*a = *[*[1]]; test_ok(a == [1])
-*a = *[*[1,2]]; test_ok(a == [1,2])
-
-a,b,*c = nil; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = 1; test_ok([a,b,c] == [1,nil,[]])
-a,b,*c = []; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = [1]; test_ok([a,b,c] == [1,nil,[]])
-a,b,*c = [nil]; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = [[]]; test_ok([a,b,c] == [[],nil,[]])
-a,b,*c = [1,2]; test_ok([a,b,c] == [1,2,[]])
-a,b,*c = [*[]]; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = [*[1]]; test_ok([a,b,c] == [1,nil,[]])
-a,b,*c = [*[1,2]]; test_ok([a,b,c] == [1,2,[]])
-
-a,b,*c = *[]; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = *[1]; test_ok([a,b,c] == [1,nil,[]])
-a,b,*c = *[nil]; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = *[[]]; test_ok([a,b,c] == [[],nil,[]])
-a,b,*c = *[1,2]; test_ok([a,b,c] == [1,2,[]])
-a,b,*c = *[*[]]; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = *[*[1]]; test_ok([a,b,c] == [1,nil,[]])
-a,b,*c = *[*[1,2]]; test_ok([a,b,c] == [1,2,[]])
-
-def f; yield nil; end; f {|a| test_ok(a == nil)}
-def f; yield 1; end; f {|a| test_ok(a == 1)}
-def f; yield []; end; f {|a| test_ok(a == [])}
-def f; yield [1]; end; f {|a| test_ok(a == [1])}
-def f; yield [nil]; end; f {|a| test_ok(a == [nil])}
-def f; yield [[]]; end; f {|a| test_ok(a == [[]])}
-def f; yield [*[]]; end; f {|a| test_ok(a == [])}
-def f; yield [*[1]]; end; f {|a| test_ok(a == [1])}
-def f; yield [*[1,2]]; end; f {|a| test_ok(a == [1,2])}
-def f; yield *[]; end; f {|a| test_ok(a == nil)}
-def f; yield *[1]; end; f {|a| test_ok(a == 1)}
-def f; yield *[nil]; end; f {|a| test_ok(a == nil)}
-def f; yield *[[]]; end; f {|a| test_ok(a == [])}
-def f; yield *[*[]]; end; f {|a| test_ok(a == nil)}
-def f; yield *[*[1]]; end; f {|a| test_ok(a == 1)}
-def f; yield *[*[1,2]]; end; f {|a| test_ok(a == 1)}
-
-def f; yield; end; f {|a,| test_ok(a == nil)}
-def f; yield nil; end; f {|a,| test_ok(a == nil)}
-def f; yield 1; end; f {|a,| test_ok(a == 1)}
-def f; yield []; end; f {|a,| test_ok(a == nil)}
-def f; yield [1]; end; f {|a,| test_ok(a == 1)}
-def f; yield [nil]; end; f {|a,| test_ok(a == nil)}
-def f; yield [[]]; end; f {|a,| test_ok(a == [])}
-def f; yield [*[]]; end; f {|a,| test_ok(a == nil)}
-def f; yield [*[1]]; end; f {|a,| test_ok(a == 1)}
-def f; yield [*[1,2]]; end; f {|a,| test_ok(a == 1)}
-
-def f; yield *[]; end; f {|a,| test_ok(a == nil)}
-def f; yield *[1]; end; f {|a,| test_ok(a == 1)}
-def f; yield *[nil]; end; f {|a,| test_ok(a == nil)}
-def f; yield *[[]]; end; f {|a,| test_ok(a == nil)}
-def f; yield *[*[]]; end; f {|a,| test_ok(a == nil)}
-def f; yield *[*[1]]; end; f {|a,| test_ok(a == 1)}
-def f; yield *[*[1,2]]; end; f {|a,| test_ok(a == 1)}
-
-def f; yield; end; f {|*a| test_ok(a == [])}
-def f; yield nil; end; f {|*a| test_ok(a == [nil])}
-def f; yield 1; end; f {|*a| test_ok(a == [1])}
-def f; yield []; end; f {|*a| test_ok(a == [[]])}
-def f; yield [1]; end; f {|*a| test_ok(a == [[1]])}
-def f; yield [nil]; end; f {|*a| test_ok(a == [[nil]])}
-def f; yield [[]]; end; f {|*a| test_ok(a == [[[]]])}
-def f; yield [1,2]; end; f {|*a| test_ok(a == [[1,2]])}
-def f; yield [*[]]; end; f {|*a| test_ok(a == [[]])}
-def f; yield [*[1]]; end; f {|*a| test_ok(a == [[1]])}
-def f; yield [*[1,2]]; end; f {|*a| test_ok(a == [[1,2]])}
-
-def f; yield *[]; end; f {|*a| test_ok(a == [])}
-def f; yield *[1]; end; f {|*a| test_ok(a == [1])}
-def f; yield *[nil]; end; f {|*a| test_ok(a == [nil])}
-def f; yield *[[]]; end; f {|*a| test_ok(a == [[]])}
-def f; yield *[*[]]; end; f {|*a| test_ok(a == [])}
-def f; yield *[*[1]]; end; f {|*a| test_ok(a == [1])}
-def f; yield *[*[1,2]]; end; f {|*a| test_ok(a == [1,2])}
-
-def f; yield; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
-def f; yield nil; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
-def f; yield 1; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
-def f; yield []; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
-def f; yield [1]; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
-def f; yield [nil]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
-def f; yield [[]]; end; f {|a,b,*c| test_ok([a,b,c] == [[],nil,[]])}
-def f; yield [*[]]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
-def f; yield [*[1]]; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
-def f; yield [*[1,2]]; end; f {|a,b,*c| test_ok([a,b,c] == [1,2,[]])}
-
-def f; yield *[]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
-def f; yield *[1]; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
-def f; yield *[nil]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
-def f; yield *[[]]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
-def f; yield *[*[]]; end; f {|a,b,*c| test_ok([a,b,c] == [nil,nil,[]])}
-def f; yield *[*[1]]; end; f {|a,b,*c| test_ok([a,b,c] == [1,nil,[]])}
-def f; yield *[*[1,2]]; end; f {|a,b,*c| test_ok([a,b,c] == [1,2,[]])}
-
-def r; return; end; a = r(); test_ok(a == nil)
-def r; return nil; end; a = r(); test_ok(a == nil)
-def r; return 1; end; a = r(); test_ok(a == 1)
-def r; return []; end; a = r(); test_ok(a == [])
-def r; return [1]; end; a = r(); test_ok(a == [1])
-def r; return [nil]; end; a = r(); test_ok(a == [nil])
-def r; return [[]]; end; a = r(); test_ok(a == [[]])
-def r; return [*[]]; end; a = r(); test_ok(a == [])
-def r; return [*[1]]; end; a = r(); test_ok(a == [1])
-def r; return [*[1,2]]; end; a = r(); test_ok(a == [1,2])
-
-def r; return *[]; end; a = r(); test_ok(a == [])
-def r; return *[1]; end; a = r(); test_ok(a == [1])
-def r; return *[nil]; end; a = r(); test_ok(a == [nil])
-def r; return *[[]]; end; a = r(); test_ok(a == [[]])
-def r; return *[*[]]; end; a = r(); test_ok(a == [])
-def r; return *[*[1]]; end; a = r(); test_ok(a == [1])
-def r; return *[*[1,2]]; end; a = r(); test_ok(a == [1,2])
-
-def r; return *[[]]; end; a = *r(); test_ok(a == [[]])
-def r; return *[*[1,2]]; end; a = *r(); test_ok(a == [1,2])
-
-def r; return; end; *a = r(); test_ok(a == [nil])
-def r; return nil; end; *a = r(); test_ok(a == [nil])
-def r; return 1; end; *a = r(); test_ok(a == [1])
-def r; return []; end; *a = r(); test_ok(a == [])
-def r; return [1]; end; *a = r(); test_ok(a == [1])
-def r; return [nil]; end; *a = r(); test_ok(a == [nil])
-def r; return [[]]; end; *a = r(); test_ok(a == [[]])
-def r; return [1,2]; end; *a = r(); test_ok(a == [1,2])
-def r; return [*[]]; end; *a = r(); test_ok(a == [])
-def r; return [*[1]]; end; *a = r(); test_ok(a == [1])
-def r; return [*[1,2]]; end; *a = r(); test_ok(a == [1,2])
-
-def r; return *[]; end; *a = r(); test_ok(a == [])
-def r; return *[1]; end; *a = r(); test_ok(a == [1])
-def r; return *[nil]; end; *a = r(); test_ok(a == [nil])
-def r; return *[[]]; end; *a = r(); test_ok(a == [[]])
-def r; return *[1,2]; end; *a = r(); test_ok(a == [1,2])
-def r; return *[*[]]; end; *a = r(); test_ok(a == [])
-def r; return *[*[1]]; end; *a = r(); test_ok(a == [1])
-def r; return *[*[1,2]]; end; *a = r(); test_ok(a == [1,2])
-
-def r; return *[[]]; end; *a = *r(); test_ok(a == [[]])
-def r; return *[1,2]; end; *a = *r(); test_ok(a == [1,2])
-def r; return *[*[1,2]]; end; *a = *r(); test_ok(a == [1,2])
-
-def r; return; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
-def r; return nil; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
-def r; return 1; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
-def r; return []; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
-def r; return [1]; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
-def r; return [nil]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
-def r; return [[]]; end; a,b,*c = r(); test_ok([a,b,c] == [[],nil,[]])
-def r; return [1,2]; end; a,b,*c = r(); test_ok([a,b,c] == [1,2,[]])
-def r; return [*[]]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
-def r; return [*[1]]; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
-def r; return [*[1,2]]; end; a,b,*c = r(); test_ok([a,b,c] == [1,2,[]])
-
-def r; return *[]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
-def r; return *[1]; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
-def r; return *[nil]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
-def r; return *[[]]; end; a,b,*c = r(); test_ok([a,b,c] == [[],nil,[]])
-def r; return *[1,2]; end; a,b,*c = r(); test_ok([a,b,c] == [1,2,[]])
-def r; return *[*[]]; end; a,b,*c = r(); test_ok([a,b,c] == [nil,nil,[]])
-def r; return *[*[1]]; end; a,b,*c = r(); test_ok([a,b,c] == [1,nil,[]])
-def r; return *[*[1,2]]; end; a,b,*c = r(); test_ok([a,b,c] == [1,2,[]])
-
-f = lambda {|r,| test_ok([] == r)}
-f.call([], *[])
-
-f = lambda {|r,*l| test_ok([] == r); test_ok([1] == l)}
-f.call([], *[1])
-
-f = lambda{|x| x}
-test_ok(f.call(42) == 42)
-test_ok(f.call([42]) == [42])
-test_ok(f.call([[42]]) == [[42]])
-test_ok(f.call([42,55]) == [42,55])
-
-f = lambda{|x,| x}
-test_ok(f.call(42) == 42)
-test_ok(f.call([42]) == [42])
-test_ok(f.call([[42]]) == [[42]])
-test_ok(f.call([42,55]) == [42,55])
-
-f = lambda{|*x| x}
-test_ok(f.call(42) == [42])
-test_ok(f.call([42]) == [[42]])
-test_ok(f.call([[42]]) == [[[42]]])
-test_ok(f.call([42,55]) == [[42,55]])
-test_ok(f.call(42,55) == [42,55])
-
-f = lambda { |a, b=42, *c| [a,b,c] }
-test_ok(f.call(1      ) == [1,42,[  ]] )
-test_ok(f.call(1,43   ) == [1,43,[  ]] )
-test_ok(f.call(1,43,44) == [1,43,[44]] )
-
-f = lambda { |a, b=(a|16), *c, &block| [a,b,c,block&&block[]] }
-test_ok(f.call(8      )     == [8,24,[  ],nil] )
-test_ok(f.call(8,43   )     == [8,43,[  ],nil] )
-test_ok(f.call(8,43,44)     == [8,43,[44],nil] )
-test_ok(f.call(8      ){45} == [8,24,[  ],45 ] )
-test_ok(f.call(8,43   ){45} == [8,43,[  ],45 ] )
-test_ok(f.call(8,43,44){45} == [8,43,[44],45 ] )
-
-f = lambda { |a, b=42, *c, d| [a,b,c,d] }
-test_ok(f.call(1      ,99) == [1,42,[  ],99] )
-test_ok(f.call(1,43   ,99) == [1,43,[  ],99] )
-test_ok(f.call(1,43,44,99) == [1,43,[44],99] )
-
-f = lambda { |a, b=(a|16), &block| [a,b,block&&block[]] }
-test_ok(f.call(8   )     == [8,24,nil] )
-test_ok(f.call(8,43)     == [8,43,nil] )
-test_ok(f.call(8,43)     == [8,43,nil] )
-test_ok(f.call(8   ){45} == [8,24,45 ] )
-test_ok(f.call(8,43){45} == [8,43,45 ] )
-test_ok(f.call(8,43){45} == [8,43,45 ] )
-
-f = lambda { |a, b=42, d| [a,b,d] }
-test_ok(f.call(1   ,99) == [1,42,99] )
-test_ok(f.call(1,43,99) == [1,43,99] )
-test_ok(f.call(1,43,99) == [1,43,99] )
-
-f = lambda { |b=42, *c, &block| [b,c,block&&block[]] }
-test_ok(f.call(     )     == [42,[  ],nil] )
-test_ok(f.call(43   )     == [43,[  ],nil] )
-test_ok(f.call(43,44)     == [43,[44],nil] )
-test_ok(f.call(     ){45} == [42,[  ],45 ] )
-test_ok(f.call(43   ){45} == [43,[  ],45 ] )
-test_ok(f.call(43,44){45} == [43,[44],45 ] )
-
-f = lambda { |b=42, *c, d| [b,c,d] }
-test_ok(f.call(      99) == [42,[  ],99] )
-test_ok(f.call(43   ,99) == [43,[  ],99] )
-test_ok(f.call(43,44,99) == [43,[44],99] )
-
-f = lambda { |b=42, &block| [b,block&&block[]] }
-test_ok(f.call(  )     == [42,nil] )
-test_ok(f.call(43)     == [43,nil] )
-test_ok(f.call(43)     == [43,nil] )
-test_ok(f.call(  ){45} == [42,45 ] )
-test_ok(f.call(43){45} == [43,45 ] )
-test_ok(f.call(43){45} == [43,45 ] )
-
-f = lambda { |b=42, d| [b,d] }
-test_ok(f.call(   99) == [42,99] )
-test_ok(f.call(43,99) == [43,99] )
-test_ok(f.call(43,99) == [43,99] )
-
-
-a,=*[1]
-test_ok(a == 1)
-a,=*[[1]]
-test_ok(a == [1])
-a,=*[[[1]]]
-test_ok(a == [[1]])
-
-x, (y, z) = 1, 2, 3
-test_ok([1,2,nil] == [x,y,z])
-x, (y, z) = 1, [2,3]
-test_ok([1,2,3] == [x,y,z])
-x, (y, z) = 1, [2]
-test_ok([1,2,nil] == [x,y,z])
-
-a = loop do break; end; test_ok(a == nil)
-a = loop do break nil; end; test_ok(a == nil)
-a = loop do break 1; end; test_ok(a == 1)
-a = loop do break []; end; test_ok(a == [])
-a = loop do break [1]; end; test_ok(a == [1])
-a = loop do break [nil]; end; test_ok(a == [nil])
-a = loop do break [[]]; end; test_ok(a == [[]])
-a = loop do break [*[]]; end; test_ok(a == [])
-a = loop do break [*[1]]; end; test_ok(a == [1])
-a = loop do break [*[1,2]]; end; test_ok(a == [1,2])
-
-a = loop do break *[]; end; test_ok(a == [])
-a = loop do break *[1]; end; test_ok(a == [1])
-a = loop do break *[nil]; end; test_ok(a == [nil])
-a = loop do break *[[]]; end; test_ok(a == [[]])
-a = loop do break *[*[]]; end; test_ok(a == [])
-a = loop do break *[*[1]]; end; test_ok(a == [1])
-a = loop do break *[*[1,2]]; end; test_ok(a == [1,2])
-
-*a = loop do break; end; test_ok(a == [nil])
-*a = loop do break nil; end; test_ok(a == [nil])
-*a = loop do break 1; end; test_ok(a == [1])
-*a = loop do break []; end; test_ok(a == [])
-*a = loop do break [1]; end; test_ok(a == [1])
-*a = loop do break [nil]; end; test_ok(a == [nil])
-*a = loop do break [[]]; end; test_ok(a == [[]])
-*a = loop do break [1,2]; end; test_ok(a == [1,2])
-*a = loop do break [*[]]; end; test_ok(a == [])
-*a = loop do break [*[1]]; end; test_ok(a == [1])
-*a = loop do break [*[1,2]]; end; test_ok(a == [1,2])
-
-*a = loop do break *[]; end; test_ok(a == [])
-*a = loop do break *[1]; end; test_ok(a == [1])
-*a = loop do break *[nil]; end; test_ok(a == [nil])
-*a = loop do break *[[]]; end; test_ok(a == [[]])
-*a = loop do break *[1,2]; end; test_ok(a == [1,2])
-*a = loop do break *[*[]]; end; test_ok(a == [])
-*a = loop do break *[*[1]]; end; test_ok(a == [1])
-*a = loop do break *[*[1,2]]; end; test_ok(a == [1,2])
-
-*a = *loop do break *[[]]; end; test_ok(a == [[]])
-*a = *loop do break *[1,2]; end; test_ok(a == [1,2])
-*a = *loop do break *[*[1,2]]; end; test_ok(a == [1,2])
-
-a,b,*c = loop do break; end; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = loop do break nil; end; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = loop do break 1; end; test_ok([a,b,c] == [1,nil,[]])
-a,b,*c = loop do break []; end; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = loop do break [1]; end; test_ok([a,b,c] == [1,nil,[]])
-a,b,*c = loop do break [nil]; end; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = loop do break [[]]; end; test_ok([a,b,c] == [[],nil,[]])
-a,b,*c = loop do break [1,2]; end; test_ok([a,b,c] == [1,2,[]])
-a,b,*c = loop do break [*[]]; end; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = loop do break [*[1]]; end; test_ok([a,b,c] == [1,nil,[]])
-a,b,*c = loop do break [*[1,2]]; end; test_ok([a,b,c] == [1,2,[]])
-
-a,b,*c = loop do break *[]; end; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = loop do break *[1]; end; test_ok([a,b,c] == [1,nil,[]])
-a,b,*c = loop do break *[nil]; end; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = loop do break *[[]]; end; test_ok([a,b,c] == [[],nil,[]])
-a,b,*c = loop do break *[1,2]; end; test_ok([a,b,c] == [1,2,[]])
-a,b,*c = loop do break *[*[]]; end; test_ok([a,b,c] == [nil,nil,[]])
-a,b,*c = loop do break *[*[1]]; end; test_ok([a,b,c] == [1,nil,[]])
-a,b,*c = loop do break *[*[1,2]]; end; test_ok([a,b,c] == [1,2,[]])
-
-def r(val); a = yield(); test_ok(a == val, 2); end
-r(nil){next}
-r(nil){next nil}
-r(1){next 1}
-r([]){next []}
-r([1]){next [1]}
-r([nil]){next [nil]}
-r([[]]){next [[]]}
-r([]){next [*[]]}
-r([1]){next [*[1]]}
-r([1,2]){next [*[1,2]]}
-
-r([]){next *[]}
-r([1]){next *[1]}
-r([nil]){next *[nil]}
-r([[]]){next *[[]]}
-r([]){next *[*[]]}
-r([1]){next *[*[1]]}
-r([1,2]){next *[*[1,2]]}
-
-def r(val); *a = yield(); test_ok(a == val, 2); end
-r([nil]){next}
-r([nil]){next nil}
-r([1]){next 1}
-r([]){next []}
-r([1]){next [1]}
-r([nil]){next [nil]}
-r([[]]){next [[]]}
-r([1,2]){next [1,2]}
-r([]){next [*[]]}
-r([1]){next [*[1]]}
-r([1,2]){next [*[1,2]]}
-
-def r(val); *a = *yield(); test_ok(a == val, 2); end
-r([[]]){next *[[]]}
-r([1,2]){next *[1,2]}
-r([1,2]){next *[*[1,2]]}
-
-def r(val); a,b,*c = yield(); test_ok([a,b,c] == val, 2); end
-r([nil,nil,[]]){next}
-r([nil,nil,[]]){next nil}
-r([1,nil,[]]){next 1}
-r([nil,nil,[]]){next []}
-r([1,nil,[]]){next [1]}
-r([nil,nil,[]]){next [nil]}
-r([[],nil,[]]){next [[]]}
-r([1,2,[]]){next [1,2]}
-r([nil,nil,[]]){next [*[]]}
-r([1,nil,[]]){next [*[1]]}
-r([1,2,[]]){next [*[1,2]]}
-
-def r(val); a,b,*c = *yield(); test_ok([a,b,c] == val, 2); end
-r([[],nil,[]]){next *[[]]}
-r([1,2,[]]){next *[1,2]}
-r([1,2,[]]){next *[*[1,2]]}
-
-test_check "condition"
-
-$x = '0';
-
-$x == $x && test_ok(true)
-$x != $x && test_ok(false)
-$x == $x || test_ok(false)
-$x != $x || test_ok(true)
-
-# first test to see if we can run the tests.
-
-test_check "if/unless";
-
-$x = 'test';
-test_ok(if $x == $x then true else false end)
-$bad = false
-unless $x == $x
-  $bad = true
-end
-test_ok(!$bad)
-test_ok(unless $x != $x then true else false end)
-
-test_check "case"
-
-case 5
-when 1, 2, 3, 4, 6, 7, 8
-  test_ok(false)
-when 5
-  test_ok(true)
-end
-
-case 5
-when 5
-  test_ok(true)
-when 1..10
-  test_ok(false)
-end
-
-case 5
-when 1..10
-  test_ok(true)
-else
-  test_ok(false)
-end
-
-case 5
-when 5
-  test_ok(true)
-else
-  test_ok(false)
-end
-
-case "foobar"
-when /^f.*r$/
-  test_ok(true)
-else
-  test_ok(false)
-end
-
-test_check "while/until";
-
-while_tmp = "while_tmp.#{$$}"
-tmp = open(while_tmp, "w")
-tmp.print "tvi925\n";
-tmp.print "tvi920\n";
-tmp.print "vt100\n";
-tmp.print "Amiga\n";
-tmp.print "paper\n";
-tmp.close
-
-# test break
-
-tmp = open(while_tmp, "r")
-test_ok(tmp.kind_of?(File))
-
-while line = tmp.gets()
-  break if /vt100/ =~ line
-end
-
-test_ok(!tmp.eof? && /vt100/ =~ line)
-tmp.close
-
-# test next
-$bad = false
-tmp = open(while_tmp, "r")
-while line = tmp.gets()
-  next if /vt100/ =~ line
-  $bad = 1 if /vt100/ =~ line
-end
-test_ok(!(!tmp.eof? || /vt100/ =~ line || $bad))
-tmp.close
-
-# test redo
-$bad = false
-tmp = open(while_tmp, "r")
-while line = tmp.gets()
-  lastline = line
-  line = line.gsub(/vt100/, 'VT100')
-  if lastline != line
-    line.gsub!('VT100', 'Vt100')
-    redo
-  end
-  $bad = 1 if /vt100/ =~ line
-  $bad = 1 if /VT100/ =~ line
-end
-test_ok(tmp.eof? && !$bad)
-tmp.close
-
-sum=0
-for i in 1..10
-  sum += i
-  i -= 1
-  if i > 0
-    redo
-  end
-end
-test_ok(sum == 220)
-
-# test interval
-$bad = false
-tmp = open(while_tmp, "r")
-while line = tmp.gets()
-  break if 3
-  case line
-  when /vt100/, /Amiga/, /paper/
-    $bad = true
-  end
-end
-test_ok(!$bad)
-tmp.close
-
-File.unlink while_tmp or `/bin/rm -f "#{while_tmp}"`
-test_ok(!File.exist?(while_tmp))
-
-i = 0
-until i>4
-  i+=1
-end
-test_ok(i>4)
-
-
-# exception handling
-test_check "exception";
-
-begin
-  raise "this must be handled"
-  test_ok(false)
-rescue
-  test_ok(true)
-end
-
-$bad = true
-begin
-  raise "this must be handled no.2"
-rescue
-  if $bad
-    $bad = false
-    retry
-    test_ok(false)
-  end
-end
-test_ok(true)
-
-# exception in rescue clause
-$string = "this must be handled no.3"
-begin
-  begin
-    raise "exception in rescue clause"
-  rescue
-    raise $string
-  end
-  test_ok(false)
-rescue => e
-  test_ok($! == e)
-  test_ok(e.message == $string)
-  test_ok(e != $string)
-end
-
-# exception in ensure clause
-begin
-  begin
-    raise "this must be handled no.4"
-  ensure
-    raise "exception in ensure clause"
-  end
-  test_ok(false)
-rescue
-  test_ok(true)
-end
-
-$bad = true
-begin
-  begin
-    raise "this must be handled no.5"
-  ensure
-    $bad = false
-  end
-rescue
-end
-test_ok(!$bad)
-
-$bad = true
-begin
-  begin
-    raise "this must be handled no.6"
-  ensure
-    $bad = false
-  end
-rescue
-end
-test_ok(!$bad)
-
-$bad = true
-while true
-  begin
-    break
-  ensure
-    $bad = false
-  end
-end
-test_ok(!$bad)
-
-test_ok(catch(:foo) {
-     loop do
-       loop do
-	 throw :foo, true
-	 break
-       end
-       break
-       test_ok(false)			# should not reach here
-     end
-     false
-   })
-
-test_check "array"
-test_ok([1, 2] + [3, 4] == [1, 2, 3, 4])
-test_ok([1, 2] * 2 == [1, 2, 1, 2])
-test_ok([1, 2] * ":" == "1:2")
-
-test_ok([1, 2].hash == [1, 2].hash)
-
-test_ok([1,2,3] & [2,3,4] == [2,3])
-test_ok([1,2,3] | [2,3,4] == [1,2,3,4])
-test_ok([1,2,3] - [2,3] == [1])
-
-$x = [0, 1, 2, 3, 4, 5]
-test_ok($x[2] == 2)
-test_ok($x[1..3] == [1, 2, 3])
-test_ok($x[1,3] == [1, 2, 3])
-
-$x[0, 2] = 10
-test_ok($x[0] == 10 && $x[1] == 2)
-
-$x[0, 0] = -1
-test_ok($x[0] == -1 && $x[1] == 10)
-
-$x[-1, 1] = 20
-test_ok($x[-1] == 20 && $x.pop == 20)
-
-# array and/or
-test_ok(([1,2,3]&[2,4,6]) == [2])
-test_ok(([1,2,3]|[2,4,6]) == [1,2,3,4,6])
-
-# compact
-$x = [nil, 1, nil, nil, 5, nil, nil]
-$x.compact!
-test_ok($x == [1, 5])
-
-# uniq
-$x = [1, 1, 4, 2, 5, 4, 5, 1, 2]
-$x.uniq!
-test_ok($x == [1, 4, 2, 5])
-
-# empty?
-test_ok(!$x.empty?)
-$x = []
-test_ok($x.empty?)
-
-# sort
-$x = ["it", "came", "to", "pass", "that", "..."]
-$x = $x.sort.join(" ")
-test_ok($x == "... came it pass that to")
-$x = [2,5,3,1,7]
-$x.sort!{|a,b| a<=>b}		# sort with condition
-test_ok($x == [1,2,3,5,7])
-$x.sort!{|a,b| b-a}		# reverse sort
-test_ok($x == [7,5,3,2,1])
-
-# split test
-$x = "The Book of Mormon"
-test_ok($x.split(//).reverse!.join == $x.reverse)
-test_ok($x.reverse == $x.reverse!)
-test_ok("1 byte string".split(//).reverse.join(":") == "g:n:i:r:t:s: :e:t:y:b: :1")
-$x = "a b c  d"
-test_ok($x.split == ['a', 'b', 'c', 'd'])
-test_ok($x.split(' ') == ['a', 'b', 'c', 'd'])
-test_ok(defined? "a".chomp)
-test_ok("abc".scan(/./) == ["a", "b", "c"])
-test_ok("1a2b3c".scan(/(\d.)/) == [["1a"], ["2b"], ["3c"]])
-# non-greedy match
-test_ok("a=12;b=22".scan(/(.*?)=(\d*);?/) == [["a", "12"], ["b", "22"]])
-
-$x = [1]
-test_ok(($x * 5).join(":") == '1:1:1:1:1')
-test_ok(($x * 1).join(":") == '1')
-test_ok(($x * 0).join(":") == '')
-
-*$x = *(1..7).to_a
-test_ok($x.size == 7)
-test_ok($x == [1, 2, 3, 4, 5, 6, 7])
-
-$x = [1,2,3]
-$x[1,0] = $x
-test_ok($x == [1,1,2,3,2,3])
-
-$x = [1,2,3]
-$x[-1,0] = $x
-test_ok($x == [1,2,1,2,3,3])
-
-$x = [1,2,3]
-$x.concat($x)
-test_ok($x == [1,2,3,1,2,3])
-
-test_check "hash"
-$x = {1=>2, 2=>4, 3=>6}
-
-test_ok($x[1] == 2)
-
-test_ok(begin
-     for k,v in $x
-       raise if k*2 != v
-     end
-     true
-   rescue
-     false
-   end)
-
-test_ok($x.length == 3)
-test_ok($x.has_key?(1))
-test_ok($x.has_value?(4))
-test_ok($x.values_at(2,3) == [4,6])
-test_ok($x == {1=>2, 2=>4, 3=>6})
-
-$z = $x.keys.sort.join(":")
-test_ok($z == "1:2:3")
-
-$z = $x.values.sort.join(":")
-test_ok($z == "2:4:6")
-test_ok($x == $x)
-
-$x.shift
-test_ok($x.length == 2)
-
-$z = [1,2]
-$x[$z] = 256
-test_ok($x[$z] == 256)
-
-$x = Hash.new(0)
-$x[1] = 1
-test_ok($x[1] == 1)
-test_ok($x[2] == 0)
-
-$x = Hash.new([])
-test_ok($x[22] == [])
-test_ok($x[22].equal?($x[22]))
-
-$x = Hash.new{[]}
-test_ok($x[22] == [])
-test_ok(!$x[22].equal?($x[22]))
-
-$x = Hash.new{|h,k| $z = k; h[k] = k*2}
-$z = 0
-test_ok($x[22] == 44)
-test_ok($z == 22)
-$z = 0
-test_ok($x[22] == 44)
-test_ok($z == 0)
-$x.default = 5
-test_ok($x[23] == 5)
-
-$x = Hash.new
-def $x.default(k)
-  $z = k
-  self[k] = k*2
-end
-$z = 0
-test_ok($x[22] == 44)
-test_ok($z == 22)
-$z = 0
-test_ok($x[22] == 44)
-test_ok($z == 0)
-
-test_check "iterator"
-
-test_ok(!iterator?)
-
-def ttt
-  test_ok(iterator?)
-end
-ttt{}
-
-# yield at top level
-test_ok(!defined?(yield))
-
-$x = [1, 2, 3, 4]
-$y = []
-
-# iterator over array
-for i in $x
-  $y.push i
-end
-test_ok($x == $y)
-
-# nested iterator
-def tt
-  1.upto(10) {|i|
-    yield i
-  }
-end
-
-i=0
-tt{|i| break if i == 5}
-test_ok(i == 0)
-
-def tt2(dummy)
-  yield 1
-end
-
-def tt3(&block)
-  tt2(raise(ArgumentError,""),&block)
-end
-
-$x = false
-begin
-  tt3{}
-rescue ArgumentError
-  $x = true
-rescue Exception
-end
-test_ok($x)
-
-def tt4 &block
-  tt2(raise(ArgumentError,""),&block)
-end
-$x = false
-begin
-  tt4{}
-rescue ArgumentError
-  $x = true
-rescue Exception
-end
-test_ok($x)
-
-# iterator break/redo/next/retry
-done = true
-loop{
-  break
-  done = false			# should not reach here
-}
-test_ok(done)
-
-done = false
-$bad = false
-loop {
-  break if done
-  done = true
-  next
-  $bad = true			# should not reach here
-}
-test_ok(!$bad)
-
-done = false
-$bad = false
-loop {
-  break if done
-  done = true
-  redo
-  $bad = true			# should not reach here
-}
-test_ok(!$bad)
-
-$x = []
-for i in 1 .. 7
-  $x.push i
-end
-test_ok($x.size == 7)
-test_ok($x == [1, 2, 3, 4, 5, 6, 7])
-
-# append method to built-in class
-class Array
-  def iter_test1
-    collect{|e| [e, yield(e)]}.sort{|a,b|a[1]<=>b[1]}
-  end
-  def iter_test2
-    a = collect{|e| [e, yield(e)]}
-    a.sort{|a,b|a[1]<=>b[1]}
-  end
-end
-$x = [[1,2],[3,4],[5,6]]
-test_ok($x.iter_test1{|x|x} == $x.iter_test2{|x|x})
-
-class IterTest
-  def initialize(e); @body = e; end
-
-  def each0(&block); @body.each(&block); end
-  def each1(&block); @body.each {|*x| block.call(*x) } end
-  def each2(&block); @body.each {|*x| block.call(x) } end
-  def each3(&block); @body.each {|x| block.call(*x) } end
-  def each4(&block); @body.each {|x| block.call(x) } end
-  def each5; @body.each {|*x| yield(*x) } end
-  def each6; @body.each {|*x| yield(x) } end
-  def each7; @body.each {|x| yield(*x) } end
-  def each8; @body.each {|x| yield(x) } end
-
-  def f(a)
-    a
-  end
-end
-test_ok(IterTest.new(nil).method(:f).to_proc.call([1]) == [1])
-m = /\w+/.match("abc")
-test_ok(IterTest.new(nil).method(:f).to_proc.call([m]) == [m])
-
-IterTest.new([0]).each0 {|x| test_ok(x == 0)}
-IterTest.new([1]).each1 {|x| test_ok(x == 1)}
-IterTest.new([2]).each2 {|x| test_ok(x == [2])}
-#IterTest.new([3]).each3 {|x| test_ok(x == 3)}
-IterTest.new([4]).each4 {|x| test_ok(x == 4)}
-IterTest.new([5]).each5 {|x| test_ok(x == 5)}
-IterTest.new([6]).each6 {|x| test_ok(x == [6])}
-#IterTest.new([7]).each7 {|x| test_ok(x == 7)}
-IterTest.new([8]).each8 {|x| test_ok(x == 8)}
-
-IterTest.new([[0]]).each0 {|x| test_ok(x == [0])}
-IterTest.new([[1]]).each1 {|x| test_ok(x == [1])}
-IterTest.new([[2]]).each2 {|x| test_ok(x == [[2]])}
-IterTest.new([[3]]).each3 {|x| test_ok(x == 3)}
-IterTest.new([[4]]).each4 {|x| test_ok(x == [4])}
-IterTest.new([[5]]).each5 {|x| test_ok(x == [5])}
-IterTest.new([[6]]).each6 {|x| test_ok(x == [[6]])}
-IterTest.new([[7]]).each7 {|x| test_ok(x == 7)}
-IterTest.new([[8]]).each8 {|x| test_ok(x == [8])}
-
-IterTest.new([[0,0]]).each0 {|*x| test_ok(x == [[0,0]])}
-IterTest.new([[8,8]]).each8 {|*x| test_ok(x == [[8,8]])}
-
-def m0(v)
-  v
-end
-
-def m1
-  m0(block_given?)
-end
-test_ok(m1{p 'test'})
-test_ok(!m1)
-
-def m
-  m0(block_given?,&Proc.new{})
-end
-test_ok(m1{p 'test'})
-test_ok(!m1)
-
-class C
-  include Enumerable
-  def initialize
-    @a = [1,2,3]
-  end
-  def each(&block)
-    @a.each(&block)
-  end
-end
-
-test_ok(C.new.collect{|n| n} == [1,2,3])
-
-test_ok(Proc == lambda{}.class)
-test_ok(Proc == Proc.new{}.class)
-lambda{|a|test_ok(a==1)}.call(1)
-def block_test(klass, &block)
-  test_ok(klass === block)
-end
-
-block_test(NilClass)
-block_test(Proc){}
-
-def call_argument_test(state, proc, *args)
-  x = state
-  begin
-    proc.call(*args)
-  rescue ArgumentError
-    x = !x
-  end
-  test_ok(x,2)
-end
-
-call_argument_test(true, lambda{||})
-call_argument_test(false, lambda{||}, 1)
-call_argument_test(true, lambda{|a,|}, 1)
-call_argument_test(false, lambda{|a,|})
-call_argument_test(false, lambda{|a,|}, 1,2)
-
-call_argument_test(true, Proc.new{||})
-call_argument_test(true, Proc.new{||}, 1)
-call_argument_test(true, Proc.new{|a,|}, 1)
-call_argument_test(true, Proc.new{|a,|})
-call_argument_test(true, Proc.new{|a,|}, 1,2)
-
-def block_get(&block)
-  block
-end
-
-test_ok(Proc == block_get{}.class)
-call_argument_test(true, block_get{||})
-call_argument_test(true, block_get{||}, 1)
-call_argument_test(true, block_get{|a,|}, 1)
-call_argument_test(true, block_get{|a,|})
-call_argument_test(true, block_get{|a,|}, 1,2)
-
-call_argument_test(true, block_get(&lambda{||}))
-call_argument_test(false, block_get(&lambda{||}),1)
-call_argument_test(true, block_get(&lambda{|a,|}),1)
-call_argument_test(false, block_get(&lambda{|a,|}),1,2)
-
-blk = block_get{11}
-test_ok(blk.class == Proc)
-test_ok(blk.to_proc.class == Proc)
-test_ok(blk.clone.call == 11)
-test_ok(block_get(&blk).class == Proc)
-
-lmd = lambda{44}
-test_ok(lmd.class == Proc)
-test_ok(lmd.to_proc.class == Proc)
-test_ok(lmd.clone.call == 44)
-test_ok(block_get(&lmd).class == Proc)
-
-test_ok(Proc.new{|a,| a}.yield(1,2,3) == 1)
-call_argument_test(true, Proc.new{|a,|}, 1,2)
-
-test_ok(Proc.new{|&b| b.call(10)}.call {|x| x} == 10)
-test_ok(Proc.new{|a,&b| b.call(a)}.call(12) {|x| x} == 12)
-
-def test_return1
-  Proc.new {
-    return 55
-  }.yield + 5
-end
-test_ok(test_return1() == 55)
-def test_return2
-  lambda {
-    return 55
-  }.call + 5
-end
-test_ok(test_return2() == 60)
-
-def proc_call(&b)
-  b.call
-end
-def proc_yield()
-  yield
-end
-def proc_return1
-  lambda{return 42}.call+1
-end
-test_ok(proc_return1() == 43)
-def proc_return2
-  ->{return 42}.call+1
-end
-test_ok(proc_return2() == 43)
-def proc_return3
-  proc_call{return 42}+1
-end
-test_ok(proc_return3() == 42)
-def proc_return4
-  proc_yield{return 42}+1
-end
-test_ok(proc_return4() == 42)
-
-def ljump_test(state, proc, *args)
-  x = state
-  begin
-    proc.call(*args)
-  rescue LocalJumpError
-    x = !x
-  end
-  test_ok(x,2)
-end
-
-ljump_test(false, block_get{break})
-ljump_test(true, lambda{break})
-
-def exit_value_test(&block)
-  block.call
-rescue LocalJumpError
-  $!.exit_value
-end
-
-test_ok(45 == exit_value_test{break 45})
-
-test_ok(55 == begin
-              block_get{break 55}.call
-            rescue LocalJumpError
-              $!.exit_value
-            end)
-
-def block_call(&block)
-  block.call
-end
-
-def test_b1
-  block_call{break 11}
-end
-test_ok(test_b1() == 11)
-
-def ljump_rescue(r)
-  begin
-    yield
-  rescue LocalJumpError => e
-    r if /from proc-closure/ =~ e.message
-  end
-end
-
-def test_b2
-  ljump_rescue(22) do
-    block_get{break 21}.call
-  end
-end
-test_ok(test_b2() == 22)
-
-def test_b3
-  ljump_rescue(33) do
-    Proc.new{break 31}.yield
-  end
-end
-test_ok(test_b3() == 33)
-
-def test_b4
-  lambda{break 44}.call
-end
-test_ok(test_b4() == 44)
-
-def test_b5
-  ljump_rescue(55) do
-    b = block_get{break 54}
-    block_call(&b)
-  end
-end
-test_ok(test_b5() == 55)
-
-def test_b6
-  b = lambda{break 67}
-  block_call(&b)
-  66
-end
-test_ok(test_b6() == 66)
-
-def util_r7
-  block_get{break 78}
-end
-
-def test_b7
-  b = util_r7()
-  ljump_rescue(77) do
-    block_call(&b)
-  end
-end
-test_ok(test_b7() == 77)
-
-def util_b8(&block)
-  block_call(&block)
-end
-
-def test_b8
-  util_b8{break 88}
-end
-test_ok(test_b8() == 88)
-
-def util_b9(&block)
-  lambda{block.call; 98}.call
-end
-
-def test_b9
-  util_b9{break 99}
-end
-test_ok(test_b9() == 99)
-
-def util_b10
-  util_b9{break 100}
-end
-
-def test_b10
-  util_b10()
-end
-test_ok(test_b10() == 100)
-
-def test_b11
-  ljump_rescue(111) do
-    loop do
-      Proc.new{break 110}.yield
-      break 112
-    end
-  end
-end
-test_ok(test_b11() == 111)
-
-def test_b12
-  loop do
-    break lambda{break 122}.call
-    break 121
-  end
-end
-test_ok(test_b12() == 122)
-
-def test_b13
-  ljump_rescue(133) do
-    while true
-      Proc.new{break 130}.yield
-      break 131
-    end
-  end
-end
-test_ok(test_b13() == 133)
-
-def test_b14
-  while true
-    break lambda{break 144}.call
-    break 143
-  end
-end
-test_ok(test_b14() == 144)
-
-def test_b15
-  [0].each {|c| yield 1 }
-  156
-end
-test_ok(test_b15{|e| break 155 } == 155)
-
-def marity_test(m)
-  method = method(m)
-  test_ok(method.arity == method.to_proc.arity, 2)
-end
-marity_test(:test_ok)
-marity_test(:marity_test)
-marity_test(:p)
-
-lambda(&method(:test_ok)).call(true)
-lambda(&block_get{|a,n| test_ok(a,n)}).call(true, 2)
-
-class ITER_TEST1
-   def a
-     block_given?
-   end
-end
-
-class ITER_TEST2 < ITER_TEST1
-   def a
-     test_ok(super)
-     super
-   end
-end
-test_ok(ITER_TEST2.new.a {})
-
-class ITER_TEST3
-  def foo x
-    return yield if block_given?
-    x
-  end
-end
-
-class ITER_TEST4 < ITER_TEST3
-  def foo x
-    test_ok(super == yield)
-    test_ok(super(x, &nil) == x)
-  end
-end
-
-ITER_TEST4.new.foo(44){55}
-
-class ITER_TEST5
-   def tt(aa)
-     aa
-   end
-
-   def uu(a)
-      class << self
-         define_method(:tt) do |sym|
-            super(sym)
-         end
-      end
-   end
-
-   def xx(*x)
-     x.size
-   end
-end
-
-a = ITER_TEST5.new
-a.uu(12)
-test_ok(a.tt(1) == 1)
-
-class ITER_TEST6 < ITER_TEST5
-   def xx(*a)
-      a << 12
-      super
-   end
-end
-
-test_ok(ITER_TEST6.new.xx([24]) == 2)
-
-test_check "float"
-test_ok(2.6.floor == 2)
-test_ok((-2.6).floor == -3)
-test_ok(2.6.ceil == 3)
-test_ok((-2.6).ceil == -2)
-test_ok(2.6.truncate == 2)
-test_ok((-2.6).truncate == -2)
-test_ok(2.6.round == 3)
-test_ok((-2.4).truncate == -2)
-test_ok((13.4 % 1 - 0.4).abs < 0.0001)
-nan = 0.0/0
-def nan_test(x,y)
-  test_ok(x != y)
-  test_ok((x < y) == false)
-  test_ok((x > y) == false)
-  test_ok((x <= y) == false)
-  test_ok((x >= y) == false)
-end
-nan_test(nan, nan)
-nan_test(nan, 0)
-nan_test(nan, 1)
-nan_test(nan, -1)
-nan_test(nan, 1000)
-nan_test(nan, -1000)
-nan_test(nan, 1_000_000_000_000)
-nan_test(nan, -1_000_000_000_000)
-nan_test(nan, 100.0);
-nan_test(nan, -100.0);
-nan_test(nan, 0.001);
-nan_test(nan, -0.001);
-nan_test(nan, 1.0/0);
-nan_test(nan, -1.0/0);
-
-#s = "3.7517675036461267e+17"
-#test_ok(s == sprintf("%.16e", s.to_f))
-f = 3.7517675036461267e+17
-test_ok(f == sprintf("%.16e", f).to_f)
-
-
-test_check "bignum"
-def fact(n)
-  return 1 if n == 0
-  f = 1
-  while n>0
-    f *= n
-    n -= 1
-  end
-  return f
-end
-$x = fact(40)
-test_ok($x == $x)
-test_ok($x == fact(40))
-test_ok($x < $x+2)
-test_ok($x > $x-2)
-test_ok($x == 815915283247897734345611269596115894272000000000)
-test_ok($x != 815915283247897734345611269596115894272000000001)
-test_ok($x+1 == 815915283247897734345611269596115894272000000001)
-test_ok($x/fact(20) == 335367096786357081410764800000)
-$x = -$x
-test_ok($x == -815915283247897734345611269596115894272000000000)
-test_ok(2-(2**32) == -(2**32-2))
-test_ok(2**32 - 5 == (2**32-3)-2)
-
-$good = true;
-for i in 1000..1014
-  $good = false if ((1 << i) != (2**i))
-end
-test_ok($good)
-
-$good = true;
-n1= 1 << 1000
-for i in 1000..1014
-  $good = false if ((1 << i) != n1)
-  n1 *= 2
-end
-test_ok($good)
-
-$good = true;
-n2=n1
-for i in 1..10
-  n1 = n1 / 2
-  n2 = n2 >> 1
-  $good = false if (n1 != n2)
-end
-test_ok($good)
-
-$good = true;
-for i in 4000..4096
-  n1 = 1 << i;
-  if (n1**2-1) / (n1+1) != (n1-1)
-    $good = false
-  end
-end
-test_ok($good)
-
-b = 10**80
-a = b * 9 + 7
-test_ok(7 == a.modulo(b))
-test_ok(-b + 7 == a.modulo(-b))
-test_ok(b + -7 == (-a).modulo(b))
-test_ok(-7 == (-a).modulo(-b))
-test_ok(7 == a.remainder(b))
-test_ok(7 == a.remainder(-b))
-test_ok(-7 == (-a).remainder(b))
-test_ok(-7 == (-a).remainder(-b))
-
-test_ok(10**40+10**20 == 10000000000000000000100000000000000000000)
-test_ok(10**40/10**20 == 100000000000000000000)
-
-a = 677330545177305025495135714080
-b = 14269972710765292560
-test_ok(a % b == 0)
-test_ok(-a % b == 0)
-
-def shift_test(a)
-  b = a / (2 ** 32)
-  c = a >> 32
-  test_ok(b == c)
-
-  b = a * (2 ** 32)
-  c = a << 32
-  test_ok(b == c)
-end
-
-shift_test(-4518325415524767873)
-shift_test(-0xfffffffffffffffff)
-
-test_check "string & char"
-
-test_ok("abcd" == "abcd")
-test_ok("abcd" =~ /abcd/)
-test_ok("abcd" === "abcd")
-# compile time string concatenation
-test_ok("ab" "cd" == "abcd")
-test_ok("#{22}aa" "cd#{44}" == "22aacd44")
-test_ok("#{22}aa" "cd#{44}" "55" "#{66}" == "22aacd445566")
-test_ok("abc" !~ /^$/)
-test_ok("abc\n" !~ /^$/)
-test_ok("abc" !~ /^d*$/)
-test_ok(("abc" =~ /d*$/) == 3)
-test_ok("" =~ /^$/)
-test_ok("\n" =~ /^$/)
-test_ok("a\n\n" =~ /^$/)
-test_ok("abcabc" =~ /.*a/ && $& == "abca")
-test_ok("abcabc" =~ /.*c/ && $& == "abcabc")
-test_ok("abcabc" =~ /.*?a/ && $& == "a")
-test_ok("abcabc" =~ /.*?c/ && $& == "abc")
-test_ok(/(.|\n)*?\n(b|\n)/ =~ "a\nb\n\n" && $& == "a\nb")
-
-test_ok(/^(ab+)+b/ =~ "ababb" && $& == "ababb")
-test_ok(/^(?:ab+)+b/ =~ "ababb" && $& == "ababb")
-test_ok(/^(ab+)+/ =~ "ababb" && $& == "ababb")
-test_ok(/^(?:ab+)+/ =~ "ababb" && $& == "ababb")
-
-test_ok(/(\s+\d+){2}/ =~ " 1 2" && $& == " 1 2")
-test_ok(/(?:\s+\d+){2}/ =~ " 1 2" && $& == " 1 2")
-
-$x = <<END;
-ABCD
-ABCD
-END
-$x.gsub!(/((.|\n)*?)B((.|\n)*?)D/, '\1\3')
-test_ok($x == "AC\nAC\n")
-
-test_ok("foobar" =~ /foo(?=(bar)|(baz))/)
-test_ok("foobaz" =~ /foo(?=(bar)|(baz))/)
-
-$foo = "abc"
-test_ok("#$foo = abc" == "abc = abc")
-test_ok("#{$foo} = abc" == "abc = abc")
-
-foo = "abc"
-test_ok("#{foo} = abc" == "abc = abc")
-
-test_ok('-' * 5 == '-----')
-test_ok('-' * 1 == '-')
-test_ok('-' * 0 == '')
-
-foo = '-'
-test_ok(foo * 5 == '-----')
-test_ok(foo * 1 == '-')
-test_ok(foo * 0 == '')
-
-$x = "a.gif"
-test_ok($x.sub(/.*\.([^\.]+)$/, '\1') == "gif")
-test_ok($x.sub(/.*\.([^\.]+)$/, 'b.\1') == "b.gif")
-test_ok($x.sub(/.*\.([^\.]+)$/, '\2') == "")
-test_ok($x.sub(/.*\.([^\.]+)$/, 'a\2b') == "ab")
-test_ok($x.sub(/.*\.([^\.]+)$/, '<\&>') == "<a.gif>")
-
-# character constants(assumes ASCII)
-test_ok("a"[0] == ?a)
-test_ok(?a == ?a)
-test_ok(?\C-a == "\1")
-test_ok(?\M-a == "\341")
-test_ok(?\M-\C-a == "\201")
-test_ok("a".upcase![0] == ?A)
-test_ok("A".downcase![0] == ?a)
-test_ok("abc".tr!("a-z", "A-Z") == "ABC")
-test_ok("aabbcccc".tr_s!("a-z", "A-Z") == "ABC")
-test_ok("abcc".squeeze!("a-z") == "abc")
-test_ok("abcd".delete!("bc") == "ad")
-
-$x = "abcdef"
-$y = [ ?a, ?b, ?c, ?d, ?e, ?f ]
-$bad = false
-$x.each_byte {|i|
-  if i.chr != $y.shift
-    $bad = true
-    break
-  end
-}
-test_ok(!$bad)
-
-s = "a string"
-s[0..s.size]="another string"
-test_ok(s == "another string")
-
-s = <<EOS
-#{
-[1,2,3].join(",")
-}
-EOS
-test_ok(s == "1,2,3\n")
-test_ok("Just".to_i(36) == 926381)
-test_ok("-another".to_i(36) == -23200231779)
-test_ok(1299022.to_s(36) == "ruby")
-test_ok(-1045307475.to_s(36) == "-hacker")
-test_ok("Just_another_Ruby_hacker".to_i(36) == 265419172580680477752431643787347)
-test_ok(-265419172580680477752431643787347.to_s(36) == "-justanotherrubyhacker")
-
-a = []
-(0..255).each {|n|
-  ch = [n].pack("C")
-  a.push ch if /a#{Regexp.quote ch}b/x =~ "ab"
-}
-test_ok(a.size == 0)
-
-test_check "assignment"
-a = nil
-test_ok(defined?(a))
-test_ok(a == nil)
-
-# multiple asignment
-a, b = 1, 2
-test_ok(a == 1 && b == 2)
-
-a, b = b, a
-test_ok(a == 2 && b == 1)
-
-a, = 1,2
-test_ok(a == 1)
-
-a, *b = 1, 2, 3
-test_ok(a == 1 && b == [2, 3])
-
-a, (b, c), d = 1, [2, 3], 4
-test_ok(a == 1 && b == 2 && c == 3 && d == 4)
-
-*a = 1, 2, 3
-test_ok(a == [1, 2, 3])
-
-*a = 4
-test_ok(a == [4])
-
-*a = nil
-test_ok(a == [nil])
-
-test_check "call"
-def aaa(a, b=100, *rest)
-  res = [a, b]
-  res += rest if rest
-  return res
-end
-
-# not enough argument
-begin
-  aaa()				# need at least 1 arg
-  test_ok(false)
-rescue
-  test_ok(true)
-end
-
-begin
-  aaa				# no arg given (exception raised)
-  test_ok(false)
-rescue
-  test_ok(true)
-end
-
-test_ok(aaa(1) == [1, 100])
-test_ok(aaa(1, 2) == [1, 2])
-test_ok(aaa(1, 2, 3, 4) == [1, 2, 3, 4])
-test_ok(aaa(1, *[2, 3, 4]) == [1, 2, 3, 4])
-
-test_check "proc"
-$proc = Proc.new{|i| i}
-test_ok($proc.call(2) == 2)
-test_ok($proc.call(3) == 3)
-
-$proc = Proc.new{|i| i*2}
-test_ok($proc.call(2) == 4)
-test_ok($proc.call(3) == 6)
-
-Proc.new{
-  iii=5				# nested local variable
-  $proc = Proc.new{|i|
-    iii = i
-  }
-  $proc2 = Proc.new {
-    $x = iii			# nested variables shared by procs
-  }
-  # scope of nested variables
-  test_ok(defined?(iii))
-}.call
-test_ok(!defined?(iii))		# out of scope
-
-loop{iii=5; test_ok(eval("defined? iii")); break}
-loop {
-  iii = 10
-  def dyna_var_check
-    loop {
-      test_ok(!defined?(iii))
-      break
-    }
-  end
-  dyna_var_check
-  break
-}
-$x=0
-$proc.call(5)
-$proc2.call
-test_ok($x == 5)
-
-if defined? Process.kill
-  test_check "signal"
-
-  $x = 0
-  trap "SIGINT", Proc.new{|sig| $x = 2}
-  Process.kill "SIGINT", $$
-  100.times {
-    sleep 0.1
-    break if $x != 0
-  }
-  test_ok($x == 2)
-
-  trap "SIGINT", Proc.new{raise "Interrupt"}
-
-  x = false
-  begin
-    Process.kill "SIGINT", $$
-    sleep 0.1
-  rescue
-    x = $!
-  end
-  test_ok(x && /Interrupt/ =~ x.message)
-end
-
-test_check "eval"
-test_ok(eval("") == nil)
-$bad=false
-eval 'while false; $bad = true; print "foo\n" end'
-test_ok(!$bad)
-
-test_ok(eval('Object'))
-test_ok(eval('true'))
-test_ok(!eval('nil'))
-test_ok(!eval('false'))
-
-$foo = 'test_ok(true)'
-begin
-  eval $foo
-rescue
-  test_ok(false)
-end
-
-test_ok(eval("$foo") == 'test_ok(true)')
-test_ok(eval("true") == true)
-i = 5
-test_ok(eval("i == 5"))
-test_ok(eval("i") == 5)
-test_ok(eval("defined? i"))
-
-# eval with binding
-def test_ev
-  local1 = "local1"
-  lambda {
-    local2 = "local2"
-    return binding
-  }.call
-end
-
-$x = test_ev
-test_ok(eval("local1", $x) == "local1") # normal local var
-test_ok(eval("local2", $x) == "local2") # nested local var
-$bad = true
-begin
-  p eval("local1")
-rescue NameError		# must raise error
-  $bad = false
-end
-test_ok(!$bad)
-
-module EvTest
-  EVTEST1 = 25
-  evtest2 = 125
-  $x = binding
-end
-test_ok(eval("EVTEST1", $x) == 25)	# constant in module
-test_ok(eval("evtest2", $x) == 125)	# local var in module
-$bad = true
-begin
-  eval("EVTEST1")
-rescue NameError		# must raise error
-  $bad = false
-end
-test_ok(!$bad)
-
-x = binding #! YARV Limitation: Proc.new{}
-eval "i4 = 1", x
-test_ok(eval("i4", x) == 1)
-x = Proc.new{binding}.call #! YARV Limitation: Proc.new{Proc.new{}}.call
-eval "i4 = 22", x
-test_ok(eval("i4", x) == 22)
-$x = []
-x = Proc.new{binding}.call #! YARV Limitation: Proc.new{Proc.new{}}.call
-eval "(0..9).each{|i5| $x[i5] = Proc.new{i5*2}}", x
-test_ok($x[4].call == 8)
-
-x = binding
-eval "i = 1", x
-test_ok(eval("i", x) == 1)
-x = Proc.new{binding}.call
-eval "i = 22", x
-test_ok(eval("i", x) == 22)
-$x = []
-x = Proc.new{binding}.call
-eval "(0..9).each{|i5| $x[i5] = Proc.new{i5*2}}", x
-test_ok($x[4].call == 8)
-x = Proc.new{binding}.call
-eval "for i6 in 1..1; j6=i6; end", x
-test_ok(eval("defined? i6", x))
-test_ok(eval("defined? j6", x))
-
-Proc.new {
-  p = binding
-  eval "foo11 = 1", p
-  foo22 = 5
-  Proc.new{foo11=22}.call
-  Proc.new{foo22=55}.call
-  test_ok(eval("foo11", p) == eval("foo11"))
-  test_ok(eval("foo11") == 1)
-  test_ok(eval("foo22", p) == eval("foo22"))
-  test_ok(eval("foo22") == 55)
-}.call if false #! YARV Limitation
-
-#! YARV Limitation: p1 = Proc.new{i7 = 0; Proc.new{i7}}.call
-p1 = Proc.new{i7 = 0; binding}.call
-#! YARV Limitation: test_ok(p1.call == 0)
-eval "i7=5", p1
-#! YARV Limitation: test_ok(p1.call == 5)
-test_ok(!defined?(i7))
-
-if false #! YARV Limitation
-p1 = Proc.new{i7 = 0; Proc.new{i7}}.call
-i7 = nil
-test_ok(p1.call == 0)
-eval "i7=1", p1
-test_ok(p1.call == 1)
-eval "i7=5", p1
-test_ok(p1.call == 5)
-test_ok(i7 == nil)
-end
-
-test_check "system"
-test_ok(`echo foobar` == "foobar\n")
-test_ok(`./miniruby -e 'print "foobar"'` == 'foobar')
-
-script_tmp = "script_tmp.#{$$}"
-tmp = open(script_tmp, "w")
-tmp.print "print $zzz\n";
-tmp.close
-
-test_ok(`./miniruby -s #{script_tmp} -zzz` == 'true')
-test_ok(`./miniruby -s #{script_tmp} -zzz=555` == '555')
-
-tmp = open(script_tmp, "w")
-tmp.print "#! /usr/local/bin/ruby -s\n";
-tmp.print "print $zzz\n";
-tmp.close
-
-test_ok(`./miniruby #{script_tmp} -zzz=678` == '678')
-
-tmp = open(script_tmp, "w")
-tmp.print "this is a leading junk\n";
-tmp.print "#! /usr/local/bin/ruby -s\n";
-tmp.print "print $zzz\n";
-tmp.print "__END__\n";
-tmp.print "this is a trailing junk\n";
-tmp.close
-
-test_ok(`./miniruby -x #{script_tmp}` == '')
-test_ok(`./miniruby -x #{script_tmp} -zzz=555` == '555')
-
-tmp = open(script_tmp, "w")
-for i in 1..5
-  tmp.print i, "\n"
-end
-tmp.close
-
-`./miniruby -i.bak -pe '$_.sub!(/^[0-9]+$/){$&.to_i * 5}' #{script_tmp}`
-done = true
-tmp = open(script_tmp, "r")
-while tmp.gets
-  if $_.to_i % 5 != 0
-    done = false
-    break
-  end
-end
-tmp.close
-test_ok(done)
-
-File.unlink script_tmp or `/bin/rm -f "#{script_tmp}"`
-File.unlink "#{script_tmp}.bak" or `/bin/rm -f "#{script_tmp}.bak"`
-
-test_check "const"
-TEST1 = 1
-TEST2 = 2
-
-module Const
-  TEST3 = 3
-  TEST4 = 4
-end
-
-module Const2
-  TEST3 = 6
-  TEST4 = 8
-end
-
-include Const
-
-test_ok([TEST1,TEST2,TEST3,TEST4] == [1,2,3,4])
-
-include Const2
-STDERR.print "intentionally redefines TEST3, TEST4\n" if $VERBOSE
-test_ok([TEST1,TEST2,TEST3,TEST4] == [1,2,6,8])
-
-
-test_ok((String <=> Object) == -1)
-test_ok((Object <=> String) == 1)
-test_ok((Array <=> String) == nil)
-
-test_check "clone"
-foo = Object.new
-def foo.test
-  "test"
-end
-bar = foo.clone
-def bar.test2
-  "test2"
-end
-
-test_ok(bar.test2 == "test2")
-test_ok(bar.test == "test")
-test_ok(foo.test == "test")
-
-begin
-  foo.test2
-  test_ok false
-rescue NoMethodError
-  test_ok true
-end
-
-module M001; end
-module M002; end
-module M003; include M002; end
-module M002; include M001; end
-module M003; include M002; end
-
-test_ok(M003.ancestors == [M003, M002, M001])
-
-test_check "marshal"
-$x = [1,2,3,[4,5,"foo"],{1=>"bar"},2.5,fact(30)]
-$y = Marshal.dump($x)
-test_ok($x == Marshal.load($y))
-
-StrClone=String.clone;
-test_ok(Marshal.load(Marshal.dump(StrClone.new("abc"))).class == StrClone)
-
-[[1,2,3,4], [81, 2, 118, 3146]].each { |w,x,y,z|
-  a = (x.to_f + y.to_f / z.to_f) * Math.exp(w.to_f / (x.to_f + y.to_f / z.to_f))
-  ma = Marshal.dump(a)
-  b = Marshal.load(ma)
-  test_ok(a == b)
-}
-
-test_check "pack"
-
-$format = "c2x5CCxsdils_l_a6";
-# Need the expression in here to force ary[5] to be numeric.  This avoids
-# test2 failing because ary2 goes str->numeric->str and ary does not.
-ary = [1,-100,127,128,32767,987.654321098 / 100.0,12345,123456,-32767,-123456,"abcdef"]
-$x = ary.pack($format)
-ary2 = $x.unpack($format)
-
-test_ok(ary.length == ary2.length)
-test_ok(ary.join(':') == ary2.join(':'))
-test_ok($x =~ /def/)
-
-$x = [-1073741825]
-test_ok($x.pack("q").unpack("q") == $x)
-
-test_check "math"
-test_ok(Math.sqrt(4) == 2)
-
-include Math
-test_ok(sqrt(4) == 2)
-
-test_check "struct"
-struct_test = Struct.new("Test", :foo, :bar)
-test_ok(struct_test == Struct::Test)
-
-test = struct_test.new(1, 2)
-test_ok(test.foo == 1 && test.bar == 2)
-test_ok(test[0] == 1 && test[1] == 2)
-
-a, b = test.to_a
-test_ok(a == 1 && b == 2)
-
-test[0] = 22
-test_ok(test.foo == 22)
-
-test.bar = 47
-test_ok(test.bar == 47)
-
-test_check "variable"
-test_ok($$.instance_of?(Integer))
-
-# read-only variable
-begin
-  $$ = 5
-  test_ok false
-rescue NameError
-  test_ok true
-end
-
-foobar = "foobar"
-$_ = foobar
-test_ok($_ == foobar)
-
-class Gods
-  @@rule = "Uranus"		# private to Gods
-  def ruler0
-    @@rule
-  end
-
-  def self.ruler1		# <= per method definition style
-    @@rule
-  end
-  class << self			# <= multiple method definition style
-    def ruler2
-      @@rule
-    end
-  end
-end
-
-module Olympians
-  @@rule ="Zeus"
-  def ruler3
-    @@rule
-  end
-end
-
-class Titans < Gods
-  @@rule = "Cronus"		# do not affect @@rule in Gods
-  include Olympians
-  def ruler4
-    @@rule
-  end
-end
-
-test_ok(Gods.new.ruler0 == "Cronus")
-test_ok(Gods.ruler1 == "Cronus")
-test_ok(Gods.ruler2 == "Cronus")
-test_ok(Titans.ruler1 == "Cronus")
-test_ok(Titans.ruler2 == "Cronus")
-atlas = Titans.new
-test_ok(atlas.ruler0 == "Cronus")
-test_ok(atlas.ruler3 == "Zeus")
-test_ok(atlas.ruler4 == "Cronus")
-
-test_check "trace"
-$x = 1234
-$y = 0
-trace_var :$x, Proc.new{$y = $x}
-$x = 40414
-test_ok($y == $x)
-
-untrace_var :$x
-$x = 19660208
-test_ok($y != $x)
-
-trace_var :$x, Proc.new{$x *= 2}
-$x = 5
-test_ok($x == 10)
-
-untrace_var :$x
-
-test_check "defined?"
-
-test_ok(defined?($x))		# global variable
-test_ok(defined?($x) == 'global-variable')# returns description
-
-foo=5
-test_ok(defined?(foo))		# local variable
-
-test_ok(defined?(Array))	# constant
-test_ok(defined?(Object.new))	# method
-test_ok(!defined?(Object.print))# private method
-test_ok(defined?(1 == 2))	# operator expression
-
-class Foo
-  def foo
-    p :foo
-  end
-  protected :foo
-  def bar(f)
-    test_ok(defined?(self.foo))
-    test_ok(defined?(f.foo))
-  end
-end
-f = Foo.new
-test_ok(defined?(f.foo) == nil)
-f.bar(f)
-
-def defined_test
-  return !defined?(yield)
-end
-
-test_ok(defined_test)		# not iterator
-test_ok(!defined_test{})	# called as iterator
-
-test_check "alias"
-class Alias0
-  def foo; "foo" end
-end
-class Alias1<Alias0
-  alias bar foo
-  def foo; "foo+" + super end
-end
-class Alias2<Alias1
-  alias baz foo
-  undef foo
-end
-
-x = Alias2.new
-test_ok(x.bar == "foo")
-test_ok(x.baz == "foo+foo")
-
-# test_check for cache
-test_ok(x.baz == "foo+foo")
-
-class Alias3<Alias2
-  def foo
-    defined? super
-  end
-  def bar
-    defined? super
-  end
-  def quux
-    defined? super
-  end
-end
-x = Alias3.new
-test_ok(!x.foo)
-test_ok(x.bar)
-test_ok(!x.quux)
-
-test_check "path"
-test_ok(File.basename("a") == "a")
-test_ok(File.basename("a/b") == "b")
-test_ok(File.basename("a/b/") == "b")
-test_ok(File.basename("/") == "/")
-test_ok(File.basename("//") == "/")
-test_ok(File.basename("///") == "/")
-test_ok(File.basename("a/b////") == "b")
-test_ok(File.basename("a.rb", ".rb") == "a")
-test_ok(File.basename("a.rb///", ".rb") == "a")
-test_ok(File.basename("a.rb///", ".*") == "a")
-test_ok(File.basename("a.rb///", ".c") == "a.rb")
-test_ok(File.dirname("a") == ".")
-test_ok(File.dirname("/") == "/")
-test_ok(File.dirname("/a") == "/")
-test_ok(File.dirname("a/b") == "a")
-test_ok(File.dirname("a/b/c") == "a/b")
-test_ok(File.dirname("/a/b/c") == "/a/b")
-test_ok(File.dirname("/a/b/") == "/a")
-test_ok(File.dirname("/a/b///") == "/a")
-case Dir.pwd
-when %r'\A\w:'
-  test_ok(/\A\w:\/\z/ =~ File.expand_path(".", "/"))
-  test_ok(/\A\w:\/a\z/ =~ File.expand_path("a", "/"))
-  dosish = true
-when %r'\A//'
-  test_ok(%r'\A//[^/]+/[^/]+\z' =~ File.expand_path(".", "/"))
-  test_ok(%r'\A//[^/]+/[^/]+/a\z' =~ File.expand_path(".", "/"))
-  dosish = true
-else
-  test_ok(File.expand_path(".", "/") == "/")
-  test_ok(File.expand_path("sub", "/") == "/sub")
-end
-if dosish
-  test_ok(File.expand_path("/", "//machine/share/sub") == "//machine/share")
-  test_ok(File.expand_path("/dir", "//machine/share/sub") == "//machine/share/dir")
-  test_ok(File.expand_path("/", "z:/sub") == "z:/")
-  test_ok(File.expand_path("/dir", "z:/sub") == "z:/dir")
-end
-test_ok(File.expand_path(".", "//") == "//")
-test_ok(File.expand_path("sub", "//") == "//sub")
-
-# test_check "Proc#binding"
-ObjectSpace.each_object(Proc){|o|
-  begin
-    b = o.binding
-    eval 'self', b
-  rescue ArgumentError
-  end
-}
-
-test_check "gc"
-begin
-  1.upto(10000) {
-    tmp = [0,1,2,3,4,5,6,7,8,9]
-  }
-  tmp = nil
-  test_ok true
-rescue
-  test_ok false
-end
-class S
-  def initialize(a)
-    @a = a
-  end
-end
-l=nil
-100000.times {
-  l = S.new(l)
-}
-GC.start
-test_ok true   # reach here or dumps core
-l = []
-100000.times {
-  l.push([l])
-}
-GC.start
-test_ok true   # reach here or dumps core
-
-ObjectSpace.each_object{|o|
-  o.class.name
-}
-
-test_ok true   # reach here or dumps core
-
-PROGRESS.finish
-if $failed > 0
-  printf "not ok/test: %d failed %d\n", $ntest, $failed
-else
-  printf "end of test(test: %d)\n", $ntest
-end
diff --git a/bcc32/Makefile.sub b/bcc32/Makefile.sub
new file mode 100644
index 0000000000..de7a2beeb8
--- /dev/null
+++ b/bcc32/Makefile.sub
@@ -0,0 +1,490 @@
+# -*- makefile -*-
+
+SHELL = $(COMSPEC)
+MKFILES = Makefile
+
+#### Start of system configuration section. ####
+OS = bccwin32
+RT = $(OS)
+
+## variables may be overridden by $(compile_dir)/Makefile
+!ifndef srcdir
+srcdir = ..
+!endif
+!ifndef RUBY_INSTALL_NAME
+RUBY_INSTALL_NAME = ruby
+!endif
+!ifndef RUBYW_INSTALL_NAME
+RUBYW_INSTALL_NAME = $(RUBY_INSTALL_NAME:ruby=rubyw)
+!elif "$(RUBYW_INSTALL_NAME)" == "$(RUBY_INSTALL_NAME)"
+RUBYW_INSTALL_NAME = $(RUBY_INSTALL_NAME:ruby=rubyw)
+!endif
+!if "$(RUBYW_INSTALL_NAME)" == "$(RUBY_INSTALL_NAME)"
+RUBYW_INSTALL_NAME = $(RUBY_INSTALL_NAME)w
+!endif
+!ifndef RUBY_SO_NAME
+RUBY_SO_NAME = $(RT)-$(RUBY_INSTALL_NAME)$(MAJOR)$(MINOR)
+!endif
+!ifndef icondirs
+!ifdef ICONDIRS
+icondirs=$(ICONDIRS)
+!endif
+!endif
+!ifdef icondirs
+icondirs=$(icondirs:\=/)
+iconinc=-I$(icondirs: = -I)
+!endif
+###############
+
+VPATH = $(srcdir):$(srcdir)/missing
+.SUFFIXES: .y
+
+!ifndef CC
+CC = bcc32
+!endif
+!ifndef CPP
+CPP = cpp32
+!endif
+!ifndef RC
+RC = brcc32
+!endif
+!ifndef YACC
+YACC = byacc
+!endif
+!ifndef AR
+AR = tlib
+!endif
+
+PURIFY =
+AUTOCONF = autoconf
+RM = $(srcdir:/=\)\win32\rm.bat
+
+!if !defined(PROCESSOR_ARCHITECTURE)
+PROCESSOR_ARCHITECTURE = x86
+!endif
+MACHINE = $(PROCESSOR_ARCHITECTURE)
+!if "$(PROCESSOR_ARCHITECTURE)" == "x86"
+!ifndef PROCESSOR_LEVEL
+PROCESSOR_LEVEL = 5
+!endif
+!if 6 < $(PROCESSOR_LEVEL)
+PROCESSOR_LEVEL = 6
+!endif
+PROCESSOR_FLAG = -$(PROCESSOR_LEVEL)
+CPU = i$(PROCESSOR_LEVEL)86
+ARCH = i386
+!else
+CPU = $(PROCESSOR_ARCHITECTURE)
+ARCH = $(PROCESSOR_ARCHITECTURE)
+!endif
+!ifndef DEBUGFLAGS
+DEBUGFLAGS = 
+!endif
+!ifndef OPTFLAGS
+OPTFLAGS = -O
+!endif
+
+!ifndef prefix
+prefix = /usr
+!endif
+!ifndef exec_prefix
+exec_prefix = $(prefix)
+!endif
+!ifndef libdir
+libdir = $(exec_prefix)/lib
+!endif
+!if !defined(datadir)
+datadir = /share
+!endif
+!ifndef EXTOUT
+EXTOUT = .ext
+!endif
+!ifndef RIDATADIR
+RIDATADIR = $(DESTDIR)$(datadir)/ri/$(MAJOR).$(MINOR)/system
+!endif
+!ifndef TESTUI
+TESTUI = console
+!endif
+!ifndef TESTS
+TESTS =
+!endif
+!ifndef RDOCTARGET
+RDOCTARGET = install-nodoc
+!endif
+
+OUTFLAG       = -o
+!ifndef CFLAGS
+CFLAGS = -q -tWR -tWC $(DEBUGFLAGS) $(OPTFLAGS) $(PROCESSOR_FLAG) -w- -wsus -wcpt -wdup -wext -wrng -wrpt -wzdi
+!endif
+!ifndef LDFLAGS
+LDFLAGS = -S:$(STACK)
+!endif
+!ifndef RFLAGS
+RFLAGS = $(iconinc)
+!endif
+!ifndef EXTLIBS
+EXTLIBS =
+!endif
+!ifndef MEMLIB
+MEMLIB =
+!endif
+LIBS = $(MEMLIB) cw32i.lib import32.lib ws2_32.lib $(EXTLIBS)
+MISSING = acosh.obj crypt.obj erf.obj win32.obj
+
+!ifndef STACK
+STACK = 0x2000000
+!endif
+
+XCFLAGS = -DRUBY_EXPORT -I. -I$(srcdir) -I$(srcdir)/missing
+
+ARFLAGS = /a
+LD = ilink32 -q -Gn
+LDSHARED  = $(LD)
+XLDFLAGS  = -Tpe c0x32.obj
+WLDFLAGS  = -aa -Tpe c0w32.obj
+DLDFLAGS  = -Tpd c0d32.obj
+LIBRUBY_LDSHARED = $(LDSHARED)
+LIBRUBY_DLDFLAGS = -Gi $(DLDFLAGS) $(EXTLDFLAGS)
+LDOBJECTS = $(MAINOBJ)
+
+SOLIBS = 
+
+EXEEXT = .exe
+PROGRAM=$(RUBY_INSTALL_NAME)$(EXEEXT)
+WPROGRAM=$(RUBYW_INSTALL_NAME)$(EXEEXT)
+RUBYDEF = $(RUBY_SO_NAME).def
+MINIRUBY = .\miniruby$(EXEEXT)
+RUNRUBY = .\ruby$(EXEEXT) "$(srcdir)/runruby.rb" --extout="$(EXTOUT)" --
+
+ORGLIBPATH = $(LIB)
+
+#### End of system configuration section. ####
+
+LIBRUBY_A     = $(RUBY_SO_NAME)-static.lib
+LIBRUBY_SO    = $(RUBY_SO_NAME).dll
+LIBRUBY       = $(RUBY_SO_NAME).lib
+LIBRUBYARG    = $(LIBRUBY)
+
+PREP          = miniruby$(EXEEXT)
+
+OBJEXT        = obj
+
+WINMAINOBJ    = winmain.$(OBJEXT)
+MINIOBJS      = dmydln.$(OBJEXT)
+
+.path.c = .;$(srcdir);$(srcdir)/win32;$(srcdir)/missing
+.path.h = .;$(srcdir);$(srcdir)/win32;$(srcdir)/missing
+.path.y = $(srcdir)
+.path. = $(srcdir)
+
+.c.obj:
+	$(CC) $(CFLAGS) $(XCFLAGS) -I. $(CPPFLAGS) -c $(<:/=\)
+
+.rc.res:
+	$(RC) $(RFLAGS) -I. -I$(<D). $(iconinc) -I$(srcdir)/win32 $(RFLAGS) -fo$@ $(<:/=\)
+
+.y.c:
+	$(YACC) $(YFLAGS) $(<:\=/)
+	sed -e "s!^ *extern char \*getenv();!/* & */!;s/^\(#.*\)y\.tab/\1parse/" y.tab.c > $(@F)
+	@del y.tab.c
+
+all: $(srcdir)/bcc32/Makefile.sub $(srcdir)/common.mk
+
+ruby: $(PROGRAM)
+rubyw: $(WPROGRAM)
+
+!include $(srcdir)/common.mk
+
+PHONY: Makefile
+
+CONFIG_H = ./.config.h.time
+
+config: config.status
+
+config.status: $(CONFIG_H)
+
+$(CONFIG_H): $(MKFILES) $(srcdir)/bcc32/Makefile.sub
+	@$(srcdir:/=\)\win32\ifchange.bat config.h &&|
+\#define HAVE_SYS_TYPES_H 1
+\#define HAVE_SYS_STAT_H 1
+\#define HAVE_STDLIB_H 1
+\#define HAVE_STRING_H 1
+\#define HAVE_MEMORY_H 1
+\#define HAVE_OFF_T 1
+\#define SIZEOF_INT 4
+\#define SIZEOF_SHORT 2
+\#define SIZEOF_LONG 4
+\#define SIZEOF_LONG_LONG 0
+\#define SIZEOF___INT64 8
+\#define SIZEOF_OFF_T 4
+\#define SIZEOF_VOIDP 4
+\#define SIZEOF_FLOAT 4
+\#define SIZEOF_DOUBLE 8
+\#define SIZEOF_TIME_T 4
+\#define HAVE_PROTOTYPES 1
+\#define TOKEN_PASTE(x,y) x\#\#y
+\#define HAVE_STDARG_PROTOTYPES 1
+\#define NORETURN(x) x
+\#define RUBY_EXTERN extern __declspec(dllimport)
+\#define HAVE_DECL_SYS_NERR 1
+\#define HAVE_LIMITS_H 1
+\#define HAVE_FCNTL_H 1
+\#define HAVE_UTIME_H 1
+\#define HAVE_FLOAT_H 1
+\#define rb_uid_t uid_t
+\#define rb_gid_t gid_t
+\#define rb_pid_t int
+\#define HAVE_STRUCT_STAT_ST_RDEV 1
+\#define HAVE_ST_RDEV 1
+\#define GETGROUPS_T int
+\#define RETSIGTYPE void
+\#define HAVE_ALLOCA 1
+\#define HAVE_DUP2 1
+\#define HAVE_MEMMOVE 1
+\#define HAVE_MKDIR 1
+\#define HAVE_STRCASECMP 1
+\#define HAVE_STRNCASECMP 1
+\#define HAVE_STRERROR 1
+\#define HAVE_STRFTIME 1
+\#define HAVE_STRCHR 1
+\#define HAVE_STRSTR 1
+\#define HAVE_STRTOD 1
+\#define HAVE_STRTOL 1
+\#define HAVE_STRTOUL 1
+\#define HAVE_ISNAN 1
+\#define HAVE_FINITE 1
+\#define HAVE_HYPOT 1
+\#define HAVE_FMOD 1
+\#define HAVE_WAITPID 1
+\#define HAVE_FSYNC 1
+\#define HAVE_GETCWD 1
+\#define HAVE_CHSIZE 1
+\#define HAVE_TIMES 1
+\#define HAVE_FCNTL 1
+\#define HAVE_LINK 1
+\#define HAVE_TELLDIR 1
+\#define HAVE_SEEKDIR 1
+\#define HAVE_COSH 1
+\#define HAVE_SINH 1
+\#define HAVE_TANH 1
+\#define RSHIFT(x,y) ((x)>>(int)y)
+\#define FILE_COUNT level
+\#define FILE_READPTR curp
+\#define inline __inline
+\#define NEED_IO_SEEK_BETWEEN_RW 1
+\#define STACK_GROW_DIRECTION -1
+\#define DEFAULT_KCODE KCODE_NONE
+\#define DLEXT ".so"
+\#define RUBY_LIB "/lib/ruby/$(MAJOR).$(MINOR)"
+\#define RUBY_SITE_LIB "/lib/ruby/site_ruby"
+\#define RUBY_SITE_LIB2 "/lib/ruby/site_ruby/$(MAJOR).$(MINOR)"
+\#define RUBY_PLATFORM "$(ARCH)-$(OS)"
+\#define RUBY_ARCHLIB "/lib/ruby/$(MAJOR).$(MINOR)/$(ARCH)-$(OS)"
+\#define RUBY_SITE_ARCHLIB "/lib/ruby/site_ruby/$(MAJOR).$(MINOR)/$(ARCH)-$(OS)"
+|
+	@exit > $@
+
+config.status: $(MKFILES) $(srcdir)/bcc32/Makefile.sub $(srcdir)/common.mk
+	@echo Creating $@
+	@type > $@ &&|
+# Generated automatically by Makefile.sub.
+s,@SHELL@,$$(COMSPEC),;t t
+s,@BUILD_FILE_SEPARATOR@,\,;t t
+s,@PATH_SEPARATOR@,;,;t t
+s,@CFLAGS@,$(CFLAGS),;t t
+s,@CPPFLAGS@,$(CPPFLAGS),;t t
+s,@CXXFLAGS@,$(CXXFLAGS),;t t
+s,@FFLAGS@,$(FFLAGS),;t t
+s,@LDFLAGS@,,;t t
+s,@LIBS@,$(LIBS),;t t
+s,@exec_prefix@,$${prefix},;t t
+s,@prefix@,,;t t
+s,@program_transform_name@,s,,,,;t t
+s,@bindir@,$${exec_prefix}/bin,;t t
+s,@sbindir@,$${exec_prefix}/sbin,;t t
+s,@libexecdir@,$${exec_prefix}/libexec,;t t
+s,@datadir@,$${prefix}/share,;t t
+s,@sysconfdir@,$${prefix}/etc,;t t
+s,@sharedstatedir@,/etc,;t t
+s,@localstatedir@,/var,;t t
+s,@libdir@,$${exec_prefix}/lib,;t t
+s,@includedir@,$${prefix}/include,;t t
+s,@oldincludedir@,/usr/include,;t t
+s,@infodir@,$${prefix}/info,;t t
+s,@mandir@,$${prefix}/man,;t t
+s,@build@,$(CPU)-pc-$(OS),;t t
+s,@build_alias@,$(CPU)-$(OS),;t t
+s,@build_cpu@,$(CPU),;t t
+s,@build_vendor@,pc,;t t
+s,@build_os@,$(OS),;t t
+s,@host@,$(CPU)-pc-$(OS),;t t
+s,@host_alias@,$(CPU)-$(OS),;t t
+s,@host_cpu@,$(CPU),;t t
+s,@host_vendor@,pc,;t t
+s,@host_os@,$(OS),;t t
+s,@target@,$(ARCH)-pc-$(OS),;t t
+s,@target_alias@,$(ARCH)-$(OS),;t t
+s,@target_cpu@,$(ARCH),;t t
+s,@target_vendor@,pc,;t t
+s,@target_os@,$(OS),;t t
+s,@CC@,$(CC),;t t
+s,@CPP@,cpp32,;t t
+s,@YACC@,$(YACC),;t t
+s,@RANLIB@,,;t t
+s,@AR@,$(AR),;t t
+s,@ARFLAGS@,$(ARFLAGS) ,;t t
+s,@LN_S@,$(LN_S),;t t
+s,@SET_MAKE@,$(SET_MAKE),;t t
+s,@CP@,copy > nul,;t t
+s,@INSTALL@,copy > nul,;t t
+s,@INSTALL_PROG@,$$(INSTALL),;t t
+s,@INSTALL_DATA@,$$(INSTALL),;t t
+s,@LIBOBJS@, acosh.obj crypt.obj erf.obj win32.obj,;t t
+s,@ALLOCA@,$(ALLOCA),;t t
+s,@DEFAULT_KCODE@,$(DEFAULT_KCODE),;t t
+s,@EXEEXT@,.exe,;t t
+s,@OBJEXT@,obj,;t t
+s,@XCFLAGS@,$(XCFLAGS),;t t
+s,@XLDFLAGS@,$(XLDFLAGS),;t t
+s,@DLDFLAGS@,$(DLDFLAGS),;t t
+s,@ARCH_FLAG@,$(ARCH_FLAG),;t t
+s,@STATIC@,$(STATIC),;t t
+s,@CCDLFLAGS@,,;t t
+s,@LDSHARED@,$(LDSHARED),;t t
+s,@DLEXT@,so,;t t
+s,@LIBEXT@,lib,;t t
+s,@STRIP@,$(STRIP),;t t
+s,@EXTSTATIC@,$(EXTSTATIC),;t t
+s,@setup@,Setup,;t t
+s,@MINIRUBY@,$(MINIRUBY),;t t
+s,@PREP@,miniruby$(EXEEXT),;t t
+s,@RUNRUBY@,$(RUNRUBY),;t t
+s,@EXTOUT@,$(EXTOUT),;t t
+s,@ARCHFILE@,,;t t
+s,@RDOCTARGET@,,;t t
+s,@LIBRUBY_LDSHARED@,$$(LDSHARED),;t t
+s,@LIBRUBY_DLDFLAGS@,-Gi $$(DLDFLAGS),;t t
+s,@RUBY_INSTALL_NAME@,$(RUBY_INSTALL_NAME),;t t
+s,@rubyw_install_name@,$(RUBYW_INSTALL_NAME),;t t
+s,@RUBYW_INSTALL_NAME@,$(RUBYW_INSTALL_NAME),;t t
+s,@RUBY_SO_NAME@,$(RUBY_SO_NAME),;t t
+s,@LIBRUBY_A@,$$(RUBY_SO_NAME)-static.lib,;t t
+s,@LIBRUBY_SO@,$$(RUBY_SO_NAME).dll,;t t
+s,@LIBRUBY_ALIASES@,$(LIBRUBY_ALIASES),;t t
+s,@LIBRUBY@,$$(RUBY_SO_NAME).lib,;t t
+s,@LIBRUBYARG@,$$(LIBRUBYARG_SHARED),;t t
+s,@LIBRUBYARG_STATIC@,$$(LIBRUBY_A),;t t
+s,@LIBRUBYARG_SHARED@,$$(LIBRUBY),;t t
+s,@SOLIBS@,$(SOLIBS),;t t
+s,@DLDLIBS@,$(DLDLIBS),;t t
+s,@ENABLE_SHARED@,yes,;t t
+s,@OUTFLAG@,$(OUTFLAG),;t t
+s,@CPPOUTFILE@,,;t t
+s,@LIBPATHFLAG@, -L"%s",;t t
+s,@RPATHFLAG@,,;t t
+s,@LIBARG@,%s.lib,;t t
+s,@LINK_SO@,$$(LDSHARED) $$(DLDFLAGS) $$(LIBPATH) $$(OBJS), $$(@:/=\), nul, $$(LIBS) $$(LOCAL_LIBS), $$(DEFFILE), $$(RESFILE),;t t
+s,@COMPILE_C@,$$(CC) $$(INCFLAGS) $$(CFLAGS) $$(CPPFLAGS) -c $$(<:/=\),;t t
+s,@COMPILE_CXX@,$$(CXX) $$(INCFLAGS) $$(CXXFLAGS) $$(CPPFLAGS) -P -c $$(<:/=\),;t t
+s,@COMPILE_RULES@,{$$(srcdir)}.%s{}.%s: {$$(topdir)}.%s{}.%s: {$$(hdrdir)}.%s{}.%s: .%s.%s:,;t t
+s,@RULE_SUBST@,{.;$$(VPATH)}%s,;t t
+s,@COMMON_LIBS@,m advapi32 avicap32 avifil32 cap comctl32 comdlg32 dlcapi gdi32 glu32 imagehlp imm32 inetmib1 kernel32 loadperf lsapi32 lz32 mapi32 mgmtapi mpr msacm32 msvfw32 nddeapi netapi32 ole32 oleaut32 oledlg olepro32 opengl32 pdh pkpd32 rasapi32 rasdlg rassapi rpcrt4 setupapi shell32 shfolder snmpapi sporder tapi32 url user32 vdmdbg version win32spl winmm wintrust wsock32,;t t
+s,@COMMON_MACROS@,WIN32_LEAN_AND_MEAN WIN32,;t t
+s,@COMMON_HEADERS@,winsock2.h windows.h,;t t
+s,@TRY_LINK@,$$(CC) -oconftest $$(INCFLAGS) -I$$(hdrdir) $$(CPPFLAGS) $$(CFLAGS) $$(LIBPATH) $$(LDFLAGS) $$(src) $$(LOCAL_LIBS) $$(LIBS),;t t
+s,@EXPORT_PREFIX@,_,;t t
+s,@arch@,$(ARCH)-$(OS),;t t
+s,@sitearch@,$(ARCH)-$(OS),;t t
+s,@sitedir@,$${prefix}/lib/ruby/site_ruby,;t t
+s,@configure_args@,--enable-shared $(configure_args),;t t
+s,@configure_input@,$$configure_input,;t t
+s,@srcdir@,$(srcdir),;t t
+s,@top_srcdir@,$(srcdir),;t t
+|
+
+miniruby$(EXEEXT):
+		@echo $(LIBS)
+		$(LD) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ) $(MINIOBJS),$@,nul,$(LIBRUBY_A) $(LIBS)
+
+$(PROGRAM):	$(MAINOBJ) $(LIBRUBY_SO) $(RUBY_INSTALL_NAME).res
+		$(LD) $(LDFLAGS) $(XLDFLAGS) $(MAINOBJ),$@,nul,$(LIBRUBYARG) $(LIBS),,$(RUBY_INSTALL_NAME).res
+
+$(WPROGRAM):	$(MAINOBJ) $(WINMAINOBJ) $(LIBRUBY_SO) $(RUBYW_INSTALL_NAME).res
+		$(LD) $(LDFLAGS) $(WLDFLAGS) $(MAINOBJ) $(WINMAINOBJ),$@,nul,$(LIBRUBYARG) $(LIBS),,$(RUBYW_INSTALL_NAME).res
+
+$(LIBRUBY_A):	$(OBJS) $(DMYEXT)
+		@-if exist $@ del $@
+		$(AR) $(ARFLAGS) "$@" $(OBJS) $(DMYEXT)
+
+# $(LIBRUBY):	$(LIBRUBY_SO)
+#		implib $@ $(LIBRUBY_SO)
+
+$(LIBRUBY_SO): $(LIBRUBY_A) $(DLDOBJS) $(RUBYDEF) $(RUBY_SO_NAME).res
+		@echo $(DLDOBJS)
+		$(LIBRUBY_LDSHARED) $(LIBRUBY_DLDFLAGS) $(DLDOBJS:/=\),$(LIBRUBY_SO),nul,$(LIBRUBY_A) $(LIBS),$(RUBYDEF),$(RUBY_SO_NAME).res
+
+$(LIBRUBY): $(LIBRUBY_SO)
+
+$(RUBYDEF):	$(LIBRUBY_A) $(PREP)
+		$(MINIRUBY) $(srcdir)/bcc32/mkexports.rb -output=$@ -base=$(RUBY_SO_NAME) $(LIBRUBY_A)
+
+$(RUBY_INSTALL_NAME).rc $(RUBYW_INSTALL_NAME).rc $(RUBY_SO_NAME).rc: rbconfig.rb
+		@$(MINIRUBY) $(srcdir)/win32/resource.rb \
+			-ruby_name=$(RUBY_INSTALL_NAME) \
+			-rubyw_name=$(RUBYW_INSTALL_NAME) \
+			-so_name=$(RUBY_SO_NAME) \
+			. $(icondirs) $(srcdir)/win32
+
+post-install-ext::
+	$(MINIRUBY) -I$(srcdir)lib -rrbconfig -rfileutils \
+		-e "FileUtils.rm_f(Dir[ARGV[0]+Config::CONFIG['archdir']+'/**/*.tds'])" "$(DESTDIR:\=/)"
+
+clean-local::
+		@$(RM) ext\extinit.c ext\extinit.$(OBJEXT) *.tds *.il? $(RUBY_SO_NAME).lib
+		@$(RM) $(RUBY_INSTALL_NAME).res $(RUBYW_INSTALL_NAME).res $(RUBY_SO_NAME).res
+
+distclean-local::
+		@$(RM) ext\config.cache $(RBCONFIG:/=\)
+		@$(RM) *.map *.pdb *.ilk *.exp $(RUBYDEF)
+		@$(RM) $(RUBY_INSTALL_NAME).rc $(RUBYW_INSTALL_NAME).rc $(RUBY_SO_NAME).rc
+
+ext/extinit.obj: ext/extinit.c $(SETUP)
+	$(CC) $(CFLAGS) $(XCFLAGS) $(CPPFLAGS) -o$@ -c ext/extinit.c
+
+main.$(OBJEXT): win32.h
+array.$(OBJEXT): win32.h
+bignum.$(OBJEXT): win32.h
+class.$(OBJEXT): win32.h
+compar.$(OBJEXT): win32.h
+dir.$(OBJEXT): dir.h win32.h
+dln.$(OBJEXT): win32.h
+enum.$(OBJEXT): win32.h
+error.$(OBJEXT): win32.h
+eval.$(OBJEXT): win32.h
+file.$(OBJEXT): win32.h
+gc.$(OBJEXT): win32.h
+hash.$(OBJEXT): win32.h
+inits.$(OBJEXT): win32.h
+io.$(OBJEXT): win32.h
+marshal.$(OBJEXT): win32.h
+math.$(OBJEXT): win32.h
+numeric.$(OBJEXT): win32.h
+object.$(OBJEXT): win32.h
+pack.$(OBJEXT): win32.h
+parse.$(OBJEXT): win32.h
+process.$(OBJEXT): win32.h
+prec.$(OBJEXT): win32.h
+random.$(OBJEXT): win32.h
+range.$(OBJEXT): win32.h
+re.$(OBJEXT): win32.h
+regex.$(OBJEXT): win32.h
+ruby.$(OBJEXT): win32.h
+signal.$(OBJEXT): win32.h
+sprintf.$(OBJEXT): win32.h
+st.$(OBJEXT): win32.h
+string.$(OBJEXT): win32.h
+struct.$(OBJEXT): win32.h
+time.$(OBJEXT): win32.h
+util.$(OBJEXT): win32.h
+variable.$(OBJEXT): win32.h
+version.$(OBJEXT): win32.h
diff --git a/bcc32/README.bcc32 b/bcc32/README.bcc32
new file mode 100644
index 0000000000..c27a1261f1
--- /dev/null
+++ b/bcc32/README.bcc32
@@ -0,0 +1,137 @@
+=begin
+
+= How to build ruby using Borland C++
+
+== Requirement
+
+(1) Borland C++ 5.0 or later.
+
+(2) Please set environment variable (({PATH}))
+    to run required commands properly from the command line.
+
+    Note: building ruby requires following commands.
+     * make
+     * bcc32
+     * tlib
+     * ilink32
+
+(3) If you want to build from CVS source, following commands are required.
+     * byacc ((<URL:http://gnuwin32.sourceforge.net/packages/byacc.htm>))
+     * sed   ((<URL:http://gnuwin32.sourceforge.net/packages/sed.htm>))
+
+(4) We strongly recommend to build ruby on C++Builder, to link following files.
+     * usebormm.lib
+     * memmgr.lib
+
+    RTL's internal memory manager cannot handle large memory block properly,
+    so we should use borlndmm.dll instead.
+     10000.times { "" << "." * 529671; GC.start } # crash
+
+== How to compile and install
+
+(1) Execute bcc32\configure.bat on your build directory.
+     ex. c:\ruby-1.6.7>bcc32\configure.bat
+     
+(2) Change ((|RUBY_INSTALL_NAME|)) and ((|RUBY_SO_NAME|)) in (({Makefile}))
+    if you want to change the name of the executable files. 
+    And add ((|RUBYW_INSTALL_NAME|)) to change the name of the
+    executable without console window if also you want.
+
+(3) Run `((%make%))'
+
+(4) Run `((%make test%))'
+
+(5) Run `((%make DESTDIR=<install_directory> install%))'
+
+    This command will create following directories and install files onto them.
+      * <install_directory>\bin
+      * <install_directory>\lib
+      * <install_directory>\lib\ruby
+      * <install_directory>\lib\ruby\<MAJOR>.<MINOR>
+      * <install_directory>\lib\ruby\<MAJOR>.<MINOR>\<PLATFORM>
+      * <install_directory>\lib\ruby\site_ruby
+      * <install_directory>\lib\ruby\site_ruby\<MAJOR>.<MINOR>
+      * <install_directory>\lib\ruby\site_ruby\<MAJOR>.<MINOR>\<PLATFORM>
+      * <install_directory>\man\man1
+    If Ruby's version is `x.y.z', the ((|<MAJOR>|)) is `x' and the ((|<MINOR>|)) is `y'.
+    The ((|<PLATFORM>|)) is usually `(({i586-bccwin32}))'.
+
+(6) Requires dynamic RTL (cc3250.dll on C++Builder5) and borlndmm.dll (If built with
+    usebormm.lib) to use installed binary. These files are ordinary in bcc32's bin
+    directory.
+
+== Icons
+
+Any icon files(*.ico) in the build directory, directories specified with
+((|icondirs|)) make variable and (({win32})) directory under the ruby
+source directory will be included in DLL or executable files, according
+to their base names.
+    $(RUBY_INSTALL_NAME).ico or ruby.ico   --> $(RUBY_INSTALL_NAME).exe
+    $(RUBYW_INSTALL_NAME).ico or rubyw.ico --> $(RUBYW_INSTALL_NAME).exe
+    the others                             --> $(RUBY_SO_NAME).dll
+
+Although no icons are distributed with the ruby source or in the official 
+site, you can use anything you like. For example, followings are written 
+in Japanese, but you can download at least.
+
+* ((<URL:http://member.nifty.ne.jp/ueivu/rubyico.html>)) or
+  ((<zipped icons|URL:http://member.nifty.ne.jp/ueivu/Ruby_ico.zip>))
+* ((<URL:http://homepage1.nifty.com/a_nakata/ruby/>)) or
+  ((<icon itself|URL:http://homepage1.nifty.com/a_nakata/ruby/RubyIcon.ico>))
+
+== Build examples
+
+* Build on the ruby source directory.
+
+  ex.)
+    ruby source directory:  C:\ruby
+    build directory:        C:\ruby
+    install directory:      C:\usr\local
+
+    C:
+    cd \ruby
+    bcc32\configure
+    make
+    make test
+    make DESTDIR=/usr/local install
+
+* Build on the relative directory from the ruby source directory and CPU type 
+  i386.
+
+  ex.)
+    ruby source directory:  C:\ruby
+    build directory:        C:\ruby\bccwin32
+    install directory:      C:\usr\local
+    CPU                     i386
+    
+    C:
+    cd \ruby
+    mkdir bccwin32
+    cd bccwin32
+    ..\bcc32\configure target i386-bccwin32
+    make
+    make test
+    make DESTDIR=/usr/local install
+
+* Build on the different drive.
+
+  ex.)
+    ruby source directory:  C:\src\ruby
+    build directory:        D:\build\ruby
+    install directory:      C:\usr\local
+
+    D:
+    cd D:\build\ruby
+    C:\src\ruby\bcc32\configure
+    make
+    make test
+    make DESTDIR=C:/usr/local install
+
+== Bugs
+
+You can ((*NOT*)) use a path name contains any white space characters as
+the ruby source directory, this restriction comes from the behavior of
+(({!INCLUDE})) directives of (({MAKE})).
+((- you may call it a bug. -))
+
+=end
diff --git a/bcc32/configure.bat b/bcc32/configure.bat
new file mode 100755
index 0000000000..123a3f23c8
--- /dev/null
+++ b/bcc32/configure.bat
@@ -0,0 +1,92 @@
+@echo off

+::: Don't set environment variable in batch file other than autoexec.bat

+::: to avoid "Out of environment space" problem on Windows 95/98.

+::: set TMPMAKE=~tmp~.mak

+

+echo> ~tmp~.mak ####

+echo>> ~tmp~.mak conf = %0

+echo>> ~tmp~.mak $(conf:\=/): nul

+echo>> ~tmp~.mak 	@del ~tmp~.mak

+echo>> ~tmp~.mak 	@-$(MAKE) -l$(MAKEFLAGS) -f $(@D)setup.mak \

+:loop

+if "%1" == "" goto :end

+if "%1" == "--prefix" goto :prefix

+if "%1" == "--srcdir" goto :srcdir

+if "%1" == "srcdir" goto :srcdir

+if "%1" == "--target" goto :target

+if "%1" == "target" goto :target

+if "%1" == "--with-static-linked-ext" goto :extstatic

+if "%1" == "--program-suffix" goto :suffix

+if "%1" == "--program-name" goto :progname

+if "%1" == "--enable-install-doc" goto :enable-rdoc

+if "%1" == "--disable-install-doc" goto :disable-rdoc

+if "%1" == "--extout" goto :extout

+if "%1" == "-h" goto :help

+if "%1" == "--help" goto :help

+  echo>> ~tmp~.mak 	"%1" \

+  shift

+goto :loop

+:srcdir

+  echo>> ~tmp~.mak 	-D"srcdir=%2" \

+  shift

+  shift

+goto :loop

+:prefix

+  echo>> ~tmp~.mak 	-D"prefix=%2" \

+  shift

+  shift

+goto :loop

+:suffix

+  echo>> ~tmp~.mak 	-D"RUBY_SUFFIX=%2" \

+  shift

+  shift

+goto :loop

+:installname

+  echo>> ~tmp~.mak 	-D"RUBY_INSTALL_NAME=%2" \

+  shift

+  shift

+goto :loop

+:soname

+  echo>> ~tmp~.mak 	-D"RUBY_SO_NAME=%2" \

+  shift

+  shift

+goto :loop

+:target

+  echo>> ~tmp~.mak 	"%2" \

+  shift

+  shift

+goto :loop

+:extstatic

+  echo>> ~tmp~.mak 	-D"EXTSTATIC=static" \

+  shift

+goto :loop

+:enable-rdoc

+  echo>> ~tmp~.mak 	-D"RDOCTARGET=install-doc" \

+  shift

+goto :loop

+:disable-rdoc

+  echo>> ~tmp~.mak 	-D"RDOCTARGET=install-nodoc" \

+  shift

+goto :loop

+:extout

+  echo>> ~tmp~.mak 	"EXTOUT=%2" \

+  shift

+  shift

+goto :loop

+:help

+  echo Configuration:

+  echo   --help                  display this help

+  echo   --srcdir=DIR            find the sources in DIR [configure dir or `..']

+  echo Installation directories:

+  echo   --prefix=PREFIX         install files in PREFIX (ignored currently)

+  echo System types:

+  echo   --target=TARGET         configure for TARGET [i386-bccwin32]

+  echo Optional Package:

+  echo   --with-static-linked-ext link external modules statically

+  echo   --enable-install-doc    install rdoc indexes during install

+  del ~tmp~.mak

+goto :exit

+:end

+echo>> ~tmp~.mak 	bcc32dir="$(@D)"

+make -s -f ~tmp~.mak

+:exit

diff --git a/bcc32/mkexports.rb b/bcc32/mkexports.rb
new file mode 100644
index 0000000000..e34b441e2f
--- /dev/null
+++ b/bcc32/mkexports.rb
@@ -0,0 +1,25 @@
+#!./miniruby -s
+
+SYM = {}
+STDIN.reopen(open("nul"))
+ARGV.each do |obj|
+  IO.foreach("|tdump -q -oiPUBDEF -oiPUBD32 #{obj.tr('/', '\\')}") do |l|
+    next unless /(?:PUBDEF|PUBD32)/ =~ l
+    SYM[$1] = true if /'(.*?)'/ =~ l
+  end
+end
+
+exports = []
+if $name
+  exports << "Name " + $name
+elsif $library
+  exports << "Library " + $library
+end
+exports << "Description " + $description.dump if $description
+exports << "EXPORTS" << SYM.keys.sort
+
+if $output
+  open($output, 'w') {|f| f.puts exports.join("\n")}
+else
+  puts exports.join("\n")
+end
diff --git a/bcc32/setup.mak b/bcc32/setup.mak
new file mode 100644
index 0000000000..b7a2539d0a
--- /dev/null
+++ b/bcc32/setup.mak
@@ -0,0 +1,133 @@
+# -*- makefile -*-
+
+!if "$(srcdir)" != ""
+bcc32dir = $(srcdir)/bcc32
+!elseif "$(bcc32dir)" == "bcc32/"
+srcdir = .
+!elseif "$(bcc32dir:/bcc32/=)/bcc32/" == "$(bcc32dir)"
+srcdir = $(bcc32dir:/bcc32/=)
+!else
+srcdir = $(bcc32dir)/..
+!endif
+!ifndef prefix
+prefix = /usr
+!endif
+OS = bccwin32
+RT = $(OS)
+BANG = !
+APPEND = echo>>$(MAKEFILE)
+!ifdef MAKEFILE
+MAKE = $(MAKE) -f $(MAKEFILE)
+!else
+MAKEFILE = Makefile
+!endif
+
+all: Makefile
+Makefile: -prologue- -generic- -epilogue-
+i386-$(OS): -prologue- -i386- -epilogue-
+i486-$(OS): -prologue- -i486- -epilogue-
+i586-$(OS): -prologue- -i586- -epilogue-
+i686-$(OS): -prologue- -i686- -epilogue-
+alpha-$(OS): -prologue- -alpha- -epilogue-
+
+-prologue-: nul
+	@echo Creating $(MAKEFILE)
+	@type > $(MAKEFILE) &&|
+\#\#\# Makefile for ruby $(OS) \#\#\#
+$(BANG)ifndef srcdir
+srcdir = $(srcdir:\=/)
+$(BANG)endif
+$(BANG)ifndef prefix
+prefix = $(prefix:\=/)
+$(BANG)endif
+$(BANG)ifndef EXTSTATIC
+EXTSTATIC = $(EXTSTATIC)
+$(BANG)endif
+!if defined(RDOCTARGET)
+$(BANG)ifndef RDOCTARGET
+RDOCTARGET = $(RDOCTARGET)
+$(BANG)endif
+!endif
+!if defined(EXTOUT)
+$(BANG)ifndef EXTOUT
+EXTOUT = $(EXTOUT)
+$(BANG)endif
+!endif
+|
+	@type > usebormm.bat &&|
+@echo off
+ilink32 -Gn -x usebormm.lib > nul
+if exist usebormm.tds echo MEMLIB = usebormm.lib
+|
+	@usebormm.bat >> $(MAKEFILE)
+	@del usebormm.*
+
+	@cpp32 -I$(srcdir) -P- -o$(MAKEFILE) > nul &&|
+\#include "version.h"
+MAJOR = RUBY_VERSION_MAJOR
+MINOR = RUBY_VERSION_MINOR
+TEENY = RUBY_VERSION_TEENY
+|
+	@type $(MAKEFILE).i >> $(MAKEFILE)
+	@del $(MAKEFILE).i
+
+-generic-: nul
+!if defined(PROCESSOR_ARCHITECTURE) ||  defined(PROCESSOR_LEVEL)
+	@type >> $(MAKEFILE) &&|
+!if defined(PROCESSOR_ARCHITECTURE)
+$(BANG)ifndef PROCESSOR_ARCHITECTURE
+PROCESSOR_ARCHITECTURE = $(PROCESSOR_ARCHITECTURE)
+$(BANG)endif
+!endif
+!if defined(PROCESSOR_LEVEL)
+$(BANG)ifndef PROCESSOR_LEVEL
+PROCESSOR_LEVEL = $(PROCESSOR_LEVEL)
+$(BANG)endif
+!endif
+
+|
+!endif
+
+-alpha-: nul
+	@$(APPEND) !ifndef PROCESSOR_ARCHITECTURE
+	@$(APPEND) PROCESSOR_ARCHITECTURE = alpha
+	@$(APPEND) !endif
+-ix86-: nul
+	@$(APPEND) !ifndef PROCESSOR_ARCHITECTURE
+	@$(APPEND) PROCESSOR_ARCHITECTURE = x86
+	@$(APPEND) !endif
+
+-i386-: -ix86-
+	@$(APPEND) !ifndef PROCESSOR_LEVEL
+	@$(APPEND) PROCESSOR_LEVEL = 3
+	@$(APPEND) !endif
+-i486-: -ix86-
+	@$(APPEND) !ifndef PROCESSOR_LEVEL
+	@$(APPEND) PROCESSOR_LEVEL = 4
+	@$(APPEND) !endif
+-i586-: -ix86-
+	@$(APPEND) !ifndef PROCESSOR_LEVEL
+	@$(APPEND) PROCESSOR_LEVEL = 5
+	@$(APPEND) !endif
+-i686-: -ix86-
+	@$(APPEND) !ifndef PROCESSOR_LEVEL
+	@$(APPEND) PROCESSOR_LEVEL = 6
+	@$(APPEND) !endif
+
+-epilogue-: nul
+	@type >> $(MAKEFILE) &&|
+
+\# OS = $(OS)
+\# RT = $(RT)
+\# RUBY_INSTALL_NAME = ruby
+\# RUBY_SO_NAME = $$(RT)-$$(RUBY_INSTALL_NAME)$$(MAJOR)$$(MINOR)
+\# CFLAGS = -q $$(DEBUGFLAGS) $$(OPTFLAGS) $$(PROCESSOR_FLAG) -w- -wsus -wcpt -wdup -wext -wrng -wrpt -wzdi
+\# CPPFLAGS = -I. -I$$(srcdir) -I$$(srcdir)/missing -DLIBRUBY_SO=\"$$(LIBRUBY_SO)\"
+\# STACK = 0x2000000
+\# LDFLAGS = -S:$$(STACK)
+\# RFLAGS = $$(iconinc)
+\# EXTLIBS = cw32.lib import32.lib user32.lib kernel32.lib
+$(BANG)include $$(srcdir)/bcc32/Makefile.sub
+|
+	@$(srcdir:/=\)\win32\rm.bat config.h config.status
+	@echo type "`$(MAKE)'" to make ruby for $(OS).
diff --git a/benchmark/bm_app_answer.rb b/benchmark/bm_app_answer.rb
deleted file mode 100644
index 3cd8a8fd37..0000000000
--- a/benchmark/bm_app_answer.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-def ack(m, n)
-  if m == 0 then
-    n + 1
-  elsif n == 0 then
-    ack(m - 1, 1)
-  else
-    ack(m - 1, ack(m, n - 1))
-  end
-end
-
-def the_answer_to_life_the_universe_and_everything
-  (ack(3,7).to_s.split(//).inject(0){|s,x| s+x.to_i}.to_s + "2" ).to_i
-end
-
-answer = the_answer_to_life_the_universe_and_everything
diff --git a/benchmark/bm_app_aobench.rb b/benchmark/bm_app_aobench.rb
deleted file mode 100644
index 2bd6acfaf8..0000000000
--- a/benchmark/bm_app_aobench.rb
+++ /dev/null
@@ -1,291 +0,0 @@
-# AO render benchmark
-# Original program (C) Syoyo Fujita in Javascript (and other languages)
-#      https://code.google.com/p/aobench/
-# Ruby(yarv2llvm) version by Hideki Miura
-#
-
-IMAGE_WIDTH = 256
-IMAGE_HEIGHT = 256
-NSUBSAMPLES = 2
-NAO_SAMPLES = 8
-
-class Vec
-  def initialize(x, y, z)
-    @x = x
-    @y = y
-    @z = z
-  end
-
-  attr_accessor :x, :y, :z
-
-  def vadd(b)
-    Vec.new(@x + b.x, @y + b.y, @z + b.z)
-  end
-
-  def vsub(b)
-    Vec.new(@x - b.x, @y - b.y, @z - b.z)
-  end
-
-  def vcross(b)
-    Vec.new(@y * b.z - @z * b.y,
-            @z * b.x - @x * b.z,
-            @x * b.y - @y * b.x)
-  end
-
-  def vdot(b)
-    @x * b.x + @y * b.y + @z * b.z
-  end
-
-  def vlength
-    Math.sqrt(@x * @x + @y * @y + @z * @z)
-  end
-
-  def vnormalize
-    len = vlength
-    v = Vec.new(@x, @y, @z)
-    if len > 1.0e-17 then
-      v.x = v.x / len
-      v.y = v.y / len
-      v.z = v.z / len
-    end
-    v
-  end
-end
-
-
-class Sphere
-  def initialize(center, radius)
-    @center = center
-    @radius = radius
-  end
-
-  attr_reader :center, :radius
-
-  def intersect(ray, isect)
-    rs = ray.org.vsub(@center)
-    b = rs.vdot(ray.dir)
-    c = rs.vdot(rs) - (@radius * @radius)
-    d = b * b - c
-    if d > 0.0 then
-      t = - b - Math.sqrt(d)
-
-      if t > 0.0 and t < isect.t then
-        isect.t = t
-        isect.hit = true
-        isect.pl = Vec.new(ray.org.x + ray.dir.x * t,
-                          ray.org.y + ray.dir.y * t,
-                          ray.org.z + ray.dir.z * t)
-        n = isect.pl.vsub(@center)
-        isect.n = n.vnormalize
-      else
-        0.0
-      end
-    end
-    nil
-  end
-end
-
-class Plane
-  def initialize(p, n)
-    @p = p
-    @n = n
-  end
-
-  def intersect(ray, isect)
-    d = -@p.vdot(@n)
-    v = ray.dir.vdot(@n)
-    v0 = v
-    if v < 0.0 then
-      v0 = -v
-    end
-    if v0 < 1.0e-17 then
-      return
-    end
-
-    t = -(ray.org.vdot(@n) + d) / v
-
-    if t > 0.0 and t < isect.t then
-      isect.hit = true
-      isect.t = t
-      isect.n = @n
-      isect.pl = Vec.new(ray.org.x + t * ray.dir.x,
-                        ray.org.y + t * ray.dir.y,
-                        ray.org.z + t * ray.dir.z)
-    end
-    nil
-  end
-end
-
-class Ray
-  def initialize(org, dir)
-    @org = org
-    @dir = dir
-  end
-
-  attr_accessor :org, :dir
-end
-
-class Isect
-  def initialize
-    @t = 10000000.0
-    @hit = false
-    @pl = Vec.new(0.0, 0.0, 0.0)
-    @n = Vec.new(0.0, 0.0, 0.0)
-  end
-
-  attr_accessor :t, :hit, :pl, :n
-end
-
-def clamp(f)
-  i = f * 255.5
-  if i > 255.0 then
-    i = 255.0
-  end
-  if i < 0.0 then
-    i = 0.0
-  end
-  i.to_i
-end
-
-def otherBasis(basis, n)
-  basis[2] = Vec.new(n.x, n.y, n.z)
-  basis[1] = Vec.new(0.0, 0.0, 0.0)
-
-  if n.x < 0.6 and n.x > -0.6 then
-    basis[1].x = 1.0
-  elsif n.y < 0.6 and n.y > -0.6 then
-    basis[1].y = 1.0
-  elsif n.z < 0.6 and n.z > -0.6 then
-    basis[1].z = 1.0
-  else
-    basis[1].x = 1.0
-  end
-
-  basis[0] = basis[1].vcross(basis[2])
-  basis[0] = basis[0].vnormalize
-
-  basis[1] = basis[2].vcross(basis[0])
-  basis[1] = basis[1].vnormalize
-end
-
-class Scene
-  def initialize
-    @spheres = Array.new
-    @spheres[0] = Sphere.new(Vec.new(-2.0, 0.0, -3.5), 0.5)
-    @spheres[1] = Sphere.new(Vec.new(-0.5, 0.0, -3.0), 0.5)
-    @spheres[2] = Sphere.new(Vec.new(1.0, 0.0, -2.2), 0.5)
-    @plane = Plane.new(Vec.new(0.0, -0.5, 0.0), Vec.new(0.0, 1.0, 0.0))
-  end
-
-  def ambient_occlusion(isect)
-    basis = Array.new
-    otherBasis(basis, isect.n)
-
-    ntheta    = NAO_SAMPLES
-    nphi      = NAO_SAMPLES
-    eps       = 0.0001
-    occlusion = 0.0
-
-    p0 = Vec.new(isect.pl.x + eps * isect.n.x,
-                isect.pl.y + eps * isect.n.y,
-                isect.pl.z + eps * isect.n.z)
-    nphi.times do |j|
-      ntheta.times do |i|
-        r = rand
-        phi = 2.0 * 3.14159265 * rand
-        x = Math.cos(phi) * Math.sqrt(1.0 - r)
-        y = Math.sin(phi) * Math.sqrt(1.0 - r)
-        z = Math.sqrt(r)
-
-        rx = x * basis[0].x + y * basis[1].x + z * basis[2].x
-        ry = x * basis[0].y + y * basis[1].y + z * basis[2].y
-        rz = x * basis[0].z + y * basis[1].z + z * basis[2].z
-
-        raydir = Vec.new(rx, ry, rz)
-        ray = Ray.new(p0, raydir)
-
-        occisect = Isect.new
-        @spheres[0].intersect(ray, occisect)
-        @spheres[1].intersect(ray, occisect)
-        @spheres[2].intersect(ray, occisect)
-        @plane.intersect(ray, occisect)
-        if occisect.hit then
-          occlusion = occlusion + 1.0
-        else
-          0.0
-        end
-      end
-    end
-
-    occlusion = (ntheta.to_f * nphi.to_f - occlusion) / (ntheta.to_f * nphi.to_f)
-
-    Vec.new(occlusion, occlusion, occlusion)
-  end
-
-  def render(w, h, nsubsamples)
-    cnt = 0
-    nsf = nsubsamples.to_f
-    h.times do |y|
-      w.times do |x|
-        rad = Vec.new(0.0, 0.0, 0.0)
-
-        # Subsampling
-        nsubsamples.times do |v|
-          nsubsamples.times do |u|
-
-            cnt = cnt + 1
-            wf = w.to_f
-            hf = h.to_f
-            xf = x.to_f
-            yf = y.to_f
-            uf = u.to_f
-            vf = v.to_f
-
-            px = (xf + (uf / nsf) - (wf / 2.0)) / (wf / 2.0)
-            py = -(yf + (vf / nsf) - (hf / 2.0)) / (hf / 2.0)
-
-            eye = Vec.new(px, py, -1.0).vnormalize
-
-            ray = Ray.new(Vec.new(0.0, 0.0, 0.0), eye)
-
-            isect = Isect.new
-            @spheres[0].intersect(ray, isect)
-            @spheres[1].intersect(ray, isect)
-            @spheres[2].intersect(ray, isect)
-            @plane.intersect(ray, isect)
-            if isect.hit then
-              col = ambient_occlusion(isect)
-              rad.x = rad.x + col.x
-              rad.y = rad.y + col.y
-              rad.z = rad.z + col.z
-            end
-          end
-        end
-
-        r = rad.x / (nsf * nsf)
-        g = rad.y / (nsf * nsf)
-        b = rad.z / (nsf * nsf)
-        printf("%c", clamp(r))
-        printf("%c", clamp(g))
-        printf("%c", clamp(b))
-      end
-      nil
-    end
-
-    nil
-  end
-end
-
-alias printf_orig printf
-def printf *args
-end
-
-# File.open("ao.ppm", "w") do |fp|
-  printf("P6\n")
-  printf("%d %d\n", IMAGE_WIDTH, IMAGE_HEIGHT)
-  printf("255\n", IMAGE_WIDTH, IMAGE_HEIGHT)
-  Scene.new.render(IMAGE_WIDTH, IMAGE_HEIGHT, NSUBSAMPLES)
-# end
-
-undef printf
-alias printf printf_orig
diff --git a/benchmark/bm_app_erb.rb b/benchmark/bm_app_erb.rb
deleted file mode 100644
index 77c66a7949..0000000000
--- a/benchmark/bm_app_erb.rb
+++ /dev/null
@@ -1,26 +0,0 @@
-#
-# Create many HTML strings with ERB.
-#
-
-require 'erb'
-
-data = DATA.read
-max = 15_000
-title = "hello world!"
-content = "hello world!\n" * 10
-
-max.times{
-  ERB.new(data).result(binding)
-}
-
-__END__
-
-<html>
-  <head> <%= title %> </head>
-  <body>
-    <h1> <%= title %> </h1>
-    <p>
-      <%= content %>
-    </p>
-  </body>
-</html>
diff --git a/benchmark/bm_app_factorial.rb b/benchmark/bm_app_factorial.rb
deleted file mode 100644
index 45f471dfdb..0000000000
--- a/benchmark/bm_app_factorial.rb
+++ /dev/null
@@ -1,11 +0,0 @@
-def fact(n)
-  if(n > 1)
-    n * fact(n-1)
-  else
-    1
-  end
-end
-
-100.times {
-  fact(5000)
-}
diff --git a/benchmark/bm_app_fib.rb b/benchmark/bm_app_fib.rb
deleted file mode 100644
index 34a7b2e725..0000000000
--- a/benchmark/bm_app_fib.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-def fib n
-  if n < 3
-    1
-  else
-    fib(n-1) + fib(n-2)
-  end
-end
-
-fib(34)
-
diff --git a/benchmark/bm_app_lc_fizzbuzz.rb b/benchmark/bm_app_lc_fizzbuzz.rb
deleted file mode 100644
index f09574bbeb..0000000000
--- a/benchmark/bm_app_lc_fizzbuzz.rb
+++ /dev/null
@@ -1,52 +0,0 @@
-#
-# FizzBuzz program using only lambda calculus
-#
-# This program is quoted from
-#   "Understanding Computation" by Tom Stuart
-#   http://computationbook.com/
-#
-# You can understand why this program works fine by reading this book.
-#
-
-solution = -> k { -> f { -> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> l { -> x { -> g { -> b { b }[-> p { p[-> x { -> y { x } }] }[l]][x][-> y { g[f[-> l { -> p { p[-> x { -> y { y } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][x][g]][-> l { -> p { p[-> x { -> y { x } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][y] }] } } } }][k][-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> l { -> x { -> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[l][f[x]] } }] } }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[m][n]][-> x { -> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[f[-> n { -> p { -> x { p[n[p][x]] } } }[m]][n]][m][x] }][-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]] } } }][-> p { -> x { p[x] } }][-> p { -> x { p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[x]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]] } }]][-> n { -> b { b }[-> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> p { -> x { p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[x]]]]]]]]]]]]]]] } }]]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]][-> b { b }[-> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> p { -> x { p[p[p[x]]] } }]]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]][-> b { b }[-> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> n { -> l { -> x { -> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> l { -> x { -> g { -> b { b }[-> p { p[-> x { -> y { x } }] }[l]][x][-> y { g[f[-> l { -> p { p[-> x { -> y { y } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][x][g]][-> l { -> p { p[-> x { -> y { x } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][y] }] } } } }][l][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][x]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }] } }[-> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]][-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> x { f[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { -> n { -> p { -> x { p[n[p][x]] } } }[f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n]][x] }][-> p { -> x { x } }] } } }][n][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][x] }]][-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]] } }][n]]]] }]
-
-FIRST     = -> l { LEFT[RIGHT[l]] }
-IF        = -> b { b }
-LEFT      = -> p { p[-> x { -> y { x } } ] }
-RIGHT     = -> p { p[-> x { -> y { y } } ] }
-IS_EMPTY  = LEFT
-REST      = -> l { RIGHT[RIGHT[l]] }
-
-def to_integer(proc)
-  proc[-> n { n + 1 }][0]
-end
-
-def to_boolean(proc)
-  IF[proc][true][false]
-end
-
-def to_array(proc)
-  array = []
-
-  until to_boolean(IS_EMPTY[proc])
-    array.push(FIRST[proc])
-    proc = REST[proc]
-  end
-
-  array
-end
-
-def to_char(c)
-  '0123456789BFiuz'.slice(to_integer(c))
-end
-
-def to_string(s)
-  to_array(s).map { |c| to_char(c) }.join
-end
-
-answer = to_array(solution).map do |p|
-  to_string(p)
-end
-
-answer_ary = answer.to_a
-# puts answer_ary
diff --git a/benchmark/bm_app_mandelbrot.rb b/benchmark/bm_app_mandelbrot.rb
deleted file mode 100644
index 801b75e8e2..0000000000
--- a/benchmark/bm_app_mandelbrot.rb
+++ /dev/null
@@ -1,23 +0,0 @@
-require 'complex'
-
-def mandelbrot? z
-  i = 0
-  while i<100
-    i += 1
-    z = z * z
-    return false if z.abs > 2
-  end
-  true
-end
-
-ary = []
-
-(0..1000).each{|dx|
-  (0..1000).each{|dy|
-    x = dx / 50.0
-    y = dy / 50.0
-    c = Complex(x, y)
-    ary << c if mandelbrot?(c)
-  }
-}
-
diff --git a/benchmark/bm_app_pentomino.rb b/benchmark/bm_app_pentomino.rb
deleted file mode 100644
index 59c63f358e..0000000000
--- a/benchmark/bm_app_pentomino.rb
+++ /dev/null
@@ -1,259 +0,0 @@
-#!/usr/local/bin/ruby
-# This program is contributed by Shin Nishiyama
-
-
-# modified by K.Sasada
-
-NP = 5
-ROW = 8 + NP
-COL = 8
-
-$p = []
-$b = []
-$no = 0
-
-def piece(n, a, nb)
-  nb.each{|x|
-    a[n] = x
-    if n == NP-1
-      $p << [a.sort]
-    else
-      nbc=nb.dup
-      [-ROW, -1, 1, ROW].each{|d|
-        if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
-          nbc << x+d
-        end
-      }
-      nbc.delete x
-      piece(n+1,a[0..n],nbc)
-    end
-  }
-end
-
-def kikaku(a)
-  a.collect {|x| x - a[0]}
-end
-def ud(a)
-  kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
-end
-def rl(a)
-  kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
-end
-def xy(a)
-  kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
-end
-
-def mkpieces
-  piece(0,[],[0])
-  $p.each do |a|
-    a0 = a[0]
-    a[1] = ud(a0)
-    a[2] = rl(a0)
-    a[3] = ud(rl(a0))
-    a[4] = xy(a0)
-    a[5] = ud(xy(a0))
-    a[6] = rl(xy(a0))
-    a[7] = ud(rl(xy(a0)))
-    a.sort!
-    a.uniq!
-  end
-  $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
-end
-
-def mkboard
-  (0...ROW*COL).each{|i|
-    if i % ROW >= ROW-NP
-      $b[i] = -2
-    else
-      $b[i] = -1
-    end
-    $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
-  }
-end
-
-def pboard
-  return # skip print
-  print "No. #$no\n"
-  (0...COL).each{|i|
-    print "|"
-    (0...ROW-NP).each{|j|
-      x = $b[i*ROW+j]
-      if x < 0
-        print "..|"
-      else
-        printf "%2d|",x+1
-      end
-    }
-    print "\n"
-  }
-  print "\n"
-end
-
-$pnum=[]
-def setpiece(a,pos)
-  if a.length == $p.length then
-    $no += 1
-    pboard
-    return
-  end
-  while $b[pos] != -1
-    pos += 1
-  end
-  ($pnum - a).each do |i|
-    $p[i].each do |x|
-      f = 0
-      x.each{|s|
-        if $b[pos+s] != -1
-          f=1
-          break
-        end
-      }
-      if f == 0 then
-        x.each{|s|
-          $b[pos+s] = i
-        }
-        a << i
-        setpiece(a.dup, pos)
-        a.pop
-        x.each{|s|
-          $b[pos+s] = -1
-        }
-      end
-    end
-  end
-end
-
-mkpieces
-mkboard
-$p[4] = [$p[4][0]]
-$pnum = (0...$p.length).to_a
-setpiece([],0)
-
-
-__END__
-
-# original
-
-NP = 5
-ROW = 8 + NP
-COL = 8
-
-$p = []
-$b = []
-$no = 0
-
-def piece(n,a,nb)
-  for x in nb
-    a[n] = x
-    if n == NP-1
-      $p << [a.sort]
-    else
-      nbc=nb.dup
-      for d in [-ROW, -1, 1, ROW]
-        if x+d > 0 and not a.include?(x+d) and not nbc.include?(x+d)
-          nbc << x+d
-        end
-      end
-      nbc.delete x
-      piece(n+1,a[0..n],nbc)
-    end
-  end
-end
-
-def kikaku(a)
-  a.collect {|x| x - a[0]}
-end
-def ud(a)
-  kikaku(a.collect {|x| ((x+NP)%ROW)-ROW*((x+NP)/ROW) }.sort)
-end
-def rl(a)
-  kikaku(a.collect {|x| ROW*((x+NP)/ROW)+ROW-((x+NP)%ROW)}.sort)
-end
-def xy(a)
-  kikaku(a.collect {|x| ROW*((x+NP)%ROW) + (x+NP)/ROW }.sort)
-end
-
-def mkpieces
-  piece(0,[],[0])
-  $p.each do |a|
-    a0 = a[0]
-    a[1] = ud(a0)
-    a[2] = rl(a0)
-    a[3] = ud(rl(a0))
-    a[4] = xy(a0)
-    a[5] = ud(xy(a0))
-    a[6] = rl(xy(a0))
-    a[7] = ud(rl(xy(a0)))
-    a.sort!
-    a.uniq!
-  end
-  $p.uniq!.sort! {|x,y| x[0] <=> y[0] }
-end
-
-def mkboard
-  for i in 0...ROW*COL
-    if i % ROW >= ROW-NP
-      $b[i] = -2
-    else
-      $b[i] = -1
-    end
-    $b[3*ROW+3]=$b[3*ROW+4]=$b[4*ROW+3]=$b[4*ROW+4]=-2
-  end
-end
-
-def pboard
-  print "No. #$no\n"
-  for i in 0...COL
-    print "|"
-    for j in 0...ROW-NP
-      x = $b[i*ROW+j]
-      if x < 0
-        print "..|"
-      else
-        printf "%2d|",x+1
-      end
-    end
-    print "\n"
-  end
-  print "\n"
-end
-
-$pnum=[]
-def setpiece(a,pos)
-  if a.length == $p.length then
-    $no += 1
-    pboard
-    return
-  end
-  while $b[pos] != -1
-    pos += 1
-  end
-  ($pnum - a).each do |i|
-    $p[i].each do |x|
-      f = 0
-      for s in x do
-        if $b[pos+s] != -1
-          f=1
-          break
-        end
-      end
-      if f == 0 then
-        for s in x do
-          $b[pos+s] = i
-        end
-        a << i
-        setpiece(a.dup, pos)
-        a.pop
-        for s in x do
-          $b[pos+s] = -1
-        end
-      end
-    end
-  end
-end
-
-mkpieces
-mkboard
-$p[4] = [$p[4][0]]
-$pnum = (0...$p.length).to_a
-setpiece([],0)
diff --git a/benchmark/bm_app_raise.rb b/benchmark/bm_app_raise.rb
deleted file mode 100644
index 5db8f95d50..0000000000
--- a/benchmark/bm_app_raise.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-i = 0
-while i<300000
-  i += 1
-  begin
-    raise
-  rescue
-  end
-end
diff --git a/benchmark/bm_app_strconcat.rb b/benchmark/bm_app_strconcat.rb
deleted file mode 100644
index 7eed7c1aed..0000000000
--- a/benchmark/bm_app_strconcat.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-i = 0
-while i<2_000_000
-  "#{1+1} #{1+1} #{1+1}"
-  i += 1
-end
diff --git a/benchmark/bm_app_tak.rb b/benchmark/bm_app_tak.rb
deleted file mode 100644
index efe5380f4e..0000000000
--- a/benchmark/bm_app_tak.rb
+++ /dev/null
@@ -1,13 +0,0 @@
-
-def tak x, y, z
-  unless y < x
-    z
-  else
-    tak( tak(x-1, y, z),
-         tak(y-1, z, x),
-         tak(z-1, x, y))
-  end
-end
-
-tak(18, 9, 0)
-
diff --git a/benchmark/bm_app_tarai.rb b/benchmark/bm_app_tarai.rb
deleted file mode 100644
index 4c146f5ccf..0000000000
--- a/benchmark/bm_app_tarai.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-def tarai( x, y, z )
-  if x <= y
-  then y
-  else tarai(tarai(x-1, y, z),
-             tarai(y-1, z, x),
-             tarai(z-1, x, y))
-  end
-end
-
-tarai(12, 6, 0)
diff --git a/benchmark/bm_app_uri.rb b/benchmark/bm_app_uri.rb
deleted file mode 100644
index 586edfd5dc..0000000000
--- a/benchmark/bm_app_uri.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-require 'uri'
-
-100_000.times{
-  uri = URI.parse('http://www.ruby-lang.org')
-  uri.scheme
-  uri.host
-  uri.port
-}
diff --git a/benchmark/bm_array_shift.rb b/benchmark/bm_array_shift.rb
deleted file mode 100644
index 798bb9e3f4..0000000000
--- a/benchmark/bm_array_shift.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-require 'benchmark'
-
-Benchmark.bm do |x|
-  [10_000,1_000_000,100_000_000].each do |n|
-    ary = Array.new(n,0)
-    GC.start
-    x.report("#{n}:shift"){ ary.shift }
-    (0..4).each do |i|
-      ary = Array.new(n,0)
-      GC.start
-      x.report("#{n}:shift(#{i})"){ ary.shift(i) }
-    end
-  end
-end
diff --git a/benchmark/bm_hash_aref_dsym.rb b/benchmark/bm_hash_aref_dsym.rb
deleted file mode 100644
index af4f8c36d4..0000000000
--- a/benchmark/bm_hash_aref_dsym.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-h = {}
-syms = ('a'..'z').map { |s| s.to_sym }
-syms.each { |s| h[s] = 1 }
-200_000.times { syms.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_aref_dsym_long.rb b/benchmark/bm_hash_aref_dsym_long.rb
deleted file mode 100644
index 9d7759379e..0000000000
--- a/benchmark/bm_hash_aref_dsym_long.rb
+++ /dev/null
@@ -1,21 +0,0 @@
-# [ruby-core:70129] [Bug #11396]
-collection_size = 200000
-sample_size = 10000
-
-values = (1..collection_size).to_a.map do |x|
-  "THIS IS A LONGER STRING THAT IS ALSO UNIQUE #{x}"
-end
-
-symbol_hash = {}
-
-values.each do |x|
-  symbol_hash[x.to_sym] = 1
-end
-
-# use the same samples each time to minimize deviations
-rng = Random.new(0)
-symbol_sample_array = values.sample(sample_size, random: rng).map(&:to_sym)
-
-3000.times do
-  symbol_sample_array.each { |x| symbol_hash[x] }
-end
diff --git a/benchmark/bm_hash_aref_fix.rb b/benchmark/bm_hash_aref_fix.rb
deleted file mode 100644
index 1346890582..0000000000
--- a/benchmark/bm_hash_aref_fix.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-h = {}
-nums = (1..26).to_a
-nums.each { |i| h[i] = i }
-200_000.times { nums.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_aref_flo.rb b/benchmark/bm_hash_aref_flo.rb
deleted file mode 100644
index 2217274c82..0000000000
--- a/benchmark/bm_hash_aref_flo.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-h = {}
-strs = [*1..10000].map! {|i| i.fdiv(10)}
-strs.each { |s| h[s] = s }
-50.times { strs.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_aref_miss.rb b/benchmark/bm_hash_aref_miss.rb
deleted file mode 100644
index b0913dd4bb..0000000000
--- a/benchmark/bm_hash_aref_miss.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-h = {}
-strs = ('a'..'z').to_a.map!(&:freeze)
-strs.each { |s| h[s] = s }
-strs = ('A'..'Z').to_a
-200_000.times { strs.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_aref_str.rb b/benchmark/bm_hash_aref_str.rb
deleted file mode 100644
index 19439b061b..0000000000
--- a/benchmark/bm_hash_aref_str.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-h = {}
-strs = ('a'..'z').to_a.map!(&:freeze)
-strs.each { |s| h[s] = s }
-200_000.times { strs.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_aref_sym.rb b/benchmark/bm_hash_aref_sym.rb
deleted file mode 100644
index f75d163fe6..0000000000
--- a/benchmark/bm_hash_aref_sym.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-h = {}
-syms = ('a'..'z').to_a
-begin
-  syms = eval("%i[#{syms.join(' ')}]")
-rescue SyntaxError # <= 1.9.3
-  syms.map!(&:to_sym)
-end
-syms.each { |s| h[s] = s }
-200_000.times { syms.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_aref_sym_long.rb b/benchmark/bm_hash_aref_sym_long.rb
deleted file mode 100644
index 9dab8df7be..0000000000
--- a/benchmark/bm_hash_aref_sym_long.rb
+++ /dev/null
@@ -1,13 +0,0 @@
-h = {}
-syms = %w[puts warn syswrite write stat bacon lettuce tomato
-some symbols in this array may already be interned  others should not be
-hash browns make good breakfast but not cooked using prime numbers
-shift for division entries delete_if keys exist?
-]
-begin
-  syms = eval("%i[#{syms.join(' ')}]")
-rescue SyntaxError # <= 1.9.3
-  syms.map!(&:to_sym)
-end
-syms.each { |s| h[s] = s }
-200_000.times { syms.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_flatten.rb b/benchmark/bm_hash_flatten.rb
deleted file mode 100644
index e944aae9f2..0000000000
--- a/benchmark/bm_hash_flatten.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-h = {}
-
-10000.times do |i|
-  h[i] = nil
-end
-
-1000.times do
-  h.flatten
-end
diff --git a/benchmark/bm_hash_ident_flo.rb b/benchmark/bm_hash_ident_flo.rb
deleted file mode 100644
index 0c7edfed3e..0000000000
--- a/benchmark/bm_hash_ident_flo.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-h = {}.compare_by_identity
-strs = (1..10000).to_a.map!(&:to_f)
-strs.each { |s| h[s] = s }
-50.times { strs.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_ident_num.rb b/benchmark/bm_hash_ident_num.rb
deleted file mode 100644
index b226736c6f..0000000000
--- a/benchmark/bm_hash_ident_num.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-h = {}.compare_by_identity
-nums = (1..26).to_a
-nums.each { |n| h[n] = n }
-200_000.times { nums.each { |n| h[n] } }
diff --git a/benchmark/bm_hash_ident_obj.rb b/benchmark/bm_hash_ident_obj.rb
deleted file mode 100644
index 4b3b58edec..0000000000
--- a/benchmark/bm_hash_ident_obj.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-h = {}.compare_by_identity
-objs = 26.times.map { Object.new }
-objs.each { |o| h[o] = o }
-200_000.times { objs.each { |o| h[o] } }
diff --git a/benchmark/bm_hash_ident_str.rb b/benchmark/bm_hash_ident_str.rb
deleted file mode 100644
index 8582b38e31..0000000000
--- a/benchmark/bm_hash_ident_str.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-h = {}.compare_by_identity
-strs = ('a'..'z').to_a
-strs.each { |s| h[s] = s }
-200_000.times { strs.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_ident_sym.rb b/benchmark/bm_hash_ident_sym.rb
deleted file mode 100644
index 4c81e3d28e..0000000000
--- a/benchmark/bm_hash_ident_sym.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-h = {}.compare_by_identity
-syms = ('a'..'z').to_a.map(&:to_sym)
-syms.each { |s| h[s] = s }
-200_000.times { syms.each { |s| h[s] } }
diff --git a/benchmark/bm_hash_keys.rb b/benchmark/bm_hash_keys.rb
deleted file mode 100644
index 6863cd01f9..0000000000
--- a/benchmark/bm_hash_keys.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-h = {}
-
-10000.times do |i|
-  h[i] = nil
-end
-
-5000.times do
-  h.keys
-end
diff --git a/benchmark/bm_hash_shift.rb b/benchmark/bm_hash_shift.rb
deleted file mode 100644
index a645671a5b..0000000000
--- a/benchmark/bm_hash_shift.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-h = {}
-
-10000.times do |i|
-  h[i] = nil
-end
-
-50000.times do
-  k, v = h.shift
-  h[k] = v
-end
diff --git a/benchmark/bm_hash_shift_u16.rb b/benchmark/bm_hash_shift_u16.rb
deleted file mode 100644
index ec800d0342..0000000000
--- a/benchmark/bm_hash_shift_u16.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-h = {}
-
-(16384..65536).each do |i|
-  h[i] = nil
-end
-
-300000.times do
-  k, v = h.shift
-  h[k] = v
-end
diff --git a/benchmark/bm_hash_shift_u24.rb b/benchmark/bm_hash_shift_u24.rb
deleted file mode 100644
index de4e0fa696..0000000000
--- a/benchmark/bm_hash_shift_u24.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-h = {}
-
-(0xff4000..0xffffff).each do |i|
-  h[i] = nil
-end
-
-300000.times do
-  k, v = h.shift
-  h[k] = v
-end
diff --git a/benchmark/bm_hash_shift_u32.rb b/benchmark/bm_hash_shift_u32.rb
deleted file mode 100644
index 656aa55583..0000000000
--- a/benchmark/bm_hash_shift_u32.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-h = {}
-
-(0xffff4000..0xffffffff).each do |i|
-  h[i] = nil
-end
-
-300000.times do
-  k, v = h.shift
-  h[k] = v
-end
diff --git a/benchmark/bm_hash_to_proc.rb b/benchmark/bm_hash_to_proc.rb
deleted file mode 100644
index 2b675bf509..0000000000
--- a/benchmark/bm_hash_to_proc.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-h = {}
-
-10000.times do |i|
-  h[i] = nil
-end
-
-5000.times do |i|
-  [i].map(&h)
-end
diff --git a/benchmark/bm_hash_values.rb b/benchmark/bm_hash_values.rb
deleted file mode 100644
index 069441302f..0000000000
--- a/benchmark/bm_hash_values.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-h = {}
-
-10000.times do |i|
-  h[i] = nil
-end
-
-5000.times do
-  h.values
-end
diff --git a/benchmark/bm_io_file_create.rb b/benchmark/bm_io_file_create.rb
deleted file mode 100644
index 2f205c1333..0000000000
--- a/benchmark/bm_io_file_create.rb
+++ /dev/null
@@ -1,13 +0,0 @@
-#
-# Create files
-#
-
-max = 200_000
-file = './tmpfile_of_bm_io_file_create'
-
-max.times{
-  f = open(file, 'w')
-  f.close#(true)
-}
-File.unlink(file)
-
diff --git a/benchmark/bm_io_file_read.rb b/benchmark/bm_io_file_read.rb
deleted file mode 100644
index b9e796ed30..0000000000
--- a/benchmark/bm_io_file_read.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-#
-# Seek and Read file.
-#
-
-require 'tempfile'
-
-max = 200_000
-str = "Hello world!  " * 1000
-f = Tempfile.new('yarv-benchmark')
-f.write str
-
-max.times{
-  f.seek 0
-  f.read
-}
diff --git a/benchmark/bm_io_file_write.rb b/benchmark/bm_io_file_write.rb
deleted file mode 100644
index aa1be0e5fe..0000000000
--- a/benchmark/bm_io_file_write.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-#
-# Seek and Write file.
-#
-
-require 'tempfile'
-
-max = 200_000
-str = "Hello world!  " * 1000
-f = Tempfile.new('yarv-benchmark')
-
-max.times{
-  f.seek 0
-  f.write str
-}
diff --git a/benchmark/bm_io_nonblock_noex.rb b/benchmark/bm_io_nonblock_noex.rb
deleted file mode 100644
index da9357fdc6..0000000000
--- a/benchmark/bm_io_nonblock_noex.rb
+++ /dev/null
@@ -1,22 +0,0 @@
-nr = 1_000_000
-i = 0
-msg = '.'
-buf = '.'
-noex = { exception: false }
-begin
-  r, w = IO.pipe
-  while i < nr
-    i += 1
-    w.write_nonblock(msg, noex)
-    r.read_nonblock(1, buf, noex)
-  end
-rescue ArgumentError # old Rubies
-  while i < nr
-    i += 1
-    w.write_nonblock(msg)
-    r.read_nonblock(1, buf)
-  end
-ensure
-  r.close
-  w.close
-end
diff --git a/benchmark/bm_io_nonblock_noex2.rb b/benchmark/bm_io_nonblock_noex2.rb
deleted file mode 100644
index 56819d049b..0000000000
--- a/benchmark/bm_io_nonblock_noex2.rb
+++ /dev/null
@@ -1,21 +0,0 @@
-nr = 1_000_000
-i = 0
-msg = '.'
-buf = '.'
-begin
-  r, w = IO.pipe
-  while i < nr
-    i += 1
-    w.write_nonblock(msg, exception: false)
-    r.read_nonblock(1, buf, exception: false)
-  end
-rescue ArgumentError # old Rubies
-  while i < nr
-    i += 1
-    w.write_nonblock(msg)
-    r.read_nonblock(1, buf)
-  end
-ensure
-  r.close
-  w.close
-end
diff --git a/benchmark/bm_io_select.rb b/benchmark/bm_io_select.rb
deleted file mode 100644
index 19248daeb1..0000000000
--- a/benchmark/bm_io_select.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-# IO.select performance
-
-w = [ IO.pipe[1] ];
-
-nr = 1000000
-nr.times {
-  IO.select nil, w
-}
-
diff --git a/benchmark/bm_io_select2.rb b/benchmark/bm_io_select2.rb
deleted file mode 100644
index 10e37d71b2..0000000000
--- a/benchmark/bm_io_select2.rb
+++ /dev/null
@@ -1,22 +0,0 @@
-# IO.select performance. worst case of single fd.
-
-ios = []
-nr = 1000000
-if defined?(Process::RLIMIT_NOFILE)
-  max = Process.getrlimit(Process::RLIMIT_NOFILE)[0]
-else
-  max = 64
-end
-puts "max fd: #{max} (results not apparent with <= 1024 max fd)"
-
-((max / 2) - 10).times do
-  ios.concat IO.pipe
-end
-
-last = [ ios[-1] ]
-puts "last IO: #{last[0].inspect}"
-
-nr.times do
-  IO.select nil, last
-end
-
diff --git a/benchmark/bm_io_select3.rb b/benchmark/bm_io_select3.rb
deleted file mode 100644
index 7d0ba1f092..0000000000
--- a/benchmark/bm_io_select3.rb
+++ /dev/null
@@ -1,21 +0,0 @@
-# IO.select performance. a lot of fd
-
-ios = []
-nr = 100
-if defined?(Process::RLIMIT_NOFILE)
-  max = Process.getrlimit(Process::RLIMIT_NOFILE)[0]
-else
-  max = 64
-end
-puts "max fd: #{max} (results not apparent with <= 1024 max fd)"
-
-(max - 10).times do
-  r, w = IO.pipe
-  r.close
-  ios.push w
-end
-
-nr.times do
-  IO.select nil, ios
-end
-
diff --git a/benchmark/bm_loop_for.rb b/benchmark/bm_loop_for.rb
deleted file mode 100644
index 0fc4cc1511..0000000000
--- a/benchmark/bm_loop_for.rb
+++ /dev/null
@@ -1,3 +0,0 @@
-for i in 1..30_000_000
-  #
-end
diff --git a/benchmark/bm_loop_generator.rb b/benchmark/bm_loop_generator.rb
deleted file mode 100644
index d3375c744c..0000000000
--- a/benchmark/bm_loop_generator.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-max = 600000
-
-if defined? Fiber
-  gen = (1..max).each
-  loop do
-    gen.next
-  end
-else
-  require 'generator'
-  gen = Generator.new((0..max))
-  while gen.next?
-    gen.next
-  end
-end
diff --git a/benchmark/bm_loop_times.rb b/benchmark/bm_loop_times.rb
deleted file mode 100644
index 521f72ad1a..0000000000
--- a/benchmark/bm_loop_times.rb
+++ /dev/null
@@ -1 +0,0 @@
-30_000_000.times{|e|}
diff --git a/benchmark/bm_loop_whileloop.rb b/benchmark/bm_loop_whileloop.rb
deleted file mode 100644
index 0072822c06..0000000000
--- a/benchmark/bm_loop_whileloop.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-i = 0
-while i<30_000_000 # benchmark loop 1
-  i += 1
-end
diff --git a/benchmark/bm_loop_whileloop2.rb b/benchmark/bm_loop_whileloop2.rb
deleted file mode 100644
index 47d02dffc4..0000000000
--- a/benchmark/bm_loop_whileloop2.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-i = 0
-while i< 6_000_000 # benchmark loop 2
-  i += 1
-end
diff --git a/benchmark/bm_marshal_dump_flo.rb b/benchmark/bm_marshal_dump_flo.rb
deleted file mode 100644
index 9b8d0c6afb..0000000000
--- a/benchmark/bm_marshal_dump_flo.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-bug10761 = 10000.times.map { |x| x.to_f }
-100.times { Marshal.dump(bug10761) }
diff --git a/benchmark/bm_marshal_dump_load_geniv.rb b/benchmark/bm_marshal_dump_load_geniv.rb
deleted file mode 100644
index 8252ad90fa..0000000000
--- a/benchmark/bm_marshal_dump_load_geniv.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-a = ''
-a.instance_eval do
-  @a = :a
-  @b = :b
-  @c = :c
-end
-100000.times do
-  a = Marshal.load(Marshal.dump(a))
-end
-#p(a.instance_eval { @a == :a && @b == :b && @c == :c })
diff --git a/benchmark/bm_marshal_dump_load_time.rb b/benchmark/bm_marshal_dump_load_time.rb
deleted file mode 100644
index e29743b791..0000000000
--- a/benchmark/bm_marshal_dump_load_time.rb
+++ /dev/null
@@ -1 +0,0 @@
-100000.times { Marshal.load(Marshal.dump(Time.now)) }
diff --git a/benchmark/bm_require.rb b/benchmark/bm_require.rb
deleted file mode 100644
index b8abc88f41..0000000000
--- a/benchmark/bm_require.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-$:.push File.join(File.dirname(__FILE__), "bm_require.data")
-
-1.upto(10000) do |i|
-  require "c#{i}"
-end
-
-$:.pop
diff --git a/benchmark/bm_require_thread.rb b/benchmark/bm_require_thread.rb
deleted file mode 100644
index e54db6c6e5..0000000000
--- a/benchmark/bm_require_thread.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-$:.push File.join(File.dirname(__FILE__), "bm_require.data")
-
-i=0
-t = Thread.new do
-  while true
-    i = i+1 # dummy loop
-  end
-end
-
-1.upto(100) do |i|
-  require "c#{i}"
-end
-
-$:.pop
-t.kill
diff --git a/benchmark/bm_securerandom.rb b/benchmark/bm_securerandom.rb
deleted file mode 100644
index a082ea6d5b..0000000000
--- a/benchmark/bm_securerandom.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-require "securerandom"
-
-20_0000.times do
-  SecureRandom.random_number(100)
-end
diff --git a/benchmark/bm_so_ackermann.rb b/benchmark/bm_so_ackermann.rb
deleted file mode 100644
index 7db5be9050..0000000000
--- a/benchmark/bm_so_ackermann.rb
+++ /dev/null
@@ -1,19 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: ackermann-ruby.code,v 1.4 2004/11/13 07:40:41 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-
-def ack(m, n)
-    if m == 0 then
-        n + 1
-    elsif n == 0 then
-        ack(m - 1, 1)
-    else
-        ack(m - 1, ack(m, n - 1))
-    end
-end
-
-NUM = 9
-ack(3, NUM)
-
-
diff --git a/benchmark/bm_so_array.rb b/benchmark/bm_so_array.rb
deleted file mode 100644
index 2b8fce8f99..0000000000
--- a/benchmark/bm_so_array.rb
+++ /dev/null
@@ -1,23 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: ary-ruby.code,v 1.4 2004/11/13 07:41:27 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# with help from Paul Brannan and Mark Hubbart
-
-n = 9000 # Integer(ARGV.shift || 1)
-
-x = Array.new(n)
-y = Array.new(n, 0)
-
-n.times{|bi|
-  x[bi] = bi + 1
-}
-
-(0 .. 999).each do |e|
-  (n-1).step(0,-1) do |bi|
-    y[bi] += x.at(bi)
-  end
-end
-# puts "#{y.first} #{y.last}"
-
-
diff --git a/benchmark/bm_so_binary_trees.rb b/benchmark/bm_so_binary_trees.rb
deleted file mode 100644
index b1693e4109..0000000000
--- a/benchmark/bm_so_binary_trees.rb
+++ /dev/null
@@ -1,62 +0,0 @@
-# The Computer Language Shootout Benchmarks
-# http://shootout.alioth.debian.org
-#
-# contributed by Jesse Millikan
-
-# disable output
-alias puts_orig puts
-def puts str
-  # disable puts
-end
-
-def item_check(tree)
- if tree[0] == nil
-  tree[1]
- else
-  tree[1] + item_check(tree[0]) - item_check(tree[2])
- end
-end
-
-def bottom_up_tree(item, depth)
- if depth > 0
-  item_item = 2 * item
-  depth -= 1
-  [bottom_up_tree(item_item - 1, depth), item, bottom_up_tree(item_item, depth)]
- else
-  [nil, item, nil]
- end
-end
-
-max_depth = 16 # ARGV[0].to_i
-min_depth = 4
-
-max_depth = min_depth + 2 if min_depth + 2 > max_depth
-
-stretch_depth = max_depth + 1
-stretch_tree = bottom_up_tree(0, stretch_depth)
-
-puts "stretch tree of depth #{stretch_depth}\t check: #{item_check(stretch_tree)}"
-stretch_tree = nil
-
-long_lived_tree = bottom_up_tree(0, max_depth)
-
-min_depth.step(max_depth + 1, 2) do |depth|
- iterations = 2**(max_depth - depth + min_depth)
-
- check = 0
-
- for i in 1..iterations
-  temp_tree = bottom_up_tree(i, depth)
-  check += item_check(temp_tree)
-
-  temp_tree = bottom_up_tree(-i, depth)
-  check += item_check(temp_tree)
- end
-
- puts "#{iterations * 2}\t trees of depth #{depth}\t check: #{check}"
-end
-
-puts "long lived tree of depth #{max_depth}\t check: #{item_check(long_lived_tree)}"
-
-undef puts
-alias puts puts_orig
diff --git a/benchmark/bm_so_concatenate.rb b/benchmark/bm_so_concatenate.rb
deleted file mode 100644
index 873214de7c..0000000000
--- a/benchmark/bm_so_concatenate.rb
+++ /dev/null
@@ -1,18 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: strcat-ruby.code,v 1.4 2004/11/13 07:43:28 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# based on code from Aristarkh A Zagorodnikov and Dat Nguyen
-
-STUFF = "hello\n"
-i = 0
-while i<10
-  i += 1
-  hello = ''
-  4_000_000.times do |e|
-    hello << STUFF
-  end
-end
-# puts hello.length
-
-
diff --git a/benchmark/bm_so_count_words.rb b/benchmark/bm_so_count_words.rb
deleted file mode 100644
index 65f6337a4a..0000000000
--- a/benchmark/bm_so_count_words.rb
+++ /dev/null
@@ -1,19 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: wc-ruby.code,v 1.4 2004/11/13 07:43:32 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# with help from Paul Brannan
-
-input = open(File.join(File.dirname($0), 'wc.input'), 'rb')
-
-nl = nw = nc = 0
-while true
-  tmp = input.read(4096) or break
-  data = tmp << (input.gets || "")
-  nc += data.length
-  nl += data.count("\n")
-  ((data.strip! || data).tr!("\n", " ") || data).squeeze!
-  nw += data.count(" ") + 1
-end
-# STDERR.puts "#{nl} #{nw} #{nc}"
-
diff --git a/benchmark/bm_so_exception.rb b/benchmark/bm_so_exception.rb
deleted file mode 100644
index deb003a594..0000000000
--- a/benchmark/bm_so_exception.rb
+++ /dev/null
@@ -1,61 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: except-ruby.code,v 1.4 2004/11/13 07:41:33 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-
-$HI = 0
-$LO = 0
-NUM = 250000 # Integer(ARGV[0] || 1)
-
-
-class Lo_Exception < Exception
-  def initialize(num)
-    @value = num
-  end
-end
-
-class Hi_Exception < Exception
-  def initialize(num)
-    @value = num
-  end
-end
-
-def some_function(num)
-  begin
-    hi_function(num)
-  rescue
-    print "We shouldn't get here, exception is: #{$!.type}\n"
-  end
-end
-
-def hi_function(num)
-  begin
-    lo_function(num)
-  rescue Hi_Exception
-    $HI = $HI + 1
-  end
-end
-
-def lo_function(num)
-  begin
-    blowup(num)
-  rescue Lo_Exception
-    $LO = $LO + 1
-  end
-end
-
-def blowup(num)
-  if num % 2 == 0
-    raise Lo_Exception.new(num)
-  else
-    raise Hi_Exception.new(num)
-  end
-end
-
-
-i = 1
-max = NUM+1
-while i < max
-  i += 1
-  some_function(i+1)
-end
diff --git a/benchmark/bm_so_fannkuch.rb b/benchmark/bm_so_fannkuch.rb
deleted file mode 100644
index bac5ecd44c..0000000000
--- a/benchmark/bm_so_fannkuch.rb
+++ /dev/null
@@ -1,45 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org/
-# Contributed by Sokolov Yura
-# Modified by Ryan Williams
-
-def fannkuch(n)
-   maxFlips, m, r, check = 0, n-1, n, 0
-   count = (1..n).to_a
-   perm = (1..n).to_a
-
-   while true
-      if check < 30
-         puts "#{perm}"
-         check += 1
-      end
-
-      while r != 1
-         count[r-1] = r
-         r -= 1
-      end
-
-      if perm[0] != 1 and perm[m] != n
-         perml = perm.clone #.dup
-         flips = 0
-         while (k = perml.first ) != 1
-            perml = perml.slice!(0, k).reverse + perml
-            flips += 1
-         end
-         maxFlips = flips if flips > maxFlips
-      end
-      while true
-         if r==n then return maxFlips end
-         perm.insert r,perm.shift
-         break if (count[r] -= 1) > 0
-         r += 1
-      end
-   end
-end
-
-def puts *args
-end
-
-N = 9 # (ARGV[0] || 1).to_i
-puts "Pfannkuchen(#{N}) = #{fannkuch(N)}"
-
diff --git a/benchmark/bm_so_fasta.rb b/benchmark/bm_so_fasta.rb
deleted file mode 100644
index 3f759ba7ae..0000000000
--- a/benchmark/bm_so_fasta.rb
+++ /dev/null
@@ -1,81 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org/
-# Contributed by Sokolov Yura
-
-$last = 42.0
-def gen_random (max,im=139968,ia=3877,ic=29573)
-    (max * ($last = ($last * ia + ic) % im)) / im
-end
-
-alu =
-   "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
-   "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
-   "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
-   "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
-   "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
-   "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
-   "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
-
-iub = [
-    ["a", 0.27],
-    ["c", 0.12],
-    ["g", 0.12],
-    ["t", 0.27],
-
-    ["B", 0.02],
-    ["D", 0.02],
-    ["H", 0.02],
-    ["K", 0.02],
-    ["M", 0.02],
-    ["N", 0.02],
-    ["R", 0.02],
-    ["S", 0.02],
-    ["V", 0.02],
-    ["W", 0.02],
-    ["Y", 0.02],
-]
-homosapiens = [
-    ["a", 0.3029549426680],
-    ["c", 0.1979883004921],
-    ["g", 0.1975473066391],
-    ["t", 0.3015094502008],
-]
-
-def make_repeat_fasta(id, desc, src, n)
-    puts ">#{id} #{desc}"
-    v = nil
-    width = 60
-    l = src.length
-    s = src * ((n / l) + 1)
-    s.slice!(n, l)
-    puts(s.scan(/.{1,#{width}}/).join("\n"))
-end
-
-def make_random_fasta(id, desc, table, n)
-    puts ">#{id} #{desc}"
-    rand, v = nil,nil
-    width = 60
-    chunk = 1 * width
-    prob = 0.0
-    table.each{|v| v[1]= (prob += v[1])}
-    for i in 1..(n/width)
-        puts((1..width).collect{
-            rand = gen_random(1.0)
-            table.find{|v| v[1]>rand}[0]
-        }.join)
-    end
-    if n%width != 0
-        puts((1..(n%width)).collect{
-            rand = gen_random(1.0)
-            table.find{|v| v[1]>rand}[0]
-        }.join)
-    end
-end
-
-
-n = (ARGV[0] or 250_000).to_i
-
-make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
-make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
-make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
-
diff --git a/benchmark/bm_so_k_nucleotide.rb b/benchmark/bm_so_k_nucleotide.rb
deleted file mode 100644
index dadab3e79c..0000000000
--- a/benchmark/bm_so_k_nucleotide.rb
+++ /dev/null
@@ -1,48 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org
-#
-# contributed by jose fco. gonzalez
-# modified by Sokolov Yura
-
-seq = String.new
-
-def frecuency( seq,length )
-    n, table = seq.length - length + 1, Hash.new(0)
-    f, i = nil, nil
-    (0 ... length).each do |f|
-        (f ... n).step(length) do |i|
-            table[seq[i,length]] += 1
-        end
-    end
-    [n,table]
-
-end
-
-def sort_by_freq( seq,length )
-    n,table = frecuency( seq,length )
-    a, b, v = nil, nil, nil
-    table.sort{|a,b| b[1] <=> a[1]}.each do |v|
-        puts "%s %.3f" % [v[0].upcase,((v[1]*100).to_f/n)]
-    end
-    puts
-end
-
-def find_seq( seq,s )
-    n,table = frecuency( seq,s.length )
-    puts "#{table[s].to_s}\t#{s.upcase}"
-end
-
-input = open(File.join(File.dirname($0), 'fasta.output.100000'), 'rb')
-
-line = input.gets while line !~ /^>THREE/
-line = input.gets
-
-while (line !~ /^>/) & line do
-    seq << line.chomp
-    line = input.gets
-end
-
-[1,2].each {|i| sort_by_freq( seq,i ) }
-
-%w(ggt ggta ggtatt ggtattttaatt ggtattttaatttatagt).each{|s| find_seq( seq,s) }
-
diff --git a/benchmark/bm_so_lists.rb b/benchmark/bm_so_lists.rb
deleted file mode 100644
index e8f4a2a5f7..0000000000
--- a/benchmark/bm_so_lists.rb
+++ /dev/null
@@ -1,47 +0,0 @@
-#from http://www.bagley.org/~doug/shootout/bench/lists/lists.ruby
-
-NUM = 300
-SIZE = 10000
-
-def test_lists()
-  # create a list of integers (Li1) from 1 to SIZE
-  li1 = (1..SIZE).to_a
-  # copy the list to li2 (not by individual items)
-  li2 = li1.dup
-  # remove each individual item from left side of li2 and
-  # append to right side of li3 (preserving order)
-  li3 = Array.new
-  while (not li2.empty?)
-    li3.push(li2.shift)
-  end
-  # li2 must now be empty
-  # remove each individual item from right side of li3 and
-  # append to right side of li2 (reversing list)
-  while (not li3.empty?)
-    li2.push(li3.pop)
-  end
-  # li3 must now be empty
-  # reverse li1 in place
-  li1.reverse!
-  # check that first item is now SIZE
-  if li1[0] != SIZE then
-    p "not SIZE"
-    0
-  else
-    # compare li1 and li2 for equality
-    if li1 != li2 then
-      return(0)
-    else
-      # return the length of the list
-      li1.length
-    end
-  end
-end
-
-i = 0
-while i<NUM
-  i += 1
-  result = test_lists()
-end
-
-result
diff --git a/benchmark/bm_so_mandelbrot.rb b/benchmark/bm_so_mandelbrot.rb
deleted file mode 100644
index 76331c64b8..0000000000
--- a/benchmark/bm_so_mandelbrot.rb
+++ /dev/null
@@ -1,57 +0,0 @@
-#  The Computer Language Benchmarks Game
-#  http://shootout.alioth.debian.org/
-#
-#  contributed by Karl von Laudermann
-#  modified by Jeremy Echols
-
-size = 600 # ARGV[0].to_i
-
-puts "P4\n#{size} #{size}"
-
-ITER = 49                           # Iterations - 1 for easy for..in looping
-LIMIT_SQUARED = 4.0                 # Presquared limit
-
-byte_acc = 0
-bit_num = 0
-
-count_size = size - 1               # Precomputed size for easy for..in looping
-
-# For..in loops are faster than .upto, .downto, .times, etc.
-for y in 0..count_size
-  for x in 0..count_size
-    zr = 0.0
-    zi = 0.0
-    cr = (2.0*x/size)-1.5
-    ci = (2.0*y/size)-1.0
-    escape = false
-
-    # To make use of the for..in code, we use a dummy variable,
-    # like one would in C
-    for dummy in 0..ITER
-      tr = zr*zr - zi*zi + cr
-      ti = 2*zr*zi + ci
-      zr, zi = tr, ti
-
-      if (zr*zr+zi*zi) > LIMIT_SQUARED
-        escape = true
-        break
-      end
-    end
-
-    byte_acc = (byte_acc << 1) | (escape ? 0b0 : 0b1)
-    bit_num += 1
-
-    # Code is very similar for these cases, but using separate blocks
-    # ensures we skip the shifting when it's unnecessary, which is most cases.
-    if (bit_num == 8)
-      print byte_acc.chr
-      byte_acc = 0
-      bit_num = 0
-    elsif (x == count_size)
-      byte_acc <<= (8 - bit_num)
-      print byte_acc.chr
-      byte_acc = 0
-      bit_num = 0
-    end
-  end
-end
diff --git a/benchmark/bm_so_matrix.rb b/benchmark/bm_so_matrix.rb
deleted file mode 100644
index e2c5c8e559..0000000000
--- a/benchmark/bm_so_matrix.rb
+++ /dev/null
@@ -1,48 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: matrix-ruby.code,v 1.4 2004/11/13 07:42:14 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-
-n = 60 #Integer(ARGV.shift || 1)
-
-size = 40
-
-def mkmatrix(rows, cols)
-    count = 1
-    mx = Array.new(rows)
-    (0 .. (rows - 1)).each do |bi|
-        row = Array.new(cols, 0)
-        (0 .. (cols - 1)).each do |j|
-            row[j] = count
-            count += 1
-        end
-        mx[bi] = row
-    end
-    mx
-end
-
-def mmult(rows, cols, m1, m2)
-    m3 = Array.new(rows)
-    (0 .. (rows - 1)).each do |bi|
-        row = Array.new(cols, 0)
-        (0 .. (cols - 1)).each do |j|
-            val = 0
-            (0 .. (cols - 1)).each do |k|
-                val += m1.at(bi).at(k) * m2.at(k).at(j)
-            end
-            row[j] = val
-        end
-        m3[bi] = row
-    end
-    m3
-end
-
-m1 = mkmatrix(size, size)
-m2 = mkmatrix(size, size)
-mm = Array.new
-n.times do
-    mm = mmult(size, size, m1, m2)
-end
-# puts "#{mm[0][0]} #{mm[2][3]} #{mm[3][2]} #{mm[4][4]}"
-
-
diff --git a/benchmark/bm_so_meteor_contest.rb b/benchmark/bm_so_meteor_contest.rb
deleted file mode 100644
index 64a7d46afe..0000000000
--- a/benchmark/bm_so_meteor_contest.rb
+++ /dev/null
@@ -1,563 +0,0 @@
-#!/usr/bin/env ruby
-#
-# The Computer Language Shootout
-#   http://shootout.alioth.debian.org
-#   contributed by Kevin Barnes (Ruby novice)
-
-# PROGRAM:  the main body is at the bottom.
-#   1) read about the problem here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
-#   2) see how I represent a board as a bitmask by reading the blank_board comments
-#   3) read as your mental paths take you
-
-def print *args
-end
-
-# class to represent all information about a particular rotation of a particular piece
-class Rotation
-  # an array (by location) containing a bit mask for how the piece maps at the given location.
-  # if the rotation is invalid at that location the mask will contain false
-  attr_reader :start_masks
-
-  # maps a direction to a relative location.  these differ depending on whether it is an even or
-  # odd row being mapped from
-  @@rotation_even_adder = { :west => -1, :east => 1, :nw => -7, :ne => -6, :sw => 5, :se => 6 }
-  @@rotation_odd_adder = { :west => -1, :east => 1, :nw => -6, :ne => -5, :sw => 6, :se => 7 }
-
-  def initialize( directions )
-    @even_offsets, @odd_offsets = normalize_offsets( get_values( directions ))
-
-    @even_mask = mask_for_offsets( @even_offsets)
-    @odd_mask = mask_for_offsets( @odd_offsets)
-
-    @start_masks = Array.new(60)
-
-    # create the rotational masks by placing the base mask at the location and seeing if
-    # 1) it overlaps the boundaries and 2) it produces a prunable board.  if either of these
-    # is true the piece cannot be placed
-    0.upto(59) do | offset |
-      mask = is_even(offset) ? (@even_mask << offset) : (@odd_mask << offset)
-      if (blank_board & mask == 0 && !prunable(blank_board | mask, 0, true)) then
-        imask = compute_required( mask, offset)
-        @start_masks[offset] = [ mask, imask, imask | mask ]
-      else
-        @start_masks[offset] = false
-      end
-    end
-  end
-
-  def compute_required( mask, offset )
-    board = blank_board
-    0.upto(offset) { | i | board |= 1 << i }
-    board |= mask
-    return 0 if (!prunable(board | mask, offset))
-    board = flood_fill(board,58)
-    count = 0
-    imask = 0
-    0.upto(59) do | i |
-      if (board[i] == 0) then
-        imask |= (1 << i)
-        count += 1
-      end
-    end
-    (count > 0 && count < 5) ? imask : 0
-  end
-
-  def flood_fill( board, location)
-    return board if (board[location] == 1)
-    board |= 1 << location
-    row, col = location.divmod(6)
-    board = flood_fill( board, location - 1) if (col > 0)
-    board = flood_fill( board, location + 1) if (col < 4)
-    if (row % 2 == 0) then
-      board = flood_fill( board, location - 7) if (col > 0 && row > 0)
-      board = flood_fill( board, location - 6) if (row > 0)
-      board = flood_fill( board, location + 6) if (row < 9)
-      board = flood_fill( board, location + 5) if (col > 0 && row < 9)
-    else
-      board = flood_fill( board, location - 5) if (col < 4 && row > 0)
-      board = flood_fill( board, location - 6) if (row > 0)
-      board = flood_fill( board, location + 6) if (row < 9)
-      board = flood_fill( board, location + 7) if (col < 4 && row < 9)
-    end
-    board
-  end
-
-  # given a location, produces a list of relative locations covered by the piece at this rotation
-  def offsets( location)
-    if is_even( location) then
-      @even_offsets.collect { | value | value + location }
-    else
-      @odd_offsets.collect { | value | value + location }
-    end
-  end
-
-  # returns a set of offsets relative to the top-left most piece of the rotation (by even or odd rows)
-  # this is hard to explain. imagine we have this partial board:
-  #   0 0 0 0 0 x        [positions 0-5]
-  #    0 0 1 1 0 x       [positions 6-11]
-  #   0 0 1 0 0 x        [positions 12-17]
-  #    0 1 0 0 0 x       [positions 18-23]
-  #   0 1 0 0 0 x        [positions 24-29]
-  #    0 0 0 0 0 x       [positions 30-35]
-  #       ...
-  # The top-left of the piece is at position 8, the
-  # board would be passed as a set of positions (values array) containing [8,9,14,19,25] not necessarily in that
-  # sorted order.  Since that array starts on an odd row, the offsets for an odd row are: [0,1,6,11,17] obtained
-  # by subtracting 8 from everything.  Now imagine the piece shifted up and to the right so it's on an even row:
-  #   0 0 0 1 1 x        [positions 0-5]
-  #    0 0 1 0 0 x       [positions 6-11]
-  #   0 0 1 0 0 x        [positions 12-17]
-  #    0 1 0 0 0 x       [positions 18-23]
-  #   0 0 0 0 0 x        [positions 24-29]
-  #    0 0 0 0 0 x       [positions 30-35]
-  #       ...
-  # Now the positions are [3,4,8,14,19] which after subtracting the lowest value (3) gives [0,1,5,11,16] thus, the
-  # offsets for this particular piece are (in even, odd order) [0,1,5,11,16],[0,1,6,11,17] which is what
-  # this function would return
-  def normalize_offsets( values)
-    min = values.min
-    even_min = is_even(min)
-    other_min = even_min ? min + 6 : min + 7
-    other_values = values.collect do | value |
-      if is_even(value) then
-        value + 6 - other_min
-      else
-        value + 7 - other_min
-      end
-    end
-    values.collect! { | value | value - min }
-
-    if even_min then
-      [values, other_values]
-    else
-      [other_values, values]
-    end
-  end
-
-  # produce a bitmask representation of an array of offset locations
-  def mask_for_offsets( offsets )
-    mask = 0
-    offsets.each { | value | mask = mask + ( 1 << value ) }
-    mask
-  end
-
-  # finds a "safe" position that a position as described by a list of directions can be placed
-  # without falling off any edge of the board.  the values returned a location to place the first piece
-  # at so it will fit after making the described moves
-  def start_adjust( directions )
-    south = east = 0;
-    directions.each do | direction |
-      east += 1 if ( direction == :sw || direction == :nw || direction == :west )
-      south += 1 if ( direction == :nw || direction == :ne )
-    end
-    south * 6 + east
-  end
-
-  # given a set of directions places the piece (as defined by a set of directions) on the board at
-  # a location that will not take it off the edge
-  def get_values ( directions )
-    start = start_adjust(directions)
-    values = [ start ]
-    directions.each do | direction |
-      if (start % 12 >= 6) then
-        start += @@rotation_odd_adder[direction]
-      else
-        start += @@rotation_even_adder[direction]
-      end
-      values += [ start ]
-    end
-
-    # some moves take you back to an existing location, we'll strip duplicates
-    values.uniq
-  end
-end
-
-# describes a piece and caches information about its rotations to as to be efficient for iteration
-# ATTRIBUTES:
-#   rotations -- all the rotations of the piece
-#   type -- a numeic "name" of the piece
-#   masks -- an array by location of all legal rotational masks (a n inner array) for that location
-#   placed -- the mask that this piece was last placed at (not a location, but the actual mask used)
-class Piece
-  attr_reader :rotations, :type, :masks
-  attr_accessor :placed
-
-  # transform hashes that change one direction into another when you either flip or rotate a set of directions
-  @@flip_converter = { :west => :west, :east => :east, :nw => :sw, :ne => :se, :sw => :nw, :se => :ne }
-  @@rotate_converter = { :west => :nw, :east => :se, :nw => :ne, :ne => :east, :sw => :west, :se => :sw }
-
-  def initialize( directions, type )
-    @type = type
-    @rotations = Array.new();
-    @map = {}
-
-    generate_rotations( directions )
-    directions.collect! { | value | @@flip_converter[value] }
-    generate_rotations( directions )
-
-    # creates the masks AND a map that returns [location, rotation] for any given mask
-    # this is used when a board is found and we want to draw it, otherwise the map is unused
-    @masks = Array.new();
-    0.upto(59) do | i |
-      even = true
-      @masks[i] = @rotations.collect do | rotation |
-        mask = rotation.start_masks[i]
-        @map[mask[0]] = [ i, rotation ] if (mask)
-        mask || nil
-      end
-      @masks[i].compact!
-    end
-  end
-
-  # rotates a set of directions through all six angles and adds a Rotation to the list for each one
-  def generate_rotations( directions )
-    6.times do
-      rotations.push( Rotation.new(directions))
-      directions.collect! { | value | @@rotate_converter[value] }
-    end
-  end
-
-  # given a board string, adds this piece to the board at whatever location/rotation
-  # important: the outbound board string is 5 wide, the normal location notation is six wide (padded)
-  def fill_string( board_string)
-    location, rotation = @map[@placed]
-    rotation.offsets(location).each do | offset |
-      row, col = offset.divmod(6)
-      board_string[ row*5 + col, 1 ] = @type.to_s
-    end
-  end
-end
-
-# a blank bit board having this form:
-#
-#    0 0 0 0 0 1
-#     0 0 0 0 0 1
-#    0 0 0 0 0 1
-#     0 0 0 0 0 1
-#    0 0 0 0 0 1
-#     0 0 0 0 0 1
-#    0 0 0 0 0 1
-#     0 0 0 0 0 1
-#    0 0 0 0 0 1
-#     0 0 0 0 0 1
-#    1 1 1 1 1 1
-#
-# where left lest significant bit is the top left and the most significant is the lower right
-# the actual board only consists of the 0 places, the 1 places are blockers to keep things from running
-# off the edges or bottom
-def blank_board
-  0b111111100000100000100000100000100000100000100000100000100000100000
-end
-
-def full_board
-  0b111111111111111111111111111111111111111111111111111111111111111111
-end
-
-# determines if a location (bit position) is in an even row
-def is_even( location)
-  (location % 12) < 6
-end
-
-# support function that create three utility maps:
-#  $converter -- for each row an array that maps a five bit row (via array mapping)
-#                to the a five bit representation of the bits below it
-#  $bit_count -- maps a five bit row (via array mapping) to the number of 1s in the row
-#  @@new_regions -- maps a five bit row (via array mapping) to an array of "region" arrays
-#                   a region array has three values the first is a mask of bits in the region,
-#                   the second is the count of those bits and the third is identical to the first
-#                   examples:
-#                           0b10010 => [ 0b01100, 2, 0b01100 ], [ 0b00001, 1, 0b00001]
-#                           0b01010 => [ 0b10000, 1, 0b10000 ], [ 0b00100, 1, 0b00100 ], [ 0b00001, 1, 0b00001]
-#                           0b10001 => [ 0b01110, 3, 0b01110 ]
-def create_collector_support
-  odd_map = [0b11, 0b110, 0b1100, 0b11000, 0b10000]
-  even_map = [0b1, 0b11, 0b110, 0b1100, 0b11000]
-
-  all_odds = Array.new(0b100000)
-  all_evens = Array.new(0b100000)
-  bit_counts = Array.new(0b100000)
-  new_regions = Array.new(0b100000)
-  0.upto(0b11111) do | i |
-    bit_count = odd = even = 0
-    0.upto(4) do | bit |
-      if (i[bit] == 1) then
-        bit_count += 1
-        odd |= odd_map[bit]
-        even |= even_map[bit]
-      end
-    end
-    all_odds[i] = odd
-    all_evens[i] = even
-    bit_counts[i] = bit_count
-    new_regions[i] = create_regions( i)
-  end
-
-  $converter = []
-  10.times { | row | $converter.push((row % 2 == 0) ? all_evens : all_odds) }
-  $bit_counts = bit_counts
-  $regions = new_regions.collect { | set | set.collect { | value | [ value, bit_counts[value], value] } }
-end
-
-# determines if a board is punable, meaning that there is no possibility that it
-# can be filled up with pieces.  A board is prunable if there is a grouping of unfilled spaces
-# that are not a multiple of five.  The following board is an example of a prunable board:
-#    0 0 1 0 0
-#     0 1 0 0 0
-#    1 1 0 0 0
-#     0 1 0 0 0
-#    0 0 0 0 0
-#       ...
-#
-# This board is prunable because the top left corner is only 3 bits in area, no piece will ever fit it
-# parameters:
-#   board -- an initial bit board (6 bit padded rows, see blank_board for format)
-#   location -- starting location, everything above and to the left is already full
-#   slotting -- set to true only when testing initial pieces, when filling normally
-#               additional assumptions are possible
-#
-# Algorithm:
-#    The algorithm starts at the top row (as determined by location) and iterates a row at a time
-#    maintainng counts of active open areas (kept in the collector array) each collector contains
-#    three values at the start of an iteration:
-#          0: mask of bits that would be adjacent to the collector in this row
-#          1: the number of bits collected so far
-#          2: a scratch space starting as zero, but used during the computation to represent
-#             the empty bits in the new row that are adjacent (position 0)
-#  The exact procedure is described in-code
-def prunable( board, location, slotting = false)
-  collectors = []
-  # loop across the rows
-  (location / 6).to_i.upto(9) do | row_on |
-    # obtain a set of regions representing the bits of the current row.
-    regions = $regions[(board >> (row_on * 6)) & 0b11111]
-    converter = $converter[row_on]
-
-    # track the number of collectors at the start of the cycle so that
-    # we don't compute against newly created collectors, only existing collectors
-    initial_collector_count = collectors.length
-
-    # loop against the regions.  For each region of the row
-    # we will see if it connects to one or more existing collectors.
-    # if it connects to 1 collector, the bits from the region are added to the
-    # bits of the collector and the mask is placed in collector[2]
-    # If the region overlaps more than one collector then all the collectors
-    # it overlaps with are merged into the first one (the others are set to nil in the array)
-    # if NO collectors are found then the region is copied as a new collector
-    regions.each do | region |
-      collector_found = nil
-      region_mask = region[2]
-      initial_collector_count.times do | collector_num |
-        collector = collectors[collector_num]
-        if (collector) then
-          collector_mask = collector[0]
-          if (collector_mask & region_mask != 0) then
-            if (collector_found) then
-              collector_found[0] |= collector_mask
-              collector_found[1] += collector[1]
-              collector_found[2] |= collector[2]
-              collectors[collector_num] = nil
-            else
-              collector_found = collector
-              collector[1] += region[1]
-              collector[2] |= region_mask
-            end
-          end
-        end
-      end
-      if (collector_found == nil) then
-        collectors.push(Array.new(region))
-      end
-    end
-
-    # check the existing collectors, if any collector overlapped no bits in the region its [2] value will
-    # be zero.  The size of any such reaason is tested if it is not a multiple of five true is returned since
-    # the board is prunable.  if it is a multiple of five it is removed.
-    # Collector that are still active have a new adjacent value [0] set based n the matched bits
-    # and have [2] cleared out for the next cycle.
-    collectors.length.times do | collector_num |
-      collector = collectors[collector_num]
-      if (collector) then
-        if (collector[2] == 0) then
-          return true if (collector[1] % 5 != 0)
-          collectors[collector_num] = nil
-        else
-          # if a collector matches all bits in the row then we can return unprunable early for the
-          # following reasons:
-          #    1) there can be no more unavailable bits bince we fill from the top left downward
-          #    2) all previous regions have been closed or joined so only this region can fail
-          #    3) this region must be good since there can never be only 1 region that is nuot
-          #       a multiple of five
-          # this rule only applies when filling normally, so we ignore the rule if we are "slotting"
-          # in pieces to see what configurations work for them (the only other time this algorithm is used).
-          return false if (collector[2] == 0b11111 && !slotting)
-          collector[0] = converter[collector[2]]
-          collector[2] = 0
-        end
-      end
-    end
-
-    # get rid of all the empty converters for the next round
-    collectors.compact!
-  end
-  return false if (collectors.length <= 1) # 1 collector or less and the region is fine
-  collectors.any? { | collector | (collector[1] % 5) != 0 } # more than 1 and we test them all for bad size
-end
-
-# creates a region given a row mask.  see prunable for what a "region" is
-def create_regions( value )
-  regions = []
-  cur_region = 0
-  5.times do | bit |
-    if (value[bit] == 0) then
-      cur_region |= 1 << bit
-    else
-      if (cur_region != 0 ) then
-        regions.push( cur_region)
-        cur_region = 0;
-      end
-    end
-  end
-  regions.push(cur_region) if (cur_region != 0)
-  regions
-end
-
-# find up to the counted number of solutions (or all solutions) and prints the final result
-def find_all
-  find_top( 1)
-  find_top( 0)
-  print_results
-end
-
-# show the board
-def print_results
-  print "#{@boards_found} solutions found\n\n"
-  print_full_board( @min_board)
-  print "\n"
-  print_full_board( @max_board)
-  print "\n"
-end
-
-# finds solutions.  This special version of the main function is only used for the top level
-# the reason for it is basically to force a particular ordering on how the rotations are tested for
-# the first piece.  It is called twice, first looking for placements of the odd rotations and then
-# looking for placements of the even locations.
-#
-# WHY?
-#   Since any found solution has an inverse we want to maximize finding solutions that are not already found
-#   as an inverse.  The inverse will ALWAYS be 3 one of the piece configurations that is exactly 3 rotations away
-#   (an odd number).  Checking even vs odd then produces a higher probability of finding more pieces earlier
-#   in the cycle.  We still need to keep checking all the permutations, but our probability of finding one will
-#   diminsh over time.  Since we are TOLD how many to search for this lets us exit before checking all pieces
-#   this bennifit is very great when seeking small numbers of solutions and is 0 when looking for more than the
-#   maximum number
-def find_top( rotation_skip)
-  board = blank_board
-  (@pieces.length-1).times do
-    piece = @pieces.shift
-    piece.masks[0].each do | mask, imask, cmask |
-      if ((rotation_skip += 1) % 2 == 0) then
-        piece.placed = mask
-        find( 1, 1, board | mask)
-      end
-    end
-    @pieces.push(piece)
-  end
-  piece = @pieces.shift
-  @pieces.push(piece)
-end
-
-# the normail find routine, iterates through the available pieces, checks all rotations at the current location
-# and adds any boards found.  depth is achieved via recursion.  the overall approach is described
-# here: http://www-128.ibm.com/developerworks/java/library/j-javaopt/
-# parameters:
-#  start_location -- where to start looking for place for the next piece at
-#  placed -- number of pieces placed
-#  board -- current state of the board
-#
-# see in-code comments
-def find( start_location, placed, board)
-  # find the next location to place a piece by looking for an empty bit
-  while board[start_location] == 1
-    start_location += 1
-  end
-
-  @pieces.length.times do
-    piece = @pieces.shift
-    piece.masks[start_location].each do | mask, imask, cmask |
-      if ( board & cmask == imask) then
-        piece.placed = mask
-        if (placed == 9) then
-          add_board
-        else
-          find( start_location + 1, placed + 1, board | mask)
-        end
-      end
-    end
-    @pieces.push(piece)
-  end
-end
-
-# print the board
-def print_full_board( board_string)
-  10.times do | row |
-    print " " if (row % 2 == 1)
-    5.times do | col |
-      print "#{board_string[row*5 + col,1]} "
-    end
-    print "\n"
-  end
-end
-
-# when a board is found we "draw it" into a string and then flip that string, adding both to
-# the list (hash) of solutions if they are unique.
-def add_board
-  board_string = "99999999999999999999999999999999999999999999999999"
-  @all_pieces.each {  | piece | piece.fill_string( board_string ) }
-  save( board_string)
-  save( board_string.reverse)
-end
-
-# adds a board string to the list (if new) and updates the current best/worst board
-def save( board_string)
-  if (@all_boards[board_string] == nil) then
-    @min_board = board_string if (board_string < @min_board)
-    @max_board = board_string if (board_string > @max_board)
-    @all_boards.store(board_string,true)
-    @boards_found += 1
-
-    # the exit motif is a time saver.  Ideally the function should return, but those tests
-    # take noticeable time (performance).
-    if (@boards_found == @stop_count) then
-      print_results
-      exit(0)
-    end
-  end
-end
-
-
-##
-## MAIN BODY :)
-##
-create_collector_support
-@pieces = [
-  Piece.new( [ :nw, :ne, :east, :east ], 2),
-  Piece.new( [ :ne, :se, :east, :ne ], 7),
-  Piece.new( [ :ne, :east, :ne, :nw ], 1),
-  Piece.new( [ :east, :sw, :sw, :se ], 6),
-  Piece.new( [ :east, :ne, :se, :ne ], 5),
-  Piece.new( [ :east, :east, :east, :se ], 0),
-  Piece.new( [ :ne, :nw, :se, :east, :se ], 4),
-  Piece.new( [ :se, :se, :se, :west ], 9),
-  Piece.new( [ :se, :se, :east, :se ], 8),
-  Piece.new( [ :east, :east, :sw, :se ], 3)
-  ];
-
-@all_pieces = Array.new( @pieces)
-
-@min_board = "99999999999999999999999999999999999999999999999999"
-@max_board = "00000000000000000000000000000000000000000000000000"
-@stop_count = ARGV[0].to_i || 2089
-@all_boards = {}
-@boards_found = 0
-
-find_all ######## DO IT!!!
diff --git a/benchmark/bm_so_nbody.rb b/benchmark/bm_so_nbody.rb
deleted file mode 100644
index d6c5bb9e61..0000000000
--- a/benchmark/bm_so_nbody.rb
+++ /dev/null
@@ -1,148 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org
-#
-# Optimized for Ruby by Jesse Millikan
-# From version ported by Michael Neumann from the C gcc version,
-# which was written by Christoph Bauer.
-
-SOLAR_MASS = 4 * Math::PI**2
-DAYS_PER_YEAR = 365.24
-
-def _puts *args
-end
-
-class Planet
- attr_accessor :x, :y, :z, :vx, :vy, :vz, :mass
-
- def initialize(x, y, z, vx, vy, vz, mass)
-  @x, @y, @z = x, y, z
-  @vx, @vy, @vz = vx * DAYS_PER_YEAR, vy * DAYS_PER_YEAR, vz * DAYS_PER_YEAR
-  @mass = mass * SOLAR_MASS
- end
-
- def move_from_i(bodies, nbodies, dt, i)
-  while i < nbodies
-   b2 = bodies[i]
-   dx = @x - b2.x
-   dy = @y - b2.y
-   dz = @z - b2.z
-
-   distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
-   mag = dt / (distance * distance * distance)
-   b_mass_mag, b2_mass_mag = @mass * mag, b2.mass * mag
-
-   @vx -= dx * b2_mass_mag
-   @vy -= dy * b2_mass_mag
-   @vz -= dz * b2_mass_mag
-   b2.vx += dx * b_mass_mag
-   b2.vy += dy * b_mass_mag
-   b2.vz += dz * b_mass_mag
-   i += 1
-  end
-
-  @x += dt * @vx
-  @y += dt * @vy
-  @z += dt * @vz
- end
-end
-
-def energy(bodies)
-  e = 0.0
-  nbodies = bodies.size
-
-  for i in 0 ... nbodies
-    b = bodies[i]
-    e += 0.5 * b.mass * (b.vx * b.vx + b.vy * b.vy + b.vz * b.vz)
-    for j in (i + 1) ... nbodies
-      b2 = bodies[j]
-      dx = b.x - b2.x
-      dy = b.y - b2.y
-      dz = b.z - b2.z
-      distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
-      e -= (b.mass * b2.mass) / distance
-    end
-  end
-  e
-end
-
-def offset_momentum(bodies)
-  px, py, pz = 0.0, 0.0, 0.0
-
-  for b in bodies
-    m = b.mass
-    px += b.vx * m
-    py += b.vy * m
-    pz += b.vz * m
-  end
-
-  b = bodies[0]
-  b.vx = - px / SOLAR_MASS
-  b.vy = - py / SOLAR_MASS
-  b.vz = - pz / SOLAR_MASS
-end
-
-BODIES = [
-  # sun
-  Planet.new(0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0),
-
-  # jupiter
-  Planet.new(
-    4.84143144246472090e+00,
-    -1.16032004402742839e+00,
-    -1.03622044471123109e-01,
-    1.66007664274403694e-03,
-    7.69901118419740425e-03,
-    -6.90460016972063023e-05,
-    9.54791938424326609e-04),
-
-  # saturn
-  Planet.new(
-    8.34336671824457987e+00,
-    4.12479856412430479e+00,
-    -4.03523417114321381e-01,
-    -2.76742510726862411e-03,
-    4.99852801234917238e-03,
-    2.30417297573763929e-05,
-    2.85885980666130812e-04),
-
-  # uranus
-  Planet.new(
-    1.28943695621391310e+01,
-    -1.51111514016986312e+01,
-    -2.23307578892655734e-01,
-    2.96460137564761618e-03,
-    2.37847173959480950e-03,
-    -2.96589568540237556e-05,
-    4.36624404335156298e-05),
-
-  # neptune
-  Planet.new(
-    1.53796971148509165e+01,
-    -2.59193146099879641e+01,
-    1.79258772950371181e-01,
-    2.68067772490389322e-03,
-    1.62824170038242295e-03,
-    -9.51592254519715870e-05,
-    5.15138902046611451e-05)
-]
-
-init = 200_000 # ARGV[0]
-n = Integer(init)
-
-offset_momentum(BODIES)
-
-puts "%.9f" % energy(BODIES)
-
-nbodies = BODIES.size
-dt = 0.01
-
-n.times do
-  i = 0
-  while i < nbodies
-    b = BODIES[i]
-    b.move_from_i(BODIES, nbodies, dt, i + 1)
-    i += 1
-  end
-end
-
-puts "%.9f" % energy(BODIES)
diff --git a/benchmark/bm_so_nested_loop.rb b/benchmark/bm_so_nested_loop.rb
deleted file mode 100644
index a0513f8c47..0000000000
--- a/benchmark/bm_so_nested_loop.rb
+++ /dev/null
@@ -1,24 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: nestedloop-ruby.code,v 1.4 2004/11/13 07:42:22 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# from Avi Bryant
-
-n = 16 # Integer(ARGV.shift || 1)
-x = 0
-n.times do
-    n.times do
-        n.times do
-            n.times do
-                n.times do
-                    n.times do
-                        x += 1
-                    end
-                end
-            end
-        end
-    end
-end
-# puts x
-
-
diff --git a/benchmark/bm_so_nsieve.rb b/benchmark/bm_so_nsieve.rb
deleted file mode 100644
index a65cc78233..0000000000
--- a/benchmark/bm_so_nsieve.rb
+++ /dev/null
@@ -1,35 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org/
-#
-# contributed by Glenn Parker, March 2005
-# modified by Evan Phoenix, Sept 2006
-
-def sieve(m)
-  flags = Flags.dup[0,m]
-  count = 0
-  pmax = m - 1
-  p = 2
-  while p <= pmax
-    unless flags[p].zero?
-      count += 1
-      mult = p
-      while mult <= pmax
-        flags[mult] = 0
-        mult += p
-      end
-    end
-    p += 1
-  end
-  count
-end
-
-n = 9 # (ARGV[0] || 2).to_i
-Flags = ("\x1" * ( 2 ** n * 10_000)).unpack("c*")
-
-n.downto(n-2) do |exponent|
-  break if exponent < 0
-  m = (1 << exponent) * 10_000
-  # m = (2 ** exponent) * 10_000
-  count = sieve(m)
-  printf "Primes up to %8d %8d\n", m, count
-end
diff --git a/benchmark/bm_so_nsieve_bits.rb b/benchmark/bm_so_nsieve_bits.rb
deleted file mode 100644
index 6f958ee44e..0000000000
--- a/benchmark/bm_so_nsieve_bits.rb
+++ /dev/null
@@ -1,43 +0,0 @@
-#!/usr/bin/ruby
-#coding: us-ascii
-#
-# The Great Computer Language Shootout
-# http://shootout.alioth.debian.org/
-#
-# nsieve-bits in Ruby
-# Contributed by Glenn Parker, March 2005
-
-CharExponent = 3
-BitsPerChar = 1 << CharExponent
-LowMask = BitsPerChar - 1
-
-def sieve(m)
-  items = "\xFF" * ((m / BitsPerChar) + 1)
-  masks = ""
-  BitsPerChar.times do |b|
-    masks << (1 << b).chr
-  end
-
-  count = 0
-  pmax = m - 1
-  2.step(pmax, 1) do |p|
-    if items[p >> CharExponent][p & LowMask] == 1
-      count += 1
-      p.step(pmax, p) do |mult|
-	a = mult >> CharExponent
-	b = mult & LowMask
-	items[a] -= masks[b] if items[a][b] != 0
-      end
-    end
-  end
-  count
-end
-
-n = 9 # (ARGV[0] || 2).to_i
-n.step(n - 2, -1) do |exponent|
-  break if exponent < 0
-  m = 2 ** exponent * 10_000
-  count = sieve(m)
-  printf "Primes up to %8d %8d\n", m, count
-end
-
diff --git a/benchmark/bm_so_object.rb b/benchmark/bm_so_object.rb
deleted file mode 100644
index e8607c7199..0000000000
--- a/benchmark/bm_so_object.rb
+++ /dev/null
@@ -1,56 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: objinst-ruby.code,v 1.4 2004/11/13 07:42:25 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# with help from Aristarkh Zagorodnikov
-
-class Toggle
-    def initialize(start_state)
-        @bool = start_state
-    end
-
-    def value
-        @bool
-    end
-
-    def activate
-        @bool = !@bool
-        self
-    end
-end
-
-class NthToggle < Toggle
-    def initialize(start_state, max_counter)
-        super start_state
-        @count_max = max_counter
-        @counter = 0
-    end
-
-    def activate
-        @counter += 1
-        if @counter >= @count_max
-            @bool = !@bool
-            @counter = 0
-        end
-        self
-    end
-end
-
-n = 1500000 # (ARGV.shift || 1).to_i
-
-toggle = Toggle.new 1
-5.times do
-    toggle.activate.value ? 'true' : 'false'
-end
-n.times do
-    toggle = Toggle.new 1
-end
-
-ntoggle = NthToggle.new 1, 3
-8.times do
-    ntoggle.activate.value ? 'true' : 'false'
-end
-n.times do
-    ntoggle = NthToggle.new 1, 3
-end
-
diff --git a/benchmark/bm_so_partial_sums.rb b/benchmark/bm_so_partial_sums.rb
deleted file mode 100644
index 630b45cb8d..0000000000
--- a/benchmark/bm_so_partial_sums.rb
+++ /dev/null
@@ -1,31 +0,0 @@
-n = 2_500_000 # (ARGV.shift || 1).to_i
-
-alt = 1.0 ; s0 = s1 = s2 = s3 = s4 = s5 = s6 = s7 = s8 = 0.0
-
-1.upto(n) do |d|
-  d = d.to_f ; d2 = d * d ; d3 = d2 * d ; ds = Math.sin(d) ; dc = Math.cos(d)
-
-  s0 += (2.0 / 3.0) ** (d - 1.0)
-  s1 += 1.0 / Math.sqrt(d)
-  s2 += 1.0 / (d * (d + 1.0))
-  s3 += 1.0 / (d3 * ds * ds)
-  s4 += 1.0 / (d3 * dc * dc)
-  s5 += 1.0 / d
-  s6 += 1.0 / d2
-  s7 += alt / d
-  s8 += alt / (2.0 * d - 1.0)
-
-  alt = -alt
-end
-
-if false
-  printf("%.9f\t(2/3)^k\n", s0)
-  printf("%.9f\tk^-0.5\n", s1)
-  printf("%.9f\t1/k(k+1)\n", s2)
-  printf("%.9f\tFlint Hills\n", s3)
-  printf("%.9f\tCookson Hills\n", s4)
-  printf("%.9f\tHarmonic\n", s5)
-  printf("%.9f\tRiemann Zeta\n", s6)
-  printf("%.9f\tAlternating Harmonic\n", s7)
-  printf("%.9f\tGregory\n", s8)
-end
diff --git a/benchmark/bm_so_pidigits.rb b/benchmark/bm_so_pidigits.rb
deleted file mode 100644
index c7d6fbfb4d..0000000000
--- a/benchmark/bm_so_pidigits.rb
+++ /dev/null
@@ -1,92 +0,0 @@
-# The Great Computer Language Shootout
-# http://shootout.alioth.debian.org/
-#
-# contributed by Gabriele Renzi
-
-class PiDigitSpigot
-
-    def initialize()
-        @z = Transformation.new 1,0,0,1
-        @x = Transformation.new 0,0,0,0
-        @inverse = Transformation.new 0,0,0,0
-    end
-
-    def next!
-        @y = @z.extract(3)
-        if safe? @y
-            @z = produce(@y)
-            @y
-        else
-            @z = consume @x.next!()
-            next!()
-        end
-    end
-
-    def safe?(digit)
-        digit == @z.extract(4)
-    end
-
-    def produce(i)
-        @inverse.qrst(10,-10*i,0,1).compose(@z)
-    end
-
-    def consume(a)
-        @z.compose(a)
-    end
-end
-
-
-class Transformation
-    attr_reader :q, :r, :s, :t
-    def initialize (q, r, s, t)
-        @q,@r,@s,@t,@k = q,r,s,t,0
-    end
-
-    def next!()
-        @q = @k = @k + 1
-        @r = 4 * @k + 2
-        @s = 0
-        @t = 2 * @k + 1
-        self
-    end
-
-    def extract(j)
-        (@q * j + @r) / (@s * j + @t)
-    end
-
-    def compose(a)
-        self.class.new( @q * a.q,
-                        @q * a.r + r * a.t,
-                        @s * a.q + t * a.s,
-                        @s * a.r + t * a.t
-                    )
-    end
-
-    def qrst *args
-        initialize *args
-        self
-    end
-
-
-end
-
-
-WIDTH = 10
-n = 2_500 # Integer(ARGV[0])
-j = 0
-
-digits = PiDigitSpigot.new
-
-while n > 0
-    if n >= WIDTH
-        WIDTH.times {print digits.next!}
-        j += WIDTH
-    else
-        n.times {print digits.next!}
-        (WIDTH-n).times {print " "}
-        j += n
-    end
-    puts "\t:"+j.to_s
-    n -= WIDTH
-end
-
diff --git a/benchmark/bm_so_random.rb b/benchmark/bm_so_random.rb
deleted file mode 100644
index a66b9e8e63..0000000000
--- a/benchmark/bm_so_random.rb
+++ /dev/null
@@ -1,20 +0,0 @@
-# from http://www.bagley.org/~doug/shootout/bench/random/random.ruby
-
-IM = 139968.0
-IA = 3877.0
-IC = 29573.0
-
-$last = 42.0
-
-def gen_random(max)
-  (max * ($last = ($last * IA + IC) % IM)) / IM
-end
-
-N = 3_000_000
-
-i = 0
-while i<N
-  i +=1
-  gen_random(100.0)
-end
-# "%.9f" % gen_random(100.0)
diff --git a/benchmark/bm_so_reverse_complement.rb b/benchmark/bm_so_reverse_complement.rb
deleted file mode 100644
index 82ea666994..0000000000
--- a/benchmark/bm_so_reverse_complement.rb
+++ /dev/null
@@ -1,30 +0,0 @@
-#!/usr/bin/ruby
-# The Great Computer Language Shootout
-# http://shootout.alioth.debian.org/
-#
-# Contributed by Peter Bjarke Olsen
-# Modified by Doug King
-
-seq=Array.new
-
-def revcomp(seq)
-  seq.reverse!.tr!('wsatugcyrkmbdhvnATUGCYRKMBDHVN','WSTAACGRYMKVHDBNTAACGRYMKVHDBN')
-  stringlen=seq.length
-  0.step(stringlen-1,60) {|x| print seq.slice(x,60) , "\n"}
-end
-
-input = open(File.join(File.dirname($0), 'fasta.output.2500000'), 'rb')
-
-while input.gets
-  if $_ =~ />/
-    if seq.length != 0
-      revcomp(seq.join)
-      seq=Array.new
-    end
-    puts $_
-  else
-    $_.sub(/\n/,'')
-    seq.push $_
-  end
-end
-revcomp(seq.join)
diff --git a/benchmark/bm_so_sieve.rb b/benchmark/bm_so_sieve.rb
deleted file mode 100644
index 43dc302648..0000000000
--- a/benchmark/bm_so_sieve.rb
+++ /dev/null
@@ -1,24 +0,0 @@
-# from http://www.bagley.org/~doug/shootout/bench/sieve/sieve.ruby
-num = 500
-count = i = j = 0
-flags0 = Array.new(8192,1)
-k = 0
-while k < num
-  k += 1
-  count = 0
-  flags = flags0.dup
-  i = 2
-  while i<8192
-    i += 1
-    if flags[i]
-      # remove all multiples of prime: i
-      j = i*i
-      while j < 8192
-        j += i
-        flags[j] = nil
-      end
-      count += 1
-    end
-  end
-end
-count
diff --git a/benchmark/bm_so_spectralnorm.rb b/benchmark/bm_so_spectralnorm.rb
deleted file mode 100644
index 6b97206689..0000000000
--- a/benchmark/bm_so_spectralnorm.rb
+++ /dev/null
@@ -1,50 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org/
-# Contributed by Sokolov Yura
-
-def eval_A(i,j)
-	return 1.0/((i+j)*(i+j+1)/2+i+1)
-end
-
-def eval_A_times_u(u)
-        v, i = nil, nil
-	(0..u.length-1).collect { |i|
-                v = 0
-		for j in 0..u.length-1
-			v += eval_A(i,j)*u[j]
-                end
-                v
-        }
-end
-
-def eval_At_times_u(u)
-	v, i = nil, nil
-	(0..u.length-1).collect{|i|
-                v = 0
-		for j in 0..u.length-1
-			v += eval_A(j,i)*u[j]
-                end
-                v
-        }
-end
-
-def eval_AtA_times_u(u)
-	return eval_At_times_u(eval_A_times_u(u))
-end
-
-n = 500 # ARGV[0].to_i
-
-u=[1]*n
-for i in 1..10
-        v=eval_AtA_times_u(u)
-        u=eval_AtA_times_u(v)
-end
-vBv=0
-vv=0
-for i in 0..n-1
-        vBv += u[i]*v[i]
-        vv += v[i]*v[i]
-end
-
-str = "%0.9f" % (Math.sqrt(vBv/vv)), "\n"
-# print str
diff --git a/benchmark/bm_vm1_attr_ivar.rb b/benchmark/bm_vm1_attr_ivar.rb
deleted file mode 100644
index 16906f3605..0000000000
--- a/benchmark/bm_vm1_attr_ivar.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-class C
-  attr_reader :a, :b
-  def initialize
-    @a = nil
-    @b = nil
-  end
-end
-obj = C.new
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  j = obj.a
-  k = obj.b
-end
diff --git a/benchmark/bm_vm1_attr_ivar_set.rb b/benchmark/bm_vm1_attr_ivar_set.rb
deleted file mode 100644
index 7e7a6b48c0..0000000000
--- a/benchmark/bm_vm1_attr_ivar_set.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-class C
-  attr_accessor :a, :b
-  def initialize
-    @a = nil
-    @b = nil
-  end
-end
-obj = C.new
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  obj.a = 1
-  obj.b = 2
-end
diff --git a/benchmark/bm_vm1_block.rb b/benchmark/bm_vm1_block.rb
deleted file mode 100644
index a9f56b15ea..0000000000
--- a/benchmark/bm_vm1_block.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-def m
-  yield
-end
-
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  m{
-  }
-end
diff --git a/benchmark/bm_vm1_const.rb b/benchmark/bm_vm1_const.rb
deleted file mode 100644
index ac59ebccf1..0000000000
--- a/benchmark/bm_vm1_const.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-Const = 1
-
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  j = Const
-  k = Const
-end
diff --git a/benchmark/bm_vm1_ensure.rb b/benchmark/bm_vm1_ensure.rb
deleted file mode 100644
index a1596145f2..0000000000
--- a/benchmark/bm_vm1_ensure.rb
+++ /dev/null
@@ -1,11 +0,0 @@
-i = 0
-while i<30_000_000 # benchmark loop 1
-  i += 1
-  begin
-    begin
-    ensure
-    end
-  ensure
-  end
-end
-
diff --git a/benchmark/bm_vm1_float_simple.rb b/benchmark/bm_vm1_float_simple.rb
deleted file mode 100644
index d4581439ff..0000000000
--- a/benchmark/bm_vm1_float_simple.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-i = 0.0; f = 0.0
-while i<30_000_000
-  i += 1
-  f += 0.1; f -= 0.1
-  f += 0.1; f -= 0.1
-  f += 0.1; f -= 0.1
-end
diff --git a/benchmark/bm_vm1_gc_short_lived.rb b/benchmark/bm_vm1_gc_short_lived.rb
deleted file mode 100644
index e78bca5668..0000000000
--- a/benchmark/bm_vm1_gc_short_lived.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-i = 0
-while i<30_000_000 # while loop 1
-  a = '' # short-lived String
-  b = ''
-  c = ''
-  d = ''
-  e = ''
-  f = ''
-  i+=1
-end
diff --git a/benchmark/bm_vm1_gc_short_with_complex_long.rb b/benchmark/bm_vm1_gc_short_with_complex_long.rb
deleted file mode 100644
index b66052dee0..0000000000
--- a/benchmark/bm_vm1_gc_short_with_complex_long.rb
+++ /dev/null
@@ -1,27 +0,0 @@
-def nested_hash h, n
-  if n == 0
-    ''
-  else
-    10.times{
-      h[Object.new] = nested_hash(h, n-1)
-    }
-  end
-end
-
-long_lived = Hash.new
-nested_hash long_lived, 6
-
-GC.start
-GC.start
-
-i = 0
-while i<30_000_000 # while loop 1
-  a = '' # short-lived String
-  b = ''
-  c = ''
-  d = ''
-  e = ''
-  f = ''
-  i+=1
-end
-
diff --git a/benchmark/bm_vm1_gc_short_with_long.rb b/benchmark/bm_vm1_gc_short_with_long.rb
deleted file mode 100644
index 298dbc845b..0000000000
--- a/benchmark/bm_vm1_gc_short_with_long.rb
+++ /dev/null
@@ -1,13 +0,0 @@
-long_lived = Array.new(1_000_000){|i| "#{i}"}
-GC.start
-GC.start
-i = 0
-while i<30_000_000 # while loop 1
-  a = '' # short-lived String
-  b = ''
-  c = ''
-  d = ''
-  e = ''
-  f = ''
-  i+=1
-end
diff --git a/benchmark/bm_vm1_gc_short_with_symbol.rb b/benchmark/bm_vm1_gc_short_with_symbol.rb
deleted file mode 100644
index 6b15c1b7bf..0000000000
--- a/benchmark/bm_vm1_gc_short_with_symbol.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-# make many symbols
-50_000.times{|i| sym = "sym#{i}".to_sym}
-GC.start
-GC.start
-
-i = 0
-while i<30_000_000 # while loop 1
-  a = '' # short-lived String
-  b = ''
-  c = ''
-  d = ''
-  e = ''
-  f = ''
-  i+=1
-end
diff --git a/benchmark/bm_vm1_gc_wb_ary.rb b/benchmark/bm_vm1_gc_wb_ary.rb
deleted file mode 100644
index 881528845b..0000000000
--- a/benchmark/bm_vm1_gc_wb_ary.rb
+++ /dev/null
@@ -1,12 +0,0 @@
-short_lived_ary = []
-
-if RUBY_VERSION >= "2.2.0"
-  GC.start(full_mark: false, immediate_mark: true, lazy_sweep: false)
-end
-
-i = 0
-short_lived = ''
-while i<30_000_000 # while loop 1
-  short_lived_ary[0] = short_lived # write barrier
-  i+=1
-end
diff --git a/benchmark/bm_vm1_gc_wb_ary_promoted.rb b/benchmark/bm_vm1_gc_wb_ary_promoted.rb
deleted file mode 100644
index 3c8279c956..0000000000
--- a/benchmark/bm_vm1_gc_wb_ary_promoted.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-long_lived = []
-
-if RUBY_VERSION > "2.2.0"
-  3.times{ GC.start(full_mark: false, immediate_mark: true, lazy_sweep: false) }
-elsif
-  GC.start
-end
-
-i = 0
-short_lived = ''
-while i<30_000_000 # while loop 1
-  long_lived[0] = short_lived # write barrier
-  i+=1
-end
diff --git a/benchmark/bm_vm1_gc_wb_obj.rb b/benchmark/bm_vm1_gc_wb_obj.rb
deleted file mode 100644
index a4067af36b..0000000000
--- a/benchmark/bm_vm1_gc_wb_obj.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-class C
-  attr_accessor :foo
-end
-short_lived_obj = C.new
-
-if RUBY_VERSION >= "2.2.0"
-  GC.start(full_mark: false, immediate_mark: true, lazy_sweep: false)
-end
-
-i = 0
-short_lived = ''
-while i<30_000_000 # while loop 1
-  short_lived_obj.foo = short_lived # write barrier
-  i+=1
-end
diff --git a/benchmark/bm_vm1_gc_wb_obj_promoted.rb b/benchmark/bm_vm1_gc_wb_obj_promoted.rb
deleted file mode 100644
index eee07a0248..0000000000
--- a/benchmark/bm_vm1_gc_wb_obj_promoted.rb
+++ /dev/null
@@ -1,17 +0,0 @@
-class C
-  attr_accessor :foo
-end
-long_lived = C.new
-
-if RUBY_VERSION >= "2.2.0"
-  3.times{ GC.start(full_mark: false, immediate_mark: true, lazy_sweep: false) }
-elsif
-  GC.start
-end
-
-i = 0
-short_lived = ''
-while i<30_000_000 # while loop 1
-  long_lived.foo = short_lived # write barrier
-  i+=1
-end
diff --git a/benchmark/bm_vm1_ivar.rb b/benchmark/bm_vm1_ivar.rb
deleted file mode 100644
index 68a73cf92f..0000000000
--- a/benchmark/bm_vm1_ivar.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-@a = 1
-
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  j = @a
-  k = @a
-end
diff --git a/benchmark/bm_vm1_ivar_set.rb b/benchmark/bm_vm1_ivar_set.rb
deleted file mode 100644
index bd81b06c34..0000000000
--- a/benchmark/bm_vm1_ivar_set.rb
+++ /dev/null
@@ -1,6 +0,0 @@
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  @a = 1
-  @b = 2
-end
diff --git a/benchmark/bm_vm1_length.rb b/benchmark/bm_vm1_length.rb
deleted file mode 100644
index 353de3ab0e..0000000000
--- a/benchmark/bm_vm1_length.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-a = 'abc'
-b = [1, 2, 3]
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  a.length
-  b.length
-end
-
diff --git a/benchmark/bm_vm1_lvar_init.rb b/benchmark/bm_vm1_lvar_init.rb
deleted file mode 100644
index 36f2068811..0000000000
--- a/benchmark/bm_vm1_lvar_init.rb
+++ /dev/null
@@ -1,18 +0,0 @@
-def m v
-  unless v
-    # unreachable code
-    v1 = v2 = v3 = v4 = v5 = v6 = v7 = v8 = v9 = v10 =
-    v11 = v12 = v13 = v14 = v15 = v16 = v17 = v18 = v19 = v20 =
-    v21 = v22 = v23 = v24 = v25 = v26 = v27 = v28 = v29 = v30 =
-    v31 = v32 = v33 = v34 = v35 = v36 = v37 = v38 = v39 = v40 =
-    v41 = v42 = v43 = v44 = v45 = v46 = v47 = v48 = v49 = v50 = 1
-  end
-end
-
-i = 0
-
-while i<30_000_000 # while loop 1
-  i += 1
-  m i
-end
-
diff --git a/benchmark/bm_vm1_lvar_set.rb b/benchmark/bm_vm1_lvar_set.rb
deleted file mode 100644
index 222e864134..0000000000
--- a/benchmark/bm_vm1_lvar_set.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  a = b = c = d = e = f = g = h = j = k = l = m = n = o = p = q = r = 1
-end
diff --git a/benchmark/bm_vm1_neq.rb b/benchmark/bm_vm1_neq.rb
deleted file mode 100644
index bbb4ae07a4..0000000000
--- a/benchmark/bm_vm1_neq.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-i = 0
-obj1 = Object.new
-obj2 = Object.new
-
-while i<30_000_000 # while loop 1
-  i += 1
-  obj1 != obj2
-end
diff --git a/benchmark/bm_vm1_not.rb b/benchmark/bm_vm1_not.rb
deleted file mode 100644
index b09ecdcc21..0000000000
--- a/benchmark/bm_vm1_not.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-i = 0
-obj = Object.new
-
-while i<30_000_000 # while loop 1
-  i += 1
-  !obj
-end
diff --git a/benchmark/bm_vm1_rescue.rb b/benchmark/bm_vm1_rescue.rb
deleted file mode 100644
index b0d3e2bdfa..0000000000
--- a/benchmark/bm_vm1_rescue.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  begin
-  rescue
-  end
-end
diff --git a/benchmark/bm_vm1_simplereturn.rb b/benchmark/bm_vm1_simplereturn.rb
deleted file mode 100644
index 63f9f21675..0000000000
--- a/benchmark/bm_vm1_simplereturn.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-def m
-  return 1
-end
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  m
-end
-
diff --git a/benchmark/bm_vm1_swap.rb b/benchmark/bm_vm1_swap.rb
deleted file mode 100644
index 918f8b2112..0000000000
--- a/benchmark/bm_vm1_swap.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-a = 1
-b = 2
-i = 0
-while i<30_000_000 # while loop 1
-  i += 1
-  a, b = b, a
-end
-
diff --git a/benchmark/bm_vm1_yield.rb b/benchmark/bm_vm1_yield.rb
deleted file mode 100644
index 775597cea6..0000000000
--- a/benchmark/bm_vm1_yield.rb
+++ /dev/null
@@ -1,10 +0,0 @@
-def m
-  i = 0
-  while i<30_000_000 # while loop 1
-    i += 1
-    yield
-  end
-end
-
-m{}
-
diff --git a/benchmark/bm_vm2_array.rb b/benchmark/bm_vm2_array.rb
deleted file mode 100644
index df9037c83c..0000000000
--- a/benchmark/bm_vm2_array.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  a = [1,2,3,4,5,6,7,8,9,10]
-end
diff --git a/benchmark/bm_vm2_bigarray.rb b/benchmark/bm_vm2_bigarray.rb
deleted file mode 100644
index b02509d6a2..0000000000
--- a/benchmark/bm_vm2_bigarray.rb
+++ /dev/null
@@ -1,106 +0,0 @@
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  a = [
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-    1,2,3,4,5,6,7,8,9,10,
-  ]
-end
diff --git a/benchmark/bm_vm2_bighash.rb b/benchmark/bm_vm2_bighash.rb
deleted file mode 100644
index 5e3f437bb8..0000000000
--- a/benchmark/bm_vm2_bighash.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-i = 0
-while i<60_000 # benchmark loop 2
-  i += 1
-  a = {0=>0, 1=>1, 2=>2, 3=>3, 4=>4, 5=>5, 6=>6, 7=>7, 8=>8, 9=>9, 10=>10, 11=>11, 12=>12, 13=>13, 14=>14, 15=>15, 16=>16, 17=>17, 18=>18, 19=>19, 20=>20, 21=>21, 22=>22, 23=>23, 24=>24, 25=>25, 26=>26, 27=>27, 28=>28, 29=>29, 30=>30, 31=>31, 32=>32, 33=>33, 34=>34, 35=>35, 36=>36, 37=>37, 38=>38, 39=>39, 40=>40, 41=>41, 42=>42, 43=>43, 44=>44, 45=>45, 46=>46, 47=>47, 48=>48, 49=>49, 50=>50, 51=>51, 52=>52, 53=>53, 54=>54, 55=>55, 56=>56, 57=>57, 58=>58, 59=>59, 60=>60, 61=>61, 62=>62, 63=>63, 64=>64, 65=>65, 66=>66, 67=>67, 68=>68, 69=>69, 70=>70, 71=>71, 72=>72, 73=>73, 74=>74, 75=>75, 76=>76, 77=>77, 78=>78, 79=>79, 80=>80, 81=>81, 82=>82, 83=>83, 84=>84, 85=>85, 86=>86, 87=>87, 88=>88, 89=>89, 90=>90, 91=>91, 92=>92, 93=>93, 94=>94, 95=>95, 96=>96, 97=>97, 98=>98, 99=>99, 100=>100, 101=>101, 102=>102, 103=>103, 104=>104, 105=>105, 106=>106, 107=>107, 108=>108, 109=>109, 110=>110, 111=>111, 112=>112, 113=>113, 114=>114, 115=>115, 116=>116, 117=>117, 118=>118, 119=>119, 120=>120, 121=>121, 122=>122, 123=>123, 124=>124, 125=>125, 126=>126, 127=>127, 128=>128, 129=>129, 130=>130, 131=>131, 132=>132, 133=>133, 134=>134, 135=>135, 136=>136, 137=>137, 138=>138, 139=>139, 140=>140, 141=>141, 142=>142, 143=>143, 144=>144, 145=>145, 146=>146, 147=>147, 148=>148, 149=>149, 150=>150, 151=>151, 152=>152, 153=>153, 154=>154, 155=>155, 156=>156, 157=>157, 158=>158, 159=>159, 160=>160, 161=>161, 162=>162, 163=>163, 164=>164, 165=>165, 166=>166, 167=>167, 168=>168, 169=>169, 170=>170, 171=>171, 172=>172, 173=>173, 174=>174, 175=>175, 176=>176, 177=>177, 178=>178, 179=>179, 180=>180, 181=>181, 182=>182, 183=>183, 184=>184, 185=>185, 186=>186, 187=>187, 188=>188, 189=>189, 190=>190, 191=>191, 192=>192, 193=>193, 194=>194, 195=>195, 196=>196, 197=>197, 198=>198, 199=>199, 200=>200, 201=>201, 202=>202, 203=>203, 204=>204, 205=>205, 206=>206, 207=>207, 208=>208, 209=>209, 210=>210, 211=>211, 212=>212, 213=>213, 214=>214, 215=>215, 216=>216, 217=>217, 218=>218, 219=>219, 220=>220, 221=>221, 222=>222, 223=>223, 224=>224, 225=>225, 226=>226, 227=>227, 228=>228, 229=>229, 230=>230, 231=>231, 232=>232, 233=>233, 234=>234, 235=>235, 236=>236, 237=>237, 238=>238, 239=>239, 240=>240, 241=>241, 242=>242, 243=>243, 244=>244, 245=>245, 246=>246, 247=>247, 248=>248, 249=>249, 250=>250, 251=>251, 252=>252, 253=>253, 254=>254, 255=>255, 256=>256, 257=>257, 258=>258, 259=>259, 260=>260, 261=>261, 262=>262, 263=>263, 264=>264, 265=>265, 266=>266, 267=>267, 268=>268, 269=>269, 270=>270, 271=>271, 272=>272, 273=>273, 274=>274, 275=>275, 276=>276, 277=>277, 278=>278, 279=>279, 280=>280, 281=>281, 282=>282, 283=>283, 284=>284, 285=>285, 286=>286, 287=>287, 288=>288, 289=>289, 290=>290, 291=>291, 292=>292, 293=>293, 294=>294, 295=>295, 296=>296, 297=>297, 298=>298, 299=>299, 300=>300, 301=>301, 302=>302, 303=>303, 304=>304, 305=>305, 306=>306, 307=>307, 308=>308, 309=>309, 310=>310, 311=>311, 312=>312, 313=>313, 314=>314, 315=>315, 316=>316, 317=>317, 318=>318, 319=>319, 320=>320, 321=>321, 322=>322, 323=>323, 324=>324, 325=>325, 326=>326, 327=>327, 328=>328, 329=>329, 330=>330, 331=>331, 332=>332, 333=>333, 334=>334, 335=>335, 336=>336, 337=>337, 338=>338, 339=>339, 340=>340, 341=>341, 342=>342, 343=>343, 344=>344, 345=>345, 346=>346, 347=>347, 348=>348, 349=>349, 350=>350, 351=>351, 352=>352, 353=>353, 354=>354, 355=>355, 356=>356, 357=>357, 358=>358, 359=>359, 360=>360, 361=>361, 362=>362, 363=>363, 364=>364, 365=>365, 366=>366, 367=>367, 368=>368, 369=>369, 370=>370, 371=>371, 372=>372, 373=>373, 374=>374, 375=>375, 376=>376, 377=>377, 378=>378, 379=>379, 380=>380, 381=>381, 382=>382, 383=>383, 384=>384, 385=>385, 386=>386, 387=>387, 388=>388, 389=>389, 390=>390, 391=>391, 392=>392, 393=>393, 394=>394, 395=>395, 396=>396, 397=>397, 398=>398, 399=>399, 400=>400, 401=>401, 402=>402, 403=>403, 404=>404, 405=>405, 406=>406, 407=>407, 408=>408, 409=>409, 410=>410, 411=>411, 412=>412, 413=>413, 414=>414, 415=>415, 416=>416, 417=>417, 418=>418, 419=>419, 420=>420, 421=>421, 422=>422, 423=>423, 424=>424, 425=>425, 426=>426, 427=>427, 428=>428, 429=>429, 430=>430, 431=>431, 432=>432, 433=>433, 434=>434, 435=>435, 436=>436, 437=>437, 438=>438, 439=>439, 440=>440, 441=>441, 442=>442, 443=>443, 444=>444, 445=>445, 446=>446, 447=>447, 448=>448, 449=>449, 450=>450, 451=>451, 452=>452, 453=>453, 454=>454, 455=>455, 456=>456, 457=>457, 458=>458, 459=>459, 460=>460, 461=>461, 462=>462, 463=>463, 464=>464, 465=>465, 466=>466, 467=>467, 468=>468, 469=>469, 470=>470, 471=>471, 472=>472, 473=>473, 474=>474, 475=>475, 476=>476, 477=>477, 478=>478, 479=>479, 480=>480, 481=>481, 482=>482, 483=>483, 484=>484, 485=>485, 486=>486, 487=>487, 488=>488, 489=>489, 490=>490, 491=>491, 492=>492, 493=>493, 494=>494, 495=>495, 496=>496, 497=>497, 498=>498, 499=>499, 500=>500,}
-end
diff --git a/benchmark/bm_vm2_case.rb b/benchmark/bm_vm2_case.rb
deleted file mode 100644
index adc6e4df0a..0000000000
--- a/benchmark/bm_vm2_case.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-i = 0
-while i<6_000_000 # while loop 2
-  case :foo
-  when :bar
-    raise
-  when :baz
-    raise
-  when :boo
-    raise
-  when :foo
-    i += 1
-  end
-end
-
diff --git a/benchmark/bm_vm2_case_lit.rb b/benchmark/bm_vm2_case_lit.rb
deleted file mode 100644
index c62b294e0e..0000000000
--- a/benchmark/bm_vm2_case_lit.rb
+++ /dev/null
@@ -1,19 +0,0 @@
-i = 0
-@ret = [ "foo", true, false, :sym, 6, nil, 0.1, 0xffffffffffffffff ]
-def foo(i)
-  @ret[i % @ret.size]
-end
-
-while i<6_000_000 # while loop 2
-  case foo(i)
-  when "foo" then :foo
-  when true then true
-  when false then false
-  when :sym then :sym
-  when 6 then :fix
-  when nil then nil
-  when 0.1 then :float
-  when 0xffffffffffffffff then :big
-  end
-  i += 1
-end
diff --git a/benchmark/bm_vm2_defined_method.rb b/benchmark/bm_vm2_defined_method.rb
deleted file mode 100644
index 053ed6c912..0000000000
--- a/benchmark/bm_vm2_defined_method.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-class Object
-  define_method(:m){}
-end
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  m; m; m; m; m; m; m; m;
-end
diff --git a/benchmark/bm_vm2_dstr.rb b/benchmark/bm_vm2_dstr.rb
deleted file mode 100644
index 58c0f7bbc3..0000000000
--- a/benchmark/bm_vm2_dstr.rb
+++ /dev/null
@@ -1,6 +0,0 @@
-i = 0
-x = y = 'z'
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  str = "foo#{x}bar#{y}baz"
-end
diff --git a/benchmark/bm_vm2_eval.rb b/benchmark/bm_vm2_eval.rb
deleted file mode 100644
index 307cfc28ef..0000000000
--- a/benchmark/bm_vm2_eval.rb
+++ /dev/null
@@ -1,6 +0,0 @@
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  eval("1")
-end
-
diff --git a/benchmark/bm_vm2_method.rb b/benchmark/bm_vm2_method.rb
deleted file mode 100644
index a8ccff7138..0000000000
--- a/benchmark/bm_vm2_method.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-def m
-  nil
-end
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  m; m; m; m; m; m; m; m;
-end
diff --git a/benchmark/bm_vm2_method_missing.rb b/benchmark/bm_vm2_method_missing.rb
deleted file mode 100644
index 2badc73101..0000000000
--- a/benchmark/bm_vm2_method_missing.rb
+++ /dev/null
@@ -1,12 +0,0 @@
-class C
-  def method_missing mid
-  end
-end
-
-obj = C.new
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m;
-end
diff --git a/benchmark/bm_vm2_method_with_block.rb b/benchmark/bm_vm2_method_with_block.rb
deleted file mode 100644
index b4efb4f520..0000000000
--- a/benchmark/bm_vm2_method_with_block.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-def m
-  nil
-end
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  m{}; m{}; m{}; m{}; m{}; m{}; m{}; m{};
-end
diff --git a/benchmark/bm_vm2_mutex.rb b/benchmark/bm_vm2_mutex.rb
deleted file mode 100644
index 5d16480c6b..0000000000
--- a/benchmark/bm_vm2_mutex.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-require 'thread'
-
-m = Thread::Mutex.new
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  m.synchronize{}
-end
diff --git a/benchmark/bm_vm2_newlambda.rb b/benchmark/bm_vm2_newlambda.rb
deleted file mode 100644
index 6422c9b0d0..0000000000
--- a/benchmark/bm_vm2_newlambda.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  lambda {}
-end
diff --git a/benchmark/bm_vm2_poly_method.rb b/benchmark/bm_vm2_poly_method.rb
deleted file mode 100644
index c82c0e4bce..0000000000
--- a/benchmark/bm_vm2_poly_method.rb
+++ /dev/null
@@ -1,20 +0,0 @@
-class C1
-  def m
-    1
-  end
-end
-class C2
-  def m
-    2
-  end
-end
-
-o1 = C1.new
-o2 = C2.new
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  o = (i % 2 == 0) ? o1 : o2
-  o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
-  i += 1
-end
diff --git a/benchmark/bm_vm2_poly_method_ov.rb b/benchmark/bm_vm2_poly_method_ov.rb
deleted file mode 100644
index aa5fd1dd38..0000000000
--- a/benchmark/bm_vm2_poly_method_ov.rb
+++ /dev/null
@@ -1,20 +0,0 @@
-class C1
-  def m
-    1
-  end
-end
-class C2
-  def m
-    2
-  end
-end
-
-o1 = C1.new
-o2 = C2.new
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  o = (i % 2 == 0) ? o1 : o2
-#  o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
-  i += 1
-end
diff --git a/benchmark/bm_vm2_proc.rb b/benchmark/bm_vm2_proc.rb
deleted file mode 100644
index 65e5217371..0000000000
--- a/benchmark/bm_vm2_proc.rb
+++ /dev/null
@@ -1,14 +0,0 @@
-def m &b
-  b
-end
-
-pr = m{
-  a = 1
-}
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  pr.call
-end
-
diff --git a/benchmark/bm_vm2_raise1.rb b/benchmark/bm_vm2_raise1.rb
deleted file mode 100644
index aa5387987f..0000000000
--- a/benchmark/bm_vm2_raise1.rb
+++ /dev/null
@@ -1,18 +0,0 @@
-def rec n
-  if n > 0
-    rec n-1
-  else
-    raise
-  end
-end
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-
-  begin
-    rec 1
-  rescue
-    # ignore
-  end
-end
diff --git a/benchmark/bm_vm2_raise2.rb b/benchmark/bm_vm2_raise2.rb
deleted file mode 100644
index 1f61c63157..0000000000
--- a/benchmark/bm_vm2_raise2.rb
+++ /dev/null
@@ -1,18 +0,0 @@
-def rec n
-  if n > 0
-    rec n-1
-  else
-    raise
-  end
-end
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-
-  begin
-    rec 10
-  rescue
-    # ignore
-  end
-end
diff --git a/benchmark/bm_vm2_regexp.rb b/benchmark/bm_vm2_regexp.rb
deleted file mode 100644
index 55f9e957a3..0000000000
--- a/benchmark/bm_vm2_regexp.rb
+++ /dev/null
@@ -1,6 +0,0 @@
-i = 0
-str = 'xxxhogexxx'
-while i<6_000_000 # benchmark loop 2
-  /hoge/ =~ str
-  i += 1
-end
diff --git a/benchmark/bm_vm2_send.rb b/benchmark/bm_vm2_send.rb
deleted file mode 100644
index 6a3ab6fdab..0000000000
--- a/benchmark/bm_vm2_send.rb
+++ /dev/null
@@ -1,12 +0,0 @@
-class C
-  def m
-  end
-end
-
-o = C.new
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  o.__send__ :m
-end
diff --git a/benchmark/bm_vm2_string_literal.rb b/benchmark/bm_vm2_string_literal.rb
deleted file mode 100644
index 1d73036849..0000000000
--- a/benchmark/bm_vm2_string_literal.rb
+++ /dev/null
@@ -1,5 +0,0 @@
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  x = "xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx"
-end
diff --git a/benchmark/bm_vm2_struct_big_aref_hi.rb b/benchmark/bm_vm2_struct_big_aref_hi.rb
deleted file mode 100644
index 22cb26b0a5..0000000000
--- a/benchmark/bm_vm2_struct_big_aref_hi.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(*('a'..'z').map { |x| x.to_sym })
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  x.z # x[25]
-end
diff --git a/benchmark/bm_vm2_struct_big_aref_lo.rb b/benchmark/bm_vm2_struct_big_aref_lo.rb
deleted file mode 100644
index 5e61a7087e..0000000000
--- a/benchmark/bm_vm2_struct_big_aref_lo.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(*('a'..'z').map { |x| x.to_sym })
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  x.k # x[10]
-end
diff --git a/benchmark/bm_vm2_struct_big_aset.rb b/benchmark/bm_vm2_struct_big_aset.rb
deleted file mode 100644
index 5a1c3d16f3..0000000000
--- a/benchmark/bm_vm2_struct_big_aset.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(*('a'..'z').map { |x| x.to_sym })
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  x.k = i # x[10] = i
-end
diff --git a/benchmark/bm_vm2_struct_big_href_hi.rb b/benchmark/bm_vm2_struct_big_href_hi.rb
deleted file mode 100644
index fff940a80a..0000000000
--- a/benchmark/bm_vm2_struct_big_href_hi.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(*('a'..'z').map { |x| x.to_sym })
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  x[:z]
-end
diff --git a/benchmark/bm_vm2_struct_big_href_lo.rb b/benchmark/bm_vm2_struct_big_href_lo.rb
deleted file mode 100644
index 5e4085d59d..0000000000
--- a/benchmark/bm_vm2_struct_big_href_lo.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(*('a'..'z').map { |x| x.to_sym })
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  x[:k]
-end
diff --git a/benchmark/bm_vm2_struct_big_hset.rb b/benchmark/bm_vm2_struct_big_hset.rb
deleted file mode 100644
index 9c0cee4141..0000000000
--- a/benchmark/bm_vm2_struct_big_hset.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(*('a'..'z').map { |x| x.to_sym })
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  x[:k] = i
-end
diff --git a/benchmark/bm_vm2_struct_small_aref.rb b/benchmark/bm_vm2_struct_small_aref.rb
deleted file mode 100644
index 8eaa555b41..0000000000
--- a/benchmark/bm_vm2_struct_small_aref.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(:a, :b, :c)
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  x.a
-end
diff --git a/benchmark/bm_vm2_struct_small_aset.rb b/benchmark/bm_vm2_struct_small_aset.rb
deleted file mode 100644
index ecd0f95669..0000000000
--- a/benchmark/bm_vm2_struct_small_aset.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(:a, :b, :c)
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  x.a = i
-end
diff --git a/benchmark/bm_vm2_struct_small_href.rb b/benchmark/bm_vm2_struct_small_href.rb
deleted file mode 100644
index 2c88fee6bf..0000000000
--- a/benchmark/bm_vm2_struct_small_href.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(:a, :b, :c)
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  x[:a]
-end
diff --git a/benchmark/bm_vm2_struct_small_hset.rb b/benchmark/bm_vm2_struct_small_hset.rb
deleted file mode 100644
index 33c36d20f1..0000000000
--- a/benchmark/bm_vm2_struct_small_hset.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-s = Struct.new(:a, :b, :c)
-x = s.new
-i = 0
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  x[:a] = 1
-end
diff --git a/benchmark/bm_vm2_super.rb b/benchmark/bm_vm2_super.rb
deleted file mode 100644
index afd8579e7b..0000000000
--- a/benchmark/bm_vm2_super.rb
+++ /dev/null
@@ -1,20 +0,0 @@
-
-class C
-  def m
-    1
-  end
-end
-
-class CC < C
-  def m
-    super()
-  end
-end
-
-obj = CC.new
-
-i = 0
-while i<6_000_000 # benchmark loop 2
-  obj.m
-  i += 1
-end
diff --git a/benchmark/bm_vm2_unif1.rb b/benchmark/bm_vm2_unif1.rb
deleted file mode 100644
index 1774625942..0000000000
--- a/benchmark/bm_vm2_unif1.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-i = 0
-def m a, b
-end
-
-while i<6_000_000 # benchmark loop 2
-  i += 1
-  m 100, 200
-end
diff --git a/benchmark/bm_vm2_zsuper.rb b/benchmark/bm_vm2_zsuper.rb
deleted file mode 100644
index 2a43e62217..0000000000
--- a/benchmark/bm_vm2_zsuper.rb
+++ /dev/null
@@ -1,20 +0,0 @@
-i = 0
-
-class C
-  def m a
-    1
-  end
-end
-
-class CC < C
-  def m a
-    super
-  end
-end
-
-obj = CC.new
-
-while i<6_000_000 # benchmark loop 2
-  obj.m 10
-  i += 1
-end
diff --git a/benchmark/bm_vm3_backtrace.rb b/benchmark/bm_vm3_backtrace.rb
deleted file mode 100644
index 0fbf73e1ca..0000000000
--- a/benchmark/bm_vm3_backtrace.rb
+++ /dev/null
@@ -1,22 +0,0 @@
-# get last backtrace
-
-begin
-  caller(0, 0)
-rescue ArgumentError
-  alias caller_orig caller
-  def caller lev, n
-    caller_orig(lev)[0..n]
-  end
-end
-
-def rec n
-  if n < 0
-    100_000.times{
-      caller(0, 1)
-    }
-  else
-    rec(n-1)
-  end
-end
-
-rec 50
diff --git a/benchmark/bm_vm3_clearmethodcache.rb b/benchmark/bm_vm3_clearmethodcache.rb
deleted file mode 100644
index 9661323cd2..0000000000
--- a/benchmark/bm_vm3_clearmethodcache.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-i = 0
-while i<200_000
-  i += 1
-
-  Class.new{
-    def m; end
-  }
-end
diff --git a/benchmark/bm_vm3_gc.rb b/benchmark/bm_vm3_gc.rb
deleted file mode 100644
index e668026915..0000000000
--- a/benchmark/bm_vm3_gc.rb
+++ /dev/null
@@ -1,6 +0,0 @@
-5000.times do
-  100.times do
-    {"xxxx"=>"yyyy"}
-  end
-  GC.start
-end
diff --git a/benchmark/bm_vm3_gc_old_full.rb b/benchmark/bm_vm3_gc_old_full.rb
deleted file mode 100644
index cfdfc8c5a5..0000000000
--- a/benchmark/bm_vm3_gc_old_full.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-old_object = Array.new(1_000_000){''}
-100.times do
-  GC.start
-end
diff --git a/benchmark/bm_vm3_gc_old_immediate.rb b/benchmark/bm_vm3_gc_old_immediate.rb
deleted file mode 100644
index ad22feb655..0000000000
--- a/benchmark/bm_vm3_gc_old_immediate.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-old_object = Array.new(1_000_000){''}
-30_000.times do
-  GC.start(full_mark: false, immediate_sweep: true)
-end
diff --git a/benchmark/bm_vm3_gc_old_lazy.rb b/benchmark/bm_vm3_gc_old_lazy.rb
deleted file mode 100644
index b74d44baf1..0000000000
--- a/benchmark/bm_vm3_gc_old_lazy.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-old_object = Array.new(1_000_000){''}
-30_000.times do
-  GC.start(full_mark: false, immediate_sweep: false)
-end
diff --git a/benchmark/bm_vm_symbol_block_pass.rb b/benchmark/bm_vm_symbol_block_pass.rb
deleted file mode 100644
index 1d433353e1..0000000000
--- a/benchmark/bm_vm_symbol_block_pass.rb
+++ /dev/null
@@ -1,13 +0,0 @@
-class C
-  1000.times {|i|
-    eval("def i#{i};end")
-  }
-end
-
-c = C.new
-m = C.instance_methods(false)
-5_000.times do
-  m.each do |n|
-    c.tap(&n)
-  end
-end
diff --git a/benchmark/bm_vm_thread_alive_check1.rb b/benchmark/bm_vm_thread_alive_check1.rb
deleted file mode 100644
index c993accdda..0000000000
--- a/benchmark/bm_vm_thread_alive_check1.rb
+++ /dev/null
@@ -1,6 +0,0 @@
-5_000.times{
-  t = Thread.new{}
-  while t.alive?
-    Thread.pass
-  end
-}
diff --git a/benchmark/bm_vm_thread_close.rb b/benchmark/bm_vm_thread_close.rb
deleted file mode 100644
index 3e9a265ce8..0000000000
--- a/benchmark/bm_vm_thread_close.rb
+++ /dev/null
@@ -1,6 +0,0 @@
-1000.times { Thread.new { sleep } }
-i = 0
-while i<100_000 # benchmark loop 3
-  i += 1
-  IO.pipe.each(&:close)
-end
diff --git a/benchmark/bm_vm_thread_create_join.rb b/benchmark/bm_vm_thread_create_join.rb
deleted file mode 100644
index 393cd45df9..0000000000
--- a/benchmark/bm_vm_thread_create_join.rb
+++ /dev/null
@@ -1,6 +0,0 @@
-i = 0
-while i<100_000 # benchmark loop 3
-  i += 1
-  Thread.new{
-  }.join
-end
diff --git a/benchmark/bm_vm_thread_mutex1.rb b/benchmark/bm_vm_thread_mutex1.rb
deleted file mode 100644
index 66e42c85e1..0000000000
--- a/benchmark/bm_vm_thread_mutex1.rb
+++ /dev/null
@@ -1,21 +0,0 @@
-# one thread, one mutex (no contention)
-
-require 'thread'
-m = Thread::Mutex.new
-r = 0
-max = 2000
-lmax = max * max
-(1..1).map{
-  Thread.new{
-    i = 0
-    while i<lmax
-      i += 1
-      m.synchronize{
-        r += 1
-      }
-    end
-  }
-}.each{|e|
-  e.join
-}
-raise r.to_s if r != max * max
diff --git a/benchmark/bm_vm_thread_mutex2.rb b/benchmark/bm_vm_thread_mutex2.rb
deleted file mode 100644
index 6e6c804c31..0000000000
--- a/benchmark/bm_vm_thread_mutex2.rb
+++ /dev/null
@@ -1,21 +0,0 @@
-# two threads, one mutex
-
-require 'thread'
-m = Thread::Mutex.new
-r = 0
-max = 2000
-lmax = (max * max)/2
-(1..2).map{
-  Thread.new{
-    i = 0
-    while i<lmax
-      i += 1
-      m.synchronize{
-        r += 1
-      }
-    end
-  }
-}.each{|e|
-  e.join
-}
-raise r.to_s if r != max * max
diff --git a/benchmark/bm_vm_thread_mutex3.rb b/benchmark/bm_vm_thread_mutex3.rb
deleted file mode 100644
index c750dc542a..0000000000
--- a/benchmark/bm_vm_thread_mutex3.rb
+++ /dev/null
@@ -1,20 +0,0 @@
-# 1000 threads, one mutex
-
-require 'thread'
-m = Thread::Mutex.new
-r = 0
-max = 2000
-(1..max).map{
-  Thread.new{
-    i = 0
-    while i<max
-      i += 1
-      m.synchronize{
-        r += 1
-      }
-    end
-  }
-}.each{|e|
-  e.join
-}
-raise r.to_s if r != max * max
diff --git a/benchmark/bm_vm_thread_pass.rb b/benchmark/bm_vm_thread_pass.rb
deleted file mode 100644
index b5b3c0bc85..0000000000
--- a/benchmark/bm_vm_thread_pass.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-# Plenty Thtread.pass
-# A performance may depend on GVL implementation.
-
-tmax = (ARGV.shift || 2).to_i
-lmax = 200_000 / tmax
-
-(1..tmax).map{
-  Thread.new{
-    lmax.times{
-      Thread.pass
-    }
-  }
-}.each{|t| t.join}
-
-
diff --git a/benchmark/bm_vm_thread_pass_flood.rb b/benchmark/bm_vm_thread_pass_flood.rb
deleted file mode 100644
index 27157d1a6f..0000000000
--- a/benchmark/bm_vm_thread_pass_flood.rb
+++ /dev/null
@@ -1,8 +0,0 @@
-1000.times{
-  Thread.new{loop{Thread.pass}}
-}
-
-i = 0
-while i<10000
-  i += 1
-end
diff --git a/benchmark/bm_vm_thread_pipe.rb b/benchmark/bm_vm_thread_pipe.rb
deleted file mode 100644
index 112a621905..0000000000
--- a/benchmark/bm_vm_thread_pipe.rb
+++ /dev/null
@@ -1,17 +0,0 @@
-# Measure small and plenty pipe read/write.
-# A performance may depend on GVL implementation.
-
-lmax = 100_000
-r, w = IO.pipe
-[Thread.new{
-  lmax.times{
-    w.write('a')
-  }
-  p "w:exit"
-}, Thread.new{
-  lmax.times{
-    r.read(1)
-  }
-  p "r:exit"
-}].each{|t| t.join}
-
diff --git a/benchmark/bm_vm_thread_queue.rb b/benchmark/bm_vm_thread_queue.rb
deleted file mode 100644
index 274ceda366..0000000000
--- a/benchmark/bm_vm_thread_queue.rb
+++ /dev/null
@@ -1,18 +0,0 @@
-require 'thread'
-
-n = 1_000_000
-q = Thread::Queue.new
-consumer = Thread.new{
-  while q.pop
-    # consuming
-  end
-}
-
-producer = Thread.new{
-  n.times{
-    q.push true
-  }
-  q.push nil
-}
-
-consumer.join
diff --git a/benchmark/driver.rb b/benchmark/driver.rb
deleted file mode 100644
index eb976b4a90..0000000000
--- a/benchmark/driver.rb
+++ /dev/null
@@ -1,427 +0,0 @@
-#
-# Ruby Benchmark driver
-#
-
-first = true
-
-begin
-  require 'optparse'
-rescue LoadError
-  if first
-    first = false
-    $:.unshift File.join(File.dirname(__FILE__), '../lib')
-    retry
-  else
-    raise
-  end
-end
-
-require 'benchmark'
-require 'pp'
-require 'tempfile'
-
-class BenchmarkDriver
-  def self.benchmark(opt)
-    driver = self.new(opt[:execs], opt[:dir], opt)
-    begin
-      driver.run
-    ensure
-      driver.show_results
-    end
-  end
-
-  def self.load(input, type, opt)
-    case type
-    when 'yaml'
-      require 'yaml'
-      h = YAML.load(input)
-    when 'json'
-      require 'json'
-      h = JSON.load(input)
-    else
-      h = eval(input.read)
-    end
-    obj = allocate
-    obj.instance_variable_set("@execs", h[:executables] || h["executables"])
-    obj.instance_variable_set("@results", h[:results] || h["results"])
-    obj.instance_variable_set("@opt", opt)
-    obj
-  end
-
-  def output *args
-    puts(*args)
-    @output and @output.puts(*args)
-  end
-
-  def message *args
-    output(*args) if @verbose
-  end
-
-  def message_print *args
-    if @verbose
-      print(*args)
-      STDOUT.flush
-      @output and @output.print(*args)
-    end
-  end
-
-  def progress_message *args
-    unless STDOUT.tty?
-      STDERR.print(*args)
-      STDERR.flush
-    end
-  end
-
-  def initialize execs, dir, opt = {}
-    @execs = execs.map{|e|
-      e.strip!
-      next if e.empty?
-
-      if /(.+)::(.+)/ =~ e
-        # ex) ruby-a::/path/to/ruby-a
-        label = $1.strip
-        path = $2
-        version = `#{path} -v`.chomp
-      else
-        path = e
-        version = label = `#{path} -v`.chomp
-      end
-      [path, label, version]
-    }.compact
-
-    @dir = dir
-    @repeat = opt[:repeat] || 1
-    @repeat = 1 if @repeat < 1
-    @pattern = opt[:pattern] || nil
-    @exclude = opt[:exclude] || nil
-    @verbose = opt[:quiet] ? false : (opt[:verbose] || false)
-    @output = opt[:output] ? open(opt[:output], 'w') : nil
-    @loop_wl1 = @loop_wl2 = nil
-    @ruby_arg = opt[:ruby_arg] || nil
-    @measure_target = opt[:measure_target]
-    @opt = opt
-
-    # [[name, [[r-1-1, r-1-2, ...], [r-2-1, r-2-2, ...]]], ...]
-    @results = []
-
-    if @verbose
-      @start_time = Time.now
-      message @start_time
-      @execs.each_with_index{|(path, label, version), i|
-        message "target #{i}: " + (label == version ? "#{label}" : "#{label} (#{version})") + " at \"#{path}\""
-      }
-      message "measure target: #{@measure_target}"
-    end
-  end
-
-  def adjusted_results name, results
-    s = nil
-    results.each_with_index{|e, i|
-      r = e.min
-      case name
-      when /^vm1_/
-        if @loop_wl1
-          r -= @loop_wl1[i]
-          r = 0 if r < 0
-          s = '*'
-        end
-      when /^vm2_/
-        if @loop_wl2
-          r -= @loop_wl2[i]
-          r = 0 if r < 0
-          s = '*'
-        end
-      end
-      yield r
-    }
-    s
-  end
-
-  def show_results
-    case @opt[:format]
-    when :tsv
-      strformat = "\t%1$s"
-      numformat = "\t%1$*2$.3f"
-      minwidth = 0
-      name_width = 0
-    when :markdown
-      markdown = true
-      strformat = "|%1$-*2$s"
-      numformat = "|%1$*2$.3f"
-    when :plain
-      strformat = " %1$-*2$s"
-      numformat = " %1$*2$.3f"
-    end
-
-    name_width ||= @results.map {|v,*| v.size}.max
-    minwidth ||= 7
-    width = @execs.map{|(_, v)| [v.size, minwidth].max}
-
-    output
-
-    if @verbose
-      message '-----------------------------------------------------------'
-      message 'raw data:'
-      message
-      message PP.pp(@results, "", 79)
-      message
-      message "Elapsed time: #{Time.now - @start_time} (sec)"
-    end
-
-    if rawdata_output = @opt[:rawdata_output]
-      h = {}
-      h[:cpuinfo] = File.read('/proc/cpuinfo') if File.exist?('/proc/cpuinfo')
-      h[:executables] = @execs
-      h[:results] = @results
-      if (type = File.extname(rawdata_output)).empty?
-        type = rawdata_output
-        rawdata_output = @output.path.sub(/\.[^.\/]+\z/, '') << '.' << rawdata_output
-      end
-      case type
-      when 'yaml'
-        require 'yaml'
-        h = YAML.dump(h)
-      when 'json'
-        require 'json'
-        h = JSON.pretty_generate(h)
-      else
-        require 'pp'
-        h = h.pretty_inspect
-      end
-      open(rawdata_output, 'w') {|f| f.puts h}
-    end
-
-    output '-----------------------------------------------------------'
-    output 'benchmark results:'
-
-    if @verbose and @repeat > 1
-      output "minimum results in each #{@repeat} measurements."
-    end
-
-    output({
-      real: "Execution time (sec)",
-      peak: "Memory usage (peak) (B)",
-      size: "Memory usage (last size) (B)",
-    }[@measure_target])
-    output if markdown
-    output ["name".ljust(name_width), @execs.map.with_index{|(_, v), i| sprintf(strformat, v, width[i])}].join("").rstrip
-    output ["-"*name_width, width.map{|n|":".rjust(n, "-")}].join("|") if markdown
-    @results.each{|v, result|
-      rets = []
-      s = adjusted_results(v, result){|r|
-        rets << sprintf(numformat, r, width[rets.size])
-      }
-      v += s if s
-      output [v.ljust(name_width), rets].join("")
-    }
-
-    if @execs.size > 1
-      output
-      output({
-        real: "Speedup ratio: compare with the result of `#{@execs[0][1]}' (greater is better)",
-        peak: "Memory consuming ratio (peak) with the result of `#{@execs[0][1]}' (greater is better)",
-        size: "Memory consuming ratio (size) with the result of `#{@execs[0][1]}' (greater is better)",
-      }[@measure_target])
-      output if markdown
-      output ["name".ljust(name_width), @execs[1..-1].map.with_index{|(_, v), i| sprintf(strformat, v, width[i])}].join("").rstrip
-      output ["-"*name_width, width[1..-1].map{|n|":".rjust(n, "-")}].join("|") if markdown
-      @results.each{|v, result|
-        rets = []
-        first_value = nil
-        s = adjusted_results(v, result){|r|
-          if first_value
-            if r == 0
-              rets << "Error"
-            else
-              rets << sprintf(numformat, first_value/Float(r), width[rets.size+1])
-            end
-          else
-            first_value = r
-          end
-        }
-        v += s if s
-        output [v.ljust(name_width), rets].join("")
-      }
-    end
-
-    if @opt[:output]
-      output
-      output "Log file: #{@opt[:output]}"
-    end
-  end
-
-  def files
-    flag = {}
-    @files = Dir.glob(File.join(@dir, 'bm*.rb')).map{|file|
-      next if @pattern && /#{@pattern}/ !~ File.basename(file)
-      next if @exclude && /#{@exclude}/ =~ File.basename(file)
-      case file
-      when /bm_(vm[12])_/, /bm_loop_(whileloop2?).rb/
-        flag[$1] = true
-      end
-      file
-    }.compact
-
-    if flag['vm1'] && !flag['whileloop']
-      @files << File.join(@dir, 'bm_loop_whileloop.rb')
-    elsif flag['vm2'] && !flag['whileloop2']
-      @files << File.join(@dir, 'bm_loop_whileloop2.rb')
-    end
-
-    @files.sort!
-    progress_message "total: #{@files.size * @repeat} trial(s) (#{@repeat} trial(s) for #{@files.size} benchmark(s))\n"
-    @files
-  end
-
-  def run
-    files.each_with_index{|file, i|
-      @i = i
-      r = measure_file(file)
-
-      if /bm_loop_whileloop.rb/ =~ file
-        @loop_wl1 = r[1].map{|e| e.min}
-      elsif /bm_loop_whileloop2.rb/ =~ file
-        @loop_wl2 = r[1].map{|e| e.min}
-      end
-    }
-  end
-
-  def measure_file file
-    name = File.basename(file, '.rb').sub(/^bm_/, '')
-    prepare_file = File.join(File.dirname(file), "prepare_#{name}.rb")
-    load prepare_file if FileTest.exist?(prepare_file)
-
-    if @verbose
-      output
-      output '-----------------------------------------------------------'
-      output name
-      output
-      output File.read(file)
-      output
-    end
-
-    result = [name]
-    result << @execs.map{|(e, v)|
-      (0...@repeat).map{
-        message_print "#{v}\t"
-        progress_message '.'
-
-        m = measure(e, file)
-        message "#{m}"
-        m
-      }
-    }
-    @results << result
-    result
-  end
-
-  unless defined?(File::NULL)
-    if File.exist?('/dev/null')
-      File::NULL = '/dev/null'
-    end
-  end
-
-  def measure executable, file
-    case @measure_target
-    when :real
-      cmd = "#{executable} #{@ruby_arg} #{file}"
-      m = Benchmark.measure{
-        system(cmd, out: File::NULL)
-      }
-      result = m.real
-    when :peak, :size
-      tmp = Tempfile.new("benchmark-memory-wrapper-data")
-      wrapper = "#{File.join(__dir__, 'memory_wrapper.rb')} #{tmp.path} #{@measure_target}"
-      cmd = "#{executable} #{@ruby_arg} #{wrapper} #{file}"
-      system(cmd, out: File::NULL)
-      result = tmp.read.to_i
-      tmp.close
-    else
-      raise "unknown measure target"
-    end
-
-    if $? != 0
-      raise $?.inspect if $? && $?.signaled?
-      output "\`#{cmd}\' exited with abnormal status (#{$?})"
-      0
-    else
-      result
-    end
-  end
-end
-
-if __FILE__ == $0
-  opt = {
-    :execs => [],
-    :dir => File.dirname(__FILE__),
-    :repeat => 1,
-    :measure_target => :real,
-    :output => nil,
-    :raw_output => nil,
-    :format => :tsv,
-  }
-  formats = {
-    :tsv => ".tsv",
-    :markdown => ".md",
-    :plain => ".txt",
-  }
-
-  parser = OptionParser.new{|o|
-    o.on('-e', '--executables [EXECS]',
-      "Specify benchmark one or more targets (e1::path1; e2::path2; e3::path3;...)"){|e|
-       e.split(/;/).each{|path|
-         opt[:execs] << path
-       }
-    }
-    o.on('-d', '--directory [DIRECTORY]', "Benchmark suites directory"){|d|
-      opt[:dir] = d
-    }
-    o.on('-p', '--pattern [PATTERN]', "Benchmark name pattern"){|p|
-      opt[:pattern] = p
-    }
-    o.on('-x', '--exclude [PATTERN]', "Benchmark exclude pattern"){|e|
-      opt[:exclude] = e
-    }
-    o.on('-r', '--repeat-count [NUM]', "Repeat count"){|n|
-      opt[:repeat] = n.to_i
-    }
-    o.on('-o', '--output-file [FILE]', "Output file"){|f|
-      opt[:output] = f
-    }
-    o.on('--ruby-arg [ARG]', "Optional argument for ruby"){|a|
-      opt[:ruby_arg] = a
-    }
-    o.on('--measure-target [TARGET]', 'real (execution time), peak, size (memory)'){|mt|
-      opt[:measure_target] = mt.to_sym
-    }
-    o.on('--rawdata-output [FILE]', 'output rawdata'){|r|
-      opt[:rawdata_output] = r
-    }
-    o.on('--load-rawdata=FILE', 'input rawdata'){|r|
-      opt[:rawdata_input] = r
-    }
-    o.on('-f', "--format=FORMAT", "output format (#{formats.keys.join(",")})", formats.keys){|r|
-      opt[:format] = r
-    }
-    o.on('-v', '--verbose'){|v|
-      opt[:verbose] = v
-    }
-    o.on('-q', '--quiet', "Run without notify information except result table."){|q|
-      opt[:quiet] = q
-      opt[:verbose] = false
-    }
-  }
-
-  parser.parse!(ARGV)
-  opt[:output] ||= "bmlog-#{Time.now.strftime('%Y%m%d-%H%M%S')}.#{$$}#{formats[opt[:format]]}"
-
-  if input = opt[:rawdata_input]
-    b = open(input) {|f|
-      BenchmarkDriver.load(f, File.extname(input)[1..-1], opt)
-    }
-    b.show_results
-  else
-    BenchmarkDriver.benchmark(opt)
-  end
-end
-
diff --git a/benchmark/gc/aobench.rb b/benchmark/gc/aobench.rb
deleted file mode 100644
index 2eed7abc83..0000000000
--- a/benchmark/gc/aobench.rb
+++ /dev/null
@@ -1 +0,0 @@
-require_relative '../bm_app_aobench.rb'
diff --git a/benchmark/gc/binary_trees.rb b/benchmark/gc/binary_trees.rb
deleted file mode 100644
index af8ea722aa..0000000000
--- a/benchmark/gc/binary_trees.rb
+++ /dev/null
@@ -1 +0,0 @@
-require_relative '../bm_so_binary_trees.rb'
diff --git a/benchmark/gc/gcbench.rb b/benchmark/gc/gcbench.rb
deleted file mode 100644
index 09a404466a..0000000000
--- a/benchmark/gc/gcbench.rb
+++ /dev/null
@@ -1,56 +0,0 @@
-require 'benchmark'
-require 'pp'
-require 'optparse'
-
-$list = true
-$gcprof = true
-
-opt = OptionParser.new
-opt.on('-q'){$list = false}
-opt.on('-d'){$gcprof = false}
-opt.parse!(ARGV)
-
-script = File.join(File.dirname(__FILE__), ARGV.shift)
-script += '.rb' unless FileTest.exist?(script)
-raise "#{script} not found" unless FileTest.exist?(script)
-
-puts "Script: #{script}"
-
-if $gcprof
-  GC::Profiler.enable
-end
-
-tms = Benchmark.measure{|x|
-  load script
-}
-
-gc_time = 0
-
-if $gcprof
-  gc_time = GC::Profiler.total_time
-  GC::Profiler.report if $list and RUBY_VERSION >= '2.0.0' # before 1.9.3, report() may run infinite loop
-  GC::Profiler.disable
-end
-
-pp GC.stat
-
-puts "#{RUBY_DESCRIPTION} #{GC::OPTS.inspect}" if defined?(GC::OPTS)
-
-desc = "#{RUBY_VERSION}#{RUBY_PATCHLEVEL >= 0 ? "p#{RUBY_PATCHLEVEL}" : "dev"}"
-name = File.basename(script, '.rb')
-
-puts
-puts script
-puts Benchmark::CAPTION
-puts tms
-puts "GC total time (sec): #{gc_time}"
-
-# show High-Water Mark on Linux
-if File.exist?('/proc/self/status') && /VmHWM:\s*(\d+.+)/ =~ File.read('/proc/self/status')
-  puts
-  puts "VmHWM: #{$1.chomp}"
-end
-
-puts
-puts "Summary of #{name} on #{desc}\t#{tms.real}\t#{gc_time}\t#{GC.count}"
-puts "         (real time in sec, GC time in sec, GC count)"
diff --git a/benchmark/gc/hash1.rb b/benchmark/gc/hash1.rb
deleted file mode 100644
index cb030d458d..0000000000
--- a/benchmark/gc/hash1.rb
+++ /dev/null
@@ -1,11 +0,0 @@
-value = 0.01
-h = {}
-n = 50_000
-
-1.upto(n){|i|
-  h["%020d" % i] = "v-#{i}"
-}
-
-(n * 1_000).times{
-  ''
-}
diff --git a/benchmark/gc/hash2.rb b/benchmark/gc/hash2.rb
deleted file mode 100644
index e8c943fb21..0000000000
--- a/benchmark/gc/hash2.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-value = 0.01
-h = {}
-n = 4*(10**6)
-
-1.upto(n){|i|
-  h["%020d" % i] = value * i
-}
diff --git a/benchmark/gc/null.rb b/benchmark/gc/null.rb
deleted file mode 100644
index c05a79f561..0000000000
--- a/benchmark/gc/null.rb
+++ /dev/null
@@ -1 +0,0 @@
-# null
diff --git a/benchmark/gc/pentomino.rb b/benchmark/gc/pentomino.rb
deleted file mode 100644
index 94ba74be89..0000000000
--- a/benchmark/gc/pentomino.rb
+++ /dev/null
@@ -1 +0,0 @@
-require_relative '../bm_app_pentomino.rb'
diff --git a/benchmark/gc/rdoc.rb b/benchmark/gc/rdoc.rb
deleted file mode 100644
index 14c89f5611..0000000000
--- a/benchmark/gc/rdoc.rb
+++ /dev/null
@@ -1,13 +0,0 @@
-require 'rdoc/rdoc'
-require 'tmpdir'
-
-srcdir = File.expand_path('../..', __dir__)
-
-Dir.mktmpdir('rdocbench-'){|d|
-  dir = File.join(d, 'rdocbench')
-  args = %W(--root #{srcdir} --page-dir #{srcdir}/doc --encoding=UTF-8 --no-force-update --all --ri --debug --quiet #{srcdir})
-  args << '--op' << dir
-
-  r = RDoc::RDoc.new
-  r.document args
-}
diff --git a/benchmark/gc/redblack.rb b/benchmark/gc/redblack.rb
deleted file mode 100644
index c66290140a..0000000000
--- a/benchmark/gc/redblack.rb
+++ /dev/null
@@ -1,366 +0,0 @@
-# This benchmark is imported from https://github.com/jruby/rubybench/blob/master/time/bench_red_black.rb
-# License is License is Apache-2
-
-require 'benchmark'
-
-# Algorithm based on "Introduction to Algorithms" by Cormen and others
-class RedBlackTree
-  class Node
-    attr_accessor :color
-    attr_accessor :key
-    attr_accessor :left
-    attr_accessor :right
-    attr_accessor :parent
-
-    RED = :red
-    BLACK = :black
-    COLORS = [RED, BLACK].freeze
-
-    def initialize(key, color = RED)
-      raise ArgumentError, "Bad value for color parameter" unless COLORS.include?(color)
-      @color = color
-      @key = key
-      @left = @right = @parent = NilNode.instance
-    end
-
-    def black?
-      return color == BLACK
-    end
-
-    def red?
-      return color == RED
-    end
-  end
-
-  class NilNode < Node
-    class << self
-      private :new
-
-      # it's not thread safe
-      def instance
-        @instance ||= begin
-          def instance
-            return @instance
-          end
-
-          new
-        end
-      end
-    end
-
-    def initialize
-      self.color = BLACK
-      self.key = 0
-      self.left = nil
-      self.right = nil
-      self.parent = nil
-    end
-
-    def nil?
-      return true
-    end
-  end
-
-  include Enumerable
-
-  attr_accessor :root
-  attr_accessor :size
-
-  def initialize
-    self.root = NilNode.instance
-    self.size = 0
-  end
-
-  def add(key)
-    insert(Node.new(key))
-  end
-
-  def insert(x)
-    insert_helper(x)
-
-    x.color = Node::RED
-    while x != root && x.parent.color == Node::RED
-      if x.parent == x.parent.parent.left
-        y = x.parent.parent.right
-        if !y.nil? && y.color == Node::RED
-          x.parent.color = Node::BLACK
-          y.color = Node::BLACK
-          x.parent.parent.color = Node::RED
-          x = x.parent.parent
-        else
-          if x == x.parent.right
-            x = x.parent
-            left_rotate(x)
-          end
-          x.parent.color = Node::BLACK
-          x.parent.parent.color = Node::RED
-          right_rotate(x.parent.parent)
-        end
-      else
-        y = x.parent.parent.left
-        if !y.nil? && y.color == Node::RED
-          x.parent.color = Node::BLACK
-          y.color = Node::BLACK
-          x.parent.parent.color = Node::RED
-          x = x.parent.parent
-        else
-          if x == x.parent.left
-            x = x.parent
-            right_rotate(x)
-          end
-          x.parent.color = Node::BLACK
-          x.parent.parent.color = Node::RED
-          left_rotate(x.parent.parent)
-        end
-      end
-    end
-    root.color = Node::BLACK
-  end
-
-  alias << insert
-
-  def delete(z)
-    y = (z.left.nil? || z.right.nil?) ? z : successor(z)
-    x = y.left.nil? ? y.right : y.left
-    x.parent = y.parent
-
-    if y.parent.nil?
-      self.root = x
-    else
-      if y == y.parent.left
-        y.parent.left = x
-      else
-        y.parent.right = x
-      end
-    end
-
-    z.key = y.key if y != z
-
-    if y.color == Node::BLACK
-      delete_fixup(x)
-    end
-
-    self.size -= 1
-    return y
-  end
-
-  def minimum(x = root)
-    while !x.left.nil?
-      x = x.left
-    end
-    return x
-  end
-
-  def maximum(x = root)
-    while !x.right.nil?
-      x = x.right
-    end
-    return x
-  end
-
-  def successor(x)
-    if !x.right.nil?
-      return minimum(x.right)
-    end
-    y = x.parent
-    while !y.nil? && x == y.right
-      x = y
-      y = y.parent
-    end
-    return y
-  end
-
-  def predecessor(x)
-    if !x.left.nil?
-      return maximum(x.left)
-    end
-    y = x.parent
-    while !y.nil? && x == y.left
-      x = y
-      y = y.parent
-    end
-    return y
-  end
-
-  def inorder_walk(x = root)
-    x = self.minimum
-    while !x.nil?
-      yield x.key
-      x = successor(x)
-    end
-  end
-
-  alias each inorder_walk
-
-  def reverse_inorder_walk(x = root)
-    x = self.maximum
-    while !x.nil?
-      yield x.key
-      x = predecessor(x)
-    end
-  end
-
-  alias reverse_each reverse_inorder_walk
-
-  def search(key, x = root)
-    while !x.nil? && x.key != key
-      key < x.key ? x = x.left : x = x.right
-    end
-    return x
-  end
-
-  def empty?
-    return self.root.nil?
-  end
-
-  def black_height(x = root)
-    height = 0
-    while !x.nil?
-      x = x.left
-      height +=1 if x.nil? || x.black?
-    end
-    return height
-  end
-
-private
-
-  def left_rotate(x)
-    raise "x.right is nil!" if x.right.nil?
-    y = x.right
-    x.right = y.left
-    y.left.parent = x if !y.left.nil?
-    y.parent = x.parent
-    if x.parent.nil?
-      self.root = y
-    else
-      if x == x.parent.left
-        x.parent.left = y
-      else
-        x.parent.right = y
-      end
-    end
-    y.left = x
-    x.parent = y
-  end
-
-  def right_rotate(x)
-    raise "x.left is nil!" if x.left.nil?
-    y = x.left
-    x.left = y.right
-    y.right.parent = x if !y.right.nil?
-    y.parent = x.parent
-    if x.parent.nil?
-      self.root = y
-    else
-      if x == x.parent.left
-        x.parent.left = y
-      else
-        x.parent.right = y
-      end
-    end
-    y.right = x
-    x.parent = y
-  end
-
-  def insert_helper(z)
-    y = NilNode.instance
-    x = root
-    while !x.nil?
-      y = x
-      z.key < x.key ? x = x.left : x = x.right
-    end
-    z.parent = y
-    if y.nil?
-      self.root = z
-    else
-      z.key < y.key ? y.left = z : y.right = z
-    end
-    self.size += 1
-  end
-
-  def delete_fixup(x)
-    while x != root && x.color == Node::BLACK
-      if x == x.parent.left
-        w = x.parent.right
-        if w.color == Node::RED
-          w.color = Node::BLACK
-          x.parent.color = Node::RED
-          left_rotate(x.parent)
-          w = x.parent.right
-        end
-        if w.left.color == Node::BLACK && w.right.color == Node::BLACK
-          w.color = Node::RED
-          x = x.parent
-        else
-          if w.right.color == Node::BLACK
-            w.left.color = Node::BLACK
-            w.color = Node::RED
-            right_rotate(w)
-            w = x.parent.right
-          end
-          w.color = x.parent.color
-          x.parent.color = Node::BLACK
-          w.right.color = Node::BLACK
-          left_rotate(x.parent)
-          x = root
-        end
-      else
-        w = x.parent.left
-        if w.color == Node::RED
-          w.color = Node::BLACK
-          x.parent.color = Node::RED
-          right_rotate(x.parent)
-          w = x.parent.left
-        end
-        if w.right.color == Node::BLACK && w.left.color == Node::BLACK
-          w.color = Node::RED
-          x = x.parent
-        else
-          if w.left.color == Node::BLACK
-            w.right.color = Node::BLACK
-            w.color = Node::RED
-            left_rotate(w)
-            w = x.parent.left
-          end
-          w.color = x.parent.color
-          x.parent.color = Node::BLACK
-          w.left.color = Node::BLACK
-          right_rotate(x.parent)
-          x = root
-        end
-      end
-    end
-    x.color = Node::BLACK
-  end
-end
-
-def rbt_bm
-  n = 100_000
-  a1 = []; n.times { a1 << rand(999_999) }
-  a2 = []; n.times { a2 << rand(999_999) }
-
-  start = Time.now
-
-  tree = RedBlackTree.new
-
-  n.times {|i| tree.add(i) }
-  n.times { tree.delete(tree.root) }
-
-  tree = RedBlackTree.new
-  a1.each {|e| tree.add(e) }
-  a2.each {|e| tree.search(e) }
-  tree.inorder_walk {|key| key + 1 }
-  tree.reverse_inorder_walk {|key| key + 1 }
-  n.times { tree.minimum }
-  n.times { tree.maximum }
-
-  return Time.now - start
-end
-
-N = (ARGV[0] || 10).to_i
-
-N.times do
-  # puts rbt_bm.to_f
-  rbt_bm.to_f
-  # puts "GC.count = #{GC.count}" if GC.respond_to?(:count)
-end
diff --git a/benchmark/gc/ring.rb b/benchmark/gc/ring.rb
deleted file mode 100644
index be2c7b7250..0000000000
--- a/benchmark/gc/ring.rb
+++ /dev/null
@@ -1,29 +0,0 @@
-# create many old objects
-
-max = 30_000_000
-
-class Ring
-  attr_reader :next_ring
-  def initialize n = nil
-    @next_ring = n
-  end
-
-
-  def size
-    s = 1
-    ring = self
-    while ring.next_ring
-      s += 1
-      ring = ring.next_ring
-    end
-    s
-  end
-end
-
-ring = Ring.new
-
-max.times{
-  ring = Ring.new(ring)
-}
-
-# p ring.size
diff --git a/benchmark/make_fasta_output.rb b/benchmark/make_fasta_output.rb
deleted file mode 100644
index b6d787ae27..0000000000
--- a/benchmark/make_fasta_output.rb
+++ /dev/null
@@ -1,19 +0,0 @@
-# prepare 'fasta.output'
-
-def prepare_fasta_output n
-  filebase = File.join(File.dirname($0), 'fasta.output')
-  script = File.join(File.dirname($0), 'bm_so_fasta.rb')
-  file = "#{filebase}.#{n}"
-
-  unless FileTest.exist?(file)
-    STDERR.puts "preparing #{file}"
-
-    open(file, 'w'){|f|
-      ARGV[0] = n
-      $stdout = f
-      load script
-      $stdout = STDOUT
-    }
-  end
-end
-
diff --git a/benchmark/memory_wrapper.rb b/benchmark/memory_wrapper.rb
deleted file mode 100644
index 3f4451a037..0000000000
--- a/benchmark/memory_wrapper.rb
+++ /dev/null
@@ -1,16 +0,0 @@
-
-write_file, target, script_file = ARGV
-
-load(script_file)
-require_relative '../test/lib/memory_status'
-open(write_file, 'wb'){|f|
-  ms = Memory::Status.new
-  case target.to_sym
-  when :peak
-    key = ms.respond_to?(:hwm) ? :hwm : :peak
-  when :size
-    key = ms.respond_to?(:rss) ? :rss : :size
-  end
-
-  f.puts ms[key]
-}
diff --git a/benchmark/other-lang/ack.pl b/benchmark/other-lang/ack.pl
deleted file mode 100644
index 201e22ddfa..0000000000
--- a/benchmark/other-lang/ack.pl
+++ /dev/null
@@ -1,11 +0,0 @@
-use integer;
-
-sub Ack {
-    return $_[0] ? ($_[1] ? Ack($_[0]-1, Ack($_[0], $_[1]-1))
-		    : Ack($_[0]-1, 1))
-	: $_[1]+1;
-}
-
-my $NUM = 9;
-$NUM = 1 if ($NUM < 1);
-my $ack = Ack(3, $NUM);
diff --git a/benchmark/other-lang/ack.py b/benchmark/other-lang/ack.py
deleted file mode 100644
index 9968e7cfcf..0000000000
--- a/benchmark/other-lang/ack.py
+++ /dev/null
@@ -1,16 +0,0 @@
-import sys
-sys.setrecursionlimit(5000000)
-
-def Ack(M, N):
-    if (not M):
-        return( N + 1 )
-    if (not N):
-        return( Ack(M-1, 1) )
-    return( Ack(M-1, Ack(M, N-1)) )
-
-def main():
-    NUM = 9
-    sys.setrecursionlimit(10000)
-    Ack(3, NUM)
-
-main()
diff --git a/benchmark/other-lang/ack.rb b/benchmark/other-lang/ack.rb
deleted file mode 100644
index 7451bed6c4..0000000000
--- a/benchmark/other-lang/ack.rb
+++ /dev/null
@@ -1,12 +0,0 @@
-def ack(m, n)
-    if m == 0 then
-        n + 1
-    elsif n == 0 then
-        ack(m - 1, 1)
-    else
-        ack(m - 1, ack(m, n - 1))
-    end
-end
-
-NUM = 9
-ack(3, NUM)
diff --git a/benchmark/other-lang/ack.scm b/benchmark/other-lang/ack.scm
deleted file mode 100644
index a80b73ba55..0000000000
--- a/benchmark/other-lang/ack.scm
+++ /dev/null
@@ -1,7 +0,0 @@
-(define (ack m n)
-  (cond ((zero? m) (+ n 1))
-	((zero? n) (ack (- m 1) 1))
-	(else      (ack (- m 1) (ack m (- n 1))))))
-
-(ack 3 9)
-
diff --git a/benchmark/other-lang/eval.rb b/benchmark/other-lang/eval.rb
deleted file mode 100644
index 48a2cea019..0000000000
--- a/benchmark/other-lang/eval.rb
+++ /dev/null
@@ -1,66 +0,0 @@
-
-Bench = %w(
-  loop
-  ack
-  fib
-  tak
-  fact
-)
-
-Lang = <<EOP.map{|l| l.strip}
-  ruby-cyg
-  ../../../test6/miniruby
-  perl
-  python
-  gosh
-EOP
-
-Bench.replace ['loop2']
-Lang.replace ['ruby-cyg']
-
-Ext = %w(
-  .rb
-  .rb
-  .pl
-  .py
-  .scm
-)
-
-p Bench
-p Lang
-
-require 'benchmark'
-
-def bench cmd
-  m = Benchmark.measure{
-    #p cmd
-    system(cmd)
-  }
-  [m.utime, m.real]
-end
-
-Result = []
-Bench.each{|b|
-  r = []
-  Lang.each_with_index{|l, idx|
-    cmd = "#{l} #{b}#{Ext[idx]}"
-    r << bench(cmd)
-  }
-  Result << r
-}
-
-require 'pp'
-# utime
-puts Lang.join("\t")
-Bench.each_with_index{|b, bi|
-  print b, "\t"
-  puts Result[bi].map{|e| e[0]}.join("\t")
-}
-
-# rtime
-puts Lang.join("\t")
-Bench.each_with_index{|b, bi|
-  print b, "\t"
-  puts Result[bi].map{|e| e[1]}.join("\t")
-}
-
diff --git a/benchmark/other-lang/fact.pl b/benchmark/other-lang/fact.pl
deleted file mode 100644
index a9b0b69cdf..0000000000
--- a/benchmark/other-lang/fact.pl
+++ /dev/null
@@ -1,13 +0,0 @@
-sub fact{
-  my $n = @_[0];
-  if($n < 2){
-    return 1;
-  }
-  else{
-    return $n * fact($n-1);
-  }
-}
-
-for($i=0; $i<10000; $i++){
-  &fact(100);
-}
diff --git a/benchmark/other-lang/fact.py b/benchmark/other-lang/fact.py
deleted file mode 100644
index 01593965d9..0000000000
--- a/benchmark/other-lang/fact.py
+++ /dev/null
@@ -1,18 +0,0 @@
-#import sys
-#sys.setrecursionlimit(1000)
-
-def factL(n):
-	r = 1
-	for x in range(2, n):
-		r *= x
-	return r
-
-def factR(n):
-	if n < 2:
-		return 1
-	else:
-		return n * factR(n-1)
-
-for i in range(10000):
-	factR(100)
-
diff --git a/benchmark/other-lang/fact.rb b/benchmark/other-lang/fact.rb
deleted file mode 100644
index 6cedc752cd..0000000000
--- a/benchmark/other-lang/fact.rb
+++ /dev/null
@@ -1,13 +0,0 @@
-def fact(n)
-  if n < 2
-    1
-  else
-    n * fact(n-1)
-  end
-end
-
-i = 0
-while i<10000
-  i += 1
-  fact(100)
-end
diff --git a/benchmark/other-lang/fact.scm b/benchmark/other-lang/fact.scm
deleted file mode 100644
index c98a7fedd3..0000000000
--- a/benchmark/other-lang/fact.scm
+++ /dev/null
@@ -1,8 +0,0 @@
-(define (fact n)
-        (if (< n 2)
-            1
-          (* n (fact (- n 1)))))
-
-(dotimes (i 10000)
-  (fact 100))
-
diff --git a/benchmark/other-lang/fib.pl b/benchmark/other-lang/fib.pl
deleted file mode 100644
index a46f666d1e..0000000000
--- a/benchmark/other-lang/fib.pl
+++ /dev/null
@@ -1,11 +0,0 @@
-sub fib{
-  my $n = $_[0];
-  if($n < 3){
-    return 1;
-  }
-  else{
-    return fib($n-1) + fib($n-2);
-  }
-};
-
-&fib(34);
diff --git a/benchmark/other-lang/fib.py b/benchmark/other-lang/fib.py
deleted file mode 100644
index 45f2bceb8d..0000000000
--- a/benchmark/other-lang/fib.py
+++ /dev/null
@@ -1,7 +0,0 @@
-def fib(n):
-  if n < 3:
-    return 1
-  else:
-    return fib(n-1) + fib(n-2)
-
-fib(34)
diff --git a/benchmark/other-lang/fib.rb b/benchmark/other-lang/fib.rb
deleted file mode 100644
index ec587eabe0..0000000000
--- a/benchmark/other-lang/fib.rb
+++ /dev/null
@@ -1,9 +0,0 @@
-def fib n
-  if n < 3
-    1
-  else
-    fib(n-1) + fib(n-2)
-  end
-end
-
-fib(34)
diff --git a/benchmark/other-lang/fib.scm b/benchmark/other-lang/fib.scm
deleted file mode 100644
index 2fc4e225bd..0000000000
--- a/benchmark/other-lang/fib.scm
+++ /dev/null
@@ -1,7 +0,0 @@
-(define (fib n)
-        (if (< n 3)
-            1
-          (+ (fib (- n 1)) (fib (- n 2)))))
-
-(fib 34)
-
diff --git a/benchmark/other-lang/loop.pl b/benchmark/other-lang/loop.pl
deleted file mode 100644
index 2777490aaa..0000000000
--- a/benchmark/other-lang/loop.pl
+++ /dev/null
@@ -1,3 +0,0 @@
-for($i=0; $i<30000000; $i++){
-}
-
diff --git a/benchmark/other-lang/loop.py b/benchmark/other-lang/loop.py
deleted file mode 100644
index 003749bf3a..0000000000
--- a/benchmark/other-lang/loop.py
+++ /dev/null
@@ -1,2 +0,0 @@
-for i in xrange(30000000):
-	pass
diff --git a/benchmark/other-lang/loop.rb b/benchmark/other-lang/loop.rb
deleted file mode 100644
index b367b9dbf3..0000000000
--- a/benchmark/other-lang/loop.rb
+++ /dev/null
@@ -1,4 +0,0 @@
-i = 0
-while i<30000000
-  i += 1
-end
diff --git a/benchmark/other-lang/loop.scm b/benchmark/other-lang/loop.scm
deleted file mode 100644
index 3364f7e679..0000000000
--- a/benchmark/other-lang/loop.scm
+++ /dev/null
@@ -1 +0,0 @@
-(dotimes (x 30000000))
diff --git a/benchmark/other-lang/loop2.rb b/benchmark/other-lang/loop2.rb
deleted file mode 100644
index df8fffc1ff..0000000000
--- a/benchmark/other-lang/loop2.rb
+++ /dev/null
@@ -1 +0,0 @@
-30000000.times{}
diff --git a/benchmark/other-lang/tak.pl b/benchmark/other-lang/tak.pl
deleted file mode 100644
index 7e748a67c6..0000000000
--- a/benchmark/other-lang/tak.pl
+++ /dev/null
@@ -1,11 +0,0 @@
-sub tak {
-    local($x, $y, $z) = @_;
-    if (!($y < $x)) {
-	return $z;
-    } else {
-	return &tak(&tak($x - 1, $y, $z),
-		    &tak($y - 1, $z, $x),
-		    &tak($z - 1, $x, $y));
-    }
-}
-&tak(18, 9, 0);
diff --git a/benchmark/other-lang/tak.py b/benchmark/other-lang/tak.py
deleted file mode 100644
index 04f3f6829c..0000000000
--- a/benchmark/other-lang/tak.py
+++ /dev/null
@@ -1,8 +0,0 @@
-def tak(x, y, z):
-	if not(y<x):
-		return z
-	else:
-		return tak(tak(x-1, y, z),
-		           tak(y-1, z, x),
-		           tak(z-1, x, y))
-tak(18, 9, 0)
diff --git a/benchmark/other-lang/tak.rb b/benchmark/other-lang/tak.rb
deleted file mode 100644
index efe5380f4e..0000000000
--- a/benchmark/other-lang/tak.rb
+++ /dev/null
@@ -1,13 +0,0 @@
-
-def tak x, y, z
-  unless y < x
-    z
-  else
-    tak( tak(x-1, y, z),
-         tak(y-1, z, x),
-         tak(z-1, x, y))
-  end
-end
-
-tak(18, 9, 0)
-
diff --git a/benchmark/other-lang/tak.scm b/benchmark/other-lang/tak.scm
deleted file mode 100644
index 52a7629ee5..0000000000
--- a/benchmark/other-lang/tak.scm
+++ /dev/null
@@ -1,10 +0,0 @@
-(define (tak x y z)
-        (if (not (< y x))
-            z
-          (tak (tak (- x 1) y z)
-               (tak (- y 1) z x)
-               (tak (- z 1) x y))))
-
-(tak 18 9 0)
-
-
diff --git a/benchmark/prepare_require.rb b/benchmark/prepare_require.rb
deleted file mode 100644
index c4786f04ad..0000000000
--- a/benchmark/prepare_require.rb
+++ /dev/null
@@ -1,25 +0,0 @@
-require "fileutils"
-
-def prepare
-  num_files = 10000
-
-  basename = File.dirname($0)
-  data_dir = File.join(basename, "bm_require.data")
-
-  # skip if all of files exists
-  if File.exist?(File.join(data_dir, "c#{num_files}.rb"))
-    return
-  end
-
-  FileUtils.mkdir_p(data_dir)
-
-  1.upto(num_files) do |i|
-    f = File.open("#{data_dir}/c#{i}.rb", "w")
-    f.puts <<-END
-      class C#{i}
-      end
-    END
-  end
-end
-
-prepare
diff --git a/benchmark/prepare_require_thread.rb b/benchmark/prepare_require_thread.rb
deleted file mode 100644
index 339ecb8b39..0000000000
--- a/benchmark/prepare_require_thread.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-load File.join(File.dirname(__FILE__), "prepare_require.rb")
-
diff --git a/benchmark/prepare_so_count_words.rb b/benchmark/prepare_so_count_words.rb
deleted file mode 100644
index ee2138cdb2..0000000000
--- a/benchmark/prepare_so_count_words.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-# prepare 'wc.input'
-
-def prepare_wc_input
-  wcinput = File.join(File.dirname($0), 'wc.input')
-  wcbase  = File.join(File.dirname($0), 'wc.input.base')
-  unless FileTest.exist?(wcinput)
-    data = File.read(wcbase)
-    13.times{
-      data << data
-    }
-    open(wcinput, 'w'){|f| f.write data}
-  end
-end
-
-prepare_wc_input
diff --git a/benchmark/prepare_so_k_nucleotide.rb b/benchmark/prepare_so_k_nucleotide.rb
deleted file mode 100644
index d83aeb7a7e..0000000000
--- a/benchmark/prepare_so_k_nucleotide.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-require_relative 'make_fasta_output'
-prepare_fasta_output(100_000)
diff --git a/benchmark/prepare_so_reverse_complement.rb b/benchmark/prepare_so_reverse_complement.rb
deleted file mode 100644
index da3ec2df14..0000000000
--- a/benchmark/prepare_so_reverse_complement.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-require_relative 'make_fasta_output'
-prepare_fasta_output(2_500_000)
diff --git a/benchmark/report.rb b/benchmark/report.rb
deleted file mode 100644
index d2dc56b1e1..0000000000
--- a/benchmark/report.rb
+++ /dev/null
@@ -1,79 +0,0 @@
-#
-# YARV benchmark driver
-#
-
-require 'yarvutil'
-require 'benchmark'
-require 'rbconfig'
-
-def exec_command type, file, w
-  <<-EOP
-  $DRIVER_PATH = '#{File.dirname($0)}'
-  $LOAD_PATH.replace $LOAD_PATH | #{$LOAD_PATH.inspect}
-  require 'benchmark'
-  require 'yarvutil'
-#  print '#{type}'
-  begin
-    puts Benchmark.measure{
-      #{w}('#{file}')
-    }.utime
-  rescue Exception => exec_command_error_variable
-    puts "\t" + exec_command_error_variable.message
-  end
-  EOP
-end
-
-def benchmark cmd
-  rubybin = ENV['RUBY'] || RbConfig.ruby
-
-  IO.popen(rubybin, 'r+'){|io|
-    io.write cmd
-    io.close_write
-    return io.gets
-  }
-end
-
-def ruby_exec file
-  prog = exec_command 'ruby', file, 'load'
-  benchmark prog
-end
-
-def yarv_exec file
-  prog = exec_command 'yarv', file, 'YARVUtil.load_bm'
-  benchmark prog
-end
-
-$wr = $wy = nil
-
-def measure bench
-  file = File.dirname($0) + "/bm_#{bench}.rb"
-  r = ruby_exec(file).to_f
-  y = yarv_exec(file).to_f
-  puts "#{bench}\t#{r}\t#{y}"
-end
-
-def measure2
-  r = ruby_exec.to_f
-  y = yarv_exec.to_f
-  puts r/y
-end
-
-if $0 == __FILE__
-  %w{
-    whileloop
-    whileloop2
-    times
-    const
-    method
-    poly_method
-    block
-    rescue
-    rescue2
-  }.each{|bench|
-    measure bench
-  }
-end
-
-
-
-
diff --git a/benchmark/run.rb b/benchmark/run.rb
deleted file mode 100644
index 0cd2363849..0000000000
--- a/benchmark/run.rb
+++ /dev/null
@@ -1,127 +0,0 @@
-#
-# Ruby benchmark driver
-#
-
-require 'benchmark'
-require 'rbconfig'
-
-$matzrubyonly = false
-$rubyonly = false
-
-$results  = []
-
-# prepare 'wc.input'
-def prepare_wc_input
-  wcinput = File.join(File.dirname($0), 'wc.input')
-  wcbase  = File.join(File.dirname($0), 'wc.input.base')
-  unless FileTest.exist?(wcinput)
-    data = File.read(wcbase)
-    13.times{
-      data << data
-    }
-    open(wcinput, 'w'){|f| f.write data}
-  end
-end
-
-prepare_wc_input
-
-def bm file
-  prog = File.readlines(file).map{|e| e.rstrip}.join("\n")
-  return if prog.empty?
-
-  /[a-z]+_(.+)\.rb/ =~ file
-  bm_name = $1
-  puts '-----------------------------------------------------------' unless $rubyonly || $matzrubyonly
-  puts "#{bm_name}: "
-
-
-puts <<EOS unless $matzrubyonly || $rubyonly
-#{prog}
---
-EOS
-  begin
-    result = [bm_name]
-    result << matzruby_exec(file) unless $rubyonly
-    result << ruby_exec(file) unless $matzrubyonly
-    $results << result
-
-  rescue Exception => e
-    puts
-    puts "** benchmark failure: #{e}"
-    puts e.backtrace
-  end
-end
-
-def benchmark file, bin
-  m = Benchmark.measure{
-    `#{bin} #{$opts} #{file}`
-  }
-  sec = '%.3f' % m.real
-  puts " #{sec}"
-  sec
-end
-
-def ruby_exec file
-  print 'ruby'
-  benchmark file, $ruby_program
-end
-
-def matzruby_exec file
-  print 'matz'
-  rubylib = ENV['RUBYLIB']
-  ENV['RUBYLIB'] = ''
-  r = benchmark file, $matzruby_program
-  ENV['RUBYLIB'] = rubylib
-  r
-end
-
-if $0 == __FILE__
-  ARGV.each{|arg|
-    case arg
-    when /\A--ruby=(.+)/
-      $ruby_program = $1
-    when /\A--matzruby=(.+)/
-      $matzruby_program = $1
-    when /\A--opts=(.+)/
-      $opts = $1
-    when /\A(-r|--only-ruby)\z/
-      $rubyonly = true
-    when /\A(-m|--only-matzruby)\z/
-      $matzrubyonly = true
-    end
-  }
-  ARGV.delete_if{|arg|
-    /\A-/ =~ arg
-  }
-
-  puts "MatzRuby:"
-  system("#{$matzruby_program} -v")
-  puts "Ruby:"
-  system("#{$ruby_program} -v")
-  puts
-
-  if ARGV.empty?
-    Dir.glob(File.dirname(__FILE__) + '/bm_*.rb').sort.each{|file|
-      bm file
-    }
-  else
-    ARGV.each{|file|
-      Dir.glob(File.join(File.dirname(__FILE__), file + '*')){|ef|
-        # file = "#{File.dirname(__FILE__)}/#{file}.rb"
-        bm ef
-      }
-    }
-  end
-
-  puts
-  puts "-- benchmark summary ---------------------------"
-  $results.each{|res|
-    print res.shift, "\t"
-    (res||[]).each{|result|
-      /([\d\.]+)/ =~ result
-      print $1 + "\t" if $1
-    }
-    puts
-  }
-end
-
diff --git a/benchmark/runc.rb b/benchmark/runc.rb
deleted file mode 100644
index 97c5cef045..0000000000
--- a/benchmark/runc.rb
+++ /dev/null
@@ -1,27 +0,0 @@
-#
-#
-#
-
-require 'benchmark'
-require 'rbconfig'
-
-$rubybin = ENV['RUBY'] || RbConfig.ruby
-
-def runfile file
-  puts file
-  file = File.join(File.dirname($0), 'contrib', file)
-  Benchmark.bm{|x|
-    x.report('ruby'){
-      system("#{$rubybin} #{file}")
-    }
-    x.report('yarv'){
-      system("#{$rubybin} -rite -I.. #{file}")
-    }
-  }
-end
-
-ARGV.each{|file|
-  runfile file
-}
-
-
diff --git a/benchmark/wc.input.base b/benchmark/wc.input.base
deleted file mode 100644
index 41143fbac0..0000000000
--- a/benchmark/wc.input.base
+++ /dev/null
@@ -1,25 +0,0 @@
-Subject:      Re: Who was Izchak Miller?
-From:         "Jane D. Anonymous" <nobody@yale.edu>
-Date:         1996/04/28
-Message-Id:   <4lv7bc$oh@news.ycc.yale.edu>
-References:   <317C405E.5DFA@panix.com> <4lk6vl$gde@ns.oar.net>
-To:           75176.2330@compuserve.com
-Content-Type: text/plain; charset=us-ascii
-Organization: Yale University
-X-Url:        news:4lk6vl$gde@ns.oar.net
-Mime-Version: 1.0
-Newsgroups:   rec.games.roguelike.nethack
-X-Mailer:     Mozilla 1.1N (Macintosh; I; 68K)
-
-Hello there, Izchak Miller was my father.  When I was younger I spent 
-many a night, hunched over the keyboard with a cup of tea, playing 
-nethack with him and my brother.  my dad was a philosopher with a strong 
-weakness for fantasy/sci fi.  I remember when he started to get involved 
-with the Nethack team- my brother's Dungeons and Dragons monster book 
-found a regular place beside my dad's desk. it's nice to see him living 
-on in the game he loved so much :-).  
-                                                                  Tamar Miller
-
-The following is a really long word of 5000 characters:
-
-wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww
diff --git a/bignum.c b/bignum.c
index 741fa2d21e..cbcea24818 100644
--- a/bignum.c
+++ b/bignum.c
@@ -2,4083 +2,379 @@
 
   bignum.c -
 
-  $Author$
+  $Author: shyouhei $
+  $Date: 2006/12/06 10:14:12 $
   created at: Fri Jun 10 00:48:55 JST 1994
 
-  Copyright (C) 1993-2007 Yukihiro Matsumoto
+  Copyright (C) 1993-2003 Yukihiro Matsumoto
 
 **********************************************************************/
 
-#include "internal.h"
-#include "ruby/thread.h"
-#include "ruby/util.h"
+#include "ruby.h"
 
-#ifdef HAVE_STRINGS_H
-#include <strings.h>
-#endif
 #include <math.h>
-#include <float.h>
 #include <ctype.h>
 #ifdef HAVE_IEEEFP_H
 #include <ieeefp.h>
 #endif
-#include "ruby_assert.h"
-
-#if defined(HAVE_LIBGMP) && defined(HAVE_GMP_H)
-#define USE_GMP
-#include <gmp.h>
-#endif
-
-#define RB_BIGNUM_TYPE_P(x) RB_TYPE_P((x), T_BIGNUM)
 
-#ifndef RUBY_INTEGER_UNIFICATION
 VALUE rb_cBignum;
-#endif
-const char ruby_digitmap[] = "0123456789abcdefghijklmnopqrstuvwxyz";
-
-#ifndef SIZEOF_BDIGIT_DBL
-# if SIZEOF_INT*2 <= SIZEOF_LONG_LONG
-#  define SIZEOF_BDIGIT_DBL SIZEOF_LONG_LONG
-# else
-#  define SIZEOF_BDIGIT_DBL SIZEOF_LONG
-# endif
-#endif
 
-STATIC_ASSERT(sizeof_bdigit_dbl, sizeof(BDIGIT_DBL) == SIZEOF_BDIGIT_DBL);
-STATIC_ASSERT(sizeof_bdigit_dbl_signed, sizeof(BDIGIT_DBL_SIGNED) == SIZEOF_BDIGIT_DBL);
-STATIC_ASSERT(sizeof_bdigit, SIZEOF_BDIGIT <= sizeof(BDIGIT));
-STATIC_ASSERT(sizeof_bdigit_and_dbl, SIZEOF_BDIGIT*2 <= SIZEOF_BDIGIT_DBL);
-STATIC_ASSERT(bdigit_signedness, 0 < (BDIGIT)-1);
-STATIC_ASSERT(bdigit_dbl_signedness, 0 < (BDIGIT_DBL)-1);
-STATIC_ASSERT(bdigit_dbl_signed_signedness, 0 > (BDIGIT_DBL_SIGNED)-1);
-STATIC_ASSERT(rbignum_embed_len_max, BIGNUM_EMBED_LEN_MAX <= (BIGNUM_EMBED_LEN_MASK >> BIGNUM_EMBED_LEN_SHIFT));
-
-#if SIZEOF_BDIGIT < SIZEOF_LONG
-STATIC_ASSERT(sizeof_long_and_sizeof_bdigit, SIZEOF_LONG % SIZEOF_BDIGIT == 0);
-#else
-STATIC_ASSERT(sizeof_long_and_sizeof_bdigit, SIZEOF_BDIGIT % SIZEOF_LONG == 0);
+#if defined __MINGW32__
+#define USHORT _USHORT
 #endif
 
-#ifdef WORDS_BIGENDIAN
-#   define HOST_BIGENDIAN_P 1
-#else
-#   define HOST_BIGENDIAN_P 0
-#endif
-#define ALIGNOF(type) ((int)offsetof(struct { char f1; type f2; }, f2))
-/* (!LSHIFTABLE(d, n) ? 0 : (n)) is same as n but suppress a warning, C4293, by Visual Studio.  */
-#define LSHIFTABLE(d, n) ((n) < sizeof(d) * CHAR_BIT)
-#define LSHIFTX(d, n) (!LSHIFTABLE(d, n) ? 0 : ((d) << (!LSHIFTABLE(d, n) ? 0 : (n))))
-#define CLEAR_LOWBITS(d, numbits) ((d) & LSHIFTX(~((d)*0), (numbits)))
-#define FILL_LOWBITS(d, numbits) ((d) | (LSHIFTX(((d)*0+1), (numbits))-1))
-#define POW2_P(x) (((x)&((x)-1))==0)
-
-#define BDIGITS(x) (BIGNUM_DIGITS(x))
-#define BITSPERDIG (SIZEOF_BDIGIT*CHAR_BIT)
+#define BDIGITS(x) ((BDIGIT*)RBIGNUM(x)->digits)
+#define BITSPERDIG (SIZEOF_BDIGITS*CHAR_BIT)
 #define BIGRAD ((BDIGIT_DBL)1 << BITSPERDIG)
-#define BIGRAD_HALF ((BDIGIT)(BIGRAD >> 1))
-#define BDIGIT_MSB(d) (((d) & BIGRAD_HALF) != 0)
-#define BIGUP(x) LSHIFTX(((x) + (BDIGIT_DBL)0), BITSPERDIG)
-#define BIGDN(x) RSHIFT((x),BITSPERDIG)
-#define BIGLO(x) ((BDIGIT)((x) & BDIGMAX))
-#define BDIGMAX ((BDIGIT)(BIGRAD-1))
-#define BDIGIT_DBL_MAX (~(BDIGIT_DBL)0)
-
-#if SIZEOF_BDIGIT == 2
-#   define swap_bdigit(x) swap16(x)
-#elif SIZEOF_BDIGIT == 4
-#   define swap_bdigit(x) swap32(x)
-#elif SIZEOF_BDIGIT == 8
-#   define swap_bdigit(x) swap64(x)
-#endif
-
-#define BIGZEROP(x) (BIGNUM_LEN(x) == 0 || \
-		     (BDIGITS(x)[0] == 0 && \
-		      (BIGNUM_LEN(x) == 1 || bigzero_p(x))))
-#define BIGSIZE(x) (BIGNUM_LEN(x) == 0 ? (size_t)0 : \
-    BDIGITS(x)[BIGNUM_LEN(x)-1] ? \
-        (size_t)(BIGNUM_LEN(x)*SIZEOF_BDIGIT - nlz(BDIGITS(x)[BIGNUM_LEN(x)-1])/CHAR_BIT) : \
-    rb_absint_size(x, NULL))
-
-#define BIGDIVREM_EXTRA_WORDS 1
-#define bdigit_roomof(n) roomof(n, SIZEOF_BDIGIT)
-#define BARY_ARGS(ary) ary, numberof(ary)
-
-#define BARY_ADD(z, x, y) bary_add(BARY_ARGS(z), BARY_ARGS(x), BARY_ARGS(y))
-#define BARY_SUB(z, x, y) bary_sub(BARY_ARGS(z), BARY_ARGS(x), BARY_ARGS(y))
-#define BARY_SHORT_MUL(z, x, y) bary_short_mul(BARY_ARGS(z), BARY_ARGS(x), BARY_ARGS(y))
-#define BARY_DIVMOD(q, r, x, y) bary_divmod(BARY_ARGS(q), BARY_ARGS(r), BARY_ARGS(x), BARY_ARGS(y))
-#define BARY_ZERO_P(x) bary_zero_p(BARY_ARGS(x))
-
-#define BIGNUM_SET_NEGATIVE_SIGN(b) BIGNUM_SET_SIGN(b, 0)
-#define BIGNUM_SET_POSITIVE_SIGN(b) BIGNUM_SET_SIGN(b, 1)
-
-#define bignew(len,sign) bignew_1(rb_cInteger,(len),(sign))
-
-#define BDIGITS_ZERO(ptr, n) do { \
-  BDIGIT *bdigitz_zero_ptr = (ptr); \
-  size_t bdigitz_zero_n = (n); \
-  while (bdigitz_zero_n) { \
-    *bdigitz_zero_ptr++ = 0; \
-    bdigitz_zero_n--; \
-  } \
-} while (0)
-
-#define BARY_TRUNC(ds, n) do { \
-        while (0 < (n) && (ds)[(n)-1] == 0) \
-            (n)--; \
-    } while (0)
-
-#define KARATSUBA_BALANCED(xn, yn) ((yn)/2 < (xn))
-#define TOOM3_BALANCED(xn, yn) (((yn)+2)/3 * 2 < (xn))
-
-#define GMP_MUL_DIGITS 20
-#define KARATSUBA_MUL_DIGITS 70
-#define TOOM3_MUL_DIGITS 150
-
-#define GMP_DIV_DIGITS 20
-#define GMP_BIG2STR_DIGITS 20
-#define GMP_STR2BIG_DIGITS 20
-
-typedef void (mulfunc_t)(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn, BDIGIT *wds, size_t wn);
-
-static mulfunc_t bary_mul_toom3_start;
-static mulfunc_t bary_mul_karatsuba_start;
-static BDIGIT bigdivrem_single(BDIGIT *qds, const BDIGIT *xds, size_t xn, BDIGIT y);
-static void bary_divmod(BDIGIT *qds, size_t qn, BDIGIT *rds, size_t rn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn);
-
-static VALUE bigmul0(VALUE x, VALUE y);
-static void bary_mul_toom3(BDIGIT *zds, size_t zn, const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn, BDIGIT *wds, size_t wn);
-static VALUE bignew_1(VALUE klass, size_t len, int sign);
-static inline VALUE bigtrunc(VALUE x);
-
-static VALUE bigsq(VALUE x);
-static void bigdivmod(VALUE x, VALUE y, volatile VALUE *divp, volatile VALUE *modp);
-static inline VALUE power_cache_get_power(int base, int power_level, size_t *numdigits_ret);
-
-#if SIZEOF_BDIGIT <= SIZEOF_INT
-static int nlz(BDIGIT x) { return nlz_int((unsigned int)x) - (SIZEOF_INT-SIZEOF_BDIGIT) * CHAR_BIT; }
-#elif SIZEOF_BDIGIT <= SIZEOF_LONG
-static int nlz(BDIGIT x) { return nlz_long((unsigned long)x) - (SIZEOF_LONG-SIZEOF_BDIGIT) * CHAR_BIT; }
-#elif SIZEOF_BDIGIT <= SIZEOF_LONG_LONG
-static int nlz(BDIGIT x) { return nlz_long_long((unsigned LONG_LONG)x) - (SIZEOF_LONG_LONG-SIZEOF_BDIGIT) * CHAR_BIT; }
-#elif SIZEOF_BDIGIT <= SIZEOF_INT128_T
-static int nlz(BDIGIT x) { return nlz_int128((uint128_t)x) - (SIZEOF_INT128_T-SIZEOF_BDIGIT) * CHAR_BIT; }
-#endif
-
-#define U16(a) ((uint16_t)(a))
-#define U32(a) ((uint32_t)(a))
-#ifdef HAVE_UINT64_T
-#define U64(a,b) (((uint64_t)(a) << 32) | (b))
-#endif
-#ifdef HAVE_UINT128_T
-#define U128(a,b,c,d) (((uint128_t)U64(a,b) << 64) | U64(c,d))
-#endif
-
-/* The following script, maxpow.rb, generates the tables follows.
-
-def big(n, bits)
-  ns = []
-  ((bits+31)/32).times {
-    ns << sprintf("0x%08x", n & 0xffff_ffff)
-    n >>= 32
-  }
-  "U#{bits}(" + ns.reverse.join(",") + ")"
-end
-def values(ary, width, indent)
-  lines = [""]
-  ary.each {|e|
-    lines << "" if !ary.last.empty? && width < (lines.last + e + ", ").length
-    lines.last << e + ", "
-  }
-  lines.map {|line| " " * indent + line.chomp(" ") + "\n" }.join
-end
-[16,32,64,128].each {|bits|
-  max = 2**bits-1
-  exps = []
-  nums = []
-  2.upto(36) {|base|
-    exp = 0
-    n = 1
-    while n * base <= max
-      exp += 1
-      n *= base
-    end
-    exps << exp.to_s
-    nums << big(n, bits)
-  }
-  puts "#ifdef HAVE_UINT#{bits}_T"
-  puts "static const int maxpow#{bits}_exp[35] = {"
-  print values(exps, 70, 4)
-  puts "};"
-  puts "static const uint#{bits}_t maxpow#{bits}_num[35] = {"
-  print values(nums, 70, 4)
-  puts "};"
-  puts "#endif"
-}
-
- */
-
-#if SIZEOF_BDIGIT_DBL == 2
-static const int maxpow16_exp[35] = {
-    15, 10, 7, 6, 6, 5, 5, 5, 4, 4, 4, 4, 4, 4, 3, 3, 3, 3, 3, 3, 3, 3,
-    3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3,
-};
-static const uint16_t maxpow16_num[35] = {
-    U16(0x00008000), U16(0x0000e6a9), U16(0x00004000), U16(0x00003d09),
-    U16(0x0000b640), U16(0x000041a7), U16(0x00008000), U16(0x0000e6a9),
-    U16(0x00002710), U16(0x00003931), U16(0x00005100), U16(0x00006f91),
-    U16(0x00009610), U16(0x0000c5c1), U16(0x00001000), U16(0x00001331),
-    U16(0x000016c8), U16(0x00001acb), U16(0x00001f40), U16(0x0000242d),
-    U16(0x00002998), U16(0x00002f87), U16(0x00003600), U16(0x00003d09),
-    U16(0x000044a8), U16(0x00004ce3), U16(0x000055c0), U16(0x00005f45),
-    U16(0x00006978), U16(0x0000745f), U16(0x00008000), U16(0x00008c61),
-    U16(0x00009988), U16(0x0000a77b), U16(0x0000b640),
-};
-#elif SIZEOF_BDIGIT_DBL == 4
-static const int maxpow32_exp[35] = {
-    31, 20, 15, 13, 12, 11, 10, 10, 9, 9, 8, 8, 8, 8, 7, 7, 7, 7, 7, 7,
-    7, 7, 6, 6, 6, 6, 6, 6, 6, 6, 6, 6, 6, 6, 6,
-};
-static const uint32_t maxpow32_num[35] = {
-    U32(0x80000000), U32(0xcfd41b91), U32(0x40000000), U32(0x48c27395),
-    U32(0x81bf1000), U32(0x75db9c97), U32(0x40000000), U32(0xcfd41b91),
-    U32(0x3b9aca00), U32(0x8c8b6d2b), U32(0x19a10000), U32(0x309f1021),
-    U32(0x57f6c100), U32(0x98c29b81), U32(0x10000000), U32(0x18754571),
-    U32(0x247dbc80), U32(0x3547667b), U32(0x4c4b4000), U32(0x6b5a6e1d),
-    U32(0x94ace180), U32(0xcaf18367), U32(0x0b640000), U32(0x0e8d4a51),
-    U32(0x1269ae40), U32(0x17179149), U32(0x1cb91000), U32(0x23744899),
-    U32(0x2b73a840), U32(0x34e63b41), U32(0x40000000), U32(0x4cfa3cc1),
-    U32(0x5c13d840), U32(0x6d91b519), U32(0x81bf1000),
-};
-#elif SIZEOF_BDIGIT_DBL == 8 && defined HAVE_UINT64_T
-static const int maxpow64_exp[35] = {
-    63, 40, 31, 27, 24, 22, 21, 20, 19, 18, 17, 17, 16, 16, 15, 15, 15,
-    15, 14, 14, 14, 14, 13, 13, 13, 13, 13, 13, 13, 12, 12, 12, 12, 12,
-    12,
-};
-static const uint64_t maxpow64_num[35] = {
-    U64(0x80000000,0x00000000), U64(0xa8b8b452,0x291fe821),
-    U64(0x40000000,0x00000000), U64(0x6765c793,0xfa10079d),
-    U64(0x41c21cb8,0xe1000000), U64(0x36427987,0x50226111),
-    U64(0x80000000,0x00000000), U64(0xa8b8b452,0x291fe821),
-    U64(0x8ac72304,0x89e80000), U64(0x4d28cb56,0xc33fa539),
-    U64(0x1eca170c,0x00000000), U64(0x780c7372,0x621bd74d),
-    U64(0x1e39a505,0x7d810000), U64(0x5b27ac99,0x3df97701),
-    U64(0x10000000,0x00000000), U64(0x27b95e99,0x7e21d9f1),
-    U64(0x5da0e1e5,0x3c5c8000), U64(0xd2ae3299,0xc1c4aedb),
-    U64(0x16bcc41e,0x90000000), U64(0x2d04b7fd,0xd9c0ef49),
-    U64(0x5658597b,0xcaa24000), U64(0xa0e20737,0x37609371),
-    U64(0x0c29e980,0x00000000), U64(0x14adf4b7,0x320334b9),
-    U64(0x226ed364,0x78bfa000), U64(0x383d9170,0xb85ff80b),
-    U64(0x5a3c23e3,0x9c000000), U64(0x8e651373,0x88122bcd),
-    U64(0xdd41bb36,0xd259e000), U64(0x0aee5720,0xee830681),
-    U64(0x10000000,0x00000000), U64(0x172588ad,0x4f5f0981),
-    U64(0x211e44f7,0xd02c1000), U64(0x2ee56725,0xf06e5c71),
-    U64(0x41c21cb8,0xe1000000),
-};
-#elif SIZEOF_BDIGIT_DBL == 16 && defined HAVE_UINT128_T
-static const int maxpow128_exp[35] = {
-    127, 80, 63, 55, 49, 45, 42, 40, 38, 37, 35, 34, 33, 32, 31, 31, 30,
-    30, 29, 29, 28, 28, 27, 27, 27, 26, 26, 26, 26, 25, 25, 25, 25, 24,
-    24,
-};
-static const uint128_t maxpow128_num[35] = {
-    U128(0x80000000,0x00000000,0x00000000,0x00000000),
-    U128(0x6f32f1ef,0x8b18a2bc,0x3cea5978,0x9c79d441),
-    U128(0x40000000,0x00000000,0x00000000,0x00000000),
-    U128(0xd0cf4b50,0xcfe20765,0xfff4b4e3,0xf741cf6d),
-    U128(0x6558e2a0,0x921fe069,0x42860000,0x00000000),
-    U128(0x5080c7b7,0xd0e31ba7,0x5911a67d,0xdd3d35e7),
-    U128(0x40000000,0x00000000,0x00000000,0x00000000),
-    U128(0x6f32f1ef,0x8b18a2bc,0x3cea5978,0x9c79d441),
-    U128(0x4b3b4ca8,0x5a86c47a,0x098a2240,0x00000000),
-    U128(0xffd1390a,0x0adc2fb8,0xdabbb817,0x4d95c99b),
-    U128(0x2c6fdb36,0x4c25e6c0,0x00000000,0x00000000),
-    U128(0x384bacd6,0x42c343b4,0xe90c4272,0x13506d29),
-    U128(0x31f5db32,0xa34aced6,0x0bf13a0e,0x00000000),
-    U128(0x20753ada,0xfd1e839f,0x53686d01,0x3143ee01),
-    U128(0x10000000,0x00000000,0x00000000,0x00000000),
-    U128(0x68ca11d6,0xb4f6d1d1,0xfaa82667,0x8073c2f1),
-    U128(0x223e493b,0xb3bb69ff,0xa4b87d6c,0x40000000),
-    U128(0xad62418d,0x14ea8247,0x01c4b488,0x6cc66f59),
-    U128(0x2863c1f5,0xcdae42f9,0x54000000,0x00000000),
-    U128(0xa63fd833,0xb9386b07,0x36039e82,0xbe651b25),
-    U128(0x1d1f7a9c,0xd087a14d,0x28cdf3d5,0x10000000),
-    U128(0x651b5095,0xc2ea8fc1,0xb30e2c57,0x77aaf7e1),
-    U128(0x0ddef20e,0xff760000,0x00000000,0x00000000),
-    U128(0x29c30f10,0x29939b14,0x6664242d,0x97d9f649),
-    U128(0x786a435a,0xe9558b0e,0x6aaf6d63,0xa8000000),
-    U128(0x0c5afe6f,0xf302bcbf,0x94fd9829,0xd87f5079),
-    U128(0x1fce575c,0xe1692706,0x07100000,0x00000000),
-    U128(0x4f34497c,0x8597e144,0x36e91802,0x00528229),
-    U128(0xbf3a8e1d,0x41ef2170,0x7802130d,0x84000000),
-    U128(0x0e7819e1,0x7f1eb0fb,0x6ee4fb89,0x01d9531f),
-    U128(0x20000000,0x00000000,0x00000000,0x00000000),
-    U128(0x4510460d,0xd9e879c0,0x14a82375,0x2f22b321),
-    U128(0x91abce3c,0x4b4117ad,0xe76d35db,0x22000000),
-    U128(0x08973ea3,0x55d75bc2,0x2e42c391,0x727d69e1),
-    U128(0x10e425c5,0x6daffabc,0x35c10000,0x00000000),
-};
-#endif
-
-static BDIGIT_DBL
-maxpow_in_bdigit_dbl(int base, int *exp_ret)
-{
-    BDIGIT_DBL maxpow;
-    int exponent;
-
-    assert(2 <= base && base <= 36);
-
-    {
-#if SIZEOF_BDIGIT_DBL == 2
-        maxpow = maxpow16_num[base-2];
-        exponent = maxpow16_exp[base-2];
-#elif SIZEOF_BDIGIT_DBL == 4
-        maxpow = maxpow32_num[base-2];
-        exponent = maxpow32_exp[base-2];
-#elif SIZEOF_BDIGIT_DBL == 8 && defined HAVE_UINT64_T
-        maxpow = maxpow64_num[base-2];
-        exponent = maxpow64_exp[base-2];
-#elif SIZEOF_BDIGIT_DBL == 16 && defined HAVE_UINT128_T
-        maxpow = maxpow128_num[base-2];
-        exponent = maxpow128_exp[base-2];
-#else
-        maxpow = base;
-        exponent = 1;
-        while (maxpow <= BDIGIT_DBL_MAX / base) {
-            maxpow *= base;
-            exponent++;
-        }
-#endif
-    }
-
-    *exp_ret = exponent;
-    return maxpow;
-}
-
-static inline BDIGIT_DBL
-bary2bdigitdbl(const BDIGIT *ds, size_t n)
-{
-    assert(n <= 2);
-
-    if (n == 2)
-        return ds[0] | BIGUP(ds[1]);
-    if (n == 1)
-        return ds[0];
-    return 0;
-}
-
-static inline void
-bdigitdbl2bary(BDIGIT *ds, size_t n, BDIGIT_DBL num)
-{
-    assert(n == 2);
-
-    ds[0] = BIGLO(num);
-    ds[1] = (BDIGIT)BIGDN(num);
-}
-
-static int
-bary_cmp(const BDIGIT *xds, size_t xn, const BDIGIT *yds, size_t yn)
-{
-    BARY_TRUNC(xds, xn);
-    BARY_TRUNC(yds, yn);
-
-    if (xn < yn)
-        return -1;
-    if (xn > yn)
-        return 1;
-
-    while (xn-- && xds[xn] == yds[xn])
-        ;
-    if (xn == (size_t)-1)
-        return 0;
-    return xds[xn] < yds[xn] ? -1 : 1;
-}
-
-static BDIGIT
-bary_small_lshift(BDIGIT *zds, const BDIGIT *xds, size_t n, int shift)
-{
-    size_t i;
-    BDIGIT_DBL num = 0;
-    assert(0 <= shift && shift < BITSPERDIG);
-
-    for (i=0; i<n; i++) {
-	num = num | (BDIGIT_DBL)*xds++ << shift;
-	*zds++ = BIGLO(num);
-	num = BIGDN(num);
-    }
-    return BIGLO(num);
-}
-
-static void
-bary_small_rshift(BDIGIT *zds, const BDIGIT *xds, size_t n, int shift, BDIGIT higher_bdigit)
-{
-    BDIGIT_DBL num = 0;
-    BDIGIT x;
-
-    assert(0 <= shift && shift < BITSPERDIG);
-
-    num = BIGUP(higher_bdigit);
-    while (n--) {
-	num = (num | xds[n]) >> shift;
-        x = xds[n];
-	zds[n] = BIGLO(num);
-	num = BIGUP(x);
-    }
-}
-
-static int
-bary_zero_p(BDIGIT *xds, size_t xn)
-{
-    if (xn == 0)
-        return 1;
-    do {
-	if (xds[--xn]) return 0;
-    } while (xn);
-    return 1;
-}
-
-static void
-bary_neg(BDIGIT *ds, size_t n)